Details from NCBI annotation

Gene Name Heterocephalus glaber isolate NMR 29 unplaced genomic scaffold, HetGla_female_1.0 scaffold00001, whole genome shotgun sequence

Genome Location

Related Sequences

XM_004833894.1 Coding sequence

G3bp2 GTPase activating protein (SH3 domain) binding protein 2, transcript variant X2

Length: 1449 bp    Location: 130339..201938   Strand: +
>XM_004833894.1
ATGGTTATGGAGAAGCCCAGCCCGCTGCTGGTGGGGCGGGAGTTCGTGAGGCAGTATTATACTTTGCTGAATAAAGCACCAGAATACTTACACAGGTTTTATGGCAGGAATTCTTCCTATGTTCATGGAGGAGTGGATGCCAGTGGAAAGCCCCAGGAAGCTGTTTATGGCCAAAATGACATACACCACAAAGTGTTATCTCTGAACTTCAGTGAATGCCATACAAAGATCCGCCATGTGGATGCACATGCCACCTTGAGTGACGGAGTTGTTGTCCAAGTCATGGGCCTGCTGTCTAATAGTGGGCAGCCAGAAAGGAAATTCATGCAGACTTTTGTTTTGGCTCCAGAAGGGTCTGTTCCAAATAAATTTTATGTTCACAATGATATGTTTCGTTATGAAGATGAAGTATTTGGTGATTCTGAACCAGAACTTGATGAAGAATCAGAAGATGAAGTGGAAGAGGAGCAAGAAGAAAGACAACCATCTCCTGAACCTGTGCAAGAAAATGCTAATAGTGGTTACTATGAAGCTCACCCTGTGACTAACGGCATAGAAGAGCCTTTGGAAGAATCCTCTCATGAACCTGAACCTGAGCCCGAATCTGAAACAAAGACTGAAGAGTTGAAACCACAAGTGGAGGAGAAGAATTTAGAAGAACTGGAGGAGAAGTCTACTACTCCTCCCCCTGCAGAGCCTGTTTCTCTGCCCCAAGAACCACCAAAGGCTTTCTCCTGGGCTTCAGTGACCAGTAAAAACCTGCCTCCTAGTGGTACTGTTTCTTCCTCTGGAATTCCACCCCATGTTAAAGCACCAGTCTCACAGCCAAGAGTTGAAGCTAAGCCAGAAGTTCAGTCTCAGCCACCACGTGTGCGTGAACAACGCCCTAGAGAGCGACCTGGTTTCCCTCCTAGAGGACCAAGACCAGGCAGGGGAGATATGGAACAGAATGACTCTGACAACCGTAGAATAATTCGCTACCCAGACAGTCATCAGCTTTTTGTTGGTAACTTGCCACATGATATTGATGAAAATGAACTGAAAGAGTTCTTTATGAGTTTTGGAAACGTTGTGGAACTTCGCATCAATACCAAGGGTGTTGGGGGAAAGCTTCCAAATTTTGGTTTTGTGGTTTTTGATGACTCTGAACCAGTTCAGAGAATCTTAATTGCAAAACCAATTATGTTCCGAGGAGAAGTGCGTTTAAATGTAGAAGAGAAAAAAACGAGAGCTGCAAGAGAGCGAGAAACCAGAGGTGGTGGTGATGATCGCAGAGATATCAGGCGCAACGACCGGGGTCCTGGTGGCCCACGTGGCCTCGTGGGCGGTGGGATGATGCGTGACCGAGATGGAAGAGGGCCTCCTCCAAGAGGTGGCATGGCACAGAAACTGGGCTCCGGAAGAGGCGCTGGGCAGATGGAAGGCCGCTTCACAGGACAGCGGCGCTGA

XM_004833898.1 Coding sequence

Cdkl2 cyclin-dependent kinase-like 2 (CDC2-related kinase), transcript variant X2

Length: 1683 bp    Location: 219727..277898   Strand: +
>XM_004833898.1
ATGGAAAAATATGAGAACCTAGGATTGGTTGGAGAAGGAAGCTACGGAATGGTGATGAAGTGTAGGGATAAAGAGAGTGGAAGGATTGTGGCCATCAAGAAGTTCTTAGAAAGTGACAATGACAAAATGGTTAAAAAAATTGCCATGCGAGAGATCAAGTTACTGAAGCAACTGAGGCATGAGAATTTGGTGAATCTGTTGGAAGTGTGTAAGAAGAAAAAAAGATGGTACCTGGTCTTTGAATTTGTTGACCACACAATTCTTGATGACTTGGAACTCTTTCCAAATGGACTAGACTACCAAGTAGTCCAAAAATATTTATTTCAGATTATTAATGGAATTGGCTTTTGTCACAGTCATAATATCATACACAGGGACATAAAGCCAGAGAACATTTTGGTGTCCCAGGCTGGTGTGGTGAAGCTGTGTGACTTTGGGTTTGCGCGAACATTGGCTGCTCCCGGGGAGGCCTACACTGACTATGTGGCCACCCGGTGGTACAGGGCACCTGAGCTGCTGGTCGGAGATGTCAAGTATGGCAAGGCTGTTGATGTCTGGGCCATCGGTTGTTTGGTAACCGAGATGCTCACAGGGGAGCCACTGTTTCCGGGAGATTCTGACATTGACCAGCTCTACCATATTATGATGTGTTTAGGTAATTTAATTCCAAGACACCAGGAGCTGTTTTATAAAAATCCTGTGTTTGCTGGAGTACAATTGCCTGAAATCCAGGAAAAAGAGCCTCTTGAAAGACGCTACCCTAAGCTCTCTGAAGTTGTGACAGATTTAACAAAGAAATGCTTACATGTTGACCCCGACAAAAGGCCACTGTGTGCCGAGCTCCTGCACCACGCCTTCTTCCAAATGGACGGGTTTGCTGAGAGATTCTCCAGGGAACTACAGCTAAAAATACAGAAAGATGCCAGGAATATTTCTTTGCCTAAAAAATCCCAAAGCAGAAAGAAGGAAAAGGAAAAAGATGAATCTTTAGGTGAAGAAAGAAAAACACTTGTGGTACAGGATACCAATGCTGATACCAAAATTAAGGATTCCAAAGTATTTAAAACAAAAGCATCAAAAGTTGATGGAGAGAAAACTGAAAAGGGCACTAGAGCTTCCAATGCCAGCTGTCTTCGTACCAGTGGGACAAGACACATCCCGGCAGTGCCCTCAGGCTGCCTTGGGGACCACGGCAGCCAGGCCACCAGGGTCCCTGGGGTGGCCATCCCCCCGCTGGTGCACACTCCCTCTGCAGCAGCTCCTGGCAGTAACCCTGGAGTCCAGAGTTACAGAGTGGATGAGAAAACTAAGAAGTATTGCATTCCATTTGTTAAACCAAATAAACACTCTCCATCAGGAATTTATAATAATGTGCCCACATTGCAGGTCTCCAGTGAGAAGAACCTCCTTCAGGCAAATAAGAAGCGAGGGGAACATGCCAAGACAGAGGTGCGGTTGCCTGAACTGAGCTACCGTCATCTCCCTGAACTGAAAGCCCTGGAAGGCATGGCTCGAAATTCTAGACTAATAAAGAAAGAGAACAAAATTCTTCCCGAATCACGAATACCTTCTCTGGCTGCTATTGACCTTCACGCCTCCAGCATGGTGTTGAACCAGGTATTAGGATCACCCCTGTCAGATGACACGGAGGCTGATTTCCCCCAGGTGGAGCACCAGCACTGA

XM_004835130.1 Coding sequence

LOC101699016 chromosome unknown open reading frame, human C4orf26

Length: 447 bp    Location: 298311..292799   Strand: -
>XM_004835130.1
ATGGCACGCAGGCTCTGCTGCTCTCGCTGGGCACTGCTCTACTGGCTGGCGGCATCCGTGGCACAAGGAGCGGAAGGGTTGGCCACCCCTCCTGGACGTGCACAGCACAATGCCAACCCTACGGACTGTCAGATCTTCACCCTCACCCCGCCACCCGCCACAAGAAGCCCGGTGACCCGGCCCCAGCCCATCACGAGGACACCCAGACACCCCTTGCTCTTCTTCCCACAGTGGCCCAGGGTCCCCCCCAGATTCCCAGGCAGACCTTTCTTCCCTCCAGGTTGCGGCCGCCGCTTCCCATGGCAGCCGTGGTTCTGGCCACACCGCTGCCTGGCCCCGGGGCGATGTTTCCTGGGGACAGAGCTCCTCGGGGGAAGCTCGTCGTCGGAGGAGAGCAGGAAGAAGAGAAGCCTGAGCTTGAGGAGCAGGGGGAGACCTTGCCTCTGA

XM_004833899.1 Coding sequence

Cdkl2 cyclin-dependent kinase-like 2 (CDC2-related kinase), transcript variant X3

High confidence: 4 potential gene matches
Length: 1680 bp    Location: 219727..277898   Strand: +
>XM_004833899.1
ATGGAAAAATATGAGAACCTAGGATTGGTTGGAGAAGGAAGCTACGGAATGGTGATGAAGTGTAGGGATAAAGAGAGTGGAAGGATTGTGGCCATCAAGAAGTTCTTAGAAAGTGACAATGACAAAATGGTTAAAAAAATTGCCATGCGAGAGATCAAGTTACTGAAGCAACTGAGGCATGAGAATTTGGTGAATCTGTTGGAAGTGTGTAAGAAGAAAAAAAGATGGTACCTGGTCTTTGAATTTGTTGACCACACAATTCTTGATGACTTGGAACTCTTTCCAAATGGACTAGACTACCAAGTAGTCCAAAAATATTTATTTCAGATTATTAATGGAATTGGCTTTTGTCACAGTCATAATATCATACACAGGGACATAAAGCCAGAGAACATTTTGGTGTCCCAGGCTGGTGTGGTGAAGCTGTGTGACTTTGGGTTTGCGCGAACATTGGCTGCTCCCGGGGAGGCCTACACTGACTATGTGGCCACCCGGTGGTACAGGGCACCTGAGCTGCTGGTCGGAGATGTCAAGTATGGCAAGGCTGTTGATGTCTGGGCCATCGGTTGTTTGGTAACCGAGATGCTCACAGGGGAGCCACTGTTTCCGGGAGATTCTGACATTGACCAGCTCTACCATATTATGATGTGTTTAGGTAATTTAATTCCAAGACACCAGGAGCTGTTTTATAAAAATCCTGTGTTTGCTGGAGTACAATTGCCTGAAATCCAGGAAAAAGAGCCTCTTGAAAGACGCTACCCTAAGCTCTCTGAAGTTGTGACAGATTTAACAAAGAAATGCTTACATGTTGACCCCGACAAAAGGCCACTGTGTGCCGAGCTCCTGCACCACGCCTTCTTCCAAATGGACGGGTTTGCTGAGAGATTCTCCAGGGAACTACAGCTAAAAATACAGAAAGATGCCAGGAATATTTCTTTGCCTAAAAAATCCCAAAGCAGAAAGAAGGAAAAGGAAAAAGATGAATCTTTAGGTGAAGAAAGAAAAACACTTGTGGTACAGGATACCAATGCTGATACCAAAATTAAGGATTCCAAAGTATTTAAAACAAAAGCATCAAAAGTTGATGGAGAGAAAACTGAAAAGGGCACTAGAGCTTCCAATGCCAGCTGTCTTCGTACCAGTGGGACAAGACACATCCCGGCAGTGCCCTCAGGCTGCCTTGGGGACCACGGCAGCCAGGCCACCAGGGTCCCTGGGGTGGCCATCCCCCCGCTGGTGCACACTCCCTCTGCAGCAGCTCCTGGCAGTAACCCTGGAGTCCAGAGTTACAGAGTGGATGAGAAAACTAAGAAGTATTGCATTCCATTTGTTAAACCAAATAAACACTCTCCATCAGGAATTTATAATAATGTGCCCACATTGGTCTCCAGTGAGAAGAACCTCCTTCAGGCAAATAAGAAGCGAGGGGAACATGCCAAGACAGAGGTGCGGTTGCCTGAACTGAGCTACCGTCATCTCCCTGAACTGAAAGCCCTGGAAGGCATGGCTCGAAATTCTAGACTAATAAAGAAAGAGAACAAAATTCTTCCCGAATCACGAATACCTTCTCTGGCTGCTATTGACCTTCACGCCTCCAGCATGGTGTTGAACCAGGTATTAGGATCACCCCTGTCAGATGACACGGAGGCTGATTTCCCCCAGGTGGAGCACCAGCACTGA

XM_004833906.1 Coding sequence

Thap6 THAP domain containing 6, transcript variant X4

Length: 546 bp    Location: 322244..311525   Strand: -
>XM_004833906.1
ATGGTGAAATGCTGCTCAGCCATCGGATGCGCCTCTCGCTGTCTACCCAATTCCAAGTTGAAAGGGCTGACCTTCCACGCATTCCCCACAGATGAAAATGTCAAAAGAAAATGGGTATTAGCAATGAAAAGACTTGATGTGAATTCTGCAGGTATGTGGGAGCCTAAAAAAGGAGATGTGTTGTGTTCAAGGCACTTTAAGAAGACAGATTTTGACAGAAGTGCTCCAAATCTTAAACTAAAACCAGGAGTCATCCCGTCTATATTTGATTCCCCATACCACTTACAGGAACACAGCTACAGTGTAATGGACAGTCCAAAGAAACTCAAGCATAAGTTAGATCATGTGATCAGCCAGCTAGAGGATACCCAGGAAAGTCTGCGCAGTGTTCTAGACCGAGAAAAGCATTTCCAAAAATCACTGAGGAAGACAATCAGGAACTTGAAGGATGAATGTCTCATCAGCCAAGAAACAGCAGAGAGACTGGATGCATTCTGCTGGGAGCCTCCTCAGGAGGCCACAGAGCATGACTGTTCCTCGAGGTAG

XM_004833903.1 Coding sequence

Thap6 THAP domain containing 6, transcript variant X1

Length: 672 bp    Location: 322244..311525   Strand: -
>XM_004833903.1
ATGGTGAAATGCTGCTCAGCCATCGGATGCGCCTCTCGCTGTCTACCCAATTCCAAGTTGAAAGGGCTGACCTTCCACGCATTCCCCACAGATGAAAATGTCAAAAGAAAATGGGTATTAGCAATGAAAAGACTTGATGTGAATTCTGCAGGTATGTGGGAGCCTAAAAAAGGAGATGTGTTGTGTTCAAGGCACTTTAAGAAGACAGATTTTGACAGAAGTGCTCCAAATCTTAAACTAAAACCAGGAGTCATCCCGTCTATATTTGATTCCCCATACCACTTACAGGACAAAAAAGAAAAGCTTCATTGTAGAAAAAACTTCACCCTCAAAACCCTTCCAGTCACAAAGCACAACCACCAGCTCGTTGGTGCTTCCTCATATACTGAAGAATTCCAATCCCAGTTCATTTTTGAACACAGCTACAGTGTAATGGACAGTCCAAAGAAACTCAAGCATAAGTTAGATCATGTGATCAGCCAGCTAGAGGATACCCAGGAAAGTCTGCGCAGTGTTCTAGACCGAGAAAAGCATTTCCAAAAATCACTGAGGAAGACAATCAGGAACTTGAAGGATGAATGTCTCATCAGCCAAGAAACAGCAGAGAGACTGGATGCATTCTGCTGGGAGCCTCCTCAGGAGGCCACAGAGCATGACTGTTCCTCGAGGTAG

XM_004833904.1 Coding sequence

Thap6 THAP domain containing 6, transcript variant X2

Length: 672 bp    Location: 322042..311525   Strand: -
>XM_004833904.1
ATGGTGAAATGCTGCTCAGCCATCGGATGCGCCTCTCGCTGTCTACCCAATTCCAAGTTGAAAGGGCTGACCTTCCACGCATTCCCCACAGATGAAAATGTCAAAAGAAAATGGGTATTAGCAATGAAAAGACTTGATGTGAATTCTGCAGGTATGTGGGAGCCTAAAAAAGGAGATGTGTTGTGTTCAAGGCACTTTAAGAAGACAGATTTTGACAGAAGTGCTCCAAATCTTAAACTAAAACCAGGAGTCATCCCGTCTATATTTGATTCCCCATACCACTTACAGGACAAAAAAGAAAAGCTTCATTGTAGAAAAAACTTCACCCTCAAAACCCTTCCAGTCACAAAGCACAACCACCAGCTCGTTGGTGCTTCCTCATATACTGAAGAATTCCAATCCCAGTTCATTTTTGAACACAGCTACAGTGTAATGGACAGTCCAAAGAAACTCAAGCATAAGTTAGATCATGTGATCAGCCAGCTAGAGGATACCCAGGAAAGTCTGCGCAGTGTTCTAGACCGAGAAAAGCATTTCCAAAAATCACTGAGGAAGACAATCAGGAACTTGAAGGATGAATGTCTCATCAGCCAAGAAACAGCAGAGAGACTGGATGCATTCTGCTGGGAGCCTCCTCAGGAGGCCACAGAGCATGACTGTTCCTCGAGGTAG

XM_004833902.1 Coding sequence

Rchy1 ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase, transcript variant X3

High confidence: 4 potential gene matches
Length: 645 bp    Location: 322406..340573   Strand: +
>XM_004833902.1
ATGGCGGCGACTGCGTGCGAGACAAGGCGGCGGGGCTGCGAACACTATGACCGCGGGTGCCTGCTGAAGGCCCAACAGTCTTGTGAGGAATGTAGCACATTGTTTGGAGAATATTACTGCAGTATATGCCATCTGTTTGACAAAGATAAGAAGCAGTATCATTGTGAAAACTGTGGAATTTGTAGGATTGGTCCCAAGGAAGATTTTTTCCACTGTTTGAAATGTAACTTATGCCTAGCTATGAATCTTCAAGGAAAACATAAGTGTATTGAAAATGTTTCTCGGCAGAATTGTCCAATATGTTTGGAGGACATTCATACATCCCGTGTTGTTGCTCATGTCTTGCCATGTGGACATCTTTTACATAGAACGTGTTATGAAGAAATGTTGAAAAAAGGCTACCGGTGTCCGTTGTGCATGCACTCTGCCTTAGATATGACTTGGTACTGGAGACAGCTGGATAATGAGGTGGCACAGACTCCTATGCCGTCAGAATATCAGAACATGACTGTGGATATTCTCTGCAATGACTGCAATGGACGATCCACAGTCCAGTTCCATATTTTGGGCATGAAATGTCAGAATTGTGACTCTTACAATACTGCTCAAGCTGGAGGGCGTAGAATTTCACTGGATCAGCAATGA

XM_004835134.1 Coding sequence

Ereg epiregulin

High confidence: 4 potential gene matches
Length: 468 bp    Location: 1349638..1339518   Strand: -
>XM_004835134.1
ATGGCCCGGCTGGCGACATTGCTCTTGGGTTTCCATCTTCTACAATTGATTCTCAGCACAACTGTGATTCCGTCCTGCATCCCAGGAGAATCTGACAATAACTGTACAGCTTTAGTCCAGATGGAGGACAGCCCGCGTGTGGCTCAAGTGTCTATCACAAAGTGTGCCTCTGACATGCAGGGCTACTGTCTGCACGGGCAGTGCATCTACTTGGTGGACATGAGCGAGAATTACTGCAGATGTGATGTGGGGTACACGGGTGTCCGATGTGAACACTTCTTCTTAACTGTCCACCAACCCTTGAGCAAAGAATATGTGGCTCTTACTGTAATTCTTGTCATCTTGACTTTGGTCATCGTTGCTGGTTCCATATACTATTTCTGCAGATGGTACAGAAATCAGAAAAGTAAAGAGTCTAAGGAGTATGAGAGAGTGACCTTGGGGGAGCCAGCACTGCCCCACGTCTGA

XM_004835132.1 Coding sequence

Parm1 prostate androgen-regulated mucin-like protein 1

High confidence: 3 potential gene matches
Length: 1026 bp    Location: 763737..699564   Strand: -
>XM_004835132.1
ATGATTCCAGAACGTCCTGACCTGGACACAGCTGACAGTAGCTTCTATGCCAATGTGGATGCCTATGGGAAATTCCTGGCACTGTTTTCCCTCAGGGCCAGCCGCCAGTGGCCGGGTGTCACCTGCTTCTGTCGCCGCTCTGTGGGTTCCCCTACTAACCCCTGTGCTGTCTCCTTCACAGGACTGAGGGCACAGAGCGGGCCAACCTTACCTGTTTCTCTTCCGGCCAAAGCCACCTCCCTGGCTGCCCTCGGGACCAGCTCTGCATCAAGCCCTGCTGTTCCCACAATGTCCCTGGCCAGCAGCACTCAGGATGCCTTGGGACTCCCTGTCACCACAGCGGCCACACTGACACTGCTCCCCAAGAACACTTCCTCTGAGCCCACCCAAGAGGCAATCGTCAGCCCAGATCCCAGCCAGCAGCACACTGACCCTGACACCTCACTCCCTGGGTTCTCCTCAACAGCTGGTGGGGTCTCCTCAGCCCTCACACCAGAGGAACACAGCTTGGGTGGTCCCGGGGCCAGCATGCCAGCCACAGGGTGGCAGTCCCCCACACCCCTATCCCAGCAAGATGTAGCCTCTTCCCCGTCAAACCTGTCAACTGCACCACTTCCAGCTCCTTCTGCCCCGGCCCCTTCCAACCACAGCTCCCAGGTGCCCAGCACACAGCCACCGAGGGCTCCCACCGCACCAGCAGAGGAGCCCAGCTTCGGCCATACAGCCACCACCCATGCCACAGTGGAGCCGGGGCCCAAGGAGAACACAGCCCAGGATGCTCAGCCTGGCAAAGCCATCTGTGGGCCGGAGACCACCACCCCATTCCTGATCATGCAAGAGGTGGGGCACGCACTGAGCTCAGGCAGCGTCGCCGCCATCACAGTGACAGTCATCGCCATGGTGGTGCTGGTGTTTGGCGTCGCGGCATATTTAAAGATCAGGCACTCCTCCTATGGAAGGCTCTTGGATGACCATGACTACGGGTCCTGGGGAAACTACAACAACCCTCTGTATGATGACTCCTAA

XM_004835133.1 Coding sequence

LOC101700802 uncharacterized LOC101700802

Length: 1626 bp    Location: 1331399..1290839   Strand: -
>XM_004835133.1
ATGGCCAAAGCAAAGATGGTGGTTAGAGTGGAGCAAGCTGGGCACAGTGGCTTCAGCCACTTGATGCCTGTAACCCTGAGGCACAGTTGGGTTCCACCTGCAGCAGAGACTCAGAGGCAAGGGTCCAGAGACCGACTGGACACCAGGAGTTGCCAAAGCTCCACTGTCTCTGATAGATTTGCACTTCAACAGCAAGACCTAGAATCCTCTGAGAAGCTCTCAAAGCTACATGATGATGGCGGTGATGATGATGGTGGTGGTGGGGATAATGACTGCGAGGAGGATGCCTATGCCTTCCAACCACAGGGTCGGTTCATGGTCCAGCATGACATGGAGAGGCTGTTGAGGGCCTGTGTCCAGCCAGCTGGACAGAAGCAGGGGAGAATGATGACAGTGTTCCCTCTTTGCAGCAGAGCCCTTCCACAAGGCTTCAGGAAACTCAAGCTGAAGAACAGCTTGAGAGGCAGAGGCTCTGGCCTGCCGTTGCCCCAGATGCCAATGCACTACCAGTACCTGCTGGCAGTGCATGATGACCACACCTCTCCAGGGCGCCGGTGCAGGTGCATGCCACACCTAATCCTTGCTAACTGCCCTCCCTCCCCCATCTCTGGGTTCCCTTCCTCTGGCCCGCGACCCTTCTCCTGTCCCTGTCCCCACCCCGGGTCTCAGCTGGTGTCCTCAGCGGGTCCTTCCCGCCCAGCCCCGATGCTCAGGGGAGCGGGGCCCACGTCACAGGGAGGTCCCTCCCCGCCCCGTGCCTGTCCCCGCCCCGTCCCGTCCCGCCCTGTTGCGTCCCATCGTCCCATCCCGCGCTATAAAGCTCAGGTGCCGAGCGGAGAGGCGACCAGCGCAGCCTCCTCTCCGACAGGACATCAGGGACCAGGGGACCAGGGACCCATGACACCCGCGTTGCTACTATCACTGCTCGTCCTCTGCTCAGGCCGTTATGCCACTGGGCTGGACCTCAATGACACAGACTCTGGGAAAGGTGGGACGTTGTTGCCCAGGGGCCACAGTGACGGGGGCCTTGAGGTTACGACAAGCAGTGAGGTGCTCTCCCTTGCGAGTGCCACACCTTCTTCCAGGGAGCTGTCTTCAGGGGCTGAGGAAGACTACTCAGAAGAGGATGACACTGAGCTGGGAACATCGGGGTACATCGTGGATGATTCTGTCAGAGTTGAACAGGTAGTGAAACCCAAGAAAAACAAGACAGAAGGTGAAAAGACTTCAGATAAACCCAAAAGAAAGAAAAAGGGAAGCAAAAATGGAAAAAGTAGAAGAAACAAGAAGAAGAAAAATCCATGTGCTGCCGAATTTCAAAACTTCTGCATTCACGGAGAATGCAAATATCTAGAGAACATGGATAGGGTAACCTGCCAATGTGATCAGGATTACTTTGGAGAACGGTGTGGAGAAAAATCCATGAAGACTCACAGGATCGCTGGCCGTGACTTGTCAAAAATCACGTTGGTGGTCATCGCTGCTTTTGTCTTGGCTGTGAGCCTCTTAGCCATTGCAGGGGTAATCACAGTCCAGCTTCGGAAGCGATACTTCAGGAAATATGAAGGAGAAGAAGAACGAAAGAAACTTAGACAAGAAAATGGCAATGCACATAGCATGGCATAA

XM_004833917.1 Coding sequence

Epgn epithelial mitogen, transcript variant X5

Length: 285 bp    Location: 1412544..1406618   Strand: -
>XM_004833917.1
ATGGCTCTGGGAGTTCCAGTGTCAGTCTATCTTTTCTTCAATGCACTGACCGCCCTGACCACTGAGGCCGACTGGACCAGGACATCCCCAGGCACAGCCCCCCAAATTGATTCTGTGGAAGGACCCATTGCCCTGAGGTTCTCACACCCCTGCCTGGAAGACCACAGCAGCTACTGCATCAATGGCATGTGTGCCTTCCACCATGAGCTGGACCAGGCCATCTGCAGGTGTCTGAACCTGAAATCTCCCTACAACATGTGTTCTGGAGGAAAAGAACCACTGTGA

XM_004833913.1 Coding sequence

Epgn epithelial mitogen, transcript variant X1

High confidence: 4 potential gene matches
Length: 465 bp    Location: 1412544..1406618   Strand: -
>XM_004833913.1
ATGGCTCTGGGAGTTCCAGTGTCAGTCTATCTTTTCTTCAATGCACTGACCGCCCTGACCACTGAGGCCGACTGGACCAGGACATCCCCAGGCACAGCCCCCCAAAGCAACAGGACAGCTAACAAGACCCAAGTTGATTCTGTGGAAGGACCCATTGCCCTGAGGTTCTCACACCCCTGCCTGGAAGACCACAGCAGCTACTGCATCAATGGCATGTGTGCCTTCCACCATGAGCTGGACCAGGCCATCTGCAGGTGTTACACTGGTTATACTGGGGAAAGGTGTGAGCACCTGACCTTAACTTCATATGCTGTGGATTCTTATGAAAAATACATTGCAGTTGGGATTGGCGTTGGACTACTACTAAGTGGTTTTCTTGCTGTTTTTTACTGCTACATAAGAAAGAGGTGTCTGAACCTGAAATCTCCCTACAACATGTGTTCTGGAGGAAAAGAACCACTGTGA

XM_004833910.1 Coding sequence

Mthfd2l methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like, transcript variant X2

Length: 957 bp    Location: 1515424..1416245   Strand: -
>XM_004833910.1
ATGATCACAACATTCCTGACTTTTGGGGGAAGCAGACCTCTACAAACTGTGAGAAGACACGAAGCCATTATTATCTCTGGTACTGAAATGGCCAAACAGATCCAGAAGGAAGTTCAGCAAGGTGTGGAGGCCTGGCTCACCCTTGGGAACGAGAGGCCTCACCTGAGCATTGTTTTAGTGGGCGACAACCCAGCAAGCCACACATATGTGAGGAATAAGATACGAGCTGCCTCTGCTGTAGGTATCTGTAGTGAGCTCATTCTAAAACCTAAGGAAGTTTCTCAGGAAGAACTTTTGGATATAACTGATCAGTTGAACATGGATCCCAAAGTCAGTGGTATATTAGTTCAGTTACCACTTCCAGATCATGTGGATGAGCGGACAGTGTGCAATGGAATTGCCCCAGGAAAAGATGTGGATGGGTTTCATGTTGTCAACATGGGGAGACTGTGCCTGGACCAGCATTCGTTCATCCCTGCCACTGCCAGTGCTGTCTGGGAGATCATCAAAAGGACAGGAATTGAAACTTTTGGGAAAAATGTGGTTGTGGCTGGAAGATCCAAGAACGTAGGCTTGCCCATTGCCATGCTTCTGCACACAGATGGAGACCACGAGCGACCAGGAGGTGATGCAACGGTGACCATAGCACACAGATACACCCCCAGGGAGAGGCTGAAGACCCAGACTCGGCTGGCAGACATTATTGTGGTCGCTGCAGGCATTCCAAAGTTGATCACGCCTGATATGGTTAAAGAAGATGCTGTAGTGATTGACGTGGGCATCAACTACATCTGCGATCCAATGACAGGAAAGACAAAATTAGTTGGCGATGTGGACTTTGAAGCTGTAAGGAAGAAAGCTGGCTTTATCACTCCAGTCCCCGGAGGTGTGGGGCCGGTGACGGTGGCGATGCTTCTGAGGAACACCCTGCTGGCGGCTCAGAGAGTCATCTACTAG

XM_004833909.1 Coding sequence

Mthfd2l methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like, transcript variant X1

High confidence: 1 potential gene match
Length: 960 bp    Location: 1515424..1422208   Strand: -
>XM_004833909.1
ATGATCACAACATTCCTGACTTTTGGGGGAAGCAGACCTCTACAAACTGTGAGAAGACACGAAGCCATTATTATCTCTGGTACTGAAATGGCCAAACAGATCCAGAAGGAAGTTCAGCAAGGTGTGGAGGCCTGGCTCACCCTTGGGAACGAGAGGCCTCACCTGAGCATTGTTTTAGTGGGCGACAACCCAGCAAGCCACACATATGTGAGGAATAAGATACGAGCTGCCTCTGCTGTAGGTATCTGTAGTGAGCTCATTCTAAAACCTAAGGAAGTTTCTCAGGAAGAACTTTTGGATATAACTGATCAGTTGAACATGGATCCCAAAGTCAGTGGTATATTAGTTCAGTTACCACTTCCAGATCATGTGGATGAGCGGACAGTGTGCAATGGAATTGCCCCAGGAAAAGATGTGGATGGGTTTCATGTTGTCAACATGGGGAGACTGTGCCTGGACCAGCATTCGTTCATCCCTGCCACTGCCAGTGCTGTCTGGGAGATCATCAAAAGGACAGGAATTGAAACTTTTGGGAAAAATGTGGTTGTGGCTGGAAGATCCAAGAACGTAGGCTTGCCCATTGCCATGCTTCTGCACACAGATGGAGACCACGAGCGACCAGGAGGTGATGCAACGGTGACCATAGCACACAGATACACCCCCAGGGAGAGGCTGAAGACCCAGACTCGGCTGGCAGACATTATTGTGGTCGCTGCAGGCATTCCAAAGTTGATCACGCCTGATATGGTTAAAGAAGATGCTGTAGTGATTGACGTGGGCATCAACTACATCTGCGATCCAATGACAGGAAAGACAAAATTAGTTGGCGATGTGGACTTTGAAGCCCTGCCCTTCACTCCCATGTGTCAGCCACTGGTCTTGAGACGTTTCCCAGAGTTCAAGCTTCCTTCCACCTCGAGGACCTTCTTGCCACCTTTACCCCAGTGCCTCCTCTGCTGA

XM_004833918.1 Coding sequence

Cxcl1 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha), transcript variant X1

Length: 405 bp    Location: 1552599..1551122   Strand: -
>XM_004833918.1
ATGGCCCACACCGCCCCCAGTGCCCTGCGCCCCGTGCCACTGCTGCTGCTGCTGCTGCTGCTGGTGACGGGAGCCGCCCGGAGAGCCGCAGGAGCGCCTGTGACCACCGAGCTGCGCTGCCGCTGTCTGCAGCCTGTGCGCGGGCTGCACCCCAAGAGTATCCAGAGCGTAGCCGTGACGGCGCCGGGACCCCACTGCCACCAAACCGAAGTCGTGGCCACGCTCAAGGATGGACGTGTAGCCTGCCTAGACCCGGAGGCCCCGATGGTGCAGAGAGTCCTGCAGAGAATGCTGAGCAAGTGCGTGGGGCTGTGCGTGCACGGGGCGGGGTCAGACCTGCGCCCTGAAATCATACCGGGGAACCGGGTGCAGCTGCGGGACAAGGAGCGGGGTTTCCATAACTGA

XM_004833920.1 Coding sequence

LOC101706767 platelet basic protein-like, transcript variant X1

Length: 378 bp    Location: 1672324..1671282   Strand: -
>XM_004833920.1
ATGAGTCTCAGATTCAACGCTACCTCCTGCTCTAGCCCCAGCCTGCATCTTGCCTTAGGGGGATTGCTGCTCCTGTCATTGCTCCTGACTGTGCTGGTTCCCTCTACCAATGGACAAGGTAAGACAAATTTAGGGAAAAACAAGGCTGCAAGCATAGAGTCGTTTGTTGAACTGCGCTGCCTATGTGTGAAGACGGTCTCTGGAATCCATCCCAGCAAGATCTCCACTTTGGAGATGATTAAGGCAGGATCCCATTGTTCCAAAGTCCAAGTGATAGCCACACTGAAAGAGGGCCAGAAAGTCTGTCTGAACCCAGATGCTCCAGGAGTCAAGAAAATGATACAGAAAACATTGGAAGGTCAGGAATCAGCTGCTTAA

XM_004833929.1 Coding sequence

LOC101708798 zinc finger protein 267-like, transcript variant X6

Length: 1989 bp    Location: 1941493..1897108   Strand: -
>XM_004833929.1
ATGGAAATGTTGACATTCAGGGATGTGGCCATTGATTTCTCTGTGGAAGAGTGGGAATTCCTGGAGCCGGCTCAGCAGAATTTGTATAGGGATGTGATGATAGAGAACTATAGAAACCTCCTCTCCCTGGGTTTAGCTGTCACTAAGCCATACCTGATCACCTTTCTGGAGCAAAGCAAGGAGCTTTGGGATGTAAAGAGTCAAGGGACAGCAGCTATTCATCCAGCTATGTCTTCTCATCATACTGAAGGATTTTCATCAGAGAAGGACATGAAACATTCATTTCAAAAAGTGATAAATCAAAGATCTGGAAATTGTGGCTTTAGCAGTTTGCACTTAAAGAAAGACTGGAAAATTGGTAAGTGTGAAGATGAGAATCCATTTCATAATGGACACCACCAATGTATGACAACTGAAAATAACAAAAGCTTCACTGTCAATAGAAATCAAGAACATGTAGCATCACAGAATATATCTGAATTTATGCCACTTCATTTTAGTAATCCACATCAGACTATTAAGTGTACCTTTTCCTGTGCCAAAATATGCAGTTTTGACAAACATGGGAAGGAATTTACCTATCCATTAATGCACAGTCAAAGTCCATATATAGATATTTGGCAAACTCATGACATATATAATGAAAATGGGAAGGCCTTTAAGAACAACTCTACTCTACATAATTGCCAGGATGCTCATATTGAACAGAAAATTTATCCTTGTAATAAAATTACTGAAAACTTTAACCATGGCTCAAATCCTAGTAAACAACATTTTTCAAAGAATATTTATAAATGTGATACATGTGGGAGAGTCTTTGACCAGTGCTCACAACTTACTACCCATCAAAGTGCCCATTTTCAAGACAAGGTGTATAACTATAAAGACTGTGGCAAAGCTTTTGTTGATGATTCTATCTTTAATCAACATCAGAGCATTCATACTGGAGAGAAGTCCTACAGATTTAAAGAAAATGCTAAATCCTTTAAGTATCACTTAACCCCTGCTCAATACCAGTTAATTCTTACTGGAGAGAAATCCTACAGTTGTAAAAATTCTGATACATTTAATCAAAACTCAACATTTACTAAGCATCAGACAATTAATACTGGAGAGAAATTGTATAAATGTAGAGAATCTGGCAAAGCCTATATTGAAAAGTCAATACTTACTCAACACCAGAGAATCTGTACTAAAGAGAAACCCTACAAATGTAAAGTATGTGACAAAACCTTTAGCCAAATTTCACCTCTTACTCAACACCAGAGAATACATATGGGAGAGAAACCTTACAATTGTAAAGAATGTGGCAAAGCCTTTAGATACTGCACATCCATTATTCAACACCAAAGAATTCATACTGGAGAGAAACCCTTCAAATGTAAAGAATGTGGCAAAGCTTTTATTCAGAGGTCAGCACTTATTCAACACCAGAGAATACATACTAAAGAGAAGCCCTACAAATGTACAAAATGTGACAAAACCTTTAATCAAACTTCACATCTTACTCGGCACCAGAGAACACATACGGGAGAGAAACCTTATAAATGTAAGGAATGTGGTAAAGCATTTAGATATTGTACAACCATTACTCGACACGAAAGAATTCATACTGGAGAGAAACCCTATAAATGTGAAGAATGTGGGAAATCCTTTAATCAAAGTTCAACACTTACTCAACATCAGAGAATTCATACAGGAGAGAAACCCTACAAATGTAAACAGTGTGGCAAAGCATTTGATCGAAGGTCTAACCTTAGTAATCATGAAAGAATACACACTGCAGAGAAACCATACAAATGTAAAGAATGTGGCAAAGCCTTTAATCAAAGCTCAACCCTTACTAAACACCAGAGAATTCATACTGGAGAGAAACCTTACAAGTGCACAGAATGTGACAAAACTTTTAATCAAATTTCACATCTTTCTCGGCACCAAAGAACACATACTTCCAATCTTAGACAACATCACCAAATTCATGTTAGATAA

XM_004833924.1 Coding sequence

LOC101708798 zinc finger protein 267-like, transcript variant X1

Length: 2085 bp    Location: 1930082..1897108   Strand: -
>XM_004833924.1
ATGTACTCTCAGCCGTCCATTTTTCCATGGTCCTGGGGTCAGCTGCTTGACACCAGCATCCACAGCTGCCATGTCTTTTCCTTGATCCCTAGGAGTGAAGAAATGTTGACATTCAGGGATGTGGCCATTGATTTCTCTGTGGAAGAGTGGGAATTCCTGGAGCCGGCTCAGCAGAATTTGTATAGGGATGTGATGATAGAGAACTATAGAAACCTCCTCTCCCTGGGTTTAGCTGTCACTAAGCCATACCTGATCACCTTTCTGGAGCAAAGCAAGGAGCTTTGGGATGTAAAGAGTCAAGGGACAGCAGCTATTCATCCAGCTATGTCTTCTCATCATACTGAAGGATTTTCATCAGAGAAGGACATGAAACATTCATTTCAAAAAGTGATAAATCAAAGATCTGGAAATTGTGGCTTTAGCAGTTTGCACTTAAAGAAAGACTGGAAAATTGGTAAGTGTGAAGATGAGAATCCATTTCATAATGGACACCACCAATGTATGACAACTGAAAATAACAAAAGCTTCACTGTCAATAGAAATCAAGAACATGTAGCATCACAGAATATATCTGAATTTATGCCACTTCATTTTAGTAATCCACATCAGACTATTAAGTGTACCTTTTCCTGTGCCAAAATATGCAGTTTTGACAAACATGGGAAGGAATTTACCTATCCATTAATGCACAGTCAAAGTCCATATATAGATATTTGGCAAACTCATGACATATATAATGAAAATGGGAAGGCCTTTAAGAACAACTCTACTCTACATAATTGCCAGGATGCTCATATTGAACAGAAAATTTATCCTTGTAATAAAATTACTGAAAACTTTAACCATGGCTCAAATCCTAGTAAACAACATTTTTCAAAGAATATTTATAAATGTGATACATGTGGGAGAGTCTTTGACCAGTGCTCACAACTTACTACCCATCAAAGTGCCCATTTTCAAGACAAGGTGTATAACTATAAAGACTGTGGCAAAGCTTTTGTTGATGATTCTATCTTTAATCAACATCAGAGCATTCATACTGGAGAGAAGTCCTACAGATTTAAAGAAAATGCTAAATCCTTTAAGTATCACTTAACCCCTGCTCAATACCAGTTAATTCTTACTGGAGAGAAATCCTACAGTTGTAAAAATTCTGATACATTTAATCAAAACTCAACATTTACTAAGCATCAGACAATTAATACTGGAGAGAAATTGTATAAATGTAGAGAATCTGGCAAAGCCTATATTGAAAAGTCAATACTTACTCAACACCAGAGAATCTGTACTAAAGAGAAACCCTACAAATGTAAAGTATGTGACAAAACCTTTAGCCAAATTTCACCTCTTACTCAACACCAGAGAATACATATGGGAGAGAAACCTTACAATTGTAAAGAATGTGGCAAAGCCTTTAGATACTGCACATCCATTATTCAACACCAAAGAATTCATACTGGAGAGAAACCCTTCAAATGTAAAGAATGTGGCAAAGCTTTTATTCAGAGGTCAGCACTTATTCAACACCAGAGAATACATACTAAAGAGAAGCCCTACAAATGTACAAAATGTGACAAAACCTTTAATCAAACTTCACATCTTACTCGGCACCAGAGAACACATACGGGAGAGAAACCTTATAAATGTAAGGAATGTGGTAAAGCATTTAGATATTGTACAACCATTACTCGACACGAAAGAATTCATACTGGAGAGAAACCCTATAAATGTGAAGAATGTGGGAAATCCTTTAATCAAAGTTCAACACTTACTCAACATCAGAGAATTCATACAGGAGAGAAACCCTACAAATGTAAACAGTGTGGCAAAGCATTTGATCGAAGGTCTAACCTTAGTAATCATGAAAGAATACACACTGCAGAGAAACCATACAAATGTAAAGAATGTGGCAAAGCCTTTAATCAAAGCTCAACCCTTACTAAACACCAGAGAATTCATACTGGAGAGAAACCTTACAAGTGCACAGAATGTGACAAAACTTTTAATCAAATTTCACATCTTTCTCGGCACCAAAGAACACATACTTCCAATCTTAGACAACATCACCAAATTCATGTTAGATAA

XM_004833928.1 Coding sequence

LOC101708798 zinc finger protein 267-like, transcript variant X5

Length: 2043 bp    Location: 1919418..1897108   Strand: -
>XM_004833928.1
ATGGCATTGTCTCTGTTGTGCGGTACTGTGGAGGCTTCTTTGCTCTGGGTGGCCCAGGAAATGTTGACATTCAGGGATGTGGCCATTGATTTCTCTGTGGAAGAGTGGGAATTCCTGGAGCCGGCTCAGCAGAATTTGTATAGGGATGTGATGATAGAGAACTATAGAAACCTCCTCTCCCTGGGTTTAGCTGTCACTAAGCCATACCTGATCACCTTTCTGGAGCAAAGCAAGGAGCTTTGGGATGTAAAGAGTCAAGGGACAGCAGCTATTCATCCAGCTATGTCTTCTCATCATACTGAAGGATTTTCATCAGAGAAGGACATGAAACATTCATTTCAAAAAGTGATAAATCAAAGATCTGGAAATTGTGGCTTTAGCAGTTTGCACTTAAAGAAAGACTGGAAAATTGGTAAGTGTGAAGATGAGAATCCATTTCATAATGGACACCACCAATGTATGACAACTGAAAATAACAAAAGCTTCACTGTCAATAGAAATCAAGAACATGTAGCATCACAGAATATATCTGAATTTATGCCACTTCATTTTAGTAATCCACATCAGACTATTAAGTGTACCTTTTCCTGTGCCAAAATATGCAGTTTTGACAAACATGGGAAGGAATTTACCTATCCATTAATGCACAGTCAAAGTCCATATATAGATATTTGGCAAACTCATGACATATATAATGAAAATGGGAAGGCCTTTAAGAACAACTCTACTCTACATAATTGCCAGGATGCTCATATTGAACAGAAAATTTATCCTTGTAATAAAATTACTGAAAACTTTAACCATGGCTCAAATCCTAGTAAACAACATTTTTCAAAGAATATTTATAAATGTGATACATGTGGGAGAGTCTTTGACCAGTGCTCACAACTTACTACCCATCAAAGTGCCCATTTTCAAGACAAGGTGTATAACTATAAAGACTGTGGCAAAGCTTTTGTTGATGATTCTATCTTTAATCAACATCAGAGCATTCATACTGGAGAGAAGTCCTACAGATTTAAAGAAAATGCTAAATCCTTTAAGTATCACTTAACCCCTGCTCAATACCAGTTAATTCTTACTGGAGAGAAATCCTACAGTTGTAAAAATTCTGATACATTTAATCAAAACTCAACATTTACTAAGCATCAGACAATTAATACTGGAGAGAAATTGTATAAATGTAGAGAATCTGGCAAAGCCTATATTGAAAAGTCAATACTTACTCAACACCAGAGAATCTGTACTAAAGAGAAACCCTACAAATGTAAAGTATGTGACAAAACCTTTAGCCAAATTTCACCTCTTACTCAACACCAGAGAATACATATGGGAGAGAAACCTTACAATTGTAAAGAATGTGGCAAAGCCTTTAGATACTGCACATCCATTATTCAACACCAAAGAATTCATACTGGAGAGAAACCCTTCAAATGTAAAGAATGTGGCAAAGCTTTTATTCAGAGGTCAGCACTTATTCAACACCAGAGAATACATACTAAAGAGAAGCCCTACAAATGTACAAAATGTGACAAAACCTTTAATCAAACTTCACATCTTACTCGGCACCAGAGAACACATACGGGAGAGAAACCTTATAAATGTAAGGAATGTGGTAAAGCATTTAGATATTGTACAACCATTACTCGACACGAAAGAATTCATACTGGAGAGAAACCCTATAAATGTGAAGAATGTGGGAAATCCTTTAATCAAAGTTCAACACTTACTCAACATCAGAGAATTCATACAGGAGAGAAACCCTACAAATGTAAACAGTGTGGCAAAGCATTTGATCGAAGGTCTAACCTTAGTAATCATGAAAGAATACACACTGCAGAGAAACCATACAAATGTAAAGAATGTGGCAAAGCCTTTAATCAAAGCTCAACCCTTACTAAACACCAGAGAATTCATACTGGAGAGAAACCTTACAAGTGCACAGAATGTGACAAAACTTTTAATCAAATTTCACATCTTTCTCGGCACCAAAGAACACATACTTCCAATCTTAGACAACATCACCAAATTCATGTTAGATAA

XM_004833926.1 Coding sequence

LOC101708798 zinc finger protein 267-like, transcript variant X3

Length: 2058 bp    Location: 1916255..1897108   Strand: -
>XM_004833926.1
ATGTTTCATTTCATTACTGTTGTAGAAGGACCAATATTTGACATTGCTGATGCTCCCTGTGGTATGTTCATGGAAATGTTGACATTCAGGGATGTGGCCATTGATTTCTCTGTGGAAGAGTGGGAATTCCTGGAGCCGGCTCAGCAGAATTTGTATAGGGATGTGATGATAGAGAACTATAGAAACCTCCTCTCCCTGGGTTTAGCTGTCACTAAGCCATACCTGATCACCTTTCTGGAGCAAAGCAAGGAGCTTTGGGATGTAAAGAGTCAAGGGACAGCAGCTATTCATCCAGCTATGTCTTCTCATCATACTGAAGGATTTTCATCAGAGAAGGACATGAAACATTCATTTCAAAAAGTGATAAATCAAAGATCTGGAAATTGTGGCTTTAGCAGTTTGCACTTAAAGAAAGACTGGAAAATTGGTAAGTGTGAAGATGAGAATCCATTTCATAATGGACACCACCAATGTATGACAACTGAAAATAACAAAAGCTTCACTGTCAATAGAAATCAAGAACATGTAGCATCACAGAATATATCTGAATTTATGCCACTTCATTTTAGTAATCCACATCAGACTATTAAGTGTACCTTTTCCTGTGCCAAAATATGCAGTTTTGACAAACATGGGAAGGAATTTACCTATCCATTAATGCACAGTCAAAGTCCATATATAGATATTTGGCAAACTCATGACATATATAATGAAAATGGGAAGGCCTTTAAGAACAACTCTACTCTACATAATTGCCAGGATGCTCATATTGAACAGAAAATTTATCCTTGTAATAAAATTACTGAAAACTTTAACCATGGCTCAAATCCTAGTAAACAACATTTTTCAAAGAATATTTATAAATGTGATACATGTGGGAGAGTCTTTGACCAGTGCTCACAACTTACTACCCATCAAAGTGCCCATTTTCAAGACAAGGTGTATAACTATAAAGACTGTGGCAAAGCTTTTGTTGATGATTCTATCTTTAATCAACATCAGAGCATTCATACTGGAGAGAAGTCCTACAGATTTAAAGAAAATGCTAAATCCTTTAAGTATCACTTAACCCCTGCTCAATACCAGTTAATTCTTACTGGAGAGAAATCCTACAGTTGTAAAAATTCTGATACATTTAATCAAAACTCAACATTTACTAAGCATCAGACAATTAATACTGGAGAGAAATTGTATAAATGTAGAGAATCTGGCAAAGCCTATATTGAAAAGTCAATACTTACTCAACACCAGAGAATCTGTACTAAAGAGAAACCCTACAAATGTAAAGTATGTGACAAAACCTTTAGCCAAATTTCACCTCTTACTCAACACCAGAGAATACATATGGGAGAGAAACCTTACAATTGTAAAGAATGTGGCAAAGCCTTTAGATACTGCACATCCATTATTCAACACCAAAGAATTCATACTGGAGAGAAACCCTTCAAATGTAAAGAATGTGGCAAAGCTTTTATTCAGAGGTCAGCACTTATTCAACACCAGAGAATACATACTAAAGAGAAGCCCTACAAATGTACAAAATGTGACAAAACCTTTAATCAAACTTCACATCTTACTCGGCACCAGAGAACACATACGGGAGAGAAACCTTATAAATGTAAGGAATGTGGTAAAGCATTTAGATATTGTACAACCATTACTCGACACGAAAGAATTCATACTGGAGAGAAACCCTATAAATGTGAAGAATGTGGGAAATCCTTTAATCAAAGTTCAACACTTACTCAACATCAGAGAATTCATACAGGAGAGAAACCCTACAAATGTAAACAGTGTGGCAAAGCATTTGATCGAAGGTCTAACCTTAGTAATCATGAAAGAATACACACTGCAGAGAAACCATACAAATGTAAAGAATGTGGCAAAGCCTTTAATCAAAGCTCAACCCTTACTAAACACCAGAGAATTCATACTGGAGAGAAACCTTACAAGTGCACAGAATGTGACAAAACTTTTAATCAAATTTCACATCTTTCTCGGCACCAAAGAACACATACTTCCAATCTTAGACAACATCACCAAATTCATGTTAGATAA

XM_004835135.1 Coding sequence

LOC101702225 zinc finger protein 709-like

Length: 1584 bp    Location: 2114086..2136868   Strand: +
>XM_004835135.1
ATGGTGACGTTGTGGAACAGGGTCTGGGAACAGGATGGAATCGGGGAAGCAGTGACCTTTGCGGATGTGGCTGTGAACTTCACCAAGGAAGAATGGGCTTTATTGAATCCATCCCAAAAGAAGCTCTGCAGAGATGTGATGTGGGAAACATTTATGAACATGGCTGTTATAAGAAGAACCTGGGATAGCCAGCAAATTGGAGAGGAGTACAAAAATTGTTGGAGAAATCTAAGAAATGAAGAGGTAGAGAAATGCTATGAATATAAAGTTTTGAATCAATCTAAAGAAATGTTCCTCTTGACTCCATATGTTAATGTGAACATGAAAAAAGCTGGTTTAAAACCAGCTGAAAGTGTTGCTTATAGAAAGCCCCTGATTGATAATATATCACTAAATGCACCCATAAGATCTCAAACTAAACTGAAGCCAGATGAATATTCAGGATTTAAAGAGAAGCACTATAAATGTAATGAAGATGGAAGAACCAGCAGTGGTTTCCAGTCCTTTAAGAAGCATGCAAAGATAAAGGCTGGAGAGAAACCCTGTGAATACAAGCAGTGTGGGAAAGCTGACTGTGATCCCAGAGAAAGAACTCACCCTAGAGAGAAGACCTTTGTGTGTAAGCAAAGTGTGAAAGCCCCCGGCACACTCAATGATGTTCAAATCCATCACAATGCAGGAAATCCATATGTATGCCAACAAACTGGGGAATCTTTTATTTCTTCCTGTTATATTGAAATACAAGAAAGAAGACATGCTGGAGAGAATCCCTGTATATCTAAGGAATGTGGAAAAGCCAAATTAGCTCCTAGTAATTCCTTTCACAAACATAGAAGTACTCACATTGGGAAGAAACTCTACAAATGTAAACAGTGTGGGAAAGCTTTCAGGAGTCATAGTAACTGTCACAGACATGAAAAAACTCATACTGGAGAGAAATCCTATGTATGTAAGCAATGTGGGAAAGCTTTCAGCACACACTGGTACTGTCAAATACATGAGAGAAGTCACACTGGGAATACACCCTATATATGTAATCACTGTGGGAAAGCATTTACTACACACAGGAATTGTCAAGTACATGAGAGAAGCCATACTGGTGAAAAACCGTATGTATGTAAGCAATGTGGGAAAGCATTCAGTATGCAGAAGCATTGTCAAATACATGAAAGAACTCACAATGGGGAGAAACTCTATATATGTAAGCATTGTGGGAAAGCTTTCAGCAGTCACTGTCACTGTCAACGACATGAAAGAATTCACACTGGGGAGAAGCCCTATGTATGTAAGCATTGTGGGAAAGAAAGAACTCACACTGGAGAGAAACCCTATGCATGTAAGCATTGTGGGAAAGCTTTCAACACACACAGTCAGTGTAAAATACATGAACGAACTCACACTGGGGAGAAACCCTATGTATGTAAGCATTGTGGGAAAGCATTCAGTACATGTAGTTCTCATAAAACACATGAAAGAACTCACCATGAAAGAACTCACACTGGGGAGAAACCCTATGTATGTAAGCAATGTGGAAAAGCATTCAGTAGACACAGTTATTGTCAAATACATGAAAAGTCACACTGA

XM_004833932.1 Coding sequence

Ccdc51 coiled-coil domain containing 51, transcript variant X1

Length: 1227 bp    Location: 2406062..2398223   Strand: -
>XM_004833932.1
ATGATGGGTTGCAGTCCTGCATTTGCTATGCAGCACATTGTGAGTGTGCCCCATGTACTGATACGGAGAGGCCTCCTTGGAAGGGACTTTGTTATAGCCAGGACTCTCTGCAGCCCAGGCCCCACCCAGCCCGGAGAGAAGCGCCCTGAGGAGGCAGTCCTGTATCATCGTCTCCCAGCTCTGGGGAGAGCCCTGGGGCGAAGCATTCAGCAACGAGCTGCCTCCATAGCCAAGACTTGGTGGGACAGATATGAAGAATTTGTGGGGCTCAATGAAGTGCGAGAGGCCCAGGGAAATGTGACTGAGGCAGAGAAAGTGTTCATGGTAGCTCGTGGGCTTGTCCGAGAGTCTCGGGAGGACTTGGAAGTTCAGCAGACCAAGCTGAAGGAGGTGAGGGACCGCTTGGACCGTGTCTCCAGGGAGGACAATCAGTACCTGGAATTGGCTACTCTGGAGCACAGGATGCTGCAGGAGGAGAAGAGGCTCCGCATAGCCTATGTGGGTGCAGAAGACTCTGAGCGTGAGAAGTTCTCTCTCTTCTCTGCAGCTGTGCGGGAGAGCCATGAGAAGGAGCGTGCAAGGGCTGAAAGGACTAAGAACTGGTCCCTCATCGGGTCAGTTCTGGGAGCCCTGATTGGTGTGGCTGGCTCCACCTATGTGAACCGTGTACGGCTACAGGAGCTGAAGGCCTTACTCCTGGAGGCACAGAAGGGACCCCTGAGTCTCCAGGAGGCCATCCGTGACCAGGCAGCTAGCTACTCCCTCCAGCAGAGGGACCTCCGTGACCTCGTGGTGGACCTGAAGGGGCTGGTGCATACCGGGCAGGGCCAGGGCTCTGGGTCACCAGCAGGTGTTTCCACTACCAGAGAGAGACACACAGATTCCCTTTCATCTGCCTTACAAGAGCAGCTTAGTCATTCCCAGCAGGTCTATTCTTGTCTAGAAGGTTTACGAGAGCAGCTCAATGGTCTGGATAAGACTTGCAGCCAAATGGTTGGGGTGATTCGGCTTGCAGAGGCCACAGCACACCCAGGCCTGGAGAAGCCAGGAGACGGGGCTCTTCCCAGCTCCTTGCTGGCACACGGGAGCATGATCTTGGCCCTATCCAACATGGAACAGAGGCTGGAAGCCCAAGTGAACAGAAACACTATCTACAGCACATTGGTCACTTGTATGACATTTCTGGCCTCACTGCCCGTGCTCTACATGCTGTTCAAGGCCAGCTAA

XM_004833944.1 Coding sequence

Atrip ATR interacting protein, transcript variant X3

High confidence: 3 potential gene matches
Length: 2373 bp    Location: 2413138..2430976   Strand: +
>XM_004833944.1
ATGGCCGGGACCACCGCGCAGAGCAGTAGGAGGCGGCCTCAGGCACTCCACCCTGGCCCGCCGCCTGGCCCCGGCCACCCCCCGAGCAAGCGGGCCCGGGGCTTCCCCGTGGCTGCCCCCCTGGATCCCGAGGACCCGTTCGATGCGCACGGGGAACTCACTGCCGACGACCTGGAGGAGCTCGACATCCTGGCGTCCCAGGCCCTGAGCCAGTGCCCGGCCGCGGCGCGGGACCTGTCCACTGTTCATAAGGTCCGAAGATTAGATGGGATGTCAAAAAGTCCTGCAGGGAAGAACACAGAAAATGCTCCAGTTAAAGATAACTTTGAACTAGAGGTACTTCAGACACAATACAAAGAACTTAAGGAAAAGCTGAAGGTGATGGAAGAAGAAATCCTCATTAAGAATGGAGAAATTAAAATCTTGCGGGACTCATTGCATCAGTCAGAATCCATTCTGGAAGAACAAAAACGATCACATTTCCTTCTTGAGCAAGAGAAAACCCAAGCACTCAGTGACAAAGAAAAAGAGTTCTCCAGAAAGGTACAATCATTGCAGTCTGAGCTCCAGTTTAAAGATGCAGAAATGAATGAATTAAGGACAAAGTTTCAGAGCAGTGAACGGGTGAATAAACTGGCTGCTCCCTCCATTTCCCATGTAAGTCCTAGGAAAAACCTTTCTGTGGTTATAAGACCAGAAGCATGTTCCTCACAGTTTGGAAAAACATCTTTTCCTACAAAGGAGTCTTTTAGTGCTAACATGTCCTTTCCCCACCCCTGCCAGACAGAGCCAGGATACAAGTCTCTGCTGGGCAGAGAGGTTTCAGATAATAAGACCCACAGTCTGAGAAGTAGTCCTATAAAGCAAGAAGAGGTACAGAAAAGTCTTACTGACAGCTGGATGCAGAAATCAAACACTGAAGGTTCCATTTTGATAAGCCTACTGCTGAAGCAGCCTTTGATCTCAGGGTCAGCCGTAGGTCTTTGCCACCTCCTGAGCAGTTGTTCTGAGGCTCCTACTGGCAACCTCTTGCAGCCTCTGGGGCTTGGCAGTATCTTGGCTGTGATTTCAGGCCTCAGAACCACAGGTTCTCACAGTGGGGCATTTTCCCCCTCAGCCCTGAGAGAAGCACAGAACCTGGCATTCACTGGACTGAATCTGATTGCCAGGAATGAAGGCTCATGTGATGGAGACCCAGCAGAGGGACCCAGAAGGGCCTTCCCACTCTGCCAGCTTCCTGGAGCCGTGCACCTCCTTCCCCTCATACAGTTCTTCATTGGCCTACACTGCCAGGCTTTGCAGGAGTTAGCAGTGGCTAAGAGGAGTGGAGCATCTGGGGACTCATCAACACATACCTCCTGCGTGGGCTCCGGGGTGGAGGCCAACCCTGAGGACTTGATTTCCAACCTGGAAGGCTTCTCTGTGGCTTCACTTAGCATTCTACAGCACCTGGTATGCCACAGCGGAGCAGTGGTCTGCCTATTACTGTCGGAAGTGGAGGCAGATGCTTCTTCTGGGGAAGGAAACGGGAGCCTGGTTCACAGACAGACTTGTGGAGAAATAATCTCAGCCCCTATGGGGGCTGCGGAAGACCAAGGACAGCATCCACTATTGAAGATGCTTCTTCACCTGTTGGCTTTCTCTTCCGCAGCAGGAGGTCACCTTCAAGCCAGTGTCCTGAGCCAGTGTCTCAAGGTTTTGGTGAAATTAGCTGAAAATGCTTCCTCTGATTTCTTGCCCAGGTTCCAGTGTGTGTTGCCAGTGCTGCCACGGTGCCTCAGCCCAGAGACACCCCTGCCTTGTGTGCTGCTGACTATTGAGCTGCTCTCTCTCCTGGTGGACCACGAGATCCTGGCATCGCAGTTCTGTTCCCACTCTGAAGGCTGTCTCCTCCTGCTGCTGTACATGTACATCACTTCAAGGCCTGACAAGGGGACCTCAGAGACACAGTGGCTTCAGCTGGAACAGGAGGCAGTGTGGCTGCTAGCCAAGCTGGGTGTGCAGAGCTCTTCCTCCCCAGTCACTGGCTCTGACTGCCAGTGCAACGTGGAGGTGGTCAGAGCTCTCACGGTGATGTTGCACCGACAGTGGCTGACTGTGCGGAGGGCAGGGGGGCCCCCAAGGACTGAGTGGCAGAAGCGGACCATGCGCTGTCTGCGTGACACGGTGCTGCTGCTGCACAGCCTGTCCCAGAAAGACAAGCTCTTCACTGTGCACTGTGTGGAAGTCCTGCATCAGTATGACCAGGTGATGCCTGGGGTCAGCACACTGATTCGAGGGCTCCCTGATGTCATGGACTGTGAAGAGGCAGCCCTGGATGACCTCTGTGGCATGGAGACTGACGCGGATGATGCTGAGATGGACTGTGGCTGA

XM_004833942.1 Coding sequence

Atrip ATR interacting protein, transcript variant X1

Length: 2367 bp    Location: 2413138..2430976   Strand: +
>XM_004833942.1
ATGGCCGGGACCACCGCGCAGAGCAGTAGGAGGCGGCCTCAGGCACTCCACCCTGGCCCGCCGCCTGGCCCCGGCCACCCCCCGAGCAAGCGGGCCCGGGGCTTCCCCGTGGCTGCCCCCCTGGATCCCGAGGACCCGTTCGATGCGCACGGGGAACTCACTGCCGACGACCTGGAGGAGCTCGACATCCTGGCGTCCCAGGCCCTGAGCCAGTGCCCGGCCGCGGCGCGGGACCTGTCCACTGTTCATAAGGTCCGAAGATTAGATGGGATGTCAAAAAGTCCTGCAGGGAAGAACACAGAAAATGCTCCAGTTAAAGATAACTTTGAACTAGAGGTACTTCAGACACAATACAAAGAACTTAAGGAAAAGCTGAAGGTGATGGAAGAAGAAATCCTCATTAAGAATGGAGAAATTAAAATCTTGCGGGACTCATTGCATCAGTCAGAATCCATTCTGGAAGAACAAAAACGATCACATTTCCTTCTTGAGCAAGAGAAAACCCAAGCACTCAGTGACAAAGAAAAAGAGTTCTCCAGAAAGGTACAATCATTGCAGTCTGAGCTCCAGTTTAAAGATGCAGAAATGAATGAATTAAGGACAAAGTTTCAGAGCAGTGAACGGGTGAATAAACTGGCTGCTCCCTCCATTTCCCATGTAAGTCCTAGGAAAAACCTTTCTGTGGTTATAAGACCAGAAGCATGTTCCTCACAGTTTGGAAAAACATCTTTTCCTACAAAGGAGTCTTTTAGTGCTAACATGTCCTTTCCCCACCCCTGCCAGACAGAGCCAGGATACAAGTCTCTGCTGGGCAGAGAGGATAATAAGACCCACAGTCTGAGAAGTAGTCCTATAAAGCAAGAAGAGGTACAGAAAAGTCTTACTGACAGCTGGATGCAGAAATCAAACACTGAAGGTTCCATTTTGATAAGCCTACTGCTGAAGCAGCCTTTGATCTCAGGGTCAGCCGTAGGTCTTTGCCACCTCCTGAGCAGTTGTTCTGAGGCTCCTACTGGCAACCTCTTGCAGCCTCTGGGGCTTGGCAGTATCTTGGCTGTGATTTCAGGCCTCAGAACCACAGGTTCTCACAGTGGGGCATTTTCCCCCTCAGCCCTGAGAGAAGCACAGAACCTGGCATTCACTGGACTGAATCTGATTGCCAGGAATGAAGGCTCATGTGATGGAGACCCAGCAGAGGGACCCAGAAGGGCCTTCCCACTCTGCCAGCTTCCTGGAGCCGTGCACCTCCTTCCCCTCATACAGTTCTTCATTGGCCTACACTGCCAGGCTTTGCAGGAGTTAGCAGTGGCTAAGAGGAGTGGAGCATCTGGGGACTCATCAACACATACCTCCTGCGTGGGCTCCGGGGTGGAGGCCAACCCTGAGGACTTGATTTCCAACCTGGAAGGCTTCTCTGTGGCTTCACTTAGCATTCTACAGCACCTGGTATGCCACAGCGGAGCAGTGGTCTGCCTATTACTGTCGGAAGTGGAGGCAGATGCTTCTTCTGGGGAAGGAAACGGGAGCCTGGTTCACAGACAGACTTGTGGAGAAATAATCTCAGCCCCTATGGGGGCTGCGGAAGACCAAGGACAGCATCCACTATTGAAGATGCTTCTTCACCTGTTGGCTTTCTCTTCCGCAGCAGGAGGTCACCTTCAAGCCAGTGTCCTGAGCCAGTGTCTCAAGGTTTTGGTGAAATTAGCTGAAAATGCTTCCTCTGATTTCTTGCCCAGGTTCCAGTGTGTGTTGCCAGTGCTGCCACGGTGCCTCAGCCCAGAGACACCCCTGCCTTGTGTGCTGCTGACTATTGAGCTGCTCTCTCTCCTGGTGGACCACGAGATCCTGGCATCGCAGTTCTGTTCCCACTCTGAAGGCTGTCTCCTCCTGCTGCTGTACATGTACATCACTTCAAGGCCTGACAAGGGGACCTCAGAGACACAGTGGCTTCAGCTGGAACAGGAGGCAGTGTGGCTGCTAGCCAAGCTGGGTGTGCAGAGCTCTTCCTCCCCAGTCACTGGCTCTGACTGCCAGTGCAACGTGGAGGTGGTCAGAGCTCTCACGGTGATGTTGCACCGACAGTGGCTGACTGTGCGGAGGGCAGGGGGGCCCCCAAGGACTGAGTGGCAGAAGCGGACCATGCGCTGTCTGCGTGACACGGTGCTGCTGCTGCACAGCCTGTCCCAGAAAGACAAGCTCTTCACTGTGCACTGTGTGGAAGTCCTGCATCAGTATGACCAGGTGATGCCTGGGGTCAGCACACTGATTCGAGGGCTCCCTGATGTCATGGACTGTGAAGAGGCAGCCCTGGATGACCTCTGTGGCATGGAGACTGACGCGGATGATGCTGAGATGGACTGTGGCTGA

XM_004833943.1 Coding sequence

Atrip ATR interacting protein, transcript variant X2

Length: 2364 bp    Location: 2413138..2430976   Strand: +
>XM_004833943.1
ATGGCCGGGACCACCGCGCAGAGCAGTAGGAGGCGGCCTCAGGCACTCCACCCTGGCCCGCCGCCTGGCCCCGGCCACCCCCCGAGCAAGCGGGCCCGGGGCTTCCCCGTGGCTGCCCCCCTGGATCCCGAGGACCCGTTCGATGCGCACGGGGAACTCACTGCCGACGACCTGGAGGAGCTCGACATCCTGGCGTCCCAGGCCCTGAGCCAGTGCCCGGCCGCGGCGCGGGACCTGTCCACTGTTCATAAGGTCCGAAGATTAGATGGGATGTCAAAAAGTCCTGCAGGGAAGAACACAGAAAATGCTCCAGTTAAAGATAACTTTGAACTAGAGGTACTTCAGACACAATACAAAGAACTTAAGGAAAAGCTGAAGGTGATGGAAGAAGAAATCCTCATTAAGAATGGAGAAATTAAAATCTTGCGGGACTCATTGCATCAGTCAGAATCCATTCTGGAAGAACAAAAACGATCACATTTCCTTCTTGAGCAAGAGAAAACCCAAGCACTCAGTGACAAAGAAAAAGAGTTCTCCAGAAAGGTACAATCATTGCAGTCTGAGCTCCAGTTTAAAGATGCAGAAATGAATGAATTAAGGACAAAGTTTCAGAGCAGTGAACGGGTGAATAAACTGGCTGCTCCCTCCATTTCCCATGTAAGTCCTAGGAAAAACCTTTCTGTGGTTATAAGACCAGAAGCATGTTCCTCACAGTTTGGAAAAACATCTTTTCCTACAAAGGAGTCTTTTAGTGCTAACATGTCCTTTCCCCACCCCTGCCAGACAGAGCCAGGATACAAGTCTCTGCTGGGCAGAGAGGATAATAAGACCCACAGTCTGAGAAGTAGTCCTATAAAGCAAGAAGAGGTACAGAAAAGTCTTACTGACAGCTGGATGCAGAAATCAAACACTGAAGGTTCCATTTTGATAAGCCTACTGCTGAAGCAGCCTTTGATCTCAGGGTCAGCCGTAGGTCTTTGCCACCTCCTGAGCAGTTGTTCTGAGGCTCCTACTGGCAACCTCTTGCAGCCTCTGGGGCTTGGCAGTATCTTGGCTGTGATTTCAGGCCTCAGAACCACAGGTTCTCACAGTGGGGCATTTTCCCCCTCAGCCCTGAGAGAAGCACAGAACCTGGCATTCACTGGACTGAATCTGATTGCCAGGAATGAAGGCTCATGTGATGGAGACCCAGCAGAGGGACCCAGAAGGGCCTTCCCACTCTGCCAGCTTCCTGGAGCCGTGCACCTCCTTCCCCTCATACAGTTCTTCATTGGCCTACACTGCCAGGCTTTGCAGGAGTTAGCAGTGGCTAAGAGGAGTGGAGCATCTGGGGACTCATCAACACATACCTCCTGCGTGGGCTCCGGGGTGGAGGCCAACCCTGAGGACTTGATTTCCAACCTGGAAGGCTTCTCTGTGGCTTCACTTAGCATTCTACAGCACCTGGTATGCCACAGCGGAGCAGTGGTCTGCCTATTACTGTCGGAAGTGGAGGCAGATGCTTCTTCTGGGGAAGGAAACGGGAGCCTGGTTCACAGACAGACTTGTGGAGAAATAATCTCAGCCCCTATGGGGGCTGCGGAAGACCAAGGACAGCATCCACTATTGAAGATGCTTCTTCACCTGTTGGCTTTCTCTTCCGCAGCAGGAGGTCACCTTCAAGCCAGTGTCCTGAGCCAGTGTCTCAAGGTTTTGGTGAAATTAGCTGAAAATGCTTCCTCTGATTTCTTGCCCAGGTTCCAGTGTGTGTTGCCAGTGCTGCCACGGTGCCTCAGCCCAGAGACACCCCTGCCTTGTGTGCTGCTGACTATTGAGCTGCTCTCTCTCCTGGTGGACCACGAGATCCTGGCATCGCAGTTCTGTTCCCACTCTGGCTGTCTCCTCCTGCTGCTGTACATGTACATCACTTCAAGGCCTGACAAGGGGACCTCAGAGACACAGTGGCTTCAGCTGGAACAGGAGGCAGTGTGGCTGCTAGCCAAGCTGGGTGTGCAGAGCTCTTCCTCCCCAGTCACTGGCTCTGACTGCCAGTGCAACGTGGAGGTGGTCAGAGCTCTCACGGTGATGTTGCACCGACAGTGGCTGACTGTGCGGAGGGCAGGGGGGCCCCCAAGGACTGAGTGGCAGAAGCGGACCATGCGCTGTCTGCGTGACACGGTGCTGCTGCTGCACAGCCTGTCCCAGAAAGACAAGCTCTTCACTGTGCACTGTGTGGAAGTCCTGCATCAGTATGACCAGGTGATGCCTGGGGTCAGCACACTGATTCGAGGGCTCCCTGATGTCATGGACTGTGAAGAGGCAGCCCTGGATGACCTCTGTGGCATGGAGACTGACGCGGATGATGCTGAGATGGACTGTGGCTGA

XM_004833937.1 Coding sequence

Shisa5 shisa homolog 5 (Xenopus laevis), transcript variant X4

Length: 711 bp    Location: 2449107..2416730   Strand: -
>XM_004833937.1
ATGGCCGCGCTGGCCCTTGCGCCCCGGACTTTCTGGCTGCTGCTGCTGCTGCTCCTGCCTCCGCCTCCGGGGGCCCGTGGTGAGGAGTGCACAACTGCCCTTGGAGGCAACTCGTTCCCCAAGCTCTGTCCTGATTTCTGCTGTGGCTCCTGTTCCAACCAATACTGCTGCTCTGATGTGCTGAAGAGACTTGTGTGGACCGAGGATGAGTGTGCTGTGCCCGAGGCCAGTTTCCCCACCCCCACAGAGCCTTGGGAGCAGCTTGGCTCGGCGCTGAGGTTTCGGTCCAGCTTTGACAGCGACCCCATGTCAGGGTTTGGAGCAACTGTAGCCATCGGCCTGACCATCTTTGTGCTGTCTGTCGTCACCATCATCATCTGCTTCACCTGCTCCTGCTGCTGTTTGTACAAGATGTGCCGCCGGCCGCGTCCCATCGTGACCACCACCACGGCCACCACTGTGGTGCACGCCCCTTACCCTCAGCCTCCAAGTGCACCCCCTAGCTACCCTGGACCGACGTACCAAGGCTACCACCCCATGCCTCCCCAGCCGGGAATGCCAGCAGCACCCTACCTGACGCAGTACCCACCACCCTACCCGGCCCAGCCCATGGGGCCTCCAGCCTACCATGAGACCTTGACTGGAGGTGCAGCTGCCAGTCAGCCTCCGTACAACCCGGCCTACATGGACCCCCCGAAAGCAGCCCCCTGA

XM_004833940.1 Coding sequence

Shisa5 shisa homolog 5 (Xenopus laevis), transcript variant X7

Length: 645 bp    Location: 2448133..2433343   Strand: -
>XM_004833940.1
ATGTCAGGGTTTGGAGCAACTGTAGCCATCGGCCTGACCATCTTTGTGCTGTCTGTCGTCACCATCATCATCTGCTTCACCTGCTCCTGCTGCTGTTTGTACAAGATGTGCCGCCGGCCGCGTCCCATCGTGACCACCACCACGGCCACCACTGTGGTGCACGCCCCTTACCCTCAGCCTCCAAGTGCACCCCCTAGCTACCCTGGACCGACGTACCAAGGCTACCACCCCATGCCTCCCCAGCCGGGAATGCCAGCAGCACCCTACCTGACGCAGTACCCACCACCCTACCCGGCCCAGCCCATGGGGCCTCCAGCCTACCATGAGACCTTGACTGGTGAGTACCAGGTGCACTCTGTGACCCTTCCTGGCCCCGACTCCCTCCTCTGCCCCACAGGTATCTATGCCAGGTACATCTGTATTGGAGCCCCCCATGCCCACAGACAACCGATGTTCTCTCCTTTCAGGAGGTGCAGCTGCCAGTCAGCCTCCGTACAACCCGGCCTACATGGACCCCCCGAAAGCAGCCCCCTGAGTGTACCCCACCTCTGTGGGTGCCACTTGATTGTGTGTGTGTGTGTTAGGTATGTGGGCACAGTTTTTACTACTCTATGTACATTGTATGTGACATGTGGCTTCCTCTGA

XM_004833939.1 Coding sequence

Shisa5 shisa homolog 5 (Xenopus laevis), transcript variant X6

Length: 642 bp    Location: 2436291..2433343   Strand: -
>XM_004833939.1
ATGGGGTTTGGAGCAACTGTAGCCATCGGCCTGACCATCTTTGTGCTGTCTGTCGTCACCATCATCATCTGCTTCACCTGCTCCTGCTGCTGTTTGTACAAGATGTGCCGCCGGCCGCGTCCCATCGTGACCACCACCACGGCCACCACTGTGGTGCACGCCCCTTACCCTCAGCCTCCAAGTGCACCCCCTAGCTACCCTGGACCGACGTACCAAGGCTACCACCCCATGCCTCCCCAGCCGGGAATGCCAGCAGCACCCTACCTGACGCAGTACCCACCACCCTACCCGGCCCAGCCCATGGGGCCTCCAGCCTACCATGAGACCTTGACTGGTGAGTACCAGGTGCACTCTGTGACCCTTCCTGGCCCCGACTCCCTCCTCTGCCCCACAGGTATCTATGCCAGGTACATCTGTATTGGAGCCCCCCATGCCCACAGACAACCGATGTTCTCTCCTTTCAGGAGGTGCAGCTGCCAGTCAGCCTCCGTACAACCCGGCCTACATGGACCCCCCGAAAGCAGCCCCCTGAGTGTACCCCACCTCTGTGGGTGCCACTTGATTGTGTGTGTGTGTGTTAGGTATGTGGGCACAGTTTTTACTACTCTATGTACATTGTATGTGACATGTGGCTTCCTCTGA

XM_004833938.1 Coding sequence

Shisa5 shisa homolog 5 (Xenopus laevis), transcript variant X5

Length: 690 bp    Location: 2449107..2434323   Strand: -
>XM_004833938.1
ATGGCCGCGCTGGCCCTTGCGCCCCGGACTTTCTGGCTGCTGCTGCTGCTGCTCCTGCCTCCGCCTCCGGGGGCCCGTGGTGAGGAGTGCACAACTGCCCTTGGAGGCAACTCGTTCCCCAAGCTCTGTCCTGATTTCTGCTGTGGCTCCTGTTCCAACCAATACTGCTGCTCTGATGTGCTGAAGAGACTTGTGTGGACCGAGGATGATTTCCCCACCCCCACAGAGCCTTGGGAGCAGCTTGGCTCGGCGCTGAGGTTTCGGTCCAGCTTTGACAGCGACCCCATGTCAGGGTTTGGAGCAACTGTAGCCATCGGCCTGACCATCTTTGTGCTGTCTGTCGTCACCATCATCATCTGCTTCACCTGCTCCTGCTGCTGTTTGTACAAGATGTGCCGCCGGCCGCGTCCCATCGTGACCACCACCACGGCCACCACTGTGGTGCACGCCCCTTACCCTCAGCCTCCAAGTGCACCCCCTAGCTACCCTGGACCGACGTACCAAGGCTACCACCCCATGCCTCCCCAGCCGGGAATGCCAGCAGCACCCTACCTGACGCAGTACCCACCACCCTACCCGGCCCAGCCCATGGGGCCTCCAGCCTACCATGAGACCTTGACTGGAGGTGCAGCTGCCAGTCAGCCTCCGTACAACCCGGCCTACATGGACCCCCCGAAAGCAGCCCCCTGA

XM_004833936.1 Coding sequence

Shisa5 shisa homolog 5 (Xenopus laevis), transcript variant X3

Length: 711 bp    Location: 2449107..2434323   Strand: -
>XM_004833936.1
ATGGCCGCGCTGGCCCTTGCGCCCCGGACTTTCTGGCTGCTGCTGCTGCTGCTCCTGCCTCCGCCTCCGGGGGCCCGTGGTGAGGAGTGCACAACTGCCCTTGGAGGCAACTCGTTCCCCAAGCTCTGTCCTGATTTCTGCTGTGGCTCCTGTTCCAACCAATACTGCTGCTCTGATGTGCTGAAGAGACTTGTGTGGACCGAGGATGAGTGTGCTGTGCCCGAGGCCAGTTTCCCCACCCCCACAGAGCCTTGGGAGCAGCTTGGCTCGGCGCTGAGGTTTCGGTCCAGCTTTGACAGCGACCCCATGTCAGGGTTTGGAGCAACTGTAGCCATCGGCCTGACCATCTTTGTGCTGTCTGTCGTCACCATCATCATCTGCTTCACCTGCTCCTGCTGCTGTTTGTACAAGATGTGCCGCCGGCCGCGTCCCATCGTGACCACCACCACGGCCACCACTGTGGTGCACGCCCCTTACCCTCAGCCTCCAAGTGCACCCCCTAGCTACCCTGGACCGACGTACCAAGGCTACCACCCCATGCCTCCCCAGCCGGGAATGCCAGCAGCACCCTACCTGACGCAGTACCCACCACCCTACCCGGCCCAGCCCATGGGGCCTCCAGCCTACCATGAGACCTTGACTGGAGGTGCAGCTGCCAGTCAGCCTCCGTACAACCCGGCCTACATGGACCCCCCGAAAGCAGCCCCCTGA

XM_004833948.1 Coding sequence

Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4, transcript variant X3

Length: 1308 bp    Location: 2566656..2519682   Strand: -
>XM_004833948.1
ATGACCAACTGCCCAACACTCATTGTCATGGTGGGCCTGCCAGCCAGGGGCAAGACCTACATTTCTAAGAAGATGACCCGATACTTGAACTGGATTGGAGTACCCACTCGGGAATTCAACGTTGGCCAGTATCGCCGGGACATGGTCAAGACCTACAAATCTTTTGAGTTTTTCCTCCCAGACAATGAAGAGGGCCTGAAAATCAGGAAGCAGTGTGCCCTGGCAGCCCTGTGTGATGTCCGGAGGTTCCTCAGTGAGGAGGGAGGACACGTGGCGGTTTTTGATGCAACCAACACTACTAGAGAGCGGAGAGCAACGATCTTCAATTTTGGGGAGCAGAATGGCTATAAGACCTTCTTTGTTGAGTCCATCTGTGTGGATCCTGAGGTCATAGCTGCCAACATTGTGCAAGTGAAGCTGGGCAGCCCCGACTATGTCAACCGGGACAGTGATGAGGCCACCGAGGATTTCATGAGACGAATTGAGTGCTACGAAAACTCCTATGAGTCTCTGGATGAGGACCTGGACAGGGATCTGTCCTATATCAAGATCATGGACGTGGGGCAGAGCTATGTGGTGAACCGAGTAGCTGACCACATCCAGAGCCGAATCGTGTATTATCTCATGAACATCCATGTGACACCCCGGTCCATCTACCTCTGCCGGCATGGGGAGAGTGAGCTCAACCTCAAGGGCCGGATTGGTGGGGACCCAGGACTGTCCCCTCGGGGCCGGCAGTTTGCCAAGAGCCTGGCTCAGTTCATAAGTGACCAGAACATCAAGGATCTGAAGGTCTGGACAAGCCAGATGAAGAGAACAATCCAAACAGCAGAGGCGCTGGGTGTGCCCTATGAGCAGTGGAAGGTCCTCAACGAGATCGATGCGGGTGTCTGCGAGGAAATGACCTACGAGGAAATTCAGGATCATTACCCACTGGAGTTTGCCCTGCGGGACCAGGACAAGTACCGGTATCGGTACCCCAAGGGGGAGTCCTATGAGGACCTAGTACAGCGGTTGGAGCCTGTCATCATGGAGCTAGAGAGGCAGGAGAATGTCCTGGTCATCTGCCACCAGGCTGTGATGCGCTGCCTCCTGGCCTACTTCCTTGACAAGGCAGCAGAACAGCTGCCCTACCTCAAGTGTCCACTGCACACAGTCCTGAAGCTCACTCCTGTGGCCTACGGTTGTAAAGTGGAGTCCATATTTCTGAACGTGGCAGCTGTGAACACACACCGGGACAGACCACAGAATGTGGACATCTCTCGGCCTCCAGAGGAAGCCCTTGTCACAGTCCCTGCTCACCAGTGA

XM_004833949.1 Coding sequence

Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4, transcript variant X4

Length: 1308 bp    Location: 2562800..2519682   Strand: -
>XM_004833949.1
ATGACCAACTGCCCAACACTCATTGTCATGGTGGGCCTGCCAGCCAGGGGCAAGACCTACATTTCTAAGAAGATGACCCGATACTTGAACTGGATTGGAGTACCCACTCGGGAATTCAACGTTGGCCAGTATCGCCGGGACATGGTCAAGACCTACAAATCTTTTGAGTTTTTCCTCCCAGACAATGAAGAGGGCCTGAAAATCAGGAAGCAGTGTGCCCTGGCAGCCCTGTGTGATGTCCGGAGGTTCCTCAGTGAGGAGGGAGGACACGTGGCGGTTTTTGATGCAACCAACACTACTAGAGAGCGGAGAGCAACGATCTTCAATTTTGGGGAGCAGAATGGCTATAAGACCTTCTTTGTTGAGTCCATCTGTGTGGATCCTGAGGTCATAGCTGCCAACATTGTGCAAGTGAAGCTGGGCAGCCCCGACTATGTCAACCGGGACAGTGATGAGGCCACCGAGGATTTCATGAGACGAATTGAGTGCTACGAAAACTCCTATGAGTCTCTGGATGAGGACCTGGACAGGGATCTGTCCTATATCAAGATCATGGACGTGGGGCAGAGCTATGTGGTGAACCGAGTAGCTGACCACATCCAGAGCCGAATCGTGTATTATCTCATGAACATCCATGTGACACCCCGGTCCATCTACCTCTGCCGGCATGGGGAGAGTGAGCTCAACCTCAAGGGCCGGATTGGTGGGGACCCAGGACTGTCCCCTCGGGGCCGGCAGTTTGCCAAGAGCCTGGCTCAGTTCATAAGTGACCAGAACATCAAGGATCTGAAGGTCTGGACAAGCCAGATGAAGAGAACAATCCAAACAGCAGAGGCGCTGGGTGTGCCCTATGAGCAGTGGAAGGTCCTCAACGAGATCGATGCGGGTGTCTGCGAGGAAATGACCTACGAGGAAATTCAGGATCATTACCCACTGGAGTTTGCCCTGCGGGACCAGGACAAGTACCGGTATCGGTACCCCAAGGGGGAGTCCTATGAGGACCTAGTACAGCGGTTGGAGCCTGTCATCATGGAGCTAGAGAGGCAGGAGAATGTCCTGGTCATCTGCCACCAGGCTGTGATGCGCTGCCTCCTGGCCTACTTCCTTGACAAGGCAGCAGAACAGCTGCCCTACCTCAAGTGTCCACTGCACACAGTCCTGAAGCTCACTCCTGTGGCCTACGGTTGTAAAGTGGAGTCCATATTTCTGAACGTGGCAGCTGTGAACACACACCGGGACAGACCACAGAATGTGGACATCTCTCGGCCTCCAGAGGAAGCCCTTGTCACAGTCCCTGCTCACCAGTGA

XM_004833947.1 Coding sequence

Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4, transcript variant X2

Length: 1362 bp    Location: 2562775..2519682   Strand: -
>XM_004833947.1
ATGGCGTCCCCGCGGGAATTGACCCAGAACCCCCTGAAGAAGATTTGGATGCCCTACAGCAACGGGCGCCCCGCCCTGCACGCCTGCCAGCGTGGTGCCAGGGGCAAGACCTACATTTCTAAGAAGATGACCCGATACTTGAACTGGATTGGAGTACCCACTCGGGAATTCAACGTTGGCCAGTATCGCCGGGACATGGTCAAGACCTACAAATCTTTTGAGTTTTTCCTCCCAGACAATGAAGAGGGCCTGAAAATCAGGAAGCAGTGTGCCCTGGCAGCCCTGTGTGATGTCCGGAGGTTCCTCAGTGAGGAGGGAGGACACGTGGCGGTTTTTGATGCAACCAACACTACTAGAGAGCGGAGAGCAACGATCTTCAATTTTGGGGAGCAGAATGGCTATAAGACCTTCTTTGTTGAGTCCATCTGTGTGGATCCTGAGGTCATAGCTGCCAACATTGTGCAAGTGAAGCTGGGCAGCCCCGACTATGTCAACCGGGACAGTGATGAGGCCACCGAGGATTTCATGAGACGAATTGAGTGCTACGAAAACTCCTATGAGTCTCTGGATGAGGACCTGGACAGGGATCTGTCCTATATCAAGATCATGGACGTGGGGCAGAGCTATGTGGTGAACCGAGTAGCTGACCACATCCAGAGCCGAATCGTGTATTATCTCATGAACATCCATGTGACACCCCGGTCCATCTACCTCTGCCGGCATGGGGAGAGTGAGCTCAACCTCAAGGGCCGGATTGGTGGGGACCCAGGACTGTCCCCTCGGGGCCGGCAGTTTGCCAAGAGCCTGGCTCAGTTCATAAGTGACCAGAACATCAAGGATCTGAAGGTCTGGACAAGCCAGATGAAGAGAACAATCCAAACAGCAGAGGCGCTGGGTGTGCCCTATGAGCAGTGGAAGGTCCTCAACGAGATCGATGCGGGTGTCTGCGAGGAAATGACCTACGAGGAAATTCAGGATCATTACCCACTGGAGTTTGCCCTGCGGGACCAGGACAAGTACCGGTATCGGTACCCCAAGGGGGAGTCCTATGAGGACCTAGTACAGCGGTTGGAGCCTGTCATCATGGAGCTAGAGAGGCAGGAGAATGTCCTGGTCATCTGCCACCAGGCTGTGATGCGCTGCCTCCTGGCCTACTTCCTTGACAAGGCAGCAGAACAGCTGCCCTACCTCAAGTGTCCACTGCACACAGTCCTGAAGCTCACTCCTGTGGCCTACGGTTGTAAAGTGGAGTCCATATTTCTGAACGTGGCAGCTGTGAACACACACCGGGACAGACCACAGAATGTGGACATCTCTCGGCCTCCAGAGGAAGCCCTTGTCACAGTCCCTGCTCACCAGTGA

XM_004833952.1 Coding sequence

Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4, transcript variant X7

Length: 1305 bp    Location: 2562775..2519682   Strand: -
>XM_004833952.1
ATGGCGTCCCCGCGGGAATTGACCCAGAACCCCCTGAAGAAGATTTGGATGCCCTACAGCAACGGGCGCCCCGCCCTGCACGCCTGCCAGCGTGGTGTTTGCATGACCAACTGCCCAACACTCATTGTCATGGTGGGCCTGCCAGCCAGGGGCAAGACCTACATTTCTAAGAAGATGACCCGATACTTGAACTGGATTGGAGTACCCACTCGGGAATTCAACGTTGGCCAGTATCGCCGGGACATGGTCAAGACCTACAAATCTTTTGAGTTTTTCCTCCCAGACAATGAAGAGGGCCTGAAAATCAGGAAGCAGTGTGCCCTGGCAGCCCTGTGTGATGTCCGGAGGTTCCTCAGTGAGGAGGGAGGACACGTGGCGGTTTTTGATGCAACCAACACTACTAGAGAGCGGAGAGCAACGATCTTCAATTTTGGGGAGCAGAATGGCTATAAGACCTTCTTTGTTGAGTCCATCTGTGTGGATCCTGAGGTCATAGCTGCCAACATTGTGCAAGTGAAGCTGGGCAGCCCCGACTATGTCAACCGGGACAGTGATGAGGCCACCGAGGATTTCATGAGACGAATTGAGTGCTACGAAAACTCCTATGAGTCTCTGGATGAGGACCTGGACAGGGATCTGTCCTATATCAAGATCATGGACGTGGGGCAGAGCTATGTGGTGAACCGAGTAGCTGACCACATCCAGAGCCGAATCGTGTATTATCTCATGAACATCCATGTGACACCCCGGTCCATCTACCTCTGCCGGCATGGGGAGAGTGAGCTCAACCTCAAGGGCCGGATTGGTGGGGACCCAGGACTGTCCCCTCGGGGCCGGCAGTTTGCCAAGAGCCTGGCTCAGTTCATAAGTGACCAGAACATCAAGGATCTGAAGGTCTGGACAAGCCAGATGAAGAGAACAATCCAAACAGCAGAGGCGCTGGGTGTGCCCTATGAGCAGTGGAAGGTCCTCAACGAGATCGATGCGTCCTATGAGGACCTAGTACAGCGGTTGGAGCCTGTCATCATGGAGCTAGAGAGGCAGGAGAATGTCCTGGTCATCTGCCACCAGGCTGTGATGCGCTGCCTCCTGGCCTACTTCCTTGACAAGGCAGCAGAACAGCTGCCCTACCTCAAGTGTCCACTGCACACAGTCCTGAAGCTCACTCCTGTGGCCTACGGTTGTAAAGTGGAGTCCATATTTCTGAACGTGGCAGCTGTGAACACACACCGGGACAGACCACAGAATGTGGACATCTCTCGGCCTCCAGAGGAAGCCCTTGTCACAGTCCCTGCTCACCAGTGA

XM_004833946.1 Coding sequence

Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4, transcript variant X1

High confidence: 3 potential gene matches
Length: 1410 bp    Location: 2562775..2519682   Strand: -
>XM_004833946.1
ATGGCGTCCCCGCGGGAATTGACCCAGAACCCCCTGAAGAAGATTTGGATGCCCTACAGCAACGGGCGCCCCGCCCTGCACGCCTGCCAGCGTGGTGTTTGCATGACCAACTGCCCAACACTCATTGTCATGGTGGGCCTGCCAGCCAGGGGCAAGACCTACATTTCTAAGAAGATGACCCGATACTTGAACTGGATTGGAGTACCCACTCGGGAATTCAACGTTGGCCAGTATCGCCGGGACATGGTCAAGACCTACAAATCTTTTGAGTTTTTCCTCCCAGACAATGAAGAGGGCCTGAAAATCAGGAAGCAGTGTGCCCTGGCAGCCCTGTGTGATGTCCGGAGGTTCCTCAGTGAGGAGGGAGGACACGTGGCGGTTTTTGATGCAACCAACACTACTAGAGAGCGGAGAGCAACGATCTTCAATTTTGGGGAGCAGAATGGCTATAAGACCTTCTTTGTTGAGTCCATCTGTGTGGATCCTGAGGTCATAGCTGCCAACATTGTGCAAGTGAAGCTGGGCAGCCCCGACTATGTCAACCGGGACAGTGATGAGGCCACCGAGGATTTCATGAGACGAATTGAGTGCTACGAAAACTCCTATGAGTCTCTGGATGAGGACCTGGACAGGGATCTGTCCTATATCAAGATCATGGACGTGGGGCAGAGCTATGTGGTGAACCGAGTAGCTGACCACATCCAGAGCCGAATCGTGTATTATCTCATGAACATCCATGTGACACCCCGGTCCATCTACCTCTGCCGGCATGGGGAGAGTGAGCTCAACCTCAAGGGCCGGATTGGTGGGGACCCAGGACTGTCCCCTCGGGGCCGGCAGTTTGCCAAGAGCCTGGCTCAGTTCATAAGTGACCAGAACATCAAGGATCTGAAGGTCTGGACAAGCCAGATGAAGAGAACAATCCAAACAGCAGAGGCGCTGGGTGTGCCCTATGAGCAGTGGAAGGTCCTCAACGAGATCGATGCGGGTGTCTGCGAGGAAATGACCTACGAGGAAATTCAGGATCATTACCCACTGGAGTTTGCCCTGCGGGACCAGGACAAGTACCGGTATCGGTACCCCAAGGGGGAGTCCTATGAGGACCTAGTACAGCGGTTGGAGCCTGTCATCATGGAGCTAGAGAGGCAGGAGAATGTCCTGGTCATCTGCCACCAGGCTGTGATGCGCTGCCTCCTGGCCTACTTCCTTGACAAGGCAGCAGAACAGCTGCCCTACCTCAAGTGTCCACTGCACACAGTCCTGAAGCTCACTCCTGTGGCCTACGGTTGTAAAGTGGAGTCCATATTTCTGAACGTGGCAGCTGTGAACACACACCGGGACAGACCACAGAATGTGGACATCTCTCGGCCTCCAGAGGAAGCCCTTGTCACAGTCCCTGCTCACCAGTGA

XM_004833951.1 Coding sequence

Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4, transcript variant X6

Length: 1308 bp    Location: 2562455..2519682   Strand: -
>XM_004833951.1
ATGACCAACTGCCCAACACTCATTGTCATGGTGGGCCTGCCAGCCAGGGGCAAGACCTACATTTCTAAGAAGATGACCCGATACTTGAACTGGATTGGAGTACCCACTCGGGAATTCAACGTTGGCCAGTATCGCCGGGACATGGTCAAGACCTACAAATCTTTTGAGTTTTTCCTCCCAGACAATGAAGAGGGCCTGAAAATCAGGAAGCAGTGTGCCCTGGCAGCCCTGTGTGATGTCCGGAGGTTCCTCAGTGAGGAGGGAGGACACGTGGCGGTTTTTGATGCAACCAACACTACTAGAGAGCGGAGAGCAACGATCTTCAATTTTGGGGAGCAGAATGGCTATAAGACCTTCTTTGTTGAGTCCATCTGTGTGGATCCTGAGGTCATAGCTGCCAACATTGTGCAAGTGAAGCTGGGCAGCCCCGACTATGTCAACCGGGACAGTGATGAGGCCACCGAGGATTTCATGAGACGAATTGAGTGCTACGAAAACTCCTATGAGTCTCTGGATGAGGACCTGGACAGGGATCTGTCCTATATCAAGATCATGGACGTGGGGCAGAGCTATGTGGTGAACCGAGTAGCTGACCACATCCAGAGCCGAATCGTGTATTATCTCATGAACATCCATGTGACACCCCGGTCCATCTACCTCTGCCGGCATGGGGAGAGTGAGCTCAACCTCAAGGGCCGGATTGGTGGGGACCCAGGACTGTCCCCTCGGGGCCGGCAGTTTGCCAAGAGCCTGGCTCAGTTCATAAGTGACCAGAACATCAAGGATCTGAAGGTCTGGACAAGCCAGATGAAGAGAACAATCCAAACAGCAGAGGCGCTGGGTGTGCCCTATGAGCAGTGGAAGGTCCTCAACGAGATCGATGCGGGTGTCTGCGAGGAAATGACCTACGAGGAAATTCAGGATCATTACCCACTGGAGTTTGCCCTGCGGGACCAGGACAAGTACCGGTATCGGTACCCCAAGGGGGAGTCCTATGAGGACCTAGTACAGCGGTTGGAGCCTGTCATCATGGAGCTAGAGAGGCAGGAGAATGTCCTGGTCATCTGCCACCAGGCTGTGATGCGCTGCCTCCTGGCCTACTTCCTTGACAAGGCAGCAGAACAGCTGCCCTACCTCAAGTGTCCACTGCACACAGTCCTGAAGCTCACTCCTGTGGCCTACGGTTGTAAAGTGGAGTCCATATTTCTGAACGTGGCAGCTGTGAACACACACCGGGACAGACCACAGAATGTGGACATCTCTCGGCCTCCAGAGGAAGCCCTTGTCACAGTCCCTGCTCACCAGTGA

XM_004833950.1 Coding sequence

Pfkfb4 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4, transcript variant X5

Length: 1308 bp    Location: 2561125..2519682   Strand: -
>XM_004833950.1
ATGACCAACTGCCCAACACTCATTGTCATGGTGGGCCTGCCAGCCAGGGGCAAGACCTACATTTCTAAGAAGATGACCCGATACTTGAACTGGATTGGAGTACCCACTCGGGAATTCAACGTTGGCCAGTATCGCCGGGACATGGTCAAGACCTACAAATCTTTTGAGTTTTTCCTCCCAGACAATGAAGAGGGCCTGAAAATCAGGAAGCAGTGTGCCCTGGCAGCCCTGTGTGATGTCCGGAGGTTCCTCAGTGAGGAGGGAGGACACGTGGCGGTTTTTGATGCAACCAACACTACTAGAGAGCGGAGAGCAACGATCTTCAATTTTGGGGAGCAGAATGGCTATAAGACCTTCTTTGTTGAGTCCATCTGTGTGGATCCTGAGGTCATAGCTGCCAACATTGTGCAAGTGAAGCTGGGCAGCCCCGACTATGTCAACCGGGACAGTGATGAGGCCACCGAGGATTTCATGAGACGAATTGAGTGCTACGAAAACTCCTATGAGTCTCTGGATGAGGACCTGGACAGGGATCTGTCCTATATCAAGATCATGGACGTGGGGCAGAGCTATGTGGTGAACCGAGTAGCTGACCACATCCAGAGCCGAATCGTGTATTATCTCATGAACATCCATGTGACACCCCGGTCCATCTACCTCTGCCGGCATGGGGAGAGTGAGCTCAACCTCAAGGGCCGGATTGGTGGGGACCCAGGACTGTCCCCTCGGGGCCGGCAGTTTGCCAAGAGCCTGGCTCAGTTCATAAGTGACCAGAACATCAAGGATCTGAAGGTCTGGACAAGCCAGATGAAGAGAACAATCCAAACAGCAGAGGCGCTGGGTGTGCCCTATGAGCAGTGGAAGGTCCTCAACGAGATCGATGCGGGTGTCTGCGAGGAAATGACCTACGAGGAAATTCAGGATCATTACCCACTGGAGTTTGCCCTGCGGGACCAGGACAAGTACCGGTATCGGTACCCCAAGGGGGAGTCCTATGAGGACCTAGTACAGCGGTTGGAGCCTGTCATCATGGAGCTAGAGAGGCAGGAGAATGTCCTGGTCATCTGCCACCAGGCTGTGATGCGCTGCCTCCTGGCCTACTTCCTTGACAAGGCAGCAGAACAGCTGCCCTACCTCAAGTGTCCACTGCACACAGTCCTGAAGCTCACTCCTGTGGCCTACGGTTGTAAAGTGGAGTCCATATTTCTGAACGTGGCAGCTGTGAACACACACCGGGACAGACCACAGAATGTGGACATCTCTCGGCCTCCAGAGGAAGCCCTTGTCACAGTCCCTGCTCACCAGTGA

XM_004833958.1 Coding sequence

LOC101719627 cytochrome b-c1 complex subunit 1, mitochondrial-like, transcript variant X2

Length: 1392 bp    Location: 2613095..2603301   Strand: -
>XM_004833958.1
ATGGCGGCGTCCGCAGTATGCCGGGCGGCCAGAGTTGGGGGACAAGTGCTGCTTCGTACCGGCCGCTTGGCTCTGCAGGCCGCTCCGGAGACTCAGGTCAGCGTGCTGGACAACGGGCTTCGCGTGGCCTCGGAGCACTCGGCCCGGCCCACCTGCACGGTAGGAGTGTGGATTGATGCTGGTAGCCGTTATGAGACTGAGAAGAACAACGGGGCAGGCTACTTCGTGGAACATTTGGCTTTCAAGGGAACAAAGAATCGGCCTGGCAATAGCCTTGAGAAGGAGGTAGAGAACATGGGGGCCCATCTTAATGCCTACAGCACTCGGGAACACACAGCCTACTATATCAAGGCACTGTCCAAAGACCTGCCAAAAGTTGTGGAAGTTCTGGCCGACATTGTGCAGAACTGCAGCCTGGAAGACTCACAGATTGAAAAGGAACGAGACGTGATCCTGCAGGAGATGCAGGAAAATGATGCCTCTATGCGGGATGTGGTCTTTGACTACCTGCATGCCACGGCATTCCAGGGCACACCTCTTGCCCAGGCTGTGGAGGGGCCCAGTCAGAACGTCAGGAAGCTGTCTCGGGCAGACTTGATGGAATACCTCAGCAGGCATTACAAAGCTCCACGCATGGTGCTGGCAGCAGCTGGGGGGGTGGAGCACCAGCAGCTGCTAGACCTTGCCCAGAAGCACTTCAGCAGCGTCTCTCCAACATACCCAGAGGACGCCGTGCCTGCTCTAACTCCATGCCGCTTCACTGGCAGTGAGATCCGCCACCGTGATGATGCCCTGCCTTTGGCCCATGTGGCCATTGCAGTAGAAGGACCTGGCTGGGCCAACCCAGATAATGTAGCTCTCCAAGTGGCCAGTGCCATGATTGGCCACTATGACTGCACTTATGGTGGTGGCGTGCACCTGTCCAGCCCACTGGCTTCAGTAGCAGCGGCCAAGAAGGTGTGCCAGAGTTTTCAGACCTTCAACATCTGCTACACGGAGACTGGGTTGCTGGGAGCACACTTTGTCTGTGACCCTGTGAGCATTGATGACATGATGTTCTTCCTGCAAGGCCAGTGGATGCGCCTGTGCACCAGTGCCACGGAGAGTGAAGTGACTCGGGGCAAAAACATCCTCAGAAATGCCCTGGTATCTCATCTGGATGGCACCACTCCTGTGTGCGAGGACATTGGACGAAGCCTCCTGACCTATGGCCGCCGCATCCCCCTGGCCGAGTGGGAGAGCCGGATTGCGGAGGTGGATGCCCAAGTGGTGCGTAAGGTCTGCTCCAAATACTTCTATGACCAGTGTCCAGCAGTGGCTGGATTTGGCCCCATCGAGCAGCTCCCAGACTACAACCGGATCCGTAGTGGCATGTTCTGGCTGCGCTTTTAG

XM_004833957.1 Coding sequence

LOC101719627 cytochrome b-c1 complex subunit 1, mitochondrial-like, transcript variant X1

Length: 1443 bp    Location: 2613095..2603301   Strand: -
>XM_004833957.1
ATGGCGGCGTCCGCAGTATGCCGGGCGGCCAGAGTTGGGGGACAAGTGCTGCTTCGTACCGGCCGCTTGCCGGCCCTGCTGAGGGCGCCTGCCTTACGGGGCGCCGCGACCTTCGCACAGGCTCTGCAGGCCGCTCCGGAGACTCAGGTCAGCGTGCTGGACAACGGGCTTCGCGTGGCCTCGGAGCACTCGGCCCGGCCCACCTGCACGGTAGGAGTGTGGATTGATGCTGGTAGCCGTTATGAGACTGAGAAGAACAACGGGGCAGGCTACTTCGTGGAACATTTGGCTTTCAAGGGAACAAAGAATCGGCCTGGCAATAGCCTTGAGAAGGAGGTAGAGAACATGGGGGCCCATCTTAATGCCTACAGCACTCGGGAACACACAGCCTACTATATCAAGGCACTGTCCAAAGACCTGCCAAAAGTTGTGGAAGTTCTGGCCGACATTGTGCAGAACTGCAGCCTGGAAGACTCACAGATTGAAAAGGAACGAGACGTGATCCTGCAGGAGATGCAGGAAAATGATGCCTCTATGCGGGATGTGGTCTTTGACTACCTGCATGCCACGGCATTCCAGGGCACACCTCTTGCCCAGGCTGTGGAGGGGCCCAGTCAGAACGTCAGGAAGCTGTCTCGGGCAGACTTGATGGAATACCTCAGCAGGCATTACAAAGCTCCACGCATGGTGCTGGCAGCAGCTGGGGGGGTGGAGCACCAGCAGCTGCTAGACCTTGCCCAGAAGCACTTCAGCAGCGTCTCTCCAACATACCCAGAGGACGCCGTGCCTGCTCTAACTCCATGCCGCTTCACTGGCAGTGAGATCCGCCACCGTGATGATGCCCTGCCTTTGGCCCATGTGGCCATTGCAGTAGAAGGACCTGGCTGGGCCAACCCAGATAATGTAGCTCTCCAAGTGGCCAGTGCCATGATTGGCCACTATGACTGCACTTATGGTGGTGGCGTGCACCTGTCCAGCCCACTGGCTTCAGTAGCAGCGGCCAAGAAGGTGTGCCAGAGTTTTCAGACCTTCAACATCTGCTACACGGAGACTGGGTTGCTGGGAGCACACTTTGTCTGTGACCCTGTGAGCATTGATGACATGATGTTCTTCCTGCAAGGCCAGTGGATGCGCCTGTGCACCAGTGCCACGGAGAGTGAAGTGACTCGGGGCAAAAACATCCTCAGAAATGCCCTGGTATCTCATCTGGATGGCACCACTCCTGTGTGCGAGGACATTGGACGAAGCCTCCTGACCTATGGCCGCCGCATCCCCCTGGCCGAGTGGGAGAGCCGGATTGCGGAGGTGGATGCCCAAGTGGTGCGTAAGGTCTGCTCCAAATACTTCTATGACCAGTGTCCAGCAGTGGCTGGATTTGGCCCCATCGAGCAGCTCCCAGACTACAACCGGATCCGTAGTGGCATGTTCTGGCTGCGCTTTTAG

XM_004833966.1 Coding sequence

Slc26a6 solute carrier family 26, member 6, transcript variant X3

Length: 2139 bp    Location: 2650033..2639941   Strand: -
>XM_004833966.1
ATGGGGCCGTTGGATGGGTGCGAACTGAGGGACACACAGGCACTGCTGTCTACAATACCAACCATGGAGCTTCAGAAACGCGACTATCTTGTAGAACGGCCACTGCTGAACCAGGAGCAGCTGGAGCACCTGGGGCACTGGGGCCCAACACCTAGGACCCATCAATGGCGAACCTGGTTTCAGTGCTCCCATTCTCGGGCCCATGGCTATCTACTCAAATACCTCCCAGTCTTGGGCTGGTTACCCCACTATCGTGTGCGTGAGTGGCTCCTGGGTGACTTGTTGTCTGGCCTGAGTGTGGCCATCATGCAGCTTCCACAGGGCTTGGCCTATGCCCTCCTGGCTGGATTACCCCCTGTGTTTGGCCTCTACAGCTCCTTCTACCCTGTCTTTGTATACTTCCTGTTTGGTACTTCCCGACACATCTCTGTGGGGACCTTTGCTATCATGTCTGTAATGGTGGGCAGTGTGACAGAATCCATCACTCAGGATGAGGACTTCCAGCAGAACACAAACTCTACTGTCAGTGCCCGTGTGCAGCTGGCCTCCACACTCAGTGTCCTGGTGGGCCTCTTCCAGGTGGCACTGGGCCTGGTGCACTTCGGCTTTGTGGTCAACTACCTGTCTGAGCCACTGGTGCGAAGCTACACCACAGCTGCATCTGTGCAGGTCTTCGTCTCACAGCTCAAGTATGTGTTCGGCCTCCAGTTGAGCAGCCGCTCAGGGCCCCTGTCCCTTATCTATACTTTTCTGGAGGTCTGCTGGAATTTGCCCAAGAGTGTGGTTGGCACCGTGGTCACTGCAGTTGTGGCAGGGGTGGCGCTCGTGATGGTGAAGATATTGAATGACAAGCTGCATCGGCATCTCCCTCTGCCAATACCTGGGGAGCTGCTCACGCTCATTGCAGCCACAGGCATCTCCTATGGTGTGAACCTGAGAAACAGATTTGAGGTGGACACTGTGGGCACCATCCCCACAGGGCTGATCGCCCCCATGATACCCAACCCCCAGCTGTTCGGAAAGCTGGTGGGACATGCCTTCGCCATCGCTGTGGTCGGGTTTGCCATTGCCATCTCACTGGGGAAGATCTTCGCTCTCAGACACGGCTACCGGGTGGACAGCAACCAGGAGCTGGTGGCCCTCGGCCTCAGTAACTTTGTTGGAGGCTTCTTCCAGTGCTTCCCTGTGAGCTGCTCCATGTCCCGGAGCCTGGTACAGGAGACCACCGGGGGCAACACACAGGTTGCTGGAGCAGTCTCTTCCCTCTTTATCCTCCTCATCATCCTTAAACTGGGGGAACTCTTCCGAGAACTGCCCAAGGCAGTTCTGGCAGCCATCATTATTGTGAACCTGAAGGGCATGTTGAAGCAATTCACTGACATATGCACCCTCTGGAAGGCAAATCGAGTAGACCTGCTTATCTGGGTGGTAACCTTTGTGGCCACCATCCTGTTAAACCTGGACCTTGGCCTGGCAGTTGCGATAGGCTTCTCCCTGCTGCTTGTGGTGGTACGAACACAGATGCCCCGGTACTCTGTCCTGGGGCAGGTGCCAGACACGGACATTTACAGAGATGTGGCGGAGTACTCAGAGGCCAAGGAGATCCCCGGTGTGAAAGTCTTCCGGTCCTCAGCCACCTTGTACTTTGCCAACGCTGAGCTCTACAGTGACACATTGAAGCAGAGGTGCGGGGTGGATGTTGACCGTCTTCTGGCCCAGAAGAAGAAGCGGCTGAGGAAACAGGAACGGAAGCTAAAGCAACAGCAGAAACACAAACAGGCTGCCTCTTCCAATGGCACCTCAGTTTCTATCAGTGTGGACACCAGCCTCGGAGACATCAAGGGCAGTGGTGTGGAGGACTCCAGGGTCAAGGTGAGCCCAGCAAATGAACTGGAGGATGTGGTAGTCAGCAGGCAAGAAGATGCCAAGGCCCCAGATGTGTCCACGCTGAAGGCCCTGGGCCTGCCCCGGCCGGACTTCCACAGTCTCATCTTGGACCTGGGGGCCCTCTCCTTTGTGGACACTGTGTGCATCAAGAGCCTGAAGAATGCCCTGTGGTCACCCAGCTTGAGGCTGGGTGCTTCTTTGATGCATCTATCACTAAGAAGCATCTCTTTGTCTCTGTCCATGACGCTGTGA

XM_004833964.1 Coding sequence

Slc26a6 solute carrier family 26, member 6, transcript variant X1

Length: 2256 bp    Location: 2650033..2639941   Strand: -
>XM_004833964.1
ATGGGGCCGTTGGATGGGTGCGAACTGAGGGACACACAGGCACTGCTGTCTACAATACCAACCATGGAGCTTCAGAAACGCGACTATCTTGTAGAACGGCCACTGCTGAACCAGGAGCAGCTGGAGCACCTGGGGCACTGGGGCCCAACACCTAGGACCCATCAATGGCGAACCTGGTTTCAGTGCTCCCATTCTCGGGCCCATGGCTATCTACTCAAATACCTCCCAGTCTTGGGCTGGTTACCCCACTATCGTGTGCGTGAGTGGCTCCTGGGTGACTTGTTGTCTGGCCTGAGTGTGGCCATCATGCAGCTTCCACAGGGCTTGGCCTATGCCCTCCTGGCTGGATTACCCCCTGTGTTTGGCCTCTACAGCTCCTTCTACCCTGTCTTTGTATACTTCCTGTTTGGTACTTCCCGACACATCTCTGTGGGGACCTTTGCTATCATGTCTGTAATGGTGGGCAGTGTGACAGAATCCATCACTCAGGATGAGGACTTCCAGCAGAACACAAACTCTACTGTCAGTGCCCGTGTGCAGCTGGCCTCCACACTCAGTGTCCTGGTGGGCCTCTTCCAGGTGGCACTGGGCCTGGTGCACTTCGGCTTTGTGGTCAACTACCTGTCTGAGCCACTGGTGCGAAGCTACACCACAGCTGCATCTGTGCAGGTCTTCGTCTCACAGCTCAAGTATGTGTTCGGCCTCCAGTTGAGCAGCCGCTCAGGGCCCCTGTCCCTTATCTATACTTTTCTGGAGGTCTGCTGGAATTTGCCCAAGAGTGTGGTTGGCACCGTGGTCACTGCAGTTGTGGCAGGGGTGGCGCTCGTGATGGTGAAGATATTGAATGACAAGCTGCATCGGCATCTCCCTCTGCCAATACCTGGGGAGCTGCTCACGCTCATTGCAGCCACAGGCATCTCCTATGGTGTGAACCTGAGAAACAGATTTGAGGTGGACACTGTGGGCACCATCCCCACAGGGCTGATCGCCCCCATGATACCCAACCCCCAGCTGTTCGGAAAGCTGGTGGGACATGCCTTCGCCATCGCTGTGGTCGGGTTTGCCATTGCCATCTCACTGGGGAAGATCTTCGCTCTCAGACACGGCTACCGGGTGGACAGCAACCAGGAGCTGGTGGCCCTCGGCCTCAGTAACTTTGTTGGAGGCTTCTTCCAGTGCTTCCCTGTGAGCTGCTCCATGTCCCGGAGCCTGGTACAGGAGACCACCGGGGGCAACACACAGGTTGCTGGAGCAGTCTCTTCCCTCTTTATCCTCCTCATCATCCTTAAACTGGGGGAACTCTTCCGAGAACTGCCCAAGGCAGTTCTGGCAGCCATCATTATTGTGAACCTGAAGGGCATGTTGAAGCAATTCACTGACATATGCACCCTCTGGAAGGCAAATCGAGTAGACCTGCTTATCTGGGTGGTAACCTTTGTGGCCACCATCCTGTTAAACCTGGACCTTGGCCTGGCAGTTGCGATAGGCTTCTCCCTGCTGCTTGTGGTGGTACGAACACAGATGCCCCGGTACTCTGTCCTGGGGCAGGTGCCAGACACGGACATTTACAGAGATGTGGCGGAGTACTCAGAGGCCAAGGAGATCCCCGGTGTGAAAGTCTTCCGGTCCTCAGCCACCTTGTACTTTGCCAACGCTGAGCTCTACAGTGACACATTGAAGCAGAGGTGCGGGGTGGATGTTGACCGTCTTCTGGCCCAGAAGAAGAAGCGGCTGAGGAAACAGGAACGGAAGCTAAAGCAACAGCAGAAACACAAACAGGCTGCCTCTTCCAATGGCACCTCAGTTTCTATCAGTGTGGACACCAGCCTCGGAGACATCAAGGGCAGTGGTGTGGAGGACTCCAGGGTCAAGGTGAGCCCAGCAAATGAACTGGAGGATGTGGTAGTCAGCAGGCAAGAAGATGCCAAGGCCCCAGATGTGTCCACGCTGAAGGCCCTGGGCCTGCCCCGGCCGGACTTCCACAGTCTCATCTTGGACCTGGGGGCCCTCTCCTTTGTGGACACTGTGTGCATCAAGAGCCTGAAGAATATTTTCCGTGACTTTCGTGAGATAGAGGTGGAGGTGTACATTGCGGCCTGCCACAGCCCTGTGGTCACCCAGCTTGAGGCTGGGTGCTTCTTTGATGCATCTATCACTAAGAAGCATCTCTTTGTCTCTGTCCATGACGCTGTGACCTTTGCCCTCCAACACTCAAGGTCTGGTCCCAACAGCCCTGTTTTGGCCACCAAACTCTGA

XM_004833965.1 Coding sequence

Slc26a6 solute carrier family 26, member 6, transcript variant X2

Length: 2193 bp    Location: 2650033..2639941   Strand: -
>XM_004833965.1
ATGGAGCTTCAGAAACGCGACTATCTTGTAGAACGGCCACTGCTGAACCAGGAGCAGCTGGAGCACCTGGGGCACTGGGGCCCAACACCTAGGACCCATCAATGGCGAACCTGGTTTCAGTGCTCCCATTCTCGGGCCCATGGCTATCTACTCAAATACCTCCCAGTCTTGGGCTGGTTACCCCACTATCGTGTGCGTGAGTGGCTCCTGGGTGACTTGTTGTCTGGCCTGAGTGTGGCCATCATGCAGCTTCCACAGGGCTTGGCCTATGCCCTCCTGGCTGGATTACCCCCTGTGTTTGGCCTCTACAGCTCCTTCTACCCTGTCTTTGTATACTTCCTGTTTGGTACTTCCCGACACATCTCTGTGGGGACCTTTGCTATCATGTCTGTAATGGTGGGCAGTGTGACAGAATCCATCACTCAGGATGAGGACTTCCAGCAGAACACAAACTCTACTGTCAGTGCCCGTGTGCAGCTGGCCTCCACACTCAGTGTCCTGGTGGGCCTCTTCCAGGTGGCACTGGGCCTGGTGCACTTCGGCTTTGTGGTCAACTACCTGTCTGAGCCACTGGTGCGAAGCTACACCACAGCTGCATCTGTGCAGGTCTTCGTCTCACAGCTCAAGTATGTGTTCGGCCTCCAGTTGAGCAGCCGCTCAGGGCCCCTGTCCCTTATCTATACTTTTCTGGAGGTCTGCTGGAATTTGCCCAAGAGTGTGGTTGGCACCGTGGTCACTGCAGTTGTGGCAGGGGTGGCGCTCGTGATGGTGAAGATATTGAATGACAAGCTGCATCGGCATCTCCCTCTGCCAATACCTGGGGAGCTGCTCACGCTCATTGCAGCCACAGGCATCTCCTATGGTGTGAACCTGAGAAACAGATTTGAGGTGGACACTGTGGGCACCATCCCCACAGGGCTGATCGCCCCCATGATACCCAACCCCCAGCTGTTCGGAAAGCTGGTGGGACATGCCTTCGCCATCGCTGTGGTCGGGTTTGCCATTGCCATCTCACTGGGGAAGATCTTCGCTCTCAGACACGGCTACCGGGTGGACAGCAACCAGGAGCTGGTGGCCCTCGGCCTCAGTAACTTTGTTGGAGGCTTCTTCCAGTGCTTCCCTGTGAGCTGCTCCATGTCCCGGAGCCTGGTACAGGAGACCACCGGGGGCAACACACAGGTTGCTGGAGCAGTCTCTTCCCTCTTTATCCTCCTCATCATCCTTAAACTGGGGGAACTCTTCCGAGAACTGCCCAAGGCAGTTCTGGCAGCCATCATTATTGTGAACCTGAAGGGCATGTTGAAGCAATTCACTGACATATGCACCCTCTGGAAGGCAAATCGAGTAGACCTGCTTATCTGGGTGGTAACCTTTGTGGCCACCATCCTGTTAAACCTGGACCTTGGCCTGGCAGTTGCGATAGGCTTCTCCCTGCTGCTTGTGGTGGTACGAACACAGATGCCCCGGTACTCTGTCCTGGGGCAGGTGCCAGACACGGACATTTACAGAGATGTGGCGGAGTACTCAGAGGCCAAGGAGATCCCCGGTGTGAAAGTCTTCCGGTCCTCAGCCACCTTGTACTTTGCCAACGCTGAGCTCTACAGTGACACATTGAAGCAGAGGTGCGGGGTGGATGTTGACCGTCTTCTGGCCCAGAAGAAGAAGCGGCTGAGGAAACAGGAACGGAAGCTAAAGCAACAGCAGAAACACAAACAGGCTGCCTCTTCCAATGGCACCTCAGTTTCTATCAGTGTGGACACCAGCCTCGGAGACATCAAGGGCAGTGGTGTGGAGGACTCCAGGGTCAAGGTGAGCCCAGCAAATGAACTGGAGGATGTGGTAGTCAGCAGGCAAGAAGATGCCAAGGCCCCAGATGTGTCCACGCTGAAGGCCCTGGGCCTGCCCCGGCCGGACTTCCACAGTCTCATCTTGGACCTGGGGGCCCTCTCCTTTGTGGACACTGTGTGCATCAAGAGCCTGAAGAATATTTTCCGTGACTTTCGTGAGATAGAGGTGGAGGTGTACATTGCGGCCTGCCACAGCCCTGTGGTCACCCAGCTTGAGGCTGGGTGCTTCTTTGATGCATCTATCACTAAGAAGCATCTCTTTGTCTCTGTCCATGACGCTGTGACCTTTGCCCTCCAACACTCAAGGTCTGGTCCCAACAGCCCTGTTTTGGCCACCAAACTCTGA

XM_004833967.1 Coding sequence

Slc26a6 solute carrier family 26, member 6, transcript variant X4

Length: 2112 bp    Location: 2650033..2641322   Strand: -
>XM_004833967.1
ATGGGGCCGTTGGATGGGTGCGAACTGAGGGACACACAGGCACTGCTGTCTACAATACCAACCATGGAGCTTCAGAAACGCGACTATCTTGTAGAACGGCCACTGCTGAACCAGGAGCAGCTGGAGCACCTGGGGCACTGGGGCCCAACACCTAGGACCCATCAATGGCGAACCTGGTTTCAGTGCTCCCATTCTCGGGCCCATGGCTATCTACTCAAATACCTCCCAGTCTTGGGCTGGTTACCCCACTATCGTGTGCGTGAGTGGCTCCTGGGTGACTTGTTGTCTGGCCTGAGTGTGGCCATCATGCAGCTTCCACAGGGCTTGGCCTATGCCCTCCTGGCTGGATTACCCCCTGTGTTTGGCCTCTACAGCTCCTTCTACCCTGTCTTTGTATACTTCCTGTTTGGTACTTCCCGACACATCTCTGTGGGGACCTTTGCTATCATGTCTGTAATGGTGGGCAGTGTGACAGAATCCATCACTCAGGATGAGGACTTCCAGCAGAACACAAACTCTACTGTCAGTGCCCGTGTGCAGCTGGCCTCCACACTCAGTGTCCTGGTGGGCCTCTTCCAGGTGGCACTGGGCCTGGTGCACTTCGGCTTTGTGGTCAACTACCTGTCTGAGCCACTGGTGCGAAGCTACACCACAGCTGCATCTGTGCAGGTCTTCGTCTCACAGCTCAAGTATGTGTTCGGCCTCCAGTTGAGCAGCCGCTCAGGGCCCCTGTCCCTTATCTATACTTTTCTGGAGGTCTGCTGGAATTTGCCCAAGAGTGTGGTTGGCACCGTGGTCACTGCAGTTGTGGCAGGGGTGGCGCTCGTGATGGTGAAGATATTGAATGACAAGCTGCATCGGCATCTCCCTCTGCCAATACCTGGGGAGCTGCTCACGCTCATTGCAGCCACAGGCATCTCCTATGGTGTGAACCTGAGAAACAGATTTGAGGTGGACACTGTGGGCACCATCCCCACAGGGCTGATCGCCCCCATGATACCCAACCCCCAGCTGTTCGGAAAGCTGGTGGGACATGCCTTCGCCATCGCTGTGGTCGGGTTTGCCATTGCCATCTCACTGGGGAAGATCTTCGCTCTCAGACACGGCTACCGGGTGGACAGCAACCAGGAGCTGGTGGCCCTCGGCCTCAGTAACTTTGTTGGAGGCTTCTTCCAGTGCTTCCCTGTGAGCTGCTCCATGTCCCGGAGCCTGGTACAGGAGACCACCGGGGGCAACACACAGGTTGCTGGAGCAGTCTCTTCCCTCTTTATCCTCCTCATCATCCTTAAACTGGGGGAACTCTTCCGAGAACTGCCCAAGGCAGTTCTGGCAGCCATCATTATTGTGAACCTGAAGGGCATGTTGAAGCAATTCACTGACATATGCACCCTCTGGAAGGCAAATCGAGTAGACCTGCTTATCTGGGTGGTAACCTTTGTGGCCACCATCCTGTTAAACCTGGACCTTGGCCTGGCAGTTGCGATAGGCTTCTCCCTGCTGCTTGTGGTGGTACGAACACAGATGCCCCGGTACTCTGTCCTGGGGCAGGTGCCAGACACGGACATTTACAGAGATGTGGCGGAGTACTCAGAGGCCAAGGAGATCCCCGGTGTGAAAGTCTTCCGGTCCTCAGCCACCTTGTACTTTGCCAACGCTGAGCTCTACAGTGACACATTGAAGCAGAGGTGCGGGGTGGATGTTGACCGTCTTCTGGCCCAGAAGAAGAAGCGGCTGAGGAAACAGGAACGGAAGCTAAAGCAACAGCAGAAACACAAACAGGGACAGCCCGAACCATCACCATCCCCTCCATGTTTATGGCTGCTCCCAGCATCGGCCAGAACTCTGCTGCCTCAGCTTGGCTGCCCTGGGTCCCACAGCATTGGCTGCCTCTTCCAATGGCACCTCAGTTTCTATCAGTGTGGACACCAGCCTCGGAGACATCAAGGGCAGTGGTGTGGAGGACTCCAGGGTCAAGGTGAGGGTGGGGTGGAAGAGGAGGTGGCAGTAGGAGCCGCAGAGATGCGGGTGGCACACATGTCCCTAGAGGAAAGCCATGGGCCTGGTAGCCGTGGGCTCAAAGGTGTTGTGCTGACAGCAGGAGGAGACCTCTAG

XM_004833970.1 Coding sequence

Nckipsd NCK interacting protein with SH3 domain, transcript variant X1

Length: 2226 bp    Location: 2695371..2685256   Strand: -
>XM_004833970.1
ATGTACCGCGCGCTGTACACCTTCCACTCGGCGGAGCCCAACGCGCTGGCGTTCGCCGCAGGCGAGACCTTCCTGGTGCTGGAGCGCAGCAGTGCGCACTGGTGGCTGGCGGCGCGGGCGCGCAGTGGCGAGACTGGCTACGTGCCGCCTGCCTACCTGCACCGTCTCCAGGGTCTAGAGCAGGATGTCCTCCAGGCCATTGATCGGGCCATTGAGGCTGTGCATAACACAGCCATGCGGGATGGTGGCAAGTACAGCCTGGAGCAGCGTGGAGTCCTCCAGAAGCTGATCCACCATCGGAAAGAGACCCTGTCTCGTAAAGGACCCTCAATCTCCAGTGCTCCAGTTATGACTGCATCCACCAGTGACCATCATTTGGACGCTGCCACCACTAGGCAGCCCAATGGGGTGTGTCGAACTGGGTTTGAACGGCAGTACAGCTTGCCCATTTCTGAGCATCTTGGGACAGATGGAGCCCTCTACCAGATCCCACCCCAGCCTCGTCGAGCAGCACCTGCTACACCACCCCCACCTGTGAAGCGCCGAGATCGAGAGGCCCTGGTGGTCTCAGGGAATGGTGGCCGAAACACCACGCCCTCTGGGTGTAGTTCAGTGTCCAGTGGCTCCTCGGTCAACAGCACTTCTCTGGATACGCTCTATACTGGCTCCAGCTCCTCTGAGCTGGGCCTTGGCTGCTCACCCACACCCCCACCTGTGCCACGCAGAGGCACCCACACAGTGTCCCAAGCCTTGCCTTCTCCCTCCAAGGCACCAGCCCGTGAGTCCCCTACAGAGGAGGTGGTGGTTCATACAACTTCAGCCCCTGATGACTTGGAGTCCCTGGGTGCTCTGAGCCTGGGGACCACAGAGGAGAAGGCAGTGGCTGAGACAGCTGTGCCAAGGACCATTGGGGCAGAACTGATGGAGCTTGTGCGGAGAAACACCGGCCTGAGCCATGACTTATGCCGCGTGGCCATCGGCGTCGTGGTGGGTCACATCCAGGCCTCTGTGCCAGCCAGCTCACCTGTCATGGAGCAGGTCCTCCTCTCGCTGGTAGAGGGCAAGGACATGAGCACAGCCCTGCCCTCTGGGCAGGTCTGCCATGACCAGCAGAGGCTGGAGGTGATTTTTGCGGACCTGGCTCGGAGGAAGGATGATGCCCAGCAGCGCAGCTGGGCCCTGTATGAGGATGAGGGCGTCATTCAATGCTATCTGGAGGAGCTGCTGCATATTCTGACTGATGCTGACCCTGAAGTTTGCAAGAAAATGTGCAAGAGGAATGAGTTCGAGTCCGTCCTGGCCTTGGTGGCCTATTACCAAATGGAACACCGAGTATCACTGCGGCTGCTGCTCCTCAAGTGCTTTGGGGCCATGTGCGGCCTCGATGCAGCTATCATCTCCACACTTGTGTCTTCTGTGCTGCCTGTGGAGCTGGCGAGGGATATGCAGACAGACACACAGGACCACCAGAAGCTCTGTTACTCTGCGCTCATCCTGGCCATGGTCTTCTCCATGGGGGAGGCAGTGCCCTACGCACACTACGAGCACCTGGGTACACCTTTTGCCCAGTTCCTGCTGAGCATCGTTGAGGATGGGCTGCCCCTGGACACCATGGAGCAGCTGCCTGATCTCTGCATGAACCTGCTTCTGGCTCTCAACCTGCACCTGCCAGGTGAGGATGGGACCTGGCTGGGAGGGGCCGATCAGAGGCTTTGCAGGCTGTGTTTTGCCTTGTCTACACCCTGTCCTTCCTCAGCACCTGACCAGAACGTCATCATGGCTGCCCTGAGCAAACACTCCAATGTGAAAATCTTCTCTGAAAAGCTGCTACTTCTTCTCAACAGAGGAGATGACCCTGTGCACATCTTCAAACATGAACCACAGCCGCCACACTCAGTTCTCAAGTTCCTGCAGGATGTTTTCAGCAGTTCTGCCACAGCTGCCATCTTCTACCACACAGATATGATGGCGCTCATTGACATCACTGTACGGCACATTGCGGACCTCTCACCCGGAGACAAGCTGCGCATGGAGTACCTCTCCCTGATGCATGCTGTGGTCCGCTCCACACCCTACTTGCAGCACCGCCATCGGCTGTCGGACCTGCAGGCTACACTGCGGCGCATCCTGACTGAGGAGGAGACCTCACCGCAGTGCCAGATGGACCGCATGATTGTCCAAGAGATGTGCAAGGAGTTCCCAGTGCTTGGGGAGGCCCCCAGCTAG

XM_004833972.1 Coding sequence

Nckipsd NCK interacting protein with SH3 domain, transcript variant X3

High confidence: 4 potential gene matches
Length: 2142 bp    Location: 2695370..2685256   Strand: -
>XM_004833972.1
ATGTACCGCGCGCTGTACACCTTCCACTCGGCGGAGCCCAACGCGCTGGCGTTCGCCGCAGGCGAGACCTTCCTGGTGCTGGAGCGCAGCAGTGCGCACTGGTGGCTGGCGGCGCGGGCGCGCAGTGGCGAGACTGGCTACGTGCCGCCTGCCTACCTGCACCGTCTCCAGGGTCTAGAGCAGGATGTCCTCCAGGCCATTGATCGGGCCATTGAGGCTGTGCATAACACAGCCATGCGGGATGGTGGCAAGTACAGCCTGGAGCAGCGTGGAGTCCTCCAGAAGCTGATCCACCATCGGAAAGAGACCCTGTCTCGTAAAGGACCCTCAATCTCCAGTGCTCCAGTTATGACTGCATCCACCAGTGACCATCATTTGGACGCTGCCACCACTAGGCAGCCCAATGGGGTGTGTCGAACTGGGTTTGAACGGCAGTACAGCTTGCCCATTTCTGAGCATCTTGGGACAGATGGAGCCCTCTACCAGATCCCACCCCAGCCTCGTCGAGCAGCACCTGCTACACCACCCCCACCTGTGAAGCGCCGAGATCGAGAGGCCCTGGTGGTCTCAGGGAATGGTGGCCGAAACACCACGCCCTCTGGGTGTAGTTCAGTGTCCAGTGGCTCCTCGGTCAACAGCACTTCTCTGGATACGCTCTATACTGGCTCCAGCTCCTCTGAGCTGGGCCTTGGCTGCTCACCCACACCCCCACCTGTGCCACGCAGAGGCACCCACACAGTGTCCCAAGCCTTGCCTTCTCCCTCCAAGGCACCAGCCCGTGAGTCCCCTACAGAGGAGGTGGTGGTTCATACAACTTCAGCCCCTGATGACTTGGAGTCCCTGGGTGCTCTGAGCCTGGGGACCACAGAGGAGAAGGCAGTGGCTGAGACAGCTGTGCCAAGGACCATTGGGGCAGAACTGATGGAGCTTGTGCGGAGAAACACCGGCCTGAGCCATGACTTATGCCGCGTGGCCATCGGCGTCGTGGTGGGTCACATCCAGGCCTCTGTGCCAGCCAGCTCACCTGTCATGGAGCAGGTCCTCCTCTCGCTGGTAGAGGGCAAGGACATGAGCACAGCCCTGCCCTCTGGGCAGGTCTGCCATGACCAGCAGAGGCTGGAGGTGATTTTTGCGGACCTGGCTCGGAGGAAGGATGATGCCCAGCAGCGCAGCTGGGCCCTGTATGAGGATGAGGGCGTCATTCAATGCTATCTGGAGGAGCTGCTGCATATTCTGACTGATGCTGACCCTGAAGTTTGCAAGAAAATGTGCAAGAGGAATGAGTTCGAGTCCGTCCTGGCCTTGGTGGCCTATTACCAAATGGAACACCGAGTATCACTGCGGCTGCTGCTCCTCAAGTGCTTTGGGGCCATGTGCGGCCTCGATGCAGCTATCATCTCCACACTTGTGTCTTCTGTGCTGCCTGTGGAGCTGGCGAGGGATATGCAGACAGACACACAGGACCACCAGAAGCTCTGTTACTCTGCGCTCATCCTGGCCATGGTCTTCTCCATGGGGGAGGCAGTGCCCTACGCACACTACGAGCACCTGGGTACACCTTTTGCCCAGTTCCTGCTGAGCATCGTTGAGGATGGGCTGCCCCTGGACACCATGGAGCAGCTGCCTGATCTCTGCATGAACCTGCTTCTGGCTCTCAACCTGCACCTGCCAGCACCTGACCAGAACGTCATCATGGCTGCCCTGAGCAAACACTCCAATGTGAAAATCTTCTCTGAAAAGCTGCTACTTCTTCTCAACAGAGGAGATGACCCTGTGCACATCTTCAAACATGAACCACAGCCGCCACACTCAGTTCTCAAGTTCCTGCAGGATGTTTTCAGCAGTTCTGCCACAGCTGCCATCTTCTACCACACAGATATGATGGCGCTCATTGACATCACTGTACGGCACATTGCGGACCTCTCACCCGGAGACAAGCTGCGCATGGAGTACCTCTCCCTGATGCATGCTGTGGTCCGCTCCACACCCTACTTGCAGCACCGCCATCGGCTGTCGGACCTGCAGGCTACACTGCGGCGCATCCTGACTGAGGAGGAGACCTCACCGCAGTGCCAGATGGACCGCATGATTGTCCAAGAGATGTGCAAGGAGTTCCCAGTGCTTGGGGAGGCCCCCAGCTAG

XM_004833971.1 Coding sequence

Nckipsd NCK interacting protein with SH3 domain, transcript variant X2

Length: 2163 bp    Location: 2695370..2685256   Strand: -
>XM_004833971.1
ATGTACCGCGCGCTGTACACCTTCCACTCGGCGGAGCCCAACGCGCTGGCGTTCGCCGCAGGCGAGACCTTCCTGGTGCTGGAGCGCAGCAGTGCGCACTGGTGGCTGGCGGCGCGGGCGCGCAGTGGCGAGACTGGCTACGTGCCGCCTGCCTACCTGCACCGTCTCCAGGGTCTAGAGCAGGATGTCCTCCAGGCCATTGATCGGGCCATTGAGGCTGTGCATAACACAGCCATGCGGGATGGTGGCAAGTACAGCCTGGAGCAGCGTGGAGTCCTCCAGAAGCTGATCCACCATCGGAAAGAGACCCTGTCTCGTAAAGGACCCTCAATCTCCAGTGCTCCAGTTATGACTGCATCCACCAGTGACCATCATTTGGACGCTGCCACCACTAGGCAGCCCAATGGGGTGTGTCGAACTGGGTTTGAACGGCAGTACAGCTTGCCCATTTCTGAGCATCTTGGGACAGATGGAGCCCTCTACCAGATCCCATTTCGGTCCTTGCAGATCCCACCCCAGCCTCGTCGAGCAGCACCTGCTACACCACCCCCACCTGTGAAGCGCCGAGATCGAGAGGCCCTGGTGGTCTCAGGGAATGGTGGCCGAAACACCACGCCCTCTGGGTGTAGTTCAGTGTCCAGTGGCTCCTCGGTCAACAGCACTTCTCTGGATACGCTCTATACTGGCTCCAGCTCCTCTGAGCTGGGCCTTGGCTGCTCACCCACACCCCCACCTGTGCCACGCAGAGGCACCCACACAGTGTCCCAAGCCTTGCCTTCTCCCTCCAAGGCACCAGCCCGTGAGTCCCCTACAGAGGAGGTGGTGGTTCATACAACTTCAGCCCCTGATGACTTGGAGTCCCTGGGTGCTCTGAGCCTGGGGACCACAGAGGAGAAGGCAGTGGCTGAGACAGCTGTGCCAAGGACCATTGGGGCAGAACTGATGGAGCTTGTGCGGAGAAACACCGGCCTGAGCCATGACTTATGCCGCGTGGCCATCGGCGTCGTGGTGGGTCACATCCAGGCCTCTGTGCCAGCCAGCTCACCTGTCATGGAGCAGGTCCTCCTCTCGCTGGTAGAGGGCAAGGACATGAGCACAGCCCTGCCCTCTGGGCAGGTCTGCCATGACCAGCAGAGGCTGGAGGTGATTTTTGCGGACCTGGCTCGGAGGAAGGATGATGCCCAGCAGCGCAGCTGGGCCCTGTATGAGGATGAGGGCGTCATTCAATGCTATCTGGAGGAGCTGCTGCATATTCTGACTGATGCTGACCCTGAAGTTTGCAAGAAAATGTGCAAGAGGAATGAGTTCGAGTCCGTCCTGGCCTTGGTGGCCTATTACCAAATGGAACACCGAGTATCACTGCGGCTGCTGCTCCTCAAGTGCTTTGGGGCCATGTGCGGCCTCGATGCAGCTATCATCTCCACACTTGTGTCTTCTGTGCTGCCTGTGGAGCTGGCGAGGGATATGCAGACAGACACACAGGACCACCAGAAGCTCTGTTACTCTGCGCTCATCCTGGCCATGGTCTTCTCCATGGGGGAGGCAGTGCCCTACGCACACTACGAGCACCTGGGTACACCTTTTGCCCAGTTCCTGCTGAGCATCGTTGAGGATGGGCTGCCCCTGGACACCATGGAGCAGCTGCCTGATCTCTGCATGAACCTGCTTCTGGCTCTCAACCTGCACCTGCCAGCACCTGACCAGAACGTCATCATGGCTGCCCTGAGCAAACACTCCAATGTGAAAATCTTCTCTGAAAAGCTGCTACTTCTTCTCAACAGAGGAGATGACCCTGTGCACATCTTCAAACATGAACCACAGCCGCCACACTCAGTTCTCAAGTTCCTGCAGGATGTTTTCAGCAGTTCTGCCACAGCTGCCATCTTCTACCACACAGATATGATGGCGCTCATTGACATCACTGTACGGCACATTGCGGACCTCTCACCCGGAGACAAGCTGCGCATGGAGTACCTCTCCCTGATGCATGCTGTGGTCCGCTCCACACCCTACTTGCAGCACCGCCATCGGCTGTCGGACCTGCAGGCTACACTGCGGCGCATCCTGACTGAGGAGGAGACCTCACCGCAGTGCCAGATGGACCGCATGATTGTCCAAGAGATGTGCAAGGAGTTCCCAGTGCTTGGGGAGGCCCCCAGCTAG

XM_004833974.1 Coding sequence

Ip6k2 inositol hexakisphosphate kinase 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 1347 bp    Location: 2734115..2697098   Strand: -
>XM_004833974.1
ATGAGCCCAGCCTTCAGGGCTATGGACGTGGAGCCCCGCACCAAGGGCATCCTGCTGGAGCCCTTTGTCCACCAAGTTGGGGGGCATTCGTGCGTTCTCCGTTTGAACGAGACAACCCTTTGCAAGCCCCTGGTCCCAAGGGAACATCAGTTCTACGAGACTCTGCCAGCTGAGATGCGAAAATTCACTCCCCAGTACAAAGCTGTTTTGATATTTGTTAGGTTTGCAGATGAGTTTGGGGCCTCTGGCAACATAGAGACTAAGGAACAGGGTGTGGTATCTGTGCACTTTGAAGAAGATGAAGACAGGAACTTGTGTTTAGTAGCATATCCATTAAAAGGGGACCATGGAACTGTGGACATTGTAGACAATTCAGACTGTGAACCAAAAAGTAAGCTTCTAAGGTGGACGAATAAAAAACATCACATCCTAGAAACAGAAAAAACCCCCAAGGACTGGGTGCGCCAGCACCGGAAAGAGGAGAAGATGAAGAGCCATAAATTAGAAGAAGAATTTGAATGGCTAAAGAAATCTGAAGTCTTATACTACAGTGTAGAAAAAAAGGGAAATATAAGTTCCCAGCTTAAACACTATAACCCTTGGAGCATGAAATGTCACCAGCAGCAGTTACAGAGAATGAAGGACAATGCCAAGCATCGGAACCAATACAAATTCATCTTACTAGAGAACCTGACTTCCCACTACGAAGTACCATGTGTCCTGGACCTGAAGATGGGCACACGCCAGCATGGTGATGATGCTTCAGAAGAGAAAGCAGCCAACCAAATCCGAAAATGTCAGCAGAGCACATCTGCAGTCATAGGTGTGCGTGTGTGTGGCATGCAGGTGTACCAGGCGGGCACAGGGCAGCTCATGTTCATGAACAAGTACCACGGGAGGAAGCTGTCGGTGCAGGGCTTCAAGGAGGCGCTCTTCCAATTCTTCCACAATGGGCGGTACCTGCGCCGGGAGCTCCTGAGCCCCGTGCTCAAGAAGCTAGCTGAGCTTAAGGCAGTGCTGGAACGACAGGAGTCCTATCGCTTCTACTCGAGCTCCCTGCTGGTGATCTATGATGGCAAAGAGTGGCCTGAGGTGGCCCTGGACTCAGATGCTGAGGACTTGGAGGACCTGTCAGAAGAGTCAGCCGATGAGTCTGCTGGTGCCTATGCCTACAAGCCCCTTGGCGCCAGCTCCGTGGACGTGCGCATGATCGACTTTGCCCATACCACCTGCAGGCTGTATGGCGAGGACAGTGTGGTGCACGAGGGCCAGGACGCTGGCTACATCTTTGGCCTCCAGAGCCTGATAGACATTGTCACAGAGATCAGCGAGGAGAGTGGGGAGTGA

XM_004833973.1 Coding sequence

Ip6k2 inositol hexakisphosphate kinase 2, transcript variant X1

Length: 1278 bp    Location: 2707813..2697098   Strand: -
>XM_004833973.1
ATGAGCCCAGCCTTCAGGGCTATGGACGTGGAGCCCCGCACCAAGGGCATCCTGCTGGAGCCCTTTGTCCACCAAGTTGGGGGGCATTCGTGCGTTCTCCGTTTGAACGAGACAACCCTTTGCAAGCCCCTGGTCCCAAGGGAACATCAGTTCTACGAGACTCTGCCAGCTGAGATGCGAAAATTCACTCCCCAGTACAAAGGTGTGGTATCTGTGCACTTTGAAGAAGATGAAGACAGGAACTTGTGTTTAGTAGCATATCCATTAAAAGGGGACCATGGAACTGTGGACATTGTAGACAATTCAGACTGTGAACCAAAAAGTAAGCTTCTAAGGTGGACGAATAAAAAACATCACATCCTAGAAACAGAAAAAACCCCCAAGGACTGGGTGCGCCAGCACCGGAAAGAGGAGAAGATGAAGAGCCATAAATTAGAAGAAGAATTTGAATGGCTAAAGAAATCTGAAGTCTTATACTACAGTGTAGAAAAAAAGGGAAATATAAGTTCCCAGCTTAAACACTATAACCCTTGGAGCATGAAATGTCACCAGCAGCAGTTACAGAGAATGAAGGACAATGCCAAGCATCGGAACCAATACAAATTCATCTTACTAGAGAACCTGACTTCCCACTACGAAGTACCATGTGTCCTGGACCTGAAGATGGGCACACGCCAGCATGGTGATGATGCTTCAGAAGAGAAAGCAGCCAACCAAATCCGAAAATGTCAGCAGAGCACATCTGCAGTCATAGGTGTGCGTGTGTGTGGCATGCAGGTGTACCAGGCGGGCACAGGGCAGCTCATGTTCATGAACAAGTACCACGGGAGGAAGCTGTCGGTGCAGGGCTTCAAGGAGGCGCTCTTCCAATTCTTCCACAATGGGCGGTACCTGCGCCGGGAGCTCCTGAGCCCCGTGCTCAAGAAGCTAGCTGAGCTTAAGGCAGTGCTGGAACGACAGGAGTCCTATCGCTTCTACTCGAGCTCCCTGCTGGTGATCTATGATGGCAAAGAGTGGCCTGAGGTGGCCCTGGACTCAGATGCTGAGGACTTGGAGGACCTGTCAGAAGAGTCAGCCGATGAGTCTGCTGGTGCCTATGCCTACAAGCCCCTTGGCGCCAGCTCCGTGGACGTGCGCATGATCGACTTTGCCCATACCACCTGCAGGCTGTATGGCGAGGACAGTGTGGTGCACGAGGGCCAGGACGCTGGCTACATCTTTGGCCTCCAGAGCCTGATAGACATTGTCACAGAGATCAGCGAGGAGAGTGGGGAGTGA

XM_004835138.1 Coding sequence

LOC101708333 sperm motility kinase 3-like

Length: 1188 bp    Location: 2922836..2921649   Strand: -
>XM_004835138.1
ATGCTGGTCGCTGTGAAGGAGTTAGTGAAGGCAAGGGTGCCAGCACACTACATTGTATGGGAGGTGGAGATCCTGCAGGACCTTCAGCACCCTAACATCGTACAGCTACTGGAGGTCATCGAAAGCGAGGACAAAGTATACCTGGTCCTAGAGTATGTGACAGGGGGAAACCTGCGGCAACGGATCCTCAGGACTGAAAACCACAGGCTGCCGGAGGAGGAGGCCCGAGGGGTATTTCAAGATATCATGGGAGCCATGGATTATTGTCATGCCCAGGGAATTGTACACGGGGACCTCAAACCCCAAAATGTTTTAATCAATTCCCAAGGTCACACCAAAATCTGTGACTTTGGGGTGGGATCCCGGTTCCTCCCTGGGAAGGAGGTGGCTGTGACTTATGGCACTCTGAAATACTGTGCCCCAGAGCGGCTCTTGGATAGGAGATATGAAGGCCCTCCCCTGGATGTTTGGGCCCTTGGCATCATACTCTATGAACTGCTCACGGGGCAGCTCCCCTTTAATGGGGATAAAACAGAGATGGTCCAAACTATGCTATCTGGGAGGTGCTCTTGCCCCCAGTCCATCTCCCGGGATGCCCAAGATCTCATCTGGAACCTCTTGTGCTTCAACCCCAGGATGCGGCCAACAGCGCAGGAGGTGCTGCAGCACCACTGGCTCCAAGATGCCCCTCCCCCCAGTCCTGAGATGCTCCCTATGCCCCCCAAAATGGCAATCCTTAATGTTATGGATGGCATGGGATTTAACCCACTGAAGGTCATCAACTCAGCGAGGAGAAAGGAGATGGACACATTCCTGCTGTTGCAGAGCCAGGGACTCCAGGGGCCACCCTTAAGGATTCGTGTGAAGCCTGTGTGTGCCCCTGAGGATGAGGATCCAGATGAAGAAATAGCATCACCCTCAACAGCTCCTGCACCCTCATCTCACATCTCCCAGAGGAGTGCCAGCGCACCTGTCACCTGCACGGGCCTCTTATTTCCTGGAGTGGAGCCCATAGGAAGGCAGGGTGGCGGAGACTCCCAGCCACCCATTCCCATCCCCAGGACCCCAACTCCCGGCATGTCCTGCCAGCCTATCCCTGCCGCTCCCAGGGTGTTCTGCCAGCCTGGCCCTGGGGCTTCCTGCTCTAGCTCCAGCCCCACCTCCACCCCTAGCAGCAGAGGGAGGTGA

XM_004833978.1 Coding sequence

Arih2 ariadne homolog 2 (Drosophila), transcript variant X1

Length: 1479 bp    Location: 2953750..3023042   Strand: +
>XM_004833978.1
ATGTCAGTGGACATGAATAGCCAGGGGTCTGACAGCAATGAAGAGGACTATGACCCAAATTGTGAGGAGGAAGAGGAAGAGGATGAGGACCCTGGGGACATAGAGGACTATTATGTGGGAGTAGCTAGTGATGTGGAGCAGCAAGGGGCTGATGCCTTTGATCCGGAGGAGTACCAGTTCACTTGCTTGACCTATAAGGAGTCTGAGGGTGCCCTCAATGAACACATGACTAGCTTGGCCTCTGTTCTAAAGGTATCTCATTCAGTTGCCAAACTTATATTAGTTAATTTCCACTGGCAAGTCTCAGAGATATTGGACAGATATAAGACCAATTCTGCTCAGCTGCTTGTTGAAGCTCGAGTTCAGCCTAATCCATCAAAACATGTCCCCACAGCCCATCCTCCTCACCACTGTGCAGTGTGTATGCAGTTTGTGCGGAAGGAAAACTTACTCTCTCTGGCCTGTCAGCACCAGTTTTGCCGCAGCTGCTGGGAGCAGCACTGCTCAGTACTTGTCAAGGATGGCGTGGGTGTGGGAGTCTCTTGTATGGCTCAGGACTGTCCACTCCGTACACCAGAAGACTTTGTGTTTCCGTTGCTTCCCAATGAAGAATTGAGAGACAAATACAGGCGCTACCTCTTCAGGGACTATGTGGAGAGTCATTACCAGCTTCAGCTGTGCCCTGGTGCAGACTGCCCCATGGTTATTCGGGTACAGGAGCCTAGAGCTCGCCGAGTGCAGTGCAATCGGTGCAACGAGGTCTTCTGTTTCAAGTGTCGTCAGATGTATCACGCCCCCACAGACTGCGCCACAATCCGGAAATGGCTCACGAAGTGTGCAGACGACTCTGAAACGGCCAACTACATTAGTGCTCACACTAAAGATTGTCCCAAGTGCAACATCTGCATTGAGAAGAATGGAGGCTGCAATCACATGCAATGCTCCAAATGTAAACACGACTTCTGCTGGATGTGTCTAGGAGATTGGAAGACTCATGGCAGCGAGTACTATGAGTGCAGTCGGTACAAGGAGAATCCTGACATTGTCAACCAGAGCCAGCAAGCCCAGGCCAGGGAGGCCCTCAAGAAGTACTTGTTCTATTTTGAGAGGTGGGAAAACCACAACAAAAGTTTGCAGCTAGAGGCCCAGACATACCAGCGGATTCATGAGAAGATTCAGGAGAGAGTCATGAACAATCTGGGGACTTGGATTGACTGGCAGTACCTACAGAATGCTGCCAAGCTCTTGGCCAAGTGTCGATACACCCTGCAGTACACCTACCCATATGCATACTACATGGAGTCTGGCCCCAGGAAGAAGCTGTTTGAATACCAGCAGGCTCAGCTGGAGGCTGAGATCGAAAACCTCTCATGGAAAGTGGAACGTGCAGACAGCTATGACAGAGGGGACTTGGAGAACCAGATGCACATAGCAGAGCAGCGAAGGAGAACCCTGCTAAAGGATTTCCATGACACTTAA

XM_004833979.1 Coding sequence

Arih2 ariadne homolog 2 (Drosophila), transcript variant X2

Length: 1479 bp    Location: 2953752..3023042   Strand: +
>XM_004833979.1
ATGTCAGTGGACATGAATAGCCAGGGGTCTGACAGCAATGAAGAGGACTATGACCCAAATTGTGAGGAGGAAGAGGAAGAGGATGAGGACCCTGGGGACATAGAGGACTATTATGTGGGAGTAGCTAGTGATGTGGAGCAGCAAGGGGCTGATGCCTTTGATCCGGAGGAGTACCAGTTCACTTGCTTGACCTATAAGGAGTCTGAGGGTGCCCTCAATGAACACATGACTAGCTTGGCCTCTGTTCTAAAGGTATCTCATTCAGTTGCCAAACTTATATTAGTTAATTTCCACTGGCAAGTCTCAGAGATATTGGACAGATATAAGACCAATTCTGCTCAGCTGCTTGTTGAAGCTCGAGTTCAGCCTAATCCATCAAAACATGTCCCCACAGCCCATCCTCCTCACCACTGTGCAGTGTGTATGCAGTTTGTGCGGAAGGAAAACTTACTCTCTCTGGCCTGTCAGCACCAGTTTTGCCGCAGCTGCTGGGAGCAGCACTGCTCAGTACTTGTCAAGGATGGCGTGGGTGTGGGAGTCTCTTGTATGGCTCAGGACTGTCCACTCCGTACACCAGAAGACTTTGTGTTTCCGTTGCTTCCCAATGAAGAATTGAGAGACAAATACAGGCGCTACCTCTTCAGGGACTATGTGGAGAGTCATTACCAGCTTCAGCTGTGCCCTGGTGCAGACTGCCCCATGGTTATTCGGGTACAGGAGCCTAGAGCTCGCCGAGTGCAGTGCAATCGGTGCAACGAGGTCTTCTGTTTCAAGTGTCGTCAGATGTATCACGCCCCCACAGACTGCGCCACAATCCGGAAATGGCTCACGAAGTGTGCAGACGACTCTGAAACGGCCAACTACATTAGTGCTCACACTAAAGATTGTCCCAAGTGCAACATCTGCATTGAGAAGAATGGAGGCTGCAATCACATGCAATGCTCCAAATGTAAACACGACTTCTGCTGGATGTGTCTAGGAGATTGGAAGACTCATGGCAGCGAGTACTATGAGTGCAGTCGGTACAAGGAGAATCCTGACATTGTCAACCAGAGCCAGCAAGCCCAGGCCAGGGAGGCCCTCAAGAAGTACTTGTTCTATTTTGAGAGGTGGGAAAACCACAACAAAAGTTTGCAGCTAGAGGCCCAGACATACCAGCGGATTCATGAGAAGATTCAGGAGAGAGTCATGAACAATCTGGGGACTTGGATTGACTGGCAGTACCTACAGAATGCTGCCAAGCTCTTGGCCAAGTGTCGATACACCCTGCAGTACACCTACCCATATGCATACTACATGGAGTCTGGCCCCAGGAAGAAGCTGTTTGAATACCAGCAGGCTCAGCTGGAGGCTGAGATCGAAAACCTCTCATGGAAAGTGGAACGTGCAGACAGCTATGACAGAGGGGACTTGGAGAACCAGATGCACATAGCAGAGCAGCGAAGGAGAACCCTGCTAAAGGATTTCCATGACACTTAA

XM_004833980.1 Coding sequence

Arih2 ariadne homolog 2 (Drosophila), transcript variant X3

High confidence: 4 potential gene matches
Length: 1479 bp    Location: 2959642..3023042   Strand: +
>XM_004833980.1
ATGTCAGTGGACATGAATAGCCAGGGGTCTGACAGCAATGAAGAGGACTATGACCCAAATTGTGAGGAGGAAGAGGAAGAGGATGAGGACCCTGGGGACATAGAGGACTATTATGTGGGAGTAGCTAGTGATGTGGAGCAGCAAGGGGCTGATGCCTTTGATCCGGAGGAGTACCAGTTCACTTGCTTGACCTATAAGGAGTCTGAGGGTGCCCTCAATGAACACATGACTAGCTTGGCCTCTGTTCTAAAGGTATCTCATTCAGTTGCCAAACTTATATTAGTTAATTTCCACTGGCAAGTCTCAGAGATATTGGACAGATATAAGACCAATTCTGCTCAGCTGCTTGTTGAAGCTCGAGTTCAGCCTAATCCATCAAAACATGTCCCCACAGCCCATCCTCCTCACCACTGTGCAGTGTGTATGCAGTTTGTGCGGAAGGAAAACTTACTCTCTCTGGCCTGTCAGCACCAGTTTTGCCGCAGCTGCTGGGAGCAGCACTGCTCAGTACTTGTCAAGGATGGCGTGGGTGTGGGAGTCTCTTGTATGGCTCAGGACTGTCCACTCCGTACACCAGAAGACTTTGTGTTTCCGTTGCTTCCCAATGAAGAATTGAGAGACAAATACAGGCGCTACCTCTTCAGGGACTATGTGGAGAGTCATTACCAGCTTCAGCTGTGCCCTGGTGCAGACTGCCCCATGGTTATTCGGGTACAGGAGCCTAGAGCTCGCCGAGTGCAGTGCAATCGGTGCAACGAGGTCTTCTGTTTCAAGTGTCGTCAGATGTATCACGCCCCCACAGACTGCGCCACAATCCGGAAATGGCTCACGAAGTGTGCAGACGACTCTGAAACGGCCAACTACATTAGTGCTCACACTAAAGATTGTCCCAAGTGCAACATCTGCATTGAGAAGAATGGAGGCTGCAATCACATGCAATGCTCCAAATGTAAACACGACTTCTGCTGGATGTGTCTAGGAGATTGGAAGACTCATGGCAGCGAGTACTATGAGTGCAGTCGGTACAAGGAGAATCCTGACATTGTCAACCAGAGCCAGCAAGCCCAGGCCAGGGAGGCCCTCAAGAAGTACTTGTTCTATTTTGAGAGGTGGGAAAACCACAACAAAAGTTTGCAGCTAGAGGCCCAGACATACCAGCGGATTCATGAGAAGATTCAGGAGAGAGTCATGAACAATCTGGGGACTTGGATTGACTGGCAGTACCTACAGAATGCTGCCAAGCTCTTGGCCAAGTGTCGATACACCCTGCAGTACACCTACCCATATGCATACTACATGGAGTCTGGCCCCAGGAAGAAGCTGTTTGAATACCAGCAGGCTCAGCTGGAGGCTGAGATCGAAAACCTCTCATGGAAAGTGGAACGTGCAGACAGCTATGACAGAGGGGACTTGGAGAACCAGATGCACATAGCAGAGCAGCGAAGGAGAACCCTGCTAAAGGATTTCCATGACACTTAA

XM_004833982.1 Coding sequence

Arih2 ariadne homolog 2 (Drosophila), transcript variant X5

Length: 1266 bp    Location: 2962495..3023042   Strand: +
>XM_004833982.1
ATGCTCACTGCCATCGGCTGCATCCTCCCTATGGCACTGGTATCTCATTCAGTTGCCAAACTTATATTAGTTAATTTCCACTGGCAAGTCTCAGAGATATTGGACAGATATAAGACCAATTCTGCTCAGCTGCTTGTTGAAGCTCGAGTTCAGCCTAATCCATCAAAACATGTCCCCACAGCCCATCCTCCTCACCACTGTGCAGTGTGTATGCAGTTTGTGCGGAAGGAAAACTTACTCTCTCTGGCCTGTCAGCACCAGTTTTGCCGCAGCTGCTGGGAGCAGCACTGCTCAGTACTTGTCAAGGATGGCGTGGGTGTGGGAGTCTCTTGTATGGCTCAGGACTGTCCACTCCGTACACCAGAAGACTTTGTGTTTCCGTTGCTTCCCAATGAAGAATTGAGAGACAAATACAGGCGCTACCTCTTCAGGGACTATGTGGAGAGTCATTACCAGCTTCAGCTGTGCCCTGGTGCAGACTGCCCCATGGTTATTCGGGTACAGGAGCCTAGAGCTCGCCGAGTGCAGTGCAATCGGTGCAACGAGGTCTTCTGTTTCAAGTGTCGTCAGATGTATCACGCCCCCACAGACTGCGCCACAATCCGGAAATGGCTCACGAAGTGTGCAGACGACTCTGAAACGGCCAACTACATTAGTGCTCACACTAAAGATTGTCCCAAGTGCAACATCTGCATTGAGAAGAATGGAGGCTGCAATCACATGCAATGCTCCAAATGTAAACACGACTTCTGCTGGATGTGTCTAGGAGATTGGAAGACTCATGGCAGCGAGTACTATGAGTGCAGTCGGTACAAGGAGAATCCTGACATTGTCAACCAGAGCCAGCAAGCCCAGGCCAGGGAGGCCCTCAAGAAGTACTTGTTCTATTTTGAGAGGTGGGAAAACCACAACAAAAGTTTGCAGCTAGAGGCCCAGACATACCAGCGGATTCATGAGAAGATTCAGGAGAGAGTCATGAACAATCTGGGGACTTGGATTGACTGGCAGTACCTACAGAATGCTGCCAAGCTCTTGGCCAAGTGTCGATACACCCTGCAGTACACCTACCCATATGCATACTACATGGAGTCTGGCCCCAGGAAGAAGCTGTTTGAATACCAGCAGGCTCAGCTGGAGGCTGAGATCGAAAACCTCTCATGGAAAGTGGAACGTGCAGACAGCTATGACAGAGGGGACTTGGAGAACCAGATGCACATAGCAGAGCAGCGAAGGAGAACCCTGCTAAAGGATTTCCATGACACTTAA

XM_004833981.1 Coding sequence

Arih2 ariadne homolog 2 (Drosophila), transcript variant X4

Length: 1266 bp    Location: 2987551..3023042   Strand: +
>XM_004833981.1
ATGCTCACTGCCATCGGCTGCATCCTCCCTATGGCACTGGTATCTCATTCAGTTGCCAAACTTATATTAGTTAATTTCCACTGGCAAGTCTCAGAGATATTGGACAGATATAAGACCAATTCTGCTCAGCTGCTTGTTGAAGCTCGAGTTCAGCCTAATCCATCAAAACATGTCCCCACAGCCCATCCTCCTCACCACTGTGCAGTGTGTATGCAGTTTGTGCGGAAGGAAAACTTACTCTCTCTGGCCTGTCAGCACCAGTTTTGCCGCAGCTGCTGGGAGCAGCACTGCTCAGTACTTGTCAAGGATGGCGTGGGTGTGGGAGTCTCTTGTATGGCTCAGGACTGTCCACTCCGTACACCAGAAGACTTTGTGTTTCCGTTGCTTCCCAATGAAGAATTGAGAGACAAATACAGGCGCTACCTCTTCAGGGACTATGTGGAGAGTCATTACCAGCTTCAGCTGTGCCCTGGTGCAGACTGCCCCATGGTTATTCGGGTACAGGAGCCTAGAGCTCGCCGAGTGCAGTGCAATCGGTGCAACGAGGTCTTCTGTTTCAAGTGTCGTCAGATGTATCACGCCCCCACAGACTGCGCCACAATCCGGAAATGGCTCACGAAGTGTGCAGACGACTCTGAAACGGCCAACTACATTAGTGCTCACACTAAAGATTGTCCCAAGTGCAACATCTGCATTGAGAAGAATGGAGGCTGCAATCACATGCAATGCTCCAAATGTAAACACGACTTCTGCTGGATGTGTCTAGGAGATTGGAAGACTCATGGCAGCGAGTACTATGAGTGCAGTCGGTACAAGGAGAATCCTGACATTGTCAACCAGAGCCAGCAAGCCCAGGCCAGGGAGGCCCTCAAGAAGTACTTGTTCTATTTTGAGAGGTGGGAAAACCACAACAAAAGTTTGCAGCTAGAGGCCCAGACATACCAGCGGATTCATGAGAAGATTCAGGAGAGAGTCATGAACAATCTGGGGACTTGGATTGACTGGCAGTACCTACAGAATGCTGCCAAGCTCTTGGCCAAGTGTCGATACACCCTGCAGTACACCTACCCATATGCATACTACATGGAGTCTGGCCCCAGGAAGAAGCTGTTTGAATACCAGCAGGCTCAGCTGGAGGCTGAGATCGAAAACCTCTCATGGAAAGTGGAACGTGCAGACAGCTATGACAGAGGGGACTTGGAGAACCAGATGCACATAGCAGAGCAGCGAAGGAGAACCCTGCTAAAGGATTTCCATGACACTTAA

XM_004835139.1 Coding sequence

P4htm prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)

High confidence: 4 potential gene matches
Length: 1506 bp    Location: 3043222..3056645   Strand: +
>XM_004835139.1
ATGGCGGCTGCGGCTACAGTTCCGCGGCCCGGAGCTGGGAAGCCCGCGGAGGCTGCTAGTCTGCAGTGGGCGACCCCTGAACCACGGGGGGTCGCGGTTGGGGCCAGGCCAGGCGACGACGAAGACTCGACTGTGCAGCCTCTGTGCAAGCCTCGCGGCATCTGCTCGCGGGCCTACTTCCTGGTGCTGATGGTGTTTGTGCACCTGTACCTGGGCAATGTGCTGGCGCTGCTGCTCTTCGTGCACTACAGTAACGGCGACGAAAGCACTGAGCCCGGACCCCCGCGCCGCTCCCCGGGCCCTCTGACCGTCCCTACCTTGGGTCCCCTCACCCGGCTAGAAGGCATCAAGGTGGGGTACGAGCGCAAGGTACAGCTGGTCACCGGCAAAGACCACGTCATTCGAACCCTTAGCCTCAAGCCGCTGCTCTTCGAAATTCCTGGCTTCCTGAGTGATGAGGAGTGTCGGCTCATCATCCACCTGGCACAGATGAAGGGGTTACAGCGCAGCCAGATCCTGTCCACTGAAGAGTATGAGGAAGCCATGAGCACTGTGCAGGTCAGCCAGCTGGACCTCTTCCAGCTGCTGGACCAGAACCACGATGGTCTCCTACAACTCCGAGAGGTCCTGGCCCAGACTCGCCTGGGAAATGGATGGTGGATGACTCCAGAGAACATTCAAGAGATGTACTCTGCGATCAAGGCAGATCCCAATGGTGATGGAGTGCTGAGTCTGCAGGAGTTCTCCAACATGGACCTTCGGGACTTCCACATGTACATGAGGAGCCACAAAGGGGAGTCCAGCGAGCTGGTGCGGAACAGCCACCACACATGGCTCTACCAGGGGGAGGGTGCCCACCACATCATGCGTGCCATCCGCCAGAGAGTGCTGCATCTCACTCGCCTGTCACCTGAGATCGTGGAACTCAGTGAGCCGCTGCAGGTTGTGCGATACAGTGAGGGAGGCCACTACCATGCCCATTTGGACAGCGGGCCTGTGTACCCAGAGACCATCTGCTCTCATACCAAGCTGGTAGCCAACGAGTCTGTACCCTTCGAGACCTCCTGTCGCTACATGACAGTGCTGTTTTATTTGAACAATGTCACCAGTGGGGGCGAGACTGTCTTCCCTGTAGCAGATAACAGAACCTACGATGAAATGAGTCTGATTCAGGATGATGTTGACCTCCGTGACACACGGAGGCACTGTGACAAAGGGAACCTTCGTGTCAAGCCTCAGCAAGGCACAGCAGTCTTCTGGTACAACTACTTGCCTGATGGGCAAGGTTGGGTGGGCGACGTGGATGACTACTCGTTGCACGGGGGGTGCCTCGTCACACGCGGCACCAAATGGATTGCCAACAATTGGATCAATGTGGACCCCAGCCGGGCACGACAAGCCCTGTTCCAGCAGGAGATGGCACGCCTATCCCGCGAAGGCGGCGCCAACTCGCAGCCCGAATGGGCCCTGGACCGAGCCTACCGCGACGCGCGCGTGGAGCTCTAA

XM_004833983.1 Coding sequence

Wdr6 WD repeat domain 6

High confidence: 4 potential gene matches
Length: 3366 bp    Location: 3056803..3063164   Strand: +
>XM_004833983.1
ATGGATGCTCTCGGAGACTACGTGTGGCCGCGGGCGACCTCCGAGCTCATACTCCTCCCGGTTACGGGGCTGGAGTGTGTGGGGGACCGGTTATTAGCGGGTGAGGGGCCTGATGTCCTGGTATACAGCTTGGACTTTGGTGGGCATCTGCGGATGATGAAGAGAGTGCAGAACCTGCTTGGCCACTATCTTATCCATGGGTTCCGGGTTCGACCAGAGCCCAATGGAGACCTGGACTCAGAGGCCATGATAGCTGTATTTGGAAGCAAGGGACTCAGAATTGTGAAGATTAGCTGGGGTCAGAGCCGCTTCCGGGAGCTCTGGCGCTCTGGCCTATGGAACATGTCTGACTGGATCTGGGATGTACGCTGGCTTGAAGGTAATGTGGCCTTGGCCCTGGGTCACAACTCAGTGCTGCTGTATGACCCTGTGGTAGGATGCATGCTACAGGATGTACCCTGCACGGACAGATGCACCCTCTCCTCAGCCTGCCTGATTGGAGAGACTTGGAAGGAACTAACCATAGTGGCAGGCGCCGTTTCCAACCAGCTTCTAGTCTGGTACCCAGCAGCTGCTCTAGCAGACAACAAGCCTGTGGCACCTGACCGACGGATCAGTGGGCATGTAGGCGTCATCTTCAGCATGTCCTACCTGGAAAGCAAGGGCTTGCTAGCAACAGCTTCAGAAGACCGAAGTGTCCGTATCTGGAAAGTTGGTGACCTGCGGGTGCCTGGAGGTCGGGTGCAGAATATTGGACACTGCTTTGGACATAGTGCCCGTGTGTGGCAGGTCAAGCTGCTAGAGAATTACCTTATCAGTGCAGGTGAAGACTGTGTGTGCTTGGTGTGGAGTCATGAAGGTGAGATCCTCCAAGCCTTTCGGGGCCACCAGGGCCGTGGGATCCGGGCCTTGGCTGCTCATGAGAAACAGACCTGGGTTATCACTGGGGGTGATGACTCAGGCATTCGGCTGTGGCACCTGGCAGGACGTGGGTACCCGGGATTAGGGGTCTCGGCTCTCTGCTTCAAGTCCCCTAGCCGGCCAGGTACCCTCAAGGCCGTGACACTGGCTGGCTCTTGGCGACTGTTGGCAGTGACTGATACAGGCACCCTGTACTTCTATGACCTTGAGGTCAAATGTTGGGAGCAGCTGCTAGAGGATAAGCACTTCCAGTCTTACTGCTTGCTGGAGGCAGCTCCTGGTCCTGAAGGCTTTGGACTGTGTGCTATGGCCAATGGGGTAGGTTGCGTCAAGGTTGTCCCCATCAACACTCCAACTGCTGCTGTGAACTGTGCCCTATTCCCCGGGAAGGTCTATAGCCTGAGCTGGGCCCTGCGTGGCTATGAGGAGCTCCTGTTGCTGGCCTCTGGCCCTGGTGGAGTGGTAGCTTGCCTAGAGATCTCAGCTGCACCCTCTGGCAAGGCCATCTTTGTCACAGAACGTTGCCGGTACCTGCTGCCCCCGAGCAAGCAGAGATGGCACACATGCAGTGCTTTTGTGCCCCCAGGTGACTTCCTGGTGTGTGGAGACCGCAGAGGCTCTGTGCTCCTATTCCCCTCCAGACCAGGAGTGCTCAAGGACCCTGGGGTTGGAGGCAAGGCTGAGCCTGGAGCTGGGGCACTTGGAGGGGATGGTGGCACAGGTGGGGCTGAGAATGCTGTGGCTGAGTGGAGCCCTGTGTCTACCCTCCATTCTCTGCATGGGAAGCAGGGTGTGACCTCAGTCACCTGTCATGCTGGTTATGTGTATACCACAGGGAGGGATGGTGCCTACTACCAGCTCTTTGTGCGAGGCAGCCAGCTCCAGCCAGTCCTACGGCAGAAGACCTGTCGGGGCATGAACTGGGTTGCTGGGCTTCGAGTGGTGCCTGATGGGAGCATGGTCATCCTGGGTTTCCATGCCAACGAGTTTGTGGTGTGGAGCCCTCGGTCACATGAGAAGCTGCACGTGGTCAGCTGTGGAGGAGGCCACCGCTCCTGGGCCTTCTCCGATACTGAAGCAGCCATGGCTTTTGCCTACCTCAAGGATGGGGATGTCATGCTCTACCAGGCTCTGGGTGGCTGCACCCGGCCACATGTGATCCTCCGGGAGGGTCTGCATGGCCGGGAGATCACCTGTGTAAAACGTGTGGGTGCCATCATCCTGGAGCCTGAGTTTGAAGTGCCCAGCTTGGAGCAGCCTGACTACTTGGAGCCTGATAGCGAGGGGCCTGGCCTGACCGACATCGTGATCACCTGCAGTGAGGACACTACTGTCTGTGTCCTTGCACTCCCCACCACCACAGGCTCAGCCCATGCCCTCACAGCTGTCTGCAATCATATCTCCTCCGTGAGAGCTTTGGCTGTGTGGGGCCTCAGCACCCCAGGCGGCCCTCATGATCCTCAGCCAGGTCTGACTGCCAATGTAGTGTCTGCAGGTGGTCGAGCAGAGATGCACTGCTTCAGCATCATGGTCAGTCCTGACCCTAGCACCTCAAGCGGGCTTGCCTGCCACGTCATACACCTTTCATCCCACCGGCTAGATGAGTACTGGGACCAGCAGCCCAATCGGCATCGCAAGGTCAAGGTGGACCCTGAGACCAGGTACATGTCCCTTGCTGTCTGTGAACTTGACCGCCCTGGCCTTGGCCCCCTTGTGGCTGTAGCCTGTAGTGATGGGGCAGTGAGGCTCTTTCTCTTGCAGGACTCTGGGCGAATTCTGCAGCTTCTTGCTGAAACTTTCCACCACAAGCGCTGTGTCCTCAAGGTCCACTCCTTTACACATGAGGCACCCAACCAGCGGCGGCGGCTGTTCCTGTGCAGTGCAGCTACTGATGGCAACCTGGCCTTCTGGGACCTTACCACTGTGCTGGACAGTGGTTCTACTGTCCTTGAGCCTCCAGCAGACCCTGGCCTTCCCTGCCGGCTGGGCACTCCCTGCATGACGCTCCAGGCCCACAGCTGTGGTGTCAACAGCCTGCACACCTTGCCCACATGTGAAGGCCACCATCTTGTGGCTAGTGGCAGTGAGGATGGCTCCCTCCATGTCTTTGTGCTCGCTGTGGAGACACCAGAGGTGGAAGAAGCTGTGGGTGAGCCTGAGCTGGTGCCCCAGTTACATGTGCTAGAAGAATATTCTGTCCCCTGTGCACATGCTGCCCATGTGACAGGCCTCAAGATCCTGAGCCCCAGCCTCATGGTCTCAGCCTCCATTGACCAGCGTCTGACATTCTGGCGTCTGGGACATGGTGAGCCCACCTTCATGAACAGCACTGTGTACCATGTGCCAGATGTGGCTGACATGGACTGCTGGCCTGTGAGCCCCGAGTTTGGCCACCGCTGTGCTCTTGGGGGCCAAGGGCTTGAGGTTTACAACTGGTATGACTGA

XM_004833986.1 Coding sequence

Dalrd3 DALR anticodon binding domain containing 3, transcript variant X3

Length: 1536 bp    Location: 3066695..3063245   Strand: -
>XM_004833986.1
ATGGCGACGGAACGTCTTGGAGTAGGGGAGACACTAGGGGCCCTAAATGCGGCTTTAGGGCCTGGCGACCCAGTGTGGTTTAAAGAGACACATGCCCGGCACCTGCGAGTTCGAGATTTCCTGGCGCCGCGACGCGCACTACAAGCGCGCTTCGGGGACGGCCAGGTGCCCGAGCATGTGCTCCGTGCCCTCGCCGGCTTGCAGGGCCCCGGGGTGGCCCCAGTACTGTGCTGCGCGCCGACACCCGCGGGCTTGTCGCTCCAGCTTCAGCGGCCTGTTGTCTTTGAGCGCGTCCTCGGCGCTGTGGCCTCCTATGCTACGCCGGCCAACTGCGCTTCACCAGGCCTGCGCATCCTCCTGCACTGCCCAGCGCTGCGCTGCAGTCCTGGCGCGCTCCGCTTGAGCCAGCTGCGGGCCGTACTCGTGGCTGATCACCTGGCGCGAGCTCTGCGCGGTCAAGGGGTGTGTGTGCGCTTAGTTCCTGCAGTGCAGGACCCGCACCTACCAACCTTTCTGCAGAAACTGCGAGTGGACTGGCCCACTGCCTCGAAAAATGCACCGGCGGAAACCCTAAGAGACTTCGTGCTTGCAAAGTTCACCTCTGCCCAAGACCAGGAGACACTACCCCCGGGTGTTTTGGGCAGACTGGGCCTGAAGGAGCTGGTGAAAGAACAGGGCCGTGGGGCTGGCTATGACCCCAACGTGGACAAGTGCCTGGTGACTGAGGAGCTGCTGTGTGTGTTAGCTGAGCTGCAGGAAGCTGTGCAGCATTGGCCCAAGGGCAACTACCCAGTCCTGCCCCCAGATTCTGATGTAGACAGCTGCATGGTTATACATGTGGTAAGCTGTGAAGAGGAGTTCCAGCAACAAAAGTTGGACTTGCTTTGGTGGAAATTGGATGACCAGGCTCCTCTCAGACAGAAGCACCTGGTCTGTGGCCCAGTGAAAGTAGCTGGTGCACCCAGCACTCTGATGACTGCCCCTGAGTACTATGAGCTCCGGCATGCCCAGGTGTGCAAGGCCTCAGCACTGAAGCATGGTAGTGATCTGGCACAAGACCCAGCATGGACAGAGATCTCTGAGCTTCTCACTGTGGCCACTATCAAGTTTGAGATGCTGAGCACAGCCCCACAGAGTCAGCTCCTCCTCGCTGACATCATCTCCACAAAGGGCACAAAAAGTGGTATCTTTGTCATGTATAACTGTGCCCGTCTTGCCACACTCTTTGAGGGTTACAAGCGCAATATGGAACAAGGTCTGTACCCCACTTTTCCATCCGTGAAAAGTCTGGACTTCTCACTGTTGCATGATGAGTGTCCTTCCCTTTCCGGACCTGCTCAGCCAGATTGCAGGCCTGTTCTGCACTGGCCCAGGGCTCCACATCAGTGCTCGCACAGAAACAGTATGCAAGTTCTTGGTACAGCTCAGCATGGACTTCAGTTCATACTACAACCGGGTACACATCCTAGGGGAGGCTCGGCCACATCTCTTTGGTCAGATGTTTGCCCGCCTGCAACTTCTAAGAGCCATTCGTGA

XM_004833984.1 Coding sequence

Dalrd3 DALR anticodon binding domain containing 3, transcript variant X1

High confidence: 4 potential gene matches
Length: 1695 bp    Location: 3066692..3063245   Strand: -
>XM_004833984.1
ATGGCGACGGAACGTCTTGGAGTAGGGGAGACACTAGGGGCCCTAAATGCGGCTTTAGGGCCTGGCGACCCAGTGTGGTTTAAAGAGACACATGCCCGGCACCTGCGAGTTCGAGATTTCCTGGCGCCGCGACGCGCACTACAAGCGCGCTTCGGGGACGGCCAGGTGGGTGTGAGCCCGGCGGGATGTGTACCACAGGCCTGGCGGGAATCTGCGCCCGCTCACCCACTCGTCTGCCCTCAGGTGCCCGAGCATGTGCTCCGTGCCCTCGCCGGCTTGCAGGGCCCCGGGGTGGCCCCAGTACTGTGCTGCGCGCCGACACCCGCGGGCTTGTCGCTCCAGCTTCAGCGGCCTGTTGTCTTTGAGCGCGTCCTCGGCGCTGTGGCCTCCTATGCTACGCCGGCCAACTGCGCTTCACCAGGCCTGCGCATCCTCCTGCACTGCCCAGCGCTGCGCTGCAGTCCTGGCGCGCTCCGCTTGAGCCAGCTGCGGGCCGTACTCGTGGCTGATCACCTGGCGCGAGCTCTGCGCGGTCAAGGGGTGTGTGTGCGCTTAGTTCCTGCAGTGCAGGACCCGCACCTACCAACCTTTCTGCAGAAACTGCGAGTGGACTGGCCCACTGCCTCGAAAAATGCACCGGCGGAAACCCTAAGAGACTTCGTGCTTGCAAAGTTCACCTCTGCCCAAGACCAGGAGACACTACCCCCGGGTGTTTTGGGCAGACTGGGCCTGAAGGAGCTGGTGAAAGAACAGGGCCGTGGGGCTGGCTATGACCCCAACGTGGACAAGTGCCTGGTGACTGAGGAGCTGCTGTGTGTGTTAGCTGAGCTGCAGGAAGCTGTGCAGCATTGGCCCAAGGGCAACTACCCAGTCCTGCCCCCAGATTCTGATGTAGACAGCTGCATGGTTATACATGTGGTAAGCTGTGAAGAGGAGTTCCAGCAACAAAAGTTGGACTTGCTTTGGTGGAAATTGGATGACCAGGCTCCTCTCAGACAGAAGCACCTGGTCTGTGGCCCAGTGAAAGTAGCTGGTGCACCCAGCACTCTGATGACTGCCCCTGAGTACTATGAGCTCCGGCATGCCCAGGTGTGCAAGGCCTCAGCACTGAAGCATGGTAGTGATCTGGCACAAGACCCAGCATGGACAGAGATCTCTGAGCTTCTCACTGTGGCCACTATCAAGTTTGAGATGCTGAGCACAGCCCCACAGAGTCAGCTCCTCCTCGCTGACATCATCTCCACAAAGGGCACAAAAAGTGGTATCTTTGTCATGTATAACTGTGCCCGTCTTGCCACACTCTTTGAGGGTTACAAGCGCAATATGGAACAAGGTCTGTACCCCACTTTTCCATCCGTGAAAAGTCTGGACTTCTCACTGTTGCATGATGAGGGGGAGTGGCTGCTGCTCTTCAATAGTGTCCTTCCCTTTCCGGACCTGCTCAGCCAGATTGCAGGCCTGTTCTGCACTGGCCCAGGGCTCCACATCAGTGCTCGCACAGAAACAGTATGCAAGTTCTTGGTACAGCTCAGCATGGACTTCAGTTCATACTACAACCGGGTACACATCCTAGGGGAGGCTCGGCCACATCTCTTTGGTCAGATGTTTGCCCGCCTGCAACTTCTAAGAGCCATTCGTGAGGTGCTCCACGCTGGCCTGGCTATGCTGGGTCTCCCACCACTGAGCCACATCTAA

XM_004833985.1 Coding sequence

Dalrd3 DALR anticodon binding domain containing 3, transcript variant X2

Length: 1617 bp    Location: 3066689..3063245   Strand: -
>XM_004833985.1
ATGGCGACGGAACGTCTTGGAGTAGGGGAGACACTAGGGGCCCTAAATGCGGCTTTAGGGCCTGGCGACCCAGTGTGGTTTAAAGAGACACATGCCCGGCACCTGCGAGTTCGAGATTTCCTGGCGCCGCGACGCGCACTACAAGCGCGCTTCGGGGACGGCCAGGTGCCCGAGCATGTGCTCCGTGCCCTCGCCGGCTTGCAGGGCCCCGGGGTGGCCCCAGTACTGTGCTGCGCGCCGACACCCGCGGGCTTGTCGCTCCAGCTTCAGCGGCCTGTTGTCTTTGAGCGCGTCCTCGGCGCTGTGGCCTCCTATGCTACGCCGGCCAACTGCGCTTCACCAGGCCTGCGCATCCTCCTGCACTGCCCAGCGCTGCGCTGCAGTCCTGGCGCGCTCCGCTTGAGCCAGCTGCGGGCCGTACTCGTGGCTGATCACCTGGCGCGAGCTCTGCGCGGTCAAGGGGTGTGTGTGCGCTTAGTTCCTGCAGTGCAGGACCCGCACCTACCAACCTTTCTGCAGAAACTGCGAGTGGACTGGCCCACTGCCTCGAAAAATGCACCGGCGGAAACCCTAAGAGACTTCGTGCTTGCAAAGTTCACCTCTGCCCAAGACCAGGAGACACTACCCCCGGGTGTTTTGGGCAGACTGGGCCTGAAGGAGCTGGTGAAAGAACAGGGCCGTGGGGCTGGCTATGACCCCAACGTGGACAAGTGCCTGGTGACTGAGGAGCTGCTGTGTGTGTTAGCTGAGCTGCAGGAAGCTGTGCAGCATTGGCCCAAGGGCAACTACCCAGTCCTGCCCCCAGATTCTGATGTAGACAGCTGCATGGTTATACATGTGGTAAGCTGTGAAGAGGAGTTCCAGCAACAAAAGTTGGACTTGCTTTGGTGGAAATTGGATGACCAGGCTCCTCTCAGACAGAAGCACCTGGTCTGTGGCCCAGTGAAAGTAGCTGGTGCACCCAGCACTCTGATGACTGCCCCTGAGTACTATGAGCTCCGGCATGCCCAGGTGTGCAAGGCCTCAGCACTGAAGCATGGTAGTGATCTGGCACAAGACCCAGCATGGACAGAGATCTCTGAGCTTCTCACTGTGGCCACTATCAAGTTTGAGATGCTGAGCACAGCCCCACAGAGTCAGCTCCTCCTCGCTGACATCATCTCCACAAAGGGCACAAAAAGTGGTATCTTTGTCATGTATAACTGTGCCCGTCTTGCCACACTCTTTGAGGGTTACAAGCGCAATATGGAACAAGGTCTGTACCCCACTTTTCCATCCGTGAAAAGTCTGGACTTCTCACTGTTGCATGATGAGGGGGAGTGGCTGCTGCTCTTCAATAGTGTCCTTCCCTTTCCGGACCTGCTCAGCCAGATTGCAGGCCTGTTCTGCACTGGCCCAGGGCTCCACATCAGTGCTCGCACAGAAACAGTATGCAAGTTCTTGGTACAGCTCAGCATGGACTTCAGTTCATACTACAACCGGGTACACATCCTAGGGGAGGCTCGGCCACATCTCTTTGGTCAGATGTTTGCCCGCCTGCAACTTCTAAGAGCCATTCGTGAGGTGCTCCACGCTGGCCTGGCTATGCTGGGTCTCCCACCACTGAGCCACATCTAA

XM_004833988.1 Coding sequence

Ndufaf3 NADH dehydrogenase (ubiquinone) complex I, assembly factor 3, transcript variant X1

Length: 540 bp    Location: 3069122..3070675   Strand: +
>XM_004833988.1
ATGGCCGTCGCCTTCGCCTTTCGCAGTCTGTGCCGGGCGCAACTCGCACCGCGCGGCCTGCGCGCCGGGCCGCTCTGGACCCCACGGCGCTGGCACCGGCTCTCCCCCGCAGACGACGAGCTGTACCAGCGGACGCACATCTCTCTGCTGCAGCGCGAGCTCCCGCACGCCATGTATATAGAAAGCTACAGCATCCGCGGCTTCACGGTCAGTGGAAGCCGAGTTCTGGGGCCGTGCGCCCTGCTCCCGAACTCCGTGCTGCAGTGGAACGTAGGATCCCACTGGGACATCACCGAAGAGAGCTTCTCCCTCTTCTGGATGCTGGAGCCCAGGATAGAGATCGTTGTCGTGGGCACTGGAAACAGGACCGAGAGGCTGCATTCCCCGGTGCTGCAGGCCATGAGGCAGCGGGGCATTGCCGTGGAAGTGCAGGATACGCCCAATGCCTGTGCTACCTTCAATTTCCTGTGTCATGAAGGCCGAGTGGTGGGAGCTGCTCTCATCCCCCCACCTGGAGAGAGTTCACTGACTCCAGAATGA

XM_004833989.1 Coding sequence

Ndufaf3 NADH dehydrogenase (ubiquinone) complex I, assembly factor 3, transcript variant X2

High confidence: 4 potential gene matches
Length: 540 bp    Location: 3069122..3070675   Strand: +
>XM_004833989.1
ATGGCCGTCGCCTTCGCCTTTCGCAGTCTGTGCCGGGCGCAACTCGCACCGCGCGGCCTGCGCGCCGGGCCGCTCTGGACCCCACGGCGCTGGCACCGGCTCTCCCCCGCAGACGACGAGCTGTACCAGCGGACGCACATCTCTCTGCTGCAGCGCGAGCTCCCGCACGCCATGTATATAGAAAGCTACAGCATCCGCGGCTTCACGGTCAGTGGAAGCCGAGTTCTGGGGCCGTGCGCCCTGCTCCCGAACTCCGTGCTGCAGTGGAACGTAGGATCCCACTGGGACATCACCGAAGAGAGCTTCTCCCTCTTCTGGATGCTGGAGCCCAGGATAGAGATCGTTGTCGTGGGCACTGGAAACAGGACCGAGAGGCTGCATTCCCCGGTGCTGCAGGCCATGAGGCAGCGGGGCATTGCCGTGGAAGTGCAGGATACGCCCAATGCCTGTGCTACCTTCAATTTCCTGTGTCATGAAGGCCGAGTGGTGGGAGCTGCTCTCATCCCCCCACCTGGAGAGAGTTCACTGACTCCAGAATGA

XM_004833996.1 Coding sequence

Impdh2 IMP (inosine 5'-monophosphate) dehydrogenase 2, transcript variant X2

Length: 1530 bp    Location: 3075890..3071132   Strand: -
>XM_004833996.1
ATGGCTGACTACCTGATTAGTGGGGGCACATCCTATGTGCCGGACGACGGACTCACGGCACAGCAGCTCTTCAACTGCGGGGACGGCCTCACCTACAACGATTTTCTCATTCTCCCTGGATACATCGACTTCACTGCAGACCAGGTGGACCTTACTTCTGCTCTGACCAAGAAGATCACACTCAAGACCCCACTGGTTTCCTCCCCCATGGATACAGTCACAGAGGCTGGGATGGCCATTGCAATGGCGCTCACAGGAGGTATTGGTTTCATCCACCACAACTGTACACCTGAATTCCAGGCCAATGAAAAATATGAGCAGGGATTCATCACAGACCCTGTGGTTCTCAGCCCCAAGGATCGAGTGCGGGATGTTTTTGAAGCTAAGGCTCGGCATGGCTTTTGTGGCATCCCCATCACAGATACAGGCCGCATGGGGAGCCGCTTAGTGGGCATCATCTCCTCGAGGGATATTGATTTTCTCAAGGAAGAGGAGCATGACCGGTTTCTGGAAGAGATCATGACAAAGAGGGAAGACTTGGTAGTAGCCCCTGCAGGCATCACATTAAAGGAAGCAAATGAAATTTTGCAGCGCAGCAAGAAGGGAAAATTACCCATTGTAAATGAAGATGATGAGCTGGTGGCCATCATTGCCCGGACCGACCTGAAGAAGAACAGGGATTACCCACTGGCCTCCAAAGATGCCAAGAAGCAGCTGCTGTGTGGGGCAGCCATTGGCACTCATGAAGATGACAAGTATAGGCTGGACTTGTTAGCTCAGTCTGGTGTGGATGTAGTGGTTTTGGACTCTTCCCAGGGCAACTCCATCTTCCAGATCAATATGATCAAGTACATCAAAGAAAAATACCCCAATCTCCAAGTCATTGGAGGCAATGTGGTCACCGCAGCTCAGGCCAAGAACCTCATTGATGCAGGTGTAGATGCCCTACGGGTGGGCATGGGAAGCGGCTCCATCTGCATCACCCAGGAAGTGTTGGCCTGTGGAAGGCCCCAAGCAACAGCAGTGTACAAAGTATCAGAATATGCACGGCGATTTGGTGTTCCTGTCATCGCTGATGGAGGAATCCAGAATGTGGGCCATATTGCCAAAGCTTTGGCCCTGGGGGCATCCACAGTCATGATGGGCTCCCTCCTGGCTGCCACCACTGAAGCCCCTGGTGAGTACTTCTTCTCTGATGGGATCCGGCTAAAGAAATATCGTGGCATGGGTTCTCTTGATGCCATGGACAAGCATCTCAGCAGCCAGAACCGCTATTTCAGTGAAGCTGACAAAATCAAAGTGGCCCAAGGGGTGTCGGGAGCTGTGCAAGACAAAGGATCCATTCACAAGTTTGTTCCTTACTTGATTGCTGGCATCCAGCACTCCTGCCAGGACATTGGTGCCAAAAGCTTGACACAAGTCCGAGCCATGATGTACTCTGGGGAGCTTAAGTTTGAGAAGAGAACGTCCTCAGCCCAGGTGGAAGGTGGTGTCCACAGCCTTCACTCGTATGAGAAGCGACTTTTCTGA

XM_004833997.1 Coding sequence

Impdh2 IMP (inosine 5'-monophosphate) dehydrogenase 2, transcript variant X3

Length: 1470 bp    Location: 3075889..3071132   Strand: -
>XM_004833997.1
ATGGCTGACTACCTGATTAGTGGGGGCACATCCTATGTGCCGGACGACGGACTCACGGCACAGCAGCTCTTCAACTGCGGGGACGGCCTCACCTACAACGATTTTCTCATTCTCCCTGGATACATCGACTTCACTGCAGACCAGGTGGACCTTACTTCTGCTCTGACCAAGAAGATCACACTCAAGACCCCACTGGTTTCCTCCCCCATGGATACAGTCACAGAGGCTGGGATGGCCATTGCAATGGCGAAATATGAGCAGGGATTCATCACAGACCCTGTGGTTCTCAGCCCCAAGGATCGAGTGCGGGATGTTTTTGAAGCTAAGGCTCGGCATGGCTTTTGTGGCATCCCCATCACAGATACAGGCCGCATGGGGAGCCGCTTAGTGGGCATCATCTCCTCGAGGGATATTGATTTTCTCAAGGAAGAGGAGCATGACCGGTTTCTGGAAGAGATCATGACAAAGAGGGAAGACTTGGTAGTAGCCCCTGCAGGCATCACATTAAAGGAAGCAAATGAAATTTTGCAGCGCAGCAAGAAGGGAAAATTACCCATTGTAAATGAAGATGATGAGCTGGTGGCCATCATTGCCCGGACCGACCTGAAGAAGAACAGGGATTACCCACTGGCCTCCAAAGATGCCAAGAAGCAGCTGCTGTGTGGGGCAGCCATTGGCACTCATGAAGATGACAAGTATAGGCTGGACTTGTTAGCTCAGTCTGGTGTGGATGTAGTGGTTTTGGACTCTTCCCAGGGCAACTCCATCTTCCAGATCAATATGATCAAGTACATCAAAGAAAAATACCCCAATCTCCAAGTCATTGGAGGCAATGTGGTCACCGCAGCTCAGGCCAAGAACCTCATTGATGCAGGTGTAGATGCCCTACGGGTGGGCATGGGAAGCGGCTCCATCTGCATCACCCAGGAAGTGTTGGCCTGTGGAAGGCCCCAAGCAACAGCAGTGTACAAAGTATCAGAATATGCACGGCGATTTGGTGTTCCTGTCATCGCTGATGGAGGAATCCAGAATGTGGGCCATATTGCCAAAGCTTTGGCCCTGGGGGCATCCACAGTCATGATGGGCTCCCTCCTGGCTGCCACCACTGAAGCCCCTGGTGAGTACTTCTTCTCTGATGGGATCCGGCTAAAGAAATATCGTGGCATGGGTTCTCTTGATGCCATGGACAAGCATCTCAGCAGCCAGAACCGCTATTTCAGTGAAGCTGACAAAATCAAAGTGGCCCAAGGGGTGTCGGGAGCTGTGCAAGACAAAGGATCCATTCACAAGTTTGTTCCTTACTTGATTGCTGGCATCCAGCACTCCTGCCAGGACATTGGTGCCAAAAGCTTGACACAAGTCCGAGCCATGATGTACTCTGGGGAGCTTAAGTTTGAGAAGAGAACGTCCTCAGCCCAGGTGGAAGGTGGTGTCCACAGCCTTCACTCGTATGAGAAGCGACTTTTCTGA

XM_004833995.1 Coding sequence

Impdh2 IMP (inosine 5'-monophosphate) dehydrogenase 2, transcript variant X1

High confidence: 2 potential gene matches
Length: 1545 bp    Location: 3075889..3071132   Strand: -
>XM_004833995.1
ATGGCTGACTACCTGATTAGTGGGGGCACATCCTATGTGCCGGACGACGGACTCACGGCACAGCAGCTCTTCAACTGCGGGGACGGCCTCACCTACAACGATTTTCTCATTCTCCCTGGATACATCGACTTCACTGCAGACCAGGTGGACCTTACTTCTGCTCTGACCAAGAAGATCACACTCAAGACCCCACTGGTTTCCTCCCCCATGGATACAGTCACAGAGGCTGGGATGGCCATTGCAATGGCGCTCACAGGAGGTATTGGTTTCATCCACCACAACTGTACACCTGAATTCCAGGCCAATGAAGTTCGAAAAGTGAAGAAATATGAGCAGGGATTCATCACAGACCCTGTGGTTCTCAGCCCCAAGGATCGAGTGCGGGATGTTTTTGAAGCTAAGGCTCGGCATGGCTTTTGTGGCATCCCCATCACAGATACAGGCCGCATGGGGAGCCGCTTAGTGGGCATCATCTCCTCGAGGGATATTGATTTTCTCAAGGAAGAGGAGCATGACCGGTTTCTGGAAGAGATCATGACAAAGAGGGAAGACTTGGTAGTAGCCCCTGCAGGCATCACATTAAAGGAAGCAAATGAAATTTTGCAGCGCAGCAAGAAGGGAAAATTACCCATTGTAAATGAAGATGATGAGCTGGTGGCCATCATTGCCCGGACCGACCTGAAGAAGAACAGGGATTACCCACTGGCCTCCAAAGATGCCAAGAAGCAGCTGCTGTGTGGGGCAGCCATTGGCACTCATGAAGATGACAAGTATAGGCTGGACTTGTTAGCTCAGTCTGGTGTGGATGTAGTGGTTTTGGACTCTTCCCAGGGCAACTCCATCTTCCAGATCAATATGATCAAGTACATCAAAGAAAAATACCCCAATCTCCAAGTCATTGGAGGCAATGTGGTCACCGCAGCTCAGGCCAAGAACCTCATTGATGCAGGTGTAGATGCCCTACGGGTGGGCATGGGAAGCGGCTCCATCTGCATCACCCAGGAAGTGTTGGCCTGTGGAAGGCCCCAAGCAACAGCAGTGTACAAAGTATCAGAATATGCACGGCGATTTGGTGTTCCTGTCATCGCTGATGGAGGAATCCAGAATGTGGGCCATATTGCCAAAGCTTTGGCCCTGGGGGCATCCACAGTCATGATGGGCTCCCTCCTGGCTGCCACCACTGAAGCCCCTGGTGAGTACTTCTTCTCTGATGGGATCCGGCTAAAGAAATATCGTGGCATGGGTTCTCTTGATGCCATGGACAAGCATCTCAGCAGCCAGAACCGCTATTTCAGTGAAGCTGACAAAATCAAAGTGGCCCAAGGGGTGTCGGGAGCTGTGCAAGACAAAGGATCCATTCACAAGTTTGTTCCTTACTTGATTGCTGGCATCCAGCACTCCTGCCAGGACATTGGTGCCAAAAGCTTGACACAAGTCCGAGCCATGATGTACTCTGGGGAGCTTAAGTTTGAGAAGAGAACGTCCTCAGCCCAGGTGGAAGGTGGTGTCCACAGCCTTCACTCGTATGAGAAGCGACTTTTCTGA

XM_004833990.1 Coding sequence

Qrich1 glutamine-rich 1, transcript variant X1

Length: 2334 bp    Location: 3122746..3076108   Strand: -
>XM_004833990.1
ATGAATAATTCTCTGGAGAACACCATTTCCTTTGAAGAATACATCCGAGTGAAGGCACGATCTGTCCCACAACACAGGATGAAGGAATTTCTGGACTCATTGGCCTCTAAGGGTCCAGAAGCCCTTCAGGAATTCCAGCAGACGGCCACCACTACCATGGTGTACCAACAGGGTGGGAACTGCATTTACACAGACAGCACTGAAGTGGCTGGGTCTTTGCTTGAACTTGCTTGTCCAGTTACCACCAGTGTTCAGCCACAGACCCAGCAAGAACAGCAGATCCAGGTTCAGCAGCCACAGCAGGTTCAGGTACAGGTGCAGGTACAGCAGTCCCCACAGCAGGTCTCGGCTCAGCAGCTCTCCCCGCAGCTCACCGTTCACCAGCCTGCCGAGCAGCCCATCCAGGTTCAGGTGCAGATCCAAGGACAGGCACCGCAGTCAGCAGCCCCTTCCATCCAGACCCCATCTCTGCAGAGCCCTAATCCCTCGCAGCTGCAAGCGGCCCAGATCCAGGTGCAGCATGTGCAGGCAGCTCAGCAGATCCAAGCAGCTGAAATTCCGGAGGAGCACATCCCACATCAGCAAATCCAGGCTCAGCTGGTTGCTGGCCAGTCTCTTGCTGGGGGTCAGCAGATCCAAATCCAGACTGTGGGTGCCCTTTCCCCACCACCATCCCAGCAGGGCTCACCTCGGGAAGGGGAGCGCCGGGTTGGCACGGCCAGTGTCCTCCAGCCAGTGAAGAAGCGCAAAGTGGACATGCCCATCACTGTGTCCTATGCCATCTCAGGTCAGCCAGTGGCCACCGTGTTGGCCATTCCACAGGGCCAGCAACAGAGTTACGTGTCTTTGAGGCCAGACTTGCTGACAGTAGACAGTGCCCACCTATACAGTGCCACTGGGACCATTACTAGCCCTACAGGAGAAACTTGGACCATCCCTGTTTATTCTGCCCAGCCCCGGGGGGACCCTCAGCAGCAGAGCATTACCCACATTGCCATTCCCCAGGAAGCCTACAACGCAGTTCATGTCAGTGGCTCACCCACAGCCCTGGCAGCTGTAAAGCTGGAGGATGACAAGGAGAAGATGGTGGGTACCACATCTGTAGTGAAAAACTCCCACGAAGAGGTTGTGCAGACCCTTGCAAACTCACTCTTTCCAGCACAGTTCATGAATGGCAACATCCACATTCCAGTGGCTGTGCAGGCTGTGGCAGGCACGTACCAGAATACGGCTCAGACTGTCCATATATGGGATCCCCAGCAACAGCCACAGCAGCAAACTCCCCAAGAACAGACACCGCCACCACCACAGCAGCAGCAGCAGCTCCAGGTTACTTGTTCAGCTCAGACCGTCCAAGTTGCTGAAGTTGAACCACAATCACAGCCACAGCCTTCCCCAGAACTTCTGCTTCCAAATTCTTTGAAGCCAGAAGAAGGGCTTGAAGTATGGAAAAACTGGGCCCAGACTAAGAATGCTGAACTGGAGAAGGATGCTCAGAACAGATTGGCCCCCATTGGGAGGCGCCAACTGCTGCGTTTCCAAGAAGATCTCATCTCCTCTGCTGTGGCTGAGTTGAATTATGGGCTGTGTCTAATGACACGGGAAGCTCGAAATGGAGAAGGTGAACCCTATGACCCTGACGTGCTCTACTATATTTTCCTGTGTATTCAAAAGTATCTTTTTGAAAATGGAAGGGTAGATGACATTTTCTCTGATCTTTACTATGTTCGATTCACGGAGTGGCTTCATGAAGTTTTGAAGGATGTTCAGCCCCGGGTCACTCCACTTGGCTACGTTCTGCCCAGCCACGTGACTGAGGAGATGCTGTGGGAGTGCAAACAGCTTGGGGCGCACTCCCCCTCTACCCTGCTGACCACCCTCATGTTCTTTAATACCAAGTACTTCCTGTTGAAGACAGTGGACCAGCACGTGAAACTGGCCTTCTCCAAGGTCTTGCGACAGACAAAGAAGAACCCCTCTAATCCAAAGGATAAAAGCACAAGTATCCGGTACCTGAAGGCCCTTGGAATACACCAGACTGGCCAGAAAGTTACAGATGACATGTATGCAGAACAGACAGAAAATCCAGAGAATCCACTGCGGTGTCCCATCAAGCTCTACGATTTCTACCTCTTCAAATGTCCCCAGAGTGTGAAAGGCCGGAATGACACCTTTTACCTGACACCTGAGCCAGTAGTGGCCCCCAACAGCCCAATCTGGTACTCAGTCCAGCCTATCAGCAGAGAGCAGATGGGACAAATGCTGACCCGGATCCTGGTGATACGAGAAATTCAGGAGGCCATTGCAGTGGCCAATGCGAGCACCATGCACTGA

XM_004833992.1 Coding sequence

Qrich1 glutamine-rich 1, transcript variant X3

Length: 2334 bp    Location: 3121401..3076108   Strand: -
>XM_004833992.1
ATGAATAATTCTCTGGAGAACACCATTTCCTTTGAAGAATACATCCGAGTGAAGGCACGATCTGTCCCACAACACAGGATGAAGGAATTTCTGGACTCATTGGCCTCTAAGGGTCCAGAAGCCCTTCAGGAATTCCAGCAGACGGCCACCACTACCATGGTGTACCAACAGGGTGGGAACTGCATTTACACAGACAGCACTGAAGTGGCTGGGTCTTTGCTTGAACTTGCTTGTCCAGTTACCACCAGTGTTCAGCCACAGACCCAGCAAGAACAGCAGATCCAGGTTCAGCAGCCACAGCAGGTTCAGGTACAGGTGCAGGTACAGCAGTCCCCACAGCAGGTCTCGGCTCAGCAGCTCTCCCCGCAGCTCACCGTTCACCAGCCTGCCGAGCAGCCCATCCAGGTTCAGGTGCAGATCCAAGGACAGGCACCGCAGTCAGCAGCCCCTTCCATCCAGACCCCATCTCTGCAGAGCCCTAATCCCTCGCAGCTGCAAGCGGCCCAGATCCAGGTGCAGCATGTGCAGGCAGCTCAGCAGATCCAAGCAGCTGAAATTCCGGAGGAGCACATCCCACATCAGCAAATCCAGGCTCAGCTGGTTGCTGGCCAGTCTCTTGCTGGGGGTCAGCAGATCCAAATCCAGACTGTGGGTGCCCTTTCCCCACCACCATCCCAGCAGGGCTCACCTCGGGAAGGGGAGCGCCGGGTTGGCACGGCCAGTGTCCTCCAGCCAGTGAAGAAGCGCAAAGTGGACATGCCCATCACTGTGTCCTATGCCATCTCAGGTCAGCCAGTGGCCACCGTGTTGGCCATTCCACAGGGCCAGCAACAGAGTTACGTGTCTTTGAGGCCAGACTTGCTGACAGTAGACAGTGCCCACCTATACAGTGCCACTGGGACCATTACTAGCCCTACAGGAGAAACTTGGACCATCCCTGTTTATTCTGCCCAGCCCCGGGGGGACCCTCAGCAGCAGAGCATTACCCACATTGCCATTCCCCAGGAAGCCTACAACGCAGTTCATGTCAGTGGCTCACCCACAGCCCTGGCAGCTGTAAAGCTGGAGGATGACAAGGAGAAGATGGTGGGTACCACATCTGTAGTGAAAAACTCCCACGAAGAGGTTGTGCAGACCCTTGCAAACTCACTCTTTCCAGCACAGTTCATGAATGGCAACATCCACATTCCAGTGGCTGTGCAGGCTGTGGCAGGCACGTACCAGAATACGGCTCAGACTGTCCATATATGGGATCCCCAGCAACAGCCACAGCAGCAAACTCCCCAAGAACAGACACCGCCACCACCACAGCAGCAGCAGCAGCTCCAGGTTACTTGTTCAGCTCAGACCGTCCAAGTTGCTGAAGTTGAACCACAATCACAGCCACAGCCTTCCCCAGAACTTCTGCTTCCAAATTCTTTGAAGCCAGAAGAAGGGCTTGAAGTATGGAAAAACTGGGCCCAGACTAAGAATGCTGAACTGGAGAAGGATGCTCAGAACAGATTGGCCCCCATTGGGAGGCGCCAACTGCTGCGTTTCCAAGAAGATCTCATCTCCTCTGCTGTGGCTGAGTTGAATTATGGGCTGTGTCTAATGACACGGGAAGCTCGAAATGGAGAAGGTGAACCCTATGACCCTGACGTGCTCTACTATATTTTCCTGTGTATTCAAAAGTATCTTTTTGAAAATGGAAGGGTAGATGACATTTTCTCTGATCTTTACTATGTTCGATTCACGGAGTGGCTTCATGAAGTTTTGAAGGATGTTCAGCCCCGGGTCACTCCACTTGGCTACGTTCTGCCCAGCCACGTGACTGAGGAGATGCTGTGGGAGTGCAAACAGCTTGGGGCGCACTCCCCCTCTACCCTGCTGACCACCCTCATGTTCTTTAATACCAAGTACTTCCTGTTGAAGACAGTGGACCAGCACGTGAAACTGGCCTTCTCCAAGGTCTTGCGACAGACAAAGAAGAACCCCTCTAATCCAAAGGATAAAAGCACAAGTATCCGGTACCTGAAGGCCCTTGGAATACACCAGACTGGCCAGAAAGTTACAGATGACATGTATGCAGAACAGACAGAAAATCCAGAGAATCCACTGCGGTGTCCCATCAAGCTCTACGATTTCTACCTCTTCAAATGTCCCCAGAGTGTGAAAGGCCGGAATGACACCTTTTACCTGACACCTGAGCCAGTAGTGGCCCCCAACAGCCCAATCTGGTACTCAGTCCAGCCTATCAGCAGAGAGCAGATGGGACAAATGCTGACCCGGATCCTGGTGATACGAGAAATTCAGGAGGCCATTGCAGTGGCCAATGCGAGCACCATGCACTGA

XM_004833991.1 Coding sequence

Qrich1 glutamine-rich 1, transcript variant X2

Length: 2334 bp    Location: 3121401..3076108   Strand: -
>XM_004833991.1
ATGAATAATTCTCTGGAGAACACCATTTCCTTTGAAGAATACATCCGAGTGAAGGCACGATCTGTCCCACAACACAGGATGAAGGAATTTCTGGACTCATTGGCCTCTAAGGGTCCAGAAGCCCTTCAGGAATTCCAGCAGACGGCCACCACTACCATGGTGTACCAACAGGGTGGGAACTGCATTTACACAGACAGCACTGAAGTGGCTGGGTCTTTGCTTGAACTTGCTTGTCCAGTTACCACCAGTGTTCAGCCACAGACCCAGCAAGAACAGCAGATCCAGGTTCAGCAGCCACAGCAGGTTCAGGTACAGGTGCAGGTACAGCAGTCCCCACAGCAGGTCTCGGCTCAGCAGCTCTCCCCGCAGCTCACCGTTCACCAGCCTGCCGAGCAGCCCATCCAGGTTCAGGTGCAGATCCAAGGACAGGCACCGCAGTCAGCAGCCCCTTCCATCCAGACCCCATCTCTGCAGAGCCCTAATCCCTCGCAGCTGCAAGCGGCCCAGATCCAGGTGCAGCATGTGCAGGCAGCTCAGCAGATCCAAGCAGCTGAAATTCCGGAGGAGCACATCCCACATCAGCAAATCCAGGCTCAGCTGGTTGCTGGCCAGTCTCTTGCTGGGGGTCAGCAGATCCAAATCCAGACTGTGGGTGCCCTTTCCCCACCACCATCCCAGCAGGGCTCACCTCGGGAAGGGGAGCGCCGGGTTGGCACGGCCAGTGTCCTCCAGCCAGTGAAGAAGCGCAAAGTGGACATGCCCATCACTGTGTCCTATGCCATCTCAGGTCAGCCAGTGGCCACCGTGTTGGCCATTCCACAGGGCCAGCAACAGAGTTACGTGTCTTTGAGGCCAGACTTGCTGACAGTAGACAGTGCCCACCTATACAGTGCCACTGGGACCATTACTAGCCCTACAGGAGAAACTTGGACCATCCCTGTTTATTCTGCCCAGCCCCGGGGGGACCCTCAGCAGCAGAGCATTACCCACATTGCCATTCCCCAGGAAGCCTACAACGCAGTTCATGTCAGTGGCTCACCCACAGCCCTGGCAGCTGTAAAGCTGGAGGATGACAAGGAGAAGATGGTGGGTACCACATCTGTAGTGAAAAACTCCCACGAAGAGGTTGTGCAGACCCTTGCAAACTCACTCTTTCCAGCACAGTTCATGAATGGCAACATCCACATTCCAGTGGCTGTGCAGGCTGTGGCAGGCACGTACCAGAATACGGCTCAGACTGTCCATATATGGGATCCCCAGCAACAGCCACAGCAGCAAACTCCCCAAGAACAGACACCGCCACCACCACAGCAGCAGCAGCAGCTCCAGGTTACTTGTTCAGCTCAGACCGTCCAAGTTGCTGAAGTTGAACCACAATCACAGCCACAGCCTTCCCCAGAACTTCTGCTTCCAAATTCTTTGAAGCCAGAAGAAGGGCTTGAAGTATGGAAAAACTGGGCCCAGACTAAGAATGCTGAACTGGAGAAGGATGCTCAGAACAGATTGGCCCCCATTGGGAGGCGCCAACTGCTGCGTTTCCAAGAAGATCTCATCTCCTCTGCTGTGGCTGAGTTGAATTATGGGCTGTGTCTAATGACACGGGAAGCTCGAAATGGAGAAGGTGAACCCTATGACCCTGACGTGCTCTACTATATTTTCCTGTGTATTCAAAAGTATCTTTTTGAAAATGGAAGGGTAGATGACATTTTCTCTGATCTTTACTATGTTCGATTCACGGAGTGGCTTCATGAAGTTTTGAAGGATGTTCAGCCCCGGGTCACTCCACTTGGCTACGTTCTGCCCAGCCACGTGACTGAGGAGATGCTGTGGGAGTGCAAACAGCTTGGGGCGCACTCCCCCTCTACCCTGCTGACCACCCTCATGTTCTTTAATACCAAGTACTTCCTGTTGAAGACAGTGGACCAGCACGTGAAACTGGCCTTCTCCAAGGTCTTGCGACAGACAAAGAAGAACCCCTCTAATCCAAAGGATAAAAGCACAAGTATCCGGTACCTGAAGGCCCTTGGAATACACCAGACTGGCCAGAAAGTTACAGATGACATGTATGCAGAACAGACAGAAAATCCAGAGAATCCACTGCGGTGTCCCATCAAGCTCTACGATTTCTACCTCTTCAAATGTCCCCAGAGTGTGAAAGGCCGGAATGACACCTTTTACCTGACACCTGAGCCAGTAGTGGCCCCCAACAGCCCAATCTGGTACTCAGTCCAGCCTATCAGCAGAGAGCAGATGGGACAAATGCTGACCCGGATCCTGGTGATACGAGAAATTCAGGAGGCCATTGCAGTGGCCAATGCGAGCACCATGCACTGA

XM_004833994.1 Coding sequence

Qrich1 glutamine-rich 1, transcript variant X5

High confidence: 4 potential gene matches
Length: 2334 bp    Location: 3113424..3076108   Strand: -
>XM_004833994.1
ATGAATAATTCTCTGGAGAACACCATTTCCTTTGAAGAATACATCCGAGTGAAGGCACGATCTGTCCCACAACACAGGATGAAGGAATTTCTGGACTCATTGGCCTCTAAGGGTCCAGAAGCCCTTCAGGAATTCCAGCAGACGGCCACCACTACCATGGTGTACCAACAGGGTGGGAACTGCATTTACACAGACAGCACTGAAGTGGCTGGGTCTTTGCTTGAACTTGCTTGTCCAGTTACCACCAGTGTTCAGCCACAGACCCAGCAAGAACAGCAGATCCAGGTTCAGCAGCCACAGCAGGTTCAGGTACAGGTGCAGGTACAGCAGTCCCCACAGCAGGTCTCGGCTCAGCAGCTCTCCCCGCAGCTCACCGTTCACCAGCCTGCCGAGCAGCCCATCCAGGTTCAGGTGCAGATCCAAGGACAGGCACCGCAGTCAGCAGCCCCTTCCATCCAGACCCCATCTCTGCAGAGCCCTAATCCCTCGCAGCTGCAAGCGGCCCAGATCCAGGTGCAGCATGTGCAGGCAGCTCAGCAGATCCAAGCAGCTGAAATTCCGGAGGAGCACATCCCACATCAGCAAATCCAGGCTCAGCTGGTTGCTGGCCAGTCTCTTGCTGGGGGTCAGCAGATCCAAATCCAGACTGTGGGTGCCCTTTCCCCACCACCATCCCAGCAGGGCTCACCTCGGGAAGGGGAGCGCCGGGTTGGCACGGCCAGTGTCCTCCAGCCAGTGAAGAAGCGCAAAGTGGACATGCCCATCACTGTGTCCTATGCCATCTCAGGTCAGCCAGTGGCCACCGTGTTGGCCATTCCACAGGGCCAGCAACAGAGTTACGTGTCTTTGAGGCCAGACTTGCTGACAGTAGACAGTGCCCACCTATACAGTGCCACTGGGACCATTACTAGCCCTACAGGAGAAACTTGGACCATCCCTGTTTATTCTGCCCAGCCCCGGGGGGACCCTCAGCAGCAGAGCATTACCCACATTGCCATTCCCCAGGAAGCCTACAACGCAGTTCATGTCAGTGGCTCACCCACAGCCCTGGCAGCTGTAAAGCTGGAGGATGACAAGGAGAAGATGGTGGGTACCACATCTGTAGTGAAAAACTCCCACGAAGAGGTTGTGCAGACCCTTGCAAACTCACTCTTTCCAGCACAGTTCATGAATGGCAACATCCACATTCCAGTGGCTGTGCAGGCTGTGGCAGGCACGTACCAGAATACGGCTCAGACTGTCCATATATGGGATCCCCAGCAACAGCCACAGCAGCAAACTCCCCAAGAACAGACACCGCCACCACCACAGCAGCAGCAGCAGCTCCAGGTTACTTGTTCAGCTCAGACCGTCCAAGTTGCTGAAGTTGAACCACAATCACAGCCACAGCCTTCCCCAGAACTTCTGCTTCCAAATTCTTTGAAGCCAGAAGAAGGGCTTGAAGTATGGAAAAACTGGGCCCAGACTAAGAATGCTGAACTGGAGAAGGATGCTCAGAACAGATTGGCCCCCATTGGGAGGCGCCAACTGCTGCGTTTCCAAGAAGATCTCATCTCCTCTGCTGTGGCTGAGTTGAATTATGGGCTGTGTCTAATGACACGGGAAGCTCGAAATGGAGAAGGTGAACCCTATGACCCTGACGTGCTCTACTATATTTTCCTGTGTATTCAAAAGTATCTTTTTGAAAATGGAAGGGTAGATGACATTTTCTCTGATCTTTACTATGTTCGATTCACGGAGTGGCTTCATGAAGTTTTGAAGGATGTTCAGCCCCGGGTCACTCCACTTGGCTACGTTCTGCCCAGCCACGTGACTGAGGAGATGCTGTGGGAGTGCAAACAGCTTGGGGCGCACTCCCCCTCTACCCTGCTGACCACCCTCATGTTCTTTAATACCAAGTACTTCCTGTTGAAGACAGTGGACCAGCACGTGAAACTGGCCTTCTCCAAGGTCTTGCGACAGACAAAGAAGAACCCCTCTAATCCAAAGGATAAAAGCACAAGTATCCGGTACCTGAAGGCCCTTGGAATACACCAGACTGGCCAGAAAGTTACAGATGACATGTATGCAGAACAGACAGAAAATCCAGAGAATCCACTGCGGTGTCCCATCAAGCTCTACGATTTCTACCTCTTCAAATGTCCCCAGAGTGTGAAAGGCCGGAATGACACCTTTTACCTGACACCTGAGCCAGTAGTGGCCCCCAACAGCCCAATCTGGTACTCAGTCCAGCCTATCAGCAGAGAGCAGATGGGACAAATGCTGACCCGGATCCTGGTGATACGAGAAATTCAGGAGGCCATTGCAGTGGCCAATGCGAGCACCATGCACTGA

XM_004833999.1 Coding sequence

Qars glutaminyl-tRNA synthetase, transcript variant X2

Length: 2292 bp    Location: 3130745..3123877   Strand: -
>XM_004833999.1
ATGGCCACTCCCGACTCTTTAGCGCTTTTCACCGCCCTTGGTCTGAGCGAACCAAAGGCCCGCGAGACGCTAAAGAACGCGGCTCTGAGTAAGCAGTTGCGTGAGGCGGCGACCCAGGCGCAGCAGACTCTGGGCTCCACCATCGACAAAGCTACCGGGACCCTGCTATATGGCTTGGCCTCACGACTCAGGGATACCAGGCGTCTCTCTTTCCTTGTGAGCTATATAGCCACTGCCCTTGAGTATGTGCGGAGTCACCCTCTGGATCCCATCGACACTATGGACTTCGAGCAGGAATGTGGTGTGGGTGTTACGGTGACCCCAGAGCAGATTGAGGAGGCTGTGGAGGCCACCATAAATAGGCACCGGTCCCAGCTCCTGATGGAGCGTTACCATTTCAACCTGGGGCTGCTGATGGGAGAAGCTCGGGCTGTGCTCAAGTGGGCAGATGGCAAAATGATCAAGCATGAAGTGGACATGCAGGTCCTCCACCTTCTGGGTCCCAAGGTGGAAGCTGATCTGCAGAAGAAACCCAAGGTGGCAAAAGCTCGATTAGAAGAAACAGACCAGAAGCCAGCAAAAGATGTGGAGAATGGTGATCCTGCAGGCCTGACCTTGTCTCTGATGGAGCAGCTTCGGGGAGAGGCCCTTAAGTTCCATAAGCCTGGTGAGAACTACAAGACCCCTGGCTATGTTACTACTCCACACACTATGGATCTACTGAAGCAACACCTGGAGATCACTGGGGGTCAGGTACGTACCCGGTTCCCGCCAGAACCCAATGGAATCCTGCACATTGGACATGCCAAAGCCATCAATTTTAACTTTGGTTATGCCAAGGCCAACAGTGGTATCTGTTTTCTGCGCTTTGATGACACCAACCCTGAGAAAGAGGAAGCAAAGTTCTTTACCGCTATCTATGACATGGTGACCTGGCTGGGTTACACTCCCCACAAGGTGACATATGCTTCTGACTATTTTGACCAGCTGTATGCCTGGGCTGTGGAGCTCATCCACAGGGGGCAGGCTTATGTTTGCCACCAGCGAGGGGAGGAGCTCAAAGGTCACAACTCTCTGCCTTCACCCTGGAGGGACCGGCCAGTGGAAGAATCACTGCTGCTTTTTGAGGCGATGCGCAAGGGCAAGTTTGCCGAGGGTGAGGCCACACTGCGGATGAAGCTGGTAATGGAGGATGGCAAGATGGACCCTGTGGCCTATCGAGTCAAGTACACAGCACATCACCGCACAGGCGACAAATGGTGCATCTACCCTACCTATGACTATACCCACTGCCTCTGTGACTCCATTGAGCACATCACCCACTCACTGTGCACCAAGGAATTCCAGTCCCGCCGGTCTTCTTACTTCTGGCTGTGCAATGCACTGGATGTCTACTGCCCTGTGCAGTGGGAGTATGGCCGCCTTAACCTGCACTATGCTGTGGTCTCCAAGAGGAAGATCCTCCAGCTTGTAGCAGCTGGTGCAGTACGGGACTGGGATGACCCACGGCTCTTCACACTTACGGCCCTGCGACGGCGGGGCTTTCCGCCTGAAGCTATCAACAGCTTCTGTGCCCGGGTTGGGGTGACAGTGGCACAGACTACAATGGAGCCACATCTTCTGGAAGCCTGTGTGCGTGATATGCTAAATGACACAGCTCCACGGGCCATGGCTGTGCTGGAACCGCTACAGGTTGTTATCACCAACTTTCCTGCTGCCAAGCACTTAGACATCCAGGTGCCCAACTTTCCAGCTGATGAGACTAAGGGCTTCCACCAGGTTCCTTTTGCATCCATTGTCTTCATTGAGAAGATGGACTTCAAGGAGGAGCCAGAGCCAGGCTATAAGCGCCTGGCTTGGGGCCAACCGGTGGGCCTGAGACATACAGGCTATGTCATTGAGCTGCAGCACGTTGTCAAGGGCCCCACTGGCTGTGTGGAGAGCCTAGAGGTGACCTGCACACGGGCTGATGCTGGGGAGAAGCCCAAGGCTTTTATTCACTGGGTGTCACAGCCTCTAAAGTGTGAAATTCGCCTTTATGAGCGACTATTCCAGCACAAGAACCCTGAAGATCCTGCTGAGGTCCCTGGTGGATTCCTTTGTGACCTGAATCCGGAATCCTTGCGAGTGGTGGAAGCAGCATTAGTAGACTGCTCTGTGGCTCTGGCAAAGCCTTTTGACAAGCTCCAGTTTGAGCGCGTTGGGTACTTCTCTGTGGATCCAGATAGCTGCCAAGGACAGCTTGTCTTCAACCGAACTGTCACACTGAAGGAGGACCCAGGAAAGTTGTGA

XM_004834000.1 Coding sequence

Qars glutaminyl-tRNA synthetase, transcript variant X3

Length: 2013 bp    Location: 3130696..3123877   Strand: -
>XM_004834000.1
ATGGACTTCGAGCAGGAATGTGGTGTGGGTGTTACGGTGACCCCAGAGCAGATTGAGGAGGCTGTGGAGGCCACCATAAATAGGCACCGGTCCCAGCTCCTGATGGAGCGTTACCATTTCAACCTGGGGCTGCTGATGGGAGAAGCTCGGGCTGTGCTCAAGTGGGCAGATGGCAAAATGATCAAGCATGAAGTGGACATGCAGGTCCTCCACCTTCTGGGTCCCAAGGTGGAAGCTGATCTGCAGAAGAAACCCAAGGTGGCAAAAGCTCGATTAGAAGAAACAGACCAGAAGCCAGCAAAAGATGTGGAGAATGGTGATCCTGCAGGCCTGACCTTGTCTCTGATGGAGCAGCTTCGGGGAGAGGCCCTTAAGTTCCATAAGCCTGGTGAGAACTACAAGACCCCTGGCTATGTTACTACTCCACACACTATGGATCTACTGAAGCAACACCTGGAGATCACTGGGGGTCAGGTACGTACCCGGTTCCCGCCAGAACCCAATGGAATCCTGCACATTGGACATGCCAAAGCCATCAATTTTAACTTTGGTTATGCCAAGGCCAACAGTGGTATCTGTTTTCTGCGCTTTGATGACACCAACCCTGAGAAAGAGGAAGCAAAGTTCTTTACCGCTATCTATGACATGGTGACCTGGCTGGGTTACACTCCCCACAAGGTGACATATGCTTCTGACTATTTTGACCAGCTGTATGCCTGGGCTGTGGAGCTCATCCACAGGGGGCAGGCTTATGTTTGCCACCAGCGAGGGGAGGAGCTCAAAGGTCACAACTCTCTGCCTTCACCCTGGAGGGACCGGCCAGTGGAAGAATCACTGCTGCTTTTTGAGGCGATGCGCAAGGGCAAGTTTGCCGAGGGTGAGGCCACACTGCGGATGAAGCTGGTAATGGAGGATGGCAAGATGGACCCTGTGGCCTATCGAGTCAAGTACACAGCACATCACCGCACAGGCGACAAATGGTGCATCTACCCTACCTATGACTATACCCACTGCCTCTGTGACTCCATTGAGCACATCACCCACTCACTGTGCACCAAGGAATTCCAGTCCCGCCGGTCTTCTTACTTCTGGCTGTGCAATGCACTGGATGTCTACTGCCCTGTGCAGTGGGAGTATGGCCGCCTTAACCTGCACTATGCTGTGGTCTCCAAGAGGAAGATCCTCCAGCTTGTAGCAGCTGGTGCAGTACGGGACTGGGATGACCCACGGCTCTTCACACTTACGGCCCTGCGACGGCGGGGCTTTCCGCCTGAAGCTATCAACAGCTTCTGTGCCCGGGTTGGGGTGACAGTGGCACAGACTACAATGGAGCCACATCTTCTGGAAGCCTGTGTGCGTGATATGCTAAATGACACAGCTCCACGGGCCATGGCTGTGCTGGAACCGCTACAGGTTGTTATCACCAACTTTCCTGCTGCCAAGCACTTAGACATCCAGGTGCCCAACTTTCCAGCTGATGAGACTAAGGGCTTCCACCAGGTTCCTTTTGCATCCATTGTCTTCATTGAGAAGATGGACTTCAAGGAGGAGCCAGAGCCAGGCTATAAGCGCCTGGCTTGGGGCCAACCGGTGGGCCTGAGACATACAGGCTATGTCATTGAGCTGCAGCACGTTGTCAAGGGCCCCACTGGCTGTGTGGAGAGCCTAGAGGTGACCTGCACACGGGCTGATGCTGGGGAGAAGCCCAAGGCTTTTATTCACTGGGTGTCACAGCCTCTAAAGTGTGAAATTCGCCTTTATGAGCGACTATTCCAGCACAAGAACCCTGAAGATCCTGCTGAGGTCCCTGGTGGATTCCTTTGTGACCTGAATCCGGAATCCTTGCGAGTGGTGGAAGCAGCATTAGTAGACTGCTCTGTGGCTCTGGCAAAGCCTTTTGACAAGCTCCAGTTTGAGCGCGTTGGGTACTTCTCTGTGGATCCAGATAGCTGCCAAGGACAGCTTGTCTTCAACCGAACTGTCACACTGAAGGAGGACCCAGGAAAGTTGTGA

XM_004834008.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X8

High confidence: 4 potential gene matches
Length: 4050 bp    Location: 3144659..3134472   Strand: -
>XM_004834008.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGGTGAGGAGTAAGCCCTTCCCCTCTGAGCTGTTCAGGGAACCTGACCCGTCTCCCCCACTGACTCCACCCTTGTCACCACAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGGACTAGGCCCTGGCCAGGCCCCAGAGGTGGCCCCCACGCGGACAGCCCCTGAACGCTACGCCCCCCCTGTGGACCGCCCAGCCCCCACCTACAGCAACATGGAGGAGGTCGATTAG

XM_004834010.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X10

Length: 4011 bp    Location: 3144659..3134473   Strand: -
>XM_004834010.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGGTGGGATGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGGTGACTTGTGGAGACCCTTGTCATCTCCCCTTACAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGGACTAGGCCCTGGCCAGGCCCCAGAGGTGGCCCCCACGCGGACAGCCCCTGAACGCTACGCCCCCCCTGTGGACCGCCCAGCCCCCACCTACAGCAACATGGAGGAGGTCGATTAG

XM_004834013.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X13

Length: 3897 bp    Location: 3144658..3134473   Strand: -
>XM_004834013.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGGACTAGGCCCTGGCCAGGCCCCAGAGGTGGCCCCCACGCGGACAGCCCCTGAACGCTACGCCCCCCCTGTGGACCGCCCAGCCCCCACCTACAGCAACATGGAGGAGGTCGATTAG

XM_004834012.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X12

Length: 3963 bp    Location: 3144658..3134473   Strand: -
>XM_004834012.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGGACTAGGCCCTGGCCAGGCCCCAGAGGTGGCCCCCACGCGGACAGCCCCTGAACGCTACGCCCCCCCTGTGGACCGCCCAGCCCCCACCTACAGCAACATGGAGGAGGTCGATTAG

XM_004834011.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X11

Length: 3969 bp    Location: 3144658..3134473   Strand: -
>XM_004834011.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGGACTAGGCCCTGGCCAGGCCCCAGAGGTGGCCCCCACGCGGACAGCCCCTGAACGCTACGCCCCCCCTGTGGACCGCCCAGCCCCCACCTACAGCAACATGGAGGAGGTCGATTAG

XM_004834003.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X3

Length: 4161 bp    Location: 3145374..3134819   Strand: -
>XM_004834003.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGGTGAGGAGTAAGCCCTTCCCCTCTGAGCTGTTCAGGGAACCTGACCCGTCTCCCCCACTGACTCCACCCTTGTCACCACAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGCTTCCCGGATTTGGCAGGAGCTCGAGACCGAGGAAGAGATGGTGCCTGAGGGGCCTGGGCCTGTTGGTCCCTGGGGACCCCAAGACTGGGTGGGCACTCCATCACGTGGCCCTACCACACCAGATGAGGGCTGCCTCCGGTACTTTGTCCTTGGCACTGTGGCCGCTTTGGTGGCCCTAGTGCTCAACGTGTTCTATCCTCTGGTATCTCAGAGTCACTGGAGATGA

XM_004834005.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X5

Length: 4155 bp    Location: 3144661..3134819   Strand: -
>XM_004834005.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGGTGAGGAGTAAGCCCTTCCCCTCTGAGCTGTTCAGGGAACCTGACCCGTCTCCCCCACTGACTCCACCCTTGTCACCACAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGCTTCCCGGATTTGGCAGGAGCTCGAGACCGAGGAAGAGATGGTGCCTGAGGGGCCTGGGCCTGTTGGTCCCTGGGGACCCCAAGACTGGGTGGGCACTCCATCACGTGGCCCTACCACACCAGATGAGGGCTGCCTCCGGTACTTTGTCCTTGGCACTGTGGCCGCTTTGGTGGCCCTAGTGCTCAACGTGTTCTATCCTCTGGTATCTCAGAGTCACTGGAGATGA

XM_004834002.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X2

Length: 4161 bp    Location: 3144660..3134819   Strand: -
>XM_004834002.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGGTGAGGAGTAAGCCCTTCCCCTCTGAGCTGTTCAGGGAACCTGACCCGTCTCCCCCACTGACTCCACCCTTGTCACCACAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGCTTCCCGGATTTGGCAGGAGCTCGAGACCGAGGAAGAGATGGTGCCTGAGGGGCCTGGGCCTGTTGGTCCCTGGGGACCCCAAGACTGGGTGGGCACTCCATCACGTGGCCCTACCACACCAGATGAGGGCTGCCTCCGGTACTTTGTCCTTGGCACTGTGGCCGCTTTGGTGGCCCTAGTGCTCAACGTGTTCTATCCTCTGGTATCTCAGAGTCACTGGAGATGA

XM_004834006.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X6

Length: 4131 bp    Location: 3144660..3134819   Strand: -
>XM_004834006.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGGTGAGGAGTAAGCCCTTCCCCTCTGAGCTGTTCAGGGAACCTGACCCGTCTCCCCCACTGACTCCACCCTTGTCACCACAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGCTTCCCGGATTTGGCAGGAGCTCGAGACCGAGGAAGAGATGGTGCCTGAGGGGCCTGGGCCTGTTGGTCCCTGGGGACCCCAAGACTGGGTGGGCACTCCATCACGTGGCCCTACCACACCAGATGAGGGCTGCCTCCGGTACTTTGTCCTTGGCACTGTGGCCGCTTTGGTGGCCCTAGTGCTCAACGTGTTCTATCCTCTGGTATCTCAGAGTCACTGGAGATGA

XM_004834004.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X4

Length: 4158 bp    Location: 3144660..3134819   Strand: -
>XM_004834004.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGGTGAGGAGTAAGCCCTTCCCCTCTGAGCTGTTCAGGGAACCTGACCCGTCTCCCCCACTGACTCCACCCTTGTCACCACAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGCTTCCCGGATTTGGCAGGAGCTCGAGACCGAGGAAGAGATGGTGCCTGAGGGGCCTGGGCCTGTTGGTCCCTGGGGACCCCAAGACTGGGTGGGCACTCCATCACGTGGCCCTACCACACCAGATGAGGGCTGCCTCCGGTACTTTGTCCTTGGCACTGTGGCCGCTTTGGTGGCCCTAGTGCTCAACGTGTTCTATCCTCTGGTATCTCAGAGTCACTGGAGATGA

XM_004834009.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X9

Length: 4011 bp    Location: 3144660..3134819   Strand: -
>XM_004834009.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGGTGAGGAGTAAGCCCTTCCCCTCTGAGCTGTTCAGGGAACCTGACCCGTCTCCCCCACTGACTCCACCCTTGTCACCACAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGCTTCCCGGATTTGGCAGGAGCTCGAGACCGAGGAAGAGATGGTGCCTGAGGGGCCTGGGCCTGTTGGTCCCTGGGGACCCCAAGACTGGGTGGGCACTCCATCACGTGGCCCTACCACACCAGATGAGGGCTGCCTCCGGTACTTTGTCCTTGGCACTGTGGCCGCTTTGGTGGCCCTAGTGCTCAACGTGTTCTATCCTCTGGTATCTCAGAGTCACTGGAGATGA

XM_004834001.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X1

Length: 4161 bp    Location: 3144660..3134819   Strand: -
>XM_004834001.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGGTGAGGAGTAAGCCCTTCCCCTCTGAGCTGTTCAGGGAACCTGACCCGTCTCCCCCACTGACTCCACCCTTGTCACCACAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGCTTCCCGGATTTGGCAGGAGCTCGAGACCGAGGAAGAGATGGTGCCTGAGGGGCCTGGGCCTGTTGGTCCCTGGGGACCCCAAGACTGGGTGGGCACTCCATCACGTGGCCCTACCACACCAGATGAGGGCTGCCTCCGGTACTTTGTCCTTGGCACTGTGGCCGCTTTGGTGGCCCTAGTGCTCAACGTGTTCTATCCTCTGGTATCTCAGAGTCACTGGAGATGA

XM_004834007.1 Coding sequence

Usp19 ubiquitin specific peptidase 19, transcript variant X7

Length: 4080 bp    Location: 3144659..3134819   Strand: -
>XM_004834007.1
ATGTCTGGAGGGACCAGTGCCACAGGCCCAAGGAGAGGGCCCCCAGGACTGGAGGAGGCCACTAGTAAGAAGAAGCAGAAGGATCGAGCAAACCAGGAGAGCAAGGATGGAGACCCTAGGAGAGTGTCACTGTCCACTCCTCAAGAGGAGCAGACTAAAGAAGAGTTGTTGCTTGATTGGAGGCAGAGTGCAGATGAGGTAATTGTTAAGCTGCGTGTGGGAACTGGTCCACTGCAGCTGGAGGAGGTGGATGCTGCCTTCACAGACACAGACTGTGTGGTTCGGCTTCCAGGTGGTCGGCAGTGGGGTGGTGTCTTCTATGCTGAAATAGAAAGTTCTTGCACCAAAGTGCAGGCCCGCAAGGGTGGTCTCCTACAGCTGGCATTGCCTAAGAAGGTGCCTCTGCTCACTTGGCCCTCTCTTCTGAAGAAACTAGAGACCCAGGAGCTGGTATCAGGTCTGCGATGCCAAGAGAATGGACAGGAGCTGTCTCCCATTGCCCTGGAGCCAGGCCCTGAGCCCCGCCGGGCTAAGCAGGAGGCCCGGAACCAAAAGCGAGCCCAGGGCCGTGGTGAGGTAGGCTCAGGGGCTGGCCCTGGGGTCCAGGCAGGGCCCAGTGCCAAGAGGGCTGTGCATCTCCGCAGAGGGCCAGAGGGGGAAAGGTCCAGGGATGGCCCTGGACTCCAGGGTGATGCCCCACCCTTCCTGGCTGATCTGGACGCCCAGGTTGAGGCTGAAGAACAGCTCCAGGTACCACTGCTGAACCCCAAAACCTGCCTTCTGGGCTCAGAGACGAATTTAGCCCTTTTGTCAGGAGAGAAGGCAGTCTTCCCCAGGAATGACCCAGTTCCCGCAGCCATTATCCAAAGCAGAGACTCTGGGAAAGATGGCCACGTCAAAGAGGAGATGGTAGAACCAGCAGATGTTGCAGCCTTGTCAGATGATAAAGAGCCTGAGTCCATAGTGAACCTGGCATTTGTCAAGAATGACTCATACGAGAAGGGGCCGGATTCAGTGGTGGTGCACGTGTATGTGAAGGAGATCCAAAGGGACACCTCTCGAGTACTTTTCCGGGAGCAGGACTTCACACTCATCTTCCAGACCAGGGATGGAAACTTCCTGAGGCTGCATCCGGGCTGTGGGTCTCACACCATCTTCCGCTGGCAGGTGAAGCTCAGGAACCTGATTGAGCCAGAACAGTGCACCTTCTGTTTCACGGCCTCTCGAATCGACATCTGCCTCCGTAAGCGGCAGAGTCAGCGCTGGGGGGGCCTGGAGGCCCCGGCTGCACGAGGTGCAGTGGGTGGTGCAAAGGTTGCTGTGCCGACAGGTCCAACTCCTCTGGAGTCAGCCCCTCCTGGAAGTCCTCCACACCCCCTGACAGGCCAGGAGGAAGCTCGAGCTGTGGAGAAGGACAAAGCTAAGGCTCGATCTGAGGATGTGGGGCTGGATAGTGTGGCCGCCCGCACCCCCTTGGAGCATGTATCCCCAAAGCCAGAACCACACCTGGCCTCGCCCAAGCCCACATGTATGGTGCCTCCAATGCCCCACAGCCCTGTGAGTGGAGACAGTGTGGAGGAGGAAGAGGAGGAAGAGAAGAAGGTGTGTCTGCCAGGATTCACCGGCCTTGTCAATTTAGGCAACACCTGCTTCATGAACAGTGTCATTCAGTCTCTGTCCAACACTCGGGAGCTTCGGGACTTCTTCCATGACCGCTCCTTTGAGGCTGAGATCAACTATAACAACCCGCTGGGGACTGGTGGGCGTTTGGCCATTGGCTTTGCTGTGCTGCTTCGGGCCCTGTGGAAGGGCACTCACCATGCCTTTCAGCCTTCCAAGTTGAAGGCCATTGTGGCAAGCAAGGCCAGCCAATTCACAGGCTATGCCCAGCATGATGCACAGGAGTTCATGGCTTTCCTGCTGGATGGGCTACATGAGGACCTGAATCGAATCCAGAACAAGCCCTACACAGAGACTGTGGACTCAGATGGGCGGCCTGATGAGGTGGTGGCTGCGGAAGCATGGCAGCGGCACAAGATGAGGAATGACTCTTTCATCGTGGACCTGTTTCAGGGCCAGTACAAGTCAAAGTTGGTGTGCCCTGTGTGTGCCAAGGTCTCCATCACTTTTGACCCATTCCTTTATCTGCCGGTGCCCTTACCACAAAAGCAAAAGGTTCTTCCCATCTTCTATTTTGCCCGAGAGCCCCACTGTAAACCCATCAAGTTCCTGGTGAGTGTTAGCAAGGAGAACTCCAGTGCGAGTGAGGTTTTGGATTCGCTCTCTGAGAGTGTTCACGTGAAGCCTGAGAACCTGCGCCTGGCTGAGGTGATTAAGAATCGCTTTCACCGTGTGTTTCTCCCCTCCCAATCCCTGGACACTGTGTCCCCATCTGACATACTCCTCTGCTTTGAGCTGCTATCCCCAGAGTTGGCTAAGGAGCGGGTAGTGGTGTTAGAGGTACAACAGCGCCCCCAGGTACCCAGCATCCCCATCTCCAAGTGTGCAGCCTGCCAGCGGAAGCAGCAGTCAGAGGATGAAAAACTGAAGCGCTGTACCCGGTGCTACCGTGTGGGCTACTGCAACCAGCTCTGCCAGAAAAACCACTGGCCTGACCATAAGGGCCTCTGCCGCCCTGAGAACATTGGCTACCCCTTCCTGGTCAGTGTACCTGCCTCACGCCTCACTTATGCTCGTCTGACTCAGTTGCTGGAAGGTTATGCCCGATACTCGGTGAGTGTATTCCAGCCACCCTTCCAGCCTGGCCGGATGGCCTTGGAGTCCCAGAGCCCTGGCTGCACCACGCTGCTCTCTACTAGCTCCCTGGAGGCTGGGGACAGTGAGAGGGAGCCTATTCAGCCTCCAGAACTCCAGTTGGTGGCTGAGGGGGACACAGGAGTTCCCCGAGTATGGGTAGCTCCTGATCGGGGGCCTGTGGCTAGCACCAGTGGAATTTCTTCTGAGATGCTGACCAGTGGGACCGTTGAGAATGGCTCCTTGCCTGTTGGTGAGAGGGTGTCCCGGCCTGAAGCTGCTGTGCCTGGGTACCAACACCCAAGTGAAGCCATAAATGCCCACACACCCCAGTTCTTCATCTATAAAATTGACGCATCTAACCGAGAACAGCGGCTAGAGGACAAAGGGGAGACCCCACTGGAGTTGGGTGATGACTGTAGCCTGGCTCTGGTCTGGCGGAACAACGAGCGCCTGCAGGAGTTTGTATTGGTAGCTTCCAAGGAGCTAGAATGTGCTGAGGACCCAGGCTCTGCTGGTGAGGCTGCCCGTGCTGGCCACTTCACCTTGGACCAGTGCCTCAACCTCTTCACACGGCCTGAGGTGCTGGCACCTGAGGAGGCCTGGTACTGCCCACAATGCAAACAGCACCGGGAAGCCTCCAAGCAGCTGCTGCTGTGGCGCCTGCCCAATGTGCTCATTGTGCAGCTCAAGCGGTTCTCTTTCCGAAGTTTCATCTGGCGTGATAAGATCAATGACTTAGTGGAGTTTCCTGTTCGGAACCTGGACCTGAGCAAGTTCTGCATTGGTCAGAAAGAGGAGCAGCTGCCCAGCTATGACCTATATGCTGTCATTAACCATTATGGAGGCATGATTGGTGGCCACTACACAGCCTGTGCACGCTTGCCTAATGATCGCAGCAGCCAGCGCAGTGACGTGGGCTGGCGCTTGTTTGATGACAGCACTGTGACGACAGTAGACGAGAGCCAGGTCGTGACCCGTTATGCCTATGTACTCTTCTACCGCCGACGGAACTCTCCTGTGGAGAGGCCCCCCAGGGCAGGTCATTCTGAGCACCACCCAGACCTAGACCCTGCAGCCGAGGCTGCTGCCAGCCAGGCTTCCCGGATTTGGCAGGAGCTCGAGACCGAGGAAGAGATGGTGCCTGAGGGGCCTGGGCCTGTTGGTCCCTGGGGACCCCAAGACTGGGTGGGCACTCCATCACGTGGCCCTACCACACCAGATGAGGGCTGCCTCCGGTACTTTGTCCTTGGCACTGTGGCCGCTTTGGTGGCCCTAGTGCTCAACGTGTTCTATCCTCTGGTATCTCAGAGTCACTGGAGATGA

XM_004834014.1 Coding sequence

Lamb2 laminin, beta 2 (laminin S), transcript variant X1

High confidence: 4 potential gene matches
Length: 5406 bp    Location: 3158741..3145643   Strand: -
>XM_004834014.1
ATGGAGTGGGCCTCAGAGGACCGAGGGAGGTGCCGGCAGGGACAGCCTGTGCCCTGGGACCTTCGACTGGGCCTGCTTCTAAGTGTGCTGGCCACCACGCTGGCCCAGGCCCCATCTCTGGATATGCCTGGCTGTTCTCGAGGAAGCTGCTACCCAGCCACAGGTGACCTGTTGGTGGGCCGTGCCGACAGACTGACTGCCTCATCCACCTGTGGCCTACGTGGGCCCCAGCCCTACTGCATTGTCAGTCACTTGCAGGATGAGAAGAAGTGCTTCCTGTGTGATTCTCGGCACCCCTTCTCTGCTCCAAACAACCCAAACAGCCATCGTATCCAGAATGTAGTCACCAGCTTTGCACCTCAGCGCCGGACAGCCTGGTGGCAATCAGAGAACGGTGTTCCCATGGTCACCATCCAGCTGGACCTGGAGGCTGAGTTCCATTTCACACACCTTATTATGACCTTCAAGACATTTCGTCCTGCTGCCATGTTGGTGGAGCGCTCAGCAGACTTTGGTCGTACCTGGTATGTGTACCGATATTTCTCCTATGACTGTGGAGCTGACTTCCCAGGAGTCCCACTAGCCCCTCCACGACACTGGGATGATGTAGTCTGTGAGTCTCGCTACTCAGAAATCGAGCCATCCACTGAAGGCGAGGTCATCTATCGTGTGCTAGACCCTGCCATCCCTATCCCAGATCCTTACAGCCCACGGATCCAGAACTTGTTGAAGATAACCAACCTTCGAGTGAACCTAACTCGGCTTCACACACTGGGGGACCACTTGCTCGACCCACGGCGGGAGATCCGAGAGAAATATTATTACGCCCTCTATGAGCTGGTAGTGCGTGGCAATTGCTTCTGCTATGGACATGCCTCACAGTGTGTGCCTGCCCCAGGGGCACCAGCTCATGCTGAGGGCATGGTACATGGGGCCTGCGTCTGCAAACACAACACTCGTGGCCTCAACTGTGAGCAGTGTCAGGATTTCTATCATGATCTTCCCTGGCATCCAGCTGAGGATGGCTACAGTCACGCCTGTAGGAAATGTGAATGCCATGGACACACCCATAGCTGCCACTTTGATATGGCCATATACCTGGCATCTGGCAATGTGAGTGGAGGTGTGTGTGACAGATGTCAGCACAACACAGTTGGACACCACTGTGAACTCTGCCGACCCTTCTTCTACCGTGACCCAACAAAGGACCTGCGGGACCCAGCTGTGTGCCACCCCTGTGACTGTGACCCTATGGGTTCCCAAGATGGTGGTCTCTGTGATTCGCATGATGATGCTGCACTGGGGCTCGTCTCAGGCCAGTGTCGCTGCAAAGAACATGTCATGGGCCCTAGCTGCCAGCGATGTCGTGATGGCTTCTTTGGGCTCAGTGCTAGTGACCCACTAGGCTGCCAGCGTTGTCAATGTAATGCACGGGGCACAGTGTCTGGGGGCACCCCGTGTGATGCCAACAGTGGAATCTGTTTCTGCAAGCGGCTGGTGACTGGACATGGCTGCGACCACTGCCTGCCTGGCCACTGGGGTCTGAGCCATGACCTGCTAGGCTGCCGTCCTTGTGACTGTGATGTGGGTGGTGCCTTGGATGCTCAGTGTGACGAGGCCACCGGTCAGTGCCACTGTCGCCCGCACATGGTTGGGCGACGCTGTGAGAAAGTGCAGCCTGGTTACTTCCGGCCCTTCCTAGACCACCTAACTTGGGAGGCTGAGGATGCCAGAGGGCAGGTGCTTGATGTGGTGGAGCGTCTGGCAGCTACCGGGGAGGCTCCCTCCTGGACTGGCCCAGGCTTTGTGCAGCTGCGGGAAGGTCAGACACTGGAATTCCTGGTGATCTCTTTGCCAAAAGCAATGGACTATGACTTGCTGCTTCGCTTGGAGCCTCAGGTCCCTGAACAGTGGGCAGAGATAGAACTGACTGTGCAGCGACCCAGTTCTGTGGCTGCCCACACCCCGTGTGGGCATGTGGTGCCCAATGATGACCGCATCCAAGGGACTCTGCAAGCAGACATTAGGTACATGGTGCTTCCCAAACCTGTCTGCCTTGAGCCTGGCATCTCCTACAGGCTGCACCTGAAGCTGGTTCGAACAGGGGGACGTGCCCAGCCTCAGGTCCCCTACTCTGGACCTGGCCTGCTCATTGATTCGTTGGTGCTGTTGCCCCGTGTACTGGCACTAGAGATGTTTAGTGCTGGTGATGTCACTTCCCTGGAGCGCCGTGCCACCTTTGAACACTATCGTTGCCATGAGGAAGGTCTGATGCCCAGCAAGACCCCTCCCACTGAGGCCTGTGACCCTCTTCTCATCAGCCTGTCCACCCTGATCTACAATGGTGCCCTGCCCTGTCAGTGTGACCCTGAAGGTTCTCTGAGTTCTGAGTGCAACCCTCATGGTGGCCAGTGCCTGTGCAAACCTGGAGTGGTTGGGCGCCGCTGTAACATTTGTGCCATTGGTTACTACGGTTTTGGCCCCACAGGCTGTCAAGCCTGCCAGTGTAGCTCTGAGGGAGCACTCAGTGGCCTATGTGAAGGGACTACTGGGCAGTGTCCCTGCCGACCTGGTGCCTTTGGGCTTCGCTGTGACCGCTGCCAACATGGCCAGTGGGGATTCCCTAATTGCTGGCCATGTGTCTGCAATGGGCATGCAGATGAATGTGACGCCCACACAGGCACTTGCCTGAGCTGCCGTGATCACACAGGCGGAGAACACTGTGAAAGGTGCATTGCTGGCTTCCATGGGGACCCACGGCTACCATATGGGGGCCAGTGTCGGCCCTGCCCCTGCCCCGAAGGCCCTGGGAGCCAGCGGAATTTTGCTGCTTCTTGCCATCGAGATGGGTACTCCCAGCAGATTGTGTGCCACTGCCAGTTAGGCTACACAGGGTTGCGGTGTGACACTTGTGCCCCTGGGCACTTTGGAGACCCATCAAGGCCAGGTGGCAGGTGCCAACCATGTGAGTGCAGTGGGAACATAGACCCCACGGACCCTGATGCCTGTAACTCCCATACGGGGCAGTGCATACGCTGTTTACACCACACAGAAGGGCCACACTGTGCACATTGCAAGCCTGGCTTCCATGGACAGGCTGCCCGACAGAGCTGTCACCGCTGTACCTGCAACCTTCTGGGCACAAATCCCCAGCAATGTCCATCTACTGACCAGTGCCGCTGTGATCCAAGCAGTGGGCAGTGCCCATGCCTCCCCAATGTTCAAGGGCTTAGCTGTGATCACTGTGCCCCCAACTTTTGGAATCTTACCAGTGGTCATGGGTGCCAGCCTTGTGCCTGCCACCTAACCCGGGCCAGAAGCCCCACTTGCAATGAGTTCACAGGGGAATGCCACTGCCATGCTGGCTTCGGTGGACGGACTTGTTCTGAGTGCCAAGAACTCCACTGGGGAGACCCTGGGTTACAGTGTCGTGCCTGTGATTGTGACCCTCGCGGGGTAGACACACCTCAGTGTCACCATTCCACTGGCCACTGTAGATGCCGCCCAGGCGTGTCTGGTGTGCGCTGTGACCAGTGTGCCCGGGGCTTCTCAGGTGTCTTTCCTGCCTGCCACTCCTGCCATGCATGCTTTGGGGATTGGGACCGCATCGTGCAGGACTTGGCTGCTCGTACACGACGCCTGGAGCAATGGGCCCACGAGCTGCAGCAGACAGGAGTGCTAGGTTCCTTTGAGAGCAGTTTCTGGCACATTCAGGAGAAGCTGGGCAAGGTGCAGGCCATTGTGGGTGCTCGCAACACCTCAGCTGCCTCCACTGCACAGCTTGTGGAAGCCATAGAGGATTTGCGGCGTGAAATTGGGCAGGCCACTGAGCGGTTGACTCAGCTGGAGGCAGAGCTGACTGATGTGCAAGATGAAAACTTCAATGCCAACCACGCACTCAGCAGTCTTGAACGAGATGGGCTTGCACTTAATCTCACACTGCGGCAGCTTGGCCAGCACCTGGACTTGCTCAAGCATTCAAATTTCCTGGGTGCCTATGATAGCATACGCCATGCCCACAGCCAGTCTGCAGAGGCAGAACGTCATGCCAACACCTCAGTCCTATCAATACCCAGCCCTGTGAGCAACTCAGCAGATACCCGGCATCGGACAGAAGTGCTGATAGATGCCCAGATGGAAGACTTTAGGCAAATGCACTTGGCTAACCAGTGGGCACTTAGTGAGCTCTCTGTCCATACTCGTACCCTGAGCCTGACAGGCATAAATGAACTGGTGTGTGGGGCACCAGGGGATGAACCCTGTGCTACCAGCCCTTGTGGAGGTGCCGGCTGTCGGGATGAGGATGGGCAGCCCCGCTGTGGGGGCCTCAGCTGCAGTGGGGCAGCAGCCACAGCAGACCTAGCACTGACCCGGGCCCGGCACACACAGGCAGAGCTGCAGCGGACACTGGTAGAAGGTGGTGGCATCCTCAGTCGAGTGGCTGAGACTCGTCGCCAGGCAGGCGAGGCACAGCAGTGGGCCCAGGCAACCCTGGAAAAGGCTAATGCTTCCAGGGGACAGGTGGAGCAGGCCAACCAGGAGCTTCGAGAACTTATCCAGAGTGTGAAAGACTTCCTCAGCCAGGAGGGGGCGGATCCGGATAGCATTGAGATGGTGGCCATGCGGGTGCTAGAGCTCTCCATCCCAGCCTCACCTGAGCAGATCCAGCACCTGGCAGGTGAAATTGCAAAGCGGGTCCGGAGCCTAGCGGATGTGGACACAATCCTGGCACGTACCATAGGGGACGTACTTCGGGCTGAGCAGCTACTGCAGGATGCACAGCGGGCACGGAGCTGGGCTGAGGGTGAGAAACAGAAGGCAGAGACAGTACAGGAAGCACTAGAAGAGGCCCTGCGGGCACAAGGTATTGCCCAGGGTGCCATCCAGGGAGCAGTGGTTGATACACACAACACAGAGCAGACAATGCACCAGGTACAGGAGAGGATGACAGGTGCAGAGCAGTCATTGAGCTCTGTAGGTGAGCGGGCTCAGCAATTGGATGCTCTCCTGGAGGCTCTGAAACTGAAACGGGCAGGAAATAGCCTGGCAGTCTCTACAGCTGAAGAAACAGCAGGCATTGCCCACACTCGTGCCCAGGAGGCTGAGCAGCTGCTGCAGGGGCCAGTGGGTGATCAATACCAAACGGTGAAGGCCCTGGCAGAACGTAAAGCCCAGGGTGTGCTGGCTGCACAGGTGAGGGCAGAACAACTGCGGGATGAGGCTCGGGGCCTGTTGCAAGCGGCTCAGGACAAGCTGCAGCGACTACAGGAACTGGAGGGGACCTACGAAGAGAATGAGCGCGCCCTGGAAGGCAAGGCGGCTCAGCTGGACGGGCTGGAGGCCAGGATGCGCAGTGTGCTTCAAGCCATCAACCTGCAAGTTCAAATCTACAACACCTGCCAGTGA

XM_004834016.1 Coding sequence

Lamb2 laminin, beta 2 (laminin S), transcript variant X3

Length: 4740 bp    Location: 3158741..3146619   Strand: -
>XM_004834016.1
ATGGAGTGGGCCTCAGAGGACCGAGGGAGGTGCCGGCAGGGACAGCCTGTGCCCTGGGACCTTCGACTGGGCCTGCTTCTAAGTGTGCTGGCCACCACGCTGGCCCAGGCCCCATCTCTGGATATGCCTGGCTGTTCTCGAGGAAGCTGCTACCCAGCCACAGGTGACCTGTTGGTGGGCCGTGCCGACAGACTGACTGCCTCATCCACCTGTGGCCTACGTGGGCCCCAGCCCTACTGCATTGTCAGTCACTTGCAGGATGAGAAGAAGTGCTTCCTGTGTGATTCTCGGCACCCCTTCTCTGCTCCAAACAACCCAAACAGCCATCGTATCCAGAATGTAGTCACCAGCTTTGCACCTCAGCGCCGGACAGCCTGGTGGCAATCAGAGAACGGTGTTCCCATGGTCACCATCCAGCTGGACCTGGAGGCTGAGTTCCATTTCACACACCTTATTATGACCTTCAAGACATTTCGTCCTGCTGCCATGTTGGTGGAGCGCTCAGCAGACTTTGGTCGTACCTGGTATGTGTACCGATATTTCTCCTATGACTGTGGAGCTGACTTCCCAGGAGTCCCACTAGCCCCTCCACGACACTGGGATGATGTAGTCTGTGAGTCTCGCTACTCAGAAATCGAGCCATCCACTGAAGGCGAGGTCATCTATCGTGTGCTAGACCCTGCCATCCCTATCCCAGATCCTTACAGCCCACGGATCCAGAACTTGTTGAAGATAACCAACCTTCGAGTGAACCTAACTCGGCTTCACACACTGGGGGACCACTTGCTCGACCCACGGCGGGAGATCCGAGAGAAATATTATTACGCCCTCTATGAGCTGGTAGTGCGTGGCAATTGCTTCTGCTATGGACATGCCTCACAGTGTGTGCCTGCCCCAGGGGCACCAGCTCATGCTGAGGGCATGGTACATGGGGCCTGCGTCTGCAAACACAACACTCGTGGCCTCAACTGTGAGCAGTGTCAGGATTTCTATCATGATCTTCCCTGGCATCCAGCTGAGGATGGCTACAGTCACGCCTGTAGGAAATGTGAATGCCATGGACACACCCATAGCTGCCACTTTGATATGGCCATATACCTGGCATCTGGCAATGTGAGTGGAGGTGTGTGTGACAGATGTCAGCACAACACAGTTGGACACCACTGTGAACTCTGCCGACCCTTCTTCTACCGTGACCCAACAAAGGACCTGCGGGACCCAGCTGTGTGCCACCCCTGTGACTGTGACCCTATGGGTTCCCAAGATGGTGGTCTCTGTGATTCGCATGATGATGCTGCACTGGGGCTCGTCTCAGGCCAGTGTCGCTGCAAAGAACATGTCATGGGCCCTAGCTGCCAGCGATGTCGTGATGGCTTCTTTGGGCTCAGTGCTAGTGACCCACTAGGCTGCCAGCGTTGTCAATGTAATGCACGGGGCACAGTGTCTGGGGGCACCCCGTGTGATGCCAACAGTGGAATCTGTTTCTGCAAGCGGCTGGTGACTGGACATGGCTGCGACCACTGCCTGCCTGGCCACTGGGGTCTGAGCCATGACCTGCTAGGCTGCCGTCCTTGTGACTGTGATGTGGGTGGTGCCTTGGATGCTCAGTGTGACGAGGCCACCGGTCAGTGCCACTGTCGCCCGCACATGGTTGGGCGACGCTGTGAGAAAGTGCAGCCTGGTTACTTCCGGCCCTTCCTAGACCACCTAACTTGGGAGGCTGAGGATGCCAGAGGGCAGGTGCTTGATGTGGTGGAGCGTCTGGCAGCTACCGGGGAGGCTCCCTCCTGGACTGGCCCAGGCTTTGTGCAGCTGCGGGAAGGTCAGACACTGGAATTCCTGGTGATCTCTTTGCCAAAAGCAATGGACTATGACTTGCTGCTTCGCTTGGAGCCTCAGGTCCCTGAACAGTGGGCAGAGATAGAACTGACTGTGCAGCGACCCAGTTCTGTGGCTGCCCACACCCCGTGTGGGCATGTGGTGCCCAATGATGACCGCATCCAAGGGACTCTGCAAGCAGACATTAGGTACATGGTGCTTCCCAAACCTGTCTGCCTTGAGCCTGGCATCTCCTACAGGCTGCACCTGAAGCTGGTTCGAACAGGGGGACGTGCCCAGCCTCAGGTCCCCTACTCTGGACCTGGCCTGCTCATTGATTCGTTGGTGCTGTTGCCCCGTGTACTGGCACTAGAGATGTTTAGTGCTGGTGATGTCACTTCCCTGGAGCGCCGTGCCACCTTTGAACACTATCGTTGCCATGAGGAAGGTCTGATGCCCAGCAAGACCCCTCCCACTGAGGCCTGTGACCCTCTTCTCATCAGCCTGTCCACCCTGATCTACAATGGTGCCCTGCCCTGTCAGTGTGACCCTGAAGGTTCTCTGAGTTCTGAGTGCAACCCTCATGGTGGCCAGTGCCTGTGCAAACCTGGAGTGGTTGGGCGCCGCTGTAACATTTGTGCCATTGGTTACTACGGTTTTGGCCCCACAGGCTGTCAAGCCTGCCAGTGTAGCTCTGAGGGAGCACTCAGTGGCCTATGTGAAGGGACTACTGGGCAGTGTCCCTGCCGACCTGGTGCCTTTGGGCTTCGCTGTGACCGCTGCCAACATGGCCAGTGGGGATTCCCTAATTGCTGGCCATGTGTCTGCAATGGGCATGCAGATGAATGTGACGCCCACACAGGCACTTGCCTGAGCTGCCGTGATCACACAGGCGGAGAACACTGTGAAAGGTGCATTGCTGGCTTCCATGGGGACCCACGGCTACCATATGGGGGCCAGTGTCGGCCCTGCCCCTGCCCCGAAGGCCCTGGGAGCCAGCGGAATTTTGCTGCTTCTTGCCATCGAGATGGGTACTCCCAGCAGATTGTGTGCCACTGCCAGTTAGGCTACACAGGGTTGCGGTGTGACACTTGTGCCCCTGGGCACTTTGGAGACCCATCAAGGCCAGGTGGCAGGTGCCAACCATGTGAGTGCAGTGGGAACATAGACCCCACGGACCCTGATGCCTGTAACTCCCATACGGGGCAGTGCATACGCTGTTTACACCACACAGAAGGGCCACACTGTGCACATTGCAAGCCTGGCTTCCATGGACAGGCTGCCCGACAGAGCTGTCACCGCTGTACCTGCAACCTTCTGGGCACAAATCCCCAGCAATGTCCATCTACTGACCAGTGCCGCTGTGATCCAAGCAGTGGGCAGTGCCCATGCCTCCCCAATGTTCAAGGGCTTAGCTGTGATCACTGTGCCCCCAACTTTTGGAATCTTACCAGTGGTCATGGGTGCCAGCCTTGTGCCTGCCACCTAACCCGGGCCAGAAGCCCCACTTGCAATGAGTTCACAGGGGAATGCCACTGCCATGCTGGCTTCGGTGGACGGACTTGTTCTGAGTGCCAAGAACTCCACTGGGGAGACCCTGGGTTACAGTGTCGTGCCTGTGATTGTGACCCTCGCGGGGTAGACACACCTCAGTGTCACCATTCCACTGGCCACTGTAGATGCCGCCCAGGCGTGTCTGGTGTGCGCTGTGACCAGTGTGCCCGGGGCTTCTCAGGTGTCTTTCCTGCCTGCCACTCCTGCCATGCATGCTTTGGGGATTGGGACCGCATCGTGCAGGACTTGGCTGCTCGTACACGACGCCTGGAGCAATGGGCCCACGAGCTGCAGCAGACAGGAGTGCTAGGTTCCTTTGAGAGCAGTTTCTGGCACATTCAGGAGAAGCTGGGCAAGGTGCAGGCCATTGTGGGTGCTCGCAACACCTCAGCTGCCTCCACTGCACAGCTTGTGGAAGCCATAGAGGATTTGCGGCGTGAAATTGGGCAGGCCACTGAGCGGTTGACTCAGCTGGAGGCAGAGCTGACTGATGTGCAAGATGAAAACTTCAATGCCAACCACGCACTCAGCAGTCTTGAACGAGATGGGCTTGCACTTAATCTCACACTGCGGCAGCTTGGCCAGCACCTGGACTTGCTCAAGCATTCAAATTTCCTGGGTGCCTATGATAGCATACGCCATGCCCACAGCCAGTCTGCAGAGGCAGAACGTCATGCCAACACCTCAGTCCTATCAATACCCAGCCCTGTGAGCAACTCAGCAGATACCCGGCATCGGACAGAAGTGCTGATAGATGCCCAGATGGAAGACTTTAGGCAAATGCACTTGGCTAACCAGTGGGCACTTAGTGAGCTCTCTGTCCATACTCGTACCCTGAGCCTGACAGGCATAAATGAACTGGTGTGTGGGGCACCAGGGGATGAACCCTGTGCTACCAGCCCTTGTGGAGGTGCCGGCTGTCGGGATGAGGATGGGCAGCCCCGCTGTGGGGGCCTCAGCTGCAGTGGGGCAGCAGCCACAGCAGACCTAGCACTGACCCGGGCCCGGCACACACAGGCAGAGCTGCAGCGGACACTGGTAGAAGGTGGTGGCATCCTCAGTCGAGTGGCTGAGACTCGTCGCCAGGCAGGCGAGGCACAGCAGTGGGCCCAGGCAACCCTGGAAAAGGCTAATGCTTCCAGGGGACAGGTGGAGCAGGCCAACCAGGAGCTTCGAGAACTTATCCAGAGTGTGAAAGACTTCCTCAGCCAGGAGGGGGCGGATCCGGATAGCATTGAGATGGTGGCCATGCGGGTGCTAGAGCTCTCCATCCCAGCCTCACCTGAGCAGATCCAGCACCTGGCAGGTGAAATTGCAAAGCGGGTCCGGAGCCTAGCGGATGTGGACACAATCCTGGAGCTGGGCTGA

XM_004834017.1 Coding sequence

Ccdc71 coiled-coil domain containing 71

High confidence: 1 potential gene match
Length: 1386 bp    Location: 3179237..3174876   Strand: -
>XM_004834017.1
ATGAGCGTGGTGGTGCAGCATGTGGAGGAGAAAGCTGTGCACTCCTGGTCGCGCATCTCCACAGCAGGGAAGAAGGCCCTGGAAGAGGCGCTGCTTGTCTTTAACCCCATGAGCCAGGATCTCAGTGCCACGGAGGCCCAACTTGTGGCTTTCCTACAGGGCCTGCGAGATGATGGTTTCCAACCTACCATTCTACGTAGCCGTGATGTCTATGGCTATAGTTCATGCACAGCCAATCCCCCAAGTCAGACGAAGCTACAGGCCTGTGCCCCCAACCCAGCTGCCACATCACCTCCAGCCAGTGCTCCCCAAACTGCTGTGCACCTGCCCACAGGCCGGGCTACTCTGCTACCCATGTCATTGTCTGGCAGGCTGGCCAAAGGGTCTACACCAGCCTTCACCAAGCATACTACTACCAATCTGCTGCTGAGCTCCCTGAAGCAGTCAAGTGCCAGCCGAACAAGGGGTGCAACAGTGGGCTTCCCCACCCACCTATATCCAGGTGTCTGCCCTGCCATGCGGCTTTCTGTTGTCCTTGAGGCCCTGGTTCCACTCAAGAATCCCATGCCCTGCTTGAGTGCTAAGCACCAGGCACAGTCACTGCAGCTGTCACTTGCAGACTCTCCTTTGAAACTGCGGAAAGGTTCAGGGAAGAGTCTAGAGAGCCCCCGGCCCAAAGCTCCTAGAAAAACCACAAGCAAGGGCCCCATGTGTCTGACTCACAAAGGTTCTAGAGCTGGACCTCAGCAAGGCACTGGGCCCCAGAAAAAGACCTATAGAGCCACTGGCTCTTTTTGTGGTCTGCAAATGAAAGAGGGTACCACCCTGGGCACCAAAATAGCCCAAGTCAAGACATCTCGAACACTGGCCAAAGTTGCCCGTGCCCACGCCAGTGTGGCTCGAACACAGGCCAAGGCCAAGGCGGCACGGGCCAAGGCTAAGGCCAAGGCAGCAAATGCTAAAGCTAAAGCCAAGGCAGCAAAGGCCAAGGCTAAAGCCAAGGCAGCAAAGGCTAAGGCTAAAGCCAAGGCAGCCCGGGCCAAGGTGGCTCAGACCCAGCCAAGGAACAGGGGCAGGCCAAAGGGATCTGTTCAGCCTAGGATTTCAAGAAAGGTCCAGAAAAGCCACTCTATGACTCTGGGGCAGAAGAGGAAAAGAGCTGAGGAAGCAAAGGACCTCCTCCCAAAGAAGAAAAAACGGCTTGGGTCCCAATCTCCTAAATCCTGGCTAGGGTCAGGAACAGCAAAGCTGGTAAAGTTCCGAGCCATAAAGGTGAACAGGCAGTCCTCAGATGATGAGGTTCGACAGCGAGCCCAGCAGATCCTCCGTGTGAACCTGTCTCCTATAATACGGCTCCAGCCATTGATGCCATATTCAACATCCTGA

XM_004834019.1 Coding sequence

Klhdc8b kelch domain containing 8B, transcript variant X2

Length: 1065 bp    Location: 3182912..3187714   Strand: +
>XM_004834019.1
ATGGCTACAGGAGGTGGCCGGACCTTTTCTTGGCAGGTGTTCCCCCCCATGCCCACTTGCCGGGTATATGCCACAGTGGCACACCAGGATGGGCACCTGCTAGTGTTGGGGGGCTGTGGCCGGGCTGGGCTACCCCTGGACACTGCTGAGACACTAGATATGGCCTCACACACATGGCTAGCACTGGCGCCCCTGCCCACTGCCCGGGCTGGTGCCGCTGCTGTGGTTCTGGGCAAGCAGGTGCTAGTGGTAGGTGGTGTGGATGAGGCCCAGAGCCCAGTAGCTGCTGTGGAGGCCTTCTTGGCTGATGAAGGCCGCTGGGAGCGTCGGGCCACCCTCCCTCAAGCAGCCATGGGGGTTGCAACTGTGGAGAGAGATGGTATGGTGTATGCTTTGGGAGGAATGGGCCCTGACACGGCCCCCCAGGCTCAAGTACGGGTGTATGAGCCTCGCCGGGATTGCTGGCTTTCACTACCCTCCATGCCCACACCCTGCTATGGGGCCTCCACCTTCTTGCATGGGAACAAGATCTATATTCTGGGGGGCCGCCAGGGCAAGCTCCCAGTGACTGCTTTTGAAGCTTTTGATCTGGAGGCCTGTACCTGGACCCGGCACCCAAGCCTACCCAGCCGCAGGGCCTTTGCTGGCTGTGCTATGGCCGAAGGCAGCGTCTTTAGCTTGGGAGGCCTGCAGCAACCTGGGCCCCACAATTTCTACTCCCGCCCACATTTTGTCAACACTGTGGAGATGTTTGACCTGGAGCATGGGTCCTGGACCAAGCTACCCCGTAGCCTACGCATGAGGGATAAGAGGGCTGACTTTGTGGTTGGCTCCCTTGGTGGCCACATCCTGGCCATTGGGGGCCTTGGAAACCAGCCATGCCCTCTGGGCTCTGTGGAGAGCTTCAGTCTTGCACAGCGGCGCTGGGAGGCACTGCCCACCATGCCCACAGCCCGCTGCTCCTGCTCTAGTCTACAGGCTGGACCCCGGCTATTTGTTATCGGGGGTGTGGCCCAGGGCCCCAGTCAAGCTGTGGAGGCACTATGTCTGCGTGATGGAGTCTGA

XM_004834018.1 Coding sequence

Klhdc8b kelch domain containing 8B, transcript variant X1

Length: 1065 bp    Location: 3182912..3187714   Strand: +
>XM_004834018.1
ATGGCTACAGGAGGTGGCCGGACCTTTTCTTGGCAGGTGTTCCCCCCCATGCCCACTTGCCGGGTATATGCCACAGTGGCACACCAGGATGGGCACCTGCTAGTGTTGGGGGGCTGTGGCCGGGCTGGGCTACCCCTGGACACTGCTGAGACACTAGATATGGCCTCACACACATGGCTAGCACTGGCGCCCCTGCCCACTGCCCGGGCTGGTGCCGCTGCTGTGGTTCTGGGCAAGCAGGTGCTAGTGGTAGGTGGTGTGGATGAGGCCCAGAGCCCAGTAGCTGCTGTGGAGGCCTTCTTGGCTGATGAAGGCCGCTGGGAGCGTCGGGCCACCCTCCCTCAAGCAGCCATGGGGGTTGCAACTGTGGAGAGAGATGGTATGGTGTATGCTTTGGGAGGAATGGGCCCTGACACGGCCCCCCAGGCTCAAGTACGGGTGTATGAGCCTCGCCGGGATTGCTGGCTTTCACTACCCTCCATGCCCACACCCTGCTATGGGGCCTCCACCTTCTTGCATGGGAACAAGATCTATATTCTGGGGGGCCGCCAGGGCAAGCTCCCAGTGACTGCTTTTGAAGCTTTTGATCTGGAGGCCTGTACCTGGACCCGGCACCCAAGCCTACCCAGCCGCAGGGCCTTTGCTGGCTGTGCTATGGCCGAAGGCAGCGTCTTTAGCTTGGGAGGCCTGCAGCAACCTGGGCCCCACAATTTCTACTCCCGCCCACATTTTGTCAACACTGTGGAGATGTTTGACCTGGAGCATGGGTCCTGGACCAAGCTACCCCGTAGCCTACGCATGAGGGATAAGAGGGCTGACTTTGTGGTTGGCTCCCTTGGTGGCCACATCCTGGCCATTGGGGGCCTTGGAAACCAGCCATGCCCTCTGGGCTCTGTGGAGAGCTTCAGTCTTGCACAGCGGCGCTGGGAGGCACTGCCCACCATGCCCACAGCCCGCTGCTCCTGCTCTAGTCTACAGGCTGGACCCCGGCTATTTGTTATCGGGGGTGTGGCCCAGGGCCCCAGTCAAGCTGTGGAGGCACTATGTCTGCGTGATGGAGTCTGA

XM_004834020.1 Coding sequence

Klhdc8b kelch domain containing 8B, transcript variant X3

High confidence: 4 potential gene matches
Length: 1065 bp    Location: 3183435..3187714   Strand: +
>XM_004834020.1
ATGGCTACAGGAGGTGGCCGGACCTTTTCTTGGCAGGTGTTCCCCCCCATGCCCACTTGCCGGGTATATGCCACAGTGGCACACCAGGATGGGCACCTGCTAGTGTTGGGGGGCTGTGGCCGGGCTGGGCTACCCCTGGACACTGCTGAGACACTAGATATGGCCTCACACACATGGCTAGCACTGGCGCCCCTGCCCACTGCCCGGGCTGGTGCCGCTGCTGTGGTTCTGGGCAAGCAGGTGCTAGTGGTAGGTGGTGTGGATGAGGCCCAGAGCCCAGTAGCTGCTGTGGAGGCCTTCTTGGCTGATGAAGGCCGCTGGGAGCGTCGGGCCACCCTCCCTCAAGCAGCCATGGGGGTTGCAACTGTGGAGAGAGATGGTATGGTGTATGCTTTGGGAGGAATGGGCCCTGACACGGCCCCCCAGGCTCAAGTACGGGTGTATGAGCCTCGCCGGGATTGCTGGCTTTCACTACCCTCCATGCCCACACCCTGCTATGGGGCCTCCACCTTCTTGCATGGGAACAAGATCTATATTCTGGGGGGCCGCCAGGGCAAGCTCCCAGTGACTGCTTTTGAAGCTTTTGATCTGGAGGCCTGTACCTGGACCCGGCACCCAAGCCTACCCAGCCGCAGGGCCTTTGCTGGCTGTGCTATGGCCGAAGGCAGCGTCTTTAGCTTGGGAGGCCTGCAGCAACCTGGGCCCCACAATTTCTACTCCCGCCCACATTTTGTCAACACTGTGGAGATGTTTGACCTGGAGCATGGGTCCTGGACCAAGCTACCCCGTAGCCTACGCATGAGGGATAAGAGGGCTGACTTTGTGGTTGGCTCCCTTGGTGGCCACATCCTGGCCATTGGGGGCCTTGGAAACCAGCCATGCCCTCTGGGCTCTGTGGAGAGCTTCAGTCTTGCACAGCGGCGCTGGGAGGCACTGCCCACCATGCCCACAGCCCGCTGCTCCTGCTCTAGTCTACAGGCTGGACCCCGGCTATTTGTTATCGGGGGTGTGGCCCAGGGCCCCAGTCAAGCTGTGGAGGCACTATGTCTGCGTGATGGAGTCTGA

XM_004834024.1 Coding sequence

Ccdc36 coiled-coil domain containing 36, transcript variant X3

Length: 837 bp    Location: 3208925..3249466   Strand: +
>XM_004834024.1
ATGCTTGGTCTCCGCGGGACCAGGAGGGAATCCTCGAAGGCGGGACCCGGTGGCTCTAGGTTTGCATGGGAGGACCACCGGAGGACCACTAAGTCATCTCACTGGAATAATAATCAGACTGATTATTCTGCTCTCAGTGATTCCCAGTTCCTCTTTGGATCTCAGTTTTGTCCAGAAAATTCAGAAACCCTGTCAGCACCCTTAGACCTAGGTGCTCACTTGAGACATTCAAAACAGTTACAACAGAATTCTGTGGATAGTGAACCTAGTATTTTCACAAAGTACCAGACAAAACCCCAACTCTTTGGAGGAGAGACAAAGGACAGGGGCTTATTTTCTCTTCCTTTACCAGTTGGAAAATCAAAATGCCTCTTGAAACAGTTTGAGGAGAAAAATAAAACTGCAAAAGACAAATGTGACAGTGAGAGTCTATACAACTTCCTTTCCCAGGTCAGAGAAAACATTCAGAGGTTGCAGACATCTGTGGACAAGTCTGAGGAGCACCTCACTTCAAGAAGCCAATCTATTTTGGATTCTTTGGAAACTGTAGCTAAGACATTGCAAGAGACTGCACGGGTCCAGAGCGACCTGAGGTTTGAGGCAATACAAGAAAAAGGCAATGCAGAGCAGGCCATCCTTGAGATGCAGAAGAAATTTGAAGCTAGACAAACAGAGTTTATAGAAATGAAGTCCAGCCTGAAGCACCTTGAGGTTTTAGTTGCCCAGCAGAATAAGGACTTCCAGCAGCTATGTGAGCATCTAGGCCAGCTGCACATGCCTGATGTCCTCGAAGAGCTAAAGAGATTGATCTCGGCACCTCAGCTCCCTGCAAACTAA

XM_004834022.1 Coding sequence

Ccdc36 coiled-coil domain containing 36, transcript variant X1

Length: 1821 bp    Location: 3208925..3239771   Strand: +
>XM_004834022.1
ATGCTTGGTCTCCGCGGGACCAGGAGGGAATCCTCGAAGGCGGGACCCGGTGGCTCTAGGTTTGCATGGGAGGACCACCGGAGGACCACTAAGTCATCTCACTGGAATAATAATCAGACTGATTATTCTGCTCTCAGTGATTCCCAGTTCCTCTTTGGATCTCAGTTTTGTCCAGAAAATTCAGAAACCCTGTCAGCACCCTTAGACCTAGGTGCTCACTTGAGACATTCAAAACAGTTACAACAGAATTCTGTGGATAGTGAACCTAGTATTTTCACAAAGTACCAGACAAAACCCCAACTCTTTGGAGGAGAGACAAAGGACAGGGGCTTATTTTCTCTTCCTTTACCAGTTGGAAAATCAAAATGCCTCTTGAAACAGTTTGAGGAGAAAAATAAAACTGCAAAAGACAAATGTGACAGTGAGAGTCTATACAACTTCCTTTCCCAGGTCAGAGAAAACATTCAGAGGTTGCAGACATCTGTGGACAAGTCTGAGGAGCACCTCACTTCAAGAAGCCAATCTATTTTGGATTCTTTGGAAACTGTAGCTAAGACATTGCAAGAGACTGCACGGGTCCAGAGCGACCTGAGGTTTGAGGCAATACAAGAAAAAGGCAATGCAGAGCAGGCCATCCTTGAGATGCAGAAGAAATTTGAAGCTAGACAAACAGAGTTTATAGAAATGAAGTCCAGCCTGAAGCACCTTGAGGTTTTAGTTGCCCAGCAGAATAAGGACTTCCAGCAGCTATGTGAGCATCTAGGCCAGCTGCACATGCCTGATGTCCTCGAAGAGCTAAAGAGATTGATCTCGGCACCTCAGGTACCTAGGCACGTGAAAGACAGTGCTTCTCAGACCTCACCATCTCTAGCCCAGAGCCTCAGTTTCATCAAGCAGAGTAAACTCACCTGTGAGGAGCCAGTTGCATGGCAGATCCAGGCCGCCCCTGCTGCAGGGAACTGCAGTGCAGGCTTCCTGAGGCCTGGGGAGTTTGGTGTCTGGGGTAAGCAAGCAAAGAGTGATTCTCTCCAAGAAAAGGCTGCACTGCCAGCAGTTGAGCCTTGTAAAGGAAATGAGCAAGTTAAGGACAAGGAAATGCAGACCAACTGCCAGGATTTAGCTGTCACTAAAACAAGTCCTAAGAACCATGGCTCCAGCATCCCAGACCACAAGGCATGTGCTGATAGAGACCTTGTTTCCCAAGGAGGCTCACAGCTTATATCCCTGGACTTAAACGACGTTACAAACAGCATTCAGAATGTCTGCCCAGAATATCAGGCCCAAAGTATATTTTTTTGTGACCCATGTCAACAGTTGGTGACTGAACAGAAAGGCAAGACTGTAGAAAGAGGGAGGAAAAGCAAGAAGCAGCAGCCCAGGAAGGCCCACAGGGGCAGGGTCCCTGCTAGGAAGCGAGAACAAACCCCGAGCAAGACCCGTGCTTTTAACCCCAAATACCAGAGTACCCTGTCTCCAGTTTCTGGCCCAGGAAGACCCCCCACAGGGCAGCAAGAGCTCCTTGCTCAGGCCCTGTGTTTGCAGGGTCCCAGAAGCTCCCCAAAATCAGTCTGTCCTGCTCTAGGAAGAAGAGTCAAGCCCAGCAAGACTGCAAGGGCAGTGAGAGGGGGTGCCTTACAATTCACCACGTGTTCTTCCAAAGGAAACAGGCTCCTCCCAAAGGAAAGCAGTTTCCAGAGGGACCACCAGATGAGCTGGTTCAGCGACCTCAACCTGGAAAATTCAGAGCCTGCCCAGTGTAAGGAGGCAGGGAAGAATTTACTGTATCACCTGGGTTTTGATAGCAGCGATGATGACTTTTGA

XM_004834027.1 Coding sequence

Gpx1 glutathione peroxidase 1

Length: 588 bp    Location: 3314859..3313773   Strand: -
>XM_004834027.1
ATGTGTGCTGGTCGTTTGGCCGCGGCCGCTCAGGCCACTGTGTACTCCTTCTCCGCACGCCCGCTGACCGGCGGAGAGCCGCTCAGTCTCGGCTCCCTGCGGGGCAAAGTGCTGCTCATCGAGAATGTGGCATCCCTCTGAGGCACCACGGTCCGGGACTTCACCCAGATGAACCAGCTGCAGGCGCGCTTCGGGCCCAGAGGCCTGGTAGTGCTCGGCTTCCCGTGCAACCAGTTTGGACACCAGGAAAACGCAAAGAACGAAGAGATTTTGCATTTGCTCAAATACGTCCGACCCGGTGGTGGGTTCGAGCCCAACTTCACTCTCTTCGAGAAGTGCGAGGTGAATGGTGCGAAGGCACATCCGCTCTTCACCTTCCTTCGAGAGGCCCTGCCGGCGCCCAGTGACGAACCCACTGCGCTCATGACCGACCCCAAGTTCATCATCTGGTCCCCGGTATGCCGCAATGACGTGGCCTGGAATTTTGAGAAGTTCCTGGTAGGCCCCGATGGTGTGCCGGTGCGCAGGTACAGTCGCCGCTTTCCTACCATCGACATTGAGCCTGACATCAAAGCCCTACTCACTTAG

XM_004835140.1 Coding sequence

LOC101710109 transforming protein RhoA-like

Length: 546 bp    Location: 3324741..3316117   Strand: -
>XM_004835140.1
ATGTATTCATTAGGAGAGTCATGCTGGATTGTGGTTTTTAGCAAGGACCAGTTCCCAGAAGTATATGTGCCCACAGTGTTTGAGAACTATGTGGCAGATATTGAAGTGGATGGAAAGCAGGTAGAGTTGGCTTTATGGGACACAGCTGGACAGGAAGATTATGATCGCCTGAGGCCTCTCTCCTACCCAGACACGGATGTTATACTGATGTGTTTCTCCATTGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAATGGACCCCAGAAGTAAAGCATTTCTGTCCCAATGTACCCATTATCCTGGTTGGAAACAAGAAGGATCTTCGGAACGATGAGCACACAAGACGGGAGTTAGCCAAGATGAAGCAGGAGCCAGTAAAACCTGAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCCTTTGGGTACATGGAATGTTCAGCGAAGACCAAAGATGGAGTGAGGGAGGTTTTTGAAATGGCCACAAGAGCTGCTCTGCAAGCCAGGCGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGA

XM_004834030.1 Coding sequence

Amt aminomethyltransferase, transcript variant X2

Length: 1212 bp    Location: 3371434..3366023   Strand: -
>XM_004834030.1
ATGCAGCGACCTGCGAGCTTGGCTACCCTTCTGGGCTTTCGCCGGCCAGCACTCCCTGCATCCCTGAGTCGCTCACTTAGTTGTGCACAGGATGTACTCCGCAGGACTCCGCTCTACGACTTTCATCTAGCCCATGGCGGGAGAATGGTGGCATTTGCAGGCTGGAGTCTGCCTGTGCAGTACCGGGACAGCCACGTGGATTCGCACTTGCACACACGCCGGCACTGTTCGCTCTTTGACGTGTCCCACATGCTGCAGACCAAGATCTTTGGTTGTGACCGAGTGAAGCTGATGGAAAGTCTAGTGGTTGGAGACATTGCGGAGCTAAAGCCAAACCAGGGGACATTGTCGCTGTTTACCAATGAGGCTGGAGGCATCTTGGACGACCTGATTGTGACCAATACTTCTGAGGGATACCTGTATGTGGTATCCAATGCTGGCTGCTGGGACAAGGACTTGGCCCTCATGCAGGACAAGGTCAGGGAGCTTCAGAGCAGGGGGAGTGATGTGAGCCTGGAGGTGGTGGATAATGCTCTGCTAGCCCTGCAAGGCCCTGCTGCAGCCCAGGTGCTACAGGCTGGTGTGGCAGAGGACCTGAAGAAACTGCCCTTCATGACGAGTGCTGTGATGGAGGTGTTTGGTGTATCTGGCTGTCGAGTAACTCGCTGTGGCTACACAGGAGAGGACGGTGTGGAGATTTCAGTGCCAGTAGCTGGGGCAGTCCACGTGGCAATGGCTCTGCTACAAAACCCAGAGGTGAAACTGGCAGGGCTGGCAGCCCGGGACAGTCTTCGCCTGGAGGCAGGCCTCTGTCTATATGGAAACGACATTGATGAACATACCACACCTGTGGAGGGCAGCCTCAGTTGGACATTGGGGAAGCGCCGCCGAGTTACTATGGACTTTCCAGGAGCCACGGTCATTGTTCCCCAGCTGAAGGGCAAGGTGGAGCGGAGGCGTGTGGGGTTGATGTGTGAGGGGGCCCCAATGCGAGCACACAGTCTCATCCTATGCACAGAAGGCACCGTGATTGGTACTGTGACCAGTGGCTGCCCATCACCCTGCCTGAAAAAGAATGTGGCGATGGGTTATGTACCTTCCAAGTACAGCCGGCCAGGGACACAGTTGCTAGTGGAGGTGCGGCGAAAGCAGCAAATGGCCATTGTCAGCAAAATGCCCTTTGTGCCCACAAATTACTACGCTCTCAAGTGA

XM_004834034.1 Coding sequence

Amt aminomethyltransferase, transcript variant X6

High confidence: 4 potential gene matches
Length: 1044 bp    Location: 3371434..3366023   Strand: -
>XM_004834034.1
ATGCAGCGACCTGCGAGCTTGGCTACCCTTCTGGGCTTTCGCCGGCCAGCACTCCCTGCATCCCTGAGTCGCTCACTTAGTTGTGCACAGACCAAGATCTTTGGTTGTGACCGAGTGAAGCTGATGGAAAGTCTAGTGGTTGGAGACATTGCGGAGCTAAAGCCAAACCAGGGGACATTGTCGCTGTTTACCAATGAGGCTGGAGGCATCTTGGACGACCTGATTGTGACCAATACTTCTGAGGGATACCTGTATGTGGTATCCAATGCTGGCTGCTGGGACAAGGACTTGGCCCTCATGCAGGACAAGGTCAGGGAGCTTCAGAGCAGGGGGAGTGATGTGAGCCTGGAGGTGGTGGATAATGCTCTGCTAGCCCTGCAAGGCCCTGCTGCAGCCCAGGTGCTACAGGCTGGTGTGGCAGAGGACCTGAAGAAACTGCCCTTCATGACGAGTGCTGTGATGGAGGTGTTTGGTGTATCTGGCTGTCGAGTAACTCGCTGTGGCTACACAGGAGAGGACGGTGTGGAGATTTCAGTGCCAGTAGCTGGGGCAGTCCACGTGGCAATGGCTCTGCTACAAAACCCAGAGGTGAAACTGGCAGGGCTGGCAGCCCGGGACAGTCTTCGCCTGGAGGCAGGCCTCTGTCTATATGGAAACGACATTGATGAACATACCACACCTGTGGAGGGCAGCCTCAGTTGGACATTGGGGAAGCGCCGCCGAGTTACTATGGACTTTCCAGGAGCCACGGTCATTGTTCCCCAGCTGAAGGGCAAGGTGGAGCGGAGGCGTGTGGGGTTGATGTGTGAGGGGGCCCCAATGCGAGCACACAGTCTCATCCTATGCACAGAAGGCACCGTGATTGGTACTGTGACCAGTGGCTGCCCATCACCCTGCCTGAAAAAGAATGTGGCGATGGGTTATGTACCTTCCAAGTACAGCCGGCCAGGGACACAGTTGCTAGTGGAGGTGCGGCGAAAGCAGCAAATGGCCATTGTCAGCAAAATGCCCTTTGTGCCCACAAATTACTACGCTCTCAAGTGA

XM_004834032.1 Coding sequence

Amt aminomethyltransferase, transcript variant X4

Length: 1080 bp    Location: 3371434..3366023   Strand: -
>XM_004834032.1
ATGCAGCGACCTGCGAGCTTGGCTACCCTTCTGGGCTTTCGCCGGCCAGCACTCCCTGCATCCCTGAGTCGCTCACTTAGTTGTGCACAGGATGTACTCCGCAGGACTCCGCTCTACGACTTTCATCTAGCCCATGGCGGGAGAATGGTGGCATTTGCAGGCTGGAGTCTGCCTGTGCAGTACCGGGACAGCCACGTGGATTCGCACTTGCACACACGCCGGCACTGTTCGCTCTTTGACGTGTCCCACATGCTGCAGACCAAGATCTTTGGTTGTGACCGAGTGAAGCTGATGGAAAGTCTAGTGGTTGGAGACATTGCGGAGCTAAAGCCAAACCAGGACAAGGTCAGGGAGCTTCAGAGCAGGGGGAGTGATGTGAGCCTGGAGGTGGTGGATAATGCTCTGCTAGCCCTGCAAGGCCCTGCTGCAGCCCAGGTGCTACAGGCTGGTGTGGCAGAGGACCTGAAGAAACTGCCCTTCATGACGAGTGCTGTGATGGAGGTGTTTGGTGTATCTGGCTGTCGAGTAACTCGCTGTGGCTACACAGGAGAGGACGGTGTGGAGATTTCAGTGCCAGTAGCTGGGGCAGTCCACGTGGCAATGGCTCTGCTACAAAACCCAGAGGTGAAACTGGCAGGGCTGGCAGCCCGGGACAGTCTTCGCCTGGAGGCAGGCCTCTGTCTATATGGAAACGACATTGATGAACATACCACACCTGTGGAGGGCAGCCTCAGTTGGACATTGGGGAAGCGCCGCCGAGTTACTATGGACTTTCCAGGAGCCACGGTCATTGTTCCCCAGCTGAAGGGCAAGGTGGAGCGGAGGCGTGTGGGGTTGATGTGTGAGGGGGCCCCAATGCGAGCACACAGTCTCATCCTATGCACAGAAGGCACCGTGATTGGTACTGTGACCAGTGGCTGCCCATCACCCTGCCTGAAAAAGAATGTGGCGATGGGTTATGTACCTTCCAAGTACAGCCGGCCAGGGACACAGTTGCTAGTGGAGGTGCGGCGAAAGCAGCAAATGGCCATTGTCAGCAAAATGCCCTTTGTGCCCACAAATTACTACGCTCTCAAGTGA

XM_004834029.1 Coding sequence

Amt aminomethyltransferase, transcript variant X1

Length: 1212 bp    Location: 3371434..3366023   Strand: -
>XM_004834029.1
ATGCAGCGACCTGCGAGCTTGGCTACCCTTCTGGGCTTTCGCCGGCCAGCACTCCCTGCATCCCTGAGTCGCTCACTTAGTTGTGCACAGGATGTACTCCGCAGGACTCCGCTCTACGACTTTCATCTAGCCCATGGCGGGAGAATGGTGGCATTTGCAGGCTGGAGTCTGCCTGTGCAGTACCGGGACAGCCACGTGGATTCGCACTTGCACACACGCCGGCACTGTTCGCTCTTTGACGTGTCCCACATGCTGCAGACCAAGATCTTTGGTTGTGACCGAGTGAAGCTGATGGAAAGTCTAGTGGTTGGAGACATTGCGGAGCTAAAGCCAAACCAGGGGACATTGTCGCTGTTTACCAATGAGGCTGGAGGCATCTTGGACGACCTGATTGTGACCAATACTTCTGAGGGATACCTGTATGTGGTATCCAATGCTGGCTGCTGGGACAAGGACTTGGCCCTCATGCAGGACAAGGTCAGGGAGCTTCAGAGCAGGGGGAGTGATGTGAGCCTGGAGGTGGTGGATAATGCTCTGCTAGCCCTGCAAGGCCCTGCTGCAGCCCAGGTGCTACAGGCTGGTGTGGCAGAGGACCTGAAGAAACTGCCCTTCATGACGAGTGCTGTGATGGAGGTGTTTGGTGTATCTGGCTGTCGAGTAACTCGCTGTGGCTACACAGGAGAGGACGGTGTGGAGATTTCAGTGCCAGTAGCTGGGGCAGTCCACGTGGCAATGGCTCTGCTACAAAACCCAGAGGTGAAACTGGCAGGGCTGGCAGCCCGGGACAGTCTTCGCCTGGAGGCAGGCCTCTGTCTATATGGAAACGACATTGATGAACATACCACACCTGTGGAGGGCAGCCTCAGTTGGACATTGGGGAAGCGCCGCCGAGTTACTATGGACTTTCCAGGAGCCACGGTCATTGTTCCCCAGCTGAAGGGCAAGGTGGAGCGGAGGCGTGTGGGGTTGATGTGTGAGGGGGCCCCAATGCGAGCACACAGTCTCATCCTATGCACAGAAGGCACCGTGATTGGTACTGTGACCAGTGGCTGCCCATCACCCTGCCTGAAAAAGAATGTGGCGATGGGTTATGTACCTTCCAAGTACAGCCGGCCAGGGACACAGTTGCTAGTGGAGGTGCGGCGAAAGCAGCAAATGGCCATTGTCAGCAAAATGCCCTTTGTGCCCACAAATTACTACGCTCTCAAGTGA

XM_004834035.1 Coding sequence

Nicn1 nicolin 1, transcript variant X1

Length: 696 bp    Location: 3377295..3372676   Strand: -
>XM_004834035.1
ATGTCCCGACTGTCGGTGCCCTGTCACGTGAAAGGCGCCGTAGCCCTGCAGGTGGGGGACATGCGGACTTTCCAAGGCCGGCCCGGTGTGGTGGTCATCGATGTCACCTTCCCTAGCATCGAGCCTTTTGAGTTGCAGGAGATCACATTTAAGAATTACTACACAGCCTTTTTGACCATCCGTGTCCGTCAGCATACCTCAGCACACACACCAGCTAAGTGGATGACCTGCCTACGAGACTGTTGTCTGATGCCTGATCCACACAGTGAGGATGGAGCCCAGGAGTATGTATCGCTATTCAAGCACCAGATGCTGTGTGACATGACTAGAGTACTGGAGCTGCGTCTGATTCTGCGGCAGCCGTCACCACTGTGGCTGTCTTTCACAGTGGAGGAGCTACAAATCTACCAGCAGGGACCAAAGAGCCCCTCTGTGACCTTTCCCAAGTGGCTCTCTCACCCGATGCCTTGTGAGCAGTCTGCCCTCCTTCTTGAGGGTCTCCCAGACCCCAGCAGGGTATCCTCTGAAGTGCAGCAGATGTGGGCGCTGACAGAGATGATCCGGGCCAGTCACACCTCCACAAGGATCGGCCGCTTTGATGTGAGTTATCTCTTCCCTCTGCTTGGCTTGCATTGCCCTGAGCAGGTCAGACCTCATAGTCCTTTGTGTTACAGGTGGATGGCTGTTATGACCTGA

XM_004834038.1 Coding sequence

Nicn1 nicolin 1, transcript variant X4

Length: 537 bp    Location: 3377294..3372676   Strand: -
>XM_004834038.1
ATGTCCCGACTGTCGGTGCCCTGTCACGTGAAAGGCGCCGTAGCCCTGCAGGTGGGGGACATGCGGACTTTCCAAGGCCGGCCCGGTGTGGTGGTCATCGATGTCACCTTCCCTAGCATCGAGCCTTTTGAGTTGCAGGAGATCACATTTAAGAATTACTACACAGCCTTTTTGACCATCCGTGTCCGTCAGCATACCTCAGCACACACACCAGCTAAGTGGATGACCTGCCTACGAGACTGTTGTCTGATGCCTGATCCACACAGTGAGGATGGAGCCCAGGAGTATGTATCGCTATTCAAGCACCAGATGCTGTGTGACATGACTAGAGTACTGGAGCTGCGTCTGATTCTGCGGCAGCCGTCACCACTGTGGCTGTCTTTCACAGTGGAGGAGCTACAAATCTACCAGCAGGGACCAAAGAGCCCCTCTGTGACCTTTCCCAAGTGGCTCTCTCACCCGATGCCTTGTGAGCAGTCTGCCCTCCTTCTTGAGGTGGATGGCTGTTATGACCTGAACTTGCTCTCCTACACTTGA

XM_004834037.1 Coding sequence

Nicn1 nicolin 1, transcript variant X3

Length: 609 bp    Location: 3377295..3373257   Strand: -
>XM_004834037.1
ATGTCCCGACTGTCGGTGCCCTGTCACGTGAAAGGCGCCGTAGCCCTGCAGGTGGGGGACATGCGGACTTTCCAAGGCCGGCCCGGTGTGGTGGTCATCGATGTCACCTTCCCTAGCATCGAGCCTTTTGAGTTGCAGGAGATCACATTTAAGAATTACTACACAGCCTTTTTGACCATCCGTGTCCGTCAGCATACCTCAGCACACACACCAGCTAAGTGGATGACCTGCCTACGAGACTGTTGTCTGATGCCTGATCCACACAGTGAGGATGGAGCCCAGGAGTATGTATCGCTATTCAAGCACCAGATGCTGTGTGACATGACTAGAGTACTGGAGCTGCGTCTGATTCTGCGGCAGCCGTCACCACTGTGGCTGTCTTTCACAGTGGAGGAGCTACAAATCTACCAGCAGGGACCAAAGAGCCCCTCTGTGACCTTTCCCAAGTGGCTCTCTCACCCGATGCCTTGTGAGCAGTCTGCCCTCCTTCTTGAGAATTCTAAGGGCAGTACTGGGGAGAGACCAATGGCCATTGACCCCTCCCTCTGGAGCAGGGTCTCCCAGACCCCAGCAGGGTATCCTCTGAAGTGCAGCAGATGTGGGCGCTGA

XM_004834041.1 Coding sequence

Dag1 dystroglycan 1 (dystrophin-associated glycoprotein 1), transcript variant X3

Length: 2682 bp    Location: 3417380..3488300   Strand: +
>XM_004834041.1
ATGTCTGTGGGTTGCTCACTGCTGTTCCCCCTCTGGGGGAGGACCTTGCTCCTTCTCCTCTCTGTGGCCAAGGCTCAGGCCCGCTGGCCCAGTGAACCCTCGGAGGCGGTCAGGGACTGGGAGAACCAGCTGGAGGCATCTATGCACTCAGTGCTGTCAGACCTCCATGAGGCTGTTCCCACCGTGGTTGGCATTCCTGATGGCACAGCTGTTGTTGGGCGCTTATTTCGCGTGACTGTTCCAACAGATTTAATCACCTCCAGTGGAGAAATCATCAAGGTATCAGCAGCTGGGAAGGAGGCTCTGCCATCTTGGCTGCATTGGGACCCACAAAGCCACACCTTAGAGGGTCTCCCCCTCGACACCGATAAAGGTGTGCATTATATCTCAGTGAGTGCTGCACGTTTGGGGGCCAATGGGAGCCACGTCCCCCAGACCTCCAGTGTGTTTTCCATTGAGGTCTACCCTGAAGACCACAGCGAGCCACAGTCCATACGGGCAGCCTCACCAGACCCTGATGAGATAGTGTCATCGGTCTGTGCTGCTGATGAGCCAGTGACAGTCCTGACAGTAATTCTGGATGCTGACCTCACTAAGATGACCCCAAAGCAAAGGATTGATCTCCTCCACAGGATGCAGAGCTTCTCAGAAGTGGAGATTCACAATATGAAGTTGGTACCAGTGGTGAATAATAGACTGTTTGACATGTCAGCCTTCATGGCTGGCCCAGGAAATGCAAAAAAGGTGGTAGAGAATGGGGCTCTGCTCTCCTGGAAACTGGGCTGCTTCCTGAACCAGAATAATGTGCCTGACATTCATGGTGTAGAGGTTCCTGCCAGGGAGGGTGCTATGTCTGCCCAGCTTGGCTACCCTGTAGTGGGTTGGCATATTGCCAATAAGAAGCCCCCTCTTCCCAAACGAATCCGGAGGCAAATCCATGCCACACCCACACCTGTCACTGCCATTGGACCCCCAACTACAGCCATCCAGGAGCCACCATCCAGGATAGTGCCCACTCCCACATCTCCAGCCATTGCTCCTCCGACGGAGACCATGGTTCCTCCAGTCAGGGATCCTGTTCCTGGGAAGCCCACAGTCACTATTCGGACTAGAGGTGCCATTATTCAGACCCCAACCCTAGGCCCCATCCAGCCCACTCGGGTATCAGAAGTTGGCACCACGGTTCCTGGACAGATTCACCCAACGATGACCATTCCTGGCTACGGGGAGCCCACAGCAGTTGCCACTCCTCCCACAAGTACCACGAAGAAGCCACGTGTATCCACACCAAAACCAGCAACGCCTTCAACTGATTCCTCGACCACTACGACTCGCAGGCCAACCAAGAAACCACGGACACCCCGACCAGTGCCCCGGGTTACCACCAAAGCTCCCATCACCAGATTGGAAACAGCCTCCCCGCCTACTCGCATTCGCACCACCACCAGCGGAGTGCCCCGTGGGGGTGAACCCAACCAGCGCCCAGAGCTCAAGAACCACATTGACAAAGTGGATGCCTGGGTGGGCACCTATTTTGAGGTGAAGATCCCATCAGACACCTTCTATGATAATGAGGATACCACCACTGACAAGCTAAAGCTGACTCTCAAGCTTCGGGAGCAGCAGCTGATAGGTGAGAAGTCCTGGGTGCAATTCAACAGCAATAGCCAGCTCATGTATGGCCTGCCTGACAGCAGCCATGTGGGCAAACATGAATATTTCATGCACGCCACAGACAAGGGGGGCCTATCAGCTGTGGACGCCTTTGAGATCCATGTTCACAAGCGCCCTCAAGGGGACAAGGCTCCTGCAAGGTTCAAGGCCATATTTACAGGTGACCTCGCATCAGTGGTGAATGACATCCACAAGAAGATTGCCTTGGTGAAGAAGCTGGCCTTTGCCTTTGGGGACCGAAATTGCAGTACCATTACCCTACAGAATATCACCCAGGGCTCCATTGTGGTGGAATGGACCAACAATACACTGCCCCTGGAGCCCTGCCCCAAAGAACAGATCACAACACTGAGCAAGAGGATTGGTGAAGATAATGGGAAACCCCGGCCTGCTTTCTCCAATGCCCTGGAGCCTGACTTCAAGGCCATGAGCATTGCTGTGACAGGCTCTGGGAGTTGTCGGCACCTACAGTTCATCCCTGTCGCGCCACCCAAGAGGGTGCCCTCAGAGGTGCCACCCACAGAGGTGCCAGACAGGGACCCTGAGAAGAGCAGTGAGGATGATGTGTACCTGCACACAGTCATCCCAGCCGTAGTGGTTGCAGCCATCCTGCTCATTGCTGGCATCATTGCCATGATCTGCTATCGCAAGAAGCGGAAGGGCAAGCTCACCCTTGAAGACCAGGCCACCTTTATCAAGAAGGGGGTGCCTATAATCTTTGCTGATGAGCTGGATGACTCCAAGCCCCCCCCCTCATCCAGCATGCCACTCATCTTGCAGGAGGAGAAGGCTCCCCTCCCCCCTCCCGAATACCCCAACCAGAGCTTGCCCGAGACCACTCCCCTAAACCAGGACACCATGGGAGAATACACACCCCTGCAGGATGAGGATCCCAATGCACCTCCCTACCAGCCCCCACCACCCTTCACAGCCCCCATGGAGGGCAAAGGTTCCCGTCCCAAGAACATGACCCCATACCGGTCACCCCCTCCTTACGTGCCCCCTTAA

XM_004834040.1 Coding sequence

Dag1 dystroglycan 1 (dystrophin-associated glycoprotein 1), transcript variant X2

Length: 2883 bp    Location: 3420413..3488300   Strand: +
>XM_004834040.1
ATGGAGCTGAATCCCCGGCCCCAGAGGAGACCTTTCTACTGGCTGAGGAAGCTGAATAACAGAAAAAGGAATGTGCCCAAGGCTCTGGGTGCTCTGGGATGGAGCAGGTGTGCAGAGAGTGAGGACCTGGCTCTGGGACCACATCACTTGTTTCCTTCCTCAGTGAGATTATCGACGTGGCAGGCTCAGGCCTGGAAGAGGATGTCTGTGGGTTGCTCACTGCTGTTCCCCCTCTGGGGGAGGACCTTGCTCCTTCTCCTCTCTGTGGCCAAGGCTCAGGCCCGCTGGCCCAGTGAACCCTCGGAGGCGGTCAGGGACTGGGAGAACCAGCTGGAGGCATCTATGCACTCAGTGCTGTCAGACCTCCATGAGGCTGTTCCCACCGTGGTTGGCATTCCTGATGGCACAGCTGTTGTTGGGCGCTTATTTCGCGTGACTGTTCCAACAGATTTAATCACCTCCAGTGGAGAAATCATCAAGGTATCAGCAGCTGGGAAGGAGGCTCTGCCATCTTGGCTGCATTGGGACCCACAAAGCCACACCTTAGAGGGTCTCCCCCTCGACACCGATAAAGGTGTGCATTATATCTCAGTGAGTGCTGCACGTTTGGGGGCCAATGGGAGCCACGTCCCCCAGACCTCCAGTGTGTTTTCCATTGAGGTCTACCCTGAAGACCACAGCGAGCCACAGTCCATACGGGCAGCCTCACCAGACCCTGATGAGATAGTGTCATCGGTCTGTGCTGCTGATGAGCCAGTGACAGTCCTGACAGTAATTCTGGATGCTGACCTCACTAAGATGACCCCAAAGCAAAGGATTGATCTCCTCCACAGGATGCAGAGCTTCTCAGAAGTGGAGATTCACAATATGAAGTTGGTACCAGTGGTGAATAATAGACTGTTTGACATGTCAGCCTTCATGGCTGGCCCAGGAAATGCAAAAAAGGTGGTAGAGAATGGGGCTCTGCTCTCCTGGAAACTGGGCTGCTTCCTGAACCAGAATAATGTGCCTGACATTCATGGTGTAGAGGTTCCTGCCAGGGAGGGTGCTATGTCTGCCCAGCTTGGCTACCCTGTAGTGGGTTGGCATATTGCCAATAAGAAGCCCCCTCTTCCCAAACGAATCCGGAGGCAAATCCATGCCACACCCACACCTGTCACTGCCATTGGACCCCCAACTACAGCCATCCAGGAGCCACCATCCAGGATAGTGCCCACTCCCACATCTCCAGCCATTGCTCCTCCGACGGAGACCATGGTTCCTCCAGTCAGGGATCCTGTTCCTGGGAAGCCCACAGTCACTATTCGGACTAGAGGTGCCATTATTCAGACCCCAACCCTAGGCCCCATCCAGCCCACTCGGGTATCAGAAGTTGGCACCACGGTTCCTGGACAGATTCACCCAACGATGACCATTCCTGGCTACGGGGAGCCCACAGCAGTTGCCACTCCTCCCACAAGTACCACGAAGAAGCCACGTGTATCCACACCAAAACCAGCAACGCCTTCAACTGATTCCTCGACCACTACGACTCGCAGGCCAACCAAGAAACCACGGACACCCCGACCAGTGCCCCGGGTTACCACCAAAGCTCCCATCACCAGATTGGAAACAGCCTCCCCGCCTACTCGCATTCGCACCACCACCAGCGGAGTGCCCCGTGGGGGTGAACCCAACCAGCGCCCAGAGCTCAAGAACCACATTGACAAAGTGGATGCCTGGGTGGGCACCTATTTTGAGGTGAAGATCCCATCAGACACCTTCTATGATAATGAGGATACCACCACTGACAAGCTAAAGCTGACTCTCAAGCTTCGGGAGCAGCAGCTGATAGGTGAGAAGTCCTGGGTGCAATTCAACAGCAATAGCCAGCTCATGTATGGCCTGCCTGACAGCAGCCATGTGGGCAAACATGAATATTTCATGCACGCCACAGACAAGGGGGGCCTATCAGCTGTGGACGCCTTTGAGATCCATGTTCACAAGCGCCCTCAAGGGGACAAGGCTCCTGCAAGGTTCAAGGCCATATTTACAGGTGACCTCGCATCAGTGGTGAATGACATCCACAAGAAGATTGCCTTGGTGAAGAAGCTGGCCTTTGCCTTTGGGGACCGAAATTGCAGTACCATTACCCTACAGAATATCACCCAGGGCTCCATTGTGGTGGAATGGACCAACAATACACTGCCCCTGGAGCCCTGCCCCAAAGAACAGATCACAACACTGAGCAAGAGGATTGGTGAAGATAATGGGAAACCCCGGCCTGCTTTCTCCAATGCCCTGGAGCCTGACTTCAAGGCCATGAGCATTGCTGTGACAGGCTCTGGGAGTTGTCGGCACCTACAGTTCATCCCTGTCGCGCCACCCAAGAGGGTGCCCTCAGAGGTGCCACCCACAGAGGTGCCAGACAGGGACCCTGAGAAGAGCAGTGAGGATGATGTGTACCTGCACACAGTCATCCCAGCCGTAGTGGTTGCAGCCATCCTGCTCATTGCTGGCATCATTGCCATGATCTGCTATCGCAAGAAGCGGAAGGGCAAGCTCACCCTTGAAGACCAGGCCACCTTTATCAAGAAGGGGGTGCCTATAATCTTTGCTGATGAGCTGGATGACTCCAAGCCCCCCCCCTCATCCAGCATGCCACTCATCTTGCAGGAGGAGAAGGCTCCCCTCCCCCCTCCCGAATACCCCAACCAGAGCTTGCCCGAGACCACTCCCCTAAACCAGGACACCATGGGAGAATACACACCCCTGCAGGATGAGGATCCCAATGCACCTCCCTACCAGCCCCCACCACCCTTCACAGCCCCCATGGAGGGCAAAGGTTCCCGTCCCAAGAACATGACCCCATACCGGTCACCCCCTCCTTACGTGCCCCCTTAA

XM_004834046.1 Coding sequence

Mst1 macrophage stimulating 1 (hepatocyte growth factor-like), transcript variant X1

Length: 2172 bp    Location: 3617242..3612467   Strand: -
>XM_004834046.1
ATGGGGTGGGTCACAGTGCAGTCTCTGGCCAAGAGGATGGGGTGGCTCCCACTCCTGCTGCTTCTGACTCTATTCTTGGAGGCCCCTGGGCAGCGCTCGCCACTGAATGACTTCCAGGTGCTTCGGGGCACAGAGCTGCAGCACTTGCTACATGGAGTGGTGCTTGGGTCTTGGCAGAAAGATGTAGTAGATGCTGAAGAGTGTGCTAAGCTCTGTGGGCCCCTCCTGGACTGCCGTGCCTTTCACTACAACATGAGCAGCCTCAGCTGCCAACTGCTCCCATGGACCCAGCACTCGCCTCACACAGGGCTGCAGCGTTCTGCAGGCTGTGATCTCTTCCAGAAGAAAGACTATGTTCGGACATGCATTATGGACAATGGCGTCAGGTACCGGGGCACTGCAGCCAAGACAGTGGCTGGCCTGCCCTGCCAAAGCTGGAATCACAGGTTCCCCAATGACCACAAGTATAAACCCACACTCAGGAATGGCCTGGAAGAAAACTTCTGTCGCAATCCTGACAGGGACCCCAGAGGTCCTTGGTGCTACACAACAGACCCTACAGTGCGCTTCCAGAGCTGTGGCATCAAGTCTTGCAGGGAGGGTGCCTGCATTCGGTGCAATGGTGAGGATTATCGTGGTTCAGTGGACCACACAGAGTCAGGACTTGAGTGCCAGCGCTGGGACCTGCAGCACCCGCACGTGCATCCCTTTGAGCCTGCCAAATTCCTGGACAAGGATCTAGATGACAACTACTGCCGGAATCCTGATGGTTCTGAGCGGCCCTGGTGCTACACCACAGACCCACAGCTTGAGCGAGAATTCTGTGATCTCCCCAGCTGTGGGTTGGAGGCACAACCACATCACGAGGCCAGGACTTTCCACTGCTTCCGAGGGAAGGGTGAGGGCTACCGGGGACTCGCCAACACCACCACCACGGGCGTGCCCTGCCAGCATTGGGATGCGCAGAGCCCACACCAGCACAGATTCCTGCCAGAGAAATATGTGTGCAAGGACCTCCGGGAAAACTTCTGCCGGAACCCTGATGGCTCGGAGGCGCCCTGGTGCTTCACATCCCGGCCTGGTATGCGGGTTGCCTTCTGCTACCAGATACCGCGCTGCACCGATGACATTCGCACAGAGGACTGCTACCATGGCTCAGGGGAGCAGTACCGAGGCTTTGTCAACAAGACCCGCAAGGGTGTCCCATGCCAGTCCTGGTCTGCACAAAGCCCACACAAGCCACTATTCACACCCACCTCTGCCCCATATGCTCAACTGGAGGAAAACTTCTGCCGGAACCCAGATGGGGATAGCCATGGGCCCTGGTGCTACACTACTGACCCAGGGACCTCCTTCGACTACTGTGCCCTGCAACGCTGCAATGATGACCCACCAAAGTCCATCCTGGACCCACCAGACCAGGTGCAGTTTGAGAAGTGTGGCAAGAGGGTGGACAGGCCAGACCAGTGGTTCTCCAAGCTACGCATAGTGGGGGGCCATCCTGGGAACTCACCTTGGACAGTCAGTTTGCACAACAGGCAAGGTCAGCATTTCTGCAGTGGGTCCCTAGTGAAGGAGCAGTGGGTACTGACAGCCCGGCAATGCTTCTCATCCTGCCATGCACCTCTCACGGGATATGAGGTGTGGCTGGGTACCCTGTTCCAGAACCCACAGCCTGGCGAGCCTGGCCTGCAGCAGGTCCCAGTGGCTAAGATGGTATGTGGGCCCTCAGATTCCCAGCTTGTCCTGCTCAAGCTGGAGAGACCTGTGACCCTAAACCAGCGAGTGGCCCTGATCTGCCTGCCCCCTGAGCGCTATGTGGTGCCTCCAAGAACCACGTGTGAGATTGCAGGCTGGGATGAGGCCAAAGGTACAAGTCATGACAGGGTCCTAAATGTGGCCTTGCTGAATGTCATCTCCAACCAGGAGTGTAACATCAAACACCGAGGGCGTGTACGAGAAAGTGAGATGTGTACCAGGAAACTGACGGCCCCTGTAGGAGCCTGTGAGGGTGACTACGGGGGCCCACTTGCCTGCTTTACCCATGACTGCTGGGTCCTGGAGGGAATTATAATCCCCAACCGAGTATGTGCACGGCCTGGATGGCCAGCCATCTTCCTGCGTGTCTCTGTGTTTGTGGACTGGATTCAGAAGGTCATGCAGCTGGGTTAG

XM_004834047.1 Coding sequence

Mst1 macrophage stimulating 1 (hepatocyte growth factor-like), transcript variant X2

High confidence: 4 potential gene matches
Length: 2163 bp    Location: 3617225..3612467   Strand: -
>XM_004834047.1
ATGGGGTGGCTCCCACTCCTGCTGCTTCTGACTCTATTCTTGGAGGCCCCTGGGCAGCGCTCGCCACTGAATGACTTCCAGGTGCTTCGGGGCACAGAGCTGCAGCACTTGCTACATGGAGTGGTGCTTGGGTCTTGGCAGAAAGATGTAGTAGATGCTGAAGAGTGTGCTAAGCTCTGTGGGCCCCTCCTGGACTGCCGTGCCTTTCACTACAACATGAGCAGCCTCAGCTGCCAACTGCTCCCATGGACCCAGCACTCGCCTCACACAGGGCTGCAGCGTTCTGCAGGCTGTGATCTCTTCCAGAAGAAAGACTATGTTCGGACATGCATTATGGACAATGGCGTCAGGTACCGGGGCACTGCAGCCAAGACAGTGGCTGGCCTGCCCTGCCAAAGCTGGAATCACAGGTTCCCCAATGACCACAAGTATAAACCCACACTCAGGAATGGCCTGGAAGAAAACTTCTGTCGCAATCCTGACAGGGACCCCAGAGGTCCTTGGTGCTACACAACAGACCCTACAGTGCGCTTCCAGAGCTGTGGCATCAAGTCTTGCAGGGAGGGTGCCTGCATTCGGTGCAATGGTGAGGATTATCGTGGTTCAGTGGACCACACAGAGTCAGGACTTGAGTGCCAGCGCTGGGACCTGCAGCACCCGCACGTGCATCCCTTTGAGCCTGCCAAATTCCTGGACAAGGATCTAGATGACAACTACTGCCGGAATCCTGATGGTTCTGAGCGGCCCTGGTGCTACACCACAGACCCACAGCTTGAGCGAGAATTCTGTGATCTCCCCAGCTGTGGGTCCGACCTGCCTCGGTCCACCCCAGGGTTGGAGGCACAACCACATCACGAGGCCAGGACTTTCCACTGCTTCCGAGGGAAGGGTGAGGGCTACCGGGGACTCGCCAACACCACCACCACGGGCGTGCCCTGCCAGCATTGGGATGCGCAGAGCCCACACCAGCACAGATTCCTGCCAGAGAAATATGTGTGCAAGGACCTCCGGGAAAACTTCTGCCGGAACCCTGATGGCTCGGAGGCGCCCTGGTGCTTCACATCCCGGCCTGGTATGCGGGTTGCCTTCTGCTACCAGATACCGCGCTGCACCGATGACATTCGCACAGAGGACTGCTACCATGGCTCAGGGGAGCAGTACCGAGGCTTTGTCAACAAGACCCGCAAGGGTGTCCCATGCCAGTCCTGGTCTGCACAAAGCCCACACAAGCCACTATTCACACCCACCTCTGCCCCATATGCTCAACTGGAGGAAAACTTCTGCCGGAACCCAGATGGGGATAGCCATGGGCCCTGGTGCTACACTACTGACCCAGGGACCTCCTTCGACTACTGTGCCCTGCAACGCTGCAATGATGACCCACCAAAGTCCATCCTGGACCCACCAGACCAGGTGCAGTTTGAGAAGTGTGGCAAGAGGGTGGACAGGCCAGACCAGTGGTTCTCCAAGCTACGCATAGTGGGGGGCCATCCTGGGAACTCACCTTGGACAGTCAGTTTGCACAACAGGCAAGGTCAGCATTTCTGCAGTGGGTCCCTAGTGAAGGAGCAGTGGGTACTGACAGCCCGGCAATGCTTCTCATCCTGCCATGCACCTCTCACGGGATATGAGGTGTGGCTGGGTACCCTGTTCCAGAACCCACAGCCTGGCGAGCCTGGCCTGCAGCAGGTCCCAGTGGCTAAGATGGTATGTGGGCCCTCAGATTCCCAGCTTGTCCTGCTCAAGCTGGAGAGACCTGTGACCCTAAACCAGCGAGTGGCCCTGATCTGCCTGCCCCCTGAGCGCTATGTGGTGCCTCCAAGAACCACGTGTGAGATTGCAGGCTGGGATGAGGCCAAAGGTACAAGTCATGACAGGGTCCTAAATGTGGCCTTGCTGAATGTCATCTCCAACCAGGAGTGTAACATCAAACACCGAGGGCGTGTACGAGAAAGTGAGATGTGTACCAGGAAACTGACGGCCCCTGTAGGAGCCTGTGAGGGTGACTACGGGGGCCCACTTGCCTGCTTTACCCATGACTGCTGGGTCCTGGAGGGAATTATAATCCCCAACCGAGTATGTGCACGGCCTGGATGGCCAGCCATCTTCCTGCGTGTCTCTGTGTTTGTGGACTGGATTCAGAAGGTCATGCAGCTGGGTTAG

XM_004834051.1 Coding sequence

Rnf123 ring finger protein 123, transcript variant X2

High confidence: 4 potential gene matches
Length: 3945 bp    Location: 3617449..3645797   Strand: +
>XM_004834051.1
ATGGCGTCTAAAGGGGCTGGCATGTCTTTCTCCCGAAAGAGCTATAAGCTGACCTCAGATGCTGAGAAATCCAGGGTCACAGGCATTGTGCATGAGAAGCTGCTGAATGACTACTTGCACTGCATCTTTTCCTCTACTGACCATGTGCCCCCTGCAGCCACCAGCAGGAAATTCCTGAACTTCCAGAACCTGCCAGAGCGTCTGGACCAGCTGCTACAGGTGGACAGTGAAGATGAGGAAAGCCAGGGACAGGTTGAAGGGCGGCTTGGCCCATCCACAGTGGTACTAGACCACACAGGAGGCTTTGAGGGGCTTCTCCTGGTGGATGATGACCTCCTGGAGGTGATTGGACACAGCAACTTTGGGACTATCCGCTCTACCACATGTGTATACAAAGGGAAGTGGCTCTACGAGGTGCTCATCTCCTCCCAGGGGCTCATGCAGATTGGTTGGTGCACCATCAGCTGCCGCTTCAATCATGAGGAAGGGGTTGGAGACACACCCAACTCCTATGCCTATGACGGAAACCGGGTGCGCAAGTGGAATGTGACCACAACAAATTATGGCAAGGCCTGGGCAGCGGGGGACATTGTGAGCTGTCTGATTGACCTGGACGCTGGTACTCTCTCCTTTTGCCTGAATGGTGTGTCACTGGGCACTGCCTTTGAGAACCTGTCCAAGGGCCAGGGCATGGCCTACTTCCCAGCCATCAGCCTGTCTTTTAAGGAGTCCGTGGCCTTCAACTTTGGCAGCCGTCCTCTGCGCTACCCAATGGCAGGCTTCCGGCCTCTGCAGGACCCACCTGGTGCTGACCTGGTGCGGGCACAGAGGTTGCTGGGCTGTTTCCGGGCAGTGCTCAGTGTGGAGCTGGACCCTGTGGAAGGGCGGCTGGTGGAGAAGGAGAGCTCTGAGTGGCAGTTGCAAGGGCAGCCCACTGTCCTCCTCACTCTGGCCCACATCTTCCATCGTTTTGCACCACTGCTGCACAAGGTATACCTGGTAGAGGCTGTGCTCATAAACTTCCTGCTGGGCATTGTGGAGAAGGACACACCTGCACAGGCACAGTCCGTGGTGCACCAGGTCTTGGACCTCTTTTGGCTCTTCATGGAGGACTATGAGGTACAGGATTGCCTCAAGCAGTTGATGATGTCTCTGCTGCGCTTATACCGGTTTTCGCCAATCGTTCCAGACCTGAGCCTGCAGATCCACTATCTGAGACTCACTATCTCCATCCTGAGGCATGAGAAGTCCCGCAAATTTCTGCTTAGCAATGTCCTCTTCGACATGCTGCGGTCTGTCATCTTCTTCTACATCAAGAGCCCCCTGCGTGTGGAGGAGGCCGGGCTGCAGGAGCTCATTCCCACCACCTGGTGGCCCTGCTGCTCCAGCAGGGAGGCCAGAGAGAATAAGGAGGTGAAGGAGGAGACGTCAGAGGAGAGGCTCCGGCGTCGAGCCTATGAGCGGGGCTGCCAGAGGCTCAAGAAGCGCATTGAAGTGGTAGAAGAACTTCAGGTCCAAATCCTGAAGCTGCTGTTGGACAATAAAGATGACAGTGGGGGTGAAGCTTCTAGGTATATCTTCCTGTCCAAGTTCCGGAAGTTTCTGCAAGAGAATGCCAGTGGCCGGGGGAATATGCCCATGCTCTGCCCCCCTGAGTACATGGTCTGCTTTTTGCACCGGCTCATCTCTGCCCTGCGCTACTATTGGGATGAGTACAAGGCTTCCAACCCCCGTGCCTGCTTCAGTGAGGAGGCTTACATCCCACCCCAGGTCTTCTATAATGGCAAAGTGGACTACTTCGACCTTCAGCGCCTTGGGGGGCTCCTCTCACACCTTCGGAAGACCCTCAGAGATGACCTTGCTGCCAAAGCTAACATTGTGATTGACCCACTGGAGCTGCAGGCAGCCACGATGGATGACCTGGATGAGGATGAGGAGCCAGCCCCGTCTGCAGCCCAGCGCCCCATGCAAGCCCTGGCCATGGGAGGGGCACTGCCCCTGCCCCGGCCAGGCTGGCTTAGTTCACCAACTCTGGGCCGAGCCAACCGCTTCCTCAGCACAGCAGCTGTGAGCCTCATGACCCCACGGCGGCCTCTGAGCACCTCGGAGAAAGTGAAGGTCCGAACACTGAGCGTGGAACAAAGGACTCGTGAGGATATTGAGGGCAGCCATTGGAACGAGGGCCTGCTGCTGGGGCGGCCTCCTGAGGAACCCGAGCAGCCTGTCACCGAGAACTCCCTGCTGGAAGTCCTAGATGGGGCCATCATGATGTATAACCTCAGCGTCCACCAGCAGCTGGGCAAGATGGTGGGTGTGTCCGACGATGTCAACGAGTATGCGATGGCTCTGAGGGACACAGAAGACAAGATCCGCAGGTGTCCCAAGCGGAGGAAGGATATCCTCACAGAATTGACCAAGAGCCAGAAAGTTTTCTCGGAAAAGCTGGATCACCTGAGCCGTCGTCTTGCCTGGGTCCACGCCACTGTCTACTCCCAGGAGAAGATGCTGGACATCTACTGGCTGCTGCGCATCTGCCTGCGGACCATCGAGCATGGGGACCGTACCGGCTCCCTCTTCGCCTTCATGCCTGAGTTCTACCTGAATGTTGCCATCAACAGCTACAGTGCTCTCAAGAATTATTTTGGCCCTGTGCACAGCATGGAGGAGCTCCCAGGCTACGAGGAGACCCTGACCCGCCTGGCTGCCATCCTTGCCAAACACTTTGCCGACACACGCATTGTAGGCACTGACATTCGAGACTCACTCATGCAGGCCCTGGCTAGCTACGTGTGTTACCCACACTCCCTACGGGCTGTGGAGCGGATCCCCAAGGAGCAGCGTGTTGCCATGGTGAGGAATCTCCTGGCGCCCTATGAGCAGCGGCCCTGGGCCCAGACCAACTGGATCCTAGTGCGGCTCTGGAGGGGCTGTGGGTTTGGATACCGCTACACACGGCTGCCACATCTGCTGAAAACCAAACCTGATGATGCCAATTTGCCCAGCCTCCAGAAGCCTTGTCCCTCCACCCTGCTGCAGCAGCACATGGCAGACCTGCTGCGGCAGGGTCCTGATGTGGCACCTAGCTTCCTCAACAGTGTCCTGAATCAGCTCAACTGGGCCTTCTCTGAGTTCATCGGCATGATCCAGGAGATTCAGCAGGCTGCTGAGCGCCTGGAGCGAAACTTTGTAGATAGCAGGCAGCTCAAGGTGTGTGCCACCTGCTTTGACCTGTCAGTCAGCCTGCTGCGTGTCCTGGAAATGACCATCACGCTGGTGCCTGAGATATTCCTCGACTGGGCCTGGCCTACCTCTGAGATGCTGCTGCGGCGTCTCGCACAGCTGCTGAACCAGGTGCTGAACCGGGTGACAGCTGAAAGGAACCTGTTTGACCGTGTGGTTACCCTGCGGCTGCCTGGTCTGGAGAGCGTGGACCACTACCCCATCCTGGTGGCAGTAACGGGCATCCTGGTACGGCTCCTGGTGCATGGTCCAGCCTCAGAGACAGAGAGAGCCACGTCAGTGCTCCTGGCTGATCCCTGCTTCCAGCTTAGATCCATATGCTATCTCCTGGGGCAGCCAGAGCCTCCAGCACCTGGTACTGCCCTGCCTGCCCCAGACCGGAAGCGCTTCTCTCTGCAGAGCTACACAGATTATATCAATGCTGAGGAGCTGGCCCAAGTGGAGCGGATGCTGGCTCATCTGACCTCTGCATCTGCTCAGGCAGCAGCTGCATCCCTGCCCACCAGCGAGGAGGACCTCTGCCCAATCTGCTACGCCCACCCCATCTCTGCTGTGTTCCAGCCCTGTGGTCACAAATCTTGCAAAGCCTGCATCAACCAGCACCTGATGAACAACAAGGATTGCTTCTTCTGCAAAGCCACCGTTGTGTCTGTAGAGGACTGGGACAAGGTAGCAAATACAGGCACCACCTCCTCGGCTCCCTAG

XM_004834053.1 Coding sequence

Ip6k1 inositol hexakisphosphate kinase 1, transcript variant X2

Length: 1302 bp    Location: 3699052..3648461   Strand: -
>XM_004834053.1
ATGTGTGTTTGTCAAACCATGGAAGTGGGGCAGTATGGCAAGAATGCAGGACGAGCGGGAGACCGAGGAGTCCTCCTGGAGCCCTTCATCCACCAAGTGGGCGGGCACAGCAGCATGATGCGTTACGACGACCACACTGTGTGCAAACCTCTCATCTCCAGAGAGCAGCGCTTCTATGAGTCCCTCCCTCCTGAGATGAAGGAGTTCACCCCTGAATACAAAGGTGTGGTATCTGTCTGTTTTGAGGGGGACAGTGATGGTTATATCAACTTGGTGGCCTACCCTTATGTGGAGAGTGAGACCATGGAACAGGATGATACACCAGAACGGGAGCAACCTCGGCGCAAACATTCCCGCCGGAGCCTGCATCGGTCAGGCAGTGGCAGTGACCACAAGGAGGAGAAAGCTACCTTGTCCCTTGAGACCTCTGAGAGCTCCCAGGAGGCAAAGAGTCTGAAGGTGGAGCTTCATAGCCACTCAGATGTCCCTTTCCAGATGCTAGATGGCAATAGCGGTCTGAGTTCTGAGAAGATCAGCCATAACCCCTGGAGCCTGCGCTGTCACAAGCAGCAGCTGAGCCGCATGCGCTCTGAGTCCAAGGACCGAAAGCTCTACAAATTCCTCCTGCTTGAGAACGTTGTTCACCATTTCAAGTACCCCTGTGTGCTGGACCTGAAGATGGGTACTCGGCAGCATGGGGACGACGCATCAGCTGAGAAGGCTGCCAGGCAGATGAGGAAGTGTGAGCAGAGCACATCTGCCACGCTGGGGGTCAGGGTCTGTGGCATGCAGGTGTACCAGCTGGACACAGGCCATTACCTCTGCAGGAACAAGTACTATGGCCGTGGGCTCTCCATTGAAGGCTTCCGCAATGCCCTCTATCAGTACCTGCACAATGGGCTGGACCTGCGACGTGACCTCTTTGAGCCTATCTTGAGCAAACTTCGAGGCCTCAAAGCTGTGCTGGAGCGGCAGGCCTCCTACCGATTCTATTCCAGTTCTCTGCTTATCATCTATGATGGCAAGGAGTGCTGGTCTGACCTGCGTCTCAAGCACCTGGACATGGGGAACACTGAGGTGGCACCACCCAGTGGCCCCAGCACTAGCCCCAGCGGCATGAACCCTGAGCCGGGCCCCTCCTGTCCACCCAAAGTGGATGTCCGCATGATTGACTTTGCACACAGCACCTTCAAGGGCTTCCGGGATGACCCCACTGTGCACGATGGGCCAGACAGAGGCTATGTGTTTGGCCTGGAGAATCTCATCAGCATCATGGAACAGATGCAGGACGAAAACCAGTAG

XM_004834050.1 Coding sequence

Rnf123 ring finger protein 123, transcript variant X1

Length: 3945 bp    Location: 3618265..3645797   Strand: +
>XM_004834050.1
ATGGCGTCTAAAGGGGCTGGCATGTCTTTCTCCCGAAAGAGCTATAAGCTGACCTCAGATGCTGAGAAATCCAGGGTCACAGGCATTGTGCATGAGAAGCTGCTGAATGACTACTTGCACTGCATCTTTTCCTCTACTGACCATGTGCCCCCTGCAGCCACCAGCAGGAAATTCCTGAACTTCCAGAACCTGCCAGAGCGTCTGGACCAGCTGCTACAGGTGGACAGTGAAGATGAGGAAAGCCAGGGACAGGTTGAAGGGCGGCTTGGCCCATCCACAGTGGTACTAGACCACACAGGAGGCTTTGAGGGGCTTCTCCTGGTGGATGATGACCTCCTGGAGGTGATTGGACACAGCAACTTTGGGACTATCCGCTCTACCACATGTGTATACAAAGGGAAGTGGCTCTACGAGGTGCTCATCTCCTCCCAGGGGCTCATGCAGATTGGTTGGTGCACCATCAGCTGCCGCTTCAATCATGAGGAAGGGGTTGGAGACACACCCAACTCCTATGCCTATGACGGAAACCGGGTGCGCAAGTGGAATGTGACCACAACAAATTATGGCAAGGCCTGGGCAGCGGGGGACATTGTGAGCTGTCTGATTGACCTGGACGCTGGTACTCTCTCCTTTTGCCTGAATGGTGTGTCACTGGGCACTGCCTTTGAGAACCTGTCCAAGGGCCAGGGCATGGCCTACTTCCCAGCCATCAGCCTGTCTTTTAAGGAGTCCGTGGCCTTCAACTTTGGCAGCCGTCCTCTGCGCTACCCAATGGCAGGCTTCCGGCCTCTGCAGGACCCACCTGGTGCTGACCTGGTGCGGGCACAGAGGTTGCTGGGCTGTTTCCGGGCAGTGCTCAGTGTGGAGCTGGACCCTGTGGAAGGGCGGCTGGTGGAGAAGGAGAGCTCTGAGTGGCAGTTGCAAGGGCAGCCCACTGTCCTCCTCACTCTGGCCCACATCTTCCATCGTTTTGCACCACTGCTGCACAAGGTATACCTGGTAGAGGCTGTGCTCATAAACTTCCTGCTGGGCATTGTGGAGAAGGACACACCTGCACAGGCACAGTCCGTGGTGCACCAGGTCTTGGACCTCTTTTGGCTCTTCATGGAGGACTATGAGGTACAGGATTGCCTCAAGCAGTTGATGATGTCTCTGCTGCGCTTATACCGGTTTTCGCCAATCGTTCCAGACCTGAGCCTGCAGATCCACTATCTGAGACTCACTATCTCCATCCTGAGGCATGAGAAGTCCCGCAAATTTCTGCTTAGCAATGTCCTCTTCGACATGCTGCGGTCTGTCATCTTCTTCTACATCAAGAGCCCCCTGCGTGTGGAGGAGGCCGGGCTGCAGGAGCTCATTCCCACCACCTGGTGGCCCTGCTGCTCCAGCAGGGAGGCCAGAGAGAATAAGGAGGTGAAGGAGGAGACGTCAGAGGAGAGGCTCCGGCGTCGAGCCTATGAGCGGGGCTGCCAGAGGCTCAAGAAGCGCATTGAAGTGGTAGAAGAACTTCAGGTCCAAATCCTGAAGCTGCTGTTGGACAATAAAGATGACAGTGGGGGTGAAGCTTCTAGGTATATCTTCCTGTCCAAGTTCCGGAAGTTTCTGCAAGAGAATGCCAGTGGCCGGGGGAATATGCCCATGCTCTGCCCCCCTGAGTACATGGTCTGCTTTTTGCACCGGCTCATCTCTGCCCTGCGCTACTATTGGGATGAGTACAAGGCTTCCAACCCCCGTGCCTGCTTCAGTGAGGAGGCTTACATCCCACCCCAGGTCTTCTATAATGGCAAAGTGGACTACTTCGACCTTCAGCGCCTTGGGGGGCTCCTCTCACACCTTCGGAAGACCCTCAGAGATGACCTTGCTGCCAAAGCTAACATTGTGATTGACCCACTGGAGCTGCAGGCAGCCACGATGGATGACCTGGATGAGGATGAGGAGCCAGCCCCGTCTGCAGCCCAGCGCCCCATGCAAGCCCTGGCCATGGGAGGGGCACTGCCCCTGCCCCGGCCAGGCTGGCTTAGTTCACCAACTCTGGGCCGAGCCAACCGCTTCCTCAGCACAGCAGCTGTGAGCCTCATGACCCCACGGCGGCCTCTGAGCACCTCGGAGAAAGTGAAGGTCCGAACACTGAGCGTGGAACAAAGGACTCGTGAGGATATTGAGGGCAGCCATTGGAACGAGGGCCTGCTGCTGGGGCGGCCTCCTGAGGAACCCGAGCAGCCTGTCACCGAGAACTCCCTGCTGGAAGTCCTAGATGGGGCCATCATGATGTATAACCTCAGCGTCCACCAGCAGCTGGGCAAGATGGTGGGTGTGTCCGACGATGTCAACGAGTATGCGATGGCTCTGAGGGACACAGAAGACAAGATCCGCAGGTGTCCCAAGCGGAGGAAGGATATCCTCACAGAATTGACCAAGAGCCAGAAAGTTTTCTCGGAAAAGCTGGATCACCTGAGCCGTCGTCTTGCCTGGGTCCACGCCACTGTCTACTCCCAGGAGAAGATGCTGGACATCTACTGGCTGCTGCGCATCTGCCTGCGGACCATCGAGCATGGGGACCGTACCGGCTCCCTCTTCGCCTTCATGCCTGAGTTCTACCTGAATGTTGCCATCAACAGCTACAGTGCTCTCAAGAATTATTTTGGCCCTGTGCACAGCATGGAGGAGCTCCCAGGCTACGAGGAGACCCTGACCCGCCTGGCTGCCATCCTTGCCAAACACTTTGCCGACACACGCATTGTAGGCACTGACATTCGAGACTCACTCATGCAGGCCCTGGCTAGCTACGTGTGTTACCCACACTCCCTACGGGCTGTGGAGCGGATCCCCAAGGAGCAGCGTGTTGCCATGGTGAGGAATCTCCTGGCGCCCTATGAGCAGCGGCCCTGGGCCCAGACCAACTGGATCCTAGTGCGGCTCTGGAGGGGCTGTGGGTTTGGATACCGCTACACACGGCTGCCACATCTGCTGAAAACCAAACCTGATGATGCCAATTTGCCCAGCCTCCAGAAGCCTTGTCCCTCCACCCTGCTGCAGCAGCACATGGCAGACCTGCTGCGGCAGGGTCCTGATGTGGCACCTAGCTTCCTCAACAGTGTCCTGAATCAGCTCAACTGGGCCTTCTCTGAGTTCATCGGCATGATCCAGGAGATTCAGCAGGCTGCTGAGCGCCTGGAGCGAAACTTTGTAGATAGCAGGCAGCTCAAGGTGTGTGCCACCTGCTTTGACCTGTCAGTCAGCCTGCTGCGTGTCCTGGAAATGACCATCACGCTGGTGCCTGAGATATTCCTCGACTGGGCCTGGCCTACCTCTGAGATGCTGCTGCGGCGTCTCGCACAGCTGCTGAACCAGGTGCTGAACCGGGTGACAGCTGAAAGGAACCTGTTTGACCGTGTGGTTACCCTGCGGCTGCCTGGTCTGGAGAGCGTGGACCACTACCCCATCCTGGTGGCAGTAACGGGCATCCTGGTACGGCTCCTGGTGCATGGTCCAGCCTCAGAGACAGAGAGAGCCACGTCAGTGCTCCTGGCTGATCCCTGCTTCCAGCTTAGATCCATATGCTATCTCCTGGGGCAGCCAGAGCCTCCAGCACCTGGTACTGCCCTGCCTGCCCCAGACCGGAAGCGCTTCTCTCTGCAGAGCTACACAGATTATATCAATGCTGAGGAGCTGGCCCAAGTGGAGCGGATGCTGGCTCATCTGACCTCTGCATCTGCTCAGGCAGCAGCTGCATCCCTGCCCACCAGCGAGGAGGACCTCTGCCCAATCTGCTACGCCCACCCCATCTCTGCTGTGTTCCAGCCCTGTGGTCACAAATCTTGCAAAGCCTGCATCAACCAGCACCTGATGAACAACAAGGATTGCTTCTTCTGCAAAGCCACCGTTGTGTCTGTAGAGGACTGGGACAAGGTAGCAAATACAGGCACCACCTCCTCGGCTCCCTAG

XM_004834049.1 Coding sequence

Amigo3 adhesion molecule with Ig-like domain 3

High confidence: 3 potential gene matches
Length: 1533 bp    Location: 3644866..3641725   Strand: -
>XM_004834049.1
ATGACCTGGCTGGTGCTGCCGGGTGCACTGCTGTGCATGCTGTGCTTCGGGTTAGGCACCCCGGATTCTAGAGGCTACCCGCCCCCTGCACTCCACGACTGCCCTTACAAATGCGTCTGCGCTGCCGATCTGCTGAGCTGTGCAGGCCTCGGGTTGCAGGACGTTCCGGCCACATTACCTGCAGCTGCTGAAGACCTCGATCTGAGCCACAACGCGCTCCGGCACCTCCGCCCTGGCTGGCTAGCGCCCCTCTCCCGGCTGCAGGCCCTGCACCTGAGCCACAACAAGCTGGATGCACTGGGTCGGGGCATCTTTAGCAACGCCAGCGGCCTGAGGCTGCTCGACCTGTCGGCTAATGCCTTGCGGGCACTTGGCCGCCATGACCTTGATGGGCTGGAAACACTGGAGATGCTGGTTCTGTATAACAACCGTCTGGCAAACTTGGATGAGCATGCCTTCCACGGCCTGAGAGCTCTTCGCCACCTCTATCTGAGCTACAACGAACTCACCTCTTTCTCTTTCAACCACCTGCACGGCCTGGGCACGACCCACCTGCGTACTCTGGATCTCTCTTCCAACCGGCTGGGACTCATCTCGGTCTCCCACCTGGCCACACTGCCCGCCTTCCTCAAGAACGGGCTCTACTTGCACAACAACCCGCTGCCCTGTGACTGCCACCTCTACCACCTGCTGCAGCGCTGGCACCAGAGAGGCCTGAGGGCCGTGTGCAATTTTGCCCGAGAGTACAAATGTCTGGCCTTCAAAGTACCCTCATCTGGTGTGCGGTTCTTCGAGCACAGCCGAATCTTTGAGAACTGCTCAGCAGCCCCGGCCATGGACCTAGAGCCATCCGAAGTGCAGCTACAGGCAAAGGTGGGTGAGTCCCTGAGGCTGTACTGCAACACCAGTGCTCCGGCTGTGAGCATCGCCTGGGTCTCCCCGCAGCATGAGCTGCTCCTGGCACCAGGATCCCGTGATGGCAGCATCACAGTGCTGGCGGATGGCAGCTTAGCCATTGGCACTGTGCAGCAGCAGCACGCAGGCATTTTTGTGTGCCTGGGCATTGGGCCCCGCCTGCACCACAACCAGACGCTTGAATACAATGTCAGTGTGCACTTTCCACATCTGGAGCCCGAGGCTTTCAACACTGGCTTCACCACACTGCTGGGCTGTGCTGTGGGCCTGGTGCTTGTGCTGGTCTACCTGTTTGTGCCACCCTGCCATGGCTGCTGCCGCTGCTGCTGCCACCACCAGCTCTGCTGTGGCTGCCGCTGGCCCCAAGCACCCAGCCCACTCCAGGAGCTGAGTGTACAGTCCTCTGTGCTCAGCACTACACCCCCAGATGCACCCAGCCGCAAGGCCAGTGTCCACAAGCACGTGGTCTTCCTAGAGCCCAGCAGGAGGGGCCTCAATGGGCGCGTGCAGCTGGCAGTTGCTGAGGACTTCGATCTCTGCAACCTTTCGGGCCTGCCACTTAAGGCTGGTTCTGAGTCTGCCAGCTCCATAGGCTCAGAGGGGCTCATGATGACCTAG

XM_004834052.1 Coding sequence

Ip6k1 inositol hexakisphosphate kinase 1, transcript variant X1

Length: 1302 bp    Location: 3704646..3648461   Strand: -
>XM_004834052.1
ATGTGTGTTTGTCAAACCATGGAAGTGGGGCAGTATGGCAAGAATGCAGGACGAGCGGGAGACCGAGGAGTCCTCCTGGAGCCCTTCATCCACCAAGTGGGCGGGCACAGCAGCATGATGCGTTACGACGACCACACTGTGTGCAAACCTCTCATCTCCAGAGAGCAGCGCTTCTATGAGTCCCTCCCTCCTGAGATGAAGGAGTTCACCCCTGAATACAAAGGTGTGGTATCTGTCTGTTTTGAGGGGGACAGTGATGGTTATATCAACTTGGTGGCCTACCCTTATGTGGAGAGTGAGACCATGGAACAGGATGATACACCAGAACGGGAGCAACCTCGGCGCAAACATTCCCGCCGGAGCCTGCATCGGTCAGGCAGTGGCAGTGACCACAAGGAGGAGAAAGCTACCTTGTCCCTTGAGACCTCTGAGAGCTCCCAGGAGGCAAAGAGTCTGAAGGTGGAGCTTCATAGCCACTCAGATGTCCCTTTCCAGATGCTAGATGGCAATAGCGGTCTGAGTTCTGAGAAGATCAGCCATAACCCCTGGAGCCTGCGCTGTCACAAGCAGCAGCTGAGCCGCATGCGCTCTGAGTCCAAGGACCGAAAGCTCTACAAATTCCTCCTGCTTGAGAACGTTGTTCACCATTTCAAGTACCCCTGTGTGCTGGACCTGAAGATGGGTACTCGGCAGCATGGGGACGACGCATCAGCTGAGAAGGCTGCCAGGCAGATGAGGAAGTGTGAGCAGAGCACATCTGCCACGCTGGGGGTCAGGGTCTGTGGCATGCAGGTGTACCAGCTGGACACAGGCCATTACCTCTGCAGGAACAAGTACTATGGCCGTGGGCTCTCCATTGAAGGCTTCCGCAATGCCCTCTATCAGTACCTGCACAATGGGCTGGACCTGCGACGTGACCTCTTTGAGCCTATCTTGAGCAAACTTCGAGGCCTCAAAGCTGTGCTGGAGCGGCAGGCCTCCTACCGATTCTATTCCAGTTCTCTGCTTATCATCTATGATGGCAAGGAGTGCTGGTCTGACCTGCGTCTCAAGCACCTGGACATGGGGAACACTGAGGTGGCACCACCCAGTGGCCCCAGCACTAGCCCCAGCGGCATGAACCCTGAGCCGGGCCCCTCCTGTCCACCCAAAGTGGATGTCCGCATGATTGACTTTGCACACAGCACCTTCAAGGGCTTCCGGGATGACCCCACTGTGCACGATGGGCCAGACAGAGGCTATGTGTTTGGCCTGGAGAATCTCATCAGCATCATGGAACAGATGCAGGACGAAAACCAGTAG

XM_004834054.1 Coding sequence

Ip6k1 inositol hexakisphosphate kinase 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 1302 bp    Location: 3679860..3648461   Strand: -
>XM_004834054.1
ATGTGTGTTTGTCAAACCATGGAAGTGGGGCAGTATGGCAAGAATGCAGGACGAGCGGGAGACCGAGGAGTCCTCCTGGAGCCCTTCATCCACCAAGTGGGCGGGCACAGCAGCATGATGCGTTACGACGACCACACTGTGTGCAAACCTCTCATCTCCAGAGAGCAGCGCTTCTATGAGTCCCTCCCTCCTGAGATGAAGGAGTTCACCCCTGAATACAAAGGTGTGGTATCTGTCTGTTTTGAGGGGGACAGTGATGGTTATATCAACTTGGTGGCCTACCCTTATGTGGAGAGTGAGACCATGGAACAGGATGATACACCAGAACGGGAGCAACCTCGGCGCAAACATTCCCGCCGGAGCCTGCATCGGTCAGGCAGTGGCAGTGACCACAAGGAGGAGAAAGCTACCTTGTCCCTTGAGACCTCTGAGAGCTCCCAGGAGGCAAAGAGTCTGAAGGTGGAGCTTCATAGCCACTCAGATGTCCCTTTCCAGATGCTAGATGGCAATAGCGGTCTGAGTTCTGAGAAGATCAGCCATAACCCCTGGAGCCTGCGCTGTCACAAGCAGCAGCTGAGCCGCATGCGCTCTGAGTCCAAGGACCGAAAGCTCTACAAATTCCTCCTGCTTGAGAACGTTGTTCACCATTTCAAGTACCCCTGTGTGCTGGACCTGAAGATGGGTACTCGGCAGCATGGGGACGACGCATCAGCTGAGAAGGCTGCCAGGCAGATGAGGAAGTGTGAGCAGAGCACATCTGCCACGCTGGGGGTCAGGGTCTGTGGCATGCAGGTGTACCAGCTGGACACAGGCCATTACCTCTGCAGGAACAAGTACTATGGCCGTGGGCTCTCCATTGAAGGCTTCCGCAATGCCCTCTATCAGTACCTGCACAATGGGCTGGACCTGCGACGTGACCTCTTTGAGCCTATCTTGAGCAAACTTCGAGGCCTCAAAGCTGTGCTGGAGCGGCAGGCCTCCTACCGATTCTATTCCAGTTCTCTGCTTATCATCTATGATGGCAAGGAGTGCTGGTCTGACCTGCGTCTCAAGCACCTGGACATGGGGAACACTGAGGTGGCACCACCCAGTGGCCCCAGCACTAGCCCCAGCGGCATGAACCCTGAGCCGGGCCCCTCCTGTCCACCCAAAGTGGATGTCCGCATGATTGACTTTGCACACAGCACCTTCAAGGGCTTCCGGGATGACCCCACTGTGCACGATGGGCCAGACAGAGGCTATGTGTTTGGCCTGGAGAATCTCATCAGCATCATGGAACAGATGCAGGACGAAAACCAGTAG

XM_004834057.1 Coding sequence

Uba7 ubiquitin-like modifier activating enzyme 7

High confidence: 4 potential gene matches
Length: 3033 bp    Location: 3729544..3720516   Strand: -
>XM_004834057.1
ATGGCTGTCCTGGAGCCTTCGGAGTGGCTGGACAAGGAGCTGTACTCCAGGCAGCTGCCTGTGCTGGGCCCACCAGCCATGCAGAGAATTAGGGAAGCCAAAGTCCTGCTGTCAGGCCTGCAGGGCCTGGGGGCTGAGGTGGCCAAGAACCTGGTCCTGATGGGTGTGGGCAGCCTCACCTTGCACGATCCCCATCCCACCTGCTGGTCTGACCTGGCTGCTCAGGTTTTTCTCTCAGAGAGAGACTTGGGAAAGAGCAGGGCTGAGGCCTCTCAAGAACACTTGGCTCAACTCAATGAAGCTGTCCAGGTCTTCGTCCACCCCAGTGACATCACTGAGGACCTACTGCTGAAATTCCAGGTGGTGGTGCTGACTGCCTCCAAGCTGGAGGAGCAGTTGATGGTGGGTGCCTTGTGCCACAAACATGGAATCTGCTTTCTAGTGGCTGACACCCGGGGACTCGTGGGGCAGTTGTTCTGTGACTTTGGTGATGAGTTCATAGTGCATGACCCTACAGAGGCGGAACCCCTGACAGCTGCCATCCAGCACATCACCCAGGGCTTCCCTGGTGTCCTCACTCTGAGAGGAGAAGACAAGGAACATTCCTTCTGTGACGGGGACTTGGTGACTTTCTCAGGCATCAAGGGCATGGTTGAGCTCAACAGCTGTTCTCCTCGGCCCATCCGTGTGCAGAAGGATCGGTCCTTGGAGATCGGGGATACATCAACTTTTTCTCCATACTTACATGGTGGGATTGTCACTGAAGTCAAGAGACCTGAGACTGTGAGACATAAGCCCCTGGACAGAGCCCTGATCCAGCCCTGTGTGGTGGCTCCAAGTGCCCAGGAAGCCCACCGTGCCCACTGCCTACATCAAGCCTTCCGTGCACTGCACAAGTTCCAGAACCTCCATGGTCGGCTACCGCAACCCTGGGATCCTGTTGATGCAGAGATCATGGTAACCCTTGCCCAGAACCTGGGACCACTGAAGGGGGCAGAAGAAGAGCCACTGAATGAGGCCCTACTTCGGACAGTTGCCCTGAGTAGTGCTGGTGTCCTGAGCCCCATGGCATCCATTCTGGGAGCAGTGACTGCCCAGGAAGTTCTGAAGGCAATCTCCAGAAAGTTCATACCCCTGGACCAGTGGCTGTACTTTGATGCCCTTGACTGTCTTCCAGAAGATGAGGAACTCTTTCCTAATCCTGAGGACTGCGCCCTGAGAGACTCGCGCTATGATGGGCAAATTGCAGTGTTTGGAGCTGGTTTTCAGGAGACACTGAGTCACCAACACTACCTCCTGGTGGGTGCTGGTGCCATTGGCTGTGAGCTACTCAAAGGCTTTGCCCTAGTGGGCCTGGGAGCTGGAGCCAGTGGAGGTGTGACTGTTGTAGACATGGACCACATAGAGTACTCCAACCTCAGCCGTCAGTTCCTCTTCAGGCCCTGGGACATTGATAAGCCCAAGGCAGAGGTGGCTGCAGCAGCTACCCAGGATCTGAACCCAGACTTAGAGGTGATGGCGCATGTCCAAGTCCTGGATCATACCACAGAACACATCTATGGAGACAACTTCTTCTCCCATGTGGATGGTGTGGTTGCTGCTGTGGACAGCTTCGAGGCCCGGCACTATGTGGCTGCTCGCTGCATCCACTACCTGAAGCCCCTGCTAGAGGCGGGCACACAGGGCACTAAGGGCAGTGCTTCAGTGTTTGTGCCATATGTGACTGAGGTTTACAAAGGCCCTGCCTCAGCTGAAGCTTCTGAGGATGCCCCCACCCCTGTCTGTACCATGCGGCGCTTCCCCAGCACATATGAGCACACCCTGGAGTGGGCTCGGAATGAATTTGAGGGACTCTTCCGACTATCTGCAGAAACCATCAGCTGCTACCAACAGGCATGCACTTCCTTGGCAGATGTGGATGGGCCACAGATGCTGACCTCACTGCAGCGGGTGCTGGGTGTCCTGCGAGTACGCCCACAGACCTGGCGAGACTGTGTCATGTGGGCCCTTGGCCACTGGCAACTATGTTTCCATGATGACATCATACAGCTGCTGAGCCTCCTCCCACCAGATAAAGTGCATGAGGATGGAACTCCGTTCTGGTCAGGTCCTAAACGGTGTCCCCAGCCCCTGAAATTTGACATCAGCCAAGACATGCACCTTCTCTACATACTGGCAGCTGCCAACCTATTTGCCCAGATGCATGGGCTGCCTGGCTCATCAGATCAAATTGCGCTCAGGGAACTGCTGAACTTGCTGCTACAGACTGACCCCCCGCACCCGGCCCCCGTGCTAGCTGAGTCTGGTGAACACCCAGAACCTACTCCCCTGACAGGCCCTGAACAGTTGAAAGAACTGCAGGAAGCCCTGGAAGTCTGGAGCAAGGGCCCTCCCCTGAAGTCCCTGGTGTTTGAGAAGGATGAAGACGGTAACTTCCACATGGACTTTGTGAGAGCAGCAGCTAGCCTGCAATCTCAGAACTATGGGATCTCAGAACCAGTAGACCATGCTCAGAGCATGAGAATGGTGAGCCAGATCATCCCAGCCATTGCCACCACTACAGCAGCGGTGGCAGGCTTGCTGGGCCTAGAGCTGTATAAAATGGTGGGCAGGCCACGACCTGTTGGTGCCTTTCGTCATACCTACCTGCACCTGGCTGAAAACCGCCTTCAACGCTCAGTACCTTCCACCCCAGCCATCCAGAAGTTCCATCACCTGGAGTGGACCCGTTGGGACCGCCTAAAGGTGCCTGCTGGGCAGCCCGAAAGGACACTGGAGTCACTGCTGGCCCATCTGCAGGAACAACATGGGCTGAATGTGAGGATGCTGCTACGTGGTCAAGCCCTGCTCTATTCAGCCCGATGGTCCCCTGAAAGTCAGGCCCAATACCTGCCCCTAAGGGTGACAGAACTGGTTCAGCAGGAGACAGACTGGGTGCCTGAGCCTGGACTGAGGGTGCTAGTGCTGGAGCTGAGCTGTGAGGGTGAGGAGGACAACACCGCCTTCCCACCTCTACACTATGAGCTGTGGTGA

XM_004834058.1 Coding sequence

Traip TRAF interacting protein, transcript variant X1

High confidence: 4 potential gene matches
Length: 1410 bp    Location: 3775256..3750874   Strand: -
>XM_004834058.1
ATGCCTATCCGTGCGCTGTGCACTATTTGTTCCGACTTATTTGACCACTCCCGTGATGTGGCCGCCATTCACTGTGGCCACACTTTCCACCTGCAGTGCCTTATTCAGTGGTTTGAGACAGCACCAAGGCAGACCTGTCCACAATGCCGAATCCAGGTTGGCAAAAGAACTATTATCAATAAACTCTTCTTTGACCTGGCCCAGGAGGAGGAGACTGCCTTGGATGCGGAATTCTTAAAGAATGAACTGGACAATATCAAAGCCCAGCTTTCCCAGAAAGAGAAGGAGAAACGAGACAGCCAGGTTATCATTGACACTCTGCGGGACACACTGGAAGAACGCAACGCCACTGTGGAATCTCTGCAGAATGCCTTAGACAAGGCTGAGATGCTCTGCTCCACACTCAAAAAGCAGATGAAATACTTGGAGCAGCAGCAGGATGAGACTAAACAAGCACAGGAGGAGGCCCGCCGACTTAGAAACAAGATTAAGGCCATGGAACGGATTGAGCTCCTACTCCAGAGCCAGCGGCCTGAGGTGGAAGAAATGATTCGAGACATGGGTGTGGGACAGTCAGCGGTGGAACAGCTGGCTGTGTACTGTATATCTCTCAAGAAAGAATATGAGAATCTGAAAGAGGTGCGGAAGGCCTCAGGGGAGCTGGCTGACAAGTTACGGAAAGACTTGGTCCTCTCCAAAAACAAGTTCCAAACAGTCTGCTCTGAATTGGATCAGACCAAGCTGGAGCTAAAGTCAGCTCAGAAGGACTTGCAGAATGCTGACAAGGAAATCACGAGCCTGAGAAAGAAGCTAACGATGTTACAGGAAACCTTGAACCTGACACCAGTGGCCAATGAGACTGTCAACCGCCTGGTTTTAGAGAGCCCAGCCCCCGTGGAGATGCTAAAACCGAAGCTTCACCGGCCACCCTTCCACAATGCCATTGACCTTGATGCTACCTTTGATGTGAATACCCCTCCAGCCCAGCCCTCTGGTTCCCAGCATGGCCGCTCCAAGAAGCTCTGCTTGGAAAAGGCACACTCTCCTGTTCAAGACATCCACAGGAAGATGCCCAAAGTTTCCACACAGGAGTCCCAGCTCTCTCTGGGTGGCCAGCGCTGTGTAGGAGAGCCAGATGAGGAACTAGCTCGTGCCTTTCCTGTCTTCATCCAAAAGGCAATCCTGGGTCAGAAACAGCCCAAGAGGACCATAGCAGAGTCCTGTCGCAGCACAGATGTGGTAAGAACAGGCTTTGATGGCCTTGGGGGCCGGACAAAATTCATTCAACCTACTGACACAGCCGTGATCCACCCACTGCCAATTAAGCCTAAGGCCAAGACTAAGCAGAGAGTGAGGGTAAAGACTGTGCAGCCTCCCTCTCAGACCAAGCTGGATACCTTCCTGTGGTAA

XM_004834060.1 Coding sequence

Camkv CaM kinase-like vesicle-associated

High confidence: 4 potential gene matches
Length: 1524 bp    Location: 3787840..3775262   Strand: -
>XM_004834060.1
ATGCCGTTTGGGTGTGTGACTCTGGGTGATAAGAAGAACTATAACCAGCCATCGGAGGTGACAGACAGATATGATTTGGGACAGGTCATTAAGACTGAAGAGTTCTGTGAAATCTTCCGTGCCAAGGACAAGACCACAGGCAAGCTGCACACCTGCAAGAAGTTTCAGAAGAGGGATGGCCGCAAGGTGCGGAAGGCAGCAAAGAATGAGATCGGCATCCTCAAAATGGTGAAGCATCCCAATATCTTGCAACTGGTGGATGTGTTTGTAACCCGCAAGGAGTACTTCATCTTCCTGGAGCTGGCCACGGGGAGGGAGGTGTTTGACTGGATCCTGGACCAGGGCTACTACTCGGAGCGAGACACGAGCAACGTGGTGCGGCAGGTCCTGGAGGCTGTGGCCTACTTGCACTCACTCAAGATTGTACACAGGAACCTGAAGCTAGAGAACCTGGTTTACTACAACAGGCTGAAGAATTCGAAGATTGTCATCAGTGACTTCCATTTGGCTAAGCTAGAAAATGGCCTCATCAAGGAGCCCTGTGGGACTCCTGAGTATCTGGCCCCAGAGGTGGTAGGACGGCAACGGTATGGACGTCCTGTGGACTGCTGGGCTATTGGTGTCATCATGTATATTCTGCTTTCAGGCAACCCACCCTTCTATGAGGAGGTGGAAGAAGATGACTATGAAAACCATGATAAGAATCTCTTCCGCAAGATCCTGGCTGGTGACTATGAGTTTGACTCTCCATACTGGGATGATATTTCTCAGGCAGCCAAAGACCTGGTCACAAGGTTGATGGAGGTAGAGCAAGACCAGCGGATTACTGCAGAAGAGGCCATCTCCCATGAATGGATTTCTGGCAATGCTGCTTCTGATAAGAACATCAAGGACGGTGTTTGTGCCCAAATTGAAAAGAACTTTGCCAGGGCCAAGTGGAAGAAAGCTGTCCGAGTGACCACCCTCATGAAACGGCTCCGGGCACCAGAGCAGTCTGGCACAGCTGCCTCTCAGTCTGCCTCAGCCACAGAATCTGCCACCCCCGGGGCTGCAGGTGGGGCCACAGCTGCTACTGGAGCTGTTCCAGCCTCAGGGGGCAGTGTTGCTGTAGCCATAGGGGGAGATGCCGCATGTGCTGCCAAGAGTGATAATGTGGCTTCTGCAGACCATAGTTCCACCCCGGCCACAGATGGCAGCGCCACTCCAGCCACTGATGGCAGCGTCACCCCAGCCACTGATGGCAGCATCACCCCAGCCACTGATGGCAGCGTCACCCCAGCTACTGACAGGAGCACTACTCCAGCCACTGATGGGAGAGCCACACCAGCCACAGAAGAGAGCACAGTGCCCACCACTCAAAGCAGTGCCACACCAGCTGCCAAGGCAGCTACCACCCCTGAACCAACTATGGCTCAGCCAGACAGCACAGCCCTAGAGGGCACCACAGGCCAGGTTCCACCCTCTAGTAAAGGGGAAGAGGCTTCTGGCTATGTCCAGGAGTCTCGGAAGGAGGAGACTAGCTGA

XM_004834068.1 Coding sequence

Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase), transcript variant X8

Length: 3957 bp    Location: 3818847..3796771   Strand: -
>XM_004834068.1
ATGGGCTTTCAGAACCGCCGCTTCACGCTGTTCCCAGCCAAGCCTGCACCCGCGGGATCCCTGAGGGCCTCTGGTTGGTCTCGATGGAGCTCCCCCTGGTCCCTGCTGCTTCTGCTGCTTCTGCGGCTGTCTGCAGTGTCCTCCACAGAGAAGGACTGGCAGTGCCCACGCACACCCTACGCGACCGCCCATGACTTTGACGTGAGGTATGTAGTGCCCCGTTTCTCCGCCGCCGGCCCAGTGCAAGCCGTACTGACTTATGAGGGTGGCCCGGATGGCAATGCTGTGTTTGTGGCCACACGCAATCGCCTGCACGTGCTTGGGCCTGACCTGCAGTTTGTGGAGAGTGTGGCCACCGGCCCTGCCGGAGACCCGAGCTGCCAGACCTGTGTGACCTGTGGACCAGGCCCCCATGGGCCACCAGGTGACACAGACACACTGGTGCTGGTGCTGGAGCCTGGGCTTCCCGCACTCGTCAGCTGTGGCTCTAGCCTGCAGGGCCGCTGCTTCCTGCATGAGCTGGAGCCCCAAGAAACAGCCTTGCACCTGGTGGCACCAGCCTGCCTCTTCTCTGCCCTCGGAAACCTGCCTGAGGACTGCCCTGACTGTGTGGCTAGCCCCCTGGGTACCCGAGTGACTGTGGTTGAGCAGGGCCAGGCCTCTTACTTCTATGTGGCATCCTCATTGAACACCACGGTGGCTGCTAGCTTTAGCCCCCGCTCTGTGTCCATCCGACGCCTCAAGGCTGATGCCTCAGGATTTGAAACAGGCTTTTCAGCACTGTCAGTGCTACCCAAATACCTGGACTCCTACCATATCAAATATGTGCACAGCTTCCACTCAGGAGCCTTTGTCTACTTCCTGACTGTGCAGCCTGCTAGTGTGACAGACACTCCTGGTGCCCTGCAAACACGCCTGGCACGGCTCAATGCTCTGGAGCCGGAGCTAAGTGACTACCGGGAGCTGATCCTCGACTGCTATTTTGCACCCAAACGCCGCCGAAGGACCCCAGAGGGCAGGCAGTCTTACCCAGTGCTTCAGGCAGCCCACTCTGCTTATGTGGGTGCCCAGCTCGCCACTGAACTAAGCATCCCCGAGGGCCGTGAAGTGCTATTTGGAGTCTTTGTGACTGGCAGGGGTGGTGGCCCTGGCATGGGCCCTAACTCTGTAGTCTGTGCCTTCCCCATTGACCTGCTGAACACTCTAATCGATGAGGGTGTGGAACGCTGTTGTGAGTCCCCTGTTATCCCTGGCCTTCGGCGAGGCCTGGACTTCTTCCAGACACCCAGTTTTTGCCCTAACCCGCCAGTCCCGGAGGCCCCTAGCCCCAACATCAGCTGCCACTACTTCCCTCTGCGGGTCAGCAGCAGCTTCCAACGTGTGGACTTATTCAATGGGCTTTTAGGACCAATGCAGATCACTGCACTGTATGTAACACGCCTTGGCAATGTCACAGTGGCCCACATGGGCACAACTGATGGACGTATCCTGCAGGTGGAGCTAGCCAGGTCACTCAACTACCTGCTGTATGTGTCCAACTTCTCATTGGGCAGCAGTAGGCAGCCCATTCAGCGAGATGTCAGTCGCCTCGGGGGCCACTTGTTCTTCGCCTCTGGGGACCAGGTCTTCCAGGTACCTATCCGAGGCCCTGGCTGCCGCCACTTCCTCACCTGTAGGGGTTGCCTTCAAACACAGCGCTTCATGGGCTGTGGCTGGTGTGGGGACATATGTGGCCGACAGGAAGAGTGTCCTGGCTCGTGGCAACAAGATCACTGTCCACCTAAGCTTACTCAGTTCTACCCCCACAGTGGGCCACTAAGGGGCAGCACGAGGCTGACCCTGTGTGGCTCCAACTTCTACCGGCACCCTGATTCTCTGGTACCTGAGGGAACCTATCAGATCACAGTGGGCCAAAGTCCCTGCCAGCTGCTGCCTCAGGATGCCTCAAACCTCAGCCCAGCACCCCAGAAAGACTTCGTAGAGGAGCTTGAGTGTGAGCTGGAGCCCTTGCATGGCCAGACAGCGGGGACTACCAACGTCAGCCTCACTGTGACTAACATGCTACCGGGCAGGCACTTCCGTGTAGATGGCACCTCCATGCTAGGAGGTTTCTCTTTCATGGAGCCAGTGCTGACAGCAGTACGACCCCTCTTTGGCCCACGGGCAGGGGGCACTCGTGTCACCCTTGAAGGCCAGGGCCTGTCTGTCGGCACCAGCCGGGCTGTGCTGATCAATGGAACTCAATGCCAGTTGAAACAGGTCAGCGAGGGGCAGATAGTATGTGCCACACCCCCTGGTGCTTCTACGGCCAGTGTCCCCCTTGGGCTGCAGGTAGGGGGTGCTGAGGTACCCGGTTCCTGGACCTTTCACTACCAGGAAGACCCCATTGTGCTGGGTATCACTCCTAACTGTGGCTACATTGGCTCCCACGTCACCATCCATGGCCAGCATCTGACTTCAGCATGGCACCTACTTCTGTCATTCCATGATGGGCAAAGGGAAGTAGAGAACAGGCAGTGTGATGGGCCACTTCCGGAGCAGCATCGATGCCGTCTGCCTGAATATGTGATCCGAGACCCCCGAGGGTGGGTGATAGGGAATCTGAGTGTCCAGGGAGATGGAGCTGCTGGCTTCACACTGCCCAGCTTTCGCTTCCTACCCCCACCTCGTCCACCCAGTGCAGACCTAGCCCCACTGAAGCCTGAAGAACATGCTGTTAAATTCCAGTACATTGGGCTGGATGCTGTGGCTGACTGTGTGGGTGTGAATGTGACTGTGGATGGGGAGAGCTGCCAGCATGAGCTCCGAGGAGATGTGGTGGTCTGTCCTGTGCCTCCTTCGGTGCAACTCAGCAAGGATGGTGTCCCATTGCAGGTCTGTGTAGATGGTGACTGTCACATCCTGGGCAGAGTGGTGCGGCCAGGCCCAGGGGGCATCCCACAGAACATACTCCTTGTTGTTCTGCTGGGCTTGCTCCTGCTTGTGGTTTTACTGGCTGCTGCACTAGTCTTCAACTACCAGTGGCGGAGGAAGCAACTGGCACTCTCTGCCCTTGATGTTCCACATTCTCCCACTGGTGTCCATGGAGAATCCTTCTCAGGCAGCAAGGAAGGGTCCTGTGTCCCTCTGCTGAGGACAGAATCCATCCGGCTCAGGGACCTGAACTCTGCACTCGTAGCCGAGGTTAAGGACATACTGATTCCTCACGAGCGAGTGATCACTCACAGTGACCAAGTCATTGGCAAAGGCCACTTTGGAGTTGTCTACCACGGGGAATATACAGACAAGGACCAGAATCAAATCCACTGCGCTATCAAGTCACTGAGTCGCATTACAGAGGTGCAAGAGGTGGAGGCCTTCCTTCGAGAGGGACTGCTAATGCGTGGCTTGCACCACCCAAATGTTCTGGCTCTCATTGGGATCATGCTGCCACCTGAGGGACTGCCGCGTGTGCTGCTGCCTTATATGCGCCATGGAGACCTGCTCCATTTCATCCGCTCACCTCAACGGAACCCCACTGTGAAGGACCTCATCAGCTTCGGCCTGCAGGTAGCTCGTGGTATGGAGTACCTGGCAGAACAGAAGTTTGTACACAGGGACCTGGCTGCTAGGAACTGCATGCTAGACGAATCATTCATAGTCAAAGTGGCTGACTTTGGTCTGGCCCGTGACATCCTGGACAAGGATTACTACAGTGTCCGTCAGCAACGCCATGCTTGCCTACCTGTCAAGTGGATGGCACTGGAGAGCCTGCAGACCTACAGATTTACCACCAAGTCTGACGTGTGGTCATTTGGTGTGCTGCTGTGGGAACTGCTAACACGGGGTGCCCCACCATACCCCCATATTGACCCTTTCGACCTCATCTACTTCCTGGCCCAGGGTCGGCGCCTTCCTCAGCCTGAATATTGTCCCAATTCTCTGCACAGCCCAGCTTCAGTGCTGCAGAGGCACTAG

XM_004834065.1 Coding sequence

Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase), transcript variant X5

Length: 4131 bp    Location: 3818847..3802530   Strand: -
>XM_004834065.1
ATGGGCTTTCAGAACCGCCGCTTCACGCTGTTCCCAGCCAAGCCTGCACCCGCGGGATCCCTGAGGGCCTCTGGTTGGTCTCGATGGAGCTCCCCCTGGTCCCTGCTGCTTCTGCTGCTTCTGCGGCTGTCTGCAGTGTCCTCCACAGAGAAGGACTGGCAGTGCCCACGCACACCCTACGCGACCGCCCATGACTTTGACGTGAGGTATGTAGTGCCCCGTTTCTCCGCCGCCGGCCCAGTGCAAGCCGTACTGACTTATGAGGGTGGCCCGGATGGCAATGCTGTGTTTGTGGCCACACGCAATCGCCTGCACGTGCTTGGGCCTGACCTGCAGTTTGTGGAGAGTGTGGCCACCGGCCCTGCCGGAGACCCGAGCTGCCAGACCTGTGTGACCTGTGGACCAGGCCCCCATGGGCCACCAGGTGACACAGACACACTGGTGCTGGTGCTGGAGCCTGGGCTTCCCGCACTCGTCAGCTGTGGCTCTAGCCTGCAGGGCCGCTGCTTCCTGCATGAGCTGGAGCCCCAAGAAACAGCCTTGCACCTGGTGGCACCAGCCTGCCTCTTCTCTGCCCTCGGAAACCTGCCTGAGGACTGCCCTGACTGTGTGGCTAGCCCCCTGGGTACCCGAGTGACTGTGGTTGAGCAGGGCCAGGCCTCTTACTTCTATGTGGCATCCTCATTGAACACCACGGTGGCTGCTAGCTTTAGCCCCCGCTCTGTGTCCATCCGACGCCTCAAGGCTGATGCCTCAGGATTTGAAACAGGCTTTTCAGCACTGTCAGTGCTACCCAAATACCTGGACTCCTACCATATCAAATATGTGCACAGCTTCCACTCAGGAGCCTTTGTCTACTTCCTGACTGTGCAGCCTGCTAGTGTGACAGACACTCCTGGTGCCCTGCAAACACGCCTGGCACGGCTCAATGCTCTGGAGCCGGAGCTAAGTGACTACCGGGAGCTGATCCTCGACTGCTATTTTGCACCCAAACGCCGCCGAAGGACCCCAGAGGGCAGGCAGTCTTACCCAGTGCTTCAGGCAGCCCACTCTGCTTATGTGGGTGCCCAGCTCGCCACTGAACTAAGCATCCCCGAGGGCCGTGAAGTGCTATTTGGAGTCTTTGTGACTGGCAGGGGTGGTGGCCCTGGCATGGGCCCTAACTCTGTAGTCTGTGCCTTCCCCATTGACCTGCTGAACACTCTAATCGATGAGGGTGTGGAACGCTGTTGTGAGTCCCCTGTTATCCCTGGCCTTCGGCGAGGCCTGGACTTCTTCCAGACACCCAGTTTTTGCCCTAACCCGCCAGTCCCGGAGGCCCCTAGCCCCAACATCAGCTGCCACTACTTCCCTCTGCGGGTCAGCAGCAGCTTCCAACGTGTGGACTTATTCAATGGGCTTTTAGGACCAATGCAGATCACTGCACTGTATGTAACACGCCTTGGCAATGTCACAGTGGCCCACATGGGCACAACTGATGGACGTATCCTGCAGGTGGAGCTAGCCAGGTCACTCAACTACCTGCTGTATGTGTCCAACTTCTCATTGGGCAGCAGTAGGCAGCCCATTCAGCGAGATGTCAGTCGCCTCGGGGGCCACTTGTTCTTCGCCTCTGGGGACCAGGTCTTCCAGGTACCTATCCGAGGCCCTGGCTGCCGCCACTTCCTCACCTGTAGGGGTTGCCTTCAAACACAGCGCTTCATGGGCTGTGGCTGGTGTGGGGACATATGTGGCCGACAGGAAGAGTGTCCTGGCTCGTGGCAACAAGATCACTGTCCACCTAAGCTTACTCAGTTCTACCCCCACAGTGGGCCACTAAGGGGCAGCACGAGGCTGACCCTGTGTGGCTCCAACTTCTACCGGCACCCTGATTCTCTGGTACCTGAGGGAACCTATCAGATCACAGTGGGCCAAAGTCCCTGCCAGCTGCTGCCTCAGGATGCCTCAAACCTCAGCCCAGCACCCCAGAAAGACTTCGTAGAGGAGCTTGAGTGTGAGCTGGAGCCCTTGCATGGCCAGACAGCGGGGACTACCAACGTCAGCCTCACTGTGACTAACATGCTACCGGGCAGGCACTTCCGTGTAGATGGCACCTCCATGCTAGGAGGTTTCTCTTTCATGGAGCCAGTGCTGACAGCAGTACGACCCCTCTTTGGCCCACGGGCAGGGGGCACTCGTGTCACCCTTGAAGGCCAGGGCCTGTCTGTCGGCACCAGCCGGGCTGTGCTGATCAATGGAACTCAATGCCAGTTGAAACAGGTCAGCGAGGGGCAGATAGTATGTGCCACACCCCCTGGTGCTTCTACGGCCAGTGTCCCCCTTGGGCTGCAGGTAGGGGGTGCTGAGGTACCCGGTTCCTGGACCTTTCACTACCAGGAAGACCCCATTGTGCTGGGTATCACTCCTAACTGTGGCTACATTGGCTCCCACGTCACCATCCATGGCCAGCATCTGACTTCAGCATGGCACCTACTTCTGTCATTCCATGATGGGCAAAGGGAAGTAGAGAACAGGTGTGATGGGCCACTTCCGGAGCAGCATCGATGCCGTCTGCCTGAATATGTGATCCGAGACCCCCGAGGGTGGGTGATAGGGAATCTGAGTGTCCAGGGAGATGGAGCTGCTGGCTTCACACTGCCCAGCTTTCGCTTCCTACCCCCACCTCGTCCACCCAGTGCAGACCTAGCCCCACTGAAGCCTGAAGAACATGCTGTTAAATTCCAGGTCTGTGTAGATGGTGACTGTCACATCCTGGGCAGAGTGGTGCGGCCAGGCCCAGGGGGCATCCCACAGAACATACTCCTTGTTGTTCTGCTGGGCTTGCTCCTGCTTGTGGTTTTACTGGCTGCTGCACTAGTCTTCAACTACCAGTGGCGGAGGAAGCAACTGGTCCTTTCTCCCAGCCTGGATGAGCTAGCATCCCTGGACCAGACTGCTGGAGCTATGCTCCTGCCTGTGCTCTACTCAGGTTCTGACTACAGAAATGATGTTGCACTCTCTGCCCTTGATGTTCCACATTCTCCCACTGGTGTCCATGGAGAATCCTTCTCAGGCAGCAAGGAAGGGTCCTGTGTCCCTCTGCTGAGGACAGAATCCATCCGGCTCAGGGACCTGAACTCTGCACTCGTAGCCGAGGTTAAGGACATACTGATTCCTCACGAGCGAGTGATCACTCACAGTGACCAAGTCATTGGCAAAGGCCACTTTGGAGTTGTCTACCACGGGGAATATACAGACAAGGACCAGAATCAAATCCACTGCGCTATCAAGTCACTGAGTCGCATTACAGAGGTGCAAGAGGTGGAGGCCTTCCTTCGAGAGGGACTGCTAATGCGTGGCTTGCACCACCCAAATGTTCTGGCTCTCATTGGGATCATGCTGCCACCTGAGGGACTGCCGCGTGTGCTGCTGCCTTATATGCGCCATGGAGACCTGCTCCATTTCATCCGCTCACCTCAACGGAACCCCACTGTGAAGGACCTCATCAGCTTCGGCCTGCAGGTAGCTCGTGGTATGGAGTACCTGGCAGAACAGAAGTTTGTACACAGGGACCTGGCTGCTAGGAACTGCATGCTAGACGAATCATTCATAGTCAAAGTGGCTGACTTTGGTCTGGCCCGTGACATCCTGGACAAGGATTACTACAGTGTCCGTCAGCAACGCCATGCTTGCCTACCTGTCAAGTGGATGGCACTGGAGAGCCTGCAGACCTACAGATTTACCACCAAGTCTGACGTGTGGTCATTTGGTGTGCTGCTGTGGGAACTGCTAACACGGGGTGCCCCACCATACCCCCATATTGACCCTTTCGACCTCATCTACTTCCTGGCCCAGGGTCGGCGCCTTCCTCAGCCTGAATATTGTCCCAATTCTCTGTACCAAGTGATGGAGAGATGCTGGGAGGCAGACCCAGCAGCACGACCCACCTTCAGAGCACTGGTGATAGAAATGGAGCAGGTTGTGGCCTCACTGCTTGGGGAACACTATGTGCAGCTTTCCACAGCCTATGTGAACCTGGGCCCTGGCACCTTGAATGAGGTGAATGTGCTTTCAGAACATCCACGGTCCTCACCTGTGCACAGGAGCATGTCTCGGCCCCGACCCCTCTCAGAGCCACCTCTGCCCACGTGA

XM_004834061.1 Coding sequence

Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase), transcript variant X1

Length: 4278 bp    Location: 3818847..3802530   Strand: -
>XM_004834061.1
ATGGGCTTTCAGAACCGCCGCTTCACGCTGTTCCCAGCCAAGCCTGCACCCGCGGGATCCCTGAGGGCCTCTGGTTGGTCTCGATGGAGCTCCCCCTGGTCCCTGCTGCTTCTGCTGCTTCTGCGGCTGTCTGCAGTGTCCTCCACAGAGAAGGACTGGCAGTGCCCACGCACACCCTACGCGACCGCCCATGACTTTGACGTGAGGTATGTAGTGCCCCGTTTCTCCGCCGCCGGCCCAGTGCAAGCCGTACTGACTTATGAGGGTGGCCCGGATGGCAATGCTGTGTTTGTGGCCACACGCAATCGCCTGCACGTGCTTGGGCCTGACCTGCAGTTTGTGGAGAGTGTGGCCACCGGCCCTGCCGGAGACCCGAGCTGCCAGACCTGTGTGACCTGTGGACCAGGCCCCCATGGGCCACCAGGTGACACAGACACACTGGTGCTGGTGCTGGAGCCTGGGCTTCCCGCACTCGTCAGCTGTGGCTCTAGCCTGCAGGGCCGCTGCTTCCTGCATGAGCTGGAGCCCCAAGAAACAGCCTTGCACCTGGTGGCACCAGCCTGCCTCTTCTCTGCCCTCGGAAACCTGCCTGAGGACTGCCCTGACTGTGTGGCTAGCCCCCTGGGTACCCGAGTGACTGTGGTTGAGCAGGGCCAGGCCTCTTACTTCTATGTGGCATCCTCATTGAACACCACGGTGGCTGCTAGCTTTAGCCCCCGCTCTGTGTCCATCCGACGCCTCAAGGCTGATGCCTCAGGATTTGAAACAGGCTTTTCAGCACTGTCAGTGCTACCCAAATACCTGGACTCCTACCATATCAAATATGTGCACAGCTTCCACTCAGGAGCCTTTGTCTACTTCCTGACTGTGCAGCCTGCTAGTGTGACAGACACTCCTGGTGCCCTGCAAACACGCCTGGCACGGCTCAATGCTCTGGAGCCGGAGCTAAGTGACTACCGGGAGCTGATCCTCGACTGCTATTTTGCACCCAAACGCCGCCGAAGGACCCCAGAGGGCAGGCAGTCTTACCCAGTGCTTCAGGCAGCCCACTCTGCTTATGTGGGTGCCCAGCTCGCCACTGAACTAAGCATCCCCGAGGGCCGTGAAGTGCTATTTGGAGTCTTTGTGACTGGCAGGGGTGGTGGCCCTGGCATGGGCCCTAACTCTGTAGTCTGTGCCTTCCCCATTGACCTGCTGAACACTCTAATCGATGAGGGTGTGGAACGCTGTTGTGAGTCCCCTGTTATCCCTGGCCTTCGGCGAGGCCTGGACTTCTTCCAGACACCCAGTTTTTGCCCTAACCCGCCAGTCCCGGAGGCCCCTAGCCCCAACATCAGCTGCCACTACTTCCCTCTGCGGGTCAGCAGCAGCTTCCAACGTGTGGACTTATTCAATGGGCTTTTAGGACCAATGCAGATCACTGCACTGTATGTAACACGCCTTGGCAATGTCACAGTGGCCCACATGGGCACAACTGATGGACGTATCCTGCAGGTGGAGCTAGCCAGGTCACTCAACTACCTGCTGTATGTGTCCAACTTCTCATTGGGCAGCAGTAGGCAGCCCATTCAGCGAGATGTCAGTCGCCTCGGGGGCCACTTGTTCTTCGCCTCTGGGGACCAGGTCTTCCAGGTACCTATCCGAGGCCCTGGCTGCCGCCACTTCCTCACCTGTAGGGGTTGCCTTCAAACACAGCGCTTCATGGGCTGTGGCTGGTGTGGGGACATATGTGGCCGACAGGAAGAGTGTCCTGGCTCGTGGCAACAAGATCACTGTCCACCTAAGCTTACTCAGTTCTACCCCCACAGTGGGCCACTAAGGGGCAGCACGAGGCTGACCCTGTGTGGCTCCAACTTCTACCGGCACCCTGATTCTCTGGTACCTGAGGGAACCTATCAGATCACAGTGGGCCAAAGTCCCTGCCAGCTGCTGCCTCAGGATGCCTCAAACCTCAGCCCAGCACCCCAGAAAGACTTCGTAGAGGAGCTTGAGTGTGAGCTGGAGCCCTTGCATGGCCAGACAGCGGGGACTACCAACGTCAGCCTCACTGTGACTAACATGCTACCGGGCAGGCACTTCCGTGTAGATGGCACCTCCATGCTAGGAGGTTTCTCTTTCATGGAGCCAGTGCTGACAGCAGTACGACCCCTCTTTGGCCCACGGGCAGGGGGCACTCGTGTCACCCTTGAAGGCCAGGGCCTGTCTGTCGGCACCAGCCGGGCTGTGCTGATCAATGGAACTCAATGCCAGTTGAAACAGGTCAGCGAGGGGCAGATAGTATGTGCCACACCCCCTGGTGCTTCTACGGCCAGTGTCCCCCTTGGGCTGCAGGTAGGGGGTGCTGAGGTACCCGGTTCCTGGACCTTTCACTACCAGGAAGACCCCATTGTGCTGGGTATCACTCCTAACTGTGGCTACATTGGCTCCCACGTCACCATCCATGGCCAGCATCTGACTTCAGCATGGCACCTACTTCTGTCATTCCATGATGGGCAAAGGGAAGTAGAGAACAGGTGTGATGGGCCACTTCCGGAGCAGCATCGATGCCGTCTGCCTGAATATGTGATCCGAGACCCCCGAGGGTGGGTGATAGGGAATCTGAGTGTCCAGGGAGATGGAGCTGCTGGCTTCACACTGCCCAGCTTTCGCTTCCTACCCCCACCTCGTCCACCCAGTGCAGACCTAGCCCCACTGAAGCCTGAAGAACATGCTGTTAAATTCCAGTACATTGGGCTGGATGCTGTGGCTGACTGTGTGGGTGTGAATGTGACTGTGGATGGGGAGAGCTGCCAGCATGAGCTCCGAGGAGATGTGGTGGTCTGTCCTGTGCCTCCTTCGGTGCAACTCAGCAAGGATGGTGTCCCATTGCAGGTCTGTGTAGATGGTGACTGTCACATCCTGGGCAGAGTGGTGCGGCCAGGCCCAGGGGGCATCCCACAGAACATACTCCTTGTTGTTCTGCTGGGCTTGCTCCTGCTTGTGGTTTTACTGGCTGCTGCACTAGTCTTCAACTACCAGTGGCGGAGGAAGCAACTGGTCCTTTCTCCCAGCCTGGATGAGCTAGCATCCCTGGACCAGACTGCTGGAGCTATGCTCCTGCCTGTGCTCTACTCAGGTTCTGACTACAGAAATGATGTTGCACTCTCTGCCCTTGATGTTCCACATTCTCCCACTGGTGTCCATGGAGAATCCTTCTCAGGCAGCAAGGAAGGGTCCTGTGTCCCTCTGCTGAGGACAGAATCCATCCGGCTCAGGGACCTGAACTCTGCACTCGTAGCCGAGGTTAAGGACATACTGATTCCTCACGAGCGAGTGATCACTCACAGTGACCAAGTCATTGGCAAAGGCCACTTTGGAGTTGTCTACCACGGGGAATATACAGACAAGGACCAGAATCAAATCCACTGCGCTATCAAGTCACTGAGTCGCATTACAGAGGTGCAAGAGGTGGAGGCCTTCCTTCGAGAGGGACTGCTAATGCGTGGCTTGCACCACCCAAATGTTCTGGCTCTCATTGGGATCATGCTGCCACCTGAGGGACTGCCGCGTGTGCTGCTGCCTTATATGCGCCATGGAGACCTGCTCCATTTCATCCGCTCACCTCAACGGAACCCCACTGTGAAGGACCTCATCAGCTTCGGCCTGCAGGTAGCTCGTGGTATGGAGTACCTGGCAGAACAGAAGTTTGTACACAGGGACCTGGCTGCTAGGAACTGCATGCTAGACGAATCATTCATAGTCAAAGTGGCTGACTTTGGTCTGGCCCGTGACATCCTGGACAAGGATTACTACAGTGTCCGTCAGCAACGCCATGCTTGCCTACCTGTCAAGTGGATGGCACTGGAGAGCCTGCAGACCTACAGATTTACCACCAAGTCTGACGTGTGGTCATTTGGTGTGCTGCTGTGGGAACTGCTAACACGGGGTGCCCCACCATACCCCCATATTGACCCTTTCGACCTCATCTACTTCCTGGCCCAGGGTCGGCGCCTTCCTCAGCCTGAATATTGTCCCAATTCTCTGTACCAAGTGATGGAGAGATGCTGGGAGGCAGACCCAGCAGCACGACCCACCTTCAGAGCACTGGTGATAGAAATGGAGCAGGTTGTGGCCTCACTGCTTGGGGAACACTATGTGCAGCTTTCCACAGCCTATGTGAACCTGGGCCCTGGCACCTTGAATGAGGTGAATGTGCTTTCAGAACATCCACGGTCCTCACCTGTGCACAGGAGCATGTCTCGGCCCCGACCCCTCTCAGAGCCACCTCTGCCCACGTGA

XM_004834062.1 Coding sequence

Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase), transcript variant X2

Length: 4200 bp    Location: 3818847..3802530   Strand: -
>XM_004834062.1
ATGGGCTTTCAGAACCGCCGCTTCACGCTGTTCCCAGCCAAGCCTGCACCCGCGGGATCCCTGAGGGCCTCTGGTTGGTCTCGATGGAGCTCCCCCTGGTCCCTGCTGCTTCTGCTGCTTCTGCGGCTGTCTGCAGTGTCCTCCACAGAGAAGGACTGGCAGTGCCCACGCACACCCTACGCGACCGCCCATGACTTTGACGTGAGGTATGTAGTGCCCCGTTTCTCCGCCGCCGGCCCAGTGCAAGCCGTACTGACTTATGAGGGTGGCCCGGATGGCAATGCTGTGTTTGTGGCCACACGCAATCGCCTGCACGTGCTTGGGCCTGACCTGCAGTTTGTGGAGAGTGTGGCCACCGGCCCTGCCGGAGACCCGAGCTGCCAGACCTGTGTGACCTGTGGACCAGGCCCCCATGGGCCACCAGGTGACACAGACACACTGGTGCTGGTGCTGGAGCCTGGGCTTCCCGCACTCGTCAGCTGTGGCTCTAGCCTGCAGGGCCGCTGCTTCCTGCATGAGCTGGAGCCCCAAGAAACAGCCTTGCACCTGGTGGCACCAGCCTGCCTCTTCTCTGCCCTCGGAAACCTGCCTGAGGACTGCCCTGACTGTGTGGCTAGCCCCCTGGGTACCCGAGTGACTGTGGTTGAGCAGGGCCAGGCCTCTTACTTCTATGTGGCATCCTCATTGAACACCACGGTGGCTGCTAGCTTTAGCCCCCGCTCTGTGTCCATCCGACGCCTCAAGGCTGATGCCTCAGGATTTGAAACAGGCTTTTCAGCACTGTCAGTGCTACCCAAATACCTGGACTCCTACCATATCAAATATGTGCACAGCTTCCACTCAGGAGCCTTTGTCTACTTCCTGACTGTGCAGCCTGCTAGTGTGACAGACACTCCTGGTGCCCTGCAAACACGCCTGGCACGGCTCAATGCTCTGGAGCCGGAGCTAAGTGACTACCGGGAGCTGATCCTCGACTGCTATTTTGCACCCAAACGCCGCCGAAGGACCCCAGAGGGCAGGCAGTCTTACCCAGTGCTTCAGGCAGCCCACTCTGCTTATGTGGGTGCCCAGCTCGCCACTGAACTAAGCATCCCCGAGGGCCGTGAAGTGCTATTTGGAGTCTTTGTGACTGGCAGGGGTGGTGGCCCTGGCATGGGCCCTAACTCTGTAGTCTGTGCCTTCCCCATTGACCTGCTGAACACTCTAATCGATGAGGGTGTGGAACGCTGTTGTGAGTCCCCTGTTATCCCTGGCCTTCGGCGAGGCCTGGACTTCTTCCAGACACCCAGTTTTTGCCCTAACCCGCCAGTCCCGGAGGCCCCTAGCCCCAACATCAGCTGCCACTACTTCCCTCTGCGGGTCAGCAGCAGCTTCCAACGTGTGGACTTATTCAATGGGCTTTTAGGACCAATGCAGATCACTGCACTGTATGTAACACGCCTTGGCAATGTCACAGTGGCCCACATGGGCACAACTGATGGACGTATCCTGCAGGTGGAGCTAGCCAGGTCACTCAACTACCTGCTGTATGTGTCCAACTTCTCATTGGGCAGCAGTAGGCAGCCCATTCAGCGAGATGTCAGTCGCCTCGGGGGCCACTTGTTCTTCGCCTCTGGGGACCAGGTCTTCCAGGTACCTATCCGAGGCCCTGGCTGCCGCCACTTCCTCACCTGTAGGGGTTGCCTTCAAACACAGCGCTTCATGGGCTGTGGCTGGTGTGGGGACATATGTGGCCGACAGGAAGAGTGTCCTGGCTCGTGGCAACAAGATCACTGTCCACCTAAGCTTACTCAGTTCTACCCCCACAGTGGGCCACTAAGGGGCAGCACGAGGCTGACCCTGTGTGGCTCCAACTTCTACCGGCACCCTGATTCTCTGGTACCTGAGGGAACCTATCAGATCACAGTGGGCCAAAGTCCCTGCCAGCTGCTGCCTCAGGATGCCTCAAACCTCAGCCCAGCACCCCAGAAAGACTTCGTAGAGGAGCTTGAGTGTGAGCTGGAGCCCTTGCATGGCCAGACAGCGGGGACTACCAACGTCAGCCTCACTGTGACTAACATGCTACCGGGCAGGCACTTCCGTGTAGATGGCACCTCCATGCTAGGAGGTTTCTCTTTCATGGAGCCAGTGCTGACAGCAGTACGACCCCTCTTTGGCCCACGGGCAGGGGGCACTCGTGTCACCCTTGAAGGCCAGGGCCTGTCTGTCGGCACCAGCCGGGCTGTGCTGATCAATGGAACTCAATGCCAGTTGAAACAGGTCAGCGAGGGGCAGATAGTATGTGCCACACCCCCTGGTGCTTCTACGGCCAGTGTCCCCCTTGGGCTGCAGGTAGGGGGTGCTGAGGTACCCGGTTCCTGGACCTTTCACTACCAGGAAGACCCCATTGTGCTGGGTATCACTCCTAACTGTGGCTACATTGGCTCCCACGTCACCATCCATGGCCAGCATCTGACTTCAGCATGGCACCTACTTCTGTCATTCCATGATGGGCAAAGGGAAGTAGAGAACAGGTGTGATGGGCCACTTCCGGAGCAGCATCGATGCCGTCTGCCTGAATATGTGATCCGAGACCCCCGAGGGTGGGTGATAGGGAATCTGAGTGTCCAGGGAGATGGAGCTGCTGGCTTCACACTGCCCAGCTTTCGCTTCCTACCCCCACCTCGTCCACCCAGTGCAGACCTAGCCCCACTGAAGCCTGAAGAACATGCTGTTAAATTCCAGTACATTGGGCTGGATGCTGTGGCTGACTGTGTGGGTGTGAATGTGACTGTGGATGGGGAGAGCTGCCAGCATGAGCTCCGAGGAGATGTGGTGGTCTGTCCTGTGCCTCCTTCGGTGCAACTCAGCAAGGATGGTGTCCCATTGCAGGTCTGTGTAGATGGTGACTGTCACATCCTGGGCAGAGTGGTGCGGCCAGGCCCAGGGGGCATCCCACAGAACATACTCCTTGTTGTTCTGCTGGGCTTGCTCCTGCTTGTGGTTTTACTGGCTGCTGCACTAGTCTTCAACTACCAGTGGCGGAGGAAGCAACTGGGTGCTCATGCCCTCTGCCCCACAGCACTCTCTGCCCTTGATGTTCCACATTCTCCCACTGGTGTCCATGGAGAATCCTTCTCAGGCAGCAAGGAAGGGTCCTGTGTCCCTCTGCTGAGGACAGAATCCATCCGGCTCAGGGACCTGAACTCTGCACTCGTAGCCGAGGTTAAGGACATACTGATTCCTCACGAGCGAGTGATCACTCACAGTGACCAAGTCATTGGCAAAGGCCACTTTGGAGTTGTCTACCACGGGGAATATACAGACAAGGACCAGAATCAAATCCACTGCGCTATCAAGTCACTGAGTCGCATTACAGAGGTGCAAGAGGTGGAGGCCTTCCTTCGAGAGGGACTGCTAATGCGTGGCTTGCACCACCCAAATGTTCTGGCTCTCATTGGGATCATGCTGCCACCTGAGGGACTGCCGCGTGTGCTGCTGCCTTATATGCGCCATGGAGACCTGCTCCATTTCATCCGCTCACCTCAACGGAACCCCACTGTGAAGGACCTCATCAGCTTCGGCCTGCAGGTAGCTCGTGGTATGGAGTACCTGGCAGAACAGAAGTTTGTACACAGGGACCTGGCTGCTAGGAACTGCATGCTAGACGAATCATTCATAGTCAAAGTGGCTGACTTTGGTCTGGCCCGTGACATCCTGGACAAGGATTACTACAGTGTCCGTCAGCAACGCCATGCTTGCCTACCTGTCAAGTGGATGGCACTGGAGAGCCTGCAGACCTACAGATTTACCACCAAGTCTGACGTGTGGTCATTTGGTGTGCTGCTGTGGGAACTGCTAACACGGGGTGCCCCACCATACCCCCATATTGACCCTTTCGACCTCATCTACTTCCTGGCCCAGGGTCGGCGCCTTCCTCAGCCTGAATATTGTCCCAATTCTCTGTACCAAGTGATGGAGAGATGCTGGGAGGCAGACCCAGCAGCACGACCCACCTTCAGAGCACTGGTGATAGAAATGGAGCAGGTTGTGGCCTCACTGCTTGGGGAACACTATGTGCAGCTTTCCACAGCCTATGTGAACCTGGGCCCTGGCACCTTGAATGAGGTGAATGTGCTTTCAGAACATCCACGGTCCTCACCTGTGCACAGGAGCATGTCTCGGCCCCGACCCCTCTCAGAGCCACCTCTGCCCACGTGA

XM_004834066.1 Coding sequence

Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase), transcript variant X6

Length: 4050 bp    Location: 3818846..3802530   Strand: -
>XM_004834066.1
ATGGGCTTTCAGAACCGCCGCTTCACGCTGTTCCCAGCCAAGCCTGCACCCGCGGGATCCCTGAGGGCCTCTGGTTGGTCTCGATGGAGCTCCCCCTGGTCCCTGCTGCTTCTGCTGCTTCTGCGGCTGTCTGCAGTGTCCTCCACAGAGAAGGACTGGCAGTGCCCACGCACACCCTACGCGACCGCCCATGACTTTGACGTGAGGTATGTAGTGCCCCGTTTCTCCGCCGCCGGCCCAGTGCAAGCCGTACTGACTTATGAGGGTGGCCCGGATGGCAATGCTGTGTTTGTGGCCACACGCAATCGCCTGCACGTGCTTGGGCCTGACCTGCAGTTTGTGGAGAGTGTGGCCACCGGCCCTGCCGGAGACCCGAGCTGCCAGACCTGTGTGACCTGTGGACCAGGCCCCCATGGGCCACCAGGTGACACAGACACACTGGTGCTGGTGCTGGAGCCTGGGCTTCCCGCACTCGTCAGCTGTGGCTCTAGCCTGCAGGGCCGCTGCTTCCTGCATGAGCTGGAGCCCCAAGAAACAGCCTTGCACCTGGTGGCACCAGCCTGCCTCTTCTCTGCCCTCGGAAACCTGCCTGAGGACTGCCCTGACTGTGTGGCTAGCCCCCTGGGTACCCGAGTGACTGTGGTTGAGCAGGGCCAGGCCTCTTACTTCTATGTGGCATCCTCATTGAACACCACGGTGGCTGCTAGCTTTAGCCCCCGCTCTGTGTCCATCCGACGCCTCAAGGCTGATGCCTCAGGATTTGAAACAGGCTTTTCAGCACTGTCAGTGCTACCCAAATACCTGGACTCCTACCATATCAAATATGTGCACAGCTTCCACTCAGGAGCCTTTGTCTACTTCCTGACTGTGCAGCCTGCTAGTGTGACAGACACTCCTGGTGCCCTGCAAACACGCCTGGCACGGCTCAATGCTCTGGAGCCGGAGCTAAGTGACTACCGGGAGCTGATCCTCGACTGCTATTTTGCACCCAAACGCCGCCGAAGGACCCCAGAGGGCAGGCAGTCTTACCCAGTGCTTCAGGCAGCCCACTCTGCTTATGTGGGTGCCCAGCTCGCCACTGAACTAAGCATCCCCGAGGGCCGTGAAGTGCTATTTGGAGTCTTTGTGACTGGCAGGGGTGGTGGCCCTGGCATGGGCCCTAACTCTGTAGTCTGTGCCTTCCCCATTGACCTGCTGAACACTCTAATCGATGAGGGTGTGGAACGCTGTTGTGAGTCCCCTGTTATCCCTGGCCTTCGGCGAGGCCTGGACTTCTTCCAGACACCCAGTTTTTGCCCTAACCCGCCAGTCCCGGAGGCCCCTAGCCCCAACATCAGCTGCCACTACTTCCCTCTGCGGGTCAGCAGCAGCTTCCAACGTGTGGACTTATTCAATGGGCTTTTAGGACCAATGCAGATCACTGCACTGTATGTAACACGCCTTGGCAATGTCACAGTGGCCCACATGGGCACAACTGATGGACGTATCCTGCAGGTCTTCCAGGTACCTATCCGAGGCCCTGGCTGCCGCCACTTCCTCACCTGTAGGGGTTGCCTTCAAACACAGCGCTTCATGGGCTGTGGCTGGTGTGGGGACATATGTGGCCGACAGGAAGAGTGTCCTGGCTCGTGGCAACAAGATCACTGTCCACCTAAGCTTACTCAGTTCTACCCCCACAGTGGGCCACTAAGGGGCAGCACGAGGCTGACCCTGTGTGGCTCCAACTTCTACCGGCACCCTGATTCTCTGGTACCTGAGGGAACCTATCAGATCACAGTGGGCCAAAGTCCCTGCCAGCTGCTGCCTCAGGATGCCTCAAACCTCAGCCCAGCACCCCAGAAAGACTTCGTAGAGGAGCTTGAGTGTGAGCTGGAGCCCTTGCATGGCCAGACAGCGGGGACTACCAACGTCAGCCTCACTGTGACTAACATGCTACCGGGCAGGCACTTCCGTGTAGATGGCACCTCCATGCTAGGAGGTTTCTCTTTCATGGAGCCAGTGCTGACAGCAGTACGACCCCTCTTTGGCCCACGGGCAGGGGGCACTCGTGTCACCCTTGAAGGCCAGGGCCTGTCTGTCGGCACCAGCCGGGCTGTGCTGATCAATGGAACTCAATGCCAGTTGAAACAGGTCAGCGAGGGGCAGATAGTATGTGCCACACCCCCTGGTGCTTCTACGGCCAGTGTCCCCCTTGGGCTGCAGGTAGGGGGTGCTGAGGTACCCGGTTCCTGGACCTTTCACTACCAGGAAGACCCCATTGTGCTGGGTATCACTCCTAACTGTGGCTACATTGGCTCCCACGTCACCATCCATGGCCAGCATCTGACTTCAGCATGGCACCTACTTCTGTCATTCCATGATGGGCAAAGGGAAGTAGAGAACAGGCAGTGTGATGGGCCACTTCCGGAGCAGCATCGATGCCGTCTGCCTGAATATGTGATCCGAGACCCCCGAGGGTGGGTGATAGGGAATCTGAGTGTCCAGGGAGATGGAGCTGCTGGCTTCACACTGCCCAGCTTTCGCTTCCTACCCCCACCTCGTCCACCCAGTGCAGACCTAGCCCCACTGAAGCCTGAAGAACATGCTGTTAAATTCCAGTACATTGGGCTGGATGCTGTGGCTGACTGTGTGGGTGTGAATGTGACTGTGGATGGGGAGAGCTGCCAGCATGAGCTCCGAGGAGATGTGGTGGTCTGTCCTGTGCCTCCTTCGGTGCAACTCAGCAAGGATGGTGTCCCATTGCAGGTCTGTGTAGATGGTGACTGTCACATCCTGGGCAGAGTGGTGCGGCCAGGCCCAGGGGGCATCCCACAGAACATACTCCTTGTTGTTCTGCTGGGCTTGCTCCTGCTTGTGGTTTTACTGGCTGCTGCACTAGTCTTCAACTACCAGTGGCGGAGGAAGCAACTGGCACTCTCTGCCCTTGATGTTCCACATTCTCCCACTGGTGTCCATGGAGAATCCTTCTCAGGCAGCAAGGAAGGGTCCTGTGTCCCTCTGCTGAGGACAGAATCCATCCGGCTCAGGGACCTGAACTCTGCACTCGTAGCCGAGGTTAAGGACATACTGATTCCTCACGAGCGAGTGATCACTCACAGTGACCAAGTCATTGGCAAAGGCCACTTTGGAGTTGTCTACCACGGGGAATATACAGACAAGGACCAGAATCAAATCCACTGCGCTATCAAGTCACTGAGTCGCATTACAGAGGTGCAAGAGGTGGAGGCCTTCCTTCGAGAGGGACTGCTAATGCGTGGCTTGCACCACCCAAATGTTCTGGCTCTCATTGGGATCATGCTGCCACCTGAGGGACTGCCGCGTGTGCTGCTGCCTTATATGCGCCATGGAGACCTGCTCCATTTCATCCGCTCACCTCAACGGAACCCCACTGTGAAGGACCTCATCAGCTTCGGCCTGCAGGTAGCTCGTGGTATGGAGTACCTGGCAGAACAGAAGTTTGTACACAGGGACCTGGCTGCTAGGAACTGCATGCTAGACGAATCATTCATAGTCAAAGTGGCTGACTTTGGTCTGGCCCGTGACATCCTGGACAAGGATTACTACAGTGTCCGTCAGCAACGCCATGCTTGCCTACCTGTCAAGTGGATGGCACTGGAGAGCCTGCAGACCTACAGATTTACCACCAAGTCTGACGTGTGGTCATTTGGTGTGCTGCTGTGGGAACTGCTAACACGGGGTGCCCCACCATACCCCCATATTGACCCTTTCGACCTCATCTACTTCCTGGCCCAGGGTCGGCGCCTTCCTCAGCCTGAATATTGTCCCAATTCTCTGTACCAAGTGATGGAGAGATGCTGGGAGGCAGACCCAGCAGCACGACCCACCTTCAGAGCACTGGTGATAGAAATGGAGCAGGTTGTGGCCTCACTGCTTGGGGAACACTATGTGCAGCTTTCCACAGCCTATGTGAACCTGGGCCCTGGCACCTTGAATGAGGTGAATGTGCTTTCAGAACATCCACGGTCCTCACCTGTGCACAGGAGCATGTCTCGGCCCCGACCCCTCTCAGAGCCACCTCTGCCCACGTGA

XM_004834067.1 Coding sequence

Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase), transcript variant X7

Length: 3972 bp    Location: 3818846..3802530   Strand: -
>XM_004834067.1
ATGGGCTTTCAGAACCGCCGCTTCACGCTGTTCCCAGCCAAGCCTGCACCCGCGGGATCCCTGAGGGCCTCTGGTTGGTCTCGATGGAGCTCCCCCTGGTCCCTGCTGCTTCTGCTGCTTCTGCGGCTGTCTGCAGTGTCCTCCACAGAGAAGGACTGGCAGTGCCCACGCACACCCTACGCGACCGCCCATGACTTTGACGTGAGGTATGTAGTGCCCCGTTTCTCCGCCGCCGGCCCAGTGCAAGCCGTACTGACTTATGAGGGTGGCCCGGATGGCAATGCTGTGTTTGTGGCCACACGCAATCGCCTGCACGTGCTTGGGCCTGACCTGCAGTTTGTGGAGAGTGTGGCCACCGGCCCTGCCGGAGACCCGAGCTGCCAGACCTGTGTGACCTGTGGACCAGGCCCCCATGGGCCACCAGGTGACACAGACACACTGGTGCTGGTGCTGGAGCCTGGGCTTCCCGCACTCGTCAGCTGTGGCTCTAGCCTGCAGGGCCGCTGCTTCCTGCATGAGCTGGAGCCCCAAGAAACAGCCTTGCACCTGGTGGCACCAGCCTGCCTCTTCTCTGCCCTCGGAAACCTGCCTGAGGACTGCCCTGACTGTGTGGCTAGCCCCCTGGGTACCCGAGTGACTGTGGTTGAGCAGGGCCAGGCCTCTTACTTCTATGTGGCATCCTCATTGAACACCACGGTGGCTGCTAGCTTTAGCCCCCGCTCTGTGTCCATCCGACGCCTCAAGGCTGATGCCTCAGGATTTGAAACAGGCTTTTCAGCACTGTCAGTGCTACCCAAATACCTGGACTCCTACCATATCAAATATGTGCACAGCTTCCACTCAGGAGCCTTTGTCTACTTCCTGACTGTGCAGCCTGCTAGTGTGACAGACACTCCTGGTGCCCTGCAAACACGCCTGGCACGGCTCAATGCTCTGGAGCCGGAGCTAAGTGACTACCGGGAGCTGATCCTCGACTGCTATTTTGCACCCAAACGCCGCCGAAGGACCCCAGAGGGCAGGCAGTCTTACCCAGTGCTTCAGGCAGCCCACTCTGCTTATGTGGGTGCCCAGCTCGCCACTGAACTAAGCATCCCCGAGGGCCGTGAAGTGCTATTTGGAGTCTTTGTGACTGGCAGGGGTGGTGGCCCTGGCATGGGCCCTAACTCTGTAGTCTGTGCCTTCCCCATTGACCTGCTGAACACTCTAATCGATGAGGGTGTGGAACGCTGTTGTGAGTCCCCTGTTATCCCTGGCCTTCGGCGAGGCCTGGACTTCTTCCAGACACCCAGTTTTTGCCCTAACCCGCCAGTCCCGGAGGCCCCTAGCCCCAACATCAGCTGCCACTACTTCCCTCTGCGGGTCAGCAGCAGCTTCCAACGTGTGGACTTATTCAATGGGCTTTTAGGACCAATGCAGATCACTGCACTGTATGTAACACGCCTTGGCAATGTCACAGTGGCCCACATGGGCACAACTGATGGACGTATCCTGCAGGTGGAGCTAGCCAGGTCACTCAACTACCTGCTGTATGTGTCCAACTTCTCATTGGGCAGCAGTAGGCAGCCCATTCAGCGAGATGTCAGTCGCCTCGGGGGCCACTTGTTCTTCGCCTCTGGGGACCAGGTCTTCCAGGTACCTATCCGAGGCCCTGGCTGCCGCCACTTCCTCACCTGTAGGGGTTGCCTTCAAACACAGCGCTTCATGGGCTGTGGCTGGTGTGGGGACATATGTGGCCGACAGGAAGAGTGTCCTGGCTCGTGGCAACAAGATCACTGTCCACCTAAGCTTACTCAGTTCTACCCCCACAGTGGGCCACTAAGGGGCAGCACGAGGCTGACCCTGTGTGGCTCCAACTTCTACCGGCACCCTGATTCTCTGGTACCTGAGGGAACCTATCAGATCACAGTGGGCCAAAGTCCCTGCCAGCTGCTGCCTCAGGATGCCTCAAACCTCAGCCCAGCACCCCAGAAAGACTTCGTAGAGGAGCTTGAGTGTGAGCTGGAGCCCTTGCATGGCCAGACAGCGGGGACTACCAACGTCAGCCTCACTGTGACTAACATGCTACCGGGCAGGCACTTCCGTGTAGATGGCACCTCCATGCTAGGAGGTTTCTCTTTCATGGAGCCAGTGCTGACAGCAGTACGACCCCTCTTTGGCCCACGGGCAGGGGGCACTCGTGTCACCCTTGAAGGCCAGGGCCTGTCTGTCGGCACCAGCCGGGCTGTGCTGATCAATGGAACTCAATGCCAGTTGAAACAGGTCAGCGAGGGGCAGATAGTATGTGCCACACCCCCTGGTGCTTCTACGGCCAGTGTCCCCCTTGGGCTGCAGGTAGGGGGTGCTGAGGTACCCGGTTCCTGGACCTTTCACTACCAGGAAGACCCCATTGTGCTGGGTATCACTCCTAACTGTGGCTACATTGGCTCCCACGTCACCATCCATGGCCAGCATCTGACTTCAGCATGGCACCTACTTCTGTCATTCCATGATGGGCAAAGGGAAGTAGAGAACAGGCAGTGTGATGGGCCACTTCCGGAGCAGCATCGATGCCGTCTGCCTGAATATGTGATCCGAGACCCCCGAGGGTGGGTGATAGGGAATCTGAGTGTCCAGGGAGATGGAGCTGCTGGCTTCACACTGCCCAGCTTTCGCTTCCTACCCCCACCTCGTCCACCCAGTGCAGACCTAGCCCCACTGAAGCCTGAAGAACATGCTGTTAAATTCCAGTACATTGGGCTGGATGCTGTGGCTGACTGTGTGGGTGTGAATGTGACTGTGGATGGGGAGAGCTGCCAGCATGAGCTCCGAGGAGATGTGGTGGTCTGTCCTGTGCCTCCTTCGGTGCAACTCAGCAAGGATGGTGTCCCATTGCAGGTCTGTGTAGATGGTGACTGTCACATCCTGGGCAGAGTGGTGCGGCCAGGCCCAGGGGGCATCCCACAGAACATACTCCTTGTTGTTCTGCTGGGCTTGCTCCTGCTTGTGGTTTTACTGGCTGCTGCACTAGTCTTCAACTACCAGTGGCGGAGGAAGCAACTGGGCCACTTTGGAGTTGTCTACCACGGGGAATATACAGACAAGGACCAGAATCAAATCCACTGCGCTATCAAGTCACTGAGTCGCATTACAGAGGTGCAAGAGGTGGAGGCCTTCCTTCGAGAGGGACTGCTAATGCGTGGCTTGCACCACCCAAATGTTCTGGCTCTCATTGGGATCATGCTGCCACCTGAGGGACTGCCGCGTGTGCTGCTGCCTTATATGCGCCATGGAGACCTGCTCCATTTCATCCGCTCACCTCAACGGAACCCCACTGTGAAGGACCTCATCAGCTTCGGCCTGCAGGTAGCTCGTGGTATGGAGTACCTGGCAGAACAGAAGTTTGTACACAGGGACCTGGCTGCTAGGAACTGCATGCTAGACGAATCATTCATAGTCAAAGTGGCTGACTTTGGTCTGGCCCGTGACATCCTGGACAAGGATTACTACAGTGTCCGTCAGCAACGCCATGCTTGCCTACCTGTCAAGTGGATGGCACTGGAGAGCCTGCAGACCTACAGATTTACCACCAAGTCTGACGTGTGGTCATTTGGTGTGCTGCTGTGGGAACTGCTAACACGGGGTGCCCCACCATACCCCCATATTGACCCTTTCGACCTCATCTACTTCCTGGCCCAGGGTCGGCGCCTTCCTCAGCCTGAATATTGTCCCAATTCTCTGTACCAAGTGATGGAGAGATGCTGGGAGGCAGACCCAGCAGCACGACCCACCTTCAGAGCACTGGTGATAGAAATGGAGCAGGTTGTGGCCTCACTGCTTGGGGAACACTATGTGCAGCTTTCCACAGCCTATGTGAACCTGGGCCCTGGCACCTTGAATGAGGTGAATGTGCTTTCAGAACATCCACGGTCCTCACCTGTGCACAGGAGCATGTCTCGGCCCCGACCCCTCTCAGAGCCACCTCTGCCCACGTGA

XM_004834063.1 Coding sequence

Mst1r macrophage stimulating 1 receptor (c-met-related tyrosine kinase), transcript variant X3

High confidence: 4 potential gene matches
Length: 4179 bp    Location: 3818846..3802530   Strand: -
>XM_004834063.1
ATGGGCTTTCAGAACCGCCGCTTCACGCTGTTCCCAGCCAAGCCTGCACCCGCGGGATCCCTGAGGGCCTCTGGTTGGTCTCGATGGAGCTCCCCCTGGTCCCTGCTGCTTCTGCTGCTTCTGCGGCTGTCTGCAGTGTCCTCCACAGAGAAGGACTGGCAGTGCCCACGCACACCCTACGCGACCGCCCATGACTTTGACGTGAGGTATGTAGTGCCCCGTTTCTCCGCCGCCGGCCCAGTGCAAGCCGTACTGACTTATGAGGGTGGCCCGGATGGCAATGCTGTGTTTGTGGCCACACGCAATCGCCTGCACGTGCTTGGGCCTGACCTGCAGTTTGTGGAGAGTGTGGCCACCGGCCCTGCCGGAGACCCGAGCTGCCAGACCTGTGTGACCTGTGGACCAGGCCCCCATGGGCCACCAGGTGACACAGACACACTGGTGCTGGTGCTGGAGCCTGGGCTTCCCGCACTCGTCAGCTGTGGCTCTAGCCTGCAGGGCCGCTGCTTCCTGCATGAGCTGGAGCCCCAAGAAACAGCCTTGCACCTGGTGGCACCAGCCTGCCTCTTCTCTGCCCTCGGAAACCTGCCTGAGGACTGCCCTGACTGTGTGGCTAGCCCCCTGGGTACCCGAGTGACTGTGGTTGAGCAGGGCCAGGCCTCTTACTTCTATGTGGCATCCTCATTGAACACCACGGTGGCTGCTAGCTTTAGCCCCCGCTCTGTGTCCATCCGACGCCTCAAGGCTGATGCCTCAGGATTTGAAACAGGCTTTTCAGCACTGTCAGTGCTACCCAAATACCTGGACTCCTACCATATCAAATATGTGCACAGCTTCCACTCAGGAGCCTTTGTCTACTTCCTGACTGTGCAGCCTGCTAGTGTGACAGACACTCCTGGTGCCCTGCAAACACGCCTGGCACGGCTCAATGCTCTGGAGCCGGAGCTAAGTGACTACCGGGAGCTGATCCTCGACTGCTATTTTGCACCCAAACGCCGCCGAAGGACCCCAGAGGGCAGGCAGTCTTACCCAGTGCTTCAGGCAGCCCACTCTGCTTATGTGGGTGCCCAGCTCGCCACTGAACTAAGCATCCCCGAGGGCCGTGAAGTGCTATTTGGAGTCTTTGTGACTGGCAGGGGTGGTGGCCCTGGCATGGGCCCTAACTCTGTAGTCTGTGCCTTCCCCATTGACCTGCTGAACACTCTAATCGATGAGGGTGTGGAACGCTGTTGTGAGTCCCCTGTTATCCCTGGCCTTCGGCGAGGCCTGGACTTCTTCCAGACACCCAGTTTTTGCCCTAACCCGCCAGTCCCGGAGGCCCCTAGCCCCAACATCAGCTGCCACTACTTCCCTCTGCGGGTCAGCAGCAGCTTCCAACGTGTGGACTTATTCAATGGGCTTTTAGGACCAATGCAGATCACTGCACTGTATGTAACACGCCTTGGCAATGTCACAGTGGCCCACATGGGCACAACTGATGGACGTATCCTGCAGGTGGAGCTAGCCAGGTCACTCAACTACCTGCTGTATGTGTCCAACTTCTCATTGGGCAGCAGTAGGCAGCCCATTCAGCGAGATGTCAGTCGCCTCGGGGGCCACTTGTTCTTCGCCTCTGGGGACCAGGTCTTCCAGGTACCTATCCGAGGCCCTGGCTGCCGCCACTTCCTCACCTGTAGGGGTTGCCTTCAAACACAGCGCTTCATGGGCTGTGGCTGGTGTGGGGACATATGTGGCCGACAGGAAGAGTGTCCTGGCTCGTGGCAACAAGATCACTGTCCACCTAAGCTTACTCAGTTCTACCCCCACAGTGGGCCACTAAGGGGCAGCACGAGGCTGACCCTGTGTGGCTCCAACTTCTACCGGCACCCTGATTCTCTGGTACCTGAGGGAACCTATCAGATCACAGTGGGCCAAAGTCCCTGCCAGCTGCTGCCTCAGGATGCCTCAAACCTCAGCCCAGCACCCCAGAAAGACTTCGTAGAGGAGCTTGAGTGTGAGCTGGAGCCCTTGCATGGCCAGACAGCGGGGACTACCAACGTCAGCCTCACTGTGACTAACATGCTACCGGGCAGGCACTTCCGTGTAGATGGCACCTCCATGCTAGGAGGTTTCTCTTTCATGGAGCCAGTGCTGACAGCAGTACGACCCCTCTTTGGCCCACGGGCAGGGGGCACTCGTGTCACCCTTGAAGGCCAGGGCCTGTCTGTCGGCACCAGCCGGGCTGTGCTGATCAATGGAACTCAATGCCAGTTGAAACAGGTCAGCGAGGGGCAGATAGTATGTGCCACACCCCCTGGTGCTTCTACGGCCAGTGTCCCCCTTGGGCTGCAGGTAGGGGGTGCTGAGGTACCCGGTTCCTGGACCTTTCACTACCAGGAAGACCCCATTGTGCTGGGTATCACTCCTAACTGTGGCTACATTGGCTCCCACGTCACCATCCATGGCCAGCATCTGACTTCAGCATGGCACCTACTTCTGTCATTCCATGATGGGCAAAGGGAAGTAGAGAACAGGCAGTGTGATGGGCCACTTCCGGAGCAGCATCGATGCCGTCTGCCTGAATATGTGATCCGAGACCCCCGAGGGTGGGTGATAGGGAATCTGAGTGTCCAGGGAGATGGAGCTGCTGGCTTCACACTGCCCAGCTTTCGCTTCCTACCCCCACCTCGTCCACCCAGTGCAGACCTAGCCCCACTGAAGCCTGAAGAACATGCTGTTAAATTCCAGTACATTGGGCTGGATGCTGTGGCTGACTGTGTGGGTGTGAATGTGACTGTGGATGGGGAGAGCTGCCAGCATGAGCTCCGAGGAGATGTGGTGGTCTGTCCTGTGCCTCCTTCGGTGCAACTCAGCAAGGATGGTGTCCCATTGCAGGTCTGTGTAGATGGTGACTGTCACATCCTGGGCAGAGTGGTGCGGCCAGGCCCAGGGGGCATCCCACAGAACATACTCCTTGTTGTTCTGCTGGGCTTGCTCCTGCTTGTGGTTTTACTGGCTGCTGCACTAGTCTTCAACTACCAGTGGCGGAGGAAGCAACTGGCACTCTCTGCCCTTGATGTTCCACATTCTCCCACTGGTGTCCATGGAGAATCCTTCTCAGGCAGCAAGGAAGGGTCCTGTGTCCCTCTGCTGAGGACAGAATCCATCCGGCTCAGGGACCTGAACTCTGCACTCGTAGCCGAGGTTAAGGACATACTGATTCCTCACGAGCGAGTGATCACTCACAGTGACCAAGTCATTGGCAAAGGCCACTTTGGAGTTGTCTACCACGGGGAATATACAGACAAGGACCAGAATCAAATCCACTGCGCTATCAAGTCACTGAGTCGCATTACAGAGGTGCAAGAGGTGGAGGCCTTCCTTCGAGAGGGACTGCTAATGCGTGGCTTGCACCACCCAAATGTTCTGGCTCTCATTGGGATCATGCTGCCACCTGAGGGACTGCCGCGTGTGCTGCTGCCTTATATGCGCCATGGAGACCTGCTCCATTTCATCCGCTCACCTCAACGGAACCCCACTGTGAAGGACCTCATCAGCTTCGGCCTGCAGGTAGCTCGTGGTATGGAGTACCTGGCAGAACAGAAGTTTGTACACAGGGACCTGGCTGCTAGGAACTGCATGCTAGACGAATCATTCATAGTCAAAGTGGCTGACTTTGGTCTGGCCCGTGACATCCTGGACAAGGATTACTACAGTGTCCGTCAGCAACGCCATGCTTGCCTACCTGTCAAGTGGATGGCACTGGAGAGCCTGCAGACCTACAGATTTACCACCAAGTCTGACGTGTGGTCATTTGGTGTGCTGCTGTGGGAACTGCTAACACGGGGTGCCCCACCATACCCCCATATTGACCCTTTCGACCTCATCTACTTCCTGGCCCAGGGTCGGCGCCTTCCTCAGCCTGAATATTGTCCCAATTCTCTGTACCAAGTGATGGAGAGATGCTGGGAGGCAGACCCAGCAGCACGACCCACCTTCAGAGCACTGGTGATAGAAATGGAGCAGGTTGTGGCCTCACTGCTTGGGGAACACTATGTGCAGCTTTCCACAGCCTATGTGAACCTGGGCCCTGGCACCTTGAATGAGGTGAATGTGCTTTCAGAACATCCACGGTCCTCACCTGTGCACAGGAGCATGTCTCGGCCCCGACCCCTCTCAGAGCCACCTCTGCCCACGTGA

XM_004834069.1 Coding sequence

Mon1a MON1 homolog A (yeast), transcript variant X1

Length: 1668 bp    Location: 3833510..3821859   Strand: -
>XM_004834069.1
ATGGCTGCTGATGTGCAGAGGAAGAGAAGCAGTGACTGCCCTGATGGCACGTTGGCTCCTTCTGATGAACTGAGTGTGGAGAGAGCCGAGAGCCCCACGCCAGGACTGGCCCAGGGGATGGAGCCAGGTGCCGGGCAAGAAGGTGCCATGTTCGTCCATGCCCGTTCCTATGAAGACCTAACTGAGTCAGAGGATGGGCCAGCTTCTGGGGATAGCCCCAAGGAGGGTTCTGGGGGTCGCCCACCACTGCCTACAGACATGCGCCAGATCAGCCAGGACTTCAGTGAGCTAAGTACCCAGCTGACAGGAATGGCCCGTGACCTACAGGAGGAAATGCTACCTGGAAGCTCTGAGGACTGGCTCGGGCCCCCTGGGGCAGCCAGTCGGCCAGCTACAGAACCCCCAGGGGAGGGCCCAGAGGAGGGGGATGAGAAGGACCCCACAGAGGCATGGCGCCTGCACCAGAAGCATGTCTTTGTGCTGAGTGAGGCAGGGAAGCCTGTATACTCCCGTCATGGGTCTGAAGAAGCACTTTCCAGCACCATGGGCGTCATGGTGGCCCTGGTTTCCTTCCTGGAGGCAGACAAGAATGCCATCCGCTCCATCCATGCAGATGGCTACAAGGTGGTATTTGTGCGCCGGAGCCCGCTGGTACTGGTGGCAGTGGCACGCACACGACAGTCGGCACAGGAGCTAGCTCAGGAGCTGCTCTACATCTACTACCAGATCCTGAGCCTTCTCACTGGTGCACAGCTGAGCCACATCTTTCAGCAGAAGCAGAATTACGACCTACGGCGCCTACTTTCAGGCTCAGAGCGCATCACTGACAACCTGCTGCAGCTCATGGCGCGAGACCCCAGCTTTCTGATGGGGGCTGCAAGGTGTCTGCCCCTGGCTGCAGCTGTGCGGGACGCTGTGAGCGCCAGCCTGCAGCAGGCACGTGCGCGCAGCCTGGTCTTCTCCATCTTACTGGCTCACAACCAGCTTGTAGCACTTGTGCGCCGCAAGGACCAATTCCTGCATCCCATTGACCTGCACCTGCTCTTCAACCTCATCAGTTCCTCCTCATCCTTCCGTGAGGGTGAGGCGTGGACACCTGTATGCCTGCCTAAATTCAACTCGGCAGGCTTCTTCCATGCACACATCTCATACCTGGAGCCTGACACTGACCTCTGCCTGCTGCTGGTCTCCACTGATCGTGAGGACTTCTTTGTGGTCTCTGACTGCCGCAGGCGCTTCCAGGAGCGCCTTCGTAAGCGTGGAGCCCACCTGGCGCTGCGAGAGGCACTGCGCACACCCTACTACAGCGTTGCCCAAGTGGGTATCCCTAACCTGCGCCACTTCCTCTATAAGTCCAAGAGCTCAGGACTCTTCACCAGTCCTGAGATTGAGGCCCCATACACCAGTGAAGAGGAGCAGGAGCGGCTACTAGGGCTTTACCAGTACCTGCACAGCCGAGCCCACAATGCTTCCCGCCCACTCAAGACCATCTACTACACAGGCCCCAACGAGAACCTCCTAGCCTGGGTGACAGGCGCCTTTGAGCTCTACATGTGCTACAGCCCTCTGGGGACTAAGGCATCAGCTGTCAGTGCCATCCATAAGCTGATGCGCTGGATCCGTAAGGAAGAAGACCGCCTCTTCATCCTCACACCCCTCACCTACTGA

XM_004834071.1 Coding sequence

Mon1a MON1 homolog A (yeast), transcript variant X3

High confidence: 4 potential gene matches
Length: 1668 bp    Location: 3833498..3821859   Strand: -
>XM_004834071.1
ATGGCTGCTGATGTGCAGAGGAAGAGAAGCAGTGACTGCCCTGATGGCACGTTGGCTCCTTCTGATGAACTGAGTGTGGAGAGAGCCGAGAGCCCCACGCCAGGACTGGCCCAGGGGATGGAGCCAGGTGCCGGGCAAGAAGGTGCCATGTTCGTCCATGCCCGTTCCTATGAAGACCTAACTGAGTCAGAGGATGGGCCAGCTTCTGGGGATAGCCCCAAGGAGGGTTCTGGGGGTCGCCCACCACTGCCTACAGACATGCGCCAGATCAGCCAGGACTTCAGTGAGCTAAGTACCCAGCTGACAGGAATGGCCCGTGACCTACAGGAGGAAATGCTACCTGGAAGCTCTGAGGACTGGCTCGGGCCCCCTGGGGCAGCCAGTCGGCCAGCTACAGAACCCCCAGGGGAGGGCCCAGAGGAGGGGGATGAGAAGGACCCCACAGAGGCATGGCGCCTGCACCAGAAGCATGTCTTTGTGCTGAGTGAGGCAGGGAAGCCTGTATACTCCCGTCATGGGTCTGAAGAAGCACTTTCCAGCACCATGGGCGTCATGGTGGCCCTGGTTTCCTTCCTGGAGGCAGACAAGAATGCCATCCGCTCCATCCATGCAGATGGCTACAAGGTGGTATTTGTGCGCCGGAGCCCGCTGGTACTGGTGGCAGTGGCACGCACACGACAGTCGGCACAGGAGCTAGCTCAGGAGCTGCTCTACATCTACTACCAGATCCTGAGCCTTCTCACTGGTGCACAGCTGAGCCACATCTTTCAGCAGAAGCAGAATTACGACCTACGGCGCCTACTTTCAGGCTCAGAGCGCATCACTGACAACCTGCTGCAGCTCATGGCGCGAGACCCCAGCTTTCTGATGGGGGCTGCAAGGTGTCTGCCCCTGGCTGCAGCTGTGCGGGACGCTGTGAGCGCCAGCCTGCAGCAGGCACGTGCGCGCAGCCTGGTCTTCTCCATCTTACTGGCTCACAACCAGCTTGTAGCACTTGTGCGCCGCAAGGACCAATTCCTGCATCCCATTGACCTGCACCTGCTCTTCAACCTCATCAGTTCCTCCTCATCCTTCCGTGAGGGTGAGGCGTGGACACCTGTATGCCTGCCTAAATTCAACTCGGCAGGCTTCTTCCATGCACACATCTCATACCTGGAGCCTGACACTGACCTCTGCCTGCTGCTGGTCTCCACTGATCGTGAGGACTTCTTTGTGGTCTCTGACTGCCGCAGGCGCTTCCAGGAGCGCCTTCGTAAGCGTGGAGCCCACCTGGCGCTGCGAGAGGCACTGCGCACACCCTACTACAGCGTTGCCCAAGTGGGTATCCCTAACCTGCGCCACTTCCTCTATAAGTCCAAGAGCTCAGGACTCTTCACCAGTCCTGAGATTGAGGCCCCATACACCAGTGAAGAGGAGCAGGAGCGGCTACTAGGGCTTTACCAGTACCTGCACAGCCGAGCCCACAATGCTTCCCGCCCACTCAAGACCATCTACTACACAGGCCCCAACGAGAACCTCCTAGCCTGGGTGACAGGCGCCTTTGAGCTCTACATGTGCTACAGCCCTCTGGGGACTAAGGCATCAGCTGTCAGTGCCATCCATAAGCTGATGCGCTGGATCCGTAAGGAAGAAGACCGCCTCTTCATCCTCACACCCCTCACCTACTGA

XM_004834072.1 Coding sequence

Rbm6 RNA binding motif protein 6

High confidence: 4 potential gene matches
Length: 3360 bp    Location: 3840457..3951614   Strand: +
>XM_004834072.1
ATGTGGGGGGATTCTCGGTCTGGTAACAGAACAGGACCTTTTCGTGGGAGCCAAGAAGAGAGGTTTGCTCCCGGGTGGAACAGGGATTATCCTCCTCCTCCCCTTAAGAGTCATGCTCAAGAGAGACACTCTGGCAACTTTCCTGGCAGAGATTCACTTCCCTTTGATTTCCAGGGGCATTCGGGGCCTCCTTTTGCAAATGTAGAGGAGCATTCTTTCAGCTATGGAGCTAGAGATGGACCGCATGGCGACTATCGAGGAGGGGAGGGACCAGGACATGATTTCAGCGGGGGACATTTTTCATCTACTGATTTCCAGAGCAGAGATTCTTCACAGTTGGACTTCAGGGGTAGGGACATACATTCTGGGGATTTTCGGGATAGAGAAGGACCACCTATGGACTATAGGGGAGAGGATGGTACTTCTATGGATTTTAGAGGAAGGGAGACACCTCATATGAACTACAGGGACAGGGATACTCACACTGTTGACTTCACAGGTAGAGATCCTCCATCTGACTTTAGGGGCCAGGGCACTTACGATTTAGATTTTAGAGGCCAGGATGGATCCCATGCAGATTTTAGAGGAAGAGATTTATCAGATTTGGATTTCAGGACCAGAGATCAGTCCCGTTCTGATTTTAGGAATAGAGATGTATCGGATTTGGACTTTAGGGATAAAGACGGAACACAGGTGGACTTCAGAGCCCGAGGTTCAGGAACTACTGATCTAGACTTTAGGGACAGGGATACACCACATTCAGACTTCAGAGGTAGACACCGGTCCAGGACTGATCAGGATTTTAGGGGCAGAGATATGGGACCTTGTGTGGAATTTAAAGACAGGGAGATGCCTCCTGTGGATCCAAAACTTTTGGATTACCTTCAGCCCTCTACACAAGATAGAGAACATTCTTGTATGAACGTGAACAAGAGAGAAGAATCCAAATATGACCATACTGCAGAAAGACCTAGTTTTGGCATTCAGAAGGGAGAATTTGAGCATTCAGAAACAAGAGAAGGAGAAACACAAGGTGTTGCCTTTGAACATGAGCTTCCATCAGATTTTCAAAAGAGCCAAAGTCCAATTCAAGACCAAGACAAGTCACAGCTTTCTGGAGCTGAGCAACAGAGTTCAGATGCTGGCCTGTTTAAACAAAAGGGTGACCTGGACTTTCTTGGCCAACAAGACACGGATTATAGAAGCATGGAGTATCGTGATGTGGATCACAGGTTGCCTGGAAGCCAGATCTTTGGCTATGGGCAGAACAAGACTTTTCTGGAAGGCAAAACTGCCCGAGACGCCCAACGGGACCTTCAGGATCAAGATTATAGGACTGGCCCAAGTGAGGAGAAACCTAGCAGGCTTATTCGTTTAAGTGGGGTGCCTGAAAATGCCACAAAAGAAGAGATTCTTAATGCCTTTCGGACTGCCAATGGAATGCCTGTAAGGGAGTTGCAGTTGAAGGAGTATAACACAGGTTACGACTATGGCTATGTCTGCGTGGAGTTTTCACTCTTGGAAGATGCCATCGGATGCATGGAGGCCAACCAGGGAACTGTAATGATCCATGACAAAGAAATCACTCTCGAGTATGTACCAAACTTGGATTTTTGGTACTGCAAAAGATGTAAGGCTAGCACTGGTGGGCATCGATCTTCATGTTCATTCTGCAAGTGTCCAAAGGAAGAGGCCAAGCAAGAATTAATAACCTACCCTCAGCCTCAGAAAACATCAATACCAGCATCTTTGGAAAAACAACCCAGCCAGTCCTCAAGGCCAGCTGAAAAAGAATCTGAATCTAGAAAACAGGAAGAAGGACAAGAACCACGCTTGGGACATCAAAAGAAAGAAGCAGAAAGATATCTGCCTCATTCTCGAAGGGAAGGGCTTGCTTTCCGAAGAGACCGAGAGAAGGAGTCATGGTCTGGAGAGATGCGCCAGGATGGAGAGAGCAAAACAATCATGCTAAAACGCATTTATCGTTCCACTCCACCTGAGGTGATAGTGGAAGTGCTGGAGCCCTATGTCCACCTTACTACTGCCAATGTTCGTATCATCAAGAACAGAACTGGCCCCATGGGCCACACCTATGGCTTTATAGACCTTGACTCCCATGCGGAAGCTCTTCGTGTAGTGAAGATTTTGCAGAACCTTGATCCACCGTTTAGCATTGATGGGAAGATGGTAGCCGTAAACCTGGCCACTGGAAAACGAAGAAATGATTCTGGAGACCATTCTGACCATATGCATTACTACCAGGGTAAAAAATATTTCCGAGATAGAAGAGGAGGTGGCAGAAATTCAGACTGGTCTTCTGACACAAATCGACAAGGACAACAGTCATCATCTGACTGCTACATATATGATTCTGCTACTGGCTACTATTATGACCCCTTGGCAGGAACTTACTATGACCCCAACACTCAGCAAGAAGTCTATGTACCCCAGGACCCTGGGTCACCTGAGGAAGAAGAGATCAAGGAAAAGAAACCTACCAGTCAGGGAAAGTCAAGTAGCAAAAAAGAAATGCCTAAGAGAGATAGCAAGGAGAAAAAAGATAGAGCAGTGACAAAGTTTCAGGAAGTTGCCAGTGAGGGGACGAGCCCCCCGGAGGATGTCTTTAAGAAGCCCCTGCCTCCTACTGTGAAGAAGGAAGAGAGTCCTCCTCCTCCGAAGGTGGTAAACCCACTGATTGGCCTCCTGGGTGAATATGGAGGAGACAGTGACTATGAAGAAGAGGAGGAGGAGCAGACTGCTCCACTACAGCCCCGCACAACCCAGCCCCAGCAGCGGGAGGAGCTGACTAAGAAGGAGAATGAAGAAGACAAACTCACTGACTGGAATAAACTGGCTTGTCTGCTCTGCAGAAGGCAGTTTCCCAACAAAGAAGTTCTAATCAAACACCAACAACTATCAGACCTGCACAAGCAAAACCTGGAAATCCACCGGAAGATAAAACAGTCTGAGCAGGAGCTAGCCTATCTGGAGAGGAGAGAACGAGAGGGAAGGTTTAAAGAAAGAGGAAATGATCGCAAGGAAAAGCTCCAATCTTTTGACTGTCCGGAAAGGAAACGCATTAAATACTCCAGGGAAACTGACAGTGATCGTAAGCCTGTTGATAAAGAAGACATCAACACTAGCAGCAAAGGAGGCTGTGTCCAGCAGCCCACTGGCTGGAGAAAAGGGGCAGGCTTGGGATTTGGCCATCCTGGATTGGGTTCATCAGAGGAGACTGAAGGCCGGATGAGGGGGCCTGGTGTTGGACTCCCGGGAAGAACCAGCAAGAGACAGTCCAATGAGACTTACCGAGACGCTGTTCGAAGAGTCATGTTTGCTCGGTATAAAGAACTTGATTAA

XM_004834077.1 Coding sequence

Rbm5 RNA binding motif protein 5, transcript variant X5

High confidence: 4 potential gene matches
Length: 2451 bp    Location: 3969458..4000588   Strand: +
>XM_004834077.1
ATGGGTTCAGACAAGCGAGTGAGTAGAACAGAGCGTAGTGGAAGATACGGTTCCATCATAGACAGGGATGACCGTGATGAAAGAGAATCTAGAAGCAGACGGAGGGACTCTGATTACAAAAGATCTAGTGATGATCGAAGGGGTGATAGATACGATGACTACCGAGACTATGATAGTCCAGAGAGAGAGCGTGAAAGAAGGAACAGTGACCGATCTGAAGATGGCTACCATTCAGATGGTGACTATGGTGAACATGACTATAGGCATGACATCAGCGATGAGAGAGAGAGCAAGACCATCATGCTGCGCGGCCTTCCCATCACCATCACAGAGAGCGATATTCGAGAAATGATGGAGTCCTTTGAAGGCCCTCAGCCTGCAGATGTGAGGCTGATGAAGAGGAAAACAGGTGTAAGCCGTGGTTTCGCCTTCGTGGAGTTTTATCACTTGCAAGATGCTACCAGCTGGATGGAAGCCAATCAGAAAAAGTTGGTGATTCAAGGAAAGCACATTGCAATGCATTATAGCAATCCCAGACCTAAGTTTGAAGATTGGCTTTGTAATAAGTGCTGCCTGAACAATTTCAGGAAAAGACTGAAATGCTTCCGATGTGGAGCAGACAAGTTTGATTCTGAACAGGAAGTGCCCCCTGGAACCACAGAGTCAGTTCAGTCTGTAGATTACTACTGTGATACAATCATTCTTCGGAACATAGCTCCACATACTGTAGTGGATTCCATAATGACAGCACTATCTCCCTACGCATCCTTAGCTGTCAATAATATTCGTCTCATAAAAGACAAGCAAACCCAGCAGAACAGAGGCTTCGCATTTGTGCAGTTGTCTTCTGCAATGGATGCGTCTCAGCTGCTTCAGATATTACAGAGTCTCCATCCTCCTTTGAAAATTGATGGGAAAACTATTGGGGTTGATTTTGCAAAAAGTGCTAGAAAAGACTTGGTCCTCCCAGATGGCAACCGTGTCAGCGCCTTCTCTGTGGCTAGTACAGCCATTGCTGCTGCTCAGTGGTCGTCTACCCAGTCTCAAAGTGGTGAAGGAGGCAGTGTTGACTACAGTTACTTACAGCCAGGCCAAGATGGTTATGCGCAGTATGCACAGTACTCACAGGATTACCAGCAGTTTTATCAGCAACAAGCTGGAGGATTGGAATCTGATGTATCGTCTGTATCAGGTAGTAAATTGACCACCACCTCAGCAGCTGTAGTGTCCCAGAGTCCCCAGCTGTATAATCAGACCTCCAATCCACCTGGCTCTCCGACTGAGGAAGCACAGCCTAGCACTAGCACAAGTACACAGGCCCCAGCTGCTTCCCCCACTGGTGTAGTTCCTGGTACCAAATATGCGGTACCAGACACATCCACTTACCAGTATGATGAATCTTCAGGATATTATTATGATCCAACAACAGGGCTCTATTATGACCCCAACTCACAATACTACTATAATTCCTTAACACAGCAGTATCTTTATTGGGATGGAGAGAAGGAGACCTATGTGCCAGCTGCAGAGTCCAGTTCCCACCAGCAGACGGGCCTGCCTCCTGCAAAAGAGGGGAAAGAAAAGAAGGAAAAACCCAAGAGCAAAACAGCTCAGCAGATCGCCAAAGACATGGAACGCTGGGCTAAGAGTTTAAACAAGCAGAAAGAAAATTTTAAAAACAGCTTTCAACCTGTCAATTCATTGAGGGAAGAGGAAAGGAGAGAATCTGCTGCAGCAGATGCTGGCTTTGCTCTCTTTGAGAAAAAGGGAGCCTTAGCAGAAAGGCAGCAGCAGCTCATCCCAGAACTGGTGCGAAATGGAGATGAGGAGAATCCCCTCAAAAGAGGTCTGGTTGCTGCATATAGTGGTGACAGTGACAATGAAGAAGATCTGGTAGAGAGACTTGAGAGTGAAGAAGAGAAGCTTGCTGACTGGAAGAAGATGGCCTGTCTGCTCTGCCGTCGCCAGTTCCCAAACAGAGATGCCCTGATCAGGCACCAGCAGCTCTCTGACTTACACAAGCAAAACATGGACATATACCGACGATCCAGGCTGAGCGAGCAGGAGCTGGAAGCCTTGGAGCTGAGGGAGAGAGAGATGAAATACCGAGATAGAGCTGCAGAAAGACGAGAGAAGTATGGCATTCCAGAACCTCCAGAGCCCAAGCGCAAGAAGCAGTTTGATGCCGGCACTGTGAATTACGAGCAGCCTACCAAAGATGGCATTGACCACAGTAACATCGGCAACAAGATGCTGCAAGCCATGGGCTGGCGGGAAGGCTCAGGCTTGGGAAGAAAGTGTCAAGGTATCACAGCTCCCATTGAGGCCCAAGTCCGGCTGAAAGGAGCTGGCCTCGGAGCCAAAGGCAGTGCATACGGGTTGTCAGGTGCCGATTCCTACAAAGATGCTGTTCGGAAAGCCATGTTTGCTCGGTTTACTGAGATGGAGTGA

XM_004834074.1 Coding sequence

Rbm5 RNA binding motif protein 5, transcript variant X2

Length: 2445 bp    Location: 3969458..4000588   Strand: +
>XM_004834074.1
ATGGGTTCAGACAAGCGAGTGAGTAGAACAGAGCGTAGTGGAAGATACGGTTCCATCATAGACAGGGATGACCGTGATGAAAGAGAATCTAGAAGCAGACGGAGGGACTCTGATTACAAAAGATCTAGTGATGATCGAAGGGGTGATAGATACGATGACTACCGAGACTATGATAGTCCAGAGAGAGAGCGTGAAAGAAGGAACAGTGACCGATCTGAAGATGGCTACCATTCAGATGGTGACTATGGTGAACATGACTATAGGCATGACATCAGCGATGAGAGAGAGAGCAAGACCATCATGCTGCGCGGCCTTCCCATCACCATCACAGAGAGCGATATTCGAGAAATGATGGAGTCCTTTGAAGGCCCTCAGCCTGCAGATGTGAGGCTGATGAAGAGGAAAACAGGTGTAAGCCGTGGTTTCGCCTTCGTGGAGTTTTATCACTTGCAAGATGCTACCAGCTGGATGGAAGCCAATCAGAAAAAGTTGGTGATTCAAGGAAAGCACATTGCAATGCATTATAGCAATCCCAGACCTAAGTTTGAAGATTGGCTTTGTAATAAGTGCTGCCTGAACAATTTCAGGAAAAGACTGAAATGCTTCCGATGTGGAGCAGACAAGTTTGATTCTGAACAGGAAGTGCCCCCTGGAACCACAGAGTCAGTTCAGTCTGTAGATTACTACTGTGATACAATCATTCTTCGGAACATAGCTCCACATACTGTAGTGGATTCCATAATGACAGCACTATCTCCCTACGCATCCTTAGCTGTCAATAATATTCGTCTCATAAAAGACAAGCAAACCCAGCAGAACAGAGGCTTCGCATTTGTGCAGTTGTCTTCTGCAATGGATGCGTCTCAGCTGCTTCAGATATTACAGAGTCTCCATCCTCCTTTGAAAATTGATGGGAAAACTATTGGGGTTGATTTTGCAAAAAGTGCTAGAAAAGACTTGGTCCTCCCAGATGGCAACCGTGTCAGCGCCTTCTCTGTGGCTAGTACAGCCATTGCTGCTGCTCAGTGGTCGTCTACCCAGTCTCAAAGTGGTGAAGGAGGCAGTGTTGACTACAGTTACTTACAGCCAGGCCAAGATGGTTATGCGCAGTATGCACAGTACTCACAGGATTACCAGCAGTTTTATCAGCAACAAGCTGGAGGATTGGAATCTGATGTATCGTCTGTATCAGGTATGACCACCACCTCAGCAGCTGTAGTGTCCCAGAGTCCCCAGCTGTATAATCAGACCTCCAATCCACCTGGCTCTCCGACTGAGGAAGCACAGCCTAGCACTAGCACAAGTACACAGGCCCCAGCTGCTTCCCCCACTGGTGTAGTTCCTGGTACCAAATATGCGGTACCAGACACATCCACTTACCAGTATGATGAATCTTCAGGATATTATTATGATCCAACAACAGGGCTCTATTATGACCCCAACTCACAATACTACTATAATTCCTTAACACAGCAGTATCTTTATTGGGATGGAGAGAAGGAGACCTATGTGCCAGCTGCAGAGTCCAGTTCCCACCAGCAGACGGGCCTGCCTCCTGCAAAAGAGGGGAAAGAAAAGAAGGAAAAACCCAAGAGCAAAACAGCTCAGCAGATCGCCAAAGACATGGAACGCTGGGCTAAGAGTTTAAACAAGCAGAAAGAAAATTTTAAAAACAGCTTTCAACCTGTCAATTCATTGAGGGAAGAGGAAAGGAGAGAATCTGCTGCAGCAGATGCTGGCTTTGCTCTCTTTGAGAAAAAGGGAGCCTTAGCAGAAAGGCAGCAGCAGCTCATCCCAGAACTGGTGCGAAATGGAGATGAGGAGAATCCCCTCAAAAGAGGTCTGGTTGCTGCATATAGTGGTGACAGTGACAATGAAGAAGATCTGGTAGAGAGACTTGAGAGTGAAGAAGAGAAGCTTGCTGACTGGAAGAAGATGGCCTGTCTGCTCTGCCGTCGCCAGTTCCCAAACAGAGATGCCCTGATCAGGCACCAGCAGCTCTCTGACTTACACAAGCAAAACATGGACATATACCGACGATCCAGGCTGAGCGAGCAGGAGCTGGAAGCCTTGGAGCTGAGGGAGAGAGAGATGAAATACCGAGATAGAGCTGCAGAAAGACGAGAGAAGTATGGCATTCCAGAACCTCCAGAGCCCAAGCGCAAGAAGCAGTTTGATGCCGGCACTGTGAATTACGAGCAGCCTACCAAAGATGGCATTGACCACAGTAACATCGGCAACAAGATGCTGCAAGCCATGGGCTGGCGGGAAGGCTCAGGCTTGGGAAGAAAGTGTCAAGGTATCACAGCTCCCATTGAGGCCCAAGTCCGGCTGAAAGGAGCTGGCCTCGGAGCCAAAGGCAGTGCATACGGGTTGTCAGGTGCCGATTCCTACAAAGATGCTGTTCGGAAAGCCATGTTTGCTCGGTTTACTGAGATGGAGTGA

XM_004834082.1 Coding sequence

Sema3f sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F, transcript variant X5

Length: 2265 bp    Location: 4036228..4063940   Strand: +
>XM_004834082.1
ATGCTTGTTACTGGTTTCCTCCTCTGGGCTTCCCTACTGACTGGGGCCTGGCCAGCCACCATTACCCAAGACCATCTCCCAGCCACACCCCGGGTCCGGCTCTCCTTCAAAGAGCTTAAGGCCACAGGCACTGCCCACTTCTTCAACTTTCTTCTCAACACCACCGATTACCGTATCTTGCTCAAGGACGAGGACCACGACCGCATGTATGTGGGCAGCAAGGACTACGTGCTGTCCCTGGACCTGCACGACATCAACCGTGAGCCCCTCATTATCCACTGGGCGGCCTCCCCACAGCGCATTGAAGAATGTGTGCTCTCAGGCAAGGATGGCAATGGTGAGTGTGGGAACTTCATCAGGCTCATCCAGCCCTGGAACAGAACCCACCTGTATGTGTGTGGCACAGGCGCCTACAACCCCATGTGCACCTATGTGAACCGCGGCCGCCGGGCGCAGGATTACATCTTCTACCTGGAGCCTGAGAGACTCGAGTCAGGGAAGGGCAAGTGTCCGTATGACCCCAAGCTGGACACAGCCTCAGCCCTCATCAACGAAGAGCTCTATGCTGGCGTGTACATTGATTTTATGGGCACAGACGCAGCCATCTTCCGCACACTTGGAAAGCAGACAGCCATGCGCACAGATCAGTACAACTCCCGGTGGCTCAATGACCCTTCATTCATCCATGCGGAGCTCATCCCTGACAGTGCAGAGCGCAACGATGACAAGCTCTACTTCTTTTTCCGTGAGCGGTCAGCAGAGACAGCCCAGAGCCCTGCTGTGTACGCCCGCATTGGGCGCATCTGCCTGAACGACGACGGTGGTCACTGCTGCCTGGTCAACAAATGGAGCACATTCCTGAAGGCACGGCTTGTCTGTTCCGTTCCAGGAGAGGATGGCATTGAGACCCACTTCGATGAGCTCCAGGATGTGTTTGTCCAGCAGACCCAGGATGTGAGGAACCCAGTCATTTATGCTGTCTTTACCTCCTCGGGCTCTGTGTTCCGAGGCTCTGCCGTATGTGTCTACTCGATGGCTGACATTCGAATGGTCTTCAATGGACCCTTTGCCCACAAGGAGGGCCCTAACTACCAGTGGATGCCCTTCTCAGGGAAGATGCCCTACCCCCGGCCTGGCACATGCCCTGGGGGAACCTTCACGCCCTCCATGAAATCTACCAAGGACTATCCTGACGAAGTGATCAACTTCATGCGCAGCCACCCACTCATGTACCAGGCTGTGTACCCACTGCAGCGGCGGCCCCTGGTGGTCCGCACAGGTGCCCCCTACCGTCTCACCACTGTTGCTGTAGACCAGGTGGATGCAGCCGATGGGCGCTATGAGGTGCTTTTCCTGGGCACAGACCGCGGGACAGTGCAGAAGGTCATTGTGTTGCCCAAGGATGACCAGGAGGTAGAGGAGCTCATGCTGGAGGAGGTAGCAGTCTTCAAGGATCCAGCACCTGTGAAAACCATGAGCATCTCTTCCAAGAGGCAACAACTGTATGTGGCCTCAGCCGTGGGTGTCACACACCTGAGCCTGCACCGCTGCCATGCATATGGTGCTGCCTGTGCCGACTGCTGCCTTGCCAGGGACCCCTACTGTGCCTGGGATGGCCAGGCCTGCTCCCGGTACACAGCATCTTCCAAAAGGCGGAGCCGTCGACAGGACGTCCGGCATGGGAACCCCATTAGGCAGTGCCGTGGGTTCAACTCTAATGCCAACAAGAATGCCATAGAGTCTGTGCAGTATGGTGTGGCAGGCAGCACGGCCTTCCTTGAGTGCCAGCCCCGCTCACCACAAGCCACTGTTAAGTGGCTCTTCCAGCGAGACCCTGGTGACCGGCGCCGAGAGATCCGCGCAGAGGAGCGCTTCCTGCGCACAGAGCAGGGCTTGTTGCTTCGCGCCCTGCAGCTTAGTGATCGAGGCCTCTACTCCTGCACGGCCACTGAGAACAACTTCAAGCACGTCGTCACGAGAGTGCAGCTGCACATACTGGGCCAGGATGCTGTCCATGCTGCCCTCTTCCCCCCGCTGGCTGTGAGCGTCCCACCACCTCCTGGCACAGGTCCCCCCACACCTCCTTACCAGGAGCTGGCCCAGCTGCTGGCCCAGCCCGAAGTGGGCCTCATCCACCAGTACTGTCAGGGTTACTGGCGTCATGTGCCCCCAAGTCCCAGAGAGGCCCCAGGGGCCCTCAGGCCTCCTGAACCCCAGGACCAGAAAAAGCCCCGGAACCGCCGGCACCACCCTCCGGACACATGA

XM_004834085.1 Coding sequence

Slc38a3 solute carrier family 38, member 3, transcript variant X2

Length: 1512 bp    Location: 4078088..4092326   Strand: +
>XM_004834085.1
ATGGACGCGCCTCTGCAGACGGAGATGGTAGAGCTGGTGCCCAATGGCAGACACTTGGAGGGGCTGCTCCCAGTTGGTATTCCTGAAGCCGACAACCAGAGGGTGGAGGACCCCAGACAGAGCTGTGTGGAGAGCAAAGGCTTCCTGCAGAAAAGCCCCAGCAAGGAGCCGCACTTCACAGATTTCGAGGGGAAAACATCATTCGGGATGTCAGTGTTCAACCTCAGCAACGCCATCATGGGCAGTGGCATCCTGGGGCTCGCCTATGCCATGGCCAACACAGGCATCATCCTTTTCCTGTTCCTGTTGACGGCGATCGCCCTGCTCTCTAGCTACTCCATCCACTTGCTTCTCAAGTCCTCTGGGATTGTGGGCATCCGCGCCTATGAGCAGCTGGGCTACCGTGCCTTTGGGACCCCTGGAAAGCTGGTGGCAGCTCTGGCCATCACACTACAGAACATTGGAGCCATGTCCAGCTACCTGTACATCATCAAGTCTGAGCTGCCTCTTGTCATACTCACCTTCCTGAACCTGGAGAAGCAGACCTTGGTCTGGTACCTGAATGGGAACTACCTGGTGATCCTGGTGTCTGTCACTGTCATTCTGCCCCTGGCACTGATGCGGCAGCTTGGCTACCTGGGCTACTCCAGTGGCTTCTCTCTTAGCTGCATGGTGTTCTTCTTAATTGCAGTCATCTACAAAAAGTTCCAAGTGCCCTGCCCGTTGCCCTCCAACTTGACCAACATCACAGGCAACTTCAGCCACATGGAGGTGGCTGAGAAGGCACAGCTGCAGGGCGAGCCTGAGGCTGCTGCCCTCTGTACCCCGAGCTACTTCACCCTCAACTCACAGACAGCATACACCATCCCCATAATGGCCTTCGCCTTCGTCTGCCACCCTGAGGTGCTGCCCATCTATACAGAGCTCAAGGACCCCACAAAGAGGAAAATGCAGCACGTCTCCAACCTGTCCATCACCGTCATGTATGTCATGTACTTCCTGGCTGCCCTCTTCGGCTATCTCACTTTCTACGACAGGGTGGAGTCAGAGCTACTGCACACCTACAGCCAGGTGGACCCGTTTGATGTGCTGATCCTGTGTGTTCGCGTGGCTGTGCTGACAGCAGTCACACTCACGGTGCCAATCGTTCTCTTCCCGGTGCGCCGTGCCATCCAACAGATACTATTTCAGAACCAGGAGTTCAGCTGGGTTCGGCATGTGCTCATTGCCACTGTCCTACTCACTTGTATCAACCTGCTGGTTATCTTCGCCCCCAACATCCTGGGCATCTTTGGGATCATTGGTGCCACATCTGCCCCATGCCTCATCTTCATCTTCCCTGCCATCTTCTACTTCCGAATAATCCCCACCGAAAAGGAGCCTGCAAGATCTACCCCCAAAATCCTGGCCCTGTGTTTCGCTCTGCTTGGCCTCTTGCTGATGACCATGAGCCTGAGCTTCATCATCATTGACTGGGTCTCAGGAAACAGCCAGCACGGAGGAAGCCACTAG

XM_004834086.1 Coding sequence

Slc38a3 solute carrier family 38, member 3, transcript variant X3

High confidence: 3 potential gene matches
Length: 1512 bp    Location: 4078098..4092326   Strand: +
>XM_004834086.1
ATGGACGCGCCTCTGCAGACGGAGATGGTAGAGCTGGTGCCCAATGGCAGACACTTGGAGGGGCTGCTCCCAGTTGGTATTCCTGAAGCCGACAACCAGAGGGTGGAGGACCCCAGACAGAGCTGTGTGGAGAGCAAAGGCTTCCTGCAGAAAAGCCCCAGCAAGGAGCCGCACTTCACAGATTTCGAGGGGAAAACATCATTCGGGATGTCAGTGTTCAACCTCAGCAACGCCATCATGGGCAGTGGCATCCTGGGGCTCGCCTATGCCATGGCCAACACAGGCATCATCCTTTTCCTGTTCCTGTTGACGGCGATCGCCCTGCTCTCTAGCTACTCCATCCACTTGCTTCTCAAGTCCTCTGGGATTGTGGGCATCCGCGCCTATGAGCAGCTGGGCTACCGTGCCTTTGGGACCCCTGGAAAGCTGGTGGCAGCTCTGGCCATCACACTACAGAACATTGGAGCCATGTCCAGCTACCTGTACATCATCAAGTCTGAGCTGCCTCTTGTCATACTCACCTTCCTGAACCTGGAGAAGCAGACCTTGGTCTGGTACCTGAATGGGAACTACCTGGTGATCCTGGTGTCTGTCACTGTCATTCTGCCCCTGGCACTGATGCGGCAGCTTGGCTACCTGGGCTACTCCAGTGGCTTCTCTCTTAGCTGCATGGTGTTCTTCTTAATTGCAGTCATCTACAAAAAGTTCCAAGTGCCCTGCCCGTTGCCCTCCAACTTGACCAACATCACAGGCAACTTCAGCCACATGGAGGTGGCTGAGAAGGCACAGCTGCAGGGCGAGCCTGAGGCTGCTGCCCTCTGTACCCCGAGCTACTTCACCCTCAACTCACAGACAGCATACACCATCCCCATAATGGCCTTCGCCTTCGTCTGCCACCCTGAGGTGCTGCCCATCTATACAGAGCTCAAGGACCCCACAAAGAGGAAAATGCAGCACGTCTCCAACCTGTCCATCACCGTCATGTATGTCATGTACTTCCTGGCTGCCCTCTTCGGCTATCTCACTTTCTACGACAGGGTGGAGTCAGAGCTACTGCACACCTACAGCCAGGTGGACCCGTTTGATGTGCTGATCCTGTGTGTTCGCGTGGCTGTGCTGACAGCAGTCACACTCACGGTGCCAATCGTTCTCTTCCCGGTGCGCCGTGCCATCCAACAGATACTATTTCAGAACCAGGAGTTCAGCTGGGTTCGGCATGTGCTCATTGCCACTGTCCTACTCACTTGTATCAACCTGCTGGTTATCTTCGCCCCCAACATCCTGGGCATCTTTGGGATCATTGGTGCCACATCTGCCCCATGCCTCATCTTCATCTTCCCTGCCATCTTCTACTTCCGAATAATCCCCACCGAAAAGGAGCCTGCAAGATCTACCCCCAAAATCCTGGCCCTGTGTTTCGCTCTGCTTGGCCTCTTGCTGATGACCATGAGCCTGAGCTTCATCATCATTGACTGGGTCTCAGGAAACAGCCAGCACGGAGGAAGCCACTAG

XM_004834087.1 Coding sequence

Slc38a3 solute carrier family 38, member 3, transcript variant X4

Length: 1458 bp    Location: 4084401..4092326   Strand: +
>XM_004834087.1
ATGGACGCGCCTCTGCAGACGGAGATGGTAGAGCTGGTGCCCAATGGCAGACACTTGGAGGGGCTGCTCCCAGTTGGTATTCCTGAAGCCGACAACCAGAGGGTGGAGGACCCCAGACAGAGCTGTGTGGAGAGCAAAGGCTTCCTGCAGAAAAGCCCCAGCAAGGAGCCGCACTTCACAGATTTCGAGGGGAAAACATCATTCGGGATGTCAGTGTTCAACCTCAGCAACGCCATCATGGGCAGTGGCATCCTGGGGCTCGCCTATGCCATGGCCAACACAGGCATCATCCTTTTCCTGTTCCTGTTGACGGCGATCGCCCTGCTCTCTAGCTACTCCATCCACTTGCTTCTCAAGTCCTCTGGGATTGTGGGCATCCGCGCCTATGAGCAGCTGGGCTACCGTGCCTTTGGGACCCCTGGAAAGCTGGTGGCAGCTCTGGCCATCACACTACAGAACATTGGAGCCATGTCCAGCTACCTGTACATCATCAAGTCTGAGCTGCCTCTTGTCATACTCACCTTCCTGAACCTGGAGAAGCAGACCTTGGTCTGGTACCTGAATGGGAACTACCTGGTGATCCTGGTGTCTGTCACTGTCATTCTGCCCCTGGCACTGATGCGGCAGCTTGGCTACCTGGGCTACTCCAGTGGCTTCTCTCTTAGCTGCATGGTGTTCTTCTTAATTGCAGTCATCTACAAAAAGTTCCAAGTGCCCTGCCCGTTGCCCTCCAACTTGACCAACATCACAGGCAACTTCAGCCACATGGAGGTGGCTGAGAAGGCACAGCTGCAGGGCGAGCCTGAGGCTGCTGCCCTCTGTACCCCGAGCTACTTCACCCTCAACTCACAGACAGCATACACCATCCCCATAATGGCCTTCGCCTTCGTCTGCCACCCTGAGGTGCTGCCCATCTATACAGAGCTCAAGGACCCCACAAAGAGGAAAATGCAGCACGTCTCCAACCTGTCCATCACCGTCATGGTGGAGTCAGAGCTACTGCACACCTACAGCCAGGTGGACCCGTTTGATGTGCTGATCCTGTGTGTTCGCGTGGCTGTGCTGACAGCAGTCACACTCACGGTGCCAATCGTTCTCTTCCCGGTGCGCCGTGCCATCCAACAGATACTATTTCAGAACCAGGAGTTCAGCTGGGTTCGGCATGTGCTCATTGCCACTGTCCTACTCACTTGTATCAACCTGCTGGTTATCTTCGCCCCCAACATCCTGGGCATCTTTGGGATCATTGGTGCCACATCTGCCCCATGCCTCATCTTCATCTTCCCTGCCATCTTCTACTTCCGAATAATCCCCACCGAAAAGGAGCCTGCAAGATCTACCCCCAAAATCCTGGCCCTGTGTTTCGCTCTGCTTGGCCTCTTGCTGATGACCATGAGCCTGAGCTTCATCATCATTGACTGGGTCTCAGGAAACAGCCAGCACGGAGGAAGCCACTAG

XM_004834089.1 Coding sequence

LOC101697890 tyrosine-protein phosphatase non-receptor type 4-like, transcript variant X2

Length: 855 bp    Location: 4127589..4112301   Strand: -
>XM_004834089.1
ATGATCCAGCTAGCTGAGGGGCTTATTACTGGAACAGTTCTGGCACAGTTTGATCAACTATATCGGAAAAAACCTGGAATGACAATGTCTTGTGCCAAATTACCTCAGAATATTTCCAAAAATAGATACAGAGATATTTCGCCTTATGATGCTACATGGGTCATTTTAAAAGGTAATGAAGACTACATCAATGCAAACTATATAAATATGGAAATTCCTTCTTCAAGTATTATTAATCAGTACATTGCTTGTCAAGGGCCATTACCACATACTTGCACAGAGTTTTGGCAGATGACTTGGGAACAAGGCTCCTCTATGGTTGTAATGTTGACCACACAAGTTGAACGTGGTAGAGTTAAATGTCACCAGTACTGGCCAGAACCCAGAGGAAGTTCATCCTATGGATGTTACCAAGTCACCTGCCACTCCGAAGAAGGAAACTCTGCTTACATCTTCAGGAAGATGACACTATTTAACAAAGAGAAAAATGAAAGTCGTCAACTCACTCACATCCAGTACATAGCCTGGCCTGACCATGGAGTCCCTGATGATTCAAGTGACTTTTTGAACTTTGTGTGTCATGTACGAAATAAGAGGGCTGGAAAAGAAGAACCTGTTGTTGTTCATTGCAGTGCTGGAACTGGAAGAACTGGGGTTCTTATTACTATGGAAACAGCCACGTGTCTCACTGAATGCAATCAGCCAGTTTATCCCCTAGACATTGTAAGAACCATGAGAGATCAACGAGCCATGATGATCCAAACACCTAGTCAATACAGATTTGTACGTGAAGCTATTTTGAAAGTTTATGAAGAAGGCTTTGTTAAACCCTTAACACCATCATCAAATAAATAA

XM_004834088.1 Coding sequence

LOC101697890 tyrosine-protein phosphatase non-receptor type 4-like, transcript variant X1

Length: 855 bp    Location: 4122523..4112301   Strand: -
>XM_004834088.1
ATGATCCAGCTAGCTGAGGGGCTTATTACTGGAACAGTTCTGGCACAGTTTGATCAACTATATCGGAAAAAACCTGGAATGACAATGTCTTGTGCCAAATTACCTCAGAATATTTCCAAAAATAGATACAGAGATATTTCGCCTTATGATGCTACATGGGTCATTTTAAAAGGTAATGAAGACTACATCAATGCAAACTATATAAATATGGAAATTCCTTCTTCAAGTATTATTAATCAGTACATTGCTTGTCAAGGGCCATTACCACATACTTGCACAGAGTTTTGGCAGATGACTTGGGAACAAGGCTCCTCTATGGTTGTAATGTTGACCACACAAGTTGAACGTGGTAGAGTTAAATGTCACCAGTACTGGCCAGAACCCAGAGGAAGTTCATCCTATGGATGTTACCAAGTCACCTGCCACTCCGAAGAAGGAAACTCTGCTTACATCTTCAGGAAGATGACACTATTTAACAAAGAGAAAAATGAAAGTCGTCAACTCACTCACATCCAGTACATAGCCTGGCCTGACCATGGAGTCCCTGATGATTCAAGTGACTTTTTGAACTTTGTGTGTCATGTACGAAATAAGAGGGCTGGAAAAGAAGAACCTGTTGTTGTTCATTGCAGTGCTGGAACTGGAAGAACTGGGGTTCTTATTACTATGGAAACAGCCACGTGTCTCACTGAATGCAATCAGCCAGTTTATCCCCTAGACATTGTAAGAACCATGAGAGATCAACGAGCCATGATGATCCAAACACCTAGTCAATACAGATTTGTACGTGAAGCTATTTTGAAAGTTTATGAAGAAGGCTTTGTTAAACCCTTAACACCATCATCAAATAAATAA

XM_004834092.1 Coding sequence

Sema3b sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B, transcript variant X2

High confidence: 3 potential gene matches
Length: 2253 bp    Location: 4131051..4142374   Strand: +
>XM_004834092.1
ATGGGGCGTGCCGAGGCCGCCGCCATGATCCCAGGCCTGGCCCTGCTCTGGGCAGCGGGGCTGGGGCTAGCTACCTCCAGCCCTCCACGCCTTCGGCTCTCCTTTCAAGAGCTCCAGGCCTGGCATGGGCTCCAGAACTTCAGGCTGGAGCGGACCTGTTGCTATGAAGCCTTGCTGGTAGACGAGGAGCGTGGGCGCCTGTTTGTGGGTGCTGAGAACCATGTGGCCTCACTCAGCCTGGACAACATCAGCAAGCAGGCCAAAAAGCTGTCCTGGCCAGCCCCTGTGGAATGGCGGGAAGAGTGCAACTGGGCAGGGAAGGACATTGGTACTGAGTGCATGAACTTTGTGAAGTTGCTCCATCCCTACAACCACACACATGTGCTAGCCTGCGGCACAGGGGCCTTCCACCCCATCTGTGCATTTGTGGAAGTGGGCCACTGGCTGGAGGAACCCGTACTCTGGTTGGAACCAAGAAGGTTTGAGGATGGCAAGGGGAAGAGCCCCTATGACCCCAGGCATCGGGCAGCCTCCGTGCTGGTAGGGGAGGAGCTGTACTCAGGGGTAGCAGCAGACCTTATGGGCCGGGACTTTACCATCTTCCGCAGCCTGGGCCAACGACCAAGTCTCCGAACAGAGCCACACGATTCCCGCTGGCTCAACGAACCCAAGTTTGTCAAGGTCTTTTGGATCCCGGAGAGTGAGAACCCAGACGACGACAAAATCTACTTCTTCTTCCATGAGTTGGCAGTGGAGGCAGCACCAGTTCTGGGGCGCCTGACAGTGTCTCGAGTAGGCCAGATCTGTCGGAATGACATGGGTGGCCAGCGAAGCTTGGTTAATAAGTGGACGACATTCCTGAAAGCACGGCTGGTATGCTCCATGCCTGGTGTGGAAGGGGACAGTCACTTCGACCAGCTCCAGGATGTGTTTCTGCTGTCCTCTCGGGACCCCCGGAACCCGCTGCTCTACACTGTGTTTTCCACGTCCAGCATCTTCCAGGGCTCTGCTGTGTGCATGTACAGCATGAACGATGTGCGCCGGGCCTTCCTGGGACCCTTTGCACACAAGGAGGGGCCCACATACCAGTGGGTGTCCTACCAGGGCCGTGTCCCCTACCCCCGGCCTGGCATGTGCCCCAGCAAGACATTTGGCACCTTTAGTTCCACCAAGGACTTCCCTGACGACGTCATCCAGTTTGCTCGGAACCACCCTCTCATGTACAACCCCATCCTGCCCATTGGTGGGCGGCCTGTCTTCATGCAAGTGAGTGCCGGTTATACCTTCACTCAAATCGCTGTCGACCGTGTAGCAGCTGCTGATGGACACTATGACGTCCTCTTCATTGGTACAGATGTGGGAACAGTGCTAAAGGTGATCTCAGTCCCCAAGGGCAACCAGCCAAGTTCTGAGGGGCTGCTTCTGGAGGAGCTGCACGTGTTTGAGGACTCAGCTGCTGTCACCAGCATGCAAATCTCCTCCAAGAGGCACCAGCTGTACATAGCCTCGCGGAGCTCAGTGGCCCAGATCTCCTTGCATCGTTGTGCAGCCCATGGCCGCGCCTGCGCAGAATGCTGTTTGGCACGCGACCCCTACTGTGCCTGGGATGGGGCCAGGTGTACACGCTTCCAGCCTAGTGCCAAGAGGCGGTTCCGGCGGCAAGACATACGGAATGGCGACCCCAGCACGCTTTGCTCTGGGGACTCGTCCCGTCCTGTGCTGCTGGAGCGAAAGGTCTTCGGGGTGGAGGGCGGCAGCGCCTTCTTGGAGTGTGAGCCCCGCTCGCTGCAAGCACACATGGAGTGGACTTTCCAACGCACAGGGGAGGCTGCTCACGCCCAGGTGCCGGCGGAGGAGCGCGCTGAGAGCATGGGGCAGGGGCTACTGCTGCGTGGACTTCAGCGCCAGGACTCAGGCGTGTACCTGTGCACCGCCGTAGAGCAAGGCTTTTCGCAGCCACTCCGTCGCCTCGAGCTGCACGTTCTGACCGCTACGCAGGCTGAGCAGCTGGCGCGTGCCGAAGAGGCTGCGCCCCCAGCGCCCCCGGGCCCTAAACTGTGGTACCGAGACTTTCTGCAGCTGGTGGAGCCCGGCGGTGGTGGCGGCGGTGGCGCGAGCTCCCTGCGCATGTGCCGACCGCAGCCCTTGCTTCGAGTCCCGGGGTCCAAGTCGCGCCGGAAGGGCCGCAACCGGCGGATGCACGCTTCCGAGCCTCGTGCCGAGAGGGGGCCCCGCAGCGCAAAACACTGGTGA

XM_004834096.1 Coding sequence

Ifrd2 interferon-related developmental regulator 2, transcript variant X3

Length: 1206 bp    Location: 4154502..4148888   Strand: -
>XM_004834096.1
ATGCCCCGCACTCGTAAGGGCAACGCGCCGCCCAAAAGCGGCCAGCGGCGTGGAGGAGGGGGGGATGCTGTGGATGAACAGGGCCAGCAGGAAGATCTTGAAGAAAAGCTGAAAGAATATGTGGACTGCCTTACAAATAAGAGTGCCAAGACCCGGCAAGGAGCTCTGGAGAGCCTGCGCTTGGCCCTGGCTTCCCGCCTGCTCCCTGACTTCCTGCTAGAACGCCGCCTCACACTGGCTGATGCCTTGGAAAAGTGCCTCAAGAAAGGGAAAGGTGAAGAACAAGCCCTGGCTGCTGCTGTGCTAGGCCTGCTCTGTGTGCAGCTGGGCCCTGGACCCAAGGGCGAGGAGCTGTTCCGCACTCTGCAGCCCCTGCTAGTCTCTGTGCTCAGTGACAGCACAGCAAGCCCCACTGCCCGGCTTCACTGTGCTTCTACTCTTGGCTTGGGGTGCTACGTGGCTGCTGCCGACATCCAGGACCTGGTCTCTTGCCTTGCCTGCTTAGAAGGTGTTTTCAGCCAGTCCTGCAGCACAGATGGCTCCACAGCTCCTGTGGTCTCTGCCAGCTTGCATGGCCTGCTCTGTGCTGCCCTGCAGGCCTGGGGGTTGTTGCTTACTCTCTGCCCCAGCACCCACATCAGCCACATCCTTGACAGGCAACTGCCCCAGCTGCCTCAGCTCTTATCCAGTGAAAATGTGAACCTGCGGATTGCTGCTGGTGAAACCATCGCACTGCTCTTTGAGCTCGCCCGGGACCTTGAGGAGGAGTTTGTTTATGAGGACATGGAGGCCCTCTGTGGTACACTGCGGACTCTAGCCACAGATAGCAACAAGTACCGTGCCAAAGCTGACCGCCGGCGCCAGCGTTCTACTTTCCGTGCCGTGCTGCATTTTGTTGAGGGTGGTGAATGTGAGGAAGAGATGATCCGGTTTGGACTGGAAATGCTTTACGTGGACAGCTGGGCTCGGCACCGGATCTATGCTGCCTTCAAGGATGTGCTGGGTTCGGGCATGCACCACCACCTGCAGAATAATGAGCTTCTCCGTGACATCTTTGGCTTGGGCCCTGTGCTGGTACTGGATGCCACTACTCTGAAGGCCTATAAAGTTTCACGTTTTGAAAAGCACCTGTACAATGCTGCTGCCTTCAAAGCCCGGACCAAGGCTCGAAGCCGTGTGCGGGACAAACGGGCAGATATCCTGTGA

XM_004834094.1 Coding sequence

Ifrd2 interferon-related developmental regulator 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 1326 bp    Location: 4154502..4148888   Strand: -
>XM_004834094.1
ATGCCCCGCACTCGTAAGGGCAACGCGCCGCCCAAAAGCGGCCAGCGGCGTGGAGGAGGTGCCCGGTGTAGTACCCAAGCTCACTCAGGTTCCAGTGAGGATGAGGCAGCCAGTGAGGCCCGCAGTACCACTAGCGAATGTCCCAGCCTTCTCAGCACCACAGCAGAGGACAGCCTGGGGGGGGATGCTGTGGATGAACAGGGCCAGCAGGAAGATCTTGAAGAAAAGCTGAAAGAATATGTGGACTGCCTTACAAATAAGAGTGCCAAGACCCGGCAAGGAGCTCTGGAGAGCCTGCGCTTGGCCCTGGCTTCCCGCCTGCTCCCTGACTTCCTGCTAGAACGCCGCCTCACACTGGCTGATGCCTTGGAAAAGTGCCTCAAGAAAGGGAAAGGTGAAGAACAAGCCCTGGCTGCTGCTGTGCTAGGCCTGCTCTGTGTGCAGCTGGGCCCTGGACCCAAGGGCGAGGAGCTGTTCCGCACTCTGCAGCCCCTGCTAGTCTCTGTGCTCAGTGACAGCACAGCAAGCCCCACTGCCCGGCTTCACTGTGCTTCTACTCTTGGCTTGGGGTGCTACGTGGCTGCTGCCGACATCCAGGACCTGGTCTCTTGCCTTGCCTGCTTAGAAGGTGTTTTCAGCCAGTCCTGCAGCACAGATGGCTCCACAGCTCCTGTGGTCTCTGCCAGCTTGCATGGCCTGCTCTGTGCTGCCCTGCAGGCCTGGGGGTTGTTGCTTACTCTCTGCCCCAGCACCCACATCAGCCACATCCTTGACAGGCAACTGCCCCAGCTGCCTCAGCTCTTATCCAGTGAAAATGTGAACCTGCGGATTGCTGCTGGTGAAACCATCGCACTGCTCTTTGAGCTCGCCCGGGACCTTGAGGAGGAGTTTGTTTATGAGGACATGGAGGCCCTCTGTGGTACACTGCGGACTCTAGCCACAGATAGCAACAAGTACCGTGCCAAAGCTGACCGCCGGCGCCAGCGTTCTACTTTCCGTGCCGTGCTGCATTTTGTTGAGGGTGGTGAATGTGAGGAAGAGATGATCCGGTTTGGACTGGAAATGCTTTACGTGGACAGCTGGGCTCGGCACCGGATCTATGCTGCCTTCAAGGATGTGCTGGGTTCGGGCATGCACCACCACCTGCAGAATAATGAGCTTCTCCGTGACATCTTTGGCTTGGGCCCTGTGCTGGTACTGGATGCCACTACTCTGAAGGCCTATAAAGTTTCACGTTTTGAAAAGCACCTGTACAATGCTGCTGCCTTCAAAGCCCGGACCAAGGCTCGAAGCCGTGTGCGGGACAAACGGGCAGATATCCTGTGA

XM_004834095.1 Coding sequence

Ifrd2 interferon-related developmental regulator 2, transcript variant X2

Length: 1275 bp    Location: 4154500..4148888   Strand: -
>XM_004834095.1
ATGCCCCGCACTCGTAAGGGCAACGCGCCGCCCAAAAGCGGCCAGCGGCGTGGAGGAGGTGCCCGGTGTAGTACCCAAGCTCACTCAGGTTCCAGTGAGGATGAGGCAGCCAGTGAGGCCCGCAGTACCACTAGCGAATGTCCCAGCCTTCTCAGCACCACAGCAGAGGACAGCCTGGGGGGGGATGCTGTGGATGAACAGGGCCAGCAGGAAGATCTTGAAGAAAAGCTGAAAGAATATGTGGACTGCCTTACAAATAAGAGTGCCAAGACCCGGCAAGGAGCTCTGGAGAGCCTGCGCTTGGCCCTGGCTTCCCGCCTGCTCCCTGACTTCCTGCTAGAACGCCGCCTCACACTGGCTGATGCCTTGGAAAAGTGCCTCAAGAAAGGGAAAGGTGAAGAACAAGCCCTGGCTGCTGCTGTGCTAGGCCTGCTCTGTGTGCAGCTGGGCCCTGGACCCAAGGGCGAGGAGCTGTTCCGCACTCTGCAGCCCCTGCTAGTCTCTGTGCTCAGTGACAGCACAGCAAGCCCCACTGCCCGGCTTCACGACCTGGTCTCTTGCCTTGCCTGCTTAGAAGGTGTTTTCAGCCAGTCCTGCAGCACAGATGGCTCCACAGCTCCTGTGGTCTCTGCCAGCTTGCATGGCCTGCTCTGTGCTGCCCTGCAGGCCTGGGGGTTGTTGCTTACTCTCTGCCCCAGCACCCACATCAGCCACATCCTTGACAGGCAACTGCCCCAGCTGCCTCAGCTCTTATCCAGTGAAAATGTGAACCTGCGGATTGCTGCTGGTGAAACCATCGCACTGCTCTTTGAGCTCGCCCGGGACCTTGAGGAGGAGTTTGTTTATGAGGACATGGAGGCCCTCTGTGGTACACTGCGGACTCTAGCCACAGATAGCAACAAGTACCGTGCCAAAGCTGACCGCCGGCGCCAGCGTTCTACTTTCCGTGCCGTGCTGCATTTTGTTGAGGGTGGTGAATGTGAGGAAGAGATGATCCGGTTTGGACTGGAAATGCTTTACGTGGACAGCTGGGCTCGGCACCGGATCTATGCTGCCTTCAAGGATGTGCTGGGTTCGGGCATGCACCACCACCTGCAGAATAATGAGCTTCTCCGTGACATCTTTGGCTTGGGCCCTGTGCTGGTACTGGATGCCACTACTCTGAAGGCCTATAAAGTTTCACGTTTTGAAAAGCACCTGTACAATGCTGCTGCCTTCAAAGCCCGGACCAAGGCTCGAAGCCGTGTGCGGGACAAACGGGCAGATATCCTGTGA

XM_004834097.1 Coding sequence

Ifrd2 interferon-related developmental regulator 2, transcript variant X4

Length: 1104 bp    Location: 4152306..4148888   Strand: -
>XM_004834097.1
ATGTCCCAGCCTTCTCAGCACCACAGCAGAGGACAGCCTGGTGCCAAGACCCGGCAAGGAGCTCTGGAGAGCCTGCGCTTGGCCCTGGCTTCCCGCCTGCTCCCTGACTTCCTGCTAGAACGCCGCCTCACACTGGCTGATGCCTTGGAAAAGTGCCTCAAGAAAGGGAAAGGTGAAGAACAAGCCCTGGCTGCTGCTGTGCTAGGCCTGCTCTGTGTGCAGCTGGGCCCTGGACCCAAGGGCGAGGAGCTGTTCCGCACTCTGCAGCCCCTGCTAGTCTCTGTGCTCAGTGACAGCACAGCAAGCCCCACTGCCCGGCTTCACTGTGCTTCTACTCTTGGCTTGGGGTGCTACGTGGCTGCTGCCGACATCCAGGACCTGGTCTCTTGCCTTGCCTGCTTAGAAGGTGTTTTCAGCCAGTCCTGCAGCACAGATGGCTCCACAGCTCCTGTGGTCTCTGCCAGCTTGCATGGCCTGCTCTGTGCTGCCCTGCAGGCCTGGGGGTTGTTGCTTACTCTCTGCCCCAGCACCCACATCAGCCACATCCTTGACAGGCAACTGCCCCAGCTGCCTCAGCTCTTATCCAGTGAAAATGTGAACCTGCGGATTGCTGCTGGTGAAACCATCGCACTGCTCTTTGAGCTCGCCCGGGACCTTGAGGAGGAGTTTGTTTATGAGGACATGGAGGCCCTCTGTGGTACACTGCGGACTCTAGCCACAGATAGCAACAAGTACCGTGCCAAAGCTGACCGCCGGCGCCAGCGTTCTACTTTCCGTGCCGTGCTGCATTTTGTTGAGGGTGGTGAATGTGAGGAAGAGATGATCCGGTTTGGACTGGAAATGCTTTACGTGGACAGCTGGGCTCGGCACCGGATCTATGCTGCCTTCAAGGATGTGCTGGGTTCGGGCATGCACCACCACCTGCAGAATAATGAGCTTCTCCGTGACATCTTTGGCTTGGGCCCTGTGCTGGTACTGGATGCCACTACTCTGAAGGCCTATAAAGTTTCACGTTTTGAAAAGCACCTGTACAATGCTGCTGCCTTCAAAGCCCGGACCAAGGCTCGAAGCCGTGTGCGGGACAAACGGGCAGATATCCTGTGA

XM_004834109.1 Coding sequence

Hyal3 hyaluronoglucosaminidase 3, transcript variant X9

Length: 513 bp    Location: 4161540..4154857   Strand: -
>XM_004834109.1
ATGCTGCCACCTGCCTACCACCAGGCCTTTGTGCAACACCGCCTGGAGGAGGCCTTCCGTGTGGCCCTCACTGGGTACCCACATCCTCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCAGCGCTCTAGGAGGTTCCTGTCCCAGGATGACCTGGTACAGACCATTGGTGTGAGTGCAGCACTGGGGGCAGCCGGCGTGGTGCTCTGGGGGGACCTGAGTTTCTCCAGCTCTGAGGAGAAGTGCTGGCATCTCCATGACTACCTGGTGGGCACTCTAGGACCCTATGTGATCAATGTGACAAGAGCAACCATGGCCTGCAGTCACCAGCAGTGCCATGGTCATGGGCGTTGTGCTCGGCAAGACCCAGGACAAAGGGAAGCCTTTCTGCATGTGCAGCCAGATGGCAGCCTTGGATCTTGGGAGTCCTTTAGCTGCCGCTGTTACCAGGGCTGGGCTGGTCCCACCTGCCAGGAGCCCAGACCTGGGGGTAGACCTAAGGAAGCAGCATAA

XM_004834105.1 Coding sequence

Hyal3 hyaluronoglucosaminidase 3, transcript variant X5

Length: 1260 bp    Location: 4161540..4154857   Strand: -
>XM_004834105.1
ATGACCATGCAGCTAGGCCCAGCCATAGTGCTGGGGGTGGCCCTGTGCCTGGGGTGTGGCCAGTCCTTGCTGCAGGCTCCTGAACGCCCCTTCTCTGTGCTGTGGAATGTACCCTCAGCACACTGTGAGGCTCACTTTGATGTGCACCTACCACTCAGTGCCTTGGGCATCATAGCCAACCACGGCCAGCATTTCCATGGCCAAAATATTACCATCTTTTACAAGAACCAGTTTGGCCTCTATCCCTACCTTGGGCCCAGGGGCACAGTTCACAATGGGGGCATCCCCCAGGCTGTGCCTCTAGATCGCCACCTGGCACAGGCTGCCCACCAGATCCGCCACAGCTTGGAACTCAGCTTTGCTGGCCTGGCAGTGCTGGACTGGGAGGAGTGGTGTCCACTCTGGGCTGGAAATTGGGGCCGCCGTAAAGCCTACAAGGCAGCCTCCTGGGCTTGGGCACAGCATGTGTTCCCTGACCTGGACCCTCAGGAGCAGCTCCACAAAGCCCATATTGGCTTTGAGCAGGCAGCCCGTGCACTGATGGAGAACACCCTGCAGCTGGGCCAGGCACTGAGGCCCCATGGGCTCTGGGGTTTCTATCGATACCCAGCCTGTGGCAATGGCTGGCACCGTATGGCTTCCAATTACACAGGCCGCTGCCATGCAGCCACCCTGGCCCGCAACACCAAACTGCATTGGCTCTGGGCTGCCTCCAGTGCTCTCTTTCCCAGCATCTACTTCCCACCCAGGCTGCCACCTGCCTACCACCAGGCCTTTGTGCAACACCGCCTGGAGGAGGCCTTCCGTGTGGCCCTCACTGGGTACCCACATCCTCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCAGCGCTCTAGGAGGTTCCTGTCCCAGGATGACCTGGTACAGACCATTGGTGTGAGTGCAGCACTGGGGGCAGCCGGCGTGGTGCTCTGGGGGGACCTGAGTTTCTCCAGCTCTGAGGAGAAGTGCTGGCATCTCCATGACTACCTGGTGGGCACTCTAGGACCCTATGTGATCAATGTGACAAGAGCAACCATGGCCTGCAGTCACCAGCAGTGCCATGGTCATGGGCGTTGTGCTCGGCAAGACCCAGGACAAAGGGAAGCCTTTCTGCATGTGCAGCCAGATGGCAGCCTTGGATCTTGGGAGTCCTTTAGCTGCCGCTGTTACCAGGGCTGGGCTGGTCCCACCTGCCAGGAGCCCAGACCTGGGGGTAGACCTAAGGAAGCAGCATAA

XM_004834102.1 Coding sequence

Hyal3 hyaluronoglucosaminidase 3, transcript variant X2

Length: 1263 bp    Location: 4161540..4154857   Strand: -
>XM_004834102.1
ATGAGGGATGGGGAAGCCAAGGCGTCGGAAACAGGGAGACCCCTTTATGAGGACCTCCAGCCTCGCACCTCCCACAGTTTCCATCTCAGTGGCATGACCATGCAGCTAGGCCCAGCCATAGTGCTGGGGGTGGCCCTGTGCCTGGGGTGTGGCCAGTCCTTGCTGCAGGCTCCTGAACGCCCCTTCTCTGTGCTGTGGAATGTACCCTCAGCACACTGTGAGGCTCACTTTGATGTGCACCTACCACTCAGTGCCTTGGGCATCATAGCCAACCACGGCCAGCATTTCCATGGCCAAAATATTACCATCTTTTACAAGAACCAGTTTGGCCTCTATCCCTACCTTGGGCCCAGGGGCACAGTTCACAATGGGGGCATCCCCCAGGCTGTGCCTCTAGATCGCCACCTGGCACAGGCTGCCCACCAGATCCGCCACAGCTTGGAACTCAGCTTTGCTGGCCTGGCAGTGCTGGACTGGGAGGAGTGGTGTCCACTCTGGGCTGGAAATTGGGGCCGCCGTAAAGCCTACAAGGCAGCCTCCTGGGCTTGGGCACAGCATGTGTTCCCTGACCTGGACCCTCAGGAGCAGCTCCACAAAGCCCATATTGGCTTTGAGCAGGCAGCCCGTGCACTGATGGAGAACACCCTGCAGCTGGGCCAGGCACTGAGGCCCCATGGGCTCTGGGGTTTCTATCGATACCCAGCCTGTGGCAATGGCTGGCACCGTATGGCTTCCAATTACACAGGCCGCTGCCATGCAGCCACCCTGGCCCGCAACACCAAACTGCATTGGCTCTGGGCTGCCTCCAGTGCTCTCTTTCCCAGCATCTACTTCCCACCCAGGCTGCCACCTGCCTACCACCAGGCCTTTGTGCAACACCGCCTGGAGGAGGCCTTCCGTGTGGCCCTCACTGGGTACCCACATCCTCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCAGCGCTCTAGGAGGTTCCTGTCCCAGGAGAAGTGCTGGCATCTCCATGACTACCTGGTGGGCACTCTAGGACCCTATGTGATCAATGTGACAAGAGCAACCATGGCCTGCAGTCACCAGCAGTGCCATGGTCATGGGCGTTGTGCTCGGCAAGACCCAGGACAAAGGGAAGCCTTTCTGCATGTGCAGCCAGATGGCAGCCTTGGATCTTGGGAGTCCTTTAGCTGCCGCTGTTACCAGGGCTGGGCTGGTCCCACCTGCCAGGAGCCCAGACCTGGGGGTAGACCTAAGGAAGCAGCATAA

XM_004834101.1 Coding sequence

Hyal3 hyaluronoglucosaminidase 3, transcript variant X1

Length: 1353 bp    Location: 4161540..4154857   Strand: -
>XM_004834101.1
ATGAGGGATGGGGAAGCCAAGGCGTCGGAAACAGGGAGACCCCTTTATGAGGACCTCCAGCCTCGCACCTCCCACAGTTTCCATCTCAGTGGCATGACCATGCAGCTAGGCCCAGCCATAGTGCTGGGGGTGGCCCTGTGCCTGGGGTGTGGCCAGTCCTTGCTGCAGGCTCCTGAACGCCCCTTCTCTGTGCTGTGGAATGTACCCTCAGCACACTGTGAGGCTCACTTTGATGTGCACCTACCACTCAGTGCCTTGGGCATCATAGCCAACCACGGCCAGCATTTCCATGGCCAAAATATTACCATCTTTTACAAGAACCAGTTTGGCCTCTATCCCTACCTTGGGCCCAGGGGCACAGTTCACAATGGGGGCATCCCCCAGGCTGTGCCTCTAGATCGCCACCTGGCACAGGCTGCCCACCAGATCCGCCACAGCTTGGAACTCAGCTTTGCTGGCCTGGCAGTGCTGGACTGGGAGGAGTGGTGTCCACTCTGGGCTGGAAATTGGGGCCGCCGTAAAGCCTACAAGGCAGCCTCCTGGGCTTGGGCACAGCATGTGTTCCCTGACCTGGACCCTCAGGAGCAGCTCCACAAAGCCCATATTGGCTTTGAGCAGGCAGCCCGTGCACTGATGGAGAACACCCTGCAGCTGGGCCAGGCACTGAGGCCCCATGGGCTCTGGGGTTTCTATCGATACCCAGCCTGTGGCAATGGCTGGCACCGTATGGCTTCCAATTACACAGGCCGCTGCCATGCAGCCACCCTGGCCCGCAACACCAAACTGCATTGGCTCTGGGCTGCCTCCAGTGCTCTCTTTCCCAGCATCTACTTCCCACCCAGGCTGCCACCTGCCTACCACCAGGCCTTTGTGCAACACCGCCTGGAGGAGGCCTTCCGTGTGGCCCTCACTGGGTACCCACATCCTCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCAGCGCTCTAGGAGGTTCCTGTCCCAGGATGACCTGGTACAGACCATTGGTGTGAGTGCAGCACTGGGGGCAGCCGGCGTGGTGCTCTGGGGGGACCTGAGTTTCTCCAGCTCTGAGGAGAAGTGCTGGCATCTCCATGACTACCTGGTGGGCACTCTAGGACCCTATGTGATCAATGTGACAAGAGCAACCATGGCCTGCAGTCACCAGCAGTGCCATGGTCATGGGCGTTGTGCTCGGCAAGACCCAGGACAAAGGGAAGCCTTTCTGCATGTGCAGCCAGATGGCAGCCTTGGATCTTGGGAGTCCTTTAGCTGCCGCTGTTACCAGGGCTGGGCTGGTCCCACCTGCCAGGAGCCCAGACCTGGGGGTAGACCTAAGGAAGCAGCATAA

XM_004834107.1 Coding sequence

Hyal3 hyaluronoglucosaminidase 3, transcript variant X7

Length: 720 bp    Location: 4161540..4154857   Strand: -
>XM_004834107.1
ATGAGGGATGGGGAAGCCAAGGCGTCGGAAACAGGGAGACCCCTTTATGAGGACCTCCAGCCTCGCACCTCCCACAGCTTAGGGAAGTGGGGAAGGGAAGCCAGGAGCCACTCTCTGGAGCAGGTGAGCAGAGGGATGGGGTCCAGCTGCCAATCCAATGCAAGAAATTTTCCAGTGTGGAGCCTCCTGTCAGCAGGACCTGGAATAAGGCTGCCACCTGCCTACCACCAGGCCTTTGTGCAACACCGCCTGGAGGAGGCCTTCCGTGTGGCCCTCACTGGGTACCCACATCCTCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCAGCGCTCTAGGAGGTTCCTGTCCCAGGATGACCTGGTACAGACCATTGGTGTGAGTGCAGCACTGGGGGCAGCCGGCGTGGTGCTCTGGGGGGACCTGAGTTTCTCCAGCTCTGAGGAGAAGTGCTGGCATCTCCATGACTACCTGGTGGGCACTCTAGGACCCTATGTGATCAATGTGACAAGAGCAACCATGGCCTGCAGTCACCAGCAGTGCCATGGTCATGGGCGTTGTGCTCGGCAAGACCCAGGACAAAGGGAAGCCTTTCTGCATGTGCAGCCAGATGGCAGCCTTGGATCTTGGGAGTCCTTTAGCTGCCGCTGTTACCAGGGCTGGGCTGGTCCCACCTGCCAGGAGCCCAGACCTGGGGGTAGACCTAAGGAAGCAGCATAA

XM_004834103.1 Coding sequence

Hyal3 hyaluronoglucosaminidase 3, transcript variant X3

Length: 1260 bp    Location: 4161540..4154857   Strand: -
>XM_004834103.1
ATGACCATGCAGCTAGGCCCAGCCATAGTGCTGGGGGTGGCCCTGTGCCTGGGGTGTGGCCAGTCCTTGCTGCAGGCTCCTGAACGCCCCTTCTCTGTGCTGTGGAATGTACCCTCAGCACACTGTGAGGCTCACTTTGATGTGCACCTACCACTCAGTGCCTTGGGCATCATAGCCAACCACGGCCAGCATTTCCATGGCCAAAATATTACCATCTTTTACAAGAACCAGTTTGGCCTCTATCCCTACCTTGGGCCCAGGGGCACAGTTCACAATGGGGGCATCCCCCAGGCTGTGCCTCTAGATCGCCACCTGGCACAGGCTGCCCACCAGATCCGCCACAGCTTGGAACTCAGCTTTGCTGGCCTGGCAGTGCTGGACTGGGAGGAGTGGTGTCCACTCTGGGCTGGAAATTGGGGCCGCCGTAAAGCCTACAAGGCAGCCTCCTGGGCTTGGGCACAGCATGTGTTCCCTGACCTGGACCCTCAGGAGCAGCTCCACAAAGCCCATATTGGCTTTGAGCAGGCAGCCCGTGCACTGATGGAGAACACCCTGCAGCTGGGCCAGGCACTGAGGCCCCATGGGCTCTGGGGTTTCTATCGATACCCAGCCTGTGGCAATGGCTGGCACCGTATGGCTTCCAATTACACAGGCCGCTGCCATGCAGCCACCCTGGCCCGCAACACCAAACTGCATTGGCTCTGGGCTGCCTCCAGTGCTCTCTTTCCCAGCATCTACTTCCCACCCAGGCTGCCACCTGCCTACCACCAGGCCTTTGTGCAACACCGCCTGGAGGAGGCCTTCCGTGTGGCCCTCACTGGGTACCCACATCCTCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCAGCGCTCTAGGAGGTTCCTGTCCCAGGATGACCTGGTACAGACCATTGGTGTGAGTGCAGCACTGGGGGCAGCCGGCGTGGTGCTCTGGGGGGACCTGAGTTTCTCCAGCTCTGAGGAGAAGTGCTGGCATCTCCATGACTACCTGGTGGGCACTCTAGGACCCTATGTGATCAATGTGACAAGAGCAACCATGGCCTGCAGTCACCAGCAGTGCCATGGTCATGGGCGTTGTGCTCGGCAAGACCCAGGACAAAGGGAAGCCTTTCTGCATGTGCAGCCAGATGGCAGCCTTGGATCTTGGGAGTCCTTTAGCTGCCGCTGTTACCAGGGCTGGGCTGGTCCCACCTGCCAGGAGCCCAGACCTGGGGGTAGACCTAAGGAAGCAGCATAA

XM_004834099.1 Coding sequence

Hyal1 hyaluronoglucosaminidase 1, transcript variant X1

Length: 1497 bp    Location: 4165537..4161631   Strand: -
>XM_004834099.1
ATGAAGCCCTTCAGTCCAGAGGTTTCCCCACACCCGCCCCATGTCATCACAGCCCACCTGCTTCAAATCTGTACCCTCTTCCTGATCTTGCTCGACATGACAAGCTCCAGGGGTCCTGTGGTACCCAACCAACCCTTCACCACGATCTGGAATGCAGACACCCAGCGATGCCTGAAGAACTACAGTGTGGACGTGGACGTCAGTATCTTTGATGTGGTAGCCAACCCTGGGCAAACCTTTCATGGCCCTAACATGACCATTTTCTACAGCTCAGAGCTGGGCACCTACCCCTACTACACAGCCACTGGGGAGCCTGTGTTTGGTGGCCTGCCACAGAATGCCAGCCTAAGTGAACACCTGGCCTACACATTCCATGACATCCAGGCAGCTATGCCTGCACCTGACTTCTCAGGGCTGGTGGTCATTGACTGGGAGGCATGGCGCCCACGCTGGGCCTTCAACTGGGACACGAAGGATATTTACCGAGAGCGCTCACAGGCACTGATTCAGGCACAGCACCCTGATTGGCCTGAAAGTCGGGTGAAGACAGTAGCCAAGGACCAGTTCCAGGAGGCTGCGAGGGCCTGGATGGCAGGTACCCTCCAGCTAGGACAGACACTGCGTCCTCATGGCCTCTGGGGCTTCTATGGCCTCCCTGACTGCTACAACTATGACTTTAAAAGTCCCAACTATACAGGCCAGTGCCCATTAGGCATCCTTCCTGAGAATGACCAGCTAGGGTGGCTGTGGAACCAGAGCCGTGCCCTCTACCCCAGTATCTACATACCTGCAGCACTGATAGGCACAGGGATGACACAGAAGTATGTGCGACACCGTGTGGGTGAGGCATTTCGTGTGGCCAGAACTGCCAGCAACCCCAGTCTACCAGTGCTGCCCTACATCCAGATCTTCTATGATACAACAAACCATCTTCTGCCCCTGGAGGAGCTGGAGCACACCCTAGGGGAGAGTGCAGCTCAAGGAGCAGCAGGAGTGGTGTTCTGGGTGAGCTCAGAGGACACAAATTCGAAGGTAAACTGCGGGGGAGCATCAAGCTCACTGGGGCAACCTGGGCCCACCCTTCCACCTCTAAAGTTCTGGCTGGCAGCATGGCAGTGTCTCAATGCCCTAAGTGGGCCCAAGCATGGCCATGGTGTCCCTGACGCTCCCCTTCCCACCCAGGAATCATGCCAGGCCATCAAAGAGTATATGGATACCACACTAGGGCCCTTCATCCTGAATGTGACCAGTGGGGCTCTTCTCTGCAGTCAAGCCCTGTGCTCTGGCCATGGCCGCTGTGCCCGCCACCCCAGCCATCCTGAGGCCCTCCTCATCCTCAACCCTGCCAGCTTCTCCATCCAGTTCACACCTGGTGGCAAGCCCCTGACCCTGAAAGGTGGCCCCTCACTAGAAGATCAGGCACAGATGGCTATGAAGTTCAGATGTCGCTGCTACCGTGGCTGGCGTGGGGCATTTTGCGGGCAGCCAGATGTGTGA

XM_004834131.1 Coding sequence

Hyal2 hyaluronoglucosaminidase 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 1416 bp    Location: 4175242..4170058   Strand: -
>XM_004834131.1
ATGCGTGCAGGCCTAGCCCCTACCGTCACACTGGCCCTGGTGCTGGCAGTGGCATGGGCCATGGAGCTGAAGCCCACAGTGCCACCCATCTTCACAGGCCGGCCCTTTGTGGTAGCCTGGGATGTACCCACACAGGACTGTGGTCCACGCCACAAGGTGCCACTGGACCTGAAGGCTTTCGATGTGGAGGCCTCACCCAATGAGGGTTTTGTGAACCAGAGTATCACAATTTTTTATTATGACCGGCTAGGCCTGTACCCACACTTCAGTGCAGCCGGGACATCTGTACATGGTGGTGTGCCACAGAATGGCAGCCTCCAAGAACACTTGGGAATGCTGAAGAAACCCGTGGAGCACTACATTCGCACTCGGGAGCCCGCAGGGCTAGCTGTCATCGACTGGGAGCACTGGCGGCCAGTGTGGGTGCGCAACTGGCAGGACAAAGATGTGTATCGCCAGTGGTCTCGTCAGCTGGTCGCCAGTCGCCACCCTGACTGGCCGAAAGACCGCATAGTCAAACAGGCACAATACGAATTCGAGTTCGCTGCACGGCAGTTCATGCTGAAGACACTACACTACGTCAAGTCAGTCAGACCTCAGCACCTCTGGGGCTTCTACCTCTTTCCTGACTGCTACAATCATGACTATGTACAGAACTGGGAGAGCTACACAGGCCGCTGTCCTGACGTCGAGGTGGCTCGAAATGATCAGCTGGCCTGGCTGTGGGCCGAGAGCACGGCCCTCTTTCCCTCTGTTTACCTAGATGAGACACTGGCCTCCTCTGTTCACGGCCGCAACTTTGTCAGCTTCCGTGTTCAGGAGGCCCTTCGTGTGGCTCAAAGCCATCATGGCAGTCATGCACTCCCAGTCTATGTCTTCACACGACCCACCTACACCCATACCAGCAGGCTCACCGGGCTTAGTGAGATGGACCTTGTTTCTACCATCGGTGAGAGTGCAGCCCTGGGTGCAGCTGGTGTCATCCTCTGGGGTGACACCTCAAGTATGGAGACCTGCCAGTACCTCCAGAATTACCTGACTGATCTGCTGGTTCCCTACGTAGTCAATGTGTCCTGGGCCACTCAGTATTGCAGTAGGGCCCAGTGTCATGGTCATGGGCGCTGTGTGCGCCGTAACCCCACCTCCAGTACCTTCCTGCATCTCAACACCAGCAGCTTCCGCCTAGTGCCCGGCAGTGCACCTGATGAACACCAGCTGCGACCTGAGGGGGAGCTCAGCCGGGCTGACCTCAACTACCTGAGGACACACTTTCGCTGCCAGTGCTACTTGGGCTGGGGTGGCGAGCAATGCCAGGACCATGGGCATACAGCTGGAGGTGCCAGTGGGGGCTGGGCTGGGTCCCACCTCAGCATCCTGCTGGCTCTGGGAGCCATAGCCCTTACCTGGACCTTGTAG

XM_004834130.1 Coding sequence

Hyal2 hyaluronoglucosaminidase 2, transcript variant X1

Length: 1416 bp    Location: 4173963..4170058   Strand: -
>XM_004834130.1
ATGCGTGCAGGCCTAGCCCCTACCGTCACACTGGCCCTGGTGCTGGCAGTGGCATGGGCCATGGAGCTGAAGCCCACAGTGCCACCCATCTTCACAGGCCGGCCCTTTGTGGTAGCCTGGGATGTACCCACACAGGACTGTGGTCCACGCCACAAGGTGCCACTGGACCTGAAGGCTTTCGATGTGGAGGCCTCACCCAATGAGGGTTTTGTGAACCAGAGTATCACAATTTTTTATTATGACCGGCTAGGCCTGTACCCACACTTCAGTGCAGCCGGGACATCTGTACATGGTGGTGTGCCACAGAATGGCAGCCTCCAAGAACACTTGGGAATGCTGAAGAAACCCGTGGAGCACTACATTCGCACTCGGGAGCCCGCAGGGCTAGCTGTCATCGACTGGGAGCACTGGCGGCCAGTGTGGGTGCGCAACTGGCAGGACAAAGATGTGTATCGCCAGTGGTCTCGTCAGCTGGTCGCCAGTCGCCACCCTGACTGGCCGAAAGACCGCATAGTCAAACAGGCACAATACGAATTCGAGTTCGCTGCACGGCAGTTCATGCTGAAGACACTACACTACGTCAAGTCAGTCAGACCTCAGCACCTCTGGGGCTTCTACCTCTTTCCTGACTGCTACAATCATGACTATGTACAGAACTGGGAGAGCTACACAGGCCGCTGTCCTGACGTCGAGGTGGCTCGAAATGATCAGCTGGCCTGGCTGTGGGCCGAGAGCACGGCCCTCTTTCCCTCTGTTTACCTAGATGAGACACTGGCCTCCTCTGTTCACGGCCGCAACTTTGTCAGCTTCCGTGTTCAGGAGGCCCTTCGTGTGGCTCAAAGCCATCATGGCAGTCATGCACTCCCAGTCTATGTCTTCACACGACCCACCTACACCCATACCAGCAGGCTCACCGGGCTTAGTGAGATGGACCTTGTTTCTACCATCGGTGAGAGTGCAGCCCTGGGTGCAGCTGGTGTCATCCTCTGGGGTGACACCTCAAGTATGGAGACCTGCCAGTACCTCCAGAATTACCTGACTGATCTGCTGGTTCCCTACGTAGTCAATGTGTCCTGGGCCACTCAGTATTGCAGTAGGGCCCAGTGTCATGGTCATGGGCGCTGTGTGCGCCGTAACCCCACCTCCAGTACCTTCCTGCATCTCAACACCAGCAGCTTCCGCCTAGTGCCCGGCAGTGCACCTGATGAACACCAGCTGCGACCTGAGGGGGAGCTCAGCCGGGCTGACCTCAACTACCTGAGGACACACTTTCGCTGCCAGTGCTACTTGGGCTGGGGTGGCGAGCAATGCCAGGACCATGGGCATACAGCTGGAGGTGCCAGTGGGGGCTGGGCTGGGTCCCACCTCAGCATCCTGCTGGCTCTGGGAGCCATAGCCCTTACCTGGACCTTGTAG

XM_004834128.1 Coding sequence

Rassf1 Ras association (RalGDS/AF-6) domain family member 1, transcript variant X7

High confidence: 4 potential gene matches
Length: 1023 bp    Location: 4190435..4181462   Strand: -
>XM_004834128.1
ATGTCGACGGAGCCGGAGCTCATTGAGCTGCGGGAGCTGGTACCCACTGGGCGCCCCGGCCCGGGTGGCAGCCGGCTGGAGCGTGCCAACGCGCTGCGCATCACGCCTGCCACCGCGCACAAGCCCGCACGGCAGCAGGCCCCAGGCCGTGGCCACCACTTCCAGTCCGCAGGGCCCACCACGCACACGTGGTGCGACCTCTGCGGTGACTTCATCTGGGGCGTTGTGCGCAAGGGCCTGCAGTGCGCGCACTGCAAGTTCACCTGCCACTACCGTTGTCGTGCGCTGGTCTGCCTGGACTGCTGCGGGCCCCGGGACCTGGGCTGGGACCCCGTCCTGGAACGGGACACAAACGTGGATGAGCCTGTGGAGTGGGAGACACCTGATCTTTCTCAAGCCAAACTTGAACAGAAGATCAAGGAGTATAATGGCCAGATCAACAGCAACCTGTTCATGAGCCTGAACAAAGATGGCTCCTACACAGGCTTCATCAAGGTTCAGTTGAAGCTGGTACGCCCTGTCTCAGTACCCTCCATCAAGAAACCACCTTCCTTGCAGGATGCCCGGAGGGGCCTGGGGCGGGGCACAGCTGTGAGACGCCGCACCTCCTTTTACCTGCCCAAGGATGCTGTCAAGCATCTCCATGTGCTGTCACGCACACGGGCCAGTGAAGTCATTGAGGCCCTCCTACGCAAATTCTTGGTGGTAGATGATCCCCGAAAGTTTGCACTCTTTGAACGGGCTGAACGTCATGGCCAGGTGTACTTCCGGAAACTGTCAGATGATGAGCAGCCTCTGCGGTTACGGCTCCTTGCAGGGCCTAGTGAGAAGGCCCTGAGTTTCATTCTAAAGGAGAATGACTCTGGGGAGGTAAATTGGGATGCCTTCAGCATGCCAGAATTACACAATTTTCTGCGCATCCTGCAGCGAGAGGAAGAAGAACACCTCCAACAGATCCTGCAGAAGTACTCCCGTTGCCGCCAAAAGATCCAAGAGGCCCTGCATGCTTGCCCCCTGGGGTGA

XM_004834123.1 Coding sequence

Rassf1 Ras association (RalGDS/AF-6) domain family member 1, transcript variant X2

Length: 1149 bp    Location: 4190431..4181462   Strand: -
>XM_004834123.1
ATGTCGACGGAGCCGGAGCTCATTGAGCTGCGGGAGCTGGTACCCACTGGGCGCCCCGGCCCGGGTGGCAGCCGGCTGGAGCGTGCCAACGCGCTGCGCATCACGCCTGCCACCGCGCACAAGCCCGCACGGCAGCAGGCCCCAGGCCGTGGCCACCACTTCCAGTCCGCAGGGCCCACCACGCACACGTGGTGCGACCTCTGCGGTGACTTCATCTGGGGCGTTGTGCGCAAGGGCCTGCAGTGCGCGCACTGCAAGTTCACCTGCCACTACCGTTGTCGTGCGCTGGTCTGCCTGGACTGCTGCGGGCCCCGGGACCTGGGCTGGGACCCCGTCCTGGAACGGGACACAAACGTGGATGAGCCTGTGGAGTGGGAGACACCTGATCTTTCTCAAGCCAAACTTGAACAGAAGATCAAGGAGTATAATGGCCAGATCAACAGCAACCTGTTCATGAGCCTGGATGCCCGGAGGGGCCTGGGGCGGGGCACAGCTGTGAGACGCCGCACCTCCTTTTACCTGCCCAAGGATGCTGTCAAGCATCTCCATGTGCTGTCACGCACACGGGCCAGTGAAGTCATTGAGGCCCTCCTACGCAAATTCTTGGTGGTAGATGATCCCCGAAAGTTTGCACTCTTTGAACGGGCTGAACGTCATGGCCAGGTGTACTTCCGGAAACTGTCAGATGATGAGCAGCCTCTGCGGTTACGGCTCCTTGCAGGGCCTAGTGAGAAGGCCCTGAGTTTCATTCTAAAGGAGAATGACTCTGGGGAGGTAAATACTACTGTCAAGAATTCTAGCAAAGACTATTCAAGCAAGAGCTTAACATCAAAAAGCCCAGATCTAGCTCTTGTGATCATTATATCATGGCTTTCTCTGGGGAGGGTCTGCCTGCTTGGCCATGCCTGCTGCATCCTGTGTACTTCCCCTCACCCTCTTCCAGTGGGATGCCTTCAGCATGCCAGAATTACACAATTTTCTGCGCATCCTGCAGCGAGAGGAAGAAGAACACCTCCAACAGATCCTGCAGAAGTACTCCCGTTGCCGCCAAAAGATCCAAGAGGCCCTGCATGCTTGCCCCCTGGGGTGACCTGTTATATACCTGGGTGGCAGGAGGAAAGTAGGCAGTGCCAAGAGCGTGCTGTGTGA

XM_004834122.1 Coding sequence

Rassf1 Ras association (RalGDS/AF-6) domain family member 1, transcript variant X1

Length: 1245 bp    Location: 4190431..4181462   Strand: -
>XM_004834122.1
ATGTCGACGGAGCCGGAGCTCATTGAGCTGCGGGAGCTGGTACCCACTGGGCGCCCCGGCCCGGGTGGCAGCCGGCTGGAGCGTGCCAACGCGCTGCGCATCACGCCTGCCACCGCGCACAAGCCCGCACGGCAGCAGGCCCCAGGCCGTGGCCACCACTTCCAGTCCGCAGGGCCCACCACGCACACGTGGTGCGACCTCTGCGGTGACTTCATCTGGGGCGTTGTGCGCAAGGGCCTGCAGTGCGCGCACTGCAAGTTCACCTGCCACTACCGTTGTCGTGCGCTGGTCTGCCTGGACTGCTGCGGGCCCCGGGACCTGGGCTGGGACCCCGTCCTGGAACGGGACACAAACGTGGATGAGCCTGTGGAGTGGGAGACACCTGATCTTTCTCAAGCCAAACTTGAACAGAAGATCAAGGAGTATAATGGCCAGATCAACAGCAACCTGTTCATGAGCCTGAACAAAGATGGCTCCTACACAGGCTTCATCAAGGTTCAGTTGAAGCTGGTACGCCCTGTCTCAGTACCCTCCATCAAGAAACCACCTTCCTTGCAGGATGCCCGGAGGGGCCTGGGGCGGGGCACAGCTGTGAGACGCCGCACCTCCTTTTACCTGCCCAAGGATGCTGTCAAGCATCTCCATGTGCTGTCACGCACACGGGCCAGTGAAGTCATTGAGGCCCTCCTACGCAAATTCTTGGTGGTAGATGATCCCCGAAAGTTTGCACTCTTTGAACGGGCTGAACGTCATGGCCAGGTGTACTTCCGGAAACTGTCAGATGATGAGCAGCCTCTGCGGTTACGGCTCCTTGCAGGGCCTAGTGAGAAGGCCCTGAGTTTCATTCTAAAGGAGAATGACTCTGGGGAGGTAAATACTACTGTCAAGAATTCTAGCAAAGACTATTCAAGCAAGAGCTTAACATCAAAAAGCCCAGATCTAGCTCTTGTGATCATTATATCATGGCTTTCTCTGGGGAGGGTCTGCCTGCTTGGCCATGCCTGCTGCATCCTGTGTACTTCCCCTCACCCTCTTCCAGTGGGATGCCTTCAGCATGCCAGAATTACACAATTTTCTGCGCATCCTGCAGCGAGAGGAAGAAGAACACCTCCAACAGATCCTGCAGAAGTACTCCCGTTGCCGCCAAAAGATCCAAGAGGCCCTGCATGCTTGCCCCCTGGGGTGACCTGTTATATACCTGGGTGGCAGGAGGAAAGTAGGCAGTGCCAAGAGCGTGCTGTGTGA

XM_004834126.1 Coding sequence

Rassf1 Ras association (RalGDS/AF-6) domain family member 1, transcript variant X5

Length: 930 bp    Location: 4188114..4181462   Strand: -
>XM_004834126.1
ATGGGCGAGGCGGAGACGCCTTCTTTTGACATGACCTGGAGCAGCACGACCAGCAGTGGCTACTGCAGCCAAGAGGACTCAGATTCAGAGCTCGAGCAGTACTTCACGGCGCGCACCTCGCTGGCACGCAGGCCGCGCCGAGACCAGAACAAAGATGGCTCCTACACAGGCTTCATCAAGGTTCAGTTGAAGCTGGTACGCCCTGTCTCAGTACCCTCCATCAAGAAACCACCTTCCTTGCAGGATGCCCGGAGGGGCCTGGGGCGGGGCACAGCTGTGAGACGCCGCACCTCCTTTTACCTGCCCAAGGATGCTGTCAAGCATCTCCATGTGCTGTCACGCACACGGGCCAGTGAAGTCATTGAGGCCCTCCTACGCAAATTCTTGGTGGTAGATGATCCCCGAAAGTTTGCACTCTTTGAACGGGCTGAACGTCATGGCCAGGTGTACTTCCGGAAACTGTCAGATGATGAGCAGCCTCTGCGGTTACGGCTCCTTGCAGGGCCTAGTGAGAAGGCCCTGAGTTTCATTCTAAAGGAGAATGACTCTGGGGAGGTAAATACTACTGTCAAGAATTCTAGCAAAGACTATTCAAGCAAGAGCTTAACATCAAAAAGCCCAGATCTAGCTCTTGTGATCATTATATCATGGCTTTCTCTGGGGAGGGTCTGCCTGCTTGGCCATGCCTGCTGCATCCTGTGTACTTCCCCTCACCCTCTTCCAGTGGGATGCCTTCAGCATGCCAGAATTACACAATTTTCTGCGCATCCTGCAGCGAGAGGAAGAAGAACACCTCCAACAGATCCTGCAGAAGTACTCCCGTTGCCGCCAAAAGATCCAAGAGGCCCTGCATGCTTGCCCCCTGGGGTGACCTGTTATATACCTGGGTGGCAGGAGGAAAGTAGGCAGTGCCAAGAGCGTGCTGTGTGA

XM_004834118.1 Coding sequence

Nprl2 nitrogen permease regulator-like 2 (S. cerevisiae), transcript variant X6

High confidence: 4 potential gene matches
Length: 1143 bp    Location: 4200102..4196154   Strand: -
>XM_004834118.1
ATGGGCAGCAACTGCCGCATCGAATGCATATTTTTCAGCGAGTTCCACCCCACGCTGGGACCCAAGATCACCTATCAGGTCCCTGAGGACTTCATCTCCCGGGAGCTATTTGACACCGTGCAAGTGTACATCATCACCAAGCCAGAGCTTCAGAACAAGCTTATCACTGTCACAGCCATGGAAAAGAAGCTGATCGGCTGTCCAGTGTGCATTGAACACAAGAAGTACAGCCGTAATGCCCTCCTCTTCAACCTGGGCTTTGTATGTGATGCCCAGGCCAAGACCTGTGCCCTGGAGCCCATTGTTAAAAAACTGGCTGGCTACCTGACCACACTGGAGCTAGAGAGCAGCTTCGTGTCCACAGAGGAGAGCAAGCAGAAGTTGGTGCCCATCATGACCATCTTACTGGAGGAACTAAATGCCTCTGGCCGGTGTACTCTACCCATAGATGAGTCCAACACCATCCACTTGAAGGTGATTGACCAGCGACCAGACCCTCCTGTGGCCCAGGAGTATGATGTTCCTGTCTTTACGAAGGACAAGGAGGATTTCTTCAACTCACAGTGGGACCTCACCACACAACAGATCCTGCCCTATATTGATGGTTTCCGCCATGTCCAGAAGATCTCAGCTGAGGCAGATGTGGAGCTAAATTTGGTGCGCATTGCCATCCAGAACCTTCTGTACTATGGTGTTGTGACACTGGTGTCCATCCTCCAGTACTCCAATGTGTACTGCCCAACACCCAAGGTCCAGGACCTGGTAGATGACAAGTCCCTGCAAGAGGCGTGTCTGTCCTTCGTAACCAAGCAAGGGCACAAAAGAGCCAGCCTCCGGGACGTGTTCCAGCTGTACTGCAGCCTGAGCCCTGGCACTACTGTTCGAGACCTCATTGGCCGACACCCCCAACAGCTACAGCACGTTGATGAAAGGAAATTGATCCAGTTTGGGCTTATGAAGAACCTTATCCGACGACTACAGAAGTATCCTGTTCGAGTATCTCACGAGGAGCACAGCCACCCTGCCCGGCTTTATACAGGCTGCCACAGCTATGATGAGATCTGCTGCAAGACAGGGATGAGCTATCATGAGCTGGACGAGCGGCTGGAAAATGACCCCAACATCATCATCTGCTGGAAGTGA

XM_004834115.1 Coding sequence

Nprl2 nitrogen permease regulator-like 2 (S. cerevisiae), transcript variant X3

Length: 1254 bp    Location: 4200102..4196154   Strand: -
>XM_004834115.1
ATGGGCAGCAACTGCCGCATCGAATGCATATTTTTCAGCGAGTTCCACCCCACGCTGGGACCCAAGATCACCTATCAGGTCCCTGAGGACTTCATCTCCCGGGAGCTATTTGACACCGTGCAAGTGTACATCATCACCAAGCCAGAGCTTCAGAACAAGCTTATCACTGTCACAGCCATGGAAAAGAAGCTGATCGGCTGTCCAGTGTGCATTGAACACAAGAAGTACAGCCGTAATGCCCTCCTCTTCAACCTGGGCTTTGTATGTGATGCCCAGGCCAAGACCTGTGCCCTGGAGCCCATTGTTAAAAAACTGGCTGGCTACCTGACCACACTGGAGCTAGAGAGCAGCTTCGTGTCCACAGAGGAGAGCAAGCAGAAGTTGGTGCCCATCATGACCATCTTACTGGAGGAACTAAATGCCTCTGGCCGGTGTACTCTACCCATAGATGAGTCCAACACCATCCACTTGAAGGTGATTGACCAGCGACCAGACCCTCCTGTGGCCCAGGAGTATGATGTTCCTGTCTTTACGAAGGACAAGGAGGATTTCTTCAACTCACAGTGGGACCTCACCACACAACAGGTATGCCAGCCCTCCCTGAGTAACATCACCTGGGGCTGGCCACAGCCTTGGCCTTGTCTGCCCCCACTGATCCTGCCCTGCTCTGACCAGATCCTGCCCTATATTGATGGTTTCCGCCATGTCCAGAAGATCTCAGCTGAGGCAGATGTGGAGCTAAATTTGGTGCGCATTGCCATCCAGAACCTTCTGTACTATGGTGTTGTGACACTGGTGTCCATCCTCCAGTACTCCAATGTGTACTGCCCAACACCCAAGGTCCAGGACCTGGTAGATGACAAGTCCCTGCAAGAGGCGTGTCTGTCCTTCGTAACCAAGCAAGGGCACAAAAGAGCCAGCCTCCGGGACGTGTTCCAGCTGTACTGCAGCCTGAGCCCTGGCACTACTGTTCGAGACCTCATTGGCCGACACCCCCAACAGCTACAGCACGTTGATGAAAGGAAATTGATCCAGTTTGGGCTTATGAAGAACCTTATCCGACGACTACAGAAGTATCCTGTTCGAGTATCTCACGAGGAGCACAGCCACCCTGCCCGGCTTTATACAGGCTGCCACAGCTATGATGAGATCTGCTGCAAGACAGGTGGAGGCAGGCGGGGCAGGCAGGGTGGGCTCGGCAAGATGGCGGCCAAGGCGTCTGACCTCACCCCACCCCCATCCCACCAGGGATGA

XM_004834113.1 Coding sequence

Nprl2 nitrogen permease regulator-like 2 (S. cerevisiae), transcript variant X1

Length: 1287 bp    Location: 4199950..4196154   Strand: -
>XM_004834113.1
ATGGGAGATAAGGAAACACTGGAGAAGAGGACTTGGGACTGGGGGAGGTCATCCTGTGAACTCCACCCACTGCCACTGTCCACTGAGCAGGCTCTTGCCACTCCTGTCCCCAGGTCCCTGAGGACTTCATCTCCCGGGAGCTATTTGACACCGTGCAAGTGTACATCATCACCAAGCCAGAGCTTCAGAACAAGCTTATCACTCACAGCCATGGAAAAGAAGCTGATCGGCTGTCCAGTGTGCATTGAACACAAGAAGTACAGCCGTAATGCCCTCCTCTTCAACCTGGGCTTTGTATGTGATGCCCAGGCCAAGACCTGTGCCCTGGAGCCCATTGTTAAAAAACTGGCTGGCTACCTGACCACACTGGAGCTAGAGAGCAGCTTCGTGTCCACAGAGGAGAGCAAGCAGAAGTTGGTGCCCATCATGACCATCTTACTGGAGGAACTAAATGCCTCTGGCCGGTGTACTCTACCCATAGATGAGTCCAACACCATCCACTTGAAGGTGATTGACCAGCGACCAGACCCTCCTGTGGCCCAGGAGTATGATGTTCCTGTCTTTACGAAGGACAAGGAGGATTTCTTCAACTCACAGTGGGACCTCACCACACAACAGGTATGCCAGCCCTCCCTGAGTAACATCACCTGGGGCTGGCCACAGCCTTGGCCTTGTCTGCCCCCACTGATCCTGCCCTGCTCTGACCAGATCCTGCCCTATATTGATGGTTTCCGCCATGTCCAGAAGATCTCAGCTGAGGCAGATGTGGAGCTAAATTTGGTGCGCATTGCCATCCAGAACCTTCTGTACTATGGTGTTGTGACACTGGTGTCCATCCTCCAGTACTCCAATGTGTACTGCCCAACACCCAAGGTCCAGGACCTGGTAGATGACAAGTCCCTGCAAGAGGCGTGTCTGTCCTTCGTAACCAAGCAAGGGCACAAAAGAGCCAGCCTCCGGGACGTGTTCCAGCTGTACTGCAGCCTGAGCCCTGGCACTACTGTTCGAGACCTCATTGGCCGACACCCCCAACAGCTACAGCACGTTGATGAAAGGAAATTGATCCAGTTTGGGCTTATGAAGAACCTTATCCGACGACTACAGAAGTATCCTGTTCGAGTATCTCACGAGGAGCACAGCCACCCTGCCCGGCTTTATACAGGCTGCCACAGCTATGATGAGATCTGCTGCAAGACAGGTGGAGGCAGGCGGGGCAGGCAGGGTGGGCTCGGCAAGATGGCGGCCAAGGCGTCTGACCTCACCCCACCCCCATCCCACCAGGGATGA

XM_004834132.1 Coding sequence

Tmem115 transmembrane protein 115

High confidence: 3 potential gene matches
Length: 1056 bp    Location: 4209206..4203455   Strand: -
>XM_004834132.1
ATGCAGCGTGCCCTTCCAGGTGCCCGCCAGCACTTGGGGGCTATCCTGGCCAGCGCCAGCGTGGTGGTAAAGGCGCTGTGCGCGGCGGTACTGTTCCTCTACCTTCTCTCCTTCGCCGTGGACACGGGCTGCCTAGCTGTCACCCCAGGCTACCTTTTTCCCCCCAACTTCTGGATCTGGACCCTGGCCACCCATGGACTGATGGAGCAGCACGTATGGGATGTGGCCATCAGCCTGGCCACAGTGGTAGTGGCAGGGCGTTTGCTGGAACCCCTCTGGGGAGCCTTGGAGCTACTGATTTTCTTCTCGGTGGTGAATGTGTCTGTGGGGCTCCTGGGGGCCTTTGCCTACCTCCTCACGTACATGGCGTCTTTCAACTTGGTCTACCTGTTCACTGTTCGTATCCATGGCGCCCTGGGCTTCCTAGCTGGTGTTATGGTGGCACTCAAACAAACTATGGGAGAGTGTGTGGTCCTGCGAGTGCCCCAGGTGCGCGTCAGCGTAGTGCCCATGCTGCTACTGGCACTGCTGCTACTGCTGCGGCTGGCCACTTTGCTCCAGAGCCCAGCACTGGCTTCTTACGGTTTTGGGCTGCTCTCCAGTTGGGTTTATCTTCGCTTCTACCAGCGCCACAGCCGGGGCCGAGGGGACATGGCTGACCACTTTGCTTTTGCCACCTTCTTCCCTGAGATCCTGCAGCCAGTGGTGGGGCTGCTGGCGAACTTAGTGCATGGCATCCTGGTGAAGGTAAAGATATGCCAGAAGACAGTAAAGCGCTATGATGTAGGAGCCCCGTCCTCCATCACCATCAGCCTTCCAGGCACAGACCCTCAAGATGCTGAGCGTCGAAGGCAACTGGCCCTGAAGGCCCTGAATGAGCGGCTGAAGAGAGTGGAGGACCAGTCCCTCTGGCCCAGCATGGATGATGATGAAGAGGAGGCTGGGGCCAAGGTGGACAGCCCCTTACCCTCAGAAAAAGCTCCTACACCTCCAGGGAAGGGGGCTACCCCAGAATCCAGTCTCATCACCTTTGAAGCAGCTCCCCCAAAGCTGTAA

XM_004834138.1 Coding sequence

Cacna2d2 calcium channel, voltage-dependent, alpha 2/delta subunit 2, transcript variant X6

Length: 3420 bp    Location: 4345849..4212901   Strand: -
>XM_004834138.1
ATGGCGGTGCCGGCTAGGACCTGCGGCGCCTCTCGGCCCGGCTCGGCGCGGACCGCGCGCCCCCGGCCCGGCCCCGGCCCCGGCCCCCGGCGCCCGGCGGCTGGGCCCATGCGTCCGCTGTTGCTACTGCTCCCGCTGCTCGCCGCTTCGGGCGCCTCCGCCTACAGCTTCCCCCAGCAGCACACGATGCAGCACTGGGCCCGGCGCCTAGAACAGGAGATTGATGGTGTGATGCGGATCTTTGGAGGCGTTCAGCAGCTCCGTGAGATCTACAAGGACAACCGGAACCTGTTTGAGGTGCAGGAGAATGAGCCTCAGAAGCTGGTGGAGAAGGTGGCAGGGGACATTGAGAGCCTATTGGACAGAAAGGTGCAGGCCCTGAAGAGATTGGCTGATGCTGCAGAGACCTTCCAGAAAGCCCACCACTGGCAGGACAACATCAAGGAGGAAGACATCATGTACTATGATGCCAAGGCTGATGCTGAACTGGATGACCCTGAGGGTGAGGATGTGGAGAGAGGGTCCAAAAGCAGCACCCTAAGGCTGGACTTCATCGAGGACCTAAACTTCAAGAACAAGGTCAACTATTCATACACGGCTGTGCAGATCCCCACAGACATCTACAAAGGCTCCACTGTTATTCTCAATGAGCTCAACTGGACAGAAGCCCTGGAGAACGTATTCATTGAGAACCGCAGGCAGGACCCCACACTGCTGTGGCAGGTCTTCGGCAGTGCCACTGGAGTCACCCGCTACTATCCAGCCACCCCCTGGCGAGCCCCTAAGAAGATTGACCTGTATGATGTCCGACGGAGACCTTGGTATATCCAGGGGGCCTCGTCGCCTAAGGACATGGTCATCATCGTTGATGTGAGTGGCAGTGTGAGTGGCCTGACACTGAAACTAATGAAGACATCTGTCTGCGAGATGCTGGACACACTCTCTGATGACGACTATGTGAACGTGGCCTCGTTCAATGAGAAGGCACAGCCTGTATCTTGCTTCACACACCTGGTGCAGGCCAATGTGCGTAACAAGAAGGTGTTCAAGGAAGCCGTGCAGGGCATGGTGGCCAAGGGCACCACAGGCTACAAGGCTGGCTTTGAGTATGCCTTTGACCAGCTGCAGAACTCCAACATCACTCGGGCCAACTGCAATAAAATGATCATGATGTTCACGGATGGTGGCGAGGACCGTGTGCAGGATGTCTTCGAGAAGTACAACTGGCCCAATCGGACGGTACGTGTCTTCACCTTCTCTGTGGGGCAGCATAACTATGATGTCACTCCCCTGCAGTGGATGGCCTGCACCAACAAAGGTTACTATTTTGAGATTCCTTCCATTGGAGCCATCCGCATCAACACGCAGGAGTATCTAGACGTGTTGGGCAGGCCCATGGTGCTGGCAGGAAAGGAAGCCAAGCAGGTGCAATGGACCAACGTCTATGAGGATGCACTGGGGCTGGGGTTGGTGGTAACAGGGACCCTCCCTGTTTTCAACCTGACGCAAGATGGCCCTGGGGAAAAGAAGAACCAGCTGATCCTGGGTGTGATGGGCATCGATGTGGCTCTGAACGACATCAAGAAGCTAACTCCCAACTACACGCTTGGAGCCAACGGCTATGTATTTGCCATTGATCTGAATGGCTACGTGTTGCTGCACCCCAATCTCAAGCCCCAGACCACCAATTTCCGGGAGCCTGTAACTCTGGACTTCCTGGATGCAGAGCTGGAGGATGAGAACAAGGAGGAGATCCGGCGGAGCATGATTGATGGCAACAAGGGTCACAAGCAGATCAGAACGTTGGTCAAATCTTTGGACGAGAGGTACATAGATGAGGTGATTCGGAACTACACCTGGGTGCCTATAAGGAGCACCAACTACAGCCTGGGGCTGGTGCTCCCACCCTATAGCACCTTCTACCTCCAAGCTAACCTCAGTGACCAGATTCTGCAGGTCAAGTATTTTGAGTTCCTGCTCCCCAGCAGCTTTGAGTCTGAAGGACATGTTTTCATTGCTCCCAGAGAGTATTGCAAGGATCTGAATGCCTCAGACAACAACACTGAGTTCCTGAAAAACTTCATTGAACTCATGGAGAAAGTGACTCCAGACTCCAAGCAGTGTAATAATTTTCTTCTGCACAACCTGATCTTGGACACAGGCATCACACAGCAGTTGGTGGAGCGTGTGTGGCGGGACCAGGATCTCAACACGTACAGCCTGCTGGCCGTGTTTGCTGCCACTGACGGTGGCATCACACGCATCTTCCCCAACAAGGCAGCTGAGGACTGGACAGAGAACCCTGAACCCTTCAATGCCAGCTTCTACCGCCGCAGCCTGGATAACCACGGTTATATCTTCAAGCCCCCACATCAGGACACCTTGTTAAGGCCGCTGGAACTGGAGAATGACACAGTGGGAGTCCTTGTCAGCACAGCTGTGGAGCTCAGCCTAGGTGGGCACACACTGAGGCCAGCAGTGGTGGGTGTCAAGCTGGACCCGGAGGCTTGGGCTGAGAAGTTTAAGGTGCTTGCCAGTAATCGTACCCACCAGGACCAGCCTCAGAAGTGTGGCCCCAACAACCCTTGTGAGATGGATTGTGAGGTTAACAATGAGGACCTTCTCTGTGTCCTCATTGATGATGGAGGGTTCCTGGTGCTGTCAAACCAGAACCATCAGTGGGACCAGGTTGGCAGGTTCTTCAGTGAGGTGGATGCCAACCTGATGCTGGCACTCTACAACAATTCCTTCTATACCCACAAGGAGTCCTACGACTATCAGGCAGCCTGTGCTCCCCAGCCTCCTGGCAACCTGGGTGCTGCACCCCGGGGTGTCTTTGTGCCCACCATTGCAGACTTCCTTAACCTGGCCTGGTGGACCTCTGCTGCCACCTGGTCTTTGTTCCAGCAGCTGCTCTACGGCCTTCTCTACCACAGCTGGTTCCAGGCCGACCCCGCGGAGGCCGAAGGGAGCCCCGAGACGCGCGAGAGCAGCTGCGTCATGAAACAGACCCAGTACTACTTCGGCTCAGTGAACGCCTCCTACAATGCCATCATCGACTGCGGAAACTGCTCCAGGCTGTTCCACGCACAGAGGCTGACCAACACTAACCTGCTCTTCGTGGTGGCGGAGAAGCCGCTGTGCAGCCAGTGCGAGGCTGGCCGACTGCTGCAGAAGGAAACACACTGCCCAGCGGACGGCCCAGAGCAGTGTGAGCTAGTGCAGAGACCACGCTACCGGAGAGGTCCACACATCTGCTTTGATTACAACGCGACAGAAGATACCTCAGACTGTGGCCGCGGAGCCTCCTTCCCTCCGTCGCTGGGCGTCCTGGTCTCCCTGCAGCTGCTGCTTCTCTTGGGCCTGCCTCCCCGGCCGCAGCCTCAAGTCCATGCCCGCGCTGCCTCGCGCCCCCTCTGA

XM_004834135.1 Coding sequence

Cacna2d2 calcium channel, voltage-dependent, alpha 2/delta subunit 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 3414 bp    Location: 4345849..4212901   Strand: -
>XM_004834135.1
ATGGCGGTGCCGGCTAGGACCTGCGGCGCCTCTCGGCCCGGCTCGGCGCGGACCGCGCGCCCCCGGCCCGGCCCCGGCCCCGGCCCCCGGCGCCCGGCGGCTGGGCCCATGCGTCCGCTGTTGCTACTGCTCCCGCTGCTCGCCGCTTCGGGCGCCTCCGCCTACAGCTTCCCCCAGCAGCACACGATGCAGCACTGGGCCCGGCGCCTAGAACAGGAGATTGATGGTGTGATGCGGATCTTTGGAGGCGTTCAGCAGCTCCGTGAGATCTACAAGGACAACCGGAACCTGTTTGAGGTGCAGGAGAATGAGCCTCAGAAGCTGGTGGAGAAGGTGGCAGGGGACATTGAGAGCCTATTGGACAGAAAGGTGCAGGCCCTGAAGAGATTGGCTGATGCTGCAGAGACCTTCCAGAAAGCCCACCACTGGCAGGACAACATCAAGGAGGAAGACATCATGTACTATGATGCCAAGGCTGATGCTGAACTGGATGACCCTGAGGGTGAGGATGTGGAGAGAGGGTCCAAAAGCAGCACCCTAAGGCTGGACTTCATCGAGGACCTAAACTTCAAGAACAAGGTCAACTATTCATACACGGCTGTGCAGATCCCCACAGACATCTACAAAGGCTCCACTGTTATTCTCAATGAGCTCAACTGGACAGAAGCCCTGGAGAACGTATTCATTGAGAACCGCAGGCAGGACCCCACACTGCTGTGGCAGGTCTTCGGCAGTGCCACTGGAGTCACCCGCTACTATCCAGCCACCCCCTGGCGAGCCCCTAAGAAGATTGACCTGTATGATGTCCGACGGAGACCTTGGTATATCCAGGGGGCCTCGTCGCCTAAGGACATGGTCATCATCGTTGATGTGAGTGGCAGTGTGAGTGGCCTGACACTGAAACTAATGAAGACATCTGTCTGCGAGATGCTGGACACACTCTCTGATGACGACTATGTGAACGTGGCCTCGTTCAATGAGAAGGCACAGCCTGTATCTTGCTTCACACACCTGGTGCAGGCCAATGTGCGTAACAAGAAGGTGTTCAAGGAAGCCGTGCAGGGCATGGTGGCCAAGGGCACCACAGGCTACAAGGCTGGCTTTGAGTATGCCTTTGACCAGCTGCAGAACTCCAACATCACTCGGGCCAACTGCAATAAAATGATCATGATGTTCACGGATGGTGGCGAGGACCGTGTGCAGGATGTCTTCGAGAAGTACAACTGGCCCAATCGGACGGTACGTGTCTTCACCTTCTCTGTGGGGCAGCATAACTATGATGTCACTCCCCTGCAGTGGATGGCCTGCACCAACAAAGGTTACTATTTTGAGATTCCTTCCATTGGAGCCATCCGCATCAACACGCAGGAGTATCTAGACGTGTTGGGCAGGCCCATGGTGCTGGCAGGAAAGGAAGCCAAGCAGGTGCAATGGACCAACGTCTATGAGGATGCACTGGGGCTGGGGTTGGTGGTAACAGGGACCCTCCCTGTTTTCAACCTGACGCAAGATGGCCCTGGGGAAAAGAAGAACCAGCTGATCCTGGGTGTGATGGGCATCGATGTGGCTCTGAACGACATCAAGAAGCTAACTCCCAACTACACGCTTGGAGCCAACGGCTATGTATTTGCCATTGATCTGAATGGCTACGTGTTGCTGCACCCCAATCTCAAGCCCCAGACCACCAATTTCCGGGAGCCTGTAACTCTGGACTTCCTGGATGCAGAGCTGGAGGATGAGAACAAGGAGGAGATCCGGCGGAGCATGATTGATGGCAACAAGGGTCACAAGCAGATCAGAACGTTGGTCAAATCTTTGGACGAGAGGTACATAGATGAGGTGATTCGGAACTACACCTGGGTGCCTATAAGGAGCACCAACTACAGCCTGGGGCTGGTGCTCCCACCCTATAGCACCTTCTACCTCCAAGCTAACCTCAGTGACCAGATTCTGCAGGTCAAGTATTTTGAGTTCCTGCTCCCCAGCAGCTTTGAGTCTGAAGGACATGTTTTCATTGCTCCCAGAGAGTATTGCAAGGATCTGAATGCCTCAGACAACAACACTGAGTTCCTGAAAAACTTCATTGAACTCATGGAGAAAGTGACTCCAGACTCCAAGCAGTGTAATAATTTTCTTCTGCACAACCTGATCTTGGACACAGGCATCACACAGCAGTTGGTGGAGCGTGTGTGGCGGGACCAGGATCTCAACACGTACAGCCTGCTGGCCGTGTTTGCTGCCACTGACGGTGGCATCACACGCATCTTCCCCAACAAGGCAGCTGAGGACTGGACAGAGAACCCTGAACCCTTCAATGCCAGCTTCTACCGCCGCAGCCTGGATAACCACGGTTATATCTTCAAGCCCCCACATCAGGACACCTTGTTAAGGCCGCTGGAACTGGAGAATGACACAGTGGGAGTCCTTGTCAGCACAGCTGTGGAGCTCAGCCTAGGTGGGCACACACTGAGGCCAGCAGTGGTGGGTGTCAAGCTGGACCCGGAGGCTTGGGCTGAGAAGTTTAAGGTGCTTGCCAGTAATCGTACCCACCAGGACCAGCCTCAGAAGTGTGGCCCCAACAACCCTTGTGAGATGGATTGTGAGGTTAACAATGAGGACCTTCTCTGTGTCCTCATTGATGATGGAGGGTTCCTGGTGCTGTCAAACCAGAACCATCAGTGGGACCAGGTTGGCAGGTTCTTCAGTGAGGTGGATGCCAACCTGATGCTGGCACTCTACAACAATTCCTTCTATACCCACAAGGAGTCCTACGACTATCAGGCAGCCTGTGCTCCCCAGCCTCCTGGCAACCTGGGTGCTGCACCCCGGGGTGTCTTTGTGCCCACCATTGCAGACTTCCTTAACCTGGCCTGGTGGACCTCTGCTGCCACCTGGTCTTTGTTCCAGCAGCTGCTCTACGGCCTTCTCTACCACAGCTGGTTCCAGGCCGACCCCGCGGAGGCCGAAGGGAGCCCCGAGACGCGCGAGAGCAGCTGCGTCATGAAACAGACCCAGTACTACTTCGGCTCAGTGAACGCCTCCTACAATGCCATCATCGACTGCGGAAACTGCTCCAGGCTGTTCCACGCACAGAGGCTGACCAACACTAACCTGCTCTTCGTGGTGGCGGAGAAGCCGCTGTGCAGCCAGTGCGAGGCTGGCCGACTGCTGCAGAAGGAAACACACTCGGACGGCCCAGAGCAGTGTGAGCTAGTGCAGAGACCACGCTACCGGAGAGGTCCACACATCTGCTTTGATTACAACGCGACAGAAGATACCTCAGACTGTGGCCGCGGAGCCTCCTTCCCTCCGTCGCTGGGCGTCCTGGTCTCCCTGCAGCTGCTGCTTCTCTTGGGCCTGCCTCCCCGGCCGCAGCCTCAAGTCCATGCCCGCGCTGCCTCGCGCCCCCTCTGA

XM_004834133.1 Coding sequence

Cacna2d2 calcium channel, voltage-dependent, alpha 2/delta subunit 2, transcript variant X1

Length: 3417 bp    Location: 4345849..4212901   Strand: -
>XM_004834133.1
ATGGCGGTGCCGGCTAGGACCTGCGGCGCCTCTCGGCCCGGCTCGGCGCGGACCGCGCGCCCCCGGCCCGGCCCCGGCCCCGGCCCCCGGCGCCCGGCGGCTGGGCCCATGCGTCCGCTGTTGCTACTGCTCCCGCTGCTCGCCGCTTCGGGCGCCTCCGCCTACAGCTTCCCCCAGCAGCACACGATGCAGCACTGGGCCCGGCGCCTAGAACAGGAGATTGATGGTGTGATGCGGATCTTTGGAGGCGTTCAGCAGCTCCGTGAGATCTACAAGGACAACCGGAACCTGTTTGAGGTGCAGGAGAATGAGCCTCAGAAGCTGGTGGAGAAGGTGGCAGGGGACATTGAGAGCCTATTGGACAGAAAGGTGCAGGCCCTGAAGAGATTGGCTGATGCTGCAGAGACCTTCCAGAAAGCCCACCACTGGCAGGACAACATCAAGGAGGAAGACATCATGTACTATGATGCCAAGGCTGATGCTGAACTGGATGACCCTGAGGGTGAGGATGTGGAGAGAGGGTCCAAAAGCAGCACCCTAAGGCTGGACTTCATCGAGGACCTAAACTTCAAGAACAAGGTCAACTATTCATACACGGCTGTGCAGATCCCCACAGACATCTACAAAGGCTCCACTGTTATTCTCAATGAGCTCAACTGGACAGAAGCCCTGGAGAACGTATTCATTGAGAACCGCAGGCAGGACCCCACACTGCTGTGGCAGGTCTTCGGCAGTGCCACTGGAGTCACCCGCTACTATCCAGCCACCCCCTGGCGAGCCCCTAAGAAGATTGACCTGTATGATGTCCGACGGAGACCTTGGTATATCCAGGGGGCCTCGTCGCCTAAGGACATGGTCATCATCGTTGATGTGAGTGGCAGTGTGAGTGGCCTGACACTGAAACTAATGAAGACATCTGTCTGCGAGATGCTGGACACACTCTCTGATGACGACTATGTGAACGTGGCCTCGTTCAATGAGAAGGCACAGCCTGTATCTTGCTTCACACACCTGGTGCAGGCCAATGTGCGTAACAAGAAGGTGTTCAAGGAAGCCGTGCAGGGCATGGTGGCCAAGGGCACCACAGGCTACAAGGCTGGCTTTGAGTATGCCTTTGACCAGCTGCAGAACTCCAACATCACTCGGGCCAACTGCAATAAAATGATCATGATGTTCACGGATGGTGGCGAGGACCGTGTGCAGGATGTCTTCGAGAAGTACAACTGGCCCAATCGGACGGTACGTGTCTTCACCTTCTCTGTGGGGCAGCATAACTATGATGTCACTCCCCTGCAGTGGATGGCCTGCACCAACAAAGGTTACTATTTTGAGATTCCTTCCATTGGAGCCATCCGCATCAACACGCAGGAGTATCTAGACGTGTTGGGCAGGCCCATGGTGCTGGCAGGAAAGGAAGCCAAGCAGGTGCAATGGACCAACGTCTATGAGGATGCACTGGGGCTGGGGTTGGTGGTAACAGGGACCCTCCCTGTTTTCAACCTGACGCAAGATGGCCCTGGGGAAAAGAAGAACCAGCTGATCCTGGGTGTGATGGGCATCGATGTGGCTCTGAACGACATCAAGAAGCTAACTCCCAACTACACGCTTGGAGCCAACGGCTATGTATTTGCCATTGATCTGAATGGCTACGTGTTGCTGCACCCCAATCTCAAGCCCCAGACCACCAATTTCCGGGAGCCTGTAACTCTGGACTTCCTGGATGCAGAGCTGGAGGATGAGAACAAGGAGGAGATCCGGCGGAGCATGATTGATGGCAACAAGGGTCACAAGCAGATCAGAACGTTGGTCAAATCTTTGGACGAGAGGTACATAGATGAGGTGATTCGGAACTACACCTGGGTGCCTATAAGGAGCACCAACTACAGCCTGGGGCTGGTGCTCCCACCCTATAGCACCTTCTACCTCCAAGCTAACCTCAGTGACCAGATTCTGCAGGTCAAGTATTTTGAGTTCCTGCTCCCCAGCAGCTTTGAGTCTGAAGGACATGTTTTCATTGCTCCCAGAGAGTATTGCAAGGATCTGAATGCCTCAGACAACAACACTGAGTTCCTGAAAAACTTCATTGAACTCATGGAGAAAGTGACTCCAGACTCCAAGCAGTGTAATAATTTTCTTCTGCACAACCTGATCTTGGACACAGGCATCACACAGCAGTTGGTGGAGCGTGTGTGGCGGGACCAGGATCTCAACACGTACAGCCTGCTGGCCGTGTTTGCTGCCACTGACGGTGGCATCACACGCATCTTCCCCAACAAGGCAGCTGAGGACTGGACAGAGAACCCTGAACCCTTCAATGCCAGCTTCTACCGCCGCAGCCTGGATAACCACGGTTATATCTTCAAGCCCCCACATCAGGACACCTTGTTAAGGCCGCTGGAACTGGAGAATGACACAGTGGGAGTCCTTGTCAGCACAGCTGTGGAGCTCAGCCTAGGTGGGCACACACTGAGGCCAGCAGTGGTGGGTGTCAAGCTGGACCCGGAGGCTTGGGCTGAGAAGTTTAAGGTGCTTGCCAGTAATCGTACCCACCAGGACCAGCCTCAGAAGCAGTGTGGCCCCAACAACCCTTGTGAGATGGATTGTGAGGTTAACAATGAGGACCTTCTCTGTGTCCTCATTGATGATGGAGGGTTCCTGGTGCTGTCAAACCAGAACCATCAGTGGGACCAGGTTGGCAGGTTCTTCAGTGAGGTGGATGCCAACCTGATGCTGGCACTCTACAACAATTCCTTCTATACCCACAAGGAGTCCTACGACTATCAGGCAGCCTGTGCTCCCCAGCCTCCTGGCAACCTGGGTGCTGCACCCCGGGGTGTCTTTGTGCCCACCATTGCAGACTTCCTTAACCTGGCCTGGTGGACCTCTGCTGCCACCTGGTCTTTGTTCCAGCAGCTGCTCTACGGCCTTCTCTACCACAGCTGGTTCCAGGCCGACCCCGCGGAGGCCGAAGGGAGCCCCGAGACGCGCGAGAGCAGCTGCGTCATGAAACAGACCCAGTACTACTTCGGCTCAGTGAACGCCTCCTACAATGCCATCATCGACTGCGGAAACTGCTCCAGGCTGTTCCACGCACAGAGGCTGACCAACACTAACCTGCTCTTCGTGGTGGCGGAGAAGCCGCTGTGCAGCCAGTGCGAGGCTGGCCGACTGCTGCAGAAGGAAACACACTCGGACGGCCCAGAGCAGTGTGAGCTAGTGCAGAGACCACGCTACCGGAGAGGTCCACACATCTGCTTTGATTACAACGCGACAGAAGATACCTCAGACTGTGGCCGCGGAGCCTCCTTCCCTCCGTCGCTGGGCGTCCTGGTCTCCCTGCAGCTGCTGCTTCTCTTGGGCCTGCCTCCCCGGCCGCAGCCTCAAGTCCATGCCCGCGCTGCCTCGCGCCCCCTCTGA

XM_004834137.1 Coding sequence

Cacna2d2 calcium channel, voltage-dependent, alpha 2/delta subunit 2, transcript variant X5

Length: 3441 bp    Location: 4345849..4212901   Strand: -
>XM_004834137.1
ATGGCGGTGCCGGCTAGGACCTGCGGCGCCTCTCGGCCCGGCTCGGCGCGGACCGCGCGCCCCCGGCCCGGCCCCGGCCCCGGCCCCCGGCGCCCGGCGGCTGGGCCCATGCGTCCGCTGTTGCTACTGCTCCCGCTGCTCGCCGCTTCGGGCGCCTCCGCCTACAGCTTCCCCCAGCAGCACACGATGCAGCACTGGGCCCGGCGCCTAGAACAGGAGATTGATGGTGTGATGCGGATCTTTGGAGGCGTTCAGCAGCTCCGTGAGATCTACAAGGACAACCGGAACCTGTTTGAGGTGCAGGAGAATGAGCCTCAGAAGCTGGTGGAGAAGGTGGCAGGGGACATTGAGAGCCTATTGGACAGAAAGGTGCAGGCCCTGAAGAGATTGGCTGATGCTGCAGAGACCTTCCAGAAAGCCCACCACTGGCAGGACAACATCAAGGAGGAAGACATCATGTACTATGATGCCAAGGCTGATGCTGAACTGGATGACCCTGAGGGTGAGGATGTGGAGAGAGGGTCCAAAAGCAGCACCCTAAGGCTGGACTTCATCGAGGACCTAAACTTCAAGAACAAGGTCAACTATTCATACACGGCTGTGCAGATCCCCACAGACATCTACAAAGGCTCCACTGTTATTCTCAATGAGCTCAACTGGACAGAAGCCCTGGAGAACGTATTCATTGAGAACCGCAGGCAGGACCCCACACTGCTGTGGCAGGTCTTCGGCAGTGCCACTGGAGTCACCCGCTACTATCCAGCCACCCCCTGGCGAGCCCCTAAGAAGATTGACCTGTATGATGTCCGACGGAGACCTTGGTATATCCAGGGGGCCTCGTCGCCTAAGGACATGGTCATCATCGTTGATGTGAGTGGCAGTGTGAGTGGCCTGACACTGAAACTAATGAAGACATCTGTCTGCGAGATGCTGGACACACTCTCTGATGACGACTATGTGAACGTGGCCTCGTTCAATGAGAAGGCACAGCCTGTATCTTGCTTCACACACCTGGTGCAGGCCAATGTGCGTAACAAGAAGGTGTTCAAGGAAGCCGTGCAGGGCATGGTGGCCAAGGGCACCACAGGCTACAAGGCTGGCTTTGAGTATGCCTTTGACCAGCTGCAGAACTCCAACATCACTCGGGCCAACTGCAATAAAATGATCATGATGTTCACGGATGGTGGCGAGGACCGTGTGCAGGATGTCTTCGAGAAGTACAACTGGCCCAATCGGACGGTACGTGTCTTCACCTTCTCTGTGGGGCAGCATAACTATGATGTCACTCCCCTGCAGTGGATGGCCTGCACCAACAAAGGTTACTATTTTGAGATTCCTTCCATTGGAGCCATCCGCATCAACACGCAGGAGTATCTAGACGTGTTGGGCAGGCCCATGGTGCTGGCAGGAAAGGAAGCCAAGCAGGTGCAATGGACCAACGTCTATGAGGATGCACTGGGGCTGGGGTTGGTGGTAACAGGGACCCTCCCTGTTTTCAACCTGACGCAAGATGGCCCTGGGGAAAAGAAGAACCAGCTGATCCTGGGTGTGATGGGCATCGATGTGGCTCTGAACGACATCAAGAAGCTAACTCCCAACTACACGCTTGGAGCCAACGGCTATGTATTTGCCATTGATCTGAATGGCTACGTGTTGCTGCACCCCAATCTCAAGCCCCAGACCACCAATTTCCGGGAGCCTGTAACTCTGGACTTCCTGGATGCAGAGCTGGAGGATGAGAACAAGGAGGAGATCCGGCGGAGCATGATTGATGGCAACAAGGGTCACAAGCAGATCAGAACGTTGGTCAAATCTTTGGACGAGAGGTACATAGATGAGGTGATTCGGAACTACACCTGGGTGCCTATAAGGAGCACCAACTACAGCCTGGGGCTGGTGCTCCCACCCTATAGCACCTTCTACCTCCAAGCTAACCTCAGTGACCAGATTCTGCAGGTCAAGTTGCCAATCAGCAAACTGAAGGATTTTGAGTTCCTGCTCCCCAGCAGCTTTGAGTCTGAAGGACATGTTTTCATTGCTCCCAGAGAGTATTGCAAGGATCTGAATGCCTCAGACAACAACACTGAGTTCCTGAAAAACTTCATTGAACTCATGGAGAAAGTGACTCCAGACTCCAAGCAGTGTAATAATTTTCTTCTGCACAACCTGATCTTGGACACAGGCATCACACAGCAGTTGGTGGAGCGTGTGTGGCGGGACCAGGATCTCAACACGTACAGCCTGCTGGCCGTGTTTGCTGCCACTGACGGTGGCATCACACGCATCTTCCCCAACAAGGCAGCTGAGGACTGGACAGAGAACCCTGAACCCTTCAATGCCAGCTTCTACCGCCGCAGCCTGGATAACCACGGTTATATCTTCAAGCCCCCACATCAGGACACCTTGTTAAGGCCGCTGGAACTGGAGAATGACACAGTGGGAGTCCTTGTCAGCACAGCTGTGGAGCTCAGCCTAGGTGGGCACACACTGAGGCCAGCAGTGGTGGGTGTCAAGCTGGACCCGGAGGCTTGGGCTGAGAAGTTTAAGGTGCTTGCCAGTAATCGTACCCACCAGGACCAGCCTCAGAAGTGTGGCCCCAACAACCCTTGTGAGATGGATTGTGAGGTTAACAATGAGGACCTTCTCTGTGTCCTCATTGATGATGGAGGGTTCCTGGTGCTGTCAAACCAGAACCATCAGTGGGACCAGGTTGGCAGGTTCTTCAGTGAGGTGGATGCCAACCTGATGCTGGCACTCTACAACAATTCCTTCTATACCCACAAGGAGTCCTACGACTATCAGGCAGCCTGTGCTCCCCAGCCTCCTGGCAACCTGGGTGCTGCACCCCGGGGTGTCTTTGTGCCCACCATTGCAGACTTCCTTAACCTGGCCTGGTGGACCTCTGCTGCCACCTGGTCTTTGTTCCAGCAGCTGCTCTACGGCCTTCTCTACCACAGCTGGTTCCAGGCCGACCCCGCGGAGGCCGAAGGGAGCCCCGAGACGCGCGAGAGCAGCTGCGTCATGAAACAGACCCAGTACTACTTCGGCTCAGTGAACGCCTCCTACAATGCCATCATCGACTGCGGAAACTGCTCCAGGCTGTTCCACGCACAGAGGCTGACCAACACTAACCTGCTCTTCGTGGTGGCGGAGAAGCCGCTGTGCAGCCAGTGCGAGGCTGGCCGACTGCTGCAGAAGGAAACACACTGCCCAGCGGACGGCCCAGAGCAGTGTGAGCTAGTGCAGAGACCACGCTACCGGAGAGGTCCACACATCTGCTTTGATTACAACGCGACAGAAGATACCTCAGACTGTGGCCGCGGAGCCTCCTTCCCTCCGTCGCTGGGCGTCCTGGTCTCCCTGCAGCTGCTGCTTCTCTTGGGCCTGCCTCCCCGGCCGCAGCCTCAAGTCCATGCCCGCGCTGCCTCGCGCCCCCTCTGA

XM_004834134.1 Coding sequence

Cacna2d2 calcium channel, voltage-dependent, alpha 2/delta subunit 2, transcript variant X2

Length: 3435 bp    Location: 4345849..4212901   Strand: -
>XM_004834134.1
ATGGCGGTGCCGGCTAGGACCTGCGGCGCCTCTCGGCCCGGCTCGGCGCGGACCGCGCGCCCCCGGCCCGGCCCCGGCCCCGGCCCCCGGCGCCCGGCGGCTGGGCCCATGCGTCCGCTGTTGCTACTGCTCCCGCTGCTCGCCGCTTCGGGCGCCTCCGCCTACAGCTTCCCCCAGCAGCACACGATGCAGCACTGGGCCCGGCGCCTAGAACAGGAGATTGATGGTGTGATGCGGATCTTTGGAGGCGTTCAGCAGCTCCGTGAGATCTACAAGGACAACCGGAACCTGTTTGAGGTGCAGGAGAATGAGCCTCAGAAGCTGGTGGAGAAGGTGGCAGGGGACATTGAGAGCCTATTGGACAGAAAGGTGCAGGCCCTGAAGAGATTGGCTGATGCTGCAGAGACCTTCCAGAAAGCCCACCACTGGCAGGACAACATCAAGGAGGAAGACATCATGTACTATGATGCCAAGGCTGATGCTGAACTGGATGACCCTGAGGGTGAGGATGTGGAGAGAGGGTCCAAAAGCAGCACCCTAAGGCTGGACTTCATCGAGGACCTAAACTTCAAGAACAAGGTCAACTATTCATACACGGCTGTGCAGATCCCCACAGACATCTACAAAGGCTCCACTGTTATTCTCAATGAGCTCAACTGGACAGAAGCCCTGGAGAACGTATTCATTGAGAACCGCAGGCAGGACCCCACACTGCTGTGGCAGGTCTTCGGCAGTGCCACTGGAGTCACCCGCTACTATCCAGCCACCCCCTGGCGAGCCCCTAAGAAGATTGACCTGTATGATGTCCGACGGAGACCTTGGTATATCCAGGGGGCCTCGTCGCCTAAGGACATGGTCATCATCGTTGATGTGAGTGGCAGTGTGAGTGGCCTGACACTGAAACTAATGAAGACATCTGTCTGCGAGATGCTGGACACACTCTCTGATGACGACTATGTGAACGTGGCCTCGTTCAATGAGAAGGCACAGCCTGTATCTTGCTTCACACACCTGGTGCAGGCCAATGTGCGTAACAAGAAGGTGTTCAAGGAAGCCGTGCAGGGCATGGTGGCCAAGGGCACCACAGGCTACAAGGCTGGCTTTGAGTATGCCTTTGACCAGCTGCAGAACTCCAACATCACTCGGGCCAACTGCAATAAAATGATCATGATGTTCACGGATGGTGGCGAGGACCGTGTGCAGGATGTCTTCGAGAAGTACAACTGGCCCAATCGGACGGTACGTGTCTTCACCTTCTCTGTGGGGCAGCATAACTATGATGTCACTCCCCTGCAGTGGATGGCCTGCACCAACAAAGGTTACTATTTTGAGATTCCTTCCATTGGAGCCATCCGCATCAACACGCAGGAGTATCTAGACGTGTTGGGCAGGCCCATGGTGCTGGCAGGAAAGGAAGCCAAGCAGGTGCAATGGACCAACGTCTATGAGGATGCACTGGGGCTGGGGTTGGTGGTAACAGGGACCCTCCCTGTTTTCAACCTGACGCAAGATGGCCCTGGGGAAAAGAAGAACCAGCTGATCCTGGGTGTGATGGGCATCGATGTGGCTCTGAACGACATCAAGAAGCTAACTCCCAACTACACGCTTGGAGCCAACGGCTATGTATTTGCCATTGATCTGAATGGCTACGTGTTGCTGCACCCCAATCTCAAGCCCCAGACCACCAATTTCCGGGAGCCTGTAACTCTGGACTTCCTGGATGCAGAGCTGGAGGATGAGAACAAGGAGGAGATCCGGCGGAGCATGATTGATGGCAACAAGGGTCACAAGCAGATCAGAACGTTGGTCAAATCTTTGGACGAGAGGTACATAGATGAGGTGATTCGGAACTACACCTGGGTGCCTATAAGGAGCACCAACTACAGCCTGGGGCTGGTGCTCCCACCCTATAGCACCTTCTACCTCCAAGCTAACCTCAGTGACCAGATTCTGCAGGTCAAGTTGCCAATCAGCAAACTGAAGGATTTTGAGTTCCTGCTCCCCAGCAGCTTTGAGTCTGAAGGACATGTTTTCATTGCTCCCAGAGAGTATTGCAAGGATCTGAATGCCTCAGACAACAACACTGAGTTCCTGAAAAACTTCATTGAACTCATGGAGAAAGTGACTCCAGACTCCAAGCAGTGTAATAATTTTCTTCTGCACAACCTGATCTTGGACACAGGCATCACACAGCAGTTGGTGGAGCGTGTGTGGCGGGACCAGGATCTCAACACGTACAGCCTGCTGGCCGTGTTTGCTGCCACTGACGGTGGCATCACACGCATCTTCCCCAACAAGGCAGCTGAGGACTGGACAGAGAACCCTGAACCCTTCAATGCCAGCTTCTACCGCCGCAGCCTGGATAACCACGGTTATATCTTCAAGCCCCCACATCAGGACACCTTGTTAAGGCCGCTGGAACTGGAGAATGACACAGTGGGAGTCCTTGTCAGCACAGCTGTGGAGCTCAGCCTAGGTGGGCACACACTGAGGCCAGCAGTGGTGGGTGTCAAGCTGGACCCGGAGGCTTGGGCTGAGAAGTTTAAGGTGCTTGCCAGTAATCGTACCCACCAGGACCAGCCTCAGAAGTGTGGCCCCAACAACCCTTGTGAGATGGATTGTGAGGTTAACAATGAGGACCTTCTCTGTGTCCTCATTGATGATGGAGGGTTCCTGGTGCTGTCAAACCAGAACCATCAGTGGGACCAGGTTGGCAGGTTCTTCAGTGAGGTGGATGCCAACCTGATGCTGGCACTCTACAACAATTCCTTCTATACCCACAAGGAGTCCTACGACTATCAGGCAGCCTGTGCTCCCCAGCCTCCTGGCAACCTGGGTGCTGCACCCCGGGGTGTCTTTGTGCCCACCATTGCAGACTTCCTTAACCTGGCCTGGTGGACCTCTGCTGCCACCTGGTCTTTGTTCCAGCAGCTGCTCTACGGCCTTCTCTACCACAGCTGGTTCCAGGCCGACCCCGCGGAGGCCGAAGGGAGCCCCGAGACGCGCGAGAGCAGCTGCGTCATGAAACAGACCCAGTACTACTTCGGCTCAGTGAACGCCTCCTACAATGCCATCATCGACTGCGGAAACTGCTCCAGGCTGTTCCACGCACAGAGGCTGACCAACACTAACCTGCTCTTCGTGGTGGCGGAGAAGCCGCTGTGCAGCCAGTGCGAGGCTGGCCGACTGCTGCAGAAGGAAACACACTCGGACGGCCCAGAGCAGTGTGAGCTAGTGCAGAGACCACGCTACCGGAGAGGTCCACACATCTGCTTTGATTACAACGCGACAGAAGATACCTCAGACTGTGGCCGCGGAGCCTCCTTCCCTCCGTCGCTGGGCGTCCTGGTCTCCCTGCAGCTGCTGCTTCTCTTGGGCCTGCCTCCCCGGCCGCAGCCTCAAGTCCATGCCCGCGCTGCCTCGCGCCCCCTCTGA

XM_004834146.1 Coding sequence

Hemk1 HemK methyltransferase family member 1, transcript variant X6

Length: 1023 bp    Location: 4404597..4415186   Strand: +
>XM_004834146.1
ATGGGGTTTTGGGGTCGAATGCTGTGGACTCTTGTGTCTGGCCCCAGCGGGAGGAGGGGAGGCGCCCAGGGCCGGGCCTTCAGCTTATGGCCACCCCGTCCACCTCTACCCAGGCTGTTGAATGCCACAGAGCTAGTCAGCCACTGGACAGGAGTCTTTGAGAAGAGAGGCATCCCAGAGGCCCGAGAATCCAGTGAATACATTGTGGCTCATGTCCTTGGAGCCAAAACATTTCAGAGCTTACAGCCAGTACTTTGGACCCAACCCCTGACTCCTCAACAACTGCTGTGCATCCAGGAGCTATGTAGCCGCCGATTGCAGAGGATGCCTGTACAGTACATCCTTGGGGAGTGGGACTTTCAGGGGCTCAATCTGAAGATGGCACCCCCAGTGTTCATTCCTCGACCTGAGACAGAGGAACTGGTGGAATGGGTACTGGAGGAGATGGCCCAGAGGCCCCATGTGATAGAAGGACAAGATGGCCCCCGCATTCTGGAGGTGGGCTGTGGATCAGGAGCCATCTCCCTCAGCCTGCTGACCCGGCTTCCTGAGAGCCAAGTCATTGCTGTGGATAAAGAGGAAGCTGCCATCAATCTGACCTGTGAGAATGCTAAGAGGCTTCAGTTGCAGGACAGGATTTGGATTGTCCCCCTTGATGTGACCTCAGAGGGGAGCTGGACACATCTTCTGCCATGGAGTCCTATGGACCTGGTTGTCAGCAATCCTCCATACATCTTCCACCAGGACATGGAGCAGCTGGCCCCAGAGATCCGCAGCTATGAAGATCCAGTGGCCCTGGATGGTGGGGAGGAGGGCATGGACATCATTACCAACATCTTGACCCTGGCACCTCGACTCCTGAAGGACTGTGGGAGCATCTTCTTGGAAGTGGACCCAAGGCACCCAGAGCTTGTCAACAATTGGCTTCAAAGTCGGCCTGATCTGTACCTGAATCTTGTGGCTGTGCACAAGGACTTCTGTGGGAAGCCCCGGTTCCTGCATGTGCAGAGGTCTGAGCCATAG

XM_004834145.1 Coding sequence

Hemk1 HemK methyltransferase family member 1, transcript variant X5

Length: 1023 bp    Location: 4404597..4415186   Strand: +
>XM_004834145.1
ATGGGGTTTTGGGGTCGAATGCTGTGGACTCTTGTGTCTGGCCCCAGCGGGAGGAGGGGAGGCGCCCAGGGCCGGGCCTTCAGCTTATGGCCACCCCGTCCACCTCTACCCAGGCTGTTGAATGCCACAGAGCTAGTCAGCCACTGGACAGGAGTCTTTGAGAAGAGAGGCATCCCAGAGGCCCGAGAATCCAGTGAATACATTGTGGCTCATGTCCTTGGAGCCAAAACATTTCAGAGCTTACAGCCAGTACTTTGGACCCAACCCCTGACTCCTCAACAACTGCTGTGCATCCAGGAGCTATGTAGCCGCCGATTGCAGAGGATGCCTGTACAGTACATCCTTGGGGAGTGGGACTTTCAGGGGCTCAATCTGAAGATGGCACCCCCAGTGTTCATTCCTCGACCTGAGACAGAGGAACTGGTGGAATGGGTACTGGAGGAGATGGCCCAGAGGCCCCATGTGATAGAAGGACAAGATGGCCCCCGCATTCTGGAGGTGGGCTGTGGATCAGGAGCCATCTCCCTCAGCCTGCTGACCCGGCTTCCTGAGAGCCAAGTCATTGCTGTGGATAAAGAGGAAGCTGCCATCAATCTGACCTGTGAGAATGCTAAGAGGCTTCAGTTGCAGGACAGGATTTGGATTGTCCCCCTTGATGTGACCTCAGAGGGGAGCTGGACACATCTTCTGCCATGGAGTCCTATGGACCTGGTTGTCAGCAATCCTCCATACATCTTCCACCAGGACATGGAGCAGCTGGCCCCAGAGATCCGCAGCTATGAAGATCCAGTGGCCCTGGATGGTGGGGAGGAGGGCATGGACATCATTACCAACATCTTGACCCTGGCACCTCGACTCCTGAAGGACTGTGGGAGCATCTTCTTGGAAGTGGACCCAAGGCACCCAGAGCTTGTCAACAATTGGCTTCAAAGTCGGCCTGATCTGTACCTGAATCTTGTGGCTGTGCACAAGGACTTCTGTGGGAAGCCCCGGTTCCTGCATGTGCAGAGGTCTGAGCCATAG

XM_004834148.1 Coding sequence

Hemk1 HemK methyltransferase family member 1, transcript variant X8

Length: 1023 bp    Location: 4404597..4415186   Strand: +
>XM_004834148.1
ATGGGGTTTTGGGGTCGAATGCTGTGGACTCTTGTGTCTGGCCCCAGCGGGAGGAGGGGAGGCGCCCAGGGCCGGGCCTTCAGCTTATGGCCACCCCGTCCACCTCTACCCAGGCTGTTGAATGCCACAGAGCTAGTCAGCCACTGGACAGGAGTCTTTGAGAAGAGAGGCATCCCAGAGGCCCGAGAATCCAGTGAATACATTGTGGCTCATGTCCTTGGAGCCAAAACATTTCAGAGCTTACAGCCAGTACTTTGGACCCAACCCCTGACTCCTCAACAACTGCTGTGCATCCAGGAGCTATGTAGCCGCCGATTGCAGAGGATGCCTGTACAGTACATCCTTGGGGAGTGGGACTTTCAGGGGCTCAATCTGAAGATGGCACCCCCAGTGTTCATTCCTCGACCTGAGACAGAGGAACTGGTGGAATGGGTACTGGAGGAGATGGCCCAGAGGCCCCATGTGATAGAAGGACAAGATGGCCCCCGCATTCTGGAGGTGGGCTGTGGATCAGGAGCCATCTCCCTCAGCCTGCTGACCCGGCTTCCTGAGAGCCAAGTCATTGCTGTGGATAAAGAGGAAGCTGCCATCAATCTGACCTGTGAGAATGCTAAGAGGCTTCAGTTGCAGGACAGGATTTGGATTGTCCCCCTTGATGTGACCTCAGAGGGGAGCTGGACACATCTTCTGCCATGGAGTCCTATGGACCTGGTTGTCAGCAATCCTCCATACATCTTCCACCAGGACATGGAGCAGCTGGCCCCAGAGATCCGCAGCTATGAAGATCCAGTGGCCCTGGATGGTGGGGAGGAGGGCATGGACATCATTACCAACATCTTGACCCTGGCACCTCGACTCCTGAAGGACTGTGGGAGCATCTTCTTGGAAGTGGACCCAAGGCACCCAGAGCTTGTCAACAATTGGCTTCAAAGTCGGCCTGATCTGTACCTGAATCTTGTGGCTGTGCACAAGGACTTCTGTGGGAAGCCCCGGTTCCTGCATGTGCAGAGGTCTGAGCCATAG

XM_004834152.1 Coding sequence

Hemk1 HemK methyltransferase family member 1, transcript variant X12

Length: 855 bp    Location: 4404597..4414262   Strand: +
>XM_004834152.1
ATGGGGTTTTGGGGTCGAATGCTGTGGACTCTTGTGTCTGGCCCCAGCGGGAGGAGGGGAGGCGCCCAGGGCCGGGCCTTCAGCTTATGGCCACCCCGTCCACCTCTACCCAGGCTGTTGAATGCCACAGAGCTAGTCAGCCACTGGACAGGAGTCTTTGAGAAGAGAGGCATCCCAGAGGCCCGAGAATCCAGTGAATACATTGTGGCTCATGTCCTTGGAGCCAAAACATTTCAGAGCTTACAGCCAGTACTTTGGACCCAACCCCTGACTCCTCAACAACTGCTGTGCATCCAGGAGCTATGTAGCCGCCGATTGCAGAGGATGCCTGTACAGTACATCCTTGGGGAGTGGGACTTTCAGGGGCTCAATCTGAAGATGGCACCCCCAGTGTTCATTCCTCGACCTGAGACAGAGGAACTGGTGGAATGGGTACTGGAGGAGATGGCCCAGAGGCCCCATGTGATAGAAGGACAAGATGGCCCCCGCATTCTGGAGGTGGGCTGTGGATCAGGAGCCATCTCCCTCAGCCTGCTGACCCGGCTTCCTGAGAGCCAAGTCATTGCTGTGGATAAAGAGGAAGCTGCCATCAATCTGACCTGTGAGAATGCTAAGAGGCTTCAGTTGCAGGACAGGATTTGGATTGTCCCCCTTGATGTGACCTCAGAGGGGAGCTGGACACATCTTCTGCCATGGAGTCCTATGGACCTGGTTGTCAGCAATCCTCCATACATCTTCCACCAGGACATGGAGCAGCTGGCCCCAGAGATCCGCAGACTCCTCTCTGAGCCTCAGTTTCCTGCCTCTGAAGGAGAACCAATAGTGCTTTGCAGGGCTACGGGGAAGCCTCAGTGA

XM_004834156.1 Coding sequence

Hemk1 HemK methyltransferase family member 1, transcript variant X16

Length: 699 bp    Location: 4407424..4415186   Strand: +
>XM_004834156.1
ATGCCTGTACAGTACATCCTTGGGGAGTGGGACTTTCAGGGGCTCAATCTGAAGATGGCACCCCCAGTGTTCATTCCTCGACCTGAGACAGAGGAACTGGTGGAATGGGTACTGGAGGAGATGGCCCAGAGGCCCCATGTGATAGAAGGACAAGATGGCCCCCGCATTCTGGAGGTGGGCTGTGGATCAGGAGCCATCTCCCTCAGCCTGCTGACCCGGCTTCCTGAGAGCCAAGTCATTGCTGTGGATAAAGAGGAAGCTGCCATCAATCTGACCTGTGAGAATGCTAAGAGGCTTCAGTTGCAGGACAGGATTTGGATTGTCCCCCTTGATGTGACCTCAGAGGGGAGCTGGACACATCTTCTGCCATGGAGTCCTATGGACCTGGTTGTCAGCAATCCTCCATACATCTTCCACCAGGACATGGAGCAGCTGGCCCCAGAGATCCGCAGCTATGAAGATCCAGTGGCCCTGGATGGTGGGGAGGAGGGCATGGACATCATTACCAACATCTTGACCCTGGCACCTCGACTCCTGAAGGACTGTGGGAGCATCTTCTTGGAAGTGGACCCAAGGCACCCAGAGCTTGTCAACAATTGGCTTCAAAGTCGGCCTGATCTGTACCTGAATCTTGTGGCTGTGCACAAGGACTTCTGTGGGAAGCCCCGGTTCCTGCATGTGCAGAGGTCTGAGCCATAG

XM_004834158.1 Coding sequence

Mapkapk3 mitogen-activated protein kinase-activated protein kinase 3, transcript variant X1

Length: 1206 bp    Location: 4446850..4476630   Strand: +
>XM_004834158.1
ATGGATTGCGAGACGGCAGAGGAGCAGGGTGGCCTTGGGCTCCCACCTGGGGCCCTCGGCGGACCCGGCTGGTGCGGTTCTCCAGCCCTCGGGGGGCGGCGGGAGCCCAAGAAGTACGCAGTGACCGATGACTACCAGTTATCCAAGCAGGTACTGGGTCTAGGTGTGAACGGCAAGGTACTGGAGTGCTTCCACCGGCGCACCGGGCAGAAGTGTGCCCTGAAGCTCCTGTACGATAGCCCCAAGGCCCGGCAGGAGGTGGACCACCACTGGCAGGCCTCGGGTGGCCCCCACATTGTGTGCATCCTGGACGTGTATGAGAACATGCATCACGGCAAGCGCTGCCTCCTCATCATCATGGAATGCATGGAAGGTGGTGAATTGTTTAGTAGGATTCAGGAACGTGGCGACCAGGCTTTCACTGAGAGAGAGGCTGCAGGGATAATGCGGGACATTGGCACCGCCATTCAGTTCCTGCACAGCCAGAACATCGCCCATCGAGATGTCAAGCCTGAAAACTTGCTTTACACATCCAAGGAGAAAGATGCTGTGCTTAAGCTCACTGACTTTGGCTTTGCCAAGGAGACCACCCAAAATGCCTTACAGACGCCCTGCTACACTCCCTATTATGTGGAAATCCTCTGGCTTGCTGACCTCATTGCACAGATGGGAAGACCAAGACCCACCCCTGAGGTCTTGGGTCCAGAGAAGTATGACAAGTCCTGTGACATGTGGTCCTTGGGTGTCATCATGTACATTCTCCTGTGTGGCTTCCCACCCTTCTATTCCAATACGGGCCAGGCCATCTCCCCAGGGATGAAGAGGAGGATCCGCCTGGGCCAGTATGGCTTCCCCAATCCTGAGTGGTCTGAGGTCTCTGAGGATGCCAAGCAGCTGATTCGACTACTGCTGAAGACAGACCCCACAGAGAGGCTGACTATCACGCAGTTCATGAACCATCCCTGGATCAATCAATCAATGGTGGTGCCACAGACCCCACTTCACACGGCCCGAGTGCTGCAAGAGGACAAAGACCATTGGGATGACGTCAAGGAGGAGATGACCAGTGCCCTGGCCACCATGCGGGTAGATTATGACCAGGTGAAGATCAAGGACCTGAAGACCTCTAACAACCGGCTCCTCAATAAGCGGAGAAAAAAACAGGCAGGCAGCTCCTCAGCTTCACAGGGCTGCAACAACCAGTAG

XM_004834159.1 Coding sequence

Mapkapk3 mitogen-activated protein kinase-activated protein kinase 3, transcript variant X2

High confidence: 4 potential gene matches
Length: 1155 bp    Location: 4446850..4476630   Strand: +
>XM_004834159.1
ATGGATTGCGAGACGGCAGAGGAGCAGGGTGGCCTTGGGCTCCCACCTGGGGCCCTCGGCGGACCCGGCTGGTGCGGTTCTCCAGCCCTCGGGGGGCGGCGGGAGCCCAAGAAGTACGCAGTGACCGATGACTACCAGTTATCCAAGCAGGTACTGGGTCTAGGTGTGAACGGCAAGGTACTGGAGTGCTTCCACCGGCGCACCGGGCAGAAGTGTGCCCTGAAGCTCCTGTACGATAGCCCCAAGGCCCGGCAGGAGGTGGACCACCACTGGCAGGCCTCGGGTGGCCCCCACATTGTGTGCATCCTGGACGTGTATGAGAACATGCATCACGGCAAGCGCTGCCTCCTCATCATCATGGAATGCATGGAAGGTGGTGAATTGTTTAGTAGGATTCAGGAACGTGGCGACCAGGCTTTCACTGAGAGAGAGGCTGCAGGGATAATGCGGGACATTGGCACCGCCATTCAGTTCCTGCACAGCCAGAACATCGCCCATCGAGATGTCAAGCCTGAAAACTTGCTTTACACATCCAAGGAGAAAGATGCTGTGCTTAAGCTCACTGACTTTGGCTTTGCCAAGGAGACCACCCAAAATGCCTTACAGACGCCCTGCTACACTCCCTATTATGTGGCCCCTGAGGTCTTGGGTCCAGAGAAGTATGACAAGTCCTGTGACATGTGGTCCTTGGGTGTCATCATGTACATTCTCCTGTGTGGCTTCCCACCCTTCTATTCCAATACGGGCCAGGCCATCTCCCCAGGGATGAAGAGGAGGATCCGCCTGGGCCAGTATGGCTTCCCCAATCCTGAGTGGTCTGAGGTCTCTGAGGATGCCAAGCAGCTGATTCGACTACTGCTGAAGACAGACCCCACAGAGAGGCTGACTATCACGCAGTTCATGAACCATCCCTGGATCAATCAATCAATGGTGGTGCCACAGACCCCACTTCACACGGCCCGAGTGCTGCAAGAGGACAAAGACCATTGGGATGACGTCAAGGAGGAGATGACCAGTGCCCTGGCCACCATGCGGGTAGATTATGACCAGGTGAAGATCAAGGACCTGAAGACCTCTAACAACCGGCTCCTCAATAAGCGGAGAAAAAAACAGGCAGGCAGCTCCTCAGCTTCACAGGGCTGCAACAACCAGTAG

XM_004834166.1 Coding sequence

Vprbp Vpr (HIV-1) binding protein, transcript variant X2

Length: 4518 bp    Location: 5240019..5176828   Strand: -
>XM_004834166.1
ATGACTACAGTAGCGGTACATGTGGACTCCAAAGCCGAGCTCACTACCCTGCTGGAGCAGTGGGAAAAGGAACATGGCAGTGGGCAGGACATGGTACCTATCCTTACAAGGATGTCTGAATTGATTGAAAAAGAAACTGAAGAATATCGTAAAGGGGATCCAGACCCATTTGATGATCGACATCCTGGTCGAGCTGATCCAGAGTGTATGCTGGGCCACTTGCTGAGAATACTCTTCAAGAATGATGATTTCATGAATGCACTGGTGAATGCATATGTGATGACAAGCCGAGAGCCTCCTTTAAATACTGCAGCTTGCAGACTGCTACTGGACATCATGCCAGGGCTGGAAACTGCTGTTGTCTTTCAAGAAAAGGAAGGAATTGTTGAGAATCTTTTCAAATGGGCCCGAGAGGCTGATCAGCCTCTGAGGACATACTCTACTGGACTGTTAGGGGGTGCTATGGAAAATCAAGACATTGCTGCCAACTACAGGGATGAAAATTCACAACTGGTGGCAATAGTGCTTCGAAGACTGAGGGAGCTACAGCTTCAGGAAGTGGCTTTGCGGCAAGAAAACAAGCGTCCACGGAAGCTCTCTTCTGAACCCCTTTTGCCTCTGGATGAGGAAGCTGTGGATATGGACTATGGTGACATGGCAGTAGATTTAGTGGATGGAGAACAGGAAGAAGCTTCTGGAGACATGGAAATCTCCTTTCATCTTGATTCAAGCCACAAGACCAGTAGTAGAGTGAACTCAGCAACCAAGCCTGAAGGAGGAGGATTAAAGAAAAACAAGTCAGCAAAACAGGGTGACAGAGAGAGCTTTAGGAAAGCCAAACAAAAATTGGGTTTCTCATCTTCTGATCCAGATAGAATGTTTGTTGAGTTGTCTAATAGCAGCTGGTCAGAAATGTCCCCCTGGGTGATTGGTACCAATTATACCCTTTATCCCATGACTCCTGCTATTGAGCAGCGACTCATTCTCCAGTATTTGACCCCTCTAGGAGAATATCAGGAGTTACTTCCCATATTCATGCAACTTGGATCACGGGAGTTGATGATGTTCTATATTGATCTAAAACAGACTAATGATGTTCTGCTTACATTTGAGGCACTCAAGCATCTAGCATCTCTCCTGCTCCATAACAAATTTGCTACAGAATTTGTTGCGCATGGAGGAGTACAGAAATTATTGGAAATTCCTCGTCCTTCTATGGCCGCAACTGGTGTATCCATGTGCTTGTATTACTTGTCCTACAACCAGGATGCTATGGAAAGAGTTTGCATGCATCCCCACAATGTTCTATCTGATGTGGTAAACTATACCCTGTGGTTAATGGAATGTTCCCACGCCTCAGGATGCTGCCATGCTACCATGTTTTTCTCAATTTGCTTCTCATTTCGGGCTGTTTTAGAGCTCTTTGATCGCTATGATGGTCTTCGTCGTCTGGTGAACTTGATCAGTACTTTGGAGATTCTGAATTTGGAAGATCAAGGTGCACTTCTGAGTGATGATGAAATATTTGCTAGCCGCCAAACTGGGAAACATACCTGCATGGCCTTGCGCAAGTATTTTGAGGCTCACCTGGCCATTAAATTGGAACAAGTGAAGCAGTCACTTCAGAGGACTGAGGGTGGCATTCTTGTTCACCCTCAACCTCCATACAAGGCATGCTCATATACTCATGAACAGATTGTGGAAATGATGGAGTTTTTGATAGAATATGGCCCTGCACAGCTGTATTGGGAACCAGCTGAAGTCTTCCTCAAACTTTCTTGTGTTCAGCTGTTGTTGCAGCTTATTTCTATTGCCTGCAATTGGAAGACCTATTATGCAAGGAATGACACTGTGCGCTTTGCTTTGGATGTTCTGGCTATTCTCACTGTGGTGCCGAAAATACAGCTCCAGTTGGCAGAATCAGTGGATGTACTGGATGAGACTGGCTCTACTGTCTCCACTGTAGGTATCAGCATTATTTTGGGAGTGGCTGAGGGTGAGTTCTTTATCCATGATGCTGAAATTCAGAAATCAGCGCTTCAAATTATCATCAATTGTGTATGTGGCCCAGATAACCGAATATCCAGTATTGGCAAATTTATCTCTGGAACTCCTCGGAGAAAGCTGCCTCAGACACCCAAGAGCAGTGAGAACACCCTGGCCAAGATGTGGAATGTAGTCCAATCCAATAATGGCATCAAGGTGCTTCTGTCCTTATTGTCCATCAAGATGCCCATCACAGATGCAGACCAGATCCGGGCCCTGGCCTGTAAGGCCCTGGTGGGCTTGTCTCGGAGTAGCACTGTCAGGCAGATCATCAGCAAACTGCCGCTTTTCAGTAGCTGCCAGATCCAGCAGCTGATGAAGGAACCTGTACTTCAGGACAAGCGCAGTGACCATGTCAAATTCTGCAAATATGCCGCTGAGCTCATTGAAAGGGTGTCCGGAAAGCCACTTCTTATTGGCACTGATGTGTCTTTGGCACGATTACAGAAAGCAGATGTGGTTGCCCAGTCAAGAATCTCTTTCCCTGAGAAAGAATTGCTTTTGTTGATACGGAACCATCTCATTTCTAAAGGGCTTGGAGAGACAGCAACTGTGCTGATGAAAGAGGCTGACCTGCCCATGACTGCTGCCTCCCATTCTTCTGCTTTCACTCCAGTAACTGCTGCTGCTTCTCCTGTCTCTCTTCCCCGAACCCCTCGTATTGCCAATGGCATCGCAACTCGGCTGGGTAGCCATGCTGCTGTTGGTGCCTCTGGCCCTTCTGCCCCTACTTCTCATTCTCAGCCACGGCCCCCCCAGGGTTCACTAGCTATGCCTGGCCCTTCTTATGCAGGCAACTCCCCTTTGATTGGTAGGATTAGTTTTATTAGAGAGAGGCCATCACCCTGCAATGGCAGGAAAATCAGAGTGTTGCGGCAAAAGTCGGACCATGGTGCCTACAGCCAGAGCCCAGCCATAAAAAAGCAGTTGGACAGGCATCTTCCTTCCCCACCTACTCTGGACAGTATCATCACAGAATATCTTAGAGAGCAACATGCTCGCTGCAAGAACCCAGTTGCCACCTGTCCACCTTTTTCTCTATTTACTCCTCACCAGTGTCCTGAGCCAAAACAGAGGCGGCAAGCGCCAATAAACTTTACCTCAAGGCTAAACCGAAGGGCATCGTTTCCAAAATATGGAGGGGTAGATGGCGGATGCTTTGATAGGCACCTTATCTTTAGCAGATTTCGTCCTATTTCAGTGTTCCGGGAAGCAAATGAAGATGAGAGTGGCTTCACCTGCTGTGCATTCTCAGCACGGGAACGGTTCCTGATGCTTGGTACCTGCACGGGGCAGCTGAAGCTCTACAATGTGTTTAGTGGACAGGAGGAAGCCAGCTATAACTGTCACAACTCAGCCATCACACACCTTGAACCTTCCAGGGATGGGTCCTTGCTGCTGACATCTGCTACTTGGAGCCAGCCTTTGTCTGCACTTTGGGGAATGAAATCAGTATTTGATATGAAGCATTCCTTCACCGAAGATCACTATGTTGAGTTCAGTAAGCACTCTCAGGATCGGGTCATAGGCACAAAAGGGGACATTGCTCATATTTATGATATTCAGACTGGCAACAAGCTGTTGACTCTGTTTAACCCAGATCTTGCCAACAACTACAAGAGGAACTGTGCCACCTTTAACCCTACAGATGATCTTGTCTTAAATGATGGCGTCCTCTGGGATGTCCGCTCGGCACAGGCCATCCACAAGTTTGACAAGTTCAACATGAACATCAGTGGAGTTTTCCATCCAAATGGACTGGAGATCATCATTAATACTGAGATTTGGGACCTTCGAACTTTCCACCTTTTACACACTGTTCCTGCTCTAGATCAGTGTCGTGTAGTGTTCAACCATACGGGGACAGTGATGTATGGAGCTATGTTGCAGGCCGATGATGAAGATGACTTAATGGAAGAGAGGATGAAAAGCCCTTTTGGGTCATCCTTCAGAACATTTAATGCAACTGACTATAAACCTATTGCAACCATTGATGTGAAGAGAAACATCTTTGACCTGTGTACAGACACCAAAGACTGCTATCTTGCTGTCATTGAGAATCAAGGCAGCATGGATGCCCTGAACATGGACACAGTGTGCCGGCTGTATGAAGTGGGTAGGCAGCGTCTTGCAGAAGATGAAGATGAAGAGGAGGACCAGGAAGAGGAAGAACAAGAGGAAGAGGATGATGATGAAGATGATGACGACACTGATGATTTAGATGAACTTGACACTGACCAGTTGCTGGAGGCGGAACTGGAGGAGGATGACAATAATGAGAACGCAGGAGAGGATGGGGACAATGACTTCTCTCCCTCTGATGAGGAGCTAGCAAACCTTCTAGAGGAGGGAGAGGATGGGGAGGATGAAGATTCTGATGCAGACGAGGAAGTGGAACTGATCCTGGGGGACACTGACAGCTCTGACAACTCTGATTTGGAAGATGACATCATTTTATCTCTGAATGAGTGA

XM_004834246.1 Coding sequence

Cdv3 CDV3 homolog (mouse), transcript variant X4

Length: 642 bp    Location: 9888629..9903835   Strand: +
>XM_004834246.1
ATGGCCGAGACGGAGGAGCGGAGCCTGGACAACTTCTTCGCCAAGAGGGACAAGAAGAAGAAGAAGGAGCGGAGCAGCCGCGCCGCCAACGCCGCGGGCGGAGCGGCGGGGGCCAGGCCGGGCGACGGCACTGGCACGGGGACTAGGCCGGGCGACGGCGGGGCCGCGGGCACCAGGCCGGGCGACGGCGGGGCCGCGGGCACGGGGACCGTGGGCCCCGGGGCCGCCACGAAGGCCGTGACGAAGGATGAAGATGAGTGGAAAGAATTTGAGCAAAAAGAGGTTGATTACAGTGGACTCAGAGTGCAGGCCATGCAAATAAGTGAAAAGGAAGAAGATGATAATGAAAAAAGAGAAGATCCAGGAGATAACTGGGAAGAAGGTGGAGGTGGTGGAGGTATAGAAAAATCTTCAGGTCCTTGGAACAAAACAGCTCCGGTACAAGCGCCTCCTGCTCCAGTAATTGTTACAGAAACCCCAGAACCGGCAATGACTAGTGGTGTGTATCGGCCTCCTGGGGCCAGGCTAACCACAACACGGAAAATGCCACAAGGACCACCAGAAATATACAGTGATACACAGTTTCCATCCTTGCAGTCCACTGCCAAGCATGTAGAAAGCCGAAACAGGTACTTAAAATGA

XM_004834165.1 Coding sequence

Vprbp Vpr (HIV-1) binding protein, transcript variant X1

Length: 4518 bp    Location: 5240008..5176828   Strand: -
>XM_004834165.1
ATGACTACAGTAGCGGTACATGTGGACTCCAAAGCCGAGCTCACTACCCTGCTGGAGCAGTGGGAAAAGGAACATGGCAGTGGGCAGGACATGGTACCTATCCTTACAAGGATGTCTGAATTGATTGAAAAAGAAACTGAAGAATATCGTAAAGGGGATCCAGACCCATTTGATGATCGACATCCTGGTCGAGCTGATCCAGAGTGTATGCTGGGCCACTTGCTGAGAATACTCTTCAAGAATGATGATTTCATGAATGCACTGGTGAATGCATATGTGATGACAAGCCGAGAGCCTCCTTTAAATACTGCAGCTTGCAGACTGCTACTGGACATCATGCCAGGGCTGGAAACTGCTGTTGTCTTTCAAGAAAAGGAAGGAATTGTTGAGAATCTTTTCAAATGGGCCCGAGAGGCTGATCAGCCTCTGAGGACATACTCTACTGGACTGTTAGGGGGTGCTATGGAAAATCAAGACATTGCTGCCAACTACAGGGATGAAAATTCACAACTGGTGGCAATAGTGCTTCGAAGACTGAGGGAGCTACAGCTTCAGGAAGTGGCTTTGCGGCAAGAAAACAAGCGTCCACGGAAGCTCTCTTCTGAACCCCTTTTGCCTCTGGATGAGGAAGCTGTGGATATGGACTATGGTGACATGGCAGTAGATTTAGTGGATGGAGAACAGGAAGAAGCTTCTGGAGACATGGAAATCTCCTTTCATCTTGATTCAAGCCACAAGACCAGTAGTAGAGTGAACTCAGCAACCAAGCCTGAAGGAGGAGGATTAAAGAAAAACAAGTCAGCAAAACAGGGTGACAGAGAGAGCTTTAGGAAAGCCAAACAAAAATTGGGTTTCTCATCTTCTGATCCAGATAGAATGTTTGTTGAGTTGTCTAATAGCAGCTGGTCAGAAATGTCCCCCTGGGTGATTGGTACCAATTATACCCTTTATCCCATGACTCCTGCTATTGAGCAGCGACTCATTCTCCAGTATTTGACCCCTCTAGGAGAATATCAGGAGTTACTTCCCATATTCATGCAACTTGGATCACGGGAGTTGATGATGTTCTATATTGATCTAAAACAGACTAATGATGTTCTGCTTACATTTGAGGCACTCAAGCATCTAGCATCTCTCCTGCTCCATAACAAATTTGCTACAGAATTTGTTGCGCATGGAGGAGTACAGAAATTATTGGAAATTCCTCGTCCTTCTATGGCCGCAACTGGTGTATCCATGTGCTTGTATTACTTGTCCTACAACCAGGATGCTATGGAAAGAGTTTGCATGCATCCCCACAATGTTCTATCTGATGTGGTAAACTATACCCTGTGGTTAATGGAATGTTCCCACGCCTCAGGATGCTGCCATGCTACCATGTTTTTCTCAATTTGCTTCTCATTTCGGGCTGTTTTAGAGCTCTTTGATCGCTATGATGGTCTTCGTCGTCTGGTGAACTTGATCAGTACTTTGGAGATTCTGAATTTGGAAGATCAAGGTGCACTTCTGAGTGATGATGAAATATTTGCTAGCCGCCAAACTGGGAAACATACCTGCATGGCCTTGCGCAAGTATTTTGAGGCTCACCTGGCCATTAAATTGGAACAAGTGAAGCAGTCACTTCAGAGGACTGAGGGTGGCATTCTTGTTCACCCTCAACCTCCATACAAGGCATGCTCATATACTCATGAACAGATTGTGGAAATGATGGAGTTTTTGATAGAATATGGCCCTGCACAGCTGTATTGGGAACCAGCTGAAGTCTTCCTCAAACTTTCTTGTGTTCAGCTGTTGTTGCAGCTTATTTCTATTGCCTGCAATTGGAAGACCTATTATGCAAGGAATGACACTGTGCGCTTTGCTTTGGATGTTCTGGCTATTCTCACTGTGGTGCCGAAAATACAGCTCCAGTTGGCAGAATCAGTGGATGTACTGGATGAGACTGGCTCTACTGTCTCCACTGTAGGTATCAGCATTATTTTGGGAGTGGCTGAGGGTGAGTTCTTTATCCATGATGCTGAAATTCAGAAATCAGCGCTTCAAATTATCATCAATTGTGTATGTGGCCCAGATAACCGAATATCCAGTATTGGCAAATTTATCTCTGGAACTCCTCGGAGAAAGCTGCCTCAGACACCCAAGAGCAGTGAGAACACCCTGGCCAAGATGTGGAATGTAGTCCAATCCAATAATGGCATCAAGGTGCTTCTGTCCTTATTGTCCATCAAGATGCCCATCACAGATGCAGACCAGATCCGGGCCCTGGCCTGTAAGGCCCTGGTGGGCTTGTCTCGGAGTAGCACTGTCAGGCAGATCATCAGCAAACTGCCGCTTTTCAGTAGCTGCCAGATCCAGCAGCTGATGAAGGAACCTGTACTTCAGGACAAGCGCAGTGACCATGTCAAATTCTGCAAATATGCCGCTGAGCTCATTGAAAGGGTGTCCGGAAAGCCACTTCTTATTGGCACTGATGTGTCTTTGGCACGATTACAGAAAGCAGATGTGGTTGCCCAGTCAAGAATCTCTTTCCCTGAGAAAGAATTGCTTTTGTTGATACGGAACCATCTCATTTCTAAAGGGCTTGGAGAGACAGCAACTGTGCTGATGAAAGAGGCTGACCTGCCCATGACTGCTGCCTCCCATTCTTCTGCTTTCACTCCAGTAACTGCTGCTGCTTCTCCTGTCTCTCTTCCCCGAACCCCTCGTATTGCCAATGGCATCGCAACTCGGCTGGGTAGCCATGCTGCTGTTGGTGCCTCTGGCCCTTCTGCCCCTACTTCTCATTCTCAGCCACGGCCCCCCCAGGGTTCACTAGCTATGCCTGGCCCTTCTTATGCAGGCAACTCCCCTTTGATTGGTAGGATTAGTTTTATTAGAGAGAGGCCATCACCCTGCAATGGCAGGAAAATCAGAGTGTTGCGGCAAAAGTCGGACCATGGTGCCTACAGCCAGAGCCCAGCCATAAAAAAGCAGTTGGACAGGCATCTTCCTTCCCCACCTACTCTGGACAGTATCATCACAGAATATCTTAGAGAGCAACATGCTCGCTGCAAGAACCCAGTTGCCACCTGTCCACCTTTTTCTCTATTTACTCCTCACCAGTGTCCTGAGCCAAAACAGAGGCGGCAAGCGCCAATAAACTTTACCTCAAGGCTAAACCGAAGGGCATCGTTTCCAAAATATGGAGGGGTAGATGGCGGATGCTTTGATAGGCACCTTATCTTTAGCAGATTTCGTCCTATTTCAGTGTTCCGGGAAGCAAATGAAGATGAGAGTGGCTTCACCTGCTGTGCATTCTCAGCACGGGAACGGTTCCTGATGCTTGGTACCTGCACGGGGCAGCTGAAGCTCTACAATGTGTTTAGTGGACAGGAGGAAGCCAGCTATAACTGTCACAACTCAGCCATCACACACCTTGAACCTTCCAGGGATGGGTCCTTGCTGCTGACATCTGCTACTTGGAGCCAGCCTTTGTCTGCACTTTGGGGAATGAAATCAGTATTTGATATGAAGCATTCCTTCACCGAAGATCACTATGTTGAGTTCAGTAAGCACTCTCAGGATCGGGTCATAGGCACAAAAGGGGACATTGCTCATATTTATGATATTCAGACTGGCAACAAGCTGTTGACTCTGTTTAACCCAGATCTTGCCAACAACTACAAGAGGAACTGTGCCACCTTTAACCCTACAGATGATCTTGTCTTAAATGATGGCGTCCTCTGGGATGTCCGCTCGGCACAGGCCATCCACAAGTTTGACAAGTTCAACATGAACATCAGTGGAGTTTTCCATCCAAATGGACTGGAGATCATCATTAATACTGAGATTTGGGACCTTCGAACTTTCCACCTTTTACACACTGTTCCTGCTCTAGATCAGTGTCGTGTAGTGTTCAACCATACGGGGACAGTGATGTATGGAGCTATGTTGCAGGCCGATGATGAAGATGACTTAATGGAAGAGAGGATGAAAAGCCCTTTTGGGTCATCCTTCAGAACATTTAATGCAACTGACTATAAACCTATTGCAACCATTGATGTGAAGAGAAACATCTTTGACCTGTGTACAGACACCAAAGACTGCTATCTTGCTGTCATTGAGAATCAAGGCAGCATGGATGCCCTGAACATGGACACAGTGTGCCGGCTGTATGAAGTGGGTAGGCAGCGTCTTGCAGAAGATGAAGATGAAGAGGAGGACCAGGAAGAGGAAGAACAAGAGGAAGAGGATGATGATGAAGATGATGACGACACTGATGATTTAGATGAACTTGACACTGACCAGTTGCTGGAGGCGGAACTGGAGGAGGATGACAATAATGAGAACGCAGGAGAGGATGGGGACAATGACTTCTCTCCCTCTGATGAGGAGCTAGCAAACCTTCTAGAGGAGGGAGAGGATGGGGAGGATGAAGATTCTGATGCAGACGAGGAAGTGGAACTGATCCTGGGGGACACTGACAGCTCTGACAACTCTGATTTGGAAGATGACATCATTTTATCTCTGAATGAGTGA

XM_004834168.1 Coding sequence

Vprbp Vpr (HIV-1) binding protein, transcript variant X4

Length: 4278 bp    Location: 5240008..5189292   Strand: -
>XM_004834168.1
ATGACTACAGTAGCGGTACATGTGGACTCCAAAGCCGAGCTCACTACCCTGCTGGAGCAGTGGGAAAAGGAACATGGCAGTGGGCAGGACATGGTACCTATCCTTACAAGGATGTCTGAATTGATTGAAAAAGAAACTGAAGAATATCGTAAAGGGGATCCAGACCCATTTGATGATCGACATCCTGGTCGAGCTGATCCAGAGTGTATGCTGGGCCACTTGCTGAGAATACTCTTCAAGAATGATGATTTCATGAATGCACTGGTGAATGCATATGTGATGACAAGCCGAGAGCCTCCTTTAAATACTGCAGCTTGCAGACTGCTACTGGACATCATGCCAGGGCTGGAAACTGCTGTTGTCTTTCAAGAAAAGGAAGGAATTGTTGAGAATCTTTTCAAATGGGCCCGAGAGGCTGATCAGCCTCTGAGGACATACTCTACTGGACTGTTAGGGGGTGCTATGGAAAATCAAGACATTGCTGCCAACTACAGGGATGAAAATTCACAACTGGTGGCAATAGTGCTTCGAAGACTGAGGGAGCTACAGCTTCAGGAAGTGGCTTTGCGGCAAGAAAACAAGCGTCCACGGAAGCTCTCTTCTGAACCCCTTTTGCCTCTGGATGAGGAAGCTGTGGATATGGACTATGGTGACATGGCAGTAGATTTAGTGGATGGAGAACAGGAAGAAGCTTCTGGAGACATGGAAATCTCCTTTCATCTTGATTCAAGCCACAAGACCAGTAGTAGAGTGAACTCAGCAACCAAGCCTGAAGGAGGAGGATTAAAGAAAAACAAGTCAGCAAAACAGGGTGACAGAGAGAGCTTTAGGAAAGCCAAACAAAAATTGGGTTTCTCATCTTCTGATCCAGATAGAATGTTTGTTGAGTTGTCTAATAGCAGCTGGTCAGAAATGTCCCCCTGGGTGATTGGTACCAATTATACCCTTTATCCCATGACTCCTGCTATTGAGCAGCGACTCATTCTCCAGTATTTGACCCCTCTAGGAGAATATCAGGAGTTACTTCCCATATTCATGCAACTTGGATCACGGGAGTTGATGATGTTCTATATTGATCTAAAACAGACTAATGATGTTCTGCTTACATTTGAGGCACTCAAGCATCTAGCATCTCTCCTGCTCCATAACAAATTTGCTACAGAATTTGTTGCGCATGGAGGAGTACAGAAATTATTGGAAATTCCTCGTCCTTCTATGGCCGCAACTGGTGTATCCATGTGCTTGTATTACTTGTCCTACAACCAGGATGCTATGGAAAGAGTTTGCATGCATCCCCACAATGTTCTATCTGATGTGGTAAACTATACCCTGTGGTTAATGGAATGTTCCCACGCCTCAGGATGCTGCCATGCTACCATGTTTTTCTCAATTTGCTTCTCATTTCGGGCTGTTTTAGAGCTCTTTGATCGCTATGATGGTCTTCGTCGTCTGGTGAACTTGATCAGTACTTTGGAGATTCTGAATTTGGAAGATCAAGGTGCACTTCTGAGTGATGATGAAATATTTGCTAGCCGCCAAACTGGGAAACATACCTGCATGGCCTTGCGCAAGTATTTTGAGGCTCACCTGGCCATTAAATTGGAACAAGTGAAGCAGTCACTTCAGAGGACTGAGGGTGGCATTCTTGTTCACCCTCAACCTCCATACAAGGCATGCTCATATACTCATGAACAGATTGTGGAAATGATGGAGTTTTTGATAGAATATGGCCCTGCACAGCTGTATTGGGAACCAGCTGAAGTCTTCCTCAAACTTTCTTGTGTTCAGCTGTTGTTGCAGCTTATTTCTATTGCCTGCAATTGGAAGACCTATTATGCAAGGAATGACACTGTGCGCTTTGCTTTGGATGTTCTGGCTATTCTCACTGTGGTGCCGAAAATACAGCTCCAGTTGGCAGAATCAGTGGATGTACTGGATGAGACTGGCTCTACTGTCTCCACTGTAGGTATCAGCATTATTTTGGGAGTGGCTGAGGGTGAGTTCTTTATCCATGATGCTGAAATTCAGAAATCAGCGCTTCAAATTATCATCAATTGTGTATGTGGCCCAGATAACCGAATATCCAGTATTGGCAAATTTATCTCTGGAACTCCTCGGAGAAAGCTGCCTCAGACACCCAAGAGCAGTGAGAACACCCTGGCCAAGATGTGGAATGTAGTCCAATCCAATAATGGCATCAAGGTGCTTCTGTCCTTATTGTCCATCAAGATGCCCATCACAGATGCAGACCAGATCCGGGCCCTGGCCTGTAAGGCCCTGGTGGGCTTGTCTCGGAGTAGCACTGTCAGGCAGATCATCAGCAAACTGCCGCTTTTCAGTAGCTGCCAGATCCAGCAGCTGATGAAGGAACCTGTACTTCAGGACAAGCGCAGTGACCATGTCAAATTCTGCAAATATGCCGCTGAGCTCATTGAAAGGGTGTCCGGAAAGCCACTTCTTATTGGCACTGATGTGTCTTTGGCACGATTACAGAAAGCAGATGTGGTTGCCCAGTCAAGAATCTCTTTCCCTGAGAAAGAATTGCTTTTGTTGATACGGAACCATCTCATTTCTAAAGGGCTTGGAGAGACAGCAACTGTGCTGATGAAAGAGGCTGACCTGCCCATGACTGCTGCCTCCCATTCTTCTGCTTTCACTCCAGTAACTGCTGCTGCTTCTCCTGTCTCTCTTCCCCGAACCCCTCGTATTGCCAATGGCATCGCAACTCGGCTGGGTAGCCATGCTGCTGTTGGTGCCTCTGGCCCTTCTGCCCCTACTTCTCATTCTCAGCCACGGCCCCCCCAGGGTTCACTAGCTATGCCTGGCCCTTCTTATGCAGGCAACTCCCCTTTGATTGGTAGGATTAGTTTTATTAGAGAGAGGCCATCACCCTGCAATGGCAGGAAAATCAGAGTGTTGCGGCAAAAGTCGGACCATGGTGCCTACAGCCAGAGCCCAGCCATAAAAAAGCAGTTGGACAGGCATCTTCCTTCCCCACCTACTCTGGACAGTATCATCACAGAATATCTTAGAGAGCAACATGCTCGCTGCAAGAACCCAGTTGCCACCTGTCCACCTTTTTCTCTATTTACTCCTCACCAGTGTCCTGAGCCAAAACAGAGGCGGCAAGCGCCAATAAACTTTACCTCAAGGCTAAACCGAAGGGCATCGTTTCCAAAATATGGAGGGGTAGATGGCGGATGCTTTGATAGGCACCTTATCTTTAGCAGATTTCGTCCTATTTCAGTGTTCCGGGAAGCAAATGAAGATGAGAGTGGCTTCACCTGCTGTGCATTCTCAGCACGGGAACGGTTCCTGATGCTTGGTACCTGCACGGGGCAGCTGAAGCTCTACAATGTGTTTAGTGGACAGGAGGAAGCCAGCTATAACTGTCACAACTCAGCCATCACACACCTTGAACCTTCCAGGGATGGGTCCTTGCTGCTGACATCTGCTACTTGGAGCCAGCCTTTGTCTGCACTTTGGGGAATGAAATCAGTATTTGATATGAAGCATTCCTTCACCGAAGATCACTATGTTGAGTTCAGTAAGCACTCTCAGGATCGGGTCATAGGCACAAAAGGGGACATTGCTCATATTTATGATATTCAGACTGGCAACAAGCTGTTGACTCTGTTTAACCCAGATCTTGCCAACAACTACAAGAGGAACTGTGCCACCTTTAACCCTACAGATGATCTTGTCTTAAATGATGGCGTCCTCTGGGATGTCCGCTCGGCACAGGCCATCCACAAGTTTGACAAGTTCAACATGAACATCAGTGGAGTTTTCCATCCAAATGGACTGGAGATCATCATTAATACTGAGATTTGGGACCTTCGAACTTTCCACCTTTTACACACTGTTCCTGCTCTAGATCAGTGTCGTGTAGTGTTCAACCATACGGGGACAGTGATGTATGGAGCTATGTTGCAGGCCGATGATGAAGATGACTTAATGGAAGAGAGGATGAAAAGCCCTTTTGGGTCATCCTTCAGAACATTTAATGCAACTGACTATAAACCTATTGCAACCATTGATGTGAAGAGAAACATCTTTGACCTGTGTACAGACACCAAAGACTGCTATCTTGCTGTCATTGAGAATCAAGGCAGCATGGATGCCCTGAACATGGACACAGTGTGCCGGCTGTATGAAGTGGGTAGGCAGCGTCTTGCAGAAGATGAAGATGAAGAGGAGGACCAGATATGGAACAGCAAGGGAAGCAAAGACACTGGAGAAAAATTGGCTGGCTGTGGAAGCAAGAGACCATCATAA

XM_004834172.1 Coding sequence

Grm2 glutamate receptor, metabotropic 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 2619 bp    Location: 5419917..5431219   Strand: +
>XM_004834172.1
ATGGGATTGCTGCTTGGGCTCCTGGCACTGCTGCTGCTGTGGGGTGCTGTGGCTGAGGGCCCAGCCAAGAAGGTGCTGACCCTGGAGGGTGACCTGGTGCTGGGTGGGCTGTTCCCAGTGCACCAGAAGGGTGGCCCAGCAGAGGAGTGTGGTCCTGTCAATGAGCATCGTGGCATCCAGCGCCTGGAAGCCATGCTTTTTGCACTGGATCGGATCAACCAAGACCCCCACCTGCTGCCCGGCGTGCATCTAGGTGCACATATCCTTGATAGCTGCTCCAAGGACACACATGCCCTGGAGCAGGCACTGGACTTTGTGCGTGCCTCACTGAGTCGTGGTGCCGATGGCTCACGCCACATCTGTCCTGATGGCTCTTATGCTACCCATGGTGATGCTCCCACTGCTATCACTGGCGTCATTGGCGGCTCCTACAGTGATGTCTCCATCCAGGTGGCCAACCTCCTGCGGCTATTTCAGATCCCACAGATCAGCTATGCCTCCACCAGTGCCAAGCTGAGTGACAAGTCCCGCTATGACTACTTTGCCCGCACAGTGCCCCCTGACTTCTTCCAAGCCAAGGCCATGGCTGAGATCCTCCGCTTCTTCAACTGGACCTATGTGTCCACTGTGGCTTCTGAGGGTGACTATGGTGAGACAGGCATTGAGGCCTTTGAGATAGAGGCCCGTGCCCGAAACATCTGCGTGGCGACCTCAGAGAAGGTGGGCCGTGCCATGAGTCGTTCTGCCTTTGAGGGGGTGGTTCGAGCCCTACTGCAGAAACCCAGTGCTCGTGTTGCTGTCTTGTTTACCCGTTCTGAGGATGCCCGTGAGCTGCTCGCTGCAACACAGCGCCTCAACGCCAGCTTCACCTGGGTGGCCAGTGATGGCTGGGGGGCCCTGGAAAGTGTTGTGGAAGGCAGTGAGGGGGCAGCTGAGGGTGCCATTACCATTGAGCTGGCCTCCTACCCCATCAGTGACTTTGCCTCTTACTTCCGGAGCCTGGACCCCTGGAACAACAGTCGGAACCCCTGGTTCCGTGAGTTCTGGGAGCAGAGATTCCGCTGTAGCTTCCGGCAGCGAGACTGTGCCACCCATTCCCTGAAGGCTGTGCCCTTTGAACAGGAGTCTAAGATCATGTTTGTGGTCAATGCAGTATATGCCATGGCCCATGCACTGCACAACATGCACCGCACCCTCTGCCCTAACACCACCCACCTCTGTGATGCCATGCGACCTGTCAACGGGCGCCGCCTCTACAAGGACTTCGTGCTCAATGTCAAGTTTGATGCCCCCTTCCGCCCCACTGACACTGACAACGAGGTGCGCTTCGACCGCTTTGGTGATGGCATTGGCCGCTACAATATCTTCACCTACCTGCGGGCAGGCAGTGGGCGCTACCGCTACCAGAAGGTGGGCTACTGGGCAGAAGGCCTGAGCCTTGATACCAGCCTCATCCCCTGGGCTGCCCCCTTGGCTGGCCCCCTACCTGCTTCTCGCTGTAGTGAGCCCTGCCTCCAGAACGAGGTGAAGAGTGTGCAGCCGGGTGAGGTGTGCTGCTGGCTCTGCATCCCCTGCCAGCCCTACGAGTACCGGCTGGACGAGTTCACCTGTGCAGACTGTGGGCTCGGCTACTGGCCCAATGCCAGCCTGACTGGCTGCTTCGAGCTGCCCCAGGAGTACATCCACTGGGGTGATGCCTGGGCTGTAGGACCTGTCACCATTGCCTGCCTGGGTGCTCTGGCCACCCTCTTTGTGCTGGGCGTCTTTGTGCGGCACAATGCCACGCCTGTGGTTAAGGCCTCTGGTCGGGAGCTCTGCTACATCCTGCTGGGTGGTGTCTTCCTCTGCTACTGCATGACCTTCATCTTCATTGCTAAGCCCTCCACGGCAGTGTGCACCTTACGGCGCCTTGGTTTGGGCACTGCCTTCTCTGTCTGCTATTCAGCCTTGCTCACCAAAACCAACCGCATTGCACGTATCTTTGGCGGGGCCCGGGAGGGTGCCCAGCGGCCGCGCTTCATCAGCCCCGCCTCGCAGGTGGCCATCTGCTTGGCACTTATCTCGGGGCAGCTGCTCATCGTGGCTGCCTGGCTGGTGGTAGAGGCACCAGGGATAGGCAAGGAGACAGCACCTGAAAGGCGGGAGGTGGTGACATTGCGCTGTAACCACCGAGATGCGAGCATGCTTGGTTCACTGGCCTACAATGTGCTCCTCATTGCGCTGTGCACGCTCTATGCCTTCAAGACCCGCAAGTGCCCCGAGAACTTCAACGAGGCCAAGTTCATTGGCTTCACCATGTATACCACCTGCATCATCTGGTTGGCATTCCTGCCCATCTTCTATGTCACCTCCAGTGACTATCGGGTTCAGACCACCACCATGTGCGTGTCAGTCAGCCTCAGTGGCTCTGTGGTGCTGGGCTGCCTCTTCGCACCCAAGCTACATATCATCCTCTTCCAGCCACAGAAGAATGTGGTGAGCCACCGGGCACCCACCAGCCGCTTTGGCAGTGCCACCACGAGGGCCAGCTCCAGCGTTGGCCAAGGATCTGGTTCCCAGTTTGTCCCCACTGTCTGCAATGGCCGAGAAGTGGTGGACTCAACAACGTCATCACTTTGA

XM_004834174.1 Coding sequence

Iqcf6 IQ motif containing F6

High confidence: 4 potential gene matches
Length: 462 bp    Location: 5478551..5477929   Strand: -
>XM_004834174.1
ATGATGGATGAGTGGACTCTAGAGACCAGGGCCATGGACGTACAAGCTGTGAGTATGACCCTTCCAGGAAGGACCCGCCTGCTGAATAATGAGAAGGAGAAGGCAGCGGTGAGGATCCAGTCATGGTGGCGTGGCAATGTAGTGCGCCGGACGCTACTGCACACAGCGCTCAGGGCCTGGGTCATCCAGGGCTGGTGGAGGTCAACTCAGGCCAAGGTGTTGGAGCAGAGACGGCCCCTGGCACTCAGACTCTACTCCTGCCAGGAGTGGGCAGTGGTGAAGGTGCAGGCCCAGGTTCGGATGTGGCAGGCCCGCAGACGCTTCCTCCAGGCCGGACAAGCCGCCTGCATCATCCAGACTCACTGGCGCTGGCATGCCAGCCAGACCCGAGGCCTGATCCAGGGCCGCTATGAGGTCAGAGCCAGGCGGATGGAGCTCGACATCGAGATCCTCATGACCTAG

XM_004835145.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1299 bp    Location: 5701494..5702959   Strand: +
>XM_004835145.1
ATGCTGTCAAACAGCGCGGTGCCAGCCGCTTCCAGACGGAGGACTGCGGTGGCCACTGAAGGGCGCCCCCAGCGCTGCCGGCTGGCGTCTGTCAGCAACATATCACCCTCTCCAGCTGCCATGCTTCTCCGGAGGCTGCGGCAACTCTCCTGGGGCAGCACTGCTGTCCAGCTCTTCATCCTAACGGTGGTAACGTTTGGCCTGCTGGCTCCCCTGGCCTGTCACCGGCTTTTGCACTCTTACTTCTATCTGCGAAACTGGCATCTGAACCAAATGAGCCAAGAGTTACTGCAGCAGAGCCTGAAGGAAGGGGAAGCTGCTCTCCACTACTTTGAGGAGCTGCCCTCTGCCGACGGCTCAGTGCCCATTGTCTGGCAGGCCACGCCCCGCCCCTGGCTGGTGATCACCATCATCACTGTGGACAGGCAGCCTGGCTTCCACTACGTCTTACAGGTCGTGTCGCAGTTCCACCAGCTCCTACAGCAGTGTGGCCCCCAGTGTGAGGGATACCAGCTCTTCTTGTGCAATGTGGAGCGCAGCGTGAGCCATTTCGATGCCAAACTGCTCTCCAAGTACATACCCGTGGCCAACCGCTATGAGGGAACTGAGGATGATTATGGTGATGACCCTTCAACCAACTCATTTGAGAAAGAAAAGCAAGACTATGTATATTGCCTTGAATCCTCACTGCAGACCTACAATCCAGACTATGTCCTGATGGTGGAAGATGATGCTGTTCCAGAAGAGCAAATATTCCCAGTCTTGGAGCACCTGCTGCGGGCTCGCTTCTCTGAGCCACACCTCCGAGACGCCCTGTGTCTTAAGCTCTATCACCCCGAGAGGTTCCAGCATTACATCAACCCAGAGCGGATCCTGGAGTGGGTCGGTGTGGGCATGTTGCTGGGGCCCTTGCTAACCTGGATATACATGAGGTTTGCCAGCTGCCCAGGCTTTAGCTAGCCTGTCCTGTTGTTCTTCTCACTGTATAGTATGGGACTGGTGGAACTGGTGGGCCGGCACTACTTCCTCNGACTGCGGCGCCTGAGTCCTTCCTTGTACAGTGTGGTTCCTGCTTCTCAGTGTTGCACCCCAGCGATGCTCTTCCCCGCACCTGCAGCCCGCCGAACCCCCACCTACCTGTCCCAAGTGTATTGCCACAAGGGATTTGGCAAGGACATGGCACTGTACTCACTCTTGAGGGCCAAAGGAGAGCGGGCCTATGTGGTAGAGCCCAATCTGGTGAAGCACATCAGGCTTTTCTCCAGCCTCCAGTACAATTTTCATCCCAGTCTGCTCTAG

XM_004835146.1 Coding sequence

Rrp9 ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)

High confidence: 4 potential gene matches
Length: 1404 bp    Location: 5761456..5752257   Strand: -
>XM_004835146.1
ATGTCTGCTACTGTAGCAGCTCGAAAGCGGGGAAAGCCGGCCTCCGGGGTTGGGGCCGCTGCAGGGGCTGGCAAACGACGGCGAAAGGTCGACTCTGTGGGGAACAGGGGCAAGTCCAAAGGCGGCGGCAAGATGAATGAGGAGATCTCCAGCGACTCTGAGAACGAGAGCCTAGCTCCAAGGAGGACTGAGGAAGAGGAGGAAGAGGAGGAGCTGGAGGAAACCGCCCAGGAGAAGAAGCTGCGCTTGGCTAAGCTTTACCTTGAGCAGCTGAGGCAGCAGGAGGAGGAGAAGGCTGAGGCTCAAGCGTTTGAAGAGGACCAAATAGCAGGGCGCCTGAAGGAGGATGTGCTGGAGCAGAGGGGCAGGCTGCAGAAGTCAGTGGCAAAGGAGATCCAGACCCCAGGCCCAGCTGACATTCGGGTCTTACGGGGCCACCAGCTCTCCATCACATGTTTGGTGATCACCCCTGACGACTTGGCCATCTTCTCCGCTGCCAAAGACTGCACTCTCATTAAGTGGAGTGTGGAGACTGGGCGGAAGCTGCATGTGATTCCAAAGGCCAAGAATGGTGCCGAGGGGAAGGCCCCTGGCCACAGCAGCCATGTCCTCTGCATGGCCATCTCCTCCGACGGCAAGTACCTTGCCTCCGGTGACCGCAGCAAGCTCATTCTCATTTGGGAAGCCCAGAGCTGCTGCCACTTGTACACCTTCACGGGACATCGGGATGCTGTGTCGGGGCTGGCGTTCCGCAGAGGCACCCACCAGCTCTATAGCACCTCCTACGACCGCTCTGTGAAGGTGTGGAATGTGGCAGAGAACTCCTATGTGGAGACACTCTTTGGACATCAAGATGCTGTGGCTGCACTGGATGCCCTGAGCCGGGAGTGCTGTGTGACAGCTGGGGGCCGGGACGGGACCGTGCGTGTGTGGAAGATCCCTGAGGAGTCCCAACTGGTCTTCTATGGCCACCAGGGCTCCATCGACTGCCTCCATCTCATCAACGAGGAGCACATGGTGTCAGGTGCAGACGATGGCTCTGTGGCCTTGTGGGGCCTCTCTAAGAAGCGGCCACTCGCCCTGCAGCGGGAAGCTCACGGGCTGCAGGGGGAGCCAGGCCTGGAGCAGCCCTTCTGGGTGTCATCGGTGGCAGCCCTCCTTAACACCGACCTTGTGGCTACAGGCTCCCACAGCTCTTGTGTGAGGCTTTGGCAGTGTGGTGAGGGCTTCCGGCGGCTCGATCACCTCCTCGACATCCCTCTGGTGGGTTTTATCAACAGCCTCAAGTTCTCCAGTGGTGGGGACTTCCTAGTGGCCGGAGTAGGGCAGGAGCACAGGCTTGGCCGATGGTGGCGGATCAAAGAGGCTCGGAACTCAGTTTGCATCATCCGGCTCCTTATTTAA

XM_004834179.1 Coding sequence

Parp3 poly (ADP-ribose) polymerase family, member 3, transcript variant X1

Length: 1596 bp    Location: 5762467..5767819   Strand: +
>XM_004834179.1
ATGGCTCCAAAACGAAAGCCTTCAGTGAAGACTGAGCACTCTGAGAAGAAGAGGCGACAGGAGCCAGGGGAGGAGAACAGCTTCCACTCCACTGCTGAGGCCCTCAGGGCTGCACCCGTAGAAAAGCGCATCGTCTGCATGGACCCTAACTGCCCACTGAGCAACAACCCTGGCACCCAGGTACACAAGGACTATGACTGCACCCTGAACCAGAGCAACATCAGGTGCAACAACAATAAGTTCTATGTCATCCAGCTGCTGGAAGACGGCAACAACTTCTTCTGCTGGAACCGCTGGGGCCGAGTGGGAGAGGTGGGCCAGTCAAAGATGAATCACTTCACCTGCCTGGAAGATGCAAAGAAGGACTTTGAGAAGAAGTTTCATGACAAGACCAAGAACAAATGGGCAGAGCGGGACCACTTTGTGGCCCACTCCGGCAAGTACACACTTATCGAAGTGCAGGGAGAGGCCAACGCCCAGGAGGCTATGGTGCAGGTAGATGGAGGCCCAGCGGGGACTGTGGTTAGGCAGGTGAGACCCTGCTCTCTGGACCCTGCCACCCGGAAGCTTATCACTAACATCTTCAGCAAGGAGATGTTTAAGAATGCCATGACCCTCATGAACCTGGATGTGAAGAAGATGCCCCTGGGGAAGTTAAGCAAGCAGCAGATCGCACGGGGCTTTGAGGCCTTGGAGGCGCTAGAGGGGGCTCTGAAACCCCCCACAGATGGTAGCCCAAGCCTGGAGGAGCTGTCCTCCCACTTCTACACCATCATCCCACACAACTTTGGCCGCAGCCGGCCTCTGCCCATCAACTCCCTCGAGCTTCTGCAGGCCAAGAAGGACATGCTGCTGGTGCTGGCAGACATCGAGCTGGCCCAGACCCTGCAGGCGGCCAGTGGGGCGGAGGAGAGAGTGGAAGAGGTGCCACACCCATTGGACCGAGACTACCAGCTCCTCAAGTGCCAGCTTCAGCTGCTGGATTCTGGGGCACCCGAGTACAAGGTGATACAGACCTACTTAGAACAGACAGGCAGCACCTACAGATGTCCAGCTCTGCAGCATGTTTGGAAAGTGAACCGGGAAGGCGAGGGAGACAGGTTCCAGGCCTACTCCAAGCTCAGGAATCGGAGGCTGCTGTGGCATGGCACCAACGTGGCTGTGGTGGCTGCCATCCTCACCAGCGGGCTTCGCATCATGCCACATTCTGGAGGCCGTGTTGGCAAGGGCATCTACTTCGCCTCAGAGAACAGCAAGTCAGCTAGCTATGTTACTGCCATGCACTGTGGGAACCACCAGGTGTGTTACATGTTCCTGGGCGAGGTGGCCCTGGGCAAAGAGTACTGCATCACCATGGACAACCCTGGCTTGAAGTCCCCACCCCTCGGCTTCGACAGTGTCATTGCCCGAGGACATACAGAGCCTGATCCTACCCAGGACATTGAACTGGAGCTGGATGGCCAGCAAGTGATGGTGCCCCAGGGCCGGCCTGTTCCATGCTCAGAATTCAGCAGCTCCCACTTCTGCCAGAGTGAGTACCTCATCTATCAGGAGAGCCAGTGTCGCCTGCGCTACCTGCTGGAGCTTCACCTCTGA

XM_004834190.1 Coding sequence

Pcbp4 poly(rC) binding protein 4, transcript variant X1

Length: 1212 bp    Location: 5787338..5776777   Strand: -
>XM_004834190.1
ATGAGCAGCTCAGATGCGGGGCTGGAGGAGGAGCCAGAGCTTAGCATCACCCTCACACTGCGGATGCTGATGCATGGGAAGGAAGTGGGCAGCATAATCGGGAAGAAGGGAGAGACTGTCAAGAGAATCAGGGAGCAGAGCAGTGCCCGGATCACCATTTCCGAGGGGTCCTGCCCTGAGCGCATCACCACCATCACTGGTTCCACAGCGGCTGTCTTCCATGCAGTCTCCATGATTGCTTTCAAGCTGGATGAGGACCTTTGTGCTGCTCCTGCAAATGGGGGCAGTGTCTCTAGGCCTCCCGTGACTCTGCGCCTTGTCATCCCTGCCAGCCAGTGTGGCTCATTGATTGGGAAGGCTGGCACCAAGATCAAGGAGATCCGAGAGACTACAGGTGCCCAGGTGCAGGTGGCAGGGGACCTGCTCCCCAATTCCACAGAGCGTGCCGTCACTGTGTCCGGGGTGCCTGATGCTATCATCTTGTGTGTTCGACAGATCTGCGCTGTTATTCTGGAGTCCCCACCCAAAGGAGCCACTATCCCATACCATCCGAGCCTCTCCCTAGGTACTGTCCTCCTCTCCGCCAACCAGGGCTTCTCTGTTCAGGGTCAGTATGGAGCTGTGACCCCTGCTGAGGTCACCAAGCTCCAGCAGCTGTCGGGCCATGCGGTCCCCTTTGCCTCACCCAGTGTGGTGCCAGGACTGGATCCCAGTGCACAGACCAGCTCCCAGGAGTTTTTGGTTCCCAATGATCTGATTGGCTGCGTGATTGGGCGCCAGGGCAGCAAGATCAGCGAGATCCGCCAGATGTCAGGGGCACATATCAAGATCGGGAACCAAGCAGAGGGTGCTGGTGAGCGGCACGTAACCATCACTGGCTCGCCGGTCTCCATCGCCCTGGCCCAGTACCTCATTACTGCCTGTCTAGAGACGGCCAAGTCTACCTCTGGGGGGACGCCCGGCTCGGCCCCCGCAGACCTGCCTGCTCCCTTCTCGCCACCCCTGACGGCCTTGCCCACAGCTCCCCCAGGCCTGCTGGGCACACCCTATGCCATCTCCCTCTCCAACTTCATCGGCCTCAAGCCTGTGCCCTTCTTGGCTCTACCACCTGCTTCCCCAGGGCCACCACCGGGCTTGGCGGCCTACACTGCCAAGATGGCAGCGGCCAATGGGAGCAAGAAAGCTGAGCGGCAGAAATTCTCCCCCTACTGA

XM_004834181.1 Coding sequence

Acy1 aminoacylase 1, transcript variant X1

Length: 1377 bp    Location: 5786205..5805329   Strand: +
>XM_004834181.1
ATGGTCTCCATACACCCTTGGCCTGGAGGTGTGTATCTGGCTCCTCCCGGGACTGCAGAGAATGGGAAGGGGTGTGTGCCAGCCAAGAGCTGCAGGAGAATGGCAGAACAAGCAGAACCCGAACCCAGAGCAGAAGCTCATCACACAGCCATGGCCAGCAAGGGTCCTGAGTTCGAGCACCCGTCCGTGACGCTCTTCCGACGGTACCTGCGCATACGCACGGTCCACCCTGAGCCCGACTACGAAGCTGCCATCACCTTCCTTGAGGAGAGGGGCCACCAGCTGGGCCTAAGCTGTCAGAAAGTGGAGGTGGTACCTGGTTATGTGATTCTTGTGCTGACCTGGCCAGGCACCAACCCTACACTCTCCTCCATCTTACTCAACTCCCACATGGATGTGGTGCCTGTCTTCAAGGAACATTGGAGTCATGACCCTTTTGAGGCCTTCAAGAATCCTGAGGGCTACATCTATGCCAGGGGTACCCAGGACATGAAGAGTGTCAGCATCCAGTACTTGGAGGCTGTGAGGAGGCTGAAGGATGAGGGCCACCGTTTTCCTAGAACCATCCACATGACCTTTGTGCCTGATGAGGAAGTTGGAGGTTTTAAAGGCATGCAGGCATTCGTGCAGCGGCCTGAGTTCCAGTCCCTGAGAGTAGGCTTTGCCCTGGATGAAGGCCTGGCCAACCCCACAGATGCCTTCACTGTCTTTTATAGTGAGCGGGCTACCTGGTGGGTGCGGTTCATCAGCACTGGGAGGCCAGGCCATGGCTCACGTTTCATTGAGGACACAGCAGCAGAGAAGCTGCACAAGGTCATGAGCTCTGTCCTGGCGTTCCGGGAGAAGGAAAAGCAGAGGCTGCAATCAAACCCTCACCTGAAGGAGGGGGCTGTGACCTGTGTGAACCTGACAAAGATAGAGGGTGGTGTGGCATTGAATGTGGTACCTGCCACTATAAGTGCTGACTTTGACTTTCGCATCGCACCAGATGTGGACCTGGAGGCTTTTGAGAAGCAGCTGCAAAGATGGTGCCAGGAAGCTGGCGAGGGGGTCACCTTCGAGTTTGCTCAGAAATGGATGGAGCCCCGAGTGACCTCTACTGATGATGCAGACCCCTGGTGGGCAGCTTTCAGTGGGATCTGCAAGGACATGAACCTCACACTGGAGCTGGAGATCCTTCCTGCTGCCACGGACAGCCGCTATATCCGCGCAGCAGGAGTCCCAGCTCTGGGCTTCTCACCCATGAACCGTACACCCGTGCTACTACACGACCATGATGAGCGACTGCATGAGGCCGTGTTCCTCCGAGGAATTGACATATACACACGTCTGCTGCCTGCCCTGGCCAGTGTGCCTGCCCTGCCCACTAACAACTGA

XM_004834182.1 Coding sequence

Acy1 aminoacylase 1, transcript variant X2

Length: 1374 bp    Location: 5786205..5805329   Strand: +
>XM_004834182.1
ATGGTCTCCATACACCCTTGGCCTGGAGGTGTGTATCTGGCTCCTCCCGGGACTGCAGAGAATGGGAAGGGGTGTGTGCCAGCCAAGAGCTGCAGGAGAATGGCAGAACAAGCAGAACCCGAACCCAGAGCAGAAGCTCATCACACAGCCATGGCCAGCAAGGGTCCTGAGTTCGAGCACCCGTCCGTGACGCTCTTCCGACGGTACCTGCGCATACGCACGGTCCACCCTGAGCCCGACTACGCTGCCATCACCTTCCTTGAGGAGAGGGGCCACCAGCTGGGCCTAAGCTGTCAGAAAGTGGAGGTGGTACCTGGTTATGTGATTCTTGTGCTGACCTGGCCAGGCACCAACCCTACACTCTCCTCCATCTTACTCAACTCCCACATGGATGTGGTGCCTGTCTTCAAGGAACATTGGAGTCATGACCCTTTTGAGGCCTTCAAGAATCCTGAGGGCTACATCTATGCCAGGGGTACCCAGGACATGAAGAGTGTCAGCATCCAGTACTTGGAGGCTGTGAGGAGGCTGAAGGATGAGGGCCACCGTTTTCCTAGAACCATCCACATGACCTTTGTGCCTGATGAGGAAGTTGGAGGTTTTAAAGGCATGCAGGCATTCGTGCAGCGGCCTGAGTTCCAGTCCCTGAGAGTAGGCTTTGCCCTGGATGAAGGCCTGGCCAACCCCACAGATGCCTTCACTGTCTTTTATAGTGAGCGGGCTACCTGGTGGGTGCGGTTCATCAGCACTGGGAGGCCAGGCCATGGCTCACGTTTCATTGAGGACACAGCAGCAGAGAAGCTGCACAAGGTCATGAGCTCTGTCCTGGCGTTCCGGGAGAAGGAAAAGCAGAGGCTGCAATCAAACCCTCACCTGAAGGAGGGGGCTGTGACCTGTGTGAACCTGACAAAGATAGAGGGTGGTGTGGCATTGAATGTGGTACCTGCCACTATAAGTGCTGACTTTGACTTTCGCATCGCACCAGATGTGGACCTGGAGGCTTTTGAGAAGCAGCTGCAAAGATGGTGCCAGGAAGCTGGCGAGGGGGTCACCTTCGAGTTTGCTCAGAAATGGATGGAGCCCCGAGTGACCTCTACTGATGATGCAGACCCCTGGTGGGCAGCTTTCAGTGGGATCTGCAAGGACATGAACCTCACACTGGAGCTGGAGATCCTTCCTGCTGCCACGGACAGCCGCTATATCCGCGCAGCAGGAGTCCCAGCTCTGGGCTTCTCACCCATGAACCGTACACCCGTGCTACTACACGACCATGATGAGCGACTGCATGAGGCCGTGTTCCTCCGAGGAATTGACATATACACACGTCTGCTGCCTGCCCTGGCCAGTGTGCCTGCCCTGCCCACTAACAACTGA

XM_004834187.1 Coding sequence

Abhd14b abhydrolase domain containing 14B, transcript variant X1

Length: 1008 bp    Location: 5792069..5787672   Strand: -
>XM_004834187.1
ATGAGGATAGGGGAACGAAAGGGAGCAGCAGGGGTACGATTCCGAAGGAACCCTCCTCCGCAGGGGTGCCAAGTCCTTAGGGGGCAGGTCACCGAGGGGTCTGAAACCGCGCCCAGCCCGGCGCTTGGGGCACGCGAGGCCAAAGATTTGGGGAAACTGAGGCCCTGTGGCTGTGAGAACAGGAGAGGGTTTAGCGGCGCGGACGACCCAGAGGCAGCTGTAGCCAAAAGAGGGCGCCCCGGAGTATGGCCCAGCCCATGCTCCGCCCCCAGCCTTTTCCCAGTTTTCCTACTCATCCCTGCCCACATTCGTCAGCTCCCGTCTGAGCGAGATCACGCAACTCCTCAGGCACATTACCACACAGCGGCAGCAGGAATGGCAAATGTGGAGCAGTACGAGGGCACTATCCAGGTGCAGGGCCAGGGCCTGTTCTTTCGAGAGGCACGGCCTGGCCATGGGCAGGCTGCTCGCCTCTCTGTGCTGCTGTTGCATGGCATCCACTTCTCTTCTGAGACCTGGCAGAACCTGGGTACACTGCACAGGCTGGCCCAGGCTGGCTACCGGGCCGTGGCCATTGACCTGCCAGGTCTGGGGCGTTCTAAGGAAGTGCCAGCCCCTGCCCCCTTCGGGGAGCTGGTCCCTGGCAGTTTCCTAGCAGCTGTGGTGGAGGCCTTACAGCTGGGCCCCCCAGTTGTGATCAGTCCATCACTGAGTGGCATGTACTCCCTGCCCTTCCTCACAGCCCCCAGCTCCCAGCTCCAGGGCTATGTGCCTGTGGCCCCCATCTGCACTGACAAAATCAATGCCGCCAACTATGCCAGTGTGAAGACTCCAGTTCTGATTGTATATGGCGATCAGGACCCCATGGGTCACACCAGCTTTGAGCACCTGAAGCAGCTGCCCAACCACCGCGTGCTCGTCATGAAGGGGGCAGGGCACCCCTGCTACTTGGATAAACCTGAGGAGTGGCACACAGGGCTGTTGGACTTCCTGCAGGGGCTGGCATGA

XM_004834183.1 Coding sequence

Acy1 aminoacylase 1, transcript variant X3

Length: 1227 bp    Location: 5799016..5805329   Strand: +
>XM_004834183.1
ATGGCCAGCAAGGGTCCTGAGTTCGAGCACCCGTCCGTGACGCTCTTCCGACGGTACCTGCGCATACGCACGGTCCACCCTGAGCCCGACTACGAAGCTGCCATCACCTTCCTTGAGGAGAGGGGCCACCAGCTGGGCCTAAGCTGTCAGAAAGTGGAGGTGGTACCTGGTTATGTGATTCTTGTGCTGACCTGGCCAGGCACCAACCCTACACTCTCCTCCATCTTACTCAACTCCCACATGGATGTGGTGCCTGTCTTCAAGGAACATTGGAGTCATGACCCTTTTGAGGCCTTCAAGAATCCTGAGGGCTACATCTATGCCAGGGGTACCCAGGACATGAAGAGTGTCAGCATCCAGTACTTGGAGGCTGTGAGGAGGCTGAAGGATGAGGGCCACCGTTTTCCTAGAACCATCCACATGACCTTTGTGCCTGATGAGGAAGTTGGAGGTTTTAAAGGCATGCAGGCATTCGTGCAGCGGCCTGAGTTCCAGTCCCTGAGAGTAGGCTTTGCCCTGGATGAAGGCCTGGCCAACCCCACAGATGCCTTCACTGTCTTTTATAGTGAGCGGGCTACCTGGTGGGTGCGGTTCATCAGCACTGGGAGGCCAGGCCATGGCTCACGTTTCATTGAGGACACAGCAGCAGAGAAGCTGCACAAGGTCATGAGCTCTGTCCTGGCGTTCCGGGAGAAGGAAAAGCAGAGGCTGCAATCAAACCCTCACCTGAAGGAGGGGGCTGTGACCTGTGTGAACCTGACAAAGATAGAGGGTGGTGTGGCATTGAATGTGGTACCTGCCACTATAAGTGCTGACTTTGACTTTCGCATCGCACCAGATGTGGACCTGGAGGCTTTTGAGAAGCAGCTGCAAAGATGGTGCCAGGAAGCTGGCGAGGGGGTCACCTTCGAGTTTGCTCAGAAATGGATGGAGCCCCGAGTGACCTCTACTGATGATGCAGACCCCTGGTGGGCAGCTTTCAGTGGGATCTGCAAGGACATGAACCTCACACTGGAGCTGGAGATCCTTCCTGCTGCCACGGACAGCCGCTATATCCGCGCAGCAGGAGTCCCAGCTCTGGGCTTCTCACCCATGAACCGTACACCCGTGCTACTACACGACCATGATGAGCGACTGCATGAGGCCGTGTTCCTCCGAGGAATTGACATATACACACGTCTGCTGCCTGCCCTGGCCAGTGTGCCTGCCCTGCCCACTAACAACTGA

XM_004834184.1 Coding sequence

Acy1 aminoacylase 1, transcript variant X4

High confidence: 3 potential gene matches
Length: 1227 bp    Location: 5799223..5805329   Strand: +
>XM_004834184.1
ATGGCCAGCAAGGGTCCTGAGTTCGAGCACCCGTCCGTGACGCTCTTCCGACGGTACCTGCGCATACGCACGGTCCACCCTGAGCCCGACTACGAAGCTGCCATCACCTTCCTTGAGGAGAGGGGCCACCAGCTGGGCCTAAGCTGTCAGAAAGTGGAGGTGGTACCTGGTTATGTGATTCTTGTGCTGACCTGGCCAGGCACCAACCCTACACTCTCCTCCATCTTACTCAACTCCCACATGGATGTGGTGCCTGTCTTCAAGGAACATTGGAGTCATGACCCTTTTGAGGCCTTCAAGAATCCTGAGGGCTACATCTATGCCAGGGGTACCCAGGACATGAAGAGTGTCAGCATCCAGTACTTGGAGGCTGTGAGGAGGCTGAAGGATGAGGGCCACCGTTTTCCTAGAACCATCCACATGACCTTTGTGCCTGATGAGGAAGTTGGAGGTTTTAAAGGCATGCAGGCATTCGTGCAGCGGCCTGAGTTCCAGTCCCTGAGAGTAGGCTTTGCCCTGGATGAAGGCCTGGCCAACCCCACAGATGCCTTCACTGTCTTTTATAGTGAGCGGGCTACCTGGTGGGTGCGGTTCATCAGCACTGGGAGGCCAGGCCATGGCTCACGTTTCATTGAGGACACAGCAGCAGAGAAGCTGCACAAGGTCATGAGCTCTGTCCTGGCGTTCCGGGAGAAGGAAAAGCAGAGGCTGCAATCAAACCCTCACCTGAAGGAGGGGGCTGTGACCTGTGTGAACCTGACAAAGATAGAGGGTGGTGTGGCATTGAATGTGGTACCTGCCACTATAAGTGCTGACTTTGACTTTCGCATCGCACCAGATGTGGACCTGGAGGCTTTTGAGAAGCAGCTGCAAAGATGGTGCCAGGAAGCTGGCGAGGGGGTCACCTTCGAGTTTGCTCAGAAATGGATGGAGCCCCGAGTGACCTCTACTGATGATGCAGACCCCTGGTGGGCAGCTTTCAGTGGGATCTGCAAGGACATGAACCTCACACTGGAGCTGGAGATCCTTCCTGCTGCCACGGACAGCCGCTATATCCGCGCAGCAGGAGTCCCAGCTCTGGGCTTCTCACCCATGAACCGTACACCCGTGCTACTACACGACCATGATGAGCGACTGCATGAGGCCGTGTTCCTCCGAGGAATTGACATATACACACGTCTGCTGCCTGCCCTGGCCAGTGTGCCTGCCCTGCCCACTAACAACTGA

XM_004834192.1 Coding sequence

Rpl29 ribosomal protein L29

High confidence: 2 potential gene matches
Length: 684 bp    Location: 5810028..5807029   Strand: -
>XM_004834192.1
ATGGCCAAGTCTAAGAACCACACCACGCACAACCAGTCCCGAAAATGGCACAGAAATGGCATCAAGAAACCCCGATCGCAAAGATATGAATCTCTGAAGGGGGTAGATCCCAAGTTCCTAAGGAATATGCGTTTTGCCAAGAAGCACAACAAGAAGGGCCTGAAGAAGATGCAGGCAAACAATGCCAAGGCCATGAGTGCACGTGCTGAGGCTATCAAGGCCCTTGTCAAGCCCAAGGAGGTCAAGCCCAAGATGCCAAAGGGTGTGAACCGCAAGCTGGCTCGACTTGCCTATATTGCCCACCCCAAGCTCGGGAAGCATATCCGTGCCCACGTTGCCAAGGGTAGCAGGCTTTGTCGGCCAAAGGCCCAGGGTCCAGTCAAGGCCCAGGCTCCAGTCAAGGCCCAGGCTCCAGCCAAGGCCCAGGCTCCAGCCAAGGCCCAGGCTCCAGCCAAGGCCCAGGCTCCAGCCAAGGCCCAGGCTCCAGCCAAGGCCCAGGCTCCAACCAAGGCCCAGGCTCCGGCCAAGGCCCAGGCTCCAGCCAAGGCCCAGGCTCCAGCCAAGGCCCAAGGTCCAGCCAAGGCCCAAGGTCCAATCAAGGCCCAGGCTCAGGCTGCCACTCCAGCTTCTGCTCCAGCTCAGGCTCCCAAAGGTGCCCAGGCCGCTGTGAAGGCTCCACAGTAA

XM_004834193.1 Coding sequence

Dusp7 dual specificity phosphatase 7

High confidence: 4 potential gene matches
Length: 1260 bp    Location: 5865608..5858588   Strand: -
>XM_004834193.1
ATGAAAAACCAGCTCCGCGGCCCCCCAGCGCGGGCGCACATGTCGGCTTCGGGGGCTGCGGCGGCTGGGGACACCCGGGCGGGGTCGGAGCCCGGCTTGGGGTCTGGGTCTGGCGCGGGTACTGGGGCGAGGGCGGCGACGGAAGCGGGGGCTATGCCCTGCAAGAGCGCCGAGTGGCTGCAGGAGGAGCTGGAGGCGCGCGGTGGCGCGTCCCTGCTGCTGCTCGACTGCCGGCCGCACGAGCTCTTCGAGTCGTCGCACATCGAGACGGCCATCAACCTGGCTATTCCGGGCCTCATGCTGCGCCGCCTTCGAAAGGGCAACCTGCCCATCCGCTCCATCATCCCCAACCACGCCGACAAGGAGCGCTTCGCCACGCGCTGCAAGGCGGCCACCGTGCTGCTCTATGACGAGGCTACAGCCGAGTGGCAGCCCGAGCCCGGCGCCCCCGCCTCGGTGCTCGGTCTGCTCCTGCAGAAGCTGCGCGACGACGGCTGCCAGGCCTACTACCTCCAAGGTGGTTTCAACAAGTTCCAGACCGAGTACTCGGAGCATTGTGAGACTAACGTTGACAGCTCTTCCTCGACGAGTGACTCGCCACCCACCTCGGTGCTGGGCCTGGGGGGCCTTCGCATCAGCTCTGACTGCTCAGATGGCGAGTCAGACCGAGAGCTGCCCAGTAGTGCCACCGAGTCAGACGGAAGCCCTGTGCCATCCAGCCAGCCAGCCTTCCCTGTCCAGATTCTGCCCTACCTCTACCTCGGCTGTGCCAAGGACTCCACCAACTTGGATGTGCTCGGCAAGTACGGCATCAAATACATCCTCAATGTTACCCCCAACCTGCCCAATGCCTTTGAGCATGGTGGCGAGTTCACCTACAAGCAGATCCCCATCTCTGACCACTGGAGCCAGAATCTCTCCCAGTTCTTCCCCGAGGCCATCAGCTTCATTGAGGAAGCCCGCTCCAAGAAGTGTGGCGTCCTGGTGCATTGTCTGGCAGGCATCAGCCGCTCGGTGACAGTCACTGTGGCCTACCTGATGCAGAAGATGAACCTGTCACTCAATGACGCCTATGACTTCGTCAAGAGGAAAAAGTCCAACATCTCGCCCAACTTCAACTTCATGGGGCAGCTGCTGGACTTTGAGCGGACGCTGGGGCTAAGCAGCCCATGTGACAACCACGCACCCAGTGAACAGCTCTACTTCTCCACTCCCACCAACCGCAACCTGTTCCCACTCAACACACTCGAGTCCACGTGA

XM_004834194.1 Coding sequence

Poc1a POC1 centriolar protein homolog A (Chlamydomonas), transcript variant X1

Length: 1539 bp    Location: 5959126..5882875   Strand: -
>XM_004834194.1
ATGGCCGCGGCCTGCCTGGTGAGTTCTTTTAGGGGTGGCCGCCTGGGCCCCTGTCTGCCCTCTGGGACGTTGGGCGCTTGGCCGACCGGAGCGGTGAATTCGAGAGGACGAGGCAGTCCACTCCACGCTAGGGAGGATCCCTCATTGGAGAGGCATTTTAAGGGCCACCGAGATGCGGTTACCTGTGTGGACTTCAGTCTCAATACAAAGCAGCTGGCCAGTGGCTCCATGGATTCCTGCCTCATGGTCTGGCACATGAAGCCCCAGGCACGTGCCTACCGCTTCACAGGCCACAAGGATGCTGTCACCTGTGTGAACTTCTCTCCCTCGGGACATTTACTTGCCTCAGGCTCCCGTGACAAGACTGTCCGCATCTGGGTACCCAACGTCAAAGGCGAGTCCACTATGTTTCGTGCACACACAGCCACAGTGAGGAGTGTCCACTTCTCCAGTGATGGCCAGTCCCTTGTGACAGCCTCTGATGACAAGACAATCAAGGTGTGGTCAACACATCGCCAGAGATTCCTGTTCTCATTGAGCCAGCACATCAACTGGGTCCGCTGTGCCAGGTTCTCCCCTGATGGGCGGCTCATCGTGTCTGCCAGTGATGACAAGACCGTCAAGCTGTGGGACAAGACCAGCCGGGAGTGTGTCCACTCATACTGTGAGCATGGCGGCTTTGTCACCTATGTGGACTTCCATCCCAGTGGTACATGTGTTGCTGCTGCCGGCATGGACAACACTGTGAAGGTGTGGGATGTACGGACTCACCGGCTGTTGCAGCATTATCAGCTACACAGTGCAGCAGTAAATGCTCTCTCTTTCCACCCATCGGGAAACTACCTGGTTACAGCCTCCAGTGACTCAACCCTGAAGATCCTGGACCTGATGGAGGGCCGGCTGCTCTACACGCTCCATGGGCATCAGGGACCTGCCATCACTGTTGCCTTTTCAAGAACTGGGGAGTATTTTGCTTCTGGAGGCTCTGATGAACAGGTGATGGTTTGGAAGAGTAACTTTGATGTTGTTGATTATGGAGAAGTAATAGAAATGCCAAGGCCCCCAGCCACACTGGCCACCTCCGCAGGGAATCTGCCAGAAATGGATCTCCCCATGCCCCCAGGCAGAGGCAAGAGTCTGGAGTCTGTGCCAAGCCAGCCCCAGGAGCCCATCAGCATGCCCCAGACACTGACCAAGACGCTGGAGCACATCGTGGGCCAGCTGGACGTCCTCACTCAGACCAGCCATGGGGTCCCTCAGGCCTGCATCTTCTCCAGGAAGCCAGATGATCCTGATCTCAGCCAGTACAGTGTCCATCCTGGAACAACGGTTGACACTGACAGAAGACAAGCTGAAGCAGTGTCTGGAGAACCAGCAGCTAATCATGCAGAGAGCAACACCATGATCAGGGGAGCAAGAATCAGGAGCTTGGTTGATTGGGGGGTGGGGGGCAGGCCAGGGATTTGTACTATGGGACTTGGGGAAATAAAGGAATTCAGCTCTGTGGGAATCACATCTGTAGTGAGCCCTGACAAATAA

XM_004834196.1 Coding sequence

Poc1a POC1 centriolar protein homolog A (Chlamydomonas), transcript variant X3

High confidence: 4 potential gene matches
Length: 1338 bp    Location: 5959126..5883137   Strand: -
>XM_004834196.1
ATGGCCGCGGCCTGCCTGGTGAGTTCTTTTAGGGGTGGCCGCCTGGGCCCCTGTCTGCCCTCTGGGACGTTGGGCGCTTGGCCGACCGGAGCGGTGAATTCGAGAGGACGAGGCAGTCCACTCCACGCTAGGGAGGATCCCTCATTGGAGAGGCATTTTAAGGGCCACCGAGATGCGGTTACCTGTGTGGACTTCAGTCTCAATACAAAGCAGCTGGCCAGTGGCTCCATGGATTCCTGCCTCATGGTCTGGCACATGAAGCCCCAGGCACGTGCCTACCGCTTCACAGGCCACAAGGATGCTGTCACCTGTGTGAACTTCTCTCCCTCGGGACATTTACTTGCCTCAGGCTCCCGTGACAAGACTGTCCGCATCTGGGTACCCAACGTCAAAGGCGAGTCCACTATGTTTCGTGCACACACAGCCACAGTGAGGAGTGTCCACTTCTCCAGTGATGGCCAGTCCCTTGTGACAGCCTCTGATGACAAGACAATCAAGGTGTGGTCAACACATCGCCAGAGATTCCTGTTCTCATTGAGCCAGCACATCAACTGGGTCCGCTGTGCCAGGTTCTCCCCTGATGGGCGGCTCATCGTGTCTGCCAGTGATGACAAGACCGTCAAGCTGTGGGACAAGACCAGCCGGGAGTGTGTCCACTCATACTGTGAGCATGGCGGCTTTGTCACCTATGTGGACTTCCATCCCAGTGGTACATGTGTTGCTGCTGCCGGCATGGACAACACTGTGAAGGTGTGGGATGTACGGACTCACCGGCTGTTGCAGCATTATCAGCTACACAGTGCAGCAGTAAATGCTCTCTCTTTCCACCCATCGGGAAACTACCTGGTTACAGCCTCCAGTGACTCAACCCTGAAGATCCTGGACCTGATGGAGGGCCGGCTGCTCTACACGCTCCATGGGCATCAGGGACCTGCCATCACTGTTGCCTTTTCAAGAACTGGGGAGTATTTTGCTTCTGGAGGCTCTGATGAACAGGTGATGGTTTGGAAGAGTAACTTTGATGTTGTTGATTATGGAGAAGTAATAGAAATGCCAAGGCCCCCAGCCACACTGGCCACCTCCGCAGGGAATCTGCCAGAAATGGATCTCCCCATGCCCCCAGGCAGAGGCAAGAGTCTGGAGTCTGTGCCAAGCCAGCCCCAGGAGCCCATCAGCATGCCCCAGACACTGACCAAGACGCTGGAGCACATCGTGGGCCAGCTGGACGTCCTCACTCAGACAGTGTCCATCCTGGAACAACGGTTGACACTGACAGAAGACAAGCTGAAGCAGTGTCTGGAGAACCAGCAGCTAATCATGCAGAGAGCAACACCATGA

XM_004834202.1 Coding sequence

Alas1 aminolevulinate, delta-, synthase 1, transcript variant X6

Length: 1923 bp    Location: 5977105..5998901   Strand: +
>XM_004834202.1
ATGGAGACCGTTGTTCGACGATGCCCCTTCTTATCTCGTGTCCCCCAGGCCTTTCTGCAGAAGGCAGGCAAATCTCTGTTGTTCTATGCCCAAAACTGCCCCAAGATGATGGAAGTTGGGGCCAATCCAGCCCCTCGGGCCCTGACTACCTCAGCGGTACACTGCCAGCAGATCAGAGAAACCCCTCCGGGCAGTGAGAAAGACAAAACTGCCAAAGCCAGTGTCCAGCAGGCTCCTGACAGAGCCCAGCAGACTCCAGATGGCACACAGCTTCCATCTGGTCATCCCTCATCTGCCACAAGCCAGGGCACTGCGAGCAAATGCCCTTTCCTGGCAGCACAGATGAGCCAGAAGGGCAGCAGTGTCTTCTGCAAAGCCAGTCTGGAGCTTCAGGAGGATGTGCAGGAGATGCATGCGGTGCGGAAAGAGGTTGCCCAAACCTCAGTGAACCCCAGTGTGATCAGTGTGAAGACTGATGGAGAGGATCCAAGTGGATTGCTGAAAAATTTCCAGGATATCATGCGAAAGCAAAGACCAGAAAGAGTGTCTCATCTTCTTCAAGATAACTTGCCGAAGTCTATTTCCACTTTTCAATATGATCATTTCTTTGAGAAGAAAATTGATGAGAAAAAAAATGACCACACCTATCGAGTTTTTAAAACTGTGAACCGGAGGGCACATATCTTCCCCATGGCAGATGACTATTCGGACTCCCTTATCACCAAAAAGCAGGTGTCGGTCTGGTGCAGTAATGACTATCTAGGGATGAGTCGCCATCCACGGGTGTGTGGGGCAGTTGTGGAGACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACAAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACCTGGAGCAGGAGCTGGCTGACCTCCATGGGAAAGATGCAGCACTCTTGTTTTCCTCATGTTTTGTGGCCAATGACTCAACCCTCTTCACCTTGGCTAAGATGATGCCAGGTTGTGAGATTTACTCAGATTCTGGGAACCATGCTTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTATATCTTCCGCCACAATGATGTCGCCCACCTCAGAGAACTGTTGCAAAGATCTGACCCCGCGGTCCCTAAGATTGTTGCATTTGAAACTGTCCACTCCATGGATGGAGCAGTGTGTCCACTAGAAGAGCTGTGCGATGTGGCCCATGAGTTTGGAGCAATCACCTTTGTGGATGAGGTTCATGCAGTGGGGCTGTATGGGGCTCGAGGTGGAGGGATTGGTGATCGAGACGGAGTCATGCCGAAGATGGACATCATTTCTGGAACACTTGGCAAAGCCTTTGGCTGTGTTGGAGGGTACATCGCCAGCACGAGTTCTCTGGTTGACACCGTGCGCTCCTATGCGGCTGGCTTCATCTTCACCACCTCTTTGCCTCCCATGCTGCTGGCTGGAGCCCTGGAGTCTGTGCGGATCCTGAAGAGTGCCGAGGGGCGGGCACTTCGCCGCCAGCACCAGCGAAACGTCAAGCTCATGAGGCAGATGCTCATGGATGCTGGCCTCCCTGTGGTCCACTGCCCCAGCCACATCATCCCTGTTCGGGTTGCCGATGCTGCTAAAAACACACAAGTATGTGATGAGCTAATGAGCAGACATAACATCTACGTCCAGGCGATCAATTACCCAACAGTGCCGCGTGGAGAGGAGCTGCTTCGGATTGCGCCTACCCCTCACCACACGCCTCAGATGATGAGCTACTTTCTGGAGAATCTGCTGGCCACATGGAAGCAAGTGGGGCTGGAACTGAAGCCACACTCCTCTGCGGAGTGCAACTTCTGCAGGCGGCCGTTGCACTTTGAAGTGATGAGTGAAAGGGAGAAAGCCTACTTCTCTGGCATGAGCAAGCTGGTGTCAGCCCAGGCCTGA

XM_004834205.1 Coding sequence

Alas1 aminolevulinate, delta-, synthase 1, transcript variant X9

Length: 1818 bp    Location: 5984761..5998901   Strand: +
>XM_004834205.1
ATGATGGAAGTTGGGGCCAATCCAGCCCCTCGGGCCCTGACTACCTCAGCGGTACACTGCCAGCAGATCAGAGAAACCCCTCCGGGCAGTGAGAAAGACAAAACTGCCAAAGCCAGTGTCCAGCAGGCTCCTGACAGAGCCCAGCAGACTCCAGATGGCACACAGCTTCCATCTGGTCATCCCTCATCTGCCACAAGCCAGGGCACTGCGAGCAAATGCCCTTTCCTGGCAGCACAGATGAGCCAGAAGGGCAGCAGTGTCTTCTGCAAAGCCAGTCTGGAGCTTCAGGAGGATGTGCAGGAGATGCATGCGGTGCGGAAAGAGGTTGCCCAAACCTCAGTGAACCCCAGTGTGATCAGTGTGAAGACTGATGGAGAGGATCCAAGTGGATTGCTGAAAAATTTCCAGGATATCATGCGAAAGCAAAGACCAGAAAGAGTGTCTCATCTTCTTCAAGATAACTTGCCGAAGTCTATTTCCACTTTTCAATATGATCATTTCTTTGAGAAGAAAATTGATGAGAAAAAAAATGACCACACCTATCGAGTTTTTAAAACTGTGAACCGGAGGGCACATATCTTCCCCATGGCAGATGACTATTCGGACTCCCTTATCACCAAAAAGCAGGTGTCGGTCTGGTGCAGTAATGACTATCTAGGGATGAGTCGCCATCCACGGGTGTGTGGGGCAGTTGTGGAGACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACAAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACCTGGAGCAGGAGCTGGCTGACCTCCATGGGAAAGATGCAGCACTCTTGTTTTCCTCATGTTTTGTGGCCAATGACTCAACCCTCTTCACCTTGGCTAAGATGATGCCAGGTTGTGAGATTTACTCAGATTCTGGGAACCATGCTTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTATATCTTCCGCCACAATGATGTCGCCCACCTCAGAGAACTGTTGCAAAGATCTGACCCCGCGGTCCCTAAGATTGTTGCATTTGAAACTGTCCACTCCATGGATGGAGCAGTGTGTCCACTAGAAGAGCTGTGCGATGTGGCCCATGAGTTTGGAGCAATCACCTTTGTGGATGAGGTTCATGCAGTGGGGCTGTATGGGGCTCGAGGTGGAGGGATTGGTGATCGAGACGGAGTCATGCCGAAGATGGACATCATTTCTGGAACACTTGGCAAAGCCTTTGGCTGTGTTGGAGGGTACATCGCCAGCACGAGTTCTCTGGTTGACACCGTGCGCTCCTATGCGGCTGGCTTCATCTTCACCACCTCTTTGCCTCCCATGCTGCTGGCTGGAGCCCTGGAGTCTGTGCGGATCCTGAAGAGTGCCGAGGGGCGGGCACTTCGCCGCCAGCACCAGCGAAACGTCAAGCTCATGAGGCAGATGCTCATGGATGCTGGCCTCCCTGTGGTCCACTGCCCCAGCCACATCATCCCTGTTCGGGTTGCCGATGCTGCTAAAAACACACAAGTATGTGATGAGCTAATGAGCAGACATAACATCTACGTCCAGGCGATCAATTACCCAACAGTGCCGCGTGGAGAGGAGCTGCTTCGGATTGCGCCTACCCCTCACCACACGCCTCAGATGATGAGCTACTTTCTGGAGAATCTGCTGGCCACATGGAAGCAAGTGGGGCTGGAACTGAAGCCACACTCCTCTGCGGAGTGCAACTTCTGCAGGCGGCCGTTGCACTTTGAAGTGATGAGTGAAAGGGAGAAAGCCTACTTCTCTGGCATGAGCAAGCTGGTGTCAGCCCAGGCCTGA

XM_004834204.1 Coding sequence

Alas1 aminolevulinate, delta-, synthase 1, transcript variant X8

Length: 1818 bp    Location: 5984761..5998901   Strand: +
>XM_004834204.1
ATGATGGAAGTTGGGGCCAATCCAGCCCCTCGGGCCCTGACTACCTCAGCGGTACACTGCCAGCAGATCAGAGAAACCCCTCCGGGCAGTGAGAAAGACAAAACTGCCAAAGCCAGTGTCCAGCAGGCTCCTGACAGAGCCCAGCAGACTCCAGATGGCACACAGCTTCCATCTGGTCATCCCTCATCTGCCACAAGCCAGGGCACTGCGAGCAAATGCCCTTTCCTGGCAGCACAGATGAGCCAGAAGGGCAGCAGTGTCTTCTGCAAAGCCAGTCTGGAGCTTCAGGAGGATGTGCAGGAGATGCATGCGGTGCGGAAAGAGGTTGCCCAAACCTCAGTGAACCCCAGTGTGATCAGTGTGAAGACTGATGGAGAGGATCCAAGTGGATTGCTGAAAAATTTCCAGGATATCATGCGAAAGCAAAGACCAGAAAGAGTGTCTCATCTTCTTCAAGATAACTTGCCGAAGTCTATTTCCACTTTTCAATATGATCATTTCTTTGAGAAGAAAATTGATGAGAAAAAAAATGACCACACCTATCGAGTTTTTAAAACTGTGAACCGGAGGGCACATATCTTCCCCATGGCAGATGACTATTCGGACTCCCTTATCACCAAAAAGCAGGTGTCGGTCTGGTGCAGTAATGACTATCTAGGGATGAGTCGCCATCCACGGGTGTGTGGGGCAGTTGTGGAGACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACAAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACCTGGAGCAGGAGCTGGCTGACCTCCATGGGAAAGATGCAGCACTCTTGTTTTCCTCATGTTTTGTGGCCAATGACTCAACCCTCTTCACCTTGGCTAAGATGATGCCAGGTTGTGAGATTTACTCAGATTCTGGGAACCATGCTTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTATATCTTCCGCCACAATGATGTCGCCCACCTCAGAGAACTGTTGCAAAGATCTGACCCCGCGGTCCCTAAGATTGTTGCATTTGAAACTGTCCACTCCATGGATGGAGCAGTGTGTCCACTAGAAGAGCTGTGCGATGTGGCCCATGAGTTTGGAGCAATCACCTTTGTGGATGAGGTTCATGCAGTGGGGCTGTATGGGGCTCGAGGTGGAGGGATTGGTGATCGAGACGGAGTCATGCCGAAGATGGACATCATTTCTGGAACACTTGGCAAAGCCTTTGGCTGTGTTGGAGGGTACATCGCCAGCACGAGTTCTCTGGTTGACACCGTGCGCTCCTATGCGGCTGGCTTCATCTTCACCACCTCTTTGCCTCCCATGCTGCTGGCTGGAGCCCTGGAGTCTGTGCGGATCCTGAAGAGTGCCGAGGGGCGGGCACTTCGCCGCCAGCACCAGCGAAACGTCAAGCTCATGAGGCAGATGCTCATGGATGCTGGCCTCCCTGTGGTCCACTGCCCCAGCCACATCATCCCTGTTCGGGTTGCCGATGCTGCTAAAAACACACAAGTATGTGATGAGCTAATGAGCAGACATAACATCTACGTCCAGGCGATCAATTACCCAACAGTGCCGCGTGGAGAGGAGCTGCTTCGGATTGCGCCTACCCCTCACCACACGCCTCAGATGATGAGCTACTTTCTGGAGAATCTGCTGGCCACATGGAAGCAAGTGGGGCTGGAACTGAAGCCACACTCCTCTGCGGAGTGCAACTTCTGCAGGCGGCCGTTGCACTTTGAAGTGATGAGTGAAAGGGAGAAAGCCTACTTCTCTGGCATGAGCAAGCTGGTGTCAGCCCAGGCCTGA

XM_004834203.1 Coding sequence

Alas1 aminolevulinate, delta-, synthase 1, transcript variant X7

High confidence: 4 potential gene matches
Length: 1923 bp    Location: 5984762..5998901   Strand: +
>XM_004834203.1
ATGGAGACCGTTGTTCGACGATGCCCCTTCTTATCTCGTGTCCCCCAGGCCTTTCTGCAGAAGGCAGGCAAATCTCTGTTGTTCTATGCCCAAAACTGCCCCAAGATGATGGAAGTTGGGGCCAATCCAGCCCCTCGGGCCCTGACTACCTCAGCGGTACACTGCCAGCAGATCAGAGAAACCCCTCCGGGCAGTGAGAAAGACAAAACTGCCAAAGCCAGTGTCCAGCAGGCTCCTGACAGAGCCCAGCAGACTCCAGATGGCACACAGCTTCCATCTGGTCATCCCTCATCTGCCACAAGCCAGGGCACTGCGAGCAAATGCCCTTTCCTGGCAGCACAGATGAGCCAGAAGGGCAGCAGTGTCTTCTGCAAAGCCAGTCTGGAGCTTCAGGAGGATGTGCAGGAGATGCATGCGGTGCGGAAAGAGGTTGCCCAAACCTCAGTGAACCCCAGTGTGATCAGTGTGAAGACTGATGGAGAGGATCCAAGTGGATTGCTGAAAAATTTCCAGGATATCATGCGAAAGCAAAGACCAGAAAGAGTGTCTCATCTTCTTCAAGATAACTTGCCGAAGTCTATTTCCACTTTTCAATATGATCATTTCTTTGAGAAGAAAATTGATGAGAAAAAAAATGACCACACCTATCGAGTTTTTAAAACTGTGAACCGGAGGGCACATATCTTCCCCATGGCAGATGACTATTCGGACTCCCTTATCACCAAAAAGCAGGTGTCGGTCTGGTGCAGTAATGACTATCTAGGGATGAGTCGCCATCCACGGGTGTGTGGGGCAGTTGTGGAGACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACAAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACCTGGAGCAGGAGCTGGCTGACCTCCATGGGAAAGATGCAGCACTCTTGTTTTCCTCATGTTTTGTGGCCAATGACTCAACCCTCTTCACCTTGGCTAAGATGATGCCAGGTTGTGAGATTTACTCAGATTCTGGGAACCATGCTTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTATATCTTCCGCCACAATGATGTCGCCCACCTCAGAGAACTGTTGCAAAGATCTGACCCCGCGGTCCCTAAGATTGTTGCATTTGAAACTGTCCACTCCATGGATGGAGCAGTGTGTCCACTAGAAGAGCTGTGCGATGTGGCCCATGAGTTTGGAGCAATCACCTTTGTGGATGAGGTTCATGCAGTGGGGCTGTATGGGGCTCGAGGTGGAGGGATTGGTGATCGAGACGGAGTCATGCCGAAGATGGACATCATTTCTGGAACACTTGGCAAAGCCTTTGGCTGTGTTGGAGGGTACATCGCCAGCACGAGTTCTCTGGTTGACACCGTGCGCTCCTATGCGGCTGGCTTCATCTTCACCACCTCTTTGCCTCCCATGCTGCTGGCTGGAGCCCTGGAGTCTGTGCGGATCCTGAAGAGTGCCGAGGGGCGGGCACTTCGCCGCCAGCACCAGCGAAACGTCAAGCTCATGAGGCAGATGCTCATGGATGCTGGCCTCCCTGTGGTCCACTGCCCCAGCCACATCATCCCTGTTCGGGTTGCCGATGCTGCTAAAAACACACAAGTATGTGATGAGCTAATGAGCAGACATAACATCTACGTCCAGGCGATCAATTACCCAACAGTGCCGCGTGGAGAGGAGCTGCTTCGGATTGCGCCTACCCCTCACCACACGCCTCAGATGATGAGCTACTTTCTGGAGAATCTGCTGGCCACATGGAAGCAAGTGGGGCTGGAACTGAAGCCACACTCCTCTGCGGAGTGCAACTTCTGCAGGCGGCCGTTGCACTTTGAAGTGATGAGTGAAAGGGAGAAAGCCTACTTCTCTGGCATGAGCAAGCTGGTGTCAGCCCAGGCCTGA

XM_004834197.1 Coding sequence

Alas1 aminolevulinate, delta-, synthase 1, transcript variant X1

Length: 1923 bp    Location: 5984764..5998901   Strand: +
>XM_004834197.1
ATGGAGACCGTTGTTCGACGATGCCCCTTCTTATCTCGTGTCCCCCAGGCCTTTCTGCAGAAGGCAGGCAAATCTCTGTTGTTCTATGCCCAAAACTGCCCCAAGATGATGGAAGTTGGGGCCAATCCAGCCCCTCGGGCCCTGACTACCTCAGCGGTACACTGCCAGCAGATCAGAGAAACCCCTCCGGGCAGTGAGAAAGACAAAACTGCCAAAGCCAGTGTCCAGCAGGCTCCTGACAGAGCCCAGCAGACTCCAGATGGCACACAGCTTCCATCTGGTCATCCCTCATCTGCCACAAGCCAGGGCACTGCGAGCAAATGCCCTTTCCTGGCAGCACAGATGAGCCAGAAGGGCAGCAGTGTCTTCTGCAAAGCCAGTCTGGAGCTTCAGGAGGATGTGCAGGAGATGCATGCGGTGCGGAAAGAGGTTGCCCAAACCTCAGTGAACCCCAGTGTGATCAGTGTGAAGACTGATGGAGAGGATCCAAGTGGATTGCTGAAAAATTTCCAGGATATCATGCGAAAGCAAAGACCAGAAAGAGTGTCTCATCTTCTTCAAGATAACTTGCCGAAGTCTATTTCCACTTTTCAATATGATCATTTCTTTGAGAAGAAAATTGATGAGAAAAAAAATGACCACACCTATCGAGTTTTTAAAACTGTGAACCGGAGGGCACATATCTTCCCCATGGCAGATGACTATTCGGACTCCCTTATCACCAAAAAGCAGGTGTCGGTCTGGTGCAGTAATGACTATCTAGGGATGAGTCGCCATCCACGGGTGTGTGGGGCAGTTGTGGAGACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACAAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACCTGGAGCAGGAGCTGGCTGACCTCCATGGGAAAGATGCAGCACTCTTGTTTTCCTCATGTTTTGTGGCCAATGACTCAACCCTCTTCACCTTGGCTAAGATGATGCCAGGTTGTGAGATTTACTCAGATTCTGGGAACCATGCTTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTATATCTTCCGCCACAATGATGTCGCCCACCTCAGAGAACTGTTGCAAAGATCTGACCCCGCGGTCCCTAAGATTGTTGCATTTGAAACTGTCCACTCCATGGATGGAGCAGTGTGTCCACTAGAAGAGCTGTGCGATGTGGCCCATGAGTTTGGAGCAATCACCTTTGTGGATGAGGTTCATGCAGTGGGGCTGTATGGGGCTCGAGGTGGAGGGATTGGTGATCGAGACGGAGTCATGCCGAAGATGGACATCATTTCTGGAACACTTGGCAAAGCCTTTGGCTGTGTTGGAGGGTACATCGCCAGCACGAGTTCTCTGGTTGACACCGTGCGCTCCTATGCGGCTGGCTTCATCTTCACCACCTCTTTGCCTCCCATGCTGCTGGCTGGAGCCCTGGAGTCTGTGCGGATCCTGAAGAGTGCCGAGGGGCGGGCACTTCGCCGCCAGCACCAGCGAAACGTCAAGCTCATGAGGCAGATGCTCATGGATGCTGGCCTCCCTGTGGTCCACTGCCCCAGCCACATCATCCCTGTTCGGGTTGCCGATGCTGCTAAAAACACACAAGTATGTGATGAGCTAATGAGCAGACATAACATCTACGTCCAGGCGATCAATTACCCAACAGTGCCGCGTGGAGAGGAGCTGCTTCGGATTGCGCCTACCCCTCACCACACGCCTCAGATGATGAGCTACTTTCTGGAGAATCTGCTGGCCACATGGAAGCAAGTGGGGCTGGAACTGAAGCCACACTCCTCTGCGGAGTGCAACTTCTGCAGGCGGCCGTTGCACTTTGAAGTGATGAGTGAAAGGGAGAAAGCCTACTTCTCTGGCATGAGCAAGCTGGTGTCAGCCCAGGCCTGA

XM_004835147.1 Coding sequence

Tlr9 toll-like receptor 9

High confidence: 3 potential gene matches
Length: 3165 bp    Location: 6009540..6004700   Strand: -
>XM_004835147.1
ATGGCTGCAGACAGGCCAGAAGTGGAAGGGCAAGTTCTCCAGAAATTTGGCCACTACAAGGACTGTGACTATGACCCCAGGGCTTCCTGCCGAAGGATCCCGCAGCCCCTCTCTCTTCTAGTGCAGGCTGTGGCACTGGCTGAAGCCCTGGCCCTGGGAGCCCTGCCTGCCTTCCTACCCTGTGAGCTCCAGCCCCATGGTGTGGTGAACTGCAACTGGCTGTTCCTGAAGTCTGTGCCCCGCTTCTCTGCAGCAGCGCCTCGAAGCAATGTCACTAGCCTTTCTTTGCTCTCCAACCGCATCCACCACCTCCATAACTCTGACTTTGTCCACCTGCCCAACCTGCGGCATCTCAACCTTAAGTGGAATTGCCCGCCGACTGGCCTTAGCCCCATGCACTTCCCCTGCCACATGACCATCGAACCCAAGACCTTTCTAGCTGTGCCCACCCTAGAGGATCTGAACCTGAGCTACAATAGCATCACCACTGTTCCTGCCCTGCCCAGCTCCCTTGTGAACCTGACCCTGAGCCACACCAATATCCTGGTGCTGGACTCCACCAGCCTCACTGGCCTGCCTGCCCTGCGTGTCCTCTTCATGGATGGCAATTGCTACTACAAGAACCCATGCCATCAGGCACTGGAGGTGGCCCCAGGTGCCCTCCTGGGTCTGGGCAACCTCACCCACCTATCGCTCAAGTACAACAACCTCACAAAGGTGCCCCGTGACCTACCACCCAGTCTTGAGTTCCTGCTGCTGTCCTACAACCACATTTTTAAACTGGAGCCTGGGGACCTGGTCAACCTGACTGCCCTTCGAGTGCTTGATGTGGGTGGAAACTGTCGCCGCTGCGATCATGCCCGCAACCCTTGTGTGGAGTGCCTTAACAAAACCCTCCAGCTGCACCCCAACACCTTCAGCCACCTCAGCCACCTTGAAGGCCTGGTGTTGAAGGACAGTTCTCTCCACACTCTGGAACCCAGATGGTTCCGAGGTCTGGAGAACCTCACAGTGCTAGACCTGAGCGAGAACTTTCTCTATGACTCCATCACCAAAACCAGGGCCTTCCAGGGCCTGGCACGGCTGCGAAAGCTCAACCTGTCCTTCAATTACTGCAAAAGAGTGTCCTTTGCTCACCTGCAGCTAGCACCCTCCTTTGGGAACCTGACCTCCCTGCAGGAGCTAGACATGAATGGCATCTTCTTTCGGTCACTCAGTGAGAACACACTAAAGCCACTGACCCACTTGCCCCTGCTCCAGACTCTTAATCTGCAGATGAATTTCATCAACCAGGCCCAGCTCAGCATCTTTGGGGCTTTCCCTGGCCTTCGCTTTGTGGACCTGTCAGACAACCGCATCAGTGGAGCTCCAACCCAGAAGGGCCTTGGGGAGGCGGATGACAGGGAGCAGGTCTGGCTGGGGCCTGAGGACCTTGCTCCAGCCCCGCTGGGCAACCCCACGTCTGAAGACTTCATGCCTAGCTGCAAACACTTCCCATTCACCTTGGACCTGTCTGGAAACAACCTGGTGACTGTGAAGTCAGAGATGTTCACCAACCTCTCTCGCCTCCAGTGTCTGATCCTGAGCCACAACTGTATTGCACAGGCTGTCAACGGCTCACAGTTCCAGACACTGACCAGTCTACAGGTGTTGGACGTGTCCCATAACAAGCTGGACCTGTACCATGGGCACTCATTCACAGAGCTGCCACAGTTAAAGGCCCTGGATCTCAGTTACAACAGTCAGCCCTTCGGCATGCAGGGCATAGGCCACAATCTCAGCTTTGTGGCCCGGCTGCACAAACTGCAGTACCTCAGCCTGGCTCACAATGGCATCAACAGCCGTGTGAACCCTCGACTCTGCAGCAGCTCCCTGCGGGCCCTGGACTTCAGTGGCAACACCGTAAGCAGCATGTGGGCTGAGGGAGACCTCTACCTCCACTTCTTCCAAGGCCTCCAAGGCCTCCTCTGGCTGGACCTGTCCCACAACCACCTGCATACCCTCCTCCCCTGCAACCTGGACAGCCTCCCCAAGAGCCTGACACTTCTGCTTCTCCGTGACAATTACCTGGCCTTCTTCAACTGGAGCAGCCTGGTCCTCCTACCCAATCTGCAGACCCTGGACTTGGCAGGAAATCAGCTGAAGGCCCTGACCAATGGCACCCTCCCCAACGGCACACAGCTGCAGAGGCTGGACGTCAGCGGCAACAGCATCAGCTTTGTGGCTTCAGGCTTCTTTGCACTGGCTACTAAGCTGCGGGAGCTCAACCTCAGTGACAACATCCTCAGGACAATTGACTCCTCCTGGTTTGGGACCCTGGCAGGCAGCCTGAAAGTCCTGGACGTGAGTGCCAACCCCCTCCACTGTACCTGTGGGGCAGCCTTTGTGGACTTCCTGCTGGAGGTGCAGGCCGCTGTGCCTGGCCTGCCCAATCACATAAAGTGTGGCAGCCCCAGCCAGCTGCAGGGCCGCAGCATTTTCGCACAGGACCTGCGCCTCTGCCTGGATGAGGCCCTCTCCTGGTACTGCTTTGGCCTTTCACTCCTGGTGGTGGCTCTGGGCCTGGTGGTGCCAGTGCTGCAGCACCTTTGCGGCTGGGACCTCTGGTACTGCTTCCACTTGGGCCTGACCTGGCTCCCCAGGTGGGGCCCAAGTGGTGCCCAAGCCCTGCCCTATGATGCCTTTGTGATCTTCGACAAGACACAGGGTGCAGTGGCCGACTGGGTGTACCAGGAGCTGCGGGTGCAGCTGGAGGAGCGCCGTGGGTTCCGGGCGCTGCGCCTGTGCCTGGAGGAGCGCGACTGGGTGCCTGGAAAGACGCTCTTTGAGAACCTGTGGGCCTCCATCTATGGCAGCTGCAAGACAGTCTTTGTGCTGGCCCACACTGACCGGGTCAGTGGCCTCCTGCGCACCGGCTTCCTGCTGGCCCAGCAGCGCCTGCTGGAGGACCGCAAGGACATCGTGGTGCTGGTGATCCTCAGCCCTGATGCCCACCGCTCCCGCTATGTGCGGCTGCGCCAGCGCCTCTGCCACCGGAGTGTCCTCTTCTGGCCCCAGCAGCCCAGGGGTCAGGGCAGTTTCTGGGCCCAGCTGAGCACAGCCCTGACAAGGGACAACCGCCACTTCTATAACCAGAACTTCTGCAGGGGACTCGCAGCTGAGTAG

XM_004834207.1 Coding sequence

Twf2 twinfilin actin-binding protein 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 1050 bp    Location: 6020848..6011606   Strand: -
>XM_004834207.1
ATGGCGCACCAGACGGGCATCCACGCCACAGAGGAGCTTAAGGAATTCTTTGCCAAGGCACGGGCTGGCTCTGTCCGGCTCATCAAAGTCATCATCGAGGACGAGCAGCTCGTGCTGGGTGCCTCGCAGGAGCCCATGGGCCGCTGGGACCAAGACTATGACAGGGCTGTGCTGCCGCTGCTGGATGCTCAACAGCCCTGCTACATGCTCTTCCGCCTCGACTCACAGAACGCTCAGGGCTTCGAGTGGCTCTTCCTCGCCTGGTCACCTGATAATTCCCCTGTGCGGCTGAAGATGCTTTATGCCGCCACACGGGCCACAGTGAAGAAGGAGTTTGGGGGCGGCCACATCAAGGATGAGCTCTTTGGCACAGTGAAGGATGACCTCTCCTTTGCTGGGTACCAGAAGCACCTATCATCCTGTGCTGCCCCCGCCCCTCTGACTTCCGCAGAGAGAGAGCTCCAGCAGATCCGTATCAATGAGGTGAAGACGGAGATCAGTGTGGAAAGCAAGCACCAGACACTGCAGGGCCTCGCCTTCCCCCTTCAGCCTGAGGCCCAGCGGGCACTTCAGCAGCTGAAGCAGAAGACCATCAACTACATTCAGCTGAAGCTGGACCTGGAGCGGGAGACCATCGAGCTGGTGCATACAGAGCCTACAGATGTGATCCAGCTGCCCTCCCGGGTACCCCGAGATGCTGCCCGCTACCACTTCTTCCTCTACAAGCACACCCATGAGGGTGACCCCCTTGAGTCTGTGGTGTTCATCTACTCCATGCCGGGCTACAAGTGCAGCATCAAGGAGCGCATGCTCTACTCCAGCTGCAAGAGCCGCCTGCTTGACTCCGTAGAGCAAGACTTCCAGCTGGAGATCTCCAAGAAGATTGAGATTGGCGATGGGGCAGAACTGACAGCTGAGTTCCTCTACGATGAGGTCCACCCCAAGCAACATGCCTTCAAGCAGGCCTTCGCCAAGCCCAAGGGCCCTGGGGGGAAGCGGGGCCACAAGCGCCTCATCCGGGGCCCAGGTGAGAACGGAGATGACAGCTAG

XM_004834208.1 Coding sequence

Twf2 twinfilin actin-binding protein 2, transcript variant X3

Length: 1056 bp    Location: 6020848..6011606   Strand: -
>XM_004834208.1
ATGGCGCACCAGACGGGCATCCACGCCACAGAGGAGCTTAAGGAATTCTTTGCCAAGGCACGGGCTGGCTCTGTCCGGCTCATCAAAGTCATCATCGAGGACGAGCAGCTCGTGCTGGGTGCCTCGCAGGAGCCCATGGGCCGCTGGGACCAAGACTATGACAGGGCTGTGCTGCCGCTGCTGGATGCTCAACAGCCCTGCTACATGCTCTTCCGCCTCGACTCACAGAACGCTCAGGGCTTCGAGTGGCTCTTCCTCGCCTGGTCACCTGATAATTCCCCTGTGCGGCTGAAGATGCTTTATGCCGCCACACGGGCCACAGTGAAGAAGGAGTTTGGGGGCGGCCACATCAAGGATGAGCTCTTTGGCACAGTGAAGGATGACCTCTCCTTTGCTGGGTACCAGAAGCACCTATCATCCTGTGCTGCCCCCGCCCCTCTGACTTCCGCAGAGAGAGAGCTCCAGCAGATCCGTATCAATGAGGTGGGTGTGAAGACGGAGATCAGTGTGGAAAGCAAGCACCAGACACTGCAGGGCCTCGCCTTCCCCCTTCAGCCTGAGGCCCAGCGGGCACTTCAGCAGCTGAAGCAGAAGACCATCAACTACATTCAGCTGAAGCTGGACCTGGAGCGGGAGACCATCGAGCTGGTGCATACAGAGCCTACAGATGTGATCCAGCTGCCCTCCCGGGTACCCCGAGATGCTGCCCGCTACCACTTCTTCCTCTACAAGCACACCCATGAGGGTGACCCCCTTGAGTCTGTGGTGTTCATCTACTCCATGCCGGGCTACAAGTGCAGCATCAAGGAGCGCATGCTCTACTCCAGCTGCAAGAGCCGCCTGCTTGACTCCGTAGAGCAAGACTTCCAGCTGGAGATCTCCAAGAAGATTGAGATTGGCGATGGGGCAGAACTGACAGCTGAGTTCCTCTACGATGAGGTCCACCCCAAGCAACATGCCTTCAAGCAGGCCTTCGCCAAGCCCAAGGGCCCTGGGGGGAAGCGGGGCCACAAGCGCCTCATCCGGGGCCCAGGTGAGAACGGAGATGACAGCTAG

XM_004834206.1 Coding sequence

Twf2 twinfilin actin-binding protein 2, transcript variant X1

Length: 1233 bp    Location: 6020848..6011606   Strand: -
>XM_004834206.1
ATGGCGCACCAGACGGGCATCCACGCCACAGAGGAGCTTAAGGAATTCTTTGCCAAGGCACGGGCTGGCTCTGTCCGGCTCATCAAAGTCATCATCGAGGACGAGCAGCTCGTGCTGGGTGCCTCGCAGGAGCCCATGGGCCGCTGGGACCAAGACTATGACAGGGCTGTGCTGCCGCTGCTGGATGCTCAACAGCCCTGCTACATGCTCTTCCGCCTCGACTCACAGAACGCTCAGGGCTTCGAGTGGCTCTTCCTCGCCTGGTCACCTGATAATTCCCCTGTGCGGCTGAAGATGCTTTATGCCGCCACACGGGCCACAGTGAAGAAGGAGTTTGGGGGCGGCCACATCAAGGATGAGCTCTTTGGCACAGTGAAGGTAGGTGAAAGTAGCCACCCAGGCCTGTACACGGCATGCAGCCAGGATCATGGGCCCACAGAAAGTGGGGCATTGTACAGGCCACAGAGAACACCAGTGCAAGGCTCGGGGGTGAAATGGGAGGGCTGGGAGTCTAGCAGCTGCAAGCTGAGGTGCCCATTTATGCCTCTGGGTCTGCCCCAGGATGACCTCTCCTTTGCTGGGTACCAGAAGCACCTATCATCCTGTGCTGCCCCCGCCCCTCTGACTTCCGCAGAGAGAGAGCTCCAGCAGATCCGTATCAATGAGGTGAAGACGGAGATCAGTGTGGAAAGCAAGCACCAGACACTGCAGGGCCTCGCCTTCCCCCTTCAGCCTGAGGCCCAGCGGGCACTTCAGCAGCTGAAGCAGAAGACCATCAACTACATTCAGCTGAAGCTGGACCTGGAGCGGGAGACCATCGAGCTGGTGCATACAGAGCCTACAGATGTGATCCAGCTGCCCTCCCGGGTACCCCGAGATGCTGCCCGCTACCACTTCTTCCTCTACAAGCACACCCATGAGGGTGACCCCCTTGAGTCTGTGGTGTTCATCTACTCCATGCCGGGCTACAAGTGCAGCATCAAGGAGCGCATGCTCTACTCCAGCTGCAAGAGCCGCCTGCTTGACTCCGTAGAGCAAGACTTCCAGCTGGAGATCTCCAAGAAGATTGAGATTGGCGATGGGGCAGAACTGACAGCTGAGTTCCTCTACGATGAGGTCCACCCCAAGCAACATGCCTTCAAGCAGGCCTTCGCCAAGCCCAAGGGCCCTGGGGGGAAGCGGGGCCACAAGCGCCTCATCCGGGGCCCAGGTGAGAACGGAGATGACAGCTAG

XM_004834209.1 Coding sequence

Ppm1m protein phosphatase, Mg2+/Mn2+ dependent, 1M, transcript variant X1

Length: 1383 bp    Location: 6025942..6030425   Strand: +
>XM_004834209.1
ATGTCAGCCGGCTGGTTGCGGCGCCGCTTCCTGCCCGGGGGTCCGCTCCCGGCTCCGCGCCCGGCCACGCCGCGCGCCAGTCCCGTGCCCTACCGGCGGCCCCGCTTTCTACGCGGCTCGGGTTCCAGCCCAGCCGCCGACGCCGCGCGCCGCCCGGACGCCCGGCCCGTGCGCAGCCCCGCGCGGGGCCGCACGCTTCCCTGGAACGCAGGCTACGCCGAGATCATCAATGCAGAAAAATCTGAATTCAATGAGGATCAAGCTGCCTGTGGGAAGCTGTGCATCCGGAGATATGAGTTTGGGGCTGAAGAGGACCAAGAGTGGCTGACCCTGTGCACAGAGGAGTTCCTTACAGGTCATTACTGGGCACTGTTTGATGGGCATGGCGGTCCTGCAGCGGCCATCCTGGCTGCCAACACCTTGCACTCCTGCCTGCGCCGGCAGCTGGAGGCCGTGGTAGAAGGCATAGTGGCCACTCAGCCCCCTATGCACCTCAGTGGTCACTGTGTCTGCCTCAGTGATCCTCAGTTTGTGGAGGAAAAGGGCATCAAGACAAAAGACTTGGTGATTGGGGCCCTGGAAAGGGCCTTCCAGGAATGCGATGAGGTGATTGGGCGGGAGCTGGAGGCCTCATGCCAGGTGGGTGGCTGCACAGCCCTGGTGGCTGTATCCTTGCAGGGAAAGCTGTATGTGGCCAATGCTGGAGACAGCAGGGCTCTTTTGGTACGGAGAGATGAGATAAGGCCACTGAGCTCTGAGTTCACCCCAGAGACTGAGCGGCAGCGGATCCAGGAGCTGGCCTTTGTCTACCCAGAGCTTCTGGCTGGTGAGTTCACCCGACTGGAATTCCCTCGGCGACTGAAAGGGGATGACTTGGGTCAGAAGGTTTTGTTCAGGGATCACCACATGAATGGCTGGAGCTACAAACGTGTGGAGAAATCAGATCTCAAATACCCACTGATTCACGGACAGGGTAGGCAGGCTCGGTTACTGGGAACACTGGCTGTCTCCCGGGGCCTAGGAGACCATCAGCTCAGAGTCCTGGACACCAACATCCAGCTCAAGCCATTCTTGCTCTCTGTCCCACAGGTGACTGTGCTAGATATGGATCAGCTGGAGCTGCAGGAGGATGATGTGGTTGTCATGGCAACAGATGGGCTCTGGGATGTCCTGTCCAATGAGCAGGTGGCACGGCTGGTGCAGAGCTTCCTCCCTGGGAACCGAGATGACCCACACAGGTTCTCGGAGTTGGCCCAAATGCTGATACGAAGCACGCAGGGGAAGGAAGACAGTCCCACGGGGCAAGGGCAGGTGTCCTACGATGATGTCTCTGTGTTCGTGATTCCCTTGCATAGCCAGGGCCAAGGGGGCAGTGGCCCCTGA

XM_004834216.1 Coding sequence

Glyctk glycerate kinase, transcript variant X4

Length: 1572 bp    Location: 6089672..6095621   Strand: +
>XM_004834216.1
ATGGCTGCAGCCCTGCAGGTTCTGCCCTGTCTGGTCCGAGCCCCTTCACGTCTCCTCTTCTGGGGCCCCCCAGTGGCCCGGCTGGTCAGCGGCATGGCCTTGTCAGAGCAGGCGCGACAGCTGTTTGAGAGTGCTGTGGGTGCTGTGCAGCCGGGGCCCATGCTGCAAAGGGCACTGTCCTTGGATCCAGATGGCAGACAGCTGAAGGTGCGGGACCGGAGCTTCCAGCTGCAGCAAAACCTGTACCTCGTTGGCTTTGGCAAGGCTGTACTCGGCATGGCAGCTGCAGTGGAGGAGCTACTGGGCCAGCATCTTGTGCAGGGTGTGATCAGTGTTCCCAAAGGGATCCGTGCTGCCATGGAACATGCTGGCAAGCAGGAGATATTGCTGAAGCCACACAGCCGTATCCAGGTATTTGAGGGTGCGGAGGACAACTTACCAGATCGTGATGCACTTCGGGCTGCACTGGCCATCCGGGATCTGGCAGAGAGACTCACAGCTGATGACCTACTGCTTGTGCTTATCTCAGGTGGGGGCTCGGCCCTGCTGCCTGCCCCCATCCCACCTGTCACCTTGGAGGAGAAACAGATGCTCACCAAGCTGCTGGCGGCCCGTGGAGCCACCATCCAGGAGCTGAACACCATCCGAAAGGCCCTGTCCCAGCTCAAGGGTGGAGGGCTGGCTCAGGCTGCCTACCCTGCCCAGGTGGTGAGCCTGATCCTGTCAGATGTGGTGGGAGACCCTGTGGAGGTGATTGCCAGCGGCCCCACTGTGGCTAGCACTCACAACGTGCAAGATTGTCTGTACATCCTCAATCGCTATGGACTTCGCGGTGCCCTGCCACGTTCTGTGAAGACCGTGCTTGCTCAGGCCGACTCTGACCCCCATGGGCCACACACCTGTGGTCATGTCCTCAATGTGATCATTGGCTCTAATGTGTTGGCACTGGCTGAGGCTCAGAGGCAGGCCCAGCTGCTGGGCTACCGGGCTGTGGTGCTGAGTGCAGCCATACAGGGTGATGTGAAAAGTGTGGCTCAGTTCTATGGGCTGCTAGCCCATGTGGCTGGAGCGCATCTCATCCCATCCACAGCTATGGCCTCAGTGGACGAGACTGTAAAACTCCGTGAGCTTGCAGCTAAGCTCCAGCTCTCAGACCTGCAGCTGGAGGAGGTGCTGGAGGTTGTAGTGGAGGCTAAGGGCCCTGTCTGCCTGCTGGCTGGTGGGGAGCCCACAGTACAGCTGCAGGGCTCCGGCAAGGGTGGCCGGAACCAGGAACTGGCCCTGCGTGTTGGAGCAGAGCTTGCAAGATGGTCTCTGGGGCCTGTTGATGTACTGTTTTTGAGTGGTGGCACTGATGGGCAGGATGGGCCCACTGAGGCTGCTGGGGCCTGGGTCATGCCTGAGCTTAAGAGCCAGGCAGCTGCTGAGGGGCTGGATGTGACCACTTTCCTAGCCCACAATGACACACATACCTTCTTCTGCCGCCTTCAGGGTGGAAAACACCTGTTATACACAGGGCTGACAGGTACCAACGTCATGGATGCCCACCTTCTGTTGCTGCGGCCTCAGTGA

XM_004834213.1 Coding sequence

Glyctk glycerate kinase, transcript variant X1

Length: 1572 bp    Location: 6091678..6095621   Strand: +
>XM_004834213.1
ATGGCTGCAGCCCTGCAGGTTCTGCCCTGTCTGGTCCGAGCCCCTTCACGTCTCCTCTTCTGGGGCCCCCCAGTGGCCCGGCTGGTCAGCGGCATGGCCTTGTCAGAGCAGGCGCGACAGCTGTTTGAGAGTGCTGTGGGTGCTGTGCAGCCGGGGCCCATGCTGCAAAGGGCACTGTCCTTGGATCCAGATGGCAGACAGCTGAAGGTGCGGGACCGGAGCTTCCAGCTGCAGCAAAACCTGTACCTCGTTGGCTTTGGCAAGGCTGTACTCGGCATGGCAGCTGCAGTGGAGGAGCTACTGGGCCAGCATCTTGTGCAGGGTGTGATCAGTGTTCCCAAAGGGATCCGTGCTGCCATGGAACATGCTGGCAAGCAGGAGATATTGCTGAAGCCACACAGCCGTATCCAGGTATTTGAGGGTGCGGAGGACAACTTACCAGATCGTGATGCACTTCGGGCTGCACTGGCCATCCGGGATCTGGCAGAGAGACTCACAGCTGATGACCTACTGCTTGTGCTTATCTCAGGTGGGGGCTCGGCCCTGCTGCCTGCCCCCATCCCACCTGTCACCTTGGAGGAGAAACAGATGCTCACCAAGCTGCTGGCGGCCCGTGGAGCCACCATCCAGGAGCTGAACACCATCCGAAAGGCCCTGTCCCAGCTCAAGGGTGGAGGGCTGGCTCAGGCTGCCTACCCTGCCCAGGTGGTGAGCCTGATCCTGTCAGATGTGGTGGGAGACCCTGTGGAGGTGATTGCCAGCGGCCCCACTGTGGCTAGCACTCACAACGTGCAAGATTGTCTGTACATCCTCAATCGCTATGGACTTCGCGGTGCCCTGCCACGTTCTGTGAAGACCGTGCTTGCTCAGGCCGACTCTGACCCCCATGGGCCACACACCTGTGGTCATGTCCTCAATGTGATCATTGGCTCTAATGTGTTGGCACTGGCTGAGGCTCAGAGGCAGGCCCAGCTGCTGGGCTACCGGGCTGTGGTGCTGAGTGCAGCCATACAGGGTGATGTGAAAAGTGTGGCTCAGTTCTATGGGCTGCTAGCCCATGTGGCTGGAGCGCATCTCATCCCATCCACAGCTATGGCCTCAGTGGACGAGACTGTAAAACTCCGTGAGCTTGCAGCTAAGCTCCAGCTCTCAGACCTGCAGCTGGAGGAGGTGCTGGAGGTTGTAGTGGAGGCTAAGGGCCCTGTCTGCCTGCTGGCTGGTGGGGAGCCCACAGTACAGCTGCAGGGCTCCGGCAAGGGTGGCCGGAACCAGGAACTGGCCCTGCGTGTTGGAGCAGAGCTTGCAAGATGGTCTCTGGGGCCTGTTGATGTACTGTTTTTGAGTGGTGGCACTGATGGGCAGGATGGGCCCACTGAGGCTGCTGGGGCCTGGGTCATGCCTGAGCTTAAGAGCCAGGCAGCTGCTGAGGGGCTGGATGTGACCACTTTCCTAGCCCACAATGACACACATACCTTCTTCTGCCGCCTTCAGGGTGGAAAACACCTGTTATACACAGGGCTGACAGGTACCAACGTCATGGATGCCCACCTTCTGTTGCTGCGGCCTCAGTGA

XM_004834215.1 Coding sequence

Glyctk glycerate kinase, transcript variant X3

Length: 1572 bp    Location: 6091678..6095621   Strand: +
>XM_004834215.1
ATGGCTGCAGCCCTGCAGGTTCTGCCCTGTCTGGTCCGAGCCCCTTCACGTCTCCTCTTCTGGGGCCCCCCAGTGGCCCGGCTGGTCAGCGGCATGGCCTTGTCAGAGCAGGCGCGACAGCTGTTTGAGAGTGCTGTGGGTGCTGTGCAGCCGGGGCCCATGCTGCAAAGGGCACTGTCCTTGGATCCAGATGGCAGACAGCTGAAGGTGCGGGACCGGAGCTTCCAGCTGCAGCAAAACCTGTACCTCGTTGGCTTTGGCAAGGCTGTACTCGGCATGGCAGCTGCAGTGGAGGAGCTACTGGGCCAGCATCTTGTGCAGGGTGTGATCAGTGTTCCCAAAGGGATCCGTGCTGCCATGGAACATGCTGGCAAGCAGGAGATATTGCTGAAGCCACACAGCCGTATCCAGGTATTTGAGGGTGCGGAGGACAACTTACCAGATCGTGATGCACTTCGGGCTGCACTGGCCATCCGGGATCTGGCAGAGAGACTCACAGCTGATGACCTACTGCTTGTGCTTATCTCAGGTGGGGGCTCGGCCCTGCTGCCTGCCCCCATCCCACCTGTCACCTTGGAGGAGAAACAGATGCTCACCAAGCTGCTGGCGGCCCGTGGAGCCACCATCCAGGAGCTGAACACCATCCGAAAGGCCCTGTCCCAGCTCAAGGGTGGAGGGCTGGCTCAGGCTGCCTACCCTGCCCAGGTGGTGAGCCTGATCCTGTCAGATGTGGTGGGAGACCCTGTGGAGGTGATTGCCAGCGGCCCCACTGTGGCTAGCACTCACAACGTGCAAGATTGTCTGTACATCCTCAATCGCTATGGACTTCGCGGTGCCCTGCCACGTTCTGTGAAGACCGTGCTTGCTCAGGCCGACTCTGACCCCCATGGGCCACACACCTGTGGTCATGTCCTCAATGTGATCATTGGCTCTAATGTGTTGGCACTGGCTGAGGCTCAGAGGCAGGCCCAGCTGCTGGGCTACCGGGCTGTGGTGCTGAGTGCAGCCATACAGGGTGATGTGAAAAGTGTGGCTCAGTTCTATGGGCTGCTAGCCCATGTGGCTGGAGCGCATCTCATCCCATCCACAGCTATGGCCTCAGTGGACGAGACTGTAAAACTCCGTGAGCTTGCAGCTAAGCTCCAGCTCTCAGACCTGCAGCTGGAGGAGGTGCTGGAGGTTGTAGTGGAGGCTAAGGGCCCTGTCTGCCTGCTGGCTGGTGGGGAGCCCACAGTACAGCTGCAGGGCTCCGGCAAGGGTGGCCGGAACCAGGAACTGGCCCTGCGTGTTGGAGCAGAGCTTGCAAGATGGTCTCTGGGGCCTGTTGATGTACTGTTTTTGAGTGGTGGCACTGATGGGCAGGATGGGCCCACTGAGGCTGCTGGGGCCTGGGTCATGCCTGAGCTTAAGAGCCAGGCAGCTGCTGAGGGGCTGGATGTGACCACTTTCCTAGCCCACAATGACACACATACCTTCTTCTGCCGCCTTCAGGGTGGAAAACACCTGTTATACACAGGGCTGACAGGTACCAACGTCATGGATGCCCACCTTCTGTTGCTGCGGCCTCAGTGA

XM_004834214.1 Coding sequence

Glyctk glycerate kinase, transcript variant X2

Length: 1572 bp    Location: 6091678..6095621   Strand: +
>XM_004834214.1
ATGGCTGCAGCCCTGCAGGTTCTGCCCTGTCTGGTCCGAGCCCCTTCACGTCTCCTCTTCTGGGGCCCCCCAGTGGCCCGGCTGGTCAGCGGCATGGCCTTGTCAGAGCAGGCGCGACAGCTGTTTGAGAGTGCTGTGGGTGCTGTGCAGCCGGGGCCCATGCTGCAAAGGGCACTGTCCTTGGATCCAGATGGCAGACAGCTGAAGGTGCGGGACCGGAGCTTCCAGCTGCAGCAAAACCTGTACCTCGTTGGCTTTGGCAAGGCTGTACTCGGCATGGCAGCTGCAGTGGAGGAGCTACTGGGCCAGCATCTTGTGCAGGGTGTGATCAGTGTTCCCAAAGGGATCCGTGCTGCCATGGAACATGCTGGCAAGCAGGAGATATTGCTGAAGCCACACAGCCGTATCCAGGTATTTGAGGGTGCGGAGGACAACTTACCAGATCGTGATGCACTTCGGGCTGCACTGGCCATCCGGGATCTGGCAGAGAGACTCACAGCTGATGACCTACTGCTTGTGCTTATCTCAGGTGGGGGCTCGGCCCTGCTGCCTGCCCCCATCCCACCTGTCACCTTGGAGGAGAAACAGATGCTCACCAAGCTGCTGGCGGCCCGTGGAGCCACCATCCAGGAGCTGAACACCATCCGAAAGGCCCTGTCCCAGCTCAAGGGTGGAGGGCTGGCTCAGGCTGCCTACCCTGCCCAGGTGGTGAGCCTGATCCTGTCAGATGTGGTGGGAGACCCTGTGGAGGTGATTGCCAGCGGCCCCACTGTGGCTAGCACTCACAACGTGCAAGATTGTCTGTACATCCTCAATCGCTATGGACTTCGCGGTGCCCTGCCACGTTCTGTGAAGACCGTGCTTGCTCAGGCCGACTCTGACCCCCATGGGCCACACACCTGTGGTCATGTCCTCAATGTGATCATTGGCTCTAATGTGTTGGCACTGGCTGAGGCTCAGAGGCAGGCCCAGCTGCTGGGCTACCGGGCTGTGGTGCTGAGTGCAGCCATACAGGGTGATGTGAAAAGTGTGGCTCAGTTCTATGGGCTGCTAGCCCATGTGGCTGGAGCGCATCTCATCCCATCCACAGCTATGGCCTCAGTGGACGAGACTGTAAAACTCCGTGAGCTTGCAGCTAAGCTCCAGCTCTCAGACCTGCAGCTGGAGGAGGTGCTGGAGGTTGTAGTGGAGGCTAAGGGCCCTGTCTGCCTGCTGGCTGGTGGGGAGCCCACAGTACAGCTGCAGGGCTCCGGCAAGGGTGGCCGGAACCAGGAACTGGCCCTGCGTGTTGGAGCAGAGCTTGCAAGATGGTCTCTGGGGCCTGTTGATGTACTGTTTTTGAGTGGTGGCACTGATGGGCAGGATGGGCCCACTGAGGCTGCTGGGGCCTGGGTCATGCCTGAGCTTAAGAGCCAGGCAGCTGCTGAGGGGCTGGATGTGACCACTTTCCTAGCCCACAATGACACACATACCTTCTTCTGCCGCCTTCAGGGTGGAAAACACCTGTTATACACAGGGCTGACAGGTACCAACGTCATGGATGCCCACCTTCTGTTGCTGCGGCCTCAGTGA

XM_004834217.1 Coding sequence

Glyctk glycerate kinase, transcript variant X5

High confidence: 4 potential gene matches
Length: 1572 bp    Location: 6091678..6095621   Strand: +
>XM_004834217.1
ATGGCTGCAGCCCTGCAGGTTCTGCCCTGTCTGGTCCGAGCCCCTTCACGTCTCCTCTTCTGGGGCCCCCCAGTGGCCCGGCTGGTCAGCGGCATGGCCTTGTCAGAGCAGGCGCGACAGCTGTTTGAGAGTGCTGTGGGTGCTGTGCAGCCGGGGCCCATGCTGCAAAGGGCACTGTCCTTGGATCCAGATGGCAGACAGCTGAAGGTGCGGGACCGGAGCTTCCAGCTGCAGCAAAACCTGTACCTCGTTGGCTTTGGCAAGGCTGTACTCGGCATGGCAGCTGCAGTGGAGGAGCTACTGGGCCAGCATCTTGTGCAGGGTGTGATCAGTGTTCCCAAAGGGATCCGTGCTGCCATGGAACATGCTGGCAAGCAGGAGATATTGCTGAAGCCACACAGCCGTATCCAGGTATTTGAGGGTGCGGAGGACAACTTACCAGATCGTGATGCACTTCGGGCTGCACTGGCCATCCGGGATCTGGCAGAGAGACTCACAGCTGATGACCTACTGCTTGTGCTTATCTCAGGTGGGGGCTCGGCCCTGCTGCCTGCCCCCATCCCACCTGTCACCTTGGAGGAGAAACAGATGCTCACCAAGCTGCTGGCGGCCCGTGGAGCCACCATCCAGGAGCTGAACACCATCCGAAAGGCCCTGTCCCAGCTCAAGGGTGGAGGGCTGGCTCAGGCTGCCTACCCTGCCCAGGTGGTGAGCCTGATCCTGTCAGATGTGGTGGGAGACCCTGTGGAGGTGATTGCCAGCGGCCCCACTGTGGCTAGCACTCACAACGTGCAAGATTGTCTGTACATCCTCAATCGCTATGGACTTCGCGGTGCCCTGCCACGTTCTGTGAAGACCGTGCTTGCTCAGGCCGACTCTGACCCCCATGGGCCACACACCTGTGGTCATGTCCTCAATGTGATCATTGGCTCTAATGTGTTGGCACTGGCTGAGGCTCAGAGGCAGGCCCAGCTGCTGGGCTACCGGGCTGTGGTGCTGAGTGCAGCCATACAGGGTGATGTGAAAAGTGTGGCTCAGTTCTATGGGCTGCTAGCCCATGTGGCTGGAGCGCATCTCATCCCATCCACAGCTATGGCCTCAGTGGACGAGACTGTAAAACTCCGTGAGCTTGCAGCTAAGCTCCAGCTCTCAGACCTGCAGCTGGAGGAGGTGCTGGAGGTTGTAGTGGAGGCTAAGGGCCCTGTCTGCCTGCTGGCTGGTGGGGAGCCCACAGTACAGCTGCAGGGCTCCGGCAAGGGTGGCCGGAACCAGGAACTGGCCCTGCGTGTTGGAGCAGAGCTTGCAAGATGGTCTCTGGGGCCTGTTGATGTACTGTTTTTGAGTGGTGGCACTGATGGGCAGGATGGGCCCACTGAGGCTGCTGGGGCCTGGGTCATGCCTGAGCTTAAGAGCCAGGCAGCTGCTGAGGGGCTGGATGTGACCACTTTCCTAGCCCACAATGACACACATACCTTCTTCTGCCGCCTTCAGGGTGGAAAACACCTGTTATACACAGGGCTGACAGGTACCAACGTCATGGATGCCCACCTTCTGTTGCTGCGGCCTCAGTGA

XM_004834218.1 Coding sequence

Pik3r4 phosphoinositide-3-kinase, regulatory subunit 4

High confidence: 4 potential gene matches
Length: 4077 bp    Location: 6744470..6642190   Strand: -
>XM_004834218.1
ATGGGAAATCAACTTGCTGGCATTGCTCCTTCCCAGATCCTTTCTGTGGAGAGTTATTTCTCAGACATCCATGACTTTGAATATGATAAAAGCCTTGGAAGTACTCGTTTTTTTAAAGTTGCTCGAGCAAAGCACCGAGAAGGCCTGGTGGTTGTGAAGGTTTTTGCAATTCAGGATCCCACATTGCCTTTAACTAGCTATAAACAAGAGCTGGAGGAACTGAAAATCAGACTTCATTCTGCACAGAATTGTCTACCTTTCCAGAAAGCAGCAGAGAAAGCATCTGAGAAAGCAGCTATGCTGTTTAGGCAATATGTTCGAGATAACCTCTATGATCGCATCAGTACTCGTCCATTCTTAAATAACATTGAGAAGCGCTGGATCGCATTCCAGATCCTGACAGCAGTGGACCAAGCACACAAATCTGGAGTCCGTCATGGGGATATCAAGACTGAGAATGTGATGGTCACCAGTTGGAACTGGGTTCTTCTGACTGATTTTGCCAGTTTTAAACCTACTTATCTTCCAGAGGACAACCCAGCAGATTTCAACTATTTCTTTGATACCTCACGGAGGAGGACTTGCTACATTGCTCCTGAACGCTTTGTTGATGGTGGTATGTTTGCTACCGAGTTAGAATACATGAGAGATCCTTCAACTCCACTTGTAGACCTAAATAGTAATCAGAGAACAAGAGGAGAGTTGAAGAGAGCAATGGATATTTTTTCAGCAGGTTGTGTGATAGCTGAACTTTTTACAGAAGGCGTACCATTGTTTGATCTCTCTCAACTTTTGGCTTATAGAAATGGACATTTTTTCCCTGAACAAGTGCTAAATAAAATTGAAGATCTCAGTATCAGAGAATTGGTAACTCAGATGATTCATCGTGAGCCAGATAAACGTTTAGAGGCTGAAGATTACTTAAAGCAGCAGCGTGGCAATGCCTTCCCTGAAATATTTTACACTTTTCTTCAGCCTTACATGGCCCAGTTTGCCAAGGAAACATTTCTCTCTGCAGATGAGCGTATTCTGGTTATACGGAAGGATTTGGGCAACATTATTCACAATCTCTGTGGTCATGATCTGCCAGAAAAAGCAGAAGGAGAGCCTAAGGAAAATGGGCTGGTTATCTTGGTGTCTGTTATAACATCCTGCCTACAGACCCTTAAGTACTGTGATTCCAAACTTGCTGCTTTGGAACTTATTCTTCATTTAGCCTCAAGATTAAGTGTAGAAATCCTTTTGGATCGTATTACTCCCTATCTTTTGCATTTCAGCAATGACTCTGTTCCTAGAGTGAGGGCTGAAGCCTTGAGAACATTGACCAAAGTTCTTGCCCTTGTCAAAGAGGTTCCTCGCAATGATATCAATATCTATCCGGAATACATTCTTCCAGGAATAGCCCACTTAGCCCAAGATGATGCTACTATTGTTAGGCTAGCTTATGCTGAAAATATAGCTCTACTGGCAGAAACAGCTCTGAGATTCCTGGAATTAGTACAGTTAAAAAATCTTAACATGGAAAATGACCCTAGTAGTGAAGAAATAGATGAAGTTACACATCCTAATGGAAATTATGACACAGAACTCCAAGCCTTACATGAAATGGTCCAGCAGAAAGTTGTCACTTTGTTAAGTGACCCTGAAAATATTGTGAAACAAACTTTAATGGAAAACGGAATAACACGGCTATGTGTATTCTTCGGACGTCAGAAAGCCAATGACGTTTTGTTGTCTCACATGATCACTTTCTTAAATGATAAGAATGATTGGCATCTGCGTGGAGCTTTTTTTGATAGTATAGTTGGTGTTGCTGCCTATGTTGGCTGGCAAAGCTCCTCAATTCTCAAGCCCCTTTTGCAACAAGGTCTTAGTGATGCTGAGGAATTTGTTATTGTGAAAGCTCTTAATGCCCTTACCTGTATGTGCCAGTTAGGGCTGTTACAAAAGCCCCATGTCTATGAATTTGCCAGTGACATTGCCCCATTCTTGTGTCATCCTAATCTGTGGATACGCTATGGTGCCGTGGGATTTATCACAGTGGTCGCCCACCAAATAAGTACAGCTGACATCTACTGCAAACTGATGCCTTATCTTGACCCGTACATTACCCAACCAGTAATACAGATTGAAAGAAAACTTGTTCTGCTCAGTGTTTTAAAAGAGCCAGTAAGTCGTTCTATATTTGATTATACTTTGAGGTCTAAAGATATTACCAGCTTGTTCAGACATCTTCATATGCGTCAGAAGAAACGAAATGGATCTCTCCCTGACTGCCCTCCACCTGAGGACCCTGCCATAGCACAGCTTCTGAAAAAACTGCTCTCACAGGGAATGACAGAGGAAGAGGAAGATAAACTTCTCTCACTAAAAGACTTCATGATGAAATCTAATAGAGCAAAAGCAAATATAGTAGACCAGAGCCATCTTCATGACAGTAGTCAGAAGGGTGTAATTGACTTGGCAGCTCTGGGCATAACTGGGAGACAAGTTGATCTTGTTAAAACCAAACAAGAACCAGATGACAAACGAGCTAGAAAACATGTAAAACAAGACTCAAATGTAAATGAAGAATGGAAAAGCATGTTTGGGTCACTGGAACCATCCAGCATCCCTCAGGCCTTGCCTAAAGGAAGTGACCAGGAGGTGATTCAGACTGGGAAGCCTACTCGTTCAGAGTCCTCTGCCGGCATTTGTGTTCCTTTGTCAACTTCTCCGCAGGTTTCAGAAGTAACCAATGTCCAAAATAAAAAACCAGTAATACAGGTTTTAAGTAGTACAGTTTTACCATCTACTTATCAGATTCGAATTACCACTTGTAAAACTGAACTTCAGCAACTCATACAGCAGAAGCGGGAGCAGTGCAATGCTGAGAGGATAGCTAAGCAGATGATGGAGAATGCCGAATGGGAGAGTAAACCACCACCACCTGGGTGGCGTCCTAAAGGACTACTAGTTGCACATCTTCATGAACACAAATCTGCTGTGAATCGAATTAGAGTCTCTGATGAACACTCACTTTTTGCAACATGTTCAAACGATGGCACAGTGAAAATCTGGAACAGCCAAAAGATGGAAGGGAAGACCACCACAACAAGATCTATTCTTACATATAGCCGAATCGGAGGACGAGTCAAGACCCTCACATTCTGCCAAGGTTCCCACTACTTAGCCATAGCATCTGATAATGGCGCTGTCCAGCTTCTTGGAGTTGAGGCTTCTAAGCTGCCCAAGTCTCCTAAAATCCATCCTCTACAAAGCAGAATTCTGGATCCGAAGGAGGATGGCTGTGTTGTGGACATACATCACTTTAACTCTGGGGCACAGTCTGTACTCGCGTATGCCACTGTGAATGGCTCTCTGGTGGGCTGGGACCTCAGGTCTTCAAACAATGCGTGGACATTAAAGCATGACTTGAAGTCAGGCCTTATCACCTCCTTTGCTGTGGACATCCATCAGTGCTGGCTCTGCATTGGTACAAGCAGTGGTACTATGGCTTGTTGGGACATGAGGTTCCAGTTGCCAATTTCTAGTCACTGTCATCCTTCCAGGGCTCGAATCAGGCGCCTCTCCATGCACCCACTGTACCAGTCTTGGGTGATTGCAGCTGTTCAGGGCAATAATGAAGTATCCATGTGGGACATGGAGACTGGTGACAGAAGATTTACTCTCTGGGCCAGCAGTGCACCACCACTTTCTGAGTTACAGCCTTCTCCTCACAGTGTCCATGGTATCTACTGCAGTCCTGCAGATGGGAATCCTATCCTGCTAACAGCTGGCTCAGACATGAAAATAAGGTTTTGGGACTTGGCTTACCCAGAAAGATCTTATGTTGTGGCAGGAAGTACTAGTTCCCCATCTGTGTCCTACTATAGAAAAATAATAGAAGGCACTGAGGTTGTACAGGAAATTCAGAACAAACAGAAAGTAGGACCAAGCGATGATACCCCTCGAAGGGGCCCGGAGTCTTTGCCTGTGGGACATCATGACATCATCACAGATGTTGCTACCTTCCAGACAACACAGGGCTTCATCGTGACTGGTTCTAGAGATGGGATTGTAAAGGTGTGGAAATAA

XM_004834220.1 Coding sequence

Atp2c1 ATPase, Ca++ transporting, type 2C, member 1, transcript variant X1

Length: 2898 bp    Location: 6864969..7000359   Strand: +
>XM_004834220.1
ATGGATAATCTGTTGCCTCCATCTAGATTCTCTTATTTCAAAAAATATCCTCTTCATGCAATTAGGAAATATTTATCAACGCTGAGAAACCAAAGAGCTGAAGATCAGGTTGCACGTTTTCAAAAAATACCTAATGGTGAAAATGAGACAATGATTCCTGTATTGACATCCAAAAAAGCAAGTGAATTACCAGTCAGTGAAGTTGCAGGCATTCTCCAAGCTGATCTTCAGAATGGTCTAAACAAATGTGAAGTTAGTCATAGGCGAGCCTTCCATGGCTGGAATGAATTTGATATCAGTGAGGATGAGCCACTGTGGAAGAAGTATATTTCCCAGTTTAAAAATCCTCTTATTATGCTGCTTCTGGCTTCTGCAGTTATCAGTGTTTTAATGCATCAGTTTGATGATGCTGTCAGTATCACTGTGGCAATACTTATAGTGGTTACAGTTGCCTTTGTTCAGGAATATCGTTCAGAAAAATCTCTTGAGGAACTGAGTAAACTTGTGCCACCAGAATGCCATTGCGTGCGTGAGGGAAAGCTGGAGCACACACTGGCCCGAGACTTGGTTCCAGGAGATACTGTTTGCCTATCTGTTGGGGACAGAGTTCCTGCTGACTTGCGCTTATTTGAAGCTGTGGATCTTTCCATTGATGAGTCTAGCTTGACAGGAGAGACAACACCTTGTTCTAAGGTGACAGCTCCTCAGCCAGCTGCAACTAATGGTGATCTTGCATCAAGGAGTAACATTGCCTTCATGGGGACACTGGTCAGATGTGGCAAAGCAAAGGGTATTGTCATTGGAACAGGAGAAAATTCTGAATTTGGGGAGGTTTTTAAAATGATGCAAGCAGAAGAAGCACCAAAAACCCCTCTGCAGAAGAGCATGGACCTCTTAGGAAAACAACTTTCCTTTTACTCCTTTGGTATAATAGGTATCATCATGTTGGTTGGCTGGTTACTAGGAAAAGATATCCTGGAAATGTTTACTATCAGTGTAAGTTTGGCTGTAGCAGCAATTCCTGAAGGTCTTCCCATTGTGGTCACAGTGACATTAGCCCTTGGTGTTATGAGAATGGTGAAGAAAAGGGCTATTGTGAAAAAACTACCTATTGTTGAAACTCTGGGATGCTGTAATGTGATTTGTTCAGATAAAACTGGAACACTGACGAAGAATGAAATGACTGTTACTCACATATTTACTTCAGATGGTCTGCATGCTGAGGTTACTGGAGTTGGCTATAATCAGTTTGGGGAAGTGATTGTTGATGGTGATGTTGTTCATGGATTCTACAACCCAGACGTTAGCAGAATTGTGGAAGCGGGCTGTGTATGCAATGATGCTGTGATTCGGAACAACACTCTAATGGGGAAGCCTACAGAAGGAGCTTTAATTGCTCTTGCCATGAAGATGGGTCTTGATGGACTTCAGCAAGACTATATCAGAAAAGCTGAATACCCTTTTAGCTCAGAGCAAAAGTGGATGGCTGTTAAATGTGTACACCGAACACAGCAGGACAGACCAGAGATTTGTTTTATGAAGGGTGCCTATGAACAGGTGATTAAGTACTGTACTACATACCATAGCAAAGGACAGACCTTGACCATTACACAGCAGCAGAGAGATCTGTACCAGCAAGAGAAGGCACGCATGGGCTCAGCAGGACTCAGAGTTCTTGCTGTGGCTTCTGGTCCTGAACTGGGACAGCTGACATTTCTTGGCTTGGTGGGAATCATTGATCCTCCCAGAACTGGTGTGAAAGAAGCAGTTACAACACTCATTGCCTCAGGAGTATCTATAAAAATGATCACTGGAGATTCACAGGAGACTGCAGTCGCTATTGCCAGTCGTCTGGGATTATATTCTAAAACCTCCCAGTCGGTCTCAGGAGAAGAAATAGATGCCATGGATGTCCAGCAGCTTTCACAGATAGTACCAAAGGTTGCGGTATTTTACAGAGCTAGCCCAAGACACAAGATGAAAATTATTAAGTCTCTACAGAAGAACGGGGCAGTTGTAGCCATGACAGGAGATGGAGTAAATGACGCAGTTGCTCTGAAGGCTGCAGACATTGGAGTTGCAATGGGCCAGACTGGCACAGATGTTTGCAAGGAGGCAGCAGACATGATCCTGGTAGATGATGACTTCCAAACCATAATGTCAGCAATTGAAGAGGGTAAAGGGATTTATAACAACATTAAAAATTTTGTTAGATTTCAGCTGAGCACGAGTATAGCAGCATTAACTTTAATATCATTGGCTACATTAATGAACTTTCCTAATCCTCTCAATGCAATGCAGATTTTGTGGATCAATATTATTATGGATGGACCCCCAGCTCAGAGCCTTGGAGTAGAACCAGTGGATAAAGACGTCATTCGTAAACCTCCTCGCAACTGGAAGGACAGCATTTTGACTAAAAATTTGATACTTAAAATACTTGTTTCATCAATAATCATTGTTTGTGGGACTTTGTTTGTCTTCTGGCGTGAGCTGCGAGACAATGTGATAACACCTAGAGACACTACGATGACCTTCACGTGCTTTGTATTTTTTGATATGTTTAATGCATTGAGTTCCAGATCTCAGACCAAGTCTGTGTTTGAGATTGGACTCTGCAGTAATAAAATGTTTTGCTATGCAGTTCTTGGATCCATCATGGGACAATTACTAGTTATTTATTTTCCTCCACTTCAGAAGGTTTTTCAGACCGAGAGCTTGAGTATACTGGATCTGTTGTTTCTTTTGGGTCTCACCTCTTCAGTATGCATAGTGGCAGAAATTATAAAGAAGGTTGAAAGGAGCAGGGAAAAGATCCAGAAGCCTGTTAGTTCGACATCACCGTCTTTTCTTGAATTAGGTCTGGCTCTGGGAGAGGAGTGGACAGCAGCTGATTGA

XM_004834221.1 Coding sequence

Atp2c1 ATPase, Ca++ transporting, type 2C, member 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 2862 bp    Location: 6864969..6988080   Strand: +
>XM_004834221.1
ATGGATAATCTGTTGCCTCCATCTAGATTCTCTTATTTCAAAAAATATCCTCTTCATGCAATTAGGAAATATTTATCAACGCTGAGAAACCAAAGAGCTGAAGATCAGGTTGCACGTTTTCAAAAAATACCTAATGGTGAAAATGAGACAATGATTCCTGTATTGACATCCAAAAAAGCAAGTGAATTACCAGTCAGTGAAGTTGCAGGCATTCTCCAAGCTGATCTTCAGAATGGTCTAAACAAATGTGAAGTTAGTCATAGGCGAGCCTTCCATGGCTGGAATGAATTTGATATCAGTGAGGATGAGCCACTGTGGAAGAAGTATATTTCCCAGTTTAAAAATCCTCTTATTATGCTGCTTCTGGCTTCTGCAGTTATCAGTGTTTTAATGCATCAGTTTGATGATGCTGTCAGTATCACTGTGGCAATACTTATAGTGGTTACAGTTGCCTTTGTTCAGGAATATCGTTCAGAAAAATCTCTTGAGGAACTGAGTAAACTTGTGCCACCAGAATGCCATTGCGTGCGTGAGGGAAAGCTGGAGCACACACTGGCCCGAGACTTGGTTCCAGGAGATACTGTTTGCCTATCTGTTGGGGACAGAGTTCCTGCTGACTTGCGCTTATTTGAAGCTGTGGATCTTTCCATTGATGAGTCTAGCTTGACAGGAGAGACAACACCTTGTTCTAAGGTGACAGCTCCTCAGCCAGCTGCAACTAATGGTGATCTTGCATCAAGGAGTAACATTGCCTTCATGGGGACACTGGTCAGATGTGGCAAAGCAAAGGGTATTGTCATTGGAACAGGAGAAAATTCTGAATTTGGGGAGGTTTTTAAAATGATGCAAGCAGAAGAAGCACCAAAAACCCCTCTGCAGAAGAGCATGGACCTCTTAGGAAAACAACTTTCCTTTTACTCCTTTGGTATAATAGGTATCATCATGTTGGTTGGCTGGTTACTAGGAAAAGATATCCTGGAAATGTTTACTATCAGTGTAAGTTTGGCTGTAGCAGCAATTCCTGAAGGTCTTCCCATTGTGGTCACAGTGACATTAGCCCTTGGTGTTATGAGAATGGTGAAGAAAAGGGCTATTGTGAAAAAACTACCTATTGTTGAAACTCTGGGATGCTGTAATGTGATTTGTTCAGATAAAACTGGAACACTGACGAAGAATGAAATGACTGTTACTCACATATTTACTTCAGATGGTCTGCATGCTGAGGTTACTGGAGTTGGCTATAATCAGTTTGGGGAAGTGATTGTTGATGGTGATGTTGTTCATGGATTCTACAACCCAGACGTTAGCAGAATTGTGGAAGCGGGCTGTGTATGCAATGATGCTGTGATTCGGAACAACACTCTAATGGGGAAGCCTACAGAAGGAGCTTTAATTGCTCTTGCCATGAAGATGGGTCTTGATGGACTTCAGCAAGACTATATCAGAAAAGCTGAATACCCTTTTAGCTCAGAGCAAAAGTGGATGGCTGTTAAATGTGTACACCGAACACAGCAGGACAGACCAGAGATTTGTTTTATGAAGGGTGCCTATGAACAGGTGATTAAGTACTGTACTACATACCATAGCAAAGGACAGACCTTGACCATTACACAGCAGCAGAGAGATCTGTACCAGCAAGAGAAGGCACGCATGGGCTCAGCAGGACTCAGAGTTCTTGCTGTGGCTTCTGGTCCTGAACTGGGACAGCTGACATTTCTTGGCTTGGTGGGAATCATTGATCCTCCCAGAACTGGTGTGAAAGAAGCAGTTACAACACTCATTGCCTCAGGAGTATCTATAAAAATGATCACTGGAGATTCACAGGAGACTGCAGTCGCTATTGCCAGTCGTCTGGGATTATATTCTAAAACCTCCCAGTCGGTCTCAGGAGAAGAAATAGATGCCATGGATGTCCAGCAGCTTTCACAGATAGTACCAAAGGTTGCGGTATTTTACAGAGCTAGCCCAAGACACAAGATGAAAATTATTAAGTCTCTACAGAAGAACGGGGCAGTTGTAGCCATGACAGGAGATGGAGTAAATGACGCAGTTGCTCTGAAGGCTGCAGACATTGGAGTTGCAATGGGCCAGACTGGCACAGATGTTTGCAAGGAGGCAGCAGACATGATCCTGGTAGATGATGACTTCCAAACCATAATGTCAGCAATTGAAGAGGGTAAAGGGATTTATAACAACATTAAAAATTTTGTTAGATTTCAGCTGAGCACGAGTATAGCAGCATTAACTTTAATATCATTGGCTACATTAATGAACTTTCCTAATCCTCTCAATGCAATGCAGATTTTGTGGATCAATATTATTATGGATGGACCCCCAGCTCAGAGCCTTGGAGTAGAACCAGTGGATAAAGACGTCATTCGTAAACCTCCTCGCAACTGGAAGGACAGCATTTTGACTAAAAATTTGATACTTAAAATACTTGTTTCATCAATAATCATTGTTTGTGGGACTTTGTTTGTCTTCTGGCGTGAGCTGCGAGACAATGTGATAACACCTAGAGACACTACGATGACCTTCACGTGCTTTGTATTTTTTGATATGTTTAATGCATTGAGTTCCAGATCTCAGACCAAGTCTGTGTTTGAGATTGGACTCTGCAGTAATAAAATGTTTTGCTATGCAGTTCTTGGATCCATCATGGGACAATTACTAGTTATTTATTTTCCTCCACTTCAGAAGGTTTTTCAGACCGAGAGCTTGAGTATACTGGATCTGTTGTTTCTTTTGGGTCTCACCTCTTCAGTATGCATAGTGGCAGAAATTATAAAGAAGGTTGAAAGGAGCAGGGAAAAGATCCAGAAGCCTGTTAGTTCGACATCACCGTCTTTTCTTGAAGTATGA

XM_004834219.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 2094 bp    Location: 7010209..6998160   Strand: -
>XM_004834219.1
ATGGAGGGGTTGTGCCTCTGGAAAGACCGAGCAGTTCTTCAGTCTGTCATCATGGGTATCCGAGGACTAATGAGTTTTGTGGAAGATCATAGTAATGAGTTCTTCACTGATTTGAAGTTGCGGGACACAAAAATTGTCATAGATGGCTACGCTCTTTTCCACCGACTTTGCTTCAATTCAAACTTGGAGCTCCGTTATGGAGGAGATTATGATTCTTTTGCAGATGTTGTACAAAAATTTTTTGAGTCACTGTTTGCTTGTAATATATGTCCATATGTTGTACTAGATGGAGGATGTGACATTTCTGACAAAAAGCTTACAACTTTAAAGGATCGAGCTAGAGAGAAGATCCAGATGGCCCATTCTCTTTCTGTTGGTGGAGGTGGGTATGTGTGTCCCTTACTCATCCGGGAAGTGTTCATACAGATTTTGATCAAACTGCAGGTATGTTTTGTCCAGTGCTTTTCAGAAGCAGATCAGGACATTATGACACTTGCCAATCACTGGAATTGCCCTGTTTTATCATCAGATAGTGACTTCTGCATTTTTGATTTGAAAACTGGGTTTTGCCCATTGAATAGCTTTCAGTGGAGAAATATGAACGCTATTAAAGGGACAAAAAACTACTATATTCCCGCCAAATGCTTTTCTCTTGATGCCTTCTGCCATCACTTCAGCAATATGAACAAAGCTCTGGTACCTCTCTTTGCAGTGCTATGTGGAAATGATCATATTAATCTGCCTATAGTGGAGACATTCTTAAGTAAAGTATGCCCTCCTCTTAGAGCTACTAGCTCTAAAGGGAGGAGACATCACCGAGTTCTGAGACTTCTGAACTGGTTGTCTCATTTTCCTGACCCTACTGAAGCACTAGATAATATTCTGAAACATCTGCCAAAAAAGGATCGAGAAAATGTTAAGGAACTTCTCTGCTGCTCCATGGCGGAATACCAGCAGTCCCAGGTGAAGCTACAAAACTTCTTCCAGGATGGTACTTTTATCTGTCAAGTTGCCATGAATCTGGGTTTACCAGAATGGGTGTTGGTAGCTTTGGCCAAAGGTCAGCTATCTCCATTCATAAGCGATGCTTTGGTACTAAGACGGACCATTCTTCACACTCAAGTAGAGAACATGCAGCGACCAAATGCCCACAGAGTCGCTCAACCTATCCGGCAGATCATTTATGGGCTTCTTTTGAATGCTTCGTCACATCCAGAAAACATGTCTCCAAATGCATTGCCTTCTCAGCCTCTAGCTTTCTGTGAAGTGGAAAGAATTAATAAAAATATCAAAACATCCATTGTTGATGCAGTAGAACTGCCCAAGGATTATACTGACTTGACCAAACTGACCAAGCTCTCCTTGGTTAGGCGGCAGATGCTTCTGTTAGAAACTCTGAAGGTGAAACAGACTATTCTGGAGCCAATCCCACCTTCTTTGAAGTTGCCCATTGCTGTCAGTTGCTACTGGTTGCAGCACACAGAAACCAAGGCAAAGCTCTATCATCTGCAAGCTCTACTGCTGGGGATGCTGATGGGGCCTTTGCATGCCATGATCAACAGCTCTGATAAGGAAGATCTGCGGGAAGGTGGTGCTAAGATGTTGTATGAAGACTTCCAGAGGGAGAAGGAGCCACCACGCCAGGGCCTGAGTTTGGATTTAGACACGGCTCACATCTTCTGTCAGTGGCAGTGCTGTCTCCAGATGGGGATGTATCTCAATCAGCTGCTGTCCACTCCTCTCCCAGAGCCAGACCTAACTCGACTATATAATGGAAGCCTTGTGCATGGACTATGCCGACAACTGCTAGCATCAACTTCTGTAGAAGGCCTCCTGAACACATGTCCTGAGGCTAAGCAACTTTATGAAAATCTGTTTAATGCCACGAGGTCATATGCTCCAGCTGAATTATTCCTACCAAAGGGTAAATCAAATACAAGGAAAAAAAGACAGAAGAAAAAGGGTACCAGTTGGTCAAATAACTGTGGGGAAATCACCTCAGACACTGGGTGCTGGTATGACGGAAGCAATCGCTTTGGCCTGTTAATGGTGGAAAACTTGGAGGAACACATTGAGGCCTCCAAGCCTGAATAA

XM_004834222.1 Coding sequence

Nek11 NIMA-related kinase 11, transcript variant X1

Length: 1938 bp    Location: 7012705..7343020   Strand: +
>XM_004834222.1
ATGTTGAAATTCCAAGAGGCTGCTAAGTGTGGAAGTGGATCAATAGCCATTTCCACTTCTCCACAGGCCTTGATTGCAAGAAGATATGTGCTTCAGCAGAAACTTGGCAGTGGAAGTTTTGGAACTGTCTATCTGGTTTCAGATAAGAAAGCCAGACAAGGAGAGGACTTAAAGGTACTGAAGGAAATCTCTGTTGGAGGACTAAATCCAAATGAAACTGTACAGGCCAACTTAGAAGCCCAGCTCCTATCCAAGCTGGACCATCCAGCCATTGTCAAGTTCTATGCAAGCTTTGTGGAGCAAGATAATTTCTGCATTATCACAGAGTACTGTGAGGGCCGTGATCTGGACTGTAAGATTCAGCAATATAAAGAAGCTGGGAAAATTTTTACAGAAAATCAAATAATAGAATGGTTTATACAGTTGTTGCTAGGAGTTGACTATATGCATGAAAGGAGGATACTTCATCGAGACTTGAAATCAAAAAATATATTTCTGAAAAATAATCTACTTAAAATTGGGGATTTTGGAGTTTCTCGACTGCTATTGGGATCCTGTGACCTGGCCACAACTTTAACTGGAACTCCCCATTATATGAGTCCTGAGGCTCTTAAACACCAAGGCTACAACACAAAATCAGATATTTGGTCATTGGCATGCATTTTGTATGAGATGTGTTGTATGAATCATGCATTCACTGGCTCCAGTTTCTTGTCCATTGTTTTAAAAATTGTTGAAGGCAATACACCTTCACTCCCTGAGAGATATCCAAGAGAACTAAACACCATCATGGAAAGCATGTTGCACAAGAGTCCTTCGTTGAGACCATCTGCCATAGAAATTTTAAAAATTCCTTACATTGATGAACAACTACAGCACTTGATACATAAATATTCGGAAATGACTATGAAAGACAAGAAGTTGGATTGTCAGAAGGAAGCTGCTTATATAATTAATGCCATGCAGAAAAAGATCCACCTGCAGACTCTGCGGGCACTGTCTGAAGTGCAGAAAATGACGCCGAGAGAAAGGATGCGTCTGAGGAAGCTCCAGGTAGCAGATGAGAAAGCCAGGAAGCTGAAAAAGATTGTGGAAGAAAAGTATGAAGAAAATAATAAGCGGATGCAAGAATTGAGATCACGGAACTTTCAGCAGCTGAGTATTGATGTACTCCATGAAAAAAAATATTTAATGGGAACAGAAGAAAAGACGGAGCGACCTCAGGGAAGACTTTCTTGTTCACACCAGGAGGAGGATGAAGAGAGGCAGCCAGGAGGGGAAGAGGAATTAGATGAACCAGCTTCAGAGAACCTGCCAGAGACTCAGCCTATTCCTTCCCTGGATCTCAATGAACTTGAGTCAAGCATAGAGGACAACATAGTTGACCTTGGATATTATGAGATCCCAGAAGACCCACTTGTGGCTGAAGAGTATTATGCTGATGTGTTTGATTCCTGTTCTGAAGAGAGTGAGGAGCAGGAAGAAGAAACAGTGTCCTTAGGACCAGAGGGAGAGGTCCTGGTTGAGGAATCTGAGCCTACTTATAGAACAAATCAACAGGACAGTGATATTGAAGCACTGGCCAGGTGTTTGGAGAGTGTCCTGGGTTGCACCTCTCTCGACACAAGGACTATGAGCAGTGTGGCTGCAGACATGTCCCCAGGACCAACCATTTTCAACAGTGTGATGGCCAGAACCAAGATGAAGCACATGAGAGAATCAGCCATGCAGAAGCTGGGAGAAAAAGTATTTGAAGAAGTCTATGATTACCTCAAGAGAGCAAGGCATCAAAATGCCAGTGAAACAGAGATCCGGGAGTGCCTTGAAAAAGTGGTCCCTCGAGCCAGTGACTGCTATGAAGTTGACCAGCTCCTCTATTTTGAGGAGCAGTTACTGATTGCAGTAGGAAAGGAGCCCCCTCTCCAGAACCCTCATTAA

XM_004834224.1 Coding sequence

Nek11 NIMA-related kinase 11, transcript variant X3

Length: 1800 bp    Location: 7012705..7343020   Strand: +
>XM_004834224.1
ATGTTGAAATTCCAAGAGGCTGCTAAGTGTGGAAGTGGATCAATAGCCATTTCCACTTCTCCACAGGCCTTGATTGCAAGAAGATATGTGCTTCAGCAGAAACTTGGCAGTGGAAGTTTTGGAACTGTCTATCTGGTTTCAGATAAGAAAGCCAGACAAGGAGAGGACTTAAAGGTACTGAAGGAAATCTCTGTTGGAGGACTAAATCCAAATGAAACTGTACAGGCCAACTTAGAAGCCCAGCTCCTATCCAAGCTGGACCATCCAGCCATTGTCAAGTTCTATGCAAGCTTTGTGGAGCAAGATAATTTCTGCATTATCACAGAGTACTGTGAGGGCCGTGATCTGGACTGTAAGATTCAGCAATATAAAGAAGCTGGGAAAATTTTTACAGAAAATCAAATAATAGAATGGTTTATACAGTTGTTGCTAGGAGTTGACTATATGCATGAAAGGAGGATACTTCATCGAGACTTGAAATCAAAAAATATATTTCTGAAAAATAATCTACTTAAAATTGGGGATTTTGGAGTTTCTCGACTGCTATTGGGATCCTGTGACCTGGCCACAACTTTAACTGGAACTCCCCATTATATGAGTCCTGAGGCTCTTAAACACCAAGGCTACAACACAAAATCAGATATTTGGTCATTGGCATGCATTTTGTATGAGATGTGTTGTATGAATCATGCATTCACTGGCTCCAGTTTCTTGTCCATTGTTTTAAAAATTGTTGAAGGCAATACACCTTCACTCCCTGAGAGATATCCAAGAGAACTAAACACCATCATGGAAAGCATGTTGCACAAGAGTCCTTCGTTGAGACCATCTGCCATAGAAATTTTAAAAATTCCTTACATTGATGAACAACTACAGCACTTGATACATAAATATTCGGAAATGACTATGAAAGACAAGAAGTTGGATTGTCAGAAGGAAGCTGCTTATATAATTAATGCCATGCAGAAAAAGATCCACCTGCAGACTCTGCGGGCACTGTCTGAAGTGCAGAAAATGACGCCGAGAGAAAGGATGCGTCTGAGGAAGCTCCAGGTAGCAGATGAGAAAGCCAGGAAGCTGAAAAAGATTGTGGAAGAAAAGTATGAAGAAAATAATAAGCGGATGCAAGAATTGAGATCACGGAACTTTCAGCAGCTGAGTATTGATGTACTCCATGAAAAAAAATATTTAATGGGAACAGAAGAAAAGACGGAGCGACCTCAGGGAAGACTTTCTTGTTCACACCAGGAGGAGGATGAAGAGAGGCAGCCAGGAGGGGAAGAGGAATTAGATGAACCAGCTTCAGAGAACCTGCCAGAGACTCAGCCTATTCCTTCCCTGGATCTCAATGAACTTGAGTCAAGCATAGAGGACAACATAGTTGACCTTGGATATTATGAGATCCCAGAAGACCCACTTGTGGCTGAAGAGTATTATGCTGATGTGTTTGATTCCTGTTCTGAAGAGAGTGAGGAGCAGGAAGAAGAAACAGTGTCCTTAGGACCAGAGGGAGAGGTCCTGGTTGAGGAATCTGAGCCTACTTATAGAACAAATCAACAGGACAGTGATATTGAAGCACTGGCCAGGTGTTTGGAGAGTGTCCTGGGTTGCACCTCTCTCGATCAGCCATGCAGAAGCTGGGAGAAAAAGTATTTGAAGAAGTCTATGATTACCTCAAGAGAGCAAGGCATCAAAATGCCAGTGAAACAGAGATCCGGGAGTGCCTTGAAAAAGTGGTCCCTCGAGCCAGTGACTGCTATGAAGTTGACCAGCTCCTCTATTTTGAGGAGCAGTTACTGA

XM_004834223.1 Coding sequence

Nek11 NIMA-related kinase 11, transcript variant X2

Length: 1830 bp    Location: 7012705..7343020   Strand: +
>XM_004834223.1
ATGTTGAAATTCCAAGAGGCTGCTAAGTGTGGAAGTGGATCAATAGCCATTTCCACTTCTCCACAGGCCTTGATTGCAAGAAGATATGTGCTTCAGCAGAAACTTGGCAGTGGAAGTTTTGGAACTGTCTATCTGGTTTCAGATAAGAAAGCCAGACAAGGAGAGGACTTAAAGGTACTGAAGGAAATCTCTGTTGGAGGACTAAATCCAAATGAAACTGTACAGGCCAACTTAGAAGCCCAGCTCCTATCCAAGCTGGACCATCCAGCCATTGTCAAGTTCTATGCAAGCTTTGTGGAGCAAGATAATTTCTGCATTATCACAGAGTACTGTGAGGGCCGTGATCTGGACTGTAAGATTCAGCAATATAAAGAAGCTGGGAAAATTTTTACAGAAAATCAAATAATAGAATGGTTTATACAGTTGTTGCTAGGAGTTGACTATATGCATGAAAGGAGGATACTTCATCGAGACTTGAAATCAAAAAATATATTTCTGAAAAATAATCTACTTAAAATTGGGGATTTTGGAGTTTCTCGACTGCTATTGGGATCCTGTGACCTGGCCACAACTTTAACTGGAACTCCCCATTATATGAGTCCTGAGGCTCTTAAACACCAAGGCTACAACACAAAATCAGATATTTGGTCATTGGCATGCATTTTGTATGAGATGTGTTGTATGAATCATGCATTCACTGGCTCCAGTTTCTTGTCCATTGTTTTAAAAATTGTTGAAGGCAATACACCTTCACTCCCTGAGAGATATCCAAGAGAACTAAACACCATCATGGAAAGCATGTTGCACAAGAGTCCTTCGTTGAGACCATCTGCCATAGAAATTTTAAAAATTCCTTACATTGATGAACAACTACAGCACTTGATACATAAATATTCGGAAATGACTATGAAAGACAAGAAGTTGGATTGTCAGAAGGAAGCTGCTTATATAATTAATGCCATGCAGAAAAAGATCCACCTGCAGACTCTGCGGGCACTGTCTGAAGTGCAGAAAATGACGCCGAGAGAAAGGATGCGTCTGAGGAAGCTCCAGGTAGCAGATGAGAAAGCCAGGAAGCTGAAAAAGATTGTGGAAGAAAAGTATGAAGAAAATAATAAGCGGATGCAAGAATTGAGATCACGGAACTTTCAGCAGCTGAGTATTGATGTACTCCATGAATTAGATGAACCAGCTTCAGAGAACCTGCCAGAGACTCAGCCTATTCCTTCCCTGGATCTCAATGAACTTGAGTCAAGCATAGAGGACAACATAGTTGACCTTGGATATTATGAGATCCCAGAAGACCCACTTGTGGCTGAAGAGTATTATGCTGATGTGTTTGATTCCTGTTCTGAAGAGAGTGAGGAGCAGGAAGAAGAAACAGTGTCCTTAGGACCAGAGGGAGAGGTCCTGGTTGAGGAATCTGAGCCTACTTATAGAACAAATCAACAGGACAGTGATATTGAAGCACTGGCCAGGTGTTTGGAGAGTGTCCTGGGTTGCACCTCTCTCGACACAAGGACTATGAGCAGTGTGGCTGCAGACATGTCCCCAGGACCAACCATTTTCAACAGTGTGATGGCCAGAACCAAGATGAAGCACATGAGAGAATCAGCCATGCAGAAGCTGGGAGAAAAAGTATTTGAAGAAGTCTATGATTACCTCAAGAGAGCAAGGCATCAAAATGCCAGTGAAACAGAGATCCGGGAGTGCCTTGAAAAAGTGGTCCCTCGAGCCAGTGACTGCTATGAAGTTGACCAGCTCCTCTATTTTGAGGAGCAGTTACTGATTGCAGTAGGAAAGGAGCCCCCTCTCCAGAACCCTCATTAA

XM_004834225.1 Coding sequence

Nek11 NIMA-related kinase 11, transcript variant X4

Length: 1440 bp    Location: 7012705..7189526   Strand: +
>XM_004834225.1
ATGTTGAAATTCCAAGAGGCTGCTAAGTGTGGAAGTGGATCAATAGCCATTTCCACTTCTCCACAGGCCTTGATTGCAAGAAGATATGTGCTTCAGCAGAAACTTGGCAGTGGAAGTTTTGGAACTGTCTATCTGGTTTCAGATAAGAAAGCCAGACAAGGAGAGGACTTAAAGGTACTGAAGGAAATCTCTGTTGGAGGACTAAATCCAAATGAAACTGTACAGGCCAACTTAGAAGCCCAGCTCCTATCCAAGCTGGACCATCCAGCCATTGTCAAGTTCTATGCAAGCTTTGTGGAGCAAGATAATTTCTGCATTATCACAGAGTACTGTGAGGGCCGTGATCTGGACTGTAAGATTCAGCAATATAAAGAAGCTGGGAAAATTTTTACAGAAAATCAAATAATAGAATGGTTTATACAGTTGTTGCTAGGAGTTGACTATATGCATGAAAGGAGGATACTTCATCGAGACTTGAAATCAAAAAATATATTTCTGAAAAATAATCTACTTAAAATTGGGGATTTTGGAGTTTCTCGACTGCTATTGGGATCCTGTGACCTGGCCACAACTTTAACTGGAACTCCCCATTATATGAGTCCTGAGGCTCTTAAACACCAAGGCTACAACACAAAATCAGATATTTGGTCATTGGCATGCATTTTGTATGAGATGTGTTGTATGAATCATGCATTCACTGGCTCCAGTTTCTTGTCCATTGTTTTAAAAATTGTTGAAGGCAATACACCTTCACTCCCTGAGAGATATCCAAGAGAACTAAACACCATCATGGAAAGCATGTTGCACAAGAGTCCTTCGTTGAGACCATCTGCCATAGAAATTTTAAAAATTCCTTACATTGATGAACAACTACAGCACTTGATACATAAATATTCGGAAATGACTATGAAAGACAAGAAGTTGGATTGTCAGAAGGAAGCTGCTTATATAATTAATGCCATGCAGAAAAAGATCCACCTGCAGACTCTGCGGGCACTGTCTGAAGTGCAGAAAATGACGCCGAGAGAAAGGATGCGTCTGAGGAAGCTCCAGGTAGCAGATGAGAAAGCCAGGAAGCTGAAAAAGATTGTGGAAGAAAAGTATGAAGAAAATAATAAGCGGATGCAAGAATTGAGATCACGGAACTTTCAGCAGCTGAGTATTGATGTACTCCATGAAAAAAAATATTTAATGGGAACAGAAGAAAAGACGGAGCGACCTCAGGGAAGACTTTCTTGTTCACACCAGGAGGAGGATGAAGAGAGGCAGCCAGGAGGGGAAGAGGAATTAGATGAACCAGCTTCAGAGAACCTGCCAGAGACTCAGCCTATTCCTTCCCTGGATCTCAATGAACTTGAGTCAAGCATAGAGGACAACATAGTTGACCTTGGATATTATGATGAGATTCCAAAGCTCAAGAAACTTAAAGCAGTTGCCTAA

XM_004834226.1 Coding sequence

Nek11 NIMA-related kinase 11, transcript variant X5

High confidence: 4 potential gene matches
Length: 1437 bp    Location: 7012705..7181515   Strand: +
>XM_004834226.1
ATGTTGAAATTCCAAGAGGCTGCTAAGTGTGGAAGTGGATCAATAGCCATTTCCACTTCTCCACAGGCCTTGATTGCAAGAAGATATGTGCTTCAGCAGAAACTTGGCAGTGGAAGTTTTGGAACTGTCTATCTGGTTTCAGATAAGAAAGCCAGACAAGGAGAGGACTTAAAGGTACTGAAGGAAATCTCTGTTGGAGGACTAAATCCAAATGAAACTGTACAGGCCAACTTAGAAGCCCAGCTCCTATCCAAGCTGGACCATCCAGCCATTGTCAAGTTCTATGCAAGCTTTGTGGAGCAAGATAATTTCTGCATTATCACAGAGTACTGTGAGGGCCGTGATCTGGACTGTAAGATTCAGCAATATAAAGAAGCTGGGAAAATTTTTACAGAAAATCAAATAATAGAATGGTTTATACAGTTGTTGCTAGGAGTTGACTATATGCATGAAAGGAGGATACTTCATCGAGACTTGAAATCAAAAAATATATTTCTGAAAAATAATCTACTTAAAATTGGGGATTTTGGAGTTTCTCGACTGCTATTGGGATCCTGTGACCTGGCCACAACTTTAACTGGAACTCCCCATTATATGAGTCCTGAGGCTCTTAAACACCAAGGCTACAACACAAAATCAGATATTTGGTCATTGGCATGCATTTTGTATGAGATGTGTTGTATGAATCATGCATTCACTGGCTCCAGTTTCTTGTCCATTGTTTTAAAAATTGTTGAAGGCAATACACCTTCACTCCCTGAGAGATATCCAAGAGAACTAAACACCATCATGGAAAGCATGTTGCACAAGAGTCCTTCGTTGAGACCATCTGCCATAGAAATTTTAAAAATTCCTTACATTGATGAACAACTACAGCACTTGATACATAAATATTCGGAAATGACTATGAAAGACAAGAAGTTGGATTGTCAGAAGGAAGCTGCTTATATAATTAATGCCATGCAGAAAAAGATCCACCTGCAGACTCTGCGGGCACTGTCTGAAGTGCAGAAAATGACGCCGAGAGAAAGGATGCGTCTGAGGAAGCTCCAGGTAGCAGATGAGAAAGCCAGGAAGCTGAAAAAGATTGTGGAAGAAAAGTATGAAGAAAATAATAAGCGGATGCAAGAATTGAGATCACGGAACTTTCAGCAGCTGAGTATTGATGTACTCCATGAAAAAAAATATTTAATGGGAACAGAAGAAAAGACGGAGCGACCTCAGGGAAGACTTTCTTGTTCACACCAGGAGGAGGATGAAGAGAGGCAGCCAGGAGGGGAAGAGGAATTAGATGAACCAGCTTCAGAGAACCTGCCAGAGACTCAGCCTATTCCTTCCCTGGATCTCAATGAACTTGAGTCAAGCATAGAGGACAACATAGTTGACCTTGGATATTATGTCTCTTGTACAGGCCACGTTGGATGCCAGAGGATTTGA

XM_004835149.1 Coding sequence

LOC101717221 U8 snoRNA-decapping enzyme-like

Length: 618 bp    Location: 7354008..7355610   Strand: +
>XM_004835149.1
ATGGCAGGGTCCCGCAAGATAGATCTAGCAGAGGCCATGGCCTTAGGCCCTGGCTGGAGGCACTTGTGTTTTGTGATGCTCTATGCACCTGACCCCAGGATGTTCTTCGGCTGCATCCTGCTGCGGTTTGCTGTGCTGATGCAGATGCAGTTCGATGGGTGCCTGGGCTTCCCAGGTAGCTTCGTGGACTCCCAAAACAGCACCCTGGAGAATGGACTGAACAGAGAGCTGCTGGCAAAGCTGGGCGAGGGGGTCTCCGCCTTCAGCGTGGAGTGCACAGACTACCGCAGCTCACATGCAGGGGACAACCCACACATTGTGGCTCACTTCTATGCCAAACGACTGATGCTAGAGCAGCTGGAAGGTGTGAAAGCTGGAGCACCAAGAGCCCAGGATCACGGGCTGGAAGTGCTGGGCCTGATTCGGGTGCCCCTGTACACCCTGCGGGATGGTGTGGGAGGCCTCCCTGCCTTTCTGGAAAATTCCTTCATTGGTGCTGCCTGGGAACAACTACTGAAAGCCCTCCAGGACTTGGAACTCTTCGAACTTGGCTCTGTCTTGAGTTTTGAAACTCATAGCTATAGGCAACATTCTGCAAACTCATGGAACCTGAAATGA

XM_004834228.1 Coding sequence

Mrpl3 mitochondrial ribosomal protein L3, transcript variant X1

High confidence: 4 potential gene matches
Length: 1044 bp    Location: 7509909..7470658   Strand: -
>XM_004834228.1
ATGCCGGGTTGGAGGCTGCTGACGCAGGCGGGCGCCCAGTTACTGGGCTGCGGCGCCGGCTGCGGTGCTGCCCCGGGCTCGAGGTGTAGTACAAACATCTGGCTTTTTGTTAGAAGTCTCCATGGTAAGAGTCCAACTTGGTGGGATGAGCATCTTTCTGAAGAAAATGTCTCATTTGTTAAGCAGTTGGTCTCTGATGAAGATAAAGCCCAGTTAGCAAGTAAACTGTGTCCTCTGAAAGATGAACCATGGCCTATACATCCTTGGGAACCAGGTTCATCCCGAGTTGGCCTTATTGCTCTGAAGCTGGGCATGATGCCTTTATGGACCAAGGATGGTGAAAAGCATGCAGTCACATTACTTCAGGTACAAGATTGTCATGTCTTAAAATATACCTCAAAGGAAAACCATAATGGAAAAATGGCAGCCCTAACTGTAGGAGGGAAAACTGTATCACGTTTCCGTAAATCTGAATCTACATTGGAATTTTACCGAGAACTTGGATTGCCACCAAAAGAGAAAGTTAAAACCTTTCACGTAACAGATAATGCTGTAATTAAGCCAGGTACTCCTCTATATGCTGCTCACTTTCGTCCGGGACAATATGTGGATGTCACCGCCAAAACTATTGGTAAAGGTTTTCAGGGCGTCATGAAAAGATGGGGATTTAAAGGCCAACCTGCTTCCCATGGTCAGACGAAAACCCATAGGAGACCTGGAGCCATTGCAACTGGTGACATTGCCAGAGTCTGGCCAGGAACTAAAATGCCTGGAAAAATGGGCAACAGATATAGGACATCATTTGGACTGAAAGTCTGGAGAATAAACACAAAACACAATATAATCTATGTAAATGGCTCAGTGCCTGGACATAAGAATTGCTTAGTAAAGATCAAAGATTCTAAGCTGCCTCCATACAGGGATTTCAGTAAAAATCTACCATTCCCTACGTATTTTCCTGATGGAGGTGAAGAGGAACTACCTGAAGATTTGTATGATGAAAATGTGTGTCAGCCCTGTGCACCTTCTATTACATTTACCTAA

XM_004834232.1 Coding sequence

Acpp acid phosphatase, prostate, transcript variant X2

Length: 1155 bp    Location: 8375493..8429677   Strand: +
>XM_004834232.1
ATGCAAGCTTTCCCACTCGGCGCCACCTGGGCGAGCCTCAGCCTTGGCCTCCTGCTGCTGCTTGGCCTCTGGCTGGACGGAGGTGTGCGAGCCAAGGAGTTGAAGTTTGTGACAGTGGTGTTTCGTCACGGAGACAGAAGTCCCATTGAAACATTTCCTAATGATCCCATTGGGGAATCCTCATGGCCAGATGGGTTTGGCCAACTCACTCAGCTGGGAATGAAACAGCATTATGAACTTGGAGAATACTTAAGGAAAAGATATGGAAAATTCTTGAATGAGTCCTATAAACGTGAACAGGTTTATATTCAAAGCACAGATGTTGACCGGACTTTGATGAGTGCTCTGGCAAACCTAGCAGCCCTGTTTCCCCCAGTGGGCACCAGCATCTGGAACCCCAGCCTGCTCTGGCAGCCCATTCCAGTGCACACAGTTGCTGTCTCTGAAGACCGGGATTTTATAAAAACTTTGCCAACACTTTCAGGATTTCAAGGCCGGGACCTTTTTGAAATTTGGAGTAAAGTCTACGATCCTTTATATTGTGAGGGTATTCACAATTTCACTTTACCCTCCTGGGCCACAAAGGACACAATGACTAAGTTGAGAGAATTATCAGAATTATCCCTCTTGTCCCTCTATGGAATACATAAGCAGAAAGAGAAATCTAGACTCCAAGGGGGTGTCATGATTAATGAAATCCTGAATCACATGAAGAGTGCAACTCAGCCACAAAAGTACAAAAAATTTGTCATGTACTCTGCGCATGACACTACTGTGAGTGGCCTACAAATGGCGCTGGATGTTTACAATGGAATCCTACCTCCTTATGCTTCCTGTCACTTGATAGAATTGTATCTTGAGAAGGGTGAGTACTTTGTGGAGATGTACTATCGGAATGAGACCCAGCACGAGCCACACCCCCTCACACTGCCGGGCTGCACCCACAGCTGTCCTCTGGAGAAGTTTGATGAGCTGGTTACCCCTGTGATACCCCAAGACTGGTCCACGGAGTGCATGATCACAAGCAACCATCAAGTTCTAAGGGTCATCCTCGCCATTGCCTTTTGTTTGGTGTCTGGAGTCCTAATGGTGCTGCTGTTTGTCCTCGTCCGCCATGGGCCCTGCTGGCAGAGAGAGTCCTACAGGAACATCTGA

XM_004834234.1 Coding sequence

Uba5 ubiquitin-like modifier activating enzyme 5, transcript variant X2

High confidence: 4 potential gene matches
Length: 1188 bp    Location: 8791727..8819961   Strand: +
>XM_004834234.1
ATGCAGGGGACAGGCAACAGAAGCTCTCCTGCAAGGTGCCTCACTGCAGGAAACATACTGGGTCTGGGGAAAATTGGAACCCACCCAGGGCGAAAAGAAGGAAAGCCCAAAGCACGGATTTGTTTCTGCTGGAGCCGCCTGATGGCATTGAAACGAATGGGAATTGTAAGCGACTATGAGAAAATCCGTACCTTTGCTGTAGCAGTAGTAGGTGTTGGTGGAGTTGGTAGTGTGACTGCTGAAATGCTGACAAGATGTGGCATTGGTAAGTTGCTGCTCTTTGACTATGACAAGGTGGAACTGGCCAATATGAATAGACTTTTCTTCCAACCTCATCAAGCAGGATTGAGTAAAGTGCAAGCAGCAGAACATACTCTGAGGAACATTAATCCTGATGTTCTTTTTGAAGTACACAACTATAATATAACCACAGTAGAAAACTTTCAACATTTTATGGATAGAATAAGTAATGGTGGGCTAGAAGAAGGAAAGCCCATCGATCTAGTTCTTAGCTGTGTGGACAATTTTGAAGCTCGAATGGCAATAAATACAGCTTGTAATGAACTTGGGCAAACATGGATGGAATCTGGGGTCAGTGAAAATGCGGTTTCAGGGCATATCCAGCTCATTATTCCTGGAGAATCTGCTTGTTTTGCGTGTGCGCCACCACTTGTGGTTGCTGCAAATATTGATGAAAAGACTCTGAAACGAGAAGGTGTTTGTGCAGCCAGTCTTCCAACCACTATGGGAGTTGTTGCAGGAATCTTGGTACAAAATGTGTTAAAGTTCCTGTTAAATTTTGGGACTGTTAGTTTTTACCTTGGGTACAATGCAATGCAGGATTTTTTTCCTACTATGTCCATGAAGCCAAATCCCCAGTGTGATGACAGAAACTGCAGGAAACAGCAAGAAGAATATAAGAAAAAGGTGGTGGCACTGCCTAAACAGGAGGCTGTTCAAGAGGAGGACAAGATAATACATGAGGATAATGAGTGGGGTATTGAGCTGGTATCTGAGGTTTCAGAAGAAGAGCTGAAAAATTCTTCAGGTCCAGTTCCTGAGTTACCTGAAGGAATTACAGTGGCATATACAATTCCAAAAAAGCAAGAAGACTCTGTACCTCAAGTTACAGTGGAAGATTCTGGTGAAAGCTTGGAAGACCTCATGGCCAAGATGAAGAATATGTAG

XM_004834233.1 Coding sequence

Uba5 ubiquitin-like modifier activating enzyme 5, transcript variant X1

Length: 1215 bp    Location: 8792854..8819961   Strand: +
>XM_004834233.1
ATGGCTGAGTCTGTGGGGCGGCTGCAGCAGCGGGTGCAGGAGCTGGAGAGGGAACTCGCCCAGGAGAGGAGTCGGCGGGTCCCGGGAGACGGCGACGTAGGGGGTGGCCGGGTCCGCATCGAGAAGATGAGCGCCGAGGTGGTGGATTCCAATCCCTACAGCCGCCTGATGGCATTGAAACGAATGGGAATTGTAAGCGACTATGAGAAAATCCGTACCTTTGCTGTAGCAGTAGTAGGTGTTGGTGGAGTTGGTAGTGTGACTGCTGAAATGCTGACAAGATGTGGCATTGGTAAGTTGCTGCTCTTTGACTATGACAAGGTGGAACTGGCCAATATGAATAGACTTTTCTTCCAACCTCATCAAGCAGGATTGAGTAAAGTGCAAGCAGCAGAACATACTCTGAGGAACATTAATCCTGATGTTCTTTTTGAAGTACACAACTATAATATAACCACAGTAGAAAACTTTCAACATTTTATGGATAGAATAAGTAATGGTGGGCTAGAAGAAGGAAAGCCCATCGATCTAGTTCTTAGCTGTGTGGACAATTTTGAAGCTCGAATGGCAATAAATACAGCTTGTAATGAACTTGGGCAAACATGGATGGAATCTGGGGTCAGTGAAAATGCGGTTTCAGGGCATATCCAGCTCATTATTCCTGGAGAATCTGCTTGTTTTGCGTGTGCGCCACCACTTGTGGTTGCTGCAAATATTGATGAAAAGACTCTGAAACGAGAAGGTGTTTGTGCAGCCAGTCTTCCAACCACTATGGGAGTTGTTGCAGGAATCTTGGTACAAAATGTGTTAAAGTTCCTGTTAAATTTTGGGACTGTTAGTTTTTACCTTGGGTACAATGCAATGCAGGATTTTTTTCCTACTATGTCCATGAAGCCAAATCCCCAGTGTGATGACAGAAACTGCAGGAAACAGCAAGAAGAATATAAGAAAAAGGTGGTGGCACTGCCTAAACAGGAGGCTGTTCAAGAGGAGGACAAGATAATACATGAGGATAATGAGTGGGGTATTGAGCTGGTATCTGAGGTTTCAGAAGAAGAGCTGAAAAATTCTTCAGGTCCAGTTCCTGAGTTACCTGAAGGAATTACAGTGGCATATACAATTCCAAAAAAGCAAGAAGACTCTGTACCTCAAGTTACAGTGGAAGATTCTGGTGAAAGCTTGGAAGACCTCATGGCCAAGATGAAGAATATGTAG

XM_004834238.1 Coding sequence

Nphp3 nephronophthisis 3 (adolescent), transcript variant X2

Length: 3837 bp    Location: 8874587..8824861   Strand: -
>XM_004834238.1
ATGGGCACAGCTTCCTCGCTCGTGAGCCCTGCGGGCGGGGAGGTGATTGAGGACACGTATGGGGCGGGCGGCGGCGAGGCCTGCGAGATCCCGGTGGAGGTGAAGCCCAAAGCCCGCCTGCTGCGCAGCTCGTTCCGCCGGGGCGCTGGGGTTGCGGGTGCCGGGCCCGGGTCTCTGCCCCGAGCGGCGGGCGGGGGCGGCTTGCTGGGCGCCAGCTTCAAGTCCACGGGCTCCTCGGTGCCCGAGCTGGAGTACGCGGCGGCCGAGTACGAGCGACTCAAAAAGGAGTATGAGATCTTCCGGGTCAGCAAGAACCAGGAGTTGTTGTCCATGGGCCGCCGTGAGGCCAAGCTGGACACCGAGAACAAGCGGCTGCGGGCCGAGCTGCAGGCGCTTCAGAAAACTTACCAGAAGATTCTTCGGGAAAAAGAAAGTGCTTTAGAAGCAAAATATCAAGCAATGGAGAGAGCAGCTACGTTTGAACATGACAGAGATAAAGTTAAAAGGCAATTCAAGATTTTTAGGGAGACCAAAGAAAATGAAATTCAGGACTTACTGAGGGCCAAGCGAGAGCTGGAGAGCAAGCTTCAGAGGTTGCAGGCTCAGGGGATCCAAGTATTTGATCCTGGAGAGTCGGATTCAGATGACAACTGTACGGATATTACTGATGACTGGGATATTGCTGTAGCTAGTTTGTTGCAGGTTACTCCCTTGTTTTCACATTCTCTGTGGAGTAACACTGTCAGATGTTACCTCATTTACACAGATGAAACCCAGTCTGAAGTGGATCTTTTCCTAAAGGACTATTCACCGAAACTTAAAAGAATGTGTGAGACAATGGGATATTTTTTCCATGCTGTTTATTTTCCAATAGATGTTAGAAATCAGTATCTCACTGTAAGAAAATGGGAAATTGAGAAGAGCTCTTTAGTTATTTTATTCATTCACTCATCTTTACCAAGCCTTTTGTTGGAAGACTGTGAAGAAGCTTTTCTGAAAAACCCTGAAGGAAAACCACGATTAATTTATCATCGTTTGGAGGATGGGAAAGTCAGTTCCGACTCTGTGCAGCAATTGATTGGTCAAGTGTGTAACCTCAACAAGGCCAACAAAGCCAAGATCATTGATCATTCAGGAGATCATGCAGAAGGAGTATATAAAACTTACATTTGTGTGGAAAAGATTATTAAACAGGACATTCTGGGCTTTGAGAACACAGACCTGGATACTAAGGATTTGGGCACTGAAGAGTCCATTCCAGAAGAGGATGATTTGGGGGATGTTCTGTGGGACATACATGATGAGCAAGAACAAATGGAAGCTTTTCAGCAGGCCTCTAATTCAGCCCATGAGTTGGGATTTGAGAAATATTATCAACGCCTTAATGATCTAGTGGCAGCACCAGCCCCGATTCCACCCCTTCTGGTGTCTGGAGGACCAGGTTCTGGAAAGTCCCTTCTTTTATCCAAGTGGATTCAGTTGCAGCAGAAGAGTTCCCCTAACATGCTGATTCTTTCTCATTTTGTGGGGAGGCCCATGTCAACCAGCTCAGAATCCTCCTTGATTATTAAACGGCTGACTCTAAAGTTGATGCAGCACTCCTGGTCAGTGTCTGCTCTGACGCTTGATCCTGCTAAGCTGCTGGAAGAATTTCCACATTGGCTGGAAAAACTCTCTGCTCGCCATCAAGGCAGCATCATCATCATCATTGATTCTATAGATCAAGTTCAGCAAGTTGAAAAACACATGAAATGGCTCATAGATCCACTGCCCGTGAATGTCAGAGTGATTGTCTCTGTGAATGTGGAAACTTGCCCTGCTGCCTGGAGGTTGTGGCCTACACTTCATCTCGATCCCTTAAATCCGAAAGATGCAAAATCTATTATAATTGCAGAATGCCATTCAGTAGACATTAAATTGAGTAAAGAGCAGGAGAAGAAGCTAGAACGACACTGTCGTTGTGCTGCCACCTGCAATGCCCTCTATGTCACCCTTTTCGGCAAAATGATGGCACGTGCTGGGAAAAGAGGCAATTTAGACAAAACCCTTCATCAGTGCCTGCAGTGTCAAGATACTGTTTCATTATATAGACTTGTTCTACACTCCATCCAGGAGTCCATGGCAAGTGATGTGGAGAAAGAGCTAATGAGACAGGTTCTCTGCCTTGTCAATGTTAGTCACAATGGTGTGAGCGAATCAGAACTGATGGAACTCTATCCTGAAACACCCTGGGCCATCTTGACCTCCCTTATTCACAGTTTACACAAAATGTGTTTGTTGACCTATGGTTGTGGCTTGCTCAGGTTTCAGCATCTGCAGGCCTGGGAAACAGTGAGACTTGAGTACATGGATGATCGCACTATTATTTCTTCATATAGGCAAAAGCTAATCAGCTATTTCAACTTGCAGCTGAGTCAGGACAGAGTGACCTGGAGAAGTGCGGATGAGCTACCCTGGCTTTTCCAGCAGCAGGGAGCTAAGCAGAAGCTGCACAATTGCCTTCTCAATCTCTTCGTGTCTCAAAACCTTTACAAAAGAGGACACTTTGCTGAGTTGCTGAGTTATTGGCAGTTTGTTGGCAAAGACAAAAGTGCGATGGCAGCAGAATACTTTGATTCATTGAAGCAGTATGAGAAAAACTGTGAAGGCGAGGAGAACATGATTTGCTTAGCTGATCTATATGAAACGCTGGGGCGATTTCTCAAGGACCTAGGCCTTCTCAGTCAGGCTGTGGTGCCTTTGCAGAGGTCTCTAGAAATTCGAGAAACAGCTTTAGATCCAGATCACCCAAGAGTAGCCCAGTCCCTTCACCAACTGGCAAGTGTGTATGTGCAATGGAAGAAGTTTGGCAATGCAGAACAACTATATAAACAGGCCTTGGAAATCTCAGAAAATGCTTATGGTGCAGACCATCTGCATACTGCTCGTGAACTTGAGGCACTTGCAACTTTGTACCAGAAACAAAATAAATATGAACAAGCTGAACATTTTAGGAAAAAATCCTTTAAAATTCGTCAGAAAGCTACAAGGAAAAAGGGCAATTTGCATGGATTTGCCCTTTTACGCAGACGGGCCCTGCAGTTAGAAGAGCTTACGTTGGGTAAGGACACACCTGATAATGCCCGGACCCTCAATGAACTCGGTGTTCTCTACTATCTTCAGAATAACCTAGAAACAGCTGACCAGTTTTTAAAGCGTTCCCTAGAGATGAGGGAACGAGTTCTAGGACCTGATCATCCTGACTGTGCCCAGTCTCTGAATAATCTGGCAGCTCTATACCATGAAAAGAAGCAGTATGACAAAGCGGAGGAACTCTATGAGAGAGCTTTGGACATTCGGAGACGAGCCTTAGCTCCGGATCACCCTTCTTTAGCATATACAGTGAAGCATCTTGCAATCTTGTATAAGAAAATGGGGAAACTTGACAAAGCTGTACCTTTGTATGAATTGGCTGTTGAAATTCGGCAGAAATCCTTTGGCCCAAAGCACCCTAGTGTAGCTACTGCCTTGGTGAACTTAGCAGTTCTTTATAGCCAAATGAAAAAGCACATTGAAGCCTTGCCATTGTATGAAAGAGCATTAAAGATTTATGAAGATAGCCTGGGTCCGATGCATCCTCGAGTTGGAGAAACATTAAAAAATTTAGCTGTGCTTAGCTATGAAGAAGGGGATTTTGAAAAAGCTGCTGAACTGTACAAAAGGGCAATGGAAATAAAAGAAGCAGAAACGTCACTCTTGGGTGGGAAAGCTCCTTCGAGACATTCATCAAGTGGAGACACATTTAGCCTAAAAACAACTCATTCTCCTAATATTTTCCTTCCTCAAGGACAAAGGTAA

XM_004834237.1 Coding sequence

Nphp3 nephronophthisis 3 (adolescent), transcript variant X1

High confidence: 4 potential gene matches
Length: 3990 bp    Location: 8874587..8824861   Strand: -
>XM_004834237.1
ATGGGCACAGCTTCCTCGCTCGTGAGCCCTGCGGGCGGGGAGGTGATTGAGGACACGTATGGGGCGGGCGGCGGCGAGGCCTGCGAGATCCCGGTGGAGGTGAAGCCCAAAGCCCGCCTGCTGCGCAGCTCGTTCCGCCGGGGCGCTGGGGTTGCGGGTGCCGGGCCCGGGTCTCTGCCCCGAGCGGCGGGCGGGGGCGGCTTGCTGGGCGCCAGCTTCAAGTCCACGGGCTCCTCGGTGCCCGAGCTGGAGTACGCGGCGGCCGAGTACGAGCGACTCAAAAAGGAGTATGAGATCTTCCGGGTCAGCAAGAACCAGGAGTTGTTGTCCATGGGCCGCCGTGAGGCCAAGCTGGACACCGAGAACAAGCGGCTGCGGGCCGAGCTGCAGGCGCTTCAGAAAACTTACCAGAAGATTCTTCGGGAAAAAGAAAGTGCTTTAGAAGCAAAATATCAAGCAATGGAGAGAGCAGCTACGTTTGAACATGACAGAGATAAAGTTAAAAGGCAATTCAAGATTTTTAGGGAGACCAAAGAAAATGAAATTCAGGACTTACTGAGGGCCAAGCGAGAGCTGGAGAGCAAGCTTCAGAGGTTGCAGGCTCAGGGGATCCAAGTATTTGATCCTGGAGAGTCGGATTCAGATGACAACTGTACGGATATTACTGCATCTGGAACCCAGTGTGAGTACTGGGCTGGTGGAGCCCTGGGCAGCGAACCCTCCCTGGGGAGCATGATCCAGCTTCAGCAGTCCTTCCGAGGCCCAGAGTTTGCGCACAGTTCTGTAGATGTGGAAGGCCCCTTTGCAAATGTCAACAGAGATGACTGGGATATTGCTGTAGCTAGTTTGTTGCAGGTTACTCCCTTGTTTTCACATTCTCTGTGGAGTAACACTGTCAGATGTTACCTCATTTACACAGATGAAACCCAGTCTGAAGTGGATCTTTTCCTAAAGGACTATTCACCGAAACTTAAAAGAATGTGTGAGACAATGGGATATTTTTTCCATGCTGTTTATTTTCCAATAGATGTTAGAAATCAGTATCTCACTGTAAGAAAATGGGAAATTGAGAAGAGCTCTTTAGTTATTTTATTCATTCACTCATCTTTACCAAGCCTTTTGTTGGAAGACTGTGAAGAAGCTTTTCTGAAAAACCCTGAAGGAAAACCACGATTAATTTATCATCGTTTGGAGGATGGGAAAGTCAGTTCCGACTCTGTGCAGCAATTGATTGGTCAAGTGTGTAACCTCAACAAGGCCAACAAAGCCAAGATCATTGATCATTCAGGAGATCATGCAGAAGGAGTATATAAAACTTACATTTGTGTGGAAAAGATTATTAAACAGGACATTCTGGGCTTTGAGAACACAGACCTGGATACTAAGGATTTGGGCACTGAAGAGTCCATTCCAGAAGAGGATGATTTGGGGGATGTTCTGTGGGACATACATGATGAGCAAGAACAAATGGAAGCTTTTCAGCAGGCCTCTAATTCAGCCCATGAGTTGGGATTTGAGAAATATTATCAACGCCTTAATGATCTAGTGGCAGCACCAGCCCCGATTCCACCCCTTCTGGTGTCTGGAGGACCAGGTTCTGGAAAGTCCCTTCTTTTATCCAAGTGGATTCAGTTGCAGCAGAAGAGTTCCCCTAACATGCTGATTCTTTCTCATTTTGTGGGGAGGCCCATGTCAACCAGCTCAGAATCCTCCTTGATTATTAAACGGCTGACTCTAAAGTTGATGCAGCACTCCTGGTCAGTGTCTGCTCTGACGCTTGATCCTGCTAAGCTGCTGGAAGAATTTCCACATTGGCTGGAAAAACTCTCTGCTCGCCATCAAGGCAGCATCATCATCATCATTGATTCTATAGATCAAGTTCAGCAAGTTGAAAAACACATGAAATGGCTCATAGATCCACTGCCCGTGAATGTCAGAGTGATTGTCTCTGTGAATGTGGAAACTTGCCCTGCTGCCTGGAGGTTGTGGCCTACACTTCATCTCGATCCCTTAAATCCGAAAGATGCAAAATCTATTATAATTGCAGAATGCCATTCAGTAGACATTAAATTGAGTAAAGAGCAGGAGAAGAAGCTAGAACGACACTGTCGTTGTGCTGCCACCTGCAATGCCCTCTATGTCACCCTTTTCGGCAAAATGATGGCACGTGCTGGGAAAAGAGGCAATTTAGACAAAACCCTTCATCAGTGCCTGCAGTGTCAAGATACTGTTTCATTATATAGACTTGTTCTACACTCCATCCAGGAGTCCATGGCAAGTGATGTGGAGAAAGAGCTAATGAGACAGGTTCTCTGCCTTGTCAATGTTAGTCACAATGGTGTGAGCGAATCAGAACTGATGGAACTCTATCCTGAAACACCCTGGGCCATCTTGACCTCCCTTATTCACAGTTTACACAAAATGTGTTTGTTGACCTATGGTTGTGGCTTGCTCAGGTTTCAGCATCTGCAGGCCTGGGAAACAGTGAGACTTGAGTACATGGATGATCGCACTATTATTTCTTCATATAGGCAAAAGCTAATCAGCTATTTCAACTTGCAGCTGAGTCAGGACAGAGTGACCTGGAGAAGTGCGGATGAGCTACCCTGGCTTTTCCAGCAGCAGGGAGCTAAGCAGAAGCTGCACAATTGCCTTCTCAATCTCTTCGTGTCTCAAAACCTTTACAAAAGAGGACACTTTGCTGAGTTGCTGAGTTATTGGCAGTTTGTTGGCAAAGACAAAAGTGCGATGGCAGCAGAATACTTTGATTCATTGAAGCAGTATGAGAAAAACTGTGAAGGCGAGGAGAACATGATTTGCTTAGCTGATCTATATGAAACGCTGGGGCGATTTCTCAAGGACCTAGGCCTTCTCAGTCAGGCTGTGGTGCCTTTGCAGAGGTCTCTAGAAATTCGAGAAACAGCTTTAGATCCAGATCACCCAAGAGTAGCCCAGTCCCTTCACCAACTGGCAAGTGTGTATGTGCAATGGAAGAAGTTTGGCAATGCAGAACAACTATATAAACAGGCCTTGGAAATCTCAGAAAATGCTTATGGTGCAGACCATCTGCATACTGCTCGTGAACTTGAGGCACTTGCAACTTTGTACCAGAAACAAAATAAATATGAACAAGCTGAACATTTTAGGAAAAAATCCTTTAAAATTCGTCAGAAAGCTACAAGGAAAAAGGGCAATTTGCATGGATTTGCCCTTTTACGCAGACGGGCCCTGCAGTTAGAAGAGCTTACGTTGGGTAAGGACACACCTGATAATGCCCGGACCCTCAATGAACTCGGTGTTCTCTACTATCTTCAGAATAACCTAGAAACAGCTGACCAGTTTTTAAAGCGTTCCCTAGAGATGAGGGAACGAGTTCTAGGACCTGATCATCCTGACTGTGCCCAGTCTCTGAATAATCTGGCAGCTCTATACCATGAAAAGAAGCAGTATGACAAAGCGGAGGAACTCTATGAGAGAGCTTTGGACATTCGGAGACGAGCCTTAGCTCCGGATCACCCTTCTTTAGCATATACAGTGAAGCATCTTGCAATCTTGTATAAGAAAATGGGGAAACTTGACAAAGCTGTACCTTTGTATGAATTGGCTGTTGAAATTCGGCAGAAATCCTTTGGCCCAAAGCACCCTAGTGTAGCTACTGCCTTGGTGAACTTAGCAGTTCTTTATAGCCAAATGAAAAAGCACATTGAAGCCTTGCCATTGTATGAAAGAGCATTAAAGATTTATGAAGATAGCCTGGGTCCGATGCATCCTCGAGTTGGAGAAACATTAAAAAATTTAGCTGTGCTTAGCTATGAAGAAGGGGATTTTGAAAAAGCTGCTGAACTGTACAAAAGGGCAATGGAAATAAAAGAAGCAGAAACGTCACTCTTGGGTGGGAAAGCTCCTTCGAGACATTCATCAAGTGGAGACACATTTAGCCTAAAAACAACTCATTCTCCTAATATTTTCCTTCCTCAAGGACAAAGGTAA

XM_004834239.1 Coding sequence

Tmem108 transmembrane protein 108, transcript variant X1

Length: 1701 bp    Location: 9314314..9682765   Strand: +
>XM_004834239.1
ATGAAGAGAAGTTTACAGGCCCTCTATTGCCAACTGTTAAGCTTCCTCCTGACCGTGGCACTGACCGAAGCGCTGGTACTTGCTATTCAGGAACCGGAATCTCTTCAGGTCCTCCCCTCAGGCAGTCCCCCAGGCACCATGGTGACCGCACCCCACAGCCAGACCACACACTCCTCTGTGGTGACACTGGGCCCTGCTCCTGATGGACCCTCACAGGCCACAGCTACCATGGCAACAACAATACCCCATCAAGACAGGCACCCTCCTATAAACACTACTTCTACTGTCATAGTGACAGCAAATATCCCCCATTCTGAAAGCCCCCTGCCCACAGGTTCCCCTCCAGTTACTATGGCAACCATAGCCTCCCACTCAGAGAGCCGACCACCAGGGGATGCTGCCCCCACCATCCTGCTAACAAAGCCAACAGGAACCACCAGCCACCCCACCACAGCAGCCCCTCGGGCTATCACTCGCAGGCCCCCACGACTCCCAGGCTCTTCCCGAAAGGGGACTGGGGCCTCATTGCGCCCTGTCCCACCTGCACCTGGTGGCCACTCTGGGAGGAAGGAAGGCCAGCGGGGACGAAATCAGAGCTCCACACACCTGGGGCAGAAGCGCCCATTGGGGAAAATCTTTCAGATCTACAAGGGCAACTTCACAGGCTCTTTGGAGTCAGATCCCTCTACTCTTTCCCCCAGGACCCCATACTTCTCTTTGCCACAGCCCCAGACAGTGGCTGCAACCACAGCACCCAGAAGTACCTCATGGGTGCCACCCACCACCCTCCTTGTACCTGCAGAGGACAAGCCAGGACTTAGCACAGCAGACCAAGGGGGTGGTTCCATCTTCACCAGCCCAGGAAGGGAGCTGAATACCACTGCAGCTGCAGGTGCTCCTATCAGTTCACAAGCCACCCCAGTGCCTTCTCAGCACCCCCACAGTGACACACAGGACAGCCCCAGCCTCAGTGACTCTTGGCTTACTGTCACCTCTGTCACCAACAGACCTCTGTCTGCCAGCTCTAAGGTCTTTACAGCTGTGATAGGGCCAAGCCAGGCTGCCTTCAATGCCACTGTCTCAGCCCCTTCCCAGGGGATTCCTCAGGGAACATCCACAACTCCACAGGCCCCAGCCCATCCCCCTGGGGTCTCAGAAAGCACTGTTTCTCTAGCTGAGGAGGAGGCTGCAGCCTCCCCCTTCATGACCGACAGGGTACCCAGTCCTCTCTCCACAGTGGTGTCTACAGCCACAGGAAACTTCCTCAACCGCCTGGTCCCTGCTGGGACCTGGAAGCCTGGAACAGCAGCAAACATCTCCCATGTGGCCGAAGGGGACAAGCCCCACCACAGAGCCACCATCTGCCTGAGCAAGATGGACATTGCCTGGGTGATCCTAGCCATCAGTGTGCCCATCTCCTCCTGCTCCGTCTTGCTGACAGTATGCTGCATGAGGAGGAAGAAGACAGCCAACCCCGAGAATAACCTGAGCTATTGGAACAACGCCATCACCATGGACTACTTCAACAGGCACGCTGTGGAGCTACCACGGGAGATCCAGTCCCTGGAGACCTCAGAGGACCAGCTCTCTGAGCCCCGCTCCCCAGCCAATGGCGACTACCGAGACACTGGGATGGTCCTGGTGAACCCCTTCTGTCAGGAAACATTGTTTGTGGGAAATGACCAAGTGTCTGAGATCTAA

XM_004834242.1 Coding sequence

Tmem108 transmembrane protein 108, transcript variant X4

High confidence: 4 potential gene matches
Length: 1701 bp    Location: 9420794..9682765   Strand: +
>XM_004834242.1
ATGAAGAGAAGTTTACAGGCCCTCTATTGCCAACTGTTAAGCTTCCTCCTGACCGTGGCACTGACCGAAGCGCTGGTACTTGCTATTCAGGAACCGGAATCTCTTCAGGTCCTCCCCTCAGGCAGTCCCCCAGGCACCATGGTGACCGCACCCCACAGCCAGACCACACACTCCTCTGTGGTGACACTGGGCCCTGCTCCTGATGGACCCTCACAGGCCACAGCTACCATGGCAACAACAATACCCCATCAAGACAGGCACCCTCCTATAAACACTACTTCTACTGTCATAGTGACAGCAAATATCCCCCATTCTGAAAGCCCCCTGCCCACAGGTTCCCCTCCAGTTACTATGGCAACCATAGCCTCCCACTCAGAGAGCCGACCACCAGGGGATGCTGCCCCCACCATCCTGCTAACAAAGCCAACAGGAACCACCAGCCACCCCACCACAGCAGCCCCTCGGGCTATCACTCGCAGGCCCCCACGACTCCCAGGCTCTTCCCGAAAGGGGACTGGGGCCTCATTGCGCCCTGTCCCACCTGCACCTGGTGGCCACTCTGGGAGGAAGGAAGGCCAGCGGGGACGAAATCAGAGCTCCACACACCTGGGGCAGAAGCGCCCATTGGGGAAAATCTTTCAGATCTACAAGGGCAACTTCACAGGCTCTTTGGAGTCAGATCCCTCTACTCTTTCCCCCAGGACCCCATACTTCTCTTTGCCACAGCCCCAGACAGTGGCTGCAACCACAGCACCCAGAAGTACCTCATGGGTGCCACCCACCACCCTCCTTGTACCTGCAGAGGACAAGCCAGGACTTAGCACAGCAGACCAAGGGGGTGGTTCCATCTTCACCAGCCCAGGAAGGGAGCTGAATACCACTGCAGCTGCAGGTGCTCCTATCAGTTCACAAGCCACCCCAGTGCCTTCTCAGCACCCCCACAGTGACACACAGGACAGCCCCAGCCTCAGTGACTCTTGGCTTACTGTCACCTCTGTCACCAACAGACCTCTGTCTGCCAGCTCTAAGGTCTTTACAGCTGTGATAGGGCCAAGCCAGGCTGCCTTCAATGCCACTGTCTCAGCCCCTTCCCAGGGGATTCCTCAGGGAACATCCACAACTCCACAGGCCCCAGCCCATCCCCCTGGGGTCTCAGAAAGCACTGTTTCTCTAGCTGAGGAGGAGGCTGCAGCCTCCCCCTTCATGACCGACAGGGTACCCAGTCCTCTCTCCACAGTGGTGTCTACAGCCACAGGAAACTTCCTCAACCGCCTGGTCCCTGCTGGGACCTGGAAGCCTGGAACAGCAGCAAACATCTCCCATGTGGCCGAAGGGGACAAGCCCCACCACAGAGCCACCATCTGCCTGAGCAAGATGGACATTGCCTGGGTGATCCTAGCCATCAGTGTGCCCATCTCCTCCTGCTCCGTCTTGCTGACAGTATGCTGCATGAGGAGGAAGAAGACAGCCAACCCCGAGAATAACCTGAGCTATTGGAACAACGCCATCACCATGGACTACTTCAACAGGCACGCTGTGGAGCTACCACGGGAGATCCAGTCCCTGGAGACCTCAGAGGACCAGCTCTCTGAGCCCCGCTCCCCAGCCAATGGCGACTACCGAGACACTGGGATGGTCCTGGTGAACCCCTTCTGTCAGGAAACATTGTTTGTGGGAAATGACCAAGTGTCTGAGATCTAA

XM_004834247.1 Coding sequence

Bfsp2 beaded filament structural protein 2, phakinin

High confidence: 4 potential gene matches
Length: 1248 bp    Location: 9685568..9772984   Strand: +
>XM_004834247.1
ATGAGTGATCAGCGGGGGGTGGTGGGCTTGCTCCCCAGTGCCAACCCCAGCATGCCCCTCCAGAGGCACAGGGCATCCTCCCGGGGCCCACGGTCAGCATCCCCTCTGGAGAGGCCCCCAGCCTCCAGAACCAATGTTGTGGGCAGCCTTGTCCGCGCCCCTGGGGTCTATGTAGGAATGGCACCCAGTGGGTGCATAGGTGGCCTGGGTGCTCATGTGACTCGCCGGGCCCTGGGCATCAGCAGCGTCTTCCTTCAGGGCCTGCGGAGCTCAGGCCTGGCCATGGTGCCGGCTCCATGCCTGGATACTGACCACGCTGCCGGTGAGGACCTAGGGGGCTGCCTGGTGGGATACATAGCCAAGGTGCATGCCCTTGAGCAAGTCAGCCAGGAGCTGGAGACAGAACTACGGATTCTCCTGGAGAGCAAGGCCAAGTGCTCAGGATGCTGGGGCACCCTCCGGGCCTCCTGGGCCAGCAGCTGCCAGCAGGTGGGTGAGGCTGTCTTGGAGAACGCTCGGCTCATGCTGCAGACAGAGACCATCCAGGCAGAAGCAGATGACTTTAAAGAGAGATATGAAAATGAGCAGCCATTTCGAAAGGCAATGGAAGAGGAAATTAGCTCTCTGTATAAAGTCATTGATGAAACTAATTTGACAAAAACAGATCTGGAGGGTCAAATAGAAAGTCTGAAAGAAGAACATGACTTTCTGTCAAGGAGCTATGAAGAGGATGTGAAGATGTTGTACAAACAGCTGGCAGGGTCTGAGCTGGAACAAATGGATGTTCCCATTGGCACCGGTCTGGATGACATCCTTGAAACAATCAGAATTCAGTGGGAAAGAGATGTGGAAAAAAACCAGGCAGAGACAGGAGCTTTGCTCCAAGCCAAGCAGGACTCGGAGGTGGCCTGCGTGTCCCAGACCCAGGAAGAGAAGCTGGCTGCAGCCCTCAGAATAGAGTTACACAACACCTCATGCCAAGTCCAAAGCCTCCAGGCTGAGATGGAATCCCTACGGGCTCTGAAACGAGGCCTGGAGAACTCGCTGCACGACGCCAAGCACTGGCACAACATGGAGCTGCAGAACCTGGGCGCCGTAGTGGGCAGGCTGGAGGCGGAGCTCCGCGAGGTCCGCGGGGAGGCCGAGGAGCAGCAGCGCGAGCGCGCGCACCTCCTGGCTCACAGGGCCCAGCTGCAGAAGGACGTGGCGTCCTACTTGGCGCTGCTGGACCGAGCTGACAGCGGGTAG

XM_004834245.1 Coding sequence

Cdv3 CDV3 homolog (mouse), transcript variant X3

Length: 780 bp    Location: 9888629..9904516   Strand: +
>XM_004834245.1
ATGGCCGAGACGGAGGAGCGGAGCCTGGACAACTTCTTCGCCAAGAGGGACAAGAAGAAGAAGAAGGAGCGGAGCAGCCGCGCCGCCAACGCCGCGGGCGGAGCGGCGGGGGCCAGGCCGGGCGACGGCACTGGCACGGGGACTAGGCCGGGCGACGGCGGGGCCGCGGGCACCAGGCCGGGCGACGGCGGGGCCGCGGGCACGGGGACCGTGGGCCCCGGGGCCGCCACGAAGGCCGTGACGAAGGATGAAGATGAGTGGAAAGAATTTGAGCAAAAAGAGGTTGATTACAGTGGACTCAGAGTGCAGGCCATGCAAATAAGTAGTGAAAAGGAAGAAGATGATAATGAAAAAAGAGAAGATCCAGGAGATAACTGGGAAGAAGGTGGAGGTGGTGGAGGTATAGAAAAATCTTCAGGTCCTTGGAACAAAACAGCTCCGGTACAAGCGCCTCCTGCTCCAGTAATTGTTACAGAAACCCCAGAACCGGCAATGACTAGTGGTGTGTATCGGCCTCCTGGGGCCAGGCTAACCACAACACGGAAAATGCCACAAGGACCACCAGAAATATACAGTGATACACAGTTTCCATCCTTGCAGTCCACTGCCAAGCATGTAGAAAGCCGAAAAGATAAAGAAATGGAGAAGAGCTTTGAAGTAGTAAGACACAAAAATAGAGGTAGGGATGAGGTGTCAAAAAACCAGGTCCTTAAACTTCAGCTAGACAACCAGTATGCTGTGCTTGAAAACCAGAAATGCAGCCACACACAGTACAATTAA

XM_004834249.1 Coding sequence

Topbp1 topoisomerase (DNA) II binding protein 1, transcript variant X2

Length: 4584 bp    Location: 9994537..9916721   Strand: -
>XM_004834249.1
ATGTCCCCAAATGACCAAGAACCGTTACTTGTGAAGTTTTTAAAGTGTTCAAACAATTCCGAATGTTTTTTTAAAGCTCTTGAGTCAATGAAAGAATTCCAGTCAAAAGAATATCTTCAGATTATTACGGAAGAAGAAGCATTGAAAATAAAGGAGAGTGATAGATCTCTTTATATCTGTGACCCTTTTAGCGGTGCTGTCTTTGATCACCTTAAAAAGCTCAGCTGCAGAATTGTTGGTCCCCAAGTAGTCTTATTTTGTATGCACTATCAACAATGTGTCCCAAGAGCTGAACATCCAGTTTATAATATGGTTATGTCTAATGTAACTGTATCTTGTACAAGCCTGGATAAAGAGAAGAGGGAAGAAGTTCATAAATACGTTCAAATGATGGGTGGACGAGTATTCAGAGACCTTAACATATCAGTAACTCACCTTGTTGCAGGAGAAGTTGGTAGCAAAAAATATTTAGTTGCTGCAAATCTAAAGAAACCTATTTTGCTTTCTTCTTGGATACAAACACTTTGGGAGAAGTCACAAGAGAACAAAATAACTAGATATACTGATATAAACATGGAAGATTTCAGGTGTCCTATTTTTCTTGGTTGTGTAATCTGTGTGACTGGTTTGGGTGGCTTGGACAGGAAGGCAGTTCAGCAGCTCACAATTAAGCATGGAGGCCAGTACATGGGACAGTTGAAAATGAATGAATGTACACACCTGATTGTGCAGGAACCAAAAGGTCAGAAATATGAATGTGCCAAGAGATGGAATGTACACTGTGTGACTACACAGTGGTTTTTTGATAGTATTGAAAAAGGTTTTTGTCAAGATGAGTCTATATACAAGGCAGAACCTAGACCAGAAGCAAAGACTCTGCCTGACACTTCAACTCCCACTGGTCAGATCAGCACGACTGATAGCCGAACTCTTTCAGACGTCAGCCACATTTCCAACATAAATGGAAGTTGTATAAATGAATCCATATACAGTTCAATTCTTAATAGCAAATTAGAACCTACATTTGAAAACCTGGAATATCTGGACATCAGTGCATTTCAAGCACCTGAAGATTTATTAGATGGTTGTCGGATATATCTTTGCGGTTTTAGTGGCAGAAGACTAGATAAACTGAGAAGGCTTATTAACAGTGGAGGTGGAGTTCGTTTTAATCAGCTTAATGAAGATGTAACTCACATTATTGTGGGAGATTATGATGATGAATTGAAGCAGTTTTGGAATAAATCAGCACACAGGCCTCATGTAGTGGGAGCAAAATGGTTGCTGGAATGTTTTAGTAAAGGTTACATGCTTCCTGAAGAAATGTATATCCACGCTAGCTACAAGCCCGTAGAAATTCCAGTTTCAGATCAGCCTGAGAGTAAAACAGCTCTTTCCAAAAAGAACAGCAGCTTCTCTAAGAAAGACTTTGCTTCTAGTGAAATGCATGAACAGGCTGATGAGGATCTGCTTTCCCAATATGTAAACAATAATTCCACAGTAGTGGAAGCTAACAAGTCTGAAGCTGCAGAGTCTGAAGTTGGGGCCTGTAATGACTCTACTCATGTTGGGCCCTTTAATAATTCTACTCACATTTCTCTACAAGAAGAAAACCAGTCTTCTGAGTGTCATTGCCTCCCTGATGCTTCTATAATTACTGAAGAAGCCTTATTTAGCCGAAAGAGTTTTCTTATTTTGGGCTTTAGTAATGAAAATGAATGTAATATTGCAAACATCATAAGAGAATATGCCGGAAAGATTGTATCCCTTCCGAGCAGAGTTGTTGCGGATTATGCTGTGGTTCCCTTGCTGGGATGTGAAGTAGAAGCAACGGTTGGAGAAGTTGTTACAAATACATGGCTGGTTACTTGTATAGACTATCAGACTTTAATTGATCCAAAGTCAAATCCTCTCTTCACACCAGTCCCAGTAATGACAGGAGTGACTCCTTTAGAGGATTGTGTTATTTCCTTCAGCCAGTGTGTTGGAGCAGAAAAAGATTCTCTGATATTCTTAGCAAGTCGCCTTGGAGCAAGTGTTCAAGAATACTTTGTTCGCAAATCTAATGCAAAGAAAGGCATGCTTGCCAGTACACATCTTGTATTGAAAGAACCAGTGGGTTCTAAATATGAAGCTGCAAAGAAGTGGAATTTACCGGCAGTCACTATAGCTTGGCTGTTGGAGACTGCTCGGACGGGAAAGAGAGGAGATGAAAGCCATTTTCTGATTGAAAATTCACCTACAGAACAAAGATTGGAAACCAAAACAACAAATGGTGAAACTCTAAATCCAGGTAGTTCAGCACATCCTGGCAAACATGTGGAATCTCTCAGAAAAATGGCTGTTACACCTTTGGATATGAACCGCTTTCAGAGTAAAGCTTTCCATGCTGTGCTCTCACAGCACACTGGGAAGGTTCCAACCGAGTCTCCAGCAGTAGGAAAGCCACTTCAGAAGGAGCCCTCAGTACACCTGGACACGCCGTCAAAATTTCTGTCTAAGGACAAACTTTTCAAGCCTTCATTTGATGTGAAGGATGCACTTGCAGCCTTGGAAACTCCAGGAGATGCCAGCAAACAGAAAAAGAAACTGAGTTCACCACTCTCAGAAGTCATTGTCAGAAATTTGAAACTTGCTTTGGAAAATAGCTCTCGAAATGCTGTCGCTCTTTCTGCCAGCCCTCAACTGAAGGGTACCCAAATGGAGAAGGAAGAAGCTCCAAAGCCACTTCACAAAGTTGTGGTATGTGTGAGTAAAAAACTCAGTAAAAAGCAGAGTGAACTAAATGGAATTGCAGCCTCTCTAGGAGCAGAATACAGGTGGAGTTTTGATGAAACTGTGACTCATTTCATCTATCAAGGCCGGCTAAATGATAGCAATCGAGAGTATAAATCTGTAAAAGAAAGAGGAATACACATTGTTTCAGAGCACTGGCTTTTAGACTGTGCTCAAGAATATAAACATCTTCCAGAATCCCTTTATCCTCATACTTACAATCCCAAAATGAGCCTGGATATCAGTGCAGTGCAAGATGACCGACTCTGTAATGGTCAAGTACTTTCAGCTATTTCTGCAGTAAAGGACAGTGAGCTAGATCATTTGACTATAGAAGAAAATGATGTCGACAATATGACTGCCAGTAACAAAGAATCAGCACTGCCAAATGGAAGTGAAAGGAATGATTCTAAAGGAGCTCTGACACAGACCTTGGAGATGAGAGAGAACTTCCAAAAGCAGCTGCAGGAAATAATGTCTGCAACTTCCATAGTGAAACCCCAAGGTCAGAGGACTTCCCTGTCAAGAAGTGGCTGTAACAGTGCCTCTTCAACCCCCGAGAGCACTCGGTCCACTCGAAGTGGACGGAGTAGAGTCCTAGAGGCACTGAGGCAGTCTCGTCAAATAGTACCTGATGTTAACACAGAGCCCTCCCAAAATGAACAGATCATTTGGGATGACCCTACAGCTAGGGAGGAGAGAGCAAGGCTTGCCAGCAATTTGCAGTGGCCTAGTTGTTCCACACAGTACTCTGAGCCTCAGGCTGATGTTAAAAAATTGGAGGATTCTCCTTTTCAGGAGCCTTTATGTGATTCGAAAATTGCTGAAAAAGCTATTAGTGATCCTGGAAACAAAGGTGGGACTGAAGCCCCAAAACACCCAGCCTTTGAAGAACTGGAAACTCCAACAAAAGACAATCATCTGATCCCTACACCTCAAGCCCCCAGTATTGCCTTCCCCTTGGCCAATCCACCAGTGGCTCCGCACCCTGGAGAAAAGATTGTAACAATAGAAGAGACTCATGAAGAATTAAAAAAACAGTACATATTTCAGTTGTCATCTCTGAATCCTCAAGAACGCATTGATTATTGTCATCTGATTGAAAAACTAGGTGGGTTAGTGATGGAGAAGCAGTGCTTTGATCCCAGCTGTACACACATTATTGTGGGACATCCACTGAGAAATGAGAAGTACTTGGCTTCCGTAGCAGCTGGGAAGTGGGTGCTTCACCGTTCCTACCTGGAAGCATGTAGAACTGCTGGCCACTTTGTACAGGAAGACGACTATGAATGGGGAAGCAGCTACATACTTGATGTTTTGACTGGCATCAATGTACAACAACGAAGACTAGCACTTGCAGCAATGAGATGGAGAAAAAAGCTCCAGCAAAGACAAGAATCAGGCATTGTTGAGGGTGCATTTAGTGGGTGGAAGGTCATTTTACATGTTGACCAGTCCCGAGAAGCAGGGTTTAAACGTCTTCTTCAGTCAGGAGGAGCAAAGGTGCTACCTGGTCATTCTCTGCCTTTATTTAAAGAGGCCACTCATCTCTTTTCTGACTTTAATAAACTGAAACCAGATGACTCAAGAGTTAATATAGCAGAAGCTGCTGCCCAGAATGTGTACTGCTTGAGAACAGAATACATTGCTGATTATCTCATGCAGGAATCTCCTCCTCCTGTAGAAAATTACTGTCTACCAGAAGCTGTTTCATTTCTTCAAAGTAGTAAGGAACCTGGACCTGGCTTATCACAAAAGAGGAAAGCTCCTGCAGAGAAGAATAAAATCAAACGGTCTAGAGTACACTAA

XM_004834251.1 Coding sequence

LOC101718231 inhibitor of carbonic anhydrase-like, transcript variant X1

Length: 2103 bp    Location: 10015967..10063072   Strand: +
>XM_004834251.1
ATGAAGCTGGCTGTCTGTGTGCTGCTGTGCGCCGGGGCTCTGGGGCTGTGTCTGACTGTCCCTGAAAAAACTGTAAGATGGTGCACTGTGTCAGATCCTGAGGCCACCAAATGTTCCAGTTTCAGTGACAATGTGAAAAAAGTCTTTTCAGCAGATGGTCCCCTTGTCACTTGCATGAAGACAACCTCTTACCGTGAATGCATCAGGGCAATTATGGCAAACAAAGCAGATGCTGTGACCATTGATGGAGGTTTGGTGTTTGAGGCCGGCTGGCCCCCCTACAACCTGAAGCCCATCGCAGCAGAGTTCTATGGGTCAAAAGATGATCCACAAACCCACTATTATGTTGTGGCTCTGGTGAAGAAGGGCACTGACTTCCAGCTGAACCAGCTCCAAGGCAAGAAGTCCTGCCACACGGGCCTGGGTTGGTCTGCTGGGTGGATCGTCCCCATTGGCCTACTGCTTCCCTCTGGCTCTCTTGAAGCAGGAGCGGCCAAGTTTTTCTCTGGCAGCTGTGTCCCCTGTGCAGATGCAAAGAAGTTCCCCAGCCTATGTCAACTGTGTGCAGGAAAAGGAACTGACAAGTGTGCTTGCTCCTCTCACGAACCATACTTTGGCTATTCGGGTGCCTTCAAGTGCCTGGAGGACAGCGTGGGGGACGTGAGCTTTGTGCGGCACTTGACGGTGTTTGAGGTCCTGCCTCAGAAGGCTGACAGGGACCAGTATGAGCTGCTCTGCCCGGACAACACCCGGAGGCCAGTGGATGAGTATGCGCAGTGCTATCTGGCCAAAGTCCCTTCTCATGCTGTCGTAGCTCGGAGTGTGGATGGCAAGGAGGACTTGATCTGGAAGCTCCTCAGCCAGGCCCAGAAATACTTTGGAAAAGACAAGTCATCAGAATTTCAGCTTTTCAGCTCCCCTCATGGGAAAGACCTGCTGTTTACTAATGCTGCCCATGGATTTTTAAGGGTCCCCCCCAAGATGGATGCCAAGCTATACCTTGGATATGAGTATTTTTCTGCCATTCAGCATGTGGAGAGAGGTGTGGAAGACTCCCGGAGGGTGCAGTGGTGTGCAGTGGGCCACCACGAAAGGGCCAAGTGTGATGAGTGGAGTGCGCTGAGTGGTGGTGCCTTGGTGTGTACCACAGAGGAGATCCCTGAAGACTGCATTGCTGCCATCATGAAAGGAGAAGCGGATGCCATGAGCTTGGATGGAGGATTTGTCTATACAGCTGGCCAGTGTGGCCTGGTGCCTGTCCTGGGAGAGAACTATGGGGCTAAAGGTAGCAATGAGCGGCTTGCGTCTAAATGTGTGAATTCAGCCTTGGAAGGTTATTCTGTTGTGGCTGTGGTTAAGAAATCAGATGCTGATATCACCTGGAACTCTCTGCAAGGCAAGAAGTCCTGCCACACTGCAGTTGGCACTTCTGCAGGCTGGAACATCCCTATGGGCTTAATATACAACAAAACCAGGTCCTGTAAATTTGATGAGTTCTTCAGTCACAGCTGTGCTCCTGGGGCTAATCCAGATTCTCAACTCTGTGCTTTGTGTGGTGGCAGCAGCAACCCAAGCCACATGTGTGCTCCCAACAGTCATGAGCGCTACTACGGCTCCAGTGGGGCTCTCAGGTGTCTGGTTGAGAAGGGAGATGTAGCCTTCGTGAAGCCCTCCGCAGTCCTACAGAACACTAATGGGAAGAATCCTGAGGTGTGGGCCAAGGATCTGAAGCAGGAAGACTTTGAGTTGCTGTGCCTTGATGGGACCAGGAAGCCTGTGACTGAGGCTCAGAGCTGCCATCTAGCCATAGTACCAAATCACGCTGTGATCTCCAGGAAAGATAAGGCAGATTTTGTTCGGAGAATTCTCTTCAACCAACAGGAGCTCTTTGGAAGAAATGGATTTGAATATATGATGTTCCAAATGTTTGAGTCCTCAACCAAGGACCTGCTGTTCAGCGATGACACTGAATGTTTGGCTAACCTAGGGAACAAAACAACTTATGAAAAATTCTTAGGGCCAGAGTATCTTTCAGCTATGGCTAATTTGAGGCCATGCTTAAATTCTGAACTTCTGGACGTCTGCCTTTTCCACAGGAATTAA

XM_004834255.1 Coding sequence

Tf transferrin, transcript variant X2

Length: 2484 bp    Location: 10077936..10109341   Strand: +
>XM_004834255.1
ATGGGGCTGGAGGCCAAAGCCAGCTCAGGCAGCTCTGGGTCCGGAGCAGAGCCAATCCCGCCCCGGTCTGGTATAGCCACGCTCCTGGCACAGAGCAAGCAGCGAGAACAAAGAATGGATTTTGTTTTCATTCCCTTCCAGCCAGCATTTTTGTGCTGGATTCCATTTGTTGTCCCACAGCTCAGGAAACGAGGCGACCATCAGGGCGAAAAGGGAAGGGGGATGGATGAGGGGCGATTATGCAACAGCTGCCCAAATAAAGGAGGTCAAAGATTGCGCCCCGGGCTGGCCTGGGCCGGGGATATAGGCGCTCGGCGCTGGCCCGCTGCGCAGAAGCGGGTCGACCTCTGCTCGCCGCTCCTCGCCGCACAGGGACGCAGAATGAGGATCGCCTTGAGCACTTTACTGGCCTGCGCCGCCTTGGGGCTATGTCTGGCTGTTCCTGAGAAAACTGTGAGGTGGTGTGCTGTGTTAGATCATGAGGCCAGCAAATGTGCCAGTTTCCGTGACAATATGAAGAAAGTCCTTCCAGCAGATGGTCCCCGCATCATTTGTGTGAAGAAAAACTCCCACCTGGATTGCATCAAGAGCATTGTGGCAAGTGAAGCAGACGCTGTTACAGTAGATGCAGGTTTGGTGCACGAGGCAGGCCTGGCTCCCAACAACCTGAAGCCTGTAGTGGCAGAGTTCTATGGGTCACAAGAGAATCCACAGACCTTCTATTTTGCTGTTGCCGTGGTGAAGAAGGACACCAACTTCCAGCTGAGCCAGCTCCAAGGCAAGAAGTCCTGCCACACTGGCCTTGGCAGGTCTGCTGGGTGGAACATCCCCATCGGCTTACTTTTTTGTGACTTACCTGAGCCACGTAAACCCCTTGAAAAAGCAGTGGCCAGTTTCTTCTCGGGCAGCTGTGTCCCCTGTGCAGATGGGGCGGCCTTCCCTCAACTGTGTCAACTGTGTCCAGGATGTGGTTGCTCCTCCCTTCAGCCATATTTCGGCTATGCAGGTGCCTTCAAATGTCTCAAGGATGGTGGTGGGGATGTGGCCTTCGTCAAGCACTTAACCATATTTGAGGTCCTGCCTCAGAAGGCTGACAGGGACCAATATGAGCTGCTCTGCCCGGACAACACCCGGAGGCCAGTGGATGAGTATGCGCAGTGCTATCTGGCCAAGGTCCCCTCTCATGCTGTCGTAGCTCGGAGTGTGGATGGCAAGGAGGACTTGATCTGGGAGCTCCTCAGCCAGGCCCAGGAACATTTTGGCAGAGACAAATCAAAAGAATTCCACTTGTTCAGCTCTTCTCATGGGAAGGATCTGCTGTTTAAAGACTCTGCACAAGGGTTTTTAAGGATTCCCCCCAGGATGGACTATAGGCTGTATCTGGGCTATCCGTACATCACTGCTATTCGGAATCTACGGGAAGGCATATGCCCAGAAAGCTCACAGGAAGAAGCAAAGACACTGAAGTGGTGTGCACTGAGCCACCATGAGAGGCACAAGTGTGATGAGTGGAGCGTTAAGAGTGATGGAAAAATAGAGTGTGAATCAGCAGAGACCACGGAAGATTGCATTGCCAAGATCATGAGTGGGGAAGCAGATGCTATGAGCTTGGATGGCGGATTTGTCTACATAGCCGGCCAGTGTGGTCTGGTGCCTGTTATGGCAGAAAACTACGAAAGCTCTAGTTGTCAAGGACCACCAGAAAAAGGTAAGCTGGAATTTGGGTATTTTGGTGTGGCAGTGGTAAAGAAATCAGATCCTGACATCAATTGGAATAATTTGGAGGGCAAGAAGTCTTGCCACACTGCAGTAGACAGAACCGCTGGCTGGAACATTCCCATGGGTCTGCTCTACAGCAGAATCAACCACTGCAGATTTGATGAATTTTTCAGTCAAGGCTGTGCCCCTGGGTCTATCAAAAATTCCAGTCTCTGTAAGCTCTGTATTGGCCCAAATGTGTGTGCTCCCAACAACAAAGAAGTGTACTATGGCTACACAGGGGCTTTCCGGTGTCTGGTTGAGAAAGGAGATGTGGCCTTTGTGAAGCACAAGACTGTCATGCAGAACACTGATGGAAACAACCCTGATTCGTGGGCTAGCAATCTTAAGAAGGACGACTTTGAGCTGCTGTGCCCTGATGGCAGCAGGAAGTCTGTGGATGAGTATGAGAAATGCCACCTGGCCCGAGCCCCAAATCATGCTGTGGTCGCACGGAAAGATAAGGCAGAATATGTTCGCGAAGTGTTAGTGAAACAGCAGAGTCAATTTGGAAGTCATGTATCTGACTGCACAAGCCAATTTTGTTTGTTCCGGTCTAAAACCAAGGATCTTCTGTTCAGGGATGATACGAAATGTTTGGTCAGAGTTGAGAATTCTGTCACCCCTGAAAAGTACTTAGGAGAGGAGTATGTCAAGGCTGTTGGTAACCTGAAAAAATGCTCAACCTCACGACTCTTGGAAGCCTGCACTTTCCACAAACTTTAA

XM_004834254.1 Coding sequence

Tf transferrin, transcript variant X1

Length: 2469 bp    Location: 10077936..10109341   Strand: +
>XM_004834254.1
ATGGGGCTGGAGGCCAAAGCCAGCTCAGGCAGCTCTGGGTCCGGAGCAGAGCCAATCCCGCCCCGGTCTGGTATAGCCACGCTCCTGGCACAGAGCAAGCAGCGAGAACAAAGAATGGATTTTGTTTTCATTCCCTTCCAGCCAGCATTTTTGTGCTGGATTCCATTTGTTGTCCCACAGCTCAGGAAACGAGGCGACCATCAGGGCGAAAAGGGAAGGGGGATGGATGAGGGGCGATTATGCAACAGCTGCCCAAATAAAGGAGGTCAAAGATTGCGCCCCGGGCTGGCCTGGGCCGGGGATATAGGCGCTCGGCGCTGGCCCGCTGCGCAGAAGCGGGTCGACCTCTGCTCGCCGCTCCTCGCCGCACAGGGACGCAGAATGAGGATCGCCTTGAGCACTTTACTGGCCTGCGCCGCCTTGGGGCTATGTCTGGCTGTTCCTGAGAAAACTGTGAGGTGGTGTGCTGTGTTAGATCATGAGGCCAGCAAATGTGCCAGTTTCCGTGACAATATGAAGAAAGTCCTTCCAGCAGATGGTCCCCGCATCATTTGTGTGAAGAAAAACTCCCACCTGGATTGCATCAAGAGCATTGTGGCAAGTGAAGCAGACGCTGTTACAGTAGATGCAGGTTTGGTGCACGAGGCAGGCCTGGCTCCCAACAACCTGAAGCCTGTAGTGGCAGAGTTCTATGGGTCACAAGAGAATCCACAGACCTTCTATTTTGCTGTTGCCGTGGTGAAGAAGGACACCAACTTCCAGCTGAGCCAGCTCCAAGGCAAGAAGTCCTGCCACACTGGCCTTGGCAGGTCTGCTGGGTGGAACATCCCCATCGGCTTACTTTTTTGTGACTTACCTGAGCCACGTAAACCCCTTGAAAAAGCAGTGGCCAGTTTCTTCTCGGGCAGCTGTGTCCCCTGTGCAGATGGGGCGGCCTTCCCTCAACTGTGTCAACTGTGTCCAGGATGTGGTTGCTCCTCCCTTCAGCCATATTTCGGCTATGCAGGTGCCTTCAAATGTCTCAAGGATGGTGGTGGGGATGTGGCCTTCGTCAAGCACTTAACCATATTTGAGGTCCTGCCTCAGAAGGCTGACAGGGACCAATATGAGCTGCTCTGCCCGGACAACACCCGGAGGCCAGTGGATGAGTATGCGCAGTGCTATCTGGCCAAGGTCCCCTCTCATGCTGTCGTAGCTCGGAGTGTGGATGGCAAGGAGGACTTGATCTGGGAGCTCCTCAGCCAGGCCCAGGAACATTTTGGCAGAGACAAATCAAAAGAATTCCACTTGTTCAGCTCTTCTCATGGGAAGGATCTGCTGTTTAAAGACTCTGCACAAGGGTTTTTAAGGATTCCCCCCAGGATGGACTATAGGCTGTATCTGGGCTATCCGTACATCACTGCTATTCGGAATCTACGGGAAGGCATATGCCCAGAAAGCTCACAGGAAGAAGCAAAGACACTGAAGTGGTGTGCACTGAGCCACCATGAGAGGCACAAGTGTGATGAGTGGAGCGTTAAGAGTGATGGAAAAATAGAGTGTGAATCAGCAGAGACCACGGAAGATTGCATTGCCAAGATCATGAGTGGGGAAGCAGATGCTATGAGCTTGGATGGCGGATTTGTCTACATAGCCGGCCAGTGTGGTCTGGTGCCTGTTATGGCAGAAAACTACGAAAGCTCTAGTTGTCAAGGACCACCAGAAAAAGGGTATTTTGGTGTGGCAGTGGTAAAGAAATCAGATCCTGACATCAATTGGAATAATTTGGAGGGCAAGAAGTCTTGCCACACTGCAGTAGACAGAACCGCTGGCTGGAACATTCCCATGGGTCTGCTCTACAGCAGAATCAACCACTGCAGATTTGATGAATTTTTCAGTCAAGGCTGTGCCCCTGGGTCTATCAAAAATTCCAGTCTCTGTAAGCTCTGTATTGGCCCAAATGTGTGTGCTCCCAACAACAAAGAAGTGTACTATGGCTACACAGGGGCTTTCCGGTGTCTGGTTGAGAAAGGAGATGTGGCCTTTGTGAAGCACAAGACTGTCATGCAGAACACTGATGGAAACAACCCTGATTCGTGGGCTAGCAATCTTAAGAAGGACGACTTTGAGCTGCTGTGCCCTGATGGCAGCAGGAAGTCTGTGGATGAGTATGAGAAATGCCACCTGGCCCGAGCCCCAAATCATGCTGTGGTCGCACGGAAAGATAAGGCAGAATATGTTCGCGAAGTGTTAGTGAAACAGCAGAGTCAATTTGGAAGTCATGTATCTGACTGCACAAGCCAATTTTGTTTGTTCCGGTCTAAAACCAAGGATCTTCTGTTCAGGGATGATACGAAATGTTTGGTCAGAGTTGAGAATTCTGTCACCCCTGAAAAGTACTTAGGAGAGGAGTATGTCAAGGCTGTTGGTAACCTGAAAAAATGCTCAACCTCACGACTCTTGGAAGCCTGCACTTTCCACAAACTTTAA

XM_004834257.1 Coding sequence

Rab6b RAB6B, member RAS oncogene family, transcript variant X1

Length: 633 bp    Location: 10197497..10143489   Strand: -
>XM_004834257.1
ATGTCTGCAGGGGGAGATTTTGGGAACCCACTGAGAAAATTCAAGTTGGTGTTCCTGGGGGAGCAGAGCGTTGGAAAGACGTCTCTGATCACAAGGTTCATGTACGACAGCTTCGACAACACATACCAGGCAACCATTGGGATTGACTTCTTGTCAAAAACCATGTACTTGGAGGACCGTACGGTTCGACTGCAGCTTTGGGACACAGCTGGCCAGGAAAGGTTCCGTAGCCTGATCCCCAGCTATATTCGGGACTCCACAGTGGCTGTGGTGGTGTACGACATCACAAATCTTAATTCCTTCCAGCAGACCTCTAAGTGGATTGATGACGTCAGGACAGAGAGGGGCAGTGACGTCATCATCATGCTGGTGGGCAACAAGACGGACCTGGCGGACAAGAGGCAGATAACTATCGAGGAAGGGGAGCAGCGTGCCAAAGAACTGAGTGTTATGTTCATTGAGACCAGCGCGAAGACTGGCTACAATGTGAAGCAGCTCTTCAGACGTGTGGCATCGGCTCTGCCCGGCATGGAGAATGTCCAGGAGAAAAGCAAAGAAGGGAGTATCCTTTTCCTCTCTCACGTGAGTGAAAAATGTGCCAGAGAAGCCATTTATTCACACTTAGGATTATAG

XM_004834256.1 Coding sequence

Srprb signal recognition particle receptor, B subunit

Length: 816 bp    Location: 10114889..10131840   Strand: +
>XM_004834256.1
ATGGCTACCGTGAACTCCCGTCGCGTAGGGGATGGAGGTGGCGCGGGAGGCACCTTCCAGCCCTACCTGGACTCCTTGAGACAGGAGCTGCAGCAGAGGGACCCTACGCTGCTGTCAGTAGTGCTGGCGGTCGCTGTGGTGCTGCTGACTCTGGTGTTCTGGAAATTCATCTGGAGCAGAAAGAGAAGTCAAAGAGCTGTTCTCCTTGTGGGTCTTTGTGACTCCGGGAAAACATTGCTATTTGTCAGGTTGTTAACAGGCCATTACAGAGACACGCAGACTTCTATTACTGACAGCTCTGCTGTGTATAGAGTCAACAATAACAGGGGCAATAGTTTAACCTTGATTGACCTTCCTGGGCACGAGAGCTTGAGACTTCAGTTCTTAGAGCGGTTTAAGTGTTCAGCCAGGGCTTTTGTGTTTGTGGTGGACAGTGCATCTTTCCAGCGAGAGGTGAAAGACGTGGCAGAGTTTCTGTATCAAGTCCTCATAGACAGCATGGGTCTGAAGAACACACCATCATTCCTAATAGCCTGCAATAAGCAAGATATTGCAATGGCAAAATCAGCAAAGTTAATTCAGCAACAGCTTGAGAAAGAACTCAACACCTTACGAGTTACCCGCTCTGCTGCCCCCAGTACACTGGACAGTTCCAGTACTGTCCCTGCTCATCTTGGAAAGAAAGGCAAAGAATTTGAGTTCTCACAGTTGCCCCTCAAAGTGGAGTTCCTCGAATGCAGTGCCAAGGGTGGAAGAGGAGACGCAGGTTCTGCAGACATCCAGAACTTAGAGAAATGGCTGGCTAAAATTGCCTGA

XM_004834261.1 Coding sequence

Slco2a1 solute carrier organic anion transporter family, member 2A1

High confidence: 4 potential gene matches
Length: 1935 bp    Location: 10339448..10256799   Strand: -
>XM_004834261.1
ATGGGGCTCCTGCCCAAGTTCGGCGCGCGCCAGAGCAGCAGCGCCTCTTCGGGCCGAGCCGGCCGCTGTTCCCGCGCGGTCTTTGGCAACATTAAGATATTTGTGCTCTGCCATGGTCTCCTGCAACTCTGCCAGCTCCTATACAGTGCCTACTTCAAAAGCACCCTCACTACCATTGAGAAGCGCTTCGGGCTCTCCAGTTCTTCCTCAGGCCTCATTTCCAGCTTGAACGAGATCAGCAATGCCATCCTCATCATCTTTGTTAGCTACTTTGGCAGCCGGGTAAACCGACCAAGACTGATCGGCATCGGGGGTCTCCTGCTGGCTGCAGGTGCCTTTGTTCTCACCCTGCCACACTTCCTCTCAGAGCCCTACCAGTACACCTCAGCCAGCATTGGGAACTTCAGCCGTGTCCAGACGGAGCTTTGCCAGAGGCGTGGGCATAACCTACCCCCTAGTAAGTGCTCAAACACCATGCAGGATGTGCGGAAGGAGACCAGCAGCATGTGGGGCCTGATGGTGATCGCACAGCTGCTGGCGGGCATCGGGACCGTGCCCATTCAGCCGTTTGGCATCTCCTATGTGGATGACTTCGCAGAGCCCAACAACTCGCCCCTGTACATCTCCATCCTATTTGCCATTGCTGTATTTGGACCAGCTTTTGGGTACCTGCTGGGCTCTGTCATGCTGCAGATCTTTGTGGACTACGGCAGGGTTGACATAGCTAAAGTTAACTTGAGCCCAGGTGACCCTCGATGGATTGGAGCCTGGTGGCTGGGCCTGCTCATTTCTTCAGCCTGTTTGGTTCTCACCTCTTTTCCTTTTTTCTTCTTTCCTCGAACGATGCCCAGAGGAGTAGAGAGTTCTCCTGAGACAGAGGATGGAACAAGAAAGATGGAGGAGGTCAGGTCAAGAGGCTCCCTGATGGATTTCATTAAAAGGTTCCCCCGCATCTTCCTGAGGCTGCTCATGAACCCACTCTTTGTGCTGGTGGTTCTGGCCCAGTGCACCTTCTCTTCTGTCATCGCCGGCCTCTCCACATTCCTCAACAAGTTTCTAGAGAAGCAGTATGGCACCTCTGCAGCCTATGCCAACTTTCTCATTGGTGCTGTAAACCTCCCTGCTGCAGCATTAGGGATGTTGTTTGGAGGAATCCTCATGAAGCGTTTTGTTTTCCCTCTGCAAACCATGCCCCGTGTGGCTGCCACCATCACCACCATCTCTATGATCCTCTGTGTCCCTCTGTTCTTCATGGGATGCTCCACCCCACCTGTGGCCGAGGTCTACCCTCCCAGCACATCAAGTTCTATACATCTGCAGCCTCCTGCCTGCCACAGGGACTGCTCGTGCCCGGATCCCATCTTCCACCCTGTCTGCGGAGACAATGGAGTCGAGTACCTTTCTCCTTGCCATGCTGGCTGCAGCAGCATCAACAAGAGCTCTGCAGACTCCAAGCAATTGATCTATTTGAACTGCAGCTGTGTGACTGGGAGATCTACTTCAGCGAAGACAGGATCATGCCCCATCCCCTGTGCCCACTTCCTGCTCCCGACCATCTTTCTCATCTCCTTCGCAGCCCTGATAGCCTGCATCTCCCACAACCCCCTCTACATGATGGTTCTGCGTGTGGTGAACCATGAGGAAAAGTCATTTGCCATTGGGGTACAGTTCTTGCTGATGCGCTTGCTGGCCTGGCTGCCATCTCCAGCCCTCTATGGCCTCATCATCGACTACTCCTGCATCCGGTGGAATTCACAGTGCTCAGGGAGGCGAGGGGCCTGCATCTACTATGACAATGATGCTCTCCGGGACAGGTACCTGGGCCTACAGATGGGCTACAAGGCACTGGGCATACTCCTGCTTTTCTTCATCAGCTGGAAGGTGAAGAAGAACAGAGAATATAATGTGCAAGAGAAGGCTATGGACCTCATCTGA

XM_004834262.1 Coding sequence

Ryk receptor-like tyrosine kinase, transcript variant X1

High confidence: 4 potential gene matches
Length: 1815 bp    Location: 10568426..10462590   Strand: -
>XM_004834262.1
ATGCGCAGGGCGGCGCGGCTCGGGCGGCTGGGCCGGGGCCGCCTCTCCAGAGCCCGCGGCCTGGGGGTCCCGCCGCCGCTGCTGCTGCTCGCGCTGCTACCTTTGCTGCCCACGCCCGGTGCCGCCGCCGCCCCCGCCCCGCCACCCCTGGCCCTGCAGCCTGCGGCGGCAGGGCCCAGCGTGAGCCTCTACCTGAGCGAGGACGAGGTGCGCCGGCTCATCGGTCTTGATGCAGAACTTTATTATGTGAGAAACGACCTTATTAGTCACTACGCTCTGTCCTTTAACCTGTTAGTACCCAGTGAGACAAATTTCCTGCACTTCACTTGGTATGCAAAGTCCAAGGTTGAATATAAACTTGGATTCCAAGTAGACAATTTTGTGGCCATGGACATGCCCCAGGTCAACATTTCTGTTCAGGGGGAAGTTCCACGCACTTTATCAGTGTTTCGGGTCGAGCTTTCCTGTACTGGCAAAGTAGATTCTGAAGTTATGATACTAATGCAGCTCAACTTGACAGTAAATTCTTCAAAAAATTTTACAGTCCTAAATTTTAAACGAAGGAAAATGTGCTACAAAAAACTTGAAGAAGTAAAAACTTCAGCATTGGACAAAAACACTAGCAGAACTATTTATGATCCTGTACATGCAGCTCCAACCACTTCTACGCGTGTATTTTATATCAGTGTAGGGGTTTGTTGTGCAGTAATATTTCTTGTAGCAATAATACTAGCTGTTTTGCACCTTCACAGTATGAAAAGAATTGAACTGGATGACAGCATCAGTGCCAGCAGTAGTTCCCAGGGGCTGTCCCAGCCATCCACCCAGACAACTCAGTACCTGAGGGCTGACACACCCAACAATGCAACTCCCATCACCAGTTATCCAACCTTGCGGATAGAGAAGAACGACCTGAGAAGTGTCACTCTTTTGGAAGCCAAAGCCAAGGTGAAGGATATAGCAATATCCAGGGAGAGGATAACACTAAAAGATGTTCTCCAAGAAGGTACCTTTGGGCGTATTTTCCATGGAATTTTAGTGGATGAAAAAGATCCAAATAAAGAAAAACATACATTTGTAAAAACAGTTAAAGATCATGCCTCTGAGATCCAGATAACCATGATGCTGACGGAAAGCTGTAAGCTGCGAGGTCTTCACCACAGAAATCTTCTTCCTATTACTCACGTGTGTATAGAAGAAGGAGAAAAGCCCATGGTGATGCTGCCTTACATGAATTGGGGGAATCTTAAATTGTTTTTACGGCAATGCAAATTAGTAGAGGCCAATAACCCACAGGCAATCTCTCAGCAAGACCTGGTACATATGGCTATTCAGATTGCCTGTGGAATGAGCTACCTGGCAAGAAGGGAAGTCATCCACAAAGACCTGGCTGCTAGAAACTGTGTCATTGATGACACACTTCAAGTTAAGATCACAGACAATGCCCTCTCCAGAGACTTGTTCCCCATGGACTATCACTGTCTGGGGGACAATGAAAACAGGCCAGTTCGATGGATGGCTCTTGAAAGTCTGGTTAATAATGAGTTCTCTAGCGCTAGTGATGTGTGGGCCTTTGGAGTAACACTGTGGGAGCTTATGACTCTGGGCCAGACACCCTATGTGGACATTGACCCCTTTGAGATGGCTGCTTACCTAAAAGATGGTTACCGAATAGCCCAGCCAATCAACTGTCCTGATGAATTATTTGCTGTGATGGCCTGTTGCTGGGCCTTAGATCCGGAGGAGAGGCCCAAGTTTCAGCAGCTGGTCCAGTGTCTTACAGAGTTCCATGCCGCCCTGGGAGCCTATGTCTGA

XM_004834265.1 Coding sequence

Amotl2 angiomotin like 2, transcript variant X2

Length: 2301 bp    Location: 10713176..10696058   Strand: -
>XM_004834265.1
ATGAGGACCCTGGAAGACTCCTCTGGGACAGTCCTGCACCGCCTCATCCAGGAGCAGCTCCGCTATGGCAACCTGACGGAAACACGTACACTGTTGGCCATCCAGCAGCAGGCCCTTAGGGGTGGGGCTGGAGCTGGGGGCACAGGGAGCCCCCAGGCCTCTCTGGAGATCTTGCCACCCGAGGACAGTCAGGTGCTGCAGCAGGCCACCAGACAGGAGCCCCAGGGCCAGGAGCACCAGGGTGGTGAGACCCACCTGGCAGAGAATACCCTCTACCGGCTGTGCCCACAGCCCAGCAAGGGTGAGGAGCTGCCTACCTATGAGGAGGCCAAAGCCCACTCGCAGTACTATGCAGCCCAGCAGGCAGGGCCACGGCCACACGTCAGCGAACGGGATCCTCGTGGGGCCCCTGGAGGCAGCCGCCGGCAAGATGAGGCCTTACGGGAGCTGAGGCATGGGCACGTGCGCTCGCTGAGTGAACGGCTTCTGCAGCTTTCCCTGGAGAGGAATGGTGCCCGAGTCCCCAGCCACATGAGCTCCTCTCACAGCTTCCCACAGCTGGCTCGAAGCCAGCAGGGCCCTCTACCCCGGGGCCCTCCTGCTGAGGGCCCAGAGACCCGTGGACCCCCACCACAGTACCCCCATGTTATAACCTCTCATGAGACTACTGCTGTCACTGACCCGAGGTACCGCGCCAGAGGTAGCCCGCACTTCCAGCATGCTGAAGTCAGGATCCTGCAGGCCCAAGTACCTCCTGTGTTCCTCCAGCAGCAGCAGCAGTACCAGTACCTGCAACAGCCCCAGGAGCACCCTGCACCCCCACATCCGGCTGTTCTCGGTCATGGGACTCATGGTCTGGGAGTGGAGGGATCAGCAAGTGTCCAGGCCTCCTCAGCCACCGTGGGGAGTCCCCATCTGGCCCAGATGGAAGCTGTGTTGAGGGAGAATGCCAGGCTCCAGAGGGAGCTGGAGAGCTCAGTAGAAAAGGCGAGCTGCATTGAAAAGCTGGAGAATGAAATCCAGCGGCTCTCTGAAGCCCATGAGAGCCTGACAAGGGCCTCTTCCAAGCGTGAGGCCCTGGAGAAGACCATGCGGAATAAGATGGACAGTGAAATGAGGCGGTTGCAGGACTTCAACCGTGATCTTAGAGAGAGATTGGAATCTGCAAACCGCCGCCTGGCAAGCAAGACCCAGGAGGCCCAGGCGGGCAGTCAAGACATGGTGGCCAAGCTGCTTGCTCAGAGCTATGAGCAGCAGCAGGAGCAAGAGAAGCTGGAGCGTGAGATGGCACTGCTGCGCAGTGCAATCGAGGACCAGCGGCGACGGGCCGAGCTGCTCGAGCAGGCTCTGGGCAATGCACAGGGCCGTGCAGCACGAGCGGAGGAAGAGCTGCGAAAGAAGCAGGCCTATGTGGAGAAGGTTGAGCGGCTGCAGCAGGCACTTGGGCAGCTGCAGGCTGCCTGCGAGAAGCGAGAGCAGCTGGAACTACGTCTGCGGACACGCCTGGAGCAAGAACTTAAGGCCCTGCGTGCACAGCAGAGACAGGCAGGCACCCCCAGTGGGGGCAGCAGTAATGGTGGGTCCCCTGAGCTCAGTGCCCTGCGACTGTCAGAACAACTGCGGGAGAAGGAGGAGCAGATCCTTGCACTGGAGGCCGACATGACCAAGTGGGAGCAGAAGTATTTGGAGGAACGTGCCATGAGACAGTTTGCCATGGATGCAGCCGCCACTGCAGCTGCCCAGCGTGACACCACTCTCATCCGACACTCCCCCCAGCCCTCTCCCAGCAGCAGCTTCAATGAGGGCCTACTCACCAGTGGCCACAGGCATCAGGAGATGGAAAGCAGGCTAAAGGTGCTCCATGCCCAGATCCTGGAGAAGGATGCTGTGATCAAGGTCCTTCAGCAGCGCTCCAGGAAGGACCCTGGCAAAGCTGCCCAGGGGTCCCTGCGGCCAGCCAAGTCAGTGCCATCCATCTTCCCGGCTGCAGTGGCAGGGACCCAGGGCTGGCAAGGGCTCTCATCAAGTGAGCGGCAAGCAGATGCTCCTGCCCGGTTGACGATAGACAGGGCACCCATGGAAGAGCCAGTGGTTGCAGCTCCCCTCCCGACCCATGCCAAACATGGGAGTAGAGATGGGAGCACACAGACCGATGGCCCTTCGGAGAGCACCTCTGCTTACCTGACATCAGAGCCCGACAGCCTTCCCAGCTGCAGCAGTGGCCAGAGGGCAGCCTCTCTGGACTCTATAGTTACATCCAGAGTCCAGGACTTGTCGGATATGGTGGAGATACTGATCTAA

XM_004834264.1 Coding sequence

Amotl2 angiomotin like 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 2469 bp    Location: 10713176..10697900   Strand: -
>XM_004834264.1
ATGAGGACCCTGGAAGACTCCTCTGGGACAGTCCTGCACCGCCTCATCCAGGAGCAGCTCCGCTATGGCAACCTGACGGAAACACGTACACTGTTGGCCATCCAGCAGCAGGCCCTTAGGGGTGGGGCTGGAGCTGGGGGCACAGGGAGCCCCCAGGCCTCTCTGGAGATCTTGCCACCCGAGGACAGTCAGGTGCTGCAGCAGGCCACCAGACAGGAGCCCCAGGGCCAGGAGCACCAGGGTGGTGAGACCCACCTGGCAGAGAATACCCTCTACCGGCTGTGCCCACAGCCCAGCAAGGGTGAGGAGCTGCCTACCTATGAGGAGGCCAAAGCCCACTCGCAGTACTATGCAGCCCAGCAGGCAGGGCCACGGCCACACGTCAGCGAACGGGATCCTCGTGGGGCCCCTGGAGGCAGCCGCCGGCAAGATGAGGCCTTACGGGAGCTGAGGCATGGGCACGTGCGCTCGCTGAGTGAACGGCTTCTGCAGCTTTCCCTGGAGAGGAATGGTGCCCGAGTCCCCAGCCACATGAGCTCCTCTCACAGCTTCCCACAGCTGGCTCGAAGCCAGCAGGGCCCTCTACCCCGGGGCCCTCCTGCTGAGGGCCCAGAGACCCGTGGACCCCCACCACAGTACCCCCATGTTATAACCTCTCATGAGACTACTGCTGTCACTGACCCGAGGTACCGCGCCAGAGGTAGCCCGCACTTCCAGCATGCTGAAGTCAGGATCCTGCAGGCCCAAGTACCTCCTGTGTTCCTCCAGCAGCAGCAGCAGTACCAGTACCTGCAACAGCCCCAGGAGCACCCTGCACCCCCACATCCGGCTGTTCTCGGTCATGGGACTCATGGTCTGGGAGTGGAGGGATCAGCAAGTGTCCAGGCCTCCTCAGCCACCGTGGGGAGTCCCCATCTGGCCCAGATGGAAGCTGTGTTGAGGGAGAATGCCAGGCTCCAGAGGGAGCTGGAGAGCTCAGTAGAAAAGGCGAGCTGCATTGAAAAGCTGGAGAATGAAATCCAGCGGCTCTCTGAAGCCCATGAGAGCCTGACAAGGGCCTCTTCCAAGCGTGAGGCCCTGGAGAAGACCATGCGGAATAAGATGGACAGTGAAATGAGGCGGTTGCAGGACTTCAACCGTGATCTTAGAGAGAGATTGGAATCTGCAAACCGCCGCCTGGCAAGCAAGACCCAGGAGGCCCAGGCGGGCAGTCAAGACATGGTGGCCAAGCTGCTTGCTCAGAGCTATGAGCAGCAGCAGGAGCAAGAGAAGCTGGAGCGTGAGATGGCACTGCTGCGCAGTGCAATCGAGGACCAGCGGCGACGGGCCGAGCTGCTCGAGCAGGCTCTGGGCAATGCACAGGGCCGTGCAGCACGAGCGGAGGAAGAGCTGCGAAAGAAGCAGGCCTATGTGGAGAAGGTTGAGCGGCTGCAGCAGGCACTTGGGCAGCTGCAGGCTGCCTGCGAGAAGCGAGAGCAGCTGGAACTACGTCTGCGGACACGCCTGGAGCAAGAACTTAAGGCCCTGCGTGCACAGCAGAGACAGGCAGGCACCCCCAGTGGGGGCAGCAGTAATGGTGGGTCCCCTGAGCTCAGTGCCCTGCGACTGTCAGAACAACTGCGGGAGAAGGAGGAGCAGATCCTTGCACTGGAGGCCGACATGACCAAGTGGGAGCAGAAGTATTTGGAGGAACGTGCCATGAGACAGTTTGCCATGGATGCAGCCGCCACTGCAGCTGCCCAGCGTGACACCACTCTCATCCGACACTCCCCCCAGCCCTCTCCCAGCAGCAGCTTCAATGAGGGCCTACTCACCAGTGGCCACAGGCATCAGGAGATGGAAAGCAGGCTAAAGGTGCTCCATGCCCAGATCCTGGAGAAGGATGCTGTGATCAAGGTCCTTCAGCAGCGCTCCAGGAAGGACCCTGGCAAAGCTGCCCAGGGGTCCCTGCGGCCAGCCAAGTCAGTGCCATCCATCTTCCCGGCTGCAGTGGCAGGGACCCAGGGCTGGCAAGGGCTCTCATCAAGTGAGCGGCAAGCAGATGCTCCTGCCCGGTTGACGATAGACAGGGCACCCATGGAAGAGCCAGTGGTTGCAGCTCCCCTCCCGACCCATGCCAAACATGGGAGTAGAGATGGGAGCACACAGACCGATGGCCCTTCGGAGAGCACCTCTGCTTACCTGACATCAGAGCCCGACAGCCTTCCCAGCTGCAGCAGTGGCCAGAGGGCAGCCTCTCTGGGTGAGCCCCCACTCCCTCCTGACTTCAGTGCTGAGCTGTCTGAGTGTGTGCTGGGGTGTGAGCTGGGATGCCAAGACCCCCTCTTCCCAAATGCTTCCTGGTCACTGCCCACCCTCCACGGGGAGCTCTACATGGTGAAAAGTGAGGAGAGGTCTGGCTTACTCCAGTGTGAGGATGAGGCCTGTTGGTGCATGAGTAGAGGAATTGGAAACCCCGAATGGAGATAG

XM_004834266.1 Coding sequence

Cep63 centrosomal protein 63kDa, transcript variant X1

High confidence: 4 potential gene matches
Length: 2277 bp    Location: 10811119..10861973   Strand: +
>XM_004834266.1
ATGTGGATGAGCCCACTTGCTCTTGCGGAGGGGAGGGCTGGAGAAATTGTTTCCAATAAGAGTACGGAGGCAGGGGGCGGAAGGGACGTGCAGACGCCGGAGGCTGGACATAAAGTTGGCGGTGACGCGCATGCGCGCCTCGGCCCGAGTTGCCACAGCAAAGGGGACTTGGCGATGGAGGCGTTGTTGGAAGGAATAAAAAATCAGGGGCATGGTGGGGGATTTTTGACATCCTGTGAAGCAGAACTACAAGAGCTCATGAAACAGATTGACATAATGGTGGCTCATAAAAAGTCTGAATGGGAAGGGCAGACACATGCTCTGGAAACTTGCCTGGACATCCGTGACCAGGAACTTAAGACCCTTAGGAGTCAGTTGGATATGAAACACAAAGAGGTTGGAATGTTGCATCAGCAGATAGAAGAACATGAAAAAGTCAAGCAAGAGATGGCCATGGAGTATAAGCAGGAGTTAAAGAAATTGCAGGAGGAATTAGGTAGACTGAAGAGAAGCTATGAAAAACTGCAGAAAAAGCAAATACGGGAATTCAGAGGAAGTACCAAAAATCACAAGGAGGATCAGTCTGAGATTGAGAGGTTAAATGGAAAAGTAGAGGAATTTCGTCAGAAATCACTGGACTGGGAGAAGCAGCGCTTGATTTATCAGCAACAGGTATCTTCTCTGGAGGCACAAAGGAAGGCTCTGGCTGAACAGTCAGAGATAATTCAGGCTCAGCTCACCAATAGGAAACAGAAATTAGACTCTGTGGAGTTGTCCAGTCAGTCAGAAATCCAGCACCTGAGCAGTAAGCTTGAGCGGGCCAAGGACACCATCTGTGCCAATGAGTTGGAAATAGAGCGTCTTAACATGAGGGTTAATGACTTGATTGGAACCAATATGACTATTCTGCATGAGCAACGGCAAAAAGAGGAAAAACTGAGAGAATCTGAAAAACTGTTGGAGACTCTGCAGGAAGAAAAGAGAGAATTGAAGGCAAATCTTCAGTATCATGAAAATTTCATGCATGAGGAAAAAAAAATGCAAAAGAAGTTACAAGCAAAAGGAAACAACACCCAACACCTAGTAGACTCCATAAGACCACTGGAGGACTCTCAGGCTGAAAGGAGGATCACCTTTCAAGGGCAAGGGGACTTAGGCAGTGTGCTCTCCCAGTTGGATTTTACCCACACAAGTGAAGAACTCTTGCAAGCAGAGGTGACTCGTCTAGAAGGCAGTTTGGAATCTGTGAGTGCAACATGTAAACAACTGAGCCAAGAGCTAATGGAAAAATATGAAGAATTGAAGAAGATGGAAGGACATAACAATGAGTATAGGGCAGAAATTAAGACGTTGAAAGAACAGATTTTACAAGCTGAACAGACTTACAGCTCTGCATTAGAAGGTATGAAGATGGAAATCTCCCACCTGACTCGGGAGTTACATCAGCGAGATAGCACTATTGCTTCTGCCAAATGTTCTTCCTCAGACATGGAAAAGCAACTCAAAGCAGAGATGCAAAAGGCAGAAGAAAAAGCAGTGGAGCATAAGGAAATTTTGAATCAGTTGGAATCACTCAAATTAGAAAATCATCGTCTTTCTGAAATGGTGATGAAATTGGAATTTGGTTTACATAAGGCAAAAGAAATTTCACTAGCAGACCTTCAGGAGAATTATATTGAGACATTAAATAAATTAGTGTCTGAAAATCAACAACTACAGAAAGATGTAATGCATACCAAATCTCAGCTGGAGATCGCTACACAGATGTGCAAACAAAAAGACAATGTCTTTAAACTGACACTCAGCAGAACAACTCAGTTCAAGAATACGGAATTTAAGCCAACCCATGGCCAGCACAGACATGATGGGATAAAGACTGAGCACTGCAAAACAGGTCTCCACTCTCCAAGAGGACAAGCACCGGATAGCACAGGCCCTGTGTCCAGGGCCTGCAGCCCTCTGAGTCCTCACCTCAGCTCTTGCAGCTCCACCATCTCTTTGCCTTCTTACTTTCTGGGTCAGACTCACTCTTTGCCTTCACTGCTAGATACAAATGATGCCAATTTTTCTGACACTATGTCTGATGGTACGAATGACCAAGAAGAGTTTATATCTTTGTACTCCACGCCTGCATCTCCCCTGGGTTCAATAGCTACCAGATTTCTGGAAGAGGAGGAGCTGAGGTCTCATCATATTCTAGAGCGCCTGGATGCCCATATTGAAGAACTAAAAAGGGAGAGTGAAAAGACAGTGAGACAATTCACAGCCCTGATGTAG

XM_004834268.1 Coding sequence

Cep63 centrosomal protein 63kDa, transcript variant X3

Length: 1794 bp    Location: 10811119..10861973   Strand: +
>XM_004834268.1
ATGTGGATGAGCCCACTTGCTCTTGCGGAGGGGAGGGCTGGAGAAATTGTTTCCAATAAGAGTACGGAGGCAGGGGGCGGAAGGGACGTGCAGACGCCGGAGGCTGGACATAAAGTTGGCGGTGACGCGCATGCGCGCCTCGGCCCGAGTTGCCACAGCAAAGGGGACTTGGCGATGGAGGCGTTGTTGGAAGGAATAAAAAATCAGGGGCATGGTGGGGGATTTTTGACATCCTGTGAAGCAGAACTACAAGAGCTCATGAAACAGATTGACATAATGGTGGCTCATAAAAAGTCTGAATGGGAAGGGCAGACACATGCTCTGGAAACTTGCCTGGACATCCGTGACCAGGAACTTAAGACCCTTAGGAGTCAGTTGGATATGAAACACAAAGAGGTTGGAATGTTGCATCAGCAGATAGAAGAACATGAAAAAGTCAAGCAAGAGATGGCCATGGAGTATAAGCAGGAGTTAAAGAAATTGCAGGAGGAATTAGGTAGACTGAAGAGAAGCTATGAAAAACTGCAGAAAAAGCAAATACGGGAATTCAGAGGAAGTACCAAAAATCACAAGGAGGATCAGTCTGAGATTGAGAGGTTAAATGGAAAAGTAGAGGAATTTCGTCAGAAATCACTGGACTGGGAGAAGCAGCGCTTGATTTATCAGCAACAGGTATCTTCTCTGGAGGCACAAAGGAAGGCTCTGGCTGAACAGTCAGAGATAATTCAGGCTCAGCTCACCAATAGGAAACAGAAATTAGACTCTGTGGAGTTGTCCAGTCAGTCAGAAATCCAGCACCTGAGCAGTAAGCTTGAGCGGGCCAAGGACACCATCTGTGCCAATGAGTTGGAAATAGAGCGTCTTAACATGAGGGTTAATGACTTGATTGGAACCAATATGACTATTCTGCATGAGCAACGGCAAAAAGAGGAAAAACTGAGAGAATCTGAAAAACTGTTGGAGACTCTGCAGGAAGAAAAGAGAGAATTGAAGGCAAATCTTCAGTATCATGAAAATTTCATGCATGAGGAAAAAAAAATGCAAAAGAAGTTACAAGCAAAAGGAAACAACACCCAACACCTAGTAGACTCCATAAGACCACTGGAGGACTCTCAGGCTGAAAGGAGGATCACCTTTCAAGGGCAAGGGGACTTAGGCAGTGTGCTCTCCCAGTTGGATTTTACCCACACAAGTGAAGAACTCTTGCAAGCAGAGGTGACTCGTCTAGAAGGCAGTTTGGAATCTGTGAGTGCAACATGTAAACAACTGAGCCAAGAGCTAATGGAAAAATATGAAGAATTGAAGAAGATGGAAGGACATAACAATGAGTATAGGGCAGAAATTAAGACGTTGAAAGAACAGATTTTACAAGCTGAACAGACTTACAGCTCTGCATTAGAAGGTATGAAGATGGAAATCTCCCACCTGACTCGGGAGTTACATCAGCGAGATAGCACTATTGCTTCTGCCAAATGTTCTTCCTCAGACATGGAAAAGCAACTCAAAGCAGAGATGCAAAAGGCAGAAGAAAAAGCAGTGGAGCATAAGGAAATTTTGAATCAGTTGGAATCACTCAAATTAGAAAATCATCGTCTTTCTGAAATGGTGATGAAATTGGAATTTGGTTTACATAAGTACTCCACGCCTGCATCTCCCCTGGGTTCAATAGCTACCAGATTTCTGGAAGAGGAGGAGCTGAGGTCTCATCATATTCTAGAGCGCCTGGATGCCCATATTGAAGAACTAAAAAGGGAGAGTGAAAAGACAGTGAGACAATTCACAGCCCTGATGTAG

XM_004834267.1 Coding sequence

Cep63 centrosomal protein 63kDa, transcript variant X2

Length: 1872 bp    Location: 10811119..10861593   Strand: +
>XM_004834267.1
ATGTGGATGAGCCCACTTGCTCTTGCGGAGGGGAGGGCTGGAGAAATTGTTTCCAATAAGAGTACGGAGGCAGGGGGCGGAAGGGACGTGCAGACGCCGGAGGCTGGACATAAAGTTGGCGGTGACGCGCATGCGCGCCTCGGCCCGAGTTGCCACAGCAAAGGGGACTTGGCGATGGAGGCGTTGTTGGAAGGAATAAAAAATCAGGGGCATGGTGGGGGATTTTTGACATCCTGTGAAGCAGAACTACAAGAGCTCATGAAACAGATTGACATAATGGTGGCTCATAAAAAGTCTGAATGGGAAGGGCAGACACATGCTCTGGAAACTTGCCTGGACATCCGTGACCAGGAACTTAAGACCCTTAGGAGTCAGTTGGATATGAAACACAAAGAGGTTGGAATGTTGCATCAGCAGATAGAAGAACATGAAAAAGTCAAGCAAGAGATGGCCATGGAGTATAAGCAGGAGTTAAAGAAATTGCAGGAGGAATTAGGTAGACTGAAGAGAAGCTATGAAAAACTGCAGAAAAAGCAAATACGGGAATTCAGAGGAAGTACCAAAAATCACAAGGAGGATCAGTCTGAGATTGAGAGGTTAAATGGAAAAGTAGAGGAATTTCGTCAGAAATCACTGGACTGGGAGAAGCAGCGCTTGATTTATCAGCAACAGGTATCTTCTCTGGAGGCACAAAGGAAGGCTCTGGCTGAACAGTCAGAGATAATTCAGGCTCAGCTCACCAATAGGAAACAGAAATTAGACTCTGTGGAGTTGTCCAGTCAGTCAGAAATCCAGCACCTGAGCAGTAAGCTTGAGCGGGCCAAGGACACCATCTGTGCCAATGAGTTGGAAATAGAGCGTCTTAACATGAGGGTTAATGACTTGATTGGAACCAATATGACTATTCTGCATGAGCAACGGCAAAAAGAGGAAAAACTGAGAGAATCTGAAAAACTGTTGGAGACTCTGCAGGAAGAAAAGAGAGAATTGAAGGCAAATCTTCAGTATCATGAAAATTTCATGCATGAGGAAAAAAAAATGCAAAAGAAGTTACAAGCAAAAGGAAACAACACCCAACACCTAGTAGACTCCATAAGACCACTGGAGGACTCTCAGGCTGAAAGGAGGATCACCTTTCAAGGGCAAGGGGACTTAGGCAGTGTGCTCTCCCAGTTGGATTTTACCCACACAAGTGAAGAACTCTTGCAAGCAGAGGTGACTCGTCTAGAAGGCAGTTTGGAATCTGTGAGTGCAACATGTAAACAACTGAGCCAAGAGCTAATGGAAAAATATGAAGAATTGAAGAAGATGGAAGGACATAACAATGAGTATAGGGCAGAAATTAAGACGTTGAAAGAACAGATTTTACAAGCTGAACAGACTTACAGCTCTGCATTAGAAGGTATGAAGATGGAAATCTCCCACCTGACTCGGGAGTTACATCAGCGAGATAGCACTATTGCTTCTGCCAAATGTTCTTCCTCAGACATGGAAAAGCAACTCAAAGCAGAGATGCAAAAGGCAGAAGAAAAAGCAGTGGAGCATAAGGAAATTTTGAATCAGTTGGAATCACTCAAATTAGAAAATCATCGTCTTTCTGAAATGGTGATGAAATTGGAATTTGGTTTACATAAGGCAAAAGAAATTTCACTAGCAGACCTTCAGGAGAATTATATTGAGACATTAAATAAATTAGTGTCTGAAAATCAACAACTACAGAAAGATGTAATGCATACCAAATCTCAGCTGGAGATCGCTACACAGATGTGCAAACAAAAAGACAATGTCTTTAAACTGACACTCAGCAGAACAACTCAGTTCAAGAATACGGAATTTAATACTCCACGCCTGCATCTCCCCTGGGTTCAATAG

XM_004834273.1 Coding sequence

Ky kyphoscoliosis peptidase

High confidence: 4 potential gene matches
Length: 1986 bp    Location: 10955472..10908923   Strand: -
>XM_004834273.1
ATGGAGCTGAAGAAGGACAGCAACGCCGTGGCCATCGACATGCTGCTGATCGTGCATTCGGAGAAGCTGCGCGCCGCGGAGGGCACGCACTTGAACCCGCAGGCGGAGCCCGACTCGCGCCTGCAGCGCGGAGGAGGATTCCAAGGTGTCAGCAATGGGACCCGGAAATGGCAGAAATTAGAAGGAAATGACCTTCATGGAAACCTGGCAGAGAAGCAGCACCGTCAGCAGCCCCAGGTCATCACTTCCTATGACAACCAAGGGACACAGCTGACTGTGGAGGTCCACCCTCGAGATGCCATGCCCCAGTTTCTCAAGAAGTTCTCCTTGGCTAAACGTTTACAAGGTGATAAAAATGGAAACACAAGACCCCGGCAGCCTGGAAACAAAGACGCCCATGCCTACCCCTGGGATCGGTCCAGCCTAAAGTCCATGCCCCTGGACCTGCAGCAGTTTGAAAAAGTGGACACCTATGCCTCACAGGTGACAGTCAAGAGTGGCCTGGATGAACTGGTGAGTGACCTGCTCCAGGAGGCCCACAGTGATCTAGAAAGGGTCCGAGCCATCTGGATCTGGATATGCCATCATATAGAGTATGACATTGAGGCTGCCCAGGAGAAGGATCGACAGGCCTTCAAGCCCACTGACATCCTGCGGACCCAGAAGACCAACTGTGATGGCTATGCTGGCCTCTTTGAAAGAATGTGCAGGATTGCTGATGTCCAGTGCATGACAGTGCCCGGTTATTCCAAGGGCTTCGGCTACCAGACAGGGCAGAGCTTCTCTGGAGAGTTTGACCACGCCTGGAACGCTGTGTACCTGGAGGGCAGGTGGCACCTGCTGGACAGCACCTGGGGCAGCGGCCTGGTGGACAAGGCCACCTCAAAATTCACGTTCCTCTACAACGAGTTCTACTTCCTCACCCATCCCGCACTGTTCATTGAGGACCACTTCCCAGACAACAAGAACTGGCAACTGCTAAAGCCTCCTCAGTCTCTGAGGCAGTTTGAGAACAGCATGTATCACAAGAGTGAGTTCTACAACAAGGGGATGCTGAGTGCCCACCCGGACGTGTCCATGATCAGAACAGTGAATGGGAAGGCTACGATCACCATTGAGAGCTGTGCCCCAACGCTGTTCATGTTCATGCTCAACGGAAAGCAGGAACATGGGCTACTGAACCTCCGGAAGAATGGGATGAAGCTAGAGGTGTACCCTCCAACCATGGGCACCCATAAGCTGCAGATTTTTGCCAAGGGCAACTCAGACATCTACAGCTCAGTGCTGGAGTACACAGTCAACTGCAACTACGTAGACCTGGGGGTCCAGCTGCCAGCTGAGCTACACCAGCCTGTGGGCCCCAGCTGGTTCTCGGAGCAGATGGGGATCCTGAAGCCCTCGCACCCTGACCCTGTCATCCACACCAGGGATGGACGCTGCTCCATCAGCTTCGGCGTGGAGGAGGGCATCAGTGTCCTGGCTTCCCTGCATGGAGATGATGCCCTCATCACTGAGGAGACACAGCGGCGCTATATCTTCCAACTGCACCGGGAGAAACGGATTGAACTGAAAGTCCAGCTGCCCCATGCCGGCAAGTTTGCCCTCAAGATCTTTGTCAAGAAGAGGCAGGAACCGGGCAACTACATCTTCGTCTTCAATTACCTCCTGTGCTGTGCCAACACCAAGGTGAACTGGCCTGTGTTCCCTGAGAGCTTTGGCAACTGGGGACAGGACAATGAGCTGCTGGAACCTCTGTCCGGTGTGCTTCCCGCCAACCGGAATGTCCCGTTCAAACTGAAGCTGCATGGTATCGCCAAAGCCCTGGTGAAGGGGCAGGACACATGGCCCCTGACCCTGAATCACGAGGGCTACTGGGAAGGCAGCTGCAGCACAGCCGGCTGCCAGGAGGTCTACGTCATGGTGCTGGAGAACGCCAACCACAACTTCTACTCCTACATCCTGAAGTACAGAGTGAACACCCAGTGA

XM_004834276.1 Coding sequence

Ppp2r3a protein phosphatase 2, regulatory subunit B'', alpha, transcript variant X2

High confidence: 4 potential gene matches
Length: 3459 bp    Location: 12384705..12567678   Strand: +
>XM_004834276.1
ATGGCAGCAACTTACCGACTTGTAGTTAGTACTGTGAACCACTACAGCAGTGTGGTAATAGATCGACGTTTTGAGCAAGCTATACATTATTGCACTGGAACCTGCCACACTTTCACACATGGAGTTGACTGCATTGTGGTACATCATAGTGTTTGTGCAGACCTCTTGCACATCCCTGTGCCTCAGTTCAAAGATGCAGATCTGAATTCTGTGTTTCTACCCCATGAAAATGGGCTTTCCTCAGCTGAAGGTGACTATCCCCATCAGGTCCTTACAGGCATACCTAGAGTCAAGAGAACTTCTACATTTCAGAATAGCTGTAACTTAAAGGACATTGCAGGAGAAGCAATCAATTTTGCCAGTGGAAAAATAAAGGAATTTTCCTTTGAAAAACTAAAAAACTCTAACCATGTGGCTTACAAAAAGGGAAGGAAAGTTAAGTCTGACTCATTTAATAGACGGTCAATTGACTTTGACTTGCTCTGTGGCCATTATAACAATGATGAGACCTCTCCATCCTTTGGTTTACTCCGGAGTTCTTCGGTTGAGGAAAAATCTTTGTCCCATAGAAACTCACTTGAGACAAACTTAACTTCAATGCTTCTTCAAAACTTCTCTGAAGAAGACCTGGTTACTCAGATTTTGCAAAGACATAAAATAAATAATTTTTCTTCTGCCACAGACATAAAAATGTGTTTAGACATCTTACTGAAATGCTCTGAGGATTTGAAAAAATGCACAGACATCATAAAACAATGCATAAAGAAAAAGTCAGGAGGTACCATCAGCGAAGAAAGTGGTAATGATACTATTCCTAGTTCTGAAACTGTCTATATGAATGTAATGACCAGGTTAGCATCCTACCTGAAAAAGTTACCATTTGAATTCATGCAATCTGAAAATAATGAGTCCATAGATTTAACAGAACTAGTCAGTAATATGCCTAGTTTACAGTTAACTCCCTTCTCACCAATATATGGCACTGAACAGCCCCCTAAATATGAAGATGTTGTCCAGCTCTCAGCCCCTAACTCTGGGCAATTTCAAACTATTGAATTGCAAGATGACAAGCATAATTCTAGGAAAATGGACATTGTAAAAACCATTCCAAACAACTCTACAAATTCCTTATATAGCTTGGGAGTAAATGATCTCAGAACTTTAAAAGCTGCCCAGCTTCAGTCACCATCATTAACCATGAACCCTGTGGAGAATGTTTCTTCTGGAGACTTAATGGAAACTCTTTATATTGAAGAAGAGTCAGATGGAAAGAAGGCATTATTAAATAAAGGAGAAAAGACAGAGAATGGACCCAGTCACAAGTTGTTAAAAGTAAATGAACATAGTGCAGAATTTTCAGACCATGGTACTCATCTTAAAAATTCTTGTGCCACAATACAAAATGAAATTGGTAAGATATTTGAGAAACCAATTTTTCATCCAGCTGAAGAAGACCCTAAATCAAAAGTTCCTAAAGTGGAAACAGGAGACCAGGGAAACTTTATTAACTCCAACAGTCAGAAAGAGATAGATAAATTGTTAATGGATTTGGAATCATTTTCACAGAAGATGGAGACCTCTCTAAGAGAGCCACTTGGCAAGGGTAAAAACTCCAGTTCTCTAAATAGTCACGGTCATTTGACTAGTCAGCTCCCTGTAGACACTGAACCTAAATCTAAAGTCTCTTCACCTGTGGAAAAAGTCTCACCTTCTTGTCTATCAAGAATTATTGAAACCAATGGACACAAAATAGAGGAAGAGGATCGAGCCCTCTTGCTGCGAATTCTGGAAAGTATTGAAGATTTTGCTCAAGAACTAGTTGACTGCAAATCAGGCAGAGGTAGCCTATCTCAGGAAAAAGAAATGATGCAAATTCTCCAGGAAACCTTGACAACTTCCTCTAAGGCCAATTTATCAGTCTGTAAGGGTCCTGTTGGTGATAAACCCAAAGACACTACTTCAATGGTTTTGATTCAGCAGACTCCAGAAGTGATCAAGATTCAAAATAAACCAGAAAAGAAACCTGAAATACCACTTCCATCTCCAGCCACCTTTTCAAGTAGTCCCCAACCTCATTCTCCTATTCCTGCTGTGAATAATGTTGTGAATCCACCATTATCCATAAACATTCCACGGTTCTACTTTCCTGAAGGACTCCCAGATACTTGCGGTAACCATGAACAGACTCTAAGCAAAATTGAAACTGCTTTTATGGATATTGAAGATCAGAAAGCAAACATTTGTGAAATAGGGAAGATCGCAAAGATCTGTGGCTGTCCTCTCTATTGGAAAGCCCCCATGTTTAGGGCTGCAGGGGGTGAGAAGACAGGATTTGTGTCAGCACAATCATTCACTACTGTGTGGAGGAGGTTGCTGAATAACCATCATGATGATGCCTCTAAGTTCATCTATCTTCTGGCAAAACCTGGCTGCAGCTCTCTAGAACAAGAAGATTTTGTCCCTTTACTTCAGGATGTGGTGGATACACACCCTGGCCTTACGTTCCTGAAAGATGCTCCCGAATTCCACTCCCGCTACATCACCACAGTTATTCAGAGAATATTCTACACAGTCAACAGATCTTGGAGTGGAAAAATTACTTCAACAGAGATAAGAAAAAGCAACTTTTTGCAAACTCTAGCCCTTTTGGAAGAAGAAGAAGATATAAATCAAATCACAGATTACTTCTCCTATGAACATTTTTATGTTATTTATTGTAAATTCTGGGAACTAGATAGTGATCATGACCTGTACATCAGCCAAGCAGATCTCTCTCGATACAATGACCAGGCTTCATCAAATAGAATAATTGAAAGAATATTCTCTGGGGCAGTAACAAGAGGAAAAACTGTGCAGAAAGAGGGAAGAATGAGCTATGCAGATTTTGTTTGGTTTTTGATCTCTGAGGAAGACAAAAGGAACCCCACCAGCATTGAGTACTGGTTCCGCTGCATGGATGTGGATGGAGATGGAGTGCTCTCCATGTATGAGCTGGAATACTTCTATGAGGAGCAATGTGAACGGATGGAAGCCATGGGCATTGAGCCCTTGCCGTTTCATGATCTGCTTTGCCAGATGCTTGACCTGGTGAAGCCAGCCTGTGATGGCAAAATAACTCTACGAGATCTGAAGAGGTGCCGAATGGCTCACATCTTCTATGACACTTTCTTTAATCTGGAAAAATACTTGGACCATGAACAGAGAGATCCCTTTGCAGTCCAGAAGGATGTTGAGAACGATGGGCCTGAGCCTTCAGACTGGGACAGGTTTGCTTCGGAGGAGTACGAGACTCTTGTTGCAGAGGAATCTGCCCAAGCACAGCTCCAGGAAGGCTCCTTTGAAGATTATGAGACAGACGAACCTGCTTCTCCCTCTGAATTTGGAAACAAAGGCAATAAAGCAGTAACTTCAAGCCTTTCCGAACAATGTGGAAAGCTTCAGTCAGTGGATGAAGAGTAG

XM_004834277.1 Coding sequence

Ppp2r3a protein phosphatase 2, regulatory subunit B'', alpha, transcript variant X3

Length: 1593 bp    Location: 12446709..12567678   Strand: +
>XM_004834277.1
ATGATGATCAAGGAAACATCTTTACGAAGGGACCCGGATTTAAGGGGAGAGTTAGCTTTCCTGGCAAGGGGCTGTGATTTTGTTCTCCCGTCACGGTTTAAGAAGCGGTTGAAGTCATTTCAGCAAACACAGATTCAAAATAAACCAGAAAAGAAACCTGAAATACCACTTCCATCTCCAGCCACCTTTTCAAGTAGTCCCCAACCTCATTCTCCTATTCCTGCTGTGAATAATGTTGTGAATCCACCATTATCCATAAACATTCCACGGTTCTACTTTCCTGAAGGACTCCCAGATACTTGCGGTAACCATGAACAGACTCTAAGCAAAATTGAAACTGCTTTTATGGATATTGAAGATCAGAAAGCAAACATTTGTGAAATAGGGAAGATCGCAAAGATCTGTGGCTGTCCTCTCTATTGGAAAGCCCCCATGTTTAGGGCTGCAGGGGGTGAGAAGACAGGATTTGTGTCAGCACAATCATTCACTACTGTGTGGAGGAGGTTGCTGAATAACCATCATGATGATGCCTCTAAGTTCATCTATCTTCTGGCAAAACCTGGCTGCAGCTCTCTAGAACAAGAAGATTTTGTCCCTTTACTTCAGGATGTGGTGGATACACACCCTGGCCTTACGTTCCTGAAAGATGCTCCCGAATTCCACTCCCGCTACATCACCACAGTTATTCAGAGAATATTCTACACAGTCAACAGATCTTGGAGTGGAAAAATTACTTCAACAGAGATAAGAAAAAGCAACTTTTTGCAAACTCTAGCCCTTTTGGAAGAAGAAGAAGATATAAATCAAATCACAGATTACTTCTCCTATGAACATTTTTATGTTATTTATTGTAAATTCTGGGAACTAGATAGTGATCATGACCTGTACATCAGCCAAGCAGATCTCTCTCGATACAATGACCAGGCTTCATCAAATAGAATAATTGAAAGAATATTCTCTGGGGCAGTAACAAGAGGAAAAACTGTGCAGAAAGAGGGAAGAATGAGCTATGCAGATTTTGTTTGGTTTTTGATCTCTGAGGAAGACAAAAGGAACCCCACCAGCATTGAGTACTGGTTCCGCTGCATGGATGTGGATGGAGATGGAGTGCTCTCCATGTATGAGCTGGAATACTTCTATGAGGAGCAATGTGAACGGATGGAAGCCATGGGCATTGAGCCCTTGCCGTTTCATGATCTGCTTTGCCAGATGCTTGACCTGGTGAAGCCAGCCTGTGATGGCAAAATAACTCTACGAGATCTGAAGAGGTGCCGAATGGCTCACATCTTCTATGACACTTTCTTTAATCTGGAAAAATACTTGGACCATGAACAGAGAGATCCCTTTGCAGTCCAGAAGGATGTTGAGAACGATGGGCCTGAGCCTTCAGACTGGGACAGGTTTGCTTCGGAGGAGTACGAGACTCTTGTTGCAGAGGAATCTGCCCAAGCACAGCTCCAGGAAGGCTCCTTTGAAGATTATGAGACAGACGAACCTGCTTCTCCCTCTGAATTTGGAAACAAAGGCAATAAAGCAGTAACTTCAAGCCTTTCCGAACAATGTGGAAAGCTTCAGTCAGTGGATGAAGAGTAG

XM_004834278.1 Coding sequence

Msl2 male-specific lethal 2 homolog (Drosophila)

High confidence: 4 potential gene matches
Length: 1734 bp    Location: 12618897..12569722   Strand: -
>XM_004834278.1
ATGAACCCGGTGAATGCTACTGCTCTTTACATTTCCGCGAGCCGCCTAGTGCTCAACTACGACCCCGGAGACCCCAAGGCGTTTACAGAGATTAACAGGCTCTTGCCTTACTTCCGACAGTCCCTCTCGTGCTGTGTTTGCGGTCATTTGCTGCAAGATCCAATTGCACCCACCAACTCCACCTGCCAACATTATGTCTGCAAAACTTGTAAAGGCAAGAAAATGATGATGAAACCTTCATGTAGCTGGTGCAAAGACTATGAGCAGTTTGAGGAAAACAAGCAGTTAAGCATTCTAGTGAATTGCTACAAAAAGCTATGTGAATATATAACACAGACTACACTTGCACGGGATATTATAGAAGCAGTTGACTGTTCTTCAGATATTTTGGCTTTGCTTAATGATGGATCATTGTTTTGTGAGGAGACAGAAAAACCCTCAGATTCATCCTTTACTTTGTGTTTGACACATTCCCCTTTACCTTCAACCTCCGAACCCACAACTGATCCTCAAGCTAGTTTATCTCCAATGTCTGAAAGCACCCTAAGCATTGCTATTGGCAGTTCTGTTATCAATGGTTTGCCTACTTATAATGGGCTTTCAATAGATAGATTTGGTATAAATATTCCTTCACCTGAACATTCAAATACGATTGATGTATGTAATACTGTTGACATAAAAACTGAGGATCTATCTGATAGCCTGCCACCTGTCTGTGACACAGTAGCCACTGATTTATGCTCCACGGGCATTGATATCTGCAGTTTCAGTGAAGATATAAAACCTGGTGACTCTTTGTTACTGAGTGTTGAGGAAGTACTCCGCAGCTTAGAAACTGTTTCAAATACAGAAGTTTGTTGTCCTAATTTGCAGCCGAACTTGGAAGCCACTGTATCCAATGGGCCTTTTTTGCAGCTTTCTTCCCAGTCTCTTAGCCATAATGTCTTTATGTCCACCAGTCCTGCACTTCATGGGTTATCATGTACAGCAGCAACTCCGAAAGCAGCAAAATTGAATAGAAAACGGTCCAGATCAGAAAGCGACAGTGAGAAAGTTCAGCCACTTCCAATTTCTACCATTATCCGAGGCCCAACATTAGGGGCATCTGCTCCTGTGACAGTGAAACGGGAAAGCAAAATTTCTCTTCAACCTATAGCAACTGTTCCCAATGGAGGCACAACACCCAAAATCAGCAAAACCGTACTTTTGTCTACTAAAAGCATGAAAAAGACTCATGAACATGGATCCAAGAAATCTCACTCTAAAACCAAGCCAGGTATTCTAAAAAAAGACAAAGCAGTAAAGGAAAAGATTCCTAGTCATCATTTTATGCCAGGAAGTCCTACCAAGACTGTGTACAAAAAGCCCCAGGAAAAGAAAGGGTGTAAATGTGGGCGTGCTACTCAAAATCCAAGTGTTCTTACATGCCGTGGCCAACGCTGCCCTTGCTACTCTAACCGCAAAGCCTGCTTAGATTGTATATGTCGTGGCTGCCAAAACTCCTATATGGCCAATGGGGAGAAGAAGCTGGAGGCATTTGCCGTGCCGGAAAAGGCCTTGGAGCAGACCAGGCTCACTTTGGGCATTAATGTGACTAGCATTGCTGTGCGTAATGCTAGTACCAGCACCAGTGTAATTAATGTCACAGGGTCCCCAGTAACGACGTTTTTAGCTGCCAGTACTCATGATGATAAAAGTTTGGATGAAGCTATAGACATGAGATTCGACTGTTAA

XM_004834282.1 Coding sequence

Pccb propionyl CoA carboxylase, beta polypeptide, transcript variant X1

Length: 1680 bp    Location: 12662465..12811110   Strand: +
>XM_004834282.1
ATGGCTGCAGCAATGCGAGTGGCGGCGGCTGGAGCTAGGCTCAGCATTCTATCTAGTGGTCTCCGCGCCGCGGTCCGCAGCCTTTGCACCCAAGGCGCCTCCGTTAACGAACGTATCGAGAATAAGCGAAGCGCCGCGCTGCTGGGAGGAGGCCAGCGCCGCATTGAAGCTCAGCATAAGCGAGGAAAACTGACTGCCAGGGAGCGGATCAGTCTCTTGCTGGACCCTGGCAGCTTTGTTGAGAGTGACATGTTTGTGGAACACACATGTGCAGATTTCGGAATGGCTGCTGATAAGAATAAGTTTCCTGGAGACAGCGTGGTCACTGGAAGGGGCCGGATCAATGGAAGATTGGTTTATGTCTTCAGTCAGGATTTCACGGTTTTTGGGGGCAGTCTGTCAGGAGCACATGCTCAGAAGATCTGCAAAATCATGGACCAGGCCATAACTGTGGGTGCTCCAGTGATTGGGCTGAATGACTCTGGGGGAGCCCGGATCCAAGAGGGAGTGGAGTCCTTGGCTGGCTATGCTGACATCTTCCTGAGAAATGTCACAGCATCCGGAGTCATCCCTCAGATCTCTCTGATCATGGGCCCGTGTGCTGGTGGGGCCGTCTACTCTCCAGCCCTAACAGACTTCACGTTCATGGTGAAGGACACCTCCTACTTGTTTATCACGGGCCCTGATGTGGTGAAGTCTGTTACCAATGAGGATGTCACCCAGGAGGAGCTTGGTGGTGCCAAGACCCACACCACCATGTCAGGTGTGGCCCACAGGGCTTTTGAGAATGATGTGGATGCCCTGTGTAACCTCCGGGAGTTCTTCAACTACCTACCCCTCAGCTGTCAGGACCTGGCTCCTGTCCGCGAGTGCCATGATCCCAGTGACCGTCTGGTTCCTGAGCTTGACACAATTGTCCCTCTGGAATCTACCAAAGCCTACAACATGCTGGATATCATACACTCGGTTGTTGATGAGCGAGAATTTTTTGAGATCATGCCCAATTATGCCAAGAATATCGTTGTTGGTTTTGCAAGAATGAATGGGAGGACTGTTGGAATTGTTGGTAACCAACCCAAGGTGGCCTCAGGATGCTTGGATATTAATTCATCTGTGAAGGGGGCTCGATTTGTCAGATTCTGTGATGCATTCAATATTCCACTCATCACTTTTGTTGATGTCCCTGGCTTTCTGCCTGGCACAGCACAGGAATATGGGGGCATCATCCGGCATGGCGCCAAGCTTCTCTATGCATTTGCCGAGGCAACTGTGCCCAAAGTCACAATCATCACCAGGAAGGCCTATGGAGGTGCCTATGATGTCATGAGCTCTAAGCACCTTCTTGGTGACACCAACTATGCCTGGCCCACAGCAGAAATTGCAGTCATGGGAGCAAAGGGTGCTGTGGAGATCATCTTCAAAGGGCATGAGGATGTGGACGCTGCCCAGGCAGAGTATGTTGAGAAGTTCGCCAACCCTTTTCCTGCAGCAGTGAGAGGGTTTGTGGATGACATCATACAGCCTTCTTCTACACGTGCCCGAATCTGCTGTGACTTGGATGTCTTGGCCAGCAAGAAGAAGGAGCTGAAGGAAGAAGGATGTTTTCTGCTACAGAGAAGAGAAACTGAAGGCTGCTTCTACAGGACCAGCACTAGGGGGCACCGGAGCAAAGTGTACTGA

XM_004834287.1 Coding sequence

Pccb propionyl CoA carboxylase, beta polypeptide, transcript variant X6

Length: 1491 bp    Location: 12662465..12811110   Strand: +
>XM_004834287.1
ATGGCTGCAGCAATGCGAGTGGCGGCGGCTGGAGCTAGGCTCAGCATTCTATCTAGTGGTCTCCGCGCCGCGGTCCGCAGCCTTTGCACCCAAGGCGCCTCCGTTAACGAACGTATCGAGAATAAGCGAAGCGCCGCGCTGCTGGGAGGAGGCCAGCGCCGCATTGAAGCTCAGCATAAGCGAGATTTCACGGTTTTTGGGGGCAGTCTGTCAGGAGCACATGCTCAGAAGATCTGCAAAATCATGGACCAGGCCATAACTGTGGGTGCTCCAGTGATTGGGCTGAATGACTCTGGGGGAGCCCGGATCCAAGAGGGAGTGGAGTCCTTGGCTGGCTATGCTGACATCTTCCTGAGAAATGTCACAGCATCCGGAGTCATCCCTCAGATCTCTCTGATCATGGGCCCGTGTGCTGGTGGGGCCGTCTACTCTCCAGCCCTAACAGACTTCACGTTCATGGTGAAGGACACCTCCTACTTGTTTATCACGGGCCCTGATGTGGTGAAGTCTGTTACCAATGAGGATGTCACCCAGGAGGAGCTTGGTGGTGCCAAGACCCACACCACCATGTCAGGTGTGGCCCACAGGGCTTTTGAGAATGATGTGGATGCCCTGTGTAACCTCCGGGAGTTCTTCAACTACCTACCCCTCAGCTGTCAGGACCTGGCTCCTGTCCGCGAGTGCCATGATCCCAGTGACCGTCTGGTTCCTGAGCTTGACACAATTGTCCCTCTGGAATCTACCAAAGCCTACAACATGCTGGATATCATACACTCGGTTGTTGATGAGCGAGAATTTTTTGAGATCATGCCCAATTATGCCAAGAATATCGTTGTTGGTTTTGCAAGAATGAATGGGAGGACTGTTGGAATTGTTGGTAACCAACCCAAGGTGGCCTCAGGATGCTTGGATATTAATTCATCTGTGAAGGGGGCTCGATTTGTCAGATTCTGTGATGCATTCAATATTCCACTCATCACTTTTGTTGATGTCCCTGGCTTTCTGCCTGGCACAGCACAGGAATATGGGGGCATCATCCGGCATGGCGCCAAGCTTCTCTATGCATTTGCCGAGGCAACTGTGCCCAAAGTCACAATCATCACCAGGAAGGCCTATGGAGGTGCCTATGATGTCATGAGCTCTAAGCACCTTCTTGGTGACACCAACTATGCCTGGCCCACAGCAGAAATTGCAGTCATGGGAGCAAAGGGTGCTGTGGAGATCATCTTCAAAGGGCATGAGGATGTGGACGCTGCCCAGGCAGAGTATGTTGAGAAGTTCGCCAACCCTTTTCCTGCAGCAGTGAGAGGGTTTGTGGATGACATCATACAGCCTTCTTCTACACGTGCCCGAATCTGCTGTGACTTGGATGTCTTGGCCAGCAAGAAGAAGGAGCTGAAGGAAGAAGGATGTTTTCTGCTACAGAGAAGAGAAACTGAAGGCTGCTTCTACAGGACCAGCACTAGGGGGCACCGGAGCAAAGTGTACTGA

XM_004834285.1 Coding sequence

Pccb propionyl CoA carboxylase, beta polypeptide, transcript variant X4

High confidence: 4 potential gene matches
Length: 1620 bp    Location: 12662469..12758702   Strand: +
>XM_004834285.1
ATGGCTGCAGCAATGCGAGTGGCGGCGGCTGGAGCTAGGCTCAGCATTCTATCTAGTGGTCTCCGCGCCGCGGTCCGCAGCCTTTGCACCCAAGGCGCCTCCGTTAACGAACGTATCGAGAATAAGCGAAGCGCCGCGCTGCTGGGAGGAGGCCAGCGCCGCATTGAAGCTCAGCATAAGCGAGGAAAACTGACTGCCAGGGAGCGGATCAGTCTCTTGCTGGACCCTGGCAGCTTTGTTGAGAGTGACATGTTTGTGGAACACACATGTGCAGATTTCGGAATGGCTGCTGATAAGAATAAGTTTCCTGGAGACAGCGTGGTCACTGGAAGGGGCCGGATCAATGGAAGATTGGTTTATGTCTTCAGTCAGGATTTCACGGTTTTTGGGGGCAGTCTGTCAGGAGCACATGCTCAGAAGATCTGCAAAATCATGGACCAGGCCATAACTGTGGGTGCTCCAGTGATTGGGCTGAATGACTCTGGGGGAGCCCGGATCCAAGAGGGAGTGGAGTCCTTGGCTGGCTATGCTGACATCTTCCTGAGAAATGTCACAGCATCCGGAGTCATCCCTCAGATCTCTCTGATCATGGGCCCGTGTGCTGGTGGGGCCGTCTACTCTCCAGCCCTAACAGACTTCACGTTCATGGTGAAGGACACCTCCTACTTGTTTATCACGGGCCCTGATGTGGTGAAGTCTGTTACCAATGAGGATGTCACCCAGGAGGAGCTTGGTGGTGCCAAGACCCACACCACCATGTCAGGTGTGGCCCACAGGGCTTTTGAGAATGATGTGGATGCCCTGTGTAACCTCCGGGAGTTCTTCAACTACCTACCCCTCAGCTGTCAGGACCTGGCTCCTGTCCGCGAGTGCCATGATCCCAGTGACCGTCTGGTTCCTGAGCTTGACACAATTGTCCCTCTGGAATCTACCAAAGCCTACAACATGCTGGATATCATACACTCGGTTGTTGATGAGCGAGAATTTTTTGAGATCATGCCCAATTATGCCAAGAATATCGTTGTTGGTTTTGCAAGAATGAATGGGAGGACTGTTGGAATTGTTGGTAACCAACCCAAGGTGGCCTCAGGATGCTTGGATATTAATTCATCTGTGAAGGGGGCTCGATTTGTCAGATTCTGTGATGCATTCAATATTCCACTCATCACTTTTGTTGATGTCCCTGGCTTTCTGCCTGGCACAGCACAGGAATATGGGGGCATCATCCGGCATGGCGCCAAGCTTCTCTATGCATTTGCCGAGGCAACTGTGCCCAAAGTCACAATCATCACCAGGAAGGCCTATGGAGGTGCCTATGATGTCATGAGCTCTAAGCACCTTCTTGGTGACACCAACTATGCCTGGCCCACAGCAGAAATTGCAGTCATGGGAGCAAAGGGTGCTGTGGAGATCATCTTCAAAGGGCATGAGGATGTGGACGCTGCCCAGGCAGAGTATGTTGAGAAGTTCGCCAACCCTTTTCCTGCAGCAGTGAGAGGGTTTGTGGATGACATCATACAGCCTTCTTCTACACGTGCCCGAATCTGCTGTGACTTGGATGTCTTGGCCAGCAAGAAGGTACAGCGTCCTTGGAGGAAACATGCGAATATTCCGTTGTAA

XM_004834280.1 Coding sequence

Stag1 stromal antigen 1, transcript variant X2

Length: 3870 bp    Location: 13159746..12762564   Strand: -
>XM_004834280.1
ATGATTACTTCAGAGTTACCAGTGTTACAGGATTCAACTAATGAAACTACTGCCCATTCTGATGCTGGCAGCGAACTTGAAGAAACAGAGGTCAAAGGAAAAAGAAAAAGGGGTCGTCCTGGCCGGCCTCCATCTACAAATAAGAAACCTCGAAAATCTCCAGGGGAGAAGAGCAGAATTGAAGCTGGAGTTAGAGGAACAGGACGTGGAAGAGCTAATGGGCACCCTCAGCAGAATGGTGAAGGGGAGCCTGTCACATTATTTGAGGTGGTGAAACTGGGGAAAAGTGCAATGCAGTCCGTGGTGGACGACTGGATTGAATCATATAAACAAGACAGGGACATCGCACTTCTGGATTTAATCAACTTTTTTATCCAGTGTTCAGGATGTCGAGGTACTGTGAGAATAGAGATGTTTCGAAATATGCAGAATGCAGAAATCATCAGAAAAATGACTGAAGAATTTGATGAGGACAGTGGTGATTATCCCCTTACCATGCCTGGACCCCAGTGGAAAAAATTTCGTTCAAACTTTTGTGAATTTATTGGAGTCCTGATTCGACAGTGTCAATATAGCATAATTTATGATGAGTATATGATGGACACAGTAATCTCCCTTTTGACTGGTTTGTCAGACTCCCAGGTCAGAGCTTTTAGACATACAAGTACCCTTGCTGCCATGAAGCTCATGACTGCTTTGGTGAATGTTGCCTTAAACCTCAGTATTCATCAGGACAATACACAGAGACAGTATGAAGCTGAGAGAAATAAAATGATTGGGAAGAGAGCCAATGAAAGATTGGAGTTACTACTTCAAAAACGGAAAGAGCTACAAGAAAATCAGGATGAAATTGAAAATATGATGAATTCTATTTTTAAGGGTATATTTGTTCATAGATACCGTGATGCTATTGCTGAGATTAGAGCCATTTGTATTGAAGAGATTGGAGTATGGATGAAAATGTATAGTGATGCCTTCCTAAATGACAGTTACCTAAAATATGTTGGCTGGACTCTTCATGACAGGCAAGGGGAAGTCAGGCTAAAGTGTTTGAAAGCCCTACAGAGCCTATATACCAATAGAGAATTATTCCCCAAATTGGAGCTGTTCACTAACCGATTCAAGGATCGCATTGTATCAATGACACTTGATAAAGAATATGATGTTGCTGTAGAAGCTATTCGACTGGTTACTCTGATACTTCATGGAAGTGAAGAAGCCCTTTCTAATGAAGACTGTGAAAATGTTTACCATTTGGTATACTCAGCACATCGTCCTGTTGCTGTGGCAGCTGGAGAGTTCCTTCACAAAAAGTTGTTTAGCAGACATGACCCACAAGCAGAAGAAGCATTAGCAAAGAGGAGAGGAAGGAACAGTCCTAATGGGAACCTCATTAGGATGCTTGTTCTTTTTTTTCTTGAAAGTGAGTTACACGAACATGCAGCCTACTTGGTGGACAGTTTGTGGGAGAGCTCTCAAGAACTGTTGAAAGACTGGGAATGTATGACAGAGTTGCTATTAGAAGAACCTGTTCAAGGAGAGGAAGCTATGTCTGACCGTCAAGAGAGTGCACTAATAGAGCTAATGGTTTGTACAATACGTCAAGCTGCTGAAGCACATCCTCCAGTGGGAAGAGGTACCGGCAAGAGAGTCCTAACTGCCAAAGAAAGAAAAACTCAAATTGATGATAGAAACAAATTGACTGAGCATTTTATTATAACACTTCCTATGTTGTTATCAAAGTATTCTGCAGATGCGGAAAAGGTAGCAAACTTGCTACAAATTCCACAGTATTTTGATCTAGAAATCTACAGCACAGGTAGAATGGAAAAGCATCTGGATGCTTTGTTAAAACAGATTAAATTTGTTGTGGAGAAACATGTAGAATCAGATGTTCTAGAAGCCTGCAGTAAAACCTATAGCATCTTATGCAGTGAAGAATATACCATCCAGAACAGAGTTGACATAGCTCGGAGCCAGCTGATTGATGAGTTTGTAGACCGGTTCAATCATTCTGTGGAAGACCTGTTGCAAGAGGGTGAAGAAGCTGATGATGATGATATTTACAATGTTCTATCCACCTTAAAGCGATTAACTTCTTTCCATAATGCTCATGATCTCACAAAATGGGATCTGTTTGGTAATTGCTACAGATTATTGAAGACTGGAATTGAACATGGAGCTATGCCAGAACAGATAGTCGTACAGGCACTGCAATGTTCCCATTACTCGATTCTTTGGCAGTTGGTGAAAATTACTGATGGTTCTCCTTCCAAAGAGGATTTGTTGGTATTGCGGAAAACAGTGAAATCCTTTTTGGCTGTTTGCCAACAGTGCCTATCTAATGTTAATACTCCAGTGAAAGAACAGGCTTTCATGTTACTCTGTGATCTATTGATGATTTTTAGCCACCAGTTAATGACAGGTGGCAGAGAGGGCCTTCAGCCTTTGGTGTTTAATCCAGATACAGGACTTCAGTCTGAACTGCTGAGTTTCGTGATGGATCATGTTTTCATTGACCAGGATGAGGAGAATCAGAGCATGGAGGGTGATGAAGAAGATGAAGCTAATAAAATCGAGGCCTTACATAAAAGAAGGAATCTACTTGCTGCCTTCAGCAAACTTATCATTTATGATATTGTTGACATGCATGCAGCTGCAGACATCTTTAAACACTACATGAAGTATTACAATGACTACGGTGATATTATTAAGGAAACACTAAGTAAAACCCGGCAGATTGATAAAATTCAGTGTGCCAAGACTCTCATTCTCAGTTTGCAGCAGTTGTTTAATGAACTTGTTCAAGAGCAAGGTCCCAACCTCGACAGGACATCTGCCCATGTCAGTGGCATTAAAGAATTGGCTCGGCGCTTTGCTCTTACATTTGGACTGGACCAAATCAAGACACGAGAAGCAGTCGCCACCCTTCACAAGGATGGCATAGAGTTTGCCTTTAAATACCAGAATCAGAAAGGACAAGAATATCCACCTCCTAACCTGGCTTTTCTTGAAGTACTAAGTGAATTTTCTTCTAAACTTCTCCGACAGGACAAAAAGACTGTTCATTCATACCTAGAGAAATTCCTTACTGAGCAGATGATGGAAAGGAGGGAAGATGTGTGGCTTCCACTCATCTCCTACAGAAATTCATTAGTCACTGGGGGTGAAGATGATAGAATGTCTGTGAACAGTGGAAGCAGCAGCAGCAAAACTTCCTCAGTAAGAAATAAGAAAGGACGACCTCCACTTCACAAAAAAAGAGTAGAAGATGAAAGTCTGGATAACACATGGCTAAACAGAACAGACACCATGATTCAGACTCCTGGCCCCCTGCCAGCCCCACAGCTTACTTCCACTGTGCTGCGAGACAATAGCCGGCCCTTGGGAGAACAGATTCAAGAACCTGAGTCTGAACATGGTTCTGAACCAGACTTTTTACACAATCCACAGATGCAGATCTCTTGGTTAGGCCAGCCGAAGTTAGAAGACCTGAATCGGAAGGACAGAACAGGAATGAACTACATGAAAGTGAGAACTGGAGTAAGGCATGCTGTTCGGGGTCTAATGGAAGAAGATGCTGAGCCCATCTTTGAAGATGTGATGATGTCATCCCGAAGCCAATTAGAAGATATGAATGAAGAATTTGAAGACACCATGGTTATTGATCTGCCTCCATCAAGAAATCGGCGAGAGAGAGCTGAACTGAGGCCAGACTTCTTTGACTCTGCAGCTATCATAGAAGATGATTCAGTAAATATTAAATTATTACTGCTTTTTACTTATGGCTTCTGGGTCTTGTATATTCATGAAATTAATCATGTCTCTTATTTTTCTAGGGATTTGGAATGCCTATGTTCTGAAATCTAA

XM_004834281.1 Coding sequence

Stag1 stromal antigen 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 3777 bp    Location: 13158696..12762564   Strand: -
>XM_004834281.1
ATGATTACTTCAGAGTTACCAGTGTTACAGGATTCAACTAATGAAACTACTGCCCATTCTGATGCTGGCAGCGAACTTGAAGAAACAGAGGTCAAAGGAAAAAGAAAAAGGGGTCGTCCTGGCCGGCCTCCATCTACAAATAAGAAACCTCGAAAATCTCCAGGGGAGAAGAGCAGAATTGAAGCTGGAGTTAGAGGAACAGGACGTGGAAGAGCTAATGGGCACCCTCAGCAGAATGGTGAAGGGGAGCCTGTCACATTATTTGAGGTGGTGAAACTGGGGAAAAGTGCAATGCAGTCCGTGGTGGACGACTGGATTGAATCATATAAACAAGACAGGGACATCGCACTTCTGGATTTAATCAACTTTTTTATCCAGTGTTCAGGATGTCGAGGTACTGTGAGAATAGAGATGTTTCGAAATATGCAGAATGCAGAAATCATCAGAAAAATGACTGAAGAATTTGATGAGGACAGTGGTGATTATCCCCTTACCATGCCTGGACCCCAGTGGAAAAAATTTCGTTCAAACTTTTGTGAATTTATTGGAGTCCTGATTCGACAGTGTCAATATAGCATAATTTATGATGAGTATATGATGGACACAGTAATCTCCCTTTTGACTGGTTTGTCAGACTCCCAGGTCAGAGCTTTTAGACATACAAGTACCCTTGCTGCCATGAAGCTCATGACTGCTTTGGTGAATGTTGCCTTAAACCTCAGTATTCATCAGGACAATACACAGAGACAGTATGAAGCTGAGAGAAATAAAATGATTGGGAAGAGAGCCAATGAAAGATTGGAGTTACTACTTCAAAAACGGAAAGAGCTACAAGAAAATCAGGATGAAATTGAAAATATGATGAATTCTATTTTTAAGGGTATATTTGTTCATAGATACCGTGATGCTATTGCTGAGATTAGAGCCATTTGTATTGAAGAGATTGGAGTATGGATGAAAATGTATAGTGATGCCTTCCTAAATGACAGTTACCTAAAATATGTTGGCTGGACTCTTCATGACAGGCAAGGGGAAGTCAGGCTAAAGTGTTTGAAAGCCCTACAGAGCCTATATACCAATAGAGAATTATTCCCCAAATTGGAGCTGTTCACTAACCGATTCAAGGATCGCATTGTATCAATGACACTTGATAAAGAATATGATGTTGCTGTAGAAGCTATTCGACTGGTTACTCTGATACTTCATGGAAGTGAAGAAGCCCTTTCTAATGAAGACTGTGAAAATGTTTACCATTTGGTATACTCAGCACATCGTCCTGTTGCTGTGGCAGCTGGAGAGTTCCTTCACAAAAAGTTGTTTAGCAGACATGACCCACAAGCAGAAGAAGCATTAGCAAAGAGGAGAGGAAGGAACAGTCCTAATGGGAACCTCATTAGGATGCTTGTTCTTTTTTTTCTTGAAAGTGAGTTACACGAACATGCAGCCTACTTGGTGGACAGTTTGTGGGAGAGCTCTCAAGAACTGTTGAAAGACTGGGAATGTATGACAGAGTTGCTATTAGAAGAACCTGTTCAAGGAGAGGAAGCTATGTCTGACCGTCAAGAGAGTGCACTAATAGAGCTAATGGTTTGTACAATACGTCAAGCTGCTGAAGCACATCCTCCAGTGGGAAGAGGTACCGGCAAGAGAGTCCTAACTGCCAAAGAAAGAAAAACTCAAATTGATGATAGAAACAAATTGACTGAGCATTTTATTATAACACTTCCTATGTTGTTATCAAAGTATTCTGCAGATGCGGAAAAGGTAGCAAACTTGCTACAAATTCCACAGTATTTTGATCTAGAAATCTACAGCACAGGTAGAATGGAAAAGCATCTGGATGCTTTGTTAAAACAGATTAAATTTGTTGTGGAGAAACATGTAGAATCAGATGTTCTAGAAGCCTGCAGTAAAACCTATAGCATCTTATGCAGTGAAGAATATACCATCCAGAACAGAGTTGACATAGCTCGGAGCCAGCTGATTGATGAGTTTGTAGACCGGTTCAATCATTCTGTGGAAGACCTGTTGCAAGAGGGTGAAGAAGCTGATGATGATGATATTTACAATGTTCTATCCACCTTAAAGCGATTAACTTCTTTCCATAATGCTCATGATCTCACAAAATGGGATCTGTTTGGTAATTGCTACAGATTATTGAAGACTGGAATTGAACATGGAGCTATGCCAGAACAGATAGTCGTACAGGCACTGCAATGTTCCCATTACTCGATTCTTTGGCAGTTGGTGAAAATTACTGATGGTTCTCCTTCCAAAGAGGATTTGTTGGTATTGCGGAAAACAGTGAAATCCTTTTTGGCTGTTTGCCAACAGTGCCTATCTAATGTTAATACTCCAGTGAAAGAACAGGCTTTCATGTTACTCTGTGATCTATTGATGATTTTTAGCCACCAGTTAATGACAGGTGGCAGAGAGGGCCTTCAGCCTTTGGTGTTTAATCCAGATACAGGACTTCAGTCTGAACTGCTGAGTTTCGTGATGGATCATGTTTTCATTGACCAGGATGAGGAGAATCAGAGCATGGAGGGTGATGAAGAAGATGAAGCTAATAAAATCGAGGCCTTACATAAAAGAAGGAATCTACTTGCTGCCTTCAGCAAACTTATCATTTATGATATTGTTGACATGCATGCAGCTGCAGACATCTTTAAACACTACATGAAGTATTACAATGACTACGGTGATATTATTAAGGAAACACTAAGTAAAACCCGGCAGATTGATAAAATTCAGTGTGCCAAGACTCTCATTCTCAGTTTGCAGCAGTTGTTTAATGAACTTGTTCAAGAGCAAGGTCCCAACCTCGACAGGACATCTGCCCATGTCAGTGGCATTAAAGAATTGGCTCGGCGCTTTGCTCTTACATTTGGACTGGACCAAATCAAGACACGAGAAGCAGTCGCCACCCTTCACAAGGATGGCATAGAGTTTGCCTTTAAATACCAGAATCAGAAAGGACAAGAATATCCACCTCCTAACCTGGCTTTTCTTGAAGTACTAAGTGAATTTTCTTCTAAACTTCTCCGACAGGACAAAAAGACTGTTCATTCATACCTAGAGAAATTCCTTACTGAGCAGATGATGGAAAGGAGGGAAGATGTGTGGCTTCCACTCATCTCCTACAGAAATTCATTAGTCACTGGGGGTGAAGATGATAGAATGTCTGTGAACAGTGGAAGCAGCAGCAGCAAAACTTCCTCAGTAAGAAATAAGAAAGGACGACCTCCACTTCACAAAAAAAGAGTAGAAGATGAAAGTCTGGATAACACATGGCTAAACAGAACAGACACCATGATTCAGACTCCTGGCCCCCTGCCAGCCCCACAGCTTACTTCCACTGTGCTGCGAGACAATAGCCGGCCCTTGGGAGAACAGATTCAAGAACCTGAGTCTGAACATGGTTCTGAACCAGACTTTTTACACAATCCACAGATGCAGATCTCTTGGTTAGGCCAGCCGAAGTTAGAAGACCTGAATCGGAAGGACAGAACAGGAATGAACTACATGAAAGTGAGAACTGGAGTAAGGCATGCTGTTCGGGGTCTAATGGAAGAAGATGCTGAGCCCATCTTTGAAGATGTGATGATGTCATCCCGAAGCCAATTAGAAGATATGAATGAAGAATTTGAAGACACCATGGTTATTGATCTGCCTCCATCAAGAAATCGGCGAGAGAGAGCTGAACTGAGGCCAGACTTCTTTGACTCTGCAGCTATCATAGAAGATGATTCAGGATTTGGAATGCCTATGTTCTGA

XM_004834279.1 Coding sequence

Stag1 stromal antigen 1, transcript variant X1

Length: 3870 bp    Location: 13158696..12762564   Strand: -
>XM_004834279.1
ATGATTACTTCAGAGTTACCAGTGTTACAGGATTCAACTAATGAAACTACTGCCCATTCTGATGCTGGCAGCGAACTTGAAGAAACAGAGGTCAAAGGAAAAAGAAAAAGGGGTCGTCCTGGCCGGCCTCCATCTACAAATAAGAAACCTCGAAAATCTCCAGGGGAGAAGAGCAGAATTGAAGCTGGAGTTAGAGGAACAGGACGTGGAAGAGCTAATGGGCACCCTCAGCAGAATGGTGAAGGGGAGCCTGTCACATTATTTGAGGTGGTGAAACTGGGGAAAAGTGCAATGCAGTCCGTGGTGGACGACTGGATTGAATCATATAAACAAGACAGGGACATCGCACTTCTGGATTTAATCAACTTTTTTATCCAGTGTTCAGGATGTCGAGGTACTGTGAGAATAGAGATGTTTCGAAATATGCAGAATGCAGAAATCATCAGAAAAATGACTGAAGAATTTGATGAGGACAGTGGTGATTATCCCCTTACCATGCCTGGACCCCAGTGGAAAAAATTTCGTTCAAACTTTTGTGAATTTATTGGAGTCCTGATTCGACAGTGTCAATATAGCATAATTTATGATGAGTATATGATGGACACAGTAATCTCCCTTTTGACTGGTTTGTCAGACTCCCAGGTCAGAGCTTTTAGACATACAAGTACCCTTGCTGCCATGAAGCTCATGACTGCTTTGGTGAATGTTGCCTTAAACCTCAGTATTCATCAGGACAATACACAGAGACAGTATGAAGCTGAGAGAAATAAAATGATTGGGAAGAGAGCCAATGAAAGATTGGAGTTACTACTTCAAAAACGGAAAGAGCTACAAGAAAATCAGGATGAAATTGAAAATATGATGAATTCTATTTTTAAGGGTATATTTGTTCATAGATACCGTGATGCTATTGCTGAGATTAGAGCCATTTGTATTGAAGAGATTGGAGTATGGATGAAAATGTATAGTGATGCCTTCCTAAATGACAGTTACCTAAAATATGTTGGCTGGACTCTTCATGACAGGCAAGGGGAAGTCAGGCTAAAGTGTTTGAAAGCCCTACAGAGCCTATATACCAATAGAGAATTATTCCCCAAATTGGAGCTGTTCACTAACCGATTCAAGGATCGCATTGTATCAATGACACTTGATAAAGAATATGATGTTGCTGTAGAAGCTATTCGACTGGTTACTCTGATACTTCATGGAAGTGAAGAAGCCCTTTCTAATGAAGACTGTGAAAATGTTTACCATTTGGTATACTCAGCACATCGTCCTGTTGCTGTGGCAGCTGGAGAGTTCCTTCACAAAAAGTTGTTTAGCAGACATGACCCACAAGCAGAAGAAGCATTAGCAAAGAGGAGAGGAAGGAACAGTCCTAATGGGAACCTCATTAGGATGCTTGTTCTTTTTTTTCTTGAAAGTGAGTTACACGAACATGCAGCCTACTTGGTGGACAGTTTGTGGGAGAGCTCTCAAGAACTGTTGAAAGACTGGGAATGTATGACAGAGTTGCTATTAGAAGAACCTGTTCAAGGAGAGGAAGCTATGTCTGACCGTCAAGAGAGTGCACTAATAGAGCTAATGGTTTGTACAATACGTCAAGCTGCTGAAGCACATCCTCCAGTGGGAAGAGGTACCGGCAAGAGAGTCCTAACTGCCAAAGAAAGAAAAACTCAAATTGATGATAGAAACAAATTGACTGAGCATTTTATTATAACACTTCCTATGTTGTTATCAAAGTATTCTGCAGATGCGGAAAAGGTAGCAAACTTGCTACAAATTCCACAGTATTTTGATCTAGAAATCTACAGCACAGGTAGAATGGAAAAGCATCTGGATGCTTTGTTAAAACAGATTAAATTTGTTGTGGAGAAACATGTAGAATCAGATGTTCTAGAAGCCTGCAGTAAAACCTATAGCATCTTATGCAGTGAAGAATATACCATCCAGAACAGAGTTGACATAGCTCGGAGCCAGCTGATTGATGAGTTTGTAGACCGGTTCAATCATTCTGTGGAAGACCTGTTGCAAGAGGGTGAAGAAGCTGATGATGATGATATTTACAATGTTCTATCCACCTTAAAGCGATTAACTTCTTTCCATAATGCTCATGATCTCACAAAATGGGATCTGTTTGGTAATTGCTACAGATTATTGAAGACTGGAATTGAACATGGAGCTATGCCAGAACAGATAGTCGTACAGGCACTGCAATGTTCCCATTACTCGATTCTTTGGCAGTTGGTGAAAATTACTGATGGTTCTCCTTCCAAAGAGGATTTGTTGGTATTGCGGAAAACAGTGAAATCCTTTTTGGCTGTTTGCCAACAGTGCCTATCTAATGTTAATACTCCAGTGAAAGAACAGGCTTTCATGTTACTCTGTGATCTATTGATGATTTTTAGCCACCAGTTAATGACAGGTGGCAGAGAGGGCCTTCAGCCTTTGGTGTTTAATCCAGATACAGGACTTCAGTCTGAACTGCTGAGTTTCGTGATGGATCATGTTTTCATTGACCAGGATGAGGAGAATCAGAGCATGGAGGGTGATGAAGAAGATGAAGCTAATAAAATCGAGGCCTTACATAAAAGAAGGAATCTACTTGCTGCCTTCAGCAAACTTATCATTTATGATATTGTTGACATGCATGCAGCTGCAGACATCTTTAAACACTACATGAAGTATTACAATGACTACGGTGATATTATTAAGGAAACACTAAGTAAAACCCGGCAGATTGATAAAATTCAGTGTGCCAAGACTCTCATTCTCAGTTTGCAGCAGTTGTTTAATGAACTTGTTCAAGAGCAAGGTCCCAACCTCGACAGGACATCTGCCCATGTCAGTGGCATTAAAGAATTGGCTCGGCGCTTTGCTCTTACATTTGGACTGGACCAAATCAAGACACGAGAAGCAGTCGCCACCCTTCACAAGGATGGCATAGAGTTTGCCTTTAAATACCAGAATCAGAAAGGACAAGAATATCCACCTCCTAACCTGGCTTTTCTTGAAGTACTAAGTGAATTTTCTTCTAAACTTCTCCGACAGGACAAAAAGACTGTTCATTCATACCTAGAGAAATTCCTTACTGAGCAGATGATGGAAAGGAGGGAAGATGTGTGGCTTCCACTCATCTCCTACAGAAATTCATTAGTCACTGGGGGTGAAGATGATAGAATGTCTGTGAACAGTGGAAGCAGCAGCAGCAAAACTTCCTCAGTAAGAAATAAGAAAGGACGACCTCCACTTCACAAAAAAAGAGTAGAAGATGAAAGTCTGGATAACACATGGCTAAACAGAACAGACACCATGATTCAGACTCCTGGCCCCCTGCCAGCCCCACAGCTTACTTCCACTGTGCTGCGAGACAATAGCCGGCCCTTGGGAGAACAGATTCAAGAACCTGAGTCTGAACATGGTTCTGAACCAGACTTTTTACACAATCCACAGATGCAGATCTCTTGGTTAGGCCAGCCGAAGTTAGAAGACCTGAATCGGAAGGACAGAACAGGAATGAACTACATGAAAGTGAGAACTGGAGTAAGGCATGCTGTTCGGGGTCTAATGGAAGAAGATGCTGAGCCCATCTTTGAAGATGTGATGATGTCATCCCGAAGCCAATTAGAAGATATGAATGAAGAATTTGAAGACACCATGGTTATTGATCTGCCTCCATCAAGAAATCGGCGAGAGAGAGCTGAACTGAGGCCAGACTTCTTTGACTCTGCAGCTATCATAGAAGATGATTCAGTAAATATTAAATTATTACTGCTTTTTACTTATGGCTTCTGGGTCTTGTATATTCATGAAATTAATCATGTCTCTTATTTTTCTAGGGATTTGGAATGCCTATGTTCTGAAATCTAA

XM_004834288.1 Coding sequence

Slc35g2 solute carrier family 35, member G2, transcript variant X1

Length: 1239 bp    Location: 13226407..13261175   Strand: +
>XM_004834288.1
ATGGATACTTCTCCGTCCAAAAAATATCCAGTTAAAAAACGAGTGAAAATACATCCCAACACAGTGATGGTAAAATATACTTCTCATTACCCCCAACCTGGGGATGATGAATATGAAGAAATTAATGAAGACTATGGGAATTTTATGGAAGAAAATCCAAAGAAAGGTCTGCTGAGTGAAATGAAAAGAAAAGGAAGAACTTTCTTTGGAACTGTGGATACTCATCCTCCACCAGCAGAAGACCCAATGACCAGTGAGATCGGACAATTCCAGAGCTTTGCAGAAAAAAATATTTTTCAGTCCCGAAAAATGTGGATAGTGCTGTTTGGATCAGCTTTGGCTCATGGATGTGTAGCCCTTATCACTAGGCTTGTTTCTGATCGTTCTAAAGTTCCATCTTTAGAACTGATTTTTATCCGTTCTGTCTTGCAGGTCTTATCTGTGTTAGTTGTGTGTTACTATCAGGAGGCTCCCTTTGGACCCCGTGGATACAGATTACGACTCTTCTTTTATGGTGTATGCAATGTCATTTCTATCACTTGTGCTTATACATCATTTTCAATAGTTCCTCCTAGCAATGGGACCACTATGTGGAGAGCCACAACCACAGTTTTTAGTGCCATTTTGGCATTTTTACTTGTAGATGAAAAAATGGCTTATGTTGACATGGTCACAGTTGTTTGTAGCGTCTTGGGTGTTTGTCTTGTCATGATCCCCAACATTGTTGATGAAGACAATTCTTTGTTAAATGCCTGGAAAGAAGCTTTTGGGTATTCAATGACTGTGATGGCAGGACTGACTACTGCTCTTTCTATGATAGTGTACAGATCCATCAGGGAGAGGATTAGCATGTGGACTGCTCTGTTTACCTTTGGTTGGACTGGGACAATCTGGGGAATATCTACTATGTTTGTTCTTCAAGAACCCATCATCCCATTAGATGGAGAAACATGGAGTTATCTCATTGCTATATGCATTTGTTCTACTGCAGCATTCTTAGGAGTTTATTATGCCTTGGACAAATTCCATCCAGCTTTGGTCAGCACAGTACAACATCTAGAGATTGTGGTAGCTATGGTCTTGCAGCTTCTAGTATTACACATATTTCCTAGTGTCTATGATGTCTTTGGAGGGGTAATCATTATGATTAGTGTATTTGTCCTTGCTGGCTATAAACTTTACTACAGAAATTTAAGAAGGCAAGATTACCAGGAAATACTAGACTCTCCCATTAAATGA

XM_004834289.1 Coding sequence

Slc35g2 solute carrier family 35, member G2, transcript variant X2

Length: 1239 bp    Location: 13234213..13261175   Strand: +
>XM_004834289.1
ATGGATACTTCTCCGTCCAAAAAATATCCAGTTAAAAAACGAGTGAAAATACATCCCAACACAGTGATGGTAAAATATACTTCTCATTACCCCCAACCTGGGGATGATGAATATGAAGAAATTAATGAAGACTATGGGAATTTTATGGAAGAAAATCCAAAGAAAGGTCTGCTGAGTGAAATGAAAAGAAAAGGAAGAACTTTCTTTGGAACTGTGGATACTCATCCTCCACCAGCAGAAGACCCAATGACCAGTGAGATCGGACAATTCCAGAGCTTTGCAGAAAAAAATATTTTTCAGTCCCGAAAAATGTGGATAGTGCTGTTTGGATCAGCTTTGGCTCATGGATGTGTAGCCCTTATCACTAGGCTTGTTTCTGATCGTTCTAAAGTTCCATCTTTAGAACTGATTTTTATCCGTTCTGTCTTGCAGGTCTTATCTGTGTTAGTTGTGTGTTACTATCAGGAGGCTCCCTTTGGACCCCGTGGATACAGATTACGACTCTTCTTTTATGGTGTATGCAATGTCATTTCTATCACTTGTGCTTATACATCATTTTCAATAGTTCCTCCTAGCAATGGGACCACTATGTGGAGAGCCACAACCACAGTTTTTAGTGCCATTTTGGCATTTTTACTTGTAGATGAAAAAATGGCTTATGTTGACATGGTCACAGTTGTTTGTAGCGTCTTGGGTGTTTGTCTTGTCATGATCCCCAACATTGTTGATGAAGACAATTCTTTGTTAAATGCCTGGAAAGAAGCTTTTGGGTATTCAATGACTGTGATGGCAGGACTGACTACTGCTCTTTCTATGATAGTGTACAGATCCATCAGGGAGAGGATTAGCATGTGGACTGCTCTGTTTACCTTTGGTTGGACTGGGACAATCTGGGGAATATCTACTATGTTTGTTCTTCAAGAACCCATCATCCCATTAGATGGAGAAACATGGAGTTATCTCATTGCTATATGCATTTGTTCTACTGCAGCATTCTTAGGAGTTTATTATGCCTTGGACAAATTCCATCCAGCTTTGGTCAGCACAGTACAACATCTAGAGATTGTGGTAGCTATGGTCTTGCAGCTTCTAGTATTACACATATTTCCTAGTGTCTATGATGTCTTTGGAGGGGTAATCATTATGATTAGTGTATTTGTCCTTGCTGGCTATAAACTTTACTACAGAAATTTAAGAAGGCAAGATTACCAGGAAATACTAGACTCTCCCATTAAATGA

XM_004834290.1 Coding sequence

Slc35g2 solute carrier family 35, member G2, transcript variant X3

High confidence: 4 potential gene matches
Length: 1239 bp    Location: 13234213..13261175   Strand: +
>XM_004834290.1
ATGGATACTTCTCCGTCCAAAAAATATCCAGTTAAAAAACGAGTGAAAATACATCCCAACACAGTGATGGTAAAATATACTTCTCATTACCCCCAACCTGGGGATGATGAATATGAAGAAATTAATGAAGACTATGGGAATTTTATGGAAGAAAATCCAAAGAAAGGTCTGCTGAGTGAAATGAAAAGAAAAGGAAGAACTTTCTTTGGAACTGTGGATACTCATCCTCCACCAGCAGAAGACCCAATGACCAGTGAGATCGGACAATTCCAGAGCTTTGCAGAAAAAAATATTTTTCAGTCCCGAAAAATGTGGATAGTGCTGTTTGGATCAGCTTTGGCTCATGGATGTGTAGCCCTTATCACTAGGCTTGTTTCTGATCGTTCTAAAGTTCCATCTTTAGAACTGATTTTTATCCGTTCTGTCTTGCAGGTCTTATCTGTGTTAGTTGTGTGTTACTATCAGGAGGCTCCCTTTGGACCCCGTGGATACAGATTACGACTCTTCTTTTATGGTGTATGCAATGTCATTTCTATCACTTGTGCTTATACATCATTTTCAATAGTTCCTCCTAGCAATGGGACCACTATGTGGAGAGCCACAACCACAGTTTTTAGTGCCATTTTGGCATTTTTACTTGTAGATGAAAAAATGGCTTATGTTGACATGGTCACAGTTGTTTGTAGCGTCTTGGGTGTTTGTCTTGTCATGATCCCCAACATTGTTGATGAAGACAATTCTTTGTTAAATGCCTGGAAAGAAGCTTTTGGGTATTCAATGACTGTGATGGCAGGACTGACTACTGCTCTTTCTATGATAGTGTACAGATCCATCAGGGAGAGGATTAGCATGTGGACTGCTCTGTTTACCTTTGGTTGGACTGGGACAATCTGGGGAATATCTACTATGTTTGTTCTTCAAGAACCCATCATCCCATTAGATGGAGAAACATGGAGTTATCTCATTGCTATATGCATTTGTTCTACTGCAGCATTCTTAGGAGTTTATTATGCCTTGGACAAATTCCATCCAGCTTTGGTCAGCACAGTACAACATCTAGAGATTGTGGTAGCTATGGTCTTGCAGCTTCTAGTATTACACATATTTCCTAGTGTCTATGATGTCTTTGGAGGGGTAATCATTATGATTAGTGTATTTGTCCTTGCTGGCTATAAACTTTACTACAGAAATTTAAGAAGGCAAGATTACCAGGAAATACTAGACTCTCCCATTAAATGA

XM_004834297.1 Coding sequence

Nck1 NCK adaptor protein 1, transcript variant X7

Length: 1134 bp    Location: 13271583..13366656   Strand: +
>XM_004834297.1
ATGGCAGAAGAAGTGGTAGTAGTAGCCAAATTTGATTATGTGGCCCAACAAGAACAAGAGCTGGACATCAAGAAGAATGAGAGATTATGGCTTCTGGATGATTCTAAGTCCTGGTGGCGAGTTAGAAATTCTATGAATAAAACAGGTTTTGTGCCTTCTAACTATGTGGAAAGGAAAAACAGTGCTCGAAAAGCATCTATTGTAAAAAATCTAAAGGATACCTTAGGCATTGGAAAAGTGAAAAGAAAACCTAGTGTTCCAGATTCTGCAACTCCTTCTGATGACAGTTTTGTTGACCCAGGGGAACGTCTTTATGACCTCAACATGCCTGCCTATGTGAAATTTAACTACATGGCCGAGAGAGAAGATGAATTATCATTGATAAAAGGAACAAAAGTGATTGTCATGGAGAAATGCAGTGATGGGTGGTGGCGGGGTAGCTACAATGGACAAATTGGATGGTTCCCTTCAAACTATGTAACTGAAGAAGGTGACAGTCCTTTGGGTGACCATGTGGGTTCACTGTCAGAGAAATTAGCAGCAGTTGTCAGTAACCTAAATACTGGGCAAGTGTTGCATGTGGTACAGGCTCTTTACCCATTCAGTTCATCCAATGACGAAGAACTTAATTTTGAGAAAGGCGATGTAATGGATGTTATTGAAAAGCCAGAAAATGACCCAGAGTGGTGGAAATGCAGGAAGATCAATGGGATGGTTGGTCTGGTGCCAAAAAACTACGTTACCATTATGCAGAATAATTCATTAACTTCAGGTTTCGAACCGCCACCTCCACAGTGTGATTATATTAGGCCTTCACTCACTGGAAAGTTTGCTGGAAATCCTTGGTATTATGGCAAAGTTACCAGACATCAAGCAGAAATGGCATTAAATGAAAGAGGACATGAAGGAGATTTTCTCATCCGGGATAGTGAATCTTCGCCAAATGATTTTTCAGTATCATTAAAAGCTCAAGGGAAAAACAAACATTTTAAAGTCCAACTAAAAGAGACCTTCTACTGCATTGGGCAGCGTAAATTCAGCACCATGGAAGAACTTGTAGAACATTACAAAAAGGCACCAATTTTTACAAGTGAACAAGGAGAAAAGTTATATCTTGTCAAACATTTATCATGA

XM_004835151.1 Coding sequence

Il20rb interleukin 20 receptor beta

High confidence: 4 potential gene matches
Length: 1125 bp    Location: 13371898..13408745   Strand: +
>XM_004835151.1
ATGGACAAGGATTTCATCAAACTGGCTGTAGTGGTGCAGTGCCTACTGGAGAGGGGCCCGGAATTGAAAAGAGTGGATTCATCATTCAAGAAACAAAACTGCAACTCGGACCTCAGCTCCAACATCTGCGATCTGAAGCATGATGGCTGGACTGTAAAAGGAAACAATGTTCCAGGTCAAACTAAGTCTGTCAAACAGACCCTCACAGTGGTTCTAAAAGGCGTCTGGACAAGTCTTATCATGTGGCTTTTCTACTCCCTGATTCCATGTTTGCTGACAGGTGAAGTAGCAGCTCTGCCTGCCCCTCAGAACCTCTCTGTACACTCAACCAACATGAAGCATCTCTTGATGTGGAGCCCGGTGGTCCTGGCTGAAGAAACAGTGTACTATTCTGTCGAGTACCAGGGGGAGTATGAGAGCTTATACACAAGCCACATCTGGATCCCCAGCAAATGGTGCTCACTCACTGAAGGTCCTGAGTGTGATGTCTCTGATGACATCACTGCCACAGTCCCATACAACCTCCGTGTCAGGGCCATCTTGGGCTCACAGACTTCAGCCTGGAGCATCCTGGAGGAGCCCTTTAATCGAAACTCAACCATCCTTACCCTGCCTGGGATGAAGGTCTCCAAGGACGGCTTCCACCTGGTTATTGAGCTGGAAGACCTGGGACCCCAGTTTGAGTTCCTTGTGGTCTACTGGAGGAAGGAGCTGGTCACCAAGGAACATGACAAAGTGGTGAGGAGGGGGGGCATTCCTGTGCCCCTCGAAACCATGGAGCCAGGGGCCCCATACTGCGTAAAGGCCCAGGCGCTGGTGAAGGCCATTGGGAGGAACAGTGCCTTCAGCCAGGAAGAGTGTGTGGAGGTGCAAGGAGAAGCTCTTCCCCTGATGCTGGCCCTGTTTGCCTTTGTTGGCTTCATGCTGATCCTCGTGGTTGTGCCACTGTCCATCTGGAAGATGGGCCGGCTGCTCCAGTACTCCTGTTGCCCCATGGTGGTCCTCCCAGACACCTTGAAAATAACCAACTCACCACAGAAGTTAATCAGCTGCAGAAGGGAAGAGGTGGATGCCTGTGCCCTGGAGGTACTGTCTTCTGAGGAGCTCTTCCGGGCGTGGATCTAG

XM_004834300.1 Coding sequence

Sox14 SRY (sex determining region Y)-box 14

High confidence: 4 potential gene matches
Length: 723 bp    Location: 14278020..14279496   Strand: +
>XM_004834300.1
ATGTCCAAACCCTCAGACCACATCAAGCGGCCCATGAATGCCTTCATGGTATGGTCCCGGGGCCAGCGGCGCAAGATGGCCCAGGAAAACCCTAAGATGCACAACTCAGAGATCAGCAAACGCCTTGGCGCCGAATGGAAGCTTCTATCTGAGGCAGAGAAGCGGCCCTACATCGACGAAGCCAAAAGACTGCGCGCCCAGCACATGAAGGAGCACCCCGACTACAAGTACCGGCCCCGGCGCAAGCCCAAGAACCTGCTCAAGAAGGACAGGTATGTCTTCCCCCTGCCCTACCTGGGCGACACGGACCCGCTCAAGGCGGCCGGCCTGCCCGTGGGGGCTTCCGACGGCCTCCTGAGCGCGCCCGAGAAAGCTCGGGCCTTCTTGCCGCCGGCCTCGGCGCCCTACTCCCTGCTGGACCCCGCGCAGTTTAGCTCGAGTGCCATCCAGAAGATGGGTGAAGTGCCCCACACCTTGGCCACCAGCGCGCTGCCCTACGCGTCCTCCCTGGGCTACCAGAACGGCGCCTTCGGCAGCCTCAGCTGCCCCAGCCAGCACACGCACACGCACCCGTCCCCAACCAACCCGGGCTACGTGGTGCCCTGTAACTGTACCGCCTGGTCTGCCTCCACCCTGCAGCCCCCGGTCGCCTACATCCTCTTCCCAGGCATGACCAAGACTGGCATAGACCCTTATTCTTCAGCCCACGCCACGGCCATGTAA

XM_004834301.1 Coding sequence

Cldn18 claudin 18

High confidence: 4 potential gene matches
Length: 786 bp    Location: 14500379..14522047   Strand: +
>XM_004834301.1
ATGTCCACCACCACGTGCCAAGTAGTGGGCTTCCTCCTGTCCATGCTGGGTCTGGCCGGCTGCATCGCTGCCACGGGGATGGACATGTGGAGCACCCAGGACCTATATGACAACCCCGTCACCTCCGTGTTCCAGTACGAAGGGCTCTGGAGAAGCTGTGTGAGGCAGAGCTCAGGGTTCACAGAGTGCCGGCCCTACTTCACCATCCTGGGTCTTCCAGCCATGCTGCAGGCAGTGCGAGCCCTAATGATCGTGGGAATTGTGCTGGGTGCCATCAGCACCTTAGTGTCCATCTTTGCTCTGAAATGCATTCGCATTGGAAGCATGGAGGACTCTGCCAAGGCCAAAATGACACTGACCTCCGGGATCATGTTCGTTATCTCAGGTGTTTGTGCAATTATTGGCGTGTCTGTGTTTGCCAACATGCTGGTTACTAATTTCTGGATGTCCACAGCTAACATGTATGGCAGCATGGGTGGAATGGTACAGACTGTTCAGACCAGGTACACCTTTGGTTCAGCTCTGTTCGTGGGCTGGATTGCTGGAGGCCTCACACTAATTGGAGGTGTGTTGATGTGCATTGCCTGCCGGGGTCTGGTACCTGATCAAACCAACTACAAAGCCGTGTCTTATCATGCCTCAGGCCACAATGTTTCCTACAGGCCTGGAGGCTTCAAAGCCAGCACTGCCTTTGGATCTACCACCAAGGCCAAGAAGATATATGACGGGGGTGCCCACACAGAAGATGAGGCACAATCTCACCCTTCCAAGTATGACTATGTGTAA

XM_004834305.1 Coding sequence

Dzip1l DAZ interacting zinc finger protein 1-like, transcript variant X4

High confidence: 4 potential gene matches
Length: 2322 bp    Location: 14619405..14568633   Strand: -
>XM_004834305.1
ATGCAACCCCCAGCTGTCACTGCTGAGGGCCTCAGCAGCCCACTCTTTGGGACCTGCACACTCCCCACCTTCAAATTCCAGCCTCGCCGTGAGAGCATAGACTGGAGGCGCATTAGTGCTTTGGATGTGGACCGTGTAGCCCAGGAGCTGGATGTGGCCACTCTGCAGGAGAACATTGCTGGTGTTACCTTCTGCAACTTGAATCAGGAGGTGTGCAGCCGCTGTGGGCACCCTGTGGACCCGGTGCTGCTCAAGGTGCTGCGCCTGGCACAGCTTATCATTGAGTACCTACTGCACTGCCAGGATTGCCTGAGTGCCATCGTCACCCAGCTGGAGGCACGGCTGCAGGCCAGCCTGGGCCAGCAGCAGCGTGGCCAGCAGGAGCTGGGCCGCCAGGCTGATGAGCTCAAGGGCGTACGGGAGGAGAGCCGCCGGCGTCGAAAGATGATCAGCACCCTACAGCAGCTGCTAATGCAGACAGGCGCCCACAACTACCATGTGTGCCACCTGTGTGACAAGTCATTCATGAATGCCACCTTTCTCCGGGGCCACATCCAACGCAGGCATGCAGGCATGGCAGAAGGTGGAAAGCAGAAACAGCAGGAACGGCCAGCTGAGGAGCTACTGGAAGAGCTGAGAGCCAAGCTGAAGTGGACCCAAGGGGAGCTGGAAGCCCAGAGGGAGGCCGAGAGGCAGCGCCAGCTCCAGGAAACAGAGATTACTCGTCAGAGGGAAATAGAAGTGAAGAAAGAATTTGATGAATGGAAAGAAAATGAGCGGACCAAGCTTTATGGAGAAATAGACAAGCTAAAACAATTACTTTGGGATGAATTTAAAACCATTGCCAACCAGAACTCTACCCTAGCAGAGAAACTGCAGGCTCTGCAGTCCCACAGTGTGATGGAATCCCACCTTGGATCACTGCGGGATGAGGACTCCGAGGAGCGACTCAGGCAGGCAGAAGAGCTCCAGGCCCTGCGAGAGAAGATGGAGATTCAGAAAACAGAATGGAAGAGAAAGTTGAAGGAATTGCAGGAAGAGCATGTGACAGAGAGGAGAGAGCTACAGGAGGAGAATGAGAGGCTCCAGGCCTCCCTGTCTCAGGATCAGAGGAAGGCAGCCACCCAGTCCCAGCACCAGATCAATGCCCTCCGTGCCCAGCTGCGGGAACAAGCCAGGCTCATAGCCTCCCAAGAGGAGAAGATCCAGACCTTGTCCCTCAGGAAGGCAGAGTGGATCCAAGAGATACCAAAGGCTGTGGACACAGAGGAGGACTCTCTTGAGGAAGAGCTGAAGGACTCCCAAGATGAACAGCAGCAGGTGCTGGCTGCTCTGAGGCGAAACCCTCCATTGATGAAGCAGTTCCGGCCTATCCTGGAGGACACCCTGGAAGAGAAGCTGGAAAGCATGGGAATAAAGAGGGATGCAAAGGGAATTGCTGTTCATACTCTCAGACACCTGGAGTCCGTGCTGAAAGCCCAGCGGGAGCAGAAGGCCAGGAAGTTTTCTGAATTTCTGAGTCTGAGGAAAAAGCTCATCAAAGAAGCCATCAGCAGAGTGAAGGAGAGACACAATGGGAATGTGGTGTCCCAGCCCAAGGGCCAGCCTCCAGACAAAAGTCAGCGGAGCACACTGCTTACCAGAGAGGCCCGGCCAAAGACCAGGGCCCTGCATGTGGCGCTGCCATCCAAGCTGGCAGAGCCATTCACACCAGCTCCTCAGAGCCGCAGCAGCCATGGCTCTGGTCCAACCCAGGTGTCTGCCCCAACTCCACGCCCCAGAGTGCAAGGACCCTCCAGCACCCCTGCCCCCCACGGGCCAGGGCTGAGCAGCACACCCCCATTCAGTTCCGAGGAGGACTCAGAGGGAAACACCGTGCATCGCATGTCTCTTCAGAACCCCCAAGTTACTTCCAAGATGGTGCCCCAGCAGAAGAATGATTGGGATTCATCTGACACTGAGTCCTCGGAAGAGAATGTGCAGCCCCCTGGCAAGGGCTCAGATGGGCTGGCTTCCTCTGGGACACTGGTGCAGTTGATGGTGAAAAATCTCGAGAAGCAGCTTGAGGCTCCAGTGAAGAATCCTGCTGGAGGGGTCAGTCTGTTCTTAAGGCCCAATGCCGGGCCTCAGAAGGCTACCATGCTGGGAAGGAAGCCTCAGCTTTCTGAAGATGAGAGCGACTTGGAGATCTCTTCCTTGGAAGATCTCTCTCAGGACCTGGACCAGAGAGAGAAACCAAAGCCCTGGTCCCGCTCAAAGCTCCCAGAGAAGATTGATGCCAGTTCTTGGAATTCTGGCCGGCCCAGGGTCCCTGGCTGGTGA

XM_004834304.1 Coding sequence

Dzip1l DAZ interacting zinc finger protein 1-like, transcript variant X3

Length: 2322 bp    Location: 14619405..14568633   Strand: -
>XM_004834304.1
ATGCAACCCCCAGCTGTCACTGCTGAGGGCCTCAGCAGCCCACTCTTTGGGACCTGCACACTCCCCACCTTCAAATTCCAGCCTCGCCGTGAGAGCATAGACTGGAGGCGCATTAGTGCTTTGGATGTGGACCGTGTAGCCCAGGAGCTGGATGTGGCCACTCTGCAGGAGAACATTGCTGGTGTTACCTTCTGCAACTTGAATCAGGAGGTGTGCAGCCGCTGTGGGCACCCTGTGGACCCGGTGCTGCTCAAGGTGCTGCGCCTGGCACAGCTTATCATTGAGTACCTACTGCACTGCCAGGATTGCCTGAGTGCCATCGTCACCCAGCTGGAGGCACGGCTGCAGGCCAGCCTGGGCCAGCAGCAGCGTGGCCAGCAGGAGCTGGGCCGCCAGGCTGATGAGCTCAAGGGCGTACGGGAGGAGAGCCGCCGGCGTCGAAAGATGATCAGCACCCTACAGCAGCTGCTAATGCAGACAGGCGCCCACAACTACCATGTGTGCCACCTGTGTGACAAGTCATTCATGAATGCCACCTTTCTCCGGGGCCACATCCAACGCAGGCATGCAGGCATGGCAGAAGGTGGAAAGCAGAAACAGCAGGAACGGCCAGCTGAGGAGCTACTGGAAGAGCTGAGAGCCAAGCTGAAGTGGACCCAAGGGGAGCTGGAAGCCCAGAGGGAGGCCGAGAGGCAGCGCCAGCTCCAGGAAACAGAGATTACTCGTCAGAGGGAAATAGAAGTGAAGAAAGAATTTGATGAATGGAAAGAAAATGAGCGGACCAAGCTTTATGGAGAAATAGACAAGCTAAAACAATTACTTTGGGATGAATTTAAAACCATTGCCAACCAGAACTCTACCCTAGCAGAGAAACTGCAGGCTCTGCAGTCCCACAGTGTGATGGAATCCCACCTTGGATCACTGCGGGATGAGGACTCCGAGGAGCGACTCAGGCAGGCAGAAGAGCTCCAGGCCCTGCGAGAGAAGATGGAGATTCAGAAAACAGAATGGAAGAGAAAGTTGAAGGAATTGCAGGAAGAGCATGTGACAGAGAGGAGAGAGCTACAGGAGGAGAATGAGAGGCTCCAGGCCTCCCTGTCTCAGGATCAGAGGAAGGCAGCCACCCAGTCCCAGCACCAGATCAATGCCCTCCGTGCCCAGCTGCGGGAACAAGCCAGGCTCATAGCCTCCCAAGAGGAGAAGATCCAGACCTTGTCCCTCAGGAAGGCAGAGTGGATCCAAGAGATACCAAAGGCTGTGGACACAGAGGAGGACTCTCTTGAGGAAGAGCTGAAGGACTCCCAAGATGAACAGCAGCAGGTGCTGGCTGCTCTGAGGCGAAACCCTCCATTGATGAAGCAGTTCCGGCCTATCCTGGAGGACACCCTGGAAGAGAAGCTGGAAAGCATGGGAATAAAGAGGGATGCAAAGGGAATTGCTGTTCATACTCTCAGACACCTGGAGTCCGTGCTGAAAGCCCAGCGGGAGCAGAAGGCCAGGAAGTTTTCTGAATTTCTGAGTCTGAGGAAAAAGCTCATCAAAGAAGCCATCAGCAGAGTGAAGGAGAGACACAATGGGAATGTGGTGTCCCAGCCCAAGGGCCAGCCTCCAGACAAAAGTCAGCGGAGCACACTGCTTACCAGAGAGGCCCGGCCAAAGACCAGGGCCCTGCATGTGGCGCTGCCATCCAAGCTGGCAGAGCCATTCACACCAGCTCCTCAGAGCCGCAGCAGCCATGGCTCTGGTCCAACCCAGGTGTCTGCCCCAACTCCACGCCCCAGAGTGCAAGGACCCTCCAGCACCCCTGCCCCCCACGGGCCAGGGCTGAGCAGCACACCCCCATTCAGTTCCGAGGAGGACTCAGAGGGAAACACCGTGCATCGCATGTCTCTTCAGAACCCCCAAGTTACTTCCAAGATGGTGCCCCAGCAGAAGAATGATTGGGATTCATCTGACACTGAGTCCTCGGAAGAGAATGTGCAGCCCCCTGGCAAGGGCTCAGATGGGCTGGCTTCCTCTGGGACACTGGTGCAGTTGATGGTGAAAAATCTCGAGAAGCAGCTTGAGGCTCCAGTGAAGAATCCTGCTGGAGGGGTCAGTCTGTTCTTAAGGCCCAATGCCGGGCCTCAGAAGGCTACCATGCTGGGAAGGAAGCCTCAGCTTTCTGAAGATGAGAGCGACTTGGAGATCTCTTCCTTGGAAGATCTCTCTCAGGACCTGGACCAGAGAGAGAAACCAAAGCCCTGGTCCCGCTCAAAGCTCCCAGAGAAGATTGATGCCAGTTCTTGGAATTCTGGCCGGCCCAGGGTCCCTGGCTGGTGA

XM_004834302.1 Coding sequence

Dzip1l DAZ interacting zinc finger protein 1-like, transcript variant X1

Length: 2406 bp    Location: 14606727..14568633   Strand: -
>XM_004834302.1
ATGGCCCTCTTCCAGCTCTTTGGCCAGCTGCCGTGGCCTGGGTGGCACCCTACCCCAGTAGTCAGCCCAGGGCTTCTCTCACCCATGCAACCCCCAGCTGTCACTGCTGAGGGCCTCAGCAGCCCACTCTTTGGGACCTGCACACTCCCCACCTTCAAATTCCAGCCTCGCCGTGAGAGCATAGACTGGAGGCGCATTAGTGCTTTGGATGTGGACCGTGTAGCCCAGGAGCTGGATGTGGCCACTCTGCAGGAGAACATTGCTGGTGTTACCTTCTGCAACTTGAATCAGGAGGTGTGCAGCCGCTGTGGGCACCCTGTGGACCCGGTGCTGCTCAAGGTGCTGCGCCTGGCACAGCTTATCATTGAGTACCTACTGCACTGCCAGGATTGCCTGAGTGCCATCGTCACCCAGCTGGAGGCACGGCTGCAGGCCAGCCTGGGCCAGCAGCAGCGTGGCCAGCAGGAGCTGGGCCGCCAGGCTGATGAGCTCAAGGGCGTACGGGAGGAGAGCCGCCGGCGTCGAAAGATGATCAGCACCCTACAGCAGCTGCTAATGCAGACAGGCGCCCACAACTACCATGTGTGCCACCTGTGTGACAAGTCATTCATGAATGCCACCTTTCTCCGGGGCCACATCCAACGCAGGCATGCAGGCATGGCAGAAGGTGGAAAGCAGAAACAGCAGGAACGGCCAGCTGAGGAGCTACTGGAAGAGCTGAGAGCCAAGCTGAAGTGGACCCAAGGGGAGCTGGAAGCCCAGAGGGAGGCCGAGAGGCAGCGCCAGCTCCAGGAAACAGAGATTACTCGTCAGAGGGAAATAGAAGTGAAGAAAGAATTTGATGAATGGAAAGAAAATGAGCGGACCAAGCTTTATGGAGAAATAGACAAGCTAAAACAATTACTTTGGGATGAATTTAAAACCATTGCCAACCAGAACTCTACCCTAGCAGAGAAACTGCAGGCTCTGCAGTCCCACAGTGTGATGGAATCCCACCTTGGATCACTGCGGGATGAGGACTCCGAGGAGCGACTCAGGCAGGCAGAAGAGCTCCAGGCCCTGCGAGAGAAGATGGAGATTCAGAAAACAGAATGGAAGAGAAAGTTGAAGGAATTGCAGGAAGAGCATGTGACAGAGAGGAGAGAGCTACAGGAGGAGAATGAGAGGCTCCAGGCCTCCCTGTCTCAGGATCAGAGGAAGGCAGCCACCCAGTCCCAGCACCAGATCAATGCCCTCCGTGCCCAGCTGCGGGAACAAGCCAGGCTCATAGCCTCCCAAGAGGAGAAGATCCAGACCTTGTCCCTCAGGAAGGCAGAGTGGATCCAAGAGATACCAAAGGCTGTGGACACAGAGGAGGACTCTCTTGAGGAAGAGCTGAAGGACTCCCAAGATGAACAGCAGCAGGTGCTGGCTGCTCTGAGGCGAAACCCTCCATTGATGAAGCAGTTCCGGCCTATCCTGGAGGACACCCTGGAAGAGAAGCTGGAAAGCATGGGAATAAAGAGGGATGCAAAGGGAATTGCTGTTCATACTCTCAGACACCTGGAGTCCGTGCTGAAAGCCCAGCGGGAGCAGAAGGCCAGGAAGTTTTCTGAATTTCTGAGTCTGAGGAAAAAGCTCATCAAAGAAGCCATCAGCAGAGTGAAGGAGAGACACAATGGGAATGTGGTGTCCCAGCCCAAGGGCCAGCCTCCAGACAAAAGTCAGCGGAGCACACTGCTTACCAGAGAGGCCCGGCCAAAGACCAGGGCCCTGCATGTGGCGCTGCCATCCAAGCTGGCAGAGCCATTCACACCAGCTCCTCAGAGCCGCAGCAGCCATGGCTCTGGTCCAACCCAGGTGTCTGCCCCAACTCCACGCCCCAGAGTGCAAGGACCCTCCAGCACCCCTGCCCCCCACGGGCCAGGGCTGAGCAGCACACCCCCATTCAGTTCCGAGGAGGACTCAGAGGGAAACACCGTGCATCGCATGTCTCTTCAGAACCCCCAAGTTACTTCCAAGATGGTGCCCCAGCAGAAGAATGATTGGGATTCATCTGACACTGAGTCCTCGGAAGAGAATGTGCAGCCCCCTGGCAAGGGCTCAGATGGGCTGGCTTCCTCTGGGACACTGGTGCAGTTGATGGTGAAAAATCTCGAGAAGCAGCTTGAGGCTCCAGTGAAGAATCCTGCTGGAGGGGTCAGTCTGTTCTTAAGGCCCAATGCCGGGCCTCAGAAGGCTACCATGCTGGGAAGGAAGCCTCAGCTTTCTGAAGATGAGAGCGACTTGGAGATCTCTTCCTTGGAAGATCTCTCTCAGGACCTGGACCAGAGAGAGAAACCAAAGCCCTGGTCCCGCTCAAAGCTCCCAGAGAAGATTGATGCCAGTTCTTGGAATTCTGGCCGGCCCAGGGTCCCTGGCTGGTGA

XM_004835152.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 1122 bp    Location: 14640070..14634378   Strand: -
>XM_004835152.1
ATGTTGAAGGAGCTCCAGTTCTCCCTGTCTGTGGTCCTGCTGCTGGCCTGTGGCTTCCTTTACCAGCTCACCTTGAGGTCCCGCTGCCTCTTCTCCTGCCTGCCTTTCTCCAAGTCCCAGCAGGGACAGGATGCCCTCCTGAGCCAGGGACGAAGCATTGTGTTTCTAGAGACTTCGGAGAGACTAGAGCCGCCCCCACTGGTTTCCTGTGCTGTGGAGTCTGCTGCCAAGATTTATCCTGAGCAGCCCGTGATCTTCTTCATGAAGGGTCTCAAAAACTCTACGCAGCTGCCCTCCAACTCCAGTTACCCAGCCTTCTCCCTCCTCTCAGGAATAGACAATGTGTTCTTCTTCCCTTTGGATATGAACAGGCTGTTTGAAAACACACCCTTGTTTTCATGGTACACTCACATCAACAGCAAGGTAGAGAGACACTGGCTCCACGTCAGCTCCGATGCATCTCGCCTGGCCATCATCTGGAAATACGGTGGTGTCTACATGGACACTGATATCATCTCCATCAGACCCATTCCCAAGGAAAACTTTCTGGCTGCACAGGCTTCTCAGGTCTCCAGTAATGGGGTGTTTGGGTTCTTACCCCGTCATCCCTTCTTGTGGGAATGTATGGAAAATTTTGTTGAACACTACAACTCACACATTTGGGGTAACCAAGGTCCCCGTTTGATAACGAGGATGTTGAGGGTGTGGTGTAAACTCAGAGACTTCCAAGACCTCGGTGACCTCAGGTGTCAGAACATTTCCTTCCTACATCCCCAAAGATTTTATCCTATTTCCTATTCAAAGTGGAGGCGCTACTATGAAGTTTGGGACCCAGAACCAAACTTCAATGACTCTTATGCCCTGCATCTGTGGAACCACATGAACCAGGGGAAGAGGACTGTGATTAAAGGAAGCAACACCCTGGTGGAAAATCTCTATCGCAAGTACTGTCCGACAACTTACCGGCATCTGGTTCAAGGCCCAGAAGGGTCAGTGACCNNAGGTCCAGGTAACAAAGAGCCAACGCTGGGTTGTTGCTGCTATGTGAAACTGGATGCCTCCTGGTCTGCAATACTCTCACTGATCTCCACTGTATCCAGAGGTTTGTGGCTCACCCACTAG

XM_004834307.1 Coding sequence

Dbr1 debranching RNA lariats 1, transcript variant X2

Length: 1401 bp    Location: 14693399..14683051   Strand: -
>XM_004834307.1
ATGCGTGTGGCAGTGGCCGGCTGTTGCCACGGAGAGCTGGACAAGATCTACGAGACGCTGGCGCTGGCGGAGCGGCGTGGGGCAGGCCCGGTGGACCTTCTTCTGTGCTGCGGCGACTTCCAGGCTGTGCGCAATGAGGCCGACCTGCGTTGCATGGCTGTGCCGCCCAAGTACCGCCACATGCAGACTTTCTACAGGTATTACTCTGGAGAGAAAAAGGCCCCTGTTCTCACAGTTTTCATCGGGGGAAACCATGAGGCCTCAAATCATTTGCAAGAGTTACCTTATGGTGGCTGGGTAGCACCAAACATTTACTATTTAGGTTTGGCTGGTGTAGTAAAATACCGCGGTGTAAGGATTGGTGGAATTTCTGGTATCTTTAAATCTCATGACTATCGAAAAGGTCATTTTGAGTGTCCTCCTTATAATTCATCTACAATAAGGAGTATATATCATGTGAGAAATATTGAAGTCTATAAATTAAAACAGGCCATGGATAAAGGGCAGACAGCCAAAGCAACTAAATTTTTAGCCTTGGACAAATGTTTACCACATAGAGACTTTCTTCAGGTTTTAGAAATAGAGCATGACCCCAGTGCTCCTGATTACTTGGAGTATGATATTGAGTGGCTCACTATTCTCAGGGATACTAATGATCTCATTAATGTGACTGGGAACCTTTGGAATATGCCTGAAAATAATGGCCTGCATACAAGGTGGGATTATAGTGCAACAGAAGAAGCTATGAAGGAAGTATTGGAAAAATTGAATAATGACCTCAGAGTTCCATGTAACTTTAGTGTAACCGCTGCTTGTTATGACCCTGGCAAGCCTCAGGCACAGGTACAACTGGTTCATAGGATCAATCCTCAGACTACTGAATTTTGTGCTCAACTTGGCATCACAGACATTAATGTCAGGCTTCAGACAGCCAAGCAAGAACATCATTTGTGCGGTGAATATGAAGAGCAGGATAATGTGGAGAGTAATGACTCTGGAGAAGAGCAAAGTGAATATAACACAGACACGTCTGCCTTGTCCTCTATTAATCCAGATGAAATAATGTTAGATGAAGAGGAAGCTGAAGATGACATTTCATACAGTGATGTGAATACACCATCTGTAGAACCTTCTTCCCATCAAGCTTCTGACTTTTCTGCAAGTTTCTCTGATGTCAGGATCTTGCCAGGTTCCATGATTGTATCTTCTGATGATACATCAGGTTCCTCAGCTGGTAGAGAGGGGAAAGCTGATGAGGCTGTGGAGTTGGGGGATGGAAAGGGCTTAACTGAAGTTCCATCCAAGAGGCTGAGCGAGGAGCATGAACCTGAACAAAGAAAGATTAAGAGGAGGAATCACGCCATCTATGCTGCAGTAGATGATGATAATGATGCAGCATAG

XM_004834306.1 Coding sequence

Dbr1 debranching RNA lariats 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1626 bp    Location: 14693399..14683051   Strand: -
>XM_004834306.1
ATGCGTGTGGCAGTGGCCGGCTGTTGCCACGGAGAGCTGGACAAGATCTACGAGACGCTGGCGCTGGCGGAGCGGCGTGGGGCAGGCCCGGTGGACCTTCTTCTGTGCTGCGGCGACTTCCAGGCTGTGCGCAATGAGGCCGACCTGCGTTGCATGGCTGTGCCGCCCAAGTACCGCCACATGCAGACTTTCTACAGGTATTACTCTGGAGAGAAAAAGGCCCCTGTTCTCACAGTTTTCATCGGGGGAAACCATGAGGCCTCAAATCATTTGCAAGAGTTACCTTATGGTGGCTGGGTAGCACCAAACATTTACTATTTAGGTTTGGCTGGTGTAGTAAAATACCGCGGTGTAAGGATTGGTGGAATTTCTGGTATCTTTAAATCTCATGACTATCGAAAAGGTCATTTTGAGTGTCCTCCTTATAATTCATCTACAATAAGGAGTATATATCATGTGAGAAATATTGAAGTCTATAAATTAAAACAGCTGAAGCAACCTATAGATATATTTTTATCTCATGATTGGCCAAGAAGTATATATCATTATGGAAATAAGAAACAGCTTCTTAAGACCAAATCTTTTTTCCGACATGAAGTGGAAAATAACACGTTGGGAAGTCCTGCAGCCTCAGAACTTTTAGAGCACCTAAAACCTACTTACTGGTTTTCTGCACACCTTCATGTGAAATTTGCAGCCTTGATGCAACACCAGGCCATGGATAAAGGGCAGACAGCCAAAGCAACTAAATTTTTAGCCTTGGACAAATGTTTACCACATAGAGACTTTCTTCAGGTTTTAGAAATAGAGCATGACCCCAGTGCTCCTGATTACTTGGAGTATGATATTGAGTGGCTCACTATTCTCAGGGATACTAATGATCTCATTAATGTGACTGGGAACCTTTGGAATATGCCTGAAAATAATGGCCTGCATACAAGGTGGGATTATAGTGCAACAGAAGAAGCTATGAAGGAAGTATTGGAAAAATTGAATAATGACCTCAGAGTTCCATGTAACTTTAGTGTAACCGCTGCTTGTTATGACCCTGGCAAGCCTCAGGCACAGGTACAACTGGTTCATAGGATCAATCCTCAGACTACTGAATTTTGTGCTCAACTTGGCATCACAGACATTAATGTCAGGCTTCAGACAGCCAAGCAAGAACATCATTTGTGCGGTGAATATGAAGAGCAGGATAATGTGGAGAGTAATGACTCTGGAGAAGAGCAAAGTGAATATAACACAGACACGTCTGCCTTGTCCTCTATTAATCCAGATGAAATAATGTTAGATGAAGAGGAAGCTGAAGATGACATTTCATACAGTGATGTGAATACACCATCTGTAGAACCTTCTTCCCATCAAGCTTCTGACTTTTCTGCAAGTTTCTCTGATGTCAGGATCTTGCCAGGTTCCATGATTGTATCTTCTGATGATACATCAGGTTCCTCAGCTGGTAGAGAGGGGAAAGCTGATGAGGCTGTGGAGTTGGGGGATGGAAAGGGCTTAACTGAAGTTCCATCCAAGAGGCTGAGCGAGGAGCATGAACCTGAACAAAGAAAGATTAAGAGGAGGAATCACGCCATCTATGCTGCAGTAGATGATGATAATGATGCAGCATAG

XM_004834311.1 Coding sequence

Armc8 armadillo repeat containing 8, transcript variant X4

Length: 1821 bp    Location: 14710912..14799806   Strand: +
>XM_004834311.1
ATGGCGTGTCTGTTGGAGACCCCAATCCGCATGAGCGTCCTCTCGGAAGTAACAGCTAGCAGTCGCCACTATGTTGACAGGCTATTTGACCCTGATCCCCAGAAAGTTCTACAAGGTGTCATAGACATGAAAAATGCTGTCATTGGAAACAACAAGCAGAAAGCCAATCTCATTGTTTTAGGAGCTGTTCCAAGATTGTTGTATTTGCTTCAGCAAGAAACATCAAGCACTGAGCTAAAAACTGAATGTGCAGTGGTGCTGGGAAGTCTTGCTATGGGTACTGAAAATAATGTCAAGTCTCTACTAGACTGCCATATTATCCCTGCCTTACTGCAAGGACTGCTGTCCCCAGACCTGAAGTTCATTGAAGCTTGCCTCCGATGCCTACGTACCATCTTTACCAGTCCTGTCACTCCAGAGGAGCTGTTGTATACAGATGCCACAGTGATACCACACCTCATGGCGCTGCTTAGCAGGTCCCGCTATACCCAGGAATATATCTGTCAGATCTTCTCACACTGCTGTAAAGGGCCAGATCATCAAACAATTTTATTTAACCATGGTGCAGTTCAGAATATTGCTCACCTACTAACCTCACTGTCCTACAAAGTTCGAATGCAAGCCCTGAAATGCTTCTCCGTTTTAGCTTTTGAAAACCCCCAGGTATCCATGACCCTGGTAAACGTTTTGGTTGATGGAGAATTGTTACCGCAGATATTTGTGAAGATGTTACAGAGGGATAAGCCTATTGAGATGCAGCTAACGTCAGCAAAATGTTTAACTTACATGTGTAGAGCTGGAGCAATTCGGACAGATGATAACTGTATTGTATTAAAGCTTGATCATGACTTAAAACATGCTCACGAACTCCGCCAGGCTGCATTCAAGCTCTATGCCTCTCTTGGAGCAAATGATGAAGACATCCGGAAGAAGATCATTGAGACTGAAAATATGATGGACCGAATTGTGACTGGCTTGTCTGAGTCTAGTGTCAAGGTGCGATTAGCTGCTGTCAGATGTTTGCACAGTTTATCCAGATCTGTACAGCAACTTCGAACCAGTTTCCAGGATCATGCTGTGTGGAAACCTTTAATGAAGGTTTTACAAAATGCACCGGATGAAATCCTAGTAGTAGCATCATCCATGTTATGTAATCTGCTTCTTGAATTTTCCCCAAGCAAAGAGCCAATTTTAGAATCAGGAGCTGTAGAGCTACTTTGTGGATTAACCCAAAGTGAAAATCCTGCCTTAAGAGTGAACGGAATTTGGGCTTTAATGAATATGGCATTTCAGGCTGAACAAAAAATTAAAGCAGATATTTTACGAAGCTTGAGTACTGAACAGCTATTCCGGTTATTATCAGATTCAGATTTGAATGTGCTGATGAAGACATTGGGACTTCTTAGAAATCTCCTTTCTACTCGGCCTCATATAGATAAAATAATGAGTACTCATGGGAAGCAAATTATGCAGGCTGTCACCCTTATTCTAGAAGGAGAGCATAACATCGAGGTTAAAGAGCAGACTTTGTGTATCCTAGCCAACATAGCAGATGGAACAACAGCAAAAGAACTTATTATGACCAATGATGACATCCTGCAGAAAATCAAATATTACATGGGTCATTCACATGTCAAACTGCAGCTTGCCGCTATGTTTTGTATATCAAACCTCATATGGAATGAAGAGGAAGGATCACAAGAACGCCAAGATAAATTACGAGACATGGGCATCGTAGATATTCTACACAAACTGAGTCAGTCACCAGATACAAATCTTTGTGACAAGGCGAAGACGGCACTGCAGCAGTACCTGGCATGA

XM_004834310.1 Coding sequence

Armc8 armadillo repeat containing 8, transcript variant X3

Length: 1872 bp    Location: 14710913..14799806   Strand: +
>XM_004834310.1
ATGGCGTGTCTGTTGGAGACCCCAATCCGCATGAGCGTCCTCTCGGAAGTAACAGCTAGCAGTCGCCACTATGTTGACAGGCTATTTGACCCTGATCCCCAGAAAGTTCTACAAGGTGTCATAGACATGAAAAATGCTGTCATTGGAAACAACAAGCAGAAAGCCAATCTCATTGTTTTAGGAGCTGTTCCAAGATTGTTGTATTTGCTTCAGCAAGAAACATCAAGCACTGAGCTAAAAACTGAATGTGCAGTGGTGCTGGGAAGTCTTGCTATGGGTACTGAAAATAATGTCAAGTCTCTACTAGACTGCCATATTATCCCTGCCTTACTGCAAGGACTGCTGTCCCCAGACCTGAAGTTCATTGAAGCTTGCCTCCGATGCCTACGTACCATCTTTACCAGTCCTGTCACTCCAGAGGAGCTGTTGTATACAGATGCCACAGTGATACCACACCTCATGGCGCTGCTTAGCAGGTCCCGCTATACCCAGGAATATATCTGTCAGATCTTCTCACACTGCTGTAAAGGGCCAGATCATCAAACAATTTTATTTAACCATGGTGCAGTTCAGAATATTGCTCACCTACTAACCTCACTGTCCTACAAAGTTCGAATGCAAGCCCTGAAATGCTTCTCCGTTTTAGCTTTTGAAAACCCCCAGGTATCCATGACCCTGGTAAACGTTTTGGTTGATGGAGAATTGTTACCGCAGATATTTGTGAAGATGTTACAGAGGGATAAGCCTATTGAGATGCAGCTAACGTCAGCAAAATGTTTAACTTACATGTGTAGAGCTGGAGCAATTCGGACAGATGATAACTGTATTGTATTAAAGACATTGCCTTGTTTGGTTCGAATGTGCAGTAAGGAAAGATTACTAGAGGAGAGAGTTGAAGGAGCTGAAACACTCGCGTATCTGATTGAGCCAGATGTTGAGCTACAGAGAATCGCTAGCATTACTGATCACCTCATTGCCATGCTTGCTGATTATTTCAAGTATCCCAGCTCAGTGAGTGCCATCACTGATATAAAAAGGCTTGATCATGACTTAAAACATGCTCACGAACTCCGCCAGGCTGCATTCAAGCTCTATGCCTCTCTTGGAGCAAATGATGAAGACATCCGGAAGAAGATCATTGAGACTGAAAATATGATGGACCGAATTGTGACTGGCTTGTCTGAGTCTAGTGTCAAGGTGCGATTAGCTGCTGTCAGATGTTTGCACAGTTTATCCAGATCTGTACAGCAACTTCGAACCAGTTTCCAGGATCATGCTGTGTGGAAACCTTTAATGAAGGTTTTACAAAATGCACCGGATGAAATCCTAGTAGTAGCATCATCCATGTTATGTAATCTGCTTCTTGAATTTTCCCCAAGCAAAGAGCCAATTTTAGAATCAGGAGCTGTAGAGCTACTTTGTGGATTAACCCAAAGTGAAAATCCTGCCTTAAGAGTGAACGGAATTTGGGCTTTAATGCATATAGATAAAATAATGAGTACTCATGGGAAGCAAATTATGCAGGCTGTCACCCTTATTCTAGAAGGAGAGCATAACATCGAGGTTAAAGAGCAGACTTTGTGTATCCTAGCCAACATAGCAGATGGAACAACAGCAAAAGAACTTATTATGACCAATGATGACATCCTGCAGAAAATCAAATATTACATGGGTCATTCACATGTCAAACTGCAGCTTGCCGCTATGTTTTGTATATCAAACCTCATATGGAATGAAGAGGAAGGATCACAAGAACGCCAAGATAAATTACGAGACATGGGCATCGTAGATATTCTACACAAACTGAGTCAGTCACCAGATACAAATCTTTGTGACAAGGCGAAGACGGCACTGCAGCAGTACCTGGCATGA

XM_004834317.1 Coding sequence

Mras muscle RAS oncogene homolog, transcript variant X6

High confidence: 4 potential gene matches
Length: 627 bp    Location: 14838847..14938682   Strand: +
>XM_004834317.1
ATGGCAACCAGCGCTGTTCCCAGTGATAACCTCCCCACCTACAAGCTGGTGGTGGTGGGCGACGGGGGTGTGGGGAAGAGTGCTCTCACCATCCAGTTTTTCCAGAAGATCTTTGTGCCTGACTACGACCCCACCATTGAGGACTCCTACCTGAAGCATACAGAGATTGACAATCAGTGGGCCATCTTAGATGTGCTGGACACAGCTGGGCAGGAGGAGTTCAGCGCCATGCGGGAGCAGTACATGCGCACAGGGGATGGCTTCCTCATCGTCTACTCTGTCACCGACAAGGCCAGCTTTGAGCACGTGGACCGCTTCCACCAGCTCATCCTGCGCGTCAAGGACAGGGAGTCATTTCCGATGATCCTTGTGGCCAACAAAGTTGATTTGATGCACCTGAGGAAAATCACGAGGGAGCAAGGAAAAGAAATGGCGACCAAACACAATATTCCTTACATAGAAACCAGTGCCAAGGACCCGCCTCTCAATGTGGACAAAGCCTTCCATGACCTCGTTAGAGTAATTAGGCAACAGATTCCAGAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCGAGGAGACCGTGCCACTGGTACCCACAAACTGCAATGTGTGATATTGTGA

XM_004834314.1 Coding sequence

Mras muscle RAS oncogene homolog, transcript variant X3

Length: 627 bp    Location: 14879584..14938682   Strand: +
>XM_004834314.1
ATGGCAACCAGCGCTGTTCCCAGTGATAACCTCCCCACCTACAAGCTGGTGGTGGTGGGCGACGGGGGTGTGGGGAAGAGTGCTCTCACCATCCAGTTTTTCCAGAAGATCTTTGTGCCTGACTACGACCCCACCATTGAGGACTCCTACCTGAAGCATACAGAGATTGACAATCAGTGGGCCATCTTAGATGTGCTGGACACAGCTGGGCAGGAGGAGTTCAGCGCCATGCGGGAGCAGTACATGCGCACAGGGGATGGCTTCCTCATCGTCTACTCTGTCACCGACAAGGCCAGCTTTGAGCACGTGGACCGCTTCCACCAGCTCATCCTGCGCGTCAAGGACAGGGAGTCATTTCCGATGATCCTTGTGGCCAACAAAGTTGATTTGATGCACCTGAGGAAAATCACGAGGGAGCAAGGAAAAGAAATGGCGACCAAACACAATATTCCTTACATAGAAACCAGTGCCAAGGACCCGCCTCTCAATGTGGACAAAGCCTTCCATGACCTCGTTAGAGTAATTAGGCAACAGATTCCAGAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCGAGGAGACCGTGCCACTGGTACCCACAAACTGCAATGTGTGATATTGTGA

XM_004834313.1 Coding sequence

Mras muscle RAS oncogene homolog, transcript variant X2

Length: 627 bp    Location: 14880380..14938682   Strand: +
>XM_004834313.1
ATGGCAACCAGCGCTGTTCCCAGTGATAACCTCCCCACCTACAAGCTGGTGGTGGTGGGCGACGGGGGTGTGGGGAAGAGTGCTCTCACCATCCAGTTTTTCCAGAAGATCTTTGTGCCTGACTACGACCCCACCATTGAGGACTCCTACCTGAAGCATACAGAGATTGACAATCAGTGGGCCATCTTAGATGTGCTGGACACAGCTGGGCAGGAGGAGTTCAGCGCCATGCGGGAGCAGTACATGCGCACAGGGGATGGCTTCCTCATCGTCTACTCTGTCACCGACAAGGCCAGCTTTGAGCACGTGGACCGCTTCCACCAGCTCATCCTGCGCGTCAAGGACAGGGAGTCATTTCCGATGATCCTTGTGGCCAACAAAGTTGATTTGATGCACCTGAGGAAAATCACGAGGGAGCAAGGAAAAGAAATGGCGACCAAACACAATATTCCTTACATAGAAACCAGTGCCAAGGACCCGCCTCTCAATGTGGACAAAGCCTTCCATGACCTCGTTAGAGTAATTAGGCAACAGATTCCAGAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCGAGGAGACCGTGCCACTGGTACCCACAAACTGCAATGTGTGATATTGTGA

XM_004834312.1 Coding sequence

Mras muscle RAS oncogene homolog, transcript variant X1

Length: 627 bp    Location: 14880473..14938682   Strand: +
>XM_004834312.1
ATGGCAACCAGCGCTGTTCCCAGTGATAACCTCCCCACCTACAAGCTGGTGGTGGTGGGCGACGGGGGTGTGGGGAAGAGTGCTCTCACCATCCAGTTTTTCCAGAAGATCTTTGTGCCTGACTACGACCCCACCATTGAGGACTCCTACCTGAAGCATACAGAGATTGACAATCAGTGGGCCATCTTAGATGTGCTGGACACAGCTGGGCAGGAGGAGTTCAGCGCCATGCGGGAGCAGTACATGCGCACAGGGGATGGCTTCCTCATCGTCTACTCTGTCACCGACAAGGCCAGCTTTGAGCACGTGGACCGCTTCCACCAGCTCATCCTGCGCGTCAAGGACAGGGAGTCATTTCCGATGATCCTTGTGGCCAACAAAGTTGATTTGATGCACCTGAGGAAAATCACGAGGGAGCAAGGAAAAGAAATGGCGACCAAACACAATATTCCTTACATAGAAACCAGTGCCAAGGACCCGCCTCTCAATGTGGACAAAGCCTTCCATGACCTCGTTAGAGTAATTAGGCAACAGATTCCAGAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCGAGGAGACCGTGCCACTGGTACCCACAAACTGCAATGTGTGATATTGTGA

XM_004834323.1 Coding sequence

Cep70 centrosomal protein 70kDa, transcript variant X4

Length: 1860 bp    Location: 15106700..15048836   Strand: -
>XM_004834323.1
ATGACTGAGGCAGCTCAAATCATCTTATTGCCAGCCTCTACCTCTTTTGATTCTGCAAGAGAAACAGTGCCTGCAGAAGTCCCTAAAGCCCAGGAATCCAGTCAATTGTCAAACAGACTCATGATTGAAAAACAGCAGGAGGAAGCAGAATGGGAAATCATAAATGTGCTGTTAATGAGGCATGACTTAAAACCTTTGTGCCTTGTCAAAAGAACAGATCTTAAAGATCTTATCATTTTTGATAAACAGTCATCACAAAGGATGAGGCAGAATTTGAAAATGTTGGTGGAAGAAACAGAACGTCAACAGAACGTGATACAAGAGCTCATAGAAACTAATCAGCAGCTTAAAGATGAGCTTCAGCTAGAACAAAGCCGAGCAGCACATCAGGAACAACGAGCTAATGACTTGGAAAAAATTATGGAGAGTGTGAAATGCAAAATTGGTGAATTGGAAGATGAATCTCTAAATAGGGTTTGCCAGCAACAAAATAAAATGAAAGATCTTCGGAAGGAGAATAGAACTTTACAGACAAAGTGCCAGCATTACAAGAAAAAACAAATGGAGCAGCAACAGACTATTGCTTCTTTGCAAAAGGATATCTGTCGATTAACAAAAGAGGAAGAAGAACGAATTATCACTCAAAACAGAGTGTTTGCCTATCTCTGCAAAAGAGTTCCTCATAGCGTCTTGGATAGACAGTTGCTTTGCCTAATTGACTACTATGAATCTAAAATTAGAAAAATCCACACACAAAGGCAATATAAAAAAGATGAAAGTCAATCAGAAGAAGAAAAAGGTTATAGAAATCTGAATGGCTCACCAACTTACAAAGGCCTTCTACTGTCATTACAGAATCAACTCAAGGAATCAAACTCCAAGATTGATGCACTTTTAAGTGAAAAGCTGAACCTCCAAAAAGATTTAGAAAGCAGGCCCACACAACATGAATTAAGACTTTATAAGCAACAAGTGAAGAAACTGGAGAAAGTCCTCAAGAAAAACATTAAATTACAGGAGCTTATCAGTCATACAAAAACCGAGGACACAGAGAAAAAAGATGAATCCAGCAAAGAAAGCCATCACCAAGCTCTAGTTGACCAGAGATACTCTCAGGTGCTATGTAGCATCAATTCAATTATTCACAATCCAAGAGCTCCAGTGATAATTTATAAACAGAGCAAAGAAGGAACCCAACATTTTAACAAAGATTTTGTTCAAGACTGTGGATTTGAACATCTTGTTCCTATAATAGAAATGTGGGCAGATGAACTGACATCCTTGAAGGATTTGTATAAGTCCTTGAAAATACTATCTGCAGACCTGGTGCCTTGGCATAATTTTAAGAAACAGGATGAAAATGAAGGTGTCAGAGTTGAAAATTTGTTGTTTATGGTAGATACCATATTGGAAGAAGTTGAAAATAAGGAAAAGGACAGCAACATGCCAAACTTTCAAACTTTGCAAGCTATTGTCTCTCACTTCCAAAAATTATTTGATGTGCCTTCTTTAAATGGAGTCTATCCCCGAATGAATGAAGTTTATACTAGGCTTGGAGAAATGAACAATGCTGTGAGAAACCTCCAAGAACTCTTAGAATTAGATAGTTCATCTTCATTGTGTGTACTGGTAAGCACAGTTGGAAAATTGTGTAGGCTGATTAATGAGGATGTGAGTGAGCAGGTTAAGCAAGTATTAGGACCTGAAGACCTCCAAAGCATTATCAACAAATTGGAAGAACATGAAGAATTTTTCCCAGCATTTCAGGCATTTACTAATGATCTACTTAAAATCTTAGAAATTGATGACTTGGATGCCATTGTACCTGCAGTAAAGAAATTAAAAGTACTTTCATACTGA

XM_004834321.1 Coding sequence

Cep70 centrosomal protein 70kDa, transcript variant X2

Length: 1896 bp    Location: 15106700..15049489   Strand: -
>XM_004834321.1
ATGACTGAGGCAGCTCAAATCATCTTATTGCCAGCCTCTACCTCTTTTGATTCTGCAAGAGAAACAGTGCCTGCAGAAGTCCCTAAAGCCCAGGAATCCAGTCAATTGTCAAACAGACTCATGATTGAAAAACAGCAGGAGGAAGCAGAATGGGAAATCATAAATGTGCTGTTAATGAGGCATGACTTAAAACCTTTGTGCCTTGTCAAAAGAACAGATCTTAAAGATCTTATCATTTTTGATAAACAGTCATCACAAAGGATGAGGCAGAATTTGAAAATGTTGGTGGAAGAAACAGAACGTCAACAGAACGTGATACAAGAGCTCATAGAAACTAATCAGCAGCTTAAAGATGAGCTTCAGCTAGAACAAAGCCGAGCAGCACATCAGGAACAACGAGCTAATGACTTGGAAAAAATTATGGAGAGTGTGAAATGCAAAATTGGTGAATTGGAAGATGAATCTCTAAATAGGGTTTGCCAGCAACAAAATAAAATGAAAGATCTTCGGAAGGAGAATAGAACTTTACAGACAAAGTGCCAGCATTACAAGAAAAAACAAATGGAGCAGCAACAGACTATTGCTTCTTTGCAAAAGGATATCTGTCGATTAACAAAAGAGGAAGAAGAACGAATTATCACTCAAAACAGAGTGTTTGCCTATCTCTGCAAAAGAGTTCCTCATAGCGTCTTGGATAGACAGTTGCTTTGCCTAATTGACTACTATGAATCTAAAATTAGAAAAATCCACACACAAAGGCAATATAAAAAAGATGAAAGTCAATCAGAAGAAGAAAAAGGTTATAGAAATCTGAATGGCTCACCAACTTACAAAGGCCTTCTACTGTCATTACAGAATCAACTCAAGGAATCAAACTCCAAGATTGATGCACTTTTAAGTGAAAAGCTGAACCTCCAAAAAGATTTAGAAAGCAGGCCCACACAACATGAATTAAGACTTTATAAGCAACAAGTGAAGAAACTGGAGAAAGTCCTCAAGAAAAACATTAAATTACAGGAGCTTATCAGTCATACAAAAACCGAGGACACAGAGAAAAAAGATGAATCCAGCAAAGAAAGCCATCACCAAGCTCTAGTTGACCAGAGATACTCTCAGGTGCTATGTAGCATCAATTCAATTATTCACAATCCAAGAGCTCCAGTGATAATTTATAAACAGAGCAAAGAAGGAACCCAACATTTTAACAAAGATTTTGTTCAAGACTGTGGATTTGAACATCTTGTTCCTATAATAGAAATGTGGGCAGATGAACTGACATCCTTGAAGGATTTGTATAAGTCCTTGAAAATACTATCTGCAGACCTGGTGCCTTGGCATAATTTTAAGAAACAGGATGAAAATGAAGGTGTCAGAGTTGAAAATTTGTTGTTTATGGTAGATACCATATTGGAAGAAGTTGAAAATAAGGAAAAGGACAGCAACATGCCAAACTTTCAAACTTTGCAAGCTATTGTCTCTCACTTCCAAAAATTATTTGATGTGCCTTCTTTAAATGGAGTCTATCCCCGAATGAATGAAGTTTATACTAGGCTTGGAGAAATGAACAATGCTGTGAGAAACCTCCAAGAACTCTTAGAATTAGATAGTTCATCTTCATTGTGTGTACTGGTAAGCACAGTTGGAAAATTGTGTAGGCTGATTAATGAGGATGTGAGTGAGCAGGTTAAGCAAGTATTAGGACCTGAAGACCTCCAAAGCATTATCAACAAATTGGAAGAACATGAAGAATTTTTCCCAGCATTTCAGGCATTTACTAATGATCTACTTAAAATCTTAGGTAAGATCTCATTGTTGGTAAATTTTGACTCTTATTTGGCTTTGAAAGAAGAATGGTCTTTAGTCAATTGGATTAGTGTTTTTACCTTGAATGCTTGA

XM_004834320.1 Coding sequence

Cep70 centrosomal protein 70kDa, transcript variant X1

Length: 1899 bp    Location: 15106700..15049489   Strand: -
>XM_004834320.1
ATGACTGAGGCAGCTCAAATCATCTTATTGCCAGCCTCTACCTCTTTTGATTCTGCAAGAGAAACAGTGCCTGCAGAAGTCCCTAAAGCCCAGGAATCCAGTCAATTGTCAAACAGACTCATGATTGAAAAACAGCAGGAGGAAGCAGAATGGGAAATCATAAATGTGCTGTTAATGAGGCATGACTTAAAACCTTTGTGCCTTGTCAAAAGAACAGATCTTAAAGGTAATCAGATCTTATTGTTCTTCAAGTCATCACAAAGGATGAGGCAGAATTTGAAAATGTTGGTGGAAGAAACAGAACGTCAACAGAACGTGATACAAGAGCTCATAGAAACTAATCAGCAGCTTAAAGATGAGCTTCAGCTAGAACAAAGCCGAGCAGCACATCAGGAACAACGAGCTAATGACTTGGAAAAAATTATGGAGAGTGTGAAATGCAAAATTGGTGAATTGGAAGATGAATCTCTAAATAGGGTTTGCCAGCAACAAAATAAAATGAAAGATCTTCGGAAGGAGAATAGAACTTTACAGACAAAGTGCCAGCATTACAAGAAAAAACAAATGGAGCAGCAACAGACTATTGCTTCTTTGCAAAAGGATATCTGTCGATTAACAAAAGAGGAAGAAGAACGAATTATCACTCAAAACAGAGTGTTTGCCTATCTCTGCAAAAGAGTTCCTCATAGCGTCTTGGATAGACAGTTGCTTTGCCTAATTGACTACTATGAATCTAAAATTAGAAAAATCCACACACAAAGGCAATATAAAAAAGATGAAAGTCAATCAGAAGAAGAAAAAGGTTATAGAAATCTGAATGGCTCACCAACTTACAAAGGCCTTCTACTGTCATTACAGAATCAACTCAAGGAATCAAACTCCAAGATTGATGCACTTTTAAGTGAAAAGCTGAACCTCCAAAAAGATTTAGAAAGCAGGCCCACACAACATGAATTAAGACTTTATAAGCAACAAGTGAAGAAACTGGAGAAAGTCCTCAAGAAAAACATTAAATTACAGGAGCTTATCAGTCATACAAAAACCGAGGACACAGAGAAAAAAGATGAATCCAGCAAAGAAAGCCATCACCAAGCTCTAGTTGACCAGAGATACTCTCAGGTGCTATGTAGCATCAATTCAATTATTCACAATCCAAGAGCTCCAGTGATAATTTATAAACAGAGCAAAGAAGGAACCCAACATTTTAACAAAGATTTTGTTCAAGACTGTGGATTTGAACATCTTGTTCCTATAATAGAAATGTGGGCAGATGAACTGACATCCTTGAAGGATTTGTATAAGTCCTTGAAAATACTATCTGCAGACCTGGTGCCTTGGCATAATTTTAAGAAACAGGATGAAAATGAAGGTGTCAGAGTTGAAAATTTGTTGTTTATGGTAGATACCATATTGGAAGAAGTTGAAAATAAGGAAAAGGACAGCAACATGCCAAACTTTCAAACTTTGCAAGCTATTGTCTCTCACTTCCAAAAATTATTTGATGTGCCTTCTTTAAATGGAGTCTATCCCCGAATGAATGAAGTTTATACTAGGCTTGGAGAAATGAACAATGCTGTGAGAAACCTCCAAGAACTCTTAGAATTAGATAGTTCATCTTCATTGTGTGTACTGGTAAGCACAGTTGGAAAATTGTGTAGGCTGATTAATGAGGATGTGAGTGAGCAGGTTAAGCAAGTATTAGGACCTGAAGACCTCCAAAGCATTATCAACAAATTGGAAGAACATGAAGAATTTTTCCCAGCATTTCAGGCATTTACTAATGATCTACTTAAAATCTTAGGTAAGATCTCATTGTTGGTAAATTTTGACTCTTATTTGGCTTTGAAAGAAGAATGGTCTTTAGTCAATTGGATTAGTGTTTTTACCTTGAATGCTTGA

XM_004834325.1 Coding sequence

Cep70 centrosomal protein 70kDa, transcript variant X6

Length: 1635 bp    Location: 15095089..15049489   Strand: -
>XM_004834325.1
ATGAGGCAGAATTTGAAAATGTTGGTGGAAGAAACAGAACGTCAACAGAACGTGATACAAGAGCTCATAGAAACTAATCAGCAGCTTAAAGATGAGCTTCAGCTAGAACAAAGCCGAGCAGCACATCAGGAACAACGAGCTAATGACTTGGAAAAAATTATGGAGAGTGTGAAATGCAAAATTGGTGAATTGGAAGATGAATCTCTAAATAGGGTTTGCCAGCAACAAAATAAAATGAAAGATCTTCGGAAGGAGAATAGAACTTTACAGACAAAGTGCCAGCATTACAAGAAAAAACAAATGGAGCAGCAACAGACTATTGCTTCTTTGCAAAAGGATATCTGTCGATTAACAAAAGAGGAAGAAGAACGAATTATCACTCAAAACAGAGTGTTTGCCTATCTCTGCAAAAGAGTTCCTCATAGCGTCTTGGATAGACAGTTGCTTTGCCTAATTGACTACTATGAATCTAAAATTAGAAAAATCCACACACAAAGGCAATATAAAAAAGATGAAAGTCAATCAGAAGAAGAAAAAGGTTATAGAAATCTGAATGGCTCACCAACTTACAAAGGCCTTCTACTGTCATTACAGAATCAACTCAAGGAATCAAACTCCAAGATTGATGCACTTTTAAGTGAAAAGCTGAACCTCCAAAAAGATTTAGAAAGCAGGCCCACACAACATGAATTAAGACTTTATAAGCAACAAGTGAAGAAACTGGAGAAAGTCCTCAAGAAAAACATTAAATTACAGGAGCTTATCAGTCATACAAAAACCGAGGACACAGAGAAAAAAGATGAATCCAGCAAAGAAAGCCATCACCAAGCTCTAGTTGACCAGAGATACTCTCAGGTGCTATGTAGCATCAATTCAATTATTCACAATCCAAGAGCTCCAGTGATAATTTATAAACAGAGCAAAGAAGGAACCCAACATTTTAACAAAGATTTTGTTCAAGACTGTGGATTTGAACATCTTGTTCCTATAATAGAAATGTGGGCAGATGAACTGACATCCTTGAAGGATTTGTATAAGTCCTTGAAAATACTATCTGCAGACCTGGTGCCTTGGCATAATTTTAAGAAACAGGATGAAAATGAAGGTGTCAGAGTTGAAAATTTGTTGTTTATGGTAGATACCATATTGGAAGAAGTTGAAAATAAGGAAAAGGACAGCAACATGCCAAACTTTCAAACTTTGCAAGCTATTGTCTCTCACTTCCAAAAATTATTTGATGTGCCTTCTTTAAATGGAGTCTATCCCCGAATGAATGAAGTTTATACTAGGCTTGGAGAAATGAACAATGCTGTGAGAAACCTCCAAGAACTCTTAGAATTAGATAGTTCATCTTCATTGTGTGTACTGGTAAGCACAGTTGGAAAATTGTGTAGGCTGATTAATGAGGATGTGAGTGAGCAGGTTAAGCAAGTATTAGGACCTGAAGACCTCCAAAGCATTATCAACAAATTGGAAGAACATGAAGAATTTTTCCCAGCATTTCAGGCATTTACTAATGATCTACTTAAAATCTTAGGTAAGATCTCATTGTTGGTAAATTTTGACTCTTATTTGGCTTTGAAAGAAGAATGGTCTTTAGTCAATTGGATTAGTGTTTTTACCTTGAATGCTTGA

XM_004834326.1 Coding sequence

Faim Fas apoptotic inhibitory molecule, transcript variant X1

Length: 606 bp    Location: 15114916..15145205   Strand: +
>XM_004834326.1
ATGGCATCTGGAGATGACAGTCCTATCTTTGAAGATGATGAAAGTCCTCCTTATAGCCTGGAAAAAATGACAGATTTTGTAGCTGTATGGGATGTTGCTTTGAGTGATGGAGTCCACAAGATTGAATTTGAACATGGGACCACATCAGGCAAACGAGTAGTATATGTAGATGGAAAGGAAGAGATAAGAAAAGAATGGATGTTCAAATTAGTGGGCAAAGAAACCTTCTGTGTTGGAGCTGCAAAGACAAAAGCAACCATAAATATAGATGCTGTCAGTGGTTTTGCTTATGAATATACTCTGGAAATTAATGGGAAAAGCCTCAAGAAGTATATGGAGAATAGATCAAAAACTACCAATACATGGGTAATGAACTTGGATGGCGAGGACTTTAGAGTTGTTTTGGAAAAAGACACTATGGACGTATGGTGCAATGGTAAAAAGATGGAGACAGCGGATGAGTTTGTAGATGATGGGACTGAAACACACTTCAGTGTTGGGAACCATGACTGTTACATAAAGGCTGTCAGTAGCGGGAAGCGGAAAGAAGGAATTATTCATACTCTCATTGTGGATAACAGAGAAATCCCAGAGATTTTTAAATGA

XM_004834330.1 Coding sequence

Pik3cb phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta, transcript variant X1

Length: 3213 bp    Location: 15355728..15226786   Strand: -
>XM_004834330.1
ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCAGTAGATTCACAAATAGCTTCGGATGGCTCCATAGCTGTGGATTTCCTTTTACCCACTGGGATTTATATCCAGTTGGAGGTACCACGGGAAGCTACCATTTCCTATATTAAGCAGATGTTATGGAAGCAAGTGCACAGTTACCCAATGTTTAACCTGCTTATGGACATTGACTCCTATATGTTTGCATGTGTGAATCAAACTGCTGTATATGAGGAACTTGAAGATGAAACACGAAGACTTTGCGATGTTAGACCTTTTCTTCCAGTTCTCAAGTTAGTGACAAGAAGTTGTGATCCAGGGGAAAAATTGGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATGCCTTAAAGGATCCTGAAGTGAATGAATTTCGACGAAAAATGCGCAAATTCAGTGAGGAAAAGATTCAGTCACTTGTGGGATTATCGTGGATTGACTGGCTAAAGCAAACCTACCCACCAGAACATGATCCATCCATCCTTGAAAACTTGGAAGACAAGCTTTATGGAGGAAAGCTCATTGTAGCTGTTCATTTTGAAAATAGTCAGGATGTGTTTAGCTTTCATGTATCTCCTAATGTGAATCCTATAAAGATAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAAGCCAGCCCTGGTGACTATGTGTTACAAGTCATTGGGAGAGTAGAATATGTATTTGGTGATCACCCACTCATTCAGTTCCAGTACGTCCGGAACTGTGTTGTGAACAGGGCCCTGCCCCATTTTGTGCTTGTGGAATGCTACAAGATCAAGAAGATGTATGAGCAAGAAATGATTGCCATAGAGGCTGCCATAAACCGGAATTCATCTAACTTTCCTCTTCCCTTACCACCAAAGAAAACACGAATTATTTCTCATGTTTGGGACAATAACAACCCTTTCCAAATTGTTTTGGTTAAGGGAAATAAACTTAACACTGAAGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGTACTGAGCTTCTGTGTAAAACCATCGTAAGCTCAGAGATATCAGGGAAAAATGATCACATTTGGAATGAAACACTGGAATTTGATATTAATACTTGTGACTTGCCAAGAATGGCTCGATTATGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACCAAAACTATTAATCCTTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCATGGGTAAATACCATGGTTTTTGACTTTAAAGGACAGTTGAGGTCTGGAGACATAATATTGCACAGCTGGTCTTCATTTCCTGATGAACTTGAAGAAATGTTGAATCCAATGGGAACTGTTCAAACAAATCCATATACTGAAAATGCAACAGCTCTGCACATTAAATTTCCAGAGAATAAAAAACAACCTTATCATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAAATTGCAAGCAGCGATAGTGCTAATGTATCAAGTCGAGGTGGAAAAAAGTTTCTTGCTGTACTGAAAGAAATCTTGGACAGGGATCCCTTGTCTCAGCTGTGTGAGAATGAAATGGATCTTATTTGGACTTTGCGACAAGACTGCAGAGAGAATTTCCCACAGTCACTGCCAAAATTACTCCTGTCAATCAAGTGGAATAAACTTGAAGATGTTGCTCAGCTCCAGGCACTGCTTCAGATTTGGCCTAAACTGCCCCCGAGGGAGGCCCTGGAGCTTCTGGATTTCAACTATCCAGATCAGTATGTACGGGAATATGCAGTGGGCTGCCTGCGTCAGATGAGTGATGAAGAACTCTCTCAATATCTTTTACAACTGGTCCAAGTTTTAAAATATGAGCCTTTTCTTGATTGTGCACTTTCTAGATTTCTATTAGAAAGAGCACTTGCTAATCGGAGAATAGGGCAGTTTCTATTTTGGCATCTCAGGTCAGAGGTGCACATTCCTGCCATCTCAGTACAGTTTGGCGTCATCCTTGAAGCGTACTGTCGAGGAAGTGTAGGGCACATGAAAGTGCTTTCCAAGCAGGTTGAAGCACTCAATAAATTAAAAACTTTAAATAGTTTAATCAAACTGAATGCAGTGAAGTTAAACAGAGCTAAAGGGAAGGAGGCCATGCACACTTGTTTAAAACAGAATGCTTACCGGGAAGCCCTCTCTGATTTGCAGTCACCTCTGAATCCATGTATCATCCTCTCAGAGCTCTATATTGAAAAGTGCAAATACATGGATTCCAAAATGAAGCCTTTGTGGCTCGTATATACCAATAAGGTATTTGGTGAGGATTCAGTTGGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACTCTCCAAATGCTGCGCTTGATGGATTTACTCTGGAAAGAAGCTGGTCTGGACCTTCGGATGCTGCCTTATGGCTGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATTGCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCGGCCTTCAATAAAGATGCCCTTCTGAACTGGCTTAAAGAATACAATTCTGGGGATGACCTGGACCGAGCCATTGAAGAGTTTACCCTATCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTCGGGATTGGTGACAGACATAGTGACAACATAATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACATATTCTTGGAAATTTCAAATCTAAATTTGGCATTAAAAGAGAACGAGTGCCTTTTATTCTTACTTATGATTTCATTCATGTCATTCAACAAGGAAAAACAGGAAACACGGAAAAGTTTGGCCGATTTCGCCAGTGTTGTGAAGATGCATATTTGATTTTACGAAGACATGGAAATCTCTTCATCACTCTCTTTGCACTGATGTTGACTGCAGGGCTTCCTGAACTTACATCAGTCAAGGATATACAGTATCTTAAGGACTCTCTTGCCTTAGGAAAGAGTGATGAAGAAGCACTCAAACAATTTAAGCAAAAATTTGATGAGGCACTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATGGCTCACACTGTTCGGAAAGACTACAGATCTTAA

XM_004834331.1 Coding sequence

Pik3cb phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta, transcript variant X2

High confidence: 4 potential gene matches
Length: 3213 bp    Location: 15355728..15226786   Strand: -
>XM_004834331.1
ATGTGCTTCAGTTTCATAATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCAGTAGATTCACAAATAGCTTCGGATGGCTCCATAGCTGTGGATTTCCTTTTACCCACTGGGATTTATATCCAGTTGGAGGTACCACGGGAAGCTACCATTTCCTATATTAAGCAGATGTTATGGAAGCAAGTGCACAGTTACCCAATGTTTAACCTGCTTATGGACATTGACTCCTATATGTTTGCATGTGTGAATCAAACTGCTGTATATGAGGAACTTGAAGATGAAACACGAAGACTTTGCGATGTTAGACCTTTTCTTCCAGTTCTCAAGTTAGTGACAAGAAGTTGTGATCCAGGGGAAAAATTGGACTCAAAAATTGGAGTCCTTATAGGAAAAGGTCTGCATGAATTTGATGCCTTAAAGGATCCTGAAGTGAATGAATTTCGACGAAAAATGCGCAAATTCAGTGAGGAAAAGATTCAGTCACTTGTGGGATTATCGTGGATTGACTGGCTAAAGCAAACCTACCCACCAGAACATGATCCATCCATCCTTGAAAACTTGGAAGACAAGCTTTATGGAGGAAAGCTCATTGTAGCTGTTCATTTTGAAAATAGTCAGGATGTGTTTAGCTTTCATGTATCTCCTAATGTGAATCCTATAAAGATAAATGAATTGGCAATCCAAAAACGTTTGACTATTCATGGGAAGGAAGATGAAGCCAGCCCTGGTGACTATGTGTTACAAGTCATTGGGAGAGTAGAATATGTATTTGGTGATCACCCACTCATTCAGTTCCAGTACGTCCGGAACTGTGTTGTGAACAGGGCCCTGCCCCATTTTGTGCTTGTGGAATGCTACAAGATCAAGAAGATGTATGAGCAAGAAATGATTGCCATAGAGGCTGCCATAAACCGGAATTCATCTAACTTTCCTCTTCCCTTACCACCAAAGAAAACACGAATTATTTCTCATGTTTGGGACAATAACAACCCTTTCCAAATTGTTTTGGTTAAGGGAAATAAACTTAACACTGAAGAAACTGTAAAAGTTCATGTCAGGGCTGGTCTTTTTCATGGTACTGAGCTTCTGTGTAAAACCATCGTAAGCTCAGAGATATCAGGGAAAAATGATCACATTTGGAATGAAACACTGGAATTTGATATTAATACTTGTGACTTGCCAAGAATGGCTCGATTATGTTTTGCTGTTTATGCAGTTTTGGATAAAGTAAAAACGAAGAAATCAACCAAAACTATTAATCCTTCTAAATATCAGACCATCAGGAAAGCTGGAAAAGTGCATTATCCTGTAGCATGGGTAAATACCATGGTTTTTGACTTTAAAGGACAGTTGAGGTCTGGAGACATAATATTGCACAGCTGGTCTTCATTTCCTGATGAACTTGAAGAAATGTTGAATCCAATGGGAACTGTTCAAACAAATCCATATACTGAAAATGCAACAGCTCTGCACATTAAATTTCCAGAGAATAAAAAACAACCTTATCATTACCCTCCCTTCGATAAGATTATTGAAAAGGCAGCTGAAATTGCAAGCAGCGATAGTGCTAATGTATCAAGTCGAGGTGGAAAAAAGTTTCTTGCTGTACTGAAAGAAATCTTGGACAGGGATCCCTTGTCTCAGCTGTGTGAGAATGAAATGGATCTTATTTGGACTTTGCGACAAGACTGCAGAGAGAATTTCCCACAGTCACTGCCAAAATTACTCCTGTCAATCAAGTGGAATAAACTTGAAGATGTTGCTCAGCTCCAGGCACTGCTTCAGATTTGGCCTAAACTGCCCCCGAGGGAGGCCCTGGAGCTTCTGGATTTCAACTATCCAGATCAGTATGTACGGGAATATGCAGTGGGCTGCCTGCGTCAGATGAGTGATGAAGAACTCTCTCAATATCTTTTACAACTGGTCCAAGTTTTAAAATATGAGCCTTTTCTTGATTGTGCACTTTCTAGATTTCTATTAGAAAGAGCACTTGCTAATCGGAGAATAGGGCAGTTTCTATTTTGGCATCTCAGGTCAGAGGTGCACATTCCTGCCATCTCAGTACAGTTTGGCGTCATCCTTGAAGCGTACTGTCGAGGAAGTGTAGGGCACATGAAAGTGCTTTCCAAGCAGGTTGAAGCACTCAATAAATTAAAAACTTTAAATAGTTTAATCAAACTGAATGCAGTGAAGTTAAACAGAGCTAAAGGGAAGGAGGCCATGCACACTTGTTTAAAACAGAATGCTTACCGGGAAGCCCTCTCTGATTTGCAGTCACCTCTGAATCCATGTATCATCCTCTCAGAGCTCTATATTGAAAAGTGCAAATACATGGATTCCAAAATGAAGCCTTTGTGGCTCGTATATACCAATAAGGTATTTGGTGAGGATTCAGTTGGAGTGATTTTTAAAAATGGTGATGATTTACGACAGGATATGTTGACTCTCCAAATGCTGCGCTTGATGGATTTACTCTGGAAAGAAGCTGGTCTGGACCTTCGGATGCTGCCTTATGGCTGTTTAGCAACAGGAGATCGCTCTGGCCTCATTGAAGTTGTGAGCACCTCTGAAACAATTGCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTGCAGCGGCCTTCAATAAAGATGCCCTTCTGAACTGGCTTAAAGAATACAATTCTGGGGATGACCTGGACCGAGCCATTGAAGAGTTTACCCTATCCTGTGCTGGCTACTGTGTAGCTTCTTATGTCCTCGGGATTGGTGACAGACATAGTGACAACATAATGGTCAAAAAAACTGGCCAGCTCTTCCACATTGACTTTGGACATATTCTTGGAAATTTCAAATCTAAATTTGGCATTAAAAGAGAACGAGTGCCTTTTATTCTTACTTATGATTTCATTCATGTCATTCAACAAGGAAAAACAGGAAACACGGAAAAGTTTGGCCGATTTCGCCAGTGTTGTGAAGATGCATATTTGATTTTACGAAGACATGGAAATCTCTTCATCACTCTCTTTGCACTGATGTTGACTGCAGGGCTTCCTGAACTTACATCAGTCAAGGATATACAGTATCTTAAGGACTCTCTTGCCTTAGGAAAGAGTGATGAAGAAGCACTCAAACAATTTAAGCAAAAATTTGATGAGGCACTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATGGCTCACACTGTTCGGAAAGACTACAGATCTTAA

XM_004834332.1 Coding sequence

Foxl2 forkhead box L2

Length: 1137 bp    Location: 15491800..15490487   Strand: -
>XM_004834332.1
ATGATGGCCAGCTACCCCGAGCCCGAGGACGCCGCAGGGGCCCTGCTGGCCCCGGACACTGGCCGCGCAGTCAAGGAGCCCGAGGCGCCACCGCCAAGTCCGGGCAAGGGCGGCGGAGGGACAGCCTCGGAGAAGCCTGACCCAGCGCAAAAGCCCCCGTACTCGTACGTGGCGCTCATCGCCATGGCGATCCGCGAGAGCGCCGAGAAGAGGCTCACGCTGTCTGGCATCTACCAGTATATCATCGCCAAGTTCCCGTTCTATGAGAAGAACAAGAAGGGCTGGCAGAATAGCATCCGACACAACCTCAGCCTCAATGAGTGCTTCATCAAGGTGCCGCGCGAGGGCGGCGGCGAGCGCAAGGGCAACTACTGGACGCTGGACCCGGCCTGCGAGGACATGTTCGAGAAGGGCAACTACCGGCGCCGCCGCCGCATGAAGCGTCCCTTCCGCCCGCCGCCCGCGCACTTCCAGCCCGGCAAGGGGCTCTTCGGGGCCGGGGGCGCGGCGGGCGGCTGCGGTGTAGCGGGTGCAGGGGCCGACGGCTACGGCTACCTGGCGCCCCCCAAGTACCTGCAGTCCGGTTTCCTTAACAACTCGTGGCCGCTGCCGCAGCCGCCCTCGCCCATGCCCTATGCCTCCTGCCAGATGGCGGCGGCCGCGGCGGCTGCAGCGGCGGCAGCCGCGGCCGCGGGACCCGGTAGCCCGGGTGCAGCCGCTGTCGTCAAGGGGCTGGCGGGCCCGGCTGCCTCGTATGGGCCATACTCGCGCGTGCAGGGCATGGCGCTGCCCCCCGCCGTAGTGAACTCGTACAACGGCCTGGGAGGCCCGCCGGCCGGACCCCCGCCGCCGCCGCCGCACCCGCACCCGCACCCGCATCCACACCCGCACGCGCACCATCTGCACGCGGCCTCCGCACCCCCGCCAGCGCCTCCGCACCACGGGGCCGCCGCGCCGCCTCCCGGCCAGCTTAGCCCGGCCAGCCCGGCCACCGCCGCACCCCCAGCGCCTGCGCCCACGAGTGCACCCGGCCTGCAGTTCGCCTGCGCCCGACAGCCCGAGCTCGCCATGATGCATTGCTCTTACTGGGACCACGACAGCAAGACCAGCGCGCTGCACTCGCGCCTCGATATCTGA

XM_004834333.1 Coding sequence

Mrps22 mitochondrial ribosomal protein S22

High confidence: 4 potential gene matches
Length: 1089 bp    Location: 15894634..15908017   Strand: +
>XM_004834333.1
ATGGTCATGGCGGCCCTCAAAGCTCCGAAGTTGCTGTGGAGGTTCTTGATAGGTTCTCGAGGCATGGAGCCAGTCTGTATCTGGACCCGAACCCAGCTTCATCCGGATACTCTGTTCCAGCTGCTGCCTCTGCCCCTCGCTGTAGGGCTGCCACGCCGTCGGCTCAGCTCCAGGACCGCAGAATCTGGTACCTCAGAGATGAAGAAACCTACATTTATAGATAAAGAAGTCCAAAGCATCCTTATCAAGATGACAGGATTGAACTTGGAGAAGATTTTTAAGCCAGCTGTACAAGAGCTGAAGCCACCAACCTATAAGCTAATGACTCAGGCACAGTTGGAAGAGGCTACCAGAAAGGCAGTTGAAGCAGCTAAAGTTCGATTAAAAATGCCACCAGTTCTGGAAGAACGAGCACCAATAAATGATGTGTTAGCAGAAGATAAGATTTTGGAAGGGACAGAAACAGCCAAATATGTGTTTACTGATATATCATATGCCATACCACACCGGGAGCGTTTTATTGTTGTAAGAGAACCAAGTGGCACACTACGCAAAGCTTCTTGGGAAGAACGGGACCGGGTGATACAAGTTTATTTCCCCAAAGAAGGTCGTAGGGTTTTACCACCAATAATTTTCAAGGAAGAAAACCTTAAGACCATGTACAGCCAGGACCGGCATGCTGATGTCCTTAATCTTTGTGTTGCCCAGTTTGAGCCAGATTCTACTGAGTACATCAAGGTTCATCACCAGACCTATGAAGATATCAATAAACATGGAAAGTATGACCTTTTACGTTCAACAAGACACTTTGGTGGAATGGCTTGGTATTTTGTAAATAAGAAAAAGATTGATGGTTTGCTGATTGACCAGATTCAGAGAGATTTAACTGATGATGCCACCAGCTTGGTCCAGCTGTATCACATGCTCCATCCAGATGGCCCATCAGCTCAAGAGGCCAGAGAGCAGGCTGCTGAGGGAATAAATTTAATTAAGGTCTTTGCAAAAACAGAAGCACAGAGGGGCGCATATATAGAATTAACACTTCAAACTTATCAAGAAGCACTCATTAGCCATTCTGCGGCTTCCTGA

XM_004834335.1 Coding sequence

Copb2 coatomer protein complex, subunit beta 2 (beta prime), transcript variant X2

Length: 2805 bp    Location: 15936856..15908551   Strand: -
>XM_004834335.1
ATGCCTCTTCGACTTGATATCAAGAGAAAGCTAACTGCTAGATCTGATCGGGTTAAGAGTGTGGATTTGCATCCTACAGAGCCATGGATGTTGGCAAGTCTTTACAATGGCAGTGTATGTGTTTGGAATCATGAAACACAGACACTGGTGAAGACATTTGAAGTATGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAACTGGGTTGTGACAGGAGCGGATGACATGCAGATCAGAGTGTTCAATTACAATACCCTGGAAAGAGTTCATATGTTTGAAGCACACTCTGACTACATTCGCTGTATAGCTGTTCATCCAACCCAGCCTTTCATTCTGACTAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCCTGTTCACAAGTGTTTGAAGGACATACCCATTATGTTATGCAGATTGTGATCAACCCCAAAGATAATAATCAGTTTGCCAGTGCATCTTTGGACAGGACCATCAAGGTGTGGCAGCTGGGCTCTTCATCACCAAACTTCACTCTGGAGGGACACGAAAAAGGTGTGAATTGCATTGATTACTACAGTGGTGGTGACAAACCATACCTCATTTCAGGTGCAGATGACCGTCTTGTTAAAATATGGGATTATCAGAATAAAACATGTGTGCAGACACTGGAGGGACATGCCCAGAATGTGTCTTGTGCCAGTTTTCATCCTGAGTTGCCAATCATCATCACAGGTTCAGAAGATGGAACAGTGCGTATCTGGCATTCAAGCACCTACCGGCTTGAAAGCACATTGAATTACGGAATGGAGAGGGTGTGGTGTGTGGCCAGTCTGAGAGGGTCTAACAATGTCGCTCTGGGCTATGATGAAGGGAGCATCATTGTTAAGCTTGGGCGGGAGGAACCTGCCATGTCCATGGATGCCAATGGAAAGATAATTTGGGCCAAGCACTCAGAAGTCCAGCAGGCCAACCTAAAAGCAATGGGAGATGCTGAAATTAAAGATGGAGAAAGATTGCCACTGGCAGTAAAGGATATGGGCAGTTGTGAAATATACCCTCAGACAATTCAGCACAACCCTAATGGGCGGTTTGTTGTGGTATGTGGTGATGGGGAGTATATCATCTACACTGCAATGGCCTTGAGAAACAAGAGCTTTGGGTCTGCCCAGGAATTTGCATGGGCCCATGATTCTTCAGAATATGCCATAAGAGAGAGCAACAGTGTTGTAAAGATATTTAAGAACTTTAAGGAAAAAAAATCATTTAAACCAGACTTTGGAGCAGAAAGTATCTATGGAGGCTTCTTGTTGGGTGTCAGATCTGTAAATGGCTTAGCCTTCTATGACTGGGACAACACAGAACTCATACGCAGAATTGAAATTCAGCCCAAACATATTTTCTGGTCTGATTCTGGAGAACTAGTCTGTATTGCCACTGAGGAATCATTTTTTATCCTTAAGTATCTGTCAGAAAAAGTTTTGGCTGCACAGGAAACACATGAAGGAGTTACTGAAGATGGCATTGAAGATGCCTTTGAGGTTCTTGGTGAAATTCAGGAAATTGTAAAAACAGGGCTATGGGTGGGCGACTGTTTCATTTACACAAGTTCTGTGAACAGATTAAATTACTATGTTGGAGGAGAAATAGTCACCATTGCTCACTTGGACAGGACAATGTATCTCCTGGGCTATATTCCTAAAGATAATAGGCTTTATCTGGGTGATAAAGAATTAAACATCGTAAGTTACTCCCTGCTGGTTTCAGTTCTGGAATACCAGACAGCTGTCATGCGGAGGGATTTTAGCATGGCTGACAAGGTCCTTCCTACCATTCCAAAAGAACAAAGGACGAGAGTTGCACACTTTTTGGAAAAGCAGGGCTTCAAGCAGCAGGCTCTCACAGTATCCACAGATCCTGAGCATCGTTTTGAGCTGGCTCTTCAGCTTGGAGAGTTAAAAATTGCATACCAGTTAGCAGTGGAGGCAGAGTCAGAACAGAAGTGGAAACAACTTGCTGAGCTTGCCATCAGTAAATGTCAGTTTGGCCTAGCCCAAGAGTGCCTGCACCATGCCCAAGATTATGGGGGTCTGCTGCTTTTGGCTACAGCCTCTGGAAATGCTACTATGGTGAACAAGCTAGCAGAGGGTGCAGAGAAAGATGGCAAAAATAATGTAGCCTTCATGAGCTACTTTTTACAGGGCAAGCTTGATGCTTGCTTAGAGCTCTTGATTAGAACAGGACGACTGCCAGAAGCAGCCTTCCTAGCCCGAACTTACTTACCCAGTCAAGTTTCAAGGTACACCTTTAATTGTAGGAGAGTGTTTCAAATGAAAACAGAGCACACTTCCTTAGTCTTTCTTTGGTTCCCTGTTTATAATAGGGTAGTCAAACTGTGGAGAGAGAATCTCTCAAAAGTCAATCAGAAAGCAGCGGAATCCCTTGCTGACCCTACAGAGTATGAAAACCTTTTCCCTGGATTAAAAGAAGCCTTTGTTGTTGAAGAATGGGTGAAGAAAACACATGCTGATCTGTGGCCAGCCAAGCAATACCCACTTGTCACGCCAAATGAAGAGAGAAATGTTATGGAGGAGGCAAAAGGCTTCCAACCCTCAAGATCTGTAGCTCAGCAGGAACTTGATGGGAAACCTGCTTCCCCTACTCCAGTTATTGTGGCTTCCCAAACAGCCAACAAAGAAGAAAAGAGCTTACTGGAGCTAGAAGTAGATTTGGATAATTTGGAATTAGAAGATATTGACACAACAGATATCAATCTGGATGAAGATATGCTGGATGACTGA

XM_004834336.1 Coding sequence

Copb2 coatomer protein complex, subunit beta 2 (beta prime), transcript variant X3

Length: 2724 bp    Location: 15936855..15908816   Strand: -
>XM_004834336.1
ATGCCTCTTCGACTTGATATCAAGAGAAAGCTAACTGCTAGATCTGATCGGGTTAAGAGTGTGGATTTGCATCCTACAGAGCCATGGATGTTGGCAAGTCTTTACAATGGCAGTGTATGTGTTTGGAATCATGAAACACAGACACTGGTGAAGACATTTGAAGTATGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAACTGGGTTGTGACAGGAGCGGATGACATGCAGATCAGAGTGTTCAATTACAATACCCTGGAAAGAGTTCATATGTTTGAAGCACACTCTGACTACATTCGCTGTATAGCTGTTCATCCAACCCAGCCTTTCATTCTGACTAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCCTGTTCACAAGTGTTTGAAGGACATACCCATTATGTTATGCAGATTGTGATCAACCCCAAAGATAATAATCAGTTTGCCAGTGCATCTTTGGACAGGACCATCAAGGTGTGGCAGCTGGGCTCTTCATCACCAAACTTCACTCTGGAGGGACACGAAAAAGGTGTGAATTGCATTGATTACTACAGTGGTGGTGACAAACCATACCTCATTTCAGGTGCAGATGACCGTCTTGTTAAAATATGGGATTATCAGAATAAAACATGTGTGCAGACACTGGAGGGACATGCCCAGAATGTGTCTTGTGCCAGTTTTCATCCTGAGTTGCCAATCATCATCACAGGTTCAGAAGATGGAACAGTGCGTATCTGGCATTCAAGCACCTACCGGCTTGAAAGCACATTGAATTACGGAATGGAGAGGGTGTGGTGTGTGGCCAGTCTGAGAGGGTCTAACAATGTCGCTCTGGGCTATGATGAAGGGAGCATCATTGTTAAGCTTGGGCGGGAGGAACCTGCCATGTCCATGGATGCCAATGGAAAGATAATTTGGGCCAAGCACTCAGAAGTCCAGCAGGCCAACCTAAAAGCAATGGGAGATGCTGAAATTAAAGATGGAGAAAGATTGCCACTGGCAGTAAAGGATATGGGCAGTTGTGAAATATACCCTCAGACAATTCAGCACAACCCTAATGGGCGGTTTGTTGTGGTATGTGGTGATGGGGAGTATATCATCTACACTGCAATGGCCTTGAGAAACAAGAGCTTTGGGTCTGCCCAGGAATTTGCATGGGCCCATGATTCTTCAGAATATGCCATAAGAGAGAGCAACAGTGTTGTAAAGATATTTAAGAACTTTAAGGAAAAAAAATCATTTAAACCAGACTTTGGAGCAGAAAGTATCTATGGAGGCTTCTTGTTGGGTGTCAGATCTGTAAATGGCTTAGCCTTCTATGACTGGGACAACACAGAACTCATACGCAGAATTGAAATTCAGCCCAAACATATTTTCTGGTCTGATTCTGGAGAACTAGTCTGTATTGCCACTGAGGAATCATTTTTTATCCTTAAGTATCTGTCAGAAAAAGTTTTGGCTGCACAGGAAACACATGAAGGAGTTACTGAAGATGGCATTGAAGATGCCTTTGAGGTTCTTGGTGAAATTCAGGAAATTGTAAAAACAGGGCTATGGGTGGGCGACTGTTTCATTTACACAAGTTCTGTGAACAGATTAAATTACTATGTTGGAGGAGAAATAGTCACCATTGCTCACTTGGACAGGACAATGTATCTCCTGGGCTATATTCCTAAAGATAATAGGCTTTATCTGGGTGATAAAGAATTAAACATCGTAAGTTACTCCCTGCTGGTTTCAGTTCTGGAATACCAGACAGCTGTCATGCGGAGGGATTTTAGCATGGCTGACAAGGTCCTTCCTACCATTCCAAAAGAACAAAGGACGAGAGTTGCACACTTTTTGGAAAAGCAGGGCTTCAAGCAGCAGGCTCTCACAGTATCCACAGATCCTGAGCATCGTTTTGAGCTGGCTCTTCAGCTTGGAGAGTTAAAAATTGCATACCAGTTAGCAGTGGAGGCAGAGTCAGAACAGAAGTGGAAACAACTTGCTGAGCTTGCCATCAGTAAATGTCAGTTTGGCCTAGCCCAAGAGTGCCTGCACCATGCCCAAGATTATGGGGGTCTGCTGCTTTTGGCTACAGCCTCTGGAAATGCTACTATGGTGAACAAGCTAGCAGAGGGTGCAGAGAAAGATGGCAAAAATAATGTAGCCTTCATGAGCTACTTTTTACAGGGCAAGCTTGATGCTTGCTTAGAGCTCTTGATTAGAACAGGACGACTGCCAGAAGCAGCCTTCCTAGCCCGAACTTACTTACCCAGTCAAGTTTCAAGGGTAGTCAAACTGTGGAGAGAGAATCTCTCAAAAGTCAATCAGAAAGCAGCGGAATCCCTTGCTGACCCTACAGAGTATGAAAACCTTTTCCCTGGATTAAAAGAAGCCTTTGTTGTTGAAGAATGGGTGAAGAAAACACATGCTGATCTGTGGCCAGCCAAGCAATACCCACTTGTCACGCCAAATGAAGAGAGAAATGTTATGGAGGAGGCAAAAGGCTTCCAACCCTCAAGATCTGTAGCTCAGCAGGAACTTGATGGGAAACCTGCTTCCCCTACTCCAGTTATTGTGGCTTCCCAAACAGCCAACAAAGAAGAAAAGGTAAGTCAGGCATCACCCCCCCCCCCACCCCAAACCAGTAAACACATGCAGGCCTTGCTGGCCTCTGATTTAAGTGATGTAATCAGTGGGAGAGTTTGA

XM_004834344.1 Coding sequence

Nmnat3 nicotinamide nucleotide adenylyltransferase 3, transcript variant X2

High confidence: 3 potential gene matches
Length: 741 bp    Location: 16289245..16157754   Strand: -
>XM_004834344.1
ATGAAGAACAGGATCCCTGTGGTGCTTCTGGCCTGTGGCTCCTTCAACCCCATCACCAACATGCACCTGCGCTTGTTTGAGGTGGCAAGAGACCACCTGCACCAAACAGGAATGTACCAGGTGATAGAGGGCATCATCTCACCTGTTAATGACAACTACGGGAAGAAAGACCTGGTGCCTTCCCATCACCGAGTGACCATGGCCCGTCTGGCCCTGAAGACGTCTGACTGGATTCGGGTGGACTCCTGGGAGAGTGAGCAGGCACAGTGGATGGAGACAGTGAAGGTGCTGAGGCATCATCAGAACCAACTGCTCAGATCTGCAACCCAGATGGAAGGCCTGGACCCTGGCAAGGCACCTTCAGACCGTGCAGCTGCACCTGAGCTGAAACTCCTCTGTGGGGCAGACGTCTTGAAGTCCTTCCAGACCCCCAACCTCTGGAAAGATGCACACATCCAGGAAATAGTGGAGAAGTTTGGCTTGGTGTGTGTGAGCAGGGCAGGGCATGACCCGAAGCGGTACATCTTGAGTTCACCCATACTATGCAAATACCAGCACAACATTCAGCTGGCCAGGGAGCCGGTGCTGAACGAGATCAGTGCCACATATGTCAGGCGAGCCCTGGGCCAAGGGCAGAGCGTGAAGTACCTGCTTCCTGATGCTGTCATTGCTTATATCAAGAACCATGGCCTGTACATGACTGACAATTCCCAGAAAGGCAGAAGTACCCAGGGGAATTAA

XM_004834343.1 Coding sequence

Nmnat3 nicotinamide nucleotide adenylyltransferase 3, transcript variant X1

Length: 741 bp    Location: 16289245..16157754   Strand: -
>XM_004834343.1
ATGAAGAACAGGATCCCTGTGGTGCTTCTGGCCTGTGGCTCCTTCAACCCCATCACCAACATGCACCTGCGCTTGTTTGAGGTGGCAAGAGACCACCTGCACCAAACAGGAATGTACCAGGTGATAGAGGGCATCATCTCACCTGTTAATGACAACTACGGGAAGAAAGACCTGGTGCCTTCCCATCACCGAGTGACCATGGCCCGTCTGGCCCTGAAGACGTCTGACTGGATTCGGGTGGACTCCTGGGAGAGTGAGCAGGCACAGTGGATGGAGACAGTGAAGGTGCTGAGGCATCATCAGAACCAACTGCTCAGATCTGCAACCCAGATGGAAGGCCTGGACCCTGGCAAGGCACCTTCAGACCGTGCAGCTGCACCTGAGCTGAAACTCCTCTGTGGGGCAGACGTCTTGAAGTCCTTCCAGACCCCCAACCTCTGGAAAGATGCACACATCCAGGAAATAGTGGAGAAGTTTGGCTTGGTGTGTGTGAGCAGGGCAGGGCATGACCCGAAGCGGTACATCTTGAGTTCACCCATACTATGCAAATACCAGCACAACATTCAGCTGGCCAGGGAGCCGGTGCTGAACGAGATCAGTGCCACATATGTCAGGCGAGCCCTGGGCCAAGGGCAGAGCGTGAAGTACCTGCTTCCTGATGCTGTCATTGCTTATATCAAGAACCATGGCCTGTACATGACTGACAATTCCCAGAAAGGCAGAAGTACCCAGGGGAATTAA

XM_004834345.1 Coding sequence

Nmnat3 nicotinamide nucleotide adenylyltransferase 3, transcript variant X3

Length: 630 bp    Location: 16181943..16157754   Strand: -
>XM_004834345.1
ATGTACCAGGTGATAGAGGGCATCATCTCACCTGTTAATGACAACTACGGGAAGAAAGACCTGGTGCCTTCCCATCACCGAGTGACCATGGCCCGTCTGGCCCTGAAGACGTCTGACTGGATTCGGGTGGACTCCTGGGAGAGTGAGCAGGCACAGTGGATGGAGACAGTGAAGGTGCTGAGGCATCATCAGAACCAACTGCTCAGATCTGCAACCCAGATGGAAGGCCTGGACCCTGGCAAGGCACCTTCAGACCGTGCAGCTGCACCTGAGCTGAAACTCCTCTGTGGGGCAGACGTCTTGAAGTCCTTCCAGACCCCCAACCTCTGGAAAGATGCACACATCCAGGAAATAGTGGAGAAGTTTGGCTTGGTGTGTGTGAGCAGGGCAGGGCATGACCCGAAGCGGTACATCTTGAGTTCACCCATACTATGCAAATACCAGCACAACATTCAGCTGGCCAGGGAGCCGGTGCTGAACGAGATCAGTGCCACATATGTCAGGCGAGCCCTGGGCCAAGGGCAGAGCGTGAAGTACCTGCTTCCTGATGCTGTCATTGCTTATATCAAGAACCATGGCCTGTACATGACTGACAATTCCCAGAAAGGCAGAAGTACCCAGGGGAATTAA

XM_004834342.1 Coding sequence

Slc25a36 solute carrier family 25 (pyrimidine nucleotide carrier ), member 36

Length: 936 bp    Location: 16198354..16197287   Strand: -
>XM_004834342.1
ATGAGCCAGAGGGACACGCTGGTGCATCTGTTCGCGGGGGGATGCGGTGGCACAGTGGGAGCTATTCTGACATGTCCACTGGAAGTTGTAAAAACACAGCTGCAGTCGTCTTCTGTGACACTTTATATCTCTGAAGTTCAGCTGAACACCATGGCTGGAGCCAGTGTTAACCGAGTAGTGTCTCCTAGACCCCTCCATTGCCTAAAAGTAATCTTGGAAAAAGAAGGGCCTTGTTCCTTGTTTAGAGGATTAGGCCCCAATATAGTGGGGGTGGCCCCTTCCAGAGCAATATACTTTGCTGCTTACTCCAACTGCAAGGAAAAATTGAATGGCGTATTTGATCCTGATTCTACCCAGGTTCACATGATTTCAGCTGCAGTGGCAGGTTTCACTGCAATCACTGCAACCAACCCCATTTGGCTTATAAAGACTCAGTTACAGCTTGATGCAAGGAACCGTGGGGAAAAGCAAAGGGGTGCTTTTGAATGTATCCGTAAAGTGTATCAAAGAGACGGAATTAAAGGATTTTACAGGGGCATGTCTGCTTCCTATGATGGCATATCAGAGACTGTTATCCATTTTGTTATTTATGAAAATATAAAGCAAAAACTACTGGAATGTAAGACTGCTTCTATGACAGAAAATGGTGAAGAGTCTGTAAAAGAAGCATCAGCCTTTGTGGGAATGATGTTTGCTGCTGCCACCTCAAAAACTTGTGCCACAACTATAGCATATCCACATGAAGTTGTAAGAACAAGACTATGTGAAGAAGGAACAAAATATAGATCCTTTTTTCAGACACTGTCTTTGGTGGTTCAAGAAGACGGTTATGGGTCGCTCTACCGTGGTCTAACAACTCGTTTGGTGAGACAGATTCCAAACACAGCCATTATGATGGCCACCTATGAATTAGTGGTCTACCTCCTCAATGGATAG

XM_004835155.1 Coding sequence

Clstn2 calsyntenin 2

High confidence: 4 potential gene matches
Length: 2766 bp    Location: 16792091..17177482   Strand: +
>XM_004835155.1
ATGACAATCAACAAGCACAAGCCATGGATTGAAACTTCGTATCATGGAGTCATAACTGAGAACAATGACACAGTCATTTTGGACCCACCACTCGTAGCATTGGATAAAGATGCACCGGTTCCTTTTGCAGGAGAAATCTGTGCTTTCAAGATCCATGGCCAGGAGCTGCCCTTCGAGGCTGTGGTGCTCAATAAGACGTCCGGGGAGGGCCGGCTCCGCGCCAGGAGTCCCATTGACTGTGAGCTGCAGAAGGAGTACACGTTCATCATCCAAGCCTATGACTGTGGCGCCGGGCCCCGGGAGACAGCCTGGAAGAAGTCACACAAGGCCGTGGTCCATATCCAGGTAAAGGATGTCAATGAGTTTGCTCCCACCTTCAAAGAGCCAGCCTATAAAGCCATTGTAACAGAGGGCAAGATCTATGACAGCATACTGCAGGTGGAAGCCATAGATGAGGACTGCTCCCCTCAGTACAGCCAGATTTGCAACTATGAAATCGTCACAACAGACGTGCCTTTTGCCATCGACAGAAATGGCAACATCAGGAACACTGAGAAGCTGAGCTATGACAGGCAGCGCCAGTATGAGATCCTAGTGACAGCCTACGACTGTGGACAGAAACCTGCTGCTCAGGATACGCTGGTGCAGGTGGACGTGAAGCCCGTTTGCAAGCCTGGATGGCAAGACTGGACCAAGAGGATTGAGTACCAGCCTGGTTCGGGGAGTCTGCCCTTATTCCCCAGCATCCACCTGGAGACGTGCGATGGAGCTGTGTCCTCTCTCCAGGTCACCGCAGAGCTGCAGACCAACTACATTGGGAAGGGCTGTGACCGGGAGACATACTCCGAGAGATCCCTTCAGAAATTATGTGGAGCCTCCTCTGGCATCATCGACCTCTTGCCATCTCCCAGCACTGCCACCAACTGGACTTCAGGACTGCTGGTGGACAGCAGTGAGATGATCTTTAAGTTTGATGGCAGACAGGGTGCCAAGATTCCAGATGGAATTGTGCCTAAGAACCTGACGGACCAGTTCACCATCACCATGTGGATGAAACATGGCCCCAGCCCCGGTGTGAGGGCTGAGAAGGAAACCATCCTCTGCAACTCAGATAAAACTGAAATGAACCGGCACCACTATGCCCTATATGTGCACAACTGCCGCCTCGTCTTCCTCTTGAGGAAGGACTTTGACCAGGCCGACACCTTTCGCCCTGCAGAGTTCCACTGGAAGCTGGACCAGATTTGTGACAAAGAGTGGCATTACTATGTCATCAATGTGGAGTTTCCTGTGGTCACCCTCTACATGGATGGAGCGACATATGAACCATACTTGGTGACCAATGACTGGCCCATTCATCCATCTCACATTGCCATGCAGCTTACTGTCGGTGCTTGTTGGCAAGGAGGCGAAGTTGCCAAACCACGATTTGCGCAATTCTTCCATGGCAGCCTGGCCAGTCTTACCATCCGCCCTGGGAAAATGGAAAGCCAAAAGGTGATTTCCTGCTTGCAGGCCTGCAAAGAGGGGCTGGATATTAATTCTTTGGAAAGCCTCGGGCAAGGAATAAAGTATCACTTCAACCCCTCACAGTCTATCCTAGTGATGGAAGGAGATGACATTGGGAACGTCAACCGTGCCCTACAGAAGGTCTCCTACATCAACTCCAGGCAGTTCCCGACAGCAGGCGTGCGACGCCTCAGAGTCTCCTCCAAAGTCCAGTGCTTTGGGGAAGACGTGTGCATCAGCATCCCCGATGTGGATGCCTATGTGATGGTCCTGCAAGCCATGGAGCCCCAGATCACTTTGCAGGGCACAGATCACCTATGGAGACAAGCTGCCCAATTCGAAAGTGCCAGAGGTGTGGTCCTCTTCCAGGATATCAAAATTGTGAGCACCTTTGCCAAACCTGAGGCCACTGGGGACATGAAAACCACAGCCCCCAAATCATCAGTCTTAGAAGAAATGCTTCACAACTTGGATTTTTGTGACATTCTGGTGCTTGGAGGGGACCTGGACCCGAGACAGGAGTGCTTGGAACTCAACCACAGTGAGCTCCACCAAAGGCATCTGGATGCCACAAACTCTACTGCAGGCTACTCCATCTATGGTGTGGGCTCCATGAGCTGCTACGAGCAGGTGCTGCGTCACATCTACTACCGCAACTGGCACCCGAGCTCCCTTGAGGGCAGGCGGTTCCGAATCAAGTGTTCAGAACTCAATGGGCGCTACACTAGCAATGAGTTCAACTTGGAGGTCAGTGTGCTACATGAAGTCAGAGTACCAGACAAGGAGCATGTCAACCACCTTATCGTGCAGCCTCCTTTCCTCCAGTCTGCCCATCACCCTGAATCCCGGAGTAGCATCCAGCGCACTTCAGTGGTCCCAAGCATCGCCACGGTTGTCATCATCATCTCCGTGTGCATGCTAGTGTTTGTTGTGGCCATGGGTGTGTACCGAGTTCGGATTGCCCACCAGCACTTCATCCAAGAGACTGAGGCTGCCAAGGAGGCCGAAATGGATTGGGATGATTCTGCACTGACTATCACCGTCAACCCCATGGAGAAACATGTAGAACCAGGACACGGGGAAGATGAGACTGAGGGAGAAGAGGAGGAGGAAGAAGCAGAGGAGGACATCAGCTCCAGCAGCAGCGAGGACAACAGTGAAGGGGAGGAGGAGGAAGAGATGGGCAGAGGCAGACACGGGCAGAGCGGCACCAGGCAAGCCCAGCTGGAGTGGGATGACTCCACCCTGCCCTACTAG

XM_004834346.1 Coding sequence

Trim42 tripartite motif containing 42

High confidence: 4 potential gene matches
Length: 2172 bp    Location: 17299923..17330802   Strand: +
>XM_004834346.1
ATGGAGACTGCTATGTGTGTTTGCTCCCCATGCTGTACATGGCAAAGATGTTGTCCTCATTTGTGCTCCTGCCTGTGCTGCAAGTTCATCTTCACCTCGGAACGGAACTGCACCTGCTTCCCCTGCCCTTACAAGGATGAGCGTAACTGCCAGTTCTGCCATTGTACCTGTGCAGAGAACCCCAACTGCCACTGGTGCTGCTGCTCCTGGGCCAATGATCCCAACTGCAAGTGCTGCTGCACGGCCAGCAGTAACATCACGTGCTACTACTACGAGAGCCGCTGCTGCCGCAATGCCACCATCATATTCCACAAGGGCTGCCTCAAGAGCATCCGCACCTCGTCCAAGACCACTCTGCATGTGGGGAGCAGCGATACTCAGGTGGATAACTTGAAGTCGATACCAGCGAACAGCCATCTGGTCGACCACCTCAGCTGCCCCATGTGCAACCGGCTGCGCCTGCACTCGTTTATGCTTCCCTGCAACCACAGCCTGTGCGAAAAGTGCCTGCGGCGCTTGCAAAAACAGGCCGAAGTCACCGAGAATTTTTTCATCCTCATTTGCCCGGTTTGCAACCGTTCGCACTGCATGCCCTATACCCACAAGATGCGGCTGCCCGAGAACTACCTGCGCGGCCGCCTCACCAAGCGCTACATGCAGGAGCACGGCTTCCTGAAGTGGCGCTTCGACCGCTCCTCTGGGCCCATCCTCTGCCAGGTCTGCCGCAACCAGCGCATCGCCTACAAGCGCTGCATCACCTGCCGCCTCAACCTGTGCAACGAGTGCCTCAAGGCCTTCCACTCGGACATCGCCATGCAGGACCACGTCTTTGTGGACACCAGCGCCGAGGACCAGGACGAGAAGATGTGCATCCACCACCCGTCCAGCCGCATCAGCGAGTACTGCCGCAGCGACAACCAGCTGCTCTGCACCTTCTGCAAGATGGCTTTCCACAGCAGCCACGACACCGTCAGCCTCATCGACGCCTGCTCCGAGAGGTCTGCCGCACTCTTCAGCGCCATCGCCAAGTTCAAAGCAGTCCGATATGAAATTGATAATGACCTAATGGAATTCAACATTTTAAAAAACAACTTTAAAGCTGCCAAGGAGACAAAGCGAAAAGAGATCAGAAATGGATTTCTCAAGCTGCGCAGCATCCTTCATGAGAAAGAGAAGAACATCATGGAACAGATAGAGAATCTGGAAGTGTCCAGGCAGAAGGAGATAGAAAAATATGTGTACATCACAAACCTGAAAGTGAATGAAATGGATGGCCTAATCGCCTATTCGAAGGAAGCACTGAAGGAGACAGGCCAAGTGGCATTCCTGCAGTCAGCCAAGATTCTTGTAGACAGGATTGAGGACGGCATCCAGAGCACCTACAGGCCCGACCCCCACCTACGGCTCCACTCCTCGCACTGCATGCCCTTGGATTTTGCTGAGCTCTCCAGTGCCATCCATAAGCTCTTCTCCACAGAACCCAAGAAGATGCGCTCCTCAGGGGACTTGCTGCCCTCTCCCTATCCCAGCCACTCAGAAATGATGATTGCCAAGAAGGTCACATTCAGCCCCCACAGCTTTGGCAACCAGCAGATATGCCAACGAAGCTCCTCCTTGTTGTCTTTCAACACTGCCAGTGAGAAGGCCAAGATGGGCCTGAAGGCATATGGAAGACCCCAGTCAGCTGCACCTGCCAAACCCACAGATGGCTTCTACACCTACCGGACCACTGAGGCAGAAAACCAGCTTGTTCAGGACAGCAACAGCTTCCACAACTGGTACTCATTCAATGAAGCCTCTGTGAGCACCCCAGGGCCAGTTGTAATCTACCAGACTTTGGTATATCCAACAGCCGTCAAGGTCTACTGGACATGCCCAGCAGAAGACGTGGACTCTTTTGAGATGGAATTCTATGAACTTGTTACTACTCCTCCTAACAATGTGCAGAGAGAGCTCTGTGGACAAATTCAGGACATAATGCAGCAGAGTCTGGAGCTACACAACCTCACCCCCAATACTGAGTATATGTTTAAAGTGAGAGCTATCAATGACAACGGTCCTGGCCAATGGAGTGACGTTTGCAAGGTGGTGACACCAGATGGGCATGGGAAGAACCGAGCTAAGTGGGGCCTCCTGAAAAATATTCAGTCTGCCCTCCAGAATCGCTTCTGA

XM_004834347.1 Coding sequence

Spsb4 splA/ryanodine receptor domain and SOCS box containing 4

High confidence: 4 potential gene matches
Length: 822 bp    Location: 17692959..17773954   Strand: +
>XM_004834347.1
ATGGGCCAGAAGCTCTCCGGGGGCCTCAAGTCGGTGGAGGTGCGGGAGCCCGCACTGCGGCCAGCCAAGCGCGAGCTGCGGGGCGCAGAGGCAGGGCGGCCAGCGCGGCTGGACCAGCTGCTGGACATGCCGGCCGCAGGCTCTGCGGTGCAGCTGCGGCACGCGTGGAACCCCGAGGACCGCTCGCTCAACGTCTTCGTCAAGGACGACGACAGGCTCACCTTCCACCGGCACCCGGTGGCACAGAGCACGGACGGCATCCGCGGCAAGGTGGGCCATGCTCGAGGCCTGCACGCCTGGCAGATTGACTGGCCGGCTCGGCAGCGCGGCACGCACGCAGTGGTGGGGGTGGCCACGGCCCGCGCCCCACTGCACTCAGTTGGCTACACCGCTCTGGTGGGCAGCGACGTGGAGTCCTGGGGCTGGGACCTGGGCCGCAGCCGCCTCTACCACGACGGCAAGAACCGGCCCGGTGTGGCCTACCCGGCCTTCCTGGGGCCCGATGAGGCCTTTGCACTGCCTGACTCGCTGCTAGTAGTGCTGGACATGGATGAGGGCACGCTCAGCTTCATCGTGGACGGCCAGTACCTGGGTGTGGCCTTCCGTGGCCTCAAGGGTAAGAAGCTGTACCCGGTGGTGAGTGCCGTCTGGGGCCACTGCGAAGTCACCATGCGCTACATCAATGGCCTTGATCCTGAGCCGCTGCCGCTCATGGACCTGTGCCGGAGATCCATTCGAGCAGCCCTGGGCCGCCAGCGCCTGCGGGACATCAGCTCCCTGCCCCTGCCTCAGTCTCTCAAAAACTATCTGCAGTACCAGTGA

XM_004834349.1 Coding sequence

Zbtb38 zinc finger and BTB domain containing 38, transcript variant X1

Length: 3585 bp    Location: 17999024..18075242   Strand: +
>XM_004834349.1
ATGACAGTCATGTCCCTTTCCAGGGACCTCAAGGATGACTTCCACAGCGACACCGTACTCTCCATTTTAAATGAGCAGCGCATTCGGGGCATTTTATGTGATGTTACTATAATTGTGGAAGACACCAAATTTAAAGCTCACAGCAATGTCCTGGCTGCTTCAAGCCTTTATTTCAAAAACATCTTCTGGAGCCATACAATCTGTATTTCCAGCCATGTCCTGGAGCTGGATGATCTCAAAGCTGAAGTGTTTACGGAAATACTTAATTATATCTACAGCTCCACAGTCGTTGTCAAGAGACAGGAAACAGTCACTGATCTTGCAGCTGCAGGGAAAAAGCTGGGAATATCGTTTTTGGAAGACCTCACTGACCGCAACTTCTCAAATTCCCCAGGTCCCTATGTATTCTGCATTACTGAAAAGGGAGTGGTTAAAGAAGAAAAAAATGAAAAAAGGCACGAAGAGCCAGCCATCACTACTGGGCCAAGGATCACAAATGCATTTTCCATCATTGAAACAGAAAATAGTAATAACATGTTTTCTCCACTGGATTTGAGGGCAAGTTTCAAAAAAGTCTCTGACTCCATGAGAACAACTAGCCTTTGCCTAGAGAGGACTGACGTCTGCCATGAGGCAGAGCCCGTTCGCACACTTGCTGAGCACTCGTATGCTGTTTCCTCCATCACCGAGGCTTACAGAAGTCAGCCTGCCCGTGAACATGATAGCGGTTCACCTGGGAAAACAGGTAAAGAAAACGGGGAAGCTCTGGTCGCAAAACCGAAAACATGCCGAAAGCCAAAGACCTATTCCTTACCCCAGGATTCTGATTCAGCCACAGAAAACATACCACCCCCTCCAGTAACGAACCCAGAAATTAATCAAGAAAGAAGTCCACAGCCAGCTGCAATTCTTCCTCACTCAAAATCTCCCAACAATGAAGGAGATGTCCATTTTTCCAAGGAAGATGAAAACCAATCTTCCGATATTCCTGTGCCGCCAGCCACAGAAGTCCCACCTCTCATTTACAACTGTAGCTGTTGTTCCAAATCCTTTGACAGTAGTGCTCTGCTCAGTGCCCACATGCAGCTTCACAAGCCAACCCAGGAGCCATTGGTGTGCAAGTACTGCAACAAACAGTTTACCACCCTGAACCGATTGGATCGGCATGAACAGATCTGTATGAGGTCAAATCACTTGCCCGTTCCTGGAGGAAACCAACCCTTTTTAGAAAATTGTCCCACCATTGGACAAAATGGTAGTTCCATCACAGGCCCAGAATCTTTACTATCTGAAAATAGGATTGGTGAATTTTCCAGTACTGGAAATACTTTGCCAGAGGCAGAGCACATGATTAAATTTGTTAATGGGCAAATGCTCTACAGTTGCGTTGTGTGCAAACGTAGTTATGTGACTTTATCCAGCCTCCGGAGACATGCAAATGTCCACTCCTGGAGAAGAACATATCCCTGCCATTACTGCAACAAAGTATTTGCATTGGCTGAGTACAGGACAAGACATGAAATTTGGCATACAGGGGAAAGGCGGTATCAGTGCATTTTCTGTCTTGAAACTTTCATGACCTACTATATACTAAAAAACCATCAGAAGTCTTTCCATGCCATAGATCATAGGCTTTCCATCAGTAAAAAGACAGCAAATGGAGGCTTGAAACCTACTGTCTATCCATATAAACTTTACCGGCTACTGCCTATGAAATGCAAGAGAGCTCCTTATAAGAGCTACCGAAACTCTTCCTATGAAAATGCTCGAGAAAACAGGCAAATAAATGAGTCTACACCTGGTACCTATGTTGTTCAGAATCCACGCAGTTCCGAATTATCTGCACTGAATTTCCAAGATAGCGTAAACGTCTTGACCAACAGTCCAGCCATCCCATTAGAAGCATCTGCATGTCAGGACATACGCACTTCTGCCACTGTGCAAAATGCAGAGGGCACCAAATGGCGAGAGGAAACAATGAAGATTGACCTAGACAATAACTTTTATTCAACTGAGGTATCAGTTTCTTCCACTGAAAATGCTGTCAGCTCTGACCTCCAGGCAGGAGATGTACCTGTTTTATCCTTGGGTAATGGCAGCGAGAACTCGGCCTCTGTGATTAGCTACAGTGGTTCAGCACCCTCAGTCATTGTGCATAGTAGCCAGTTCTCATCAGTGATAATGCACAGCAATGCTGTTGCTGCCATGGCCAGCAGCAGCCACAGAGCCCCTTCAGACCCAGCTGTCAGTCAGCCCCTGAAAGATGACAGCAAGCCCGAGACAGATAAAGTGGGTAGATTTGCAAGCAGACCCAAAAGCACTAAAGAGAAAAAGAAAACTATTCCATGTAACAAGGCAGAAATTCCAGAGGAATCAAAATACGTTGCTGATCCTGGAGGGTCATTAAACAAAGCCACAAATACAGTTGAAGAAACCAGTAAAATTGAAACTTATATTGCAAAACCTGCTCTTCCTGGAACCTCCACAAATAGCAACGTTGCACCCCTTTGCCAAATAACAGTGAAAATTGGGAACGAAGCCATTGTGAAAAGGCATATTCTGGGATCTAAGTTGTTTTACAAAAGGGGAAGAAGACCCAAGTATCAAACACAGGAAGAGACAGTGCCCCAGGTGAGTGACCCAAAAACCCATGGAGACAGCCCTCTTGGGGTTTGCCAATCTGAGTGTGTGGAGATGAGTGAAGTATTTGATGATGCAAGTGATCAGGATTCCACCGATAAGCCATGGCGCCCCTACTACAACTACAAGCCCAAAAAGAAATCTAGACAGTTGAGAAAAATGAGGAAAGGCAACTGGAGGAAAGAACATGGAAACAAGAGCCCAAGCAATAAGTGTAAATACCCAGCAGAACTGGACTGTGCTGTGGGAAAGCCTCCTCCAGATAAGGCCTTTGAGGAAGAAGAAAATAAAGAGATGCCCAAGCTGCAGTGTGAACTCTGTGATGGAGACAAAGTATCAGGGGCTGGAAACCTAGGCAGGCCCCACCGGCATCTCACTTCCAAGCCTTATGTCTGTGAGCTCTGTGCCAAGCAGTTCCAGAGCCCTTCCACACTTAAAATGCACATGAGATGTCACACTGGAGAGAAGCCGTACCAGTGCAAGACCTGTGGACGGTGCTTTTCAGTTCAAGGAAACTTGCAGAAGCATGAACGCATCCACCTGGGCGTGAAGGAGTTCATCTGCCAGTATTGCAACAAGGCATTCACATTGAATGAGACCCTCAAAATCCATGAAAGAATCCACACTGGTGAAAAGCGTTACCATTGTCAGTTCTGTTTTCAGAGTTTTTTGTATCTCTCCACAAAAAGGAATCATGAGCAGAGGCATATTCGGGAGCATAATGGGAAAGGCTTTGCTTGCTTCCAGTGCCCCAAAATTTGCAAAACAGCTGCTGCCCTTGGAATGCACCAAAAGAAACATTTATTCAAAAACCCAAATCAACAGGAGAAAATCGGTGACATGTGCCATGAAAACTCAAATCCTTTAGAGAATCAACATTTCATTGATTCAGAAGACACTGACCAAAAGGATAATGTGAAATCGATTGTTGAAAATGTCCTTTGA

XM_004834350.1 Coding sequence

Zbtb38 zinc finger and BTB domain containing 38, transcript variant X2

Length: 3585 bp    Location: 17999158..18075242   Strand: +
>XM_004834350.1
ATGACAGTCATGTCCCTTTCCAGGGACCTCAAGGATGACTTCCACAGCGACACCGTACTCTCCATTTTAAATGAGCAGCGCATTCGGGGCATTTTATGTGATGTTACTATAATTGTGGAAGACACCAAATTTAAAGCTCACAGCAATGTCCTGGCTGCTTCAAGCCTTTATTTCAAAAACATCTTCTGGAGCCATACAATCTGTATTTCCAGCCATGTCCTGGAGCTGGATGATCTCAAAGCTGAAGTGTTTACGGAAATACTTAATTATATCTACAGCTCCACAGTCGTTGTCAAGAGACAGGAAACAGTCACTGATCTTGCAGCTGCAGGGAAAAAGCTGGGAATATCGTTTTTGGAAGACCTCACTGACCGCAACTTCTCAAATTCCCCAGGTCCCTATGTATTCTGCATTACTGAAAAGGGAGTGGTTAAAGAAGAAAAAAATGAAAAAAGGCACGAAGAGCCAGCCATCACTACTGGGCCAAGGATCACAAATGCATTTTCCATCATTGAAACAGAAAATAGTAATAACATGTTTTCTCCACTGGATTTGAGGGCAAGTTTCAAAAAAGTCTCTGACTCCATGAGAACAACTAGCCTTTGCCTAGAGAGGACTGACGTCTGCCATGAGGCAGAGCCCGTTCGCACACTTGCTGAGCACTCGTATGCTGTTTCCTCCATCACCGAGGCTTACAGAAGTCAGCCTGCCCGTGAACATGATAGCGGTTCACCTGGGAAAACAGGTAAAGAAAACGGGGAAGCTCTGGTCGCAAAACCGAAAACATGCCGAAAGCCAAAGACCTATTCCTTACCCCAGGATTCTGATTCAGCCACAGAAAACATACCACCCCCTCCAGTAACGAACCCAGAAATTAATCAAGAAAGAAGTCCACAGCCAGCTGCAATTCTTCCTCACTCAAAATCTCCCAACAATGAAGGAGATGTCCATTTTTCCAAGGAAGATGAAAACCAATCTTCCGATATTCCTGTGCCGCCAGCCACAGAAGTCCCACCTCTCATTTACAACTGTAGCTGTTGTTCCAAATCCTTTGACAGTAGTGCTCTGCTCAGTGCCCACATGCAGCTTCACAAGCCAACCCAGGAGCCATTGGTGTGCAAGTACTGCAACAAACAGTTTACCACCCTGAACCGATTGGATCGGCATGAACAGATCTGTATGAGGTCAAATCACTTGCCCGTTCCTGGAGGAAACCAACCCTTTTTAGAAAATTGTCCCACCATTGGACAAAATGGTAGTTCCATCACAGGCCCAGAATCTTTACTATCTGAAAATAGGATTGGTGAATTTTCCAGTACTGGAAATACTTTGCCAGAGGCAGAGCACATGATTAAATTTGTTAATGGGCAAATGCTCTACAGTTGCGTTGTGTGCAAACGTAGTTATGTGACTTTATCCAGCCTCCGGAGACATGCAAATGTCCACTCCTGGAGAAGAACATATCCCTGCCATTACTGCAACAAAGTATTTGCATTGGCTGAGTACAGGACAAGACATGAAATTTGGCATACAGGGGAAAGGCGGTATCAGTGCATTTTCTGTCTTGAAACTTTCATGACCTACTATATACTAAAAAACCATCAGAAGTCTTTCCATGCCATAGATCATAGGCTTTCCATCAGTAAAAAGACAGCAAATGGAGGCTTGAAACCTACTGTCTATCCATATAAACTTTACCGGCTACTGCCTATGAAATGCAAGAGAGCTCCTTATAAGAGCTACCGAAACTCTTCCTATGAAAATGCTCGAGAAAACAGGCAAATAAATGAGTCTACACCTGGTACCTATGTTGTTCAGAATCCACGCAGTTCCGAATTATCTGCACTGAATTTCCAAGATAGCGTAAACGTCTTGACCAACAGTCCAGCCATCCCATTAGAAGCATCTGCATGTCAGGACATACGCACTTCTGCCACTGTGCAAAATGCAGAGGGCACCAAATGGCGAGAGGAAACAATGAAGATTGACCTAGACAATAACTTTTATTCAACTGAGGTATCAGTTTCTTCCACTGAAAATGCTGTCAGCTCTGACCTCCAGGCAGGAGATGTACCTGTTTTATCCTTGGGTAATGGCAGCGAGAACTCGGCCTCTGTGATTAGCTACAGTGGTTCAGCACCCTCAGTCATTGTGCATAGTAGCCAGTTCTCATCAGTGATAATGCACAGCAATGCTGTTGCTGCCATGGCCAGCAGCAGCCACAGAGCCCCTTCAGACCCAGCTGTCAGTCAGCCCCTGAAAGATGACAGCAAGCCCGAGACAGATAAAGTGGGTAGATTTGCAAGCAGACCCAAAAGCACTAAAGAGAAAAAGAAAACTATTCCATGTAACAAGGCAGAAATTCCAGAGGAATCAAAATACGTTGCTGATCCTGGAGGGTCATTAAACAAAGCCACAAATACAGTTGAAGAAACCAGTAAAATTGAAACTTATATTGCAAAACCTGCTCTTCCTGGAACCTCCACAAATAGCAACGTTGCACCCCTTTGCCAAATAACAGTGAAAATTGGGAACGAAGCCATTGTGAAAAGGCATATTCTGGGATCTAAGTTGTTTTACAAAAGGGGAAGAAGACCCAAGTATCAAACACAGGAAGAGACAGTGCCCCAGGTGAGTGACCCAAAAACCCATGGAGACAGCCCTCTTGGGGTTTGCCAATCTGAGTGTGTGGAGATGAGTGAAGTATTTGATGATGCAAGTGATCAGGATTCCACCGATAAGCCATGGCGCCCCTACTACAACTACAAGCCCAAAAAGAAATCTAGACAGTTGAGAAAAATGAGGAAAGGCAACTGGAGGAAAGAACATGGAAACAAGAGCCCAAGCAATAAGTGTAAATACCCAGCAGAACTGGACTGTGCTGTGGGAAAGCCTCCTCCAGATAAGGCCTTTGAGGAAGAAGAAAATAAAGAGATGCCCAAGCTGCAGTGTGAACTCTGTGATGGAGACAAAGTATCAGGGGCTGGAAACCTAGGCAGGCCCCACCGGCATCTCACTTCCAAGCCTTATGTCTGTGAGCTCTGTGCCAAGCAGTTCCAGAGCCCTTCCACACTTAAAATGCACATGAGATGTCACACTGGAGAGAAGCCGTACCAGTGCAAGACCTGTGGACGGTGCTTTTCAGTTCAAGGAAACTTGCAGAAGCATGAACGCATCCACCTGGGCGTGAAGGAGTTCATCTGCCAGTATTGCAACAAGGCATTCACATTGAATGAGACCCTCAAAATCCATGAAAGAATCCACACTGGTGAAAAGCGTTACCATTGTCAGTTCTGTTTTCAGAGTTTTTTGTATCTCTCCACAAAAAGGAATCATGAGCAGAGGCATATTCGGGAGCATAATGGGAAAGGCTTTGCTTGCTTCCAGTGCCCCAAAATTTGCAAAACAGCTGCTGCCCTTGGAATGCACCAAAAGAAACATTTATTCAAAAACCCAAATCAACAGGAGAAAATCGGTGACATGTGCCATGAAAACTCAAATCCTTTAGAGAATCAACATTTCATTGATTCAGAAGACACTGACCAAAAGGATAATGTGAAATCGATTGTTGAAAATGTCCTTTGA

XM_004834353.1 Coding sequence

Zbtb38 zinc finger and BTB domain containing 38, transcript variant X5

Length: 3585 bp    Location: 18033862..18075242   Strand: +
>XM_004834353.1
ATGACAGTCATGTCCCTTTCCAGGGACCTCAAGGATGACTTCCACAGCGACACCGTACTCTCCATTTTAAATGAGCAGCGCATTCGGGGCATTTTATGTGATGTTACTATAATTGTGGAAGACACCAAATTTAAAGCTCACAGCAATGTCCTGGCTGCTTCAAGCCTTTATTTCAAAAACATCTTCTGGAGCCATACAATCTGTATTTCCAGCCATGTCCTGGAGCTGGATGATCTCAAAGCTGAAGTGTTTACGGAAATACTTAATTATATCTACAGCTCCACAGTCGTTGTCAAGAGACAGGAAACAGTCACTGATCTTGCAGCTGCAGGGAAAAAGCTGGGAATATCGTTTTTGGAAGACCTCACTGACCGCAACTTCTCAAATTCCCCAGGTCCCTATGTATTCTGCATTACTGAAAAGGGAGTGGTTAAAGAAGAAAAAAATGAAAAAAGGCACGAAGAGCCAGCCATCACTACTGGGCCAAGGATCACAAATGCATTTTCCATCATTGAAACAGAAAATAGTAATAACATGTTTTCTCCACTGGATTTGAGGGCAAGTTTCAAAAAAGTCTCTGACTCCATGAGAACAACTAGCCTTTGCCTAGAGAGGACTGACGTCTGCCATGAGGCAGAGCCCGTTCGCACACTTGCTGAGCACTCGTATGCTGTTTCCTCCATCACCGAGGCTTACAGAAGTCAGCCTGCCCGTGAACATGATAGCGGTTCACCTGGGAAAACAGGTAAAGAAAACGGGGAAGCTCTGGTCGCAAAACCGAAAACATGCCGAAAGCCAAAGACCTATTCCTTACCCCAGGATTCTGATTCAGCCACAGAAAACATACCACCCCCTCCAGTAACGAACCCAGAAATTAATCAAGAAAGAAGTCCACAGCCAGCTGCAATTCTTCCTCACTCAAAATCTCCCAACAATGAAGGAGATGTCCATTTTTCCAAGGAAGATGAAAACCAATCTTCCGATATTCCTGTGCCGCCAGCCACAGAAGTCCCACCTCTCATTTACAACTGTAGCTGTTGTTCCAAATCCTTTGACAGTAGTGCTCTGCTCAGTGCCCACATGCAGCTTCACAAGCCAACCCAGGAGCCATTGGTGTGCAAGTACTGCAACAAACAGTTTACCACCCTGAACCGATTGGATCGGCATGAACAGATCTGTATGAGGTCAAATCACTTGCCCGTTCCTGGAGGAAACCAACCCTTTTTAGAAAATTGTCCCACCATTGGACAAAATGGTAGTTCCATCACAGGCCCAGAATCTTTACTATCTGAAAATAGGATTGGTGAATTTTCCAGTACTGGAAATACTTTGCCAGAGGCAGAGCACATGATTAAATTTGTTAATGGGCAAATGCTCTACAGTTGCGTTGTGTGCAAACGTAGTTATGTGACTTTATCCAGCCTCCGGAGACATGCAAATGTCCACTCCTGGAGAAGAACATATCCCTGCCATTACTGCAACAAAGTATTTGCATTGGCTGAGTACAGGACAAGACATGAAATTTGGCATACAGGGGAAAGGCGGTATCAGTGCATTTTCTGTCTTGAAACTTTCATGACCTACTATATACTAAAAAACCATCAGAAGTCTTTCCATGCCATAGATCATAGGCTTTCCATCAGTAAAAAGACAGCAAATGGAGGCTTGAAACCTACTGTCTATCCATATAAACTTTACCGGCTACTGCCTATGAAATGCAAGAGAGCTCCTTATAAGAGCTACCGAAACTCTTCCTATGAAAATGCTCGAGAAAACAGGCAAATAAATGAGTCTACACCTGGTACCTATGTTGTTCAGAATCCACGCAGTTCCGAATTATCTGCACTGAATTTCCAAGATAGCGTAAACGTCTTGACCAACAGTCCAGCCATCCCATTAGAAGCATCTGCATGTCAGGACATACGCACTTCTGCCACTGTGCAAAATGCAGAGGGCACCAAATGGCGAGAGGAAACAATGAAGATTGACCTAGACAATAACTTTTATTCAACTGAGGTATCAGTTTCTTCCACTGAAAATGCTGTCAGCTCTGACCTCCAGGCAGGAGATGTACCTGTTTTATCCTTGGGTAATGGCAGCGAGAACTCGGCCTCTGTGATTAGCTACAGTGGTTCAGCACCCTCAGTCATTGTGCATAGTAGCCAGTTCTCATCAGTGATAATGCACAGCAATGCTGTTGCTGCCATGGCCAGCAGCAGCCACAGAGCCCCTTCAGACCCAGCTGTCAGTCAGCCCCTGAAAGATGACAGCAAGCCCGAGACAGATAAAGTGGGTAGATTTGCAAGCAGACCCAAAAGCACTAAAGAGAAAAAGAAAACTATTCCATGTAACAAGGCAGAAATTCCAGAGGAATCAAAATACGTTGCTGATCCTGGAGGGTCATTAAACAAAGCCACAAATACAGTTGAAGAAACCAGTAAAATTGAAACTTATATTGCAAAACCTGCTCTTCCTGGAACCTCCACAAATAGCAACGTTGCACCCCTTTGCCAAATAACAGTGAAAATTGGGAACGAAGCCATTGTGAAAAGGCATATTCTGGGATCTAAGTTGTTTTACAAAAGGGGAAGAAGACCCAAGTATCAAACACAGGAAGAGACAGTGCCCCAGGTGAGTGACCCAAAAACCCATGGAGACAGCCCTCTTGGGGTTTGCCAATCTGAGTGTGTGGAGATGAGTGAAGTATTTGATGATGCAAGTGATCAGGATTCCACCGATAAGCCATGGCGCCCCTACTACAACTACAAGCCCAAAAAGAAATCTAGACAGTTGAGAAAAATGAGGAAAGGCAACTGGAGGAAAGAACATGGAAACAAGAGCCCAAGCAATAAGTGTAAATACCCAGCAGAACTGGACTGTGCTGTGGGAAAGCCTCCTCCAGATAAGGCCTTTGAGGAAGAAGAAAATAAAGAGATGCCCAAGCTGCAGTGTGAACTCTGTGATGGAGACAAAGTATCAGGGGCTGGAAACCTAGGCAGGCCCCACCGGCATCTCACTTCCAAGCCTTATGTCTGTGAGCTCTGTGCCAAGCAGTTCCAGAGCCCTTCCACACTTAAAATGCACATGAGATGTCACACTGGAGAGAAGCCGTACCAGTGCAAGACCTGTGGACGGTGCTTTTCAGTTCAAGGAAACTTGCAGAAGCATGAACGCATCCACCTGGGCGTGAAGGAGTTCATCTGCCAGTATTGCAACAAGGCATTCACATTGAATGAGACCCTCAAAATCCATGAAAGAATCCACACTGGTGAAAAGCGTTACCATTGTCAGTTCTGTTTTCAGAGTTTTTTGTATCTCTCCACAAAAAGGAATCATGAGCAGAGGCATATTCGGGAGCATAATGGGAAAGGCTTTGCTTGCTTCCAGTGCCCCAAAATTTGCAAAACAGCTGCTGCCCTTGGAATGCACCAAAAGAAACATTTATTCAAAAACCCAAATCAACAGGAGAAAATCGGTGACATGTGCCATGAAAACTCAAATCCTTTAGAGAATCAACATTTCATTGATTCAGAAGACACTGACCAAAAGGATAATGTGAAATCGATTGTTGAAAATGTCCTTTGA

XM_004834352.1 Coding sequence

Zbtb38 zinc finger and BTB domain containing 38, transcript variant X4

Length: 3585 bp    Location: 18034289..18075242   Strand: +
>XM_004834352.1
ATGACAGTCATGTCCCTTTCCAGGGACCTCAAGGATGACTTCCACAGCGACACCGTACTCTCCATTTTAAATGAGCAGCGCATTCGGGGCATTTTATGTGATGTTACTATAATTGTGGAAGACACCAAATTTAAAGCTCACAGCAATGTCCTGGCTGCTTCAAGCCTTTATTTCAAAAACATCTTCTGGAGCCATACAATCTGTATTTCCAGCCATGTCCTGGAGCTGGATGATCTCAAAGCTGAAGTGTTTACGGAAATACTTAATTATATCTACAGCTCCACAGTCGTTGTCAAGAGACAGGAAACAGTCACTGATCTTGCAGCTGCAGGGAAAAAGCTGGGAATATCGTTTTTGGAAGACCTCACTGACCGCAACTTCTCAAATTCCCCAGGTCCCTATGTATTCTGCATTACTGAAAAGGGAGTGGTTAAAGAAGAAAAAAATGAAAAAAGGCACGAAGAGCCAGCCATCACTACTGGGCCAAGGATCACAAATGCATTTTCCATCATTGAAACAGAAAATAGTAATAACATGTTTTCTCCACTGGATTTGAGGGCAAGTTTCAAAAAAGTCTCTGACTCCATGAGAACAACTAGCCTTTGCCTAGAGAGGACTGACGTCTGCCATGAGGCAGAGCCCGTTCGCACACTTGCTGAGCACTCGTATGCTGTTTCCTCCATCACCGAGGCTTACAGAAGTCAGCCTGCCCGTGAACATGATAGCGGTTCACCTGGGAAAACAGGTAAAGAAAACGGGGAAGCTCTGGTCGCAAAACCGAAAACATGCCGAAAGCCAAAGACCTATTCCTTACCCCAGGATTCTGATTCAGCCACAGAAAACATACCACCCCCTCCAGTAACGAACCCAGAAATTAATCAAGAAAGAAGTCCACAGCCAGCTGCAATTCTTCCTCACTCAAAATCTCCCAACAATGAAGGAGATGTCCATTTTTCCAAGGAAGATGAAAACCAATCTTCCGATATTCCTGTGCCGCCAGCCACAGAAGTCCCACCTCTCATTTACAACTGTAGCTGTTGTTCCAAATCCTTTGACAGTAGTGCTCTGCTCAGTGCCCACATGCAGCTTCACAAGCCAACCCAGGAGCCATTGGTGTGCAAGTACTGCAACAAACAGTTTACCACCCTGAACCGATTGGATCGGCATGAACAGATCTGTATGAGGTCAAATCACTTGCCCGTTCCTGGAGGAAACCAACCCTTTTTAGAAAATTGTCCCACCATTGGACAAAATGGTAGTTCCATCACAGGCCCAGAATCTTTACTATCTGAAAATAGGATTGGTGAATTTTCCAGTACTGGAAATACTTTGCCAGAGGCAGAGCACATGATTAAATTTGTTAATGGGCAAATGCTCTACAGTTGCGTTGTGTGCAAACGTAGTTATGTGACTTTATCCAGCCTCCGGAGACATGCAAATGTCCACTCCTGGAGAAGAACATATCCCTGCCATTACTGCAACAAAGTATTTGCATTGGCTGAGTACAGGACAAGACATGAAATTTGGCATACAGGGGAAAGGCGGTATCAGTGCATTTTCTGTCTTGAAACTTTCATGACCTACTATATACTAAAAAACCATCAGAAGTCTTTCCATGCCATAGATCATAGGCTTTCCATCAGTAAAAAGACAGCAAATGGAGGCTTGAAACCTACTGTCTATCCATATAAACTTTACCGGCTACTGCCTATGAAATGCAAGAGAGCTCCTTATAAGAGCTACCGAAACTCTTCCTATGAAAATGCTCGAGAAAACAGGCAAATAAATGAGTCTACACCTGGTACCTATGTTGTTCAGAATCCACGCAGTTCCGAATTATCTGCACTGAATTTCCAAGATAGCGTAAACGTCTTGACCAACAGTCCAGCCATCCCATTAGAAGCATCTGCATGTCAGGACATACGCACTTCTGCCACTGTGCAAAATGCAGAGGGCACCAAATGGCGAGAGGAAACAATGAAGATTGACCTAGACAATAACTTTTATTCAACTGAGGTATCAGTTTCTTCCACTGAAAATGCTGTCAGCTCTGACCTCCAGGCAGGAGATGTACCTGTTTTATCCTTGGGTAATGGCAGCGAGAACTCGGCCTCTGTGATTAGCTACAGTGGTTCAGCACCCTCAGTCATTGTGCATAGTAGCCAGTTCTCATCAGTGATAATGCACAGCAATGCTGTTGCTGCCATGGCCAGCAGCAGCCACAGAGCCCCTTCAGACCCAGCTGTCAGTCAGCCCCTGAAAGATGACAGCAAGCCCGAGACAGATAAAGTGGGTAGATTTGCAAGCAGACCCAAAAGCACTAAAGAGAAAAAGAAAACTATTCCATGTAACAAGGCAGAAATTCCAGAGGAATCAAAATACGTTGCTGATCCTGGAGGGTCATTAAACAAAGCCACAAATACAGTTGAAGAAACCAGTAAAATTGAAACTTATATTGCAAAACCTGCTCTTCCTGGAACCTCCACAAATAGCAACGTTGCACCCCTTTGCCAAATAACAGTGAAAATTGGGAACGAAGCCATTGTGAAAAGGCATATTCTGGGATCTAAGTTGTTTTACAAAAGGGGAAGAAGACCCAAGTATCAAACACAGGAAGAGACAGTGCCCCAGGTGAGTGACCCAAAAACCCATGGAGACAGCCCTCTTGGGGTTTGCCAATCTGAGTGTGTGGAGATGAGTGAAGTATTTGATGATGCAAGTGATCAGGATTCCACCGATAAGCCATGGCGCCCCTACTACAACTACAAGCCCAAAAAGAAATCTAGACAGTTGAGAAAAATGAGGAAAGGCAACTGGAGGAAAGAACATGGAAACAAGAGCCCAAGCAATAAGTGTAAATACCCAGCAGAACTGGACTGTGCTGTGGGAAAGCCTCCTCCAGATAAGGCCTTTGAGGAAGAAGAAAATAAAGAGATGCCCAAGCTGCAGTGTGAACTCTGTGATGGAGACAAAGTATCAGGGGCTGGAAACCTAGGCAGGCCCCACCGGCATCTCACTTCCAAGCCTTATGTCTGTGAGCTCTGTGCCAAGCAGTTCCAGAGCCCTTCCACACTTAAAATGCACATGAGATGTCACACTGGAGAGAAGCCGTACCAGTGCAAGACCTGTGGACGGTGCTTTTCAGTTCAAGGAAACTTGCAGAAGCATGAACGCATCCACCTGGGCGTGAAGGAGTTCATCTGCCAGTATTGCAACAAGGCATTCACATTGAATGAGACCCTCAAAATCCATGAAAGAATCCACACTGGTGAAAAGCGTTACCATTGTCAGTTCTGTTTTCAGAGTTTTTTGTATCTCTCCACAAAAAGGAATCATGAGCAGAGGCATATTCGGGAGCATAATGGGAAAGGCTTTGCTTGCTTCCAGTGCCCCAAAATTTGCAAAACAGCTGCTGCCCTTGGAATGCACCAAAAGAAACATTTATTCAAAAACCCAAATCAACAGGAGAAAATCGGTGACATGTGCCATGAAAACTCAAATCCTTTAGAGAATCAACATTTCATTGATTCAGAAGACACTGACCAAAAGGATAATGTGAAATCGATTGTTGAAAATGTCCTTTGA

XM_004834354.1 Coding sequence

Zbtb38 zinc finger and BTB domain containing 38, transcript variant X6

Length: 3585 bp    Location: 18034289..18075242   Strand: +
>XM_004834354.1
ATGACAGTCATGTCCCTTTCCAGGGACCTCAAGGATGACTTCCACAGCGACACCGTACTCTCCATTTTAAATGAGCAGCGCATTCGGGGCATTTTATGTGATGTTACTATAATTGTGGAAGACACCAAATTTAAAGCTCACAGCAATGTCCTGGCTGCTTCAAGCCTTTATTTCAAAAACATCTTCTGGAGCCATACAATCTGTATTTCCAGCCATGTCCTGGAGCTGGATGATCTCAAAGCTGAAGTGTTTACGGAAATACTTAATTATATCTACAGCTCCACAGTCGTTGTCAAGAGACAGGAAACAGTCACTGATCTTGCAGCTGCAGGGAAAAAGCTGGGAATATCGTTTTTGGAAGACCTCACTGACCGCAACTTCTCAAATTCCCCAGGTCCCTATGTATTCTGCATTACTGAAAAGGGAGTGGTTAAAGAAGAAAAAAATGAAAAAAGGCACGAAGAGCCAGCCATCACTACTGGGCCAAGGATCACAAATGCATTTTCCATCATTGAAACAGAAAATAGTAATAACATGTTTTCTCCACTGGATTTGAGGGCAAGTTTCAAAAAAGTCTCTGACTCCATGAGAACAACTAGCCTTTGCCTAGAGAGGACTGACGTCTGCCATGAGGCAGAGCCCGTTCGCACACTTGCTGAGCACTCGTATGCTGTTTCCTCCATCACCGAGGCTTACAGAAGTCAGCCTGCCCGTGAACATGATAGCGGTTCACCTGGGAAAACAGGTAAAGAAAACGGGGAAGCTCTGGTCGCAAAACCGAAAACATGCCGAAAGCCAAAGACCTATTCCTTACCCCAGGATTCTGATTCAGCCACAGAAAACATACCACCCCCTCCAGTAACGAACCCAGAAATTAATCAAGAAAGAAGTCCACAGCCAGCTGCAATTCTTCCTCACTCAAAATCTCCCAACAATGAAGGAGATGTCCATTTTTCCAAGGAAGATGAAAACCAATCTTCCGATATTCCTGTGCCGCCAGCCACAGAAGTCCCACCTCTCATTTACAACTGTAGCTGTTGTTCCAAATCCTTTGACAGTAGTGCTCTGCTCAGTGCCCACATGCAGCTTCACAAGCCAACCCAGGAGCCATTGGTGTGCAAGTACTGCAACAAACAGTTTACCACCCTGAACCGATTGGATCGGCATGAACAGATCTGTATGAGGTCAAATCACTTGCCCGTTCCTGGAGGAAACCAACCCTTTTTAGAAAATTGTCCCACCATTGGACAAAATGGTAGTTCCATCACAGGCCCAGAATCTTTACTATCTGAAAATAGGATTGGTGAATTTTCCAGTACTGGAAATACTTTGCCAGAGGCAGAGCACATGATTAAATTTGTTAATGGGCAAATGCTCTACAGTTGCGTTGTGTGCAAACGTAGTTATGTGACTTTATCCAGCCTCCGGAGACATGCAAATGTCCACTCCTGGAGAAGAACATATCCCTGCCATTACTGCAACAAAGTATTTGCATTGGCTGAGTACAGGACAAGACATGAAATTTGGCATACAGGGGAAAGGCGGTATCAGTGCATTTTCTGTCTTGAAACTTTCATGACCTACTATATACTAAAAAACCATCAGAAGTCTTTCCATGCCATAGATCATAGGCTTTCCATCAGTAAAAAGACAGCAAATGGAGGCTTGAAACCTACTGTCTATCCATATAAACTTTACCGGCTACTGCCTATGAAATGCAAGAGAGCTCCTTATAAGAGCTACCGAAACTCTTCCTATGAAAATGCTCGAGAAAACAGGCAAATAAATGAGTCTACACCTGGTACCTATGTTGTTCAGAATCCACGCAGTTCCGAATTATCTGCACTGAATTTCCAAGATAGCGTAAACGTCTTGACCAACAGTCCAGCCATCCCATTAGAAGCATCTGCATGTCAGGACATACGCACTTCTGCCACTGTGCAAAATGCAGAGGGCACCAAATGGCGAGAGGAAACAATGAAGATTGACCTAGACAATAACTTTTATTCAACTGAGGTATCAGTTTCTTCCACTGAAAATGCTGTCAGCTCTGACCTCCAGGCAGGAGATGTACCTGTTTTATCCTTGGGTAATGGCAGCGAGAACTCGGCCTCTGTGATTAGCTACAGTGGTTCAGCACCCTCAGTCATTGTGCATAGTAGCCAGTTCTCATCAGTGATAATGCACAGCAATGCTGTTGCTGCCATGGCCAGCAGCAGCCACAGAGCCCCTTCAGACCCAGCTGTCAGTCAGCCCCTGAAAGATGACAGCAAGCCCGAGACAGATAAAGTGGGTAGATTTGCAAGCAGACCCAAAAGCACTAAAGAGAAAAAGAAAACTATTCCATGTAACAAGGCAGAAATTCCAGAGGAATCAAAATACGTTGCTGATCCTGGAGGGTCATTAAACAAAGCCACAAATACAGTTGAAGAAACCAGTAAAATTGAAACTTATATTGCAAAACCTGCTCTTCCTGGAACCTCCACAAATAGCAACGTTGCACCCCTTTGCCAAATAACAGTGAAAATTGGGAACGAAGCCATTGTGAAAAGGCATATTCTGGGATCTAAGTTGTTTTACAAAAGGGGAAGAAGACCCAAGTATCAAACACAGGAAGAGACAGTGCCCCAGGTGAGTGACCCAAAAACCCATGGAGACAGCCCTCTTGGGGTTTGCCAATCTGAGTGTGTGGAGATGAGTGAAGTATTTGATGATGCAAGTGATCAGGATTCCACCGATAAGCCATGGCGCCCCTACTACAACTACAAGCCCAAAAAGAAATCTAGACAGTTGAGAAAAATGAGGAAAGGCAACTGGAGGAAAGAACATGGAAACAAGAGCCCAAGCAATAAGTGTAAATACCCAGCAGAACTGGACTGTGCTGTGGGAAAGCCTCCTCCAGATAAGGCCTTTGAGGAAGAAGAAAATAAAGAGATGCCCAAGCTGCAGTGTGAACTCTGTGATGGAGACAAAGTATCAGGGGCTGGAAACCTAGGCAGGCCCCACCGGCATCTCACTTCCAAGCCTTATGTCTGTGAGCTCTGTGCCAAGCAGTTCCAGAGCCCTTCCACACTTAAAATGCACATGAGATGTCACACTGGAGAGAAGCCGTACCAGTGCAAGACCTGTGGACGGTGCTTTTCAGTTCAAGGAAACTTGCAGAAGCATGAACGCATCCACCTGGGCGTGAAGGAGTTCATCTGCCAGTATTGCAACAAGGCATTCACATTGAATGAGACCCTCAAAATCCATGAAAGAATCCACACTGGTGAAAAGCGTTACCATTGTCAGTTCTGTTTTCAGAGTTTTTTGTATCTCTCCACAAAAAGGAATCATGAGCAGAGGCATATTCGGGAGCATAATGGGAAAGGCTTTGCTTGCTTCCAGTGCCCCAAAATTTGCAAAACAGCTGCTGCCCTTGGAATGCACCAAAAGAAACATTTATTCAAAAACCCAAATCAACAGGAGAAAATCGGTGACATGTGCCATGAAAACTCAAATCCTTTAGAGAATCAACATTTCATTGATTCAGAAGACACTGACCAAAAGGATAATGTGAAATCGATTGTTGAAAATGTCCTTTGA

XM_004834355.1 Coding sequence

Zbtb38 zinc finger and BTB domain containing 38, transcript variant X7

High confidence: 4 potential gene matches
Length: 3585 bp    Location: 18062234..18075242   Strand: +
>XM_004834355.1
ATGACAGTCATGTCCCTTTCCAGGGACCTCAAGGATGACTTCCACAGCGACACCGTACTCTCCATTTTAAATGAGCAGCGCATTCGGGGCATTTTATGTGATGTTACTATAATTGTGGAAGACACCAAATTTAAAGCTCACAGCAATGTCCTGGCTGCTTCAAGCCTTTATTTCAAAAACATCTTCTGGAGCCATACAATCTGTATTTCCAGCCATGTCCTGGAGCTGGATGATCTCAAAGCTGAAGTGTTTACGGAAATACTTAATTATATCTACAGCTCCACAGTCGTTGTCAAGAGACAGGAAACAGTCACTGATCTTGCAGCTGCAGGGAAAAAGCTGGGAATATCGTTTTTGGAAGACCTCACTGACCGCAACTTCTCAAATTCCCCAGGTCCCTATGTATTCTGCATTACTGAAAAGGGAGTGGTTAAAGAAGAAAAAAATGAAAAAAGGCACGAAGAGCCAGCCATCACTACTGGGCCAAGGATCACAAATGCATTTTCCATCATTGAAACAGAAAATAGTAATAACATGTTTTCTCCACTGGATTTGAGGGCAAGTTTCAAAAAAGTCTCTGACTCCATGAGAACAACTAGCCTTTGCCTAGAGAGGACTGACGTCTGCCATGAGGCAGAGCCCGTTCGCACACTTGCTGAGCACTCGTATGCTGTTTCCTCCATCACCGAGGCTTACAGAAGTCAGCCTGCCCGTGAACATGATAGCGGTTCACCTGGGAAAACAGGTAAAGAAAACGGGGAAGCTCTGGTCGCAAAACCGAAAACATGCCGAAAGCCAAAGACCTATTCCTTACCCCAGGATTCTGATTCAGCCACAGAAAACATACCACCCCCTCCAGTAACGAACCCAGAAATTAATCAAGAAAGAAGTCCACAGCCAGCTGCAATTCTTCCTCACTCAAAATCTCCCAACAATGAAGGAGATGTCCATTTTTCCAAGGAAGATGAAAACCAATCTTCCGATATTCCTGTGCCGCCAGCCACAGAAGTCCCACCTCTCATTTACAACTGTAGCTGTTGTTCCAAATCCTTTGACAGTAGTGCTCTGCTCAGTGCCCACATGCAGCTTCACAAGCCAACCCAGGAGCCATTGGTGTGCAAGTACTGCAACAAACAGTTTACCACCCTGAACCGATTGGATCGGCATGAACAGATCTGTATGAGGTCAAATCACTTGCCCGTTCCTGGAGGAAACCAACCCTTTTTAGAAAATTGTCCCACCATTGGACAAAATGGTAGTTCCATCACAGGCCCAGAATCTTTACTATCTGAAAATAGGATTGGTGAATTTTCCAGTACTGGAAATACTTTGCCAGAGGCAGAGCACATGATTAAATTTGTTAATGGGCAAATGCTCTACAGTTGCGTTGTGTGCAAACGTAGTTATGTGACTTTATCCAGCCTCCGGAGACATGCAAATGTCCACTCCTGGAGAAGAACATATCCCTGCCATTACTGCAACAAAGTATTTGCATTGGCTGAGTACAGGACAAGACATGAAATTTGGCATACAGGGGAAAGGCGGTATCAGTGCATTTTCTGTCTTGAAACTTTCATGACCTACTATATACTAAAAAACCATCAGAAGTCTTTCCATGCCATAGATCATAGGCTTTCCATCAGTAAAAAGACAGCAAATGGAGGCTTGAAACCTACTGTCTATCCATATAAACTTTACCGGCTACTGCCTATGAAATGCAAGAGAGCTCCTTATAAGAGCTACCGAAACTCTTCCTATGAAAATGCTCGAGAAAACAGGCAAATAAATGAGTCTACACCTGGTACCTATGTTGTTCAGAATCCACGCAGTTCCGAATTATCTGCACTGAATTTCCAAGATAGCGTAAACGTCTTGACCAACAGTCCAGCCATCCCATTAGAAGCATCTGCATGTCAGGACATACGCACTTCTGCCACTGTGCAAAATGCAGAGGGCACCAAATGGCGAGAGGAAACAATGAAGATTGACCTAGACAATAACTTTTATTCAACTGAGGTATCAGTTTCTTCCACTGAAAATGCTGTCAGCTCTGACCTCCAGGCAGGAGATGTACCTGTTTTATCCTTGGGTAATGGCAGCGAGAACTCGGCCTCTGTGATTAGCTACAGTGGTTCAGCACCCTCAGTCATTGTGCATAGTAGCCAGTTCTCATCAGTGATAATGCACAGCAATGCTGTTGCTGCCATGGCCAGCAGCAGCCACAGAGCCCCTTCAGACCCAGCTGTCAGTCAGCCCCTGAAAGATGACAGCAAGCCCGAGACAGATAAAGTGGGTAGATTTGCAAGCAGACCCAAAAGCACTAAAGAGAAAAAGAAAACTATTCCATGTAACAAGGCAGAAATTCCAGAGGAATCAAAATACGTTGCTGATCCTGGAGGGTCATTAAACAAAGCCACAAATACAGTTGAAGAAACCAGTAAAATTGAAACTTATATTGCAAAACCTGCTCTTCCTGGAACCTCCACAAATAGCAACGTTGCACCCCTTTGCCAAATAACAGTGAAAATTGGGAACGAAGCCATTGTGAAAAGGCATATTCTGGGATCTAAGTTGTTTTACAAAAGGGGAAGAAGACCCAAGTATCAAACACAGGAAGAGACAGTGCCCCAGGTGAGTGACCCAAAAACCCATGGAGACAGCCCTCTTGGGGTTTGCCAATCTGAGTGTGTGGAGATGAGTGAAGTATTTGATGATGCAAGTGATCAGGATTCCACCGATAAGCCATGGCGCCCCTACTACAACTACAAGCCCAAAAAGAAATCTAGACAGTTGAGAAAAATGAGGAAAGGCAACTGGAGGAAAGAACATGGAAACAAGAGCCCAAGCAATAAGTGTAAATACCCAGCAGAACTGGACTGTGCTGTGGGAAAGCCTCCTCCAGATAAGGCCTTTGAGGAAGAAGAAAATAAAGAGATGCCCAAGCTGCAGTGTGAACTCTGTGATGGAGACAAAGTATCAGGGGCTGGAAACCTAGGCAGGCCCCACCGGCATCTCACTTCCAAGCCTTATGTCTGTGAGCTCTGTGCCAAGCAGTTCCAGAGCCCTTCCACACTTAAAATGCACATGAGATGTCACACTGGAGAGAAGCCGTACCAGTGCAAGACCTGTGGACGGTGCTTTTCAGTTCAAGGAAACTTGCAGAAGCATGAACGCATCCACCTGGGCGTGAAGGAGTTCATCTGCCAGTATTGCAACAAGGCATTCACATTGAATGAGACCCTCAAAATCCATGAAAGAATCCACACTGGTGAAAAGCGTTACCATTGTCAGTTCTGTTTTCAGAGTTTTTTGTATCTCTCCACAAAAAGGAATCATGAGCAGAGGCATATTCGGGAGCATAATGGGAAAGGCTTTGCTTGCTTCCAGTGCCCCAAAATTTGCAAAACAGCTGCTGCCCTTGGAATGCACCAAAAGAAACATTTATTCAAAAACCCAAATCAACAGGAGAAAATCGGTGACATGTGCCATGAAAACTCAAATCCTTTAGAGAATCAACATTTCATTGATTCAGAAGACACTGACCAAAAGGATAATGTGAAATCGATTGTTGAAAATGTCCTTTGA

XM_004834356.1 Coding sequence

Rasa2 RAS p21 protein activator 2, transcript variant X1

Length: 2553 bp    Location: 18119727..18250928   Strand: +
>XM_004834356.1
ATGGCGGCGGCGGCGACGCCTGCTGCTGCGGCTTCTTCCCAGGCGCCGGCAGCGATTTCGACGGCAGAGCCCGAGGCTGGGAACGAGGATTGTCGCGAGGTCCGAGTGCTGCAGAGCCTGCGGGGCAAGATCTGTGAAGCGAAAAATTTATTGCCATATCTTGGACCCAACAAAATGAGAGATTGTTTCTGTACTATAAATTTGGACCAAGAAGAGGTTTATCGTACCCAAGTTGTTGAAAAATCCTTAAGCCCATTTTTTAGTGAAGAATTTTACTTTGAGATTCCAAGGACTTTCCAGTATTTGTCTTTCTATGTTTATGATAAGAACGTTTTACAAAGAGACCTTCGTATAGGCAAAGTAGCCATCAAAAAAGAAGACTTGTGTAATCATAGTGGCAAAGAAACTTGGTTTTCACTGCAACCTGTTGACTCCAATTCAGAGGTTCAGGGTAAAGTTCACCTTGAATTAAAACTGAATGAACTGATAACAGAGAATGGAACTGTGTGCCAGCAACTCGTTGTACACATCAAGGCATGCCATGGATTACCTCTCATAAATGGACAAAGCTGTGATCCTTATGCAACAGTTTCTCTAGTGGGTCCTTCTAGGAATGACCAGAAGAAGACAAAAGTAAAGAAGAAAACAAGCAATCCACAGTTTAATGAAATCTTTTACTTTGAGGTAACCAGATCCAGTAGTTACACCAGAAAATCCCAGTTCCAGGTAGAAGAGGAGGACATTGAAAAGCTAGAAATTAGGATCGACTTGTGGAATAATGGAAACCTGGTCCAAGATGTTTTCCTGGGTGAAATTAAGGTTCCTGTGAGTGTGTTAAGAAATGACTCCTCTCATCAAGCCTGGTACTTGCTTCAACCGAGAGACAATGGGAACAAGTCATCTAAAACTGATGACCTGGGATCTCTTCGATTAAATATATGTTATACAGAAGATTATGTGCTTCCTTCAGAGTACTACAGTCCTTTGAAAACTTTGCTGCTAAAATCACCAGATGTTCAGCCAATATCTGCCTCAGCTGCTTACATTTTGGGTGAAATATGTCGAGATAAAAATGATGCTGTTTTGCCCCTTGTTCGACTGCTGCTGCACCATGATAAACTTGTTCCTTTTGTCACTGCAGTGGCTGAATTAGACTTGAAGGATACCCAAGATGCAAACACAATTTTTAGAGGAAATTCCTTGGCTACCCGATGTCTGGATGAGATGATGAAAATAGTGGGAGGCCACTACCTGAAAGTAACATTAAAATCTATACTAGATGAGATATGTGAATCCTCAAAATCTTGTGAAATTGATCCTATTAAATTAAAAGAAGGAGATAATGTAGAAAATAATAAGGAGAATCTGCGCTACTATGTGGACAAGTTATTCAATACAATTATAAAGTCAAGTATGAGCTGTCCTACTGTAATGTGTGATATCTTTTATTCTTTAAGGCAAATAGCTACTCAAAGATTTCCAAATGACCCTCATGTTCAGTATTCTGCAGTGAGCAGCTTTGTATTCCTTCGTTTCTTTGCTGTAGCCGTAGTATCACCTCATACTTTTCATTTGCGACCTCATCATCCAGATGCACAGACAATTAGGACATTAACTCTCATCTCAAAAACCATTCAGACTTTGGGAAGCTGGGGCAGCCTGTCCAAAAGTAAGTCAAGTTTCAAAGAGACATTCATGTGTGAATTTTTCAAAATGTTTCAAGAAGAAGGATATATTACAGCAGTTAAAAAGTTCTTGGATGAGATTTCATCTACTGAAACTAAAGTGTCCAGTGGAACAAGTGAACCTGTGCACTTGAAAGAAGGTGAGATGTTTAAAAGAGCTCAGGGAAGAACTCGAATTGGAAAAAAGAATTTCAAGAAACGGTGGTTCTGCTTAACAAGCAGAGAGCTCACTTACCACAAACAACCAGGTAGCAAAGATGCAATTTATACAATTCCAGTAAAAAACATTCTTGCTGTGGAAAAATTAGAAGAGAGTTCTTTCAACAAGAAAAATATGTTCCAAGTAATACATACTGAGAAACCACTGTACGTCCAGGCAAATAATTGTGTGGAAGCTAATGAATGGATAGACGTACTCTGCAGGGTGAGCCGATGCAATCAAAACAGACTTAGTTCTTTTCATCCTTCTGCATATCTAAATGGAATCTGGCTCTGCTGTCAGGAGACTAGTGAAAGCACTCCGGGCTGCAAGCCATGTACTGCAGGTGTCCCTGCAGACATCCAAATAGATATTGATGAAGACAGAGAAACAGAAAGAATTTATTCCCTTTTTACCCTCAGTTTGCTTAAACTACAGAAGATGGAAGAGGCTTGTGGAACTATAGCTGTCTATCAAGGACCACAGAAAGAGCCAGATGATTATTCTAACTTTGTAATTGAGGATTCTGTAACAACCTTTAAGACCATTCAACAAATAAAAAGCATCATAGAGAAGCTGGATGAACCTCATGAAAAGTATAGGAAGAAAAGATCAAGTAGTGCAAAATATGGGAGCAAGGAAAATCCAATCATTGGGAAAACATCTTAG

XM_004834359.1 Coding sequence

LOC101726050 uncharacterized LOC101726050, transcript variant X2

Length: 1128 bp    Location: 18291569..18370874   Strand: +
>XM_004834359.1
ATGCCAAGAGTAAAGAAAGGGAAAGGGAAAGCTAAAGGGGCTCCCCCACCCATCGTTCCGATTCTTCAACGGTTCCTGAAAACCTATGGAAAGCACTGTGCACGCTCCCAGACATCAGTGTGTCCAGCCATCAGAAGGGACCTGAAAAGCAGCATTGACAGTGAGCAGAGCCTCAGGAGGTTTACACTCATAAGACCTGACGACTCCCCGCCAGGCCTCCCACCAGTGTCCTTGGAACCTCTCCTCACAACAATCCGAGATGAGCAGTACACCCTGGGGAAGGAGATCTGCATCTGGGGCCTTCAGCTGAGCAACCCGGAGATTGCCAGACTCTCTTGCCTTCTGGAATTGACGGGGTGCACTACCTGCCCATTTACTACGCTGGAAATCATTGCCTGCAAGATGGACCCATGGTCCCTAGGGCGACTTGGGAAGGCTTTGCAGTTCAGCAGATTGCTTTTTCTTATCCTCGATTATTGCAGACTTGGAAATGAAGAAATAGAGCGTATCTTCTCAGGCCTGGAGAACAATAAGAGGCTTCAAGGCCTCAGTCTGCGTTACTGTGGGCTGGGACCATGGAGTGGGCAGAGGCTGGGGTCCATCATTAGCCAGAGTGCCATCTGCAAGCTGCACCTCGATGGCAACTATTTGCAGTGCTCTGGATCTCTGGCTCTGCTCAGGCCCTTAGCGGAGTATGCAGAGATGCAGGGGAAAGAACCGCCAGCCACAGCCTCTCCTGACACGAGAAATCCCACTCAGCAGCTCCACAAAATCAAGAATAAAAAGCGCTTGACTGAAGCTGGTCCTTGGTTAGTGAAGTTACATTTGGCAGATAATGGAATAGATGGCAAAGGAGAAGGAGAAAGCTTGTTGGAATTTACTCAAATGCTGACATGCCTGATCAAATACTCTGCCCATGTAAGGGAAATTGACCTTGGGAACAACATCCTGGGAGAAATGGCTGCTGCTCATATCCTTGGAGCCCTGAGAGCCAGAAAGACAGGTAAACTACCAGTCTTAAAAATTACAGTCACTCCCCAGATCTCTTCCGATACCTTTAGATCTATTTGGAAAAATAGCAAGAAATCTAATACTACCTATAAAAAGAAGAATAAGGCTAAAAACTGA

XM_004834358.1 Coding sequence

LOC101726050 uncharacterized LOC101726050, transcript variant X1

Length: 1128 bp    Location: 18291889..18370874   Strand: +
>XM_004834358.1
ATGCCAAGAGTAAAGAAAGGGAAAGGGAAAGCTAAAGGGGCTCCCCCACCCATCGTTCCGATTCTTCAACGGTTCCTGAAAACCTATGGAAAGCACTGTGCACGCTCCCAGACATCAGTGTGTCCAGCCATCAGAAGGGACCTGAAAAGCAGCATTGACAGTGAGCAGAGCCTCAGGAGGTTTACACTCATAAGACCTGACGACTCCCCGCCAGGCCTCCCACCAGTGTCCTTGGAACCTCTCCTCACAACAATCCGAGATGAGCAGTACACCCTGGGGAAGGAGATCTGCATCTGGGGCCTTCAGCTGAGCAACCCGGAGATTGCCAGACTCTCTTGCCTTCTGGAATTGACGGGGTGCACTACCTGCCCATTTACTACGCTGGAAATCATTGCCTGCAAGATGGACCCATGGTCCCTAGGGCGACTTGGGAAGGCTTTGCAGTTCAGCAGATTGCTTTTTCTTATCCTCGATTATTGCAGACTTGGAAATGAAGAAATAGAGCGTATCTTCTCAGGCCTGGAGAACAATAAGAGGCTTCAAGGCCTCAGTCTGCGTTACTGTGGGCTGGGACCATGGAGTGGGCAGAGGCTGGGGTCCATCATTAGCCAGAGTGCCATCTGCAAGCTGCACCTCGATGGCAACTATTTGCAGTGCTCTGGATCTCTGGCTCTGCTCAGGCCCTTAGCGGAGTATGCAGAGATGCAGGGGAAAGAACCGCCAGCCACAGCCTCTCCTGACACGAGAAATCCCACTCAGCAGCTCCACAAAATCAAGAATAAAAAGCGCTTGACTGAAGCTGGTCCTTGGTTAGTGAAGTTACATTTGGCAGATAATGGAATAGATGGCAAAGGAGAAGGAGAAAGCTTGTTGGAATTTACTCAAATGCTGACATGCCTGATCAAATACTCTGCCCATGTAAGGGAAATTGACCTTGGGAACAACATCCTGGGAGAAATGGCTGCTGCTCATATCCTTGGAGCCCTGAGAGCCAGAAAGACAGGTAAACTACCAGTCTTAAAAATTACAGTCACTCCCCAGATCTCTTCCGATACCTTTAGATCTATTTGGAAAAATAGCAAGAAATCTAATACTACCTATAAAAAGAAGAATAAGGCTAAAAACTGA

XM_004834361.1 Coding sequence

LOC101726050 uncharacterized LOC101726050, transcript variant X4

Length: 987 bp    Location: 18291889..18370874   Strand: +
>XM_004834361.1
ATGCCAAGAGTAAAGAAAGGGAAAGGGAAAGCTAAAGGGGCTCCCCCACCCATCGTTCCGATTCTTCAACGGTTCCTGAAAACCTATGGAAAGCACTGTGCACGCTCCCAGACATCAGTGTGTCCAGCCATCAGAAGGGACCTGAAAAGCAGCATTGACAGTGAGCAGAGCCTCAGGAGGTTTACACTCATAAGACCTGACGACTCCCCGCCAGGCCTCCCACCAGTGTCCTTGGAACCTCTCCTCACAACAATCCGAGATGAGCAGTACACCCTGGGGAAGGAGATCTGCATCTGGGGCCTTCAGCTGAGCAACCCGGAGATTGCCAGACTCTCTTGCCTTCTGGAATTGACGGGGTGCACTACCTGCCCATTTACTACGCTGGAAATCATTGCCTGCAAGATGGACCCATGGTCCCTAGGGCGACTTGGGAAGGCTTTGCAGTTCAGCAGATTGCTTTTTCTTATCCTCGATTATTGCAGCAAGCTGCACCTCGATGGCAACTATTTGCAGTGCTCTGGATCTCTGGCTCTGCTCAGGCCCTTAGCGGAGTATGCAGAGATGCAGGGGAAAGAACCGCCAGCCACAGCCTCTCCTGACACGAGAAATCCCACTCAGCAGCTCCACAAAATCAAGAATAAAAAGCGCTTGACTGAAGCTGGTCCTTGGTTAGTGAAGTTACATTTGGCAGATAATGGAATAGATGGCAAAGGAGAAGGAGAAAGCTTGTTGGAATTTACTCAAATGCTGACATGCCTGATCAAATACTCTGCCCATGTAAGGGAAATTGACCTTGGGAACAACATCCTGGGAGAAATGGCTGCTGCTCATATCCTTGGAGCCCTGAGAGCCAGAAAGACAGGTAAACTACCAGTCTTAAAAATTACAGTCACTCCCCAGATCTCTTCCGATACCTTTAGATCTATTTGGAAAAATAGCAAGAAATCTAATACTACCTATAAAAAGAAGAATAAGGCTAAAAACTGA

XM_004834364.1 Coding sequence

Rnf7 ring finger protein 7, transcript variant X3

Length: 273 bp    Location: 18379669..18388556   Strand: +
>XM_004834364.1
ATGGCCGACGTAGAAGACGGCGAAGAGCCCTGCGCCTTGTCCTCTCACTCGGGGAGCGCAGGCTCCAAGTCGGGAGGAGACAAAATGTTCTCGCTGAAGAAGTGGAACGCGGTGGCCATGTGGAGCTGGGACGTGGAGTGCGATACGTGCGCCATCTGCAGGGTCCAGATGCCTGTCTTAGATGTCAAGCTGAAAACAAACAAGAGGATTGTGTTGTGGTTTGGGGAGAATGCAATCATTCCTTCCACAACTGCTGCATGTCTCTGTGGGTGA

XM_004835156.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1731 bp    Location: 18429546..18464873   Strand: +
>XM_004835156.1
ATGGTGGACACGGGGGGCCTGGACAACCTGATCGCCAGCACGGCCTACCTGCACGCCCGCAAGCCCTAGGACTGCAACAGCCGGGAGCTGCGGCGGTGGCGCTGGAGCCTGGCGCTGCCCGGGCCACAGGACTGTGCCGAGCTCCGCCGTGAGCTGGTTCTCCGCTTCGACACCCTGTGCGAGCTGCAGCCCATCGGCCTCCGCCTCTTCCGAGACTTCCTGGCCAAGGTGCCGGTGTACCGAGAGGCATCCGCCTTCCTGGAGGAGGTGCAGGCCTGAGAGTTGTCCGAGCCCGGGCCTGCCAAGGACGTCGCACTGCAGGGGCTGCTGGCCACTTGTGTCCCTTCCCCAAGTGGCCCACACCCCTTCCTCAGCCTGGCACTGGTCACCAGGTGCCAAGCAGCCACCACCAAAGAAGAGTGTGTGGCCGTAGTGCCCCTAGCCAAGGCTGGGGCCATGGGCTTCTTGCAGGAGCAGCCCTTCAGGGACTTCCTGGCCAGCCCCTTCTACGACAAATTCCTGCAGTGGAAGCTCTTTGAGATGCAGCCAATATCCAGCAAGTACTTCATCGAGTTCCGAGTGTTGGGGAAAGGTGGTTTTGGGGAGGTGTGTGCCATCCAGGTGAAAAACACTGGTAAGATGTATGCCTGTAAAAAACTGGACAAGAAGCGGCTGAAGAAGAAAAATGGGGAGAAAATGGCTCTCCTGGAAAAGGAAATCTTAGAAAAGGTGAACAGCNTTTTCATCGTCTTGCTGGCCTACGCCTTTGAGAGCAAGTCCCATCTCTGCCTGGTCATGACCCTGATGAACGGGGGTGACCTCAAGTTCCACATCTACAACGTGGGCACCCGGGGCCTGGCCTTGAGCCGGGTGGTCTTCTACTCAGCCCAGATGGCCTGTGGACTGCTGGACCTCCACAGCCTGGGCATCGTCTACCGGGACCTGAAGCCTGAGAACGTGCTGCTCGATGACCTCGGTAACTGCAGGCTGTCTGATATGGGGTTGGCTGTGCAGATCCAGGATGACAGGCCTGTCACCCAGAGGGCTGGAACCAATGGTTACATGGCTACTGAAATCCTCATAGAGAAGGTGAGCTATTCCTACCCTGTGGACTGGTTTGCGATGGGATGCAGCATTTATGAAATGGTAGTTGGACGGACACCATTCAAAGATTACAAGGAAAAGATCAGTAAAGAGGATCTAAAGCAAAGAACTCTGAAAGAGGAGGCCATGTTCCAACATGAGAACTTCACAGAGGAGGTGAAAGACATCTGTAGACTCTTCTTAGAAAAGAAACCAGAACAACGCTTAGGAAGCAGAAAAAACTCTGACGATCCCAGGAAACACCCTTTCTTCAATACCATCAACTTTCCTCGTCTGGAAGCTGGCCTACTTGAACCTCCATTTGTACCAGACCCTTACGTGATTTATGCCAAAGACATTGATGAAATTGAAGATTTCTCTGAGGTGCGGGGGGTGNNGTTTGATGACACAGATAAGAAATTCTTCAACAGATTTGCAACAGGTGCTGTCCCCATCACGTGACAGGAAGAAATCCTAGAGTCAGGGCTGTTTGAGGAACTGAACGACCCCAACCAGCCAGCAGGTTACGGGAAGGATAATTCATCCAAGTCTGATGGTGTTTGTTATTGTGAATTGTCCCCCTACCAGCCAGAGTCTCAGCTGACATGGTCCCCAATTGTTCCAGCACTGCTGAAGGAGGCTGATTAA

XM_004834370.1 Coding sequence

Tfdp2 transcription factor Dp-2 (E2F dimerization partner 2), transcript variant X4

Length: 1161 bp    Location: 18638677..18562721   Strand: -
>XM_004834370.1
ATGATTATAAGCACACCACAGAGACTCGCCAGTTCAGGAAGTGTTCTGATCGGGAGCCCATACACTCCTGCACCAGCAATGGTCACTCAGACACACATAGCAGAAGCAACTAGCTGGGTTCCTGGTGATAGAAAACGGGCTAGAGAATTTATAGAATCTGATTTTTCAGAAAGTAAACGAAGCAAAAAAGGAGATAAAAATGGAAAAGGCTTGAGACATTTTTCAATGAAAGTGTGTGAAAAAGTTCAGCGGAAAGGTACAACATCATATAATGAAGTAGCTGATGAACTGGTATCAGAGTTCACCAATTCAAATAATCATTTGGCAGCTGATTCGCAGGCTTATGATCAGAAGAACATTAGGAGAAGAGTTTATGATGCTTTAAATGTGCTAATGGCAATGAACATAATTTCAAAGGAAAAAAAAGAAATCAAGTGGATTGGTCTGCCTACCAATTCTGCTCAGGAATGTCAAAACCTGGAGATAGAGAAGCAGAGACGGATAGAACGGATAAAGCAAAAGCGGGCCCAACTGCAAGAACTTCTCCTACAGCAAATTGCTTTCAAAAACCTGGTACAGAGAAATCGACAAAACGAACAGCAAAACCAGGGCCCCCCAGCGCTCAACTCCACCATTCAGCTGCCGTTTATAATCATCAATACAAGCAGAAAGACGGTGATAGATTGCAGCATCTCCAGTGACAAGTTTGAATATCTTTTTAATTTTGACAACACCTTTGAGATCCATGATGACATAGAAGTACTGAAACGGATGGGAATGTCCTTTGGCCTGGAGTCAGGCAAATGCTCTCTGGAGGACCTGAAACTGGCTAAATCACTGGTGCCAAAGGCTTTAGAAAGTTACATCACAGATATCTCCACAGGACCTTCTTGGTTAAATCAAGGACTACTTTTGAACTCTGCCCAATCAGCATCAAATTTAGACTTGACCACCGGTGCAACCTTACCCCAATCAAGTGTAAACCAAGGGTTATGCTTGGATGCTGAAGTGGCCTTAGCAACCGGGCAGTTCCTTGCCCCAAACAGTCACCAGTCCAGCAGTGCGGCCTCTCACTGCTCTGAGTCCCGAGGCGAGACCCCCTGCTCGTTCAACGATGAAGACGAGGAAGATGATGAGGAGGATTCCTCCTCTCCAGAATAA

XM_004834374.1 Coding sequence

Gk5 glycerol kinase 5 (putative), transcript variant X3

Length: 1338 bp    Location: 18865402..18780196   Strand: -
>XM_004834374.1
ATGTCGGAGCAGTCTAATGGACTCCAGCACCGGCCTACGGCCTTCGTGCTGGGGCTGGACGTGGGGAGCTCTGTGATCCGCTGCCACGTCTATGACCGGACGGCGCTGGTTCGCGGCTCCAGCGCGCAGAAGGTAGAAAATATTTATCCTCAAGCTGGCTGGGTTGAAATTGATCCTGATATTTTGTGGGCTCAGTTTGTTGCTGTAATAAAAGATTCTGTCAAAGATGCGGGGATACAGATGAGGCAGGTTGTTGGTCTCGGCATATCAACACAGAGAGCAACTTTTATTACCTGGAACAGGAAAACAGGAAAGCATTTTCACAACTTCATTAGTTGGCAAGACCTAAGAGCAGCTGAACTTGTAAAATCTTGCAATAATTCTCTTCTGATGAAGGTACAAAAGGCAGTTGAAGAAGAAAATTGTTGCTTCGGGACTATTGATACCTGGTTGTTACACAAGCTCACAAAAGGTTCTGCATATGCTACGGACTTTTCAAATGCCAGTACAACTGGATTTTTTGATACATATAAGATGTGCTGGAGCAGTTTCCTTACCTACCTGGCTTCCATACCACTCTCTGTCCTGCCTCCTATAAAGGACACAAGCCACAATTTTGGATCAGTGGATGAGGAGATATTTGGTGTGCCTATACCAATACTTGCCTTGGTTGGTGATCAGCAGTCAGCCATGTTTGGAGAGTGCTGCTTCCAGAGAGGAGACGTGAAGTTAACCATGGGAACAGGAACTTTTTTGGATATAAATACTGGCAATGACCCTCTGAATGGTACTGGAGATCTTTTCACAGATGCTGCTGAGACTGAAAAAATGGCCACAAGTCTTGAAGATTCTGAAGGAGTTTATTTTGTTCCATCTTTTAGCGGATTACAGGCTCCATTAAATGACCCCTGTGCGTGTGCCTCCTTTATGGGTTTGAAGCCTTCCACCAGTAAATACCATCTTGTACGAGCAATATTGGAGTCAATAGCATTCAGAAACAAACAATTATATGAGATCATGCAGAAAGAGATCCATATTCCTATCACGAAAATCCGGGCAGATGGAGGAGTATGTAGGAATGGTTTTGTCATGCAGATGACTTCAGATTTGATCAATGAGAACATAGACAGACCTGCCCACTTCGACATGTCCTGCCTGGGTGCAGCTTCTCTGGCTGGCCTTGCTGTTGGGTTTTGGAAAGACAAGGAAGAATTAAATAAACTGAGGCAAAGCGAAATGGTTTTCAAGCCACAAAAGAAATGGGAAGACTATGAAATGAATATGGAAAACTGGGTGAAAGCAGTGAAGCGCTCCATGCATTGGTACAACAAGGCTTGA

XM_004834372.1 Coding sequence

Gk5 glycerol kinase 5 (putative), transcript variant X1

High confidence: 4 potential gene matches
Length: 1470 bp    Location: 18865402..18780196   Strand: -
>XM_004834372.1
ATGTCGGAGCAGTCTAATGGACTCCAGCACCGGCCTACGGCCTTCGTGCTGGGGCTGGACGTGGGGAGCTCTGTGATCCGCTGCCACGTCTATGACCGGACGGCGCTGGTTCGCGGCTCCAGCGCGCAGAAGGTAGAAAATATTTATCCTCAAGCTGGCTGGGTTGAAATTGATCCTGATATTTTGTGGGCTCAGTTTGTTGCTGTAATAAAAGATTCTGTCAAAGATGCGGGGATACAGATGAGGCAGGTTGTTGGTCTCGGCATATCAACACAGAGAGCAACTTTTATTACCTGGAACAGGAAAACAGGAAAGCATTTTCACAACTTCATTAGTTGGCAAGACCTAAGAGCAGCTGAACTTGTAAAATCTTGCAATAATTCTCTTCTGATGAAGGTATTTCACAGTTTCTGCAGAGTGGCTTACTTTTTCACTAGAAAGAGGCGATTTTTAACAGGCAGCCAGTTTACTTTCACTACCCAGCAAGTTTCCATGCGTTTGGCCTGGATTTTACAGAACAAGACTGAGGTACAAAAGGCAGTTGAAGAAGAAAATTGTTGCTTCGGGACTATTGATACCTGGTTGTTACACAAGCTCACAAAAGGTTCTGCATATGCTACGGACTTTTCAAATGCCAGTACAACTGGATTTTTTGATACATATAAGATGTGCTGGAGCAGTTTCCTTACCTACCTGGCTTCCATACCACTCTCTGTCCTGCCTCCTATAAAGGACACAAGCCACAATTTTGGATCAGTGGATGAGGAGATATTTGGTGTGCCTATACCAATACTTGCCTTGGTTGGTGATCAGCAGTCAGCCATGTTTGGAGAGTGCTGCTTCCAGAGAGGAGACGTGAAGTTAACCATGGGAACAGGAACTTTTTTGGATATAAATACTGGCAATGACCCTCTGAATGGTACTGGAGATCTTTTCACAGATGCTGCTGAGACTGAAAAAATGGCCACAAGTCTTGAAGATTCTGAAGGAGTTTATTTTGTTCCATCTTTTAGCGGATTACAGGCTCCATTAAATGACCCCTGTGCGTGTGCCTCCTTTATGGGTTTGAAGCCTTCCACCAGTAAATACCATCTTGTACGAGCAATATTGGAGTCAATAGCATTCAGAAACAAACAATTATATGAGATCATGCAGAAAGAGATCCATATTCCTATCACGAAAATCCGGGCAGATGGAGGAGTATGTAGGAATGGTTTTGTCATGCAGATGACTTCAGATTTGATCAATGAGAACATAGACAGACCTGCCCACTTCGACATGTCCTGCCTGGGTGCAGCTTCTCTGGCTGGCCTTGCTGTTGGGTTTTGGAAAGACAAGGAAGAATTAAATAAACTGAGGCAAAGCGAAATGGTTTTCAAGCCACAAAAGAAATGGGAAGACTATGAAATGAATATGGAAAACTGGGTGAAAGCAGTGAAGCGCTCCATGCATTGGTACAACAAGGCTTGA

XM_004834375.1 Coding sequence

Gk5 glycerol kinase 5 (putative), transcript variant X4

Length: 1230 bp    Location: 18865325..18780196   Strand: -
>XM_004834375.1
ATGAGGCAGGTTGTTGGTCTCGGCATATCAACACAGAGAGCAACTTTTATTACCTGGAACAGGAAAACAGGAAAGCATTTTCACAACTTCATTAGTTGGCAAGACCTAAGAGCAGCTGAACTTGTAAAATCTTGCAATAATTCTCTTCTGATGAAGGTATTTCACAGTTTCTGCAGAGTGGCTTACTTTTTCACTAGAAAGAGGCGATTTTTAACAGGCAGCCAGTTTACTTTCACTACCCAGCAAGTTTCCATGCGTTTGGCCTGGATTTTACAGAACAAGACTGAGGTACAAAAGGCAGTTGAAGAAGAAAATTGTTGCTTCGGGACTATTGATACCTGGTTGTTACACAAGCTCACAAAAGGTTCTGCATATGCTACGGACTTTTCAAATGCCAGTACAACTGGATTTTTTGATACATATAAGATGTGCTGGAGCAGTTTCCTTACCTACCTGGCTTCCATACCACTCTCTGTCCTGCCTCCTATAAAGGACACAAGCCACAATTTTGGATCAGTGGATGAGGAGATATTTGGTGTGCCTATACCAATACTTGCCTTGGTTGGTGATCAGCAGTCAGCCATGTTTGGAGAGTGCTGCTTCCAGAGAGGAGACGTGAAGTTAACCATGGGAACAGGAACTTTTTTGGATATAAATACTGGCAATGACCCTCTGAATGGTACTGGAGATCTTTTCACAGATGCTGCTGAGACTGAAAAAATGGCCACAAGTCTTGAAGATTCTGAAGGAGTTTATTTTGTTCCATCTTTTAGCGGATTACAGGCTCCATTAAATGACCCCTGTGCGTGTGCCTCCTTTATGGGTTTGAAGCCTTCCACCAGTAAATACCATCTTGTACGAGCAATATTGGAGTCAATAGCATTCAGAAACAAACAATTATATGAGATCATGCAGAAAGAGATCCATATTCCTATCACGAAAATCCGGGCAGATGGAGGAGTATGTAGGAATGGTTTTGTCATGCAGATGACTTCAGATTTGATCAATGAGAACATAGACAGACCTGCCCACTTCGACATGTCCTGCCTGGGTGCAGCTTCTCTGGCTGGCCTTGCTGTTGGGTTTTGGAAAGACAAGGAAGAATTAAATAAACTGAGGCAAAGCGAAATGGTTTTCAAGCCACAAAAGAAATGGGAAGACTATGAAATGAATATGGAAAACTGGGTGAAAGCAGTGAAGCGCTCCATGCATTGGTACAACAAGGCTTGA

XM_004834380.1 Coding sequence

Pls1 plastin 1, transcript variant X1

Length: 1893 bp    Location: 19164369..19302222   Strand: +
>XM_004834380.1
ATGGAAAATAGTACCACTACCATTTCTCGGGAGGAGCTTGAAGAACTACAAGAAGCATTTAATAAAATAGATATTGACAACAGTGGATATGTGAGTGACTATGAACTTCAGGACCTATTTAAGGAAGCAAGCCTTCCTCTTCCTGGCTATAAGGTGCGCGAGATTGTGGAGAAAATTCTAGTAGTTGCTGACAACAACAAAGATGGCAAAATCAGTTTTGAAGAGTTTGTGTCACTAATGCAAGAGTTAAAAAGCAAAGATATCAGCAAAACATTCCGAAAAATAATTAACAAGAGAGAAGGAATTACTGCTATTGGAGGAACTTCATCCATTTCCAGTGAGGGCACACAGCATTCTTATTCAGAGGAAGAAAAAGTGGCTTTTGTTAACTGGATAAACAAAGCCCTAGAGAGTGACCCTGACTGTAAGCATCTTATACCCATGAATCCCAATGATGGCAGTCTGTTCAGATCACTTGCAGATGGCATCCTTCTTTGCAAAATGATCAACTTATCTGAACCAGATACAATTGATGAAAGAGCCATTAATAAGAAGAAGCTCACTCCTTTTACTGTTTCTGAAAATTTAAACCTAGCCCTGAATTCTGCCTCAGCCATTGGTTGTACAGTGGTCAACATTGGTGCACAGGATCTTAAAGAAGGAAAGCCTCACTTGGTCTTGGGTCTTCTCTGGCAGATCATCAAAGTTGGTCTTTTTGCTGATATTGAGATTTCTAGGAATGAAGCTTTGATTGCATTGCTAAATGAAGGTGAAGAACTAGAGGAACTGATGAAGCTTTCTCCTGAGGAATTACTGCTGCGATGGGTGAACTACCATCTGACCAACGCAGGATGGAATACCATCAACAACTTCAGCCAGGACATTAAGGATTCAAGAGCCTATTTTCATCTGCTTAATCAGATTGCCCCTAAGAGTGACCGAGAGGATGGACCTGCCATTGCCATTGACCTTTCAGGATTTAATGAGAAAAATGACCTGAAGCGTGCTGGATTCATGCTTCAAGAAGCAGATAAACTAGGCTGCAGACAGTTTGTTACTCCTGCAGATGTGGTTTCAGGAAATCCTAAACTTAATTTAGCCTTTGTAGCTAATCTTTTTAACACATACCCCTGCCTACACAAGCCTGATAATAATGAAATTGATATTAATTTATTGGAAGGAGAGAGCAAAGAAGAGAGGACATTTCGGAACTGGATGAATTCCTTGGGAGTCAATCCATACATTAATCATTTGTATGGTGACCTTGAAGATGCTTTAGTGATCTTTCAGCTCTATGAAATGATTCGAGTGCCAGTCAACTGGAACCAGGTCAACAAACCTCCTTATCCTGCTCTTGGAGGGAATATGAAGAAGATTGAGAACTGTAACTATGCTGTAGAGCTTGGAAAGAATAAAGCCAAATTCTCCTTGGTTGGCATTGCTGGTCAGGACCTAAATGAAGGGAATTCAACACTTACTCTGGCACTGGTATGGCAGCTGATGAGAAGGTACACATTGAATGTGTTATCAGATCTTGGAGAGGGAGAAAAAGTAAATGATGAAATTATTATTAAATGGGTCAATCAGACTCTTAAAAATGCAAACAAAAATACTTCTATTTCCAGCTTCAAGGATAAATCTATTAGCACGAGTTTACCTGTCCTAGATTTAATAGATGCCATTGCACCAAATGCAGTTCGTCAAGAAATGATCAAGAGAGAAAACCTTTCTGATGAAGACAAACTGAACAATGCTAAATATGCCATTTCAGTTGCTCGAAAGATTGGTGCCCGGATATATGCATTACCTGATGATCTCGTAGAAGTAAAACCAAAGATGGTTATGACGGTGTTTGCATGCTTAATGGGAAAAGGACTGAACAGAATAAAATAA

XM_004834381.1 Coding sequence

Pls1 plastin 1, transcript variant X2

Length: 1893 bp    Location: 19206074..19302222   Strand: +
>XM_004834381.1
ATGGAAAATAGTACCACTACCATTTCTCGGGAGGAGCTTGAAGAACTACAAGAAGCATTTAATAAAATAGATATTGACAACAGTGGATATGTGAGTGACTATGAACTTCAGGACCTATTTAAGGAAGCAAGCCTTCCTCTTCCTGGCTATAAGGTGCGCGAGATTGTGGAGAAAATTCTAGTAGTTGCTGACAACAACAAAGATGGCAAAATCAGTTTTGAAGAGTTTGTGTCACTAATGCAAGAGTTAAAAAGCAAAGATATCAGCAAAACATTCCGAAAAATAATTAACAAGAGAGAAGGAATTACTGCTATTGGAGGAACTTCATCCATTTCCAGTGAGGGCACACAGCATTCTTATTCAGAGGAAGAAAAAGTGGCTTTTGTTAACTGGATAAACAAAGCCCTAGAGAGTGACCCTGACTGTAAGCATCTTATACCCATGAATCCCAATGATGGCAGTCTGTTCAGATCACTTGCAGATGGCATCCTTCTTTGCAAAATGATCAACTTATCTGAACCAGATACAATTGATGAAAGAGCCATTAATAAGAAGAAGCTCACTCCTTTTACTGTTTCTGAAAATTTAAACCTAGCCCTGAATTCTGCCTCAGCCATTGGTTGTACAGTGGTCAACATTGGTGCACAGGATCTTAAAGAAGGAAAGCCTCACTTGGTCTTGGGTCTTCTCTGGCAGATCATCAAAGTTGGTCTTTTTGCTGATATTGAGATTTCTAGGAATGAAGCTTTGATTGCATTGCTAAATGAAGGTGAAGAACTAGAGGAACTGATGAAGCTTTCTCCTGAGGAATTACTGCTGCGATGGGTGAACTACCATCTGACCAACGCAGGATGGAATACCATCAACAACTTCAGCCAGGACATTAAGGATTCAAGAGCCTATTTTCATCTGCTTAATCAGATTGCCCCTAAGAGTGACCGAGAGGATGGACCTGCCATTGCCATTGACCTTTCAGGATTTAATGAGAAAAATGACCTGAAGCGTGCTGGATTCATGCTTCAAGAAGCAGATAAACTAGGCTGCAGACAGTTTGTTACTCCTGCAGATGTGGTTTCAGGAAATCCTAAACTTAATTTAGCCTTTGTAGCTAATCTTTTTAACACATACCCCTGCCTACACAAGCCTGATAATAATGAAATTGATATTAATTTATTGGAAGGAGAGAGCAAAGAAGAGAGGACATTTCGGAACTGGATGAATTCCTTGGGAGTCAATCCATACATTAATCATTTGTATGGTGACCTTGAAGATGCTTTAGTGATCTTTCAGCTCTATGAAATGATTCGAGTGCCAGTCAACTGGAACCAGGTCAACAAACCTCCTTATCCTGCTCTTGGAGGGAATATGAAGAAGATTGAGAACTGTAACTATGCTGTAGAGCTTGGAAAGAATAAAGCCAAATTCTCCTTGGTTGGCATTGCTGGTCAGGACCTAAATGAAGGGAATTCAACACTTACTCTGGCACTGGTATGGCAGCTGATGAGAAGGTACACATTGAATGTGTTATCAGATCTTGGAGAGGGAGAAAAAGTAAATGATGAAATTATTATTAAATGGGTCAATCAGACTCTTAAAAATGCAAACAAAAATACTTCTATTTCCAGCTTCAAGGATAAATCTATTAGCACGAGTTTACCTGTCCTAGATTTAATAGATGCCATTGCACCAAATGCAGTTCGTCAAGAAATGATCAAGAGAGAAAACCTTTCTGATGAAGACAAACTGAACAATGCTAAATATGCCATTTCAGTTGCTCGAAAGATTGGTGCCCGGATATATGCATTACCTGATGATCTCGTAGAAGTAAAACCAAAGATGGTTATGACGGTGTTTGCATGCTTAATGGGAAAAGGACTGAACAGAATAAAATAA

XM_004834387.1 Coding sequence

LOC101704368 progestin and adipoQ receptor family member 9-like, transcript variant X2

Length: 1284 bp    Location: 19614689..19611971   Strand: -
>XM_004834387.1
ATGGAGCGGCTGCTCGGAGGCGCAGGTCCTGTCTTGAACCCAGAGCGACGCCCCCGGCGCGGGCACAAAGGCTCCGACGGCGGCCGGCGGGGGCTGCCCAGCGCGCAGGAACCGGCGCCAGAGGTCGCCTGTGTGCGTCCTAGCCGAGCCCCGGGCACCATGCCGCGGCGCCTGCAGCCCCGGGGCACGGGCACAAAGGGCACGGCCGCGGCAGCTTCGGGGGCCGCCCGGCACTCCCATCCCGCAGTACCCGAGGATCCCCCAGCGTCGGCCAAGCCGCTGCTGCGTTGGGACGAAGTGCCCGACGACTTCGTGGAGTGCTTCATCCTGTCGGGCTACCGGCGCCTGCCGTGCACGGCGCAGGAGTGCCTGGCCTCGGTGCTGAAGCCTACCAATGAGACGCTCAACTTCTGGACGCACTTCATCCCGCTGATACTATTCCTGAGCAAGTTCTGCCGCCTGTTCTTCCTGAGCGGCTGCGATGTGCCCTTCCACCATCCGTGGTTGCTGCCACTGTGGTGCTACGCGTCCGGAGTGCTGCTGACCTTCGCCATGAGCTGCACTGCGCACGTGTTCAGCTGCCTGTCACTGCGCCTGCGCGCCGCCTTCTTCTACTTGGACTACGCATCCATAAGCTACTATGGCTTTGGGAGCACGGTGGCCTACTACTACTACCTGCTGCCTGGCCTGAGCTTGCTGGACGCCAGAGTCATGACCCCGTATGTACAGCAGCGCCTGGGCTGGCACGTGGATTGCACGCGCCTCATAGCCACCTACCGCGCACTGGTGCTGCCAGTGGCCTTCATGCTGGCGGTGGCCTGCACCGTGGCCTGCTGCAAGAGCCGCACCGACTGGTGCGCCTACCCGTTCGCCTTGCGTACCTTTGTCTTCATCATGCCCCTCAGCATGGCCTGCCCCATTATGCTGGAGAGCTGGCTCTTCGACCTGCGTGGCGAGAACCCCACACTCTTTGTGCACTTCTACCGCCGCTACTTCTGGCTAGTGGTGGCTGCCTTCTTCAACGTAAGCAAGATCCCGGAGCGCATCCAGCCAGGCCTCTTTGACATCATTGGTCACAGTCACCAGCTTTTCCACATCTTCACTTTCCTCAGCATCTATGACCAGGTGTACTACGTGGAGGAGGGTCTGCGCCAGTTTCTCCAGGCACCGCCTGCAGCGCCCACCTTCTCAGGCACCGTGGGCTACATGTTGCTGCTGGTAGTTTGCCTGGGGTTGGTCATCAGGAAGTTCCTCAACAACACCGAATTCTGCAGTAAAAAGTGA

XM_004834389.1 Coding sequence

U2surp U2 snRNP-associated SURP domain containing, transcript variant X1

Length: 3090 bp    Location: 19645728..19694152   Strand: +
>XM_004834389.1
ATGGCGGACAAAACGCCAGGCGGATCTCAGAAGGCCAGTTCGAAGACCAGATCATCAGATGTTCATTCATCTGGATCTTCAGATGCACATATGGATGCATCTGGACCTTCAGATAGTGATATGCCAAGTCGGACAAGACCTAAGAGCCCAAGAAAACATAATTACAGGAATGAAAGTGCCCGTGAAAACCTTTGTGATTCTCCTCATCAGAATCTTTCAAGACCTCTTCTGGAAAACAAACTTAAAGCATTCAGTATTGGAAAAATGAGTACAGCTAAGCGAACTTTAAGTAAAAAGGAACAAGAGGAATTAAAGAAAAAGGAAGATGAAAAGGCAGCTGCTGAGATTTATGAGGAATTTCTTGCTGCTTTTGAAGGAAGTGACGGTAATAAAGTAAAAACTTTTGTGCGAGGAGGTGTTGTTAATGCAGCTAAAGAAGAACATGAAACAGATGAAAAAAGAGGTAAAATCTATAAGCCATCTTCAAGATTTGCAGATCAAAAAAATCCTCCAAATCAGTCATCCAATGAAAGACCACCATCTCTTCTGGTGATAGAAACCAAAAAACCCCCATTGAAGAAAGGGGAGAAAGAAAAGAAAAAAAGCAATTTAGAACTCTTCAAAGAAGAATTGAAACAAATTCAAGAAGAGCGTGATGAGAGACATAAAACAAAAGGCAGGTTAAGTCGATTTGAGCCTCCTCAGTCAGATTCTGATGGTCAGCGTCGTTCTATGGATGCACCTTCAAGAAGAAATAGATCATCCGGTGTTCTTGATGATTATGCACCTGGCTCACATGATGTAGGAGATCCAAGTACTACTAATTTATACCTTGGAAACATTAATCCACAGATGAATGAAGAAATGCTGTGCCAAGAATTTGGAAGATTTGGGCCATTGGCTAGTGTGAAAATTATGTGGCCTAGAACTGATGAAGAAAGAGCAAGAGAGAGAAATTGTGGCTTTGTGGCCTTTATGAATAGGCGAGATGCTGAAAGAGCTTTAAAAAATTTAAATGGAAAAATGATTATGTCTTTTGAAATGAAGTTAGGTTGGGGTAAAGCCGTACCGATTCCGCCACATCCAATATACATTCCTCCTTCTATGATGGAACATACGCTCCCTCCACCTCCATCCGGACTGCCTTTTAATGCGCAGCCTAGAGAGCGGTTAAAAAACCCCAATGCTCCCATGTTACCACCACCTAAAAACAAGGAGGATTTTGAGAAGACTCTGTCGCAAGCCATAGTCAAAGTGGTTATCCCAACAGAAAGGAATTTGCTCGCCCTGATACATCGAATGATAGAGTTTGTTGTACGTGAAGGGCCGATGTTTGAAGCTATGATTATGAACAGAGAAATCAACAATCCTATGTTCAGGTTCTTATTTGAAAACCAGACGCCAGCCCATGTTTACTACAGGTGGAAGCTTTATTCTATTCTGCAGGGAGATTCTCCAACTAAATGGCGAACAGAGGATTTTCGTATGTTCAAAAATGGATCTTTTTGGAGGCCACCACCATTAAATCCATACCTTCATGGAATGTCAGAAGAACAGGAAACAGAAGCTTTTGTAGAGGAACCTAGTAAAAAGGGAGCACTTAAAGAAGAACAGAGGGACAAATTAGAAGAAATCTTGCGAGGATTGACTCCAAGGAAAAATGATATTGGAGATGCAATGGTTTTCTGTCTTAATAATGCTGAAGCTGCTGAAGAAATAGTAGATTGCATTACTGAGTCATTGTCTATCTTAAAGACACCTCTTCCTAAAAAGATTGCCAGGTTATATTTGGTTTCTGATGTTTTGTACAACTCTTCAGCCAAAGTTGCCAATGCTTCATATTATAGAAAATTTTTTGAAACAAAGTTATGTCAGATATTTTCTGACCTCAATGCTACCTATCGTACAATTCAAGGCCATTTACAATCTGAAAATTTTAAGCAACGAGTAATGACCTGCTTCAGAGCCTGGGAAGATTGGGCAATTTATCCAGAACCATTTTTGATCAAACTACAAAATATTTTCTTAGGACTTGTAAATATTATTGAAGAAAAGGAAACAGAGGATGTACCAGATGATCTTGATGGTGCTCCCATTGAGGAAGAGCTTGATGGTGCACCTCTGGAGGATGTGGATGGGATTCCCATTGATGCTACTCCCATTGATGATCTTGATGGTGTTCCTATAAAAAGTCTTGATGATGATCTGGATGGAGTGCCTTTGGATGCAACTGAAGACTCAAAGAAGAATGAGCCTATATTTAAAGTTGCTCCATCAAAATGGGAAGCTGTAGATGAATCTGAATTGGAAGCACAGGCTGTAACAACTTCTAAGTGGGAGTTATTTGACCAGCATGAAGAATCGGAAGAAGAAGAAAATCAAAATCAAGAAGAAGAAAGTGAAGATGAAGAAGATACTCAAAGTTCCAAATCTGAAGAACATCATTTGTACTCTAATCCAATCAAAGAAGAAATGACTGAGTCCAAGTTCTCTAAGTACTCAGAAATGAGTGAGGAAAAACGAGCAAAACTTCGTGAAATTGAGCTCAAAGTTATGAAGTTTCAGGATGAATTAGAATCTGGAAAAAGACCTAAAAAACCAGGCCAAAGTTTCCAAGAGCAAGTTGAGCACTACAGAGATAAACTTCTTCAACGAGAAAAAGAGAAAGAATTAGAAAGAGAACGAGAAAGAGACAAGAAAGATAAAGAAAAATTGGAATCTCGATCCAAAGACAAGAAGGAAAAAGATGAATGTACTCCAACAAGGAAGGAAAGGAAAAGACGGCACAGTACATCCCCCAGCCCATCTCGCAGTAGCAGTGGTAGACGAGTAAAATCACCATCACCAAAATCGGAGCGATCAGAGCGTTCAGAAAGATCTCATAAAGAAAGCTCACGGTCCAGGTCATCTCACAAAGATTCTCCTAGAGATGTTAGCAAAAAAGCCAAAAGATCACCATCTGGTTCAAGGACGCCTAAGAGGTCTAGGCGGTCACGGTCTAGATCCCCTAAAAAATCAGGGAAGAAATCCAGATCCCAGTCTCGATCTCCACACAGGTCTCATAAAAAGTCAAAGAAAAACAAACACTGA

XM_004834395.1 Coding sequence

LOC101707609 chromosome unknown open reading frame, human C3orf58

Length: 1293 bp    Location: 20633821..20654161   Strand: +
>XM_004834395.1
ATGTGGCGCCTGGTGCCCCCAAAGCTGGGCCGCCTGTCCCGCTCGCTGAAGCTGGCGGCGCTGGGCAGCCTGTTGGTGCTCATGGTGCTGCACTCGCCGTCGCTGCTCGCCTCCTGGCAGCGCAACGAGCTGACCGACCGGCGCTTCCTGCAGCTCAATAAGTGCCCGGCGTGCTTCGGCACGAGCTGGTGCCGCCGCTTCCTCAACGGGCAGGTGGTGTTCGAGGCGTGGGGCCGCCTGCGTCTGCTGGACTTCCTCAACGTGAAGAACGTCTACTTCGCTCAGTACGGCGAGCCCCGCGAGGGCGGCCGCCGCCGAGTGGTGCTCAAGCGCCTCGGCTCGCAGCGCGAGCTGGCGCAGCTCGACCAGAGCATCTGCAAGCGGGCCACCGGCCGGCCGCGCTGCGACCTGCTCCAGGCCATGCCCCGGACTGAGTTCGCGCGCCTCAACGGGGACGTGCGCCTGCTCACGCCCGAGGCGGTGGAGGGCTGGTCCGACCTGGTCCACTGCCCCTCGCAGCGCCTGCTGGACCGCCTGGTGCGCCGCTACGCCGAGACCAAGGACTCAGGCAGCTTCCTGCTCCGCAACCTCAAAGACTCGGAGCGCATGCAGCTGCTGCTAACCTTGGCCTTCAACCCCGAGCCGCTGGTGCTACAGAGTTTTCCGTCTGATGAGGGTTGGCCATTTGCAAAATACCTTGGAGCATGTGGAAGAATGGTGGCTGTTAATTATGTTGGAGAAGAACTGTGGAGTTACTTCAGTGCACCATGGGAGAAAAGAGTTGACCTTGCTTGGCAGTTAATGGAAATAGCAGAGCAACTTACAAACAATGACTTTGAATTTGCACTCTACCTCCTGGATGTCAGCTTTGACAATTTTGCAGTTGGTCCTCGAGATGGGAAGGTAATCATTGTGGATGCTGAAAATGTTTTGGTTGCTGACAAAAGATTAATTAGACAGAATAAACCTGAAAATTGGGATGTATGGTATGAAAGCAAATTTGATGACTGTGATAAGGAGGCTTGTTTATCGTTCTCAAAAGAAATTCTTTGTGCTCGTGTCACTGTGGACCACAATTATTATGCTGTTTGTCAAAACCTCTTATCCAGACATGCCACCTGGCGTGGCACATCTGGAGGACTTCTTCATGATCCACCAAGTGAAATTGCCAAAGATGGCCGACTCGAGGCCTTATTGGATGAATGTGCCAACCCAAAGAAACGCTATGGCAGATTCCAGGCAGCAAAGGAACTGCGGGAATATCTGGCACAATTAAGTAATAATGTCAGGTAG

XM_004834403.1 Coding sequence

Plscr1 phospholipid scramblase 1, transcript variant X4

High confidence: 1 potential gene match
Length: 984 bp    Location: 23488520..23456385   Strand: -
>XM_004834403.1
ATGGATCCTCCTCACCGAGGAGCAAATTTTCCACCTGCATATAACCCACAGTTTCCACCAGCAGCATTCCAAGGACCTCCAGGACAAACTGGCTACTCTGGGCCCCAGGGTACCTATTTAGGTCCCAAGGCTGGCTATCCTGGGCCCTACAGTGCTTATCAAGGTCCCCCAGTTGGCTCCCCAATCCCACCAGGCAGCTTTGCAGGTGCTGGCCAACCTGGGTTTCCTGTTCAGAGTCAGCCAGGATATAGTCAGCCGGGGGGACCTGCAGGGGCACCATGGATGCCAGCACCACCACCTCCATTGAACTGCCCACCTGGACTGGAATACTTAAGTCAGATAGATCAGATTCTGGTTCACCAGCAAATTGAACTTCTGGAAGTCTTAACAGGCTTTGAAACTAATAATAAATATGAAATTAAGAACAGCCTTGGACAGAGGGTTTACTTTGCAGTGGAAGATAATGATTGCTGCACTCGAAATTGCTGTGGAGCATCTAGGCCTTTTACATTGAAGATTCTTGATAATTTGGGCCGAGAAGTCATAACTATGGAGAGACCACTGAGATGTACCAGCTGCTGTTTCCCTTGCTGCCTTCAGGAGATAGAAATCCAGGCTCCTCCTGGTGTTCCAATTGGTTATGTTACTCAGAAGTGGCACCCATGTCTGCCTAAGTTTACTGTTCAAAATGAGAGGAGAGAGGATGTACTAAAAATAATTGGTCCATGTATTGTGTGCAGTTGTTGTTCAGACATTGATTTTGAGATTAAATCTCTTGATGAACAATCTGTGGTTGGCAAGATTTCCAAACAGTGGTCTGGGCTTGTAAGAGAGGCATTCACAGATGCCGACAACTTCGGGATCCAGTTTCCTTTAGACCTGGATGTGAAAATAAAAACTGTGATGCTTGGTGCATGTTTCCTCGTTGACTTCATGTTTTTTGAAAGTACTGACAACCAGCAACAAAAATCAGGAGTATGGTAG

XM_004834401.1 Coding sequence

Plscr1 phospholipid scramblase 1, transcript variant X2

Length: 984 bp    Location: 23491539..23456386   Strand: -
>XM_004834401.1
ATGGATCCTCCTCACCGAGGAGCAAATTTTCCACCTGCATATAACCCACAGTTTCCACCAGCAGCATTCCAAGGACCTCCAGGACAAACTGGCTACTCTGGGCCCCAGGGTACCTATTTAGGTCCCAAGGCTGGCTATCCTGGGCCCTACAGTGCTTATCAAGGTCCCCCAGTTGGCTCCCCAATCCCACCAGGCAGCTTTGCAGGTGCTGGCCAACCTGGGTTTCCTGTTCAGAGTCAGCCAGGATATAGTCAGCCGGGGGGACCTGCAGGGGCACCATGGATGCCAGCACCACCACCTCCATTGAACTGCCCACCTGGACTGGAATACTTAAGTCAGATAGATCAGATTCTGGTTCACCAGCAAATTGAACTTCTGGAAGTCTTAACAGGCTTTGAAACTAATAATAAATATGAAATTAAGAACAGCCTTGGACAGAGGGTTTACTTTGCAGTGGAAGATAATGATTGCTGCACTCGAAATTGCTGTGGAGCATCTAGGCCTTTTACATTGAAGATTCTTGATAATTTGGGCCGAGAAGTCATAACTATGGAGAGACCACTGAGATGTACCAGCTGCTGTTTCCCTTGCTGCCTTCAGGAGATAGAAATCCAGGCTCCTCCTGGTGTTCCAATTGGTTATGTTACTCAGAAGTGGCACCCATGTCTGCCTAAGTTTACTGTTCAAAATGAGAGGAGAGAGGATGTACTAAAAATAATTGGTCCATGTATTGTGTGCAGTTGTTGTTCAGACATTGATTTTGAGATTAAATCTCTTGATGAACAATCTGTGGTTGGCAAGATTTCCAAACAGTGGTCTGGGCTTGTAAGAGAGGCATTCACAGATGCCGACAACTTCGGGATCCAGTTTCCTTTAGACCTGGATGTGAAAATAAAAACTGTGATGCTTGGTGCATGTTTCCTCGTTGACTTCATGTTTTTTGAAAGTACTGACAACCAGCAACAAAAATCAGGAGTATGGTAG

XM_004834400.1 Coding sequence

Plscr1 phospholipid scramblase 1, transcript variant X1

Length: 984 bp    Location: 23491918..23456388   Strand: -
>XM_004834400.1
ATGGATCCTCCTCACCGAGGAGCAAATTTTCCACCTGCATATAACCCACAGTTTCCACCAGCAGCATTCCAAGGACCTCCAGGACAAACTGGCTACTCTGGGCCCCAGGGTACCTATTTAGGTCCCAAGGCTGGCTATCCTGGGCCCTACAGTGCTTATCAAGGTCCCCCAGTTGGCTCCCCAATCCCACCAGGCAGCTTTGCAGGTGCTGGCCAACCTGGGTTTCCTGTTCAGAGTCAGCCAGGATATAGTCAGCCGGGGGGACCTGCAGGGGCACCATGGATGCCAGCACCACCACCTCCATTGAACTGCCCACCTGGACTGGAATACTTAAGTCAGATAGATCAGATTCTGGTTCACCAGCAAATTGAACTTCTGGAAGTCTTAACAGGCTTTGAAACTAATAATAAATATGAAATTAAGAACAGCCTTGGACAGAGGGTTTACTTTGCAGTGGAAGATAATGATTGCTGCACTCGAAATTGCTGTGGAGCATCTAGGCCTTTTACATTGAAGATTCTTGATAATTTGGGCCGAGAAGTCATAACTATGGAGAGACCACTGAGATGTACCAGCTGCTGTTTCCCTTGCTGCCTTCAGGAGATAGAAATCCAGGCTCCTCCTGGTGTTCCAATTGGTTATGTTACTCAGAAGTGGCACCCATGTCTGCCTAAGTTTACTGTTCAAAATGAGAGGAGAGAGGATGTACTAAAAATAATTGGTCCATGTATTGTGTGCAGTTGTTGTTCAGACATTGATTTTGAGATTAAATCTCTTGATGAACAATCTGTGGTTGGCAAGATTTCCAAACAGTGGTCTGGGCTTGTAAGAGAGGCATTCACAGATGCCGACAACTTCGGGATCCAGTTTCCTTTAGACCTGGATGTGAAAATAAAAACTGTGATGCTTGGTGCATGTTTCCTCGTTGACTTCATGTTTTTTGAAAGTACTGACAACCAGCAACAAAAATCAGGAGTATGGTAG

XM_004834404.1 Coding sequence

Plscr5 phospholipid scramblase family, member 5

High confidence: 4 potential gene matches
Length: 822 bp    Location: 23565050..23549704   Strand: -
>XM_004834404.1
ATGGCCTCTAAAGATACACACAACCAAAAAGGTAGAGGGCTACCTCATTTTCTTCCTGGAGTTCCGGACCCAGGCCGAAGTTGTATCATCTCTTCTTCCCATCCAGGGAACCAAGTCTGGCAGCCGGGACCCCACCCACCAAGCAGCTTCCTGACAACAGTCAGTGTCCCTCCTGGTCTAGAGTATTTAAGCCAGTTAGACCTGATAATTATACACCAGCAAGTGGAGCTTCTTGGAATGATTCTTGGCACTGAGACCTCCAACAAATATGAGATTAAAAACAGCTTGGGACAAAGAATCTACTTTGCAGTGGAGGAAAGCATCTGCTTTAATCGAACGTTCTGTTCCACACTGCGATCCTGCACCCTGAAGATCACAGATAACTCAGGCCGAGAGGTGATTACAGTAAACCGGCCCTTAAGGTGTAACAGCTGCTGGTGCCCTTGTTACCTACAAGAGTTAGAAATACAAGCCCCTCCTGGTACTATAGTTGCTTATGTTGCACAGAAGTGGGACCCCTTTCAGCCTAAATTCACAATCCAAAATGCAAACAAAGAAGATATTTTGAAAATTGTTGGTCCCTGTGTAACATGTGGCTGTTTTGGCGATGTGGATTTTAAGGTGAAAACCATTAATGAAAAGCTCACAGTTGGGAAGATTTCAAAGTACTGGTCTGGATTTGTAAATAATGTTTTCACAAATGCTGACAACTTTGGAATCCATATTCCTGCAGATCTCGATGTGACAATTAAAGCAGCGATGATTGGTGCTTGTTTTCTTTTTGATTTTATATTCTTTGAACATTCACTAGCTGGATTATAA

XM_004834406.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 1185 bp    Location: 24435088..24416659   Strand: -
>XM_004834406.1
ATGCCAGATACCCTGCCACGAGGAAATTTCAGACCGAGGACACCCAGCATGCTGCCTTTCTGTAAGAATGCAAAGTTGGGTCTCCTTTCTTTCCTGATCTGTGCTGGAAGGAGCNNTATTACTTTGGGGAAAGAACTGAAACTAAATAAAATCCTCTGGGAAAAGGCTCAAAATCAGAAAATGAGATACAAGACCTCATTGGTGATGAGGAAACGATTGAGGCTTTACCGAAACACCCTGAAAGAGTCGAGTAGCATCTCCGGACACCATGGCCCCCAGCTCTCCGCCGCTTCCAGCCCTTCGGTGTACCCAGGCCTTCATGAGCAGCCTCACCAGGCCTCCCACAGCCGTCCTCTGAACGGACTGCTGCGTCTGGGGCTCCCTGGAGACATGTACGCCAGGCCTGAGCCCTTTGCGCCAGGGCCCACGGCCCACAGCGACGCCTTGGGAGCTGCCGCAGCCCTGCACGGCTACGGCGGCATGAACCTGACCGTGAACCTCGCCGCGCCCCACGGCCCTGGCGCCTTCTTCCGATACATGCGCCAGCCCATCAAACAGGAGCTCATCTGCAAGTGGCTGGCGGCCGATGGCCCTGTGCCCCCACGCCTCTGCTCCAAAACTTTCAGCACCATGCACGAGCTTGTCACGCACGTCACCGTGGAGCACGTCGGCGGCCCGGAGCAGGCCAACCACATTTGCTTCTGGGAGGAGTGTCTGCGACAGGGCAAGCCCTTCAAAGCCAAATACAAACTTGTAAATCACATCCGCGTGCACACGGGCGAGAAGCCCTTCCCTTGTCCTTTCCCGGGGTGTGGGAAGGTGTTTGCTAGATCAGAAAATCTCAAAATACACAAACGAACTCACACAGGCGAGAAGCCCTTCAGGTGTGAATTCGAGGGCTGTGAGCGGCGCTTCGCCAACAGCAGCGACCGCAAGAAGCATTCGCACGTGCACACGAGCGACAAGCCATACACGTGCAAGGTGCGCGGCTGCGACAAGTGCTACACGCACCCCAGCTCTCTGCGTAAGCACATGAAGGTGCATGGTCGCTCCCCGCCGCCCGGCTCTGGCTACGACTCAGCTACCCCGTCTGCCCTCTTGTCGCCCTCGTCGGACTGCGGCCATGAGCCCCTGGTGGCCTCCTCAGGGGCGGTGGTGGTGCGTGGCACGGACCTGAGCGAATGA

XM_004834405.1 Coding sequence

Zic1 Zic family member 1

Length: 1344 bp    Location: 24440715..24444321   Strand: +
>XM_004834405.1
ATGCTCCTGGACGCCGGCCCCCAGTACCCTGCGATCGGTGTGACCACCTTTGGAGCGTCCCGCCACCACTCGGCGGGCGACGTGTCCGAGCGAGACGTGGGCCTGGGCATCAACCCGTTCGCCGACGGCATGGGCGCCTTCAAGCTGAACCCCAGTTCGCACGAGCTGGCCTCGGCCGGACAGACGGCCTTCACGTCGCAGGCGCCAGGCTACGCGGCCGCTGCGGCCCTGAGCCATCACCATCACCCGGGCCACGTCGGCTCCTATTCCAGCGCAGCTTTCAATTCTACGCGGGACTTTCTGTTCCGCAACCGGGGCTTCGGCGACGCGGCCGCGGCGGCCAGTGCACAGCACAGCCTCTTCGCTGCTTCAGCTGGCGGCTTCGGGGGCCCACACGGCCATACGGACGCGGCGGGCCACCTCCTTTTCCCCGGGCTTCACGAGCAGGCGGCGGGCCACGCTTCACCCAACGTGGTCAACGGGCAGATGAGGCTCGGCTTCTCAGGGGACATGTACCCGCGGCCAGAGCAGTATGGCCAGGTGACCAGCCCGCGCTCCGAGCACTACGCCGCGCCGCAGCTGCACGGCTACGGGCCCATGAACGTGAACATGGCCGCGCACCACGGCGCCGGCGCTTTCTTCCGCTACATGCGCCAACCCATCAAGCAAGAGCTCATCTGTAAGTGGATCGAGCCTGAGCAGCTGGCCAACCCCAAAAAGTCGTGCAACAAAACTTTCAGCACCATGCATGAGCTGGTCACGCACGTCACTGTGGAGCACGTCGGCGGCCCGGAGCAGAGTAACCACATCTGCTTCTGGGAGGAGTGTCCGCGCGAGGGCAAGCCCTTCAAAGCCAAATACAAACTGGTCAACCACATCCGTGTGCACACGGGCGAGAAGCCTTTCCCCTGTCCCTTTCCTGGCTGCGGCAAGGTCTTCGCGCGCTCGGAGAACCTAAAGATCCACAAAAGGACGCACACAGGGGAGAAGCCCTTCAAGTGCGAGTTCGAGGGCTGCGACCGGCGCTTTGCTAACAGCAGCGACCGCAAGAAGCACATGCACGTGCACACGAGTGACAAGCCCTATCTCTGCAAGATGTGCGACAAGTCCTACACGCACCCCAGCTCCCTGCGTAAACACATGAAGGTCCACGAATCCTCCTCGCAGGGCTCGCAGCCTTCGCCCGCCGCCAGCTCGGGCTACGAGTCCTCCACGCCGCCCACCATCGTGTCTCCCTCCACAGACAACCCGGCCGCCAGCTCCCTGTCGCCCTCCTCCTCCGCGGTGCACCACACAGCCGGCCACAGCGCGCTCTCTTCCAATTTTAACGAATGGTACGTTTAA

XM_004834407.1 Coding sequence

LOC101713142 PTB domain-containing engulfment adapter protein 1-like, transcript variant X1

Length: 915 bp    Location: 24975474..24976452   Strand: +
>XM_004834407.1
ATGAACCGTGCATTTAGCAGGAAGAAAGACAAAACATGGGTGCATACGCCTGAAGCTTTATTAAAACATTACATTCCCTATAACACCAAGTTTCTTTGCAGTACAGAAGTGGAGCAGGCAAAGGGGACGGAAGTTGTGCGAGATGCGGTGCGGAAGCTAAAGTTTGCAAGACACATCAAGAAACCTGAAGGCCAGAAAATTCCTAAAGTTGAATTGCAAATATCAATTTATGGAGTAAAAATCCTAGAACCTAAAACAAAGGAAGTCCAGCACAATTGCCAGTTTCATAGAATATCATTTTGTGCAGATGATAAAACCGACAAGAGGATATTCAGTTTCATATGCAAAGATTCCGAGTCAAACAAACATTTGTACTATGTATTTAACAGTGAAAAGTGTGCTGAAGAGATAACTTTAACCATTGGCCAAGCATTTGACCTGGCATACAGGAAATTTCTAGAATCTGGAGAAAAAGATGTTGAAACAAGAAAGCAGATTGCAGGGCTACAAAAAAGAATCCAAAACCTAGAAACAGAAAATATGGAACTTAAAAATAAAGTAGAAGGTTTGGAAAACCAGTTAAGAATTATTCAAGTATCAACATCTCCAGCAGGCAATGTGGCATCCAAGTCACCCTCCAAGGACATCTTTGATATGATTCTATTTTCTCCAGTTGCAGACCAGTCTTCAGTAGCTACTCGCAACGGCACACAGCCACCCCCAGTACCTAGTAGATCTACAGAAATGAAACGGGACCTGTTTGGAGCGGAACCTTTTGACCCATTTAGCTGTGGAGCAGGGGATTTCCCTCCAGATATTCAATCAAAATTAGATGAAATGCAGGAGGGGTTCAAAATGAGACTAACTCTTGAAGGCACAGTATTTTGTCTCGACCCATTAGACAGCAGATGCTGA

XM_004834411.1 Coding sequence

Agtr1 angiotensin II receptor, type 1, transcript variant X3

Length: 1080 bp    Location: 25964811..26006463   Strand: +
>XM_004834411.1
ATGATCCTCAACTCTTCTACCGAAGATGGTATTAAAAGAATCCAAGATGACTGCCCCAAAGCTGGAAGGCACAGTTACATATTTGTCATGATCCCCACGTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGGTGATTGTCATTTACTTTTACATGAAACTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGATATATGCTTTCTGCTAACTTTGCCACTGTGGGCTGTCTACACTGCTATGGAATACCGCTGGCCCTTCGGCAATTACCTGTGTAAAATCGCTTCGGCTAGCGTCAGTTTCAACCTGTATGCCAGTGTGTTTCTCCTCACCTGTCTCAGCATCGATCGCTACCTGGCTATTGTTCACCCGATGAAGTCACGTCTTCGACGCACAATGCTTGTTGCCAAAGTTACTTGCATCATAATTTGGCTGTTGGCTGGCTTGGCCAGTTTGCCAGTTATTATTCACAGAAATGTATTTTTCATCGAGAACACCAACATCACAGTTTGTGCTTTCCATTATGAATCCCAAAATTCAACCCTCCCCATAGGCCTAGGCCTGACCAAAAATATACTGGGTTTCATGTTTCCTTTTCTGATCATCCTTACAAGTTATACTCTGATTTGGAAGGCCCTAAAGAAGGCTTATGAAATTCAGAAGAACAAGCCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTTCTGTTCTTTTTCTTTTCCTGGGTTCCCCACCAAATATTCACCTTTTTGGATGTATTGATCCAGCTGGGCATTATACATGACTGCAAAATTTCAGATATTGTGGACACCGCCATGCCCATTACCATTTGCATAGCTTATTTTAACAATTGCCTTAACCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAAATATTTTCTCCAGCTTCTGAAATACATTCCCCCAAAGGCCAAATCCCACTCAAACCTATCAACAAAAATGAGCACACTTTCTTACCGCCCCTCAGATAATGTAAGCTCATCTGCCAAGAAGCCAATGCAGTGTTTTGAGGTGGAGTGA

XM_004834412.1 Coding sequence

Agtr1 angiotensin II receptor, type 1, transcript variant X4

Length: 1080 bp    Location: 25964811..26006463   Strand: +
>XM_004834412.1
ATGATCCTCAACTCTTCTACCGAAGATGGTATTAAAAGAATCCAAGATGACTGCCCCAAAGCTGGAAGGCACAGTTACATATTTGTCATGATCCCCACGTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGGTGATTGTCATTTACTTTTACATGAAACTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGATATATGCTTTCTGCTAACTTTGCCACTGTGGGCTGTCTACACTGCTATGGAATACCGCTGGCCCTTCGGCAATTACCTGTGTAAAATCGCTTCGGCTAGCGTCAGTTTCAACCTGTATGCCAGTGTGTTTCTCCTCACCTGTCTCAGCATCGATCGCTACCTGGCTATTGTTCACCCGATGAAGTCACGTCTTCGACGCACAATGCTTGTTGCCAAAGTTACTTGCATCATAATTTGGCTGTTGGCTGGCTTGGCCAGTTTGCCAGTTATTATTCACAGAAATGTATTTTTCATCGAGAACACCAACATCACAGTTTGTGCTTTCCATTATGAATCCCAAAATTCAACCCTCCCCATAGGCCTAGGCCTGACCAAAAATATACTGGGTTTCATGTTTCCTTTTCTGATCATCCTTACAAGTTATACTCTGATTTGGAAGGCCCTAAAGAAGGCTTATGAAATTCAGAAGAACAAGCCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTTCTGTTCTTTTTCTTTTCCTGGGTTCCCCACCAAATATTCACCTTTTTGGATGTATTGATCCAGCTGGGCATTATACATGACTGCAAAATTTCAGATATTGTGGACACCGCCATGCCCATTACCATTTGCATAGCTTATTTTAACAATTGCCTTAACCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAAATATTTTCTCCAGCTTCTGAAATACATTCCCCCAAAGGCCAAATCCCACTCAAACCTATCAACAAAAATGAGCACACTTTCTTACCGCCCCTCAGATAATGTAAGCTCATCTGCCAAGAAGCCAATGCAGTGTTTTGAGGTGGAGTGA

XM_004834413.1 Coding sequence

Agtr1 angiotensin II receptor, type 1, transcript variant X5

Length: 1080 bp    Location: 25964811..26006463   Strand: +
>XM_004834413.1
ATGATCCTCAACTCTTCTACCGAAGATGGTATTAAAAGAATCCAAGATGACTGCCCCAAAGCTGGAAGGCACAGTTACATATTTGTCATGATCCCCACGTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGGTGATTGTCATTTACTTTTACATGAAACTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGATATATGCTTTCTGCTAACTTTGCCACTGTGGGCTGTCTACACTGCTATGGAATACCGCTGGCCCTTCGGCAATTACCTGTGTAAAATCGCTTCGGCTAGCGTCAGTTTCAACCTGTATGCCAGTGTGTTTCTCCTCACCTGTCTCAGCATCGATCGCTACCTGGCTATTGTTCACCCGATGAAGTCACGTCTTCGACGCACAATGCTTGTTGCCAAAGTTACTTGCATCATAATTTGGCTGTTGGCTGGCTTGGCCAGTTTGCCAGTTATTATTCACAGAAATGTATTTTTCATCGAGAACACCAACATCACAGTTTGTGCTTTCCATTATGAATCCCAAAATTCAACCCTCCCCATAGGCCTAGGCCTGACCAAAAATATACTGGGTTTCATGTTTCCTTTTCTGATCATCCTTACAAGTTATACTCTGATTTGGAAGGCCCTAAAGAAGGCTTATGAAATTCAGAAGAACAAGCCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTTCTGTTCTTTTTCTTTTCCTGGGTTCCCCACCAAATATTCACCTTTTTGGATGTATTGATCCAGCTGGGCATTATACATGACTGCAAAATTTCAGATATTGTGGACACCGCCATGCCCATTACCATTTGCATAGCTTATTTTAACAATTGCCTTAACCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAAATATTTTCTCCAGCTTCTGAAATACATTCCCCCAAAGGCCAAATCCCACTCAAACCTATCAACAAAAATGAGCACACTTTCTTACCGCCCCTCAGATAATGTAAGCTCATCTGCCAAGAAGCCAATGCAGTGTTTTGAGGTGGAGTGA

XM_004834414.1 Coding sequence

Agtr1 angiotensin II receptor, type 1, transcript variant X6

Length: 1080 bp    Location: 25968653..26006463   Strand: +
>XM_004834414.1
ATGATCCTCAACTCTTCTACCGAAGATGGTATTAAAAGAATCCAAGATGACTGCCCCAAAGCTGGAAGGCACAGTTACATATTTGTCATGATCCCCACGTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGGTGATTGTCATTTACTTTTACATGAAACTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGATATATGCTTTCTGCTAACTTTGCCACTGTGGGCTGTCTACACTGCTATGGAATACCGCTGGCCCTTCGGCAATTACCTGTGTAAAATCGCTTCGGCTAGCGTCAGTTTCAACCTGTATGCCAGTGTGTTTCTCCTCACCTGTCTCAGCATCGATCGCTACCTGGCTATTGTTCACCCGATGAAGTCACGTCTTCGACGCACAATGCTTGTTGCCAAAGTTACTTGCATCATAATTTGGCTGTTGGCTGGCTTGGCCAGTTTGCCAGTTATTATTCACAGAAATGTATTTTTCATCGAGAACACCAACATCACAGTTTGTGCTTTCCATTATGAATCCCAAAATTCAACCCTCCCCATAGGCCTAGGCCTGACCAAAAATATACTGGGTTTCATGTTTCCTTTTCTGATCATCCTTACAAGTTATACTCTGATTTGGAAGGCCCTAAAGAAGGCTTATGAAATTCAGAAGAACAAGCCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTTCTGTTCTTTTTCTTTTCCTGGGTTCCCCACCAAATATTCACCTTTTTGGATGTATTGATCCAGCTGGGCATTATACATGACTGCAAAATTTCAGATATTGTGGACACCGCCATGCCCATTACCATTTGCATAGCTTATTTTAACAATTGCCTTAACCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAAATATTTTCTCCAGCTTCTGAAATACATTCCCCCAAAGGCCAAATCCCACTCAAACCTATCAACAAAAATGAGCACACTTTCTTACCGCCCCTCAGATAATGTAAGCTCATCTGCCAAGAAGCCAATGCAGTGTTTTGAGGTGGAGTGA

XM_004834409.1 Coding sequence

Agtr1 angiotensin II receptor, type 1, transcript variant X1

Length: 1131 bp    Location: 25982005..26006463   Strand: +
>XM_004834409.1
ATGGGATCATTTGGTGTAGTGCCTGAGATTAATTCGACTCAGGAGATCAAAATGATCCTCAACTCTTCTACCGAAGATGGTATTAAAAGAATCCAAGATGACTGCCCCAAAGCTGGAAGGCACAGTTACATATTTGTCATGATCCCCACGTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGGTGATTGTCATTTACTTTTACATGAAACTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGATATATGCTTTCTGCTAACTTTGCCACTGTGGGCTGTCTACACTGCTATGGAATACCGCTGGCCCTTCGGCAATTACCTGTGTAAAATCGCTTCGGCTAGCGTCAGTTTCAACCTGTATGCCAGTGTGTTTCTCCTCACCTGTCTCAGCATCGATCGCTACCTGGCTATTGTTCACCCGATGAAGTCACGTCTTCGACGCACAATGCTTGTTGCCAAAGTTACTTGCATCATAATTTGGCTGTTGGCTGGCTTGGCCAGTTTGCCAGTTATTATTCACAGAAATGTATTTTTCATCGAGAACACCAACATCACAGTTTGTGCTTTCCATTATGAATCCCAAAATTCAACCCTCCCCATAGGCCTAGGCCTGACCAAAAATATACTGGGTTTCATGTTTCCTTTTCTGATCATCCTTACAAGTTATACTCTGATTTGGAAGGCCCTAAAGAAGGCTTATGAAATTCAGAAGAACAAGCCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTTCTGTTCTTTTTCTTTTCCTGGGTTCCCCACCAAATATTCACCTTTTTGGATGTATTGATCCAGCTGGGCATTATACATGACTGCAAAATTTCAGATATTGTGGACACCGCCATGCCCATTACCATTTGCATAGCTTATTTTAACAATTGCCTTAACCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAAATATTTTCTCCAGCTTCTGAAATACATTCCCCCAAAGGCCAAATCCCACTCAAACCTATCAACAAAAATGAGCACACTTTCTTACCGCCCCTCAGATAATGTAAGCTCATCTGCCAAGAAGCCAATGCAGTGTTTTGAGGTGGAGTGA

XM_004834417.1 Coding sequence

Gyg1 glycogenin 1, transcript variant X1

Length: 1053 bp    Location: 26218789..26254096   Strand: +
>XM_004834417.1
ATGGCAGATCAGGCCTTTGTGACACTGACCACAAATGATGCCTACGCCAAAGGTGCCCTGGTCCTAGGCTCGTCTCTGAAACAGCACAGGACCACCAGGAGGCTGGTTGTGCTTGCCACCCCACAGGTCTCAGACTCTATGAGAAAAGTTTTAGAGAAAGTCTTTGATGAAGTTATCATGGTAGATGTCTTGGATAGTGGCGATTCTGCTCATCTCACCTTAATGAAGAGGCCTGAGTTGGGTGTCACGCTGACAAAACTTCACTGCTGGTCACTTACACAGTATTCAAAGTGTGTGTTCATGGATGCAGATACTCTGGTCCTAGTAAATATTGATGATCTTTTTGAGAGAGAAGAATTGTCAGCAGCACCAGACCCAGGGTGGCCTGACTGCTTCAACTCCGGAGTCTTTGTCTATCAGCCCTCAGTTGAAACGTATAGCCGGCTGTTGCATCTTGCTTCTGAGCAAGGTAGCTTTGATGGTGGGGACCAGGGCTTACTGAACACATTTTTTAGCAGCTGGGCAACAACAGATATCAGAAAACACCTGCCATTTATTTATAACCTAAGTAGCATTTCTATATACTCCTATCTCCCAGCATTTAAAATGTTTGGAGCAAATGCCAAAGTTGTGCACTTCCTAGGACAAGTCAAACCATGGAATTATACTTATGATCCCCAAACAAAAAGTGTTAAAAGTGAGTCCCATGATCCCACCATGACTCATCCAGAGTTTCTTAATCTGTGGTGGGACATCTTCACTACCAATGTCTTACCTCTGCTTCAACATTATGGACTTGTCAAAGACACCTGCTCATACAGAGATGTGCTTTCAGACTTGGTCTATACACTGGCTTTCTCTTGTGGCTTCTGTAGAAAGGAACATGCCTCAGGAGCCATATCACACCTGTCCCTTGGGGAGAACCCAGCTGCACCACAGCCTTCTGTATCATCAGAAGACAGGAAGGAGCGGTGGGAACAGGGCCAGGCTGATTACATGGGAGCAGACTCCTTTGACAACATCAAGCAAAAACTTGACACTTACCTCCAGTAG

XM_004834429.1 Coding sequence

Hltf helicase-like transcription factor, transcript variant X3

High confidence: 4 potential gene matches
Length: 3012 bp    Location: 26334151..26255426   Strand: -
>XM_004834429.1
ATGTCCTGGATGTTCAAGAGGGATCCCGTTTGGAAGTACTTACAGACTGTCCAATATGGAATCCATGGAAATTTCCCACGCCTTCCATATCCAACTTTCTTTCCACGTTTTGAATTCCAAGATATTATTCCTCCAGATGACTTCCTAACTAGTGATGAAGAGCTAGATTCAGTTTTGTTTGGAATTTTGCGAGGTCATGTGGTTGGACTACGCTATTACACAGGAGTAGTTAATAATAATGAAATGGTTGCATTACAGCGAGAGCCTAATAATACTTATGATAAGAATGCGATTAAAGTAAATAATGTGAATGGAAATCAGGTTGGCTATTTAAAGAAAGATCTTGCAGCTGCTTTGGCCTATATTATGGACAACAAATTGGCACAAGTGGAAGGGGTAGTTCCTTTTGGTGCAAATAATACTTTTACCATGCCTCTGCATATGACTTTTTGGGGAAAAGAAGAAAATAAAAAAGCAGTTTTAGATCAGTTGAAGAAACATGGATTTAAATTGGGTCCTGCACCAAAAACTTTAGGATTCAGTTTTGAAAGTGGTTGGGGCTCTGGAAGAGCTGGACCAAGTTATAGTATGCCAATTCATGCTGCAGTACAGATGACAACTGAGCAGCTTAAAACAGAATTTGACAGATTGTTTGAAGATTTAAAAGAAGATGATAAAACTCAGGAAATGGAACCAGCTGAGGCTATTGAAACGCCATTGCTTTCACATCAAAAACAAGCTTTAGCTTGGATGATTTCACGAGAAAACAGTAAAGAACTTCCACTGTTTTGGGAACAGCGAAATGACTTATACTATAACACAATAACAAATTTTTCTGAGAAGGAGCGACCAGAAAATGTCCATGGAGGAATTTTAGCTGATGATATGGGCTTGGGTAAAACTCTTACAGCTATTGCAGTAATTCTTACCAACTTCCATGATGGCAAACCCCTTCCTGTTGAAAGAATTAAGAAGAATCAACTGAAGAAGGAATATAGTGTTAGCCATGAGTCTATGAAGCTTGGAGGAAACAGTACCAGTGAAAAGGCAGATGGACTAAGCAAAGAAGGATCTAGATGTAATGAAGAACCCAGTATTTCACATATTAAGAAGAATAAGTATTCCATATCAGAATTCTTTAGCTCCCATCCCAAAAGAAGAAAAATTACTGCCCAGCACATTGAAAGCAGTGATTCAGAGGAAATTGAGACAAATGAATTGCCACACAAAATAAAAGGAAAACTGAAAAATGTGCAGTCAGAGAATAAAAGGCTAAAAGCAGGATCATCTAAGAAAGAAGATGCAACATTTTCACTTACCTCACCTCCGATGGCGAAAAAGAAAATGTTAAAAAAGGGAACATCTACAGTAGACAGTTCAAAGAAAAGTAATGTTGAAGAGAGACCAAGAACAACACTGATCATTTGTCCACTTTCTGTGTTAAGCAACTGGATTGACCAGTTCGGACAACATATAAAATCAGAAGTGCATTTGAATTTTTATGTTTATTATGGTCCTGATCGTATTAGAGACCCAGCCTTGCTTTCAAAACAAGATATTGTTTTGACCACATACAATATTTTAACTCATGACTATGGAACTAAAGGTGATAGTCCACTGCATAGCATAAGGTGGCTAAGAGTGATCCTGGATGAAGGGCATGCCATACGAAATCCAAATGCCCAGCAGACAAAAGCTGTTCTTGATTTAGAAGCAGAAAGAAGATGGGTATTGACAGGTACTCCTATCCAGAATTCTTTAAAGGATTTGTGGTCTCTTCTTTCCTTTTTAAAACTTAAACCATTTCTTGATAGAGAATGGTGGCATAGAACAATACAGCGTCCCGTTACAATGGGAGATGAAGCAGGACTTAGGCGCTTACAGTCCCTAATTAAAAATATCACACTTAGACGAACAAAGACAAGTAAAATTAAAGGAAAACCTGTTTTGGAGTTACCAGAACGTAAAGTATTCATTCAGCACATTACACTTTCAGATGAAGAGAGAAAGATTTATCAGTCTGTGAAAAATGAAGGCAAAGCTACTATTGGAAGGTATTTTAATGAAGGAACTGTCCTTGCACACTATGCAGATGTCCTGGGTCTTTTGCTTAGATTGCGGCAGATTTGTTGTCATACTCACCTTCTTACAAATGCAGTGTCATCCAGTGGTCCTTCAGGAAATGATACACCTGAAGAACTGAGAAAGATGTTAATAAAGAAGATGAAATTAATTCTGAGCTCTGGTTCAGATGAAGAATGTGCAATTTGCCTGGATTCTTTAACAGTTCCTGTGATAACACATTGTGCACATGTATTTTGTAAACCTTGTATTTGCCAAGTCATTCAGAATGAGCAGCCACATGCTAAATGCCCTTTATGCAGAAATGATATTCATGGAGACAATTTACTAGAATGTCCTCCAGAAGAAATGACATGTGACAATGAAAAAAAGTCTAATATGGAATGGACATCCAGTTCAAAGATTAATGCTCTTATGCATGCTTTGATTGACTTAAGAAAGAAGAATCCCAACATAAAGAGTTTAGTGGTTTCTCAATTTACAGCATTCCTATCTTTAATAGAAACACCACTTAAAGCCTCTGGATTTGTGTTTACTCGTTTGGATGGTTCTATGGCCCAAAAAAAGAGAGTTGAATCAATTCAGTGTTTTCAAAACACTGAAACAGGATCTCCAACTATAATGCTCCTGTCCTTAAAAGCAGGTGGAGTTGGTTTGAATCTTTGTGCAGCTTCTCGAGTGTTTTTAATGGATCCAGCCTGGAATCCTGCTGCTGAAGATCAGTGCTTTGACAGATGCCATCGACTTGGCCAGAAGCAAGAAGTTATTATCACAAAATTCATTGTGAAGGATTCTGTTGAAGAAAATATGCTGAAAATACAAAATACGAAAAGAGAACTTGCAGCTGGAGCTTTTGGAACTAAAAAGACAAACGCTAATGAAATGAAACAAGCTAAAATTAATGAAATCAAAACTTTAATTGATTTATAA

XM_004834422.1 Coding sequence

Hps3 Hermansky-Pudlak syndrome 3, transcript variant X2

High confidence: 4 potential gene matches
Length: 3012 bp    Location: 26426518..26469777   Strand: +
>XM_004834422.1
ATGGTGCATCTGTACAACCTGCACCCGTTTGGGTCGCAGCAGGTGGTTCCCTGCAAGCTGGAGCCAGAGCAGTTCTGCGGCGGGGGGTGCGACGCGCTGTTCGTGGCGGCCGGCTGCAAGGTGGAGGCGTTCGCCGTGACAGGCCAGGAGCTGTGCCAGCCGAGGTGCGCCTTCTCTACGCTGGGCAGGGTGCTGCGCATGGCCTACAGCGAGGCCGGGGACTATTTGGTAGCAATTGAAGAGAAAAACAAGGCTATGTTTCTACGTGCTTATGTGAACTGGAGAAGTAAAAGGGCGGAGAACTCTCGAGTGTGTATCCGAATGATTGGACATAATGTGGAGGCGCCCTTCCGGGAATCCTTCAAAGACCAGATGTCCATTGTTGAAATGCCGCTCTCTGAGGCCCCCTTGTGCATTTCCTGTTGCCCTGTGAAAGGAGACCTCCTTGTTGGCTGCACAAATAAATTAGTCTTATTTAGTTTGACGTACCAGGTCATTAATGAGGAATTCTCAATGTTGGACTTTGAACGTAGTTTAATTATCCATGTGGATAATATCACTCCTGTCGAAATTTCTTTTTGTGTTGGATATGTTGCTGTCATGTCAGATTTGGAAGTCTTAATCTTAAAACTGGAATCGGACTCTAAAAACAGAGAGAGAGTTAACCACCAGCCATATAAGACCAGCAATCCAGTAAAACAGACAAATGAAGATTTCAGTAATGAAACTTCACAGATTGAGTCAGATGATTTTGTTATCTGCCAGAAGCCCATGGAGCTTCTTGGTGAAAAAAGTGAACAATGTGGGATATCTGTTACACTGGAATCTACAGGATTAGCTGATGAAAAAATAAAATACTTCCACATCCGGCATCTGCTCTATAGACGTTTTACTCCTGATATTTCCTTCTATGTCTCATCTGATGACATCAGGTTCCATTCCCTTCAGCTGCTACCCATTTACCAGACAGGTTCTCTTACTTCTGATGAAAAAAATTCTCCTCAGGGAAAAGAGTTGCTGAGTCTTTTTTGTTTTTTCTCATTACCTCACATGGGCTACCTCTACATGGTTGTCAAATCTGTTGAATTAATCTCTGTCTACCAATACCCTGAGAAGTCTCAGCAGGCGGTGCTCACACCACAGTTTTTGCACGTCATCACCAGAAACAACCTGCAGTGTTTCACAGTGCGATGTAGCGCAGCAGCAGCTCGTGAGGAGGACCCCTACATGGACACCACCCTGAAGGCTTGCCCACCTGTCAGTATGGATGTCTGTGCTTTAAGAATACAGCTTTTTATAGGCTTGAAAGCCATCTGTCATTTTAAAAATCATGTAGTACTTTTAACCAAGGCAGACCCTGAAGCCATTCCAGACAGAAGAGAATCGCCCAGGAGATTTCTTTCTAGAAAAGATACCAGTGTTAAGATCAAACCTCCTGTAGCTGAGGCTGGGTGGAGTTTGTATATTGTGAATACGATCTCACCAGTGCAACTATACAAAGAAATGGTAGACTATAGTAATACCTACAAGACTGTAAAAACCCAGAGCTGCATCCACCTTCTCAGTGAGGCCCATCTGTTAGTAAGAGCTGCCCTGATGGATACCTGTCAGCTGCAACCTGGAGAGAAAGCAGAGCTTTTGGAAGCCTTTAAAGAAAGCTGTGGGCACCTTGGAGACTGTTACAGCAGGCTTGACACCCAGCATTCCCACCTCGCCTTGCCATACTATAAGATGTCTGGTTTGTCTCTGGCTGAAGTTTTGACCCGTGTGGATTGGGCAGCAGAGTATGAATCACAGAAATATGAGAGGGGATTGATCTTTTATATTAATCATTCACTTTGTGAAAACCTGGATGAAGAATTAAGTGAAGAATTAGCAGCAAAAGTGGTTCAGATGTTTCACGTAGCTGAGCCGAAACAATTGCCCCATATTCTCTGTAGTCCTTCTGTGAAGAACGTGAATCCCTTAACTGCCTTGAGCTGTCTAAGGAAACTGGATACCCGTGGACTCTCCTCAGTCTTAGTGACACTGACAAAAGCAGCACTGGCTCTAAAGATGGGAGATCTTGACATGCATAGAAGTGAAATGAAAAGTCATTCAGAGATGAAGTTGGTATGTGGCTTCATTCTGGAACCTCGGCTACTGATTCAACAGAGGAAGAGACAGATTGTTCCAACGGAGCTTGCAGTTCACTTGAAGGAGACTCAGCCTGGATTGCTTGTGGCTGCAGTCCTGGGTTTACAGAAGAATAACAAAATTGGAATTGAAGAGGCGGATTCTTTCTTTAAGGTGCTCTGTGGTAAGGATGAAGATACGATTCCTCAGCTCTTGGTAGACTTTTGGGAAGCGCAGCTGGTGGCCTGTCTCCCAGATGTGGTACTTCAGGAGCTCTGTTACAAGCTCATATCACAGTACACCTGGAGATTATCTAAGAGACAACTTCCTGATACCACACCCTTGAGAACATCAGAGGATCTGATAAATGCCTGTAGTCATTATGGCTTAATCTATCCCTGGGTTCATGTTTTAATATCATCTGATTCCTTAGCCAATAAAAATTATACAGAAGACCTTTCAAAATTACAGTCTCTTATATGTGGTCCTTCATTTGACATAGCTTCCATTGTTCCCTTCTTGGAGCCACTCTCAGAAGACACTGTTGCTGGCCTCAGTGTCCATGTTCTGTGTCGTACCCGTCTCAAAGAATACGAACAGTGCATAGACACACTGTTAGAGAGATGTCCAGAGGCGGTCATTCCATATGCTAATCATGAGCTGAAAGAAGAGAACCGGACTCTATGGTGGAAAAAACTTCTACCTGAACTTTGTCAGAGAATAAAGTGTGGTGGAGAGAAGTATCAGTTTTACCTGTCATCATTAAAAGAAACATTGTCAGTTGTTGCCGTGGACCTAGAATTAAGGGATTTCTTAAATGTTCTCCCAGAAGATGGCACTGCAGCGTTTTTCTTGCCTTATCTTCTTTATTGTAGCCAAAAGAAATCATTGACATAA

XM_004834426.1 Coding sequence

Hps3 Hermansky-Pudlak syndrome 3, transcript variant X6

Length: 2622 bp    Location: 26426518..26469777   Strand: +
>XM_004834426.1
ATGGTGCATCTGTACAACCTGCACCCGTTTGGGTCGCAGCAGGTGGTTCCCTGCAAGCTGGAGCCAGAGCAGTTCTGCGGCGGGGGGTGCGACGCGCTGTTCGTGGCGGCCGGCTGCAAGGTGGAGGCGTTCGCCGTGACAGGCCAGGAGCTGTGCCAGCCGAGGTGCGCCTTCTCTACGCTGGGCAGGGTGCTGCGCATGGCCTACAGCGAGGCCGATTTGGAAGTCTTAATCTTAAAACTGGAATCGGACTCTAAAAACAGAGAGAGAGTTAACCACCAGCCATATAAGACCAGCAATCCAGTAAAACAGACAAATGAAGATTTCAGTAATGAAACTTCACAGATTGAGTCAGATGATTTTGTTATCTGCCAGAAGCCCATGGAGCTTCTTGGTGAAAAAAGTGAACAATGTGGGATATCTGTTACACTGGAATCTACAGGATTAGCTGATGAAAAAATAAAATACTTCCACATCCGGCATCTGCTCTATAGACGTTTTACTCCTGATATTTCCTTCTATGTCTCATCTGATGACATCAGGTTCCATTCCCTTCAGCTGCTACCCATTTACCAGACAGGTTCTCTTACTTCTGATGAAAAAAATTCTCCTCAGGGAAAAGAGTTGCTGAGTCTTTTTTGTTTTTTCTCATTACCTCACATGGGCTACCTCTACATGGTTGTCAAATCTGTTGAATTAATCTCTGTCTACCAATACCCTGAGAAGTCTCAGCAGGCGGTGCTCACACCACAGTTTTTGCACGTCATCACCAGAAACAACCTGCAGTGTTTCACAGTGCGATGTAGCGCAGCAGCAGCTCGTGAGGAGGACCCCTACATGGACACCACCCTGAAGGCTTGCCCACCTGTCAGTATGGATGTCTGTGCTTTAAGAATACAGCTTTTTATAGGCTTGAAAGCCATCTGTCATTTTAAAAATCATGTAGTACTTTTAACCAAGGCAGACCCTGAAGCCATTCCAGACAGAAGAGAATCGCCCAGGAGATTTCTTTCTAGAAAAGATACCAGTGTTAAGATCAAACCTCCTGTAGCTGAGGCTGGGTGGAGTTTGTATATTGTGAATACGATCTCACCAGTGCAACTATACAAAGAAATGGTAGACTATAGTAATACCTACAAGACTGTAAAAACCCAGAGCTGCATCCACCTTCTCAGTGAGGCCCATCTGTTAGTAAGAGCTGCCCTGATGGATACCTGTCAGCTGCAACCTGGAGAGAAAGCAGAGCTTTTGGAAGCCTTTAAAGAAAGCTGTGGGCACCTTGGAGACTGTTACAGCAGGCTTGACACCCAGCATTCCCACCTCGCCTTGCCATACTATAAGATGTCTGGTTTGTCTCTGGCTGAAGTTTTGACCCGTGTGGATTGGGCAGCAGAGTATGAATCACAGAAATATGAGAGGGGATTGATCTTTTATATTAATCATTCACTTTGTGAAAACCTGGATGAAGAATTAAGTGAAGAATTAGCAGCAAAAGTGGTTCAGATGTTTCACGTAGCTGAGCCGAAACAATTGCCCCATATTCTCTGTAGTCCTTCTGTGAAGAACGTGAATCCCTTAACTGCCTTGAGCTGTCTAAGGAAACTGGATACCCGTGGACTCTCCTCAGTCTTAGTGACACTGACAAAAGCAGCACTGGCTCTAAAGATGGGAGATCTTGACATGCATAGAAGTGAAATGAAAAGTCATTCAGAGATGAAGTTGGTATGTGGCTTCATTCTGGAACCTCGGCTACTGATTCAACAGAGGAAGAGACAGATTGTTCCAACGGAGCTTGCAGTTCACTTGAAGGAGACTCAGCCTGGATTGCTTGTGGCTGCAGTCCTGGGTTTACAGAAGAATAACAAAATTGGAATTGAAGAGGCGGATTCTTTCTTTAAGGTGCTCTGTGGTAAGGATGAAGATACGATTCCTCAGCTCTTGGTAGACTTTTGGGAAGCGCAGCTGGTGGCCTGTCTCCCAGATGTGGTACTTCAGGAGCTCTGTTACAAGCTCATATCACAGTACACCTGGAGATTATCTAAGAGACAACTTCCTGATACCACACCCTTGAGAACATCAGAGGATCTGATAAATGCCTGTAGTCATTATGGCTTAATCTATCCCTGGGTTCATGTTTTAATATCATCTGATTCCTTAGCCAATAAAAATTATACAGAAGACCTTTCAAAATTACAGTCTCTTATATGTGGTCCTTCATTTGACATAGCTTCCATTGTTCCCTTCTTGGAGCCACTCTCAGAAGACACTGTTGCTGGCCTCAGTGTCCATGTTCTGTGTCGTACCCGTCTCAAAGAATACGAACAGTGCATAGACACACTGTTAGAGAGATGTCCAGAGGCGGTCATTCCATATGCTAATCATGAGCTGAAAGAAGAGAACCGGACTCTATGGTGGAAAAAACTTCTACCTGAACTTTGTCAGAGAATAAAGTGTGGTGGAGAGAAGTATCAGTTTTACCTGTCATCATTAAAAGAAACATTGTCAGTTGTTGCCGTGGACCTAGAATTAAGGGATTTCTTAAATGTTCTCCCAGAAGATGGCACTGCAGCGTTTTTCTTGCCTTATCTTCTTTATTGTAGCCAAAAGAAATCATTGACATAA

XM_004834423.1 Coding sequence

Hps3 Hermansky-Pudlak syndrome 3, transcript variant X3

Length: 2928 bp    Location: 26426518..26469775   Strand: +
>XM_004834423.1
ATGGTGCATCTGTACAACCTGCACCCGTTTGGGTCGCAGCAGGTGGTTCCCTGCAAGCTGGAGCCAGAGCAGTTCTGCGGCGGGGGGTGCGACGCGCTGTTCGTGGCGGCCGGCTGCAAGGTGGAGGCGTTCGCCGTGACAGGCCAGGAGCTGTGCCAGCCGAGGTGCGCCTTCTCTACGCTGGGCAGGGTGCTGCGCATGGCCTACAGCGAGGCCGGGGACTATTTGGTAGCAATTGAAGAGAAAAACAAGGCTATGTTTCTACGTGCTTATGTGAACTGGAGAAGTAAAAGGGCGGAGAACTCTCGAGTGTGTATCCGAATGATTGGACATAATGTGGAGGCGCCCTTCCGGGAATCCTTCAAAGACCAGATGTCCATTGTTGAAATGCCGCTCTCTGAGGCCCCCTTGTGCATTTCCTGTTGCCCTGTGAAAGGAGACCTCCTTGTTGGCTGCACAAATAAATTAGTCTTATTTAGTTTGACGTACCAGGTCATTAATGAGGAATTCTCAATGTTGGACTTTGAACGTAGTTTAATTATCCATGTGGATAATATCACTCCTGTCGAAATTTCTTTTTGTGTTGGATATGTTGCTGTCATGTCAGATTTGGAAGTCTTAATCTTAAAACTGGAATCGGACTCTAAAAACAGAGAGAGAGTTAACCACCAGCCATATAAGACCAGCAATCCAGTAAAACAGACAAATGAAGATTTCAGTAATGAAACTTCACAGATTGAGTCAGATGATTTTGTTATCTGCCAGAAGCCCATGGAGCTTCTTGGTGAAAAAAGTGAACAATGTGGGATATCTGTTACACTGGAATCTACAGGATTAGCTGATGAAAAAATAAAATACTTCCACATCCGGCATCTGCTCTATAGACGTTTTACTCCTGATATTTCCTTCTATGTCTCATCTGATGACATCAGGTTCCATTCCCTTCAGCTGCTACCCATTTACCAGACAGGTTCTCTTACTTCTGATGAAAAAAATTCTCCTCAGGGAAAAGAGTTGCTGAGTCTTTTTTGTTTTTTCTCATTACCTCACATGGGCTACCTCTACATGGTTGTCAAATCTGTTGAATTAATCTCTGTCTACCAATACCCTGAGAAGTCTCAGCAGGCGGTGCTCACACCACAGTTTTTGCACGTCATCACCAGAAACAACCTGCAGTGTTTCACAGTGCGATGTAGCGCAGCAGCAGCTCGTGAGGAGGACCCCTACATGGACACCACCCTGAAGGCTTGCCCACCTGTCAGTATGGATGTCTGTGCTTTAAGAATACAGCTTTTTATAGGCTTGAAAGCCATCTGTCATTTTAAAAATCATGTAGTACTTTTAACCAAGGCAGACCCTGAAGCCATTCCAGACAGAAGAGAATCGCCCAGGAGATTTCTTTCTAGAAAAGATACCAGTGTTAAGATCAAACCTCCTGTAGCTGAGGCTGGGTGGAGTTTGTATATTGTGAATACGATCTCACCAGTGCAACTATACAAAGAAATGGTAGACTATAGTAATACCTACAAGACTGTAAAAACCCAGAGCTGCATCCACCTTCTCAGTGAGGCCCATCTGTTAGTAAGAGCTGCCCTGATGGATACCTGTCAGCTGCAACCTGGAGAGAAAGCAGAGCTTTTGGAAGCCTTTAAAGAAAGCTGTGGGCACCTTGGAGACTGTTACAGCAGGCTTGACACCCAGCATTCCCACCTCGCCTTGCCATACTATAAGATGTCTGGTTTGTCTCTGGCTGAAGTTTTGACCCGTGTGGATTGGGCAGCAGAGTATGAATCACAGAAATATGAGAGGGGATTGATCTTTTATATTAATCATTCACTTTGTGAAAACCTGGATGAAGAATTAAGTGAAGAATTAGCAGCAAAAGTGGTTCAGATGTTTCACGTAGCTGAGCCGAAACAATTGCCCCATATTCTCTGTAGTCCTTCTGTGAAGAACGTGAATCCCTTAACTGCCTTGAGCTGTCTAAGGAAACTGGATACCCGTGGACTCTCCTCAGTCTTAGTGACACTGACAAAAGCAGCACTGGCTCTAAAGATGGGAGATCTTGACATGCATAGAAGTGAAATGAAAAGTCATTCAGAGATGAAGTTGGTATGTGGCTTCATTCTGGAACCTCGGCTACTGATTCAACAGAGGAAGAGACAGATTGTTCCAACGGAGCTTGCAGTTCACTTGAAGGAGACTCAGCCTGGATTGCTTGTGGCTGCAGTCCTGGGTTTACAGAAGAATAACAAAATTGGAATTGAAGAGGCGGATTCTTTCTTTAAGGTGCTCTGTGGTAAGGATGAAGATACGATTCCTCAGCTCTTGGTAGACTTTTGGGAAGCGCAGCTGGTGGCCTGTCTCCCAGATGTGGTACTTCAGGAGCTCTGTTACAAGCTCATATCACAGTACACCTGGAGATTATCTAAGAGACAACTTCCTGATACCACACCCTTGAGAACATCAGAGGATCTGATAAATGCCTGTAGTCATTATGGCTTAATCTATCCCTGGGTTCATGTTTTAATATCATCTGATTCCTTAGCCAATAAAAATTATACAGAAGACCTTTCAAAATTACAGTCTCTTATATGTGGTCCTTCATTTGACATAGCTTCCATTGTTCCCTTCTTGGAGCCACTCTCAGAAGACACTGTTGCTGGCCTCAGTGTCCATGTTCTGTGTCGTACCCGTCTCAAAGAATACGAACAGTGCATAGACACACTGTTAGAGAGATGTCCAGAGGCGGTCATTCCATATGCTAATCATGAGCTGAAAGAAGAGAACCGGACTCTATGGTGGAAAAAACTTCTACCTGAACTTTGTCAGAGAATAAAGTGTGGTGGAGAGAAGTATCAGTTTTACCTGTCATCATTAAAAGGCGATTTCAAGATGCTTAACTTACCATGTAGTGGGAACTATTGA

XM_004834432.1 Coding sequence

Tm4sf1 transmembrane 4 L six family member 1, transcript variant X2

Length: 609 bp    Location: 26652893..26644123   Strand: -
>XM_004834432.1
ATGTGCTATGGCAAATGTGCGCGATGCATCGGACATTCTCTTGTGTGGCTCTCTGTCCTCTGCATAGTAGCTAATATTTTGCTTTACTTTCCCAATGGGGAGACAAAGTATGCATCTGAAAACAACCTCAGCCGCTTTGTGTTGTTTTTCGGTGGTATTGCAGGAGGGGGCTTGCTGATGCTCCTGCCAGCATTTGTCTTCATTGGGCTGGAAGAGGAGGACTGCTGTGGCTGCTGTGGCCACGACAGCTGTGGCAAGAGATGCGCAATGCTTTCTTCTATATTGGCTGCTCTCATTGGAATCTCAGGATCTGGCTACTGTGTCACCGTGGCATCTCTGGGCTTAGCAGAAGGACCGTGGTGTCTTGATTCTCTCGGCCAGTGGAACTATACCTTCGCCAGCACTGAAGGACAGTACCTTCTGGATAGCACCACATGGTCCCAGTGCAAGGAACCCAAGCACATCGTAGAGTGGAATGTGACACTGTTTTCTATCCTCTTGGCTCTTGGTGGAATCGAATTCATCTTGTGTCTCATTCAAGTAATAAATGGATTGCTTGGAGGCATCTGTGGCTACTGCTGCTCTCGCCAGCAGCAATATGACTGCTGA

XM_004834424.1 Coding sequence

Hps3 Hermansky-Pudlak syndrome 3, transcript variant X4

Length: 2910 bp    Location: 26428645..26469777   Strand: +
>XM_004834424.1
ATGTCCGATACCTATACATCAAAATCACCTGGGAAGCTTAAAAAAAGTCCCCATGCCTGGGCCACACCCTCAGAGATCCAGCATAGTAGTTTCTCTGGAATCTGCCAACACTGGGGGGACTATTTGGTAGCAATTGAAGAGAAAAACAAGGCTATGTTTCTACGTGCTTATGTGAACTGGAGAAGTAAAAGGGCGGAGAACTCTCGAGTGTGTATCCGAATGATTGGACATAATGTGGAGGCGCCCTTCCGGGAATCCTTCAAAGACCAGATGTCCATTGTTGAAATGCCGCTCTCTGAGGCCCCCTTGTGCATTTCCTGTTGCCCTGTGAAAGGAGACCTCCTTGTTGGCTGCACAAATAAATTAGTCTTATTTAGTTTGACGTACCAGGTCATTAATGAGGAATTCTCAATGTTGGACTTTGAACGTAGTTTAATTATCCATGTGGATAATATCACTCCTGTCGAAATTTCTTTTTGTGTTGGATATGTTGCTGTCATGTCAGATTTGGAAGTCTTAATCTTAAAACTGGAATCGGACTCTAAAAACAGAGAGAGAGTTAACCACCAGCCATATAAGACCAGCAATCCAGTAAAACAGACAAATGAAGATTTCAGTAATGAAACTTCACAGATTGAGTCAGATGATTTTGTTATCTGCCAGAAGCCCATGGAGCTTCTTGGTGAAAAAAGTGAACAATGTGGGATATCTGTTACACTGGAATCTACAGGATTAGCTGATGAAAAAATAAAATACTTCCACATCCGGCATCTGCTCTATAGACGTTTTACTCCTGATATTTCCTTCTATGTCTCATCTGATGACATCAGGTTCCATTCCCTTCAGCTGCTACCCATTTACCAGACAGGTTCTCTTACTTCTGATGAAAAAAATTCTCCTCAGGGAAAAGAGTTGCTGAGTCTTTTTTGTTTTTTCTCATTACCTCACATGGGCTACCTCTACATGGTTGTCAAATCTGTTGAATTAATCTCTGTCTACCAATACCCTGAGAAGTCTCAGCAGGCGGTGCTCACACCACAGTTTTTGCACGTCATCACCAGAAACAACCTGCAGTGTTTCACAGTGCGATGTAGCGCAGCAGCAGCTCGTGAGGAGGACCCCTACATGGACACCACCCTGAAGGCTTGCCCACCTGTCAGTATGGATGTCTGTGCTTTAAGAATACAGCTTTTTATAGGCTTGAAAGCCATCTGTCATTTTAAAAATCATGTAGTACTTTTAACCAAGGCAGACCCTGAAGCCATTCCAGACAGAAGAGAATCGCCCAGGAGATTTCTTTCTAGAAAAGATACCAGTGTTAAGATCAAACCTCCTGTAGCTGAGGCTGGGTGGAGTTTGTATATTGTGAATACGATCTCACCAGTGCAACTATACAAAGAAATGGTAGACTATAGTAATACCTACAAGACTGTAAAAACCCAGAGCTGCATCCACCTTCTCAGTGAGGCCCATCTGTTAGTAAGAGCTGCCCTGATGGATACCTGTCAGCTGCAACCTGGAGAGAAAGCAGAGCTTTTGGAAGCCTTTAAAGAAAGCTGTGGGCACCTTGGAGACTGTTACAGCAGGCTTGACACCCAGCATTCCCACCTCGCCTTGCCATACTATAAGATGTCTGGTTTGTCTCTGGCTGAAGTTTTGACCCGTGTGGATTGGGCAGCAGAGTATGAATCACAGAAATATGAGAGGGGATTGATCTTTTATATTAATCATTCACTTTGTGAAAACCTGGATGAAGAATTAAGTGAAGAATTAGCAGCAAAAGTGGTTCAGATGTTTCACGTAGCTGAGCCGAAACAATTGCCCCATATTCTCTGTAGTCCTTCTGTGAAGAACGTGAATCCCTTAACTGCCTTGAGCTGTCTAAGGAAACTGGATACCCGTGGACTCTCCTCAGTCTTAGTGACACTGACAAAAGCAGCACTGGCTCTAAAGATGGGAGATCTTGACATGCATAGAAGTGAAATGAAAAGTCATTCAGAGATGAAGTTGGTATGTGGCTTCATTCTGGAACCTCGGCTACTGATTCAACAGAGGAAGAGACAGATTGTTCCAACGGAGCTTGCAGTTCACTTGAAGGAGACTCAGCCTGGATTGCTTGTGGCTGCAGTCCTGGGTTTACAGAAGAATAACAAAATTGGAATTGAAGAGGCGGATTCTTTCTTTAAGGTGCTCTGTGGTAAGGATGAAGATACGATTCCTCAGCTCTTGGTAGACTTTTGGGAAGCGCAGCTGGTGGCCTGTCTCCCAGATGTGGTACTTCAGGAGCTCTGTTACAAGCTCATATCACAGTACACCTGGAGATTATCTAAGAGACAACTTCCTGATACCACACCCTTGAGAACATCAGAGGATCTGATAAATGCCTGTAGTCATTATGGCTTAATCTATCCCTGGGTTCATGTTTTAATATCATCTGATTCCTTAGCCAATAAAAATTATACAGAAGACCTTTCAAAATTACAGTCTCTTATATGTGGTCCTTCATTTGACATAGCTTCCATTGTTCCCTTCTTGGAGCCACTCTCAGAAGACACTGTTGCTGGCCTCAGTGTCCATGTTCTGTGTCGTACCCGTCTCAAAGAATACGAACAGTGCATAGACACACTGTTAGAGAGATGTCCAGAGGCGGTCATTCCATATGCTAATCATGAGCTGAAAGAAGAGAACCGGACTCTATGGTGGAAAAAACTTCTACCTGAACTTTGTCAGAGAATAAAGTGTGGTGGAGAGAAGTATCAGTTTTACCTGTCATCATTAAAAGAAACATTGTCAGTTGTTGCCGTGGACCTAGAATTAAGGGATTTCTTAAATGTTCTCCCAGAAGATGGCACTGCAGCGTTTTTCTTGCCTTATCTTCTTTATTGTAGCCAAAAGAAATCATTGACATAA

XM_004834420.1 Coding sequence

Cp ceruloplasmin (ferroxidase), transcript variant X2

High confidence: 4 potential gene matches
Length: 3204 bp    Location: 26510796..26470511   Strand: -
>XM_004834420.1
ATGAAGCTTTCTGTGCTTGGCATTTTTCTGTTTTTATGTAGTACTCCAGCCTGGACAAAAGATAAGCATTATTACATTGGAATTAATGAGACAACTTGGAACTATGCCTCTGACAAGGAGGAAAAGACACTTATTTCAGTTGACAAGGAGCAGTACAATATCTATCTTCAAAATGGCCCAGACAGAATTGGAAGAATATACAAGAAAGCCCTCTATCATCAGTATACAGATGAAACCTTTAGTGAAACTATAGAAAAGCCAGATTGGCTAGGGTTTTTAGGCCCTATTATAAAAGCTGAAACTGGAGATAAGGTTTATATACATTTTAAAAACTTTGCCTCTAGGGCCTACACTTTTCATGCACATGGAATAACCTACTATAAGGAGCATGAGGGGGCCATCTATCCTGATAACACCACCGATTTTCACAAGGCAGATGACAAAGTGCTTCCAGGAGAGCAGTATACATACATATTGGATGCCAATGAAGAACAGAGTCCTGGTGAGGGGGACAGCAATTGTGCGACTCGGATTTACCATTCCCACATTGATGCTCCAAAAGATATTGCTTCAGGACTCATTGGACCCTTAATAATCTGTAAAAAAGATTCTCTGGATAAGGAAAAAGAAAAAAATCTCGACCAAGAATTTGTGGTAATGTTTTCTGTGGTGGATGAAAATCTCAGCTGGTACCTAGAAGACAATATTGAAACCTACTGCTTGGAACCAGAGAAAGTTGACAAAGACAATGAAGACTTCCAGGAGAGTAACAGAATGTATTCTGTGAATGGATATACCTTTGGAAGTCTTCCAGGGCTCTCCATGTGTGCAGAAGACAGAGTGAAGTGGTATCTTTTTGGGATGGGTAATGAAGTTGACGTGCATGCAGTTTTCTTTCATGGACAAGCATTGACTAACAAGAACTACCATGTTGATACAATCAATCTTTTTCCCGCTACTCTTGTGGATGCTTTTATGGTGGCCCAGAACCCTGGAGTGTGGATGCTTAGCTGTCAGAATCTAAACCATCTGAAAGCTGGTCTGCAGGCCTTTTTCCAGGTTCAGAGCTGTAACAAGTCTTCATCAGAGAATGATATCCTGGGGGAAAATGTTAGACACTACTACATTGCTGCTGAGGAAATCATCTGGAACTATGCTCCCTCTGGTATAGACAGTTTCACCAATGAAAACTTAACAGCTCCTGAAAGTGACTCGGCAGTATTTTTTGAACAAGGTCCTACAAGAATTGGTGGTTCTTATAAAAAGTTGGTTTATCGTGAGTACACAGATGCCTCCTTCACAAATCGAAAGGAAAGAGGCCCTGAGCAGGAACATCTTGGCATTCTGGGTCCTGTCATATGGGCAGAGGTGGGAGACACCATCAAAGTCACCTTTCATAACAAAGGACCATATCCCCTCAGTATTGAGCCGACTGGGGTGAGATTCAGCAAGGACAATGAGGGCACATACTACGCCCCACATTACAGCCCCTCAAAAGGAAGGGTGCCTCCTCATTCAGCCTCCTATGTGGCACCAGAGAAAACCTTTACCTATGAATGGACTGTCCCCAAAGAAGTGGGACCCACTTATGCAGATCCTGTGTGTCTATCTGGGATGTATTATTCTGCTGTGGATCCCACCAAAGATATATTCACTGGGCTTATTGGGCCAATGAAAATATGCAAGAAAGGGAGTTTACATGCAAATGGAAGACAGAAAGATGTAGACAAGGAGTTCTATTTGTTTCCTACAGTATTTGATGAGAATGAGAGCTTACTCCTGGATGATAATATTAGAATATTTACAACTGCACCTGATCAAGTGAATAAGGAGGATGCAGACTTTCAAGAATCTAATAAAATGCATTCCATGAATGGATTCATGAATGGGAACCAGCCTGGTCTCACCATGTGCCAGGGAGATTCAGTTGTGTGGTACTTGTTCAGTGCTGGAAACGAGGCTGATTTACACGGGATATACTTTTCAGGAAACACGTATCTGTCAAGAGGAGAAAGAAGAGACACAGCAAACCTCTTCCCTCAAACAAGTCTGACACTCCTCATGCACCCTGACACAGAAGGGACTTTTGATGTTGAGTGCCTTACAACGGATCACTACACAGGTGGCATGAAACAAAAATATACTGTGAACCCATGCAAGCAACTGTCCGAGGAGGATTCCACTCTCTTCCTGGGAGAAAGGACCTACTATATTGCAGCAGTCGAGGTGGAATGGGATTATTCACCACACAGGGAATGGGAAAAGGAGTTGCATCATTTACAGGATCAAAATGCTTCAAATGCATTTTTGGATAAGGGAGAGTTTTACATAGGCTCAAAGTACAAGAAAGCTATATATCGGCAATACACTGACAGCACGTTCACAGTTCCGGTGGAGAGAAAAGCTGAAGAAGAACACCTGGGAATTCTAGGTCCACAACTTCATGCAGATGTTAGAGACAAAATTAAAATTGTCTTTAAAAACATGGCAACAAGGCCCTACTCAATACATGCCCATGGGGTGAAAACAGAGGATTCTACAGTTACTCCAACATTACCAGGTGAAACTCGAACTTACATATGGCAAATCCCAGAAAGATCTGGCGCTGGACCAGAGGACATGGCTTGTATCCCATGGGCTTACTATTCAACTGTAGATCAAGTTAAGGACCTTTACAGTGGATTGATTGGCTCACTGATTGTCTGTCGAAAATCTTACATCAAGGTATTCAATCCCAAAAAGAAACTGGAACTTTCCCTCCTGTTTCTAGTATTCGATGAGAATGAATCTTGGTACTTAGATGACAACATTGAAACATACTCTGAGCATCCCAAGAGAGTAAACAAAGAAAATGAAGAATTCATAGAAAGCAATAAAATGCATGCTATCAATGGAAGAATGTTTGGAAACTTACAAGGCCTCACGATGCATGTGGGGGATGAGGTCACCTGGTATCTGTTAGGCATGGGCAATGAAGTGGACTTGCATTCTGTGCATTTTCATGGCCACAGCTTCCAATATAAGCACAGGGGCATTTATAGTTCTGATGTCTTTGACGTTTTTCCTGGAACATACCAAACCCTTGAAATGTTTCCCAAAACACCTGGAATCTGGTTACTCCACTGCCATGTGACTGACCACATTCATGCTGGGATGGAAACCACCTACACTGTTCTGCCAAATGAAGAAACCAAGTCTGGATGA

XM_004834431.1 Coding sequence

Tm4sf1 transmembrane 4 L six family member 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 747 bp    Location: 26652902..26645448   Strand: -
>XM_004834431.1
ATGTGCTATGGCAAATGTGCGCGATGCATCGGACATTCTCTTGTGTGGCTCTCTGTCCTCTGCATAGTAGCTAATATTTTGCTTTACTTTCCCAATGGGGAGACAAAGTATGCATCTGAAAACAACCTCAGCCGCTTTGTGTTGTTTTTCGGTGGTATTGCAGGAGGGGGCTTGCTGATGCTCCTGCCAGCATTTGTCTTCATTGGGCTGGAAGAGGAGGACTGCTGTGGCTGCTGTGGCCACGACAGCTGTGGCAAGAGATGCGCAATGCTTTCTTCTATATTGGCTGCTCTCATTGGAATCTCAGGATCTGGCTACTGTGTCACCGTGGCATCTCTGGGCTTAGCAGAAGGACCGTGGTGTCTTGATTCTCTCGGCCAGTGGAACTATACCTTCGCCAGCACTGAAGGACAGTACCTTCTGGATAGCACCACATGGTCCCAGTGCAAGGAACCCAAGCACATCGTAGAGTGGAATGTGACACTGTTTTCTATCCTCTTGGCTCTTGGTGGAATCGAATTCATCTTGTGTCTCATTCAAGTAATAAATGGATTGCTTGGAGGCATCTGTGGCTACTGCTGCTCTCGCCAGCAGGTAAGAACCTGTATGAAAATGCCCTGTCCTGGGCATGGTGTTTCAGCTGTCATAATGCACCATTCTTTTCATCAAAGAGAAAAAGGCAAAACTAAACATGCTCCAACTGGCAATGTTTATTCTTCCATCATCCCTGTGGCACTGGATCAGTAG

XM_004834433.1 Coding sequence

Tm4sf4 transmembrane 4 L six family member 4

High confidence: 4 potential gene matches
Length: 606 bp    Location: 26767485..26796177   Strand: +
>XM_004834433.1
ATGTGCTTCGGGAGCTGCGCCAAGTGCCTGGGGGGCACCCTCATCCCCCTGGCTCTGTTTGGCTTAGTGGCTAACATCCTGCTGTTTTTCCCTGGAGGAAAAGTGATCGATAACAACAGCCACCTGTCTGAAGAGGTCTGGTATTTCGGAGGAATACTAGGAAGTGGGGTCTTGATGATCTTCCCTGTGCTGGTGTTCTTGGGCCTGAAGAACAATGACTGCTACGGGTGCTGTGGTAACGAGAGCTGCGGGAAGCGAATGGCGATGTTCACTTCTGTGATATTTGCTGCAATTGGATTTGTGGGTGCTGGATACTCATTTGTCATCTCAGCCATCTCCATCAACAAGGGTCCTAAATGTCTCGTGGCCAATGCCACGTGGACCTACCCCTTCCAGAATGGGGATTACCTCAGTGACCATGCCTTGTGGAGCAAGTGCGAAAAGCCCCCCAATGTAGTTCCCTGGAATCTGACCCTCTTCTCCATCCTGCTAGTCATAGGAGGGATCCAGATGATTCTGTGTGCCATCCAGGCGATCAACGGCCTCCTGGGAACCCTCTGTGGAGAATGCCACAGAGGCTGCTGTGGGAGAGAAGGACCAGTTTAA

XM_004834435.1 Coding sequence

Wwtr1 WW domain containing transcription regulator 1, transcript variant X1

Length: 1218 bp    Location: 26967121..26815125   Strand: -
>XM_004834435.1
ATGCAGAAGATGAATCCGTCCTCGGCGCCCCCTCCGCTCCCGCCGCCCGGGCAGCAGGTGATCCACGTCACTCAGGACCTCGACACGGACCTCGAAGCCCTCTTCAACTCTGTCATGAACCCTAAGCCCAGCTCGTGGCGGAAGAAGATCCTGCCGGAGTCCTTCTTCAAGGAGCCGGATTCAGGCTCGCACTCGCGCCAGTCCAGTACCGACTCGTCGGGCGGCCACCCGGGGCCCAGGCTGGCTGGCGGCCCCCAGCACGTCCGCTCGCACTCGTCGCCCGCATCCCTGCAGCTGGGCACCGGCACCGGCGCGGGCGCGGCGGGCAGCCCCGCACAGCAGCACGCCCACCTTCGCCAGCAGTCCTATGACGTGACCGACGAGCTGCCGCTGCCCCCGGGCTGGGAGATGACCTTCACGGCCACTGGCCAGAGGTACTTCCTCAATCACATAGAAAAAATCACCACATGGCAAGACCCTAGGAAGGTGATGAATCAGCCCCTGAATCATCTGAGCCTCCACCCTGCCATCACTTCCACACCAGTGCCTCAGAGGGCCATGGCCGTGTCCCAGCCAAATCTGGTGCTCAATCACCAACACCAGCAGCAGATGGCACCCAGCACCCTGAGCCCCCAGAACCACCCTGCTCAGAACCCAACATCGGGGCTCATGAGTCTGCCCAATGCGCTCACCACTCAGCAGCAGCAGCAGCAGAAACTTCGGCTCCAGAGGATCCAGATGGAGAGAGAGAGAATCAGAATGCGCCAAGAGGAGCTCATGCGGCAGGAAGCTGCCCTCTGCAGACAGCTCCCCATGGAAGCAGAGTCCATGGCCACCGTTCAGGCTGCTGTCAACCCGCCCGCCATGACCCCAGACATGAGATCCATTACCAATAATAGCTCAGATCCTTTCCTCAATGGAGGGCCCTACCATTCGAGGGAACAGAGCACGGACAGTGGCCTGGGCTTGGGGTGCTACAGTGTCCCCACAACTCCGGAGGACTTCCTCAGCAATGTGGATGAGATGGATACAGGAGAAAATGTAGGTCAGACACCTATGAACATCAACCACCAGCAGACCCGCTTCCCTGATTTCCTTGACTGTCTTCCCGGAACGAACGTTGACCTAGGAACTTTGGAATCTGAAGATCTGATCCCCCTCTTCAATGATGTAGAGTCTGCTCTGAACAAAAGTGAGCCCTTTCAGACCTGGCTGTAG

XM_004834434.1 Coding sequence

LOC101722580 peptidyl-prolyl cis-trans isomerase A-like

Length: 495 bp    Location: 26853694..26854197   Strand: +
>XM_004834434.1
ATGGTCAACCCCACCGTGTTCTTCGATATCGCCGCCGATGGCGAGCCTTTGGGCCGCGTCTCCTTTGAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGAAAACTTTTGTGCTCTGAGCACTGGAGAGAAAGGATTTGGTTATAAGGGTTCCTGCTTTCATAGAATTATTCCAGGATTTATGTGTCAGGGTGGTGACTTTACACGCCACAGTGGGACTGGTGGTAAGTCTATCTACGGGGAGAAATTCGATGACGAGAAGTTCATCCTGAAGCACACAGGTCCTAGCATCTTGTCCATGGCGAATGCTGGACCAAACACAAATGGCTCCCAGTTTTTCATCTGCACTGCCAAGACTGAATGGTTGGATGGCAAGCACGTGGTGTTCGGGAAGGTGAAAGAGGGCATGAACATCGTGGAGGCCATGAAGCGCTTCGGGTCCAGGAACGGCAAGACCAGCAAGAAGGTCACCGTCACTGACTGTGGGCAGCTCTGA

XM_004834439.1 Coding sequence

Ankub1 ankyrin repeat and ubiquitin domain containing 1, transcript variant X2

Length: 1500 bp    Location: 27110040..27084091   Strand: -
>XM_004834439.1
ATGAGGATTTTCATAGCTTTTGAAGGATCATTTGAACCATTTGATGTTTCAACTGATGAAACTGTGGAAGCTGTCAAGCTGATGATAAAGGATTATTTTCACATTCCTCTCTCTGAAGACAAACAAGCCAGACGATATCTGGAGTTAGTGTATGCTGGAGCTGCCCTAAGGAACAGTTGGTGTCTTGCTGACATTGGAATATCTTTCTGTTCGACTCTCAAATGCTTTGTTAAGGAAGAAGACAAGCCTACTCTCTACGTGTTCAATGCTGTAACCCAAGAGACAATGCCAATAATCGAGAGCATTTCCCTTCTTGGTACAACACTTCGTTTGGACGTCTGGGATGGATGGAAGGAATTTCTGATGGGCTGTCTCCTTGGGCAAAAACTTAAAGTCCAACGATATTTATCAAAAGAAGGACCAGTACTCAAGTATCAGAAAAGGGTAGCCCTGTACATCGCTGCCTTTTATGGCTACATTGAGCTCACTGAATGGGCCCTGCAGCAGGGTGTGCGGCCACATGAGGCGGTTGGTGTTCATCCCTATCGAGCATGGTGCTATGAAGCCCTTCATGCAGATGTCTCTAAATGCCCCATTCATGCAGCTGCAGAAGCAGGCCAGCTGCTGATTCTGAAGGCCTTTGTCAACTGCAGCGTTCTGTGCCTGGAGTGCAAAACTGCAGCAGGACAAACTCCTCTGACCATCGCGTTCAAACACAAGCATAAAGACTGTGCATTATATTTGTTGAGTAAAATGTGGTCCATGGTTTCTTTTCTGAAAATTTCAGTCCCAATGAGGATTTATATTAAAATAAAACAATGGATCCTCAGAGCTCAGAGTCACAGCCTGCATAAAAAGCAGCTTTGCAAATCAAGGGTCTTTGGGGCAAAAGTTGGAGATACTGTGATGGTGGATGGTTTCACCACACCAAAAATGACCTCCAAGAGCTGGCATAAGACTGGGAATAAGGACTCACAAAGCAATTTGAGCAAGCTACCGCCTCTCAAGAAACACACTGCAAACAAGAAACCCGTTTATGCTTTGACAATTTCACAGAAGGATACTAGGGAACAGATTCCCACATTTCCTCCCCTAGGAGATACAAATAAATTCTCTGACTTACAAAGATATCAACAACAATATAAAAAAAAAATTACTGCCACAGCTAAGAAAAAAGAAGGGCACGTGAAAAATACATATCTGCCCCAAGTCCCCCTTCCTCCAATTTCAAGAGTGGGATATTCACACCCATCATTTTACTATGCAACACCCAGTGCTGACTCCCTACTAAGGTCCTCTTTTGAATCTTTCTCCAAGCACAGTGGAAGGACTCCAAGGGAGAACGCGATCTACTGCTTAGCTGTGGCAAGTGCCTTTAAAGAGAAACGATGGCTTCAACAGTTAGAAATAGCAAGAGCTCTTGCCAAAAAGAGCATTTCTAACCTGACTACCCAAGGAGGTCTGACAGCAGGTGAAAACCTTCCGGAAGTTGTGCTTTGA

XM_004834441.1 Coding sequence

Rnf13 ring finger protein 13, transcript variant X2

High confidence: 4 potential gene matches
Length: 1146 bp    Location: 27156076..27303802   Strand: +
>XM_004834441.1
ATGCTGCTCTCCATAGGGATGCTTATGCTGTCGGCCACACAAGTCTACACCATCTTGACTGTCCAGCTCTTTGCATTCTTAAACTTACTGCCTGTAGAAGCAGACATTTTAGCATATAATTTTGAAAATGCATCTCAGACATTTGATGATCTTCCAGCAAGATTTGGTTATAGACTTCCAGCTGAAGGTTTAAAGGGTTTTTTGATTAATTCAAAACCAGAGAATGCTTGTGAACCCATAGTGCCTCCACCAGTAAAAGACAATTCATCTGGCACTTTCATCGTGTTAATTAGAAGACTTGATTGTAATTTTGATATAAAGGTTTTAAATGCACAGAGAGCCGGATACAAAGCCGCTATTGTTCACAATGTTGATTCTGACGACCTCATTAGCATGGGATCCAACGACATTGATGTGTTAAAGAAAATTGACATTCCATCTGTCTTTATTGGTGAATCATCAGCTAATTCCCTGAAAGATGAATTCACATATGAAAAAGGGGGCCACATTATCTTAGTTCCAGAATTTAATCTTCCTCTGGAATACTATCTAATCCCCTTCCTCATTATAGTGGGCATCTGTCTCATCCTAATAGTCATTTTTATGATCACAAAATTTGTCCAGGACAGACACAGAGCTAGAAGAAATAGACTTGGTAAAGATCAACTTAAGAAACTCCCAGTACATAAATTTAAGAAAGGAGATGAGTATGATGTATGTGCCATTTGTTTGGATGAATATGAAGATGGAGACAAACTCAGAATCCTTCCCTGTTCCCATGCTTATCACTGCAAGTGTGTAGACCCCTGGCTAACTAAAACCAAGAAAACCTGTCCAGTCTGCAAGCAGAAAGTTGTTCCTTCTCAAGGTGATTCTGACTCTGACACAGACAGTAGTCAAGAAGAAAACGAAGTGTCAGAACACACCCCTTTGCTTAGACCTTTAGCCTCTGTCAGTGCCCAGTCATTTGGGGCTTTGTCAGAGTCCCACTCACATCAGAACATGACAGAATCTTCAGACTTTGAGGACGATGACAATGAAGATACTGACAGCAGTGAGGCAGAAAATGAATTGAATGAACACAGTGTTGTGGTCCAGTTGCAGCCTAATGGTGAGCAGGACTGCAACATAGCAAATACCGTGTGA

XM_004834440.1 Coding sequence

Rnf13 ring finger protein 13, transcript variant X1

Length: 1146 bp    Location: 27156076..27303802   Strand: +
>XM_004834440.1
ATGCTGCTCTCCATAGGGATGCTTATGCTGTCGGCCACACAAGTCTACACCATCTTGACTGTCCAGCTCTTTGCATTCTTAAACTTACTGCCTGTAGAAGCAGACATTTTAGCATATAATTTTGAAAATGCATCTCAGACATTTGATGATCTTCCAGCAAGATTTGGTTATAGACTTCCAGCTGAAGGTTTAAAGGGTTTTTTGATTAATTCAAAACCAGAGAATGCTTGTGAACCCATAGTGCCTCCACCAGTAAAAGACAATTCATCTGGCACTTTCATCGTGTTAATTAGAAGACTTGATTGTAATTTTGATATAAAGGTTTTAAATGCACAGAGAGCCGGATACAAAGCCGCTATTGTTCACAATGTTGATTCTGACGACCTCATTAGCATGGGATCCAACGACATTGATGTGTTAAAGAAAATTGACATTCCATCTGTCTTTATTGGTGAATCATCAGCTAATTCCCTGAAAGATGAATTCACATATGAAAAAGGGGGCCACATTATCTTAGTTCCAGAATTTAATCTTCCTCTGGAATACTATCTAATCCCCTTCCTCATTATAGTGGGCATCTGTCTCATCCTAATAGTCATTTTTATGATCACAAAATTTGTCCAGGACAGACACAGAGCTAGAAGAAATAGACTTGGTAAAGATCAACTTAAGAAACTCCCAGTACATAAATTTAAGAAAGGAGATGAGTATGATGTATGTGCCATTTGTTTGGATGAATATGAAGATGGAGACAAACTCAGAATCCTTCCCTGTTCCCATGCTTATCACTGCAAGTGTGTAGACCCCTGGCTAACTAAAACCAAGAAAACCTGTCCAGTCTGCAAGCAGAAAGTTGTTCCTTCTCAAGGTGATTCTGACTCTGACACAGACAGTAGTCAAGAAGAAAACGAAGTGTCAGAACACACCCCTTTGCTTAGACCTTTAGCCTCTGTCAGTGCCCAGTCATTTGGGGCTTTGTCAGAGTCCCACTCACATCAGAACATGACAGAATCTTCAGACTTTGAGGACGATGACAATGAAGATACTGACAGCAGTGAGGCAGAAAATGAATTGAATGAACACAGTGTTGTGGTCCAGTTGCAGCCTAATGGTGAGCAGGACTGCAACATAGCAAATACCGTGTGA

XM_004834442.1 Coding sequence

Rnf13 ring finger protein 13, transcript variant X3

Length: 1020 bp    Location: 27156076..27303802   Strand: +
>XM_004834442.1
ATGCTGCTCTCCATAGGGATGCTTATGCTGTCGGCCACACAAGTCTACACCATCTTGACTGTCCAGCTCTTTGCATTCTTAAACTTACTGCCTGTAGAAGCAGACATTTTAGCATATAATTTTGAAAATGCATCTCAGACATTTGATGATCTTCCAGCAAGATTTGGTTATAGACTTCCAGCTGAAGGTTTAAAGGTTTTAAATGCACAGAGAGCCGGATACAAAGCCGCTATTGTTCACAATGTTGATTCTGACGACCTCATTAGCATGGGATCCAACGACATTGATGTGTTAAAGAAAATTGACATTCCATCTGTCTTTATTGGTGAATCATCAGCTAATTCCCTGAAAGATGAATTCACATATGAAAAAGGGGGCCACATTATCTTAGTTCCAGAATTTAATCTTCCTCTGGAATACTATCTAATCCCCTTCCTCATTATAGTGGGCATCTGTCTCATCCTAATAGTCATTTTTATGATCACAAAATTTGTCCAGGACAGACACAGAGCTAGAAGAAATAGACTTGGTAAAGATCAACTTAAGAAACTCCCAGTACATAAATTTAAGAAAGGAGATGAGTATGATGTATGTGCCATTTGTTTGGATGAATATGAAGATGGAGACAAACTCAGAATCCTTCCCTGTTCCCATGCTTATCACTGCAAGTGTGTAGACCCCTGGCTAACTAAAACCAAGAAAACCTGTCCAGTCTGCAAGCAGAAAGTTGTTCCTTCTCAAGGTGATTCTGACTCTGACACAGACAGTAGTCAAGAAGAAAACGAAGTGTCAGAACACACCCCTTTGCTTAGACCTTTAGCCTCTGTCAGTGCCCAGTCATTTGGGGCTTTGTCAGAGTCCCACTCACATCAGAACATGACAGAATCTTCAGACTTTGAGGACGATGACAATGAAGATACTGACAGCAGTGAGGCAGAAAATGAATTGAATGAACACAGTGTTGTGGTCCAGTTGCAGCCTAATGGTGAGCAGGACTGCAACATAGCAAATACCGTGTGA

XM_004834447.1 Coding sequence

Tsc22d2 TSC22 domain family, member 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 2364 bp    Location: 27821624..27864805   Strand: +
>XM_004834447.1
ATGTCCAAGATGCCGGCCAAGAAGAAGAGCTGCTTCCAGATCACCAGTGTCACCACTGCCCAGGTAGCCACTAGCATTACCGAGGACACCGAAAGCCTGGACGACCCGGACGAGTCACGCACGGAGGACGTCTCCTCTGAGATATTCGACGTATCTCGAGCCACAGACTATGGCCCTGAGGAGGTCTGCGAGCGCAGCTCCTCCGAGGAGACACTCAACAATGTTGGGGATGCGGAGACTCCCGGGACCGTCTCCCCAAACCTCCTCCTAGATGGGCACCTGGCCATCGCCTCGGCTCCCGCCAACGGAGGAGGAGCCATTCTGGCTCGGAGCGTGGCTGGGGCGCTCGCCAGTACCGTGGCGGCGGCCGCCACTCCAGCCCCCGCCCCCGGGGCTCCGGGTGGCCCCCCGAGCGCTGGGTCCTCCGCCGGACCGGGAACTACAGCTCCGTCTCAGCCCCCCACCACTTGCAGTTCCCGTTTCCGCGTGATCAAGCTGGACCACGGGAGCGGGGAGCCCTATCGACGCGGCCGATGGACGTGTATGGAATACTATGAGCGGGATTCCGACAGCAGCGTCCTGACTAGGTCCGGGGATTGCATTAGACACAGCAATACTTTTGACCAGACTGCAGAGCGGGACAGCGGCCTGGGCGCCACCGGAGGGTCTGTAGTGGTAGTGGTGGCCTCCATGCAGGGGGCGCACGGGCCCGACTCGGGAACTGACAGCTCCTTGACTGCTGTGTCACAGCTACCCCCGTCGGAGAAAATGAGCCAGCCCACTCCGGCCCAGCCGCAGAGTTTTAGCGTTGGGCAGTCGCAGCCGCCACCGCCGCCCGTAGGTGGGGCTGTGGCTCAAAGCTCGGTTCTGCTGCCGCCGTTTGCGGGAGCAGCTGCCGGGCAGCAGCCAATGATAGCAGCTGCCGCACAGCCAAGCCAGCTACAGGGAACTGGGCCCGGCGGCTCCCCTCCAGGACCGAGTGGACCAGGTCTGCCGCCTACGAATGTAACCCTGGCGCAGCCGGCTGCGTCCCTACCTCCGCAGCCGGTCCCAGCAGTCGGCGCTTCAGCGACGCAACATTCCCAGCAGTTCGCCTATCCCCAGCCTCCGATTCAGCCTGGCCATTTGCTGCCGGGCCAGCCCTCCGGCCAGAGTGAGTACTTGCAGCACCACGTGGCCGGCCTCCAGCCGCCGAGCCCTGCGCAGCCTTCCTCCACCAGCGCCGGAGCGACCGCCTCTACTGCGGCTAACTTTCCCATGGGCTCTGGCCAGAATGCCTCTTCGGTAGGCGCGCAGATAAGGGGCACGTCTTCCCAGCCCAGTGAAGCTGTTACTGCGGGGCCGGGACTAGCACAAGGCGGGCAGGCCGCGCCTTGTCAGCCGGCTGGGGTGTCCCCAGCTGCTGTAGGAGGCATGGTGCAGCCGGGCAAGGGTCCTACGGGGGTCGGGCAGCCCCAGTCTCTGCCTCCGCAGCAGATCGGTGGCAGTGGTCAGCTGTCAGTCGTGCCTGGTGGCCCTCACACCGTGGTGCCCGGAGTTCCAAACGTGCCTGCAGCCGTACCCGCTCCAAGCGTGCCTAGTGTGTCTACCACTTCTGTTACTATGCCAAATGTACCTGCGCCTCTGGCCCAGTCGCAGCCGCTGAGCAGCCATACACCAGTCAGCAGGAGCAGCAGTGTAATCCAGCACGTTGGGCTGCCCTTAGCTCAAGGCACACACAGTGCGCCAACGAGTCTACCACAGTCTGACCTAAGTCAATTTCAGACTCAGACCCAGCCTTTAGTCGGGCAAGTTGACGATACTAGAAGAAAATCAGAACCCCTACCTCAACCACCACTTTCTCTCATTGCTGAAAATAAGCCTGTTGTGAAGCCACCTGTTGCAGATTCTCTAGCAAACCCTCTTCAGCTAACACCTATGAACAGTCTTGCCACCTCTGTGTTCAGCATAGCTATTCCTGTTGATGGGGATGAAGACAGGAATCCTTCAACTGCTTTCTACCAAGCGTTCCATTTGAACATGTTTCAGGAATCAAAGAGCCTCTGGGATAGTGCATCTGGGGGAGGTGGTGTAGCCATTGACAACAAAATAGAACAAGCAATGGATCTGGTGAAAAGCCATTTGATGTATGCAGTAAGAGAAGAAGTGGAAGTTCTAAAGGAACAAATAAAAGAATTAGTTGAAAGAAACTCTTTACTTGAACGAGAAAATGCACTGTTAAAATCTCTTTCAAACAATGATCAGTTATCCCAACTCCCAGCCCAACAGGCCAATCCTGGTAGCACTTCTCAACAGCAAGCAGTGATAGCACAGCCTCCACAGCCAACGCAACCTCCACAGCAGCCGAATGTCTCCTCTGCATAA

XM_004834451.1 Coding sequence

Eif2a eukaryotic translation initiation factor 2A, 65kDa

High confidence: 4 potential gene matches
Length: 1779 bp    Location: 27973666..28013434   Strand: +
>XM_004834451.1
ATGGGTTTCTTTTTCCGGGACAAGATGGCGCCGTCCACGCCGCTTTTGACAGTCCGGGGATCAGAAGGACTATACATGGTGAATGGCCCACCACACTTTACAGAAAGCACAGTATTTCCAAGGGAATCTCGGAAAAACTGCAAAGTTTATACCTATAGTAAGGATGGGACCTTATTTGCCTGGGCCAATGGAGAAAAAGTAAATATTATCAGTGTCACTAACAAGAGACTACTGCACTCCTTCGACCTCCCAAAGACAGTTTGCCTTGAATTCTCGCCCCAAAACACTATCCTGGCAACATGGCAGCCTTACACTACTTCTAAAGATGGCACAGCGGGGATACCCAACCTACAACTTTATGATGTGAAAACTGGAACATGTTTGAAATCTTTTATACAGAAAAAAGCACAAAATTGGTATCCATTCTGGTCAGAAGATGAAATCATTTGTGCCCGAAATGTTAACAACGAAGTTCACTTCTTTGAAAACAACAATTTTAATACAATTGCAAATAAGTTGCATTTGCAAAAAATTAATGATTTTGTTTTATCACCTGGACCCCAACCATACAAGGTAGCTGTCTATGTTCCAGGAAGTAAAGGTGCACCTTCATTTGTTAGATTATACCAGTACCCCAACTTTGCTGGACCTCATGTAGCTTTAGCCAACAAGAGTTTCTTTAAAGCAGATAAGGTTACAATGTTGTGGAATAAAAAAGCCACTGCTGTGTTGGTAATAGCTAGTACAGAAGTTGACAAGACAGGAGCTTCCTACTATGGAGAACAAACGCTGCACTACATTGCGACAAATGGAGAAAGTGCTGTGGTGCAATTACCAAAAAATGGCCCCATTTATGATGTAGTTTGGAATTCTAGTTCAACTGAATTTTGTGTTGTATATGGTTTTATGCCCGCCAAAGCAACAATTTTCAATTTGAAATGTGATCCGGTGTTTGACTTTGGAACTGGTCCTCGAAATGCAGCCTACTACAGCCCTCATGGACATATATTAGTACTAGCTGGATTTGGAAATCTGAGGGGACAAATGGAAGTATGGGATGTTAAAAACTACAAACTTATTTCTAAACCAGTAGCTTCTGATTCTACGTATTTTGCTTGGTGTCCAGATGGTGAGCATATCTTAACAGCCACATGTGCTCCCAGGTTACGTGTTAATAATGGGTACAAGATTTGGCATTATACTGGCTCTATCTTGCACAAGTATGATGTCCCATCAAATGGAGAATTGTGGCAGGTTTCTTGGCAGCCATTCTTGGATGGAATATTTCCAGCAAAAACAGTAACTTACCAAGCAGTTCCAAGTGAAGTACCCAGTGAGGAGCCTAAGGTTGCAACAGCTTATAGACCTCCAGCTTTAAGAAATAAACCAATCACCAATTCCAAATTGCATGAAGAAGAACCACCCCAGAATATGAAACCACAACCAGGACATGATAAACCATTATCAAAAACAGCCCTTAAAAATCAAAGAAAGCATGAAGCTAAAAAAGCTGCAAAGGAAGCAAGAAGTGACAAAAGTCCAGATGTGACACCCACTCCTGCCCCACAGAGTGTACCACAAAACACTATCTCTCAGTCAACTTTTGGTGACCCTGAAATAGACAAAAAAATTAAGAATTTGAAGAAGAAACTGAAAGCAATTGAACAACTTAAAGAACAAGCAGCAGCTGGAAAACAGCTAGAAAAAAATCAGTTGGAGAAAATTCAAAAAGAGACAGCCATTCTTCAGGAACTGGAAGAGTTGGAATTGGGTATTTAA

XM_004834462.1 Coding sequence

P2ry13 purinergic receptor P2Y, G-protein coupled, 13

High confidence: 4 potential gene matches
Length: 1017 bp    Location: 28767423..28765770   Strand: -
>XM_004834462.1
ATGACACTGGAAACAATCAATGCCACAGTGATCCAGGGCTTCAACCGGTCTCAGCGATGCCTAAGAGATACTCGGATAACACAGCTGGTGTTCCCAGTCCTCTACACTGTGGTTTTCTTCACTGGTGTCCTGCTGAACACTTTGGCCCTGTGGGTGTTCATTCAGATCCCCAGTTCCTCCACCTTCATCGTCTATCTCAAAAACACTTTGGTGGCTGACTTGATAATGACACTCACGCTTCCTTTCAAAATCCTCTCTGACTCACACCTTGGACCCTGGCAACTCAGAGCTTTTGCGTGTCGTTTCTCTGCCGTAATCTATTATGAGACCATGTATATAGGCATCATGCTCCTGGGCCTTATAGCCTTTGACAGATTTCTCAAGATCATCAGACCCTTTGGAAAATATTTTATTAAAAAACCTGTTTTTGCAAAAATAGTCTCAACTCTCATCTGGTTCCTGTTGTTCCTCATCTCCCTGCCAAATATGATCCTGAACAACAAGGCAGCAACACCATCATCTGTGAAAAAGTGTGCATCCCTGAAGGGCCCTCTGGGGCTGAAATGGCATCGAGTCGTCAATTACATATGCCAGTTTATTTTCTGGACTGTTTTTGTCCTAATCCTTCTGTTTTACATGGTAATTGCAACAAAAGTATACAGTTCTTATAAAAAGTTCAGAAGTAAGGACAGCAAAAACAACAGAAGGGTGGAGGGGAAAGTATTTGTGGTAGTGGCAGTCTTCTTTCTGTGCTTCGCTCCATTTCATTTTGCGAGAGTTCCATACACTCACAGTCAGACCAACAACACAACTGACTGCAAGCAAGAGAATCAACTATTCATTGCTAAAGAAACAACTCTCTTTTTGGCAGCAACTAACATTTGTATGGACCCCTTAATATATATATTCTTATGCAAAAAATTTACAGAAAGATTGCCATGTATAAAATGGAGAAAGACCACAGCATCAAGCCAAGAACATTGCAGCAGTCATACAGACAATATAACCTTAGGCTGA

XM_004834461.1 Coding sequence

P2ry12 purinergic receptor P2Y, G-protein coupled, 12, transcript variant X6

High confidence: 4 potential gene matches
Length: 1029 bp    Location: 28790602..28772525   Strand: -
>XM_004834461.1
ATGCAGGCCACCAGCAACCTCACCTCTGCACATGGGAACAGCAGCCTCTGTGCCAGAGACTACAAGATTACCCAGGTTCTCTTCCCGCTGCTCTACTCTTTCCTGTTTTTTGTTGGACTCATCACAAACAGCCTGGCAATGAGGATTTTCTTTCAAATCAACAGTAAATCTAACTTCATTATTTTTCTAAAGAACACAGTCATTTCCGATCTTCTCATGATTCTGACTTTTCCATTCAAAATTCTTAGTGATGCCGAACTGGGACCAGGACCTCTGAGAACCTTTGTGTGCCAAGTTACTTCTGTCATATTTTATTTCACAATGTATATCAGTATTTCATTCCTAGGACTGATAACTATCGACCGTTACCAGAAGACCACCAGGCCATTTAAAACATCCAACCCCAGTAATCTCTTGGGGGCTAAGATTCTCTCTGTTGTCATCTGGGCTTTCATGTTCTTATTCTCTTTGCCTAACATGATTCTCACTAACAAGAGGCCAAGAGACAAGAATGTGAAGAAATGCTCTTTCTTTAAATCACAGTTTGGGCTGGTCTGGCATGAAATAGTCAATTACATCTGTCAAGTCATTTTCTGGATTAATTTTTTAATTGTAATTGTATGCTATACGCTCATTACAAAAGAACTCTACAGATCATATGTAAGAACAAGGGGAGCAGGCAAAGTCCCCAGGAAAAAGGTGAATGTCAAAGTTTTCATTATCATTGCTGTGTTCTTTATTTGTTTTGTTCCTTTCCATTTTGCACGAATTCCCTACACCCTGAGTCAGACCCGGGATGTTTTTGACTGTGCTGCAGAGAACACTCTGTTCTACGTCAAAGAAAGCACACTCTGGTTAACTTCTTTGAATGCATGCTTGGATCCATTCATCTATTTTTTCCTTTGCAAATCCTTTAGAAATTCCTTGATAAGCATGCTGAAGTGCCACAATTCTGCAAAATCTCCACCCCGAGAAAACAGGAAGAAAGGACAGGGTGGTGGTGACCCAAGTGAAGAGACTCCAATGTAA

XM_004834459.1 Coding sequence

P2ry12 purinergic receptor P2Y, G-protein coupled, 12, transcript variant X4

Length: 1029 bp    Location: 28782585..28772525   Strand: -
>XM_004834459.1
ATGCAGGCCACCAGCAACCTCACCTCTGCACATGGGAACAGCAGCCTCTGTGCCAGAGACTACAAGATTACCCAGGTTCTCTTCCCGCTGCTCTACTCTTTCCTGTTTTTTGTTGGACTCATCACAAACAGCCTGGCAATGAGGATTTTCTTTCAAATCAACAGTAAATCTAACTTCATTATTTTTCTAAAGAACACAGTCATTTCCGATCTTCTCATGATTCTGACTTTTCCATTCAAAATTCTTAGTGATGCCGAACTGGGACCAGGACCTCTGAGAACCTTTGTGTGCCAAGTTACTTCTGTCATATTTTATTTCACAATGTATATCAGTATTTCATTCCTAGGACTGATAACTATCGACCGTTACCAGAAGACCACCAGGCCATTTAAAACATCCAACCCCAGTAATCTCTTGGGGGCTAAGATTCTCTCTGTTGTCATCTGGGCTTTCATGTTCTTATTCTCTTTGCCTAACATGATTCTCACTAACAAGAGGCCAAGAGACAAGAATGTGAAGAAATGCTCTTTCTTTAAATCACAGTTTGGGCTGGTCTGGCATGAAATAGTCAATTACATCTGTCAAGTCATTTTCTGGATTAATTTTTTAATTGTAATTGTATGCTATACGCTCATTACAAAAGAACTCTACAGATCATATGTAAGAACAAGGGGAGCAGGCAAAGTCCCCAGGAAAAAGGTGAATGTCAAAGTTTTCATTATCATTGCTGTGTTCTTTATTTGTTTTGTTCCTTTCCATTTTGCACGAATTCCCTACACCCTGAGTCAGACCCGGGATGTTTTTGACTGTGCTGCAGAGAACACTCTGTTCTACGTCAAAGAAAGCACACTCTGGTTAACTTCTTTGAATGCATGCTTGGATCCATTCATCTATTTTTTCCTTTGCAAATCCTTTAGAAATTCCTTGATAAGCATGCTGAAGTGCCACAATTCTGCAAAATCTCCACCCCGAGAAAACAGGAAGAAAGGACAGGGTGGTGGTGACCCAAGTGAAGAGACTCCAATGTAA

XM_004834468.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1065 bp    Location: 29496758..29505363   Strand: +
>XM_004834468.1
ATGGTGATGGCTCAATTCAGTTTAACTCAGCAGAATTTGTTGAACAACTACAATATGCACGGGACTATGGCATGGAATTCAACTTGTAGAAACTGGCTGACAGCACAGGTTGCTTTGCAAAAGTACTATCTTTCAATTTTCTATGGGATTGAGTTCGTTGTAGGAATTCTTGGAAATACGGTTGTTGTTTTTGGCTACCTCTTCTGTCTGAAGAACTGGAATAGCAGCAACATCTATCTCTTTAACCTCTCCATCTCTGATTTAGCTTTTTTGTGCACCCTTCCCATGCTGATGAGAAGCTATGCCAACCAAACCTGGATATATGGAGATGTGTTCTGCATCATCAACCGGTACGTGCTTCATGCCAACCTCTACACCAGCATCCTTTTCCTCACCTTTATCAGCATCGATCGATACATGCTCATGAAGCATCCTTTCCGAGAACACCTTCTGCAAAAGAAAGAGTTTGCTGTTTTAACCTCTTTGGCTATTTGGGTTTTAGTAACCTTAGAGCTACTACCTATACTTCCTCTTATAAATCCCACTACAACTGAACAAGGCACCAACTGTCTTGATTATGCAAGTTCTGGAGACCCTCGATACAACCTCATTTACAGCATGTGCCTAACCTTGTTGGGATTCCTTATTCCTCTTTCCGTGATGTGCTTCTTCTATTACAAGATTGCTGTCTTCCTAAAGCAGAGAAGCAGGCAGCTCTCTACCACCTTGCCCCTTGAAAAGCCTCTCCACTTAGTTATCATGGCAGTGGTGATTTTCTCCGTGCTCTTTACGCCCTATCACATTATGCGGAATGTGAGGATTGCTACGCGCCTGGACAGCTGGAAGCAGAACCAATGCACACAAGAAATCATCAAATCCTTATACACTGTGACTCGGCCATTGGCCTTTCTGAACAGTGCTATCAACCCTGTCTTCTACTTTCTGATGGGTGATCACTTTAGGGAAATGCTGATGAGTAAACTGAGACACCACTTTAAATCCCTTACAACCTTCAGAAAAGAACTTATACTTTATGAACTCATACTTTCATTTAGTGAAAAGTGA

XM_004834475.1 Coding sequence

Mbnl1 muscleblind-like splicing regulator 1, transcript variant X7

Length: 924 bp    Location: 29930367..30110459   Strand: +
>XM_004834475.1
ATGGCCATGTTGGCCCAGCAAATGCAACTAGCCAATGCCATGATGCCCGGTGCCCCATTACAACCCGTGCCAATGTTTTCAGTTGCACCAAGCTTAGCCACCAATGCATCAGCAGCCTTTAATCCCTACCTGGGACCTGTTTCTCCAAGCCTGGTTCCAGCAGAGATCTTGCCGACTACACCAATGTTGGTTACTGGGAATCCGGGGGTTCCTGTACCTGCAGCTGCTGCAGCTGCTGCACAGAAATTAATGCGGACAGACAGACTTGAGGTATGTCGAGAGTACCAACGTGGCAATTGCAACAGAGGAGAAAATGATTGTCGGTTTGCTCATCCTGCTGACAGCACAATGATTGACACCAATGACAACACAGTCACCGTCTGTATGGATTACATCAAGGGAAGATGCTCTCGGGAAAAGTGCAAATACTTTCATCCGCCTGCACATCTGCAAGCCAAGATCAAGGCTGCTCAATACCAGGTCAACCAAGCTGCAGCAGCCCAGGCTGCAGCCACTGCAGCTGCCATGACTCAGTCGGCTGTCAAATCACTGAAGCGACCCCTCGAGGCAACCTTTGACCTGGGAATTCCTCAAGCTGTACTTCCCCCATTACCAAAGAGGCCTGCTCTTGAAAAAACCAACGGTGCCACTGCAGTCTTTAACACTGGTATTTTCCAGTACCAACAGGCTCTAGCCAACATGCAGTTACAACAGCATACAGCATTTCTCCCACCAGGCTCAATATTGTGCATGACACCCGCTACAAGTGTTGTTCCCATGGTGCACGGTGCTACGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAGCCAACCAGATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAG

XM_004834469.1 Coding sequence

Mbnl1 muscleblind-like splicing regulator 1, transcript variant X1

Length: 1200 bp    Location: 29930404..30110458   Strand: +
>XM_004834469.1
ATGGCTGTTAATGTCACACCAATTCGGGATACAAAATGGCTAACACTGGAAGTATGTAGAGAGTTTCAAAGGGGCACTTGCTCACGGCCTGACACGGAATGTAAATTTGCACATCCTTCGAAAAGCTGCCAAGTTGAAAATGGACGAGTAATCGCCTGCTTTGATTCATTGAAAGGTCGTTGCTCCAGGGAGAACTGCAAATATCTTCATCCACCCCCACACTTAAAAACACAATTGGAGATAAATGGGCGCAATAACTTGATTCAGCAGAAGAACATGGCCATGTTGGCCCAGCAAATGCAACTAGCCAATGCCATGATGCCCGGTGCCCCATTACAACCCGTGCCAATGTTTTCAGTTGCACCAAGCTTAGCCACCAATGCATCAGCAGCCTTTAATCCCTACCTGGGACCTGTTTCTCCAAGCCTGGTTCCAGCAGAGATCTTGCCGACTACACCAATGTTGGTTACTGGGAATCCGGGGGTTCCTGTACCTGCAGCTGCTGCAGCTGCTGCACAGAAATTAATGCGGACAGACAGACTTGAGGTATGTCGAGAGTACCAACGTGGCAATTGCAACAGAGGAGAAAATGATTGTCGGTTTGCTCATCCTGCTGACAGCACAATGATTGACACCAATGACAACACAGTCACCGTCTGTATGGATTACATCAAGGGAAGATGCTCTCGGGAAAAGTGCAAATACTTTCATCCGCCTGCACATCTGCAAGCCAAGATCAAGGCTGCTCAATACCAGGTCAACCAAGCTGCAGCAGCCCAGGCTGCAGCCACTGCAGCTGCCATGACTCAGTCGGCTGTCAAATCACTGAAGCGACCCCTCGAGGCAACCTTTGACCTGGGAATTCCTCAAGCTGTACTTCCCCCATTACCAAAGAGGCCTGCTCTTGAAAAAACCAACGGTGCCACTGCAGTCTTTAACACTGGTATTTTCCAGTACCAACAGGCTCTAGCCAACATGCAGTTACAACAGCATACAGCATTTCTCCCACCAGGCTCAATATTGTGCATGACACCCGCTACAAGTGTTGTTCCCATGGTGCACGGTGCTACGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAGCCAACCAGATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAG

XM_004834471.1 Coding sequence

Mbnl1 muscleblind-like splicing regulator 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 1164 bp    Location: 29930404..30110458   Strand: +
>XM_004834471.1
ATGGCTGTTAATGTCACACCAATTCGGGATACAAAATGGCTAACACTGGAAGTATGTAGAGAGTTTCAAAGGGGCACTTGCTCACGGCCTGACACGGAATGTAAATTTGCACATCCTTCGAAAAGCTGCCAAGTTGAAAATGGACGAGTAATCGCCTGCTTTGATTCATTGAAAGGTCGTTGCTCCAGGGAGAACTGCAAATATCTTCATCCACCCCCACACTTAAAAACACAATTGGAGATAAATGGGCGCAATAACTTGATTCAGCAGAAGAACATGGCCATGTTGGCCCAGCAAATGCAACTAGCCAATGCCATGATGCCCGGTGCCCCATTACAACCCGTGCCAATGTTTTCAGTTGCACCAAGCTTAGCCACCAATGCATCAGCAGCCTTTAATCCCTACCTGGGACCTGTTTCTCCAAGCCTGGTTCCAGCAGAGATCTTGCCGACTACACCAATGTTGGTTACTGGGAATCCGGGGGTTCCTGTACCTGCAGCTGCTGCAGCTGCTGCACAGAAATTAATGCGGACAGACAGACTTGAGGTATGTCGAGAGTACCAACGTGGCAATTGCAACAGAGGAGAAAATGATTGTCGGTTTGCTCATCCTGCTGACAGCACAATGATTGACACCAATGACAACACAGTCACCGTCTGTATGGATTACATCAAGGGAAGATGCTCTCGGGAAAAGTGCAAATACTTTCATCCGCCTGCACATCTGCAAGCCAAGATCAAGGCTGCTCAATACCAGGTCAACCAAGCTGCAGCAGCCCAGGCTGCAGCCACTGCAGCTGCCATGACTCAGTCGGCTGTCAAATCACTGAAGCGACCCCTCGAGGCAACCTTTGACCTGGGAATTCCTCAAGCTGTACTTCCCCCATTACCAAAGAGGCCTGCTCTTGAAAAAACCAACGGTGCCACTGCAGTCTTTAACACTGGTATTTTCCAGTACCAACAGGCTCTAGCCAACATGCAGTTACAACAGCATACAGCATTTCTCCCACCAGTTCCCATGGTGCACGGTGCTACGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAGCCAACCAGATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAG

XM_004834473.1 Coding sequence

Mbnl1 muscleblind-like splicing regulator 1, transcript variant X5

Length: 1110 bp    Location: 29930404..30110458   Strand: +
>XM_004834473.1
ATGGCTGTTAATGTCACACCAATTCGGGATACAAAATGGCTAACACTGGAAGTATGTAGAGAGTTTCAAAGGGGCACTTGCTCACGGCCTGACACGGAATGTAAATTTGCACATCCTTCGAAAAGCTGCCAAGTTGAAAATGGACGAGTAATCGCCTGCTTTGATTCATTGAAAGGTCGTTGCTCCAGGGAGAACTGCAAATATCTTCATCCACCCCCACACTTAAAAACACAATTGGAGATAAATGGGCGCAATAACTTGATTCAGCAGAAGAACATGGCCATGTTGGCCCAGCAAATGCAACTAGCCAATGCCATGATGCCCGGTGCCCCATTACAACCCGTGCCAATGTTTTCAGTTGCACCAAGCTTAGCCACCAATGCATCAGCAGCCTTTAATCCCTACCTGGGACCTGTTTCTCCAAGCCTGGTTCCAGCAGAGATCTTGCCGACTACACCAATGTTGGTTACTGGGAATCCGGGGGTTCCTGTACCTGCAGCTGCTGCAGCTGCTGCACAGAAATTAATGCGGACAGACAGACTTGAGGTATGTCGAGAGTACCAACGTGGCAATTGCAACAGAGGAGAAAATGATTGTCGGTTTGCTCATCCTGCTGACAGCACAATGATTGACACCAATGACAACACAGTCACCGTCTGTATGGATTACATCAAGGGAAGATGCTCTCGGGAAAAGTGCAAATACTTTCATCCGCCTGCACATCTGCAAGCCAAGATCAAGGCTGCTCAATACCAGGTCAACCAAGCTGCAGCAGCCCAGGCTGCAGCCACTGCAGCTGCCATGGGAATTCCTCAAGCTGTACTTCCCCCATTACCAAAGAGGCCTGCTCTTGAAAAAACCAACGGTGCCACTGCAGTCTTTAACACTGGTATTTTCCAGTACCAACAGGCTCTAGCCAACATGCAGTTACAACAGCATACAGCATTTCTCCCACCAGTTCCCATGGTGCACGGTGCTACGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAGCCAACCAGATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAG

XM_004834470.1 Coding sequence

Mbnl1 muscleblind-like splicing regulator 1, transcript variant X2

Length: 1200 bp    Location: 29959124..30110458   Strand: +
>XM_004834470.1
ATGGCTGTTAATGTCACACCAATTCGGGATACAAAATGGCTAACACTGGAAGTATGTAGAGAGTTTCAAAGGGGCACTTGCTCACGGCCTGACACGGAATGTAAATTTGCACATCCTTCGAAAAGCTGCCAAGTTGAAAATGGACGAGTAATCGCCTGCTTTGATTCATTGAAAGGTCGTTGCTCCAGGGAGAACTGCAAATATCTTCATCCACCCCCACACTTAAAAACACAATTGGAGATAAATGGGCGCAATAACTTGATTCAGCAGAAGAACATGGCCATGTTGGCCCAGCAAATGCAACTAGCCAATGCCATGATGCCCGGTGCCCCATTACAACCCGTGCCAATGTTTTCAGTTGCACCAAGCTTAGCCACCAATGCATCAGCAGCCTTTAATCCCTACCTGGGACCTGTTTCTCCAAGCCTGGTTCCAGCAGAGATCTTGCCGACTACACCAATGTTGGTTACTGGGAATCCGGGGGTTCCTGTACCTGCAGCTGCTGCAGCTGCTGCACAGAAATTAATGCGGACAGACAGACTTGAGGTATGTCGAGAGTACCAACGTGGCAATTGCAACAGAGGAGAAAATGATTGTCGGTTTGCTCATCCTGCTGACAGCACAATGATTGACACCAATGACAACACAGTCACCGTCTGTATGGATTACATCAAGGGAAGATGCTCTCGGGAAAAGTGCAAATACTTTCATCCGCCTGCACATCTGCAAGCCAAGATCAAGGCTGCTCAATACCAGGTCAACCAAGCTGCAGCAGCCCAGGCTGCAGCCACTGCAGCTGCCATGACTCAGTCGGCTGTCAAATCACTGAAGCGACCCCTCGAGGCAACCTTTGACCTGGGAATTCCTCAAGCTGTACTTCCCCCATTACCAAAGAGGCCTGCTCTTGAAAAAACCAACGGTGCCACTGCAGTCTTTAACACTGGTATTTTCCAGTACCAACAGGCTCTAGCCAACATGCAGTTACAACAGCATACAGCATTTCTCCCACCAGGCTCAATATTGTGCATGACACCCGCTACAAGTGTTGTTCCCATGGTGCACGGTGCTACGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAGCCAACCAGATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAG

XM_004834482.1 Coding sequence

Arhgef26 Rho guanine nucleotide exchange factor (GEF) 26, transcript variant X1

Length: 2613 bp    Location: 31716144..31846037   Strand: +
>XM_004834482.1
ATGGACGGCGAGAGCGAAGTGGATTTTTCTAGCAACAGATTAACCCCTTTATGGCGGAGGCGGTCGACCCCTGAGCCCCAGCTGCTGGGCCGGAGCAAACCGAGGCCCCAGTCCTACCAGAGCCCCAGCGGGTTGCTGATCACGGACTTCCCAGTGGAGGAGCTGGGGACGCTGCCGGCGGCGCAGACTCCCGCCCGGCTGCCCACCTCGTCGGACGGCAGGACGGTGCAGAAGAGCCCCCTCCTTCTTTGCACCCATCGGTGGGCGGTGACCAATGGGCGGACGGTCTCCCCGGAATACAGAGCTGCTTCTCCTCGACCCCGACGGTCCAAGTCACCCCAAGTCCCCAAAGCGGCTTCGGGCGGCTCCCCGAAGTCTCGGGCGAATGGCACGGTGACGTCGCCTGCCCCGCCGCCTCCGCTGAGCACCCCGCGGACTCCTGCTGTTCCCGCACCCTCCAGCCCGGAGGACCCCACCGGAGTGACTGCCAGCCGGCTGCCTTCACCCACTATCAATGGTCTTGCCTCCCAAAACGATTCCTCTGGCTCCCGTTCTCAGTCTGCGGAGACGGCTAAGAACCCAGAACGGAGGCCTTCGGGACTCTGTAATGTGCCCCAGAAAAAGTCTTCGGAACAAAACCTCCCCCTCCAAAGGCTGCCCTCACAGGAGAACGAACTACCCGAAAATCCTTCCGTGGTTTTGAGTACAAACAGCCCTGCTGCCCTCAAAGTGGGGAAGCAGCAGATCATTCCGAAGAGCCTGGCCTCAGAAATTAAATTAAGTAAATCCAACAGTCAGAATGTAGAGCCCCACAAGAGACTCCTCAAGGTACGCAGCATGGTGGAGGGCTTCGGAGCGCCCCTGGGTCCGGCAGGGGAAGAGAGGGAGGTCGACAATGACGTGGATAGCCCGGGGTCTCTGCGGCGAGGCCTGCGGTCCACATCCTATCGCAGGGCCGTGGTCAGTGGCTTTGATTTTGACAGCCCTAACAGCTCCAAGAAGAAGAACAGGATGTCCCAGCCTGTCCTGAAAGTGGTGATGGAAGACAAGGAAAAGTTTTCCAGCCTGGGAAGGATAAAGAAAAAAATGCTGAAAGGACAAGGAACATTTGATGGGGAAGAAAATGCTGTCCTATATCAAAACTACAAAGAAAAGGCCCTTGACATTGACTCTGATGAAGAGTCGGAGTTCAAAGAACAGAAGTCAGAGGAAAAAATTGTGATTCACCATAAGCCACTGAGATCTACGTGGAGCCAGCTCTCTGCAGTGAAAAGAAATGGGCTATCTCAAACAGTAAGCCAGGAGGAAAGGAAGAGACAAGAGGCAATCTTTGAAGTCATATCATCTGAACATTCATATTTACTCAGCTTAGAGATCTTGATTCGAATGTTTAAAAATTCTAAAGAACTGAGTGATACAATGACCAAAACTGAGAGACACCATCTTTTCTCCAATATTACAGATGTCTGTGAGGCAAGCAAAAAATTCTTTACAGAGTTGGAAGCAAGGCATCAGAATAATATCTTCATAGAAGATATAAGTGACATTGTAGAAAAACACACAGCATCCACATTTGATCCCTATGTGAAATACTGCACAAATGAAGTCTACCAACAACGAACACTACAGAAATTGTTAGCCACCAATCCCTCCTTTAAGGAAGTATTGTCTCGGATCGAGTCTCATGAAGACTGTAGGAACCTACCCATGATCTCTTTTCTCATTCTCCCCATGCAGAGAGTGACCCGCCTTCCCCTGCTGATGGATACTATCTGTCAAAAAACACCTAAGGATTCTCCAAAGTATGAAGTCTGCAAAAGGGCCTTAAAGGAAGTAAGCAAGTTGGTTCGCCTATGTAATGAAGGAGCCCGAAAGATGGAAAGGACCGAGATGATGTATACAATTAACTCCCAGCTGGAATTTAAAATTAAGCCTTTTCCTTTAGTCTCCTCCTCCCGGTGGTTGGTGAAAAGAGGTGAATTGACAGCCTATGTAGAAGACACTGTGCTTTTCTCGAGGAGGACATCCAAACAGCAAGTGTACTTTTTTCTGTTTAATGACGTCCTCATTATCACCAAGAAGAAGAGTGAAGAAAGCTACAACGTCAATGATTATTCTTTAAGAGATCAGCTCTTGGTGGAATCCTGTGACAATGAAGAGCTTAATTCCTCTCCAGGGAAGAACAGTTCCACAATGCTTTATTCAAGACAGAGCTCTGCCAGTCACCTCTTTACGCTGACAGTCCTGAATAACCATGCGAATGAGAAAGTGGAAATGCTGCTGGGGGCGGAGACACAGAGTGAGCGAGCCCGCTGGATAACTGCCCTCGGACACAGCAGTGGGAAGCAGCCTCCAGACCGAACCTCACTGACCCAGGTGGAAATCATTAGGTCATTCACATCCAAGCAACCAGATGAACTCTCCCTGCAAGTGGCGGATGTGGTCCTCATTTATCAGCGTGTTGGAGATGGCTGGTATGAGGGGGAACGACTTCGAGATGGAGAAAGGGGCTGGTTTCCTATGGAATGTGCCAAGGAGATAACCTGTCAAGCTATAATCGACAAGAACGTGGAGAGAATGGGACGTCTGCTAGGACTTGAGACCAACGTGTAA

XM_004834487.1 Coding sequence

Mme membrane metallo-endopeptidase, transcript variant X2

Length: 2253 bp    Location: 32601488..32689011   Strand: +
>XM_004834487.1
ATGGGAAGATCTGAAAGTCAGATGGATATAACTGATATCAACACTCCAAAGCCAAAGAAGAAACAGCGATGGACTCCTTTGGAGATCAGTCTCTCAGTCCTTGTCCTGCTCCTTACTATCATAGCTGTGACCATGATAGCTCTCTATGCAACGTACGATGATGGTATCTGCAAGTCATCAGATTGCATAAAATCAGCTGCTCGACTGATCCAGAACATGGATGCAACTATTGAGCCTTGTGCAGACTTTTTCAAATATGCCTGTGGAGGCTGGCTGAAACGCAATGTCATTCCTGAGACCAGTTCCCGTTACAGTAATTTTGACATTTTAAGAGATGAGCTAGAAGTTATTTTGAAAGATGTCCTCGAGGAACCCAAAACTGAAGATATTGTAGCAGTGCAAAAAGCAAAAACATTGTACAGATCCTGTATAAATGAATCTGTCATTGATAGTAGACGTGGACAACCTCTACTCAAACTGTTGCCAGATATATATGGGTGGCCAGTGGCCACAGAAAACTGGGAACAAATATATGGTACTTCTTGGACAGCTGAAAAATCTATGGCTCAATTGAGTTCTAAATATGGAAAAAAAGTTTTAATTAATTTTTTTGTTGGCACTGATGATAAGAACTCTACCTACCATATAATTCATTTTGACCAACCTCGACTTGGCCTCCCTTCCAGAGACTACTATGAATGCACTGGAATATATGCAGAGGCTTGTAATGCATATGTGGATTTTATGATTTCTGTGGCCAAATTGATTCGTCAAGAAGAAGGATTGCCTATTGATGAAAACCAACTCTCTTTGGAAATGAAGAAAGTTATGGAATTGGAAAAAGAAATTGCCAATGCTACAACTAAATCTGAAGATCGAAATGACCCAATGCTTCTTTACAACAAAATGACTTTGGCTCAGCTCCAAAATAATTTTTCACTGGAGATCAATGGAAAGCCATTCAGTTGGTCAAATTTCACAAATGAAATCATGTCAACTGTGAATATTAATATTCCAAATGAGGAAGAGGTGGTTGTGTATGCTCCAGAATATTTAATCAAACTTAAACCCATTCTTACCAAATATTCTGCCAGAGATCTTCAAAATTTAATGTCCTGGAGGTTCATAATGGATCTTGTAAGCAGCCTCAGCCGAACCTACAAGGAGTCCAGAAATGCTTTCCGCAAGGCCCTTTATGGCACAACATCAGAAACAGCAACTTGGAGACGTTGTGCAAACTATGTCAATGGGAATATGGAAAATGCTGTGGGAAGGCTTTATGTGGAAGCAGCATTTGCTGGAGAGAGTAAACATGTGGTTGAGGATTTGATTGCGCAGATCCGGGAAGTTTTTATTCAGACTTTAGATGAACTCACCTGGATGGATGCTGAAACAAAAAAGAAAGCTGAAGAAAAGGCCTTAGCAATTAAAGAAAGGATAGGCTATCCTGATGACATTGTTTCAAATGATAACAAACTGAATAATGAATATGTCGAGCTAAACTACAAAGAAGATGAATACTTTGAGAATATAATTCAAAATTTGAAATTCAGCCAAAGTAAGCAACTAAAGAAGCTCCGAGAAAAGGTGGACAAGAATGAGTGGATAAGCGGAGCAGCCGTAGTCAATGCATTTTATTCTTCAGGCAGAAATCAGATAGTCTTCCCAGCTGGCATTCTGCAGCCCCCCTTCTTTAGTGCCCAGCAGTCAAACTCATTGAATTATGGGGGCATTGGCATGGTCATAGGACATGAAATAACCCACGGCTTCGATGACAATGGCAGGAATTTTAACAAGGATGGAGACCTGGTTGACTGGTGGACTCAACAGTCTGCAAATAACTTCAAGGACCAATCCCAATGCATGGTTTACCAATACGGGAATTTCACCTGGGACCTAGCAGGTGGACAGCATCTCAATGGAATTAATACATTGGGAGAAAACATTGCCGATAATGGTGGTCTTGGCCAAGCATATAGAGCCTATCAGAATTATATTAAAAAGAATGGTGAAGAAAAATTACTCCCTGGACTTGACCTAAATCACAAACAACTGTTCTTCTTGAACTTTGCCCAGGTGTGGTGTGGGACCTACAGGCCAGAGTATGCAGTCAACTCCATTAAAACAGATGTGCACAGTCCAGGCAATTTCAGGATTATTGGGACTTTGCAGAATTCTGCTGAGTTTTCAGAAGCCTTTAATTGCCGAAAGAATTCATATATGAATCCAGAGAAGAAGTGTCGGGTTTGGTGA

XM_004834484.1 Coding sequence

Dhx36 DEAH (Asp-Glu-Ala-His) box polypeptide 36

High confidence: 4 potential gene matches
Length: 3060 bp    Location: 31913980..31859146   Strand: -
>XM_004834484.1
ATGTGCATCTGCTTCCGGCCCCAGACGCCATTTGCAGCGGTTGCGGCTTCTCACGGGGAGTACTTTTCCCGAACAATGAGCTATGACTACCATCAGAACTGGGGCTGCGATGGCGGTTCTTGCAGCTCCAATGGTGGGTATGGAAGGGGCCACGGAGGGAGTCGAGGCCCCGGAGGCGGCGGCGGCGGAGGTGGTCGAGGTGGACGGGGCCGGCATCCCGGGCACTTGAAAGGCCGCGACATTGGCTTGTGGTACGCGAAAAAACAGACACAGAAGAACAAGGAGGCGGAGAGGAAGGAGAGAGCGGTAGTACACATGGATGAACGACGAGAAGAGCAAATTACACACCTGCTGAATTCTGTCCAAACTAAAAATGATAAAGATTCAGAAGCACAGATATCCTGGTTTGCCCCAGAGGATCATGGATACGGAACTGAAGTTTCCAATGAGAACAAATCAACCTCAGAGAAAAAACTTGACAACCAAGAAAAGAAATTGATAAACCAGGAAAAAACGAGATTGAAAATCCGGGACAGATCATATATTGATAGACATGCTGAATATCTTTTGCAAGACAATGAACCAGATGTAACCTTAGACCAACAATTATTGGAAGATTTACAGAAGAAAAAAAAAGATCTTCAGTATATTGAAATGCAGTGTTTCAGAGAAAAGCTTCCTTCATACGGAATGCAAAAGGAGTTGGTAGATTTAATTGATAAACACCAGGTAACAGTAATAAGTGGTGAAACTGGTTGTGGAAAAACCACTCAAGTTACTCAGTTCATTTTGGATAACTACATTGAAAGAGGAAAAGGATCTGTATGCAGAATAGTTTGTACTCAGCCAAGAAGAATTAGTGCCATTTCAGTTGCAGAAAGAGTGGCTGCAGAAAGGGCAGAATCTTGTGGCAATGGTAATAGTACCGGGTACCAAATTCGTCTCCAGAGTCGGTTGCCAAGAAAACAGGGTTCTATCTTATACTGCACAACAGGAATCATCCTTCAGTGGCTCCAGTCAGACCCGCATTTGTCTAGCGTTAGTCATATCATACTTGATGAAATCCATGAAAGAAATCTACAGTCAGATGTTTTAATGACTGTTACTAAAGATCTTCTCAATTCTCGCCCTGACCTGAAAGTAATATTGATGAGTGCAACATTGAATGCTGAGAAATTTTCAGAATACTTTGGTAACTGTCCAATGATACATATACCTGGTTTTACTTTTCCGGTTGTAGAATATCTTTTGGAAGATATAATTGAAAAAATAAGATATGTTCCAGAACAAAAGGAACACAGATCCCAATATAAGAGGGGTTTCATGCAAGGGCATGTAAATAGACCAGAAAAAGAAGAAAAAGAAGCAATCTATAAAGAACGTTGGCCAGATTATTTGAGGGAGCTGCGAAGACGGTATTCTGCCAGTACTATAGATGTTTTGAAAATGATGGATGATGATAAAGTCGATTTGAATTTGATTGCTGCCCTAATCCAGTACATTGTTTTAGAAGAAGAGGAGGGTGCAATACTGGTCTTTCTGCCAGGCTGGGATAATATCAGTACTTTACATGATCTTTTGATGTCACAAGTGATGTTTAAGTCAGATAAATTTATCATCATACCATTACATTCACTGATGCCTACAGTAAATCAGACACAGGTATTTAAAAGAACTCCTCCTGGTGTTCGGAAAATAGTAATTGCCACCAACATCGCAGAGACTAGCATTACCATAGATGATGTAGTTTTTGTGATAGATGGAGGAAAAATTAAAGAGACACACTTCGATACTCAGAACAACATCAGTACGATGTCTGCTGAGTGGGTTAGTAAAGCTAATGCCAAACAGAGGAAAGGTCGAGCTGGAAGAGTTCAACCTGGTCATTGCTATCATCTGTATAATGGTCTTAGAGCAAGTCTTCTAGATGACTATCAACTACCAGAAATTTTGAGAACTCCTTTGGAAGAACTTTGTTTGCAAATAAAGATTTTAAGGCTAGGTGGAATTGCTTATTTTCTGAGTAGATTAATGGATCCACCGTCAAATGAGGCTGTGTTGCTCTCCATAAGACACCTGATGGAACTGAATGCTTTGGATAAACAAGAAGAATTGACACCTCTTGGAGTCCACTTAGCACGATTACCAGTTGAACCACATATTGGGAAAATGATTCTTTTTGGAGCTCTTTTCTGTTGCTTAGACCCGGTACTCACTATTGCTGCTAGTCTTAGCTTCAAAGATCCTTTTGTTATTCCATTGGGAAAAGAAAAGATTGCAGATGCAAGAAGAAAGGAATTAGCAAAGGAAACTAGAAGTGATCACCTGACAGTTGTGAATGCGTTTGAGGGATGGGAAGAAGCTAAACGACGGGGTTTCAGATATGAAAAAGACTATTGCTGGGAATATTTTCTGTCTTCAAACACACTGCAGATGCTGCATAACATGAAAGGACAGTTTGCTGAGCATCTTCTTGGAGCTGGATTTGTAAGCAGTAAAAATCCTAAAGATCCAAAAGCTAATATAAATTCAGATAATGAGAAGATAATTAAAGCTGTCATCTGTGCTGGTTTATATCCCAAAGTTGCTAAAATCCGACTGAATTTGAGTAAAAAAAGAAAAATGGTGAAAGTTCACACAAAACCAGATGGCCTGGTTTCTATTCATCCTAAGTCCGTTAATGTGGAGCAAACAGACTTTAATTACAACTGGCTTATCTATCACTTGAAGATGAGAACAAGTAGTATATACTTGTACGACTGCACAGAAGTTTCCCCATATTGTCTCTTGTTCTTTGGAGGTGATATTTCCATCCAAAAGGATAATGATCAGGAGACTATTGCTGTAGATGAATGGATTATATTTCAGTCTCCAGAAAGAATTGCCCATCTCGTTAAGAAATTAAGAAAAGAACTGGATACCCTTCTTCAAGAGAAGATCGAAAGCCCTCAGCCTGTAGACTGGAAAGAAACTAAATCCAGAGACTGTGCAGTCCTGTCAGCTATTATAGACTTGATCAAAACACAGGAAAAGGCAACTCCCAGGAACTTTCCACCATGA

XM_004834486.1 Coding sequence

Mme membrane metallo-endopeptidase, transcript variant X1

Length: 2253 bp    Location: 32602409..32689011   Strand: +
>XM_004834486.1
ATGGGAAGATCTGAAAGTCAGATGGATATAACTGATATCAACACTCCAAAGCCAAAGAAGAAACAGCGATGGACTCCTTTGGAGATCAGTCTCTCAGTCCTTGTCCTGCTCCTTACTATCATAGCTGTGACCATGATAGCTCTCTATGCAACGTACGATGATGGTATCTGCAAGTCATCAGATTGCATAAAATCAGCTGCTCGACTGATCCAGAACATGGATGCAACTATTGAGCCTTGTGCAGACTTTTTCAAATATGCCTGTGGAGGCTGGCTGAAACGCAATGTCATTCCTGAGACCAGTTCCCGTTACAGTAATTTTGACATTTTAAGAGATGAGCTAGAAGTTATTTTGAAAGATGTCCTCGAGGAACCCAAAACTGAAGATATTGTAGCAGTGCAAAAAGCAAAAACATTGTACAGATCCTGTATAAATGAATCTGTCATTGATAGTAGACGTGGACAACCTCTACTCAAACTGTTGCCAGATATATATGGGTGGCCAGTGGCCACAGAAAACTGGGAACAAATATATGGTACTTCTTGGACAGCTGAAAAATCTATGGCTCAATTGAGTTCTAAATATGGAAAAAAAGTTTTAATTAATTTTTTTGTTGGCACTGATGATAAGAACTCTACCTACCATATAATTCATTTTGACCAACCTCGACTTGGCCTCCCTTCCAGAGACTACTATGAATGCACTGGAATATATGCAGAGGCTTGTAATGCATATGTGGATTTTATGATTTCTGTGGCCAAATTGATTCGTCAAGAAGAAGGATTGCCTATTGATGAAAACCAACTCTCTTTGGAAATGAAGAAAGTTATGGAATTGGAAAAAGAAATTGCCAATGCTACAACTAAATCTGAAGATCGAAATGACCCAATGCTTCTTTACAACAAAATGACTTTGGCTCAGCTCCAAAATAATTTTTCACTGGAGATCAATGGAAAGCCATTCAGTTGGTCAAATTTCACAAATGAAATCATGTCAACTGTGAATATTAATATTCCAAATGAGGAAGAGGTGGTTGTGTATGCTCCAGAATATTTAATCAAACTTAAACCCATTCTTACCAAATATTCTGCCAGAGATCTTCAAAATTTAATGTCCTGGAGGTTCATAATGGATCTTGTAAGCAGCCTCAGCCGAACCTACAAGGAGTCCAGAAATGCTTTCCGCAAGGCCCTTTATGGCACAACATCAGAAACAGCAACTTGGAGACGTTGTGCAAACTATGTCAATGGGAATATGGAAAATGCTGTGGGAAGGCTTTATGTGGAAGCAGCATTTGCTGGAGAGAGTAAACATGTGGTTGAGGATTTGATTGCGCAGATCCGGGAAGTTTTTATTCAGACTTTAGATGAACTCACCTGGATGGATGCTGAAACAAAAAAGAAAGCTGAAGAAAAGGCCTTAGCAATTAAAGAAAGGATAGGCTATCCTGATGACATTGTTTCAAATGATAACAAACTGAATAATGAATATGTCGAGCTAAACTACAAAGAAGATGAATACTTTGAGAATATAATTCAAAATTTGAAATTCAGCCAAAGTAAGCAACTAAAGAAGCTCCGAGAAAAGGTGGACAAGAATGAGTGGATAAGCGGAGCAGCCGTAGTCAATGCATTTTATTCTTCAGGCAGAAATCAGATAGTCTTCCCAGCTGGCATTCTGCAGCCCCCCTTCTTTAGTGCCCAGCAGTCAAACTCATTGAATTATGGGGGCATTGGCATGGTCATAGGACATGAAATAACCCACGGCTTCGATGACAATGGCAGGAATTTTAACAAGGATGGAGACCTGGTTGACTGGTGGACTCAACAGTCTGCAAATAACTTCAAGGACCAATCCCAATGCATGGTTTACCAATACGGGAATTTCACCTGGGACCTAGCAGGTGGACAGCATCTCAATGGAATTAATACATTGGGAGAAAACATTGCCGATAATGGTGGTCTTGGCCAAGCATATAGAGCCTATCAGAATTATATTAAAAAGAATGGTGAAGAAAAATTACTCCCTGGACTTGACCTAAATCACAAACAACTGTTCTTCTTGAACTTTGCCCAGGTGTGGTGTGGGACCTACAGGCCAGAGTATGCAGTCAACTCCATTAAAACAGATGTGCACAGTCCAGGCAATTTCAGGATTATTGGGACTTTGCAGAATTCTGCTGAGTTTTCAGAAGCCTTTAATTGCCGAAAGAATTCATATATGAATCCAGAGAAGAAGTGTCGGGTTTGGTGA

XM_004834488.1 Coding sequence

Mme membrane metallo-endopeptidase, transcript variant X3

Length: 2253 bp    Location: 32606497..32689011   Strand: +
>XM_004834488.1
ATGGGAAGATCTGAAAGTCAGATGGATATAACTGATATCAACACTCCAAAGCCAAAGAAGAAACAGCGATGGACTCCTTTGGAGATCAGTCTCTCAGTCCTTGTCCTGCTCCTTACTATCATAGCTGTGACCATGATAGCTCTCTATGCAACGTACGATGATGGTATCTGCAAGTCATCAGATTGCATAAAATCAGCTGCTCGACTGATCCAGAACATGGATGCAACTATTGAGCCTTGTGCAGACTTTTTCAAATATGCCTGTGGAGGCTGGCTGAAACGCAATGTCATTCCTGAGACCAGTTCCCGTTACAGTAATTTTGACATTTTAAGAGATGAGCTAGAAGTTATTTTGAAAGATGTCCTCGAGGAACCCAAAACTGAAGATATTGTAGCAGTGCAAAAAGCAAAAACATTGTACAGATCCTGTATAAATGAATCTGTCATTGATAGTAGACGTGGACAACCTCTACTCAAACTGTTGCCAGATATATATGGGTGGCCAGTGGCCACAGAAAACTGGGAACAAATATATGGTACTTCTTGGACAGCTGAAAAATCTATGGCTCAATTGAGTTCTAAATATGGAAAAAAAGTTTTAATTAATTTTTTTGTTGGCACTGATGATAAGAACTCTACCTACCATATAATTCATTTTGACCAACCTCGACTTGGCCTCCCTTCCAGAGACTACTATGAATGCACTGGAATATATGCAGAGGCTTGTAATGCATATGTGGATTTTATGATTTCTGTGGCCAAATTGATTCGTCAAGAAGAAGGATTGCCTATTGATGAAAACCAACTCTCTTTGGAAATGAAGAAAGTTATGGAATTGGAAAAAGAAATTGCCAATGCTACAACTAAATCTGAAGATCGAAATGACCCAATGCTTCTTTACAACAAAATGACTTTGGCTCAGCTCCAAAATAATTTTTCACTGGAGATCAATGGAAAGCCATTCAGTTGGTCAAATTTCACAAATGAAATCATGTCAACTGTGAATATTAATATTCCAAATGAGGAAGAGGTGGTTGTGTATGCTCCAGAATATTTAATCAAACTTAAACCCATTCTTACCAAATATTCTGCCAGAGATCTTCAAAATTTAATGTCCTGGAGGTTCATAATGGATCTTGTAAGCAGCCTCAGCCGAACCTACAAGGAGTCCAGAAATGCTTTCCGCAAGGCCCTTTATGGCACAACATCAGAAACAGCAACTTGGAGACGTTGTGCAAACTATGTCAATGGGAATATGGAAAATGCTGTGGGAAGGCTTTATGTGGAAGCAGCATTTGCTGGAGAGAGTAAACATGTGGTTGAGGATTTGATTGCGCAGATCCGGGAAGTTTTTATTCAGACTTTAGATGAACTCACCTGGATGGATGCTGAAACAAAAAAGAAAGCTGAAGAAAAGGCCTTAGCAATTAAAGAAAGGATAGGCTATCCTGATGACATTGTTTCAAATGATAACAAACTGAATAATGAATATGTCGAGCTAAACTACAAAGAAGATGAATACTTTGAGAATATAATTCAAAATTTGAAATTCAGCCAAAGTAAGCAACTAAAGAAGCTCCGAGAAAAGGTGGACAAGAATGAGTGGATAAGCGGAGCAGCCGTAGTCAATGCATTTTATTCTTCAGGCAGAAATCAGATAGTCTTCCCAGCTGGCATTCTGCAGCCCCCCTTCTTTAGTGCCCAGCAGTCAAACTCATTGAATTATGGGGGCATTGGCATGGTCATAGGACATGAAATAACCCACGGCTTCGATGACAATGGCAGGAATTTTAACAAGGATGGAGACCTGGTTGACTGGTGGACTCAACAGTCTGCAAATAACTTCAAGGACCAATCCCAATGCATGGTTTACCAATACGGGAATTTCACCTGGGACCTAGCAGGTGGACAGCATCTCAATGGAATTAATACATTGGGAGAAAACATTGCCGATAATGGTGGTCTTGGCCAAGCATATAGAGCCTATCAGAATTATATTAAAAAGAATGGTGAAGAAAAATTACTCCCTGGACTTGACCTAAATCACAAACAACTGTTCTTCTTGAACTTTGCCCAGGTGTGGTGTGGGACCTACAGGCCAGAGTATGCAGTCAACTCCATTAAAACAGATGTGCACAGTCCAGGCAATTTCAGGATTATTGGGACTTTGCAGAATTCTGCTGAGTTTTCAGAAGCCTTTAATTGCCGAAAGAATTCATATATGAATCCAGAGAAGAAGTGTCGGGTTTGGTGA

XM_004834497.1 Coding sequence

Slc33a1 solute carrier family 33 (acetyl-CoA transporter), member 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1650 bp    Location: 33443146..33424654   Strand: -
>XM_004834497.1
ATGTCGCCCACCATCTCTCACAAGGACAGCAGTCGGCAACGGCGGCCGGGGACTTTCAACCATTCCCTGGATATGAAGACCGGTCCTCTGCCGCCCGGCAGCTGGGATGACAGTCAGCCGGACTCGGTGGGCGGGGAAGAGGACAGAGAAGCTCTTCTGAGGGATGCTGACCCTGGTGACTTCTTGAAAGCCCCGCGGAGCTGTCGAGCCGAAATAAGCAGCATTTTGCTACTGCTCTTTCTTTACGTGCTCCAGGGCATCCCCTTAGGCCTGGCGGGAAGCATCCCACTTATTTTGCAGAGCAAAAATGTTAGCTATACAGACCAAGCTTTCTTCAGTTTTGTCTTTTGGCCCTTCAGTCTCAAATTGCTCTGGGCCCCTTTGGTTGATGCAGTTTACTTCAAGAACTTTGGTCGTCGAAAATCCTGGCTTGTCCCTACACAGTATGTACTAGGACTCTTCATGATATTTTTATCCACTCAAGTGGATCATTTGCTCGGGAATGCCGATGGCAGAACACCTGATGTAGTTGCCCTTACTGTGACATTCTTTTTATTTGAATTCCTAGCCGCAACTCAGGACATCGCTGTGGATGGTTGGGCGTTAACTATGTTATCCCGGGAAAACGTGGGTTATGCTTCCACTTGCAATTCAGTGGGCCAAACAGCAGGCTACTTTTTGGGCAATGTTTTGTTTTTGGCTCTTGAATCTCCCGACTTTTGTAACAAATATTTGCGGTTTCAACCTCAACCCAAGGGAATCGTTACTCTTTCAGATTTTCTTTTTTTCTGGGGAACTGTATTTTTAATAACAACAACTTTAGTCGCCCTTCTGAAAAAAGAAAACAAAGAAGTATCAGTAAAAGAAGAAACACAAGGGATCACAGATACTTATAAGCTGCTTTTTACAATTATAAAAATGCCAGCAGTTCTGACATTTTGCCTTCTGATTCTAACGTCAAAGATTGGTTTTTCAGCAGCAGATGCAGTAACAGGACTGAAATTGGTAGAAGAGGGAGTACCTAAAGAACATTTAGCTTTACTGGCAGTTCCAATGGTTCCTTTGCAGATAATACTGCCTCTGATTATCAGCAAATATACTGCAGGTCCCCAGCCACTAAACATATTTTACAAAGCCATGCCCTACAGATTGTTGTTTGGATTAGAATATGCCCTGCTAGTTTGGTGGACTCCTAAAGTAGAGCACCAAGGAGGATTCCCTATATATTACTATATTGTAGTGCTGCTGAGTTATGCCTTACATCAGGTTACGTTATACAGCATGTATGTTTCCATAATGGCTTTCAATGCAAAGGTTAGTGATCCACTTATTGGAGGAACATATATGACTCTTTTAAATACTGTGTCCAATCTGGGAGGAAACTGGCCATCTACAGTTGCTCTTTGGCTGGTGGATCCCCTCACAGTGAAAGAGTGTGTAGGGGCATCAAACCAGAATTGTCGATCAATTGATGCTATTGAGCTTTGCAAAAAACTTGGTGGCTCTTGTGTTACAGCACTGGATGGTTATTATGTGGAATCGATTATTTGTGTTTTTATTGGATTTTGTTGGTGGTTCTTTCTTGGACCAAAATTTAAAAAGTTACAGGATGAAGGACCATCTTCGTGGAAGTGCAAAAGGAGCAATTAA

XM_004834496.1 Coding sequence

Slc33a1 solute carrier family 33 (acetyl-CoA transporter), member 1, transcript variant X1

Length: 1650 bp    Location: 33443145..33425676   Strand: -
>XM_004834496.1
ATGTCGCCCACCATCTCTCACAAGGACAGCAGTCGGCAACGGCGGCCGGGGACTTTCAACCATTCCCTGGATATGAAGACCGGTCCTCTGCCGCCCGGCAGCTGGGATGACAGTCAGCCGGACTCGGTGGGCGGGGAAGAGGACAGAGAAGCTCTTCTGAGGGATGCTGACCCTGGTGACTTCTTGAAAGCCCCGCGGAGCTGTCGAGCCGAAATAAGCAGCATTTTGCTACTGCTCTTTCTTTACGTGCTCCAGGGCATCCCCTTAGGCCTGGCGGGAAGCATCCCACTTATTTTGCAGAGCAAAAATGTTAGCTATACAGACCAAGCTTTCTTCAGTTTTGTCTTTTGGCCCTTCAGTCTCAAATTGCTCTGGGCCCCTTTGGTTGATGCAGTTTACTTCAAGAACTTTGGTCGTCGAAAATCCTGGCTTGTCCCTACACAGTATGTACTAGGACTCTTCATGATATTTTTATCCACTCAAGTGGATCATTTGCTCGGGAATGCCGATGGCAGAACACCTGATGTAGTTGCCCTTACTGTGACATTCTTTTTATTTGAATTCCTAGCCGCAACTCAGGACATCGCTGTGGATGGTTGGGCGTTAACTATGTTATCCCGGGAAAACGTGGGTTATGCTTCCACTTGCAATTCAGTGGGCCAAACAGCAGGCTACTTTTTGGGCAATGTTTTGTTTTTGGCTCTTGAATCTCCCGACTTTTGTAACAAATATTTGCGGTTTCAACCTCAACCCAAGGGAATCGTTACTCTTTCAGATTTTCTTTTTTTCTGGGGAACTGTATTTTTAATAACAACAACTTTAGTCGCCCTTCTGAAAAAAGAAAACAAAGAAGTATCAGTAAAAGAAGAAACACAAGGGATCACAGATACTTATAAGCTGCTTTTTACAATTATAAAAATGCCAGCAGTTCTGACATTTTGCCTTCTGATTCTAACGTCAAAGATTGGTTTTTCAGCAGCAGATGCAGTAACAGGACTGAAATTGGTAGAAGAGGGAGTACCTAAAGAACATTTAGCTTTACTGGCAGTTCCAATGGTTCCTTTGCAGATAATACTGCCTCTGATTATCAGCAAATATACTGCAGGTCCCCAGCCACTAAACATATTTTACAAAGCCATGCCCTACAGATTGTTGTTTGGATTAGAATATGCCCTGCTAGTTTGGTGGACTCCTAAAGTAGAGCACCAAGGAGGATTCCCTATATATTACTATATTGTAGTGCTGCTGAGTTATGCCTTACATCAGGTTACGTTATACAGCATGTATGTTTCCATAATGGCTTTCAATGCAAAGGTTAGTGATCCACTTATTGGAGGAACATATATGACTCTTTTAAATACTGTGTCCAATCTGGGAGGAAACTGGCCATCTACAGTTGCTCTTTGGCTGGTGGATCCCCTCACAGTGAAAGAGTGTGTAGGGGCATCAAACCAGAATTGTCGATCAATTGATGCTATTGAGCTTTGCAAAAAACTTGGTGGCTCTTGTGTTACAGCACTGGATGGTTATTATGTGGAATCGATTATTTGTGTTTTTATTGGATTTTGTTGGTGGTTCTTTCTTGGACCAAAATTTAAAAAGTTACAGGATGAAGGACCATCTTCGTGGAAGTGCAAAAGGAGCAATTAA

XM_004834498.1 Coding sequence

Gmps guanine monphosphate synthetase

High confidence: 3 potential gene matches
Length: 2082 bp    Location: 33460571..33535593   Strand: +
>XM_004834498.1
ATGGCTCTGTGCAACGGAGACTCCAAGCTGGAGAATGCTGGAGGAGACCTTAAGGATGGCCGCCAACACTATGAAGAAGCTGTTGTCATTTTGGATGCTGGTGCTCAGTACGGGAAAGTCATAGACCGAAGAGTGAGGGAACTATTTGTGCAATCTGAAATCTTCCCCCTGGAAACGCCAGCATTTGCCATAAAAGAACAAGGATTCCGTGCTATTATCATCTCTGGAGGACCTAATTCTGTGTATGCGGAAGATGCTCCCTGGTTTGATCCAGCAATATTCACTATTGGCAAGCCTATCCTTGGGATTTGCTATGGCATGCAGATGATGAATAAGGTATTTGGAGGTACTGTGCACAAAAAAAGTGTTAGAGAAGATGGAGTCTTCAACATCAGTGTGGATAATACATGTTCATTATTCAGGGGCCTTCAGAAGGAAGAAATTGTTTTGCTTACACATGGAGATAGTGTAGACAAAGTAGCTGATGGATTCAAGGTTGTGGCACGTTCTGGGAACATTGTGGCAGGTATAGCAAATGAATCTAAAAAGTTGTATGGAGTACAGTTCCACCCAGAAGTTGGCCTTACAGAAAATGGAAAAGTAATACTGAAGAATTTCCTTTATGATATAGCTGGGTGCACTGGGACTTTTACAGTGCAGAACAGAGAGCTTGAATGCATTCGAGAGATCAAAGAGCAAGTAGGCACATCAAAAGTTTTGGTTTTACTCAGTGGTGGTGTAGACTCAACAGTTTGTACGGCTTTGCTAAATCGTGCTTTGAATCAAGATCAAGTCATTGCTGTGCACATTGATAATGGCTTTATGAGAAAACGGGAAAGCCAGTCTGTTGAAGAAGCACTCAAAAAGCTTGGAATTCAGGTTAAAGTGATAAATGCTGCTCATTCCTTCTATAATGGAACAACTACTTTACCAATATCAGATGAAGACAGAACCCCACGAAAAAGAATTAGCAAAACATTAAATATGACTACAAGTCCTGAAGAGAAAAGAAAAATCATTGGTGATACTTTTGTTAAGATTGCCAATGAAGTAATTGGAGAAATGAATCTGAAACCAGATGAGGTTTTCCTTGCCCAAGGTACTTTACGGCCTGATCTAATTGAAAGTGCATCCCTTGTTGCAAGTGGCAAAGCTGAACTCATTAAAACTCATCACAATGACACAGAACTTATCAGAAAGTTGAGAGAAGAGGGAAAAGTAATAGAACCACTGAAAGATTTTCATAAAGATGAAGTGAGAATTTTAGGCAGAGAACTTGGCCTTCCTGAAGAATTAGTTTCCAGGCATCCATTTCCAGGTCCTGGCTTGGCTATCAGAGTAATATGTGCTGAGGAACCTTATATTTGTAAGGACTTTCCTGAAACCAATAATATTTTGAAAATAGTGGCTGATTTTTCTGCAAGTGTTAAGAAGCCTCATACATTATTACAAAGAGTCAAAGCCTGCACCACAGAAGAGGATCAGGAGAAGCTGATGCAGATTACGAGTCTCCATTCACTGAATGCTTTCTTGCTGCCGATCAAAACTGTAGGTGTGCAGGGTGACTGTCGTTCCTACAGTTATGTTTGTGGGATCTCCAGTAAAGATGAGCCTGACTGGGAGTCTCTTGTTTTCCTTGCTAGGCTTATACCGAGGATGTGTCACAATATTAACAGAGTTGTCTATATCTTTGGCCCACCGGTTAAAGAACCTCCTACAGATGTTACTCCCACTTTCTTGACAACAGGGGTGCTTAGTACTTTACGCCAAGCTGATTTTGAGGCCCATAACATTCTCAGGGAGTCTGGGTTTGCTGGGAAAATAAGCCAAATGCCAGTGATTTTGACACCATTACATTTTGATCGGGACCCACTTCAGAAGCAGCCTTCATGCCAGAGATCTGTGGTTATTCGAACCTTTATTACTAGTGACTTCATGACTGGTATACCCGCAACACCTGGTAATGAGATCCCTGTGGAGGTGGTGTTAAAGATGGTCACTGAGATTAAGAAGATTCCTGGTATTTCTCGAATTATGTATGACTTAACATCAAAGCCCCCAGGAACTACTGAGTGGGAGTAA

XM_004834499.1 Coding sequence

LOC101720103 vomeronasal type-2 receptor 1-like

Length: 2742 bp    Location: 33612842..33641257   Strand: +
>XM_004834499.1
ATGGCCAACAGAAAGAAATGTTTGGTTATAGGATTTCTTGTATTTTTATGGACTGACTTAGACGCTCAAGTTGAAGAAAAGAAAGAAGAACAGACCTGCAGGTTGCTGGGCAAGTTTGATTTGAATGGCTATGTAGATGCCAAAAACCATACAATTGTTATTGGAGGACTGTTTCCTATACACTCCAGGACTATCCCAGCAAATGAGTCTATTTTGGAGCCAGTATCAGCAAAATGTGAAGGGTTTAACTTTCGAGGATTCCGCTGGATGAAAACCATGATTCACACGATCAGAGAAATTAATGAGAGGAAGGATATTTTGCCCAATACAACTCTGGGCTATCAGATCTTTGATACCTGTTTCACCATCTCCAAAGCAATGGAGTCAGCTTTGGTTTTCCTTACAGGGCAGGAAGAAAACAAACCCAATATTAGAAATAGTACTGGAGCGTATCTGGCAGGAATTATTGGATCAGGTGGATCGTCCTTATCAATTGCTGCTTCAAGAATTCTAGGGTTGTATTATTTACCTCAGGTGGGCTACTTCTCTACTTGTTCAAGTCTTAGTGACAAATTCCAGTTTCCATCTTATATTCGCACAATAGCCAGTGATAAGTACCAGTCCAGAGCCATGGTACAACTTATCCAACACTTTGGTTGGGTCTGGGTAGGCGCTATTGCAGCTGATGATGATTATGGTAAATATGGAGTAAAAGCTTTTAAAGAACACATGGAGGAGGTTAATCTCTGTATTGCATTCTCTGAAACCATACCCAAAGTCTATTCCAATGAGAAAATGCAAAAAGCTGTTAAAGCTATAAGGAGTTCTACCGCCAGAGTCATTGTGCTTTATGCATCTGATATTGACCTCAGTCCTTTTGTGCTAGAAATGGTTTACCATAACATAACTGACAGAACATGGATCGCGAGTGAAGCATGGATTACCTCAGCCCTCATTGCAAAGCCTGAATATTTCCCATATTTTGGAGGAAGTATTGGATTTGCAATACCAAGAACTGATATACCAGGATTAAAAGAATTTCTTTATGATGTCCATCCTAGCAAGGATCCAAATGATGTCCTGACCATTGAATTCTGGCAAACTGCATTTAACTGTACTTGGCCAAATAGTAGTGTTCCCTACAATGTTGACCACAGAGTGAATATGACTGGTAAAGAAGACAGATTATATGCCATGTCTGATAAATTCTGTACTGGAGAGGAGAAGTTGGAAGACCTTAACAATACCTATTTGGATGTGTCTCAGCTCAGAATTACAAACAATGTCAAACAAGCTGTGTATGCTATGGCTCATGCCCTGGATCAACTAAGTAGATGTGAAGAGAGAAGGGGGCCATTCTCACCGGACTCGAGTTGTGCATATTTACCTGACTTTGAGCCTTGGCAATTAATGTACTATATGAAGATGGTTAGATTTGAAACCCATGATGGAAAGATAATAAAATTTGATAGTAATGGAGACATGTTTGGACACTACGATATTCTAAACTGGCAACTAGATGATAATGGAGAAGTTGCCTTTGTGAAGATTGGAGAATATAAATTTAAACCAAATAAGATTGAACTTGTTTTGGAAAAGAATTCGACGATATTTTGGAACACCGAATCATCAGGGCTTCCCCACTCAGTGTGTACTGATGTGTGTCCTCCCGGAACGCGGAAGGGGATTCGTCAGGGGGAACCAATATGCTGCTTTGATTGTATCCCATGTGCTGATGGACATGTATCAGAGAGAGCAGGTCAAAGGGAGTGTGACCAATGTGGTGAAGACTATTGGTCAAATGAGCAAAAGAGCATGTGTGTGCTGAAAGAGGTGGAATTCCTGGCTTATGATGAGGCTCTGGGATTCACCCTGCTTATTCTCTCCATCTTTGGGGCCCTTGTGATCTTGGCAGTCATGATTGTGTATGTGATATACAGGCAAACTCCTCTGGTGAATGCCAATGACCGGGAGCTGAGCTTTCTCATTCAGGTTTCTCTTATCATCACTGTGCTGTCATCTATTCTCTTCATTGACAAGCCGTACAACTGGTCCTGCATGGCCCGCCAGGTCACGCTGGCCCTGGGCTTTTCTCTGTGTTTATCTTCCACTCTTGGAAAGACTATATCATTGTTTTTTGCCTACAGAATTTCCATATCCAAAACCCGATTCACATCCATGCACCCCCTTTTTCGAAAAATCATTGTTTTGGTCTCTGTTGTAGTTGAGGTTGGCATATGCATAGCCTACTTGGTATTACAACCCCCACGGGTATACAAGAACATGGAATCTCAAAATATAAAGATCATTTTGGAGTGCAATGAAGGTTCTATAGAATTTTTGTGCTCCTTGTTTGGGATTGATGCCTTCCTGGCCTTTCTATGCTTCCTTACAACTTTTGTGGCTCGTCAGTTGCCAGATAATTATTACGAAGGAAAATGCATCACTTTTGGGATGCTGGTTTTCTTTATTGTCTGGATTTCTTTTGTCCCTGCTTACTTGAGCACCAAAGGCAAATTCAAAGTGGCTGTGGAAATATTTGCAATCTTGGCATCCAGCTATGGTTTGTTAGGTTGCATATTTGCTCCCAAGTGTTTCATTATTTTGCTGAGGCCGAAGAGGAATACTGATGAAACTGTTGGTGGGAGAGTCCCCACTGTAGATAGGAGCATGCAGCTAACTTCAGCATCAGTGAGCAGTGAGCTTAACAATACCACAGTGTCAACTGTTCTGGATGAATAG

XM_004834500.1 Coding sequence

Kcnab1 potassium voltage-gated channel, shaker-related subfamily, beta member 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1497 bp    Location: 33701390..34141393   Strand: +
>XM_004834500.1
ATGTTCCAAGACATCACTGGTGGTGGCTGCTTTACCCCTGCATCCGAGACGCCGGAGATACCCTTTCATTTGGAGCAGCCCCGGCTCAGTTACAGCTCTGGGTGGCAGGATAAGGTGAAGGGAGAGCCGGAGCATGGGGGCGGGGAAGAGGAGAGAAGCAGAAGCAGAAAAATCAATTCCAATTGCTTTGATGACAGTGACTTAGTCTTCTCTGAAAGACAGGTAGGAACGTCCAGGATGCTGGCAGCACGGACAGGGGCAGCGGGGAGTCAGATCTCAGAAGAGAACTCCAAGTTAAGGAAGCAGTCTGCATGTTCAGTAGGGGGGAGAGACAAATCTCCCAAGAAAGCCTCAGAAAATGTTAAAGACAGCAGCCTCAGCCCCTCAGGGCAAAGCCAGCTGAGGGCAAGGCAGCTGGCTCTGCTGCGCGAAGTGGAGATGAACTGGTACCTACAGCTCTGCGACCTGTCCGCCGAGCGCACCACCGCCTACACGACGGGCATGCCGCACAGGAATCTTGGAAAATCAGGACTCAGAGTTTCATGCTTGGGTCTTGGAACATGGGTGACATTTGGAGGTCAAATTTCAGATGAGGTTGCTGAACGGCTGATGACCATTGCCTATGAAAGTGGCGTTAACCTCTTTGATACTGCCGAGGTCTATGCAGCTGGAAAGGCTGAGGTGATTCTGGGGAGTATCATCAAGAAGAAAGGCTGGAGGAGATCCAGCCTCGTCATAACAACTAAGCTCTACTGGGGTGGAAAAGCTGAAACAGAAAGAGGGTTGTCAAGAAAGCATATTATTGAAGGACTGAAGGGCTCCCTCCAGAGGCTGCAGCTGGAGTATGTGGATGTGGTCTTTGCAAATCGTCCAGACAGCAACACCCCCATGGAAGAAATTGTTCGAGCCATGACACATGTGATAAACCAAGGCATGGCGATGTACTGGGGCACCTCAAGGTGGAGCGCTATGGAGATCATGGAAGCCTATTCTGTAGCAAGACAGTTCAATATGATCCCTCCGGTCTGTGAACAAGCTGAGTACCATCTTTTCCAGAGAGAGAAGGTGGAGGTCCAGCTGCCTGAGCTCTACCATAAAATAGGGGTTGGCGCAATGACATGGTCTCCACTTGCCTGTGGAATCATCTCAGGAAAATATGGAAATGGGGTGCCTGAAAGCTCCAGGGCTTCGCTGAAGTGCTACCAGTGGTTGAAAGAAAGAATTGTAAGTGAAGAAGGGAGAAAACAGCAAAACAAGCTAAAAGACCTTTCTCCAATTGCTGAGCGTCTAGGATGCACACTACCTCAGCTAGCTGTTGCCTGGTGCCTGAGAAATGAAGGCGTGAGTTCTGTACTCCTGGGATCATCCACTCCCGAGCAACTCATTGAAAACCTCGGTGCCATTCAGGTTCTCCCAAAGATGACATCACATGTGGTAAATGAGATTGATAACATATTGAGAAACAAGCCCTACAGCAAAAAGGACTATAGATCATAA

XM_004834502.1 Coding sequence

Kcnab1 potassium voltage-gated channel, shaker-related subfamily, beta member 1, transcript variant X3

Length: 1206 bp    Location: 33875878..34141388   Strand: +
>XM_004834502.1
ATGCAAGTCTCCATAGCCTGCACTGAGCACAATTTGAAGAGTCGGAATGGTGAGGACCGACTTCTGAGCAAGCAGAGCTCCACCGCCCCCAATGTGGTGAACGCAGCCCGGGCCAAATTCCGTACGGTCGCTATCATCGCGCGCAGCCTGGGGACGTTCACCCCCCAGCATCACATTTCTCTCAAAGAGTCCACCGCAAAGCAGACTGGCATGAAATATAGGAATCTTGGAAAATCAGGACTCAGAGTTTCATGCTTGGGTCTTGGAACATGGGTGACATTTGGAGGTCAAATTTCAGATGAGGTTGCTGAACGGCTGATGACCATTGCCTATGAAAGTGGCGTTAACCTCTTTGATACTGCCGAGGTCTATGCAGCTGGAAAGGCTGAGGTGATTCTGGGGAGTATCATCAAGAAGAAAGGCTGGAGGAGATCCAGCCTCGTCATAACAACTAAGCTCTACTGGGGTGGAAAAGCTGAAACAGAAAGAGGGTTGTCAAGAAAGCATATTATTGAAGGACTGAAGGGCTCCCTCCAGAGGCTGCAGCTGGAGTATGTGGATGTGGTCTTTGCAAATCGTCCAGACAGCAACACCCCCATGGAAGAAATTGTTCGAGCCATGACACATGTGATAAACCAAGGCATGGCGATGTACTGGGGCACCTCAAGGTGGAGCGCTATGGAGATCATGGAAGCCTATTCTGTAGCAAGACAGTTCAATATGATCCCTCCGGTCTGTGAACAAGCTGAGTACCATCTTTTCCAGAGAGAGAAGGTGGAGGTCCAGCTGCCTGAGCTCTACCATAAAATAGGGGTTGGCGCAATGACATGGTCTCCACTTGCCTGTGGAATCATCTCAGGAAAATATGGAAATGGGGTGCCTGAAAGCTCCAGGGCTTCGCTGAAGTGCTACCAGTGGTTGAAAGAAAGAATTGTAAGTGAAGAAGGGAGAAAACAGCAAAACAAGCTAAAAGACCTTTCTCCAATTGCTGAGCGTCTAGGATGCACACTACCTCAGCTAGCTGTTGCCTGGTGCCTGAGAAATGAAGGCGTGAGTTCTGTACTCCTGGGATCATCCACTCCCGAGCAACTCATTGAAAACCTCGGTGCCATTCAGGTTCTCCCAAAGATGACATCACATGTGGTAAATGAGATTGATAACATATTGAGAAACAAGCCCTACAGCAAAAAGGACTATAGATCATAA

XM_004835163.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 2367 bp    Location: 34408442..34641002   Strand: +
>XM_004835163.1
ATGACCCGACGTGACTCTGGTTCGAGGAAGGGAATCGGAAGTGAACAATCAAGGATGTTTCTGCATTCAAAAAAGAAAGAAATCTTTCTCGTGATCGTGTTAGAGAGCAGGTTCACAAACACCTACATCATTTTGCTTCAAGGCTCTCTCAATATATTTTGGGAAATTACGGATCGTCACATTCCCATGCATGCTTTACCTGAAGAAATCCAAAAGATGTCTCCTGAAGAAAAAGTTTGTAACTACTGTGGAGTCAGCTATCTAATTCTTCATGAATTTAAAGCTATGGAAGAAAAAGTGAAAGCAACGGAAAAAGAGATGACATTTTATCAAGGAATTATAGAACTTGAAAAGAGGCTTCAAGAAGAGCTACAGTCTCTTAGCCAAGATTTTGAACAGTGCAAAATTGACAATCCAGAGAAGAAAGCCCAAATTTGGGATGCAAGCATGCAGTTAAAAAATCAAGAAAATGAGTTCCAGNAATTACAAAAAGAACTGGGTTGTTTGCAACATGAATTAAAAATTAAACACAGAAAATCACAAATTTGCAATGAAAGATTGTTGGAGTTCAACAATTTCTGGAATAAGACTCTTTCATTCCTTTCTTTTACTAAAAAGGAGCTAACTACTATTAAAAATGAAATATATAATAATTTTCAAGACTGGACTTCACTGAAAGGAGAAGTTTTTCTACAAATTAAATGTATAAGTGAAATAGCTTTGACAGAAATCAACACATTAAATAAAAGTTTGACAGTGTACCAGAGAAATAAGGCATGCCTTGAAGAGGAAATGAAAACTCTCAGATTCTTGTCAGATGCAGCCATATTAAAATCTCAGCAGACTGAGGCATCCAAACAACAGAAAGTAAACTTGCAAGCCAGGTGCTATGATTTACAAAAAGAAGTACTAGGTTTACAATGTCAAGTAGAGGCACTTGTGTTAAAACTCCAGAAGACAGTGACTGAACTGGACAAGTATAAAGAAATGCTCAAGATTAAAACTAATGAAGCTGATGACTGTCAAAAAGAACTTAGAAAANCTAAGTTTGAATCCATTATTGCTGAGTCACGGCACACTAGGTTGCTTAAAGAGAAAGAAGACTCTTTAATGACTTGTCAACAAATATATAAAACTTTACAGGAAGAGCTGTTTATGAAAGAAAGGCAAGAAGAAGACACAAAAAGAATTCACCTTGCCGAAAACGAACTGCAGATATCCAAAACTCTTCTGAATCAGACAAAGGAAGAAGTTGTAACACTGAAAAATGAAAGGGAATTGATGCTGATTTCACATCAGAAAAGCACTGAGAAGCTGCAGGAATCCCTGAGACAGAAGCTGCTGAGTGATGCTAACTGGAGGGAGGAGATTGAAGCTGAACTTTCCAAGGAAAGAGCTTGATATTTAGTTGAATTTGAAGAGCAAGCTCTTCTCTTTAAGAAAGAAGCAAAACTGGAACTTGATATTGAAAAAGAAAAACACCAAGAAATAATCCAAAAATATAAGAAAGAACAAGAAGAACTACAAATGAAGATATCTGACCTAATCACAGGTGCTACAAGAGACCTAAGGCTGGAAGTGACTGCTCTTGAGGAAAAACTCCACGAACCCCATATTCGATACACTGAAGAATCTGCGTCAAAGAAAACAGAAATTGAAAACCTTAAAAATTTAGTTGTAGAATTTGAATCTCGCTTGAAGAAGGAATTTAACAACAATGATTCAGTTTCTCAAGACNNGAGGAAGGAAATGAAACAGAAGTCAGATGAGCTGTAAAGAGTAACGCTAGTGCAAACACAACTGATACAGCGATTTAACCAGTCCCAGGAAGAGAACACTGTTCTTCAGGAAACAGTGCGCAGAGAGTGTGAAGAACGCTTTGAACTGACAGAGGCATTGATCCAAGCCAGAGAACAGCTCCTGGAGCTCAGGAAGCTCCATGGAAGCTTACCGTTGTCATCATGTCCCCACAGCAAGGGCAGCCTAACCTCTTCTGTCGCAGCCGTCGGTAATCATAGAGAGTGAAGCCCTGTAAGACTGAACTCTGAAAAAGGAATCAGAATTCCCAGCCTGCACAGAGCATCAAACCCCATCACTTCCCCAACCTCAGATAAGCCCAAGAGGACCAGCAACTCAGGTGTGCCAGTGCTCGCCGCCGCACCAAATTCTCCCAGGGGCAAGGCGTCTTCAGTAAATGAGACCAGACAGAGATTGGCTGCCGTTCTTCGGAGGAGGCTGAGTCAGCAGCGATTGATCCAGGGTCAGGAGCAGCTCCACACAGCGTGCACTTCTTTCACAGAGATTCACTGCACCCGAGGGCGACAAAGATCAAATACGTCTGTAGATATATTTAACAAAGGAATGTAA

XM_004834505.1 Coding sequence

LOC101698880 elongation factor 1-alpha 1-like

Length: 1398 bp    Location: 34559657..34558260   Strand: -
>XM_004834505.1
ATGGGAAAGGAAAAGACTCATATCAATATCATCATCATCGGACATGTGGATTCAGGCAAGTCCACCACTACCAGCCATCTGATCTACAAATGTGGTGGCATCAACAAAAGAACCATTGAAAAATTTGAGAAGGAGGTTGCTGAGATGGGGAAGGGTTCTTTCAAGTACGCCTGGGTCTTGGATAAACTGAAAGCTGAGCATGAGCGTGGTATCACCATTGACATCTCCCTGTGGAAATTTGAGACCAGCAAGTATTATGTGACTATCATTGATGCTCCAGGACACAGAGACTTTATCAAAAACATGATTACAGGCACATCTCAGGCTGATTGTGCTGTCCTGATTGTTGCTGCTGGTGTTGGTGAATTCGAAGCTGGTATCTCCAAGAACGGGCAGACCCATGAGCATGCCCTTCTGGCTTACATGCTGGGTGTGAAACAACTCATTGTTGGTGTTAACAAAATGGATTCCACTGAGCCACCCTACAGCCAGAAGAGATACAAGGAAATTGTTAAGGAAGTCAGCACCTACATTAAGAAAATTGGCTACAACCCTGACATAGTAGCTTTTGTGCCAATTTCTGGTTGGAATGGTGACAACATGCTGGAGCCAAGTGCTAACATGCCTTGCTTCAAGGGATGGAAGGTGACTCGTAAAGATGGTAATGCTAGTGGAACCACACTGCTTGAAGCTTTGGATTGCATCCTGCCACCCACTCGCCCAACTGACAAGCCTTTGCAGCTGCCCCTCCAGGATGTCTACAAAATTGGTGGTATCAGTACAGTCCCTGTGGGGAGAGTGGAGAGTGGTGTTCTCAAACCTGGCATGGTGGTCACCTTTGCACCAGTCAATGTTGCAAGTGAAGTAAAGTCTGTTGAAATGCACCATGAAGCTTTGAGTGAAGCTCTTCCTGGTGACAATGTGGGCTTCAACGTCAAGAACGTGTCTGTCAAAGATGTTCATTGTGGCAATGTTGCTGGTGACAGCAAAAATGACCCACCAATGGAAGCAGCTGGTTGCACTGCTCGGGTGATTATCCTGAACCATCCAGGCCAGATCAGTGCTGGCTATGCTCCTGTACTGGATTGCCATACAGCTCACATCGCTTGCAAGTTTACTGAGCTGAAAGCAAAGATTGATTGCCAGTCTGGTAAGCTGGAAGATGGCCCCAAATTCTTGAAATCTAGTGATGCTGACATCATTGACATGGTTCCAGGCAAGCCCATGTGTGTTGAGAGCTTCTCTGACTATCCACCTCTGGGTCGTTTTGCTGTTTGCGATATGAGACAGACAGTTGTTGTGGGTGTCATCAAAGCAGTGGACAAGAAGGCTGCTGGAGCTGGCAAAGTCACCAAGTCTGCCCAGAAAGCTCAGAAGGCTAATGAATATCACCCCTAA

XM_004834509.1 Coding sequence

Veph1 ventricular zone expressed PH domain-containing 1

High confidence: 4 potential gene matches
Length: 2364 bp    Location: 35192758..34890818   Strand: -
>XM_004834509.1
ATGCATCAACTGTTCAGACTAGTTTTGGGACAAAAAGATCTTTCACGAGCTGGGGACCTCTTCTCCTTAGATGACTCTGAGATCGAAGACAGCCTAACAGAAGCTTTGGAGCAGATTAAAATAATTAGCTCATCATCAGACTACCAAACCAATAACAATGACCAGGCTGTGGTTGAAATCTGTATCACAAGAATCACAACAGCCATCAGAGAGACAGAATCCATTGAAAAGCATGCCAAGGCCCTTGTGGGGCTCTGGGACTCCTGCTTGGAACACAACCTAAGACCCTCCGGCAAAGATGAAGATACTCCTCATGCAAAAATTGCATCCGATATCATGAGTTGCATTTTACAGAATTATAACCGGCTCCCTGTGATGGTATTAGCCATCCCCATTGCAGTGAAATTCCTCCACAGAGGCAACAAGGAACTGTGCAGGAACATGTCTAACTACCTGTCCCTGGCTGCAATTACCAACGCGGATCTCCTTGCTGACCACACAGAAGTTATAGTAAAGAGCATATTGCAAGGAAATGCCATGTTGTTAAGGGTATTACCTGCAGTGTATGAAAAGCAGCCTCAGCCAATTAACAGACACCTGATAGAACTCTTGGCCTTGATGTCTCAACTGGAACAACCAGAGCAGTCCCATCTACTACAGCTTTTGCATGTAGCAGCAAAGAGGAAACAACTGGAGGTGGTTCAGAAATGTATTCCTTTTCTAATCAGGAATTTGAAGAGTTCAACCCATCATGACATCATCCTAAACATCCTTCTAGAGATAGCTGGCTATGAGCCAGTGGCTTTGAGCAGTTTTCTTCCAATGCTGAAAGAGATTGGAGAGAGATTTCCCTATCTCATTGGACAAATGGCGAGGATCTATGGAGCTATTGGGCATGTGGATGAAGTGAGAGCCAGGAGCTGCGTGGTGTACCTGGTGAGCCAGCTGGCCAACATGGAGCATTCATTTCACCATATTCTCCTGCTAGAGATCAAGAGCATCACTGACACCTTCTCCTCCATCCTGGGTCCTCAGAGCAGGGACATCTTCCGCATGAGCAACAGCTTTACCACCATTGCCAAGCTCTTGTGTAGACAACTGGAAAATACCAAGACTGTTAATGACAGGCGAAAAATCAGCACTGATACTGGACTCCCTGAGAAACTAGAAGTCAACCTCAAGGTAGCTAAGAATGAAGACCATGAAAAGCTTCAAGTTAAAATCCAGGCTTTTGAAGACAAAATATATGCTGAAAGCTATATTCCAGGATCTATCAGGAGATATAGCTTAGACCATGTTTCTAAGGAAGAAAGAAAAAACATTAGATTTAACAGGTCAAAAAGTTTGGCTTTACACACTGTGCTCACGAAGGGTGTGAGTTCAGATGACGGAAAAGAAGAAGAGAGTGCACAAAGAGCAGTCAGCATCTCTCTTTCAGAAATAGACCCACTTAGCCATGGAAGTGACAAGTTGCCGCTTAAGACAGACACCCACGGATCGCAGCTGAAAAACTCTTCAGCTTCACACCCGAGTATTGTACACCTAGAATCAGAGAATTTTGAAGAAACTATTAAAGAAAACGTCCAGGGAGAAACTCCAGAGATAACCACAAATCCTATAGAATACCAAGATAAGCTGTACTTGCATCTGAAGGAAAACCTCAGTAAAGTGAAATCATACGCCATGGAAATCATGAAGAAAATCCCTATCCCTGACCAGTGCACCATTGAGGATACAGTGAGAAGTTGTGTAGCAAAGTTGTTCTTCACATGCTCCCTGAAGGGTCATTACTGCCTGTACAGTAAGTCCAGTTTCATTCTCATCAGCCAAGATCCCCAGCCATGGATCCAGATCATGTTTCTCTTTCAGCAGGATCTGGACCAGGTACAGCTCCATCTAGAAGAAGTGAGATTCTTTGATGTGTTTGGCTTCAGTGAAACAGCAGGAGCATGGCAGTGCTTCATGTGCAACAACCCTGAAAAAGCAACTGTTGTAAATCAAGATGGCCAGCCTCTCATAGAAGGAAAACTTAAAGAGAAGCAAGTCAGGTGGAAGTTCATCAAAAGGTGGAAAACGCGTTATTTTACATTGGCTGGAAATCAACTTTTGTTTCAAAAAGGAAAATCTAAAGACGATCCTGATGAGTCTCCAATAGAACTCAGCAAAGTACAGAGTGTGAAAGCTGTGGCCAAGAAACGCAGGGACCGCTCTCTCCCTCGGGCTTTTGAAATCTTCACAGACAATAAAACCTATGTTTTCAAGGCCAAAGATGAGAAGAATGCAGAAGAATGGCTGCAGTGCATCAACGTGGCAGTTGCCCAGGCAAAAGAGAAGGAAAGTAGAGAAGTGACCACATATCTGTAG

XM_004834518.1 Coding sequence

Rarres1 retinoic acid receptor responder (tazarotene induced) 1

Length: 870 bp    Location: 36434716..36404953   Strand: -
>XM_004834518.1
ATGCAGCCCCGTCGGCCCCAGCCGCCCGCGCCCCGGTCGAGGGCCCCACGTCCAGCCGCCCGGCTGCTCGCTCTGCAGGTGCTGCTTGCCCTCCAGGGCGCGGCGACGATGCCCTCGGGGCCAGGGCAGCCCCCGGATGCGGGGCTCTCGCGCGGGCTCCTACAGCAGGCGGCGCGCGCGGCGCTGCACTTCCTCAACTTCCGCGCCGGCTCGCCCAGCGCCCTTCGATTGCTGGCGGCTGTGCAGCAGGGCCGCGCGCGGGTCGATTCACAAAGGGGATGTAAAGTTGACCTGGTGTTTAGCACAGAGCGCTACAATCCCAAATCTTTACTTCAGGAAGGTGAGGAGCATTTGGGGAAATGTTCTGCTAATGTGTTCTTCAAGAATCAGAAACCCAGACCAGCCATTAATGTCACCTGTACAAGGCTCATGGACCAGAAGAAAAGACAACAAGATGATTACCTGCTTTACAAGCAAATGAAGAAACTGAAGAATCCCTTGGATGCGGTCAGCATACCTGATAGCCATGGATATATCGATCCCTCACTGAGACCCATCTGGGACTTGGCTTTTCTTGGCAGCTCTTACGTGATGTGGGAAAAGACGAGTCAGTTTTTACACTACTACTTGGTCCAGCTTAGTAGTGTGAAGCAGTGGAAAACTAATGATGATGTGATTGATTTTGATTATACTGTACTACTTCACGAATTCCCAACACAGGAAATCATTCCCTGTCTTATTCACCTGGTCTGGTACCCTGGAAAACCACTTAAAGTGAAGTACCGCTGTGAAGAGCTACAGACCTCAGAAGAAGCCTCTGGAACTGCAGAAGGATCAGCTATGGAACTAACACAGCTTAGTAACTTCTAA

XM_004834519.1 Coding sequence

Mfsd1 major facilitator superfamily domain containing 1, transcript variant X1

Length: 1398 bp    Location: 36502209..36525322   Strand: +
>XM_004834519.1
ATGGAGGAGGAGGGTGAGGAAGCGCGGGCGCTGCTGGCAGGCGGCCCCGATGAGGCCCGCAGCGGAGCCCCCGCCGCCTCCCAGGTGCTGTCGGCCCTCTGCGACCCCAGCCGCCTGGCGCACCGGCTTTTGGTGCTGATGCTGATGTGCTTTCTTGGCTTCGGTAGCTATTTTTGCTATGATAATCCTGCTGCCCTTCAGACTCAGATTCAACGAGACATGCAGGTGAATACCACAAAATTCATGCTGCTGTATGCTTGGTATTCTTGGCCCAATGTAGTTTTGTGTTTCTTGGGTGGATTTTTGATAGACCGAGTATTTGGAATACGATGGGGCACAATTATTTTTATCTGCTTTGTTTGCATTGGTCAGGTTATTTTTGCTCTGGGTGGAATATTTAATGCTTTTTGGCTGATGGAATTGGGAAGGTTTGTTTTTGGGATTGGTGGAGAGTCCTTAGCAGTTGCCCAGAACACGTATGCTGTGAGTTGGTTTAAAGGGAAAGAATTAAACCTGGTGTTTGGACTCCAGCTCAGCATGGCTAGAATTGGAAGTACAGTAAACATGAACCTCATGGGATGGCTGTATTCTAAGATTGAAGCTTCTTTGGGTTCTGCTGGTCCCACAACCCTTGGGGCCACACTGTTGATTGGGGGTATAACCTGTATTCTTTCACTAATCTGTGCCTTGGCTCTTGCTTACTTGGATCAGAGAGCAGAGAAAATTCTTCATAAAGAACAAGGAAAAACAGGTGAAGTTATTAAATTAACGGATATAAAAGACTTCTCCTTACCCCTCTGGCTGATATTTATCATCTGTGTTGGCTATTATGTTGTGGTGTTCCCTTTTATTGGACTTGGGAAAATTTTCTTTATAGAGAAATTTGGATTTTCTTCCCAGGCAGCAAGTGCAATTAACAGTGTTGTATATATCATATCAGCTCCCATGTCCCCAGTATTTGGGCTCTTGGTGGATAAAACAGGGAAGAACATCATCTGGGTTCTATGTGCAGTAACCACCACTCTCGTGTCCCACATGATGCTGGCCTTCACGATGTGGAACCCTTGGATTGCTATGTGTCTCCTGGGACTCTCCTATTCATTGCTTGCCTGTGCATTGTGGCCAATGGTGGCATTTTTAGTTCCTGAACATCAACTGGGAACTGCATATGGCTTCATGCAGTCCATTCAGAATCTTGGATTGGCAATCATTTCCATTATTGCTGGCATGATATTGGATACTCGGGGATATTTGTTTTTAGAAGTTTTCTTCATTGCCTGTGTTTCTGTGGCACTTTTATCTGTGGTGTTACTTTATTTGGTGAATCATGCCCAGGGTGGAAGCCTAAATTACTCTACAAGACAAAGGGAAGAAATGATGGTTTCTCATACTGAATAA

XM_004834521.1 Coding sequence

Mfsd1 major facilitator superfamily domain containing 1, transcript variant X3

Length: 1179 bp    Location: 36502625..36525322   Strand: +
>XM_004834521.1
ATGCAGGTGAATACCACAAAATTCATGCTGCTGTATGCTTGGTATTCTTGGCCCAATGTAGTTTTGTGTTTCTTGGGTGGATTTTTGATAGACCGAGTATTTGGAATACGATGGGGCACAATTATTTTTATCTGCTTTGTTTGCATTGGTCAGGTTATTTTTGCTCTGGGTGGAATATTTAATGCTTTTTGGCTGATGGAATTGGGAAGGTTTGTTTTTGGGATTGGTGGAGAGTCCTTAGCAGTTGCCCAGAACACGTATGCTGTGAGTTGGTTTAAAGGGAAAGAATTAAACCTGGTGTTTGGACTCCAGCTCAGCATGGCTAGAATTGGAAGTACAGTAAACATGAACCTCATGGGATGGCTGTATTCTAAGATTGAAGCTTCTTTGGGTTCTGCTGGTCCCACAACCCTTGGGGCCACACTGTTGATTGGGGGTATAACCTGTATTCTTTCACTAATCTGTGCCTTGGCTCTTGCTTACTTGGATCAGAGAGCAGAGAAAATTCTTCATAAAGAACAAGGAAAAACAGGTGAAGTTATTAAATTAACGGATATAAAAGACTTCTCCTTACCCCTCTGGCTGATATTTATCATCTGTGTTGGCTATTATGTTGTGGTGTTCCCTTTTATTGGACTTGGGAAAATTTTCTTTATAGAGAAATTTGGATTTTCTTCCCAGGCAGCAAGTGCAATTAACAGTGTTGTATATATCATATCAGCTCCCATGTCCCCAGTATTTGGGCTCTTGGTGGATAAAACAGGGAAGAACATCATCTGGGTTCTATGTGCAGTAACCACCACTCTCGTGTCCCACATGATGCTGGCCTTCACGATGTGGAACCCTTGGATTGCTATGTGTCTCCTGGGACTCTCCTATTCATTGCTTGCCTGTGCATTGTGGCCAATGGTGGCATTTTTAGTTCCTGAACATCAACTGGGAACTGCATATGGCTTCATGCAGTCCATTCAGAATCTTGGATTGGCAATCATTTCCATTATTGCTGGCATGATATTGGATACTCGGGGATATTTGTTTTTAGAAGTTTTCTTCATTGCCTGTGTTTCTGTGGCACTTTTATCTGTGGTGTTACTTTATTTGGTGAATCATGCCCAGGGTGGAAGCCTAAATTACTCTACAAGACAAAGGGAAGAAATGATGGTTTCTCATACTGAATAA

XM_004834522.1 Coding sequence

Schip1 schwannomin interacting protein 1, transcript variant X1

Length: 1680 bp    Location: 36830036..37687358   Strand: +
>XM_004834522.1
ATGCGTCTGGAAGAACTGAAAAGATTGCAGAATCCTTTAGAACACGTTAATGATGGGAAATATTTTCTTGAAAATCACCAGCTGGCCATGGATGTGGAGAATAATATTGCAAAATATCCCCTTAATCTACAGCCCTTGGAATCAAAGGTGAAAATCATTCAGCGAGCATGGCGTGAGTACCTGCAGCGGCATGATCCCCTGGAGAAGAGGAGCCCTTCCCCACCCTCTGTCTCCTCTGACAAGCTGAGCAGCTCCATGAGCATGAACACCTTTTCCGATAGCAGCACACCTGACTACCGAGAGGATGGGATGGATCTAGGCAGTGACGCCGGCAGTAGCAGCAGCAGCCGCGCCAGTTCGCAGTCCAACTCCACTAAAGTGACCCCTTGCTCCGAGTGCAAATCCTCGTCGTCGCCGGGGGGCAGCCTGGACTTGGTGTCTGCCCTGGAGGACTATGAGGAGCCTTTTCTGGTCTACCAGAAGAAGGAGATTGATGAATGGGCGCCGGAGGAGGACGGGGAGGAAGAGGAAGAGGAAGACGAGCGAGGGTACCGGGATGACCGGTGTCCGGCTCGGGAGCCAGGGAACGTGAGCGCCAGGACCGGGGGCGGCGGGGGCAGGAGCAGCACCACCACCACGACCATGCCGCCCCCGATGCCCAACGGCAACCTCCACCCGCAAGCCCCCCAGGACCTCAGGCACAATGGCAATGTGGTGGTGGCCGGCCGGCCGAGCGGTTCCCGGGGTCCTCGGCGAACGATCCAGAAGCCCAAGCCGGCGGGTAGCCGGCACGGCGGCCGGGGCCCGGCAGCCGGGTGGCTCTGCCTCCAACCCCCGGACGGCGGGACTTGCGTCCTAGAAGAGCCCCCAGTACCCCCTATGGACTGGGAGGCGCTGGAGAAGCATCTGGCCGGGCTGCAGTTCCGGGAGCAGGAGGTGCGAAACCAGGGCCAGGCGAGGACCAACTCCACCTCCGCACAGAAAAATGAGAGAGAGTCTATCAGACAGAAGTTGGCACTTGGAAGCTTCTTTGATGATGGCCCAGGAATTTATACCAGCTGTAGCAAAAGTGGGAAGCCAAGTCTTTCCTCTCGATTGCAGAGCGGGATGAACCTGCAGATATGCTTTGTCAATGACAGTGGCAGTGATAAGGACAGTGATGCTGATGACAGTAAGACTGAAACCAGCTTGGACACTCCCTTGTCACCCATGAGCAAACAGAGTTCTTCCTATTCTGACAGAGATACCACTGAAGAAGAGTCTGAATCCTTGGATGACATGGACTTCCTCACAAGGCAAAAGAAATTGCAAGCTGAAGCCAAGATGGCCCTTGCCATGGCCAAACCAATGGCCAAAATGCAAGTAGAAGTGGAAAAACAGAACAGGAAAAAGTCTCCCGTCGCTGATCTTCTGCCACATATGCCTCATATAAGTGAATGTTTGATGAAAAGAAGTTTAAAACCCACCGACTTGAGAGACATGACTATTGGGCAGCTACAAGTGATAGTCAATGATCTCCATTCCCAGATCGAAAGCTTGAATGAAGAGTTGGTCCAGCTGCTTCTCATCCGTGATGAGCTGCACACAGAGCAGGATGCGATGCTGGTAGACATCGAAGACTTGACCAGACATGCTGAAAGTCAGCAGAAGCACATGGCAGAGAAAATGCCTGCAAAGTGA

XM_004834523.1 Coding sequence

Schip1 schwannomin interacting protein 1, transcript variant X2

Length: 1452 bp    Location: 37052256..37687358   Strand: +
>XM_004834523.1
ATGGAGAAGTCTAAGCAACGCATGACAACGTGGGACTGTGACCAGGGCAAACAATCTAACAGTGACTACCGAGAGGATGGGATGGATCTAGGCAGTGACGCCGGCAGTAGCAGCAGCAGCCGCGCCAGTTCGCAGTCCAACTCCACTAAAGTGACCCCTTGCTCCGAGTGCAAATCCTCGTCGTCGCCGGGGGGCAGCCTGGACTTGGTGTCTGCCCTGGAGGACTATGAGGAGCCTTTTCTGGTCTACCAGAAGAAGGAGATTGATGAATGGGCGCCGGAGGAGGACGGGGAGGAAGAGGAAGAGGAAGACGAGCGAGGGTACCGGGATGACCGGTGTCCGGCTCGGGAGCCAGGGAACGTGAGCGCCAGGACCGGGGGCGGCGGGGGCAGGAGCAGCACCACCACCACGACCATGCCGCCCCCGATGCCCAACGGCAACCTCCACCCGCAAGCCCCCCAGGACCTCAGGCACAATGGCAATGTGGTGGTGGCCGGCCGGCCGAGCGGTTCCCGGGGTCCTCGGCGAACGATCCAGAAGCCCAAGCCGGCGGGTAGCCGGCACGGCGGCCGGGGCCCGGCAGCCGGGTGGCTCTGCCTCCAACCCCCGGACGGCGGGACTTGCGTCCTAGAAGAGCCCCCAGTACCCCCTATGGACTGGGAGGCGCTGGAGAAGCATCTGGCCGGGCTGCAGTTCCGGGAGCAGGAGGTGCGAAACCAGGGCCAGGCGAGGACCAACTCCACCTCCGCACAGAAAAATGAGAGAGAGTCTATCAGACAGAAGTTGGCACTTGGAAGCTTCTTTGATGATGGCCCAGGAATTTATACCAGCTGTAGCAAAAGTGGGAAGCCAAGTCTTTCCTCTCGATTGCAGAGCGGGATGAACCTGCAGATATGCTTTGTCAATGACAGTGGCAGTGATAAGGACAGTGATGCTGATGACAGTAAGACTGAAACCAGCTTGGACACTCCCTTGTCACCCATGAGCAAACAGAGTTCTTCCTATTCTGACAGAGATACCACTGAAGAAGAGTCTGAATCCTTGGATGACATGGACTTCCTCACAAGGCAAAAGAAATTGCAAGCTGAAGCCAAGATGGCCCTTGCCATGGCCAAACCAATGGCCAAAATGCAAGTAGAAGTGGAAAAACAGAACAGGAAAAAGTCTCCCGTCGCTGATCTTCTGCCACATATGCCTCATATAAGTGAATGTTTGATGAAAAGAAGTTTAAAACCCACCGACTTGAGAGACATGACTATTGGGCAGCTACAAGTGATAGTCAATGATCTCCATTCCCAGATCGAAAGCTTGAATGAAGAGTTGGTCCAGCTGCTTCTCATCCGTGATGAGCTGCACACAGAGCAGGATGCGATGCTGGTAGACATCGAAGACTTGACCAGACATGCTGAAAGTCAGCAGAAGCACATGGCAGAGAAAATGCCTGCAAAGTGA

XM_004834527.1 Coding sequence

Schip1 schwannomin interacting protein 1, transcript variant X6

Length: 783 bp    Location: 37648466..37687358   Strand: +
>XM_004834527.1
ATGAATTTGGACAGTGATGGAATGGATGACATCATCAGTCAAGAATCCCCAGTGGATATGGAAGGGAATTATAAAAAGGCACAGAAAAATGAGAGAGAGTCTATCAGACAGAAGTTGGCACTTGGAAGCTTCTTTGATGATGGCCCAGGAATTTATACCAGCTGTAGCAAAAGTGGGAAGCCAAGTCTTTCCTCTCGATTGCAGAGCGGGATGAACCTGCAGATATGCTTTGTCAATGACAGTGGCAGTGATAAGGACAGTGATGCTGATGACAGTAAGACTGAAACCAGCTTGGACACTCCCTTGTCACCCATGAGCAAACAGAGTTCTTCCTATTCTGACAGAGATACCACTGAAGAAGAGTCTGAATCCTTGGATGACATGGACTTCCTCACAAGGCAAAAGAAATTGCAAGCTGAAGCCAAGATGGCCCTTGCCATGGCCAAACCAATGGCCAAAATGCAAGTAGAAGTGGAAAAACAGAACAGGAAAAAGTCTCCCGTCGCTGATCTTCTGCCACATATGCCTCATATAAGTGAATGTTTGATGAAAAGAAGTTTAAAACCCACCGACTTGAGAGACATGACTATTGGGCAGCTACAAGTGATAGTCAATGATCTCCATTCCCAGATCGAAAGCTTGAATGAAGAGTTGGTCCAGCTGCTTCTCATCCGTGATGAGCTGCACACAGAGCAGGATGCGATGCTGGTAGACATCGAAGACTTGACCAGACATGCTGAAAGTCAGCAGAAGCACATGGCAGAGAAAATGCCTGCAAAGTGA

XM_004834529.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 759 bp    Location: 37787995..37794637   Strand: +
>XM_004834529.1
ATGTGGCCCCCTGGATCAGCTGCCAACNNCGCCGCCTCACCTGCTGCGCCCACCGGCCTGCATCCAACTGCCGCTCGGGGTCCGCACAGCCGGCTCAACATGGGTCCTTCGCTCAGCTTCCTACTTTTGGCCACCATTGTCCTCCCAGTCCATCTCAGTTGGGCCAGGAGCCTCCCTAGGGCCACAACGGTCAGAGAAACGTTCCAGTGCCTTAACCACTCCCAAACCCTGCTGAGCGCAGTGAGCAGCACGCTTCAAAAGGCCAGACAAACCCTAGAATTTTACTCCTGTACTCCTGAAGAGTTGGATCATGAAGATATCACAAAAGACAAAACCAGCACAGTGAAAGCCTGTGTGCCACTGGAACTAGTCAAGAATGAGAGCTGCCTGGCTTCTGGACATACTTCTTTCATAACTAATGGGAGTTGCCTGACTTCCAGAAAGACCTCGTTTTTGATGACCCTGTGCCTTAATAGTATCTATGAGGACTTGAAACTGTACCAGCTGGAGTTCAAGGCCATGAATGCAAAGCTTTTGATGGATCCTAACAGGCAGATCTTTCTAGATCAAAACATGCTTTCAGCTATTGATGAGTTGATGCAGGCCCTGAATGTCAACAGTGAGACTGTGCCACAAAAACCTTCCTCTGAAGAACCAGATTTTTATAAAACTAAAATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGTGCAGTCACTATCGACAGAATGATGAGTTATCTGAATTCTTCCTAA

XM_004834531.1 Coding sequence

Ift80 intraflagellar transport 80 homolog (Chlamydomonas), transcript variant X1

High confidence: 4 potential gene matches
Length: 2334 bp    Location: 38119674..38003904   Strand: -
>XM_004834531.1
ATGAGACTGAAGATATCTCTTTTAAAAGAACCAAGGCATCAAGAATTGGTAAGCTGTGTGGGCTGGACTACTGCTGAAGAACTGTATTCATGTAGTGATGATCACCAGATAGTGAAGTGGAACTTGTTAACCAGTGAAACAAGTCAAATAGTAAAGCTACCTGATGATATTTACCCAATAGATCTTCACTGGTTTCCAAAAAGTTTAGGCATAAAGAAACAGACTCAAGCAGAAAGCTTTGTTCTCACAAGTTCAGATGGTAAATTTCACCTAATTTCTAAGTTAGGAAGAGTGGAAAAAAGTGTAGAAGCTCACTGTGGAGCAGTACTTGCAGGAAGATGGAATTATGAAGGAACAGCATTAGTTACAGTTGGAGAAGATGGACAAATAAAAATTTGGTCAAAGACTGGGATGCTTAGATCAACTTTAGCTCAGCAAGGAACACCAGTGTATTCAGTAGCATGGGGCCCTGATTCAGAAAAAGTTCTTTACACAGCAGGCAAGCAGCTGATTATTAAACCTCTTCAACCAAATGCTAAAGTTTTACAGTGGAAAGCTCATGATGGTATTATTTTGAAAGTTGATTGGAACTCAGTCAATGACCTTATTTTATCTGCTGGTGAAGATTGTAAATATAAGGTATGGGATAGTTACGGCCGTCCATTGTACAGTTCACAACCTCATGAGCATCCTATTACCTCAGTTGCCTGGGCTCCAGATGGAGAATTGTTTGCTGTTGGATCATTTCATACTTTACGCTTGTGTGATAAAACTGGGTGGTCATATGCTTTAGAAAAACCCAACACTGGAAGCATATTTAATATTGCGTGGTCAGTTGATGGCACTCAGATTGCTGGAGCCTGTGGAAATGGGCATGTTGTTTTTGGACATGTGGTGGAGCAACGTTGGGAGTGGAAAAATTTTCAAGTGACATTAACTAAAAGAAGAACTATGCAGGTTCGGAATGTTCTTAATGATGCAGTGGACATATTGGAATTTCGTGATAGAGTCATTAAAGCATCTTTGAACTGTGCACACTTAGTTGTTTCAACATCTCTTCAATGTTACGTGTTCTCTACGAAGAACTGGAATACACCACTTATATTTGATCTCAAAGAAGGAACTGTTAGTTTAATTCTACAGGCAGAAAGACATTTTCTTCTTGTAGATGGTGGTGGTATCTATTTATATTCTTATGAAGGGCGCTTCATTTCTTCTCCAAAATTTCCTGGAATGAGAACAGATATTTTGAATGCACAGACTGTGTCTCTAAGTAATGATACTATAGCAATAAAAGACAAAGCTGATGAGAAAATTATCTTTCTCTTTGAGGCATCAACTGGAAAACCACTAGGTGATGGGAAACATCTTTCTCATAAGATTGAAATTTTGGAAATTGCTCTGGATCAAAAAGGACTTACCAATGATAGAAAAATTGCTTTCATTGATAAAAATAGAGATCTCTATATCACTTCAGTAAAACGATTTGGGAAGGAAGAACAAATTATCAAACTTGGAACAATGGTGCATACTGTGGCCTGGTGTGATACATGCAATATCCTTTGTGGACTTCAGGATACTCGATTTACAGTGTGGTATTACCCTAATACAGTTTATGTGGACAGAGACATTTTGCCTAAAACACTGTCTGAAAGGGATGCAAGTGAATTTAGTAAAAATCCCCATATTATGAGTTTTGTTGGAAATCAGGTAACTATAAGAAGAGCAGATGGCTCCCTGGTACATATCAGCATATCACCATATCCCGCTATTCTCCACGAATACGTAGGCAGTTCAAAATGGGAGGATGCTGTGAGACTTTGTCGTTTTGTAAAGGAGCAAACCATGTGGGCTTGCCTAGCTGCTATGGCAATTGCTAATCGAGATATGATTACTGCAGAAATAGCCTATGCAGCCATAGGTGAAATTGACAAAGTCCAATACATCAATTCTATAAAAGATCTTCCATCTAAAGAATCAAAAATGGCCCACATACTACTGTTTAGTGGGAACATACAGGAGGCTGAAATAATTCTTCTTCAGGCTGGCCTTGTTTATCAAGCAATCCAGATCAATATTAATCTGTATAACTGGGAAAGAGCACTGGAATTGGCTGTAAAATACAAAACACATGTTGATACGGTTCTTGCTTACCGTCAAAAGTTTTTAGAGACATTTGGTAAACAGGAAACTAATGAACGATATTTGCAATATGCAGAAGGTCTCCAAATAGATTGGGAGAAAATCAAAGTCAAAATTCAGATGGAAATTACTAAAGAACGAGAGCGATCATCAAGCAGCCAATCCAACAAGAATATAAGTCTGAAGCACTAA

XM_004835166.1 Coding sequence

Kpna4 karyopherin alpha 4 (importin alpha 3)

High confidence: 4 potential gene matches
Length: 1566 bp    Location: 38341480..38277337   Strand: -
>XM_004835166.1
ATGGCGGACAACGAGAAATTGGACAACCAGCGGCTCAAGAATTTCAAGAACAAAGGCCGCGACTTGGAGACTATGAGAAGACAACGAAATGAAGTTGTAGTTGAATTAAGGAAGAATAAAAGAGATGAACATCTCTTAAAGAGAAGGAACGTACCACATGAAGATATCTGTGAAGATTCTGATATAGATGGCGATTACAGAGTGCAAAATACCTCTCTAGAAGCTATTGTTCAAAATGCTTCAAGTGATAACCAAGGAATTCAATTAAGTGCAGTTCAAGCTGCTAGGAAGCTTTTGTCCAGTGATCGAAATCCACCAATTGATGACTTAATAAAATCTGGAATATTGCCTATTTTAGTCCATTGTCTTGAAAGAGATGACAATCCTTCTTTACAGTTTGAAGCTGCATGGGCCTTGACAAACATTGCATCTGGAACCTCTGAACAAACTCAAGCAGTGGTTCAGTCTAATGCTGTGCCGCTTTTCTTGAGGCTTCTCCATTCTCCCCATCAGAATGTCTGTGAACAAGCTGTGTGGGCACTGGGAAATATCATAGGTGATGGACCCCAGTGTAGAGATTATGTCATAAGTCTTGGAGTTGTGAAACCTTTACTTTCATTCATAAGTCCATCCATTCCTATAACATTCTTAAGAAATGTTACTTGGGTTATGGTCAATTTATGTCGCCACAAAGACCCACCACCACCAATGGAAACCATTCAGGAGATTCTTCCAGCCCTTTGTGTTTTAATTCATCACACAGACGTAAATATATTGGTAGATACAGTCTGGGCCCTGTCTTACCTTACTGATGCTGGCAATGAACAGATACAGATGGTAATAGACTCTGGAATAGTTCCTCATTTGGTTCCTCTACTCAGCCACCAGGAAGTTAAAGTGCAGACTGCTGCACTTCGAGCTGTGGGCAACATTGTTACAGGAACTGATGAGCAAACACAAGTAGTTTTGAATTGTGATGCTCTTTCACACTTTCCAGCACTCTTGACACATCCCAAAGAGAAAATTAATAAAGAAGCAGTTTGGTTCCTATCTAACATCACTGCAGGAAATCAGCAGCAGGTTCAGGCTGTAATTGATGCCAATCTTGTACCAATGATAATACACCTTTTGGATAAGGTAAGAAAATCATCTTTTATCTATCTGAGTAAGAAGAAGGGTTCTGACAAATTATGTGAATATAACTTTTCTGTAGCCTACCTTATCCAGCAAAATGTTATCCCACCTTTTTGCAACTTGTTGACTGTAAAAGATGCACAAGTTGTACAAGTAGTACTTGATGGACTAAGTAATATATTAAAAATGGCTGAAGATGAGGCAGAAACCATAGCCAATCTTATAGAAGAATGTGGAGGACTGGAGAAAATTGAACAACTTCAAAATCATGAAAACGAAGACATCTACAAATTGGCCTATGAGATCATTGATCAGTTCTTCTCTTCAGATGATATTGATGAAGATCCTAGCATTGTTCCAGAGGCAATTCAAGGTGGAACATTTGGTTTCAATTCATCTGCCAATGTACCAACAGAAGGGTTCCAGTTTTAG

XM_004834536.1 Coding sequence

Arl14 ADP-ribosylation factor-like 14

High confidence: 4 potential gene matches
Length: 576 bp    Location: 38500757..38501332   Strand: +
>XM_004834536.1
ATGGGTCTGCTAAGCTCTAAAGCCCTGAAAGCCAAGCAAGCTCATATTCTTCTTCTCGGACTTGACTCAGCTGGGAAGTCTACTCTCCTTTATAAATTAAAGCTTGCTAAGGATGTTACAACTATCCCAACAATAGGTTTCAATGTGGAGATGATCCAATTGGAAAGCAGTTTCTCACTCACAGTCTGGGATGTTGGAGGACAAGAAAAAATGAGAACTGTTTGGAGCTATTACTGTGAGAATACTGATGGGCTGGTGTATGTTGTGGACTGCACAGACAAACAGCGACTGGAAGCCTCCCGGAAAGAATTTAAGCATGTCTTGAAGAATGAACATATTAAAAATGTGCCTGTTGTCATATTAGCTAACAAACAAGATGTTCCTGGAGCTCTGACCGCTGAGGACATTACTAGAATGTTCCAAGTGAAGAAGCTCTGCAGTGACCGGAACTGGTACGTGCAGCCTTGCTGTGCCATCACAGGTGACGGGCTGACTGAAGGATTCGAGAAACTAACAGGATTTGTGAAAAGCCATATGAAATCAAGAGACACTTCAGCATTCTTCAAGCAGAAATGA

XM_004834537.1 Coding sequence

Ppm1l protein phosphatase, Mg2+/Mn2+ dependent, 1L

High confidence: 4 potential gene matches
Length: 1083 bp    Location: 38610610..38980464   Strand: +
>XM_004834537.1
ATGATAGAGGATACAATGACTTTGCTCTCTCTGCTGGGTCGCATCATGCGGTACTTCTTGCTGAGACCCGAGACGCTTTTCCTGCTGTGCGTCAGCTTGGCGCTGTGGAGTTACTTCTTCCACACGGACGAAGTGAAGACCATCGTCAAGTCCAGCCGGGACGCCGTGAAGATGGTGAAGGGCAAGGTGGCTGAGATCATGCAGAACGATCGACTTGGAGGGCTTGACGTGCTGGAGGCCGAGTTTTCCAAGACCTGGGAGTTCAAGAGCCATAACGTGGCTGTGTACTCCATCCAGGGCCGGAGAGACCACATGGAGGACCGCTTCGAAGTTCTTACTGATCTGGCCAACAAGACGCACCCGTCCATCTTCGGGATCTTCGATGGACACGGCGGCGAGACTGCAGCTGAATATGTAAAATCTCGACTCCCAGAGGCCCTTAAACAGCATCTTCAGGACTATGAAAAAGACAAAGAAAATAGTGTATTGTCTTACCAGACCATCCTTGAACAGCAGATTCTGTCAATTGACCGAGAAATGTTAGAGAAATTGACTGTATCCTATGATGAAGCAGGTACAACGTGTTTGATTGCTCTACTGTCAGATAAAGACCTCACTGTGGCCAATGTAGGTGACTCACGAGGGGTCCTGTGTGACAAAGACGGAAATGCCATTCCCTTATCTCATGATCACAAGCCTTACCAACTGAAGGAAAGAAAGAGGATAAAGAGAGCTGGTGGTTTCATCAGTTTCAATGGCTCATGGAGGGTCCAGGGAATCCTGGCCATGTCTCGATCCCTGGGGGATTATCCACTGAAAAATCTCAACGTGGTCATCCCAGACCCAGATATCCTGACCTTTGACCTGGACAAGCTCCAACCTGAGTTCATGATTTTGGCATCAGATGGCCTGTGGGATGCTTTCAGCAATGAAGAAGCAGTTCGATTTATCAAGGAGCGGTTGGATGAACCTCACTTTGGGGCCAAGAGCATAGTTTTGCAGTCATTTTACAGAGGCTGCCCTGATAACATTACAGTCATGGTGGTGAAGTTCAGGAATAGCAGCAAAACAGAAGAGCAGTGA

XM_004834543.1 Coding sequence

Sptssb serine palmitoyltransferase, small subunit B

High confidence: 4 potential gene matches
Length: 237 bp    Location: 39323139..39291652   Strand: -
>XM_004834543.1
ATGAGCATGGATTTCAGGCGTGTGAAAGAATATTTCTCTTGGCTCTACTATCAATACCAAATCATTACATGTTGTGCTGTCATGGAGCCCTGGGAGCAATCTATGTTCAATACTGTTGTGCTAACCATTTTTGCCATGGTGGTGTACACTGCCTACATCTTCATCCCAATCCACATTCGCCTGGCTTGGGAATTTTTCTCAAAAATATGTGGATATCACAGTACAATTTCCAACTGA

XM_004835167.1 Coding sequence

Otol1 otolin 1

High confidence: 4 potential gene matches
Length: 1425 bp    Location: 39476409..39484861   Strand: +
>XM_004835167.1
ATGTGGATACTTTCTTGGCTTTGTGCCATTTTAATTATTTTGGCTATTGCTGATATGGAGGCAGCAGCAAAGACCACACCATATACCAAATTTACAAAGAAATCTGAGGGGAAAGAGATGCCAAAGGATATAAAGGTGTCTAGTGGCTCACCTCGGGAAGAATGGGAAACTCTGCTCACAGAGATGGCTGCACTGGTAGAACCCACCACGGACCCTGCCGCCTTGAACTCTGCCTTTCCCACGGCCGCTCTCTTTCCCTTTGAAAACTTCACTCTTGACACAGTTCATTACTTTTTGAATTGTTGTCATTGTTGTTCATTTGTTGCTGGGCAGAAAGGAGAACTAGGAAAGACTGGAAAACCAGGTCTTAAAGAAGAGGTTGGTGATATGGGGATTCCAGGGCCACCAGGAGTCATTGGGCCCCAAGGCCCAAAAGGTCACAAAGGAGAAAAGGGACTAAAGGGAGAACGTGGGGACCAAGGTACAAGTGGAATTCCAGGATATCCAGGGAAACCTGGAGAACAAGGTGGACCTGGTCCTAAGGGAGATAAAGGAAGCATTGGCCTTGCAGGAGTAAAAGGACAAAAAGGCTCAAAGGGGGATCTGTGTGGGAATGGCACCAAAGGAGACAAAGGAGACCCGGGAGCCATGGGCTCCCCAGGCTTGAATGGAGGGCCTGGGACCAAGGGAGAGAAAGGAGAGACAGGAGAGAAAGGCTACTGTAGAGACTCAGGGGAGAGAGGAGGGAAAGGACAAAAAGGTGAGGTGGGCATGAAAGGAGAGAAAGGCAGCAAAGGAGATACTGGAATAGAAGGCAGAAGGGGCCCAGATGGTCTGCCTGGGGCCAAAGGTGATCCCGGCCTTAAAGGAGAAAAAGGAGAGTTAGGTCCCCCTGGCCTGATGGGACCTGCTGGGCCAAAGGGTGAGCTTGGAACTAAAGGGGTCCGGGGACCTATTGGGAAAAAAGGCTCACGGGGCTTCAAGGGCTCCAAGGGAGAGGTAGCCAAAGTCCCACAGTCAGCTTTCAGCGTTGCTTTATCAAAGCCGTTCCCTCCTCCTAACATCCCTATCAAATTTGACAAGATTTTGTATAACCATCAAGGGGATTACAGCCCTGTCACTGGGAAATTTAACTGCAGTATTCCTGGGACATATGTGTTTTCCTACCATGTCACTGTGAGGGGCCGACCTGCTCGGATCAGCCTGATGGCCAAGAATAAGAAGCAATTCAAGACCAGAGAAACTCTCTATGGCCAGGAGATAGACCAGGCCTCTCTCCTCCTCATCCTGAAATTAAGTGCAGGAGATCAAGTGTGGCTGGAGGTGTCAAAGGATTGGAATGGAGTGTATGTGAGTGCTGAAGATGACAGCATTTTTACTGGGTTTCTTTTGTACCCGGAGGAAACTCTTGAAATTTCACTATAA

XM_004834546.1 Coding sequence

Slitrk3 SLIT and NTRK-like family, member 3, transcript variant X2

High confidence: 4 potential gene matches
Length: 2943 bp    Location: 43191531..43181818   Strand: -
>XM_004834546.1
ATGATGAAACCTTCCATAGCTGAGATGCTTCACAGAGGGAGGATGTTGTGGATAATTCTTCTAAGCACAATTGCTCTAGGATGGACTACCCCCATTCCCCTGATAGAGGACTCAGAGGAAATAGATGAGCCCTGTTTTGATCCATGCTACTGTGAAGTTAAAGAAAGCCTCTTTCATATACATTGTGACAGTAAAGGATTTACAAATATTAGTCAGATTACTGAATTTTGGTCAAGACCTTTTAAACTGTATCTGCAGAGGAATTCAATGAGGAAATTATACACCAACAGTTTTCTTCATTTGAATAATGCTGTGTCCATTAACCTTGGGAACAATGCTTTGCAGGACATTCAAATGGGAGCTTTTAATGGTCTTAAGATCTTAAAGAGGCTATACCTACATGAGAATAAACTAGATGTCTTCAGAAATGACACCTTCCTTGGCTTGGAAAGTCTAGAATATCTGCAGGCAGATTACAATGTCATTAAACGTATTGAGAGTGGAGCATTTCGGAACCTAAGTAAATTGAGGGTTCTGATTTTAAATGATAATCTCATCCCCATGCTTCCCACCAATTTATTTAAGGCTGTTTCTTTAACCCATTTGGACTTACGTGGAAACAGGTTAAAGGTTCTTTTTTACCGAGGAATGCTAGATCACATTGGCAGAAGCCTAATGGAGCTCCAACTAGAAGAAAATCCCTGGAACTGTACCTGTGAAATTGTGCAGCTGAAGAGCTGGCTGGAACGCATTCCTTACACTGCCCTGGTGGGAGACATCACCTGTGAGACACCTTTCCATTTCCATGGAAAGGACCTGCGAGAAATCAGGAAGACAGAACTCTGCCCCTTGTTGTCTGACTCTGAGGTGGAAGCTAGTTTGGGGATACCTCATTTGTCATCAAGCAAGGAGAATGCATGGCCAACTAAACCTTCCTCCATGCTGTCCTCTGTCCATTTTACTGCTTCTTCTGTTGAATACAAGTCCTCAAATAAACAGCCCAAGCCCACCAAACAGCCCCGAACACCAAGACCACCCTCTACATCCCAAGCTTTATATCCTGGTCCAAATCAACCTCCTATTGCTCCTTACCAGACCAGACCACCAATTCCTATCATATGCCCTACTGGGTGTACTTGTAATTTGCACATCAATGACCTTGGCTTGACTGTCAATTGCAAAGAGCGAGGATTTAATAACATTTCTGAACTTCTTCCAAGGCCACTGAATGCCAAAAAACTGTACCTGAGTAGCAATCTGATTCAGAAAATATACCGCTCAGATTTTTGGAATTTTTCTTCTTTGGATCTCTTACATCTGGGGAACAACCGCATTTCTTATGTCCAGGATGGGGCCTTCATCAACCTGCCTAACTTAAAAAGTCTGTTTCTCAATGGCAATGATATAGAGAAGCTGACACCTGGCATGTTCCGAGGGCTACAGAGTTTGCACTACTTGTACTTTGAGTTCAACGTCATCCGGGAAATTCAGCCTGCAGCTTTTAGCCTCATGCCCAACTTGAAGCTGCTATTCCTCAACAATAACTTGCTGAGGACTCTGCCGACAGACGCCTTTGCAGGCACATCCCTGGCTCGGCTCAACTTGAGAAAGAACTATTTCCTCTATCTTCCTGTGGCTGGTGTGCTGGAACACTTGAATGCCATTGTGCAGATAGACCTCAACGAGAATCCCTGGGACTGCACTTGTGACCTGGTCCCCTTTAAGCAGTGGATCGAAACCATCAGCTCAGTCAGTGTGGTAGGAGATGTGCTTTGTAGGAGCCCTGAGAACCTCACACACCGTGATGTCCGCACCATCGAACTGGAAGTGTTATGTCCAGAGATGCTGCATATTGCACCCACTGGCGCATCCCCAGCCCACTCTGGAGATTCTCACTTTGTTGGGAGCCCAACGAGTGTATCACCTTATGAGTTATCTCCTCCCGGGGTCCCTGTGCCACTTTCTGTGTTGATCCTCAGCCTGCTGGTTCTGTTCTTTTCTGCAGTCTTTGTTGCTGCAGGCCTCTTTGCCTACGTGCTCCGACGGCGTCGGAAGAAGCTGCCCTTTCGAAGTAAGCGGCAAGAAGGTGTAGACCTCACCGGCATCCAGATGCAGTGCCACCGGCTGTTTGAGGATGGTGGAGGTGGTGGTGGTGGAAGCGCGGGTGGAGGCCGACCAACTCTTTCTTCCCCTGAGAAGGCTCCTCCTGTGGGTCACGTGTACGAGTACATCCCCCACCCGGTTACCCAGATGTGCAACAACCCCATCTACAAGCCTCGTGAGGAGGAAGAAGTGGTTGCTTCAGCAGGGCAGGACACAGGAAGTGCAGAACGTGGGGGTCCTGGGACACAGGCGCCGGGAATGGGCGAGGTTCTCCTAGGAAGTGAGCAGTTTGCGGAGACACCGAAGGAGACCCACAGCAACTACCGGACTTTGCTGGAGAAAGAGAAGGAGTGGGCCCTGGCGGTTTCCAGCTCCCAGCTCAACACCATAGTGACGGTGAATCACCACCACCCTCACCCACACCACTCTGCAGTTGGTGGGGTTCCAGGGGTCGTTGGGGGAGCTGGGGGAGACTTGTCTGGGTTCCGCCACCATGAGAAGAATGGTGGGGTGGTGCTGTTCCCCCCCGGGGGAGGCTGTGGTGGTGGCAGTATGCTACTTGACCGGGAGAGACCACAGCCGGGCCCCTGCGCAGTCGGCTTCGTGGACTGTCTCTACGGCACAGTGCCCAAATTAAAGGAACTACATGTCCACCCCCCCGGCATGCAATACCCAGACTTACAGCAGGATGCCAGGCTCAAAGAAACCCTTCTCTTCTCAGCTGGAAAGGGCTTCACAGACCACCAAACCCAAAAAAGTGATTACCTCGAGTTAAGGGCCAAACTTCAAACAAAGCCGGATTACCTCGAAGTCCTGGAAAAAACATCGTATAGGTTCTAA

XM_004834545.1 Coding sequence

Slitrk3 SLIT and NTRK-like family, member 3, transcript variant X1

Length: 2943 bp    Location: 43190576..43181818   Strand: -
>XM_004834545.1
ATGATGAAACCTTCCATAGCTGAGATGCTTCACAGAGGGAGGATGTTGTGGATAATTCTTCTAAGCACAATTGCTCTAGGATGGACTACCCCCATTCCCCTGATAGAGGACTCAGAGGAAATAGATGAGCCCTGTTTTGATCCATGCTACTGTGAAGTTAAAGAAAGCCTCTTTCATATACATTGTGACAGTAAAGGATTTACAAATATTAGTCAGATTACTGAATTTTGGTCAAGACCTTTTAAACTGTATCTGCAGAGGAATTCAATGAGGAAATTATACACCAACAGTTTTCTTCATTTGAATAATGCTGTGTCCATTAACCTTGGGAACAATGCTTTGCAGGACATTCAAATGGGAGCTTTTAATGGTCTTAAGATCTTAAAGAGGCTATACCTACATGAGAATAAACTAGATGTCTTCAGAAATGACACCTTCCTTGGCTTGGAAAGTCTAGAATATCTGCAGGCAGATTACAATGTCATTAAACGTATTGAGAGTGGAGCATTTCGGAACCTAAGTAAATTGAGGGTTCTGATTTTAAATGATAATCTCATCCCCATGCTTCCCACCAATTTATTTAAGGCTGTTTCTTTAACCCATTTGGACTTACGTGGAAACAGGTTAAAGGTTCTTTTTTACCGAGGAATGCTAGATCACATTGGCAGAAGCCTAATGGAGCTCCAACTAGAAGAAAATCCCTGGAACTGTACCTGTGAAATTGTGCAGCTGAAGAGCTGGCTGGAACGCATTCCTTACACTGCCCTGGTGGGAGACATCACCTGTGAGACACCTTTCCATTTCCATGGAAAGGACCTGCGAGAAATCAGGAAGACAGAACTCTGCCCCTTGTTGTCTGACTCTGAGGTGGAAGCTAGTTTGGGGATACCTCATTTGTCATCAAGCAAGGAGAATGCATGGCCAACTAAACCTTCCTCCATGCTGTCCTCTGTCCATTTTACTGCTTCTTCTGTTGAATACAAGTCCTCAAATAAACAGCCCAAGCCCACCAAACAGCCCCGAACACCAAGACCACCCTCTACATCCCAAGCTTTATATCCTGGTCCAAATCAACCTCCTATTGCTCCTTACCAGACCAGACCACCAATTCCTATCATATGCCCTACTGGGTGTACTTGTAATTTGCACATCAATGACCTTGGCTTGACTGTCAATTGCAAAGAGCGAGGATTTAATAACATTTCTGAACTTCTTCCAAGGCCACTGAATGCCAAAAAACTGTACCTGAGTAGCAATCTGATTCAGAAAATATACCGCTCAGATTTTTGGAATTTTTCTTCTTTGGATCTCTTACATCTGGGGAACAACCGCATTTCTTATGTCCAGGATGGGGCCTTCATCAACCTGCCTAACTTAAAAAGTCTGTTTCTCAATGGCAATGATATAGAGAAGCTGACACCTGGCATGTTCCGAGGGCTACAGAGTTTGCACTACTTGTACTTTGAGTTCAACGTCATCCGGGAAATTCAGCCTGCAGCTTTTAGCCTCATGCCCAACTTGAAGCTGCTATTCCTCAACAATAACTTGCTGAGGACTCTGCCGACAGACGCCTTTGCAGGCACATCCCTGGCTCGGCTCAACTTGAGAAAGAACTATTTCCTCTATCTTCCTGTGGCTGGTGTGCTGGAACACTTGAATGCCATTGTGCAGATAGACCTCAACGAGAATCCCTGGGACTGCACTTGTGACCTGGTCCCCTTTAAGCAGTGGATCGAAACCATCAGCTCAGTCAGTGTGGTAGGAGATGTGCTTTGTAGGAGCCCTGAGAACCTCACACACCGTGATGTCCGCACCATCGAACTGGAAGTGTTATGTCCAGAGATGCTGCATATTGCACCCACTGGCGCATCCCCAGCCCACTCTGGAGATTCTCACTTTGTTGGGAGCCCAACGAGTGTATCACCTTATGAGTTATCTCCTCCCGGGGTCCCTGTGCCACTTTCTGTGTTGATCCTCAGCCTGCTGGTTCTGTTCTTTTCTGCAGTCTTTGTTGCTGCAGGCCTCTTTGCCTACGTGCTCCGACGGCGTCGGAAGAAGCTGCCCTTTCGAAGTAAGCGGCAAGAAGGTGTAGACCTCACCGGCATCCAGATGCAGTGCCACCGGCTGTTTGAGGATGGTGGAGGTGGTGGTGGTGGAAGCGCGGGTGGAGGCCGACCAACTCTTTCTTCCCCTGAGAAGGCTCCTCCTGTGGGTCACGTGTACGAGTACATCCCCCACCCGGTTACCCAGATGTGCAACAACCCCATCTACAAGCCTCGTGAGGAGGAAGAAGTGGTTGCTTCAGCAGGGCAGGACACAGGAAGTGCAGAACGTGGGGGTCCTGGGACACAGGCGCCGGGAATGGGCGAGGTTCTCCTAGGAAGTGAGCAGTTTGCGGAGACACCGAAGGAGACCCACAGCAACTACCGGACTTTGCTGGAGAAAGAGAAGGAGTGGGCCCTGGCGGTTTCCAGCTCCCAGCTCAACACCATAGTGACGGTGAATCACCACCACCCTCACCCACACCACTCTGCAGTTGGTGGGGTTCCAGGGGTCGTTGGGGGAGCTGGGGGAGACTTGTCTGGGTTCCGCCACCATGAGAAGAATGGTGGGGTGGTGCTGTTCCCCCCCGGGGGAGGCTGTGGTGGTGGCAGTATGCTACTTGACCGGGAGAGACCACAGCCGGGCCCCTGCGCAGTCGGCTTCGTGGACTGTCTCTACGGCACAGTGCCCAAATTAAAGGAACTACATGTCCACCCCCCCGGCATGCAATACCCAGACTTACAGCAGGATGCCAGGCTCAAAGAAACCCTTCTCTTCTCAGCTGGAAAGGGCTTCACAGACCACCAAACCCAAAAAAGTGATTACCTCGAGTTAAGGGCCAAACTTCAAACAAAGCCGGATTACCTCGAAGTCCTGGAAAAAACATCGTATAGGTTCTAA

XM_004834547.1 Coding sequence

Bche butyrylcholinesterase, transcript variant X1

High confidence: 4 potential gene matches
Length: 1809 bp    Location: 43849310..43796329   Strand: -
>XM_004834547.1
ATGCAAAGTAAGCACACAATCACAAGTGTCTCATGTATTTTGTGGTTTCTTCTGTTCTGCGCGCTTGTTGGGAAGTCCTACACTGAAGAAGACATCTTAGTTACAACTAGGAGTGGAAAAGTCAGAGGGATGAACTTGTCGGTTCTCGGTGGCACAGTCACTGCCTTTCTTGGAATTCCCTATGCACAGCCACCTGTTGGTAGACTTAGATTCAAAAAGCCACAACCTCTGAACAAGTGGTCTGAAATTTGGAATGCCACAAAATATGCAAATTCTTGCCATCAAAACATAGATCAACGTTTCCCAGGATTCCAAGGATCAGAGATGTGGAATCCAAACACAGAGCTCAGTGAAGACTGTTTATATCTTAATGTGTGGATTCCAGCGCTGAAGCCAAAAAATGCTACTGTAATGATATGGATCTATGGTGGTGGCTTTCAAACTGGGACATCCTCTTTACATGTTTATGATGGAAAGTTTCTGGCTCGAGTTGAAAGAGTTATTATAGTTTCAATGAACTATAGGGTGGGTGCCCTAGGATTCTTAGCTTTACCTGGAAATCCTGAGGCTCCAGGAAACTTGGGTTTATTTGACCAACAACTGGCACTTCAATGGGTCCAAAACAATATTGCAGCCTTTGGTGGGAATCCTAGAAGTGTAACTCTCTTTGGAGAAAGCGCAGGAGCAGCTTCAGTTGGGCTTCATTTGCTTTCTTCCAAAAGCCACCCTCTATTCACTAGAGCTATTCTGCAAAGTGGGTCCCCTAGTGCACCTTGGGCAGTAATATCTCCTTATGAAGTTAGGAACAGAACCTTGACGTTGGCTAAATTTATTGGCTGTTTCAAAGACAATGAGACTGAGATAATAAAATGCCTTCAAAACAAAGATCCTCAGGAAATTCTCCTGAATGAAGTGTTTGTCCTCCCTCACAATAATCTCCTGTCAGTAAATTTTGGTCCAACTGTCGATGGTGATTTTCTGACTGACATGCCGGAGACTTTGCTCCAACTTGGACAATTTAAAAAAACCCAGATCTTGGTGGGTGTGAATAAAGATGAAGGGACAGCTTTTCTAGTATATGGTGCTCCTGGTTTTAGCAAAGATAACAACAGTATTATAACTAGAAGAGAATTTCAAGAAGGTTTAAAAATATGCTTTCCAGGAGTGAGTGAATTTGGAAGGGAATCCATCCTTTTCCATTATGCAGACTGGCTAGATGACCAGAGGCCTGAAAACTACCGTGAGGCTTTGGATGATGTCACTGGGGATTACAATATCATATGCCCTGCCCTGCAGTTTACCAAAATCTTCTCAGATTTGGGAAATCATGCCTTTTTCTACTCTTTTGAACACCGATCCTCCAAACTTCCTTGGCCTGAATGGATGGGAGTGATGCATGGCTATGAAATTGAATTTGTCTTTGGTTTACCTCTGGAAAGAAGAAATAATTACACAAAAGCTGAAGAAATTTTGAGTAGATCCATAATGAAACAATGGACAAATTTTGCGAAATATGGACACCCAAATGGTACCCAGAGAAATAGCACAGGATGGCCGGTCTTCAAAAGCACTGAACAAAAATACCTGACCTTGAACACAGGATCATCCAGTATACACGCTAAACTACGTGCTCAACAGTGCCAATTTTGGACACTATTTTTCCCCAGAGTCTTGGAAATGACAGGAAATATTGATGAAGTCGAACAAGAGTGGAAAGCAGGATTCTATCGCTGGAACAATTACATGATGGACTGGAAAAATCAATTTAACGATTACACTAGCAAGAAAGAAAGCTGTATGGGTCTCTAA

XM_004834548.1 Coding sequence

Bche butyrylcholinesterase, transcript variant X2

Length: 1782 bp    Location: 43849312..43799706   Strand: -
>XM_004834548.1
ATGCAAAGTAAGCACACAATCACAAGTGTCTCATGTATTTTGTGGTTTCTTCTGTTCTGCGCGCTTGTTGGGAAGTCCTACACTGAAGAAGACATCTTAGTTACAACTAGGAGTGGAAAAGTCAGAGGGATGAACTTGTCGGTTCTCGGTGGCACAGTCACTGCCTTTCTTGGAATTCCCTATGCACAGCCACCTGTTGGTAGACTTAGATTCAAAAAGCCACAACCTCTGAACAAGTGGTCTGAAATTTGGAATGCCACAAAATATGCAAATTCTTGCCATCAAAACATAGATCAACGTTTCCCAGGATTCCAAGGATCAGAGATGTGGAATCCAAACACAGAGCTCAGTGAAGACTGTTTATATCTTAATGTGTGGATTCCAGCGCTGAAGCCAAAAAATGCTACTGTAATGATATGGATCTATGGTGGTGGCTTTCAAACTGGGACATCCTCTTTACATGTTTATGATGGAAAGTTTCTGGCTCGAGTTGAAAGAGTTATTATAGTTTCAATGAACTATAGGGTGGGTGCCCTAGGATTCTTAGCTTTACCTGGAAATCCTGAGGCTCCAGGAAACTTGGGTTTATTTGACCAACAACTGGCACTTCAATGGGTCCAAAACAATATTGCAGCCTTTGGTGGGAATCCTAGAAGTGTAACTCTCTTTGGAGAAAGCGCAGGAGCAGCTTCAGTTGGGCTTCATTTGCTTTCTTCCAAAAGCCACCCTCTATTCACTAGAGCTATTCTGCAAAGTGGGTCCCCTAGTGCACCTTGGGCAGTAATATCTCCTTATGAAGTTAGGAACAGAACCTTGACGTTGGCTAAATTTATTGGCTGTTTCAAAGACAATGAGACTGAGATAATAAAATGCCTTCAAAACAAAGATCCTCAGGAAATTCTCCTGAATGAAGTGTTTGTCCTCCCTCACAATAATCTCCTGTCAGTAAATTTTGGTCCAACTGTCGATGGTGATTTTCTGACTGACATGCCGGAGACTTTGCTCCAACTTGGACAATTTAAAAAAACCCAGATCTTGGTGGGTGTGAATAAAGATGAAGGGACAGCTTTTCTAGTATATGGTGCTCCTGGTTTTAGCAAAGATAACAACAGTATTATAACTAGAAGAGAATTTCAAGAAGGTTTAAAAATATGCTTTCCAGGAGTGAGTGAATTTGGAAGGGAATCCATCCTTTTCCATTATGCAGACTGGCTAGATGACCAGAGGCCTGAAAACTACCGTGAGGCTTTGGATGATGTCACTGGGGATTACAATATCATATGCCCTGCCCTGCAGTTTACCAAAATCTTCTCAGATTTGGGAAATCATGCCTTTTTCTACTCTTTTGAACACCGATCCTCCAAACTTCCTTGGCCTGAATGGATGGGAGTGATGCATGGCTATGAAATTGAATTTGTCTTTGGTTTACCTCTGGAAAGAAGAAATAATTACACAAAAGCTGAAGAAATTTTGAGTAGATCCATAATGAAACAATGGACAAATTTTGCGAAATATGGACACCCAAATGGTACCCAGAGAAATAGCACAGGATGGCCGGTCTTCAAAAGCACTGAACAAAAATACCTGACCTTGAACACAGGATCATCCAGTATACACGCTAAACTACGTGCTCAACAGTGCCAATTTTGGACACTATTTTTCCCCAGAGTCTTGGAAATGACAGGAACTGCTTTACCAGCTAGAGCTACACAAATAAAATTGAGTGTGCTCACTCACAGAGAGGTGGTGTGGTCAGGGTCCAGGATCATGGAAAGCTTTTAA

XM_004835169.1 Coding sequence

Wdr49 WD repeat domain 49

Length: 3021 bp    Location: 45572417..45450742   Strand: -
>XM_004835169.1
ATGACAGAGATTGTTGGTTGGGGCACACAGGAAGAATATGGCGAGCTCTTTGATAAAGTGGATGTGGACCAAGATGGCTTTATTAATTGGGACAAATTGACTTCATTTATACTGTTATCGCTTTATGAGAAAGATGAACGAGAAAAAGCAACTGTGGTTCCCCAGTGGAAGGACCTTGAATTCCTCGAAGGAAAACACAAGGACACCATCCAAAAAGTAATTTTCTTAAAGAGTTCAAGTCGTTACATAACTATTAGCAAAGAAGGTTTGCTGGGAATCTGGGGAGAGAATTTAAAGCTCCAAGAAACACTTCCCATCACTTCTGATGCCACTAAGCTCAAACACCTGTGGGTGACAAGTCTGGTTTCCCTGGAAAATGCAAACAAGGTTACAGCAGGATCATGGATCTTACGCAAAGCAGAGGCTGCCAAGTGCCTGACACAGCATAATGCTGCTTATCTGATTTTGAGTGCTTTACTAGTCAGCTTCTTAATTCTAATAGCGGTGACATTTACAAGCAAAGAGATTTGTTTCTATGATCTGCTGTCTGAAGAATTTCCTTGTCAATACAAACTCCAAGGCCTGAAAGGAACACCAATTTGTATGGATTATTGGTACAATCCTCTTGATGCCAATGAATCAATTCTTTCCTTAGGAGATACAGCTGGAAAGGTTCGAGCAATTGTTTTCACAGCAGCTTTGATTTCCCTGTTTGAAAAGCCTGTTAGTACATGGGAAGATGAAGAAGCCACTATGACCATTAACTGGGAAGAACTGCTTTCTGGATGTCACAGATGTTGCCATGTATTAGAACACAAGCTTCATCATGGAGATTGGGTGAGGCAAGTTAATTACAATGCATCTTTGGACGCTATCATTTCTAGTACAACCAACAATACAAATACTGTGGTGCTGGCTTGGAGAGAGAAATCAAAAAAGCATCTTAAAATGACATCCTTCAACATTGCCCAGGGCATTCATGCTTTTGATTATCACTCCCGGCTCAATTTAATTGCAACTGCTGGCATTAACAATAAAGTTTGCCTTTGGAATCCTTATGTTGTTTCTAAACCAGTCGGTGTCCTTTGGGGTCACTCAGCCAGTGTAATAGCGGTCCAATTCTTTGCGGAAAGAAAACAACTTTTCAGCTTCTCCATGGATAAAATTTTGAGACTCTGGGATATTCATCACCAACTGTCCATCCAGAGGATAGCTTGCTCTTTCCCCAGAAGTCAAGACTTCACATGCCTCTTCCACTTTGATGAAACCCACGGACAGCTTTTCATCGCATTTAATAACCAACTAGCATTATTGGCAATGAAAAGTGAAACGAGCAAGAGAGTGAAAAGCCATGCAAAACCAGTCACTTGTGTTCTTTACAATTCACTCTTGAAGCAGATAATTAGCTCAGACATGGGGTCTACAGTTTCCTTCTGGATGATAGACACTGGGCAGAAAATCAAACAGTTTACTGGTTGCCATGGCAACGCAGAAATCAGCACTATGGCCCTTGATGCAAATGAGACCCGGCTTTTGACTGGCAGCACAGATGGAACTGTGAAGATTTGGGACTTTAATGGATATTGTCACCACACACTAAATGTTGGACAAGATGGGGCTGTGGATATTTCACAGATCCTCATTCTTAAGAAGACAATACTGGTTACAGGCTGGGACAGAGCTATTACTGTGTTTCGACCACAGAAGTTCAATCAGTTTTTCATCCAGTCTGAAGAATGGAAAGGAGGAATCCAACACTACGATGACATCTTGTGTGTTGCATTTTTACCTCCACAAACTCTTGCCACAGGGAGTTACGATGGAGAAATCATTCTATGGCACAATAGCACAGAAAATGCTCACCATGTCCTTCACCCTTGTTACCAGAGGCTGTTAAAAAGAAAGTCAGATATGGAGCCGCAAAAGCTTTACAGTGCTGAACAAAGAGGCTCCACTTACCCCGTGGCAGACCAGGCTCCCTTGGCAGCCCGGACCTCTGAGACTGACACTGAGGGTAACAATGCTGTTGTGAGGCTTTGCTTCCTTGAAGCAAGGAAAAACATTGCAGCAACAGGCGGAGCTAATCTGGTATCATGTGGAGGATCTGGTTATGTTAGATTCTGGAATACACTTAAGAAACAACTTCTGGCTGAATTTTTGGCTCATAGTGGGGTTGGATCCATTACCATGTCTATTGATAAGCTGAATCGATATCTTACCACAGGAGATCTTGATGGATGTTTGAAAATCTGGAATATAGAGGAATACTGTTTTGAATCAAATAAGAAAAAAATCACACAGACTCCAACTCTGATCAGGTCCTTCCAACCTCATGAGGACCAGATAACTTCCTTGGAGATGTGTGAGCGGGATGCACATTTACTGATTATCTCTGCCTCTACTGACTGCAGTATTTGTGTGACTGGCATCCATGGTGCTCCTGTTTGGATCTTGGGTCAGGCAAAACATTGGCATCTTGAAAATTGTTTTTCTGTTCTTGAAAGAGATGTGAATTTAATAGAAAGTGAGAGTCCAGAGGAAAGTATGAAGGTAAACGCTTTATATTCTAAAGAGGAATCATGTTTAGAGTCAACTGAACATTCACTACTTAATACTCAAGAAAAAGATGACTCAACAAACATTTTCAGACCATCTGAAGACATAAATTTAGGTATAAAATACAAGGAAAGAAATATCCATAAGAAAAAAGCACGTAAACTTTACTATGATGAAATTATACAAAAAACAGCCAGCACATTTAGGTCATTAAGCATCAGAGCCCTGACAGAGTTGCCTGAGGTGAATAAACCTGCCTTTCTTCTAGACCCTGAGAAATATTTTAAGAAAGAGCCAGAGGAACATCTCAGAATTCCAGAGCTTCCTTTACTTTCTGAAACTTTGAAAGCTGTATTTCATGAGAAAAACCTGTTCCCCAAAGAAATTCTGGATCAAAAAAGAAAACCCAAGCAATTATGTCAAGAAACAACTTGTGAAGTGAAGATAAAAAGAAGTAAGAAATGA

XM_004834559.1 Coding sequence

Golim4 golgi integral membrane protein 4, transcript variant X4

Length: 2025 bp    Location: 46111155..46028803   Strand: -
>XM_004834559.1
ATGCTCTACTACGAGCTGCAGACGCAGCTGCGGAAAGCCGAGGCGGTGGCGCTCAAGTACCAGCAGCACCAGGAGTCCCTCTCTGCCCAGTTGCAAGTTGTGTATGAACACAGATCAAGATTAGAGAAATCTTTACAAAAGGAAAGACTTGAGCATAAGAAAGCAAAGGAAGATTTCCTTGTTTACAAGTTAGAAGCACAAGAAACACTGAATAAAGGAAGGCAAGACTCCAATAGCAGATACAGTGCACTGAATGTCCAACATCAGATGTTAAAAAGTCAACATGAGGAGTTGAAGAAACAACACAGTGACTTGGAAGAGGAACATCGCCAACAAGGGGAAGACTTCAGTAGAACATTCAATGACCACAAGCAGAAATACTTGCAGCTTCAGCAAGAAAAAGAACAAGAACTTTCTAAGCTAAAAGAAACTGTATACAATTTGAGAGAAGAGAATAGACAGCTGAGGAAAGCACACCAAGACATACACACACAACTGCAAGATGTCAAGCAACAGCATAAGAATTTACTCTCCGAGCATGAACAACTTGTAGTGACTTTGGAAGACCACAAGAGTGCACTAGCTGCTGCACAGACTCAAGTTGCAGAATATAAACAGCTGAAAGATACTCTGAATAAGATTCCAAGCCTTCGAAAATCTGACCAAGCAGAGCTGCAGAATGTTACCCTTACTCAGGTGGCACAGTCTCCACAAGGTTACAACACAGCAAGGAGGCACCCAACTGGAAAGCCACAAGAGGTGTCTCGAAACAGTGATATGTGGCAGAAACAAGAAGGAATGCCTGGAAGAGCAGAAGAAATGAAACCTTATCCTCCCACCCAGAAGGGTGTAGAATTCCAGGCTGCAGCAGAGTACAACCCACACCAAATGGAACCAAGAGAGCCAGAGGAGCACCAGGTGGAAGAAGAGCACAGAAAGGCCCTGGAAGAGGAGGAAATGGAGCAGGTTGGGCAGGCTGAACATCTCGAGGAAGAACATGATCCATCGCCAGAAGAGCAGGACCGCGAGTGGAGAGAGCTGCATGAACAGAAGGAAGCAGCCAACCTGCTGGAAGGGCGTGCTCATGCTGAGGCACACCCTTCAGCCAAGCTGGTTACCAAATTCCGGTCCTTGTACGAGGAGCAATTGGAGCAGCAGAGACTGGCAGTGAGAAGGGATGAGGAGGCCGAGCGGCTGCGAAAACGCCAGGAAGCCTTGCACCAGCAGAGGCTGCAGGGACAACTGTTATGGCAGCGGCAACAGCAGGAGCAGCAGCTTCTGGCCAGAGAGATGGCTCAGCAGAGGGAGGCTGGGCACAAGAAGGGCCAGCAGCAGCACCAGGAGCAGCTACGGCAGCAAGCTCATTATAACGCTGTGGATAATGATATTGTTCGGGGGCCAGAGGACCAGGGAGTGCAAGAAGAGGAAGGAGGCGCCTATGAAAGAGAAAACCAGCACCAAGATGAAGCTGAAGGAGACCTAGGTAACCGACATGAGCCCCATGAACAAGGACCCCGAGAAGCCGACCCAGAATCTGAGGCAAATAGGGCAGCTGTAGAGGATATTAACCCAGCGGATGACCCAAATAATCAAGGTGAAGATGAATTTGAGGAAGCAGAGCAAGTGAGAGAAGAAAATTTGCCTGATGAAAATGAAGAGCAACAACAAAGTGATCAAAAGCAAGAGAATGCGGAAATGGAAGAACATTTGGTGATGGCAGGAAATCCAGACCAGCAGGAGGATAATGTTGATGAACAGTACCAGGAAGAGGGAGAGGAGGAGGTAGTAAGATCACAGGAGGTTCAGGAAGATTTGACTGAAGAGAAAAAAAGGGAACTGGAGCATAATGCTGAGGACACCTATGGGGAAAATGATGAAAACGCTGATGATAAAAACAATGATGGAGGAGAAGAGCAAGAAGTCCAAGATGACAACCACCCAAAAGGTGGAGAGGAACACTATGAAGAGGAGGAAGAAGACGGGGCTGCTGTTGCTGAGAAATCACATCGAAGAGCTGAAATGTAG

XM_004834556.1 Coding sequence

Golim4 golgi integral membrane protein 4, transcript variant X1

Length: 2115 bp    Location: 46110644..46028803   Strand: -
>XM_004834556.1
ATGGGAAACGGGATGTGCTCCCGAAAACAGAAGCGGATCTTCCAGACGCTGCTCCTGCTGACAGTGGTGTTCGGCTTTCTCTACGGCGCGATGCTCTACTACGAGCTGCAGACGCAGCTGCGGAAAGCCGAGGCGGTGGCGCTCAAGTACCAGCAGCACCAGGAGTCCCTCTCTGCCCAGTTGCAAGTTGTGTATGAACACAGATCAAGATTAGAGAAATCTTTACAAAAGGAAAGACTTGAGCATAAGAAAGCAAAGGAAGATTTCCTTGTTTACAAGTTAGAAGCACAAGAAACACTGAATAAAGGAAGGCAAGACTCCAATAGCAGATACAGTGCACTGAATGTCCAACATCAGATGTTAAAAAGTCAACATGAGGAGTTGAAGAAACAACACAGTGACTTGGAAGAGGAACATCGCCAACAAGGGGAAGACTTCAGTAGAACATTCAATGACCACAAGCAGAAATACTTGCAGCTTCAGCAAGAAAAAGAACAAGAACTTTCTAAGCTAAAAGAAACTGTATACAATTTGAGAGAAGAGAATAGACAGCTGAGGAAAGCACACCAAGACATACACACACAACTGCAAGATGTCAAGCAACAGCATAAGAATTTACTCTCCGAGCATGAACAACTTGTAGTGACTTTGGAAGACCACAAGAGTGCACTAGCTGCTGCACAGACTCAAGTTGCAGAATATAAACAGCTGAAAGATACTCTGAATAAGATTCCAAGCCTTCGAAAATCTGACCAAGCAGAGCTGCAGAATGTTACCCTTACTCAGGTGGCACAGTCTCCACAAGGTTACAACACAGCAAGGAGGCACCCAACTGGAAAGCCACAAGAGGTGTCTCGAAACAGTGATATGTGGCAGAAACAAGAAGGAATGCCTGGAAGAGCAGAAGAAATGAAACCTTATCCTCCCACCCAGAAGGGTGTAGAATTCCAGGCTGCAGCAGAGTACAACCCACACCAAATGGAACCAAGAGAGCCAGAGGAGCACCAGGTGGAAGAAGAGCACAGAAAGGCCCTGGAAGAGGAGGAAATGGAGCAGGTTGGGCAGGCTGAACATCTCGAGGAAGAACATGATCCATCGCCAGAAGAGCAGGACCGCGAGTGGAGAGAGCTGCATGAACAGAAGGAAGCAGCCAACCTGCTGGAAGGGCGTGCTCATGCTGAGGCACACCCTTCAGCCAAGCTGGTTACCAAATTCCGGTCCTTGTACGAGGAGCAATTGGAGCAGCAGAGACTGGCAGTGAGAAGGGATGAGGAGGCCGAGCGGCTGCGAAAACGCCAGGAAGCCTTGCACCAGCAGAGGCTGCAGGGACAACTGTTATGGCAGCGGCAACAGCAGGAGCAGCAGCTTCTGGCCAGAGAGATGGCTCAGCAGAGGGAGGCTGGGCACAAGAAGGGCCAGCAGCAGCACCAGGAGCAGCTACGGCAGCAAGCTCATTATAACGCTGTGGATAATGATATTGTTCGGGGGCCAGAGGACCAGGGAGTGCAAGAAGAGGAAGGAGGCGCCTATGAAAGAGAAAACCAGCACCAAGATGAAGCTGAAGGAGACCTAGGTAACCGACATGAGCCCCATGAACAAGGACCCCGAGAAGCCGACCCAGAATCTGAGGCAAATAGGGCAGCTGTAGAGGATATTAACCCAGCGGATGACCCAAATAATCAAGGTGAAGATGAATTTGAGGAAGCAGAGCAAGTGAGAGAAGAAAATTTGCCTGATGAAAATGAAGAGCAACAACAAAGTGATCAAAAGCAAGAGAATGCGGAAATGGAAGAACATTTGGTGATGGCAGGAAATCCAGACCAGCAGGAGGATAATGTTGATGAACAGTACCAGGAAGAGGGAGAGGAGGAGGTAGTAAGATCACAGGAGGTTCAGGAAGATTTGACTGAAGAGAAAAAAAGGGAACTGGAGCATAATGCTGAGGACACCTATGGGGAAAATGATGAAAACGCTGATGATAAAAACAATGATGGAGGAGAAGAGCAAGAAGTCCAAGATGACAACCACCCAAAAGGTGGAGAGGAACACTATGAAGAGGAGGAAGAAGACGGGGCTGCTGTTGCTGAGAAATCACATCGAAGAGCTGAAATGTAG

XM_004835170.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 2916 bp    Location: 46272861..46919839   Strand: +
>XM_004835170.1
ATGACCTCGCGACTGTGGCTCTGGTGCTTCTGCGGCTGGTTGGCCGCCAGCTGGCCGCCAGGAAGCGCCCTACAGCTCCAGCCCGGCACGCCAAATGTTTGTGAAGAACAGAAGCTGACTGTGGTAGGACTCCCACAGCCCTGTGTCCGGGCCTTCACACACATGGTCAAGCTTTGGAAACAAGGCTGTACCCACCCTGGGTGGTGTGCGGGTTACGAAAGAAGGACCCGGTACTACACTGTGTACAGACAGGTGTACAGCATTGAGCAGCGGACAGTTCACAGGTGCTGCCCTGGTTGGAGCCAATGGGATGATGAACCGGGCTGCCTACACTCTGTCTTTGCTGCGGGGACTCATTTCAATGGAAGGAAATGTTCAGATGGTGAAGCCCAGCTATGCCAGTGTTCACAGGGATACCATGGTCCCCGCTGTAAATATGATGTCGATGAATGTACGGTGGTGAATGGAGGCTGCCAGCAGCGCTGTATTAACACTCTGGGCACTTTCCACTGTGAATGTGATACAGGATACAGACTCCATGCTGACGAACGCACCTGCATAAAGATGGACCCCTGCACAGGTGGAAATGGATGTGCTCACATATGTCAGAATGAGAATGGCATGCCCAGGTGTGCCTGCCACCCAGGGTACCAGCTGTCTGAAGACAAAAAGACCTGTGAGGATATAAATGAATGTACTGAAGGGCTTGCTCACTGTGGTCATCTCTGTGTGAACTCAGTGGGATCTTTCACTTGTGTCTGCCAGCCAGGCTTTGAACTGGGAGCTAATGGAAAACGGTGTTACAGGATTGAATTGGAAATTGTCAATAGCTGTGAAAAGAACAATGGTGGTTGTTCCCATCACTGTGAACATGAAATTGGTGGGCCCCATTGTTCCTGTAACCATGGACACCAGCTGGATTCAGATAAGAAAACATGCATAGACCTTGATGAATGTGAAAGTGGAGAAGCCTGCTGTGCCCAGCTCTGCATCAACTATTTAGGAGGCTATGAATGCAGCTGTCAGGAAGGCTTTGTGATCAGTTCTGATGGGTGTGGATGTGATGCTTTATATGATGATGAACTAGAGGAAGAACAAGAATTAGAAGTGAACTTTCCAGGCTTTCTAATCCAGAGCCCACCTCAACTGCTTCATTATGTTGCTACCTCTCTGACTCCCTCTTACAAAGATGAAGAGGAAGAGGAAAAAGCTTTACAAGAACTCACTGTTTTGCACGAAGTTGTCTGTTTAGGTGGCACCTTCGGACATGACTGTAGTTTGCGCTGTGAAGACTGCATGAATGGAGGCAAATGCCAGGAAGGAAGGAGTGGATGTTCCTGCCCAGCAGGCTGGGGTGGTGTTCTTTGTAATGAACTTGCTCCCCAGAGACTCATGGGAAAAGGTGTGGCAGCATCTGTGGTTGCCAGAGGAGGCACCTGTGATCCTCTGACTGGGCAGTGCTGGTGCCCCCCAGGGGTACGAGGGAAAACTTGTGAAGGATGCCTGAGAGGGTTCTTTGGGAAGGACTGCAGAAGAAAATGTAACTGTGCCAACAATGGCCATTGCCACAGGATGTATGGCACCTGTGTGTGTGAGCCCGGGTGCTTTGGGAGGTTTTGTCATCTGAACTGTCCCAAGGGGGTCTACGGAGCTGGCTGCTCTTCTGAATGTCAGTGTGTGGAGGAGAACACCCTGGAATGCAGTGCCAAAAATGGTAGTTGCACGTGCAAATATGGTTACCAAGGCAACAGATGCCAGAAAGCCTGCCCTGAGGGCCTCTGGGGACCAGAATGTCGCTTCTCTTGTGGATCCTGTGAGAATGGAGGTCACTGCAACAAAAAAACTGGCAACTGTGACTGCCCTCCTGGTTACACAGGAAAATCCTGTGCCTTGCAAGATCTAGAGCTACCGGGCTTTGTATTAACCTATATTTACACAGACAGATTTAATTCATTGGGTTTATATTTCCTCTCCCCCTTAGTCTGTCCACCAGGCACATATGAGAAGGACTGTAACCAGGCATGTCAGTGTGCAGCCAAGAATGAGGACTGTCACCCAGTCACAGGGAGATGCACTTGTCTGCCTGGCTACCATGGAAACCACAGTCATCTCCATAAGTGTGGGTGCCCGGAAGGCACTTATGGCCCATATTGCCAAAAGACATCTAAGTGTCTGAATGGTGCCAGCTGTGACCCAATGATTGGCACCTGTGACTGCCCTCCTGGCTTCATCGGAGCAGACTGCAGTCAAGCTTGTCCTGAAGGTCACTATGGGCAAGACTGTGTTCACCGGTGTTCTTGTGGCTTGGGACAGTGTGACCCAGTGACTGGAAGGTGTCAGTGTCCACCTGGCCAAATGGGAGACAGGTGTCAGCAAGGATGTCCCCAGACAAGATATGGCACAAATTGTGAGTTTAAATGTGCATGCCAAAATGGTGGACTTTGCAATCCCATGGATGGAAGCTGTACCTGTGGCCTTGGATGGACAGGAAATGATTGTGAAAAAGTGTGCCCACCTGGTTTTTATGGTTTGAATTGTTCTCACATCTGTGACTGCGAAAATGGAGCCAGTTGTGATGCACTGAGTGGACAGTGCACCTGCCTCCCAGGCTTCCACGGCAGCCAGCGTGAGAAAGAGTGTGGGCCTGGAATGTTTGGAGACAATTGTCATCAACTCTGTGACTGTGAAGGAGAAAGCCCTTGCCACCCAGTAACTGGAAAATGCCTCTGCCTACCAGGCAGAACTGGAGCCAAATGTGAAGCTGAATGCGTGCCAGGCCAGTTTGGACCCAACTGCTCTCTGAAGTGCCAATGTGCCCCCAGAGCTCGCTGTAACCCTCTCAACGGGAGCTGCACTTGCCCGCCTAAAAGAATGGGTCCAACCTGTGAGGAAAATGGTTCAGAGTACCCTCAATAA

XM_004834568.1 Coding sequence

Mecom MDS1 and EVI1 complex locus, transcript variant X8

Length: 2721 bp    Location: 47693612..47104929   Strand: -
>XM_004834568.1
ATGAGATCCAAAGGCAGGGCAAGGAAACTGGCCACAAGTAATGAGTGTGTATATGGCAACTACCCTGAAATATCTTTGGAAGAAATGCCAGATGCAGATGGAGTAGCCAGCACTCCCTCCCTCACTTTTCAAGAGCCATGCTCTCCAGCCACATCCAGTGAAGCATTTACTCCAAAGGAGAGCTCTCCTTATAAAGCTCCCATCTACATCCCTGATGACATCCCCATTCCTACTGAGTTTGAACTTCGAGAGTCAAATATGCCTGGAGCAGGACTAGGAATATGGACCAAAAGGAAGATTGAAGTAGGTGAAAAGTTTGGACCTTATGTGGGAGAGCAGAGGTCAAACCTGAAAGACCCCAGTTATGGATGGGAGATCTTAGATGAGTTTTGCAATGTCAAGTTCTGCATAGATGCCAGTCAACCAGATGTAGGAAGCTGGCTCAAGTACATCAGGTTCGCTGGCTGTTATGATCAGCACAACCTCGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATTGCGCCGGGAGAGGAGCTCCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACCATGGCACCTGACATCCACGAAGAACGGCAGTATCGATGTGAGGACTGTGACCAGCTCTTTGAATCCAAAGCTGAACTAGCAGATCACCAGAAGTTTCCCTGTAGTACACCTCACTCAGCATTCTCAATGGTGGAAGAAGACTTTCAACAAAAACTTGAAAGTGAAAATGACCTCCGAGAGATACACACCATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCTTGGAGAAACACATGTTGTCACATACTGAAGAGAGGGAATACAAGTGTGATCAGTGTCCCAAGGCATTTAACTGGAAGTCCAATTTAATTCGCCACCAGATGTCACATGACAGTGGAAAGCACTATGAATGTGAGAACTGTGCCAAGGTTTTCACGGACCCTAGCAACCTTCAGCGGCACATTCGCTCTCAGCACGTTGGTGCCCGGGCCCATGCATGCCCGGAGTGTGGCAAAACGTTTGCCACTTCGTCAGGCCTCAAACAACACAAGCACATCCACAGCAGTGTGAAGCCCTTTATCTCATTCTCTCAATCAATGTACCCATTTCCTGATAGAGACTTGAGATCGTTACCTTTGAAAATGGAACCCCAATCACCAAGTGAAGCAAAGAAACTACAGAAGGGAAACTCAGAGTCTCCCTTTGATCTCACCACTAAACGAAAGGATGAGAAGCCCTTGACTCCCGTCCCCTCCAAGCCTCCAGCAACACCTGCCACAAGCCAAGACCAGCCCCTGGATCTCAGTATGGGCAGTAGGAGTAGAGCCAGTGGGACCAAGCTGACTGAGCCTCGAAAAAACCATGTATTTGGGGAAAAGAAAGGAAGCAATGTTGAAGCAAGAGCAGCTTCAGATGGTTCCTTGCAGCATGCAAGACCCACTCCCTTCTTTATGGACCCTATTTACAGAGTAGAGAAAAGAAAACTAACTGACCCACTTGAAGCTTTAAAAGAGAAATACTTGAGACCTTCTCCAGGATTTTTGTTTCACCCACAAATGTCAGCTATTGAAAACATGGCAGAAAAGCTAGAGGGCTTCAGTGCCCTGAAACCTGAGGCCAGTGAGCTGCTACAGTCAGTGCCCTCCATGTTCAATTTCAGAGCACCTCCTAATACCCTGCCAGAGAACCTACTGCGTAAGGGAAAAGAGCGTTATACCTGCAGATACTGTGGTAAGATTTTTCCAAGGTCTGCGAACCTAACACGGCACTTGAGAACCCACACAGGAGAGCAGCCTTACAGATGCAAATACTGTGACAGATCATTTAGCATATCTTCAAACTTGCAACGACATGTTCGCAACATCCACAATAAGGAAAAACCGTTTAAATGTCACTTATGTGATAGGTGTTTTGGTCAGCAAACCAATTTAGACAGACATTTAAAGAAGCATGAGAATGGGAACATGTCTGGTACGGCAACATCGTCACCTCATTCTGAACTGGAAAGCACAGGCGCCATTCTGGATGACAAGGAAGATGCTTACTTCACAGAAATTAGGAATTTCATTGGGAATAGCAACCACAGCAGCCAGTCTCCCAGGAATGCAGAGGAGAGAATGAATGGCAGTCACTTTAAGGATGAAAAGCTTTTGGTGACTAGTCAAAATTCAGACTTACTGGATGATGAAGAAGTGGAAGACGAGGTGTTGTTGGATGAGGAGGATGAAGACAATGAACTTATGGGAAAAACCAGAAAGGAACCCATGACAAGTAATTTACATGAAGGAAACCCTGAGGATGACTTCGAAGAAGCCAGTGCCCTGGAGATGAGCTGTAAGACGTCCCCAGTGAGGTATAAAGAGGAAGAATATAAAACTGGACTTTCTGCTCTAGATCACATAAGGCACTTCACAGATAGCCTCAAAATGAGGAAAATGGAAGATAATCAATATACTGAAGCTGAGCTGTCTTCTTTTAGTACTTCCCATGTGCCAGAGGAACTTAAACAGCCGTTACACAGAAAGTCCAAATCACAGGCATATGCTATGATGTTGTCATTGTCCGACAAGGAGTCCCTCCATTCTGCATCTCACAGTTCTTCCACCGTGTGGCACAGCATGGCAAGGGCTGCAGCAGAATCCAGTGCCATCCAGTCCATAAGCCACGTATGA

XM_004834564.1 Coding sequence

Mecom MDS1 and EVI1 complex locus, transcript variant X4

Length: 3693 bp    Location: 47693612..47104929   Strand: -
>XM_004834564.1
ATGAGATCCAAAGGCAGGGCAAGGAAACTGGCCACAAGTAATGAGTGTGTATATGGCAACTACCCTGAAATATCTTTGGAAGAAATGCCAGATGCAGATGGAGTAGCCAGCACTCCCTCCCTCACTTTTCAAGAGCCATGCTCTCCAGCCACATCCAGTGAAGCATTTACTCCAAAGGAGAGCTCTCCTTATAAAGCTCCCATCTACATCCCTGATGACATCCCCATTCCTACTGAGTTTGAACTTCGAGAGTCAAATATGCCTGGAGCAGGACTAGGAATATGGACCAAAAGGAAGATTGAAGTAGGTGAAAAGTTTGGACCTTATGTGGGAGAGCAGAGGTCAAACCTGAAAGACCCCAGTTATGGATGGGAGATCTTAGATGAGTTTTGCAATGTCAAGTTCTGCATAGATGCCAGTCAACCAGATGTAGGAAGCTGGCTCAAGTACATCAGGTTCGCTGGCTGTTATGATCAGCACAACCTCGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATTGCGCCGGGAGAGGAGCTCCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACCATGGCACCTGACATCCACGAAGAACGGCAGTATCGATGTGAGGACTGTGACCAGCTCTTTGAATCCAAAGCTGAACTAGCAGATCACCAGAAGTTTCCCTGTAGTACACCTCACTCAGCATTCTCAATGGTGGAAGAAGACTTTCAACAAAAACTTGAAAGTGAAAATGACCTCCGAGAGATACACACCATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCTTGGAGAAACACATGTTGTCACATACTGAAGAGAGGGAATACAAGTGTGATCAGTGTCCCAAGGCATTTAACTGGAAGTCCAATTTAATTCGCCACCAGATGTCACATGACAGTGGAAAGCACTATGAATGTGAGAACTGTGCCAAGGTTTTCACGGACCCTAGCAACCTTCAGCGGCACATTCGCTCTCAGCACGTTGGTGCCCGGGCCCATGCATGCCCGGAGTGTGGCAAAACGTTTGCCACTTCGTCAGGCCTCAAACAACACAAGCACATCCACAGCAGTGTGAAGCCCTTTATCTGTGAGGTCTGCCATAAATCCTATACTCAGTTTTCAAACCTTTGTCGTCATAAGCGCATGCATGCTGATTGCAGAACCCAAATCAAGTGCAAAGACTGTGGACAAATGTTCAGCACTACGTCTTCCTTAAATAAACACAGGAGGTTTTGTGAGGGCAAGAACCATTTTGCGGCAGGTGGATTTTTTGGCCAAGGCATTTCACTTCCTGGAACCCCAGCTATGGATAAAACGTCCATGGTTAATATGAGTCATGCCAACCCGGGCCTTGCTGACTATTTTGGCGCCAATAGGCATCCTGCTGGTCTTACCTTTCCAACAGCTCCTGGATTTTCTTTTAGCTTCCCTGGTCTGTTTCCTTCCGGCTTGTACCACAGGCCTCCTTTGATACCTGCTAGTTCTCCTGTTAAAGGACTACCAAGTACTGAACAGACAAACAAAAGTCAAAGTCCCCTCATGACACATCCTCAGATACTGCCAGCTACACAGGATATTTTGAAGGCACTATCTAAACACCCACCTGTAGGGGACAATAAGCCAGTGGAGCTCCAGCCCGAGAGGTCCTCTGAAGAGAGGGCCCTTGAGAAAATCAGTGACCAGTCAGAGAGTAGTGACCTTGATGATGTCAGTACACCAAGTGGCAGTGACCTGGAAACAACCTCGGGCTCTGATCTGGAAAGTGACATTGAAAGTGATAAAGAGAAATTTAAAGAAAATGGTAAAATGTTCAAAGACAAAGTAAGCCCTCTTCAGAATCTGGCTTCAATAAATAATAAGAAAGAATACAGCAATCATTCCATTTTCTCACCATCTTTAGAGGAGCAAACTGCCGTGTCAGGAGCTGTGAATGATTCTATAAAGGCTATTGCTTCTATTGCTGAAAAATACTTTGGTTCAACAGGACTGGTGGGGCTGCAAGACAAAAAAGTTGGAGCTTTACCTTACCCTTCCATGTTTCCCCTCCCATTTTTTCCAGCATTCTCTCAATCAATGTACCCATTTCCTGATAGAGACTTGAGATCGTTACCTTTGAAAATGGAACCCCAATCACCAAGTGAAGCAAAGAAACTACAGAAGGGAAACTCAGAGTCTCCCTTTGATCTCACCACTAAACGAAAGGATGAGAAGCCCTTGACTCCCGTCCCCTCCAAGCCTCCAGCAACACCTGCCACAAGCCAAGACCAGCCCCTGGATCTCAGTATGGGCAGTAGGAGTAGAGCCAGTGGGACCAAGCTGACTGAGCCTCGAAAAAACCATGTATTTGGGGAAAAGAAAGGAAGCAATGTTGAAGCAAGAGCAGCTTCAGATGGTTCCTTGCAGCATGCAAGACCCACTCCCTTCTTTATGGACCCTATTTACAGAGTAGAGAAAAGAAAACTAACTGACCCACTTGAAGCTTTAAAAGAGAAATACTTGAGACCTTCTCCAGGATTTTTGTTTCACCCACAAATGTCAGCTATTGAAAACATGGCAGAAAAGCTAGAGGGCTTCAGTGCCCTGAAACCTGAGGCCAGTGAGCTGCTACAGTCAGTGCCCTCCATGTTCAATTTCAGAGCACCTCCTAATACCCTGCCAGAGAACCTACTGCGTAAGGGAAAAGAGCGTTATACCTGCAGATACTGTGGTAAGATTTTTCCAAGGTCTGCGAACCTAACACGGCACTTGAGAACCCACACAGGAGAGCAGCCTTACAGATGCAAATACTGTGACAGATCATTTAGCATATCTTCAAACTTGCAACGACATGTTCGCAACATCCACAATAAGGAAAAACCGTTTAAATGTCACTTATGTGATAGGTGTTTTGGTCAGCAAACCAATTTAGACAGACATTTAAAGAAGCATGAGAATGGGAACATGTCTGGTACGGCAACATCGTCACCTCATTCTGAACTGGAAAGCACAGGCGCCATTCTGGATGACAAGGAAGATGCTTACTTCACAGAAATTAGGAATTTCATTGGGAATAGCAACCACAGCAGCCAGTCTCCCAGGAATGCAGAGGAGAGAATGAATGGCAGTCACTTTAAGGATGAAAAGCTTTTGGTGACTAGTCAAAATTCAGACTTACTGGATGATGAAGAAGTGGAAGACGAGGTGTTGTTGGATGAGGAGGATGAAGACAATGAACTTATGGGAAAAACCAGAAAGGAACCCATGACAAGTAATTTACATGAAGGAAACCCTGAGGATGACTTCGAAGAAGCCAGTGCCCTGGAGATGAGCTGTAAGACGTCCCCAGTGAGGTATAAAGAGGAAGAATATAAAACTGGACTTTCTGCTCTAGATCACATAAGGCACTTCACAGATAGCCTCAAAATGAGGAAAATGGAAGATAATCAATATACTGAAGCTGAGCTGTCTTCTTTTAGTACTTCCCATGTGCCAGAGGAACTTAAACAGCCGTTACACAGAAAGTCCAAATCACAGGCATATGCTATGATGTTGTCATTGTCCGACAAGGAGTCCCTCCATTCTGCATCTCACAGTTCTTCCACCGTGTGGCACAGCATGGCAAGGGCTGCAGCAGAATCCAGTGCCATCCAGTCCATAAGCCACGTATGA

XM_004834561.1 Coding sequence

Mecom MDS1 and EVI1 complex locus, transcript variant X1

Length: 3720 bp    Location: 47693612..47104929   Strand: -
>XM_004834561.1
ATGAGATCCAAAGGCAGGGCAAGGAAACTGGCCACAAGTAATGAGTGTGTATATGGCAACTACCCTGAAATATCTTTGGAAGAAATGCCAGATGCAGATGGAGTAGCCAGCACTCCCTCCCTCACTTTTCAAGAGCCATGCTCTCCAGCCACATCCAGTGAAGCATTTACTCCAAAGGAGAGCTCTCCTTATAAAGCTCCCATCTACATCCCTGATGACATCCCCATTCCTACTGAGTTTGAACTTCGAGAGTCAAATATGCCTGGAGCAGGACTAGGAATATGGACCAAAAGGAAGATTGAAGTAGGTGAAAAGTTTGGACCTTATGTGGGAGAGCAGAGGTCAAACCTGAAAGACCCCAGTTATGGATGGGAGATCTTAGATGAGTTTTGCAATGTCAAGTTCTGCATAGATGCCAGTCAACCAGATGTAGGAAGCTGGCTCAAGTACATCAGGTTCGCTGGCTGTTATGATCAGCACAACCTCGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATTGCGCCGGGAGAGGAGCTCCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACCATGGCACCTGACATCCACGAAGAACGGCAGTATCGATGTGAGGACTGTGACCAGCTCTTTGAATCCAAAGCTGAACTAGCAGATCACCAGAAGTTTCCCTGTAGTACACCTCACTCAGCATTCTCAATGGTGGAAGAAGACTTTCAACAAAAACTTGAAAGTGAAAATGACCTCCGAGAGATACACACCATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCTTGGAGAAACACATGTTGTCACATACTGAAGAGAGGGAATACAAGTGTGATCAGTGTCCCAAGGCATTTAACTGGAAGTCCAATTTAATTCGCCACCAGATGTCACATGACAGTGGAAAGCACTATGAATGTGAGAACTGTGCCAAGGTTTTCACGGACCCTAGCAACCTTCAGCGGCACATTCGCTCTCAGCACGTTGGTGCCCGGGCCCATGCATGCCCGGAGTGTGGCAAAACGTTTGCCACTTCGTCAGGCCTCAAACAACACAAGCACATCCACAGCAGTGTGAAGCCCTTTATCTGTGAGGTCTGCCATAAATCCTATACTCAGTTTTCAAACCTTTGTCGTCATAAGCGCATGCATGCTGATTGCAGAACCCAAATCAAGTGCAAAGACTGTGGACAAATGTTCAGCACTACGTCTTCCTTAAATAAACACAGGAGGTTTTGTGAGGGCAAGAACCATTTTGCGGCAGGTGGATTTTTTGGCCAAGGCATTTCACTTCCTGGAACCCCAGCTATGGATAAAACGTCCATGGTTAATATGAGTCATGCCAACCCGGGCCTTGCTGACTATTTTGGCGCCAATAGGCATCCTGCTGGTCTTACCTTTCCAACAGCTCCTGGATTTTCTTTTAGCTTCCCTGGTCTGTTTCCTTCCGGCTTGTACCACAGGCCTCCTTTGATACCTGCTAGTTCTCCTGTTAAAGGACTACCAAGTACTGAACAGACAAACAAAAGTCAAAGTCCCCTCATGACACATCCTCAGATACTGCCAGCTACACAGGATATTTTGAAGGCACTATCTAAACACCCACCTGTAGGGGACAATAAGCCAGTGGAGCTCCAGCCCGAGAGGTCCTCTGAAGAGAGGGCCCTTGAGAAAATCAGTGACCAGTCAGAGAGTAGTGACCTTGATGATGTCAGTACACCAAGTGGCAGTGACCTGGAAACAACCTCGGGCTCTGATCTGGAAAGTGACATTGAAAGTGATAAAGAGAAATTTAAAGAAAATGGTAAAATGTTCAAAGACAAAGTAAGCCCTCTTCAGAATCTGGCTTCAATAAATAATAAGAAAGAATACAGCAATCATTCCATTTTCTCACCATCTTTAGAGGAGCAAACTGCCGTGTCAGGAGCTGTGAATGATTCTATAAAGGCTATTGCTTCTATTGCTGAAAAATACTTTGGTTCAACAGGACTGGTGGGGCTGCAAGACAAAAAAGTTGGAGCTTTACCTTACCCTTCCATGTTTCCCCTCCCATTTTTTCCAGCATTCTCTCAATCAATGTACCCATTTCCTGATAGAGACTTGAGATCGTTACCTTTGAAAATGGAACCCCAATCACCAAGTGAAGCAAAGAAACTACAGAAGGGAAACTCAGAGTCTCCCTTTGATCTCACCACTAAACGAAAGGATGAGAAGCCCTTGACTCCCGTCCCCTCCAAGCCTCCAGCAACACCTGCCACAAGCCAAGACCAGCCCCTGGATCTCAGTATGGGCAGTAGGAGTAGAGCCAGTGGGACCAAGCTGACTGAGCCTCGAAAAAACCATGTATTTGGGGAAAAGAAAGGAAGCAATGTTGAAGCAAGAGCAGCTTCAGATGGTTCCTTGCAGCATGCAAGACCCACTCCCTTCTTTATGGACCCTATTTACAGAGTAGAGAAAAGAAAACTAACTGACCCACTTGAAGCTTTAAAAGAGAAATACTTGAGACCTTCTCCAGGATTTTTGTTTCACCCACAATTCCAAGTGCCTGATCAGAGAACTTGGATGTCAGCTATTGAAAACATGGCAGAAAAGCTAGAGGGCTTCAGTGCCCTGAAACCTGAGGCCAGTGAGCTGCTACAGTCAGTGCCCTCCATGTTCAATTTCAGAGCACCTCCTAATACCCTGCCAGAGAACCTACTGCGTAAGGGAAAAGAGCGTTATACCTGCAGATACTGTGGTAAGATTTTTCCAAGGTCTGCGAACCTAACACGGCACTTGAGAACCCACACAGGAGAGCAGCCTTACAGATGCAAATACTGTGACAGATCATTTAGCATATCTTCAAACTTGCAACGACATGTTCGCAACATCCACAATAAGGAAAAACCGTTTAAATGTCACTTATGTGATAGGTGTTTTGGTCAGCAAACCAATTTAGACAGACATTTAAAGAAGCATGAGAATGGGAACATGTCTGGTACGGCAACATCGTCACCTCATTCTGAACTGGAAAGCACAGGCGCCATTCTGGATGACAAGGAAGATGCTTACTTCACAGAAATTAGGAATTTCATTGGGAATAGCAACCACAGCAGCCAGTCTCCCAGGAATGCAGAGGAGAGAATGAATGGCAGTCACTTTAAGGATGAAAAGCTTTTGGTGACTAGTCAAAATTCAGACTTACTGGATGATGAAGAAGTGGAAGACGAGGTGTTGTTGGATGAGGAGGATGAAGACAATGAACTTATGGGAAAAACCAGAAAGGAACCCATGACAAGTAATTTACATGAAGGAAACCCTGAGGATGACTTCGAAGAAGCCAGTGCCCTGGAGATGAGCTGTAAGACGTCCCCAGTGAGGTATAAAGAGGAAGAATATAAAACTGGACTTTCTGCTCTAGATCACATAAGGCACTTCACAGATAGCCTCAAAATGAGGAAAATGGAAGATAATCAATATACTGAAGCTGAGCTGTCTTCTTTTAGTACTTCCCATGTGCCAGAGGAACTTAAACAGCCGTTACACAGAAAGTCCAAATCACAGGCATATGCTATGATGTTGTCATTGTCCGACAAGGAGTCCCTCCATTCTGCATCTCACAGTTCTTCCACCGTGTGGCACAGCATGGCAAGGGCTGCAGCAGAATCCAGTGCCATCCAGTCCATAAGCCACGTATGA

XM_004834566.1 Coding sequence

Mecom MDS1 and EVI1 complex locus, transcript variant X6

High confidence: 4 potential gene matches
Length: 3351 bp    Location: 47166036..47104929   Strand: -
>XM_004834566.1
ATGATCTTAGATGAGTTTTGCAATGTCAAGTTCTGCATAGATGCCAGTCAACCAGATGTAGGAAGCTGGCTCAAGTACATCAGGTTCGCTGGCTGTTATGATCAGCACAACCTCGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATTGCGCCGGGAGAGGAGCTCCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACCATGGCACCTGACATCCACGAAGAACGGCAGTATCGATGTGAGGACTGTGACCAGCTCTTTGAATCCAAAGCTGAACTAGCAGATCACCAGAAGTTTCCCTGTAGTACACCTCACTCAGCATTCTCAATGGTGGAAGAAGACTTTCAACAAAAACTTGAAAGTGAAAATGACCTCCGAGAGATACACACCATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCTTGGAGAAACACATGTTGTCACATACTGAAGAGAGGGAATACAAGTGTGATCAGTGTCCCAAGGCATTTAACTGGAAGTCCAATTTAATTCGCCACCAGATGTCACATGACAGTGGAAAGCACTATGAATGTGAGAACTGTGCCAAGCAGGTTTTCACGGACCCTAGCAACCTTCAGCGGCACATTCGCTCTCAGCACGTTGGTGCCCGGGCCCATGCATGCCCGGAGTGTGGCAAAACGTTTGCCACTTCGTCAGGCCTCAAACAACACAAGCACATCCACAGCAGTGTGAAGCCCTTTATCTGTGAGGTCTGCCATAAATCCTATACTCAGTTTTCAAACCTTTGTCGTCATAAGCGCATGCATGCTGATTGCAGAACCCAAATCAAGTGCAAAGACTGTGGACAAATGTTCAGCACTACGTCTTCCTTAAATAAACACAGGAGGTTTTGTGAGGGCAAGAACCATTTTGCGGCAGGTGGATTTTTTGGCCAAGGCATTTCACTTCCTGGAACCCCAGCTATGGATAAAACGTCCATGGTTAATATGAGTCATGCCAACCCGGGCCTTGCTGACTATTTTGGCGCCAATAGGCATCCTGCTGGTCTTACCTTTCCAACAGCTCCTGGATTTTCTTTTAGCTTCCCTGGTCTGTTTCCTTCCGGCTTGTACCACAGGCCTCCTTTGATACCTGCTAGTTCTCCTGTTAAAGGACTACCAAGTACTGAACAGACAAACAAAAGTCAAAGTCCCCTCATGACACATCCTCAGATACTGCCAGCTACACAGGATATTTTGAAGGCACTATCTAAACACCCACCTGTAGGGGACAATAAGCCAGTGGAGCTCCAGCCCGAGAGGTCCTCTGAAGAGAGGGCCCTTGAGAAAATCAGTGACCAGTCAGAGAGTAGTGACCTTGATGATGTCAGTACACCAAGTGGCAGTGACCTGGAAACAACCTCGGGCTCTGATCTGGAAAGTGACATTGAAAGTGATAAAGAGAAATTTAAAGAAAATGGTAAAATGTTCAAAGACAAAGTAAGCCCTCTTCAGAATCTGGCTTCAATAAATAATAAGAAAGAATACAGCAATCATTCCATTTTCTCACCATCTTTAGAGGAGCAAACTGCCGTGTCAGGAGCTGTGAATGATTCTATAAAGGCTATTGCTTCTATTGCTGAAAAATACTTTGGTTCAACAGGACTGGTGGGGCTGCAAGACAAAAAAGTTGGAGCTTTACCTTACCCTTCCATGTTTCCCCTCCCATTTTTTCCAGCATTCTCTCAATCAATGTACCCATTTCCTGATAGAGACTTGAGATCGTTACCTTTGAAAATGGAACCCCAATCACCAAGTGAAGCAAAGAAACTACAGAAGGGAAACTCAGAGTCTCCCTTTGATCTCACCACTAAACGAAAGGATGAGAAGCCCTTGACTCCCGTCCCCTCCAAGCCTCCAGCAACACCTGCCACAAGCCAAGACCAGCCCCTGGATCTCAGTATGGGCAGTAGGAGTAGAGCCAGTGGGACCAAGCTGACTGAGCCTCGAAAAAACCATGTATTTGGGGAAAAGAAAGGAAGCAATGTTGAAGCAAGAGCAGCTTCAGATGGTTCCTTGCAGCATGCAAGACCCACTCCCTTCTTTATGGACCCTATTTACAGAGTAGAGAAAAGAAAACTAACTGACCCACTTGAAGCTTTAAAAGAGAAATACTTGAGACCTTCTCCAGGATTTTTGTTTCACCCACAATTCCAAGTGCCTGATCAGAGAACTTGGATGTCAGCTATTGAAAACATGGCAGAAAAGCTAGAGGGCTTCAGTGCCCTGAAACCTGAGGCCAGTGAGCTGCTACAGTCAGTGCCCTCCATGTTCAATTTCAGAGCACCTCCTAATACCCTGCCAGAGAACCTACTGCGTAAGGGAAAAGAGCGTTATACCTGCAGATACTGTGGTAAGATTTTTCCAAGGTCTGCGAACCTAACACGGCACTTGAGAACCCACACAGGAGAGCAGCCTTACAGATGCAAATACTGTGACAGATCATTTAGCATATCTTCAAACTTGCAACGACATGTTCGCAACATCCACAATAAGGAAAAACCGTTTAAATGTCACTTATGTGATAGGTGTTTTGGTCAGCAAACCAATTTAGACAGACATTTAAAGAAGCATGAGAATGGGAACATGTCTGGTACGGCAACATCGTCACCTCATTCTGAACTGGAAAGCACAGGCGCCATTCTGGATGACAAGGAAGATGCTTACTTCACAGAAATTAGGAATTTCATTGGGAATAGCAACCACAGCAGCCAGTCTCCCAGGAATGCAGAGGAGAGAATGAATGGCAGTCACTTTAAGGATGAAAAGCTTTTGGTGACTAGTCAAAATTCAGACTTACTGGATGATGAAGAAGTGGAAGACGAGGTGTTGTTGGATGAGGAGGATGAAGACAATGAACTTATGGGAAAAACCAGAAAGGAACCCATGACAAGTAATTTACATGAAGGAAACCCTGAGGATGACTTCGAAGAAGCCAGTGCCCTGGAGATGAGCTGTAAGACGTCCCCAGTGAGGTATAAAGAGGAAGAATATAAAACTGGACTTTCTGCTCTAGATCACATAAGGCACTTCACAGATAGCCTCAAAATGAGGAAAATGGAAGATAATCAATATACTGAAGCTGAGCTGTCTTCTTTTAGTACTTCCCATGTGCCAGAGGAACTTAAACAGCCGTTACACAGAAAGTCCAAATCACAGGCATATGCTATGATGTTGTCATTGTCCGACAAGGAGTCCCTCCATTCTGCATCTCACAGTTCTTCCACCGTGTGGCACAGCATGGCAAGGGCTGCAGCAGAATCCAGTGCCATCCAGTCCATAAGCCACGTATGA

XM_004834570.1 Coding sequence

Actrt3 actin-related protein T3, transcript variant X2

Length: 945 bp    Location: 47821733..47818647   Strand: -
>XM_004834570.1
ATGATTACATTCGTCGTGGGGAGTTGCTATCCTGTGGAGCGTGGTCTCATCACTTCCTGGGGGGACATGGAGACAGTGTGGAAGCATATCTATGACTGTAATCTGAAACTAAAGCCCTGTGATGGCCCAGTCTTGATTACTGAGCCAGCACTGAATCCATTGGTCAACCGGCAACAAATCATTGAAGTTTTTTTTGAGCATCTGGGTGTCCCTGCTTTCTATATGTCCACCCAAGCTTTGCTGGCTCTCTTTGCTGCTGGCTTCACTACTGGCTTGGTGCTGAATTCGGGTGCCGGGCTTACCCAGTGTGTGCCAGTCTTTGAGGGTTACTGTCTGCCTTATGGCGTACAACAGCTACATCTGGCAGGCCTTGACCTCACCAACTACCTCAAGATGCTGCTGATGGACCACGGAGTCACGCTGCTTAGTGGTGCAGACAGAAAGACTGTCGCAGACATTAAGGAGAACTTTTGTTATGTGGCAGTGAACTATGAAGAGGAAATGGCCAAGAAATCCCATTCCCTAGAGAAAGTTTACGAACTACCTGATGGAATAACCATCAAGCTCCACGATCAGCTCTTTCGTTGTCCAGAGGCCCTCTTCTCTCCATGTCTCATGAACATTGATGCCCCTGGCATCGATAAGATGTGCTTCAGCAGTGTAATGAAATGCGACACAGATCTGAGGAATTCCTTCTTCTCCAATATTGTCCTTGCTGGGGGATCAGCCTCCTTCCCTGGCTTAGACCAGCGGCTATTTAAAGATATAGCAAAGATGGTGCCTGCTAACACACCTGTACAGGTTGCAGCTCCCTCAGAAAGGAAATTGTCAGTGTGGATGGGGGGTTCTATTCTTGCCTCCCTGTCTGCCTTCCAAGACATGTGGATCACTGCTGCAGAATTCAAAGAAGTTGGACCCAACATAGTACACCAAAGATGCTTCTGA

XM_004834571.1 Coding sequence

Mynn myoneurin, transcript variant X1

High confidence: 4 potential gene matches
Length: 1830 bp    Location: 47823345..47833988   Strand: +
>XM_004834571.1
ATGCAGTATTCACACCACTGTGAGCACCTTTTAGAGAGACTGAACAAACAACGAGAAGCAGGTTTTCTTTGTGACTGCACCATAGTGATTGGGGAATTCCAGTTTAAAGCCCATAGGAATGTGCTCGCCTCGTTTAGTGAGTATTTTGGTGCGATCTACAGAAGCACTTCTGAAAACAATGTTTTTCTTGATCAGAGTCAGGTGAAGGCTGATGGATTTCAGAAATTGTTGGAGTTTATATACACAGGAACTTTAAATCTTGACAGTTGGAATGTTAAAGAAATTCATCAGGCTGCTGACTTTCTCAAAGTGGAAGAGGTGGTAACTAAATGTAAAATAAAAATGGAAGATTTTGCTTTTATTGCTAATCCCTCTTCTACAGAGATATCTAGTATTACTGGAAACATTGAATTGAATCAACAGACGTGTCTTCTTACTCTACGAGATTATAACAACCGGGAGAAATCAGAAGAATCTACAGATTTAGTTCAGGCAAATCCTAAACAAGGGGCTTTAGCAAAGAAGTCATCTCAAACTAAAAAGAAGAAAAAAGCTTTCAACTCCCAGAAAACAGGGCAGAATAAAACAATGCAATATCCCAGTGACATTTTAGAAAACACATCCGTTGAATTATTCCTAGATGCAAATAAATTGTCCACACCTGTAGCTGAACAAGTTGCACAAAGAAATAATTCAGAACTTGAGTTGACATCAGTTGTGGAGAATACTTTTCCAGCACAAGATATTGTGCAAACTGTTACAGTGAAACAGAAACGTGGAAAATCACAGCCAAATTGTGCTCTGAAAGAACACTCTATGTCTAATATAGCCAGTGTCAAGAGTCCTTATGAGCTGGAGAATTCTGGGGAAGAGCTGGATCAGAAGTATTCCAAGGCCAAGCCAATGTGTAACACCTGTGGGAAAGTATTTTCAGAAGCCAGCAGTTTGAGAAGGCACATGAGAATACATAAAGGAGTCAAACCTTATGTGTGCCACTTGTGTGGGAAGGCATTTACCCAGTGTAATCAGCTGAAAACACATGTAAGAACTCATACAGGTGAGAGGCCATACAAATGTGAATTATGTGATAAAGGATTTGCCCAGAAATGCCAGCTTGTCTTCCATAGTCGAATGCATCATGGTGAGGAAAAACCTTATAAATGTGATGTATGCAATTTACAGTTTGCAACTTCTAGCAATCTCAAGATTCATGCAAGGAAGCATAGCGGAGAGAAGCCATATGTTTGTGATAGATGTGGACAGAGATTTGCACAAGCTAGCACACTGACCTATCATGTCCGTAGGCATACGGGAGAAAAGCCTTACGTATGTGACACTTGTGGGAAGGCATTTGCTGTTTCTAGTTCTCTTATCACTCATTCTCGAAAGCATACAGGTGAAAAACCATACATATGTGGTATTTGTGGGAAAAGTTTTATTTCCTCAGGAGAGCTCAACAAACACTTTCGATCCCATACAGGAGAAAGACCATTTATCTGTGAATTATGTGGAAATTCTTATACAGATATTAAAAATTTAAAGAAGCACAAAACAAAAGTCCATTCTGGTGCAGATAAAACTCTAGAGTCCAGTGCAGAGGATCATACTTTGAATGAACAGGATTCCATACAGAAAAGTCCTTTGTCAGAAACTATAGATGTGAAGCCTTCTGATATGACTCTACCCCTAGCTCTTCCACTTGGGACTGAGGACCAACACATGCTTCTGCCTGTCACAGATAATCAGTCTCCTACATCAGATACATTGTTGAGGTCAACTGTGAATGGGTATTCAGAACCACAATTGATTTTTTTACAACAATTATACTGA

XM_004835171.1 Coding sequence

Lrrc34 leucine rich repeat containing 34

High confidence: 4 potential gene matches
Length: 1671 bp    Location: 47863809..47837810   Strand: -
>XM_004835171.1
ATGAGGAGCAGCTTGGAGGAGGCCGACCCTGCTGCGGCCCCCACTCCGGCCCCGGCCCAGGCGGGTAAGCACGGTGAGGAGCAGGATGCCTTTGGGTGTCCACTGGCCCGGACAAACGCGCGAGGAGACGCACTGGCTGATTGCGGAAGCTGTAGGCCCCGGGAACCCCAGCTGTGGCCCGAACTCCGGGTCCAAGGGTCAGCACTAGAAGCTAAAGCAGTGTGCTGGCAGGCCGAAGGCTGGTGCTGGAAGCTGAAGAATCTGTGCCAGAAGCCAGGAGACAACAGCCAAGGTGAAGGCGAAGACTGGAGTTCCTCTGAAGAGAACAGCCGAAGCTCCTCCGAGGAAAATCAGCTGAAATTCTTCCCTCTAGTTCTTTTTATACCGTTGCAACAACAGACCCCCATGGAAGCTCCAGCATCTATTGCTACTCTCCAGGAAAGTTACTGTAAACTATGTTCAGAAAAGTCCCAGAATATTAATCCTTTTATATTGTGTGTACTCCAAAAAGTGGATGAAGAAATTAAAAAGGGACCCAAAGAAGGAATCACATTGAGCATTGCAGGTAACAATCGCTTAATCCCAGTACAAAAAGTGACAGCTGAAGATTTTTGTATTCTTTCTAAACTTCTAAAGGATAATCCGTATATTAATGGTTTGGATGTTAGATATAATCTCATAAATGATATTGGTGCACACTATGCTGCGAAACTTCTTCAGAAACAACTGTACCTCATTTACTTAAACCTTATGTTTAATGATATTGGGCCCGAAGGTGGAGAATTGCTTGCTAAAGCATTACATAAGAATACAACTCTGAAATACTTAAGAATGACTGGAAATAAGATTGAAAATAAAGGTGGAATGGTTTTTGCTGCAATGTTGCAAATTAATTCATCCTTAGAGAAATTAGATGTGGGTGACTGTGATCTGGGCATGCAAAGTGTGGTAGCATTTGCCACAGTACTAACTCAAAACCAAGCAATTAAGGGAATAAACCTAAACCGACCTATACTGTACGGGGAACAGGAGGAGTCCACAGTCCATCTAGGTCACATGTTGAAAGAAAATCACTGCCTTGTTGAACTACACATGTGTAAGCATGGTATAAAAAACTGCGGTTTCCATCAGTTATGCAATGCACTGTATCTGAACAGTAGCCTACGATACCTTGATGTCAGCTGCAATAAAATAACTCGTGATGGAATGGTGTATTTAGCTGATGTACTGAAAACCAATGCTACCCTGGAAGTAATAGATCTTTCTTTTAACAGAATAGAAAATGCTGGTGCAAACTACCTCAGTGAATCTCTTACTTCACACAACAGGAGTCTTAAAGCATTGTCAGTAGTCAGCAACAACATAGAGGGAGAAGGACTTGTTGCACTTTCTCAATCAATGAAAACAAATCCTACACTATCTCATATCTACATCTGGGGAAACAAATTTGATGAGGCTACATGTGTGGCATATTCAGATTTAATTCAAAAGGATCGTTTGAAGCCAGAAAATACTGATGTGGAGCCATTTGTGGTAGATGGACATGTGTATCTAGCAGAAGTCTCCAATGGCCTTAAAAAACATTACTATTGGACACCAACTTATGGAGATGCTTATGGGCACTCATCAAACTCAGGCTTTGCTCTTGTTCCAGTAGGTCAAAATTTATGA

XM_004834579.1 Coding sequence

Phc3 polyhomeotic homolog 3 (Drosophila), transcript variant X1

High confidence: 4 potential gene matches
Length: 2988 bp    Location: 48238279..48153414   Strand: -
>XM_004834579.1
ATGGCGGAAGCGGAATTTAAGGACCACAGTACAACTATGGATAGTGAACCAAACCCTGGAGCATCTTCTGTGTCCACCACAACCAGTAGCACCACCACCACCACCATCACTACCTCCTCCTCTCGAATGCAGCAGCCACAGGTTTCAGTCTACAGTGGCTCAGACCGACACGCTGTTCAGGTAATTCAACAGGCATTGCATCGCCCCCCCAGTTCAGCTGCTCAGTACCTGCAGCAGATGTATGCAGCTCAGCAGCAGCACTTGATGCTACACACTGCTGCCCTTCAGCAGCAACATTTAAGCAGCTCCCAGCTCCAGAGCCTTGCTGCCGTGCAGGCAAGTTTGTCCAGTGGAAGACCATCTACATCCCCAACAGGAAGTGTCACTCAACAGTCAAGTATGTCCCAGACATCTATCAACCTCTCCACTTCTCCTACACCTGCACAGTTAATAAGCCGTTCCCAGGCTTCCAGTTCTACCAGCGGCAGTATTACCCAACAGACTATGTTACTAGGGAGTACCTCCCCTACCCTAACGGCAAGCCAAGCTCAAATGTATCTCCGAGCTCAAATGCTGATTTTCACACCCGCTACCACTGTGGCTGCTGTACAGTCTGACATTCCTGTTGTCTCGTCGTCATCGTCATCTTCCTGTCAGTCTGCAGCTACTCAGGTTCAGAATTTAACATTACGCAGCCAGAAGTTGGGTGTATTATCTAGCTCACAGAATGGTCCACCAAAAAGCACTAGTCAAACTCAGTCATTGACAATTTGTCATAACAAAACAACAGTGACCAGTTCTAAAGTCAGCCAACGAGATCCTTCTCCAGAATGTAATAAGAAAGGAGAGAGTCCAAGTCTGGAATCACGAAGCACAGCTGTCACTCGGACATCAAGTATTCACCAGTTAATAGCACCAGCTTCATATTCTCCAATTCAACCTCATTCTCTAATAAAACATCAACAGATTCCTCTTCATTCACCACCTCCCAAGGTTTCCCATCATCAGCTGATATTACAACAGCAGCAACAGCAAATTCAGCCAATCACACTTCAGAATTCAACTCAAGATCCACCCCCATCCCAGCACTGTATACCACTCCAAAACCATGGCCTTCCTCCAGCTCCCAGCAGTGCTCAGTCACAGCATTGTTCACCGATTCAGAGCCATCCCCCTCCTTTAACGGTATCCCCTAATCAGTCACAGTCAGCCCAGCAGTCTGTAGTAGTGTCTCCTCCACCACCTCATTCACCAAGTCAGTCTCCTACTATAATAATTCATCCACAAGCACTTATTCAGCCACACCCTCTTGTGTCATCAGCTCTTCAGCCAGGGCCAAATTTGCAGCAGTCTGCTGCTAATCAGGTGCAACCCACAGCACAACTGAATCTTCCATCCCATCTTCCACTTCCAGCTTCCCCTCTTGTACACATTGGCCCAGTTCAGCAGTCTGCTTTGGTGTCCCCAGGTCAGCAGATTGTGTCTCCATCACACCAGCAGTATTCAACCCTGCAGTCCTCTCCAATCCCAATTGCAACCCCTCCACAGATGTCGACATCTCCTCCAGCTCAGATTCCACCACTACCCTTACAGTCTATGCAGTCTTTACAAGTGCAGCCTGAAATTCTATCCCAGGGCCAGGTTTTGGTGCAGAATGCTTTGGTGTCTGAAGAGGAGCTTCCAGCTGCAGAAGCTTTGGTCCAGTTGCCATTTCAGACTCTTCCTCCTCCACAGACTGTTGCGGTAAACCTACAAGTACAACCACCAGCATCTGTTGATCCACCAGTGGTTTATCAAGTAGAAGATGTGTGTGAGGAAGAAATGCCAGAGGAGTCTGATGAATGTGTCCGGATGGATAGAACTCCGCCACCTCCCACTTTGTCTCCAGCAGCTATAACTGTGGGGAGAGGAGAGGATTTGACTTCTGAACATCCTTTGTTAGAGCAAGTGGAATTACCTGCTGTGGCATCAGTCAGCGCTTCAGTAATTAAATCTCCATCAGATCCCTCACATGTTTCCGTTCCTGCCCCTCCACTTTTACTTCCAGCTGCTACCACAAGGAGTACTAGTACATCTATGCCTGGTAGCACTCCCAGCATTGAAAACAAGCCTCCACAGGCTATTGTCAAACCACAGATCTTGACCCATGTTATTGAAGGGTTTGTGATTCAGGAGGGATTGGAGCCATTTCCTGTTAGTCGTTCATCTTTGCTAATAGAACAACCTGTGAAAAAAAGGCCTCTTTTGGATAATCAGGTGATAAATTCTGTGTGTGTTCAACAAGAGCTACAGAACAATACAAAGCATGCAGATAATTCATCTGATACAGAGATGGAAGACATGACTGCTGAAGAGACATTAGAAGAAATGGACAGTGAGTTGCTCAAGTGTGAATTCTGTGGGAAAATGGGATATGCTAATGAATTTTTGCGGTCAAAACGATTCTGCACTATGTCATGTGCTAAAAGGTACAATGTTAGCTGTTCTAAAAAATTTGCACTTAGTCGTTGGAATCGAAAGCCTGATAATCAAAGTCTTGGGCATCGTGGCCGTCGTCCAAGTGGTCCTGAAGGGGCAGCGAGAGAACATATCCTTAGGCAGCTTCCAATTACTTATCCATCTGCAGAAGAAGACTTGGCTTCTCATGAAGATTCTGTGCCATCTGCTATGACAACTCGTCTGCGCAGGCAGAGTGAGCGGGAAAGAGAACGTGAACTTCGTGATGTAAGAATTAGGAAAATGCCTGAGAACAATGACTTGCTTCCAGTTTCCCAGACAGAGCCCTCTATATGGACAGTTGATGATGTCTGGGCCTTCATCCATTCTTTGCCTGGCTGCCAGGATATTGCAGATGAGTTCAGAGCACAAGAGATTGATGGACAGGCCCTTCTCTTGCTAAAAGAAGACCATCTCATGAGTGCAATGAATATTAAGTTAGGTCCAGCTCTAAAGATCTGTGCACGCATCAACTCTCTGAAGGAGTCTTAA

XM_004834589.1 Coding sequence

Rpl22l1 ribosomal protein L22-like 1, transcript variant X4

High confidence: 3 potential gene matches
Length: 366 bp    Location: 48931508..48928225   Strand: -
>XM_004834589.1
ATGGCTCCTAAAGACAAGAAGCCTAAGAGGTCAACCTGGAAATTCAATTTGGATCTTACTCACCCAGTAGAAGATGGAATTTTTGATTCTGGAAATTTTGAGCAGTTTTTGAGGGAGAAGGTTAAAGTTAATGGGAAAACCGGAAATCTTGGGAATGTTGTTCACATTGAACGCTTCAAGAATAAAATCACAGTTGTTTCCGAGAAACAGTTCTCTAAAAGGTATTTGAAATATCTTACCAAAAAATACCTTAAAAAGAATAATCTTCGTGATTGGCTTCGTGTGGTTGCATCTGACAAAGAGACTTATGAACTCCGGTACTTCCAGATTAGTCAAGATGAAGATGGATCAGAATCTGAGGAGTAG

XM_004834590.1 Coding sequence

Eif5a2 eukaryotic translation initiation factor 5A2, transcript variant X1

Length: 462 bp    Location: 48968300..48951186   Strand: -
>XM_004834590.1
ATGGCGGACGAAATTGATTTCACTACTGGTGATGCCGGTGCTTCCAGCACTTACCCTATGCAGTGCTCGGCCCTGCGCAAAAACGGCTTCGTGGTGCTCAAAGGACGACCCTGCAAAATAGTGGAGATGTCAACTTCCAAAACTGGAAAGCACGGTCATGCCAAAGTACACCTTGTTGGAATTGATATTTTCACAGGGAAAAAATACGAAGATATTTGCCCTTCTACTCACAACATGGATGTTCCAAATATTAAAAGAAATGATTATCAACTGATATGCATTCAGGATGGTTACCTTTCCCTGCTAACAGAAACTGGTGAAGTCCGTGAGGATCTTAAACTGCCAGAAGGTGAACTAGGCAAAGAAATAGAAGGAAAATACAATGCAGGTGAAGATGTACAGGTTTCTGTCATGTGTGCCATGAGCGAAGAGTATGCTGTAGCCATAAAGCCCTGCAAATAA

XM_004834593.1 Coding sequence

Slc2a2 solute carrier family 2 (facilitated glucose transporter), member 2, transcript variant X2

Length: 1575 bp    Location: 49056342..49029623   Strand: -
>XM_004834593.1
ATGGCAGGAGATAAGATCACTGGAACCTTGGCTTTCACTGTCTTCACTGCTGTACTGAGTTCTTTCCAGTTTGGATACAACATTGGTGTGATCAATGCACCTCAACAGATAATAATATCTCATTATAGACATGTTTTGGGTGTTCCACTGGATGATCGAAAGGCTACCAACAACTATGTTATCAACAGTACAGATGCACTGCCCATCTCCCCACACCCAGGGACATCAACACCAGTCCCTTGGCCTGAGGAAGAAACTGTGACATCTACTGGCCTAGTCACCATGCTCTGGTCCTTGTCTGTGTCCAGCTTTGCAGTGGGTGGAATGATTGCATCATTCTTTGGTGGGTGGCTTGGGGACAAGCTTGGAAGAATCAAAGCCTTGCTCGCAGCAAACAGCCTCTCATTAGTTGGAGCTCTCTTGATGGGGTGTTCCAAATTAGGACCATCTCATATTCTCATAATCGCAGGAAGAAGTATATCAGGACTCTACTGTGGGCTAATTTCAGGGCTGGTTCCAATGTACATTGGTGAAATTGCTCCAACCTCGCTCAGGGGCGCGCTTGGCACTCTTCACCAGCTGGCCATTGTCACAGGCATTCTTATCAGTCAGATTATTGGCCTTGACTTTATCCTGGGCAATCAAGATCTGTGGCACATTCTGCTTGGCCTATCTGCTGGGCCAGCTCTTCTGCAGTCTCTGTTATTAATCTTCTGTCCAGAAAGCCCCAGGTATCTTTACATCAAGTTGGAAGAGGAAGTCAAAGCCAAGAAAAGTTTGAAAAGACTCAGAGGAAGTAATGATGTCACCAAAGACATGAATGAGATGAAAAAGGAGAAAGAAGAATCATCAAGTGAGCAGAAAGTTTCTGTGACTCAACTCTTCACCAATTCCACCTACCGACAGCCTTTGATAGTGGCATTAATGCTGCACATGGCTCAGCAATTTTCTGGGATCAATGCAATCTTTTACTACTCAACCAGCATTTTTCAGACAGCTGGACTCAGCCAGCCTGTTTATGCAACCATTGGAGTTGGCGCCATCAACATGGTTTTCACTGCTGTTTCTGTATTTCTTGTGGAGAAGGCAGGACGACGCTCTCTGTTTCTAATCGGAATGAGTGGGATGTTTTTCTGTGCCATCTTCATGTCAGTGGGGCTTGTGCTACTGGATAAGTTTGCTTGGATGAGTTACATGAGCATGTCAGCCATATTTCTCTTTGTCAGTTTCTTTGAAATTGGGCCAGGCCCCATCCCCTGGTTCATGGTGGCTGAGTTCTTCAGCCAAGGACCACGCCCGACAGCTTTAGCACTAGCTGCGTTCAGCAACTGGGCTTGCAATTTCATTATAGCTTTGTGTTTCCAGTACATTGCGGATTTCTGTGGACCTTATGTGTTTTTCCTCTTTGCTGGAGTGGTCCTGGCCTTTACTCTGTTTACATTTTTTAAAGTTCCAGAAACCAAGGGAAAGTCTTTTGAGGAAATTGCTGCAGAATTCCGGAAAAAGAGTGGTTCAGCCAAACGGTCAAAAGCTCCTATAGAAATGGAATTCCTTAGAGCTACAGGGACTGTATAA

XM_004834596.1 Coding sequence

Tnik TRAF2 and NCK interacting kinase, transcript variant X3

Length: 3972 bp    Location: 49498015..49087986   Strand: -
>XM_004834596.1
ATGGCGAGCGACTCCCCGGCTCGCAGCCTGGATGAAATCGATCTCTCGGCTCTGAGGGACCCTGCAGGGATCTTTGAATTGGTGGAACTTGTTGGAAATGGAACATATGGGCAAGTTTATAAGGGTCGTCATGTCAAAACTGGCCAGCTTGCAGCCATCAAGGTTATGGATGTCACAGGGGATGAAGAGGAAGAAATCAAACAAGAAATTAACATGTTGAAGAAATATTCTCATCACCGAAATATAGCTACATACTATGGTGCTTTTATCAAAAAGAACCCTCCAGGCATGGATGACCAACTGTGGTTGGTGATGGAGTTTTGTGGCGCTGGCTCTGTCACTGACCTGATCAAAAACACGAAAGGCAACACGTTGAAAGAAGAGTGGATTGCGTACATCTGCAGAGAGATCTTACGGGGGCTGAGTCACCTTCACCAGCATAAAGTGATTCATCGGGATATTAAAGGGCAAAACGTCTTGTTGACTGAAAATGCAGAAGTTAAACTAGTGGACTTTGGAGTCAGTGCCCAGCTTGACCGCACAGTGGGCAGGAGGAACACTTTCATTGGGACACCCTACTGGATGGCACCAGAAGTCATTGCCTGTGATGAAAACCCAGATGCCACATATGATTTCAAGAGTGACTTGTGGTCTTTGGGAATCACCGCCATAGAGATGGCAGAAGGTGCTCCCCCTCTCTGTGACATGCACCCCATGAGAGCCCTCTTCCTCATCCCTCGGAACCCAGCACCTCGGCTGAAGTCTAAGAAGTGGTCAAAAAAATTCCAGTCATTTATTGAGAGCTGCTTGGTAAAGAATCACAGCCAGCGACCAGCAACAGAGCAACTGATGAAGCATCCGTTTATAAGAGACCAACCGAATGAGCGCCAGGTCCGCATTCAACTCAAGGACCATATTGATAGAACAAAGAAAAAAAGAGGAGAAAAAGATGAGACAGAGTATGAGTACAGTGGAAGTGAGGAGGAGGAAGAGGAGAATGACTCTGGAGAGCCCAGCTCCATCCTGAACCTGCCTGGGGAGTCGACCCTGCGGCGGGACTTTCTGAGACTCCAACTGGCCAACAAGGAGCGTTCAGAGGCCCTTCGAAGGCAGCAGCTGGAGCAGCAGCAGCGGGAGAATGAGGAGCACAAGAGGCAGCTGCTAGCTGAGCGCCAGAAGCGCATCGAGGAGCAGAAGGAGCAGCGGCGGCGGCTGGAAGAGCAACAAAGGCGAGAGAAGGAGCTGCGGAAGCAGCAGGAGAGGGAGCAACGCCGGCACTATGAGGAGCAGATGCGCAGGGAGGAGGAGAGGAGGCGCGCAGAGCATGAGCAGGAATATAAGCGCAAGCAATTGGAAGAACAGAGACAAGCAGAAAGGCTACAGAGGCAGCTAAAGCAAGAGAGAGACTATTTGGTTTCTCTTCAGCATCAGCGGCAGGAGCAGAGGCCCCTAGAGAAGAAGCCACTGTACCATTACAAAGAAGGGATGAGTCCTAGTGAGAAGCCAGCATGGGCCAAAGAGGTAGAAGAACGGTCAAGACTCAACCGGCAGAGTTCACCTGCCATGCCTCACAAGGTTGCCAACAGGATTTCTGACCCCAACCTGCCCCCAAGGTCGGAGTCCTTCAGCATTAGTGGAGTTCAACCTGCTCGAACACCCCCTATGCTCAGACCTGTTGATCCCCAGATCCCACAGCTGGTGGCTGTAAAATCCCAGGGACCTGCCTTGACCGCCTCTCAGTCAGTGCATGAGCAGCCTACAAAAGGCCTCTCTGGATTTCAGGAGGCTCTGAACGTGACCTCTCACCGTGTTGAGATGCCACGCCAGAACTCAGATCCCACTTCTGAAAACCCTCCTCTCCCCACTCGCATTGAGAAGTTTGACCGAAGCTCTTGGTTACGACAGGAAGAAGATATTCCACCAAAGGTGCCTCAAAGAACAACTTCTATATCCCCGGCGTTAGCCAGAAAGAATTCACCTGGAAATGGTAGTGCTTTGGGACCCAGACTAGGATCTCAACCCATCAGAGCAAGCAACCCTGATCTCCGGAGAACAGAGCCGGTCTTGGACAGCCCCTTGCAGAGGACCAGCAGTGGCAGTTCCTCCAGCTCCAGCACCCCCAGCTCCCAGCCCAGCTCCCAAGGAGGCTCCCAGCCTGGCTCGCAGGCAGGATCCAGTGAACGGACCAGAGTTCGAGCCAACAGTAAGTCGGAAGGATCACCTGTGCTCCCCCATGAGCCTTCCAAGGTGAAACCAGAAGAATCCAGGGATATTACCCGGCCCAGCCGACCAGCTGATCTGACGGCATTAGCCAAGGAATTAAGAGAACTGCGGATTGAAGAAACAAACCGCCCACTGAAGAAGGTGACTGATTATTCTTCTTCCAGTGAAGAGTCGGAGAGTAGTGAGGAGGAGGAGGAAGACGGAGAAAGTGAGACCCATGATGGGAGTGTGGCTGTCAGTGACATACCCAGACTCATACCAACAGGAGCTCCAGGAAGCAATGAGCAGTACAATGTGGGAATGATCGGAACACATGGGCTGGAGACCTCTCACGCAGACACTTTTAGCAGCAGTATTTCAAGAGAAGGAACCTTAATGATTAGAGAGACAGCTGGAGAGAAGAAGCGATCCGGCCACAGTGACAGCAATGGCTTCGCTGGCCACATCAATCTCCCTGACTTGGTGCAGCAGAGCCATTCCCCAGCTGGAACCCCAACTGAGGGCCTGGGGCGTGTCTCCACCCATCCCCAGGAGATGGACTCCGGGACTGAATATGGCATGGGAAGCAGCACCAAAGCCTCCTTCACTCCATTTGTGGACCCCAGAGTATACCAGACATCTCCCACTGATGAAGATGAGGAGGATGAAGAATCATCAGCTGCAGCTCTGTTTACTAGTGAACTTCTTAGGCAAGAACAGGCCAAACTCAATGAAGCAAGAAAGATTTCTGTGGTAAACGTAAACCCAACCAACATTCGGCCTCATAGCGACACACCAGAAATCAGAAAATACAAGAAACGATTCAACTCAGAAATACTTTGTGCAGCTCTGTGGGGTGTAAACCTTCTGGTGGGAACTGAAAATGGCCTGATGCTTTTGGACCGAAGTGGGCAAGGCAAAGTCTATAATTTGATCAATAGAAGGCGATTTCAGCAGATGGACGTGCTAGAGGGACTAAATGTTCTTGTAACAATATCAGGAAAGAAGAATAAGCTAAGAGTTTACTATCTGTCCTGGTTAAGAAACAGAATACTACACAATGACCCAGAAGTGGAAAAGAAACAAGGCTGGATCACTGTTGGGGACTTGGAGGGCTGTATTCATTACAAAGTTGTTAAATATGAAAGGATCAAATTCTTGGTGATTGCCTTGAAGAACGCTGTGGAGATATATGCTTGGGCTCCTAAACCGTACCATAAGTTCATGGCATTTAAGTCTTTTGCAGATCTTCAGCACAAGCCTCTACTAGTTGACCTCACTGTAGAAGAAGGTCAGAGGTTAAAGGTTATTTTCGGCTCACACACTGGTTTCCATGTAATTGATGTTGATTCAGGAAACTCTTATGATATCTACATACCATCTCATATTCAGGGCAATATCACTCCTCATGCTATTGTCATCTTGCCTAAAACAGATGGAATGGAAATGCTTGTTTGCTATGAGGATGAGGGGGTGTACGTGAACACCTATGGCCGGATAACTAAGGATGTGGTGCTCCAATGGGGAGAAATGCCCACATCTGTGGCTTACATTCATTCCAATCAGATAATGGGCTGGGGCGAGAAAGCTATTGAGATCCGGTCAGTGGAAACAGGACATTTGGATGGAGTATTTATGCATAAGCGAGCTCAAAGGTTAAAGTTTCTATGTGAAAGAAATGATAAGGTATTTTTTGCATCCGTGCGATCTGGAGGAAGTAGCCAAGTGTTTTTCATGACCCTCAACAGAAATTCCATGATGAACTGGTAA

XM_004834594.1 Coding sequence

Tnik TRAF2 and NCK interacting kinase, transcript variant X1

High confidence: 4 potential gene matches
Length: 4083 bp    Location: 49498015..49087986   Strand: -
>XM_004834594.1
ATGGCGAGCGACTCCCCGGCTCGCAGCCTGGATGAAATCGATCTCTCGGCTCTGAGGGACCCTGCAGGGATCTTTGAATTGGTGGAACTTGTTGGAAATGGAACATATGGGCAAGTTTATAAGGGTCGTCATGTCAAAACTGGCCAGCTTGCAGCCATCAAGGTTATGGATGTCACAGGGGATGAAGAGGAAGAAATCAAACAAGAAATTAACATGTTGAAGAAATATTCTCATCACCGAAATATAGCTACATACTATGGTGCTTTTATCAAAAAGAACCCTCCAGGCATGGATGACCAACTGTGGTTGGTGATGGAGTTTTGTGGCGCTGGCTCTGTCACTGACCTGATCAAAAACACGAAAGGCAACACGTTGAAAGAAGAGTGGATTGCGTACATCTGCAGAGAGATCTTACGGGGGCTGAGTCACCTTCACCAGCATAAAGTGATTCATCGGGATATTAAAGGGCAAAACGTCTTGTTGACTGAAAATGCAGAAGTTAAACTAGTGGACTTTGGAGTCAGTGCCCAGCTTGACCGCACAGTGGGCAGGAGGAACACTTTCATTGGGACACCCTACTGGATGGCACCAGAAGTCATTGCCTGTGATGAAAACCCAGATGCCACATATGATTTCAAGAGTGACTTGTGGTCTTTGGGAATCACCGCCATAGAGATGGCAGAAGGTGCTCCCCCTCTCTGTGACATGCACCCCATGAGAGCCCTCTTCCTCATCCCTCGGAACCCAGCACCTCGGCTGAAGTCTAAGAAGTGGTCAAAAAAATTCCAGTCATTTATTGAGAGCTGCTTGGTAAAGAATCACAGCCAGCGACCAGCAACAGAGCAACTGATGAAGCATCCGTTTATAAGAGACCAACCGAATGAGCGCCAGGTCCGCATTCAACTCAAGGACCATATTGATAGAACAAAGAAAAAAAGAGGAGAAAAAGATGAGACAGAGTATGAGTACAGTGGAAGTGAGGAGGAGGAAGAGGAGAATGACTCTGGAGAGCCCAGCTCCATCCTGAACCTGCCTGGGGAGTCGACCCTGCGGCGGGACTTTCTGAGACTCCAACTGGCCAACAAGGAGCGTTCAGAGGCCCTTCGAAGGCAGCAGCTGGAGCAGCAGCAGCGGGAGAATGAGGAGCACAAGAGGCAGCTGCTAGCTGAGCGCCAGAAGCGCATCGAGGAGCAGAAGGAGCAGCGGCGGCGGCTGGAAGAGCAACAAAGGCGAGAGAAGGAGCTGCGGAAGCAGCAGGAGAGGGAGCAACGCCGGCACTATGAGGAGCAGATGCGCAGGGAGGAGGAGAGGAGGCGCGCAGAGCATGAGCAGGAATACATCAGGCGACAGTTAGAGGAGGAGCAAAGACAGTTAGAGATCTTGCAGCAGCAGCTACTGCATGAACAAGCTCTACTTCTGGAATATAAGCGCAAGCAATTGGAAGAACAGAGACAAGCAGAAAGGCTACAGAGGCAGCTAAAGCAAGAGAGAGACTATTTGGTTTCTCTTCAGCATCAGCGGCAGGAGCAGAGGCCCCTAGAGAAGAAGCCACTGTACCATTACAAAGAAGGGATGAGTCCTAGTGAGAAGCCAGCATGGGCCAAAGAGGTAGAAGAACGGTCAAGACTCAACCGGCAGAGTTCACCTGCCATGCCTCACAAGGTTGCCAACAGGATTTCTGACCCCAACCTGCCCCCAAGGTCGGAGTCCTTCAGCATTAGTGGAGTTCAACCTGCTCGAACACCCCCTATGCTCAGACCTGTTGATCCCCAGATCCCACAGCTGGTGGCTGTAAAATCCCAGGGACCTGCCTTGACCGCCTCTCAGTCAGTGCATGAGCAGCCTACAAAAGGCCTCTCTGGATTTCAGGAGGCTCTGAACGTGACCTCTCACCGTGTTGAGATGCCACGCCAGAACTCAGATCCCACTTCTGAAAACCCTCCTCTCCCCACTCGCATTGAGAAGTTTGACCGAAGCTCTTGGTTACGACAGGAAGAAGATATTCCACCAAAGGTGCCTCAAAGAACAACTTCTATATCCCCGGCGTTAGCCAGAAAGAATTCACCTGGAAATGGTAGTGCTTTGGGACCCAGACTAGGATCTCAACCCATCAGAGCAAGCAACCCTGATCTCCGGAGAACAGAGCCGGTCTTGGACAGCCCCTTGCAGAGGACCAGCAGTGGCAGTTCCTCCAGCTCCAGCACCCCCAGCTCCCAGCCCAGCTCCCAAGGAGGCTCCCAGCCTGGCTCGCAGGCAGGATCCAGTGAACGGACCAGAGTTCGAGCCAACAGTAAGTCGGAAGGATCACCTGTGCTCCCCCATGAGCCTTCCAAGGTGAAACCAGAAGAATCCAGGGATATTACCCGGCCCAGCCGACCAGCTAGCTATAAGAAAGCTATAGATGAGGATCTGACGGCATTAGCCAAGGAATTAAGAGAACTGCGGATTGAAGAAACAAACCGCCCACTGAAGAAGGTGACTGATTATTCTTCTTCCAGTGAAGAGTCGGAGAGTAGTGAGGAGGAGGAGGAAGACGGAGAAAGTGAGACCCATGATGGGAGTGTGGCTGTCAGTGACATACCCAGACTCATACCAACAGGAGCTCCAGGAAGCAATGAGCAGTACAATGTGGGAATGATCGGAACACATGGGCTGGAGACCTCTCACGCAGACACTTTTAGCAGCAGTATTTCAAGAGAAGGAACCTTAATGATTAGAGAGACAGCTGGAGAGAAGAAGCGATCCGGCCACAGTGACAGCAATGGCTTCGCTGGCCACATCAATCTCCCTGACTTGGTGCAGCAGAGCCATTCCCCAGCTGGAACCCCAACTGAGGGCCTGGGGCGTGTCTCCACCCATCCCCAGGAGATGGACTCCGGGACTGAATATGGCATGGGAAGCAGCACCAAAGCCTCCTTCACTCCATTTGTGGACCCCAGAGTATACCAGACATCTCCCACTGATGAAGATGAGGAGGATGAAGAATCATCAGCTGCAGCTCTGTTTACTAGTGAACTTCTTAGGCAAGAACAGGCCAAACTCAATGAAGCAAGAAAGATTTCTGTGGTAAACGTAAACCCAACCAACATTCGGCCTCATAGCGACACACCAGAAATCAGAAAATACAAGAAACGATTCAACTCAGAAATACTTTGTGCAGCTCTGTGGGGTGTAAACCTTCTGGTGGGAACTGAAAATGGCCTGATGCTTTTGGACCGAAGTGGGCAAGGCAAAGTCTATAATTTGATCAATAGAAGGCGATTTCAGCAGATGGACGTGCTAGAGGGACTAAATGTTCTTGTAACAATATCAGGAAAGAAGAATAAGCTAAGAGTTTACTATCTGTCCTGGTTAAGAAACAGAATACTACACAATGACCCAGAAGTGGAAAAGAAACAAGGCTGGATCACTGTTGGGGACTTGGAGGGCTGTATTCATTACAAAGTTGTTAAATATGAAAGGATCAAATTCTTGGTGATTGCCTTGAAGAACGCTGTGGAGATATATGCTTGGGCTCCTAAACCGTACCATAAGTTCATGGCATTTAAGTCTTTTGCAGATCTTCAGCACAAGCCTCTACTAGTTGACCTCACTGTAGAAGAAGGTCAGAGGTTAAAGGTTATTTTCGGCTCACACACTGGTTTCCATGTAATTGATGTTGATTCAGGAAACTCTTATGATATCTACATACCATCTCATATTCAGGGCAATATCACTCCTCATGCTATTGTCATCTTGCCTAAAACAGATGGAATGGAAATGCTTGTTTGCTATGAGGATGAGGGGGTGTACGTGAACACCTATGGCCGGATAACTAAGGATGTGGTGCTCCAATGGGGAGAAATGCCCACATCTGTGGCTTACATTCATTCCAATCAGATAATGGGCTGGGGCGAGAAAGCTATTGAGATCCGGTCAGTGGAAACAGGACATTTGGATGGAGTATTTATGCATAAGCGAGCTCAAAGGTTAAAGTTTCTATGTGAAAGAAATGATAAGGTATTTTTTGCATCCGTGCGATCTGGAGGAAGTAGCCAAGTGTTTTTCATGACCCTCAACAGAAATTCCATGATGAACTGGTAA

XM_004834597.1 Coding sequence

Pld1 phospholipase D1, phosphatidylcholine-specific, transcript variant X1

Length: 3129 bp    Location: 49834184..49665835   Strand: -
>XM_004834597.1
ATGTCCAAAGTTAACATGTCATTGAAAAATGAGTCAAGAGTAAATACCTCTGCACTGCAGAAAATTGCTGCCGACATGAGCAATTTGATAGAAAATCTGGACACACGAGAGCTCCATTTTGAAGGAGAGGAGGTGGAATATGATGTGTTTCCTGGTGACCCCAAGGCTCAAGAAGTGTGTATCCCTTTCTCTGCTATTTATAACACTCAAGGATTTAAGGAGCCTAATATACAGACGTATCTCTCCGGCTGTCCAATAAAAGCACAAGTTCTGGAAGTGGAGCGTTTCACATCTACATCAAGGGTGCCAAGTATCAATCTATACACTATTGAATTAACACATGGGGAATTTAAATGGCAAGTTAAGAGGAAATTCAAGCACTTTCAAGAATTTCACAGAGAACTGCTCAAGTACAAAGCCTTTATCCGCATCCCCATTCCCACTAAAAGGCACACATTTAGAAGACAAAATGTCAAAGGGGAAGCGCCTCGAGAAATGCCCAGTTTGCCCAGTTCACATGAAAATAGGATTCAAGAAGAACAGTTCTATGGAAGAAGGAAACAACTGGAAGATTACCTGACAAAGATACTAAAAATGCCCATGTATAAAAACTATCATGCCACAACAGAATTCCTTGATATAAGCCAGTTATCTTTCATCCGTGATTTGGGACCAAAGGGCCTAGAAGGCATGATCATGAAAAGATCCGGGGGACACAGAATACCAGGTTTGAATTGCTGTGGTCAGGGGAGAGCCTGCTACAGATGGTCAAAAAGGTGGTTAGTAGTGAAAGATTCCTTTTTATTATATATGAAACCAGACAGTGGTGCTATTGCCTTCGTTCTGCTGGTAGATAAAGAATTTAGAATTAAGGTGGGGAAGAAAGACACAGAAACGAAATATGGACTTCGAATTGATAATCTTTCAAGGACACTTATTTTAAAATGCAACAGCTACAGACATGCTCGGTGGTGGGGAGGAGCTATAGAAGATTTCATCCAGAAATATGGCGCCAACTTTCTCAAGGACCATCGATTTGGGTCATATGCTGCTATCCAGGACAGCACTTTAGCTAAATGGTACGTTAATGCCAAAGGATATTTTGAAGATGTGGCAAATGCAATGGAAGAGGCAAAAGAAGAGATTTTTATCACAGATTGGTGGTTGAGTCCAGAAATTTTCCTTAAACGCCCCGTGGTTGAAGGAAATCGTTGGAGATTGGACTGCATTCTTAAACGAAAAGCACAACAAGGGGTGCAGATCTTCATAATGCTCTACAAAGAGGTGGAGCTCGCCCTGGGAATCAACAGTGAATATAGCAAGCGGACTTTAGTGCGGCTGCACCCTAACATCAAGGTGATGAGGCACCCAGATCATGTGTCGTCCAGTGTTTATTTATGGGCTCATCATGAGAAACTTGTCATCATCGATCAATCAGTGGCCTTTGTGGGTGGGATTGACCTGGCCTATGGAAGGTGGGATGACAATGAACACAGACTCACAGATGTGGGAAGCGTGAAGCGGGTCATTTCAGGACCATCTCTGGGTTCTCTCACGGCTGCAGTCACAGAGTCTATGGAATCCTTAAGCCTCAAAAATAAACATGAATCTAATAAAAATATTCCCAGCCCGAAGAGTCCTGATGATACAGACTCAAAACTGAAAGGCTTAGGAAAGCCACGAAAGTTGTCCAAACTTAACCTCTACCGGCAGCTCCACTGGCACCACCTGCACAGTATGGACAGCCTCAGCAGCCTGGAAAGCAGCTCCAATACTGGCTCCATCCGCAGCTTACAGACTGGCGTGGGAGAGCTGCATGGGGAGACCAGATTCTGGCATGGGAAGGATTACTGCAACTTTGTCTTCAAAGACTGGGTTCAGCTGGATAAACCTTTTGCTGATTTCATTGACAGGTACTCTACCCCCCGGATGCCCTGGCACGACATTGCCTCTGTAGTCCACGGGAAGGCAGCTCGAGATGTGGCGCGTCACTTCATCCAGCGATGGAACTTCACAAAGATTATGAAACCAAAATATCGGTCCCTTTCTTATCCTTTTCTGCTTCCAAAGTCTCAAATCACAGCCCATGAGCTGAGATACCAAGTGCCTGGGGCTGTCCACGCTAGTGTACAGTTGCTCCGTTCTGCTGCTGATTGGTCTGCTGGTATAAAGTACCATGAGGAATCTATCCACAGTGCTTACACCTATGTGATAGAGAACAGCAAGCACTATATTTATATTGAAAACCAATTTTTTATAAGCTGTGCTGATGACAAAGTTGTGTTCAATAAGGTGGGTGATGCTATTACTCAGAGGATCCTGAAAGCTCACAGGGAAGGAAAGCGATACCGGGTCTATGTTGTGATACCACTTCTGCCGGGATTCGAAGGAGACATTTCAACTGGAGGAGGAAATGCTCTGCAGGCCATAATGCACTTCAACTACAGAACCATGTGCAGGGGAGAAAATTCCATCCTCGAACAGTTAAAACCAAAACTTGGTAATCAGTGGATAAATTACATTTCATTCTGTGGTCTTAGAACACATGCAGAGCTTGAAGGAAACCTAGTCACTGAACTTATCTATGTCCACAGCAAGTTGTTAATTGCTGATGATAACACTGTTATTATTGGCTCTGCCAACATAAACGACCGAAGCATGCTGGGGAAGCGTGACAGTGAAATGGCTGTCATTGTACAGGACACAGAGATGATCCCATCAGTAATGGATGGACAAGAGTACCAGGCTGGCCTGTTTGCCCAAGGACTGCGGCTACAGTGCTTCAGGATTGTCCTTGGCTACCTTTCTGACCCAAGTGAGGACCTTCAGGATCCAGTGAGTGACAAATTTTTCAAGGAGGTGTGGGTTTCAACAGCAGCTCGAAATGCTACAATTTATGATAAGGTGTTCCGATGCCTTCCCAATGATGAAGTACACAATTTAATGCAGTTGAGAGACTTCATAAACAAGCCCATATTAGCAAAGGAAGATCCCATCAGAGCTGAGGAGGAACTAAAAAAGATCCGTGGATTCTTGGTGCAATTCCCCTTTTACTTCTTGTCTGAAGAAAGCCTGCTGCCTTCTGTTGGAACCAAAGAAGCCATAGTGCCCACAGAGGTTTGGACTTAA

XM_004835173.1 Coding sequence

Tmem212 transmembrane protein 212

High confidence: 4 potential gene matches
Length: 657 bp    Location: 49917557..49991756   Strand: +
>XM_004835173.1
ATGAAGGTCCTATATCAAACTTCTGGCCAAATTCTCACTACTCTGGGTAGTCTCAGTATATTTTCTGGAGTTATTGCTTTCTTCCCTGTCTTTTCTTACAAGCTTTGGTTCACAGGATGGAGTGTGTGGATTGCTTGTCCCATCTGGAATGGAACTTTGGCCATCACAGCTGGTGTACTTCTACTATCGGCTTCCAAACAGTGGACACAAAGATATCAGTGGGAAGCTTGTTTCACCTTTGTGATTCTGAGCATTATGGGATGTCCGCTTCATTTCACAGTAGCGTTGGAATCTGTTCTTCTTGGCCACTATTGCTTCTACTCATTTTCAGGGGTTGCAGGGACCAATTACCTTGGTTATGCAGTTGCCTTTCCTTTTCTATATGCAAAATTCCCATTGGTTTGTGTGGACCCACTCCACTATGAAGAATACCACCTGATGCTTCAAGCCACTGACTTGTGCCTGAGCTTTGCTGTGTTCTGTGCATCTCTGACAGTGTTCATCAAGTTTTCTGCAAGACTAATCCTGAATGGACACATCAATGGTTCCCGTGCCAGGGGCTTTGTTCCCGATGTGAAAGAGTTAGAGATAGTGGAAGCTTTTGGAGGACACATGGAAGGTGATAAGGTCATGGGCAGCTTCTCCCAGCAGCATTAA

XM_004834601.1 Coding sequence

Fndc3b fibronectin type III domain containing 3B, transcript variant X3

Length: 3624 bp    Location: 50112724..50447035   Strand: +
>XM_004834601.1
ATGTACGTCACAATGATGATGACCGACCAAATCCCTCTGGAACTGCCACCACTGCTGAATGGAGAGGTAGCCATGATGCCTCACTTGGTGAACGGAGAAGCAGCCCAGCAGGTTATTCTCGTTCAAGTTAATCCAGGTGAGACTTTTACAATAAGAGCGGAGGATGGAACACTTCAGTGCATTCAAGGACCTGCTGAAGTTCCCATGATGTCGCCCAATGGATCCATTCCTCCCATTCATGTGCCCCCAGGTTATATCTCACAGGTGATTGAAGATAGTACTGGAGTCCGGCGGGTGGTGGTCACACCCCAGTCTCCTGAATGTTATCCCCCAAGCTACCCCTCAGCCATGTCTCCCACCCATCACCTGCCCCCGTACCTGGCCCACCACCCACATTTCATCCATAACTCCCACACGGCTTACTACCCACCAGTTACTGGGCCTGGAGATATGCCACCTCAGTTTTTTCCTCAGCACCACCTTCCTCCTACAATATATGGCGAGCAAGAAATCATACCACTCTATGGAATGTCAAGCTACATTACACGAGAAGACCAGTACAGCAAACCTCCGCACAAAAAACTCAAAGATCGCCAGATTGACCGCCAGAACCGCCTCAACAGTCCTCCTTCCTCCATCTACAAAAGCAACTGCACAACAGTGTACAACGGCTATGGAAAGGGGCACGGCGGTGGAGGCAGTGGAGGTGGGGGAGGCGGCAGTGGTGGTGGGCCTGGAATCAAGAAAATGGAGCGGCGAGCAAGGAGCAGTCCGAAGTCGAATGATTCAGATTTGCAAGAATATGAGTTGGAAGTAAAAAGGGTACAAGACATTCTTTCTGGAATAGAGAAGCCACAGGTTTCTAATATTCAGGCGAGAGCGGTTGTATTATCCTGGGCTCCCCCTGTTGGACTCTCATGTGGACCCCACAGTGGTCTTTCCTTCCCCTACAGTTATGAGGTTGCCTTATCTGACAAAGGCCGAGATGGAAAATACAAGATAATATACAGTGGAGAAGAATTAGAATGTAACCTGAAAGATCTTAGACCAGCAACTGATTATCACGTGAGGGTATATGCCATGTACAATTCAGTGAAGGGATCCTGCTCCGAGCCAGTTAGCTTCACCACCCACAGCTGTGCGCCCGAGTGTCCTTTCCCCCCTAAGCTGGCACATAGGAGCAAAAGTTCACTAACCTTGCAATGGAAGGCACCAATTGACAATGGGTCAAAAGTCACCAACTACCTTTTAGAATGGGATGAGGGGAAAAGAAACAGTGGTTTCAGACAATGCTTCTTTGGGAGCCAGAAGCACTGCAAGTTGACAAAGCTTTGTCCAGCCATGGGGTACACATTCAGGCTGGCTGCTCGGAATGACATTGGCACCAGTGGTTACAGCCAAGAGGTGGTGTGCTACACATTAGGAAACATCCCTCAGATGCCGTCTGCACCAAGACTTGTTCGAGCTGGTGTCACATGGGTCACGTTGCAGTGGAATAAGCCAGAAGGCTGTTTACCTGAGGAAGCAGTCACCTACACCTTGGAAATTCAGGAGGATGAAAATGATAACCTTTTCCACCCAAAATACACTGGAGAGGACTTAACTTGTACTGTGAAAAATCTTAAAAGAAGCACACAGTATAAATTCCGGCTGACTGCTTCTAATATGGAAGGGAAAAGCTGCCCAAGTGAAGTTTTGGTTTGTACGACCAGTCCTGACAGGCCTGGACCTCCTACAAGACCCCTCATTAAAGGACCTGTCACACCTCACGGCTTCAGTGTCAAATGGGACCCTCCCAAGGATAATGGTGGTTCAGAAATTCTCAAGTACTTGCTGGAGATTACGGATGGAAATTCTGAAGCCAATCAGTGGGAAGTGGCATACAGTGGATCGGCTACAGAATACACATTCACCCACTTGAAACCAGGCACTTTGTACAAACTCCGAGCATGCTGCATCAGTACTGGTGGGCACAGTCAGTGTTCTGAAAGTCTCCCTGTTCGCACACTAAGCATTGCACCAGGTCAGTGTCGACCACCGAGGGTTTTGGGTAGACCAAAGCACAAAGAAGTCCACTTAGAGTGGGATGTTCCTGTGTCAGAAAGTGGCTGTGAGGTCTCAGAGTATAGTGTGGAGATGACAGAACCTGAGGATGTGGCTTCAGAAGTATACCATGGGCCAGAGCTGGAGTGTACTGTTGGCAACCTGCTTCCTGGAACCATGTATCGCTTCAGAGTCAGGGCTCTGAACGATGGGGGGTATGGTCCCTATTCCGATGTGTCTGAAATCACTACTGCCACAGGGCCTCCTGGTCAGTGCAAAGCACCTTGTGTTTCTTTTACACCTGATGGATGTGTCCTCGTGAGCTGGGAGACTCCTGAAAGCTCGGGTGCCGACATCTCAGAGTACAGGTTGGAGTGGGGAGAAGATGAAGAGTCCTTAGAACTCATTTATCATGGGACCAACACCTGCTTTGAGATAAGAGATCTGCTGCCTGCTGCAGAATATTGCTGTAGACTACAGGCCTTCAATCAAGCAGGAGCAGGACCATACAGTGAGCTTGTCCTTTGCCAGACACCAGCATCTGCCCCTGACCCCGTCTCCACTCTCTGTGTCCTGGAGGAAGAGCCCCTTAATGCCTACCCCAACTCACCATCTGTGTGCCTTGTACTGAGCTGGGAAGAGCCGTGCAATAATGGGTCAGAAATCCTCTCGTACAACATTGACCTTGGAGATAGCAGCATTACTGTGGGCAACACCACCACCCATGTTGTAAAAGATCTCCTTCCAGAAACCACCTACCGGATCAGAATTCAGGCTGTAAATGAAATTGGAGCTGGACCATTTAGTCAGTTCATTAAAGCAAAAACTCGACCATTACCACCCTTGCCTCCTAGGCTAGAATGTGCTGCAGCTGGGCCACAGAGCCTGAAGCTAAAATGGGGTGACAGTAACTCTAAGACACATGCTGCTGATGACATGGTGTACACACTACAGCTGGAGGACAGAAACAAAAGGTTTATTTCCATTTACAGAGGACCCAGCCACACTTACAAGGTCCAGAGACTGACAGAATTCACATGCTACTCCTTCCGAATCCAGGCAGCCAGTGAGGCTGGGGAAGGGCCCTTCTCCGAAACCTACACCTTCAGCACAACCAAAAGTGTCCCCCCCACCATCAAAGCACCCCGAGTAACACAGCTAGAAGGAAATTCATGTGAAATTTTATGGGAGACGGTACCACCAATGAAAGGCGACCCTGTTAACTACATTCTGCAGGTATTGGTTGGAAGAGAATCCGAGTATAAACAGGTGTACAAGGGAGAAGAAGCCACATTCCAAATCTCAGGCCTCCAGACCAACACGGACTACCGGTTCCGCGTGTGTGCGTGTCGGCGCTGTTTAGACACCTCTCAGGAGCTAAGCGGAGCTTTCAGCCCCTCTGCAGCTTTTGTATTGCAACGAAGTGAGGTCATGCTTACAGGGGACATGGGGAGCTTAGACGATCCCAAAATGAAGAGCATGATGCCTACTGATGAACAGTTTGCAGCCCTCATTGTGCTTGGCTTTGCGACTTTGTCCATTCTATTTGCCTTTATATTACAGTACTTCTTAATGAAGTAA

XM_004834600.1 Coding sequence

Fndc3b fibronectin type III domain containing 3B, transcript variant X2

Length: 3624 bp    Location: 50176747..50447035   Strand: +
>XM_004834600.1
ATGTACGTCACAATGATGATGACCGACCAAATCCCTCTGGAACTGCCACCACTGCTGAATGGAGAGGTAGCCATGATGCCTCACTTGGTGAACGGAGAAGCAGCCCAGCAGGTTATTCTCGTTCAAGTTAATCCAGGTGAGACTTTTACAATAAGAGCGGAGGATGGAACACTTCAGTGCATTCAAGGACCTGCTGAAGTTCCCATGATGTCGCCCAATGGATCCATTCCTCCCATTCATGTGCCCCCAGGTTATATCTCACAGGTGATTGAAGATAGTACTGGAGTCCGGCGGGTGGTGGTCACACCCCAGTCTCCTGAATGTTATCCCCCAAGCTACCCCTCAGCCATGTCTCCCACCCATCACCTGCCCCCGTACCTGGCCCACCACCCACATTTCATCCATAACTCCCACACGGCTTACTACCCACCAGTTACTGGGCCTGGAGATATGCCACCTCAGTTTTTTCCTCAGCACCACCTTCCTCCTACAATATATGGCGAGCAAGAAATCATACCACTCTATGGAATGTCAAGCTACATTACACGAGAAGACCAGTACAGCAAACCTCCGCACAAAAAACTCAAAGATCGCCAGATTGACCGCCAGAACCGCCTCAACAGTCCTCCTTCCTCCATCTACAAAAGCAACTGCACAACAGTGTACAACGGCTATGGAAAGGGGCACGGCGGTGGAGGCAGTGGAGGTGGGGGAGGCGGCAGTGGTGGTGGGCCTGGAATCAAGAAAATGGAGCGGCGAGCAAGGAGCAGTCCGAAGTCGAATGATTCAGATTTGCAAGAATATGAGTTGGAAGTAAAAAGGGTACAAGACATTCTTTCTGGAATAGAGAAGCCACAGGTTTCTAATATTCAGGCGAGAGCGGTTGTATTATCCTGGGCTCCCCCTGTTGGACTCTCATGTGGACCCCACAGTGGTCTTTCCTTCCCCTACAGTTATGAGGTTGCCTTATCTGACAAAGGCCGAGATGGAAAATACAAGATAATATACAGTGGAGAAGAATTAGAATGTAACCTGAAAGATCTTAGACCAGCAACTGATTATCACGTGAGGGTATATGCCATGTACAATTCAGTGAAGGGATCCTGCTCCGAGCCAGTTAGCTTCACCACCCACAGCTGTGCGCCCGAGTGTCCTTTCCCCCCTAAGCTGGCACATAGGAGCAAAAGTTCACTAACCTTGCAATGGAAGGCACCAATTGACAATGGGTCAAAAGTCACCAACTACCTTTTAGAATGGGATGAGGGGAAAAGAAACAGTGGTTTCAGACAATGCTTCTTTGGGAGCCAGAAGCACTGCAAGTTGACAAAGCTTTGTCCAGCCATGGGGTACACATTCAGGCTGGCTGCTCGGAATGACATTGGCACCAGTGGTTACAGCCAAGAGGTGGTGTGCTACACATTAGGAAACATCCCTCAGATGCCGTCTGCACCAAGACTTGTTCGAGCTGGTGTCACATGGGTCACGTTGCAGTGGAATAAGCCAGAAGGCTGTTTACCTGAGGAAGCAGTCACCTACACCTTGGAAATTCAGGAGGATGAAAATGATAACCTTTTCCACCCAAAATACACTGGAGAGGACTTAACTTGTACTGTGAAAAATCTTAAAAGAAGCACACAGTATAAATTCCGGCTGACTGCTTCTAATATGGAAGGGAAAAGCTGCCCAAGTGAAGTTTTGGTTTGTACGACCAGTCCTGACAGGCCTGGACCTCCTACAAGACCCCTCATTAAAGGACCTGTCACACCTCACGGCTTCAGTGTCAAATGGGACCCTCCCAAGGATAATGGTGGTTCAGAAATTCTCAAGTACTTGCTGGAGATTACGGATGGAAATTCTGAAGCCAATCAGTGGGAAGTGGCATACAGTGGATCGGCTACAGAATACACATTCACCCACTTGAAACCAGGCACTTTGTACAAACTCCGAGCATGCTGCATCAGTACTGGTGGGCACAGTCAGTGTTCTGAAAGTCTCCCTGTTCGCACACTAAGCATTGCACCAGGTCAGTGTCGACCACCGAGGGTTTTGGGTAGACCAAAGCACAAAGAAGTCCACTTAGAGTGGGATGTTCCTGTGTCAGAAAGTGGCTGTGAGGTCTCAGAGTATAGTGTGGAGATGACAGAACCTGAGGATGTGGCTTCAGAAGTATACCATGGGCCAGAGCTGGAGTGTACTGTTGGCAACCTGCTTCCTGGAACCATGTATCGCTTCAGAGTCAGGGCTCTGAACGATGGGGGGTATGGTCCCTATTCCGATGTGTCTGAAATCACTACTGCCACAGGGCCTCCTGGTCAGTGCAAAGCACCTTGTGTTTCTTTTACACCTGATGGATGTGTCCTCGTGAGCTGGGAGACTCCTGAAAGCTCGGGTGCCGACATCTCAGAGTACAGGTTGGAGTGGGGAGAAGATGAAGAGTCCTTAGAACTCATTTATCATGGGACCAACACCTGCTTTGAGATAAGAGATCTGCTGCCTGCTGCAGAATATTGCTGTAGACTACAGGCCTTCAATCAAGCAGGAGCAGGACCATACAGTGAGCTTGTCCTTTGCCAGACACCAGCATCTGCCCCTGACCCCGTCTCCACTCTCTGTGTCCTGGAGGAAGAGCCCCTTAATGCCTACCCCAACTCACCATCTGTGTGCCTTGTACTGAGCTGGGAAGAGCCGTGCAATAATGGGTCAGAAATCCTCTCGTACAACATTGACCTTGGAGATAGCAGCATTACTGTGGGCAACACCACCACCCATGTTGTAAAAGATCTCCTTCCAGAAACCACCTACCGGATCAGAATTCAGGCTGTAAATGAAATTGGAGCTGGACCATTTAGTCAGTTCATTAAAGCAAAAACTCGACCATTACCACCCTTGCCTCCTAGGCTAGAATGTGCTGCAGCTGGGCCACAGAGCCTGAAGCTAAAATGGGGTGACAGTAACTCTAAGACACATGCTGCTGATGACATGGTGTACACACTACAGCTGGAGGACAGAAACAAAAGGTTTATTTCCATTTACAGAGGACCCAGCCACACTTACAAGGTCCAGAGACTGACAGAATTCACATGCTACTCCTTCCGAATCCAGGCAGCCAGTGAGGCTGGGGAAGGGCCCTTCTCCGAAACCTACACCTTCAGCACAACCAAAAGTGTCCCCCCCACCATCAAAGCACCCCGAGTAACACAGCTAGAAGGAAATTCATGTGAAATTTTATGGGAGACGGTACCACCAATGAAAGGCGACCCTGTTAACTACATTCTGCAGGTATTGGTTGGAAGAGAATCCGAGTATAAACAGGTGTACAAGGGAGAAGAAGCCACATTCCAAATCTCAGGCCTCCAGACCAACACGGACTACCGGTTCCGCGTGTGTGCGTGTCGGCGCTGTTTAGACACCTCTCAGGAGCTAAGCGGAGCTTTCAGCCCCTCTGCAGCTTTTGTATTGCAACGAAGTGAGGTCATGCTTACAGGGGACATGGGGAGCTTAGACGATCCCAAAATGAAGAGCATGATGCCTACTGATGAACAGTTTGCAGCCCTCATTGTGCTTGGCTTTGCGACTTTGTCCATTCTATTTGCCTTTATATTACAGTACTTCTTAATGAAGTAA

XM_004834606.1 Coding sequence

Nceh1 neutral cholesterol ester hydrolase 1, transcript variant X2

Length: 1155 bp    Location: 50731425..50653285   Strand: -
>XM_004834606.1
ATGAGGTCGTCCTGTGTTCTGCTCACCGCCCTGGTGGCGCTGGCCGCCTACTACGTCTACATCCCGCTGCCCAGCTCGGTGTCGGATCCCTGGAAGCTGATGCTCCTGGACGCGACTTTCCGGGGCGCACAGCAAGTGAGTAACCTGATTCACTACCTGGGACTGACCCACCATCTGACCGCCCTGAATTTTATCATCATTTCTTTCGGCAAGAAAAGTGCGTGGTCCTCTGCCCAAGTGAAGGTGACTGACACTGACTTTGATGGTGTGGAAGTCCGAGTGTTCCAAGGTTCTCCAAAGCCCGGTGAGCCGCTGAAACGCAGCGTTGTTTATATCCACGGAGGAGGCTGGGCCTTGGCAAGCGCAAAAATCAAGTATTACGATGAGCTGTGTACTGGAATGGCAGAGGAACTGAATGCTGTCATTGTCTCCATCGAGTACAGGCTGGTCCCACAGGTTTATTTTCCTGAGCAAATTCACGACGTGGTCCGTGCTACAAAGTACTTCCTGCAGCCCGAGGTCTTGCAGAAGTATAAGTTCAGTCAAGATGCCAACCTAAGGAATAAGCTCAAACTGCAAGCACTGATCTATCCAGTCCTCCAAGCGTTAGATTTTAATACACCCTCTTACCAGCAAAACGTGAACACCCCAATCCTGCCTCGCTATGTCATGGTAAAGTACTGGCTGGACTACTTCAAAGGCAACTACGACTTTGTGCAGGCGATGATGGTTAACAATCACACTTCCCTGGAAGTGGAGGAGGCGGCTGCCCTCAGAGCCCGTCTAAACTGGATGTCGCTATTGCCTGCATCCATCACGAAGGACTACAAGCCTGTTGTGCAGACCACGGGCAATGCCAGGATCGTCCGGGAGATCCCTCAGCTGCTGGACGCCCGCTCCTCCCCACTCATTGCAGACCAGGATGTGCTCCAGCACCTCCCGAAGACCTATATTCTCACGTGTGAGCACGATGTGCTGAGAGACGACGGGATCATGTACGCCAGGCGTCTGGAGAGCGTGGGTGTGGAGGTGACCCTCGATCACTTTGAGGATGGCTTCCACGGGTGCGTGATTTTCACGAGCTGGCCCACCAACTTCTCAGTGGGAATCCGGACTAGGAATAGTTACATCCAGTGGCTGGATCAAAACCTGTGA

XM_004834605.1 Coding sequence

Nceh1 neutral cholesterol ester hydrolase 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1227 bp    Location: 50731425..50653285   Strand: -
>XM_004834605.1
ATGAGGTCGTCCTGTGTTCTGCTCACCGCCCTGGTGGCGCTGGCCGCCTACTACGTCTACATCCCGCTGCCCAGCTCGGTGTCGGATCCCTGGAAGCTGATGCTCCTGGACGCGACTTTCCGGGGCGCACAGCAAGTGAGTAACCTGATTCACTACCTGGGACTGACCCACCATCTGACCGCCCTGAATTTTATCATCATTTCTTTCGGCAAGAAAAGTGCGTGGTCCTCTGCCCAAGTGAAGGTGACTGACACTGACTTTGATGGTGTGGAAGTCCGAGTGTTCCAAGGTTCTCCAAAGCCCGGTGAGCCGCTGAAACGCAGCGTTGTTTATATCCACGGAGGAGGCTGGGCCTTGGCAAGCGCAAAAATCAAGTATTACGATGAGCTGTGTACTGGAATGGCAGAGGAACTGAATGCTGTCATTGTCTCCATCGAGTACAGGCTGGTCCCACAGGTTTATTTTCCTGAGCAAATTCACGACGTGGTCCGTGCTACAAAGTACTTCCTGCAGCCCGAGGTCTTGCAGAAGTATAAGGTAGATCCCAGCAGGATTGGAGTTTCTGGTGACAGTGCTGGTGGAAACTTGGCCGCTGCCCTTGGACAACAGTTCAGTCAAGATGCCAACCTAAGGAATAAGCTCAAACTGCAAGCACTGATCTATCCAGTCCTCCAAGCGTTAGATTTTAATACACCCTCTTACCAGCAAAACGTGAACACCCCAATCCTGCCTCGCTATGTCATGGTAAAGTACTGGCTGGACTACTTCAAAGGCAACTACGACTTTGTGCAGGCGATGATGGTTAACAATCACACTTCCCTGGAAGTGGAGGAGGCGGCTGCCCTCAGAGCCCGTCTAAACTGGATGTCGCTATTGCCTGCATCCATCACGAAGGACTACAAGCCTGTTGTGCAGACCACGGGCAATGCCAGGATCGTCCGGGAGATCCCTCAGCTGCTGGACGCCCGCTCCTCCCCACTCATTGCAGACCAGGATGTGCTCCAGCACCTCCCGAAGACCTATATTCTCACGTGTGAGCACGATGTGCTGAGAGACGACGGGATCATGTACGCCAGGCGTCTGGAGAGCGTGGGTGTGGAGGTGACCCTCGATCACTTTGAGGATGGCTTCCACGGGTGCGTGATTTTCACGAGCTGGCCCACCAACTTCTCAGTGGGAATCCGGACTAGGAATAGTTACATCCAGTGGCTGGATCAAAACCTGTGA

XM_004834607.1 Coding sequence

Nceh1 neutral cholesterol ester hydrolase 1, transcript variant X3

Length: 828 bp    Location: 50730909..50653285   Strand: -
>XM_004834607.1
ATGGCAGAGGAACTGAATGCTGTCATTGTCTCCATCGAGTACAGGCTGGTCCCACAGGTTTATTTTCCTGAGCAAATTCACGACGTGGTCCGTGCTACAAAGTACTTCCTGCAGCCCGAGGTCTTGCAGAAGTATAAGGTAGATCCCAGCAGGATTGGAGTTTCTGGTGACAGTGCTGGTGGAAACTTGGCCGCTGCCCTTGGACAACAGTTCAGTCAAGATGCCAACCTAAGGAATAAGCTCAAACTGCAAGCACTGATCTATCCAGTCCTCCAAGCGTTAGATTTTAATACACCCTCTTACCAGCAAAACGTGAACACCCCAATCCTGCCTCGCTATGTCATGGTAAAGTACTGGCTGGACTACTTCAAAGGCAACTACGACTTTGTGCAGGCGATGATGGTTAACAATCACACTTCCCTGGAAGTGGAGGAGGCGGCTGCCCTCAGAGCCCGTCTAAACTGGATGTCGCTATTGCCTGCATCCATCACGAAGGACTACAAGCCTGTTGTGCAGACCACGGGCAATGCCAGGATCGTCCGGGAGATCCCTCAGCTGCTGGACGCCCGCTCCTCCCCACTCATTGCAGACCAGGATGTGCTCCAGCACCTCCCGAAGACCTATATTCTCACGTGTGAGCACGATGTGCTGAGAGACGACGGGATCATGTACGCCAGGCGTCTGGAGAGCGTGGGTGTGGAGGTGACCCTCGATCACTTTGAGGATGGCTTCCACGGGTGCGTGATTTTCACGAGCTGGCCCACCAACTTCTCAGTGGGAATCCGGACTAGGAATAGTTACATCCAGTGGCTGGATCAAAACCTGTGA

XM_004834608.1 Coding sequence

Ect2 epithelial cell transforming sequence 2 oncogene

High confidence: 4 potential gene matches
Length: 2745 bp    Location: 50773566..50840510   Strand: +
>XM_004834608.1
ATGGCTGACAGCAGTGTATTAACACCCACTACTGGGGGGACTAGCATGGCGGACTCTTCCATTTTTGATTCTAAAGTTACTGAAACTTCGAAGGAAAACCTATTTATTGGTTCTACTTCATACGCTGAAGAAGAAATGCCTCAGATTGAAACAAGAGTGGTAATGGTTCAAGAAGCTGGAAAACAAGAAGAACTTATAAAAGCCTTAAAGACTATTAAAATAATGGAAGTCCCTGTTATAAAAATAAGAGAAAGTTGTCCTGGAAAATCGGATGAAAAATTAATAAAAAGTGTTATTAATATGGAAATTAAAGTAACCTGTATAAAGATGGACTCAATGGAAGAATTTGAAAGTTTGGATTCTCCAGAATTTGAGAATGTATTCATAGTTACAGACTTCCAGAACTCTGTCTTTAATGACTTACACAAGGGTGATTGTAGAATTATTGGACCACCAGTTGTATTAGACTGTGCACAAAAAGGAGAGCCTTTGCCGTTTTCATGTCGTCCGTTGTATTGTACAAGTATGATGAATTTAGTCTTATGCTTTACTGGATTCAGGAAGAAAGAAGAACTAGTCAGATTGGTGACACTGGTTCATCATATGGGTGGAGTTATTCGAAAAGATTTTAATTCAAAAGTTACACATTTGGTGGCAAATTGCACACAAGGAGAAAAATTCAGGGTTGCTGTGAGTCTGGGTACTCCAATTATGAAGCCAGATTGGATTTATAAAGCATGGGAGAGACGGAATGAACAGGATTTCTGTGCAGCGGTTGATGATTTTAGAAATGAATTTAAAGTTCCTCCATTTCAAGATTGCATTTTAAGTTTCCTGGGATTTTCAGACGAAGAGAAAACCAATATGGAAGAAATGACTGAAATGCAAGGAGGTAACTATTTACCAGTTGGAGATCAAAGATGCACTCACCTTATAGTTGAAGAGAATACAGTAAAAGAACTTCCATTTGAACCTTCAAAGAAACTTTATGTTGTCAAGCAAGAGTGGTTCTGGGGAAGCATTCAAATGGATGCCCGTGCTGGAGAAACTATGTATTTGTATGAAAAGGCTAATACTCCTGAGCTCAAGAAATCAGTGTCACTGCTTTCTCTACATACTCCAAACAGCAATCGCAAAAGACGTCGTTTAAAAGAGTCACTCGCTCAGCTTTCAAAAGAGACAGACGTGTCACCTTTTCCCCCCCGTAAGCGTCCATCAGCTGAACATTCCCTTTCTATCGGATCACTCCTTGACATCTCCAATACACCAGAGTCTAGCATCAACTGTGGAGAAACTCCGAAGTCTTGTAGTAAGTCTTCTAAAAATTCTACCCCAGCTCCTTCAAAGCAGTCGGCCAGGTGGCAAGTTGCAAAAGAACTTTATCAGACTGAAAGTAATTATGTAAATATATTGGCAACAATTATTCAATTATTTCAGGTACCATTGGAAGAGGAAGGACAACGTGGAGGCCCTATCCTTGCACCAGAAGAGATTAAGACTATTTTTGGTAGCATTCCAGATATCTTTGATGTACACACTAAGATAAAGGAAGATCTTGAAGACCTTATTGTTAATTGGGATGAAAGCAAAAGCATTGGCAATATCTTTCTTAAATATTCAAAAGATTTGGTAAAAACATATCCCCCCTTTGTAAACTTCTTTGAAATGAGCAAGGAAACAATTATTAAATGTGAAAAACAGAAACCCAGATTTCATGCTTTTCTTAAGATAAACCAAGCTAAGCCAGAATGTGGACGACAAAGCCTTGTTGAACTTCTCATCCGACCAGTACAGAGGCTCCCCAGTGTTGCATTACTTTTAAATGATCTTAAGAAACATACAGCTGATGAAAATCCTGACAAAAGCACTTTAGAAAAAGCTATTGGGTCCCTAAAAGAAGTAATGACGCATATCAATGAAGATAAAAGAAAAACAGAAGCACAAAAGCAAATATTTGATGTCGTTTATGAAGTAGATGGATGTCCAGCAAATCTTTTATCTTCTCACCGAAGTTTGGTGCAGCGAGTTGAAACTGTTTCTCTAGGTGAGCACCCCTGTGACAAAGGAGAGCAAGTAACTCTCTTTCTCTTCAGTGACTGCCTGGAGATAGCAAGAAAACGGCACAAAGTTATTGGCACTTTTAGGAGTCCTCCTGGCCATACCCGACCCCCAGCTTCTCTTAAGCATATTTGTCTAATGCCCCTATCTCAGATTAAGAAGGTTTTGGATATAAGAGAGACAGAAGATTGCCGTAATGCTTTTGCCTTGCTTGTGAGGCCACCAACAGAGCAGGCAAATGTGCTGCTCAGTTTCCAGATGACATCAGATGAACTTCCAAAAGACAACTGGCTAAAGATGTTGTGTCGACATGTAGCCAACACCATTTGTAAAGCAGATGCTGAGAATCTCATGTATACTGCTGATCCAGAATCCTTTGAAGTAAATACAAAAGATATGGATAGTACACTGAGTAGAGCATCTAGAGCAATAAAAAAGACTTCAAAAAAGGTTACAAGAGCATTCTCTTTTTCCAAAACTCCAAAACGAGCTCTACGGATGGCTCTCATGCCATCCCATAACTCAGTGGAGGGAAGAAGTCCTCCCAGCAATGATAAACATGCAGTGAGTCGCCTTTCTAGCACATCATCATTAGCAGGTATCCCATCTCCTTCCCTTGTCAGCCTTCCTTCTTTCTTTGAAAGGCGAAGTCATACTTTAAGTAGATCAACAACTCATTTGATATGA

XM_004834613.1 Coding sequence

Naaladl2 N-acetylated alpha-linked acidic dipeptidase-like 2

Length: 2388 bp    Location: 52855820..53742278   Strand: +
>XM_004834613.1
ATGGGAGAGAATGAAGCAAAATCACCTAACACGTCTTTGCAAGGTAAAAAGATGGCCTATCAGAAGGTCAGTGCAGATCAAAGTATGTCAGGACGCTCACAGTTCTTAGACGGCGATGACCTTCAAGGCACTGCCCTTGATTTAGAGTGGGACATGGAAAAAGAACTGGAGGAGCCTGGTTTTGACCAGTTCCAACTTGATAGTTCTGAGAATGAAAACCAGGGGCACCCAGAATCTGTGGACCTCAATCTTGATTCCATTCAACCAGCAACTTCACCCAAAGGAAGATTCCAGCAACTACAAGAAGAAACTGACTATTTTTCCCATTATACAAGATCTGCACCAAAGAGCAACCGCTGCAACATTTGTCACTTTTTAAAAATATTTTGCACAGCCACCATTTTATTTATTCTTGGAATTTTGATAGGTTACTATGCACATACGAATTGCCCCTCAGATGCCTCATCTTCAGGAACAGTTGATCCTCAGTTATATCAAGAGATTCTCAAGAAAATCCAAGCAGAAGATATTAAGAAATCTTTCAGAAATTTTGTAGAGCTGTATAAAAGTGAAGATGACATGGAAATGTCAAAGACGATTAAGACTCACTGGACTGCTTTGGGCTTAGAAGATGTACAGTTTGTGAATTATTCCGTGCTGCTAAATCTGCCAGGCCCTTGGCCCAGCACTGTGACGCTGATCAGCAGCGGCCAATGCTTTCATCCTAATGGCCAGCCTTGCAGTGAAAGGGCCAGAAAAGACAGCAGCCCAGACCTGCTCTACTCCTATGCAGCTTATTCTGCCAAAGGAACTCTCAAGGCTGAAGTCATTGATGTGAGTTATGGAACTGCAGATGATTTAAAAAGGATTAAAAAAGTGAAAAATGTAACAAATCATATTGCACTCATGAAATTAGGAAAATTACCACTACTTTATAAGATATCCTTATTGGAACAGACTGGATTTGGAGGTGTTCTTCTATATATTGACCCTTGCGATCTACCAAAGACTGTGAACTCTAACTATGATACCTTCATGGTGTCTTTGAATCCAGGAGGAGATCCTACTACTCCTGGTTACCCAAGTGTTGATGGAAGCTTCAGACAAAACCAATCAAACCTCACCTCTCTGTTAGTGCAGCCCATATCTGCATCCCTTGTTGCAAAACTGATCTCTTTACCTACAGCTGGAACCAAAAGTGAGATCTGCAGTCCTCTGGAACTTCCACATAATGAAATAAGAATTGTCAGCATGAAAGTTCAGACAGTCACAAAATTTCAAACAGTTACAAATGTGGTTGGATATGTCAAGGGCTTGGCATCTCCAGACCGGTATATTATAGTTGGCAGCCATCATCATACTGTGTACAGTTATAATGGACAAGAATGGGCCAGCAGTACAGCAATAATCACAGCTTTTATCCAAGCTTTGATGTTGAGAGTCAAGAGGGGATGGAGGCCAGACCGCACCATAGTTTTCTGCGCATGGGGAGGAACAACTCTGGGCAATATTGGCTCATACGAATGGGGAGAGGATTTCAAGAAGATTCTCCAAAAAAATGTTGTGGCTTATGTGAGTCTCCACAGTCCCGTAAGGGGCAACTCGAGCCTACACCCTGTGGCATCCCCATCTCTTCAGCAACTGGTAGTAGAGAAAAATAAGTTCAATTGTGACAGAAGAATTCAGTGCCCAGAAACCAATGTCAGTTCTGTGCAGATACAAGGTGATGCTGATTATTTCATCAACCATCTTGGAGTTCCCACCGTGCAATTTACTTATGAGGACATCAGTGCATTAGAGGGTCCAAGTTTTCTCTCTGAGGCAGCTTTTCCTCAACATGCAATAAAAATTGAAGAAATAGATCCTTTCTTCAACCTTCATGAAACCATTGCCAAGCTCTCAGGAGAAATGATTTTGCAAATTGCCAATGAACCAGTTCTGCCCTTTAATGCTCTCGATATAGCTTTAGAAGTTCAAAACAGCCTTAAAGGTGATCGACTCAGTGCACATCACCTGCTGGCTGCGGCATCCTGCCTAAGGGAGAGCGCTGAACTCTTTCAGTCAGAGGAAATGCGACCTGCCAATGATCCCAAGGAGAGAGCCCCCATCCGCGTCCGGATGCTGAATGACATCCTCCAAGACATGGAGAAGAGCTTCTTGGTGAGGCAGGTGCCACCAGGCTTTTACAGAAATATCCTGTACCACATGGATGAGAAGACAAGCCAGTTTTCGATACTCGTGGAGGCTTGGGAACACTGCAACTCACTTGCATCAAATGAGACCCTTCAAGGAGCTCTGTCAGAGGTTTTGAACAGCATTAATTCAGCTCAGGTTTACTTTAAAGTAGGACTTGAAGTGTTTGAGAGTTTCTTGGTAGCAAAGACCTGA

XM_004834615.1 Coding sequence

Tbl1xr1 transducin (beta)-like 1 X-linked receptor 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1545 bp    Location: 55013357..54835624   Strand: -
>XM_004834615.1
ATGAGTATAAGCAGTGATGAGGTCAACTTCTTGGTATATAGATACTTGCAAGAGTCAGGATTTTCTCATTCAGCATTTACCTTTGGTATAGAAAGCCATATAAGTCAGTCTAATATAAATGGTGCACTTGTCCCACCTGCTGCATTGATCTCTATCATCCAGAAAGGTCTACAGTATGTAGAGGCAGAAGTTAGTATAAATGAGGATGGTACCTTGTTTGATGGTCGGCCCATAGAATCTTTGTCCCTGATAGATGCCGTAATGCCTGATGTAGTACAAACAAGACAACAAGCTTACAGAGATAAGCTTGCACAGCAACAGGCAGCAGCTGCTGCAGCTGCTGCAGCTGCAACCAACCAACAAGGATCTGCAAAAAATGGAGAAAATACAGCAAATGGGGAAGAGAATGGAGCACATACTATAGCAAATAATCATACTGATATGATGGAAGTAGATGGGGATGTTGAAATCCCTCCTAATAAAGCAGTTGTGTTACGGGGCCATGAATCTGAAGTTTTCATCTGTGCCTGGAACCCTGTTAGCGATCTCTTGGCATCAGGGTCGGGAGACTCAACAGCAAGAATATGGAATCTTAGTGAAAATAGCACTAGTGGTTCCACACAGTTAGTACTTAGACATTGCATACGAGAAGGAGGACAAGATGTTCCAAGTAACAAGGATGTAACTTCTCTAGATTGGAATAGTGAAGGTACACTTCTAGCAACTGGTTCATATGATGGATTTGCCAGAATATGGACTAAAGATGGTAATCTTGCTAGCACCTTAGGGCAGCATAAAGGCCCTATATTTGCATTAAAATGGAATAAGAAAGGAAATTTCATCCTAAGTGCTGGAGTAGATAAGACTACAATTATTTGGGATGCACATACTGGTGAAGCAAAGCAACAGTTTCCTTTTCATTCAGCACCAGCATTGGATGTTGACTGGCAGAGCAACAATACCTTCGCTTCCTGTAGTACAGATATGTGCATTCATGTCTGCAAATTAGGACAAGACCGACCTGTTAAAACATTCCAGGGACATACGAATGAAGTAAATGCTATCAAATGGGACCCAACTGGCAATCTCCTGGCCTCCTGTTCTGATGACATGACTTTGAAGATATGGAGTATGAAACAAGACAGTTGTGTCCATGATTTGCAAGCACATAATAAAGAAATTTATACTATTAAGTGGAGTCCAACAGGACCAGGGACAAATAATCCAAATGCCAACCTTATGTTAGCAAGTGCATCCTTTGATTCTACTGTTAGGTTATGGGATGTAGACCGAGGGATTTGTATCCATACTTTGACAAAACACCAAGAACCTGTGTACAGTGTAGCGTTCAGTCCTGACGGCAGGTATCTGGCAAGTGGTTCTTTTGACAAATGTGTGCACATCTGGAACACACAGACAGGTGCTCTAGTTCACAGCTATAGGGGAACAGGTGGAATTTTTGAAGTTTGCTGGAATGCAGCAGGAGACAAAGTTGGAGCCAGTGCATCAGATGGTTCAGTTTGTGTATTAGATCTTCGGAAATAG

XM_004834614.1 Coding sequence

Tbl1xr1 transducin (beta)-like 1 X-linked receptor 1, transcript variant X1

Length: 1545 bp    Location: 55013357..54835624   Strand: -
>XM_004834614.1
ATGAGTATAAGCAGTGATGAGGTCAACTTCTTGGTATATAGATACTTGCAAGAGTCAGGATTTTCTCATTCAGCATTTACCTTTGGTATAGAAAGCCATATAAGTCAGTCTAATATAAATGGTGCACTTGTCCCACCTGCTGCATTGATCTCTATCATCCAGAAAGGTCTACAGTATGTAGAGGCAGAAGTTAGTATAAATGAGGATGGTACCTTGTTTGATGGTCGGCCCATAGAATCTTTGTCCCTGATAGATGCCGTAATGCCTGATGTAGTACAAACAAGACAACAAGCTTACAGAGATAAGCTTGCACAGCAACAGGCAGCAGCTGCTGCAGCTGCTGCAGCTGCAACCAACCAACAAGGATCTGCAAAAAATGGAGAAAATACAGCAAATGGGGAAGAGAATGGAGCACATACTATAGCAAATAATCATACTGATATGATGGAAGTAGATGGGGATGTTGAAATCCCTCCTAATAAAGCAGTTGTGTTACGGGGCCATGAATCTGAAGTTTTCATCTGTGCCTGGAACCCTGTTAGCGATCTCTTGGCATCAGGGTCGGGAGACTCAACAGCAAGAATATGGAATCTTAGTGAAAATAGCACTAGTGGTTCCACACAGTTAGTACTTAGACATTGCATACGAGAAGGAGGACAAGATGTTCCAAGTAACAAGGATGTAACTTCTCTAGATTGGAATAGTGAAGGTACACTTCTAGCAACTGGTTCATATGATGGATTTGCCAGAATATGGACTAAAGATGGTAATCTTGCTAGCACCTTAGGGCAGCATAAAGGCCCTATATTTGCATTAAAATGGAATAAGAAAGGAAATTTCATCCTAAGTGCTGGAGTAGATAAGACTACAATTATTTGGGATGCACATACTGGTGAAGCAAAGCAACAGTTTCCTTTTCATTCAGCACCAGCATTGGATGTTGACTGGCAGAGCAACAATACCTTCGCTTCCTGTAGTACAGATATGTGCATTCATGTCTGCAAATTAGGACAAGACCGACCTGTTAAAACATTCCAGGGACATACGAATGAAGTAAATGCTATCAAATGGGACCCAACTGGCAATCTCCTGGCCTCCTGTTCTGATGACATGACTTTGAAGATATGGAGTATGAAACAAGACAGTTGTGTCCATGATTTGCAAGCACATAATAAAGAAATTTATACTATTAAGTGGAGTCCAACAGGACCAGGGACAAATAATCCAAATGCCAACCTTATGTTAGCAAGTGCATCCTTTGATTCTACTGTTAGGTTATGGGATGTAGACCGAGGGATTTGTATCCATACTTTGACAAAACACCAAGAACCTGTGTACAGTGTAGCGTTCAGTCCTGACGGCAGGTATCTGGCAAGTGGTTCTTTTGACAAATGTGTGCACATCTGGAACACACAGACAGGTGCTCTAGTTCACAGCTATAGGGGAACAGGTGGAATTTTTGAAGTTTGCTGGAATGCAGCAGGAGACAAAGTTGGAGCCAGTGCATCAGATGGTTCAGTTTGTGTATTAGATCTTCGGAAATAG

XM_004835174.1 Coding sequence

LOC101701652 spermatogenesis-associated protein 31A1-like

Length: 3339 bp    Location: 55328651..55333744   Strand: +
>XM_004835174.1
ATGTCGGTCTGGTGCCTTCCGATGACCTCTATGTGGTTTGCTGGAGGTGCCAGACATCCAGTGCAGATGAGGTGGAAGAAAAGGCAAAGGAAGAGGACACCTGCTCTCCTAGTTTCCAACTGCCCACCTCTTGGAGACTGCCAGATTTGCCAGAAATTGGATAAGAAGCCAATTCCCCTTCTGAAAAGCTTGCCGAGGCTGCTCCCTGGCCAAGGAAGCTCTCAACAGCCCGCACACCAACACCACCCTGCTGATGCGGGTACAAGAGCACCCGTCACAGCCCCACAGCCACAGGGGGAGAAAGCAGACCCTGCTGCCCTGTCCCTGGTAGAGGCTGCCCCCTCTCCTCTCACTCCACACCTTCTACCTCCGGACTCCTCTCCATCACCAGGCCCATCAACAACCTCCTCCGATTTTGTGCGTTCACGCACACCCCTCACTGCTTCTGAGTCCCCAGAGCCCCTGCTTCCCCTGGGAAGACTTTCACCCCAGCCACTTTCCCTTTCCCTTTCCCCACCACGTCCTCCCGATTGTGCCACAACCCCACCTCCCTGCTGGGACACAAACCAGAAGCCAGAACAGCAGCTTGGTCCTCAGCAACTCTCATGTCCCAAGATCCTGGGGGCCCACTTTCAGAAGAAATGTAACCAGCTTTTCTGGGGTCTGCCCTCTCTGCACAGTGAATCCATAACAGCTGCTGCTGGGATCTCTCAGAACCCTCCCGTTCCACACCTTTCCACCTTCTTATTCAACAGAATCCCACCTGTTTGCCCCGTTCACACGCAGGGTCAAATGTCCCCACTGCTTTCCCCGGCCCAGGATCCATCCTGTCTGGAGCCCCGATGCCCACTGCAATCCCAGCCCCCAGCTCTGGGTCAGGCCCAGACTCAGACCCACCCGCAGTCCTCCTCCCCCGTCCTGTTAGCACCTTCTCTGCCCCTCAGTAGGGGCCTTGGAGCATCCTGTTCTACCTCCCATAACCCTCAGTCACCCATCGCAACTGAAATTCAACACTCAGGAAGGCCCTCGTTGAAGAAACACCTAGAACGTGGGCGGGCTGTTCCCTCAGCAGTCCGAAGCCCTCAGGAGGATTACTCTTCCTCCACTCCCACCCTTTGCCAAGGCAAGGGTGCCACTGCCATCCTTCGTGAGAGTTTTCCAATCAGCTCTGAGCTCCGGGGAAAAAAAGAGCCACACATTCAAAAGTGGCACGTTCAACACCAGCAAGACCTGCCCTGCAGGATCCAGGAATCTCCAGAACTCACACAGCCTCAGTGTGACTTAGCGCATTCACCTCAGGTAAAGGACAAACCCAGGCTCTCACATTCGTCTGTGTCTACAGGCAAACCCAGCAAGGATGTGCGGAAGGTGAGGTTCCAGCTAAGGAGGGACTCAGGCAAGAATGTGGGGCATAGTCTAGGCAAGTTCTCAAAAGATCTCTCCAGGGCCCTAGGAAGCTCCCTAGTGAAGGCTCTGGGGGCAATCTCTGAGGAGTCAGAGAGGAACCTGATGTGGCCCATGGACAGTGACACAAGAAATGACTCACTCGGAAGTAGAGACAAGAAACATCTAGAAGGCGCGCTGAAAGCACATTTGGGTGTGAAGATGGGGCAGATCCATGAGGGGCTGATCCCTCTGAGAGTGCGCCAGTCCTGGAACACTGTAAATGAGCCCTTTTCCAAGTCTCACACCCCCAAGAAAACCAGAACTCCAGCATCCTCCAGGAGTTGGGAAACCCATGTGAGCACCATCCAGAACTTTTTCTCCAATCCAGGCACCCAGCAGGACCTGGAGATGCAGAGTACAAGGTTAAGGGTGAGGCACAGGTGGGGCCTCCCCCTCAAGCTCCTCAAGGCCATAAACGCCTTTAAGTCAACAAAGGCTGCACCCTCCCACTTTCCACAGTTTACCCGTCCCTCCTCCTCTGCCGGTGTGTCCGGGGCTGACTTGACAGTGGAGGATGAGGCCAAGTTCCTGGGAAAACCACCTCAGGGATGTCCGGGAGAGGAGGCGACAGTCAGGCAGTCTGTCCGCACACGGGACAGTCTCCTTGTCTCCTCTCTTTCGTGTAAGGAGACCAAGAGGGACCTGGCAGGGATCCCTCTTGGTGATGGCCAGGGGTCCTCAGAGGCCCCCCTCACTAGACAGGACAGTGCGGGGCCTTCACAGCAACTCACATCCAGCCTCATGGGCAGAACCTGTGAGAGAAGGAGCATCCAAAGGGTTGGTAGAGGCAGCCCAAAAGTCCCCTTGCTTCCTGGAACACGTATCACCCAAGATGCAGGAGAGCCAGGCCTTTGGGCAGACACTGGGAGCAAGTTTCAGCACGGAGTGGAAACCAAGTCAGTGAGCCATTGTCAAGTCTGTGTCACAGGTGTCCACCTTCCAGACTGTCCCACTGACACTCTCTGTGCTTCACACCGTTTGGCGTCTCCAGAGTCCCAGAGCTGCCATCGCAGCATGTCTCTAGGGGACATGCTAGCTCCACAACTGTTTGATGGCCTAATGGCAGGCAGAGGGAGCAGCCTGGGGCAGCAGAAGCCCAGGATCCTGAAACATCAGCACTCACCGAAGAGGCAAAGCAAGACATCTGCCCCTGCTGACAAGCATGAGGTTGGTAGGAGCCCCAGCTCAGGAAAACGTGAAGACAGGTTGGGAGACTTGGGGACCTCTGAGCTCACCCAGGATGGGGGAATAGAAGACACCTCAGAGAGTAAACACCTTCAGCTCCCACAAAAGAAACCAGTCCCCTCAGAAGGCTACTTCCAAAGAAGCATGAAGGAATGTCTACAGTGGGTTTTACCTAAGAAAGAAATCAAAGGGCAGGAAGACACCCAGAAAAATGGCAAGCCTGCATGCCCCATGGCCCAAAGTCAGAGATCAGCCAAAAACATACTTTATGTGGACCATAACACTGATGAGGTTCAGCAGCTCGTGACAGCACTTGGGCAGATGGTAGAAGCCACAATAATGCTTAAGCGCAAATTTTGTGTCTTGAAGTTCAATCAGCACAAAGAGGAAGAAGGTCACGGCCCAGTCGCCCAGGTTTCCTGCTCCTCAGAGCACAGGAGGAGAAAGCCAGGACATGCAGCCACCCCCAAGTGCCACAGCTGTCCTACCAGGGAGAGGCACCCCCGTGGCCAAGAGTCCTTGAAAACTGGACAGCTCAACAGTGAGCAGCAGGGTCGGAGGCATCCCCAACCCTCCTTCCCCATCAAGGCTGTGCCCCCAGTCAGCCCCTCCCAGTGTGGCCCAACAGCATCCAGGGCACCAGGCCGACAACATTATTGCCCAAGGTGTGGTCCTCTTTTGGGAGGTGTCTTCACTGGACAACAGTGA

XM_004834623.1 Coding sequence

Kcnmb3 potassium large conductance calcium-activated channel, subfamily M beta member 3, transcript variant X3

Length: 672 bp    Location: 57003014..56975782   Strand: -
>XM_004834623.1
ATGCTGCTGGGGTTTGCAATGATGGGTTTCTCAGTCCTAATGTTCTTCTTGCTTGGGACAACCATCCTGAAGCCTTTTATGCTCAGCATACAGAGAGAAGAATCAAACTGCACAACCATCCACACACAGATCATGGACGACTGGCTGGACTATACTTTCACCTGTGGCGTGGACTGCCAAGGTCAGGGGAAGTATCCATGTCTTCAGGTGTTTGTGAACCTCACCCACTCAGGACAGAAAGCTCTCCTACATTATAATGAAGAGGCTGCCCAGTTCAATTCCAAGTGCTTTTATACACCTAAGTGCCACCAAGATAGGAATGATTTACTCAACAGTGTTCTGGATATAAAGGAATTCTTCGATCACAAAAATGGAATGTCTTTCTCATGCTTCTACAGTCCAGACAGCCAATCTGAAGATGTCATTCTTATAAAAAAATATGATCCAATGGTTATCTTCCACTGCTTATTCTGGCCTTCACTGACTCTGCTAGGTGGTGCCCTGATTGTTGGTATGGTGAGATTAACACAGCACCTGTCTCTTCTCTGTGAAAAATATAGCATCATGGTCAGAGATGAAGTAGGTGGCAAAGTACCCTCTATAGGACAGCATCAATACAAACTGTGCAGTACAGAAAAGAGGAAAGGAAGAAACAGGGCAATCTTAAGATAA

XM_004834621.1 Coding sequence

Kcnmb3 potassium large conductance calcium-activated channel, subfamily M beta member 3, transcript variant X1

High confidence: 4 potential gene matches
Length: 840 bp    Location: 56987731..56975782   Strand: -
>XM_004834621.1
ATGCAGCCCTTCAGCATCCCCGTCCAAATCACACTCCAGGGCAGCCGCAGGCACCAGGGGAGGACAGCCTTTTCTATCCCTGGGAAGAAGAGACACAGAGACTACAGCAATGGAGAACCACCAGACATATACCAGAAGTTGCTGTCCAGCGCTGGAGAGGACAGAGCCATGCTGCTGGGGTTTGCAATGATGGGTTTCTCAGTCCTAATGTTCTTCTTGCTTGGGACAACCATCCTGAAGCCTTTTATGCTCAGCATACAGAGAGAAGAATCAAACTGCACAACCATCCACACACAGATCATGGACGACTGGCTGGACTATACTTTCACCTGTGGCGTGGACTGCCAAGGTCAGGGGAAGTATCCATGTCTTCAGGTGTTTGTGAACCTCACCCACTCAGGACAGAAAGCTCTCCTACATTATAATGAAGAGGCTGCCCAGTTCAATTCCAAGTGCTTTTATACACCTAAGTGCCACCAAGATAGGAATGATTTACTCAACAGTGTTCTGGATATAAAGGAATTCTTCGATCACAAAAATGGAATGTCTTTCTCATGCTTCTACAGTCCAGACAGCCAATCTGAAGATGTCATTCTTATAAAAAAATATGATCCAATGGTTATCTTCCACTGCTTATTCTGGCCTTCACTGACTCTGCTAGGTGGTGCCCTGATTGTTGGTATGGTGAGATTAACACAGCACCTGTCTCTTCTCTGTGAAAAATATAGCATCATGGTCAGAGATGAAGTAGGTGGCAAAGTACCCTCTATAGGACAGCATCAATACAAACTGTGCAGTACAGAAAAGAGGAAAGGAAGAAACAGGGCAATCTTAAGATAA

XM_004834627.1 Coding sequence

Znf639 zinc finger protein 639, transcript variant X2

Length: 1458 bp    Location: 57074062..57085241   Strand: +
>XM_004834627.1
ATGAATGAATATCCTAAAAAAAGAAAGAGGAAGACTTTACACCCTTCTCGTTATTCAGATTCCTCTGGAATAAGCAGAATTGCAGATGGATTCAGTGGCATTTTTTCTGATCATTGTTACAGTGTCTGTTCTATGAGACAGCCAGACTTAAAATATTTTGACAATAAAGATGATGATTCGGATACTGAAATATCAAATGACCTACCAAAATTTGCAGAAGGAATCAAGGCCAGAAACAGAAATCATAACTACCTGGTTCCCAGTCCTGTACTTAGAATTCTAGACCACACTTCCTTTTCTTCAGAAAAATCTGCTGATGTTGAAATTTGTGATGAAGAGTGTGACTCACCTGAATCAGTCAACCAGCAAACTCACGAGGAGAATCCTATAGAAGTCCACACTGCCGAAGATGTTCCAATTGCTGTAGAGGTACATGCAATTTCGGAGGATTATGATATAGAGACAGAAAACAATTCCTCAGAAAGCCTCCAAGACCAAACTGATGAAGAGCCACCCACTAAACTTTGTAAGATTCTTGACAAAAGCCAAGCTTTGAATGTAACTGCCCAGCAGAAATGGCCTTTACTGAGAGCTAATAGCAGTGGCCTCTATAAATGTGAACTTTGTGAATTCAACAGTAAATATTTCTCTGATTTAAAGCAGCATATGATCCTAAAGCATAAACGTACTGATTCAAATGTGTGCCGAGTATGCAAGGAAAGTTTCTCTACCAACATGCTTCTGATTGAACATGCCAAACTACATGAAGAGGATCCCTACATTTGTAAATACTGTGACTATAAGACAGTCATTTTTGAGAACCTCAGCCAGCACATTGCAGACACCCACTTTAGTGATCACCTCTACTGGTGTGAGCAGTGTGATGTGCAGTTTTCCTCAAGCAGTGAGCTCTACCTACATTTCCAGGAGCACAGCTGTGATGAACAGTACTTGTGTCAATTCTGTGAACACGAAACCAATGATCCAGAAGACTTGCACAGCCATGTGGTAAATGAGCATGCATGTAAATTAATAGAATTAAGTGATAAGTATAACAATGGACAACATGGACAGTACAGCCTCTTAAGCAAAATTACTTTTGACAAATGTAAGAACTTCTTCGTATGTCAAGTATGTGGTTTTCGGAGCAGACTTCACACAAATGTTAACAGGCATGTTGCTATTGAACATACTAAAATATTTCCTCATGTCTGTGATGACTGTGGGAAAGGCTTTTCAAGCATGCTAGAATACTGCAAGCATTTAAATTCACATTTATCTGAAGGGATTTATTTATGTCAGTATTGTGAATATTCAACAGGACAAATTGAAGATCTTAAAATTCACTTGGATTTCAAGCATTCGGCTGACTTACCTCATAAATGTAGTGACTGCTTGATGAGGTTTGGAAATGAAAGGGAATTAATAAGCCACCTGCCAGTCCATGAGACAACTTGA

XM_004834628.1 Coding sequence

Znf639 zinc finger protein 639, transcript variant X3

Length: 1458 bp    Location: 57074162..57085241   Strand: +
>XM_004834628.1
ATGAATGAATATCCTAAAAAAAGAAAGAGGAAGACTTTACACCCTTCTCGTTATTCAGATTCCTCTGGAATAAGCAGAATTGCAGATGGATTCAGTGGCATTTTTTCTGATCATTGTTACAGTGTCTGTTCTATGAGACAGCCAGACTTAAAATATTTTGACAATAAAGATGATGATTCGGATACTGAAATATCAAATGACCTACCAAAATTTGCAGAAGGAATCAAGGCCAGAAACAGAAATCATAACTACCTGGTTCCCAGTCCTGTACTTAGAATTCTAGACCACACTTCCTTTTCTTCAGAAAAATCTGCTGATGTTGAAATTTGTGATGAAGAGTGTGACTCACCTGAATCAGTCAACCAGCAAACTCACGAGGAGAATCCTATAGAAGTCCACACTGCCGAAGATGTTCCAATTGCTGTAGAGGTACATGCAATTTCGGAGGATTATGATATAGAGACAGAAAACAATTCCTCAGAAAGCCTCCAAGACCAAACTGATGAAGAGCCACCCACTAAACTTTGTAAGATTCTTGACAAAAGCCAAGCTTTGAATGTAACTGCCCAGCAGAAATGGCCTTTACTGAGAGCTAATAGCAGTGGCCTCTATAAATGTGAACTTTGTGAATTCAACAGTAAATATTTCTCTGATTTAAAGCAGCATATGATCCTAAAGCATAAACGTACTGATTCAAATGTGTGCCGAGTATGCAAGGAAAGTTTCTCTACCAACATGCTTCTGATTGAACATGCCAAACTACATGAAGAGGATCCCTACATTTGTAAATACTGTGACTATAAGACAGTCATTTTTGAGAACCTCAGCCAGCACATTGCAGACACCCACTTTAGTGATCACCTCTACTGGTGTGAGCAGTGTGATGTGCAGTTTTCCTCAAGCAGTGAGCTCTACCTACATTTCCAGGAGCACAGCTGTGATGAACAGTACTTGTGTCAATTCTGTGAACACGAAACCAATGATCCAGAAGACTTGCACAGCCATGTGGTAAATGAGCATGCATGTAAATTAATAGAATTAAGTGATAAGTATAACAATGGACAACATGGACAGTACAGCCTCTTAAGCAAAATTACTTTTGACAAATGTAAGAACTTCTTCGTATGTCAAGTATGTGGTTTTCGGAGCAGACTTCACACAAATGTTAACAGGCATGTTGCTATTGAACATACTAAAATATTTCCTCATGTCTGTGATGACTGTGGGAAAGGCTTTTCAAGCATGCTAGAATACTGCAAGCATTTAAATTCACATTTATCTGAAGGGATTTATTTATGTCAGTATTGTGAATATTCAACAGGACAAATTGAAGATCTTAAAATTCACTTGGATTTCAAGCATTCGGCTGACTTACCTCATAAATGTAGTGACTGCTTGATGAGGTTTGGAAATGAAAGGGAATTAATAAGCCACCTGCCAGTCCATGAGACAACTTGA

XM_004834642.1 Coding sequence

Pex5l peroxisomal biogenesis factor 5-like, transcript variant X2

Length: 1956 bp    Location: 57701593..57505548   Strand: -
>XM_004834642.1
ATGTCTGACACTGAAATGGATAGAAGGACTCACATTCCTTCTCTACTTAATGTCCTTTTGTCCAGAAATCGGGTCATGCAAATGAGCTACTTGAAAAGTAAAGAACAAGGATATGGAAAACTAAGCTGTGATGAAGACCTTGAAATAATTGTTGATCAAAAGCAGGGAAAAGGCTCTAGGGCGGCAGATAAGGCTGTTGCCATGGTGATGAAGGAGATACCGAGGGAGGAGTCTGCTGAAGAAAAGCCCCTCCTTACTATGACATCACAGCTGGTGAATGAGCAACAGGAAAGCAGGCCGCTCCTGAGTCCGTCCATTGATGACTTTCTCTGTGAAACCAAATCGGAGGCAATTGCAAGGCCAGTAACGTCCAATACAGCCGTGTTGACCACTGGCTTAGATCTCCTTGACCTGAGTGAACCAGTGTCTCAAACCCAAACCAAAGCTAAGAAGTTGGAGGCCTCATCAAAAACCTCATCCCTCAAGAAAAAGGTCGATGGATCAGACCTCATCAGTGCAGATGCTGAGCAGAGAAGCCAGCCTCTCAGAGGCCCAGAGACCTCATCCTTAGATCTTGTAGACATTCAAACACAACTGGAAAAATGGGATAATGTTAAGTTTCATGGAGATCGAAACAGCAAAGGGCATCCAATGGCAGAGAGAAAATCCTGCTCATCCAGAACTGGATCAAAAGAGCTCTTATGGTCCTCAGAGCACAGGTCTCAACCAGAACTGAGTGGCGGGAAAAGTGCCCTAAACTCTGAATCTGCTTCTGAACTAGAGTTAGTGACTCCAGCACAGGCTCGGCTGACTAAAGAACATCGCTGGGGAAGTTCACTGCTTTCTAGAAACCACTCCTTGGAAGAGGAATTTGAAAGGGCAAAGGCAGCAGTAGAGTCAGACACAGAGTTTTGGGATAAGATGCAAGCAGAATGGGAAGAAATGGCCCGGAGAAACTGGATCTCTGAGAACCAAGAAGCCCAGAACCAAGTTACAATCTCAGCTAGTGAGAAGGGATATTACTTTCACACCGAAAACCCCTTTAAGGACTGGCCTGGAGCATTTGAAGAAGGCTTAAAAAGGCTGAAGGAAGGGGACCTGCCAGTCACCATCCTGTTCATGGAGGCAGCGATCCTTCAGGATCCTGGAGATGCAGAGGCATGGCAGTTTCTTGGGATAACCCAGGCGGAAAATGAAAACGAACAAGCAGCCATTGTCGCCCTCCAGAGGTGCTTAGAATTGCAGCCCAACAACTTGAAAGCTTTGATGGCTTTGGCTGTGAGTTATACAAACACTGGCCATCAGCAGGATGCCTGTGAAGCTCTGAAGAATTGGATTAAGCAAAACCCAAAGTACAAATACCTTGTGAAGAGCAAGAAGGGATCTCCAGGCCTCTCTCGGCGGATGTCTAAGTCCCCAGTTGACAGCTCTGTTCTAGAAGGAGTGAAAGAATTATATCTGGAAGCTGCCCATCAAAACGGAGACATGATTGACCCAGACCTACAGACAGGTCTGGGGGTACTGTTCCACCTGAGTGGGGAATTTAACAGAGCAATAGATGCATTTAACGCTGCCTTAACTGTTCGGCCAGAGGACTATTCATTATGGAACCGTCTTGGGGCGACCCTGGCAAATGGAGACCGCAGTGAGGAAGCTGTGGAGGCCTACACACGAGCGCTGGAGATCCAGCCAGGCTTCATCCGGTCCAGATACAACCTGGGGATTAGCTGTATCAACCTGGGCGCCTACAGAGAAGCGGTCAGCAATTTTCTCACTGCCCTCAGTTTGCAAAGAAAGAGCAGGAATCAACAGCAAGTTCCTCATCCTGCAATCTCTGGGAACATCTGGGCTGCCCTCAGAATTGCACTGTCACTGATGGACCAACCAGAACTCTTCCAGGCAGCTAATCTTGGTGACCTGGATGTCCTCCTAAGAGCTTTCAATTTGGATCCTTGA

XM_004834634.1 Coding sequence

Actl6a actin-like 6A, transcript variant X1

High confidence: 4 potential gene matches
Length: 1290 bp    Location: 57305119..57337797   Strand: +
>XM_004834634.1
ATGAGCGGCGGCGTGTACGGGGGAGATGAAGTTGGAGCCCTGGTTTTTGACATTGGATCCTATACTGTCAGAGCTGGTTATGCTGGTGAGGACTGCCCCAAGGTGGATTTCCCCACAGCTATTGGAATGGTGCTAGAAAGAGATGATGGAAGCACCCTGATGGAAATAGATGGCGATAAAGGCAAACAAGGCGGCCCCAGCTACTACATAGACACCAACGCCCTGCGTGTTCCGAGGGAGAATATGGAGGCCATTTCACCACTAAAAAATGGCATGGTTGAAGACTGGGATAGTTTCCAAGCTATTTTGGATCACACCTATAAAATGCACGTCAAATCAGAAGCCAGCCTGCATCCTGTTCTCATGTCAGAGGCGCCGTGGAATACTAGAGCAAAGAGAGAGAAACTGACAGAGTTAATGTTTGAACACTACAACATCCCTGCATTCTTCCTATGCAAAACTGCAGTTTTGACAGCATTTGCTAACGGTCGTTCTACAGGGCTAATTTTGGACAGTGGGGCGACTCATACCACTGCAATTCCAGTCCACGATGGTTACGTCCTTCAACAAGGCATTGTGAAGTCCCCTCTTGCTGGAGATTTTATAACTATGCAATGCAGAGAACTCTTCCAAGAAATGAACATAGAATTGATTCCTCCATATATGATTGCATCAAAAGAAGCTGTTCGTGAAGGATCTCCAGCAAACTGGAAAAGAAAAGAGAAGTTGCCACAGGTTACAAGATCTTGGCACAATTACATGTGTAATTGTGTTATCCAAGATTTTCAAGCTTCAGTACTTCAAGTGTCAGATTCAACTTACGATGAACAAGTAGCTGCACAGATGCCAACTGTTCATTATGAATTTCCTAACGGCTACAACTGTGATTTTGGTGCAGAACGGCTAAAAATTCCTGAAGGATTATTTGACCCTTCCAATGTAAAGGGGTTATCAGGAAATACAATGTTGGGAGTCAGTCATGTTGTCACTACAAGTGTCGGAATGTGTGATATTGATATTAGACCCGGTCTCTATGGCAGTGTGATAGTGGCAGGAGGAAACACGCTAATACAGAGTTTTACTGATAGGTTGAATAGAGAGCTTTCTCAGAAAACTCCTCCAAGTATGCGGTTGAAACTGATTGCAAATAACACAACAGTGGAACGGAGGTTTAGTTCTTGGATTGGTGGCTCCATTCTAGCTTCTTTGGGTACCTTTCAACAGATGTGGATTTCCAAACAAGAATATGAAGAAGGAGGAAAGCAGTGTGTAGAAAGGAAATGCCCTTGA

XM_004834635.1 Coding sequence

Actl6a actin-like 6A, transcript variant X2

Length: 1164 bp    Location: 57305122..57337797   Strand: +
>XM_004834635.1
ATGGTGCTAGAAAGAGATGATGGAAGCACCCTGATGGAAATAGATGGCGATAAAGGCAAACAAGGCGGCCCCAGCTACTACATAGACACCAACGCCCTGCGTGTTCCGAGGGAGAATATGGAGGCCATTTCACCACTAAAAAATGGCATGGTTGAAGACTGGGATAGTTTCCAAGCTATTTTGGATCACACCTATAAAATGCACGTCAAATCAGAAGCCAGCCTGCATCCTGTTCTCATGTCAGAGGCGCCGTGGAATACTAGAGCAAAGAGAGAGAAACTGACAGAGTTAATGTTTGAACACTACAACATCCCTGCATTCTTCCTATGCAAAACTGCAGTTTTGACAGCATTTGCTAACGGTCGTTCTACAGGGCTAATTTTGGACAGTGGGGCGACTCATACCACTGCAATTCCAGTCCACGATGGTTACGTCCTTCAACAAGGCATTGTGAAGTCCCCTCTTGCTGGAGATTTTATAACTATGCAATGCAGAGAACTCTTCCAAGAAATGAACATAGAATTGATTCCTCCATATATGATTGCATCAAAAGAAGCTGTTCGTGAAGGATCTCCAGCAAACTGGAAAAGAAAAGAGAAGTTGCCACAGGTTACAAGATCTTGGCACAATTACATGTGTAATTGTGTTATCCAAGATTTTCAAGCTTCAGTACTTCAAGTGTCAGATTCAACTTACGATGAACAAGTAGCTGCACAGATGCCAACTGTTCATTATGAATTTCCTAACGGCTACAACTGTGATTTTGGTGCAGAACGGCTAAAAATTCCTGAAGGATTATTTGACCCTTCCAATGTAAAGGGGTTATCAGGAAATACAATGTTGGGAGTCAGTCATGTTGTCACTACAAGTGTCGGAATGTGTGATATTGATATTAGACCCGGTCTCTATGGCAGTGTGATAGTGGCAGGAGGAAACACGCTAATACAGAGTTTTACTGATAGGTTGAATAGAGAGCTTTCTCAGAAAACTCCTCCAAGTATGCGGTTGAAACTGATTGCAAATAACACAACAGTGGAACGGAGGTTTAGTTCTTGGATTGGTGGCTCCATTCTAGCTTCTTTGGGTACCTTTCAACAGATGTGGATTTCCAAACAAGAATATGAAGAAGGAGGAAAGCAGTGTGTAGAAAGGAAATGCCCTTGA

XM_004834640.1 Coding sequence

Usp13 ubiquitin specific peptidase 13 (isopeptidase T-3), transcript variant X3

Length: 2301 bp    Location: 57384906..57490985   Strand: +
>XM_004834640.1
ATGCAGCGCCGGGGCGCCCTGTTCGGCGTGCTGGGCGGCGGCAGGAAGATGGCTGCAGGCGACATCGGCGAGCTGCTGGTGCCCCACATGCCCACGATCCGCGTGCCCAGGTCCGGGGACAGGGTCTACAAGAACGAGTGCGCCTTCTCCTATGACTCCCCCAACTCTGAAGGTGGACTCTATGTATGCATGAATACGTTTTTGGCCTTTGGAAGGGAACATGTTGAAAGACATTTTCGAAAAACTGGACAGAGTGTCTACATGCACCTAAAAAGACATGTGAAAGAGAAGGTAAGAGGGGCATCTGGTGGAGCTTTACCACAAAGGAGGAATTCCAAGATATTTTTAGATCTAGATACTGATGACGATTTAAATAGCGACGATTATGAATATGAAGATGAAGCCAAACTTGTTATATTCCCAGACCACTATGAAATAGCACTACCAAATATTGAGGAGTTACCAGCCCTGGTAACAATTGCTTGTGATGCAGTTCTCAGCTCGAAATCTCCATACAGAAAGCAGGACCCAGACACATGGGAAAATGAATTGCCAGTATCTAAATATGCCAATAACCTCACCCAGCTGGACAATGGAGTCAGGATTCCTCCAAGTGGTTGGAAGTGTGCCAGGTGTGACCTTCGGGAGAACCTCTGGTTGAATTTGACCGACGGCTCCATCCTGTGTGGAAAGTGGTTCTTTGACAGCTCTGGGGGTAATGGGCATGCGCTGGAGCATTATAGAGACATGGGCTATCCTTTGGCTGTGAAGTTGGGAACCATCACTCCTGATGGGGCAGATGTTTATTCTTTTCAAGAAGAGGAACCTGTTTTGGATCCTCACTTGGCCAAGCATTTAGCACATTTTGGAATTGATATGCTTCACATGCATGGGACAGAGAATAGGCTCCGGGACAATGACATCAAGCCGAGGGTCAGTGAGTGGGAAGTGATCCAGGAGTCGGGGACAAAGCTGAAGCCCATGTATGGCCCCGGGTACACGGGCCTGAAGAACCTGGGCAACAGCTGCTATCTCAGCTCTGTCATGCAGGCCATCTTCAGCATCCCAGAGTTCCAGAGAGCGTATGTAGGAAATCTTCCAAGAATATTTGACTACTCGCCTTTAGATCCAACACAAGATTTCAACACACAGATGACTAAGTTAGGACACGGCCTTCTCTCAGGCCAGTATTCAAAGCCTCCAGTGAAAGCTGAGCTCATTGAGCAGGTGATGAAGGAGGAGCACAAGCCTCAACAGAATGGGATCTCTCCACGTATGTTTAAGGCTTTTGTCAGCAAGAGCCACCCAGAATTCTCCTCTAACAGACAACAAGATGCCCAGGAGTTTTTCTTGCACTTGGTGAATCTTGTAGAGAGAAATCGCATTGGCTCAGAAAACCCAAGTGATGTTTTTCGTTTTTTGGTGGAAGAACGTATTCAGTGCTGCCAGACCCGAAAAGTCCGCTACACAGAGAGGGTGGATTACCTGATGCAGCTACCTGTGGCCATGGAGGCAGCAACCAACAAAGATGAACTGATTGCCTATGAATTAACACGAAGAGAAGCAGAAGCAAACAGAAGACCCCTTCCTGAACTGGTGCGTGCCAAGATACCATTCAGTGCCTGCCTTCAGGCTTTTTCAGAACCAGAAAACGTTGATGATTTCTGGAGCAGCGCCCTACAAGCGAAGTCTGCAGGCGTGAAAACATCTCGCTTTGCCTCATTCCCCGAATACTTGGTAGTGCAGATAAAGAAGTTCACTTTTGGTCTTGACTGGGTTCCCAAAAAATTTGATGTTTCTATTGATATGCCAGATCTACTTGATATCAACCATCTCCGAGCCAGAGGGTTACAGCCAGGAGAGGAGGAACTTCCAGACATCAGCCCTCCCATAGTCATTCCTGATGACTCCAAAGATCGTCTGATGAACCAATTGATAGACCCCTCAGACATTGATGAGTCATCGGTGATGCAGCTGGCTGAGATGGGCTTCCCTCTGGAAGCCTGCCGGAAGGCTGTGTACTTTACTGGAAATATGGGAGCTGAGGTGGCCTTCAACTGGATCATTATCCACATGGAAGAGCCTGATTTTGCCGAACCGCTGACCATGCCTGGTTATGGAGGAGCAGCGTCTGCTGGAGCCTCGGTATTTGGTGCTAGTGGGTTGGATAACCAGCCTCCAGAGGAAATTGTAGCTATCATTACCTCCATGGGATTCCAGAGAAATCAGGCTGTGCAGGCATTACGAGCAACGTGTATGAATTATTTGCATTTATCAGTCACATGGGAACATCTACAATGA

XM_004834646.1 Coding sequence

Pex5l peroxisomal biogenesis factor 5-like, transcript variant X6

Length: 1812 bp    Location: 57763369..57505548   Strand: -
>XM_004834646.1
ATGTACCAGGGACACATGCAGGGAAAAGGCTCTAGGGCGGCAGATAAGGCTGTTGCCATGGTGATGAAGGAGATACCGAGGGAGGAGTCTGCTGAAGAAAAGCCCCTCCTTACTATGACATCACAGCTGGTGAATGAGCAACAGGAAAGCAGGCCGCTCCTGAGTCCGTCCATTGATGACTTTCTCTGTGAAACCAAATCGGAGGCAATTGCAAGGCCAGTAACGTCCAATACAGCCGTGTTGACCACTGGCTTAGATCTCCTTGACCTGAGTGAACCAGTGTCTCAAACCCAAACCAAAGCTAAGAAGTTGGAGGCCTCATCAAAAACCTCATCCCTCAAGAAAAAGGTCGATGGATCAGACCTCATCAGTGCAGATGCTGAGCAGAGAAGCCAGCCTCTCAGAGGCCCAGAGACCTCATCCTTAGATCTTGTAGACATTCAAACACAACTGGAAAAATGGGATAATGTTAAGTTTCATGGAGATCGAAACAGCAAAGGGCATCCAATGGCAGAGAGAAAATCCTGCTCATCCAGAACTGGATCAAAAGAGCTCTTATGGTCCTCAGAGCACAGGTCTCAACCAGAACTGAGTGGCGGGAAAAGTGCCCTAAACTCTGAATCTGCTTCTGAACTAGAGTTAGTGACTCCAGCACAGGCTCGGCTGACTAAAGAACATCGCTGGGGAAGTTCACTGCTTTCTAGAAACCACTCCTTGGAAGAGGAATTTGAAAGGGCAAAGGCAGCAGTAGAGTCAGACACAGAGTTTTGGGATAAGATGCAAGCAGAATGGGAAGAAATGGCCCGGAGAAACTGGATCTCTGAGAACCAAGAAGCCCAGAACCAAGTTACAATCTCAGCTAGTGAGAAGGGATATTACTTTCACACCGAAAACCCCTTTAAGGACTGGCCTGGAGCATTTGAAGAAGGCTTAAAAAGGCTGAAGGAAGGGGACCTGCCAGTCACCATCCTGTTCATGGAGGCAGCGATCCTTCAGGATCCTGGAGATGCAGAGGCATGGCAGTTTCTTGGGATAACCCAGGCGGAAAATGAAAACGAACAAGCAGCCATTGTCGCCCTCCAGAGGTGCTTAGAATTGCAGCCCAACAACTTGAAAGCTTTGATGGCTTTGGCTGTGAGTTATACAAACACTGGCCATCAGCAGGATGCCTGTGAAGCTCTGAAGAATTGGATTAAGCAAAACCCAAAGTACAAATACCTTGTGAAGAGCAAGAAGGGATCTCCAGGCCTCTCTCGGCGGATGTCTAAGTCCCCAGTTGACAGCTCTGTTCTAGAAGGAGTGAAAGAATTATATCTGGAAGCTGCCCATCAAAACGGAGACATGATTGACCCAGACCTACAGACAGGTCTGGGGGTACTGTTCCACCTGAGTGGGGAATTTAACAGAGCAATAGATGCATTTAACGCTGCCTTAACTGTTCGGCCAGAGGACTATTCATTATGGAACCGTCTTGGGGCGACCCTGGCAAATGGAGACCGCAGTGAGGAAGCTGTGGAGGCCTACACACGAGCGCTGGAGATCCAGCCAGGCTTCATCCGGTCCAGATACAACCTGGGGATTAGCTGTATCAACCTGGGCGCCTACAGAGAAGCGGTCAGCAATTTTCTCACTGCCCTCAGTTTGCAAAGAAAGAGCAGGAATCAACAGCAAGTTCCTCATCCTGCAATCTCTGGGAACATCTGGGCTGCCCTCAGAATTGCACTGTCACTGATGGACCAACCAGAACTCTTCCAGGCAGCTAATCTTGGTGACCTGGATGTCCTCCTAAGAGCTTTCAATTTGGATCCTTGA

XM_004834641.1 Coding sequence

Pex5l peroxisomal biogenesis factor 5-like, transcript variant X1

Length: 2019 bp    Location: 57701593..57505548   Strand: -
>XM_004834641.1
ATGTCTGACACTGAAATGGATAGAAGGACTCACATTCCTTCTCTACTTAATGTCCTTTTGTCCAGAAATCGGGTCATGCAAATGAGCTACTTGAAAAGTAAAGAACAAGGATATGGAAAACTAAGCTGTGATGAAGACCTTGAAATAATTGTTGATCAAAAGCAGGTAGTAGGTGTTACCTTGAAGAGAAAGTGGCACTGTCTTCAAAAAAGTGACCTGACCCTGGCGTTGGGAAAAGGCTCTAGGGCGGCAGATAAGGCTGTTGCCATGGTGATGAAGGAGATACCGAGGGAGGAGTCTGCTGAAGAAAAGCCCCTCCTTACTATGACATCACAGCTGGTGAATGAGCAACAGGAAAGCAGGCCGCTCCTGAGTCCGTCCATTGATGACTTTCTCTGTGAAACCAAATCGGAGGCAATTGCAAGGCCAGTAACGTCCAATACAGCCGTGTTGACCACTGGCTTAGATCTCCTTGACCTGAGTGAACCAGTGTCTCAAACCCAAACCAAAGCTAAGAAGTTGGAGGCCTCATCAAAAACCTCATCCCTCAAGAAAAAGGTCGATGGATCAGACCTCATCAGTGCAGATGCTGAGCAGAGAAGCCAGCCTCTCAGAGGCCCAGAGACCTCATCCTTAGATCTTGACATTCAAACACAACTGGAAAAATGGGATAATGTTAAGTTTCATGGAGATCGAAACAGCAAAGGGCATCCAATGGCAGAGAGAAAATCCTGCTCATCCAGAACTGGATCAAAAGAGCTCTTATGGTCCTCAGAGCACAGGTCTCAACCAGAACTGAGTGGCGGGAAAAGTGCCCTAAACTCTGAATCTGCTTCTGAACTAGAGTTAGTGACTCCAGCACAGGCTCGGCTGACTAAAGAACATCGCTGGGGAAGTTCACTGCTTTCTAGAAACCACTCCTTGGAAGAGGAATTTGAAAGGGCAAAGGCAGCAGTAGAGTCAGACACAGAGTTTTGGGATAAGATGCAAGCAGAATGGGAAGAAATGGCCCGGAGAAACTGGATCTCTGAGAACCAAGAAGCCCAGAACCAAGTTACAATCTCAGCTAGTGAGAAGGGATATTACTTTCACACCGAAAACCCCTTTAAGGACTGGCCTGGAGCATTTGAAGAAGGCTTAAAAAGGCTGAAGGAAGGGGACCTGCCAGTCACCATCCTGTTCATGGAGGCAGCGATCCTTCAGGATCCTGGAGATGCAGAGGCATGGCAGTTTCTTGGGATAACCCAGGCGGAAAATGAAAACGAACAAGCAGCCATTGTCGCCCTCCAGAGGTGCTTAGAATTGCAGCCCAACAACTTGAAAGCTTTGATGGCTTTGGCTGTGAGTTATACAAACACTGGCCATCAGCAGGATGCCTGTGAAGCTCTGAAGAATTGGATTAAGCAAAACCCAAAGTACAAATACCTTGTGAAGAGCAAGAAGGGATCTCCAGGCCTCTCTCGGCGGATGTCTAAGTCCCCAGTTGACAGCTCTGTTCTAGAAGGAGTGAAAGAATTATATCTGGAAGCTGCCCATCAAAACGGAGACATGATTGACCCAGACCTACAGACAGGTCTGGGGGTACTGTTCCACCTGAGTGGGGAATTTAACAGAGCAATAGATGCATTTAACGCTGCCTTAACTGTTCGGCCAGAGGACTATTCATTATGGAACCGTCTTGGGGCGACCCTGGCAAATGGAGACCGCAGTGAGGAAGCTGTGGAGGCCTACACACGAGCGCTGGAGATCCAGCCAGGCTTCATCCGGTCCAGATACAACCTGGGGATTAGCTGTATCAACCTGGGCGCCTACAGAGAAGCGGTCAGCAATTTTCTCACTGCCCTCAGTTTGCAAAGAAAGAGCAGGAATCAACAGCAAGTTCCTCATCCTGCAATCTCTGGGAACATCTGGGCTGCCCTCAGAATTGCACTGTCACTGATGGACCAACCAGAACTCTTCCAGGCAGCTAATCTTGGTGACCTGGATGTCCTCCTAAGAGCTTTCAATTTGGATCCTTGA

XM_004834649.1 Coding sequence

Ccdc39 coiled-coil domain containing 39, transcript variant X2

High confidence: 4 potential gene matches
Length: 2814 bp    Location: 58471852..58436015   Strand: -
>XM_004834649.1
ATGAGTAGAGAGTTCCTGGCGGAGCTGCATTGGGAGGATGGGTTTGCCCTCCCAGTGTCAAACGAAGGGAACAAAATGCTGGAAAATCAGTTATCAAAGCTGCAGAATGAAAAATCAAACTTGGAAGATCAGCTACATGATTACGAGGATCGAATTAATGCTATGAATTCTCACTTCAAAAATGTTAAGCAAGAATTCTCATTTACACAGTCTCTTTACAAAGCAAAGGAGAATGAGATTGAAAGTGAAGAACATTTTAAGGCCATTGCCGAAAGAGAATTGGGACGAGTGAAGAGTGAAATACTAAGACTAGAAAATGAGATCGTTTCCATACGAGAACGGAAAACTGACAAGGAAAATGGCATATTTAAAGCAACTCAAAAGTTGGATGGTTTGAAATGTCAAATGAACTGGGACCAGCAAGCATTGGAGGCCTGGCTAGAAGAATCAGCTCATAAAGATAGTGATGCCTTCACTCTTCAGAAATATGCACAACAAGATGATAATAAAATTAGGGCACTGACCCTGAAGTTAGAAAGACTGACCTTGGAATGTAATCAGAAGAGAAAGGTTCTTGACAACGAACTTACAGAGACTCTAAGTGCCCAGTTAGAATTGGATAAAGCAGCACAAGATTTTCAGAAGATTCATAATGAAAGACAAGAACTCATTGAACAGTGGGAGAACACAATAGAACAGATGCAGAAGAGGGATCGAGACATAGATGACTGTGCCTTGGCATTAACAAGGATAAAACAGGAAACAAGAGAAAAAGAAAGTTTGGTTAAAGAAAAGGTCAAGTTTTTGGAAAATGAAATTGGGAATAACACAGAGTATGAGAAAAGGATTTCTGCTGCTGACCGTGAAGTTTTAAAATGTAGAACAGAATATCAAAATCATGAATCCAGTAGAAGTCAGCTGAAGGATGAGCTGGATTCTTTAAAAGCCACTGTAAATAGAACTTCCAGTGATTTGGAAGCTTTGAGGAAAAATATTTCCAAAATAAAGAAGGACAGTCATGAAGAAAGACAAAGGTTACAAAAAATTAAAAATCATAATCAGATCATTAGCAAAAAATTAAATCATATAACTGAGAAAACCATGTCTGTGGAAGAGAAGGCCACCAATTTGGAAGATATGCTAAAAGAACAGGAAAAGGGTGTAAAGGAAGTGGAAGTTCGATTGAACATAGTGAAAGATGTGCTGTTTAAGAAAGTTCAGGAGTTACAGACTGAGATGATGAAAGAAAAAGCTGTTGTATCAGAAATTGAAGGAACCCGTTCCACTCTGAAACATCTCAACAATCAGTTACATAAACTGGATTTTGAAACCTTAAAACAGCAAGAAATTATGTACAGTCAGGACTTTTACATTCAACAAGTGGAACGAAGAATGTCACAGTTAAAGGGAGAAATTAATTCAGAAGAAAAACAAGCTCTGGAAGCAAAAATTGTTGAATTTAAGAAGTCTTTGGAAGAAAAAAAGTCTACATTTGACCTTTTGGAAACACAGATCAAGAAACTTCATAATGATCTTTACTTTATCAAGAAGTCGAACAGTAAAAATTGTGATGAAAAACAGTCCCTTTTGACCAAAATAAATGAATTAAACCTTTTTATCAACAGCTCAGAGAAAGAACTCAACAAAGCCAAAGTTTTTAAACAGGATTTGATGATAGAGGATAATCTTTTAAAACTTGAGGTTAAACGTACTCGAGAAATGCTTCACAGTAAGGCAGAAGAAGTTCTTTCCCTGGAAAAAAGAAAACAGCAGTTACTTACAGCTATGGAAGAGCGAACCGAAGAAATTAAGGTGCACAAAATGATGCTTGCCTCACAAATAAGATATGTTGATCAAGAAAGGCAAAACATAAGTGGGGAGTTCCATGAACGACTCAGTAAAATTGATAAGCTGAAAAATAGATATGAAATTCTTACTGTTGTTATGCTGCCTCCTGAAGGTGAAGAGGAGAAAACACAGGCCTATTATGTAATAAAGGCTGCTCAAGAAAAAGAAGAACTTCAAAGGGAAGGTGACAGTTTGGATGCTAAGATTAACAAAGCTGAAAAAGAAATCTATGCTCTAGGAAATACCTTGCAAGTCCTGAACAGCTGCAACAGAAATTACAAACATTCTTTTAAAAAAGTGACTCCATCTAGTGATGAGTATCAGCTAAAAATTCAACTAGAAGAACAAAGAAGAGCTGCTGATGAAAAATACAGATATAAACAGAGACAAATTAGAGAACTTCAAGAAGACATCCAGAGCATGGAAAACACTTTACAACTTACAGAACATTTAGCAAATAATGTCAAAGAAAAACTATCAGAGAAACAAGCTTTTGCATCTCAAGTACATAGAGAAACTGAAGAGCAGAAGCCAAAATTAGAGAGAGTGACTAAACAGTGTGCAAAACTCACAAAAGATATCCGTCTTTTGAAACAAACAAAAGATGAAACACCAGAAGAACAAGACATTAAAGTCCGTGAAGTGAAGCAATTTCAAAAGGTCATTGATGAAATGTTAGTTGATTGTATAAAAGAAAATGCTGCAATCCGTTTTATCCTTCAAACATATTTTAAGCAGAATGGGTTAGAGCTACCAATAGCTAGTAGTAAAGAGAGCCACCAGAGTTCTACATCTTCACAGGCCTCACTGGTATCACCAAGTAGCATAAATACTTCTGCTTCTCAGGCTTCGATTAAAGTATTAGAGCTCAACTTCCCAGACTCTTCACCAGTAGGCAGTAATTCTAGGCCAATCAGAGCTAGCAGTAGTTCTAGTAATTTGAAAAGCAACAAGAGTGGCAAATAA

XM_004834648.1 Coding sequence

Ccdc39 coiled-coil domain containing 39, transcript variant X1

Length: 2826 bp    Location: 58471852..58436015   Strand: -
>XM_004834648.1
ATGAGTAGAGAGTTCCTGGCGGAGCTGCATTGGGAGGATGGGTTTGCCCTCCCAGTGTCAAACGAAGGGAACAAAATGCTGGAAAATCAGTTATCAAAGCTGCAGAATGAAAAATCAAACTTGGAAGATCAGCTACATGATTACGAGGATCGAATTAATGCTATGAATTCTCACTTCAAAAATGTTAAGCAAGAATTCTCATTTACACAGTCTCTTTACAAAGCAAAGGAGAATGAGATTGAAAGTGAAGAACATTTTAAGGCCATTGCCGAAAGAGAATTGGGACGAGTGAAGAGTGAAATACTAAGACTAGAAAATGAGATCGTTTCCATACGAGAACGGAAAACTGACAAGGAAAATGGCATATTTAAAGCAACTCAAAAGTTGGATGGTTTGAAATGTCAAATGAACTGGGACCAGCAAGCATTGGAGGCCTGGCTAGAAGAATCAGCTCATAAAGATAGTGATGCCTTCACTCTTCAGAAATATGCACAACAAGATGATAATAAAATTAGGGCACTGACCCTGAAGTTAGAAAGACTGACCTTGGAATGTAATCAGAAGAGAAAGGTTCTTGACAACGAACTTACAGAGACTCTAAGTGCCCAGTTAGAATTGGATAAAGCAGCACAAGATTTTCAGAAGATTCATAATGAAAGACAAGAACTCATTGAACAGTGGGAGAACACAATAGAACAGATGCAGAAGAGGGATCGAGACATAGATGACTGTGCCTTGGCATTAACAAGGATAAAACAGGAAACAAGAGAAAAAGAAAGTTTGGTTAAAGAAAAGGTCAAGTTTTTGGAAAATGAAATTGGGAATAACACAGAGTATGAGAAAAGGATTTCTGCTGCTGACCGTGAAGTTTTAAAATGTAGAACAGAATATCAAAATCATGAATCCAGTAGAAGTCAGCTGAAGGATGAGCTGGATTCTTTAAAAGCCACTGTAAATAGAACTTCCAGTGATTTGGAAGCTTTGAGGAAAAATATTTCCAAAATAAAGAAGGACAGTCATGAAGAAAGACAAAGGTTACAAAAAATTAAAAATCATAATCAGATCATTAGCAAAAAATTAAATCATATAACTGAGAAAACCATGTCTGTGGAAGAGAAGGCCACCAATTTGGAAGATATGCTAAAAGAACAGGAAAAGGGTGTAAAGGAAGTGGAAGTTCGATTGAACATAGTGAAAGATGTGCTGTTTAAGAAAGTTCAGGAGTTACAGACTGAGATGATGAAAGAAAAAGCTGTTGTATCAGAAATTGAAGGAACCCGTTCCACTCTGAAACATCTCAACAATCAGTTACATAAACTGGATTTTGAAACCTTAAAACAGCAAGAAATTATGTACAGTCAGGACTTTTACATTCAACAAGTGGAACGAAGAATGTCACAGTTAAAGGGAGAAATTAATTCAGAAGAAAAACAAGCTCTGGAAGCAAAAATTGTTGAATTTAAGAAGTCTTTGGAAGAAAAAAAGTCTACATTTGACCTTTTGGAAACACAGATCAAGAAACTTCATAATGATCTTTACTTTATCAAGAAGTCGAACAGTAAAAATTGTGATGAAAAACAGTCCCTTTTGACCAAAATAAATGAATTAAACCTTTTTATCAACAGCTCAGAGAAAGAACTCAACAAAGCCAAAGTTTTTAAACAGGATTTGATGATAGAGGATAATCTTTTAAAACTTGAGGTTAAACGTACTCGAGAAATGCTTCACAGTAAGGCAGAAGAAGTTCTTTCCCTGGAAAAAAGAAAACAGCAGTTACTTACAGCTATGGAAGAGCGAACCGAAGAAATTAAGGTGCACAAAATGATGCTTGCCTCACAAATAAGATATGTTGATCAAGAAAGGCAAAACATAAGTGGGGAGTTCCATGAACGACTCAGTAAAATTGATAAGCTGAAAAATAGATATGAAATTCTTACTGTTGTTATGCTGCCTCCTGAAGGTGAAGAGGAGAAAACACAGGCCTATTATGTAATAAAGGCTGCTCAAGAAAAAGAAGAACTTCAAAGGGAAGGTGACAGTTTGGATGCTAAGATTAACAAAGCTGAAAAAGAAATCTATGCTCTAGGAAATACCTTGCAAGTCCTGAACAGCTGCAACAGAAATTACAAACATTCTTTTAAAAAAGTGACTCCATCTAGTGATGAGTATCAGCTAAAAATTCAACTAGAAGAACAAAGAAGAGCTGCTGATGAAAAATACAGATATAAACAGAGACAAATTAGAGAACTTCAAGAAGACATCCAGAGCATGGAAAACACTTTACAACTTACAGAACATTTAGCAAATAATGTCAAAGAAAAACTATCAGAGAAACAAGCTTTTGCATCTCAAGTACATAGAGAAACTGAAGAGCAGAAGCCAAAATTAGAGAGAGTGACTAAACAGTGTGCAAAACTCACAAAAGATATCCGTCTTTTGAAACAAACAAAAGATGAAACACCAGAAGAACAAGACATTAAAGTCCGTGAAGTGAAGCAATTTCAAAAGGTCATTGATGAAATGTTAGTTGATTGTATAAAAGAAAATGCTGCAATCCGTTTTATCCTTCAAACATATTTTAAGCAGAATGGGTTAGAGCTACCAATAGCTAGTAGTAAAGAGAGCCACCAGAGTTCTACATCTTCACAGGCCTCACTGGTATCACCAAGGTCATCTAGGAGTAGCATAAATACTTCTGCTTCTCAGGCTTCGATTAAAGTATTAGAGCTCAACTTCCCAGACTCTTCACCAGTAGGCAGTAATTCTAGGCCAATCAGAGCTAGCAGTAGTTCTAGTAATTTGAAAAGCAACAAGAGTGGCAAATAA

XM_004834650.1 Coding sequence

Fxr1 fragile X mental retardation, autosomal homolog 1, transcript variant X1

Length: 2034 bp    Location: 58680029..58743073   Strand: +
>XM_004834650.1
ATGGCGGAGCTGACGGTGGAGGTTCGCGGCTCCAACGGGGCTTTTTACAAGGGATTTATCAAAGATGTTCATGAAGACTCCCTCACAGTTGTTTTTGAAAATAATTGGCAACCGGAACGCCAGGTTCCATTTAATGAAGTTAGATTACCACCACCACCTGATATTAAAAAAGAAATTAGTGAAGGAGATGAAGTAGAGGTATATTCAAGAGCAAATGAGCAAGAACCATGTGGATGGTGGTTGGCTAAAGTTCGGATGATGAAAGGAGAATTTTATGTCATTGAATATGCTGCTTGTGATGCCACTTACAATGAAATAGTCACATTTGAACGACTTCGGCCTGTCAATCAAAATAAAACTGTCAAAAAAAATACCTTCTTTAAATGCACAGTGGATGTTCCTGAGGATTTGAGAGAGGCGTGTGCTAATGAAAATGCACATAAAGATTTTAAGAAAGCAGTAGGAGCATGCAGAATATTTTATCATCCAGAAACCACACAGCTAATGATACTGTCTGCTAGTGAAGCAACTGTGAAGAGAGTAAATATTTTAAGTGACATGCATTTACGAAGTATTCGTACGAAGTTGATGCTTATGTCCAGAAATGAAGAGGCTACTAAGCATTTAGAATGCACAAAACAACTTGCAGCAGCTTTTCATGAAGAATTTGTTGTGAGAGAAGATTTAATGGGCCTGGCAATAGGAACACATGGTAGTAACATACAGCAAGCTAGAAAGGTTCCTGGAGTTACCGCCATTGAGCTAGATGAAGATACTGGAACATTTAGAATCTATGGAGAGAGTGCTGATGCTGTAAAAAAGGCTAGAGGTTTCTTGGAATTTGTGGAGGATTTTATTCAGGTTCCTAGGAATCTTGTTGGGAAAGTAATTGGGAAAAATGGCAAAGTTATTCAAGAAATAGTGGACAAATCGGGTGTTGTTCGGGTGAGAATTGAAGGAGACAATGAAAATAAGCTACCTAGAGAAGATGGGATGGTTCCATTTGTATTTGTTGGCACTAAAGAAAGCATTGGAAATGTGCAAGTTCTTTTAGAATATCATATTGCTTATCTAAAGGAAGTGGAACAGCTAAGAATGGAACGCCTACAGATTGATGAACAGCTACGACAGATTGGTATGGGTTTCAGACCTTCTTCCACCAGAGGGCCTGAAAAAGAGAAAGGATGTGCCACTGATGAAAGTACCGTCTCTTCTGTACAAGGTTCTAGGTCTTATAGTGGAAGAGGCAGAGGTCGTCGGGGCCCTAATTACACCTCCGGTTATGGTACAAATTCTGAGCTGTCTAACCCCTCTGAAACAGAATCTGAACGTAAAGATGAGCTGAGTGATTGGTCATTGGCAGGAGAAGATGATCGAGAGAGCCGACATCAGCGTGACAGCAGGAGACGCCCGGGAGGAAGAGGCAGAAGTGTTTCAGGGGGTCGAGGTCGAGGTGGACCACGTGGTGGCAAATCCTCCATCAGTTCTGTGCTCAAAGATCCAGACAGCAATCCATACAGCTTACTTGATAATACAGAATCAGATCAGACTGCAGACACTGATGCCAGCGAATCTCATCACAGTACTAACCGTCGTAGGCGGTCTCGTAGACGAAGGACTGATGAAGATACTGTTCTGATGGATGGAATGACTGAATCTGACACGGCTTCTGTTAATGAAAATGGGCTAGATGATAGTGAAAAAAAACCCCAGCGACGCAATCGTAGCCGCAGGCGTCGTTTCAGGGGTCAGGCAGAAGATAGACAGCCAGTCACAGTTGCAGATTATATTTCTAGAGCTGAGTCTCAGAGCAGACAAAGAAACCTCCCAAGGGAAACTTTGGCTAAAAACAAGAAAGAAATGGTAAAAGATGTGATTGAAGAGCATGGTCCTTCAGAAAAGGCAATAAATGGCCCAACTAGTGCTTCTGGCGATGAAATTCCTAAGCTACAGCGTACTCCAGGAGAAGAAAAGATTAATACCTTAAAAGAAGAAAACACTCAAGAAGCAGCAGTCCTAAATGGTGTTTCATAA

XM_004834652.1 Coding sequence

Fxr1 fragile X mental retardation, autosomal homolog 1, transcript variant X3

Length: 1953 bp    Location: 58680030..58743073   Strand: +
>XM_004834652.1
ATGGCGGAGCTGACGGTGGAGGTTCGCGGCTCCAACGGGGCTTTTTACAAGGGATTTATCAAAGATGTTCATGAAGACTCCCTCACAGTTGTTTTTGAAAATAATTGGCAACCGGAACGCCAGGTTCCATTTAATGAAGTTAGATTACCACCACCACCTGATATTAAAAAAGAAATTAGTGAAGGAGATGAAGTAGAGGTATATTCAAGAGCAAATGAGCAAGAACCATGTGGATGGTGGTTGGCTAAAGTTCGGATGATGAAAGGAGAATTTTATGTCATTGAATATGCTGCTTGTGATGCCACTTACAATGAAATAGTCACATTTGAACGACTTCGGCCTGTCAATCAAAATAAAACTGTCAAAAAAAATACCTTCTTTAAATGCACAGTGGATGTTCCTGAGGATTTGAGAGAGGCGTGTGCTAATGAAAATGCACATAAAGATTTTAAGAAAGCAGTAGGAGCATGCAGAATATTTTATCATCCAGAAACCACACAGCTAATGATACTGTCTGCTAGTGAAGCAACTGTGAAGAGAGTAAATATTTTAAGTGACATGCATTTACGAAGTATTCGTACGAAGTTGATGCTTATGTCCAGAAATGAAGAGGCTACTAAGCATTTAGAATGCACAAAACAACTTGCAGCAGCTTTTCATGAAGAATTTGTTGTGAGAGAAGATTTAATGGGCCTGGCAATAGGAACACATGGTAGTAACATACAGCAAGCTAGAAAGGTTCCTGGAGTTACCGCCATTGAGCTAGATGAAGATACTGGAACATTTAGAATCTATGGAGAGAGTGCTGATGCTGTAAAAAAGGCTAGAGGTTTCTTGGAATTTGTGGAGGATTTTATTCAGGTTCCTAGGAATCTTGTTGGGAAAGTAATTGGGAAAAATGGCAAAGTTATTCAAGAAATAGTGGACAAATCGGGTGTTGTTCGGGTGAGAATTGAAGGAGACAATGAAAATAAGCTACCTAGAGAAGATGGGATGGTTCCATTTGTATTTGTTGGCACTAAAGAAAGCATTGGAAATGTGCAAGTTCTTTTAGAATATCATATTGCTTATCTAAAGGAAGTGGAACAGCTAAGAATGGAACGCCTACAGATTGATGAACAGCTACGACAGATTGGTATGGGTTTCAGACCTTCTTCCACCAGAGGGCCTGAAAAAGAGAAAGGATGTGCCACTGATGAAAGTACCGTCTCTTCTGTACAAGGTTCTAGGTCTTATAGTGGAAGAGGCAGAGGTCGTCGGGGCCCTAATTACACCTCCGGTTATGGTACAAATTCTGAGCTGTCTAACCCCTCTGAAACAGAATCTGAACGTAAAGATGAGCTGAGTGATTGGTCATTGGCAGGAGAAGATGATCGAGAGAGCCGACATCAGCGTGACAGCAGGAGACGCCCGGGAGGAAGAGGCAGAAGTGTTTCAGGGGGTCGAGGTCGAGGTGGACCACGTGGTGGCAAATCCTCCATCAGTTCTGTGCTCAAAGATCCAGACAGCAATCCATACAGCTTACTTGATAATACAGAATCAGATCAGACTGCAGACACTGATGCCAGCGAATCTCATCACAGTACTAACCGTCGTAGGCGGTCTCGTAGACGAAGGACTGATGAAGATACTGTTCTGATGGATGGAATGACTGAATCTGACACGGCTTCTGTTAATGAAAATGGGCTAGTCACAGTTGCAGATTATATTTCTAGAGCTGAGTCTCAGAGCAGACAAAGAAACCTCCCAAGGGAAACTTTGGCTAAAAACAAGAAAGAAATGGTAAAAGATGTGATTGAAGAGCATGGTCCTTCAGAAAAGGCAATAAATGGCCCAACTAGTGCTTCTGGCGATGAAATTCCTAAGCTACAGCGTACTCCAGGAGAAGAAAAGATTAATACCTTAAAAGAAGAAAACACTCAAGAAGCAGCAGTCCTAAATGGTGTTTCATAA

XM_004834651.1 Coding sequence

Fxr1 fragile X mental retardation, autosomal homolog 1, transcript variant X2

Length: 1983 bp    Location: 58680030..58743073   Strand: +
>XM_004834651.1
ATGGCGGAGCTGACGGTGGAGGTTCGCGGCTCCAACGGGGCTTTTTACAAGGGATTTATCAAAGATGTTCATGAAGACTCCCTCACAGTTGTTTTTGAAAATAATTGGCAACCGGAACGCCAGGTTCCATTTAATGAAGTTAGATTACCACCACCACCTGATATTAAAAAAGAAATTAGTGAAGGAGATGAAGTAGAGGTATATTCAAGAGCAAATGAGCAAGAACCATGTGGATGGTGGTTGGCTAAAGTTCGGATGATGAAAGGAGAATTTTATGTCATTGAATATGCTGCTTGTGATGCCACTTACAATGAAATAGTCACATTTGAACGACTTCGGCCTGTCAATCAAAATAAAACTGTCAAAAAAAATACCTTCTTTAAATGCACAGTGGATGTTCCTGAGGATTTGAGAGAGGCGTGTGCTAATGAAAATGCACATAAAGATTTTAAGAAAGCAGTAGGAGCATGCAGAATATTTTATCATCCAGAAACCACACAGCTAATGATACTGTCTGCTAGTGAAGCAACTGTGAAGAGAGTAAATATTTTAAGTGACATGCATTTACGAAGTATTCGTACGAAGTTGATGCTTATGTCCAGAAATGAAGAGGCTACTAAGCATTTAGAATGCACAAAACAACTTGCAGCAGCTTTTCATGAAGAATTTGTTGTGAGAGAAGATTTAATGGGCCTGGCAATAGGAACACATGGTAGTAACATACAGCAAGCTAGAAAGGTTCCTGGAGTTACCGCCATTGAGCTAGATGAAGATACTGGAACATTTAGAATCTATGGAGAGAGTGCTGATGCTGTAAAAAAGGCTAGAGGTTTCTTGGAATTTGTGGAGGATTTTATTCAGGTTCCTAGGAATCTTGTTGGGAAAGTAATTGGGAAAAATGGCAAAGTTATTCAAGAAATAGTGGACAAATCGGGTGTTGTTCGGGTGAGAATTGAAGGAGACAATGAAAATAAGCTACCTAGAGAAGATGGGATGGTTCCATTTGTATTTGTTGGCACTAAAGAAAGCATTGGAAATGTGCAAGTTCTTTTAGAATATCATATTGCTTATCTAAAGGAAGTGGAACAGCTAAGAATGGAACGCCTACAGATTGATGAACAGCTACGACAGATTGGTTCTAGGTCTTATAGTGGAAGAGGCAGAGGTCGTCGGGGCCCTAATTACACCTCCGGTTATGGTACAAATTCTGAGCTGTCTAACCCCTCTGAAACAGAATCTGAACGTAAAGATGAGCTGAGTGATTGGTCATTGGCAGGAGAAGATGATCGAGAGAGCCGACATCAGCGTGACAGCAGGAGACGCCCGGGAGGAAGAGGCAGAAGTGTTTCAGGGGGTCGAGGTCGAGGTGGACCACGTGGTGGCAAATCCTCCATCAGTTCTGTGCTCAAAGATCCAGACAGCAATCCATACAGCTTACTTGATAATACAGAATCAGATCAGACTGCAGACACTGATGCCAGCGAATCTCATCACAGTACTAACCGTCGTAGGCGGTCTCGTAGACGAAGGACTGATGAAGATACTGTTCTGATGGATGGAATGACTGAATCTGACACGGCTTCTGTTAATGAAAATGGGCTAGATGATAGTGAAAAAAAACCCCAGCGACGCAATCGTAGCCGCAGGCGTCGTTTCAGGGGTCAGGCAGAAGATAGACAGCCAGGGATTACTGTGTGCAATGGAAAAGTTAACTTGAAAGTCACAGTTGCAGATTATATTTCTAGAGCTGAGTCTCAGAGCAGACAAAGAAACCTCCCAAGGGAAACTTTGGCTAAAAACAAGAAAGAAATGGTAAAAGATGTGATTGAAGAGCATGGTCCTTCAGAAAAGGCAATAAATGGCCCAACTAGTGCTTCTGGCGATGAAATTCCTAAGCTACAGCGTACTCCAGGAGAAGAAAAGATTAATACCTTAAAAGAAGAAAACACTCAAGAAGCAGCAGTCCTAAATGGTGTTTCATAA

XM_004834653.1 Coding sequence

Fxr1 fragile X mental retardation, autosomal homolog 1, transcript variant X4

Length: 1947 bp    Location: 58680030..58743073   Strand: +
>XM_004834653.1
ATGGCGGAGCTGACGGTGGAGGTTCGCGGCTCCAACGGGGCTTTTTACAAGGGATTTATCAAAGATGTTCATGAAGACTCCCTCACAGTTGTTTTTGAAAATAATTGGCAACCGGAACGCCAGGTTCCATTTAATGAAGTTAGATTACCACCACCACCTGATATTAAAAAAGAAATTAGTGAAGGAGATGAAGTAGAGGTATATTCAAGAGCAAATGAGCAAGAACCATGTGGATGGTGGTTGGCTAAAGTTCGGATGATGAAAGGAGAATTTTATGTCATTGAATATGCTGCTTGTGATGCCACTTACAATGAAATAGTCACATTTGAACGACTTCGGCCTGTCAATCAAAATAAAACTGTCAAAAAAAATACCTTCTTTAAATGCACAGTGGATGTTCCTGAGGATTTGAGAGAGGCGTGTGCTAATGAAAATGCACATAAAGATTTTAAGAAAGCAGTAGGAGCATGCAGAATATTTTATCATCCAGAAACCACACAGCTAATGATACTGTCTGCTAGTGAAGCAACTGTGAAGAGAGTAAATATTTTAAGTGACATGCATTTACGAAGTATTCGTACGAAGTTGATGCTTATGTCCAGAAATGAAGAGGCTACTAAGCATTTAGAATGCACAAAACAACTTGCAGCAGCTTTTCATGAAGAATTTGTTGTGAGAGAAGATTTAATGGGCCTGGCAATAGGAACACATGGTAGTAACATACAGCAAGCTAGAAAGGTTCCTGGAGTTACCGCCATTGAGCTAGATGAAGATACTGGAACATTTAGAATCTATGGAGAGAGTGCTGATGCTGTAAAAAAGGCTAGAGGTTTCTTGGAATTTGTGGAGGATTTTATTCAGGTTCCTAGGAATCTTGTTGGGAAAGTAATTGGGAAAAATGGCAAAGTTATTCAAGAAATAGTGGACAAATCGGGTGTTGTTCGGGTGAGAATTGAAGGAGACAATGAAAATAAGCTACCTAGAGAAGATGGGATGGTTCCATTTGTATTTGTTGGCACTAAAGAAAGCATTGGAAATGTGCAAGTTCTTTTAGAATATCATATTGCTTATCTAAAGGAAGTGGAACAGCTAAGAATGGAACGCCTACAGATTGATGAACAGCTACGACAGATTGGTTCTAGGTCTTATAGTGGAAGAGGCAGAGGTCGTCGGGGCCCTAATTACACCTCCGGTTATGGTACAAATTCTGAGCTGTCTAACCCCTCTGAAACAGAATCTGAACGTAAAGATGAGCTGAGTGATTGGTCATTGGCAGGAGAAGATGATCGAGAGAGCCGACATCAGCGTGACAGCAGGAGACGCCCGGGAGGAAGAGGCAGAAGTGTTTCAGGGGGTCGAGGTCGAGGTGGACCACGTGGTGGCAAATCCTCCATCAGTTCTGTGCTCAAAGATCCAGACAGCAATCCATACAGCTTACTTGATAATACAGAATCAGATCAGACTGCAGACACTGATGCCAGCGAATCTCATCACAGTACTAACCGTCGTAGGCGGTCTCGTAGACGAAGGACTGATGAAGATACTGTTCTGATGGATGGAATGACTGAATCTGACACGGCTTCTGTTAATGAAAATGGGCTAGATGATAGTGAAAAAAAACCCCAGCGACGCAATCGTAGCCGCAGGCGTCGTTTCAGGGGTCAGGCAGAAGATAGACAGCCAGTCACAGTTGCAGATTATATTTCTAGAGCTGAGTCTCAGAGCAGACAAAGAAACCTCCCAAGGGAAACTTTGGCTAAAAACAAGAAAGAAATGGTAAAAGATGTGATTGAAGAGCATGGTCCTTCAGAAAAGGCAATAAATGGCCCAACTAGTGCTTCTGGCGATGAAATTCCTAAGCTACAGCGTACTCCAGGAGAAGAAAAGATTAATACCTTAAAAGAAGAAAACACTCAAGAAGCAGCAGTCCTAAATGGTGTTTCATAA

XM_004834654.1 Coding sequence

Fxr1 fragile X mental retardation, autosomal homolog 1, transcript variant X5

High confidence: 4 potential gene matches
Length: 1866 bp    Location: 58680030..58743073   Strand: +
>XM_004834654.1
ATGGCGGAGCTGACGGTGGAGGTTCGCGGCTCCAACGGGGCTTTTTACAAGGGATTTATCAAAGATGTTCATGAAGACTCCCTCACAGTTGTTTTTGAAAATAATTGGCAACCGGAACGCCAGGTTCCATTTAATGAAGTTAGATTACCACCACCACCTGATATTAAAAAAGAAATTAGTGAAGGAGATGAAGTAGAGGTATATTCAAGAGCAAATGAGCAAGAACCATGTGGATGGTGGTTGGCTAAAGTTCGGATGATGAAAGGAGAATTTTATGTCATTGAATATGCTGCTTGTGATGCCACTTACAATGAAATAGTCACATTTGAACGACTTCGGCCTGTCAATCAAAATAAAACTGTCAAAAAAAATACCTTCTTTAAATGCACAGTGGATGTTCCTGAGGATTTGAGAGAGGCGTGTGCTAATGAAAATGCACATAAAGATTTTAAGAAAGCAGTAGGAGCATGCAGAATATTTTATCATCCAGAAACCACACAGCTAATGATACTGTCTGCTAGTGAAGCAACTGTGAAGAGAGTAAATATTTTAAGTGACATGCATTTACGAAGTATTCGTACGAAGTTGATGCTTATGTCCAGAAATGAAGAGGCTACTAAGCATTTAGAATGCACAAAACAACTTGCAGCAGCTTTTCATGAAGAATTTGTTGTGAGAGAAGATTTAATGGGCCTGGCAATAGGAACACATGGTAGTAACATACAGCAAGCTAGAAAGGTTCCTGGAGTTACCGCCATTGAGCTAGATGAAGATACTGGAACATTTAGAATCTATGGAGAGAGTGCTGATGCTGTAAAAAAGGCTAGAGGTTTCTTGGAATTTGTGGAGGATTTTATTCAGGTTCCTAGGAATCTTGTTGGGAAAGTAATTGGGAAAAATGGCAAAGTTATTCAAGAAATAGTGGACAAATCGGGTGTTGTTCGGGTGAGAATTGAAGGAGACAATGAAAATAAGCTACCTAGAGAAGATGGGATGGTTCCATTTGTATTTGTTGGCACTAAAGAAAGCATTGGAAATGTGCAAGTTCTTTTAGAATATCATATTGCTTATCTAAAGGAAGTGGAACAGCTAAGAATGGAACGCCTACAGATTGATGAACAGCTACGACAGATTGGTTCTAGGTCTTATAGTGGAAGAGGCAGAGGTCGTCGGGGCCCTAATTACACCTCCGGTTATGGTACAAATTCTGAGCTGTCTAACCCCTCTGAAACAGAATCTGAACGTAAAGATGAGCTGAGTGATTGGTCATTGGCAGGAGAAGATGATCGAGAGAGCCGACATCAGCGTGACAGCAGGAGACGCCCGGGAGGAAGAGGCAGAAGTGTTTCAGGGGGTCGAGGTCGAGGTGGACCACGTGGTGGCAAATCCTCCATCAGTTCTGTGCTCAAAGATCCAGACAGCAATCCATACAGCTTACTTGATAATACAGAATCAGATCAGACTGCAGACACTGATGCCAGCGAATCTCATCACAGTACTAACCGTCGTAGGCGGTCTCGTAGACGAAGGACTGATGAAGATACTGTTCTGATGGATGGAATGACTGAATCTGACACGGCTTCTGTTAATGAAAATGGGCTAGTCACAGTTGCAGATTATATTTCTAGAGCTGAGTCTCAGAGCAGACAAAGAAACCTCCCAAGGGAAACTTTGGCTAAAAACAAGAAAGAAATGGTAAAAGATGTGATTGAAGAGCATGGTCCTTCAGAAAAGGCAATAAATGGCCCAACTAGTGCTTCTGGCGATGAAATTCCTAAGCTACAGCGTACTCCAGGAGAAGAAAAGATTAATACCTTAAAAGAAGAAAACACTCAAGAAGCAGCAGTCCTAAATGGTGTTTCATAA

XM_004834657.1 Coding sequence

Dnajc19 DnaJ (Hsp40) homolog, subfamily C, member 19, transcript variant X3

Length: 351 bp    Location: 58755525..58746824   Strand: -
>XM_004834657.1
ATGGCCAGTACAGTGGTAGCAGTTGGACTGACCATTGCTGCTGCAGGATTTGCAGGCCGTTATGTTTTACAAGCCATGAAGCATATGGAGCCTCAAGTAAAACAAGTTTTTCAGAGCCTACCAAAGTCTGCCTTCAGTGGTGGCTATTATAGAGGTGGGTTTGAACCCAAAATGACAAAACGGGAAGCAGCACTAATACTAGGTGTAAGCCCTACTGCCAATAAAGGAAAAATAAGAGATGCTCATCGACGAATTATGCTCTTAAATCATCCAGACAAGGGAGGATCTCCTTATATAGCAGCCAAAATCAATGAAGCTAAAGATTTACTAGAAGGTCAAGCTAAAAAATGA

XM_004834659.1 Coding sequence

Atp11b ATPase, class VI, type 11B

High confidence: 4 potential gene matches
Length: 3534 bp    Location: 60555962..60660000   Strand: +
>XM_004834659.1
ATGTGGCGCTGGGTCCGCCAGCAGCTGGGTCTTGACCCACCCCATCAAAGTGACACAAGAACTATTTACATAGCCAACAGGTTTCCTCAGAATGGCCTTTACACACCTCAGAAATTTATAGATAACCGAATAATTTCATCTAAGTATACTGTGTGGAATTTTGTCCCAAAAAATTTATTTGAACAATTCAGAAGAGTGGCAAACTTTTATTTTCTTATTATATTTTTGGTTCAGCTTATGATTGATACACCTACCAGTCCAATTACCAGTGGACTTCCATTATTCTTTGTGATAACAGTAACCGCCATAAAGCAGGGATATGAAGATTGGTTACGCCATAACTCAGATAATGAAGTAAATGGAGCTCCTGTTTATGTTGTTCGAAGTGGTGGCCTTGTAAAAACTAGGTCAAAAAACATTCGGGTAGGTGATATTGTTCGAATAGCCAAAGATGAAATCTTCCCTGCAGACTTGGTGCTTCTCTCCTCGGATCGACCTGATGGTTCATGTCACATTACAACTGCTAGTTTGGATGGAGAAACAAACCTAAAGACACATGTGGCAGTTCCAGAAACAGCAGTATTACAGACAGTTGCCAATTTGGACAGTCTTATAGCTGTAATAGAATGCCAGCAACCGGAAGCAGATTTGTACAGATTCATGGGACGAATGATAATAACTCAGCAAATGGAAGAAATTGTAAGGCCTCTGGGCCCAGAGAGTCTCTTACTTCGTGGAGCCAGATTAAAAAACACAAAAGAAATTTTTGGTGTTGCTGTGTACACCGGAATGGAAACTAAAATGGCATTAAATTATAAGAGCAAGTCACAGAAAAGATCTGCTGTGGAAAAATCAATGAATACATTTTTGATAATTTACCTAATAATCCTTATTTCTGAAGCCATCATCAGTACTATCCTGAAATATACCTGGCAAGCTGAAGAAAAATGGAATGAACCTTGGTATAACCAAAAAACAGAACATCAGAGAAATAGTAGTAAGATTCTGAGATTTATTTCTGATTTCCTTGCTTTTCTGGTACTCTACAATTTCATCATTCCAATTTCACTGTATGTAACAGTTGAAATGCAGAAATTTCTTGGATCATTTTTTATTGGCTGGGATCTTGATCTCTATCATGAGGAATCAGATCAGAAAGCTCAAGTCAATACTTCCGATCTGAATGAAGAACTTGGACAGGTGAACTACGTGTTTACAGATAAAACTGGAACACTAACAGAAAATGAGATGCAGTTCCGGGAATGTTCAATTAATGGCATAAAATACCAAGAAATCAATGGTAGACTTGTACCCGAAGGACCAACACCTGACTCTTCAGAAGGAAACTTATCATATCTTAGTGGTTTATCTCACCTTAGCAACTTAGCCCATCTTACAAGCAGTTCCTCTTTTAGAACCAGTCCTGAAAATGAAAATGAACTAATTAAAGAACATGGTCTCTTCTTCAAAGCAGTTAGTCTCTGCCATACTGTGCAGATCAGCAATGTTCAAAGTGATGGCATTGGTGATGGTCCCTGGCAGTCCAGCCTGGCATCCTCTCAACTAGAGTACTATGCATCTTCCCCAGATGAAAAGGCGCTAGTGGAAGCTGCTGCAAGAATTGGCATTGTATTTATTGGCAATTCTGAAGAAATTATGGAAATTAAAATACTTGGAAAACTGGAACGGTACAGACTGCTTCATGTTCTGGAATTTGATTCAGATCGTAGGAGAATGAGTGTAATTGTTCAAGCATGTTCAGGTGAGAAGCTTTTATTTGCTAAAGGAGCAGAATCATCAATACTTCCTAACTGTATAGGTGGAGACATAGAGAAAACGAGAATTCATGTAGATGAATTTGCTTTGAAAGGGCTAAGAACTCTGTGTATAGCCTATAGACAGTTTACACCTAATGAGTATGAAGAGATAGACAGACGCCTGTTTGAAGCCAGGACTGCCTTGCAGCAACGGGAAGAGAAATTGGCTGAAGTCTTTCAGTTCATAGAGAAAGACCTGATTTTACTTGGGGCTACAGCCGTAGAAGACAGACTGCAAGATAAAGTTCAAGAAACTATTGAAGCATTGAGAATGGCTGGTATCAAAGTGTGGGTACTTACAGGAGACAAACATGAAACTGCTGTTAGTGTGAGTTTATCTTGTGGACATTTTCATAGAACTATGAACATCCTTGAACTTATTAACCAGAAATCAGACAACGAATGTGCTGAACAGTTGAGGCAGCTTGCCAGAAGAATTACAGAGGATCATGTGATTCAGCATGGGCTAGTAGTTGATGGGACCAGCCTATCTCTTGCACTCAGGGAGCATGAAAAGCTATTTATGGAAGTTTGCAGAAATTGTTCGGCTGTATTATGCTGTCGTATGGCACCACTGCAGAAAGCAAAAGTAATAAGACTGATAAAAATCTCACCTGAGAAACCTATAACATTGGCTGTTGGTGATGGTGCTAATGATGTAAGCATGATACAAGAAGCACATGTTGGCATAGGAATCATGGGTAAAGAAGGAAGACAGGCTGCAAGAAACAGTGACTATGCAATAGCTAGATTTAAATTCCTCTCCAAACTACTTTTTGTTCATGGTCATTTTTATTATATCAGAATAGCTACCCTTGTACAGTATTTTTTTTATAAGAATGTGTGCTTTATCACACCCCAGTTTTTATATCAGTTCTACTGTTTGTTTTCTCAGCAAACACTGTATGACAGCATGTACCTGACTTTGTACAATATTTGTTTTACTTCCCTACCTGTTCTGATATATAGTCTTTTGGAACAGCATATAGACCCTCATGTATTACAGAACAAGCCTACTCTCTACAGGGATATTAGTAAAAACCATCTCTTAAGCATTAAAACGTTTCTTTATTGGACTATCCTGGGTTTCAGTCATGCCTTTATTTTCTTTTTTGGATCCTATTTTCTGATGGGGAAAGATACATCTCTTCTTGGAAATGGCCAGATGTTTGGAAACTGGACATTTGGCACTTTGGTCTTCACAGTCATGGTTATTACAGTCACAGCAAAGATGGCTTTGGAAACTCATTTTTGGACTTGGATCAACCATCTTGTTACATGGGGATCTATTATATTTTATTTTATATTTTCTTTATTTTATAGTGGGATTCTCTGGCCATTCTTGAGCTCCCAGAATATGTACTTTGTATTTATTCAGCTCCTATCAAGTGGTTCTACTTGGTTTGCCATAACTCTTATGGTTGTTACATGTCTATTTCTTGACATTGTGAAGAAGGTATTTGGCCGACACCTCCATCCTACAAGTACTGAAAAGGCACAGCTTACTCAAACAAATTCAAGTATCAAGTGCTTGGACTCCATGTGCTGTTTCCCAGAAGGAGAAGCAGCATGTGCATCTGTTAGAAGAATGCTGGAACGAGCTATAGGGAGATGTAGCCCCACCCACATCAGCAGATCATGGAGTGCCTCGGATCCTTTCTGTACCAACGACAGGAGCGTCCTGACTCTCTCCACAATGGACTCATCTACTTGCTAA

XM_004834661.1 Coding sequence

Dcun1d1 DCN1, defective in cullin neddylation 1, domain containing 1, transcript variant X2

Length: 735 bp    Location: 60724480..60683231   Strand: -
>XM_004834661.1
ATGATCTTCACACAATCTAGTGAAAAAACTGCAGTAAGTTGTCTTTCTCAAAATGACTGGAAGTTAGATGTTGCAACAGATAATTTTTTCCAAAATCCTGAACTGTATATACGAGAGAGTGTAAAAGGATCATTGGACAGGAAGAAGTTAGAACAGCTATACAATAGATACAAAGATCCTCAAGATGAAAATAAAATTGGAATAGATGGTATACAGCAATTCTGTGATGACCTGGCACTTGATCCAGCCAGCATTAGTGTTTTGATCATTGCATGGAAGTTCAGAGCAGCAACACAGTGTGAGTTCTCCAAGCAGGAGTTCATGGACGGCATGACAGAATTAGGATGTGACAGCATAGAAAAGCTAAAGGCTCAAATACCCAAGATGGAACAAGAATTGAAAGAACCAGGACGATTTAAGGATTTTTACCAGTTTACTTTTAATTTTGCAAAGAATCCAGGACAAAAAGGATTAGATCTAGAAATGGCCATTGCCTACTGGAACTTAGTGCTTAATGGAAGATTTAAATTCTTAGACTTATGGAATAAATTTTTGTTGGAACATCATAAACGATCAATACCAAGAGATACTTGGAATCTTCTTTTAGACTTCAGTGCAATGATTGCAGATGACATGTCTAATTATGATGAAGAAGGAGCATGGCCTGTTCTCATTGATGACTTTGTGGAATTTGCACGCCCTCAAATTGCTGGGACAAAAAGTACAACAGTGTAG

XM_004834660.1 Coding sequence

Dcun1d1 DCN1, defective in cullin neddylation 1, domain containing 1, transcript variant X1

High confidence: 1 potential gene match
Length: 780 bp    Location: 60719274..60683231   Strand: -
>XM_004834660.1
ATGAACAAGTTGAAATCATCGCAGAAGGATAAAGTTCGACAGTTTATGATCTTCACACAATCTAGTGAAAAAACTGCAGTAAGTTGTCTTTCTCAAAATGACTGGAAGTTAGATGTTGCAACAGATAATTTTTTCCAAAATCCTGAACTGTATATACGAGAGAGTGTAAAAGGATCATTGGACAGGAAGAAGTTAGAACAGCTATACAATAGATACAAAGATCCTCAAGATGAAAATAAAATTGGAATAGATGGTATACAGCAATTCTGTGATGACCTGGCACTTGATCCAGCCAGCATTAGTGTTTTGATCATTGCATGGAAGTTCAGAGCAGCAACACAGTGTGAGTTCTCCAAGCAGGAGTTCATGGACGGCATGACAGAATTAGGATGTGACAGCATAGAAAAGCTAAAGGCTCAAATACCCAAGATGGAACAAGAATTGAAAGAACCAGGACGATTTAAGGATTTTTACCAGTTTACTTTTAATTTTGCAAAGAATCCAGGACAAAAAGGATTAGATCTAGAAATGGCCATTGCCTACTGGAACTTAGTGCTTAATGGAAGATTTAAATTCTTAGACTTATGGAATAAATTTTTGTTGGAACATCATAAACGATCAATACCAAGAGATACTTGGAATCTTCTTTTAGACTTCAGTGCAATGATTGCAGATGACATGTCTAATTATGATGAAGAAGGAGCATGGCCTGTTCTCATTGATGACTTTGTGGAATTTGCACGCCCTCAAATTGCTGGGACAAAAAGTACAACAGTGTAG

XM_004835175.1 Coding sequence

LOC101704482 Krueppel-like factor 4-like

Length: 870 bp    Location: 60741904..60743345   Strand: +
>XM_004835175.1
ATGTGGGCCGCGGGTGACCCGGGTGTGGCCCCCAGTGGCACTGGCGGCGGCTTCCTGTGCGGCCAGGAGTGGGCGCTCCCTCCCTTCAACCTGGCTGATATCGATGTGACCCCGTCGGGCGGCTTCGTGGCCGAGCTCCTGCGGCCCGAACTGGACCCGGCTTTTGCGCCGCAGGCGTCGCTGAGGGCCCCCGTGAGCGAGTACGGCGGCGCGTCGGCCGGCAAAGGCGGCCCCGACGGCGGGCTCCCGGCGGTGGCGGCGCCCTACGCGCTCGGCGGGCCCCAGGACGCCCCCCTGGGCGCTGCACAGCCGCTCTACAGCCCGCCCGGGCCCGGCCCGCACCACTTCGCCCAGGGGCCGCAGTTCCTGAGCAGGACTGGCCCGACCGGGGCTCCCGCGGAATTGCTGGGCTCCGGGGACTGTCACCCCCCCCTGCCGCTGCCCCCGGGATTCCACCCCCATCCGGGACCCGGCTACCCAGCCTTCCTGCACGAGCAGGCGCCGCCCATCCCTGCACCTCACTACCAAGAGCTCATGCCGCCCGGTCCTTGCCTGCCAGAGGAGCCCAAGCCAAAGAGGGGAAGAAGGACGTGGCCCCGGAAAACGTCGGCCTCCCACACTTGTGGTTACGCGGGCTGCGGCAAGACCTACACCAAGAGTTCGCATCTCAAGGCACACCTGCGGACCCACACCGGGGAGAAGCCGTACCGCTGCAACTGGGAGGGCTGCGAATGGAAGTTCGCCCGCTCGGACGAACTGACCAGGCACTACCGCAAACACACAGGGCACCGCCCCTTCCAGTGCCTGCAGTGCGACCGGGCCTTCTCCAGGTCGGACCACCTCGCCCTACACATGAAGCGGCACTTTTAA

XM_004834662.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 2097 bp    Location: 60872046..60818070   Strand: -
>XM_004834662.1
ATGGTAACGACGCTCNGGCCGAAGATGGCGGCTGGGCGCGAGCGGGGCGGAGGAGCGGATCCCTCGGGTTCAGGTTCGGGCCGTGCCCGTCCTGGCCGCAGTGGACTGCTGTGGGTCTGGGTCGTCTTGCTCCTGCTGGGCGGATTCTCGCCCGGGTTCCCGCCCGGCGCCGCGTCCGCTTCCGTCTCCGTGGGCAGCTCGTCTCTCTGCCGCCACCACGTCCCCTCTGTCAGCGAGGTCATAAATAAGGTTCATCTTAAAACAAATCATGTTGTAAAGAGAGGTGCTGATGACCATTTAAGAATCAAGACTGTCTATGATAAAAGTATTGAGGAGCTGCTTGATGAGAAGAGGCATCTCGTGAAGAACAAGCTTTTCCCACAAGCAATTTCCTACTTAGAAAAGACGTTCCAGGTCCGCAGACCAGCTGGCACCATCCTGCTCAGCAGACAATGTGCCACAAACCAGTACCTGAGGAAGGAAAACGACCCTCACCGCTACTGCACCGGTGAGTGTGCGGCGCAGACCCAGTGCGGCCCGGTGACGGTGCCCGAGGAGCACCTGCAGCCGTGCAGGGTATGTCGAGGCGGGAAGTGGCCCTGCATGGCAGAGGTCGAGCAGCACCCAGAGGGCATCCGAGATGCGGACTTTGTCCTTTACGTGGGTGCTTTGGCCACGGAGAGATGCAGCCACGAAAACATCATCTCTTACGCAGCCTACTGCCAGCAGGAAGCGGAGACGGACAGGCCAATAGCAGGATATGCTAACCTGTGTCCAAATATGATCTCTACCCAGCCTCAGGAGTTCATCGGGATGCTGTCCACAGTGAAACACGAGATTATCCACGCCCTGGGCTTCTCTGCTGGCCTGTTTGCCTTCTACCGTGATAAAGATGGAAATCCTCTAACTTCAAGGTTTGCAAATGGTCTCCCTCCTTTTAATTACAGTCTTGGGTTATATCAGTGGAGTGATAAAGTAGTTCGCAAAGTGGAGCGATCATGGAACGTCCGTGATAATAAGACAGTTCATCACCCTGTGTATCTCCTTGTGACCCCTCATGTTGTGGATGAAGCACGAAAACATTTTAAATGTTCACTTCTGGAAGGAATGGAGCTTGAGAATCAAGGTGGGCTAGGCACAGAGCTCAACCACTGGGAAAAACGGTTATTAGAGAATGAAGCAATGACGGGTTCTCACACCCAGAACCGAGTCCTCTCTCGAATCACCTTGGCGTTAATGGAGGACACTGGCTGGTATAGAGCGAACTACAGCATGGCTGAGAAGCTAGACTGGGGCCTTGGGATGGGCTGCGACTTCGTGAAGAAGAGCTGCAAGTTCTGGATGGATCAGCAGAGACAGAAGGGCCAGGCGCTGAGCCCTTACTGTGATACACTCAGGAGCAGCCCGCTACAGCTGACCTGCAGGCAGGACCAGAGGGCCGTGGCTGTGTGCAATCTGCAAAAGTTCCCTAAGCCTTTGCCGCCAGAGTACCAGTACTTTGACGAGCTCGGCGGGGTCCCAGCAGAGGACCTGGAGCGCTTTGGTGGCTCGGTGGAGATCGCGGACTACTGCCCTTTCAGCCAGGAGTTCAGCTGGCATCTGAGCGGCGAGTATCAGCGCAGCTCGGATTGCAGAATCCTGGAGAATCAGCCAGAAATTTTGAAAAACTATGGTGCTGAAAAGTATGGACCTCATTCCGTTTGTCTGATTCAGAAATCGGCATTTGTCATGGAAAAGTGCGAGAGAAAACTGAGTTACCCAGACTGGGGGAGTGGATGCTACCAGATCTCTTGTTCTCCTCAAGGTCTGAAGGTCTGGGTGCAGGACACAGCGTACCCATGCAGCCGAGCCGGGCAGGTCCTCCCCGTCAGCATTCAGATGAATGGCTGGATCCATGGCGGGAACCTGCTTTGCCCGTCCTGCTGGGACTTCTGCGAGCAGTGCCCTCCGGAAACAGACCCTCCGGCTGCCAACCTCACCCAGGCGCTGCCCCTCGATCTCTGCTCCCGCTCCTCCAGCCTGGTGGTCACGCTCTGGCTGCTGCTGGGCAACCTGCTTCCTGTGCTGGCTGGAGTCCTTCTGTGCGTGTGGCACTAG

XM_004834665.1 Coding sequence

Rpl35a ribosomal protein L35a, transcript variant X3

High confidence: 3 potential gene matches
Length: 333 bp    Location: 60879371..60875693   Strand: -
>XM_004834665.1
ATGTCTGGAAGACTGTGGTGCAAGGCCATTTTTGCTGGCTATAAGCGAGGTCTCCGGAACCAAAGGGAACACACAGCTCTTCTTAAAATTGAAGGTGTTTATGCCCGCGATGAAACTGAATTCTATTTGGGCAAGAGATGTGCGTATGTGTACAAAGCGAAAAACAACACAGTGACTCCAGGTGGCAAACCAAACAAAACCAGAGTGATCTGGGGAAAGGTAACTCGAGCCCATGGAAACAGCGGCATGGTTCGTGCCAAGTTCCGAAGCAACCTTCCTGCTAAGGCCATTGGACACCGAATCCGTGTGATGCTGTACCCGTCAAGGATTTAA

XM_004834667.1 Coding sequence

Iqcg IQ motif containing G, transcript variant X2

High confidence: 4 potential gene matches
Length: 1260 bp    Location: 60879600..60900418   Strand: +
>XM_004834667.1
ATGGAAGAACTAGACAGTGTGGAAGCCTCACCTGTTCCTCCAGAAGCCTGGCCATCCCACCTGGTGCTGGTGATGGGTGAGGCGTCCTGTGAGGCCCAAGTCAGCCCCGAGGCTGCCTCAGGGCTGTCCCTGCTGGAGGTGCTGATGGTCTCCGTGGTGCTGGAGGACGCCAGGGAGCAGCTGTCCATCCTGGGCCACATCATGCCGTGGCCGCTGGAGAGGAGGCAGAGCACTGTGCTGAGAAACAACAGCCCAGACAAACCACCAGCACTCTTGACTGGAAGGAAGATATCCACTCCGTTACCACTGAAAGGACCAGTGTCACCTAGAGTCAGACCGGGAGGCCAGTTGGCTGCTAAGCAGAACAACATTCGTGATCTTGCCTTTAAAACACCTGCGGCGCGGGCCATTATGACGGCAGAGACGCTGAAGAAAATGCAGAGCGATAGGCAGTTTTTCAGCGATGTCATTGCAGGTACCATGCAGGAGTTGCAAGAGTCAGGAACTTTCATGAGCCTCCTGAAAGCCCTGCAAAAAGAAAAGGAAAACAAGATACACTTCTATGATGTCATTGCCAGGGAGGAAGAGGGACGAAAAATGATAAAATCTCTTCAAAAACAACTGATTAATGTTAAGAAAGAACAGCAAGCTGAAGTACAGAGCCAAAATGAATACATTGCCCACCTCAAGGACCAGCTGCAAGAGATGAAGGCGAAGACCAATCTGGAGAATCATTACATGAAAAGGAATACCGAGCTACAGATCGCCCAGACCCAGAGAAAGTGCAACTGGACCGAGGAGGTCCTGCTGGAGGAGATCGAGAAAGTGAGGATGAAGACTGAAGAAGAGAACCGGATCCACATGGAGATTGAGATGTTCCTTAGGAAAGAGCAGCAGAGGCTTGAGGAGAAGCTAGAGTTCTGGATGGAGAAATTCGATAAGGACACAGAAATGAAGCAGAATGAACTGAATGCTCTCAAGGCTGCCAAGGCCAGTGACCTAGCTCACCTGCAGCACCTGGCGAAGATGATTCGGGAGTATGAGGAGGTCATCATTGAAGATCGGATAGAAAAGGAGAAGACCAGGAAGAAGATGGAACAGGATACGCTGGAACTAAAGAGTGCCATAAAGCTCCAGGCCTGGTGGCGGGGCACTGTGATACGGAAGGAAATTGGAGGCTTCAAAATGCCTAAGAAGGAGAAAGATGACAGTAAGGATTCAAAAGGAAAAGACAAGGACAAACGAAGAGGCAAGAAGTGA

XM_004834668.1 Coding sequence

Iqcg IQ motif containing G, transcript variant X3

Length: 1134 bp    Location: 60879600..60899660   Strand: +
>XM_004834668.1
ATGGAAGAACTAGACAGTGTGGAAGCCTCACCTGTTCCTCCAGAAGCCTGGCCATCCCACCTGGTGCTGGTGATGGGTGAGGCGTCCTGTGAGGCCCAAGTCAGCCCCGAGGCTGCCTCAGGGCTGTCCCTGCTGGAGGTGCTGATGGTCTCCGTGGTGCTGGAGGACGCCAGGGAGCAGCTGTCCATCCTGGGCCACATCATGCCGTGGCCGCTGGAGAGGAGGCAGAGCACTGTGCTGAGAAACAACAGCCCAGACAAACCACCAGCACTCTTGACTGGAAGGAAGATATCCACTCCGTTACCACTGAAAGGACCAGTGTCACCTAGAGTCAGACCGGGAGGCCAGTTGGCTGCTAAGCAGAACAACATTCGTGATCTTGCCTTTAAAACACCTGCGGCGCGGGCCATTATGACGGCAGAGACGCTGAAGAAAATGCAGAGCGATAGGCAGTTTTTCAGCGATGTCATTGCAGGTACCATGCAGGAGTTGCAAGAGTCAGGAACTTTCATGAGCCTCCTGAAAGCCCTGCAAAAAGAAAAGGAAAACAAGATACACTTCTATGATGTCATTGCCAGGGAGGAAGAGGGACGAAAAATGATAAAATCTCTTCAAAAACAACTGATTAATGTTAAGAAAGAACAGCAAGCTGAAGTACAGAGCCAAAATGAATACATTGCCCACCTCAAGGACCAGCTGCAAGAGATGAAGGCGAAGACCAATCTGGAGAATCATTACATGAAAAGGAATACCGAGCTACAGATCGCCCAGACCCAGAGAAAGTGCAACTGGACCGAGGAGGTCCTGCTGGAGGAGATCGAGAAAGTGAGGATGAAGACTGAAGAAGAGAACCGGATCCACATGGAGATTGAGATGTTCCTTAGGAAAGAGCAGCAGAGGCTTGAGGAGAAGCTAGAGTTCTGGATGGAGAAATTCGATAAGGACACAGAAATGAAGCAGAATGAACTGAATGCTCTCAAGGCTGCCAAGGCCAGTGACCTAGCTCACCTGCAGCACCTGGCGAAGATGATTCGGGAGTATGAGGAGGTCATCATTGAAGATCGGATAGAAAAGGAGAAGACCAGGAAGAAGATGGAACAGGATACGCTGGAACTAAAGAGTGCCATAAAGTGA

XM_004835177.1 Coding sequence

Lrch3 leucine-rich repeats and calponin homology (CH) domain containing 3

High confidence: 4 potential gene matches
Length: 2295 bp    Location: 61011749..60901919   Strand: -
>XM_004835177.1
ATGAACCCCCAACAGCGCATGGCTGTGATAGGGACCAACAAGGAGCTGAGCGACCTGCTAGACTTCAGTGCGATGTTTTCTCCACCTGTTAATAGTGGGAAAGCCAGACCAACGACACTGGGAAGCAAGTATTCTGGCCCTGTGGTGTTGGCAGGGAGCCTCTCCGGTGTTAACGGCGGCTTGAACCCCGGGGCAGGCCCTGGTCCTAGCCCGGGCTCGTGGAGCCGCTCCCTCGACCGAGCCCTGGAGGAGGCGGCGGTAACCGGGGTGCTGAGCCTGAGTGGCCGGAAGCTGAGAGAGTTTCCCCGGGGAGCGGCCCACCACGACCTGACAGACACCACCCGGGCGGATTTATCACGAAATCGCCTCTCAGAAATTCCTATAGAAGCATGTCATTTTGTTTCCCTTGAAAATCTCAACTTATACCAAAATTGCATTCGGTATATTCCAGAAGCAATTCTAAACTTACAAGCACTAACATTCTTAAATATTAGTCGGAACCAACTGTCAACATTACCAGTACACTTGTGTAATTTACCATTGAAAGTCTTAATTGCTAGTAATAACAAATTGGTCTCACTTCCAGAAGAAATTGGACGCCTCAGACAGTTGACAGAACTTGATGTCAGCTGCAATGAAATTCAGACTATACCTTCTCAAATTGGTAATCTGGAGGCTTTGCGAGACCTTAATGTAAGAAGAAATCACTTAGTACGTTTGCCCGAAGAGCTTGCAGAGTTGCCTTTGATACGTTTAGACTTCTCCTGCAATAAAATTACATCAATCCCTGTTTGTTACCGGAACCTCAGACACCTGCAGGTGATCACCCTAGATAACAACCCACTGCAGTCACCTCCTGCACAGATATGTATAAAAGGCAAAATCCACATATTTAAATACCTGAACATGCAAGCTTGTAAGATTGCTCCAGACCTGCCGGATTATGATAGGAGACCCTTGGGCTTTGGCTCCTGCCATGAAGAACTGTACTCAGGTCGCCCTTATGGAGCCCTTGATTCAGGTTTCAATAGTGTGGACAGTGGAGATAAGAGGTGGTCAGGGAATGAGCCTACAGATGAATTTTCAGATTTGCCGCTTCGGGTAGCAGAAATTACTAAAGAACAAAGACTACGAAGAGAAAGCCAATACCAGGAGAATCGGAACAGTTTAGTTGTAACAAATGGTGGAGTGGAACACGACTTGGATCAGATTGACTACATTGACAGCTGTGCTGCAGAGGAAGAGGAAGATGAAGCAAGACAGCCCCGGGGCCTGGACTCTGACAGCCTCAGCTCACAGTTCATGGCGTACATCGAACAGCGGCGGGTCTCACACGAGTGTTCACCAGTAAAGCCAGCAGCCATTAGGGAGTTTCAAAAACCAGAAGACATGAGACGATATTCACATCAAAACAGGGTTCCAGTTGAGCCACCTTCTCTCTTGTCACTATCACCAAGCCACAATCAGCTTCCACACACAGACTTGGAAGTGCACCGGAGAAGAGAACAGTTGGTAGAACGTGCTCGGAGAGAAGCACAGCTGGCAGCCCTGCAATACGAGGAGGAGAAAATGAGGACCAAGCAGATTCAGAGAGAGGCTGTCCTGGACTTTGTCAAGCAAAAAGCATCACAAAATCCACAAAAACAACAATCCCCGATGGATAATGAGTGTCCCTTCCCACCCAGAAGGTCTCAGCACACTGATGATAGTGCCTTGTTAGTGTCGCTGTCAGGGTTGAATCAGGTGGACTGTGCTGCTACCCTGCCTCATTCTGCTGCCTTCATGCCTCTTAAGAGTGATGACAAACCTAATGCTACATCAAGTTCACCCACCGTGGAAACAGGTCATGCTTCCTCCCTTCACTCATCTCCTGCACCTGCCATGGATTCTACAGAATGCATCACAAGACAGAGAGAAGAAGAGCTGAAATTAATAGATCAGCTACGGAAACACATTGAGTACCGGTTAAAAGTCTCTCTGCCTTGTGATCTTGGAGCGGCTCTAACTGATGGTGTTGTTCTTTGCCATTTGGCCAATCATGTGCGGCCTCGATCTGTCCCAAGCATTCATGTTCCCTCACCAGCTGTGCCTAAATTAACAATGGCAAAATGCAGGCGAAATGTGGAGAATTTCCTAGAAGCATGCAGAAAAATTGGTGTACCTCAGGAGCAATTGTGCTTGCCTCTCCACATTTTAGAAGAGAAAGGTTTGGGCCAGGTTGCAGTGACGGTGCAGGCTCTCCTGGCACTCGCCCCGGCCAAGCAGCAGCAGCAGCAGCAGCTGTCTGCTGTGTAA

XM_004834670.1 Coding sequence

Fyttd1 forty-two-three domain containing 1, transcript variant X2

Length: 852 bp    Location: 61040801..61016003   Strand: -
>XM_004834670.1
ATGAACCGGTTTGGTACCCGGTTGGTGGGAGCCACGGCGACCCCGTCGCCGCCCCCGAAAGCCCGCAGTAATGAGAACCTGGACAAAATCGATATGTCTCTGGATGATATTATCAAATTGAATAGAAAGGAAGGAAAGAAGCAGAATTTTCCGAGACTAAATAGAAGACTCCAGCAAAATAGTGCTCGGCAATTCAGGATGAGAGTACGGTGGGGAATCCAGCAGAATTCTGGTTTTGGTAAAACTAGTCTGAGCCGAAGAGGAAAAGTAATGCCTGGGAAGAGATGTCCTTATGGAGTTATCACTGGCCTTGCAGCTAGAAAAGCAACTGGAATTCGAAAAGGAGTTAGTCCTATGAATCGTCCACCTCTAAGTGACAAGAATATAGAACGATATTTTCCAGTATTAAAAAGGAAAGCAAACCTTCTGAGACAAAATGAAGTGCAAAGGAAACCAGCTGCAGTTCTCAAGAGACCTAACCAGTTAAACAGAAAGAGTGGAAATAAATTAAGCCATCAGAAAGACACTCGTCAGGCAACTTTTCTTTTCCGAAGAGGCCTGAAGGTTCAGGCCCAGTTGAACACAGAACAACTGTTAGACGATGTAGCAGCAAAGAGAACTCGTCAAAATCAGAAACCACGATTAACTCGTACTGCTATACCCTCATTCTTGACAAAACGGGAACAATCCGATGTAAAGAAAGTTCCTAAAGGTGTCCCTCTACAATTTGACATAAATAGTGTTGGGAAACAGACAGGGATGACTTTGAATGAAAGATTTGGAATCCTGAAGGAACAAAGAGCCACTCTCACATACAACAAAGGAGGAAGCCGCTTTGTCACTGTGGGATAG

XM_004834669.1 Coding sequence

Fyttd1 forty-two-three domain containing 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 954 bp    Location: 61040801..61016003   Strand: -
>XM_004834669.1
ATGAACCGGTTTGGTACCCGGTTGGTGGGAGCCACGGCGACCCCGTCGCCGCCCCCGAAAGCCCGCAGTAATGAGAACCTGGACAAAATCGATATGTCTCTGGATGATATTATCAAATTGAATAGAAAGGAAGGAAAGAAGCAGAATTTTCCGAGACTAAATAGAAGACTCCAGCAAAATAGTGCTCGGCAATTCAGGATGAGAGTACGGTGGGGAATCCAGCAGAATTCTGGTTTTGGTAAAACTAGTCTGAGCCGAAGAGGAAAAGTAATGCCTGGGAAGAGATGTCCTTATGGAGTTATCACTGGCCTTGCAGCTAGAAAAGCAACTGGAATTCGAAAAGGAGTTAGTCCTATGAATCGTCCACCTCTAAGTGACAAGAATATAGAACGATATTTTCCAGTATTAAAAAGGAAAGCAAACCTTCTGAGACAAAATGAAGTGCAAAGGAAACCAGCTGCAGTTCTCAAGAGACCTAACCAGTTAAACAGAAAAAATAACATTCCAGCTAATTTTACCAGGAGTGGAAATAAATTAAGCCATCAGAAAGACACTCGTCAGGCAACTTTTCTTTTCCGAAGAGGCCTGAAGGTTCAGGCCCAGTTGAACACAGAACAACTGTTAGACGATGTAGCAGCAAAGAGAACTCGTCAGTGGCGTACTTCCACCACAAATGGAGGAATTTTGACTGTGTCCATTGACAATCCTGGAGCAGTACAGTGCCCAGTAAATCAGAAACCACGATTAACTCGTACTGCTATACCCTCATTCTTGACAAAACGGGAACAATCCGATGTAAAGAAAGTTCCTAAAGGTGTCCCTCTACAATTTGACATAAATAGTGTTGGGAAACAGACAGGGATGACTTTGAATGAAAGATTTGGAATCCTGAAGGAACAAAGAGCCACTCTCACATACAACAAAGGAGGAAGCCGCTTTGTCACTGTGGGATAG

XM_004834673.1 Coding sequence

Kiaa0226 KIAA0226 ortholog, transcript variant X3

Length: 2847 bp    Location: 61040855..61111998   Strand: +
>XM_004834673.1
ATGATAACGTTTGCCGGGTCTGCACCACCTCGCAATCCGCTCTCTCAAAACACTGGGCACGGTCCTAACTACCTTAGTAAGACCTCATCTGGGCGGGAGCACTGGCAGCTGCTGGGCAATTTGAAGACCACTGTGGAGGGCTTGGTGTCAGCCAACAGCCCCAACGTCTGGTCCAAGTATGGTGGCCTGGAGCGGCTCTGCAGGGACATGCAGCGCATCCTCTACCATGGGCTCATCCATGACCAGCTCTGTTGCCGGCAGGCAGATTACTGGCAGTTTGTGAAGGACATCCGCTGGCTCAGCCCCCACTCCGCCCTCCACGTGGAGAAGTTCATCAACTTGCATGAGGATGGACAGAGCGATGTCTCAGGTGTGAGCCAGCACGCTGTCGCGGAGCTGTGGCTGCAGCACAGTTTGCAGTGTCACTGCCTCTCGGCCCAGCTGCGGCCCCTGCTGGGGGACAGGCAGTACATCCGGAAATTCTACACAGACAGCGCCTTTCTGCTCAGCGACGCGCACGTGACAGCCATGCTGCAGTGCCTGGAAGCCGTGGAGCAGAACAACCCCCGCCTGCTGGCTCAGATCGACGCATCCATGTTTGCCAGAAAGCATGAGAGCCCGCTGCTGGTGACGAAAAGCCAGAGCCTGACAGCTCTGCCTGGTTCCACACACATCCCACGGACCAGCTGTGCTCAGCATTCCTACTTCGGGGCCTCCTCCGGCCTGCACCAGTCCATGGCCAACCACGGCTCAGAGAGAAGAACCACTTCCTTTACAGTCTGTGGCCCTCCCCAGAGACCCCAGGAAGTCCAAGGGCACCTGGCCCCAGCAGAAGAGCAAACCACCTACATCCCCCAGCTTTCAGACTCGGCACCAGCCTCAGCGCCCCTGTCGACCCCACAAGAGATGAGCTCCAGGGCCGCAACCAGCCCGCTGGAGGTATCATGGGCCAGTAGCCAGAGTGACTCACCGAGTGATGGCAGTGAGGGGCCCGAGTACCTGGCCATCGGCAGCCTGGACCCCCGAGGCCAGCCTGGCAGCTGTCAGAGCCCCAGCAGCAATGGCGGGAGCAGCAGCTTGAAGCTGTTCTCCTCCGTCAGCTCCCAGAAGCCAGGCTCTGCCACGTCTTCTTTAGGGGAAGAAGAGGGCAGCAGGCAGAGCCAGCTGCCCAGTGTCCCCCGAAGGTCCAGCTTCTCAGAGGGGCAGACGCTCCCTGTCACTGGAGTGACAAAGAAGAGCCACATCCGCTCCCACTCGGACACCAACATTGCCACCAGAGGAGCCCCAGAAGGTGCCCAGTGCCTGGGCTCGGGAGAGGGCATGTTCCGGAGACCATCAGAAGGACAGTCCCTCATCAGCTACCTCTCGGAGCAGGACTTCGGCAGCTGTGCAGATCTGGAAAAGGAGAACGCCCACTTCAGCATCTCAGAGTCTCTGATTGCGGCCATTGAGCTGATGAAGTGCAACATGATGAACCAGTGCTTGGAGGAGGAGGTGGAGGAGGAGGACAGTGATCGAGAGATCCAGGAGTTGAAGCAGAAAATCCGCCTCCGGCGCCGGCAGATCCGTACCAAGAACCTGCTCCCTGAGTACCAGGAGACAGAGCACGGGAGCTTTCGGGTCACCTCCAGCAGCTCCCAGTTCAGCTCTCGGGATTCCACACAGTTCTCTGACTCTGGCTCCACTGATGAGGTTGATGAGCTTGAAATCCAAGATGCCGACATCCGACGGAGCACAACCTCAAACAGCAAACCCTTCGTTTCCTCCCAATCCTTCTCCCACTGCTTCCTGCACTCCACGTCGGCCGAGGCAGTGGCCATGGGGCTTCTGAAGCAGTTTGAGGGAATGCAGCTTCCAGCGGCCTCGGAGCTGGAGTGGCTGGTCCCAGAGCATGATGCCCCTCAGAAGCTCCTGCCCATCCCCAACTCCCTGCCCATCTCGCCAGATGATGGGCAGCACGCAGACATCTACAAGCTTCGGATCCGTGTGCGTGGCAACCTGGAGTGGGCCCCACCCCGGCCTCAGATCATTTTTAATGTTCATCCAGCCCCAACGAGGAAGATCGCTGTGGCCAAGCAGAATTACCGCTGTGCAGGATGTGGCATCCGGACTGACCCTGATTATATCAAGCGGCTACGGTACTGTGAGTACCTAGGCAAGTACTTCTGTCAGTGCTGCCACGAGAATGCCCAGATGGTCATTCCTGCCCGGGTCCTGCGTAAGTGGGACTTCAGCAAATACTATGTCAGCAATTTCTCCAAGGACCTGCTCCTCAAGATCTGGAACGACCCCCTCTTCAACGTGCAGGACATCAACAGCGCCCTCTACAGGAAGGTCAAGCTGCTCAACCAAGTGCGGCTGCTTCGGGTCCAGCTGTACCACATGAAGAACATGTTCAAGACGTGCCGACTGGCCAAGGAGCTTCTGGACTCCTTTGACACAGTCCCAGGCCACCTGACAGAGGATCTCCACCTGTACTCTCTGAATGACCTGACCGCCACCAAGAAGGGGGAGCTGGGGCCAAGGCTTGCCGAGCTCACCCAGGCAGGGGCTGCCCACGTGGAGCGGTGCATGCTCTGCCAAGCCAAGGGCTTCATCTGTGAGTTCTGTCAGAGGGAGGAAGACATCATCTTCCCTTTTGAGCTGCAGAAGTGCCGGATCTGTGAAGAATGTAAAGCGTGCTACCATAAAGCCTGCTTCAAGTCTGGACACTGTCCCCGGTGCGAGCGGCTGCAGGCCCGGCGGGAACTGCTTGCCAGGCACAGCCTGGAGTCCTACTTGTCTGACTACGAGGAGGAACCCGAGGAGGTCCTGACCCTTGAAGCCACTGTCCTGGAGGGTACCTGA

XM_004834672.1 Coding sequence

Kiaa0226 KIAA0226 ortholog, transcript variant X2

Length: 2865 bp    Location: 61050699..61111998   Strand: +
>XM_004834672.1
ATGCGGCCGGAGGGCGCGGGAATGGATCTGGGCTGTGGCGAAGAGCGCCTGCCAGAGGAGAGCAGGCGGGAGCACTGGCAGCTGCTGGGCAATTTGAAGACCACTGTGGAGGGCTTGGTGTCAGCCAACAGCCCCAACGTCTGGTCCAAGTATGGTGGCCTGGAGCGGCTCTGCAGGGACATGCAGCGCATCCTCTACCATGGGCTCATCCATGACCAGCTCTGTTGCCGGCAGGCAGATTACTGGCAGTTTGTGAAGGACATCCGCTGGCTCAGCCCCCACTCCGCCCTCCACGTGGAGAAGTTCATCAACTTGCATGAGGATGGACAGAGCGATGTCTCAGGTGTGAGCCAGCACGCTGTCGCGGAGCTGTGGCTGCAGCACAGTTTGCAGTGTCACTGCCTCTCGGCCCAGCTGCGGCCCCTGCTGGGGGACAGGCAGTACATCCGGAAATTCTACACAGACAGCGCCTTTCTGCTCAGCGACGCGCACGTGACAGCCATGCTGCAGTGCCTGGAAGCCGTGGAGCAGAACAACCCCCGCCTGCTGGCTCAGATCGACGCATCCATGTTTGCCAGAAAGCATGAGAGCCCGCTGCTGGTGACGAAAAGCCAGAGCCTGACAGCTCTGCCTGGTTCCACACACATCCCACGGACCAGCTGTGCTCAGCATTCCTACTTCGGGGCCTCCTCCGGCCTGCACCAGTCCATGGCCAACCACGGCTCAGAGAGAAGAACCACTTCCTTTACAGTCTGTGGCCCTCCCCAGAGACCCCAGGAAGTCCAAGGGCACCTGGCCCCAGCAGAAGAGCAAACCACCTACATCCCCCAGCTTTCAGACTCGGCACCAGCCTCAGCGCCCCTGTCGACCCCACAAGAGATGAGCTCCAGGGCCGCAACCAGCCCGCTGGAGGTATCATGGGCCAGTAGCCAGAGTGACTCACCGAGTGATGGCAGTGAGGGGCCCGAGTACCTGGCCATCGGCAGCCTGGACCCCCGAGGCCAGCCTGGCAGCTGTCAGAGCCCCAGCAGCAATGGCGGGAGCAGCAGCTTGAAGCTGTTCTCCTCCGTCAGCTCCCAGAAGCCAGGCTCTGCCACGTCTTCTTTAGGGGAAGAAGAGGGCAGCAGGCAGAGCCAGCTGCCCAGTGTCCCCCGAAGGTCCAGCTTCTCAGAGGGGCAGACGCTCCCTGTCACTGGAGTGACAAAGAAGAGCCACATCCGCTCCCACTCGGACACCAACATTGCCACCAGAGGAGCCCCAGGATGCCCCAGGAATATCACCATTATAGTTGAAGATCCCATTGCAGAAGGTGCCCAGTGCCTGGGCTCGGGAGAGGGCATGTTCCGGAGACCATCAGAAGGACAGTCCCTCATCAGCTACCTCTCGGAGCAGGACTTCGGCAGCTGTGCAGATCTGGAAAAGGAGAACGCCCACTTCAGCATCTCAGAGTCTCTGATTGCGGCCATTGAGCTGATGAAGTGCAACATGATGAACCAGTGCTTGGAGGAGGAGGTGGAGGAGGAGGACAGTGATCGAGAGATCCAGGAGTTGAAGCAGAAAATCCGCCTCCGGCGCCGGCAGATCCGTACCAAGAACCTGCTCCCTGAGTACCAGGAGACAGAGCACGGGAGCTTTCGGGTCACCTCCAGCAGCTCCCAGTTCAGCTCTCGGGATTCCACACAGTTCTCTGACTCTGGCTCCACTGATGAGGTTGATGAGCTTGAAATCCAAGATGCCGACATCCGACGGAGCACAACCTCAAACAGCAAACCCTTCGTTTCCTCCCAATCCTTCTCCCACTGCTTCCTGCACTCCACGTCGGCCGAGGCAGTGGCCATGGGGCTTCTGAAGCAGTTTGAGGGAATGCAGCTTCCAGCGGCCTCGGAGCTGGAGTGGCTGGTCCCAGAGCATGATGCCCCTCAGAAGCTCCTGCCCATCCCCAACTCCCTGCCCATCTCGCCAGATGATGGGCAGCACGCAGACATCTACAAGCTTCGGATCCGTGTGCGTGGCAACCTGGAGTGGGCCCCACCCCGGCCTCAGATCATTTTTAATGTTCATCCAGCCCCAACGAGGAAGATCGCTGTGGCCAAGCAGAATTACCGCTGTGCAGGATGTGGCATCCGGACTGACCCTGATTATATCAAGCGGCTACGGTACTGTGAGTACCTAGGCAAGTACTTCTGTCAGTGCTGCCACGAGAATGCCCAGATGGTCATTCCTGCCCGGGTCCTGCGTAAGTGGGACTTCAGCAAATACTATGTCAGCAATTTCTCCAAGGACCTGCTCCTCAAGATCTGGAACGACCCCCTCTTCAACGTGCAGGACATCAACAGCGCCCTCTACAGGAAGGTCAAGCTGCTCAACCAAGTGCGGCTGCTTCGGGTCCAGCTGTACCACATGAAGAACATGTTCAAGACGTGCCGACTGGCCAAGGAGCTTCTGGACTCCTTTGACACAGTCCCAGGCCACCTGACAGAGGATCTCCACCTGTACTCTCTGAATGACCTGACCGCCACCAAGAAGGGGGAGCTGGGGCCAAGGCTTGCCGAGCTCACCCAGGCAGGGGCTGCCCACGTGGAGCGGTGCATGCTCTGCCAAGCCAAGGGCTTCATCTGTGAGTTCTGTCAGAGGGAGGAAGACATCATCTTCCCTTTTGAGCTGCAGAAGTGCCGGATCTGTGAAGAATGTAAAGCGTGCTACCATAAAGCCTGCTTCAAGTCTGGACACTGTCCCCGGTGCGAGCGGCTGCAGGCCCGGCGGGAACTGCTTGCCAGGCACAGCCTGGAGTCCTACTTGTCTGACTACGAGGAGGAACCCGAGGAGGTCCTGACCCTTGAAGCCACTGTCCTGGAGGGTACCTGA

XM_004834674.1 Coding sequence

LOC101700085 somatomedin-B and thrombospondin type-1 domain-containing protein-like

Length: 378 bp    Location: 61124806..61131349   Strand: +
>XM_004834674.1
ATGTGGGCGGCCCTTCTCCTCCTGCTGTGGCTGAGCCCTGTGGTCTCCCAGTTGAACATAGGCAGTTGCTCCCAACCGAACCCCCTCTGCTGCCAGGGATTCAATCACAGCTGCATCAGGGGAACCTGCTTCTGCGATGACTACTGCATCAATATCTCAGAGTGCTGTGTGGACTACAGAGCTGTCTGCCGCCCCAGTGACTCCCTGCCTCTCGGGGACAAGATGGTGCTACGTATGGTGCTGAGGATACAGAGCCCTCCCTGCCCTGACAGCAGCAATCCAGACTTGGTGCAGAGCATGGCCCAGAAGCTTCTCCAAAGCACTCTGCTGAAGAGGCAGCTCTCCATGTCTGTGAAGGGAGTCGGGAAGAAAGCCTGA

XM_004834676.1 Coding sequence

Muc4 mucin 4, cell surface associated

High confidence: 2 potential gene matches
Length: 3417 bp    Location: 61176889..61154663   Strand: -
>XM_004834676.1
ATGACCTCCCTGAGGACAGTGACATCTCCACTCCCCACAACCTCCCAAACCCTTCTGACCTCCACTCCCAGCACACCCAGGGGCTCCCACTCCTCACCCTCCTCGGGTCCTGTCAAGCCAGAGCCAGGAGTCCCCCTCTTCCCGTATGGGGTAAGCCACGGAGACCGGCACTTTGTCAGGATTGCTGTGGACTTTACCTCACAGCTCTTCAGGATCAAGATTGGCTTCCCCCTCGGCTCCTCTCTGTGGGATTCCTTCTATTTCACAGATAATGGCCAGATCTTTTTCCCGGAGTCGGACTACCAGATCTTCCCCTACCCTAACCCACCCCCAGGAGGCTTCACAGGACGAGACCCTGTCGCCACCGTGGCTCCATTCTGGGATGACGCTGATTTCTCCAGCCAGAAGGGAGAAATCTTTTATCAGGAATATGAGACACTCTACAATGAACCCAACTGGTTAGTCCAGCAGGTGGAGACTTGGATTAAAAACTTCACAAATTCGTGGGGCTACAAAGCCAGGTGGACCCTAAAGGTCACATGGGTCAATGTCTCTCCCTACCCTGCTCAGAGGACCTCTGGGACCAATACCTACCAAGCCATCCTGTCCACGGATGGCAGCAGATCCTATGCCCTGTTTCTGTACCAGAGCGGTGGGATGCAGTGGGATGTGACCCAACACCAGGGCAACCCGGTCCTCATGGGCTTCTCCAGTGGAGATGGCTATTTTGAGAACAGCCCGCTGATGTCCAGGCCACTGTGGGAGAAGTATCGTCCAGACCAGTTCCTGGATCCCAAATTAGGCGTCCGGAGGCTGCAGATCTACAGGCTGCACAGGGAGGAGAGGCCCAACTTCCGCCTCAGGTGCCTGCAGCGGCTGAGCAGCCAGCAGCTGAGCAGCCAGGCGCCCAGCTGGGCCCGGAGGCCAATCTTCTGTCCTTGCTCCTGGCAACAGGGACGATGGGACTTGAGGTTCCAGCCCCTCAGGATAGGCAGCTGGGGTCCCCATGGCCAGCACCTGTGCAGCTTCTCCTGGAGTGGTGGCGTGTGCTGCAGCTACGGGCCCTGGGGGGAGTTTCGGGAAGGCTGGAGCATGAAGAGTCCGGAGCTGCTTGGCCGGGAACTAGAGACGCAGAACTGGTGCTGCCGCTGGAACGACCACCCCCGCTTCTGTGCCTTGTACCACGAGCAGTGGCCCCAAGTCGGCTGCGCCGCCTACAGGCCCCCGAGGCCCGCCTGGATGTTTGGGGACCCCCACATCACCACCTTGGATGACACCTCTTTCACCTTCAATGGGCTGGGGGACTTCCTGCTGGTCCGCGCCTGGGGCAGCAACTCCTCCTTCCTCCTCGAGGGCCGTACTGCCCAGACCGGCTCTGCCAGTGCCACTAACTTCATTGCCTTTGCCACTCAGTACGAGGCCGGCAGACTGAACCCCATCACAGTCCAGTTTCTCCTGGGGCCCAATGACACGGTCCACGTTCTGCACAATAACGGGAGTGTGACATTTGAGACTAGCCAGGAAGATGCTGAAGGCACAGAAATGTTCAATGCCACCGGAGTCCTGCTGATGCGCAATGGCTCCCTGGTCTCAGCCAGCTTTGACGGCACGGTGACCATCTCGGTGACTGCTCTCTCCAACATCCTGCACGCGGTGTCCAGCCTCCCAGAGGAGTACTGGGACCACACCAAGGGCCTCCTAGGGGTCTGGAACAACAACCCAGAAGACGGCTTTAGGATGCCCAATGGCTCCTGTGTTCCCCACAACAGCTCAGAGGAGATGCTTTTCCACTATGGGATGACCTGGGCCCTCAATGGAACAGGCCTCCTTGGCATGAGGCATGACCCGCTGCCTTCCAACTTCACCCCCATCTTCCTTTCCCAACTGTCGAAAAACTCCCCTCTGGCCTCTGGGTGTGATGGGGACAAGCAGTGCATCTATGACACGCTGGCCACTGGAGACACCCAAGCCAGCCTTCACACCAGGGAGCTTTTCAGAATGAACCAGCTGATGAACGCCACCCTCAATCAGTTCCCGCCCTCCATCAGTGATTGCCATGTGATGGAAGCCTACAAGGACAAGACCTCCCAGTTTCAGTGCACCAGCAACTCTGAGAATGTCACCTTTGAGCTCCAAGGGAACCACACCTCCTTCCAGATCCTCAAGAATGGGACTTTGCTGTGGGCCCCAAACTCACCAGAACCAGTCACCCTGGAGATTCTAGTGCAAGACCCCAAGACTGGCTTGTCATCTGTCCTCCAGCCCAAGACAGTGGCCCGCTTTTGCAGTTCAAGGAGCCAGTGTCTGTACAACCAGACCCGCCGGGTGGGCAACTCCTCCCTAGAGGAGGCCAGCTGCCAGTGTGGCAAGGACACCTTTGGTCGCCACTGTGAACGCTCCAAGGACCCCTGTGATGAGCGGTGCTTCCCGAATGTGCAGTGCATCCCTGGGAGGGGCTGTGGCGCCTGCCCCCGGTTCATGACTGGGGACGGGAGGCACTGCACAGCCCTGGTGGACCCACTTCTCTGTCAGAACAAGTCCTGCCCGGTGAATTACTGCTACAACCACGGCCACTGCTTCGTGTCCCAGACTCAGGGCTGCCAGCTGGCTTGTACCTGTCCCCCAGCCTTCACAGATGCCCGCTGCTTCCTGGCAGGGAACACTTTTGTTCCCTCTGTCCTTGGAGAACTTCCTGTGAGGCCCATCCAGCTGTCGCTCCGTGAGGAGGAAAATGCCACCAAGGAGGACGTGAATGCCTCGGTGGCATACAGGCTGGAGCACCTGGATGTGCGGGCCTTCCTCCGGAATAGCCATGTGGAGCACAGCCATTCCATAGCACTGCCCTCAGGACTCTCCATCCAGCACTGGAAGGTAGTCTCGGAGTTCGGGTACCGTCCCAGGGGCCCTGTCATCCACTTCCTGAACCAGCAGCTCCTGGACGCCGTGGTCAGGGCCTTCCTCACGCAGGAGTGGGGTGCGAGACAGAAGAGCAGCCCGGAGGCCCGGAACAATGTGGCCTTCCAGCCCATCAGCAGGAAAGATGTGTCCGATGGCCAGGCTCGGCTGAACACGAGCAACCTGGGCTTGTACTTCAAATGCTATGGTTACGAGGGTTACCACCTAGTCTACAGACCCCAGAATGGCCTCACCTGCGTGTCCCCATGCAGTGAGGACCACTGTCAGCATGGAGGCCAGTGCCAGCACCTGCCCGATGGGCTGCACTGCAGCTGCGTGTCCTTCTCCATCTACACGTCCTGGGGTGAGCGCTGCGAGCACCTGAGCATGAAACTCGGCGCGTTCTTCGGGATCCTTTTCGGGTCCCTGGGCGCCCTCGTGCTGCTGGGGGTCGTGGTCTGGGTGGCCCTGCGCCTGAGGGGCCTGTCCAAGGCCGAGTACCCACTGCCCTTGGAGAACTGA

XM_004834685.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X9

Length: 3234 bp    Location: 61272773..61237653   Strand: -
>XM_004834685.1
ATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGTGAGGGGCTGGGCTGTGGGTGGGCAGAGCCAAGGGACCCAGCAGGCTGGGCATGGTGCTGATGGGCATTGTGCCCAGCTGCAGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGCGCTGA

XM_004834677.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X1

Length: 3348 bp    Location: 61272773..61237653   Strand: -
>XM_004834677.1
ATGTGCAGGAGTCGCCAGTCTGAAGTCAGGGAGGGTGAGCTGGCCCACGCTCCAGGCGCACAGCCGGCACTGTCCCAGGGAGGTCAAGACCAGGAGAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGTGAGGGGCTGGGCTGTGGGTGGGCAGAGCCAAGGGACCCAGCAGGCTGGGCATGGTGCTGATGGGCATTGTGCCCAGCTGCAGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGCGCTGA

XM_004834680.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X4

Length: 3303 bp    Location: 61260625..61237653   Strand: -
>XM_004834680.1
ATGTGCAGGAGTCGCCAGTCTGAAGTCAGGGAGGGTGAGCTGGCCCACGCTCCAGGCGCACAGCCGGCACTGTCCCAGGGAGGTCAAGACCAGGAGAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGTGAGGGGCTGGGCTGTGGGTGGGCAGAGCCAAGGGACCCAGCAGGCTGGGCATGGTGCTGATGGGCATTGTGCCCAGCTGCAGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGCGCTGA

XM_004834683.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X7

Length: 3267 bp    Location: 61260625..61237653   Strand: -
>XM_004834683.1
ATGTGCAGGAGTCGCCAGTCTGAAGTCAGGGAGGGTGAGCTGGCCCACGCTCCAGGCGCACAGCCGGCACTGTCCCAGGGAGGTCAAGACCAGGAGAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGCTGCAGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGTGA

XM_004834688.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X12

Length: 3216 bp    Location: 61260624..61237653   Strand: -
>XM_004834688.1
ATGTGCAGGAGTCGCCAGTCTGAAGTCAGGGAGGGTGAGCTGGCCCACGCTCCAGGCGCACAGCCGGCACTGTCCCAGGGAGGTCAAGACCAGGAGAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGTGA

XM_004834684.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X8

Length: 3264 bp    Location: 61260624..61237653   Strand: -
>XM_004834684.1
ATGTGCAGGAGTCGCCAGTCTGAAGTCAGGGAGGGTGAGCTGGCCCACGCTCCAGGCGCACAGCCGGCACTGTCCCAGGGAGGTCAAGACCAGGAGAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGCGCTGA

XM_004834682.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X6

Length: 3270 bp    Location: 61260624..61237653   Strand: -
>XM_004834682.1
ATGTGCAGGAGTCGCCAGTCTGAAGTCAGGGAGGGTGAGCTGGCCCACGCTCCAGGCGCACAGCCGGCACTGTCCCAGGGAGGTCAAGACCAGGAGAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGCTGCAGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGCGCTGA

XM_004834679.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X3

Length: 3306 bp    Location: 61259958..61237653   Strand: -
>XM_004834679.1
ATGAGGAAAAGAACTGCTTACCAGCACCTGGCAGCGGGGCAAGGAGGGGCGGAGAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGTGAGGGGCTGGGCTGTGGGTGGGCAGAGCCAAGGGACCCAGCAGGCTGGGCATGGTGCTGATGGGCATTGTGCCCAGCTGCAGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGCGCTGA

XM_004834689.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X13

High confidence: 4 potential gene matches
Length: 3129 bp    Location: 61259618..61237653   Strand: -
>XM_004834689.1
ATGAGGAAAAGAACTGCTTACCAGCACCTGGCAGCGGGGCAAGGAGGGGCGGAGAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGTGA

XM_004834678.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X2

Length: 3330 bp    Location: 61257382..61237653   Strand: -
>XM_004834678.1
ATGCCAGCAGCTCGCCGCTTCCCCGGCCTGGAGCTGTCGTTCCCTCTCCTGGCCAGGCTGCGGAGGCGGCTGTACACAAGGCTGGGGAGCAGCAGCATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGTGAGGGGCTGGGCTGTGGGTGGGCAGAGCCAAGGGACCCAGCAGGCTGGGCATGGTGCTGATGGGCATTGTGCCCAGCTGCAGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGCGCTGA

XM_004834687.1 Coding sequence

Tnk2 tyrosine kinase, non-receptor, 2, transcript variant X11

Length: 3234 bp    Location: 61256174..61237653   Strand: -
>XM_004834687.1
ATGCAGCCCGAAGAGGGCACAGCCTGGCTGCTGGAGCTGCTGTCCGAGGTGCAGCTCCAACAGTACTTCCTGCGGCTCCGTGACGACCTCAATGTGACCCGCCTGTCCCACTTCGAGTATGTCAAGAACGAGGACCTGGAGAAGATTGGCATGGGCCGGCCTGGCCAGCGGCGGCTGTGGGAGGCCGTGAAGAGAAGGAAGGCCCTGTGCAAGCGCAAGTCGTGGATGAGCAAGGTGTTCAGTGGAAAGCGGCTGGAGGCTGAGTTCCCCCCTCACCACTCCCAGAGCACCTTCCGGAAGCCCTCGCCTACCCCCGGGGCCCCTGCAGGCGAGGGGCCCCTACAGAGCCTCACCTGCCTCATCGGGGAGAAGGACTTGCGCCTCCTGGAGAAGCTGGGGGATGGCTCCTTCGGCGTGGTGCGCAGGGGAGAGTGGGATTCGCCCTCCGGCAAGACGGTGAGTGTGGCCGTGAAGTGCCTGAAGCCTGACGTGCTGAGTCAGCCTGAGGCCATGGATGACTTCATCCGGGAGGTCAACGCCATGCACTCACTTGACCACCGAAACCTCATCCGCCTGTACGGTGTGGTGCTCACGCCGCCCATGAAGATGGTGACAGAGCTGGCACCCTTGGGATCCCTGTTGGACCGGCTGCGGAAGCACCAGGGTCACTTTCTCCTGGGGACTCTGAGCCGCTATGCTGTACAGGTGGCCGAGGGCATGGGCTACCTGGAGTCCAAGCGCTTTATTCACCGTGATCTGGCCGCCCGAAATCTACTGCTGGCTACCCGTGACCTGGTCAAGATCGGGGACTTCGGACTGATGCGAGCCCTGCCCCAGAATGACGACCACTATGTCATGCAGGAACATCGCAAGGTGCCCTTTGCCTGGTGCGCCCCTGAGAGCCTGAAGACCCGCACCTTCTCCCATGCCAGCGACACCTGGATGTTCGGGGTCACATTGTGGGAGATGTTCACCTATGGCCAGGAGCCCTGGATCGGCCTCAATGGCAGCCAGATCCTGCACAAGATTGATAAGGAGGGGGAGCGCCTGCCACGGCCTGAGGACTGCCCCCAGGACATCTACAACGTCATGGTCCAGTGCTGGGCGCACAAGCCCGAGGACAGACCCACATTTGTGGCCCTCCGGGACTTCCTGCTGGAGGCCCAGCCCACTGACATGCGGGCCCTGCAGGACTTTGAGGAGCCAGACAAGCTGCACATCCAGATGAATGATGTCATTACTGTCATCGAGGGAAGAGCTGAGAACTACTGGTGGCGAGGGCAGAACACGCGGACGCTGTGTGTGGGGCCCTTCCCTCGCAACGTGGTGACCTCCGTGGCTGGCCTGTCGGCGCAGGACATCAGCCAGCCCCTGCAGAACAGCTTCATCCACACAGGGCACGGGGACAGCGACCCCCGCCACTGCTGGGGCTTCCCTGACCGCATTGATGAACTGTACCTGGGGAACCCTATGGATCCCCCTGACTTGCTGAGTGTGGAGCTGAGCACCTCCCGGCCCAGCCAGCACCTGGGAAGGCTGAAAAGGGAGCCTCCGCCTCGCCCTCCTCAGCCTGCCATCTTCACTCCGAAGCCCACTTACGACCCTGTGAGCGAGGACCCAGACGCCCTGGCCAGTGACTTCAAGAGGCTGGGTCTGCGGAAGCCAGGCCTGCCCTGGGGGCTGTGGCTGTCGAAGCCCTCAGCCCGGGTCCCAGGCACCAAGGCAGGCCGTGGTGTCAGTGGCGGGGCTAGCGAGGTCACCCTCATCGACTTTGGCGAGGACCCCGTGGTCCCTGCCCCTCGGCCCTGCGCACCTTCCCTGGCACAGCTGGCCATGGACGCCTGCTCCTTGCTGGACAAGACCCCTCCCCAGAGCCCCACACGGGCCCTGCCACGCCCCCTGCACCCCACACCAGTGGTGGACTGGGATGCACGCCCACTGCCCCCGCCCCCTGCCTACGACGATGTGGCCCAGGACGAAGACGACTTCGAGGTCTGCTCCATCAATAGCACGCTGGTGGGCACTGGGCTGGCCACTGGGCCCTGCCAGGGCGAGACCAACTACGCCTTCATGCCTGAGCCCGAGCGGTGCCCCCTGGCGCTGGAGGACAACCTGTTCCTGCCCTCCCAGGGTGGGGCCCCACCGCCCAGCTCGGCGCAGACTGCCCAGATCTTCCAGGCGCTGCAGCAGGAGTGCATGCGGCAGCTGCAGGTCCCCACGGGCTCTCTGGCCCCCTCACCTGGCCCCGCCAGTGATGACAAGCCCCAGGTGCCACCCCGGGTGCCCATTCCCCCAAGGCCCACGCACCCAAGAGTCGAGTTGTCTCCGGCCCCCTCGGGAGAGGAGGAGCTGGGCCGGTGGCCCGGACCTGTGTCCCCTCCTCGGGTGCCTCCCCGGGAGCCCCTGTCCCCACAAAGCTCAAGGACCCCCAGCCCCCTGGTGCCGCCTGGCAGCTCCCCACTGCCACCCCGGCTCTCGAGCTCACCCGGGAAGACCATGCCTACCACCCAGAGCTTTGCCTCCGACCCCAAGTATGCAACCCCTCAGGTGATCCAGGCTCCTGGCCCCCGGGCAGGGCCCTGCATCCTGCCCATCGTGCGCGATGGCCGTAAGGTCAGCAGCACCCACTACTACCTGCTGCCTGAACGTCCTCCCTACCTGGAGCGCTATCAGCGCTTCCTCCGGGAGGCCTCAAGTCCCGAGGAGCCAGCCCTGCAACCCGTGCCCCTGCTGCCGCCACCGCCCAGCACCCCCGCCCCCGCGGCCCCCACCGCCACCGTGCGGCCCATGCCCCAGGCCGCCCCCGACCCCAAGGCCAACTTCTCTACCAACAACAGCAACCCTGCTGTCCGGCCACCCACCTCACAGAGGGGCTGCCCGGGGGATGGGCTGGAGACTGCACGGCAGGCGGATGAGGTCCAGATGGTGAGGGGCTGGGCTGTGGGTGGGCAGAGCCAAGGGACCCAGCAGGCTGGGCATGGTGCTGATGGGCATTGTGCCCAGCTGCAGGCCATGGTGCACGGGGTGACCACAGAGGAGTGCCAGGCCGCCCTGCAGTGCCACGGCTGGAGTATGCAGAGGGCTGCCCAGTATCTGAAGGTGGAGCAGCTCTTTGGGCTGGGGCTACGGCCAAGGCTGGAGTGTCACAAAGTGCTGGAGATGTTTGACTGGAACCTGGAGCAGGCTGGCTGCCACCTGCTGGGCTCCTTCGGCCCTGCCCACCACAAGCGCTGA

NM_001267852.1 Coding sequence

annotated by transcript or proteomic data mRNA

High confidence: 4 potential gene matches
Length: 2295 bp    Location: 61313467..61282650   Strand: -
>NM_001267852.1
ATGATGAATCAAGCCAGGGCAACGTTCTCAAACTTGTTTGGTGGAGAACCATTGTCATATACCCGGTTTAGTCTGGCTCGGCACGTAGATGGAGATAACAGTCATGTGGAGATGAAGCTGGCTGCAGATGAGGAAGAAAATGCTGACAACATGAGGGCCAATGTCAAAGCACCAAGAAGGTGTATCAGAAGCATCTGCTATGTGGTTATTGCCATCACCATTTTTTTCTTGATTGGATTTATGATCGGGTACCTGGGCTACTGTAGACGTGTAGAACCAAAGGCTGAGTGTGAGAGACCAGCAGTCATGGATGTGATGAAGGAGTCAGAAGACCTGGAAGTGGAAGAAGTGATGCCTGAAGCCTCCTCTCACTTGTACTGGGAAGACCTCAAAACAATGTTGTCAGAGAAACTCAGCAATGCAAAGTTCAGCGACACAGTCAAACAGCTGAATGAAAATGCATATGTCCCTCGTGAGGCTGGTTCTGAAAAAGATGAAAATCTTGCCTATTTTGTTGAGAATCAGTTCAGTGAATATAAACTCAGCAAAGTCTGGCGGAATGAACACTATGTTAAGATTCAAGTAAAAAACAGCACTGCTCCAAACTCTGTGACTGTGGTAAGTGCAAATAATGGGATGGTGTACCTGGTGGAGAATCCTGAGGGCTACGTGGCATACAGTAAGGCTGCAACAGTTACTGGTAAACTGGTTCACGCTAACTTTGGCACTAAAAAGGACTTTGAAGATTTAAATACTTCTGTGAATGGATCTTTAGTGATTGTAAGAGCAGGGAAAATCACTTTTGCAGAAAAGGTTTCAAATGCTGCAGGCTTAAATGCACTTGGTGTCTTGATATACCTGGACAACACTCAATTTCCCATCACTAAGGCAGACCTTCCATTCTTTGGTCATGCTCATCTGGGAACAGGCGACCCTTACACCCCTGGATTCCCTTCTTTTAATCATACCCAGTTTCCGCCATCTCAGTCATCTGGATTGCCTACTATTCCAGTCCAGACCATCTCCAGACAGGCTGCAGAAAATCTGTTTGCAAATATGGAAAGAGACTGTCCCACTAGCTGGAGAACAGATGTTTCTTGTCGGATGCAGTCGAGACAGGACAGGAATGTGAAGCTCATTGTGAACAATGTGCTGAAAGAGATAAGAATTCTTAACATCTTTGGAGTTATTAAAGGTGTTGAAGAGCCAGATCGCTATGTTGTAGTGGGGGCCCAGAGGGATTCCTGGGGTCCTGGAGCTGCGAAGGCCAGCGTGGGAACTGCTCTTCTATTGGAACTCGCCCGGACATTCTCAGATATGGTATTAAAAGATGGATTTAAGCCCCACAGAAGCATCATCTTTGTTAGCTGGAGCGCTGGAGACTTTGGAGCCGTCGGTGCCACTGAATGGCTAGAGGGATACATTACCTCTTTACATTTAAAGGCTGTCACTTACATTAATTTGGATAAAGCTGTTCTTGGTACTACAAACTTCAAGGTTACTGGCAGCCCAATGTTGTATAAACTTATTGAAAAAACTATGCAAGAGGTGAAGCATCCACTTACTGGGGCATCTCTATATAAGGATAGCAATTGGGTCAACAAAGTTGAGAAACTTTCTTTTGACAACGCTGCTTTTCCTTTCCTCGCATATTCTGGAATTCCAGCAGTTTCTTTTTGTTTTTGTGAGGACAAGGGCTATCCTTACTTGAGTACCACCCTGGATAACTATGACATGCTGATGCGGGAAATTCCTCAGTTGAACAAATTAATGTATGCAGCAGCAGAGGTGGCCGGTCAGTTCCTGATCAGACTGACCCATGATCTTGAATTAAACCTGGACTATGAGGTTTATAACAGCAAAATGCTTTTGTTTCTGAGAGAACTGATGCAACACACGACAGACATAAAGGAGATGGGGCTGAGCCTGCAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCGACTTCCAGACTGACGACAGATTTCCACAGTGCTGAGAGAACAAACAGGTTCATCATGAAGGAGTTAAATGATCGTATTATGAAAGTGGAGTACCACTTCCTGTCACCCTACGTGTCCCCGAGGGAGTCTCCTTTCCGGCATATCTTCTGGGGCTCTGGCTCTCACACTCTGCAAGCTTTACTGGATAACTTGAAGCTGCGAAAGGAGAATAAAGCTGCATTTAATGAAACACTGTTTAGGAACCAGTTGGCTCTGGCAACTTGGACAATTCAAGGCGTGGCAAATGCCCTCTCTGGTGACATTTGGGATATTGACAATGAGTTTTAA

XM_004834690.1 Coding sequence

Zdhhc19 zinc finger, DHHC-type containing 19

High confidence: 4 potential gene matches
Length: 909 bp    Location: 61370595..61363444   Strand: -
>XM_004834690.1
ATGTCCCACATGAAAGGCCCCCAACCCCCACCTCTCATCTCATTTTCCTGGTTCCTTCTGAGCCTGCTCCCTGCCTTCAACGTGGTCCTGCTGGTCGTTTTCAGTGGGCTCTTCTTTGCATTTCCTTGCAGGTGGCTGGTTCAGAACGGGGAATGGGCCGTTCCTGCCATCACAGGCCCCCTCTTCGTCCTCACCTTCTTCAGTCTCATCTCACTCAACTTCTCAGACCCGGGTACCTTACATCAAGGCTCCCTGAAGGAGGATCCCATGTTGGTCCACGTGGTGTGGGTGAACCACAGGGCCTTCTGCCTGCGGTGGTGCCCAAGCTGCTGCTTTCACCGCCCACCTCGGACTCACCACTGCCCCTGGTGCAACATCTGTGTGGAGGACTTTGACCACCATTGCAAGTGGGTCAATAACTGCATTGGTCACCGCAACTTCCGCTGCTTCATGCTGCTCATCGTGTCCCTGTTCCTCTACTCCAGCGCCCTGCTGGTTATCTCTCTGGTGTTCTTGACGCGCACCAGCCACCTGCCCTTCAACCTGGACAAGGCCATGGCCCTGGTGGTGGCGGTCCCCGCCGCCGGCTTCCTGCTGCCGCTCTTGCTGCTGCTGGTGAGCCAGGTCCTGTCGGTGAGCACGGCTGAGCGCTCCTGCAAAGGCCAGTGCAGAGACCTTCAGGGATACAACCCGTTCGACCAGGGCTGCACCAGGAACTGGTACCTGGCACTCTGTGTACCGCTGGGATCCCCGTACATGTCTGACGCTGTCTGGCTGCAGAGACCAGTGGGGCCCAAGGGGCCGCCCGTGCCAGCGCCGAGCCCCCCTGCTGTGCCCCTGCACTCACTGTCACCCACCCTGTCTGGGGAAGGGGGTGCTCTCCAGGAGCTGCCCACCGGCTCTGCTTAG

XM_004834692.1 Coding sequence

Pcyt1a phosphate cytidylyltransferase 1, choline, alpha

High confidence: 4 potential gene matches
Length: 1104 bp    Location: 61466016..61418013   Strand: -
>XM_004834692.1
ATGGATGCACAGAGCTCAGCCAGAGTCAACTCAAGGAAGAGGAGAAAAGAGGGCCTGGGACCGAATGGGGCGACGGAGAAAGACGGGATTCCCTCCAAAGTGCAGCGCTGTGCAGTGGGCTTACAGGAGCCAGCTCCTTTTTCTGATGAAGTCGAAGTTGACTTTATTAAGCCCTATGTCAGGGTAACTCTGGAAGAAGCCTGCAGAGGAACTTCTTATGAGCGGCCTGTGCGAGTTTATGCAGACGGAATATTTGACTTGTTTCACTCTGGTCATGCCCGGGCGCTGATGCAAGCGAAGAACCTCTTCCCTAATACATACCTCATTGTGGGAGTCTGCAGCGATGAGCTAACACACAACTTCAAAGGCTTCACAGTGATGAACGAGAACGAGCGCTATGATGCGGTGCAGCACTGCCGCTACGTGGACGAGGTGGTGAGGAACGCGCCCTGGACCCTGACCCCCGAGTTCCTGGCAGAGCACCGGATTGATTTCGTAGCCCATGATGACATCCCTTACTCTTCTGCTGGGAGCGACGATGTCTATAAGCACATCAAGGAGGCAGGCATGTTCGCGCCAACACAGAGGACAGAAGGCATCTCCACGTCAGACATCATCACTCGGATTGTCCGTGACTACGATGTGTACGCCAGACGCAACCTGCAGCGGGGCTACACGGCCAAGGAGCTCAACGTCAGCTTCATCAATGAGAAGAAATATCACCTACAGGAGCGGGTTGACAAAGTAAAGAAAAAAGTAAAAGATGTGGAGGAAAAGTCCAAAGAATTTGTTCAGAAGGTGGAGGAAAAAAGCATTGACCTCATCCAGAAATGGGAAGAGAAATCCCGAGAATTCATTGGCAATTTCCTGGAAATGTTCGGTCCAGAAGGAGCACTGAAACACATGCTGAAAGAGGGAAAAGGCCGGATGCTGCAGGCCATCAGCCCCAAGCAGAGCCCCAGCAGCAGCCCGACGCGGGAGCGCTCCCCCTCCCCCTCCTTCCGCTGGCCCTTCTCCGGCAAGACGTCCCCGCCGCCCTCCCCAGCCGGTCTCTCTAGGCGCAAGGCCATGGCCTACGACATCAGTGAGGATGAGGAAGACTAA

XM_004834694.1 Coding sequence

Tctex1d2 Tctex1 domain containing 2, transcript variant X2

Length: 744 bp    Location: 61479756..61467489   Strand: -
>XM_004834694.1
ATGAGGACACAGCGTAATGTTTTGAGGAGCCCGCCTTTTGCAGCACTCTGCATTTCTGGGCTCCTGTACACACCTACCCGTCCGCAGCCGGAGGCCCAACCTCTGCCAGTTCCGGCCCTCAGCGGTGCGCTTGCGCGGCCGAGGCCGGCCGAGGCCAGCCGCTCCCGGAGCAAGCGTTGGCGTCACGTGACCGCCAAGGGTGTTCCTGTCGCCCTGGCGACGGCCTCCCCGCTGCTCGCCTTAGCTGTCCGGGCCAGGCCTTCATCGCGAGATACACCGGGTCCAGGAGCCCTGGCCATGGCCACCTCCGCAGGCATGTCCTTGTCTGCAGGCCTATCCTCTCCCGGGGTCGACGAGGTGCCTGAGACTGAGAAGAACTCAGGAGACCCGGAGAACACCTATATCCTGAGGCCCATTTTCCAGCAAAGGTTCAGGCCCTCTGTGGTGAAAGACTGCATCCACGCAGTGCTCAAGGCCGAGCTGGCCAGCACCGAGTACTCGGCAGAAGAAACGCCCCAGCTCACCAGGCGCCTATCAGAAAACATCAAAGATAAGTTAAAAGAGATGGGATTTGACCGATACAAAATGGTGGTGCAAGTAGTGATTGGAGAGCAAAGAGGCGAAGGAGTTTTCATGGCAGCTCGATGCTTCTGGGATGCGGACACTGACAACTACACTCATGATGTTTTCATGAACGACAGTTTATTCTGTGTGGTAGCAGCATTTGGCTGTTTCTACTATTGA

XM_004834693.1 Coding sequence

Tctex1d2 Tctex1 domain containing 2, transcript variant X1

Length: 807 bp    Location: 61479756..61469912   Strand: -
>XM_004834693.1
ATGAGGACACAGCGTAATGTTTTGAGGAGCCCGCCTTTTGCAGCACTCTGCATTTCTGGGCTCCTGTACACACCTACCCGTCCGCAGCCGGAGGCCCAACCTCTGCCAGTTCCGGCCCTCAGCGGTGCGCTTGCGCGGCCGAGGCCGGCCGAGGCCAGCCGCTCCCGGAGCAAGCGTTGGCGTCACGTGACCGCCAAGGGTGTTCCTGTCGCCCTGGCGACGGCCTCCCCGCTGCTCGCCTTAGCTGTCCGGGCCAGGCCTTCATCGCGAGATACACCGGGTCCAGGAGCCCTGGCCATGGCCACCTCCGCAGGCATGTCCTTGTCTGCAGGCCTATCCTCTCCCGGGGTCGACGAGGTGCCTGAGACTGAGAAGAACTCAGGAGACCCGGAGAACACCTATATCCTGAGGCCCATTTTCCAGCAAAGGTTCAGGCCCTCTGTGGTGAAAGACTGCATCCACGCAGTGCTCAAGGCCGAGCTGGCCAGCACCGAGTACTCGGCAGAAGAAACGCCCCAGCTCACCAGGCGCCTATCAGAAAACATCAAAGATAAGTTAAAAGAGATGGGATTTGACCGATACAAAATGGTGGTGCAAGTAGTGATTGGAGAGCAAAGAGGCGAAGGAGTTTTCATGGCAGCTCGATGCTTCTGGGATGCGGACACTGACAACTACACTCATGATGTTTTCATGAACGTAAGTCTACCTGGAAACCTTTCCTCTGCAGGGACTCTCAGGCATCACAAATTAAGTTATTCAATGTTTACTAAGATGGGAGGACACTCTAGATTTAGACATTTGTCTTAG

XM_004834709.1 Coding sequence

Cep19 centrosomal protein 19kDa, transcript variant X4

Length: 486 bp    Location: 61790001..61783736   Strand: -
>XM_004834709.1
ATGTGCACTGCCAAGAAATGTGGAATTAGATTCCAGCCTCCAGCTATTATCTTAATTTATGAGAATGAAGTCAAGGGGAAGAATCGTCAGCGCATCATGCCAGTCCGAAACTTTTCCAAGTTCTCAGATTGCACCAGAGCTGCTGAACAATTAAAGAATAATCCACGCCACAAGAGTTACCTGGAACAGGTATCCCTGAAGCAGCTAGAGAAGTTGTTTGCTCTTTTACGAGGTCACTTGTGTGGACAGAGTCTGGCAACAACAATGGAACAAATTCAACGGGAAACAACCATTGATCCTGAGGAAGACCTGAACAAACTAGATGACAAGGAGCTTGCCAAAAGGAAGAGCATCATGGATGAACTCTTTGAGAAAAATCAGAAGAAGAAGGATGATCCAGATTTTGTTTATGACATCGAGGTTGAGTTCTCACAGGGCAAGCTACAGTCCTGCGGCTGGGACACAGACTCAGCTGATGAGTTCTGA

XM_004834697.1 Coding sequence

Tm4sf19 transmembrane 4 L six family member 19, transcript variant X2

Length: 552 bp    Location: 61487335..61484712   Strand: -
>XM_004834697.1
ATGCTGTTCTCTCCCTGCCTGCTGGGCTGCTCCAGGACCTGCTCCCGAGTGCTGGGGCTGAGCCTGGGGACTGCAGCTCTGTTTGCCGCCGGTGCCAACACAGTGCTCCTCTTCCCGAACTGGGACGTCAGCTACCTGCTTCGGGGCCTCATAGGCCGGCATGCCTTGCTGGGTTCCGGGCTCTGGGCAGGGGGCCTCATGATCCTCACTGCTCTCCTTGCCGCCGGCTTGGCTTTGGTCGGAGCCCTGATATGTTTCGTCACTTCTGGAGTGGCCCTGAGAGATGGTCCACTGTGCATGTTCAATATCTTGTCCTACAATCAGACACAGGCATGGAAATACGGCTACCCATTCAAAGACCTGCGGCACACGAATTATCTGTATGACCGGTCGCTCTGGAGCTCTGTCTGCCTAGAGCCCTCCATGGCTGTCGTCTGGCACGTATCCTTCTTCTCAGTTCTCCTGTGCATCAGCACCCTCCAGCTTCTCCTGGTGGCCGTCCATTTCATCAACAGCTTCCTTGGCCTCTTCTGCAGCCTCTGTGAGGAATGA

XM_004834696.1 Coding sequence

Tm4sf19 transmembrane 4 L six family member 19, transcript variant X1

High confidence: 3 potential gene matches
Length: 630 bp    Location: 61487335..61484712   Strand: -
>XM_004834696.1
ATGCTGTTCTCTCCCTGCCTGCTGGGCTGCTCCAGGACCTGCTCCCGAGTGCTGGGGCTGAGCCTGGGGACTGCAGCTCTGTTTGCCGCCGGTGCCAACACAGTGCTCCTCTTCCCGAACTGGGACGTCAGCTACCTGCTTCGGGGCCTCATAGGCCGGCATGCCTTGCTGGGTTCCGGGCTCTGGGCAGGGGGCCTCATGGTGCTCGTGGCTGCCACCCTTATCTCTATGATGGGCTGGAGAGGCTGCTGCTTCAGGAAGAGCGCACCGTGTTGCAGCATCCTCACTGCTCTCCTTGCCGCCGGCTTGGCTTTGGTCGGAGCCCTGATATGTTTCGTCACTTCTGGAGTGGCCCTGAGAGATGGTCCACTGTGCATGTTCAATATCTTGTCCTACAATCAGACACAGGCATGGAAATACGGCTACCCATTCAAAGACCTGCGGCACACGAATTATCTGTATGACCGGTCGCTCTGGAGCTCTGTCTGCCTAGAGCCCTCCATGGCTGTCGTCTGGCACGTATCCTTCTTCTCAGTTCTCCTGTGCATCAGCACCCTCCAGCTTCTCCTGGTGGCCGTCCATTTCATCAACAGCTTCCTTGGCCTCTTCTGCAGCCTCTGTGAGGAATGA

XM_004834698.1 Coding sequence

Ubxn7 UBX domain protein 7

High confidence: 3 potential gene matches
Length: 1473 bp    Location: 61571909..61507095   Strand: -
>XM_004834698.1
ATGGCTGCCCACGGGGGCTCGGCGGCGGCGGCGTCAGCGCTGAAGGGGTTAATCCAGCAGTTCACTGCCATCACCGGTGCGAGTGAAAGTGTAGGAAAGCACATGCTTGAAGCCTGCAACAACAACCTGGAAATGGCAGTCACTATGTTCCTGGATGGGGGAGGAATCGCCGAAGAGCCCAGTACCAGTTCTGCTAGTGTCTCCACTGTCAGACCACATACAGAGGAAGAAGTTCGTGCCCCAATTCCTCAAAAGCAAGAAATATTGGTGGAGCCAGAACCTTTGTTTGGTGCTCCTAAGAGACGACGGCCTGCGCGTTCAATATTTGATGGTTTCCGAGATTTTCAAACTGAAACTATTCGGCAAGAGCAGGAACTAAGAAATGGTGGAGCAATAGATAAGAAACTAACTACCCTTGCAGATCTATTCCGGCCACCCATTGACTTGATGCATAAAGGCAGCTTTGAAACAGCCAAAGAATGTGGCCAGATGCAGAATAAGTGGCTGATGATAAATATTCAAAATGTGCAAGACTTTGCATGCCAGTGCCTCAACCGTGATGTATGGAGCAATGAAGCTGTGAAGAACATTATTCGAGAACATTTCATTTTCTGGCAGGTTTATCATGACAGTGAGGAAGGTCAGAGATACATACAGTTTTATAAGCTAGGGGACTTCCCCTATGTCTCCATCTTGGACCCACGAACAGGTCAGAAGCTAGTAGAGTGGCACCAATTAGATGTATCTTCTTTCTTGGACCAAGTGACAGGATTTCTGGGTGAACATGGGCAACTGGATGGACTTTCTAGCAGTCCTCCCAAAAAATGTGCCCGATCAGAGAGTCTGATAGATGCAAGTGAGGACAGTCAGCTGGAAGCAGCCATCAGAGCTTCCCTGCAGGAGACACATTTTGACTCCACACAGACGAAGCAGGACAGCCGCTCAGATGAAGAGTCTGAATCTGAACTTTTTTCTGGCAGTGAGGAGTTCATATCTATTTGTGGCTCCGATGAAGAGGAAGAGGTAGAGAATCTTGCCAAATCCAGGAAATCCCCCCACAAAGATTTGGGGCATAGAAAGGAGGAGAATAGGAGGTCACTGACTGAGCCCTCTGCCAGAACTGAGCAGGGGACAGCCACAAATCACCAAGGATTGCCAGCTTTGGACCCAGAGGTCCTGGAGATGTCACCTGAAAAGTCAGATGGAAGTGTGGAAGGGGCAGATGTAAACGGACCAAAAGCACAGCTGATGTTGCGGTACCCAGATGGAAAAAGGGAACAGATCACTCTTCCAGAGCAAGCTAAGCTGCTAGCTTTAGTGAAGCATGTGCAGTCTAAAGGATATCCAAATGAACGTTTTGAACTTCTCACCAACTTCCCTCGGAGGAAACTCTCTCATCTGGACTATGACATTACATTACAGGAGGCAGGCCTTTGTCCTCAAGAGACTGTTTTTGTACAGGAGAGAAATTAA

XM_004834708.1 Coding sequence

Cep19 centrosomal protein 19kDa, transcript variant X3

Length: 486 bp    Location: 61790001..61783736   Strand: -
>XM_004834708.1
ATGTGCACTGCCAAGAAATGTGGAATTAGATTCCAGCCTCCAGCTATTATCTTAATTTATGAGAATGAAGTCAAGGGGAAGAATCGTCAGCGCATCATGCCAGTCCGAAACTTTTCCAAGTTCTCAGATTGCACCAGAGCTGCTGAACAATTAAAGAATAATCCACGCCACAAGAGTTACCTGGAACAGGTATCCCTGAAGCAGCTAGAGAAGTTGTTTGCTCTTTTACGAGGTCACTTGTGTGGACAGAGTCTGGCAACAACAATGGAACAAATTCAACGGGAAACAACCATTGATCCTGAGGAAGACCTGAACAAACTAGATGACAAGGAGCTTGCCAAAAGGAAGAGCATCATGGATGAACTCTTTGAGAAAAATCAGAAGAAGAAGGATGATCCAGATTTTGTTTATGACATCGAGGTTGAGTTCTCACAGGGCAAGCTACAGTCCTGCGGCTGGGACACAGACTCAGCTGATGAGTTCTGA

XM_004834712.1 Coding sequence

Senp5 SUMO1/sentrin specific peptidase 5, transcript variant X1

Length: 2253 bp    Location: 61891611..61924858   Strand: +
>XM_004834712.1
ATGAAAAAACAGAGGAAAAGTCTACGGAGGAAAGGAATTCACTTCGCCTTTTCTGAGAAATGGAATACAGGGTTTGTAGGCTTTAAGAAATTCTATTTTCACCAACACTTGGGCATTCTGAAAGCTAAGTTAGGAAGGCTAGTTACTTGGAACAGACAGTTGGGGTATTTCCAGTGTAGAAAAAAGGCTCTTGCAATCCAGAAAACATGGATCCAAGATGAAGGCCTGTGTGCTAAGACTAAGTCCAGTGTGGCAACTCCAAATGCTAGCTCTGTGTCCTCTAAAGTGGAAAGAAACAACACTCAGCACTTCATTTCTTCCTCAAGGGGCCTCCTGAGACTCCATACAGAGAAGTCACTGTCCTCGACGAAGAACTCAGACCATGAGTCCTGTGGAGAGAAGACTCTCTTGAAGGCAGTTGCTGGCTTGCCAGCAAATAGTGTTTTAGGTCAGGCCAGCGGTCGCAGACTGAGGAGAGCACCTCATGACTTTCCCATGACGTTCAGTGGGGAGAGCCAGAGTCCAGGAGAGAGTGGCAAGATTGTGGTCACTTTGAGCAACCATAAAAGAAAACGCTTTTGTTATGGTTGCTACCAAGGGCTAGAGTGCCGCAGGAATGGAGGACTCCTGATTCCAAGAAAAGTCCAACTTAACCAACATCGAAGAATAAAAGTGTCTCCTCTTATGATGTATGAGAAGTTATCCATGATAAGATTTCAGTATAGGATTCTCAGATCCCAGCACTTCAGAACAAAAAGCAAAATCTGTAAGCTAAGAAAAGCCCAGCGAAGCTGGGTACAGAAAGTCACTGGAGACCATCAAGAGACCCTTAGGGATAACGTGGAAGGCGGCAGTTGCAACCCATTCCCTTCCCCAGCACCTAGAGATTCCTCTTCCCGGCGTCAGCCGCTCATTCCAGATATGGACAGTGATGTGCTGGCAAAGGGAAAGAACTCTCCCATGCCCGATGGCTGTGCTAAAGGGAGCCTTCGTGTGGGCAAGGGGCCTCGTGTAGATGGCACATTCCCTGACCAGCAGAATGGCGGTGCCACCGACGCCTGGGACCAGACACCTTGTTCCCCTCAGTGGGAGTGCGCAGAGCTGACTGCTGAGTGCCCCTTGTCAGAACATCAAAGTAACATGTTCCCCTCAGAAACTGAGACAGATGCTATGCCTCTGAGTCGGAAGAATGGCACAGGTGCCGTGGGTGATGGCAAGGTAGAGCTGCCTGCGCCTGGAGCCAAGGAAGCCGGGAGTGGCATGGATGGGCCTGTTGCCCGTCAGACTGTGGAGCCTGAGAACTGCGAGATGGAGGAGGAGGGGGCGCTCAAGCAGAACATCCTCAGCTCCAAGCTGCTGGACCACCCGTACTGTAAGAGTCCACTTGAAGCGCCTCGGGAGTGCAGTGAGCCCAAGCTAGAGAGTCCCTTGCGAGGTGGCAAGAACAGTCAGAAGGTGGTGCCCGTGGATGATGAGCAGCTGTCCATCTGCCTTTCTGGATTCTTAGATGAAGTTATGAAAAAGTATGGCAGTTTGGTCCCACTCAGTGAAAAAGATGTCCTTGCAAGATTAAAAGATGTCTTTAATGAAGACTTTTCTAATAGAAAACCATTTATTAATAGGGAAATAACAAACTATCGGGCCAGACATCAAAAATGCAACTTCCGCATCTTCTACAATAAGCACATGCTGGATATGGATGATCTGGCCACGCTGGATGGTCAGAACTGGCTGAATGACCAGGTCATTAATATGTATGGCGAGCTGATAATGGATGCAGTCCCAGATAAAGTTCACTTCTTCAACAGCTTTTTTCATAGACAGCTGGTAACCAAAGGATATAATGGAGTTAAGAGATGGACTAAAAAGGTGGATTTGTTTAAAAAGAGTCTTCTGTTGATTCCTATTCACTTGGAAGTCCACTGGTCTCTCATTACAGTGACACTCTCTAATCGAATTATTTCATTTTATGATTCACAAGGCATTCATTTTAAGTTTTGTGTAGAGAATATAAGAAAGTATTTGCTGACTGAAGCCAGAGAAAAAAACAGACCTGAATTTCTGCAGGGTTGGCAGACTGCTGTTACGAAGTGTATCCCACAACAGAAAAATGACAGTGACTGTGGAGTCTTCGTGCTCCAGTACTGCAAGTGCCTCGCCTTGGAGCAGCCTTTCCAGTTTTCGCAGGAAGACATGCCGCGCGTGCGCAAGCGGATCTACAAGGAGCTGTGTGAGTGCCGGCTCCTGGACTGA

XM_004834713.1 Coding sequence

Senp5 SUMO1/sentrin specific peptidase 5, transcript variant X2

High confidence: 3 potential gene matches
Length: 2253 bp    Location: 61891611..61924858   Strand: +
>XM_004834713.1
ATGAAAAAACAGAGGAAAAGTCTACGGAGGAAAGGAATTCACTTCGCCTTTTCTGAGAAATGGAATACAGGGTTTGTAGGCTTTAAGAAATTCTATTTTCACCAACACTTGGGCATTCTGAAAGCTAAGTTAGGAAGGCTAGTTACTTGGAACAGACAGTTGGGGTATTTCCAGTGTAGAAAAAAGGCTCTTGCAATCCAGAAAACATGGATCCAAGATGAAGGCCTGTGTGCTAAGACTAAGTCCAGTGTGGCAACTCCAAATGCTAGCTCTGTGTCCTCTAAAGTGGAAAGAAACAACACTCAGCACTTCATTTCTTCCTCAAGGGGCCTCCTGAGACTCCATACAGAGAAGTCACTGTCCTCGACGAAGAACTCAGACCATGAGTCCTGTGGAGAGAAGACTCTCTTGAAGGCAGTTGCTGGCTTGCCAGCAAATAGTGTTTTAGGTCAGGCCAGCGGTCGCAGACTGAGGAGAGCACCTCATGACTTTCCCATGACGTTCAGTGGGGAGAGCCAGAGTCCAGGAGAGAGTGGCAAGATTGTGGTCACTTTGAGCAACCATAAAAGAAAACGCTTTTGTTATGGTTGCTACCAAGGGCTAGAGTGCCGCAGGAATGGAGGACTCCTGATTCCAAGAAAAGTCCAACTTAACCAACATCGAAGAATAAAAGTGTCTCCTCTTATGATGTATGAGAAGTTATCCATGATAAGATTTCAGTATAGGATTCTCAGATCCCAGCACTTCAGAACAAAAAGCAAAATCTGTAAGCTAAGAAAAGCCCAGCGAAGCTGGGTACAGAAAGTCACTGGAGACCATCAAGAGACCCTTAGGGATAACGTGGAAGGCGGCAGTTGCAACCCATTCCCTTCCCCAGCACCTAGAGATTCCTCTTCCCGGCGTCAGCCGCTCATTCCAGATATGGACAGTGATGTGCTGGCAAAGGGAAAGAACTCTCCCATGCCCGATGGCTGTGCTAAAGGGAGCCTTCGTGTGGGCAAGGGGCCTCGTGTAGATGGCACATTCCCTGACCAGCAGAATGGCGGTGCCACCGACGCCTGGGACCAGACACCTTGTTCCCCTCAGTGGGAGTGCGCAGAGCTGACTGCTGAGTGCCCCTTGTCAGAACATCAAAGTAACATGTTCCCCTCAGAAACTGAGACAGATGCTATGCCTCTGAGTCGGAAGAATGGCACAGGTGCCGTGGGTGATGGCAAGGTAGAGCTGCCTGCGCCTGGAGCCAAGGAAGCCGGGAGTGGCATGGATGGGCCTGTTGCCCGTCAGACTGTGGAGCCTGAGAACTGCGAGATGGAGGAGGAGGGGGCGCTCAAGCAGAACATCCTCAGCTCCAAGCTGCTGGACCACCCGTACTGTAAGAGTCCACTTGAAGCGCCTCGGGAGTGCAGTGAGCCCAAGCTAGAGAGTCCCTTGCGAGGTGGCAAGAACAGTCAGAAGGTGGTGCCCGTGGATGATGAGCAGCTGTCCATCTGCCTTTCTGGATTCTTAGATGAAGTTATGAAAAAGTATGGCAGTTTGGTCCCACTCAGTGAAAAAGATGTCCTTGCAAGATTAAAAGATGTCTTTAATGAAGACTTTTCTAATAGAAAACCATTTATTAATAGGGAAATAACAAACTATCGGGCCAGACATCAAAAATGCAACTTCCGCATCTTCTACAATAAGCACATGCTGGATATGGATGATCTGGCCACGCTGGATGGTCAGAACTGGCTGAATGACCAGGTCATTAATATGTATGGCGAGCTGATAATGGATGCAGTCCCAGATAAAGTTCACTTCTTCAACAGCTTTTTTCATAGACAGCTGGTAACCAAAGGATATAATGGAGTTAAGAGATGGACTAAAAAGGTGGATTTGTTTAAAAAGAGTCTTCTGTTGATTCCTATTCACTTGGAAGTCCACTGGTCTCTCATTACAGTGACACTCTCTAATCGAATTATTTCATTTTATGATTCACAAGGCATTCATTTTAAGTTTTGTGTAGAGAATATAAGAAAGTATTTGCTGACTGAAGCCAGAGAAAAAAACAGACCTGAATTTCTGCAGGGTTGGCAGACTGCTGTTACGAAGTGTATCCCACAACAGAAAAATGACAGTGACTGTGGAGTCTTCGTGCTCCAGTACTGCAAGTGCCTCGCCTTGGAGCAGCCTTTCCAGTTTTCGCAGGAAGACATGCCGCGCGTGCGCAAGCGGATCTACAAGGAGCTGTGTGAGTGCCGGCTCCTGGACTGA

XM_004834718.1 Coding sequence

Pigz phosphatidylinositol glycan anchor biosynthesis, class Z

High confidence: 3 potential gene matches
Length: 1716 bp    Location: 61956337..61933504   Strand: -
>XM_004834718.1
ATGCCAGACTCTCAGCCCGCTCTCCCCACTGTTCGGCAGCAGCTGAACCCGGAAGTAACAGCCCGGAAGTTCTGGGGAGGCCTCAGCCTGCTCCGCGTGCTGTGGTGCCTGCTCCCGCAGACGGGTTACGTGCACCCTGATGAGTTCTTCCAGTCGCCGGAGGTCATGGCAGAGGACATCCTGGGTGTGCAGGCCACGCGGCCCTGGGAGTTCTATGCCAGCAGCTCCTGCCGCACCGCAGTCTTCCCACTGCTGACTTCTGGCTCTGCCTTCTGGGTACTCCGGCTCTGGGAGGAGCTGGGGCTGTGGCCAGGCCCCGTGAGTGGCTACGCGCTGCTGGTAGGACCCCGGCTTCTCCTCACCGCCCTCTCCTTTGCCCTGGACCGGGCTGTGTACCACCTGGCCCCACTGTGGGGCGCAGATCGCTGGCGTGCCCTGGTCCTGCTGTCCGGGTCCTACGTCACCCTGGTGTTCTATACCAGGACCTTCTCCAATGCCATCGAGGGGCTTCTCTTCACATGGCTGCTGGTGCTGGTATCCCCTCACCTGGCATGGTGCCTCACACCCAAGAAACCTGCCTCAGGCCCATGGTGGCACAGCTGCCTTCTTGGGGCTGTGGTGGCTGCTGGCTTCTTCAACCGGCCCACATTCCTGGCCTTCGCCCTGGTCCCCCTCCTCCTCTGGGGCCAGCGCGGAGCCCGGCAGCCCAGCTTGAAGTCCCTGGCCCAGGAGGGCCTGGCGCTACTCCCTGGGGCAGCCCTTGCCACAGGGGCCTTCGTGGCTGTGGACAGCTGGTACTTCTCCAGCCTCTCCAGGTCTAACAGCCTGGTCTTCACACCTGCCAACTTCCTGCGCTACAACCTGGATCCCCAAAACCTTGCCAGGCACGGCACACATACGCGGCTCACCCACCTGGCCCTCAATGGCTTCCTGCTCTTCGGGGTGCTGCACGCCCAGGCACTGCAGGCCTCATGGCAGCAGCTGCAAGTGGGCCTCCGGGTGTGGGCACAGATGGGCCTTGGGAGGGTGCCGGGCACCCTGAACTTGCTATCCAACCCCCGTGCATCCCTCCTCCTCCTCTACTTCGTGCCCCTGGCCCTGCTGTCTGCCTTCAGCCACCAGGAGGCTCGGTTCCTCATCCCCCTCCTCATCCCCCTAGTCCTGCTGTGCAGCCCACGGACCCACCCTGTGCCCTGGAAGGGCACCCTGGTCCTCTTCAATGCCATCGGTGCCCTCTTCTTCGGCTGCTTGCATCAGGGAGGCCTGGTACCCGGCCTGAGGGTCCTCGAGCAGGTGGTCCATGGCCCCGTGCGCCCAGGCCTGCCGACCCACTACACGCTCCTCTTCACTCGCACCTACATGCCGCCCCAGCACCTCCTGCACCTCCCAGGCTTCGAGTCACCCGTGGAGGTGGTGGACATGGGTGGGACTGAGGACTGGGTCCTGTGCCAAGCTGTGAAGAACTTCACCAGACAGCCGGCTTGCCAGGTGGCCGGTGGGCCATGGCTCTGCCGCCTCTTTGTGGTGATGCCTGGGACCACCAGGCACATCGTGGAGAAGTGCAGCTTCCCTCTCAAGAACCAGACACTCGTGTTTCCCCACCTGACCCTGGAGGACCCACCGAGCCTGTCCTCCCTGCTGAGTGGGGACTGGGGGGACCACCTTAGCTTGCACATCATGGAGCTGGAGGACATGCCTGAGGGTACAACACAGTAG

XM_004835180.1 Coding sequence

Mfi2 antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5

High confidence: 4 potential gene matches
Length: 2271 bp    Location: 61988139..61971634   Strand: -
>XM_004835180.1
ATGGGCCAGTGGGATCCTATAGCGCTACTGAAGCCACCCTCCCTAGCAGCCGTGGGCTGGGTGAGGTCAGGGACCTGGGCCTCACTGTCCCTGTGCTCCCCAGTGCTCAACGGGGAGCAGGTGACGGAGATGCGCTGGTGCACCATCTCGGATGCGGAGCAGCTGAAGTGCAAGGACATGAGCAAGGCCTTCCAGGAAGTGGGCATCCAGCCTTTCATTGCCTGTGTCCAGGGCACCTCGGCCCTCCACTGCACGCAGCTCATCTCGGCCCAGAAGGCCGACGCCGTCACCCTCAATGGAGAAGCCATTTACGAGGCGGGGAAGGAGCACGGCCTCAAGCCCGTGCTGGGCGAGCTGTATGATGCAGAGGTTGGGACCTCCTACTATGCCGTGGCTGTGGTCCGGAAGAACTCCTCTGTGACCGTCAACACCCTGAAGGGCGTGAGGTCCTGCCACACGGGCCTCCATCGGACAGCGGGCTGGAATGTGCCTGTGGGCTTCCTGGTGGGGAGCGGCCGCCTCTCCGTGATGGGCTGTGACATGCTCATGGCTGTCAGCGAGTTTTTTGGGGGCAGCTGCGTCCCTGGTGCAGGAGAGACCAATCACTCGCTGTCCCTGTGCCGCGCCTGCAGGGGTGACGGCTCTGGGAAGAGGGTGTGTGACAGCAGCCCCCTGGAGAGATACTACGGCTACAGCGGGGCCTTCCGGTGCCTGGCAGAAGGGGCAGGGGACGTGGCCTTCGTGAGACACAGCACGGTGCTGGAGAACACAGACGGGAAAACGCTGCCCTCCTGGGACAAGGCTCTGCTGTCACGGGACTTTGAGCTGCTGTGTAGGAACGGCAGCCGTGCCAGTGTCACGGAGTGGCGGCAATGCCACCTGGCCCGGGTGCCCGCAAGCGCCGTGGTGGTCCGGCCTGACATGGATGAAAAACTCCTCTTCCGACTGCTCGGCGAGGGCCAGCTGCTGTTCAACCATGAGGGCAGCCCCTTCCAGATGTTCCGCTCAGAGAGCTACGGCCACAGGGACCTGCTGTTCAAGGATGCCACTGTGGAGCTGGTGCCCATCGGTACGAAGACCTATGAGGCATGGCTGGGCCGCAACTTCCTACACGCCATGAAGGGCCTGCTCTGCGACCCCAACCAGCTACCCCACTTCCTACGCTGGTGCGTGCTGTCCACACCCGAGTTCCGGAAGTGTGGCGACATGGCGATGGCCTTCAACCAGCAGAAGCTCAAGCCGGAAATCCAGTGTGTGTGGGCCAACTCCCCACTGCAGTGCATGACACAGATCCAGGATGGACACATCGACGCTGTGACCCTGAGGGGTGAAGACATTTACACGGCAGGGAAGATGTTTGGGCTGGTCCCAGCAGCCGGGGAGTCTTATACTGAGAACAGTAGCAGCTCGTACTACGCCGTGGCCCTGGTGAGGCGGGACATCTCCTCAGCCTTCAGCCTGAATGAGCTTCGCGGCAAGCGCTCCTGCCACCCCAGTGTGGACAGCCCCGCCGGCTGGACTGTGCCCATGGGCACCCTCGTCTACACGGGCTCCATCCGGCCCCGGGACTGCAATGTGATCCAAGGGATGAGCGAGGTCTTCAATGGCAGCTGTGTGCCCGGGAGCGAGGCCAGGAAATACCCATCCTCACTGTGCGCTATCTGCGAGGGGGATGAAAAAGGTCGAAACAAGTGCGTGGCCAATAGCCAGGAGAGGTATTTCGGCGACAGCGGGGCCTTCAGGTGCCTGACGGAGAAGGCAGGGGACATTGCCTTTGTGAAGCACACGACTGTCTTTGACAACACAAACGGCCACACGACCGAGCCCTGGGCAGCTGGGCTCAGGCACCAGGACTACCAGCTACTGTGCCCCAATGGGGCACGTGCGGAGGTGCACCAGTTCCAAGCCTGCAGCCTGGCCAAGGTCCCGGCCCACGCCGTCATGGTGCGGCCTGACACCAACACCTTTCCTGTGTTCGGACTCCTGGACAAGGCCCAGGAGCTGTACGGAGAGGACAACAATAAGAACGGGTTCCAGATGTTTGACTCCTACAAATACGGAGGCCAAGACCTGCTTTTCCAGGACGTTACAGTCCGGCTGGTTCCTGTCGCGGAGAAGAGCACATACCTCGGGTGGCTGGGGCCTGACTACGTGAGAGCCATGGAGGGGCTCCTGACACCGCCGTGTTCAGGCCCAGTCGCTGTCCCCGGGGTTTCCTGGCTGCTCCTGCTGCCCCTCGTTGCTGGCCTCATCCTCCCAAGCCGCCTCTGA

XM_004834720.1 Coding sequence

Dlg1 discs, large homolog 1 (Drosophila), transcript variant X1

Length: 2817 bp    Location: 62223078..62002280   Strand: -
>XM_004834720.1
ATGCCGGTCCGGAAGCAAGATACCCAGAGGGCGTTGCACCTTTTGGAAGAGTATCGTTCTAAACTAAGCCAAACTGAAGATAGACAGCTAAGAAGTTCCATAGAACGAGTTATTAACATATTTCAGAGCAACCTCTTTCAGGCTTTAATAGATATTCAAGAAT