Details from NCBI annotation

Gene Name Heterocephalus glaber isolate NMR 29 unplaced genomic scaffold, HetGla_female_1.0 scaffold00012, whole genome shotgun sequence

Genome Location

Related Sequences

XR_205075.1 Non-coding sequence

LOC101726220 PREDICTED: Heterocephalus glaber uncharacterized LOC101726220 (LOC101726220), misc_RNA.

Length: 1083 bp     
>XR_205075.1
GGGAGGCAGCAGGGAGGCACACAGCACAGAGCTGGGGTGCGCAGTCCCAGGGGGCTGGAAGGCCCACCCAGCGGATCCCGGAGCTGATCAAGGCCGGCTCCTCCTGGGAGGGGTTGGAGCCGCACTGGGGCAGCCCCATGCCTTCTGCTGTGGCCAGGACTGGCACCCTAAGAAGCAGTAAAGCGGGCAGGCTCTCGCCTCCCTGAACCTCCTCTCCCGGGCAGTGCAGGTGGTGACCGGGACTGGAGCAGCACCCGCGGCTTCTGTGCGAAACAGGGTGAGCAGTCTGAGGGCAAGATCCCAAGGCTGAGGAGGCCATGGAAACCCAGCTTGCTGTGGAGGAAGAGAGAAGCCAATCAACATTGCCTGGTCCCCAGATCTGTTGGGGCCAGTCTCTGAGGACAAGACACAGGACATTTCTGCGAGGGTTCAGTCAGACGATGAGGATGTGAAAATGATGGGAATCAGCCCAGGCCCAGGTCCAGACAGTTGCATAAGAAGGTGTGGTGTGGTTCTTGTCTGTTTCTGCACACCCTGGAGGGTGTGGGACCCCGCTCCGTGGCATAATCAGAACAGAAAGAAGTCTCCCTCCCCTGCTGACCAGTGCCCAACAGACAGCAAAGGCCGCTGCAAGCCTGCTCCTCCCTGCAGGCTGCGGTGTGGGGAGAGCATGCAGATGCATTCTTTATGCTTTAATTTAGCACCTTGCTCGCCCGCCTTGCCTTCCTCAGCACATTAGGCTGCCTCCTCTGACCCACCTGACTAGGAAGTCATCATTCTTTCTTTGAGCATTATTTTCATAAAAAAGAAAACAAAAACAATACAAAAGGCCATTCCAGACAAGCAATTCCCTTGTTTATTGATTTGCCCTGTCAGGTTCTTTTATGCAGACATAAGTTTTATGATAAAACTTCAGCCTTGCCTTTTATGACAATAAATAATGCATTGTGCTTCTTGAGTGCTCATGTTGTGTGGGACCCATGCTGGCTCCTGGCCTCGTAGTTCCAGGCAGGTCCTGTCTGTCCAAGTCACATACTTCCAAAGTTACTATCAGTTTCCTCCCCCTGAAGGTGGTATCAAGAT

XM_004840994.1 Coding sequence

Mtg2 mitochondrial ribosome-associated GTPase 2, transcript variant X1

Length: 1218 bp    Location: 28053478..28070886   Strand: +
>XM_004840994.1
ATGGTGCCTGTGAGGCTCTTCTCAGCAAGCTCTTGGACCAGGTTGGAGGGAGTGATGGGGGCTCCATCCACATGGGCTGGCCTCCCGCTCGGCAGGCTCCTTCCACAGCAGGCTCCACCCAGGCCACTCTCCACGGGCTGTGCAGACTGCACCAAGCATCAGAAACCCCCCGGAAAGAAGCTGCTGTCTGAGAAGAAACTGAAAAAGCATTTTGTGGACCATCGCAGAGTGCTTGTCCGTGGAGGAAGTGGAGGCTCGGGCATGAGCTGTTTCCACAGCGAGCCCCGAAAGGAGTTCGGAGGCCCCGATGGCGGGGATGGTGGCAGTGGTGGCCACGTCGTCCTGAGAGTTGACCCAAAAGTCAAGTCCCTGTCGTCAGTCCTGTCCCACTATCAGGGCTTCAGTGGAGAAGATGGCGGCAGGAAAAACTGCTCCGGACGAGGTGGCGCTGTCCTCTACATCCAGGTCCCCATGGGCACCTTGGTGAAGGAGGGAAGTGAAATCATGGCTGACCTGAGCCGACCAGGCGACGAGTACATTGCGGCACTGGGGGGTGCAGGAGGGAAAGGCAACCGCTTTTTCCTGGCCAACGACAACCGCGCCCCCGTGACTTGCACCCCTGGAGAGCTGGGTCAGGAGCGTGTTCTCCACCTGGAGCTCAAGACGGTGGCCCACGCCGGGATGGTTGGGTTCCCCAATGCTGGGAAGTCCTCCCTCCTCCGAGCCATTTCCAATGCAAAGCCCGCTGTGGCGTCCTACCCGTTCACCACCCTAAATCCCCACGTAGGCATTGTGCACTATGCCGGCCACCAGCAAGTAGCAGTGGCAGACATCCCAGGGATCATCCGAGGTGCCCACCAGAACAGGGGCCTGGGGCTCAGCTTCCTCAGGCACATCGAACGCTGCCTCTTCCTCTTGTTCGTGGTGGACCTTTCCGTCCCAGAGCCATGGACTCAGTTTGAGCATTTAAAATATGAACTGGAGAAGTACAAAGAAGGCCTGTCTGAGAAGCCCCATGCGATTGTTGCAAATAAGATTGATCTGCCACAGGCCAGAGCCATTCTACCCCAGCTCCGGGCCCAGCTGGGACAGGAGGTCATCGCCCTGTCAGCCCTGACTGGGGAGAACCTGGAGCAACTGCTGCTCCACCTGAAAGTCCTCTACGATGCCTACATGGAGGCTGAGCTGGGGAAGGGCTGCCAGCCACTTAGGTGGTAG

XM_004841053.1 Coding sequence

Chrna4 cholinergic receptor, nicotinic, alpha 4 (neuronal), transcript variant X5

Length: 1326 bp    Location: 29035426..29024668   Strand: -
>XM_004841053.1
ATGAAGTTCGGGTCCTGGACCTACGACAAGGCTGAGATCGACCTGGTGAGCATGCACAGCCGGGTGGACCAGCTGGAGTTCTGGGAGAGCGGCGAGTGGGCCATCGTGGATGCCGTGGGCACCTACAACACGCGGAAGTATGAGTGCTGTGCCGAGATCTATCCCGACATCACCTACGCCTTCGTCATCCGGCGCCTGCCACTCTTCTACACCATCAACCTCATCATCCCGTGCCTGCTCATCTCCTGCCTCACCGTGCTGGTCTTCTACCTCCCCTCCGACTGCGGCGAGAAGATCACCCTGTGCATCTCGGTGCTGCTGTCGCTCACCGTCTTCCTGCTCCTCATCACCGAGATCATCCCGTCCACCTCACTGGTCATCCCGCTCATCGGTGAGTACCTGCTCTTCACCATGATCTTCGTCACCCTCTCCATCATCATCACCGTCTTCGTGCTCAACGTGCACCACCGCTGGCCGCACACGCACAGCATGCCTGCCTGGGTGCGCAGGGTTTTCCTGGACATCGTGCCGCGCCTGCTCTTCATGAAGCGGCCGTCCGTGGTCAAGGACAACTGCCGGCGGCTCATCGAGTCCATGCACAAGATGGCCAGCACCCCACGCTTCTGGCCCGAGCCTGAGGGGGAGCCCAGCGTCCTGAGTGGCTCCCGCAGTGGGGGCCCATCTCCCAGCCCATCCTCCTGTGTCCCTGCGGAGCCTCAGCCTTCCTGCAAGTCGGCCTCTGGCCAGGCGCCCACTGTGGAGCCCGCGGGGGCCGAGGAGGCTGGCCCCTGCCCCCTACCCAACAGCTCCAGGGCCTTTGCGACCCCCAAAGCCAGGTCCCTGAGTGTCCAGCACATGTCCAGTCCCCATGAAACAACGGAGGGCGGCATCCGGAGCCGATCTCGGAGTGTCCAGTACTGGGGCCCTCGGGACAGCACTGCCTCCTGGGCTGATGGCTGGGTGGCTGGCTCCCCGGCTTCTCTGAAGGCCCAGTCTGCTGAGCTGCCGCCAGACCAGCCCTCCCCATGCAAGTGCATGTGTAAGAAGGAGCCACCTGTGGTGTCCCCGGTCACTGTGCTCGAGGCCCACAGCACCAAAGTGCCACCCCGGCACCTGCCCCTGTCACCGGCCTTGACCCAGGCGGTGGAGGGCGTCCAGTACATCGCTGATCATCTGAAGGCAGAAGACTCTGATTTCTCGGTGAAGGAGGACTGGAAGTACGTGGCCATGGTCATCGACCGCATCTTCCTCTGGATGTTCATCGTTGTCTGCCTGCTGGGAACCGTGGGCCTGTTCCTGCCACCCTGGCTGGCCGGCATGATCTAA

XM_004840606.1 Coding sequence

Rem1 RAS (RAD and GEM)-like GTP-binding 1

High confidence: 4 potential gene matches
Length: 894 bp    Location: 1007214..997319   Strand: -
>XM_004840606.1
ATGACACTAAACACCCAGCAAGAAGCAAAAACTCCCCTCCGCCGCAGAGCTAGCACTCCACTACCCCTGTCATCGCGGAGCCACCAGCCTGGCCGCCTGTGCACAGCATCCCCAACTCAATCCCAGCATCCCCCACTGGACCAATCAGCCTCCCTCAACCCTCCTGCCCGGAAACCCTCACCTGCCCCAGATAGCTGGTCCTCTGAATCCAGCGACTCTGAAGGCTCCTGGGAGACCCTCTACCGAGTAGTGCTGCTTGGAGACCCTGGTGTAGGGAAGACCAGCCTGGCCAGCCTCTTTGCAGGGAAGCAAGAGCGGGACTTCCATGAACAGCTGGGAGATGTGTATGAGAGGACCCTCACAGTGGACGGAGAGGACACCACACTGGTGGTCATGGACACCTGGGAGGCCGAGAAACTGGACGAAAGCTGGAGCCGGGAGTCCTGCCTGCAAATGGGCAGCGCCTATGTCATCGTGTACTCCATCGCAGACCGCGGCAGCTTTGAGAGCGCCTCAGAGCTCCGCATCCAGCTGCGGCGAGCACACCGGGCAGACCACGTGCCCATCATTCTCGTGGGCAACAAGGCAGACCTGGCCCGCTGCAGGGAAGTCTCCGTGGAAGAGGGCCGCGCCTGTGCTGTGGTGTTCGACTGCAAGTTCATCGAGACGTCAGCAACCCTGCAGCACAACGTGGCCGAGCTCTTCGAGGGCGTGGTGCGCCAGCTACGCCTGCGTCGCCGGGATAGCGCAGCCCAGGAGCCCTCAGCACCGCGACGGAGGCCCAGCTTCGGCCAGCGCGCTCGTCGCTTTTTGGCTCGCCTGACGGCCCGCAGCGCCCGCCGCCGAGCCCTCAAAGCCCGCTCCAAGTCCTGCCACAATCTAGCTGTGCTCTGA

XM_004840595.1 Coding sequence

Foxs1 forkhead box S1

High confidence: 4 potential gene matches
Length: 996 bp    Location: 670992..672339   Strand: +
>XM_004840595.1
ATGCAGCAGCCACCACCACCACCAGGGCCACTGGTCCCTGCGACAGAGCCCACCAAGCCCCCGTACAGCTACATAGCCCTGATCGCCATGGCCATCCAGAGCTCGCCAGGGCAAAGGGCCACCCTCAGTGGCATCTACCACTACATCATGGGCCGCTTTGCCTTCTACCGCCACAACCGGCCCGGCTGGCAAAACAGCATTCGCCACAACCTGTCTCTCAACGAGTGCTTTGTCAAGGTGCCCCGGGATGATCGAAAGCCAGGCAAGGGCAGCTACTGGACCCTGGACCCTGACTGCCACGACATGTTCCAGCACGGCAGCTTCCTCCGTCGCCGCCGCCGCTTCACCCGGCGGGCAGGTGCTGAGGGCACCAAGGGCTCTGCAAAGGCACCCCGTGGGCCCCTCAGAACCGCCAACCAGGACACAGGAGTTCCCGATGCTACGACTGGCAGGCAGAGCCCATTCCCACCAGAGCTGCCCGAGCCCAAGGGCCTAAGCTTTGGGGGTCTGATGGGGGCTCTACCAGCCAGCATGTGCCCAGCAACTGCTGACAAAAGGCCACAGCCACCCGTGGAGCCCAAAGAGATGCCCACGCCTAAGCCTGCAGGCCCTGAAGAGCTCCCCATGGCCACCTCGTCTTCTCCGTGCCCGGCATTTGGCTTTCCTGCTGGCTTCTCCGAGGCAGAGGGTTTTAGCAAGGTCCCTACACCCACAGCGACCCCGGAGGCGGGCATCAGCAGCAGCTACCAGTGTCGGCTGCAGGCACTGAATTTCTGCATGGGGGCTGACACAGGCCTGGAGCACCTCTTGGCCTCGGCAGCCCCCTCCCCTGCACCACCCACCCCTCCGGCCTCCCTCCGGGCCCCATTACCCCTGCCAGCTGACCCCAAGGAACCGTGGGCTGCAGGGGGCTTCCCTGTCCAGGGAGGCTCCGGCTACCCACTGGGGCTGCCCTCCTGCCTATACCGGACACCAAGAGTGTTCTTCTTTGAGTGA

XR_205078.1 Non-coding sequence

Kcnq2 PREDICTED: Heterocephalus glaber potassium voltage-gated channel, KQT-like subfamily, member 2 (Kcnq2), transcript variant X19, misc_RNA.

Length: 2917 bp     
>XR_205078.1
GTCCGCTGAGCCCGCGCCCGGCCAGGCGCTGCCCGGCACCATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGGTCAGTCCCTCCTGCCTCCAGCTGCTTTGGTGTGTCTGCCTTGTGGACACCCTTCGGTCCTGCTCCTCTGTGTGCCCACTGCGAGTCGTGGGGTGAGGGCTGCTATGCGGGCCCCGTGCGTGCTTCCGTGTGTGCGCGTGTGCCTGTGTTCACAGCCTCCTCCCAGGGCTTTGGGCTCACTGGGCAGCACTGCCGGTTGGGCCGCTGGGGGCTTCGTGGGTGGGCCCCTCTGCCCGTACCTCCAACCTCCCCGGAGACGCTGAGGCTGGAGAGTTCCCGCACAGGACCTGGGTTTACAGCTAGTCTGAGTGGAGCCCCCCTCCGGCCATTCGGGGCTGGGCCAGGAGGGCCCTCAGTCTCTGGGTCACCTGTCCTGGGTGTCGGACGCCCTCTCCCCATCTCATAGGCCCCGGTGGGGCCTGACTTCACTCTGTTCCCTCTGCTGAGGTTGAGGCAGCCTGAGGGCATCCAGGGGCTTCAGCTGGGTCCTCTCCCTGCTCTCTGCTGGCCCCAGGAGGCTGTGTGTTCAGGCAAGTTAGAAGGCTCATGGGGCCAGCTCTGCTTTGGGACGGAAGGGCAGGAGCCAGCTGCTGCTTTCCTAGTGATGAAAAGAAAATCCAACTCATTTCACAAACGTCAGGCTGAATGAGCTCCAGCCACTGTGCATCCTTGCTGAGTTCTCAAGCTCCTCTGAGTGAGGGTCTCCCGGTCCAGTGCCTGTGCATTTGCTGCAGAGTAAACCTGAACCGGTCTGAGTTAGACATCTGACCGTCTCCCTCATGCCCTTCTGGACTATAGGGTGACCCAGCTAGCAGGTGGGGTCCGTTCAAGAAGGACTTGATCCTTCACCCGTCAAATCCACGAAAGGGTAATAATAGCCAGAGCCCTGAATTGAAAGTATCAGCAACGTCTCTGCCCCAAATCAGCTGAAGGAACAACCACTGACTGAAAACTCCTCAAAGAGGATAAGAAAACTAATTGTGGAGCTTTGGAGAGGTCATCCCAGTGCTGGCCAGTGTGCGACCTAGTGTCGCCGGTGACCAGATGAGGAAAGGAGAGAGCCAGCCCCACCTGGCCCTGGTGAAAGGGTGGGGTGCTCAGCCCCACGGTCAGGGGTTATCCGTAACGAGGGCACCCCATTTCTCACTGTCGCCATCTGTGTGGCTGCCCTCCCTGGCCCCAGTGCCCGGCAGTGGCCAGTGGAGCCCTGTGCCCCCTTGGCCAGGAATGCTGGTGCTGAGCGCCGATCTGCCCAGTGGGCCTGGGGTCCTGTCCACTGCATCTCCTGCCACCCAGCACCAGGCCCTCCTGTGAGCATTTGGCCCCAAGGCCCCTGGCCCCTTGCGGTTTCTCGGGCTTGTTGCCTTAGCTCAGCCTCCTCTTCGTGATTCTCTCTCAGCCTCTCTCTCTCTCCCTCTCCTGCCCCCATTAAGTGCTTTTAATCACTGTCACTGCCCTTCTCGGGCCCTTTCTCGTCTGCTCTGTCTTTTGGGATGAGGTGCTGACCCTGAAGGCAGGACTCGAGGTGAGGACCCCTGGGAGCCCCAGCTCTCTGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCG

XR_205081.1 Non-coding sequence

Kcnq2 PREDICTED: Heterocephalus glaber potassium voltage-gated channel, KQT-like subfamily, member 2 (Kcnq2), transcript variant X22, misc_RNA.

Length: 2879 bp     
>XR_205081.1
GTCCGCTGAGCCCGCGCCCGGCCAGGCGCTGCCCGGCACCATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGGTCAGTCCCTCCTGCCTCCAGCTGCTTTGGTGTGTCTGCCTTGTGGACACCCTTCGGTCCTGCTCCTCTGTGTGCCCACTGCGAGTCGTGGGGTGAGGGCTGCTATGCGGGCCCCGTGCGTGCTTCCGTGTGTGCGCGTGTGCCTGTGTTCACAGCCTCCTCCCAGGGCTTTGGGCTCACTGGGCAGCACTGCCGGTTGGGCCGCTGGGGGCTTCGTGGGTGGGCCCCTCTGCCCGTACCTCCAACCTCCCCGGAGACGCTGAGGCTGGAGAGTTCCCGCACAGGACCTGGGTTTACAGCTAGTCTGAGTGGAGCCCCCCTCCGGCCATTCGGGGCTGGGCCAGGAGGGCCCTCAGTCTCTGGGTCACCTGTCCTGGGTGTCGGACGCCCTCTCCCCATCTCATAGGCCCCGGTGGGGCCTGACTTCACTCTGTTCCCTCTGCTGAGGTTGAGGCAGCCTGAGGGCATCCAGGGGCTTCAGCTGGGTCCTCTCCCTGCTCTCTGCTGGCCCCAGGAGGCTGTGTGTTCAGGCAAGTTAGAAGGCTCATGGGGCCAGCTCTGCTTTGGGACGGAAGGGCAGGAGCCAGCTGCTGCTTTCCTAGTGATGAAAAGAAAATCCAACTCATTTCACAAACGTCAGGCTGAATGAGCTCCAGCCACTGTGCATCCTTGCTGAGTTCTCAAGCTCCTCTGAGTGAGGGTCTCCCGGTCCAGTGCCTGTGCATTTGCTGCAGAGTAAACCTGAACCGGTCTGAGTTAGACATCTGACCGTCTCCCTCATGCCCTTCTGGACTATAGGGTGACCCAGCTAGCAGGTGGGGTCCGTTCAAGAAGGACTTGATCCTTCACCCGTCAAATCCACGAAAGGGTAATAATAGCCAGAGCCCTGAATTGAAAGTATCAGCAACGTCTCTGCCCCAAATCAGCTGAAGGAACAACCACTGACTGAAAACTCCTCAAAGAGGATAAGAAAACTAATTGTGGAGCTTTGGAGAGGTCATCCCAGTGCTGGCCAGTGTGCGACCTAGTGTCGCCGGTGACCAGATGAGGAAAGGAGAGAGCCAGCCCCACCTGGCCCTGGTGAAAGGGTGGGGTGCTCAGCCCCACGGTCAGGGGTTATCCGTAACGAGGGCACCCCATTTCTCACTGTCGCCATCTGTGTGGCTGCCCTCCCTGGCCCCAGTGCCCGGCAGTGGCCAGTGGAGCCCTGTGCCCCCTTGGCCAGGAATGCTGGTGCTGAGCGCCGATCTGCCCAGTGGGCCTGGGGTCCTGTCCACTGCATCTCCTGCCACCCAGCACCAGGCCCTCCTGTGAGCATTTGGCCCCAAGGCCCCTGGCCCCTTGCGGTTTCTCGGGCTTGTTGCCTTAGCTCAGCCTCCTCTTCGTGATTCTCTCTCAGCCTCTCTCTCTCTCCCTCTCCTGCCCCCATTAAGTGCTTTTAATCACTGTCACTGCCCTTCTCGGGCCCTTTCTCGTCTGCTCTGTCTTTTGGGATGAGGTGCTGACCCTGAAGGCAGGACTCGAGTAAAGGCAGACCGTGCCGAGGGTGCCTGTGTGGATGCTGCCCCGGA

XR_205079.1 Non-coding sequence

Kcnq2 PREDICTED: Heterocephalus glaber potassium voltage-gated channel, KQT-like subfamily, member 2 (Kcnq2), transcript variant X20, misc_RNA.

Length: 2909 bp     
>XR_205079.1
GTCCGCTGAGCCCGCGCCCGGCCAGGCGCTGCCCGGCACCATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGGTCAGTCCCTCCTGCCTCCAGCTGCTTTGGTGTGTCTGCCTTGTGGACACCCTTCGGTCCTGCTCCTCTGTGTGCCCACTGCGAGTCGTGGGGTGAGGGCTGCTATGCGGGCCCCGTGCGTGCTTCCGTGTGTGCGCGTGTGCCTGTGTTCACAGCCTCCTCCCAGGGCTTTGGGCTCACTGGGCAGCACTGCCGGTTGGGCCGCTGGGGGCTTCGTGGGTGGGCCCCTCTGCCCGTACCTCCAACCTCCCCGGAGACGCTGAGGCTGGAGAGTTCCCGCACAGGACCTGGGTTTACAGCTAGTCTGAGTGGAGCCCCCCTCCGGCCATTCGGGGCTGGGCCAGGAGGGCCCTCAGTCTCTGGGTCACCTGTCCTGGGTGTCGGACGCCCTCTCCCCATCTCATAGGCCCCGGTGGGGCCTGACTTCACTCTGTTCCCTCTGCTGAGGTTGAGGCAGCCTGAGGGCATCCAGGGGCTTCAGCTGGGTCCTCTCCCTGCTCTCTGCTGGCCCCAGGAGGCTGTGTGTTCAGGCAAGTTAGAAGGCTCATGGGGCCAGCTCTGCTTTGGGACGGAAGGGCAGGAGCCAGCTGCTGCTTTCCTAGTGATGAAAAGAAAATCCAACTCATTTCACAAACGTCAGGCTGAATGAGCTCCAGCCACTGTGCATCCTTGCTGAGTTCTCAAGCTCCTCTGAGTGAGGGTCTCCCGGTCCAGTGCCTGTGCATTTGCTGCAGAGTAAACCTGAACCGGTCTGAGTTAGACATCTGACCGTCTCCCTCATGCCCTTCTGGACTATAGGGTGACCCAGCTAGCAGGTGGGGTCCGTTCAAGAAGGACTTGATCCTTCACCCGTCAAATCCACGAAAGGGTAATAATAGCCAGAGCCCTGAATTGAAAGTATCAGCAACGTCTCTGCCCCAAATCAGCTGAAGGAACAACCACTGACTGAAAACTCCTCAAAGAGGATAAGAAAACTAATTGTGGAGCTTTGGAGAGGTCATCCCAGTGCTGGCCAGTGTGCGACCTAGTGTCGCCGGTGACCAGATGAGGAAAGGAGAGAGCCAGCCCCACCTGGCCCTGGTGAAAGGGTGGGGTGCTCAGCCCCACGGTCAGGGGTTATCCGTAACGAGGGCACCCCATTTCTCACTGTCGCCATCTGTGTGGCTGCCCTCCCTGGCCCCAGTGCCCGGCAGTGGCCAGTGGAGCCCTGTGCCCCCTTGGCCAGGAATGCTGGTGCTGAGCGCCGATCTGCCCAGTGGGCCTGGGGTCCTGTCCACTGCATCTCCTGCCACCCAGCACCAGGCCCTCCTGTGAGCATTTGGCCCCAAGGCCCCTGGCCCCTTGCGGTTTCTCGGGCTTGTTGCCTTAGCTCAGCCTCCTCTTCGTGATTCTCTCTCAGCCTCTCTCTCTCTCCCTCTCCTGCCCCCATTAAGTGCTTTTAATCACTGTCACTGCCCTTCTCGGGCCCTTTCTCGTCTGCTCTGTCTTTTGGGATGAGGTGCTGACCCTGAAGGCAGGACTCGAGGTGAGGACCCCTGGGAGCCCCAGCTCTCTGTAAAGGCAGACCGTGCCGAGGGTGCCTGTGTGGATGCTGCCCCGGA

XM_004841173.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1434 bp    Location: 29203757..29195104   Strand: -
>XM_004841173.1
ATGGGCCTCCGGCGGCACCGCAGCCTGACGCCCGCCTGGGGCGTGGAGCCCTTCCTCAGGAGGCGCCTGCGTNGTCTGTCCTTTTGGGACAAGATCTGGCCGGCGGAGGAGCCAGAGGACGACGTCCCGGCGGCGCCGGGCCCCGACGCTGAGCCGCGAGCGCAGCTCTTCCGCGCGCTCCGCGACTTCGCGGCTCGCTGCCGCGGGGACCGGGAGGCGAACTGCGTCTTCGCCCGCGGGCTCTCCGGCCGACCCAGCGCCGGGCTGGTGCCCATCACCTACGCGGCCGCGGCTGCTCCGGAGACGCTTGCAGAGCAGCCCCGGTACTTGAGTGGGATCAGCCGGTCCCACGCCCAGCAGCTCCTCTTGTGCCCTGCCAGCGAACCAGGGGCCTTCCTTAACCGGCCCAGAGAGAGCAGCCTCGGGGGCTTCTCACTCTCAGTCCGAGCCAAGGCCAAAGTCTGCCACTACCGAATTTGTACAGCGCCCGGCAGCAGCCTCTACCTACAGGAGGGCCAGCGCTTCCCCAGTCTGGAGGAGCTGCACGCCTACTACAAGGCCAACTGGAAGCTGACCTAGAACCCCCTGCTGCAGCCCTGTGTGCCCCAGAAGCCCCCGGCACAGGACAAGTGGGAGCGGCCACGCTCGGAATTTGTCCTCTGGAGGAAGTTGGGTGAAGGCTGCTTTGGGGAGGTGTGGGAAGGCCTGTGGCTGGGCTCTGTGCCTCTAGTGGTCAACGTCATCAAGCCAGCTGACATGAAGCTGGCCGAATTCACCAAGGAGATCGCGGCTCTGAAGAGCCTGCGGCATGAGCGGCTCATGTGGCTGCATGTGGTGTGCTCCACAGGGGAGCCCGTGTATATCATCACTGAGGTCCTGTGCAAGGGCAGCCTGCAGGCGTACCTGGGCAGTGAGCCCCGAGGGCCAGCACTGAGCCTGCCACTCCTGCTGAGCTTCACTTGCCAGGTGGCCGAGGCCATGAGCTACTTGGAGGAGTGGCACATCGTCCACCGAGACCTGGCCGCCAGGAATGTGCTCGTGGGCAATGACCTCACCTTTGGCCTGGCCCGGCTCCTAAAGGATGACATCTACTCCCCAAGCAGCAGCTCCAAGATCCCTGTCAAGTGGACGGCACCTGAGGCAGCCAATTACCACATTTTCTCGCACAAGTCTGATGTCTGGTCCTTCGGCATCCTGCTGTACGAGGTCTTCACCTATGGCCAGTGTCCCTTTGAAGGTGTGATGACCAATCATGAGACTCTGTGGCAGCTCAGCTGTGGGTACCAGCTGCCCTGCCCAGCTGCCTGCCCAGTGGAAGTGTACCTGCTCCTTTTGGAGTGCTGGAAGGGCAGCCCTGAGGAGCGGCCTGCCTTTGCCATGCTGCGAGAGAAGCTGGGCACTGTCCACAGGCACCTGCACCTGGGCCTCACGTGA

XM_004841091.1 Coding sequence

Arfrp1 ADP-ribosylation factor related protein 1, transcript variant X1

Length: 606 bp    Location: 29355836..29346667   Strand: -
>XM_004841091.1
ATGTACACACTGCTGTCGGGGCTGTACAAGTATATGTTCCAGAAGGATGAGTACTGCATCCTGATCCTGGGCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCAAAAACCCGGTTTAACAAGAACTACAAGGGGATGAATCTGTCTAAAATCACCACCACCGTGGGTCTAAACATTGGCACTGTGGACATAGGAAAGGCTCGCCTCATGTTCTGGGACTTAGGGGGACAGGAGGAGCTGCAGTCTTTGTGGGATAAGTACTATGCGGAGTGCCATGGCGTCATCTATGTCATTGACTCTACTGATGAAGAGAGACTGTCAGAGTCCAAGCAGGCATTTGAGAAGGTGGTTTCCAGTGAGGCTCTTGATGGTGTCCCCATCCTGGTGCTGGCCAACAAGCAGGATGTGGAGACGTGCCTCTCCATCCCTGACATCAAGACTGCGTTCAGCGACTGCAGCTATAAGATCGGCAGGCGAGACTGTCTGACCCAGGCCTGCTCTGCCCTCACAGGCAAAGGAGTACGTGAGGGCATTGAATGGATGGTGAAGTGCGTCGTGCGGAACATCCACCGGCCACCCCGGCAGAGGGACATCACGTAG

XM_004841086.1 Coding sequence

Lime1 Lck interacting transmembrane adaptor 1, transcript variant X1

Length: 978 bp    Location: 29390640..29393459   Strand: +
>XM_004841086.1
ATGGGGCCGCCAGTGCCTGTGGCCCTGCCAGCCATCTGGGTGCTAGGGTGTTTCTCTCTGCTCCTCTGGCTGTGGGCGTTGTGCACAGCCTGCCACAGGAAGCAGGTGCAGAGCCAGCAGGCAAGACTGCAGGACACTGTGATGCTGGCAGAAACGTCCCTGCTGAGACAGACTCATCTCTGCCCCCTCAGCAAGTCTGACACCAGGCTGCATGAGCTGCACCGCGGTACCCATGGCAGCAAAGGTGAGGTGACTACCAGAAGGACACATGGGGAGTGGCTGGCTGCAGCTTGGGACCACACCTGCTGTCCACCCCTAATGGCCTCTGGCCTGACCTTACCCATAGCCCTGAGGCCTGCCAGCATGGATCTCCTGCACCCACACTGGCTAGAAGTTTCCAGGGGTAGCGCCAGACCACTGGCAGCCCCCTCTGCCTTCCCACGTCAGCAGCTGCCGGGGCCCCCATCTGCGACTGCCTTCACACTGTCCACTGGTCCTGAGGCCACCTATTCTAATGTGGGGCTGGCTGCCATCCCTAGAGCTAGCCTGGCTGCCAGCCCTGTGGTATGGGCAGGGACACGGCTGACCACTGGCTGTGACAGGCCAGGGCACTGGGCCAGACCTGTACTGGCTGAGTATGCCTCCATCCAGAAGCTCAGAGGGTCAGATCCGGGCCCCCAAGAACTGCAGCAAGGGAAGACTGAGGTGACCCCAGCTGCTCAGGTGGACATCCTGTACTCCAGGGTCTGCAAGCCTAGAAACAGGGACGCAGGGCCCGCCACAGACCCACCGGGCCGTGAGGGCACAGGAGCAGTTCTGACCCTGGAGACTGGCTTAACCTATGAACCGCTCCCTCCTAGGGGCCTGGACATGGACAGCAATCCCCTGGAAAATGTGTATGAAAGCATCCAGGATGTGGGGACCCCTGAAAGTCCAGAGCCCTCCATTCTGCCTATTAGCATAAGCGGACATATGTAG

XM_004841102.1 Coding sequence

Tpd52l2 tumor protein D52-like 2, transcript variant X5

Length: 621 bp    Location: 29492121..29511410   Strand: +
>XM_004841102.1
ATGGACACCGCCGGCCAAGGTGTAGCTGCCCAGTCTCCTGCTGTTGAGGGTCTGACGGAGACAGAAGAGGAGGAGCTCAGGGCCGAGCTTGCCAAGGTAGAAGAAGAAATCATCACCCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGAGAGCTGAAAAGGAGGCTGGGCCTGTCTGCCTTGGGGGAGCTGAAACAGAACCTGTCTAAGAGCTGGCATGATGTGCAGGTCTCTAATGCCTATGTGAAAACTTCTGAGAAACTTGGAGAGTGGAATGAGAAAGTGACCCAGTCCGACCTCTACAAGAAGACCCAGGAAACTCTCTCTCAAGCAGGCCAGAAGACATCTGCGGCCTTGTCTACCATGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGGGCTCATCCATTCTCACACTCCTTTAGCAGCTACTCCATCCGTCACTCGATAAGTATGCCAGTCATGAGGAACTCTGCCACCTTCAAGTCGTTTGAAGATCGTGTGGGGACCATAAAGTCTAAGGTTGTGGGTGGCAGAGAGAATGGCAGTGACAGCCTCCCCTCCCCAGCGGGGAGTGCTGACCAGCCCCTGCCAGGTCATGCGCCTTTCTAA

XM_004841098.1 Coding sequence

Tpd52l2 tumor protein D52-like 2, transcript variant X1

Length: 690 bp    Location: 29492122..29511410   Strand: +
>XM_004841098.1
ATGGACACCGCCGGCCAAGATATCAACCTGAATTCTCCTAACAAAGGTCAGCTACCTGACTTCATGATTGATGTCCCTGTTGACCCAGGTGTAGCTGCCCAGTCTCCTGCTGTTGAGGGTCTGACGGAGACAGAAGAGGAGGAGCTCAGGGCCGAGCTTGCCAAGGTAGAAGAAGAAATCATCACCCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGAGAGCTGAAAAGGAGGCTGGGCCTGTCTGCCTTGGGGGAGCTGAAACAGAACCTGTCTAAGAGCTGGCATGATGTGCAGGTCTCTAATGCCTATGTGAAAACTTCTGAGAAACTTGGAGAGTGGAATGAGAAAGTGACCCAGTCCGACCTCTACAAGAAGACCCAGGAAACTCTCTCTCAAGCAGGCCAGAAGACATCTGCGGCCTTGTCTACCATGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGGGCTCATCCATTCTCACACTCCTTTAGCAGCTACTCCATCCGTCACTCGATAAGTATGCCAGTCATGAGGAACTCTGCCACCTTCAAGTCGTTTGAAGATCGTGTGGGGACCATAAAGTCTAAGGTTGTGGGTGGCAGAGAGAATGGCAGTGACAGCCTCCCCTCCCCAGCGGGGAGTGCTGACCAGCCCCTGCCAGGTCATGCGCCTTTCTAA

XM_004841105.1 Coding sequence

Tpd52l2 tumor protein D52-like 2, transcript variant X8

Length: 546 bp    Location: 29492122..29511410   Strand: +
>XM_004841105.1
ATGGACACCGCCGGCCAAGATATCAACCTGAATTCTCCTAACAAAGGTCAGCTACCTGACTTCATGATTGATGTCCCTGTTGACCCAGGTGTAGAAGAAGAAATCATCACCCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGAGAGCTGAAAAGGAGGCTGGGCCTGTCTGCCTTGGGGGAGCTGAAACAGAACCTGTCTAAGAGCTGGCATGATGTGCAGGTCTCTAATGCCTATGTGAAAACTTCTGAGAAACTTGGAGAGTGGAATGAGAAAGTGACCCAGTCCGACCTCTACAAGAAGACCCAGGAAACTCTCTCTCAAGCAGGCCAGAAGACATCTGCGGCCTTGTCTACCATGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGGAACTCTGCCACCTTCAAGTCGTTTGAAGATCGTGTGGGGACCATAAAGTCTAAGGTTGTGGGTGGCAGAGAGAATGGCAGTGACAGCCTCCCCTCCCCAGCGGGGAGTGCTGACCAGCCCCTGCCAGGTCATGCGCCTTTCTAA

XM_004841100.1 Coding sequence

Tpd52l2 tumor protein D52-like 2, transcript variant X3

Length: 630 bp    Location: 29492125..29511410   Strand: +
>XM_004841100.1
ATGGACACCGCCGGCCAAGATATCAACCTGAATTCTCCTAACAAAGGTCAGCTACCTGACTTCATGATTGATGTCCCTGTTGACCCAGGTGTAGCTGCCCAGTCTCCTGCTGTTGAGGGTCTGACGGAGACAGAAGAGGAGGAGCTCAGGGCCGAGCTTGCCAAGGTAGAAGAAGAAATCATCACCCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGAGAGCTGAAAAGGAGGCTGGGCCTGTCTGCCTTGGGGGAGCTGAAACAGAACCTGTCTAAGAGCTGGCATGATGTGCAGGTCTCTAATGCCTACAAGAAGACCCAGGAAACTCTCTCTCAAGCAGGCCAGAAGACATCTGCGGCCTTGTCTACCATGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGGGCTCATCCATTCTCACACTCCTTTAGCAGCTACTCCATCCGTCACTCGATAAGTATGCCAGTCATGAGGAACTCTGCCACCTTCAAGTCGTTTGAAGATCGTGTGGGGACCATAAAGTCTAAGGTTGTGGGTGGCAGAGAGAATGGCAGTGACAGCCTCCCCTCCCCAGCGGGGAGTGCTGACCAGCCCCTGCCAGGTCATGCGCCTTTCTAA

XM_004841106.1 Coding sequence

Tpd52l2 tumor protein D52-like 2, transcript variant X9

Length: 492 bp    Location: 29492128..29511410   Strand: +
>XM_004841106.1
ATGGACACCGCCGGCCAAGGTGTAGCTGCCCAGTCTCCTGCTGTTGAGGGTCTGACGGAGACAGAAGAGGAGGAGCTCAGGGCCGAGCTTGCCAAGGTAGAAGAAGAAATCATCACCCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGAGAGCTGAAAAGGAGGCTGGGCCTGTCTGCCTTGGGGGAGCTGAAACAGAACCTGTCTAAGAGCTGGCATGATGTGCAGGTCTCTAATGCCTACAAGAAGACCCAGGAAACTCTCTCTCAAGCAGGCCAGAAGACATCTGCGGCCTTGTCTACCATGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGGAACTCTGCCACCTTCAAGTCGTTTGAAGATCGTGTGGGGACCATAAAGTCTAAGGTTGTGGGTGGCAGAGAGAATGGCAGTGACAGCCTCCCCTCCCCAGCGGGGAGTGCTGACCAGCCCCTGCCAGGTCATGCGCCTTTCTAA

XM_004841104.1 Coding sequence

Tpd52l2 tumor protein D52-like 2, transcript variant X7

Length: 561 bp    Location: 29492129..29511410   Strand: +
>XM_004841104.1
ATGGACACCGCCGGCCAAGATATCAACCTGAATTCTCCTAACAAAGGTCAGCTACCTGACTTCATGATTGATGTCCCTGTTGACCCAGGTGTAGCTGCCCAGTCTCCTGCTGTTGAGGGTCTGACGGAGACAGAAGAGGAGGAGCTCAGGGCCGAGCTTGCCAAGGTAGAAGAAGAAATCATCACCCTGCGCCAGGTCCTGGCAGCCAAGGAGAGGCACTGTGGAGAGCTGAAAAGGAGGCTGGGCCTGTCTGCCTTGGGGGAGCTGAAACAGAACCTGTCTAAGAGCTGGCATGATGTGCAGGTCTCTAATGCCTACAAGAAGACCCAGGAAACTCTCTCTCAAGCAGGCCAGAAGACATCTGCGGCCTTGTCTACCATGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGGAACTCTGCCACCTTCAAGTCGTTTGAAGATCGTGTGGGGACCATAAAGTCTAAGGTTGTGGGTGGCAGAGAGAATGGCAGTGACAGCCTCCCCTCCCCAGCGGGGAGTGCTGACCAGCCCCTGCCAGGTCATGCGCCTTTCTAA

XM_004841108.1 Coding sequence

Dnajc5 DnaJ (Hsp40) homolog, subfamily C, member 5

Length: 615 bp    Location: 29515295..29562619   Strand: +
>XM_004841108.1
ATGGCAGACCAGAGGCAGCGCTCACTTTCTACCTCCGGAGAATCGCTATACCATGTTCTCGGGCTGGACAAGAATGCAACTTCAGATGACATTAAAAAATCCTATCGGAAGCTTGCCCTGAAGTATCACCCAGACAAGAACCCTGATAACCCAGAGGCTGCAGACAAGTTTAAGGAGATCAACAACGCCCACGCCATCCTGACGGATGCCACAAAAAGGAACATCTATGACAAGTACGGCTCTCTGGGGCTCTATGTGGCCGAGCAGTTCGGGGAAGAGAACGTCAACACCTACTTCGTGCTCTCCAGCTGGTGGGCCAAGGCCCTGTTTGTCTTCTGCGGCCTCCTCACCTGCTGCTACTGCTGCTGTTGCCTGTGCTGCTGCTTCAACTGCTGCTGCGGGAAGTGTAAGCCGAAGGCTCCTGAGGGTGAAGAGACCGAGTTCTACGTGTCCCCTGAGGACCTGGAGGCACAGCTGCAGTCTGATGAGAGGGAGGCCACAGATACACCAATCGTCATACAGCCAGCGTCCGCCACAGAGACCACCCAGCTCACGGCTGACTCCCACCCCAGTTACCACACTGACGGGTTCAACTAAGTTCAGGAAAAGCTGTGA

XM_004841121.1 Coding sequence

Samd10 sterile alpha motif domain containing 10, transcript variant X1

Length: 615 bp    Location: 29599799..29595493   Strand: -
>XM_004841121.1
ATGTTCACCGAGCTGAGGGCCAAGCTGAGCCCCCCGCCGGGCCGCGCCGGGGCAGTGCACTACGGCCTCGGGGAGAGCCGGGATGTGGACGCCACTGCCCACTTCAGCTTCTGCCGGACCCTCCTGGAGCACACAGTGTCGGCTGAGAGCATCCCTTGCCACTTGCCTCGGATGCCGGGTTCCAGCTTCACATGGCACGACCCCCGTAGCCAGAGAGGATCCAGCAGCAGGCCCGTCAAGCTCCTGCAGCAGCCCGGCACAGAGACCCCCCAGGGCCAGCTGTACTCTGAGCACTGTGGCCTGTACCACACGAGCCCCTCTCTGGGTGGGCTGGCACGGCCTGCAGTCCTGTGGAGCCAGCAGGATGTCTGCAAGTGGCTCAAGAGACACTGTCCCCACAACTACCTCGTCTACGTCGAGGCCTTCTCCCAACACGCTATCACTGGCCGGGCTCTGCTGAGGCTGAATGCAGAGAAGCTGCAGCGGATGGGGCTGGCACAGGAGGCCCAGAGGCAGGAGGTGCTACAGCAGGTGCTCCGCCTGCAGCTTCCTTTGGAAATATGTCCTAGCTGCTGCCAAGGCTTGAACCCCAGACCCCAGCACTGTGACCAGTGA

XM_004841122.1 Coding sequence

Samd10 sterile alpha motif domain containing 10, transcript variant X2

Length: 609 bp    Location: 29599799..29595493   Strand: -
>XM_004841122.1
ATGTTCACCGAGCTGAGGGCCAAGCTGAGCCCCCCGCCGGGCCGCGCCGGGGCAGTGCACTACGGCCTCGGGGAGAGCCGGGATGTGGACGCCACTGCCCACTTCAGCTTCTGCCGGACCCTCCTGGAGCACACAGTGTCGGCTGAGAGCATCCCTTGCCACTTGCCTCGGATGCCGGGTTCCAGCTTCACATGGCACGACCCCCGTAGCCAGAGAGGATCCAGCAGCAGGCCCGTCAAGCTCCTGCAGCAGCCCGGCACAGAGACCCCCCAGGGCCAGCTGTACTCTGAGCACTGTGGCCTGTACCACACGAGCCCCTCTCTGGGTGGGCTGGCACGGCCTGCAGTCCTGTGGAGCCAGCAGGATGTCTGCAAGTGGCTCAAGAGACACTGTCCCCACAACTACCTCGTCTACGTCGAGGCCTTCTCCCAACACGCTATCACTGGCCGGGCTCTGCTGAGGCTGAATGCAGAGAAGCTGCAGCGGATGGGGCTGGCACAGGAGGCCCAGAGGCAGGAGGTGCTACAGCAGGTGCTCCGCCTGCAGGTGCGTGAGGAGGGGCGGAGCCTGCAGCTGCTCAGCCAAGCTTCCTTTGGAAATATGTCCTAG

XM_004841129.1 Coding sequence

Tcea2 transcription elongation factor A (SII), 2, transcript variant X2

Length: 945 bp    Location: 29692273..29699377   Strand: +
>XM_004841129.1
ATGGACCTGCTGCGGGAGCTGAAGGCCATGCCTATCACGCTGCACCTGCTCCAGTCCACCCGTGTTGGGATGTCTGTCAACGCCCTGCGGAAGCAGAGCTCGGACGAGGAGGTCATTGGACTGGCCAAGTCTCTCATCAAGTCCTGGAAGAAGCTCCTGGATGTTTCCAATGCTAAAACCAGGGATCCAGGGAGGGACACACCTCTACCCACATCGTCCACAAAGAATGCCTCAGAGGCCATGGATCACAGCCGTAAGAGGCTGGACCTTCCCAGGATGTCATCCACCCCAAGGATCACCACATTTCCTCCGGTGCCCATTACTTGCGATGCTGTGCGCAACAAATGCCGTGAGATGCTAACCACTGCCCTGCAAACAGACCATGACCATGTGGCAGTGGGCACAGACTGTGAACGTCTATCGGCTCAGATCGAGGAGTATATCCTTTGTGCAGACTTTGCGGGGGCCCGAGGCTTCAGGTGGAGTCTGTGGGCCACTGGGCCTGGCTCCCTCTGGTGGCTGCTGGACACCACTGCCGCGGTGCCAGTACCCTCTCTGGGCTGCATCTTCCTGGATGTGGGAAACACAGACATGAAGTACAAGAACCGTGTGAGGAGCCGTATCTCTAACCTTAAAGATGCCAAGAACCCGGAGCTTCGGAGGAACGTGCTATGTGGTGCCATAACACCCCAGCAGATCGCGGTGATGACGTCGGAGGAGATGGCGAGTGATGAGCTGAAGGAGATCCGCAAGGCCATGACCAAGGAGGCCATCCGGGAGCACCAGATGGCCCGCACAGGTGGCACGCAGACAGACTTGTTCACCTGTGGCAAGTGCAGAAAGAAGAACTGCACCTACACGCAGGTGCAGACTCGCAGCTCTGATGAGCCCATGACCACCTTTGTTGTCTGCAATGAGTGTGGAAACCGCTGGAAGTTCTGCTGA

XM_004841178.1 Coding sequence

LOC101712325 chromosome unknown open reading frame, human C20orf201

Length: 531 bp    Location: 29708965..29708212   Strand: -
>XM_004841178.1
ATGCCCTCGCTAGGAGCCGGGCCCCGCGAGGGGCGCACAGAGCGAGCGACTGCCACAGAGCCGCCCAGGCCGGGCTGGGCGCTGACGCTGGAGGGGCTGGGAGCCATGCCCCCCACGCAACGCCGCCGCCACCCGCTGTTCAGCGACCTGCGCGAGGACGGGGCCGCAGCCTCCTCCCTCTCCCCGCGCGAGTCTGCGGAGCTGGCAACCCGCATGCCCGACCCGCGCTCCTGGACGCAGTCGCTCGACCAGCCGGCGGGGCGCGCGAGCCCGCTCCTGAGTGTTCTCAAGGCGGCGGAGGTCCGCGGACGCGATCGCGCCCTCCGGCTACGCTACATCCACATGCGGGCGGAGGAGATCACGCTGCTGATCCGGCAGCAGAGCTCCGCGCGCGCCGCCATCCGAGTGGAGCTGTTCCTGACGCCACAGCTGAAGCCGAAGCGCGTCCTGGACCCCCTGGACCGGCAAGAGAGGCGCCACGTGGAGACCATCCTGGAGGAGGCCGCGGATGGCAGCATTTTCCCCCGGTGA

XM_004841135.1 Coding sequence

Npbwr2 neuropeptides B/W receptor 2

Length: 1011 bp    Location: 29725662..29723940   Strand: -
>XM_004841135.1
ATGCAGGCTGCTGCATGCACAAAGCCGCCTGAGACCAGAAGCACCTCCTTCCTCACCTCCATGAATGGCAGCCGCTCCCAGGAAGGCAGCACTGAGCCCAACACCACCTCCACCGAGCCGCTGTCAGCTCTCTACGTGCTCCTGCCGGCTGTGTACTCTGTGCTCTGCGCCGTGGGGCTGACTGGGAACACGGCTGTCATTTATGTGATCCTGAGGGCCCCCAAGATGAGGACAGTGACCAACGTGTTTGTCCTGAACCTGGCTGTGGCTGACGGGCTCTCCATCCTGGTGCTGCCAGCCAACATTGCAGAGCACCTGCTGCAGCGCTGGCCCTTCGGGGAGCCTCTCTGCAAGCTGGTGCTGGCCATCGACCACTACAACATCTTCTCCAGCGTCTACTTCCTGGCTGTGATGAGCGTGGACCGCTACCTAGTGGTGCTGGCCACCGTGCGGTCCCGCCGTGTGCCCCGGCGCACCCAGCGGGGAGCAAAGGTTGCTAGCCTGTGTGTCTGGCTGGGCGTCACCATCATGGTTCTGCCCTTCTTCTCCTTTGCTCGTGTCTACAGCAACGAGCTGCAGGTGCCCACCTGTGGGCTGAGCTTCCCCCAGCCAGAGAGGGCCTGGTTCCAGGCCAGCCGCATCTACACACTGGTACTGGGCTTTGCACTGCCTGTGTGCACTATCTGTGTGCTCTACATGGACCTCCTGCGCCGGCTGAGGGCCATGCAGCTCCACTCAGGCGCCAAAGCCCTAGGCAAGGCCAAGAGGAAGGTGACAGTCCTGGTCCTCACCGTGCTGGCTGTGTGCCTCCTCTGCTGGACGCCCTTCCACCTGGCTTCTGTGGTGGCCCTGACCACAGACATGCCCCAGACATCCCTTGTCATTGGCATCTCCTATACCATCACCAGCCTCAGCTATGCCAACTCGTGTCTCAACCCCTTCCTGTATGCCTTCCTGGACGACAGCTTCCAAAAGAATTTCCGCACCATGTTTCTGTGCCAAGGGCCCTGA

XM_004840678.1 Coding sequence

Tmem239 transmembrane protein 239

High confidence: 4 potential gene matches
Length: 459 bp    Location: 3940745..3941551   Strand: +
>XM_004840678.1
ATGATGCAGCAGCCTCGAATGGAGTCGGATGACAGTGGGGCTGGTGAGGGGCCACAGCGGGCAGTGCCCTGGTCAGCCTGGCTCACCCAGCAGGACTGGATGCGCTGGTGTGCTCGACATGTGCCCCAGAGCTGGGCCCAGTGGTGGGCCACAACTAGCTGGAGGCAGCCACTGCAGCGGGTGCTTTGGAACCTGGAGGGGATTCTCTACCTGCTGCTGGCCCTGACGCTGTGCCACGTACTCTTCACCACCGGCTCCCACCTGCTGAGCTCCCTGTGGCCTGTGGCGGTCGTGGTGTGGCGTCATCTGCTGCCAGCTGTCCTGCTCTTGGTGCTCAGCGCCCTACCCACCCTGCTGTTTACTGCCTCCTTCCTGCTGCTCTTCTCCACGTTGCTGAGCCTTGTGGGCCTCCTCACCTCCATGAATCACCCAGGCTATGCTCAGGACTTGAACGAATAG

XM_004841179.1 Coding sequence

LOC101713412 olfactory receptor 8I2-like

Length: 669 bp    Location: 29986483..29987310   Strand: +
>XM_004841179.1
CTCTTCATTGTCTTGGGGAACCTGGGACTAATCTTGCTAATCAGAACTGACCCTTTGCTTCACATGCCTATATACTTTTTCCTCAGCAACTTAGCGTTCATTGACATCTTCTATTCTTCCACTGTAACACCCAAAGCACTGGTCAGTCTGCAGTCCAAACAGAAATCCATCTCTTTCATGGGCTGCTTTGTTCAGATATACTTTTTTGTTGGCTTGGTGTGCAGGAAATATTTTCTTCTGGGCTCCATGGCCTATGATACTTTCATAGCGATTTGCAATCCTCTGCTGTATTCGGCTTTCATGTCCCAGAGAGCGTGCAACTGGCTGGGGGCAATGTCCTACGCTGTAGGCTTCACGAATTCTCTAGTCTCCATGTGTGTGATTAGCATCACCATCCTCTGGGCCATCCTGAGGGTCCAGTCTGCAGTGGGCAGGCAGAAAGCCTTCTCCACCTGTGCCTCCCACCTCACAGGTGTGGCCGTCTTCTACAGGTGCCTGATTTTCACACATTTGCAGCCTGATAACACATCATTCCTGACCCAGGCACAGATGGCCTGCGTGTTCTACACCATTGTCATCCCCATGCTGAATCCTCTCATCTACAGCCTGAGGAACAGAGAAGTGAAATACGCTCTCCTGAGAACCCTGCACAGGAAACAGTTTATATGA

XM_004840657.1 Coding sequence

Fkbp1a FK506 binding protein 1A, 12kDa

High confidence: 4 potential gene matches
Length: 327 bp    Location: 2692938..2669909   Strand: -
>XM_004840657.1
ATGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTTCCGAAGCGCGGCCAGACCTGCGTGGTACACTACACCGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTGGGCAAGCAGGAGGTGATCCGAGGCTGGGAGGAAGGGGTAGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATCTCCCCAGACTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTTGTCTTCGACGTGGAGCTTCTAAAACTGGAATGA

XM_004841181.1 Coding sequence

LOC101714113 olfactory receptor 8H1-like

Length: 573 bp    Location: 30076213..30077160   Strand: +
>XM_004841181.1
ATGGGTAGAAGGAACTCGACCAGTGTACCTAGCTTCATCCTCATGGGGCTGATGGACTCTGAAGAGACACAGCTGGTCCTTTTCTTGCTCTTTCTCCTGATTTACCTGATCACAGTGCTAGGGAATGTGGGGATGATACTGTTTATTGGCCTGGATCTCCAGCTTCACACCCCCATGTACTTTTTTCTCACTCACTTGTCATTTCTCGACCTCAGCTACTCAAATGTCATCACCCCTAAAACCTTACAGAACTTACTGACTTCCACCAAGAGCATCTCATTCCTGGGCTGCTTCACCCAGATGTACTTTTTTGTTATCTTTGTTGCTGCCGAATCCTTCTCCACCTGTGCCTCTCATCTCCTGGGAGTCATCATCTTCTACAGCACTATGATATTTACTTATCTGAAACCAAAGACGTCCTACTCCTTGGGAAGGGATCAGGTGGCTTCTGTGTTTTACACGATTGTGATCCCTATGCTGAACCCTCTCATTTATAGTCTCAGAAATAAGGAGGTGAAAAATGCTGCTGTTAGAATCCTGCAGAAGAGAGATACCTGCAGGAAACTAAAATAA

XM_004841183.1 Coding sequence

LOC101715872 olfactory receptor 10AG1-like

Length: 963 bp    Location: 30279989..30280951   Strand: +
>XM_004841183.1
ATGACACATGAAGAGATAAACACAGGAGGCAATGGTTCCATGGTGAGGTACTTTGTCCTGCTGGGGTTTTCTGACCTTCCAAACCTCCAGGGGTTTCTGTCTGGGGTGTTAACCATCATTTACTTGATTATCGTAATTGGAAACGGCCTCATAATCATCATAACAAGCCTGGACCCTGCACTCCAGAGACCCATGTATTTTTTCCTGGCAAATTTGTCTTCTTTGGAAATCTGCTATGTTTCAGTCACTCTACCTAGGATTCTGTTCAACATTTGGACACAGAATAGAAACATTTCTTTGTTAGGCTGTGCCACACAATTGTTTTTCTTCCTTATACAGGCAGCTACTGAGTGCTTCCTGCTGGCCGTGATGTCCTATGACCGCTATGTGGCCATCTGTCACCCTCTGCACTACCCTCTGCTTATGAACCCAAAGAAGTGTGCTCAGCTGGCAGCCGGTTCCTGGCTGAGTGGAATCCCAGTCCAGATAGGGCAAACTTGCCAGATATTCTCTCTGCATTTCTGTAAGTCCAACCAAATCCCCCACTTCTTCTGTGACCTACCTCCCATTCTCAAGTTGGCCTGCGGGGACACTTTAGCTCATGAGATGTCTGTCTATTTGATGGCTATGTTTTTTGCAACTGTCCCTTTCATGGTGATCCTTGCCTCTTATAGCAAAATCATTTCCACCATTCTGAGGTTGCCAACAGTGCAAGGACGGACCAAGGCCTTCTCCACATGCTCTTCCCACCTTCTGGTTGTGGTGCTATTTTTTGGATCTGCTAGCATCACCTACCTAAGGTCAAAGTCCAGCCATTCTGCAGGAACTGACAAACTGCTGTCTCTCTTCTACACTATTGTGACACCCATGTTCAACCCCATGATATACAGCCTCAGGAACAAGGAAGTCATTGCAGCGCTGAAAAAAGTATTTCTTCAAACACAACACCATGGTTCTCTTTGA

XM_004841184.1 Coding sequence

LOC101717607 olfactory receptor 4P4-like

Length: 714 bp    Location: 30352603..30351890   Strand: -
>XM_004841184.1
ATGATTTCTATCACTTGCAGCCAGCTAATTGACCAACCCATGTATTTCTTCCTTAATTACCTTGCTCTCTCAGACCTGTGCTATACTTCCACAGTGACCCCTAAACTAGTCACCGACTCGCTGAAAGAAAGGAACACCATTTCTTATACTGGCTTCATGGCTCAGCTTTCTGCTATGCACTTCTTCAGGGGCATCGAGATCTTCATCCTCACAGGGATGGCCTGTGACCGCTATGTGGCCATCCGCAAGCTGCTGCACTATGCGGTCATCATGAGCAGGCCCAGGTGTAATGCGGCTGTCACTGCATGCTGCTCAGGGGGATTTCTGCATTCCTTTGTCCAGTTCCTCTTCATTACCACCCTGCCTTTCTGTGGCCCCATTGAAATGAAGCACTACTTCTGTGATGTGTTCCCTTTGCTGGAACTGGCCTGCACAGACACACACAGAGCCGGAATCCTAGTGGTCACCAATTCAGGCATGATGGGATTGGTGGTGTTTGTGGTTGTGATGCTGTCTCACATGGTGAGTTTGTACACCATCAGGGCTTACCCTACAGAGAGTCACAGGAAAGCCCTTTCCACCTGCAGCTCCCACGTAATGGTGGTGGTTTTGTTCTTCGTGCCTGTCCTCTTCATTTACATCAGACCAGCAGCCCCTTCCCAGAGGACAAAGTGTTTGCTCTTTTCTACAGCATCATCATGTTCAACCCCCTGA

XM_004841185.1 Coding sequence

LOC101717936 olfactory receptor 4C16-like

Length: 933 bp    Location: 30427447..30428379   Strand: +
>XM_004841185.1
ATGCAGCTGAGCAATAATGTGACTGAGTTCATTCTACTTGGGTTGACACAAGATCCTGTTAGGAAGAAAATAGTTTTCATCATTTTTTTGGTTTTCTATGTGGGGACACTGATGGGTAACTTGCTGATTATCACCACCATCAAGACCAATCGGGCACTTGGGAGTCCAATGTACTTCTTCCTTTTCTACTTATCCCTATCAGACACCTGCTTCTCCACTTCCATCGCCCCTAGAACGATTATGGACACCCTTGTAGAGCAGGCCACTATTACTTTCAGTGAGTGCATGATCCAAGTCTTCTCCTTCCATTTCTTTGGCTGCCTGGAGGTTTTAATCCTGATCCTCATGGCTGTGGACCGCTATGTGGCCATCTGTAAGCCTCTGCACTACACGACCATTGTGAACCGCAGGATCTGTGCAGTGTTTGTGGCCGTGGCCTGGGTGGGATCCGGTGTGCATTCTTCAGTTCAGATTTTTCTGGCCTTGAGTCTGCCTTATTGTGGTCCCAATATGATCGATCATTATTTCTGTGACCTGGAGCCCCTATTGGAACTTGCCTGTGCAGACACTTACGTGGTCAACCTGCTCCTGGTGTCCAATAGTGGGGCCATTTGTACAGTAGGCTTTGTCTTGCTGATGTTCAACTATGTTGTCATTTTGCATTCTCTCAGAAACCACAGTGCTGAAGGGAGGAGAAAAGCCCTCTCCACCTGCATGTCCCACATCATTGTGGTCATCTTGTTCTTTGTACCTTGCATATTTATTTATACACGTCCTGCCACCACCTTCCCCATGGATAAGATGATAGCTGTGTTTTACACGATTGGAACACCTTTGCTCAACCCTCTGATTTACACACTGAGGAATGCAGAAGTGAAAAATGCCATGAGCAAGTTGTGGAGCAAGAAACTGATCTCAGTTGATGTCAGATGA

XM_004841142.1 Coding sequence

LOC101711112 olfactory receptor 4C46-like

Length: 930 bp    Location: 30439466..30438537   Strand: -
>XM_004841142.1
ATGGCTCATAAAAACAATGTGACAGAATTTGTTCTACTGGGGCTCACAGAAAACCCAAAGATTGAGAAAATCATATTTGCTGTGTTTTCCCTCATCTACATCATCTCCATGGTAGGAAATTTACTCATTCTTATCACCATCACTGCCAGCCCACTACGGAGGTCCCCCATGTACTTCTTCTTGGCCCATCTCTCCTTTATTGATGCCTGCTACTCTTCAGTCAATACCCCGAACGTGATTGTAAATTCACTCCATGAAAAGAAGACTATTCTGTTCAATGGATGCATGACTCAGATCTTTGCAGAGCATTTCATTGGAGGCGCTGAGATCATCCTGCTGACAGTGATGGCCTATGACCGCTATGTGGCCATCAGCAAGCCCCTGCACTACACAGTCATCATGAACTGGAGAGTGTGCAGCCTGCTGGTGGGAGTCTCATGGGTGGGAGGCTTTCTTCATGGAACCATACAGATCATCTTCATCTTGCCACTGCCATTCTGTGGCCCCAATGTCATAGACGATTTTATGTGTGATCTGAACCCTCTTCTCAAGCTGGCCTGCACTGATACCCACATTCTGGGGTTCTTTGTTGCTGCCAACAGTGGCTTCGTCTGCCTGTTAAATTTCTTGCTTCTTCTGGTCTCCTACATGGCTATTCTCTTCTCCTTAAAGACTCACAGTGTGGAGGGGAGGCAGAAAGCCCTCTCCACCTGTGCTTCCCACATTATGGTAGTCATCTTGTTCTTTGTGCCCTGCATATTTGTGTACATGAGACCTGCAACAACTTTATCCATTGACAAAGCAGTTACTGTTTTCTACACCATGGTAACTCCCATGTTAAATCCTTTGATCTATACTTTGAGAAATGCTCAGATGAAAAATACTATTAGGAATTCTTTTGGTAGGAAAGTTCTTTCAGGTGACAAATAA

XM_004841186.1 Coding sequence

LOC101718272 olfactory receptor 4S2-like

Length: 957 bp    Location: 30480499..30479543   Strand: -
>XM_004841186.1
ATGGCCTCATGGACTCATTCCAAGGAAAAATTAAACAATGTAACTGAATTCGTTTTCTGGGGTCTTTCTCAGAACCCAGAGGTTGAAGAAGCTTGCTTTGTGGTATTTTCATTCTTCTATGTGGTCATTCTCCTGGGAAACTTCCTTATCATGTTAGCAGTTTGCCATGGAAACCTGTTTAAGATGCCTATGTACTTCTTCCTCAACTTCTTGTCTTTTGTGGACATTTGCTACTCTTCAGTCACAGCACCCAAGATGATTGCTGACATATTAGCACAGAACAAAACTATCTCGTATGAAGGGTGCATGTTGCAGCTCTTTGGGGTACATTTCTTCGGTTGCACGGAGATCTTCATCCTCACTGTCATGGCCTATGATCGCTATGTGGCTATCTGTAAACCCCTACACTACCTGACCATCATGGACCGGGAGACATGCAATAAACTGTTGCTAGGGACATGGCTGGGTGGTTTTGTACACTCCATTATCCAAGTGGCTCTTGTAGTTCAACTCCCCTTCTGCGGCCCCAATGAGATTGATCACTACTTTTGTGATGTTCACCCCGTGCTGAAACTCGCCTGCACAGACACCTACCTTGTCGGTGTCGTGGTGACAGCCAATAGTGGGACCATCGCCCTGGGGAGTTTCATCATCTTGCTCATCTCCTACACTGTCATCCTGGTGTCTCTGCGGAAGCAGTCAGCAGAAGGCAGGCGCAAAGCTCTCTCTACCTGTGGCGCCCACATCGCTGTGGTCATCATCTTTTTCGGTCCCTGTACTTTTATGTACATGCGGCCGGACACGACCTTCTCTGAGGACAAGATGGTGGCTGTGTTCTACACCATTATCACGCCCATGTTAAATCCTCTGATTTATACCTTGAGAAATGCAGAAGTAAAGAACAGAATGAAGAAACTGTGGAGTAGGAAGGTTTTCTGGGAGGTCAATAGCAAATAG

XM_004841192.1 Coding sequence

LOC101724613 olfactory receptor 2B11-like

Length: 948 bp    Location: 31046858..31047805   Strand: +
>XM_004841192.1
ATGGAAAGAGTAAACCTGAGCTTTCCCAATGCCTTTTTGCTGCTGGGCTTCTCACAGTTTCCATGGCTGGAGAGGCCTCTTTTTGGGATGGTTCTGCTCTCCTATGTACTCACCCTGGTGGGGAACAGCTCCATCATCCTCCTCTCCCTGTTGGACCCCAGACTTCAGATGCCCATGTACTTCTTCCTGGACAATCTTTCTCTGCTGGACATTGGTGTCACCTGCACCATTGTGCCCCAGCTTCTGACCAATCTCTGGGGACAAGATAAGACCATTGCTTCCTGGGGCTGTATCACACAGGTCTACTTTTTCAACTGGACTGCCTGTGCTGAATGCATCCTACTGGCCATGATGGCCATTGATCGCTATGTGGCCATCTGCCAGCCCCTCCAGTACACTCTCATCATGCATCCCCGGGTGTGTGTGCAGATGGCAGCTGCCTCCTGGTCCAGCGGCCTGGCCAATTCCCTGCTACAAACCATATCCACCCTCCAGCTCCCCCTCTGTGGACCTCACACCTTGGACCACTTCTTCTGTGAGGTTCCTGTTCTCATCAAGCTGGCCTGTGGGGACACCACTGCTAATGAGTTGGCCCTGTCCATTGGAGCCATCCCATTTGGAATGCTGGCTCCCTTGTTGGTAGTTGTCTCCTACATCTTCATTGCTAGAGCTATACTGAAGTTACCTTCAGCTGAAGGCAGGCACAAGGCACTCAGCACCTGCAGTTCCCACTTGCTGGTGGTCACCATGTACTATGGCCCTGCCATATATGTGTACTTCCAGCCTCCTGCAAAAAGTTCTCAGACTAAATTCATGTCCTTCTTCTACTGTGTTATTACCCCAGTGCTCAACCCACTCATCTATACCCTGAGAAACCAGGATGTGAAAACAGCACTGAAGAGGATCCTGCAATTCCCGAGTGGGATGGAGTGTTTAAAAGCCAAATGA

XM_004841199.1 Coding sequence

LOC101706090 olfactory receptor 2G3-like

Length: 849 bp    Location: 32730999..32727455   Strand: -
>XM_004841199.1
ATGCCATTAAATTCTCTTTTGAGCATGAACCCTACTGTGGAGTGTATATATAAAGCAGATGACATGGAAAAGGAAAACATGAGTTTTCCCAACACTGTTGTCCTGCTGGCTTTCTCAGAGTTTCTGTGGCTGGAGAGGGCCCTCTCTGCAGTGGTCCTGGGCTCCTACCTCCTCACCGTAGTGGGGAACAGCTCCATCATCCTCCTCTCCCTGGTGGACCCCAGACTGCAGACACCCATGTACTTCTTCCTGGACAACCTCTCTCTGCTGGACCTCCGCTGCACTGAATGCATTCTGCTGGCCATGATGGCCATTGATCGCTATTTGGCCATCTGCTGCCCCCTCCTGTACACTCTCATCATGTGTCCCTGGGTATGTGTGCAGATGGCAGTTGCCTCCTTGTCCAGCAGCCTGGCCAGTTCTCTGGTGCAATCCACACTCATCCTCCAGCTCCCCCTCTGTGGGCACCATGCCCTGGACCACTTCTTCTGTGAGGTGCCAGTGCTCATAAAGCTGGCCTGTGTGGACAGCACTGCTAATGAGCTAACCCTGGCTAAAGGAGCCATCCCTTTTTCAGGGATGGCTCCCCTGATGGTGGTCATCTCCTACACCCTCATTGCCAGGGCTGTGCTGAAACTGCCTACAGCTGGAGCCAGGCACAAGGCACTCAGGACCTGCAGATCCCACTTGGTGGTGGTCACCCTGTACTTTGGTCCTGCCATGTACATGGACCTCCAGCCTCCAGCAAATCACACTCAGGCCAAGCTCATGTCCTTCTTCTACTACATTATCCCAGTGCTTAACCCACTCATCTATGCCCTGAGGAACAAGGATGTGAAGAGAGCCTAG

XM_004840796.1 Coding sequence

Mcm8 minichromosome maintenance complex component 8

High confidence: 4 potential gene matches
Length: 2502 bp    Location: 6787578..6825722   Strand: +
>XM_004840796.1
ATGAGTGGAACGCATAGAGGCAGAGGATTTGGGCGAGGCAGATTTCAAAGCTGGAAAAGAGGAAGAGGAGGTGGGAACTTCTCAGGAAAATGGAGAGAAAGAGAATGCAGACCTGGCCTGAATAAAACCACTGGAAAACAAACCTCTGAATATACCCCACAGCCTTTGCTACTGCAGTCAACATTGGATCAATTCATACCATATAAAGCCTGGAAGCTTTATTTTTCTGAAGTTTACAGTGATAACTCTCCTTATATTGAGAAGATTCAAGCATTTGAAAAATTTTTCACAGGACGTATTGATTTATATGATAAGGATGAAATAGAAAGAAAAGGAAGTATTTTGGTGGATTTTAAAGAACTGATAAAAGATGATGAAATAACAAACTTCATACCGGATATAGGAAATGAACTAAGGGATGCACCTGAGAAAACCTTGGCCTGCATGGGTCTGGCGGTACATCAGGTATTAACTAAGGACCTCGAAAGGCATGCTGCTGAATTACAAGCCCAAGAAAGATTGTGTAGTGATGGAGAAACAATGGTAAATGTGCCACACATTTACGCAAGGGTGTACAACTATGAGCCCTTGACACACCTGAAGAGTATTCGTGCAAATTACTATGGAAAGTACATTGCTCTGAGGGGGACAGTGGTCCGCGTCAGTAACATAAAGCCTCTCTGCACCAAGATGGCTTTTCTTTGTGCGGCTTGTGGAGAGGTTCAGAGCTTATCTCTTCCAGATGGAAAATACAGTCTTCCCACAAAGTGTCCCGTACCTGCCTGTCGTGGGAAGTCATTCACTCCTCTCCACAGCTCTCCTCTTACAGTTACCGTGGACTGGCAGTCGATCAAAATCCAGGAGCTCATGTCTGATGCTCAGCGAGAAGCAGGTCGGATTCCACGAACAATAGAATGTGAGCTCGTTCATGACCTTGTAGATAGCTGTGTCCCAGGAGACACAGTGACCATTACCGGAATTGTCAAAGTCTCAAATGCTGAAGAAGGATCTCGAAACAAGAATGACAAGTGCATGTTCCTTTTGTATGTTGAAGCAAATTCAGTTAGCAATAGTAAAGGTCAGAAAACAGAGACTTCTGAGGACGGCTGTAGACATGGAACATTGATGGAGTTCTCACTTAAGGACTTCTATGCCATCCGGGAGATTCAAGCTGAAGAAAACCTGTTTAAACTCATCATCAACTCACTTTGCCCTGTGATTTTTGGTCACGAACTTGTTAAAGCAGGTTTGGCATTAGCACTCTTTGGAGGTAGCCAGAAATATGCAGATGACAAAAACAGAATCCCAATTCGAGGAGACCCACATGTTCTTGTTGTTGGAGATCCAGGCTTGGGAAAAAGTCAGATGCTACAGGCAGTATGCAACATTGCTCCACGTGGTGTGTATGTCTGCGGTAACACCACGACCACCTCTGGGCTGACTGTAACTCTTTCAAAAGACAGTGCCTCTGGTGATTTTGCTTTGGAAGCCGGCGCCCTGGTACTTGGCGATCAAGGCATTTGTGGAATAGATGAATTTGATAAGATGGGAAACCAACATCAAGCCTTGTTAGAAGCCATGGAACAGCAAAGTATTAGCCTTGCAAAGGCTGGTGTGGTTTGTAGCCTCCCTGCAAGAACTTCAGTTATTGCTGCTGCAAACCCAGTTGGAGGACACTATAATAAAGCCAAAACAGTTTCTGAGAATTTAAAAATGGGGAGTACCCTGCTCTCCAGATTTGACTTGGTCTTTATCCTGTTAGACACTCCAAATGAGCAGCATGATCACTTACTCTCTGAACACGTGATTGCAATAAGAGCTGGAAAGCAGAGAGCTGTTACTAGCGCCACAGTAGTTCGTGTGAATAGTCAAGATTCAAATACTTCTATACTTGAAGTGGTTTCTGAGAAACCATTATCAGAAAGACTAAAGGTGGTTCCTGGAGAAATAATAGACCCAATTCCCCACCAGCTATTGAGAAAGTATATTGGCTATGCTCGACAGTATGTCTACCCCAGGCTGTCAGCAGAAGCTGCTCGAGTTCTTCAAGATTTTTACCTGGAACTTCGGAAACAGAGCCAGAGGTTAAATAGCTCACCAATCACTACCAGGCAGCTGGAGTCTTTGATTCGGCTAACAGAGGCACGAGCAAGGTTGGAATTGAGAGAGGAAGCAACCAAAGAAGATGCTGAGGATATAGTTGAAATTATGAAATATAGCATGCTAGGAACTTATTCTGATGAGTTTGGGAACTTAGATTTTGAGCGATCCCAGCATGGTTCTGGAATGAGCAACAGGTCAACAGCAAAAAGATTTATTTCTGCTCTCAACAATATTGCTGAAAGAACTTACAATAATTTGTTTCAATTTCATCAACTTCGGCAGATTGCCAAAGAACTAAACATTCAGGTTGCTGATTTTGAAAATTTCATTGGTTCACTAAATGACCAGGGATACCTCTTGAAAAAAGGCCCAAAAGTTTACCAACTTCAAACTATGTGA

XM_004840927.1 Coding sequence

Rae1 RAE1 RNA export 1 homolog (S. pombe), transcript variant X3

High confidence: 4 potential gene matches
Length: 1107 bp    Location: 23803598..23825045   Strand: +
>XM_004840927.1
ATGAGTCTGTTCGGAACAACTTCTGGTTTTGGAACTGGTGGGACCAGCATGTTTGGCAGCACAACCACAGATAACCATAATCCTATGAAGGATATTGAAGTGACATCTTCTCCTGATGACAGCATCGGGTGTCTATCATTTAGCCCCCCAACCTTGCCGGGGAACTTTCTTGTTGCCGGATCGTGGGCTAATGATGTTCGCTGCTGGGAAGTTCAGGACAATGGGCAGACCATTCCAAAAGCCCAGCAAATGCACACTGGCCCCGTGCTTGACATCTGCTGGAGTGATGATGGAAGCAAAGTATTTACAGCATCGTGTGACAAAACTGCCAAAATGTGGGACCTCAACAGTAACCAAGCAATCCAGATAGCACAGCATGATGCACCTGTTAAAACCATACATTGGATCAAAGCTCCAAACTACAGCTGTGTGATGACCGGAAGCTGGGATAAGACTCTGAAGTTTTGGGATTCTCGGTCATCAAACCCTATGATGGTCTTGCAGCTCCCGGAGAGGTGTTACTGTGCTGACGTGATATATCCAATGGCTGTAGTGGCAACAGCAGAGAGGGGCCTAATCGTCTACCAGCTAGAAAATCAGCCTTCGGAGTTCAGGAGGATAGAGTCCCCGCTGAAGCACCAGCATCGCTGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGCTTCGCCCTGGGGAGCATTGAGGGGAGAGTTGCTATTCACTACATCAACCCCCCAAACCCTGCCAAAGATAATTTCACCTTTAAATGTCACCGATCCAATGGGACTAACACTTCAGCTCCCCAGGACATCTACGCGGTAAACGGAATCGCATTCCACCCTGTTCATGGCACCCTCGCAACCGTGGGCTCTGATGGTCGGTTCAGCTTCTGGGACAAAGATGCCCGAACAAAACTGAAGACTTCAGAACAGTTGGACCAGCCGATATCTGCGTGCTGCTTCAACCACAACGGCAACATATTCGCCTACGCGTCCAGCTACGACTGGTCCAAGGGACATGAATTTTATAATCCTCAGAAGAAAAATTACATTTTCCTGCGTAATGCAGCCGAAGAACTAAAGCCCAGGAATAAGAAGTAG

XM_004840930.1 Coding sequence

Pck1 phosphoenolpyruvate carboxykinase 1 (soluble)

High confidence: 4 potential gene matches
Length: 1869 bp    Location: 23985349..23990354   Strand: +
>XM_004840930.1
ATGCCTCCTCAGCTGCACAATGGCCAGGACTTCTCCGCCAAAGTCGTGCAAGGCAGCCTGGACAGCCTGCCCCAGGCAGTGAGGGAGTTTGTGGAGAGCAGTGTGCAGCTGTGCCAGCCGGATCACATCCATATCTGCGATGGCTCGGAGGAGGAGAATGGGCAGCTGCTGGCCCGCATGCAGGAAGACGGCGTCATCAGGAAGCTGAAGAAGTATGACAATTGTTGGTTGGCACTCACTGACCCCAGGGACGTGGCCAGGATAGAAAGCAAGACCGTGATCATCACCCAAGAGCAGAGAGACACAGTGCCCATCCCCCGGACCGGCCTCAGCCAGCTGGGTCGCTGGATGTCAGAAGAGGACTTCGAGAAAGCGTTCAATGCCAGGTTCCCAGGGTGCATGAAAGGTCGCACCATGTATGTCATCCCATTCAGCATGGGGCCCCTGGGCTCGCCACTGTCCAAGCTCGGCATCGAGCTCACCGACTCGCCCTACGTGGTGGCCAGCATGCGGATCATGACCCGAATGGGCACAGCCGTCCTGCAGGCCCTTGGGGACGGCGAGTTCATCAAGTGTCTGCATTCCGTGGGCTGCCCTTTGCCTTTAAAAAAGCCTCTGGTCAACAGCTGGGCCTGCAACCCAGACCTGATGCTCATCGCCCACCTGCCCGACCGCAGGGAAATTGTCTCCTTCGGAAGTGGCTATGGCGGGAACTCGCTGCTTGGGAAGAAGTGCTTTGCACTCAGGATAGCCAGCCGGCTGGCCAAGGAGGAGGGGTGGCTGGCGGAGCACATGCTGATTCTGGGTATCACCAACCCCATGGGAGAGAAGAAGTACCTGGCAGCAGCTTTCCCCAGCGCCTGCGGGAAGACCAACCTAGCCATGATGAACCCCACGCTCCCGGGGTGGAAAATTGAGTGTGTAGGTGACGACATTGCCTGGATGAAATTTGATGCCCAAGGTAACTTAAGGGCCATCAACCCAGAAAACGGTTTTTTTGGTGTGGCTCCTGGCACCTCAGTGAAGACGAACCCCAATGCCATCAAGACTATCCGGAAGAACACCATCTTCACCAACGTGGCCGAGACCAGCGAGGGCGGCATTTACTGGGAAGGCATCGATGAGCCGCTGGCCCCAGGCATCACAATCACTTCCTGGAAGAACAAAGAATGGAGCCCAATGGATGGGGAACCTTGTGCCCACCCCAACTCGCGATTCTGTACCCCTGCGAGCCAGTGCCCCATCATTGATCCTGCCTGGGAGTCTCCGGAAGGCGTGCCCATCCAGGGCATCATCTTTGGAGGCCGCAGACCTGCTGGTGTCCCTCTTGTCTATGAAGCTCTCAGCTGGCAGCATGGTGTGTTTGTGGGGGCAGCCATGAGATCGGAGGCCACTGCAGCTGCAGAGCACAAAGGCAAAGTCATCATGCATGACCCTTTTGCTATGCGGCCCTTCTTTGGCTACAACTTTGGTAGATATCTGGCCCACTGGCTGAGCATGGCTCACCGCCCAGCAGCCAAGCTGCCCAGGATCTTCCATGTCAACTGGTTCCGTAAGGACAAGGAAGGCAAATTCCTCTGGCCAGGCTTCGGAGAGAACTCCAGGGTGCTGGAGTGGATGTTCAACCGGATCAACGGGGAAGACAGCGCCCAGCTCACACCCATTGGCTATGTCCCCAAGAAGGATGCCCTGAACCTGAAAGGCCTGGGGAATGTCAACGTAGAGGAGCTCTTCAGCATCTCCAAAGAGTTCTGGGAGAAAGAGGTAGAAGACATTGAGAAATATCTGGAAGATCAAGTCAATGCTGACCTCCCCTATGAAATCGAGAGGGAGGTCCTTGCTCTGAAGCAAAGAATCAGCCAGATGTAG

XM_004840780.1 Coding sequence

Pcna proliferating cell nuclear antigen

High confidence: 3 potential gene matches
Length: 786 bp    Location: 6148118..6143538   Strand: -
>XM_004840780.1
ATGTTCGAGGCACGCCTGGTCCAAGGCTCCATCCTGAAGAAGGTGCTGGAGGCACTTAAGGACCTCATCAACGAGGCCTGCTGGGACATCAGCTCGGGCGGCGTGAACCTGCAGAGCATGGACTCGTCCCACGTCTCCCTGGTGCAGCTCACGTTGCGCTCCGAAGGCTTCGATACTTACCGCTGCGACCGCAACCTGGCCATGGGAGTGAACCTCACCAGTATGTCCAAAATATTAAAATGCGCTGGCAACGAAGACATCATTACCCTACGAGCTGAAGATAATGCAGACACTCTGGCACTAGTATTTGAAGCACCTAATCAGGAGAAAGTATCAGACTATGAAATGAAGTTAATGGATTTAGATGTTGAACAGCTTGGAATTCCAGAACAAGAATACAGTTGTGTGGTAAAGATGCCTTCTGGTGAGTTTGCACGTATATGCCGAGACCTCAGTCACATCGGAGATGCTGTTGTAATATCATGTGCAAAAGATGGAGTGAAATTCTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAGTTGTCACAAACCAGTAATGTTGACAAAGAGGAAGAAGCTGTTACCATAGAGATGAATGAGCCTGTTCAGCTAACTTTTGCACTAAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTCCTACAGTAACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCTGACATGGGACATTTAAAGTACTATTTGGCTCCCAAGATCGAGGATGAAGAAGGATCTTAG

XM_004840816.1 Coding sequence

Ankef1 ankyrin repeat and EF-hand domain containing 1

High confidence: 4 potential gene matches
Length: 2331 bp    Location: 10991994..11009810   Strand: +
>XM_004840816.1
ATGGCGTTAGCAGATAAGAGACTTGAGAACTTGCAGATCTACAAAGTTCTTCAGTGTGTTCGGAACAAAAACAAGAAGCAGATAGAGAAGCTGATCTGGCTTGGATACCCTCAACTAATCAACTTCACAGACTCTGTGGATGGACTTAGTGCTCTGCACTTAGCTTCAGTTTCCAATGACGTTGATATGGTTAGCTTTCTCCTTGAACTCGGAGCTCACCCTGATGTGCAAGACCATAAGGGCTGTACCCCAACAATGAGGGCTGCTGAACTGGGCCATGAGTTGTCGATGGAAATATTAGCCAAAGCAAAGGCTGATATGACTATAGTTGATAATGAAGGGAAAGGCATTTTATTTTACTGCATTCTACCTACTAAGCGGCATTATCGCTGTGCTTTGATTGCCCTTGAACATGGTGCAGATGTCAACAATTCTACCTATGATGGAAAACCAGTGTTCCTTAGAGCCTGTGAAGAAGCCCATGATATTAGAGAGATGTGCCTGACGTTTTTGGAAAGAGGAGCTGATCCAAATGCTATCAACTCATCCACAGGTCGCACCGCTTTAATGGAGGCATCAAGAGAAGGAGTGACAGAATTAGTTCGGGGAATATTGGAAAGAGGAGGTGCAGTGAATACATTGGACAGTGATAGACATCATGCTGCTCATTTTGCTGCCAAAGGAGGCTTTTTTGATATACTGAAGCTTCTTTTTGCTTACAATGGAGACATGGGGATGATCGCAATGAATGGGAACACACCACTTCATTACGCTGCTATGGGCGGTTTTACCAACTGTTGTAAATATGTAGCTCAGCGAGGATGTGACCTGAAATGGAAGAATTTAGACCATAAAACACCAAGGGCTTTGGCAAAAGAAGGTGGCTTCAAAGCAGCTAGCAAAGAAATTCATCGAGCAGAGCGAATTGCTAATAAACTGGCCAAACCAGGAGCCAAAAATCCTAATCCACTCTGGGCCCTCAGATTACATGATTGGTCCATAGAACATGAGACTTTTCTTCGGGAAGTCTTTTCATTTGTGGACAGAGGTGATGGGTCAGTCACCAAGGAAGACTTTGTGATGACCCTGGAGGAGAGGCAAGAGTACGCCAGCTCTGAACAGCTGTTTTCAATAGCTCAACTTCATGAAAAATTCCAAGGAGGAGGGGTCAATATTAATGAGTTCTTTAAAGGAACTAGATACCTAAACAAGTCTTTTGTCTTGGGATCTTATGGACCTAAGAAAAAGAAAAAAGGGATGGGCAAAAAGGAAAGGAAAGGCAAGTTTGTTATACCCCTCCCAGTCTGCGTCATTCCTGATGATGCATTTCCACATCGATCAGATGGTGGGCCTCCATATTACATGATTGAAACCTACCAGAATGTAACTGATTATAGCCGGTTTAATCAAGATCACCCACCAGAACATCCCATGCAGGATGATTCTGCTTGGTACATTGATGAGCCAGGGAAGGTATTTTCAAATATTAATTTTATCACCAAGGCAGGAGACCTAGCATCTCTGAAAAAGGCATTTGAATCGGGAATACCTGTGGATATGAAGGATAAATATTACAAGACACCACTAATGATGGCATGTGCAAATGGAAACATAGATGTAGTCAAGTTTCTTCTTGAAAAAGGGGCGAATATTAATGCAACAGACAATTTTCTGTGGACCCCACTTCATTTTGCATGCCATGCAGGCCAGCAAGACATTGCAGAGCTTCTTGTTGAGTCCGGAGCTTCAATAGATGCACTTTCAATCAACAACTCAACTCCTTTGAGTCGAGCTATTGAAAGCTGTAGGATGGATACTGTAAAATACCTACTTGATATCGGTGCTAAATTTCAGCTGGAAAATAGAAAAGGTCACACTGCCATGGATATTGCAAAAGCTTATGCTGATTATAGAATAATTGATCTGATTAAAGAAAAGTCAGATAACTTGCCAAAACCTCCAGAAAATCAAAAACTGAAAGCCAAGCCACCCCCTAAACTGAAGACTGAAGGCCCTGAAATTAAGAAAGAAGAGGAAGCACTTTCATCACTTTATGCTGTACCAACCATAACAAAAAAGAAGAACAGGCATAAAGATAATGTGGTTTATCTCAATTCATTGATTACCAGTGGTTATACCAAGAAAGTGGATATCACGTTTGTTCCACGAAGGGTTTGGAGTCCTGAAGCCACAACCCCAGAGCTGGTCCAGAAGCGGGAACTGCGTCGGGAAAGACTTAGTTATGAAGTGGACTTTGAGGATTTCATGATGCCTTTTCAGAAGAACATGACAGAGAAAGCTCAAGCTTTGGAAGCTACCTTGAAGAGTTAA

XM_004840876.1 Coding sequence

Polr3f polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa

High confidence: 3 potential gene matches
Length: 951 bp    Location: 19196604..19210403   Strand: +
>XM_004840876.1
ATGGCTGAGGTGAAGGTGAAGGTGCAGCCGCCCGACGCGGTTCCGGTCGAAATAGAAAATAGGATCATAGAACTATGTCACCAGTTTCCTCATGGAATCACAGACCAAGTAATTCAGAATGAAATGCCTCATATAGAAGCCCAACAGCGGGCAGTGGCCATCAATAGACTCTTGTCCATGGGTCAGTTGGATCTCTTAAGGAGTAATACAGGCCTTTTATACAGAATAAAGGACTCTCAGAATGCTGGTAAAATGAAAGGATCAGATAACCAGGAAAAACTAGTATATCAGATCATAGAGGATGCGGGAAATAAAGGAATATGGAGCAGAGATATTCGATATAAAAGTAACTTGCCATTAACAGAAATCAACAAAATTCTAAAGAATTTGGAAAGTAAAAAACTTATCAAAGCTGTTAAGTCCGTAGCGGCCTCCAAAAAGAAAGTATATATGCTGTATAACCTGCAGCCAGACCGGTCTGTGACTGGTGGGGCCTGGTACAGTGACCAGGATTTTGAATCTGAATTTGTAGAGGTGCTTAACCAACAGTGCTTTAAATTCCTACAATCCAAGGCAGAAACAGCTCGAGAAAGCAAACAGAATCCAGTGATTCAGAGAAATAGTTCATTTGCCTCATCACATGAAGTGTGGAAATATATCTGTGAATTGGGGATCAGTAAGGTAGAGTTGTCCATGGAGGACATAGAAACCATCTTGAATACCCTCATTTATGATGGGAAAGTAGAGATGACAATCATTGCTGCAAAGGAAGGCACAGTTGGCAGTGTAGACGGACACATGAAACTATACAGGGCAGTCAGTCCAATCATCGCACCCACAGGCTTGGTCCGGTCACCCTGCGGACTCTGCCCGGTCTTTGATGACTGCCATGAAGGCGGTGAGATTTCACCCTCTAATTGTATTTACATGACAGAGTGGCTTGAATTTTAA

XM_004840879.1 Coding sequence

Sec23b Sec23 homolog B (S. cerevisiae), transcript variant X2

Length: 2307 bp    Location: 19222628..19255512   Strand: +
>XM_004840879.1
ATGATGGCAACATATCTGGAGTTCATTCAGCAGAATGAAGAACGTGATGGGGTGCGCTTCAGTTGGAATTTGTGGCCATCCAGCCGTCTGGAGGCCACGCGAATGGTGGTCCCGCTGGCCTGTCTTCTTACTCCTTTGAAGGATCGTCCAGACCTGCCTCCTGTACAGTATGAACCTGTGTTTTGCAGCAGGCCCACCTGCAAAGCTGTCCTCAATCCACTTTGTCAGGTTGATTATCAAGCAAAACTTTGGGCTTGTAATTTCTGTTTCCAAAGAAACCAGTTCCCCCCATCGTATGCAGGCATATCTGAGGTGAACCAGCCTGCCGAGCTCATGCCCCAGTTCTCTACAATTGAGTACGTGGTACAGCGAGGTCCTCGGTCCCCTCTGATCTTCCTCTATGTGGTGGACACGTGCCTGGAGGAAGATGACCTTCAGGCCCTCAAAGAGTCCCTGCAGATGTCCCTGAGTCTCCTTCCTCTGGAGGCCCTGGTGGGCCTCATCACTTTTGGGAGGATGGTGCAGGTTCATGAGCTGAGCTGTGAAGGAATCTCCAAAAGTTATGTCTTCCGCGGGACCAAGGATTTAACCGCAAAGCAAATACAGGATATGCTGGGCCTGTCCAAGCCAGCCATGCCCATGCAGCAAACAAGGCCTGCACAGCCTCAGGAGCACCCTTTTGTTTCCAGCAGGTTTCTGCAGCCCATTCACAAGATTGACATGACCCTCACAGATCTCCTCGGGGAGCTGCAGAGGGACCCATGGCCGGTCACTCAGGGAAAGAGGCCTCTGCGGTCCACTGGGGTTGCGTTGTCCATTGCCGTTGGCCTGCTGGAGGGTACTTTTCCAAACACGGGAGCCAGGATCATGCTGTTCACTGGAGGGCCCCCCACGCAGGGGCCTGGCCTGGTGGTGGGAGATGAATTAAAGGTTCCCATTCGTTCCTGGCATGATATTGAGAAAGATAATGCACGGTTCATGAAAAAGGCAACAAAGCACTATGAGATGCTCGCTAATAGAGCTGCTACAAATGGTCACTGCATTGATATTTATGCTTGTGCCCTTGATCAAACTGGACTTTTGGAGATGAAGTGTTGTACAAATCTTACTGGAGGCCACATGGTGATGGGAGATTCTTTCAACACCTCCCTCTTCAAGCAGACCTTCCAAAGAATTTTTAGCAAAGATTTTAACGGAGATTTCCGAATGGCTTTTGGTGCTACTTTGGAAGTAAAGACCTCTCGGGAGCTGAAGGTTTCAGGAGCCATTGGTCCATGTGTGTCTCTGAACATGAAGGGACCCTGTGTGTCAGAAAATGAGCTTGGTGTAGGAGGCACGAGTCAGTGGAAGATCTGTGGCCTAGATCCCACGTCTACACTTGGCATCTACTTCGAAGTCGTCAATCAGCACAATGCCCCAGTCCCCCAAGGAAGCAGAGGTGCCATCCAGTTTGTCACACAATATCAGCATTCCAGCACACTGAAACGCATCCGTGTGACCACCATTGCCCGAAATTGGGCAGATGTGCAGAGCCAGCTCCAGCTCATAGAGGCTGCGTTTGACCAGGAGGCTGCAGCGGTCCTGATGGCGAGGCTTGGAGTGTTCCGGGCAGAGTCGGAGGAGGGCCCTGACGTGCTCCGATGGCTGGACCGGCAGCTCATCCGACTGTGTCAGAAGTTTGGACAATATAACAAAGAAGATCCCACTTCTTTTAGGCTATCAGATGCCTTTTCTCTATATCCTCAGTTCATGTTCCACCTCAGAAGATCGCCCTTTCTCCAGGTGTTTAACAACAGTCCTGATGAGTCGTCCTATTACAGACACCACTTTGCACGGCAGGACCTGACCCAGTCCCTCATCATGATCCAGCCCATCCTCTACTCCTACTCCTTCCATGGCCCGCCAGAGCCGGTGCTCTTGGACAGCAGCAGCATTCTAGCTGACAGAATCTTGCTGATGGACACTTTCTTCCAAATTGTCATTTATCTTGGTGAGACCATAGCCCAGTGGCAGAAGGCCGGCTACCAGGACATGCCTGAGTACGAGAACTTCAAGCACCTGCTGCAGGCTCCACTGGATGATGCGCAGGAGATCCTGCAGGCACGCTTCCCCATGCCGCGCTATGTCCACACAGAGCATGGCGGCAGCCAGGCTCGATTTCTTTTGTCCAAAGTGAACCCATCTCAGACACACAATAACCTGTATGCTTGGGGACAGGAAACCGGAGCGCCCATCCTGACGGATGACGTCAGCCTGCAGGTGTTCATGGACCATCTGAAGAAGCTGGCCGTGTCCAGTGCCTGTTAG

XM_004840884.1 Coding sequence

Dtd1 D-tyrosyl-tRNA deacylase 1, transcript variant X3

Length: 630 bp    Location: 19273773..19296850   Strand: +
>XM_004840884.1
ATGTCAACCACAGTAGGAGAAATGGCCCCATGTTTGGGCAAATCCTCCACCTGGAGGAGCAGGCAGCACAGGTTATCACTGCAAGCCCAGTGCCTTCCAGGAGCTGTGAATAGAGGCGCTACAGGAGCAGAGACCCCAGAGCAGCCTCCTGGGACAGGGCTGCGCCCCAGCGGTGGTACACATGAGTCCTGGCCAAGGTCATGCCTTCCGGTCCGAAAGATCTTGAACCTGCGTGTGTTTGAGGACGAGAGCGGCAAGCCCTGGTCCAAGAGTGTGATGGACAAGCAGTACGAGGTGCTGTGTGTCAGCCAGTTCACCCTGCAGTGTGTCCTCAAGGGCAACAAGCCCGACTTCCACCTGGCCATGCCCACCGAGCAGGCCGAGAGCTTCTACAACAGCTTCCTGGAGCAGCTGCGGAAGACTTACCGGCCCGAGCTCATCAAAGATGGCAAATTTGGTGCCTACATGCAGGTGCATATTCAGAACGATGGGCCTGTGACCATAGAGCTGGAGTCTCCGGCTCCCGGCACTGCCACCTCTGACCCAAAACAGTGCTCTTGCCATTGTGATGCGACCACCATGAGAAGATACCAGGGGAGTCCTCACTACAACTGGCACTGCGCTGTGTGA

XM_004840618.1 Coding sequence

Nrsn2 neurensin 2, transcript variant X1

Length: 594 bp    Location: 1448042..1453940   Strand: +
>XM_004840618.1
ATGCTGGGCTGCAACCCCTGCAGCTGTGTAACCACCGTGGAGGAAAGCAAGTGGTATGGAGTCCACTCCTACCTGTACCTCTTCTACGAAGACTGCACTGGCATGGCTCTCAGTGATGACCCTGAAGGACCCCCAGTCCTGTGTCCCCACCAACTCTGGCCCTCACTGTGCTGGAAGATCTGCCTGTCCTCAGGGACCCTGCTTCTGCTGCTGGGGATAGCAGCTCTGACCACTGGCTATGTGGTGCCCCCCAAGTTGGAGACCGTCAACAATACTGACTTGCCGCTGCTAGATGAGCGGGCAGCCAACTACAACAAGGCCCTGAGCACCTGCCGCCTGGCAGGCACAGCACTCTGTGGGGCAGCTGGGATCCTGCTGACCATCTGCCTCTTGTGGGCCATGTCAGGATGGCTGAACCCAGACGCCAAGGCAGAGCCCTTGGACACTGAAGCTGATAGCCATGTGGAGGTCTTCAGGGATGAGCCAGGGCAGCAGCTGTCCCCCACCTTCTGCAATACCAGTGGTCAGTCATGGTTCTTGACCTCCTTTGGGCACTCCTCTGTTCAGATCATCCAGCCCAAGAGGGACTCCTGA

XM_004840775.1 Coding sequence

Rassf2 Ras association (RalGDS/AF-6) domain family member 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 981 bp    Location: 5894540..5857607   Strand: -
>XM_004840775.1
ATGGATTACAGTCACCAAACTTCCCTAGTCCCACGTGGGCAAGATAAATACATTTCCAAGAATGAACTTCTCCTGCACCTGAAGACCTACAACCTGTACTATGAGGGCCAGAACTTGCAGCTGCGACACAGGGAGGAAGAAGATGAGTTCATCGTGGAGGGGCTGCTGAACATCTCCTGGGGGCTGCGCCGGCCCATCCGTCTGCAGATGCAAGACGACAATGAGCGCATCCGGCCCCCGCCCTCCTCCTCGTCCTGGCACTCAGGCTGCAACCTGGGGGCTCAGGGCACCATCCTGAAGCCCCTCACCATGCCTGCCATTCAGATCTCAGAGGCGGACACCCCTCCCGAGGGTGACCAGACACCCAGCCTCACAGACACCAGGGGTCTGAAGCCCGTGCAGGAAGACACCCCACAGCTGATGCGCACGCGCAGTGATGTTGGGGTGCGTCGGCGTGGTAACGTGAGAACGCCCAGTGACCAGCGGCGAATCCGACGCCACCGCTTCTCCATCAATGGCCATTTTTACAACCACAAGACTTCCGTGTTCACGCCTGCCTATGGCTCTGTCACCAACGTCCGAATCAACAGCACCATGACTACCCCGCAGGTCCTGAAGCTGCTGCTCAACAAATTTAAGATTGAGAATTCAGCAGAGGAGTTTGCTTTGTACGTGGTCCACACCAGTGGTGAGAAACAGAAGCTGAAGACCACCGATTACCCACTGATTGCCCGCATCCTGCAGGGGCCCTGTGAGCAGGTCTCCAAGGTGTTCCTGATGGAGAAAGACCAGGTGGAGGAGGTCACCTATGACGTGGCCCAGTACATAAAGTTTGAGATGCCGGTCCTGAAAAGCTTCATCCAGAAGCTCCAGGAGGAGGAGGATCGGGAGGTGAAGAAGCTGATGCAGAAGTGTGGAAGTGAACACAGTAATGCAGTGGCTCATGAGTGGGCTAGTGAAGGTACACTGTACTCCGGCTAA

XM_004841127.1 Coding sequence

Rgs19 regulator of G-protein signaling 19, transcript variant X2

High confidence: 4 potential gene matches
Length: 654 bp    Location: 29705212..29700033   Strand: -
>XM_004841127.1
ATGCCCACCCCGAATGAGGCTGAGAAGCAGCACACAGGGCCAGAAGAGGCGGACAGGCCCCCCTCAATGTCCAGCCATGCCACAGCCCCCCGGGGGGCCCCCAGCCGCAACCCCTGCTGCTTGTGCTGGTGCTGCTGTTGCAGCTGCTCCTGGAACCAAGAGCGGCAGCGAGCGTGGCAGGCCTCCCGTGAAAGCAAGCTGCAGCCCCTCTCCAGCTGTGAAGCTTGTGCCCCACCGAGCCCTGAGGAGGTGCAGAGCTGGGCGCAGTCCTTTGACAAGCTGATGCACAGCCCTGCGGGCCGCAGCGTGTTCCGGGCATTCCTGCGCACGGAGTACAGCGAGGAGAACATGCTCTTCTGGCTGGCCTGCGAGGAGCTGAAGGCAGAAGCCAACCGGCACGTGGTGGATGAGAAGGCACGCCTCATCTACGAGGACTATGTGTCCATCCTCTCCCCCAAAGAGGTGAGCCTGGACTCCCGAGTACGGGAGGGCATCAACAGGAAGATGCAGGAGCCGTCCGCACACACGTTTGATGATGCACAGCTGCAAATCTACACTCTCATGCACCGGGACTCCTACCCTCGCTTCCTTAGCTCCCCCACCTACCGTGCCCTGCTGCTCCCAGAGCCCCCACAGTCCTCCTCTGAGGCCTAG

XM_004841209.1 Coding sequence

LOC101720245 olfactory receptor 2L13-like

Length: 810 bp    Location: 33820397..33821206   Strand: +
>XM_004841209.1
ATGATTCACCTCATACGTGTGGATGTCCGGCTAGATATGCCCATGTACCTTGTCCTAAGCCAGCTCTCCCTCATGGACCTGATGTACATCTCTACCACTGTCCCCAACATGGTGGTCAATTTCCTCTCTGGTCAGAAGAGCATCTCCTTGCCGGGGTGTGGGGTGCAGAGTTTCTGCTTCCTGACTATGGCATGCTCTGAAGGGCTACTCCTGGCCTCCATGGCTTATGACCGATTTGTAGCCATCTGCCACCCCCTCCATTATACCATCCGCATGAGCAAAAGTGTGTGTGCAAAGATGATTGCAGGATCTTGGACACTTGGCTCCATCAACTCCCTGGCCCACACAATCTATGCCCTTCATCTTCCCTACTGCAGGTCCAGGGCCATCAATCACTTCTTCTGTGATGTCCCAGCCATGCTGCCCCTGGCCTGTGTGGACACCTGGGTCTATGAGTACATGGTTTTTGTGAGCACCAGCCTGTTCCTCCTTCTCCCTTTCCTTGGAATCACTGCTTCCTATGGACGGGTCCTTTTTTCTGTCTTCCACATGCGCTCCAAAGAGGGAAGAAAAAAGGCCTTCACCACATGCTCCACACATTTAACAGTGGTGACCTTTTACTATGCTCTTTTTGTTTACACCTATCTTCGACCCAGGATTCTCCGTTCCCCAGCAGAAGACAAGATCCTGGCAGTTTTCTATACCATCCTCACCCCTATGCTGAACCCCATTATCTACAGCCTGAGGAACAAGGAGGTGCTGGGGGCCCTGGAGAGAGTGTTTGGGATATTGTCTTCCAAGAAGAAATGA

XM_004841210.1 Coding sequence

LOC101720613 glycine cleavage system H protein, mitochondrial-like

Length: 519 bp    Location: 33861814..33861296   Strand: -
>XM_004841210.1
ATGGTGGTGCAAGTGGCCAACAGCATGCACACCATGGCCTGCAGCCTGCATGCAACCTCCGTGCCCTCTGTATCCTGCCTGATTGGGCCCTGTGGGTTAGGGTGTGTGCTGTCCAGTCCTGCACACAGGACAGCTGTGCTCAAAGCACATAAATTCACAGAGAAACATGAATGGATAACAACAGAAAATGGTATTGGAATGGTAGGAATCAGCATCTTTGCACAGGAAGCTTTGGGAGATGTTGCTTATTCTAGTCTGCCTGAAGTTGGGATAAAATTGAAAAAGCAAGATAAGTTTGGTGCTTTGGAAAGCATGAAAGCTCCCAGTGAAATCTGTTCTCCTGTGTCAGGAGAAGTAGCTGAAATTAATGAAGCACTTGCAGAAAATCAAGGGCTTGTGGACAAATCTTGTTGTGAAGTTGGTGGGCTAACCAAGATGACAGTGAGTGACACTTCAGAACTAGATGAGTTCTTGAGTGAAGAAGCATATGAGAACTATGTGAAATCAACTGAGGAGTGA

XM_004841212.1 Coding sequence

LOC101723070 olfactory receptor 14I1-like

Length: 915 bp    Location: 34032057..34032971   Strand: +
>XM_004841212.1
ATGGACAACCTCACTGTCTTCACAGAATTCCTCCTCGTGGATTTTGCAGGATCCTGGGAGCCCCAGGTTCTGCAAGGTGTGCTGTTCTTAGTGATTTATCTGGGAGCACTAACAGGAAATCTTGTGACTGTAACTGTCATCATGACAGACACACATCTGCACTCTCCCATGTACTTTTTTATAATCAGTGTGGCCTTAATAGACTGTGGCAGCATCTCAGTTATTGTTCCCAAGGCCATAGTGAATTCCATGACAGGCTGTAAGACCATATCTCTGACGGAGTGTGCTGCACAGATTTTCCTCTATCTTCTTTTTGCAGAGGTAGAATTTGCCCTCCTGGTTGTCATGTCCTATGACTGCTACATGGCCATTTGCGACCCTCTGCACTACAGGCTCATCATCACACAGTCTTTGTTCCCAGGCCACAGCTGGCTCCTGGGTCTCTGGTCTGGTCTTCTCTGCTGTCCACACAGGAGCTCTGTTCAGGCTTCCTCCACCAAGACCAATGTGATCCACCAATATTTCTGTGATATTCCTCAAATCCTGAGGATTTCATGTTCAGATGTCCAGTTTTCTGAATTTGTACTTCTTGCTGTAAGTGCTTCCCTCATCTTAGTGTGTCTTGCCTTTATGTTTCTGTCATATGTTAAAATATTTTCAACTGTGTTTAAGATCCTTTCTATGGAAGCCCGTAACAAAGCCATATCCACCTGTATCCCACAGCTGGCCATTCTCCTTTTGTTTCACATCTCTGGGGAGGTGTCTGTCTTGGGTCACATTGCAAAGAAACCATCCCTGAAGAATCTGCTGATGGCCATGTTCTACACCATGGTGCTCCCATTTGTGAACCCCATCATCTACTGTCTACACATCAAGGAAATCAATGGTTCTCTGAGAAGAATGTTCAGTAGATAA

XM_004841213.1 Coding sequence

LOC101723779 olfactory receptor 14K1-like

Length: 945 bp    Location: 34130935..34131879   Strand: +
>XM_004841213.1
ATGAAGAATCAGACACTTCTGAGGGAGTTTTTGCTCCTGAGATTGACAGACAGCACAGTGCTGCTGGGGCTCCAGGCTGCCTTCTTCTCCCAGATCTACCTGGTGGCCATGCTGGAGAATCTGATGATCATCCTAATCACAGTTCTCAACTGCCACCTCCACACCCCCATGTACTTCTTCCTCAGGCATTTGTCTTTCTTGGACCTGTGTCTCATTTCCACCACAGTCCCCAAATGTATTCTCAACTCCATCACCCTCAGAGAGTCCATCTCTTTCTTTAGGTGTGTGTGTCAGATCTTCTTGGTGGTCCTGTTGGCAGGGCCAGAGATGGGATTCCTCACCTACATGTCCTGTGATCATTATGTGGCCATCTGCCACTCTCTGCACTATGAGGCTGTCATGAGCAAAAGGTGCTGTGTCCAGTTGATGGCTGTGTCCTGGCTCAGTGGAGGGGCCCTGGGAATCTTCTGCTCAGCAAGGATGTTCTCCCTGGAGTTCTGTGGCTCCAATAGGATTCACCAGTTTTTCTGTGATGTTTCTGCCCTTCTAGAGCTCACTTGTTCTAAGGAATATGCTGCTATCAATGTCAGTCTGGTCCTTGGTATCTTCTATGTGTTCTCATGTTTGGTTTGCATCGTGGTCTCTTACGTGTTTATTTTCTCTACTGGGTTGAAGAGCTCATCCAGGCAGAGCAGGTCCAAAGCCTTCTCCACCTATGTACCCCACCTGGTGGTTGTCAGCACCTTTTTCCTAACAGGTACTTCTGCTTATTTAAAGCCAAGCTCCAATGCACCTCCTCTTCTCAAAGTGCTGTGTTCTTTGTTCTACACTGTGGCACGCCCAGCCTTGAACCCCATTATCTACTATCTGAGGAACAGGGACATTCAATCAGCTCTAAGAAATTTGTTGAGGAAGGCAAGGAGGGGACTAATAGAAGGATACTAA

XM_004841214.1 Coding sequence

LOC101724505 olfactory receptor 14I1-like

Length: 921 bp    Location: 34237443..34236523   Strand: -
>XM_004841214.1
ATGGACAACCTCACTGTCTTCACAGAATTCCTCCTCATGGATGTCACACACTCCTGGGAGTTTCAGGTTCTTCAAGGTGTGCTCTTTTTAGTGATTTATCTGGGAGCAATAACAGGGAATCTTGGGACTGTCATTATCATCATAACAGACATACATTTGCACTCCCCCATGTACTTTTTTATAAGCAGTGTGGCCCTCCTAGACCTCGGGAGCATCACAGTCGTTGTTCCCAGAGCTGTAGTGAAGTCCATGACAGGCAAAAAAACCATATCCCTGGCAGAGTGTGCTGCACAGATTTTCCTCTATGTCCTTTTTGCAGCTGTGGAATTTGCCCTCCTGGTGGTTATGTCCTTTGACCGCTACGTGGCCATTTGCCACCCTCTGCACTATGGGCTCATCATCACCCCAAGTCTGTGCTCCCAGGCTGTAGCTGGCTCCTGGGCATCTGGTCTGGTCTACTCTGCTATCCACACAGGTGCTCTGTTCAGGCTTCCCTTCACCAAGACCAATGTGATCCCACAATATTTCTGTGATGTACCTCAAATTCTGAGAATTTCATCTTCAGATGTCCAGTTTTCAGAATTTGTAATCATTGCTCTAAGCATTTGTCTTGTGTTAATATGTTTTTCATTTATGTTTATGTCATACACTAACATATTTTCAACTGTGCTCAAGATGCATTCTGTGGAAGCCCGAAACAAAGTCATATCCACCTGTACCCCACAACTGGCCATTCTCCTATTGTTGATCATTTCAGGAGCAATAGCTTACTTAGGTCCCATTGCAAATAAACCTTCCCTTAAGAATCTGCTCACTGCTATTTTCTATAGCGTGGTGCCACCATTCGTGAACCCCATCATCTACTGTCTACGCAACAGAGAGATCAATGCTGCTTTGCAAAGAATGTTCAACAGATTCTGA

XM_004841202.1 Coding sequence

LOC101711857 olfactory receptor 8K3-like

Length: 942 bp    Location: 33113772..33114713   Strand: +
>XM_004841202.1
ATGGAGGGGCCCAACCTCACAGCGGTGACTGAGTTCATCCTGCTGGGTGTCACAGATCTCCCTGAGCTGCAAGCTCTACTGTTCCTCCTGTTCCTCATCGTCTACCTGACCTCACTGCTGGGCAACCTGGGCATGATCATCTTCATCCAGTTGAACCCCAAGCTGCAAACTCCCATGTACTTTTTCCTCAGAAACCTGGCTCTCACTGATGTTGGCTATTCTACAGCTGTTGGACCCAAAATGCTGGCTAATTTTGTGGTGGATCAAAATACAATCTCCTATTATGGTTGTGCTACACACATTGCTTTCTCTGTTGTGTTTATTGCTTATGAGGTTTTTATTCTGTCTGTGATGTCCTATGACCATTATGTGGCCATCTGTAACCCTCTCCTCTATACTGTCATCATGTCACCAAGGCTGTGTTGGGTACTAGTGGGGACTCCCTATCTCTACTGCACATTTGTGTCTCTTCTGGTCACCATAAAGATATTCACTTTGGCCTTCTGTGGATACAATGTCATCAGTCATTTCTACTGTGACACTCTCCCTTTGATATCTCTTGTCTTCTCAGACACATATGAAATTGAATTGATAATTGTGATTTTTGCTGCTTTTGATTTCATTTCTTCTTTTCCGGTGGTCCTCATGTTCTACCTGCTCATCCTCATAGCCATTCTCAGGATGAAGTCTGCAGAGGGCAGGCACAAGGCCTTCTTCACCTGTGGGTCCCACCTAACCATGGTCACTGTGTTCTGTGGGATGCTGATATTTATGTACATGCAGAGCAAGTCCCATCACTCCAGTGACACTGACAAAGTGGATTCTATATTTTACACCCTGGTCATCCCTATGTTGAATCCTTTGATTTACAGCTTGAGGAACAAAGATGTAAAATGTGCCCTACAAAGATCATGGAAAAAAACTATGCAATATCTTTTCTAA

XM_004841203.1 Coding sequence

LOC101716791 olfactory receptor 4C15-like

Length: 945 bp    Location: 33315036..33315989   Strand: +
>XM_004841203.1
ATGCAAAACCAAAGTGTTGTGACTGAGTTTGTACTCCTGGGGCTCTCACAGAATCCAAGAGTTCAGAAAATAGCATTTGTGGTGTTTTTGTTGATCTACTTTGCAACTATGGGGGGCAACATGCTGATCGTGGTGACAATTGTATGCAGCCCTGCTCTGCTGGGCTCCCCCATGTACTTCTTCTTGGTATTCTTATCATCTCTGGATGCCTGCTTCTCCTCAGTTGTCACCCCAAAGACAATTGCAGACACTCTCCATGAGAGGAAAACCATCTCCTATGAAGGCTGCATGATGCAGGTCTTTGGTGTACACTTCCTTGCAGGGGCAGAGGTGATTGTCCTCACCGCCATGGCCTATGACCGCTATGTGGCCATTTGCAAGCCCTTGCACTACTCCTCCATCATGAACTGGAGGCTCTGTGGCATTCTGATGGCCGTAGCCTTGATAGGTGGCTTCCTACACTCTATGATTCAAATTTTCTTTACTTTCCACCTGCCACTATGTGGCCCCAACATCATCGATCACATCATGTGTGACCTGTACCCATTATTGAAGCTTGCCTGCACTGACACACACATCTTGCGTCTTTTGGTGGTTGCCAACAGTGGGTCTTTCTGCATCCTCATCTTCTCTATGTTGCTTGTGTCCTATGGTGTCATCTTGTTTTCCCTGAGGAAGCACAGTTCTGGAGGGCAGAGGAAGGCTCTCTCCACCTGTGGGTCCCACATTGCTGTTGTGGTTTTATTTTTTGTTCCGTGCATATTTATGTATGCACAACCTCCATCTGTTTACTTCTTTGATAAAGTTGTGGCCATATTTTGCACCATGTTAACTCCCTTGTTCAATCCTATTATTTATACATTCCGGAATAAGGACATGAAGAATGCAATGAGAAAAGTATGGAAGAGATTTGTGGTGGTTTCTGATGAAAAAATAAAACATTAA

XM_004841204.1 Coding sequence

LOC101717143 olfactory receptor 7D2-like

Length: 570 bp    Location: 33324302..33334266   Strand: +
>XM_004841204.1
ATGAATAGAAGAATAATCAAATTCATTCTGTTTGGGTTGACACAAGATGTGGAAAACCAGAAGGTGATATTTGGGATTTTCTTGATTCCTTACATTATGACTCTGTTGGGCAACTTTGTCACCATGGTGACCATTAAAGCCAGCCAGACCCTTGGGAGTGCCATGTACTTCTTCCTCTTCTACTTGTCCTTCACTGATGCTTATTTCTCTACAAGCACGGCCCCCAGACTGATCTCAGATGCCCTTTCTCAGAAGAAAATGGTGGCTGTGTTTTACACAATCGCCACGCCCTTACTCAACCCTCTCATCTATACCCTGAGAACACAGAGAATATTTTTGCTTAAAAGCCTTCAGCAAATTCTCACATTTGAAGAATTATCTACACAGTACAAAGTAACTCTCAGGGGCCATGTTTATCAAAACCAGAGAATTCCAAGGAACACACAAGCCCCAAGCAACACACCACAGAACTGTGTCCCTGGTGTGAGAGGAACAGGAAAGGGCTCATCTCAGGAAGATTCTCTCTTGCAAAGGGAAAGGCTGGCCTGGACTCATGTACAGAGAGAATGA

XM_004841205.1 Coding sequence

LOC101717489 olfactory receptor 4C16-like

Length: 579 bp    Location: 33354861..33355439   Strand: +
>XM_004841205.1
ATGGACTGCTATGTGGCCATCTGTAAACCCCTGCACTACACAACCATTGTGAACTGCAGGCTCTGTGCAGTGTTTGTCACTGTGGCCCGGGTGGGATCCTGTGTGCATTCTTTAGCTCAGATTCTTCTGACATTGAGTCTGCCTTACTGTGGCCCCAGTGTGATTGATCACTATTTCTGTCACCTGGAGCCCCTGGTGGAAGTTGCCTGTGTGGACATCTACGTGGTCAACCTGCTCTTGGTGTCCAACAGTGGGGCCATTTGTTCAGTGAGTTTTGTCTTACTGATGTTCAACTATGTTGTCATCCTGCATTCTTTCAGAAGCCACAGCACTGAAGGGAGGAGGAAAGCCCTCTCCACCTGCATCTCCCACATCACCATGGTTGCCTTGTTCTTTGCACCTTGCATGTTTATTTACACATGCCTTGCCACCACCTTCCCCATGGATAAGGTGATAGCTGTGTTTTACATGATTGGAATACCCTTTCTCAACCCACTGATTTACACACTGAGGAATGCAGAAGTGAAAAACGCCATGAGCAAGTTGTGGAGCAAGAAGTTGATCTCAGATGTTATGTGA

XM_004841206.1 Coding sequence

LOC101718862 olfactory receptor 14I1-like

Length: 537 bp    Location: 33585823..33584891   Strand: -
>XM_004841206.1
ATGGATAACCTCATCATGTTCACAGAATTCCTCCTCCTTAGTATTGCAAGCTCCCAGGAGCTCCAGGTTCTGCAAGGCTTCCTGTTCTTAGGGATTTATCTGGAAACACTAACAGGGAATCTAGTGACTGTCATTGTCATTGTGATAGACACACATCTGCACTCTCCCATGTACTTTTTTATAAGCAACGTGGCCCTGCTAGACCTCAGCAACCTCTCATGTTTGCCTTGTCTTATTATGTTTATTGTATTGATGTTCATGTCATATGTTACTATATTTTCAACTGTGCTTAAGATGCATTCTGTGAAAGCCCTTAACAAAGCCATATCCACCTGTACTCTGAAGCTGGCCATTGTTTTTTTGGATCTTATTTCTGAGTCAGTGACTGTTGTAGGGCCCACTGCAAAGAAACCATCCCTTAGGAGTTTGCTGACTGCCATGTTCTACACCATGGTGCCCCCATTCATGAACCCCATCATCTACTGTTTATCCAACAGGGATATCCATGCTGCTCTGAGAAGAATGTTCAGTAAATAA

XM_004841207.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 951 bp    Location: 33675090..33674142   Strand: -
>XM_004841207.1
ATGAGCAATCAGACACTTCTGAGGGGGTTCTTGCTCCTGAGACTGACAGACAACATGGTGTTGCTGAGGCTTCAGGCTGCCCTCTTCTCCCTTGTCTACCTGGTGGCCATGTTTGAGAATCTGACCATTCTCATCCTCACAATTCTGGACTGCCACCTTCACACTCCCATGTACTTCTTCCTCAGGCATTTGTCTTACGTGGAACTCTCTCTCATTTCTACCACAGTCCCCAAATCCATTCTAAACTGTTTCATCCTCAGCGAATACATCTCTTTTTTGGGGTGTATGTGTCAGCTCTTCTTGGTGATCCTGTTGGCAGGGTCAGAGGCAGGAATCCTTACTGCCATGTCCTATGATCGCTATGTGGCCATCTGCCACCCTCTGCACTATGAGGCTCTCATGAGCAATGGGTGCTGTGTACAGTTGATGGCTGTGTCCTGGTTCAGTGGAGGGGCCCTGGGAATCTTGTACTCAGTGGGGATATTCTCCTTGGAGTTCTGTGGCCCCAACAGGATTCACCAGTTTTTCTGTGATGTCCCTGCCCTTCTAGAGCTCACTTGTTCTGAGGAGCGTGTTGCTGTCAGTGTCAGTGTGGCCCTTGGGGTTCTCTATGCATTCTCATGTTTGGTTTGCATCATGGTCTCCTATGTTTATNNTTTCTCTACTGTGTTGAAGATCCCATCCAGGCATAGCAGGTCCAAAGCCTTCTCCACCTGTATGCCCCACCTGGTGGTTGTGAGCACCTTTCTCTTAACAGGTTCTGCTGCTTATTTAAAGCCAAGCTCCAATGCACCTCCTCTTCAGGATGTGCTGTGCTCTATGTTCTACACTGTGGCACCCCCAACCCTGAACCCCATTATCTACTGTCTGAGGAACAGGGATATTCATTCAGCTCTAAATAAAGTCCTGAGGAAAGTGAGAAGGGGCCTAATAGAAAGATACTACAGCTAA

XM_004841195.1 Coding sequence

LOC101701789 olfactory receptor 2G3-like

Length: 993 bp    Location: 32086138..32093308   Strand: +
>XM_004841195.1
ATGCTCATTGTACTGCAGAATTCCCGGGTTTTTACTGACCTGTGTGGTGAGCTGTTAGCCAGTGTCCATGTGGCGCTGCTCTTGATGATTCCGACACAGAGTCCACTCTTTGCAGTGGTCCTGGTCTCCTACCTGCTCACTCTGTTGGGGAACAGCTCCATCATTATCCTCTCCCTGCTGGGCCCCAGACTGCGGATTCCCATGTACTTCTTCCTGGACAACCTCTCTCTACTGGATCTCAGTGTCACCTGCACCATTGTGCCTCAGCTGCTGGTCAACCTCTGGGGACCAGACAAGACAATTGCTGCCTGGGGCTGCATCACACAACTCTATGTTTATACCTGGACAGGTGCCACTGAATGCATCCTGCTGGCTGTGATGGCCATTGATTTCTATGTCGCCATCTGCTGGCCCCACCAGTACACTCTTATCATGCATCCCTGGATTTGTGCACAGATGGCAGCTGCCTCCTGGTCCAGTGCCCTGGCCAGTACTCTGCTCCATGCCACACTCACCATCCAGCTCCCACTCTGTGGGCACCACACCCTGGACCACTTCTTCTGTGAGATACCTGTGCTCATCAAGCTGGCCTGTGGGGACACCACAGCTAATGAGCTGGCCCTGGCTTTAGGAGCCATTCCTTTTGCAGGGATGGCTCCTCTGATGGTGGTCATCTCCTACATCTTAATTGTCAGGGCTATTCTGAAACTACTGTCAGCTGAAGGAAGACACAAGGCACTCAGCACCTGCAGTTCCCACTTGCTGGTGGTCACCATGTACTTTGGGCCAGGCATCTACATGTATCTCCAGCCCCCTTCCCACAGCACAAAGGCCAAGTTTATGTCATTCTTATACAGCATTATCACCCCAGTGCTCAACCCACTCATCTACACCCTAAGAAACAAGGATGTGAAGACAGCATGGAAGAGGATCCTTCAATCCCAGGGTGAGGTGAAGTCTTGGAAAGTCAGAAGATCCCTGACTGTGTCCTGA

XM_004841197.1 Coding sequence

LOC101702835 bifunctional protease/dUTPase-like

Length: 666 bp    Location: 32454850..32454185   Strand: -
>XM_004841197.1
ATGAAGAGTATTCTGATTGCTCCAGGGCTAATAGATGGGGATTTTAGTGGAGAAATCAAAATCATGACCCACTTGCCTACCGGGATTTCTGTGATACAAGCAGGGCAACGTATAGCACAGTTGCTGCTGCTTCCGCAGATACCAACAAAAAATCCAGCAATAAGGAAAAAAAGAGGAGATGCTGGATTCAGCTCTTCCGATGCTTATTGGGTACAGCCCATAGGAGCCCATTGGCCTGAGCTCACCTTGACCATTAATGGAAAAAATTTTCAGGGCTTGTTAGATACTGGAGCTGATGTTTCCATTCTAACTGCCGATCAATGGCCCATGGCATGGCCTAAACAATCAACCATGACCCAGTTACAGGGAATAGGTCAAAGCCAAAGTGCTGAACAGAGTAGTGATGTGTTGTTTTGGAAAGATGCTGAAGGTCATCAGGGTAGATTCCAACCGTACATTGTGCCGGGGCTGCCAGTTAATCTGTGGGGCCGAGATGTTATGAAAGAAATGGGGGCATATTTGTATAGTCCTAGTGAACAGGTCAACCACCAAATGTTTGAGCAAGGACTCTTACCTAATCAAGGCTTGGGAATTACAGGTCAAGGAATACAAAAACCTTTAATGCTGAGCCAACGGCCTTCAAAAACAGGTTTAGGGTATTTTTAA

XM_004841189.1 Coding sequence

LOC101722841 olfactory receptor 5V1-like

Length: 942 bp    Location: 30823501..30822560   Strand: -
>XM_004841189.1
ATGGACATCTATAATGTCACCAGTGTGACTCAGTTCATCCTCATTGGGCTCTCTGACCTCCCCAAGGTGCGCTACCCTCTCTTTGTGGCCTTTGCCATCATCTACCAGGTCACCTTGGTGGGGAATGGGGCCATCCTCTTGGCCATTGGGACTGAGGCAAAGCTGCACACTCCCATGTACTTCTTCCTTGCAAACTTGTCCCTCTTAGACATATTCTGCCCAACAACAACTGTCCCCAATATTCTGCACAACCTCTTGACTAAGAACCACAGCATTTCCTTTGTTGGGTGTGCTCTGCAGCTGTATTTCCTGGTTGCACTTGTTGGGACTGAAGTCTTCCTGCTGGCTGTCATGGCTTATGACCGGTATGTAGCCATCTGCTTCCCCCTTCGCTACTCTGTCATCATAACCAAGGCTCACTGTGCTCAGCTGGTCTCTGGGATCTGGGCAGCTGGATTCCTCAATTCCACCATCCACACAATATCCACCTTCAGCCTGTCCTTCTGCAGGTCCAATCTGGTGAACCAGTATTACTGTGATATCCCACAAATTGTGGCCCTGTCTTGCTCATCCACTTATGCGGCTGAAATGCTTATTTTTGTGGTAGGGGGTATCAGTGCATTCATTTCCTTCCTGACCACCTTGATCTCCTATGTGTACATCATCTCCACCATCCTGAAGATCCAGTCTGCAGAAGGGAAGCACAAAGCCTTCTCCACATGTGCCTCCCACCTCCTGGTGGTCTGTCTGTTCTATAGCACAGCCATCTTCACCTACATCCGGCCCTCCTCCAGCCAACACTCCCCTGCCAGGGACAGACTCATCTCCATGCTCTATGGGGTCATCACCCCAATGCTTAACCCTGTCATCTACAGCCTGAGGAACATGGAGGTGAAAAAGGTCCTCAGGAGGGCTGTATATGGTAGAATGTGCTCACAGTAA

XM_004841190.1 Coding sequence

LOC101723899 olfactory receptor 2B2-like

Length: 933 bp    Location: 31001560..31002492   Strand: +
>XM_004841190.1
ATGAGCTTTCCCAACACTTTTGTCCTGCTGGGCTTCTCAGAGTTTCCATGGCTAGAGAGGCCCCTCTTTGCAGTGGTCCTGGTCTCCTACCTCCTCAGCCTGGTGGGTAACAGCTCCATCATCCTCCTCTCCCTAGTGGACCCCAGACTCCAGACACCCATGTACTTCTTCTTGGATAACCTCTCTCTGCTGGACCTATGTATCACCTGCACCACTGTGCCGCAGCTGCTGGCCAACCTGTGGAGATCAGGAAAGACCATTACTTCCTGGGGCTGCATCACACAGAGCTATCTATTTGGCTTGGCAGCCAGCACTGAATGTGTCTTGTTGGCCATGATGGCCATTGACCGCTATGTGGCCATCTGCTGGCCCCTCCAGTACACTCTCATCATGCGTCCCTGGGTATGTGTGCAGATGGCAGCTACCTCCTGGTCCAGTGGCCTCACCAATGCTCTGCTCCAAGCCACACTCATGCTCCAGCTCCCCTTCTGTGGGCACCACACCCTGGACCACTTCTTCTGTGAAGTGCCTGTGCTCATCAAGCTAGCCTGTGGGGACACCTCTGCTAATGAGCAGGCCATCACATTTGCAACCATTCCATTTGGAATGGTGGCTCCACTGATGATGGTCATCTCCTACATCTTTATTGCTAGGGCTGTACTTAAGCTACCTTCAGCTGAAGGAAGGCAAAAGGCACTCAGCACCTGCAGTTCCCACTTGTTGGTGGTAACTCTGTACTTTGCACCTGGCATGTACATGTACCTCCAGCCTTCATCCAAGACTTCCCAAGCCAAGTTCATGTCCTTTTTCTGCTGCATTATCACACCACTGCTCAATCCACTCATCTACACCCTGAGAAACAAGGATGTGCAGACAGCGTGGAAAAGGATCCTGAAATCCCAGGGCAGAGTGAAGTCTCTAAAAGCCAGATGA

XM_004841191.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1059 bp    Location: 31025371..31035773   Strand: +
>XM_004841191.1
ATGAATGATAAAGTGAGGGCTATGATTCCTGGGGATCCTCTGCTGGAGGACCCTGAAGAATGGGTGAGGTTGGGTGTGTCTGGATACAGGACCATCGCTGTGGCTGGCAGTGAGTCAGATGTGGCAATGAGGAGATCCGAGGTTGGCCTGGAATTCATTCCTGACTTCAGGAGGAAGTTCCCATGGCTCAAAAGGCCACTCTTTGCAGTGGTCCTCATCTCCTACTTCCTCAATCTGGTGGGGAATAGCTCCATCATCCTCCTCTCCCTGGAGGACCCCAGACTTCAGACACCTATGTACTTCCTGGACAACCCCTCTCTGCTGGACCTCAGTGTGACCTGTGGCACTGTGCCCCAGATGCTGGCCAAGCTCTGGGGACCACACAAGACAATTGCTGCCTGGGCTTGCATCACACAGGGCTATATTCTTAACTGGACTGCCTCTGCTGAATGCATCCTATTGGCCATGATGTCCATTGATCACTATGTGGCCATCTGCTGGCCCCTCCAGTACACTGTCATCATTTGTCCCTGGGCATGTGTGCATATGGCAGCTCCCTCCTGTTCCAGCAGGCTCCTGAATTCCCTGCTCCAAACCACTCTCACCCTCCAGCTCCCCCTCTGTAGACAGCATACTCTGGACCACTTCTGTGAACTGCCTGTGCTCATCAAGCCAGCCTTTGGGGAAACCACTGCTAATGAGCTGGCCCTGGTTATTGGACCCATTCCTTTTGCAAGGATGGCTCCCATGCTGGTGGTCACCTCTGACACCTTCATTGCCAGGGCTCTACTGAAACTACCTTCAGCTGAAAGCAGGCACAAGGCACTCAGCACCTGTAGTTCCCGCTTGCTTGTGGTCACCATGTACTTTGCTTCTGCCATGTATGTGCAACTCCAGCCTCCAAAAAATCACACTCAGGCAAAGTTCATGTCCTTCTACNNTGTTATTACCCCAGTCCTCAACACACTCATCTATACCCTGAGAAACAAGGATGGGATGCCAGCATGGAAGAGGATCCTGCAATACCAGGGTGGGGTGAAGTCTTTGGAAGTGAGATGA

XM_004840799.1 Coding sequence

Crls1 cardiolipin synthase 1, transcript variant X3

Length: 576 bp    Location: 6828678..6852071   Strand: +
>XM_004840799.1
ATGTTGTCAATGACAAGAATTGGCTTGGCTCCAGTTTTGGGCTATTTGATTATTGAAGAAGATTTTAATGTTGCACTCGGAGTCTTTGCTTTAGCTGGACTTACTGATTTGTTGGATGGATTTATTGCTCGAAACTGGGCCAATCAAAAATCAGCTTTGGGAAGTGCTCTTGATCCACTTGCTGATAAAATACTTATCAGTGTATTATATGTTAGCTTGACCTATGCAGATCTTATTCCAGTTCCACTTACTTATATGATAATTTCAAGAGACATAATGTTGATTGCTGCTGTTTTTTATGTCAGATATCGAACTCTCCCAACACCGCGAACACTAGCTAAGTATTTCAATCCTTGCTATGCTACTGCTAGGTTAAAACCAACATTCATCAGTAAGGTGAACACAGCGGTCCAGTTAATCTTGGTGGCAGCTTCTTTGGCAGCTCCAGTTTTCAATTATGCTGACAGCGTTTATCTTCACATACTGTGGTATTTTACAGCTTTCACCACAGCTGCATCAGCTTACAGTTATTATCATTATGGTCGGAAAACTGTTCAAGTGATAAAAGACAGATGA

XM_004841174.1 Coding sequence

LOC101710881 chromosome unknown open reading frame, human C20orf195

Length: 1326 bp    Location: 29208099..29210639   Strand: +
>XM_004841174.1
ATGGCGTTCAGGCGCCAGCTGGACGGCCCTTCCCGCACTCAGAGACCCCCAAGTATAGGGGCCCAGGCCAACGTGGTGCCCTGGGGGGCGGAGACCAGGCCTCTTCTGAGGGAGCTTCACCCCCACAACCCACGACCCGCCCGGCTGCGGCTCGCCCTGCGGTGTGGTGGACAACTTGTTTCCCTCCAGTCCCTCACCCGGGCTGGCCGGATAGGGCGTCACAATGGCTTCCGGTCTCCATGGCAACCCGGGGCTGGCTGCGCGGGGCCGGAGCGGAAGGCCCTGGACAGTTTGCCACAGGTCTCCGCGCGCCTAGAGGCCTGGCCCAGGCCGGTGACCTTCCAGGTAGCAGGCCTGGGCCTGGACAAGATGAAGCTGGACAGTTCACAGTGCTTTCTGCACGCGGAGGAGGTGGAGGATCAGCAGCTGCTGGAACCGGAGGCCTGGAGGACCTACACAGAGCGCCGCAACACCCTGCGGGAGTTCCTGACCTCGGACCTGAGCCCCTACCTGCTCAAGTGCCACCATGCCCGCATCCAGCTGCTCAGGAAGTGCTCCTACCACATCGAGATCTTCCCCAAGCATCTGGCCCTGGGCAACCAGAACTCACCGGTGCTGCCCAGCACTATGTATCAGCTCATTGACCCCTGCAGGTTCCAGCGCATGAAGAAGGTGGGCACGGCACAGACAAAGATCCAGCTTCTGCTGCTTGGGGACCTGCTGGAGCAGCTGGACCAGGGCCGCCTGGAGCTGGACTCCCTGCTTGAGTCGCCAGACCTGCGGCCTTTCCTGGCTGGCTGGGGACTTGTGGAACAGCGTCTAGCATACTTGTCCGCTGTCATGGACAACTTCCTGGCCATGATGGTACCAAGCCGCCTGCATATCAAGCACCACCTGGTGTCTGACATCGGAGCCACCAAGATCCCACACATCCGGCTCATGCTGAGCACCAAGATGCCGGTCATGTTTAACCGGAAGGAGTCAGTGGCCCACTGGGACTGGGTCAGCCTGCGCTGGTTTGCCACCGTCCAGCAGGCAGCACTGGAGCAGTTTGAGCTGCGCTTCAAGCTGCTGGAGCCACGAACGCAGCAGGAATGCATGCAGTGTGGGGTCATCTCCGTGGCAGCCTGCACCTTTGAAGTCCACAACCTGCTGCCCAATCGCACCTACAAGTTCACTGTCAAGAGGGCAGAGAGCTACACACTGGTGTATGAGCCCTGGCAGGACAGCCTTACTCTGCAGACCACTCCGGGGCCCCCTGAGGGGCTCACCCCCACCCGGCTGGGAAAACCCAGCCTGCCTTTGACTGCACCTTCTGAGAGATGA

XM_004841169.1 Coding sequence

Lama5 laminin, alpha 5

High confidence: 4 potential gene matches
Length: 11115 bp    Location: 28217113..28156958   Strand: -
>XM_004841169.1
ATGGCGAAGCGCGACGACCCGCTCCGCGCCCAGAGCGCACGGGGCCCCCGCGGCCCGGCGCCGCTGCTGCTGGCCGGTCTGGCGCTGCTGGGCGCGGCGCGGGCGCGGGCCCCGGAGGACGGCGGCTTCAGCTTGCACCCCCCGTACTTCAACCTGGCCGAGGGCGCTCGCATCGCCGCGTCCGCGACCTGCGGCGAGGAGGCCCCGGCGCACGGGCCCCCACGCCCCACCGAGGACCTGTACTGCAAGCTGGTGGGCGGCCCCGTGGCCGGCGGAGACCCCAACCAGACCATACAGGGCCAGTACTGCGACATCTGCACAGCCTCCAGCAGCAACAAGGCACACCCCGTGAGCAACGCCATCGATGGCACGGAGCGCTGGTGGCAGAGCCCACCACTGTCCCGGGGCCTGGAATACAATGAGGTCAACGTCACCCTGGACCTGGGCCAGGTCTTCCACGTGGCCTACGTGCTCATCAAGTTTGCCAACTCCCCTCGGCCAGACCTCTGGGTGCTAGAGCGCTCCACAGATTTCGGCCACACCTACCAGCCGTGGCAGTTCTTCGCCTCCTCCAAGAGGGATTGCCTGGAGCGATTCGGGGCTGGGACGCTGGAGCGGATCACGCAGGATGATGATGTCATTTGCACCACCGAGTACTCCCGCATCGTGCCCCTGGAGAACGGCGAGATCGTGGTGTCCTTGGTGAACGGGCGCCCTGGAGCCATGAACTTCTCCTATTCACCACTGCTCCGAGACTTCACCAAAGCCACCAACATCCGGCTGCGTTTTCTGCGCACCAACACGCTGCTGGGCCACCTCATGGGCAAGGCACTGAGAGACCCCACCGTCACCCGCCGGTACTACTACAGCATCAAAGACGTCAGCATTGGTGGACGCTGTGTGTGCCATGGCCACGCGGATGTCTGCGATGCCAAAGACCCCTCGGACCCTTTCAGGCTTCAGTGTGCCTGCCAGCACAACACATGCGGGGGCTCCTGTGACCACTGCTGCCCCGGCTTCAACCAACAGCCGTGGAAGCCGGCCACCACTGACAGTGCCAACGAGTGCCAGTCCTGTAACTGCCACAGCCATGCCCATGACTGTTACTACGACCCTGAGGTGGACAGGCGCAACGCCAGCCGGAACCAGGACAGTGTGTACCAGGGTGGGGGCGTCTGCATCAACTGCCAGCATCACACCACTGGCATCAACTGTGAGCGCTGTCTACCTGGCTTCTACCGCTCCCCAGACCACCCTCTTGACTCCCCCGACGCCTGTCACCGCTGCAACTGTGAGTCCAACTTCACCGATGGGACGTGTGAGGACCTGACTGGCCGCTGCTACTGCCGGCCAAACTTCACCGGGGAGCACTGCGACATGTGTGCTGAGGGCTTCACAGGCTTCCCGAATTGCTCCTCTGTGCTGTCCTCCCACAACGACACCGGGGAGCAGGTGCTGCCACCGGGGCACATTGTGAATTGTGACTGCAGCGCCAGCGGGACTGAGGACAACGCCTGCCGGAAGGACCCAAGGGTTGGTCACTGCGTGTGCAAACCCAACTTCCGGGGTGCCCACTGTGAGCTCTGTGCTCCGGGGTTCTACGGACCGAGCTGCCAGCCATGCCAGTGCTCCAGTCCCGGGGTGGCCAATGGCCTCTGTGACCCCAACTCTGGCCAGTGCAGGTGTCGCATAGGCTTTGAGGGGGCTGCCTGCGATCACTGTGCCCCCGGCTACTTCCATTTCCCTCTGTGCCAGCTGTGTGGATGCAGCCCTGCAGGGACCTTGCCCGAGGGCTGTGATGAAGCTGGCCGCTGCCTGTGCCGGCCCGGGTTTGATGGCCCCCACTGTGACCGCTGCCGCCCAGGCCACCACAGTTACCCCAGCTGCCATGCCTGCGCCTGTGACCCCCGGGGGTCCCTGGACCAGCTCTGCGGGGCAGGTGGTTTGTGCCGCTGCCGCCCCGGCTACATGGGTGCCACCTGCCAGGAATGCAGCGCTGGGTTCCATGGCTTCCCCGCCTGCATCCCCTGCCACTGCTCCACTGACGGCTCCCTGCACTCAGCCTGTGACCCCCGGACAGGCCAGTGCAGCTGCCGGCCCCGTGTGGCGGGGCTGCGGTGTGACGTGTGTGTGCCTGGTGCCTACAACTTCCCCTACTGCGAAGCTGGCTCCTGTCACCCTGCTGGCCTGGCCCTGGCCAATCCCAACCCTCATGAGTCTCATCCTCTCCTGGCACAGGGTCCGTGTGTGTGCCGGGCTCATGTGGAGGGGCCGAGCTGTGACCGCTGCAAACCTGGCTTCTGGGGGCTGAGCCCCAGCAACCCCGAGGGCTGCACTCGCTGCAGCTGTGACCCCAGGGGCACACTGGGTGGAGTCTCCGAGTGCCAGCCGGGCAGTGGCCAGTGCTTCTGCAAGCCCCATGTGTGTGGCCAGACCTGTGCGGCATGTGAGGACGGCTTCTTCGGGCTGGATCAGGCTGACTACTTTGGCTGCCACAGCTGCCGATGTGACGTCGGTGGAGCCCTGAGCCGGGGCTGCGACCCGAAGACAGGCACTTGCCGGTGCCGCCCCAACACCCAGGGTCCTACCTGCAGCGAGCCCGTGAAGGACCACTACCTGCCTGACCTGCACCATCTGCGGCTGGAGCTGGAGGAAGCGACCACCCCCGAGGGCCATGCTGTGCGCTTTGGCTTCAACCCGCTGGAGTTCGAGAACTTCAGCTGGAGGGGCTATGCGCACATGGTGCCCATCCAGCCCAGGATCGTGGCCAGGTTGGACGTAGCCTCCTCTGACCTCTTCCGACTGGTCTTCCGCTACGTCAACCGTGGGCCCACAAGTGTGAGTGGCCGGGTCTCTGTGCAGGAGAACGGCAAGTTCAGCACCTGCGTCAACTGCACAGAGCAGAGCCAGCCCGTAGCCTTCCCACCCAGCACCGAGCCTGCCTTCATCACCGTGCCCCAGAGGGGCCTTGGGGAGCCCTTTGTGCTGAACCCTGGCACCTGGGCCCTGCTCGTGGAGGCCGAAGGGGTGCTCCTGGACTATGTGGTCCTGCTGCCCAGCGCCTACTATGAGGCAGCCCTCCTGCAGCTTCGAGTGACCGAGGCCTGCACCTACCGCCCCTCCGCCCGTCGCTCCGGGGAGAACTGCCTTCTCTATGCACACCTCCCCCTGGACGGCTTCCCCTCGGCTGCTGGGCCTGAGGCCCTGTGTGGCAGTGACAACAGCCTGCCCCGGCCCTGCCCCCTGGAGCAGCTCAGCCCTTCACACCCACCGCTGGCCGCCTGCCTGGGCAGTGACGTGGACATCCAGCTGCAAGTAACTGTGCCACGGCCGGGCCGCTACGCCCTGGTGCTGGAGTATGCCAACGAGCATATGCGCCAGGAGGTGGACGTGGCCGTGCACACTCCCCAGCAGGGCCCCCAGCTGGGGGCCGTCAGCCTCCACCCCTGCAGTTACAGCACCTTGTGTCGGGGCCTCGTCCTGGACGCTCGGCACCACGTGGCCACCTTCTACCTGGACTCAGAGGCCAGCATCCGACTCACAGCAGAGCAGGCGCGCTTCTTCCTGCACAGCGTCATTCTGGTGCCCCAGGAAGAGTTCAGCACAGAGATGGTGAAGCCCCGGGTCCGCTGCACGAGCAGCCACGGCACCTTCGGGCCCGGCAGTGCCGCCTGCCTGCCCTCCCGCTTTCCGAAGCCGCCGAGACCCATCATCCTCAGGGACTGCCAGGTGCTGCCACTGCCTCCCAGCCTCCCTCTGACCCACTCTCAGGAGCTCACACCAGGTGCGGCCCCCACTGGGCCCCAGCCTCGGCCCCCCACTGCTGTGGATCCCGACACGGAGCCCACCTTGCTGCGCCACCCCCAGGGCACTGTGGTCTTCACCACCCAGGTGCCCGCCCTGGGCCGCTATGCCTTCCTGCTGCACGGCTACCAGCCAGCCCACCCCAGCTTCCCTGTGGAGGTCCTCATCAGCGGGGGCCGCATCTGGCAGGGCCACGCCAGTGCCAGCTTCTGCCCACACGCCTATGGCTGCCGCACCCTGGTGCTGTGTGAGGGCCAGGCTGTGCTGGATGTGACTGACAGTGAGCTCACGGTGACCGTGCGTGTGCCTGAGGGCCGGTCATTCTGGCTGGATTACGTGCTCGTTGTCCCTGAGGATGCCTATAGCCCTAGCTACCTCCGGGAGGAGCCCCTGGACAAGTCCTACGACTTCATCAGCCACTGTGCTGCCCACGGCTACTACATCAGCCCCCACAGCTCATCCCCATTCTGCCAAGACGCTGCCAACTCGCTGTCCCTCTTCTACAATAATGGGGCCTTACCTTGTGGCTGCCACGAGGTGGGCGCCACAGGCCCCACATGCGAGCCCGTCGGGGGCCAGTGTCCCTGCCGGGCCCATGTCATCGGCCGTGACTGCTCCCGCTGTGCCACTGGCTACTGGGGCTTTCCCAACTGCAGGGCCTGCGACTGTGGTGCCCGCTTGTGTGAGGAGCTCACGGGCCAGTGTATTTGCCCGCCACGCACTGTACTCCCTGAGTGCCTGGTCTGCCAGCCCCGGACCTTCGGCTGCCACCCCCTGGTCGGCTGCGAGGAGTGTAACTGCTCGGGGCCCGGCGTCCAGGAGCTCACCGACCCTACCTGTGATGTGGACAGTGGCCAGTGCAAGTGCAGACCCAATGTGGCTGGACGCCGCTGTGACAGCTGTGCCGCAGGCTTCCACAGTTATCCCAGCTGCCGCCCCTGTGACTGCCACGAGGCCGGCACTGTACCTGGTGTGTGTGACCCCCTCACAGGCCAGTGCCACTGCAAGGAGAACGTGCAGGGCCCGAGGTGTGACCAGTGCCGCCTTGGGACCTTTTCGCTTGACGCTGCGAACCCCAAGGGCTGCACCCGCTGCTTCTGCTTTGGGGCTACGGAGCGCTGCAAGAGCTCTGCCCACGTCCGCCGTGAGCTTGTGGACATGGAGGGCTGGACTCTGCTGAGCACTGACCGGCAGGTGGTGCCCCACGAGAGACTGGCGGAATCAGAGCTGCTGCGTGCGGACCTGCAGCACATGGCCAGCTCCCTCCCTGATGCCCTCCCCGAGCTGTACTGGCAAGCCCCACCCTCCTACTTGGGAGACCGGGTGTCGTCCTATGGTGGGATGCTCCGCTATGAGCTGCACTCGGAGACCCAGCGCGGAGACGTCTTCATCCTCACCGAGAGCAGGCCGGATGTGGTGCTGCAGGGCAACCAGATGAGCATCACATTCCTGGAGCCAGCATATCCTGCACCCGGCCACGTCCATCTCGGGCAGCTGCTGCTGGTGGAGGGGAACTTCCGGCACACAGAGACCCACAATGCTGTGTCCCGTGAGGAGCTCATGATGGTCCTGGCAGGCCTGGAGCAGCTGCAGATCCGCTCCCTCTTCTCGAAGGTCTCCTTGGCTGTCTCCTTGCGTAGGGTCATGCTGGAGGTGGCCAGTGAGGTGGGCAGAGGCCCTCCAGCCAGCAGTGTGGAGCTGTGCATGTGTCCTGCCAACTACCGTGGGGACTCGTGCCAGGAATGTGCCCCTGGCTATTACCGGGACACCAAGGGACTCTTTCTGGGCCGATGTGTCCCCTGTCAGTGTCATGGCCATTCAGACCGCTGCCTCCCTGGTTCTGGCGTCTGCGTGGGCTGCCAGCACAACACAGAGGGGGATCACTGTGAGCGCTGCCGGGCTGGCTTCGTGAGCAGCAGGCCTGAGGACCCCTCTGGCCCCTGTGTCAGCTGCCCCTGCCCTCTGGCGGTTCCTTCCAACAATTTCGCGGAGGGCTGTGTCCTGCGCGGCGGCCGCCCCCAGTGCCTCTGCAGACCCGGCTACACGGGGGCCTCCTGTGAGCGGTGTGCGCCCGGCTTCTTTGGGAACCCTCTGGTGCTGGGCAGCTCGTGCCAGCCCTGTGACTGCAGCGGCAATGGCGACCCCAACATGATCTTCAGCGACTGTGACCCCCTGACAGGCGCCTGTCGCGGCTGCCTGCGCCACACCACCGGGCCTCACTGTGAAAGCTGCGCCCCTGGTTTCTACGGCAATGCCCTGCTGCCTGGCAACTGCACCCCGTGTGACTGCTCCCCGTGCGGGGCAGAGGCCTGTGACCCCCGGAGTGGCCGCTGCCTGTGCAAGGCTGGTGTGACCGGGCCCCGCTGTGACCGCTGCCAGGAGGGACACTTCGGTTTCGAGCGCTGTCAGGGCTGCCGCCCTTGTGCCTGTGGGCCAGCCGCCGAGGGCTCCAAGTGCCACTCCCAGAGTGGGCAGTGCCACTGCCGACCAGGAGCTGGAGGGCTCCAGTGCCGTGAATGTGCCCCTGGCCACTGGGGGCTCCTGGAGCAGGGCTGCAGGCGCTGCCAGTGCCCAGGGGGCCACTGCGACCCGCACACTGGCCGCTGCACCTGCCCGCCAGGGCTCAGCGGGGAGCGCTGTGACACCTGCAGCCAGCAGCACCAGGTGCCTGTGCCAGGCGGGCCCAGGGGCCAGGGTGTCCACTGCGAAGTGTGTGACCACTGTGTGGTCTTGCTCCTGGATGACTTGGAGCGGGCCAGTGCCCTCTTCCCTGCGATCCGCGAGCAGCTGAGCAGTATCAGTGCCGGCTCTGCAGCCTGGGCCCAGCTACACAGGCTGAATGCCTCCATCGCCGACCTGCAGGCCCAGCTCCGGAGCCCTCTGGGCCCCAGATATGAGGCAGAGCAGCAGCTGCAGACCCTGGAGCAGCAGAGTGTGAACTTGGAGCAGGATGTACAGCGGCTGAGCGGCCAGGCCACGGAGACCCAAGATCAGGCCAGCCAGCTGCTGAACGGTACCGAGGCCACGCTGGGCCGTGCACAGACGCTGCTGGTGACTGTCCAGGCTGTGGACCGTGCCCTGAGCGAGCTGGGATCCCAGCTGGGCCACATCTCACCAGCCAACACATCGACTCCATCAGGCGAGCAGCTGCGCCGGGCGCTGGCGGAGGTGGACAGCTTCCTGCAGGAGATGCGGGCCCGTGACCTTGGGGCGCCCCGGGTGGTGGCAGAAACTGAGCTGGCCAAGGCCCTGAAGCTGCTGGCCCGTGTGCAGGAGCAGCTGACCCACCGCTGGGAGGAGAATCAGGTGCTGGCTCAACGCACCCGCGAGAGGCTGGCTCAGCACGAGGCGGGCCTCATGGACCTGCGGGAGGCCCTGAACCAGGCGGTGGCCACCACCCGGGAGGCCGAGCAGCTCAACAACCGCAACCAGGAGCAGTTGGAGGAAGCTCTGCAACGGAGGCAGGAGCTGTCCCGGGACAATGCCACCCTGAAGGCCGCTCTGGAGGCTGCCAGCCGCACCCTGGCCCGCGTCTCTGAGCTGCTGCGTGGCATGGACCAGGCCAAGGAGGACCTGGAGCACCTGGCAGCCAGCCTGGATGGGGCCCAGACCCCACTGCTGGAAAAGATCAGGGCCTTCTCCCCGGCTGGCAGCAAGCTGGACTTGGTGGAGACTGCTGAAGCCCATGCGGAGCAGCTGAACCAGCTGGCACTCAACCTGTCCAGCATCATCCTTGGGGTCAACCAGGACCGTTTCATCCAGAGGGCCGTGGAGGCTTCCAACGCCTATAGCAGCATCCTGAAGGCCATACAGGCTGCTGAGGACGCCGCTAAGCAGGCCTGGCAGCAGGCGAGCCATGCGTGGGAGACCGTGGTGCAGCAGGCCCTGGTGCCTCGAGCCCAGCAGCTGCTGGCCAACAGCAGTGCTCTGGAGGAGGCTGTGCTCGGGCAGCAGCGGAGGTTGGACCTCGCTCGGGTCACCCTGCAGGGTGCCAGAACCCAGCTCCGGGACATCCAAGCCAAGAAGAACCAGCTGGTGGCCCAACTCCAAGAGGTGCAGGCCATGCTGGCCATGGACACAGACGAGACGAGCAAGAAGATCGCCCATGCCAAGGCTGTGGCTGCTGAAGCCCAGGACACGGCTGCCCGAGTGCAGTCCCAGCTTCGGGACATGCAGAGGAGCCTGGAGCAGTGGCAGGGCCAGTTCGGAGCCCTGCGGGGTCAGGACCTGGGCCAGGCAGTGCTGGATGCGGGCCGCTCAGTGTCCTCCCTGGAGAAGACGCTGCCACAGCTGCTGGCCAAGCTGAGCCTGCTGGAGAACCGCAGCGCGCACAACGCCAGCCTGGCCCTGTCCGCCAGCATCGGTCGCGTGCGGGAGCTCATCGCTCAGGCCCGGGGCGCTGCCAGCAAGGTCAGGGTGTCCATGAAGTTCAGTGGGCGTTCAGGGGTGCAGCTGCGCACCCCACGAGACCTCGCCGACCTGGCCGCCTACACCGCCCTCAAGTTCCACCTGCAGAGCTCTGAGCCGGCGCCAGAGCCTGGGCAGCAGGGCGGGGACCACTTTGTGCTGTACATGGGCAGCCGCCAGGCCACTGGGGACTACATGGGTGTGTCTCTGAGAAACCGGACGGTGCACTGGGTGTACCGGCTGGGGGCGGCCGGCCCTGTGACCCTCAGCATCGATGAGGACATCGGGGAGCAATTTGCCACCATCAACATCGACAGGACCCTCCAGTTTGGCCACATGTCCGTCACGGTGGAGGATCCAGCAGTCCAGGAGACTAAGGGGGATGCGGTGGCCCCTGGGGTGGAGGGACTGCTCAGCCTGCGGCCTGACGACTTTGTCTTCTACGTGGGCGGGTACCCCAGTGGCTTCACGCCCCCTGCGCCCCTCCGCTTCCCTGGCTACCGGGGCTGCATTGAATTGGACACGCTGAATGAGGAGGTGGTCAGTCTGTACAACTTCGAGAGGACCTTCCGGCTGGACACAGCTGTGGACAGGCCTTGTGCCCGCTCCAAGTCCACAGGGGACCCGTGGCTCACGGATGGCTCTTTCCTGGATGGCACTGGCTTTGCCCGCATCAGCTTTGAGAGGCAGCTGACCACCACCAAGCGCTTCGACCAGGAGCTGCGGCTCGTGTCCTACAACGGCATCATCTTCTTCCTGAAGCACCAGGGCCAGTTCCTGTGCCTGGCAATGCTCAAAGGCAACCTCGTGCTCCTGTACGACCTTGGCACGGGTCTGAAGGAGGCTCCTCCCCTGCAGCCGCCTCCTCCCCTGACCACGGCCAGCAAGGCGATCCAGGTGTTCCTGCTGGCCGGCAGCCGAGAGCGCATACTGGTGCGCGTGGACAGGACCACAGTGTTCAGCGTGGAGCAGAGCAACACGCTGGACATGGCCAGCGCCTACTACCTGGGAGGGGTGCCGCCTGAGCAACTGCCGTCAAGCCTGCGCAGACTCTTCCCCTCCGGGGGCTCCATCCGTGGCTGCATCAAGGGGATCAAAGCTCTGGGCAAATACGTGGACCTCAAGAGGCTGAACACCACAGGCGTCAGCGCTGGCTGCACGGCAGACCTGCTGGTGGGGCGCACCGTGACTTTCCATGGCCATGGCTTCCTGCCTCTGGCGCTCCCCGATGTGGCACCCCTCACCGGCGACATCTACTCTGGCATTGGCTTCCGCAGCACCCAGGACAGTGGTCTGCTCTACCACCGAGCGTCCCTGGATGGGCTGTGCCAGGTGTCCCTGCAGCAAGGCCACGTGACATTGCGGCTTATGAGGACAGAGCTGAAGACACGAGCGGTCTTCAACGATGGTGCCCCCCACTACGCTGCCTTCTATAGCAATGCCACAGGGGTCTGGCTGTATGTGGACGACCAGCTACAGCAGACAAGGCCTCACCGGGGGCCACCTCCCAGGCAGCAACCCCCGACTGAGGAGCCCCCACAGCTCCTCCTGGGGGGCCTGTCTGAGTCCGCCTCCTCCTTCCGCAACTTCAGCGGCTGCATCAGCAATGTCTTTGTCCAGCGGCTCCAGGGGCCGCAGCGAGTGTTTGACCTGCAGCAGAACCTGGGCAGCGTCAACGTGAGCACCGGCTGTGCCCTGGGCCTGCACAGCCAGTCCCCGGGGCCGGAAGCTCAAGGGCTGCGGGCTGTGGCTCGGAAGAGCTCCCGCCGCAGCCGCCAGCCTAGCCAGGACCCTGCGTGCACGCCACCTCTGCAGCTCAACGTGACCCGAGATGCCTTCCAGCTTGGGGGTCCCCGTCCCAGTCACCTGGAGTTTGCAGACCTCCTGGACCCCCGCAGGGACCGGTTTCAGCTCTCCATGCTTGCCCGCCCTCACGCCCTCCACGGCCTCCTGCTCTTCGCTGCGCCGCTGGCAGCCAGCAGCCCCTCCCTGGCTGTCTTCCTGAGCCACGGGCGGTTTGTCGCACAGACCGGAGGGCCTGAACCCCACCTTCGTGTCCAGAGCCGCCAGCGTGCGCGGGCTGGCAAGTGGCACACAGTCTCTGTGCGCTGGGAGAAGGGTCAGCTCCAGCTCCTCACAGATGGGGTCCAGGCCTGGAGCCGCGAGTGGCCCCGCCATCGGGCCGGGAGGGCAGAGGGCCTGCGGCCCCACACCCTCTTTGTGGGGGGCCTCCCGGCCGCCAGCCACAGCTCCCACCTGCCGGTGACTGTCGGATTCAGTGGCTGTGTGAAGAGACTGCAGTTGGACGGGCGGCCCTTGGGGGCCCCCACTCGGATGGTGGGGGTCACGCCCTGTACCCCAGGCCCCCTGGAACATGGCCTGTTTTTCCCCGACAGTGGAGGAGTTGTCACCCTAGAACCCCTGGGGGCCACCCTGCCCCACGTGAGCCTGGAGCTGGAGGTGCGGCCCCTGGCAGCCACTGGGCTGATCTTCCACCTGGGCCAGGCCCAGGGCCCCCCCTACCTGAAGCTACAGATGTTCAAGAAGCAGGTCTTGCTGCGAGCAGATGACGGGGCAGGTGAATTTTCCACGTGGGTGACACGCCCTGCAGCACTGTGTGATGGGCAGTGGCACCGACTAGCTGCCAACAAGGGCAGGGACGTGCTCCGGCTGGAGGTCGACACACAGAGCAACCACACCATGGGCCCCACGGCATCAGCTGTAGCTGACAGCCCAGCACCTCTGCATCTGGGGGGCCTGCCTGAGACCATGGCTACAGAGTCTGAGCTCCCTGCCTTCCGGGGCTGCATGAGGAAGCTGGTGGTGAACCGGACCCCCGTCACTGTGACTCACTCTGCAGGCGTCCAGGGGGCAGTCGGGGCCAGTGGCTGCCCGGTCACATAG

XM_004841167.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 4803 bp    Location: 25836283..25897082   Strand: +
>XM_004841167.1
ATGGAGGACCCCGGGGACGAGAGCAATGCGGATGCGCCTGAGGCCCTCAGTCCCATGAGGGAAGAGTTCTGGAGGACCGGGGGCATCCGGAGGACCATGATCACACAGCAGGAGGGTGCCGGGAACACCGAGGCGGACCCTGCCCGGCAGCAGCCACTCAGCCCCTCCCTGCAACATCGCGGGAGGCGGCCGAAGCGCCCCCAGCAGGTCGGAGAGCCCCAGAGCACAGGCTTGTGTCGAGGAGGGGACTCCCTGGCTGTGTCCCTGGAGGGTTCCGGAGAGCCAGCGTCCCGCCCAGGGTCTCCTGTGCACAGCGCCCTGGAAGGGCGCAGCGAGAGCAGCTCTGAGACGAAGTGTGGACCAGCGCCTGGCTCCGAGTGCGTGAAGCCTAGAGGTCGGGATGAGCAGGGTGACAGCGCCGACAGTGACATCGACGGCTTCACTGGGGAGGGACTTCAGAATCGCCTCCCGAGGAAGCCAGAGCAAGAATCAGCAGAAAGGGCCCCGAAGGGTGTCTGCAGTGGCCCGCGGAAGCCGCGTCCGGAGGAGGAGCCCAGCAAAGGCGTGGAGGTCCAGGCAGGCAGTGCCGGCCGCAAGGGGCCACCCTGCAGGCAGGACCCTGAGGCTGCTCGGGGGTCTGACCGAGAGTGGGAGTTGGAGGCAGTAGCGGTTCAGGGACCTGGAGACAAAGACCCCGGGGACCCGGGCAAACCTGGGCCTGAGTGTGAGGTTTCCGCCCCCAGCGCCCTCTGCCGCCAGCCTCACAGCAACAGGGAAGAGGCCGGAGTGCAGGTGGCTGCTGCCACCACGCTGTCCACGCCGCTGCCGCCAGCCGCACGCCTGCTGACGGTGCGCGTCGGGCCTAAGACCTCAGGGCACGCGGGGCTGTGGCGTGGGCGGCGGGAGCGCGTCTGCCGTCCCAGGTCCCTAGGATGGGCGCTGTGGGCCCAGAGCCTCCGGTTGGTGATCTGCCCCGACCACGGTGAGGAGTGCTTCCGTGTTCACTGCGTGGGCATTTCTGAGCCTCCGGGCTGTCTCTTGGAGAGGAACGGGGCTGATCACGTCGACCTGAACGGCACCGCCCTGCAAGCGCAGGAGAGGACGTCAGAAGCCCCTGATGCGCAGGGGCCTGGATGCAGATCCGGAGGTGCTGGCGTCACACAGGGCAAGAGCAGACGGGCCTGCCGGCGGAAGTCCCGGGCCGACCAGCGGAGCAGGAGTGAAAGTGAGGAAACCTCGAGCCCCAGGGGCGAGGAGGCCATGGAGATGTCCCCGCCTGTCACAGTGGCTCCTGGCACCGTGCCCTGTGCGTGCCCCGGGTGCTCCAATATGGCACAGCCTGACACAGTCTACTGCTGCAACGACTGCCTTCTCAGGCACGCAGCAACTGCTATGAGATTGCTCAGTGTACATAAAAAACACAAACCAAAGCCGAAGAAGAAGAAGAAGAAGGTCAGGATGAAGCCAGAAAAGCTCTGTCTCCCAAAACCTAGTGTTCAGGCGGGGATGAAAATGTCCTCTGTGCACGAGAGGCCAGCTCCAGAGGAAGCTGAACCCCCAGCGAAGAAGGTTACAGTGACTCCTCTTGGGAGCGACTCCATGGGGAAGGCGGCGGCCAGTGAGAGCAGCACACCCTCCCGGGCTGGAGACCACAAGTGCAGCGCAGTGACGCCAGAGAAACCTGCTGCACCCTCCACACCATGCTGGGGCCAATCCCCCAAGGACCACAGGAGAGTGGAGGACAGAGTGGTGGGAGCAGCCTCAGGCCCAAAGGAAACAGCCCTTCCAGGCTCCTCAGGGGGCAGGCAGCCTTTGTGCAGAAGTCTCGCCACAAAGAAGGCCCGTCCTTTCGTTAACAAGGCAGCAGCCAAACCGGCCGTTCAGAAGTCATCCTCAGGCTTCAGGGGCCCCATCCCCAAGGGCCCCTGGCTCGGGGAGGCCCCAGCAGGGCCCTCAGCTGCCAGACCGGCAGGACCAATGCCAGTTCCTCTGGCAAGCAATTCCAAAAAGTCACCGTGCTCTGCAGCGTCGATGGGAGCCACGAGGAAACCTGTGGTACCTTTGGTCCCCACAGCTTCTCCGGCCCCTGGGTGCCTCAGGCCTGTGGGTCCTGCCCTGTCACAGCCAGAGTCACAACTTCGGCAAATTATAAGACACTCCTTGAAGGAGATTCTGTGGAAAAGAGTCTGTGAAAGTGGTGATTTAATCAGGACTGAAAATGAGGTAGGAAAAACTGCCATCCGCCTTGAGGAGGAGATGTTTAACTTGTTCCGAGTTACAGATCATCGCTACAGGAGTAAATACCGCAGCATCATGCTCCGCCTCAAGGATCCTGCAAGTCAGGGACTCTTCCATCGAGTAGTGCGTGAAGAAATCTCTCTGGAGGAACTTGTGAGAATGAAGCCAGAGGAACTGGTGTCTAAAGAGCTTTCCACGTGTAAAGACGGGCTGACAAAATCTAACGGCACCATGAAGCCAGAAACCATTCCTGATGTGAGCTATCCTCCACCACTGCAAGATTGGGATGAGCAGCAGGAGTCAATATGCACTGTACACACGAAGATCACAGTGCCTCTCCCTGATCCCCTTAGCAGCATGTTGGAGGATACGACAAGTCAGCACCGGGCCCACCTTTTTGATCTAAACTGTAAAATGTGTACAGGTCAGGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAACTATCACCTTCTGCCAAGAAATTAGACTTAACATCCAAGCCCAGAAGCGCTGCACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCACTGACTCTGCCCAAAGATGCCTCTGAGCCACATCTGGAAAGGGCCTCTGGTCCAACGCCAGAGAGAAAGTATGTCCCTGGGCCTCCCNGGGACAGTTGTGCAGGGCCCTCCCCACCGGAAGGCCCCTCCAGCTGCCCGGCCTCCTGTGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGACCAGGACCCTAGGACTGCTGTGGGCAGGTCCTGTACCCACCTGGACAGCACCCACATGCCTGCAGCCAACCCAGACCTGCTAAAGCCCAAACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCCTGTCCCCTGACCCCAGGCATCTGTCAGTTGTGCCATCACCAAGTGTCAGCATTTCAGAGTCCTGGTCCCCCCGGATAGGAGGCAAGGCCCTGCCTTTGTCTCACCTCAGCAGCATTTGGAAAGGCCTCATTAACATGCAGAGCGTAGGCAAATTTGTCACCAAGGCGTGTCCTGTCTCTGGGAACTCTGTTTATCTCGGAGAGGACTTGCCAGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCTGTGTCTAAGGAGCTCTGTCTGATTCGCTTCCACCCTGCGACCTGGGAGGAGGAGGGCACCTACATATCTCTCTACTCCTACTTTCGCAGCTGCGGCCACTTTGGGGTTGTAGCGAACACCAACAGGCGGATCAAGGACCTCTACTTGATCCCACTGAGTGCTGGGGACCCCGTGCCACCCAGGCTCTTGCCCTTGGCGGGACCAGGCCTTGAGTCCCCACGTCCAAATTTGCTCCTTGGGTTGGTCATCAGTGAGAAACAGAAACGTCTGCCAGACACTGGGGAGCTGGACAAGATGAGGGAGAAGCAGACCCCCCTGGATGCGCCAGGCTGTCCCAGCCTCCCTGCAGCCCCTCAGCCCAAGAGGAAGCCCCCCAAGAGCCAGCTGTGCTCTGCAGCTGAGGGGTCCCCACCACCTCTGCTGCCTCTTCCTGAGCCCCCTGTGTTGAAAACACTGTCGTCCCTCCTCCCTGTGGCCACCTGCAGTGTCACCACTCCCACTACAGCAGTACCAGTGCCCCTGGCAGCCTCACCTGTCACTTTGAGGCCTTCAGACCCAGCCTCACCACTACACTTCATCCTGCGGACTCTCTTTAAAGGGACTTCTTTCCAGGCCCCTCCCCAGGACCCTGCAGGCCTGACTCCAACTCCCCAGCAGGACCGAAAAGCCCAGGCCCAGGAAGGGGCATCAGGAGTGCTGCTCCTCGATCCCATTGTTCAGCAATTTGGCCACTTCATGGACAGTGGCCCCCAGGAGGAGGAGGAGGAGGATGACAGGCTTTATAACCCAGAGGAAGGGTACAACATGCAGCCAGCCTTCGACCCCTGGCTTGCTGAGAGGGGGAAGTGGCAGGATGGGGGAAAGGCCCTGGACGCTTCGGAGGAGGCAGCGGTGGCCTACGACCCGGAAGACGAGACCTTTCTGGAGGCGGCCAACGTGACCGTCGCTGACCTGCCCAACGTGATGTGTGCAGATCTCCGGGAGAGGCCCGGAGAACACACCAGATACTGGCCCCCTCCTGCTTGGGGGCATCAGAGAATTTGGGAGGACTTAAAGTCATCACTGGCCAAAGCGGAGCTGCTTCCCCAGGAGCACCGGGCCCTAGACCAGAGTCAGGGAGCCCTTGGCACAAACCATACCTCCTACTCAGGGCTCAGTAGAGACCCCCAGCAGGCCAGGCACCTAGCCCGGCAACCTGACTGCTGGGTGTCCGAGGTGTCCGACGCTGTGGAGGGAGCTGAGGAGAGGCGAGGCCAGGCGAGACCCGGACGCCGGCTGCCCTCCCTCCGCATCCGCGAGGTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCGAGTGGGAACCGCATTGCTGCCGAAACTGAGAACCCCGCTGTGACGCCCTTCGGCCACTAG

XM_004841161.1 Coding sequence

LOC101704414 cystatin-13-like

Length: 435 bp    Location: 23141759..23144654   Strand: +
>XM_004841161.1
ATGGCCAGACTCTGCCAGGCCCTGCTGCTCCTCACGATCACTGTGACCCTTGAGTCCAGCACGGTGCAAGCCTGGGGTTCCCCGAAGGTGGTGCGGCCATTCCAGGACATCTCCTCATCCTACGTGTATGTGCAGCAGGCGGTCTGGTATGCCAAGAAGGAGTACAACAAGGCCAACAAAGACAAGTACAGCTTCCGTGTGGTAGAGATTCTCAAGTCCCAGGAGCAGGTCACAGACAGTTTGGAGTACTATGTTGAAGCCAAAATCACCCGAACAATGTGCTTGAAAACTGCAGGAGAAAATGAACACTGGTTATTTCAAAAGAATCTCAAAATAAAAAGGTGAGGGCCTGAGGTTTTTTGCATCTTTATTGTTAGATCCAAGCCATGGAAATTTGAGCTATCCATGCTGAAGAAGCAGTGCAAAGATGCCTAG

XM_004841162.1 Coding sequence

Cst9l cystatin 9-like

Length: 549 bp    Location: 23148279..23146400   Strand: -
>XM_004841162.1
ATGGTGCGTCCCCCTGGGAGGAGGGTGCTGGCCTGGGCTGCCCTGCTGCTTCTCTGGGGCATCTGGCTCCTGGGGACTGGAGCCTGGTATTTCCAGCAGGAGCAGGAGGATGACTGGAATGAGGTGGCACTCTATTTCCCCCCCACCATGGAGTTCGCCTAGCACACATTCAACCAGGAGCACAAAGACGAGTATGCCTACCGGGTGGAGCACCTCCTGAATGTCCGGAGGGAGCAGGCGAGAGAACACTGCGTCATCCCTGTCCCCTGCACCGAGCTCGGCCTCACCAAGCCACTGCCCTCTGCTCATCACCCCTGCCTGGAGAAGGTCCCCTGGCTGTCACCTCCCACTGTGAACATGGCATTCTTCATGACGCTGCAGCTGGGCAGAACCAAATGCAAGAAGTTCCAGGATGACCTCGACAACTGCCGCTTCCAGGAGAGCCCCGAACCCAGCAATATCGTCACCTGCACCTTCAACGTGAGCACCCTGCCCTGGACCACAGAGTTCCAACTCTTGAACAAGAACTGCTCTGAGGGCCCCCACTGA

XM_004841163.1 Coding sequence

LOC101705473 serine/arginine repetitive matrix protein 3-like

Length: 828 bp    Location: 23743225..23733020   Strand: -
>XM_004841163.1
ATGGGAGTTGAATTAACGTTGGACTCCTCAGAACAACCATGGGAGAGCAAAGATGGCTTCTCTGGGGGTCCTGGGCTGAGGGGCCTAGGAAGCTCCTTTGGTGCCTGCCCAGTGAGTGGCCCCAGTCCACCCTTAGGACCATTCTACTGTACGTATGGAGCACCTGCTGTGTGCCAGGCCCAGGTGGGCTCAGACGAGGACACAGGCTCCGGGAGCAGTGATTCACTGAGTCCCACCCTGCAGGGGAAGGGGTGCTCTGCGAGACCGGGTGTGCGAACCCTCAGTGAGGAGCGGTGGTCCAGAGGGCCTTGGGAAGGCCCAGGGCGTCAATCCCAGCACCCGGCACCCGGTGGGCACTCGGCCCCAGCGCGCACCACTCGGGGGCTCTCGAGGCGGCCTCTCTTGCGATCGAGGGCGCGCGGGGCTGAAGAACAATCTCCGGCCTCGGCTCTCAGCGCCGGAGGTTGGAAGAGGGCGGGTCGCCGGCGCCCGAAGGCGAGGACGCAGAGCCGCGGGAGGAAGGAGCGCTCGCCCGCCCGCCGCCTCGCTGCCTCCCCGCGCTCGTTCTCCGGACTCCTGGAGCTGCCGGCTGCTCCTCCCACCCGCGCCCGCCTCCTCGCTCGCTCGCTCCCGGGAGCTGCTTTCCAGCCCTGCGGTGCGCCCGGGCGAGTGCGGGGCGAGGGGCCCCGGGCCAGCGCCGAGCAGAGGGCGGGGCGGGACCAGTCTGCGGCAAGTGACCGAGCCGTGCGGCCCGCTGCCTGCCCCCCTCTGCCACCTGGGGCGGCGCGGCCCGGGTGCCGCGAGCCCGGGAGCCCCGTTCGCGCGTAG

XM_004841155.1 Coding sequence

Tgm6 transglutaminase 6

High confidence: 4 potential gene matches
Length: 2259 bp    Location: 3654288..3672382   Strand: +
>XM_004841155.1
ATGTCCAAAGGCCCTGAACCAGAAGCAAGCACAGCAGGTTCAAGGAACAGTCTGGAAGCCAGTGCAATTAAAAAGGTTGAGTCGGGAGAAGAGAAAGAGAAGACTCAGAAAGATACCAAAGGGCTCAATCATGAAGGATTTGTGGGGGTCAGAGTCACCAAAGTGGATTGGCAGCAGACAAGGAATGGCGCTGCCCACAGAACCCGGGAATACTCTTGCTGTGAGCTGGTGGTTCGCAGAGGCCAGCTGTTCAGCATCAGGCTGTATCTGACTGGAGTCCTAGACAGAGAGGAGACCCTCACCCTCACAGTGGAGACAGGGTCTCAGGCTTCCGAGGCCCTCCACACCAAAGCTGTGTTCCAGACAGCACATCTGGAGGTGGGTGATGCATGGACAGCAGCGAAGGAGGCACAGACCGGGAACACCGTGACTGTCAGCCTTGCCAGTCCTCCAGATGCTGTCATTGGCCGCTACCTGCTGAGTGCCAGGGCTTCCTCCCGCCGCAAGCACGGCGACCGGAAGCTGGGCGAGTTTGTTCTGCTTTTCAATCCATGGTGCCCAGAGGACGATGTATTTCTGGCCTCGGAGGAGGAGAGACAGGAGTATGTGCTCAACGACAGTGGCATCATCTACCGCGGTGTGGAGAAGCACATTCGAGCCCAGGGCTGGAACTACGGGCAGTTTGAGGAGGACATCCTGAACATCTGCCTCTCCATCCTGGACCGAAGCCCCAGTTACCAAGAAGACCCAGCCACAGACGTGTCCTGCCGCCACAACCCTGTCTATGTCACCAGGGTCGTCAGTGCCATGGTGAACAGCAACAATGACCGGGGCGTGGTACAAGGCCAGTGGCAGGGCAAATACAGCGGTGGCACCAGCCCGCTGCACTGGAGAGGCAGCGTGGCCATTCTGCAGAAGTGGTTCAAGGGCAAGTACAAGCCAGTCAAATACGGCCAGTGCTGGGTCTTCGCGGGAGTGATGTGTACAGTCCTCAGATGCCTGGGGATCCCAACACGGGTGGTGTCCAACTTCAACTCAGCCCACGACACCGACAAGAACCTGAGTGTGGACAAATACGTGGACTCCTTTGGGCGGACCCTGGAGGACTTGACAGAAGACAGCATGTGGAATTTCCATGTCTGGAACGAGAGCTGGTTTGCCCGACAGGATCTGGGCCCCTCTTACGATGGCTGGCAGGTTCTGGACGCTACCCCCCAGGAAGAGAGCGAAGGCATGTTCCAGTGTGGCCCAGCCTCAGTCACAGCCATCCGCGAGGGCGACATACATTTGGCCCATGATGGCCCCTTCGTGTTCGCGGAGGTCAATGCAGACTACATCACCTGGCTGTGGCACAAGGATGAGAGCCAGGAGCGTGTGTACTCAGACACAAAGAAGATCGGGAGGTGCATCAGCACCAAGGCAGTAGGCAGTGACTCCCGCGTGGACATCACCAGCCTCTACAAGTACCCAGAAGGGTCTCAGAAGGAGAGGCAGGTGTACCGCAAGGCCATGAAGAAGCTGCTCAGTGTGGAAGCCTGGGGGAAGAGGTCGCAGATCCAAAGGGCCAGCAGGCACAGCCTCCAGCATGATGACCTCCTGGAGCCGCCCACCAAGCCCAGCATCACTGGCAAGTTCAAGGTGCTGGAACCGCCAGTGCTGGGCCATGACCTGAAGCTGGCTCTGAGCTTGGCCAGCCTCACCTCCCAGGTCCTGCAAGTCCAGGTCAATCTGAGTGGTGCCACCATTCTCTACACCCGCAGGCCAGTGGCAGAAATCCTGCATGAGTCCCACACAGTGAGGCTGGACCCGCAAGAAGAAAAGAAAATTCCAATCACAATATCTTACTCTCAGTACAAAGAGAACCTGACTGAGGACAAGAAGATCCTGTTGGCTGCCATGTGCCTTGTCACCAAAGGAGAAAAGCTCCTGGTGGAGAAGGACATTACTCTGGAGGACTTTATCATCATCAAGGTGCTGGGCCCAGCCACAGTGGGAGTGGCAGTTGCTGTAGAAGTGACCGTGGTCAACCCCCTCTCAGAAAGAGTGAAGGATTGTGTGCTGATGGTGGAAGGCAGTGGCCTTCTTCAAGGACAGCTTAGCATTAACATACCCACCCTGCAGCCCCAGGAGAGGGCCTTGGTCCAGTTCAGCATCACCCCAACCAGGAGTGGCCCACGGCAGCTGCAGGTGGACCTCGTCAGCCCCCACTTCCCAGACATCAAGGGCTTCGTGATCATCCACGTGGCCGCAGCCAAGTGA

XM_004921064.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 789 bp    Location: 3709913..3707815   Strand: -
>XM_004921064.1
TGTGAGAGAGAGAAGGTGGCTTCAAAGACTCGCAAGTGTGGGCACAGGAGAGAAGGAGGAAAGGAAGCCTCAAGGACATTCTCCACCCTCTTCCAAGAACAGTCGTCAAGAGGAGGTAACATGNGTGTAGAAAAAGAGCCTCACTCAGCTCAGAGGGTAAACNCTTTTGTAACCAAAGGGTTGAAGGAGTTAGAGACCTTGNATATTGGAGCAGTGGACTATAGAGTGTGTGAGCCAGACTGTAGCCTGAAATCAAACTTCATTGCAAAGTCCAAGACTCTTGCAGGCAAGAAGCCCTATGTTTGCAGTGATTTCAGGCATAAGTCGACCCTCATCAGACACCATTGGACACACTCAATGGAGAAGCCANNTGTGTGCAGTGAGGGTGGCAGAGGCATTAGCTAGAAGCCCAACATCAGCAGCCATCAGAAANNACATTCAGAAGAGAAAGCTTTCTTGTGCAAGGAGTGTGAGTATAGCTTTAGAAATAAGTCTATCCTCAGTAGACATCAATGGACTCACNTTAGGGAGAATCCTTGCATTCACAGCAAGCATGAGTGAAGCTTTGGCCAGAGGTCATCCTTCNTTCATAACCAGAAGATCCACTCAGGTGAGAAACCTTCCATGTGCCTGGAGTGTGGACGAGGCTTCATGATGAGGTGAAGACACCAGAGGCTGCTTAGGGGAGAAGGTTATGTTTGCAGGGAGTTTGAGGCCTTAGCAACACTCAGTCCTACTCAGCACACCAGAGGATACTCAGGTGAGAAGCCTTCAATTTTCAGGGTGTGA

XM_004840883.1 Coding sequence

Dtd1 D-tyrosyl-tRNA deacylase 1, transcript variant X2

Length: 660 bp    Location: 19274307..19303043   Strand: +
>XM_004840883.1
ATGATTGTGACCTGCCCCACTTCCTTGCCAGGGTGTTGTCCCATGTCAACCACAGTAGGAGAAATGGCCCCATGTTTGGGCAAATCCTCCACCTGGAGGAGCAGGCAGCACAGGTTATCACTGCAAGCCCAGTGCCTTCCAGGAGCTGTGAATAGAGGCGCTACAGGAGCAGAGACCCCAGAGCAGCCTCCTGGGACAGGGCTGCGCCCCAGCGGTGGTACACATGAGTCCTGGCCAAGGTCATGCCTTCCGGTCCGAAAGATCTTGAACCTGCGTGTGTTTGAGGACGAGAGCGGCAAGCCCTGGTCCAAGAGTGTGATGGACAAGCAGTACGAGGTGCTGTGTGTCAGCCAGTTCACCCTGCAGTGTGTCCTCAAGGGCAACAAGCCCGACTTCCACCTGGCCATGCCCACCGAGCAGGCCGAGAGCTTCTACAACAGCTTCCTGGAGCAGCTGCGGAAGACTTACCGGCCCGAGCTCATCAAAGATGGCAAATTTGGTGCCTACATGCAGGTGCATATTCAGAACGATGGGCCTGTGACCATAGAGCTGGAGTCTCCGGCTCCCGGCACTGCCACCTCTGACCCAAAACAGCATCTCTCATCATCCACCTGGAACGAACTCCTTCTTTGTCTGCTGTTGCATCTTCCCCACCTTTAA

XM_004841151.1 Coding sequence

LOC101719094 chromosome unknown open reading frame, human C20orf202

Length: 447 bp    Location: 2467194..2474635   Strand: +
>XM_004841151.1
ATGGCTGCTCCAGCTCCAACTCTTATTGCTGCTTTGAAGTCCACAGATGGAGCACAGCAGCCTAAAGGAGGTCCAGGACTGTACAGTCAAAGGCCCTTCAGGCCCATAGCAGGTCATTGTCAGGGTCTCTATCTCAAGGACACTGAGATGAAAACAGCAGGAGAGCCAGTCCTGAATCTTGGGCAGACCCTGGAGTGGCTGAGGAGGGAGCTGTCTGAGATGCAGATCCAGGACCAGCATCTCCTGCTTACACTGAGGCATCTCCACGGTGTTCTGGAGGAGCTTCGCACACAGACCGCCCAATGGGAGGATGGCAGGTCCAGCGAGGGGACATCCCCCATCAGAGGAAGAGCAGGCTCTGAAAGCAGGGGCTGCCAGACAGTCACTTCCAGGCGGCTGGCCCAGCTCCTGAAAGGGGAAGAAAGCAGAAGAAGCTCACTTCCTTAA

XM_004841144.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 933 bp    Location: 380753..381770   Strand: +
>XM_004841144.1
ATGGCGCACGAGAGGGCAGGGGCCCTGGAAACCGCCGTGCCACTCGCCCTGGCCCGCGCAAGAGGGGAGTCCGCGCCTGGCCCCCGCGGCCTGGACCCCAGGAGTGGCGGAACACGGGCATCTCGACTTGCAGGGGGACCCGAGACCTTCCCATCAGTCCTAGGACGGCAGTGGGAGGTGACGGCGGGAGCCGGTGGGAAGGTCGAGGAAGTGACGACTGAGGAGGGCGCCATCTTGGAGAAGGCAGCGCAGGCGGTGGGGAATCAACAGGTGGGGGGAGAAGCAGCTGGGGGGGGGGGCGGGCAGGAGAAGTTGGAGGTGGACGTAGAGACCCAGGGGCATCTGGTGCCCCTGCACCTTGAGGGCCTAATTGTGGACCCACTGGAGGCCATTCAGTGGCAGCTGGAAGCCACGAGTGGCCAGGCTGACAGCGCATACCAACAGCTCTAGCGCAGGTTCGGGAGGATGCGCCTGCTGCGCTTAGCTCGGAGCTTCATCATCCAAAATACTCCGGGTTTTGGGGTCACTGCCTTCCTGAACGACCCGCAGCTGGCAACCATGATCAGCCCCCAAGATGAAGTCATGCTCTGCTCCCTGATGAACTTGATGAGGGAGCTCAGACACACCAGGAAAGGTTGCAAGTAAAAGTTCCGCTTTTGGAGCAACCCCTACTTCCGAAATAAGGTGATAGTAAAGAAGTATGAGTGTAGATCCTCAGGCCGGGTGGTATCAGTTGCAACTATCAGATGGCACTGGGGCCAGGAACCCCCTGCCCCAGCACAGCAGAACCTCGACCCTNGAAGCTTCTTCAGCTGGTTTTCATAGCACAGCTTTCCAGAGGCTGACAGGGTTTCCCAGATCATTAAAGATGACCTGTGGCCCAACCTCCTGCAGCATTACTTGCTGAGGTGTAGGGCCTCCAGAATCAGATGA

XM_004841145.1 Coding sequence

Defb125 defensin, beta 125

Length: 327 bp    Location: 1185292..1187041   Strand: +
>XM_004841145.1
ATGGCTGCCTGGAAGGTACCAAAATGCTGGGATGATATGGGGCACTGCCGAAGACGATGTTTAGATAATGAAAGGTATAAACTTCTTTGTAAGAACAAGGTGTCATGCTGCATTCCCATACGAAAGTCATATGATGACACTCCAAGGCCCCTACCTCCCTTGATCCCCATATGGCACATAACAATTGATGTGGGTGATTGGATTCCTGTTTCACCAGGATTGAATGATGAGATGACATTTGATGACAAGGAACATGAAGAAACAACAATAACAATAACTGAGTCTTTTATTCCTGAGAAAGCGCCTATAAAGTCCATGACCTTCTAA

XM_004841066.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X13

Length: 2562 bp    Location: 29143589..29095029   Strand: -
>XM_004841066.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGTCAGAAGGTCAGTTTGAAAGACCGTGTCTTCTCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCTGAGCAGAGCCTTGAAGACAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004841093.1 Coding sequence

Arfrp1 ADP-ribosylation factor related protein 1, transcript variant X3

Length: 606 bp    Location: 29355864..29346667   Strand: -
>XM_004841093.1
ATGTACACACTGCTGTCGGGGCTGTACAAGTATATGTTCCAGAAGGATGAGTACTGCATCCTGATCCTGGGCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCAAAAACCCGGTTTAACAAGAACTACAAGGGGATGAATCTGTCTAAAATCACCACCACCGTGGGTCTAAACATTGGCACTGTGGACATAGGAAAGGCTCGCCTCATGTTCTGGGACTTAGGGGGACAGGAGGAGCTGCAGTCTTTGTGGGATAAGTACTATGCGGAGTGCCATGGCGTCATCTATGTCATTGACTCTACTGATGAAGAGAGACTGTCAGAGTCCAAGCAGGCATTTGAGAAGGTGGTTTCCAGTGAGGCTCTTGATGGTGTCCCCATCCTGGTGCTGGCCAACAAGCAGGATGTGGAGACGTGCCTCTCCATCCCTGACATCAAGACTGCGTTCAGCGACTGCAGCTATAAGATCGGCAGGCGAGACTGTCTGACCCAGGCCTGCTCTGCCCTCACAGGCAAAGGAGTACGTGAGGGCATTGAATGGATGGTGAAGTGCGTCGTGCGGAACATCCACCGGCCACCCCGGCAGAGGGACATCACGTAG

XM_004841092.1 Coding sequence

Arfrp1 ADP-ribosylation factor related protein 1, transcript variant X2

Length: 606 bp    Location: 29355836..29346667   Strand: -
>XM_004841092.1
ATGTACACACTGCTGTCGGGGCTGTACAAGTATATGTTCCAGAAGGATGAGTACTGCATCCTGATCCTGGGCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCAAAAACCCGGTTTAACAAGAACTACAAGGGGATGAATCTGTCTAAAATCACCACCACCGTGGGTCTAAACATTGGCACTGTGGACATAGGAAAGGCTCGCCTCATGTTCTGGGACTTAGGGGGACAGGAGGAGCTGCAGTCTTTGTGGGATAAGTACTATGCGGAGTGCCATGGCGTCATCTATGTCATTGACTCTACTGATGAAGAGAGACTGTCAGAGTCCAAGCAGGCATTTGAGAAGGTGGTTTCCAGTGAGGCTCTTGATGGTGTCCCCATCCTGGTGCTGGCCAACAAGCAGGATGTGGAGACGTGCCTCTCCATCCCTGACATCAAGACTGCGTTCAGCGACTGCAGCTATAAGATCGGCAGGCGAGACTGTCTGACCCAGGCCTGCTCTGCCCTCACAGGCAAAGGAGTACGTGAGGGCATTGAATGGATGGTGAAGTGCGTCGTGCGGAACATCCACCGGCCACCCCGGCAGAGGGACATCACGTAG

XM_004841095.1 Coding sequence

Arfrp1 ADP-ribosylation factor related protein 1, transcript variant X5

Length: 366 bp    Location: 29355836..29347878   Strand: -
>XM_004841095.1
ATGTACACACTGCTGTCGGGGCTGTACAAGTATATGTTCCAGAAGGATGAGTACTGCATCCTGATCCTGGGCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCAAAAACCCGGTTTAACAAGAACTACAAGGGGATGAATCTGTCTAAAATCACCACCACCGTGGGTCTAAACATTGGCACTGTGGACATAGGAAAGGCTCGCCTCATGTTCTGGGACTTAGGGGGACAGGAGGAGCTGCAGTCTTTGTGGGATAAGTACTATGCGGAGTGCCATGGCGTCATCTATGTCATTGACTCTACTGATGAAGAGAGACTGTCAGAGTCCAAGCAGGCATTTGACGTGCCTCTCCATCCCTGA

XM_004841087.1 Coding sequence

Lime1 Lck interacting transmembrane adaptor 1, transcript variant X2

Length: 876 bp    Location: 29390640..29393459   Strand: +
>XM_004841087.1
ATGGGGCCGCCAGTGCCTGTGGCCCTGCCAGCCATCTGGGTGCTAGGGTGTTTCTCTCTGCTCCTCTGGCTGTGGGCGTTGTGCACAGCCTGCCACAGGAAGCAGGTGCAGAGCCAGCAGGCAAGACTGCAGGACACTGTGATGCTGGCAGAAACGTCCCTGCTGAGACAGACTCATCTCTGCCCCCTCAGCAAGTCTGACACCAGGCTGCATGAGCTGCACCGCGGTACCCATGGCAGCAAAGCCCTGAGGCCTGCCAGCATGGATCTCCTGCACCCACACTGGCTAGAAGTTTCCAGGGGTAGCGCCAGACCACTGGCAGCCCCCTCTGCCTTCCCACGTCAGCAGCTGCCGGGGCCCCCATCTGCGACTGCCTTCACACTGTCCACTGGTCCTGAGGCCACCTATTCTAATGTGGGGCTGGCTGCCATCCCTAGAGCTAGCCTGGCTGCCAGCCCTGTGGTATGGGCAGGGACACGGCTGACCACTGGCTGTGACAGGCCAGGGCACTGGGCCAGACCTGTACTGGCTGAGTATGCCTCCATCCAGAAGCTCAGAGGGTCAGATCCGGGCCCCCAAGAACTGCAGCAAGGGAAGACTGAGGTGACCCCAGCTGCTCAGGTGGACATCCTGTACTCCAGGGTCTGCAAGCCTAGAAACAGGGACGCAGGGCCCGCCACAGACCCACCGGGCCGTGAGGGCACAGGAGCAGTTCTGACCCTGGAGACTGGCTTAACCTATGAACCGCTCCCTCCTAGGGGCCTGGACATGGACAGCAATCCCCTGGAAAATGTGTATGAAAGCATCCAGGATGTGGGGACCCCTGAAAGTCCAGAGCCCTCCATTCTGCCTATTAGCATAAGCGGACATATGTAG

XM_004841085.1 Coding sequence

Stmn3 stathmin-like 3

High confidence: 4 potential gene matches
Length: 543 bp    Location: 29299621..29292348   Strand: -
>XM_004841085.1
ATGGCCAGCACCGTGTCCGCGTACAAAGAGAAGATGAAGGAGCTGTCTGTTCTATCGCTCATCTGCTCCTGCTTCTACGCACAGCCTCATCCCAGCACCATCTACCAGTATGGGGACATGGAGGTGAAAGAATTGGACAAGCGAGCCTCTGGCCAGAGCTTTGAGGTCATCCTCAAGTCCCCTTCTGACCTATCCCCAGAGAGCCCTGTGCTGTCTTCTCCCCCGAAGAGGAAGGACATCTCCCTGGAGGAGCTGCGGAAGCGGTTGGAGGCAGCTGAGGAACGGAGGAAGACGCAGGAGGCGCAAGTCCTGAAGCAGCTGGCGGAGCGGCGCGAGCACGAGCGCGAGGTGCTGCACAAGGCGCTGGAGGAGAACAACAACTTCAGCCGCCAGGCGGAGGAGAAGCTCAACTACAAGATGGAGCTCAGCAAGGAGATCCGCGAGGCGCACCTGGCGGCGCTGCGCGAGCGGCTGCGCGAGAAGGAGCTGCACGCGGCAGAGGTGCGCAGGAACAAGGAGCAGCGGGAGGAGATGTCCGGCTAG

XM_004841080.1 Coding sequence

Helz2 helicase with zinc finger 2, transcriptional coactivator, transcript variant X3

Length: 8898 bp    Location: 29228442..29214063   Strand: -
>XM_004841080.1
ATGGCCTCCTCGGGGTGTGGCCCATCGTCCACCAGCCCCTTGGCCCCCAGGGAGCCTCTGGCCAGGCTCTGCGCCCAAGTGGATCTCTGTCTGGGCTGCTCCCGCTGTGCCCAGCGCCTCAATGACAGCACCTACGTCCTGTGCCAGGTGGAGCACAGCTGCTCCCACGAGGTCCTTCTGGCTCGCCTTAAGGGAGCTGCCAAGAAGAAGACCTGGCGCGAGGTGGGCCACCGGCCCTGCTTCCCGCGGCCTTGGCGGTACAGAGTGTGTCGCTACTATCGCCCGGGGCTGGGCTGCCAGCACCACAGGAACAGGTGCACCTTTGCCCGCAGCCCTGAGGAGGCGCTGGTCTGGACCTTCGAGCTGAAGCACAGCCTCTCCCGCCTGTGGCTGAAGGCTGCGGTGCAGGGCGATGGGGTCCAGGGCGGGCCGTGCAGGGCTGCTGACGCCATCCTGGCAGAGTTTGGTGGCCACTTCCAGCTGCTCTGTGCCCACTGCTTCAGGGCCCGGCCCCAGCATCTCTGCCCTGTGGACCCCCAGGGGCAGTGCCCCAAGCACAGAACCTGCCCTGCACTCCTGGTGCACGTCAGTACCAAGGGCCGTAAGCGCCAGTTCACCGAGGTGCGGCCCAAGCCCCAGAATGGCCAGCCGCTGCACTACTGCATGTTTGTGGAGCAGGGACAGCCGTGCCGCCACGGGGCAGCCCGCTGCCAGTTTGCACACAGTGCTGTAGAGATGGCCGTGTGGGAGGCCGAGCAGCTGGGTGGGCTTGAGCGGGAGGCCCTGCGCACATTCCCTGCCCTCGGCAGAGACAAGTGCATGGGCCCCCATGGCCAGTGCCCCAGGGGCAGCCAGCCCCCCGAGGTAGAGCTGTACTGCTACACCTGCCTGGTAACCTACCGCTCTCAAGAGGCCTTCGAGAACCACTGCGCCTCCCTGGAGCACTCGCAGATGGTGGCCTTCGACCAGGCTGTACCCTGGGAGCACCGCGTCCCCCCCATGGGGCTCTCCAAGTTTGAGCTCTGCGCAAGGCCTGACCTCTGTGAGTATGGGGCCACCTGCACCAAGGCTCACTCAGAACAGGAGCTGCAGGAGTGGATCCGGCGGGCGCAGGCCACAGAGCTGCGGGAGCAGGCAGCCTGGCAGGACGGGCTGGTGTCATACCAGGCACGGCTGCTGGTGGAGTACCGGTGCAGCAGCAGTGAGGTCCCAGTGATGGCGGAGACCATCTGTGGCGTGTCTGTCACCTGCCGCCAGCCCCTAGTCCATCGGGCCCAGGAGAAGAAGACCCAGCACAGCTGGGTGTTCTCTGTCTACTCTGAGGACCCTCTGCTGCATGTGGCCTTGCTTAAGCAGGAGCCTGGAGCAGACTTCTTCCTGGTGGCACCCTGCCTCCCCAAGGGCCGGCTCTATGCAAGTGGGGAGCACTTTCGGGTGCCCAGCTCCCGAGCGGAGTTTCAGGTGGGAGTGCGGGTCCAGACTGCCTCCTTTGGCACCTTCGAGCAATGGGTGGTCTTTGACTTTGGCCGTCGGCCAGTGCTGCTTCGGAAGCTGTGGCTGCAGCTGGGCCAGGCTCTCTGCTCGGAGCTCACCAGGAGGCCAGCACCTGGCTGGCCTGAGGAGGTGGACCTGTGGCACACTGGCAACCGCCACATGGTGCCTTGTGTGGAGCGGACAGCCGAGCAGGCAGCCCTGATGACCAAGTACAAGGTGCCCAGCCTGGCCCTGAAGGTCGGTCACGGCAGCCTGGCCTCGGAACCCATCTCTCGAGCCAACTACCGGCAGAGCATGCACCACTTCCTCTATGAGGAGGAGGCTGCTCGGCGGCAGCTGGTGGCCAAGCTGACCCTGCGGGGCCGGGTGTCCCTGAAGACTTCACTGCAGACAGCGGCACTCGGCATGCTCTTTGCGCCCCCAGGAGCCCTCTATGCTGAGGTCCTGGTCCCTTCTTCTCTGACACCAGACACGGACCAGGGCTTCCTGCTGAGCCGGGAGGTCAGCACAGCCCTCGTGGCCCCTGTGCCTGCGCCTGACAGCACTGTGTTCGAGGTGCGACTTGAGAAGCGAGCCAGCTCGGAGCAGACATTGTGGCTGCTGCTGCCCACACACTGCTGTGTGGCCCTGGGGCTGCGGGCTGAGGGGAGCCCCATCTTGGAAGTGCAGTTCCAGATTGACCCGCTCAACTTCTGGTTCTGGCATCAGGCAGTAGATGCATTGCCTGAGGAGCACCTGGTGGTGCCCAACCTGCCCACCTGTGCCCTGCCCTGTCCTCGCCCGATCCCACCCTTGCTTCGTGGCAACCGCAAGCAGAAACTGGCTGTGGGGCTCATTGCAGGCAGCAGTGCCGGGAGCGCAAAGCCTGTGCCTCCATTGCTCATCTATGGCCCCTTTGGCACCGGCAAGACCTACACCCTGGCCATGGCCACCCTGGAGGTTGTTCAGCAGCCCCACACCAAGGTGCTCATCTGCACGCACACCAACAGTGCCGCCGACATCTACATCAGGGAGTATTTCCATGGCCATGTTGCCAGGGGCCACGTTGAGGCAGCTCCTCTCCGGGTGATGTACACTGACAGGCCGCCAAACCAGACCGACCCAACCACACTGCAGTACTGCTGCCTGACAGAGGACGCCCGGGCCTTCCGCCTGCCCACGAAGGCAGAGCTGGCGGAGCACCGCGTGGTCGTCACCACTACCTCACAGGCCCGTGAGCTCCGCGTGCCTGCTGGCTTCTTCTCCCACATCCTCATCGACGAGGCCGCCCAGATGCTGGAGTGTGAGGCCCTCACTCCGCTGGCCTACGCCTCACCACGCACCCACGTGGTGCTGGCCGGGGACCACCTGCAGGTCACACCCAGGCTCTTCAGTGTGCCCAGGGCCAAGGCTGCTGGGCACACCCTGCTGTACCGCCTTTTCCTGCACTATCAGCAGGAGGCCCACGAGATCGCTCGGCAGAGCCGCATTATCTTTCATGAGAACTACCGCTCCACCACCGCCATCATTGGCTTCATCTCGCGCCACTTCTATGTGGCCAAGGGCAACCCCATCCAGGCCAGTGGCAAGGTCCCAGCCCACCCCCGACAGTACCCACTCATGTTCTGCCATGTGGCAGGCACCCCGGAGCAGGACATGTCCATGATGTCCTGGCTGAACCCGGCGGAGGTCACACAGGTGGTGGAGAAGGTGCAGGAGGTCTACAACACCTGGCCCCACTGCTGGGGGGTCCGGGAGCAGAGAAGCATCTGTGCCATTTCCCACGGTGCTCAGGTCAGCGCACTGAGGCAGGAGCTGAGGAGGAGGAACCTGGGAGAGGTGTCTGTGGGCAGCTTTGAGACCCTGCCAGGGCGGGAGTTCCGGGTGGTGGTGCTGAGCACTGTCCACAACTGCCACAGCCTGCTCAGCCGGGGGGCGCCCACCTTGGAGTTCTTCACCGATGCTCGTGTGCTGAACACAGTCATGACCCGTGCCCAGTCCCAGGTGGTGGCTGTAGGCGACGCCATGGCCCTCTGCTCCTTCGGGGCCTGCAGCAAGCTCTGGAAGAGCTTCATCCAAGAATGCACGGAGCACCGTAGCATCTTCCCGGAGGGGCTGTCGCTGGGGCAGATTGAGCAGGGTGTGGCCCAGAGGCAGCACTGGGCCCCTGTGGCCCTCAGAGCAGAGAGAACATGGGCATCAGTAGTGAGGGACACTGGCTGGACGGGGCAGCCAGGGGCCCTGGACAGGGCAGCCAGGGGCCCTGCCACAGAGCACACAGCTATAGCAAAGGTCCCACCAGGGCCTGTGACGATGAAGAGTGAGGCCACAGGGACAGGAGACACAGCTGTTGGGGATCCAGCATCAAGAGGACCAGCCACGACACAGATAAAGGCTGAATCAGGAGGGGACACAGCAAAGGGAGACCCGGCAGGAAGACCAGCCACCCTGGAGGGCAGAGGGTCTGAGGGCCCTGAGGACTCAGAGTCAGACTTCTGGGCCTCTGACTGTGAGCTCAACGCTGACGACACCATCCTGCAGGAGCTCCTGGATGAGACCCGGCAGGTGACGGTGACTGTTGGGGAGGACGGACTCCTGGACACCCTGGCCAGGCCTGCCTCCTCACGGCTGCCCTGGCAGTACAAAAACCTGCCCTTGGGCACACTGCGGAACCTCATGCGCTCAGAGCCTGGGCTCTATCGCCGCTGCACCTTCCTGAAAGAGACCTTCGAGCGGGCATCAGCCATCCCCCTGGATGAGGCGGTCTCCAGCCCCATCCAGGTCAGGGGTCGCCTGAACTGCGGGATGGCCTTCACGGGGGACAAGGTGCTGGTGCAGGTCCTGGGCCAGTCGGCTGGTGACGAGGCTGCCCCAGAGAGGCTACAGGGCCGCGTGGTGGGTGTGCTGAAGAGGAAGAAATGTGAGCTGGCATTTGTGTGCCGGATGGACAAATGGGATCCCCGAATCATGATCCCCATCAACAGCTCTGTGACCAAGATCTTCGTAGCTGATCTGAAGGACCCGCTTCGGGTTCCCATCCACCGCCTCCTTCAGGGCCGAGTGCAGTGTGTGGGACACAAGAGTCTCACTGCCGAGGGCAGGCACACACAGCTCTTCTGGGTCCGCATCATCCTGTGGCGGGAGCGTTTCTATTACCCCCTGGGCATCATCCTGGAGGTGCTTCCTGAGGCCACCAGCTGGGAACAGGGCCTCCACATCCTTGGCCTGGAGCACGGCTTGCAAACCTCCGTGCCGGACTCAGCCTCTGTCTCCAAGGCACTGCAGAAATACCGTGTGGATCTTGGCACAGCTGCTGGCCACAGAGAGGACTGCCGCAGCTTCCTGACATTCACTGTGGACCCACAGGGCGCTTGCAACCTGGACGATGCCCTCAGTGTCCGGGACCTGGGTCCCAGGTACGAGGTGGCTGTGCACATTGCTGACGTGGCCAGTGTTGTGCCCAGGGACGGGGTGCTGGACGTGGAGGCCCGCCGGCAGGGTGCTGTGTTCTATGCCCCCGACAGGGAGCCAGTGTCCATGCTGCCGGCCAGCCTGTGCCGAGATGTGCTCAGCCTCCTGCCGGGCAAGGACCGCCTCGCCATCTCCCTCTTCCTAACCCTGGACAAGGACAGCAGCCAGCTCAGGGGCCTGCGCTTTGCACCCTCAGTTGTCTGCTCTGACAGGCAGCTGTCCTACGAGGAGGCCGAGGTGCTGATCAGGGAGCACCAGGGTGCTGGCATGGAGCTGCCGGCGTGCCTGGACTCAGTGGAGGCCTGTGTGGTGGCTGCCTGCTACTTCTCCCGGGTGCTGCGCCGGCGTCGGCTGCAAGCTGCCTGCCACTATGAGGCCCCAGATGAGGAGAGCACCCTGGGCTTCCGTGCAGCCCACATCATGGTCCAAGAGTACATGATTCAGTTTAACAGCCTGGTGGCTGAATTCCTGGTGGGCAACAAGCACACACAGGCGGTCACGCCCCTGAGATGCCAGCCCACACCCCTGATGGCCCAGCTTCAAGCCGTGTGTGAGAAGCACAGAGAACTGGTGCCCCTGTCACTGCACCTCCGCCACCACTTGCAAGGCCATAGCAGCCCCAAAACACAGCTGCACCTCCTGTCTTCCCTCTGGAAGCAGGTCCAGCTTGCTGCCCACAGCCAGGATTATGGCCAGATGGTGGATCTCATTACCACTGACGACATGCACCCCTCCCTGGCTCCCGTGGGCCTGGACCTCCGCAAGGCCCTGGGCCGCTCTGGTTTTGGCCGCTCCAGCCAGGGTGGACAGCAGCTCATTGGCCACTACTCGTTGCAGGTGGGCTGCTACACATGGGCCACATCGCCCATCCGCAGATACCTCGATGTGGTGTTGCAGCGGCTGATCCTACTAGCTCTGGGCCGAGGGGGCTGCGTGTACTCCTCCAGAGACATCGATGGGCTCTGCCAAGACTTCGCCCGCCAGCATGCATCCGCCCAGAGCTACCAGCGACAGGCCTACAGCCTGCGCCTGGCCACTCAGCTCAAGGCTCAGCCTCGAGACAAGCTGGGCGTGGTAGTAGATGTGGAGCCAGGCACCCACTGCTTCAAGTTACTCTTCCCGGCCAACCGAGAGAGCCTGCCCGACCTGTGCCCTGTCCATTATCACTCCCTGCAGCTGGCTGAGCACCCCCACGACCTCAAGGACCGGCGGGGCCTACGCCTTGTGTGGCGGCGCCGCACCTACTCTGTGCAGGAGTCCAAGCTGCCCTCTCCACTGCCTGGCACCCTGTTTGACCCACACGTCTGGACCATCAACACAACCCTGTGGAAGCAGCTGCTGGTGCTGGTGGAGCAGGACCGCTGGCTGGAGGCAGCCACCCTCATCCAGGAGCAAAGAGGGAGGGAATGTCAAAAGCGGAAGGTGGTGCAGGTGAACCGGAGCCCCTGTGGCCACTTCCTGGAGGTGACCCGGGAGCTGGGCAGCGGCGACACTCTGCAGGTCCAGTTCAGTACCAGCATGCAGCGAGGCTTCCTGGTGCCTGCCCTGCAGCTGTGGACTGTGGCACCTGGCCTCAGTCTCTGCCTGGAGCATGCAGAGCATCCAGTCAGCTGCTTCTCAGGCCATGCACACCAAGCCCCACAGCACCAGTACTGTGACGAGGATCAGTACTCGCTCATATGGGGGCCGCTCTGTGCCCAGGAGTCGGTCACTGGTGCTGTTGCTGAGAACAATTCCATTGTGCTGCAGCACGTGTGCATTTCCTGGGATGCAGAGCGGACACAGCAGAGGCAGCTGCAGGGCACCTTCCACCTGGACCCTGCCTTCCTTCAGGAGAACTGCACTGATGTTGACTTCAGCTGCTGCTACCTCTGCATCCGGCTTGAGGGCCTCCCAGTGCCCCCAGCCAGCCCACCCCCTGGGCCCAGCAGCCTTGGCCCCTTCCTGAGCATCGATCCTGACACGTATGCCTGGGTGGCCCACGGGCTGACGGACAGCTGTGACCAGGAAGACCCGGCCGACCGGCAAGAGGCCCCCAGGAGGGTGCACTTCTTCATCCACCACATGGCCATGGAGAAAGTTCCGGAAAGTGCGCTGAGGCCCGGCACCCTATTCACGGTGGAGGTGTTGCTCAAGAAGCTTCCTGACCTCTGCAAGGAGCAAGCCGTGCGCAGGCTGAAGCAGGCATCTCCACTGGTCCTCAGCATTGCCCTTGGCCGACCCCTGCTGCAGCCTGACGGCCCCATTCACCAGCGGCCCTTCCACAGGGGGACTGCTGCCAGGCTCCTGAAGCAACAGGCCTACGACATCCCTGGGGGCTGCCCCAAGCTGAACGCCAGCCAGAACAGGGCCATCAGGCAGGCTCTGGAGAAGCCATTTACTGTCATTCAGGGCCCACCAGGCACAGGGAAGACATTTGTGGGCCTCCACATCGTCTTCTGGTTCCACAAATCAAATCAGGAGCAAGTACCAAGGAGGAGAAGCTCTGACGGAGAGGAGCCACTGCAGGGCCCGTGCATCCTGTACTGTGGCCCCTCCAACAAGTCCGTGGATGTCCTGGCAGGAATGCTCCTGGGCTGGCGGGCGGAGCTGAGGCCCTTGCGGGTGTACAGCGAGCAGTTCGAGGCCACTGAGTTTCCAGCACCGGCTGTGGGCAGCAGGGGGCTATACAACAAGGCTCCCCGGGAGGAGAGGCCGAGCCAGACCCTCAGGAGCATCTCCCTGCACCACCGTGTCCGGCGGGACCCCAACCCACATGCACCAAAGGTCAGGGAGTTTGACGCCCGGGTGAGCAGAGGGGAAGTCTTCTCCAAGGAGGACCTCATTTCGAGGGTCATGCGAGCGGCGCAGAAGTTCGAACTGGCCCGGCACTCTGTCATCCTGTGCACATGCTGCTGTGCGGCTTCACACTGCCTCCGAACCCTTAACGTCCGGCAGATCCTCATTGATGAGGCGGCCATGGCCACGGAGCCCGAGACCCTCATTCCTCTAGTGCACTTCTCGGAGGCCGAGAAGGTGGTCCTTCTTGGGGACCACAAGCAGCTGCGCCCTGTGGTCAAGAATGAGCAGCTGCAAAACCTGGGGATGGATAAGTCCCTCTTCGAGCGCTATCACAGGGATGCCTACATGCTGGACACCCAGTACCGGATGCACGAGGTCATCTGCGCCTTCCCCTCTGCGGAATTCTACGGTGGGAAGCTGAGGACCTGTCAGGGCCTGAGGCGGCCGCCCAGCATCCTGGGCCATGCGCACAAGGAGAGCTGCCCTGTCATCTTTGGCCATGTGCAGGGCCATGAACAGAGGCTGCTGGTGACCACAGAGGAAGGGAATGAGAATTCCAGGGCCAACCTGGAGGAGGTGGCAGAGGTGGTGAGTGTCAGAGGCCCTCCCCGGAAACTTGTGTGTCCGGGAAGGCTTCCTGGAGGAGGAACAGGAGTTGGGGCTGAGGGAACAAGTAAAGCTCCTGTGTCCGGTCCAGCTCCACCTGCCCCTTCATTCCCTCAGATCCGCATCACCAAGCAACTGACACTGGACCGGACAGTGGAGCCCAAAGACATTGCCATCCTCACCCCCTATAATGCACAGGCTGCGGCCATCAACAAGGGCCTCATGCGGGAGGGTGTCACCGGAGTGACCGTGTCCTCCATCACCAAGAGCCAGGGAAGCGAGTGGCGCTATGTGCTGGTGAGCACTGTCCGCACGTGCCCCCGGAGCGATGTGGACTGCCGGCCAACGAAGGGCTGGCTCAGGAAGTTCCTGGGCTTTGTTGTGGACCCCAACCAAGTGAACGTGGCCATCACCCGGGCCCAGGAGGGGCTCTGCCTGATTGGAGACCACATCCTGCTGAGCTGCTGCCCCCTGTGGCGCCGCCTGCTGGATTTCTGCAGAGCCCAGCAAAGCTTCGTGCCTGCCAGCAAGGTGCGGGTCCGGAGGAGGCCAGCTGTGTCACTGTGA

XM_004841075.1 Coding sequence

Ppdpf pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish), transcript variant X1

Length: 345 bp    Location: 29177454..29178625   Strand: +
>XM_004841075.1
ATGGCAGCCATCCCCTCCAGCGGCTCGCTCGTGGCCACCCACGACTACTACCGGCGCCGCCTGGGCTCCGCGTCCGGCAGCAGCTCCTGCGGAAGTGCCGAGTACCCCGGGGAAGCCGTCCCCCACCACCTGGGTCTCCCCAAGGCCGACCCAGGTCACTGGTGGGCCAGCTTCTTCTTCGGGAAGCCCATTGTCCCATTCATGGCCACAGTGTTGGAGTCCCCAGAGCACTCGGAAGCCCCCCAGGCTCCCAGCAGCGTGGTCACCAGTGGCCTGGCTTCGGAAACCACAGGGAAGCAGCCGCTCAGCCAGCCCAGCCAGGCCAACACCAGGCCCTCGTCCTGA

XM_004841084.1 Coding sequence

Gmeb2 glucocorticoid modulatory element binding protein 2, transcript variant X3

Length: 1359 bp    Location: 29255003..29241819   Strand: -
>XM_004841084.1
ATGGCTGAAGAGGGGGAGAACTTGGAGGCTGAAATTGTGTACCCCATCACCTGTGGAGACAGCAGAGCCAACTTGATTTGGAGGAAGTTTGTGTGCCCTGGCATCAATGTGAAGTGTGTTCAGTATGACGAGCATGTGATCAGCCCAAAGGAGTTCGTCCACCTGGCAGGGAAGTCCACCCTGAAGGACTGGAAGAGGGCCATCCGAATGAACGGCATCATGCTCAGAAAGATCATGGACTCCGGGGAGCTGGACTTCTATCAGCACGACAAAGTCTGCTCCAATACCTGCCGCAGCACCAAAATTGACCTGTCAGGCGCCCGAGTGTCCCTGAGCAGCCCCACGTCTGCAGAGTACATCCCACTCACACCTGCTGCAGCTGATGTGAATGGTTCGCCTGCCACCATCACCATAGAGACCTGCGAAGACCCCAGTGACTGGACGACAGCAATTGGAGATGACACATTTGCTTTCTGGCGGGGACTGAAGGATGCTGGCCTGCTGGATGAGGTCATACAGGAGTTCCAGCAGGAACTGGAGGAGACTATGAAAGGTCTACAGCAGCGGGTGCAGGATCCTCCCCTGCAGCTCCGAGATGCTGTCCTCCTCAACAACATTGTACAGAATTTCGGCATGCTGGACCTGGTGAAAAAGGTGCTGGCCAGCCACAAGTGCCAGATGGACCGCTCAAGGGAGCAGTATGCCCGGGACCTGGCAGCTCTGGAGCAGCAGTGTGATGAACACCGCCGCCGCGCCAAGGAGCTGAAGCACAAGTCCCAGCACCTCAGCAACGTGCTCATGACGCTGACCCCTGTCTCCCTGCCACCCCCCATGAAGCGGCCGCGGCTCGCACGCGCCACGTCTGGACCAGCCTCCATGGGCTCGCAGGTGCTCACCCAATCTGCACAGATCGCCCTCAGCCCAGGCGTGCCAGTGTCCCAGCTGACCAGCCTCCCACTTGGCAAAGTGGTGTCCACGCTGCCCTCAGCCATCCTGGGCAAGAGCTCCCCTCAGGTGCCCCCAGCCAGCTCACCGGCCTCTCCTCTGCTTGGGGGCTATACAGTCCTGGCCTCCTCAGGCTCCGCTTTCCCTAGCACAGTGGAGATCCACCCGGACGCGTCCAGTCTCACAGTCCTGAGCACGGCAGCCATGCAGGATGGCAGCACGGTGCTGAAAGTGGTCAGCCCACTGCAGCTGCTCACCCTGCCCAGCCTGGGCCCCGCCCTGCAGAATGTGGCCCAGGCGTCACCGGCAGGCAGCACAATTGTGACAGTGCCCACAGCGGCTGCCCCAGGGGCTGACGAGCACACAGCCACCATTGAGGTGTCTGCCATGGCAGAGGACCACGAGCAGAAATAG

XM_004841081.1 Coding sequence

Helz2 helicase with zinc finger 2, transcriptional coactivator, transcript variant X4

High confidence: 4 potential gene matches
Length: 8769 bp    Location: 29228442..29214063   Strand: -
>XM_004841081.1
ATGGCCTCCTCGGGGTGTGGCCCATCGTCCACCAGCCCCTTGGCCCCCAGGGAGCCTCTGGCCAGGCTCTGCGCCCAAGTGGATCTCTGTCTGGGCTGCTCCCGCTGTGCCCAGCGCCTCAATGACAGCACCTACGTCCTGTGCCAGGTGGAGCACAGCTGCTCCCACGAGGTCCTTCTGGCTCGCCTTAAGGGAGCTGCCAAGAAGAAGACCTGGCGCGAGGTGGGCCACCGGCCCTGCTTCCCGCGGCCTTGGCGGTACAGAGTGTGTCGCTACTATCGCCCGGGGCTGGGCTGCCAGCACCACAGGAACAGGTGCACCTTTGCCCGCAGCCCTGAGGAGGCGCTGGTCTGGACCTTCGAGCTGAAGCACAGCCTCTCCCGCCTGTGGCTGAAGGCTGCGGTGCAGGGCGATGGGGTCCAGGGCGGGCCGTGCAGGGCTGCTGACGCCATCCTGGCAGAGTTTGGTGGCCACTTCCAGCTGCTCTGTGCCCACTGCTTCAGGGCCCGGCCCCAGCATCTCTGCCCTGTGGACCCCCAGGGGCAGTGCCCCAAGCACAGAACCTGCCCTGCACTCCTGGTGCACGTCAGTACCAAGGGCCGTAAGCGCCAGTTCACCGAGGTGCGGCCCAAGCCCCAGAATGGCCAGCCGCTGCACTACTGCATGTTTGTGGAGCAGGGACAGCCGTGCCGCCACGGGGCAGCCCGCTGCCAGTTTGCACACAGTGCTGTAGAGATGGCCGTGTGGGAGGCCGAGCAGCTGGGTGGGCTTGAGCGGGAGGCCCTGCGCACATTCCCTGCCCTCGGCAGAGACAAGTGCATGGGCCCCCATGGCCAGTGCCCCAGGGGCAGCCAGCCCCCCGAGGTAGAGCTGTACTGCTACACCTGCCTGGTAACCTACCGCTCTCAAGAGGCCTTCGAGAACCACTGCGCCTCCCTGGAGCACTCGCAGATGGTGGCCTTCGACCAGGCTGTACCCTGGGAGCACCGCGTCCCCCCCATGGGGCTCTCCAAGTTTGAGCTCTGCGCAAGGCCTGACCTCTGTGAGTATGGGGCCACCTGCACCAAGGCTCACTCAGAACAGGAGCTGCAGGAGTGGATCCGGCGGGCGCAGGCCACAGAGCTGCGGGAGCAGGCAGCCTGGCAGGACGGGCTGGTGTCATACCAGGCACGGCTGCTGGTGGAGTACCGGTGCAGCAGCAGTGAGGTCCCAGTGATGGCGGAGACCATCTGTGGCGTGTCTGTCACCTGCCGCCAGCCCCTAGTCCATCGGGCCCAGGAGAAGAAGACCCAGCACAGCTGGGTGTTCTCTGTCTACTCTGAGGACCCTCTGCTGCATGTGGCCTTGCTTAAGCAGGAGCCTGGAGCAGACTTCTTCCTGGTGGCACCCTGCCTCCCCAAGGGCCGGCTCTATGCAAGTGGGGAGCACTTTCGGGTGCCCAGCTCCCGAGCGGAGTTTCAGGTGGGAGTGCGGGTCCAGACTGCCTCCTTTGGCACCTTCGAGCAATGGGTGGTCTTTGACTTTGGCCGTCGGCCAGTGCTGCTTCGGAAGCTGTGGCTGCAGCTGGGCCAGGCTCTCTGCTCGGAGCTCACCAGGAGGCCAGCACCTGGCTGGCCTGAGGAGGTGGACCTGTGGCACACTGGCAACCGCCACATGGTGCCTTGTGTGGAGCGGACAGCCGAGCAGGCAGCCCTGATGACCAAGTACAAGGTGCCCAGCCTGGCCCTGAAGGTCGGTCACGGCAGCCTGGCCTCGGAACCCATCTCTCGAGCCAACTACCGGCAGAGCATGCACCACTTCCTCTATGAGGAGGAGGCTGCTCGGCGGCAGCTGGTGGCCAAGCTGACCCTGCGGGGCCGGGTGTCCCTGAAGACTTCACTGCAGACAGCGGCACTCGGCATGCTCTTTGCGCCCCCAGGAGCCCTCTATGCTGAGGTCCTGGTCCCTTCTTCTCTGACACCAGACACGGACCAGGGCTTCCTGCTGAGCCGGGAGGTCAGCACAGCCCTCGTGGCCCCTGTGCCTGCGCCTGACAGCACTGTGTTCGAGGTGCGACTTGAGAAGCGAGCCAGCTCGGAGCAGACATTGTGGCTGCTGCTGCCCACACACTGCTGTGTGGCCCTGGGGCTGCGGGCTGAGGGGAGCCCCATCTTGGAAGTGCAGTTCCAGATTGACCCGCTCAACTTCTGGTTCTGGCATCAGGCAGTAGATGCATTGCCTGAGGAGCACCTGGTGGTGCCCAACCTGCCCACCTGTGCCCTGCCCTGTCCTCGCCCGATCCCACCCTTGCTTCGTGGCAACCGCAAGCAGAAACTGGCTGTGGGGCTCATTGCAGGCAGCAGTGCCGGGAGCGCAAAGCCTGTGCCTCCATTGCTCATCTATGGCCCCTTTGGCACCGGCAAGACCTACACCCTGGCCATGGCCACCCTGGAGGTTGTTCAGCAGCCCCACACCAAGGTGCTCATCTGCACGCACACCAACAGTGCCGCCGACATCTACATCAGGGAGTATTTCCATGGCCATGTTGCCAGGGGCCACGTTGAGGCAGCTCCTCTCCGGGTGATGTACACTGACAGGCCGCCAAACCAGACCGACCCAACCACACTGCAGTACTGCTGCCTGACAGAGGACGCCCGGGCCTTCCGCCTGCCCACGAAGGCAGAGCTGGCGGAGCACCGCGTGGTCGTCACCACTACCTCACAGGCCCGTGAGCTCCGCGTGCCTGCTGGCTTCTTCTCCCACATCCTCATCGACGAGGCCGCCCAGATGCTGGAGTGTGAGGCCCTCACTCCGCTGGCCTACGCCTCACCACGCACCCACGTGGTGCTGGCCGGGGACCACCTGCAGGTCACACCCAGGCTCTTCAGTGTGCCCAGGGCCAAGGCTGCTGGGCACACCCTGCTGTACCGCCTTTTCCTGCACTATCAGCAGGAGGCCCACGAGATCGCTCGGCAGAGCCGCATTATCTTTCATGAGAACTACCGCTCCACCACCGCCATCATTGGCTTCATCTCGCGCCACTTCTATGTGGCCAAGGGCAACCCCATCCAGGCCAGTGGCAAGGTCCCAGCCCACCCCCGACAGTACCCACTCATGTTCTGCCATGTGGCAGGCACCCCGGAGCAGGACATGTCCATGATGTCCTGGCTGAACCCGGCGGAGGTCACACAGGTGGTGGAGAAGGTGCAGGAGGTCTACAACACCTGGCCCCACTGCTGGGGGGTCCGGGAGCAGAGAAGCATCTGTGCCATTTCCCACGGTGCTCAGGTCAGCGCACTGAGGCAGGAGCTGAGGAGGAGGAACCTGGGAGAGGTGTCTGTGGGCAGCTTTGAGACCCTGCCAGGGCGGGAGTTCCGGGTGGTGGTGCTGAGCACTGTCCACAACTGCCACAGCCTGCTCAGCCGGGGGGCGCCCACCTTGGAGTTCTTCACCGATGCTCGTGTGCTGAACACAGTCATGACCCGTGCCCAGTCCCAGGTGGTGGCTGTAGGCGACGCCATGGCCCTCTGCTCCTTCGGGGCCTGCAGCAAGCTCTGGAAGAGCTTCATCCAAGAATGCACGGAGCACCGTAGCATCTTCCCGGAGGGGCTGTCGCTGGGGCAGATTGAGCAGGGTGTGGCCCAGAGGCAGCACTGGGCCCCTGTGGCCCTCAGAGCAGAGAGAACATGGGCATCAGTAGTGAGGGACACTGGCTGGACGGGGCAGCCAGGGGCCCTGGACAGGGCAGCCAGGGGCCCTGCCACAGAGCACACAGCTATAGCAAAGGTCCCACCAGGGCCTGTGACGATGAAGAGTGAGGCCACAGGGACAGGAGACACAGCTGTTGGGGATCCAGCATCAAGAGGACCAGCCACGACACAGATAAAGGCTGAATCAGGAGGGGACACAGCAAAGGGAGACCCGGCAGGAAGACCAGCCACCCTGGAGGGCAGAGGGTCTGAGGGCCCTGAGGACTCAGAGTCAGACTTCTGGGCCTCTGACTGTGAGCTCAACGCTGACGACACCATCCTGCAGGAGCTCCTGGATGAGACCCGGCAGGTGACGGTGACTGTTGGGGAGGACGGACTCCTGGACACCCTGGCCAGGCCTGCCTCCTCACGGCTGCCCTGGCAGTACAAAAACCTGCCCTTGGGCACACTGCGGAACCTCATGCGCTCAGAGCCTGGGCTCTATCGCCGCTGCACCTTCCTGAAAGAGACCTTCGAGCGGGCATCAGCCATCCCCCTGGATGAGGCGGTCTCCAGCCCCATCCAGGTCAGGGGTCGCCTGAACTGCGGGATGGCCTTCACGGGGGACAAGGTGCTGGTGCAGGTCCTGGGCCAGTCGGCTGGTGACGAGGCTGCCCCAGAGAGGCTACAGGGCCGCGTGGTGGGTGTGCTGAAGAGGAAGAAATGTGAGCTGGCATTTGTGTGCCGGATGGACAAATGGGATCCCCGAATCATGATCCCCATCAACAGCTCTGTGACCAAGATCTTCGTAGCTGATCTGAAGGACCCGCTTCGGGTTCCCATCCACCGCCTCCTTCAGGGCCGAGTGCAGTGTGTGGGACACAAGAGTCTCACTGCCGAGGGCAGGCACACACAGCTCTTCTGGGTCCGCATCATCCTGTGGCGGGAGCGTTTCTATTACCCCCTGGGCATCATCCTGGAGGTGCTTCCTGAGGCCACCAGCTGGGAACAGGGCCTCCACATCCTTGGCCTGGAGCACGGCTTGCAAACCTCCGTGCCGGACTCAGCCTCTGTCTCCAAGGCACTGCAGAAATACCGTGTGGATCTTGGCACAGCTGCTGGCCACAGAGAGGACTGCCGCAGCTTCCTGACATTCACTGTGGACCCACAGGGCGCTTGCAACCTGGACGATGCCCTCAGTGTCCGGGACCTGGGTCCCAGGTACGAGGTGGCTGTGCACATTGCTGACGTGGCCAGTGTTGTGCCCAGGGACGGGGTGCTGGACGTGGAGGCCCGCCGGCAGGGTGCTGTGTTCTATGCCCCCGACAGGGAGCCAGTGTCCATGCTGCCGGCCAGCCTGTGCCGAGATGTGCTCAGCCTCCTGCCGGGCAAGGACCGCCTCGCCATCTCCCTCTTCCTAACCCTGGACAAGGACAGCAGCCAGCTCAGGGGCCTGCGCTTTGCACCCTCAGTTGTCTGCTCTGACAGGCAGCTGTCCTACGAGGAGGCCGAGGTGCTGATCAGGGAGCACCAGGGTGCTGGCATGGAGCTGCCGGCGTGCCTGGACTCAGTGGAGGCCTGTGTGGTGGCTGCCTGCTACTTCTCCCGGGTGCTGCGCCGGCGTCGGCTGCAAGCTGCCTGCCACTATGAGGCCCCAGATGAGGAGAGCACCCTGGGCTTCCGTGCAGCCCACATCATGGTCCAAGAGTACATGATTCAGTTTAACAGCCTGGTGGCTGAATTCCTGGTGGGCAACAAGCACACACAGGCGGTCACGCCCCTGAGATGCCAGCCCACACCCCTGATGGCCCAGCTTCAAGCCGTGTGTGAGAAGCACAGAGAACTGGTGCCCCTGTCACTGCACCTCCGCCACCACTTGCAAGGCCATAGCAGCCCCAAAACACAGCTGCACCTCCTGTCTTCCCTCTGGAAGCAGGTCCAGCTTGCTGCCCACAGCCAGGATTATGGCCAGATGGTGGATCTCATTACCACTGACGACATGCACCCCTCCCTGGCTCCCGTGGGCCTGGACCTCCGCAAGGCCCTGGGCCGCTCTGGTTTTGGCCGCTCCAGCCAGGGTGGACAGCAGCTCATTGGCCACTACTCGTTGCAGGTGGGCTGCTACACATGGGCCACATCGCCCATCCGCAGATACCTCGATGTGGTGTTGCAGCGGCTGATCCTACTAGCTCTGGGCCGAGGGGGCTGCGTGTACTCCTCCAGAGACATCGATGGGCTCTGCCAAGACTTCGCCCGCCAGCATGCATCCGCCCAGAGCTACCAGCGACAGGCCTACAGCCTGCGCCTGGCCACTCAGCTCAAGGCTCAGCCTCGAGACAAGCTGGGCGTGGTAGTAGATGTGGAGCCAGGCACCCACTGCTTCAAGTTACTCTTCCCGGCCAACCGAGAGAGCCTGCCCGACCTGTGCCCTGTCCATTATCACTCCCTGCAGCTGGCTGAGCACCCCCACGACCTCAAGGACCGGCGGGGCCTACGCCTTGTGTGGCGGCGCCGCACCTACTCTGTGCAGGAGTCCAAGCTGCCCTCTCCACTGCCTGGCACCCTGTTTGACCCACACGTCTGGACCATCAACACAACCCTGTGGAAGCAGCTGCTGGTGCTGGTGGAGCAGGACCGCTGGCTGGAGGCAGCCACCCTCATCCAGGAGCAAAGAGGGAGGGAATGTCAAAAGCGGAAGGTGGTGCAGGTGAACCGGAGCCCCTGTGGCCACTTCCTGGAGGTGACCCGGGAGCTGGGCAGCGGCGACACTCTGCAGGTCCAGTTCAGTACCAGCATGCAGCGAGGCTTCCTGGTGCCTGCCCTGCAGCTGTGGACTGTGGCACCTGGCCTCAGTCTCTGCCTGGAGCATGCAGAGCATCCAGTCAGCTGCTTCTCAGGCCATGCACACCAAGCCCCACAGCACCAGTACTGTGACGAGGATCAGTACTCGCTCATATGGGGGCCGCTCTGTGCCCAGGAGTCGGTCACTGGTGCTGTTGCTGAGAACAATTCCATTGTGCTGCAGCACGTGTGCATTTCCTGGGATGCAGAGCGGACACAGCAGAGGCAGCTGCAGGGCACCTTCCACCTGGACCCTGCCTTCCTTCAGGAGAACTGCACTGATGTTGACTTCAGCTGCTGCTACCTCTGCATCCGGCTTGAGGGCCTCCCAGTGCCCCCAGCCAGCCCACCCCCTGGGCCCAGCAGCCTTGGCCCCTTCCTGAGCATCGATCCTGACACGTATGCCTGGGTGGCCCACGGGCTGACGGACAGCTGTGACCAGGAAGACCCGGCCGACCGGCAAGAGGCCCCCAGGAGGGTGCACTTCTTCATCCACCACATGGCCATGGAGAAAGTTCCGGAAAGTGCGCTGAGGCCCGGCACCCTATTCACGGTGGAGGTGTTGCTCAAGAAGCTTCCTGACCTCTGCAAGGAGCAAGCCGTGCGCAGGCTGAAGCAGGCATCTCCACTGGTCCTCAGCATTGCCCTTGGCCGACCCCTGCTGCAGCCTGACGGCCCCATTCACCAGCGGCCCTTCCACAGGGGGACTGCTGCCAGGCTCCTGAAGCAACAGGCCTACGACATCCCTGGGGGCTGCCCCAAGCTGAACGCCAGCCAGAACAGGGCCATCAGGCAGGCTCTGGAGAAGCCATTTACTGTCATTCAGGGCCCACCAGGCACAGGGAAGACATTTGTGGGCCTCCACATCGTCTTCTGGTTCCACAAATCAAATCAGGAGCAAGTACCAAGGAGGAGAAGCTCTGACGGAGAGGAGCCACTGCAGGGCCCGTGCATCCTGTACTGTGGCCCCTCCAACAAGTCCGTGGATGTCCTGGCAGGAATGCTCCTGGGCTGGCGGGCGGAGCTGAGGCCCTTGCGGGTGTACAGCGAGCAGTTCGAGGCCACTGAGTTTCCAGCACCGGCTGTGGGCAGCAGGGGGCTATACAACAAGGCTCCCCGGGAGGAGAGGCCGAGCCAGACCCTCAGGAGCATCTCCCTGCACCACCGTGTCCGGCGGGACCCCAACCCACATGCACCAAAGGTCAGGGAGTTTGACGCCCGGGTGAGCAGAGGGGAAGTCTTCTCCAAGGAGGACCTCATTTCGTACAGGAGGGTCATGCGAGCGGCGCAGAAGTTCGAACTGGCCCGGCACTCTGTCATCCTGTGCACATGCTGCTGTGCGGCTTCACACTGCCTCCGAACCCTTAACGTCCGGCAGATCCTCATTGATGAGGCGGCCATGGCCACGGAGCCCGAGACCCTCATTCCTCTAGTGCACTTCTCGGAGGCCGAGAAGGTGGTCCTTCTTGGGGACCACAAGCAGCTGCGCCCTGTGGTCAAGAATGAGCAGCTGCAAAACCTGGGGATGGATAAGTCCCTCTTCGAGCGCTATCACAGGGATGCCTACATGCTGGACACCCAGTACCGGATGCACGAGGTCATCTGCGCCTTCCCCTCTGCGGAATTCTACGGTGGGAAGCTGAGGACCTGTCAGGGCCTGAGGCGGCCGCCCAGCATCCTGGGCCATGCGCACAAGGAGAGCTGCCCTGTCATCTTTGGCCATGTGCAGGGCCATGAACAGAGGCTGCTGGTGACCACAGAGGAAGGGAATGAGAATTCCAGGGCCAACCTGGAGGAGGTGGCAGAGGTGATCCGCATCACCAAGCAACTGACACTGGACCGGACAGTGGAGCCCAAAGACATTGCCATCCTCACCCCCTATAATGCACAGGCTGCGGCCATCAACAAGGGCCTCATGCGGGAGGGTGTCACCGGAGTGACCGTGTCCTCCATCACCAAGAGCCAGGGAAGCGAGTGGCGCTATGTGCTGGTGAGCACTGTCCGCACGTGCCCCCGGAGCGATGTGGACTGCCGGCCAACGAAGGGCTGGCTCAGGAAGTTCCTGGGCTTTGTTGTGGACCCCAACCAAGTGAACGTGGCCATCACCCGGGCCCAGGAGGGGCTCTGCCTGATTGGAGACCACATCCTGCTGAGCTGCTGCCCCCTGTGGCGCCGCCTGCTGGATTTCTGCAGAGCCCAGCAAAGCTTCGTGCCTGCCAGCAAGGTGCGGGTCCGGAGGAGGCCAGCTGTGTCACTGTGA

XM_004841076.1 Coding sequence

Ppdpf pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish), transcript variant X2

Length: 345 bp    Location: 29177512..29178625   Strand: +
>XM_004841076.1
ATGGCAGCCATCCCCTCCAGCGGCTCGCTCGTGGCCACCCACGACTACTACCGGCGCCGCCTGGGCTCCGCGTCCGGCAGCAGCTCCTGCGGAAGTGCCGAGTACCCCGGGGAAGCCGTCCCCCACCACCTGGGTCTCCCCAAGGCCGACCCAGGTCACTGGTGGGCCAGCTTCTTCTTCGGGAAGCCCATTGTCCCATTCATGGCCACAGTGTTGGAGTCCCCAGAGCACTCGGAAGCCCCCCAGGCTCCCAGCAGCGTGGTCACCAGTGGCCTGGCTTCGGAAACCACAGGGAAGCAGCCGCTCAGCCAGCCCAGCCAGGCCAACACCAGGCCCTCGTCCTGA

XM_004841078.1 Coding sequence

Helz2 helicase with zinc finger 2, transcriptional coactivator, transcript variant X1

Length: 8904 bp    Location: 29228442..29214063   Strand: -
>XM_004841078.1
ATGGCCTCCTCGGGGTGTGGCCCATCGTCCACCAGCCCCTTGGCCCCCAGGGAGCCTCTGGCCAGGCTCTGCGCCCAAGTGGATCTCTGTCTGGGCTGCTCCCGCTGTGCCCAGCGCCTCAATGACAGCACCTACGTCCTGTGCCAGGTGGAGCACAGCTGCTCCCACGAGGTCCTTCTGGCTCGCCTTAAGGGAGCTGCCAAGAAGAAGACCTGGCGCGAGGTGGGCCACCGGCCCTGCTTCCCGCGGCCTTGGCGGTACAGAGTGTGTCGCTACTATCGCCCGGGGCTGGGCTGCCAGCACCACAGGAACAGGTGCACCTTTGCCCGCAGCCCTGAGGAGGCGCTGGTCTGGACCTTCGAGCTGAAGCACAGCCTCTCCCGCCTGTGGCTGAAGGCTGCGGTGCAGGGCGATGGGGTCCAGGGCGGGCCGTGCAGGGCTGCTGACGCCATCCTGGCAGAGTTTGGTGGCCACTTCCAGCTGCTCTGTGCCCACTGCTTCAGGGCCCGGCCCCAGCATCTCTGCCCTGTGGACCCCCAGGGGCAGTGCCCCAAGCACAGAACCTGCCCTGCACTCCTGGTGCACGTCAGTACCAAGGGCCGTAAGCGCCAGTTCACCGAGGTGCGGCCCAAGCCCCAGAATGGCCAGCCGCTGCACTACTGCATGTTTGTGGAGCAGGGACAGCCGTGCCGCCACGGGGCAGCCCGCTGCCAGTTTGCACACAGTGCTGTAGAGATGGCCGTGTGGGAGGCCGAGCAGCTGGGTGGGCTTGAGCGGGAGGCCCTGCGCACATTCCCTGCCCTCGGCAGAGACAAGTGCATGGGCCCCCATGGCCAGTGCCCCAGGGGCAGCCAGCCCCCCGAGGTAGAGCTGTACTGCTACACCTGCCTGGTAACCTACCGCTCTCAAGAGGCCTTCGAGAACCACTGCGCCTCCCTGGAGCACTCGCAGATGGTGGCCTTCGACCAGGCTGTACCCTGGGAGCACCGCGTCCCCCCCATGGGGCTCTCCAAGTTTGAGCTCTGCGCAAGGCCTGACCTCTGTGAGTATGGGGCCACCTGCACCAAGGCTCACTCAGAACAGGAGCTGCAGGAGTGGATCCGGCGGGCGCAGGCCACAGAGCTGCGGGAGCAGGCAGCCTGGCAGGACGGGCTGGTGTCATACCAGGCACGGCTGCTGGTGGAGTACCGGTGCAGCAGCAGTGAGGTCCCAGTGATGGCGGAGACCATCTGTGGCGTGTCTGTCACCTGCCGCCAGCCCCTAGTCCATCGGGCCCAGGAGAAGAAGACCCAGCACAGCTGGGTGTTCTCTGTCTACTCTGAGGACCCTCTGCTGCATGTGGCCTTGCTTAAGCAGGAGCCTGGAGCAGACTTCTTCCTGGTGGCACCCTGCCTCCCCAAGGGCCGGCTCTATGCAAGTGGGGAGCACTTTCGGGTGCCCAGCTCCCGAGCGGAGTTTCAGGTGGGAGTGCGGGTCCAGACTGCCTCCTTTGGCACCTTCGAGCAATGGGTGGTCTTTGACTTTGGCCGTCGGCCAGTGCTGCTTCGGAAGCTGTGGCTGCAGCTGGGCCAGGCTCTCTGCTCGGAGCTCACCAGGAGGCCAGCACCTGGCTGGCCTGAGGAGGTGGACCTGTGGCACACTGGCAACCGCCACATGGTGCCTTGTGTGGAGCGGACAGCCGAGCAGGCAGCCCTGATGACCAAGTACAAGGTGCCCAGCCTGGCCCTGAAGGTCGGTCACGGCAGCCTGGCCTCGGAACCCATCTCTCGAGCCAACTACCGGCAGAGCATGCACCACTTCCTCTATGAGGAGGAGGCTGCTCGGCGGCAGCTGGTGGCCAAGCTGACCCTGCGGGGCCGGGTGTCCCTGAAGACTTCACTGCAGACAGCGGCACTCGGCATGCTCTTTGCGCCCCCAGGAGCCCTCTATGCTGAGGTCCTGGTCCCTTCTTCTCTGACACCAGACACGGACCAGGGCTTCCTGCTGAGCCGGGAGGTCAGCACAGCCCTCGTGGCCCCTGTGCCTGCGCCTGACAGCACTGTGTTCGAGGTGCGACTTGAGAAGCGAGCCAGCTCGGAGCAGACATTGTGGCTGCTGCTGCCCACACACTGCTGTGTGGCCCTGGGGCTGCGGGCTGAGGGGAGCCCCATCTTGGAAGTGCAGTTCCAGATTGACCCGCTCAACTTCTGGTTCTGGCATCAGGCAGTAGATGCATTGCCTGAGGAGCACCTGGTGGTGCCCAACCTGCCCACCTGTGCCCTGCCCTGTCCTCGCCCGATCCCACCCTTGCTTCGTGGCAACCGCAAGCAGAAACTGGCTGTGGGGCTCATTGCAGGCAGCAGTGCCGGGAGCGCAAAGCCTGTGCCTCCATTGCTCATCTATGGCCCCTTTGGCACCGGCAAGACCTACACCCTGGCCATGGCCACCCTGGAGGTTGTTCAGCAGCCCCACACCAAGGTGCTCATCTGCACGCACACCAACAGTGCCGCCGACATCTACATCAGGGAGTATTTCCATGGCCATGTTGCCAGGGGCCACGTTGAGGCAGCTCCTCTCCGGGTGATGTACACTGACAGGCCGCCAAACCAGACCGACCCAACCACACTGCAGTACTGCTGCCTGACAGAGGACGCCCGGGCCTTCCGCCTGCCCACGAAGGCAGAGCTGGCGGAGCACCGCGTGGTCGTCACCACTACCTCACAGGCCCGTGAGCTCCGCGTGCCTGCTGGCTTCTTCTCCCACATCCTCATCGACGAGGCCGCCCAGATGCTGGAGTGTGAGGCCCTCACTCCGCTGGCCTACGCCTCACCACGCACCCACGTGGTGCTGGCCGGGGACCACCTGCAGGTCACACCCAGGCTCTTCAGTGTGCCCAGGGCCAAGGCTGCTGGGCACACCCTGCTGTACCGCCTTTTCCTGCACTATCAGCAGGAGGCCCACGAGATCGCTCGGCAGAGCCGCATTATCTTTCATGAGAACTACCGCTCCACCACCGCCATCATTGGCTTCATCTCGCGCCACTTCTATGTGGCCAAGGGCAACCCCATCCAGGCCAGTGGCAAGGTCCCAGCCCACCCCCGACAGTACCCACTCATGTTCTGCCATGTGGCAGGCACCCCGGAGCAGGACATGTCCATGATGTCCTGGCTGAACCCGGCGGAGGTCACACAGGTGGTGGAGAAGGTGCAGGAGGTCTACAACACCTGGCCCCACTGCTGGGGGGTCCGGGAGCAGAGAAGCATCTGTGCCATTTCCCACGGTGCTCAGGTCAGCGCACTGAGGCAGGAGCTGAGGAGGAGGAACCTGGGAGAGGTGTCTGTGGGCAGCTTTGAGACCCTGCCAGGGCGGGAGTTCCGGGTGGTGGTGCTGAGCACTGTCCACAACTGCCACAGCCTGCTCAGCCGGGGGGCGCCCACCTTGGAGTTCTTCACCGATGCTCGTGTGCTGAACACAGTCATGACCCGTGCCCAGTCCCAGGTGGTGGCTGTAGGCGACGCCATGGCCCTCTGCTCCTTCGGGGCCTGCAGCAAGCTCTGGAAGAGCTTCATCCAAGAATGCACGGAGCACCGTAGCATCTTCCCGGAGGGGCTGTCGCTGGGGCAGATTGAGCAGGGTGTGGCCCAGAGGCAGCACTGGGCCCCTGTGGCCCTCAGAGCAGAGAGAACATGGGCATCAGTAGTGAGGGACACTGGCTGGACGGGGCAGCCAGGGGCCCTGGACAGGGCAGCCAGGGGCCCTGCCACAGAGCACACAGCTATAGCAAAGGTCCCACCAGGGCCTGTGACGATGAAGAGTGAGGCCACAGGGACAGGAGACACAGCTGTTGGGGATCCAGCATCAAGAGGACCAGCCACGACACAGATAAAGGCTGAATCAGGAGGGGACACAGCAAAGGGAGACCCGGCAGGAAGACCAGCCACCCTGGAGGGCAGAGGGTCTGAGGGCCCTGAGGACTCAGAGTCAGACTTCTGGGCCTCTGACTGTGAGCTCAACGCTGACGACACCATCCTGCAGGAGCTCCTGGATGAGACCCGGCAGGTGACGGTGACTGTTGGGGAGGACGGACTCCTGGACACCCTGGCCAGGCCTGCCTCCTCACGGCTGCCCTGGCAGTACAAAAACCTGCCCTTGGGCACACTGCGGAACCTCATGCGCTCAGAGCCTGGGCTCTATCGCCGCTGCACCTTCCTGAAAGAGACCTTCGAGCGGGCATCAGCCATCCCCCTGGATGAGGCGGTCTCCAGCCCCATCCAGGTCAGGGGTCGCCTGAACTGCGGGATGGCCTTCACGGGGGACAAGGTGCTGGTGCAGGTCCTGGGCCAGTCGGCTGGTGACGAGGCTGCCCCAGAGAGGCTACAGGGCCGCGTGGTGGGTGTGCTGAAGAGGAAGAAATGTGAGCTGGCATTTGTGTGCCGGATGGACAAATGGGATCCCCGAATCATGATCCCCATCAACAGCTCTGTGACCAAGATCTTCGTAGCTGATCTGAAGGACCCGCTTCGGGTTCCCATCCACCGCCTCCTTCAGGGCCGAGTGCAGTGTGTGGGACACAAGAGTCTCACTGCCGAGGGCAGGCACACACAGCTCTTCTGGGTCCGCATCATCCTGTGGCGGGAGCGTTTCTATTACCCCCTGGGCATCATCCTGGAGGTGCTTCCTGAGGCCACCAGCTGGGAACAGGGCCTCCACATCCTTGGCCTGGAGCACGGCTTGCAAACCTCCGTGCCGGACTCAGCCTCTGTCTCCAAGGCACTGCAGAAATACCGTGTGGATCTTGGCACAGCTGCTGGCCACAGAGAGGACTGCCGCAGCTTCCTGACATTCACTGTGGACCCACAGGGCGCTTGCAACCTGGACGATGCCCTCAGTGTCCGGGACCTGGGTCCCAGGTACGAGGTGGCTGTGCACATTGCTGACGTGGCCAGTGTTGTGCCCAGGGACGGGGTGCTGGACGTGGAGGCCCGCCGGCAGGGTGCTGTGTTCTATGCCCCCGACAGGGAGCCAGTGTCCATGCTGCCGGCCAGCCTGTGCCGAGATGTGCTCAGCCTCCTGCCGGGCAAGGACCGCCTCGCCATCTCCCTCTTCCTAACCCTGGACAAGGACAGCAGCCAGCTCAGGGGCCTGCGCTTTGCACCCTCAGTTGTCTGCTCTGACAGGCAGCTGTCCTACGAGGAGGCCGAGGTGCTGATCAGGGAGCACCAGGGTGCTGGCATGGAGCTGCCGGCGTGCCTGGACTCAGTGGAGGCCTGTGTGGTGGCTGCCTGCTACTTCTCCCGGGTGCTGCGCCGGCGTCGGCTGCAAGCTGCCTGCCACTATGAGGCCCCAGATGAGGAGAGCACCCTGGGCTTCCGTGCAGCCCACATCATGGTCCAAGAGTACATGATTCAGTTTAACAGCCTGGTGGCTGAATTCCTGGTGGGCAACAAGCACACACAGGCGGTCACGCCCCTGAGATGCCAGCCCACACCCCTGATGGCCCAGCTTCAAGCCGTGTGTGAGAAGCACAGAGAACTGGTGCCCCTGTCACTGCACCTCCGCCACCACTTGCAAGGCCATAGCAGCCCCAAAACACAGCTGCACCTCCTGTCTTCCCTCTGGAAGCAGGTCCAGCTTGCTGCCCACAGCCAGGATTATGGCCAGATGGTGGATCTCATTACCACTGACGACATGCACCCCTCCCTGGCTCCCGTGGGCCTGGACCTCCGCAAGGCCCTGGGCCGCTCTGGTTTTGGCCGCTCCAGCCAGGGTGGACAGCAGCTCATTGGCCACTACTCGTTGCAGGTGGGCTGCTACACATGGGCCACATCGCCCATCCGCAGATACCTCGATGTGGTGTTGCAGCGGCTGATCCTACTAGCTCTGGGCCGAGGGGGCTGCGTGTACTCCTCCAGAGACATCGATGGGCTCTGCCAAGACTTCGCCCGCCAGCATGCATCCGCCCAGAGCTACCAGCGACAGGCCTACAGCCTGCGCCTGGCCACTCAGCTCAAGGCTCAGCCTCGAGACAAGCTGGGCGTGGTAGTAGATGTGGAGCCAGGCACCCACTGCTTCAAGTTACTCTTCCCGGCCAACCGAGAGAGCCTGCCCGACCTGTGCCCTGTCCATTATCACTCCCTGCAGCTGGCTGAGCACCCCCACGACCTCAAGGACCGGCGGGGCCTACGCCTTGTGTGGCGGCGCCGCACCTACTCTGTGCAGGAGTCCAAGCTGCCCTCTCCACTGCCTGGCACCCTGTTTGACCCACACGTCTGGACCATCAACACAACCCTGTGGAAGCAGCTGCTGGTGCTGGTGGAGCAGGACCGCTGGCTGGAGGCAGCCACCCTCATCCAGGAGCAAAGAGGGAGGGAATGTCAAAAGCGGAAGGTGGTGCAGGTGAACCGGAGCCCCTGTGGCCACTTCCTGGAGGTGACCCGGGAGCTGGGCAGCGGCGACACTCTGCAGGTCCAGTTCAGTACCAGCATGCAGCGAGGCTTCCTGGTGCCTGCCCTGCAGCTGTGGACTGTGGCACCTGGCCTCAGTCTCTGCCTGGAGCATGCAGAGCATCCAGTCAGCTGCTTCTCAGGCCATGCACACCAAGCCCCACAGCACCAGTACTGTGACGAGGATCAGTACTCGCTCATATGGGGGCCGCTCTGTGCCCAGGAGTCGGTCACTGGTGCTGTTGCTGAGAACAATTCCATTGTGCTGCAGCACGTGTGCATTTCCTGGGATGCAGAGCGGACACAGCAGAGGCAGCTGCAGGGCACCTTCCACCTGGACCCTGCCTTCCTTCAGGAGAACTGCACTGATGTTGACTTCAGCTGCTGCTACCTCTGCATCCGGCTTGAGGGCCTCCCAGTGCCCCCAGCCAGCCCACCCCCTGGGCCCAGCAGCCTTGGCCCCTTCCTGAGCATCGATCCTGACACGTATGCCTGGGTGGCCCACGGGCTGACGGACAGCTGTGACCAGGAAGACCCGGCCGACCGGCAAGAGGCCCCCAGGAGGGTGCACTTCTTCATCCACCACATGGCCATGGAGAAAGTTCCGGAAAGTGCGCTGAGGCCCGGCACCCTATTCACGGTGGAGGTGTTGCTCAAGAAGCTTCCTGACCTCTGCAAGGAGCAAGCCGTGCGCAGGCTGAAGCAGGCATCTCCACTGGTCCTCAGCATTGCCCTTGGCCGACCCCTGCTGCAGCCTGACGGCCCCATTCACCAGCGGCCCTTCCACAGGGGGACTGCTGCCAGGCTCCTGAAGCAACAGGCCTACGACATCCCTGGGGGCTGCCCCAAGCTGAACGCCAGCCAGAACAGGGCCATCAGGCAGGCTCTGGAGAAGCCATTTACTGTCATTCAGGGCCCACCAGGCACAGGGAAGACATTTGTGGGCCTCCACATCGTCTTCTGGTTCCACAAATCAAATCAGGAGCAAGTACCAAGGAGGAGAAGCTCTGACGGAGAGGAGCCACTGCAGGGCCCGTGCATCCTGTACTGTGGCCCCTCCAACAAGTCCGTGGATGTCCTGGCAGGAATGCTCCTGGGCTGGCGGGCGGAGCTGAGGCCCTTGCGGGTGTACAGCGAGCAGTTCGAGGCCACTGAGTTTCCAGCACCGGCTGTGGGCAGCAGGGGGCTATACAACAAGGCTCCCCGGGAGGAGAGGCCGAGCCAGACCCTCAGGAGCATCTCCCTGCACCACCGTGTCCGGCGGGACCCCAACCCACATGCACCAAAGGTCAGGGAGTTTGACGCCCGGGTGAGCAGAGGGGAAGTCTTCTCCAAGGAGGACCTCATTTCGTACAGGAGGGTCATGCGAGCGGCGCAGAAGTTCGAACTGGCCCGGCACTCTGTCATCCTGTGCACATGCTGCTGTGCGGCTTCACACTGCCTCCGAACCCTTAACGTCCGGCAGATCCTCATTGATGAGGCGGCCATGGCCACGGAGCCCGAGACCCTCATTCCTCTAGTGCACTTCTCGGAGGCCGAGAAGGTGGTCCTTCTTGGGGACCACAAGCAGCTGCGCCCTGTGGTCAAGAATGAGCAGCTGCAAAACCTGGGGATGGATAAGTCCCTCTTCGAGCGCTATCACAGGGATGCCTACATGCTGGACACCCAGTACCGGATGCACGAGGTCATCTGCGCCTTCCCCTCTGCGGAATTCTACGGTGGGAAGCTGAGGACCTGTCAGGGCCTGAGGCGGCCGCCCAGCATCCTGGGCCATGCGCACAAGGAGAGCTGCCCTGTCATCTTTGGCCATGTGCAGGGCCATGAACAGAGGCTGCTGGTGACCACAGAGGAAGGGAATGAGAATTCCAGGGCCAACCTGGAGGAGGTGGCAGAGGTGGTGAGTGTCAGAGGCCCTCCCCGGAAACTTGTGTGTCCGGGAAGGCTTCCTGGAGGAGGAACAGGAGTTGGGGCTGAGGGAACAAGTAAAGCTCCTGTGTCCGGTCCAGCTCCACCTGCCCCTTCATTCCCTCAGATCCGCATCACCAAGCAACTGACACTGGACCGGACAGTGGAGCCCAAAGACATTGCCATCCTCACCCCCTATAATGCACAGGCTGCGGCCATCAACAAGGGCCTCATGCGGGAGGGTGTCACCGGAGTGACCGTGTCCTCCATCACCAAGAGCCAGGGAAGCGAGTGGCGCTATGTGCTGGTGAGCACTGTCCGCACGTGCCCCCGGAGCGATGTGGACTGCCGGCCAACGAAGGGCTGGCTCAGGAAGTTCCTGGGCTTTGTTGTGGACCCCAACCAAGTGAACGTGGCCATCACCCGGGCCCAGGAGGGGCTCTGCCTGATTGGAGACCACATCCTGCTGAGCTGCTGCCCCCTGTGGCGCCGCCTGCTGGATTTCTGCAGAGCCCAGCAAAGCTTCGTGCCTGCCAGCAAGGTGCGGGTCCGGAGGAGGCCAGCTGTGTCACTGTGA

XM_004841079.1 Coding sequence

Helz2 helicase with zinc finger 2, transcriptional coactivator, transcript variant X2

Length: 8904 bp    Location: 29228058..29214063   Strand: -
>XM_004841079.1
ATGGCCTCCTCGGGGTGTGGCCCATCGTCCACCAGCCCCTTGGCCCCCAGGGAGCCTCTGGCCAGGCTCTGCGCCCAAGTGGATCTCTGTCTGGGCTGCTCCCGCTGTGCCCAGCGCCTCAATGACAGCACCTACGTCCTGTGCCAGGTGGAGCACAGCTGCTCCCACGAGGTCCTTCTGGCTCGCCTTAAGGGAGCTGCCAAGAAGAAGACCTGGCGCGAGGTGGGCCACCGGCCCTGCTTCCCGCGGCCTTGGCGGTACAGAGTGTGTCGCTACTATCGCCCGGGGCTGGGCTGCCAGCACCACAGGAACAGGTGCACCTTTGCCCGCAGCCCTGAGGAGGCGCTGGTCTGGACCTTCGAGCTGAAGCACAGCCTCTCCCGCCTGTGGCTGAAGGCTGCGGTGCAGGGCGATGGGGTCCAGGGCGGGCCGTGCAGGGCTGCTGACGCCATCCTGGCAGAGTTTGGTGGCCACTTCCAGCTGCTCTGTGCCCACTGCTTCAGGGCCCGGCCCCAGCATCTCTGCCCTGTGGACCCCCAGGGGCAGTGCCCCAAGCACAGAACCTGCCCTGCACTCCTGGTGCACGTCAGTACCAAGGGCCGTAAGCGCCAGTTCACCGAGGTGCGGCCCAAGCCCCAGAATGGCCAGCCGCTGCACTACTGCATGTTTGTGGAGCAGGGACAGCCGTGCCGCCACGGGGCAGCCCGCTGCCAGTTTGCACACAGTGCTGTAGAGATGGCCGTGTGGGAGGCCGAGCAGCTGGGTGGGCTTGAGCGGGAGGCCCTGCGCACATTCCCTGCCCTCGGCAGAGACAAGTGCATGGGCCCCCATGGCCAGTGCCCCAGGGGCAGCCAGCCCCCCGAGGTAGAGCTGTACTGCTACACCTGCCTGGTAACCTACCGCTCTCAAGAGGCCTTCGAGAACCACTGCGCCTCCCTGGAGCACTCGCAGATGGTGGCCTTCGACCAGGCTGTACCCTGGGAGCACCGCGTCCCCCCCATGGGGCTCTCCAAGTTTGAGCTCTGCGCAAGGCCTGACCTCTGTGAGTATGGGGCCACCTGCACCAAGGCTCACTCAGAACAGGAGCTGCAGGAGTGGATCCGGCGGGCGCAGGCCACAGAGCTGCGGGAGCAGGCAGCCTGGCAGGACGGGCTGGTGTCATACCAGGCACGGCTGCTGGTGGAGTACCGGTGCAGCAGCAGTGAGGTCCCAGTGATGGCGGAGACCATCTGTGGCGTGTCTGTCACCTGCCGCCAGCCCCTAGTCCATCGGGCCCAGGAGAAGAAGACCCAGCACAGCTGGGTGTTCTCTGTCTACTCTGAGGACCCTCTGCTGCATGTGGCCTTGCTTAAGCAGGAGCCTGGAGCAGACTTCTTCCTGGTGGCACCCTGCCTCCCCAAGGGCCGGCTCTATGCAAGTGGGGAGCACTTTCGGGTGCCCAGCTCCCGAGCGGAGTTTCAGGTGGGAGTGCGGGTCCAGACTGCCTCCTTTGGCACCTTCGAGCAATGGGTGGTCTTTGACTTTGGCCGTCGGCCAGTGCTGCTTCGGAAGCTGTGGCTGCAGCTGGGCCAGGCTCTCTGCTCGGAGCTCACCAGGAGGCCAGCACCTGGCTGGCCTGAGGAGGTGGACCTGTGGCACACTGGCAACCGCCACATGGTGCCTTGTGTGGAGCGGACAGCCGAGCAGGCAGCCCTGATGACCAAGTACAAGGTGCCCAGCCTGGCCCTGAAGGTCGGTCACGGCAGCCTGGCCTCGGAACCCATCTCTCGAGCCAACTACCGGCAGAGCATGCACCACTTCCTCTATGAGGAGGAGGCTGCTCGGCGGCAGCTGGTGGCCAAGCTGACCCTGCGGGGCCGGGTGTCCCTGAAGACTTCACTGCAGACAGCGGCACTCGGCATGCTCTTTGCGCCCCCAGGAGCCCTCTATGCTGAGGTCCTGGTCCCTTCTTCTCTGACACCAGACACGGACCAGGGCTTCCTGCTGAGCCGGGAGGTCAGCACAGCCCTCGTGGCCCCTGTGCCTGCGCCTGACAGCACTGTGTTCGAGGTGCGACTTGAGAAGCGAGCCAGCTCGGAGCAGACATTGTGGCTGCTGCTGCCCACACACTGCTGTGTGGCCCTGGGGCTGCGGGCTGAGGGGAGCCCCATCTTGGAAGTGCAGTTCCAGATTGACCCGCTCAACTTCTGGTTCTGGCATCAGGCAGTAGATGCATTGCCTGAGGAGCACCTGGTGGTGCCCAACCTGCCCACCTGTGCCCTGCCCTGTCCTCGCCCGATCCCACCCTTGCTTCGTGGCAACCGCAAGCAGAAACTGGCTGTGGGGCTCATTGCAGGCAGCAGTGCCGGGAGCGCAAAGCCTGTGCCTCCATTGCTCATCTATGGCCCCTTTGGCACCGGCAAGACCTACACCCTGGCCATGGCCACCCTGGAGGTTGTTCAGCAGCCCCACACCAAGGTGCTCATCTGCACGCACACCAACAGTGCCGCCGACATCTACATCAGGGAGTATTTCCATGGCCATGTTGCCAGGGGCCACGTTGAGGCAGCTCCTCTCCGGGTGATGTACACTGACAGGCCGCCAAACCAGACCGACCCAACCACACTGCAGTACTGCTGCCTGACAGAGGACGCCCGGGCCTTCCGCCTGCCCACGAAGGCAGAGCTGGCGGAGCACCGCGTGGTCGTCACCACTACCTCACAGGCCCGTGAGCTCCGCGTGCCTGCTGGCTTCTTCTCCCACATCCTCATCGACGAGGCCGCCCAGATGCTGGAGTGTGAGGCCCTCACTCCGCTGGCCTACGCCTCACCACGCACCCACGTGGTGCTGGCCGGGGACCACCTGCAGGTCACACCCAGGCTCTTCAGTGTGCCCAGGGCCAAGGCTGCTGGGCACACCCTGCTGTACCGCCTTTTCCTGCACTATCAGCAGGAGGCCCACGAGATCGCTCGGCAGAGCCGCATTATCTTTCATGAGAACTACCGCTCCACCACCGCCATCATTGGCTTCATCTCGCGCCACTTCTATGTGGCCAAGGGCAACCCCATCCAGGCCAGTGGCAAGGTCCCAGCCCACCCCCGACAGTACCCACTCATGTTCTGCCATGTGGCAGGCACCCCGGAGCAGGACATGTCCATGATGTCCTGGCTGAACCCGGCGGAGGTCACACAGGTGGTGGAGAAGGTGCAGGAGGTCTACAACACCTGGCCCCACTGCTGGGGGGTCCGGGAGCAGAGAAGCATCTGTGCCATTTCCCACGGTGCTCAGGTCAGCGCACTGAGGCAGGAGCTGAGGAGGAGGAACCTGGGAGAGGTGTCTGTGGGCAGCTTTGAGACCCTGCCAGGGCGGGAGTTCCGGGTGGTGGTGCTGAGCACTGTCCACAACTGCCACAGCCTGCTCAGCCGGGGGGCGCCCACCTTGGAGTTCTTCACCGATGCTCGTGTGCTGAACACAGTCATGACCCGTGCCCAGTCCCAGGTGGTGGCTGTAGGCGACGCCATGGCCCTCTGCTCCTTCGGGGCCTGCAGCAAGCTCTGGAAGAGCTTCATCCAAGAATGCACGGAGCACCGTAGCATCTTCCCGGAGGGGCTGTCGCTGGGGCAGATTGAGCAGGGTGTGGCCCAGAGGCAGCACTGGGCCCCTGTGGCCCTCAGAGCAGAGAGAACATGGGCATCAGTAGTGAGGGACACTGGCTGGACGGGGCAGCCAGGGGCCCTGGACAGGGCAGCCAGGGGCCCTGCCACAGAGCACACAGCTATAGCAAAGGTCCCACCAGGGCCTGTGACGATGAAGAGTGAGGCCACAGGGACAGGAGACACAGCTGTTGGGGATCCAGCATCAAGAGGACCAGCCACGACACAGATAAAGGCTGAATCAGGAGGGGACACAGCAAAGGGAGACCCGGCAGGAAGACCAGCCACCCTGGAGGGCAGAGGGTCTGAGGGCCCTGAGGACTCAGAGTCAGACTTCTGGGCCTCTGACTGTGAGCTCAACGCTGACGACACCATCCTGCAGGAGCTCCTGGATGAGACCCGGCAGGTGACGGTGACTGTTGGGGAGGACGGACTCCTGGACACCCTGGCCAGGCCTGCCTCCTCACGGCTGCCCTGGCAGTACAAAAACCTGCCCTTGGGCACACTGCGGAACCTCATGCGCTCAGAGCCTGGGCTCTATCGCCGCTGCACCTTCCTGAAAGAGACCTTCGAGCGGGCATCAGCCATCCCCCTGGATGAGGCGGTCTCCAGCCCCATCCAGGTCAGGGGTCGCCTGAACTGCGGGATGGCCTTCACGGGGGACAAGGTGCTGGTGCAGGTCCTGGGCCAGTCGGCTGGTGACGAGGCTGCCCCAGAGAGGCTACAGGGCCGCGTGGTGGGTGTGCTGAAGAGGAAGAAATGTGAGCTGGCATTTGTGTGCCGGATGGACAAATGGGATCCCCGAATCATGATCCCCATCAACAGCTCTGTGACCAAGATCTTCGTAGCTGATCTGAAGGACCCGCTTCGGGTTCCCATCCACCGCCTCCTTCAGGGCCGAGTGCAGTGTGTGGGACACAAGAGTCTCACTGCCGAGGGCAGGCACACACAGCTCTTCTGGGTCCGCATCATCCTGTGGCGGGAGCGTTTCTATTACCCCCTGGGCATCATCCTGGAGGTGCTTCCTGAGGCCACCAGCTGGGAACAGGGCCTCCACATCCTTGGCCTGGAGCACGGCTTGCAAACCTCCGTGCCGGACTCAGCCTCTGTCTCCAAGGCACTGCAGAAATACCGTGTGGATCTTGGCACAGCTGCTGGCCACAGAGAGGACTGCCGCAGCTTCCTGACATTCACTGTGGACCCACAGGGCGCTTGCAACCTGGACGATGCCCTCAGTGTCCGGGACCTGGGTCCCAGGTACGAGGTGGCTGTGCACATTGCTGACGTGGCCAGTGTTGTGCCCAGGGACGGGGTGCTGGACGTGGAGGCCCGCCGGCAGGGTGCTGTGTTCTATGCCCCCGACAGGGAGCCAGTGTCCATGCTGCCGGCCAGCCTGTGCCGAGATGTGCTCAGCCTCCTGCCGGGCAAGGACCGCCTCGCCATCTCCCTCTTCCTAACCCTGGACAAGGACAGCAGCCAGCTCAGGGGCCTGCGCTTTGCACCCTCAGTTGTCTGCTCTGACAGGCAGCTGTCCTACGAGGAGGCCGAGGTGCTGATCAGGGAGCACCAGGGTGCTGGCATGGAGCTGCCGGCGTGCCTGGACTCAGTGGAGGCCTGTGTGGTGGCTGCCTGCTACTTCTCCCGGGTGCTGCGCCGGCGTCGGCTGCAAGCTGCCTGCCACTATGAGGCCCCAGATGAGGAGAGCACCCTGGGCTTCCGTGCAGCCCACATCATGGTCCAAGAGTACATGATTCAGTTTAACAGCCTGGTGGCTGAATTCCTGGTGGGCAACAAGCACACACAGGCGGTCACGCCCCTGAGATGCCAGCCCACACCCCTGATGGCCCAGCTTCAAGCCGTGTGTGAGAAGCACAGAGAACTGGTGCCCCTGTCACTGCACCTCCGCCACCACTTGCAAGGCCATAGCAGCCCCAAAACACAGCTGCACCTCCTGTCTTCCCTCTGGAAGCAGGTCCAGCTTGCTGCCCACAGCCAGGATTATGGCCAGATGGTGGATCTCATTACCACTGACGACATGCACCCCTCCCTGGCTCCCGTGGGCCTGGACCTCCGCAAGGCCCTGGGCCGCTCTGGTTTTGGCCGCTCCAGCCAGGGTGGACAGCAGCTCATTGGCCACTACTCGTTGCAGGTGGGCTGCTACACATGGGCCACATCGCCCATCCGCAGATACCTCGATGTGGTGTTGCAGCGGCTGATCCTACTAGCTCTGGGCCGAGGGGGCTGCGTGTACTCCTCCAGAGACATCGATGGGCTCTGCCAAGACTTCGCCCGCCAGCATGCATCCGCCCAGAGCTACCAGCGACAGGCCTACAGCCTGCGCCTGGCCACTCAGCTCAAGGCTCAGCCTCGAGACAAGCTGGGCGTGGTAGTAGATGTGGAGCCAGGCACCCACTGCTTCAAGTTACTCTTCCCGGCCAACCGAGAGAGCCTGCCCGACCTGTGCCCTGTCCATTATCACTCCCTGCAGCTGGCTGAGCACCCCCACGACCTCAAGGACCGGCGGGGCCTACGCCTTGTGTGGCGGCGCCGCACCTACTCTGTGCAGGAGTCCAAGCTGCCCTCTCCACTGCCTGGCACCCTGTTTGACCCACACGTCTGGACCATCAACACAACCCTGTGGAAGCAGCTGCTGGTGCTGGTGGAGCAGGACCGCTGGCTGGAGGCAGCCACCCTCATCCAGGAGCAAAGAGGGAGGGAATGTCAAAAGCGGAAGGTGGTGCAGGTGAACCGGAGCCCCTGTGGCCACTTCCTGGAGGTGACCCGGGAGCTGGGCAGCGGCGACACTCTGCAGGTCCAGTTCAGTACCAGCATGCAGCGAGGCTTCCTGGTGCCTGCCCTGCAGCTGTGGACTGTGGCACCTGGCCTCAGTCTCTGCCTGGAGCATGCAGAGCATCCAGTCAGCTGCTTCTCAGGCCATGCACACCAAGCCCCACAGCACCAGTACTGTGACGAGGATCAGTACTCGCTCATATGGGGGCCGCTCTGTGCCCAGGAGTCGGTCACTGGTGCTGTTGCTGAGAACAATTCCATTGTGCTGCAGCACGTGTGCATTTCCTGGGATGCAGAGCGGACACAGCAGAGGCAGCTGCAGGGCACCTTCCACCTGGACCCTGCCTTCCTTCAGGAGAACTGCACTGATGTTGACTTCAGCTGCTGCTACCTCTGCATCCGGCTTGAGGGCCTCCCAGTGCCCCCAGCCAGCCCACCCCCTGGGCCCAGCAGCCTTGGCCCCTTCCTGAGCATCGATCCTGACACGTATGCCTGGGTGGCCCACGGGCTGACGGACAGCTGTGACCAGGAAGACCCGGCCGACCGGCAAGAGGCCCCCAGGAGGGTGCACTTCTTCATCCACCACATGGCCATGGAGAAAGTTCCGGAAAGTGCGCTGAGGCCCGGCACCCTATTCACGGTGGAGGTGTTGCTCAAGAAGCTTCCTGACCTCTGCAAGGAGCAAGCCGTGCGCAGGCTGAAGCAGGCATCTCCACTGGTCCTCAGCATTGCCCTTGGCCGACCCCTGCTGCAGCCTGACGGCCCCATTCACCAGCGGCCCTTCCACAGGGGGACTGCTGCCAGGCTCCTGAAGCAACAGGCCTACGACATCCCTGGGGGCTGCCCCAAGCTGAACGCCAGCCAGAACAGGGCCATCAGGCAGGCTCTGGAGAAGCCATTTACTGTCATTCAGGGCCCACCAGGCACAGGGAAGACATTTGTGGGCCTCCACATCGTCTTCTGGTTCCACAAATCAAATCAGGAGCAAGTACCAAGGAGGAGAAGCTCTGACGGAGAGGAGCCACTGCAGGGCCCGTGCATCCTGTACTGTGGCCCCTCCAACAAGTCCGTGGATGTCCTGGCAGGAATGCTCCTGGGCTGGCGGGCGGAGCTGAGGCCCTTGCGGGTGTACAGCGAGCAGTTCGAGGCCACTGAGTTTCCAGCACCGGCTGTGGGCAGCAGGGGGCTATACAACAAGGCTCCCCGGGAGGAGAGGCCGAGCCAGACCCTCAGGAGCATCTCCCTGCACCACCGTGTCCGGCGGGACCCCAACCCACATGCACCAAAGGTCAGGGAGTTTGACGCCCGGGTGAGCAGAGGGGAAGTCTTCTCCAAGGAGGACCTCATTTCGTACAGGAGGGTCATGCGAGCGGCGCAGAAGTTCGAACTGGCCCGGCACTCTGTCATCCTGTGCACATGCTGCTGTGCGGCTTCACACTGCCTCCGAACCCTTAACGTCCGGCAGATCCTCATTGATGAGGCGGCCATGGCCACGGAGCCCGAGACCCTCATTCCTCTAGTGCACTTCTCGGAGGCCGAGAAGGTGGTCCTTCTTGGGGACCACAAGCAGCTGCGCCCTGTGGTCAAGAATGAGCAGCTGCAAAACCTGGGGATGGATAAGTCCCTCTTCGAGCGCTATCACAGGGATGCCTACATGCTGGACACCCAGTACCGGATGCACGAGGTCATCTGCGCCTTCCCCTCTGCGGAATTCTACGGTGGGAAGCTGAGGACCTGTCAGGGCCTGAGGCGGCCGCCCAGCATCCTGGGCCATGCGCACAAGGAGAGCTGCCCTGTCATCTTTGGCCATGTGCAGGGCCATGAACAGAGGCTGCTGGTGACCACAGAGGAAGGGAATGAGAATTCCAGGGCCAACCTGGAGGAGGTGGCAGAGGTGGTGAGTGTCAGAGGCCCTCCCCGGAAACTTGTGTGTCCGGGAAGGCTTCCTGGAGGAGGAACAGGAGTTGGGGCTGAGGGAACAAGTAAAGCTCCTGTGTCCGGTCCAGCTCCACCTGCCCCTTCATTCCCTCAGATCCGCATCACCAAGCAACTGACACTGGACCGGACAGTGGAGCCCAAAGACATTGCCATCCTCACCCCCTATAATGCACAGGCTGCGGCCATCAACAAGGGCCTCATGCGGGAGGGTGTCACCGGAGTGACCGTGTCCTCCATCACCAAGAGCCAGGGAAGCGAGTGGCGCTATGTGCTGGTGAGCACTGTCCGCACGTGCCCCCGGAGCGATGTGGACTGCCGGCCAACGAAGGGCTGGCTCAGGAAGTTCCTGGGCTTTGTTGTGGACCCCAACCAAGTGAACGTGGCCATCACCCGGGCCCAGGAGGGGCTCTGCCTGATTGGAGACCACATCCTGCTGAGCTGCTGCCCCCTGTGGCGCCGCCTGCTGGATTTCTGCAGAGCCCAGCAAAGCTTCGTGCCTGCCAGCAAGGTGCGGGTCCGGAGGAGGCCAGCTGTGTCACTGTGA

XM_004841073.1 Coding sequence

Eef1a2 eukaryotic translation elongation factor 1 alpha 2, transcript variant X3

Length: 1452 bp    Location: 29163805..29155492   Strand: -
>XM_004841073.1
ATGGGCAAGGAGAAGACTCACATCAACATTGTGGTCATCGGCCACGTGGACTCAGGCAAGTCCACCACGACGGGTCACCTCATCTACAAATGTGGGGGCATCGACAAGAGGACCATTGAGAAGTTTGAGAAAGAGGCGGCTGAGATGGGGAAGGGCTCCTTCAAGTACGCCTGGGTGCTGGACAAGCTGAAGGCGGAGCGGGAGCGTGGCATTACCATTGACATTTCCCTCTGGAAGTTCGAGACCACCAAATACTACATCACCATCATTGATGCCCCGGGCCACCGAGACTTCATCAAGAACATGATCACCGGCACATCCCAAGCGGACTGCGCAGTGCTGATCGTGGCAGCAGGTGTGGGTGAATTTGAAGCTGGCATCTCTAAGAATGGGCAGACCCGGGAGCACGCGCTGCTGGCCTACACCCTGGGGGTGAAGCAGCTCATTGTGGGTGTCAACAAGATGGACTCCACGGAGCCAGCCTACAGTGAGAAGCGCTACGATGAGATCGTCAAGGAGGTCAGCGCCTACATCAAGAAGATTGGCTACAACCCAGCCACAGTGCCCTTTGTGCCCATCTCAGGCTGGCATGGGGACAACATGCTGGAGCCCTCGCCCAACATGCCATGGTTCAAGGGCTGGAAGGTGGAGCGCAAAGAAGGGAACGCAAGTGGCGTGTCCCTGCTAGAGGCCCTGGATACCATCCTGCCCCCCACCCGGCCCACAGACAAGCCCCTGCGCCTGCCCCTGCAGGATGTGTACAAGATCGGTGGCATTGGCACTGTGCCCGTGGGCCGAGTGGAGACAGGCATCCTTCGGCCAGGCATGGTGGTGACCTTTGCACCGGTAAACATCACCACGGAGGTGAAGTCAGTGGAAATGCATCACGAGGCGCTCAGTGAGGCTCTGCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTGTCTGTCAAGGATATCCGCCGGGGCAATGTGTGTGGGGACAGCAAGTCTGATCCGCCTCAGGAGGCTGCCCAGTTTACCTCCCAGGTCATCATCCTGAACCACCCTGGGCAGATCAGCGCTGGCTACTCGCCAGTCATTGACTGCCACACGGCCCACATTGCCTGTAAATTTGCCGAGCTGAAGGAGAAGATCGACCGGCGCTCTGGCAAGAAGCTGGAGGACAACCCCAAGTCTCTGAAGTCCGGCGATGCAGCCATCGTAGAGATGGTCCCCGGGAAGCCCATGTGTGTGGAGAGCTTCTCGCAGTACCCACCTCTCGGTGAGCGGGGTGCCCCAGGGAGACACGGGACGAGGTGGCTGATCCAATACGCCGGCAGAGGGCGGCTGGGGGAAGTTGCGGGGGGGGAGGCTCCTTTGCCGTTGGAAACTTCTCTTGAGCTTACTCATAGCGCTCAGTCTCTGTCACTGAGTGCAGGTGGCAAACCTGGGATGGTGTCCCTCTGTTGA

XM_004841068.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X15

Length: 2523 bp    Location: 29143589..29095029   Strand: -
>XM_004841068.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCTGAGCAGAGCCTTGAAGACAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004840798.1 Coding sequence

Crls1 cardiolipin synthase 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 612 bp    Location: 6828677..6852071   Strand: +
>XM_004840798.1
ATGCCACAGTATGAAAATCCATGGACAATTCCAAATATGTTGTCAATGACAAGAATTGGCTTGGCTCCAGTTTTGGGCTATTTGATTATTGAAGAAGATTTTAATGTTGCACTCGGAGTCTTTGCTTTAGCTGGACTTACTGATTTGTTGGATGGATTTATTGCTCGAAACTGGGCCAATCAAAAATCAGCTTTGGGAAGTGCTCTTGATCCACTTGCTGATAAAATACTTATCAGTGTATTATATGTTAGCTTGACCTATGCAGATCTTATTCCAGTTCCACTTACTTATATGATAATTTCAAGAGACATAATGTTGATTGCTGCTGTTTTTTATGTCAGATATCGAACTCTCCCAACACCGCGAACACTAGCTAAGTATTTCAATCCTTGCTATGCTACTGCTAGGTTAAAACCAACATTCATCAGTAAGGTGAACACAGCGGTCCAGTTAATCTTGGTGGCAGCTTCTTTGGCAGCTCCAGTTTTCAATTATGCTGACAGCGTTTATCTTCACATACTGTGGTATTTTACAGCTTTCACCACAGCTGCATCAGCTTACAGTTATTATCATTATGGTCGGAAAACTGTTCAAGTGATAAAAGACAGATGA

XM_004841069.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X16

Length: 2436 bp    Location: 29143589..29095029   Strand: -
>XM_004841069.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGGTACCGGGTGGGGCAGAAGGTGACCCAGACGCAGGGAGACGCTAGGTCCAGACCCGGCCCCAGCCCCAGACATGCTGGTCCTCCTTTCATTCCAAGATCCATGACTCTCGAAGCGCTCGGGTTAGCGTGGAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004841059.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X6

Length: 2655 bp    Location: 29143589..29095029   Strand: -
>XM_004841059.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCTGAGCAGAGCCTTGAAGACAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGGATAGATATGATTGTGGGCCCCCCACCCCCTTCAACTCCCCGGCACAAGAAGTACCCCACCAAAGGACCCACGGCCCCTCCGAGAGAGTCACCCCAGTACTCACCTAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004841058.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X5

Length: 2691 bp    Location: 29143589..29095029   Strand: -
>XM_004841058.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGTCAGAAGGTCAGTTTGAAAGACCGTGTCTTCTCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCTGAGCAGAGCCTTGAAGACAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGGATAGATATGATTGTGGGCCCCCCACCCCCTTCAACTCCCCGGCACAAGAAGTACCCCACCAAAGGACCCACGGCCCCTCCGAGAGAGTCACCCCAGTACTCACCTAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004841062.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X9

Length: 2634 bp    Location: 29143589..29095029   Strand: -
>XM_004841062.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGTAAAGGCAGACCGTGCCGAGGGTGCCTGTGTGGATGCTGCCCCGGACACTCTAGTCAGAAGGTCAGTTTGAAAGACCGTGTCTTCTCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCTGAGCAGAGCCTTGAAGACAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004841061.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X8

Length: 2637 bp    Location: 29143589..29095029   Strand: -
>XM_004841061.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGTAAAGGCAGACCGTGCCGAGGGTGCCTGTGTGGATGCTGCCCCGGACACTCTAGTCAGAAGGTCAGTTTGAAAGACCGTGTCTTCTCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCTGAGCAGAGCCTTGAAGACAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004841057.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X4

Length: 2715 bp    Location: 29143589..29095029   Strand: -
>XM_004841057.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGTAAAGGCAGACCGTGCCGAGGGTGCCTGTGTGGATGCTGCCCCGGACACTCTAGTCAGAAGGTCAGTTTGAAAGACCGTGTCTTCTCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCTGAGCAGAGCCTTGAAGACAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGGATAGATATGATTGTGGGCCCCCCACCCCCTTCAACTCCCCGGCACAAGAAGTACCCCACCAAAGGACCCACGGCCCCTCCGAGAGAGTCACCCCAGTACTCACCTAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004841054.1 Coding sequence

Kcnq2 potassium voltage-gated channel, KQT-like subfamily, member 2, transcript variant X1

Length: 2745 bp    Location: 29143589..29095029   Strand: -
>XM_004841054.1
ATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGTAAAGGCAGACCGTGCCGAGGGTGCCTGTGTGGATGCTGCCCCGGACACTCTAGTCAGAAGGTCAGTTTGAAAGACCGTGTCTTCTCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCTGAGCAGAGCCTTGAAGACAGCCCGAGCAAGGTGCCCAAGAGCTGGAGCTTTGGGGACCGCAGCCGTGCGCGACAGGCTTTCCGCATCAAGGGCGCCACCTCCCGGCAGAACTCGGAAGAAGCAAGTCTCCCCGGGGAGGACATCGTGGAGGACAATAAGAGCTGCAACTGCGAGTTTGTGAGCGAGGACTTGACGCCTGGCCTGAAAGTCAGCATCCGAGCCGTGTGTGTCATGCGGTTCCTGGTGTCCAAGCGGAAGTTCAAGGAGAGCCTGCGGCCATACGACGTGATGGATGTCATTGAGCAGTATTCAGCCGGGCACCTGGACATGCTGTCCCGCATCAAGAGCCTGCAGTCCAGGATAGATATGATTGTGGGCCCCCCACCCCCTTCAACTCCCCGGCACAAGAAGTACCCCACCAAAGGACCCACGGCCCCTCCGAGAGAGTCACCCCAGTACTCACCTAGAGTGGACCAGATCGTGGGGCGGGGCCCAGCGATAACAGACAAGGACCGGACCAAGGGCCCGGCGGAGGCTGAGCTGCCAGAGGACCCCAGCATGATGGGGCGGCTCGGCAAGGTAGAGAAGCAGGTCTTGTCCATGGAGAAGAAGCTGGACTTCCTGGTGAACATCTACATGCAGCGCATGGGCATCCCCCCGACCGAGACCGAGGCCTACTTTGGAGCGAAGGAGCCAGAGCCGGCACCACCGTACCACAGCCCCGAGGACAGCCGGGAGCACGTGGACAAGCACGGCTGCATCATCAAGATCGTCCGGTCCACCAGCTCCACCGGCCAGAGGAACTTCTCCGCGCCCCCCACAGTGCCCCCTGCCCAGTGCCCACCGTCCACCTCATGGCAGCAGCAGGGGCACCAGCGCCACGGCACCTCCCCTGTGGGGGACCACAGCTCACTGGTCCGCATCCCACCGCCGCCCGCACATGAGCGCTCGCTGTCCGCCTACAGCGGGGCCAACCGGGCCAGCACAGAGTTCCTGAGGCTGGAGGACACCCCGGCCTGCAGGCCCCACGAGGGCATCCCGCGGGACAGTGACACGTCCATCTCCATCCCATCCGTGGACCACGAGGAGCTGGAGCGCTCCTTCAGTGGCTTCAGCATCTCCCAATCCAAGGAGAACCTGGACGCGCTCAGCGGCTGCTACGCAGCTGTGGCCCCGTGTGCCAAGGTCAGGCCCTACATCGCGGAGGGCGAGTCCGACACGGACTCGGACCTCTGCACGCCCTGTGGGCCCCCGCCACGCTCTGCCACAGGCGAGGGCCCCTTTGGCGATATGGGCTGGGCTGGGCCCAGGAAGTGA

XM_004841049.1 Coding sequence

Chrna4 cholinergic receptor, nicotinic, alpha 4 (neuronal), transcript variant X1

Length: 1905 bp    Location: 29038779..29024668   Strand: -
>XM_004841049.1
ATGGGGCAGAACACACCCGACGAGGGTCTTCAGGTAGGGTGGGGATGTGGCAGAGTGCCTGGTGTGAGGCGGCGTGGATGGCCACCCAGCCCATCTGCACCAGCCACTGGCCCACCTCTCTGCGCAGTGAGCAGCCATGTGGAGACCCGGGCCCACTCGGAGGAGCGGCTCTTGAAGACCCTCTTCTCCGGCTACAACAAGTGGTCCCGGCCAGTGGCCAACACCTCGGATGTGGTCCTCGTCCGCTTTGGCCTGTCCATCGCCCAGCTAATTGATGTGGACGAGAAGAACCAGATGATGACGACGAACGTGTGGGTGAAGCAGGAGTGGCACGACTACAAGCTGCGCTGGGAGCCCAGCGACTACGAGAACGTCACCTCTATCCGCATTCCCTCTGAGCTCATCTGGCGGCCGGACATCGTCCTCTATAACAATGCGGATGGGGACTTTGCCATCACCCACCTGACCAAGGCCCACCTGTTCCATGACGGGCGGGTGCAGTGGACGCCCCCGGCCATCTACAAGAGCTCCTGCAGCATCGATGTCACCTTCTTCCCCTTCGACCAGCAGAACTGCACCATGAAGTTCGGGTCCTGGACCTACGACAAGGCTGAGATCGACCTGGTGAGCATGCACAGCCGGGTGGACCAGCTGGAGTTCTGGGAGAGCGGCGAGTGGGCCATCGTGGATGCCGTGGGCACCTACAACACGCGGAAGTATGAGTGCTGTGCCGAGATCTATCCCGACATCACCTACGCCTTCGTCATCCGGCGCCTGCCACTCTTCTACACCATCAACCTCATCATCCCGTGCCTGCTCATCTCCTGCCTCACCGTGCTGGTCTTCTACCTCCCCTCCGACTGCGGCGAGAAGATCACCCTGTGCATCTCGGTGCTGCTGTCGCTCACCGTCTTCCTGCTCCTCATCACCGAGATCATCCCGTCCACCTCACTGGTCATCCCGCTCATCGGTGAGTACCTGCTCTTCACCATGATCTTCGTCACCCTCTCCATCATCATCACCGTCTTCGTGCTCAACGTGCACCACCGCTGGCCGCACACGCACAGCATGCCTGCCTGGGTGCGCAGGGTTTTCCTGGACATCGTGCCGCGCCTGCTCTTCATGAAGCGGCCGTCCGTGGTCAAGGACAACTGCCGGCGGCTCATCGAGTCCATGCACAAGATGGCCAGCACCCCACGCTTCTGGCCCGAGCCTGAGGGGGAGCCCAGCGTCCTGAGTGGCTCCCGCAGTGGGGGCCCATCTCCCAGCCCATCCTCCTGTGTCCCTGCGGAGCCTCAGCCTTCCTGCAAGTCGGCCTCTGGCCAGGCGCCCACTGTGGAGCCCGCGGGGGCCGAGGAGGCTGGCCCCTGCCCCCTACCCAACAGCTCCAGGGCCTTTGCGACCCCCAAAGCCAGGTCCCTGAGTGTCCAGCACATGTCCAGTCCCCATGAAACAACGGAGGGCGGCATCCGGAGCCGATCTCGGAGTGTCCAGTACTGGGGCCCTCGGGACAGCACTGCCTCCTGGGCTGATGGCTGGGTGGCTGGCTCCCCGGCTTCTCTGAAGGCCCAGTCTGCTGAGCTGCCGCCAGACCAGCCCTCCCCATGCAAGTGCATGTGTAAGAAGGAGCCACCTGTGGTGTCCCCGGTCACTGTGCTCGAGGCCCACAGCACCAAAGTGCCACCCCGGCACCTGCCCCTGTCACCGGCCTTGACCCAGGCGGTGGAGGGCGTCCAGTACATCGCTGATCATCTGAAGGCAGAAGACTCTGATTTCTCGGTGAAGGAGGACTGGAAGTACGTGGCCATGGTCATCGACCGCATCTTCCTCTGGATGTTCATCGTTGTCTGCCTGCTGGGAACCGTGGGCCTGTTCCTGCCACCCTGGCTGGCCGGCATGATCTAA

XM_004841045.1 Coding sequence

Arfgap1 ADP-ribosylation factor GTPase activating protein 1, transcript variant X3

Length: 1161 bp    Location: 28971334..28986717   Strand: +
>XM_004841045.1
ATGGCCAGCCCAAGGACCAGGAAAGTTCTTAAAGAAGTCAGAGTGCAAGATGAGAACAACGTTTGTTTTGAGTGTGGTGCATTCAACCCTCAGTGGGTCAGCGTGACTTATGGCATCTGGATCTGCCTGGAGTGCTCTGGGAAACACCGCGGGCTTGGGGTGCATCTCAGCTTTGTGCGCTCTGTTACAATGGACAAGTGGAAGGACATTGAGCTCGAGAAGATGAAGGCTGGTGGGAATGCTAAGTTCCAAGAGTTCCTGGAGTCACAGGAGGATTATGATCCGTCCTGGTCCCTGCAGGACAAGTACAACAGCAAAGCCGCAGCACTCTTTAGGGATAAGGTGGCCACTCTGGCTGAAGGCAGAGAATGGTCTCTGGAGTCATCGCCTGCCCAGAACTGGACCCCACCTCAGCCCAAGATACTGGCATCTGCTGTCCACCGACCCTCTGGCCAGACACAGAATGTGACCGCCTCTGCTGACAAGGCTTTTGAGGACTGGCTGAATGATGACCTTGGCTCCTATCAAGGGGCCCAGGAGAATCGCTACGTGGGGTTTGGGAACACGGCCCCATCTCAGAAGAGGGAAGATGACTTCCTCAACAATGCCATGTCATCCCTGTACTCGGGCTGGAGCAGTTTTACCACCGGAGCAAGCAAGTTTGCCTCTGCAGCCAGGGAAGGTGCTACAAAATTTGGATCCCAAGCAAGTCAGAAGGCTTCAGAGTTGGGCCACAGCCTGAATGAGAATGTCCTCAAGCCTGCGCAGGAGAAGGTCCAGGGGGTCGGCAGCAAGGGGTGGCGGGATGTCACCACCTTCTTCTCCGGGAAGACAGACGAGCCCCCAAGCAGGCTCATCGAGGGCCAGAGCTACCAGAACAGTGGCAGGGACATCTTCCAGAACAACACCGTAGACCAGAGCTTCTGGGAGACCTTTGGGAGCACCGAACCCCCCAAGGCCAAGTCCCCGAGCAGTGACAGCTGGACCTGCGCAGACACCTCGACAGGGAGGAGGAGCTCAGACAGCTGGGACGTGTGGGGCTCAGGCTCCGCGTCCAACAACAAGAACAGCAACAGCGACGGCTGGGAGAGCTGGGAGGCCACCAAGAAGGCCGCGCCCCCCGCGGCTGTTGACGAGGGCTGGGACGACCAGAGCTGGTAG

XM_004841047.1 Coding sequence

Arfgap1 ADP-ribosylation factor GTPase activating protein 1, transcript variant X5

Length: 1104 bp    Location: 28971334..28986717   Strand: +
>XM_004841047.1
ATGGCCAGCCCAAGGACCAGGAAAGTTCTTAAAGAAGTCAGAGTGCAAGATGAGAACAACGTTTGTTTTGAGTGTGGTGCATTCAACCCTCAGTGGGTCAGCGTGACTTATGGCATCTGGATCTGCCTGGAGTGCTCTGGGAAACACCGCGGGCTTGGGGTGCATCTCAGCTTTGTGCGCTCTGTTACAATGGACAAGTGGAAGGACATTGAGCTCGAGAAGATGAAGGCTGGTGGGAATGCTAAGTTCCAAGAGTTCCTGGAGTCACAGGAGGATTATGATCCGTCCTGGTCCCTGCAGGACAAGTACAACAGCAAAGCCGCAGCACTCTTTAGGGATAAGGTGGCCACTCTGGCTGAAGGCAGAGAATGGTCTCTGGAGTCATCGCCTGCCCAGAACTGGACCCCACCTCAGCCCAAGATACTGGCATCTGCTGTCCACCGACCCTCTGGCCAGACACAGAATGTGACCGCCTCTGCTGACAAGGCTTTTGAGGACTGGCTGAATGATGACCTTGGCTCCTATCAAGGGGCCCAGGAGAATCGCTACGTGGGGTTTGGGAACACGGCCCCATCTCAGAAGAGGGAAGATGACTTCCTCAACAATGCCATGTCATCCCTGTACTCGGGCTGGAGCAGTTTTACCACCGGAGCAAGCAAGTTTGCCTCTGCAGCCAGGGAAGGTGCTACAAAATTTGGATCCCAAGCAAGTCAGAAGGTCCAGGGGGTCGGCAGCAAGGGGTGGCGGGATGTCACCACCTTCTTCTCCGGGAAGACAGACGAGCCCCCAAGCAGGCTCATCGAGGGCCAGAGCTACCAGAACAGTGGCAGGGACATCTTCCAGAACAACACCGTAGACCAGAGCTTCTGGGAGACCTTTGGGAGCACCGAACCCCCCAAGGCCAAGTCCCCGAGCAGTGACAGCTGGACCTGCGCAGACACCTCGACAGGGAGGAGGAGCTCAGACAGCTGGGACGTGTGGGGCTCAGGCTCCGCGTCCAACAACAAGAACAGCAACAGCGACGGCTGGGAGAGCTGGGAGGCCACCAAGAAGGCCGCGCCCCCCGCGGCTGTTGACGAGGGCTGGGACGACCAGAGCTGGTAG

XM_004841039.1 Coding sequence

Gid8 GID complex subunit 8 homolog (S. cerevisiae), transcript variant X3

High confidence: 4 potential gene matches
Length: 687 bp    Location: 28700837..28707539   Strand: +
>XM_004841039.1
ATGAGTTATGCAGAAAAGCCCGATGAAATCACAAAAGATGAGTGGATGGAAAAGCTCAATAACTTACATGTCCAGCGGGCAGACATGAATCGACTCATCATGAACTATCTGGTCACAGAGGGCTTTAAGGAAGCAGCCGAAAAATTTCGAATGGAATCTGGAATTGAACCAAGTGTGGATCTAGAAACACTTGATGAACGGATCAAGATTCGGGAGATGATTCTGAAGGGTCAGATTCAAGAGGCCATTGCCTTGATCAACAGCCTCCATCCAGAGCTCCTGGACACAAACCGGTATCTTTACTTTCATCTGCAGCAACAGCATTTGATTGAGCTGATCCGCCAGCGTGAGACTGAGGCGGCACTGGAGTTTGCCCAGACACAGCTGGCAGAGCAGGGCGAGGAAAGCAGAGAGTGCCTCACGGAGATGGAGCGCACACTGGCCTTGCTGGCTTTTGACAGCCCCGAGGAGTCACCCTTCGGAGACCTTCTCCACATGATGCAGAGGCAAAAGGTGTGGAGTGAAGTTAACCAAGCTGTTCTAGATTATGAGAATCGTGAGTCAACACCCAAGCTGGCAAAATTACTGAAACTACTACTTTGGGCTCAGAACGAGCTGGACCAGAAGAAAGTAAAATATCCCAAAATGACAGACCTCAGCAAGGGTGTGATTGAGGAGCCCAAGTAG

XM_004841038.1 Coding sequence

Gid8 GID complex subunit 8 homolog (S. cerevisiae), transcript variant X2

Length: 687 bp    Location: 28701018..28707539   Strand: +
>XM_004841038.1
ATGAGTTATGCAGAAAAGCCCGATGAAATCACAAAAGATGAGTGGATGGAAAAGCTCAATAACTTACATGTCCAGCGGGCAGACATGAATCGACTCATCATGAACTATCTGGTCACAGAGGGCTTTAAGGAAGCAGCCGAAAAATTTCGAATGGAATCTGGAATTGAACCAAGTGTGGATCTAGAAACACTTGATGAACGGATCAAGATTCGGGAGATGATTCTGAAGGGTCAGATTCAAGAGGCCATTGCCTTGATCAACAGCCTCCATCCAGAGCTCCTGGACACAAACCGGTATCTTTACTTTCATCTGCAGCAACAGCATTTGATTGAGCTGATCCGCCAGCGTGAGACTGAGGCGGCACTGGAGTTTGCCCAGACACAGCTGGCAGAGCAGGGCGAGGAAAGCAGAGAGTGCCTCACGGAGATGGAGCGCACACTGGCCTTGCTGGCTTTTGACAGCCCCGAGGAGTCACCCTTCGGAGACCTTCTCCACATGATGCAGAGGCAAAAGGTGTGGAGTGAAGTTAACCAAGCTGTTCTAGATTATGAGAATCGTGAGTCAACACCCAAGCTGGCAAAATTACTGAAACTACTACTTTGGGCTCAGAACGAGCTGGACCAGAAGAAAGTAAAATATCCCAAAATGACAGACCTCAGCAAGGGTGTGATTGAGGAGCCCAAGTAG

XM_004841037.1 Coding sequence

Gid8 GID complex subunit 8 homolog (S. cerevisiae), transcript variant X1

Length: 687 bp    Location: 28700837..28707539   Strand: +
>XM_004841037.1
ATGAGTTATGCAGAAAAGCCCGATGAAATCACAAAAGATGAGTGGATGGAAAAGCTCAATAACTTACATGTCCAGCGGGCAGACATGAATCGACTCATCATGAACTATCTGGTCACAGAGGGCTTTAAGGAAGCAGCCGAAAAATTTCGAATGGAATCTGGAATTGAACCAAGTGTGGATCTAGAAACACTTGATGAACGGATCAAGATTCGGGAGATGATTCTGAAGGGTCAGATTCAAGAGGCCATTGCCTTGATCAACAGCCTCCATCCAGAGCTCCTGGACACAAACCGGTATCTTTACTTTCATCTGCAGCAACAGCATTTGATTGAGCTGATCCGCCAGCGTGAGACTGAGGCGGCACTGGAGTTTGCCCAGACACAGCTGGCAGAGCAGGGCGAGGAAAGCAGAGAGTGCCTCACGGAGATGGAGCGCACACTGGCCTTGCTGGCTTTTGACAGCCCCGAGGAGTCACCCTTCGGAGACCTTCTCCACATGATGCAGAGGCAAAAGGTGTGGAGTGAAGTTAACCAAGCTGTTCTAGATTATGAGAATCGTGAGTCAACACCCAAGCTGGCAAAATTACTGAAACTACTACTTTGGGCTCAGAACGAGCTGGACCAGAAGAAAGTAAAATATCCCAAAATGACAGACCTCAGCAAGGGTGTGATTGAGGAGCCCAAGTAG

XM_004841010.1 Coding sequence

Rps21 ribosomal protein S21, transcript variant X3

Length: 246 bp    Location: 28242993..28244146   Strand: +
>XM_004841010.1
ATGCAGAACGACGCGGGCGAGTTCGTGGACCTGTATGTGCCGCGGAAGTGCTCCGCCAGCAACCGCATTATTGGTGCGAAGGACCACGCATCCATCCAGATGAATGTGGCCGAGGTTGACAAGGTCACGGGCAGGTTTAACGGCCAGTTTAAAACCTATGCCATCTGCGGGGCCATTCGCAGGATGGGTGAATCAGATGACTCTATTCTACGTTTGGCCAAGGCTGATGGCATCGTCTCAAAGTAA

XM_004841008.1 Coding sequence

Rps21 ribosomal protein S21, transcript variant X1

Length: 252 bp    Location: 28242993..28244295   Strand: +
>XM_004841008.1
ATGCAGAACGACGCGGGCGAGTTCGTGGACCTGTATGTGCCGCGGAAGTGCTCCGCCAGCAACCGCATTATTGGTGCGAAGGACCACGCATCCATCCAGATGAATGTGGCCGAGGTTGACAAGGTCACGGGCAGGTTTAACGGCCAGTTTAAAACCTATGCCATCTGCGGGGCCATTCGCAGGATGGGTGAATCAGATGACTCTATTCTACGTTTGGCCAAGGCTGATGGCATCGTCTCAAAGAACTTCTGA

XM_004841031.1 Coding sequence

Dido1 death inducer-obliterator 1, transcript variant X4

Length: 6717 bp    Location: 28700677..28646938   Strand: -
>XM_004841031.1
ATGGATGATCCTGGGGACCAGAGCAATGAGGAAGCACCTAAAGCTATTAAGCCCACAAGTAAAGAGTTCAGGAAGACTTGGGGGTTCCGGAGAACAACAATTGCTAAGCGAGAGGGTGCTGGCGACACTGAGGTAGACCCTGTGGAGCAGCAGCCACACAGCCTCTCCCTGCGCCGCAGTGGGAGGCAGCCAAAGCGCACTGAGAGGGTAGAAGAGTTCCTGACCACAGTTCGACGCCGAGGAAGAAAGAATGTGCCTGTTTCCCTTGAGGATTCCGGCGAGGCAGCATCCTGTCCAGTCACAGATGTGGAAAGTGCCTCGGAAGGTAGTGTTGAGAGCAGCTCTGAGATAAAGAGTGTTCCTGCATCTCGTTCCAAGCGGGGGAAGGAACGCCCCACCTCTTCTGAAAAGGCCAAAGGAGGGGATGAGCAGGAAGACACCTCTGACAGTGACAGTGATGGGCTCACTTTGAAAGAACTTCAGAATCGTCTTCGAAGAAAACGAGAACAAGAACCAGCAGAGAGGCCCCTGAAGGGCATCCTGAGTCGCCTGAGGAAGAAACGGCGAGAAGAGGACTCAAGTGATACCGTGGAGGTTGAGGTGGCCAGAGCTGGCCACGATGTGCCACCCTGTAAGCAAGAGTCTGAGGCTGGTGAGGGAGCTGTGAACCAGGCAGCAGAAGATGACAGAGAGGGTGAATCAGAGGGGACAGTGGCTCAGGAACCTAAAGATGAAGACCCTGGGGACATGGGCAAACCTAAACCTGATTGTGAGGTTTATGACCCCAATGCCCTGTACTGCATCTGCCGCCAGCCTCACAATAACAGGTTTATGATCTGTTGTGACCGCTGTGAGGAGTGGTTCCATGGCGACTGCGTGGGAATTTCTGAGGCTCGAGGGCGTCTCTTGGAGAGGAATGGGGAAGATTACATCTGCCCAAACTGTACCATTCTGCAAGTGCAGGAGGATACGAATGCAGAAGCCACTGATGAGCAGGAAACTAGATACAGACCTGCAAGTGTGGACGGCACAGACTGCACCAGCATAGGGACAGTAGAGCAAAAGTCTAGTGAAGATCAGGGGATCAAGGGTAGAATTGAGAAAGCCGCAAACCCCAGTGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCCTGGAAACACCTAGCGCCTCAAGGTGCATCGGTCCTGGGTGCTCCAGTGTGGCACAGCCTGAATCGGTGTACTGCAGTAATGACTGCATTCTCAAACATGCAGCAGCTACTATGAGAAATCTAAATTCAGGTAAAGAACAAAAACCAAAGCCTAAGGAGAAAGTCAAGATGAAGCCAGAAAAACTCAGTCTTCCAAAATGTAGTGTTCAGGCAGGGATTAAAATCTCTATACACAAGAAGCCTGCTCCAGAGAGAAAAGAAAATGCGGCGAAGAAAGTGATGGTGACTCCTCCTAGGAGTGACACAGTGGGGAAGGAGGCAGCCTGTGAGAGCAGCACACCCTCCTGGGCCAGCGACCACAACTACAATGCAGTGAAGCCAGAGAATACTGCTGCACTCTCCCCACCACGGTTCTGTAAATCCGTGAAGGACGACAGGAGAGTGGAGGACAGAGCGGTGGGAGCAGCCACAGGCCCGAAGAAAACAGCCCTTCCAGGCTCCTCGGTGGGCAGGCAGCCTTCGTCCAGAACTCTTGTTCCAAAGAAGCTGCCTCCTTTCACTAACATGGCAGGAGCCAAACCAGCTGTTAAAAAATCACCATCAGGATTCAGGGGCCCCATCCCCAAGAGGCCCTGGCTCTTGCCTGCCCCATCAGGTGCCTCAGCTGCCAGGCAAGCTGGACCAATTCCTGTTGCTATGGTCGCTGCTTCCAAAAAGGCACTGGGCTCTGCTGCTTTGGTCGGATCCATAAGGAAGCCAGCGGCAACTTCTGCCCCCACAACTGTTCCAGCCACAGGACGCCTCGGGGGCACAGGCTCGGCCCAGTCACAACCAAATTCACAAATACGGCAAAATATAAGACGCTCCTTGAAAGAGATTTTATGGAAAAGAGTCAATGACAGTGATGACTTAATCATGACGGAAAATGAAGTGGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTTCAAGTAACAGATAATCGCTACAAGAGTAAATACCGCAGTATCATGTTCAACCTCAAGGATCCTAAAAATCAGGGACTCTTCCATCGAGTTCTGCGTGAAGAAATTTCTTTGGCAAAACTTGTGAGAATGAAGCCAGAAGAACTTGTGTCTAAAGAACTTTCTATGTGGAAAGAGAAGCCAACGAAACCTGTAATGGAGTCCAGAAGTAAACTGCAGAATGAAAGCAAGAAGGCTGCCATGAAGCCAGAAACCATTCCTGACATGGAGGACTCTCCACCTGTGTCAGACTCAGATGAGCAGCAGGAATCCGTACGAGCTGCCCCTGAGAAAAGCACAGCCCCCCTTCTCGATGTGTTCAGCAGCATGTTGGAAGACACAACGAGTCAGCACCGGGCCCATCTTTTTGATCTAAACTGTAAAATTTGTACAGGTCAAGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAATTATCAACTTCTGTTAAGAAAGAAGACCTAAAGCCCAAGCCCGACAGCTCTCTACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCAGAGATTCTGCCAGAAAATGCCTCGGAGCCAGACCTGGAAAGGGCGTCTGGTCCAACGCCAGAGGGAAAGTGTGTCCCTGGGCCTCCAGAGGACAGCCATCCAGGGCCCTCCCTGACAGAAAGCTCTTCTCCCTGTCCAGCTTCCTGCGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGGCCGAGACCCCAGGACTGCTGTGGGCGGGTCCTGTGCCCACCCGGACAGCACCCACATGCCTGAAGCCAAGCCAGACCTGCTAAAGCCCACACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCTCGTCTTCTGACCCCAGGCATCTGTCAGTTCCACCATCACCAAGTGTCAGTGCCTCAGAGACACGATCTCCCCCAGAAGGAGACACGACTCTCTTTTTGTCTCGCCTCAACACCATTTGGAAAGGATTTATTAACATGCAGAGTGTAGCCAAATTTGTCACTAAGGCATATCCCGTCTCTGGGTGTTTCGATTATCTCAGTGAGGACTTGCCGGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCCGTGTCTAAGGAGCTCTGTCTGATTCGTTTCCACCCGGCAACAGAGGAGGAAGAGGTTGCCTACATTTCTCTCTACTCCTATTTTAGCAGCCGTGGCCGCTTTGGGGTTGTAGCTAATAACAACAGGCATGTGAAGGACCTCTACTTGATCCCACTGAGTGCTAAGGACCCTGTGCCACCTAAACTCTTGCCCTTTGAGGGACCAGGTCTTGAGTCTCCACGTCCAAATATAATCCTTGGGTTAGTGATCTGTCAGAAAATAAAACGTCCTTCAAATGCTGGAGAGGCAGACAAGACAGAGGAGAAGCGGGCCCGAGTTCAACAGGAAGAAATGGATGTTCCAGTCTATCCCAAAGTCACGGCAGCCTCACAGTCTGAGAGGAAGCCCCCCAAGTACCAGCTATACTCTGCAGACGCAGTGGTGGGCACCACGCCCCCTGGGTCTCCTCCACCCCCGCCCCCTCTCCCTGAGCCCCCAGTGCTGAAGACGCTGTCATCACTCACACCGGCAGCCACCAGCAGTGCTGCACCTGCCTCAGCAGCAGCAGTTACCACGGCAGCTCCCGCTTCACCTGTCACTTCATCAGCTTCCAAGACGGCCACCCCCTTGGAGCACATTCTGCAGACTCTCTTCGGAAAGAAGAAGGTGTTTGAACCCCGGGCCAGAGACTCTGCTGGGCCACCTCTAGCTCCTCAGCAGGATTCCAAAAACAAGGGTGAGGAAGGCGTGTCCGCTGCTCCTCTGTTAGATCCCATCGTTCAGCAGTTTGGTCAGCTCTCAAAAGATAAGGCTCTGGAAGAAGAGGAAGATGACAGGCCCTATGACCCTGAAGAAGAATATGACCCAGAACGAGCCTTCGACGCCCCACTTCCTGAGACAAGGACGTCCCACGATGTGGAAAAGGCTCCAGACGCGGCTGAGAGGGAAGAGGTGGCCTATGACCCTGAAGATGAGACAATTTTAGAGGAAGCCAAGGTGACCATTGACGACCTGCCCAACAGGATGTGTGCAGACGTGAGAAGCAGCTCCACGGAGAAGCCTACAGAGTATACCACTGACGTCCCCACTCCCTCCTTGGTTGAACAGCAGAAAATGCTGGAGGAACTAAACAAACAAATTGAGGAGCAGAAGCGGCAGCTAGAGGAACAAGAAGAAGCTCTTAGGCAGCAGAGAGCTGCCGTGGGGGTTTCCATGGCACACTTCTCCGTTTCAGATGCATTGATGTCGCCACCTCCAAAGTCATCACTGGCTAAGGGAGAGCTGTTCCCCCAGGAGCAGCAGGCCCCAGACCAGAATCAGGGAGTCCCAGGGACAAACCAAAGCTCAGACTTGAGGCAGAATAGAGACCCTAGGCAGGCCAGACGCCTGGCGGAGAACAGCGAGAATGAGCCCCTCTCCAGGAGTCCGGCAGGCAGTGTTCCAGGAGTACAGGGTGCCCTGGCTACCAGGGAGGCTCCTTGTGGGGCCACAGCAGTCCAGGTGCCTGTAGCAGCCCCAGAATCAAAGCAGTTGACGGCTCCTTGGGGTGCAGGTGAAAAGGCTGCACTGATGTCCAAGCAGGATGGCCAGGGGTGTGAGCACCCTGGAAACCCCGCTCCGCAGCCCCTGGAGAACATTCATCCCCCAGCAGCCGGAGACAGCACAGCCAGACCTGCCCGGAGAGTGCTGCTGCCTACACCTCCGAGCACTGCCTTTCAGCCTGGCTTCACCCTGCACAATGATGTACAGAATTTTAATCCTGCTGGAGGAAGAGAGCCTTTCTCAGGCCTGGTATTTACATCTCAGGAAAAATCTCTTTGCCCACCTCTGTATGAGGACCCAAGAAACACTCAGTGTGCTGGAAAGAGTGACAGCCCAGCCAGTGGTGCAGAGGGTGACAGAGAGCCACTGTCCAGGCCTGGTGAAGGCACTGCCCTATACCCTCAGGCTGGGCAAAAGGGAGCCCTTCAGCCCCAGTTTCCAGGCCAGCGTGAATCCATTCCTCGCCCTTTTGGGATGTCTGGATTTCATGGCCCAAATTTCCCAGGACCCAGGGGACCAGTCCCTCCGTTTCCAGAAGATAATGTAGTTCCTAAGAGTGATGGGCCAAGAGCACCTCCACCTGCCAGATTCGGGCCCCAGAAGGCACCCATCCCTTCCTTATTCTTGGGGCAACATGGGCCGCCTTATGGAGACAATAGGGGTCCCTCTCCCTCTTACCTTGGGCCCAGAGCGGGAGCACCAGCCCAGTTTGAGGAACACAAAGATCCCCATGGGGAGAAAAGGGAATTCCAGGACACCCTGTACAGTGAGATGACAGGTCCCTCTGCCCAGTGTGAAGGACCAGAGCAGGCTCAGTTCATGGGAAACAGGGGCCCTTCACCTTTCCAGTTTGGAGGCCAAAGACGGCCTCTCCTGACTCAGCTAAAAGGTTCCCGAGGGGGACCCCCACCTGCCCAGTTTGGCGGCCAGAGAGGACCACCCCCTGGCCATTTTGTGGGCCCCCGGGGGCCCCATCCCAATCAGTTTGAAGGACCCAGAGGCCAAGCCCCAGGTTTCATGCCAGGGCCCCGGGGCCTTCAGCCTCAGCAGTTTGAAGAGCAGAGGGTAAACTCACCGCCTAGGTTTGCAGGTCAGAGGACACCAGCACCTATGCCATTTGGGGGACCAAGGGTCTCTGCGCCCTTTTCTGAAAAAAACGAGCAGACACCTCCCCGATTTCACTTTCCGGGCCCAGGCCCGTCACCTCAAGCAATGAAACCATCCCCCAGACCCCTCCTGGAGCTTCCAAGCCACCCCCCGCAGCACAGGAAGGACCGATGGGATGAAGCTGGCCCGGCCACAGCCCTGCCTCCTAGTGCTTCGTCTGGACAGGGCCCTGAGGCTGATGGACAGTGGGCTGTGGCAGCCGACTTCCGAGAGGGCAAAGGCCATGAGTACAGGAACCAGACTTTTGAAGGGAGGCAGAGAGAACGGTTTGAAGCCGGGCCCAAAGAAAAAGCACTGGAGGAGCCAGAAGTCCAAGAGCCAGAGAGTCGGCAGGGCCGGGCATTTGAGGACAGGAGGCGAGATCGAGACCGTGGCCGGAACTGGAGTCGAGAAAGAGACTGGGAGAGGAGCCGAGAGTGGGACAGACACAGAGAGAAAGACTGCAGCCGCGAGTGGGACAAGAACAACGAGAGGAACCCAAGCCGGGACAAAGAGCGACAGGCAGATCGGACCAAGGAGTGGGACCGAAGCCGGGAGAGAAGCAGAAATCGGGACCGAGACAGAAGGCGGGACCGGGATAGGTCCCGGAGCCGAGACCGTGACCGAGAGAGGGCCCGGGACAGAGAGCGAGCCGGAGAGCGCAAGGACCGCAGCAAGAGCAAAGAGAGCACCAGGGACTTGAAGCTGGAGGCCACGAAGCCCTCTGATCCGGGCAGCACCTCTGCTTAG

XM_004841035.1 Coding sequence

Dido1 death inducer-obliterator 1, transcript variant X8

Length: 6717 bp    Location: 28700677..28646938   Strand: -
>XM_004841035.1
ATGGATGATCCTGGGGACCAGAGCAATGAGGAAGCACCTAAAGCTATTAAGCCCACAAGTAAAGAGTTCAGGAAGACTTGGGGGTTCCGGAGAACAACAATTGCTAAGCGAGAGGGTGCTGGCGACACTGAGGTAGACCCTGTGGAGCAGCAGCCACACAGCCTCTCCCTGCGCCGCAGTGGGAGGCAGCCAAAGCGCACTGAGAGGGTAGAAGAGTTCCTGACCACAGTTCGACGCCGAGGAAGAAAGAATGTGCCTGTTTCCCTTGAGGATTCCGGCGAGGCAGCATCCTGTCCAGTCACAGATGTGGAAAGTGCCTCGGAAGGTAGTGTTGAGAGCAGCTCTGAGATAAAGAGTGTTCCTGCATCTCGTTCCAAGCGGGGGAAGGAACGCCCCACCTCTTCTGAAAAGGCCAAAGGAGGGGATGAGCAGGAAGACACCTCTGACAGTGACAGTGATGGGCTCACTTTGAAAGAACTTCAGAATCGTCTTCGAAGAAAACGAGAACAAGAACCAGCAGAGAGGCCCCTGAAGGGCATCCTGAGTCGCCTGAGGAAGAAACGGCGAGAAGAGGACTCAAGTGATACCGTGGAGGTTGAGGTGGCCAGAGCTGGCCACGATGTGCCACCCTGTAAGCAAGAGTCTGAGGCTGGTGAGGGAGCTGTGAACCAGGCAGCAGAAGATGACAGAGAGGGTGAATCAGAGGGGACAGTGGCTCAGGAACCTAAAGATGAAGACCCTGGGGACATGGGCAAACCTAAACCTGATTGTGAGGTTTATGACCCCAATGCCCTGTACTGCATCTGCCGCCAGCCTCACAATAACAGGTTTATGATCTGTTGTGACCGCTGTGAGGAGTGGTTCCATGGCGACTGCGTGGGAATTTCTGAGGCTCGAGGGCGTCTCTTGGAGAGGAATGGGGAAGATTACATCTGCCCAAACTGTACCATTCTGCAAGTGCAGGAGGATACGAATGCAGAAGCCACTGATGAGCAGGAAACTAGATACAGACCTGCAAGTGTGGACGGCACAGACTGCACCAGCATAGGGACAGTAGAGCAAAAGTCTAGTGAAGATCAGGGGATCAAGGGTAGAATTGAGAAAGCCGCAAACCCCAGTGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCCTGGAAACACCTAGCGCCTCAAGGTGCATCGGTCCTGGGTGCTCCAGTGTGGCACAGCCTGAATCGGTGTACTGCAGTAATGACTGCATTCTCAAACATGCAGCAGCTACTATGAGAAATCTAAATTCAGGTAAAGAACAAAAACCAAAGCCTAAGGAGAAAGTCAAGATGAAGCCAGAAAAACTCAGTCTTCCAAAATGTAGTGTTCAGGCAGGGATTAAAATCTCTATACACAAGAAGCCTGCTCCAGAGAGAAAAGAAAATGCGGCGAAGAAAGTGATGGTGACTCCTCCTAGGAGTGACACAGTGGGGAAGGAGGCAGCCTGTGAGAGCAGCACACCCTCCTGGGCCAGCGACCACAACTACAATGCAGTGAAGCCAGAGAATACTGCTGCACTCTCCCCACCACGGTTCTGTAAATCCGTGAAGGACGACAGGAGAGTGGAGGACAGAGCGGTGGGAGCAGCCACAGGCCCGAAGAAAACAGCCCTTCCAGGCTCCTCGGTGGGCAGGCAGCCTTCGTCCAGAACTCTTGTTCCAAAGAAGCTGCCTCCTTTCACTAACATGGCAGGAGCCAAACCAGCTGTTAAAAAATCACCATCAGGATTCAGGGGCCCCATCCCCAAGAGGCCCTGGCTCTTGCCTGCCCCATCAGGTGCCTCAGCTGCCAGGCAAGCTGGACCAATTCCTGTTGCTATGGTCGCTGCTTCCAAAAAGGCACTGGGCTCTGCTGCTTTGGTCGGATCCATAAGGAAGCCAGCGGCAACTTCTGCCCCCACAACTGTTCCAGCCACAGGACGCCTCGGGGGCACAGGCTCGGCCCAGTCACAACCAAATTCACAAATACGGCAAAATATAAGACGCTCCTTGAAAGAGATTTTATGGAAAAGAGTCAATGACAGTGATGACTTAATCATGACGGAAAATGAAGTGGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTTCAAGTAACAGATAATCGCTACAAGAGTAAATACCGCAGTATCATGTTCAACCTCAAGGATCCTAAAAATCAGGGACTCTTCCATCGAGTTCTGCGTGAAGAAATTTCTTTGGCAAAACTTGTGAGAATGAAGCCAGAAGAACTTGTGTCTAAAGAACTTTCTATGTGGAAAGAGAAGCCAACGAAACCTGTAATGGAGTCCAGAAGTAAACTGCAGAATGAAAGCAAGAAGGCTGCCATGAAGCCAGAAACCATTCCTGACATGGAGGACTCTCCACCTGTGTCAGACTCAGATGAGCAGCAGGAATCCGTACGAGCTGCCCCTGAGAAAAGCACAGCCCCCCTTCTCGATGTGTTCAGCAGCATGTTGGAAGACACAACGAGTCAGCACCGGGCCCATCTTTTTGATCTAAACTGTAAAATTTGTACAGGTCAAGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAATTATCAACTTCTGTTAAGAAAGAAGACCTAAAGCCCAAGCCCGACAGCTCTCTACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCAGAGATTCTGCCAGAAAATGCCTCGGAGCCAGACCTGGAAAGGGCGTCTGGTCCAACGCCAGAGGGAAAGTGTGTCCCTGGGCCTCCAGAGGACAGCCATCCAGGGCCCTCCCTGACAGAAAGCTCTTCTCCCTGTCCAGCTTCCTGCGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGGCCGAGACCCCAGGACTGCTGTGGGCGGGTCCTGTGCCCACCCGGACAGCACCCACATGCCTGAAGCCAAGCCAGACCTGCTAAAGCCCACACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCTCGTCTTCTGACCCCAGGCATCTGTCAGTTCCACCATCACCAAGTGTCAGTGCCTCAGAGACACGATCTCCCCCAGAAGGAGACACGACTCTCTTTTTGTCTCGCCTCAACACCATTTGGAAAGGATTTATTAACATGCAGAGTGTAGCCAAATTTGTCACTAAGGCATATCCCGTCTCTGGGTGTTTCGATTATCTCAGTGAGGACTTGCCGGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCCGTGTCTAAGGAGCTCTGTCTGATTCGTTTCCACCCGGCAACAGAGGAGGAAGAGGTTGCCTACATTTCTCTCTACTCCTATTTTAGCAGCCGTGGCCGCTTTGGGGTTGTAGCTAATAACAACAGGCATGTGAAGGACCTCTACTTGATCCCACTGAGTGCTAAGGACCCTGTGCCACCTAAACTCTTGCCCTTTGAGGGACCAGGTCTTGAGTCTCCACGTCCAAATATAATCCTTGGGTTAGTGATCTGTCAGAAAATAAAACGTCCTTCAAATGCTGGAGAGGCAGACAAGACAGAGGAGAAGCGGGCCCGAGTTCAACAGGAAGAAATGGATGTTCCAGTCTATCCCAAAGTCACGGCAGCCTCACAGTCTGAGAGGAAGCCCCCCAAGTACCAGCTATACTCTGCAGACGCAGTGGTGGGCACCACGCCCCCTGGGTCTCCTCCACCCCCGCCCCCTCTCCCTGAGCCCCCAGTGCTGAAGACGCTGTCATCACTCACACCGGCAGCCACCAGCAGTGCTGCACCTGCCTCAGCAGCAGCAGTTACCACGGCAGCTCCCGCTTCACCTGTCACTTCATCAGCTTCCAAGACGGCCACCCCCTTGGAGCACATTCTGCAGACTCTCTTCGGAAAGAAGAAGGTGTTTGAACCCCGGGCCAGAGACTCTGCTGGGCCACCTCTAGCTCCTCAGCAGGATTCCAAAAACAAGGGTGAGGAAGGCGTGTCCGCTGCTCCTCTGTTAGATCCCATCGTTCAGCAGTTTGGTCAGCTCTCAAAAGATAAGGCTCTGGAAGAAGAGGAAGATGACAGGCCCTATGACCCTGAAGAAGAATATGACCCAGAACGAGCCTTCGACGCCCCACTTCCTGAGACAAGGACGTCCCACGATGTGGAAAAGGCTCCAGACGCGGCTGAGAGGGAAGAGGTGGCCTATGACCCTGAAGATGAGACAATTTTAGAGGAAGCCAAGGTGACCATTGACGACCTGCCCAACAGGATGTGTGCAGACGTGAGAAGCAGCTCCACGGAGAAGCCTACAGAGTATACCACTGACGTCCCCACTCCCTCCTTGGTTGAACAGCAGAAAATGCTGGAGGAACTAAACAAACAAATTGAGGAGCAGAAGCGGCAGCTAGAGGAACAAGAAGAAGCTCTTAGGCAGCAGAGAGCTGCCGTGGGGGTTTCCATGGCACACTTCTCCGTTTCAGATGCATTGATGTCGCCACCTCCAAAGTCATCACTGGCTAAGGGAGAGCTGTTCCCCCAGGAGCAGCAGGCCCCAGACCAGAATCAGGGAGTCCCAGGGACAAACCAAAGCTCAGACTTGAGGCAGAATAGAGACCCTAGGCAGGCCAGACGCCTGGCGGAGAACAGCGAGAATGAGCCCCTCTCCAGGAGTCCGGCAGGCAGTGTTCCAGGAGTACAGGGTGCCCTGGCTACCAGGGAGGCTCCTTGTGGGGCCACAGCAGTCCAGGTGCCTGTAGCAGCCCCAGAATCAAAGCAGTTGACGGCTCCTTGGGGTGCAGGTGAAAAGGCTGCACTGATGTCCAAGCAGGATGGCCAGGGGTGTGAGCACCCTGGAAACCCCGCTCCGCAGCCCCTGGAGAACATTCATCCCCCAGCAGCCGGAGACAGCACAGCCAGACCTGCCCGGAGAGTGCTGCTGCCTACACCTCCGAGCACTGCCTTTCAGCCTGGCTTCACCCTGCACAATGATGTACAGAATTTTAATCCTGCTGGAGGAAGAGAGCCTTTCTCAGGCCTGGTATTTACATCTCAGGAAAAATCTCTTTGCCCACCTCTGTATGAGGACCCAAGAAACACTCAGTGTGCTGGAAAGAGTGACAGCCCAGCCAGTGGTGCAGAGGGTGACAGAGAGCCACTGTCCAGGCCTGGTGAAGGCACTGCCCTATACCCTCAGGCTGGGCAAAAGGGAGCCCTTCAGCCCCAGTTTCCAGGCCAGCGTGAATCCATTCCTCGCCCTTTTGGGATGTCTGGATTTCATGGCCCAAATTTCCCAGGACCCAGGGGACCAGTCCCTCCGTTTCCAGAAGATAATGTAGTTCCTAAGAGTGATGGGCCAAGAGCACCTCCACCTGCCAGATTCGGGCCCCAGAAGGCACCCATCCCTTCCTTATTCTTGGGGCAACATGGGCCGCCTTATGGAGACAATAGGGGTCCCTCTCCCTCTTACCTTGGGCCCAGAGCGGGAGCACCAGCCCAGTTTGAGGAACACAAAGATCCCCATGGGGAGAAAAGGGAATTCCAGGACACCCTGTACAGTGAGATGACAGGTCCCTCTGCCCAGTGTGAAGGACCAGAGCAGGCTCAGTTCATGGGAAACAGGGGCCCTTCACCTTTCCAGTTTGGAGGCCAAAGACGGCCTCTCCTGACTCAGCTAAAAGGTTCCCGAGGGGGACCCCCACCTGCCCAGTTTGGCGGCCAGAGAGGACCACCCCCTGGCCATTTTGTGGGCCCCCGGGGGCCCCATCCCAATCAGTTTGAAGGACCCAGAGGCCAAGCCCCAGGTTTCATGCCAGGGCCCCGGGGCCTTCAGCCTCAGCAGTTTGAAGAGCAGAGGGTAAACTCACCGCCTAGGTTTGCAGGTCAGAGGACACCAGCACCTATGCCATTTGGGGGACCAAGGGTCTCTGCGCCCTTTTCTGAAAAAAACGAGCAGACACCTCCCCGATTTCACTTTCCGGGCCCAGGCCCGTCACCTCAAGCAATGAAACCATCCCCCAGACCCCTCCTGGAGCTTCCAAGCCACCCCCCGCAGCACAGGAAGGACCGATGGGATGAAGCTGGCCCGGCCACAGCCCTGCCTCCTAGTGCTTCGTCTGGACAGGGCCCTGAGGCTGATGGACAGTGGGCTGTGGCAGCCGACTTCCGAGAGGGCAAAGGCCATGAGTACAGGAACCAGACTTTTGAAGGGAGGCAGAGAGAACGGTTTGAAGCCGGGCCCAAAGAAAAAGCACTGGAGGAGCCAGAAGTCCAAGAGCCAGAGAGTCGGCAGGGCCGGGCATTTGAGGACAGGAGGCGAGATCGAGACCGTGGCCGGAACTGGAGTCGAGAAAGAGACTGGGAGAGGAGCCGAGAGTGGGACAGACACAGAGAGAAAGACTGCAGCCGCGAGTGGGACAAGAACAACGAGAGGAACCCAAGCCGGGACAAAGAGCGACAGGCAGATCGGACCAAGGAGTGGGACCGAAGCCGGGAGAGAAGCAGAAATCGGGACCGAGACAGAAGGCGGGACCGGGATAGGTCCCGGAGCCGAGACCGTGACCGAGAGAGGGCCCGGGACAGAGAGCGAGCCGGAGAGCGCAAGGACCGCAGCAAGAGCAAAGAGAGCACCAGGGACTTGAAGCTGGAGGCCACGAAGCCCTCTGATCCGGGCAGCACCTCTGCTTAG

XM_004841033.1 Coding sequence

Dido1 death inducer-obliterator 1, transcript variant X6

Length: 6717 bp    Location: 28700677..28646938   Strand: -
>XM_004841033.1
ATGGATGATCCTGGGGACCAGAGCAATGAGGAAGCACCTAAAGCTATTAAGCCCACAAGTAAAGAGTTCAGGAAGACTTGGGGGTTCCGGAGAACAACAATTGCTAAGCGAGAGGGTGCTGGCGACACTGAGGTAGACCCTGTGGAGCAGCAGCCACACAGCCTCTCCCTGCGCCGCAGTGGGAGGCAGCCAAAGCGCACTGAGAGGGTAGAAGAGTTCCTGACCACAGTTCGACGCCGAGGAAGAAAGAATGTGCCTGTTTCCCTTGAGGATTCCGGCGAGGCAGCATCCTGTCCAGTCACAGATGTGGAAAGTGCCTCGGAAGGTAGTGTTGAGAGCAGCTCTGAGATAAAGAGTGTTCCTGCATCTCGTTCCAAGCGGGGGAAGGAACGCCCCACCTCTTCTGAAAAGGCCAAAGGAGGGGATGAGCAGGAAGACACCTCTGACAGTGACAGTGATGGGCTCACTTTGAAAGAACTTCAGAATCGTCTTCGAAGAAAACGAGAACAAGAACCAGCAGAGAGGCCCCTGAAGGGCATCCTGAGTCGCCTGAGGAAGAAACGGCGAGAAGAGGACTCAAGTGATACCGTGGAGGTTGAGGTGGCCAGAGCTGGCCACGATGTGCCACCCTGTAAGCAAGAGTCTGAGGCTGGTGAGGGAGCTGTGAACCAGGCAGCAGAAGATGACAGAGAGGGTGAATCAGAGGGGACAGTGGCTCAGGAACCTAAAGATGAAGACCCTGGGGACATGGGCAAACCTAAACCTGATTGTGAGGTTTATGACCCCAATGCCCTGTACTGCATCTGCCGCCAGCCTCACAATAACAGGTTTATGATCTGTTGTGACCGCTGTGAGGAGTGGTTCCATGGCGACTGCGTGGGAATTTCTGAGGCTCGAGGGCGTCTCTTGGAGAGGAATGGGGAAGATTACATCTGCCCAAACTGTACCATTCTGCAAGTGCAGGAGGATACGAATGCAGAAGCCACTGATGAGCAGGAAACTAGATACAGACCTGCAAGTGTGGACGGCACAGACTGCACCAGCATAGGGACAGTAGAGCAAAAGTCTAGTGAAGATCAGGGGATCAAGGGTAGAATTGAGAAAGCCGCAAACCCCAGTGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCCTGGAAACACCTAGCGCCTCAAGGTGCATCGGTCCTGGGTGCTCCAGTGTGGCACAGCCTGAATCGGTGTACTGCAGTAATGACTGCATTCTCAAACATGCAGCAGCTACTATGAGAAATCTAAATTCAGGTAAAGAACAAAAACCAAAGCCTAAGGAGAAAGTCAAGATGAAGCCAGAAAAACTCAGTCTTCCAAAATGTAGTGTTCAGGCAGGGATTAAAATCTCTATACACAAGAAGCCTGCTCCAGAGAGAAAAGAAAATGCGGCGAAGAAAGTGATGGTGACTCCTCCTAGGAGTGACACAGTGGGGAAGGAGGCAGCCTGTGAGAGCAGCACACCCTCCTGGGCCAGCGACCACAACTACAATGCAGTGAAGCCAGAGAATACTGCTGCACTCTCCCCACCACGGTTCTGTAAATCCGTGAAGGACGACAGGAGAGTGGAGGACAGAGCGGTGGGAGCAGCCACAGGCCCGAAGAAAACAGCCCTTCCAGGCTCCTCGGTGGGCAGGCAGCCTTCGTCCAGAACTCTTGTTCCAAAGAAGCTGCCTCCTTTCACTAACATGGCAGGAGCCAAACCAGCTGTTAAAAAATCACCATCAGGATTCAGGGGCCCCATCCCCAAGAGGCCCTGGCTCTTGCCTGCCCCATCAGGTGCCTCAGCTGCCAGGCAAGCTGGACCAATTCCTGTTGCTATGGTCGCTGCTTCCAAAAAGGCACTGGGCTCTGCTGCTTTGGTCGGATCCATAAGGAAGCCAGCGGCAACTTCTGCCCCCACAACTGTTCCAGCCACAGGACGCCTCGGGGGCACAGGCTCGGCCCAGTCACAACCAAATTCACAAATACGGCAAAATATAAGACGCTCCTTGAAAGAGATTTTATGGAAAAGAGTCAATGACAGTGATGACTTAATCATGACGGAAAATGAAGTGGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTTCAAGTAACAGATAATCGCTACAAGAGTAAATACCGCAGTATCATGTTCAACCTCAAGGATCCTAAAAATCAGGGACTCTTCCATCGAGTTCTGCGTGAAGAAATTTCTTTGGCAAAACTTGTGAGAATGAAGCCAGAAGAACTTGTGTCTAAAGAACTTTCTATGTGGAAAGAGAAGCCAACGAAACCTGTAATGGAGTCCAGAAGTAAACTGCAGAATGAAAGCAAGAAGGCTGCCATGAAGCCAGAAACCATTCCTGACATGGAGGACTCTCCACCTGTGTCAGACTCAGATGAGCAGCAGGAATCCGTACGAGCTGCCCCTGAGAAAAGCACAGCCCCCCTTCTCGATGTGTTCAGCAGCATGTTGGAAGACACAACGAGTCAGCACCGGGCCCATCTTTTTGATCTAAACTGTAAAATTTGTACAGGTCAAGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAATTATCAACTTCTGTTAAGAAAGAAGACCTAAAGCCCAAGCCCGACAGCTCTCTACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCAGAGATTCTGCCAGAAAATGCCTCGGAGCCAGACCTGGAAAGGGCGTCTGGTCCAACGCCAGAGGGAAAGTGTGTCCCTGGGCCTCCAGAGGACAGCCATCCAGGGCCCTCCCTGACAGAAAGCTCTTCTCCCTGTCCAGCTTCCTGCGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGGCCGAGACCCCAGGACTGCTGTGGGCGGGTCCTGTGCCCACCCGGACAGCACCCACATGCCTGAAGCCAAGCCAGACCTGCTAAAGCCCACACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCTCGTCTTCTGACCCCAGGCATCTGTCAGTTCCACCATCACCAAGTGTCAGTGCCTCAGAGACACGATCTCCCCCAGAAGGAGACACGACTCTCTTTTTGTCTCGCCTCAACACCATTTGGAAAGGATTTATTAACATGCAGAGTGTAGCCAAATTTGTCACTAAGGCATATCCCGTCTCTGGGTGTTTCGATTATCTCAGTGAGGACTTGCCGGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCCGTGTCTAAGGAGCTCTGTCTGATTCGTTTCCACCCGGCAACAGAGGAGGAAGAGGTTGCCTACATTTCTCTCTACTCCTATTTTAGCAGCCGTGGCCGCTTTGGGGTTGTAGCTAATAACAACAGGCATGTGAAGGACCTCTACTTGATCCCACTGAGTGCTAAGGACCCTGTGCCACCTAAACTCTTGCCCTTTGAGGGACCAGGTCTTGAGTCTCCACGTCCAAATATAATCCTTGGGTTAGTGATCTGTCAGAAAATAAAACGTCCTTCAAATGCTGGAGAGGCAGACAAGACAGAGGAGAAGCGGGCCCGAGTTCAACAGGAAGAAATGGATGTTCCAGTCTATCCCAAAGTCACGGCAGCCTCACAGTCTGAGAGGAAGCCCCCCAAGTACCAGCTATACTCTGCAGACGCAGTGGTGGGCACCACGCCCCCTGGGTCTCCTCCACCCCCGCCCCCTCTCCCTGAGCCCCCAGTGCTGAAGACGCTGTCATCACTCACACCGGCAGCCACCAGCAGTGCTGCACCTGCCTCAGCAGCAGCAGTTACCACGGCAGCTCCCGCTTCACCTGTCACTTCATCAGCTTCCAAGACGGCCACCCCCTTGGAGCACATTCTGCAGACTCTCTTCGGAAAGAAGAAGGTGTTTGAACCCCGGGCCAGAGACTCTGCTGGGCCACCTCTAGCTCCTCAGCAGGATTCCAAAAACAAGGGTGAGGAAGGCGTGTCCGCTGCTCCTCTGTTAGATCCCATCGTTCAGCAGTTTGGTCAGCTCTCAAAAGATAAGGCTCTGGAAGAAGAGGAAGATGACAGGCCCTATGACCCTGAAGAAGAATATGACCCAGAACGAGCCTTCGACGCCCCACTTCCTGAGACAAGGACGTCCCACGATGTGGAAAAGGCTCCAGACGCGGCTGAGAGGGAAGAGGTGGCCTATGACCCTGAAGATGAGACAATTTTAGAGGAAGCCAAGGTGACCATTGACGACCTGCCCAACAGGATGTGTGCAGACGTGAGAAGCAGCTCCACGGAGAAGCCTACAGAGTATACCACTGACGTCCCCACTCCCTCCTTGGTTGAACAGCAGAAAATGCTGGAGGAACTAAACAAACAAATTGAGGAGCAGAAGCGGCAGCTAGAGGAACAAGAAGAAGCTCTTAGGCAGCAGAGAGCTGCCGTGGGGGTTTCCATGGCACACTTCTCCGTTTCAGATGCATTGATGTCGCCACCTCCAAAGTCATCACTGGCTAAGGGAGAGCTGTTCCCCCAGGAGCAGCAGGCCCCAGACCAGAATCAGGGAGTCCCAGGGACAAACCAAAGCTCAGACTTGAGGCAGAATAGAGACCCTAGGCAGGCCAGACGCCTGGCGGAGAACAGCGAGAATGAGCCCCTCTCCAGGAGTCCGGCAGGCAGTGTTCCAGGAGTACAGGGTGCCCTGGCTACCAGGGAGGCTCCTTGTGGGGCCACAGCAGTCCAGGTGCCTGTAGCAGCCCCAGAATCAAAGCAGTTGACGGCTCCTTGGGGTGCAGGTGAAAAGGCTGCACTGATGTCCAAGCAGGATGGCCAGGGGTGTGAGCACCCTGGAAACCCCGCTCCGCAGCCCCTGGAGAACATTCATCCCCCAGCAGCCGGAGACAGCACAGCCAGACCTGCCCGGAGAGTGCTGCTGCCTACACCTCCGAGCACTGCCTTTCAGCCTGGCTTCACCCTGCACAATGATGTACAGAATTTTAATCCTGCTGGAGGAAGAGAGCCTTTCTCAGGCCTGGTATTTACATCTCAGGAAAAATCTCTTTGCCCACCTCTGTATGAGGACCCAAGAAACACTCAGTGTGCTGGAAAGAGTGACAGCCCAGCCAGTGGTGCAGAGGGTGACAGAGAGCCACTGTCCAGGCCTGGTGAAGGCACTGCCCTATACCCTCAGGCTGGGCAAAAGGGAGCCCTTCAGCCCCAGTTTCCAGGCCAGCGTGAATCCATTCCTCGCCCTTTTGGGATGTCTGGATTTCATGGCCCAAATTTCCCAGGACCCAGGGGACCAGTCCCTCCGTTTCCAGAAGATAATGTAGTTCCTAAGAGTGATGGGCCAAGAGCACCTCCACCTGCCAGATTCGGGCCCCAGAAGGCACCCATCCCTTCCTTATTCTTGGGGCAACATGGGCCGCCTTATGGAGACAATAGGGGTCCCTCTCCCTCTTACCTTGGGCCCAGAGCGGGAGCACCAGCCCAGTTTGAGGAACACAAAGATCCCCATGGGGAGAAAAGGGAATTCCAGGACACCCTGTACAGTGAGATGACAGGTCCCTCTGCCCAGTGTGAAGGACCAGAGCAGGCTCAGTTCATGGGAAACAGGGGCCCTTCACCTTTCCAGTTTGGAGGCCAAAGACGGCCTCTCCTGACTCAGCTAAAAGGTTCCCGAGGGGGACCCCCACCTGCCCAGTTTGGCGGCCAGAGAGGACCACCCCCTGGCCATTTTGTGGGCCCCCGGGGGCCCCATCCCAATCAGTTTGAAGGACCCAGAGGCCAAGCCCCAGGTTTCATGCCAGGGCCCCGGGGCCTTCAGCCTCAGCAGTTTGAAGAGCAGAGGGTAAACTCACCGCCTAGGTTTGCAGGTCAGAGGACACCAGCACCTATGCCATTTGGGGGACCAAGGGTCTCTGCGCCCTTTTCTGAAAAAAACGAGCAGACACCTCCCCGATTTCACTTTCCGGGCCCAGGCCCGTCACCTCAAGCAATGAAACCATCCCCCAGACCCCTCCTGGAGCTTCCAAGCCACCCCCCGCAGCACAGGAAGGACCGATGGGATGAAGCTGGCCCGGCCACAGCCCTGCCTCCTAGTGCTTCGTCTGGACAGGGCCCTGAGGCTGATGGACAGTGGGCTGTGGCAGCCGACTTCCGAGAGGGCAAAGGCCATGAGTACAGGAACCAGACTTTTGAAGGGAGGCAGAGAGAACGGTTTGAAGCCGGGCCCAAAGAAAAAGCACTGGAGGAGCCAGAAGTCCAAGAGCCAGAGAGTCGGCAGGGCCGGGCATTTGAGGACAGGAGGCGAGATCGAGACCGTGGCCGGAACTGGAGTCGAGAAAGAGACTGGGAGAGGAGCCGAGAGTGGGACAGACACAGAGAGAAAGACTGCAGCCGCGAGTGGGACAAGAACAACGAGAGGAACCCAAGCCGGGACAAAGAGCGACAGGCAGATCGGACCAAGGAGTGGGACCGAAGCCGGGAGAGAAGCAGAAATCGGGACCGAGACAGAAGGCGGGACCGGGATAGGTCCCGGAGCCGAGACCGTGACCGAGAGAGGGCCCGGGACAGAGAGCGAGCCGGAGAGCGCAAGGACCGCAGCAAGAGCAAAGAGAGCACCAGGGACTTGAAGCTGGAGGCCACGAAGCCCTCTGATCCGGGCAGCACCTCTGCTTAG

XM_004841032.1 Coding sequence

Dido1 death inducer-obliterator 1, transcript variant X5

Length: 6717 bp    Location: 28700677..28646938   Strand: -
>XM_004841032.1
ATGGATGATCCTGGGGACCAGAGCAATGAGGAAGCACCTAAAGCTATTAAGCCCACAAGTAAAGAGTTCAGGAAGACTTGGGGGTTCCGGAGAACAACAATTGCTAAGCGAGAGGGTGCTGGCGACACTGAGGTAGACCCTGTGGAGCAGCAGCCACACAGCCTCTCCCTGCGCCGCAGTGGGAGGCAGCCAAAGCGCACTGAGAGGGTAGAAGAGTTCCTGACCACAGTTCGACGCCGAGGAAGAAAGAATGTGCCTGTTTCCCTTGAGGATTCCGGCGAGGCAGCATCCTGTCCAGTCACAGATGTGGAAAGTGCCTCGGAAGGTAGTGTTGAGAGCAGCTCTGAGATAAAGAGTGTTCCTGCATCTCGTTCCAAGCGGGGGAAGGAACGCCCCACCTCTTCTGAAAAGGCCAAAGGAGGGGATGAGCAGGAAGACACCTCTGACAGTGACAGTGATGGGCTCACTTTGAAAGAACTTCAGAATCGTCTTCGAAGAAAACGAGAACAAGAACCAGCAGAGAGGCCCCTGAAGGGCATCCTGAGTCGCCTGAGGAAGAAACGGCGAGAAGAGGACTCAAGTGATACCGTGGAGGTTGAGGTGGCCAGAGCTGGCCACGATGTGCCACCCTGTAAGCAAGAGTCTGAGGCTGGTGAGGGAGCTGTGAACCAGGCAGCAGAAGATGACAGAGAGGGTGAATCAGAGGGGACAGTGGCTCAGGAACCTAAAGATGAAGACCCTGGGGACATGGGCAAACCTAAACCTGATTGTGAGGTTTATGACCCCAATGCCCTGTACTGCATCTGCCGCCAGCCTCACAATAACAGGTTTATGATCTGTTGTGACCGCTGTGAGGAGTGGTTCCATGGCGACTGCGTGGGAATTTCTGAGGCTCGAGGGCGTCTCTTGGAGAGGAATGGGGAAGATTACATCTGCCCAAACTGTACCATTCTGCAAGTGCAGGAGGATACGAATGCAGAAGCCACTGATGAGCAGGAAACTAGATACAGACCTGCAAGTGTGGACGGCACAGACTGCACCAGCATAGGGACAGTAGAGCAAAAGTCTAGTGAAGATCAGGGGATCAAGGGTAGAATTGAGAAAGCCGCAAACCCCAGTGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCCTGGAAACACCTAGCGCCTCAAGGTGCATCGGTCCTGGGTGCTCCAGTGTGGCACAGCCTGAATCGGTGTACTGCAGTAATGACTGCATTCTCAAACATGCAGCAGCTACTATGAGAAATCTAAATTCAGGTAAAGAACAAAAACCAAAGCCTAAGGAGAAAGTCAAGATGAAGCCAGAAAAACTCAGTCTTCCAAAATGTAGTGTTCAGGCAGGGATTAAAATCTCTATACACAAGAAGCCTGCTCCAGAGAGAAAAGAAAATGCGGCGAAGAAAGTGATGGTGACTCCTCCTAGGAGTGACACAGTGGGGAAGGAGGCAGCCTGTGAGAGCAGCACACCCTCCTGGGCCAGCGACCACAACTACAATGCAGTGAAGCCAGAGAATACTGCTGCACTCTCCCCACCACGGTTCTGTAAATCCGTGAAGGACGACAGGAGAGTGGAGGACAGAGCGGTGGGAGCAGCCACAGGCCCGAAGAAAACAGCCCTTCCAGGCTCCTCGGTGGGCAGGCAGCCTTCGTCCAGAACTCTTGTTCCAAAGAAGCTGCCTCCTTTCACTAACATGGCAGGAGCCAAACCAGCTGTTAAAAAATCACCATCAGGATTCAGGGGCCCCATCCCCAAGAGGCCCTGGCTCTTGCCTGCCCCATCAGGTGCCTCAGCTGCCAGGCAAGCTGGACCAATTCCTGTTGCTATGGTCGCTGCTTCCAAAAAGGCACTGGGCTCTGCTGCTTTGGTCGGATCCATAAGGAAGCCAGCGGCAACTTCTGCCCCCACAACTGTTCCAGCCACAGGACGCCTCGGGGGCACAGGCTCGGCCCAGTCACAACCAAATTCACAAATACGGCAAAATATAAGACGCTCCTTGAAAGAGATTTTATGGAAAAGAGTCAATGACAGTGATGACTTAATCATGACGGAAAATGAAGTGGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTTCAAGTAACAGATAATCGCTACAAGAGTAAATACCGCAGTATCATGTTCAACCTCAAGGATCCTAAAAATCAGGGACTCTTCCATCGAGTTCTGCGTGAAGAAATTTCTTTGGCAAAACTTGTGAGAATGAAGCCAGAAGAACTTGTGTCTAAAGAACTTTCTATGTGGAAAGAGAAGCCAACGAAACCTGTAATGGAGTCCAGAAGTAAACTGCAGAATGAAAGCAAGAAGGCTGCCATGAAGCCAGAAACCATTCCTGACATGGAGGACTCTCCACCTGTGTCAGACTCAGATGAGCAGCAGGAATCCGTACGAGCTGCCCCTGAGAAAAGCACAGCCCCCCTTCTCGATGTGTTCAGCAGCATGTTGGAAGACACAACGAGTCAGCACCGGGCCCATCTTTTTGATCTAAACTGTAAAATTTGTACAGGTCAAGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAATTATCAACTTCTGTTAAGAAAGAAGACCTAAAGCCCAAGCCCGACAGCTCTCTACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCAGAGATTCTGCCAGAAAATGCCTCGGAGCCAGACCTGGAAAGGGCGTCTGGTCCAACGCCAGAGGGAAAGTGTGTCCCTGGGCCTCCAGAGGACAGCCATCCAGGGCCCTCCCTGACAGAAAGCTCTTCTCCCTGTCCAGCTTCCTGCGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGGCCGAGACCCCAGGACTGCTGTGGGCGGGTCCTGTGCCCACCCGGACAGCACCCACATGCCTGAAGCCAAGCCAGACCTGCTAAAGCCCACACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCTCGTCTTCTGACCCCAGGCATCTGTCAGTTCCACCATCACCAAGTGTCAGTGCCTCAGAGACACGATCTCCCCCAGAAGGAGACACGACTCTCTTTTTGTCTCGCCTCAACACCATTTGGAAAGGATTTATTAACATGCAGAGTGTAGCCAAATTTGTCACTAAGGCATATCCCGTCTCTGGGTGTTTCGATTATCTCAGTGAGGACTTGCCGGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCCGTGTCTAAGGAGCTCTGTCTGATTCGTTTCCACCCGGCAACAGAGGAGGAAGAGGTTGCCTACATTTCTCTCTACTCCTATTTTAGCAGCCGTGGCCGCTTTGGGGTTGTAGCTAATAACAACAGGCATGTGAAGGACCTCTACTTGATCCCACTGAGTGCTAAGGACCCTGTGCCACCTAAACTCTTGCCCTTTGAGGGACCAGGTCTTGAGTCTCCACGTCCAAATATAATCCTTGGGTTAGTGATCTGTCAGAAAATAAAACGTCCTTCAAATGCTGGAGAGGCAGACAAGACAGAGGAGAAGCGGGCCCGAGTTCAACAGGAAGAAATGGATGTTCCAGTCTATCCCAAAGTCACGGCAGCCTCACAGTCTGAGAGGAAGCCCCCCAAGTACCAGCTATACTCTGCAGACGCAGTGGTGGGCACCACGCCCCCTGGGTCTCCTCCACCCCCGCCCCCTCTCCCTGAGCCCCCAGTGCTGAAGACGCTGTCATCACTCACACCGGCAGCCACCAGCAGTGCTGCACCTGCCTCAGCAGCAGCAGTTACCACGGCAGCTCCCGCTTCACCTGTCACTTCATCAGCTTCCAAGACGGCCACCCCCTTGGAGCACATTCTGCAGACTCTCTTCGGAAAGAAGAAGGTGTTTGAACCCCGGGCCAGAGACTCTGCTGGGCCACCTCTAGCTCCTCAGCAGGATTCCAAAAACAAGGGTGAGGAAGGCGTGTCCGCTGCTCCTCTGTTAGATCCCATCGTTCAGCAGTTTGGTCAGCTCTCAAAAGATAAGGCTCTGGAAGAAGAGGAAGATGACAGGCCCTATGACCCTGAAGAAGAATATGACCCAGAACGAGCCTTCGACGCCCCACTTCCTGAGACAAGGACGTCCCACGATGTGGAAAAGGCTCCAGACGCGGCTGAGAGGGAAGAGGTGGCCTATGACCCTGAAGATGAGACAATTTTAGAGGAAGCCAAGGTGACCATTGACGACCTGCCCAACAGGATGTGTGCAGACGTGAGAAGCAGCTCCACGGAGAAGCCTACAGAGTATACCACTGACGTCCCCACTCCCTCCTTGGTTGAACAGCAGAAAATGCTGGAGGAACTAAACAAACAAATTGAGGAGCAGAAGCGGCAGCTAGAGGAACAAGAAGAAGCTCTTAGGCAGCAGAGAGCTGCCGTGGGGGTTTCCATGGCACACTTCTCCGTTTCAGATGCATTGATGTCGCCACCTCCAAAGTCATCACTGGCTAAGGGAGAGCTGTTCCCCCAGGAGCAGCAGGCCCCAGACCAGAATCAGGGAGTCCCAGGGACAAACCAAAGCTCAGACTTGAGGCAGAATAGAGACCCTAGGCAGGCCAGACGCCTGGCGGAGAACAGCGAGAATGAGCCCCTCTCCAGGAGTCCGGCAGGCAGTGTTCCAGGAGTACAGGGTGCCCTGGCTACCAGGGAGGCTCCTTGTGGGGCCACAGCAGTCCAGGTGCCTGTAGCAGCCCCAGAATCAAAGCAGTTGACGGCTCCTTGGGGTGCAGGTGAAAAGGCTGCACTGATGTCCAAGCAGGATGGCCAGGGGTGTGAGCACCCTGGAAACCCCGCTCCGCAGCCCCTGGAGAACATTCATCCCCCAGCAGCCGGAGACAGCACAGCCAGACCTGCCCGGAGAGTGCTGCTGCCTACACCTCCGAGCACTGCCTTTCAGCCTGGCTTCACCCTGCACAATGATGTACAGAATTTTAATCCTGCTGGAGGAAGAGAGCCTTTCTCAGGCCTGGTATTTACATCTCAGGAAAAATCTCTTTGCCCACCTCTGTATGAGGACCCAAGAAACACTCAGTGTGCTGGAAAGAGTGACAGCCCAGCCAGTGGTGCAGAGGGTGACAGAGAGCCACTGTCCAGGCCTGGTGAAGGCACTGCCCTATACCCTCAGGCTGGGCAAAAGGGAGCCCTTCAGCCCCAGTTTCCAGGCCAGCGTGAATCCATTCCTCGCCCTTTTGGGATGTCTGGATTTCATGGCCCAAATTTCCCAGGACCCAGGGGACCAGTCCCTCCGTTTCCAGAAGATAATGTAGTTCCTAAGAGTGATGGGCCAAGAGCACCTCCACCTGCCAGATTCGGGCCCCAGAAGGCACCCATCCCTTCCTTATTCTTGGGGCAACATGGGCCGCCTTATGGAGACAATAGGGGTCCCTCTCCCTCTTACCTTGGGCCCAGAGCGGGAGCACCAGCCCAGTTTGAGGAACACAAAGATCCCCATGGGGAGAAAAGGGAATTCCAGGACACCCTGTACAGTGAGATGACAGGTCCCTCTGCCCAGTGTGAAGGACCAGAGCAGGCTCAGTTCATGGGAAACAGGGGCCCTTCACCTTTCCAGTTTGGAGGCCAAAGACGGCCTCTCCTGACTCAGCTAAAAGGTTCCCGAGGGGGACCCCCACCTGCCCAGTTTGGCGGCCAGAGAGGACCACCCCCTGGCCATTTTGTGGGCCCCCGGGGGCCCCATCCCAATCAGTTTGAAGGACCCAGAGGCCAAGCCCCAGGTTTCATGCCAGGGCCCCGGGGCCTTCAGCCTCAGCAGTTTGAAGAGCAGAGGGTAAACTCACCGCCTAGGTTTGCAGGTCAGAGGACACCAGCACCTATGCCATTTGGGGGACCAAGGGTCTCTGCGCCCTTTTCTGAAAAAAACGAGCAGACACCTCCCCGATTTCACTTTCCGGGCCCAGGCCCGTCACCTCAAGCAATGAAACCATCCCCCAGACCCCTCCTGGAGCTTCCAAGCCACCCCCCGCAGCACAGGAAGGACCGATGGGATGAAGCTGGCCCGGCCACAGCCCTGCCTCCTAGTGCTTCGTCTGGACAGGGCCCTGAGGCTGATGGACAGTGGGCTGTGGCAGCCGACTTCCGAGAGGGCAAAGGCCATGAGTACAGGAACCAGACTTTTGAAGGGAGGCAGAGAGAACGGTTTGAAGCCGGGCCCAAAGAAAAAGCACTGGAGGAGCCAGAAGTCCAAGAGCCAGAGAGTCGGCAGGGCCGGGCATTTGAGGACAGGAGGCGAGATCGAGACCGTGGCCGGAACTGGAGTCGAGAAAGAGACTGGGAGAGGAGCCGAGAGTGGGACAGACACAGAGAGAAAGACTGCAGCCGCGAGTGGGACAAGAACAACGAGAGGAACCCAAGCCGGGACAAAGAGCGACAGGCAGATCGGACCAAGGAGTGGGACCGAAGCCGGGAGAGAAGCAGAAATCGGGACCGAGACAGAAGGCGGGACCGGGATAGGTCCCGGAGCCGAGACCGTGACCGAGAGAGGGCCCGGGACAGAGAGCGAGCCGGAGAGCGCAAGGACCGCAGCAAGAGCAAAGAGAGCACCAGGGACTTGAAGCTGGAGGCCACGAAGCCCTCTGATCCGGGCAGCACCTCTGCTTAG

XM_004841030.1 Coding sequence

Dido1 death inducer-obliterator 1, transcript variant X3

Length: 6717 bp    Location: 28700677..28646938   Strand: -
>XM_004841030.1
ATGGATGATCCTGGGGACCAGAGCAATGAGGAAGCACCTAAAGCTATTAAGCCCACAAGTAAAGAGTTCAGGAAGACTTGGGGGTTCCGGAGAACAACAATTGCTAAGCGAGAGGGTGCTGGCGACACTGAGGTAGACCCTGTGGAGCAGCAGCCACACAGCCTCTCCCTGCGCCGCAGTGGGAGGCAGCCAAAGCGCACTGAGAGGGTAGAAGAGTTCCTGACCACAGTTCGACGCCGAGGAAGAAAGAATGTGCCTGTTTCCCTTGAGGATTCCGGCGAGGCAGCATCCTGTCCAGTCACAGATGTGGAAAGTGCCTCGGAAGGTAGTGTTGAGAGCAGCTCTGAGATAAAGAGTGTTCCTGCATCTCGTTCCAAGCGGGGGAAGGAACGCCCCACCTCTTCTGAAAAGGCCAAAGGAGGGGATGAGCAGGAAGACACCTCTGACAGTGACAGTGATGGGCTCACTTTGAAAGAACTTCAGAATCGTCTTCGAAGAAAACGAGAACAAGAACCAGCAGAGAGGCCCCTGAAGGGCATCCTGAGTCGCCTGAGGAAGAAACGGCGAGAAGAGGACTCAAGTGATACCGTGGAGGTTGAGGTGGCCAGAGCTGGCCACGATGTGCCACCCTGTAAGCAAGAGTCTGAGGCTGGTGAGGGAGCTGTGAACCAGGCAGCAGAAGATGACAGAGAGGGTGAATCAGAGGGGACAGTGGCTCAGGAACCTAAAGATGAAGACCCTGGGGACATGGGCAAACCTAAACCTGATTGTGAGGTTTATGACCCCAATGCCCTGTACTGCATCTGCCGCCAGCCTCACAATAACAGGTTTATGATCTGTTGTGACCGCTGTGAGGAGTGGTTCCATGGCGACTGCGTGGGAATTTCTGAGGCTCGAGGGCGTCTCTTGGAGAGGAATGGGGAAGATTACATCTGCCCAAACTGTACCATTCTGCAAGTGCAGGAGGATACGAATGCAGAAGCCACTGATGAGCAGGAAACTAGATACAGACCTGCAAGTGTGGACGGCACAGACTGCACCAGCATAGGGACAGTAGAGCAAAAGTCTAGTGAAGATCAGGGGATCAAGGGTAGAATTGAGAAAGCCGCAAACCCCAGTGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCCTGGAAACACCTAGCGCCTCAAGGTGCATCGGTCCTGGGTGCTCCAGTGTGGCACAGCCTGAATCGGTGTACTGCAGTAATGACTGCATTCTCAAACATGCAGCAGCTACTATGAGAAATCTAAATTCAGGTAAAGAACAAAAACCAAAGCCTAAGGAGAAAGTCAAGATGAAGCCAGAAAAACTCAGTCTTCCAAAATGTAGTGTTCAGGCAGGGATTAAAATCTCTATACACAAGAAGCCTGCTCCAGAGAGAAAAGAAAATGCGGCGAAGAAAGTGATGGTGACTCCTCCTAGGAGTGACACAGTGGGGAAGGAGGCAGCCTGTGAGAGCAGCACACCCTCCTGGGCCAGCGACCACAACTACAATGCAGTGAAGCCAGAGAATACTGCTGCACTCTCCCCACCACGGTTCTGTAAATCCGTGAAGGACGACAGGAGAGTGGAGGACAGAGCGGTGGGAGCAGCCACAGGCCCGAAGAAAACAGCCCTTCCAGGCTCCTCGGTGGGCAGGCAGCCTTCGTCCAGAACTCTTGTTCCAAAGAAGCTGCCTCCTTTCACTAACATGGCAGGAGCCAAACCAGCTGTTAAAAAATCACCATCAGGATTCAGGGGCCCCATCCCCAAGAGGCCCTGGCTCTTGCCTGCCCCATCAGGTGCCTCAGCTGCCAGGCAAGCTGGACCAATTCCTGTTGCTATGGTCGCTGCTTCCAAAAAGGCACTGGGCTCTGCTGCTTTGGTCGGATCCATAAGGAAGCCAGCGGCAACTTCTGCCCCCACAACTGTTCCAGCCACAGGACGCCTCGGGGGCACAGGCTCGGCCCAGTCACAACCAAATTCACAAATACGGCAAAATATAAGACGCTCCTTGAAAGAGATTTTATGGAAAAGAGTCAATGACAGTGATGACTTAATCATGACGGAAAATGAAGTGGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTTCAAGTAACAGATAATCGCTACAAGAGTAAATACCGCAGTATCATGTTCAACCTCAAGGATCCTAAAAATCAGGGACTCTTCCATCGAGTTCTGCGTGAAGAAATTTCTTTGGCAAAACTTGTGAGAATGAAGCCAGAAGAACTTGTGTCTAAAGAACTTTCTATGTGGAAAGAGAAGCCAACGAAACCTGTAATGGAGTCCAGAAGTAAACTGCAGAATGAAAGCAAGAAGGCTGCCATGAAGCCAGAAACCATTCCTGACATGGAGGACTCTCCACCTGTGTCAGACTCAGATGAGCAGCAGGAATCCGTACGAGCTGCCCCTGAGAAAAGCACAGCCCCCCTTCTCGATGTGTTCAGCAGCATGTTGGAAGACACAACGAGTCAGCACCGGGCCCATCTTTTTGATCTAAACTGTAAAATTTGTACAGGTCAAGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAATTATCAACTTCTGTTAAGAAAGAAGACCTAAAGCCCAAGCCCGACAGCTCTCTACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCAGAGATTCTGCCAGAAAATGCCTCGGAGCCAGACCTGGAAAGGGCGTCTGGTCCAACGCCAGAGGGAAAGTGTGTCCCTGGGCCTCCAGAGGACAGCCATCCAGGGCCCTCCCTGACAGAAAGCTCTTCTCCCTGTCCAGCTTCCTGCGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGGCCGAGACCCCAGGACTGCTGTGGGCGGGTCCTGTGCCCACCCGGACAGCACCCACATGCCTGAAGCCAAGCCAGACCTGCTAAAGCCCACACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCTCGTCTTCTGACCCCAGGCATCTGTCAGTTCCACCATCACCAAGTGTCAGTGCCTCAGAGACACGATCTCCCCCAGAAGGAGACACGACTCTCTTTTTGTCTCGCCTCAACACCATTTGGAAAGGATTTATTAACATGCAGAGTGTAGCCAAATTTGTCACTAAGGCATATCCCGTCTCTGGGTGTTTCGATTATCTCAGTGAGGACTTGCCGGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCCGTGTCTAAGGAGCTCTGTCTGATTCGTTTCCACCCGGCAACAGAGGAGGAAGAGGTTGCCTACATTTCTCTCTACTCCTATTTTAGCAGCCGTGGCCGCTTTGGGGTTGTAGCTAATAACAACAGGCATGTGAAGGACCTCTACTTGATCCCACTGAGTGCTAAGGACCCTGTGCCACCTAAACTCTTGCCCTTTGAGGGACCAGGTCTTGAGTCTCCACGTCCAAATATAATCCTTGGGTTAGTGATCTGTCAGAAAATAAAACGTCCTTCAAATGCTGGAGAGGCAGACAAGACAGAGGAGAAGCGGGCCCGAGTTCAACAGGAAGAAATGGATGTTCCAGTCTATCCCAAAGTCACGGCAGCCTCACAGTCTGAGAGGAAGCCCCCCAAGTACCAGCTATACTCTGCAGACGCAGTGGTGGGCACCACGCCCCCTGGGTCTCCTCCACCCCCGCCCCCTCTCCCTGAGCCCCCAGTGCTGAAGACGCTGTCATCACTCACACCGGCAGCCACCAGCAGTGCTGCACCTGCCTCAGCAGCAGCAGTTACCACGGCAGCTCCCGCTTCACCTGTCACTTCATCAGCTTCCAAGACGGCCACCCCCTTGGAGCACATTCTGCAGACTCTCTTCGGAAAGAAGAAGGTGTTTGAACCCCGGGCCAGAGACTCTGCTGGGCCACCTCTAGCTCCTCAGCAGGATTCCAAAAACAAGGGTGAGGAAGGCGTGTCCGCTGCTCCTCTGTTAGATCCCATCGTTCAGCAGTTTGGTCAGCTCTCAAAAGATAAGGCTCTGGAAGAAGAGGAAGATGACAGGCCCTATGACCCTGAAGAAGAATATGACCCAGAACGAGCCTTCGACGCCCCACTTCCTGAGACAAGGACGTCCCACGATGTGGAAAAGGCTCCAGACGCGGCTGAGAGGGAAGAGGTGGCCTATGACCCTGAAGATGAGACAATTTTAGAGGAAGCCAAGGTGACCATTGACGACCTGCCCAACAGGATGTGTGCAGACGTGAGAAGCAGCTCCACGGAGAAGCCTACAGAGTATACCACTGACGTCCCCACTCCCTCCTTGGTTGAACAGCAGAAAATGCTGGAGGAACTAAACAAACAAATTGAGGAGCAGAAGCGGCAGCTAGAGGAACAAGAAGAAGCTCTTAGGCAGCAGAGAGCTGCCGTGGGGGTTTCCATGGCACACTTCTCCGTTTCAGATGCATTGATGTCGCCACCTCCAAAGTCATCACTGGCTAAGGGAGAGCTGTTCCCCCAGGAGCAGCAGGCCCCAGACCAGAATCAGGGAGTCCCAGGGACAAACCAAAGCTCAGACTTGAGGCAGAATAGAGACCCTAGGCAGGCCAGACGCCTGGCGGAGAACAGCGAGAATGAGCCCCTCTCCAGGAGTCCGGCAGGCAGTGTTCCAGGAGTACAGGGTGCCCTGGCTACCAGGGAGGCTCCTTGTGGGGCCACAGCAGTCCAGGTGCCTGTAGCAGCCCCAGAATCAAAGCAGTTGACGGCTCCTTGGGGTGCAGGTGAAAAGGCTGCACTGATGTCCAAGCAGGATGGCCAGGGGTGTGAGCACCCTGGAAACCCCGCTCCGCAGCCCCTGGAGAACATTCATCCCCCAGCAGCCGGAGACAGCACAGCCAGACCTGCCCGGAGAGTGCTGCTGCCTACACCTCCGAGCACTGCCTTTCAGCCTGGCTTCACCCTGCACAATGATGTACAGAATTTTAATCCTGCTGGAGGAAGAGAGCCTTTCTCAGGCCTGGTATTTACATCTCAGGAAAAATCTCTTTGCCCACCTCTGTATGAGGACCCAAGAAACACTCAGTGTGCTGGAAAGAGTGACAGCCCAGCCAGTGGTGCAGAGGGTGACAGAGAGCCACTGTCCAGGCCTGGTGAAGGCACTGCCCTATACCCTCAGGCTGGGCAAAAGGGAGCCCTTCAGCCCCAGTTTCCAGGCCAGCGTGAATCCATTCCTCGCCCTTTTGGGATGTCTGGATTTCATGGCCCAAATTTCCCAGGACCCAGGGGACCAGTCCCTCCGTTTCCAGAAGATAATGTAGTTCCTAAGAGTGATGGGCCAAGAGCACCTCCACCTGCCAGATTCGGGCCCCAGAAGGCACCCATCCCTTCCTTATTCTTGGGGCAACATGGGCCGCCTTATGGAGACAATAGGGGTCCCTCTCCCTCTTACCTTGGGCCCAGAGCGGGAGCACCAGCCCAGTTTGAGGAACACAAAGATCCCCATGGGGAGAAAAGGGAATTCCAGGACACCCTGTACAGTGAGATGACAGGTCCCTCTGCCCAGTGTGAAGGACCAGAGCAGGCTCAGTTCATGGGAAACAGGGGCCCTTCACCTTTCCAGTTTGGAGGCCAAAGACGGCCTCTCCTGACTCAGCTAAAAGGTTCCCGAGGGGGACCCCCACCTGCCCAGTTTGGCGGCCAGAGAGGACCACCCCCTGGCCATTTTGTGGGCCCCCGGGGGCCCCATCCCAATCAGTTTGAAGGACCCAGAGGCCAAGCCCCAGGTTTCATGCCAGGGCCCCGGGGCCTTCAGCCTCAGCAGTTTGAAGAGCAGAGGGTAAACTCACCGCCTAGGTTTGCAGGTCAGAGGACACCAGCACCTATGCCATTTGGGGGACCAAGGGTCTCTGCGCCCTTTTCTGAAAAAAACGAGCAGACACCTCCCCGATTTCACTTTCCGGGCCCAGGCCCGTCACCTCAAGCAATGAAACCATCCCCCAGACCCCTCCTGGAGCTTCCAAGCCACCCCCCGCAGCACAGGAAGGACCGATGGGATGAAGCTGGCCCGGCCACAGCCCTGCCTCCTAGTGCTTCGTCTGGACAGGGCCCTGAGGCTGATGGACAGTGGGCTGTGGCAGCCGACTTCCGAGAGGGCAAAGGCCATGAGTACAGGAACCAGACTTTTGAAGGGAGGCAGAGAGAACGGTTTGAAGCCGGGCCCAAAGAAAAAGCACTGGAGGAGCCAGAAGTCCAAGAGCCAGAGAGTCGGCAGGGCCGGGCATTTGAGGACAGGAGGCGAGATCGAGACCGTGGCCGGAACTGGAGTCGAGAAAGAGACTGGGAGAGGAGCCGAGAGTGGGACAGACACAGAGAGAAAGACTGCAGCCGCGAGTGGGACAAGAACAACGAGAGGAACCCAAGCCGGGACAAAGAGCGACAGGCAGATCGGACCAAGGAGTGGGACCGAAGCCGGGAGAGAAGCAGAAATCGGGACCGAGACAGAAGGCGGGACCGGGATAGGTCCCGGAGCCGAGACCGTGACCGAGAGAGGGCCCGGGACAGAGAGCGAGCCGGAGAGCGCAAGGACCGCAGCAAGAGCAAAGAGAGCACCAGGGACTTGAAGCTGGAGGCCACGAAGCCCTCTGATCCGGGCAGCACCTCTGCTTAG

XM_004841034.1 Coding sequence

Dido1 death inducer-obliterator 1, transcript variant X7

Length: 6717 bp    Location: 28691441..28646938   Strand: -
>XM_004841034.1
ATGGATGATCCTGGGGACCAGAGCAATGAGGAAGCACCTAAAGCTATTAAGCCCACAAGTAAAGAGTTCAGGAAGACTTGGGGGTTCCGGAGAACAACAATTGCTAAGCGAGAGGGTGCTGGCGACACTGAGGTAGACCCTGTGGAGCAGCAGCCACACAGCCTCTCCCTGCGCCGCAGTGGGAGGCAGCCAAAGCGCACTGAGAGGGTAGAAGAGTTCCTGACCACAGTTCGACGCCGAGGAAGAAAGAATGTGCCTGTTTCCCTTGAGGATTCCGGCGAGGCAGCATCCTGTCCAGTCACAGATGTGGAAAGTGCCTCGGAAGGTAGTGTTGAGAGCAGCTCTGAGATAAAGAGTGTTCCTGCATCTCGTTCCAAGCGGGGGAAGGAACGCCCCACCTCTTCTGAAAAGGCCAAAGGAGGGGATGAGCAGGAAGACACCTCTGACAGTGACAGTGATGGGCTCACTTTGAAAGAACTTCAGAATCGTCTTCGAAGAAAACGAGAACAAGAACCAGCAGAGAGGCCCCTGAAGGGCATCCTGAGTCGCCTGAGGAAGAAACGGCGAGAAGAGGACTCAAGTGATACCGTGGAGGTTGAGGTGGCCAGAGCTGGCCACGATGTGCCACCCTGTAAGCAAGAGTCTGAGGCTGGTGAGGGAGCTGTGAACCAGGCAGCAGAAGATGACAGAGAGGGTGAATCAGAGGGGACAGTGGCTCAGGAACCTAAAGATGAAGACCCTGGGGACATGGGCAAACCTAAACCTGATTGTGAGGTTTATGACCCCAATGCCCTGTACTGCATCTGCCGCCAGCCTCACAATAACAGGTTTATGATCTGTTGTGACCGCTGTGAGGAGTGGTTCCATGGCGACTGCGTGGGAATTTCTGAGGCTCGAGGGCGTCTCTTGGAGAGGAATGGGGAAGATTACATCTGCCCAAACTGTACCATTCTGCAAGTGCAGGAGGATACGAATGCAGAAGCCACTGATGAGCAGGAAACTAGATACAGACCTGCAAGTGTGGACGGCACAGACTGCACCAGCATAGGGACAGTAGAGCAAAAGTCTAGTGAAGATCAGGGGATCAAGGGTAGAATTGAGAAAGCCGCAAACCCCAGTGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCCTGGAAACACCTAGCGCCTCAAGGTGCATCGGTCCTGGGTGCTCCAGTGTGGCACAGCCTGAATCGGTGTACTGCAGTAATGACTGCATTCTCAAACATGCAGCAGCTACTATGAGAAATCTAAATTCAGGTAAAGAACAAAAACCAAAGCCTAAGGAGAAAGTCAAGATGAAGCCAGAAAAACTCAGTCTTCCAAAATGTAGTGTTCAGGCAGGGATTAAAATCTCTATACACAAGAAGCCTGCTCCAGAGAGAAAAGAAAATGCGGCGAAGAAAGTGATGGTGACTCCTCCTAGGAGTGACACAGTGGGGAAGGAGGCAGCCTGTGAGAGCAGCACACCCTCCTGGGCCAGCGACCACAACTACAATGCAGTGAAGCCAGAGAATACTGCTGCACTCTCCCCACCACGGTTCTGTAAATCCGTGAAGGACGACAGGAGAGTGGAGGACAGAGCGGTGGGAGCAGCCACAGGCCCGAAGAAAACAGCCCTTCCAGGCTCCTCGGTGGGCAGGCAGCCTTCGTCCAGAACTCTTGTTCCAAAGAAGCTGCCTCCTTTCACTAACATGGCAGGAGCCAAACCAGCTGTTAAAAAATCACCATCAGGATTCAGGGGCCCCATCCCCAAGAGGCCCTGGCTCTTGCCTGCCCCATCAGGTGCCTCAGCTGCCAGGCAAGCTGGACCAATTCCTGTTGCTATGGTCGCTGCTTCCAAAAAGGCACTGGGCTCTGCTGCTTTGGTCGGATCCATAAGGAAGCCAGCGGCAACTTCTGCCCCCACAACTGTTCCAGCCACAGGACGCCTCGGGGGCACAGGCTCGGCCCAGTCACAACCAAATTCACAAATACGGCAAAATATAAGACGCTCCTTGAAAGAGATTTTATGGAAAAGAGTCAATGACAGTGATGACTTAATCATGACGGAAAATGAAGTGGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTTCAAGTAACAGATAATCGCTACAAGAGTAAATACCGCAGTATCATGTTCAACCTCAAGGATCCTAAAAATCAGGGACTCTTCCATCGAGTTCTGCGTGAAGAAATTTCTTTGGCAAAACTTGTGAGAATGAAGCCAGAAGAACTTGTGTCTAAAGAACTTTCTATGTGGAAAGAGAAGCCAACGAAACCTGTAATGGAGTCCAGAAGTAAACTGCAGAATGAAAGCAAGAAGGCTGCCATGAAGCCAGAAACCATTCCTGACATGGAGGACTCTCCACCTGTGTCAGACTCAGATGAGCAGCAGGAATCCGTACGAGCTGCCCCTGAGAAAAGCACAGCCCCCCTTCTCGATGTGTTCAGCAGCATGTTGGAAGACACAACGAGTCAGCACCGGGCCCATCTTTTTGATCTAAACTGTAAAATTTGTACAGGTCAAGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAATTATCAACTTCTGTTAAGAAAGAAGACCTAAAGCCCAAGCCCGACAGCTCTCTACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCAGAGATTCTGCCAGAAAATGCCTCGGAGCCAGACCTGGAAAGGGCGTCTGGTCCAACGCCAGAGGGAAAGTGTGTCCCTGGGCCTCCAGAGGACAGCCATCCAGGGCCCTCCCTGACAGAAAGCTCTTCTCCCTGTCCAGCTTCCTGCGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGGCCGAGACCCCAGGACTGCTGTGGGCGGGTCCTGTGCCCACCCGGACAGCACCCACATGCCTGAAGCCAAGCCAGACCTGCTAAAGCCCACACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCTCGTCTTCTGACCCCAGGCATCTGTCAGTTCCACCATCACCAAGTGTCAGTGCCTCAGAGACACGATCTCCCCCAGAAGGAGACACGACTCTCTTTTTGTCTCGCCTCAACACCATTTGGAAAGGATTTATTAACATGCAGAGTGTAGCCAAATTTGTCACTAAGGCATATCCCGTCTCTGGGTGTTTCGATTATCTCAGTGAGGACTTGCCGGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCCGTGTCTAAGGAGCTCTGTCTGATTCGTTTCCACCCGGCAACAGAGGAGGAAGAGGTTGCCTACATTTCTCTCTACTCCTATTTTAGCAGCCGTGGCCGCTTTGGGGTTGTAGCTAATAACAACAGGCATGTGAAGGACCTCTACTTGATCCCACTGAGTGCTAAGGACCCTGTGCCACCTAAACTCTTGCCCTTTGAGGGACCAGGTCTTGAGTCTCCACGTCCAAATATAATCCTTGGGTTAGTGATCTGTCAGAAAATAAAACGTCCTTCAAATGCTGGAGAGGCAGACAAGACAGAGGAGAAGCGGGCCCGAGTTCAACAGGAAGAAATGGATGTTCCAGTCTATCCCAAAGTCACGGCAGCCTCACAGTCTGAGAGGAAGCCCCCCAAGTACCAGCTATACTCTGCAGACGCAGTGGTGGGCACCACGCCCCCTGGGTCTCCTCCACCCCCGCCCCCTCTCCCTGAGCCCCCAGTGCTGAAGACGCTGTCATCACTCACACCGGCAGCCACCAGCAGTGCTGCACCTGCCTCAGCAGCAGCAGTTACCACGGCAGCTCCCGCTTCACCTGTCACTTCATCAGCTTCCAAGACGGCCACCCCCTTGGAGCACATTCTGCAGACTCTCTTCGGAAAGAAGAAGGTGTTTGAACCCCGGGCCAGAGACTCTGCTGGGCCACCTCTAGCTCCTCAGCAGGATTCCAAAAACAAGGGTGAGGAAGGCGTGTCCGCTGCTCCTCTGTTAGATCCCATCGTTCAGCAGTTTGGTCAGCTCTCAAAAGATAAGGCTCTGGAAGAAGAGGAAGATGACAGGCCCTATGACCCTGAAGAAGAATATGACCCAGAACGAGCCTTCGACGCCCCACTTCCTGAGACAAGGACGTCCCACGATGTGGAAAAGGCTCCAGACGCGGCTGAGAGGGAAGAGGTGGCCTATGACCCTGAAGATGAGACAATTTTAGAGGAAGCCAAGGTGACCATTGACGACCTGCCCAACAGGATGTGTGCAGACGTGAGAAGCAGCTCCACGGAGAAGCCTACAGAGTATACCACTGACGTCCCCACTCCCTCCTTGGTTGAACAGCAGAAAATGCTGGAGGAACTAAACAAACAAATTGAGGAGCAGAAGCGGCAGCTAGAGGAACAAGAAGAAGCTCTTAGGCAGCAGAGAGCTGCCGTGGGGGTTTCCATGGCACACTTCTCCGTTTCAGATGCATTGATGTCGCCACCTCCAAAGTCATCACTGGCTAAGGGAGAGCTGTTCCCCCAGGAGCAGCAGGCCCCAGACCAGAATCAGGGAGTCCCAGGGACAAACCAAAGCTCAGACTTGAGGCAGAATAGAGACCCTAGGCAGGCCAGACGCCTGGCGGAGAACAGCGAGAATGAGCCCCTCTCCAGGAGTCCGGCAGGCAGTGTTCCAGGAGTACAGGGTGCCCTGGCTACCAGGGAGGCTCCTTGTGGGGCCACAGCAGTCCAGGTGCCTGTAGCAGCCCCAGAATCAAAGCAGTTGACGGCTCCTTGGGGTGCAGGTGAAAAGGCTGCACTGATGTCCAAGCAGGATGGCCAGGGGTGTGAGCACCCTGGAAACCCCGCTCCGCAGCCCCTGGAGAACATTCATCCCCCAGCAGCCGGAGACAGCACAGCCAGACCTGCCCGGAGAGTGCTGCTGCCTACACCTCCGAGCACTGCCTTTCAGCCTGGCTTCACCCTGCACAATGATGTACAGAATTTTAATCCTGCTGGAGGAAGAGAGCCTTTCTCAGGCCTGGTATTTACATCTCAGGAAAAATCTCTTTGCCCACCTCTGTATGAGGACCCAAGAAACACTCAGTGTGCTGGAAAGAGTGACAGCCCAGCCAGTGGTGCAGAGGGTGACAGAGAGCCACTGTCCAGGCCTGGTGAAGGCACTGCCCTATACCCTCAGGCTGGGCAAAAGGGAGCCCTTCAGCCCCAGTTTCCAGGCCAGCGTGAATCCATTCCTCGCCCTTTTGGGATGTCTGGATTTCATGGCCCAAATTTCCCAGGACCCAGGGGACCAGTCCCTCCGTTTCCAGAAGATAATGTAGTTCCTAAGAGTGATGGGCCAAGAGCACCTCCACCTGCCAGATTCGGGCCCCAGAAGGCACCCATCCCTTCCTTATTCTTGGGGCAACATGGGCCGCCTTATGGAGACAATAGGGGTCCCTCTCCCTCTTACCTTGGGCCCAGAGCGGGAGCACCAGCCCAGTTTGAGGAACACAAAGATCCCCATGGGGAGAAAAGGGAATTCCAGGACACCCTGTACAGTGAGATGACAGGTCCCTCTGCCCAGTGTGAAGGACCAGAGCAGGCTCAGTTCATGGGAAACAGGGGCCCTTCACCTTTCCAGTTTGGAGGCCAAAGACGGCCTCTCCTGACTCAGCTAAAAGGTTCCCGAGGGGGACCCCCACCTGCCCAGTTTGGCGGCCAGAGAGGACCACCCCCTGGCCATTTTGTGGGCCCCCGGGGGCCCCATCCCAATCAGTTTGAAGGACCCAGAGGCCAAGCCCCAGGTTTCATGCCAGGGCCCCGGGGCCTTCAGCCTCAGCAGTTTGAAGAGCAGAGGGTAAACTCACCGCCTAGGTTTGCAGGTCAGAGGACACCAGCACCTATGCCATTTGGGGGACCAAGGGTCTCTGCGCCCTTTTCTGAAAAAAACGAGCAGACACCTCCCCGATTTCACTTTCCGGGCCCAGGCCCGTCACCTCAAGCAATGAAACCATCCCCCAGACCCCTCCTGGAGCTTCCAAGCCACCCCCCGCAGCACAGGAAGGACCGATGGGATGAAGCTGGCCCGGCCACAGCCCTGCCTCCTAGTGCTTCGTCTGGACAGGGCCCTGAGGCTGATGGACAGTGGGCTGTGGCAGCCGACTTCCGAGAGGGCAAAGGCCATGAGTACAGGAACCAGACTTTTGAAGGGAGGCAGAGAGAACGGTTTGAAGCCGGGCCCAAAGAAAAAGCACTGGAGGAGCCAGAAGTCCAAGAGCCAGAGAGTCGGCAGGGCCGGGCATTTGAGGACAGGAGGCGAGATCGAGACCGTGGCCGGAACTGGAGTCGAGAAAGAGACTGGGAGAGGAGCCGAGAGTGGGACAGACACAGAGAGAAAGACTGCAGCCGCGAGTGGGACAAGAACAACGAGAGGAACCCAAGCCGGGACAAAGAGCGACAGGCAGATCGGACCAAGGAGTGGGACCGAAGCCGGGAGAGAAGCAGAAATCGGGACCGAGACAGAAGGCGGGACCGGGATAGGTCCCGGAGCCGAGACCGTGACCGAGAGAGGGCCCGGGACAGAGAGCGAGCCGGAGAGCGCAAGGACCGCAGCAAGAGCAAAGAGAGCACCAGGGACTTGAAGCTGGAGGCCACGAAGCCCTCTGATCCGGGCAGCACCTCTGCTTAG

XM_004841029.1 Coding sequence

Dido1 death inducer-obliterator 1, transcript variant X2

Length: 6789 bp    Location: 28680850..28646938   Strand: -
>XM_004841029.1
ATGCACATAAGGAGTTGCCTCAGTGGTCTGCGGCTCATGCTGGGATTGCCTTTTACTCTAGGTATGGATGATCCTGGGGACCAGAGCAATGAGGAAGCACCTAAAGCTATTAAGCCCACAAGTAAAGAGTTCAGGAAGACTTGGGGGTTCCGGAGAACAACAATTGCTAAGCGAGAGGGTGCTGGCGACACTGAGGTAGACCCTGTGGAGCAGCAGCCACACAGCCTCTCCCTGCGCCGCAGTGGGAGGCAGCCAAAGCGCACTGAGAGGGTAGAAGAGTTCCTGACCACAGTTCGACGCCGAGGAAGAAAGAATGTGCCTGTTTCCCTTGAGGATTCCGGCGAGGCAGCATCCTGTCCAGTCACAGATGTGGAAAGTGCCTCGGAAGGTAGTGTTGAGAGCAGCTCTGAGATAAAGAGTGTTCCTGCATCTCGTTCCAAGCGGGGGAAGGAACGCCCCACCTCTTCTGAAAAGGCCAAAGGAGGGGATGAGCAGGAAGACACCTCTGACAGTGACAGTGATGGGCTCACTTTGAAAGAACTTCAGAATCGTCTTCGAAGAAAACGAGAACAAGAACCAGCAGAGAGGCCCCTGAAGGGCATCCTGAGTCGCCTGAGGAAGAAACGGCGAGAAGAGGACTCAAGTGATACCGTGGAGGTTGAGGTGGCCAGAGCTGGCCACGATGTGCCACCCTGTAAGCAAGAGTCTGAGGCTGGTGAGGGAGCTGTGAACCAGGCAGCAGAAGATGACAGAGAGGGTGAATCAGAGGGGACAGTGGCTCAGGAACCTAAAGATGAAGACCCTGGGGACATGGGCAAACCTAAACCTGATTGTGAGGTTTATGACCCCAATGCCCTGTACTGCATCTGCCGCCAGCCTCACAATAACAGGTTTATGATCTGTTGTGACCGCTGTGAGGAGTGGTTCCATGGCGACTGCGTGGGAATTTCTGAGGCTCGAGGGCGTCTCTTGGAGAGGAATGGGGAAGATTACATCTGCCCAAACTGTACCATTCTGCAAGTGCAGGAGGATACGAATGCAGAAGCCACTGATGAGCAGGAAACTAGATACAGACCTGCAAGTGTGGACGGCACAGACTGCACCAGCATAGGGACAGTAGAGCAAAAGTCTAGTGAAGATCAGGGGATCAAGGGTAGAATTGAGAAAGCCGCAAACCCCAGTGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCCTGGAAACACCTAGCGCCTCAAGGTGCATCGGTCCTGGGTGCTCCAGTGTGGCACAGCCTGAATCGGTGTACTGCAGTAATGACTGCATTCTCAAACATGCAGCAGCTACTATGAGAAATCTAAATTCAGGTAAAGAACAAAAACCAAAGCCTAAGGAGAAAGTCAAGATGAAGCCAGAAAAACTCAGTCTTCCAAAATGTAGTGTTCAGGCAGGGATTAAAATCTCTATACACAAGAAGCCTGCTCCAGAGAGAAAAGAAAATGCGGCGAAGAAAGTGATGGTGACTCCTCCTAGGAGTGACACAGTGGGGAAGGAGGCAGCCTGTGAGAGCAGCACACCCTCCTGGGCCAGCGACCACAACTACAATGCAGTGAAGCCAGAGAAAGCAGAATCACCACGTGCTCTTGTCCCTGTGCTCTGCTCTGCAGCCGTGAAGGACGACAGGAGAGTGGAGGACAGAGCGGTGGGAGCAGCCACAGGCCCGAAGAAAACAGCCCTTCCAGGCTCCTCGGTGGGCAGGCAGCCTTCGTCCAGAACTCTTGTTCCAAAGAAGCTGCCTCCTTTCACTAACATGGCAGGAGCCAAACCAGCTGTTAAAAAATCACCATCAGGATTCAGGGGCCCCATCCCCAAGAGGCCCTGGCTCTTGCCTGCCCCATCAGGTGCCTCAGCTGCCAGGCAAGCTGGACCAATTCCTGTTGCTATGGTCGCTGCTTCCAAAAAGGCACTGGGCTCTGCTGCTTTGGTCGGATCCATAAGGAAGCCAGCGGCAACTTCTGCCCCCACAACTGTTCCAGCCACAGGACGCCTCGGGGGCACAGGCTCGGCCCAGTCACAACCAAATTCACAAATACGGCAAAATATAAGACGCTCCTTGAAAGAGATTTTATGGAAAAGAGTCAATGACAGTGATGACTTAATCATGACGGAAAATGAAGTGGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTTCAAGTAACAGATAATCGCTACAAGAGTAAATACCGCAGTATCATGTTCAACCTCAAGGATCCTAAAAATCAGGGACTCTTCCATCGAGTTCTGCGTGAAGAAATTTCTTTGGCAAAACTTGTGAGAATGAAGCCAGAAGAACTTGTGTCTAAAGAACTTTCTATGTGGAAAGAGAAGCCAACGAAACCTGTAATGGAGTCCAGAAGTAAACTGCAGAATGAAAGCAAGAAGGCTGCCATGAAGCCAGAAACCATTCCTGACATGGAGGACTCTCCACCTGTGTCAGACTCAGATGAGCAGCAGGAATCCGTACGAGCTGCCCCTGAGAAAAGCACAGCCCCCCTTCTCGATGTGTTCAGCAGCATGTTGGAAGACACAACGAGTCAGCACCGGGCCCATCTTTTTGATCTAAACTGTAAAATTTGTACAGGTCAAGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAATTATCAACTTCTGTTAAGAAAGAAGACCTAAAGCCCAAGCCCGACAGCTCTCTACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCAGAGATTCTGCCAGAAAATGCCTCGGAGCCAGACCTGGAAAGGGCGTCTGGTCCAACGCCAGAGGGAAAGTGTGTCCCTGGGCCTCCAGAGGACAGCCATCCAGGGCCCTCCCTGACAGAAAGCTCTTCTCCCTGTCCAGCTTCCTGCGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGGCCGAGACCCCAGGACTGCTGTGGGCGGGTCCTGTGCCCACCCGGACAGCACCCACATGCCTGAAGCCAAGCCAGACCTGCTAAAGCCCACACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCTCGTCTTCTGACCCCAGGCATCTGTCAGTTCCACCATCACCAAGTGTCAGTGCCTCAGAGACACGATCTCCCCCAGAAGGAGACACGACTCTCTTTTTGTCTCGCCTCAACACCATTTGGAAAGGATTTATTAACATGCAGAGTGTAGCCAAATTTGTCACTAAGGCATATCCCGTCTCTGGGTGTTTCGATTATCTCAGTGAGGACTTGCCGGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCCGTGTCTAAGGAGCTCTGTCTGATTCGTTTCCACCCGGCAACAGAGGAGGAAGAGGTTGCCTACATTTCTCTCTACTCCTATTTTAGCAGCCGTGGCCGCTTTGGGGTTGTAGCTAATAACAACAGGCATGTGAAGGACCTCTACTTGATCCCACTGAGTGCTAAGGACCCTGTGCCACCTAAACTCTTGCCCTTTGAGGGACCAGGTCTTGAGTCTCCACGTCCAAATATAATCCTTGGGTTAGTGATCTGTCAGAAAATAAAACGTCCTTCAAATGCTGGAGAGGCAGACAAGACAGAGGAGAAGCGGGCCCGAGTTCAACAGGAAGAAATGGATGTTCCAGTCTATCCCAAAGTCACGGCAGCCTCACAGTCTGAGAGGAAGCCCCCCAAGTACCAGCTATACTCTGCAGACGCAGTGGTGGGCACCACGCCCCCTGGGTCTCCTCCACCCCCGCCCCCTCTCCCTGAGCCCCCAGTGCTGAAGACGCTGTCATCACTCACACCGGCAGCCACCAGCAGTGCTGCACCTGCCTCAGCAGCAGCAGTTACCACGGCAGCTCCCGCTTCACCTGTCACTTCATCAGCTTCCAAGACGGCCACCCCCTTGGAGCACATTCTGCAGACTCTCTTCGGAAAGAAGAAGGTGTTTGAACCCCGGGCCAGAGACTCTGCTGGGCCACCTCTAGCTCCTCAGCAGGATTCCAAAAACAAGGGTGAGGAAGGCGTGTCCGCTGCTCCTCTGTTAGATCCCATCGTTCAGCAGTTTGGTCAGCTCTCAAAAGATAAGGCTCTGGAAGAAGAGGAAGATGACAGGCCCTATGACCCTGAAGAAGAATATGACCCAGAACGAGCCTTCGACGCCCCACTTCCTGAGACAAGGACGTCCCACGATGTGGAAAAGGCTCCAGACGCGGCTGAGAGGGAAGAGGTGGCCTATGACCCTGAAGATGAGACAATTTTAGAGGAAGCCAAGGTGACCATTGACGACCTGCCCAACAGGATGTGTGCAGACGTGAGAAGCAGCTCCACGGAGAAGCCTACAGAGTATACCACTGACGTCCCCACTCCCTCCTTGGTTGAACAGCAGAAAATGCTGGAGGAACTAAACAAACAAATTGAGGAGCAGAAGCGGCAGCTAGAGGAACAAGAAGAAGCTCTTAGGCAGCAGAGAGCTGCCGTGGGGGTTTCCATGGCACACTTCTCCGTTTCAGATGCATTGATGTCGCCACCTCCAAAGTCATCACTGGCTAAGGGAGAGCTGTTCCCCCAGGAGCAGCAGGCCCCAGACCAGAATCAGGGAGTCCCAGGGACAAACCAAAGCTCAGACTTGAGGCAGAATAGAGACCCTAGGCAGGCCAGACGCCTGGCGGAGAACAGCGAGAATGAGCCCCTCTCCAGGAGTCCGGCAGGCAGTGTTCCAGGAGTACAGGGTGCCCTGGCTACCAGGGAGGCTCCTTGTGGGGCCACAGCAGTCCAGGTGCCTGTAGCAGCCCCAGAATCAAAGCAGTTGACGGCTCCTTGGGGTGCAGGTGAAAAGGCTGCACTGATGTCCAAGCAGGATGGCCAGGGGTGTGAGCACCCTGGAAACCCCGCTCCGCAGCCCCTGGAGAACATTCATCCCCCAGCAGCCGGAGACAGCACAGCCAGACCTGCCCGGAGAGTGCTGCTGCCTACACCTCCGAGCACTGCCTTTCAGCCTGGCTTCACCCTGCACAATGATGTACAGAATTTTAATCCTGCTGGAGGAAGAGAGCCTTTCTCAGGCCTGGTATTTACATCTCAGGAAAAATCTCTTTGCCCACCTCTGTATGAGGACCCAAGAAACACTCAGTGTGCTGGAAAGAGTGACAGCCCAGCCAGTGGTGCAGAGGGTGACAGAGAGCCACTGTCCAGGCCTGGTGAAGGCACTGCCCTATACCCTCAGGCTGGGCAAAAGGGAGCCCTTCAGCCCCAGTTTCCAGGCCAGCGTGAATCCATTCCTCGCCCTTTTGGGATGTCTGGATTTCATGGCCCAAATTTCCCAGGACCCAGGGGACCAGTCCCTCCGTTTCCAGAAGATAATGTAGTTCCTAAGAGTGATGGGCCAAGAGCACCTCCACCTGCCAGATTCGGGCCCCAGAAGGCACCCATCCCTTCCTTATTCTTGGGGCAACATGGGCCGCCTTATGGAGACAATAGGGGTCCCTCTCCCTCTTACCTTGGGCCCAGAGCGGGAGCACCAGCCCAGTTTGAGGAACACAAAGATCCCCATGGGGAGAAAAGGGAATTCCAGGACACCCTGTACAGTGAGATGACAGGTCCCTCTGCCCAGTGTGAAGGACCAGAGCAGGCTCAGTTCATGGGAAACAGGGGCCCTTCACCTTTCCAGTTTGGAGGCCAAAGACGGCCTCTCCTGACTCAGCTAAAAGGTTCCCGAGGGGGACCCCCACCTGCCCAGTTTGGCGGCCAGAGAGGACCACCCCCTGGCCATTTTGTGGGCCCCCGGGGGCCCCATCCCAATCAGTTTGAAGGACCCAGAGGCCAAGCCCCAGGTTTCATGCCAGGGCCCCGGGGCCTTCAGCCTCAGCAGTTTGAAGAGCAGAGGGTAAACTCACCGCCTAGGTTTGCAGGTCAGAGGACACCAGCACCTATGCCATTTGGGGGACCAAGGGTCTCTGCGCCCTTTTCTGAAAAAAACGAGCAGACACCTCCCCGATTTCACTTTCCGGGCCCAGGCCCGTCACCTCAAGCAATGAAACCATCCCCCAGACCCCTCCTGGAGCTTCCAAGCCACCCCCCGCAGCACAGGAAGGACCGATGGGATGAAGCTGGCCCGGCCACAGCCCTGCCTCCTAGTGCTTCGTCTGGACAGGGCCCTGAGGCTGATGGACAGTGGGCTGTGGCAGCCGACTTCCGAGAGGGCAAAGGCCATGAGTACAGGAACCAGACTTTTGAAGGGAGGCAGAGAGAACGGTTTGAAGCCGGGCCCAAAGAAAAAGCACTGGAGGAGCCAGAAGTCCAAGAGCCAGAGAGTCGGCAGGGCCGGGCATTTGAGGACAGGAGGCGAGATCGAGACCGTGGCCGGAACTGGAGTCGAGAAAGAGACTGGGAGAGGAGCCGAGAGTGGGACAGACACAGAGAGAAAGACTGCAGCCGCGAGTGGGACAAGAACAACGAGAGGAACCCAAGCCGGGACAAAGAGCGACAGGCAGATCGGACCAAGGAGTGGGACCGAAGCCGGGAGAGAAGCAGAAATCGGGACCGAGACAGAAGGCGGGACCGGGATAGGTCCCGGAGCCGAGACCGTGACCGAGAGAGGGCCCGGGACAGAGAGCGAGCCGGAGAGCGCAAGGACCGCAGCAAGAGCAAAGAGAGCACCAGGGACTTGAAGCTGGAGGCCACGAAGCCCTCTGATCCGGGCAGCACCTCTGCTTAG

XM_004840999.1 Coding sequence

Mtg2 mitochondrial ribosome-associated GTPase 2, transcript variant X6

Length: 1218 bp    Location: 28053478..28070886   Strand: +
>XM_004840999.1
ATGGTGCCTGTGAGGCTCTTCTCAGCAAGCTCTTGGACCAGGTTGGAGGGAGTGATGGGGGCTCCATCCACATGGGCTGGCCTCCCGCTCGGCAGGCTCCTTCCACAGCAGGCTCCACCCAGGCCACTCTCCACGGGCTGTGCAGACTGCACCAAGCATCAGAAACCCCCCGGAAAGAAGCTGCTGTCTGAGAAGAAACTGAAAAAGCATTTTGTGGACCATCGCAGAGTGCTTGTCCGTGGAGGAAGTGGAGGCTCGGGCATGAGCTGTTTCCACAGCGAGCCCCGAAAGGAGTTCGGAGGCCCCGATGGCGGGGATGGTGGCAGTGGTGGCCACGTCGTCCTGAGAGTTGACCCAAAAGTCAAGTCCCTGTCGTCAGTCCTGTCCCACTATCAGGGCTTCAGTGGAGAAGATGGCGGCAGGAAAAACTGCTCCGGACGAGGTGGCGCTGTCCTCTACATCCAGGTCCCCATGGGCACCTTGGTGAAGGAGGGAAGTGAAATCATGGCTGACCTGAGCCGACCAGGCGACGAGTACATTGCGGCACTGGGGGGTGCAGGAGGGAAAGGCAACCGCTTTTTCCTGGCCAACGACAACCGCGCCCCCGTGACTTGCACCCCTGGAGAGCTGGGTCAGGAGCGTGTTCTCCACCTGGAGCTCAAGACGGTGGCCCACGCCGGGATGGTTGGGTTCCCCAATGCTGGGAAGTCCTCCCTCCTCCGAGCCATTTCCAATGCAAAGCCCGCTGTGGCGTCCTACCCGTTCACCACCCTAAATCCCCACGTAGGCATTGTGCACTATGCCGGCCACCAGCAAGTAGCAGTGGCAGACATCCCAGGGATCATCCGAGGTGCCCACCAGAACAGGGGCCTGGGGCTCAGCTTCCTCAGGCACATCGAACGCTGCCTCTTCCTCTTGTTCGTGGTGGACCTTTCCGTCCCAGAGCCATGGACTCAGTTTGAGCATTTAAAATATGAACTGGAGAAGTACAAAGAAGGCCTGTCTGAGAAGCCCCATGCGATTGTTGCAAATAAGATTGATCTGCCACAGGCCAGAGCCATTCTACCCCAGCTCCGGGCCCAGCTGGGACAGGAGGTCATCGCCCTGTCAGCCCTGACTGGGGAGAACCTGGAGCAACTGCTGCTCCACCTGAAAGTCCTCTACGATGCCTACATGGAGGCTGAGCTGGGGAAGGGCTGCCAGCCACTTAGGTGGTAG

XM_004841023.1 Coding sequence

Ogfr opioid growth factor receptor, transcript variant X1

Length: 1656 bp    Location: 28579415..28588315   Strand: +
>XM_004841023.1
ATGGACGACCCGGACTGCGACTCCACTTGGGAGGAGGACGAAGCGGCGGAGGACGGCGCGGAGGCCAGCGCGGTCGACGCGGGCGACGCGGGCGACGCGGGCGACGCGAGCAACGCGGACGAGGGCGCGGACGAGGACGTGGACGAGGACGAGGGCCCGCGGGCGGCCTGGCCGGGCTCGCTCCAGTCCAGGATGACAGGGACCCGCAACTGGCGAGCCATGCAGGACATGTGCCGATACCGGCACCACTACCCGGATTTGGTGGAACGAGACTCCAATGGGGACATGCCCAACTTGAGTTTCTACAGAAATGAGATCCGCTTCCTGCCTAACGGCTGTTTCGTGGAGGACATTCTTCAAAACTGGAAGGACAACTATGAGCTCCTGGAGGACAATCACTCCTACATCCAGTGGCGGGGAGCTGCACTGGGCCACCTGCCCCTAAAGGGCCTGCACCATCCATGTCTGCACAGGCTGTTTCCTCTGCGGGAGCCGGGAGTGAACTGGCATGCCAAGCCGCTCACACTCAAGGAGGTTGAGGCGTTCAAAAGCTCCAAGGAGGTCCGGGAGCGGCTTATCCGGGCCTACGAGCTCATGCTTGGCTTCTACGGCATCCAGCTGGAGGACCGGGACACAGGCGCCGTGTGCCGGGCACAGAACTACTACAAGCGCTTCCAGAACCTGAACTGGCGCAGCCACAATAACCTTCGCATCACCCGCATCCTCAAGTCGCTGGGTGAGCTGGGCCTGGAGCACTACCAGGCCCCGCTGGCTCGCTTCTTCCTCGAGGAGACACTGGTGCGGCATGAGCTGCCGGGCGTGCGCCAGAGTGCCCTGGACTACTTCCTCTTCGCTGTGCGCTGCCGGCGCCGGCGCCGTGAACTCGTGCACTTTGCCTGGCTGCACTTCCAGCCCCGCTGCAAGTTTGTGTGGGGGCCCCGAGACAAGCTGCTGAAGTTCAAGCCCCAAGTCACAGTCCAGGCACTGGCCAGCCCCAGACAGGTGGAGCGAGACAAGGCCCTGGAGGACGCCCCCCTGGAAGCCAGCACCCAGGCTCAGACCTGCGGGCCAGAGAAGGACCAGGACGGGGACAGCGCGTCGGCTGAGGGTCCCCAGCCGCTGGGTGAAAAGCTCCAGGACACGGGAAACCAGGAGGGGTACCAGCAGGATCAGGCCGACCCCCCAAGCCCCAAAGAGAGCAAGAAGAGGAAGTTGGAGGCCAACAGGCGGGAGCAGGCCCCAGGGGAGCCGGGCCCCCAGGGTGTGTCCGAGGTGGAGAAGATAGCCCTGAACCTGGAGGGCTGTGCCCTCAGCCAGGGCAGCCGTGACCCAGGGGAGGTCGGGCAGCCCTGTCCCGAGCCCCCAGAAGCCAGCGCGGCTGATGAAGTGAGGAAGCGGAGGAGGGTGGAGGAGGATGCGGGGGGCAAGGAAGTGGTGACCCGTGGTGGCGCCCAGATGCCAGGTCCTGCCCCGGCGGAGCACCCTGAGGTCCAGAAGTGGGATGGGGGCGAGGGCGACCTGGAAAACCAGGCGGGCCCGGAGCACGGTGCTCCCAGGAGGCCGTCAGACCGGCCTGGGCCTGCCGCGGCAGGGACCTCACGAGGTGAGACAGAGGTGGCCAGGATGGAGCCTTCTGTCGAACCTGGAAAGCCTTAA

XM_004841022.1 Coding sequence

Mrgbp MRG/MORF4L binding protein, transcript variant X2

High confidence: 3 potential gene matches
Length: 615 bp    Location: 28571417..28576679   Strand: +
>XM_004841022.1
ATGGGGGAGGCCGAGGTGGGCGGCGGGGGTGCCGCTGGCGACAAGGGGCCGGGGGAAGCGGCCACGAGCCCGGCGGAGGAGACGGTGGTGTGGAGCCCCGAGGTGGAGGTGTGCCTCTTCCACGCCATGCTGGGCCACAAGCCCGTCGGTGTGAACCGGCACTTCCACATGATCTGTATCCGGGACAAGTTCAGCCAGAATATTGGGCGACAGGTTCCGTCCAAGGTCATCTGGGACCATCTGAGCACTATGTATGACATGCAGGCACTGCATGAGTCTGAGATTCTTCCCTTCCCGAATCCAGAAAGGAACTTCGTCCTTCCTGAAGAGATCATTCAAGAGGTCCGAGAAGGAAAAGTGACCATCGAGGAGGAAATGAAAGAGGAGATGAAGGAAGACGTGGACCCCCACAATGGGGCTGACGATGTTTTTTCATCTTCAGGGAGCTTGGGGAAAGCAACAGAAAAATCCAGCAAAGACAAAGAGAAGAACTCTTCAGACTTGGGGTGCAAAGAAGGGGCAGACAAGCGGAAGCGTAGCCGGGTCACCGACAAAGTGCTGACAGCAAACAGTAACCCCTCTAGCCCCAGTGCTGCCAAGCGGCGCCGGACATAG

XM_004841021.1 Coding sequence

Mrgbp MRG/MORF4L binding protein, transcript variant X1

Length: 663 bp    Location: 28571417..28574858   Strand: +
>XM_004841021.1
ATGGGGGAGGCCGAGGTGGGCGGCGGGGGTGCCGCTGGCGACAAGGGGCCGGGGGAAGCGGCCACGAGCCCGGCGGAGGAGACGGTGGTGTGGAGCCCCGAGGTGGAGGTGTGCCTCTTCCACGCCATGCTGGGCCACAAGCCCGTCGGTGTGAACCGGCACTTCCACATGATCTGTATCCGGGACAAGTTCAGCCAGAATATTGGGCGACAGGTTCCGTCCAAGGTCATCTGGGACCATCTGAGCACTATGTATGACATGCAGGCACTGCATGAGTCTGAGATTCTTCCCTTCCCGAATCCAGAAAGGAACTTCGTCCTTCCTGAAGAGATCATTCAAGAGGTCCGAGAAGGAAAAGTGACCATCGAGGAGGAAATGAAAGAGGAGATGAAGGAAGACGTGGACCCCCACAATGGGGCTGACGATGGTAAGTGTGGAGCTGCTCACCCTCCGGTGCCCTTTGGGCCACAGCACCGTCTCCACAGCCAGAAAGGCCTCCCACATGCAGGGCAGGGTCAGGTGGCCATAAAGTGCAAGGTGGAGGCTCCAGTTAGAGGCCGGCACGGTGCGGGTCCTCAGTGCAGGACCCCTGACAGCCTGTGCAAGGAGCCAGGTGCTCAGCTGCCCCCTCATTTGACGTCCCGGCAGAGCCTGGAAGCCTGA

XM_004841012.1 Coding sequence

Cables2 Cdk5 and Abl enzyme substrate 2, transcript variant X2

Length: 1293 bp    Location: 28259648..28244422   Strand: -
>XM_004841012.1
ATGAGGCAGTATGACACGAGGAACAGCAGGATCGTGCTCATCTGTGCCAAGCGGTCCCTGTGCGCGGCCTTCTCGGTCCTGCCCTATGGAGAAGGCCTGCGGATCAGTGACCTAAGGGTGGACAGCCAGAAGCAGAGGCATCCGTCCGGTGGCGTGTCTGTTTCTTCCGAGATGGTCTTTGAATTGGAAGGCGTTGAACTGGGAGCGGATGGAAAGGTTGTCTCTTATGCAAAGTTCCTGTACCCTACCAATGCCCTGGTTGCACACAAGAGTGACAGCCATGGCCTGCTGCCCCAGCCTCGGCCCAGCATCCCCCGGGCTCTGCCAGGGTCAAGACACAAACCTGCCACAACCAAGGTACCACCAGCTGGCACGGAACTAGGTAGGCACCCACCTTCCCCATGGCACGGACCTGGGTGGCATACAGGCCTTCACCATGGCCAGGCCAGAGCCAGGAATGGGCCACCGGCATCAGTAAGCCACATTCACCCCCAAAGCCCTTGCTGGAGAGCCTGCCCTGGGAGCAGGGCCAGTGGCAGCCTCTCTAGAGAAACAGCTCCAGTCGGCACAGCCAGGCAGCGGAGAGGAAACCATCCCAGGCTGCTCCAGAGGGGCCGTCTCTACTGCACCCACAGACTTTGGGCAGGGAAGAACCATAGCCAGCACCTCCCCAACTTCAGCAGTTTTGCTGGTTCTGATGGAAGTTCTGGGTGTCAGGAGCTGCCTCTCCTTACAGGGAGCGATGGGGGAGATACCCTGGAGTACAACCCCAACCTCCTGGATGACCCACAGTGGCCCTGTGGGAAGCACAAGCGTGTCCTCATCTTTGCCTCATACATGACCACAGTGATAGAGTACGTGAAGCCCTCGGACCTCAAGAAGGACATGAACGAGACCTTCAGAGAAAAGTTTCCACACATCAAACTGACACTGAGCAAAATCAGGAGTTTGAAGCGGGAAATGCGGAACCTGTCTGAGGAGTGCAGCCTGGAGCCAGTGACTGTGTCCATGGCCTACGTATACTTTGAGAAGCTTGTACTGCAGGGCAAGCTCAACAAACAGAACCGCAAGTTGTGCGCTGGCGCCTGCGTGCTACTGGCTGCCAAGATCAGCAGTGACCTCCGCAAGAACGAAGTGAAGCAACTCATTGACAAGCTGGAAGAAAGATTCCGATTCAACAGGCGAGATCTCATTGGGTTCGAGTTCACAGTGCTCGTGGCTTTGGAACTGGCCTTGTACCTTCCGGAGAGCCAAGTGTTACCTCACTACAGACGCCTCACCCAGCAGTTCTAG

XM_004841014.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 2181 bp    Location: 28276670..28261670   Strand: -
>XM_004841014.1
ATGGAGACCTTCATGGAGTCGCTAAACAAGCTGAAGGACACCCACGAGAAGGAGGTCCTGGGCCTGCAGAACAAGCTTCTGGAACTGAACTCTGAGAGGTGCCGGGATGCCCAGCGGGTGGAGGAGCTCTTCGCCAAGAACCACCAGCTGAGGGAGCAGCAGAAGGCGCTGAAGGAGAACCTGCGGGTGCTGGAGAACAGACTTCGGGCCGGCCTGTGCGACCGCTGCATGGTCACCCAGGAAGTGGCCAGGAAGAGGCAGCTGGAGTTCGAGAGCTCCCACCTGCAGAGCCTGCAGCGCATCTGTGTCCTCACCAACGAGATGACCAAATTAAAGGAGGAGAACAAGATGTTGAAGGAGGAGGTGAAGCGGCTATGTGGCCTGGAAGACAAGCCGGCACCCCCAGCCAGGGAAGGTACCTTGGAGCGCCCCTCACCCCTGCTGCTCCCCTCCCCCGGCGGCCGGAAGGCTGTCACCGAGAAGCCACACGGAGGCCATGAAGAGGCTGAGGAGGAGCAGCAGGCCACAGCTTCTCCAGGAGAAGACAAGTCCGCGGGCTACAGGACATCTCCAGTGGTCAACCCGCCCGAGTCCCGGGCCCCAGACATGAGTCCCCAGCGCATCTCCAACCAGCTGCACGCCACTGTCGCTGTGGTGCGGCCTGGGTCTCGGGCCTGCCTGGCGGACCGCGGCTCCTCCGACCGGACATCTCCACCCACCAGGAGCACCCCGTCCAGTCCAGTGTACGAGCACAGCCTCCCTCTGGACAGCTTCCTGCGGGCTTCCGGGCCTGCAGTCCGGGCCTATGAGTCCCTGAAGCGGCCCCTTCAGACCGACCACTTCTGTCTCCTGGACCGCCATCTGTCCCTGCACCTCCAGAGCCCACACAACAGCCCCCCAGCCCTAGCCCCAGCCCCCCACAGCCCCCAGCCCTGGGTCCTGAAGGCAGGGGAGGCCTGGGAGGAGCCCGTGGGCCTGCTGGGCCTGCCTGGCGCCCTGGTGGGCATGCAGGACCCCCGGCTAGAGGGGGTGCTACACCTGCTCCTGGCTCAGCGGCAGCTGTGTGCGCGGGCACGGGCGGGCAGTGACACACTGAGGGGTCCGCCCCCCATGGGGGGGACTCCGCCCTCCCCGCCAGTCGGCTGGGACTCTGACAGTCCTGAGCATGAGGTGCTCGGGGCAGCCCTGACCACAGCAGCCCTGCCTGGTGGGCGGCACCCACAGACCGCTGGCAGCTCCCCTCAGAAGGAGGCAGGGGCCACTCAAGACTATGCCCCAGACAAGCCCCTGGACCTCTCAGACCCGGGCCGCAGCAAGGACGCCCCCAAGTCTGCCAGCCAAGCTGAGTCCCTCAGCTCCAAACTCGCCTGCCCTCTCAGCCCTGAGCCGCTGACTCTGTCCCGCGCCCTGACTCACAGCCCCCCAACACTCAGCAATGGCACCCAAGGACCCACAGAGCCAGAGCCGGAGGGGTCTCCCACTCCCACGGTAAGGGGCCCAGGGCTGCCCACAGCCCAGGGCCTGACCTCGGCCTCCATGACCGCCACTGCAGTCCAGCCTCCCCAGCCTTGGACTGCCCTCCTGTGCCAACCCAAAGTCAGTACCAGGAGTGCCCTGGCCACTCATTTGCACAGGGCTGACCTCCGGCCACAGCCCAGGTGTGGACTTGCGGGCTGCATCCACCCAGGGCTGACCACCCCGGCCTCCTTCTGCCTCCCCCAGGGCCCCTCACCGCCTCTCCCAGGGCCCCCCCTCAGCCTGCTCACTGCCATTGGGACCAGATGTGAAGCCAGAGGGAGGTCAAGGCCAGCACCCCACCCACAGGGCCCCAAGGCTGCTGGGCCCCCAGAGCCCAGCAAGGCTGGAGCGCACAGCCTAGGGTCGGGGGAACTGGAGGAGTCTGACACATCCAACAGTGAGGTGGACCGAAGCTCCGAAACAGGGGCCAAACTGAGCATGCCAGGGGAGGAACACAGGCGCTTCTGCCCCCAGAAGCCCCAGCAGGGTTTGCAGCAGAAGAGGAAGCAGACCTTGGACCTGGCAAGCAGAGGCTCCAAGAAGCTGTGCCGAGGGAGAAGGAAAGCAAGGGAGCTTATGATAGCTGCCGAGGGGCCCAACAGCCCAAGGGACACCAAGGACTGCAGCCCCTCGCCTGGCAACAGCAGCCCTGAGGAGACCTAG

XM_004841016.1 Coding sequence

Slco4a1 solute carrier organic anion transporter family, member 4A1, transcript variant X1

Length: 2445 bp    Location: 28450478..28470512   Strand: +
>XM_004841016.1
ATGCCAGCCCTCCGGCCGGCCGCGGGAACAGCGAACAAACGGGCAGCTGGAATTCCTCTCGGCCACTTCTGCCAGTCCCACTGTCACCCTGCTTCCAAGGCCTCCCCACCAGGCCCGGAGATGCCCCAGCAAGCGCTGGGGGACACGCGCTTCCCCCTGATGCCCCAGCTCTTCAACAGCACCCACTTGGCTGTTGAAAATGGGCTTGACCACAGCCCCCTGGGCAGCAGGGACTCCCCAGGCTCTGAGCGCTCCACCACCCACAGCCCCCTGGACTCCTGCAGCCAGCCCCTGTGCCAGCCCCGGACAGAGAAGCACAACAGCCAGGCGGCTCCGCAGGTGCAGTACGTTTCAGTGGGGCCACCAGACACAGCGTGTGGCTGGCGAGGCTTCACCCCAGAGTGCCTGCAGGTCTTCAACACCCCCAAGGGCTTCCTGTTCTTCCTGTGTGCAGCCTCCTTCCTGCAGGGCATGACGGTGAACGGCTTCATCAACACGGTCATCACCTCCATCGAGCGGCGCTATGACCTGCACAGCTACCAGAGCGGGCTCATCGCCAGCTCCTACGACATTGCCGCCTGTCTCTGCCTTACCTTTGTCAGCTACTTCGGGGGCAGTGGACACAAGCCGCGCTGGCTGGGCTGGGGCGTGCTGCTCCTGGGCGCCGGCTCGCTGGTGTTCGCCCTGCCCCACTTCATCTCGGGCCGCTATGAGGCGGAGGTGGACGAAGGGACCGGGATGTGCCCGGCCAACCAGAGCGTGGTGTGTGCTGACAGCTCCTCGGGCCTGTCCCACTACCGGCTGGTCTTCATGCTGGGCCAGTTCCTGCACGGCGTGGGCGCCACGCCCCTGTATACCCTGGGCGTCACCTACCTGGACGAGAATGTCAAGTCCAGCTACTCGCCCGTCTACATTGCTGTCTTTTACACTGCAGCCATCCTGGGCCCTGCTGCTGGCTATCTGATCGGAGGCGCCATGCTGAATGTTTACACGGAAGTGGGCCGGCGGACCCACTTGACCCCCGAGAGCCCACTGTGGGTTGGTGCCTGGTGGATCGGCTTCCTGGGCGCAGGGGCAACAGCCTTGATCATCGCTGTCCCCATCCTTGGCTACCCCCGACAGCTGCCAGGCTCCCAGCGCTATGTCATCATGAGAGCAGCAGAGACACAGCAGCTGAAAGAGCGCAGCCACAAGACAGCTGGCAGCCTGGCCTTGGGGAAGACAGTCAGAGACCTGCCGCTCTCCATCTGGCTCCTCCTGAAGAATCCCACATTCATCCTACTCTGTCTGGCGGGGGCCACTGAGGCCACGCTCATTGCCAGCATGTCCACGTTTGGCCCCAAGTTCTTGGAGGCCCAGTTCAGCCTCAGTGCCTCAGAAGCGGCCTCTTTGTTCGGGTACCTGGTGGTGCCGGCAGGCGGTGGCGGCACACTCTTGGGCGGCTTCCTGGTGAACAGGTTTAAGCTCCGAGGCCCCGGGATCGTCAGGTTCTGCCTGCTCTGCACCCTGACCAGCCTGCTTGCCTTCTTCGTCTTCCTCACACACTGCCCCAACGTGCCCATGGCAGGCGTGACCACAGGCTACACCAGCCTCCTGCCTGAAGGCCACCTGAACCTGACGGCCACCTGCAATGAGCACTGCAGCTGCCAGCCCGAGCACTACCGCCCTGTGTGCGACGCGAACGGCACCATGTACTACTCCCCCTGCCACGCAGGGTGCCTGGGGCCCGCAGAGACGGGCTGGGATGGCCAGAAGGTGTACCAAGGCTGTAGCTGTGTCCCTGCGAGTTTGGGCCAGGCCACTGCAGGGAAATGCACTTCAACTTGTCAGAGAAAGCCCCTCCTTCTGGTTCTCGTGTTCGCTGTAATTATCTTTACATTCCTCAGCAGCATTCCTGCGCTGACGGCGACTCTACGGCAGCATCCCGGGACCCATCGCCTTTGGCTGGGTGATCGACAAGGCCTGCCTCCTATGGCAAAACCAGTGCAGCCACCAGGGCTCCTGCTTCGTGTACCAGAACGCAGCCATGAGCCGCTATATACTCGTCGTGGGGCTCGTGTACAAGGTGCTGGGCTTCCTCTTCTTTGCTGCCGCCTGCTTCCTGTACGAGTCTCCGTCCGGGCCCTTGGCCGACCGGGCCGCCTCCCTGCCCAGCCAGTCATCAGCCTCCGAGGGCCCCTCGGACCTCCAGCTGCAGAGTGCCATCTGACCCGCCTGCTCAGGGTCGCCCTCCTCACCGAGGCCACAGTGCCGGACCTGGGGAGTCTGCGCTGGACTCGGGGCCTGCGGGGCCACCCCAAGGTTGCACTGAGCCATGGGTCGTGGAGGTCAGAGCCTGAGACCAGGAAGGAGGAGTGGTGCCGGGCATACTGGAAGTGGACACGCCCCCCAGCCCGAGCACTCCTGAGGAATGGCCCATCCTGCCAGCTGCCTGCCTGGCTCTGA

XM_004841005.1 Coding sequence

Adrm1 adhesion regulating molecule 1, transcript variant X1

Length: 1224 bp    Location: 28151401..28156823   Strand: +
>XM_004841005.1
ATGACGACTTCAGGCGCTCTCTTCCCAAGCCTGGTGCCTGGCTCTCGGGGCTCCTCCAACAAGTATCTGGTAGAGTTCCGGGCGGGCAAAATGTCATTAAAAGGAACTACAGTCACCCCGGATAAACGGAAAGGGCTCGTGTACATCCAGCAAACGGACGACTCGCTCATTCACTTCTGCTGGAAAGATAGGACCTCTGGGACCGTGGAGGACGACCTGATTATATTCCCCGATGACTGTGAGTTCAAGCGTGTGCCTCAGTGCCCCAGTGGGAGGGTCTACGTGCTCAAGTTCAAGGCAGGGTCCAAGCGGCTCTTCTTTTGGATGCAGGAGCCCAAGACTGATCAGGACGAGGAGCACTGCCGGAAGGTCAACGAGTATCTGAACAACCCGCCGATGCCTGGGGCACTGGGGGCGAGTGGAAGTGGAGGCCACGAGCTCTCCGCACTGGGCGGTGAGGGCAGCCTGCAGAGCCTGCTGGGGAACATGAGTCACAGCCAGCTCATGCAGCTCATCGGACCGGCTGGCCTTGGAGGGCTGGGTGGGCTTGGGGCCCTGACTGGACCAGGCCTGGCCAGTTTACTGGGGAGCGGCGGGCCTCCGGCGAGCAGCTCTTCGTCCAGCTCCCGGAGCCAGTCGGCAGCGGTCACCCCATCCTCTACCACCTCTTCTGCCCGCGCCACCCCAGCCCCTTCTGCCCCAGCAGCTGCCTCAGCGACCAGCCCGAGTCCTGCGCCCAGTTCAGGTAACGGAACCAGCACGGCAGCCAGCCCAACCCAGCCCATCCAGCTGAGCGACCTCCAGAGCATCCTGGCCACTATGAATGTGCCAGCCGGGCCAGGAGGCGGCCAGCAAGTGGACCTGGCCAGTGTGCTGACGCCAGAGATCATGGCTCCCATCCTTGCCAACGCAGACGTCCAGGAGCGCCTGTTGCCCTACCTGCCATCGGGGGAGTCACTGCCCCAGACCGCAGACGAGATCCAGAACACGCTGACTTCCCCTCAGTTCCAGCAGGCCCTGGGCATGTTCAGTGCAGCCTTGGCTTCGGGGCAGCTGGGCCCCCTCATGTGCCAGTTCGGGCTGCCTGCAGAGGCGGTGGAGGCCGCCAACAAGGGCGATGTGGAAGCATTTGCCAAAGCTATGCAGAACAATGCCAAATCTGAGCAGAAAGAGGGCGATGCAAAAGACAAGAAAGACGAAGAAGAAGATATGAGTCTCGATTAA

XM_004840991.1 Coding sequence

Psma7 proteasome (prosome, macropain) subunit, alpha type, 7, transcript variant X1

Length: 768 bp    Location: 28017055..28011058   Strand: -
>XM_004840991.1
ATGAGCTACGACCGCGCCATCACCGTCTTCTCGCCCGACGGCCACCTCTTCCAAGTGGAGTACGCGCAGGAGGCCGTCAAGAAGGGCTCGACCGCGGTTGGTGTTCGAGGAAGGGACATTGTTGTTCTTGGTGTGGAAAAGAAATCAGTGGCTAAACTACAAGATGAAAGAACTGTGCGAAAGATCTGTGCTTTGGATGACAACGTCTGCATGGCCTTTGCAGATGCCTCTGCTGTCTTTGCAGGCCTCACTGCTGACGCAAGGATCGTCATCAATAGGGCCCGGGTGGAGTGCCAGAGCCACCGCCTGACTGTGGAGGACCCGGTCACTGTGGAGTACATCACCCGCTACATTGCCAGTCTGAAGCAGCGTTATACGCAGAGCAATGGGCGCAGGCCTTTTGGCATCTCTGCCCTCATCGTGGGTTTTGACTTCGATGGCACCCCTCGACTCTATCAGACTGACCCCTCTGGCACATACCATGCCTGGAAGGCCAATGCCATAGGCAGGGGTGCCAAGTCAGTGCGTGAGTTCCTGGAGAAGAACTATACCGATGAAGCCATTGAGACAGATGATCTAACCATCAAGCTGGTGATCAAGGCACTCCTGGAAGTGGTCCAGTCAGGTGGCAAAAACATTGAACTTGCTGTCATGAGGAGAGATCAGCCTCTCAAGATTCTAAATCCTGAAGAAATTGAGAAATATGTTGCTGAAATTGAAAAAGAAAAAGAAGAAAATGAAAAGAAGAAACAAAAGAAAGCATCGTGA

XM_004841007.1 Coding sequence

Adrm1 adhesion regulating molecule 1, transcript variant X3

Length: 1107 bp    Location: 28151401..28156823   Strand: +
>XM_004841007.1
ATGACGACTTCAGGCGCTCTCTTCCCAAGCCTGGTGCCTGGCTCTCGGGGCTCCTCCAACAAGTATCTGGTAGAGTTCCGGGCGGGCAAAATGTCATTAAAAGGAACTACAGTCACCCCGGATAAACGGAAAGGGCTCGTGTACATCCAGCAAACGGACGACTCGCTCATTCACTTCTGCTGGAAAGATAGGACCTCTGGGACCGTGGAGGACGAGCCCAAGACTGATCAGGACGAGGAGCACTGCCGGAAGGTCAACGAGTATCTGAACAACCCGCCGATGCCTGGGGCACTGGGGGCGAGTGGAAGTGGAGGCCACGAGCTCTCCGCACTGGGCGGTGAGGGCAGCCTGCAGAGCCTGCTGGGGAACATGAGTCACAGCCAGCTCATGCAGCTCATCGGACCGGCTGGCCTTGGAGGGCTGGGTGGGCTTGGGGCCCTGACTGGACCAGGCCTGGCCAGTTTACTGGGGAGCGGCGGGCCTCCGGCGAGCAGCTCTTCGTCCAGCTCCCGGAGCCAGTCGGCAGCGGTCACCCCATCCTCTACCACCTCTTCTGCCCGCGCCACCCCAGCCCCTTCTGCCCCAGCAGCTGCCTCAGCGACCAGCCCGAGTCCTGCGCCCAGTTCAGGTAACGGAACCAGCACGGCAGCCAGCCCAACCCAGCCCATCCAGCTGAGCGACCTCCAGAGCATCCTGGCCACTATGAATGTGCCAGCCGGGCCAGGAGGCGGCCAGCAAGTGGACCTGGCCAGTGTGCTGACGCCAGAGATCATGGCTCCCATCCTTGCCAACGCAGACGTCCAGGAGCGCCTGTTGCCCTACCTGCCATCGGGGGAGTCACTGCCCCAGACCGCAGACGAGATCCAGAACACGCTGACTTCCCCTCAGTTCCAGCAGGCCCTGGGCATGTTCAGTGCAGCCTTGGCTTCGGGGCAGCTGGGCCCCCTCATGTGCCAGTTCGGGCTGCCTGCAGAGGCGGTGGAGGCCGCCAACAAGGGCGATGTGGAAGCATTTGCCAAAGCTATGCAGAACAATGCCAAATCTGAGCAGAAAGAGGGCGATGCAAAAGACAAGAAAGACGAAGAAGAAGATATGAGTCTCGATTAA

XM_004840952.1 Coding sequence

Stx16 syntaxin 16, transcript variant X12

Length: 858 bp    Location: 24965086..24974377   Strand: +
>XM_004840952.1
ATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGGCTGGAGCATGCGCGTTTCCAGACGTGGGGGCTCTGCCTGGCAGCCAGGGAAGCTGCAGTGGAGAGAAGCGAGGCAGCAGAGGCTGAAGAGCGGGGTCCATAGCGTCTCCGCCAGCCTTTGCCCCAGCGGTAGATTCTGA

XM_004840995.1 Coding sequence

Mtg2 mitochondrial ribosome-associated GTPase 2, transcript variant X2

Length: 1218 bp    Location: 28053478..28070886   Strand: +
>XM_004840995.1
ATGGTGCCTGTGAGGCTCTTCTCAGCAAGCTCTTGGACCAGGTTGGAGGGAGTGATGGGGGCTCCATCCACATGGGCTGGCCTCCCGCTCGGCAGGCTCCTTCCACAGCAGGCTCCACCCAGGCCACTCTCCACGGGCTGTGCAGACTGCACCAAGCATCAGAAACCCCCCGGAAAGAAGCTGCTGTCTGAGAAGAAACTGAAAAAGCATTTTGTGGACCATCGCAGAGTGCTTGTCCGTGGAGGAAGTGGAGGCTCGGGCATGAGCTGTTTCCACAGCGAGCCCCGAAAGGAGTTCGGAGGCCCCGATGGCGGGGATGGTGGCAGTGGTGGCCACGTCGTCCTGAGAGTTGACCCAAAAGTCAAGTCCCTGTCGTCAGTCCTGTCCCACTATCAGGGCTTCAGTGGAGAAGATGGCGGCAGGAAAAACTGCTCCGGACGAGGTGGCGCTGTCCTCTACATCCAGGTCCCCATGGGCACCTTGGTGAAGGAGGGAAGTGAAATCATGGCTGACCTGAGCCGACCAGGCGACGAGTACATTGCGGCACTGGGGGGTGCAGGAGGGAAAGGCAACCGCTTTTTCCTGGCCAACGACAACCGCGCCCCCGTGACTTGCACCCCTGGAGAGCTGGGTCAGGAGCGTGTTCTCCACCTGGAGCTCAAGACGGTGGCCCACGCCGGGATGGTTGGGTTCCCCAATGCTGGGAAGTCCTCCCTCCTCCGAGCCATTTCCAATGCAAAGCCCGCTGTGGCGTCCTACCCGTTCACCACCCTAAATCCCCACGTAGGCATTGTGCACTATGCCGGCCACCAGCAAGTAGCAGTGGCAGACATCCCAGGGATCATCCGAGGTGCCCACCAGAACAGGGGCCTGGGGCTCAGCTTCCTCAGGCACATCGAACGCTGCCTCTTCCTCTTGTTCGTGGTGGACCTTTCCGTCCCAGAGCCATGGACTCAGTTTGAGCATTTAAAATATGAACTGGAGAAGTACAAAGAAGGCCTGTCTGAGAAGCCCCATGCGATTGTTGCAAATAAGATTGATCTGCCACAGGCCAGAGCCATTCTACCCCAGCTCCGGGCCCAGCTGGGACAGGAGGTCATCGCCCTGTCAGCCCTGACTGGGGAGAACCTGGAGCAACTGCTGCTCCACCTGAAAGTCCTCTACGATGCCTACATGGAGGCTGAGCTGGGGAAGGGCTGCCAGCCACTTAGGTGGTAG

XM_004840997.1 Coding sequence

Mtg2 mitochondrial ribosome-associated GTPase 2, transcript variant X4

Length: 1218 bp    Location: 28053478..28070886   Strand: +
>XM_004840997.1
ATGGTGCCTGTGAGGCTCTTCTCAGCAAGCTCTTGGACCAGGTTGGAGGGAGTGATGGGGGCTCCATCCACATGGGCTGGCCTCCCGCTCGGCAGGCTCCTTCCACAGCAGGCTCCACCCAGGCCACTCTCCACGGGCTGTGCAGACTGCACCAAGCATCAGAAACCCCCCGGAAAGAAGCTGCTGTCTGAGAAGAAACTGAAAAAGCATTTTGTGGACCATCGCAGAGTGCTTGTCCGTGGAGGAAGTGGAGGCTCGGGCATGAGCTGTTTCCACAGCGAGCCCCGAAAGGAGTTCGGAGGCCCCGATGGCGGGGATGGTGGCAGTGGTGGCCACGTCGTCCTGAGAGTTGACCCAAAAGTCAAGTCCCTGTCGTCAGTCCTGTCCCACTATCAGGGCTTCAGTGGAGAAGATGGCGGCAGGAAAAACTGCTCCGGACGAGGTGGCGCTGTCCTCTACATCCAGGTCCCCATGGGCACCTTGGTGAAGGAGGGAAGTGAAATCATGGCTGACCTGAGCCGACCAGGCGACGAGTACATTGCGGCACTGGGGGGTGCAGGAGGGAAAGGCAACCGCTTTTTCCTGGCCAACGACAACCGCGCCCCCGTGACTTGCACCCCTGGAGAGCTGGGTCAGGAGCGTGTTCTCCACCTGGAGCTCAAGACGGTGGCCCACGCCGGGATGGTTGGGTTCCCCAATGCTGGGAAGTCCTCCCTCCTCCGAGCCATTTCCAATGCAAAGCCCGCTGTGGCGTCCTACCCGTTCACCACCCTAAATCCCCACGTAGGCATTGTGCACTATGCCGGCCACCAGCAAGTAGCAGTGGCAGACATCCCAGGGATCATCCGAGGTGCCCACCAGAACAGGGGCCTGGGGCTCAGCTTCCTCAGGCACATCGAACGCTGCCTCTTCCTCTTGTTCGTGGTGGACCTTTCCGTCCCAGAGCCATGGACTCAGTTTGAGCATTTAAAATATGAACTGGAGAAGTACAAAGAAGGCCTGTCTGAGAAGCCCCATGCGATTGTTGCAAATAAGATTGATCTGCCACAGGCCAGAGCCATTCTACCCCAGCTCCGGGCCCAGCTGGGACAGGAGGTCATCGCCCTGTCAGCCCTGACTGGGGAGAACCTGGAGCAACTGCTGCTCCACCTGAAAGTCCTCTACGATGCCTACATGGAGGCTGAGCTGGGGAAGGGCTGCCAGCCACTTAGGTGGTAG

XM_004840985.1 Coding sequence

Fam217b family with sequence similarity 217, member B, transcript variant X6

Length: 1122 bp    Location: 26208342..26215208   Strand: +
>XM_004840985.1
ATGAATGCTGGGCCATCTTGGAATAAAGTACAACTTTCAAAGGATTCTTCAGGAAAAAGACATAGTAAATCCCAAGTACCTCATCTGTCTTCCGGGCTGAGAGGCAGCCTTGTGGGCGTCTCTCAACCAGCTGCAGAGAAACTTAAAGAAGGCTTTCTTCCAGAAGGAAAACCAGAAGGGAATGTACTCAGCTCCATGTGCCAGGGAGCCTCAGGGAACAAATTGTTTCTTGACTTCCAGTCAATGAAAATTATTAAGGAAGGTGCTGACGAGGACAGTGCAAGTGATCTGTCAGACTCGGAGCGGATGCCGATTCCTCCTCCTCCCCTCACCCCGCCAGATCTAAATCTTCGAGCTGAGGAAATCGACCCAATTTACTTCGATCTTCACCCAAGTCAGAGCCATGCCAAGCCCGAGTACTGTTACCCCGATTTCCTGCCACCCCCTTTTAGCTCGTGGAACCTCCGGGAGATGGCAGTGCTTCTGAACACAGAGTACGAGGCCGAGCCCCGAGCCCGGGGCTTCCTTGGGAAGTACATCAACAGGCTCCTTCAGCTCGAGTGGCTGCAGATCCAGACTGTACAAGGTGAGAAGGGAAAGGGCTCCAAGGCCCGACCTCTGGCAGCCCAGGGGGCGCCCGGGGCTCTGAAAAGTCCTGGGAGAAGTAAACTAATTGCGAGTGGTCTGTCCAAGCCGCTGCCTCACCTGGAAGGGGCTTCAAAGTCAGGCCCTGCACAAAAGCAAGGTTTTCGCTTTGAAGAAACACGTCCATCCTATTACGCCTTTGAGACCTCCCCCAGGTCCCCTGAGGCCAGCACCAGGCTACATCCCCTCCAGCAAACCCCCGAAATGAGGACTAAAGAGAAGAAAAAGAAATCCAGTAAAAGCACCAAGATGCAGCACAGGGATTTTTCTTGCAGCGACAGCAGCTCCAAACTGGAAGCCAGTGGGAATATCCGAGTTCCCGAACAGCCAGCAACGATTCTGGACTCTTGCAGAACACAAGCACATGGGAATCTTAAGAAAAAGGGGACTGCAAACAGCTGTGCTCATACAACAATATCCAGTGAGAAGAAACTCAAAACAAATGGAGCAAAGCAAAACTCATACAAATTAAAATAA

XM_004840987.1 Coding sequence

Cdh4 cadherin 4, type 1, R-cadherin (retinal), transcript variant X2

Length: 2748 bp    Location: 27331484..27858447   Strand: +
>XM_004840987.1
ATGACGGCGAGCTCTGGGCTGCTCCTCGCGCTGCTCTCGCTCTGCGGCGCGCTCCGGGCCCATAATGAGGATCTTACAGCCAGAGAGACCTGCAAGGCTGGCTTCTCGGAGGAGGACTACACAGCGTTAATCTCCCCCAATATTCTGCAGGGAGAGAAGCTCCTCAAAGTGAAGTTCAGCAGCTGCTTGGGGAACAAGGGGACGCAGTATGAGACCAACAGTGTGGACTTCAAAGTCGGGGCAGACGGGACCGTCTTCGCCACTCGGGAGCTGCAGATCCCCTCTGAGCAGGTGGCCTTCACGGTGACAGCCAGGGACCACCAGACGGCCAAGCAATGGGACGCCATGGTGCGGCTGCTGGTGGCCCAGACCTGGACCTCGAACTCAGGACGCAAGGTAAGGAAAGGAAAAAACGTGGACCTGGACCCCGCTCAGCCCCCCCAAGACATACTGCTACCGTGGCCCCAACGGCAGAGCTCCAGCGGCCTGAGGCGGCAGAAACGGGACTGGGTCATCCCCCCCATCAACGTGCCGGAGAACTCCCGCGGCCCCTTCCCGCAGCAGCTCGTGAGGATCCGTTCCGACAAAGACAATGACATCCCCATCCGGTACAGCATCACAGGCGTGGGCGCGGACCAGCCGCCCATGGAGGTCTTCAGCATCGACTCCATGTCTGGGCGCATGTACGTCACACGGCCCATGGACCGGGAAGAGCGAGCCTCTTACCATCTTCGAGCCCACGCTGTGGACATGAACGGCAACAAGGTGGAGAACCCCATTGACCTGTACATCTACGTCATCGACATGAACGACAACCGCCCTGAGTTCATCAACCAGGTCTACAATGGCTCTGTGGACGAGGGCTCCAAGCCAGGAACCTACGTGATGACAGTCACAGCCAACGACGCCGATGACAGCACCACAGCCAACGGAATGGTGCGGTACCGGATTGTAACCCAGACACCACAGAGTCCGTCTCAGAACATGTTCACCATCAACAGCGAAACAGGGGACCTGGTGACAGTGGCAGCTGGCCTGGACCGTGAGAAAGTCCAGCAGTACACAGTCATCGTCCAGGCCACCGACATGGAGGGGAATCTCAACTATGGCCTCTCGAACACAGCCACAGCGATCATCTCGGTGACAGACGTGAACGACAACCCGCCAGAGTTCACCTCGAGCACATTTGCAGGAGAGGTCCCCGAGAACCGCGTGGAGACGGTGGTCGCAAACCTGACGGTGATGGACCGCGACCAGCCCCACTCGCCCAACTGGAACGCCGTCTACCGCATCATCAGCGGAGACCCCTCGGGCCACTTCAGCGTCCGCACCGACCCCATCACCAACGAGGGCATGGTCACCATGGCGAAGGCGGTGGACTATGAGCTGAACAGGGCCTTCATGTTGACCGTGATGGTGTCCAACCAGGCACCCCTGGCCAGCGGGATCCAGATGTCCTTCCAGTCCACGGCGGGTGTGACCATCTCTGTCACGGACATCAACGAGGCACCCTACTTTCCGTCCAACCGCAAGCTGATCCGCCTGGAGGAGGGTGTGCCAGCTGGCACCGCGCTCACCACCTTCTCTGCCGTGGACCCTGACCGCTTCATGCAGCAGGCTGTGAGGTACTCAAAGCTGTCCGACCCAGCCAACTGGCTGCACATCAATGCCTCCAACGGTCAGATCACCACGGCGGCTGTCCTGGACCGAGAGTCCCTCTACATCAGAAACAACGTCTACGAGGCAACCTTCCTGGCAGCTGACAACGGGATCCCCCCGGCCAGTGGCACCGGTACTCTGCAGATCTATCTTATCGACATCAACGACAATGCCCCGGAGCTGCTGCCCAAGGAGGCGCAGGTCTGCGAGAAGCCAGGCCTGAACGCCATCAACATCACTGCGGCCGACGCCGACATCGACCCCAACATCGGCCCCTACGTCTTCGAGCTGCCCTTCATCCCAGCCACTGTGCGAAAAAACTGGACCATTACCCGCCTGAATGGTGACTATGCCCAGCTGAGCTTGCGCATCCTGTACCTGGAGGCCGGGGTGTACGAGGTCCCCATCACCGTCACAGACTCTGGGAACCCTCCCCTGTCCAACACATCCGTCATCAAGGTCAAGGTGTGCCCGTGCGATGAAAACGGTGACTGCACCACCATCGGCGCGGTGGCCGCGGCCGGCCTGGGCACAGGCGCCATAGTGGCCATCCTCATCTGCATCGTCATCCTGCTGACCATGGTCCTGCTGTTCGTCATGTGGATGAGGCGGCGGGGGAAGGAGCGGCTCACCAAGCAGCTGCTCATCGACCCCGAGGACGACGTGCGGGACAACATCCTCACCTACGACGAGGAAGGCGGCGGCGAGGAGGACCAGGACTATGACCTCAGCCAGCTGCAGCAGCCGGAAGCCATGGAGCACGTGCTGAGCAAGGCCCCCGGGGTGCGGCGGGTGGATGAGCGGCCGGTGGGCGCGGAGCCCCAGTACCCCGTGAGGCCCGTGGTGCCCCACCCAGGTGACATCGGCGACTTTATCAATGAGGGGCTGCGAGCTGCTGACAACGATCCCACGGCGCCCCCCTATGACTCCTTGCTGGTCTTTGACTACGAAGGGAGTGGCTCCACTGCGGGCTCGGTGAGCTCCCTGAACTCGTCCAGCTCCGGGGACCAAGACTACGATTACCTCAACGACTGGGGGCCCCGGTTCAAGAAGCTGGCAGACATGTACGGGGGCAGCGAGGAGGACTAG

XM_004840988.1 Coding sequence

Lsm14b LSM14B, SCD6 homolog B (S. cerevisiae), transcript variant X1

Length: 1275 bp    Location: 27998837..28010543   Strand: +
>XM_004840988.1
ATGAGCGGCTCCTCGGGTACCCCGTATCTGGGCAGCAAGATCAGCCTCATTTCCAAGGCACAGATTCGCTACGAGGGCATTCTCTACACCATCGACACCGACAACTCCACCGTGGCTCTCGCCAAAGTGAGGTCCTTTGGTACTGAAGACCGTCCCACAGATAGGCCTGCTCCCCCAAGAGAGGAAATTTATGAGTACATCATTTTTCGGGGAAGTGATATTAAAGATATTACTGTATGTGAACCTCCGAAAGCTCAGCACACACTCCCTCAGGATCCTGCTATCGTTCAGTCTTCCTTGGGCTCTGCCTCTGCCTCGCCCTTCCAGCCACATGTGCCTTATAGCCCCTTCAGAGGAATGCCGCCCTATGGCCAGCTGGCAGCCAGCTCCCTGCTCAGCCAGCAGTATGCATCTTCCTTAGGTCTAGAGAAGTTGGTAAGCCCTCCAGCCTCAGCCGCTGCTTCCAGTCCTAGTTCTTCTCCATCTCCACAGCCCGTTTCAGAGCTTGACATGTCCTCAGAGCCACCTCAGCTCACTTCCAAGGGAGCTGGTTTTCCATCTGCCCCAGTTGGCAAGAGCCCCATGGTGGAACAGGCTGTCCAGACTGGTTCTGTTGATAACCTGAATGCCAAAAAGCTGTTACCTGGCAAGGGCACCTCAGGGATGCAGCTCAGCGGTCGCCAGGCCCACCCAAGCAGCAAGACCACTGGTGATATAGTCCAGCCAGCAGCTGTGCACACTCAAGGGCAGGTGAATGATGAGAACAGAAGACCTCAGAGGAGGCGGTCAGGGAATCGGCGAACAAGGAATCGCTCCAGAGGGCAAAACCGTCCTACTAATGTCAAGGAAAACACAATCAAGTTTGAGGGAGACTTTGATTTTGAGAGTGCAAATGCCCAGTTCAACCGAGAAGAACTGGACAAAGAATTCAAGAAGAAACTAAATTTTAAAGAGGACAAGGCTGAGAAGGGGGAAGAGAAGGACCAGGCTGTGGTCACTCCGAGTGATGAAACTCCTGCTGAGGAAGACCTTCTGGGGCCCAACTGCTACTATGACAAATCCAAGTCCTTCTTCGACAATATCTCTTCTGAACTCAAGACCAGTTCTAGGCGGACAACATGGGCTGAAGAGAGGAAGCTGAATACAGAGACCTTTGGGGTATCAGGGAGGTTCCTTCGAGGCCGCACTTCCCGTGGAGGATTCCGAGGAGGCAGGGGCAATGGGACCACTCGGCGCAACCCTACTTCCCACAGAGCCGGGACTGGCAGGGTGTAA

XM_004840989.1 Coding sequence

Lsm14b LSM14B, SCD6 homolog B (S. cerevisiae), transcript variant X2

Length: 1197 bp    Location: 27998837..28010543   Strand: +
>XM_004840989.1
ATGAGCGGCTCCTCGGGTACCCCGTATCTGGGCAGCAAGATCAGCCTCATTTCCAAGGCACAGATTCGCTACGAGGGCATTCTCTACACCATCGACACCGACAACTCCACCGTGGCTCTCGCCAAAGTGAGGTCCTTTGGTACTGAAGACCGTCCCACAGATAGGCCTGCTCCCCCAAGAGAGGAAATTTATGAGTACATCATTTTTCGGGGAAGTGATATTAAAGATATTACTGTATGTGAACCTCCGAAAGCTCAGCACACACTCCCTCAGGATCCTGCTATCGTTCAGTCTTCCTTGGGCTCTGCCTCTGCCTCGCCCTTCCAGCCACATGTGCCTTATAGCCCCTTCAGAGGAATGCCGCCCTATGGCCAGCTGGCAGCCAGCTCCCTGCTCAGCCAGCAGTATGCATCTTCCTTAGGTCTAGAGAAGTTGGTAAGCCCTCCAGCCTCAGCCGCTGCTTCCAGTCCTAGTTCTTCTCCATCTCCACAGCCCGTTTCAGAGCTTGACATGTCCTCAGAGCCACCTCAGCTCACTTCCAAGGGAGCTGGTTTTCCATCTGCCCCAGTTGGCAAGAGCCCCATGGTGGAACAGGCTGTCCAGACTGGTTCTGTTGATAACCTGAATGCCAAAAAGCTGTTACCTGGCAAGGGCACCTCAGGGATGCAGCTCAGCGGTCGCCAGGCCCACCCAAGCAGCAAGACCACTGGTGGGAATCGGCGAACAAGGAATCGCTCCAGAGGGCAAAACCGTCCTACTAATGTCAAGGAAAACACAATCAAGTTTGAGGGAGACTTTGATTTTGAGAGTGCAAATGCCCAGTTCAACCGAGAAGAACTGGACAAAGAATTCAAGAAGAAACTAAATTTTAAAGAGGACAAGGCTGAGAAGGGGGAAGAGAAGGACCAGGCTGTGGTCACTCCGAGTGATGAAACTCCTGCTGAGGAAGACCTTCTGGGGCCCAACTGCTACTATGACAAATCCAAGTCCTTCTTCGACAATATCTCTTCTGAACTCAAGACCAGTTCTAGGCGGACAACATGGGCTGAAGAGAGGAAGCTGAATACAGAGACCTTTGGGGTATCAGGGAGGTTCCTTCGAGGCCGCACTTCCCGTGGAGGATTCCGAGGAGGCAGGGGCAATGGGACCACTCGGCGCAACCCTACTTCCCACAGAGCCGGGACTGGCAGGGTGTAA

XM_004840984.1 Coding sequence

Fam217b family with sequence similarity 217, member B, transcript variant X5

Length: 1122 bp    Location: 26208330..26215208   Strand: +
>XM_004840984.1
ATGAATGCTGGGCCATCTTGGAATAAAGTACAACTTTCAAAGGATTCTTCAGGAAAAAGACATAGTAAATCCCAAGTACCTCATCTGTCTTCCGGGCTGAGAGGCAGCCTTGTGGGCGTCTCTCAACCAGCTGCAGAGAAACTTAAAGAAGGCTTTCTTCCAGAAGGAAAACCAGAAGGGAATGTACTCAGCTCCATGTGCCAGGGAGCCTCAGGGAACAAATTGTTTCTTGACTTCCAGTCAATGAAAATTATTAAGGAAGGTGCTGACGAGGACAGTGCAAGTGATCTGTCAGACTCGGAGCGGATGCCGATTCCTCCTCCTCCCCTCACCCCGCCAGATCTAAATCTTCGAGCTGAGGAAATCGACCCAATTTACTTCGATCTTCACCCAAGTCAGAGCCATGCCAAGCCCGAGTACTGTTACCCCGATTTCCTGCCACCCCCTTTTAGCTCGTGGAACCTCCGGGAGATGGCAGTGCTTCTGAACACAGAGTACGAGGCCGAGCCCCGAGCCCGGGGCTTCCTTGGGAAGTACATCAACAGGCTCCTTCAGCTCGAGTGGCTGCAGATCCAGACTGTACAAGGTGAGAAGGGAAAGGGCTCCAAGGCCCGACCTCTGGCAGCCCAGGGGGCGCCCGGGGCTCTGAAAAGTCCTGGGAGAAGTAAACTAATTGCGAGTGGTCTGTCCAAGCCGCTGCCTCACCTGGAAGGGGCTTCAAAGTCAGGCCCTGCACAAAAGCAAGGTTTTCGCTTTGAAGAAACACGTCCATCCTATTACGCCTTTGAGACCTCCCCCAGGTCCCCTGAGGCCAGCACCAGGCTACATCCCCTCCAGCAAACCCCCGAAATGAGGACTAAAGAGAAGAAAAAGAAATCCAGTAAAAGCACCAAGATGCAGCACAGGGATTTTTCTTGCAGCGACAGCAGCTCCAAACTGGAAGCCAGTGGGAATATCCGAGTTCCCGAACAGCCAGCAACGATTCTGGACTCTTGCAGAACACAAGCACATGGGAATCTTAAGAAAAAGGGGACTGCAAACAGCTGTGCTCATACAACAATATCCAGTGAGAAGAAACTCAAAACAAATGGAGCAAAGCAAAACTCATACAAATTAAAATAA

XM_004840981.1 Coding sequence

Fam217b family with sequence similarity 217, member B, transcript variant X2

Length: 1413 bp    Location: 26209618..26215208   Strand: +
>XM_004840981.1
ATGTGGAAAAAACATAAGTGCAAAACCAGCCCAGTACTGGAAACAGGACCATGTGTGATCAGTACTTACTGTCCGTATTCTGTTGCCTCTAGTTCTGGTGATGCTGAGTACTTTGCGAATATAAAAGGAGTAAAGAAGTCACCTTCTTCGTTGTCATATTCCAACAGATCTAGCAAGAATATTTTGAACACTACAGAAAAGACAGTTCATCAAACTTTTGATGATGATCGGCCATGTAATTTTTTCAAGAAGAGGAGTAGGGTGAATGAATCTCATCAGAAAAACAGCAATATGAATGCTGGGCCATCTTGGAATAAAGTACAACTTTCAAAGGATTCTTCAGGAAAAAGACATAGTAAATCCCAAGTACCTCATCTGTCTTCCGGGCTGAGAGGCAGCCTTGTGGGCGTCTCTCAACCAGCTGCAGAGAAACTTAAAGAAGGCTTTCTTCCAGAAGGAAAACCAGAAGGGAATGTACTCAGCTCCATGTGCCAGGGAGCCTCAGGGAACAAATTGTTTCTTGACTTCCAGTCAATGAAAATTATTAAGGAAGGTGCTGACGAGGACAGTGCAAGTGATCTGTCAGACTCGGAGCGGATGCCGATTCCTCCTCCTCCCCTCACCCCGCCAGATCTAAATCTTCGAGCTGAGGAAATCGACCCAATTTACTTCGATCTTCACCCAAGTCAGAGCCATGCCAAGCCCGAGTACTGTTACCCCGATTTCCTGCCACCCCCTTTTAGCTCGTGGAACCTCCGGGAGATGGCAGTGCTTCTGAACACAGAGTACGAGGCCGAGCCCCGAGCCCGGGGCTTCCTTGGGAAGTACATCAACAGGCTCCTTCAGCTCGAGTGGCTGCAGATCCAGACTGTACAAGGTGAGAAGGGAAAGGGCTCCAAGGCCCGACCTCTGGCAGCCCAGGGGGCGCCCGGGGCTCTGAAAAGTCCTGGGAGAAGTAAACTAATTGCGAGTGGTCTGTCCAAGCCGCTGCCTCACCTGGAAGGGGCTTCAAAGTCAGGCCCTGCACAAAAGCAAGGTTTTCGCTTTGAAGAAACACGTCCATCCTATTACGCCTTTGAGACCTCCCCCAGGTCCCCTGAGGCCAGCACCAGGCTACATCCCCTCCAGCAAACCCCCGAAATGAGGACTAAAGAGAAGAAAAAGAAATCCAGTAAAAGCACCAAGATGCAGCACAGGGATTTTTCTTGCAGCGACAGCAGCTCCAAACTGGAAGCCAGTGGGAATATCCGAGTTCCCGAACAGCCAGCAACGATTCTGGACTCTTGCAGAACACAAGCACATGGGAATCTTAAGAAAAAGGGGACTGCAAACAGCTGTGCTCATACAACAATATCCAGTGAGAAGAAACTCAAAACAAATGGAGCAAAGCAAAACTCATACAAATTAAAATAA

XM_004840978.1 Coding sequence

Phactr3 phosphatase and actin regulator 3, transcript variant X3

Length: 1560 bp    Location: 25968247..26115192   Strand: +
>XM_004840978.1
ATGGACCGAATGCCCCCAGCGCGCTCGGAGTATCCGGTCTCAGGGATCCGAACCCCCCCAGTGAGAAGGAACAGCAGGCTGGCCACCCTGGGCCGCATCTTCAAGCCCTGGAAGTGGAGGAAAAAGAAAAATGAAAAGCTGAAGCAGACGACGTCAGCTCTGGAGAAGAAGATGGCCAGCAGGCAAGGCCGGGAGGAGCTCATCAAGCAGGGGCTGCTGGAGATGATGGAGCAGGATGCTGAAAGCAAAGTGTGCAGCCCTGGTGGAGGCCTCCGACCCACACAAAGCGAACCATCCACTCCCCAGCCAGAGGCCCTGACTTCAGAAGATGCCCAGCCGGGAAGCCCCTCTGCCACTGCTGGGGCAAACCAGGCCTCCCTGGATGAGCCACTGTCCTCAGACGCCCACTCGGACAATGCAGCCAAATTGCCTTCTGTGTCCAGTGGGGACGAAGCGGACGCTGGGAGCCTCCTGTCCGCCCCTGACGAGCTCTCTCAAGCCTTAGCTGGGTCCGACTCCTTGGACAGCCCTGCCAGAGCCCTGGAGAGGTGCGTGGGTCAGCTCCCCAGCGCTCCGCTGCTGCCCACACCGCCGCCCAAGGCAAGCTCCAAAACCACAAGAAACGTCACAGGACAAGCTGCGCTCTTCCAAGGTTCCGGTGTGAAAAGCAGCGACCCGGGCCTCCGAGGACAGCTGTCCACACCCACGGGGTCCCCCCACCTCACTACCATCCACCGGCCACTGCCGCCCAGCCGTGTCATAGAGGAGCTGCACAGGGCGCTGGCCACGAAGCACCGCCAGGACAGTTTTCAAGGGCGGGAAAGCAAAGGGTCTCCCAAGAAGCGGGTGGACATCCATCTCTCAAGAACGTCCAGCATGGAGCGGGGCGAGGAGACAGAGGAGGCATGGAGCTTTGATGGGGCCTTGGAGAGCAAGCGGACTGCAGCTAAAGAGTCTGAGGAGAACAAGGAGAACTTGATCATGAGTTCCGAGCTCAAGGATGACTTGCTTTTGTATCAGGACGAAGAGGCACTGAATGACTCCATCATTTCTGGAACACTGCCCAGGAGATGCAAGAAGGAGCTACTGGCGGTGAAGCTGAGGAATCGGCCGAGCAAGCAGGAGCTGGAGGACCGGAACATTTTCCCCAGGAGGACTGATGAAGAAAGACAGGAAATCCGGCAGCAGATCGAACTGAAACTGTCCAAACGACTGAGCCAACGACCTGCTGTGGAGGAGCTGGAGAGAAGAAATATCCTGAAACAAAGGAATGATCAGACAGAACAGGAAGAAAGAAGAGAAATCAAGCAAAGATTAACAAGAAAGCTTAATCAGAGACCCACTGTTGATGAATTAAGAGACAGAAAAATTCTGATACGTTTCAGTGATTATGTGGAAGTAGCAAAAGCGCAGGACTATGACAGGAGGGCAGACAAACCCTGGACAAGACTGTCAGCAGCAGATAAGGCAGCAATTCGTAAAGAATTAAATGAATACAAAAGTAATGAAATGGAAGTACATGCATCAAGCAAGCATTTGACAAGATTCCACAGGCCATAG

XM_004840975.1 Coding sequence

Edn3 endothelin 3

High confidence: 4 potential gene matches
Length: 552 bp    Location: 25658884..25680763   Strand: +
>XM_004840975.1
ATGGAGCCGGGGCTGTGGCTCCTTTTCGGGCTCACAGTGATCTCCGCCGCAGGATTCCGGCCGTGCCCTCAGACTGGGGGCTCTGGCAGGACCAGCGCGCTTCCGGGCCCCCCTGCAGCCAGATCTGAGGGGGACTGCGAAGAAACTGTGCTCGGCCTCAGCGAGGGGACGGGGGCCCCAGCGGCGGCGCAGGGCCCAAGTCCTGGAAAATCTGGGCAGGAGCTGGGAGTGGAGGGGGGCCCTGTGCACCACCGTGCCCGGCGCTGCACGTGCTTCACCTACAAGGACAAGGAGTGTGTCTACTACTGCCACCTGGACATCATCTGGATCAACACTCCCGAACGGACTGTGCCCTATGGACTGTCCAACTACAGAGGAAGCTTCCGGGGCAAGAGGTCCTCAGGGCCTTTTCCAGGGAGCTCACAGGCCTCGCTGCAGACCCACTTGCGCTGTGCATGCCTGGGGTCCGACGACAAGGCCTGTGTGCGGTTCTGCACGCAGACGTGGGATGGCCGCAGTAATTCCAGGACAGCAGAAAACGCAGACAAATAA

XM_004840940.1 Coding sequence

Vapb VAMP (vesicle-associated membrane protein)-associated protein B and C, transcript variant X2

Length: 450 bp    Location: 24716775..24767805   Strand: +
>XM_004840940.1
ATGGCGAAGGTGGAGCAGGTTCTGAGCCTCGAGCCGCAGCACGAGCTCAAGTTCCGAGGTCCCTTCACTGATGTCGTTACCGCCAACCTGAAGCTTGGCAACCCAACAGATCGAAATGTGTGTTTTAAAGTGAAGACCACAGCACCTCGTAGGTATTGCGTTCGGCCCAACAGTGGAATCATTGACGCTGGGGCCTCAATCAATGTATCTGGAAGAAGATGGGCTTCGGATGAGGAAGACAGTACAGAGCCACAGCCCCATTGCAGCACTTGCTGCAACTGGGAAGGAGGAAGGCCTCAGCACTCGGCTACTGGCTCTGGTGGTTTTGTTCTTTATTGTTGGTGTCATTATAGGGAAGATTGCCTTGTAAAGGCAGCATGCAGTGGATGGCAAATTGGATTGATGGATGCACCGTATCATGGGATTCAAGTTTATCATAACCATGTGTAA

XM_004840965.1 Coding sequence

LOC101719318 negative elongation factor D-like, transcript variant X2

Length: 1749 bp    Location: 25267379..25280844   Strand: +
>XM_004840965.1
ATGGCTGAAGACTACTTCGGGAATACCGCGGAGTGGGGCGAGGAGGCGGACGGCGGCCAGCAGCAGGAAGATGATTCTGGAGAAGGAGAAGACGATGCAGAGGTGCAACAGGAATGCCTGCATAAGTTTTCCACCCGGGATTATATCATGGAGCCCTCCATCTTCAACACTTTGAAGAGGTATTTTCAGGCAGGGGGATCTCCGGAGAATGTCATCCAGCTCTTATCTGAGAACTACACTGCTGTGGCCCAGACTGTGAACCTGCTGGCCGAGTGGCTCATTCAGACAGGTGTTGAGCCAGTGCAGGTTCAGGAAACTGTGGAAAATCACTTGAAGAGTTTATTAATCAAACATTTTGACCCACGCAAAGCAGATTCTATTTTTACAGAAGAAGGAGAGACCCCAGCTTGGCTTGAACAAATGATTGCACACACCACTTGGAGAGATCTCTTTTACAAGCTGGCTGAAGCTCATCCAGACTGTTTGATGCTCAACTTTACTGTTAAGCTGATCTCCGATGCAGGGTACCAAGGGGAGATCACCAGTGTGTCCACTGCTTGTCAGCAGTTGGAAGTGTTCTCTAGAGTGCTACGAACCTCACTAGCCACAATCTTGGATGGAGGAGAAGAAAACCTTGAAAAAAATCTTCCCGAGTTTGCTAAGATGGTGTGCCACGGGGAGCACACGTACCTGTTTGCCCAGGCCATGATGTCCGTGCTGGCTCAGGAGGAGCAGGGTGGCTCTGCGGTACGCAGGGTTGCACAAGAGGTGCAGCGCTTCGCCCAGGAGAAAGGCCATGACGCCAGTCAGATCACACTGGCCTTGGGCACAGCCGCCTCGTACCCCCGTGCCTGCCAGGCCCTCGGGGCCATGCTGTCCAAAGGAGCCCTGAACCCTGCAGACATCACAGTCCTGTTCAAGATGTTCACGAGCATGGACCCTCCTCCCGTTGAACTCATCCGGGTTCCGGCCTTCCTGGACCTGTTCATGCAGTCTCTCTTCAAACCAGGCGCCCGGATCAACCAGGACCACAAACACAAGTACATCCACATCTTGGCTTACGCAGCAAGTGTGGTTGAGACATGGAAGAAGAACAAGCGGGTGAGCATCAATAAAGATGAGCTGAAGTCAACTTCGAAAGCGGTGGAAACAGTTCACAATTTATGTTGCAATGAGAACAAAGGGGCCTCTGAACTTGTGGCAGAACTGAGCACACTTTATCAGTGTATTAGGTTTCCAGTGGTAGCAATGGGTGTGCTGAAGTGGGTGGATTGGACTGTGTCAGAGCCCAGGTACTTCCAGCTGCAGACTGACCATACTCCAGTGCACCTGGCGTTGCTGGACGAGATCAGCACCTGCCACCAGCTCCTGCACCCCCAGGTTCTGCAACTGCTTGTTAAGCTCTTTGAGACTGAGCATTCCCAGCTGGACGTGATGGAGCAGCTCGAGCTGAAGAAGACCCTGCTGGACCGGATGGTTCACCTGCTGAGCCGAGGTTATGTACTTCCTGTTGTCAGTTACATCCGACAGTGTCTGGAGGAGCTGGACACTGACATTTCACTCATTCGCTATTTTGTCACTGAGGTGCTGGATGTTATTGCTCCTCCATACACCTCGGACTTTGTGCAGCTCTTCCTCCCCATCTTGGAAAATGACAGCATTGCAGGCACCATCAAAACAGAAGGCGAACATGACCCTGTGACAGAATTTATTGCTCACTGCAAGTCTAACTTCATCATGGTGAACTAA

XM_004840966.1 Coding sequence

LOC101719318 negative elongation factor D-like, transcript variant X3

Length: 1602 bp    Location: 25267499..25280844   Strand: +
>XM_004840966.1
ATGGAGCCCTCCATCTTCAACACTTTGAAGAGGTATTTTCAGGCAGGGGGATCTCCGGAGAATGTCATCCAGCTCTTATCTGAGAACTACACTGCTGTGGCCCAGACTGTGAACCTGCTGGCCGAGTGGCTCATTCAGACAGGTGTTGAGCCAGTGCAGGTTCAGGAAACTGTGGAAAATCACTTGAAGAGTTTATTAATCAAACATTTTGACCCACGCAAAGCAGATTCTATTTTTACAGAAGAAGGAGAGACCCCAGCTTGGCTTGAACAAATGATTGCACACACCACTTGGAGAGATCTCTTTTACAAGCTGGCTGAAGCTCATCCAGACTGTTTGATGCTCAACTTTACTGTTAAGCTGATCTCCGATGCAGGGTACCAAGGGGAGATCACCAGTGTGTCCACTGCTTGTCAGCAGTTGGAAGTGTTCTCTAGAGTGCTACGAACCTCACTAGCCACAATCTTGGATGGAGGAGAAGAAAACCTTGAAAAAAATCTTCCCGAGTTTGCTAAGATGGTGTGCCACGGGGAGCACACGTACCTGTTTGCCCAGGCCATGATGTCCGTGCTGGCTCAGGAGGAGCAGGGTGGCTCTGCGGTACGCAGGGTTGCACAAGAGGTGCAGCGCTTCGCCCAGGAGAAAGGCCATGACGCCAGTCAGATCACACTGGCCTTGGGCACAGCCGCCTCGTACCCCCGTGCCTGCCAGGCCCTCGGGGCCATGCTGTCCAAAGGAGCCCTGAACCCTGCAGACATCACAGTCCTGTTCAAGATGTTCACGAGCATGGACCCTCCTCCCGTTGAACTCATCCGGGTTCCGGCCTTCCTGGACCTGTTCATGCAGTCTCTCTTCAAACCAGGCGCCCGGATCAACCAGGACCACAAACACAAGTACATCCACATCTTGGCTTACGCAGCAAGTGTGGTTGAGACATGGAAGAAGAACAAGCGGGTGAGCATCAATAAAGATGAGCTGAAGTCAACTTCGAAAGCGGTGGAAACAGTTCACAATTTATGTTGCAATGAGAACAAAGGGGCCTCTGAACTTGTGGCAGAACTGAGCACACTTTATCAGTGTATTAGGTTTCCAGTGGTAGCAATGGGTGTGCTGAAGTGGGTGGATTGGACTGTGTCAGAGCCCAGGTACTTCCAGCTGCAGACTGACCATACTCCAGTGCACCTGGCGTTGCTGGACGAGATCAGCACCTGCCACCAGCTCCTGCACCCCCAGGTTCTGCAACTGCTTGTTAAGCTCTTTGAGACTGAGCATTCCCAGCTGGACGTGATGGAGCAGCTCGAGCTGAAGAAGACCCTGCTGGACCGGATGGTTCACCTGCTGAGCCGAGGTTATGTACTTCCTGTTGTCAGTTACATCCGACAGTGTCTGGAGGAGCTGGACACTGACATTTCACTCATTCGCTATTTTGTCACTGAGGTGCTGGATGTTATTGCTCCTCCATACACCTCGGACTTTGTGCAGCTCTTCCTCCCCATCTTGGAAAATGACAGCATTGCAGGCACCATCAAAACAGAAGGCGAACATGACCCTGTGACAGAATTTATTGCTCACTGCAAGTCTAACTTCATCATGGTGAACTAA

XM_004840962.1 Coding sequence

Gnas GNAS complex locus, transcript variant X8

Length: 1011 bp    Location: 25177254..25197183   Strand: +
>XM_004840962.1
ATGAGGATCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCGCAAGCTGCAAGGAGCAACAGCGAAGGTAGTGAGAAGGCCACCAAAGTACAGGACATCAAAAACAACCTGAAGGAGGCTATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCCGTGGAGCTGGCCAACCCTGAGAACCAGTTCAGAGTGGACTACATTCTGAGCGTGATGAACGTGCCCGACTTTGACTTCCCGCCTGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGATGAAGGGGTGCGAGCCTGCTACGAGCGCTCCAACGAGTACCAGCTGATCGACTGTGCCCAGTACTTTCTGGACAAGATCGATGTCATCAAGCAGGCCGACTACGTGCCCAGCGACCAGGACCTGCTTCGCTGCCGTGTCCTGACCTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTCAACTTCCACATGTTCGATGTGGGCGGCCAGCGTGATGAACGGCGCAAATGGATCCAGTGCTTCAATGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTCATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATCTGGAACAACAGATGGCTGCGTACCATCTCTGTGATTCTGTTCCTCAATAAGCAAGATCTTCTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCTCGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGTGTGACCCGGGCCAAGTACTTCATTCGAGATGAGTTTCTGAGAATCAGCACTGCTAGTGGAGATGGGCGCCACTATTGCTATCCTCACTTTACCTGCGCTGTGGACACCGAGAACATTCGCCGTGTGTTCAACGACTGCCGCGACATCATCCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA

XM_004840956.1 Coding sequence

Gnas GNAS complex locus, transcript variant X2

Length: 2850 bp    Location: 25138693..25197188   Strand: +
>XM_004840956.1
ATGGGCATGCGCAACTGCCTCCACGGCAGTAATATGCCAGGACAATGCAATATCCCCGCCCAGATCGGGGAACAGCCCGAACAGCACCCTGTGGAGGCCCCAGGGGAAGCTGCCCCCGGTGCTGGGCCTGGCCCAGCCGAAGAGATGGAGGCCCAACCGCCTTCCCATGAGCCCGTCCCGGTCGAGGTCGAAGGAGAGGCCTGCGGACTCCCAGAGGTCTCCGGCCCCGGCGTCCAGGCAGCCGAGGAAGATCGAGTCTGTGGAAACTACAGCCCCGCACCAGAAGAAGCTGTGCCATTTGAGTTGGACCAGCCTGCGCAGGGAGGCTGTGGCCAACCTGTCTTGCAGATCCCAGACCTTGCTCCAGGCGGTCCATGTGCAGTGGTCCCCCGAGACCCTCCCGACGAGCCTCGATCCCTCAGTCCCAAAAATGCTGGCTTCAGAGGAGGATATAGCCCTCTCCCTGAGGAGGCTGTGCCATTTGAACTTGAAGGAGAAGCATTTGGGGACAGCAGCCCACGCCCCGGCTTGCCCCGAGTTATCCCGCAAGTCGGTGGTGGTCGGCTTTTCGCGGCTGTCGCAGTCCCGAGTTCGGTCTGGCTCGCTCCCGCCGCAAACGCGCCTGCCCTGCGGGTCGGAGGCGCCGGCGGAAGCCCCTCCCGAGAGGCTGTCAGATCTCCTCTCAACTTCCCGGGCGACGGCCCCCCGATGCAGATCTCCGGACCCCCAATCAAGATTGGTAGATCTCCCACTGGGGTCGACGACACTCCCGTCAATGCGGACATCCCCCCAATCGCGAGACACGGCCCGCCCATCGAAGTCTCGGGAGCCCCAGATAAGAGAGAGCCCCCAGAGGGACCCCCAGTCGGGAGAGACGCAGCCGCGATGGAAGGAGGCTCCCCTGGCGCCACTGCGGAAGGGGGGAAAGTCCCCTCTCCGGGGGACGGAGGCGCTGCCGCCAGGGCAGCCGCTGCCGCGCCAGCAGAGCCCGACTCCGGGGCAGCCGCTGCCGCGCCAAGCGAGCCTGCCACCCCGGCTGATCCCGACTCCGGGGGAGCCCCTGCCGCCCGGGCCGAGGCTGCTGCACCAGCCAATCCCGGCCCCAGGGCAGCCCGCGCCGCCCCAGCCGATCCTGAAGTCCGGCGAGCCCCGGCCGGAGCGGCCGCACTGGGAGCCCCTGCCGCCCGAGCCGGTCCTGCTCTCGGATCCGTCTCAGCAGCGCTCGCTGCCCGTGGAGCGCCCATCGCCCGCGGGGCACCCATCGCCCGGGCGGCGCCCAATGCCGGGCCCGCCTCCTTCGCCCCTGCCTCTGGGGCCAGCCGCAAGCTCCATCTCCTCAGACCCCCCAGCCCCGAGATCCAGGCTGCTGACCCGCCTACTCCGGAGCCTGCTCGGGCGACTGCCTGGCGGGCCAAATCCGAGTGCGGCAGCGGCCATCTCCGGTACGCAGATGAGGGTCAGGTTTGCGACGACTCTTCCAGCGACGAGTCCGATGCCCGGACCACCGGATGCTTCCACTGCTGCCTGCGCCGAAACCGCCACCGAAAGGTTCGGCACAGCTTACTCCGCAACTTTCTCTCCCGGGCTTTGTCGCGCTGCTTCCGTAGAGGCAGGGGCTCCAGAGCCGCGAACCTCTCCAAGGTCAAGAAGGACTCTCTGGGCGACAAGCGCAGGCAGATGTGCAAAGAAGCCATTGAGATGCGCGTCCAGAAGCGCGCCGCGAAGAAGCGCAGCAAGCTCATCGACAAGCAACTCGAGGACGAGAAGATGGGCTTTGTGTGCACGCACCGCCTCTTCCTTCTAGGTGCTGGAGAATCTGGTAAAAGCACCATTGTGAAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCGCAAGCTGCAAGGAGCAACAGCGAAGGTGAGAAGGCCACCAAAGTACAGGACATCAAAAACAACCTGAAGGAGGCTATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCCGTGGAGCTGGCCAACCCTGAGAACCAGTTCAGAGTGGACTACATTCTGAGCGTGATGAACGTGCCCGACTTTGACTTCCCGCCTGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGATGAAGGGGTGCGAGCCTGCTACGAGCGCTCCAACGAGTACCAGCTGATCGACTGTGCCCAGTACTTTCTGGACAAGATCGATGTCATCAAGCAGGCCGACTACGTGCCCAGCGACCAGGACCTGCTTCGCTGCCGTGTCCTGACCTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTCAACTTCCACATGTTCGATGTGGGCGGCCAGCGTGATGAACGGCGCAAATGGATCCAGTGCTTCAATGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTCATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATCTGGAACAACAGATGGCTGCGTACCATCTCTGTGATTCTGTTCCTCAATAAGCAAGATCTTCTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCTCGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGTGTGACCCGGGCCAAGTACTTCATTCGAGATGAGTTTCTGAGAATCAGCACTGCTAGTGGAGATGGGCGCCACTATTGCTATCCTCACTTTACCTGCGCTGTGGACACCGAGAACATTCGCCGTGTGTTCAACGACTGCCGCGACATCATCCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA

XM_004840957.1 Coding sequence

Gnas GNAS complex locus, transcript variant X3

Length: 2805 bp    Location: 25138693..25197188   Strand: +
>XM_004840957.1
ATGGGCATGCGCAACTGCCTCCACGGCAGTAATATGCCAGGACAATGCAATATCCCCGCCCAGATCGGGGAACAGCCCGAACAGCACCCTGTGGAGGCCCCAGGGGAAGCTGCCCCCGGTGCTGGGCCTGGCCCAGCCGAAGAGATGGAGGCCCAACCGCCTTCCCATGAGCCCGTCCCGGTCGAGGTCGAAGGAGAGGCCTGCGGACTCCCAGAGGTCTCCGGCCCCGGCGTCCAGGCAGCCGAGGAAGATCGAGTCTGTGGAAACTACAGCCCCGCACCAGAAGAAGCTGTGCCATTTGAGTTGGACCAGCCTGCGCAGGGAGGCTGTGGCCAACCTGTCTTGCAGATCCCAGACCTTGCTCCAGGCGGTCCATGTGCAGTGGTCCCCCGAGACCCTCCCGACGAGCCTCGATCCCTCAGTCCCAAAAATGCTGGCTTCAGAGGAGGATATAGCCCTCTCCCTGAGGAGGCTGTGCCATTTGAACTTGAAGGAGAAGCATTTGGGGACAGCAGCCCACGCCCCGGCTTGCCCCGAGTTATCCCGCAAGTCGGTGGTGGTCGGCTTTTCGCGGCTGTCGCAGTCCCGAGTTCGGTCTGGCTCGCTCCCGCCGCAAACGCGCCTGCCCTGCGGGTCGGAGGCGCCGGCGGAAGCCCCTCCCGAGAGGCTGTCAGATCTCCTCTCAACTTCCCGGGCGACGGCCCCCCGATGCAGATCTCCGGACCCCCAATCAAGATTGGTAGATCTCCCACTGGGGTCGACGACACTCCCGTCAATGCGGACATCCCCCCAATCGCGAGACACGGCCCGCCCATCGAAGTCTCGGGAGCCCCAGATAAGAGAGAGCCCCCAGAGGGACCCCCAGTCGGGAGAGACGCAGCCGCGATGGAAGGAGGCTCCCCTGGCGCCACTGCGGAAGGGGGGAAAGTCCCCTCTCCGGGGGACGGAGGCGCTGCCGCCAGGGCAGCCGCTGCCGCGCCAGCAGAGCCCGACTCCGGGGCAGCCGCTGCCGCGCCAAGCGAGCCTGCCACCCCGGCTGATCCCGACTCCGGGGGAGCCCCTGCCGCCCGGGCCGAGGCTGCTGCACCAGCCAATCCCGGCCCCAGGGCAGCCCGCGCCGCCCCAGCCGATCCTGAAGTCCGGCGAGCCCCGGCCGGAGCGGCCGCACTGGGAGCCCCTGCCGCCCGAGCCGGTCCTGCTCTCGGATCCGTCTCAGCAGCGCTCGCTGCCCGTGGAGCGCCCATCGCCCGCGGGGCACCCATCGCCCGGGCGGCGCCCAATGCCGGGCCCGCCTCCTTCGCCCCTGCCTCTGGGGCCAGCCGCAAGCTCCATCTCCTCAGACCCCCCAGCCCCGAGATCCAGGCTGCTGACCCGCCTACTCCGGAGCCTGCTCGGGCGACTGCCTGGCGGGCCAAATCCGAGTGCGGCAGCGGCCATCTCCGGTACGCAGATGAGGGTCAGGTTTGCGACGACTCTTCCAGCGACGAGTCCGATGCCCGGACCACCGGATGCTTCCACTGCTGCCTGCGCCGAAACCGCCACCGAAAGGTTCGGCACAGCTTACTCCGCAACTTTCTCTCCCGGGCTTTGTCGCGCTGCTTCCGTAGAGGCAGGGGCTCCAGAGCCGCGAACCTCTCCAAGGTCAAGAAGGACTCTCTGGGCGACAAGCGCAGGCAGATGTGCAAAGAAGCCATTGAGATGCGCGTCCAGAAGCGCGCCGCGAAGAAGCGCAGCAAGCTCATCGACAAGCAACTCGAGGACGAGAAGATGGGCTTTGTGTGCACGCACCGCCTCTTCCTTCTAGGTGCTGGAGAATCTGGTAAAAGCACCATTGTGAAGCAGATGAGGATCCTGCATGTTAATGGGTTTAATGGAGATGAGAAGGCCACCAAAGTACAGGACATCAAAAACAACCTGAAGGAGGCTATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCCGTGGAGCTGGCCAACCCTGAGAACCAGTTCAGAGTGGACTACATTCTGAGCGTGATGAACGTGCCCGACTTTGACTTCCCGCCTGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGATGAAGGGGTGCGAGCCTGCTACGAGCGCTCCAACGAGTACCAGCTGATCGACTGTGCCCAGTACTTTCTGGACAAGATCGATGTCATCAAGCAGGCCGACTACGTGCCCAGCGACCAGGACCTGCTTCGCTGCCGTGTCCTGACCTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTCAACTTCCACATGTTCGATGTGGGCGGCCAGCGTGATGAACGGCGCAAATGGATCCAGTGCTTCAATGATGTGACTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTCATCCGGGAGGACAACCAGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATCTGGAACAACAGATGGCTGCGTACCATCTCTGTGATTCTGTTCCTCAATAAGCAAGATCTTCTCGCTGAGAAAGTCCTTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCTCGCTACACTACTCCTGAGGATGCTACTCCCGAGCCCGGAGAGGACCCACGTGTGACCCGGGCCAAGTACTTCATTCGAGATGAGTTTCTGAGAATCAGCACTGCTAGTGGAGATGGGCGCCACTATTGCTATCCTCACTTTACCTGCGCTGTGGACACCGAGAACATTCGCCGTGTGTTCAACGACTGCCGCGACATCATCCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAA

XM_004840919.1 Coding sequence

Cst8 cystatin 8 (cystatin-related epididymal specific), transcript variant X3

Length: 357 bp    Location: 23125604..23128657   Strand: +
>XM_004840919.1
ATGACCAGATCCTGGGGACTGTCCTTGCTCCTCCTCACCATCCCAGTGGCCCTGGTGACCAGCGCAGACCCAGCCAAGAACATAGTGAAGATTTTGAGGCCATTCAAATCCATTGAGTTTTCGGATGCAAACATGAGGCAGTGCCTATGGTTTGCCATGCAGGAATACAACAAAGAGAGTGAGGACAAGTACATCTTCCTCGTGAGCCAGATCCAGCTGGCCCAGATGCAGATCACAGACCATATGGAATACATAATTGAGGTTGAAATTGCCCGAAGCAATTGCAGAAAGCCTCTAAGCAACAATGAGAACTGTGTCATTCAAAAAAACTTCAACCTGGAAAAGCCTCCGGGATAA

XM_004840947.1 Coding sequence

Stx16 syntaxin 16, transcript variant X7

Length: 954 bp    Location: 24951985..24974378   Strand: +
>XM_004840947.1
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGTTAGCCGAGCAACTTGCCGATGACCGTATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGGCTGGAGCATGCGCGTTTCCAGACGTGGGGGCTCTGCCTGGCAGCCAGGGAAGCTGCAGTGGAGAGAAGCGAGGCAGCAGAGGCTGAAGAGCGGGGTCCATAGCGTCTCCGCCAGCCTTTGCCCCAGCGGTAGATTCTGA

XM_004840944.1 Coding sequence

Stx16 syntaxin 16, transcript variant X4

Length: 969 bp    Location: 24951986..24977417   Strand: +
>XM_004840944.1
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGTTAGCCGAGCAAGTGAGTAGTCACACCACCTCCAGCCCTCTGCATTCACGTAGCATTGCTGCGCTTGCCGATGACCGTATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGCAGAGCAGTACCAAAAGAAGAATCGGAAGATGCTTGTGATTTTAATGCTGTTTGTCATCATCATTATCCTCATTGTTGTCCTTGTCGGTGTGAAGTCTCGCTAG

XM_004840948.1 Coding sequence

Stx16 syntaxin 16, transcript variant X8

Length: 930 bp    Location: 24951988..24977417   Strand: +
>XM_004840948.1
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGTTAGCCGAGCAAGAGCTGGACGAGCTTGCCGATGACCGTATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGCAGAGCAGTACCAAAAGAAGAATCGGAAGATGCTTGTGATTTTAATGCTGTTTGTCATCATCATTATCCTCATTGTTGTCCTTGTCGGTGTGAAGTCTCGCTAG

XM_004840949.1 Coding sequence

Stx16 syntaxin 16, transcript variant X9

Length: 918 bp    Location: 24951988..24977417   Strand: +
>XM_004840949.1
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGTTAGCCGAGCAACTTGCCGATGACCGTATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGCAGAGCAGTACCAAAAGAAGAATCGGAAGATGCTTGTGATTTTAATGCTGTTTGTCATCATCATTATCCTCATTGTTGTCCTTGTCGGTGTGAAGTCTCGCTAG

XM_004840945.1 Coding sequence

Stx16 syntaxin 16, transcript variant X5

Length: 969 bp    Location: 24966630..24974379   Strand: +
>XM_004840945.1
ATGGGGGGAGCGAACTTGCAGTATCATTTCAAAGCAAGGGACGATGTTGCTGGTGGCCAGCCAAGTGAGGAAAGAAATGACGGCCTTGGGGTCAAGCTTGCCGATGACCGTATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGGCTGGAGCATGCGCGTTTCCAGACGTGGGGGCTCTGCCTGGCAGCCAGGGAAGCTGCAGTGGAGAGAAGCGAGGCAGCAGAGGCTGAAGAGCGGGGTCCATAGCGTCTCCGCCAGCCTTTGCCCCAGCGGTAGATTCTGA

XM_004840937.1 Coding sequence

LOC101710030 serine/threonine-protein phosphatase 4 regulatory subunit 1-like, transcript variant X5

Length: 2502 bp    Location: 24636750..24544490   Strand: -
>XM_004840937.1
ATGGCGGAGATCCCCCTGTACTTTGTGGACTTGCAGGATGACTTAGACGACTATGGATTTGAAGACTATGGTCCAGATTGTGACAGTGTGAGGCTAACAGCCTTCTTGGACATCCCAGGCCAGGATGACCTGCCCCCACTTGCACGCCTGGAAAAGTATGCTTTCAGTGATAACATCTTCAACCGTCAGATTATTGCCGGAGGACTGCTTGATATCTTCCGGGACTTCAGTAACAATGAAGAAGACTTCTTAACAATAATGGAGATTGCAGTCAGATTGTCAGAAGATGCAGAGCCCACAGTACGGACTGAGCTGTTGGAACAGATTCCTGCTATTGGCATTTTTTTACGAGAAAACAGACCAGATTTTCCAGTGGTGTTTTCTGAATACCTCATACCTGTGGTAGTGAAGGGCCTTACGGACCCAGACAATCAGGTTAGAAAATCCAGTCAGGAAGTGCTGCTGATTCTTCTGGAACAAGATCTAATTTTCCAGGGAGATATTGAAAACAAAGTATGTTCGATTCTGCTGGAACTGTCTGCCCCAGAAAGTGACGATGAATACAGAGCAGAAGCCGTGAGTATGATCTGCAAAATGGCTGCAATGCTGAGTAAGAGCACAGTTGAGCGCCTGCTACTCCCTCGGTTCTGTGAGCTGTGTGGTGACAGGAAGCTCTTTCAAGTTCGGAAGGTGTGTGCTATGAATTTTGGTGATGTTTGTCATGCTGTTGGACAAGAAGCCACTGAGAAATTTTTGCTCCTCAGATTTTTCGAGCTCTGCTCAGATAACGTATGGGGTATGCGGAAAGCCTGTGCGGAATGCTTCATGGCTGTGTCCTACAACACCTCCCCTGAGGTCCGCAGAAGCCAGCTTTCACCTCTTTTCATCAGACTCCTCAGTGACCCCTGTCGCTGGGTGCGCCAGGCTGCCTTCCAGTCCCTTGGGCCCTTCATTTCCACCTTTGCAAACCCCTCCACGGCTGACCTGTACATTGGAGAGGACAGCACCCTGAGCATCCAGCCACCAAGCCAGGATCTGGAGGCTGACTTTGCCTCTGCCTCACCTAATCCCAGTGCTTGTGGTGATGCCTGCCCCACTAGTTCAACAAAGCCTGTGCAGACAGAGCCAGATCTACGTGTGGAAGGGACACGAGTAGAAACCAGTATTTTCCTGCATGGCGATAGCTCTTCCAACGGCCTAACAGAAAACCCAAAGGAAGGTCCTGCTTTGGCTGGAGCTGAGTTGACTAGGCTTTCCCCAGAGGCCAATGCCATCTTGGAACTCCCTTCTACTAACAACTTCCCTATCAGTAGCCACCCAGAGAACTCAGATGATGTATTCAGTAATGTCCTTTATTGGCGAACTCCTCTCCCTGACATCAGCAAAGACATGGAGCTGTTTCTGAGTGAGGCTGGCGCTCAGGAAGAGGGCTGTACAAGACCTGAGAGTGTGTACAACAGCTGTGTAGCCAGAAGTGAGATTCAGAAGGTCCTCAGGAGTTTACAGGAACATATGATCTGTGATCCAGATGTTCAAGCTCAGGTTCAGGTATTATCTGCTGCCCTGAGAGCTGCACAGCTGGACTCCACGAATGAACCTGAGAGCAGGCCACCAGAAGGTCTAAATGAAGTGTCCATTTCAGATCCCAGCTCTGCCCCTGACAATCAGATCCCTCCGTCAGCCTCATCATCTCAGAATGAGCTCTCTGTGGCAAGGATATTACAAAGCACAGATCCTGGTGATGTCCAAAATGGAGCCAGTGACCATTGGGAGACTCAGCAGAAGCCTGAACCAACCACACTTGAGGAGAATAAATCTAATTTACAGGATATAATTCCTCAGCCATTGCTGGATGAGTTCATGTCAATGACAGACCCTGCTCGAGCCCAGACCGTGGACACTGACATAGCCAAACAGTGTGCCTACAGCCTCCCCGGGGTGGCACTGGCCCTGGGGAGGCAGAACTGGCACTGTCTGAAAGGCACCTACGAAACACTGGCTTCTGATGTTCAGTGGAAGGTCCGTCGGACCCTCGCCTTCTCTATTCACGAGCTGGCTGCGATTCTTGGGGATCAGTTGACAGCAGCCGACCTGGTGCCCATCTTCAATGGATTTTTAAAGGATCTGGACGAAGTACGCATAGGAGTACTTAAACATCTGTATGATTTCCTAAAGTTGCTTCATGAAGACAAGAGGAGAGAATATCTTTATCAGCTTCAAGAATTTGTAGTGACCGATAACAGAAATTGGAGGTTTCGATATGAACTAGCAGAACAGCTGATACTAATTTTGGAACTCTATAACCCCAATGATGTTTATGATTATTTAATGCATATTGCCTTGAGATTATGTGCAGATAAAGTTTCTGAAGTTCGGTGGATCTCCTTCAAACTAGTTGTGGCAATTCTGCAGAAGTTCTATTCAAACAGCGAAAGTGCACTGGGGTTGAATTTCATCAATGAACTCATCCTAAGGTTCCGGCACTGCTCAAAGCCGTGGTGA

XM_004840941.1 Coding sequence

Stx16 syntaxin 16, transcript variant X1

Length: 1017 bp    Location: 24951983..24974379   Strand: +
>XM_004840941.1
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGTTAGCCGAGCAAGTGAGTAGTCACACCACCTCCAGCCCTCTGCATTCACGTAGCATTGCTGCGGAGCTGGACGAGCTTGCCGATGACCGTATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGGCTGGAGCATGCGCGTTTCCAGACGTGGGGGCTCTGCCTGGCAGCCAGGGAAGCTGCAGTGGAGAGAAGCGAGGCAGCAGAGGCTGAAGAGCGGGGTCCATAGCGTCTCCGCCAGCCTTTGCCCCAGCGGTAGATTCTGA

XM_004840935.1 Coding sequence

LOC101710030 serine/threonine-protein phosphatase 4 regulatory subunit 1-like, transcript variant X3

Length: 2724 bp    Location: 24636750..24540139   Strand: -
>XM_004840935.1
ATGGCGGAGATCCCCCTGTACTTTGTGGACTTGCAGGATGACTTAGACGACTATGGATTTGAAGACTATGGTCCAGATTGTGACAGTGTGAGGCTAACAGCCTTCTTGGACATCCCAGGCCAGGATGACCTGCCCCCACTTGCACGCCTGGAAAAGTATGCTTTCAGTGATAACATCTTCAACCGTCAGATTATTGCCGGAGGACTGCTTGATATCTTCCGGGACTTCAGTAACAATGAAGAAGACTTCTTAACAATAATGGAGATTGCAGTCAGATTGTCAGAAGATGCAGAGCCCACAGTACGGACTGAGCTGTTGGAACAGATTCCTGCTATTGGCATTTTTTTACGAGAAAACAGACCAGATTTTCCAGTGGTGTTTTCTGAATACCTCATACCTGTGGTAGTGAAGGGCCTTACGGACCCAGACAATCAGGTTAGAAAATCCAGTCAGGAAGTGCTGCTGATTCTTCTGGAACAAGATCTAATTTTCCAGGGAGATATTGAAAACAAAGTATGTTCGATTCTGCTGGAACTGTCTGCCCCAGAAAGTGACGATGAATACAGAGCAGAAGCCGTGAGTATGATCTGCAAAATGGCTGCAATGCTGAGTAAGAGCACAGTTGAGCGCCTGCTACTCCCTCGGTTCTGTGAGCTGTGTGGTGACAGGAAGCTCTTTCAAGTTCGGAAGGTGTGTGCTATGAATTTTGGTGATGTTTGTCATGCTGTTGGACAAGAAGCCACTGAGAAATTTTTGCTCCTCAGATTTTTCGAGCTCTGCTCAGATAACGTATGGGGTATGCGGAAAGCCTGTGCGGAATGCTTCATGGCTGTGTCCTACAACACCTCCCCTGAGGTCCGCAGAAGCCAGCTTTCACCTCTTTTCATCAGACTCCTCAGTGACCCCTGTCGCTGGGTGCGCCAGGCTGCCTTCCAGTCCCTTGGGCCCTTCATTTCCACCTTTGCAAACCCCTCCACGGCTGACCTGTACATTGGAGAGGACAGCACCCTGAGCATCCAGCCACCAAGCCAGGATCTGGAGGCTGACTTTGCCTCTGCCTCACCTAATCCCAGTGCTTGTGGTGATGCCTGCCCCACTAGTTCAACAAAGCCTGTGCAGACAGAGCCAGATCTACGTGTGGAAGGGACACGAGTAGAAACCAGTATTTTCCTGCATGGCGATAGCTCTTCCAACGGCCTAACAGAAAACCCAAAGGAAGGTCCTGCTTTGGCTGGAGCTGAGTTGACTAGGCTTTCCCCAGAGGCCAATGCCATCTTGGAACTCCCTTCTACTAACAACTTCCCTATCAGTAGCCACCCAGAGAACTCAGATGATGTATTCAGTAATGTCCTTTATTGGCGAACTCCTCTCCCTGACATCAGCAAAGACATGGAGCTGTTTCTGAGTGAGGCTGGCGCTCAGGAAGAGGGCTGTACAAGACCTGAGAGTGTGTACAACAGCTGTGTAGCCAGAAGTGAGATTCAGAAGGTCCTCAGGAGTTTACAGGAACATATGATCTGTGATCCAGATGTTCAAGATCCCAGCTCTGCCCCTGACAATCAGATCCCTCCGTCAGCCTCATCATCTCAGAATGAGCTCTCTGTGGCAAGGATATTACAAAGCACAGATCCTGGTGATGTCCAAAATGGAGCCAGTGACCATTGGGAGACTCAGCAGAAGCCTGAACCAACCACACTTGAGGAGAATAAATCTAATTTACAGGATATAATTCCTCAGCCATTGCTGGATGAGTTCATGTCAATGACAGACCCTGCTCGAGCCCAGACCGTGGACACTGACATAGCCAAACAGTGTGCCTACAGCCTCCCCGGGGTGGCACTGGCCCTGGGGAGGCAGAACTGGCACTGTCTGAAAGGCACCTACGAAACACTGGCTTCTGATGTTCAGTGGAAGGTCCGTCGGACCCTCGCCTTCTCTATTCACGAGCTGGCTGCGATTCTTGGGGATCAGTTGACAGCAGCCGACCTGGTGCCCATCTTCAATGGATTTTTAAAGGATCTGGACGAAGTACGCATAGGAGTACTTAAACATCTGTATGATTTCCTAAAGTTGCTTCATGAAGACAAGAGGAGAGAATATCTTTATCAGCTTCAAGAATTTGTAGTGACCGATAACAGAAATTGGAGGTTTCGATATGAACTAGCAGAACAGCTGATACTAATTTTGGAACTCTATAACCCCAATGATGTTTATGATTATTTAATGCATATTGCCTTGAGATTATGTGCAGATAAAGTTTCTGAAGTTCGGTGGATCTCCTTCAAACTAGTTGTGGCAATTCTGCAGAAGTTCTATTCAAACAGCGAAAGTGCACTGGGGTTGAATTTCATCAATGAACTCATCCTAAGGTTCCGGCACTGCTCAAAGTGGGTTGGAAGGCAAGCTTTCGCTTTCATTTGTCAGGCCGTGGTGAGTGAGGAGTGTGTCCCAGTGGACCAGTTTGTTGAGCACCTGCTTCCCAACCTCTTGAGCCTCAAGTCAGATCCTGTGCCCAACGTGAGGGTTCTGCTGGCCAAGGCTCTGCGGCAGACCTTGATGGCAAAGGCATATTTTAGAAATGCTGGTAACCCTCATCTTGAAGTTGTTGAAGAGACTGTCTTGGCTTTGCAGTCTGACCGGGACCAAGATGTTTCCTTTTTTGCCACTTTAGAACCAAAGCGGCAGAGTGTTATGGACACTACTGTTCTGGGAAAGCAGAGTTAG

XM_004840926.1 Coding sequence

Rae1 RAE1 RNA export 1 homolog (S. pombe), transcript variant X2

Length: 1107 bp    Location: 23803375..23825045   Strand: +
>XM_004840926.1
ATGAGTCTGTTCGGAACAACTTCTGGTTTTGGAACTGGTGGGACCAGCATGTTTGGCAGCACAACCACAGATAACCATAATCCTATGAAGGATATTGAAGTGACATCTTCTCCTGATGACAGCATCGGGTGTCTATCATTTAGCCCCCCAACCTTGCCGGGGAACTTTCTTGTTGCCGGATCGTGGGCTAATGATGTTCGCTGCTGGGAAGTTCAGGACAATGGGCAGACCATTCCAAAAGCCCAGCAAATGCACACTGGCCCCGTGCTTGACATCTGCTGGAGTGATGATGGAAGCAAAGTATTTACAGCATCGTGTGACAAAACTGCCAAAATGTGGGACCTCAACAGTAACCAAGCAATCCAGATAGCACAGCATGATGCACCTGTTAAAACCATACATTGGATCAAAGCTCCAAACTACAGCTGTGTGATGACCGGAAGCTGGGATAAGACTCTGAAGTTTTGGGATTCTCGGTCATCAAACCCTATGATGGTCTTGCAGCTCCCGGAGAGGTGTTACTGTGCTGACGTGATATATCCAATGGCTGTAGTGGCAACAGCAGAGAGGGGCCTAATCGTCTACCAGCTAGAAAATCAGCCTTCGGAGTTCAGGAGGATAGAGTCCCCGCTGAAGCACCAGCATCGCTGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGCTTCGCCCTGGGGAGCATTGAGGGGAGAGTTGCTATTCACTACATCAACCCCCCAAACCCTGCCAAAGATAATTTCACCTTTAAATGTCACCGATCCAATGGGACTAACACTTCAGCTCCCCAGGACATCTACGCGGTAAACGGAATCGCATTCCACCCTGTTCATGGCACCCTCGCAACCGTGGGCTCTGATGGTCGGTTCAGCTTCTGGGACAAAGATGCCCGAACAAAACTGAAGACTTCAGAACAGTTGGACCAGCCGATATCTGCGTGCTGCTTCAACCACAACGGCAACATATTCGCCTACGCGTCCAGCTACGACTGGTCCAAGGGACATGAATTTTATAATCCTCAGAAGAAAAATTACATTTTCCTGCGTAATGCAGCCGAAGAACTAAAGCCCAGGAATAAGAAGTAG

XM_004840925.1 Coding sequence

Rae1 RAE1 RNA export 1 homolog (S. pombe), transcript variant X1

Length: 1107 bp    Location: 23803381..23825045   Strand: +
>XM_004840925.1
ATGAGTCTGTTCGGAACAACTTCTGGTTTTGGAACTGGTGGGACCAGCATGTTTGGCAGCACAACCACAGATAACCATAATCCTATGAAGGATATTGAAGTGACATCTTCTCCTGATGACAGCATCGGGTGTCTATCATTTAGCCCCCCAACCTTGCCGGGGAACTTTCTTGTTGCCGGATCGTGGGCTAATGATGTTCGCTGCTGGGAAGTTCAGGACAATGGGCAGACCATTCCAAAAGCCCAGCAAATGCACACTGGCCCCGTGCTTGACATCTGCTGGAGTGATGATGGAAGCAAAGTATTTACAGCATCGTGTGACAAAACTGCCAAAATGTGGGACCTCAACAGTAACCAAGCAATCCAGATAGCACAGCATGATGCACCTGTTAAAACCATACATTGGATCAAAGCTCCAAACTACAGCTGTGTGATGACCGGAAGCTGGGATAAGACTCTGAAGTTTTGGGATTCTCGGTCATCAAACCCTATGATGGTCTTGCAGCTCCCGGAGAGGTGTTACTGTGCTGACGTGATATATCCAATGGCTGTAGTGGCAACAGCAGAGAGGGGCCTAATCGTCTACCAGCTAGAAAATCAGCCTTCGGAGTTCAGGAGGATAGAGTCCCCGCTGAAGCACCAGCATCGCTGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGCTTCGCCCTGGGGAGCATTGAGGGGAGAGTTGCTATTCACTACATCAACCCCCCAAACCCTGCCAAAGATAATTTCACCTTTAAATGTCACCGATCCAATGGGACTAACACTTCAGCTCCCCAGGACATCTACGCGGTAAACGGAATCGCATTCCACCCTGTTCATGGCACCCTCGCAACCGTGGGCTCTGATGGTCGGTTCAGCTTCTGGGACAAAGATGCCCGAACAAAACTGAAGACTTCAGAACAGTTGGACCAGCCGATATCTGCGTGCTGCTTCAACCACAACGGCAACATATTCGCCTACGCGTCCAGCTACGACTGGTCCAAGGGACATGAATTTTATAATCCTCAGAAGAAAAATTACATTTTCCTGCGTAATGCAGCCGAAGAACTAAAGCCCAGGAATAAGAAGTAG

XM_004840924.1 Coding sequence

Spo11 SPO11 meiotic protein covalently bound to DSB, transcript variant X2

Length: 1077 bp    Location: 23784436..23799372   Strand: +
>XM_004840924.1
ATGGCGTTTGCACCCATGGGTCCGGAGGCCTCGTTCTTTGAGGTCCTCGACCGACATAGAGCTTCCCTGTTGGCCGCCCTGAGTAAAGGCAGTCCAGAGCCCCCTGTCCAAGGGACTCGCACGGCCTCTAGGTTTGACGACACTGTGGGCCTTCAGATGGTATCCCACTGTACCACGAGAAAAATCAAAAGTGATTCACCAAAATCAGTTAAAAAATTTGCTCTAATTCTTAAAATATTATCCATGATCTATAAATTGGTACAGAGCAACACCTATGCAACGAAAAGAGACATATATTACACTGACAGCCAGCTCTTTGGTAATCAGTCTGTTGTGGACAATATTATTGATGACATTTCTTGTATGCTGAAAGTGCCACGGAGGAGTCTACATATATTATCGACATCCAAAGGGTTAATCGCTGGCAGTCTGAGGTTCACTGAAGAAGATGGCACCAGAGTGAGCTGTGCCTGTGGCGCTTCTGCTATTGCTGTGCCATCTAATATTCAAGGACTTCGGAACTTAATTACAGATGCAAAATTTCTGTTAATTGTAGAAAAAGATGCAACATTTCAGCGGCTCCTAGATGACAACTTCTGCAACAAAATGTCGCCATGCATCATGGTGACGGGAAAAGGTATACCTGATCTGAACACGAGACTTTTAGTCAAGAAACTGTGGGACCTCTTTCACATTCCCGTTTTCACATTGGTAGATGCTGATCCACATGGCATAGAAATAATGTGCATCTATAAGTATGGATCTATGTCTATGTCATTTGAAGCCCACAACCTCACAGTCCCGGCTGTTAGATGGCTCGGTCTCCTCCCTTCTGATATTAACAGGTTAAATATACCTAAAGATAGTTTAATTCCACTTACAAAACGGGACCAAATGAAACTTGACAGTATCTTGAAGAGACCTTATGTTACCTGCCAACCATTTTGGAGAAAAGAAATGGAAATGATGGCAGACTCTAGAATGAAGGCGGAAATCCAAGCTTTGACCTCCCTGTCCTCAGATTACCTTTCCAGAGTATACTTACCCAACAAGCTAAAATTTGGAGGGTGGATATGA

XM_004840915.1 Coding sequence

LOC101703202 cystatin-12-like, transcript variant X2

Length: 405 bp    Location: 23114225..23117509   Strand: +
>XM_004840915.1
ATGCTGTGGAAGGTGACACTGCTTGTGGGGTTCCTTGTGCTGGGGACCCCTGACCAATTCGTGGACATTGACAAGAATGGGAAGGCCTTTGCCATATCTGTGGAGCACGTTGTGTTTCATTTCAATGAGGCCCAGGAGGACCCATTTGCTTACAAGTTCCTTCGGGTCTGGCAGAGCCAGGGCGAGTTCTTTACCGGGACATATTTAATAGACCTGGAGATGGGCCGCACAGTGTGCAGAAAACACGATGAAGACATTGACAATTGCCTGCTGCAACAAGACACAGGAAGGAGGAAGGTGCGCTGCACTTACATTGTGAAGACCATAGAGTGGTTGACCAAGTTCTCCATCCTGAACAGCACCTGTGCTCAGACCGAGGTGGAGAGGGCCTGGCTAGCCCTGTAA

XM_004840918.1 Coding sequence

Cst8 cystatin 8 (cystatin-related epididymal specific), transcript variant X2

Length: 378 bp    Location: 23125604..23127479   Strand: +
>XM_004840918.1
ATGACCAGATCCTGGGGACTGTCCTTGCTCCTCCTCACCATCCCAGTGGCCCTGGTGACCAGCGCAGACCCAGCCAAGAACATAGTGAAGATTTTGAGGCCATTCAAATCCATTGAGTTTTCGGATGCAAACATGAGGCAGTGCCTATGGTTTGCCATGCAGGAATACAACAAAGAGAGTGAGGACAAGTACATCTTCCTCGTGAGCCAGATCCAGCTGGCCCAGATGCAGATCACAGACCATATGGAATACATAATTGAGGTTGAAATTGCCCGAAGCAATTGCAGAAAGCCTCTAAGCAACAATGAGAACTGTGTCATTCAAAAAAACTTCAACCTGGAAAAGAGACCTGGACCTTGGAGGCAGAAACATTGCTGA

XM_004840914.1 Coding sequence

LOC101703202 cystatin-12-like, transcript variant X1

Length: 405 bp    Location: 23114448..23117509   Strand: +
>XM_004840914.1
ATGCTGTGGAAGGTGACACTGCTTGTGGGGTTCCTTGTGCTGGGGACCCCTGACCAATTCGTGGACATTGACAAGAATGGGAAGGCCTTTGCCATATCTGTGGAGCACGTTGTGTTTCATTTCAATGAGGCCCAGGAGGACCCATTTGCTTACAAGTTCCTTCGGGTCTGGCAGAGCCAGGGCGAGTTCTTTACCGGGACATATTTAATAGACCTGGAGATGGGCCGCACAGTGTGCAGAAAACACGATGAAGACATTGACAATTGCCTGCTGCAACAAGACACAGGAAGGAGGAAGGTGCGCTGCACTTACATTGTGAAGACCATAGAGTGGTTGACCAAGTTCTCCATCCTGAACAGCACCTGTGCTCAGACCGAGGTGGAGAGGGCCTGGCTAGCCCTGTAA

XM_004840916.1 Coding sequence

LOC101703202 cystatin-12-like, transcript variant X3

Length: 405 bp    Location: 23114179..23117509   Strand: +
>XM_004840916.1
ATGCTGTGGAAGGTGACACTGCTTGTGGGGTTCCTTGTGCTGGGGACCCCTGACCAATTCGTGGACATTGACAAGAATGGGAAGGCCTTTGCCATATCTGTGGAGCACGTTGTGTTTCATTTCAATGAGGCCCAGGAGGACCCATTTGCTTACAAGTTCCTTCGGGTCTGGCAGAGCCAGGGCGAGTTCTTTACCGGGACATATTTAATAGACCTGGAGATGGGCCGCACAGTGTGCAGAAAACACGATGAAGACATTGACAATTGCCTGCTGCAACAAGACACAGGAAGGAGGAAGGTGCGCTGCACTTACATTGTGAAGACCATAGAGTGGTTGACCAAGTTCTCCATCCTGAACAGCACCTGTGCTCAGACCGAGGTGGAGAGGGCCTGGCTAGCCCTGTAA

XM_004840779.1 Coding sequence

Tmem230 transmembrane protein 230

High confidence: 4 potential gene matches
Length: 363 bp    Location: 6142365..6135252   Strand: -
>XM_004840779.1
ATGATGCCATCTCGTACCAACCTGGCTACTGGAATCCCCAGTAGTAAAGTAAAATACTCAAGGCTCTCCAGCACAGACGATGGCTACATTGACCTTCAGTTTAAGAAAAGCCCTCCTAAGATCCCCTACAAGGCCATCGCACTTGCCACTGTGCTGTTTTTGATTGGTGCCTTTCTTATTATCATAGGCTCCCTCCTGTTGTCTGGCTACATCAGCAAAGGGGGGGCAGACCGGGCCGTTCCAGTCCTGATCATTGGCATTCTGGTGTTCCTGCCAGGATTTTATCACCTGCGCATTGCCTACTACGCATCCAAAGGCTACCGGGGTTATTCCTATGATGACATTCCAGACTTTGATGACTAG

XM_004840909.1 Coding sequence

Nxt1 NTF2-like export factor 1, transcript variant X1

Length: 423 bp    Location: 23021123..23023327   Strand: +
>XM_004840909.1
ATGGCATCTGTGGACTTCAAGACCTACGTGGACCAGGCCTGCAGAGCAGCTGAGGAGTTTGTCAACGTCTACTACACCACCATGGATAAGCGCCGGCGCCTGCTGTCCCGCCTCTACATGGGCACGGCCACCTTGGTGTGGAATGGAAACGCTGTTTCCGGACAGGAGTCTTTGAGTGAGTTCTTTGAAATGCTGCCCTCCAGTGAGTTCCAGATCAATGTGGTTGACTGCCAGCCCGTCCATGATGAGGCCACCCCGAGCCAGACCACGGTCCTTGTTGTCATCTGTGGGTCAGTGAAGTTTGAGGGCAACAAACAGCGGGACTTCAACCAGAATTTCATCCTCACTGCCCAGGCCTCTCCCAACAACACGGTGTGGAAAATCGCAAGTGACTGTTTCCGGTTCCAAGACTGGGCTAGCTAG

XM_004840903.1 Coding sequence

Nkx2-4 NK2 homeobox 4

Length: 1062 bp    Location: 21775587..21774115   Strand: -
>XM_004840903.1
ATGTCGTTGAGCCCCAAGCACACGACGCCCTTCTCCGTGTCCGACATCCTGAGCCCCATCGAGGAGACCTACAAGAAGTTCGGCGGCACCATGGACGGCGCGCCGCCCGGGCTGGGGGCGCCCCTGGGGGCCGCGGCCGCTGCCTACCGCGCGCCGCCGTCCGGGCCAGCCCCGCAGACGGGGATGCAGGCGCCGCATGCCGTCGCCGGGCACAACGCGGCGGCGGCGGCGGCCGCGGCGGCGGCGGCGGCCGCAGCAGCGGCCGCCACCTACCACATGCCGGCGGGCGTCTCGCAGTTCCCTCACGGCGCCATGGGCGGCTACTGCAACGGCGGCCTGGGGAACATGGGAGAGCTGCCCAGCTACGCGGACAGCATGCGGGGCGGCGCGGCGGCCGCAGCAACCGGCTGGTACGGCGCCAACGCGGACCCGCGCTACTCCTCAATCTCCAGGTTCATGGGTCCGTCGGCGGGCGTGAACGTGGCCGGCATGGGGTCACTGAGCGGCATCGCCGACGCCGCCAAGTCTCTGGGCCCACTGCACGCGGCGGCGGCGGCCCCGCGTAGAAAGCGGCGCGTGCTGTTCTCACAGGCGCAGGTGTACGAGCTGGAGCGGCGCTTCAAGCAGCAGAAGTACCTGTCAGCGCCCGAGCGCGAGCACCTGGCCAGTATGATCCACCTGACGCCCACACAGGTCAAGATCTGGTTCCAGAACCACCGCTACAAGATGAAGCGGCAAGCCAAGGACAAGGCGGCGCAGCAGCTGCAACAGGAGGCAGGCCTGGGGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCTTCGCCGCGTCGCGTGGCCGTGCCCGTGCTGGTCAAGGACGGCAAGCCGTGCCAGAACGGCGCGGGGAGCGGGGCGCCAACGCCCGGCCCGCCGCCGCCGCCCACGCCCGAGCTCGAGGAGCTCTCGCCCAGCCCGCCCGCGCTGCACGGGCCCGCGGCCGGGATGGCGTTGGACACGGCCGCCGGGGACTACGGAGCGGGGGTGCTCGGCGCCAACCTGCTCTATGGCAGGACGTGGTGA

XM_004840895.1 Coding sequence

Naa20 N(alpha)-acetyltransferase 20, NatB catalytic subunit, transcript variant X1

Length: 594 bp    Location: 20549380..20563518   Strand: +
>XM_004840895.1
ATGACCACGCTGCGGGCTTTCACCTGCGACGACCTCTTCCGCTTCAACAACATTAACTTGGATCCACTTACAGAAACTTATGGGATTCCTTTTTACTTACAGTACCTCGCCCACTGGCCGGAGTATTTCATCGTTGCAGAGGCCCCTGGTGGAGAGTTAATGGGCTACAGTGAGTATTCTCCCACTTCAGTGTATCTAACTATGTCATGCCTTTTTTTGCTGGCAGTCATGGGCAAAGCAGAAGGCTCTGTCGCAAGGGAGGAGTGGCATGGCCATGTTACAGCTCTGTCTGTCGCTCCTGAATTTCGGCGCCTTGGTTTGGCTGCTAAGCTCATGGAGTTACTGGAGGAGATTTCGGAGAGAAAAGGCGGATTTTTCGTTGATCTCTTCGTCAGAGTGTCTAACCAGGTTGCAGTCAACATGTATAAGCAGCTGGGCTATAGCGTGTACCGGACAGTCATAGAGTACTACTCGGCCAGCAATGGGGAGCCAGATGAGGATGCCTACGATATGAGAAAAGCACTTTCCAGGGACACGGAGAAGAAATCCATCATCCCGTTACCCCATCCGGTGAGGCCTGAAGACATTGAATAA

XM_004840897.1 Coding sequence

Naa20 N(alpha)-acetyltransferase 20, NatB catalytic subunit, transcript variant X3

Length: 378 bp    Location: 20549380..20563518   Strand: +
>XM_004840897.1
ATGACCACGCTGCGGGCTTTCACCTGCGACGACCTCTTCCGCTTCAACAACATTAACTTGGATCCACTTACAGAAACTTATGGGATTCCTTTTTACTTACAGTACCTCGCCCACTGGCCGGAGTATTTCATCGTTGCAGAGGCCCCTGGTGGAGAGTTAATGGGCTACATCATGGGCAAAGCAGAAGGCTCTGTCGCAAGGGAGGAGTGGCATGGCCATGTTACAGCTCTGTCTGTCGCTCCTGAATTTCGGCGCCTTGGTTTGGCTGCTAAGCTCATGGAGTTACTGGAGGAGATTTCGGAGAGATATGAGAAAAGCACTTTCCAGGGACACGGAGAAGAAATCCATCATCCCGTTACCCCATCCGGTGAGGCCTGA

XM_004921062.1 Coding sequence

Scp2d1 SCP2 sterol-binding domain containing 1

Length: 471 bp    Location: 19425894..19426364   Strand: +
>XM_004921062.1
ATGTAGAGGAGGACAGACCATCCTTCCAAAAGTAAAGCTGGGAATAGACTCAAGGCGGGCCAGTTCAAGACTCCAGGTTCAGCTCGGGAAGTGGCCATGCCACCCACTGTGAACCTGTCAGGACTGCAGAGCTTCCCTATGCTAGAGGACATCAGCCATTACATCAAAGACATGGGTGCCCAGCTGGTGAAGAAAGTCAGTGCCATCTTTCAGCTGGACATCACTAAGGATGGGAAGACCATTCTGCAGTGCACCATTGACCTGAAGAACAGAGCTGGGGACATGTATCCAGGACCCGCAGGGCTCCTGGCAGACACTGTCTTCACAATCCCAGAGTCTGTCTTTATGGAGTTAGTTTTGGGGAAAATGAACCTGTAGAAAGCTTTCTTGGCTGGCATGTTCAAAGTGAGTGGCAAAGTTCTCCTCAGCCAGAAGCTGGAGAGGGTTTTCAAAGATTGGGCTAAGTTTTAA

XM_004840790.1 Coding sequence

LOC101717821 chromosome unknown open reading frame, human C20orf196, transcript variant X1

Length: 657 bp    Location: 6630747..6749123   Strand: +
>XM_004840790.1
ATGGCACCACGGTTTCCGGTTCCGGTCTCTTGCTGTTGTGGGCGGGCGATGGCTGCCGCAGGCAGCCCGCCGGGAGACAGCTTGGACCTGCCCTCAGCCAGCGCAGTCGGAGACTACGTGCTGCTGCTGCGGAGGCCTGGCGAGGGCGCGGGCGGAGAGAGCCTAAGCTCTGCAGAGTCCCATTCCGTCCCCTGCTCTTCTGACATAGAGCCAGACAGCGGCAACCTAAATGCTGAACAAAAAGACTCTTGGATCTGTGAGAACCTCTGGCCTGACTCTTCTGCCAAAAGCCAGTTGGAGGCCAAGAAAGAGGACAATGGGCTTCGAGAATCCCTGGATAGATTCTATGAAGTGTTCAGCCATCCCCAGCCAGCCTCTGGGGACCCGCTCTTGGCATCTGTCTGCCAGTGCCTGTCTCAGAAAATTGCTGAACTGAGGGGCCAAGGGAGCCAGAAGTACACCCTCCGCAGCTTCCAGATGGCCCGGGTCATCTTCAACCGGGATGGCTGCTCAGTCTTGCGGAAGCACTGCAGGGACACCCGCTTCTACCCACTGCGTGAAGGAAGCACGGCTCTGGATGAGGAAAAGCAGACCCCAGGACTTTCAAAAGCTATCATCCGCTTCCTCTTGCAGCAGAATGTGATGAAAGACCCCTAA

XM_004840871.1 Coding sequence

Dzank1 double zinc ribbon and ankyrin repeat domains 1, transcript variant X3

Length: 2187 bp    Location: 19196502..19143016   Strand: -
>XM_004840871.1
ATGACGGCTGGTTCAGTGTGTGTCCCTCAGATCATACCACTGCGAATACCTCAGCCTGGAAAAGCGAACCATGAAATTGATAATAATACTCTTTTGGAAATGAAATCAGACACCCCGGATGTCAACATATATTACACCCTGGATGGCAGTAAACCTGAATTTCTGAAGAAAATTGGTTATGGTGAAAATAATACATTTAAGTATACAAAACCTATTACTCTGCCTGATGGAAAAATACAAGTTAAAGCTATTGCAGTGTCTAAAGACAACAGACAGAGTGGAATTGTCACAAAGGTGTTCCAAGTAGACTATGAACCACCAAGCCCAGCCTCTTCTGGAGACAGAGTTGAAAATGTTCTCAAAGGCTCTTCAAAGCAGGAATTAAAAAATGGATTTGTTGGACCAAAAGTAAGAAAGAAATGTAAGAATGCTGAAAATAAACCTGGTTGGAATGTTAACCTTCGAAAGTTTTCAGACCTCAAGGTAGGCGAAAGATCTACACTTCTGAAAGCTCTGAGAGATCTTCGTTTCTCAAAGAGTCCATTGGAAATCTCAGCTCACTGTGAAGGATCAAGTTCTAGGCTGCTCACCCACCAGTCCCAGTTTCAGTCGCCTGGTTTTGCACACATACCAGGCCAGAAGAGTTTGACAAGCACGGAGATCATGAGAATCCAAAGGCAGACAGACTTTCTCAAGTGTGCCCACTGCCTGGCCCCCCGCCCATCGGATCCTTTCGCTAGATTCTGTCACGAGTGTGGTGCTCCTGTCCCATCCATATTTGGCTGTCGTCTTCCACCCCCTGAAGGAGCGCAGAAGGTGATCTGCCGCTCCTGTGGCACGGGGAATCCTGCTCACCTGAGATACTGTGTCACCTGCGAGGGGGCCCTGCCTTCGCCACAAGAGTCCTGGAACAGTGGCGAGAAAGCACCCCCTCTGCTGACCCAGAAAGGGGAGACCACTTCCTGGTGCAGATGTGGCTGCCACAACCTCGGGGAGGCAATCTTCTGCGACTGGTGTGGAGCCAAGCTTGGCCTTTCTGCTAGCCACTCCATCTGCCCTAAATGTGGGGCCAGCAATCACCCATCTGCTCAATTCTGTGCTACCTGTGGCGTTTGTGTGAACTCCATGGCAAGACAGAGCCTGGATGGCAGCCCGACTGTCCTAGCTGGGGAGCCGCACCCCACTTCTCAGCCCCGATATGCTTGGCAACCCCTAACTGTCCCTCTGCCCAGCGCTGATGCTGGGCCTAAGAAGCATGTGGGCACCCAGACCGTGGGCCTCTTCTACCCGTCTGGCAGGCAGCTGGCCTTGAAGGAGCCGGAGGTGGAGACACGTGGCCGCATGCCCCCACTCATGGCCATCAGCCCAGGCAGAGGATACTGGAGAAAACAGTTGGATCACATCTCTGCTCACCTCCGGTCCTACACTCAGAACAACCCTGAGTTCCGGGCCCTGGTCTCAGAGCCCAGGATGGGGAAGCTCATCTCTGCCACTGTCCATGAAGATGGCTGTGAAGTTAGCATCAGGCTGAATTATATTCAAGTCTCCAACAAGAACCTGTACCTCAGCAAAGCAATGGACTTAAGCAACCGCTTTCTCAGCAGTATCACCGAGGGTGGTGATGGCCTCTACGGCAGCAGGTCCAGCTTGGTGAGTGACTACAGCCAGAGTCCCTCAGACTCTGAGGTCAAGAGGATGAGGAACATCAAAACCAAAAACTTTCACATAAAGAAAGAGCAGCCGAGGCCTAGAAGCAGACATCGGGTGGAAGAAGTGGGCCTGGCAGGGGACAAAAGAGTCTCTGTGCTTGAACAGCTGCTGGACAAGGATACAGATCCTGACTGCAGTGACAGCACGGGCCGATCTGCTGCTGCCTTAAATAAGCACCAGGAAGCCATTCCAGTTCTCACTGGGAGAGGAGTGGATGTGGACCAGCAGTGGGGGCTGTACAGCACGAGCCTCCAGAAGGTGGACACTCGAGGCCAGACAGCCCACAACCTGGCTCTGGAAAGGGAGGACCACCACGTCACCTTGCTCTTTGATGCTAAGTTCAGCCAGGAGCTGGGGGACCAGCTCAGCCAGCCTGAGAGCTGCAGCCCAGATGACTGTCAGGCCCAAGGCAGCTGCTGGTCCTCACAGAAGGAGCCACTCAGCACTGGCTGTCCTGTTTCTGAAGTGTGCATATGA

XM_004840866.1 Coding sequence

Znf133 zinc finger protein 133, transcript variant X1

Length: 1965 bp    Location: 19111753..19129908   Strand: +
>XM_004840866.1
ATGGCGTTCAGGGATGTGGCTGTGGATTTCTCCCAGGAGGAGTGGAGCTTGCTGAGTCCTGCTCAGAGGAGCCTGTACAGGGAGGTGATGCTGGAGACCTACAGCCACCTGGTGTCTCTGGGAATTCCGTTTTCTAAACCAAAACTCATCACACAGCTGGAGCAGGGGAAAGAAATGTGGCGAGAAGAGAGAAAATGTTCACTGGCCACCTGTCCAGCAGAACCAAAGCCGGAACTCCAGCCAGGTCCTTTCTGCCCCCTGGATTTCTCAGCTCAGAAATTCCCTGTGCAGCATGTGCTGTGCAGCCAGCCTCCCTGGCTATTGACGTGCTTGTGCACAGGAAGTCCTGTCCTGCCAGGGGCTCTGTGCCCGGAGGACCTGGAAGACCAGCAGAAGCAGCCGCAAGCCTCACAGGGGTGTGCTTGGAGTGCAGAGGCCGAGAGTGGTTACAGCAAGGGCACCAAGCCTGCCTTTGGGAAGACAAAGAGGAGGACTTTGGGCGTGTTCTCCAGGCCACCGCAGAGACAGCTGGTCAAGGCCCTCCGTGGGGTGGAGATGGAAGCTGGCGCCACTCCGCCGGGGACCCCCGAGGACACAGACAAGTTGCTGAAGAGCATCGAAGTCTTAGGGTTCGGGACGGTCAACTGCAGTGAGTGCGGCCTGGGTTTCAGCAAGATGACCAACCTGTTGAGCCACCAGCGCATCCACTCGGGCGAAAAGCCATACGTGTGTGGGGTGTGTGAGAAGGGCTTCAGCCTGAAGAAGAGCCTGGCTCGGCACCAGAAAGCTCACTCAGGGGAGAAGCCCATCGTGTGCGGCGAGTGTGGCCGGGGCTTCAACCGCAAGTCCACGCTGGTCATCCACGAGCGCACGCACTCGGGCGAGAAGCCGTATGCCTGTGTGGAGTGCGGGCGCGGCTTCAGCCAGAAGTCCAACCTCATCATCCACCAGCGCACGCACTCAGGCGAGAAGCCCTACGTGTGCCGCGAGTGTGGCAAGGGCTTCAGCCAGAAATCAGCCGTGGTCAGGCACCAACGCACGCACCTTGAGGAGAAGACGATCGTATGCGGGGACTGCGGCCTGGGCTTCAGTGACAGGTCCAACCTGATCTCGCACCAGCGCACGCACTCAGGCGAGAAGCCCTACGCATGCAAGGAGTGTGGCCGCTGCTTCCGACAGAGGACCACACTGGTCAACCACCAGCGCACACACTCTAAGGAAAAGCCATACATATGCAGCGTGTGTGGGCACAGCTTTAGCCAGAACTCCACCCTCATCTCGCACCGCAGGACACACACTGGGGAGAAGCCCTTTGTGTGTTCTGTGTGCAGCCGGGGCTTCAGCCTCAAGTCACACCTCAACAGGCACCGCAACATCCACTCTGGGGAGAAGCCCATCGTGTGCAAGGACTGCGGTCGGGGCTTCAGCCAGCAGTCCAACCTCATCCGGCACCAGCGGACACACTCGGGGGAGAAGCCCATGGTGTGCGAGGAGTGTGGACGCGGCTTCAGCCAGAAGTCCAACCTCGTGGCGCACCAGAGGACACACTCAGGGGAAAAGCCGTACGTGTGCCAGGACTGTGACAAAGGCTTCAGCCACCAGGCTGGGCTCATCAGGCACAAAAGGAAGCACTTGAGGGAGAAGCCTTACACGTGCCGGCAGTGTGGACTGGGGTTTGGCAACAAGTCCACTTTAATCACGCATAAGCGGGTCCACTTGGAAGGGAAGCCTTGTGTCTGCAGCGAGTGTGGCCAAGGCTTTATCCAGAAATCCCTCCTGGCTTTACACCAGCTGGCACACAAGGGGAAGACGCCTTACGTGTGCAGAGCCTGCGGGCAAGGCTTTAAGCAGAAGTCTCAGCTGAGCAGGCACAGGAAGACAAAGTGTAGCCACCACAGACTGCCACTCCAGGCCAACTCTGAGGCTGGTTCTGGGCAGGCTTCTGACCTCTTGGATTTACTTTGA

XM_004840865.1 Coding sequence

Pet117 PET117 homolog (S. cerevisiae)

High confidence: 3 potential gene matches
Length: 246 bp    Location: 19039729..19043860   Strand: +
>XM_004840865.1
ATGTCTCGGGCTTCCAAGGTGGTGCTGGGCCTCTCCGTGGTGCTTACCGCGGCCACTGTGGCCGGTGTACATCTAAGGCAGAGGCAGGACCGGCAGAGGCTTCGTGACGGAGTGATCCGAGACCTTGAGAGGCAAAACCGGAAAAAAGAAAACATTCGTGTTTTGGGCGAACAGATTATTTTGACTGAGCAACTTGAAGCAGAAAGAGAGAAGATATTGTTGGAGAAGGGATCTCAAAAAACATGA

XM_004840868.1 Coding sequence

Znf133 zinc finger protein 133, transcript variant X3

Length: 1962 bp    Location: 19111753..19129908   Strand: +
>XM_004840868.1
ATGGCGTTCAGGGATGTGGCTGTGGATTTCTCCCAGGAGGAGTGGAGCTTGCTGAGTCCTGCTCAGAGGAGCCTGTACAGGGAGGTGATGCTGGAGACCTACAGCCACCTGGTGTCTCTGGGAATTCCGTTTTCTAAACCAAAACTCATCACACAGCTGGAGCAGGGGAAAGAAATGTGGCGAGAAGAGAGAAAATGTTCACTGGCCACCTGTCCAGAACCAAAGCCGGAACTCCAGCCAGGTCCTTTCTGCCCCCTGGATTTCTCAGCTCAGAAATTCCCTGTGCAGCATGTGCTGTGCAGCCAGCCTCCCTGGCTATTGACGTGCTTGTGCACAGGAAGTCCTGTCCTGCCAGGGGCTCTGTGCCCGGAGGACCTGGAAGACCAGCAGAAGCAGCCGCAAGCCTCACAGGGGTGTGCTTGGAGTGCAGAGGCCGAGAGTGGTTACAGCAAGGGCACCAAGCCTGCCTTTGGGAAGACAAAGAGGAGGACTTTGGGCGTGTTCTCCAGGCCACCGCAGAGACAGCTGGTCAAGGCCCTCCGTGGGGTGGAGATGGAAGCTGGCGCCACTCCGCCGGGGACCCCCGAGGACACAGACAAGTTGCTGAAGAGCATCGAAGTCTTAGGGTTCGGGACGGTCAACTGCAGTGAGTGCGGCCTGGGTTTCAGCAAGATGACCAACCTGTTGAGCCACCAGCGCATCCACTCGGGCGAAAAGCCATACGTGTGTGGGGTGTGTGAGAAGGGCTTCAGCCTGAAGAAGAGCCTGGCTCGGCACCAGAAAGCTCACTCAGGGGAGAAGCCCATCGTGTGCGGCGAGTGTGGCCGGGGCTTCAACCGCAAGTCCACGCTGGTCATCCACGAGCGCACGCACTCGGGCGAGAAGCCGTATGCCTGTGTGGAGTGCGGGCGCGGCTTCAGCCAGAAGTCCAACCTCATCATCCACCAGCGCACGCACTCAGGCGAGAAGCCCTACGTGTGCCGCGAGTGTGGCAAGGGCTTCAGCCAGAAATCAGCCGTGGTCAGGCACCAACGCACGCACCTTGAGGAGAAGACGATCGTATGCGGGGACTGCGGCCTGGGCTTCAGTGACAGGTCCAACCTGATCTCGCACCAGCGCACGCACTCAGGCGAGAAGCCCTACGCATGCAAGGAGTGTGGCCGCTGCTTCCGACAGAGGACCACACTGGTCAACCACCAGCGCACACACTCTAAGGAAAAGCCATACATATGCAGCGTGTGTGGGCACAGCTTTAGCCAGAACTCCACCCTCATCTCGCACCGCAGGACACACACTGGGGAGAAGCCCTTTGTGTGTTCTGTGTGCAGCCGGGGCTTCAGCCTCAAGTCACACCTCAACAGGCACCGCAACATCCACTCTGGGGAGAAGCCCATCGTGTGCAAGGACTGCGGTCGGGGCTTCAGCCAGCAGTCCAACCTCATCCGGCACCAGCGGACACACTCGGGGGAGAAGCCCATGGTGTGCGAGGAGTGTGGACGCGGCTTCAGCCAGAAGTCCAACCTCGTGGCGCACCAGAGGACACACTCAGGGGAAAAGCCGTACGTGTGCCAGGACTGTGACAAAGGCTTCAGCCACCAGGCTGGGCTCATCAGGCACAAAAGGAAGCACTTGAGGGAGAAGCCTTACACGTGCCGGCAGTGTGGACTGGGGTTTGGCAACAAGTCCACTTTAATCACGCATAAGCGGGTCCACTTGGAAGGGAAGCCTTGTGTCTGCAGCGAGTGTGGCCAAGGCTTTATCCAGAAATCCCTCCTGGCTTTACACCAGCTGGCACACAAGGGGAAGACGCCTTACGTGTGCAGAGCCTGCGGGCAAGGCTTTAAGCAGAAGTCTCAGCTGAGCAGGCACAGGAAGACAAAGTGTAGCCACCACAGACTGCCACTCCAGGCCAACTCTGAGGCTGGTTCTGGGCAGGCTTCTGACCTCTTGGATTTACTTTGA

XM_004840864.1 Coding sequence

Csrp2bp CSRP2 binding protein, transcript variant X2

Length: 2355 bp    Location: 19043994..19077450   Strand: +
>XM_004840864.1
ATGGAGAGCAGTGTCCACCTGAGTGGGCTGCTGAGCCGCCACGACGATGAGGCCACCAGGACGTCCACCTCCGAGGGGCTGGAGGAGGGGGAGGTGGAGGGCGAGACCCTCCTTATCGTGGAGTCGGAGGACCAGGCCTCGGTGGACTTGTCGCATGACCAGAGCGGGGACTCCCTCAACAGTGACGAGGGCGATGTGTCGTGGCTGGAGGAGCAGCTGTCCTACTTCTGCGACAAGTGCCAAAAATGGATACCAGCCAGTCAGCTGAGGGAACAGCTCAGTTACCTTAAGGGAGATAACTTTTTTAGGTTTACTTGTTCCGACTGCTCAGCGGATGGCAAGGAGCAGTACGAGCGGCTGAAACTGACATGGCAGCAGGTTGTCATGTTGGCCATGTACAACTTGTCCCTGGAAGGCAGTGGGCGTCAGGGCTACTTCCGGTGGAAAGAGGACATCTGCGCTTTCATCGAGAAGCACTGGGCCTTCTTGCTGGGGAACAGGAAGAAGACTTCCACTTGGTGGAGCACTGTGGCAGGCTGCCTGAGCGTGGGGAGTCCCATGTACTTCCGCTCAGGGGCACAGGAGTTCGGGGAGCCAGGCTGGTGGAGACTGGTACATAACAAGCCGCCCACCCTGAAGCCAGAAGGGGAGAAGCTGTCTGGCTCCACGCTGAAGGCCAAAGGTGAGAGTGCCTCAAAGCCCACCCTGGACCCCATCATCACTGTAGAGGGCCTTCGGAAACGGGCCAGCCGGAACCCTGTGGAGTCTGCCATGGAGCTGAAGGAGAAGCGGTCCCGCACGCAGGAGGCGAAGGACATCCGGCGGGCCCAGAAGGAGGCAGCCGGCTTTCTGGATCGCAGCCCTGCGTCCACACCTGTGAAGTTCTCCAGCCGGGCCCGCCGGCCAGATGCGGTCCTTGAGCGGGGTGAGGTGATCGACTTTGCATCACTGAGCTCCTCAGACCGCACCCCGCTGACCAGCCCCTCCCCATCACCCTCGCTGGACTTCTCTGCACCTGGGACACCGGCGTCACACTCGGCCACGCCGAGCCTGCTGTCGGAGGCCGACCTGATCCCCGATGCCATGCCCCCGCAGGCACTGTTCCATGATGATGATGAGCTGGACGGTGATGGCGACATTGACCCAGGAGTGGAGGACCCGCCACCGTCCCTGGGGCCCGTGGCTTCAGGGCTGGGGACCGGAGGCAGGAAGAAGGTCAGAGCCCCCGAGCACATCAAGCAGGAGGTGGACAGTGAGGAGGAGAAACCAGACAGGGCAGATCTGGACAGCGAGGACACAGACTCCAGTGCGTCCCTGCAGACCCGGGCGCGGGACAAGAGGAGGCCGCCCCTGCAGAAGGATGCAAGGCCACAGGGGCCCCGGTACACGCCTGCCAGCATCTACGAGGAAAAGCTGCTGCTGCGCAGGCTGGAGGCCTGTCCCAGTGCCGTGGCCATGACGCCTGAGGCACGCAGGCTGAAGCGCAAGCTAATTGTCAGGCAGGCCAAGAGGGACCGGGGGCTGCCCCTCTTCGACCTGGACCAGGTGGTCAATGCTGCCCTTTTGCTAGTCGATGGGATCTATGGAGCCAAAGAGGGAGGGGTGTCCCGGCTTCCAGCTGGACAGGCCACCTACCGGACCACCTGCCAGGACTTCCGAATCCTTGACCGCTACCAGACAGCCTTGCCATCCAGGAAGGGATTTCGACACCAGACCAGCAAGTTTTTGTATCGCCTGGTGGGCTCAGAAGACCTGGCTGTGGACCAGAGCATTGTCAGTCCCTACACTTCCCGGATCCTAAAGCCCTACATCAGGCGTGATTATGAGACAAAACCACCCAAACTACAGCTTCTGTCCCAGATTCGTTCCTACCTGCACAGAGGTGACCCTCACTGGATATCCGAGCCCGACGCACCTCTTGATTACTGCTATGTCCGGCCAAATCACATCCCAACGATCAACTCGATGTGTCAGGAGTTTTTCTGGCCTGGCATTGACCTGTCTGAGTGCCTGCAGTATCCCGACTTCAGTGTGGTCGTCCTCTATAAGAAAGTCATCATCGCCTTCGGCTTCATGGTTCCCGATGTGAAATACAATGAGGCTTACATTTCATTTCTGCTTGTCCACCCGGAATGGAGACGAGCAGGGATCGCAACTTTCATGATCTATCACCTGATTCAGACCTGCATGGGCAAAGACGTGACCCTCCACGTCTCAGCGAGCAACCCCGCCATGCTGCTGTACCAGAAGTTTGGGTTCAAGACAGAGGAGTATGTTCTGGACTTTTATGATAAGTACTACCCACTGGAGAGCACAGAGTGTAAGCATGCCTTCTTCCTGCGGCTCCGGCGCTGA

XM_004840853.1 Coding sequence

Dstn destrin (actin depolymerizing factor), transcript variant X1

Length: 576 bp    Location: 18728187..18759094   Strand: +
>XM_004840853.1
ATGTGCAGATTTTTCCTCTCACGCGAGGGTCCGCCGTGTCTAGCTGGCCAATCATCGGAGGGCTGCGGGAATCGCACCAAAGCCTCGGGAGTGCAAGTTGCTGATGAAGTATGTCGCATTTTTTATGACATGAAAGTTCGGAAATGCTCCACACCTGAGGAAATTAAAAAAAGAAAGAAGGCTGTCATTTTTTGTCTCAGTGCAGACAAAAAGTGCATCATTGTTGAAGAAGGCAAAGAGATCCTAGTTGGAGATGTGGGTGTGACCATCACTGATCCCTTCAAGCATTTTGTGGGGATGCTTCCTGAAAAGGATTGTCGCTATGCCTTGTATGATGCAAGCTTCGAGACCAAGGAGTCCAGGAAAGAAGAGCTGATGTTCTTTTTGTGGGCCCCAGAACTGGCCCCTCTGAAGAGTAAGATGATCTACGCCAGCTCTAAGGATGCGATCAAAAAGAAGTTCCAAGGCATCAAACACGAATGTCAAGCAAATGGGCCGGAAGACCTCAACCGAGCTTGTATTGCCGAAAAGCTGGGTGGGTCCTTGATTGTAGCCTTCGAAGGGTGCCCCGTGTAG

XM_004840855.1 Coding sequence

Dstn destrin (actin depolymerizing factor), transcript variant X3

High confidence: 3 potential gene matches
Length: 498 bp    Location: 18728780..18759094   Strand: +
>XM_004840855.1
ATGGCCTCGGGAGTGCAAGTTGCTGATGAAGTATGTCGCATTTTTTATGACATGAAAGTTCGGAAATGCTCCACACCTGAGGAAATTAAAAAAAGAAAGAAGGCTGTCATTTTTTGTCTCAGTGCAGACAAAAAGTGCATCATTGTTGAAGAAGGCAAAGAGATCCTAGTTGGAGATGTGGGTGTGACCATCACTGATCCCTTCAAGCATTTTGTGGGGATGCTTCCTGAAAAGGATTGTCGCTATGCCTTGTATGATGCAAGCTTCGAGACCAAGGAGTCCAGGAAAGAAGAGCTGATGTTCTTTTTGTGGGCCCCAGAACTGGCCCCTCTGAAGAGTAAGATGATCTACGCCAGCTCTAAGGATGCGATCAAAAAGAAGTTCCAAGGCATCAAACACGAATGTCAAGCAAATGGGCCGGAAGACCTCAACCGAGCTTGTATTGCCGAAAAGCTGGGTGGGTCCTTGATTGTAGCCTTCGAAGGGTGCCCCGTGTAG

XM_004840859.1 Coding sequence

Mgme1 mitochondrial genome maintenance exonuclease 1, transcript variant X1

Length: 1089 bp    Location: 18974637..18983120   Strand: +
>XM_004840859.1
ATGAAGGCATTTCAGACCCTTTGCAAGCAGCTCAGGTCCAAGGCGTTTTCTGTAGAACCAGCCCACATTGCTGGTTTTTCCACTTCCTCTTATTCATGTGGTCCAAAGAAGAAAAACCCCTATGAAGAAGTGGACCAAACCAGATACTCTGAGTTAGTAAAGTCAGTCTTGTCCTTCCGAGGTCCTGCTCAGACTCCAGAATCGCTGCTGGAGGAGGATGCTTTACTCTTTGGACCTGTGAGTAAGGCCAAACCCCCAAAGCAAGACAAAGCCAGAGTTCCCCGGAACTGGTTTCCTATCTTCAATCCAGGCCGAAGCCTAAAACCAAACACAAGTGAGCCTTCAGTTCCTTTGAAAATCCCTCTGCAAAGGAATATGATACCAAGTGTGACCCGGGTCCTGCAGCGGACCATGACAGCAGAACAGATTTTCTACTTGGAGAGGTGGAGACAGCGAATGATTCTGGAGCTGGGAGAAGATGGCTTTGCAGAGTATACTTCAAACATTTTTTTGCAAGGGAAGCGCTTCCACGAGGCCCTGGAAAACATACTCTCAGCCGAGGGGAACATAAAAGAGGAGGATGAAAGTCCCCTTGCCTGTGGCCACATCAGAAGTGTGCAGCATCTTCTGAAAGATGTGTGTGGAGTGCGTGCTCTCGAGAGCGCCGTCCAGCACAGGGCTCTGCAGTACGTGGGGCTGCTGGACTGTGTGGCTGAGTACCGAGGCAAGCTGTGCGTGATCGACTGGAAGACATCAGAGAAGCCGAAGCCCTTCCTCCAGAACACATACGATAACCCACTGCAGGTGGTGGCGTACATGGGTGCCCTGAACCACGATGCCAACTACAGCTTCCAGGTGCAGTGCGGCCTGATCGTGGTGGCCTACAAGGATGGCTCCCCCGCACATGCCCACTTCCTGAACGCCGAGCTCTGCTCCCACTACTGGGCCAAGTGGCTGCTGCGCCTAGAGGAGTACAAGGAAAAGGTTCGGAGCCAGGATGGCCAGAAGCCAGGAGAAGGCCAGGACGCAGCCAGAGCAGGTGCTGCTCTCCCTGTAGGAGAAGAGGGATCGCTGTCTCCTGCTTGCTGA

XM_004840845.1 Coding sequence

Snrpb2 small nuclear ribonucleoprotein polypeptide B, transcript variant X1

Length: 675 bp    Location: 17892964..17902321   Strand: +
>XM_004840845.1
ATGGATATTAGACCAAATCATACAATTTATATCAACAATATGAATGACAAAATTAAAAAAGAAGAATTGAAGCGATCCCTATATGCACTGTTTTCTCAGTTTGGGCATGTGGTAGATATTGTGGCTTTAAAGACTATGAAGATGCGAGGCCAGGCCTTTGTTATATTTAAAGAACTGGGTTCATCCACAAATGCTTTAAGACAGTTACAAGGATTCCCATTTTATGGCAAACCAATGCGAATCCAGTATGCAAAAACAGATTCTGATATAATATCTAAAATGCGTGGCACTTTTGCTGACAAGGAAAAGAAAAAAGAAAAGAAAAAAGCCAAAACTGTGGAACAAACTGCAACAACTGCAAACAAAAAGCCTGGCCAGGGAATATCAACAACTAATACCCAAGGAAATGCAACAACAAATCCTCAGGTCCCTGATTACCCTCCAAACTATATTTTATTCCTTAATAATTTACCAGAAGAGACTAACGAGATGATGCTGTCTATGCTGTTTAATCAGTTTCCTGGTTTTAAGGAAGTACGCCTGGTACCTGGAAGGCATGACATTGCTTTTGTGGAATTTGAAAATGATGGGCAGGCTGGAGCTGCCAGGGATGCATTACAAGGGTTTAAGATCACACCATCCCATGCAATGAAGATCACCTATGCCAAGAAATAA

XM_004840846.1 Coding sequence

Snrpb2 small nuclear ribonucleoprotein polypeptide B, transcript variant X2

Length: 675 bp    Location: 17894102..17902321   Strand: +
>XM_004840846.1
ATGGATATTAGACCAAATCATACAATTTATATCAACAATATGAATGACAAAATTAAAAAAGAAGAATTGAAGCGATCCCTATATGCACTGTTTTCTCAGTTTGGGCATGTGGTAGATATTGTGGCTTTAAAGACTATGAAGATGCGAGGCCAGGCCTTTGTTATATTTAAAGAACTGGGTTCATCCACAAATGCTTTAAGACAGTTACAAGGATTCCCATTTTATGGCAAACCAATGCGAATCCAGTATGCAAAAACAGATTCTGATATAATATCTAAAATGCGTGGCACTTTTGCTGACAAGGAAAAGAAAAAAGAAAAGAAAAAAGCCAAAACTGTGGAACAAACTGCAACAACTGCAAACAAAAAGCCTGGCCAGGGAATATCAACAACTAATACCCAAGGAAATGCAACAACAAATCCTCAGGTCCCTGATTACCCTCCAAACTATATTTTATTCCTTAATAATTTACCAGAAGAGACTAACGAGATGATGCTGTCTATGCTGTTTAATCAGTTTCCTGGTTTTAAGGAAGTACGCCTGGTACCTGGAAGGCATGACATTGCTTTTGTGGAATTTGAAAATGATGGGCAGGCTGGAGCTGCCAGGGATGCATTACAAGGGTTTAAGATCACACCATCCCATGCAATGAAGATCACCTATGCCAAGAAATAA

XM_004840849.1 Coding sequence

Otor otoraplin

High confidence: 4 potential gene matches
Length: 387 bp    Location: 17908579..17911354   Strand: +
>XM_004840849.1
ATGGCAAGAATATTGTTGCTTTTTCTCCCTGGTCTGGTGGCTGTATGTGCGGGGCATGGAGTATTTATGGATAGACTTGCTTCCAAGAAGCTGTGTGCGGATGACGAGTGTGTCTATACTATTTCTCTGGCTAGAGCCCAAGAAGATTATAATGCCCCAGACTGTAGATTCATTAATGTTAAAAAAGGGCAGCAGATCTACATTTACTCAAAGCTGGTAAAAGAAAATGAAGCTGGAGAATTTTGGGCTGGCAGTGTTTATGGTGATCACCAGACTGAGATGGGAATCGTGGGTTATTTCCCCAGCAGCTTGGTCAAGGAGCAACGTGTGTACCAGGAAGCCACCAAGGAAGTTCTCACTACAGATATTGACTTCTTCTGTGAATAA

XM_004840847.1 Coding sequence

Snrpb2 small nuclear ribonucleoprotein polypeptide B, transcript variant X3

Length: 675 bp    Location: 17892964..17902321   Strand: +
>XM_004840847.1
ATGGATATTAGACCAAATCATACAATTTATATCAACAATATGAATGACAAAATTAAAAAAGAAGAATTGAAGCGATCCCTATATGCACTGTTTTCTCAGTTTGGGCATGTGGTAGATATTGTGGCTTTAAAGACTATGAAGATGCGAGGCCAGGCCTTTGTTATATTTAAAGAACTGGGTTCATCCACAAATGCTTTAAGACAGTTACAAGGATTCCCATTTTATGGCAAACCAATGCGAATCCAGTATGCAAAAACAGATTCTGATATAATATCTAAAATGCGTGGCACTTTTGCTGACAAGGAAAAGAAAAAAGAAAAGAAAAAAGCCAAAACTGTGGAACAAACTGCAACAACTGCAAACAAAAAGCCTGGCCAGGGAATATCAACAACTAATACCCAAGGAAATGCAACAACAAATCCTCAGGTCCCTGATTACCCTCCAAACTATATTTTATTCCTTAATAATTTACCAGAAGAGACTAACGAGATGATGCTGTCTATGCTGTTTAATCAGTTTCCTGGTTTTAAGGAAGTACGCCTGGTACCTGGAAGGCATGACATTGCTTTTGTGGAATTTGAAAATGATGGGCAGGCTGGAGCTGCCAGGGATGCATTACAAGGGTTTAAGATCACACCATCCCATGCAATGAAGATCACCTATGCCAAGAAATAA

XM_004840841.1 Coding sequence

Kif16b kinesin family member 16B, transcript variant X2

Length: 4137 bp    Location: 17750525..17564774   Strand: -
>XM_004840841.1
ATGGCATCTGTCAAGGTGGCCGTGAGAGTTCGGCCCATGAATCGCAGGGAAAAGGACTTGGAGGCCAAGTTCATTATTCAAATGGAGAAAAGCAAGACAACAATCACAAACTTAAAGCTACCAGAAGGAGGGACTGGGGATTCAGGAAGAGAACGCACCAAGACCTTCACCTATGACTTTTCTTTTTATTCTGCTGATACAAAGAGTCCAGATTATATTTCACAAGAAATGATTTTCAAAACCCTGGGCACAGATGTCATGAAATCTGCATTTGAAGGTTATAATGCTTGTGTCTTTGCATATGGGCAAACTGGATCTGGAAAGTCATACACTATGATGGGAGATTCTGGTGATTTGGGCTTAATACCTCGGATCTGTGAAGGGCTCTTCAGTCGGATAAATGAAACCACCCGATGGGATGAAGCATCCTTTCGGACTGAAGTCAGCTACTTAGAAATTTATAATGAACGTGTGAGAGACCTGCTTAGGCGGAAGTCATCTAAAACCTTCAATTTGAGAGTCCGAGAGCATCCAAAAGAAGGACCTTATGTCGAGGATTTATCCAAACATTTAGTACAGAATTATGGTGACGTGGAAGAACTGATGGATGCAGGGAATATCAACCGGACCACAGCAGCAACTGGGATGAACGATGTCAGTAGCAGGTCTCACGCCATCTTCACCATCAAGTTCACTCAGGCAAAGTTTGACTCTGAAATGCCATGTGAAACCGTGAGTAAGATCCACTTAGTCGATCTTGCCGGAAGTGAGCGTGCAGATGCCACTGGTGCCACGGGGGTCCGGCTCAAGGAAGGGGGGAACATTAACAAGTCCCTCGTGACTCTGGGAAATGTCATTTCTGCCTTAGCTGATTTATCTCAGGATGCAGCAAACCCTCTTGTAAAGAAGAAGCAAGTTTTTGTGCCTTACAGGGATTCTGTTTTGACTTGGTTGTTGAAAGATAGCCTTGGAGGAAACTCTAAAACTATCATGATTGCCACCATTTCACCTGCTGATGTCAATTATGGAGAAACCCTAAGTACTCTTCGCTATGCAAATAGAGCCAAAAACATCATCAACAAGCCTACCATTAACGAGGATGCCAACGTCAAACTTATCCGTGAGCTGCGAGCTGAAATAGCCAGGCTGAAAACACTGCTTGCTCAAGGGAATCAGATTGCCCTCTTAGACTCCCCTACAGCTTTAAGTATGGAGGAAAAACTTCAGCAGAATGAAGCAAGAGTTCAAGAATTGACTAAGGAATGGACAAACAAGTGGAATGAAACCCAAAATATTTTGAAAGAACAGACGCTAGCTCTTAGGAAGGAAGGGATTGGGGTTGTTTTGGATTCCGAACTACCTCACCTGATTGGCATTGATGATGACCTTCTGAGCACTGGAATCATCTTATATCACTTGAAGGAAGGTCAGACATATGTTGGTAGAGAAGATGCTTCAATGGAGCAAGATATTGTTCTTCATGGCCTTGACTTGGAGAGTGAGCACTGTGTCTTCGAAAATGTTGGGGGAACAGTGACGCTAATACCCCTGAGTGGTTCTCAGTGCTCTGTGAATGGTGTCCAGATCATGGAGGCCACACATCTAAATCAAGGTGCTGTGATACTCTTGGGAAGAACCAATATGTTTCGTTTTAATCACCCAAAGGAAGCTGCCAAGCTCAGGGAGAAGAGGAAGAGTGGCCTTCTGTCCTCCTTCAGCTTGTCCATGACCGACCTCTCAAAGTCCTGTGAGAACCTGTCTGCAGTCATGTTGTACAACCCCGGACTTGAATTTGAGCGACAACAGCGTGAAGAACTTGAAAAATTAGAAAGTAAGAGGAAGCTGATAGAAGAGATGGAGGAAAAGCAGAAGTCGGACAAGGCAGCGCTGGAGCGCATGCAGCAGGAGGTGGAGACGCAGCGCAAGGAGACAGAAATTGTTAAGCGTGAGATTCGCAAGCAGGAGGAGAGCCTCAAACGCCGCAGCTTCCACATTGAGAACAAGCTCAAGGACCTGCTTGCCGAGAAGGAAAAGTTTGAGGAGGAGAGGCTGCGTGAGCAGCAGGAGATCGAGCTGCAAAAGAAGAGACAGGAGGAAGAGAGCTTTCTCCATTGGCTCCAGGAATTCAGCAGCAGTGAGCAGCCTGAGAAGATGGAGATATTCCAGGAGCTGGACCGGCTGCAGCGGGAAAAAGATGAGCAGCACACCAAGCTGGCTCTGGAGAAGCAGAGGCTGGAGGAGCAGGAGCAGGAGCAGGTGCTGCTGTTGGCACAGCTTGAGGAGCAGCTTCAGGAGAGGCAGGAGATGGCCCCGCTGCTGTATGGCGAGGTTCTGAGGTCAGAGGAGGAAAAGCAGGAGCTTGAGGTCATCCGGGCTGTCCTCCTGCAGGCCAGGAAGGCCCTGGCTACAGGGGACACTGGCAGCCAGGGGCTGGACAGGGCCCAGCTGCATTTCCTAGAGTTCAAAAGAAAGCAGCTCATCCAGCTGGCCACCTCGGAACAAGAACTGGTCCAGCAAAAAGACCTCCTGAGTAAAGAAGTCCAGGAAGATCAGGAAGCCCTGCAGCACTTACAGTGTGAAAAGGATATGGACTGTAGGTTGTCGGCAAAAAATGATGGCCCAAGTATTTCCAGAGTGGCTCACGATTTAGAGAAAATAAAGGCAGCAGAATGCAGGCTGCGGTATAAAGAATGTCAGCTACAGGACCTCCTGCAAAATCACCTGCCAGCCCTGTTGGAAAAAAAGCAGAGAGCACTTGAAGTCCTTGACCAGGGCCCTCTCAGCTTGAACAACACTCTGTATCAAGTGGAAAAAGAAATGGAAGAAAAGGAAGAGCGACTTGCTCAGCACCAAGCCAGTGCCCGCCAGCTGCAGCAGCTCCAGGCCACCTTCGAATTCACCACCAATATCGCGAGACAAGAAGAGAAAGTGAGGAGAAAAGAGAAGGAGATTCTGGAGTCTCAGGAGAAGCAACAGAGAGAGGCACTGGAGCAGGCAGTGGCTAAGCTGTGGCACAGACAGTTGGCCCTGCAACAGCACTCCACCCTGGGCCTAGAGGGTGAGAAAGAGAGGCAGAAGCCAGCAGAGCAGAGCAGCAGCAGTGAGCAATTGGAGCTCCTGGCTGGCCTGGAAGCTGAGCAGGAGAACCTGGAGAAGGACCAGGACAGAATCAATGCTTACATTGAAGAAGAAGTCCAAAGACGTCTTCAGGATTTGCACCGCACAGTTGGTATTGCTAGGAATACTTCTACAGATATAACGAAAGATGAGAAACTTCACAATGACACCATTCAACGTAAGCTAAAATATGAGAAAAGGCAATCTCAGCCAGCACAATGCGTTGTCTCACTTCCGTCCAAAGACACCACTGACACTGCCCACATTGTCATTAGAGAAGAGAGGAGAGAGGCAGCACAGAGCACAGGGCACAGAGCACAGAGGCAGCACAGAGGGCCTGCCGGACCCATCCCCAGAGCACCCTTCCCATCCTTGGCATCATCATCACAGGAGGGAAAGGATCTGTCCTTGGGGGCCGGGGTGCTGCCTGACAGCAGTTGCAAAGATCACTCTGAGCCGTGTGACCACCTGGAGCCAGAGTGCCTTCATCTACCTGAAAGCACTTTTCTTAACAGAAAGGACACCAGCTTTGTTCCAGAGGATTTTCAAGGTGGGTCAGAAAATCTCAGTAAGCCAATGACTCTCAAGGATGAACACAGCTTGAGAGCTGAGTCCAGCTGGACATGGCTGCAGCACACATCCCAACAAGCGTCTACAGATGGCAGAAGCAAGCAGGTCAGGCTGAGCGGAGCTCTCTGCTTTGTTCTCTCAGACACTGCTTCTCAGGAGGAGTGTGCACCTGGCATTGCTCCTCAGAGTGGCCAGACTCTCATGGTTTGTGATGATCAAGACAAGAAAGCTTTAGCTGCTGAACAGATTAGCTCTGCAGCATCACCAATAAATATCAAGGCAGAAGGAAACAGTGGCCTGGGATATTTTTACCACAAGTTCTCAGACCTTTATAAAGATAGCAGTAATCACCTGCTGCATGCTGGCACTGTAGTAATCAGCCGAGCCATGCATGTGGGGAGTTTGTGTGCCCCAAATAGGCTCGCCTCGCACCTGACAGCGTTCTTCTGA

XM_004840836.1 Coding sequence

Flrt3 fibronectin leucine rich transmembrane protein 3, transcript variant X1

Length: 1947 bp    Location: 15355727..15343653   Strand: -
>XM_004840836.1
ATGATCAGCCCAGCCTGGAGCCTCTTCCTCATTGGGACTAAAATTGGGCTGTTCCTGCAAGTGGCACCTCTATCTGTTATGGCTAAATCCTGTCCATCTGTGTGTCGCTGTGATGCTGGTTTCATTTACTGTAATGATCGCTTTCTGACATCCATCCCCACAGGAATACCAGAGGATGCTACAACTCTTTACCTTCAGAACAACCAAATAAATAATGCTGGGATTCCTTCAGATTTGAAAAACTTGCTGAAAGTAGAAAGAATATATCTATACCATAACAGTTTAGATGAGTTTCCTACCAACCTCCCAAAGTATGTAAAAGAGTTACACTTGCAAGAAAATAACATAAGAACTATCACTTATGATTCACTTTCAAAAATTCCATACCTGGAAGAATTACATTTAGATGATAACTCTGTCTCTGCTGTTAGCATTGAAGAAGGAGCATTTCGAGACAGCAACTATCTCCGGCTACTTTTCTTGTCCCGTAATCACCTTAGCACAATTCCCTGGGGTCTGCCCAGGACTATAGAAGAACTACGTTTGGATGATAATCGCATATCCACTATTTCATCACCATCTCTTCAAGGCCTCACTAGTCTAAAACGCCTGGTTTTAGATGGAAACCTGTTGAACAACCATGGTTTAGGTGACAAAGTTTTCTTCAGCCTCGTTAACTTAACAGAACTATCACTGGTAAGGAATTCCTTGACTGCTGCACCAGTAAACCTTCCAGGCACAAACCTGAGGAAGCTTTACCTACAAGATAACCACATCAACCGGGTGCCCCCAAATGCTTTTTCTTATCTAAGGCAGCTGTATCGACTTGATATGTCTAATAATAACCTAAGTAATTTACCTCAGGGTATCTTTGATGATTTGGACAATATAACCCAACTGATTCTTCGCAACAATCCCTGGTATTGTGGCTGCAAGATGAAATGGGTACGTGACTGGTTACAATCACTACCTTTGAAGGTCAACGTGCGGGGGCTCATGTGCCAAGCCCCAGAAAAAGTTCGTGGGATGGCTATCAAGGACCTCAATGCAGAACTGTTTGATTGTAAAGACAGTGGGATTGTAAGCACCATTCAGATAACCACTGCAATACCCAATACACAGTATCCTGCTCAAGGACAGTGGCCAGCTCCAGCGACAAAACAACCAGATATTAAGAACCCCAAGCCTAAGGATCAGCGAACTACAGGGAGCCCCTCAAGAAAAACAATTATAATTACTGTGAAGTCTGTCACCTCTGACACAATACATATCTCCTGGAAACTTGCTCTACCTATGACTGCTTTAAGGCTCAGCTGGCTTAAACTGGGCCACAGCCCAGCATTTGGATCTATAACAGAAACAATTGTAACAGGGGAACGCAGTGAATACTTGGTTACAGCCCTGGAGCCTGACTCACCCTACAGAGTATGCATGGTTCCCATGGAAACCAGCAACCTCTATTTCTTTGATGAAACTCCTGTTTGTATTGAGACTGAAACTGCACCTCTTAGAATGTACAACCCTACAACCACCCTCAATCGAGAGCAAGAGAAAGAACCTTACAAAAACCCTAATTTACCTTTGGCTGCCATCATTGGTGGGGCAGTAGCCCTGGTGACCATTGCCCTTCTTGCTTTAGTGTGTTGGTATGTTCATAGGAATGGATCTCTATTCTCCAGGAACTGTGCATACAGCAAAGGGAGGAGAAGAAAGGATGACTATGCAGAAGCTGGCACTAAGAAGGACAACTCTATCCTGGAAATCAGGGAGACTTCTTTTCAGATGTTACCAATAAATAATGAACCCATCTCAAAGGAGGAGTTTGTAATACACACCATATTTCCTCCTAATGGAATGAATCTGTATAAAAACAATCACAGTGAAAGCAGTAGTAACCGAAGCTACAGAGACAGTGGCATTCCAGACTCAGATCACTCACACTCATGA

XM_004840837.1 Coding sequence

Flrt3 fibronectin leucine rich transmembrane protein 3, transcript variant X2

Length: 1947 bp    Location: 15346953..15343653   Strand: -
>XM_004840837.1
ATGATCAGCCCAGCCTGGAGCCTCTTCCTCATTGGGACTAAAATTGGGCTGTTCCTGCAAGTGGCACCTCTATCTGTTATGGCTAAATCCTGTCCATCTGTGTGTCGCTGTGATGCTGGTTTCATTTACTGTAATGATCGCTTTCTGACATCCATCCCCACAGGAATACCAGAGGATGCTACAACTCTTTACCTTCAGAACAACCAAATAAATAATGCTGGGATTCCTTCAGATTTGAAAAACTTGCTGAAAGTAGAAAGAATATATCTATACCATAACAGTTTAGATGAGTTTCCTACCAACCTCCCAAAGTATGTAAAAGAGTTACACTTGCAAGAAAATAACATAAGAACTATCACTTATGATTCACTTTCAAAAATTCCATACCTGGAAGAATTACATTTAGATGATAACTCTGTCTCTGCTGTTAGCATTGAAGAAGGAGCATTTCGAGACAGCAACTATCTCCGGCTACTTTTCTTGTCCCGTAATCACCTTAGCACAATTCCCTGGGGTCTGCCCAGGACTATAGAAGAACTACGTTTGGATGATAATCGCATATCCACTATTTCATCACCATCTCTTCAAGGCCTCACTAGTCTAAAACGCCTGGTTTTAGATGGAAACCTGTTGAACAACCATGGTTTAGGTGACAAAGTTTTCTTCAGCCTCGTTAACTTAACAGAACTATCACTGGTAAGGAATTCCTTGACTGCTGCACCAGTAAACCTTCCAGGCACAAACCTGAGGAAGCTTTACCTACAAGATAACCACATCAACCGGGTGCCCCCAAATGCTTTTTCTTATCTAAGGCAGCTGTATCGACTTGATATGTCTAATAATAACCTAAGTAATTTACCTCAGGGTATCTTTGATGATTTGGACAATATAACCCAACTGATTCTTCGCAACAATCCCTGGTATTGTGGCTGCAAGATGAAATGGGTACGTGACTGGTTACAATCACTACCTTTGAAGGTCAACGTGCGGGGGCTCATGTGCCAAGCCCCAGAAAAAGTTCGTGGGATGGCTATCAAGGACCTCAATGCAGAACTGTTTGATTGTAAAGACAGTGGGATTGTAAGCACCATTCAGATAACCACTGCAATACCCAATACACAGTATCCTGCTCAAGGACAGTGGCCAGCTCCAGCGACAAAACAACCAGATATTAAGAACCCCAAGCCTAAGGATCAGCGAACTACAGGGAGCCCCTCAAGAAAAACAATTATAATTACTGTGAAGTCTGTCACCTCTGACACAATACATATCTCCTGGAAACTTGCTCTACCTATGACTGCTTTAAGGCTCAGCTGGCTTAAACTGGGCCACAGCCCAGCATTTGGATCTATAACAGAAACAATTGTAACAGGGGAACGCAGTGAATACTTGGTTACAGCCCTGGAGCCTGACTCACCCTACAGAGTATGCATGGTTCCCATGGAAACCAGCAACCTCTATTTCTTTGATGAAACTCCTGTTTGTATTGAGACTGAAACTGCACCTCTTAGAATGTACAACCCTACAACCACCCTCAATCGAGAGCAAGAGAAAGAACCTTACAAAAACCCTAATTTACCTTTGGCTGCCATCATTGGTGGGGCAGTAGCCCTGGTGACCATTGCCCTTCTTGCTTTAGTGTGTTGGTATGTTCATAGGAATGGATCTCTATTCTCCAGGAACTGTGCATACAGCAAAGGGAGGAGAAGAAAGGATGACTATGCAGAAGCTGGCACTAAGAAGGACAACTCTATCCTGGAAATCAGGGAGACTTCTTTTCAGATGTTACCAATAAATAATGAACCCATCTCAAAGGAGGAGTTTGTAATACACACCATATTTCCTCCTAATGGAATGAATCTGTATAAAAACAATCACAGTGAAAGCAGTAGTAACCGAAGCTACAGAGACAGTGGCATTCCAGACTCAGATCACTCACACTCATGA

XM_004840832.1 Coding sequence

Esf1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae), transcript variant X1

Length: 2469 bp    Location: 14778017..14708812   Strand: -
>XM_004840832.1
ATGTCATCCAAACAAGAAATAATGAATGACCAGCGGTTTAGGAAGGTTTCAAAGGACCCCAGATTCTGGGAAATGCCAGAAAAGGATCGAAAAGTCAAAATTGACAAGAGATTTCGAGCCATGTTTCATGACAAAAAGTTCAAATTGAACTATGCAGTTGATAAAAGAGGACGCCCTATCAACCACAGCACTACTGAGGACTTGAAACGTTTCTATGAGCTTTCAGATTCTGATTCTGATCTCTCTGATGAAGATAGCAAACCACTGAATCAACAGAAAATAAAAAAGAAAAACCGCCAGACAAAAAAAGAAATAGATTCAAAAAATATAATTGAGGAAAAGAAAGAAACCAAGAAAATTAATCAGAAGTATCCCGGAAATGATTTAGATGATTCCGAAAGAATTCAGGAAATGAAAAGTTCTAAGAAGATAGATTCAGAAATAAGTCCAAAGAAGGACAGCAAAGAACTTACACAAGAAGGTACAAAAGGAAAAAAAAGCATTATTGAACATAATAGAGACTCTTTTCCCAAAAGAAAACTAAAGACAGACCCAAGCACCTCTAAAACTGTGCAACCTCCCAAGATCAGTTGTTCTAAGACAGAAAGAGAAAAGCAATCAGTGGTTCCAGTCATAATAGGAGATAGTGATGCTAACGTGTCTGACAAAGATGTTCTGGAGGAAGATTCAGACAATGCTGATGAAAGTGATGAGGAATCTGAAGTTGAAATCACAGGTGGTGGTAGAGCTTCAGCTGATGGTGGAAGTGAAGATGAAGATAGTGAGGATGATGATGAAAGTGACAGTGGCCCTGATCTTGCAAGGGGTAAAGGAAATATAGAAACTAGTTCCGAAGATGAAGATGATTTGGCAGATTTATTTCCAGAAGAACCTGGTTTTGAGCATGCTTGGAGAGAATTAGATAAAGATGCGCCCCGGGCTAATGAGATTACACATCGACTAGCAGTTTGCAACATGGACTGGGATCGATTAAAGGCAAAAGATTTACTGGCTCTGTTCAACTCATTTAAGCCTAAAGGAGGTGTTATATTTTCCGTAAAGATATATCCTTCAGAGTTTGGAAAGGAGAGGATGAAGGAAGAGCAAGTTCAAGGACCAGTGGAGTTATTAAGCATTCCTGAAGATGCTCCTGAAAAGGACTGGACCTCTAGAGAAAAATTGAGAGATTATCAGTTCAAACGACTGAAGTACTATTATGCGGTAGTGGACTGTGATTCTCCTGAAACAGCAAGTAAAATTTATGAGGATTGTGATGGCCTCGAATTTGAAAGTAGTTGTTCTTTCATAGATCTAAGGTTTATACCAGATGATATTACTTTTGATGATGAGCCTAAGGATATAGCCTCAGAAGTGGATTTAACAGCGTATAAACCAAAATATTTCACATCTGCTGCAATGGGAACATCAACGGTGGAGATCACTTGGGATGAGACTGATCATGAAAGAATCACAACACTCAACAGGAAATTTAAAAAGGAAGAACTTTTGGACATGGATTTTCAAGCCTACTTAGCTTCCTCTAGTGAAGATGAAGAGTTGATAGAAGAGGAGCCACAAGATAATGATGAAGTCAGTGGAGAAGATGATGGGAAAGCAAAGAAAAGTCAGAAGGATGATGAAGAACAAATTGCTAAATACAGGCAGCTCTTGCAGGTTATTCAAGAAAAAGAAAAGAAAGGCAAAGAAAATGATATGGAAATGGAAATTAAGTGGGTTCCAGGCCTTAAAGAAAGTGCAGAAGAGATGGTAAAAAACAAATTGGAAGGAAAAGATAAACTGACCCCTTGGGAACAATTTTTAGAGAAGAAAAAAGAGAAAAAAAGACTAAAAAAGAAACAGAAGGCTCTTGCTGAAGAGGCTAGTGAAGATGAACTTCCCCCTGATGTCGATTTCAATGACCCATACTTTGCTGAAGAAGTTAAAAAAATAGGTTTAAAGAAAAAATCAATGAAATCTGCAAAAAATGCCACATCTCCAGAGGAAGAAATTGAAATTGAAAGACAAAAGGCTGAAATGGCTTTGCTTGTGATGGATGAGGAGGAAGACAGTAAAAAACACTTCAATTACAATAAGATTGTGGAGCACCAGAATCTAAGCAAAAAGAAGAAGAAACAGCTTATGAAAAAGAAAGAATTATTAGAAGATGACTTTGAGGTAAACGTTAGTGATGCACGATTTCAGGCAATGTATACTTCCCACTTGTTCAATTTGGATCCTTCAGATTCTAATTTCAAGAAAACAAAAGCTATGGAAAAAATCCTTCAGGAGAAAGCCCGGCAAAGAGAACGAAAAGAACAAGAAATTATTCAGGCAATAAAGAAAAAAGAAAGCGAGATTGAAAAGGTATCTCAGAAGAAGTCTATTGATCCTGCCTTGTCAGTGCTGATTAAATCTGTAAAAAACAAAACAGAACAGTTTCAAGCAAGAAAAAAACAAAGAGTCAAATAA

XM_004840821.1 Coding sequence

Mkks McKusick-Kaufman syndrome, transcript variant X3

Length: 1617 bp    Location: 11447634..11425185   Strand: -
>XM_004840821.1
ATGTTGTCTCGATTAGAAGCTAAGAAGCCATCACTGTGTTACAGTGAACCACTCACAACTGAGAAAGTCAGGGCCACACTTTCTGTCTTGAAAGGCATCCTAACATCCTGCTATGGCCCTTCCGGGCGGCTGAAACAGCTGCACAACGGCATGGGGGGCGCTGTGTGCACAACCTCCCAGTCTGCAGTGCTGCTCCGCAACCTCTCAGTCACCCATCCCATATTAAAGATCCTGACAACATCCGTGCAGAACCATGTGTCCTGCTTCAGTGACTGTGGGTTATTCACAGCCATTCTTTGCTGCAACCTAATTGAAAATGTTCAGAAAACAGATTTGACAGTCACCACCACCATTAAACTTAATACACACCTTTTGAATTTCTGTACCAATTATCTCAGGTCTGAGGTCTGTGGTTGCCGAATCCCAGTCGATTTTAGTAATACCCCGATCCTCCTTTGTTTGGTGCGCAGTATTTTAACAAGTAAACCTGCCTGTATGCTCACCAGGAAGGAAATAGATCATATCAGTGTTTTGATTCTTAGAGCTTTTTTGCTTACAATTCCAGAAAACACAGAAGATCCCATCATTTTAGGAAAGAGTATAATTGTACCTTTAAAGGGTCAAAGAGTTACAGATTCTACTGTGTTACCCGGAGTACTCATTGAAGTGTCAGAAGTTCAATTAATGAAGATATTACTTGTCCGAAAATCAAGTCCCCTCAAGGTGGTGCTCTTTTCTACATCTTTATCCGGAGACTTTTCTGACCCTGGAGAAGGAAATGTGGTGGTCAGTGATGGGGTGTTTCTTGAAAATGCAGTCCTGGACCAGTTGATTAACCTAGGAAGGCAGTTAGTTAGTGACCGTGTGGAACTTGTCCTATGCCAAAAAGTTATACACCCGTCTTTGAAACAGTTCCTTACTACGCATCAAGTTATTGCCATAGACAGAGTGGGAGTGATGCTGATGGAGCCCCTAAGCAAAGTGACAGGAGCACAGCCTATTGGTTCCCTAGGCTCAATATCTCCTGGTAGTTATGGAAGCGTGAAAGACTGGTGCTCTGCTAAATTTGGCTGCAAACATTTTTTTCATCTTATTCCTAATGAAGCGACTGTCAGCAGCTTGCTTCTCTGCAACAGAAGTGACACTGCCTGGGATGAGCTGAAGACTTATGAGGAGCCAGGAAGTATTCTCCAAGATGATGGATGTACTCAAGCAGAACTTCAACTAATTGCTGAAGCTTTTTGCAGTGCTCTAGAGTCTCTCGCTGGCTCTTTGGAACATGATGGAGGTGAAATTCTGATTGACATGAAGTATGGACACTTTTGGTCAATTCAGGCAGGTCCTTCCTCTGTTGTTAACTGGACAGATTTGCTTTCTAGATGTGGCTGTGGAGTATACAGTAGCCAGGAAGAACTTGGCTGGTCTTTCTTAAGAAGCACGTGTCATCCTTTTGTACCCCAGACCTGCCTTCCACATGAATCTTGGGAAGTCAGCCCACAATCAGCCCACAGCCTGACCCTGGACTGTTTGACTGCTAAGCTCAGTGGCCTACAGGTGGCTGTAGAGACAGCAAATTTGATATTAGATCTTGCCTATGTCATTGAAGATAAAAGCTGA

XM_004840815.1 Coding sequence

Pak7 p21 protein (Cdc42/Rac)-activated kinase 7

High confidence: 4 potential gene matches
Length: 2124 bp    Location: 10608745..10476203   Strand: -
>XM_004840815.1
ATGTTTGGGAAGAAAAAGAAAAAGATTGAAATTTCTGGCCCATCCAACTTTGAACACAGGGTTCACACTGGGTTTGATCCACAAGAGCAGAAATTCACTGGCCTTCCACAGCAGTGGCACAGCCTGTTAGCAGATACAGCCAACAGGCCGAAGCCCATGGTGGACCCTTCATGCATCACACCCATACAGCTGGCTCCCATGAAGACAATCGTGCGAGGACACAAGCCCTGCCAGGAAAGCTCCATCAACGGGCTGCTGGAGGACTTCGACAGCATCTCTGTGACGCGCTCCAACTCTCTGCGCAAAGAGAGCCCGCTGACGCCAGAGCCAGGCGCGGGCCGGGGCGCTGGCCGGGGCGCCGAGAACGGCTTCCTGAGCTTCTCGCAGTACTCCAGCGAGTCGGACCCCGCGGACTACGCGGCCGAGCCAGTCCGGGAGGCGGCGCTCTACGCGGAAGACCTGGACGCCTTCTACCGGGGCAGCCCGGCTGCCAAGCAGAACGGGCACGTGCCGGCCTTGCGCCCCGCCGAGCCCTGCTACCCCCTGCGCTCCGAGCTCACCCGCTGCCCCGTCGACTACCACGCGCACCTAGACCCCCTGGGCAGAGCCGCCGATCAGGGCGACCTCCGGTGGGAGCCGCCCCGGGCCGCCAGCAGCTCTCCCCTGGACTACGCCTTCGCCTTCCCGCCGCCGCGCACCTCCAAGGAGAGCCTGGCCTACAGTGAGAGCGACTGGGCGCCCGGCCTGGACGACTATGACAGGAGGCCCAAGTCCTCTTACATGACCCAGAGGAGCCCCCAGCCGGCCATGCGGCAGAGATCCAAGTCAGGCTCTGGGCTCCAGGAACCCTTGATGCCATTCGGAGCAAGTGCATTTAAAACCCACCCCCAGGGCCACTCCTACAGCTCCTACACCTACCCTCGCCTGTCTGAGCCCACCATGTGCATTCCGAAGGTGGACTATGATCGAGCACAGATGGTCCTCAGTCCTCCACTGTCTGGGTCCGACACCTACCCCAGGGGCCCCGCCAAACTACCTCAAAGTCAAAGCAAAGCAGGCTATTCTTCAAGCAGCCACCAGTACCCTTCTGGGTACCACAAAGCCAGCCTGTACCACCACCCTTCCCTGCAGACAAGTTCGCAGTACATTTCCACTGCCTCCTACCTGAGCTCTCTCAGCATTTCATCCAGCACCTACCCCCCACCCAGCTGGGGCTCCTCCTCAGACCAGCAGCCCTCCAGGGTGTCCCATGAACAGTTTCGGGCTGCCCTGCAGCTGGTGGTTAGCCCAGGAGACCCAAGGGAATACTTGGATAACTTCATCAAAATCGGAGAAGGGTCAACAGGCATTGTGTGCATTGCAACTGAAAAACACACAGGGAAACAGGTGGCAGTGAAGAAAATGGACCTCCGAAAGCAACAGAGGCGAGAACTGCTTTTCAATGAGGTTGTGATCATGCGGGATTACCACCATGACAATGTGGTTGACATGTACAACAGCTACCTTGTTGGTGATGAACTCTGGGTGGTCATGGAATTTCTAGAAGGTGGTGCCTTGACTGACATTGTGACTCATACCAGAATGAATGAAGAGCAGATAGCTACTGTCTGTCTGTCAGTTCTGAGAGCCCTTTCGTACCTTCACAACCAAGGAGTGATTCATAGGGACATCAAGAGTGACTCCATCCTCCTGACCAGTGACGGCCGAATAAAGTTATCTGACTTTGGTTTCTGTGCTCAAGTGTCCAAAGAGGTGCCAAAGAGGAAATCGCTGGTGGGCACCCCCTACTGGATGGCACCCGAGGTGATTTCTAGGCTGCCTTATGGGACAGAGGTGGATATCTGGTCCCTTGGAATCATGGTGATAGAGATGACTGATGGTGAGCCCCCTTACTTCAATGAGCCTCCCCTCCAGGCAATGAGGAGGATCCGGGACAGTTTACCTCCAAGAGTGAAGGACCTACATAAGGTTTCTTCAGTGCTCCGGGGATTCCTAGACCTGATGTTGGTAAGGGAGCCCTCTCAAAGAGCCACTGCCCAGGAACTCCTTGGACATCCATTCTTAAAACTAGCAGGTCCGCCATCTTGCATCGTTCCCCTCATGAGACAATACAGACACCACTGA

XM_004840809.1 Coding sequence

Plcb1 phospholipase C, beta 1 (phosphoinositide-specific), transcript variant X1

Length: 3666 bp    Location: 9031132..9857899   Strand: +
>XM_004840809.1
ATGGCTGGGGCTCAACCCGGAGTGCATGCCTTGCAACTCAAGCCCGTGTGCGTGTCCGACAGCCTCAAGAAGGGCACCAAATTCGTCAAGTGGGATGATGACTCCACTATTGTTACTCCAATTATTTTGAGGACTGACCCTCAGGGATTTTTCTTTTACTGGACTGATCAAAATAAGGAGACGGAGCTGTTAGATCTCAGCCTTGTCAAGGATGCCAGGTGTGGGAAACATGCCAAGGCTCCTAAGGACCCCAAATTACGTGAACTTCTGGATGTAGGGAACATCGGGCACCTGGAGCATCGCATGATAACGGTGGTTTATGGGCCTGATCTAGTTAACATCTCCCATTTGAATCTCGTGGCTTTCCAAGAAGAAGTGGCCAAGGAATGGACAAATGAGGTTTTCAGTTTGGCAACAAACCTGTTGGCCCAAAACATGTCCAGGGACACATTTTTGGAAAAAGCCTACACTAAACTTAAGCTGCAAGTCACTCCAGAAGGACGCATTCCTCTTAAAAACATCTATCGATTGTTTTCAGCAGACCGAAAGCGAGTTGAAACTGCATTAGAGGCTTGTAGTCTTCCATCTTCAAGGAATGATTCAATACCTCAAGAAGATTTCACTCCAGATGTGTACAGAGTTTTCCTGAACAATCTTTGCCCTCGACCTGAGATTGATAACATCTTTTCTGAATTTGGTGCCAAAAGCAAACCATATCTTACTGTTGATCAGATGATGGATTTTATCAACCTTAAGCAGCGGGACCCCCGGCTAAATGAAATCCTTTATCCACCTCTGAAACATGAGCAAGTCCAAGTATTGATTGAAAAGTATGAACCCAACAATAGCCTTGCCAAAAAAGGACAGATATCGGTGGATGGATTTATGCGCTATCTGAGTGGAGAAGAAAATGGAGTTGTTTCACCTGAGAAACTGGATTTGAATGAAGATATGTCTCAGCCCTTGTCTCACTATTTCATTAACTCCTCACACAACACCTACCTCACAGCTGGCCAGCTGGCTGGAAATTCCTCTGTTGAGATGTATCGCCAAGTGCTTCTGTCTGGGTGTCGTTGTGTGGAGCTGGACTGCTGGAAAGGAAGAACTGCAGAAGAAGAGCCTGTCATCACCCACGGCTTCACCATGACAACTGAAATTTCCTTCAAGGAGGTGATAGAAGCAATCGCAGAGTGTGCATTTAAGACTTCACCTTTTCCAATTCTCCTCTCATTTGAAAACCACGTGGATTCCCCAAAGCAGCAAGCCAAGATGGCAGAGTATTGCCGGTTGATCTTTGGTGATGCCCTTCTCATGGAGCCACTGGAAAAATACCCACTGGAATCTGGAGTCCCTCTTCCAAGCCCTATGGATTTAATGTATAAAATTTTGGTGAAAAACAAGAAGAAATCACACAAGTCATCAGAAGGAAGTGGCAAAAAGAAGCTCTCTGAACAAGCTTCCAACACATACAGCGACTCCTCCAGCATGTTCGAGCCCTCATCCCCAGGAGCCGGTGAGGGGCTGGGAGGCGAAGCTGATACGGAGAGTGACGATGATGAAGATGATGACGACTGTAAAAAGTCTTCCATGGATGAGGGAACTGCTGGGAGTGAGGCTATGGCCACAGAAGAGATGTCTAATCTGGTGAATTATATTCAGCCGGTCAAGTTTGAATCATTTGAAATTTCAAAAAAAAGAAATAAAAGTTTTGAAATGTCTTCCTTTGTGGAAACCAAAGGACTTGAACAACTTACCAAGTCTCCTGTGGAATTTGTAGAATATAACAAAATGCAGCTTAGCAGAATATATCCGAAAGGAACACGTGTGGATTCATCCAACTACATGCCCCAGCTCTTTTGGAACGCCGGCTGTCAGATGGTGGCGCTGAATTTCCAGACAATGGACTTGGCTATGCAAATAAACATGGGGATGTACGAATACAACGGTAAGAGCGGCTACAGATTAAAGCCAGAGTTCATGAGGCGGCCCGACAAGCATTTTGATCCATTTACTGAAGGAATCGTAGATGGGATAGTGGCTAACACATTATCTGTCAAGATTATTTCAGGTCAGTTTCTTTCTGATAAGAAAGTTGGGACCTATGTGGAAGTGGATATGTTTGGTTTGCCTGTGGACACAAGGAGGAAGGCATTTAAGACCAAGACATCCCAAGGAAATGCTGTAAATCCTGTCTGGGAAGAAGAGCCTATTGTATTCAAAAAGGTGGTTCTTCCTTCTCTGGCCTGTTTGAGGATAGCAGTTTATGAAGAGGGAGGTAAATTCATTGGGCATCGGATCTTGCCAGTACAAGCCATTCGGCCAGGGTACCACTACATCTGTCTGAGGAATGAAAGGAACCAGCCTCTGACGCTGCCAGCTGTCTTTGTCTACATAGAAGTGAAAGACTATGTGCCAGATACATATGCAGACGTGATTGAAGCTTTGTCAAACCCAATTCGGTATGTGAATCTGATGGAGCAGAGAGCTAAGCAACTGGCTGCTTTGACACTGGAAGATGAAGAAGAAATAAAGAAAGAGGCTGATCCTGGGGAAACACCATCAGAGGCTCCTAGTGAAGCCAGGACAACTCCAGCAGAAAACGGGGTGAATCACACTACATCCCTGGCACCCAAGCAGCCCTCCCAGGCTTTGCACAGTCAACCAGCTCCAGGTTCTGTAAAGGCTCCTGCCAAAACAGAAGATCTTATTCAGACCGTCTTAACAGAAGTGGAGGCGCAGACTATAGAAGAGCTGAAGCAACAGAAATCATTTGTGAAACTTCAAAAGAAGCATTACAAAGAAATGAAAGACCTGGTTAAGAGACACCACAAGAAAACCACTGACCTGATCAAAGAACACACAACGAAATACAATGAAATTCAGAATGATTACTTGAGAAGGAGGGCAGCCTTGGAAAAGACTGCCAAAAAAGACAGCAAGAAAAAATCGGAACCCAGCAGCCCTGACCATGGCTCATCAACCATCGAGCAAGACCTTGCTGCCCTGGATGCCGAAATGACCCAAAAGTTAATAGACTTGAAGGACAAACAACAGCAGCAGCTACTAAATCTTCGGCAAGAGCAGTATTATAGTGAAAAATACCAGAAGCGAGAACATATTAAACTGCTTATTCAGAAGTTGATGGATGTCGCTGAAGAGTGTCAGAACAGTCAATTAAAGAAGCTCAAAGAAATCTGTGAGAAAGAGAAGAAAGAATTAAAGAAGAAAATGGATAAAAAGAGGCAGGAGAAGATAACAGAAGCTAAATCCAAAGACAAAAGCCAGATGGAAGAGGAGAAGACAGAGATGATTCGGTCATACATCCAGGAAGTGGTGCAGTACATCAAGAGGTTAGAAGAGGCACAAAGTAAAAGGCAAGAAAAACTTGTGGAGAAACACAAGGAGATTCGCCAGCAGATCCTGGATGAAAAGCCCAAGCTTCAGATGGAATTGGAGCAAGAATACCAAGATAAGTTCAAAAGATTGCCCCTGGAGATTTTGGAGTTCGTGCAGGAAGCTATGAAAGGGAAAATCAATGAAGACAGCAATCATGGTTCTGCCCCTGCTTCCCGTGCCTCAGACTCGGGAAAAGTGAACCACAAGACTCCCTCCAGTGAAGAGGTAGAAGGAGAGAACCCAGGAAAGGAGGTTGATACTCCTCTGTGA

XM_004840792.1 Coding sequence

LOC101717821 chromosome unknown open reading frame, human C20orf196, transcript variant X3

Length: 609 bp    Location: 6630786..6749123   Strand: +
>XM_004840792.1
ATGGCTGCCGCAGGCAGCCCGCCGGGAGACAGCTTGGACCTGCCCTCAGCCAGCGCAGTCGGAGACTACGTGCTGCTGCTGCGGAGGCCTGGCGAGGGCGCGGGCGGAGAGAGCCTAAGCTCTGCAGAGTCCCATTCCGTCCCCTGCTCTTCTGACATAGAGCCAGACAGCGGCAACCTAAATGCTGAACAAAAAGACTCTTGGATCTGTGAGAACCTCTGGCCTGACTCTTCTGCCAAAAGCCAGTTGGAGGCCAAGAAAGAGGACAATGGGCTTCGAGAATCCCTGGATAGATTCTATGAAGTGTTCAGCCATCCCCAGCCAGCCTCTGGGGACCCGCTCTTGGCATCTGTCTGCCAGTGCCTGTCTCAGAAAATTGCTGAACTGAGGGGCCAAGGGAGCCAGAAGTACACCCTCCGCAGCTTCCAGATGGCCCGGGTCATCTTCAACCGGGATGGCTGCTCAGTCTTGCGGAAGCACTGCAGGGACACCCGCTTCTACCCACTGCGTGAAGGAAGCACGGCTCTGGATGAGGAAAAGCAGACCCCAGGACTTTCAAAAGCTATCATCCGCTTCCTCTTGCAGCAGAATGTGATGAAAGACCCCTAA

XM_004840810.1 Coding sequence

Plcb1 phospholipase C, beta 1 (phosphoinositide-specific), transcript variant X2

Length: 3651 bp    Location: 9031132..9857899   Strand: +
>XM_004840810.1
ATGGCTGGGGCTCAACCCGGAGTGCATGCCTTGCAACTCAAGCCCGTGTGCGTGTCCGACAGCCTCAAGAAGGGCACCAAATTCGTCAAGTGGGATGATGACTCCACTATTGTTACTCCAATTATTTTGAGGACTGACCCTCAGGGATTTTTCTTTTACTGGACTGATCAAAATAAGGAGACGGAGCTGTTAGATCTCAGCCTTGTCAAGGATGCCAGGTGTGGGAAACATGCCAAGGCTCCTAAGGACCCCAAATTACGTGAACTTCTGGATGTAGGGAACATCGGGCACCTGGAGCATCGCATGATAACGGTGGTTTATGGGCCTGATCTAGTTAACATCTCCCATTTGAATCTCGTGGCTTTCCAAGAAGAAGTGGCCAAGGAATGGACAAATGAGGTTTTCAGTTTGGCAACAAACCTGTTGGCCCAAAACATGTCCAGGGACACATTTTTGGAAAAAGCCTACACTAAACTTAAGCTGCAAGTCACTCCAGAAGGACGCATTCCTCTTAAAAACATCTATCGATTGTTTTCAGCAGACCGAAAGCGAGTTGAAACTGCATTAGAGGCTTGTAGTCTTCCATCTTCAAGGAATGATTCAATACCTCAAGAAGATTTCACTCCAGATGTGTACAGAGTTTTCCTGAACAATCTTTGCCCTCGACCTGAGATTGATAACATCTTTTCTGAATTTGGTGCCAAAAGCAAACCATATCTTACTGTTGATCAGATGATGGATTTTATCAACCTTAAGCAGCGGGACCCCCGGCTAAATGAAATCCTTTATCCACCTCTGAAACATGAGCAAGTCCAAGTATTGATTGAAAAGTATGAACCCAACAATAGCCTTGCCAAAAAAGGACAGATATCGGTGGATGGATTTATGCGCTATCTGAGTGGAGAAGAAAATGGAGTTGTTTCACCTGAGAAACTGGATTTGAATGAAGATATGTCTCAGCCCTTGTCTCACTATTTCATTAACTCCTCACACAACACCTACCTCACAGCTGGCCAGCTGGCTGGAAATTCCTCTGTTGAGATGTATCGCCAAGTGCTTCTGTCTGGGTGTCGTTGTGTGGAGCTGGACTGCTGGAAAGGAAGAACTGCAGAAGAAGAGCCTGTCATCACCCACGGCTTCACCATGACAACTGAAATTTCCTTCAAGGAGGTGATAGAAGCAATCGCAGAGTGTGCATTTAAGACTTCACCTTTTCCAATTCTCCTCTCATTTGAAAACCACGTGGATTCCCCAAAGCAGCAAGCCAAGATGGCAGAGTATTGCCGGTTGATCTTTGGTGATGCCCTTCTCATGGAGCCACTGGAAAAATACCCACTGGAATCTGGAGTCCCTCTTCCAAGCCCTATGGATTTAATGTATAAAATTTTGGTGAAAAACAAGAAGAAATCACACAAGTCATCAGAAGGAAGTGGCAAAAAGAAGCTCTCTGAACAAGCTTCCAACACATACAGCGACTCCTCCAGCATGTTCGAGCCCTCATCCCCAGGAGCCGGCGAAGCTGATACGGAGAGTGACGATGATGAAGATGATGACGACTGTAAAAAGTCTTCCATGGATGAGGGAACTGCTGGGAGTGAGGCTATGGCCACAGAAGAGATGTCTAATCTGGTGAATTATATTCAGCCGGTCAAGTTTGAATCATTTGAAATTTCAAAAAAAAGAAATAAAAGTTTTGAAATGTCTTCCTTTGTGGAAACCAAAGGACTTGAACAACTTACCAAGTCTCCTGTGGAATTTGTAGAATATAACAAAATGCAGCTTAGCAGAATATATCCGAAAGGAACACGTGTGGATTCATCCAACTACATGCCCCAGCTCTTTTGGAACGCCGGCTGTCAGATGGTGGCGCTGAATTTCCAGACAATGGACTTGGCTATGCAAATAAACATGGGGATGTACGAATACAACGGTAAGAGCGGCTACAGATTAAAGCCAGAGTTCATGAGGCGGCCCGACAAGCATTTTGATCCATTTACTGAAGGAATCGTAGATGGGATAGTGGCTAACACATTATCTGTCAAGATTATTTCAGGTCAGTTTCTTTCTGATAAGAAAGTTGGGACCTATGTGGAAGTGGATATGTTTGGTTTGCCTGTGGACACAAGGAGGAAGGCATTTAAGACCAAGACATCCCAAGGAAATGCTGTAAATCCTGTCTGGGAAGAAGAGCCTATTGTATTCAAAAAGGTGGTTCTTCCTTCTCTGGCCTGTTTGAGGATAGCAGTTTATGAAGAGGGAGGTAAATTCATTGGGCATCGGATCTTGCCAGTACAAGCCATTCGGCCAGGGTACCACTACATCTGTCTGAGGAATGAAAGGAACCAGCCTCTGACGCTGCCAGCTGTCTTTGTCTACATAGAAGTGAAAGACTATGTGCCAGATACATATGCAGACGTGATTGAAGCTTTGTCAAACCCAATTCGGTATGTGAATCTGATGGAGCAGAGAGCTAAGCAACTGGCTGCTTTGACACTGGAAGATGAAGAAGAAATAAAGAAAGAGGCTGATCCTGGGGAAACACCATCAGAGGCTCCTAGTGAAGCCAGGACAACTCCAGCAGAAAACGGGGTGAATCACACTACATCCCTGGCACCCAAGCAGCCCTCCCAGGCTTTGCACAGTCAACCAGCTCCAGGTTCTGTAAAGGCTCCTGCCAAAACAGAAGATCTTATTCAGACCGTCTTAACAGAAGTGGAGGCGCAGACTATAGAAGAGCTGAAGCAACAGAAATCATTTGTGAAACTTCAAAAGAAGCATTACAAAGAAATGAAAGACCTGGTTAAGAGACACCACAAGAAAACCACTGACCTGATCAAAGAACACACAACGAAATACAATGAAATTCAGAATGATTACTTGAGAAGGAGGGCAGCCTTGGAAAAGACTGCCAAAAAAGACAGCAAGAAAAAATCGGAACCCAGCAGCCCTGACCATGGCTCATCAACCATCGAGCAAGACCTTGCTGCCCTGGATGCCGAAATGACCCAAAAGTTAATAGACTTGAAGGACAAACAACAGCAGCAGCTACTAAATCTTCGGCAAGAGCAGTATTATAGTGAAAAATACCAGAAGCGAGAACATATTAAACTGCTTATTCAGAAGTTGATGGATGTCGCTGAAGAGTGTCAGAACAGTCAATTAAAGAAGCTCAAAGAAATCTGTGAGAAAGAGAAGAAAGAATTAAAGAAGAAAATGGATAAAAAGAGGCAGGAGAAGATAACAGAAGCTAAATCCAAAGACAAAAGCCAGATGGAAGAGGAGAAGACAGAGATGATTCGGTCATACATCCAGGAAGTGGTGCAGTACATCAAGAGGTTAGAAGAGGCACAAAGTAAAAGGCAAGAAAAACTTGTGGAGAAACACAAGGAGATTCGCCAGCAGATCCTGGATGAAAAGCCCAAGCTTCAGATGGAATTGGAGCAAGAATACCAAGATAAGTTCAAAAGATTGCCCCTGGAGATTTTGGAGTTCGTGCAGGAAGCTATGAAAGGGAAAATCAATGAAGACAGCAATCATGGTTCTGCCCCTGCTTCCCGTGCCTCAGACTCGGGAAAAGTGAACCACAAGACTCCCTCCAGTGAAGAGGTAGAAGGAGAGAACCCAGGAAAGGAGGTTGATACTCCTCTGTGA

XM_004840797.1 Coding sequence

Crls1 cardiolipin synthase 1, transcript variant X1

Length: 897 bp    Location: 6828280..6852071   Strand: +
>XM_004840797.1
ATGCTGACTTGGCGCGTGGCGCGCGGGCCGTGGGGGGCCCTATGTAGGACGGCGTGGGCGCGGGGGGCGCGGCCGGGCCGGGGGCGCGCTCTCGGGGCCCTGCTGCCCGCTTCCGGCTGCCTGGCGGAGCGCCAGTGGCTGCGGCCGGCCGCGCTCGGCCTGCGCCTGCTGGGGCCCGGCGCGCGGCGCCACGGCTCGGGCGCGGGGAAGGCGGGCCCGGGTCCCGCGGCAGAGGGCGGCGCCGCGGCGGAGGCCCTGGGCGGCCGGTGTGGCCCCGCGAGCGCTGCCAGCGCGTATGAAAATCCATGGACAATTCCAAATATGTTGTCAATGACAAGAATTGGCTTGGCTCCAGTTTTGGGCTATTTGATTATTGAAGAAGATTTTAATGTTGCACTCGGAGTCTTTGCTTTAGCTGGACTTACTGATTTGTTGGATGGATTTATTGCTCGAAACTGGGCCAATCAAAAATCAGCTTTGGGAAGTGCTCTTGATCCACTTGCTGATAAAATACTTATCAGTGTATTATATGTTAGCTTGACCTATGCAGATCTTATTCCAGTTCCACTTACTTATATGATAATTTCAAGAGACATAATGTTGATTGCTGCTGTTTTTTATGTCAGATATCGAACTCTCCCAACACCGCGAACACTAGCTAAGTATTTCAATCCTTGCTATGCTACTGCTAGGTTAAAACCAACATTCATCAGTAAGGTGAACACAGCGGTCCAGTTAATCTTGGTGGCAGCTTCTTTGGCAGCTCCAGTTTTCAATTATGCTGACAGCGTTTATCTTCACATACTGTGGTATTTTACAGCTTTCACCACAGCTGCATCAGCTTACAGTTATTATCATTATGGTCGGAAAACTGTTCAAGTGATAAAAGACAGATGA

XM_004840791.1 Coding sequence

LOC101717821 chromosome unknown open reading frame, human C20orf196, transcript variant X2

Length: 657 bp    Location: 6630747..6754096   Strand: +
>XM_004840791.1
ATGGCACCACGGTTTCCGGTTCCGGTCTCTTGCTGTTGTGGGCGGGCGATGGCTGCCGCAGGCAGCCCGCCGGGAGACAGCTTGGACCTGCCCTCAGCCAGCGCAGTCGGAGACTACGTGCTGCTGCTGCGGAGGCCTGGCGAGGGCGCGGGCGGAGAGAGCCTAAGCTCTGCAGAGTCCCATTCCGTCCCCTGCTCTTCTGACATAGAGCCAGACAGCGGCAACCTAAATGCTGAACAAAAAGACTCTTGGATCTGTGAGAACCTCTGGCCTGACTCTTCTGCCAAAAGCCAGTTGGAGGCCAAGAAAGAGGACAATGGGCTTCGAGAATCCCTGGATAGATTCTATGAAGTGTTCAGCCATCCCCAGCCAGCCTCTGGGGACCCGCTCTTGGCATCTGTCTGCCAGTGCCTGTCTCAGAAAATTGCTGAACTGAGGGGCCAAGGGAGCCAGAAGTACACCCTCCGCAGCTTCCAGATGGCCCGGGTCATCTTCAACCGGGATGGCTGCTCAGTCTTGCGGAAGCACTGCAGGGACACCCGCTTCTACCCACTGCGTGAAGGAAGCACGGCTCTGGATGAGGAAAAGCAGACCCCAGGACTTTCAAAAGCTATCATCCGCTTCCTCTTGCAGCAGAATGTGATGAAAGACCCCTAA

XM_004840784.1 Coding sequence

Prokr2 prokineticin receptor 2, transcript variant X2

Length: 1158 bp    Location: 6281398..6270628   Strand: -
>XM_004840784.1
ATGACAGCCCAGAGCAGAAACACCAGCTTTACACCCATCTTTAATCCATCCCAAGACCATGGCTCCTCGCTTTCCTTCAACCTGAGCTATGGCGATTACGACCTACCTCTGGATGAGGATGATGAGGACATGACCAAGACCTGGACCTTCTTCGCAGCCAAGATAGTCATCGGGGTGGCACTGGCAGGCATCATGCTGGTCTGTGGCATTGGCAACTTTATCTTTATTGCTGCCCTTGCCCGCTACAAGAAGCTGCGAAACCTCACCAACCTGCTTATTGCTAACCTGGCCATCTCCGACTTCCTAGTGGCCATTGTCTGCTGCCCCTTTGAGATGGACTACTACGTGGTACGAGAGCTCTCCTGGGAGCATGGCCACATGCTCTGCGCCTCCGTCAACTACCTACGCACTGTCTCCCTCTACGTCTCCACCAATGCCCTGCTGGCCATCGCTATTGACAGGTATCTGGCCATTGTCCACCCCTTGAAGCCAAGGATGAATTACCAAACGGCCTCCTTCCTCATCACTTTGGTCTGGATTGTCTCCATTCTTATTGCCATCCCATCGGCCTACTTCACGACAGAAACCGTCCTCTTTACTGTCAAGAACCAGGAGAAGATTTTCTGCGGCCAGATCTGGCCAGTGGACCAGCAGCTCTACTATAAGTCCTACTTTCTCTTCATCTTTGGCCTGGAGTTTGTGGGCCCCGTGGTCACCATGACCCTGTGCTACGCCAGGATCTCCCGGGAGCTCTGGTTTAAGGCTGTCCCCGGCTTTCAGACCGAGCAGATCCGCAAGCGGCTGCGCTGCCGCCGGAAGACCGTGCTGGTCCTCATGGGCATCCTCACCGCCTATGTGCTGTGCTGGGCGCCCTTCTATGGCTTCACCATCGTGCGCGACTTCTTCCCTTCCGTGTTCGTCAAGGAGAAGCACTACCTCACCGCTTTCTATGTGGTCGAGTGCATTGCCATGAGCAACAGCATGATCAACACCGTGTGCTTCGTGATGGTCAAGAACAACACCATGAAGTACTTCAAGAAGATAATGCTTCTCCACTGGCGTCCCTCCCGCCATGGAAGCAAGTCCAGTGCTGACCTTGACCTCAAAATGAGTGCAGTGCCAGCCACAGAAGAGGTGGACTGTATCCGGCTGAAGTGA

XM_004840786.1 Coding sequence

Gpcpd1 glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae), transcript variant X1

Length: 2016 bp    Location: 6528865..6472621   Strand: -
>XM_004840786.1
ATGACGCCTTCTCAGGTTACCTTTGAAATAAGAGGATCTCTCTTACCAGGAGAAGTTTTTGCAATATGTGGAAGCTGTGATGCTTTGGGAAACTGGAATCCTCAGAATGCTGTGGCTCTTCTAGACAGTGAGACAGGTGACAGCATGTTATGGAAAGCAACCATTGCACTCACTAGGGGAATATCAGTTCTGTATCGCTACTACAAAGGATACTTTTTAGAACCAAAGACTATCGGTGGTCCATGTCAAGTCATAGTTCACAAGTGGGAGACTCATCTACAACCACGATCAATAACCCCTTTAGAAAGTGAAATTATTATTGATGATGGACAATTTGGAATCCACAATGGTGTTGAAACTCTGGATTGTGGATGGCTGACATGCCAGACGGAAATAAGATTACGTTTGCATTATTCTGAAAAACCTCCAGTCTCAATAACCAAGAAAAAATTCAAAAAATCTAGATTTAGAGTAAAGCTTACACTAGAGGGTCCCGAGGAAGACGATGATGATAGGGTATCTCCCACTGTTCTTCATAAAATGTCTAATACCCTGGAGATAGCCTTGATAAGTGACAACGAGTTCAAGTGCAGGCACTCACAGCCAGAGTGTGGGTATGGCCTACAGCCTGACCGTTGGACTGAGTACAGCATACAGACCATGGAGCCGGATAACCTAGAACTAATCTTTGATTTTTTTGAGGAAGATCTCAGTGAACATGTAGTTCAAGGTGACGCCCTTCCAGGACATGTGGGCACAGCATGCCTCTTATCATCCACCATTGCAGAGAGTGGGCGGAGTGCCGGGGTTCTTACCCTTCCTATCATGAGCAGGAATTCCAGGAAAACCATAGGCAAAGTTCGAGTTGACTTTATCATCATTAAGCCATTAACCGGATACAGTTGTGACATGAAATCTTCATTTTCCAAGTATTGGAAACCAAGAATACCACTGGATGTTGGACATCGAGGTGCAGGGAACTCGACAACAACTGCCCAGCTGGCTAAAGTTCAAGAAAATACTATTGCTTCTTTAAGAAACGCTGCTACTCATGGTGCAGCTTTTGTAGAATTTGATGTCCATCTTTCAAAGGACTTTGTGCCTGTGGTGTATCATGATCTTACCTGCTGTTTGACCATGAAAAAGAAATTTGATGCTGATCCAGTTGAATTATTTGAAATTCCAGTAAAGGAACTAACATTCGACCAACTACAGTTATTAAAGCTTTCTCATGTGACAGCACTAAAATCTAAAGATCGGAAAGAATCTGTAGTTGAGGGAGAAAATTCCTTTTCTGAAAACCAGCCATTTCCTTCTCTTAAGATGGTTTTAGAGTCTTTGCCAGAAGATGTAGGGTTTAATATAGAAATAAAGTGGATCTGCCAACAAAGGGATGGAATATGGGATGGTAACTTGTCAACATATTTTGACATGAATCTGTTTTTGGATATAATTCTAAAAAATGTTTTAGAAAACTCTGGAAAGAGAAGAATTGTGTTTTCTTCATTTGATGCAGATATTTGTACAATGGTTCGACAAAAGCAGAACAAATATCCCGTATTGTTTTTGACTCAAGGAAAATCTGATATTTACCCTGAACTTATGGACCTCAGATGTCGGACAACTCCCATTGCAATGAGCTTTGCACAGTTTGAAAATCTTCTGGGGATAAATGCACATACTGAAGACCTGCTCAGAAACCCATCCTATATTCAGGAGGCAAAAGCTAAGGGCCTTGTCATATTCTGTTGGGGCGATGACACCAATGATCCTGAAAACAGAAGGAAGTTGAAAGAATTTGGAGTTAATGGCCTAATTTATGATAGGATATATGATTGGATGCCTGAACAGCCAAATATATTCCAAGTGGAGCAGTTGGAACGCCTGAAGCAAGAATTGCCAGAGCTTAAGAGCTGCTTATGTCCCACTGTTAGCCACTTTGTCTCCTCATCCCTGTGCGGGGACCCTGACAACCATGTGGATGCCAATGGCATTGATAATGTGGAGAGCACTTAG

XM_004840782.1 Coding sequence

Cds2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2, transcript variant X2

Length: 1152 bp    Location: 6212508..6231967   Strand: +
>XM_004840782.1
ATGCCCAGATGGAAGAACTGGTGGGTGAGAGGCATCCTGACTTTGGCCATGATTGCATTTTTCTTCATCATCATTTACCTAGGACCAATGGTTTTAATGATGATCGTGATGTGTGTTCAGATAAAGTGTTTCCACGAGATCATCACTATCGGCTACAATGTCTACCACTCCTATGACCTGCCCTGGTTTAGGACCCTCAGCTGGTACTTTCTGCTGTGTGTAAACTATTTCTTCTATGGTGAGACGGTGACGGATTACTTCTTCACCCTGGTCCAGAGAGAAGAGCCTTTGCGGATTCTCAGTAAATACCACCGGTTCATTTCCTTCACCCTCTACCTAACCGGATTTTGCATGTTTGTACTAAGCCTGGTCAAGAAGCATTATCGACTGCAGTTCTACATGTTTGGCTGGACCCATGTAACACTACTGATTGTTGTAACCCAGTCACATCTCGTTATCCACAACCTGTTTGAAGGAATGATCTGGTTCATTGTCCCCATTTCCTGTGTGATCTGCAATGACATCATGGCCTATATGTTTGGCTTTTTCTTTGGTCGGACCCCACTCATCAAGCTCTCTCCCAAGAAGACATGGGAAGGCTTCATTGGGGGTTTCTTTGCTACTGTGGTGTTTGGCCTTCTGCTGTCCTATGTGATGTCTGGGTACAGATGCTTTGTCTGTCCCGTGGAGTACAACAATGACACCAACAGCTTCACCGTGGACTGTGAGCCTTCAGACCTGTTCCGCCTGCAGGAGTACAACATTCCTGGGGTGATCCATTCGGTCATTGGCTGGAAAACTGTTCGGATGTACCCCTTCCAGATTCACAGCATTGCCCTCTCCACCTTTGCCTCGCTCATAGGCCCTTTTGGAGGCTTCTTCGCAAGCGGCTTCAAGCGAGCCTTTAAAATCAAGGACTTTGCCAATACCATTCCTGGCCACGGAGGCATCATGGATCGCTTTGACTGCCAGTACCTGATGGCCACCTTTGTCAATGTGTACATCGCCAGTTTTATCAGGGGTCCTAACCCGAGCAAGCTGATTCAGCAGTTCCTGACCTTGCGGCCAGATCAGCAGCTCCACATCTTCAACACGCTTAAGTCTCACCTAATGGACAAGGGGATCCTGACACCTGCCGCAGAAGATGAGTAG

XM_004840742.1 Coding sequence

Ap5s1 adaptor-related protein complex 5, sigma 1 subunit, transcript variant X1

Length: 603 bp    Location: 4903492..4907702   Strand: +
>XM_004840742.1
ATGGTCCACGCCTTTCTCATACATACTTTGAGGACCCCGAATGCAGAGGCCACAGGCTTTTGCCGAGTGCTCTACTCTTGCGTCTTTGGTGCTGAGAAGTCACCAGATGATCCAAGGCCACACGGTGCAGAGAGGGACAGGCTCCTCCGAAAGGAACAGATTTTGGCAGTGGCCAGGCAGGTGGAGTCGATGTGTCAACTGCAGCAGCTGGCATCAGGCCGCCCATCCTTGGACCTGCAGACCCAGATCTGTGACGAGCCTGTGCCCCTGCATGAGTCCCCACATGGGGTCTTCGGGCTGGCGGCAGGAGACCCCTTCCGGGAGCCTCACACCGTGGTGTGGTTGGGAGTGCTGTCCCTAGGCTTTGCCCTGGTGCTCGACGCCCATGACAACCTGCTGCTGGCAGAGAGCACACTCCGCCTGCTGGCCCGCCTCCTCCTGGACCACCTCCGTCTGCTGACCCCAGGCTCCAGCCTCCTGCTGCGGGCCGACCATGTTGAGGGCGTCCTCTCCCGCTTCCTGCCCCATGGCCAGCTGCTCTTCCTCAATGACCAGTTCGTCCAGGCTCTGGAGAAGGAATTCAGTGCTTCCTGGCCCCGCTGA

XM_004840772.1 Coding sequence

Prnd prion protein 2 (dublet)

High confidence: 3 potential gene matches
Length: 540 bp    Location: 5814931..5820072   Strand: +
>XM_004840772.1
ATGAAGACTCCCCTGGGTGTGTGGGCACTGGCCCTGGCCTGTGTCCTGCTTCTCTGCCACCTCTCCTCCGTCACGGCGCGGGGCATAAAGCACAGGGTCAAGTGGAGCCGGAAGCCTGCCCCCAGCCCGCCGCAGCAGGTCACCAAGGCCCGAGTGGCCGCGACCCACCCAGGGGCCTTCATCAGGCAGGGCCGCAAGCTGGACATCGACTTCGGAGCCGAGGGCAACCGGTACTATGAGGCCAACTACTGGCAGTTCCCAGACGGCATCCACTATGACGGCTGCTCCGAGGGCAACGTGACCAAGGAGATGCTGGTCACCGGCTGCATCAATGCCACCCAGGCGGCCAACCAGGCCGAGTTCTCCCCGGAGAAGCAGGACAACAAGCTCTACCAGCAGGTCCTGTGGCAGCTGATCAAGGAGCTCTGCTCCATCAAGCACTGTGATTTTTGGTTGGAAAGGGGAGCAGGGTTCCGGGTGGCCATGGACCAGCCAATAATGCTCTGCCTGCTGGTGTTCGTGTGGGTCCTCGTGAAATAA

XM_004840747.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X2

Length: 1590 bp    Location: 4936539..4951064   Strand: +
>XM_004840747.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840724.1 Coding sequence

LOC101696453 glutathione peroxidase 6-like

Length: 663 bp    Location: 4631247..4632086   Strand: +
>XM_004840724.1
ATGCGCCCTGTGCTCTCAGCCACAGGCCTCGGCCTCCTCCTGCTGTTCCTGCTAGGCCTTGCGCAGGACACCCCAAACGCGCAGGAGATGAAGATGGATTGCAACAAAGCTGTGCCAGGCACCATTTACAAGTACAGAGCCCTGACCCTCATGGGCGAGGAATACGTCCAGTTCACGAAGTACTCGGGCAAGCATGTCCTCTTCGTCAACTTGGCCACCTATTGCGGCCTGACCGCCCAGTACCCTGAACTGAATGCACTGCAGGACGAGCTGCGAAGTTTGGGTGTTGTTGTATTGGGCTTTCCTTGTAACCAGTTTGGAAGACAGGAACCAGGAAAGAACTTGCAGATCCTCTCTGGGCTCAGATATGTGCGTCCAGGTGGTGGCTTTGTCCCCAGTTTCCAGCTCTTTGAGAAAGGGGATGTGAATGGAGAAAACGAACAGAAGGTCTTCACCTTTCTGAAGAACTCCTGCCCTCCAACCTCTGAACTTTTGGGGTCACCAGGGCTGCGCTCCTGGGAGCCCATGAAGGTCCACGACATCTGCTGGAACTTTGAGAAGTTCCTGGTGGGGCCGGACGGAATCCCAGTCATGCTCTGGTTCCACAAGGCTCCAGTCAGCACCGTGAGGTCCGAGTACCTGAAGGGGCTCCACGCCCAGTAG

XM_004840723.1 Coding sequence

LOC101726583 cytochrome c-like

Length: 318 bp    Location: 4665987..4664684   Strand: -
>XM_004840723.1
ATGGGTGATTTTGAGAAAGGCAAGAAGATTTTTGTACAGAAGTGTGCCCAGTGCCACACTATGGAGAAGGGAGGCAAGCACAAGACTGGCCCAAATCTCCATGGTCTGTTTGGGCGGAAGACAGGTCAAGCTGTTGGATTCTCTTACACAGATGCCAACAAGAAGAAAGGCATCACCTGGGGAGAGGATACATTGATGGAGTACTTGGAGAATTCCAAGAAGTACATCCCTGGATCAAAAATGATCTTCGTTGGCATTAAGAAGGGAGAGGAAAGGGCAGACTTAATAGCTTACCTCAAAAAAGCTACTAATGAGTAA

XM_004840731.1 Coding sequence

Siglec1 sialic acid binding Ig-like lectin 1, sialoadhesin, transcript variant X3

High confidence: 4 potential gene matches
Length: 5091 bp    Location: 4802866..4781347   Strand: -
>XM_004840731.1
ATGGGCTTCCTGCTCCAGCTGCTCATCTTCGCCTCCATCCTTCCCCCAGGCCAGCCCTCGTGGGGTGTCTCCAGTCCAGAAGGTGTGCAGGGTGTGAAGGGGTCTTGCCTGCTCATCCCCTGCACATTCAGCTTTCCTGCCAATGTGGAGGTGCCCAGTGGCATCACTGCCATCTGGTACTATGACTACTCAGGCAGTCGGCAAGTGGTGAGCCACTCAGCCAGCCCTGAGTTGGTGGAGTCTCGCTTCCGTGGCCGTGCTCAGCTGCTCGGAGACATGAACCACAGAACATGCAGCCTGCTGCTGAGTGACCTGCAGGCTGAGGACACCGGCGCTTACAACTTCCGCTTCGAGATCAGCGAGGGCAACCGCTGGTCAGACGTCAAAGGCACCTTGGTCACCGTGACAGAGGAGCCCCATGCGCCCACCATTACCTCCCCCAAAGAGCTTCGAGAGGGCACAGAGGTGACCTTCAACTGTTCCACAGCCTACGTGTGTCTGCAGAAGCCGGTCAGCCTGCAGTGGCAGGGCCAGGACCCGACTCGTTCTGTCACCTCCATTATCCAGAAACTCGACCCTACGGGTGGTGTCAGCCACATGAAGACCCTCCACATGACCCTGTCCTGGCAGGACCATGGACAGACCCTGCTCTGTCAGCTCTCAGTGGCTGACCACAGGAGTCAGGGCCAGGTCCACCTCCGTGTGCAGCATGCCCCCAAGAGTGTGGAGATCCTCCTCAGCCCCTCGGGGCAGAACATCCTTCCAGGGAATCTGGTCACACTCACTTGCCAAGTGAACAGCAGCTACCCTGTTGTAGACTCCGTGCAGTGGCTCAAGGACGGGGTGCCCCTCAAAGCCAATAGCCGCATGCTGCAGTTGTCCCAGGCGGCCTGGAATGATTCCGGTGTCTACACCTGCCAAGCTGGGAATACAGTGGGCTTTTTGGTCTCACCACCTATCAGCCTCCATGTCTTCATGGCCAAGGTTGAAGTGAGTCCATCAGGCCCCATCCTGGAGAACCAGACCGTGATGCTGTCCTGCGACACACCCAAGGAGGCACCCAGTGAGCTCAGCTACAGCTGGTACAAGAACCAGGTCCTGCTGGAGGATGCCCACACCCCCACCCTCTGGCTGCATGTGGCCACCAGGGCCGATACTGGCTTCTACTCCTGCGAGGTGCAGAACACCCAGGGCAGTGTGCGCTCTGGCCCCGTCAGTGTGGTGGTCAGCCACCCTCCCCTTGTCCCGGACCTGAGTGCCTTCCTAGAGACGCAGGCCAGGCTCGTGGGCATCCTCCAGTGCTCCGTGGTCAGTGAGCCTCTGGCCACACTGGTGCTGTCCCACGCGGACCTCATCATGGCCTCTAGCTCTGGAGAGAGGAACTACAGCCCCCGCTTCACCGTCTTCTCTGCTCCCAACTTCCTGCGCCTAGAGATTCGTGATCTGCAGGCAGCTGACAGTGGGGAATACAAGTGCACAGCTGCCAACTCCCTTGGAAATGCAACCTCCACCCTGGACTTCCATGCCAGCGCTGCCCGGCTCCTCATCAGCCCATCGGCCGAGGTGGTGGAAGGGCAAGCGGTGACTCTGAGCTGCAGGAGCGGCCTGAGCCCAGGGCCCGACACCCGCTTCTCCTGGTACCGGAACGGAGCACTGCTTCTCGAGGGACCCGGCAGCAACCTCCTGCTCCCCGCGGTCTCCAGCACTGATGCTGGCTCTTACCACTGCCGTGCCCAAGACGGACACAGCGCCAGCGGCCCCTCAGTGCCCACTGTCCTCACTGTGTTCTACCCCCCCCACCAGCTCACACTCACTGCCCAGCTGGAACTGCATGCCCCTGGTGCTGAGGCTGGGCGCCGTGGCCTCTTGCTGTGCCGTGTGGACAGCGACCCACCTGCCCATCTACGGCTGCTCCACAGAGAGCATGTAGTGGCCACATCATCAGAGGGTGGCTGCTGTACATGTCAAGGTTGCTCCCCACGCACAAAGGTCACCAACATGCCCAACCTGCTGCGGGTGGAGATTCACAACCCAGTGCTGGAGGATGAGGGCGTGTACCTGTGTGAGGCCAGTAACACCCTGGGCAACGCCTCTGCCTCGGCCACCTTCAACGCCCAGGCCACCGTCCTGGTCATCACCCCATCCAACTCGCTGCAGGAGGGCACAGAGGCCAACCTGACTTGCAGTGTGAGCCAGGAAGCCGCCAGCAGCCCTGCCAACTTCTCCTGGTTCCGGAATGGGGTGCTGTGGGCTCAGGGCCCCCGGGAGACTGTGAGGCTACCATCTGTGGCCAGGACCGACTCTGCCCTGTACACCTGTCACTTCATCACCAAAGCCAGCACCCAGCCCTCAGCGCCTGTGGTCCTGAGTGTGCTCTATCCCCCAGACCCTCCAAAGCTGTCAGCCCTCCTGGACATGGGCCAGGGCCACACAGCCATGTTCATCTGCACTGTGGACAGCCATCCCCTGGCTCAGCTGTCCCTGTTCCATGGGGAGCAACTCCTGGCCACCAGCCATGGACCCCAGCTCTCATCCCATGGTAGGCTCCAGACCAAGGCCACCACCAACTCCCTGCAGCTGGAGGTCCGAGAACTAGCCCTTGGGGACTCTGGTCAGTACCACTGCGAGGCTATAAATGTTCTGGGATCAGCCAACACTTCACTCTTTTTCCACGTCCGAGGAGCCTGGGTCCAGGTCTCACCATCCCCTGAGCTCCAGGCAGGCCAGGCCGTGGTCCTGCACTGTCAGGTGCCCACGGGGGTCCCCGAGGAGGCCTCGTACCTCTGGTTTCGGGATGGCCAGGCCCTCCACGAGTCAACCTCAGCCACGCTGTGCATTGCAGCCATAACTCCGAAGCAAGCTGGTGCCTACCATTGCCAAGTTCAGGCCTCAGGCTCAGCCACCAGCCTGGCTGCCCCCATCAGCCTGCATGTGTCCTATGCCCCACAGCAGGCCACACTCACCACCCTGATGGACATGGGCCCAGGACGACTGGGCCTCATCCTGTGCCATGTGGACAGTGACCCTCCAGCCCAGCTGCGGCTGCTCCACGGAGACCACCTGGTGGCCTCTACCCTGCAAGCTGTGGGGGAAGATGCAGGCAGCGATGCCCGGCTACGGGTGTCCATGACCCCCAACACACTTCGGCTGGAGATCCACAACACAGTGCTGGAAGACGAGGGCGTCTACACCTGTGAGGCCACCAACACCCTGGGGCAGGCCTCAGCTTCAGCTGACTTTGATGCCCAGGCTGTGAGTGTGCAGGTGTGGCCCAAAGCCACCGTGAAGGAGGGGCAGCAAGTGAACCTTACCTGCCTCGTGTGGGCCACCCACCTGGCTCAGCTCACCTACATATGGTATCAGGACGGGCAGAAACGCCCAGGTGCCCGCTCCATCTCCCTGCCCAACGTCACACTTATTGATGCTGCCTCCTATCGCTGTAGTGTGGGGTCCCCTGGACAGGCACCCCGCCTCTCCACACCTGTCACCCTGGATGTCCTCTATGCTCCCCGCAGCCTACGCCTGACCTACCTCTTGGACAGCCATGGTGGCGGGCAGCTGGCCTTGGTGCTGTGCACAGTGGACAGCCGTCCACCTGCCCAGATGGCCCTCAGCCGCGCTGGCCGCCTCCTGGCCTCCTCATCCACAGCCTCTGTCCCCAACACCCTGCGCCTGGAGCTGCAGGAGCCGCGGCCCAGTGACGAAGGGCTGTACTGCTGCTCAGCCCACAGCCCTCTGGGCCAGACCAACACTTCCCTGGAGCTGCGGCTGGAGGGTGTACGGGTGACACTGGCTCCATCAGCTGCTATCCCTGAGGGAACCTCCGTCACAGTGACCTGTGAGGACCCTGCTGCACGCCCACCCATACTTTATTCCTGGTACCACAATGGCCGTTGGCTGCAGGAAGGGACAGCTGCCTCACTTAAGTTCCTGAGGGCCACACGGGCTCACACGGGTGCCTACTCCTGTCAGGTCCATGATGCCCAGGGCACACGCACCTCCCGGCTGGCCTCCTTGCAAGTCCTCTATCCTCCCCGAGATGCTGTCCTTTCTTCCTTCCGCGACTCCAGAACCAGCCCCATGGCCATGGTACAGTGCACTGTGGACAGTGAGCCACCTGCTGAGCTAGCTCTGTCCTACAATGGCACAGTGCTAGCCACCAGCCATGGACTCCATGACTCAGTATCTGAGACTGGTGACATCCAGGTGGCCCGCAATGCCCTGCGGCTGCAGGTGCCAGATATGCCTGCAGATGATGACAACACCTATGTTTGCATGGCCCAAAATTTGCTGGGCTCAGTCAGTACCACCTGGAAGCTACAGGTGGAGGGTGTGCGCGTGGTGGCTGAGCCAGGCCTGGAGGTGCCTGAGGGCACCGCGCTGAACCTGAGCTGCCACCTCCCTCATTCTCCTGGGCTCATGGGCAACTCCACCTTCACATGGTTCCAGAACGGCCGGCCACTGCACACACATCCCATGCCCACTCTGACCTTCAGCCATGTGGGCCGTGCCCAGTCTGGGCTGTACCACTGCCAAGCAGAGCTGCCCTCTGGAGCCTCGGCCTCTGCTCCAGTCATGCTCCGAGTGCTCTACCCGCCCACGACGCCCACCATGACAGTCTTTGTGGAGCCTAAGGGTGGCCTCCGGGGGATCCTGGACTGCCGAGTGGACAGCCAGCCCCTGGCCAGCCTGACCCTCCACCTCGGGAGCAGACTGGTGGCCTCCAGCCAGCTGCAGGGTGCTCCCACAGGGTCGCACATCCATGTCTCAGCCTCCCCTAATGCCCTGAGGGTGGACATGGAGGCTCTAAGGCCCAGAGACCAGGGGGAATATGTGTGTTCTGCCTCCAATGGCCTGGGCTCTGCTTCTGCCTCTGCCTACTTTGGGGTTTCAGCCCTGCACCAGCTGCATTTGTTCCAGTGGCTCCTTTGGGTGCTGGGACTACTGGCTGCCTTCCTGTGCTTGCTGTTAGGCCTGGGGGCCTACTATGTCTGGAGGAAGCGTTCTCAAAATTTGAACACAGGCAGGAATTTGTTGGAGATGGACTTCCCCAATGGACACCATGCAGGAGGAGAAGGAGGAGGAGACTGA

XM_004840734.1 Coding sequence

LOC101699998 chromosome unknown open reading frame, human C20orf27

Length: 525 bp    Location: 4852233..4838261   Strand: -
>XM_004840734.1
ATGGCTGCAGCCAACAAGGGCAACAAACCCAGAGTCCGGAATATCCGCTTTGCAGCAGGCCATGACGCAGAAGGCTCCCACAGCCATGTCCACTTTGATGAGAAGCTGCACGACTCAGTGGTCATGGTCACCCAGGAGAGTGACAGCAGCTTTCTGGTCAAGGTTGGGTTCCTGAAGATCTTGCACAAGTATGAGATTACCTTCACTCTGCCCCCGGTGCGCAGACTGAGCAAGGACATCCGGGAGGCACCAGTCCCCAGTTTGCACCTCAAGCTCCTCAGTGTTGTGCCCATCCCTGAAGGTTACAGTGTCAAGTGTGAGTACTCTGCGCACAAGGAAGGAGTCCTCAAAGAAGAGATGCTGCTGGCCTGTGAGGATGGTGCAGGTGCTTGTGTGCGTGTGACGGTGCAAGCACGAGTCATGGACCGGCACCACGGCACCCCCATGCTGCTGGATGGTGTCAAGTGCGTGGGCGCTGAGCTGGAGTACGACTCGGAGCACAGCGACTGGCATGGCTTCGACTGA

XM_004840730.1 Coding sequence

Siglec1 sialic acid binding Ig-like lectin 1, sialoadhesin, transcript variant X2

Length: 5133 bp    Location: 4802866..4783237   Strand: -
>XM_004840730.1
ATGGGCTTCCTGCTCCAGCTGCTCATCTTCGCCTCCATCCTTCCCCCAGGCCAGCCCTCGTGGGGTGTCTCCAGTCCAGAAGGTGTGCAGGGTGTGAAGGGGTCTTGCCTGCTCATCCCCTGCACATTCAGCTTTCCTGCCAATGTGGAGGTGCCCAGTGGCATCACTGCCATCTGGTACTATGACTACTCAGGCAGTCGGCAAGTGGTGAGCCACTCAGCCAGCCCTGAGTTGGTGGAGTCTCGCTTCCGTGGCCGTGCTCAGCTGCTCGGAGACATGAACCACAGAACATGCAGCCTGCTGCTGAGTGACCTGCAGGCTGAGGACACCGGCGCTTACAACTTCCGCTTCGAGATCAGCGAGGGCAACCGCTGGTCAGACGTCAAAGGCACCTTGGTCACCGTGACAGAGGAGCCCCATGCGCCCACCATTACCTCCCCCAAAGAGCTTCGAGAGGGCACAGAGGTGACCTTCAACTGTTCCACAGCCTACGTGTGTCTGCAGAAGCCGGTCAGCCTGCAGTGGCAGGGCCAGGACCCGACTCGTTCTGTCACCTCCATTATCCAGAAACTCGACCCTACGGGTGGTGTCAGCCACATGAAGACCCTCCACATGACCCTGTCCTGGCAGGACCATGGACAGACCCTGCTCTGTCAGCTCTCAGTGGCTGACCACAGGAGTCAGGGCCAGGTCCACCTCCGTGTGCAGCATGCCCCCAAGAGTGTGGAGATCCTCCTCAGCCCCTCGGGGCAGAACATCCTTCCAGGGAATCTGGTCACACTCACTTGCCAAGTGAACAGCAGCTACCCTGTTGTAGACTCCGTGCAGTGGCTCAAGGACGGGGTGCCCCTCAAAGCCAATAGCCGCATGCTGCAGTTGTCCCAGGCGGCCTGGAATGATTCCGGTGTCTACACCTGCCAAGCTGGGAATACAGTGGGCTTTTTGGTCTCACCACCTATCAGCCTCCATGTCTTCATGGCCAAGGTTGAAGTGAGTCCATCAGGCCCCATCCTGGAGAACCAGACCGTGATGCTGTCCTGCGACACACCCAAGGAGGCACCCAGTGAGCTCAGCTACAGCTGGTACAAGAACCAGGTCCTGCTGGAGGATGCCCACACCCCCACCCTCTGGCTGCATGTGGCCACCAGGGCCGATACTGGCTTCTACTCCTGCGAGGTGCAGAACACCCAGGGCAGTGTGCGCTCTGGCCCCGTCAGTGTGGTGGTCAGCCACCCTCCCCTTGTCCCGGACCTGAGTGCCTTCCTAGAGACGCAGGCCAGGCTCGTGGGCATCCTCCAGTGCTCCGTGGTCAGTGAGCCTCTGGCCACACTGGTGCTGTCCCACGCGGACCTCATCATGGCCTCTAGCTCTGGAGAGAGGAACTACAGCCCCCGCTTCACCGTCTTCTCTGCTCCCAACTTCCTGCGCCTAGAGATTCGTGATCTGCAGGCAGCTGACAGTGGGGAATACAAGTGCACAGCTGCCAACTCCCTTGGAAATGCAACCTCCACCCTGGACTTCCATGCCAGCGCTGCCCGGCTCCTCATCAGCCCATCGGCCGAGGTGGTGGAAGGGCAAGCGGTGACTCTGAGCTGCAGGAGCGGCCTGAGCCCAGGGCCCGACACCCGCTTCTCCTGGTACCGGAACGGAGCACTGCTTCTCGAGGGACCCGGCAGCAACCTCCTGCTCCCCGCGGTCTCCAGCACTGATGCTGGCTCTTACCACTGCCGTGCCCAAGACGGACACAGCGCCAGCGGCCCCTCAGTGCCCACTGTCCTCACTGTGTTCTACCCCCCCCACCAGCTCACACTCACTGCCCAGCTGGAACTGCATGCCCCTGGTGCTGAGGCTGGGCGCCGTGGCCTCTTGCTGTGCCGTGTGGACAGCGACCCACCTGCCCATCTACGGCTGCTCCACAGAGAGCATGTAGTGGCCACATCATCAGAGGGTGGCTGCTGTACATGTCAAGGTTGCTCCCCACGCACAAAGGTCACCAACATGCCCAACCTGCTGCGGGTGGAGATTCACAACCCAGTGCTGGAGGATGAGGGCGTGTACCTGTGTGAGGCCAGTAACACCCTGGGCAACGCCTCTGCCTCGGCCACCTTCAACGCCCAGGCCACCGTCCTGGTCATCACCCCATCCAACTCGCTGCAGGAGGGCACAGAGGCCAACCTGACTTGCAGTGTGAGCCAGGAAGCCGCCAGCAGCCCTGCCAACTTCTCCTGGTTCCGGAATGGGGTGCTGTGGGCTCAGGGCCCCCGGGAGACTGTGAGGCTACCATCTGTGGCCAGGACCGACTCTGCCCTGTACACCTGTCACTTCATCACCAAAGCCAGCACCCAGCCCTCAGCGCCTGTGGTCCTGAGTGTGCTCTATCCCCCAGACCCTCCAAAGCTGTCAGCCCTCCTGGACATGGGCCAGGGCCACACAGCCATGTTCATCTGCACTGTGGACAGCCATCCCCTGGCTCAGCTGTCCCTGTTCCATGGGGAGCAACTCCTGGCCACCAGCCATGGACCCCAGCTCTCATCCCATGGTAGGCTCCAGACCAAGGCCACCACCAACTCCCTGCAGCTGGAGGTCCGAGAACTAGCCCTTGGGGACTCTGGTCAGTACCACTGCGAGGCTATAAATGTTCTGGGATCAGCCAACACTTCACTCTTTTTCCACGTCCGAGGAGCCTGGGTCCAGGTCTCACCATCCCCTGAGCTCCAGGCAGGCCAGGCCGTGGTCCTGCACTGTCAGGTGCCCACGGGGGTCCCCGAGGAGGCCTCGTACCTCTGGTTTCGGGATGGCCAGGCCCTCCACGAGTCAACCTCAGCCACGCTGTGCATTGCAGCCATAACTCCGAAGCAAGCTGGTGCCTACCATTGCCAAGTTCAGGCCTCAGGCTCAGCCACCAGCCTGGCTGCCCCCATCAGCCTGCATGTGTCCTATGCCCCACAGCAGGCCACACTCACCACCCTGATGGACATGGGCCCAGGACGACTGGGCCTCATCCTGTGCCATGTGGACAGTGACCCTCCAGCCCAGCTGCGGCTGCTCCACGGAGACCACCTGGTGGCCTCTACCCTGCAAGCTGTGGGGGAAGATGCAGGCAGCGATGCCCGGCTACGGGTGTCCATGACCCCCAACACACTTCGGCTGGAGATCCACAACACAGTGCTGGAAGACGAGGGCGTCTACACCTGTGAGGCCACCAACACCCTGGGGCAGGCCTCAGCTTCAGCTGACTTTGATGCCCAGGCTGTGAGTGTGCAGGTGTGGCCCAAAGCCACCGTGAAGGAGGGGCAGCAAGTGAACCTTACCTGCCTCGTGTGGGCCACCCACCTGGCTCAGCTCACCTACATATGGTATCAGGACGGGCAGAAACGCCCAGGTGCCCGCTCCATCTCCCTGCCCAACGTCACACTTATTGATGCTGCCTCCTATCGCTGTAGTGTGGGGTCCCCTGGACAGGCACCCCGCCTCTCCACACCTGTCACCCTGGATGTCCTCTATGCTCCCCGCAGCCTACGCCTGACCTACCTCTTGGACAGCCATGGTGGCGGGCAGCTGGCCTTGGTGCTGTGCACAGTGGACAGCCGTCCACCTGCCCAGATGGCCCTCAGCCGCGCTGGCCGCCTCCTGGCCTCCTCATCCACAGCCTCTGTCCCCAACACCCTGCGCCTGGAGCTGCAGGAGCCGCGGCCCAGTGACGAAGGGCTGTACTGCTGCTCAGCCCACAGCCCTCTGGGCCAGACCAACACTTCCCTGGAGCTGCGGCTGGAGGGTGTACGGGTGACACTGGCTCCATCAGCTGCTATCCCTGAGGGAACCTCCGTCACAGTGACCTGTGAGGACCCTGCTGCACGCCCACCCATACTTTATTCCTGGTACCACAATGGCCGTTGGCTGCAGGAAGGGACAGCTGCCTCACTTAAGTTCCTGAGGGCCACACGGGCTCACACGGGTGCCTACTCCTGTCAGGTCCATGATGCCCAGGGCACACGCACCTCCCGGCTGGCCTCCTTGCAAGTCCTCTATCCTCCCCGAGATGCTGTCCTTTCTTCCTTCCGCGACTCCAGAACCAGCCCCATGGCCATGGTACAGTGCACTGTGGACAGTGAGCCACCTGCTGAGCTAGCTCTGTCCTACAATGGCACAGTGCTAGCCACCAGCCATGGACTCCATGACTCAGTATCTGAGACTGGTGACATCCAGGTGGCCCGCAATGCCCTGCGGCTGCAGGTGCCAGATATGCCTGCAGATGATGACAACACCTATGTTTGCATGGCCCAAAATTTGCTGGGCTCAGTCAGTACCACCTGGAAGCTACAGGTGGAGGGTGTGCGCGTGGTGGCTGAGCCAGGCCTGGAGGTGCCTGAGGGCACCGCGCTGAACCTGAGCTGCCACCTCCCTCATTCTCCTGGGCTCATGGGCAACTCCACCTTCACATGGTTCCAGAACGGCCGGCCACTGCACACACATCCCATGCCCACTCTGACCTTCAGCCATGTGGGCCGTGCCCAGTCTGGGCTGTACCACTGCCAAGCAGAGCTGCCCTCTGGAGCCTCGGCCTCTGCTCCAGTCATGCTCCGAGTGCTCTACCCGCCCACGACGCCCACCATGACAGTCTTTGTGGAGCCTAAGGGTGGCCTCCGGGGGATCCTGGACTGCCGAGTGGACAGCCAGCCCCTGGCCAGCCTGACCCTCCACCTCGGGAGCAGACTGGTGGCCTCCAGCCAGCTGCAGGGTGCTCCCACAGGGTCGCACATCCATGTCTCAGCCTCCCCTAATGCCCTGAGGGTGGACATGGAGGCTCTAAGGCCCAGAGACCAGGGGGAATATGTGTGTTCTGCCTCCAATGGCCTGGGCTCTGCTTCTGCCTCTGCCTACTTTGGGGTTTCAGCCCTGCACCAGCTGCATTTGTTCCAGTGGCTCCTTTGGGTGCTGGGACTACTGGCTGCCTTCCTGTGCTTGCTGTTAGGCCTGGGGGCCTACTATGTCTGGAGGAAGCGTTCTCAAAATTTGAACACAGGCAGGAATTTGTTGGAGATGGACTTCCCCAATGGACACCATGCAGGTAAGCACTCTACACACATGGGCACATGTAGGCATAACACTAGCCTGCTCACAGTGCCCAGCTAG

XM_004840729.1 Coding sequence

Siglec1 sialic acid binding Ig-like lectin 1, sialoadhesin, transcript variant X1

Length: 5139 bp    Location: 4802866..4783392   Strand: -
>XM_004840729.1
ATGGGCTTCCTGCTCCAGCTGCTCATCTTCGCCTCCATCCTTCCCCCAGGCCAGCCCTCGTGGGGTGTCTCCAGTCCAGAAGGTGTGCAGGGTGTGAAGGGGTCTTGCCTGCTCATCCCCTGCACATTCAGCTTTCCTGCCAATGTGGAGGTGCCCAGTGGCATCACTGCCATCTGGTACTATGACTACTCAGGCAGTCGGCAAGTGGTGAGCCACTCAGCCAGCCCTGAGTTGGTGGAGTCTCGCTTCCGTGGCCGTGCTCAGCTGCTCGGAGACATGAACCACAGAACATGCAGCCTGCTGCTGAGTGACCTGCAGGCTGAGGACACCGGCGCTTACAACTTCCGCTTCGAGATCAGCGAGGGCAACCGCTGGTCAGACGTCAAAGGCACCTTGGTCACCGTGACAGAGGAGCCCCATGCGCCCACCATTACCTCCCCCAAAGAGCTTCGAGAGGGCACAGAGGTGACCTTCAACTGTTCCACAGCCTACGTGTGTCTGCAGAAGCCGGTCAGCCTGCAGTGGCAGGGCCAGGACCCGACTCGTTCTGTCACCTCCATTATCCAGAAACTCGACCCTACGGGTGGTGTCAGCCACATGAAGACCCTCCACATGACCCTGTCCTGGCAGGACCATGGACAGACCCTGCTCTGTCAGCTCTCAGTGGCTGACCACAGGAGTCAGGGCCAGGTCCACCTCCGTGTGCAGCATGCCCCCAAGAGTGTGGAGATCCTCCTCAGCCCCTCGGGGCAGAACATCCTTCCAGGGAATCTGGTCACACTCACTTGCCAAGTGAACAGCAGCTACCCTGTTGTAGACTCCGTGCAGTGGCTCAAGGACGGGGTGCCCCTCAAAGCCAATAGCCGCATGCTGCAGTTGTCCCAGGCGGCCTGGAATGATTCCGGTGTCTACACCTGCCAAGCTGGGAATACAGTGGGCTTTTTGGTCTCACCACCTATCAGCCTCCATGTCTTCATGGCCAAGGTTGAAGTGAGTCCATCAGGCCCCATCCTGGAGAACCAGACCGTGATGCTGTCCTGCGACACACCCAAGGAGGCACCCAGTGAGCTCAGCTACAGCTGGTACAAGAACCAGGTCCTGCTGGAGGATGCCCACACCCCCACCCTCTGGCTGCATGTGGCCACCAGGGCCGATACTGGCTTCTACTCCTGCGAGGTGCAGAACACCCAGGGCAGTGTGCGCTCTGGCCCCGTCAGTGTGGTGGTCAGCCACCCTCCCCTTGTCCCGGACCTGAGTGCCTTCCTAGAGACGCAGGCCAGGCTCGTGGGCATCCTCCAGTGCTCCGTGGTCAGTGAGCCTCTGGCCACACTGGTGCTGTCCCACGCGGACCTCATCATGGCCTCTAGCTCTGGAGAGAGGAACTACAGCCCCCGCTTCACCGTCTTCTCTGCTCCCAACTTCCTGCGCCTAGAGATTCGTGATCTGCAGGCAGCTGACAGTGGGGAATACAAGTGCACAGCTGCCAACTCCCTTGGAAATGCAACCTCCACCCTGGACTTCCATGCCAGCGCTGCCCGGCTCCTCATCAGCCCATCGGCCGAGGTGGTGGAAGGGCAAGCGGTGACTCTGAGCTGCAGGAGCGGCCTGAGCCCAGGGCCCGACACCCGCTTCTCCTGGTACCGGAACGGAGCACTGCTTCTCGAGGGACCCGGCAGCAACCTCCTGCTCCCCGCGGTCTCCAGCACTGATGCTGGCTCTTACCACTGCCGTGCCCAAGACGGACACAGCGCCAGCGGCCCCTCAGTGCCCACTGTCCTCACTGTGTTCTACCCCCCCCACCAGCTCACACTCACTGCCCAGCTGGAACTGCATGCCCCTGGTGCTGAGGCTGGGCGCCGTGGCCTCTTGCTGTGCCGTGTGGACAGCGACCCACCTGCCCATCTACGGCTGCTCCACAGAGAGCATGTAGTGGCCACATCATCAGAGGGTGGCTGCTGTACATGTCAAGGTTGCTCCCCACGCACAAAGGTCACCAACATGCCCAACCTGCTGCGGGTGGAGATTCACAACCCAGTGCTGGAGGATGAGGGCGTGTACCTGTGTGAGGCCAGTAACACCCTGGGCAACGCCTCTGCCTCGGCCACCTTCAACGCCCAGGCCACCGTCCTGGTCATCACCCCATCCAACTCGCTGCAGGAGGGCACAGAGGCCAACCTGACTTGCAGTGTGAGCCAGGAAGCCGCCAGCAGCCCTGCCAACTTCTCCTGGTTCCGGAATGGGGTGCTGTGGGCTCAGGGCCCCCGGGAGACTGTGAGGCTACCATCTGTGGCCAGGACCGACTCTGCCCTGTACACCTGTCACTTCATCACCAAAGCCAGCACCCAGCCCTCAGCGCCTGTGGTCCTGAGTGTGCTCTATCCCCCAGACCCTCCAAAGCTGTCAGCCCTCCTGGACATGGGCCAGGGCCACACAGCCATGTTCATCTGCACTGTGGACAGCCATCCCCTGGCTCAGCTGTCCCTGTTCCATGGGGAGCAACTCCTGGCCACCAGCCATGGACCCCAGCTCTCATCCCATGGTAGGCTCCAGACCAAGGCCACCACCAACTCCCTGCAGCTGGAGGTCCGAGAACTAGCCCTTGGGGACTCTGGTCAGTACCACTGCGAGGCTATAAATGTTCTGGGATCAGCCAACACTTCACTCTTTTTCCACGTCCGAGGAGCCTGGGTCCAGGTCTCACCATCCCCTGAGCTCCAGGCAGGCCAGGCCGTGGTCCTGCACTGTCAGGTGCCCACGGGGGTCCCCGAGGAGGCCTCGTACCTCTGGTTTCGGGATGGCCAGGCCCTCCACGAGTCAACCTCAGCCACGCTGTGCATTGCAGCCATAACTCCGAAGCAAGCTGGTGCCTACCATTGCCAAGTTCAGGCCTCAGGCTCAGCCACCAGCCTGGCTGCCCCCATCAGCCTGCATGTGTCCTATGCCCCACAGCAGGCCACACTCACCACCCTGATGGACATGGGCCCAGGACGACTGGGCCTCATCCTGTGCCATGTGGACAGTGACCCTCCAGCCCAGCTGCGGCTGCTCCACGGAGACCACCTGGTGGCCTCTACCCTGCAAGCTGTGGGGGAAGATGCAGGCAGCGATGCCCGGCTACGGGTGTCCATGACCCCCAACACACTTCGGCTGGAGATCCACAACACAGTGCTGGAAGACGAGGGCGTCTACACCTGTGAGGCCACCAACACCCTGGGGCAGGCCTCAGCTTCAGCTGACTTTGATGCCCAGGCTGTGAGTGTGCAGGTGTGGCCCAAAGCCACCGTGAAGGAGGGGCAGCAAGTGAACCTTACCTGCCTCGTGTGGGCCACCCACCTGGCTCAGCTCACCTACATATGGTATCAGGACGGGCAGAAACGCCCAGGTGCCCGCTCCATCTCCCTGCCCAACGTCACACTTATTGATGCTGCCTCCTATCGCTGTAGTGTGGGGTCCCCTGGACAGGCACCCCGCCTCTCCACACCTGTCACCCTGGATGTCCTCTATGCTCCCCGCAGCCTACGCCTGACCTACCTCTTGGACAGCCATGGTGGCGGGCAGCTGGCCTTGGTGCTGTGCACAGTGGACAGCCGTCCACCTGCCCAGATGGCCCTCAGCCGCGCTGGCCGCCTCCTGGCCTCCTCATCCACAGCCTCTGTCCCCAACACCCTGCGCCTGGAGCTGCAGGAGCCGCGGCCCAGTGACGAAGGGCTGTACTGCTGCTCAGCCCACAGCCCTCTGGGCCAGACCAACACTTCCCTGGAGCTGCGGCTGGAGGGTGTACGGGTGACACTGGCTCCATCAGCTGCTATCCCTGAGGGAACCTCCGTCACAGTGACCTGTGAGGACCCTGCTGCACGCCCACCCATACTTTATTCCTGGTACCACAATGGCCGTTGGCTGCAGGAAGGGACAGCTGCCTCACTTAAGTTCCTGAGGGCCACACGGGCTCACACGGGTGCCTACTCCTGTCAGGTCCATGATGCCCAGGGCACACGCACCTCCCGGCTGGCCTCCTTGCAAGTCCTCTATCCTCCCCGAGATGCTGTCCTTTCTTCCTTCCGCGACTCCAGAACCAGCCCCATGGCCATGGTACAGTGCACTGTGGACAGTGAGCCACCTGCTGAGCTAGCTCTGTCCTACAATGGCACAGTGCTAGCCACCAGCCATGGACTCCATGACTCAGTATCTGAGACTGGTGACATCCAGGTGGCCCGCAATGCCCTGCGGCTGCAGGTGCCAGATATGCCTGCAGATGATGACAACACCTATGTTTGCATGGCCCAAAATTTGCTGGGCTCAGTCAGTACCACCTGGAAGCTACAGGTGGAGGGTGTGCGCGTGGTGGCTGAGCCAGGCCTGGAGGTGCCTGAGGGCACCGCGCTGAACCTGAGCTGCCACCTCCCTCATTCTCCTGGGCTCATGGGCAACTCCACCTTCACATGGTTCCAGAACGGCCGGCCACTGCACACACATCCCATGCCCACTCTGACCTTCAGCCATGTGGGCCGTGCCCAGTCTGGGCTGTACCACTGCCAAGCAGAGCTGCCCTCTGGAGCCTCGGCCTCTGCTCCAGTCATGCTCCGAGTGCTCTACCCGCCCACGACGCCCACCATGACAGTCTTTGTGGAGCCTAAGGGTGGCCTCCGGGGGATCCTGGACTGCCGAGTGGACAGCCAGCCCCTGGCCAGCCTGACCCTCCACCTCGGGAGCAGACTGGTGGCCTCCAGCCAGCTGCAGGGTGCTCCCACAGGGTCGCACATCCATGTCTCAGCCTCCCCTAATGCCCTGAGGGTGGACATGGAGGCTCTAAGGCCCAGAGACCAGGGGGAATATGTGTGTTCTGCCTCCAATGGCCTGGGCTCTGCTTCTGCCTCTGCCTACTTTGGGGTTTCAGCCCTGCACCAGCTGCATTTGTTCCAGTGGCTCCTTTGGGTGCTGGGACTACTGGCTGCCTTCCTGTGCTTGCTGTTAGGCCTGGGGGCCTACTATGTCTGGAGGTGGGTCTGGGTCATCCCATCCCTTTCCCTCCAGCACCCCCACATCCTTTGGGGGAACCTCCCACCTACCAAGTTCATAGACTGCTACTCCTCCCAATGTGGGAATTCCCCTAGAATTGCATCTACATCCATCTTTCTGTAG

XM_004840732.1 Coding sequence

Hspa12b heat shock 70kD protein 12B, transcript variant X1

Length: 2061 bp    Location: 4818644..4837862   Strand: +
>XM_004840732.1
ATGCTGGCTGTCCCAGAGATGGGCCTGCAGGGGCTGTACATCGGCTCCAGCCCAGAGTGCTCCCCAGTGCCCAGCCCGCCCGGCTCCCCAAGGATCCAGGAAAGCTGCAGCATTGCCCCCCTCACACCCTCACAGTCACCAAAGCCAGAAGCCCGAGTTCCCCAGCAGGCCTCCTTCTCTGTGGTGGTTGCCATTGACTTTGGCACCACATCCAGCGGCTATGCCTTCAGCTTTGCCAGTGACCCAGAGTCCATCCACATGATGAGGAAATGGGAGGGTGGGGATCCTGGCGTGGCCCACCAGAAGACCCCTACCTGCCTGCTGCTGACCCCGGAGGGTACCTTTCACAGTTTTGGCTACACTGCTCGTGATTACTACCATGACCTGGACCCCGAGGAGGCCCGGGACTGGCTCTACTTTGAGAAGTTCAAGATGAAGATCCATAGTGCCACTGATCTCACCTTGAAGACCCAGCTAGAGGCGGTAAATGGAAAGAAGATGCCAGCTCTGGAAGTGTTCGCCCATGCCCTACGCTTCTTCAAGGAGCATGCCCTACAGGAGCTGAGGGAGCAGTGCCCGTCACTGCCAGAAAAGGATACTGTGCGCTGGGTGTTGACAGTGCCTGCCATCTGGAAACAGCCAGCCAAGCAGTTCATGCGGGAGGCCACCTACCTGGCTGGCCTGGTGTCTCGAGAGAATGCAGAACAGCTACTCATCGCTCTGGAGCCTGAGGCCGCCTCTGTCTACTGCCGGAAGCTGCGGCTGCACCAGCTCATGGACCTGAGTAGCAGAGCCCCAAGTGGTGGGCGACTGGGCGAGCGCCGCTCCATCGACTCCAGCTTCCGGCAGGCCCGTGAGCAGCTGCGAAGGTCCCGCCACAGCCGCACATTCCTGGTGGAGTCGGGCGTGGGAGAGCTGTGGGCAGAGATGCAAGCAGGGGATCGCTACATGGTGGCAGACTGTGGGGGAGGCACTGTGGACCTGACAGTGCACCAGCTGGAACAGCCCCATGGCACCCTGAAGGAGCTCTACAAGGCATCCGGAGGCCCCTATGGCGCGGTGGGCGTGGACTTGGCCTTTGAGCAGTTACTCTGCCGCATCTTCGGAGAGGACTTCATCGCCACTTTCAAAAAGCAAAGGCCAGCAGCTTGGGTGGATCTGACCATCGCCTTCGAGGCCCGCAAACGCACAGCGGGCCCGCACCGAGCGGGGCCGCTCAATATCTCGCTGCCTTTCTCCTTCATTGACTTCTACCGAAAGCAGCGAGGCCACAACGTGGAGACGGCCTTGCGCAGGAGCAGTGTGAACTTCGTGAAGTGGTCCTCGCAAGGGATGCTTCGGATGTCTTGTGAGGCCATGAACGAGCTCTTTCAGCCCACGGTCAGTGGGATCATCCAGCACATAGAGGCGCTGCTGGCGCGGCCCGAAGTGCAGGGTGTGAAGCTGCTGTTCCTGGTGGGCGGCTTCGCAGAGTCGCCAGTGCTACAGCATGCAGTGCAGGTGGCGCTGGGCGCCCGCGGTCTGCGCGTTGTGGTCCCGCACGACGTCAGCCTCACCATCCTCAAGGGCGCCGTGCTCTTTGGCCAGGCGCCCGGCGTGGTGCGCGTGCGCCGCTCGCCGCTCACCTATGGCGTGGGTGTCCTCAACCGCTTCGTGGAGGGACGTCACCCACCCGACAAGCTGCTCGTGCGCGACGGCCGCCGCTGGTGCACCGACGTCTTCGAGCGCTTCGTGGCCGCCGAGCAGTCAGTGGCCCTAGGCGAAGAGGTGCGGCGAAGCTACTGCCCGGCGCGCCCCGGCCAGCGGCGCGTGCTCATCAACTTGTACTGCTGCGCCGCTGAAGACGCGCTCTTCATCACCGACCCCGGCGTGCGCAAGTGCGGCGCGCTCAGCCTGGAGCTCGAAGCTGCTGAGGGCGGCCCGGACAGCGCCGGCACGGCCCCCGGGCGCCGCGAGATCCGTGCGGCCATGCAGTTTGGCGACACTGAGATTAAGGTCACCGCCGTAGACGTCAGCACCAATCGCTCTGTGCGCGCCGCTATTGACTTTCTTTCCAACTGA

XM_004840720.1 Coding sequence

Itpa inosine triphosphatase (nucleoside triphosphate pyrophosphatase), transcript variant X1

Length: 714 bp    Location: 4312360..4325825   Strand: +
>XM_004840720.1
ATGGGCTTCCGGAGCTCTGAGGGCTATCTCCTGTTCGCAATGGCGGCGTCCTTTGCCGGGAAGAAAATCGTGTTTGTAACAGGGAATGCCAAGAAGCTGGAGGAGGTGCGGGGAGCGTGCGTGGGGCCGAGCGGAAGGCGCTTGGGAATAGGGGTCGTTCAGATTCTAGGAGATAAGTTTCCATGCACTTTGGTGGCACAGAAGATTGACTTGCCAGAGTACCAGGGCGAGCCAGATGAAATTTCCATTCAGAAGTGTCGGGAGGCTGCGCGCCAGGTGCAGGGACCCGTCCTGGTAGAAGATACCTGTTTGTGCTTCAGTGCCCTTGGTGGGCTTCCTGGCCCCTACATAAAATGGTTTCTGGAGAAGTTAAAGCCTGAAGGTTTGCACCAACTCCTGGCTGGCTTCGAGGACAAATCGGCTTATGCACTCTGCACGTTCGCGCTCAGCACAGGGGACCCAAGCGAGCCTGTGAGCCTGTTCAGGGGCCGGACCTCGGGCCAGATTGTAGCTCCCCGAGGCTGCCGGGACTTTGGCTGGGACCCCTGCTTTCAGCCTGATGGATACGAGCAGACGTACGCTGAGATGCCCAAGGCAGAGAAGAATGCCATCTCCCATCGCTTCCGGGCCCTGCTTGAGCTGCAGCAGTACTTTGGCAGCTTGACTCCTGGGGCTGGAGGAGGTGCCTCGGGCTGGGGATCTGGGGAGAGCTAG

XM_004840722.1 Coding sequence

Itpa inosine triphosphatase (nucleoside triphosphate pyrophosphatase), transcript variant X3

Length: 543 bp    Location: 4312360..4325825   Strand: +
>XM_004840722.1
ATGGGCTTCCGGAGCTCTGAGGGCTATCTCCTGTTCGCAATGGCGGCGTCCTTTGCCGGGAAGAAAATCGTGTTTGTAACAGGGAATGCCAAGAAGCTGGAGGAGGTGCAGGGACCCGTCCTGGTAGAAGATACCTGTTTGTGCTTCAGTGCCCTTGGTGGGCTTCCTGGCCCCTACATAAAATGGTTTCTGGAGAAGTTAAAGCCTGAAGGTTTGCACCAACTCCTGGCTGGCTTCGAGGACAAATCGGCTTATGCACTCTGCACGTTCGCGCTCAGCACAGGGGACCCAAGCGAGCCTGTGAGCCTGTTCAGGGGCCGGACCTCGGGCCAGATTGTAGCTCCCCGAGGCTGCCGGGACTTTGGCTGGGACCCCTGCTTTCAGCCTGATGGATACGAGCAGACGTACGCTGAGATGCCCAAGGCAGAGAAGAATGCCATCTCCCATCGCTTCCGGGCCCTGCTTGAGCTGCAGCAGTACTTTGGCAGCTTGACTCCTGGGGCTGGAGGAGGTGCCTCGGGCTGGGGATCTGGGGAGAGCTAG

XM_004840714.1 Coding sequence

Slc4a11 solute carrier family 4, sodium borate transporter, member 11, transcript variant X2

Length: 2730 bp    Location: 4339877..4328675   Strand: -
>XM_004840714.1
ATGGCCGCGGCCAGCAGGCGCGTGTTCCATCTCCAGCCGTGCGAAAGCTCCTCTTTGGCCACATCAAGGAATGGATGCCTTGAGGACTCCAGTGAGTACTTCTCAGCTGCATCCCTGAGCTACCTCAAGAATGATGTGGACAATGCTTCAGAGGTCCGGGAAGAAAGCCTGGGGGATGAGGTCTTTGACACGGTCAACTCCTCCATCGTGTCTGGCGAGAGCATCCAGTTTTTCGTCAATGTCAACCTTGAGGTGCAGCCCTCCATATCTGGTGAAGCGCTGTCTGGCTGCGTGCTCCTGCACACATCCCGCAAGTACCTGAAGTTAAAGAACTTTGGGGAAGAGATCCGAGCACACCGGGACCTGGATGGCTTCCTGGCCCAGGCCAGCATCATCCTGAATGAAACAGCCACCTCCTTGGATGATGTGCTACGCACCATGCTGAGCCGCTTTGCCCAGGACCCCAACAACGCTGAACCCGACTGCAACTTGGACCTAATCATGGCCAAGCTCTTTACGGATGCAGGGGGCCCCACGGAGAGTAAAGTGCACCTGCTGTCAGATACCATCCAAGGGGTCACAGCCACGGTGAGAGGGGTGCAGTACCAGCAGTCATGGCTCTGCATCATCTGTACCATGAAAGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTGGTTCGCCCACAGAACTGGGGCGAAAACTCCTGTGAGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAAATGAAAAGCACCAAGACTGCAATGGAGGTGGCACGCACCTTCGCCACCATGTTTTCAGACATCACCTTCCGCCAGAAGCTCCTGAAGACCCGCACAGAGGACGAATTCAAGGAGGCATTGGTGCATCAGAGACAGCTGCTCACCATGACAATACCAAGAGCAAATGGACATGGCACAGGCTCCTTCCATGGCCATAGACACCCACAGCCCCCAAAGTGCAAGGACTTTATCCCTTTTGGGAGGGGCATCCGGGAAGACATCATGCGCAGGTTTCCTGTATACCCACTGGACTTCACTGATGGCATTATCGGGAAAAGCAAGGCTGTGGGCAAATACATAACCACCACCCTGTTCCTCTACTTCGCCTGCCTCCTGCCCACAATTGCTTTTGGATCCCTGAATGATGAGAACACAAATGGGGCCATTGATGTTCAGAAGACCATAGCTGGCCAGAGTATAGGAGGCCTCTTGTACGCGATCTTCTCCGGGCAGCCGCTGGTGATTCTGCTGACGACTGCACCCCTGGCCATCTACACCCAGGTGATTCGTGTCATCTGTGATGACTACAACTTGGACTTCAATGCTTTCTATGCGTGGACAGGCCTGTGGAACAGTTTCTTCCTTGCACTCTATGCCTTCTTCAACCTCAGCCTGGTCATGAGTCTCTTCAAGAGGTCAACAGAGGAAATCATTGCCCTGTTCATTTCCATCACCTTCGTGCTGGATGCTGTCAAGGGCATGATCAAAATCTTCTGGAAGTACTACTACGGTTACCACCACACAAAGAGAACAGATACCAGCCTCAACTCTGGCATCCACACAGCCTTCAACACCAATCTCCTGGCTGGTTCCATTGAGCTGGATGCCTCAAGCAGCCCAGATGCTGTGCACTCTGGCCAGGCAACTGCAGTGCTCAGCCTCCTCATCATGCTGGGTACCCTCTGGCTGGGCTACACTCTCTACCAGTTCAAGAAGAGCCCCTACCTGCACCCATATGTGCGAGAGATCCTGTCCGACTGTGCCCTGCCCATTGCAGTGCTCACCTTCTCCCTCCTCAGCTCCTATGGCTTCCAGGAAATTGAGATGAGCAGGTTCCGCTACAACCCCAGCGAGAACCTGTTTGAGGTGGCACAGATCGACTCACTGTCCCTGGGAGCCATTGGCAGTGCCATGGTCCTCGGTTTCCTGCTCTCCCTGCTCTTCTTCATCGAGCAGAACCTGGTGGCTGCCTTGGTCAATGCACCAGAGAACAGGCTGGTGAAAGGCACTGCCTACCACTGGGATCTCCTGCTCCTAGCCATCATCAACACGGGGCTGTCCCTATTTGGGCTGCCCTGGATCCACGCTGCCTACCCCCACTCTCCACTGCACGTGCGGGCCCTAGCTTTAGTGGAGGAGCGAGTGGAGAATGGGCACATTTATGAGACAATTGTGAATGTGAAGGAGACGAGGCTGACATCTCTGGGCGCCAGCATGCTAGTGGGTCTGTCCCTCCTGCTGCTGCCTTTCCCACTGCAGTGGATCCCCAAGCCTGTGCTCTATGGCCTCTTCCTCTACATTGCGCTTACCTCCTTGGATGGCAACCAGCTCTTCTCTCGTGTGGCCCTGCTGCTCAAGGAGCAGACATCATACCCACCCACCCACTACGTTCGGAGGGTGCCCCAGAGGAAGATCCACTACTTCACAGGCCTGCAGGTCCTGCAGCTGCTACTGCTCTGCGCCTTCGGCATGAGCACCCTGCCCTACATGAAGATGATCTTCCCCCTCATCATGATTCTCATGATTCCCATCCGGTACAGGCGGGCAGGAAGGGCAGCCCAGGGCTGTGTTGTGCGGGCTGTGCTGGGTGCCTGCCACCTTCTCTCTGACCACTCACAGCTCATCTGCATACCTCTCCCTCCTGTCCACAGCTACATCCTGCTGCCCCGAATCATTGAAGCCAAGTACTTGGATGCCATGGACGCTGAGCACTGGTCCTGA

XM_004840715.1 Coding sequence

Slc4a11 solute carrier family 4, sodium borate transporter, member 11, transcript variant X3

Length: 2658 bp    Location: 4339877..4328675   Strand: -
>XM_004840715.1
ATGGCCGCGGCCAGCAGGCGCGTGTTCCATCTCCAGCCGTGCGAAAGCTCCTCTTTGGCCACATCAAGGAATGGATGCCTTGAGGACTCCAGTGAGTACTTCTCAGCTGCATCCCTGAGCTACCTCAAGAATGATGTGGACAATGCTTCAGAGGTCCGGGAAGAAAGCCTGGGGGATGAGGTCTTTGACACGGTCAACTCCTCCATCGTGTCTGGCGAGAGCATCCAGTTTTTCGTCAATGTCAACCTTGAGGTGCAGCCCTCCATATCTGAAGGTGAAGCGCTGTCTGGCTGCGTGCTCCTGCACACATCCCGCAAGTACCTGAAGTTAAAGAACTTTGGGGAAGAGATCCGAGCACACCGGGACCTGGATGGCTTCCTGGCCCAGGCCAGCATCATCCTGAATGAAACAGCCACCTCCTTGGATGATGTGCTACGCACCATGCTGAGCCGCTTTGCCCAGGACCCCAACAACGCTGAACCCGACTGCAACTTGGACCTAATCATGGCCAAGCTCTTTACGGATGCAGGGGGCCCCACGGAGAGTAAAGTGCACCTGCTGTCAGATACCATCCAAGGGGTCACAGCCACGGTGAGAGGGGTGCAGTACCAGCAGTCATGGCTCTGCATCATCTGTACCATGAAAGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTGGTTCGCCCACAGAACTGGGGCGAAAACTCCTGTGAGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAAATGAAAAGCACCAAGACTGCAATGGAGGTGGCACGCACCTTCGCCACCATGTTTTCAGACATCACCTTCCGCCAGAAGCTCCTGAAGACCCGCACAGAGGACGAATTCAAGGAGGCATTGGTGCATCAGAGACAGCTGCTCACCATGACAATACCAAGAGCAAATGGACATGGCACAGGCTCCTTCCATGGCCATAGACACCCACAGCCCCCAAAGTGCAAGGACTTTATCCCTTTTGGGAGGGGCATCCGGGAAGACATCATGCGCAGGTTTCCTGTATACCCACTGGACTTCACTGATGGCATTATCGGGAAAAGCAAGGCTGTGGGCAAATACATAACCACCACCCTGTTCCTCTACTTCGCCTGCCTCCTGCCCACAATTGCTTTTGGATCCCTGAATGATGAGAACACAAATGGGGCCATTGATGTTCAGAAGACCATAGCTGGCCAGAGTATAGGAGGCCTCTTGTACGCGATCTTCTCCGGGCAGCCGCTGGTGATTCTGCTGACGACTGCACCCCTGGCCATCTACACCCAGGTGATTCGTGTCATCTGTGATGACTACAACTTGGACTTCAATGCTTTCTATGCGTGGACAGGCCTGTGGAACAGTTTCTTCCTTGCACTCTATGCCTTCTTCAACCTCAGCCTGGTCATGAGTCTCTTCAAGAGGTCAACAGAGGAAATCATTGCCCTGTTCATTTCCATCACCTTCGTGCTGGATGCTGTCAAGGGCATGATCAAAACCTTCAACACCAATCTCCTGGCTGGTTCCATTGAGCTGGATGCCTCAAGCAGCCCAGATGCTGTGCACTCTGGCCAGGCAACTGCAGTGCTCAGCCTCCTCATCATGCTGGGTACCCTCTGGCTGGGCTACACTCTCTACCAGTTCAAGAAGAGCCCCTACCTGCACCCATATGTGCGAGAGATCCTGTCCGACTGTGCCCTGCCCATTGCAGTGCTCACCTTCTCCCTCCTCAGCTCCTATGGCTTCCAGGAAATTGAGATGAGCAGGTTCCGCTACAACCCCAGCGAGAACCTGTTTGAGGTGGCACAGATCGACTCACTGTCCCTGGGAGCCATTGGCAGTGCCATGGTCCTCGGTTTCCTGCTCTCCCTGCTCTTCTTCATCGAGCAGAACCTGGTGGCTGCCTTGGTCAATGCACCAGAGAACAGGCTGGTGAAAGGCACTGCCTACCACTGGGATCTCCTGCTCCTAGCCATCATCAACACGGGGCTGTCCCTATTTGGGCTGCCCTGGATCCACGCTGCCTACCCCCACTCTCCACTGCACGTGCGGGCCCTAGCTTTAGTGGAGGAGCGAGTGGAGAATGGGCACATTTATGAGACAATTGTGAATGTGAAGGAGACGAGGCTGACATCTCTGGGCGCCAGCATGCTAGTGGGTCTGTCCCTCCTGCTGCTGCCTTTCCCACTGCAGTGGATCCCCAAGCCTGTGCTCTATGGCCTCTTCCTCTACATTGCGCTTACCTCCTTGGATGGCAACCAGCTCTTCTCTCGTGTGGCCCTGCTGCTCAAGGAGCAGACATCATACCCACCCACCCACTACGTTCGGAGGGTGCCCCAGAGGAAGATCCACTACTTCACAGGCCTGCAGGTCCTGCAGCTGCTACTGCTCTGCGCCTTCGGCATGAGCACCCTGCCCTACATGAAGATGATCTTCCCCCTCATCATGATTCTCATGATTCCCATCCGGTACAGGCGGGCAGGAAGGGCAGCCCAGGGCTGTGTTGTGCGGGCTGTGCTGGGTGCCTGCCACCTTCTCTCTGACCACTCACAGCTCATCTGCATACCTCTCCCTCCTGTCCACAGCTACATCCTGCTGCCCCGAATCATTGAAGCCAAGTACTTGGATGCCATGGACGCTGAGCACTGGTCCTGA

XM_004840713.1 Coding sequence

Slc4a11 solute carrier family 4, sodium borate transporter, member 11, transcript variant X1

Length: 2733 bp    Location: 4339877..4328675   Strand: -
>XM_004840713.1
ATGGCCGCGGCCAGCAGGCGCGTGTTCCATCTCCAGCCGTGCGAAAGCTCCTCTTTGGCCACATCAAGGAATGGATGCCTTGAGGACTCCAGTGAGTACTTCTCAGCTGCATCCCTGAGCTACCTCAAGAATGATGTGGACAATGCTTCAGAGGTCCGGGAAGAAAGCCTGGGGGATGAGGTCTTTGACACGGTCAACTCCTCCATCGTGTCTGGCGAGAGCATCCAGTTTTTCGTCAATGTCAACCTTGAGGTGCAGCCCTCCATATCTGAAGGTGAAGCGCTGTCTGGCTGCGTGCTCCTGCACACATCCCGCAAGTACCTGAAGTTAAAGAACTTTGGGGAAGAGATCCGAGCACACCGGGACCTGGATGGCTTCCTGGCCCAGGCCAGCATCATCCTGAATGAAACAGCCACCTCCTTGGATGATGTGCTACGCACCATGCTGAGCCGCTTTGCCCAGGACCCCAACAACGCTGAACCCGACTGCAACTTGGACCTAATCATGGCCAAGCTCTTTACGGATGCAGGGGGCCCCACGGAGAGTAAAGTGCACCTGCTGTCAGATACCATCCAAGGGGTCACAGCCACGGTGAGAGGGGTGCAGTACCAGCAGTCATGGCTCTGCATCATCTGTACCATGAAAGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTGGTTCGCCCACAGAACTGGGGCGAAAACTCCTGTGAGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAAATGAAAAGCACCAAGACTGCAATGGAGGTGGCACGCACCTTCGCCACCATGTTTTCAGACATCACCTTCCGCCAGAAGCTCCTGAAGACCCGCACAGAGGACGAATTCAAGGAGGCATTGGTGCATCAGAGACAGCTGCTCACCATGACAATACCAAGAGCAAATGGACATGGCACAGGCTCCTTCCATGGCCATAGACACCCACAGCCCCCAAAGTGCAAGGACTTTATCCCTTTTGGGAGGGGCATCCGGGAAGACATCATGCGCAGGTTTCCTGTATACCCACTGGACTTCACTGATGGCATTATCGGGAAAAGCAAGGCTGTGGGCAAATACATAACCACCACCCTGTTCCTCTACTTCGCCTGCCTCCTGCCCACAATTGCTTTTGGATCCCTGAATGATGAGAACACAAATGGGGCCATTGATGTTCAGAAGACCATAGCTGGCCAGAGTATAGGAGGCCTCTTGTACGCGATCTTCTCCGGGCAGCCGCTGGTGATTCTGCTGACGACTGCACCCCTGGCCATCTACACCCAGGTGATTCGTGTCATCTGTGATGACTACAACTTGGACTTCAATGCTTTCTATGCGTGGACAGGCCTGTGGAACAGTTTCTTCCTTGCACTCTATGCCTTCTTCAACCTCAGCCTGGTCATGAGTCTCTTCAAGAGGTCAACAGAGGAAATCATTGCCCTGTTCATTTCCATCACCTTCGTGCTGGATGCTGTCAAGGGCATGATCAAAATCTTCTGGAAGTACTACTACGGTTACCACCACACAAAGAGAACAGATACCAGCCTCAACTCTGGCATCCACACAGCCTTCAACACCAATCTCCTGGCTGGTTCCATTGAGCTGGATGCCTCAAGCAGCCCAGATGCTGTGCACTCTGGCCAGGCAACTGCAGTGCTCAGCCTCCTCATCATGCTGGGTACCCTCTGGCTGGGCTACACTCTCTACCAGTTCAAGAAGAGCCCCTACCTGCACCCATATGTGCGAGAGATCCTGTCCGACTGTGCCCTGCCCATTGCAGTGCTCACCTTCTCCCTCCTCAGCTCCTATGGCTTCCAGGAAATTGAGATGAGCAGGTTCCGCTACAACCCCAGCGAGAACCTGTTTGAGGTGGCACAGATCGACTCACTGTCCCTGGGAGCCATTGGCAGTGCCATGGTCCTCGGTTTCCTGCTCTCCCTGCTCTTCTTCATCGAGCAGAACCTGGTGGCTGCCTTGGTCAATGCACCAGAGAACAGGCTGGTGAAAGGCACTGCCTACCACTGGGATCTCCTGCTCCTAGCCATCATCAACACGGGGCTGTCCCTATTTGGGCTGCCCTGGATCCACGCTGCCTACCCCCACTCTCCACTGCACGTGCGGGCCCTAGCTTTAGTGGAGGAGCGAGTGGAGAATGGGCACATTTATGAGACAATTGTGAATGTGAAGGAGACGAGGCTGACATCTCTGGGCGCCAGCATGCTAGTGGGTCTGTCCCTCCTGCTGCTGCCTTTCCCACTGCAGTGGATCCCCAAGCCTGTGCTCTATGGCCTCTTCCTCTACATTGCGCTTACCTCCTTGGATGGCAACCAGCTCTTCTCTCGTGTGGCCCTGCTGCTCAAGGAGCAGACATCATACCCACCCACCCACTACGTTCGGAGGGTGCCCCAGAGGAAGATCCACTACTTCACAGGCCTGCAGGTCCTGCAGCTGCTACTGCTCTGCGCCTTCGGCATGAGCACCCTGCCCTACATGAAGATGATCTTCCCCCTCATCATGATTCTCATGATTCCCATCCGGTACAGGCGGGCAGGAAGGGCAGCCCAGGGCTGTGTTGTGCGGGCTGTGCTGGGTGCCTGCCACCTTCTCTCTGACCACTCACAGCTCATCTGCATACCTCTCCCTCCTGTCCACAGCTACATCCTGCTGCCCCGAATCATTGAAGCCAAGTACTTGGATGCCATGGACGCTGAGCACTGGTCCTGA

XM_004840718.1 Coding sequence

Slc4a11 solute carrier family 4, sodium borate transporter, member 11, transcript variant X6

Length: 2214 bp    Location: 4339877..4329635   Strand: -
>XM_004840718.1
ATGGCCGCGGCCAGCAGGCGCGTGTTCCATCTCCAGCCGTGCGAAAGCTCCTCTTTGGCCACATCAAGGAATGGATGCCTTGAGGACTCCAGTGAGTACTTCTCAGCTGCATCCCTGAGCTACCTCAAGAATGATGTGGACAATGCTTCAGAGGTCCGGGAAGAAAGCCTGGGGGATGAGGTCTTTGACACGGTCAACTCCTCCATCGTGTCTGGCGAGAGCATCCAGTTTTTCGTCAATGTCAACCTTGAGGTGCAGCCCTCCATATCTGAAGGTGAAGCGCTGTCTGGCTGCGTGCTCCTGCACACATCCCGCAAGTACCTGAAGTTAAAGAACTTTGGGGAAGAGATCCGAGCACACCGGGACCTGGATGGCTTCCTGGCCCAGGCCAGCATCATCCTGAATGAAACAGCCACCTCCTTGGATGATGTGCTACGCACCATGCTGAGCCGCTTTGCCCAGGACCCCAACAACGCTGAACCCGACTGCAACTTGGACCTAATCATGGCCAAGCTCTTTACGGATGCAGGGGGCCCCACGGAGAGTAAAGTGCACCTGCTGTCAGATACCATCCAAGGGGTCACAGCCACGGTGAGAGGGGTGCAGTACCAGCAGTCATGGCTCTGCATCATCTGTACCATGAAAGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTGGTTCGCCCACAGAACTGGGGCGAAAACTCCTGTGAGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAAATGAAAAGCACCAAGACTGCAATGGAGGTGGCACGCACCTTCGCCACCATGTTTTCAGACATCACCTTCCGCCAGAAGCTCCTGAAGACCCGCACAGAGGACGAATTCAAGGAGGCATTGGTGCATCAGAGACAGCTGCTCACCATGACAATACCAAGAGCAAATGGACATGGCACAGGCTCCTTCCATGGCCATAGACACCCACAGCCCCCAAAGTGCAAGGACTTTATCCCTTTTGGGAGGGGCATCCGGGAAGACATCATGCGCAGGTTTCCTGTATACCCACTGGACTTCACTGATGGCATTATCGGGAAAAGCAAGGCTGTGGGCAAATACATAACCACCACCCTGTTCCTCTACTTCGCCTGCCTCCTGCCCACAATTGCTTTTGGATCCCTGAATGATGAGAACACAAATGGGGCCATTGATGTTCAGAAGACCATAGCTGGCCAGAGTATAGGAGGCCTCTTGTACGCGATCTTCTCCGGGCAGCCGCTGGTGATTCTGCTGACGACTGCACCCCTGGCCATCTACACCCAGGTGATTCGTGTCATCTGTGATGACTACAACTTGGACTTCAATGCTTTCTATGCGTGGACAGGCCTGTGGAACAGTTTCTTCCTTGCACTCTATGCCTTCTTCAACCTCAGCCTGGTCATGAGTCTCTTCAAGAGGTCAACAGAGGAAATCATTGCCCTGTTCATTTCCATCACCTTCGTGCTGGATGCTGTCAAGGGCATGATCAAAATCTTCTGGAAGTACTACTACGGTTACCACCACACAAAGAGAACAGATACCAGCCTCAACTCTGGCATCCACACAGCCTTCAACACCAATCTCCTGGCTGGTTCCATTGAGCTGGATGCCTCAAGCAGCCCAGATGCTGTGCACTCTGGCCAGGCAACTGCAGTGCTCAGCCTCCTCATCATGCTGGGTACCCTCTGGCTGGGCTACACTCTCTACCAGTTCAAGAAGAGCCCCTACCTGCACCCATATGTGCGAGAGATCCTGTCCGACTGTGCCCTGCCCATTGCAGTGCTCACCTTCTCCCTCCTCAGCTCCTATGGCTTCCAGGAAATTGAGATGAGCAGGTTCCGCTACAACCCCAGCGAGAACCTGTTTGAGGTGGCACAGATCGACTCACTGTCCCTGGGAGCCATTGGCAGTGCCATGGTCCTCGGTTTCCTGCTCTCCCTGCTCTTCTTCATCGAGCAGAACCTGGTGGCTGCCTTGGTCAATGCACCAGAGAACAGGCCAGTGGGGCTCTGTCCATGTGTGTCTGTGCTGCAGGCTGGTGAAAGGCACTGCCTACCACTGGGATCTCCTGCTCCTAGCCATCATCAACACGGGGCTGTCCCTATTTGGGCTGCCCTGGATCCACGCTGCCTACCCCCACTCTCCACTGCACGTGCGGGCCCTAGCTTTAGTGGAGGAGCGAGTGGAGAATGGGCACATTTATGA

XM_004840707.1 Coding sequence

LOC101719551 proSAP-interacting protein 1-like, transcript variant X6

Length: 2013 bp    Location: 4277271..4271584   Strand: -
>XM_004840707.1
ATGGCGAAGCTGGAGACCCTGCCTGTGCGTGCTGATCCAGGGCGGGATCCCCTCCTGGCCTTTGCCCCCCGGCCCTCTGAGCTTGGACCCCCAGACCCCCGCCTGGCCATGGGCAGTGTGGGCAGTGGGGTGGCCCATGCCCAAGAGTTTGCCATGAAGAGTGTGGGCACTCGAACAGGGGGTGGGGGCAGTCAGGGGAGTTTCCCTGGCCCCCGAGGCAGTGGCAGTGGGACCAGTAGGGAGAGGCCTGGCCGATACCCCTCTGAGGACAAAACTCTCGCCAACTCTCTCTACCTCAATGGCGAGCTTCGGGGCAGTGACCATACAGATGTCTGTGGCAATGTGGTGGGCAGCAGTGGTGGCAGCAGCAGCAGCGGTGGCAGTGACAAAGCCCCACCACAGTATCGTGAGCCCAGCCACCCACCCAAGCTCCTGGCCACCTCTGGCAAGCTAGATCAGTGCTCAGAGCCACTAGTTCGGCCATCGGCCTTCAAGCCTGTTGTACCCAAGAATTTCCATTCCATGCAGAACTTGTGTCCCCCACAGACCAATGGAACCCCTGAGGGACGACAGGGCCCTGGTGGCCTCAAGGGTGGACTGGACAAGTCTCGGACCATGACCCCAGCGGGTGGGAGTGGGGGCGGCCTCTCAGACTCAGGCCGGAACTCACTCACAAGCCTGCCCACCTACAGCTCCAGCTACAGCCAACACTTGGCACCCCTGAGTGCTTCCACCAGCCACATCAACCGAATCGGCACTGCCAGCTATGGTAGTGGCAGCAATGGTGGGGGGTCAGGGTACCAGGACCTGGGGACCTCAGACAGTGGGCGGGCCTCCAGCAAGAGTGGGTCTTCGTTATCCATGGGGCGGCCAGGCCACCTGGGATCTGGGGAGGGTGGGGGTGGAGGCCTGCCATTTGCAGCCTGCTCACCACCCTCGCCCAGTACACTGATCCAGGAGCTGGAGGAGCGGTTGTGGGAGAAGGAGCAGGAGGTGGCAGCTCTGCGGCGCAGCCTGGAGCAGAGTGAGGCGGCTGTGGCCCAGGTGCTGGAGGAGCGGCAGAAGGCGTGGGAGCGCGAGCTGGCCGAGCTTCGGCAGGGCTGCAGTGGGAAGTTGCAGCAGGTGGCTCGCCGTGCCCAGCGTGCCCAGCAGGGCCTGCAGTTGCAGGTGCTGCGGCTGCAGCAGGACAAGAAGCAGCTGCAGGAGGAGGCAGCCCGGCTGATGCGGCAGCGGGAAGAGCTCGAGGACAAGGTGGCCGCTTGTCAGAAGGAGCAGGCCGACTTCCTGCCCCGGATGGAGGAAACTAAGTGGGAGGTGTGCCAGAAGGCCGGCGAGATTTCCCTCCTGAAACAGCAGTTGAAAGACTCACAAGCTGACGTGTCCCAAAAGCTGAGTGAGATCGTGGGGCTGCGCTCCCAGCTGCGGGAGGGCCGGGCCTCACTTCGGGAGAAGGAAGAGCAGCTGCTCAGCCTGAGGGACTCCTTTGGCAGCAAACAGGCCAGCCTGGAGCTGGCTGAGGGTGAGCTGCCTGCCACCTGCCACAAGCCAGTGCTGACCCCTGTGGACCCAGCCGACCCACAGGAGGCACTGGCCACCTGCGAGAGCGATGAGGCCAAGATGCGTCGTCAGGCTGGGGTGGCTGCTGCTGCATCCTTGGTTTCCATGGATGGGGAGGTGGATGCTGGGGGCGAGAGTGGGACCAGGGCCCTGCGACGGGAGGTGGGTCGGCTGCAGGCTGAGCTGGCAGCCGAGCGGCGGGCCCGGGAGCGCCAGGGTGCCAGCTTTGCAGAGGAGCGCCGAGTGTGGCTGGAGGAGAAGGAGAAGGTCATTGAGTACCAGAAGCAGCTGCAGCTGAGTTATGTGGAGATGTACCAGCGCAACCAGCAGCTGGAGCGGCGGCTGCGGGAGCGTGGGGCAGCAGGGGGTGCAAGCACACCTACCCCCCAACTTGGTGAGGAGAAGAAGGCCTGGACCCCTTCCCGCCTTGAGCGCATCGAGTCCACAGAAATCTGA

XM_004840709.1 Coding sequence

Ddrgk1 DDRGK domain containing 1, transcript variant X1

Length: 999 bp    Location: 4305411..4292256   Strand: -
>XM_004840709.1
ATGTTTGGGGACTCGAGGCGGACGCTGTGGTTCAACTGGGAGGTCTTCGGCATGTTAGCGACCCTGGTGTACTTGGCCGCGGCGGCTCTGCTCTTTGGCCTTATCCTCTTCCTGACCCGCAGCCGGCGCCGGACAGCAGAAGCTGGTCAAGAGCTACAGCACAATGAGGAGGTGCCAGGAGTAGCAGCTCGGGTGGACCCGTCACGGCTCCTGGAGGCAGAAGAGCAGAGAGCTGGAGGCAGACCCCGGCGCCGGAGGGACCTGGGCAGCCGCCTGCAGGCTCATCGTCGAGCCCAGCGGGTGGCTTGGACAGAAGTGGATGAGAATGAGGACGAAACTGACATCCCAGCTCAGGAGGAAGAAGGAATTGAGAAGCCAGCAGAAACTCACTCGACAGGGAAAATTGGAGCCAAGAAACTACGGAAACTAGAAGAGAAACAGGCTCGAAAAGCCCAGCGTGAGGCAGAGGAGGCTGAAAGAGAGGAGCGGAAGCGCCTGGAGTCCCAGCGGGAGGCAGAATGGAAGAAGGAAGAGGAGCGGCTCCGCCTGGAGGAGGAACAGAAGGAGGAGGAAGAGAGAAAGGCCCGGGAGGAGCAGGCCCGGAGGGAACATGAGGAGTATCTCAAATTGAAGGAGGCCTTCGTGGTGGAGGAGGAGGGTGTGAGCGAGAGCATGACTGAGGAGCAGTCCCACAACTTCCTGACAGAATTCATCAACTACATTAAGCAGTCCAAAGTTGTGCTTTTAGAAGATTTGGCTTCCCAGCTGGGCCTGCGGACTCAGGACACCATAAATCGCATCCAGGACCTGTTGGCTGAGGGGACTCTAACAGGTGTGATTGACGACCGGGGCAAGTTCATCTACATAACCCCTGAGGAACTGGCTGCTGTGGCCAACTTCATCCGACAGCGGGGCCGAGTGTCCATCACCGAACTTGCTCAGGCTAGCAACTCCCTCATCGCCTGGGGCCAGGAACCCCCTGCCCAGGCCCCAGCCTGA

XM_004840712.1 Coding sequence

LOC101722265 chromosome unknown open reading frame, human C20orf194, transcript variant X2

Length: 3534 bp    Location: 4484485..4349822   Strand: -
>XM_004840712.1
ATGGACGTGTACCCCTCGCACAGGCTGGGGCTGCCCTGCGCCCGGTCCCCCGGCGGCTCTGGCCGCGGGTCGCCTTCCGTCAGCTGCGGCCGACTCCGCCAGGTTCAGAGCATCCTGAACCAGAGCAGCAAGTCGCGACCTGACGGGATCCTTTGCATTCTAGGAATTGATAGCAGGTACAATGAAGGCTGCAGAGAGCTGGCAAATTATCTTCTGTTTGGTTTATATAATCAGAATACCAGTGATTTTGAGAAAACAGGATTTTCTGAAGAAATTCTGGATGATGTAATTATGTTGATTAAATCAGATAGTGTCCATCTGTACTGTAATCCTGTCAACTATTGCCATCTGTTACCGTATGTGGCACACTGGAGAAATCTACATTTCCACTGCATGACTGAAAATGAGTATGAAGATGAGGAAGCTGCAGAAGAGTTTAAAATTTCGAGCTTTGTGGATATGGTTAGAGACTGTAGTAAAATTGGCATTCCTTACAGCTCCCAAGGTCACTTGCAGATATTTGATATGTTTGTGGTAGAGAAATGGCCAATTGTACAGGCCTTCGCACTTGAGGGCATTGGAGGAGATGGATTTTTTACCATGAAATATGAGCTGCAGGATGTGAGTTTGAATCTATGGAATGTCTACAGCAAGATGGATCCTATGTCACTCGAGAACTTGCTTTCAGAAGATTTGGTGGCTTTTGAACATCAGTGGACTAACTTCTTTGCTAATTTTGACACAGAAATTCCTTTCCTACTGGAACTTTCAGAATCACAAGCTGGTGAGCCATTCAGAAGTTACTTCAGTCATGGAATGATCTCCAGCCATATAACTGAAAACAGCCCTAATAGGCAGCCATTTGTTCTCTTTGGTAATCACTCCACGCGAGAAAACCTGAATGCTGGCAACTTTAACTTCCCTTCTGAAGGTCATCTGGTACGCAGCACTGGTCCTGGTGGGAGCTTTGCCAAACACATGGTAGCACAGTGTATCTCACCAAAGGGACCTCTTGCATGTTCAAGAACATACTTTTTTGGAGCTACTCATGTTCCTTACTTAGGAGGTAATAACAAGCTGCCCAAGAAAACTGAACAAATTAGGCTCTTGTCCCAGATATATGCTGCTGTTATTGAGGCTGTTTTGGCTGGCATTGCATGTTATGCTAAAACTTCCAGTCTAACAAAGGCAAAGGAATTAGCAGAGCAGTCCCTGGGATCTGGATTAGAATCCTTTGAGTTGGTTCAGTTTAAGGCAGCACTACGCTCCAAGACGGCTTTTCACATACATGCTGTGAATAATCAGGGAAGAATTGTGCCTCTGGATAATGAAGATAATTTATCCTTTGTGAAAACGGCTTGTATGACTGTCTATGACATTCCTGACTTGCTGGGAGAAAGAGGATGCTTAGGATCTGTGGTCTTCTCAGAATCATTTTTGACATCTCGGATCTTGGTTAAAGAAAAGGATGGCACTGTTACCACAGAGACCAGCTGCATAGTCCTGACGGCCACCATTCCCAGATTCTGCTTCTGGCTGGTAGAAGATGATGAAGTAAAATTGTCTGAGAAAACCCAGCAAGCAGTGAGGGAGGATGAGTGTTTCCTGGGCACTTTCCTAGCAGGAGGAGAAGGAGCATATCTTTATCCCAGCAATCTACAGCCCTGGCCTGAGGAAGGGAATGTGCTTTTCTTCTCCAGTGGCCTTTTGTTTTCTCACCGTCATCATGGAAATATCATCATTTCTAAGGATCACATGAATTCTATTTCTTTCTATGATGGGGATTCCACCAGTATTGTGGCTGCCCTTCTCATCGACTTCAAAAGCTCATTACTTCCTCACCTCCCAGTTCATTTCCATGGGTCAAGCAATTTTCTGATGATTGCCCTTTTCCCAAAATCAAAGATATATCAAGCATTTTACTCAGAGGTCTTCTCCCCCTGGCAACAGCAGGATAACTCAGGGCTCCCTTTAAAAGTGATCCAGGAAGATGGATTATCTGTGGAACAAAAGAGATTGCACTCCAGTGCACAGAAGCTCTTCGCTGTCCTGAGCCATCCCACTGGGGAGAAGTGGAGTTCTTTAAAACTGCTCTTAGCCAAACTCCCAGAGTTGGACTGGTTTTGCCAGCATTTTGCTGTCAGCAGCATTAGTCAGGAGCCTGTGATGCGGACCCATCTCCCAGTCCTGCTGCGCCAAGTTGAAGTTAGCCCTTTGCATGGAGTAGAGAATAACAAGGTAATTATTAGCATTGTAACCGGACTCCCAGGCTGTCATGCTAGTGAGCTCTGTGCTTTTCTGGTCACTCTGCATAAAGAATATGGCAGGTGGATCGTTTACCGCCAAATCATGGATAGCTCGGAATGTTTTCATGCTGCGCACTTTCAGAAATACCTTTCCAGCGCTCTGGAGGCCCAACAGAACCGTTCTGCCCGCCAGTCAGCCTACATCCGCAAGAAGACCAGACTGTTGGTGGTATTACAAGGCTACACAGATGTTATTGATGTTGTTCAGGCACTGCAGACCCATCCAGATGCAAATGTCAAGTCTTCCTTCACCATTGGTGCCATTACAGTGTGCGTGGATCCTCTAAGCTGCTACATGGAACACAGATTTCTCTTCCCGAAATGTCTTGACCAGTGTTCACAAGGTCTGGTGAATAATGTCGTGTTCACGAGTCTCACCATGGAGCAGAGGCACCCTCTCCTTGTTCAGCTGCAGAGCCTCTTCAGAGCTGCCAACCCTACTGCAGCCTTCATTCTGGCAGAAAACGGGATTATTACCAGGAATGAAGACATTGAGCTGATTCTCTCAGAAAATAGCTTTTCAAGTTCTCAGATGCTACGATCTCGATATTTAATGTACCCTGGCTGGTATGAAGGTAAATTCAGTGCTGGCTCAGTCTTTCCACTAATGGTTCAGATCTGTGTATGGTTTGGTCGACCCTTGGAGAAGACTCGCTTTGTGGCCAAGTGTAAAGCAATTCAGTCCTCCATCAAGCCAAGCCCCTTCTCTGGAAACATCTACCACATCCTGGGCAAAGTAAAGTTTTCAGACTCTGAAAGGACAATGGAGGTCTGCCACAACACTCTGGCCAATTCCCTGAGCATCGTGCCGGTTTTGGAGGGACCCAGGCCACCATCAGACTCAAGAAGCATCCCTCAAGACAGCAGCGGGCAGCAGGAGTGCTACCTTGTGTTCATTGGCTGCTCCTTGAAGGAAGATAGCCTCAAGGACTGGCTCCGGCAGTCAGCTAAGCAGAAGCCTCAGAGGAAAGCTCTGAAGACCAGGGGAATGCTGACCCAGCAGGAGATCAGGAACATCCATGTGAAACGCCACCTAGACCCCCTACCTGCAGGTTACTTCTACAATGGCACCCAGTTTGTTAACTTCTTTGGGGATAAGACTGATTTTCACCCTCTCATGGACCAGTTCATGAATGACTACGTGGAAGAAGCCAACCGGGAAATTGAGAGATACAACCGTGAGCTGGACCAGCAGGAGTACCATGACCTCTTTGAGCAGAAGCCCTAG

XM_004840704.1 Coding sequence

LOC101719551 proSAP-interacting protein 1-like, transcript variant X3

Length: 2103 bp    Location: 4281781..4271584   Strand: -
>XM_004840704.1
ATGGCCCCTGCAGACCAGGCCTCAGAGGGTCCCAGGCTTGAGGACCCGGCGGCCCCCCACCCCCTTGGAAAGTGCCTTCCTGGCATAGTCATGGCGAAGCTGGAGACCCTGCCTGTGCGTGCTGATCCAGGGCGGGATCCCCTCCTGGCCTTTGCCCCCCGGCCCTCTGAGCTTGGACCCCCAGACCCCCGCCTGGCCATGGGCAGTGTGGGCAGTGGGGTGGCCCATGCCCAAGAGTTTGCCATGAAGAGTGTGGGCACTCGAACAGGGGGTGGGGGCAGTCAGGGGAGTTTCCCTGGCCCCCGAGGCAGTGGCAGTGGGACCAGTAGGGAGAGGCCTGGCCGATACCCCTCTGAGGACAAAACTCTCGCCAACTCTCTCTACCTCAATGGCGAGCTTCGGGGCAGTGACCATACAGATGTCTGTGGCAATGTGGTGGGCAGCAGTGGTGGCAGCAGCAGCAGCGGTGGCAGTGACAAAGCCCCACCACAGTATCGTGAGCCCAGCCACCCACCCAAGCTCCTGGCCACCTCTGGCAAGCTAGATCAGTGCTCAGAGCCACTAGTTCGGCCATCGGCCTTCAAGCCTGTTGTACCCAAGAATTTCCATTCCATGCAGAACTTGTGTCCCCCACAGACCAATGGAACCCCTGAGGGACGACAGGGCCCTGGTGGCCTCAAGGGTGGACTGGACAAGTCTCGGACCATGACCCCAGCGGGTGGGAGTGGGGGCGGCCTCTCAGACTCAGGCCGGAACTCACTCACAAGCCTGCCCACCTACAGCTCCAGCTACAGCCAACACTTGGCACCCCTGAGTGCTTCCACCAGCCACATCAACCGAATCGGCACTGCCAGCTATGGTAGTGGCAGCAATGGTGGGGGGTCAGGGTACCAGGACCTGGGGACCTCAGACAGTGGGCGGGCCTCCAGCAAGAGTGGGTCTTCGTTATCCATGGGGCGGCCAGGCCACCTGGGATCTGGGGAGGGTGGGGGTGGAGGCCTGCCATTTGCAGCCTGCTCACCACCCTCGCCCAGTACACTGATCCAGGAGCTGGAGGAGCGGTTGTGGGAGAAGGAGCAGGAGGTGGCAGCTCTGCGGCGCAGCCTGGAGCAGAGTGAGGCGGCTGTGGCCCAGGTGCTGGAGGAGCGGCAGAAGGCGTGGGAGCGCGAGCTGGCCGAGCTTCGGCAGGGCTGCAGTGGGAAGTTGCAGCAGGTGGCTCGCCGTGCCCAGCGTGCCCAGCAGGGCCTGCAGTTGCAGGTGCTGCGGCTGCAGCAGGACAAGAAGCAGCTGCAGGAGGAGGCAGCCCGGCTGATGCGGCAGCGGGAAGAGCTCGAGGACAAGGTGGCCGCTTGTCAGAAGGAGCAGGCCGACTTCCTGCCCCGGATGGAGGAAACTAAGTGGGAGGTGTGCCAGAAGGCCGGCGAGATTTCCCTCCTGAAACAGCAGTTGAAAGACTCACAAGCTGACGTGTCCCAAAAGCTGAGTGAGATCGTGGGGCTGCGCTCCCAGCTGCGGGAGGGCCGGGCCTCACTTCGGGAGAAGGAAGAGCAGCTGCTCAGCCTGAGGGACTCCTTTGGCAGCAAACAGGCCAGCCTGGAGCTGGCTGAGGGTGAGCTGCCTGCCACCTGCCACAAGCCAGTGCTGACCCCTGTGGACCCAGCCGACCCACAGGAGGCACTGGCCACCTGCGAGAGCGATGAGGCCAAGATGCGTCGTCAGGCTGGGGTGGCTGCTGCTGCATCCTTGGTTTCCATGGATGGGGAGGTGGATGCTGGGGGCGAGAGTGGGACCAGGGCCCTGCGACGGGAGGTGGGTCGGCTGCAGGCTGAGCTGGCAGCCGAGCGGCGGGCCCGGGAGCGCCAGGGTGCCAGCTTTGCAGAGGAGCGCCGAGTGTGGCTGGAGGAGAAGGAGAAGGTCATTGAGTACCAGAAGCAGCTGCAGCTGAGTTATGTGGAGATGTACCAGCGCAACCAGCAGCTGGAGCGGCGGCTGCGGGAGCGTGGGGCAGCAGGGGGTGCAAGCACACCTACCCCCCAACTTGGTGAGGAGAAGAAGGCCTGGACCCCTTCCCGCCTTGAGCGCATCGAGTCCACAGAAATCTGA

XM_004840705.1 Coding sequence

LOC101719551 proSAP-interacting protein 1-like, transcript variant X4

Length: 2040 bp    Location: 4277273..4271584   Strand: -
>XM_004840705.1
ATGGCCCCTGCAGACCAGGCCTCAGAGGGTCCCAGGCTTGAGGACCCGGCGGCCCCCCACCCCCTTGGAAAGTGCCTTCCTGGCATAGTCATGGCGAAGCTGGAGACCCTGCCTGTGCGTGCTGATCCAGGGCGGGATCCCCTCCTGGCCTTTGCCCCCCGGCCCTCTGAGCTTGGACCCCCAGACCCCCGCCTGGCCATGGGCAGTGTGGGCAGTGGGGTGGCCCATGCCCAAGAGTTTGCCATGAAGAGTGTGGGCACTCGAACAGGGGGTGGGGGCAGTCAGGGGAGTTTCCCTGGCCCCCGAGGCAGTGGCAGTGGGACCAGTAGGGAGAGGCCTGGCCGATACCCCTCTGAGGACAAAACTCTCGCCAACTCTCTCTACCTCAATGGCGAGCTTCGGGGCAGTGACCATACAGATGTCTGTGGCAATGTGGTGGGCAGCAGTGGTGGCAGCAGCAGCAGCGGTGGCAGTGACAAAGCCCCACCACAGTATCGTGAGCCCAGCCACCCACCCAAGCTCCTGGCCACCTCTGGCAAGCTAGATCAGTGCTCAGAGCCACTAGTTCGGCCATCGGCCTTCAAGCCTGTTGTACCCAAGAATTTCCATTCCATGCAGAACTTGTGTCCCCCACAGACCAATGGAACCCCTGAGGGACGACAGGGCCCTGGTGGCCTCAAGGGTGGACTGGACAAGTCTCGGACCATGACCCCAGCGGGTGGGAGTGGGGGCGGCCTCTCAGACTCAGGCCGGAACTCACTCACAAGCCTGCCCACCTACAGCTCCAGCTACAGCCAACACTTGGCACCCCTGAGTGCTTCCACCAGCCACATCAACCGAATCGGCACTGCCAGCTATGGTAGTGGCAGCAATGGTGGGGGGTCAGGGTACCAGGACCTGGGGACCTCAGACAGTGGGCGGGCCTCCAGCAAGAGTGGGTCTTCGTTATCCATGGGGCGGCCAGGCCACCTGGGATCTGGGGAGGGTGGGGGTGGAGGCCTGCCATTTGCAGCCTGCTCACCACCCTCGCCCAGTACACTGATCCAGGAGCTGGAGGAGCGGTTGTGGGAGAAGGAGCAGGAGGTGGCAGCTCTGCGGCGCAGCCTGGAGCAGAGTGAGGCGGCTGTGGCCCAGGTGCTGGAGGAGCGGCAGAAGGCGTGGGAGCGCGAGCTGGCCGAGCTTCGGCAGGGCTGCAGTGGGAAGTTGCAGCAGGTGGCTCGCCGTGCCCAGCGTGCCCAGCAGGGCCTGCAGTTGCAGGTGCTGCGGCTGCAGCAGGACAAGAAGCAGCTGCAGGAGGAGGCAGCCCGGCTGATGCGGCAGCGGGAAGAGCTCGAGGACAAGGTGTGCCAGAAGGCCGGCGAGATTTCCCTCCTGAAACAGCAGTTGAAAGACTCACAAGCTGACGTGTCCCAAAAGCTGAGTGAGATCGTGGGGCTGCGCTCCCAGCTGCGGGAGGGCCGGGCCTCACTTCGGGAGAAGGAAGAGCAGCTGCTCAGCCTGAGGGACTCCTTTGGCAGCAAACAGGCCAGCCTGGAGCTGGCTGAGGGTGAGCTGCCTGCCACCTGCCACAAGCCAGTGCTGACCCCTGTGGACCCAGCCGACCCACAGGAGGCACTGGCCACCTGCGAGAGCGATGAGGCCAAGATGCGTCGTCAGGCTGGGGTGGCTGCTGCTGCATCCTTGGTTTCCATGGATGGGGAGGTGGATGCTGGGGGCGAGAGTGGGACCAGGGCCCTGCGACGGGAGGTGGGTCGGCTGCAGGCTGAGCTGGCAGCCGAGCGGCGGGCCCGGGAGCGCCAGGGTGCCAGCTTTGCAGAGGAGCGCCGAGTGTGGCTGGAGGAGAAGGAGAAGGTCATTGAGTACCAGAAGCAGCTGCAGCTGAGTTATGTGGAGATGTACCAGCGCAACCAGCAGCTGGAGCGGCGGCTGCGGGAGCGTGGGGCAGCAGGGGGTGCAAGCACACCTACCCCCCAACTTGGTGAGGAGAAGAAGGCCTGGACCCCTTCCCGCCTTGAGCGCATCGAGTCCACAGAAATCTGA

XM_004840702.1 Coding sequence

LOC101719551 proSAP-interacting protein 1-like, transcript variant X1

Length: 2103 bp    Location: 4277272..4271584   Strand: -
>XM_004840702.1
ATGGCCCCTGCAGACCAGGCCTCAGAGGGTCCCAGGCTTGAGGACCCGGCGGCCCCCCACCCCCTTGGAAAGTGCCTTCCTGGCATAGTCATGGCGAAGCTGGAGACCCTGCCTGTGCGTGCTGATCCAGGGCGGGATCCCCTCCTGGCCTTTGCCCCCCGGCCCTCTGAGCTTGGACCCCCAGACCCCCGCCTGGCCATGGGCAGTGTGGGCAGTGGGGTGGCCCATGCCCAAGAGTTTGCCATGAAGAGTGTGGGCACTCGAACAGGGGGTGGGGGCAGTCAGGGGAGTTTCCCTGGCCCCCGAGGCAGTGGCAGTGGGACCAGTAGGGAGAGGCCTGGCCGATACCCCTCTGAGGACAAAACTCTCGCCAACTCTCTCTACCTCAATGGCGAGCTTCGGGGCAGTGACCATACAGATGTCTGTGGCAATGTGGTGGGCAGCAGTGGTGGCAGCAGCAGCAGCGGTGGCAGTGACAAAGCCCCACCACAGTATCGTGAGCCCAGCCACCCACCCAAGCTCCTGGCCACCTCTGGCAAGCTAGATCAGTGCTCAGAGCCACTAGTTCGGCCATCGGCCTTCAAGCCTGTTGTACCCAAGAATTTCCATTCCATGCAGAACTTGTGTCCCCCACAGACCAATGGAACCCCTGAGGGACGACAGGGCCCTGGTGGCCTCAAGGGTGGACTGGACAAGTCTCGGACCATGACCCCAGCGGGTGGGAGTGGGGGCGGCCTCTCAGACTCAGGCCGGAACTCACTCACAAGCCTGCCCACCTACAGCTCCAGCTACAGCCAACACTTGGCACCCCTGAGTGCTTCCACCAGCCACATCAACCGAATCGGCACTGCCAGCTATGGTAGTGGCAGCAATGGTGGGGGGTCAGGGTACCAGGACCTGGGGACCTCAGACAGTGGGCGGGCCTCCAGCAAGAGTGGGTCTTCGTTATCCATGGGGCGGCCAGGCCACCTGGGATCTGGGGAGGGTGGGGGTGGAGGCCTGCCATTTGCAGCCTGCTCACCACCCTCGCCCAGTACACTGATCCAGGAGCTGGAGGAGCGGTTGTGGGAGAAGGAGCAGGAGGTGGCAGCTCTGCGGCGCAGCCTGGAGCAGAGTGAGGCGGCTGTGGCCCAGGTGCTGGAGGAGCGGCAGAAGGCGTGGGAGCGCGAGCTGGCCGAGCTTCGGCAGGGCTGCAGTGGGAAGTTGCAGCAGGTGGCTCGCCGTGCCCAGCGTGCCCAGCAGGGCCTGCAGTTGCAGGTGCTGCGGCTGCAGCAGGACAAGAAGCAGCTGCAGGAGGAGGCAGCCCGGCTGATGCGGCAGCGGGAAGAGCTCGAGGACAAGGTGGCCGCTTGTCAGAAGGAGCAGGCCGACTTCCTGCCCCGGATGGAGGAAACTAAGTGGGAGGTGTGCCAGAAGGCCGGCGAGATTTCCCTCCTGAAACAGCAGTTGAAAGACTCACAAGCTGACGTGTCCCAAAAGCTGAGTGAGATCGTGGGGCTGCGCTCCCAGCTGCGGGAGGGCCGGGCCTCACTTCGGGAGAAGGAAGAGCAGCTGCTCAGCCTGAGGGACTCCTTTGGCAGCAAACAGGCCAGCCTGGAGCTGGCTGAGGGTGAGCTGCCTGCCACCTGCCACAAGCCAGTGCTGACCCCTGTGGACCCAGCCGACCCACAGGAGGCACTGGCCACCTGCGAGAGCGATGAGGCCAAGATGCGTCGTCAGGCTGGGGTGGCTGCTGCTGCATCCTTGGTTTCCATGGATGGGGAGGTGGATGCTGGGGGCGAGAGTGGGACCAGGGCCCTGCGACGGGAGGTGGGTCGGCTGCAGGCTGAGCTGGCAGCCGAGCGGCGGGCCCGGGAGCGCCAGGGTGCCAGCTTTGCAGAGGAGCGCCGAGTGTGGCTGGAGGAGAAGGAGAAGGTCATTGAGTACCAGAAGCAGCTGCAGCTGAGTTATGTGGAGATGTACCAGCGCAACCAGCAGCTGGAGCGGCGGCTGCGGGAGCGTGGGGCAGCAGGGGGTGCAAGCACACCTACCCCCCAACTTGGTGAGGAGAAGAAGGCCTGGACCCCTTCCCGCCTTGAGCGCATCGAGTCCACAGAAATCTGA

XM_004840703.1 Coding sequence

LOC101719551 proSAP-interacting protein 1-like, transcript variant X2

Length: 2103 bp    Location: 4281043..4271584   Strand: -
>XM_004840703.1
ATGGCCCCTGCAGACCAGGCCTCAGAGGGTCCCAGGCTTGAGGACCCGGCGGCCCCCCACCCCCTTGGAAAGTGCCTTCCTGGCATAGTCATGGCGAAGCTGGAGACCCTGCCTGTGCGTGCTGATCCAGGGCGGGATCCCCTCCTGGCCTTTGCCCCCCGGCCCTCTGAGCTTGGACCCCCAGACCCCCGCCTGGCCATGGGCAGTGTGGGCAGTGGGGTGGCCCATGCCCAAGAGTTTGCCATGAAGAGTGTGGGCACTCGAACAGGGGGTGGGGGCAGTCAGGGGAGTTTCCCTGGCCCCCGAGGCAGTGGCAGTGGGACCAGTAGGGAGAGGCCTGGCCGATACCCCTCTGAGGACAAAACTCTCGCCAACTCTCTCTACCTCAATGGCGAGCTTCGGGGCAGTGACCATACAGATGTCTGTGGCAATGTGGTGGGCAGCAGTGGTGGCAGCAGCAGCAGCGGTGGCAGTGACAAAGCCCCACCACAGTATCGTGAGCCCAGCCACCCACCCAAGCTCCTGGCCACCTCTGGCAAGCTAGATCAGTGCTCAGAGCCACTAGTTCGGCCATCGGCCTTCAAGCCTGTTGTACCCAAGAATTTCCATTCCATGCAGAACTTGTGTCCCCCACAGACCAATGGAACCCCTGAGGGACGACAGGGCCCTGGTGGCCTCAAGGGTGGACTGGACAAGTCTCGGACCATGACCCCAGCGGGTGGGAGTGGGGGCGGCCTCTCAGACTCAGGCCGGAACTCACTCACAAGCCTGCCCACCTACAGCTCCAGCTACAGCCAACACTTGGCACCCCTGAGTGCTTCCACCAGCCACATCAACCGAATCGGCACTGCCAGCTATGGTAGTGGCAGCAATGGTGGGGGGTCAGGGTACCAGGACCTGGGGACCTCAGACAGTGGGCGGGCCTCCAGCAAGAGTGGGTCTTCGTTATCCATGGGGCGGCCAGGCCACCTGGGATCTGGGGAGGGTGGGGGTGGAGGCCTGCCATTTGCAGCCTGCTCACCACCCTCGCCCAGTACACTGATCCAGGAGCTGGAGGAGCGGTTGTGGGAGAAGGAGCAGGAGGTGGCAGCTCTGCGGCGCAGCCTGGAGCAGAGTGAGGCGGCTGTGGCCCAGGTGCTGGAGGAGCGGCAGAAGGCGTGGGAGCGCGAGCTGGCCGAGCTTCGGCAGGGCTGCAGTGGGAAGTTGCAGCAGGTGGCTCGCCGTGCCCAGCGTGCCCAGCAGGGCCTGCAGTTGCAGGTGCTGCGGCTGCAGCAGGACAAGAAGCAGCTGCAGGAGGAGGCAGCCCGGCTGATGCGGCAGCGGGAAGAGCTCGAGGACAAGGTGGCCGCTTGTCAGAAGGAGCAGGCCGACTTCCTGCCCCGGATGGAGGAAACTAAGTGGGAGGTGTGCCAGAAGGCCGGCGAGATTTCCCTCCTGAAACAGCAGTTGAAAGACTCACAAGCTGACGTGTCCCAAAAGCTGAGTGAGATCGTGGGGCTGCGCTCCCAGCTGCGGGAGGGCCGGGCCTCACTTCGGGAGAAGGAAGAGCAGCTGCTCAGCCTGAGGGACTCCTTTGGCAGCAAACAGGCCAGCCTGGAGCTGGCTGAGGGTGAGCTGCCTGCCACCTGCCACAAGCCAGTGCTGACCCCTGTGGACCCAGCCGACCCACAGGAGGCACTGGCCACCTGCGAGAGCGATGAGGCCAAGATGCGTCGTCAGGCTGGGGTGGCTGCTGCTGCATCCTTGGTTTCCATGGATGGGGAGGTGGATGCTGGGGGCGAGAGTGGGACCAGGGCCCTGCGACGGGAGGTGGGTCGGCTGCAGGCTGAGCTGGCAGCCGAGCGGCGGGCCCGGGAGCGCCAGGGTGCCAGCTTTGCAGAGGAGCGCCGAGTGTGGCTGGAGGAGAAGGAGAAGGTCATTGAGTACCAGAAGCAGCTGCAGCTGAGTTATGTGGAGATGTACCAGCGCAACCAGCAGCTGGAGCGGCGGCTGCGGGAGCGTGGGGCAGCAGGGGGTGCAAGCACACCTACCCCCCAACTTGGTGAGGAGAAGAAGGCCTGGACCCCTTCCCGCCTTGAGCGCATCGAGTCCACAGAAATCTGA

XM_004840694.1 Coding sequence

LOC101717385 oxytocin-neurophysin 1-like

Length: 378 bp    Location: 4200602..4201415   Strand: +
>XM_004840694.1
ATGGCCGGCCCCAGCCTGGCCTGCTGCCTGCTCGGCCTCCTGGCGCTGACTTCCGCCTGCTACATCCAGAACTGTCCTCTGGGCGGCAAGAGGGCCGCGCTGGACCTCGATGTGCGCAAGTGCCTCCCCTGCGGCCCCGGAGGCCAAGGGCGCTGCTTCGGGCCCAGCATCTGCTGCGCGGACGCGCTGGGCTGCTTCGTGGGCACGGCCGAGGCACTGCGCTGCCAGGAGGAGAACTACCTCCCGTCGCCCTGCCAGTCTGGCCACAAGCCGTGCGGGAGCGGGGGACGCTGCGCGGCCAACGGTGTCTGCTGCAGCCCAGACGGCTGCCACACCGACCCCGCCTGCGACCTCGAGGCCGCCTTCTCCGAACGCTGA

XM_004840697.1 Coding sequence

Ubox5 U-box domain containing 5, transcript variant X2

Length: 2445 bp    Location: 4268210..4255475   Strand: -
>XM_004840697.1
ATGGCTCTTGTGATATGCCGAAGATGTCCAGGCAGTTTCTATGGAACATCTCCTTGCCCAGCTCTAATCAAGCACCATGTAAACAAGAAATTGTCTGGTCACACATGTGAGGACTATACCCTTATTGCCAAAAAGATCAGTTCTGACAGAATGGCAGCCACTTTCAAGTTATTAAAGCCTTTAAAATATCAAGCATTTTGCAATCCTGTTGTCTACAGTGCTACCCAAAGTGTGCTGTATTGGAATATGGGAACCAGCAGGTGGCACAAAGAACAGGACCATCCAGAGCACAGTGGCCCCTGCCACCCTGCCAGAAGAGTGAAGAATATTAGTGGCACCACCTCTTCTCAGAGAGTCCTCACAACCAACAGTGCCCTTCTGGGTTTGGGAGTCCACCAGGCTTCTGCCTTGAAGGCCAGCACGTTGCAGCTGGGTTCACCCAGGACCATGAGAACTGATAAAGAGGATGTAGAAGTTTTTGATTCCTTTGAAGACACCCGAGTTTTCCTACAGCTAAGACCAGAGTACCAGCTTCACAGCCATAAAAAATCAGAGACTTGTCAGCCCCTGTCCGTTTCAGAGAGTAAACTAATTTTGCACAAAGTCAGGGTGTATCAAAATAACCTCCAGCCTCAAACTATTGTTGATTATTTCTGTAAGCTGAGCTCTTTGCCTGCAGAGCAGCGTCCCATTTTGCTGTCTAATGCCAGCTTTACTTTGCTCTGCCAGCTGAGTGTGAAAAACATAAAATTCTTTGATATCCCGGGTCTGATCAGTATTTTAAAAGCCTTGGTCAATTTAGGAATCCCTCACTGCCACCCAATGCTAGATGTGTATGAAACCAGATTTGGGCATCAGGTGTGGGAGATGAGTCTGGACCAGCTTCTCTTGGTGGCTGATCTCTGGCGGCACTTAGGCCACAGAGTACCACAGTTCTTAAAAATTTTTTTTAGTTATCTTAATTTGCACTGGAAAGATCTATCTTTGTCTCAGTTCATTCATTTAATTTATATTATAGGTGAAAGTCGTCAGGTACCACAGGACCTAATGCAAAAACTGGAATCACTGATCCTTAAGTATATTGATTTGATCAATTTAGAGGAAGTTGGTACAATCTGTTTGGGGTTCTTTAAGTCAAGTAGTAGTCTGTCCGAATTTGTCATGCGGAAAATTGGAGACGTGGCTTGTGCTGACATGCACCATCTGAGTAGTCACGCCTTAGTGCATATTCTTAAAATGTTCCGTTTAACTCACGTGGATCATGTAAACTTTATGAAGCAGTTTGGAGAGATTGCTCCTCAGAGAATTCCTTCCCTGGGTGTTCAGGGTGTCATGCATTTGACTCTTGCCTGCTCAGCCTTACGTATGTTGGATGAGAGAGTAATGAATGCTGTGGCTGCCTCTTTGCCTTCTCGGGTAGCACACTGTCGAAGTAAGGATGTTGCCAAAATTCTGTGGTCATTTGGAACTCTGAATTATAAGCCACCCAACACAGAAGAATTTTATTCCAGCTTGATAAATGAAATTCACAGAAAGATGGATGAATTCAACAAATACCCGGAACACATGTTCACCTGTCTGCTGGGTCTGGCATTTTCTGAATACTTTCCAGCAGAGCTCATCAATGTTGCTCTGAGTCCAGGGTTTATCAGGTTAGCTCTAGAGAGAACTAAGTTTGAGCTTACTAAGGAACTGTATACTCTTGATGGTACAGTTGGCATTGAATGTCCAGATTACAAAGGCAATCGTCTTAGTTCTCACCTTCAGCAAGAGGCATCTGCAAATCTGTGGAATTTAGCAAGTAATGATATGAACTCAAAGCCTGAATTCCTAGAAGCTCTCTCTTTTCTTGAGACCATGTTGGGTGGCCCGCAGTACATCAAGCACCATATGATTTTACCTCATACCCGATCTTCTGACTTAGAGGTGCAGCTTGATGCTAACATGAGGCCACTACCATTTAACAGAGAAGCCATACCAACTGAAGACAAGGTTAATTTAAAGCTTATGCCTGTGGGAGTCAGCCTTACAGATGATTTGATGAATCAGTTGCTAAAAGGGAAAGCAAAAAGGCATTTCCATAGAGAAATTGAGTCAGAGACTGGGCAGTGGCCCATGAAGTTGGAGAAGGCAGCCATACCATTGGGGAGCTCCCCTTGCAATGTGGCAGATGGGTTAGGAGCTGTTGAGATGGCTGACCTGTGTCCCCCAGCCCATGTGCAGGCCCCATTAGTGAAGCTGGCCATTCAGTTCACACATAGGAACCAGTATTGCTATGGTACAAGGAATCTACTTGGATTGCATAATATGAAGCGGCGGCAGCTGATTCGACTTGGGTACCGAGTGATCGAGTTAACCTACTGGGAGTGGTTTCCACTCTTGAAACGAACTCGATCAGAGAAGCTGGCATTCCTCCATGAGAAAGTGTTCACCTCTGTTCTCTGA

XM_004840681.1 Coding sequence

Vps16 vacuolar protein sorting 16 homolog (S. cerevisiae), transcript variant X3

Length: 2178 bp    Location: 3959677..3989962   Strand: +
>XM_004840681.1
ATGGACTGCTACACAGCGAACTGGAACCCACTCGGAGACTCTGCCTTTTACCGGAAGTATGAACTATACAGCATGGACTGGGACCTGAAAGAGGAACTCAGGGACTGCCTGGTGGCTGCTGCACCCTATGGGGGCCCCATTGCGCTGCTGAGGAACCCCTGGCGAAAGGAGAAAGCTGCCAGTGTACGGCCCATGCTTGAGATCTATTCTGCTTCTGGTGTGCCCCTGGTCAGCCTGCTGTGGAAGAGTGGACCTGTGGTGTCCATGGGCTGGTCAGCTGAGGAAGAGCTGCTCTGCGTGCAGGAAGATGGTGCAGTACTGGTTTATGGGCTTCATGGTGACTTCCGGAGACACTTTAGCATGGGCAATGAGGTGCTGCAGAACCGGGTTCTAGATGCCCGGATCTTTCACACTGAGCTTGGTTCTGGGGTGGCCATCCTCACAGGGGCCCATCGCTTTACCCTCAGTGCCAATGTAGGCGACCTCAAACTCCGCCGGATGCCAGAGGTGCCAGGCCTGCAAAGTGCACCCTCATGCTGGACTACATTGTTCCAGGAACGAGTGGCACACATTCTTCTGGCCGTGGGACCTGATCTTTACCTCTTGGATCACGCAACCTGCTCTGTAGTGACACCCCCTGGACTACCTCCAGGAGTGACTAGCTTCCTGCAGATGGCTGTCTCCTTTACCTATCGACACCTAGCACTCTTCACAGACACGGGCTACATCTGGATGGGGACAGCATCATTTACGGACAAGCTGTGTGAGTTCAACTGCAACATCCGAGCACCCCCGAAGCAAATGGTCTGGTGCACCCGACCTCGAAGCAAGGAGAGGGCTGTCGTGGTGGCCTGGGAGAGGCGGCTAATGGTGGTGGGCAATGCACCTGAGAGCATCCAGTTTGTGCTAGATGAGGACTCCTACCTGGTTCCTGAGCTCGATGGGGTCCGCATCTTCTCCCGAAACACCCATGAGTTTCTGCATGAGGTTCCAGTGACCAGTGAGGAGATCTTCAAAATTGCCTCAATGGCCCCTGGAGCACTGCTATTGGAAGCCCAGAAGGAGTACGAGAAAGAGAGCCAGAAGGCAGATGAGTACCTACGAGAGATCCAGGAGCTGGGGCAGCTAACCCAGGCAGTACAGCAGTGCATTGAGGCTGCAGGACATGAGCACAGGCCAGACATGCAGAAGAGTCTGCTCAGGGCGGCCTCCTTTGGAAAGTGTTTCCTTGACAGATTTCCACCCGACAGCTTTGTACGCATGTGTCAGGACCTGCGTGTGCTCAATGCCATTCGGGACTACCACATTGGGATTCCCCTCACCTATAGCCAATACAAGCAACTTACTATCCAGGTGCTACTGGACAGGCTTGTGTTGCGGAGACTTTACCCCCTCGCTATCCAGATATGCGAGTACTTGCGACTTCCAGAAGTACAGGGCATCAGCAGGATCCTGGCTCACTGGGCCTGCTACAAGGTACAACAGAAGGATGTGTCAGATGAGGATGTTGCACGAGCCATTAATCAGAAGCTGGGGGACACTCCTGGTGTCTCATATTCAGACATTGCTGCACGGGCCTATGGCTGTGGCCGCACAGAGCTGGCCATCAAGCTCCTGGAGTATGAACCACGCTCAGGGGAGCAGGTACCCCTTCTCCTCAAGATGAAAAGGAGCAAACTGGCACTGAGCAAGGCCATTGAGAGTGGGGACACTGACTTGGTATTCACAGTGTTACTGCACCTGAAGAATGAGCTGAACCGAGGAGACTTTTTCATGACCCTCCGGAACCAGCCCATGGCCCTGAGTTTGTACCGACAGTTTTGTAAGCATCAGGAGCTAGAGACACTGAAGGACCTCTACAATCAAGATGACAATCACCAGGAGTTGGGCAGCTTCCACCTCCGAGCCAGCTATGCTGCAGAAGAGCGCATCGAAGGGCGAGTAGCAGCTCTGCAGATAGCAGCTGATGCCTTCTATAAGGCCAAGAACGAGTTTGCAGCCAAGGCCACAGAGGATCAAATGCGCCTCCTCCGGCTACAGCGGCGTCTAGAAGATGAGCTGGGAGGCCAGTTCCTAGACCTGTCTCTACATGACACAGTCACCACCCTCATTGTTGGTGGCCATAACAAGCGTGCGGAACAGCTGTCACGTGACTTCCGCATCCCTGACAAGAGGTAG

XM_004840690.1 Coding sequence

Ptpra protein tyrosine phosphatase, receptor type, A, transcript variant X1

Length: 2400 bp    Location: 3997925..4155130   Strand: +
>XM_004840690.1
ATGGATTCCTGGTTCATTCTTGTTCTGCTTGGCAGTGGTCTGATACGTGTGAGTGCCAACAATACTACCACAGTTTCACCTTCGTTAGGATCAATTAAAGCATCAACAACAGAATCAGTTAGAGAAGAGAACAAAACTTCAAATCCAACCTCTTCAGTAACTTCTCTTTCTCTGGCACCAACATTCAGCCCAAATTCAACTCTGGGACCCACCTATGTAACCACTGTCAATTATTCATACTCGGACAATGGGACCATCAGAACAATAAGCACTAATTCTGTAGGCACTGCCATTTCACCAAATGGGACGTGGCTTCCAGACAACCAGTCCACAGATGCCAGAACACAACCCTGGCAGGGGATTTCCAGCACTACAGGAACCACTCCAAAAAACTTCACTTCTTCAGGTAATTCTGACTCGAAGGACAGAAGAGATGAGACTTCAATTATTGCAGTGATAGTAGCCTTGTCCTCTCTGCTAGTGATTGTTTTTATCATCATAGTTCTGTACATGTTAAGGTTTAAGAAATACAAGCAAGCTGGTAGCCATTCCAATTCTTTCCGCTTATCAAACGGCCGCGCTGAGGATGTGGAGCCCCAGAGCGTGCCACTTCTGGCCAGGTCCCCAAGCACTAACAGAAAATACCCACCCCTGCCCGTGGACAAGCTGGAAGAAGAGATTAACCGGAGAATGGCTGACGACAATAAGCTCTTCAGAGAAGAATTCAATGCTCTCCCTGCTTGCCCTATCCAGGCCACCTGTGAGGCTGCCTCTAAGGAAGAAAATAAAGAAAAAAATCGATACGTAAACATCTTGCCCTATGACCACTCTAGAGTACACCTGACACCTGTTGAAGGGGTTCCAGATTCTGATTACATCAATGCTTCATTCATTAATGGCTACCAAGAAAAGAACAAATTTATTGCTGCACAAGGACCAAAAGAAGAAACAGTGAATGATTTCTGGAGGATGATCTGGGAACAAAACACAGCCACCATTGTCATGGTGACCAATCTGAAGGAGAGAAAGGAGTGTAAGTGCGCCCAGTACTGGCCAGACCAAGGCTGCTGGACCTACGGGAATATCCGTGTGTCCGTAGAGGATGTGACTGTCCTGGTGGACTACACAGTACGAAAGTTCTGTATTCAGCAGGTGGGCGATGTGACCAACAGAAAACCACAGCGCCTCATCACTCAGTTCCACTTTACCAGCTGGCCAGACTTTGGGGTACCTTTCACCCCAATTGGCATGCTCAAGTTCCTCAAGAAGGTGAAGGCCTGTAACCCTCAGTATGCAGGAGCCATTGTGGTCCACTGCAGTGCAGGTGTCGGGCGTACAGGTACCTTTGTCGTCATTGATGCCATGCTGGACATGATGCACACAGAACGGAAAGTGGATGTGTATGGCTTTGTGAGCCGTATCCGGGCCCAGCGCTGCCAGATGGTTCAAACAGATATGCAGTATGTCTTCATATACCAAGCCCTTCTGGAGCATTATCTCTATGGGGATACAGAACTGGAAGTGACCTCTCTAGAAACCCACCTGCAGAAAATTTATAACAAAATCCCAGGGACCAGCAACAATGGATTAGAGGAGGAATTTAAGAAGTTAACATCAATCAAAATCCAGAATGACAAGATGCGGACTGGAAACCTTCCGGCCAACATGAAGAAGAACCGTGTTTTACAGATCATTCCATATGAATTCAACAGAGTGATCATTCCGGTTAAGCGAGGCGAGGAGAACACAGACTATGTGAATGCATCCTTCATTGATGGTTACCGGCAGAAGGACTCATACATCGCCAGCCAGGGCCCTCTTCTGCACACAATTGAGGACTTCTGGCGAATGATCTGGGAGTGGAAATCCTGTTCCATTGTGATGCTAACGGAACTGGAGGAAAGAGGCCAGGAGAAGTGTGCCCAGTACTGGCCATCTGATGGTCTGGTGTCCTATGGAGACATCACAGTGGAGCTGAAGAAAGAGGAGGAATGTGAGAGCTACACTGTCCGAGACCTCCTGGTCACCAACACCAGAGAAAACAAGAGCCGGCAGATCCGACAATTCCACTTCCATGGCTGGCCTGAAGTGGGCATCCCCAGTGATGGGAAGGGCATGATCAGCATCATTGCAGCCGTGCAGAAGCAGCAGCAGCAGTCTGGGAACCACCCTATCACTGTGCATTGCAGCGCTGGAGCAGGACGGACCGGGACCTTCTGTGCCTTGAGCACAGTCCTGGAGCGCGTGAAGGCAGAGGGAATTTTGGACGTCTTCCAGACTGTCAAGAGTCTTCGACTGCAGAGGCCACACATGGTCCAGACACTGGAACAGTACGAGTTCTGCTACAAGGTGGTGCAGGAGTACATTGACGCCTTCTCAGACTATGCCAACTTCAAGTGA

XM_004840683.1 Coding sequence

Vps16 vacuolar protein sorting 16 homolog (S. cerevisiae), transcript variant X5

Length: 2088 bp    Location: 3959677..3991191   Strand: +
>XM_004840683.1
ATGGACTGCTACACAGCGAACTGGAACCCACTCGGAGACTCTGCCTTTTACCGGAAGTATGAACTATACAGCATGGACTGGGACCTGAAAGAGGAACTCAGGGACTGCCTGGTGGCTGCTGCACCCTATGGGGGCCCCATTGCGCTGCTGAGGAACCCCTGGCGAAAGGAGAAAGCTGCCAGTGTACGGCCCATGCTTGAGATCTATTCTGCTTCTGGTGTGCCCCTGGTCAGCCTGCTGTGGAAGAGTGGACCTGTGGTGTCCATGGGCTGGTCAGCTGAGGAAGAGCTGCTCTGCGTGCAGGAAGATGGTGCAGTACTGGTTTATGGGCTTCATGGTGACTTCCGGAGACACTTTAGCATGGGCAATGAGGTGCTGCAGAACCGGGTTCTAGATGCCCGGATCTTTCACACTGAGCTTGGTTCTGGGGTGGCCATCCTCACAGGGGCCCATCGCTTTACCCTCAGTGCCAATGTAGGCGACCTCAAACTCCGCCGGATGCCAGAGGTGCCAGGCCTGCAAAGTGCACCCTCATGCTGGACTACATTGTTCCAGGAACGAGTGGCACACATTCTTCTGGCCGTGGGACCTGATCTTTACCTCTTGGATCACGCAACCTGCTCTGTAGTGACACCCCCTGGACTACCTCCAGGAGTGACTAGCTTCCTGCAGATGGCTGTCTCCTTTACCTATCGACACCTAGCACTCTTCACAGACACGGGCTACATCTGGATGGGGACAGCATCATTTACGGACAAGCTGTGTGAGTTCAACTGCAACATCCGAGCACCCCCGAAGCAAATGGTCTGGTGCACCCGACCTCGAAGCAAGGAGAGGGCTGTCGTGGTGGCCTGGGAGAGGCGGCTAATGGTGGTGGGCAATGCACCTGAGAGCATCCAATACAAGCAACTTACTATCCAGGTGCTACTGGACAGGCTTGTGTTGCGGAGACTTTACCCCCTCGCTATCCAGATATGCGAGTACTTGCGACTTCCAGAAGTACAGGGCATCAGCAGGATCCTGGCTCACTGGGCCTGCTACAAGGTACAACAGAAGGATGTGTCAGATGAGGATGTTGCACGAGCCATTAATCAGAAGCTGGGGGACACTCCTGGTGTCTCATATTCAGACATTGCTGCACGGGCCTATGGCTGTGGCCGCACAGAGCTGGCCATCAAGCTCCTGGAGTATGAACCACGCTCAGGGGAGCAGGTACCCCTTCTCCTCAAGATGAAAAGGAGCAAACTGGCACTGAGCAAGGCCATTGAGAGTGGGGACACTGACTTGGTATTCACAGTGTTACTGCACCTGAAGAATGAGCTGAACCGAGGAGACTTTTTCATGACCCTCCGGAACCAGCCCATGGCCCTGAGTTTGTACCGACAGTTTTGTAAGCATCAGGAGCTAGAGACACTGAAGGACCTCTACAATCAAGATGACAATCACCAGGAGTTGGGCAGCTTCCACCTCCGAGCCAGCTATGCTGCAGAAGAGCGCATCGAAGGGCGAGTAGCAGCTCTGCAGATAGCAGCTGATGCCTTCTATAAGGCCAAGAACGAGTTTGCAGCCAAGGCCACAGAGGATCAAATGCGCCTCCTCCGGCTACAGCGGCGTCTAGAAGATGAGCTGGGAGGCCAGTTCCTAGACCTGTCTCTACATGACACAGTCACCACCCTCATTGTTGGTGGCCATAACAAGCGTGCGGAACAGCTGTCACGTGACTTCCGCATCCCTGACAAGAGGCTCTGGTGGCTGAAGCTCACTGCCCTGGCAGATTTGGAAGACTGGGAGGAGCTGGAGAAGTTTTCCAAGAGCAAAAAATCACCCATCGGTTACCTGCCCTTTGTGGAGATCTGCATGAAACAGCACAACAAATATGAGGCCAAGAAGTATGCATCCCGTGTGGGTCCTGAGCAGAAGGTCAAAGCTTTGCTTCTTGTTGGAGACGTGGCTCAGGCTGCAGATGTGGCCATCGAGCACCGGAGTGAGGCTGAGTTGAGTCTTGTGTTGTCCCACTGCACTGGAGCCTCTGATGGGGCCACAGCTGACAAAATTCAGCGGGCCAGAACACAAGCCCAGAAGAAGTGA

XM_004840682.1 Coding sequence

Vps16 vacuolar protein sorting 16 homolog (S. cerevisiae), transcript variant X4

Length: 2178 bp    Location: 3959677..3989903   Strand: +
>XM_004840682.1
ATGGACTGCTACACAGCGAACTGGAACCCACTCGGAGACTCTGCCTTTTACCGGAAGTATGAACTATACAGCATGGACTGGGACCTGAAAGAGGAACTCAGGGACTGCCTGGTGGCTGCTGCACCCTATGGGGGCCCCATTGCGCTGCTGAGGAACCCCTGGCGAAAGGAGAAAGCTGCCAGTGTACGGCCCATGCTTGAGATCTATTCTGCTTCTGGTGTGCCCCTGGTCAGCCTGCTGTGGAAGAGTGGACCTGTGGTGTCCATGGGCTGGTCAGCTGAGGAAGAGCTGCTCTGCGTGCAGGAAGATGGTGCAGTACTGGTTTATGGGCTTCATGGTGACTTCCGGAGACACTTTAGCATGGGCAATGAGGTGCTGCAGAACCGGGTTCTAGATGCCCGGATCTTTCACACTGAGCTTGGTTCTGGGGTGGCCATCCTCACAGGGGCCCATCGCTTTACCCTCAGTGCCAATGTAGGCGACCTCAAACTCCGCCGGATGCCAGAGGTGCCAGGCCTGCAAAGTGCACCCTCATGCTGGACTACATTGTTCCAGGAACGAGTGGCACACATTCTTCTGGCCGTGGGACCTGATCTTTACCTCTTGGATCACGCAACCTGCTCTGTAGTGACACCCCCTGGACTACCTCCAGGAGTGACTAGCTTCCTGCAGATGGCTGTCTCCTTTACCTATCGACACCTAGCACTCTTCACAGACACGGGCTACATCTGGATGGGGACAGCATCATTTACGGACAAGCTGTGTGAGTTCAACTGCAACATCCGAGCACCCCCGAAGCAAATGGTCTGGTGCACCCGACCTCGAAGCAAGGAGAGGGCTGTCGTGGTGGCCTGGGAGAGGCGGCTAATGGTGGTGGGCAATGCACCTGAGAGCATCCAGTTTGTGCTAGATGAGGACTCCTACCTGGTTCCTGAGCTCGATGGGGTCCGCATCTTCTCCCGAAACACCCATGAGTTTCTGCATGAGGTTCCAGTGACCAGTGAGGAGATCTTCAAAATTGCCTCAATGGCCCCTGGAGCACTGCTATTGGAAGCCCAGAAGGAGTACGAGAAAGAGAGCCAGAAGGCAGATGAGTACCTACGAGAGATCCAGGAGCTGGGGCAGCTAACCCAGGCAGTACAGCAGTGCATTGAGGCTGCAGGACATGAGCACAGGCCAGACATGCAGAAGAGTCTGCTCAGGGCGGCCTCCTTTGGAAAGTGTTTCCTTGACAGATTTCCACCCGACAGCTTTGTACGCATGTGTCAGGACCTGCGTGTGCTCAATGCCATTCGGGACTACCACATTGGGATTCCCCTCACCTATAGCCAATACAAGCAACTTACTATCCAGGTGCTACTGGACAGGCTTGTGTTGCGGAGACTTTACCCCCTCGCTATCCAGATATGCGAGTACTTGCGACTTCCAGAAGTACAGGGCATCAGCAGGATCCTGGCTCACTGGGCCTGCTACAAGGTACAACAGAAGGATGTGTCAGATGAGGATGTTGCACGAGCCATTAATCAGAAGCTGGGGGACACTCCTGGTGTCTCATATTCAGACATTGCTGCACGGGCCTATGGCTGTGGCCGCACAGAGCTGGCCATCAAGCTCCTGGAGTATGAACCACGCTCAGGGGAGCAGGTACCCCTTCTCCTCAAGATGAAAAGGAGCAAACTGGCACTGAGCAAGGCCATTGAGAGTGGGGACACTGACTTGGTATTCACAGTGTTACTGCACCTGAAGAATGAGCTGAACCGAGGAGACTTTTTCATGACCCTCCGGAACCAGCCCATGGCCCTGAGTTTGTACCGACAGTTTTGTAAGCATCAGGAGCTAGAGACACTGAAGGACCTCTACAATCAAGATGACAATCACCAGGAGTTGGGCAGCTTCCACCTCCGAGCCAGCTATGCTGCAGAAGAGCGCATCGAAGGGCGAGTAGCAGCTCTGCAGATAGCAGCTGATGCCTTCTATAAGGCCAAGAACGAGTTTGCAGCCAAGGCCACAGAGGATCAAATGCGCCTCCTCCGGCTACAGCGGCGTCTAGAAGATGAGCTGGGAGGCCAGTTCCTAGACCTGTCTCTACATGACACAGTCACCACCCTCATTGTTGGTGGCCATAACAAGCGTGCGGAACAGCTGTCACGTGACTTCCGCATCCCTGACAAGAGGTAG

XM_004840676.1 Coding sequence

Cpxm1 carboxypeptidase X (M14 family), member 1, transcript variant X2

Length: 1974 bp    Location: 3936636..3930428   Strand: -
>XM_004840676.1
ATGTGGGGTCCGCTGCTCACCTTGGCCGCCTTCGCGCCTGCCGTTGGTCTGGGTCTGGGGACGCCCAGCGCCTCAGTGCTGGACCTGGCGCGGCCCTCGACCACGGAACCCCTGGGCTCGACCCTGGCCCCGAGTAGCAGCCCTGCACTGCCGCCAGCGAAGGCGAACGGAACCTTGAAACAGCACACCCGGATTCGAATCATCAGGAAGAAAAAGGTCATTCTGAAGAAGCGAAAGAAACTAACTAGTCCCAGTTTCCCAGTGACTGCCAAGCCTTTGGTGACCACCAGCTCAGCAGGGACTCTCAACCTCTTTGAGAAACAGGAACCAGGCTGTCCCCCTTTGGGCCTGGAGTCCCTCCGAGTTTCAGATAGCCAGCTTGAGGCATCCAGCAGCCAGTCTTTTGGTCTTGGACCACACCGAGGACGGCTCAACATCCAGTCAGGCCTGGAGGATGGTGATCTGTATGATGGGGCCTGGTGTGCCGAGCAGCAGGACACTGAGCCATGGCTTCAGGTGGACACTAGGAAACCCACCCGCTTCTCAGGCATTGTCACACAGGGCAGGAACTCTATCTGGAGATATGACTGGGTCACATCATACAAGGTCCAGTTCAGCAATGACAGTCAGAACTGGTGGAGGAGTCGGAATCACAGCAGTGGGATGGACTCGGTATTTCCTGCTAATTCTGACCCAGAAACCCCAGTGCTGAACCTCCTGCCAGAGCCCCAGGTGGCCCGCTTCATTCGTCTGCTGCCCCAGACCTGGCTCCAGGGAGGCTCATCTTGCCTCCGAGCAGAGATCCTGGGCTGCCCCATCTCAGATCCTAATGACCTGTTCCCTGAGACCCACACACCAGGGTCCTCTGACCCTCTGGACTTTCAGCATCACAATTACAAGGCCATGAGGAAGCTGATGAAGCAGGTGAATGAGAAGTGTCCCAACATCACCCGCATCTACAGCATCGGGAAGAGCTACCAGGGCCTGAAGCTATATGTGATGGAAATGTCAGACCATCCTGGGGAGCATGAGCTGGGGGAGCCTGAGGTACGCTATGTGGCTGGCATGCATGGGAATGAGGCCCTGGGGCGCGAGTTGGTTCTGCTCCTGATGCAGTACTTGTGCCGGGAGTACCTGCGAGGGGACCCACGAGTGACCCGGCTGCTCAATGAGATGCGCATCCACCTGTTGCCCTCCATGAACCCTGATGGTTATGAGATTGCCTACCGCCGGGGCTCGGAGCTGGTGGGCTGGGCAGAGGGTCGCTGGACCCACCAGAGCATTGACCTTAACCACAATTTTGCTGATCTCAACACACAACTGTGGGATGCAGAGGACGATGGGCTAGTGCCCCATATAGTCCCCAACCATCACCTGCCACTGCCTACTTATTACACCCTGCCCAATGCAACTGTGGCTCCTGAAACATGGGCAGTGATCAACTGGATGAAACGGATCCCCTTTGTGCTGAGTGCCAACCTTCATGGGGGCATGAATGACTTCAGTTATCTACACACTAACTGCTTTGAGGTCACTGTGGAGCTGTCCTGTGACAAGTTCCCTCATGAGAGTGAGCTGCCCCAGGAGTGGGAGAACAACAAAGATGCCCTCCTCACATACCTGGAACAGGTGCGCATGGGCATTGCAGGAGTTGTGCGGGACAAGGACACGGAGGAGGGGATTGCTGATGCTGTCATTGTTGTGGATGGGATTAACCATGATGTTACAACGGCATGGGGTGGGGATTACTGGCGGCTGCTAACCCCAGGGGACTATATGGTGACTGCCAGTGCTGAAGGCTACCATGCAGTGACACGGAGCTGCCAGGTCACCTTTGAAGAGGGACCAACCCCCTGCAATTTCTTGCTCACCAAGACTCCCAAACAGAGACTGAGAGAGCTGCTGGCAACAGGGGCCAAGGTCCCCCCAGACCTTCGGAGGCGGCTGGAGCGGCTGAGAGGACAGAAAGATTAA

XM_004840680.1 Coding sequence

Vps16 vacuolar protein sorting 16 homolog (S. cerevisiae), transcript variant X2

Length: 2199 bp    Location: 3959677..3989988   Strand: +
>XM_004840680.1
ATGGACTGCTACACAGCGAACTGGAACCCACTCGGAGACTCTGCCTTTTACCGGAAGTATGAACTATACAGCATGGACTGGGACCTGAAAGAGGAACTCAGGGACTGCCTGGTGGCTGCTGCACCCTATGGGGGCCCCATTGCGCTGCTGAGGAACCCCTGGCGAAAGGAGAAAGCTGCCAGTGTACGGCCCATGCTTGAGATCTATTCTGCTTCTGGTGTGCCCCTGGTCAGCCTGCTGTGGAAGAGTGGACCTGTGGTGTCCATGGGCTGGTCAGCTGAGGAAGAGCTGCTCTGCGTGCAGGAAGATGGTGCAGTACTGGTTTATGGGCTTCATGGTGACTTCCGGAGACACTTTAGCATGGGCAATGAGGTGCTGCAGAACCGGGTTCTAGATGCCCGGATCTTTCACACTGAGCTTGGTTCTGGGGTGGCCATCCTCACAGGGGCCCATCGCTTTACCCTCAGTGCCAATGTAGGCGACCTCAAACTCCGCCGGATGCCAGAGGTGCCAGGCCTGCAAAGTGCACCCTCATGCTGGACTACATTGTTCCAGGAACGAGTGGCACACATTCTTCTGGCCGTGGGACCTGATCTTTACCTCTTGGATCACGCAACCTGCTCTGTAGTGACACCCCCTGGACTACCTCCAGGAGTGACTAGCTTCCTGCAGATGGCTGTCTCCTTTACCTATCGACACCTAGCACTCTTCACAGACACGGGCTACATCTGGATGGGGACAGCATCATTTACGGACAAGCTGTGTGAGTTCAACTGCAACATCCGAGCACCCCCGAAGCAAATGGTCTGGTGCACCCGACCTCGAAGCAAGGAGAGGGCTGTCGTGGTGGCCTGGGAGAGGCGGCTAATGGTGGTGGGCAATGCACCTGAGAGCATCCAGTTTGTGCTAGATGAGGACTCCTACCTGGTTCCTGAGCTCGATGGGGTCCGCATCTTCTCCCGAAACACCCATGAGTTTCTGCATGAGGTTCCAGTGACCAGTGAGGAGATCTTCAAAATTGCCTCAATGGCCCCTGGAGCACTGCTATTGGAAGCCCAGAAGGAGTACGAGAAAGAGAGCCAGAAGGCAGATGAGTACCTACGAGAGATCCAGGAGCTGGGGCAGCTAACCCAGGCAGTACAGCAGTGCATTGAGGCTGCAGGACATGAGCACAGGCCAGACATGCAGAAGAGTCTGCTCAGGGCGGCCTCCTTTGGAAAGTGTTTCCTTGACAGATTTCCACCCGACAGCTTTGTACGCATGTGTCAGGACCTGCGTGTGCTCAATGCCATTCGGGACTACCACATTGGGATTCCCCTCACCTATAGCCAATACAAGCAACTTACTATCCAGGTGCTACTGGACAGGCTTGTGTTGCGGAGACTTTACCCCCTCGCTATCCAGATATGCGAGTACTTGCGACTTCCAGAAGTACAGGGCATCAGCAGGATCCTGGCTCACTGGGCCTGCTACAAGGTACAACAGAAGGATGTGTCAGATGAGGATGTTGCACGAGCCATTAATCAGAAGCTGGGGGACACTCCTGGTGTCTCATATTCAGACATTGCTGCACGGGCCTATGGCTGTGGCCGCACAGAGCTGGCCATCAAGCTCCTGGAGTATGAACCACGCTCAGGGGAGCAGGTACCCCTTCTCCTCAAGATGAAAAGGAGCAAACTGGCACTGAGCAAGGCCATTGAGAGTGGGGACACTGACTTGGTATTCACAGTGTTACTGCACCTGAAGAATGAGCTGAACCGAGGAGACTTTTTCATGACCCTCCGGAACCAGCCCATGGCCCTGAGTTTGTACCGACAGTTTTGTAAGCATCAGGAGCTAGAGACACTGAAGGACCTCTACAATCAAGATGACAATCACCAGGAGTTGGGCAGCTTCCACCTCCGAGCCAGCTATGCTGCAGAAGAGCGCATCGAAGGGCGAGTAGCAGCTCTGCAGATAGCAGCTGATGCCTTCTATAAGGCCAAGAACGAGTTTGCAGCCAAGGCCACAGAGGATCAAATGCGCCTCCTCCGGCTACAGCGGCGTCTAGAAGATGAGCTGGGAGGCCAGTTCCTAGACCTGTCTCTACATGACACAGTCACCACCCTCATTGTTGGTGGCCATAACAAGCGTGCGGAACAGCTGTCACGTGACTTCCGCATCCCTGACAAGAGCTTTCCCATAGGCTCTGGTGGCTGA

XM_004840677.1 Coding sequence

LOC101711852 chromosome unknown open reading frame, human C20orf141

Length: 504 bp    Location: 3939350..3940195   Strand: +
>XM_004840677.1
ATGACCTGCCTCTGCTTACTCAGGCCCAAAGCCCTTGCAGGTCCAATCCCACTCCCTGCCAGGGACCTGGGTGCTAGGGAGGGATTGGGTAGGTTAGTACACCCATGAGTATCCCCCTGGGACCCTAGCCAGGCTCAGCTCCTGGATAGCATTCTAGGACTGGGGGCACCAGGGCTGACAACTGGAGCAGTCTTTACCATGTCTGGAGCAGTTCTGCTGCTACTACTGTTGCTGGTCAGCTTCCTCGCCTTTGACTTGCTCCACAGGCCTGCAAGTCCCACCCTGCTGCAACACAGACTGCTCACAAGGGGCCAGAATCAGGGCGCCGGCAAGGGTCCAGGACAGCAGGCAGCTCCCCTCTTCCCAACAGGGGTCATCCCAGGACAGCCCAGCCTCCAGGATGCACTGCTCCTGCTGCTCTTCGGCCTGGGGCTGCTCTTGGGAGCCCATGGCATAATCCTGGCCCTGCTGGGCCTGGTTTTCTGCCTGCATCCTTGGGCCTGA

XM_004840671.1 Coding sequence

Idh3b isocitrate dehydrogenase 3 (NAD+) beta, transcript variant X3

Length: 1158 bp    Location: 3814226..3808784   Strand: -
>XM_004840671.1
ATGGCGGCTTTGAACGGTGTCCGCTGGCTGACCCGAGCAGTGGTTGCCGTCCGGAGCCCTGGGGCATGGAGAGGTCTGAGTATTTCAGTCACAGCGAATGCAGCTTCTCAGTCACAGGCTCAAGACATGAAAGTCGAGGGCGCATTTCCTGTGACCATGCTGCCGGGAGATGGCGTTGGGCCGGAGCTCATGCATGCTGTCAAGGAGGTGTTCAAGGCTGCTTCTGTCCCAGTGGAGTTCCAGGAGCACCACCTGAGTGAGGTGCAGAATATGGCCTCTGAGGAGAAGCTGGAGCAGGTGCTGAATTCCATGAAGGAGAACAAAGTGGCCATCATTGGAAAGATCCATACCCCAATGGAGTATAAGGGGGAACTAGCTTCCTATGATATGCGGCTAAGGCGTAAGTTGGATTTGTTTGCCAACGTAGTCCATGTGAAGTCCCTTCCTGGGTACATGACTCGGCATAACAATCTAGATCTGGTGATTATTCGAGAGCAGACAGAAGGGGAATACAGCTCTCTGGAGCATGAGAGTGCAAGGGGTGTGATTGAATGCTTAAAGATTGTTACTCGAACCAAATCTCAGCGGATTGCAAAGTTTGCCTTTGACTATGCCACCAAGAAGGGGCGGAGCAAGGTCACAGCTGTCCATAAGGCCAATATCATGAAACTTGGGGATGGGTTGTTCCTGCAGTGCTGTGAGGAAGTTGCTGAACTGTATCCCAAAATCAAGTTTGAGACAATGATCATAGACAACTGCTGCATGCAGCTGGTGCAGAATCCTTACCAGTTTGATGTGCTTGTGATGCCCAATCTCTATGGGAACATTATTGACAATCTGGCTGCTGGCCTGGTTGGGGGAGCTGGTGTGGTCCCTGGTGAGAGCTACAGTGCCGAGTATGCAGTTTTTGAGACGGGTGCCCGACATCCATTTGCCCAAGCAGTGGGCAGGAATATAGCCAACCCCACAGCCATGTTGCTGTCAGCTTCCAACATGCTTCGGCATCTCAATCTTGAGTATCACTCCAGCACGATTGCTGATGCAGTGAAGAAGGTGATCAAAGTTGGCAAGGTGCGGACTCGAGACATGGGCGGCTACAGCACCACAACCGACTTCATCAAGTCTGTCATCGGCCATCTACACCCCCATGGGGTCTAG

XM_004840663.1 Coding sequence

Pdyn prodynorphin, transcript variant X1

Length: 741 bp    Location: 3253108..3239109   Strand: -
>XM_004840663.1
ATGGCGTGGCAGAGGCTGGTGCTGGCCACCTGCCTCCTGGTGCTGCCCTCTGCCTCAGCAGAATGCCTGTCCCAGTGCTCCTTGTGTGCTGTGAAGACCCAGGATTGGCCCAAACCCATCAATCCCCTGATTTGCTCCCTGGAATGCCAGGACACCTTGCTGCCCACCGAGGAGTGGCAGCGATGCCAGGGCATCCTGTCCTTTTTCACCCCCTCTGCCTTCAGGTTCAGGGGCCAGAATGGCCTGGACAGCAGGGCAGCTTTGGAAAAGGCCTCCATGGAGCTGGTCAAGCATGCTGGGCCTTTCCTGCAGGAGCTGGAGAAAAGTGGACTCCTCTCCAGCACCCCTGCAAAGGACAAGCTCAGGGGTCTCTCTGGTGGGTTCGGGGAAGGCATGGAGTCTGACGCAGTGGGAGCTTCCCAGCTACACGGTGGTGCTGTGGAGGCTGCAGCTCTCAATTTCGATGAGGACCCCAAGGAGCAGGTCAAACGCTACGGGGGCTTTCTTCGCAAATATCCCAAGAGGAGCACAGAGGTGGCTGGGGAGGGCGATGGGGATGAGGACAGTGTGGGCCACGAGGACCTGTACAAACGCTATGGGGGCTTCTTGCGGCGCATCCGTCCCAAGCTCAAGTGGGACAACCAGAAGCGCTATGGTGGTTTTCTCCGGCGCCAGTTCAAGGTGGTGACACGGTCACAGGAAGACCCCAGTGCCTACTCAGAAGAGTTTTTTGATGTGTAA

XM_004840664.1 Coding sequence

Pdyn prodynorphin, transcript variant X2

Length: 741 bp    Location: 3253108..3239109   Strand: -
>XM_004840664.1
ATGGCGTGGCAGAGGCTGGTGCTGGCCACCTGCCTCCTGGTGCTGCCCTCTGCCTCAGCAGAATGCCTGTCCCAGTGCTCCTTGTGTGCTGTGAAGACCCAGGATTGGCCCAAACCCATCAATCCCCTGATTTGCTCCCTGGAATGCCAGGACACCTTGCTGCCCACCGAGGAGTGGCAGCGATGCCAGGGCATCCTGTCCTTTTTCACCCCCTCTGCCTTCAGGTTCAGGGGCCAGAATGGCCTGGACAGCAGGGCAGCTTTGGAAAAGGCCTCCATGGAGCTGGTCAAGCATGCTGGGCCTTTCCTGCAGGAGCTGGAGAAAAGTGGACTCCTCTCCAGCACCCCTGCAAAGGACAAGCTCAGGGGTCTCTCTGGTGGGTTCGGGGAAGGCATGGAGTCTGACGCAGTGGGAGCTTCCCAGCTACACGGTGGTGCTGTGGAGGCTGCAGCTCTCAATTTCGATGAGGACCCCAAGGAGCAGGTCAAACGCTACGGGGGCTTTCTTCGCAAATATCCCAAGAGGAGCACAGAGGTGGCTGGGGAGGGCGATGGGGATGAGGACAGTGTGGGCCACGAGGACCTGTACAAACGCTATGGGGGCTTCTTGCGGCGCATCCGTCCCAAGCTCAAGTGGGACAACCAGAAGCGCTATGGTGGTTTTCTCCGGCGCCAGTTCAAGGTGGTGACACGGTCACAGGAAGACCCCAGTGCCTACTCAGAAGAGTTTTTTGATGTGTAA

XM_004840665.1 Coding sequence

Pdyn prodynorphin, transcript variant X3

High confidence: 4 potential gene matches
Length: 741 bp    Location: 3251601..3239109   Strand: -
>XM_004840665.1
ATGGCGTGGCAGAGGCTGGTGCTGGCCACCTGCCTCCTGGTGCTGCCCTCTGCCTCAGCAGAATGCCTGTCCCAGTGCTCCTTGTGTGCTGTGAAGACCCAGGATTGGCCCAAACCCATCAATCCCCTGATTTGCTCCCTGGAATGCCAGGACACCTTGCTGCCCACCGAGGAGTGGCAGCGATGCCAGGGCATCCTGTCCTTTTTCACCCCCTCTGCCTTCAGGTTCAGGGGCCAGAATGGCCTGGACAGCAGGGCAGCTTTGGAAAAGGCCTCCATGGAGCTGGTCAAGCATGCTGGGCCTTTCCTGCAGGAGCTGGAGAAAAGTGGACTCCTCTCCAGCACCCCTGCAAAGGACAAGCTCAGGGGTCTCTCTGGTGGGTTCGGGGAAGGCATGGAGTCTGACGCAGTGGGAGCTTCCCAGCTACACGGTGGTGCTGTGGAGGCTGCAGCTCTCAATTTCGATGAGGACCCCAAGGAGCAGGTCAAACGCTACGGGGGCTTTCTTCGCAAATATCCCAAGAGGAGCACAGAGGTGGCTGGGGAGGGCGATGGGGATGAGGACAGTGTGGGCCACGAGGACCTGTACAAACGCTATGGGGGCTTCTTGCGGCGCATCCGTCCCAAGCTCAAGTGGGACAACCAGAAGCGCTATGGTGGTTTTCTCCGGCGCCAGTTCAAGGTGGTGACACGGTCACAGGAAGACCCCAGTGCCTACTCAGAAGAGTTTTTTGATGTGTAA

XM_004840660.1 Coding sequence

Nsfl1c NSFL1 (p97) cofactor (p47), transcript variant X3

Length: 1020 bp    Location: 2774032..2749501   Strand: -
>XM_004840660.1
ATGGCGGCGGAACGACAGGATGCGCTGAGGGAGTTTGTGGCGGTAACGGGCGCTGAGGAGGACCGGGCCCGCTTCTTCCTCGAGTCGGCCGGCTGGGACCTGCAGATTGCGCTAGCGAGCTTTTATGAGGACGGAGGGGACGAAGACATTGTGACCATTTCACAGGCAACCCCCAGTTCAGTGTCCAGAGGCACAGCCCCCAGTGATAATAGGGTGACATCCTTCAGAGACCTTATTCATGACCAAGATGAGGATGACGAAGAGGAAGAGGGCCAGAGGTTTTATGCTGGGGGCTCAGAGAGAAGTGGACAACAGATTGTTGGCCCTCCCAGGAAGAAAAGTCCCAACGAGCTGGTGGATGATCTCTTTAAAGGTGCTAAGGAGCACGGAGCTGTAGCTGTGGAGCGAGTGACCAAGAGCCCTGGAGAGACCAGTAAACCAAGAGTTCATGTCGTTCTGAAGCTCTGGAAAAGTGGATTCAGCCTGGACAATGGCGAGCTCAGAAGCTACCAAGACCCATCCAATGCCCAGTTTCTGGAGTCAATCCGCAGAGGGGAGGTGCCAGCAGAGCTGCGGAGGTTAGCTCATGGTGGGCAGGTGAACTTGGATATGGAAGACCATCGGGATGAGGACTTTGTGAAGCCTAAGGGAGCTTTCAAAGCTTTCACTGGTGAAGGCCAGAAACTCGGCAGCACAGCCCCCCAGGTATTGAGTACCAGCTCTCCAGCCCAGCAGGCAGAAAATGAAGCCAAAGCCAGCTCTTCTGTCTTAATCAACGAGTCAGAGCCTACTACCAACATCCAAATTCGACTTGCCGATGGTGGGAGACTGGTACAGAAATTTAACCACAGCCACAGGATCAGCGACATCCGACTTTTCATCGTGGATGCCCGGCCAGCCATGGCTGCCACCAGCTTTGTCCTCATGACTACCTTTCCAAACAAAGAGCTGGCTGACGAGAGCCAAACTCTGAAGGAAGCCAACCTACTCAATGCTGTCATCGTGCAGCGGTTAACATAA

XM_004840654.1 Coding sequence

Snph syntaphilin, transcript variant X6

Length: 1590 bp    Location: 2609589..2622540   Strand: +
>XM_004840654.1
ATGGCCATGTCCCTGCCAGGGAGCAGACGGGCCTCTGCTGGATCCCGCAGTGGGGGCGCTTTGAGCCACAGTGGCCTGGCAGTGTTCGCTCAGTGCCCACAGCTGCCCCCCAGCCAGAATGAGCACCTGCCTCTTCTCCCTGCCTCCAGGCGCACCTCTCCACCCGTGAGCGTGCGGGATGCCTATGGTACCTCTTCCCTCAGCAGTAGCAGCAACTCAGGCTCCTGCAAGGGCAGCGACAGCAGCCCCACACCCAGGCGCTCCATGAAGTACACACTGTGCAGTGACAACCATGGCATCAAGCCCCCCACCCCGGAGCAGTACCTGACCCCCCTGCAGCAGAAAGAGGTGTGCATCCGGCACCTGAAGGCGCGGCTGAAGGACACACAGGACCGGCTCCAGGACCGGGACACAGAGATCGATGACCTGAAGACACAGCTATCACGCATGCAGGAGGACTGGATTGAGGAGGAATGCCACCGTGTGGAGGCTCAGCTAGCCCTGAAGGAAGCCCGCAAGGAAATCAAACAGCTCAAACAGGTCATTGACACTGTCAAAAACAACCTGATTGACAAAGACAAGGGGCTGCAGAAATACTTTGTGGACATCAACATCCAGAACAAGAAGCTAGAGACGCTGCTGCACAGCATGGAGGTGGCCCAGAATGGCATGGCCAAGGAGGAGGGCACTGGGGAGTCGGCTGGTGGTTCCCCTGCCCGCTCCCTCACCCGCAGTTCCACTTATACCAAGCTGAGTGACCCAGCTGTCTGCGGTGACCACCAGCCTGGTGATCCCTCCGCCTCTGCTGAAGATGGAACCGACAGTGGCTTTGTGGCTGCTGATGACACACTAAGCCGGACTGACGCTCTAGAGGCCAGCAGCCTGCTGTCATCAGGGGTGGACTGTGGCCCTGAGGAGGCCTCGCTGCACAGCTCCTTCAGCCTGGGTGCCCGCTTCCCTGCCAGTAACACCTATGAGAAGCTTCTGTGTGCCACAGAAGCTGGTGTGCAGGCCAGCTGCATGCAGGAGCGGGCCATCCAGACAGACTTTGTGCACTACCAACCCGACCTGGACACCATCCTGGAGAGAGTGACACAGGCCCAGGGCTGTGGGACAGTCCCTGAGGACAGGCACCCAGAGTCAGATTCCCACCCCCCAGGGCCCAGAGACCCCAACTCAGCAGTGGTGGTGACAATGGGTGATGAGCTTGAGGTCCCGCAGGCCATCACCCATGGGCCCACTGTACACCGGCCTGGAGCCAACCCCAACCCTGGTCTGTCGGTGAGTGTGGTATGCCCTGTGGAGGAGGAGGAGGAGGAGGTGGCCACGCCTGCGGCTACAGCTGAAAAGGAGCCCAAGAGCTACTGGAGTCGCCACTACATCGTGGATCTTCTGGCTGTGGTGGTGCCAGCCATGCCCACAGTAGCCTGGCTTTGCCGCTCCCAGCGACGCCAGGGCCAGCCCATCTACAACATCAGCTCCCTGCTGCGGGGCTGCTGCACTGTGGCCTTGCACTCCATCCGCAGGATGAGCTGCCGCTCTCTAGCCCACTCAGGGCCCAGTTCAGCAAGCAGTAGCTCCCAGCTCTGA

XM_004840643.1 Coding sequence

Slc52a3 solute carrier family 52, riboflavin transporter, member 3, transcript variant X3

Length: 1407 bp    Location: 2100817..2106877   Strand: +
>XM_004840643.1
ATGGCCTTGCTGGTCCACCTGCTGGTCTGCGTCTTCGGGATGGGCTCCTGGGTGGCCATCAATGGGCTGTGGGTGGAGCTGCCCCTGCTGGTGACAGAGCTGCCTGAGGGCTGGAACCTGCCCTCCTACCTCACGCTGATCATCCAGCTGGCCAACATTGGGCCCCTGCTGGTCACCCTGCTGCATCGCTTCCGGCCTGGCTATCTCTCTGAAGTCGCCATCATCTTCACCATCCTGACCGTAGGCACTGTCACCTGTATCCTTTTTGCCTTCCTCTGGAACATGACCTCCAGAGTGCTGGGTGGCCGCCACAGCATTGCCTTCATCATCCTCACTTTCTTCCTGGCACTGGTGGACTGCACCTCCTCCGTCACCTTCCTGCCCTTCATGAGCCAGCTGCCCTCCTACTACCTCACTACCTTCTTTGTGGGTGAAGGATTCAGTGGCCTCCTGCCTGCACTGTTGGCTCTGGCCCAGGGCTCGGGTATCACCTCCTGTGTCAATGTCACGGACTCACTGGATGCCAACTCAAGCACTGTGACCACCAACGAGACCCACAGCACACAGGGAACCAGCAGCCCCACGGTGTGGACCCCCACGGTGTGGACCCCCACCAGCCACCTGGAGGGCCGCTACCTCCCCGCGCGCTTCTCACCACTGGTCTTCTTCCTGCTGCTGGCCGCCATGATGGCCTGCTGCCTCCTCGCCTTCTTCCTGCTCCAGCATCGGTCCCAGGCCCAGCAAGGTTCCATCGAGGACCTGCTTCAGTCCCAGGTCACCCTCCACTCCATCAGGCCGCAAGAGGAGAAAGACGCAGGCCCCCTAGACCCTGCAGAGAACAGCAAGGGGAAGGCACAACTGGAGGAGAAAGTGGCCACCCTGCACCCTGTGCAGCTGGCCTTCATCTACACGCTGGTGGCCTTTGTAAACGCACTCACCAACGGCGTGCTACCCTCTGTGCAGACCTACTCCTGCCTGTCCTACGGGTCTTTCACCTACCACCTGTCTGCCACCCTCAGCTCCGTGGCCAGCCCACTTGCCTGCTTCCTCTCCATATTCCTGCCTAACAGGTCTCTGCCTTTCCTGGGGGTCATCACTGTGCTGGGGACTGGCTTTGGGGCCTACAACATGGCCATGGCTGCGATGAGCCCCTGCCCCCTCCTCCAGGGCCACTGGGGGGGAGAAGTCCTCATTGTGATTTCTTGGGTGCTGTTCACTGCCTGTCTCAGCTACATCAAGGTCATGCTGGGAGTGATCCTGAGAGACCAGAGCCACAGCGCCCTCGTGTGGTGCGGGGCGGCGGTGCAGCTGGGCTCTCTGGTCGGGGCGCTGCTCATGTTCCCGCTGGTCAATGTGCTGAGGCTCTTCGTGTCTGCCGACTTTTGCAACCTGGATTGCTCTACCTAG

XM_004840641.1 Coding sequence

Slc52a3 solute carrier family 52, riboflavin transporter, member 3, transcript variant X1

Length: 1407 bp    Location: 2101483..2106877   Strand: +
>XM_004840641.1
ATGGCCTTGCTGGTCCACCTGCTGGTCTGCGTCTTCGGGATGGGCTCCTGGGTGGCCATCAATGGGCTGTGGGTGGAGCTGCCCCTGCTGGTGACAGAGCTGCCTGAGGGCTGGAACCTGCCCTCCTACCTCACGCTGATCATCCAGCTGGCCAACATTGGGCCCCTGCTGGTCACCCTGCTGCATCGCTTCCGGCCTGGCTATCTCTCTGAAGTCGCCATCATCTTCACCATCCTGACCGTAGGCACTGTCACCTGTATCCTTTTTGCCTTCCTCTGGAACATGACCTCCAGAGTGCTGGGTGGCCGCCACAGCATTGCCTTCATCATCCTCACTTTCTTCCTGGCACTGGTGGACTGCACCTCCTCCGTCACCTTCCTGCCCTTCATGAGCCAGCTGCCCTCCTACTACCTCACTACCTTCTTTGTGGGTGAAGGATTCAGTGGCCTCCTGCCTGCACTGTTGGCTCTGGCCCAGGGCTCGGGTATCACCTCCTGTGTCAATGTCACGGACTCACTGGATGCCAACTCAAGCACTGTGACCACCAACGAGACCCACAGCACACAGGGAACCAGCAGCCCCACGGTGTGGACCCCCACGGTGTGGACCCCCACCAGCCACCTGGAGGGCCGCTACCTCCCCGCGCGCTTCTCACCACTGGTCTTCTTCCTGCTGCTGGCCGCCATGATGGCCTGCTGCCTCCTCGCCTTCTTCCTGCTCCAGCATCGGTCCCAGGCCCAGCAAGGTTCCATCGAGGACCTGCTTCAGTCCCAGGTCACCCTCCACTCCATCAGGCCGCAAGAGGAGAAAGACGCAGGCCCCCTAGACCCTGCAGAGAACAGCAAGGGGAAGGCACAACTGGAGGAGAAAGTGGCCACCCTGCACCCTGTGCAGCTGGCCTTCATCTACACGCTGGTGGCCTTTGTAAACGCACTCACCAACGGCGTGCTACCCTCTGTGCAGACCTACTCCTGCCTGTCCTACGGGTCTTTCACCTACCACCTGTCTGCCACCCTCAGCTCCGTGGCCAGCCCACTTGCCTGCTTCCTCTCCATATTCCTGCCTAACAGGTCTCTGCCTTTCCTGGGGGTCATCACTGTGCTGGGGACTGGCTTTGGGGCCTACAACATGGCCATGGCTGCGATGAGCCCCTGCCCCCTCCTCCAGGGCCACTGGGGGGGAGAAGTCCTCATTGTGATTTCTTGGGTGCTGTTCACTGCCTGTCTCAGCTACATCAAGGTCATGCTGGGAGTGATCCTGAGAGACCAGAGCCACAGCGCCCTCGTGTGGTGCGGGGCGGCGGTGCAGCTGGGCTCTCTGGTCGGGGCGCTGCTCATGTTCCCGCTGGTCAATGTGCTGAGGCTCTTCGTGTCTGCCGACTTTTGCAACCTGGATTGCTCTACCTAG

XM_004840632.1 Coding sequence

Csnk2a1 casein kinase 2, alpha 1 polypeptide, transcript variant X3

Length: 1176 bp    Location: 1611386..1566550   Strand: -
>XM_004840632.1
ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACGCACAGACCCCGAGAGTACTGGGATTATGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAACTGGTTAGAAAACTAGGCAGGGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAGGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTAAGAGGAGGCCCCAATATCATCACATTGGCAGACATTGTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACATGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAAATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTGAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGGCTAATAGACTGGGGCCTAGCTGAGTTTTATCATCCTGGTCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGCCCTGAGCTACTTGTAGACTATCAGATGTATGATTATAGTTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTCCGGAAGGAGCCGTTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGATTATATTGACAAATACAACATTGAATTAGATCCCCGTTTCAATGATATCTTGGGCAGACACTCTCGTAAGCGATGGGAACGCTTTGTCCACAGTGAAAACCAGCACCTTGTCAGCCCAGAGGCCTTGGATTTCCTGGATAAGCTGCTGCGATATGATCACCAGTCACGGCTCACTGCAAGAGAAGCCATGGAACATCCCTATTTCTATACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCAGGGGGCAGTACACCTGTCAGCAGCGCCAACATGATGTCAGGGATTTCTTCAGTGCCAACCCCTTCACCCCTCGGACCTCTGGCAGGCTCACCAGTGATTGCTTCTGCCAACCCCCTTGGGATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA

XM_004840635.1 Coding sequence

Tcf15 transcription factor 15 (basic helix-loop-helix)

High confidence: 4 potential gene matches
Length: 591 bp    Location: 1694815..1689431   Strand: -
>XM_004840635.1
ATGGCTTTCGCGCTGCTGCGCCCCGTCGGCGCGCACGTGCTGTACCCGGACGTAAGGCTGCTGAGCGAGGACGAGGAGAACCGCAGCGAAAGCGACGCGTCGGACCAGTCGTTCGGCTGCTGCGAAGGCCTGGAGGCAGCGCGGCGAGGCCCGGGCCCCGGGGGCGGGCGGCGGGCGGGCGGCGGCGCGGGCCCTGTGGTAGTAGTGCGACAGCGGCAGGCGGCCAACGCGCGGGAACGGGACCGCACGCAGAGCGTGAACACGGCCTTTACGGCGCTGCGCACGCTTATCCCCACCGAGCCGGTGGATCGAAAGCTGTCCAAGATCGAGACGCTGCGCCTGGCTTCCAGCTACATCGCGCACCTGGCCAACGTGTTGCTGCTGGGCGACGCGGCCGACGACGGGCAGCCGTGCTTCCGTGCGGCCGGCAACGCCAAGACCGCCGCCGCCGCCGCCGCCGACGGCCGCCAGCCGCGCTCCATCTGCACCTTCTGCCTCAGCAACCAGCGCAAGGGGGGTGGCCGTCGTGACCTGGGAGGCAGCTGCTTGAAAGTGAGGGGGGTAACCCCTCTTCGAGGGCCTCGGAGATGA

XM_004840636.1 Coding sequence

Srxn1 sulfiredoxin 1

High confidence: 4 potential gene matches
Length: 414 bp    Location: 1730053..1724554   Strand: -
>XM_004840636.1
ATGGGGCTGCGCGCTGGCCGAGCTCTGGGCAGAGTGGGTGCGGGCCGGGGGATGCTCGAGGGGCCCGGGGAGAGCGGCAGTGCGCAGGGCGGCAGTATCCACTCGGGCTGCATCGCCGCCGTGCACAACGTGCCGCTGAGCGTGCTCATTCGACCGCTGCCTTCTGTGCTGGACCCGGCCAAGGTGCAGAGACTGGTGGACACCATCCGGGACAACCCAGACAACGTGCCGCCCATCGACGTTCTCTGGATCAAAGGGGCCCAGGGTGGTGACTACTACTACTCCTTCGGGGGCTGCCATCGCTACGCAGCCTACCAGCAGCTGCAGCGAGAGACCATCCCTGCCAAGCTTGTGCAGTCCACCCTTTCGGACCTCCGAGTGTACCTGGGCGCGTCCACTCCGGATTTGCAGTAG

XM_004840612.1 Coding sequence

Defb128 defensin, beta 128

Length: 285 bp    Location: 1251708..1249893   Strand: -
>XM_004840612.1
ATGAAGCTGTTTCTGGTTCTCATTGTTCTGCTGTCTCAGGTACTCACAGCTTGGGCAAAACCCCCAAGATGCTTTAATAATGTGGCAGGCTACTGCAAGAAGAAATGCAAAATGGGGGAAATATCTGAAATGGGATGTCTACATGGAAAATTATGTGGTGTCAATGAAGAGGAAAACAAAAAATACCACAAATCCCACCAACCACCTCCACAATCTGATCAGAAGGTTGCAGAGGTGTACGACTATGTCATTTACCCCACCGTCACACTTGTTTCGATCCTGTGA

XM_004840629.1 Coding sequence

Tbc1d20 TBC1 domain family, member 20, transcript variant X2

Length: 1131 bp    Location: 1550806..1525739   Strand: -
>XM_004840629.1
ATGGCCCTCCGATGTGAGCAGGGCGACGGCCCTACCTGCAGCCCCTGGGACGGTGGTACCCAGAAGACAGACTTCAACACCAAAAGGAAAAAGAAAGTGGCAGAGATCTACCAGGCTCTGAACAGTGATCCCACTGATGTGGCTGCCCTTAGACGCATGGCTATCAGTGAAGGAGGACTCCTGACCGATGAGATCAGACAAAAAGTGTGGCCCAAGCTCCTCAATGTCAACACCAGTGATCCATCACCTGCACCAGGCATGCCAGATGAACAGAGGGAAGGGCTCCAGGAAGAGCTCATCGACATCATCCTCCTCATCTTGGAGCGGAACCCTCAGTTGCACTACTACCAGGGCTACCATGACATCGTGGTCACATTTCTGCTGGTGGTAGGCGAGAAGCTGGCAACATCCCTGGTAGAAAAATTATCTACCCACCACCTCAGGGATTTCATGGATTCCACAATGGACAACACCAAGCACATATTAAACTACCTGATGCCCATCATTGACCAGGTGAATCCAGAACTCCATGACTTCATGCAGAGTGCTGAAGTGGGGACCATCTTTGCCCTCAGCTGGCTCATCACCTGGTTTGGGCATGTCCTGTCTGACTTCAAGCACGTGGTGCGGTTATATGACTTCTTCCTGGCCTGTCACCCGCTGATGCCCATTTACTTTGCAGCTGTGATTGTGTTATACCGTGAGCAGGAAGTCCTGGACTGTGACTGTGACATGGCCTCGGTCCACCACCTGTTGTCCCAGATCCCTCAGGACCTGCCCTATGAGACACTGATCAGCAGGGCAGGGGACCTCTTTGTTCAGTTTCCCCCTTCTGAGCTCACACGAGAGGCAGCTGCCCAGCAACAGGCTGAGAGAACGGCAGCCTCTACCTTCAAAGACTTTGAGCTGGCGTCAGCCCAGCAGAGGCCGGACATGGTGCTTCGGCAGCGGTTTCGGGGACTTCTGCGCCCAGAGGCTCGAACAAAGGATGTCCTGACCAAACCAAGGACCAACCGCTTTGTGAAACTGGCAGTGATGGGGCTGACGGTGGCACTTGGAGCAGCTGCATTGGCAGTGGTGAAGAGTGCCCTGGAGTGGGCCCCGAAGTTCCAGCTGCAGCTGTTCCCCTGA

XM_004840630.1 Coding sequence

Csnk2a1 casein kinase 2, alpha 1 polypeptide, transcript variant X1

Length: 1176 bp    Location: 1634812..1566550   Strand: -
>XM_004840630.1
ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACGCACAGACCCCGAGAGTACTGGGATTATGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAACTGGTTAGAAAACTAGGCAGGGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAGGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTAAGAGGAGGCCCCAATATCATCACATTGGCAGACATTGTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACATGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAAATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTGAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGGCTAATAGACTGGGGCCTAGCTGAGTTTTATCATCCTGGTCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGCCCTGAGCTACTTGTAGACTATCAGATGTATGATTATAGTTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTCCGGAAGGAGCCGTTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGATTATATTGACAAATACAACATTGAATTAGATCCCCGTTTCAATGATATCTTGGGCAGACACTCTCGTAAGCGATGGGAACGCTTTGTCCACAGTGAAAACCAGCACCTTGTCAGCCCAGAGGCCTTGGATTTCCTGGATAAGCTGCTGCGATATGATCACCAGTCACGGCTCACTGCAAGAGAAGCCATGGAACATCCCTATTTCTATACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCAGGGGGCAGTACACCTGTCAGCAGCGCCAACATGATGTCAGGGATTTCTTCAGTGCCAACCCCTTCACCCCTCGGACCTCTGGCAGGCTCACCAGTGATTGCTTCTGCCAACCCCCTTGGGATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA

XM_004840614.1 Coding sequence

Defb132 defensin, beta 132, transcript variant X2

Length: 177 bp    Location: 1354505..1360540   Strand: +
>XM_004840614.1
ATGAAGTCTCTGCTCCTGGTCTTTGCAGCCCTCAGATTCCTAGCCGAGCTGGCCTCAGCTGACCGGGGTGGAACAAGACTTGCACAGAACGACCTGGGAGAGTGCAGTCTGATATGCAGCTGGAACGAGTGGCTGACACTTCTGTATGACAGGTGCCTGCTGCTCCTGAGAGCATGA

XM_004840613.1 Coding sequence

Defb132 defensin, beta 132, transcript variant X1

Length: 273 bp    Location: 1354505..1355882   Strand: +
>XM_004840613.1
ATGAAGTCTCTGCTCCTGGTCTTTGCAGCCCTCAGATTCCTAGCCGAGCTGGCCTCAGCTGACCGGGGTGGAACAAGACTTGCACAGAACGACCTGGGAGAGTGCAGTCTGATATGCAGCTGGAACGAGTGGCTGACACTTCTGTATGACAGGTACAGACAATGCTGTGTCGAATCCGACTTCCTGCCAATGCCTATCATGCCACAACATGTAGATAAATCTAAGTCCTTGCACAGAAAAACCACACAAAGCCACAGCGAGAGTCCACCATAG

XM_004840623.1 Coding sequence

Rbck1 RanBP-type and C3HC4-type zinc finger containing 1, transcript variant X2

Length: 1584 bp    Location: 1503041..1523542   Strand: +
>XM_004840623.1
ATGGACGAGACGACCAAGAAAGAGGAGATGGCCCTGAGCCTCGCCCGGGCGGTGGTGGGCGGGGATGAGCAGGCAGCTGTGAAGTATGCCACCTGGCTGGCACAGCAGCGGGCATCCCTGAGTGTGCATCTGAAGCCAGAGGTCCCACGGACACGGGACATCAGGCTGTGTGTGAGTGTGGAGGATGCCCATGTACAGACCGTCACCATCTGGCTCATGGTGCGCCCTGACATGACAGTGGCTTCCCTCAAGGACATGGTATTCCTGGACTATGGCTTCCCCCCGAGGCTGCAGCAGTGGGTGATTGGGCAGCGGCTGGCCCGAGACCAGGAGACACTGCACTCCCATGGGGTGCGGCGGAATGGGGACAGCGCCTACCTGTATCTGCTGTCAGCCCGAAACACCTCACTCAACCCACGGGAGGTTCAGCGCCAGCGCCAGCTTCGGATGCTGGAGGATCTGGGCTTCAAGGACCTCACACTCCAGCCACGGGGTCCCCTGGAGCCAGCTCCTTCCAACCCTGGGGTACCCCAGGAACTTGGAGGGGTACAACCCAATGGAGTGCCTGAGCCTCCACCGGTGGGCTGGCAGTGCCCTGGGTGCACCTTCATCAACAAACCTACCCGGCCTGGCTGCGAGATGTGCTGCTGTTCACGGCCGGAGGCCTACCAGGTGCCTGCCTCATACCAGCCCGATGAGGAGGAGCGGGCACGTCTGGCCGGCGAACAGGAGGCGCTACGTCAGTACCAGCAGCGGAAGCAGCAGCAGCAAGAGGGGAACTACCTGCAGCACGTGAAGCTGGAGCAGAGGAGCCTGGTGCTGAATACGGAGCCCGCCGAGTGCCCCGTGTGCTACTCGGTGCTGGCACCTGGTGAGGCGGTGGTGCTGCGGGAGTGTCTGCACACCTTCTGCAGGGAATGCCTCCAGGGCACCATCCGCAACAGCCAGGAGGCGGAGGTCTCCTGTCCCTTCATTGATGACACCTACTCGTGCCCGGGGAAGCTGCTGGAGAGGGAGATCCGGGCGGATCGGGGCTGTTTGCAGCTCCTGCCCCCCGAGGATTACCAGCGCTTTCTGGACCTGAGCGTCTCCATTGCAGAAAACCGCAGTGCTTTCAGCTACCACTGCAAGACCCCGGACTGCAAGGGCTGGTGCTTTTTTGAGGATGACGTCAATGAGTTCACCTGTCCCGTGTGTTTCCACATCAACTGCTTGCTTTGCAAGCTTCTCAGATCCCTGGGGAACCCTGTCACCCTGCAGGCCATCCACGAGCACATTAACTGCAAGGAGTATCAGGATGACCTGGCACTGCGGGCTCAGAATGACCTGGCTGCCCGGCAGACCACAGAGATGCTGCAGGTGATGCTGCAGCAGGGTGAGGCCATGCACTGCCCACGGTGCCGGATCGTGGTACAGAAGAAGGACGGCTGTGACTGGATCCGCTGCACTGTCTGCCACACTGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCCAGGGGCCCAGGGGACACCAGTGGGGGCTGCCGCTGCCGAGTGAATGGGATTCCTTGCCACCCAAGCTGTCAGAACTGCCACTAA

XM_004840610.1 Coding sequence

LOC101717935 beta-defensin 122-like

Length: 198 bp    Location: 1088573..1091457   Strand: +
>XM_004840610.1
ATGGTCATGAGGACTTTTCTGCTAGCTTTGGTTGTGCTGCTGCTCCTGTTCCAGGTCATTCCAGGCAACACTAAAAGATGTTGGAATCATCGTGGCTCCTGCAGTGAAAGATGCATAAAGAAAGAAATATTTTTTATTTTCTGCACGAGTGGTTACCTGTGCTGTGTGAAGCCCAAGCACAAGCCAAATTTACTATAG

XM_004840608.1 Coding sequence

Defb119 defensin, beta 119, transcript variant X1

Length: 252 bp    Location: 1123326..1133734   Strand: +
>XM_004840608.1
ATGAAGCTTCTTTTTCTGTTTCTTGCCATCCTTCTGGCAATGGAACCAGTGATGTCAGGAAAACATCCCATCCTTCGATGCATGGGCAACATTGGAGTCTGTAGACCCTCCTGCAAAAAGAATGAGCAGCCCTACTACTACTGCAGAAATTATCAACCATGCTGCCTCCAGTCCTACGTGAGGATAAGCATCACCGGAGCAGAGGGAAATAATGATTGGTCTTATGGGAACCACTGGCCCAAGATACCTTGA

XM_004840609.1 Coding sequence

Defb119 defensin, beta 119, transcript variant X2

Length: 237 bp    Location: 1129998..1133734   Strand: +
>XM_004840609.1
ATGGATATATATCAAGTGGCTCACAGTAGATGCTCAGCAAATGGAAAACATCCCATCCTTCGATGCATGGGCAACATTGGAGTCTGTAGACCCTCCTGCAAAAAGAATGAGCAGCCCTACTACTACTGCAGAAATTATCAACCATGCTGCCTCCAGTCCTACGTGAGGATAAGCATCACCGGAGCAGAGGGAAATAATGATTGGTCTTATGGGAACCACTGGCCCAAGATACCTTGA

XM_004840611.1 Coding sequence

Defb118 defensin, beta 118

Length: 318 bp    Location: 1143386..1135977   Strand: -
>XM_004840611.1
ATGAGGCTTCTGCTGGTGGCTCTTTCTGTCTTTGTATTCCTGCTCCAAGTGATCCCAGCCTACGGTGATGGGGGAAAATGCCAGAACAAATTGGGGACCTGCAGGAAACACTGCAAAGACGGAGAAGCAATAAAAGAAGCTTGTAAAAATCATCTCAACTGCTGCGTTTCAGCTAATAAAAGCCACAGCCAAGAGGTCTTTGACAAGAAGCTTCCCGAAGCAACTCCCACCACTTGGTATGATTTACCATCAGGTGCTTTTGATATAATTATAACAGTACCTGCTGCAAACCGCTTTGAAGAAAACTTATATGATTGA

XM_004840600.1 Coding sequence

Bcl2l1 BCL2-like 1, transcript variant X2

Length: 513 bp    Location: 790046..838506   Strand: +
>XM_004840600.1
ATGTCTCAGAGCAACTGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTCAGTGATGTGGAAGAGAGCAGGACTGAAGCCCCAGAAGGGACTGAATCAGAGATGGAGACCCCCAGTGCCATCAGTGGCAACCCATCCTGGCACCTGGCGGATAGCCCCACGGTGAACGGGGCAACTGGCCACAGCAGCAGTTTGGATGCCCGGGAGGTGATCCCCATGGCAGCAGTGAAGCAGGCTCTGAGGGAAGCAGGTGACGAGTTTGAACTTCGGTACCGGCGGGCATTCAGTGACCTAACATCTCAGCTCCACATCACCCCAGGGACAGCATATCAGAGCTTTGAACAGGACACTTTTGTGGAACTCTACGGGAACAATGCAGCAGCCGAGAGCCGGAAGGGCCAGGAACGCTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCTGGCATGGTTCTGCTGGGCTCACTCTTCAGTCGGAAATGA

XM_004840605.1 Coding sequence

Hm13 histocompatibility (minor) 13, transcript variant X2

Length: 1134 bp    Location: 977655..923686   Strand: -
>XM_004840605.1
ATGGACTCGGCCCTTAGCGACCCGCACAACGGCAGCGCAGAGACAGGTGGTGCGGCCAACGGCACGACGCGTCCTCCCTCCACGCCCGAGGGCATCGCGCTGGCCTACGGCAGCCTGCTGCTTATGGCGCTCCTGCCCATCTTCTTCGGCGCCCTGCGTTCGGTGCGCTGTGCCCGCGGCAAGAACGCCTCAGACATGCCGGAAACCATCACCAGCCGAGATGCTGCCCGCTTCCCCATCATTGCCAGCTGCACACTCCTGGGGCTCTACCTCTTTTTCAAAATATTCTCCCAGGAGTACATCAACCTCTTGCTGTCAATGTATTTCTTCGTACTGGGAATCCTGGCCCTGTCCCACACCATCAGCCCCTTCATGAATAAGTTTTTCCCAGCCAACTTTCCAAATCGACAGTATCAGCTGCTCTTCACTCAGGGCTCTGGGGAAAACAAAGAAGAGATCATCAATTATGAGTTTGACACTAAGGACCTGGTGTGCCTGGGCCTAAGCAGCATTGTTGGCGTCTGGTACCTGCTGAGAAAGCACTGGATTGCCAACAACCTTTTTGGCCTGGCCTTCTCCTTAAACGGGGTGGAACTCCTGCACCTGAACAATGTCAGCACTGGCTGCATCCTGCTAGGTGGACTCTTCATCTATGATGTCTTCTGGGTATTTGGGACCAACGTTATGGTGACAGTGGCCAAGTCCTTTGAGGCACCAATAAAATTGGTATTTCCGCAGGATCTGCTGGAAAAGGGCCTCGAAGCAGACAACTTCGCCATGCTGGGACTCGGAGATATTGTCATTCCAGGGATCTTCATTGCCTTGCTGCTGCGTTTTGACATCAGCTTGAAGAAGAACACCCATACCTACTTCTACACCAGCTTCGCAGCCTACATCTTCGGCCTGGGCCTTACCATCTTCATCATGCACATCTTCAAACACGCCCAGCCTGCCCTCCTGTACCTGGTTCCTGCCTGCATCGGCTTTCCCGTTCTTGTGGCCCTGGCCAAGGGAGAAGTGACAGAAATGTTCAGTTATGAGGAATCGAATCCTAAAGATCCAGCAGCAGTGATAGAATCCAAAGAAGCAACAGAGGCATCAGCATTGAAGGGGCTGGAGAAGAAAGAGAAGTGA

XM_004840602.1 Coding sequence

LOC101714003 cytochrome c oxidase subunit 4 isoform 2, mitochondrial-like, transcript variant X2

Length: 513 bp    Location: 862743..852110   Strand: -
>XM_004840602.1
ATGCTCTCCAGAGCCGCTTGGAGCTTGGTGCTGAGGAGAGGACCTGGAATTCGGGGGACACACAGTCCAGGAGGTGCCGCTGATGGCCAGGGCAAGATGCCCTCCTATACCAACTACTATGCCCAGCGTACCTACCCCATGCCAGACGAGCCCTTCTGCACGGAACTCAGCGCCCAGCAGCGTGCCCTGAAGGAGAAGGAGAAGGGAAGCTGGACCCAGCTGAGTCACGCTGAGAAAGTGGCCCTATACCGGATCCAGTTCCACGAGACCTTCGCAGAGATGAACCGGCACTCTCAAGAGTGGAAGACAGTGATGGGCTGTGTCTTCTTTTTCATTGGAATAACGGCTCTGCTGATTTGGTGGCAGCGGGTCTACGTGTTCCCAGAGAAGCCCATCACCCTGACAGACAAGTGGAAGACCCAGCAGCTGCAGCGAGTCCTGGACATGAAGGGCAACCCTGTGCAGGGCCTGGCCTCTCGCTGGGACTACGAGAGGAAGGAGTGGAAGAAGTGA

XM_004840601.1 Coding sequence

LOC101714003 cytochrome c oxidase subunit 4 isoform 2, mitochondrial-like, transcript variant X1

Length: 513 bp    Location: 862263..852110   Strand: -
>XM_004840601.1
ATGCTCTCCAGAGCCGCTTGGAGCTTGGTGCTGAGGAGAGGACCTGGAATTCGGGGGACACACAGTCCAGGAGGTGCCGCTGATGGCCAGGGCAAGATGCCCTCCTATACCAACTACTATGCCCAGCGTACCTACCCCATGCCAGACGAGCCCTTCTGCACGGAACTCAGCGCCCAGCAGCGTGCCCTGAAGGAGAAGGAGAAGGGAAGCTGGACCCAGCTGAGTCACGCTGAGAAAGTGGCCCTATACCGGATCCAGTTCCACGAGACCTTCGCAGAGATGAACCGGCACTCTCAAGAGTGGAAGACAGTGATGGGCTGTGTCTTCTTTTTCATTGGAATAACGGCTCTGCTGATTTGGTGGCAGCGGGTCTACGTGTTCCCAGAGAAGCCCATCACCCTGACAGACAAGTGGAAGACCCAGCAGCTGCAGCGAGTCCTGGACATGAAGGGCAACCCTGTGCAGGGCCTGGCCTCTCGCTGGGACTACGAGAGGAAGGAGTGGAAGAAGTGA

XM_004840590.1 Coding sequence

Ccm2l cerebral cavernous malformation 2-like

Length: 1452 bp    Location: 525493..510509   Strand: -
>XM_004840590.1
ATGGAGTATGAAGTCAAGAAGGGGAAGAAGGGCTTTGTGTCCCCCATCCGAAGGCTGGTGTTCCCCAAGGCTGCACGCCGGGCAGCCTTTCGCAATAGTGTGAGTCGCCGGCCCCTGCACTCAATGCCCCTTTATCCCCCTGACTATCTCATCGACCCCCAGATTCTGCTATGTGACTACTTGGAGAAAGAGGTCAAGTTCCTAGGCCACCTCACCTGGGTGACTTCCTCACTGAACCCTTCCAGCCGTGACGAGCTTCTGCAGCTGCTGGACAAGGCCCGGCAGCTGAAGGAGCTGCCGCTGAAGACCACGGCGGAGCAGGACAGCATTCTGAGCCTGTCGGCCCGCTGCCTACTGCTCACCTGGCGCGACAACGAGGAGCTCATCCTGCGCATCCCTACGCACGAGATCGCCGCCGCCTCCTACCTGCAGGACGATGCGCTGCACCTGTTGGTGCTTAAAACCGGTCTGGGCGTGGACCCGGTGCCGGCGGGAGTGGACGCCAGCCCGGGGGGCGCGAGGTGCGAACCCAGCCCTTCGGGCGCGGCGCCCGAGAAACCGCGGGTGGGCACTTCGGAGCGGCGCCACACCATCTGCAGCCTGGACTGGCGGATGGCGTGGGGCGGGGGCACGGGCGCCGAGGCGCGGGCCGGGGGCGGCGGCGGCAGCTTGGAGCGCCAGCGCGCTAGGGCGCGGGCATCGGGCAGCTGGGAGCGGCGGCAGACGTTTAGCGGCAGCTGGGAGCGGCGACACGCGGGCGGCGGCGGTGGCGCGGGCAAGCCAGGCGGCAGCTGGGAGCGGAGGCAGGCGGCCGGCGGCTGCGGCGGCAGCTGGGAGCGGCGCCACCCGGGCCCCAACCCGCTCGACCCTCAGGACCCCAGCCCCGACGCCTACTGCAACCTGGTCATCCTGGCTGTGCCCAACAGGGATGCTGCCGAGGAATCCTGCGCACTCATCTGTCAGGTTTTCCAGATCATCTATGGGGACCAAGGCATCGAGTGTGTGGACCGGGCCGGCTACCACTATATGTCCACACCTGAACGGCCATGGCTCTGCAGCCGCACAACGGCTCCCAGGACACATTTGAAGCATGCTACAGTGGCACATCCACTCCCTCTTTCCACGGCTCACACTGCAGTGGCAGTGACCACAGCGGCCTGAGCCTTGAGCAGCTGCAGGATTACATGATCACGCTGCGGAGTAAGCTGGGGTCCTCTGAGATCCAGCAGTTCGCGCTGCTTCTGCGGGAGTACCGGCTGGGGCTGCCCATCCAGGACTTCTGTGCCAGCCTGCTGAAGCTCTATGGAGACCACCGCAAGTTCCTGCTCCTGGGGATGCGGCCCTTCATCCCAGACCAGGACATCTGCTACTTCGAGGGCTTCCTGGAGGGCGTGGGTATCCGAGAGGGCGGCATCCTCACCGACAGCTTCGGCCGAATCAAGCGCAGCATGA

XM_004840581.1 Coding sequence

Pofut1 protein O-fucosyltransferase 1, transcript variant X1

Length: 1176 bp    Location: 364243..337959   Strand: -
>XM_004840581.1
ATGGGCGCCGCCGCGTGGGCACTGCCGCCCTTGCTGCTGCGTGTGTCTCTTCTGCTACTGCTTCTGCAGCTCCCGGGGCTGCCCGCGGGCTCCTGGGACCCGGCTGGTTACCTGCTCTACTGCCCGTGCATGGGGCGCTTTGGGAACCAGGCCGATCATTTCTTGGGCTCCCTTGCATTTGCAAAGCTACTGAATCGCACCTTGGCTGTACCTCCATGGATTGAGTACCAGCATCATAAACCTCCCTTCACCAATCTGCATGTGTCCTACAAGAAATACTTCAAGCTGGAGCCCCTCCAGGCCTACCATCGGGTCATCAGCCTGGAGGACTTCATGGAGAAGCTGGCACCCACCTATTGGCCTCCTGAGAAGCGGGTGGCATACTGCTTTGAGGTAGCAGCTCAGCGAAGCCCTGATAAGAAGACGTGCCCCATGAAGGAAGGAAACCCCTTTGGCCCATTCTGGGACCAGTTTCACGTGAGTTTCAACAAGTCGGAGCTTTTTGCAGGCCTTTCCTTCACCGCCTCCTATAAAGAACAGTGGATCCAGAGATTTTCACCAAAGGAACATCCGGTGCTTGCTCTACCAGGGGCCCCAGCACAGTTCCCCATCCTGGAAGAACACAGGTCACTCCAGAAGTACATGGTATGGTCAGACGAGATGGTGAAGATGGGAGAATCCCAGATCCGCAACCACCTCATCCGGCCCTATGTGGGCATTCATCTGCGCATTGGCTCTGACTGGAAGAATGCCTGTGCTATGCTGAAGGATGGCACCGTGGGCTCGCACTTCATGGCTTCTCCACAGTGTGTGGGCTACAGCCGCGTCACGGCAGCCCCACTTACCATGACCATGTGCCTCCCTGACCTGAAGGAAATCTGGCGGGCTGTGAAGCTCTGGGTGAGGGCGCTGAGCGCCCAGTCGATCTACATTGCCACTGATTCTGAGAGCTATGTGCCGGAGATCCAGCAGCTCTTCAAAGAGAAGGTGAAGGTGGTGAGCCTCAAGCCAGAGGTGGCCCAGATCGACCTGTACATCCTTGGCCAAGCTGACCACTTTATTGGCAATTGTGTGTCATCTTTCACTGCCTTCGTGAAGCGCGAGCGGGATCTTCAGGGGAAGCAGTCCTCTTTCTTCGGCATGGACAGGCCCCCTCAACTGCGAGACGAGTTCTGA

XM_004840585.1 Coding sequence

Tm9sf4 transmembrane 9 superfamily protein member 4, transcript variant X2

Length: 1929 bp    Location: 447867..402111   Strand: -
>XM_004840585.1
ATGGCGGCGGCGATGGTTTGGCTGCCATGGTCTCTGCTACTTCTTTCTCTCATGTATCAAACAAGCGCCTTCTATGTCCCAGGGGTTGCGCCAATCAACTTCCACCAGAACGACCCTGTAGAAATCAAGGCTGTGAAGCTCACCAGCTCTCGAACCCAGCTACCTTATGAGTACTACTCATTGCCCTTCTGCCAGCCCAGCAAAATAACCTACAAAGCAGAGAATCTGGGAGAGGTGCTGAGAGGGGACCGGATTGTCAACACCCCTTTCCAGGTTCTCATGAACAGTGAGAAGAAGTGTGAAGTTCTATGCAGCCAGTCCAGCAAGCCAGTAACCCTGACAGTGGAACAGAGCAGGCTCGTGGCTGAGCGCATCACAGAAGACTACTATGTTCACCTCATTGCTGACAACCTGCCAGTGGCCACCCGGCTGGAGCTGTACTCCAGCCGTGACAGTGATGACAAGAAGAAAGAAAAAGATGTGCAGTTTGAACATGGCTACCGGCTCGGCTTCACAGACGTCAACAAGATCTACCTGCACAATCACCTTTCGTTCATCCTTTACTACCACCGGGAAGATATGGAAGAGGACCAGGAACATACATACCGTGTCGTCCGCTTCGAGGTGATTCCCCAGAGCATCAGGCTGGAGGACCTCAAAACAGATGAGAAGAGTTCATGTACTCTGCCTGAGGGTACCAACTCCTCACCCCAAGAGATTGACCCTACCAAGGAGAATCAGCTGTACTTCACCTACTCTGTTCACTGGGAGGAAAGTGACATCAAATGGGCCTCTCGCTGGGACACTTACCTGACCATGAGTGATGTGCAGATCCACTGGTTTTCTATCATTAACTCTGTCGTGGTGGTCTTCTTCCTATCAGGCATCCTGAGCATGATTATCATTCGGACCCTCCGGAAGGACATCGCCAACTATAACAAGGAAGATGACATTGAAGACACTATGGAAGAATCTGGGTGGAAGCTGGTACACGGTGATGTCTTCAGGCCACCCCAATACCCCATGATCCTCAGCTCCCTGCTGGGGTCAGGCATTCAGCTCTTCTGTATGATCCTGATCGTCATCTTTGTGGCCATGCTTGGGATGCTGTCGCCTTCCAGCCGGGGAGCTCTCATGACCACAGCCTGCTTTCTCTTCATGTTCATGGGGGTGTTTGGTGGATTTTCTGCTGGCCGTTTGTACCGCACTCTAAAAGGTCATCGGTGGAAGAAAGGAGCCTTCTGTACGGCAACACTATACCCTGGTGTGGTTTTTGGCATCTGCTTCATACTGAATTGCTTTATCTGGGGAAAGCACTCGTCAGGAGCGGTACCTTTTCCTACCATGGTTGCTCTGCTCTGCATGTGGTTTGGGATCTCCCTGCCTCTTGTCTACTTGGGGTACTACTTCGGCTTCCGCAAGCAGCCATATGACAACCCTGTACGTACCAACCAGATTCCCCGGCAGATTCCTGAACAGCGGTGGTACATGAATCGATTTGTGGGAATTCTCATGGCTGGGATCCTCCCCTTCGGTGCCATGTTCATCGAGCTGTTCTTCATCTTCAGTGCCATCTGGGAGAATCAATTCTATTACCTCTTTGGCTTCCTATTCCTTGTTTTCATCATCCTGGTGGTATCCTGTTCACAAATCAGCATCGTCATGGTGTACTTCCAGCTGTGTGCAGAGGATTACCGCTGGTGGTGGAGGAATTTTCTAGTCTCCGGGGGATCTGCATTCTACGTCCTGGTCTACGCCATCTTTTATTTTGTTAACAAGCTGGACATCGTCGAATTCATCCCTTCTCTCCTCTACTTTGGCTACACAGCCCTCATGGTCCTATCCTTCTGGCTGCTCACGGGTACGATTGGCTTCTATGCAGCCTACATGTTTGTCCGCAAGATCTATGCTGCCGTGAAGATAGACTGA

XM_004840576.1 Coding sequence

Asxl1 additional sex combs like 1 (Drosophila), transcript variant X1

Length: 4602 bp    Location: 257643..189866   Strand: -
>XM_004840576.1
ATGAAGGACAAACAGAAGAGGAAGAAGGAACGCACGTGGGCCGAGGCCGCGCGCCTGGTATTAGAAAACTACTCAGATGCTCCAATGACACCAAAACAGATTCTACAGGTCATAGAGACAGAAGGACTAAAGGAAATGAGAAGTGGGACATCCCCTCTTGCGTGCCTCAATGCCATGCTACATTCCAATTCAAGAGGAGGAGAAGGGCTGTTTTATAAATTACCTGGTCGAATCAGCCTTTTTACACTCAAGAAGGATGCCCTGCAGTGGTCTCGAAATACAGCTGCAATGGAAGGAGAGGAGCCAGAGGACTCAGCTGATGTAGAGAGCTGTGGATCTAATGAAGCCAGCACTGTGAGTGGTGAAAATGATGTATCTCTTGATGAAACATCTTCAAATGCATCCTGTTCTACAGAATCTCAGAATAGACCTCTTTCCAGTCCCAGGGACAACTATAGAGCTTCCTCTCAGGCAAACAAACAAAAGAAAAAGACTGGGGTGATGTTGCCTCGAGTTGTTCTGACTCCTCTGAAGGTAAATGGGGCCCACATGGAATCTGCAGCAGGGTTCTCAGGCCGCCACGCCGATGGCGAGAGCGGCAGCCCATCCAGCAGCAGCAGCGGCTCTTTGGCCTTGGGCAGCGCTGCTATTCGTGGCCAGGCCGAGGTCACCCGGGACCCTGCCCCGCTCCTGAAAGGCTTCCGGAAGCCGGCCACAGGTCAAATGAAGCGCAATAGAGGAGAAGAGATAGATTTTGAGACTCCTGGGTCTATTCTTGTCAACACCAACCTCCGTGCCCTGATAAACTCTCGGACCTTCCATGCCTTGCCATCACACTTCCAGCAGCAGCTCCTCTTCCTTCTTCCTGAAGTAGACAGACAGGTGGGAACAGATGGCCTGTTGCGTCTCAGCAGTAGTGCACTTAATAATGAGTTTTTCACCCATGCAGCTCAGAGCTGGAGGGAACGCCTGGCTGATGGTGAATTCACCCATGAGATGCAAGTCAGGATTCGACAGGAAATGGAGAAGGAGAAGAAGGTAGAACAGTGGAAAGAAAAGTTCTTTGAAGACTATTATGGACAGAGATTGGGTTTGACTAAAGAAGAATCATTGCAGCAGAATGTGAGCCAGGAGGTGACTGAAGTCATGAGTGGGTTGCATGTCCCAGGAGAATCAGCACAGCCACAGCATGGTCCAGCAGCCCGCCAACGAGATGGGCATTTTAAGAAACGATCTCGGCCAGATCTCCAAACCAGAGGCAGAAGGAGTCTGTGCAAAAAACAGGAGCCAGAACAAGCAGGGGTTGCTAAGGAGGCAAACTCTGTGGCACCAGACATTCTACTCTCTGAGGATGGGGAGGCTAAAACTGGCTCGGCCAGGGTGAGCAGTCCCCCCCTGCCAAGCGTATCCTCTGCAGCATCCGGCCAAGGGGTTCCTGAATGCCCTGGTGAACTTGTGGCTTCCCACATCCAGACAGAGGCGGATAACTTGGCACATGCCTCTGCATCTCCAGACAGAATTCCCTGCTTGTCTCAGGATACTGTGGATCAGGAACCCAAGGATCAGAAAAGGAAATCCTTTGAGCAGGCAGCCTCTGCATCCTTTCCCGAAAAGAAGCCCCGGCTTGAAGACCGTCAGTCCTTTCGTAACACAATTGAAAGTGTTCACACCGAAAAGCCACAGCCCACTAAAGAGGAGCCCAAAGTCCCACCCATCCGGATTCAACTTTCACGTATCAAACCACCCTGGGTGGTTAAAGGTCAGCCCACTTACCAGATATGCCCCCGGATCATCCCCATCACGGAGTCCTCCTGCCGGGGCTGGACTGGTGCCAGAACCCTTGCAGACATTAAAGCCCGTGCTTTGCAGGCCCGAGGGACAAGAGGCCACCACTGTCATCGAGAGACGGCCACCACTGCCATCGGAGGGGGGGGTGGCCCGGGTGGAGGTGGCAGCGGGGCCACCGATGAGGGAGGTGGCAGAGGCGGCAGCAGTAGTGATGGTGGTGAGGCCTGTGGTCACTCTGAGCCCAGGGGAGCCTCGAGCACCCCCAGAGAGTGTACGTCAGATCTACAGCGAACACAACTACTGCCGCCTTGTCCTCTAAATGAGGAGCACACACAGGCTGGAACTGCCATGTCTAGGGCCAAAAGAGAAGAATTGGCTTCTCACAGAAAGGAGGAAAACTGCCCACTGCAGAGGGTTCCAGGTATACTCACAAGTGGCCTGGATGATGCCTCCCAGCCCCCCATTGCTCCCACTGGGGACCAGCCTTGCCAGGCTTTACCATTACTGTCTTCCCAAACCCCAGTGGCTGAGAAGTTAGCAGAGCAGCCTGAGTTGTATCAAGATACTAGAACTCAGTGTGAATCTGGCACCACTTCCTGGGAAGTGGGCAATGAAGAACAAGGAGCCACTGTTCCTTTAGAAAATGGTCCTGTACAGTCTCTATTGCTAGATACATTAGCAAAAGGAACTGACCAGACTCTCAACAGTAATCCTACCATGAAGGATCCTATAAATGTGACCCCAAGTTCCACACCTGAATTATCACTGACTGCCTTCCTACAGGACAGACCATTTGATGACAAATTAGGACTTGGTGACTCAGGCCTACCCATGAGGGAAAGTTACAGTAGACAAGAAAGCTTGAGAACTGAGGCTCTTTCTTCCAATAATGCTGCTCTTTGGACTCCCATCCTGTTGAATGACAGGGTAGTGAACCAGTCTGAGCCAGAATCTAGAGAAAACTTTCCATCTGTGGAGCCCCAGGTTGGAGAAGAGTGGGAGAAAGCAGCTCCCCTCATTGCCTTGTTGTCTGGGAGCTTGGCAGCTGAGGAGGGTGTGGCTCCCCCTGACAAGTGTACTTCACTCTGGACTTTGCCACCGCAAGGAGGCATAGGTGACAGGGACACCGAGGACAAGCAAGTAGACATTGAAAAGCTGAAAATCAATGAAGACTCTGAAGCACTGAGTCCTCATAGCGAATCCACAGATACTGTGTCTGACTTTGAAGGCCACCTGACTGAGGACAGCAGTGAGCCTGCAGCTAGTGAAGCCACAATGAAGAAGGAATCATTGATGGAAAAGGATACCAAGCATGATTGGAACCAGTCTGCCTCACTGTCCAAGGTACACAGTGACTTGAGTCTGGTTACAAGGACAGAGGGGGTGGTTACTTCTCAGAGCTGGGTTTCTCGAGTATGTGCGGTCCCCCAGAAGATCCCAGACTCCCTCTTGCTGGCCAGTAGTGAGTACCAGCCAAGACCCATGTGGTTGGCCAGGCCTGTGTCTGCAGTGGAGGCCAACAACCCACTTGTGATGCAATTGCTACAGGGTAACTTGCCCCTAGAGAAGGTTCTTCCTCCAGCGCATGGTGGCAGCAAGCCAGAATCCCCACAACTGCCACTTACAAAAGGACAGAGCCATGGTGGTCCCCTGGGCATAGGATCCTTGCATAATCCTGGGGAAAACAGTCACACAATTGGCAAAATCAGCCCTGGTTCTTTAAGAGTGTTGAAGGGTCCTCTTCAGTCTGAGAGTTGTGAAGCAAACAGTCTTGGCAGGGTAGAGGCCACCCAGACTCCTGGAGCACCCCAGATTTCCAAGTTGGTTCCAAGTCTAGACTCCCCACAGCCAGTGACAAATCTGATGACCTGTTCTGGGAAACTGGAAGAAGTGGATTCCAAAGAGCAGCTGTCTTCCTTTAATTTTGAAGATAAGGGTGTCCAGGATGCATCCCGGTGCAGTAATTCACATGCTGCTTCAAGTCCAGGAGATCTCACTACCTCGAGAGCACCTTGTTTCTCATCTCCAAATGTGATCTCTTTTGGTCCAAAGCAGCCAGTTGGGGCTCTGAGTAATGTTGGAGGCCAAGGGAAAAAGCTTTTTGGCCCTAGGAATATGGCTGCAACCATTCAGTGTCCCAGGCCTGCAGACTCAACACCGCTGCCTGCTGATGTCCCTCCAGTTTTTCCCAGTAGGAAGTTGGGACCGAGCAAAAACTCTTTATCTGATGGGGTACAGACTGCAAAGGAAGACTGGGTTCCAAAGCCACCACCTGCCTCTGTTAGCATCAAGAATGAAAAAACTTCTGTGGGGGCTCCTCTTAAGGCAGATGCAGAGAACAGGAAAGCTGCTGGGCACAGTCCTCTGGAGCTGGTGGGTCATTTACAAGGGATGCCCTTTGTCATGGACTTGCCCTTTTGGAAGTTACCCCGAGAGCCAGGGAAAGGTCTCAGTCAGCCTCTGGAGCCTTCTTCCATCCCCTCCCAGCTTAACATCAAGCAGGCTTTTTATGGGAAGCTTTCTAAACTCCAGCTGAGTTCCACCAGCTTTAATTACTCTTCCAGCTCACCCACCTTTCCCAAAAGCCTTGCTGGAAGTGTGGTGCAGCTGAGCCACAAAGCAAACTTTGGTGCAAGCCACAGTACATCACTGTCCTTGCAGATGTTCACTGACAGCAGCACGGTGGAAAGTATCTCACTTCAGTGTGCATGCAGCCTGAAAGCCATGATCATGTGCCAAGGCTGTGGTGCATTCTGTCATGATGACTGTATTGGACCCTCAAAGCTCTGTGTATTGTGCCTTGTGGTGAGATAA

XM_004840579.1 Coding sequence

Asxl1 additional sex combs like 1 (Drosophila), transcript variant X4

Length: 3879 bp    Location: 198297..189866   Strand: -
>XM_004840579.1
ATGAAGCGCAATAGAGGAGAAGAGATAGATTTTGAGACTCCTGGGTCTATTCTTGTCAACACCAACCTCCGTGCCCTGATAAACTCTCGGACCTTCCATGCCTTGCCATCACACTTCCAGCAGCAGCTCCTCTTCCTTCTTCCTGAAGTAGACAGACAGGTGGGAACAGATGGCCTGTTGCGTCTCAGCAGTAGTGCACTTAATAATGAGTTTTTCACCCATGCAGCTCAGAGCTGGAGGGAACGCCTGGCTGATGGTGAATTCACCCATGAGATGCAAGTCAGGATTCGACAGGAAATGGAGAAGGAGAAGAAGGTAGAACAGTGGAAAGAAAAGTTCTTTGAAGACTATTATGGACAGAGATTGGGTTTGACTAAAGAAGAATCATTGCAGCAGAATGTGAGCCAGGAGGTGACTGAAGTCATGAGTGGGTTGCATGTCCCAGGAGAATCAGCACAGCCACAGCATGGTCCAGCAGCCCGCCAACGAGATGGGCATTTTAAGAAACGATCTCGGCCAGATCTCCAAACCAGAGGCAGAAGGAGTCTGTGCAAAAAACAGGAGCCAGAACAAGCAGGGGTTGCTAAGGAGGCAAACTCTGTGGCACCAGACATTCTACTCTCTGAGGATGGGGAGGCTAAAACTGGCTCGGCCAGGGTGAGCAGTCCCCCCCTGCCAAGCGTATCCTCTGCAGCATCCGGCCAAGGGGTTCCTGAATGCCCTGGTGAACTTGTGGCTTCCCACATCCAGACAGAGGCGGATAACTTGGCACATGCCTCTGCATCTCCAGACAGAATTCCCTGCTTGTCTCAGGATACTGTGGATCAGGAACCCAAGGATCAGAAAAGGAAATCCTTTGAGCAGGCAGCCTCTGCATCCTTTCCCGAAAAGAAGCCCCGGCTTGAAGACCGTCAGTCCTTTCGTAACACAATTGAAAGTGTTCACACCGAAAAGCCACAGCCCACTAAAGAGGAGCCCAAAGTCCCACCCATCCGGATTCAACTTTCACGTATCAAACCACCCTGGGTGGTTAAAGGTCAGCCCACTTACCAGATATGCCCCCGGATCATCCCCATCACGGAGTCCTCCTGCCGGGGCTGGACTGGTGCCAGAACCCTTGCAGACATTAAAGCCCGTGCTTTGCAGGCCCGAGGGACAAGAGGCCACCACTGTCATCGAGAGACGGCCACCACTGCCATCGGAGGGGGGGGTGGCCCGGGTGGAGGTGGCAGCGGGGCCACCGATGAGGGAGGTGGCAGAGGCGGCAGCAGTAGTGATGGTGGTGAGGCCTGTGGTCACTCTGAGCCCAGGGGAGCCTCGAGCACCCCCAGAGAGTGTACGTCAGATCTACAGCGAACACAACTACTGCCGCCTTGTCCTCTAAATGAGGAGCACACACAGGCTGGAACTGCCATGTCTAGGGCCAAAAGAGAAGAATTGGCTTCTCACAGAAAGGAGGAAAACTGCCCACTGCAGAGGGTTCCAGGTATACTCACAAGTGGCCTGGATGATGCCTCCCAGCCCCCCATTGCTCCCACTGGGGACCAGCCTTGCCAGGCTTTACCATTACTGTCTTCCCAAACCCCAGTGGCTGAGAAGTTAGCAGAGCAGCCTGAGTTGTATCAAGATACTAGAACTCAGTGTGAATCTGGCACCACTTCCTGGGAAGTGGGCAATGAAGAACAAGGAGCCACTGTTCCTTTAGAAAATGGTCCTGTACAGTCTCTATTGCTAGATACATTAGCAAAAGGAACTGACCAGACTCTCAACAGTAATCCTACCATGAAGGATCCTATAAATGTGACCCCAAGTTCCACACCTGAATTATCACTGACTGCCTTCCTACAGGACAGACCATTTGATGACAAATTAGGACTTGGTGACTCAGGCCTACCCATGAGGGAAAGTTACAGTAGACAAGAAAGCTTGAGAACTGAGGCTCTTTCTTCCAATAATGCTGCTCTTTGGACTCCCATCCTGTTGAATGACAGGGTAGTGAACCAGTCTGAGCCAGAATCTAGAGAAAACTTTCCATCTGTGGAGCCCCAGGTTGGAGAAGAGTGGGAGAAAGCAGCTCCCCTCATTGCCTTGTTGTCTGGGAGCTTGGCAGCTGAGGAGGGTGTGGCTCCCCCTGACAAGTGTACTTCACTCTGGACTTTGCCACCGCAAGGAGGCATAGGTGACAGGGACACCGAGGACAAGCAAGTAGACATTGAAAAGCTGAAAATCAATGAAGACTCTGAAGCACTGAGTCCTCATAGCGAATCCACAGATACTGTGTCTGACTTTGAAGGCCACCTGACTGAGGACAGCAGTGAGCCTGCAGCTAGTGAAGCCACAATGAAGAAGGAATCATTGATGGAAAAGGATACCAAGCATGATTGGAACCAGTCTGCCTCACTGTCCAAGGTACACAGTGACTTGAGTCTGGTTACAAGGACAGAGGGGGTGGTTACTTCTCAGAGCTGGGTTTCTCGAGTATGTGCGGTCCCCCAGAAGATCCCAGACTCCCTCTTGCTGGCCAGTAGTGAGTACCAGCCAAGACCCATGTGGTTGGCCAGGCCTGTGTCTGCAGTGGAGGCCAACAACCCACTTGTGATGCAATTGCTACAGGGTAACTTGCCCCTAGAGAAGGTTCTTCCTCCAGCGCATGGTGGCAGCAAGCCAGAATCCCCACAACTGCCACTTACAAAAGGACAGAGCCATGGTGGTCCCCTGGGCATAGGATCCTTGCATAATCCTGGGGAAAACAGTCACACAATTGGCAAAATCAGCCCTGGTTCTTTAAGAGTGTTGAAGGGTCCTCTTCAGTCTGAGAGTTGTGAAGCAAACAGTCTTGGCAGGGTAGAGGCCACCCAGACTCCTGGAGCACCCCAGATTTCCAAGTTGGTTCCAAGTCTAGACTCCCCACAGCCAGTGACAAATCTGATGACCTGTTCTGGGAAACTGGAAGAAGTGGATTCCAAAGAGCAGCTGTCTTCCTTTAATTTTGAAGATAAGGGTGTCCAGGATGCATCCCGGTGCAGTAATTCACATGCTGCTTCAAGTCCAGGAGATCTCACTACCTCGAGAGCACCTTGTTTCTCATCTCCAAATGTGATCTCTTTTGGTCCAAAGCAGCCAGTTGGGGCTCTGAGTAATGTTGGAGGCCAAGGGAAAAAGCTTTTTGGCCCTAGGAATATGGCTGCAACCATTCAGTGTCCCAGGCCTGCAGACTCAACACCGCTGCCTGCTGATGTCCCTCCAGTTTTTCCCAGTAGGAAGTTGGGACCGAGCAAAAACTCTTTATCTGATGGGGTACAGACTGCAAAGGAAGACTGGGTTCCAAAGCCACCACCTGCCTCTGTTAGCATCAAGAATGAAAAAACTTCTGTGGGGGCTCCTCTTAAGGCAGATGCAGAGAACAGGAAAGCTGCTGGGCACAGTCCTCTGGAGCTGGTGGGTCATTTACAAGGGATGCCCTTTGTCATGGACTTGCCCTTTTGGAAGTTACCCCGAGAGCCAGGGAAAGGTCTCAGTCAGCCTCTGGAGCCTTCTTCCATCCCCTCCCAGCTTAACATCAAGCAGGCTTTTTATGGGAAGCTTTCTAAACTCCAGCTGAGTTCCACCAGCTTTAATTACTCTTCCAGCTCACCCACCTTTCCCAAAAGCCTTGCTGGAAGTGTGGTGCAGCTGAGCCACAAAGCAAACTTTGGTGCAAGCCACAGTACATCACTGTCCTTGCAGATGTTCACTGACAGCAGCACGGTGGAAAGTATCTCACTTCAGTGTGCATGCAGCCTGAAAGCCATGATCATGTGCCAAGGCTGTGGTGCATTCTGTCATGATGACTGTATTGGACCCTCAAAGCTCTGTGTATTGTGCCTTGTGGTGAGATAA

XM_004840574.1 Coding sequence

LOC101705096 chromosome unknown open reading frame, human C20orf112, transcript variant X1

Length: 2043 bp    Location: 68002..185545   Strand: +
>XM_004840574.1
ATGCCGAAGCCGACGCTTCTGCTGCGCGGGGGCTGGGAGCGCGAGCGCAACCCCGGGGACTCGGAGCTGGGCCGCCAGTTCCGGGACTGGTGCCTGCGCACCTACGGCGACTCGGCCAAAACCAAGACGGTGACACGCAGCAAATACCAGAGGATCGCTGAGGTCCTGCAGGGCGGCGGCGGGACTGGCTCGGGCAGCGGCCCCGCGGCCGGCGAGAAAGGCAAGTTCCAGTTCTGGGTGCGCTCCAAGGGCTTCCGCCTGGGCAGCGGCCGGGAACCCAAGATGGGCCAAGTGGTGTATGTGCCGGTCAAGACGGGCTCGGGGGCAGATGGCCTGTCGGAGCCCGAGGGCATCTCTCTGAAGCGGGTTGCTGTGGTGGAAGATTTCTTTGACATCATCTACTCAATGCATGTGGAGAGCTCGGCGGAGCCAGGCAAAGCCCCCAAGCACGCTGGGCAGAAGAAAACCTACCGGGCGATCGCAGAGACCTACGCCTTCCTCCCGAGAGAGGCTGTGACCCGCTTCCTGATGAGCTGCACCGAGTGTCAGAAGAGGATGCACTTTAATTCCAATGGCCTGGAACCCAAAGAAAATGAGCCTCCATCTCCTCTGGTCTCCGGGATCATTGATTACAACATGCCCCTCACCTCCACCTACTTGAAGCAGATGAAGCTGCGAGTGATGAATTCCCAGGAGCAGGATGAGACCTCTGTGAGCAGTGAAGACTTTGATATGAATGACTCCACATGGATGTCCGCTGACCCACACCTGGCCTCCAGCCTGAGCCCCAGCCAGGACGAGAGGATGCAGAGCCCGCAGAACCTCCACAACCAAGAGGATGATGATTCCTCCTCCGAGAGTGGCAGTGGCCATGGCTCCTCTACCCTAAACCCATCCACATCAAGCAGCACACAGGGCGACCCCGCCTTCCCTGAATTGAACGGCAACGGCGCTGCGGCCCCCATGGACTTCACTTCCACTGCTGAGGATCAGCCCATCAACCTGTGTGACAAGCTCCCACCAGGCACAGCACTGGGCACACCCTCCTACTCCTCCGATGGCTGTGGCACTGATGGGCTGCGGAGCCGTGTCAAATATGGGGTGAAGGCTACTCCTGAGTCACCCCCCTACAGCTCTGGGAGCTACGATTCCATCAAGACAGAGGTCAGTGGCTGCCCTGAGGATTTGACGGTAGGCCGGGCGCCCACAGCAGATGATGATGATGATGACCATGATGACCACGAGGACAATGACAAGATGAATGACTCTGAGGGCATGGACCCTGAGCGTCTCAAGGCCTTCAACATGTTTGTGCGTCTCTTTGTGGATGAGAACCTGGACCGCATGGTGCCCATTTCCAAGCAGCCCAAGGAGAAGATCCAGGCCATCATCGAGTCTTGTAGCCGGCAGTTCCCTGAGTTCCAGGAGCGGGCCCGAAAGCGCATCCGTACATACCTCAAGTCCTGCCGACGTATGAAGAAGAATGGCATGGAGATGACCAGACCCACGCCTCCCCACCTAACCTCGGCCATGGCAGAAAACATCCTAGCAGCTGCCTGTGAGAGCGAGACAAGAAAAGCAGCCAAAAGGATGCGCCTGGAGATCTACCAGTCCTCGCAGGATGAGCCCATAGCCCTGGACAAGCAACACTCCCGGGACTCTGCAGCCATCACCCACTCCACCTACACACTGCCAGCCTCCTCCTACTCCCAGGACCCTGTGTATGTCAACGGCGGCCTCAACTACAGCTACCGTGGCTATGGGGCTTTGAGCAGCAACCTGCAGCCCCCTACTTCCCTCCAGACAGGAAATCACAGTAACGGGCCCACAGACCTCAGCATGAAAGGCGGGTCCTCCACCACCTCTACCACGCCCACACCCACCCCCTCCAGCAACAGCACCAGCAGGACCATGCCCACTGCCCAGCTCAGCCCCACTGAGATCAGTGCTGTGCGGCAGCTCATCGCTGGCTACCGGGAGTCAGCGGCCTTCCTGCTGCGCTCTGCAGATGAACTGGAAAACCTCATTTTACAGCAGAACTGA

XM_004841088.1 Coding sequence

Lime1 Lck interacting transmembrane adaptor 1, transcript variant X3

High confidence: 3 potential gene matches
Length: 837 bp    Location: 29391961..29393459   Strand: +
>XM_004841088.1
ATGCTGGCAGAAACGTCCCTGCTGAGACAGACTCATCTCTGCCCCCTCAGCAAGTCTGACACCAGGCTGCATGAGCTGCACCGCGGTACCCATGGCAGCAAAGGTGAGGTGACTACCAGAAGGACACATGGGGAGTGGCTGGCTGCAGCTTGGGACCACACCTGCTGTCCACCCCTAATGGCCTCTGGCCTGACCTTACCCATAGCCCTGAGGCCTGCCAGCATGGATCTCCTGCACCCACACTGGCTAGAAGTTTCCAGGGGTAGCGCCAGACCACTGGCAGCCCCCTCTGCCTTCCCACGTCAGCAGCTGCCGGGGCCCCCATCTGCGACTGCCTTCACACTGTCCACTGGTCCTGAGGCCACCTATTCTAATGTGGGGCTGGCTGCCATCCCTAGAGCTAGCCTGGCTGCCAGCCCTGTGGTATGGGCAGGGACACGGCTGACCACTGGCTGTGACAGGCCAGGGCACTGGGCCAGACCTGTACTGGCTGAGTATGCCTCCATCCAGAAGCTCAGAGGGTCAGATCCGGGCCCCCAAGAACTGCAGCAAGGGAAGACTGAGGTGACCCCAGCTGCTCAGGTGGACATCCTGTACTCCAGGGTCTGCAAGCCTAGAAACAGGGACGCAGGGCCCGCCACAGACCCACCGGGCCGTGAGGGCACAGGAGCAGTTCTGACCCTGGAGACTGGCTTAACCTATGAACCGCTCCCTCCTAGGGGCCTGGACATGGACAGCAATCCCCTGGAAAATGTGTATGAAAGCATCCAGGATGTGGGGACCCCTGAAAGTCCAGAGCCCTCCATTCTGCCTATTAGCATAAGCGGACATATGTAG

XM_004841159.1 Coding sequence

Cstl1 cystatin-like 1

High confidence: 4 potential gene matches
Length: 426 bp    Location: 23096364..23099727   Strand: +
>XM_004841159.1
ATGGAGGTCAGAGATGGGAGGAGCCTCTGGCTGCTGCTGCTGGCCCTGGCCCTGGTCCTGGCAGCCACACAGAACTACTTCCAGGGGTGGCCAGGCTTCGAGGAGAAGCCCATGAGCAAGGAAAACATGAACTCGACTCTGGACTTCTTCATCCAGTCCTACAACAACGCCAGCAACGACACCTACTTATTCCGGGTCCAGAAGCTCATCCGCACTCAGGTGCAGTTGACAACAGGTGTGGAGTACCTGGTCACTGTGAGGATAGGCAGGACCACGTGCACGAGGACAGACCCGGCCCGAAGCAGTGCCTCCTGCCCCCTGCAGGACAAGAAGCTGAAGAAGAGCCTGGTCTGTGAGTCACTGATCTACACTGTACCCTGGCTAAACTATTTCCAGCTCTGGAACAACTCCTGCCTGGAGGGCTGA

XM_004841123.1 Coding sequence

Samd10 sterile alpha motif domain containing 10, transcript variant X3

High confidence: 4 potential gene matches
Length: 603 bp    Location: 29599799..29595493   Strand: -
>XM_004841123.1
ATGTTCACCGAGCTGAGGGCCAAGCTGAGCCCCCCGCCGGGCCGCGCCGGGGCAGTGCACTACGGCCTCGGGGAGAGCCGGGATGTGGACGCCACTGCCCACTTCAGCTTCTGCCGGACCCTCCTGGAGCACACAGTGTCGGCTGAGAGCATCCCTTGCCACTTGCCTCGGATGCCGGGTTCCAGCTTCACATGGCACGACCCCCGTAGCCAGAGAGGATCCAGCAGCAGGCCCGTCAAGCTCCTGCAGCAGCCCGGCACAGAGACCCCCCAGGGCCAGCTGTACTCTGAGCACTGTGGCCTGTACCACACGAGCCCCTCTCTGGGTGGGCTGGCACGGCCTGCAGTCCTGTGGAGCCAGCAGGATGTCTGCAAGTGGCTCAAGAGACACTGTCCCCACAACTACCTCGTCTACGTCGAGGCCTTCTCCCAACACGCTATCACTGGCCGGGCTCTGCTGAGGCTGAATGCAGAGAAGCTGCAGCGGATGGGGCTGGCACAGGAGGCCCAGAGGCAGGAGGTGCTACAGCAGGTGCTCCGCCTGCAGGTGCGTGAGGAGGGGCGGAGCCTGCAGCTGCTCAGCCAAGCTGCTGCCAAGGCTTGA

XM_004841124.1 Coding sequence

Prpf6 pre-mRNA processing factor 6

High confidence: 4 potential gene matches
Length: 2826 bp    Location: 29601046..29664054   Strand: +
>XM_004841124.1
ATGAACAAGAAGAAGAAACCGTTCCTGGGCATGCCCGCGCCGCTCGGCTATGTGCCGGGGCTGGGCCGCGGTGCCACTGGCTTCACTACCCGCTCAGACATTGGGCCTGCCCGGGATGCAAATGATCCTGTGGACGATCGCCATGCACCACCAGGCAAAAGAACCGTGGGGGACCAGATGAAGAAAAACCAGGCTGCTGATGATGATGATGAGGATCTGAATGACACCAACTATGATGAGTTTAATGGTTATGCTGGGAGCCTCTTCTCAAGTGGACCCTATGAAAAAGATGATGAGGAAGCAGATGCTATTTATGCAGCTCTGGATAAAAGGATGGATGAAAGAAGGAAAGAAAGGAGAGAACAAAGGGAGAAAGAAGAGATTGAGAAATACAGAATGGAACGCCCCAAAATCCAGCAACAGTTCTCAGATCTCAAAAGGAAGTTGGCAGAGGTCACAGAAGAAGAGTGGCTGAGCATCCCGGAGGTCGGCGATGCCAGAAACAAACGTCAGCGGAATCCACGTTATGAGAAGCTGACCCCTGTTCCTGATAGCTTTTTCGCCAAACATTTACAGACGGGGGAGAACCATACTTCTGTGGATCCCCGGCAAACTCAATTTGGAGGTCTGAACACACCCTATCCAGGCGGGCTGAACACGCCATATCCAGGTGGAATGACCCCGGGCCTGATGACACCTGGCACGGGGGAGCTGGACATGAGGAAGATTGGGCAAGCGAGGAACACCCTGATGGACATGAGGTTGAGCCAGGTGTCTGACTCGGTGAGTGGACAGACTGTTGTGGACCCCAAAGGCTATCTGACAGATCTAAACTCTATGATCCCGACCCATGGAGGGGACATCAATGATATCAAGAAGGCGCGGCTGCTCCTCAAGTCTGTTCGAGAGACAAATCCTCATCACCCACCAGCCTGGATTGCCTCTGCACGGCTGGAGGAAGTCACTGGGAAGCTGCAAGTGGCTCGGAACCTTATTATGAAGGGGACAGAGATGTGCCCCAAGAGTGAAGATGTCTGGCTAGAAGCAGCCAGGTTGCAGCCTGGGGACACAGCTAAGGCTGTTGTGGCCCAGGCAGTCCGTCATCTCCCACAGTCTGTTAGGATTTACATCAGAGCAGCAGAGCTAGAAACAGACATTCGTGCAAAGAAGCGGGTTCTTCGGAAAGCCCTAGAGCATGTTCCAAACTCTGTTCGCTTGTGGAAAGCAGCTGTTGAGCTGGAAGAGCCTGAAGATGCTAGAATCATGCTCAGCCGAGCTGTGGAGTGCTGCCCCACCAGTGTAGAGCTCTGGCTTGCTCTGGCGAGGCTGGAGACTTATGAAAATGCCCGCAAAGTCTTAAATAAGGCACGTGAGAACATTCCTACAGACCGGCACATCTGGATCACAGCTGCCAAGCTTGAGGAGGCCAATGGGAACACTCAGATGGTGGAGAAGATCATTGACAGAGCTATCACCTCACTGCGGGCCAATGGTGTGGAGATCAACCGTGAGCAGTGGATCCAGGATGCTGAGGAGTGTGACAGGGCAGGGAGCGTGGCCACCTGCCAAGCAGTCATGCGTGCCGTGATTGGCATCGGGATTGAAGAAGAAGACCGGAAGCACACCTGGATGGAAGATGCTGACAGTTGTGTAGCCCACAATGCCCTGGAGTGTGCACGAGCTATCTATGCCTATGCCCTGCAAGTGTTCCCCAGCAAGAAGAGTGTGTGGCTACGAGCTGCGTACTTTGAAAAAAATCACGGCACCAGGGAGTCTCTGGAAGCACTTCTGCAGAGGGCTGTGGCCCACTGCCCCAAGGCAGAGGTGCTGTGGCTCATGGGTGCCAAATCCAAGTGGCTGGCAGGGGATGTGCCGGCAGCAAGGAGCATCTTGGCCTTGGCCTTCCAGGCCAACCCCAACAGTGAGGAGATCTGGTTGGCAGCTGTGAAGCTGGAGTCAGAGAACAATGAGTACGAGCGGGCCCGAAGGCTGCTGGCCAAGGCACGGAGCAGTGCGCCCACAGCTCGAGTGTTTATGAAGTCTGTGAAGCTGGAGTGGGTGCTGGGGAACATTGCAGCTGCCCAGGAGCTGTGTGAGGAGGCACTGAAGCACTATGAGGACTTCCCCAAGCTGTGGATGATGAAAGGGCAAATTGAGGAGCAGGGGGAGCTGATGGAGAATGCTCGAGAAGCCTACAACCAGGGGCTGAAGAAGTGCCCCCACTCCACACCCCTGTGGCTCTTGCTTTCCCGGCTAGAGGAGAAGATTGGGCAGCTGACCCGAGCACGGGCCATTTTGGAGAAGTCTCGTCTGAAGAACCCAAAGAACCCTGGCCTGTGGTTGGAGTCTGTGAGGCTGGAGTACCGTGCAGGGCTGAAGAACATTGCCAATACGCTCATGGCCAAGGCATTGCAGGAATGCCCCAACTCTGGTATCCTGTGGTCTGAAGCTGTCTTCCTTGAGGCCCGGCCGCAGAGAAAGACCAAGAGCGTGGATGCCCTGAAGAAGTGTGAGCATGACCCTCACGTGCTGTTGGCTGTGGCCAAGCTGTTCTGGAGTGAGCGGAAGATCACCAAGGCCCGGGAGTGGTTCCACCGCACAGTGAAGATTGATTCAGACCTGGGGGATGCCTGGGCTTTCTTCTACAAGTTTGAGCTGCAGCACGGCACCGAGGAGCAGCAGGAGGAGGTGAGGAAACGCTGTGAGAATGCAGAGCCCCGGCATGGGGAGCTGTGGTGCACCGTGTCCAAGGACATCACCAACTGGCAGAGGAAGATTGGGGAGATCCTGGTGCTGGTGGCTGCTCACATCAAGAACACATTCTGA

XM_004841025.1 Coding sequence

Col9a3 collagen, type IX, alpha 3

High confidence: 4 potential gene matches
Length: 2043 bp    Location: 28591546..28610346   Strand: +
>XM_004841025.1
ATGGCCCGCGCGCCCACCCTGGCCCTGCTCCTGCTGGGACGGCTCCTGGCAGCCGCCACCGCACAGAAAGTGGGGCTCCCTGGGCCCCCGGGGGCCCCGGGGCCACCCGGGAAGCCGGGCACGGACGGCATTGACGGAGAAGCTGGTCCTCCAGGTCTGCCTGGGCCCCCGGGATCGAAGGGGACCCCGGGGAAACGAGGGAAGCCCGGAGAGGCAGGACTGCCAGGACTTCCAGGTGTGGACGGTCTGACTGGGCGGGACGGACCTGCTGGACCCAAAGGTGCCCCTGGAGAACGGGGAAGCCTGGGACCCCCGGGGCCGCCTGGGCTGGGGGGCAAAGGCCTCCCTGGACCCCCCGGAGAGGCAGGTGTGAGCGGCCTCCCCGGTGGGATGGGCCTCCGAGGTCCTCCGGGACCCTCTGGACTTCCAGGCCTGCCTGGGCCCCCAGGACCTCCGGGACCTCCTGGACAGCCTGGGGTCCTCCCTGAAGGTGCTGCTGACCTACAGTGCCCTGCCGTCTGCCCTCCAGGCCCCCCCGGGCCTCCAGGAATGCCAGGGTTTAAGGGGCCCACCGGCCACAAAGGAGAACAGGGAGAAGTTGGCAAGGACGGCGAGAAGGGTGACCCCGGCCCACCCGGTCCTGCTGGTGTTCCAGGCGCCGTGGGGCTGCAGGGTCCCCGAGGATTAAGAGGGCTGCCAGGGCCACTGGGGCCCCCTGGGGACCGGGGTCCCATTGGGTTCCGAGGGCCGCCTGGCGCCCCAGGGTCTCCCGGGAAAGTGGGTGACAGAGGTGGGAGGGGCCCTGAGGGCTTCCGAGGCCCCAAGGGTGACCTTGGTAGACCTGGTCCCAAAGGAATCCCTGGCGTGGCCGGGCCAGGTGGGGAGCTGGGTGTGCCAGGCACGGATGGCCGGGACGGCATGCCAGGACTCGATGGCGAGAAGGGAGAGGCCGGTCGCCATGGTGCCCTGGGAGAGAAGGGCCCCAATGGGCTGCCGGGCCTCCCTGGACGAGCAGGGTCCAAAGGCGAGAAGGGAGAACTGGGCACAGCCGGGGAGCTGGGCGAGGCTGGCCCCTCTGGAGAGCCTGGCATGCCCGGAGACATCGGCATGCCCGGGGGGCACGGCGAGGCTGGCCACAGGGGCTCCATGGGGGCCCTCGGCCCACAAGGTCCTCCCGGGGCCCCCGGAGTCCGAGGCTTCCAGGGCCGAAAGGGCAGCATAGGAGACCTTGGCCTCCCGGGTCCGCAGGGCCTCCGTGGTGAAGTGGGCGACCGGGGCCCAGGAGGCACTGCAGGCCCGAAGGGAGACCAGGGCATTGCGGGTTCCGATGGCCTTCCTGGGGACAAAGGAGAGCTGGGCCCCAGTGGTTCAGCTGGACCCAAAGGAGAGTCTGGAAGTCGAGGGGAGCTAGGCCCCAAAGGCATCCAGGGACCCAATGGCACCAGTGGCGTCCAGGGCGCCCCTGGCCCACCTGGGCCCGTGGGCCTCCAGGGTGTGCAGGGCATCCCTGGGATCACCGGGAATCCTGGAGTTCCGGGGAAAGAAGCCAGTGAGCAGCGCATCAGGGAGCTGTGTGGGGGCGTGATCAGCGAGCAAATTGCACAGTTAGCTGCACACCTGAGGAAGCCTTTAGCACCGGGCTCCATCGGTCGGCCTGGTCCAGCTGGTCCTCCAGGGCCTCCTGGCCCTCCAGGCTCCATCGGCCACCCTGGTATTCGAGGGCCTCCCGGATACCGCGGTCCCACGGGGGAGCTGGGAGACCCTGGCCCCAGAGGAGGTCAGGGCGACAGAGGAGACAAGGGTGCAGTGGGCGCAGGGCTGAACGGCCCCGCCGGAGACCAGGGACTCCAAGGGTCACAAGGCGTGCCCGGCATCAGCAGAGACGGCCGGGATGGTGCTCATGGTGAGCCGGGGCTTCCTGGAGATCCTGGGCTTGCCGGTGCTGTCGGGGCTCAGGGGACACCAGGGATCTGTGACACTTCCGCCTGCCAAGGAGCTGTGTTAGGAGGGAATGGGGAAAAATCTGGTCCTCGCAGCGCATAG

XM_004840886.1 Coding sequence

Dtd1 D-tyrosyl-tRNA deacylase 1, transcript variant X5

High confidence: 4 potential gene matches
Length: 630 bp    Location: 19268970..19394060   Strand: +
>XM_004840886.1
ATGAAGGCCGTAGTGCAGCGCGTCACCCGCGCCAGCGTCACAGTTGGAGGTGAGCAGGTGAGCGCCATCGGCCGGGGCCTCTGTGTGCTGCTGGGTATCTCCCTGGAGGACTCACACAAGGAGCTGGAGCACATGGTCCGAAAGATCTTGAACCTGCGTGTGTTTGAGGACGAGAGCGGCAAGCCCTGGTCCAAGAGTGTGATGGACAAGCAGTACGAGGTGCTGTGTGTCAGCCAGTTCACCCTGCAGTGTGTCCTCAAGGGCAACAAGCCCGACTTCCACCTGGCCATGCCCACCGAGCAGGCCGAGAGCTTCTACAACAGCTTCCTGGAGCAGCTGCGGAAGACTTACCGGCCCGAGCTCATCAAAGATGGCAAATTTGGTGCCTACATGCAGGTGCATATTCAGAACGATGGGCCTGTGACCATAGAGCTGGAGTCTCCGGCTCCCGGCACTGCCACCTCTGACCCAAAACAGCTATCAAAGTTGGAGAAGCAGCAGCAGAGGAAAGAAAAGATGAGAGCCAAGGGGCCCTCAGAATCCAGCAAAGAGCGCACCACTCCCCGGAAGGAAGACCGTAGTGCCAGCAGTGGGGCAGAGGGTGATGTGTCTTCTGAGCGAGAGCCATAG

XM_004840850.1 Coding sequence

Pcsk2 proprotein convertase subtilisin/kexin type 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 1917 bp    Location: 18368974..18642503   Strand: +
>XM_004840850.1
ATGAAGGGGGCTTGTGGCTCCCGGTGGCAGGCGGCCGCCGGGCTCCTCTTCTGTGTCATGGTTTCTGCATCTGCCGAGAGACCCATCTTCACGAATCATTTTCTCGTGGAGTTGCATAAAGGGGGTGAGGAAGAAGCTCGCCAAGTTGCCGGGGAGCACGGCTTCGGAGTCCGGAAGCTCCCTTTCATGGAAGGCCTGTATCACTTTTATCACAATGGCCTCACAAAAGCTAAAAGAAGACGCAGCCTACAGCACAAGCAGCAGCTGGAGAGAGACCCCAGGGTAAAGATGGCCTTGCAACAGGAAGGGTTTAACCGAAAGAAGCGAGGGTACAGAGATATCAATGAGATTGACATCAACATGAATGATCCTCTTTTTACAAAGCAGTGGTACCTGATCAACACTGGACAGGCTGATGGCACTCCTGGCCTTGATTTGAATGTGGCAGAGGCCTGGGAACTGGGATACACTGGGAAAGGTGTGACCATTGGGATTATGGATGATGGGATCGACTATCTCCACCCAGACCTGGCCTCCAACTATAATGCCGAAGCCAGTTACGACTTCAGCAGCAATGACCCCTACCCATACCCTCGGTACACAGACGACTGGTTTAACAGCCATGGAACAAGATGTGCAGGAGAAGTTTCAGCAGCAGCCAACAACAATATCTGCGGGGTTGGGGTGGCGTACAACTCCAAAGTCGCAGGTATCCGGATGCTGGACCAGCCCTTCATGACTGATGTCATCGAAGCCTCCTCCATCAGCCACATGCCCCAGCTCATTGACATCTACAGCGCCAGCTGGGGCCCCACGGACAACGGGAAGACGGTGGACGGGCCCCGAGAGCTCACATTGCAGGCCATGGCTGATGGCGTGAACAAGGGCCGCGGGGGCAAGGGCAGCATCTACGTGTGGGCCTCTGGAGACGGTGGCAGCTACGATGACTGCAACTGCGACGGCTACGCCTCGAGCATGTGGACCATCTCCATCAACTCGGCCATCAATGACGGCAGGACGGCGCTGTACGACGAGAGCTGCTCCTCCACCTTGGCGTCCACCTTCAGCAACGGGCGCAAGAGGAACCCCGAGGCGGGCGTGGCCACCACAGATCTGTATGGCAACTGCACCCTGCGGCATTCTGGGACATCAGCAGCGGCTCCTGAAGCAGCTGGGGTTTTCGCGCTGGCTTTGGAAGCCAACATGGGGCTGACCTGGCGAGACATGCAGCACCTGACGGTCCTCACCTCCAAAAGGAACCAGCTCCACGATGAGGTCCATCAGTGGCGGCGCAATGGGGTTGGCCTGGAGTTTAATCATCTCTTTGGCTACGGGGTCCTGGATGCCGGCGCCATGGTGAAAATGGCCAAAGACTGGAAGACCGTGCCAGAGAGGTTCCACTGTGTGGGAGGCACCGTGCAGGACCCAGAGAAGATCCCACCCACCGGCAAGCTGGTGTTGACGCTCACCACGGCTGCCTGCGAGGGGAAGGAGAATTTCGTGCGCTACCTCGAGCATGTCCAGGCCGTCATCACAGTCAACGCCACCAGGCGAGGAGACCTGAACATCAACATGACGTCGCCCATGGGCACCAAGTCCATTTTGCTGAGCCGGCGTCCTCGGGATGATGACTCCAAGGTGGGCTTCGACAAGTGGCCTTTCATGACCACCCACACGTGGGGGGAGGACGCCCGGGGGACCTGGATGCTGGAGCTGGGCTTCGTGGGCAGCGCACCTCAGAAGGGGGTGCTCAAGGAGTGGACCCTCATGCTGCACGGCACGCAGAGCGCCCCGTACATCGACCAGGTGGTGCGGGATTACCAGTCCAAGCTGGCCATGTCCAAGAAGCAGGAGCTGGAGGAAGAGCTGGATGAAGCCGTGGAGAGGAGCCTGAAGAGCATCCTTGGCAAGAACTAG

XM_004840830.1 Coding sequence

Ism1 isthmin 1, angiogenesis inhibitor, transcript variant X2

High confidence: 4 potential gene matches
Length: 1395 bp    Location: 14186973..14262530   Strand: +
>XM_004840830.1
ATGGTGCGTCTGGCTGCCGAGCTGCTGCTGATCTTGGGGTTACTGCTGCTCACACTGCACATCACCGTTCTGCGCGGTTCCGGAGCCACCGACGGGCCAGACGCGGCCACCGGCAACGCCAGCCTGGCCCAGTTGCAGAATAACCTTAACCTGGAAGGTGACTCCACATCAGAAACCAGCTTTCCTCTCTCCAAAGAAGTACCAGGGGAGCCTCTGAACCACCACGCTACACATCAGCCCTTTTCCAGGCAGCAATTCCCAGAAGAAACTGGCCACCCCTCCTTGCAAAGAGATGGCCCCAGGTCCTTTCTCCTGGACTTGCCAAACTTTCCAGATCTTTCTAAAGCTGATATCAATGGGCAGAATCCAAATATCCAGGTCACCATAGAGGTGGTCGACGGTCCAGACTCTGAAGGAGATAAAGATCAGCATCCGGAGAATAAGCCCAGCTGGTCAGTCCCATCCCCTGACTGGCAGGCCTGGTGGCAGAGGTCCTTGTCCTTGGTGAGGGCCAACAGCGGGGACCAGGACTACAAGTACGACAGTACCTCAGATGACAGCAACTTCCTCAACCCCCCCAGGGGGTGGGATCGTCCGGCCCCAGGCCACCAGACTTTTGAAACCAAAGAGCAGCCAGAATATGATTCCACAGATGGAGAAGGTGACTGGAGTCTCTGGTCTGCCTGCAGCATCACCTGTGGGAATGGTAACCAGAAACGGACCCGGTCTTGTGGCTACGCGTGCACTGCAACCGAATCTAGGACCTGTGACCGTCCAAACTGCCCAGGCATTGAGGACACCTTCAGAACAGCGGCCACTGAAGTGAGTCTGCTTGCGGGAAGTGAGGAGTTTAATGCCACCAAGCTGTTTGAAGTTGATACAGACAGCTGTGAGCGATGGATGAGCTGCAGAAGCGAATTCCTAAAGAAGTATATGCACAAGGTGATCAATGACCTGCCCAGCTGTCCCTGCTCTTACCCCACCGAAGTGGCCTACAGCACAGCGGACATCTTTGACCACATAAAGCGCAAGGACTTCCGCTGGAAGGATGCCAGCGGGCCCAAAGAGAAGCTGGAGATCTACAAACCCACAGCCCGATACTGCATCCGGTCCATGCTGTCGCTAGAGAGCACCACGCTGGCTGCCCAGCATTGTTGCTATGGTGACAACATGCAGCTTATCACCCGGGGCAAAGGGGCGGGGACACCCAATCTCATCAGCACGGAGTTCTCTGCTGAACTGCACTACAAGGTGGATGTGCTGCCCTGGATCATCTGCAAGGGCGACTGGAGCAGATACAACGAGGCTCGGCCACCCAACAATGGGCAGAAGTGCACTGAGAGCCCCTCAGACGAGGACTACATCAAGCAGTTCCAGGAGGCCAGGGAGTACTGA

XM_004840938.1 Coding sequence

Rab22a RAB22A, member RAS oncogene family

High confidence: 4 potential gene matches
Length: 585 bp    Location: 24637090..24691941   Strand: +
>XM_004840938.1
ATGGCGCTGAGGGAACTCAAAGTGTGTCTGCTGGGGGATACAGGTGTAGGTAAATCAAGTATTGTGTGGCGGTTTGTGGAAGACAGTTTTGATCCGAACATCAACCCAACAATAGGGGCATCTTTTATGACCAAGACTGTCCAGTACCAAAATGAGCTACATAAATTCCTAATCTGGGATACAGCTGGACAAGAACGATTTCGTGCCTTAGCACCAATGTACTACCGAGGATCGGCTGCAGCTATAATTGTTTATGATATCACAAAAGAAGAGACATTTTCAACATTAAAGAACTGGGTAAAGGAGCTTCGACAGCATGGCCCACCTAATATTGTAGTTGCCATTGCAGGAAATAAGTGTGATCTTATCGATGTCAGAGAAGTCATGGAGAGAGATGCTAAGGACTACGCTGACTCCATTCATGCAATTTTTGTAGAGACCAGTGCAAAAAATGCGATAAACATAAATGAACTCTTTATAGAAATTAGTCGAAGAATTCCATCCACTGATGCCAACCCGCCATCTGGCAGTAAGGGCTTCAAACTCCGAAGACCACCATCAGAGCCAAAACGAAACTGCTGTTGA

XM_004840771.1 Coding sequence

Prnp prion protein, transcript variant X4

High confidence: 4 potential gene matches
Length: 735 bp    Location: 5785180..5802162   Strand: +
>XM_004840771.1
ATGGTGAACGCTGGCTGCTGGCTACTGGTTCTTTTTGTGGCTACATGGAGTGACATTGGCCTCTGCAAGAAGCGACCAAAACCAGGAGGAGGATGGAACAGCGGGGGCAGCCGTTACCCATCTCACAGCGGGGGCAACTGGGGCCAGCCCCATGGCGGTGGCTGGGGACAGCCCCATGGTGGTAGTTGGGGCCAGCCCCATGGTGGAGGCTGGGGACAGCCCCATGGTGGTGGCTGGGGTCATGGAGGTGGCACCTACAATCAGTGGAACAAACCCAGTAAGCCCAAAACCAACATGAAGCATATGGCAGGCGCTGCAGCGGCGGGGGCAGTGGTGGGAGGTCTGACTGGCTACATGCTGGGGAGTGCCATGAGCAGGCCCCTCATCCATTTCGGCAGTGATTATGAGGACCGTTACTACCGTGAGAACATGTACCGTTACCCCAACCAAGTGTACTACAGGCCCGTGGATCAGTACAACAACCAGAACAGCTTTGTGCAGGACTGCGTCAATATCACGATCAAGCAGCACACAGTCACCACCACCACCAAAGGGGAGAACTTCACCGAGACCGACGTGAAGATAATGGAGCGCGTACTGGAGCAGATGTGCACCACGCAGTACCAGAAGGAGTCCCAGGCCTACTACTACCGCGGAAGAGCCGGCTTGGTGCTCTTCTCCTCCCCACCTGTGATCCTCCTCATCTCCTTCCTCATCTTCCTGATAGTGGGATGA

XM_004840922.1 Coding sequence

Bmp7 bone morphogenetic protein 7

High confidence: 4 potential gene matches
Length: 1296 bp    Location: 23733068..23658211   Strand: -
>XM_004840922.1
ATGCACGTGCGCTCGCTGCGCGCCGCGGCGCCGCACAGCTTCGTAGCGCTCTGGGCGCCTCTGTTCCTGCTGCGCACTGCCCTGGGAGACTTCAGCCTGGACAACGAGGTGCACTCGAGTTTCATCCACCGGCGCCTCCGCAGCCAAGAGCGGAGGGAGATGCAGCGTGAGATCCTCTCCATCTTGGGTTTGCCCCATCGCCCGCGCCCCCACCTCCAGGGCAAGCACAACTCCGCGCCCATGTTCATGCTGGACCTGTACAACGCCATGGCGGTGGAGGAGGGCGGCGGGCCCGACGGCCAGGGCTTCTCCTACCCGTACAAGGCCGTCTTCAGCACCCAGGGCCCCCCACTGGCCAGCCTGCAAGACAGCCACTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTCGTGGAACATGACAAAGAGTTCTTCCACCCACGCTACCACCATCGTGAGTTCCGGTTCGATTTATCCAAGATCCCGGAAGGGGAAGCTGTGACTGCAGCTGAGTTCCGGATCTATAAGGACTACATCCGGGAACGCTTTGATAATGAGACCTTCCGGATCAGCGTCTACCAGGTGCTCCAGGAGCACTTGGGCAGGGAGTCAGACCTCTTTCTACTCGACAGCCGCACCCTCTGGGCCTCCGAGGAGGGCTGGCTGGTGTTCGACATCACGGCCACGAGCAACCACTGGGTGGTCAACCCTCGGCACAACCTGGGCCTGCAACTTTCAGTGGAGACTCTGGATGGGCAGAGCGTGAACCCCAAGCTGGCGGGCCTGATCGGGCGGCATGGACCCCAGAACAAGCAGCCCTTCATGGTGGCCTTCTTCAAGGCCACGGAGGTGCACCTCCGCAGCGTGCGGTCCACGGGGGGCAAGCAGCGCAGCCAGAATCGCTCCAAGACGCCCAAGAACCAGGAGGCGCTGAGGATGTCCAGCGTGCCAGAAAACAGCAGCAGCGACCAGAGGCAGGCCTGTAAGAAGCACGAGCTGTACGTCAGCTTCCGAGACCTGGGCTGGCAGGACTGGATCATTGCGCCTGAGGGCTATGCCGCCTACTACTGCGAAGGGGAGTGCGCCTTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACACTGGTCCACTTCATCAACCCGGACACCGTGCCCAAGCCCTGCTGTGCTCCTACCCAGCTCAATGCCATCTCTGTCCTCTACTTCGACGACAGCTCCAATGTCATCCTAAAGAAATACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAG

XM_004840823.1 Coding sequence

Slx4ip SLX4 interacting protein

High confidence: 4 potential gene matches
Length: 1293 bp    Location: 11448624..11633696   Strand: +
>XM_004840823.1
ATGGCATCTAAGAAATTTGCTGTTAAAGTGACATGTGGCCCTGTCTTCGAAAGCCTGTCCAAGTTGCCACTCAGTTCAGAAGAACAGAGAGATTGCAAGGATTTTGCTGTCCTGGTGGATCTTCATGTATCTCCACAAGGGTCAAACAAAGATACCAGCTGGTTTTCTGAACAGAAAAAAGAGGAAGTCTGTTTGCTGTTAAAGGAAACCATTTATTCAAGAGTTAAGGAGTACTTGGAAGTCCGTAAACAGCACAAGCCATCAAATACAGAATTCACAAGATCCACTCCCTTGTCCTTAAAAGGTTATGGGTATCAGATCACAGCCTATTTCCTCAAGAGGGGGATACACCTTCGCTGCATTGGGAGCTTACAGAATACTAAACTCCGCGTATTTCCTGACCGATTTGTGGTCCTTGTTAGTCAGCTTGCAGTCATTCCTGACATCTTGTCAAATCAGAAAGAATTGACAGAAAGAGCTCTCCATGGAGTGTCTGATTATTTTGCTGAGTGTGCGGAGAGTCCACTTCCTCCCGGTGCAAAGCTCAGGAGAAATGCTCTGAAAGAAATTGTGAAAAGAACTGAAACGAAAAGCATCTCAAGCAAATCACAGAGCCACAGGGCCACTGTGAGAACTTCTAGTGACTCAGACATTACAGTGGTGGTGAGGAGGAGCGATGATGATCAGGCCTTATCCAGTCCCGCATCAGAATCCATGGGACAAGAAAAGGATTACATAAAGGCAGTGGAGCGCCACTGGAGGCTTCCTGTTCAAAAGCTGGAAAATGTTAATCAGACTCAACCAGAAGACACTAACAGCCAACAAAAACCTCATCCTGGGGAGTGGTTAAAGACAGGACTTCTAAGCAGGAGCCCTGTCTACAGCTGTGAGTCAGCATCCCCAGGTCCAAAGCAAAGTCCATGGGCGGCCAAAACACAACAGAAATGCAGGAACTGTGGCTCTGCAGAAGACTCCCACCACCACAAGAGAGTTTCTCTTGGAAGTGATCGATTAGTCTCTGGAGAAATAATAGTGGAAAAAAGCACAGCTGTCGGTCGTTTGCCAACTTTAGAGCTGTCAGATCCAGGGTTACTTTTGAAACAAGATTTGGCGAAAACCATGTCTAAGGACGAGTTGCATGTTTTGGAAAATCTCTCCTCCAGACATCTTATGAAAAATAACCCAGCACAGGAACAGCAAACTAGCTCAGCCACAAATCCTAGAAAATTATCTATACCTCAGGGCAACCTAACCGAAAAAAGAAAGAAATTGCAAAGGATTGCAAAGTTATAG

XM_004840814.1 Coding sequence

Lamp5 lysosomal-associated membrane protein family, member 5

High confidence: 4 potential gene matches
Length: 843 bp    Location: 10449399..10468950   Strand: +
>XM_004840814.1
ATGGATCTCCGAGGAAAAGCCTTTCCCCATGTCCGCAGATTTCGAGTTCTCCTCGTGCTGTTCAACACAATGGCTCAAATCATGGCAGAACAAGAAGTGGAAAATCTATCAGGCCTTTCCACTAACCCTGAAAAAGATATATTTGTGGTGCGGGAAAACGGGACGACGTGTCTCATGGCAGAGTTTGCAGCCAAATTTATTGTACCTTATGATGTGTGGGCCAGCAATTACGTCGATCTGATCACAGAACAGGCTGAGATCGCGCTGACCCGGGGAGCCGAGGTGAAGGGCCATTGTGGCCACAATGAGTCGGAGCTGCAGGTGTTCTGGGTGGATCGCGCCTACGCACTCAAAATGCTCTTTGTAAAGGAAAGCCACAACATATCCAAGGGACCCGAGGCCACGTGGAGGCTGAGCAAGGTGCAGTTTGTTTACGACTCCTCTGAGAAGACTCACTTTAAAGATGCAGTCAGTGCTGGGAAGCACACCGCCAACTCCCATCGCCTCTCTGCATTGGTGACCCCAGCTGGGAAGTCCTATGAATGTCAAGCTCAGCAAACCATCTCTCTGGCCTCCAGCGATCCCCAGAAGACTGTCACTATGATCCTGTCTGCGGTCCACATTCAACCCTTTGACATTATCTCAGATTTTGTCTTCAGCGAAGAGCATAAATGCCCAGTGGATGAGCGGGAGCAGTTGGAGGAAACCTTGCCCCTGATTTTGGGGCTGATCTTGGGCCTTATTATTGTGGTAACACTAGTGATTTACCACATCCACCACAAAATGACTGCCAACCAGGTTCAGATTCCTAGGGACCGATCCCAGTACAAACACATGGGCTAG

XM_004840818.1 Coding sequence

Snap25 synaptosomal-associated protein, 25kDa, transcript variant X2

High confidence: 4 potential gene matches
Length: 621 bp    Location: 11218270..11302980   Strand: +
>XM_004840818.1
ATGGCTGAAGACGCGGACATGCGCAATGAGCTCGAGGAGATGCAGAGGAGGGCTGATCAGCTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTAGAAGAGAGTAAAGATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTCGATCGTGTCGAAGAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCCGAGAAAAATTTAAAAGATTTAGGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTTGTGGCCAGCCAGCCTGCTCGCGTGGTGGATGAACGGGAGCAGATGGCCATCAGTGGTGGCTTCATCCGCAGGGTAACAAATGATGCCCGAGAAAATGAAATGGATGAAAACCTGGAGCAGGTGAGCGGCATCATTGGAAACCTCCGTCACATGGCCCTGGATATGGGCAATGAGATTGATACACAGAATCGCCAGATCGACAGGATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA

XM_004840787.1 Coding sequence

Gpcpd1 glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae), transcript variant X2

High confidence: 4 potential gene matches
Length: 2016 bp    Location: 6528864..6472621   Strand: -
>XM_004840787.1
ATGACGCCTTCTCAGGTTACCTTTGAAATAAGAGGATCTCTCTTACCAGGAGAAGTTTTTGCAATATGTGGAAGCTGTGATGCTTTGGGAAACTGGAATCCTCAGAATGCTGTGGCTCTTCTAGACAGTGAGACAGGTGACAGCATGTTATGGAAAGCAACCATTGCACTCACTAGGGGAATATCAGTTCTGTATCGCTACTACAAAGGATACTTTTTAGAACCAAAGACTATCGGTGGTCCATGTCAAGTCATAGTTCACAAGTGGGAGACTCATCTACAACCACGATCAATAACCCCTTTAGAAAGTGAAATTATTATTGATGATGGACAATTTGGAATCCACAATGGTGTTGAAACTCTGGATTGTGGATGGCTGACATGCCAGACGGAAATAAGATTACGTTTGCATTATTCTGAAAAACCTCCAGTCTCAATAACCAAGAAAAAATTCAAAAAATCTAGATTTAGAGTAAAGCTTACACTAGAGGGTCCCGAGGAAGACGATGATGATAGGGTATCTCCCACTGTTCTTCATAAAATGTCTAATACCCTGGAGATAGCCTTGATAAGTGACAACGAGTTCAAGTGCAGGCACTCACAGCCAGAGTGTGGGTATGGCCTACAGCCTGACCGTTGGACTGAGTACAGCATACAGACCATGGAGCCGGATAACCTAGAACTAATCTTTGATTTTTTTGAGGAAGATCTCAGTGAACATGTAGTTCAAGGTGACGCCCTTCCAGGACATGTGGGCACAGCATGCCTCTTATCATCCACCATTGCAGAGAGTGGGCGGAGTGCCGGGGTTCTTACCCTTCCTATCATGAGCAGGAATTCCAGGAAAACCATAGGCAAAGTTCGAGTTGACTTTATCATCATTAAGCCATTAACCGGATACAGTTGTGACATGAAATCTTCATTTTCCAAGTATTGGAAACCAAGAATACCACTGGATGTTGGACATCGAGGTGCAGGGAACTCGACAACAACTGCCCAGCTGGCTAAAGTTCAAGAAAATACTATTGCTTCTTTAAGAAACGCTGCTACTCATGGTGCAGCTTTTGTAGAATTTGATGTCCATCTTTCAAAGGACTTTGTGCCTGTGGTGTATCATGATCTTACCTGCTGTTTGACCATGAAAAAGAAATTTGATGCTGATCCAGTTGAATTATTTGAAATTCCAGTAAAGGAACTAACATTCGACCAACTACAGTTATTAAAGCTTTCTCATGTGACAGCACTAAAATCTAAAGATCGGAAAGAATCTGTAGTTGAGGGAGAAAATTCCTTTTCTGAAAACCAGCCATTTCCTTCTCTTAAGATGGTTTTAGAGTCTTTGCCAGAAGATGTAGGGTTTAATATAGAAATAAAGTGGATCTGCCAACAAAGGGATGGAATATGGGATGGTAACTTGTCAACATATTTTGACATGAATCTGTTTTTGGATATAATTCTAAAAAATGTTTTAGAAAACTCTGGAAAGAGAAGAATTGTGTTTTCTTCATTTGATGCAGATATTTGTACAATGGTTCGACAAAAGCAGAACAAATATCCCGTATTGTTTTTGACTCAAGGAAAATCTGATATTTACCCTGAACTTATGGACCTCAGATGTCGGACAACTCCCATTGCAATGAGCTTTGCACAGTTTGAAAATCTTCTGGGGATAAATGCACATACTGAAGACCTGCTCAGAAACCCATCCTATATTCAGGAGGCAAAAGCTAAGGGCCTTGTCATATTCTGTTGGGGCGATGACACCAATGATCCTGAAAACAGAAGGAAGTTGAAAGAATTTGGAGTTAATGGCCTAATTTATGATAGGATATATGATTGGATGCCTGAACAGCCAAATATATTCCAAGTGGAGCAGTTGGAACGCCTGAAGCAAGAATTGCCAGAGCTTAAGAGCTGCTTATGTCCCACTGTTAGCCACTTTGTCTCCTCATCCCTGTGCGGGGACCCTGACAACCATGTGGATGCCAATGGCATTGATAATGTGGAGAGCACTTAG

XM_004841097.1 Coding sequence

Zbtb46 zinc finger and BTB domain containing 46, transcript variant X2

High confidence: 4 potential gene matches
Length: 1797 bp    Location: 29441891..29398779   Strand: -
>XM_004841097.1
ATGAACAACCGAAAGGAAGATATGGAAATCACGTCCCATTACCGACACCTGCTTCGTGAGCTCAACGAGCAGAGGCAGCACGGGGTGCTCTGTGATGTCTGTGTGGTCGTGGAGGGCAAAGTGTTCAAGGCGCACAAGAACGTCCTGCTCGGGAGCAGTCGCTACTTCAAGACGCTCTACTGCCAGGTGCAGAAGGCGTCCGGCCAGGCCACGGTCACCCACCTGGACATCGTCACAGCCCAGGGCTTCAAAGCCATCATCGACTTCATGTACTCTGCCCACCTGGCCCTCACCAGCAGGAACGTCATTGAGGTGATGTCCGCCGCCAGCTTTCTGCAGATGACAGACATCGTGCAGGCCTGCCACGACTTCATCAAGGCCGCGCTGGACATCAGCATCAAGTCAGACACCTCGGATGAGCTCTCAGAGTTTGAGATTGGCGCCCCATCCAGCAGCAGCACTGAGGCTCTGATCTCAGCCGTGATGGCAGGGAGGAGCATCTCCCCGTGGCTGGCTCGGCGGACTAGTCCGGCCAATTCCTCCGGAGACTCGGCCATCGCCAGCTGTCATGAAGGCGGGAGCAGTTATGGGAAGGAGGATCCCGAGCCCAAGGCTGATGGCCCCGATGACATTTCCTCACAGTCTCTGTGGCCTGGAGATGTGGGCTACGGGCCCCTGCACATCAAAGAGGAGCAGATCTCGCCTCCTCATTACGGAGCGGGCGAGCTTCCCTCTGCCAAAGATGGTGTGGCGCAGAACTCGTTCCCAGAGCAGGGTGCCGGGGATAGCTGGCAGCCCTCAGGCCGGAGGAAGAACCGAAAGAACAAAGAGACTGTGCGGCACATCACACAGCAGGTGGAGGGCGACAGCCGGGCTGGCTCTCCAGTGCCCTCGTTCCTTCCCACGCCAGGATGGCCGTTCAGCAGCCGAGACTCAAATGCAGACCTGAGCGTCATGGAGGCCAGCAGCTCGGACAGCCGAGGCGAGAGGGCCGAGCTCTATGCACACATCGATGAGGGTCTGCTGGGAGGAGAAGCCAGCTTCTTGGGCCCGCCGCTCACCCCGGAGAAGGATGAGGCCCTGCACCAGGCCACCGCGGTGGCCAGCCTGCGGGCAGCTCTCATGAGTAAGAACAGCCTGCTGTCTCTCAAGGCCGACATGCTCGGAGACGACGGCTCCCTGCTGTTCGAGTACCTGCCCAAAGGCACCCACTCGTTGTCCTTGAATGAATTCACGGTGATCAGGAAGAAGTTCAAGTGCCCCTACTGCAGCTTCTCAGCCATGCACCAGTGCATCCTCAAGCGGCATATGCGCTCGCACACGGGGGAGCGGCCCTACCCGTGCGAGATCTGCGGGAAGAAGTTCACGCGGCGCGAGCACATGAAGCGGCACACGCTGGTGCACAGCAAGGACAAGAAGTACGTGTGCAAGGTGTGCAGCCGCGTGTTCGTGTCGGCCGCCAGCGTGGGCATCAAGCATGGCTCGCGGCGCCACGGCGTGTGTGCTGACTGCGCGGGCCGCGGCGCGGCCGCAGCCCTGGACCAGGGCGGTGGCGATGGCTCCCCTGAGGCGCTGTTTGCGGGCGACGCGCCCTACCTGGAGGACCCCGACGACCCGCGCGCAGAGGGCGAGGAGGAGCTGGGGGAGGACGAGGACGACGACGTGGCCAGGTGGAAGGACGACGTGGGGCTGACGCATGAGGACGCGCTGCTGGCGGACAAGGACGACGAGGACTCGCCGCGGGCGCCCCGCAGCCCCGCAGCGGAGCGCGACCAGGACTTCGCCTGGGTCTCCTAG

XR_205058.1 Non-coding sequence

LOC101703907 PREDICTED: Heterocephalus glaber uncharacterized LOC101703907 (LOC101703907), misc_RNA.

Length: 620 bp     
>XR_205058.1
CTAGGTTTTCTATATATAAGATCAATTGTCTACAAATAGGGATAGTTTGACTTCCTCTTTTCCAATTTAGATGCCCTTTATTTCTTTTTTCTTATCCAATTGCTCTGGATAGGAAGTCACTAACAATTGGATTCTGAACTAATTAAAAGCTAAGCAAAGCTAATAAGTTATAGATCTTTAAAAGTAAGATATCCTACCTGGATAGCCTACCCTGGGGCCCTCTCAGTGGAATGCCACTCAACTTTGTCAGATGACATCTTTGCCTCAAACACTCATGGGAGGGCTTTTCTTGGAAGCTCTTGTCAAAGGTGCTCTGTTATCTTCACAGGACAGCAAGATACAAAATTTGGATTTCCCATCATCATGATCCCAAGGGAGAACCTCTACAGCTCTTCTCCACTCATCAAGGTTTTGGTGACCAGAACTCTGACTTTATTTGGTCAAATGAGAACTTGGCATCATGGCTGCTGGCAGGGAAAATCCCTGGAGAAAAAGTTTAAGGGGAGTGTGTATCTGGCATGAGAGAAGAATTCTTTGCCCATTCTAGCAGAGAGCCCCAAAGAGTCCCATCAAACCAGGTAAAAACCCCGCCCCCAGCCAAACTTGTTGAAGAAGATGTT

XR_205059.1 Non-coding sequence

LOC101708846 PREDICTED: Heterocephalus glaber uncharacterized LOC101708846 (LOC101708846), misc_RNA.

Length: 297 bp     
>XR_205059.1
CTTTCTAACAATATGCTGGTTCTAAGAAAAGAAGGGGAAGCCCCACAGCCGGTTTTCCAGTAAGAGGGGTCTATGTTCCTCACACTGGGGAAATTGGTGGTGGCTTGGTGTTCATGCATTTCCTGCATGTTTGTGGGTAACAGTCACATCCAAGGACATATTATTATCTTCATGGAGGAGAATAGAAGAGACTGAGCTGTGAGCGAGGAACATATACAATGAAGGGATGCTGGAAAACTGGAATCTGCTGTCTTTGGGTGACTCCAGCCCAGGAATCAGAAGTCCCAGGAGCAGCAG

XR_205057.1 Non-coding sequence

LOC101703679 PREDICTED: Heterocephalus glaber uncharacterized LOC101703679 (LOC101703679), misc_RNA.

Length: 439 bp     
>XR_205057.1
CCGGAAGCGCCGGCCGCCGCACAGAGGGACCGGAAGCCGGGAAGTTCTGAGGTCGCCGGATGCATCTGTGTGGGAGGCCGCGTCCTGCTGACCTCTCCCTGCTTTTCTCTGTGCTTCCAACCTGGCTCCATCTCTCTTGTCAAGTTTCCGCATCCTAGAGATGGATGCAATGATAACGGGCCAACTGACCGGGTGACTCTAAGTTCTAGGGTCTGCAAGTCTGCAAGTGAAGACCATCATTGCTGTGGCTGCCACCCTTACAGGGTACGTGACCATGGAGTACAGCAGCCACATTGTATTCATAAGGATGAAGATCACATGACAGAGAGTTGGAAGGAGCTTGGGTCACTAATGCTATTGCTCTTCCCTAATCCCAGAAGCAGTGCCTGCTTCCAGACTTGTGTGAGAAAAATAAAGCCCTTATTTGGTTTTACCATCA

XR_205061.1 Non-coding sequence

LOC101724148 PREDICTED: Heterocephalus glaber uncharacterized LOC101724148 (LOC101724148), misc_RNA.

Length: 306 bp     
>XR_205061.1
GGGACCTTGTATTTGCGAGGCAGCCGGCAGCACCACTGAACTAAATCCCGGGCCCTGGAATGGATTTTCATGCATATAATTTATAAACCTTTAAAAGGAGTCAGGAACTCAAGGTTCTGCCTGGAAAATTACTTGAGGTGTATCAAGTGAATAGTTATATACTAAATGAGCCACAACCCTAGGAAAGCTTCAACGGGCTGAGATTCCAAGGTGGCTCATTCCCCTACCAGAGATCTCTGAAGCCAAGAAAATTGACACAATGAAGCATAACTGTGATACCATCCAAGGTGACCTGCAAAAGCCAAG

XR_205062.1 Non-coding sequence

LOC101697560 PREDICTED: Heterocephalus glaber uncharacterized LOC101697560 (LOC101697560), misc_RNA.

Length: 228 bp     
>XR_205062.1
ATTGAGATTCACTCTAATGAGCTCATTTTAACTTAATAGTTCCTATAATCCCACCAACACAGTCACATTCTGAGAGTACTGATTCCAACTACCTTGAAGTCATCTTACAGAACAGCCACGTGCAGGTGCTCCAAGTGCCAGTCCCAGCTGAGCTCAAACTTCCAGCTGTTCCCACCAAGGTCCACACACAGAGAACTACTGCCCATACAAAAGGAAGAATTACGTGGT

XR_205064.1 Non-coding sequence

LOC101713411 PREDICTED: Heterocephalus glaber uncharacterized LOC101713411 (LOC101713411), misc_RNA.

Length: 1270 bp     
>XR_205064.1
ATAAGGAAGCCGGGGCGCGGGAACTGGCTGGACCCGCCCAGGCGAACTCGGGGTCCCCGGGGCATCGGGGATGGCGCCCGGCCTGCGCCTGTCGCCCCCCCCCACGCCAAGGTCAAGGTCAAGGTCAAGATGCAGATTTATTTTCTGTTTGCGGTTGGTAGAATCCTCGCATGTGAAACTCGCAGGTACTGGGGCCCGCTGGACACTTGGACCTCGCACTGTGGTCCTGGCAGCAGTGAACAACAGTGAATTAGCGCAAGAAACAACGTAGAGAAGGAGCGAAGATCTAGGAACCTAAACAGGGCAGAGTTTAGGAGCCCAGAGCTCAGAAGCCTCCAGAAACCGCTGCTTCCCTAGGGTGGAAGAACGATGGAGACCACTGCGAGAGGAAGAAGGATGGAGGTAACACCAGCCAGCAGCAGACAGGGCTGAGGATGCCCGGAGGCTCCCTTCCTCCTCGCTGGCTCCGGTCATGGCCTCCCATTGGCCGGCCTTACCGGAATTGGTTGCAAGGCAGCCTGGGAAATGTAGTCCCGAGCCCGGCTGCAGTGTGGCAAAGCAAGGAGCAGAGTGATGCCAACAGGAAATGCCAGCCAGGCTCGCTACGGTGGGGCGCGGTGGGGATGGGACGCCCCGCCCTACCCGAAGGTGTCAGCTCACGTCTTGGTCTGATCTGCACAGCAATGGAGGGAGAGCAACAAGGGGAAGACTCTGCCACCCTTTCCCAGCAGGAGGAGACAGCAGGACAATGACCTATGCTCTGGGCCCCACCCTTGACCTTCCTGGCGCACCGTTCTCGGTGGCCCTACCATCTGAGCTGGAACTCAGACTCCCTGTTAGCAAGAGCAAAGCTCCCGCCCCGTGGGGAGGAGACAGTCACGCCGCAGCTGCAGGTCCCGGTCCCACGCCCTTCCACCATGCCGCCCTGTTGTGTGCGTCACTCGTCACTCGCTCCATGCTTTTCCCAGCCCCCAAAGACAGGCGCCGAGGGTATTCCCAGAAAACCCAGAAAAAATTACAGCCAAAAAAAACGTGCCGCAGGTGTCCCCCTGTAACCGAATCAAGTCAAAGTCCTGAAACAGAGAACTGAGAACCTCCCAGAAGGTCTGGGTGTGCGGCTTATCTGCTTCAGGCTAAATTAGACCTGCAGGCCCCCATCATTTCCCTAAGTGATGTAGATCTTAAAAAAACAAGCTTCTGTATGTTTGCTATGTACAAAATCATACAGCATCACTGTACCTGCTTTCATTTAATAATTCCCAGAATTCAA

XR_205065.1 Non-coding sequence

LOC101697561 PREDICTED: Heterocephalus glaber uncharacterized LOC101697561 (LOC101697561), misc_RNA.

Length: 924 bp     
>XR_205065.1
AGGCTTCAAATACAAATATGACTTCCCTGGCTGAAATTCCTGATTGGAAAAAAGAAGTCACTGGGATATGAAATAATCAGGTAGCCATATCACCTCCATTTCACTTAGCCTCAGAGTATGTCGCCAAAAGAGAGGGTTTTGGCTTCATGATATGTTGTAGTCTGTCAATTAAAGTAGGAGTGGAGTGAATTCCTGAGGGGTTCTCCCTACTTATTCCCTCAATAGAATCATTATAGAATGGTAGATGTCTCTTCCTTACTCCAAATTTTTGGCCCCATCTGGTTTCAGGACCAAAAACCAAGGTGAGTCAAGAACATCTGTGACCGTGGCCATCTCGACGCAGATCTGCCAGGCTGGGACGTGCTGCCTAAGGCTGCTCAGGGAAGAGGTGACCCAGTCCAGCAGAGTAAGAGCCCAGAGCTTCAGTCACCAGAATCCTCAGCCTCCTGCTGCAGGCCTGGAGTGAGCCCACCACCTTCATCAGAGCCACAGCCTCACCCGCAAATGGGGAGCTGAACCAGTTACCCCGAGGGCCTCCTGGTGCTACACATCCAGGTTAAGATGCCCGTGACATTGTGACCTGCTTGTAACCACAGATGTAAACAATGTGATTGCTGTTTGTTTCAGCTGTGTGGGTCTCCTTGTCCCTTCCTGGGTCTCTCCACCCGTGCCACGACTTCTGACAAATACTGACTGAACAGCTCTGGGCACCAGACCCAGGTAGTGCCAAGCCCAAAGCACGCTGTCTGAGGCCACCGCGCAGCATGCATGGAGACAGCTGCCGGCCGTGCAGTGAAGGGGAGCAAACAGGGTACATGCGGGGCAGTGACCATGGGCTGAGGACTCTCTAGGGCCAAGGAAGGCCATTTTTCTATTTTTAAAAAATTGATGTATAATTGACATAAAAGATCCAGTTCTAAAGTG

XR_205067.1 Non-coding sequence

LOC101699524 PREDICTED: Heterocephalus glaber uncharacterized LOC101699524 (LOC101699524), misc_RNA.

Length: 2839 bp     
>XR_205067.1
TGGAGTGTGCCTCAACAGGGCCAGCTCTTTTTCTTGTTATTTATTATTTCTCCACTCAAGTTTCACTCACCTGTAGCGGATGTTGGGGACATCAGAATGAGGCGACAGTCCCTCCAGAGGCTCAGCCTGCCAAACACAGACAAGTGAGTAGACTTACCTTGTGTATGTGTGTATCTGGTGTCTACAGGGTGAGACTATGATTGGTGCCTCTGTGTTCATTTTCTGGCAAAGATAACATTAAGTCAAGGATGCAGCCTGTAAATGATGGAGTCTTCAGGTGAAGGAAGAATGGTAAGTGCAAGACTAATGAGATACCTGAGTCGGCGGAGTGCTGACCCTCGAACTGGGACTGGGAGACATGAAGCAGCCTGGGGTGGGGACACAGCAGGTGGGCCCAGGCATGGAGGGGGAAGAACAGGGCTTGGGGTGGACCACTGGTTTCACCCTGGCTTTTGCTCTCCTGAGCCCCAGTGGCCTCCTTGTGGTTAACAGTTGGCCACTCACAGTGGGTCTTGGTCCTGAGGAGGAGGAGACCACTTCTAGGTGGAGCCCCTGGGTGTATGTTGATTCCCCAGGAGTCCTGCCTCCTGCTGAGCTCCAGCACAGTGGACCGGGGTGTGGGGGGTGCGAGCGGGGGATGGGCAGGAATCCGGACCTTATCTCCACTGGGCAATGATTAACCAGAGGGGCTGCAGCAGGGGACCAGACAAGACAGTAAACCAGGAGGTCTGGGCAGGCAGGCAGGGACAGCAGTTCACAGACAGATGTGGGGACTGAGAGGGACCAGGAACAGAGGACAGGGTGGGGGTACTCTCTCAGGTGACACCCACAGGCTGGGGAGGCCAGGGCAATGGCAGAGGGCTTCCAGGCAACTCGAAGATGAGAATGGACAGGTTGGCAGGATCTGCAGGAGAGAAAGAGTGTCCATGTTCATGTTGACAGACTTGGATGTCGCCTAGCGAGGAGAGCAAGGAAGAGGTTTGGGCCAAAAGGAAGGGGTGAGTGATGTCGGCAAGATTGCCAGTGGGGTGGTCCTCATGACCCTCCCAGCCTCTGACCTCAGGCAGCTTACCTGGCACCAAGTGAGGACACAGTGAGCTTTTCCACCACTACCAGAACAAGTTGCTCCCAGAAGAAGTGCCCAAAGCCCAGGGAAGGAAGGGGTCAGGGGCCAGTGCCAGCACTGAGGAGACACTGAGGGAAAGAGGGCAGCACAGACTGATGCTGAGAAGCAGCTCCCAGAAAGCAGGGAGGAAGGACCTGAGTGCACGGGATGGGCAGCCAGGAGAGGACACCCTGGGAAGAGGGGGAAGGGCTGGGCACTTTCAGAAGATCCAGAGAGAGAGCTGGAAGGATCTGGGGTCAGGAGCTGAGAGGCTGTGGGCATCTTTGGGGGGGTGCTGCTGACGGAGGCTGGAGGACAGAAAGCTGGGGAAATAGAGTCAATATGTGCTGAGGTTAGGGAAGAGAGAGAAGATGTCTGCACCGAAAATTATTTAGAGCTACTGTGTAGAGTGAAGTGTGCTGTCTCCTAGAACATGGCACACCTATGAGGGCATCGGTGTGGTCCTTCTACAGCCAAGCAAACCAAGGCCCAGAGGAGTTGAAAGACCCTCCCAAGGTCACACAGCGAGCAAGAATGGAGTCTCAGAGCAGGGTGTGGGGCCACACACCTGTGATCCCAGTGCTCTGAGAGACTTAGGCTAGAGGATTGAAAGTCAGCCTCTTAGAGAGACCCTGGCTCAAAATAAAAAAGTAACTAACCAGTGCCAAAGCCTTGGTTCAGTTCCCAGTACTACCCCCCCATCCCTCAAAAAAGAAAGGAGTCTCTGATCTTAGCCTGACTGGGCCCGCTTAAACTCTAAATCCAACAGGGCGGAGGAAGAAGGAAGCAGGCATGTGCTTCAAATTGGGAAGAATGTTTTAGGGACTTCAGGCCCTGATAATGAATGTGCATGCACCGTCTCAGTGTAAGGGAGCTCTGGTGTGGGCTGCCTGGCCACAGCCATGGGTGGACACAGCCCTGGGGAAACGGGGCCACTTCCTGCCTTCCTGACACACTTACAGATCAGCCTGTGGAGTGGGGGATTCTGGGAATTTTCTCACTGTTGCACCCCTTGATTTGCTGCGACACCTGGGATAGAGCTGGGGTCGGGGGAGTGAGGGGCTGGGCTAGGTCAGCATCAGCCCGAGTGTCAGTGAAATAAGCAAGAAAGTGGCACTGGGTCTTACCTGGGTGAGGCAAAACAAAAGTGCCCTCAGGAATGCGAAACTAGAAACACACCATGTCATCCACCGTGGGATTCAAGGCTCTGAGCAAACCCCTCAATTTCTGTGAGGATTCTGACCTTACAGAGAGAAAGCAGAAGCCTGGAGAGATTGAACACTTAGTCTCGGATTGCACAGCTAGGACCCAGAGACCTTGGATGGAAGCCCAGGCCCTCAGGGTCAGGGCAAAAGAGTGGCACCCTGAGCCCATGTGATGTTTGAAAATGGTCCCTTGTTCTTCAGAGAGATCAGCCAGAGAAGACTCCGACTTAGAGACCAGGGAGGTTTGGTCTACTGCACACTGTTGCTTGATTCCAGGTCCAGTCTGGCCCCAGTGCCCCTCTGGGTGTCTTGGAGTCATCTCAGAAGCCACACCTACGTGTGTCACCGAGGGGACATGTGTCGAGATGGCAGAATGGTGAGGGACCAGGGTCACCTTCATTATTCTGCTCTACTGGAAGGAATACAATAAGATGATGACAGTGAAATGATATGGGAGCTCTGTACCTGCTGTCAACTTAAGTGACACAAACAAAAAAGAAGCAAATTATTAAATGGCTTATTATTGTCA

XR_205069.1 Non-coding sequence

LOC101704871 PREDICTED: Heterocephalus glaber uncharacterized LOC101704871 (LOC101704871), misc_RNA.

Length: 545 bp     
>XR_205069.1
GTCGCCAAGCGCCGGTTGCCCTGGAGAGCGTCGCCAGGTGCTGAGCGCAGCTGGCGTGTCTTCCAGCGCTGGAGATTGGGGAGCGCGCCCGCCACTCCCGGCCCCAACGCGTTCCTTCTTCCTCTTTGCAGTGGGTCCTTGGGTTTCTGCTGTACGCTCGGAATCGCTCGCCCACGCTCCGGGAGGGCAGCGAGGGTGCCATTTTTGTCTGCTTCCTCTCCCACTGCTTTTGTTGAAGGAACCAGTAAAGAAGATTTCCTTACAAGGATCCTTGGGGACAACTTTGTCCCCATTGAGCTGTGGATTTGAAGAGAAGAATGAAGCCATAAAGAGGAAAAACCAGCCTCTAGTAAAACGAGTGTTTCTTTTTCATTTGGCAGTGCTAAGGATCGAACTTAGATCTTCATACATGCCAGGAGAGCACTCTGCCTTGGAGCCACATCCCCAGCCCCAAATTGGTGTTTCTTAACTTTTTCGGAGTCCTCAGACCTATTTTGGAATTTGATGAAAACTTTAAACCTATTCTCAAAAAACTATCTATTAGC

XR_205070.1 Non-coding sequence

LOC101709443 PREDICTED: Heterocephalus glaber uncharacterized LOC101709443 (LOC101709443), misc_RNA.

Length: 253 bp     
>XR_205070.1
CAAGCCTAGTACAACTCTGTAGGTCCTCCACATGCTGATTCTCTCTCCTGAAGATCCCTCACTTTCAGCCTTTCCAGTGAGGGGCTGGAGGCAAAATATGCAAGGACTGAATGAATTAATCAATTAATTGCACGTTCATATCGTCTTTCACAGACGGGAAATGAAGACTCGGAGGAGCTGAGTGCCTGAGCCCCTCTAGACACTTCAGCAAAGATGTTTTCTCGCCCTGGAGCAGCATCCCTGGAACGCAGAG

XR_205071.1 Non-coding sequence

LOC101711739 PREDICTED: Heterocephalus glaber uncharacterized LOC101711739 (LOC101711739), misc_RNA.

Length: 1991 bp     
>XR_205071.1
CGAAGAGAGCTTTCGGAGGGAGGGCCGTCGGGCCAGCCGCTGTGTTCGGCTTCTTACTCAATAATAATAATTAACAAGTCTACACTTCCACGTTCTCTTGCTCGTGTAGTGCCAGGCACTGTTAGAGACTTTGAATAATAATGCAAGTACTTATTGTAAACATGATGTTTATGGTGACTGATACGTGCTAGGCACTATGACAGATCGTAAATGATAATTATAAATATAATAAACTACCAAATTATTATTTACTTATTTTTTTGCCACTCTGGTGATGCTTTCAATAACAACAAACAACTGTCATAAATAAAAGCTGCTCCACATTAAATCTTTGCCATGCAACCAGCACTGTCCTGGATCCTTCGCTAATAGACACCATTTATTCATGCAACAAAGGCTACAGAATACAATGATGAGAAAAATTTACCTTATTCCACCTTCCTGCTAGAATCGAGTGAAGAGACATCCTTTGAGTAAGTAACCACACAGATACTGAGGCTGGCTTGCTAGAGCAGCAATTCATTCCCTCACCACAGTGAGGACGGCACTGTGCAGTCTCCTCCCGTTGTTTACTTTTCAAGAGTCAGACAGCAATCTCATCATCATTCCTTCACACGTAGCAAGGGCTTACGGCACAGCAGGGACTCAACAGATGTAAGAGCGAGTGAAGAAATGAAGGAACGAATGCATGAATAAAGATCCAGGATCACCAGTGGTGGAAGTTTCAGGACAAACTTGTGCATAGGATTTGTAAAAACCCTTGGAAGACCCAGCAGCTCAAACCCACCCTGGATGGCGGATGGGGCAGTCAAAGTCAGAAGTTCCTGACCATTTTCCAAAAAGGGTTTGGAGGCCCCTCCAGAATTAGGCAGAAGGACATGGGAAGGGCTTTCTCCTCTGCTGAGGGTCTCAGGAACCTAGGTGTCTGTTGCAAGTTTGCACAGCAGGGGGAAAAGATGAAGAGTTTGCCCCTCCTTGCCCAGGAGAAAGATCTTCCTATCGCCCCGAATTCCCTCAGTTCTTTATTCCTGTGAGCAACCAGGGGATGGATTCCTGGTCCCCATCTCTGTGCCTGGTGCATAAAAAGTGCTCAATAAATGTTTGATGAATGAATGAAATAATGTAATTAAGAATTGAAGAGGGTGGGGTAGAGGGAGAGAGTCTTTTCAATCCTTAGGAGTTGTCCTCAAGCACCAAGAAGGCCATATTTGCATACAAATAATTGATATTCTAATTACAAATCATTCGTATTGCTTTATTAAGCAGATCCCCAAAGGATCTGTAGAAGATAGATTCCATGCTCCTTAGGGGTAAGGACAGCATATTTACCTCCTTGTTCCCCGACGGCAATGGAAGGCAGAAGAACTACATGATAAATGTTTGATGAGGCAGTGGATGAGCATGAGCTTAATTGTGGGGAGAGTTTATGGGGCCCCTACAGATCATTCCCAGTGTTGGGGGAGAGAGGGACAGGGGACACATTTGTGTATTTGTGCATATGCAAAATTGGCAATCCTCCCTTTTTCCAAGCCCTGGGGATTTGTATTTCGTTCATACCTCAGGCACTGGAGGAGGAGCAGGTTGGCTGAACAGAAGGGAAAAGACAAAAGACACCAGACCCCTGGCCCCTTCTGTCCAGCTGTGAGCCAAAGCCGATGACCTCACGAGGCTCTGCCAGGGAGCGGGTGGGAGCAAGGGCCTTAGACCTTTCCTGTTGTCTCTGAGTGCCTCTCCTTAAGCCACTGCAAAGAAATAATCATACATAAACGTTTAAAAAAATGTATGCAACCAATGAGAGAAAGTATCATTAGGAAACATTGCAGTGGTCTTTGATTTCATTGAAAGCTGTGCCCACTCTGCAACTGCAGTTTTGAGTCACCCTCACAGACCCTCTGAAAACAAACCGTGCAGCAGCCAGTGTCCTAGGCACGAGATGGGAGGCCAGAGTTCCCTGAAGGGACAGACAGATGACAGGCAGACAGAGGGAGAAA

XR_205072.1 Non-coding sequence

LOC101712559 PREDICTED: Heterocephalus glaber uncharacterized LOC101712559 (LOC101712559), misc_RNA.

Length: 1027 bp     
>XR_205072.1
CTCATAGGTCCGAGGCCAGAAGAGGTGGAGACAGCGCGGCCAGCGCTCGCCCTGGCGCGCCCCCTGTGAGACCCCGGGCCCCGGTCTCCCCGAGGCTGCAGTGCACAAGAAGGGCTCCCCAAACTGTGTCCGCTAAGCCCAGCGGTGCCTGCCCAGCGCCGGGGCGCGCCCAGGCCAGGCCGCTCCCGGGACCCCTGAAGTTTCTGTCCGGGCCTTCCAGATACTCCTGGAAAAGTCGCGTCAAGTTGGAGCCCGCAAGCCCAGGAGCGCAGCGAAAGGGGCCAGGCCAGGGCGCCCCGCAGCCGGCAGCCGCGCTCTGTAGTTAGCCGTCCCCAGCTTCGCCGCCCAGGCAAAGTGTGGAGCCAACGAGGGCGGGTTTCCTCCCCCACCCCCAACGCCTCCTCCTGCCACCACCCCGCAGTTCTCCTCAGGGTGAGTCAGCTTAGGGTGGCAGCTCCGAGGCCAGGCAGCTGCGAGGGGGAGGACGAACCGGATGCCTCCAAACTGGTCCCTGCGGATCCCACCCTGGCACCGGGCCTCCCTGGTGGCATCCTGTTTGGCAGGCCAGCCTCGAAGAAAGTTTACAATTAACATTCCTGGTTTAGTCTCCACCCCCTCTTGAAATGGAATTTTTATCTCTTGATTCCTGCTACAAGATGCGATGCCTGTTTATCCAGTTGCATGAATAATTGGTCAGCTCTTTCCAACTTGCCAGAAGCAACCCCTGGCCGTTTCTGGAGCACTGGGAGAGACCTTCGCACAGTTTCTGCTTGGAGTCCACCGCTCTTCATCTCAGGTCTAGACAGCTACCTGTTCTATTTGGCTTAGCCTGTGCTGCAGAAAGTCCCAGTTCTTCCAAATCAAGCTCCAGGAAATTGAGAAGCATGTTATTAGTTTTAGCAAACAATTTAAACAAAACTAAGACCAGATCTCCCAGCAATGGTGAAGGATCTCAAGGGAGACCTTGGTCACAGTGGGCCTGGCTTCCCTACAGGCACTGCCTGCCATAGAGGACAAGCCATCGAAA

XR_205073.1 Non-coding sequence

LOC101719092 PREDICTED: Heterocephalus glaber uncharacterized LOC101719092 (LOC101719092), misc_RNA.

Length: 308 bp     
>XR_205073.1
CCGAGGGAACGCCCACGACTGGTCCTGCTCCTCAGGCCGGACGCGCCTCGCTTCGGCTCGGCCAAGCCCAAGGTTCCCACTGGCCCGGACCTTTGGTCCTGCCTTGCAACGGCTTCTGTTTTTTGTGGACTCTATACTGATTTCCATAATGGTTGACTAGTTCATGTTCCCACCAACAAGGAGATAGTAGAAGGACTCTCCCACCCGGCCTCACCAGCATTTGGAGGAAAGATGCCAAGTTCCGAGCACCCCTATGGAGAAACTGCTTCCTATGGTAGCTAAATAAATAAGCAGAGATGGAGTCTCCA

XR_205074.1 Non-coding sequence

LOC101719318 PREDICTED: Heterocephalus glaber negative elongation factor D-like (LOC101719318), transcript variant X4, misc_RNA.

Length: 2132 bp     
>XR_205074.1
AAGCCTGGCGGGCCCGGCGCCGGGTGCTATCATGGCTGAAGACTACTTCGGGAATACCGCGGAGTGGGGCGAGGAGGCGGACGGCGGCCAGCAGCAGGAAGATGATTCTGGAGAAGGAGAAGACGATGCAGAGGTGCAACAGGAATGCCTGCATAAGTTTTCCACCCGGGATTATATCATGGAGCCCTCCATCTTCAACACTTTGAAGAGGTATTTTCAGGCAGGGGGATCTCCGGAGAATGTCATCCAGCTCTTATCTGAGAACTACACTGCTGTGGCCCAGACTGTGAACCTGCTGGCCGAGTGGCTCATTCAGACAGGTGTTGAGCCAGTGCAGGTTCAGGAAACTGTGGAAAATCACTTGAAGAGTTTATTAATCAAACATTTTGACCCACGCAAAGCAGATTCTATTTTTACAGAAGAAGGAGAGACCCCAGCTTGGCTTGAACAAATGATTGCACACACCACTTGGAGAGATCTCTTTTACAAGCTGGCTGAAGCTCATCCAGACTGTTTGATGCTCAACTTTACTGTTAAGCTGATCTCCGATGCAGGGTACCAAGGGGAGATCACCAGTGTGTCCACTGCTTGTCAGCAGTTGGAAGTGTTCTCTAGAGTGCTACGAACCTCACTAGCCACAATCTTGGATGGAGGAGAAGAAAACCTTGAAAAAAATCTTCCCGAGTTTGCTAAGATGGTGTGCCACGGGGAGCACACGTACCTGTTTGCCCAGGCCATGATGTCCGTGCTGGCTCAGGAGGAGCAGGGTGGCTCTGCGGTACGCAGGGTTGCACAAGAGGTGCAGCGCTTCGCCCAGGAGAAAGGCCATGACGCCAGTCAGATCACACTGGCCTTGGGCACAGCCGCCTCGTACCCCCGTGCCTGCCAGGCCCTCGGGGCCATGCTGTCCAAAGGAGCCCTGAACCCTGCAGACATCACAGTCCTGTTCAAGATGTTCACGAGCATGGACCCTCCTCCCGTTGAACTCATCCGGGTTCCGGCCTTCCTGGACCTGTTCATGCAGTCTCTCTTCAAACCAGGCGCCCGGATCAACCAGGACCACAAACACAAGTACATCCACATCTTGGCTTACGCAGCAAGTGTGGTTGAGACATGGAAGAAGAACAAGCGGGTGAGCATCAATAAAGATGAGCTGAAGTCAACTTCGAAAGCGGTGGAAACAGTTCACAATTTATGTTGCAATGAGAACAAAGGGGCCTCTGAACTTGTGGCAGAACTGAGCACACTTTATCAGTGTATTAGGTTTCCAGTGGTAGCAATGGGTGTGCTGAAGTGGGTGGATTGGACTGTGTCAGAGCCCAGGTACTTCCAGCTGCAGACTGACCATACTCCAGTGCACCTGGCGTTGCTGGACGAGATCAGCACCTGCCACCAGCTCCTGCACCCCCAGGTTCTGCAACTGCTTGTTAAGCTCTTTGAGACTGAGCATTCCCAGCTGGACGTGATGGAGCAGCTCGAGCTGAAGAAGACCCTGCTGGACCGGATGGTTCACCTGCTGAGCCGAGGTGCTGGATGTTATTGCTCCTCCATACACCTCGGACTTTGTGCAGCTCTTCCTCCCCATCTTGGAAAATGACAGCATTGCAGGCACCATCAAAACAGAAGGCGAACATGACCCTGTGACAGAATTTATTGCTCACTGCAAGTCTAACTTCATCATGGTGAACTAAATCAGCATCCTCCAGGGCTGAAGCCGAACCTTCTGGAGCCTGGCTGTGGAGGACCCTTTGAGGAAGCTGCTGTTTGAAGAGGCTCAGTCAGCATCTTGGATGTGGGGTCTGCTGGGAGGGGCAGATAACTGTTTTCAGAGGAACATGTTAGCAGTGTGAGAATCTGCTATGATGGACAGTCCCTTCTCTTTGTTGTCAACCCAGTATGGTTCCTCCATTCTGTGTGCAGTGTTCATCTCCCTCAGCACAGGAATTAGGCTCATACTACCTCTCGGGATGAACCCAGTCAGCCCGAGGATGCTAGGAATTCAGAAACTGAGTCACTTTGCTGAACTGCTTACAAGGTAGACTTGTTTCCTCAGAAGAACCAGATTGGTTGGTTGATGTTTTTGTGATTGTTTCAATTTGCTAAGAACATGAAATAAATTTTTACAAAGCCTT

XR_205076.1 Non-coding sequence

LOC101715759 PREDICTED: Heterocephalus glaber uncharacterized LOC101715759 (LOC101715759), misc_RNA.

Length: 7709 bp     
>XR_205076.1
GTTTATCTGTTAAGAAATCATGAAATGTACCAATGCTTGCTGTGTAAAGAACATCCTGCTAGTTGAATAAAGAACATCTGGAAACTCCCCTAACATCCCCTAACCACAAAAATTCTGCTTCTGTAGTTCTGCTTGCTAAGCTCCCCTGCAGCCTCTGTAAAACCATCCGACCCTCTGAGCTTGGGGCCTCTCTGAGCTTGCTGCTTGGAGAGTGCTGTCTGGCCAGACTAATAAAGTCTGTACTTATCCTGAGTCAGTGTGATCGGTGTGATCTTTGTTTGGGTGGTTCTCGCTACAGTCTGCTCACTAGAGCAATTTGGTAGGATTATAGGTCCTACATTTTGGAGGCCCCAGCGAGATACCCCCAACAAGACCACTGATCATAGCCGAGATCCAGCTGGACAAATCTCAGAGACAGACTTCAGAAAACCTCTGGAGGTAAGGTTTTGGTTTTCGGTTGCAACCATTTGTTAGTCGGGAGTGAGGTGGCTGACGATCCGGGAAGCCTCCTCCCAACCCCCAAGTTCCTGACGAGGAACAGGGGAAGCTTTAGTCTTGTTCTGTGTTGTTTTCTGTCCATATTGTGTTCCATCTGTCTGGTGCTCTGCTTTGCTCTGTGTTTAATTTTAAATCCTATAGGAAAAGACAATATGCGAGGATCCTGTTCCACCGGATCTATGCCGCTTAACTGTTTTATCACTAACTTTAAATTGGCTTTTTCCCCAGAGAAGGAAGATGAATACGGGGTAAAATTTTCCCACAGGAAACTCCATACACTTTGTCAATTAGAATGGCCAAATTTTGGTGTAGGGTGGCCGGCCGAAGGAACCTTCGACCCCGGTACCTGTCGGGCTGTTTTGAAATGAGTCATCGGGCACCCTGGCCACCCCGACCAGTTCCCCTATATTGATATTTGGGTTCAGGCTTGTGAGGATCCCCTGGCTTGGCTCTGGTGCTATTCTCTTGAAACTGAAACTCATATTTTGGTCACAACCCTGAAAAGGCCCAAAGATCCCACAGCCCAGACTGCCAAGCCGGTCCTCTCACAGGACCCTGATCCTTTAGACCCTTTAGCCCATCCCCTATCTTATGCAGGTCCTGCAACCTCCTCTCTTTCACCTGGGGTTCATCCAGGGTCTCGTAATCCTTTTTCCTCACAGTCTGCCCAGCCCTTGTCACCTCCATCTCTCTACCCTCCTCTCCCTGAGAAGCCCCAATCTCTGGACTCTGTGACCTCTCCTTCCCACACCCATACTGGAGTCATTTATGGACCCAGTAAGAGCCCCATTGGGGAGGCCAGTTCGGCCTCCCTTTTGCCCCTCTGGGAGACAGAGAAAGGATGATATGTTTATATCCCATTTACTACTACTGATTTGTATAATTGGAAACATCAGAATCCCCCATTCTCAGAAAAACCCCAGGCCCTGATTTCCCTACTAGAATCTGTTTTCCACTTCCATGACCCTATCTGGGATGACTGCCAGCAACTCTTATAGGCCCTTTTCATCTCCGAAGAAAGAGAGCGAATTTGGGGATAAGCTGTGAGGTCGATATTGGGGGAAATAGAAGGTCCCTTAGACCAACAACAATGAGACCGTATTGAGGCCCAGTTCCCATCCAAGTGGCCTGGCTGGCAGGCCAACTCCACGGGTGGAAGAGAAGCTCTCCAGAACTACCATCAGCATCTCCTGGCCGGGTTTGAGGGGAGCCGCTCGAAAGCCTACCAACTTAAGCAAGGTAAGCGAGGTCCTTCAGGGACCTGAGGAATCCCCTGCTGCCTTTCTGGAGCACCTACTGGAGGCATACCATACGTATAGTCCAATTGATCCAGACACACCCATAAATAGCCAGGCAGTCAATCTGACTTTTGTTACTCAGTCGGCCCCAGATATTAAAAGGAAGTTGCAGAAGTTAGACGGATTTGAGGGAAAGAATAGGGAGGAACTGATGAGTGTGGCTATGAAAATATTCGGAAATCAGGATCCCCTAGAGGAGAGGATGGCCAAGAAATTGGGAAAGGCAACTATAGCAGCCCTGGCAGATGGTGGGTTTGTGCAAAAAGGAAAACCAGAAAAGTAAATGGGAAATAAAGGGAAAAACTGGCCCCTGTTGGAGAAAGATCAATGTGCCTATTGTAAGGAAAAAGGCCACTACAAGAGAGACTGTGAGAAGCTAAAGAGAAAAAAGGAAAAGGAGGGCCAAGAGGAAAAGGTCCTGTTAGTAGATGAAGAAGACTGATGGGGCCAGGGCTCATGGCCGCTAGACCCCAGTGAGCCTTTGGTCACTCTTGAAGTAGGGGGAACAGATGTTCAATTTCTTGTGGACACTGGTGCAGCCCATTCGGTACTGAAGGTCCCCCTTGGACCCCTCATTTCCCTAAAAACCTCCATAACAGGAGCCACAGGGAAATCAGCCTCTTATCCATGGACTTCAAAACGAACAGTGAATCTGGGGAAGGGCACGGTCACCCACTCATTTGTGGTCATCCTCAAATGCCCATACCCATTGGGGGGAAGGGATTTACTTAGAAAATTGGGGGCCACTATCACCTTGAACCAGGAGGAGGAACCTTTGAACTTAAGGCACCCCCCGCAATCCTGGTGACAGTGCCCCTAGAAGATGAATTCAGGCTTACAAGAGACGGAACAGAGCCCCCTAAGGAGGAGTGGGACTATCTCCAGACAAAAGATCCCAAGGTTTGGGCCAAAGCCAGTCCTCCTGGTTTGGTGAAACACCATCCCCCAATAGTCGTTCAACTACTTGCTTCAGCAACCCCCATCTGGGTGTGCCAGTATCCCATCCAGCTGGAAGCTAAGGTGGGGATCTTCAAACACATCCATCGGCTTCTGGAGGTTGGCATATTAGGTCCTTGCCAGTCGGCTTGGAACACCCCTCTGCTCCCTGTAAAGAAGCCTGGAACTTCTGATTTCAGGCCAGTGCAAGACCTATGGGAAATAAATGCCAGAGTGGAGACCCTCCATCCCACTGTGCCAAACCCTTATACCTTATTGAGCCTTATCCCGCCTGACCATAAGTGGTATACAGTACTAGATCTAAAAGATGCTTTTTTTAGCCTCCCCTTGGCTCCAGTAAGCCAACCCCTCTTTGCCTTCGAGTGGATGGACCCAGACACAGGATCGACTGGCCAGTTGACATGGACTCGCCTGCCACAAGGATTCAAGAATTCCCCCCCCACCGCCCCATTCGGGGAGGCTCTGAGCAAGGATCTACAGGAGTCCGTAGGCTATCGTGTATCCTGGAAGAAAGCCCATCTTTGCCAGACCAAGGTAAACTACCTGGGATATGTTCTCAAGGGAGGGAAGCAAAGACTGGCTGAATCACAGGGAGCAGCAATTCTTCAGATTCCAGAACCAAACATGAAGAAACAGGTACGTGAATTCTTGGGGACAGTTGGATATTGTAGGATTTGGATTCCTAACTTTGCTGAGATCGCCAAGCCCTTGTATGAGGCCACTGCAGGGGGAAACAAGCCCCTTGAATGGATGGCTACACATCAACAAGCCTTCCAGGTGCTGAAGGCTGCACTTACCTCAGCACCGGCTCTAGCCTTGCCAGATTTGAACAAGCCATTTACTTGTTGACCATGGAAATGGTCGATAGCTTACCTCTCAAAAAGACTGGATCCTGTGGTGCAGGGCTGGCTGACCTGCTTATGGACAGTAGCCACAGCAGCCATTTTAACTCAAGAGGCTGATAAGTTGACATTTGGGCAAGACTTAACTCTGATTACTCCCCATGCCGTTGAACCCCCGTTGCACAGCTCACCCAGCAGATGGTTGTCAAATGCCAGACTGTTACAGTACCAAGGGCTCTTGCTAGAACAGCCACGCATCAAGTTTGCCACCACTGCTAGCCTCAACCCAGCCACCTTACTCCCCGAGTCCGATGAACAGATGCCCATCCATGATTGCCTCGAGACTCTTGAGAACTTGAGAGGAGGGCATCCGGATTTGACAGATCAGGCCCTCCCTCGTGCAGAGGTCACATTCTACACTGATGGGTGTAGCTTCATATGTGACAGAGTGTGGTATGCTGAGGGGACAGTGGTCAACCAGAACTGGCAGGTGGAATGGGAACAAGGGCTATCCTGGGGGACATCAGCACAGAAGGCTGAGCTGATTGCCTTGACCAAGGCTCTAGAACTAGGTAAAGGCAAAAGGATAAATATTTTCACTGACAGCCATTATGCCTTTGCCACCGCTCATGTGCATGGGGAAATTTATCAAAACTGAGGACTGCTAACCTCTGAAGGAAAGACAATCAAGAATAAAACAGAGATATTGGCATTGTTATAAGCCATTTGGCTGCCCTGAGAGGTTGCTGTCACCCATTGCCACGGATATCAAAAGGGGACCAACCTGGAGGTAGTTGGCAACAATGCAGCTGATCTGGCTGCAAGACAAGCTGCCCCAAAATCAGTGGGGAAACAAATGGTTCTGCTCCCCACACCAGTGCTACCAGAGAAACCAGAATACACAGATGAAGAGACAACAGAAATGGCCAAGAAGCAATGGACCCAAGGTAAACATGGGTGGTGGACAACCAATGATGGAAAGGTGGTGCTCCCAGCTGCTGTAGCAGACACGCTGCTACAAGAACTGCATGAGTCCACTCACCTTGGCGAGAAAAAGATGATGGCCACCCTGAGGCCCCATTTCATCATCAAGGGAATGGCACAAAAAGCCACGGACATGGTGAGATGATGCCGCACCTGTATCAAGGTAAATGCAAATCGGGTGATTGAACCCCCTGGGGTCTGACACAGAGGATTAACTCTGGGAGAACATTGGGAATTGGACTTTACTGAAATGAAACCTGGAATGTATGGGTATAAATACCTACTAGTTTTTGTAGACACCTTTTCAGGATGGGTAGAACCCTTCCCTACTAAGAGAGAGACTGCTGAGGTAACCATCAAAAAGCTCTTGACAGAAATAATCCCTCGTTTCAGCTTGCCCCTAGCCCTGGGGTCTGACAGTGGCCCAGCCTTCAGGGCTAAGATATCCAAATTGATCAGTAAAGCTTTTGGGATAAAATGGAACTTGCATTGTGCCTATAGGCCTCAGAGTTCGGGGCAAGTGGAGAGAACAAATTGAATTTTGAAAGAGGTTCTAACTAAATTATGCCTGGAGACTGAACAGGGTTGGGTAGAGCTTCTCCCCTTTGCTCTCCTTCACACTAGGTGCACCCCTAGGTCACCCCTAAATCTGTCACCCTTCCAGGTCATTTACAGACGATCTCCTCTGATCATCCCTCTGGTTGATTTAGAGTTAAAGGAAAAACTTTCCCACCTCCAACTCCTTAAGTCCTTAAAAGCAGTCCATCAGCTTCAGTCAGAATTACATGATGAATTAAGAAAGACCATGCCTGACCCCAACAAGAAACCCCTACAACCCTTACCCTATAAGCTGGGAGATTTGGTTTTCATTCGCAGGTTTGATTCCCAGACCTTGGAACCCCACTGGAAGGGACAGTTTCCTGTCGTCCTGGTGACTCCCTCAGCTGTGAAGGTGGCTGGACATTCGGCCTGGATACATCACAGTCATCTGAAGGCAGTGCCACCCCAACCCCAGCCTCAGGATGGCAAGTCATTCGACAAACAAAGGACCCCTTAAAGATAAGATTAATCAAGGACTGAGATGGGTAATGTGGGGACTTATGGGATCCTTGGTTCTGTCGGCCCAAGTAAAAGGAAATGTTCAACAGCTGGTGCTCTCCAGCCATAACTCCCAGAGCTGGATGTGGTCTCTAAAAAATTCACTTACCGGAGCCCTAATTGTTACTGTTACAACAGATCAACAGCCTGTTTTTCAGGTAGACCTGTTGGCCCTAGGGTTTCCCAAGGTTTATTTTGTTGGGAGGGGCCCGAACACTATAGGACCGAATTTCCGAACAATTGGCCTATACGCATGCCCCATAGGAAAGGATCCCAACTGTGGTGGTGGGCCGGGATATCACGGTTATTAGTGGGGCTGTGAGTCAATAGCCCCGTGGGTAAACAATGATCCCTTTTTGGCTATAACTCGGCCTACAAACCCAACGTGTAACCCAGGAAACTGTGAACCTGTAGAACTTAGACTAAAACAATGGCAGAACCCCTACAAAGATTGGGAAAAGGGAAAGGCATGGATGCTAGCGCTGTATGTCACTGGAAAAGACCCTATGACAGACATCATCATCCAGCGAAGTCTAGTAGTGGTACCACCCAAACTGGTGGGCAACATTTATAGAACATTGAACCCCCAGAAACAGGTAACCAGCCCCAGACGTGCAGGGGGGGTTCCTCCTGCTCATCGCGGAGTGGGGACACATGTGCCCGCCATGCCACCATGACAGCCAGCCACCCAGGTAGCATCCTACCCAACAATGCCCCCGAGTCACCAACCCAGCTGTACTTAAAGATGCTGGATGCTATGTATAAAGTGTTTAATGGGTCTGACTATAATGTCACTAATGAATGTTGGATGTGTCTGAACCCAAAGCCCCCGTACTATGTAGGAATAGCAATCAATGGAACCTACACTGAAACAGGCCAGGATGGGTGCAACTGGAAACAGCCGAAGTTGTCAATAGGGGATATACATGGAAGAGGGTCATGTGTTAAAAACCCCAATGTCACCTCATCTTACTTGGATGAAGCCTGCGTTTATCAGACGACTTCTGCAGGATGTGATCAAGAGCAGAAAACAATTCATGGTGGGCATGCACAGGAGGTATAACCCCTTGCCTCTCTGTTGCTGTCCTGCAAAGGGAACCCGAAGTTTGTGTGCTCGTCCATGTTTTGCCCCAGGTGGTTGTGTATGGTGGGGAACAGGGTTGGGAATATTTGACCAAGAAAGCCCATACTAGGGAGAAATGCCACCCTGACCTCATTCCAGTACTGACTATAGGAAAAATTGTAGGATCCGCAGCTCTAGGAGCAGCAGCATTAGGTATACAGGACTCCAACTTTAAGACCCTAACTCAAGAAGTAAGGATAGACTTGGGTCTGATCACTAAATCAGTATCTCACCTAAAAAAAAAAAGTGGATTCCTTGGCGGAAATGGTCCTCCAGAACTGCTGAGGTCTCGACCTCCTGTACATGAAGGAGGACGGGCTGTGTACAGCCTTGGGAGAACAGTGCTGTTATTATGTCAATAAATCAGGGGTTATTCGAGATACCTTGGCTACAGTAAACAAACATTTACAAGAGAAGTATTACAGGTTAAAAAATAATTCTGGGTGGTATCAGTCTTTGTTTAACTGGTCTCCCTGGTTGACTACCCTTGTGTCCACCCTGGCAGGACCCTTGATGATCCTGTTGCTGGCACTAACCTTCGGGCCATGAATTATCAACAAGCTCATGGCCTATACGTGGGCCCAAGTAGGGTCCGTTCACCTCATGGTTCTAAATCAACAAGCCAGTTATAACACATTGCTGCTAAAAAAACAAAAAGAAAACAGTGTGTAGGATTACTTGCTTGGATAAAATCAGTGGGGAATGTAAGACCTGGATAAGATTTAGCATAAGTAGAGCCATTTTGTTGTAAAACCTCCATTTTGTCCCCATGAGTTTCGGGTTCACTGAAAGGACACAGAGTTCCCGGAATGTACTTGTTTATCTGTTAAGAAATCATGAAATGTACCAATGCTTGCTGTGTAAAGAACATCCTGCTAGTTGAATAAAGAAATCTGGAAACTCCCCTAA

XR_205077.1 Non-coding sequence

Kcnq2 PREDICTED: Heterocephalus glaber potassium voltage-gated channel, KQT-like subfamily, member 2 (Kcnq2), transcript variant X18, misc_RNA.

Length: 2903 bp     
>XR_205077.1
GTCCGCTGAGCCCGCGCCCGGCCAGGCGCTGCCCGGCACCATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGGTCAGTCCCTCCTGCCTCCAGCTGCTTTGGTGTGTCTGCCTTGTGGACACCCTTCGGTCCTGCTCCTCTGTGTGCCCACTGCGAGTCGTGGGGTGAGGGCTGCTATGCGGGCCCCGTGCGTGCTTCCGTGTGTGCGCGTGTGCCTGTGTTCACAGCCTCCTCCCAGGGCTTTGGGCTCACTGGGCAGCACTGCCGGTTGGGCCGCTGGGGGCTTCGTGGGTGGGCCCCTCTGCCCGTACCTCCAACCTCCCCGGAGACGCTGAGGCTGGAGAGTTCCCGCACAGGACCTGGGTTTACAGCTAGTCTGAGTGGAGCCCCCCTCCGGCCATTCGGGGCTGGGCCAGGAGGGCCCTCAGTCTCTGGGTCACCTGTCCTGGGTGTCGGACGCCCTCTCCCCATCTCATAGGCCCCGGTGGGGCCTGACTTCACTCTGTTCCCTCTGCTGAGGTTGAGGCAGCCTGAGGGCATCCAGGGGCTTCAGCTGGGTCCTCTCCCTGCTCTCTGCTGGCCCCAGGAGGCTGTGTGTTCAGGCAAGTTAGAAGGCTCATGGGGCCAGCTCTGCTTTGGGACGGAAGGGCAGGAGCCAGCTGCTGCTTTCCTAGTGATGAAAAGAAAATCCAACTCATTTCACAAACGTCAGGCTGAATGAGCTCCAGCCACTGTGCATCCTTGCTGAGTTCTCAAGCTCCTCTGAGTGAGGGTCTCCCGGTCCAGTGCCTGTGCATTTGCTGCAGAGTAAACCTGAACCGGTCTGAGTTAGACATCTGACCGTCTCCCTCATGCCCTTCTGGACTATAGGGTGACCCAGCTAGCAGGTGGGGTCCGTTCAAGAAGGACTTGATCCTTCACCCGTCAAATCCACGAAAGGGTAATAATAGCCAGAGCCCTGAATTGAAAGTATCAGCAACGTCTCTGCCCCAAATCAGCTGAAGGAACAACCACTGACTGAAAACTCCTCAAAGAGGATAAGAAAACTAATTGTGGAGCTTTGGAGAGGTCATCCCAGTGCTGGCCAGTGTGCGACCTAGTGTCGCCGGTGACCAGATGAGGAAAGGAGAGAGCCAGCCCCACCTGGCCCTGGTGAAAGGGTGGGGTGCTCAGCCCCACGGTCAGGGGTTATCCGTAACGAGGGCACCCCATTTCTCACTGTCGCCATCTGTGTGGCTGCCCTCCCTGGCCCCAGTGCCCGGCAGTGGCCAGTGGAGCCCTGTGCCCCCTTGGCCAGGAATGCTGGTGCTGAGCGCCGATCTGCCCAGTGGGCCTGGGGTCCTGTCCACTGCATCTCCTGCCACCCAGCACCAGGCCCTCCTGTGAGCATTTGGCCCCAAGGCCCCTGGCCCCTTGCGGTTTCTCGGGCTTGTTGCCTTAGCTCAGCCTCCTCTTCGTGATTCTCTCTCAGCCTCTCTCTCTCTCCCTCTCCTGCCCCCATTAAGTGCTTTTAATCACTGTCACTGCCCTTCTCGGGCCCTTTCTCGTCTGCTCTGTCTTTTGGGATGAGGTGCTGACCCTGAAGGCAGGACTCGAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCCCCAGGCCCAGCCAGTCCGGCGGTCACCCAGCGCT

XR_205080.1 Non-coding sequence

Kcnq2 PREDICTED: Heterocephalus glaber potassium voltage-gated channel, KQT-like subfamily, member 2 (Kcnq2), transcript variant X21, misc_RNA.

Length: 2905 bp     
>XR_205080.1
GTCCGCTGAGCCCGCGCCCGGCCAGGCGCTGCCCGGCACCATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGACTCATCCCACCACTCAACCAGCTGGAGCTGTTGAGGAACCTCAAGAGCAAGTCTGGACTCACCTTCAGGAAGGAGCCTCAGCCGGAGCCGTCGCCCAGGTCAGTCCCTCCTGCCTCCAGCTGCTTTGGTGTGTCTGCCTTGTGGACACCCTTCGGTCCTGCTCCTCTGTGTGCCCACTGCGAGTCGTGGGGTGAGGGCTGCTATGCGGGCCCCGTGCGTGCTTCCGTGTGTGCGCGTGTGCCTGTGTTCACAGCCTCCTCCCAGGGCTTTGGGCTCACTGGGCAGCACTGCCGGTTGGGCCGCTGGGGGCTTCGTGGGTGGGCCCCTCTGCCCGTACCTCCAACCTCCCCGGAGACGCTGAGGCTGGAGAGTTCCCGCACAGGACCTGGGTTTACAGCTAGTCTGAGTGGAGCCCCCCTCCGGCCATTCGGGGCTGGGCCAGGAGGGCCCTCAGTCTCTGGGTCACCTGTCCTGGGTGTCGGACGCCCTCTCCCCATCTCATAGGCCCCGGTGGGGCCTGACTTCACTCTGTTCCCTCTGCTGAGGTTGAGGCAGCCTGAGGGCATCCAGGGGCTTCAGCTGGGTCCTCTCCCTGCTCTCTGCTGGCCCCAGGAGGCTGTGTGTTCAGGCAAGTTAGAAGGCTCATGGGGCCAGCTCTGCTTTGGGACGGAAGGGCAGGAGCCAGCTGCTGCTTTCCTAGTGATGAAAAGAAAATCCAACTCATTTCACAAACGTCAGGCTGAATGAGCTCCAGCCACTGTGCATCCTTGCTGAGTTCTCAAGCTCCTCTGAGTGAGGGTCTCCCGGTCCAGTGCCTGTGCATTTGCTGCAGAGTAAACCTGAACCGGTCTGAGTTAGACATCTGACCGTCTCCCTCATGCCCTTCTGGACTATAGGGTGACCCAGCTAGCAGGTGGGGTCCGTTCAAGAAGGACTTGATCCTTCACCCGTCAAATCCACGAAAGGGTAATAATAGCCAGAGCCCTGAATTGAAAGTATCAGCAACGTCTCTGCCCCAAATCAGCTGAAGGAACAACCACTGACTGAAAACTCCTCAAAGAGGATAAGAAAACTAATTGTGGAGCTTTGGAGAGGTCATCCCAGTGCTGGCCAGTGTGCGACCTAGTGTCGCCGGTGACCAGATGAGGAAAGGAGAGAGCCAGCCCCACCTGGCCCTGGTGAAAGGGTGGGGTGCTCAGCCCCACGGTCAGGGGTTATCCGTAACGAGGGCACCCCATTTCTCACTGTCGCCATCTGTGTGGCTGCCCTCCCTGGCCCCAGTGCCCGGCAGTGGCCAGTGGAGCCCTGTGCCCCCTTGGCCAGGAATGCTGGTGCTGAGCGCCGATCTGCCCAGTGGGCCTGGGGTCCTGTCCACTGCATCTCCTGCCACCCAGCACCAGGCCCTCCTGTGAGCATTTGGCCCCAAGGCCCCTGGCCCCTTGCGGTTTCTCGGGCTTGTTGCCTTAGCTCAGCCTCCTCTTCGTGATTCTCTCTCAGCCTCTCTCTCTCTCCCTCTCCTGCCCCCATTAAGTGCTTTTAATCACTGTCACTGCCCTTCTCGGGCCCTTTCTCGTCTGCTCTGTCTTTTGGGATGAGGTGCTGACCCTGAAGGCAGGACTCGAGTCAGAAGGTCAGTTTGAAAGACCGTGTCTTCTCCAGCCCCCGAGGCGTGGCTGCCAAGGGGAAGGGGTCTCC

XR_205082.1 Non-coding sequence

Kcnq2 PREDICTED: Heterocephalus glaber potassium voltage-gated channel, KQT-like subfamily, member 2 (Kcnq2), transcript variant X23, misc_RNA.

Length: 2251 bp     
>XR_205082.1
GTCCGCTGAGCCCGCGCCCGGCCAGGCGCTGCCCGGCACCATGGTGCAGAAGTCGCGCAACGGCGGGGTGTACCCCGGCCCGAGCGGGGAGAAGAAGCTCAAGGTGGGGTTCGTGGGGCTGGACCCCGGCGCGCCCGACTCCACCCGGGACGGCGCGCTGCTCATCGCCGGCTCCGAGGCCCCCAAGCGCGGCAGCATCCTGAGTAAGCCGCGCGCGGGCAGCGCTGGCGCCGGGAAGCCCCCCAAGCGCAACGCCTTCTACCGCAAGCTGCAGAATTTCCTCTACAACGTGCTGGAGCGGCCCCGCGGCTGGGCGTTCATCTACCACGCCTACGTGTTCCTCTTGGTCTTCTCCTGCCTCGTGCTGTCTGTGTTTTCCACCATCAAGGAGTACGAGAAGAGCTCGGAGGGAGCCCTCTACATCCTGGAAATCGTGACCATCGTGGTGTTTGGCGTGGAGTACTTTGTCCGGATCTGGGCTGCAGGCTGCTGCTGCCGGTACCGTGGCTGGAGAGGACGCCTGAAGTTTGCCCGGAAGCCATTCTGTGTGATCGACATCATGGTGCTCATCGCTTCCATTGCGGTGCTGGCGGCTGGCTCCCAGGGCAATGTCTTTGCCACGTCTGCACTCCGAAGCCTGCGGTTCCTGCAGATCCTGCGGATGATCCGCATGGACCGGAGGGGGGGCACCTGGAAGCTGCTGGGCTCTGTGGTCTACGCCCACAGCAAGGAGCTGGTCACTGCCTGGTACATTGGCTTCCTCTGCCTCATTCTGGCCTCGTTTCTGGTGTACTTGGCAGAGAAGGGAGAGAATGACCATTTCGACACCTACGCAGATGCACTGTGGTGGGGCCTGATCACCCTGACGACCATTGGCTACGGGGACAAGTACCCCCAGACCTGGAACGGGAGGCTCCTGGCGGCAACATTCACCCTCATTGGTGTCTCCTTCTTCGCTCTTCCTGCGGGCATTTTGGGGTCTGGTTTTGCCCTGAAAGTCCAAGAGCAGCATCGGCAGAAGCACTTCGAGAAGAGGCGGAACCCAGCAGCGGGTCTGATCCAGAGCTGTGCTCTCCCTCCGCAGTCCGCCTGGAGGTTCTACGCCACCAACCTGTCGCGCACGGACCTGCACTCCACCTGGCAGTACTACGAGCGCACGGTCACGGTGCCCATGTACAGCTCACAAACTCAAACCTACGGGGCATCCAGGTAGGAAATGCATGGGACAGAAAGCCGTGTGTGTGGTTCTCGTACTGTCTGGGTCACTCCGGGGCTAGCTCTCGAGCCCCGCTGCCCACAGAGACGGCCCGTCCCAGTGGTCCTTGTGCTGGCCAGTGTCAGGCCTGTCTCCCTGTGGCCCTTCCCTGCCTGGAGCCCCTGCCAACTGCCCCTCTCCCTGGACCCGGAGCAACCTTCCTTGCCCCCTTGTCGCTCGCCTCCTCAGCCACTGTCCCTTATTGTCAGCCCGCTTGTCCTCGGGTCACTCCTGTTCCTTGTCCTGCTTTGTGTCTGTCTGCAACTGCAGTCCCCACCTGTGTCTGCCCCAGCCCCCAGACCCGTTCAGGAACAGAGCGGAGTAGGGTGTGGGGTCACCGTGTTGCTTGGGGCTGTGGCCCGGGCCAAGGGATCATCCCAGAATCTGCAGGCCATGGGCCCCTGTTCGGCACCTGCCTCTGGCGTCCCTCTCCCTGCCCCTCGGCCCATTGCCTTGTGATACTGGTCCAGGCCCTGGAGAGCTACATGTGGCCTCCTGGCTAAGGTTCTTTCCTCAGATGGGGCTGCTGAGCCCCTCAGAACGTCTCGCCTTGTGCACAGTGCAGGGGCCCTTCCCTGAGGGGCATGTGGGCCTGTGCAGGACAGTAGCAAGTCCCAGCTGTGCCCAGTGAGCTGTGGTCCCTTCCCGCAAGCAGTGCCCACCCTGCCACACTGTGAGGAGGTTGAGCCTCCCTGGGCCAGGCCACTGTGCTGGACAGCGCAGGTCAGGCCAGGCATCTCTACCCCACATGCTCCCTGCAGACCTCAGAGCCAGCACTACACCCAGAAATAAGATACCCCAACATTTGTCGGGCACCCCGGCCTGGGGCTGGAGCTGTGCCCTGAGGCTAGTGGAACCCCCAAACCATCGGGCTCCTTCCTGCGGCTCCCCAGCCCCCTCCCCTCAGCCTGCTGCACCCTTGTCTGCTGTAAGTGGCGGGGCCCAAGCTGTGTGGCCAGCCTGCTCAGCGCTGCTCCGTGTGTCCCAGGCATGCCG

XR_205083.1 Non-coding sequence

LOC101712924 PREDICTED: Heterocephalus glaber uncharacterized LOC101712924 (LOC101712924), misc_RNA.

Length: 2787 bp     
>XR_205083.1
TGAGCTGTCACTCAGCTCCTCCCACACCCAGAACCCTTCCTTCCCCAGCTGTTGGGGAGCAGAGTCCAGCTCCTCCACTGGAGTGTCTGGCTCCCCAGGGCTCAGCCTCTGACTCAGCCCACAGCTGCCCTTCTGGGGAATTGCTCCCCACCCACAGCACAGCAGGCCAGGGCTTTCCTCCTGCAGAGGACCCCCTGGACAGCACACACAGCCCAGGAAGAAGAGAGGGGGCAACTGGCTGTCAGCATTGCCTCTGTGTAACTGCAGTGACCTCTTCATGGCATCAGAGATGTGGCCTCCCAGTGCAGTGGAGTCTTGGCCCGGGCACCTGCTGGGAACCAGGGCCTTGTAATATATGTTCTCAAAGTCCTGATGGGAGGTTCAGCTGTTGCCCTAGCTATGATTGGTAAAGGGATAATTTCTGCTTCAGGAGCTGGAGCTAACACTGACCTCAATATGACCATGAAAGACACAAGAGGTCTCCTCCAAAGGCCCATAAACAGAGCTAAGGGTTCTACAAGCAGCTTTCACTGGAGCTACAGGGGTTCTACTTGTCCAGGTTCCTGTCCCACTGCTGGCCTCCTGGACCTCCAGCCTCAGCTCAGCCTGGGCAGTCCTGCTGCTCCTCTCCCAAAGAGAAGATGGAGACTGAGACCAACAGCTAGGTCCCCCCTGGCCCTGTGCTGTGTGTGTGGCTCCCACTAACCACCTTGTGTGTTTCCCTGCCTTGAGCCCTGGAGATACAAATATATGTAGCTAATCACCTCTTTTCAGTCACTCATTCATTTAACAAATTATACATTTGATACATACATATGAAGCATTTGTTCATCATGTTAGGTCTTCCACCATGGCAGGACATGGGGAATGTTGTAAACATGACTTTGTCCTAGACCTCTAGGACCTTTCAGGCTCCCAAGAGCTTCAGCAGATGTATTCACTGGGTTTTCCTCATAGGCTATTTATGCAGAAAAGAGAGGTTTATGCCTCTCAGTTTGGGGAGTTCAAAGCTATGGCACCTCCATTGGCTAATATAGTGTAAAAACTACAATGAAAGCATGGGTTGCAGTTAAGGGCAAGGGGAGGGCTGGGAAGGAAAATAAAGCACGTTATTACATGCATGAATACAAGGAAAAAACCTCAATATTCCCTATCATGAATATGCACTAATAAATTTGTTGGCAGAGTTTCAGATTCCATGCTGCAAATATAAAGAAATGAACCCTGGAATCTGTGCGTTGAGCTTCTCAGTAAAGATGAGGGGCCGTTTGGGCAGTGGTGAGTGGTGATTTCAGTTGTCTGAACTGGGGAGACAGGGCGGTGCCCCTGAGCCTCAATGTGCACCTGTTAGGCGTTTGCCAGGACACTGCTGGACCTGTATGGTGTGATGTTCTGGAGTGTAGGTAACCACGGCAGCACCCACAGGTGGCACCTGGATAGTTCTGTTCACAGACACAGATGGAAGCCTTGCAGTTTTGGGGCTCTCCTGGGGAGCCAGTGTGGACAGGGGCAGTTTAGGTCCAGGTGGGGGCTGTGTTTGCATGACAGTGTGAATTTGAAGTAGAAAACTGTACATTTGAAAATGGTTGGGATGGTTGTGCTTATTTTATTACAATGAAATATAATAAACAATTTACTATTTTTTTAAAAGAACACCCAGGTCTAGGAAGCATCACCAAGTTTTAAAACCCCCAGGTGCCCCCTCTCCCTGTTCCTACAGGAGGCTACAACCCCCACTGTGATACTGATTACTACCTTGTCTCTATATTCCAGTCACATATCTGCATATCAGTGCTCCTAAACAAAAGGGAAGAGTTATCAGGGTTACTCAGGCTCCAAGTTCATCCTGGGTCCTGGTGGCCCTGGCAGGGCACAGGCTCCTGGGTGGGGCACCTTGCCCACACTGCTGCAGTCTTGAACAGCATGGAAGATAGACCTGGGAGAGAAGTGCGTACATCTGTGTGAGGTCACACGGGCTGTGTATAGAGCAAACAGGAAATTCTGGCAGGTGAGACGATCACAAGTTCTAGGCCCACCTGGATGACCCATGGAAGAAGAGCGAGGTGGGGGAAAGGTGTATAACTCATGGTGGCCAGGAAGCTGACTGAGGGCAAGGTGCCGGAGAGGAAGGGGACAGGGACCAGACCTGCCTGTACCTGAGGCCTCTGTAACTCACCCAGAAGTGTGCTCCACCAGTCTCCAGGGTGGGTCCTAAAGCCAATCAAGCTGACACAGTGGGGTTTAACTGTCACACGGACATAGATATTCTCACCCCACTAACAGATGAGGAAATGGACTCTGAGGGAGCCCTTCTCAGAAACACACTCACTGCTCAGTGGACAAGAGACTGACTCCCAGCCTCCTGACACACAGCCCAGCACTTTCTCCTATCGCAGGGTGCTTGCCCACAGTTTCTCTTCTCCCTGAATGGCTCCAACCCCATTGATGAGCCCCAGGCAGGAAAAGGCAAAGACAGCACTTTGCTGATTGGCGGCAGCCTGTGCTGGGCCTCCTTCCTGGGAGAGCATGGGGTAGGGATCCTGGGGAGATGTACTTCCCTCCATAAGCAGGAGAACCTAGAGTGTTTTATAATAAAAAGAAAAATGAACAAAGGTCCCATTTAAGAATCTATTGCCCTTCTCTCTTTCACTCATCTTTTACTGGCCATAAGTGTATAGTGTTAATTAATAGGACAAAGGTATTTAGAGTAGCTTAGAATGTTAAAGAAAATATCATTATAGCTTTCATAAGGAAATGCACTAAATGATACCCCCGAGGGAAAATTCT

XM_004840939.1 Coding sequence

Vapb VAMP (vesicle-associated membrane protein)-associated protein B and C, transcript variant X1

High confidence: 1 potential gene match
Length: 732 bp    Location: 24716771..24766480   Strand: +
>XM_004840939.1
ATGGCGAAGGTGGAGCAGGTTCTGAGCCTCGAGCCGCAGCACGAGCTCAAGTTCCGAGGTCCCTTCACTGATGTCGTTACCGCCAACCTGAAGCTTGGCAACCCAACAGATCGAAATGTGTGTTTTAAAGTGAAGACCACAGCACCTCGTAGGTATTGCGTTCGGCCCAACAGTGGAATCATTGACGCTGGGGCCTCAATCAATGTATCTGTGATGTTACAGCCTTTCGATTATGATCCCAATGAGAAAAGTAAACACAAGTTTATGGTTCAGTCTATGTTTGCTCCAACTGACACTTCTGATATGGAAGCAGTATGGAAGGAGGCAAAACCGGAAGACCTTATGGATTCAAAACTTAGATGTGTGTTTGAATTGCCAGCAGAAAATGATAAACCACATGATGTAGAAATAAATAAAATTATATCTACAACTGCATCAAAGACAGAAACACCATCAGTGTCTAAATCTCTGACTTCGTCTCTGGATGACACTGAAGTTAAGAAAGTGATGGAAGAGTGTAAGAGGCTGCAAGGAGAAGTCCAGAGGCTTCGGGAGGAGAACAAGCAGTTTAAGGAAGAAGATGGGCTTCGGATGAGGAAGACAGTACAGAGCCACAGCCCCATTGCAGCACTTGCTGCAACTGGGAAGGAGGAAGGCCTCAGCACTCGGCTACTGGCTCTGGTGGTTTTGTTCTTTATTGTTGGTGTCATTATAGGGAAGATTGCCTTGTAA

XM_004921066.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 699 bp    Location: 28937836..28942319   Strand: +
>XM_004921066.1
ATGGTGTGTGGCTCTCGGGCAGTGGAGCTGCCAGGAGGATGTGCCCAGGAGAAGGGAGTCTTCCCCTACCTCAGTGGGCTGGCCCTCATCACCATGGGGCCTCAGCATGGGGCGCTGTCACCCACCCAGCTGGCTCTCACCACACCCTCCACCCCGCCCCGGCAGGACCAAGTGCTTGTGCTGTGTGGCCCAGAGCCGGGCCACGGGGCAGCCAGCCATGAGCCTGTGCAGGAGCCGCGTGGGCACCCCTGTCTGTGCTGCCGTGTCCTGCACCAGGACTGTGTGGACGGGCAGACCCTGGGCCAGCTGCACCCCCTGACAGAGGAGGCTGCAGAGGAGGAGACAGGAGCCACCTCACTTGCAAGGCCCTCTCTCCCTGGCATGGGCTCTGAGGAGCTGCTGCTGGCCTCCTTCTGCAACTGGCCCCTGACTGCCGGGGTTCAGCTTGAGCTACTGGCCGCTGCTGGCTTCTTCCACACAGGTCAGCAGGACAGGGTGAGGTGCCTCTTCTGCTATGGGGCCCTGCAGAGCTGGGAGCATGGGGACGATCCCNGGACCGAGCATACCAGGTGGTTCCCCAGGTGCCAATTCCTGCTGCGGTCCAAAGGAAGGAGCTTCGTCCACCGTGTCCAAGAAGCCTGTCACCCTCTGCTCAGCTCCTGGGTGAGCCGTCTCTCCTGGGGCTCTGGTGGACAGTGA

XM_004841160.1 Coding sequence

Cst11 cystatin 11

High confidence: 4 potential gene matches
Length: 465 bp    Location: 23106333..23104474   Strand: -
>XM_004841160.1
ATGGCTTGGCCCTGGCAGGCCCTGCAGCTCCCACTGGCCATTCTGGTGGTGCTTGTGGCCTTCAGTGACCAATTCAGGAGGAGAACCTTCATCAGCATGAATGAGGAGACAGCAGTGAGCCAGTTGGTGCCCCAGACCTTGTACTACCTCAATGACCAGTACAACCAGGAGAGTGAGGACACATACAGCTTGCGGATATTTCGGGTGCTCCGGGTACAGAGGCGGGTGACCGACCACCTGGAATATCGCATCCAGGTGGAGATGTGGAGAACCAGGTGCCTGAAGCCAAAGTTCAGCAACTGTGCCCCTCAGGAGGGGGTGCAGTACAAGCAAATAGAATGCTACTTCTCCGTGTATGTGAACCCCTGGGCTGAAAAGTACAAGATCTTGAAGAAGTACTGCGAGGACAGCAACTTCCCTGTGGCTGCTTCCAGGGAGGATCCCAGAACCCCCAGTGCACAGTAA

XM_004841089.1 Coding sequence

Zgpat zinc finger, CCCH-type with G patch domain, transcript variant X1

High confidence: 3 potential gene matches
Length: 1530 bp    Location: 29355915..29390539   Strand: +
>XM_004841089.1
ATGGACGAAGACAGCCTAGAGACGGCCCTCCAGACCTACCGTGGCCAGCTGCGGCAGGTGGAACTGGCCCTGGGTGCGGGCCTGGATGCCTCCGAGCAGGCGGACTTGCGCCAGCTGCAGGGCGACTTGAAGGAGCTGATCGAGCTCACCGAGGCCAGCCTGGTGTCTGTCAGGAAGAGCAAGCTGCTGGCCACGCTGGACCAAGAGTGCCCACCCCAGGAGGACGCCGAATACCTGGAGTTCCAGAAGGCCATTGCTGAGGTCCCGGAGGTGCCCACCACTCCCAGGGCAGACCTAGAGACCGGCCATGAGAGAGAGGCAGGACCAGAACCTACTGAACCTGGGCGGGAAGAGGAGGGAGAGGAGGAAGAACTGAACGGAGCGAAGGTGAACGCCCCCTACTACAGTGCATGGGGCACCTTGGAGTATCACAATGCCATGGTGGTGGGCACCGAGGAGACAGAGGATGGAACGGCCTGCGTCCGCGTGCTCTACCTGTACCCCACTCACAAGTCTCTGAAGCCGTGCCCATTCTTCCTAGAGGGAAAGTGCCGCTTCAAGGAGAACTGCCGATTCTCCCATGGGCAGGTGGTCTCTGTCGATGAGCTGCGCCCTTTCCAGGACCCAGACCTGAGCTTGCTGCAGGCCGGCTCTCCATGTCTGGCCAAGCACCACGATGGCCTCTGGCACCCGGCGCGAATCACTGATGTGGACAATGGCTACTACACAGTCAAATTTGACTCCCTGCTGCTGAAAGAGGCCGTGGTGGAGGGGGACAGCATCCTGCCCCCACTTCGGACAGAGGCTGAAGAGTCCTCTGACTCAGACAGTGGCGATCTGGGTGACTCCAGCTATGCCAGAGTAGTGGAATCAGGCCCTGTGGATACTGGGACCAGTAGTTCCGCCTTCGCTGGCTGGGAGGTGCACACACGTGGCATTGGATCTAGGCTCCTCGCCAGAATGGGCTATGAGTTTGGCAAAGGTCTGGGCCGACATGCAGAAGGCCGGGTGGAGCCCATCCATGCTGTGGTGTTGCCTCGAGGAAAGTCTCTAGACCAATGCGCAGAGACTCTGCAAAAGAGGACCAAGGAAGGGCAGGATGGTGCCAGTAGGCCCCCAAGGTGCCGGAGGAGGAAGGGTAGGCCTGCGGGCCACCTGCCCCCGAGGAATGTATTTGACTTCCTGAATGAAAAGCTGCAAAGCCAGGCTCCTAGGGACCTGGAGGCTGGGGTGGATCTCCCCAGAGGAAAGAAAACCAAGGACATGTACCACGCCAGCAAGAGTGCCAAGCAGGCCCTGAACCTGCAGCTCTTCCAGACTGAGGAAAAGATTGAGCGGACCCAGCGAGACATCCGGGGCATCCAGGAGGCCCTCACTCGGAATGCTGGCCGGCACAGTGTGGCAGCAGCCCAGCTGGAGGAGAAGCTGGCGGGAGCCCAGCGGCAGCTGGGGCAGCTCCGGGCCCAGGAGGCAGGCTTGCAGCGGGAGCAGCGGAAGGCAGACACCCACAGGAAGATGACAGAATTCTAG

XM_004841028.1 Coding sequence

Dido1 death inducer-obliterator 1, transcript variant X1

High confidence: 3 potential gene matches
Length: 6780 bp    Location: 28680849..28646938   Strand: -
>XM_004841028.1
ATGCACATAAGGAGTTGCCTCAGTGGTCTGCGGCTCATGCTGGGATTGCCTTTTACTCTAGGTATGGATGATCCTGGGGACCAGAGCAATGAGGAAGCACCTAAAGCTATTAAGCCCACAAGTAAAGAGTTCAGGAAGACTTGGGGGTTCCGGAGAACAACAATTGCTAAGCGAGAGGGTGCTGGCGACACTGAGGTAGACCCTGTGGAGCAGCAGCCACACAGCCTCTCCCTGCGCCGCAGTGGGAGGCAGCCAAAGCGCACTGAGAGGGTAGAAGAGTTCCTGACCACAGTTCGACGCCGAGGAAGAAAGAATGTGCCTGTTTCCCTTGAGGATTCCGGCGAGGCAGCATCCTGTCCAGTCACAGATGTGGAAAGTGCCTCGGAAGGTAGTGTTGAGAGCAGCTCTGAGATAAAGAGTGTTCCTGCATCTCGTTCCAAGCGGGGGAAGGAACGCCCCACCTCTTCTGAAAAGGCCAAAGGAGGGGATGAGCAGGAAGACACCTCTGACAGTGACAGTGATGGGCTCACTTTGAAAGAACTTCAGAATCGTCTTCGAAGAAAACGAGAACAAGAACCAGCAGAGAGGCCCCTGAAGGGCATCCTGAGTCGCCTGAGGAAGAAACGGCGAGAAGAGGACTCAAGTGATACCGTGGAGGTTGAGGTGGCCAGAGCTGGCCACGATGTGCCACCCTGTAAGCAAGAGTCTGAGGCTGGTGAGGGAGCTGTGAACCAGGCAGCAGAAGATGACAGAGAGGGTGAATCAGAGGGGACAGTGGCTCAGGAACCTAAAGATGAAGACCCTGGGGACATGGGCAAACCTAAACCTGATTGTGAGGTTTATGACCCCAATGCCCTGTACTGCATCTGCCGCCAGCCTCACAATAACAGGTTTATGATCTGTTGTGACCGCTGTGAGGAGTGGTTCCATGGCGACTGCGTGGGAATTTCTGAGGCTCGAGGGCGTCTCTTGGAGAGGAATGGGGAAGATTACATCTGCCCAAACTGTACCATTCTGCAAGTGCAGGAGGATACGAATGCAGAAGCCACTGATGAGCAGGAAACTAGATACAGACCTGCAAGTGTGGACGGCACAGACTGCACCAGCATAGGGACAGTAGAGCAAAAGTCTAGTGAAGATCAGGGGATCAAGGGTAGAATTGAGAAAGCCGCAAACCCCAGTGGCAAGAAAAAACTCAAGATATTCCAGCCTGTCCTGGAAACACCTAGCGCCTCAAGGTGCATCGGTCCTGGGTGCTCCAGTGTGGCACAGCCTGAATCGGTGTACTGCAGTAATGACTGCATTCTCAAACATGCAGCAGCTACTATGAGAAATCTAAATTCAGGTAAAGAACAAAAACCAAAGCCTAAGGAGAAAGTCAAGATGAAGCCAGAAAAACTCAGTCTTCCAAAATGTAGTGTTCAGGCAGGGATTAAAATCTCTATACACAAGAAGCCTGCTCCAGAGAGAAAAGAAAATGCGGCGAAGAAAGTGATGGTGACTCCTCCTAGGAGTGACACAGTGGGGAAGGAGGCAGCCTGTGAGAGCAGCACACCCTCCTGGGCCAGCGACCACAACTACAATGCAGTGAAGCCAGAGAATACTGCTGCACTCTCCCCACCACGGTTCTGTAAATCCGTGAAGGACGACAGGAGAGTGGAGGACAGAGCGGTGGGAGCAGCCACAGGCCCGAAGAAAACAGCCCTTCCAGGCTCCTCGGTGGGCAGGCAGCCTTCGTCCAGAACTCTTGTTCCAAAGAAGCTGCCTCCTTTCACTAACATGGCAGGAGCCAAACCAGCTGTTAAAAAATCACCATCAGGATTCAGGGGCCCCATCCCCAAGAGGCCCTGGCTCTTGCCTGCCCCATCAGGTGCCTCAGCTGCCAGGCAAGCTGGACCAATTCCTGTTGCTATGGTCGCTGCTTCCAAAAAGGCACTGGGCTCTGCTGCTTTGGTCGGATCCATAAGGAAGCCAGCGGCAACTTCTGCCCCCACAACTGTTCCAGCCACAGGACGCCTCGGGGGCACAGGCTCGGCCCAGTCACAACCAAATTCACAAATACGGCAAAATATAAGACGCTCCTTGAAAGAGATTTTATGGAAAAGAGTCAATGACAGTGATGACTTAATCATGACGGAAAATGAAGTGGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTTCAAGTAACAGATAATCGCTACAAGAGTAAATACCGCAGTATCATGTTCAACCTCAAGGATCCTAAAAATCAGGGACTCTTCCATCGAGTTCTGCGTGAAGAAATTTCTTTGGCAAAACTTGTGAGAATGAAGCCAGAAGAACTTGTGTCTAAAGAACTTTCTATGTGGAAAGAGAAGCCAACGAAACCTGTAATGGAGTCCAGAAGTAAACTGCAGAATGAAAGCAAGAAGGCTGCCATGAAGCCAGAAACCATTCCTGACATGGAGGACTCTCCACCTGTGTCAGACTCAGATGAGCAGCAGGAATCCGTACGAGCTGCCCCTGAGAAAAGCACAGCCCCCCTTCTCGATGTGTTCAGCAGCATGTTGGAAGACACAACGAGTCAGCACCGGGCCCATCTTTTTGATCTAAACTGTAAAATTTGTACAGGTCAAGTTCTGTCAGAAGATGAACCAGCTCCTAAAAAACAAAAATTATCAACTTCTGTTAAGAAAGAAGACCTAAAGCCCAAGCCCGACAGCTCTCTACCTGATCCAGTTCCTCACTTGTCTGAGGAAGGCTCTGCAGAGATTCTGCCAGAAAATGCCTCGGAGCCAGACCTGGAAAGGGCGTCTGGTCCAACGCCAGAGGGAAAGTGTGTCCCTGGGCCTCCAGAGGACAGCCATCCAGGGCCCTCCCTGACAGAAAGCTCTTCTCCCTGTCCAGCTTCCTGCGGGGCTGGGGTGGTCACCACGGTCACGGTGTCAGGCCGAGACCCCAGGACTGCTGTGGGCGGGTCCTGTGCCCACCCGGACAGCACCCACATGCCTGAAGCCAAGCCAGACCTGCTAAAGCCCACACTGCCCTCTGTGACACTGCCCAAGTCCATACTTGCTAAGCCGTCCTCGTCTTCTGACCCCAGGCATCTGTCAGTTCCACCATCACCAAGTGTCAGTGCCTCAGAGACACGATCTCCCCCAGAAGGAGACACGACTCTCTTTTTGTCTCGCCTCAACACCATTTGGAAAGGATTTATTAACATGCAGAGTGTAGCCAAATTTGTCACTAAGGCATATCCCGTCTCTGGGTGTTTCGATTATCTCAGTGAGGACTTGCCGGATACGATCCACATCGGTGGGAGGATTGCTCCGAAGACAGTGTGGGATTATGTCGGCAAGCTCAAGTCTTCCGTGTCTAAGGAGCTCTGTCTGATTCGTTTCCACCCGGCAACAGAGGAGGAAGAGGTTGCCTACATTTCTCTCTACTCCTATTTTAGCAGCCGTGGCCGCTTTGGGGTTGTAGCTAATAACAACAGGCATGTGAAGGACCTCTACTTGATCCCACTGAGTGCTAAGGACCCTGTGCCACCTAAACTCTTGCCCTTTGAGGGACCAGGTCTTGAGTCTCCACGTCCAAATATAATCCTTGGGTTAGTGATCTGTCAGAAAATAAAACGTCCTTCAAATGCTGGAGAGGCAGACAAGACAGAGGAGAAGCGGGCCCGAGTTCAACAGGAAGAAATGGATGTTCCAGTCTATCCCAAAGTCACGGCAGCCTCACAGTCTGAGAGGAAGCCCCCCAAGTACCAGCTATACTCTGCAGACGCAGTGGTGGGCACCACGCCCCCTGGGTCTCCTCCACCCCCGCCCCCTCTCCCTGAGCCCCCAGTGCTGAAGACGCTGTCATCACTCACACCGGCAGCCACCAGCAGTGCTGCACCTGCCTCAGCAGCAGCAGTTACCACGGCAGCTCCCGCTTCACCTGTCACTTCATCAGCTTCCAAGACGGCCACCCCCTTGGAGCACATTCTGCAGACTCTCTTCGGAAAGAAGAAGGTGTTTGAACCCCGGGCCAGAGACTCTGCTGGGCCACCTCTAGCTCCTCAGCAGGATTCCAAAAACAAGGGTGAGGAAGGCGTGTCCGCTGCTCCTCTGTTAGATCCCATCGTTCAGCAGTTTGGTCAGCTCTCAAAAGATAAGGCTCTGGAAGAAGAGGAAGATGACAGGCCCTATGACCCTGAAGAAGAATATGACCCAGAACGAGCCTTCGACGCCCCACTTCCTGAGACAAGGACGTCCCACGATGTGGAAAAGGCTCCAGACGCGGCTGAGAGGGAAGAGGTGGCCTATGACCCTGAAGATGAGACAATTTTAGAGGAAGCCAAGGTGACCATTGACGACCTGCCCAACAGGATGTGTGCAGACGTGAGAAGCAGCTCCACGGAGAAGCCTACAGAGTATACCACTGACGTCCCCACTCCCTCCTTGGTTGAACAGCAGAAAATGCTGGAGGAACTAAACAAACAAATTGAGGAGCAGAAGCGGCAGCTAGAGGAACAAGAAGAAGCTCTTAGGCAGCAGAGAGCTGCCGTGGGGGTTTCCATGGCACACTTCTCCGTTTCAGATGCATTGATGTCGCCACCTCCAAAGTCATCACTGGCTAAGGGAGAGCTGTTCCCCCAGGAGCAGCAGGCCCCAGACCAGAATCAGGGAGTCCCAGGGACAAACCAAAGCTCAGACTTGAGGCAGAATAGAGACCCTAGGCAGGCCAGACGCCTGGCGGAGAACAGCGAGAATGAGCCCCTCTCCAGGAGTCCGGCAGGCAGTGTTCCAGGAGTACAGGGTGCCCTGGCTACCAGGGAGGCTCCTTGTGGGGCCACAGCAGTCCAGGTGCCTGTAGCAGCCCCAGAATCAAAGCAGTTGACGGCTCCTTGGGGTGCAGGTGAAAAGGCTGCACTGATGTCCAAGCAGGATGGCCAGGGGTGTGAGCACCCTGGAAACCCCGCTCCGCAGCCCCTGGAGAACATTCATCCCCCAGCAGCCGGAGACAGCACAGCCAGACCTGCCCGGAGAGTGCTGCTGCCTACACCTCCGAGCACTGCCTTTCAGCCTGGCTTCACCCTGCACAATGATGTACAGAATTTTAATCCTGCTGGAGGAAGAGAGCCTTTCTCAGGCCTGGTATTTACATCTCAGGAAAAATCTCTTTGCCCACCTCTGTATGAGGACCCAAGAAACACTCAGTGTGCTGGAAAGAGTGACAGCCCAGCCAGTGGTGCAGAGGGTGACAGAGAGCCACTGTCCAGGCCTGGTGAAGGCACTGCCCTATACCCTCAGGCTGGGCAAAAGGGAGCCCTTCAGCCCCAGTTTCCAGGCCAGCGTGAATCCATTCCTCGCCCTTTTGGGATGTCTGGATTTCATGGCCCAAATTTCCCAGGACCCAGGGGACCAGTCCCTCCGTTTCCAGAAGATAATGTAGTTCCTAAGAGTGATGGGCCAAGAGCACCTCCACCTGCCAGATTCGGGCCCCAGAAGGCACCCATCCCTTCCTTATTCTTGGGGCAACATGGGCCGCCTTATGGAGACAATAGGGGTCCCTCTCCCTCTTACCTTGGGCCCAGAGCGGGAGCACCAGCCCAGTTTGAGGAACACAAAGATCCCCATGGGGAGAAAAGGGAATTCCAGGACACCCTGTACAGTGAGATGACAGGTCCCTCTGCCCAGTGTGAAGGACCAGAGCAGGCTCAGTTCATGGGAAACAGGGGCCCTTCACCTTTCCAGTTTGGAGGCCAAAGACGGCCTCTCCTGACTCAGCTAAAAGGTTCCCGAGGGGGACCCCCACCTGCCCAGTTTGGCGGCCAGAGAGGACCACCCCCTGGCCATTTTGTGGGCCCCCGGGGGCCCCATCCCAATCAGTTTGAAGGACCCAGAGGCCAAGCCCCAGGTTTCATGCCAGGGCCCCGGGGCCTTCAGCCTCAGCAGTTTGAAGAGCAGAGGGTAAACTCACCGCCTAGGTTTGCAGGTCAGAGGACACCAGCACCTATGCCATTTGGGGGACCAAGGGTCTCTGCGCCCTTTTCTGAAAAAAACGAGCAGACACCTCCCCGATTTCACTTTCCGGGCCCAGGCCCGTCACCTCAAGCAATGAAACCATCCCCCAGACCCCTCCTGGAGCTTCCAAGCCACCCCCCGCAGCACAGGAAGGACCGATGGGATGAAGCTGGCCCGGCCACAGCCCTGCCTCCTAGTGCTTCGTCTGGACAGGGCCCTGAGGCTGATGGACAGTGGGCTGTGGCAGCCGACTTCCGAGAGGGCAAAGGCCATGAGTACAGGAACCAGACTTTTGAAGGGAGGCAGAGAGAACGGTTTGAAGCCGGGCCCAAAGAAAAAGCACTGGAGGAGCCAGAAGTCCAAGAGCCAGAGAGTCGGCAGGGCCGGGCATTTGAGGACAGGAGGCGAGATCGAGACCGTGGCCGGAACTGGAGTCGAGAAAGAGACTGGGAGAGGAGCCGAGAGTGGGACAGACACAGAGAGAAAGACTGCAGCCGCGAGTGGGACAAGAACAACGAGAGGAACCCAAGCCGGGACAAAGAGCGACAGGCAGATCGGACCAAGGAGTGGGACCGAAGCCGGGAGAGAAGCAGAAATCGGGACCGAGACAGAAGGCGGGACCGGGATAGGTCCCGGAGCCGAGACCGTGACCGAGAGAGGGCCCGGGACAGAGAGCGAGCCGGAGAGCGCAAGGACCGCAGCAAGAGCAAAGAGAGCACCAGGGACTTGAAGCTGGAGGCCACGAAGCCCTCTGATCCGGGCAGCACCTCTGCTTAG

XM_004841006.1 Coding sequence

Adrm1 adhesion regulating molecule 1, transcript variant X2

High confidence: 3 potential gene matches
Length: 1224 bp    Location: 28151641..28156823   Strand: +
>XM_004841006.1
ATGACGACTTCAGGCGCTCTCTTCCCAAGCCTGGTGCCTGGCTCTCGGGGCTCCTCCAACAAGTATCTGGTAGAGTTCCGGGCGGGCAAAATGTCATTAAAAGGAACTACAGTCACCCCGGATAAACGGAAAGGGCTCGTGTACATCCAGCAAACGGACGACTCGCTCATTCACTTCTGCTGGAAAGATAGGACCTCTGGGACCGTGGAGGACGACCTGATTATATTCCCCGATGACTGTGAGTTCAAGCGTGTGCCTCAGTGCCCCAGTGGGAGGGTCTACGTGCTCAAGTTCAAGGCAGGGTCCAAGCGGCTCTTCTTTTGGATGCAGGAGCCCAAGACTGATCAGGACGAGGAGCACTGCCGGAAGGTCAACGAGTATCTGAACAACCCGCCGATGCCTGGGGCACTGGGGGCGAGTGGAAGTGGAGGCCACGAGCTCTCCGCACTGGGCGGTGAGGGCAGCCTGCAGAGCCTGCTGGGGAACATGAGTCACAGCCAGCTCATGCAGCTCATCGGACCGGCTGGCCTTGGAGGGCTGGGTGGGCTTGGGGCCCTGACTGGACCAGGCCTGGCCAGTTTACTGGGGAGCGGCGGGCCTCCGGCGAGCAGCTCTTCGTCCAGCTCCCGGAGCCAGTCGGCAGCGGTCACCCCATCCTCTACCACCTCTTCTGCCCGCGCCACCCCAGCCCCTTCTGCCCCAGCAGCTGCCTCAGCGACCAGCCCGAGTCCTGCGCCCAGTTCAGGTAACGGAACCAGCACGGCAGCCAGCCCAACCCAGCCCATCCAGCTGAGCGACCTCCAGAGCATCCTGGCCACTATGAATGTGCCAGCCGGGCCAGGAGGCGGCCAGCAAGTGGACCTGGCCAGTGTGCTGACGCCAGAGATCATGGCTCCCATCCTTGCCAACGCAGACGTCCAGGAGCGCCTGTTGCCCTACCTGCCATCGGGGGAGTCACTGCCCCAGACCGCAGACGAGATCCAGAACACGCTGACTTCCCCTCAGTTCCAGCAGGCCCTGGGCATGTTCAGTGCAGCCTTGGCTTCGGGGCAGCTGGGCCCCCTCATGTGCCAGTTCGGGCTGCCTGCAGAGGCGGTGGAGGCCGCCAACAAGGGCGATGTGGAAGCATTTGCCAAAGCTATGCAGAACAATGCCAAATCTGAGCAGAAAGAGGGCGATGCAAAAGACAAGAAAGACGAAGAAGAAGATATGAGTCTCGATTAA

XM_004840970.1 Coding sequence

Slmo2 slowmo homolog 2 (Drosophila), transcript variant X1

High confidence: 4 potential gene matches
Length: 585 bp    Location: 25335673..25324415   Strand: -
>XM_004840970.1
ATGAAGATCTGGACTTCGGAGCACGTATTTGACCACCCTTGGGAAACTGTCACAACAGCTGCGATGCAGAAATATCCAAACCCGATGAACCCCAGTGTGGTTGGAGTTGACGTGCTGGACAGACATATGGATCCCTCTGGAAAGCTGCACAGCCACAGACTTCTCAGCACAGAGTGGGGACTGCCTTCCATTGTGAAGTCTATTATTGGTGCAGCAAGAACCAAAACATATGTTCAAGAACATTCTGTAGTTGATCCTGTAGAGAAAACAATGGAACTTAAATCTACTAATATTTCATTTACAAATATGGTTTCAGTAGATGAGAGACTTATATACAAACCACATCCTCAAGACCCAGAAAAAACTGTTTTGACTCAGGAAGCCATAATCACGGTGAAAGGGGTCAGCCTCAGCAGTTACCTTGAAGGACTGATGGCAAGCACAATATCTTCCAATGCTAATAAAGGCCGAGAAGCAATGGAGTGGGTAATACATAAATTAAACGCTGAGATTGAAGAATTGGCAGCTTCAGCAAGAGGAAGCATAAGGACACCAATGGCTGCGGCCGCATTTGTAGAGAAATGA

XM_004840943.1 Coding sequence

Stx16 syntaxin 16, transcript variant X3

High confidence: 3 potential gene matches
Length: 981 bp    Location: 24951986..24977417   Strand: +
>XM_004840943.1
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGTTAGCCGAGCAAGTGAGTAGTCACACCACCTCCAGCCCTCTGCATTCACGTAGCATTGCTGCGGAGCTGGACGAGCTTGCCGATGACCGTATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGCAGAGCAGTACCAAAAGAAGAATCGGAAGATGCTTGTGATTTTAATGCTGTTTGTCATCATCATTATCCTCATTGTTGTCCTTGTCGGTGTGAAGTCTCGCTAG

XM_004840931.1 Coding sequence

Pmepa1 prostate transmembrane protein, androgen induced 1

High confidence: 4 potential gene matches
Length: 840 bp    Location: 24103956..24053947   Strand: -
>XM_004840931.1
ATGGGGGTCAACAGCACCGCCGCCGCCGCCGCCGCCGGGCAGCCCAATGTCTCCTGCACGTGCAACTGCAAGCGCTCTTTGTTCCAGAGCATGGAGATCACGGAGCTGGAGTTCGTGCAGATCATCGTCATCGTGGTGGTGATGATGGTCATGGTGGTGGTGATCACGTGCCTGCTGAGCCACTACAAGCTGTCGGCCCGCTCCTTCATCAGCCGGCACAGCCAGGGCCGGAGGAGGGACGACGGGCTCTCCTCTGAAGGATGCCTCTGGCCCTCAGAGAGCACGGTGTCAGGCGGCGGAATCCCCGAGCCACAGGTCTACACGGCACCACGGCCCGCTGACCGCCTGGCTGTGCCTGCCTTCGCCCCCCGGGACCGCTTCCACCGCTTCCAGCCCACCTACCCCTACCTGCAGCACGAGATCGACCTGCCACCCACCATCTCACTGTCCGATGGAGAGGAGCCCCCACCCTACCAGGGCCCCTGCACCCTCCAGCTGCGGGACCCTGAGCAGCAGCTGGAGCTGAACCGAGAGTCAGTGCGCGCACCGCCCAACCGAACCATCTTCGACAGTGACCTGATGGACAGCGCCATGCTGGGTGGCCCCTGTCCCCCCAGCAGTAACTCCGGCATCAGTGCCACGTGCTACGGCAGCGGCGGGCGCATGGAGGGGCCACCCCCCACCTACAGCGAGGTCATCGGCCACTACCCCGGCTCCTCCTTTCAGCACCAGCAAAGCAGCGGGCCGCCCTCCCTGCTGGAGGGGACCCGGCTCCACCACTCCCACATGGCACCCCTGGAGAGCAAAGAGAAGGAGAAACAGAAAGGACACCCCCTCTAG

XM_004840898.1 Coding sequence

Ralgapa2 Ral GTPase activating protein, alpha subunit 2 (catalytic)

High confidence: 4 potential gene matches
Length: 5757 bp    Location: 21171886..20879797   Strand: -
>XM_004840898.1
ATGTTCTCGCGACGGAGCCACGGGGACGTGAGGAAGTCGGCGCAGAAGGCGCTGGACCCCAGGAAGGACGCGGCGACGCGGCTGCGACACCTGCGGGCGCTGCTGGATAATGTGGATGCAAGCGATCTTAAGCCATTTTTTGAGACCCACTATTCTCAGATATATTTCATCTTCTATGAAAATTTTATAACACTGGAAAATAGTTTAAAATTAAAAGGGAATAATAAATCACAAAGGGAGGAGCTGGACTCTATTCTCTTTCTTTTTGAAAAAATACTGCAGTTTCTACCTGAACGAATTTTCTTTCGATGGCATTACCAGAGCATAGGCTCAACTTTAAAGAAGCTTCTACACACTGGAAATTCTATAAAGATAAGATGTGAAGGAATCAGACTGTTTCTTTTGTGGCTTCAAGCACTTCAGACAAACTGTGCAGAAGAGCAGGTGCTGATTTTCGCTTGCCTCGTGCCTGGTTTCCCAGCCATCTTGTCCTCCAGGGGGCCCTGCACACTGGAGACCCTCATCAATCCCAGTCCTAGTGTAGCTGATGCAAAGATATATCCAGAAGAAATCACTCCACTCCTGCCAGCCATATCAGGGGAGAAGACTGCAGAGGACCAAACTTGCTTTTTCCTTCAGATACTGTTGAAGTATACGGTAATTCAGGCTGCAAGCTTGGAGTGGAAGAATAAGGAAAATCAAGATACTGGTTTTAAATTTCTTTTTACATTGTTTCGAAAGTATTATCTTCCTCATTTATTTCCATCATTTACTAAGTTAACAAACATCTACAAACCTGTACTTGACATCCCCCATTGGAGACCAAAGCCCCTGTACATTACTACAACTCGAGACAGTGAGAGCATTTACAGCACAAAAATTCCATACATGGCAGCTCGTGTTGTTTTTATTAAGTGGATTGTAACTTTCTTTTTGGAAAAGTATCTAACTGCAACACAAAGCACTAAAAATGGAGTTGATGTGTTGCCTAAAATTATTCAGACTGTTGGTGGTGGTGCAGAGCCAGAGAGGGTACCGGAGCTGGATGGCAGTGGGCCTCTGGAGCAAGAGAAGGGCTATTCTAACAGCAGCGCCCTGTCTGAGCGGAGACTCAGCAGCTCTAGCCTCTGCAGCATCGAAGAAGAACACCGGACAGTGTATGGAATGGTGCGGCAAATCCTCCTGTCCACACGCGGTTACGTCAATTTTGTGAATGAAGTATTTCGCCAGGCATTTCTGTTGCCTTCCTGTGAGATAGCTATAACTAGGAAAGTAGTTCAGGTGTACAGAAAATGGATCCTCCAGGAAAAGCCTGTGTTCATGGAAGAGCCGGATAAAAACAACATTGCCCAAGAGGATGCTGAAAAACTAGGTGTTTCAGAGATTGATGCCAAGGAGGCCTCCTTGGATGGTTCGGGTCATAAGCGGTCTTCCAGCTGGGGACGCACGTATTCCTTCACGAGCGCCATGAGCAGAGGGTGTGTGGCTGAGGAGGACAGCACCAGTGTGAAGGCCGGGTCCCAGGCTGTGCTGCAGGTATTTCTGACAAATGCTGCAAATGTATTTTTGCTGGAACCTTGTGTTGAAGTTCCTGTGCTCTTGAAAGAGCAAGTTGATGCTTGCAAAGCTGTTTTGATTATTTTTAGGCGTATGATAATGGAGCTTACAATGAATAAAAAGACATGGGAGCAGATGTTGCAAATACTACTCAGGATAACAGAAGCTGTCATGCAGAAGCCAAAGGATAAACAAATAAAGGACTTGTTTGCCCAGAGCTTGGCAGGGTTACTGTTTAGGACACTCATCGTGGCGTGGATCCGAGCAAACCTTTGCGTGTTCATCTCTCGGGAGCTCTGGGACAACTTTCTGGGCGTGCTGTCCTCCCTCACTGAGTGGGAGGAGCTCATAAGCGAGTGGGCCAACATCATGGACTCCCTGACTGCGGTGCTGGCAAGAACTGTATATGGAGTTGAGATGACAAACCTGCCTCTGGACAAACTGAGTGAGCAGAAGGAGAAGAAGCAGCGGGGCAAAGGCTGTGTTCTGGATTCTCAGAAAGGGACCACTGTGGGGAGATCCTTTTCTCTCAGCTGGCGGAGCCACCCAGATGTGACCGAGCCCATGCGGTTCAGGAGTGCTACCACATCTGGGGCACCCGGGGTAGAGAAGGCAAGAAATAACGTCCGCCAAAAAGCAACTGCTAAGCGAAGCCAGTCTATCAGCAACTGTGTCCATCTCTCTGAGGCTTTGCCTGCCACTAAAAGCATCCAGTTCCTGCCCCACACCGTGAGCGCTCTCTTACCTGGTCTCTCTTACTCCTCTTGCTCTCACAGGCTGTCAGAAGTGGAGGAGAATCCACAGTCAGAGAACACACCTGCAGCAGAACCAACCCAGCTCACGATGGGGCAGCAGCAGGTCCTCCAGAGCAGCAGCACCTCTGACATCCCCGAGCCGAGGATCCCAGAAGCATCTCAGGGTCAAAAGGTAGAGTTTGCACAAAATTTGACTTCTTCAGAACCCAAGCCTAGTCAAGAGAATACAGGCCAGGTGAAGAGAGAACATGAAGGAATAACAATCTTAGTTCGAAGAAGTAGCAGCCCTGCTGAGTTGGATCTGCAGGATGATTTGCAGCAGACACAAGGAAAATGTAGGGAAAGACAGAAGAGTGAAAGTGCCAGCGGCGACACAGCTCTGGGCTATAACAGTGAAGCCGAGCTGTTGGTGACCCCATGGCAGGCGTGTGAGGAGGACCCCGACCTGAGCACACCCACAGATGCTGTGGCTGACTCTGATGCACGGCAGTGGTTACAGCTGAGTCCCACTGATACCTCAAACCTAACAGACAACAGTGAGTGCCTGGTGGATGACTGTAGTATCATTGCCGGAGGGAACCTCACCGGCTGGCACCCAGATTCTGCTGCTGTGTTATGGAGAAGAATCTTGGGGATCCTTGGAGATGTGAATAACATCCAGTCGCCCAAGATCCATGCCAAAGTGTTTGGGTATCTCTATGAGCTCTGGTACAAACTAGCCAAGATCCGGGATAATCTAGCTGTAAGCCTGGATAACCAGTCCTCTCCGTCTCCTCCTATTTTGATCCCACCACTCAGAATGTTTGCATCATGGTTATTTAAGGCGACAACACTGCCAAATAAGTATAAGGAAGGCAAACTGCAAGCCTACAGGCTGATCTGCGCCATGATGACCAGACGCCAGGATGTCCTGCCAAATTCCGACTTCCTGGTGCACTTCTACCTCGCGATGCACCTGGGCTTAACCAGTGAGGACCAGGATATCTTGAATACAATCATAAGACACTGCCCACCCCGATTCTTCTCCCTGGGTCTGCCTGGCTTCTCCATGCTGGTAGGGGACTTCATCACAGCCTCAGCCAGGGTCCTCGGCACAGACATGTTGGTGGCGCCTCGTTCTGAAGCTCTCACCATCCTTGGGTCCCTCGTCTGCTTCCCAAATATCTACCAGGAGATCCCATTACTGCCGTCTGTACCAGAAGTGAGTGAGGTCGTCACTGGAACCGAAGATGTCAAGCATTACCTTATAAATATTTTACTGAAGAATGCCACAGAGGAACCAAATGAATGTGCAAGGTGCATTGCCATTTGCTCCCTGGGGGTGTGGATCTGCGAGGAGCTTATGCAGCGCACCTGGCACCCCCAGGTGAAGGAGGCCATCAATGTGGTCGGTGTGACACTAAAGTTTCCTAACAAAATCGTGGCTCAGGTAGCTTGTGATGTTCTTCAGTTGCTGGTTTCCTATTGGGAAAAACTTCAGCTGTTTGAAACCTCCCTGCCTCGGAAAATGGCAGAAATCCTTGTGGCCACAATTGCTTTTCTTTTACCAAGTGCAGAGTATTCCTCAGTGGAAGCAGATAAGAAGTTCATCGTGTCCTTGCTCCTCTGCCTCCTGGACTGGTGCATGGCGCTGCCAGTGAGCGCCCTTCTGCACCCAGTGTCCACCTCAGTCCTAGAGGAGCAGCACCTGTCTCAGGCGCCCTTGTTGGATTATATCTACAGGGTCCTCCACTGCTGTGTCTGTGGCTCCAGCACATACACCCAGCAGAGTCACTATACTCTGACCCTGGCTGACTTGTCCTCTGTGGATTATGACCCCTTCCTGCCCCTGGCCAGTGTAAGGAGCTCTGAGCCAGTCCAGTGCCATTCCTCAGCAGATCTGGACAACCTGCTGACTGTGGAAGAGGAGAGGAGAAGGAGGAGCCTGGAGCTGATCCCGCTTACTGCCCGCATGGTGATGGCACACCTGGTCAACCACCTGGGCCACTACCCGCTGGCTGGGGGCCCAGCTGTACTGCACAGCCTGGTCAGTGAGAACCACGACAACACCCACACTGAGGGTGCCGAACTGTCCCCCGATGTGTTCCGGAGCCCAAACCTGCAGCTCTTTGTATTTAATGACAGCACCCTCATCTCTTACCTGCAGATGCCTGCAGAGGGGATGGGTGGCACGTCCCCGGGGGATGCTGTCTCAGATGTTCGGGTCATTGTGCGAGATGTTTCAGGGAAGTACTCCTGGGATGGGAAGGTGCTCTATGGACCCTCGGAGGGCTGCCCAGCACCCAGTGGGTACAGTTCCACCTTTCAGATTCCCAGCTACCATTCTCAGAGTGTTGGGCCTCAGAAAGATCTTCCTCAGATTCAGGAAGGGGACGATGTGCTAGACAAGTTGCTGGAGAACATTGGCTACACAAGCCCCGAATGCCTCTTACCGTCTCAGCTAAAGCTAAATGAGCCTTCCCCACCCCCGTATGGAATGAACAGTGAGCAGGAGAAGGAAATTATCAAGGTTATCCTGTGCCAAAATGCACAGGAGGACGAGCATGTTCAGAGGTGTAATTCGGCCTCCACCATGAAGGTCACCAGCCAAGGGCAGCCCTCCCCAGTGGAGCCCCGAGGACCCTTCTATTTCTGCAGGCTGCTGCTCGATGACTTGGGAATGAACTCTTGGGACAGAAGGAAGAATTTTCATCTGTTGAAGAAAAATTCAAAATTATTGAGAGAGCTAAAAAATCTGGACTCCCGTCAGTGCCGGGAGACACACAAAATTGCAGTGTTTTACATTGCTGAAGGTCAAGAAGACAAGTGTTCGATCCTCTCCAATGAAAGAGGAAGCCAAGCTTATGAAGACTTCGTTGCTGGTCTTGGATGGGAGGTGGATCTCTCTACCCACTGCGGCTTCATGGGCGGCCTGCAGCGCAATGGCAGCACTGGGCAGACTGCCCCTTACTACGCTACCTCCACTGTGGAAGTGATTTTTCATGTTTCCACTCGGATGCCATCGGACTCAGACGATTCCCTCACCAAAAAGCTCCGTCACTTGGGGAATGATGAGGTCCACATCGTCTGGTCTGAACACTCCAGGGACTACCGCAGGGGCATCATCCCAACGGCCTTTGGCGACGTTTCCATCATCATTTACCCAATGAAGAACCACATGTTCTTTATCACCATAACCAAGAAACCTGAGGTGCCATTTTTTGGGCCTCTGTTCGATGGAGCCATCGTGAATGGGAATCTGCTTCCGAGCCTTATCTGTGCCACGTGCATCAATGCCAGCCGGGCCGTGAAGTGCCTCATACCGCTCTACCAGAACTTCTATGAAGAACGAGCACTGTATCTTGAAGCAATAATTCAGAACCATCGCGAAGTCATGACATTCGAGGATTTTGCAGCTCAAGTCTTCTCCCCCTCGCCCAGCTATTCCCTCAGCGGAACGGATTAA

XM_004840852.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 1965 bp    Location: 18681652..18653068   Strand: -
>XM_004840852.1
ATGTACCACCGCAGCTACGTGTTCCAGGCCCGCCGGGAGCGCTACGAGCGCTCCGCGGAGCCCGAGCGGGATGCGATCGCCGGGCCCCCTAGCCCCGCGCCGCTGCAGGGCCTGGGGGAGCGCGTGGCCGCCCACGTGCAGCGCGCTCGGGCGCTAGAGCAGCGCCACGCGGGGCTGCGCGGGCAGCTCGACACCTTCAGGCGCCTGGGCGAACTGGCGGGGCCCGAGGACGCCCTAGCGCGACACGCCGAGTCCAACCGGAGGCGCGCGGGGGACCTGGCGGCCGAGCGCACCCAGCTGCTGCGCCAGAGCGTGGAGGCACAGCGCGCGCTCGACGAGTTCAGGACCAAGTATGAAAACGAGTGTGAGTGTCAGCTGCTGCTGAAGGAAATGCTGGAGCGGCTAAACAAGGAAGCTGATGAAGCCTTGTTGCATAACCTGCGCCAACAGCTCGAGGCCCAGTTTCTGCAGGACGATATCAGTGTGACCAAGGACAGGAACAAAAAGAATCTTCTGGAAATCCAGACCTACATTGGCATCCTGCAGCAGATCATCCAAACAGCACCTCAGGGGCCCGCTATCATGTGTGAGATGAGGGAGGAGAAACTCCTGACGGAACGAGAGGTGGCCTCACTGCAGAGCCAGCTGGAGGAGGGCCGGGAGGCGCTGTCCCACCTGCAGGCACAGCTCGCGGAGCTGCAGGCCCAGACCTTGGCCCTGGAGCAGGCAATGAAAAATGCCCACGAGTGTTACAATGACAAGATCCAGCTGTACAATGAGCAGATTGAGAGCCTGCGGAGGGAGATCGAGGAGGCTGAGCGGACGCTGGAGAGGACTTCATACGACTGCCGGCAGCTGGCAGTGGCCCAGCAGACCCTGAGGAACGAGCTGGACCGATATCAGCGCATCATCGAGATTGAAGCCAACAGGCTGAGCTCCGCCTTCATCGAGACTCCGGTCATCCTGTTCACCCCGAGCCACAAGACTCCTCTCAGCCTGGGATCAGGTGGGAAAGATCTCGCCAGGACCTTGCAAGACATCACAGCAGCTAAACCAAGGCAAAAAGGCCTCCCCAAGAACGTTCCATGGAAGAAGGAGATCATAGCTCAGGATAAAGCAGATAAAATTCTGGAAGACCCCCCGGTAAAAGATCCGGAAGACCCAAAGCCAGGACAGGGGGCAGCTAAAGAGGAGGCTGAATTCAGGTGTGAATTGGGGGGTGGAGAAGCAAGCTCCTCAGTCCAGGGAAGGGGTCTGGAAGATGTGCCAGACGGGGGGCAGATCAGCAAAGCCCTCGGGAAACTGTGCAAGAAGGTCAAGGAAAGAGTGAGAATCCACAGAGAACCAGCACCGGAGCCCCCCGCCGACCTCTACACCAAAGGGCGTCGCGTGCTGGTCACGGGGGAGGCCAGCTATGTGGACCCTGGGTTCTGCTCCTCCTCCATCCCCACTGGAGGTGGGGTAGTGATTTCCATTGAGGAAGGCTCTGTGTATGGTAATGGGCGCGTGGAGCCCTGTCCTGAGCAGCCCATGCCACCTTTGGAGAATGGACCAGGGGGTCCCCAGCGGGGAGAGGGGGAGCACACAGGAAACCAGCAGTCTGCAGACAAGGGGGAAGAGATAAAAGCCCAGGAACCGAAAGACCCTGGGGTGAAGGACCAGGGCCAGAAGGAAGAGGAGAGCCCCAGGAGACCCTGTCCTGTGGCCATACCCGGTCCAGAGGAACCATCTACACCCCAGCCTCCAGGGCCTGGGTCCGCTCAGGATGGAGAGGAGAGTAAGAGCAGTGGCCAGCCAGAAAGGGGCCTTCCCAGGCCTATGGCTTTCAAGAAGGTAGAAATGGTGGAATCCATTGAGCAGATTTCAATGGAGAGCATCGAGACATACGAGGAGACCNNTCTGGTCGTGGAGACCATGACCGGGAAGACAAAGGTGAATAAGAAACTGGGAGAGAAGGGCACGTAG

XM_004840789.1 Coding sequence

Chgb chromogranin B (secretogranin 1)

High confidence: 4 potential gene matches
Length: 2019 bp    Location: 6754289..6766314   Strand: +
>XM_004840789.1
ATGCAGCCGGCAGCGCTTCTTGGCCTCCTGGGAGCCGCAGTGCTGGCCGCGGTCAGCTCTGTGCCCGTGGATAACAGAAACCACAATGAAGAAGTGGTGACTCGCTGCATCATCGAGGTTCTCTCAAATGCACTGTCCAAGTCCAGTGTTCCACCCATCAGCCCCGAGTGCCGGCAAGTCCTGAAGAAGAGTGGAAAAGAGGTCAAAGATGATGAGAAAAGTGAGAATGAAAACAAAAAGTTTGAAGTAAGATTGTTAAGAGACCCAGGTGATGCCACAGAAGCCCACAGACTCTCCAGCAGGGAGGAAGCTAGAGCCCCAGGGGAGGTAGACACTCAAGGCCAGACAAAGACTGACAGGGAGAAATGGGAAGAGGGAAGCAAACACAGCCAAGAGGGCATGGATGAGTCTTGGGGGAGTCTCTATCCCTCCAAGGACAATGGCCAAGGATCTGAAGAAGCCAAGGTACACTATTCTGAGAAGAGCGAGAATGAGGGCAGGGAGGAAGAAGAGGGAGAGGACCATCAGAAAGGGGAGCATGGGGAAGATGCCAGTGAAGGGAGGCACACTGAAGAGGCAGGAGAGACACAGAATGCCCTTCTCAACAAAAGAAGCCAGGCTTCAGCCAAGAAAAAAGAGGAGTTGGTGGCCAAATCAGATACCCACTCTGCTGGGCTCCCTGAGAAGACACACAGCGGGGAGAAGAGCAGCCAGGAGAGTGAAGAGGAGGTGAGAAGCCAGGAGAAATCCCCTCAAGAGTCTCACAGCCAACCTCGGAGCCAGGAAGAATCGGAGGAAAGTGAGGAAGATGCTACCTCTGAGGTGGCCAAACGACACATGAGGCCCAGACATCACCATGGGAGGACCAGGCCTGACAGGTCCTTTCAAGAAGAGAATCTTCCTTCTGAGGAAAAGGGACAGGAATCTAAGGAGGCAAACATGGCCATGACCAGTTTAGAACAGAGAGACCACCACTCTACCCATTATCAGGCATCAGAGGAAGAACCTGAATATGAGGAAGAAGCAAGGGGTTATCCAGGTGTCCAGGCTCCTAAGGACCTGGAGGGTGGACAATACATGGGCAGAGGAAGTGAGGAGTACAGGTCTCCAAGGCCTCACAGTGAGGAGAGCTGGGAGGAGGAGGACAAGAGAAACCGCCCCAGCTCAGAGCTTAACAACTTAGTGCAGGGATATAGTGAAGGGAGTGAGGAAGAGAGGGTCCATGAGGCAGGGAAGGGACACCATTACAGAGGGAGAGGAGGGGAACCAGGTGCCTATTCTACTCCTGACACCACAGAAGAGAAAAGGTTCTTGGTTGAAGGACATCATCATGTTCAGGAAAGTCAGATGGACAAGGCAAGGAGACATCCACAAGATGAGTGGCAAGAACAGGACAGAAATTACCTCAATTATGGTGAGGAAGGAGCCCAAGAAAAGTGGCAGCAGCGGGAGGACCTCCGAGACCCTAGAGAAAACAAGGAGGACGATAGGCTTCAAGACAAACAATATGTCTCCCATCACATCACTGAAAAGAGGAAGAGATTAGGGGTGCTGTTCAACCCATACTTTGACCCTCTCCAGTGGAAGAACAGCCATTTTGAGAGAAGAGACAACATGGATGACAATTTTCTTGGCGGTGAAGAAGAAAATGGGCTGACCTTGAATGAGAAGGCTTCCTTCCCAGAATACAGCTATGACTGGTGGGAGAAAAAGCCCTTCTCTGAGGATGTGAATTGGGGATATGAGAAGAGAAGCTTCCCTAGGGCTCCCAAACTGGACCTGAAAAGGCAATATGACAGGGTGGCTGAGCTGGACCAGCTCCTTCATTACAGGAAGAAGTCAGCTGAATTCCCCGACTTCTATGACGCCGAGGAACAGCTGAGCACACGCCAGGAGGCAGAAAATGAACAGGAAGGGGCTGACCATCTGACGGAGGAAGAGGAGAAACAACTTGAAAACTTGGCTGCGATGGATTTGGAATTACAGAAAATAGCTGAGAAGTTTAGTCAAAGGGGCTGA

XM_004840727.1 Coding sequence

Gfra4 GDNF family receptor alpha 4

High confidence: 4 potential gene matches
Length: 810 bp    Location: 4757642..4753821   Strand: -
>XM_004840727.1
ATGGCAGGCTGCTTGAGGGCCGCGCTGCTGCTGCTGCTACTACTGGGGTCTGTGAGCGTAGCCGGAGGGAACCGCTGCGTGGACGCGGCCGAGGCTTGCACGGCGGACGCGCGGTGCCAGCGGCTGCGCACTGAGTACGTGGCGCGGTGCCTGGGCCAGGCAGCGCCCCGGAGCTGTCATCGCGCCCGCTGTCACCGGGCCCTGCGCCGCTTCTTCTCCCGTGGGGCGCCAGCGCTCACCCACGCGCTGCTCTTCTGCCCTTGCGCGAGCCCCGCGTGCGCCGAGCGCCGGCGCCAGACCTTCGTGCCCGCCTGTGCCTTCTACGGGCCGGGTGCAGTGCGGCCCTCTTGCCTGGAGACCTTGGACGCCTGTGCGCAGAGCCGGGTCTGCAGGCCCCGCCTCCTGGTCTTCCAGGCTTCCTGCCTGCAGGTCCCCAGCGCCCCCGACGGCTGCCTGCGCGACCGGGGACCCCGCTGCCTCCGCGCCTACGCAGGCCTAATGGGCACAGCCATCACCCCCAACTACTTGGACAACTCGAGCGCGCGCGTGGAGCCCTGGTGCGACTGCAGAGCCAGCGGAAACCGGCGGGAAGAATGCGAAGCCTTCCGGGGTCTCTTTACAAAGAACCAGTGCTTGGATGGTGCCATACAAGCTTTTGGGAGCCGGTGGTCTGGAATCCTGCAAGTCCAGTTGGACTCTCACTGGGACCCTGGACACAACCTCCTGCAGGTGTCCTCTGCAGGTGGGCCCCTGGAGGGAAGCTCCCTACTGTCCATACTCCCTGTCCTGGCTCTCCAGGCCCTGCTGTGA

XM_004840745.1 Coding sequence

Ap5s1 adaptor-related protein complex 5, sigma 1 subunit, transcript variant X4

High confidence: 4 potential gene matches
Length: 603 bp    Location: 4903851..4907702   Strand: +
>XM_004840745.1
ATGGTCCACGCCTTTCTCATACATACTTTGAGGACCCCGAATGCAGAGGCCACAGGCTTTTGCCGAGTGCTCTACTCTTGCGTCTTTGGTGCTGAGAAGTCACCAGATGATCCAAGGCCACACGGTGCAGAGAGGGACAGGCTCCTCCGAAAGGAACAGATTTTGGCAGTGGCCAGGCAGGTGGAGTCGATGTGTCAACTGCAGCAGCTGGCATCAGGCCGCCCATCCTTGGACCTGCAGACCCAGATCTGTGACGAGCCTGTGCCCCTGCATGAGTCCCCACATGGGGTCTTCGGGCTGGCGGCAGGAGACCCCTTCCGGGAGCCTCACACCGTGGTGTGGTTGGGAGTGCTGTCCCTAGGCTTTGCCCTGGTGCTCGACGCCCATGACAACCTGCTGCTGGCAGAGAGCACACTCCGCCTGCTGGCCCGCCTCCTCCTGGACCACCTCCGTCTGCTGACCCCAGGCTCCAGCCTCCTGCTGCGGGCCGACCATGTTGAGGGCGTCCTCTCCCGCTTCCTGCCCCATGGCCAGCTGCTCTTCCTCAATGACCAGTTCGTCCAGGCTCTGGAGAAGGAATTCAGTGCTTCCTGGCCCCGCTGA

XM_004840710.1 Coding sequence

Ddrgk1 DDRGK domain containing 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 999 bp    Location: 4305411..4292256   Strand: -
>XM_004840710.1
ATGTTTGGGGACTCGAGGCGGACGCTGTGGTTCAACTGGGAGGTCTTCGGCATGTTAGCGACCCTGGTGTACTTGGCCGCGGCGGCTCTGCTCTTTGGCCTTATCCTCTTCCTGACCCGCAGCCGGCGCCGGACAGCAGAAGCTGGTCAAGAGCTACAGCACAATGAGGAGGTGCCAGGAGTAGCAGCTCGGGTGGACCCGTCACGGCTCCTGGAGGCAGAAGAGCAGAGAGCTGGAGGCAGACCCCGGCGCCGGAGGGACCTGGGCAGCCGCCTGCAGGCTCATCGTCGAGCCCAGCGGGTGGCTTGGACAGAAGTGGATGAGAATGAGGACGAAACTGACATCCCAGCTCAGGAGGAAGAAGGAATTGAGAAGCCAGCAGAAACTCACTCGACAGGGAAAATTGGAGCCAAGAAACTACGGAAACTAGAAGAGAAACAGGCTCGAAAAGCCCAGCGTGAGGCAGAGGAGGCTGAAAGAGAGGAGCGGAAGCGCCTGGAGTCCCAGCGGGAGGCAGAATGGAAGAAGGAAGAGGAGCGGCTCCGCCTGGAGGAGGAACAGAAGGAGGAGGAAGAGAGAAAGGCCCGGGAGGAGCAGGCCCGGAGGGAACATGAGGAGTATCTCAAATTGAAGGAGGCCTTCGTGGTGGAGGAGGAGGGTGTGAGCGAGAGCATGACTGAGGAGCAGTCCCACAACTTCCTGACAGAATTCATCAACTACATTAAGCAGTCCAAAGTTGTGCTTTTAGAAGATTTGGCTTCCCAGCTGGGCCTGCGGACTCAGGACACCATAAATCGCATCCAGGACCTGTTGGCTGAGGGGACTCTAACAGGTGTGATTGACGACCGGGGCAAGTTCATCTACATAACCCCTGAGGAACTGGCTGCTGTGGCCAACTTCATCCGACAGCGGGGCCGAGTGTCCATCACCGAACTTGCTCAGGCTAGCAACTCCCTCATCGCCTGGGGCCAGGAACCCCCTGCCCAGGCCCCAGCCTGA

XM_004840691.1 Coding sequence

Ptpra protein tyrosine phosphatase, receptor type, A, transcript variant X2

High confidence: 4 potential gene matches
Length: 2373 bp    Location: 3997924..4155130   Strand: +
>XM_004840691.1
ATGGATTCCTGGTTCATTCTTGTTCTGCTTGGCAGTGGTCTGATACGTGTGAGTGCCAACAATACTACCACAGTTTCACCTTCGTTAGGATCAATTAAAGCATCAACAACAGAATCAGTTAGAGAAGAGAACAAAACTTCAAATCCAACCTCTTCAGTAACTTCTCTTTCTCTGGCACCAACATTCAGCCCAAATTCAACTCTGGGACCCACCTATGTAACCACTGTCAATTATTCATACTCGGACAATGGGACCATCAGAACAATAAGCACTAATTCTGTAGGCACTGCCATTTCACCAAATGGGACGTGGCTTCCAGACAACCAGTCCACAGATGCCAGAACACAACCCTGGCAGGGGATTTCCAGCACTACAGGAACCACTCCAAAAAACTTCACTTCTTCAGATGAGACTTCAATTATTGCAGTGATAGTAGCCTTGTCCTCTCTGCTAGTGATTGTTTTTATCATCATAGTTCTGTACATGTTAAGGTTTAAGAAATACAAGCAAGCTGGTAGCCATTCCAATTCTTTCCGCTTATCAAACGGCCGCGCTGAGGATGTGGAGCCCCAGAGCGTGCCACTTCTGGCCAGGTCCCCAAGCACTAACAGAAAATACCCACCCCTGCCCGTGGACAAGCTGGAAGAAGAGATTAACCGGAGAATGGCTGACGACAATAAGCTCTTCAGAGAAGAATTCAATGCTCTCCCTGCTTGCCCTATCCAGGCCACCTGTGAGGCTGCCTCTAAGGAAGAAAATAAAGAAAAAAATCGATACGTAAACATCTTGCCCTATGACCACTCTAGAGTACACCTGACACCTGTTGAAGGGGTTCCAGATTCTGATTACATCAATGCTTCATTCATTAATGGCTACCAAGAAAAGAACAAATTTATTGCTGCACAAGGACCAAAAGAAGAAACAGTGAATGATTTCTGGAGGATGATCTGGGAACAAAACACAGCCACCATTGTCATGGTGACCAATCTGAAGGAGAGAAAGGAGTGTAAGTGCGCCCAGTACTGGCCAGACCAAGGCTGCTGGACCTACGGGAATATCCGTGTGTCCGTAGAGGATGTGACTGTCCTGGTGGACTACACAGTACGAAAGTTCTGTATTCAGCAGGTGGGCGATGTGACCAACAGAAAACCACAGCGCCTCATCACTCAGTTCCACTTTACCAGCTGGCCAGACTTTGGGGTACCTTTCACCCCAATTGGCATGCTCAAGTTCCTCAAGAAGGTGAAGGCCTGTAACCCTCAGTATGCAGGAGCCATTGTGGTCCACTGCAGTGCAGGTGTCGGGCGTACAGGTACCTTTGTCGTCATTGATGCCATGCTGGACATGATGCACACAGAACGGAAAGTGGATGTGTATGGCTTTGTGAGCCGTATCCGGGCCCAGCGCTGCCAGATGGTTCAAACAGATATGCAGTATGTCTTCATATACCAAGCCCTTCTGGAGCATTATCTCTATGGGGATACAGAACTGGAAGTGACCTCTCTAGAAACCCACCTGCAGAAAATTTATAACAAAATCCCAGGGACCAGCAACAATGGATTAGAGGAGGAATTTAAGAAGTTAACATCAATCAAAATCCAGAATGACAAGATGCGGACTGGAAACCTTCCGGCCAACATGAAGAAGAACCGTGTTTTACAGATCATTCCATATGAATTCAACAGAGTGATCATTCCGGTTAAGCGAGGCGAGGAGAACACAGACTATGTGAATGCATCCTTCATTGATGGTTACCGGCAGAAGGACTCATACATCGCCAGCCAGGGCCCTCTTCTGCACACAATTGAGGACTTCTGGCGAATGATCTGGGAGTGGAAATCCTGTTCCATTGTGATGCTAACGGAACTGGAGGAAAGAGGCCAGGAGAAGTGTGCCCAGTACTGGCCATCTGATGGTCTGGTGTCCTATGGAGACATCACAGTGGAGCTGAAGAAAGAGGAGGAATGTGAGAGCTACACTGTCCGAGACCTCCTGGTCACCAACACCAGAGAAAACAAGAGCCGGCAGATCCGACAATTCCACTTCCATGGCTGGCCTGAAGTGGGCATCCCCAGTGATGGGAAGGGCATGATCAGCATCATTGCAGCCGTGCAGAAGCAGCAGCAGCAGTCTGGGAACCACCCTATCACTGTGCATTGCAGCGCTGGAGCAGGACGGACCGGGACCTTCTGTGCCTTGAGCACAGTCCTGGAGCGCGTGAAGGCAGAGGGAATTTTGGACGTCTTCCAGACTGTCAAGAGTCTTCGACTGCAGAGGCCACACATGGTCCAGACACTGGAACAGTACGAGTTCTGCTACAAGGTGGTGCAGGAGTACATTGACGCCTTCTCAGACTATGCCAACTTCAAGTGA

XM_004840667.1 Coding sequence

Snrpb small nuclear ribonucleoprotein polypeptides B and B1, transcript variant X1

High confidence: 4 potential gene matches
Length: 723 bp    Location: 3703264..3694488   Strand: -
>XM_004840667.1
ATGACGGTGGGCAAGAGCAGCAAGATGCTGCAGCACATTGACTACAGGATGAGGTGCATCCTACAAGATGGCCGGATCTTCATTGGTACCTTCAAGGCTTTCGACAAGCATATGAATTTGATCCTCTGTGACTGTGATGAATTCAGGAAGATCAAGCCAAAGAACTCTAAGCAAGCAGAAAGGGAAGAGAAACGAGTCCTCGGTTTGGTGCTGCTTCGAGGGGAGAACCTGGTCTCCATGACAGTAGAAGGACCTCCTCCCAAAGATACTGGCATTGCCCGAGTGCCACTTGCTGGAGCTGCTGGGGGACCAGGAATTGGTAGGGCTGCTGGTAGAGGAATCCCAGCTGGTGTTCCCATGCCGCAGGCTCCTGCAGGACTTGCTGGGCCAGTCCGTGGGGTTGGTGGGCCATCTCAACAGGTGATGACCCCACAAGGAAGAGGCACTGTTGCAGCTGCAGCAGCTGCTGCCACAGCTAGTATTGCAGGGGCCCCGACCCAGTATCCACCCGGCCGTGGGGGTCCTCCCCCGCCTATGGGCCGAGGGGCCCCCCCTCCAGGCATGATGGGCCCTCCTCCTGGCATGCGGCCACCCATGGGTCCTCCAATGGGGATCCCTCCTGGACGAGGGACTCCTATGGGCATGCCCCCTCCAGGGATGCGGCCCCCTCCCCCAGGTATGCGAGGGCCCCCTCCCCCGGGAATGCGCCCACCAAGGCCCTAG

XM_004840644.1 Coding sequence

Slc52a3 solute carrier family 52, riboflavin transporter, member 3, transcript variant X4

High confidence: 4 potential gene matches
Length: 1407 bp    Location: 2093307..2106877   Strand: +
>XM_004840644.1
ATGGCCTTGCTGGTCCACCTGCTGGTCTGCGTCTTCGGGATGGGCTCCTGGGTGGCCATCAATGGGCTGTGGGTGGAGCTGCCCCTGCTGGTGACAGAGCTGCCTGAGGGCTGGAACCTGCCCTCCTACCTCACGCTGATCATCCAGCTGGCCAACATTGGGCCCCTGCTGGTCACCCTGCTGCATCGCTTCCGGCCTGGCTATCTCTCTGAAGTCGCCATCATCTTCACCATCCTGACCGTAGGCACTGTCACCTGTATCCTTTTTGCCTTCCTCTGGAACATGACCTCCAGAGTGCTGGGTGGCCGCCACAGCATTGCCTTCATCATCCTCACTTTCTTCCTGGCACTGGTGGACTGCACCTCCTCCGTCACCTTCCTGCCCTTCATGAGCCAGCTGCCCTCCTACTACCTCACTACCTTCTTTGTGGGTGAAGGATTCAGTGGCCTCCTGCCTGCACTGTTGGCTCTGGCCCAGGGCTCGGGTATCACCTCCTGTGTCAATGTCACGGACTCACTGGATGCCAACTCAAGCACTGTGACCACCAACGAGACCCACAGCACACAGGGAACCAGCAGCCCCACGGTGTGGACCCCCACGGTGTGGACCCCCACCAGCCACCTGGAGGGCCGCTACCTCCCCGCGCGCTTCTCACCACTGGTCTTCTTCCTGCTGCTGGCCGCCATGATGGCCTGCTGCCTCCTCGCCTTCTTCCTGCTCCAGCATCGGTCCCAGGCCCAGCAAGGTTCCATCGAGGACCTGCTTCAGTCCCAGGTCACCCTCCACTCCATCAGGCCGCAAGAGGAGAAAGACGCAGGCCCCCTAGACCCTGCAGAGAACAGCAAGGGGAAGGCACAACTGGAGGAGAAAGTGGCCACCCTGCACCCTGTGCAGCTGGCCTTCATCTACACGCTGGTGGCCTTTGTAAACGCACTCACCAACGGCGTGCTACCCTCTGTGCAGACCTACTCCTGCCTGTCCTACGGGTCTTTCACCTACCACCTGTCTGCCACCCTCAGCTCCGTGGCCAGCCCACTTGCCTGCTTCCTCTCCATATTCCTGCCTAACAGGTCTCTGCCTTTCCTGGGGGTCATCACTGTGCTGGGGACTGGCTTTGGGGCCTACAACATGGCCATGGCTGCGATGAGCCCCTGCCCCCTCCTCCAGGGCCACTGGGGGGGAGAAGTCCTCATTGTGATTTCTTGGGTGCTGTTCACTGCCTGTCTCAGCTACATCAAGGTCATGCTGGGAGTGATCCTGAGAGACCAGAGCCACAGCGCCCTCGTGTGGTGCGGGGCGGCGGTGCAGCTGGGCTCTCTGGTCGGGGCGCTGCTCATGTTCCCGCTGGTCAATGTGCTGAGGCTCTTCGTGTCTGCCGACTTTTGCAACCTGGATTGCTCTACCTAG

XM_004840646.1 Coding sequence

Psmf1 proteasome (prosome, macropain) inhibitor subunit 1 (PI31)

High confidence: 4 potential gene matches
Length: 837 bp    Location: 2402785..2443071   Strand: +
>XM_004840646.1
ATGTCGAAGCTGCGGGTGTTCATGGCGGGCTTGGAGGTACTTTTCGCTTCGGCGGCGCCGGTGATCACCTGCGCGCAGGACGCGCTCGTCTGCTTCCTGCACTGGGAGGTGGTGACACACGGCTACTGTGGCTTGGGTGCCGGCGATCAGCCAGGTCCCAGTGATAAGAAGTCAGAACTGCTACCAGCTGGGTGGAGCGATAATAAAGACCTGTATGTCCTCCGTTATGAGTCCAAGGATGGGTCCAGAAAGCTCCTGATGAAAGCTGTCCCTGTGGAGAACAGCATGATCATCAATGTGCTGGAATATGGCTCACAGCAAGTGACAGACTTGACTCTGAACTTAGATGATTTTATCAGTGCAGAAGACCTGGGTGACTTCCACAGGACCTACAAGAACAGCAAGGAGCTTCGTTCTCGCATCCTATCTGGAATCATCACACCCATCCATGAGCAGTGGGACAAGGCCAGTGAAAGCAGTGCCCAACGTGAGTTCCCCCCTGCCACCGCCAGAGAAGTAGACCCTCTCCGGATTCCTCCACACCATCCGCACACCAGCCGGCAGCCTCCCTGGTCTGATCCCCTGGGCCCCTTTGCTGTCGGGGGAGAAGACCTAGACCCCTTCGGGTTCCGGAGAGGTGGCATGATTGTGGACCCCTTGAGATCTGGCTTCCCAAGAGCACTTATTGACCCATCTTCAGGTCTCCCAAACCAGCTTCCTCCAGGTGCAGTTCCCCCAGGAGCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCCTCTGGGCCCAACCCAGACCATCTCCCTCCGCCGGGTTTCGATGACATGTACCTGTGA

XM_004840648.1 Coding sequence

Tmem74b transmembrane protein 74B, transcript variant X2

High confidence: 4 potential gene matches
Length: 699 bp    Location: 2459712..2455466   Strand: -
>XM_004840648.1
ATGGCATCTCCCCCTGGTCTGGAACTGAAGACACTGAGCAATGGTCCTCAGGTCCCAAGGAGACCGGCCCCACTGGGCCCAGTGGCCCCACCGAGGGCTGGGGTGGAGAATGCCTGTTTCACCTCAGAGGAGCATGAGACTAATTTCCAGAACCCTGGGGATGCCAGACTGGGCAGCTCCCCCAGTCCCCTGGGGAGTGTTTCCTCACTGCCCCGGTCCCAGCGGGACGATCTGTCCCTATATTCAGAGGAAGGGCCAGGTTTGGAGCCCGTGAGCCGCCCTGTGGATTATGGCTTCGTTTCTGCTCTGGTTTTCCTGGTGAGTGGGATCCTCCTGGTGGTAACAGCATATGCCATCCCCCGTGAGGCCCGCGTAAACCCGGACACAGTGACTGCAAGGGAGATGGAGCGACTAGAGATGTACTATGCCCGCCTGGGCTCCCACCTGGACAAGTGCATCATCGCGGGCCTGGGGCTGCTCACAGTGGGCGGCATGCTCTTGTCAGTGCTGCTCATGATCTCCCTGTGCAAGGGTGAGCTGTACCGCAGGAGGACCTTCGTCCCTGGCAGAGGCCCCAGGAAGACCTATGGCTCCATTAACCTTCGCATGAGACAGCTAAATGGGGATAGGGGCCAAGCACTGGTGGAGAACGAACTTATCCAAGTCTCGGAGGCCAGCCATACCCTCCAGGGGTCTTAA

XM_004840617.1 Coding sequence

Sox12 SRY (sex determining region Y)-box 12

High confidence: 4 potential gene matches
Length: 930 bp    Location: 1428241..1432364   Strand: +
>XM_004840617.1
ATGGTGCAGCAGCGGGGCGCGCGGGCGAAGCGGGACGGCGGGCCGCCGCCCCCGGGGCCCGGGCCGACCGAGGAGGGGGCGCGCGAGCCCGGCTGGTGCAAGACCCCGAGCGGCCACATCAAGAGGCCAATGAACGCGTTCATGGTGTGGTCGCAGCATGAGCGGCGGAAGATCATGGACCAGTGGCCCGACATGCACAACGCCGAGATCTCCAAGCGCCTGGGCCGCCGCTGGCAGCTGCTGCAGGATTCAGAGAAGATCCCGTTCGTGAGGGAGGCGGAGCGGCTGCGCCTCAAGCACATGGCGGATTACCCGGACTACAAGTACCGGCCGCGCAAAAAGAGCAAGGGGACGCCCGCCAAGGCGCGGCCCCGCCCCCCCGGCGGTGGTAGCAGCCGGCTCAAACCCGGGCCGCAACTGCCGAGCCGCGGGGCCCGCCGGGCGGCGGGAGGGCCCTTGGGGGGCAGTGCGGCGCCGCCCGAGGACGACGATGAGGACGACGACGAGGAGCTACTAGAGGTGCGCCTAGTCGAGACCCCAGGGCGGGAGCTGTGGCGGATGGTCCCGGCGGGGCGGGCCGCCCGGGGACCGGCGGAGCGCGCCCAAGGGCCGTCGGTTGAGGGGGCGGCCGCCCCCGCCGCCTCCCCGACCCCATCGGAGGACGAGGAGCTGGAGGAGGAGGAGGCGGCAGCGGTGGAGGAAGGCGAGGAGACGGTGGCGTCGGGGGAGGAGCCCCTGGGCTTTCTGTCCAGGCTGCCCCCCGTCCCCACTGGCCTGGACTGCACCGCCCTGGACCGCGACCCGGACCTGCCACCTGCCTCGGGCACGTCACACTTCGAGTTCCCGGACTACTGCACCCCCGAGGTCACCGAGATGATCGCAGGGGACTGGCGCCCGTCTAGCATCGCCGACCTGGTTTTCACCTACTGA

XM_004840621.1 Coding sequence

Nrsn2 neurensin 2, transcript variant X4

High confidence: 4 potential gene matches
Length: 594 bp    Location: 1449886..1453940   Strand: +
>XM_004840621.1
ATGCTGGGCTGCAACCCCTGCAGCTGTGTAACCACCGTGGAGGAAAGCAAGTGGTATGGAGTCCACTCCTACCTGTACCTCTTCTACGAAGACTGCACTGGCATGGCTCTCAGTGATGACCCTGAAGGACCCCCAGTCCTGTGTCCCCACCAACTCTGGCCCTCACTGTGCTGGAAGATCTGCCTGTCCTCAGGGACCCTGCTTCTGCTGCTGGGGATAGCAGCTCTGACCACTGGCTATGTGGTGCCCCCCAAGTTGGAGACCGTCAACAATACTGACTTGCCGCTGCTAGATGAGCGGGCAGCCAACTACAACAAGGCCCTGAGCACCTGCCGCCTGGCAGGCACAGCACTCTGTGGGGCAGCTGGGATCCTGCTGACCATCTGCCTCTTGTGGGCCATGTCAGGATGGCTGAACCCAGACGCCAAGGCAGAGCCCTTGGACACTGAAGCTGATAGCCATGTGGAGGTCTTCAGGGATGAGCCAGGGCAGCAGCTGTCCCCCACCTTCTGCAATACCAGTGGTCAGTCATGGTTCTTGACCTCCTTTGGGCACTCCTCTGTTCAGATCATCCAGCCCAAGAGGGACTCCTGA

XM_004840992.1 Coding sequence

Psma7 proteasome (prosome, macropain) subunit, alpha type, 7, transcript variant X2

High confidence: 4 potential gene matches
Length: 747 bp    Location: 28017055..28011058   Strand: -
>XM_004840992.1
ATGAGCTACGACCGCGCCATCACCGTCTTCTCGCCCGACGGCCACCTCTTCCAAGTGGAGTACGCGCAGGAGGCCGTCAAGAAGGGCTCGACCGCGGTTGGTGTTCGAGGAAGGGACATTGTTGTTCTTGGTGTGGAAAAGAAATCAGTGGCTAAACTACAAGATGAAAGAACTGTGCGAAAGATCTGTGCTTTGGATGACAACGTCTGCATGGCCTTTGCAGGCCTCACTGCTGACGCAAGGATCGTCATCAATAGGGCCCGGGTGGAGTGCCAGAGCCACCGCCTGACTGTGGAGGACCCGGTCACTGTGGAGTACATCACCCGCTACATTGCCAGTCTGAAGCAGCGTTATACGCAGAGCAATGGGCGCAGGCCTTTTGGCATCTCTGCCCTCATCGTGGGTTTTGACTTCGATGGCACCCCTCGACTCTATCAGACTGACCCCTCTGGCACATACCATGCCTGGAAGGCCAATGCCATAGGCAGGGGTGCCAAGTCAGTGCGTGAGTTCCTGGAGAAGAACTATACCGATGAAGCCATTGAGACAGATGATCTAACCATCAAGCTGGTGATCAAGGCACTCCTGGAAGTGGTCCAGTCAGGTGGCAAAAACATTGAACTTGCTGTCATGAGGAGAGATCAGCCTCTCAAGATTCTAAATCCTGAAGAAATTGAGAAATATGTTGCTGAAATTGAAAAAGAAAAAGAAGAAAATGAAAAGAAGAAACAAAAGAAAGCATCGTGA

XM_004841130.1 Coding sequence

Tcea2 transcription elongation factor A (SII), 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 903 bp    Location: 29692004..29699377   Strand: +
>XM_004841130.1
ATGATGGGCAAGGAGGAGGAGATCGCGCGCATCGCCCGGAGGCTGGACAAGATGGTGACCAGGAAGAGCGCGGAGGGAGCCATGGACCTGCTGCGGGAGCTGAAGGCCATGCCTATCACGCTGCACCTGCTCCAGTCCACCCGTGTTGGGATGTCTGTCAACGCCCTGCGGAAGCAGAGCTCGGACGAGGAGGTCATTGGACTGGCCAAGTCTCTCATCAAGTCCTGGAAGAAGCTCCTGGATGTTTCCAATGCTAAAACCAGGGATCCAGGGAGGGACACACCTCTACCCACATCGTCCACAAAGAATGCCTCAGAGGCCATGGATCACAGCCGTAAGAGGCTGGACCTTCCCAGGATGTCATCCACCCCAAGGATCACCACATTTCCTCCGGTGCCCATTACTTGCGATGCTGTGCGCAACAAATGCCGTGAGATGCTAACCACTGCCCTGCAAACAGACCATGACCATGTGGCAGTGGGCACAGACTGTGAACGTCTATCGGCTCAGATCGAGGAGTGCATCTTCCTGGATGTGGGAAACACAGACATGAAGTACAAGAACCGTGTGAGGAGCCGTATCTCTAACCTTAAAGATGCCAAGAACCCGGAGCTTCGGAGGAACGTGCTATGTGGTGCCATAACACCCCAGCAGATCGCGGTGATGACGTCGGAGGAGATGGCGAGTGATGAGCTGAAGGAGATCCGCAAGGCCATGACCAAGGAGGCCATCCGGGAGCACCAGATGGCCCGCACAGGTGGCACGCAGACAGACTTGTTCACCTGTGGCAAGTGCAGAAAGAAGAACTGCACCTACACGCAGGTGCAGACTCGCAGCTCTGATGAGCCCATGACCACCTTTGTTGTCTGCAATGAGTGTGGAAACCGCTGGAAGTTCTGCTGA

XM_004840670.1 Coding sequence

Idh3b isocitrate dehydrogenase 3 (NAD+) beta, transcript variant X2

High confidence: 4 potential gene matches
Length: 1146 bp    Location: 3814226..3808436   Strand: -
>XM_004840670.1
ATGGCGGCTTTGAACGGTGTCCGCTGGCTGACCCGAGCAGTGGTTGCCGTCCGGAGCCCTGGGGCATGGAGAGGTCTGAGTATTTCAGTCACAGCGAATGCAGCTTCTCAGGCTCAAGACATGAAAGTCGAGGGCGCATTTCCTGTGACCATGCTGCCGGGAGATGGCGTTGGGCCGGAGCTCATGCATGCTGTCAAGGAGGTGTTCAAGGCTGCTTCTGTCCCAGTGGAGTTCCAGGAGCACCACCTGAGTGAGGTGCAGAATATGGCCTCTGAGGAGAAGCTGGAGCAGGTGCTGAATTCCATGAAGGAGAACAAAGTGGCCATCATTGGAAAGATCCATACCCCAATGGAGTATAAGGGGGAACTAGCTTCCTATGATATGCGGCTAAGGCGTAAGTTGGATTTGTTTGCCAACGTAGTCCATGTGAAGTCCCTTCCTGGGTACATGACTCGGCATAACAATCTAGATCTGGTGATTATTCGAGAGCAGACAGAAGGGGAATACAGCTCTCTGGAGCATGAGAGTGCAAGGGGTGTGATTGAATGCTTAAAGATTGTTACTCGAACCAAATCTCAGCGGATTGCAAAGTTTGCCTTTGACTATGCCACCAAGAAGGGGCGGAGCAAGGTCACAGCTGTCCATAAGGCCAATATCATGAAACTTGGGGATGGGTTGTTCCTGCAGTGCTGTGAGGAAGTTGCTGAACTGTATCCCAAAATCAAGTTTGAGACAATGATCATAGACAACTGCTGCATGCAGCTGGTGCAGAATCCTTACCAGTTTGATGTGCTTGTGATGCCCAATCTCTATGGGAACATTATTGACAATCTGGCTGCTGGCCTGGTTGGGGGAGCTGGTGTGGTCCCTGGTGAGAGCTACAGTGCCGAGTATGCAGTTTTTGAGACGGGTGCCCGACATCCATTTGCCCAAGCAGTGGGCAGGAATATAGCCAACCCCACAGCCATGTTGCTGTCAGCTTCCAACATGCTTCGGCATCTCAATCTTGAGTATCACTCCAGCACGATTGCTGATGCAGTGAAGAAGGTGATCAAAGTTGGCAAGGTTCGGACCTCCGACATGGGTGGCTATGCCACTTGCCATGACTTCACCGAGGCTGTCATTGATGCCCTGTCCCACCCATAG

XM_004841048.1 Coding sequence

Col20a1 collagen, type XX, alpha 1

High confidence: 4 potential gene matches
Length: 4107 bp    Location: 28990376..29017938   Strand: +
>XM_004841048.1
ATGAACCCCCAAGGCCACCCCGCCCTCCACTTCTGCCTCTGGCTGTGGCTGGGTGCCATCTCCACACGTGGGCAGGGACAAGGAGGTGGCCGCCTGAGGCTGGCCGTGCTGCCCGAGGACCGGCTGCAGATGAAGTGGCGAGACCTGCAGGGCGGCGGCCTCGGCTATCTGGTGCAGGTGAAGCCCATGGCAGGGGACTCAGAGCAGGAAGTGATGCTGACCACCAAGACCCCCAAGGCCACCGTCGGGGGCCTGAGCCCCTCCAAGGGCTACATCTTGCAGATATTTGAGCTCACTGGCTCGGAGCCCACCCTGCTGGTGCGGAGGGAGTTTGTGATCAAGGATCTGAAGAGTAAGCCCCTGAGCAGGAGTGGCCAGAGGCCACCAGGGACAGCCCTAAAGCCTCTACCCTCCCACATGGGGGGCCCGGGCCCCAAGCAGACCCCTGAGCCCAGCATCACCTTTGTGCCCAGCCAAGAGCCGCCTGTGCTTGCTGGCCCCCAGTTCCGCTGCACACCCCCCACGCCCACCGACATGGTCTTCCTGGTGGACGGGTCCTGGAGTGTCGGCCACAGCCACTTCCAGCTAGTCAAAGACTTCCTGGCCAGCGTCATCTCACCCTTTGAAATTGGGCCCAATCAAGTCCAAGTAGGCCTGACTCAGTACAGCGGAGACCCCCAGACTGAGTGGGACCTGAACTCCTTCCGCACCAGGGAGGAGGTGCTGGCCGCTGTGCACAGCCTTCGCTACAAGGGAGGAAACACATTCACAGGCCTCGCCCTGAGCCACGTGCTGGGGTACAACCTGAAGCCGGCGGCAGGTCTCCGTGCAGAGGCGGCTCACTTGGTGATCCTGGTGACGGATGGCAAGTCCCAGGACGATGTGCATGCAGCTGCACACACCCTCCAGGGCCTGGACGTCGAGGTCTTCACTGTGGGGGTGAAGAATGCCGACGAGGCTGAGCTGAAGCTCCTGGCCTCCCAGCCGCAGGACATCACCGTCCACAACGTGCTGGACTTCCCCCAGCTGGCCACCCTGGCTGGCCTGCTCAGCCGCCTCATCTGCCAGCAGGTCCAGGGCTGGAACCTGAGCAGGGCCCCAGCCACGTGGGCCCCAGCCGCTCCAGCTCTGGACACCCTCCCCGTCCCCACCAGCCTGGTGGTGACCCAGGTCACCTCCTCCAGCATCCGCCTGTCCTGGTCGCCGGCCCCTCAGCCGCCCCTCAAGTATCTCATCGTGTGGCGGCCTTCCAGGGGTGGCGTCCACCGGGAGGTGGTGGTGGAGGGGCCTGCAGCATCCACAGAGCTTCGGAACCTGAGCTCCAGCACCGAGTATTTGGTGTCTGTGCTCCCTGTCTATGAGGCCGGGGTCGGCGAGGGCCTGCAGGGCCTGGCGACCACAGCACCCCTCCCTCCACCCCGGGCGCTAACCCTGGCTGCAGTGACACCCAGGACCCTCCGCCTCACCTGGCAGCCCTCGGCTGGGGCCAGGCAGTACTTGGTGCGGTGCTCGCCAGCCTTCCCCAAGGGTGGGGAGGAGGAGATTGAGGTGCGGGTGGGGCAGCCAGAGGTGCTGCTGGATGGCCTGGAACCGGGCAGGGACTACATGGTCTCCGTGCAAAGCCTTCAAGGGCCAGAGGCCAGCGAGGCCCGGGGTGTCCACGCCAGAACCCCCGCCCTGGCCCCCCCAAGACACCTGGGCTTCTCAGACGTGAGCCACGACTCAGCCCGTGTGACCTGGGAAGGCACCCAGCGGCCCACATACCTGGTCAGGGTCAGCTACATCTCCAGCGACGGTGGCCACTCGGGACAGAAAGAGGCGCCTGGGAATGCCACCTCGGCCACCCTGGGCCCCCTGTCCTCCTCCACCACATACACTGTCCGAGTCACCTCCGTCCACCGGGGAGGCAGCTCCTCCACGCTGACCGGCCAGGTGACCACAGGGAAAGTGCCCAGCCCAAGCCAGCTGTCTGTGACAGAACTGCCAGGGAATGCAGTCAGGCTGACGTGGGCAGCTTCGGCCCCAACCGGCGTGCTTGTCTACCAGATCAAGTGGACTCCCCTGGGAGAGGGGAAGGCCCACGAGATCTCTGTGCCAGGCACTCTCAGCACAGCTGTCCTGCCCGGCCTGGGGAGGCACGAGGAATACGAAATCACCATCCTGGCCTACTACAGGGATGGGGCCCGCAGTGACCCTGTGTCCCTCCACTATACACCCCCTGCAGTGAGCAGGAGCCCCCCCTCAGGCCTGACCCTGTCCTTGGAGACCCCCAACAGCCTGCACGTCAGCTGGACACCCCCAAGTGGCCCCGTGCTCCACTACCGGGTCACCTATGCGCCAGCCTCGGGCTCAGGACCTGAGAAATCAATCTCCGTGGCAGGTCACAGGGGCCAGGCCACGCTCCCTGACCTGCTGGCTGCCACCAAGTACAAGGTCCTGGTCTCAGCTGTCTACGCAGTAGGGGAGAGTGTGGCTGTGTCTGCCACAGGCCGAACAGCAGCCTGCCCTGCCCTTCGCTGGAACAGCTCCCTTCCAGGGTTTGACCTGATGCTGGCTTTCGGCCTGGTGGAGAAGGAGTACGCCTCCATTCGAGGTGTGGCCATGGAGCCTTCGCCTTGGGGTGGGACCCCGACCTTCACACTCTTCAAGGATGCTCAGCTGACGCGGCGGGCCAGCGACATCCACGCCGCCGCGCTCCCGCCGGAGCACACCATCGTCTTCCTTCTGCGCCTGCTCCCCGAGGCGCCCCGCGAGGCCTTCGCGCTGTGGCAGATGACAGCCGAGGACTTCCAGCCTGTCCTCGGCATTCTTCTGGACGCCAGCAGGAAGTCGCTGACCTACTTCAACCACGACCCGAGGGCCGCCTTGCAGGAGGTCACCTTTGACCTGCAGGAGGTGAAGAAGATTTTCTTCGGGAGCTTCCACAAGGTTCATGTGGCTGTGGGCCGCACCAAGGTCAGACTCTACGTGGACTGCCGGAAGGTGGCCGAGAGGCCCATGGGAGAGGCTGGCAGGTCGCCCATCACCGGCTTTGTCACCCTGGGGAGGCTGGCCAAGGCACGGGGACCCCGGAGCAGCTCGGCCACATTCCAGCTCCAGATGCTGCAGATTCTGTGCAGTGACACCTGGGCAGACGAGGACGGGTGCTGTGAGCTCCCTGCTTTGAGGGACAAAGAGACGTGTCCGGCCTTCTCTTCTGCCTGTTCCTGTTCCTCTGACACCACTGGGCCCCCGGGGCCCCAAGGGCCTCCAGGCCCCCCAGGCAGGAACGGCACCCCAGGACAGCAGGGCCTCCCGGGGCCTAAGGGAGAGCCAGGGCCACCAGGACAGACAGGACCAGAGGGCCCTGGGGGACAGCAGGGGTCACCAGGGACTCAGGGCCGTGCAATCCAGGGGCCTGTGGGTCCACCGGGGGTCAAAGGAGAGAAGGGCGACCATGGCCTCCCGGGCTTGCAGGGCCACCCTGGCCAGCAAGGCGCTCCTGGGAGAGTTGGGCTCCAAGGACCAAAGGGAACGAGAGGACTGGAGGGGCCTGCTGGCCTGCCTGGACCCCCAGGCCCCCGGGGATTCCAGGGCTCAGCGGGAGCCAGGGGAACCAATGGGGAGCGAGGGCCCCCAGGGGCTGTGGGGCCCACGGGGCTTCCAGGACCCAAAGGGGAGCGAGGGGAGAAGGGGGAGCCTCAGTCCCTCACCACCATCTTCCAGCTGGTGAGCCAGGCCTGCGAGTCAGCCATCCAGACACATGTGCTCAAGCTGGACTCCTTCCTCCATGAGAACTCCAGGCCCCCGATGCCCATCCTGGTCGAGACAGTAGAGCCAGGCAGGCCTGGGCCCCTGGGGACCCCCAGCCTTCGAAGCAAGGCCTCACTTCCTGGAGAACAGGGGCGCAGGGACCACCGTCCTGAGCACCAAGGCCAGCCTGTAGCTGTCAGCCAGCCGGGCAGCCCTGGGCCCAGGGTAGCCGGGCCCCAGCATCCCAGGAGGGGACAGGACGCGCCCCGTGCTGCCTCGAGTGACCCTGGGCCTTCCGCCCGCACCTTCCCCTGGGTGTCTGGACACTGGGAGAAGAGTCCTGGCGAGGCGAGAATGAGGCCCCAGGAAGAGTGA

XM_004840901.1 Coding sequence

Xrn2 5'-3' exoribonuclease 2

High confidence: 4 potential gene matches
Length: 3057 bp    Location: 21690995..21768267   Strand: +
>XM_004840901.1
ATGGTTCCACTCCCACCTACCGGCGTGCCTCACCTGGCCGGCCCGGCCGGCCCATCCCGGCGTGCCCCGCGGAGGCGCGTTTCATCACTTCCGGCCGCAACGCGCACGTGGGCGGAAGTGCAGGTGCCCGCGGCTGCTTTTCCTGCTGGTCTCTCTGGTTACACGGGTCGCCGGCCGGGCCGCTGCCTCGGCTGTGCCGCCGTTATGGGAGTCCCGGCGTTCTTCCGCTGGCTCAGCCGCAAGTACCCGTCCATCATTGTCAACTGCGTGGAAGAGAAGCCCAAAGAATGCAATGGTGTAAAGATTCCAGTTGATGCCAGTAAACCTAACCCAAATGATGTGGAGTTTGATAATCTGTATTTGGATATGAATGGAATCATCCACCCCTGTACTCATCCTGAAGATAAGCCAGCACCAAAAAATGAAGATGAAATGATGGTTGCAATATTTGAGTACATAGACAGACTTTTCAATATTGTAAGACCAAGACGTCTTCTGTACATGGCAATAGATGGAGTGGCACCACGTGCTAAAATGAACCAGCAGCGGTCAAGGAGGTTCAGAGCATCAAAAGAAGGAATGGAAGCAGCGATCGAGAAGCAGCGTGTCAGGGAGGAGATAATGGCAAAAGGTGGCTATCTTCCTCCAGAAGAAATAAAAGAAAGATTTGACAGCAACTGTATTACACCAGGAACTGAGTTCATGGACAATCTTGCTAAATGTCTTCGCTATTACATTGCTGATCGTTTAAATAATGACCCTGGGTGGAAAAATTTGACAGTTATTTTATCTGATGCTAGTGCTCCTGGTGAAGGAGAACATAAAATCATGGATTACATTAGAAGACAAAGAGCACAGCCTAACCATGACCCAAATACTCACCATTGTTTATGTGGGGCAGATGCTGATCTCATTATGCTTGGCCTCGCTACACACGAACCGAACTTTACCATTATTAGAGAAGAATTCAAACCAAACAAGCCCAAACCTTGTGGTCTTTGTAACCAGTTTGGACATGAGGTCAAGGATTGTGAAGGTTTGCCAAGAGAAAAGAAGGGAAAGCATGATGAACTTGGAGATAGTCTTCCATGTGCAGAAGGAGAGTTTATCTTCCTTCGGCTGAATGTTCTGCGTGAGTATTTGGAAAGAGAGCTCACCATGGCCAGCCTGCCATTCACATTTGATGTTGAGAGGAGTATTGACGATTGGGTCTTCATGTGCTTCTTTGTGGGAAATGACTTCCTTCCCCACTTGCCATCCTTAGAGATTAGGGAAGGTGCAATTGACCGTTTGGTTAACATATACAAAAACGTGGTGCACAAGACTGGGGGTTACCTTACAGAAAGTGGTTATGTCAATCTGCAAAGAGTACAGATGATCATGTTAGCAGTTGGTGAAGTTGAGGATAGCATTTTTAAAAAGAGAAAGGATGATGAGGACAGTTTTAGAAGACGACAGAAAGAAAAAAGAAAGAGAATGAAGAGAGATCAACCAGCTTTCACTCCTAGTGGAATATTAACCCCTCATGCCTTGGGTTCAAGAAACTCACCAGGTTCCCAAGTATCCAGTAACCCGAGGCAAGCAGCTTATGAAATGCGGATGCAGACCAACTCTAGCCCTTCCGTGTCTCCTAATACAAGTTTCACATCCGATGGCTCCCCGTCTCCACTAGGAGGAATTAAGCGAAAAGCAGAAGACAGCGACAGTGAGCCTGAGCCCGAGGATAATGTCAGGTTGTGGGAAGCTGGTTGGAAGCAGCGATACTACAAGAACAAATTTGATGTTGATGCAGCTGATGAGAAATTCCGTCGTAAAGTTGTACAGTCTTATGTTGAAGGACTTTGCTGGGTTCTTAGATATTATTATCAGGGCTGTGCTTCCTGGAAGTGGTATTATCCATTCCATTATGCTCCATTTGCTTCAGACTTTGAAGGTATTGCAGACATGCCTTCTGATTTTGAGAAGGGTACAAAACCGTTTAAACCACTGGAACAACTTATGGGAGTTTTTCCAGCTGCAAGTGGTAACTTTCTACCCCCATCTTGGCGGAAGCTCATGAGCGATCCTGATTCTAGTATAATTGACTTCTACCCTGAAGACTTTGCTATTGATTTGAATGGGAAGAAATATGCATGGCAAGGTGTTGCTCTGTTGCCCTTTGTGGATGAGCGAAGGCTGCGAGCTGCCCTAGAAGAGGTGTACCCAGACCTCACTCCAGAAGAAAACAGAAGAAACAGCCTTGGAGCTGATGTTTTGTTTGTGGGGAAACATCACCAACTCCATGACTTCATTTCTGAGCTGTACCAAACGGGTTCCACGGAGCCAGTGGATGTCCCACCTGAACTTTGCCATGGGATTCAAGGAAAATTTTCTTTGGATGAAGAGGCCGTTCTCCCAGATCAAGTAGTGTGTTCTCCTGTTCCCATGTTACGGGATCTGACACAGAACACTGCGATCAGTATTAATTTTAAAGACCCACAGTTTGCTGAAGATTATGTTTTTAAAGCTGTAATGCTTCCAGGAGCAAGAAAGCCAGCAGCAGTACTGAAGCCCAGTGACTGGGAAAAATCCAGCAATGGCCGTCAATGGAAGCCCCAGCTGGGCTTTAACCGGGACCGGAGGCCAGTGCATCTGGACCAGGCAGCCTTCAGGACTTTGGGCCATGTTATGCCAAGAGGCTCAGGGACTGGAGTTTACAGCAATGCTGCGCCACCCTCTGCAACTTACCAGGGAAATTTATACAGGCCGCTGTTAAGAGGACAAGCCCAGATCCCCAAATTGATGTCCAATATGAGGCCCCAGGATTCCTGGCGAGGTCCTCCTCCCCTTTTCCAGCAGCAGAGATTTGACAGAGGTGTTGGGGCAGAGCCTCTGCTGCCATGGAACCGGATGCTCCAAACCCAAAATGCAGCTTTCCAGCCAAACCAGTACCAGATGCTAGCTGGGCCGGGTGGGTATCCGCCCCGGCGAGATGATCGTGGAGGAAGACAGGGATATCCCAGAGAAGGAAGAAAATACCCTTTGCCACCACCCTCAGGAAGATACAGTTGGAATTAA

XM_004841043.1 Coding sequence

Arfgap1 ADP-ribosylation factor GTPase activating protein 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1191 bp    Location: 28971334..28986717   Strand: +
>XM_004841043.1
ATGGCCAGCCCAAGGACCAGGAAAGTTCTTAAAGAAGTCAGAGTGCAAGATGAGAACAACGTTTGTTTTGAGTGTGGTGCATTCAACCCTCAGTGGGTCAGCGTGACTTATGGCATCTGGATCTGCCTGGAGTGCTCTGGGAAACACCGCGGGCTTGGGGTGCATCTCAGCTTTGTGCGCTCTGTTACAATGGACAAGTGGAAGGACATTGAGCTCGAGAAGATGAAGGCTGGTGGGAATGCTAAGTTCCAAGAGTTCCTGGAGTCACAGGAGGATTATGATCCGTCCTGGTCCCTGCAGGACAAGTACAACAGCAAAGCCGCAGCACTCTTTAGGGATAAGGTGGCCACTCTGGCTGAAGGCAGAGAATGGTCTCTGGAGTCATCGCCTGCCCAGAACTGGACCCCACCTCAGCCCAAGATACTGGCATCTGCTGTCCACCGACCCTCTGGCCAGACACAGAATGTGACCGCCTCTGCTGACAAGGCTTTTGAGGACTGGCTGAATGATGACCTTGGCTCCTATCAAGGGGCCCAGGAGAATCGCTACGTGGGGTTTGGGAACACGGCCCCATCTCAGAAGAGGGAAGATGACTTCCTCAACAATGCCATGTCATCCCTGTACTCGGGCTGGAGCAGTTTTACCACCGGAGCAAGCAAGTTTGCCTCTGCAGCCAGGGAAGGTGCTACAAAATTTGGATCCCAAGCAAGTCAGAAGTTTTGGGGTTACAAGCAGCAGCCAGAGCCGGCTTCAGAGTTGGGCCACAGCCTGAATGAGAATGTCCTCAAGCCTGCGCAGGAGAAGGTCCAGGGGGTCGGCAGCAAGGGGTGGCGGGATGTCACCACCTTCTTCTCCGGGAAGACAGACGAGCCCCCAAGCAGGCTCATCGAGGGCCAGAGCTACCAGAACAGTGGCAGGGACATCTTCCAGAACAACACCGTAGACCAGAGCTTCTGGGAGACCTTTGGGAGCACCGAACCCCCCAAGGCCAAGTCCCCGAGCAGTGACAGCTGGACCTGCGCAGACACCTCGACAGGGAGGAGGAGCTCAGACAGCTGGGACGTGTGGGGCTCAGGCTCCGCGTCCAACAACAAGAACAGCAACAGCGACGGCTGGGAGAGCTGGGAGGCCACCAAGAAGGCCGCGCCCCCCGCGGCTGTTGACGAGGGCTGGGACGACCAGAGCTGGTAG

XM_004840599.1 Coding sequence

Bcl2l1 BCL2-like 1, transcript variant X1

High confidence: 3 potential gene matches
Length: 702 bp    Location: 788557..838506   Strand: +
>XM_004840599.1
ATGTCTCAGAGCAACTGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTCAGTGATGTGGAAGAGAGCAGGACTGAAGCCCCAGAAGGGACTGAATCAGAGATGGAGACCCCCAGTGCCATCAGTGGCAACCCATCCTGGCACCTGGCGGATAGCCCCACGGTGAACGGGGCAACTGGCCACAGCAGCAGTTTGGATGCCCGGGAGGTGATCCCCATGGCAGCAGTGAAGCAGGCTCTGAGGGAAGCAGGTGACGAGTTTGAACTTCGGTACCGGCGGGCATTCAGTGACCTAACATCTCAGCTCCACATCACCCCAGGGACAGCATATCAGAGCTTTGAACAGGTAGTGAATGAACTCTTCCGGGATGGGGTAAACTGGGGTCGCATTGTGGCCTTTTTCTCCTTCGGCGGGGCATTGTGCGTGGAGAGCGTAGACAAGGAGATGCAGGTATTGGTGAGGCGGATCGCAAGCTGGATGGCCACTTACCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGAGGCTGGGACACTTTTGTGGAACTCTACGGGAACAATGCAGCAGCCGAGAGCCGGAAGGGCCAGGAACGCTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCTGGCATGGTTCTGCTGGGCTCACTCTTCAGTCGGAAATGA

XM_004840603.1 Coding sequence

Id1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein

High confidence: 4 potential gene matches
Length: 456 bp    Location: 898248..897038   Strand: -
>XM_004840603.1
ATGAAGGTGGCCAGTGGTAGCGCCGCGCCCGCCGCGGGCCCCAGCTGCGCTCTAAAGGCTGGCAAGACGGCGGGCGGCGCGGGCGAAGTGGTTCGCTGCCTGTCCGAGCAGAGCGTGGCTATCTCTCGCTGCGCCGGGACGCGCCTGCCCGCCTTGCTGGACGAGCAGCAGGTAAACGTGCTGCTGTACGACATGAACGGCTGCTACTCGCGCCTCAAGGAGCTAGTGCCCACCCTGCCCCAGAACCGCAAAGTGAGCAAGGTAGAGATCCTGCAGCACGTCATCGACTACATCAGGGACCTGCAGTTGGAGCTGAACTCGGAATCCGAAGTCGGAACCCCAGGGGGCCGGGGGCTGCCGGTCCGGGCTCCGCTCAGCACCCTCAACGGCGAGATCAGCGCCTTGGCGACAGAGACAGCATGTGTTTCGGCTGACGATCGCATCTTGTGTCGCTGA

XM_004840679.1 Coding sequence

Vps16 vacuolar protein sorting 16 homolog (S. cerevisiae), transcript variant X1

High confidence: 4 potential gene matches
Length: 2520 bp    Location: 3959677..3991191   Strand: +
>XM_004840679.1
ATGGACTGCTACACAGCGAACTGGAACCCACTCGGAGACTCTGCCTTTTACCGGAAGTATGAACTATACAGCATGGACTGGGACCTGAAAGAGGAACTCAGGGACTGCCTGGTGGCTGCTGCACCCTATGGGGGCCCCATTGCGCTGCTGAGGAACCCCTGGCGAAAGGAGAAAGCTGCCAGTGTACGGCCCATGCTTGAGATCTATTCTGCTTCTGGTGTGCCCCTGGTCAGCCTGCTGTGGAAGAGTGGACCTGTGGTGTCCATGGGCTGGTCAGCTGAGGAAGAGCTGCTCTGCGTGCAGGAAGATGGTGCAGTACTGGTTTATGGGCTTCATGGTGACTTCCGGAGACACTTTAGCATGGGCAATGAGGTGCTGCAGAACCGGGTTCTAGATGCCCGGATCTTTCACACTGAGCTTGGTTCTGGGGTGGCCATCCTCACAGGGGCCCATCGCTTTACCCTCAGTGCCAATGTAGGCGACCTCAAACTCCGCCGGATGCCAGAGGTGCCAGGCCTGCAAAGTGCACCCTCATGCTGGACTACATTGTTCCAGGAACGAGTGGCACACATTCTTCTGGCCGTGGGACCTGATCTTTACCTCTTGGATCACGCAACCTGCTCTGTAGTGACACCCCCTGGACTACCTCCAGGAGTGACTAGCTTCCTGCAGATGGCTGTCTCCTTTACCTATCGACACCTAGCACTCTTCACAGACACGGGCTACATCTGGATGGGGACAGCATCATTTACGGACAAGCTGTGTGAGTTCAACTGCAACATCCGAGCACCCCCGAAGCAAATGGTCTGGTGCACCCGACCTCGAAGCAAGGAGAGGGCTGTCGTGGTGGCCTGGGAGAGGCGGCTAATGGTGGTGGGCAATGCACCTGAGAGCATCCAGTTTGTGCTAGATGAGGACTCCTACCTGGTTCCTGAGCTCGATGGGGTCCGCATCTTCTCCCGAAACACCCATGAGTTTCTGCATGAGGTTCCAGTGACCAGTGAGGAGATCTTCAAAATTGCCTCAATGGCCCCTGGAGCACTGCTATTGGAAGCCCAGAAGGAGTACGAGAAAGAGAGCCAGAAGGCAGATGAGTACCTACGAGAGATCCAGGAGCTGGGGCAGCTAACCCAGGCAGTACAGCAGTGCATTGAGGCTGCAGGACATGAGCACAGGCCAGACATGCAGAAGAGTCTGCTCAGGGCGGCCTCCTTTGGAAAGTGTTTCCTTGACAGATTTCCACCCGACAGCTTTGTACGCATGTGTCAGGACCTGCGTGTGCTCAATGCCATTCGGGACTACCACATTGGGATTCCCCTCACCTATAGCCAATACAAGCAACTTACTATCCAGGTGCTACTGGACAGGCTTGTGTTGCGGAGACTTTACCCCCTCGCTATCCAGATATGCGAGTACTTGCGACTTCCAGAAGTACAGGGCATCAGCAGGATCCTGGCTCACTGGGCCTGCTACAAGGTACAACAGAAGGATGTGTCAGATGAGGATGTTGCACGAGCCATTAATCAGAAGCTGGGGGACACTCCTGGTGTCTCATATTCAGACATTGCTGCACGGGCCTATGGCTGTGGCCGCACAGAGCTGGCCATCAAGCTCCTGGAGTATGAACCACGCTCAGGGGAGCAGGTACCCCTTCTCCTCAAGATGAAAAGGAGCAAACTGGCACTGAGCAAGGCCATTGAGAGTGGGGACACTGACTTGGTATTCACAGTGTTACTGCACCTGAAGAATGAGCTGAACCGAGGAGACTTTTTCATGACCCTCCGGAACCAGCCCATGGCCCTGAGTTTGTACCGACAGTTTTGTAAGCATCAGGAGCTAGAGACACTGAAGGACCTCTACAATCAAGATGACAATCACCAGGAGTTGGGCAGCTTCCACCTCCGAGCCAGCTATGCTGCAGAAGAGCGCATCGAAGGGCGAGTAGCAGCTCTGCAGATAGCAGCTGATGCCTTCTATAAGGCCAAGAACGAGTTTGCAGCCAAGGCCACAGAGGATCAAATGCGCCTCCTCCGGCTACAGCGGCGTCTAGAAGATGAGCTGGGAGGCCAGTTCCTAGACCTGTCTCTACATGACACAGTCACCACCCTCATTGTTGGTGGCCATAACAAGCGTGCGGAACAGCTGTCACGTGACTTCCGCATCCCTGACAAGAGGCTCTGGTGGCTGAAGCTCACTGCCCTGGCAGATTTGGAAGACTGGGAGGAGCTGGAGAAGTTTTCCAAGAGCAAAAAATCACCCATCGGTTACCTGCCCTTTGTGGAGATCTGCATGAAACAGCACAACAAATATGAGGCCAAGAAGTATGCATCCCGTGTGGGTCCTGAGCAGAAGGTCAAAGCTTTGCTTCTTGTTGGAGACGTGGCTCAGGCTGCAGATGTGGCCATCGAGCACCGGAGTGAGGCTGAGTTGAGTCTTGTGTTGTCCCACTGCACTGGAGCCTCTGATGGGGCCACAGCTGACAAAATTCAGCGGGCCAGAACACAAGCCCAGAAGAAGTGA

XM_004840637.1 Coding sequence

Scrt2 scratch homolog 2, zinc finger protein (Drosophila)

High confidence: 4 potential gene matches
Length: 924 bp    Location: 1769161..1756746   Strand: -
>XM_004840637.1
ATGCCGCGCTCCTTCTTGGTAAAGAAGATCAAAGGCGACGGTTTCCAGTGCAGCGGGGTGCCGGCGCCCACCTACCACCCCTTGGAGACCGCCTACGTGCTGCCTGGCGTCCGGGGGCCTCCCGGGGACAACGGTTATGTCCCGCACTGCCTGCCCCCCAGCAGCTACGATGCAGACCAGAAGCCCGGCCTGGAACTGGCGCCCGCTGAGCCCGTGTACCCGCCGGCGGCCGCGGAGGAGTACAGCGACCCCGAGAGTCCGCAGTCCAGCCTGTCGGCACGCTACTTCCGCGGGGAGGCGGCGGTGACCGACAGCTACTCCATGGACGCCTTCTTCATCTCGGACGGGCGCTCCCGGCGGCGGCGGGGCGGGGCCGGCGGGGACGCGGCGGGCGTGGGGGACGCGGGAGGCGCCGGGGAGCGCTCAGGGCGCGCGGGGGCGCCGACGGGCAGCGGGCACCGGCACGCGTGCGCCGAGTGCGGCAAGACGTATGCCACGTCGTCGAACCTGAGCCGTCACAAGCAGACGCACCGCAGCCTGGACAGCCAGCTGGCGCGGAAGTGCCCGACGTGCGGCAAGGCTTATGTGTCTATGCCCGCGCTCGCCATGCACGTGCTCACGCACAACCTACGCCACAAGTGCGGCGTGTGCGGGAAAGCCTTCTCGCGACCCTGGCTGCTGCAGGGCCACATGCGCTCGCACACTGGCGAGAAGCCCTTTGGCTGTGCGCACTGCGGCAAGGCCTTCGCGGATCGCTCCAACCTGCGCGCGCACATGCAGACGCACTCGGCCTTCAAGCACTACCGCTGCCGCCAGTGCGACAAGAGCTTCGCGCTCAAGTCCTACCTCCACAAGCACTGCGAGGCTGCCTGCGTCAAGGGCGCAGAGCCGCCCCCGCCGGCCCACCCTGGCTCAGCCAGCTGA

XM_004841111.1 Coding sequence

Znf512b zinc finger protein 512B, transcript variant X3

High confidence: 4 potential gene matches
Length: 2646 bp    Location: 29592156..29584787   Strand: -
>XM_004841111.1
ATGTCTGATCCCTTCTGTGTTGGAGGAGGCCGACGTCTCCAGGGGTCCAGCAAAAGTGGACCTGGGAAGGGTAGCAGCCGGAAAGAAGTCCGACTTCCGGTGCTGCAGGACCCACCGAAGCTGGGGATGCCGGTGGTCCACAGTGGACAGACAGTGCCTGGCCAGGCCCCTCTGTGCTTTGAACCAGGAAGTCCAGCCAGTGACCGGACAGAAGGGAAGAAAAAGGGGCGGCCGAAAGCTGAGAACCAGGCCCTCCGAGACATTCCTCTCTCCCTTATGAACCAGTGGAAGGATGAGTTCAAGGCACACTCAAGGGTGAAGTGTCCAAACTCAGGGTGCTGGCTGGAGTTCCCCAGCATCTACGGGCTCAAGTACCATTACCAGCGGTGCCAAGGGGGTGCTGTCTCAGATAGGCTGGCCTTCCCTTGCCCCTTCTGCGAGGCCGCATTCACTTCCAAGACTCAGCTGGAGAAACACCGGATTTGGAATCACATGGACCGTCCCCTGGCTACCCCGAAGCCTGGCCCTGTCAGCCGGCCAGTGACCGTCAGCCGGCCTGTTGGGGTCAGCAAGCCCATCGGAGTGAGCAAACCAGTCACTATCGGAAAGCCAGTGGGAGTCAGCAGGCCTATTGGCATCAGCAAGCCAGTCACAGTCAGCAGGCCCGTGCCAGTCCCAAGGCCCATGCCGGTCACCAAGCCTGTCACAGTCAGCAGGCCCATAACAGTCACCAAGGCCATGCCTGTCACCAGGCCTGTGCCTGTCACCAGGCCCATTCCAGTCACCAAGCCCGTGCCAGTCTCCAAGCTTGTGACAGTTACAAAACCCGTGCCGGTCACCAAGCCAGTTCCAATCAGCAGGCCCATTGTGGTCAGCAAGCCAGTGCCGGTCAGCAGGCCTGTCGCCATCAGCAGACACACACCGCCCTGCAAAATGGTGCTGCTGACCAAGTCTGAGAACAAAGCACTGCGTGCCCCAGGGAAGAGCAGCGGTAAGAAAAGGGCTGCAGACAGCCTGGATCCTTGCCCCATCCCACCCAAGCAGGCCAGGCCCGAGAATGGGGAGTATGGCCCATCTACCACAGGCCAGAGTATGGCCTTCCAGCTGAGCACCGACCCCAGCAATAGCTCCCTGCTGCTGGGAAGCAGGCCCTCGATGGGGAAGGAGGTGCTGCGGCCTGCGGGCCCTGTGTTCCCACCTGAGGAAGACCCAGAGCGCACAAAGCACAGAAGGAAACAGAAAACACCCAAGAAGTTTACAGGGGAGCAGCCATCCATCTCAGGGACCTTTGGGCTCAAAGGGCTAGCCAAAGCCGAGGACAAGGCCCGAATTCACCGCTCCAAGAGGCAGGAGGGGCTGGGCCCGGAGGACGTACGCAAGAAGGTGCCAGCTACCCCCATCACTGTCAGCAAGGAGGCGTCAACTCCTGTGACTCACCCTGCCCCAGGTGGCCCTGAAGAGCAGTGGCAGCGAGCCATCCATGAGCGGGGGGAGGCCGTCTGCCCCACTTGCAATGTGGTCACCAGGAAGACTATCGTGGGACTTAAGAAGCACATGGAGGTGTGTCAGAAGCTGCAAGATGCGCTCAAGTGCCAGCACTGTCGGAAGCAGTTCAAGTCCAAGGCTGGCCTCAACTACCACACCATGGCTGAGCACAGTGCCAAGCCCACTGATGCTGAAGCCTCAGAGGGGAGTGAGCAGGAGGAGCGGGAGCGGCTTCGAAAGGTGCTGAAGCAGATGGGGCGACTGCGCTGCCCCCAGGAGGGCTGTGGGGCTGCCTTCTCCAGCCTCATGGGCTATCAGTACCACCAGCGACGCTGCGGGAAGCCGCCCTGCGAGGTAGACACTCCCTCCTTCCCCTGCGCCCACTGTGGCAAGACCTACCGCTCCAAGGCTGGTCATGACTACCACGTGCGCTCAGAACACACGGCTCCGCCCCCCGAGGAATCCATGGACAAGACCCCTGAGGCAGAGGACCTGCTGGGTGTGGCCCGGACCCCAAGCGGTCGCATTCGCCGCACATCGGCCCAGGTTGCCGTGTTCCATCTGCAGGAGATCGCAGAAGATGAGCTGGCCCGCGACTGGACCAAGCGGCGCATGAAGGACGACCTTGTGCCTGAGACTGCACGGCTGAACTACACTCGGCCAGGCCTCCCTACACTCAACCCACAGCTGCTGGAGGCATGGAAGAATGAAGTCAAAGAGAAAGGCCACGTAAACTGCCCCAACGATTGCTGCGAAGCCATCTACTCCAGCGTGTCTGGTCTCAAGGCCCATCTTGCCAGCTGCAGCAAGGGGGACCACCTGGTAGGGAAGTACCACTGCCTGCTGTGTCCCAAAGAGTTCAGCTCTGAGAGCGGTGTCAAGTACCACATCCTCAAGACTCATGCAGAGAACTGGTTCCGGACCTCAGCAGATCCACCTCCCAAACACAGGAGCCAGGACTCCTTGTTGCCCAGGAGAGAGAAAAAGAAAACCCTGGGGGGTGGGAAGAAGCGGGGCCGCAAGCCCAAGGAACGGCCCCCTGAGGAGCCTGTGGCCAAGCTGCCCCCGAGCCGGGACGACTGGCCCCTGGGAGGCAAAGACAAGGGCGCTCGGGGCTCCACTGGGCGGAAGGTGGGAGCTGGCAAGGCATGTGAGAAGTGA

XM_004840770.1 Coding sequence

Prnp prion protein, transcript variant X3

Length: 735 bp    Location: 5785154..5802162   Strand: +
>XM_004840770.1
ATGGTGAACGCTGGCTGCTGGCTACTGGTTCTTTTTGTGGCTACATGGAGTGACATTGGCCTCTGCAAGAAGCGACCAAAACCAGGAGGAGGATGGAACAGCGGGGGCAGCCGTTACCCATCTCACAGCGGGGGCAACTGGGGCCAGCCCCATGGCGGTGGCTGGGGACAGCCCCATGGTGGTAGTTGGGGCCAGCCCCATGGTGGAGGCTGGGGACAGCCCCATGGTGGTGGCTGGGGTCATGGAGGTGGCACCTACAATCAGTGGAACAAACCCAGTAAGCCCAAAACCAACATGAAGCATATGGCAGGCGCTGCAGCGGCGGGGGCAGTGGTGGGAGGTCTGACTGGCTACATGCTGGGGAGTGCCATGAGCAGGCCCCTCATCCATTTCGGCAGTGATTATGAGGACCGTTACTACCGTGAGAACATGTACCGTTACCCCAACCAAGTGTACTACAGGCCCGTGGATCAGTACAACAACCAGAACAGCTTTGTGCAGGACTGCGTCAATATCACGATCAAGCAGCACACAGTCACCACCACCACCAAAGGGGAGAACTTCACCGAGACCGACGTGAAGATAATGGAGCGCGTACTGGAGCAGATGTGCACCACGCAGTACCAGAAGGAGTCCCAGGCCTACTACTACCGCGGAAGAGCCGGCTTGGTGCTCTTCTCCTCCCCACCTGTGATCCTCCTCATCTCCTTCCTCATCTTCCTGATAGTGGGATGA

XM_004840768.1 Coding sequence

Prnp prion protein, transcript variant X1

Length: 735 bp    Location: 5785158..5802162   Strand: +
>XM_004840768.1
ATGGTGAACGCTGGCTGCTGGCTACTGGTTCTTTTTGTGGCTACATGGAGTGACATTGGCCTCTGCAAGAAGCGACCAAAACCAGGAGGAGGATGGAACAGCGGGGGCAGCCGTTACCCATCTCACAGCGGGGGCAACTGGGGCCAGCCCCATGGCGGTGGCTGGGGACAGCCCCATGGTGGTAGTTGGGGCCAGCCCCATGGTGGAGGCTGGGGACAGCCCCATGGTGGTGGCTGGGGTCATGGAGGTGGCACCTACAATCAGTGGAACAAACCCAGTAAGCCCAAAACCAACATGAAGCATATGGCAGGCGCTGCAGCGGCGGGGGCAGTGGTGGGAGGTCTGACTGGCTACATGCTGGGGAGTGCCATGAGCAGGCCCCTCATCCATTTCGGCAGTGATTATGAGGACCGTTACTACCGTGAGAACATGTACCGTTACCCCAACCAAGTGTACTACAGGCCCGTGGATCAGTACAACAACCAGAACAGCTTTGTGCAGGACTGCGTCAATATCACGATCAAGCAGCACACAGTCACCACCACCACCAAAGGGGAGAACTTCACCGAGACCGACGTGAAGATAATGGAGCGCGTACTGGAGCAGATGTGCACCACGCAGTACCAGAAGGAGTCCCAGGCCTACTACTACCGCGGAAGAGCCGGCTTGGTGCTCTTCTCCTCCCCACCTGTGATCCTCCTCATCTCCTTCCTCATCTTCCTGATAGTGGGATGA

XM_004840591.1 Coding sequence

Pdrg1 p53 and DNA-damage regulated 1

High confidence: 4 potential gene matches
Length: 402 bp    Location: 575699..582009   Strand: +
>XM_004840591.1
ATGCTGTCTCCGGAGGCAGAGCGGGTGCTGCGATACCTGGTCGAGGTAGAGGAGCTCGCCGAAGAAGTGCTAGCGGATAAGCGGCAGATTGTGGACCTTGACACCAAAAGGAATCAGAACCGAGAGGGCCTGAGGGCCCTGCAGAAGGATCTCAGCCTCTCTGAAGATGTGATGGTTTGCTTTGGGAGCATGTTTATCAAGATGCCTCACTCTCAGACGAAGGAAATGATTGAGAAAGATCAGGAACACCTGGATAAAGAAATAGAAAAACTCCGGAAACAACTTAAAGTGAAAGTCAACTGTCTCTTTGAGGCTCAAGGCAAGCCGGAGCTGAAGGGCTTTAACTTGAACCCACTCAATCAGGATGAGCTTAAAGCTCTCAAGATCATCTTGAAAGGATGA

XM_004840592.1 Coding sequence

Dusp15 dual specificity phosphatase 15, transcript variant X1

Length: 729 bp    Location: 651550..660876   Strand: +
>XM_004840592.1
ATGGGGAATGGCATGACCAAGGTACTTCCTGGACTCTACCTTGGAAACTTCATTGATGCCAAAGACCCAGATCAGCTGGGACGGAATAAGATCACTCACATCATCTCTATCCACGAGTCGCCACAGCCTCTGCTGCAGGATATCATCTACCTTCGCATCCCAGTGGCTGATACCCCCGAGGTACTAATCAAAAAACACTTCAGAGAATGCATCGACTTCATCCACTCCTGCCGTCTCGACGGAGGGAACTGCCTTGTGCACTGCTCCGCCGGCAGCTGGAAGAGCGCTTTGGCGAGAGCCCGTTCCGCGACGAGGAGGACGTGCGCGCGCTGCTGCCGCTGTGCAAGCGGTGTCGCCAGGGGTCAGCGACCTCAGCCGCCTCGGCCGCGCCGCATTCGACCGCTTCGGAGGGGACCCTGCAGCGCCTGGTGCCGCGCGCGCCTCGGGACGCCCACCGGCCGCTGCCGCTGCTGGCGCGCGTTAAGCAGACTTTCTCCTGCCTCCCTCGGTGTCTGTCCCGCAAGGGCGGCAAGTGAGGACCCGCTTCCTCCCGGCGGACCCCTCTCTGGGCCTTCCTTCTTCGACCAGGATGGGCCCCAGGGTGTGGGAGCCCCAGCGGCCTGTCCCCTTGCCTGCCCCTTGCTTGTCGCGTCTCAGTCAGTGTGCCGCCCTCTGTGCCCTCTGTGCGTCTGTGTCTGGCCGGCCTGCTGCAGCCATCTGGTGCCTTAG

XM_004840593.1 Coding sequence

Dusp15 dual specificity phosphatase 15, transcript variant X2

High confidence: 4 potential gene matches
Length: 708 bp    Location: 651550..660652   Strand: +
>XM_004840593.1
ATGGGGAATGGCATGACCAAGGTACTTCCTGGACTCTACCTTGGAAACTTCATTGATGCCAAAGACCCAGATCAGCTGGGACGGAATAAGATCACTCACATCATCTCTATCCACGAGTCGCCACAGCCTCTGCTGCAGGATATCATCTACCTTCGCATCCCAGTGGCTGATACCCCCGAGGTACTAATCAAAAAACACTTCAGAGAATGCATCGACTTCATCCACTCCTGCCGTCTCGACGGAGGGAACTGCCTTGTGCACTGCTTTGCAGGCATCTCCCGCAGCACCACCATTGTGACAGCCTATGTGATGACAGTGACGGGACTAGGCTGGCGAGAAGTGCTTGAAGCCATCAAGTCCACCCGGCCTATTGCCAATCCCAACCCAGGCTTTAGGCAGCAGCTTGAAGAGTTTGGCTGGGGGACCTCTGGGAAGCTCCGCCGGCAGCTGGAAGAGCGCTTTGGCGAGAGCCCGTTCCGCGACGAGGAGGACGTGCGCGCGCTGCTGCCGCTGTGCAAGCGGTGTCGCCAGGGGTCAGCGACCTCAGCCGCCTCGGCCGCGCCGCATTCGACCGCTTCGGAGGGGACCCTGCAGCGCCTGGTGCCGCGCGCGCCTCGGGACGCCCACCGGCCGCTGCCGCTGCTGGCGCGCGTTAAGCAGACTTTCTCCTGCCTCCCTCGGTGTCTGTCCCGCAAGGGCGGCAAGTGA

XM_004841147.1 Coding sequence

LOC101717386 R-spondin-4-like

Length: 909 bp    Location: 1809669..1835371   Strand: +
>XM_004841147.1
ATGAAGGGCACTCTCAGGCCCTGGCTGGACTGCCAGTCCCATGGGCCCCCTGGGGCCCAGCACTTCGCCAGTGCACAGCAGGTCTTCAGCGGAGGGAAGGGATGGGGTGGCGGTGCGGAGCAGATGGACTGGGCGTCCGCAGGCTCGGGGTCCCCCGGTCCAGTCCAGGTGGCTCGGGAACTCCCGGCCAGCTGCGGGGGCTTGGGAGGGGACCCCGTTTTCCATGACAATGGATCTGGCTCTGTGGAGCTTCTGGCTCTTTCTGAAAATCAAATGATCATGAAAGTGGGCCCTGGCCTGGGGGGCAACTGCACAGGCTGCGTCATCTGCTCAGAGGAGAACGGCTGCTCCACCTGCCAGCAGAGGCTCTTCCTGCTCATCCGCCGTGAGGGCATCCGCCAGTACGGCAAGTGCGTGCACGACTGTCCACTCGGCTTCTTCGGCATCCGCGGCCAGGAGGTCAACAGGTGCAAAAAATGCGGGGCTACATGTGACAGCTGCTTCAGCCAGGACTTCTGCATCCGCTGCAAGAGACGATTCTTTCTGCACAAGGGGAAGTGTCTGCCCACCTGCCCACCAGGCACCTTGACCCACCAGAGCACCCGGGAGTGCCAGGAGGAATGTAAGCTGGGAGCCTGGGGCAGCTGGAGCCCCTGCACACATGACAGGAAGACCTGTGGTGCCACCTGGGGCCTGGAGACCCGCGTACGTGAGGCTGGGCTGGCCGGGCAGGAGGAGGAGGCCACCTGCCAGGTGCAGTCTGAGTCCAGGAAATGTCCCATCCAGAGGCCCTGTCCAGGAGAGAGAAATGCCCGCCAGAAGAAGGGCCGGAAGGACCGGCGCCAGCGCAAGGACAGAAAGCTGGAGCGCAGGCTGGATGGGAGGTCTCGCCAGCCTGGCCTACAGTGA

XR_205055.1 Non-coding sequence

LOC101705727 PREDICTED: Heterocephalus glaber uncharacterized LOC101705727 (LOC101705727), misc_RNA.

Length: 3017 bp     
>XR_205055.1
ACCCGGCGCGAGGGCGGCGGTGGGGGAGGGGCAGTGGATCCACGCGCCCGCGCTGCGTCAGTCGCCCACGGCGGCGGCGGCGGCAGCAGCAGCCCCGCGATCGCTAAGGAATGCGGCGGCCCCGCATAACCACGGGGTCAGGGGTCACGGCTCCGGCCTCCGCTTTCCCGCTCTGCTGAGGGACTGAGACAGGACCGGCGGCAGGGCGGAACGGCGAGACGCGGCTTTCCCTCCGGCGCTTGGGAAGAAGAGGAACAATCCTTCCCCCCAAAATTGACTTGGTTTCTGTACTTTTTTTCCAATCTACAGCTCACACATTAACCTTTGACATGGCATCTAGCTTATTTCAAATGTCTTTTTGAGTAGCTTCATACCACCACCACCATCACCTGTAAAGAGTAACTAGAGAAGATTCACTGTAATGTATATGTTTAGTACACGCACTGTGGTAAGCAGAATACTGTCTTCCCTGCTCACCTCAGATTGTCCAAGCTTTAGTGTCCCTAGAGTAGTGGTGGCAAACTTACGGAATGCATGCTACAGCAAGCTGTTTATATCTTTGAAAGCTCTAAAAGGTTGACCATCACTTCCCTAGAGCTTGTGAACATGTTACATTTAATGGCAAAAGGAATTTTACAGATGGAACCTTAAAATAGGGAGACTTACCCTAGATTTTCTAGGTGAGCCCAGTGTAATCACATGGGCATTTAAAAGCAGAAGAGGAAGGCAAAGACATTTTGGAGAGATAAAGTAGAATTAGAATCAAAGTTTGAGAGGGACTGTATTCACCGTTACTAGCTTTGAAAGTGGCCCTAAGTCAGGGATATAAACAGCTCCTAAAATCAGAGAAAAATCCCTACCAACAGCCAGCAAGAAAACAGGGATCTCAGTCCTATAACTTCATGGAACTGAATTCTGACAGCCCAGTTGAGTTTGGAAGCAGAGTCTCTAGAAAGAATATAGACACCTTGATCCTAGCCTTAGTCTTGAAGCAGAGAACCAGTTGAGCCATGCTGCCTCTGGGTTTCTGGCCCATAAGAAATACAAGATATAAATGAATGTTGTTTTATGCTACTAAATCTGTGGTAACTTTTTACAGCAGCAAAGATAGCTAATATAGGCACTGTGAAAACACTTTCATTTATTTCAGCAAACACTGCCTGGATCTCAAAGTTGGGTCAGGCCATAGAGGAATCCAGGTGTGAATATATCAAGGTGTGAATATATTTGCCTTTGCAGAATCAAACAGGAACTAATTACAATATCAAATCAAGCATGAAAAGAGAATATATTCAGAGGACTGTACAAGATATTTGTTGGAAAGTTGGCTTTAGTCATTAAACCTAAAGTAGTTGTGATTTTTTTTTTTTTTTACATTAACAAAGCTCCTGAGTTTATTTTCTTGCTAGAAGCACCAAAATACAAACCTATATATTTTTTGGTGATTTTTTTTTCTTTTTCATTATAGTAATTTTTACTATAAATTGTCTTTGGAAGTCGGCACAAGTGTCGTGGGCAATGTAAGATAAACAGGACTGACATTCAACCTGACCTAGGGCAAGGGATGAGTCTCTCTTTTCAGACTTATGAGCAAAGAACAAAACTAGTAGACACCCAGGAATTCCCAAGACACGTACACCCCCGAACCTCACAATGAGATGATGTATTTATTGCCTCTGGATCTGGACTCCAGCAAGCCCGGGTTTGAACTTCTTTGTAGTCCTTTTGCACCTGTGTGATCCCAGACCTCCACATGGCTGGAAATGGGGTTTAAATTACAAAAAAATAGCCAGGCATGGTAGAGCATGCCTATAATCCCAGCACTTGGGGACTAAGCAGCTAAGGCAGGAAGATTGCAAGTTCAAGGCCAGCACGAGCTATATGTCAAGACCCCGTCTCCAAAAAAAAGTTACCAAAAGGGCCACATTACATTTCACGCCTCTCCACGTGTCCAACGCAGACCAAGACCCCTGGCGAACACAAGACATTCAAGTGTCTTGGCTGCACGATCACCAGAGATGCTATGAGCAGCCCCGCCTGGGCCCACTTTCTACCCCCACAGCAAGACTCCAGTTGGCTCGCCTAACTGAAGCACCTGGGGAGCTGTTAACCACAACACTAGAGATAGAAACCAACCGAGGATGAAATGCGGACAGCTACAAGTGCTACAGTTATGTTATGACAAATGCCACTGTCAATCCAGTTGGCAGATGTGACCACCACATGGTCCTTGGAGACCAGATTCTCAGGTGAACTTCAATCAGATGGTGGCTCTCATCTGAGGGCCTGCCAAAATCAGCCCCAAGATTAAATAATAAGTTTGAAGTTCAAAATACAGTTTCCAAGATTTAGTAGTTTCTCAATTAAAAAAAAAATCCAAGAGATAAGTGGGCAGCAATTTCCAAGGTGCGCATTTGCCATCCTGGTGAATCAGCCCCCATCCCAACCCAGGATTCTGCCTCAACAATACATTCTTTGAACTCCTGCTTATTTTCCAACAAAAGTGACTTACACTATGCCAAGCTATGAGGGTTTTTTGTTTAGTTTTTGTTTTAACTCTTTAAGGAAAGAAGAGGGGAAGGTAAAGAGACATAACACATAGTTTGAGGGCATCTTATGAAAAACACAATTAAGAAACCTTTGGGCTAGGGATGTAGCTCAGTGGCACAGCACCTGCCTCACAAGAGCAAGGCCCTTGAGTTTGATCCCCAGTACCCCCCCCAAAAAAAAAGAAAAGAAAAGAAAAAGAAAAATGTGAGAAGCACTTGTTAAGGTCTTCCCCCACCCACATTCTTTTTTTGAGGTGTTGGGGATCAAACTCAGGGCCTCATACATTCTAGACAAGTGTTCTATCACCAAGCCATACCCCTAGCCCTGTCTCTCTTCATTTTATGTCTCTCTTCTTTGTTGCTATGTATTTTAAATGCCAGTATTGTAATTCAGTATTTTCCCCTTCTACCTTTCTTTTTTGTTTTTCTGTTTGTTTGTTTTTTTGGTACTGGGGATCGAACTCGGGT

XM_004840580.1 Coding sequence

Kif3b kinesin family member 3B

High confidence: 4 potential gene matches
Length: 2247 bp    Location: 314916..270834   Strand: -
>XM_004840580.1
ATGTTGAAGTTAAAAAGCTCGGAGTCAGTCCGGGTGGTGGTTCGCTGTCGGCCCATGAATAGCAAGGAAAAGGCTGCTTCCTACGACAAGGTGGTGGATGTGGATGTGAAGCTGGGGCAAGTATCGGTGAAGAACCCCAAAGGTACGGCCCATGAAATGCCCAAGACCTTCACCTTTGACGCAGTCTATGACTGGAACGCCAAGCAGTTTGAACTCTACGATGAGACATTCCGACCACTAGTAGACTCTGTGCTGCAAGGTTTCAATGGGACAATTTTTGCCTATGGACAAACTGGGACTGGGAAAACCTACACGATGGAAGGGGTCCGTGGTGACCCTGAAAAAAGAGGGGTCATCCCTAACTCATTTGACCACATCTTCACCCACATCTCTAGATCCCAGAATCAGCAGTATCTGGTCAGGGCTTCTTACTTAGAGATTTACCAGGAGGAGATCCGAGACCTGCTCTCAAAGGACCAGACCAAAAGGCTTGAGCTCAAAGAGAGGCCTGACACTGGGTTGTATGTGAAAGACCTGTCTTCCTTTGTCACCAAGAGCGTGAAGGAGATAGAGCACGTGATGAATGTGGGCAACCAGAACCGCTCTGTCGGTGCTACCAACATGAATGAGCACAGCTCACGTTCTCATGCGATCTTTGTCATCACTATCGAGTGTAGTGAGGTGGGCCTTGATGGTGAGAACCACATTCGTGTAGGGAAATTGAACCTTGTAGATCTGGCTGGCAGTGAACGGCAAGCCAAGACTGGTGCGCAAGGGGAAAGACTGAAGGAAGCAACCAAAATCAACCTCTCCCTTTCAGCCTTGGGGAATGTCATCTCTGCCCTGGTGGATGGCAAAAGCACACACATTCCATATCGAGACTCAAAGCTTACGAGGCTCCTCCAAGATTCCCTTGGTGGCAATGCCAAGACTGTGATGGTAGCCAATGTGGGGCCTGCCTCTTACAATGTAGAAGAGACTCTGACCACTCTAAGATATGCCAACCGTGCCAAAAACATTAAGAACAAGCCAAGGGTCAACGAGGACCCAAAAGATGCCCTCCTTCGAGAATTCCAGGAAGAAATTGCTCGGCTCAAAGCCCAGCTGGAAAAACGGTCCATTGGCAGAAGGAAGAGGCGAGAGAAGCGGAGGGAAGGTGGTGGCACTGGTGGGGATGGAGAAGATGAGGAGGAGGAGGGAGAAGAGGGGGAGGAGGAAGGAGATGATAAGGATGATTACTGGCGGGAACAGCAAGAAAAACTGGAGATTGAGAAGCGGGCTATTGTGGAGGACCACAGTTTGGTTGCAGAGGAGAAGATGAGGTTGTTGAAGGAGAAGGAGAAAAAGATGGAGGACCTGCGACGAGAGAAGGATGCTGCTGAGATGCTGGGCGCCAAAATCAAGGCTATGGAGAGTAAACTTCTTGTTGGAGGAAAAAATATAGTAGATCATACGAATGAACAGCAGAAAATCTTGGAGCAGAAACGGCAAGAAATTGCAGAACAGAAACGTCGAGAGAGAGAAATCCAGCAACAGATGGAAAGTCGAGACGAGGAGACCTTGGAACTTAAAGAGACATACAGCTCATTGCAGCAAGAAGTGGACATCAAGACCAAAAAACTCAAAAAGCTCTTCTCCAAGCTTCAGGCGGTGAAGGCTGAGATCCATGACCTCCAAGAAGAGCACATCAAGGAGCGCCAGGAACTGGAGCAGACGCAGAACGAGCTCACTCGAGAGCTGAAACTCAAGCATCTTATTATAGAAAACTTTATTCCTCTGGAAGAAAAGAGTAAAAATATGAACAGATCCTTTTTTGATGAAGAGGAAGATCATTGGAAATTACATCCTATAACCAGACTGGAGAATCAGCAGATGATGAAGCGGCCAGTCTCCGCTGTTGGCTATAAGAGACCATTGAGCCAACATGCAAGAATGTCCATGATGATTCGTCCAGAGTCCCGATACCGGGCAGAAAACACAATGCTCTTGGAACTGGACATGCCCAGCCGGACCACAAGAAATTACGAGGGCCCAGCCATTGCCCCCAAGGTCCAGGCTGCGTTGGATGCAGCTCTACAGGATGAAGATGAGATACAGGTGGATGCGTCGTCCTTTGAAAGCACTGCAATTAAGAAATCCAAGGCCAGACCTAAAAGTGGCAGGAAGTCAGGATCCTCTTCCTCGTCCTCCTCAGGAACCCCTGCATCTCAGCTGTATCCACAGTCTCGGGGGCTGGTTCCCAAGTAA

XM_004840583.1 Coding sequence

Pofut1 protein O-fucosyltransferase 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 1176 bp    Location: 364243..337959   Strand: -
>XM_004840583.1
ATGGGCGCCGCCGCGTGGGCACTGCCGCCCTTGCTGCTGCGTGTGTCTCTTCTGCTACTGCTTCTGCAGCTCCCGGGGCTGCCCGCGGGCTCCTGGGACCCGGCTGGTTACCTGCTCTACTGCCCGTGCATGGGGCGCTTTGGGAACCAGGCCGATCATTTCTTGGGCTCCCTTGCATTTGCAAAGCTACTGAATCGCACCTTGGCTGTACCTCCATGGATTGAGTACCAGCATCATAAACCTCCCTTCACCAATCTGCATGTGTCCTACAAGAAATACTTCAAGCTGGAGCCCCTCCAGGCCTACCATCGGGTCATCAGCCTGGAGGACTTCATGGAGAAGCTGGCACCCACCTATTGGCCTCCTGAGAAGCGGGTGGCATACTGCTTTGAGGTAGCAGCTCAGCGAAGCCCTGATAAGAAGACGTGCCCCATGAAGGAAGGAAACCCCTTTGGCCCATTCTGGGACCAGTTTCACGTGAGTTTCAACAAGTCGGAGCTTTTTGCAGGCCTTTCCTTCACCGCCTCCTATAAAGAACAGTGGATCCAGAGATTTTCACCAAAGGAACATCCGGTGCTTGCTCTACCAGGGGCCCCAGCACAGTTCCCCATCCTGGAAGAACACAGGTCACTCCAGAAGTACATGGTATGGTCAGACGAGATGGTGAAGATGGGAGAATCCCAGATCCGCAACCACCTCATCCGGCCCTATGTGGGCATTCATCTGCGCATTGGCTCTGACTGGAAGAATGCCTGTGCTATGCTGAAGGATGGCACCGTGGGCTCGCACTTCATGGCTTCTCCACAGTGTGTGGGCTACAGCCGCGTCACGGCAGCCCCACTTACCATGACCATGTGCCTCCCTGACCTGAAGGAAATCTGGCGGGCTGTGAAGCTCTGGGTGAGGGCGCTGAGCGCCCAGTCGATCTACATTGCCACTGATTCTGAGAGCTATGTGCCGGAGATCCAGCAGCTCTTCAAAGAGAAGGTACGAGTGGTGAGCCTCAAGCCAGAGGTGGCCCAGATCGACCTGTACATCCTTGGCCAAGCTGACCACTTTATTGGCAATTGTGTGTCATCTTTCACTGCCTTCGTGAAGCGCGAGCGGGATCTTCAGGGGAAGCAGTCCTCTTTCTTCGGCATGGACAGGCCCCCTCAACTGCGAGACGAGTTCTGA

XM_004840587.1 Coding sequence

Hck hemopoietic cell kinase, transcript variant X2

Length: 1509 bp    Location: 493821..455696   Strand: -
>XM_004840587.1
ATGGGGTGCTTGAAGTCCAAGTTCCTCCGGGATAGAGGGAAAATCTCCAAAACTGAGCCTAGCTCCAACCTGCACACCCCTGTGTATGTACCGGACCCCACGTCCTCAGTCAAGCTGGGGCCTAACAGCAACAGCAACCCCCCGGGGCTCATGGAGGGTTCCGAGGACTTCATTGTGGTTGCCTTGTATGATTACGATGCCATTCACAGAGAAGACCTCAGCTTCCAGAAGGGGGACCAAATGGTGGTCCTGGAGGAGTCTGGGGAGTGGTGGAGGGCGCAATCCTTGGCTACCCAGAAAGAGGGTTACATCCCAAGCAACTATGTGGCCCGCGTTAACTCTCTGGAGACAGAGGAGTGGTTCTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTCCTAGCTCCTGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACCAAAGGGAGCTACTCTTTGTCTGTTCGAGACTGTGACCCACAGCAAGGAGACACAGTGAAGCACTACAAGATCCGGACCCTGGACAATGGGGGCTTCTATGTCTCCCCGAGGAGCACCTTCAGCAGCCTGCAGGACCTGGTGGCCCACTACAAGAAGGGGAAGGACGGACTGTGCCAGAAGCTGTCATTTCCATGTGTGTCCTCCAAGCCCCAGAAGCCATGGGAGAAAGATGCCTGGGAGATTCCCCGGGAATCCCTCAAGCTGGAGAAGAGACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACCTACAACCAGCACACCAAGGTGGCAGTGAAGACAATGAAGCCGGGCAGCATGTCAGTGGAGGCCTTCCTGGAGGAGGCCAACATCATGAAGACGCTGCAGCATGACAAGCTGGTGAAGCTGCATGCAGTGGTCACGCAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCCTGCTGGACTTTTTGAAAAGTGAAGAAGGCAGTAAGCAGCCTTTGCCAAAACTGATCGACTTCTCTGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATTCACCGAGACCTCCGAGCTGCCAACATCTTGGTCTCCGCGTTGCTGGTGTGTAAGATCGCTGACTTCGGCCTGGCCCGGGTCATTGAGGACAATGAGTACACAGCTCGGGAAGGGGCCAAGTTCCCCATCAAGTGGACGGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCTGACGTCTGGTCCTTTGGCATCCTGCTGATGGAGATTGTCACCTATGGCCGGATCCCTTACCCAGGAATGTCCAACCCAGAGGTGATCCGGGCACTGGAGCATGGGTACCGGATGCCTCGGCCGGATCACTGCCCAGAGGAGCTCTACAACATCATGACACGCTGCTGGAAGAACCGTCCAGAGGAGCGGCCCACCTTCGAGTATATCCAGAGTGTGCTGGACGACTTCTACACGGCCACTGAGAGCCAGTACCAACAACAGCCTTGA

XM_004840598.1 Coding sequence

Tpx2 TPX2, microtubule-associated, homolog (Xenopus laevis), transcript variant X2

Length: 2223 bp    Location: 772427..709338   Strand: -
>XM_004840598.1
ATGTCACAAGTTAAAAACTCTTACTCCTTTGATGCTCCCTCGGACTTCATCAATTTTACATCTTTGGATTATGAGGAAGATACAGAAAATGTAGATTCATGGTTCGAGGAGAAGGCCAATTTAGAGAATAAGTTTCTTGGGAAAAATGGGACAGGAGAGCTTTTTCAGAACAAAACTTCCTTGAGAAAAGCAAATCTTCAGCAAGCTAGTCTCACACCTTTGCGACCAGTTGAGAACACTTACTACAAAGAGGCAGAAAAAGTAAATCTTACGGAACATTCTGATTCATCAAATGCTTGTTGCACCCTGGAAGTTGAGGGAACCAAATCAAGAAATGCTCCAGCCCAGCCTCAGAGGATATCTCTTAGACTCTCTGCCCAGAAGAATATGGAGAAGAAAGAAAAACACCATGTTCAAATGAAAGCAAAGAGATGTGCCACTCCTGTAATCAGTGAAATTCCACCTTCCAAGAAAATGAAAATTTCTCAAAACAGAAAGGATCCAGAGGAAGAGGAAGAGGGCAGTGCTCAAGATACTTCCAAAAAGAATAAATTTTCCCCAAAGAAAGCCAAGGGCAGACATACTACACCTCATGTACCAACTATAAAGCAGAAAGTTCTCAAAAGTACTGAGGAGCAAGAGTTGGAAAAGAGCATGAAAATGCAGCAGGAGGTGGTAGAAATGCGGAAAAAGAATGAAGAGTTCAAGAAACTTGCTCTTGCAGGAGCAGGGCAACCTGTGAAGAAATCAGTGAGCCAGGTAACCAAAGTAGTTGACTTCCACTTCTGCACAGATGAGCGAATCAAACAGCATCCTAAGAACCAGGAGGAATATAAGGAAGTGAACTTTACAGCTGAATTGCGAAAGCATCCTCCCTCTCCTGCTCGAGTGGCTAAGGGATGTACTATTATTAAGCCTTTCAACTTGTCCCAAGGAAGGAAGAGAACATTTGACGAGGCTGCTTCTGCATATGTGTCCCTGGCACAGCAGGTTGAGGCGTTCCATAAACGAACCCCTAACAGATATCATTTGAGGAGCAAGAAGGAAGATATTAGCCTTTTATCCTCCAAATCTTCTGTGACCAAGATATCCACAGAGCCACAGACCCCTGTACTGCAAACCAGATTCCGAGCGAGGCCTGTGACCTGCAAAAGTACAGTGGAACAGGAGGCTGAAGAGCTTGAGAAACTGCAGCAATACAAATTCAAAGCACGAGAAGTTGATTCCAGAATTCTTGAAGGTGGGCCCATCTTGCCCAAGAGACCACCTGTGAAACCACCCACTCAGCCTATTGGATTTGATTTGGAAATTGAGAAAAGAATCCAGGAGCGAGAGTCAAAGAAGAAGTCAGAGAATGAACACTTTGAATTTCATTCCAGACCTTGCCCTACTAAGATCTTGGAAGATGTTGTGGGTGTTCCTGAAAAGAAGGTACTTCCAATCACCGTTCCCAAGTCTCCAGCCTTTGCGTTGAAGAACAGAATCCGATTGCCCACCAAAGAAGATGAGGAAGAGGATGAACCGACAGTGATAAGAGCTCAGCCTATGCCACATTATGGCGTGCCTTTTAAGCCCCATATCCCAGAGGCAAGAACTGTAGAAATATGCCCTTTCTCCTTTGATTCTCGGGACAAAGAACGCCAGTTACAGAAGGAGAAGAAAATAAAAGAATTGCAGAAAGGAGAGGTACCCAAGTTTAAGGCACTTCCCTTGCCTCATTTTGATAGCATTAATCTGCCAGAGAAGAAGGTCAAGAATGTGACCCAGACTGAGCCATTTGCATTGGAGACTGACAAAAGAGGTGCTAGGAAGGCTGAGACATGGAAGCACCAGCTGGAGGAAGAACTGAAACAGCAGAAAGAAGCAACTTGTTTCAAGGCTCGTCCAAACACTGTCATCTTCCAGGAGCCCTTTGTTCCCAAGAAAGAGAAAAAATCAGTTGCTGTTCAGGAACCTTTTCAGTTGGCCACTGAGAAGAGAGCCAAGGAGCGACAGGAGCTGGAAAGGAGAATAGCTGAGGCGGAAGCCCAGAAAGCCCAGCAGCTGGAGGAGGCCAGAGAGCAGGAGGAAGAACAGAAGAAGGAGGAGCTGGCCAGGCTACGGAAAGAACTGGTGCACAAGGCAAATCCAATACGCAAGTACCAGGCTGTGGAGATAAAGTCAAGCAACCAGCCTCTGACTGTCCCTGTCTCTCCTAAGTTCTCCACTCGATTCCACTGCTGA

XM_004840604.1 Coding sequence

Hm13 histocompatibility (minor) 13, transcript variant X1

Length: 1281 bp    Location: 977661..923679   Strand: -
>XM_004840604.1
ATGGACTCGGCCCTTAGCGACCCGCACAACGGCAGCGCAGAGACAGGTGGTGCGGCCAACGGCACGACGCGTCCTCCCTCCACGCCCGAGGGCATCGCGCTGGCCTACGGCAGCCTGCTGCTTATGGCGCTCCTGCCCATCTTCTTCGGCGCCCTGCGTTCGGTGCGCTGTGCCCGCGGCAAGAACGCCTCAGACATGCCGGAAACCATCACCAGCCGAGATGCTGCCCGCTTCCCCATCATTGCCAGCTGCACACTCCTGGGGCTCTACCTCTTTTTCAAAATATTCTCCCAGGAGTACATCAACCTCTTGCTGTCAATGTATTTCTTCGTACTGGGAATCCTGGCCCTGTCCCACACCATCAGCCCCTTCATGAATAAGTTTTTCCCAGCCAACTTTCCAAATCGACAGTATCAGCTGCTCTTCACTCAGGGCTCTGGGGAAAACAAAGAAGAGATCATCAATTATGAGTTTGACACTAAGGACCTGGTGTGCCTGGGCCTAAGCAGCATTGTTGGCGTCTGGTACCTGCTGAGAAAGCACTGGATTGCCAACAACCTTTTTGGCCTGGCCTTCTCCTTAAACGGGGTGGAACTCCTGCACCTGAACAATGTCAGCACTGGCTGCATCCTGCTAGGTGGACTCTTCATCTATGATGTCTTCTGGGTATTTGGGACCAACGTTATGGTGACAGTGGCCAAGTCCTTTGAGGCACCAATAAAATTGGTATTTCCGCAGGATCTGCTGGAAAAGGGCCTCGAAGCAGACAACTTCGCCATGCTGGGACTCGGAGATATTGTCATTCCAGGGATCTTCATTGCCTTGCTGCTGCGTTTTGACATCAGCTTGAAGAAGAACACCCATACCTACTTCTACACCAGCTTCGCAGCCTACATCTTCGGCCTGGGCCTTACCATCTTCATCATGCACATCTTCAAACACGCCCAGCCTGCCCTCCTGTACCTGGTTCCTGCCTGCATCGGCTTTCCCGTTCTTGTGGCCCTGGCCAAGGGAGAAGTGACAGAAATGTTCAGCTACGAGTCCTCGGCGGAAATCCTGCCTCACACCCCGAGGCTCACCCACTTCCCCACAGTCTCGGGCTCCCCTGCCAGCCTGGCCGACTCCATGCAGCAGAAGCTAGCTGGCCCTCGTCGCCGGCGCCCACAGAATCCCAGCGCCATTTATGAGGAATCGAATCCTAAAGATCCAGCAGCAGTGATAGAATCCAAAGAAGCAACAGAGGCATCAGCATTGAAGGGGCTGGAGAAGAAAGAGAAGTGA

XR_205056.1 Non-coding sequence

Hm13 PREDICTED: Heterocephalus glaber histocompatibility (minor) 13 (Hm13), transcript variant X3, misc_RNA.

Length: 1458 bp     
>XR_205056.1
GAGCGGCGCGAGGCGGTGAGGAAGGCACGTCACTTCCTGTTTCTTTAGGAGAACGTGGCTTTCCCAGCAGCGCCCTTTCGGAAGTCTGAGTACCTGCAGCAGCAACGGCCGTGGAGCTGGAGTTAGAGCCAGAGCGCAGCCTCGTCATGGACTCGGCCCTTAGCGACCCGCACAACGGCAGCGCAGAGACAGGTGGTGCGGCCAACGGCACGACGCGTCCTCCCTCCACGCCCGAGGGCATCGCGCTGGCCTACGGCAGCCTGCTGCTTATGGCGCTCCTGCCCATCTTCTTCGGCGCCCTGCGTTCGGTGCGCTGTGCCCGCGGCAAGAACGCCTCAGACATGCCGGAAACCATCACCAGCCGAGATGCTGCCCGCTTCCCCATCATTGCCAGCTGCACACTCCTGGGGCTCTACCTCTTTTTCAAAATATTCTCCCAGGAGTACATCAACCTCTTGCTGTCAATGTATTTCTTCGTACTGGGAATCCTGGCCCTGTCCCACACCATCAGCCCCTTCATGAATAAGTTTTTCCCAGCCAACTTTCCAAATCGACAGTATCAGCTGCTCTTCACTCAGGGCTCTGGGGAAAACAAAGAAGAGATCATCAATTATGAGTTTGACACTAAGGACCTGGTGTGCCTGGGCCTAAGCAGCATTGTTGGCGTCTGGTACCTGCTGAGAAAGCACTGGATTGCCAACAACCTTTTTGGCCTGGCCTTCTCCTTAAACGGGGTGGAACTCCTGCACCTGAACAATGTCAGCACTGGCTGCATCCTGCTAGGTGGACTCTTCATCTATGATGTCTTCTGGGTATTTGGGACCAACGTTATGGTGACAGTGGCCAAGTCCTTTGAGGCACCAATAAAATTGGTATTTCCGCAGGATCTGCTGGAAAAGGGCCTCGAAGCAGACAACTTCGCCATGCTGGGACTCGGAGATATTGTCATTCCAGGGATCTTCATTGCCTTGCTGCTGCGTTTTGACATCAGCTTGAAGAAGAACACCCATACCTACTTCTACACCAGCTTCGCAGCCTACATCTTCGGCCTGGGCCTTACCATCTTCATCATGCACATCTTCAAACACGCCCAGCCTGCCCTCCTGTACCTGGTTCCTGCCTGCATCGGCTTTCCCGTTCTTGTGGCCCTGGCCAAGGGAGAAGTGACAGAAATGTTCAGCTACGAGTCCTCGGCGGAAATCCTGCCTCACACCCCGAGGCTCACCCACTTCCCCACAGTCTCGGGCTCCCCTGCCAGCCTGGCCGACTCCATGCAGCAGAAGCTAGCTGGCCCTCGTCGCCGGCGCCCACAGAATCCCAGCGCCATGTAATGCCCAGCGGGTGCCCACTTGCCCGCTTCCCCCACTGCCCTGGGCCCAAGTTATGAGGAATCGAATCCTAAAGATCCAGCAGCAGTGATAGAATCCAAAGAAGCAACAGAGGCATCAGCATTGAAGG

XM_004840620.1 Coding sequence

Nrsn2 neurensin 2, transcript variant X3

Length: 594 bp    Location: 1448058..1453940   Strand: +
>XM_004840620.1
ATGCTGGGCTGCAACCCCTGCAGCTGTGTAACCACCGTGGAGGAAAGCAAGTGGTATGGAGTCCACTCCTACCTGTACCTCTTCTACGAAGACTGCACTGGCATGGCTCTCAGTGATGACCCTGAAGGACCCCCAGTCCTGTGTCCCCACCAACTCTGGCCCTCACTGTGCTGGAAGATCTGCCTGTCCTCAGGGACCCTGCTTCTGCTGCTGGGGATAGCAGCTCTGACCACTGGCTATGTGGTGCCCCCCAAGTTGGAGACCGTCAACAATACTGACTTGCCGCTGCTAGATGAGCGGGCAGCCAACTACAACAAGGCCCTGAGCACCTGCCGCCTGGCAGGCACAGCACTCTGTGGGGCAGCTGGGATCCTGCTGACCATCTGCCTCTTGTGGGCCATGTCAGGATGGCTGAACCCAGACGCCAAGGCAGAGCCCTTGGACACTGAAGCTGATAGCCATGTGGAGGTCTTCAGGGATGAGCCAGGGCAGCAGCTGTCCCCCACCTTCTGCAATACCAGTGGTCAGTCATGGTTCTTGACCTCCTTTGGGCACTCCTCTGTTCAGATCATCCAGCCCAAGAGGGACTCCTGA

XM_004840622.1 Coding sequence

Rbck1 RanBP-type and C3HC4-type zinc finger containing 1, transcript variant X1

Length: 1587 bp    Location: 1503041..1523542   Strand: +
>XM_004840622.1
ATGGACGAGACGACCAAGAAAGCAGAGGAGATGGCCCTGAGCCTCGCCCGGGCGGTGGTGGGCGGGGATGAGCAGGCAGCTGTGAAGTATGCCACCTGGCTGGCACAGCAGCGGGCATCCCTGAGTGTGCATCTGAAGCCAGAGGTCCCACGGACACGGGACATCAGGCTGTGTGTGAGTGTGGAGGATGCCCATGTACAGACCGTCACCATCTGGCTCATGGTGCGCCCTGACATGACAGTGGCTTCCCTCAAGGACATGGTATTCCTGGACTATGGCTTCCCCCCGAGGCTGCAGCAGTGGGTGATTGGGCAGCGGCTGGCCCGAGACCAGGAGACACTGCACTCCCATGGGGTGCGGCGGAATGGGGACAGCGCCTACCTGTATCTGCTGTCAGCCCGAAACACCTCACTCAACCCACGGGAGGTTCAGCGCCAGCGCCAGCTTCGGATGCTGGAGGATCTGGGCTTCAAGGACCTCACACTCCAGCCACGGGGTCCCCTGGAGCCAGCTCCTTCCAACCCTGGGGTACCCCAGGAACTTGGAGGGGTACAACCCAATGGAGTGCCTGAGCCTCCACCGGTGGGCTGGCAGTGCCCTGGGTGCACCTTCATCAACAAACCTACCCGGCCTGGCTGCGAGATGTGCTGCTGTTCACGGCCGGAGGCCTACCAGGTGCCTGCCTCATACCAGCCCGATGAGGAGGAGCGGGCACGTCTGGCCGGCGAACAGGAGGCGCTACGTCAGTACCAGCAGCGGAAGCAGCAGCAGCAAGAGGGGAACTACCTGCAGCACGTGAAGCTGGAGCAGAGGAGCCTGGTGCTGAATACGGAGCCCGCCGAGTGCCCCGTGTGCTACTCGGTGCTGGCACCTGGTGAGGCGGTGGTGCTGCGGGAGTGTCTGCACACCTTCTGCAGGGAATGCCTCCAGGGCACCATCCGCAACAGCCAGGAGGCGGAGGTCTCCTGTCCCTTCATTGATGACACCTACTCGTGCCCGGGGAAGCTGCTGGAGAGGGAGATCCGGGCGGATCGGGGCTGTTTGCAGCTCCTGCCCCCCGAGGATTACCAGCGCTTTCTGGACCTGAGCGTCTCCATTGCAGAAAACCGCAGTGCTTTCAGCTACCACTGCAAGACCCCGGACTGCAAGGGCTGGTGCTTTTTTGAGGATGACGTCAATGAGTTCACCTGTCCCGTGTGTTTCCACATCAACTGCTTGCTTTGCAAGCTTCTCAGATCCCTGGGGAACCCTGTCACCCTGCAGGCCATCCACGAGCACATTAACTGCAAGGAGTATCAGGATGACCTGGCACTGCGGGCTCAGAATGACCTGGCTGCCCGGCAGACCACAGAGATGCTGCAGGTGATGCTGCAGCAGGGTGAGGCCATGCACTGCCCACGGTGCCGGATCGTGGTACAGAAGAAGGACGGCTGTGACTGGATCCGCTGCACTGTCTGCCACACTGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCCAGGGGCCCAGGGGACACCAGTGGGGGCTGCCGCTGCCGAGTGAATGGGATTCCTTGCCACCCAAGCTGTCAGAACTGCCACTAA

XM_004840668.1 Coding sequence

Snrpb small nuclear ribonucleoprotein polypeptides B and B1, transcript variant X2

Length: 687 bp    Location: 3703263..3695042   Strand: -
>XM_004840668.1
ATGACGGTGGGCAAGAGCAGCAAGATGCTGCAGCACATTGACTACAGGATGAGGTGCATCCTACAAGATGGCCGGATCTTCATTGGTACCTTCAAGGCTTTCGACAAGCATATGAATTTGATCCTCTGTGACTGTGATGAATTCAGGAAGATCAAGCCAAAGAACTCTAAGCAAGCAGAAAGGGAAGAGAAACGAGTCCTCGGTTTGGTGCTGCTTCGAGGGGAGAACCTGGTCTCCATGACAGTAGAAGGACCTCCTCCCAAAGATACTGGCATTGCCCGAGTGCCACTTGCTGGAGCTGCTGGGGGACCAGGAATTGGTAGGGCTGCTGGTAGAGGAATCCCAGCTGGTGTTCCCATGCCGCAGGCTCCTGCAGGACTTGCTGGGCCAGTCCGTGGGGTTGGTGGGCCATCTCAACAGGTGATGACCCCACAAGGAAGAGGCACTGTTGCAGCTGCAGCAGCTGCTGCCACAGCTAGTATTGCAGGGGCCCCGACCCAGTATCCACCCGGCCGTGGGGGTCCTCCCCCGCCTATGGGCCGAGGGGCCCCCCCTCCAGGCATGATGGGCCCTCCTCCTGGCATGCGGCCACCCATGGGTCCTCCAATGGGGATCCCTCCTGGACGAGGGACTCCTATGGGCATGCCCCCTCCAGGGATGCGGCCCCCTCCCCCAGGCCTTCTTTGA

XM_004840757.1 Coding sequence

Rnf24 ring finger protein 24, transcript variant X2

Length: 447 bp    Location: 5073597..5010471   Strand: -
>XM_004840757.1
ATGAGCTCGGATTTCCCACACTACAACTTCAGGATGCCTAATATTGGATTCCAGAATCTGCCTCTCAACATATATATTGTGGTTTTTGGCACTGCTATATTTGTCTTCATTCTTAGTTTACTCTTCTGTTGCTACCTGATTAGGCTAAGACATCAAGCACACAAAGAATTTTATGCCTACAAACAGGTTATATTAAAAGAGAAAGTGAAAGAGCTGAATTTACATGAGCTCTGTGCAGTGTGTCTAGAAGACTTCAAGCCCAGAGATGAGTTGGGGATTTGTCCATGTAAGCATGCCTTCCACAGAAAGTGCCTTATTAAGTGGCTGGAGGTTCGGAAAGTGTGTCCACTGTGCAACATGCCAGTTCTGCAGCTGGCCCAGTTGCACAGTAAGCAGAACCATGGTCCCCCCCAGGGACCCCTTCCTGGAGCAGAGAACATTGTATAG

XM_004840626.1 Coding sequence

Rbck1 RanBP-type and C3HC4-type zinc finger containing 1, transcript variant X5

High confidence: 4 potential gene matches
Length: 1533 bp    Location: 1503041..1523542   Strand: +
>XM_004840626.1
ATGGACGAGACGACCAAGAAAGCAGAGGAGATGGCCCTGAGCCTCGCCCGGGCGGTGGTGGGCGGGGATGAGCAGGCAGCTGTGAAGTATGCCACCTGGCTGGCACAGCAGCGGGCATCCCTGAGTGTGCATCTGAAGCCAGAGGTCCCACGGACACGGGACATCAGGCTGTGTGTGAGTGTGGAGGATGCCCATGTACAGACCGTCACCATCTGGCTCATGGTGCGCCCTGACATGACAGTGGCTTCCCTCAAGGACATGGTATTCCTGGACTATGGCTTCCCCCCGAGGCTGCAGCAGTGGGTGATTGGGCAGCGGCTGGCCCGAGACCAGGAGACACTGCACTCCCATGGGGTGCGGCGGAATGGGGACAGCGCCTACCTGTATCTGCTGTCAGCCCGAAACACCTCACTCAACCCACGGGAGGTTCAGCGCCAGCGCCAGCTTCGGATGCTGGAGGATCTGGGCTTCAAGGACCTCACACTCCAGCCACGGGGTCCCCTGGAGCCAGCTCCTTCCAACCCTGGGGTACCCCAGGAACTTGGAGGGGTACAACCCAATGGAGTGCCTGAGCCTCCACCGGTGGGCTGGCAGTGCCCTGGGTGCACCTTCATCAACAAACCTACCCGGCCTGGCTGCGAGATGTGCTGCTGTTCACGGCCGGAGGCCTACCAGGTGCCTGCCTCATACCAGCCCGATGAGGAGGAGCGGGCACGTCTGGCCGGCGAACAGGAGGCGCTACGTCAGTACCAGCAGCGGAAGCAGCAGCAGCAAGAGGGGAACTACCTGCAGCACGTGAAGCTGGAGCAGAGGAGCCTGGTGCTGAATACGGAGCCCGCCGAGTGCCCCGTGTGCTACTCGGTGCTGGCACCTGGTGAGGCGGTGGTGCTGCGGGAGTGTCTGCACACCTTCTGCAGGGAATGCCTCCAGGGCACCATCCGCAACAGCCAGGAGGCGGAGGTCTCCTGTCCCTTCATTGATGACACCTACTCGTGCCCGGGGAAGCTGCTGGAGAGGGAGATCCGGGCGCTCCTGCCCCCCGAGGATTACCAGCGCTTTCTGGACCTGAGCGTCTCCATTGCAGAAAACCGCAGTGCTTTCAGCTACCACTGCAAGACCCCGGACTGCAAGGGCTGGTGCTTTTTTGAGGATGACGTCAATGAGTTCACCTGTCCCGTGTGTTTCCACATCAACTGCTTGCTTTGCAAGGCCATCCACGAGCACATTAACTGCAAGGAGTATCAGGATGACCTGGCACTGCGGGCTCAGAATGACCTGGCTGCCCGGCAGACCACAGAGATGCTGCAGGTGATGCTGCAGCAGGGTGAGGCCATGCACTGCCCACGGTGCCGGATCGTGGTACAGAAGAAGGACGGCTGTGACTGGATCCGCTGCACTGTCTGCCACACTGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCCAGGGGCCCAGGGGACACCAGTGGGGGCTGCCGCTGCCGAGTGAATGGGATTCCTTGCCACCCAAGCTGTCAGAACTGCCACTAA

XM_004840628.1 Coding sequence

Tbc1d20 TBC1 domain family, member 20, transcript variant X1

High confidence: 4 potential gene matches
Length: 1212 bp    Location: 1550806..1525739   Strand: -
>XM_004840628.1
ATGGCCCTCCGATGTGAGCAGGGCGACGGCCCTACCTGCAGCCCCTGGGACGGTGGTACCCAGAAGACAGACTTCAACACCAAAAGGAAAAAGAAAGTGGCAGAGATCTACCAGGCTCTGAACAGTGATCCCACTGATGTGGCTGCCCTTAGACGCATGGCTATCAGTGAAGGAGGACTCCTGACCGATGAGATCAGACAAAAAGTGTGGCCCAAGCTCCTCAATGTCAACACCAGTGATCCATCACCTGCACCAGGAAAGGACCTACGGCAGGTGAGCAAGGACTACCAACAAGTGCTGCTGGATGTCAGGCGGTCCCTACGGCGCTTCCCCCCTGGCATGCCAGATGAACAGAGGGAAGGGCTCCAGGAAGAGCTCATCGACATCATCCTCCTCATCTTGGAGCGGAACCCTCAGTTGCACTACTACCAGGGCTACCATGACATCGTGGTCACATTTCTGCTGGTGGTAGGCGAGAAGCTGGCAACATCCCTGGTAGAAAAATTATCTACCCACCACCTCAGGGATTTCATGGATTCCACAATGGACAACACCAAGCACATATTAAACTACCTGATGCCCATCATTGACCAGGTGAATCCAGAACTCCATGACTTCATGCAGAGTGCTGAAGTGGGGACCATCTTTGCCCTCAGCTGGCTCATCACCTGGTTTGGGCATGTCCTGTCTGACTTCAAGCACGTGGTGCGGTTATATGACTTCTTCCTGGCCTGTCACCCGCTGATGCCCATTTACTTTGCAGCTGTGATTGTGTTATACCGTGAGCAGGAAGTCCTGGACTGTGACTGTGACATGGCCTCGGTCCACCACCTGTTGTCCCAGATCCCTCAGGACCTGCCCTATGAGACACTGATCAGCAGGGCAGGGGACCTCTTTGTTCAGTTTCCCCCTTCTGAGCTCACACGAGAGGCAGCTGCCCAGCAACAGGCTGAGAGAACGGCAGCCTCTACCTTCAAAGACTTTGAGCTGGCGTCAGCCCAGCAGAGGCCGGACATGGTGCTTCGGCAGCGGTTTCGGGGACTTCTGCGCCCAGAGGCTCGAACAAAGGATGTCCTGACCAAACCAAGGACCAACCGCTTTGTGAAACTGGCAGTGATGGGGCTGACGGTGGCACTTGGAGCAGCTGCATTGGCAGTGGTGAAGAGTGCCCTGGAGTGGGCCCCGAAGTTCCAGCTGCAGCTGTTCCCCTGA

XM_004840633.1 Coding sequence

Csnk2a1 casein kinase 2, alpha 1 polypeptide, transcript variant X4

Length: 1176 bp    Location: 1635285..1566550   Strand: -
>XM_004840633.1
ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACGCACAGACCCCGAGAGTACTGGGATTATGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAACTGGTTAGAAAACTAGGCAGGGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAGGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTAAGAGGAGGCCCCAATATCATCACATTGGCAGACATTGTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACATGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAAATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTGAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGGCTAATAGACTGGGGCCTAGCTGAGTTTTATCATCCTGGTCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGCCCTGAGCTACTTGTAGACTATCAGATGTATGATTATAGTTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTCCGGAAGGAGCCGTTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGATTATATTGACAAATACAACATTGAATTAGATCCCCGTTTCAATGATATCTTGGGCAGACACTCTCGTAAGCGATGGGAACGCTTTGTCCACAGTGAAAACCAGCACCTTGTCAGCCCAGAGGCCTTGGATTTCCTGGATAAGCTGCTGCGATATGATCACCAGTCACGGCTCACTGCAAGAGAAGCCATGGAACATCCCTATTTCTATACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCAGGGGGCAGTACACCTGTCAGCAGCGCCAACATGATGTCAGGGATTTCTTCAGTGCCAACCCCTTCACCCCTCGGACCTCTGGCAGGCTCACCAGTGATTGCTTCTGCCAACCCCCTTGGGATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA

XM_004840650.1 Coding sequence

Snph syntaphilin, transcript variant X2

Length: 1722 bp    Location: 2578398..2622540   Strand: +
>XM_004840650.1
ATGCCTGGCAGCGGCCCCAGTGAGAGGATGACATGGCCCGGCCCGGCCTTCCCTGCTGGCCCCCCAACCTGCCCTCTTTCTTCAGCCCCAGGGACACCACCCATTCCACCCCTTACTCGGACCCGCAGCCTCATGGCCATGTCCCTGCCAGGGAGCAGACGGGCCTCTGCTGGATCCCGCAGTGGGGGCGCTTTGAGCCACAGTGGCCTGGCAGTGTTCGCTCAGTGCCCACAGCTGCCCCCCAGCCAGAATGAGCACCTGCCTCTTCTCCCTGCCTCCAGGCGCACCTCTCCACCCGTGAGCGTGCGGGATGCCTATGGTACCTCTTCCCTCAGCAGTAGCAGCAACTCAGGCTCCTGCAAGGGCAGCGACAGCAGCCCCACACCCAGGCGCTCCATGAAGTACACACTGTGCAGTGACAACCATGGCATCAAGCCCCCCACCCCGGAGCAGTACCTGACCCCCCTGCAGCAGAAAGAGGTGTGCATCCGGCACCTGAAGGCGCGGCTGAAGGACACACAGGACCGGCTCCAGGACCGGGACACAGAGATCGATGACCTGAAGACACAGCTATCACGCATGCAGGAGGACTGGATTGAGGAGGAATGCCACCGTGTGGAGGCTCAGCTAGCCCTGAAGGAAGCCCGCAAGGAAATCAAACAGCTCAAACAGGTCATTGACACTGTCAAAAACAACCTGATTGACAAAGACAAGGGGCTGCAGAAATACTTTGTGGACATCAACATCCAGAACAAGAAGCTAGAGACGCTGCTGCACAGCATGGAGGTGGCCCAGAATGGCATGGCCAAGGAGGAGGGCACTGGGGAGTCGGCTGGTGGTTCCCCTGCCCGCTCCCTCACCCGCAGTTCCACTTATACCAAGCTGAGTGACCCAGCTGTCTGCGGTGACCACCAGCCTGGTGATCCCTCCGCCTCTGCTGAAGATGGAACCGACAGTGGCTTTGTGGCTGCTGATGACACACTAAGCCGGACTGACGCTCTAGAGGCCAGCAGCCTGCTGTCATCAGGGGTGGACTGTGGCCCTGAGGAGGCCTCGCTGCACAGCTCCTTCAGCCTGGGTGCCCGCTTCCCTGCCAGTAACACCTATGAGAAGCTTCTGTGTGCCACAGAAGCTGGTGTGCAGGCCAGCTGCATGCAGGAGCGGGCCATCCAGACAGACTTTGTGCACTACCAACCCGACCTGGACACCATCCTGGAGAGAGTGACACAGGCCCAGGGCTGTGGGACAGTCCCTGAGGACAGGCACCCAGAGTCAGATTCCCACCCCCCAGGGCCCAGAGACCCCAACTCAGCAGTGGTGGTGACAATGGGTGATGAGCTTGAGGTCCCGCAGGCCATCACCCATGGGCCCACTGTACACCGGCCTGGAGCCAACCCCAACCCTGGTCTGTCGGTGAGTGTGGTATGCCCTGTGGAGGAGGAGGAGGAGGAGGTGGCCACGCCTGCGGCTACAGCTGAAAAGGAGCCCAAGAGCTACTGGAGTCGCCACTACATCGTGGATCTTCTGGCTGTGGTGGTGCCAGCCATGCCCACAGTAGCCTGGCTTTGCCGCTCCCAGCGACGCCAGGGCCAGCCCATCTACAACATCAGCTCCCTGCTGCGGGGCTGCTGCACTGTGGCCTTGCACTCCATCCGCAGGATGAGCTGCCGCTCTCTAGCCCACTCAGGGCCCAGTTCAGCAAGCAGTAGCTCCCAGCTCTGA

XM_004841156.1 Coding sequence

Tmc2 transmembrane channel-like 2

High confidence: 4 potential gene matches
Length: 2673 bp    Location: 3723601..3786971   Strand: +
>XM_004841156.1
ATGAGCCCTCCACCAAAGGGCATGGAGGTGGAAGGTGACAGGTCAGGAAGGAGATCCTCGAGAAAGCAGGCTCACAAAGCTGAAGGTCTGGTGGGCAAGCATGGAGCCCAGCCTGGCCAGAAGGAGCGGGTCAGAGGCAGCCCAAGGCCCAGGTCCCCCCAGAGGAAGCAGACAGAATTTAGGATCTGCCGTGAAGAGCTGCGGGGACAGGAGCGGAGCCCAGCCATGAGGACTGGCGAGTCGAGGAGGAAGAGAGATGGGAGAGCTTCCTTCAAGGAGCAGAGAGCATCCCCAAAGAAGGACAAGAAGGTTCTGAGGAAGGAGGAGAGGTGGAAGAAGCTGAAGAAACCCAGGTCATTGTCCTTGGCCTCCAGTACCTCTGGAGTGGAGTCTCCATACTCTGAAGAGGAGCTGGCCCAGATCCTCGAGCAAGTGGAAGAAAAAAAGAAGCTCATTGCCACCATGAGGAACAAGCCCTGGCCCATGGCAAAGAAGTTGACTGAACTCAGGGAGGCCCAAGAATTTGTGGAGAAGTATGAAGGAGCCCTAGGAAAGGGGAAAGGCAAGCGACTCTACGCCTACAGGATGCTGATGGCTAAGAAATGGGTCAAGTTTAAGAGAGATTTTGATAATTTTAAGACTCAGTGTATTCCTTGGGAAATGAAGATCAAGGACATTGAAAGTCACTTTGGTTCTTCAGTGGCATCATATTTCATCTTTCTTCGATGGATGTATGGAGTTAACTTGGTCCTTTTTGGCTTAATATTTGGTCTAGTCATAATTCCAGAGGTACTGATGGGTGTGCCCTATGGAAGCATTCCCAGAAAGACTGTGCCTCGGGCTGAGGAAGAAAAAGCCATGGACTTTTCTGTCCTTTGGGATTTTGAGGGCTACATCAAGTATTCTGCTCTCTTCTATGGCTACTACAACAACCAGAGGACCATTGGGTGGCTGAGGTACAGGCTGCCCATGGCTTACTTTATGGTGGGGATCAGCGTGTTTGGCTACAGTCTGATGATTGTCATTAGATCGATGGCCAGCAATACCCAGGGGAGCACAAGCGAGGGAGAGAGTGATAACTTCACATTCAGCTTCAAGATGTTCACCAGCTGGGACTACTTGATTGGGAATTCAGAAACAGCAGACAACAAATACGCCTCCATCACCACCAGTTTCAAGGAATCAATAGTGGATGAACAAGAGAGTAACAAAGAAGAAAATATCCACCTGACAAGATTTCTTCGTATCTTGGCCAACTTTCTCATCATCTGCTGTTTGTGTGGGAGTGGGTACCTCATTTACTTTGTGGTGAAGAGATCCCAGGAGTTTTCCAAAATGCAGAATGTCAGCTGGTATGAAAGGAACGAGGTAGAGATTGTGATGTCCCTGCTTGGGATGTTTTGTCCCCCTCTCTTTGAAACCATCGCTGCACTGGAGAATTATCACCCTCGAATTGGACTGAAGTGGCAGCTGGGGCGCATCTTCGCACTCTTCCTAGGGAACCTCTACACATTTCTGTTGGCTCTAATGGATGATGTCCATCTCAAGCTTTCTAATGAAGCAACGATAAAGAACATCACTCACTGGACTCTGTTTAACTATTACAATTCCTCGGGTTGGAATGAGAGTGTCCCCCGGCCACCCCTACACCCTGCAGATGTGCCCCGCGGTTCTTGCTGGGAGACAGCTGTGGGCATTGAATTCATGAGGCTGACTGTGTCCGACATGCTGGTAACATACATCACCATCCTGCTAGGGGACTTCCTACGGGCTTGTTTTGTCCGGTTCATGAATTACTGCTGGTGCTGGGATCTGGAGGCTGGATTTCCATCATACGCTGAGTTTGATATTAGTGGAAATGTGCTGGGTTTGATCTTCAACCAAGGCATGATCTGGATGGGCTCCTTCTATGCTCCAGGACTGGTGGGCATTAACGTCCTGCGCCTGCTGACCTCCATGTACTTCCAGTGCTGGGCAGTGATGAGCAGCAACGTCCCCCATGAACGCGTGTTCAAAGCCTCCAGATCCAACAACTTCTACATGGCCCTGTTGCTGCTGGTCCTCTTCCTCAGCCTCCTACCAGTGGCCTATACCATCATGTCCCTCCCACCCTCCTTTGACTGCGGCCCATTCAGTGGGAAAAACAGAATGTATGACGTCCTCCAAGAGACCATTGAAAATGATTTCCCGACCTTCCTGGGCAAGATCTTTGCTTTCCTTGCCAATCCAGGACTGATCATCCCAGCCATCCTACTGATGTTCCTGGCAATCTACTACCTGAACTCAGTTTCCAAAAGCCTTTCCAGAGCCAATGCCCAGCTGAGGAAGAAAATCCAAGCACTCCGTGAAGTTGAGAAGAGCCACAAATCTGTCAAAAACAGAGCCACAGACAGAGATTCAGGGGACACACCTAAAAGCTCCAAAAATTCCACCCAGCTGCAAATCACCAAGCCAGAGCCCGCATCTCACTCTGCTAGCCAAAGCCAGTTCCTGGACAAGAAGGCACAGGACACTGGGACCACCAGTTCTGCCAGTGGGACCCTGCTGCCTGCCTCCCAGCACCTTCCTGGATCTCAGCCTCCAGGAGTCAAACCTGATTCTGGCAAACTCCAGTCTCGGACTCATCCCTGGAGGTCAGCCTCTGGAAAGAGTGCTCAGAGGCCTCCCCATTGA

XM_004840756.1 Coding sequence

Rnf24 ring finger protein 24, transcript variant X1

Length: 492 bp    Location: 5038193..5010471   Strand: -
>XM_004840756.1
ATGCCTAATTTTTTTTCCATTCTTTGCTTCCCCCATAGTTCATCCATGAGCTCGGATTTCCCACACTACAACTTCAGGATGCCTAATATTGGATTCCAGAATCTGCCTCTCAACATATATATTGTGGTTTTTGGCACTGCTATATTTGTCTTCATTCTTAGTTTACTCTTCTGTTGCTACCTGATTAGGCTAAGACATCAAGCACACAAAGAATTTTATGCCTACAAACAGGTTATATTAAAAGAGAAAGTGAAAGAGCTGAATTTACATGAGCTCTGTGCAGTGTGTCTAGAAGACTTCAAGCCCAGAGATGAGTTGGGGATTTGTCCATGTAAGCATGCCTTCCACAGAAAGTGCCTTATTAAGTGGCTGGAGGTTCGGAAAGTGTGTCCACTGTGCAACATGCCAGTTCTGCAGCTGGCCCAGTTGCACAGTAAGCAGAACCATGGTCCCCCCCAGGGACCCCTTCCTGGAGCAGAGAACATTGTATAG

XM_004840658.1 Coding sequence

Nsfl1c NSFL1 (p97) cofactor (p47), transcript variant X1

Length: 1119 bp    Location: 2774032..2749501   Strand: -
>XM_004840658.1
ATGGCGGCGGAACGACAGGATGCGCTGAGGGAGTTTGTGGCGGTAACGGGCGCTGAGGAGGACCGGGCCCGCTTCTTCCTCGAGTCGGCCGGCTGGGACCTGCAGATTGCGCTAGCGAGCTTTTATGAGGACGGAGGGGACGAAGACATTGTGACCATTTCACAGGCAACCCCCAGTTCAGTGTCCAGAGGCACAGCCCCCAGTGATAATAGGGTGACATCCTTCAGAGACCTTATTCATGACCAAGATGAGGATGACGAAGAGGAAGAGGGCCAGAGGAGCAGGTTTTATGCTGGGGGCTCAGAGAGAAGTGGACAACAGATTGTTGGCCCTCCCAGGAAGAAAAGTCCCAACGAGCTGGTGGATGATCTCTTTAAAGGTGCTAAGGAGCACGGAGCTGTAGCTGTGGAGCGAGTGACCAAGAGCCCTGGAGAGACCAGTAAACCAAGACCCTTTGCAGGAGGTGGCTACCGTCTTGGAGCAGCACCAGAGGAAGAGTCTGCCTATGTGGCAGGAGAAAGGAGACAGCATTCCAGCCAGGATGTTCATGTCGTTCTGAAGCTCTGGAAAAGTGGATTCAGCCTGGACAATGGCGAGCTCAGAAGCTACCAAGACCCATCCAATGCCCAGTTTCTGGAGTCAATCCGCAGAGGGGAGGTGCCAGCAGAGCTGCGGAGGTTAGCTCATGGTGGGCAGGTGAACTTGGATATGGAAGACCATCGGGATGAGGACTTTGTGAAGCCTAAGGGAGCTTTCAAAGCTTTCACTGGTGAAGGCCAGAAACTCGGCAGCACAGCCCCCCAGGTATTGAGTACCAGCTCTCCAGCCCAGCAGGCAGAAAATGAAGCCAAAGCCAGCTCTTCTGTCTTAATCAACGAGTCAGAGCCTACTACCAACATCCAAATTCGACTTGCCGATGGTGGGAGACTGGTACAGAAATTTAACCACAGCCACAGGATCAGCGACATCCGACTTTTCATCGTGGATGCCCGGCCAGCCATGGCTGCCACCAGCTTTGTCCTCATGACTACCTTTCCAAACAAAGAGCTGGCTGACGAGAGCCAAACTCTGAAGGAAGCCAACCTACTCAATGCTGTCATCGTGCAGCGGTTAACATAA

XM_004840666.1 Coding sequence

Stk35 serine/threonine kinase 35

High confidence: 4 potential gene matches
Length: 1608 bp    Location: 3360648..3404611   Strand: +
>XM_004840666.1
ATGGGCCACCAGGAATCTCCGCTGACCCGAAGAGCGGCGAGAGGCGCAGCTTACGTAAAGAGGTTATGTAAAGGGGTCAGCGAGCGCGAACACGTGGAAAACCACGGGAACCTGGAAGCCTGGGCCCCCTTGTCGAGTGCCACTGCCACCACCGGTGCAGCACTACAGCCTGTCGCCCGCCCAGCCCGGGCCAACTACTCCCGCGCTACTCGGTCCCGGAGGCTGCTCCGGCTTGGAGCGGACCATTTCCCGGCGAGGGCTCCAGGGGGGAAACGCGCCGCCCGGAAGTGGAGCAGCGCCAGCCAGGTCACAATCCAAGGTCCCGCTCCTTCGCGTGCCGGGACCGGACGAAGGGATGAAGCAGGGCGGACCCGGGCAGCACCGTTGCTGCTCCCCCCGCCGCCCGCAGCCATGGAAACGGGGGAGGAGGACGGCGCCCGCCGAGGTACACAAAGCCCGGAGCGGAAAAGGCGAAGCCCAGTGCCGAAGGCGCCCAGCGAGAAGCTGAGGCCGGCAGCTGCGGCCCAGGCAATGGATCCAGTGGCGGCCGAGGCCTACCTGGCGCGCCGGCGGCCCGAGGTTAGCAGCGGGTCTGCGCCGCCCCGCTACAGCCTGTTGGCGGAGATCGGGCGCGGCAGTTACGGCGTGGTTTACGAGGCAGTAGCCGGGCGCAGCGGGGCCCGGGTGGCGGTCAAGAAGATCCGCTGCGACGCCCCTGAGAATGTGGAGCTGGCGCTGGCCGAATTTTGGGCCCTGACCAGCCTTAAACGGCGCCACCAGAACGTCGTACAGTTTGAAGAGTGCGTCCTGCAGCGCAACGGGCTCGCCCAGCGCATGAGCCACGGCAACAAGAGTTCGCAGCTTTACCTGCGCCTGGTGGAGACCTCGCTCAAAGGAGAAAGGATCCTGGGCTATGCTGAAGAGCCCTGCTATCTCTGGTTTGTCATGGAGTTCTGTGAAGGTGGAGACCTGAATCAGTACGTCTTGTCCCGGAGGCCAGACCCAGCCACCAACAAAAGCTTCATGCTACAGCTCACGAGCGCCATTGCCTTCCTGCACAAAAACCACATCGTACACAGGGACCTAAAGCCAGACAACATCCTCATCACAGAGCGGTCGGGCACTCCCATCCTCAAAGTGGCAGACTTTGGACTGAGCAAAGTCTGTGCTGGGCTGGCACCTCGAGGCAAAGAGGGCAATCAAGACAACAAAAATGTGAATGTGAATAAATACTGGCTATCATCAGCCTGTGGCTCAGACTTCTACATGGCCCCTGAAGTCTGGGAGGGACACTACACAGCCAAGGCAGACATCTTTGCCCTGGGCATTATCATTTGGGCAATGATAGAAAGAATCACTTTCATAGACTCTGAGACCAAGAAGGAGCTCCTAGGGACCTATATTAAACAGGGAACTGAGATTGTCCCTGTTGGTGAGGCGCTGCTAGAAAACCCAAAGATGGAGTTGCACATCCCACAGAAACGTAGGACTTCCATGTCTGAGGGGATCAAGCAGCTCTTGAAAGATATGTTGGCTGCTAACCCACAGGACCGGCCTGATGCCTTTGAACTTGAAACCAGAATGGACCGGGTCACATGTGCTGCTTAA

XM_004841154.1 Coding sequence

Tgm3 transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)

High confidence: 4 potential gene matches
Length: 2169 bp    Location: 3543982..3585575   Strand: +
>XM_004841154.1
ATGAGTGGAGGACAGTGTGAGAAGACCGTGACCCCTCCCAGAGTCACTGTGTATCTCAGGACTTCAGGCTCTGCTTTCTGTGTCACAGCTTTAGAGCTCCAGAATGTCGACTGGCAAGTGGCCGACAACCGGCGTGCACATCACACAGGACAGTTCTCCTCCCGGGAGGTCATCTTGCGCAGAGGCCAGTCATGTAATATAGTAGCGTTCTTTAACCGTGCTCTTAACTCTGAAGAAGGTCTGAATCTCACAGCTGAAACAGGTCCTAACCCCTCAGAGTCAGCCAGGACAAAGGCCACATTTCCAGTCGCCAGTGGCAGAAGCACAGGTGGCAGCTGGGCTGCAGAGGTCATGGAAAATAATGGCAATGCTCTGACCATTGCCATTTACAGTCCTGCCAGTGCCCCCATCGGAAGGTACACACTGAGCCTTCAGATCTCCTCCAAGGGCAGAGTCTCCTCTGTGAAACTTGGGACATTCGTGCTGCTCTTTAATCCCTGGCTACAAGCGGATGATGTTTTTATGAGTAACCAGGCTGAGAGACAAGAATATGTTGAGGAAGATTCTGGCATCATCTTCGTGGGCAGCACAAATCGAATTGGCATGGTTGGCTGGAACTTTGGACAGTATGAAGAAGACATTCTGAATATCAGCCTCTCCATCTTGGATAAGAGTCTGAATTTCCGACGTGACCCTGGTACTGACGTGGCCCGCAGAAACGACCCCAAATATGTTGGCCGGGTGCTGAGTGCCATGATCAATAGCAATGACGACAACGGTGTGATCGCTGGGAATTGGAGTGGCAGTTACACAGGTGGCCTGGACCCAAGGAACTGGAATGGCAGTGTGGAGATCCTCAAGGAGTGGAAAAAATCTGGCTTCAGGCCAGTCCGATTTGGCCAGTGCTGGGTCTTTGCTGGGACACTCAACACAGTGCTGCGCTGCTTGGGGATTCCCTCCCGGGTGATCACCAACTTCAACTCCGCTCATGACACAGACCGAAACCTCAGTGTGGATGTCTACTACGACCCCATGGGAAACCCACTGGACAAGGGCAGTGATAGTGTGTGGAATTTCCATGTCTGGAACGAAGGCTGGTTTGTGCGGAATGACCTGGGCCCCTCATACAATGGATGGCAGGTGTTGGATGCTACTCCCCAGGAGAGGAGCCAAGGGGTCTTCCAGTGTGGCCCCGCTTCAGTCATCGCAGTCCGAGAGGGGGATGTGGACCGGAATTTCGACATGCCCTTCATCTACTCGGAGGTCAATGCTGATCGCATTACCTGGATCTATAATGCTTCCAACGGTACCCAGAAGCAGAACTCCATAGATACTCGGTCGGTTGGCAGGTACATCAGCACCAAGGCAGTGGGCAGCTACTCTCGCATGGACATCACAGACAAGTACAAGTACCCAGAAGATTCCAATGAGGAAAGACGAGTGCAAGAAAAGGCCTTGAGCAAACTTAAACCAAATCCATCATTTGGCGCAACATCTGCAGAGGACTTGCCAAGAGAGGAACGGGCACCCAGCATCTCTGGGAGATTCAAGGTGAATGGTGTATTGGCAGTGGGCCAAGAAGTCAACCTAGCCCTGCTGCTCAAAAACTTGGCCAGTGATAGGAAGACAGTGACAGTGAACATGACAGCCTGGACCATCGTCTACAATGGCACACTTGTACATGAGGTGTGGAAGGGCTCTGCCACAGTATCCCTGGACCCTGAAGAAGAAGTGCAACATCCCGTGAAGATTACGTATGCCCAGTATGATAAGTACCTGAAGGCAGACAACATGATCCGGACCACAGCTGTATGCAAGGTGTCTGATGAGGCTGAGGTGGTGGTAGAACGGGACATCATCCTGGACAACCCCACCTTGACCCTGGAGGTGCTGGACCGTGCCCGAGTGAGGAAGCCTGTCAATGTGCAGATGCTCTTCTCCAACCCCCTGGATGAACCCGTGAAGGACTGTGTGCTGATGGTGGAGGGCAGCGGCCTGCTGCGGGGCAACCTCAAGATTGAGGTGCCAGCCCTGCGCCCCAAGGAGCGGTCCCGGGTCCGTTTTGAGATCCTGCCCACCCGGAGTGGCACCAAGCAGCTGCTTGCAGACTTCTCCTGCAACAAGTTCCCAGCGATCAAGGCTATGCTGTCCATCGACGTGGTCGAGTGA

XM_004840674.1 Coding sequence

Ebf4 early B-cell factor 4, transcript variant X2

High confidence: 4 potential gene matches
Length: 1794 bp    Location: 3834231..3892353   Strand: +
>XM_004840674.1
ATGGACACTCTGCCCCGCGGGGGGCTGAACCTCAAGGAGGAGCCGCTGTTGCCCGCCGGCCTGGGCTCTGTGCGCTCCTGGATGCAGGGCGCGGGCATCCTAGACTCCAACACCGCAGCGCAGAGTGGTGTGGGCCTGGCACGAGCACATTTTGAGAAGCAGCCCCCCTCCAACCTCAGGAAATCCAACTTCTTCCATTTTGTGCTGGCCATGTACGACCGGCAGGGGCAGCCCGTGGAGGTGGAGCGCACAGCATTCATCGACTTCGTGGAAAAGGACCGAGAACCTGGAGCAGAAAAGACAAACAATGGAATCCATTATCGCCTCCGGCTGGTATATAACAATGGGCTTCGGACAGAGCAAGACCTCTATGTGCGTCTCATCGACTCCATGTCCAAGCAGGCTATCATCTATGAAGGTCAGGACAAGAACCCCGAAATGTGCCGAGTACTGCTTACCCACGAGATTATGTGCAGCCGGTGCTGTGACCGGAAGAGCTGTGGCAACCGGAATGAGACACCCTCAGATCCGGTCATTATTGACAGGTTCTTCCTCAAATTCTTCCTCAAATGCAACCAGAACTGCCTAAAGAATGCAGGGAATCCCCGAGATATGCGCCGCTTCCAGGTGGTAGTATCCACGACGGTGAGCGTGGATGGACACGTGCTGGCTGTGTCCGACAACATGTTCGTGCACAACAATTCCAAGCATGGCCGCAGGGCCCGCCGCCTGGACCCTTCCGAAGCTGCCACCCCCTGCATCAAGGCCATCAGCCCGGGGGAAGGCTGGACCACGGGAGGCGCCACCGTCATTGTCATCGGCGAGAACTTCTTCGACGGGTTGCAGGTCGTGTTTGGAAACATGCTCGTGTGGAGCGAGCTCATCACGCCCCACGCCATCCGGGTGCAGACACCCCCCCGACACATCCCCGGGGTGGTGGAGGTGACTCTCTCCTACAAGTCCAAGCAGTTTTGCAAGGGAGCCCCCGGCCGCTTTGTCTACACAGCTCTGAATGAGCCCACCATTGACTATGGCTTCCAGAGGCTACAGAAGGTCATTCCCAGGCACCCTGGGGACCCTGAGAGGCTTCCCAAGGAAGTGCTGCTGAAGCGGGCGGCCGACTTGGCGGAGGCCCTGTACGGAATGCCTAGCAGTAACCAGGAGCTCCTCCTGAAGCGCGCGGCGGATGTGGCCGAGGCTCTGTACAGCGCCCCCCGAGCACCCGCACCGCTCGGACCCCTGGCCCCCAGCCACGCGCATCCTGCAGTGGTGGGCATTAACGCCTTCAGCAGCCCGCTCGCCATCGCCGTCGGGGACGCCACACAGGGGCCTGAGCCGGGCTACGCGCGCAGCTGCAGCAGCGCGTCCCCACGCGGATTCGCACCCAGCCCCGGCTCGCAGCAGAGCAGCTATGGCAGCGGCCTGGGAAGCGGCCTTGGCAGCTACGCGCCTGGGGTGGCCGGGCTTGGGGTGCCCGGGTCCCCTAGCTTCCTCAACGGCTCTACGGCCACCTCACCTTTCGCCATCATGCCCTCTAGCCCCCCACTGGCGGCTGCCTCCTCCATGTCCCTCCCGGCTGCTGCCCCCACCACTAGCGTCTTCTCCTTCTCGCCTGTCAACATGATCTCTGCTGTGAAACAGAGGAGCGCCTTTGCCCCTGTGCTACGTCCACCAAGCTCCCCACCCTCGGCCTGCCCCAGAGCCCATGGAGAGGGGCTTCCAGATCAGCCTTTTGAGGATTCTGACAAGTTCCATTCTCCAGCCCGGGGGCTTCAAGGCCTGGCATACTCCTAA

XM_004840673.1 Coding sequence

Ebf4 early B-cell factor 4, transcript variant X1

Length: 1806 bp    Location: 3834677..3892353   Strand: +
>XM_004840673.1
ATGTTCCCCGCGCAGGACACTCTGCCCCGCGGGGGGCTGAACCTCAAGGAGGAGCCGCTGTTGCCCGCCGGCCTGGGCTCTGTGCGCTCCTGGATGCAGGGCGCGGGCATCCTAGACTCCAACACCGCAGCGCAGAGTGGTGTGGGCCTGGCACGAGCACATTTTGAGAAGCAGCCCCCCTCCAACCTCAGGAAATCCAACTTCTTCCATTTTGTGCTGGCCATGTACGACCGGCAGGGGCAGCCCGTGGAGGTGGAGCGCACAGCATTCATCGACTTCGTGGAAAAGGACCGAGAACCTGGAGCAGAAAAGACAAACAATGGAATCCATTATCGCCTCCGGCTGGTATATAACAATGGGCTTCGGACAGAGCAAGACCTCTATGTGCGTCTCATCGACTCCATGTCCAAGCAGGCTATCATCTATGAAGGTCAGGACAAGAACCCCGAAATGTGCCGAGTACTGCTTACCCACGAGATTATGTGCAGCCGGTGCTGTGACCGGAAGAGCTGTGGCAACCGGAATGAGACACCCTCAGATCCGGTCATTATTGACAGGTTCTTCCTCAAATTCTTCCTCAAATGCAACCAGAACTGCCTAAAGAATGCAGGGAATCCCCGAGATATGCGCCGCTTCCAGGTGGTAGTATCCACGACGGTGAGCGTGGATGGACACGTGCTGGCTGTGTCCGACAACATGTTCGTGCACAACAATTCCAAGCATGGCCGCAGGGCCCGCCGCCTGGACCCTTCCGAAGCTGCCACCCCCTGCATCAAGGCCATCAGCCCGGGGGAAGGCTGGACCACGGGAGGCGCCACCGTCATTGTCATCGGCGAGAACTTCTTCGACGGGTTGCAGGTCGTGTTTGGAAACATGCTCGTGTGGAGCGAGCTCATCACGCCCCACGCCATCCGGGTGCAGACACCCCCCCGACACATCCCCGGGGTGGTGGAGGTGACTCTCTCCTACAAGTCCAAGCAGTTTTGCAAGGGAGCCCCCGGCCGCTTTGTCTACACAGCTCTGAATGAGCCCACCATTGACTATGGCTTCCAGAGGCTACAGAAGGTCATTCCCAGGCACCCTGGGGACCCTGAGAGGCTTCCCAAGGAAGTGCTGCTGAAGCGGGCGGCCGACTTGGCGGAGGCCCTGTACGGAATGCCTAGCAGTAACCAGGAGCTCCTCCTGAAGCGCGCGGCGGATGTGGCCGAGGCTCTGTACAGCGCCCCCCGAGCACCCGCACCGCTCGGACCCCTGGCCCCCAGCCACGCGCATCCTGCAGTGGTGGGCATTAACGCCTTCAGCAGCCCGCTCGCCATCGCCGTCGGGGACGCCACACAGGGGCCTGAGCCGGGCTACGCGCGCAGCTGCAGCAGCGCGTCCCCACGCGGATTCGCACCCAGCCCCGGCTCGCAGCAGAGCAGCTATGGCAGCGGCCTGGGAAGCGGCCTTGGCAGCTACGCGCCTGGGGTGGCCGGGCTTGGGGTGCCCGGGTCCCCTAGCTTCCTCAACGGCTCTACGGCCACCTCACCTTTCGCCATCATGCCCTCTAGCCCCCCACTGGCGGCTGCCTCCTCCATGTCCCTCCCGGCTGCTGCCCCCACCACTAGCGTCTTCTCCTTCTCGCCTGTCAACATGATCTCTGCTGTGAAACAGAGGAGCGCCTTTGCCCCTGTGCTACGTCCACCAAGCTCCCCACCCTCGGCCTGCCCCAGAGCCCATGGAGAGGGGCTTCCAGATCAGCCTTTTGAGGATTCTGACAAGTTCCATTCTCCAGCCCGGGGGCTTCAAGGCCTGGCATACTCCTAA

XM_004840675.1 Coding sequence

Cpxm1 carboxypeptidase X (M14 family), member 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 2196 bp    Location: 3936636..3930428   Strand: -
>XM_004840675.1
ATGTGGGGTCCGCTGCTCACCTTGGCCGCCTTCGCGCCTGCCGTTGGTCTGGGTCTGGGGACGCCCAGCGCCTCAGTGCTGGACCTGGCGCGGCCCTCGACCACGGAACCCCTGGGCTCGACCCTGGCCCCGAGTAGCAGCCCTGCACTGCCGCCAGCGAAGGCGAACGGAACCTTGAAACAGCACACCCGGATTCGAATCATCAGGAAGAAAAAGGTCATTCTGAAGAAGCGAAAGAAACTAACTAGTCCCAGTTTCCCAGTGACTGCCAAGCCTTTGGTGACCACCAGCTCAGCAGGGACTCTCAACCTCTTTGAGAAACAGGAACCAGGCTGTCCCCCTTTGGGCCTGGAGTCCCTCCGAGTTTCAGATAGCCAGCTTGAGGCATCCAGCAGCCAGTCTTTTGGTCTTGGACCACACCGAGGACGGCTCAACATCCAGTCAGGCCTGGAGGATGGTGATCTGTATGATGGGGCCTGGTGTGCCGAGCAGCAGGACACTGAGCCATGGCTTCAGGTGGACACTAGGAAACCCACCCGCTTCTCAGGCATTGTCACACAGGGCAGGAACTCTATCTGGAGATATGACTGGGTCACATCATACAAGGTCCAGTTCAGCAATGACAGTCAGAACTGGTGGAGGAGTCGGAATCACAGCAGTGGGATGGACTCGGTATTTCCTGCTAATTCTGACCCAGAAACCCCAGTGCTGAACCTCCTGCCAGAGCCCCAGGTGGCCCGCTTCATTCGTCTGCTGCCCCAGACCTGGCTCCAGGGAGGCTCATCTTGCCTCCGAGCAGAGATCCTGGGCTGCCCCATCTCAGATCCTAATGACCTGTTCCCTGAGACCCACACACCAGGGTCCTCTGACCCTCTGGACTTTCAGCATCACAATTACAAGGCCATGAGGAAGCTGATGAAGCAGGTGAATGAGAAGTGTCCCAACATCACCCGCATCTACAGCATCGGGAAGAGCTACCAGGGCCTGAAGCTATATGTGATGGAAATGTCAGACCATCCTGGGGAGCATGAGCTGGGGGAGCCTGAGGTACGCTATGTGGCTGGCATGCATGGGAATGAGGCCCTGGGGCGCGAGTTGGTTCTGCTCCTGATGCAGTACTTGTGCCGGGAGTACCTGCGAGGGGACCCACGAGTGACCCGGCTGCTCAATGAGATGCGCATCCACCTGTTGCCCTCCATGAACCCTGATGGTTATGAGATTGCCTACCGCCGGGGCTCGGAGCTGGTGGGCTGGGCAGAGGGTCGCTGGACCCACCAGAGCATTGACCTTAACCACAATTTTGCTGATCTCAACACACAACTGTGGGATGCAGAGGACGATGGGCTAGTGCCCCATATAGTCCCCAACCATCACCTGCCACTGCCTACTTATTACACCCTGCCCAATGCAACTGTGGCTCCTGAAACATGGGCAGTGATCAACTGGATGAAACGGATCCCCTTTGTGCTGAGTGCCAACCTTCATGGGGGTGAGCTGGTGGTGTCCTACCCATATGACATGACTCGGACCCCGTGGGCTGCCCGTGAACTCACGCCTACACCAGATGATGCAGTCTTCCAGTGGCTCAGCACGGTCTACGCTGGCACTAGTCGGGTGATGCAGGACACAGATCGTCGGCCCTGCCACAGCCAAGACTTCTCCTTGCATGGCAATATCATCAACGGGGCTGACTGGCACACAGTCCCTGGGAGCATGAATGACTTCAGTTATCTACACACTAACTGCTTTGAGGTCACTGTGGAGCTGTCCTGTGACAAGTTCCCTCATGAGAGTGAGCTGCCCCAGGAGTGGGAGAACAACAAAGATGCCCTCCTCACATACCTGGAACAGGTGCGCATGGGCATTGCAGGAGTTGTGCGGGACAAGGACACGGAGGAGGGGATTGCTGATGCTGTCATTGTTGTGGATGGGATTAACCATGATGTTACAACGGCATGGGGTGGGGATTACTGGCGGCTGCTAACCCCAGGGGACTATATGGTGACTGCCAGTGCTGAAGGCTACCATGCAGTGACACGGAGCTGCCAGGTCACCTTTGAAGAGGGACCAACCCCCTGCAATTTCTTGCTCACCAAGACTCCCAAACAGAGACTGAGAGAGCTGCTGGCAACAGGGGCCAAGGTCCCCCCAGACCTTCGGAGGCGGCTGGAGCGGCTGAGAGGACAGAAAGATTAA

XM_004840684.1 Coding sequence

Pced1a PC-esterase domain containing 1A, transcript variant X1

Length: 1536 bp    Location: 3959322..3953955   Strand: -
>XM_004840684.1
ATGAGCCCTCTTCTGCCGCTGCTACCGCCACCTCCTGTAACCCTGAGCATCTTGGGAGGAGCCTGCGCAGGTCTCTTTTATCCTGGGGCGGGACCTAGGGCCGACCTGCCCTGTGTCCCCGCCCTCGAGCGGTTTAGTGGCCTCTCCCTGCAGCCGGTTGGTGTCGGTGACAGCATGGTCTTCTGTCTGGAAAGCGAGGTGCTGCGCCGCCCGCTGCGAAGCGCCATGGTCCACTTCCAAGCTTCAGAAGTCCAGCAGCTGCTACACAACAAGTTCGTCGTCATCTTGGGGGACTCCATCCAGAGAGCTGTGTATAAGGATCTGGTGCTTCTGCTCCAGAAAGACTCGCTGCTCACAGTTGCCCAGTTGAAAGCCAAGGGGGAGCTGAGCTTTGAACAGGACCAGCTGGTGGCTGGGGGCCAGCTGGGTGAGCTGCACAACGGGACACAGTATCGTGAAGTCCGCCAGTTCTGCTCCGGTTCTGGCCATCACCTTGTGCGGTTCTACTTCCTCACCCGAGTTTACTCTGAGTACCTGGAGGATGTTCTGGAGGAGCTGACATATGGGCCTGCCCCGGACCTGGTGATCATCAACTCTTGCCTTTGGGATCTCTCCAGGTATGGCCGCTGTTCAATGGAGAGCTACCGAGAGAATCTGGAACGAGTATTCATACGCATGGACCAGGTGTTGCCAGACTCCTGTCTGCTGGTGTGGAACATGGCGATGCCCCTGGGAGAGCGTGTCACTGGAGGTTTCCTACTGCCAGAGCTCCAGCCCCTGGCAGCCACTTTGCGACGGGATGTGGTTGAGGGGAACTTCTATAGTGCTACACTGGCTGGGGACCACTACTTCGATGTTCTGGATCTCCACTTTCATTTCCGGCACGCAGTACAGCACCGTCATCGAGATGGTGTCCACTGGGACCAACATGCACACCGCCACCTCTCACACTTGCTTCTGACCCATGTGGCCGATGCTTGGGGCGTAGAGCTGCCCACGAGGGACCATCCCCCTGAACCATGGATTGAGGACTGGCCAGAGATGGATCATCCGTTCCAGGGAAGCCATAGGCAGCCCCCAGACTTCGGGGAGCAGCTGGCCTTACCCCCACCCCCACCCCCTCCTTTACCCCCTCCTATGTCTTTTTCCTACCCTCTTCCACAACCTTCACCACCTCCCTTGTTCCCACCCCTGCCCCAGGATACCTCTTTTTACCCAGGCCAGCCCTTCCCACCCCAGGAATTCTTCAGTTATAATCCAATAGAAGACTTCTCGATGCCACCCAATTTAGGGTGTGGCTCTCGAGTGAACTTTGTGCCTGGTCCCCTGCCACCTCCAGTCCCTGGCTCTGTCTCCCACGGTCAGCACCGGGGCCCAGTGGTCCACCGGGGGATGCCACGCTGTGTTCCCAACAGCCCCTACCATGTGCCAAGATTGGGGGGTCTCTGTAGACGACTCAGGCACTCAGACAGACTGATCCACACATACAAACTGGACAGGCGAGGACATACCCATTCAGGAACATGGCCTGGGTAG

XM_004840689.1 Coding sequence

Pced1a PC-esterase domain containing 1A, transcript variant X6

High confidence: 4 potential gene matches
Length: 1362 bp    Location: 3959086..3953955   Strand: -
>XM_004840689.1
ATGGTCTTCTGTCTGGAAAGCGAGGTGCTGCGCCGCCCGCTGCGAAGCGCCATGGTCCACTTCCAAGCTTCAGAAGTCCAGCAGCTGCTACACAACAAGTTCGTCGTCATCTTGGGGGACTCCATCCAGAGAGCTGTGTATAAGGATCTGGTGCTTCTGCTCCAGAAAGACTCGCTGCTCACAGTTGCCCAGTTGAAAGCCAAGGGGGAGCTGAGCTTTGAACAGGACCAGCTGGTGGCTGGGGGCCAGCTGGGTGAGCTGCACAACGGGACACAGTATCGTGAAGTCCGCCAGTTCTGCTCCGGTTCTGGCCATCACCTTGTGCGGTTCTACTTCCTCACCCGAGTTTACTCTGAGTACCTGGAGGATGTTCTGGAGGAGCTGACATATGGGCCTGCCCCGGACCTGGTGATCATCAACTCTTGCCTTTGGGATCTCTCCAGGTATGGCCGCTGTTCAATGGAGAGCTACCGAGAGAATCTGGAACGAGTATTCATACGCATGGACCAGGTGTTGCCAGACTCCTGTCTGCTGGTGTGGAACATGGCGATGCCCCTGGGAGAGCGTGTCACTGGAGGTTTCCTACTGCCAGAGCTCCAGCCCCTGGCAGCCACTTTGCGACGGGATGTGGTTGAGGGGAACTTCTATAGTGCTACACTGGCTGGGGACCACTACTTCGATGTTCTGGATCTCCACTTTCATTTCCGGCACGCAGTACAGCACCGTCATCGAGATGGTGTCCACTGGGACCAACATGCACACCGCCACCTCTCACACTTGCTTCTGACCCATGTGGCCGATGCTTGGGGCGTAGAGCTGCCCACGAGGGACCATCCCCCTGAACCATGGATTGAGGACTGGCCAGAGATGGATCATCCGTTCCAGGGAAGCCATAGGCAGCCCCCAGACTTCGGGGAGCAGCTGGCCTTACCCCCACCCCCACCCCCTCCTTTACCCCCTCCTATGTCTTTTTCCTACCCTCTTCCACAACCTTCACCACCTCCCTTGTTCCCACCCCTGCCCCAGGATACCTCTTTTTACCCAGGCCAGCCCTTCCCACCCCAGGAATTCTTCAGTTATAATCCAATAGAAGACTTCTCGATGCCACCCAATTTAGGGTGTGGCTCTCGAGTGAACTTTGTGCCTGGTCCCCTGCCACCTCCAGTCCCTGGCTCTGTCTCCCACGGTCAGCACCGGGGCCCAGTGGTCCACCGGGGGATGCCACGCTGTGTTCCCAACAGCCCCTACCATGTGCCAAGATTGGGGGGTCTCTGTAGACGACTCAGGCACTCAGACAGACTGATCCACACATACAAACTGGACAGGCGAGGACATACCCATTCAGGAACATGGCCTGGGTAG

XM_004840692.1 Coding sequence

Mrps26 mitochondrial ribosomal protein S26

High confidence: 4 potential gene matches
Length: 606 bp    Location: 4164348..4166308   Strand: +
>XM_004840692.1
ATGCACCTCGCGCTGAGTGCCCTCCGCGCTGGACCTCCGTGCCGGCCTCTTGCAGTGCTGCTGATACCGGCGCGCGGCCGCAAGACGCGCCACGACCCGCCGGCCAAGTCCAAGGTCGGCCGCGTGAACACGCCGCCCGCTGTGGACCCTGCGGAATTCTTCGTGCTGGCGGAGCGTTATCGGCTGTACCGCCAGACCGTGCGCGCCCTCAGGCTGGAGTTCATGGCGGAGGTGCGGAAGCAGCAGTACGAGGCCCGTGCCGGCGTCTTGGCGGAGCGCAAGGCACGGGAAGAAGCGGCCAAACACCAGGAGCTGATGGCCTGGAACCGGGCGGAGAACCAGCGACTGCTTGAGCTGCGGATCTCGAGGCTGCAGCAGGAAGCGCGCGAGCTGGAGCAGCAGCACGCGGAGGAGCAGGCGCGCCGGGCACTGGAGGAGCAGGCCTGGGTGCGACTGAGGGAGCAGGAAGTGCAGCAGCTACAGGAGGAGGCAAAAAACTTTATCACCCGAGAGAACCTGGAAGCGAGGGTGGAAGAAGCATTGAACTCCTCAAAGAACTACAACTGGGCCATCACCAGACAGGGTCTGGTGGTCAGGCCGCAGTAG

XM_004840788.1 Coding sequence

Gpcpd1 glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae), transcript variant X3

Length: 1875 bp    Location: 6528865..6479723   Strand: -
>XM_004840788.1
ATGACGCCTTCTCAGGTTACCTTTGAAATAAGAGGATCTCTCTTACCAGGAGAAGTTTTTGCAATATGTGGAAGCTGTGATGCTTTGGGAAACTGGAATCCTCAGAATGCTGTGGCTCTTCTAGACAGTGAGACAGGTGACAGCATGTTATGGAAAGCAACCATTGCACTCACTAGGGGAATATCAGTTCTGTATCGCTACTACAAAGGATACTTTTTAGAACCAAAGACTATCGGTGGTCCATGTCAAGTCATAGTTCACAAGTGGGAGACTCATCTACAACCACGATCAATAACCCCTTTAGAAAGTGAAATTATTATTGATGATGGACAATTTGGAATCCACAATGGTGTTGAAACTCTGGATTGTGGATGGCTGACATGCCAGACGGAAATAAGATTACGTTTGCATTATTCTGAAAAACCTCCAGTCTCAATAACCAAGAAAAAATTCAAAAAATCTAGATTTAGAGTAAAGCTTACACTAGAGGGTCCCGAGGAAGACGATGATGATAGGGTATCTCCCACTGTTCTTCATAAAATGTCTAATACCCTGGAGATAGCCTTGATAAGTGACAACGAGTTCAAGTGCAGGCACTCACAGCCAGAGTGTGGGTATGGCCTACAGCCTGACCGTTGGACTGAGTACAGCATACAGACCATGGAGCCGGATAACCTAGAACTAATCTTTGATTTTTTTGAGGAAGATCTCAGTGAACATGTAGTTCAAGGTGACGCCCTTCCAGGACATGTGGGCACAGCATGCCTCTTATCATCCACCATTGCAGAGAGTGGGCGGAGTGCCGGGGTTCTTACCCTTCCTATCATGAGCAGGAATTCCAGGAAAACCATAGGCAAAGTTCGAGTTGACTTTATCATCATTAAGCCATTAACCGGATACAGTTGTGACATGAAATCTTCATTTTCCAAGTATTGGAAACCAAGAATACCACTGGATGTTGGACATCGAGGTGCAGGGAACTCGACAACAACTGCCCAGCTGGCTAAAGTTCAAGAAAATACTATTGCTTCTTTAAGAAACGCTGCTACTCATGGTGCAGCTTTTGTAGAATTTGATGTCCATCTTTCAAAGGACTTTGTGCCTGTGGTGTATCATGATCTTACCTGCTGTTTGACCATGAAAAAGAAATTTGATGCTGATCCAGTTGAATTATTTGAAATTCCAGTAAAGGAACTAACATTCGACCAACTACAGTTATTAAAGCTTTCTCATGTGACAGCACTAAAATCTAAAGATCGGAAAGAATCTGTAGTTGAGGGAGAAAATTCCTTTTCTGAAAACCAGCCATTTCCTTCTCTTAAGATGGTTTTAGAGTCTTTGCCAGAAGATGTAGGGTTTAATATAGAAATAAAGTGGATCTGCCAACAAAGGGATGGAATATGGGATGGTAACTTGTCAACATATTTTGACATGAATCTGTTTTTGGATATAATTCTAAAAAATGTTTTAGAAAACTCTGGAAAGAGAAGAATTGTGTTTTCTTCATTTGATGCAGATATTTGTACAATGGTTCGACAAAAGCAGAACAAATATCCCGTATTGTTTTTGACTCAAGGAAAATCTGATATTTACCCTGAACTTATGGACCTCAGATGTCGGACAACTCCCATTGCAATGAGCTTTGCACAGTTTGAAAATCTTCTGGGGATAAATGCACATACTGAAGACCTGCTCAGAAACCCATCCTATATTCAGGAGGCAAAAGCTAAGGGCCTTGTCATATTCTGTTGGGGCGATGACACCAATGATCCTGAAAACAGAAGGAAGTTGAAAGAATTTGGAGTTAATGGCCTAATTTATGATAGGTACTTATTTTGCATAAAAAATCTCCCTGGAATGTTAGAAAAAGTATAG

XM_004840700.1 Coding sequence

Ubox5 U-box domain containing 5, transcript variant X5

High confidence: 4 potential gene matches
Length: 1626 bp    Location: 4268182..4228564   Strand: -
>XM_004840700.1
ATGGTAATAAATCTTTGCCTCCCACAGTTCAGACCAAGAATTCACTGCAACAAGATATCAGCTGATGGTTATGAAGTAGAAAATCTCATCTCTGAAGACCTCACAAAGAGAAGCCATGGTTTTAGGACAGAGTATTTCATTAAGCCACCAGTCCACGTGACAGTTTCCTTTCCCTTTAATGTGGAAATCTGTAGGATTCACTTAGACCTCACAGCTTGGGGCAGCCAGAATGTCACTGGCCTGGAGATGTACACGTCCACCTTATCCAGCAGAGCCTCTTGGAGTGGGCCCAAGTGCCAGGGCCTCGGCTCCACCGAGCCCTCTGTGCCCAACAAAGAGGCGTTCACCTTGGTCGGCAAAGTCTTGCTGAAGAACCAGAGCCAAGTGGTATTCAGCCACCGGGGCTTCAAGGCCAGGCCACCTTTTAGCCCAGTGGAAGTCACACTTCCCTCCCCTGCAGTTATGGCCCAGGAGCTCTGGAATAAAGGGACTCTTTCCCTTTGCCATGTGGCCCACCTCAGGATCTGCATCACCCACGTGACGGGCAGTGGTGTCCCTTGCATCAAGAGGTTGGAGGTGTGGGGTCAGCCGGCCAAGACTTGCTCTCAGGAGGTGATAGACAGTGTCTTGCTGGTGGCCTCAGAGAGTATACCTCAGGACCTGGCCCTGCAGAACCGAGCCTTGCCCATGGAGAGTGACTGTCACTCCGAAGGCCAATCTGAGGGCCAGCAGGCCCCTTCCAGCCTGCGAGAGCTGGCTGAGGTGATTTGGGAAGTGCCTGAGGAGTTCCTGGATCCCATCACCCTGGAGATCATGCCCTGCCCCATGCTGCTGCCCTCGGGCAAGGTCATCGATCAGAGCACCCTAGAGAAGTGTAACCGCAGTGAGGCCACTTGGGGCCGAGTGCCCAGTGACCCATTCACAGGCATTGCCTTCACCCCGCACTCCCAACCCCTGCCACACCCCACCCTGAAGGCCCGCATAGACCACTTCCTGCTCCAGCACTCTGTCCCTAGCTGCCACCTGCTTGGGAGAGCACAGGCTGCATCAGCAGTGACCCCTTCTTCCATAACCCTGCCTTCTCGGAAAAGGAAGCTGGAGCAGGGGCACCGGGCCCCAGACAGTAGCCTTGGTGTGAACACTTCCTGCTTTCGGACCACAAACTTTCTGGTCTCTTCCACTGCTTCAGAACATTCCACCAAGAAAATGAAGGCCACCGACGAGCCTATCCTGATGCACATGGACTGCTCCACAGGGCCTGTGTCCCATGAGCAAAAGCTGTCACAAAGCTTGGAAATGGCCTTGATGACCACCCTTGGCTCTATGCCTTCCTTCACACCCCGGCTGAATAGGGGACAGCTCCAGCACCTGGGCACAAGAGGAAGCAGCACTTCGGGGAGGCCAGGCGCCAGCTCAGGGCAGCCTGGCTGCCACCCAGGCCCCGAGTGCACCTCCTGCAAAAGAGTGTTTTCTTCCTACTTCAAAAAGGAGCCCATGTACCAGCTGCCCTGTGGCCACCTCCTGTGCCGCCCTTGCCTGGGTGAGAAGCAGCACTCCCTGCCCATGACCTGCACAGCCTGCCAGCAGCCCTTCACCAGCCAGGATGTGCTGCGGGTGCACTTCTGA

XM_004840696.1 Coding sequence

Ubox5 U-box domain containing 5, transcript variant X1

Length: 2445 bp    Location: 4268182..4255475   Strand: -
>XM_004840696.1
ATGGCTCTTGTGATATGCCGAAGATGTCCAGGCAGTTTCTATGGAACATCTCCTTGCCCAGCTCTAATCAAGCACCATGTAAACAAGAAATTGTCTGGTCACACATGTGAGGACTATACCCTTATTGCCAAAAAGATCAGTTCTGACAGAATGGCAGCCACTTTCAAGTTATTAAAGCCTTTAAAATATCAAGCATTTTGCAATCCTGTTGTCTACAGTGCTACCCAAAGTGTGCTGTATTGGAATATGGGAACCAGCAGGTGGCACAAAGAACAGGACCATCCAGAGCACAGTGGCCCCTGCCACCCTGCCAGAAGAGTGAAGAATATTAGTGGCACCACCTCTTCTCAGAGAGTCCTCACAACCAACAGTGCCCTTCTGGGTTTGGGAGTCCACCAGGCTTCTGCCTTGAAGGCCAGCACGTTGCAGCTGGGTTCACCCAGGACCATGAGAACTGATAAAGAGGATGTAGAAGTTTTTGATTCCTTTGAAGACACCCGAGTTTTCCTACAGCTAAGACCAGAGTACCAGCTTCACAGCCATAAAAAATCAGAGACTTGTCAGCCCCTGTCCGTTTCAGAGAGTAAACTAATTTTGCACAAAGTCAGGGTGTATCAAAATAACCTCCAGCCTCAAACTATTGTTGATTATTTCTGTAAGCTGAGCTCTTTGCCTGCAGAGCAGCGTCCCATTTTGCTGTCTAATGCCAGCTTTACTTTGCTCTGCCAGCTGAGTGTGAAAAACATAAAATTCTTTGATATCCCGGGTCTGATCAGTATTTTAAAAGCCTTGGTCAATTTAGGAATCCCTCACTGCCACCCAATGCTAGATGTGTATGAAACCAGATTTGGGCATCAGGTGTGGGAGATGAGTCTGGACCAGCTTCTCTTGGTGGCTGATCTCTGGCGGCACTTAGGCCACAGAGTACCACAGTTCTTAAAAATTTTTTTTAGTTATCTTAATTTGCACTGGAAAGATCTATCTTTGTCTCAGTTCATTCATTTAATTTATATTATAGGTGAAAGTCGTCAGGTACCACAGGACCTAATGCAAAAACTGGAATCACTGATCCTTAAGTATATTGATTTGATCAATTTAGAGGAAGTTGGTACAATCTGTTTGGGGTTCTTTAAGTCAAGTAGTAGTCTGTCCGAATTTGTCATGCGGAAAATTGGAGACGTGGCTTGTGCTGACATGCACCATCTGAGTAGTCACGCCTTAGTGCATATTCTTAAAATGTTCCGTTTAACTCACGTGGATCATGTAAACTTTATGAAGCAGTTTGGAGAGATTGCTCCTCAGAGAATTCCTTCCCTGGGTGTTCAGGGTGTCATGCATTTGACTCTTGCCTGCTCAGCCTTACGTATGTTGGATGAGAGAGTAATGAATGCTGTGGCTGCCTCTTTGCCTTCTCGGGTAGCACACTGTCGAAGTAAGGATGTTGCCAAAATTCTGTGGTCATTTGGAACTCTGAATTATAAGCCACCCAACACAGAAGAATTTTATTCCAGCTTGATAAATGAAATTCACAGAAAGATGGATGAATTCAACAAATACCCGGAACACATGTTCACCTGTCTGCTGGGTCTGGCATTTTCTGAATACTTTCCAGCAGAGCTCATCAATGTTGCTCTGAGTCCAGGGTTTATCAGGTTAGCTCTAGAGAGAACTAAGTTTGAGCTTACTAAGGAACTGTATACTCTTGATGGTACAGTTGGCATTGAATGTCCAGATTACAAAGGCAATCGTCTTAGTTCTCACCTTCAGCAAGAGGCATCTGCAAATCTGTGGAATTTAGCAAGTAATGATATGAACTCAAAGCCTGAATTCCTAGAAGCTCTCTCTTTTCTTGAGACCATGTTGGGTGGCCCGCAGTACATCAAGCACCATATGATTTTACCTCATACCCGATCTTCTGACTTAGAGGTGCAGCTTGATGCTAACATGAGGCCACTACCATTTAACAGAGAAGCCATACCAACTGAAGACAAGGTTAATTTAAAGCTTATGCCTGTGGGAGTCAGCCTTACAGATGATTTGATGAATCAGTTGCTAAAAGGGAAAGCAAAAAGGCATTTCCATAGAGAAATTGAGTCAGAGACTGGGCAGTGGCCCATGAAGTTGGAGAAGGCAGCCATACCATTGGGGAGCTCCCCTTGCAATGTGGCAGATGGGTTAGGAGCTGTTGAGATGGCTGACCTGTGTCCCCCAGCCCATGTGCAGGCCCCATTAGTGAAGCTGGCCATTCAGTTCACACATAGGAACCAGTATTGCTATGGTACAAGGAATCTACTTGGATTGCATAATATGAAGCGGCGGCAGCTGATTCGACTTGGGTACCGAGTGATCGAGTTAACCTACTGGGAGTGGTTTCCACTCTTGAAACGAACTCGATCAGAGAAGCTGGCATTCCTCCATGAGAAAGTGTTCACCTCTGTTCTCTGA

XM_004840721.1 Coding sequence

Itpa inosine triphosphatase (nucleoside triphosphate pyrophosphatase), transcript variant X2

High confidence: 4 potential gene matches
Length: 666 bp    Location: 4312360..4325825   Strand: +
>XM_004840721.1
ATGGGCTTCCGGAGCTCTGAGGGCTATCTCCTGTTCGCAATGGCGGCGTCCTTTGCCGGGAAGAAAATCGTGTTTGTAACAGGGAATGCCAAGAAGCTGGAGGAGGTCGTTCAGATTCTAGGAGATAAGTTTCCATGCACTTTGGTGGCACAGAAGATTGACTTGCCAGAGTACCAGGGCGAGCCAGATGAAATTTCCATTCAGAAGTGTCGGGAGGCTGCGCGCCAGGTGCAGGGACCCGTCCTGGTAGAAGATACCTGTTTGTGCTTCAGTGCCCTTGGTGGGCTTCCTGGCCCCTACATAAAATGGTTTCTGGAGAAGTTAAAGCCTGAAGGTTTGCACCAACTCCTGGCTGGCTTCGAGGACAAATCGGCTTATGCACTCTGCACGTTCGCGCTCAGCACAGGGGACCCAAGCGAGCCTGTGAGCCTGTTCAGGGGCCGGACCTCGGGCCAGATTGTAGCTCCCCGAGGCTGCCGGGACTTTGGCTGGGACCCCTGCTTTCAGCCTGATGGATACGAGCAGACGTACGCTGAGATGCCCAAGGCAGAGAAGAATGCCATCTCCCATCGCTTCCGGGCCCTGCTTGAGCTGCAGCAGTACTTTGGCAGCTTGACTCCTGGGGCTGGAGGAGGTGCCTCGGGCTGGGGATCTGGGGAGAGCTAG

XM_004840719.1 Coding sequence

Slc4a11 solute carrier family 4, sodium borate transporter, member 11, transcript variant X7

Length: 2214 bp    Location: 4339877..4329639   Strand: -
>XM_004840719.1
ATGGCCGCGGCCAGCAGGCGCGTGTTCCATCTCCAGCCGTGCGAAAGCTCCTCTTTGGCCACATCAAGGAATGGATGCCTTGAGGACTCCAGTGAGTACTTCTCAGCTGCATCCCTGAGCTACCTCAAGAATGATGTGGACAATGCTTCAGAGGTCCGGGAAGAAAGCCTGGGGGATGAGGTCTTTGACACGGTCAACTCCTCCATCGTGTCTGGCGAGAGCATCCAGTTTTTCGTCAATGTCAACCTTGAGGTGCAGCCCTCCATATCTGAAGGTGAAGCGCTGTCTGGCTGCGTGCTCCTGCACACATCCCGCAAGTACCTGAAGTTAAAGAACTTTGGGGAAGAGATCCGAGCACACCGGGACCTGGATGGCTTCCTGGCCCAGGCCAGCATCATCCTGAATGAAACAGCCACCTCCTTGGATGATGTGCTACGCACCATGCTGAGCCGCTTTGCCCAGGACCCCAACAACGCTGAACCCGACTGCAACTTGGACCTAATCATGGCCAAGCTCTTTACGGATGCAGGGGGCCCCACGGAGAGTAAAGTGCACCTGCTGTCAGATACCATCCAAGGGGTCACAGCCACGGTGAGAGGGGTGCAGTACCAGCAGTCATGGCTCTGCATCATCTGTACCATGAAAGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTGGTTCGCCCACAGAACTGGGGCGAAAACTCCTGTGAGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAAATGAAAAGCACCAAGACTGCAATGGAGGTGGCACGCACCTTCGCCACCATGTTTTCAGACATCACCTTCCGCCAGAAGCTCCTGAAGACCCGCACAGAGGACGAATTCAAGGAGGCATTGGTGCATCAGAGACAGCTGCTCACCATGACAATACCAAGAGCAAATGGACATGGCACAGGCTCCTTCCATGGCCATAGACACCCACAGCCCCCAAAGTGCAAGGACTTTATCCCTTTTGGGAGGGGCATCCGGGAAGACATCATGCGCAGGTTTCCTGTATACCCACTGGACTTCACTGATGGCATTATCGGGAAAAGCAAGGCTGTGGGCAAATACATAACCACCACCCTGTTCCTCTACTTCGCCTGCCTCCTGCCCACAATTGCTTTTGGATCCCTGAATGATGAGAACACAAATGGGGCCATTGATGTTCAGAAGACCATAGCTGGCCAGAGTATAGGAGGCCTCTTGTACGCGATCTTCTCCGGGCAGCCGCTGGTGATTCTGCTGACGACTGCACCCCTGGCCATCTACACCCAGGTGATTCGTGTCATCTGTGATGACTACAACTTGGACTTCAATGCTTTCTATGCGTGGACAGGCCTGTGGAACAGTTTCTTCCTTGCACTCTATGCCTTCTTCAACCTCAGCCTGGTCATGAGTCTCTTCAAGAGGTCAACAGAGGAAATCATTGCCCTGTTCATTTCCATCACCTTCGTGCTGGATGCTGTCAAGGGCATGATCAAAATCTTCTGGAAGTACTACTACGGTTACCACCACACAAAGAGAACAGATACCAGCCTCAACTCTGGCATCCACACAGCCTTCAACACCAATCTCCTGGCTGGTTCCATTGAGCTGGATGCCTCAAGCAGCCCAGATGCTGTGCACTCTGGCCAGGCAACTGCAGTGCTCAGCCTCCTCATCATGCTGGGTACCCTCTGGCTGGGCTACACTCTCTACCAGTTCAAGAAGAGCCCCTACCTGCACCCATATGTGCGAGAGATCCTGTCCGACTGTGCCCTGCCCATTGCAGTGCTCACCTTCTCCCTCCTCAGCTCCTATGGCTTCCAGGAAATTGAGATGAGCAGGTTCCGCTACAACCCCAGCGAGAACCTGTTTGAGGTGGCACAGATCGACTCACTGTCCCTGGGAGCCATTGGCAGTGCCATGGTCCTCGGTTTCCTGCTCTCCCTGCTCTTCTTCATCGAGCAGAACCTGGTGGCTGCCTTGGTCAATGCACCAGAGAACAGGCCAGTGGGGCTCTGTCCATGTGTGTCTGTGCTGCAGGCTGGTGAAAGGCACTGCCTACCACTGGGATCTCCTGCTCCTAGCCATCATCAACACGGGGCTGTCCCTATTTGGGCTGCCCTGGATCCACGCTGCCTACCCCCACTCTCCACTGCACGTGCGGGCCCTAGCTTTAGTGGAGGAGCGAGTGGAGAATGGGCACATTTATGA

XM_004840728.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 2406 bp    Location: 4777775..4765936   Strand: -
>XM_004840728.1
ATGGGCAGGGGCTCGCTGAGAGCTCCGGGATTGGCGGTGCCGCGGTGGCTGCTGTCACTACTGCTGCTGTCTCGGGGGCCAGTGTCTGGCGCTTGGTTGCTTCCAGGAAATACTTCTGGAGAGCCAGTCACCACCCCCTGGGTCCTGGATGGACAACCCTGGCTCACCATCGTCCTGAAAGAGCCGATCTCGACACTAGACTCAGGCCTGGTGGCCTTGGAAGCTGAAGGCCAGGAGTTCCTGCTTGAGCTGGAGAAGAACCACAGGCTGCTGGCTGCTGGTTACACAGAAACCCACTATAGCCAAGATGGCCAGCCAGTGGTGCTGGTCCCCAACCACATGGACCACTGTCACTACCACGGGAGAGTGAGGGGCTTCCCCAACTCTTCGGTTATGCTCAGCACCTGCTCTGGGATGAGGGGCTTGATCAGGCTCAACAGCAATGCCAGCTATTACCTGCAGCCCTGGCCACCTGGAGACCCAGAGGACCTCTCAACCCACAGGACTTTCCGGATGGAGAGGCTGCTCACCTGGAAAGGGACCTGCAGCTACAGTGACCCCGAGGACAAAGGGGGCATGGCCAGGCTTCGTCCTGCCCCTCAGAGCAGGGAGAGGCGAGAAGCCCCCAGGGGCCAGAGGTACCTGGAGCTATACGTAGTAGCCGACCACTCCCTGTACTTGACCCAGCACCGAAACTTGAACCATACCAAAGAGCGTCTCCTGGAGGTTGCCAGTTATGTAGACCAGATCCTCAGGACGCTGGACATCCAGGTGGTGCTGACAGGCCTGGAAGTGTGGACAGAGCAAGACCACAGCCGCGTCACACCCGACGCCAACGCCACGCTCTGGGACTTCCTGAAGTGGCGCCGGGGGCTGTGGGCACGGCGGCCGCACGACTCGGCGCAGCTACTCACGGGCTGCACCTTCCGGGGCGCCACCGTGGGCCTGGCGCCCGTCGAGGGCATGTGTCGCGCAGAGAGCTCGGGCGGTGTGAGCACGGACCACTCGGAGCTCCCCATCGGCGCTGCGGCCACCATGGCCCATGAGATCGGCCACAGCCTGGGCCTCAGCCACGACCTCGATGGCTGCTGCGTGGAGGCCGCGGCAGAGCAAGGCGGCTGCATCATGGCCGCGGCCACGGGGCACCCGTTCCCGCGCCTCTTCAGCGCCTGCAGCCGCCGCCAACTGCGGGCCTTCTTCCGCAAGGGGGGCGGCGCGTGCCTCTACAACGCCCCAGACCCCGGGCTTCAGATCCCGCCTACGCGCTGCGGGAACGGCTTCGTGGAAGCGGGCGAGGAGTGCGACTGCGGCTCTGAGCAGAAGTGCCCAGACCCCTGTTGCTTCGCCCACAACTGCTCGTTACATGCGGGGGCCCAGTGTGCCCACGGGGACTGCTGCGCGCGCTGCCTGCTGAAGCCAGCTGGCTCGCCGTGCCGCCAGGCTGCAGGAGACTGTGACCTCCCTGAGTTCTGCACTGGCTCTTCCCCCCACTGTCCCCCGGATGTTTACCTGCTGGACGGCTTGCCCTGCGCGGGAGGCCAAGGCTACTGCCTGGATGGCGCGTGTCCCACGCTGGAGCAGCAGTGCGCACAGCTCTGGGGGCCTGGCTCCCGCCCAGCCCCCGAGGCCTGTTTCCAGCTGGTGAACCCCGCGGGAGACGCCACTGGGAATTGCGGCCAGGATGGCTCTGGCCGCTTCCTGCCTTGTGCTCAGAGGGACACTCAGTGCGGGAAGCTGCAGTGCCAGGGCGGGGAGCCCAGCCCCCTAGTGCCACACATCTTGCCTGTGGAGTCCACACTTCACTTAGACGGCCACCAGGTGGCTTGTCGTGCAGCTCTGGTGATCCCCGATGCCCAGCTGGACTTGCTGGACTTGGGCCTGGTAGAGCCCGGCACCCAGTGTGGTCCTAGAATGGTGTGCCAGGACAGGCGCTGCCAGAACACTTCCTCCCAGGAGCTGGAGCGCTGCCTAACTACCTGCCACAACCATGGGGTTTGCAACAGCAACCATAACTGCCACTGCTCTCCAGGCTGGGCTCCACCCTTCTGTGACAAGCCGGGGTTCGGTGGCAGTGTGGACAGTGGCCCAGTGCACCCTGAAAATGGCGACACGTTCCTTCTGGCAGTGCTCTTCAGCTTCCTGCTCCCTCTGCTCCCTGGGGTGGGCCTGGCCTGGTGCTACTTCCGGCTCCCTGGGCTCCACCTCCAGCGATGCCCCGGGGGCTATAGGAGAGACCAGGAATGCAGTGGGCCCAAAGATGGCCCTCTCAGGAACCATAGCCTGGGTGGCATTTACCTTGTGCAGTTGGGGTCCGTGGCCATTGGAGACCCCCAGCCCCTGGACCCTGAGAACTCTGCCCAAGTTAGCAGTCACCCTGAGAAGCCTGTGCCCTGCTGCCCTTTTTGA

XM_004840733.1 Coding sequence

Hspa12b heat shock 70kD protein 12B, transcript variant X2

High confidence: 4 potential gene matches
Length: 2058 bp    Location: 4818644..4837862   Strand: +
>XM_004840733.1
ATGCTGGCTGTCCCAGAGATGGGCCTGCAGGGGCTGTACATCGGCTCCAGCCCAGAGTGCTCCCCAGTGCCCAGCCCGCCCGGCTCCCCAAGGATCCAGGAAAGCTGCAGCATTGCCCCCCTCACACCCTCACAGTCACCAAAGCCAGAAGCCCGAGTTCCCCAGCAGGCCTCCTTCTCTGTGGTGGTTGCCATTGACTTTGGCACCACATCCAGCGGCTATGCCTTCAGCTTTGCCAGTGACCCAGAGTCCATCCACATGATGAGGAAATGGGAGGGTGGGGATCCTGGCGTGGCCCACCAGAAGACCCCTACCTGCCTGCTGCTGACCCCGGAGGGTACCTTTCACAGTTTTGGCTACACTGCTCGTGATTACTACCATGACCTGGACCCCGAGGAGGCCCGGGACTGGCTCTACTTTGAGAAGTTCAAGATGAAGATCCATAGTGCCACTGATCTCACCTTGAAGACCCAGCTAGAGGCGGTAAATGGAAAGAAGATGCCAGCTCTGGAAGTGTTCGCCCATGCCCTACGCTTCTTCAAGGAGCATGCCCTACAGCTGAGGGAGCAGTGCCCGTCACTGCCAGAAAAGGATACTGTGCGCTGGGTGTTGACAGTGCCTGCCATCTGGAAACAGCCAGCCAAGCAGTTCATGCGGGAGGCCACCTACCTGGCTGGCCTGGTGTCTCGAGAGAATGCAGAACAGCTACTCATCGCTCTGGAGCCTGAGGCCGCCTCTGTCTACTGCCGGAAGCTGCGGCTGCACCAGCTCATGGACCTGAGTAGCAGAGCCCCAAGTGGTGGGCGACTGGGCGAGCGCCGCTCCATCGACTCCAGCTTCCGGCAGGCCCGTGAGCAGCTGCGAAGGTCCCGCCACAGCCGCACATTCCTGGTGGAGTCGGGCGTGGGAGAGCTGTGGGCAGAGATGCAAGCAGGGGATCGCTACATGGTGGCAGACTGTGGGGGAGGCACTGTGGACCTGACAGTGCACCAGCTGGAACAGCCCCATGGCACCCTGAAGGAGCTCTACAAGGCATCCGGAGGCCCCTATGGCGCGGTGGGCGTGGACTTGGCCTTTGAGCAGTTACTCTGCCGCATCTTCGGAGAGGACTTCATCGCCACTTTCAAAAAGCAAAGGCCAGCAGCTTGGGTGGATCTGACCATCGCCTTCGAGGCCCGCAAACGCACAGCGGGCCCGCACCGAGCGGGGCCGCTCAATATCTCGCTGCCTTTCTCCTTCATTGACTTCTACCGAAAGCAGCGAGGCCACAACGTGGAGACGGCCTTGCGCAGGAGCAGTGTGAACTTCGTGAAGTGGTCCTCGCAAGGGATGCTTCGGATGTCTTGTGAGGCCATGAACGAGCTCTTTCAGCCCACGGTCAGTGGGATCATCCAGCACATAGAGGCGCTGCTGGCGCGGCCCGAAGTGCAGGGTGTGAAGCTGCTGTTCCTGGTGGGCGGCTTCGCAGAGTCGCCAGTGCTACAGCATGCAGTGCAGGTGGCGCTGGGCGCCCGCGGTCTGCGCGTTGTGGTCCCGCACGACGTCAGCCTCACCATCCTCAAGGGCGCCGTGCTCTTTGGCCAGGCGCCCGGCGTGGTGCGCGTGCGCCGCTCGCCGCTCACCTATGGCGTGGGTGTCCTCAACCGCTTCGTGGAGGGACGTCACCCACCCGACAAGCTGCTCGTGCGCGACGGCCGCCGCTGGTGCACCGACGTCTTCGAGCGCTTCGTGGCCGCCGAGCAGTCAGTGGCCCTAGGCGAAGAGGTGCGGCGAAGCTACTGCCCGGCGCGCCCCGGCCAGCGGCGCGTGCTCATCAACTTGTACTGCTGCGCCGCTGAAGACGCGCTCTTCATCACCGACCCCGGCGTGCGCAAGTGCGGCGCGCTCAGCCTGGAGCTCGAAGCTGCTGAGGGCGGCCCGGACAGCGCCGGCACGGCCCCCGGGCGCCGCGAGATCCGTGCGGCCATGCAGTTTGGCGACACTGAGATTAAGGTCACCGCCGTAGACGTCAGCACCAATCGCTCTGTGCGCGCCGCTATTGACTTTCTTTCCAACTGA

XM_004840741.1 Coding sequence

Cdc25b cell division cycle 25B, transcript variant X5

Length: 1410 bp    Location: 4871287..4892924   Strand: +
>XM_004840741.1
ATGGATTCTCCCAGTCCTATGGACCCCCAGATGGCAGAGCAGATGTTTGAACAGGCCATCCAGGCAGCCAGCCGGGTCATTCGAAATGATCATTTTGCCATCAGACGCTTCCAGTCCTTGCCAGTGAAGCTGCTGGGCCACAGCCCTGTGCTCCGGAACATCACCAACTCCCAAGTACTAGACTGCTGGAGCAAGAGCGAGTCGGGTGGCAGAGCTGCCATCAGTCCTGAAGAGGATAAGGAGAATGAGGGATTTGTTTTCAAGATGCCATGGAAGCCTACACATCCCAGCCCTGCTCATACCCTGGTGGGGTGGGCCAGCCGCAGAGAGGCCTTTACCCAGAGGCCAAACTCGGCCCCCAACCTGATGTGTCTCACTCCTGAGCGGAAGATGGAAGTGGAGGAGCTGAGCCCCATGGCTCAGTCTCACTGCCTCTCCCTGACTCCTGCTGAGGGAGCTGCTGAGGAAGATGATGGATTTGTGGACATCCTGGAGAGTGATTTAAAGGAGGATGATGCAGTCCCTGCAGGAATGGAGAGCCTCATTAGTGCCCCACTGGTCAAGACCTTGGATAAGGAAGAGGAGCAGGACCTCGTCATGTTCAGCAAGTGCCAGCGGCTCTTCCGTTCTCCATCCATGCCCTGCAGTGTGATCCGGCCCATTCTCAAGAGACTCGAGCGGCCCCAGGACAGGGATATGCCTGTACAGAGCAAGCGGAGGAGGAGCGTGACCCTTCTGGAGGAGCAGCAGCAGCCTGAGGAACCTAAAGCACGAGTTCTCCGCTCAAAGTCCTTGTGTCATGATGAGATTGAGAGCATCCTGGACAGTGACCACCGAGGACTCATTGGAGATTACTCTAAGGCCTTCCTCCTACAGACAGTGGATGGCAGACACCAAGACCTCAAATACATCTCTCCAGAAACCGTGGTGGCCCTGTTGATGGGCAAGTTCAGCAATATTGTGGAGAAGTTTGTGATTGTGGATTGCAGATACCCCTATGAGTATGAAGGCGGGCACATCAAGACTGCGGTGAACTTGCCCCTTGAACGAGATGCTGAGACCTTCCTGCTGCAGAGCCCAATCACACCCTGTAGCCTGGATAAGAGGATCATCCTCATTTTCCACTGTGAATTCTCCTCAGAGCGTGGGCCCCGCATGTGCCGATTCATCAGGGAACGTGATCGTGCAGCCAATGACTACCCCAGGCTCTACTACCCCGAGATGTACGTCCTCAAGGGCGGCTACAAGGAGTTCTTCCCACAGCACCCGAACTTCTGTGAACCCCGGGACTACCGGCCCATGAATCACGAGGGCTTCAGGGAGGAGCTGAGGACCTTCCGCCTCAAGATGCGCAGCTGGGCTGGGGAGCGGAGCAGGCGTGAGCTCTGTAGCCGGCTGCAGGAACAGTGA

XM_004840739.1 Coding sequence

Cdc25b cell division cycle 25B, transcript variant X3

Length: 1626 bp    Location: 4882516..4891457   Strand: +
>XM_004840739.1
ATGGAGGGGCCCCCGCCCCAGCCCGAGCCTGCGCCCGGCTCGGCTCTCAGCCCGGCCGTCGTGCGCACTGGCGCCCAGCGCCTGGGCCACCACCCCGGCCTCCAGCTGGGTTCTCAGGGCCTCCTGGGGTCCCCGGAGCGCGCGGCCTCTTCCTCTCCAGTCACCACCCTCACCCAGACCATGCACAAGCTCGCTGGGCTCGGCAGTGATTCCCCAACGTGTCAGGTAGGGACCCTGCCCCTCCGAAGTCAGCTAACTCGCCTATCCCTGTCTCGGCGGGCATCAGAATCCTCCTTGTCGTCTGAGTCCTCAGAATCTTCTGATGCAGGTCTCTGCATGGATTCTCCCAGTCCTATGGACCCCCAGATGGCAGAGCAGATGTTTGAACAGGCCATCCAGGCAGCCAGCCGGGTCATTCGAAATGATCATTTTGCCATCAGACGCTTCCAGTCCTTGCCAGTGAAGCTGCTGGGCCACAGCCCTGTGCTCCGGAACATCACCAACTCCCAAGTACTAGACTGCTGGAGCAAGAGCGAGTCGGGTGGCAGAGCTGCCATCAGTCCTGAAGAGGATAAGGAGAATGAGGGATTTGTTTTCAAGATGCCATGGAAGCCTACACATCCCAGCCCTGCTCATACCCTGGTGGGGTGGGCCAGCCGCAGAGAGGCCTTTACCCAGAGGCCAAACTCGGCCCCCAACCTGATGTGTCTCACTCCTGAGCGGAAGATGGAAGTGGAGGAGCTGAGCCCCATGGCTCAGTCTCACTGCCTCTCCCTGACTCCTGCTGAGGGAGCTGCTGAGGAAGATGATGGATTTGTGGACATCCTGGAGAGTGATTTAAAGGAGGATGATGCAGTCCCTGCAGGAATGGAGAGCCTCATTAGTGCCCCACTGGTCAAGACCTTGGATAAGGAAGAGGAGCAGGACCTCGTCATGTTCAGCAAGTGCCAGCGGCTCTTCCGTTCTCCATCCATGCCCTGCAGTGTGATCCGGCCCATTCTCAAGAGACTCGAGCGGCCCCAGGACAGGGATATGCCTGTACAGAGCAAGCGGAGGAGGAGCGTGACCCTTCTGGAGGAGCAGCAGCAGCCTGAGGAACCTAAAGCACGAGTTCTCCGCTCAAAGTCCTTGTGTCATGATGAGATTGAGAGCATCCTGGACAGTGACCACCGAGGACTCATTGGAGATTACTCTAAGGCCTTCCTCCTACAGACAGTGGATGGCAGACACCAAGACCTCAAATACATCTCTCCAGAAACCGTGGTGGCCCTGTTGATGGGCAAGTTCAGCAATATTGTGGAGAAGTTTGTGATTGTGGATTGCAGATACCCCTATGAGTATGAAGGCGGGCACATCAAGACTGCGGTGAACTTGCCCCTTGAACGAGATGCTGAGACCTTCCTGCTGCAGAGCCCAATCACACCCTGTAGCCTGGATAAGAGGATCATCCTCATTTTCCACTGTGAATTCTCCTCAGAGCGTGGGCCCCGCATGTGCCGATTCATCAGGGAACGTGATCGTGCAGCCAATGACTACCCCAGGCTCTACTACCCCGAGATGTACGTCCTCAAGGGCGGCTACAAGGAGTTCTTCCCACAGCACCCGACCCCTCCCATGCTGCCCTAG

XM_004840746.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X1

Length: 1590 bp    Location: 4936539..4951064   Strand: +
>XM_004840746.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840838.1 Coding sequence

Flrt3 fibronectin leucine rich transmembrane protein 3, transcript variant X3

High confidence: 4 potential gene matches
Length: 1947 bp    Location: 15355727..15343653   Strand: -
>XM_004840838.1
ATGATCAGCCCAGCCTGGAGCCTCTTCCTCATTGGGACTAAAATTGGGCTGTTCCTGCAAGTGGCACCTCTATCTGTTATGGCTAAATCCTGTCCATCTGTGTGTCGCTGTGATGCTGGTTTCATTTACTGTAATGATCGCTTTCTGACATCCATCCCCACAGGAATACCAGAGGATGCTACAACTCTTTACCTTCAGAACAACCAAATAAATAATGCTGGGATTCCTTCAGATTTGAAAAACTTGCTGAAAGTAGAAAGAATATATCTATACCATAACAGTTTAGATGAGTTTCCTACCAACCTCCCAAAGTATGTAAAAGAGTTACACTTGCAAGAAAATAACATAAGAACTATCACTTATGATTCACTTTCAAAAATTCCATACCTGGAAGAATTACATTTAGATGATAACTCTGTCTCTGCTGTTAGCATTGAAGAAGGAGCATTTCGAGACAGCAACTATCTCCGGCTACTTTTCTTGTCCCGTAATCACCTTAGCACAATTCCCTGGGGTCTGCCCAGGACTATAGAAGAACTACGTTTGGATGATAATCGCATATCCACTATTTCATCACCATCTCTTCAAGGCCTCACTAGTCTAAAACGCCTGGTTTTAGATGGAAACCTGTTGAACAACCATGGTTTAGGTGACAAAGTTTTCTTCAGCCTCGTTAACTTAACAGAACTATCACTGGTAAGGAATTCCTTGACTGCTGCACCAGTAAACCTTCCAGGCACAAACCTGAGGAAGCTTTACCTACAAGATAACCACATCAACCGGGTGCCCCCAAATGCTTTTTCTTATCTAAGGCAGCTGTATCGACTTGATATGTCTAATAATAACCTAAGTAATTTACCTCAGGGTATCTTTGATGATTTGGACAATATAACCCAACTGATTCTTCGCAACAATCCCTGGTATTGTGGCTGCAAGATGAAATGGGTACGTGACTGGTTACAATCACTACCTTTGAAGGTCAACGTGCGGGGGCTCATGTGCCAAGCCCCAGAAAAAGTTCGTGGGATGGCTATCAAGGACCTCAATGCAGAACTGTTTGATTGTAAAGACAGTGGGATTGTAAGCACCATTCAGATAACCACTGCAATACCCAATACACAGTATCCTGCTCAAGGACAGTGGCCAGCTCCAGCGACAAAACAACCAGATATTAAGAACCCCAAGCCTAAGGATCAGCGAACTACAGGGAGCCCCTCAAGAAAAACAATTATAATTACTGTGAAGTCTGTCACCTCTGACACAATACATATCTCCTGGAAACTTGCTCTACCTATGACTGCTTTAAGGCTCAGCTGGCTTAAACTGGGCCACAGCCCAGCATTTGGATCTATAACAGAAACAATTGTAACAGGGGAACGCAGTGAATACTTGGTTACAGCCCTGGAGCCTGACTCACCCTACAGAGTATGCATGGTTCCCATGGAAACCAGCAACCTCTATTTCTTTGATGAAACTCCTGTTTGTATTGAGACTGAAACTGCACCTCTTAGAATGTACAACCCTACAACCACCCTCAATCGAGAGCAAGAGAAAGAACCTTACAAAAACCCTAATTTACCTTTGGCTGCCATCATTGGTGGGGCAGTAGCCCTGGTGACCATTGCCCTTCTTGCTTTAGTGTGTTGGTATGTTCATAGGAATGGATCTCTATTCTCCAGGAACTGTGCATACAGCAAAGGGAGGAGAAGAAAGGATGACTATGCAGAAGCTGGCACTAAGAAGGACAACTCTATCCTGGAAATCAGGGAGACTTCTTTTCAGATGTTACCAATAAATAATGAACCCATCTCAAAGGAGGAGTTTGTAATACACACCATATTTCCTCCTAATGGAATGAATCTGTATAAAAACAATCACAGTGAAAGCAGTAGTAACCGAAGCTACAGAGACAGTGGCATTCCAGACTCAGATCACTCACACTCATGA

XM_004840751.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X6

Length: 1590 bp    Location: 4936539..4951064   Strand: +
>XM_004840751.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840749.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X4

Length: 1590 bp    Location: 4936539..4951064   Strand: +
>XM_004840749.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840752.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X7

Length: 1590 bp    Location: 4936539..4951064   Strand: +
>XM_004840752.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840874.1 Coding sequence

Dzank1 double zinc ribbon and ankyrin repeat domains 1, transcript variant X6

Length: 2040 bp    Location: 19196501..19143176   Strand: -
>XM_004840874.1
ATGACGGCTGGTTCAGTGTGTGTCCCTCAGATCATACCACTGCGAATACCTCAGCCTGGAAAAGCGAACCATGAAATTGATAATAATACTCTTTTGGAAATGAAATCAGACACCCCGGATGTCAACATATATTACACCCTGGATGGCAGTAAACCTGAATTTCTGAAGAAAATTGGTTATGGTGAAAATAATACATTTAAGTATACAAAACCTATTACTCTGCCTGATGGAAAAATACAAGTTAAAGCTATTGCAGTGTCTAAAGACAACAGACAGAGTGGAATTGTCACAAAGGTGTTCCAAGTAGACTATGAACCACCAAGCCCAGCCTCTTCTGGAGACAGAGTTGAAAATGTTCTCAAAGGCTCTTCAAAGCAGGAATTAAAAAATGGATTTGTTGGACCAAAAGTAAGAAAGAAATGTAAGAATGCTGAAAATAAACCTGGTTGGAATGTTAACCTTCGAAAGTTTTCAGACCTCAAGGTAGGCGAAAGATCTACACTTCTGAAAGCTCTGAGAGATCTTCGTTTCTCAAAGAGTCCATTGGAAATCTCAGCTCACTGTGAAGGATCAAGTTCTAGGCTGCTCACCCACCAGTCCCAGTTTCAGTCGCCTGGTTTTGCACACATACCAGGCCAGAAGAGTTTGACAAGCACGGAGATCATGAGAATCCAAAGGCAGACAGACTTTCTCAAGTGTGCCCACTGCCTGGCCCCCCGCCCATCGGATCCTTTCGCTAGATTCTGTCACGAGTGTGGTGCTCCTGTCCCATCCATATTTGGCTGTCGTCTTCCACCCCCTGAAGGAGCGCAGATGGGCTCGTGTGCAGAATGTGGAAACGTGGTGCCCATGAACACCCCCATCTGTGTGGTGTGCGAGGCTCCACTTGCTCTACAGCTGCAGCCCCAGGCCAGCCTCCACTTGAAGGAGAAGGTGATCTGCCGCTCCTGTGGCACGGGGAATCCTGCTCACCTGAGATACTGTGTCACCTGCGAGGGGGCCCTGCCTTCGCCACAAGAGTCCTGGAACAGTGGCGAGAAAGCACCCCCTCTGCTGACCCAGAAAGGGGAGACCACTTCCTGGTGCAGATGTGGCTGCCACAACCTCGGGGAGGCAATCTTCTGCGACTGGTGTGGAGCCAAGCTTGGCCTTTCTGCTAGCCACTCCATCTGCCCTAAATGTGGGGCCAGCAATCACCCATCTGCTCAATTCTGTGCTACCTGTGGCGTTTGTGTGAACTCCATGGCAAGACAGAGCCTGGATGGCAGCCCGACTGTCCTAGCTGGGGAGCCGCACCCCACTTCTCAGCCCCGATATGCTTGGCAACCCCTAACTGTCCCTCTGCCCAGCGCTGATGCTGGGCCTAAGAAGCATGTGGGCACCCAGACCGTGGGCCTCTTCTACCCGTCTGGCAGGCAGCTGGCCTTGAAGGAGCCGGAGGTGGAGACACGTGGCCGCATGCCCCCACTCATGGCCATCAGCCCAGGCAGAGGATACTGGAGAAAACAGTTGGATCACATCTCTGCTCACCTCCGGTCCTACACTCAGAACAACCCTGAGTTCCGGGCCCTGGTCTCAGAGCCCAGGATGGGGAAGCTCATCTCTGCCACTGTCCATGAAGATGGCTGTGAAGTTAGCATCAGGCTGAATTATATTCAAGTCTCCAACAAGAACCTGTACCTCAGCAAAGCAATGGACTTAAGCAACCGCTTTCTCAGCAGTATCACCGAGGGTGGTGATGGCCTCTACGGCAGCAGGTCCAGCTTGGTGAGTGACTACAGCCAGAGTCCCTCAGACTCTGAGGTCAAGAGGATGAGGAACATCAAAACCAAAAACTTTCACATAAAGAAAGAGCAGCCGAGGCCTAGAAGCAGACATCGGGTGGAAGAAGTGGGCCTGGCAGGGGACAAAAGAGTCTCTGTGCTTGAACAGCTGCTGGACAAGGTACAGCACGAGCCTCCAGAAGGTGGACACTCGAGGCCAGACAGCCCACAACCTGGCTCTGGAAAGGGAGGACCACCACGTCACCTTGCTCTTTGA

XM_004840750.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X5

Length: 1590 bp    Location: 4936540..4951064   Strand: +
>XM_004840750.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840753.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X8

Length: 1590 bp    Location: 4936540..4951064   Strand: +
>XM_004840753.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840759.1 Coding sequence

Pank2 pantothenate kinase 2

Length: 1350 bp    Location: 4966260..5007720   Strand: +
>XM_004840759.1
ATGGGAGCGGGCCGGCTCGGCGCGCCCATGGAGCGCCACGGCAGAGCCGCCGCTACCTCAGCTCCGTTGGCCGGAGAGCAGGAGCCCGGAGGCGCCGAAGAAGGGCGGCGGCGGCGGGAGCCACTGCGGCGCCGGGCTAGCAGCGCCTCGGCGCCCCGGGTCCGGGCCGCGGCAGAGGGCGCGAGGCGGGACCGGCCCGGCTCCTACAGCGGTTCTGCCTCCGTGTCCCGCCAGCGCGTCGAAAGCCTCCGGAAAAAGCGGCCTCTTTTTCCATGGTTTGGCTTGGATATTGGTGGTACCCTGGTCAAGCTGGTTTATTTTGAACCCAAAGACATCACTGCTGAAGAAGAAGAGGAAGAAGTAGAGAGTCTTAAAAGCATTCGGAAGTACCTGACCTCCAATGTGGCTTATGGGTCTGCGGGCATTCGGGATGTGCACCTTGAGCTGAAGGACCTGACTCTGTGTGGACGCAAAGGCAATCTGCACTTTATACGCTTTCCCACTCATGACATGCCTGCTTTTATTCAAATGGGGAGAGATAAAAACTTCTCGAGTCTCCACACAGTCTTTTGTGCCACTGGAGGTGGAGCATACAAATTTGAGCAGGATTTTCTCACAATAGGTGATCTTCAGCTTTGCAAACTGGATGAACTAGATTGCTTAATAAAAGGAATTTTATACATTGACTCAGTGGGATTCAATGGACGGTCACAGTGCTACTACTTTGAAAACCCTGCTGATTCTGAAAAATGTCAGAAGTTGCCATTTGAATTGAAAAATCCATACCCCTTGCTTCTGGTGAACATTGGCTCAGGGGTTAGCATCTTAGCAGTATATTCCGAAGATAATTACAAGAGGGTTACAGGTACTAGTCTTGGAGGAGGAACTTTTTTTGGTCTCTGTTGTCTTCTAACTGGCTGTACTACTTTTGAAGAAGCTCTTGAAATGGCATCTCGTGGAGACAGTACCAAAGTGGATAAACTAGTGCGAGACATTTATGGAGGAGATTATGAGAGGTTTGGATTGCCAGGCTGGGCCGTGGCTTCGAGCTTTGGAAACATGATGAGCAAGGAGAAGCGAGAGGCTGTCAGTAAGGAGGACCTCGCCAGAGCGACTTTGATCACTATCACCAACAACATTGGCTCCATAGCAAGAATGTGTGCTCTTAATGAAAACATTAACCAGGTGGTATTTGTTGGAAATTTCTTGAGAATTAATACCATCGCCATGCGGCTTTTGGCATATGCTTTGGATTATTGGTCCAAGGGGCAACTGAAAGCACTGTTTTCGGAACATGAGGGTTATTTTGGAGCTGTTGGAGCACTTCTTGAGCTGTTGAAGATTCCCTGA

XM_004840765.1 Coding sequence

Smox spermine oxidase, transcript variant X6

High confidence: 4 potential gene matches
Length: 1668 bp    Location: 5215998..5250731   Strand: +
>XM_004840765.1
ATGCAAAGTTGTGAATCCAGTGGCGAAAGTGCGGATGACCCTCTCAGTTGTGGCCTGCGGAGAAGGGGACAGCCTCGAGTTGTGGTGATTGGTGCTGGCTTGGCTGGCCTGGCTGCAACCAAAGCGCTTCTGGAGCAGGGCTTCACAGATGTCACTGTCCTCGAGGCTTCTAGCCGCATCGGAGGCCGCGTGCAAAGCGTGAAACTCGGACACGCCACCTTTGAGCTGGGAGCCACCTGGATCCATGGCTCCCATGGGAATCCTGTCTATCATCTAGCAGAAGCCAACGGCCTCTTGGAAGAGACAACCGATGGTGAGCGCAGCGTGGGCCGCATCAGCCTCTACTCCAAGAATGGCGTGGCCTGCTACCTTACCAACCGCAGCCGCAGGATCCCCAAGGATGTGGTTGAGGAATTCAGCGATTTATACAACGAGGTCTATAACTTGACCCAGGAGTTCTTCCGGCATGGTAAACCAGTCAATGCGGAGAGTCAGAACAGCGTTGGGGTGTTCACCCGGGAGGAGGTGCGCAACCGCGTCAGGGATGAGCCTGATGACCCGGAGACCACCAAGCGCCTGAAACTTGCCATGATGCAGCAGTACCTGAAGGTAGAAAGCTGTGAGAGCAGCTCACACAGCATAGACGAAGTATCCCTGAGCGCCTTCGGGGAGTGGACCGAGATCCCTGGTGCCCACCACGTCATCCCCTCAGGCTTCATGCGGGTCGTGGAGCTGCTGGCTGAGGGCATCCCGGCCCATGTAATCCAGCTGGGGAAACCTGTCCGGTGTATTCACTGGGACCAGGCCTCTGCCCGCCCCCGGGGTCCTGAGATCCAGCCTCGGGACAAGGGTGACCACAATCACGACACAGGGGAGGACAACCAGAGTGGAGAGAGTTCCCAGGGGCATGGATGGGATGAGGATGAGCAGTGGCCGGTGGTGGTGGAGTGCGAAGACTGCGAGGTGATCCCAGCAGACCACGTGATTGTGACCGTGTCCCTGGGTGTGCTCAAGAGGCAGTACACCAGCTTCTTCCAGCCGGGCCTGCCCACAGAAAAGGTGGCTGCCATCCACCGCCTGGGCATTGGCACCACTGACAAGATCTTCCTTGAATTTGAGGAGCCCTTCTGGGGTCCTGAGTGCAACAGCCTGCAGTTTGTGTGGGAGGATGAGGCTGAGAGCCACACCCTCACCTACCCACCTGAGCAGTGGTACCGCAAAATCTGTGGCTTCGACGTCCTCTACCCCCCTGAGCGCTATGGCCATGTGCTGAGTGGCTGGATCTGTGGGGAGGAGGCCCTTGTCATGGAGAGGTGTGATGACGAGGCAGTGGCCGAGATCTGCACAGAGATGTTGCGTCAGTTCACAGGGAACCCCAACATTCCAAAACCTCGGCGAATCCTGCGCTCGGCCTGGGGTAGCAACCCTTACTTCCGAGGCTCCTACTCATACACGCAGGTGGGCTCAAGTGGGGCAGACGTGGAGAAGCTGGCCAAGCCGCTGCCCTACACAGAGAGCTCCAAGACCGCGCCCATGCAGGTGCTGTTCTCGGGGGAGGCCACCCACCGCAAGTACTACTCCACTACTCACGGTGCTCTGCTGTCCGGCCAGCGCGAGGCTGCTCGTCTCATCGAGATGTATCGAGACCTCTTCCAGCAGGGTCCCTGA

XM_004840761.1 Coding sequence

Smox spermine oxidase, transcript variant X2

Length: 1758 bp    Location: 5232819..5250731   Strand: +
>XM_004840761.1
ATGCAAAGTTGTGAATCCAGTGGCGAAAGTGCGGATGACCCTCTCAGTTGTGGCCTGCGGAGAAGGGGACAGCCTCGAGTTGTGGTGATTGGTGCTGGCTTGGCTGGCCTGGCTGCAACCAAAGCGCTTCTGGAGCAGGGCTTCACAGATGTCACTGTCCTCGAGGCTTCTAGCCGCATCGGAGGCCGCGTGCAAAGCGTGAAACTCGGACACGCCACCTTTGAGCTGGGAGCCACCTGGATCCATGGCTCCCATGGGAATCCTGTCTATCATCTAGCAGAAGCCAACGGCCTCTTGGAAGAGACAACCGATGGTGAGCGCAGCGTGGGCCGCATCAGCCTCTACTCCAAGAATGGCGTGGCCTGCTACCTTACCAACCGCAGCCGCAGGATCCCCAAGGATGTGGTTGAGGAATTCAGCGATTTATACAACGAGGTCTATAACTTGACCCAGGAGTTCTTCCGGCATGGTAAACCAGTCAATGCGGAGAGTCAGAACAGCGTTGGGGTGTTCACCCGGGAGGAGGTGCGCAACCGCGTCAGGGATGAGCCTGATGACCCGGAGACCACCAAGCGCCTGAAACTTGCCATGATGCAGCAGTACCTGAAGGTAGAAAGCTGTGAGAGCAGCTCACACAGCATAGACGAAGTATCCCTGAGCGCCTTCGGGGAGTGGACCGAGATCCCTGGTGCCCACCACGTCATCCCCTCAGGCTTCATGCGGGTCGTGGAGCTGCTGGCTGAGGGCATCCCGGCCCATGTAATCCAGCTGGGGAAACCTGTCCGGTGTATTCACTGGGACCAGGCCTCTGCCCGCCCCCGGGGTCCTGAGATCCAGCCTCGGGACAAGGGTGACCACAATCACGACACAGGGGAGGACAACCAGAGTGGAGAGAGTTCCCAGGGGCATGGATGGGATGAGGATGAGCAGTGGCCGGTGGTGGTGGAGTGCGAAGACTGCGAGGTGATCCCAGCAGACCACGTGATTGTGACCGTGTCCCTGGGTGTGCTCAAGAGGCAGTACACCAGCTTCTTCCAGCCGGGCCTGCCCACAGAAAAGGTGGCTGCCATCCACCGCCTGGGCATTGGCACCACTGACAAGATCTTCCTTGAATTTGAGGAGCCCTTCTGGGGTCCTGAGTGCAACAGCCTGCAGTTTGTGTGGGAGGATGAGGCTGAGAGCCACACCCTCACCTACCCACCTGAGCAGTGGTACCGCAAAATCTGTGGCTTCGACGTCCTCTACCCCCCTGAGCGCTATGGCCATGTGCTGAGTGGCTGGATCTGTGGGGAGGAGGCCCTTGTCATGGAGAGGTGTGATGACGAGGCAGTGGCCGAGATCTGCACAGAGATGTTGCGTCAGTTCACAGGGAACCCCAACATTCCAAAACCTCGGCGAATCCTGCGCTCGGCCTGGGGTAGCAACCCTTACTTCCGAGGCTCCTACTCATACACGCAGGTGGGCTCAAGTGGGGCAGACGTGGAGAAGCTGGCCAAGCCGCTGCCCTACACAGAGAGCTCCAAGACCGCGCACAGAGGCACCACAAAGCAGCAGCCTGGTCACCTTTTATCATCTAAGTTTCCAGAACAGTCTCTGGACCCTAGTAGGGGCTCCATAAAGCCCATGCAGGTGCTGTTCTCGGGGGAGGCCACCCACCGCAAGTACTACTCCACTACTCACGGTGCTCTGCTGTCCGGCCAGCGCGAGGCTGCTCGTCTCATCGAGATGTATCGAGACCTCTTCCAGCAGGGTCCCTGA

XM_004840763.1 Coding sequence

Smox spermine oxidase, transcript variant X4

Length: 1758 bp    Location: 5237494..5250731   Strand: +
>XM_004840763.1
ATGCAAAGTTGTGAATCCAGTGGCGAAAGTGCGGATGACCCTCTCAGTTGTGGCCTGCGGAGAAGGGGACAGCCTCGAGTTGTGGTGATTGGTGCTGGCTTGGCTGGCCTGGCTGCAACCAAAGCGCTTCTGGAGCAGGGCTTCACAGATGTCACTGTCCTCGAGGCTTCTAGCCGCATCGGAGGCCGCGTGCAAAGCGTGAAACTCGGACACGCCACCTTTGAGCTGGGAGCCACCTGGATCCATGGCTCCCATGGGAATCCTGTCTATCATCTAGCAGAAGCCAACGGCCTCTTGGAAGAGACAACCGATGGTGAGCGCAGCGTGGGCCGCATCAGCCTCTACTCCAAGAATGGCGTGGCCTGCTACCTTACCAACCGCAGCCGCAGGATCCCCAAGGATGTGGTTGAGGAATTCAGCGATTTATACAACGAGGTCTATAACTTGACCCAGGAGTTCTTCCGGCATGGTAAACCAGTCAATGCGGAGAGTCAGAACAGCGTTGGGGTGTTCACCCGGGAGGAGGTGCGCAACCGCGTCAGGGATGAGCCTGATGACCCGGAGACCACCAAGCGCCTGAAACTTGCCATGATGCAGCAGTACCTGAAGGTAGAAAGCTGTGAGAGCAGCTCACACAGCATAGACGAAGTATCCCTGAGCGCCTTCGGGGAGTGGACCGAGATCCCTGGTGCCCACCACGTCATCCCCTCAGGCTTCATGCGGGTCGTGGAGCTGCTGGCTGAGGGCATCCCGGCCCATGTAATCCAGCTGGGGAAACCTGTCCGGTGTATTCACTGGGACCAGGCCTCTGCCCGCCCCCGGGGTCCTGAGATCCAGCCTCGGGACAAGGGTGACCACAATCACGACACAGGGGAGGACAACCAGAGTGGAGAGAGTTCCCAGGGGCATGGATGGGATGAGGATGAGCAGTGGCCGGTGGTGGTGGAGTGCGAAGACTGCGAGGTGATCCCAGCAGACCACGTGATTGTGACCGTGTCCCTGGGTGTGCTCAAGAGGCAGTACACCAGCTTCTTCCAGCCGGGCCTGCCCACAGAAAAGGTGGCTGCCATCCACCGCCTGGGCATTGGCACCACTGACAAGATCTTCCTTGAATTTGAGGAGCCCTTCTGGGGTCCTGAGTGCAACAGCCTGCAGTTTGTGTGGGAGGATGAGGCTGAGAGCCACACCCTCACCTACCCACCTGAGCAGTGGTACCGCAAAATCTGTGGCTTCGACGTCCTCTACCCCCCTGAGCGCTATGGCCATGTGCTGAGTGGCTGGATCTGTGGGGAGGAGGCCCTTGTCATGGAGAGGTGTGATGACGAGGCAGTGGCCGAGATCTGCACAGAGATGTTGCGTCAGTTCACAGGGAACCCCAACATTCCAAAACCTCGGCGAATCCTGCGCTCGGCCTGGGGTAGCAACCCTTACTTCCGAGGCTCCTACTCATACACGCAGGTGGGCTCAAGTGGGGCAGACGTGGAGAAGCTGGCCAAGCCGCTGCCCTACACAGAGAGCTCCAAGACCGCGCACAGAGGCACCACAAAGCAGCAGCCTGGTCACCTTTTATCATCTAAGTTTCCAGAACAGTCTCTGGACCCTAGTAGGGGCTCCATAAAGCCCATGCAGGTGCTGTTCTCGGGGGAGGCCACCCACCGCAAGTACTACTCCACTACTCACGGTGCTCTGCTGTCCGGCCAGCGCGAGGCTGCTCGTCTCATCGAGATGTATCGAGACCTCTTCCAGCAGGGTCCCTGA

XM_004840767.1 Coding sequence

Adra1d adrenoceptor alpha 1D

High confidence: 4 potential gene matches
Length: 1701 bp    Location: 5297181..5276494   Strand: -
>XM_004840767.1
ATGACTTTCCGCGACCTCCTCAGCGTCACTTTCGAGGGACCCCGCCCGGACGGCAGCGCCGGGGGCTCCGGGGCTGGCGGCGGCGGGAGCGGCGCGGGCGGCACGGCGGCCTCGGAGGGCCCAGCGGTGGGCGGTGTGCCAGGGGCCGCAGGCGGCGGCGGTGGCGGCGTGGTGGGCGCGGGCGGCAGTGAGGACAACCGGAGCTCGGCCGGGGAACCCGGGGCCGCGGGCGCGGGAGGCGAGGTGAACGGCACGGCGGCCGTCGGGGGGCTGGTGGTGAGCGCGCAGGGCGTGGGCGTGGGCGTGTTTCTGGCAGCCTTCATCCTCACTGCCGTGGCGGGCAATCTGCTTGTCATCCTCTCGGTGGCCTGCAACCGCCACCTGCAGACGGTCACCAACTATTTCATTGTGAACCTGGCCGTGGCCGACCTGCTGTTGAGCACCACCGTGCTGCCGTTCTCTGCCACCATGGAGGTCCTGGGCTTCTGGGCCTTCGGTCGGGCCTTCTGCGACGTGTGGGCAGCCGTGGACGTGCTGTGCTGCACCGCCTCCATCCTCAGCCTGTGCACCATCTCCGTGGACCGGTACGTGGGCGTTCGCCACTCGCTCAAGTACCCGGCCATCATGACTGAGCGCAAGGCGGCCGCCATCCTGGCGCTGCTCTGGGCCGTGGCCCTCGTGGTGTCGGTGGGGCCGCTGCTGGGCTGGAAGGAGCCCGTGCCCCTGGATGAGCGTTTCTGTGGCATCACGGAGGAGGCCGGCTACGCTGTCTTCTCTTCGCTGTGCTCCTTCTACCTTCCCATGGCGGTCATCGTGGTCATGTACTGCCGCGTGTACATAGTAGCGCGCAGCACCACGCGCAGCCTGGAGGCCGGCATCAAACGCGAGCGGGGCAAGGCCTCGGAGGTGGTGCTGCGCATCCACTGTCGCGGGGCAGCCACCGGTGCCGACGGGGCGCACAGCGGAACTCGGAGCACCAAGGGCCACACCTTCCGCAGCTCGCTCTCAGTGCGCCTCCTCAAGTTCTCCCGCGAGAAGAAGGCTGCCAAGACGCTGGCCATCGTCGTGGGCGTCTTCGTGCTCTGCTGGTTCCCCTTCTTCTTCGTCCTGCCGCTTGGCTCTCTGTTCCCGCAGCTGAAGCCGTCCGAAGGTGTGTTCAAGGTTATCTTCTGGCTCGGCTACTTCAACAGCTGCGTGAACCCTCTCATCTACCCTTGCTCCAGCCGCGAGTTCAAACGCGCTTTCCTCCGCCTCCTGCGCTGCCAGTGTCGCCGCCGCCGCCGCCGCCGCCCTCTCTGGCGCGTCTACGGCCACTACTGGCGAGCCTCGACCAGCGGCCCGCATCCCGACTGCGCCCCCAGCCCGGGCGCCGCGCCCCCAGGGGCCCCGCTGGCCCTCATCGCGCCCTCTGCCCCCGGCACGCCAGAGGTCCAGGCTGCGGTCTCCAGCCATCGAAAGCCGCCCAGCACTTTCCGCGAGTGGCGGCTGCTTGGGCCCCTCCGGAGACCCACGACCCAGCTGCGTGCCAAGGTCTCCAGCCTGTCGCACAAGATCCGCTCCGGGGGCGCGCAGCGCCCAGAGGCCCTGCGCACTGAAGTGGAGGCCGTGTCTCTCGGAGTCCCCCAGGATTTGGCAGAGGGCGCCACCTGCCAGGCTTATGAAGAAGCTGACTACACTAACCTCCGGGAGACTGATATTTAA

XR_205060.1 Non-coding sequence

Rassf2 PREDICTED: Heterocephalus glaber Ras association (RalGDS/AF-6) domain family member 2 (Rassf2), transcript variant X4, misc_RNA.

Length: 3177 bp     
>XR_205060.1
AGCCGCGGGGAGATCCCGGGCGTGCGGATGCCTTACGGGCCGCGTGGTCTCGGAGTCCCAGCGCGCCCGCCTGGCGGCCGAAGAAAGTTGCGCCTCGGAGCTTACCCTCGGCTCTGACCCTGGGGTTCCTCCTTCCTTCCGCGCCCAGGGTGGTGGCGGGAAGGTATCCGCGCCCCAGACACAGGGTCTCCGGGACTCCCTGGAGAGGCGGGGCCGAGCAGCTGGTGCAGAGATAGGCAGGCCGCAGCACCCCGGGGAGTGTCTGCCCCAATCCGCCCCTTTCCTCCTGGGGCGACGGACAGTACCGAGGTGGGTCGGAGGCCCCAGAGCCAAGTGAGGACGCAGGGGCCTGTGTCTTCCGGGCACTTCCCCGCTGCGCTACGGTCTCGGGCTTCCCCCGGAGCCCGGCTGAGGTCGCCAGGGACCTAGCTTTGAGCTCTCTTGCGCCTGAAAGAGGCAGGTGCCTTGGGCGGCAGGCCCTCTTCTGCATTTCCAGTGCTTACTTTGCGCTCAGCTCTGAGCGAGGAGAGACTTAGGGACAGCAGACAGTGACGGTGACTTGACAGGGAGGCAGAGGGTTCTGTTTCACATCTAGGGTGCTGTGTGAGTTCTGGACTGTCCACAGCACCTGCGCGCCGCGGGAACAAGCTGAGCGCCAGCCTTCTCAACGCGCTATATGCACTTTATTCCCAGGAGGCTGGAGCCCAGGGGACAAGAACACATTGGCAGAGGCCGCTTCCACAGCCGCAGAGGTTATATTCCAGGCCTCTCCTTCTGATGAACAGAGACACAAAGAATGGATTACAGTCACCAAACTTCCCTAGTCCCACGTGGGCAAGATAAATACATTTCCAAGAATGAACTTCTCCTGCACCTGAAGACCTACAACCTGTACTATGAGGGCCAGAACTTGCAGCTGCGACACAGGGAGGAAGAAGATGAGTTCATCGTGGAGGGGCTGCTGAACATCTCCTGGGGGCTGCGCCGGCCCATCCGTCTGCAGATGCAAGACGACAATGAGCGCATCCGGCCCCCGCCCTCCTCCTCGTCCTGGCACTCAGGCTGCAACCTGGGGGCTCAGGGCACCATCCTGAAGCCCCTCACCATGCCTGCCATTCAGATCTCAGAGGCGGACACCCCTCCCGAGGGTGACCAGACACCCAGCCTCACAGACACCAGGGGTCTGAAGCCCGTGCAGGAAGACACCCCACAGCTGATGCGCACGCGCAGTGATGTTGGGGTGCGTCGGCGTGGTAACGTGAGAACGCCCAGTGACCAGCGGCGAATCCGACGCCACCGCTTCTCCATCAATGGCCATTTTTACAACCACAAGACTTCCGTGTTCACGCCTGCCTATGGCTCTGTCACCAACGTCCGAATCAACAGCACCATGACTACCCCGCAGGTCCTGAAGCTGCTGCTCAACAAATTTAAGATTGAGAATTCAGCAGAGGAGTTTGCTTTGTACGTGGTCCACACCAGTGGTGAGAAACAGAAGCTGAAGACCACCGATTACCCACTGATTGCCCGCATCCTGCAGGGGCCCTGTGAGCAGGTCTCCAAGGTGTTCCTGATGGAGAAAGACCAGGTGGAGGAGGTCACCTATGACGTGGCCCAGTACATAAAGTTTGAGATGCCGGTCCTGAAAAGCTTCATCCAGAAGCTCCAGGAGGAGGAGGATCGGGAGGTGAAGAAGCTGATGCAGAAGTGTGGAAGTGAACACAGTAATGCAGTGGCTCATGAGTGGGCTAGTGAAGGTATCACCCAGTGCCACCTGATGTTAGCTGGTGCCTCCTGGGTGGGGTTGGGGGGGTCATCCGAAGGAAGGGTCTGTTGCCAGCTGCCTTCTACTATAGGCTATCTCTTGTCCCCAGGTACACTGTACTCCGGCTAATGATTAGCCAAAGGCTGGAGGAGATAGCTGACACTCCGGCAACAATCTGAACTGCAGGAATGGGGGATCCAGGTGCCCCAGGGGCTGCCACTGACCTGAGAAGACCCACAGGAAGCTGGGCGCTCCCCTCCCATGGCAGTGCTTATGTGCAAACCACAAGCCATCCTTTGGTCCTTGGAACAGGATGAGAAGCCAGCGGACAACTCCCTATCCCTGGATCCCTGCTCTCCTCTCTTTCACTTGCAAGAACTTTTGATTTTAACTATAAGGAGGACCACAGATATGTACCTGTATGTGCACAGGACACTCGCTTGTGCCTCCCTGATGTTTCCATCTGCAGTTGACTCTAGCAGCCAGCTCCACCACCACAAGGCTGACAGATGTGTGCCAGTGGCAGGAGAGTCAGGGGAGGACTTCAGGCTAAAGAAAAAATTTTTTCTCTTAAGAGCCGGGGGCAGCCACACAAATCTGCCCAAGTGTAGAAGGGGCATTTGTGCTGATAAGAGATTCTCTGTATGCCTGGAAAGGTCAGTGAATGTGAGATCCTTGGAAATTAAAAATAACATCCCCATATCCTTGTCTGATGGAGAGAAACAGATAAATTATCCTGGGTAGTTGCAATGAGTCCACATGTTTTTACACTGGAAACTTTGCTTGTTTTAAATAACAAAGATGAATGTGCTGGTCCATGTAGATGCCGAAGAATGGATTCCACCTTGCAGAGTCGGGGAGCCTGCATGATTCTCCCACGTGGTTCTCTGGTGCTTCCTTGGGATGGAGGAAAGTCCCACAAAGCAGAGGCCTCACGGGGTGCCCACGATGCTCACTGGGGCCTGGCTTGTCCTGAGAAGATGGCCAGGAGGTTTCCAAGCCCCCTCCTTAGGGCTGAAGGAAGAGCAGAGGCCACCTGCAGAGACCAGCGCCTGCCAGCCCAACCCGTCTTCACATCAGCACATCTTTGGGCTGTGCAGATCAACTGAGCAAGATCAGAACGCAGAACGGATGTTACAGAAAGGAGAAAAGACCACAGAGCACAGCACGACGTCTTCCTGGTGCCAAGTCACCTGACAACACTCACACATCTGCCCTGACCGCTGCATGGACCTCTACCACAAATATTTGCTTCGACCCCTGTACGTGCCAGACCCCTTCCTGATCCCCTATAAAAATCCCTGCCTGGGGCTGGGGATTTAGCTCAGTGGTTCTGCCGCCTGCCCTGCAAGGGCAAGGACCCGAGTTCGATCCTCTGTACCAAAAAAAAAAAAAAAAATCCCTGCCTGTTC

XM_004840778.1 Coding sequence

Slc23a2 solute carrier family 23 (nucleobase transporters), member 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 1953 bp    Location: 6049987..5917621   Strand: -
>XM_004840778.1
ATGATGGGTATTGGCAAGAACACTACATCCAAATCAGTGGAGGCTGGGAGTTCCACAGAGGGCAAATACGAAGATGAAGCAAAGCACCCCACCTTCTTCACTCTTCCGGTGGTCATCAATGGAGGGGCCACATCCAGCGGGGAGCAGGACAATGAAGATACAGAGCTCATGGCAATCTACACTACAGAAAATGGCATCCCCGAGAAGAGCTCTCTCGCGGAAACCCTGGACAGCACCGGCAGTCTGGACCCCCAGCGGTCGGACATGATCTACACCATAGAAGACGTTCCCCCCTGGTACCTGTGCATATTTCTGGGGCTGCAGCACTATCTGACCTGCTTCAGCGGCACCATCGCAGTGCCCTTTCTGCTGGCCGATGCCATGTGTGTGGGGTATGACCAGTGGGCCACCAGCCAGCTCATCGGGACCATTTTCTTCTGTGTGGGAATTACAACTTTGCTGCAGACCACGTTTGGATGCAGGTTACCCCTGTTTCAGGCCAGTGCTTTTGCATTTTTGGCCCCTGCTCGAGCCATCCTGTCTTTAGATAAATGGAAATGTAACACCACAGATGTTTCAGTTGCCAATGGAACAGCAGAGCTGTTGCAGACAGAACGCATCTGGTATCCGCGGATCAAAGAGATCCAGGGTGCCATCATCATGTCCTCATTGATAGAAGTGGTCATTGGGCTCCTTGGCCTGCCTGGGGCTCTGCTGCGATACATTGGGCCACTGACCATCACACCCACAGTGGCCCTCATCGGACTCTCTGGTTTCCAGGCAGCTGGAGAGAGGGCTGGAAAGCACTGGGGCATCGCCATGCTGACAATTTTCCTAGTGTTACTGTTTTCTCAATATGCCAGAAATGTTAAATTTCCTCTCCCGATTTACAAATCTAAGAAGGGATGGACTGCGTACAAGTTACAGCTTTTCAAAATGTTCCCTATAATCCTGGCCATCCTTGTGTCCTGGCTGCTCTGCTTCATCTTCACAGTGACTGATGTCTTCCCTCCTGACAGCACCAAGTATGGCTTCTATGCGCGCACAGATGCCAGGCAGGGTGTGCTGCTGGTTGCCCCCTGGTTTAAGGTTCCATACCCATTTCAGTGGGGGCTGCCCACCGTCTCTGCAGCCGGCGTCATCGGCATGCTCAGTGCCGTTGTGGCCAGCATCATTGAGTCCATCGGTGACTACTACGCCTGTGCCAGGCTCTCCTGTGCCCCGCCACCTCCCATCCATGCAATAAACAGGGGGATCTTCGTGGAGGGTCTCTCCTGTGTTCTCGATGGCATATTTGGTACTGGGAATGGCTCTACTTCATCCAGTCCCAACATTGGAGTTTTGGGAATTACAAAGGTGGGCAGCCGCCGGGTGATCCAGTACGGTGCCGCCCTCATGCTTGGCCTGGGCATGATTGGCAAGTTTAGTGCCCTCTTCGCGTCCCTGCCGGACCCGGTGCTTGGAGCCCTCTTCTGCACTCTCTTCGGAATGATCACTGCTGTTGGCCTGTCCAACCTGCAATTCATTGACTTGAATTCCTCCCGGAACCTTTTTGTGCTTGGATTTTCCATCTTCTTTGGGCTCGTCCTTCCAAGTTACCTCAGACAGAACCCTCTGGTCACAGGCATAACAGGAATTGATCAAGTCTTAAATGTTCTTCTCACAACTGCTATGTTTGTAGGAGGCTGTGTGGCTTTTATTTTGGACAACACCATCCCAGGTACCCCAGAGGAAAGAGGAATCAGGAAATGGAAGAAGGGCGTGAGCAAAGGGAACAAGTCGCTTGATGGCATGGAATCCTACAACTTGCCATTCGGCATGAACATTATCAAAAAATACAGATGCTTCAGCTACCTGCCCATCAGCCCAACCTTTGTAGGCTACACATGGAAAGGCTTTGGGAAGAGCAAAAACAGTCGGAATTCAGATGAAGACTCGCAGGCCACGGTATAG

XM_004840777.1 Coding sequence

Slc23a2 solute carrier family 23 (nucleobase transporters), member 2, transcript variant X2

Length: 1953 bp    Location: 6049770..5917621   Strand: -
>XM_004840777.1
ATGATGGGTATTGGCAAGAACACTACATCCAAATCAGTGGAGGCTGGGAGTTCCACAGAGGGCAAATACGAAGATGAAGCAAAGCACCCCACCTTCTTCACTCTTCCGGTGGTCATCAATGGAGGGGCCACATCCAGCGGGGAGCAGGACAATGAAGATACAGAGCTCATGGCAATCTACACTACAGAAAATGGCATCCCCGAGAAGAGCTCTCTCGCGGAAACCCTGGACAGCACCGGCAGTCTGGACCCCCAGCGGTCGGACATGATCTACACCATAGAAGACGTTCCCCCCTGGTACCTGTGCATATTTCTGGGGCTGCAGCACTATCTGACCTGCTTCAGCGGCACCATCGCAGTGCCCTTTCTGCTGGCCGATGCCATGTGTGTGGGGTATGACCAGTGGGCCACCAGCCAGCTCATCGGGACCATTTTCTTCTGTGTGGGAATTACAACTTTGCTGCAGACCACGTTTGGATGCAGGTTACCCCTGTTTCAGGCCAGTGCTTTTGCATTTTTGGCCCCTGCTCGAGCCATCCTGTCTTTAGATAAATGGAAATGTAACACCACAGATGTTTCAGTTGCCAATGGAACAGCAGAGCTGTTGCAGACAGAACGCATCTGGTATCCGCGGATCAAAGAGATCCAGGGTGCCATCATCATGTCCTCATTGATAGAAGTGGTCATTGGGCTCCTTGGCCTGCCTGGGGCTCTGCTGCGATACATTGGGCCACTGACCATCACACCCACAGTGGCCCTCATCGGACTCTCTGGTTTCCAGGCAGCTGGAGAGAGGGCTGGAAAGCACTGGGGCATCGCCATGCTGACAATTTTCCTAGTGTTACTGTTTTCTCAATATGCCAGAAATGTTAAATTTCCTCTCCCGATTTACAAATCTAAGAAGGGATGGACTGCGTACAAGTTACAGCTTTTCAAAATGTTCCCTATAATCCTGGCCATCCTTGTGTCCTGGCTGCTCTGCTTCATCTTCACAGTGACTGATGTCTTCCCTCCTGACAGCACCAAGTATGGCTTCTATGCGCGCACAGATGCCAGGCAGGGTGTGCTGCTGGTTGCCCCCTGGTTTAAGGTTCCATACCCATTTCAGTGGGGGCTGCCCACCGTCTCTGCAGCCGGCGTCATCGGCATGCTCAGTGCCGTTGTGGCCAGCATCATTGAGTCCATCGGTGACTACTACGCCTGTGCCAGGCTCTCCTGTGCCCCGCCACCTCCCATCCATGCAATAAACAGGGGGATCTTCGTGGAGGGTCTCTCCTGTGTTCTCGATGGCATATTTGGTACTGGGAATGGCTCTACTTCATCCAGTCCCAACATTGGAGTTTTGGGAATTACAAAGGTGGGCAGCCGCCGGGTGATCCAGTACGGTGCCGCCCTCATGCTTGGCCTGGGCATGATTGGCAAGTTTAGTGCCCTCTTCGCGTCCCTGCCGGACCCGGTGCTTGGAGCCCTCTTCTGCACTCTCTTCGGAATGATCACTGCTGTTGGCCTGTCCAACCTGCAATTCATTGACTTGAATTCCTCCCGGAACCTTTTTGTGCTTGGATTTTCCATCTTCTTTGGGCTCGTCCTTCCAAGTTACCTCAGACAGAACCCTCTGGTCACAGGCATAACAGGAATTGATCAAGTCTTAAATGTTCTTCTCACAACTGCTATGTTTGTAGGAGGCTGTGTGGCTTTTATTTTGGACAACACCATCCCAGGTACCCCAGAGGAAAGAGGAATCAGGAAATGGAAGAAGGGCGTGAGCAAAGGGAACAAGTCGCTTGATGGCATGGAATCCTACAACTTGCCATTCGGCATGAACATTATCAAAAAATACAGATGCTTCAGCTACCTGCCCATCAGCCCAACCTTTGTAGGCTACACATGGAAAGGCTTTGGGAAGAGCAAAAACAGTCGGAATTCAGATGAAGACTCGCAGGCCACGGTATAG

XM_004840776.1 Coding sequence

Slc23a2 solute carrier family 23 (nucleobase transporters), member 2, transcript variant X1

Length: 1953 bp    Location: 6010759..5917621   Strand: -
>XM_004840776.1
ATGATGGGTATTGGCAAGAACACTACATCCAAATCAGTGGAGGCTGGGAGTTCCACAGAGGGCAAATACGAAGATGAAGCAAAGCACCCCACCTTCTTCACTCTTCCGGTGGTCATCAATGGAGGGGCCACATCCAGCGGGGAGCAGGACAATGAAGATACAGAGCTCATGGCAATCTACACTACAGAAAATGGCATCCCCGAGAAGAGCTCTCTCGCGGAAACCCTGGACAGCACCGGCAGTCTGGACCCCCAGCGGTCGGACATGATCTACACCATAGAAGACGTTCCCCCCTGGTACCTGTGCATATTTCTGGGGCTGCAGCACTATCTGACCTGCTTCAGCGGCACCATCGCAGTGCCCTTTCTGCTGGCCGATGCCATGTGTGTGGGGTATGACCAGTGGGCCACCAGCCAGCTCATCGGGACCATTTTCTTCTGTGTGGGAATTACAACTTTGCTGCAGACCACGTTTGGATGCAGGTTACCCCTGTTTCAGGCCAGTGCTTTTGCATTTTTGGCCCCTGCTCGAGCCATCCTGTCTTTAGATAAATGGAAATGTAACACCACAGATGTTTCAGTTGCCAATGGAACAGCAGAGCTGTTGCAGACAGAACGCATCTGGTATCCGCGGATCAAAGAGATCCAGGGTGCCATCATCATGTCCTCATTGATAGAAGTGGTCATTGGGCTCCTTGGCCTGCCTGGGGCTCTGCTGCGATACATTGGGCCACTGACCATCACACCCACAGTGGCCCTCATCGGACTCTCTGGTTTCCAGGCAGCTGGAGAGAGGGCTGGAAAGCACTGGGGCATCGCCATGCTGACAATTTTCCTAGTGTTACTGTTTTCTCAATATGCCAGAAATGTTAAATTTCCTCTCCCGATTTACAAATCTAAGAAGGGATGGACTGCGTACAAGTTACAGCTTTTCAAAATGTTCCCTATAATCCTGGCCATCCTTGTGTCCTGGCTGCTCTGCTTCATCTTCACAGTGACTGATGTCTTCCCTCCTGACAGCACCAAGTATGGCTTCTATGCGCGCACAGATGCCAGGCAGGGTGTGCTGCTGGTTGCCCCCTGGTTTAAGGTTCCATACCCATTTCAGTGGGGGCTGCCCACCGTCTCTGCAGCCGGCGTCATCGGCATGCTCAGTGCCGTTGTGGCCAGCATCATTGAGTCCATCGGTGACTACTACGCCTGTGCCAGGCTCTCCTGTGCCCCGCCACCTCCCATCCATGCAATAAACAGGGGGATCTTCGTGGAGGGTCTCTCCTGTGTTCTCGATGGCATATTTGGTACTGGGAATGGCTCTACTTCATCCAGTCCCAACATTGGAGTTTTGGGAATTACAAAGGTGGGCAGCCGCCGGGTGATCCAGTACGGTGCCGCCCTCATGCTTGGCCTGGGCATGATTGGCAAGTTTAGTGCCCTCTTCGCGTCCCTGCCGGACCCGGTGCTTGGAGCCCTCTTCTGCACTCTCTTCGGAATGATCACTGCTGTTGGCCTGTCCAACCTGCAATTCATTGACTTGAATTCCTCCCGGAACCTTTTTGTGCTTGGATTTTCCATCTTCTTTGGGCTCGTCCTTCCAAGTTACCTCAGACAGAACCCTCTGGTCACAGGCATAACAGGAATTGATCAAGTCTTAAATGTTCTTCTCACAACTGCTATGTTTGTAGGAGGCTGTGTGGCTTTTATTTTGGACAACACCATCCCAGGTACCCCAGAGGAAAGAGGAATCAGGAAATGGAAGAAGGGCGTGAGCAAAGGGAACAAGTCGCTTGATGGCATGGAATCCTACAACTTGCCATTCGGCATGAACATTATCAAAAAATACAGATGCTTCAGCTACCTGCCCATCAGCCCAACCTTTGTAGGCTACACATGGAAAGGCTTTGGGAAGAGCAAAAACAGTCGGAATTCAGATGAAGACTCGCAGGCCACGGTATAG

XM_004840800.1 Coding sequence

Lrrn4 leucine rich repeat neuronal 4

High confidence: 4 potential gene matches
Length: 1956 bp    Location: 6865846..6856702   Strand: -
>XM_004840800.1
ATGCGGTGGACTCTGTTGCTGCTGCTCTTGACCGTGCAGAGGCAGAGTGAGGCAGGGCCTCACCAGGAGAAGGCCTCGGGCTTCGGACTCGCTCCTCAAAGGTCCCCGGGGAGCGGCGGCAGCACTGCCACCACATCGCCCTGCGAGGGGCTCCCCGCCGCAGGGGCCACGGCCTGGACCTTGGCGAACCGCAACCTGGAGAGGCTGCCCCGCTGCCTGCCGCGCACGCTGCAGAGCCTCGACTGCAGCCACAACCAGCTGCACGCCCTGAGCGTGGGCGAGCTCAGCCACCTGCCCGAGCTGCAGGAGCTCACGCTGCACCACAACAGCATCGCCACGCTGCGCTGGGGCCTCAGAGCGCCGCCCGGGCTGCGCGTCCTGGATCTCAGCTACAACAGGCTGAACAAGCTGCCCCAGTGCCTCATTCCCCCGCGGCACACCCCGAGTGTGTTGGAGCTCGCGGGGAATCCGCTTCGGGAGCTGCCAGCCCGGGCCTTCGTCTGCTTCCCCGCGCTGCAGCAGCTTAACCTCTCCTCCACCGAGCTGGGCGGCGGCGCCCAGGGAGGCATCGCCCGGGCGGCGTTCGCTGGAGCTGCTGGTGAACCCCTGGCCACGCTCAAGGTTCTGGATCTCAGCGGCACGCACCTCCAGCAAATTGAGTCTGGGTGGATCAGAAACCTGCCAAATCTCACACATCTCTACCTGAGGAAGATGCCAAGGCTAAGGACCCTGGAGGGAGACATTTTCAAAATGACCCCCAACCTCCAGCAGCTGGATTGCCACGACTCCCCTGACCTGACTTCCGTCCACACACACATCTTCCGGGATACCCCTTCTCTACAGACCCTTCTTTTCCACAACTGCAACTTGAGTTCCTTCCCTCCTTGGACCATGAATTCCTCCCAGGTGCCATCTGTTACCCTCTTTGGCAACCCTCTCACTTGCAGCTGTGAGTTATCCTGGCTCTTCATGGATGCAGAGAGAACTGTCCTAAGCAGGGCGGCAGACACGATGTGCTCACCAGCTGCAGGATCCAGGGGCCCCTTCTCAGCGCCTCTTCCCCTCTCCCAGCTGCCAGGTGTGTGCAGGTCAGACCTTCTGGCTTCAAACCAGCCTGTGGGAGGCCAGCCAAGTGTCACCAAAGGCTCATCCCACTTGACTCCTTCAGACAACGGGATTCCCGTCATCCTGTTGGATGATGACAGCCAGGAGGAGAGGGACAGGGAGGAGGTGGATGTCCCCACTCAGCCTGGCCGCTGCGATTACAACCTGTGCAGGCACCTGCAGACCCCATGCCTGGAGCTGCAAAAGCACTCACATTGCACCTGCCCGGGGCTCAGCAGGGAGGACACTGTCCCCGACCCGCCCCAGCTACAGAGGGTGTCGGAGTTGACTGACACGTCAGTGCTCATCCGCTGGTGCGCCCCTTACTCGGTGGTGCGCACCTACCAGATCCACTACTTCACGGAGGGTGATGCAAGGAACCAGTCAGTGGGAGACATCTATGCCACTGCTCGACAGCACCCTCTGTACGGGCTGTCACCCAGTACTACCTACCAGGTGTGCGTGGTGGCAGCCAATGCTGCGGGCCTGAGCCAGCTGGAGCCGATGGGTTGGAGGAGGCCGTGCACCACTGTCACCACTAAGCCCAGCTCAGTGGTCATCCTCATGGCGCTGGGGACTGCCTGCAGCCTGCTGCTCCTCAGCACCCTGGTGCTGTCTGTGTGCCTCTTCAGGCAAGGCCAGAAGCTGTGCCGGCACAACCACAACACCTACCTGGTGTCCTTCAAAAACCCATACCTGATGCCCCTCGAAAACCCTGGCCAGGACTGCAGGCAGAGTGCAGTGATGGGAGTCTTGCCTGGTGTGTGTGAGGCCCCAGGTTCCATCCCCAGCACCACACAGAGAGGAGAGGAACCAGCCTTTGACCCTGTGAAGCTGCAGACCTTCTATTAG

XM_004840890.1 Coding sequence

Rin2 Ras and Rab interactor 2, transcript variant X2

Length: 2586 bp    Location: 20338322..20536464   Strand: +
>XM_004840890.1
ATGGTTCACACCGATACCAGCCTGGAGAACGGCCTGGGAACTCCCAAAACCCACAGCATGGTCAGACAGCAGGAGGACCCCTGCCCTGAGGACAAGGAAGCAAAGGGCAGCCCGAGGGACTCTGGCTACGACAGCCTGTCTGGAAGGCTCAGCATCCTGGACCGGCTCCTGCACACACACCCTGTCTGGCTGCAGCTGGGCCTGAGCGAGGAGGAGGCAGCCGAGGTCCTGCAGGCGCAGCCACCTGGGATCTTCCTGGTGCGCAAGTCCACCAAGATGCAGAAGAAAGTGCTATCCCTGCGCCTGCCCTGCGAGTTCGGAGCCCCACTTAGGGAGTTTGCCATCAGGGAGAGTGCCTACACCTTTTCCCTGGAAGGCTCAGGAATCAGCTTTGCAGATTTATTCCGGCTCATTGCCTTCTACTGCATCAGCAGGGATGTCCTGCCATTCACCTTGAAGTTGCCTTATGCCATTTCAACAGCCAAGACTGAGGCTCAGCTTGAAGAACTGGCCCAGCTGGGACTAAATTTTTGGAGCTCCTCCGCTGACAGCAACCCCCCCAACCCTCCACCTCCCCATAGGCCTCTCCACTCAGACGGCCTCTGTCCCGCCTCCTGGCGCCAGCTCTGCCTCATCAACGGGGTGCATGCCATCAAGCCCAGGACGCCTTCGGAGCTGGAGTGCAGCCAGACCAACGGAGCCCTGTGCTTCATTAACCCGCTCTTTCTGCAAGTGCACAGCCAGGACCTCAGGGCCTGCCCAAAGCGGCCAAGTTCAAGGACTCCCCCGGCGAATGGCTCCGAGTGGCCTCGGTCCCCACCACCCAGGCCTCCGCCACCCACCATTCAGAGTCTGCACACCAGCCCTCGGCTGTCCAGGAGTGACACCCGGCCGGGCATGCCACAGACAGTCAGCCAGGACACGCAAGAGAACGTAGCCACGCTGGGAAGGAAACCAACCCCCATCCCTCCACCCCGGCTGAAGAAGCAGGCTTCTTTCCTAGAGGCGGAGAGCAGCACCAAGACCTTGACGGCCCGGCTGCCTGGCCGGGGCTTGGAGCTGGAGCTGGAGCCGGGCACAGCTGGCAGCACAGGTGGGGCCCCGCCCACGGGGGATTGCACAAGGGCCCAGCCTCCTCCCGCCTCTGCAGCCCGGCCCCCACGCCATGGGGGCAGGCAGAGACTGAGCGACATGAGCATTTCCACTTCCTCCTCTGACTCGCTGGAGTTTGAGCGGAGCATGCCGCTGGATGGCTACGAGGGGGACACAAACAGCAGCCTGGAGGACTACGAGGGCGAGAGTGACCAGGAGACCATGGCACCCCCCATCAAGTCCAAGAAGAACAGGCACAGCTCCTTCGTGCTACCCAAGCTGGTCAAGTTGCAGCTTCGAAAGATGAGCGGGGTGCTCAGCTCCTTCATGACACCTGAGAAGCGCATGGTGCGCCGGATCGCAGAGCTGTCACGGGACAAGTGCACCTACTTTGGCTGCCTGGTGCAGGACTACGTGAGCTTCCTGCTGGAGAACCGTGAGTGCCACGTGTCCAGCACGGACATGCTGCAGACCATCCGGCAGTTCATGACCCAGGTCAAGAACTACCTGGCCCAGAGCTCTGAGCTGGACCCCCCCATCGAGTCGCTGATCCCCGAGGACCAAATCGACGTGGTGCTGGAGAAGGCCATGCACAAGTGCATCCTGAAGCCCCTTAAGGGACACGTGGAAGGCATGCTGAGGGACTTCCACATGGCTGATGGCTCCTGGAAACAGCTGAAGGAGAACCTGCAGCTTGTGCGGCAACGGAACCCTCAGGAGCTGGGGGTCTTCGCCCCGACGCCTGACTTGGTGGATGTGGAGAAGATCAAGGTCAAGTTCATGATGATGCAGAAGATGTATTCACCAGAGAAGAAGGTGATGCTTCTGCTGCGGGTGTGCAAGCTCATCTACACAGTCATGGAGAACAACTCAGGGAGGATGTATGGTGCTGACGACTTCCTGCCGGTCCTGACCTATGTCATAGCTCAGTGTGACATGCTGGAACTGGACATTGAGATCGAGTACATGATGGAGCTCCTGGACCCATCACTGCTGCATGGAGAAGGAGGCTACTACCTGACCAGTGCCTACGGAGCCCTGTCCCTGATAAAGAACTTCCAGGAAGAGCAGGCGGCACGGTTGCTCAGCTCGGAAACAAGGGACACACTGAGGCAGTGGCACAAGCGGAGGACTGCCAACCGGACCATCCCTTCTGTGGATGACTTCCAGAATTACCTCCGGGTAGCGTTCCAGGAGGTGGGCAGCGGCTGCACGGGCAAGACACTACTCGTGAGGCCCTACATCACCACCGAGGATGTTTGCCAGCTTTGTGCTGAGAAGTTTAAGGTGGATGACCCCGAGGAGTACAGCCTCTTCCTCTTCGTGGATGAAACATGGCAGCAGCTGGCAGAGGACACTTATCCTCAAAAAATCAAGGCCGAGTTGCATAGCCGGCCACAACCCCACGTCTTCCACTTCGTCTACAAGCGCATCAAGAGCGATCCTTATGGTGTCATTTTTCAGAACGGTGATGAAGACCTCAGCCCTTCATAG

XM_004840804.1 Coding sequence

Fermt1 fermitin family member 1, transcript variant X4

Length: 1773 bp    Location: 6914224..6885662   Strand: -
>XM_004840804.1
ATGCTCTCCTCCAGTGACTTCACACCTGCATCCTGGGAGCTCGTGGTCCGAGTTGACCACCCAAACTCAGAGGAGCAGCGGGACATCACGCTAAGGGTGTCTGGGGACCTGCATGTGGGAGGCGTGATGCTCAAGCTGGTGGAGGAGATCAACATTGCCCAAGACTGGTCAGATTTCGCTCTGTGGTGGGAGCAGAAGCATTGCTGGCTTCTGAAAACCCACTGGACCCTGGACAAATGTGGGGTGCAGGCCGATGCCAGGCTTCTCTTCACCCCTCAGCACAAGATGCTGCGCCTCCGCCTGCCCAACCTGAAGACGGTGCGGATGCGCATCAGCTTCTCAGCCGTGGTGTTCAGAGCCATCAGCGACATCTGCAGAGCCCTGAATATTAGAAGATCAGAAGAACTTTCCTTGTTAAAGCCTTCTGGTGACTATATTAAGAAGAAAAAGAAGAAAGACAAAAACAATAAGGAGCCTGTGATTGAAGATATTCTGAACCTGGAGAGTTCTCCAACAAGTTCGGGTTCACCAGGAAGTGCTGGCTTATACAGCAAGACCATGACTCCCACCTATGACCCCATCAACGGGATGCCCGTGTCGTCCACCGTGACGTGGTTTGGTGACAGTCCCTTGGCAGGACAAAGCTGCAGCATCCTCGCCTTCAGCCAGCCCCCCCAGTCCCCAGAAGCACTGGCTGATATGTTCCAGCCCCGGTCCCTGGTGGAAAAAGCCAAGCTTAACACAGGTTGGCTGGACTCCTCGCGCTCCCTCATGGAACAAGGCATCCAGGAGGATGAGCAGCTGCTGTTACGATTTAAATACTACAGTTTCTTTGACTTGAATCCTAAATATGATGCTGTCAGAATAAACCAGCTCTACGAACAAGCCAGGTGGGCTATTCTCTTAGAAGAAATCGACTGCACGGAGGAAGAAATGCTGATCTTTGCGGCACTCCAGTATCACATCAGCAAGCTGTCACTGTCCACTGAATCTCAGGATTTTACAAACGAGTCTGAGGTTGACGAAGTTGAAGCTGCACTTTCTAACTTAGAAGTGACCCTCGAAGGTAGAAAATCAAACAGCACTCTGGAGGACATTACTGATATCCCTAAACTTACAGATAATCTCAAATTATTTAGGCCCAAGAAGCTAGTATTAAAAGGTTTCAAACAATATTGGTTCGTCTTTAAAGACACATCTATAGCCTACTTTAAAAATAAGGATCTTGAACAAGGGGAACCGGTAGAAAAACTAAACCTCAGAGGCTGTGAAGTTGTACCAGATGTGAATGTAGCAGGGAGAAAATTTGGAATCAAGTTACTAATCCCTATTGCTGATGGTATGAACGAAGTGTATTTGAGATGTGACCATGAGAACCAGTATGCCCGGTGGATGGCTGCCTGCATCTTGGCATCAAAGGGCAAAACCATGGCAGACAGCTCCTACCAGCCTGAGGTCCTCAACATCCTTTCATTTCTGAGGATGAAAAACCGGAACTCGTCATCTGAGGTGGCTTCCAGTCTTGAAAGCATGGACATGAACCCAGAGTGTTTCGTGTCTCCTCGGTGTGCAAAAAAGCACAAGTCTAAACAGCTGGCAGCCCGGGTCCTGGAAGCCCACCAGAACGTTGCCCAGATGTCCCTTATCGAAGCCAAGCTGCGGTTCATTCAGGCCTGGCAATCCCTACCAGAGTTTGGCCTCACCTACTACCTTGTCAGTGCTGGAGATGGAACCCAGGACCTTGCACACCCTAGGCAGGTGCTCTGCCACTGA

XM_004840825.1 Coding sequence

Btbd3 BTB (POZ) domain containing 3, transcript variant X1

High confidence: 4 potential gene matches
Length: 1581 bp    Location: 12870977..12879831   Strand: +
>XM_004840825.1
ATGGTAGATGACAAGGAAAAGAACATGAAATGTCTCACCTTCTTCTTGATGCTTCCAGAGACTGTAAAGAATAGGTCCAAGAAAAGCTCGAAGAAAACAAATACTAGCAGCAGTAGTAGCAGCAGCAGCAGCAGCAGCAAGTTGCCTCCAGTTTGTTATGAAATAATTACCTTGAAGACTAAGAAGAAGAAGAAGATGGCTGCTGATATATTTCCCCGCAAAAAACCAGCCAACTCCAGCAGCACCACTGTCCAGCAGTACCACCAGCAGAATCTCAGTAACAACAACCTTATCCCAGCCCCCAATTGGCAAGGTCTCTATCCCACCATCAGAGAAAGAAATGCGGTGATGTTCAATAATGATTTGATGGCAGATGTACATTTTGTGGTTGGGCCACCAGGTGGGACTCAGCGGTTGCCAGGACACAAATATGTCTTAGCTGTTGGGAGCTCTGTCTTCCATGCGATGTTTTATGGAGAACTTGCTGAGGACAAAGATGAAATCCGTATACCAGATGTTGAACCTGCTGCTTTTCTCGCTATGCTAAAATATATCTATTGTGATGAAATTGACTTGGCTGCAGACACAGTGCTGGCCACACTGTATGCTGCCAAAAAGTACATTGTCCCTCACCTTGCCCGAGCCTGTGTGAATTTCCTGGAGACCAGCCTGAGTGCCAAGAACGCCTGTGTGCTGCTCTCCCAGAGCTGCCTATTCGAAGAGCCAGACCTGACCCAGCGCTGCTGGGAGGTGATCGATGCCCAGGCTGAGTTAGCTCTCAAGTCTGAGGGGTTCTGTGATATCGACTTCCAGACGCTAGAAAGCATCCTCCGCAGGGAAACTCTGAATGCCAAAGAAATTGTCGTTTTTGAGGCAGCTCTCAACTGGGCTGAAGTAGAATGCCAGCGACAAGATCTAGCCTTGAGCATTGAAAATAAACGCAAAGTCCTAGGAAAGGCACTTTACTTAATCCGCATACCCACAATGGCCCTTGATGACTTTGCAAATGGTGCTGCCCAGTCCGGAGTATTAACTCTCAATGAGACCAATGACATCTTCCTCTGGTACACTGCGGCCAAAAAGCCTGAGTTGCAGTTTGTGAGTAAAGCCCGCAAGGGTCTCGTCCCCCAGCGCTGTCACCGTTTCCAATCTTGTGCCTATCGGAGCAACCAGTGGCGCTATCGGGGCCGCTGTGACAGCATCCAATTTGCAGTTGACAAGAGAGTATTCATTGCAGGCTTTGGGCTGTATGGCTCCAGCTGTGGCTCTGCAGAGTACAGTGCCAAGATCGAACTCAAGCGTCAGGGCGTTGTCTTGGGGCAGAACTTGAGCAAGTATTTCTCAGATGGGTCCAGCAATACCTTCCCTGTGTGGTTTGAGTACCCAGTGCAGATCGAGCCAGACACCTTTTACACAGCCAGTGTGATCCTGGATGGCAATGAACTCAGCTACTTCGGACAAGAAGGCATGACGGAAGTTCAGTGTGGCAAAGTGACTGTCCAGTTTCAGTGCTCCTCAGATAGCACAAATGGCACTGGTGTACAGGGAGGGCAGATCCCTGAACTTATATTCTATGCTTGA

XR_205063.1 Non-coding sequence

LOC101697793 PREDICTED: Heterocephalus glaber uncharacterized LOC101697793 (LOC101697793), misc_RNA.

Length: 418 bp     
>XR_205063.1
CCCCTAACCCCCACCCAGCCGTAGTAGTTCCCCAGCCTGCGCCGGGGAGAGCAGGAACATGGCGCTCGGAGCGATGTAACAGGCGAGGAGAAGGGATGAGGCTCCGCCGCCTCACTGACACCCAGCTACCAGAAATACACTGTGGTGAATTCTGCCTCTTGCCAAAATGAACACTGAGGAAAAATGAAGAAAACTGAAGAACTCCAATGAAAAATTACGAACAGAAATAGCAACCCTCCTCTGGAGTCTTTAATTTATCCACAGCCATTGTAAAAAAGGTGATGTCATATGCCTTTGTAGGGAAGTGAGTATGTGAGACAGGAAAAAGAAGGAAGACAGAAAAGAACCCTTGACACCTAGATATGGAATTACCAATGGAATTACCAATATTGAACCAAGAAGACATAAAAATTCTAAA

XM_004840808.1 Coding sequence

Tmx4 thioredoxin-related transmembrane protein 4

High confidence: 4 potential gene matches
Length: 1050 bp    Location: 8908377..8862752   Strand: -
>XM_004840808.1
ATGGCGGGCGGGCGCTGCGGCCCGCTGTGGACTGCGCTCCTGATCGCCTGGGTCGCGGCGTTGGCCGTTGCCGAGGGCCCTGAGCAGGCCCTGGTGCCGGCGGAGCCGAGCCGGGTACAGCCCATGACCGCTTCCAACTGGACGTTGGTGATGGAGGGCGAGTGGATGCTGAAATTTTATGCCCCGTGGTGTCCATCGTGCCAGCAGACTGATTCTGAATGGGAGACCTTTGCAAAGAATGGTGAAACTCTTCAGATCAGTGTGGGGAAGGTGGATGTCATTCAGGAACCAGGTTTGAGTGGCCGTTTCTTTGTCACCACTCTCCCAGCCTTTTTTCATGCAAAAGATGGGATATTTCGCCGTTACCGAGGCCCAGGAATCTTTGAAGATCTACAGAATTACATCTTAGAGAAGAAATGGCAGTCAGTTGAGCCTCTGACTGGCTGGAAGTCCCCAGCTTCACTAACGATGTCTGGAATGGCTGGTCTTTTTAGCATCTCTGGCAAGATTTGGCATCTTCACAATTATTTCACAGTGACCCTTGGAATTCCTGCTTGGTGTTCTTATGTCTTTTTCATCGTTGCCACTTTGGTTTTTGGCCTTTTCATGGGTCTGGTCTTGGTGGTAATATCAGAATGCTTCTATGTACCACTTCCAAGGAATTTATCTGAACATTCTGAGCAAAATCAGAGATCAGAGGAGGCTCAGGGAGCTGAACATTTACAGGATGCAGAAGAGGAAAAAGATGATTCCAATGAAGAAGAAAATAAGGACAGCCTTTTAGATGATGAAGAGGAGAAAGAAGACCTTGGTGATGAGGATGAAGCAGAGGAGGAAGAGGAGATGGACAATGTGGCTGGTGGTGTGGATGAGGAGAGGAGTGATCCCAACAACCAGGGGCTTCTGACAGAGGCCAGTGTGGCCCAGGAGGAAGTTGAATCTGAGGAGACTAAAGGAGACACCACTGGAAAACCCTCCTCAGCTGACACAGAGGTAGCAGAAGACTCACTGAGACAGCGCAAGAGTCAGCATGCCAATAAGGGACTGTAG

XM_004840820.1 Coding sequence

Mkks McKusick-Kaufman syndrome, transcript variant X2

High confidence: 4 potential gene matches
Length: 1728 bp    Location: 11447638..11425185   Strand: -
>XM_004840820.1
ATGTTGTCTCGATTAGAAGCTAAGAAGCCATCACTGTGTTACAGTGAACCACTCACAACTGAGAAAGTCAGGGCCACACTTTCTGTCTTGAAAGGCATCCTAACATCCTGCTATGGCCCTTCCGGGCGGCTGAAACAGCTGCACAACGGCATGGGGGGCGCTGTGTGCACAACCTCCCAGTCTGCAGTGCTGCTCCGCAACCTCTCAGTCACCCATCCCATATTAAAGATCCTGACAACATCCGTGCAGAACCATGTGTCCTGCTTCAGTGACTGTGGGTTATTCACAGCCATTCTTTGCTGCAACCTAATTGAAAATGTTCAGAAAACAGATTTGACAGTCACCACCACCATTAAACTTAATACACACCTTTTGAATTTCTGTACCAATTATCTCAGGTCTGAGGTCTGTGGTTGCCGAATCCCAGTCGATTTTAGTAATACCCCGATCCTCCTTTGTTTGGTGCGCAGTATTTTAACAAGTAAACCTGCCTGTATGCTCACCAGGAAGGAAATAGATCATATCAGTGTTTTGATTCTTAGAGCTTTTTTGCTTACAATTCCAGAAAACACAGAAGATCCCATCATTTTAGGAAAGAGTATAATTGTACCTTTAAAGGGTCAAAGAGTTACAGATTCTACTGTGTTACCCGGAGTACTCATTGAAGTGTCAGAAGTTCAATTAATGAAGATATTACTTGTCCGAAAATCAAGTCCCCTCAAGGTGGTGCTCTTTTCTACATCTTTATCCGGAGACTTTTCTGACCCTGGAGAAGGAAATGTGGTGGTCAGTGATGGGGTGTTTCTTGAAAATGCAGTCCTGGACCAGTTGATTAACCTAGGAAGGCAGTTAGTTAGTGACCGTGTGGAACTTGTCCTATGCCAAAAAGTTATACACCCGTCTTTGAAACAGTTCCTTACTACGCATCAAGTTATTGCCATAGACAGAGTGGGAGTGATGCTGATGGAGCCCCTAAGCAAAGTGACAGGAGCACAGCCTATTGGTTCCCTAGGCTCAATATCTCCTGGTAGTTATGGAAGCGTGAAAGACTGGTGCTCTGCTAAATTTGGCTGCAAACATTTTTTTCATCTTATTCCTAATGAAGCGACTGTCAGCAGCTTGCTTCTCTGCAACAGAAGTGACACTGCCTGGGATGAGCTGAAGCTCACATGTCAAACAGCACTGCATGTCTTGCAATTAATAATCAAGGAGCCATGGGTTTTGTTGGGAGGTGGCTGCACTGAAACTCATTTGGCTGCATATATCAGACACAAGACTTATGAGGAGCCAGGAAGTATTCTCCAAGATGATGGATGTACTCAAGCAGAACTTCAACTAATTGCTGAAGCTTTTTGCAGTGCTCTAGAGTCTCTCGCTGGCTCTTTGGAACATGATGGAGGTGAAATTCTGATTGACATGAAGTATGGACACTTTTGGTCAATTCAGGCAGGTCCTTCCTCTGTTGTTAACTGGACAGATTTGCTTTCTAGATGTGGCTGTGGAGTATACAGTAGCCAGGAAGAACTTGGCTGGTCTTTCTTAAGAAGCACGTGTCATCCTTTTGTACCCCAGACCTGCCTTCCACATGAATCTTGGGAAGTCAGCCCACAATCAGCCCACAGCCTGACCCTGGACTGTTTGACTGCTAAGCTCAGTGGCCTACAGGTGGCTGTAGAGACAGCAAATTTGATATTAGATCTTGCCTATGTCATTGAAGATAAAAGCTGA

XM_004840829.1 Coding sequence

Ism1 isthmin 1, angiogenesis inhibitor, transcript variant X1

Length: 1437 bp    Location: 14186973..14262530   Strand: +
>XM_004840829.1
ATGGTGCGTCTGGCTGCCGAGCTGCTGCTGATCTTGGGGTTACTGCTGCTCACACTGCACATCACCGTTCTGCGCGGTTCCGGAGCCACCGACGGGCCAGACGCGGCCACCGGCAACGCCAGCCTGGCCCAGTTGCAGGCACAATCCAACTCAAGTTATCTTGACCATCCTGCTGGAAAGAATAACCTTAACCTGGAAGGTGACTCCACATCAGAAACCAGCTTTCCTCTCTCCAAAGAAGTACCAGGGGAGCCTCTGAACCACCACGCTACACATCAGCCCTTTTCCAGGCAGCAATTCCCAGAAGAAACTGGCCACCCCTCCTTGCAAAGAGATGGCCCCAGGTCCTTTCTCCTGGACTTGCCAAACTTTCCAGATCTTTCTAAAGCTGATATCAATGGGCAGAATCCAAATATCCAGGTCACCATAGAGGTGGTCGACGGTCCAGACTCTGAAGGAGATAAAGATCAGCATCCGGAGAATAAGCCCAGCTGGTCAGTCCCATCCCCTGACTGGCAGGCCTGGTGGCAGAGGTCCTTGTCCTTGGTGAGGGCCAACAGCGGGGACCAGGACTACAAGTACGACAGTACCTCAGATGACAGCAACTTCCTCAACCCCCCCAGGGGGTGGGATCGTCCGGCCCCAGGCCACCAGACTTTTGAAACCAAAGAGCAGCCAGAATATGATTCCACAGATGGAGAAGGTGACTGGAGTCTCTGGTCTGCCTGCAGCATCACCTGTGGGAATGGTAACCAGAAACGGACCCGGTCTTGTGGCTACGCGTGCACTGCAACCGAATCTAGGACCTGTGACCGTCCAAACTGCCCAGGCATTGAGGACACCTTCAGAACAGCGGCCACTGAAGTGAGTCTGCTTGCGGGAAGTGAGGAGTTTAATGCCACCAAGCTGTTTGAAGTTGATACAGACAGCTGTGAGCGATGGATGAGCTGCAGAAGCGAATTCCTAAAGAAGTATATGCACAAGGTGATCAATGACCTGCCCAGCTGTCCCTGCTCTTACCCCACCGAAGTGGCCTACAGCACAGCGGACATCTTTGACCACATAAAGCGCAAGGACTTCCGCTGGAAGGATGCCAGCGGGCCCAAAGAGAAGCTGGAGATCTACAAACCCACAGCCCGATACTGCATCCGGTCCATGCTGTCGCTAGAGAGCACCACGCTGGCTGCCCAGCATTGTTGCTATGGTGACAACATGCAGCTTATCACCCGGGGCAAAGGGGCGGGGACACCCAATCTCATCAGCACGGAGTTCTCTGCTGAACTGCACTACAAGGTGGATGTGCTGCCCTGGATCATCTGCAAGGGCGACTGGAGCAGATACAACGAGGCTCGGCCACCCAACAATGGGCAGAAGTGCACTGAGAGCCCCTCAGACGAGGACTACATCAAGCAGTTCCAGGAGGCCAGGGAGTACTGA

XM_004840834.1 Coding sequence

Esf1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae), transcript variant X3

Length: 2328 bp    Location: 14778017..14708812   Strand: -
>XM_004840834.1
ATGTCATCCAAACAAGAAATAATGAATGACCAGCGGTTTAGGAAGGTTTCAAAGGACCCCAGATTCTGGGAAATGCCAGAAAAGGATCGAAAAGTCAAAATTGACAAGAGATTTCGAGCCATGTTTCATGACAAAAAGTTCAAATTGAACTATGCAGTTGATAAAAGAGGACGCCCTATCAACCACAGCACTACTGAGGACTTGAAACGTTTCTATGAGCTTTCAGATTCTGATTCTGATCTCTCTGATGAAGATAGCAAACCACTGAATCAACAGAAAATAAAAAAGAAAAACCGCCAGACAAAAAAAGAAATAGATTCAAAAAATATAATTGAGGAAAAGAAAGAAACCAAGAAAATTAATCAGAAGTATCCCGGAAATGATTTAGATGATTCCGAAAGAATTCAGGAAATGAAAAGTTCTAAGAAGATAGATTCAGAAATAAGTCCAAAGAAGGACAGCAAAGAACTTACACAAGAAGTGGTTCCAGTCATAATAGGAGATAGTGATGCTAACGTGTCTGACAAAGATGTTCTGGAGGAAGATTCAGACAATGCTGATGAAAGTGATGAGGAATCTGAAGTTGAAATCACAGGTGGTGGTAGAGCTTCAGCTGATGGTGGAAGTGAAGATGAAGATAGTGAGGATGATGATGAAAGTGACAGTGGCCCTGATCTTGCAAGGGGTAAAGGAAATATAGAAACTAGTTCCGAAGATGAAGATGATTTGGCAGATTTATTTCCAGAAGAACCTGGTTTTGAGCATGCTTGGAGAGAATTAGATAAAGATGCGCCCCGGGCTAATGAGATTACACATCGACTAGCAGTTTGCAACATGGACTGGGATCGATTAAAGGCAAAAGATTTACTGGCTCTGTTCAACTCATTTAAGCCTAAAGGAGGTGTTATATTTTCCGTAAAGATATATCCTTCAGAGTTTGGAAAGGAGAGGATGAAGGAAGAGCAAGTTCAAGGACCAGTGGAGTTATTAAGCATTCCTGAAGATGCTCCTGAAAAGGACTGGACCTCTAGAGAAAAATTGAGAGATTATCAGTTCAAACGACTGAAGTACTATTATGCGGTAGTGGACTGTGATTCTCCTGAAACAGCAAGTAAAATTTATGAGGATTGTGATGGCCTCGAATTTGAAAGTAGTTGTTCTTTCATAGATCTAAGGTTTATACCAGATGATATTACTTTTGATGATGAGCCTAAGGATATAGCCTCAGAAGTGGATTTAACAGCGTATAAACCAAAATATTTCACATCTGCTGCAATGGGAACATCAACGGTGGAGATCACTTGGGATGAGACTGATCATGAAAGAATCACAACACTCAACAGGAAATTTAAAAAGGAAGAACTTTTGGACATGGATTTTCAAGCCTACTTAGCTTCCTCTAGTGAAGATGAAGAGTTGATAGAAGAGGAGCCACAAGATAATGATGAAGTCAGTGGAGAAGATGATGGGAAAGCAAAGAAAAGTCAGAAGGATGATGAAGAACAAATTGCTAAATACAGGCAGCTCTTGCAGGTTATTCAAGAAAAAGAAAAGAAAGGCAAAGAAAATGATATGGAAATGGAAATTAAGTGGGTTCCAGGCCTTAAAGAAAGTGCAGAAGAGATGGTAAAAAACAAATTGGAAGGAAAAGATAAACTGACCCCTTGGGAACAATTTTTAGAGAAGAAAAAAGAGAAAAAAAGACTAAAAAAGAAACAGAAGGCTCTTGCTGAAGAGGCTAGTGAAGATGAACTTCCCCCTGATGTCGATTTCAATGACCCATACTTTGCTGAAGAAGTTAAAAAAATAGGTTTAAAGAAAAAATCAATGAAATCTGCAAAAAATGCCACATCTCCAGAGGAAGAAATTGAAATTGAAAGACAAAAGGCTGAAATGGCTTTGCTTGTGATGGATGAGGAGGAAGACAGTAAAAAACACTTCAATTACAATAAGATTGTGGAGCACCAGAATCTAAGCAAAAAGAAGAAGAAACAGCTTATGAAAAAGAAAGAATTATTAGAAGATGACTTTGAGGTAAACGTTAGTGATGCACGATTTCAGGCAATGTATACTTCCCACTTGTTCAATTTGGATCCTTCAGATTCTAATTTCAAGAAAACAAAAGCTATGGAAAAAATCCTTCAGGAGAAAGCCCGGCAAAGAGAACGAAAAGAACAAGAAATTATTCAGGCAATAAAGAAAAAAGAAAGCGAGATTGAAAAGGTATCTCAGAAGAAGTCTATTGATCCTGCCTTGTCAGTGCTGATTAAATCTGTAAAAAACAAAACAGAACAGTTTCAAGCAAGAAAAAAACAAAGAGTCAAATAA

XM_004921065.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 1800 bp    Location: 14920363..14859841   Strand: -
>XM_004921065.1
ATGGTCAATTGCAATGTGAAAGAGCAAGTAAAGAAAAATTTCACAGATGAAAGAGATGAGCTATTTAAGATGGGCATGAAGATTCTCCAGGAGTCTAAAAGCCAAAAACAAAAAGCAGAAGCCTACATGCTTTTTGCCAAAACAACTGATATGGGAAATTTGAAAGCTATGGAGAAGATGGCTGACGCTTTGCTATTTGGAAATTTTGGCCTGCAAAACATAACAGCAGCTATCCAATTATATGAGTTCTTGGCTAAGGAAGGATCATATAAAGCCCAAAACGCATTAGGATTTTTGTCTTCTTATGGAATAGGAATGGAGTATGATCAAGCCAAGGCACTGATATATTATACCTTTGGAAGTGCTGGAGGAAGTATGATGTCCCAGATGATTTTGGGGTACAGATATTTTTCAGGAATCAACGTTCTACAGGATTGTGAAATTGCCCTAAATCACTACAAGAAAGTGGCAGATTATATTGCAGACAAATTGGAAAAAAATGAAGGCATTCCAGTGGGAAAAGTGAGACTAACTGAGAGACTTGAAAATTTGAGTTCTAACAGTGAGATCTTGGATTGGGACATATACCAATACTATAAATTTTTGGCAGAAAGAGGAGATGTTCAGATACAAGTATCTCTTGGACAGTTACATCTGATTGGGAGGAAAGGTGTAGATCAGGATTACTATAAAGCATTATACTACTTTTTAAAGGCAGCAAAAGCGGGGAGTGCAAATGCCATGGCATTTATAGGAAAGATGTATTTAGAGGGGAATGCTGCTGCACCACAAAATAATGCTACTGCCTTCAAATACTTTTCCATGGCAGCCAATAAGGGCAATGCAATTGGTCTTCATGGACTTGGACTCCTTTACTTTTATGGAAAAGGAGTTCCAGTGAATTATGCTGAAGCACTTAAGTACTTTCAGAAAGCTGCAGAGAAAGGATGGCCCAATGCACAGTTCCAGCTCGGCTTCATGTACTACTCTGGCTCTGGAGTTTGGAAAGATTATAAACTTGGCTTCAAATATTTTTACTTGGCATCTCAGAGTGGGCAGCCCCTCGCCATTTATTATCTGGCTGAGATGTATGCAACAGGCACAGGGTTATCAAGATCATGCACAGCTGCTGTGGCGCTTTATAAAGGTGTCTGTGAACTAGGCCACTGGGCTGAGAAATTCCTGACAGCTTACTTTGCCTATAAGGATGGTGATATAGATTCATCTCTTGTTCAGTATGCACTGCTTGCAGAAATGGGGTATGAAGTAGCTCAAAGCAATTCAGTGTTCATTTTGGAATCTAAAAAGGCTAAAATTCTTCAAAAAGAGAAGATGTATCCAATGGCACTACTCTTATGGAATCGAGCTGCTGTTCAAGGAAATGTATTTGCTAGAGTAAAAATTGGAGATTACTATTACTATGGCTATGGGACTAAGAAAGACTATCAAACAGCAGCCACACACTACAGCATTGCAGCCGAAAAATATCACAACGCACAAGCCATGTTCAATCTGGCCTATATGTATGAACATGGGTTAGGTATTGCAAAGGACATTCACTTGGCCAGGAGATTATATGACATGGCTGCTCAAACAAGTCCAGATGCTAATGTACCTGTATTCCTTGCCCTCATGAAACTGGAAACTATGCATTTGCTCAGAGATATCCTGTTTTTAAATTTTACAACAATATGGAAATGGATGAAATTGGAAAGCACCCTTGGTCCATACTGGGATTTATTTGTGATTGGCCTAATTATTGCCGTGCTGATCTTTCTCCTTAAAAATCGCCATAGATAG

XM_004840844.1 Coding sequence

Kif16b kinesin family member 16B, transcript variant X5

Length: 3405 bp    Location: 17750525..17552740   Strand: -
>XM_004840844.1
ATGGCATCTGTCAAGGTGGCCGTGAGAGTTCGGCCCATGAATCGCAGGGAAAAGGACTTGGAGGCCAAGTTCATTATTCAAATGGAGAAAAGCAAGACAACAATCACAAACTTAAAGCTACCAGAAGGAGGGACTGGGGATTCAGGAAGAGAACGCACCAAGACCTTCACCTATGACTTTTCTTTTTATTCTGCTGATACAAAGAGTCCAGATTATATTTCACAAGAAATGATTTTCAAAACCCTGGGCACAGATGTCATGAAATCTGCATTTGAAGGTTATAATGCTTGTGTCTTTGCATATGGGCAAACTGGATCTGGAAAGTCATACACTATGATGGGAGATTCTGGTGATTTGGGCTTAATACCTCGGATCTGTGAAGGGCTCTTCAGTCGGATAAATGAAACCACCCGATGGGATGAAGCATCCTTTCGGACTGAAGTCAGCTACTTAGAAATTTATAATGAACGTGTGAGAGACCTGCTTAGGCGGAAGTCATCTAAAACCTTCAATTTGAGAGTCCGAGAGCATCCAAAAGAAGGACCTTATGTCGAGGATTTATCCAAACATTTAGTACAGAATTATGGTGACGTGGAAGAACTGATGGATGCAGGGAATATCAACCGGACCACAGCAGCAACTGGGATGAACGATGTCAGTAGCAGGTCTCACGCCATCTTCACCATCAAGTTCACTCAGGCAAAGTTTGACTCTGAAATGCCATGTGAAACCGTGAGTAAGATCCACTTAGTCGATCTTGCCGGAAGTGAGCGTGCAGATGCCACTGGTGCCACGGGGGTCCGGCTCAAGGAAGGGGGGAACATTAACAAGTCCCTCGTGACTCTGGGAAATGTCATTTCTGCCTTAGCTGATTTATCTCAGGATGCAGCAAACCCTCTTGTAAAGAAGAAGCAAGTTTTTGTGCCTTACAGGGATTCTGTTTTGACTTGGTTGTTGAAAGATAGCCTTGGAGGAAACTCTAAAACTATCATGATTGCCACCATTTCACCTGCTGATGTCAATTATGGAGAAACCCTAAGTACTCTTCGCTATGCAAATAGAGCCAAAAACATCATCAACAAGCCTACCATTAACGAGGATGCCAACGTCAAACTTATCCGTGAGCTGCGAGCTGAAATAGCCAGGCTGAAAACACTGCTTGCTCAAGGGAATCAGATTGCCCTCTTAGACTCCCCTACAGCTTTAAGTATGGAGGAAAAACTTCAGCAGAATGAAGCAAGAGTTCAAGAATTGACTAAGGAATGGACAAACAAGTGGAATGAAACCCAAAATATTTTGAAAGAACAGACGCTAGCTCTTAGGAAGGAAGGGATTGGGGTTGTTTTGGATTCCGAACTACCTCACCTGATTGGCATTGATGATGACCTTCTGAGCACTGGAATCATCTTATATCACTTGAAGGAAGGTCAGACATATGTTGGTAGAGAAGATGCTTCAATGGAGCAAGATATTGTTCTTCATGGCCTTGACTTGGAGAGTGAGCACTGTGTCTTCGAAAATGTTGGGGGAACAGTGACGCTAATACCCCTGAGTGGTTCTCAGTGCTCTGTGAATGGTGTCCAGATCATGGAGGCCACACATCTAAATCAAGGTGCTGTGATACTCTTGGGAAGAACCAATATGTTTCGTTTTAATCACCCAAAGGAAGCTGCCAAGCTCAGGGAGAAGAGGAAGAGTGGCCTTCTGTCCTCCTTCAGCTTGTCCATGACCGACCTCTCAAAGTCCTGTGAGAACCTGTCTGCAGTCATGTTGTACAACCCCGGTCTTTTCCCTGTAAAAGGACCCATCTGTCTAAGACTTGAATTTGAGCGACAACAGCGTGAAGAACTTGAAAAATTAGAAAGTAAGAGGAAGCTGATAGAAGAGATGGAGGAAAAGCAGAAGTCGGACAAGGCAGCGCTGGAGCGCATGCAGCAGGAGGTGGAGACGCAGCGCAAGGAGACAGAAATTGTTAAGCGTGAGATTCGCAAGCAGGAGGAGAGCCTCAAACGCCGCAGCTTCCACATTGAGAACAAGCTCAAGGACCTGCTTGCCGAGAAGGAAAAGTTTGAGGAGGAGAGGCTGCGTGAGCAGCAGGAGATCGAGCTGCAAAAGAAGAGACAGGAGGAAGAGAGCTTTCTCCATTGGCTCCAGGAATTCAGCAGCAGTGAGCAGCCTGAGAAGATGGAGATATTCCAGGAGCTGGACCGGCTGCAGCGGGAAAAAGATGAGCAGCACACCAAGCTGGCTCTGGAGAAGCAGAGGCTGGAGGAGCAGGAGCAGGAGCAGGTGCTGCTGTTGGCACAGCTTGAGGAGCAGCTTCAGGAGAGGCAGGAGATGGCCCCGCTGCTGTATGGCGAGGTTCTGAGGTCAGAGGAGGAAAAGCAGGAGCTTGAGGTCATCCGGGCTGTCCTCCTGCAGGCCAGGAAGGCCCTGGCTACAGGGGACACTGGCAGCCAGGGGCTGGACAGGGCCCAGCTGCATTTCCTAGAGTTCAAAAGAAAGCAGCTCATCCAGCTGGCCACCTCGGAACAAGAACTGGTCCAGCAAAAAGACCTCCTGAGTAAAGAAGTCCAGGAAGATCAGGAAGCCCTGCAGCACTTACAGTGTGAAAAGGATATGGACTGTAGGTTGTCGGCAAAAAATGATGGCCCAAGTATTTCCAGAGTGGCTCACGATTTAGAGAAAATAAAGGCAGCAGAATGCAGGCTGCGGTATAAAGAATGTCAGCTACAGGACCTCCTGCAAAATCACCTGCCAGCCCTGTTGGAAAAAAAGCAGAGAGCACTTGAAGTCCTTGACCAGGGCCCTCTCAGCTTGAACAACACTCTGTATCAAGTGGAAAAAGAAATGGAAGAAAAGGAAGAGCGACTTGCTCAGCACCAAGCCAGTGCCCGCCAGCTGCAGCAGCTCCAGGCCACCTTCGAATTCACCACCAATATCGCGAGACAAGAAGAGAAAGTGAGGAGAAAAGAGAAGGAGATTCTGGAGTCTCAGGAGAAGCAACAGAGAGAGGCACTGGAGCAGGCAGTGGCTAAGCTGTGGCACAGACAGTTGGCCCTGCAACAGCACTCCACCCTGGGCCTAGAGGGTGAGAAAGAGAGGCAGAAGCCAGCAGAGCAGAGCAGCAGCAGTGAGCAATTGGAGCTCCTGGCTGGCCTGGAAGCTGAGCAGGAGAACCTGGAGAAGGACCAGGACAGAATCAATGCTTACATTGAAGAAGAAGTCCAAAGACGTCTTCAGGATTTGCACCGCACAGTTGGTATTGCTAGGAATACTTCTACAGATATAACGAAAGATGAGAAACTTCACAATGACACCATTCAACGTAAGCTAAAATATGAGGGTGTTTGCAGCAGAGTGATCGCGCTTTCTCTTTGTTCTCTCCATCTGATGTGCCTTTGA

XM_004840840.1 Coding sequence

Kif16b kinesin family member 16B, transcript variant X1

Length: 4170 bp    Location: 17750525..17564774   Strand: -
>XM_004840840.1
ATGGCATCTGTCAAGGTGGCCGTGAGAGTTCGGCCCATGAATCGCAGGGAAAAGGACTTGGAGGCCAAGTTCATTATTCAAATGGAGAAAAGCAAGACAACAATCACAAACTTAAAGCTACCAGAAGGAGGGACTGGGGATTCAGGAAGAGAACGCACCAAGACCTTCACCTATGACTTTTCTTTTTATTCTGCTGATACAAAGAGTCCAGATTATATTTCACAAGAAATGATTTTCAAAACCCTGGGCACAGATGTCATGAAATCTGCATTTGAAGGTTATAATGCTTGTGTCTTTGCATATGGGCAAACTGGATCTGGAAAGTCATACACTATGATGGGAGATTCTGGTGATTTGGGCTTAATACCTCGGATCTGTGAAGGGCTCTTCAGTCGGATAAATGAAACCACCCGATGGGATGAAGCATCCTTTCGGACTGAAGTCAGCTACTTAGAAATTTATAATGAACGTGTGAGAGACCTGCTTAGGCGGAAGTCATCTAAAACCTTCAATTTGAGAGTCCGAGAGCATCCAAAAGAAGGACCTTATGTCGAGGATTTATCCAAACATTTAGTACAGAATTATGGTGACGTGGAAGAACTGATGGATGCAGGGAATATCAACCGGACCACAGCAGCAACTGGGATGAACGATGTCAGTAGCAGGTCTCACGCCATCTTCACCATCAAGTTCACTCAGGCAAAGTTTGACTCTGAAATGCCATGTGAAACCGTGAGTAAGATCCACTTAGTCGATCTTGCCGGAAGTGAGCGTGCAGATGCCACTGGTGCCACGGGGGTCCGGCTCAAGGAAGGGGGGAACATTAACAAGTCCCTCGTGACTCTGGGAAATGTCATTTCTGCCTTAGCTGATTTATCTCAGGATGCAGCAAACCCTCTTGTAAAGAAGAAGCAAGTTTTTGTGCCTTACAGGGATTCTGTTTTGACTTGGTTGTTGAAAGATAGCCTTGGAGGAAACTCTAAAACTATCATGATTGCCACCATTTCACCTGCTGATGTCAATTATGGAGAAACCCTAAGTACTCTTCGCTATGCAAATAGAGCCAAAAACATCATCAACAAGCCTACCATTAACGAGGATGCCAACGTCAAACTTATCCGTGAGCTGCGAGCTGAAATAGCCAGGCTGAAAACACTGCTTGCTCAAGGGAATCAGATTGCCCTCTTAGACTCCCCTACAGCTTTAAGTATGGAGGAAAAACTTCAGCAGAATGAAGCAAGAGTTCAAGAATTGACTAAGGAATGGACAAACAAGTGGAATGAAACCCAAAATATTTTGAAAGAACAGACGCTAGCTCTTAGGAAGGAAGGGATTGGGGTTGTTTTGGATTCCGAACTACCTCACCTGATTGGCATTGATGATGACCTTCTGAGCACTGGAATCATCTTATATCACTTGAAGGAAGGTCAGACATATGTTGGTAGAGAAGATGCTTCAATGGAGCAAGATATTGTTCTTCATGGCCTTGACTTGGAGAGTGAGCACTGTGTCTTCGAAAATGTTGGGGGAACAGTGACGCTAATACCCCTGAGTGGTTCTCAGTGCTCTGTGAATGGTGTCCAGATCATGGAGGCCACACATCTAAATCAAGGTGCTGTGATACTCTTGGGAAGAACCAATATGTTTCGTTTTAATCACCCAAAGGAAGCTGCCAAGCTCAGGGAGAAGAGGAAGAGTGGCCTTCTGTCCTCCTTCAGCTTGTCCATGACCGACCTCTCAAAGTCCTGTGAGAACCTGTCTGCAGTCATGTTGTACAACCCCGGTCTTTTCCCTGTAAAAGGACCCATCTGTCTAAGACTTGAATTTGAGCGACAACAGCGTGAAGAACTTGAAAAATTAGAAAGTAAGAGGAAGCTGATAGAAGAGATGGAGGAAAAGCAGAAGTCGGACAAGGCAGCGCTGGAGCGCATGCAGCAGGAGGTGGAGACGCAGCGCAAGGAGACAGAAATTGTTAAGCGTGAGATTCGCAAGCAGGAGGAGAGCCTCAAACGCCGCAGCTTCCACATTGAGAACAAGCTCAAGGACCTGCTTGCCGAGAAGGAAAAGTTTGAGGAGGAGAGGCTGCGTGAGCAGCAGGAGATCGAGCTGCAAAAGAAGAGACAGGAGGAAGAGAGCTTTCTCCATTGGCTCCAGGAATTCAGCAGCAGTGAGCAGCCTGAGAAGATGGAGATATTCCAGGAGCTGGACCGGCTGCAGCGGGAAAAAGATGAGCAGCACACCAAGCTGGCTCTGGAGAAGCAGAGGCTGGAGGAGCAGGAGCAGGAGCAGGTGCTGCTGTTGGCACAGCTTGAGGAGCAGCTTCAGGAGAGGCAGGAGATGGCCCCGCTGCTGTATGGCGAGGTTCTGAGGTCAGAGGAGGAAAAGCAGGAGCTTGAGGTCATCCGGGCTGTCCTCCTGCAGGCCAGGAAGGCCCTGGCTACAGGGGACACTGGCAGCCAGGGGCTGGACAGGGCCCAGCTGCATTTCCTAGAGTTCAAAAGAAAGCAGCTCATCCAGCTGGCCACCTCGGAACAAGAACTGGTCCAGCAAAAAGACCTCCTGAGTAAAGAAGTCCAGGAAGATCAGGAAGCCCTGCAGCACTTACAGTGTGAAAAGGATATGGACTGTAGGTTGTCGGCAAAAAATGATGGCCCAAGTATTTCCAGAGTGGCTCACGATTTAGAGAAAATAAAGGCAGCAGAATGCAGGCTGCGGTATAAAGAATGTCAGCTACAGGACCTCCTGCAAAATCACCTGCCAGCCCTGTTGGAAAAAAAGCAGAGAGCACTTGAAGTCCTTGACCAGGGCCCTCTCAGCTTGAACAACACTCTGTATCAAGTGGAAAAAGAAATGGAAGAAAAGGAAGAGCGACTTGCTCAGCACCAAGCCAGTGCCCGCCAGCTGCAGCAGCTCCAGGCCACCTTCGAATTCACCACCAATATCGCGAGACAAGAAGAGAAAGTGAGGAGAAAAGAGAAGGAGATTCTGGAGTCTCAGGAGAAGCAACAGAGAGAGGCACTGGAGCAGGCAGTGGCTAAGCTGTGGCACAGACAGTTGGCCCTGCAACAGCACTCCACCCTGGGCCTAGAGGGTGAGAAAGAGAGGCAGAAGCCAGCAGAGCAGAGCAGCAGCAGTGAGCAATTGGAGCTCCTGGCTGGCCTGGAAGCTGAGCAGGAGAACCTGGAGAAGGACCAGGACAGAATCAATGCTTACATTGAAGAAGAAGTCCAAAGACGTCTTCAGGATTTGCACCGCACAGTTGGTATTGCTAGGAATACTTCTACAGATATAACGAAAGATGAGAAACTTCACAATGACACCATTCAACGTAAGCTAAAATATGAGAAAAGGCAATCTCAGCCAGCACAATGCGTTGTCTCACTTCCGTCCAAAGACACCACTGACACTGCCCACATTGTCATTAGAGAAGAGAGGAGAGAGGCAGCACAGAGCACAGGGCACAGAGCACAGAGGCAGCACAGAGGGCCTGCCGGACCCATCCCCAGAGCACCCTTCCCATCCTTGGCATCATCATCACAGGAGGGAAAGGATCTGTCCTTGGGGGCCGGGGTGCTGCCTGACAGCAGTTGCAAAGATCACTCTGAGCCGTGTGACCACCTGGAGCCAGAGTGCCTTCATCTACCTGAAAGCACTTTTCTTAACAGAAAGGACACCAGCTTTGTTCCAGAGGATTTTCAAGGTGGGTCAGAAAATCTCAGTAAGCCAATGACTCTCAAGGATGAACACAGCTTGAGAGCTGAGTCCAGCTGGACATGGCTGCAGCACACATCCCAACAAGCGTCTACAGATGGCAGAAGCAAGCAGGTCAGGCTGAGCGGAGCTCTCTGCTTTGTTCTCTCAGACACTGCTTCTCAGGAGGAGTGTGCACCTGGCATTGCTCCTCAGAGTGGCCAGACTCTCATGGTTTGTGATGATCAAGACAAGAAAGCTTTAGCTGCTGAACAGATTAGCTCTGCAGCATCACCAATAAATATCAAGGCAGAAGGAAACAGTGGCCTGGGATATTTTTACCACAAGTTCTCAGACCTTTATAAAGATAGCAGTAATCACCTGCTGCATGCTGGCACTGTAGTAATCAGCCGAGCCATGCATGTGGGGAGTTTGTGTGCCCCAAATAGGCTCGCCTCGCACCTGACAGCGTTCTTCTGA

XM_004840851.1 Coding sequence

Pcsk2 proprotein convertase subtilisin/kexin type 2, transcript variant X2

Length: 1812 bp    Location: 18368974..18642503   Strand: +
>XM_004840851.1
ATGAAGGGGGCTTGTGGCTCCCGGTGGCAGGCGGCCGCCGGGCTCCTCTTCTGTGTCATGGTTTCTGCATCTGCCGAGAGACCCATCTTCACGAATCATTTTCTCGTGGAGTTGCATAAAGGGGGTGAGGAAGAAGCTCGCCAAGTTGCCGGGGAGCACGGCTTCGGAGTCCGGAAGGTAAAGATGGCCTTGCAACAGGAAGGGTTTAACCGAAAGAAGCGAGGGTACAGAGATATCAATGAGATTGACATCAACATGAATGATCCTCTTTTTACAAAGCAGTGGTACCTGATCAACACTGGACAGGCTGATGGCACTCCTGGCCTTGATTTGAATGTGGCAGAGGCCTGGGAACTGGGATACACTGGGAAAGGTGTGACCATTGGGATTATGGATGATGGGATCGACTATCTCCACCCAGACCTGGCCTCCAACTATAATGCCGAAGCCAGTTACGACTTCAGCAGCAATGACCCCTACCCATACCCTCGGTACACAGACGACTGGTTTAACAGCCATGGAACAAGATGTGCAGGAGAAGTTTCAGCAGCAGCCAACAACAATATCTGCGGGGTTGGGGTGGCGTACAACTCCAAAGTCGCAGGTATCCGGATGCTGGACCAGCCCTTCATGACTGATGTCATCGAAGCCTCCTCCATCAGCCACATGCCCCAGCTCATTGACATCTACAGCGCCAGCTGGGGCCCCACGGACAACGGGAAGACGGTGGACGGGCCCCGAGAGCTCACATTGCAGGCCATGGCTGATGGCGTGAACAAGGGCCGCGGGGGCAAGGGCAGCATCTACGTGTGGGCCTCTGGAGACGGTGGCAGCTACGATGACTGCAACTGCGACGGCTACGCCTCGAGCATGTGGACCATCTCCATCAACTCGGCCATCAATGACGGCAGGACGGCGCTGTACGACGAGAGCTGCTCCTCCACCTTGGCGTCCACCTTCAGCAACGGGCGCAAGAGGAACCCCGAGGCGGGCGTGGCCACCACAGATCTGTATGGCAACTGCACCCTGCGGCATTCTGGGACATCAGCAGCGGCTCCTGAAGCAGCTGGGGTTTTCGCGCTGGCTTTGGAAGCCAACATGGGGCTGACCTGGCGAGACATGCAGCACCTGACGGTCCTCACCTCCAAAAGGAACCAGCTCCACGATGAGGTCCATCAGTGGCGGCGCAATGGGGTTGGCCTGGAGTTTAATCATCTCTTTGGCTACGGGGTCCTGGATGCCGGCGCCATGGTGAAAATGGCCAAAGACTGGAAGACCGTGCCAGAGAGGTTCCACTGTGTGGGAGGCACCGTGCAGGACCCAGAGAAGATCCCACCCACCGGCAAGCTGGTGTTGACGCTCACCACGGCTGCCTGCGAGGGGAAGGAGAATTTCGTGCGCTACCTCGAGCATGTCCAGGCCGTCATCACAGTCAACGCCACCAGGCGAGGAGACCTGAACATCAACATGACGTCGCCCATGGGCACCAAGTCCATTTTGCTGAGCCGGCGTCCTCGGGATGATGACTCCAAGGTGGGCTTCGACAAGTGGCCTTTCATGACCACCCACACGTGGGGGGAGGACGCCCGGGGGACCTGGATGCTGGAGCTGGGCTTCGTGGGCAGCGCACCTCAGAAGGGGGTGCTCAAGGAGTGGACCCTCATGCTGCACGGCACGCAGAGCGCCCCGTACATCGACCAGGTGGTGCGGGATTACCAGTCCAAGCTGGCCATGTCCAAGAAGCAGGAGCTGGAGGAAGAGCTGGATGAAGCCGTGGAGAGGAGCCTGAAGAGCATCCTTGGCAAGAACTAG

XM_004840854.1 Coding sequence

Dstn destrin (actin depolymerizing factor), transcript variant X2

Length: 537 bp    Location: 18730033..18759094   Strand: +
>XM_004840854.1
ATGCTCGTTCGTGGAAGAAAAAGATTAGCCAGTAGTTTTTTGGCCTCGGGAGTGCAAGTTGCTGATGAAGTATGTCGCATTTTTTATGACATGAAAGTTCGGAAATGCTCCACACCTGAGGAAATTAAAAAAAGAAAGAAGGCTGTCATTTTTTGTCTCAGTGCAGACAAAAAGTGCATCATTGTTGAAGAAGGCAAAGAGATCCTAGTTGGAGATGTGGGTGTGACCATCACTGATCCCTTCAAGCATTTTGTGGGGATGCTTCCTGAAAAGGATTGTCGCTATGCCTTGTATGATGCAAGCTTCGAGACCAAGGAGTCCAGGAAAGAAGAGCTGATGTTCTTTTTGTGGGCCCCAGAACTGGCCCCTCTGAAGAGTAAGATGATCTACGCCAGCTCTAAGGATGCGATCAAAAAGAAGTTCCAAGGCATCAAACACGAATGTCAAGCAAATGGGCCGGAAGACCTCAACCGAGCTTGTATTGCCGAAAAGCTGGGTGGGTCCTTGATTGTAGCCTTCGAAGGGTGCCCCGTGTAG

XM_004840857.1 Coding sequence

Rrbp1 ribosome binding protein 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 2904 bp    Location: 18815577..18762436   Strand: -
>XM_004840857.1
ATGGATATCTACGACACGCAGACCTTGGGCGTCATGGTCTTTGGCGGCTTCATGGTGGTGTCTGCCATTGGCATCTTCCTGGTGTCCACCTTCTCCATGAAGGAAACGTCGTATGAAGAGGCCCTCGCCAACCAGCGCAAAGAAATGGCGAAAATTTACTACCAGAAAGTGGAAAAGAAAAAGAAGGAGAAAACCGTGGAGAAGAAAGGAAAGACCAAGAAAAAGGATGAGAAACCAAACGGGAAGATTCCTGACCATGACCTGGGCCCCAATGTCACCGTCCTCCTCAAAGAACCAACACGCACTCCTGCCTTGGCTGTGGCCCCAACCCCCATCCAGGCCCCCCTGGTCTTTACCCCTGTTGCTGCAGTACCAGCCATGCCCCAAGAGAAGCTGGGCTCCTCCCCAAAGGACAAAAAGAAGAAGGAGAAAAAAGTGGCCAAAGTTGAACCAGCAGTCAGCTCAGTAGTGAATTCCATCCAGGTTTTGGCCTCAAAGTCAGCCATCTTGGAAGCTGCTCCCAAGGAGAGTGCAAGTGCAGATGTAGTGCAGAGCCAGGAGGCGCCCAAGCTGGAGGCTCCTGCAAAGAAGAAGTCTGGTTCCAAGAAAAAGAGGCCCCCCGATGCCAACAGCCCTCTCTACCTACCCTACAAGACGCTGGTCTCCATGGTTGGAACCATGGCGTTCAATGAGGGTGAGGCCCAGCGGCTCATCGAGATCCTGTCTGAGAAGGCTGGTGTCATCCAGGACACCTGGCACAAGGCCACTCAGAAGGGAGACCCCGTGGTGATTCTGAAACGTCAGCTGGAAGAGAAGGAAAAACTGCTGGCCACAGAGCAGGAGGATGCGGCTGTAGCCAAGAGCAAACTGAGGGAACTCAACAAGGAGATGGCTGCGGAGAAGGCCAAGGCTGCTGCTGGGGAGGCCAAGGTGAAGAAGCAGCTGGTGGCTCGGGAGCAGGAGATTGCAGCAGTGCAGGCACGCATGCAGGCCAGCTACCGAGAGCACGTGAAGGAGGTGCAGCAGCTACAGGGCAAGATCCGGACTCTGCAGGAGCAGCTGGAGAATGGCCCCAACACCCAGCTAGCCCGACTACAGCAGGAGAACTCCATCCTGCGGGACGCCCTGAACCAGGCCACCAGCCAGGTGGAGAGCAAGCAGAACGCAGAGCTGGCGAAGCTGCGGCAGGAGCTGGGTAAGGCCAGCAAGGAGCTGATGGAGAAGGCGGAGGCGTCCCGGCAGGAGGAGCAGCAGCGCAAGGCCCTGGAAGCTAAGGCGGCCGCCTTTGAGAAGCAGGTGCTGCAGCTGCAGGTGTCCTACAGGGAGAGTGAGGAGGCTCTGCAGAAACGTCTGGATGAGCTTAGCCGGGAGTTGTGCCGCACTCAGAGCAGCCATGCCAGCCTGCGTGCCGATGCCGAGAAGGCCCAGGAGCAGCAGCAGCGGGTGGCAGAGCTGCACAGCAAGCTGCAGTCCTCCGAGGCAGAGGTGAAGAGCAAGTGTGAGGAGCTGCGGGGGCTCCATGGGCAGCTCCAGGAGGCCCGAGCAGAGAACACCCAGCTGGCTGAGCGCATGCACTCCATCGAGGCCCTGCTGGAGGCGGGCCAGACACGGGACACCCAGGCCAGCCAAGCTGAGGCAGAGCAGCAGCAGACCCGCCTCAAGGAGCTGGAGTCACAGGTGTCATGTCTGGAGAAGGAGGCCATTGAGCTCAGGGAGGCTGTGGAGCAGCAGAAAGGGAAGAATAATGACCTCCGGGAGAAGAACTGGAAGGCCATGGAGGCGCTGGCCTTGGCCGAGAGGACCTGTGCAGAGAAGCTGCAAACCCTGACACAGGCCAAGGAGGACTCAGAGAAGCAGCTCCACCTGACTGAGGCGCAGACCAGGGAGGCCCTGCTGGCCCTGCTCCCGGAACTCTCTGCCTTGGCACACCAGAGCTATGCCGAGTGGCTGCAGGAGCTCAGAGTGAGGGGCCCCGAGCTGCTGAAGATACCGTCGGAGCCCCCTCAGGACGTGACCTCCAAGCTGCGGGAGGCCGAGGAGGCCCAGAGCACTCTGCAGGCCGAGTGTGACCAGTACCGCGCCATCCTGGCTGAGACGGAGGGCATGCTCAAGGACCTGCAGAAGAGTGTAGAGGAGGAGGAGCAGGTGTGGAAGGCCAAGGTGGGCACCAAGGAGGAGGAACTGCAGAAGTCCCAGGTCACAGTGAAGCATCTCGAAGACACTATAGAGAAGCTCAAAGGAGAACTTGAAAGCTCAGATCAGGTGCGGAAGCACACCTTGCACTTGGAGGCAGAGCTGGAGAAGCACATGGCTGCCGCCAGCGCCGAGTGCCAGAGCTACGCCAAGGAGGTGGCAGGGCTGAGGCAGCTGCTGTTAGATTCTCAATCTCAGCTAGACGCAACGAAGAGTGAAGCCCAGAAGCAGAGCCAAGAGCTCGCCCTGGTCAGGCGGCAGTTGAGTGAGATGAAGAGCCATGTAGCAGATGGTGATGTGGCTGGATCCCCAGGAGTCCCCTCAGCCAAGCAGGACCCTGTGAAGCTGCAAGCACAGCTGGAGCGGATGGAGCTCGCCCTGGAGGAGGAGCAGGTGCAGCGGCAGAAGCTCACAGCTGAGTTTCAGGAGGCACGGAGCACGGTGTGCCAACTACAGGAAGAGCTGGAGATGCTGCGTGCCACTGGCCCCCCGGCATCTCTGGGCACTGAGGAGGTTGCACAGCTGAAGGAGAGACTAGAGAAAGAGAAGAAGTTAACAAGTGACCTGGGTCGTGCCGCCAGCAAACTGCAGGAGCTTCTGAAGACCACCCAGGAGCAGCTGGCAGAGGAGAAGGACAAGGTGAAGCAGCTGCAAGAACAGCTGGAAAAAGTGGAGGATGGCAGTGGTCCGAAAGAGGGCACCTCCGTCTGA

XM_004840858.1 Coding sequence

Banf2 barrier to autointegration factor 2

High confidence: 4 potential gene matches
Length: 273 bp    Location: 18845491..18855938   Strand: +
>XM_004840858.1
ATGGAGCCCATGTCTCCCGGCCTGAGAGCCTTCCTCTCAGAGCCCATGGGAGAGAAGGACGTCTGCTGGGTGGACGGGGTCAGCCGGGAGCTGGCCGTCAATCTGGTTGCCAAAGGGTTCAGCAAGGCTTACATCCTGTTGGGACAGTTCCTTCTGATGCACAAGGACGAGGATGAGTTCCAGAAGTGGCTGATCGACTGCTGCGGCGCCACGGAGTGTGAGGCGCGCCGGAGCACTACCTGTCTGAAGGAGTGGTGCACCTGCTTCCTGTAG

XM_004840862.1 Coding sequence

Ovol2 ovo-like 2 (Drosophila)

High confidence: 4 potential gene matches
Length: 813 bp    Location: 19012369..18995246   Strand: -
>XM_004840862.1
ATGCCCAAAGCCTTCCTGGTAAAGCGCAGGAGCCCGGGTGCCGCGGCGCGCACCTGGACTGCACTCCCGGATGAGAACCGCGCGGACGTCTACATCCCAGTGGCCTTGGGCCGGCTGCTCCACGGCCCTCCTGAAGACAGTCGCAGCGACTTCGGCAGCGGCAGCAGTACCGGCGAGCCCGGAGGCACCGAGAGCAGCTCGTCCCCGCGTGCCCCGGAGCGCGACACCCCCGAGCCCCGCGATGCCGGGGGCGCAGATGGACACCTGGCGGCGAAGCAGCGCCCGGTTGCCAGGTCGAAAATCAAGTTCACTACAGGGACATGCAGCGATTCAGTGATACACAGCTGCGAGCTCTGTGGCAAGGGCTTTCGCCTGCAGCGTATGCTCAACCGCCACCTCAAGTGCCACAGCCAGGTGAAGAGGCACCTGTGCACCTTCTGTGGTAAGGGCTTCAACGACACCTTCGACCTCAAGCGGCATGTCCGAACGCACACAGGCATTCGGCCCTACAAGTGTGACGTGTGCAACAAGGCCTTCACGCAACGCTGCTCACTGGAGTCGCACCTGAAGAAGATCCATGGCGTGCATCAGCAGTACGCCTACAAGCAGCGGCGAGACAAGCTGTACGTGTGTGAGGACTGTGGCCACACGGGTCCCTCGCAGGAAGACCTGTACCTGCATGCACACCGTGCACACCCGGGTAGTGCCCTCCTGCAAAAGACTTCCAAGAAGTTGGCGGCGTTGCTGCAGACCAAGCTGGTGGCCTCATGCCCTGGGGACGCTAGCCTGAGCGAAGAAGAGGCCCGGAAGTGA

XM_004840867.1 Coding sequence

Znf133 zinc finger protein 133, transcript variant X2

Length: 1965 bp    Location: 19111787..19129908   Strand: +
>XM_004840867.1
ATGGCGTTCAGGGATGTGGCTGTGGATTTCTCCCAGGAGGAGTGGAGCTTGCTGAGTCCTGCTCAGAGGAGCCTGTACAGGGAGGTGATGCTGGAGACCTACAGCCACCTGGTGTCTCTGGGAATTCCGTTTTCTAAACCAAAACTCATCACACAGCTGGAGCAGGGGAAAGAAATGTGGCGAGAAGAGAGAAAATGTTCACTGGCCACCTGTCCAGCAGAACCAAAGCCGGAACTCCAGCCAGGTCCTTTCTGCCCCCTGGATTTCTCAGCTCAGAAATTCCCTGTGCAGCATGTGCTGTGCAGCCAGCCTCCCTGGCTATTGACGTGCTTGTGCACAGGAAGTCCTGTCCTGCCAGGGGCTCTGTGCCCGGAGGACCTGGAAGACCAGCAGAAGCAGCCGCAAGCCTCACAGGGGTGTGCTTGGAGTGCAGAGGCCGAGAGTGGTTACAGCAAGGGCACCAAGCCTGCCTTTGGGAAGACAAAGAGGAGGACTTTGGGCGTGTTCTCCAGGCCACCGCAGAGACAGCTGGTCAAGGCCCTCCGTGGGGTGGAGATGGAAGCTGGCGCCACTCCGCCGGGGACCCCCGAGGACACAGACAAGTTGCTGAAGAGCATCGAAGTCTTAGGGTTCGGGACGGTCAACTGCAGTGAGTGCGGCCTGGGTTTCAGCAAGATGACCAACCTGTTGAGCCACCAGCGCATCCACTCGGGCGAAAAGCCATACGTGTGTGGGGTGTGTGAGAAGGGCTTCAGCCTGAAGAAGAGCCTGGCTCGGCACCAGAAAGCTCACTCAGGGGAGAAGCCCATCGTGTGCGGCGAGTGTGGCCGGGGCTTCAACCGCAAGTCCACGCTGGTCATCCACGAGCGCACGCACTCGGGCGAGAAGCCGTATGCCTGTGTGGAGTGCGGGCGCGGCTTCAGCCAGAAGTCCAACCTCATCATCCACCAGCGCACGCACTCAGGCGAGAAGCCCTACGTGTGCCGCGAGTGTGGCAAGGGCTTCAGCCAGAAATCAGCCGTGGTCAGGCACCAACGCACGCACCTTGAGGAGAAGACGATCGTATGCGGGGACTGCGGCCTGGGCTTCAGTGACAGGTCCAACCTGATCTCGCACCAGCGCACGCACTCAGGCGAGAAGCCCTACGCATGCAAGGAGTGTGGCCGCTGCTTCCGACAGAGGACCACACTGGTCAACCACCAGCGCACACACTCTAAGGAAAAGCCATACATATGCAGCGTGTGTGGGCACAGCTTTAGCCAGAACTCCACCCTCATCTCGCACCGCAGGACACACACTGGGGAGAAGCCCTTTGTGTGTTCTGTGTGCAGCCGGGGCTTCAGCCTCAAGTCACACCTCAACAGGCACCGCAACATCCACTCTGGGGAGAAGCCCATCGTGTGCAAGGACTGCGGTCGGGGCTTCAGCCAGCAGTCCAACCTCATCCGGCACCAGCGGACACACTCGGGGGAGAAGCCCATGGTGTGCGAGGAGTGTGGACGCGGCTTCAGCCAGAAGTCCAACCTCGTGGCGCACCAGAGGACACACTCAGGGGAAAAGCCGTACGTGTGCCAGGACTGTGACAAAGGCTTCAGCCACCAGGCTGGGCTCATCAGGCACAAAAGGAAGCACTTGAGGGAGAAGCCTTACACGTGCCGGCAGTGTGGACTGGGGTTTGGCAACAAGTCCACTTTAATCACGCATAAGCGGGTCCACTTGGAAGGGAAGCCTTGTGTCTGCAGCGAGTGTGGCCAAGGCTTTATCCAGAAATCCCTCCTGGCTTTACACCAGCTGGCACACAAGGGGAAGACGCCTTACGTGTGCAGAGCCTGCGGGCAAGGCTTTAAGCAGAAGTCTCAGCTGAGCAGGCACAGGAAGACAAAGTGTAGCCACCACAGACTGCCACTCCAGGCCAACTCTGAGGCTGGTTCTGGGCAGGCTTCTGACCTCTTGGATTTACTTTGA

XM_004840869.1 Coding sequence

Dzank1 double zinc ribbon and ankyrin repeat domains 1, transcript variant X1

Length: 2304 bp    Location: 19196502..19143016   Strand: -
>XM_004840869.1
ATGACGGCTGGTTCAGTGTGTGTCCCTCAGATCATACCACTGCGAATACCTCAGCCTGGAAAAGCGAACCATGAAATTGATAATAATACTCTTTTGGAAATGAAATCAGACACCCCGGATGTCAACATATATTACACCCTGGATGGCAGTAAACCTGAATTTCTGAAGAAAATTGGTTATGGTGAAAATAATACATTTAAGTATACAAAACCTATTACTCTGCCTGATGGAAAAATACAAGTTAAAGCTATTGCAGTGTCTAAAGACAACAGACAGAGTGGAATTGTCACAAAGGTGTTCCAAGTAGACTATGAACCACCAAGCCCAGCCTCTTCTGGAGACAGAGTTGAAAATGTTCTCAAAGGCTCTTCAAAGCAGGAATTAAAAAATGGATTTGTTGGACCAAAAGTAAGAAAGAAATGTAAGAATGCTGAAAATAAACCTGGTTGGAATGTTAACCTTCGAAAGTTTTCAGACCTCAAGGTAGGCGAAAGATCTACACTTCTGAAAGCTCTGAGAGATCTTCGTTTCTCAAAGAGTCCATTGGAAATCTCAGCTCACTGTGAAGGATCAAGTTCTAGGCTGCTCACCCACCAGTCCCAGTTTCAGTCGCCTGGTTTTGCACACATACCAGGCCAGAAGAGTTTGACAAGCACGGAGATCATGAGAATCCAAAGGCAGACAGACTTTCTCAAGTGTGCCCACTGCCTGGCCCCCCGCCCATCGGATCCTTTCGCTAGATTCTGTCACGAGTGTGGTGCTCCTGTCCCATCCATATTTGGCTGTCGTCTTCCACCCCCTGAAGGAGCGCAGATGGGCTCGTGTGCAGAATGTGGAAACGTGGTGCCCATGAACACCCCCATCTGTGTGGTGTGCGAGGCTCCACTTGCTCTACAGCTGCAGCCCCAGGCCAGCCTCCACTTGAAGGAGAAGGTGATCTGCCGCTCCTGTGGCACGGGGAATCCTGCTCACCTGAGATACTGTGTCACCTGCGAGGGGGCCCTGCCTTCGCCACAAGAGTCCTGGAACAGTGGCGAGAAAGCACCCCCTCTGCTGACCCAGAAAGGGGAGACCACTTCCTGGTGCAGATGTGGCTGCCACAACCTCGGGGAGGCAATCTTCTGCGACTGGTGTGGAGCCAAGCTTGGCCTTTCTGCTAGCCACTCCATCTGCCCTAAATGTGGGGCCAGCAATCACCCATCTGCTCAATTCTGTGCTACCTGTGGCGTTTGTGTGAACTCCATGGCAAGACAGAGCCTGGATGGCAGCCCGACTGTCCTAGCTGGGGAGCCGCACCCCACTTCTCAGCCCCGATATGCTTGGCAACCCCTAACTGTCCCTCTGCCCAGCGCTGATGCTGGGCCTAAGAAGCATGTGGGCACCCAGACCGTGGGCCTCTTCTACCCGTCTGGCAGGCAGCTGGCCTTGAAGGAGCCGGAGGTGGAGACACGTGGCCGCATGCCCCCACTCATGGCCATCAGCCCAGGCAGAGGATACTGGAGAAAACAGTTGGATCACATCTCTGCTCACCTCCGGTCCTACACTCAGAACAACCCTGAGTTCCGGGCCCTGGTCTCAGAGCCCAGGATGGGGAAGCTCATCTCTGCCACTGTCCATGAAGATGGCTGTGAAGTTAGCATCAGGCTGAATTATATTCAAGTCTCCAACAAGAACCTGTACCTCAGCAAAGCAATGGACTTAAGCAACCGCTTTCTCAGCAGTATCACCGAGGGTGGTGATGGCCTCTACGGCAGCAGGTCCAGCTTGGTGAGTGACTACAGCCAGAGTCCCTCAGACTCTGAGGTCAAGAGGATGAGGAACATCAAAACCAAAAACTTTCACATAAAGAAAGAGCAGCCGAGGCCTAGAAGCAGACATCGGGTGGAAGAAGTGGGCCTGGCAGGGGACAAAAGAGTCTCTGTGCTTGAACAGCTGCTGGACAAGGATACAGATCCTGACTGCAGTGACAGCACGGGCCGATCTGCTGCTGCCTTAAATAAGCACCAGGAAGCCATTCCAGTTCTCACTGGGAGAGGAGTGGATGTGGACCAGCAGTGGGGGCTGTACAGCACGAGCCTCCAGAAGGTGGACACTCGAGGCCAGACAGCCCACAACCTGGCTCTGGAAAGGGAGGACCACCACGTCACCTTGCTCTTTGATGCTAAGTTCAGCCAGGAGCTGGGGGACCAGCTCAGCCAGCCTGAGAGCTGCAGCCCAGATGACTGTCAGGCCCAAGGCAGCTGCTGGTCCTCACAGAAGGAGCCACTCAGCACTGGCTGTCCTGTTTCTGAAGTGTGCATATGA

XM_004840894.1 Coding sequence

Crnkl1 crooked neck pre-mRNA splicing factor-like 1 (Drosophila), transcript variant X2

Length: 2064 bp    Location: 20581719..20565033   Strand: -
>XM_004840894.1
ATGGCGGCCTCCACAGCGGCCGGGAAGCAGCGAATTCCCAAGGTGGCCAAGGTAAAAAACAAAGCCCCAGCTGAAGTACAGATAACTGCTGAACAACTCTTAAGAGAAGCCAAGGAAAGAGAACTTGAGCTTCTGCCACCTCCACCTCAGCAGAAGATCACAGATGAAGAAGAATTAAACGATTACAAGCTAAGGAAAAGGAAGACTTTTGAAGATAACATAAGAAAAAACAGGACTGTGATTAGTAACTGGATAAAGTACGCACAATGGGAAGAAAGTCTAAAGGAAATTCAAAGGGCTCGATCCATATACGAGCGTGCTTTAGATGTAGACTATCGAAATATCACACTGTGGCTGAAATATGCAGAAATGGAAATGAAGAACCGCCAAGTCAACCACGCCCGAAACATCTGGGACCGGGCCATAACAACTCTGCCGAGAGTCAACCAATTCTGGTACAAGTATACGTACATGGAGGAGATGCTGGGCAATGTGCCGGGAGCCCGGCAAGTGTTTGAGCGCTGGATGGAATGGCAGCCTGAGGAGCAGGCCTGGCACTCCTACATCAACTTTGAGCTGAGGTACAAGGAGGTGGAGCGGGCCCGCACCATCTATGAGCGCTTTGTCCTTGTGCACCCTGATGTGAAAAACTGGATCAAGTACGCCCGCTTCGAAGAGAAACATGCTTACTTTGCCCATGCCCGGAAAGTATACGAGAGAGCGGTGGAATTCTTTGGAGATGAACACATGGATGAACACCTTTATGTTGCTTTTGCCAGATTTGAAGAAAATCAGAAAGAATTCGAAAGGGTGCGAGTCATCTACAAGTACGCTCTGGATAGAATCCCAAAACATGAGGCCCAAGAACTCTTTAAAAACTACACCATCTTTGAGAAGAAGTTCGGCGACAGGCGGGGCATTGAAGACATCATCGTGAGCAAGCGGAGGTTCCAGTATGAGGAGGAAGTGAAGGCTAATCCACACAATTACGATGCATGGTTCGATTACTTGCGCTTGGTGGAAAGTGACGCCGAAGCTGAGACTGTGCGTGAAGTCTATGAGAGAGCGATTGCCAACGTCCCGCCCATCCCAGAGAAGCGGCACTGGAAGCGCTACATCTACCTGTGGATCAACTATGCACTCTATGAGGAGCTGGAAGCAAAGGACCCTGAAAGGACAAGACAAGTTTATCGAGCCACTTTGGAACTAATTCCACACAAAAAGTTCACATTTGCCAAAATGTGGTTATATTATGCACAGTTTGAAATAAGACAGAAAAATTTACCATTTGCCAGACGAGCTTTGGGGACGGCCATAGGCAAATGTCCAAAGAACAAGTTATTTAAAGGTTACATAGAATTGGAGTTGCAGCTTCGAGAATTCGACAGATGCCGGAAGCTTTATGAAAAGTTCCTGGAATTTGGACCTGAAAATTGTACCTCCTGGATTAAGTTTGCCGAGTTAGAGACAATCCTTGGTGATATTGACAGAGCACGGGCCATCTATGAATTGGCTATCAGCCAGCCACGTCTAGACATGCCGGAGGTGCTTTGGAAATCATACATTGATTTTGAAATTGAGCAGGAAGAAACTGAAAGAACACGAAATCTTTACCGACAGCTGCTTCAGCGGACACAACATGTCAAGGTATGGATCAGTTTTGCTCAGTTTGAATTGTCTTCCGGGAAAGAAGGAAGCATCACCAAATGCAGACAAATCTATGAAGAAGCTAACAAAACCATGCGGAACTGTGAAGAAAAGGAAGAGAGGCTTATGCTGCTGGAATCCTGGCGAAGCTTTGAAGATGAATTTGGAACCGCATCAGATAAAGAGAGAGTGGACAAACTAATGCCAGAGAAAGTCAAAAAGAGACGAAAAGTTCAGGCGGATGATGGGTCTGACGCAGGCTGGGAAGAATACTATGATTACATCTTTCCTGAGGATGCTGCCAACCAGCCCAACCTCAAGCTGCTGGCCATGGCCAAACTCTGGAAGAAACAGCAGCAGGAAAAGGAGGCTGCTGAGCAGGATCCAGATAAGGACATCAATGAGAGTGAATCTTGA

XM_004841158.1 Coding sequence

LOC101702970 chromosome unknown open reading frame, human C20orf26

Length: 3696 bp    Location: 20581763..20856162   Strand: +
>XM_004841158.1
ATGTCTGTACTCACTTCTCCCAGAGGAAAGGTAGAAGTGGTTCACTGCCGAAGAACAGAATCCCAGGATATTTATTGTATCCAAAAACTCATTAGAAAATTTACCCAGAAGCTGTTTGGGAGGCTTAATATCGTCTATCTTCTAGAAAAGGCAAACCTGGCTATTACCCTGTGCAATGACAGGGAGGAGATCATGGCCCACGCCACCTTCTTGGACTATCCCAACTGGAACGTGGCCACGCCAGAGGCCTGGGAATCAGTGTTCCGGGAGCTTGATGTTGACATCCCCTGCACGCCCCTGAATACGCTGTTCCTGCACCTCTTTGTGGCCGTGGATGAGTATTCTGTTGGCTGCTGCAAAGAGATTATTCGGACAGTGTTTAAGGTGGTGCCAGAGCTGCACTTCATCTTTCTCATAGTGCCATCCTACATGAGCCTAGGCTCGACTCTCGTCACTGTTTTTAATGAAGTGGGGAGCTTGCCGTATCTGATGTATGATGAGGACTTCACAGTGTACGTGTGTCACAGGCACAGCCACTACCCTCAGCTGCACATTCGCAGAGCCAGGGTGGAAGACCATGACGACCTCATGCTGATATTTATGCACCATGACACCATTTTGAAGGACACATATGGCGAATACTTCCTGGCTGAGCTGATAGAAGCTCAGGACGAAGAGAACCATGCTGTCGTGTGTGAGGTGGAAGGTGTGGCTGTCGGCTTCATGAGCTTGTGCTCCAGAGTGAATCTGCCGCTGCTGCATGAGTGCTTTGACCTGGGTCCTTTCCATGGATTCTGCACCCCACATCCCGAAGATGTCCTGGAGCCACCAAGAGAACCCAGAAGCACAGATGCCAAACTCAGGACAGAGAGCCAGAGTTCCCAGAAGACAGCCCAGGAACTCTCAGGACTGTTTTCCCCGGAGGCCACGGGGAGCTTCCAGGAAAAGGTCATGGAAGAAGCTGAACTCCTCTCAGCAGTCCACAGTGAAAATGCCAGTGAAATGCAGGACACGGATAAACTCAGTCTGCTTTCCCTCACTGGTGAGCAGGAACATGGTGTCAGCCGCTGGAGCTCAGCATCCATCCTGCTGCCCGAGGAGCCTGACTATTTCCGCCCAGTCTACAGGGGAGCCCCCACTGTGTTCTGCATTCAGCTCTTTTGTATCGATGAGCAGTATGAGGCAAGGTCTCTGGATTTTATGAATTTTGTTTTCAGTCTCTTTCCCGACAAGAACTTCTGCATCATTTCCGTGCCCCAACTCACCCCTGAGTTTGTCCTCATCCAGAACTTCATGAAAGTCATCCCCTTTGGTGACTGCACACTCCAGCACGACCTCTACGTCTTCCACCGGGCCGGGCTGTTCAAGTCCATTAATATAAGATTAGCCAATTGCACAGACACTCCTGGCGTGGAAAAGCTGGTGAGCTCCCTCATGCTGAGTAAAAGCATATTGGAGGACTTTGCCCAGTACAGTGAGGCCCGCAGAGACCCTGATGGAACACCACTGCAGGCTTTTGTGGCGGAAGTGGCAGAACAAGTCGTTGGCATTGCAGTGATCAGAGACGAAATGGACATAGAGTACATACGCTCCCACTACAACATTGAGGACTTCATCTACTTCAGCCACCACCAGCGGGACGAGCACGGGCGTCTGCACCACTTTGCCCTGAACCCTGCTTTCCGGCACTACACAAAGTTCTTTCTGAAGGAGCTCCTTCGCCTGGGTTCCAAGACCTGTCTCTATTACCCTGTGTACCCACAGCCCCGGGATGGCAAGCTCCAGAGCCCCTACGCCCACTCCCTGACATCTGCCCTTCATTACTTGGTTCCCGTGCGACCACGACGACAGATTGTCTATCCTCTGGAAAAGCTTGGCATCAACGCTCCATCAAAGGCGGTCTCCAAGGATGTGTTGGGTTATGCCTTGAACCACACAAACAGAAAGCTAATGTTGGAACCTAAAATAACTGTCAATGCCAGGATTGTTGTGGTTGGTGCCTCCAGTGTTGGAATTTCCTTCCTAGAGACACTGGTGTTTTGCGCTCACCTGAAATTTAATAATCTCACTCTGATTTCAACGCATGGCCTCCCAGGAAAAAAACTTCTGGGGAATGAACAAAGGAAGTTTTTAGCAAGCGACCACTGTTTTAATGATAAAGATTATGCACTGATGTCACTATGCTCCTGGGTTAATGTGGTGGTGGGCAGAATGACGGGCATAAACCGGGCAGCCAAGCATGTCGTGGTGTCCAAGGACAAAGCTGTGCCGTATGACCACCTCATCCTGTGCACCGGGCAGCAGTACCAGGTCCCGTGTCCATCAGGGGTCGATATCAGCCAACACCCCACAAACCAAGACGTTCCTGACAGCAGCAAGATGCGGTACACAGGACAAGTTCCCTGCAACCTGTTCATGCTCAACGATGAGGAGGACTGCGTGAAGGCCCTGACTTGGATACTGAGCAACTCTGTTACCACAGAAGGGAATGTCATTGTCTACGGGAACACGATCGACACCTATACCACTGTGGAAACACTCTTACACCTGGGTGTGAGAGGCTCCTGCATCTATCTTGTGCACACCCCGCCCAAGTCTACAGTCACCTGCATCAACAACTACTTGGTGGAGAGTGCCGTGGAGGAAGCACTGGGGGCAGCTGGCGTCACCACCTTCTGGGACGCCATCCTGGCCCAGTGGAACCAGGGCCTGAACCCCGACCCCATCCACTGCGCCAGCTTCACCACGCCTACCAAGACTTTCCAGCTCCAGTGCACCATGTTCTTCAGCTTCTGTGAGAAGAATGTAGACTATGAAACATTCAAAGCATTGAATGATGCATGCCTCGTCTATGATGGCCGGCTTGTGATTGACACCAACTTCCACACCAACGATGTTGCCATCAGAGCTGCGGGCCCCCTCACTAAGTTCTCCAACAGATACTACTCAAATGACTGGACTCACAAAAACTTCAGTTCCAAAGAAGTGGGCTTTCAGTTGGCAGCTGCTATGCTCACTCTCTTTGATCCAACCCTTGAGCCTGTGATGGAGCCACCAGCCGATCTGGACTGTCTCATCCCCATGTACAAAGGAGCCAAGATCCAAGGAGGAATTCTTCCTGGGTCCTACCATTACCTGCATATCACCAAGCCGGCCATCCCCATTCCCCTAGAGGTGCGGATGACACAGCCTGATTTTGGTTCAGAAATAGTAACAGGCAGCGCAAAAACTGGGACCTACTTCCGAATTCACATCAACAAGTATAAAATGGTAGAGGACATCACATGCCTTTCCAAGGAGCCTTTCCCAGTCTCCAACTACATCCGCTTGTTCGGCCAGCATGAACAAGCCCTAAACAACCTTTGTGCACGTTACGATAGTGACCAGATCACAGATCTCTACAGCTACTTCACGGAGCCCTGGTGCATGGCCCTGCTCCACGATCGCTTTATCGACCTCAGGAAGGAGCTGCGCCAGGTCCTGGCCTCTGAGCAGGAGGAAGGCCTGCCTTCCATAGAACAGCTGGTGCGCCAGATAGAAGATGAGGAAGTCAACCTCAAGGAAGAGCCCAGGAATTACCTCAGGAGAGTATTCGAGGACACCATCTACCGGCCCCTGGTGGAGAAGAGCATCCTTGACTACCTGCACTACAACCGCTACCACCTGCCCATGTATGCGTGGCCCGGCATCATCTAG

XR_205066.1 Non-coding sequence

LOC101699284 PREDICTED: Heterocephalus glaber uncharacterized LOC101699284 (LOC101699284), misc_RNA.

Length: 490 bp     
>XR_205066.1
TCTTGTGAGTAAAGCTGCTGTGAATATGCATACCAGATGTCTGTGTGAACGCAAGTTTTCACTCTGCTGAGACACATCTCCAAGGGAGCAGTTGCTGAGGGACAAAACCCGCCAAACCGCTTTCCTGCTTGGCTTCCTCCACGACTCGCCCCAGAGGTCCAGAAGTGACCATCCCACTGGTGCCACATACTCACTACCTCTCATTATGGTGTGATCGAGAGCGGCCGAAGCCGTGTGCAATAATATACACGTATAAATATTTGAACAGGAAAAAGAACGTCTGCCTGGTGTAGACCAAGGAAGAAATGCATTTAAACACCTCATGCCACTGGAGGGACCTTGACTTGGAGCCACAGCAGGCAAGGAGTGCTGACAGGGCTTTGATAGCCTGTATTTGCCATGGCGGGCTGCAGTCAGAGCCAGGTATTAATGAGCCCATTGGCCCCAGGCTCCTTCGCCCAGTGCCACCCAGCCCAAGGGGACCTGGATA

XR_205068.1 Non-coding sequence

LOC101701443 PREDICTED: Heterocephalus glaber uncharacterized LOC101701443 (LOC101701443), misc_RNA.

Length: 1221 bp     
>XR_205068.1
CTCGGCTCTCCTGGGCCCAGGCGTTCTGTTGAGGTTTCCGGGGTCTCCACCGAGCCATACCCTCTGCGCTCACCTTCACGGCGTAAGCCACGTGGAGCTGACGTCCTGAGGGCGTCGGGCGGTGGACCAGGCGGTCCTAGGAGAGATAGGCTGGGGGCCGCTGCCCCGAGCCCAGCTACACCGCCTGGCGGTTGCGGTTCTTCTACTGTCAGCCGCGCTAGGGCACATCTGGAACCAAAGCTGCATTTCACTGAGTGTTAAGAGCAGCAGGGCCGGAGATTTAGCTCGGTGGTTCCGTCGCCTGCCTCTCAAGCGCAAGGTCCCGAGTTCGATACACGGTGCCAAAAAAGAACAGCAGGCTCCACAGACAGAACCATTCACTGCTGGGACCTGGAAAATGTAAAGTGTACATGAAAAACAAAACAAAAGCCTGTTTACAAAATCCCCAGCTTCATCTGCAGGTCGAAGCCGAACAGTTTAACCTGTCCCCTCTGGGCGTCCCGGGGCTCCCACCCCCTACCCGCCTTAGACCTCGGTGGTTGGGACGTTTTGGGGACGAGGGGGAAGGGCTATTCAGTATAGCCCACCTGGTTCTGGCAGGAAGGCGACAGCCTGTGTTAAGACACAGAGCTCGGTGGGCCGGGGATTTAGCTCAGTGGTTTCGCCGCCTGCTGCGCAAGCACAAGGACCCAAGTTCAATCCGGGGTACCAAAAAAAAAAAACAGAGCTCGAGGCGGGGATGGGCGTCTTGGCAGTAGTAGTCACCAGAATGTCTTTACTGTATGTATAATCGCCCCGGATAGTGCTGAGAGTTCACTTTACAGCATCTATACGCTGCCCAGGGATGGACATGGAACCGGAGCCGACCCACTTCCAGGCCTGGTAGGCTGGTGTAGAGCTGCTCCCCTTCCTTCTGGTGTCCTATCCCCTCTTCATTCCTGAGAACTCTGGGACGGATCGCTATTCCTGATTTTATGGATGAAGAAGTGAAGAGACAGAAATTAAACAGCCAGCCTGGAGTTACAGAGGCCTTTCAAGCCTAGAAGTGGTGAATTTCCTGGCAGGACCTAAGAGCAACAGCTGCTTCTGAACTGGGGCCCCAACAGTCCAGAGAACATGGATGAGCCCAACTTGGGTGGAGGACAGAAACCTTACTGGAAAGAGGACCTACACCCTAGCCGGCTGCTGACAGCTACCATCTCTACCCTGTGAAGCCAGATC

XM_004840904.1 Coding sequence

Pax1 paired box 1

High confidence: 3 potential gene matches
Length: 1368 bp    Location: 22009733..22017325   Strand: +
>XM_004840904.1
ATGAAGTTCACCCTGGGCCTGGGGTCGCGAGCGTGGAGAGTGTCTTGGGCCCGGGCGGCGGCGGCAGCAGCAGCGGGCTCCCGGGCGGGCAGCGGCGCGCTGGGCGGTGGCGCAGTGCGCCTCTCCAGCCCCCGGCCCCTGCGGCGCGGCTCTCGCCTCGCGCGCGCGCTCCCTCTATGCCTCTCCGGCGGCGGCGGTGGCGCAGCTCTCCCGGATCGCGCAGGGCCCAGCCCCCGCCGCCCCGGCGCCAGGCAGCCGGCCGGCCCGCGCGCCATGGAGCAGACGTATGGAGAAGTGAACCAGCTGGGCGGTGTGTTCGTGAACGGCCGCCCCCTACCCAACGCCATCCGCCTGCGCATCGTGGAGCTGGCGCAGCTGGGCATCCGACCCTGTGACATCAGCCGGCAGCTGCGCGTCTCCCACGGCTGCGTGAGCAAGATCCTGGCTCGCTACAACGAGACCGGCTCCATCCTGCCTGGGGCCATCGGAGGCAGTAAGCCTAGAGTCACCACTCCCAACGTGGTCAAACACATCCGGGACTACAAGCAGGGGGACCCTGGCATCTTTGCTTGGGAGATCCGTGACCGGCTGCTAGCCGACGGCGTCTGCGACAAGTACAACGTGCCCTCTGTGAGCTCCATCAGCCGCATCCTGCGCAACAAGATCGGCAGTCTGACCCAGCCCGGGCCCTACGAGCCCAGCAAGCAGCCACCTCCCCAGCCCGCGCTGCCCTACAACCCCATCTACCAGTACCCCTACCCCAGTCCCGTGTCCCCCACGGGGGCCAAGATGGGCGGCCACCCTGGGGTCCCCGGCTCGGCGGGCCACGTCAGCATCCCGCGGTCGTGGCCCTCGGCGCACTCGGTCAGCAACATCCTGGGCATCCGGACGCTGATGGAGCAAACAGGCGCCCTGGCTGGGAGCGAAGGCGCTGCCTACTCCCCCAAGATGGAAGAGTGGGCCGGGGTGAACCGCACTCCCTTCCCTGCCACTCCTATGGTGAATGGGCTCGAGAAGCCAGCCTTGGAGGCGGACATTAAATACACCCAGTCGGCCTCTGGGCTCTCCGCCGCCGTGGGCGGCTTCCTCCCAGCCTGCGCCTACCCGGCCTCCAACCAGCCCGGCGTGTACAGCGCTCCGGGAGGAGGCTACCTCGCCCCAGGCCCGCCTTGGCCACCCGCGCAGGGACCCCCGCTGGCGTCGCCCGGGGCTGGCGTCTCACTGCACGGTGGGGAGCTCGGTGCAGCGGTGACCTTCAAGCATCCCAGCCGAGAAGGCCCCGACCGGAAGCCCTCTAGCCCCAGCGGCAAGGCTGCGGACTCCCTGGGTAGCTTGCACGGACTGTCACTCCCGGCCACCTCCTCCTAG

XM_004840905.1 Coding sequence

Foxa2 forkhead box A2, transcript variant X1

Length: 1383 bp    Location: 22648594..22645589   Strand: -
>XM_004840905.1
ATGCACTCGGCCTCCAGTATGCTGGGAGCCGTGAAGATGGAAGGACACGAGCCGTCCGACTGGAGCAGCTACTATGCCGAGCCCGAGGGCTACTCCTCCGTGAGCAACATGAACGCCGGCCTGGGAATGAATGGAATGAACACGTACATGAGCATGTCGGCGGCCGCCATGGGCAGCGGCTCGGGCAACATGGGCGCGGGCTCCATGAACATGTCCTCGTACGTGGGCGCGGGCATGAGCCCGTCCCTGGCTGGCATGTCCCCGGGCGCCGGCCCCATGGCAGGCATGGGCGGCACGGCTGGCGCTGCGGGTGTGGCGGGCATGGGGCCGCACCTGAGCCCCAGCCTGAGTCCACTTGGGGGACAGGCGGCAGGGGCCATGGGCGGCCTGGCGCCCTACGCCAACATGAACTCCATGAGCCCCATGTACGGGCAGGCGGGGCTGAGCCGCGCGCGCGACCCCAAGACTTACCGGCGCAGCTACACTCATGCCAAGCCGCCCTACTCTTATATCTCGCTCATTACCATGGCCATCCAGCAGAGCCCCAACAAGATGCTGACGCTGAGCGAGATCTACCAGTGGATCATGGACCTCTTCCCCTTCTACCGGCAGAACCAACAGCGCTGGCAGAACTCCATCCGCCACTCGCTGTCCTTCAACGACTGCTTCCTCAAGGTGCCGCGCTCGCCTGACAAGCCTGGCAAGGGCTCCTTCTGGACCCTGCACCCCGACTCGGGCAACATGTTCGAGAATGGCTGCTACCTGCGGCGCCAGAAACGCTTCAAGTGCGAGAAGCAGCTGGCGCTGAAAGAGGCGGCGGGCGGAGGCAAGAAAGGCGCGGCGGGGAGCTCTGCCACTCAGGCTCCGCTTGGGGAGCCCTCTGGGCCAGCCCCCGAGACGCCGGCGGGCACCGAGTCACCGCACTCAAGCGCGTCTCCCTGCCAGGAGCACAAGCGAGGGCCCCTCGGGGAGCTGAAGGTGCCCCCCACCGCAGGGCTGAGCCCCCCGGAGCCCGCGCCCTCCCCGGGGCAGCAGCCCTCCGCCGCTGCGCACCTGCTGGGCCCGGCGCACCACCCCGGCCTGCCGCCCGAGGCGCACCTGAAACCGGAGCACCACTACGCCTTCAACCACCCCTTCTCCATCAACAACCTCATGTCCTCGGAGCAGCAGCACCACCACAGCCACCATCACCACCAGCCGCACAAAATGGACCTCAAGGCCTACGAACAGGTGATGCACTACCCTGGCTACGGGTCCCCCATGCCAGGCAGCTTGGCCATGGGCCCAGTCACGAACAAAGCGGGCCTGGACGCCTCGCCCCTGGCAGCAGACACTTCCTACTACCAGGGGGTGTACTCGCGGCCCATTATGAACTCCTCTTAA

XM_004840908.1 Coding sequence

Cd93 CD93 molecule

High confidence: 4 potential gene matches
Length: 1965 bp    Location: 22914749..22911491   Strand: -
>XM_004840908.1
ATGGCCAGCCCCAGGGACCTGCTTCTGCTGCTGCTCCTGGGCCAGCCCTGGGTGGGGGCTGCTGCCCACACCACAGAGGCTGACGCAGCGGAGGCTGTGGTGTGTGGAGGGACTGCCTGCTACACGGCCCACTGGGGCAAGCTGAGCGCGGCTGAAGCCCAGGGCGTCTGTAGCCAGAACGGGGGAAACCTGGCCACGGTAAAGACCAAGGAGGAGGCCCGACTCATTCAGCACGCCTTGGCCCAGCTCCTGAAGCCGAGGGCGCCCCTGGCAGCGAGGATGGGCAAGTTCTGGGTGGGGCTCCAGCGGGAGAAGGGCAAGTGCTTGGACCCTGAGCTGCCACTGAAAGGCTTCAGCTGGGTGGGTGGCGGGGAGGACACAGAGTATGCAAATTGGCACAAAGAAGAGCTCAAGAGCTCCTGCGTCTCCAAGCGCTGTGTGGCTCTGCCACTGGACCTGTCCCAGAACCCCCACCCAGACCGCCTCCCCAAATGGTTTGAAGGCCCCTGCGGATCATCAGGCAACCCAGGAGGCAACACCGAGGGGTTTGTGTGCAAGTTCAGCTTCAAAGGCATGTGCCGGCCCCTGGCCCTGGGTGGCCCAGGCCAGGTGAACTACAGCACCCCTTTCAGGGCCACCACCTCCTCACTGGATGCTGTGCCCTTTGGTTCTTTGGCCAGCGTGGCCTGCGAAGCTGGGGCTGAGAATCAGGGCTATGAACTGCTGTGCAGGGAGAAGATGATAGAGGTGTTTGACTGGGGCATTACCGGGCCCCTGTGTGTCAACCCTGAGTTGGGGTGCACCTTCAACAATGGGGGCTGTGAGCAGGACTGCTTCGAGGGGGGTTCTGGCTCTTTCCGCTGTGGCTGCCGGCCTGGCTTCCGGCTGCGGGACGACCTGGTGTCCTGCGCTTCGAGGAACCCGTGCAGCTCTAGCCCCTGCAAGGGGGAGGCCACCTGCGTCTCCAGGCCCCACGAGGACACCTACACATGCCTCTGCCCCCGTGGCTACCAGCTGGATGCAAGACAGCAGGGCTGTGTAGATGTGGACGAGTGCCACGACACACCTTGTGCCCAAGGCTGTGTCAATACAGCTGGGGGCTTCCACTGTGAGTGCTGGCCGGGCTACACAGCTGGTGGCCCTGGGGAGGAGGCCTGTGTGGATGTGGACGAGTGTGCTCTCAACCTTGCGCCCTGTGCCCAAGACTGCACTAACACCGCCGGCTCCTTCCACTGCTCCTGCCAGCCGGGCTATGTCCTGTCAGGGGAGGACGCCACCCAGTGTGAGGACAAGGACGAGTGCGCTGACCCCACGGGCAGCCCCTGCCCAGGCCTGTGCTCCAACGTGCAGGGCTCCTTCCACTGTGGCTGCCTGGTAGGCTTGAAGCTGGCCCCCGATGGGCTCTCCTGTGTCCCAGACCATGCGTCCACAGTGTCCTTGGCTGGGGTTCTGCCAGAGGATGAGCAAGATAGGAAGTGGGGCACCATGCCTCCCGCCACCATGTCTCCCTCCATGCTCGGTCCCACCAGGGGCTCCGAGAGTTTCTCCACGGGTACACTCTCCACAGGAAGGTCCTCCTTGACCTCTGATGTCCCTACCACGTCTGCCCACGCTAAAGTGTCATCTCCCAGTGGGAGCCCTGGCCTTGGGACAGAGCAGGGCACCCCCTTGTCCAAAGCTGCTGCTGGCCATAGCAAGCCAATGGGTAAGGTCTCTGTGGCTGCTCCAAGTGAGGATGGTGAGGACGGGCAAAGGCTGCTGCTGTTCTACATCCTGGGCACGGTGGTGGCCATCTCCCTCCTGCTGGCACTGGCCTTGGGGCTCCTGGTCTGTCGCAAGCGGAGAGCCAAGCGCGAGATGAAAGAAAAGAAGCCGCAGAACGCAGCCGACAGTTACGCCTGGGTCCCCGAGCAGCCTGAGGGCCGAGAGAATCAGTACAGTCCGACACCTGGGTCAGACTGCTGA

XM_004840910.1 Coding sequence

Nxt1 NTF2-like export factor 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 423 bp    Location: 23021680..23023327   Strand: +
>XM_004840910.1
ATGGCATCTGTGGACTTCAAGACCTACGTGGACCAGGCCTGCAGAGCAGCTGAGGAGTTTGTCAACGTCTACTACACCACCATGGATAAGCGCCGGCGCCTGCTGTCCCGCCTCTACATGGGCACGGCCACCTTGGTGTGGAATGGAAACGCTGTTTCCGGACAGGAGTCTTTGAGTGAGTTCTTTGAAATGCTGCCCTCCAGTGAGTTCCAGATCAATGTGGTTGACTGCCAGCCCGTCCATGATGAGGCCACCCCGAGCCAGACCACGGTCCTTGTTGTCATCTGTGGGTCAGTGAAGTTTGAGGGCAACAAACAGCGGGACTTCAACCAGAATTTCATCCTCACTGCCCAGGCCTCTCCCAACAACACGGTGTGGAAAATCGCAAGTGACTGTTTCCGGTTCCAAGACTGGGCTAGCTAG

XM_004841165.1 Coding sequence

Ankrd60 ankyrin repeat domain 60

High confidence: 2 potential gene matches
Length: 1524 bp    Location: 24539851..24529511   Strand: -
>XM_004841165.1
ATGGTGTGCAGGTCCCCTGCAGGAATTGCCCTAACTGGAGCCTGGCAAGTGAGCTTCCCTTCTGGAGGGGCTCACGCCTCGAGGGCGCCCCAGGGTCGCTCCCGCCTCTCTAAGCTGATGGGTTTGATACTGCTTGCAGATGTGAACGGAGGCTCATCGCCGCCTGGTGCCAGCGGATCTGCGAAGGAATCTCGTTTCTGCGCTACGGGGAAAAGAGGTAACAGGTTTCCCACAGCAGCAAACTCGCTGCAAGCTGCAAGCTGCGGGGGCAGAGGGGCTGGGCCGGGCCGGGCGTGGGTTGGAGCGGCCACGGGCTCTGCTGTCCCTGTCCTCTGCTCGGTCCGAAACAAGCGCCAGGCGTCTGCCTCGCTCAACCGCCCCGCGCTCAGCCGGGCCTTTGTCCTCCGCAGCGCGGCCCAGGCACGGGCAGGAAACCGTCAGTGCGCCCGGGCTACACTCGTTCTCGTCCTGTCCTCGCTGGGGTTCAGCCGCTCGCGGGGGTGGACCTATGGTGGGGGAGGCGCGGGGACCTCTTGGAGCGTGCGGAGGTGGCCCGCGGCGGGTGGCAGGGGTGGGCGGTGCCCTCGAGCTGGCTGCGGGCGGACGGGTGTCCCGGGCCGTGCAGCCGCCCTCCTTGAAGGCCTCCGGGCACGCGGGCGGACCCAGCCGCTGGCCATCGCCCCGGAGGCCGTGCCTGACCTGGTCCCCGTCGTCCTCTCCGTGCGGATGAGGCTGGAGGAGACCGGGGATATGTTCCGACTGGCGAACTGCCTCAGCGACATCACCGTGCGGGAACTCAAAGAGGACCTGGACCTGGCGGCCGGCATCCCCTTCAACCTCCAGCGCCTCCAATACCTGGACCAAGGAGATTTACTGGACAACAGCACCCTAAAGTCCCAGGACATCCTGCCTGGGGGTATTCTTTCTCTGTGTGTCTGGCACTATGATGGTTGGATGGATCTGGTTGTGGCGGCAGTGGAAGGAGACCCCAGTAAGCTGTCCTGTCTCGGGATCACTGAAGATTCTTTCTACCGAACTGCGAATTCCAGCCATCTTGAGGGCAACAAGTGGAGGCAGTGGACATCTCAGAGGGCCTTTGTGGTGCTGTACATCACCTCCCACAGAGGTCATTTAGATGCTGTGTGGTACCTTCTAGAACATGGAGCCAGCTGCCGCCGCAGGTCCCCGGTGGGCAGGACGGCCCTGCACGTGGCCTCAGCCATGGGCCGCCTGGACTGCATCACACTCCTGCTGGAGCACGGGGCCTCCATCCTCGACAGGGACGCCCACGGGGAGACACCCATCGCCCTGGCCCGCCACCTGCAACACCAGCAGAGGGAGCGACACATGTTCCTCCTGCACTGGATGGCCAGGTCGGGGGTAAAGGGCCCCAGCGAACTGACCATTCAGCTTTTAAATTCCTGGGCCGTATTTCCTGCTGTCATAGCAAGTGAGATCTGTGTGGACGATGTCTCTCACGGTCTACGTGGCTATGCCCAGCTCAGCAACCTGTTTGACAAATAG

XM_004840951.1 Coding sequence

Stx16 syntaxin 16, transcript variant X11

Length: 897 bp    Location: 24951987..24980047   Strand: +
>XM_004840951.1
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGTTAGCCGAGCAAGTGAGTAGTCACACCACCTCCAGCCCTCTGCATTCACGTAGCATTGCTGCGGAGCTGGACGAGCTTGCCGATGACCGTATGGCACTGGTATCGGGCATTAGCTTAGATCCAGAAGCAGCCATCGGTGTAACAAAACGGTCACCTCCAAAATGGGTGGATGGAGTGGATGAAATACAATATGATGTTGGCCGGATTAAACAGAAGATGAAGGAGTTAGCCAGCCTTCACGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGTGAGGAGGAGCATGCCATTGAAATAACCACTCAGGAGGTCACACAGCTCTTCCACAGGTGTCAGCGTGCAGTGCAGGCCCTGCCGAGCAGGGCCCGGAGGGCCTGCTCCGAGCAGGAGGAGCGACTGCTGCGCAACGTGGTGGCCTCCCTGGCACAGACCCTGCAGGAGCTGTCCACCAGCTTCCGGCACGCACAATCCGGCTACCTCAAGCGCGTGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTTGATACATCAGTACCACTAATGGATGATGGAGACGATAATACTCTGTATGCTCGGGGCTTCACGGATGACCAGCTGGTGTTGGTGGAGCAGAATACACTGATGGTGGAGGAGAGAGCGCGCGAGATCCTCCAGATTGCGCAGTCCATTTCTGACCTGAATGAAATCTTTAGGGACTTAGGAGCCATGATTGTAGAGCAGGGAACGGTCCTTGATAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGCTTGAAACAGCTTCACAAGGCTTTCGGAAGGCAGACCTGA

XM_004840953.1 Coding sequence

Npepl1 aminopeptidase-like 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1572 bp    Location: 24986673..25001764   Strand: +
>XM_004840953.1
ATGGCGAACGTGGGGCTGCAGTTCCAGGCCAGCGCCGGGGACGCGGACCCGCAGAACCGGCCCCTGCTGCTGCTCGGGCAGCTGCACCACCTGCACCGCGTGCCCTGGAGCCACGTCCGCGGGAAGCTGCAGCCCCGGGTCACCGAAGAGCTCTGGCAGGCTGCTCTGGCCACGCTCAACCCCAACCCCACGGACAGCTGTCCCCTCTACCTGAACTACGCCACCGTGGCAGCCTTGCCCTCCAGAGTGAGTCGGCACAACAGCCCCTCGGCTGCCCATTTCCTCACCCGGCTGGTGCGGACCTGTCTGCCACCCGGAGCCCAGCGCTGCATCCTGATGGTCTGTGAGCAGTCTGACATCTTCGCATCAGCCTGCGCCCTGGCCCGGGCCTTCCCACTCTTCACACACCGCTCGGGGGCTTCCCGTCGCTCCGAGAAGAGGACTGTCACCGTGGAGTTTTTCCTGGTGGGACAGGACAACGGGCCAGTGAAAGTGTCCACGTTGCAATGCTTAGTAACTGCCACGGAAGGTGTGCGGCTGGCAGCCCGCATTGTGGACACGCCCTGCAATGAAATGAACACAGACATCTTCCTTGAGGAGATTAACAAAGTTGGAAAAGAGCTGGGAATCGCCCCAACCGTCATCCGGGATGAGGAGCTGAAGACGAGAGGATTCGGAGGGATCTACGGCGTCGGCAAAGCGGCCCTGCACCCCCCGGCCCTGGCCATCCTCAGCCACACCCCTGACGGAGCCACGCAGACCATCGCATGGGTGGGCAAGGGCATCGTCTATGACACCGGGGGCCTCAGCATCAAGGGGAAGACCACCATGCCGGGCATGAAGCGAGACTGCGGAGGTGCTGCAGCCATCCTGGGGGCCTTCAGAGCTGCCATCAAGCAGGGTTTCAAAGACAACCTCCACGCCGTGTTCTGCTTGGCAGAGAATGCTGTGGGGCCCAATGCCACCAGGCCAGATGACATCCACCTGCTGTACTCTGGAAAGACCGTGGAAATCAACAACACAGATGCCGAGGGCAGGCTGGTGCTGGCCGATGGCGTGTCTTATGCCTGCAAAGACCTGGGGGCCGACATCATCCTGGACATGGCCACACTGACCGGGGCTCAGGGCATCGCCACGGGGAAGTACCATGCTGCAGTGCTCACCAACAGTGCTGAGTGGGAAGCGGCCTGCGTGAAGGCCGGCCGGAAGTGCGGGGACCTGGTGCACCCCCTGGTCTACTGCCCCGAGCTGCACTTCAGCGAGTTCACCTCGGCCGTGGCTGACATGAAGAACTCGGTGGCGGATCGGGACAACAGCCCCAGCTCCTGTGCTGGCCTCTTCATCGCCTCGCACATTGGCTTCGACTGGCCTGGGGTCTGGGTCCACCTGGACATCGCTGCACCGGTGCATGCTGGCGAGCGAGCTACCGGCTTTGGCGTGGCCCTGCTGCTGGCGCTCTTCGGCCGAGCCTCCGAGGACCCCCTGCTGAACCTGGTGTCCCCACTGGGCTGGGAGCCTGCCGAACAGGAGGCTGCTGTGGGGAGGGACTCCAAGAGGCGCAGGCTTGTGTGA

XM_004840575.1 Coding sequence

LOC101705096 chromosome unknown open reading frame, human C20orf112, transcript variant X2

Length: 1311 bp    Location: 157657..185545   Strand: +
>XM_004840575.1
ATGAATGACTCCACATGGATGTCCGCTGACCCACACCTGGCCTCCAGCCTGAGCCCCAGCCAGGACGAGAGGATGCAGAGCCCGCAGAACCTCCACAACCAAGAGGATGATGATTCCTCCTCCGAGAGTGGCAGTGGCCATGGCTCCTCTACCCTAAACCCATCCACATCAAGCAGCACACAGGGCGACCCCGCCTTCCCTGAATTGAACGGCAACGGCGCTGCGGCCCCCATGGACTTCACTTCCACTGCTGAGGATCAGCCCATCAACCTGTGTGACAAGCTCCCACCAGGCACAGCACTGGGCACACCCTCCTACTCCTCCGATGGCTGTGGCACTGATGGGCTGCGGAGCCGTGTCAAATATGGGGTGAAGGCTACTCCTGAGTCACCCCCCTACAGCTCTGGGAGCTACGATTCCATCAAGACAGAGGTCAGTGGCTGCCCTGAGGATTTGACGGTAGGCCGGGCGCCCACAGCAGATGATGATGATGATGACCATGATGACCACGAGGACAATGACAAGATGAATGACTCTGAGGGCATGGACCCTGAGCGTCTCAAGGCCTTCAACATGTTTGTGCGTCTCTTTGTGGATGAGAACCTGGACCGCATGGTGCCCATTTCCAAGCAGCCCAAGGAGAAGATCCAGGCCATCATCGAGTCTTGTAGCCGGCAGTTCCCTGAGTTCCAGGAGCGGGCCCGAAAGCGCATCCGTACATACCTCAAGTCCTGCCGACGTATGAAGAAGAATGGCATGGAGATGACCAGACCCACGCCTCCCCACCTAACCTCGGCCATGGCAGAAAACATCCTAGCAGCTGCCTGTGAGAGCGAGACAAGAAAAGCAGCCAAAAGGATGCGCCTGGAGATCTACCAGTCCTCGCAGGATGAGCCCATAGCCCTGGACAAGCAACACTCCCGGGACTCTGCAGCCATCACCCACTCCACCTACACACTGCCAGCCTCCTCCTACTCCCAGGACCCTGTGTATGTCAACGGCGGCCTCAACTACAGCTACCGTGGCTATGGGGCTTTGAGCAGCAACCTGCAGCCCCCTACTTCCCTCCAGACAGGAAATCACAGTAACGGGCCCACAGACCTCAGCATGAAAGGCGGGTCCTCCACCACCTCTACCACGCCCACACCCACCCCCTCCAGCAACAGCACCAGCAGGACCATGCCCACTGCCCAGCTCAGCCCCACTGAGATCAGTGCTGTGCGGCAGCTCATCGCTGGCTACCGGGAGTCAGCGGCCTTCCTGCTGCGCTCTGCAGATGAACTGGAAAACCTCATTTTACAGCAGAACTGA

XM_004840577.1 Coding sequence

Asxl1 additional sex combs like 1 (Drosophila), transcript variant X2

Length: 4599 bp    Location: 257643..189866   Strand: -
>XM_004840577.1
ATGAAGGACAAACAGAAGAGGAAGAAGGAACGCACGTGGGCCGAGGCCGCGCGCCTGGTATTAGAAAACTACTCAGATGCTCCAATGACACCAAAACAGATTCTACAGGTCATAGAGACAGAAGGACTAAAGGAAATGAGTGGGACATCCCCTCTTGCGTGCCTCAATGCCATGCTACATTCCAATTCAAGAGGAGGAGAAGGGCTGTTTTATAAATTACCTGGTCGAATCAGCCTTTTTACACTCAAGAAGGATGCCCTGCAGTGGTCTCGAAATACAGCTGCAATGGAAGGAGAGGAGCCAGAGGACTCAGCTGATGTAGAGAGCTGTGGATCTAATGAAGCCAGCACTGTGAGTGGTGAAAATGATGTATCTCTTGATGAAACATCTTCAAATGCATCCTGTTCTACAGAATCTCAGAATAGACCTCTTTCCAGTCCCAGGGACAACTATAGAGCTTCCTCTCAGGCAAACAAACAAAAGAAAAAGACTGGGGTGATGTTGCCTCGAGTTGTTCTGACTCCTCTGAAGGTAAATGGGGCCCACATGGAATCTGCAGCAGGGTTCTCAGGCCGCCACGCCGATGGCGAGAGCGGCAGCCCATCCAGCAGCAGCAGCGGCTCTTTGGCCTTGGGCAGCGCTGCTATTCGTGGCCAGGCCGAGGTCACCCGGGACCCTGCCCCGCTCCTGAAAGGCTTCCGGAAGCCGGCCACAGGTCAAATGAAGCGCAATAGAGGAGAAGAGATAGATTTTGAGACTCCTGGGTCTATTCTTGTCAACACCAACCTCCGTGCCCTGATAAACTCTCGGACCTTCCATGCCTTGCCATCACACTTCCAGCAGCAGCTCCTCTTCCTTCTTCCTGAAGTAGACAGACAGGTGGGAACAGATGGCCTGTTGCGTCTCAGCAGTAGTGCACTTAATAATGAGTTTTTCACCCATGCAGCTCAGAGCTGGAGGGAACGCCTGGCTGATGGTGAATTCACCCATGAGATGCAAGTCAGGATTCGACAGGAAATGGAGAAGGAGAAGAAGGTAGAACAGTGGAAAGAAAAGTTCTTTGAAGACTATTATGGACAGAGATTGGGTTTGACTAAAGAAGAATCATTGCAGCAGAATGTGAGCCAGGAGGTGACTGAAGTCATGAGTGGGTTGCATGTCCCAGGAGAATCAGCACAGCCACAGCATGGTCCAGCAGCCCGCCAACGAGATGGGCATTTTAAGAAACGATCTCGGCCAGATCTCCAAACCAGAGGCAGAAGGAGTCTGTGCAAAAAACAGGAGCCAGAACAAGCAGGGGTTGCTAAGGAGGCAAACTCTGTGGCACCAGACATTCTACTCTCTGAGGATGGGGAGGCTAAAACTGGCTCGGCCAGGGTGAGCAGTCCCCCCCTGCCAAGCGTATCCTCTGCAGCATCCGGCCAAGGGGTTCCTGAATGCCCTGGTGAACTTGTGGCTTCCCACATCCAGACAGAGGCGGATAACTTGGCACATGCCTCTGCATCTCCAGACAGAATTCCCTGCTTGTCTCAGGATACTGTGGATCAGGAACCCAAGGATCAGAAAAGGAAATCCTTTGAGCAGGCAGCCTCTGCATCCTTTCCCGAAAAGAAGCCCCGGCTTGAAGACCGTCAGTCCTTTCGTAACACAATTGAAAGTGTTCACACCGAAAAGCCACAGCCCACTAAAGAGGAGCCCAAAGTCCCACCCATCCGGATTCAACTTTCACGTATCAAACCACCCTGGGTGGTTAAAGGTCAGCCCACTTACCAGATATGCCCCCGGATCATCCCCATCACGGAGTCCTCCTGCCGGGGCTGGACTGGTGCCAGAACCCTTGCAGACATTAAAGCCCGTGCTTTGCAGGCCCGAGGGACAAGAGGCCACCACTGTCATCGAGAGACGGCCACCACTGCCATCGGAGGGGGGGGTGGCCCGGGTGGAGGTGGCAGCGGGGCCACCGATGAGGGAGGTGGCAGAGGCGGCAGCAGTAGTGATGGTGGTGAGGCCTGTGGTCACTCTGAGCCCAGGGGAGCCTCGAGCACCCCCAGAGAGTGTACGTCAGATCTACAGCGAACACAACTACTGCCGCCTTGTCCTCTAAATGAGGAGCACACACAGGCTGGAACTGCCATGTCTAGGGCCAAAAGAGAAGAATTGGCTTCTCACAGAAAGGAGGAAAACTGCCCACTGCAGAGGGTTCCAGGTATACTCACAAGTGGCCTGGATGATGCCTCCCAGCCCCCCATTGCTCCCACTGGGGACCAGCCTTGCCAGGCTTTACCATTACTGTCTTCCCAAACCCCAGTGGCTGAGAAGTTAGCAGAGCAGCCTGAGTTGTATCAAGATACTAGAACTCAGTGTGAATCTGGCACCACTTCCTGGGAAGTGGGCAATGAAGAACAAGGAGCCACTGTTCCTTTAGAAAATGGTCCTGTACAGTCTCTATTGCTAGATACATTAGCAAAAGGAACTGACCAGACTCTCAACAGTAATCCTACCATGAAGGATCCTATAAATGTGACCCCAAGTTCCACACCTGAATTATCACTGACTGCCTTCCTACAGGACAGACCATTTGATGACAAATTAGGACTTGGTGACTCAGGCCTACCCATGAGGGAAAGTTACAGTAGACAAGAAAGCTTGAGAACTGAGGCTCTTTCTTCCAATAATGCTGCTCTTTGGACTCCCATCCTGTTGAATGACAGGGTAGTGAACCAGTCTGAGCCAGAATCTAGAGAAAACTTTCCATCTGTGGAGCCCCAGGTTGGAGAAGAGTGGGAGAAAGCAGCTCCCCTCATTGCCTTGTTGTCTGGGAGCTTGGCAGCTGAGGAGGGTGTGGCTCCCCCTGACAAGTGTACTTCACTCTGGACTTTGCCACCGCAAGGAGGCATAGGTGACAGGGACACCGAGGACAAGCAAGTAGACATTGAAAAGCTGAAAATCAATGAAGACTCTGAAGCACTGAGTCCTCATAGCGAATCCACAGATACTGTGTCTGACTTTGAAGGCCACCTGACTGAGGACAGCAGTGAGCCTGCAGCTAGTGAAGCCACAATGAAGAAGGAATCATTGATGGAAAAGGATACCAAGCATGATTGGAACCAGTCTGCCTCACTGTCCAAGGTACACAGTGACTTGAGTCTGGTTACAAGGACAGAGGGGGTGGTTACTTCTCAGAGCTGGGTTTCTCGAGTATGTGCGGTCCCCCAGAAGATCCCAGACTCCCTCTTGCTGGCCAGTAGTGAGTACCAGCCAAGACCCATGTGGTTGGCCAGGCCTGTGTCTGCAGTGGAGGCCAACAACCCACTTGTGATGCAATTGCTACAGGGTAACTTGCCCCTAGAGAAGGTTCTTCCTCCAGCGCATGGTGGCAGCAAGCCAGAATCCCCACAACTGCCACTTACAAAAGGACAGAGCCATGGTGGTCCCCTGGGCATAGGATCCTTGCATAATCCTGGGGAAAACAGTCACACAATTGGCAAAATCAGCCCTGGTTCTTTAAGAGTGTTGAAGGGTCCTCTTCAGTCTGAGAGTTGTGAAGCAAACAGTCTTGGCAGGGTAGAGGCCACCCAGACTCCTGGAGCACCCCAGATTTCCAAGTTGGTTCCAAGTCTAGACTCCCCACAGCCAGTGACAAATCTGATGACCTGTTCTGGGAAACTGGAAGAAGTGGATTCCAAAGAGCAGCTGTCTTCCTTTAATTTTGAAGATAAGGGTGTCCAGGATGCATCCCGGTGCAGTAATTCACATGCTGCTTCAAGTCCAGGAGATCTCACTACCTCGAGAGCACCTTGTTTCTCATCTCCAAATGTGATCTCTTTTGGTCCAAAGCAGCCAGTTGGGGCTCTGAGTAATGTTGGAGGCCAAGGGAAAAAGCTTTTTGGCCCTAGGAATATGGCTGCAACCATTCAGTGTCCCAGGCCTGCAGACTCAACACCGCTGCCTGCTGATGTCCCTCCAGTTTTTCCCAGTAGGAAGTTGGGACCGAGCAAAAACTCTTTATCTGATGGGGTACAGACTGCAAAGGAAGACTGGGTTCCAAAGCCACCACCTGCCTCTGTTAGCATCAAGAATGAAAAAACTTCTGTGGGGGCTCCTCTTAAGGCAGATGCAGAGAACAGGAAAGCTGCTGGGCACAGTCCTCTGGAGCTGGTGGGTCATTTACAAGGGATGCCCTTTGTCATGGACTTGCCCTTTTGGAAGTTACCCCGAGAGCCAGGGAAAGGTCTCAGTCAGCCTCTGGAGCCTTCTTCCATCCCCTCCCAGCTTAACATCAAGCAGGCTTTTTATGGGAAGCTTTCTAAACTCCAGCTGAGTTCCACCAGCTTTAATTACTCTTCCAGCTCACCCACCTTTCCCAAAAGCCTTGCTGGAAGTGTGGTGCAGCTGAGCCACAAAGCAAACTTTGGTGCAAGCCACAGTACATCACTGTCCTTGCAGATGTTCACTGACAGCAGCACGGTGGAAAGTATCTCACTTCAGTGTGCATGCAGCCTGAAAGCCATGATCATGTGCCAAGGCTGTGGTGCATTCTGTCATGATGACTGTATTGGACCCTCAAAGCTCTGTGTATTGTGCCTTGTGGTGAGATAA

XM_004840578.1 Coding sequence

Asxl1 additional sex combs like 1 (Drosophila), transcript variant X3

High confidence: 4 potential gene matches
Length: 4518 bp    Location: 255668..189866   Strand: -
>XM_004840578.1
ATGACACCAAAACAGATTCTACAGGTCATAGAGACAGAAGGACTAAAGGAAATGAGAAGTGGGACATCCCCTCTTGCGTGCCTCAATGCCATGCTACATTCCAATTCAAGAGGAGGAGAAGGGCTGTTTTATAAATTACCTGGTCGAATCAGCCTTTTTACACTCAAGAAGGATGCCCTGCAGTGGTCTCGAAATACAGCTGCAATGGAAGGAGAGGAGCCAGAGGACTCAGCTGATGTAGAGAGCTGTGGATCTAATGAAGCCAGCACTGTGAGTGGTGAAAATGATGTATCTCTTGATGAAACATCTTCAAATGCATCCTGTTCTACAGAATCTCAGAATAGACCTCTTTCCAGTCCCAGGGACAACTATAGAGCTTCCTCTCAGGCAAACAAACAAAAGAAAAAGACTGGGGTGATGTTGCCTCGAGTTGTTCTGACTCCTCTGAAGGTAAATGGGGCCCACATGGAATCTGCAGCAGGGTTCTCAGGCCGCCACGCCGATGGCGAGAGCGGCAGCCCATCCAGCAGCAGCAGCGGCTCTTTGGCCTTGGGCAGCGCTGCTATTCGTGGCCAGGCCGAGGTCACCCGGGACCCTGCCCCGCTCCTGAAAGGCTTCCGGAAGCCGGCCACAGGTCAAATGAAGCGCAATAGAGGAGAAGAGATAGATTTTGAGACTCCTGGGTCTATTCTTGTCAACACCAACCTCCGTGCCCTGATAAACTCTCGGACCTTCCATGCCTTGCCATCACACTTCCAGCAGCAGCTCCTCTTCCTTCTTCCTGAAGTAGACAGACAGGTGGGAACAGATGGCCTGTTGCGTCTCAGCAGTAGTGCACTTAATAATGAGTTTTTCACCCATGCAGCTCAGAGCTGGAGGGAACGCCTGGCTGATGGTGAATTCACCCATGAGATGCAAGTCAGGATTCGACAGGAAATGGAGAAGGAGAAGAAGGTAGAACAGTGGAAAGAAAAGTTCTTTGAAGACTATTATGGACAGAGATTGGGTTTGACTAAAGAAGAATCATTGCAGCAGAATGTGAGCCAGGAGGTGACTGAAGTCATGAGTGGGTTGCATGTCCCAGGAGAATCAGCACAGCCACAGCATGGTCCAGCAGCCCGCCAACGAGATGGGCATTTTAAGAAACGATCTCGGCCAGATCTCCAAACCAGAGGCAGAAGGAGTCTGTGCAAAAAACAGGAGCCAGAACAAGCAGGGGTTGCTAAGGAGGCAAACTCTGTGGCACCAGACATTCTACTCTCTGAGGATGGGGAGGCTAAAACTGGCTCGGCCAGGGTGAGCAGTCCCCCCCTGCCAAGCGTATCCTCTGCAGCATCCGGCCAAGGGGTTCCTGAATGCCCTGGTGAACTTGTGGCTTCCCACATCCAGACAGAGGCGGATAACTTGGCACATGCCTCTGCATCTCCAGACAGAATTCCCTGCTTGTCTCAGGATACTGTGGATCAGGAACCCAAGGATCAGAAAAGGAAATCCTTTGAGCAGGCAGCCTCTGCATCCTTTCCCGAAAAGAAGCCCCGGCTTGAAGACCGTCAGTCCTTTCGTAACACAATTGAAAGTGTTCACACCGAAAAGCCACAGCCCACTAAAGAGGAGCCCAAAGTCCCACCCATCCGGATTCAACTTTCACGTATCAAACCACCCTGGGTGGTTAAAGGTCAGCCCACTTACCAGATATGCCCCCGGATCATCCCCATCACGGAGTCCTCCTGCCGGGGCTGGACTGGTGCCAGAACCCTTGCAGACATTAAAGCCCGTGCTTTGCAGGCCCGAGGGACAAGAGGCCACCACTGTCATCGAGAGACGGCCACCACTGCCATCGGAGGGGGGGGTGGCCCGGGTGGAGGTGGCAGCGGGGCCACCGATGAGGGAGGTGGCAGAGGCGGCAGCAGTAGTGATGGTGGTGAGGCCTGTGGTCACTCTGAGCCCAGGGGAGCCTCGAGCACCCCCAGAGAGTGTACGTCAGATCTACAGCGAACACAACTACTGCCGCCTTGTCCTCTAAATGAGGAGCACACACAGGCTGGAACTGCCATGTCTAGGGCCAAAAGAGAAGAATTGGCTTCTCACAGAAAGGAGGAAAACTGCCCACTGCAGAGGGTTCCAGGTATACTCACAAGTGGCCTGGATGATGCCTCCCAGCCCCCCATTGCTCCCACTGGGGACCAGCCTTGCCAGGCTTTACCATTACTGTCTTCCCAAACCCCAGTGGCTGAGAAGTTAGCAGAGCAGCCTGAGTTGTATCAAGATACTAGAACTCAGTGTGAATCTGGCACCACTTCCTGGGAAGTGGGCAATGAAGAACAAGGAGCCACTGTTCCTTTAGAAAATGGTCCTGTACAGTCTCTATTGCTAGATACATTAGCAAAAGGAACTGACCAGACTCTCAACAGTAATCCTACCATGAAGGATCCTATAAATGTGACCCCAAGTTCCACACCTGAATTATCACTGACTGCCTTCCTACAGGACAGACCATTTGATGACAAATTAGGACTTGGTGACTCAGGCCTACCCATGAGGGAAAGTTACAGTAGACAAGAAAGCTTGAGAACTGAGGCTCTTTCTTCCAATAATGCTGCTCTTTGGACTCCCATCCTGTTGAATGACAGGGTAGTGAACCAGTCTGAGCCAGAATCTAGAGAAAACTTTCCATCTGTGGAGCCCCAGGTTGGAGAAGAGTGGGAGAAAGCAGCTCCCCTCATTGCCTTGTTGTCTGGGAGCTTGGCAGCTGAGGAGGGTGTGGCTCCCCCTGACAAGTGTACTTCACTCTGGACTTTGCCACCGCAAGGAGGCATAGGTGACAGGGACACCGAGGACAAGCAAGTAGACATTGAAAAGCTGAAAATCAATGAAGACTCTGAAGCACTGAGTCCTCATAGCGAATCCACAGATACTGTGTCTGACTTTGAAGGCCACCTGACTGAGGACAGCAGTGAGCCTGCAGCTAGTGAAGCCACAATGAAGAAGGAATCATTGATGGAAAAGGATACCAAGCATGATTGGAACCAGTCTGCCTCACTGTCCAAGGTACACAGTGACTTGAGTCTGGTTACAAGGACAGAGGGGGTGGTTACTTCTCAGAGCTGGGTTTCTCGAGTATGTGCGGTCCCCCAGAAGATCCCAGACTCCCTCTTGCTGGCCAGTAGTGAGTACCAGCCAAGACCCATGTGGTTGGCCAGGCCTGTGTCTGCAGTGGAGGCCAACAACCCACTTGTGATGCAATTGCTACAGGGTAACTTGCCCCTAGAGAAGGTTCTTCCTCCAGCGCATGGTGGCAGCAAGCCAGAATCCCCACAACTGCCACTTACAAAAGGACAGAGCCATGGTGGTCCCCTGGGCATAGGATCCTTGCATAATCCTGGGGAAAACAGTCACACAATTGGCAAAATCAGCCCTGGTTCTTTAAGAGTGTTGAAGGGTCCTCTTCAGTCTGAGAGTTGTGAAGCAAACAGTCTTGGCAGGGTAGAGGCCACCCAGACTCCTGGAGCACCCCAGATTTCCAAGTTGGTTCCAAGTCTAGACTCCCCACAGCCAGTGACAAATCTGATGACCTGTTCTGGGAAACTGGAAGAAGTGGATTCCAAAGAGCAGCTGTCTTCCTTTAATTTTGAAGATAAGGGTGTCCAGGATGCATCCCGGTGCAGTAATTCACATGCTGCTTCAAGTCCAGGAGATCTCACTACCTCGAGAGCACCTTGTTTCTCATCTCCAAATGTGATCTCTTTTGGTCCAAAGCAGCCAGTTGGGGCTCTGAGTAATGTTGGAGGCCAAGGGAAAAAGCTTTTTGGCCCTAGGAATATGGCTGCAACCATTCAGTGTCCCAGGCCTGCAGACTCAACACCGCTGCCTGCTGATGTCCCTCCAGTTTTTCCCAGTAGGAAGTTGGGACCGAGCAAAAACTCTTTATCTGATGGGGTACAGACTGCAAAGGAAGACTGGGTTCCAAAGCCACCACCTGCCTCTGTTAGCATCAAGAATGAAAAAACTTCTGTGGGGGCTCCTCTTAAGGCAGATGCAGAGAACAGGAAAGCTGCTGGGCACAGTCCTCTGGAGCTGGTGGGTCATTTACAAGGGATGCCCTTTGTCATGGACTTGCCCTTTTGGAAGTTACCCCGAGAGCCAGGGAAAGGTCTCAGTCAGCCTCTGGAGCCTTCTTCCATCCCCTCCCAGCTTAACATCAAGCAGGCTTTTTATGGGAAGCTTTCTAAACTCCAGCTGAGTTCCACCAGCTTTAATTACTCTTCCAGCTCACCCACCTTTCCCAAAAGCCTTGCTGGAAGTGTGGTGCAGCTGAGCCACAAAGCAAACTTTGGTGCAAGCCACAGTACATCACTGTCCTTGCAGATGTTCACTGACAGCAGCACGGTGGAAAGTATCTCACTTCAGTGTGCATGCAGCCTGAAAGCCATGATCATGTGCCAAGGCTGTGGTGCATTCTGTCATGATGACTGTATTGGACCCTCAAAGCTCTGTGTATTGTGCCTTGTGGTGAGATAA

XM_004840582.1 Coding sequence

Pofut1 protein O-fucosyltransferase 1, transcript variant X2

Length: 1173 bp    Location: 364243..337959   Strand: -
>XM_004840582.1
ATGGGCGCCGCCGCGTGGGCACTGCCGCCCTTGCTGCTGCGTGTGTCTCTTCTGCTACTGCTTCTGCAGCTCCCGGGGCTGCCCGCGGGCTCCTGGGACCCGGCTGGTTACCTGCTCTACTGCCCGTGCATGGGGCGCTTTGGGAACCAGGCCGATCATTTCTTGGGCTCCCTTGCATTTGCAAAGCTACTGAATCGCACCTTGGCTGTACCTCCATGGATTGAGTACCAGCATCATAAACCTCCCTTCACCAATCTGCATGTGTCCTACAAGAAATACTTCAAGCTGGAGCCCCTCCAGGCCTACCATCGGGTCATCAGCCTGGAGGACTTCATGGAGAAGCTGGCACCCACCTATTGGCCTCCTGAGAAGCGGGTGGCATACTGCTTTGAGGTAGCAGCTCAGCGAAGCCCTGATAAGAAGACGTGCCCCATGAAGGAAGGAAACCCCTTTGGCCCATTCTGGGACCAGTTTCACGTGAGTTTCAACAAGTCGGAGCTTTTTGCAGGCCTTTCCTTCACCGCCTCCTATAAAGAACAGTGGATCCAGAGATTTTCACCAAAGGAACATCCGGTGCTTGCTCTACCAGGGGCCCCAGCACAGTTCCCCATCCTGGAAGAACACAGGTCACTCCAGAAGTACATGGTATGGTCAGACGAGATGGTGAAGATGGGAGAATCCCAGATCCGCAACCACCTCATCCGGCCCTATGTGGGCATTCATCTGCGCATTGGCTCTGACTGGAATGCCTGTGCTATGCTGAAGGATGGCACCGTGGGCTCGCACTTCATGGCTTCTCCACAGTGTGTGGGCTACAGCCGCGTCACGGCAGCCCCACTTACCATGACCATGTGCCTCCCTGACCTGAAGGAAATCTGGCGGGCTGTGAAGCTCTGGGTGAGGGCGCTGAGCGCCCAGTCGATCTACATTGCCACTGATTCTGAGAGCTATGTGCCGGAGATCCAGCAGCTCTTCAAAGAGAAGGTGAAGGTGGTGAGCCTCAAGCCAGAGGTGGCCCAGATCGACCTGTACATCCTTGGCCAAGCTGACCACTTTATTGGCAATTGTGTGTCATCTTTCACTGCCTTCGTGAAGCGCGAGCGGGATCTTCAGGGGAAGCAGTCCTCTTTCTTCGGCATGGACAGGCCCCCTCAACTGCGAGACGAGTTCTGA

XM_004841143.1 Coding sequence

LOC101713894 zinc finger protein PLAGL2-like

Length: 1263 bp    Location: 364411..374509   Strand: +
>XM_004841143.1
ATGACCACATTTTTCACGAGCGTCCCTCCCTGGATTCAAGATGCAAAGCAGGAGGAGGAAGTGGGCTGGAAACTAGTTCCCAGGCCTCGGGGCCGGGAGGCAGAGAGTCAAGTGAAGTGCCAATGTGAAATCTCGGGGACACCATTCTCAAATGGGGAGAAGCTAAGGCCTCATAGCCTCCCCCATCCAGAGCAGAAACCATATAGCTGCCCTCAGCTGCACTGTGGGAAGGCTTTTGCTTCCAAGTATAAGCTGTATAGGCACATGGCCACCCACTCAGCCCAGAAACCCCACCAGTGCATGTACTGTGATAAGATGTTTCACCGCAAGGACCATCTGCGCAACCACTTGCAGACCCACGACCCGAACAAAGAGGCCCTCCACTGTTCTGAGTGTGGTAAGAATTATAATACAAAGCTGGGCTATCGTCGCCAACTGGCTATGCATGCTGCCAGCAGCGGTGACCTCAGCTGCAAGGTGTGCCTGCAGACCTTTGAGAGTACCCAGGCCTTGCTAGAGCACCTGAAAGCCCACTCACGCCGGGTAGCAGGTGGTGCCAAGGAAAAGAAGCACCCCTGTGACCACTGTGACCGGCGGTTCTATACTCGTAAAGATGTGCGGCGGCATCTGGTGGTGCACACAGGCCGCAAGGACTTCCTGTGCCAGTACTGTGCCCAGCGGTTTGGCCGCAAGGACCACCTGACTCGTCATGTTAAGAAGAGCCACTCTCAGGAGCTGCTCAAGATCAAGACAGAGCCAGTGGACATGTTAGGCCTACTCAGCTGCAGCTCCACAGTCAGCGTGAAGGAAGAGCTGAGCCCTGTACTATGCATGGCCTCTCGGGACATGATGGGGGCCAAGGCTTTTCCTGGCATGTTGCCCATGGGCATGTATGGTACCCATATCCCTAACATGCCCACCACGGGCATGCCACACTCCCTGCTAGATGAAGCACTGCTCACCAAGAGCCCCGCCAACCTCTCTGAGGCCCTCTGCGCTGCTAATGTGGACTTTTCCCACTTACTGGGCTTTCTTCCACTCAATCTGCCCCCATGTAACCCACCTGGGGCCACAGGAAGCCTGGTCATGGGCTACTCCCAGGCTGAGGCACAGCCCCTGCTCACCACTTTGCAAGCTCAGCCTCAAGATTCCCCAGGAACTGGGGGACCACTGAACTTCGGGCCTCTGCACTCCTTGCCTCCTGTCTTCACTTCTGGCCTGAGTACTACCACCCTGCCTCATTTCCACCAAGCATTCCAGTAG

XM_004840584.1 Coding sequence

Tm9sf4 transmembrane 9 superfamily protein member 4, transcript variant X1

High confidence: 4 potential gene matches
Length: 1935 bp    Location: 438767..402111   Strand: -
>XM_004840584.1
ATGGAAATGAAATCATACAAGGTTTGGCTGCCATGGTCTCTGCTACTTCTTTCTCTCATGTATCAAACAAGCGCCTTCTATGTCCCAGGGGTTGCGCCAATCAACTTCCACCAGAACGACCCTGTAGAAATCAAGGCTGTGAAGCTCACCAGCTCTCGAACCCAGCTACCTTATGAGTACTACTCATTGCCCTTCTGCCAGCCCAGCAAAATAACCTACAAAGCAGAGAATCTGGGAGAGGTGCTGAGAGGGGACCGGATTGTCAACACCCCTTTCCAGGTTCTCATGAACAGTGAGAAGAAGTGTGAAGTTCTATGCAGCCAGTCCAGCAAGCCAGTAACCCTGACAGTGGAACAGAGCAGGCTCGTGGCTGAGCGCATCACAGAAGACTACTATGTTCACCTCATTGCTGACAACCTGCCAGTGGCCACCCGGCTGGAGCTGTACTCCAGCCGTGACAGTGATGACAAGAAGAAAGAAAAAGATGTGCAGTTTGAACATGGCTACCGGCTCGGCTTCACAGACGTCAACAAGATCTACCTGCACAATCACCTTTCGTTCATCCTTTACTACCACCGGGAAGATATGGAAGAGGACCAGGAACATACATACCGTGTCGTCCGCTTCGAGGTGATTCCCCAGAGCATCAGGCTGGAGGACCTCAAAACAGATGAGAAGAGTTCATGTACTCTGCCTGAGGGTACCAACTCCTCACCCCAAGAGATTGACCCTACCAAGGAGAATCAGCTGTACTTCACCTACTCTGTTCACTGGGAGGAAAGTGACATCAAATGGGCCTCTCGCTGGGACACTTACCTGACCATGAGTGATGTGCAGATCCACTGGTTTTCTATCATTAACTCTGTCGTGGTGGTCTTCTTCCTATCAGGCATCCTGAGCATGATTATCATTCGGACCCTCCGGAAGGACATCGCCAACTATAACAAGGAAGATGACATTGAAGACACTATGGAAGAATCTGGGTGGAAGCTGGTACACGGTGATGTCTTCAGGCCACCCCAATACCCCATGATCCTCAGCTCCCTGCTGGGGTCAGGCATTCAGCTCTTCTGTATGATCCTGATCGTCATCTTTGTGGCCATGCTTGGGATGCTGTCGCCTTCCAGCCGGGGAGCTCTCATGACCACAGCCTGCTTTCTCTTCATGTTCATGGGGGTGTTTGGTGGATTTTCTGCTGGCCGTTTGTACCGCACTCTAAAAGGTCATCGGTGGAAGAAAGGAGCCTTCTGTACGGCAACACTATACCCTGGTGTGGTTTTTGGCATCTGCTTCATACTGAATTGCTTTATCTGGGGAAAGCACTCGTCAGGAGCGGTACCTTTTCCTACCATGGTTGCTCTGCTCTGCATGTGGTTTGGGATCTCCCTGCCTCTTGTCTACTTGGGGTACTACTTCGGCTTCCGCAAGCAGCCATATGACAACCCTGTACGTACCAACCAGATTCCCCGGCAGATTCCTGAACAGCGGTGGTACATGAATCGATTTGTGGGAATTCTCATGGCTGGGATCCTCCCCTTCGGTGCCATGTTCATCGAGCTGTTCTTCATCTTCAGTGCCATCTGGGAGAATCAATTCTATTACCTCTTTGGCTTCCTATTCCTTGTTTTCATCATCCTGGTGGTATCCTGTTCACAAATCAGCATCGTCATGGTGTACTTCCAGCTGTGTGCAGAGGATTACCGCTGGTGGTGGAGGAATTTTCTAGTCTCCGGGGGATCTGCATTCTACGTCCTGGTCTACGCCATCTTTTATTTTGTTAACAAGCTGGACATCGTCGAATTCATCCCTTCTCTCCTCTACTTTGGCTACACAGCCCTCATGGTCCTATCCTTCTGGCTGCTCACGGGTACGATTGGCTTCTATGCAGCCTACATGTTTGTCCGCAAGATCTATGCTGCCGTGAAGATAGACTGA

XM_004840586.1 Coding sequence

Hck hemopoietic cell kinase, transcript variant X1

High confidence: 4 potential gene matches
Length: 1512 bp    Location: 493821..455696   Strand: -
>XM_004840586.1
ATGGGGTGCTTGAAGTCCAAGTTCCTCCGGGATAGAGGGAAAATCTCCAAAACTGAGCCTAGCTCCAACCTGCACACCCCTGTGTATGTACCGGACCCCACGTCCTCAGTCAAGCTGGGGCCTAACAGCAACAGCAACCCCCCGGGGCTCATGGAGGCAGGTTCCGAGGACTTCATTGTGGTTGCCTTGTATGATTACGATGCCATTCACAGAGAAGACCTCAGCTTCCAGAAGGGGGACCAAATGGTGGTCCTGGAGGAGTCTGGGGAGTGGTGGAGGGCGCAATCCTTGGCTACCCAGAAAGAGGGTTACATCCCAAGCAACTATGTGGCCCGCGTTAACTCTCTGGAGACAGAGGAGTGGTTCTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTCCTAGCTCCTGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACCAAAGGGAGCTACTCTTTGTCTGTTCGAGACTGTGACCCACAGCAAGGAGACACAGTGAAGCACTACAAGATCCGGACCCTGGACAATGGGGGCTTCTATGTCTCCCCGAGGAGCACCTTCAGCAGCCTGCAGGACCTGGTGGCCCACTACAAGAAGGGGAAGGACGGACTGTGCCAGAAGCTGTCATTTCCATGTGTGTCCTCCAAGCCCCAGAAGCCATGGGAGAAAGATGCCTGGGAGATTCCCCGGGAATCCCTCAAGCTGGAGAAGAGACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACCTACAACCAGCACACCAAGGTGGCAGTGAAGACAATGAAGCCGGGCAGCATGTCAGTGGAGGCCTTCCTGGAGGAGGCCAACATCATGAAGACGCTGCAGCATGACAAGCTGGTGAAGCTGCATGCAGTGGTCACGCAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCCTGCTGGACTTTTTGAAAAGTGAAGAAGGCAGTAAGCAGCCTTTGCCAAAACTGATCGACTTCTCTGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATTCACCGAGACCTCCGAGCTGCCAACATCTTGGTCTCCGCGTTGCTGGTGTGTAAGATCGCTGACTTCGGCCTGGCCCGGGTCATTGAGGACAATGAGTACACAGCTCGGGAAGGGGCCAAGTTCCCCATCAAGTGGACGGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCTGACGTCTGGTCCTTTGGCATCCTGCTGATGGAGATTGTCACCTATGGCCGGATCCCTTACCCAGGAATGTCCAACCCAGAGGTGATCCGGGCACTGGAGCATGGGTACCGGATGCCTCGGCCGGATCACTGCCCAGAGGAGCTCTACAACATCATGACACGCTGCTGGAAGAACCGTCCAGAGGAGCGGCCCACCTTCGAGTATATCCAGAGTGTGCTGGACGACTTCTACACGGCCACTGAGAGCCAGTACCAACAACAGCCTTGA

XM_004840588.1 Coding sequence

Hck hemopoietic cell kinase, transcript variant X3

Length: 1413 bp    Location: 480709..455696   Strand: -
>XM_004840588.1
ATGACACACAAGGATAGGGGGCCTAACAGCAACAGCAACCCCCCGGGGCTCATGGAGGCAGGTTCCGAGGACTTCATTGTGGTTGCCTTGTATGATTACGATGCCATTCACAGAGAAGACCTCAGCTTCCAGAAGGGGGACCAAATGGTGGTCCTGGAGGAGTCTGGGGAGTGGTGGAGGGCGCAATCCTTGGCTACCCAGAAAGAGGGTTACATCCCAAGCAACTATGTGGCCCGCGTTAACTCTCTGGAGACAGAGGAGTGGTTCTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTCCTAGCTCCTGGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACCAAAGGGAGCTACTCTTTGTCTGTTCGAGACTGTGACCCACAGCAAGGAGACACAGTGAAGCACTACAAGATCCGGACCCTGGACAATGGGGGCTTCTATGTCTCCCCGAGGAGCACCTTCAGCAGCCTGCAGGACCTGGTGGCCCACTACAAGAAGGGGAAGGACGGACTGTGCCAGAAGCTGTCATTTCCATGTGTGTCCTCCAAGCCCCAGAAGCCATGGGAGAAAGATGCCTGGGAGATTCCCCGGGAATCCCTCAAGCTGGAGAAGAGACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACCTACAACCAGCACACCAAGGTGGCAGTGAAGACAATGAAGCCGGGCAGCATGTCAGTGGAGGCCTTCCTGGAGGAGGCCAACATCATGAAGACGCTGCAGCATGACAAGCTGGTGAAGCTGCATGCAGTGGTCACGCAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCCTGCTGGACTTTTTGAAAAGTGAAGAAGGCAGTAAGCAGCCTTTGCCAAAACTGATCGACTTCTCTGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATTCACCGAGACCTCCGAGCTGCCAACATCTTGGTCTCCGCGTTGCTGGTGTGTAAGATCGCTGACTTCGGCCTGGCCCGGGTCATTGAGGACAATGAGTACACAGCTCGGGAAGGGGCCAAGTTCCCCATCAAGTGGACGGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCTGACGTCTGGTCCTTTGGCATCCTGCTGATGGAGATTGTCACCTATGGCCGGATCCCTTACCCAGGAATGTCCAACCCAGAGGTGATCCGGGCACTGGAGCATGGGTACCGGATGCCTCGGCCGGATCACTGCCCAGAGGAGCTCTACAACATCATGACACGCTGCTGGAAGAACCGTCCAGAGGAGCGGCCCACCTTCGAGTATATCCAGAGTGTGCTGGACGACTTCTACACGGCCACTGAGAGCCAGTACCAACAACAGCCTTGA

XM_004840589.1 Coding sequence

Xkr7 XK, Kell blood group complex subunit-related family, member 7

High confidence: 3 potential gene matches
Length: 1731 bp    Location: 561198..537263   Strand: -
>XM_004840589.1
ATGGCCGCGAAGTCGGATGGAGCGGCGGCCGCGGCCGGCCCGGGGCCCGAGGGGGCGGCTGGGGGGCCCCGGGGCGGTGCCGGCGAGCCCGGGGAGGCGGTGGCGGGCCCCGAGGGCCCGGGGGTGTCCGCGGCGGGCGGCACGGGGCCACGCTACGAGTTGCGCGACTGCTGCTGGGTGCTGTGCGCGCTGCTCGTGTTCTTCTCCGACGGCGCCACGGACCTGTGGCTGGCGGCCTCCTACTACCTGCAGGGTCAGCCCACCGTCTTCGGCCTCACGTTGCTCTTCGTGCTCCTGCCCTCTCTGGTAGTGCAGCTGCTCAGCTTCCGCTGGTTCGTTTACGACTACTCGGAACCCGCGGGGACCCCGGGACCCGCCGTCAGCACCAAGGACAGCGGCATCGGCGCCCCCGCCATCGGCACCAAGGACAGCGCCACCGCCTTCAGGACCGACGAAGGCGGCCCCGAGCTGGGTCCCGGGCCCCCCTCCGTCAGCTCCTACCGTCGCCGCTGCTGTCGCCTCTGCGTCTGGCTACTGCAGACCTTCATCCACCTCCTGCAGCTCGGCCAGGTCTGGAGGTACTTGCACGCCCTGTACCTGGGCCTGCAGAGTCGCTGGCGTGGGGAGCGGCTGCGGCGCCACTTCTACTGGCAGATGCTGTTCGAGAGCGCGGACGTGAGCATGCTACGCCTGCTGGAGACCTTCCTGCGCAGCGCGCCGCAGCTGGTGCTGCAGCTCAGCCTGCTGGTCGACAAAGGCGGGGAGCCCGACCTGCTGCCCGCCCTCTCCACTTCTGCCTCCCTCGTGTCCCTGGCATGGACACTGGCCTCCTACCAGAAGGTGCTGCGGGACTCAAGGGATGACAAGCGACCCCTGTCCTACAAGGGTGCCGTGGCCCAGGTGCTGTGGCACCTGTTCACCATTGCAGCCCGCAGCCTGGCCTTTGCCCTCTTTGCCAGTGTCTATAAACTCTACTTTGGCATCTTCATTGTGGCTCACTGGTGCGTCATGACCTTCTGGGTCATCCAGGGAGAGACTGACTTCTGCATGTCCAAGTGGGAGGAGATCATCTACAACATGGTGGTAGGCATCATCTACATCTTCTGCTGGTTCAATGTCAAGGAGGGGCGCAGCCGCCGCCGCATGACCTTGTACTACTGCATCATCCTGCTGGAGAACGCTGCGCTCACTGGGTTCTGGTACTCCAGCCACAACTTTGACTTTCATTCGCTCATCCTGGTCTGCATGGTGGCCTCCAGCTTTGCGCTGGGAATATTCTTCATGTGTGTCTATTATTGTCTCCTGCACCCCAATGGGCCCATGCTGGGTCCCCAGGTGCCTGGCTGCATCTTCTCTGAGGCCCCAGGGCCCTGTGGCCCACCAGTTGACACTGTCACAAGTCCCCCAAGATCCCTGCCAAGGACTACAGGCACAGAGAGGGATGGGGCCTCAATGGGGGGTGAACGCGCAGGGACCCCCACACCACCTGTCTTCCAGGTGCGGCCTGGCTTGCCTCCCACACCAGTAGCTCGGCCTGTGCGGACAGAGAGGCCTGTTATTCGGATTGACTTGCCTCGTAAGAAGTACCCAGCATGGGATGCTCATTTTATTGACCGCCGGCTCCGGAAGACCATCCTGGCACTGGAGTATTCCTCGCCTGCCACACCCCAGTTGCAGTACCGCAGCATGGGGACTTCCCAGGAGCTGCTGGAGTATGAGACCACAGTGTAG

XM_004840594.1 Coding sequence

Ttll9 tubulin tyrosine ligase-like family, member 9

High confidence: 4 potential gene matches
Length: 1395 bp    Location: 647573..583935   Strand: -
>XM_004840594.1
ATGTCGCGACCAAAGAATCAAAGTTATAAGGGCCATGGGTTGTCAAAAGGAAAAGAGCGAGAGCAGAGAGCATCGATTCGGTTCAAGACCACTCTTATGAACACTGTCATGGACGTCCTCCACAACAGGCCGGGATGGGTGGAAGTGAAAGATGAAGGGGAATGGGACTTCTACTGGTGCGATGTCAGCTGTCTCAGGGAGAACTTTGACCACACCTACATGGATGATCACGTGCGGATCAGTCACTTCCGGAACCACTACGAGCTGACCCGCAAGAACTATATGGTGAAGAACCTGAAGCGGTTCCGGAGACAGCTGGAGCGCGAGGCAGGAAAGCCGGAGGCGGCCAAGTGCGACTTCTTCCCTAAAACCTTTGAGATGCCCAGTGAGTACCACCTGTTCGTGGAGGAGTTCCGCAAGCACCCAGGGATCACCTGGATCATGAAGCCTGTTGCACGGTCTCAGGGCAAGGGCATCTTCCTCTTCCGGAGACTGAAGGACATCACGGACTGGAGGCAGGGCACTGCCAGCAAGAAATTCGCCAGCCTGGAGGCCCAGCCTGCCCATGCCGCCACCACCACTGTCAATCCTTCTGGCAGCCAAGACACAAGAAGTTCTGATGACCAGAAAGATGAGCTACCTGTGGAGAACTATGTAGCTCAGCGTTACATCGAGAATCCCTACTTAATCGGAGGCCGCAAGTTTGACCTGCGAGTCTACGTGCTGGTGATGTCGTACCTCCCGCTGCGTGCCTGGCTCTACAGGGACGGCTTTGCCCGATTCTCTAACACCCGCTTCACGCTGAGCAGCATCGACGACCAGTATGTTCACCTCACCAACGTCGCAGTGCAGAAGATGTCTCCCGACTACCACCCAAAGAAGGGCTGCAAGTGGATGCTCCAGCACTTTCGGCAGTACCTAGCATCCAAGCATGGGCCCCAGGTGGTGGAAGCACTTTTCAGTGACATGGACAACATCTTCATCAAGAGCCTGCAAAGTGTGCAGAAGGTGATCATTAGTGACAAGCACTGCTTCGAGCTGTATGGCTACGACATCCTCATCGACCAAGACCTCAAGCCGTGGCTCCTGGAGGTCAATGCATCCCCCTCGCTGACAGCCAGCAGCCAGGAGGACTATGAGCTCAAGACTTGCCTGCTGGAGGACACGCTGCACGTGGTAGACATGGAAGCCAGGCTCACAGGAAAGGAAAAGCGAGTCGGGGGCTTCGACCTCATGTGGAATGATGGTCCTGTCAGCAGAGAGGAGGGGGCTCCTGACCTGCCGGGGATGGGAAACTTTGTGACCAACACACACCTCGGCTGTGTCAATGATCGGAAAAACCAGCTGCAGCAACTGTTCCGCTCCCTTCAGTCCCAGAAGAAAGCTTCCAGTTGA

XM_004840596.1 Coding sequence

Mylk2 myosin light chain kinase 2

High confidence: 4 potential gene matches
Length: 1788 bp    Location: 693659..680810   Strand: -
>XM_004840596.1
ATGGCGACAGAAAATGGATCAGTCGAGCTGGGAATCCAGAACTCAACAGACAAGGCACCTAACAGTGCTACAGATGAAGAACCTCTGGCTGCAGAGAAACACCCCGGGTCCCCAGACCCCAAGAAAGATCTGGATCCATCCACCCTGAAGAGAGCTGCCGAAGCCCCTGCCCCGGAGAAAGGGGATGGTGTCCTAGTTCAGCCCTCAACCAGCAGCCAGAGCCCTGAGGCAGAGGCTGACCAGGGAGGGGGCCCTGCAGAGGGCAATGCTGGGCAGCCGGCAGCCCTGCCCCAGCAGACTGAGACAGCTGAGGCCAGTGCCAAGAAGCCCAGTGCTGAGCAAGGACCCTCAGGCAGCCGAGCACCTGGAGAGCCCAAGGTGGGCAAGAAGGCGGCAGAGGGCCAAGCCGCGGCCAGGAGAGGCTCTCCTGCCTTTCTGCATAGCCCCAGCTGCCCCGCCATCATCTCAAGCTCTGAGAAACTGCTGGCCCCAAAGCCCCTCAGTGAGGCATCAGAGCTCATCTTTGAAGGGGTACCTGACACATCTGGCCCCCCAGATCCTGAGCCAGCCAAGGCAGAAGGAGAGAAGAACATCGTGGCAGGGAGCCAGAAGGAAGCAGGAGAGAAAGCCCCCGGCCAGGCTGGCCAGGCCAAGGTGCAAGGGGACACCTCGAGGGGAATCGGGTTCCAGGCTGCGCCCTCAGAGACCGCGGAGGAGGGGCAGGCCCTCTGTCTCCCAGCCAGGGAGGAGGACTGCTTCCAGATTCTGGACGATTGTCCCCCTCCTCCCGCCCCCTTCCCACACCGCGTCGTGGAGCTTCGGCCCGGAAATGTTAACAGCGAATTCAGCTTGAACTCCAAGGAGGCACTTGGAGGGGGCAAGTTTGGAGCAGTCTGCACCTGCACAGAGAAAGCCACAGGCCTCAAGCTGGCAGCCAAAGTCATCAAGAAGCAGACCCCCAAAGACAAGGAAATGGTGATGCTGGAGATTGAGGTCATGAACCAGCTCAACCACCGCAACCTGATCCAGCTCTATGCGGCCATCGAGACCTCGCATGAGATCATCCTGTTCATGGAGTACATCGAGGGAGGCGAGCTCTTCGAGAGGATCGTGGATGAGGACTACCAGCTGACTGAGGTGGACACCATGGTGTTCGTCAGGCAGATCTGTGACGGGATCCTCTTCATGCACAAGATGAGGGTCCTGCACTTGGACCTGAAGCCAGAGAACATCCTGTGTGTCAACAGCACGGGACACTTGGTGAAGATCATTGACTTTGGCCTGGCGCGGAGGTATAACCCCAGCGAGAAGCTGAAGGTGAATTTTGGGACCCCGGAGTTCCTGTCCCCTGAGGTGGTGAATTATGAGCAGATCTCCGATAAGACTGACATGTGGAGTCTGGGCGTCATCACCTACATGCTGCTGAGCGGCCTCTCCCCCTTCCTGGGAGATGATGACACCGAGACCCTGAACAATGTCCTGTCTTCCAACTGGTACTTTGACGAGGAGACCTTTGAGGCTGTGTCAGATGAGGCCAAAGACTTCGTCTCCAAGCTCATCGTCAAGGACCAGGGGGCCCGAATGAATGCTGCCCAGTGCCTGGCCCACCCCTGGCTCAACAACCTGGCCGAGAAGGCCAAGCGCTGTAACTGCCGTCTTAAGTCCCAGATCCTGCTTAAGAAATACCTCATGAAGAGGCGCTGGAAGAAAAACTTTATTGCCGTCAGTGCTGCCAACCGCTTTAAGAAGATCACCAGCTCGGGAGCCCTCATGGCTCTGGGGGTCTGA

XM_004840615.1 Coding sequence

LOC101719550 chromosome unknown open reading frame, human C20orf96

Length: 1086 bp    Location: 1389751..1371767   Strand: -
>XM_004840615.1
ATGCCTATTATAGTTTCCCTAATGGCTCATGTCTTTCGGAAACCCAGCCACTTGGGGACTCACTCCACGGCCCACAATTCCCAGTTTCTGCAGTGGTCCAAGCATGAAAGCAAACCATCTACTCTGCCTCCACTTCAACAAACCAGCAGCCATAACAAAAGCAAAATGAAGACTTCGAGTAGAGGCAGTGCAGTGCCCTCCAAGCTCATGCCGTTGGAGACAAGCCAGCTGAAGAATCCACAAGGGCGCATAAGGCAGAAGCCGCATCTGGGAAAGATACCAGCCAAACCCCGGCTAATGAGGATGATGCTCCAGAACCAGCGGAGCTTGCTCCAGGATGTTTGCGATCATGAGTGCTTCCTCACCAAGCAGAATGAAGGGGTGGTCAGAACCATCCTGGACATGGAGGCCAGCACGGCACTGCAAGTGCGGGCCATCCTGCGGCAGGAAGACATTTCACTGAACATGATGGACATCTTGGAGTACTCAAACAACAAGCTACAGAGGTCGAAGTCTGAGCTTCAGGAGTGGAGAGAGAAGGAGGAATGGAAGAAGAACAGCCTGGAGCAGCAGGCAGAGCAGCTGAACACCAGGATCAAGAACATGCAGGAGTTGGTGAGCTTCCTGAGCACGTACATGGAGCACAAATACTCCCTCAGGTCTGTTCAGATTGCCAGCCTTGTGTGCCAGCTGCAGCAGGTGAAGGACAGCCAGCAGGAGGAGCTGGATAACCGCAGTGAGATGCGCAGAATGGTGCTAAAGACTCTGTCCAACACAAAGGAGGAGAAAAAGAGAAAAGTTTGGAGGTCCCTGTTGGTGAAAACCCAGTATCCCCATGACAAGACCCTTCAGCAGGTGATCTGGGACAGCTGGTACCAGCAGAAATGGATGGTCAAGTGCAGAGAACTTATTGACCAATCAAAGGAGAAAATGCCCACATTAAGGGCTGACGTGGAAGTGCTCCGGACCCAGGTCCAGGATCTACAGGAGGTCATTTTTGAGGATGTTTTGCTTCAGAGACCCAAGTGCACCCCAGACATGGACATCATCCTCAACATCCCTGTGGAGGAGCTGCTCCCTTTCTAG

XM_004840597.1 Coding sequence

Tpx2 TPX2, microtubule-associated, homolog (Xenopus laevis), transcript variant X1

High confidence: 1 potential gene match
Length: 2244 bp    Location: 772427..709338   Strand: -
>XM_004840597.1
ATGTCACAAGTTAAAAACTCTTACTCCTTTGATGCTCCCTCGGACTTCATCAATTTTACATCTTTGGATTATGAGGAAGATACAGAAAATGTAGATTCATGGTTCGAGGAGAAGGCCAATTTAGAGAATAAGTTTCTTGGGAAAAATGGGACAGGAGAGCTTTTTCAGAACAAAACTTCCTTGAGAAAAGCAAATCTTCAGCAAGCTAGTCTCACACCTTTGCGACCAGTTGAGAACACTTACTACAAAGAGGCAGAAAAAGTAAATCTTACGGAACATTCTGATTCATCAAATGCTTGTTGCACCCTGGAAGTTGAGGGAACCAAATCAAGAAATGCTCCAGCCCAGCCTCAGAGGATATCTCTTAGACTCTCTGCCCAGAAGAATATGGAGAAGAAAGAAAAACACCATGTTCAAATGAAAGCAAAGAGATGTGCCACTCCTGTAATCAGTGAAATTCCACCTTCCAAGAAAATGAAAATTTCTCAAAACAGAAAGGATCCAGAGGAAGAGGAAGAGGGCAGTGCTCAAGATACTTCCAAAAAGAATAAATTTTCCCCAAAGAAAGCCAAGGGCAGACATACTACACCTCATGTACCAACTATAAAGCAGAAAGTTCTCAAAAGTACTGAGGAGCAAGAGTTGGAAAAGAGCATGAAAATGCAGCAGGAGGTGGTAGAAATGCGGAAAAAGAATGAAGAGTTCAAGAAACTTGCTCTTGCAGGAGCAGGGCAACCTGTGAAGAAATCAGTGAGCCAGGTAACCAAAGTAGTTGACTTCCACTTCTGCACAGATGAGCGAATCAAACAGCATCCTAAGAACCAGGAGGAATATAAGGAAGTGAACTTTACAGCTGAATTGCGAAAGCATCCTCCCTCTCCTGCTCGAGTGGCTAAGGGATGTACTATTATTAAGCCTTTCAACTTGTCCCAAGGAAGGAAGAGAACATTTGACGAGGCTGCTTCTGCATATGTGTCCCTGGCACAGCAGGTTGAGGCGTTCCATAAACGAACCCCTAACAGATATCATTTGAGGAGCAAGAAGGAAGATATTAGCCTTTTATCCTCCAAATCTTCTGTGACCAAGATATCCACAGAGCCACAGACCCCTGTACTGCAAACCAGATTCCGAGCGAGGCCTGTGACCTGCAAAAGTACAGTGGAACAGGAGGCTGAAGAGCTTGAGAAACTGCAGCAATACAAATTCAAAGCACGAGAAGTTGATTCCAGAATTCTTGAAGGTGGGCCCATCTTGCCCAAGAGACCACCTGTGAAACCACCCACTCAGCCTATTGGATTTGATTTGGAAATTGAGAAAAGAATCCAGGAGCGAGAGTCAAAGAAGAAGTCAGAGAATGAACACTTTGAATTTCATTCCAGACCTTGCCCTACTAAGATCTTGGAAGATGTTGTGGGTGTTCCTGAAAAGAAGGTACTTCCAATCACCGTTCCCAAGTCTCCAGCCTTTGCGTTGAAGAACAGAATCCGATTGCCCACCAAAGAAGATGAGGAAGAGGATGAACCGACAGTGATAAGAGCTCAGCCTATGCCACATTATGGCGTGCCTTTTAAGCCCCATATCCCAGAGGCAAGAACTGTAGAAATATGCCCTTTCTCCTTTGATTCTCGGGACAAAGAACGCCAGTTACAGAAGGAGAAGAAAATAAAAGAATTGCAGAAAGGAGAGGTACCCAAGTTTAAGGCACTTCCCTTGCCTCATTTTGATAGCATTAATCTGCCAGAGAAGAAGGTCAAGAATGTGACCCAGACTGAGCCATTTGCATTGGAGACTGACAAAAGAGGTGCTAGGAAGGCTGAGACATGGAAGCACCAGCTGGAGGAAGAACTGAAACAGCAGAAAGAAGCAACTTGTTTCAAGGCTCGTCCAAACACTGTCATCTTCCAGGAGCCCTTTGTTCCCAAGAAAGAGAAAAAATCAGTTGCTGAGGACCTTTCTGGTTCTCTAGTTCAGGAACCTTTTCAGTTGGCCACTGAGAAGAGAGCCAAGGAGCGACAGGAGCTGGAAAGGAGAATAGCTGAGGCGGAAGCCCAGAAAGCCCAGCAGCTGGAGGAGGCCAGAGAGCAGGAGGAAGAACAGAAGAAGGAGGAGCTGGCCAGGCTACGGAAAGAACTGGTGCACAAGGCAAATCCAATACGCAAGTACCAGGCTGTGGAGATAAAGTCAAGCAACCAGCCTCTGACTGTCCCTGTCTCTCCTAAGTTCTCCACTCGATTCCACTGCTGA

XM_004840607.1 Coding sequence

LOC101716684 beta-defensin 36-like

Length: 207 bp    Location: 1081071..1078435   Strand: -
>XM_004840607.1
ATGAAGCTCCTGCTGCTGACGTTGGCCGTGGTGCTGCTCACGTCCCAGCTCACCCCAGGTGACACTCAAAGATGCTGGAATCTTCTTGGCAAATGTCGCCACAGATGCTTCAGGAAGGATAGTGTCTATGTTTACTGCACGAATGGTAAATTGTGCTGTGTCAAACCCAAGTACCAGCCAAAACCAAAGCCATCGTGGTCATTTTAA

XM_004840616.1 Coding sequence

Zcchc3 zinc finger, CCHC domain containing 3

High confidence: 4 potential gene matches
Length: 1221 bp    Location: 1398921..1402330   Strand: +
>XM_004840616.1
ATGGCCACCGGTGGCGGAACGGAGGAGGAGAAGATGCGGGGACGGCCGCAGCTCTTGCCTCCAGCGCGGCCCGGGGCTCCGGGCGAGGAGGCCGAGGGCACCCGCGAGAAGATGGGCTGGGCCCAGGTGGTGAAGAATCTGGCCGAAAAGAAGGGCGAGTTCCGCGACCCGCGGCCACCACGGCGGGAGGAAGAAAGCAGCAGCGTGAACGCGGGAAGCAGGCTCAGCGCCCCCGCAGGCCTGGCGGCGCCGGGCCTCGGCGACTTCCCGCCAGCCGGCCGCGGGGACCCGAAGGGCCGACGGAGAGAGCCAGCTGGCGAGGCGGCGGACTCCCGCAAGAAGAAGGGCGCCGCTGAGCCAAGCAGGAAGAAAAAGGCCGAGGCGGCGGCCATCGCGACTCCTGCCCGGGCCGGCGAGGCCGACGATGCGGGCGAGCAACCGCTCCCGGACGAGCAGGGGGCGGCAACGGTGGCCCCCACTGCCGGCCCGGGTAAGGGGCGCTTCCTCGTGCGCATCTGCTTCCAGGGCGACGAGGGCGCCTGCCCGACCCGGGACTTCGTGGTGGGAGCGCTCATCCTGGGCTCCATCGGCATGGACCCGAGCGACATCTACGCAGTCATCCAGATCCCCGGCAGCCGTGAGTTTGACGTGAGCTTCCGCTCAGCGGAGAAGCTGGCTCTATTCCTCCGCGTCTACGAGGAGAAGCGCGAGCAGGAAGACTGCTGGGAGAACTTTGTAGTGCTGGGGCGGAGCAAGTCCAGCTTGAAGACGCTCTTCATCCTCTTCCGGAACGAAACAGTGGACGTGGAGGACATCGTCACCTGGCTCAAGCGCCACTGCGACGTGCTGGCCGTGCCCGTGAAAGTGACCGATAGGTTTGGGATCTGGACGGGGGAATACAAGTGCGAGATCGAGCTGCGCCAGGGGGAGGGTGGGGTCAGGCACCTGCCGGGGGCCTTCTTTCTGGGGGCCGAGAGAGGCTACAGCTGGTACAAGGGGCAGCCCAAGACATGCTTTAAATGTGGTTCCCGGACCCACATGAGCGGCAGCTGCACGCAGGACAGGTGTTTCAGGTGCGGAGAAGAGGGGCACCTGAGCCCTTACTGCCGAAAGGGCATCGTGTGCAACCTCTGTGGCAAGCGAGGGCATGCCTTTGCTCAGTGTCCCAAAGCAGTTCACAATTCCATGGCAGCTCAGCTCTCTGGCGTGGCCGGGCACTGA

XM_004840619.1 Coding sequence

Nrsn2 neurensin 2, transcript variant X2

Length: 594 bp    Location: 1449881..1453940   Strand: +
>XM_004840619.1
ATGCTGGGCTGCAACCCCTGCAGCTGTGTAACCACCGTGGAGGAAAGCAAGTGGTATGGAGTCCACTCCTACCTGTACCTCTTCTACGAAGACTGCACTGGCATGGCTCTCAGTGATGACCCTGAAGGACCCCCAGTCCTGTGTCCCCACCAACTCTGGCCCTCACTGTGCTGGAAGATCTGCCTGTCCTCAGGGACCCTGCTTCTGCTGCTGGGGATAGCAGCTCTGACCACTGGCTATGTGGTGCCCCCCAAGTTGGAGACCGTCAACAATACTGACTTGCCGCTGCTAGATGAGCGGGCAGCCAACTACAACAAGGCCCTGAGCACCTGCCGCCTGGCAGGCACAGCACTCTGTGGGGCAGCTGGGATCCTGCTGACCATCTGCCTCTTGTGGGCCATGTCAGGATGGCTGAACCCAGACGCCAAGGCAGAGCCCTTGGACACTGAAGCTGATAGCCATGTGGAGGTCTTCAGGGATGAGCCAGGGCAGCAGCTGTCCCCCACCTTCTGCAATACCAGTGGTCAGTCATGGTTCTTGACCTCCTTTGGGCACTCCTCTGTTCAGATCATCCAGCCCAAGAGGGACTCCTGA

XM_004841146.1 Coding sequence

Trib3 tribbles homolog 3 (Drosophila)

High confidence: 4 potential gene matches
Length: 1449 bp    Location: 1486223..1494001   Strand: +
>XM_004841146.1
ATGTTTTTCCAAGGTGATAGGGAGGGTCAGCATCTGCCCTCAAGCTCGGTTTTCAGTCCCTTCCTCGAGACCACACTCCCTGGGGTGCCCTGTGGGCTAGTGCAGGGTGGGGAGCAGGCAGCAGGGGGCGGCAAGGTGGGGCGGGGCGCGGTGCTGGGGCGGCCAGGGGCGGGGCAAGGGGATGGCGCAATCCCCGGCCAGCGGGCGTCAGACAGCGGACTGTTAGCTAAGGGTTACATCACCCGGCCGGACCCGGAGCGGGGCACACTGCGATCCCGAGTCACTCGAGGTTCCTACGGCTCAGCACACTTTCTCGCCAGGGGCTGGACTGCGAGATTGGCCTCAGCGCAGCGGGCAGGTGTCACCTGCGGGGACAAGATTCGAGCCACCTCTCTGCCTGCTCCTGTGGGTGCTCCCTCCACGAAGAAGACGATGGAGTCAGTGGCCGACTTGGACCCTGAGTGGCCCATTGAGAAACGAGCTCGAAGTGGGCCCCAGCCCAGGCCAGTGCCCTGCCTGCTGACTCTGAGCCCACCCCCGGCTCTAGCCCATGTACCTGCCATGGCCCCTGTCTCCCAGCACCTTGGGCCCTACGTCCTCCTGGAGCCCAAGGAGGATGGGAGGGCCTACCGGGCCCTGCACCGCCCCACAGGCACTGAGTACACCTGCAAGGTGTACCCGGCATCCGAAGCCCAGGCAGTGCTGGAGCCCTACTCGAGGCTGCCCCCCCACGATCACGTGGCTCGGCCCGCGCAGGTCCTGCTGGGCACCGAGCTCCTCTACGCCTTCTTCTGTCGGACTCACGGGGACATGCACAGCCTGGTCCGCAGCCGAGGCCGCGTCCCTGAGCCAGAGGCTGCCCTGCTTTTCCGTCAGATGGCCGCTGCTCTGGCGCACTGCCACCAGCATGGTCTGGTCCTGCGTGATCTCAAACTTCGGCGCTTCGTCTTCACCAACCGTGAGAGGACAAAGCTGGTACTGGAGAACCTGGAGGATGCCTGTGTCCTGACGGGGCCTGACGACCTACTGTGGGACAAACAGGCGTGCCCAGCCTATGTGGGACCCGAGATCCTCAGCTCTCAAGCATCCTACTCCGGCAAGCCAGCAGATGTCTGGAGCCTGGGCGTGGCGCTCTTCACCATGCTGGCTGGCCACTACCCCTTCCAGGGCTCAGAGCCTGCCCTGCTCTTTGGCAAGATCCGCCGTGGTGCCTTTGCCCTGCCTGCTGGCCTCTCAGCCCCTGCCCGCTGCCTGGTCCGCTGCCTCCTCCGGCGGGAGCCGGCCGAGAGGCTCATGGCCACAGGCATCCTACTGCACCCCTGGCTGCAGGGGGACCCACGCCCCACAGCCCTATCCCGATCCCACCTTGGGGATGCTGATCAGGTGGTCCCTGATGGGGCAGGGCTGGAGGAGGAGGGGGACAGCGGGGAGGTGTGTCTGTACAGCTAG

XM_004840627.1 Coding sequence

Rbck1 RanBP-type and C3HC4-type zinc finger containing 1, transcript variant X6

Length: 1443 bp    Location: 1503041..1523542   Strand: +
>XM_004840627.1
ATGGACGAGACGACCAAGAAAGCAGAGGAGATGGCCCTGAGCCTCGCCCGGGCGGTGGTGGGCGGGGATGAGCAGGCAGCTGTGAAGTATGCCACCTGGCTGGCACAGCAGCGGGCATCCCTGAGTGTGCATCTGAAGCCAGAGGTCCCACGGACACGGGACATCAGGCTGTGTGTGAGTGTGGAGGATGCCCATGTACAGACCGTCACCATCTGGCTCATGGTGCGCCCTGACATGACAGTGGCTTCCCTCAAGGACATGGTATTCCTGGACTATGGCTTCCCCCCGAGGCTGCAGCAGTGGGTGATTGGGCAGCGGCTGGCCCGAGACCAGGAGACACTGCACTCCCATGGGGTGCGGCGGAATGGGGACAGCGCCTACCTGTATCTGCTGTCAGCCCGAAACACCTCACTCAACCCACGGGAGGTTCAGCGCCAGCGCCAGCTTCGGATGCTGGAGGATCTGGGCTTCAAGGACCTCACACTCCAGCCACGGGGTCCCCTGGAGCCAGCTCCTTCCAACCCTGGGGTACCCCAGGAACTTGGAGGGGTACAACCCAATGGAGTGCCTGAGCCTCCACCGGTGGGCTGGCAGTGCCCTGGGTGCACCTTCATCAACAAACCTACCCGGCCTGGCTGCGAGATGTGCTGCTGTTCACGGCCGGAGGCCTACCAGGTGCCTGCCTCATACCAGCCCGATGAGGAGGAGCGGGCACGTCTGGCCGGCGAACAGGAGGCGCTACGTCAGTACCAGCAGCGGAAGCAGCAGCAGCAAGAGGGGAACTACCTGCAGCACGTGAAGCTGGAGCAGAGGAGCCTGGTGCTGAATACGGAGCCCGCCGAGTGCCCCGTGTGCTACTCGGTGCTGGCACCTGGTGAGGCGGTGGTGCTGCGGGAGTGTCTGCACACCTTCTGCAGGGAATGCCTCCAGGGCACCATCCGCAACAGCCAGGAGGCGGAGGTCTCCTGTCCCTTCATTGATGACACCTACTCGTGCCCGGGGAAGCTGCTGGAGAGGGAGATCCGGGCGGATCGGGGCTGTTTGCAGCTCCTGCCCCCCGAGGATTACCAGCGCTTTCTGGACCTGAGCGTCTCCATTGCAGAAAACCGCAGTGCTTTCAGCTACCACTGCAAGACCCCGGACTGCAAGGGCTGGTGCTTTTTTGAGGATGACGTCAATGAGTTCACCTGTCCCGTGTGTTTCCACATCAACTGCTTGCTTTGCAAGCTTCTCAGATCCCTGGGGAACCCTGTCACCCTGCAGGCCATCCACGAGCACATTAACTGCAAGGAGTATCAGGATGACCTGGCACTGCGGGCTCAGAATGACCTGGCTGCCCGGCAGACCACAGAGATGCTGCAGGGCCCAGGGGACACCAGTGGGGGCTGCCGCTGCCGAGTGAATGGGATTCCTTGCCACCCAAGCTGTCAGAACTGCCACTAA

XM_004840625.1 Coding sequence

Rbck1 RanBP-type and C3HC4-type zinc finger containing 1, transcript variant X4

Length: 1551 bp    Location: 1503041..1523542   Strand: +
>XM_004840625.1
ATGGACGAGACGACCAAGAAAGCAGAGGAGATGGCCCTGAGCCTCGCCCGGGCGGTGGTGGGCGGGGATGAGCAGGCAGCTGTGAAGTATGCCACCTGGCTGGCACAGCAGCGGGCATCCCTGAGTGTGCATCTGAAGCCAGAGGTCCCACGGACACGGGACATCAGGCTGTGTGTGAGTGTGGAGGATGCCCATGTACAGACCGTCACCATCTGGCTCATGGTGCGCCCTGACATGACAGTGGCTTCCCTCAAGGACATGGTATTCCTGGACTATGGCTTCCCCCCGAGGCTGCAGCAGTGGGTGATTGGGCAGCGGCTGGCCCGAGACCAGGAGACACTGCACTCCCATGGGGTGCGGCGGAATGGGGACAGCGCCTACCTGTATCTGCTGTCAGCCCGAAACACCTCACTCAACCCACGGGAGGTTCAGCGCCAGCGCCAGCTTCGGATGCTGGAGGATCTGGGCTTCAAGGACCTCACACTCCAGCCACGGGGTCCCCTGGAGCCAGCTCCTTCCAACCCTGGGGTACCCCAGGAACTTGGAGGGGTACAACCCAATGGAGTGCCTGAGCCTCCACCGGTGGGCTGGCAGTGCCCTGGGTGCACCTTCATCAACAAACCTACCCGGCCTGGCTGCGAGATGTGCTGCTGTTCACGGCCGGAGGCCTACCAGGTGCCTGCCTCATACCAGCCCGATGAGGAGGAGCGGGCACGTCTGGCCGGCGAACAGGAGGCGCTACGTCAGTACCAGCAGCGGAAGCAGCAGCAGCAAGAGGGGAACTACCTGCAGCACGTGAAGCTGGAGCAGAGGAGCCTGGTGCTGAATACGGAGCCCGCCGAGTGCCCCGTGTGCTACTCGGTGCTGGCACCTGGTGAGGCGGTGGTGCTGCGGGAGTGTCTGCACACCTTCTGCAGGGAATGCCTCCAGGGCACCATCCGCAACAGCCAGGAGGCGGAGGTCTCCTGTCCCTTCATTGATGACACCTACTCGTGCCCGGGGAAGCTGCTGGAGAGGGAGATCCGGGCGGATCGGGGCTGTTTGCAGCTCCTGCCCCCCGAGGATTACCAGCGCTTTCTGGACCTGAGCGTCTCCATTGCAGAAAACCGCAGTGCTTTCAGCTACCACTGCAAGACCCCGGACTGCAAGGGCTGGTGCTTTTTTGAGGATGACGTCAATGAGTTCACCTGTCCCGTGTGTTTCCACATCAACTGCTTGCTTTGCAAGGCCATCCACGAGCACATTAACTGCAAGGAGTATCAGGATGACCTGGCACTGCGGGCTCAGAATGACCTGGCTGCCCGGCAGACCACAGAGATGCTGCAGGTGATGCTGCAGCAGGGTGAGGCCATGCACTGCCCACGGTGCCGGATCGTGGTACAGAAGAAGGACGGCTGTGACTGGATCCGCTGCACTGTCTGCCACACTGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCCAGGGGCCCAGGGGACACCAGTGGGGGCTGCCGCTGCCGAGTGAATGGGATTCCTTGCCACCCAAGCTGTCAGAACTGCCACTAA

XM_004840624.1 Coding sequence

Rbck1 RanBP-type and C3HC4-type zinc finger containing 1, transcript variant X3

Length: 1569 bp    Location: 1503041..1523542   Strand: +
>XM_004840624.1
ATGGACGAGACGACCAAGAAAGCAGAGGAGATGGCCCTGAGCCTCGCCCGGGCGGTGGTGGGCGGGGATGAGCAGGCAGCTGTGAAGTATGCCACCTGGCTGGCACAGCAGCGGGCATCCCTGAGTGTGCATCTGAAGCCAGAGGTCCCACGGACACGGGACATCAGGCTGTGTGTGAGTGTGGAGGATGCCCATGTACAGACCGTCACCATCTGGCTCATGGTGCGCCCTGACATGACAGTGGCTTCCCTCAAGGACATGGTATTCCTGGACTATGGCTTCCCCCCGAGGCTGCAGCAGTGGGTGATTGGGCAGCGGCTGGCCCGAGACCAGGAGACACTGCACTCCCATGGGGTGCGGCGGAATGGGGACAGCGCCTACCTGTATCTGCTGTCAGCCCGAAACACCTCACTCAACCCACGGGAGGTTCAGCGCCAGCGCCAGCTTCGGATGCTGGAGGATCTGGGCTTCAAGGACCTCACACTCCAGCCACGGGGTCCCCTGGAGCCAGCTCCTTCCAACCCTGGGGTACCCCAGGAACTTGGAGGGGTACAACCCAATGGAGTGCCTGAGCCTCCACCGGTGGGCTGGCAGTGCCCTGGGTGCACCTTCATCAACAAACCTACCCGGCCTGGCTGCGAGATGTGCTGCTGTTCACGGCCGGAGGCCTACCAGGTGCCTGCCTCATACCAGCCCGATGAGGAGGAGCGGGCACGTCTGGCCGGCGAACAGGAGGCGCTACGTCAGTACCAGCAGCGGAAGCAGCAGCAGCAAGAGGGGAACTACCTGCAGCACGTGAAGCTGGAGCAGAGGAGCCTGGTGCTGAATACGGAGCCCGCCGAGTGCCCCGTGTGCTACTCGGTGCTGGCACCTGGTGAGGCGGTGGTGCTGCGGGAGTGTCTGCACACCTTCTGCAGGGAATGCCTCCAGGGCACCATCCGCAACAGCCAGGAGGCGGAGGTCTCCTGTCCCTTCATTGATGACACCTACTCGTGCCCGGGGAAGCTGCTGGAGAGGGAGATCCGGGCGCTCCTGCCCCCCGAGGATTACCAGCGCTTTCTGGACCTGAGCGTCTCCATTGCAGAAAACCGCAGTGCTTTCAGCTACCACTGCAAGACCCCGGACTGCAAGGGCTGGTGCTTTTTTGAGGATGACGTCAATGAGTTCACCTGTCCCGTGTGTTTCCACATCAACTGCTTGCTTTGCAAGCTTCTCAGATCCCTGGGGAACCCTGTCACCCTGCAGGCCATCCACGAGCACATTAACTGCAAGGAGTATCAGGATGACCTGGCACTGCGGGCTCAGAATGACCTGGCTGCCCGGCAGACCACAGAGATGCTGCAGGTGATGCTGCAGCAGGGTGAGGCCATGCACTGCCCACGGTGCCGGATCGTGGTACAGAAGAAGGACGGCTGTGACTGGATCCGCTGCACTGTCTGCCACACTGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCCAGGGGCCCAGGGGACACCAGTGGGGGCTGCCGCTGCCGAGTGAATGGGATTCCTTGCCACCCAAGCTGTCAGAACTGCCACTAA

XM_004840634.1 Coding sequence

Csnk2a1 casein kinase 2, alpha 1 polypeptide, transcript variant X5

High confidence: 3 potential gene matches
Length: 1176 bp    Location: 1634812..1558641   Strand: -
>XM_004840634.1
ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACGCACAGACCCCGAGAGTACTGGGATTATGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAACTGGTTAGAAAACTAGGCAGGGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAGGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTAAGAGGAGGCCCCAATATCATCACATTGGCAGACATTGTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACATGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAAATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTGAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGGCTAATAGACTGGGGCCTAGCTGAGTTTTATCATCCTGGTCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGCCCTGAGCTACTTGTAGACTATCAGATGTATGATTATAGTTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTCCGGAAGGAGCCGTTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGATTATATTGACAAATACAACATTGAATTAGATCCCCGTTTCAATGATATCTTGGGCAGACACTCTCGTAAGCGATGGGAACGCTTTGTCCACAGTGAAAACCAGCACCTTGTCAGCCCAGAGGCCTTGGATTTCCTGGATAAGCTGCTGCGATATGATCACCAGTCACGGCTCACTGCAAGAGAAGCCATGGAACATCCCTATTTCTATACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCAGGGGGCAGTACACCTGTCAGCAGCGCCAACATGATGTCAGGGATTTCTTCAGTGCCAACCCCTTCACCCCTCGGACCTCTGGCAGGCTCACCAGTGATTGCTTCTGCCAACCCCCTTGGGATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA

XM_004840631.1 Coding sequence

Csnk2a1 casein kinase 2, alpha 1 polypeptide, transcript variant X2

Length: 1176 bp    Location: 1635285..1566550   Strand: -
>XM_004840631.1
ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACGCACAGACCCCGAGAGTACTGGGATTATGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAACTGGTTAGAAAACTAGGCAGGGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAGGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTAAGAGGAGGCCCCAATATCATCACATTGGCAGACATTGTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACATGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAAATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTGAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGGCTAATAGACTGGGGCCTAGCTGAGTTTTATCATCCTGGTCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGCCCTGAGCTACTTGTAGACTATCAGATGTATGATTATAGTTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTCCGGAAGGAGCCGTTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGATTATATTGACAAATACAACATTGAATTAGATCCCCGTTTCAATGATATCTTGGGCAGACACTCTCGTAAGCGATGGGAACGCTTTGTCCACAGTGAAAACCAGCACCTTGTCAGCCCAGAGGCCTTGGATTTCCTGGATAAGCTGCTGCGATATGATCACCAGTCACGGCTCACTGCAAGAGAAGCCATGGAACATCCCTATTTCTATACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCAGGGGGCAGTACACCTGTCAGCAGCGCCAACATGATGTCAGGGATTTCTTCAGTGCCAACCCCTTCACCCCTCGGACCTCTGGCAGGCTCACCAGTGATTGCTTCTGCCAACCCCCTTGGGATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA

XM_004841148.1 Coding sequence

LOC101717722 angiopoietin-4-like

Length: 1206 bp    Location: 1866047..1887837   Strand: +
>XM_004841148.1
ATGTTGCGGGGCAGCCTCTTCCTTCTGGTGGCCTCTATGACTGCAGCCAAAGGGAATGGAAAGCAGGTAGACAGTACCCAGAAGAACTGGCCACCCATGGTGCACATGTGGGAGTTGACTGGCAATTGGATAGGAAACCTGGAGAATGAGCTGAAGAACAGCATCCAGACAATGCAGAAGGTCCTGAACCAGTTGTTGCCCATGGAGAACAAGATGCTGGAGACTTTGCGTTCCATTGACAAGCAGGAGAAGCACATGCAGGAGCAGAGTGACATACTGAAAAACCTGCATGGCCACAACAGTTACCTGGATCCTATAATGGTCATCGCGGATGCACAGCAGCAGGTCCAGCTGGCCGGCCTCCACAATTTAAAGGAGCTGCTGCAGCAGCTGCTGGACCACCACAACAGCACTCTAACCAGCATCCAGGACAGCTTGCAAGCTGCCAGCAGCAACTCCAGCCTCCGGCATCAAAATCAACACCATCTTCTGGAGATCCTGCAGGAGCTCATTCACCTGGTGGACCAGGGCCCAGGTGCAGCTCTGTTGAAGTTCCAGGACTGTGAGGCCATCCGCAGGTCTGGGCTCAGTGCAGATGGTATCTACACCATCCTCGTTCCCAATGTGACAGAGCCCAAGAGGGTGTTCTGTGTGATGGGCACTGATGGAGGCGCCTGGACCATCGTTCAGCGCCGTGAGAACGGAACAGTGAATTTTGATCGGAACTGGGAGGATTACAAGCAGGGCTTTGGAGACCCAGATGGGGAGCATTGGCTGGGCAACGAGGTGGTGCACCAGCTCACCAACATCACTAAGTACTCTCTGCGTGTGGAGATGGAAGACTGGGAGGGCAACAAGTTCTACGCCAACTTCGGGCATTTTCAGCTGGGCAGCGAGGAGCAGTTTTACAGGATTTTTCTGGACCAGTACAGTGGTGCAGCAATGTATGAGAACCACCTGATCTTGGGGAACAACAACTTCAGCACCTATGATTCAGACCATGATGTTTGCACCTGCAATTGTGCACAGGCAATGACTGGAGGGTGGTGGTTTGACAGCTGCGGTGCCTCCAATCTCAATGGCATCTACTATCCAGCCGGAAATCACTTGCACAAGATTGATGGCATCCGCTGGCACCATTCCTTTGAGGATCCCACATATTCACTCAGTTCATCCCGCATGATGATCCGGCCCTTGCTCAGCTAG

XM_004841149.1 Coding sequence

LOC101718402 angiopoietin-4-like

Length: 1314 bp    Location: 2025081..2041537   Strand: +
>XM_004841149.1
ATGCTGCTGGGCAGCCTCCTCCTCCTGGTGGCCACCACGACTACCACCCAAGTGAAGGGACAGCAGGCAAACAGGCGTAGGCAGGTATATGGAATCCAGCATGACCAGTGCGGCTACACCATCTTGCTGCCTGAGCTCCCACACTCCCCACCAAAATCCACAGCTTTGAAGGCATCCAACAACACCCAGAACCAGCTACCCATCATTTGTGCAGGGCTGTTATCTGACCAACAAATGGAACAGCTGAAGAATGTACTGAAGTACAGCCCACAGAGGCTGCAGAAGGAGGCTGCTCTGGTTTCTGCCTGTGACCCAGCCCAATATCTCCCCAGCTGGAGATACATCCTGATCATCTTGAGACCAGACCTACCACTGGACCAGCAAAACATAGAGCAGACCCACCTGGCCCCCATGCTCCAGAACCAGACCCAGAAGCTGACAGGCATGGAGGATCAGGTCCTGAACCAGAAGTCATGCATGGAGATCCAGATGATGGAGATTCTACTGACCATCACCAAACTAGAGAAGCAGCTGCAGGAGCAGAGCTATGAGCTCAACCAGTTGCATGGCTGCAACAGGAAGTCTCCAGATGCAAATGTGGGTAGGACAGTGGGCTCACCCCCATGCAACCCTCCCCCCAGCGACCTGAAGACTAAGTTGCTCACCCTGAAGGTGCAGAAAGAGGCCCAGCTTGCCAGTATCCACAGCTTGAAGGCACAGCTGCCACAGCTGCTGAAACACCAGAGCTGCACCCTCACCAGCATCCAGCACAACCTACAAGCTGAAAGCAGCAACTCCAGCATTCTGCAGCAGAGGCAGCACCAATTCCTGGAGAACCTGAAGCAGCTCATGTGCCTGGTAGACCAGAGCCCAGGTGCAGCTGAGCAGGTATTCCGAGACTGTGAGGAGATCCATAGGTTTGGAGTCAATAAGGATGGCGTCTACACCATCCACATACCCAATCTGAACCAGGCCAAGAGGGTGTTCTGTGTGATGGGCACAGATGGAGGCACATGGACCGTCATCCAGCACCGGGAGAACAACAAAGTGGATTTTGAACGGAACTGGGAGGATTACAAGCAGGGCTTCGGAGACCCAGGGGAGCACTGTCTGGGCAACGAGGAGGTGCACCAGCTCACCAGCAGCGCAAAGTACTCTCTGCGTGTGGAGCTAAAAGACTGCCACGGCAACCCAGCCCACAGCAACTTCAAGCATTTCCAGCTGGGCAGTGAAGAACAGTTTTACAAGTGGGCTTGGGGCCCAGATGGCGGGCAGGCTGAGGTCCCTGGTGGGTGGGCTGTGTTCCAAGGCTAG

XM_004840638.1 Coding sequence

Fam110a family with sequence similarity 110, member A, transcript variant X1

Length: 930 bp    Location: 2078152..2066957   Strand: -
>XM_004840638.1
ATGGTCTCTTCAAGACCCAGGCCCTTGAGGTACGTGGCAGCCATGCCGGTGGACACGCTGACCCCGGGAGCCCCAGCCACTCCTGTTCTTCCTTTCCGCCTGCGGACCAAGTTTCCCAGCTACCTACTACGGAGGCCAGTGGATGGTGGAGCCCGGAAACTCAGTGCTGTGGAGCGCCTGGAGGCAGACAAGGCCAAGTATGTCAAGAGTCTGCACGTGGCCAACACCCGCCAGGAACCTGTACAGCCTCTGCTGTCTAAACAGCCACTCTTCAGCCCAGGGACTCGCAGAACGGTGCTCACACCCAGCCGCCGAGCCCTGCCTGGTCCTGGCTGCCGGCCCCAGTTAGACCTGGACATCCTTAGCAGCCTCATCAACTTGTGTGATAGCCCGGTGTCCACTGGTGAGGCCAGCTGTACCCCTGGACGAGCAGAGGGAACCCCCCAGCACCCCCCAGCCACTCCTCCACGCCCACTGTCCAGTACAACTGCTGTCCGCCGAGTGGACGTCCGCCCTCCACATGTGTCACCGGCTGGGCCCTGCCCATCACCAGGCACAACCGTTGCCTCCAGCCCAGTCTGGCCACAGAGTCTGAAGCGCTCTAAGTCTGACCTGAGCGAGCGCTTCTCCCGCGTAGCAGCTGACCTTGAGTGCTTTTTTAACTTCTGTGGCCTGGACCCAGAGGAGGCACGGGGGTTGGGGGTGGCCCACCTGGCTCGGGCCAGCTCGGACATCGTGTCCCTGGCGGGGCCCAGTGCTGAGCCTGGCAGTTCTGAGGGGGGCTACTCTGCCAGGAGCTCTGCTACAGTGGAGGAGCGTGCTCAGGAGCGGGTCCCCTATGGTGTGTCCGTGGTGGAGCGTAATGCCCGTGTGATCAAGTGGCTGTATGGCTTGCGGCAGGCACGGGAGACCCCTGCAGCTGAGGGCTAG

XM_004840640.1 Coding sequence

Fam110a family with sequence similarity 110, member A, transcript variant X3

High confidence: 4 potential gene matches
Length: 930 bp    Location: 2077799..2066957   Strand: -
>XM_004840640.1
ATGGTCTCTTCAAGACCCAGGCCCTTGAGGTACGTGGCAGCCATGCCGGTGGACACGCTGACCCCGGGAGCCCCAGCCACTCCTGTTCTTCCTTTCCGCCTGCGGACCAAGTTTCCCAGCTACCTACTACGGAGGCCAGTGGATGGTGGAGCCCGGAAACTCAGTGCTGTGGAGCGCCTGGAGGCAGACAAGGCCAAGTATGTCAAGAGTCTGCACGTGGCCAACACCCGCCAGGAACCTGTACAGCCTCTGCTGTCTAAACAGCCACTCTTCAGCCCAGGGACTCGCAGAACGGTGCTCACACCCAGCCGCCGAGCCCTGCCTGGTCCTGGCTGCCGGCCCCAGTTAGACCTGGACATCCTTAGCAGCCTCATCAACTTGTGTGATAGCCCGGTGTCCACTGGTGAGGCCAGCTGTACCCCTGGACGAGCAGAGGGAACCCCCCAGCACCCCCCAGCCACTCCTCCACGCCCACTGTCCAGTACAACTGCTGTCCGCCGAGTGGACGTCCGCCCTCCACATGTGTCACCGGCTGGGCCCTGCCCATCACCAGGCACAACCGTTGCCTCCAGCCCAGTCTGGCCACAGAGTCTGAAGCGCTCTAAGTCTGACCTGAGCGAGCGCTTCTCCCGCGTAGCAGCTGACCTTGAGTGCTTTTTTAACTTCTGTGGCCTGGACCCAGAGGAGGCACGGGGGTTGGGGGTGGCCCACCTGGCTCGGGCCAGCTCGGACATCGTGTCCCTGGCGGGGCCCAGTGCTGAGCCTGGCAGTTCTGAGGGGGGCTACTCTGCCAGGAGCTCTGCTACAGTGGAGGAGCGTGCTCAGGAGCGGGTCCCCTATGGTGTGTCCGTGGTGGAGCGTAATGCCCGTGTGATCAAGTGGCTGTATGGCTTGCGGCAGGCACGGGAGACCCCTGCAGCTGAGGGCTAG

XM_004840639.1 Coding sequence

Fam110a family with sequence similarity 110, member A, transcript variant X2

Length: 930 bp    Location: 2071907..2066957   Strand: -
>XM_004840639.1
ATGGTCTCTTCAAGACCCAGGCCCTTGAGGTACGTGGCAGCCATGCCGGTGGACACGCTGACCCCGGGAGCCCCAGCCACTCCTGTTCTTCCTTTCCGCCTGCGGACCAAGTTTCCCAGCTACCTACTACGGAGGCCAGTGGATGGTGGAGCCCGGAAACTCAGTGCTGTGGAGCGCCTGGAGGCAGACAAGGCCAAGTATGTCAAGAGTCTGCACGTGGCCAACACCCGCCAGGAACCTGTACAGCCTCTGCTGTCTAAACAGCCACTCTTCAGCCCAGGGACTCGCAGAACGGTGCTCACACCCAGCCGCCGAGCCCTGCCTGGTCCTGGCTGCCGGCCCCAGTTAGACCTGGACATCCTTAGCAGCCTCATCAACTTGTGTGATAGCCCGGTGTCCACTGGTGAGGCCAGCTGTACCCCTGGACGAGCAGAGGGAACCCCCCAGCACCCCCCAGCCACTCCTCCACGCCCACTGTCCAGTACAACTGCTGTCCGCCGAGTGGACGTCCGCCCTCCACATGTGTCACCGGCTGGGCCCTGCCCATCACCAGGCACAACCGTTGCCTCCAGCCCAGTCTGGCCACAGAGTCTGAAGCGCTCTAAGTCTGACCTGAGCGAGCGCTTCTCCCGCGTAGCAGCTGACCTTGAGTGCTTTTTTAACTTCTGTGGCCTGGACCCAGAGGAGGCACGGGGGTTGGGGGTGGCCCACCTGGCTCGGGCCAGCTCGGACATCGTGTCCCTGGCGGGGCCCAGTGCTGAGCCTGGCAGTTCTGAGGGGGGCTACTCTGCCAGGAGCTCTGCTACAGTGGAGGAGCGTGCTCAGGAGCGGGTCCCCTATGGTGTGTCCGTGGTGGAGCGTAATGCCCGTGTGATCAAGTGGCTGTATGGCTTGCGGCAGGCACGGGAGACCCCTGCAGCTGAGGGCTAG

XM_004840642.1 Coding sequence

Slc52a3 solute carrier family 52, riboflavin transporter, member 3, transcript variant X2

Length: 1407 bp    Location: 2100817..2106877   Strand: +
>XM_004840642.1
ATGGCCTTGCTGGTCCACCTGCTGGTCTGCGTCTTCGGGATGGGCTCCTGGGTGGCCATCAATGGGCTGTGGGTGGAGCTGCCCCTGCTGGTGACAGAGCTGCCTGAGGGCTGGAACCTGCCCTCCTACCTCACGCTGATCATCCAGCTGGCCAACATTGGGCCCCTGCTGGTCACCCTGCTGCATCGCTTCCGGCCTGGCTATCTCTCTGAAGTCGCCATCATCTTCACCATCCTGACCGTAGGCACTGTCACCTGTATCCTTTTTGCCTTCCTCTGGAACATGACCTCCAGAGTGCTGGGTGGCCGCCACAGCATTGCCTTCATCATCCTCACTTTCTTCCTGGCACTGGTGGACTGCACCTCCTCCGTCACCTTCCTGCCCTTCATGAGCCAGCTGCCCTCCTACTACCTCACTACCTTCTTTGTGGGTGAAGGATTCAGTGGCCTCCTGCCTGCACTGTTGGCTCTGGCCCAGGGCTCGGGTATCACCTCCTGTGTCAATGTCACGGACTCACTGGATGCCAACTCAAGCACTGTGACCACCAACGAGACCCACAGCACACAGGGAACCAGCAGCCCCACGGTGTGGACCCCCACGGTGTGGACCCCCACCAGCCACCTGGAGGGCCGCTACCTCCCCGCGCGCTTCTCACCACTGGTCTTCTTCCTGCTGCTGGCCGCCATGATGGCCTGCTGCCTCCTCGCCTTCTTCCTGCTCCAGCATCGGTCCCAGGCCCAGCAAGGTTCCATCGAGGACCTGCTTCAGTCCCAGGTCACCCTCCACTCCATCAGGCCGCAAGAGGAGAAAGACGCAGGCCCCCTAGACCCTGCAGAGAACAGCAAGGGGAAGGCACAACTGGAGGAGAAAGTGGCCACCCTGCACCCTGTGCAGCTGGCCTTCATCTACACGCTGGTGGCCTTTGTAAACGCACTCACCAACGGCGTGCTACCCTCTGTGCAGACCTACTCCTGCCTGTCCTACGGGTCTTTCACCTACCACCTGTCTGCCACCCTCAGCTCCGTGGCCAGCCCACTTGCCTGCTTCCTCTCCATATTCCTGCCTAACAGGTCTCTGCCTTTCCTGGGGGTCATCACTGTGCTGGGGACTGGCTTTGGGGCCTACAACATGGCCATGGCTGCGATGAGCCCCTGCCCCCTCCTCCAGGGCCACTGGGGGGGAGAAGTCCTCATTGTGATTTCTTGGGTGCTGTTCACTGCCTGTCTCAGCTACATCAAGGTCATGCTGGGAGTGATCCTGAGAGACCAGAGCCACAGCGCCCTCGTGTGGTGCGGGGCGGCGGTGCAGCTGGGCTCTCTGGTCGGGGCGCTGCTCATGTTCCCGCTGGTCAATGTGCTGAGGCTCTTCGTGTCTGCCGACTTTTGCAACCTGGATTGCTCTACCTAG

XM_004841150.1 Coding sequence

LOC101718756 angiopoietin-4-like

Length: 1650 bp    Location: 2175800..2124814   Strand: -
>XM_004841150.1
ATGCTCTCTGGGCCAGCCATGCTGCTGGGCAGCCTCCTCCTTCTGGTGGGCACCATGACTGCAGCCCAACAGATGGGACAGCAAGCAGGTAGCCATAAGCTGCAGTTTCATTTCAAGCATGATGAGTGCAGCTACACCTTCTTTCTGCCTGAGCCTCAGCCCTGCAGCCCGGAATCCACCACTGTGGGGGGCTCCTGCATCCCCCAGAAGAACCAGCCATCCATGATGCACATGAGGCTGTTATTCCACCATCAGATGGAAAAGCTGGAGAATGCACTAAGGAACAGCACACAGAGGCTGCAGAAGCTGGCAGAGAACATCCAGACCCTCTTTGGGTCAAAGCTGCAGCAGGCCCAGCAAAATATAGTTCAGAACCACACGGCCCCCATGCTGGAGCTGGACACCAGCCTCCTGAACCAGACCACAAACCAGACCCTCAAGCTGACTGACATGGAGGCTCAGGTCCTGAACCAGATGTCACACATGGAGCGCCAGATGCTGAACACTTCGCTGACCACTGACAAGCTGGAGAAGCAGCTGCAGAAGCAGAGAGGCACACTGGACCTGCTGCATGGCCACAACAGGTGGGTGCTAGCACCTGGTCCTGGTGGGACAGGAGCTGAGCCAGGACTCAAGCTTGGGACCCAGGCCGGAGCTGAGGCTGTGGCTGTGGTGGCAGCTGGACCCAGTAACCTGGAAACTCAGTTGGACAACATGGAGGCTCACCAGAAGGCCCAGCTGGAGGGCCTCCGCAGTGAAAAGGAGAATTTGTGGCAGCAACTGGACCAACATAGCAGCAGACTTGCCCGCATCCGTCAGGGCCTGGAAGCTCTGCGCAGTAACTCCAGCCTCCTGCAGCAGCAGCACCACCAGCTGCTGAAGAGCCTGCAACTCCTCAAACGCATGGTGGAGCAGAGCCCAGGTGAACTAGTGGGGCTTCTGGGGCAGGAGGCTGGTACAGCTGTGCAGAGGTTCCTGGACTGTGAGGATATCCGCAAGTTTGGGCTCAATAAGGATGGTGTCTACATCATCTTAGTGCCCAGTCTGAACCAGACCAAGAGGGATCCCAGCTGCTCCCTCTTCCCCCAGGTGTTTTGTGTGATGGACGCTGAAGGTGCCTGGACTGTCATCCAGCGCCGTAAGGACGGCACAGTGAATTTCCAGCGGAATTGGGAGGATTACAAGCAGGGCTTTGGAGACCCATCTGGGGAGCACTGGCTGGGCAACGAGGTGGTGCACCAGCTCACCAACAGCACTAAGTACTCTCTGCGAGTGGAGATGGAAGACTGGGATGGCAACACATTCTCTGCCAACTTCGAGCATTTCCAGCTGGGCAGCGAGGAGCAGTTTTACAGGATTTTTCTGGACAAGCACAGTGGCATGGCATCTCCCCGGGGTCACCTGATCATAGGGAACAACACCTTCAGCACCCGAGATGCAGACCATGACAACTGTGTCTGCAATTGTGCAGCGATGATGTCTGGAGGATGGTGGTTTGATGCCTGCGGCATCTCCAACCTCAATGGCGTCTACCACCCAGCCGGCCAGCACAAGCTCAAGATCAATGGCATCCGCTGGGACAGCTCCTCCCCAGGCTCTACCTCCTCACTCCGCACCTCTCGCATGATGATGCGGCCCTTGAACAGCTAG

XM_004840645.1 Coding sequence

LOC101699407 R-spondin-4-like

Length: 462 bp    Location: 2282380..2252491   Strand: -
>XM_004840645.1
ATGCGGGTGCCACTGTGTCTGCTGCTGCTTGTCGCCCACGCGGTGGACATGCTTGCCCTGCACCGAAGGAAGAAGCAAGAGGGCACAGGGCTGGGGTCCAAGTGTTCCCATTGTGTGATTGATTCATGCTGCAATGAGGAGAATGGCTGCTCCACCTGCCAGCAGAGGCTCTTCCTGCTCATCCGCCGTGAGGGCATCCGCCAGTACGGCAAGTGCGTGCACGACTGTCCACTCGGCTTCTTCGGCATCCGCGGCCAGGAGGTCAACAGGTGCAAAAAATGCGGGGCTACATGTGACAGCTGCTTCAGCCAGGACTTCTGCATCCGCTGCAAGAGACGATTCTTTCTGCACAAGGGGAAGTGTCTGCCCACCTGCCCACCAGGCACCTTGACCCACCAGAGCACCTGGGAGTGCCAGGATGACCACACCTATAAACCCTCAAAAGACAAACAGCAGGCCTGA

XM_004840647.1 Coding sequence

Tmem74b transmembrane protein 74B, transcript variant X1

Length: 699 bp    Location: 2460243..2455466   Strand: -
>XM_004840647.1
ATGGCATCTCCCCCTGGTCTGGAACTGAAGACACTGAGCAATGGTCCTCAGGTCCCAAGGAGACCGGCCCCACTGGGCCCAGTGGCCCCACCGAGGGCTGGGGTGGAGAATGCCTGTTTCACCTCAGAGGAGCATGAGACTAATTTCCAGAACCCTGGGGATGCCAGACTGGGCAGCTCCCCCAGTCCCCTGGGGAGTGTTTCCTCACTGCCCCGGTCCCAGCGGGACGATCTGTCCCTATATTCAGAGGAAGGGCCAGGTTTGGAGCCCGTGAGCCGCCCTGTGGATTATGGCTTCGTTTCTGCTCTGGTTTTCCTGGTGAGTGGGATCCTCCTGGTGGTAACAGCATATGCCATCCCCCGTGAGGCCCGCGTAAACCCGGACACAGTGACTGCAAGGGAGATGGAGCGACTAGAGATGTACTATGCCCGCCTGGGCTCCCACCTGGACAAGTGCATCATCGCGGGCCTGGGGCTGCTCACAGTGGGCGGCATGCTCTTGTCAGTGCTGCTCATGATCTCCCTGTGCAAGGGTGAGCTGTACCGCAGGAGGACCTTCGTCCCTGGCAGAGGCCCCAGGAAGACCTATGGCTCCATTAACCTTCGCATGAGACAGCTAAATGGGGATAGGGGCCAAGCACTGGTGGAGAACGAACTTATCCAAGTCTCGGAGGCCAGCCATACCCTCCAGGGGTCTTAA

XM_004841152.1 Coding sequence

Rad21l1 RAD21-like 1 (S. pombe)

Length: 1662 bp    Location: 2487839..2540878   Strand: +
>XM_004841152.1
ATGTTCTACACCCATGTGGTTATGAGTAGGCGAGAGCCACTGGCCAAAATATGGCTTGCAGCCCACTGGGAGAAGAAACTCACAAAGGCCCATGTATTTGAATGTAATCTAGAGATAACTATTGAAAAAATTATTTCACCTAAGGTAAAAATTGCACTTCGAACTTCAGGACACCTTCTTTTGGGAGTTGTTCGAATCTATGATAGGAAGGCAAAATATCTTTTGGCAGATTGCAGTGAAGCATTTCTTAAAATGAAGATGACATTCCGCCCAGGACTGGTTGACCTCCCAAAAGAGAGTTTTGAAGCAGCTTACAATGCTATTACATTACCAGAAGAGTTTCATGATTTTGACACCCATAATATAAATATGATTGACATTTCAGAGCACTTCACTCAGAACCAAAGCAGACCTGAAGAAATTACACTTAGAGAAGAGTATGGCAATGATCTACTTTTCCAAACCAAGAGCTTTGGGGAAGAATCTGAAATTCTCCGAAGACATAGTTTGTTTGATGACAACATATTATTGAACTCCAGGGGTCATTTTATTGAACATAGTCCTGGAAATCTTATTGAAGAAAAATCTTTGTTCTATGACAGTGGAGATGGATTTGGAGATGAAGGAGCTGCAGGAGAAATGATTGACAATCTATTGCAAGATGATGAGAATATCCTGTTGGAAGATATGCATTTAAACAGAGAAATTTCCCTGCCTCCTGATCCTCCTAGTACAATAGTAGAACCAGATAATCCAGATGGCATATGTCTACCTGAAAATGAAAAACTGGATGAAGCAACATTATTATCAAATGAAGAAGGAATATTTGCTCTTGAACCAACTGATGTTTCAGACCTTGCTGAGAAAAGGAAAAGCAAAAAGAGGAGATTGCTTATAGATCCAATCAAGGAGATCAGTAGCAAAACTATGCATAAACAGCTGACTTCCTTTTCGGACACACTCATGGTTTTAGAACTTGCACCTCCTACCCAAAGATTAATGATGTGGAAGAAGAGGGGAGGAGTGGATACACTTCTGTCAACTGCTGCCCAGGATTTGATTCATAGTGAACTGAAAGTGTTGTTTACAAAATGCTTTCTGGCCTCTGGCTTTAAACTTGGAAGAAAATTGACGCAGAAGAAGTCAGTAAGGGAAGGACTGGGAAGACAAAATGTAGTAGAGATCTCCATGATGGAAGAGCCAAATTCCCACCAAGAGTTAAGTCACCCCCACATTTGGAAGGATGTGATTGATGAGTTTAAGAGTAGCTCTAATGAGGATATCAGTAAAAATAGTAACTCTGAGCAGGATATTATTGAAATGATCCCTCAAGCTGCTGAGAAATCATCTATAAAGAATGCTTTCTTGGCCCAAGAATATTGTCCAGTGGAATTGGAGTCATCAGAGAATGAACAAAACAGTGAAGCTGAGAGATGGAATCAAAGATTATTTCAGATGTTAAATCGTTTACGGGAATCTAACAAGATGGGGATGCAGTCCTTTAGTCTGAAGAACCTTTGCAGAAATAGTGACCGAAAACAAGCTGCTACCAAATTTTGTAGCTTTCTTATCCTAAAAAAACAGCAGGTTATTGAGCTGAGTCAAAGTACTCCCTATGCAGATATTATAGCTACAGTAGGACCAATGTTCCATACAATGTGA

XM_004840653.1 Coding sequence

Snph syntaphilin, transcript variant X5

Length: 1590 bp    Location: 2578398..2622540   Strand: +
>XM_004840653.1
ATGGCCATGTCCCTGCCAGGGAGCAGACGGGCCTCTGCTGGATCCCGCAGTGGGGGCGCTTTGAGCCACAGTGGCCTGGCAGTGTTCGCTCAGTGCCCACAGCTGCCCCCCAGCCAGAATGAGCACCTGCCTCTTCTCCCTGCCTCCAGGCGCACCTCTCCACCCGTGAGCGTGCGGGATGCCTATGGTACCTCTTCCCTCAGCAGTAGCAGCAACTCAGGCTCCTGCAAGGGCAGCGACAGCAGCCCCACACCCAGGCGCTCCATGAAGTACACACTGTGCAGTGACAACCATGGCATCAAGCCCCCCACCCCGGAGCAGTACCTGACCCCCCTGCAGCAGAAAGAGGTGTGCATCCGGCACCTGAAGGCGCGGCTGAAGGACACACAGGACCGGCTCCAGGACCGGGACACAGAGATCGATGACCTGAAGACACAGCTATCACGCATGCAGGAGGACTGGATTGAGGAGGAATGCCACCGTGTGGAGGCTCAGCTAGCCCTGAAGGAAGCCCGCAAGGAAATCAAACAGCTCAAACAGGTCATTGACACTGTCAAAAACAACCTGATTGACAAAGACAAGGGGCTGCAGAAATACTTTGTGGACATCAACATCCAGAACAAGAAGCTAGAGACGCTGCTGCACAGCATGGAGGTGGCCCAGAATGGCATGGCCAAGGAGGAGGGCACTGGGGAGTCGGCTGGTGGTTCCCCTGCCCGCTCCCTCACCCGCAGTTCCACTTATACCAAGCTGAGTGACCCAGCTGTCTGCGGTGACCACCAGCCTGGTGATCCCTCCGCCTCTGCTGAAGATGGAACCGACAGTGGCTTTGTGGCTGCTGATGACACACTAAGCCGGACTGACGCTCTAGAGGCCAGCAGCCTGCTGTCATCAGGGGTGGACTGTGGCCCTGAGGAGGCCTCGCTGCACAGCTCCTTCAGCCTGGGTGCCCGCTTCCCTGCCAGTAACACCTATGAGAAGCTTCTGTGTGCCACAGAAGCTGGTGTGCAGGCCAGCTGCATGCAGGAGCGGGCCATCCAGACAGACTTTGTGCACTACCAACCCGACCTGGACACCATCCTGGAGAGAGTGACACAGGCCCAGGGCTGTGGGACAGTCCCTGAGGACAGGCACCCAGAGTCAGATTCCCACCCCCCAGGGCCCAGAGACCCCAACTCAGCAGTGGTGGTGACAATGGGTGATGAGCTTGAGGTCCCGCAGGCCATCACCCATGGGCCCACTGTACACCGGCCTGGAGCCAACCCCAACCCTGGTCTGTCGGTGAGTGTGGTATGCCCTGTGGAGGAGGAGGAGGAGGAGGTGGCCACGCCTGCGGCTACAGCTGAAAAGGAGCCCAAGAGCTACTGGAGTCGCCACTACATCGTGGATCTTCTGGCTGTGGTGGTGCCAGCCATGCCCACAGTAGCCTGGCTTTGCCGCTCCCAGCGACGCCAGGGCCAGCCCATCTACAACATCAGCTCCCTGCTGCGGGGCTGCTGCACTGTGGCCTTGCACTCCATCCGCAGGATGAGCTGCCGCTCTCTAGCCCACTCAGGGCCCAGTTCAGCAAGCAGTAGCTCCCAGCTCTGA

XM_004840649.1 Coding sequence

Snph syntaphilin, transcript variant X1

Length: 1722 bp    Location: 2609588..2622540   Strand: +
>XM_004840649.1
ATGCCTGGCAGCGGCCCCAGTGAGAGGATGACATGGCCCGGCCCGGCCTTCCCTGCTGGCCCCCCAACCTGCCCTCTTTCTTCAGCCCCAGGGACACCACCCATTCCACCCCTTACTCGGACCCGCAGCCTCATGGCCATGTCCCTGCCAGGGAGCAGACGGGCCTCTGCTGGATCCCGCAGTGGGGGCGCTTTGAGCCACAGTGGCCTGGCAGTGTTCGCTCAGTGCCCACAGCTGCCCCCCAGCCAGAATGAGCACCTGCCTCTTCTCCCTGCCTCCAGGCGCACCTCTCCACCCGTGAGCGTGCGGGATGCCTATGGTACCTCTTCCCTCAGCAGTAGCAGCAACTCAGGCTCCTGCAAGGGCAGCGACAGCAGCCCCACACCCAGGCGCTCCATGAAGTACACACTGTGCAGTGACAACCATGGCATCAAGCCCCCCACCCCGGAGCAGTACCTGACCCCCCTGCAGCAGAAAGAGGTGTGCATCCGGCACCTGAAGGCGCGGCTGAAGGACACACAGGACCGGCTCCAGGACCGGGACACAGAGATCGATGACCTGAAGACACAGCTATCACGCATGCAGGAGGACTGGATTGAGGAGGAATGCCACCGTGTGGAGGCTCAGCTAGCCCTGAAGGAAGCCCGCAAGGAAATCAAACAGCTCAAACAGGTCATTGACACTGTCAAAAACAACCTGATTGACAAAGACAAGGGGCTGCAGAAATACTTTGTGGACATCAACATCCAGAACAAGAAGCTAGAGACGCTGCTGCACAGCATGGAGGTGGCCCAGAATGGCATGGCCAAGGAGGAGGGCACTGGGGAGTCGGCTGGTGGTTCCCCTGCCCGCTCCCTCACCCGCAGTTCCACTTATACCAAGCTGAGTGACCCAGCTGTCTGCGGTGACCACCAGCCTGGTGATCCCTCCGCCTCTGCTGAAGATGGAACCGACAGTGGCTTTGTGGCTGCTGATGACACACTAAGCCGGACTGACGCTCTAGAGGCCAGCAGCCTGCTGTCATCAGGGGTGGACTGTGGCCCTGAGGAGGCCTCGCTGCACAGCTCCTTCAGCCTGGGTGCCCGCTTCCCTGCCAGTAACACCTATGAGAAGCTTCTGTGTGCCACAGAAGCTGGTGTGCAGGCCAGCTGCATGCAGGAGCGGGCCATCCAGACAGACTTTGTGCACTACCAACCCGACCTGGACACCATCCTGGAGAGAGTGACACAGGCCCAGGGCTGTGGGACAGTCCCTGAGGACAGGCACCCAGAGTCAGATTCCCACCCCCCAGGGCCCAGAGACCCCAACTCAGCAGTGGTGGTGACAATGGGTGATGAGCTTGAGGTCCCGCAGGCCATCACCCATGGGCCCACTGTACACCGGCCTGGAGCCAACCCCAACCCTGGTCTGTCGGTGAGTGTGGTATGCCCTGTGGAGGAGGAGGAGGAGGAGGTGGCCACGCCTGCGGCTACAGCTGAAAAGGAGCCCAAGAGCTACTGGAGTCGCCACTACATCGTGGATCTTCTGGCTGTGGTGGTGCCAGCCATGCCCACAGTAGCCTGGCTTTGCCGCTCCCAGCGACGCCAGGGCCAGCCCATCTACAACATCAGCTCCCTGCTGCGGGGCTGCTGCACTGTGGCCTTGCACTCCATCCGCAGGATGAGCTGCCGCTCTCTAGCCCACTCAGGGCCCAGTTCAGCAAGCAGTAGCTCCCAGCTCTGA

XM_004840655.1 Coding sequence

Snph syntaphilin, transcript variant X7

Length: 1515 bp    Location: 2609588..2622540   Strand: +
>XM_004840655.1
ATGCCTGGCAGCGGCCCCAGTGAGAGGATGACATGGCCCGGCCCGGCCTTCCCTGCTGGCCCCCCAACCTGCCCTCTTTCTTCAGCCCCAGGGACACCACCCATTCCACCCCTTACTCGGACCCGCAGCCTCATGGCCATGTCCCTGCCAGGGAGCAGACGGGCCTCTGCTGGATCCCGCAGGCGCTCCATGAAGTACACACTGTGCAGTGACAACCATGGCATCAAGCCCCCCACCCCGGAGCAGTACCTGACCCCCCTGCAGCAGAAAGAGGTGTGCATCCGGCACCTGAAGGCGCGGCTGAAGGACACACAGGACCGGCTCCAGGACCGGGACACAGAGATCGATGACCTGAAGACACAGCTATCACGCATGCAGGAGGACTGGATTGAGGAGGAATGCCACCGTGTGGAGGCTCAGCTAGCCCTGAAGGAAGCCCGCAAGGAAATCAAACAGCTCAAACAGGTCATTGACACTGTCAAAAACAACCTGATTGACAAAGACAAGGGGCTGCAGAAATACTTTGTGGACATCAACATCCAGAACAAGAAGCTAGAGACGCTGCTGCACAGCATGGAGGTGGCCCAGAATGGCATGGCCAAGGAGGAGGGCACTGGGGAGTCGGCTGGTGGTTCCCCTGCCCGCTCCCTCACCCGCAGTTCCACTTATACCAAGCTGAGTGACCCAGCTGTCTGCGGTGACCACCAGCCTGGTGATCCCTCCGCCTCTGCTGAAGATGGAACCGACAGTGGCTTTGTGGCTGCTGATGACACACTAAGCCGGACTGACGCTCTAGAGGCCAGCAGCCTGCTGTCATCAGGGGTGGACTGTGGCCCTGAGGAGGCCTCGCTGCACAGCTCCTTCAGCCTGGGTGCCCGCTTCCCTGCCAGTAACACCTATGAGAAGCTTCTGTGTGCCACAGAAGCTGGTGTGCAGGCCAGCTGCATGCAGGAGCGGGCCATCCAGACAGACTTTGTGCACTACCAACCCGACCTGGACACCATCCTGGAGAGAGTGACACAGGCCCAGGGCTGTGGGACAGTCCCTGAGGACAGGCACCCAGAGTCAGATTCCCACCCCCCAGGGCCCAGAGACCCCAACTCAGCAGTGGTGGTGACAATGGGTGATGAGCTTGAGGTCCCGCAGGCCATCACCCATGGGCCCACTGTACACCGGCCTGGAGCCAACCCCAACCCTGGTCTGTCGGTGAGTGTGGTATGCCCTGTGGAGGAGGAGGAGGAGGAGGTGGCCACGCCTGCGGCTACAGCTGAAAAGGAGCCCAAGAGCTACTGGAGTCGCCACTACATCGTGGATCTTCTGGCTGTGGTGGTGCCAGCCATGCCCACAGTAGCCTGGCTTTGCCGCTCCCAGCGACGCCAGGGCCAGCCCATCTACAACATCAGCTCCCTGCTGCGGGGCTGCTGCACTGTGGCCTTGCACTCCATCCGCAGGATGAGCTGCCGCTCTCTAGCCCACTCAGGGCCCAGTTCAGCAAGCAGTAGCTCCCAGCTCTGA

XM_004840651.1 Coding sequence

Snph syntaphilin, transcript variant X3

Length: 1722 bp    Location: 2609588..2622540   Strand: +
>XM_004840651.1
ATGCCTGGCAGCGGCCCCAGTGAGAGGATGACATGGCCCGGCCCGGCCTTCCCTGCTGGCCCCCCAACCTGCCCTCTTTCTTCAGCCCCAGGGACACCACCCATTCCACCCCTTACTCGGACCCGCAGCCTCATGGCCATGTCCCTGCCAGGGAGCAGACGGGCCTCTGCTGGATCCCGCAGTGGGGGCGCTTTGAGCCACAGTGGCCTGGCAGTGTTCGCTCAGTGCCCACAGCTGCCCCCCAGCCAGAATGAGCACCTGCCTCTTCTCCCTGCCTCCAGGCGCACCTCTCCACCCGTGAGCGTGCGGGATGCCTATGGTACCTCTTCCCTCAGCAGTAGCAGCAACTCAGGCTCCTGCAAGGGCAGCGACAGCAGCCCCACACCCAGGCGCTCCATGAAGTACACACTGTGCAGTGACAACCATGGCATCAAGCCCCCCACCCCGGAGCAGTACCTGACCCCCCTGCAGCAGAAAGAGGTGTGCATCCGGCACCTGAAGGCGCGGCTGAAGGACACACAGGACCGGCTCCAGGACCGGGACACAGAGATCGATGACCTGAAGACACAGCTATCACGCATGCAGGAGGACTGGATTGAGGAGGAATGCCACCGTGTGGAGGCTCAGCTAGCCCTGAAGGAAGCCCGCAAGGAAATCAAACAGCTCAAACAGGTCATTGACACTGTCAAAAACAACCTGATTGACAAAGACAAGGGGCTGCAGAAATACTTTGTGGACATCAACATCCAGAACAAGAAGCTAGAGACGCTGCTGCACAGCATGGAGGTGGCCCAGAATGGCATGGCCAAGGAGGAGGGCACTGGGGAGTCGGCTGGTGGTTCCCCTGCCCGCTCCCTCACCCGCAGTTCCACTTATACCAAGCTGAGTGACCCAGCTGTCTGCGGTGACCACCAGCCTGGTGATCCCTCCGCCTCTGCTGAAGATGGAACCGACAGTGGCTTTGTGGCTGCTGATGACACACTAAGCCGGACTGACGCTCTAGAGGCCAGCAGCCTGCTGTCATCAGGGGTGGACTGTGGCCCTGAGGAGGCCTCGCTGCACAGCTCCTTCAGCCTGGGTGCCCGCTTCCCTGCCAGTAACACCTATGAGAAGCTTCTGTGTGCCACAGAAGCTGGTGTGCAGGCCAGCTGCATGCAGGAGCGGGCCATCCAGACAGACTTTGTGCACTACCAACCCGACCTGGACACCATCCTGGAGAGAGTGACACAGGCCCAGGGCTGTGGGACAGTCCCTGAGGACAGGCACCCAGAGTCAGATTCCCACCCCCCAGGGCCCAGAGACCCCAACTCAGCAGTGGTGGTGACAATGGGTGATGAGCTTGAGGTCCCGCAGGCCATCACCCATGGGCCCACTGTACACCGGCCTGGAGCCAACCCCAACCCTGGTCTGTCGGTGAGTGTGGTATGCCCTGTGGAGGAGGAGGAGGAGGAGGTGGCCACGCCTGCGGCTACAGCTGAAAAGGAGCCCAAGAGCTACTGGAGTCGCCACTACATCGTGGATCTTCTGGCTGTGGTGGTGCCAGCCATGCCCACAGTAGCCTGGCTTTGCCGCTCCCAGCGACGCCAGGGCCAGCCCATCTACAACATCAGCTCCCTGCTGCGGGGCTGCTGCACTGTGGCCTTGCACTCCATCCGCAGGATGAGCTGCCGCTCTCTAGCCCACTCAGGGCCCAGTTCAGCAAGCAGTAGCTCCCAGCTCTGA

XM_004840652.1 Coding sequence

Snph syntaphilin, transcript variant X4

High confidence: 4 potential gene matches
Length: 1623 bp    Location: 2609590..2622540   Strand: +
>XM_004840652.1
ATGCCTGGCAGCGGCCCCAGTGAGAGGATGACATGGCCCGGCCCGGCCTTCCCTGCTGGCCCCCCAACCTGCCCTCTTTCTTCAGCCCCAGGGACACCACCCATTCCACCCCTTACTCGGACCCGCAGCCTCATGGCCATGTCCCTGCCAGGGAGCAGACGGGCCTCTGCTGGATCCCGCAGGCGCACCTCTCCACCCGTGAGCGTGCGGGATGCCTATGGTACCTCTTCCCTCAGCAGTAGCAGCAACTCAGGCTCCTGCAAGGGCAGCGACAGCAGCCCCACACCCAGGCGCTCCATGAAGTACACACTGTGCAGTGACAACCATGGCATCAAGCCCCCCACCCCGGAGCAGTACCTGACCCCCCTGCAGCAGAAAGAGGTGTGCATCCGGCACCTGAAGGCGCGGCTGAAGGACACACAGGACCGGCTCCAGGACCGGGACACAGAGATCGATGACCTGAAGACACAGCTATCACGCATGCAGGAGGACTGGATTGAGGAGGAATGCCACCGTGTGGAGGCTCAGCTAGCCCTGAAGGAAGCCCGCAAGGAAATCAAACAGCTCAAACAGGTCATTGACACTGTCAAAAACAACCTGATTGACAAAGACAAGGGGCTGCAGAAATACTTTGTGGACATCAACATCCAGAACAAGAAGCTAGAGACGCTGCTGCACAGCATGGAGGTGGCCCAGAATGGCATGGCCAAGGAGGAGGGCACTGGGGAGTCGGCTGGTGGTTCCCCTGCCCGCTCCCTCACCCGCAGTTCCACTTATACCAAGCTGAGTGACCCAGCTGTCTGCGGTGACCACCAGCCTGGTGATCCCTCCGCCTCTGCTGAAGATGGAACCGACAGTGGCTTTGTGGCTGCTGATGACACACTAAGCCGGACTGACGCTCTAGAGGCCAGCAGCCTGCTGTCATCAGGGGTGGACTGTGGCCCTGAGGAGGCCTCGCTGCACAGCTCCTTCAGCCTGGGTGCCCGCTTCCCTGCCAGTAACACCTATGAGAAGCTTCTGTGTGCCACAGAAGCTGGTGTGCAGGCCAGCTGCATGCAGGAGCGGGCCATCCAGACAGACTTTGTGCACTACCAACCCGACCTGGACACCATCCTGGAGAGAGTGACACAGGCCCAGGGCTGTGGGACAGTCCCTGAGGACAGGCACCCAGAGTCAGATTCCCACCCCCCAGGGCCCAGAGACCCCAACTCAGCAGTGGTGGTGACAATGGGTGATGAGCTTGAGGTCCCGCAGGCCATCACCCATGGGCCCACTGTACACCGGCCTGGAGCCAACCCCAACCCTGGTCTGTCGGTGAGTGTGGTATGCCCTGTGGAGGAGGAGGAGGAGGAGGTGGCCACGCCTGCGGCTACAGCTGAAAAGGAGCCCAAGAGCTACTGGAGTCGCCACTACATCGTGGATCTTCTGGCTGTGGTGGTGCCAGCCATGCCCACAGTAGCCTGGCTTTGCCGCTCCCAGCGACGCCAGGGCCAGCCCATCTACAACATCAGCTCCCTGCTGCGGGGCTGCTGCACTGTGGCCTTGCACTCCATCCGCAGGATGAGCTGCCGCTCTCTAGCCCACTCAGGGCCCAGTTCAGCAAGCAGTAGCTCCCAGCTCTGA

XM_004840656.1 Coding sequence

Sdcbp2 syndecan binding protein (syntenin) 2

High confidence: 4 potential gene matches
Length: 879 bp    Location: 2635362..2624776   Strand: -
>XM_004840656.1
ATGTCTGCTCTGTACCCATCTCTGGAGGACCTGAAGGTGGACCAAGTCATCCAGGCCCAAACCAGAGCCTCGCCCAAGATGCTCACCTTGCCTATGCAGGAGGCAACTGGCTCCCCACCTTCAGTTCTGTACCCAAACTTGGGAGAACTGGAGAGCTACATGGGTCTTTCCCTCTCCAGCCAACAAATCCAGCAGAGCCTGCTTCAGCTCCCAGAGGGTGACAATACGGCGGTCTCTGGGCCCTGGCCCGGCCAGCTGGTGGCGCCGGTGTCCGGGAACAACCTGGGCATGCGGCGTGCGGAGATCAAGTCTGGAGTGCGGGAGATCCACCTGTGCAAAGATGAGCGTGGCAAGACTGGGCTGCGGCTGCGGGCCATAGACAAGGGGCTCTTCGTGCAGCTGGTCCAGGCCAACACCCCTGCATCCCTGGTGGGGCTGCGCTTTGGGGACCAGATCCTGCAGATTGACGGGTGTGACTGTGCTGGGTGGAGCACAGACAAAGCCCACCGGGTGCTGAAGAAGGCTTCAGTAGAGAAGATTGTCATGGTTGTTCGGGACAGGCCATTCCAGCGGACAGTCACGATGCACAAGGATGGCTTGGGCCATGTTGGCTTCTTCATCAAGAAGGGGAAGGTTGTGTCTGTGGTCAAAGGGAGCTCTGCGGCCCGCAACGGGCTCCTCACCAGCCACTGCATATGCGAGGTGAACGGGCAGAATGTCATTGGACTGAAGGACAAAGCAATCATGGAGATACTGGCAACAGCTGGAGATGTCATCACCCTGACCATCATTCCCGCTGTGATCTACGAGCACATGGTGAAAAAGTTGTCCCCGATGCTGCTCCACCACACCATGGACCACTCTATCCCAGATGCCTGA

XM_004840659.1 Coding sequence

Nsfl1c NSFL1 (p97) cofactor (p47), transcript variant X2

High confidence: 3 potential gene matches
Length: 1113 bp    Location: 2774031..2749501   Strand: -
>XM_004840659.1
ATGGCGGCGGAACGACAGGATGCGCTGAGGGAGTTTGTGGCGGTAACGGGCGCTGAGGAGGACCGGGCCCGCTTCTTCCTCGAGTCGGCCGGCTGGGACCTGCAGATTGCGCTAGCGAGCTTTTATGAGGACGGAGGGGACGAAGACATTGTGACCATTTCACAGGCAACCCCCAGTTCAGTGTCCAGAGGCACAGCCCCCAGTGATAATAGGGTGACATCCTTCAGAGACCTTATTCATGACCAAGATGAGGATGACGAAGAGGAAGAGGGCCAGAGGTTTTATGCTGGGGGCTCAGAGAGAAGTGGACAACAGATTGTTGGCCCTCCCAGGAAGAAAAGTCCCAACGAGCTGGTGGATGATCTCTTTAAAGGTGCTAAGGAGCACGGAGCTGTAGCTGTGGAGCGAGTGACCAAGAGCCCTGGAGAGACCAGTAAACCAAGACCCTTTGCAGGAGGTGGCTACCGTCTTGGAGCAGCACCAGAGGAAGAGTCTGCCTATGTGGCAGGAGAAAGGAGACAGCATTCCAGCCAGGATGTTCATGTCGTTCTGAAGCTCTGGAAAAGTGGATTCAGCCTGGACAATGGCGAGCTCAGAAGCTACCAAGACCCATCCAATGCCCAGTTTCTGGAGTCAATCCGCAGAGGGGAGGTGCCAGCAGAGCTGCGGAGGTTAGCTCATGGTGGGCAGGTGAACTTGGATATGGAAGACCATCGGGATGAGGACTTTGTGAAGCCTAAGGGAGCTTTCAAAGCTTTCACTGGTGAAGGCCAGAAACTCGGCAGCACAGCCCCCCAGGTATTGAGTACCAGCTCTCCAGCCCAGCAGGCAGAAAATGAAGCCAAAGCCAGCTCTTCTGTCTTAATCAACGAGTCAGAGCCTACTACCAACATCCAAATTCGACTTGCCGATGGTGGGAGACTGGTACAGAAATTTAACCACAGCCACAGGATCAGCGACATCCGACTTTTCATCGTGGATGCCCGGCCAGCCATGGCTGCCACCAGCTTTGTCCTCATGACTACCTTTCCAAACAAAGAGCTGGCTGACGAGAGCCAAACTCTGAAGGAAGCCAACCTACTCAATGCTGTCATCGTGCAGCGGTTAACATAA

XM_004841153.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1290 bp    Location: 2825857..2787436   Strand: -
>XM_004841153.1
ATGGCACCCAGATGGAGGCAAGAACTCCATGAGTTGAAGGAAGACACAAGTCCTCCTGACTCTTCCAAATCTGACCTTGGCTTTGAAGGAACATGTTGCAGCACTCATCTTTGCCCCCACACCTTGAGTAATGTTCTCCAGTTCCAGCAGCCGAGGACAAGGGAATCAGAAACAGCCTCATCCACAGACCCCACCACAGACTCCAACAGCCTCCAGAGAGCAATTGCCTGCCAGTCCTGGGGACCACACAAAGCACCGTGTTCTCCTCACGATGCCTCCTCCACTTCTCTGGTTCACTCACCTCGCTGCTCCCTGTTGCTGGTACTGTTCCTTGACCTAACAGGAGCCTCTGAGCAGAGCAATGGGAGTGAACAGCAGCAGGTGCTACAACCCGAGGGCCCAATGCTGGTGGCAGAAGGTGACACCCTCTTACTGAGGTGTATGGTGGTGAGCTCTTGCATTGATGATATGATAAAATGGGTCAAGGTGAACAGTCAGGACCAACAGGAAATTTATAACTTCAAACATGGCATTTTTCCTGGGGTGATGCCTATGATCCAGAGGACATTAGAGCCCCTGAACTGTGATTATTCCATCTACATCCACAATGTCACTAAGGAGCATGCTGGAACCTACCACTGCCTGTGTGAGTTCTCAGAAGATAAGCTGGATAAAGGCACCTCTGTGTTTGTGAAGGGAGCTGGAGACTCCAGGCTAGACCTCTGGATTATCCAACCCCAGGAGCTGGTGCTGGTGATCGTTGGTGACACTGTCCTCCTAAACTGCACAGTGCTTGGATATGGTCCCCCTGGCCCCATCAGGTGGTTCCGAGGGACTGGTCTGAGCCGAGAGGCCATTTACAATTTTGAAGGCATCTCCCACCCCAATGTCACAGCAGTGCGCGGCTCCAACAATGACTTCAGTATTCTTCTCCATGGTGTCTCCATTGAGGATGCAGGCACCTACTACTGTGTAAAATTTCATAGGAAACCCAACATTCAATATCTGTCTGGACAGGGCAGCAGGCTGAGAGTAAAAGCAAAACCTATTTCTCTAGAGAAAGAATTCACCGATGAACCTGCACCCCAGATATCTCTGACAGGCCTCCTGTCTGTGTTCACACCTGTGGTCCTGGGGCTGAAGACAGTGACCTTGGCTATACTCCTACTGGCCCTGTCTGCCTGCCAGAGAAGTTCTGGATGAGAAGACTTCTAGACCTCANNGCCTCAGAAAGCTGTGCACAGATTAGAATGGACAAGAGGCAAGAGTAAAGTGTCAGCCTATTTGTAG

XM_004921063.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1311 bp    Location: 2891534..2827756   Strand: -
>XM_004921063.1
ATGATGCCTATCCCTGCCTCCCAGCTCCAGCCTCCTTGTCTTGTCCTGTTGCTGTCCTTCCTGCTCAGACTCACAGGAGCAGCCACAGAGAAGAATCTGCAGGTGATTCAGCCTGAGAAGCCAGTGTTGGTTGCTGCCAGAGAGACAGCCACTCTGCACTGCACTGTGACCTCTCTGCTCCCTGTGGGTCCCATCAAATGGTTCAGGGGGCAAGGACAATGCCGTGAGCTAATCTACAATTACCAGAGAGGCCATTTTTCCAGAATCACAAATCTTTCAGACACCACAAAGAGAGACACCATGGACTTTTCCATCCGCATCAGTAACATCACTCCAGCAGACGCTGGCACCTACTACTGTGTGAAGTTCGAGAAAACCAGCTCTGGGGACACAGAGTTTCAGTCTGGAGGAGGCACTGAGTTGTCTGTGTGTACCAGACCCTCTCCTCCTGTGTTATCTGGTCCTGTGGCTAAAGCTACANCTTGGACAACAGCAAACTTCACATACAAGTACCACAGCTTCTCCCCCTGAGTTGTCACCCTAGGGTGATTCAAAAATGAGAGTGAACTCTTCAACTTCCAGACCACTGTGGACCCTATGGGAGAANCTATCTCCTATAGCATCTTTAGCACAACCACTGTGGTGCTGGACCGANAGGATATTTTCTTTCAGGTCACCTGTGAGGTGGACCATGTTCACAAAGATGCTGCTGCTGATCCTTATATCTGCCATCTACATCTACAAGAAACAGAAGACCTGACTTGGTTGGTTTGCCCTACTGCTTTTGGGACTTTGCTGAGGCAGCACGTCATGGTGGGAGTGTGTGGGAGTGGAAGATGCTTACCTCATAAGGCTTGGGAGCAAAATGAGAGATTAAGAAACTGCAGTCCCAATACCATTGGTAAATGTGCACAGATTCTGAAAGCAGTGGTGTGGACCAGAGAAGCATGGCTTCAGAACTATGTTGTGACCTCCCTTCTCCCCATGAGACCTGTTGAGTGGTTCAGGGCTTCTGCACCAGGCCAGCAGTTGATCTACAGTTTCAATGGAGGCCATTTTCCTCTGCTAACAAGTATTTCAGATATCACCAAGAGAAACAACAGCTTCTCCATCCTCGTCAGGAACCTCACCACAGCAGACACTGGCACCTACTACTGTGTGAAGTTCCAGAAAAGATACCTTGACACCATGGAAATTAAGTCTGGACCTCCCTGCATATGCCAAAATATGGAAAATGAAACTATAAATATTAAAAGAAAACATGTGGGTTCTTTTATAGTGCGGAAATGGGAGGACCTTTCCCAACTATAA

XM_004840661.1 Coding sequence

Sirpa signal-regulatory protein alpha, transcript variant X1

High confidence: 1 potential gene match
Length: 1527 bp    Location: 3158645..3202018   Strand: +
>XM_004840661.1
ATGGAGCCCGCCGGCCCGGCCCCCGGCCGCTTCGGGCCGCTGCTCTGCCTGCTGCTCGCGTCTTGTGCCTGGCCAGGAGCAGCCGCAGAGGAGACTCTGCAGGTGATTCAACCTGAAAACCCAGTGTTGGTCGCTGCTGGAGAGACAGCCACTCTGCGCTGCACTGTGACCTCCCTGCTCCCTCTGGGGCCCATCCGATGGTTCAGGGGGAAAGAACCAGGCCGGGAGTTAATCTACAATTTCAAAGGAGGCCACTTCCCCCGAGTCACAAATGTGTCAGACAACACACAGAGAGACACCAAGGACTTTTCCATCCGTATCAGTAACGTCACCCCAGTAGACGCTGGTACCTACTACTGTGTGAAGTTCGAGAAAACCACCTCTGAGGACACGGAATTTCGGTCTGGAAGAGGCACTGAGTTGTCTGTGCGTGCCAAACCCTCTCCCCCTGAGGTGTCAGGCCCTATGGCGAGGGCCACACCTGGCCAGACAGTGAGCTTCACCTGCAAGTCCCATGGCTTCTCCCCCCGAGACATCAGCCTGAAGTGGTTCAAAAATGGGAACGAGCTCTCCGACTCCCAGACCAGCGTGGATCCCATGGGAAAAATCATCTCCTACAGCATCTCCAGCACAGCCAAGGTGGTGCTGGCTCCTGGGGACGTTCACTCGCAGGTCATCTGTGAAGTGGCCCATGTCACCTTGCAGGGGGGCCCTCTTCGTGGGATTGCCAACTTATCAGCCAGCATCCGAGTTCCACCCACCTTGGAGGTCACCCAGCAGCCCACAATGACAGAGAACCAGGTGAACGTCACCTGCCAGGTGAAGAAGTTCTACCCCCAAAGACTGAAGCTCACCTGGTTGGAGAATGGAAATGTGTCCCGGACAGAAACGTCCTCTAATGTCACAGAGAACAAGGATGGGACCTACAACTGGACAAGCTGGATCTTGGTGAATTTATCTACTCACAGGGAGAAAGTAGTGCTCACCTGCCAGGTGGAGCATGATGGGCAGCCAGCAGCCACCAGAAACCTGACCGTGCCAGTCTCTGTCCCCACAAAAAAGGAGGGCATGGATACCACCCCTGAGAAAAATGCCAAAGACAACTGGAACATCTTTATCGTGGTGGGTGTGGTGTGCACCTTGTTGGTAGTCCTGCTGATGGCGACCCTCTACCTCCTCCGAATCAGGCAGAAAAAAGCCAAGGGATCCACTTCTTCTACAAGGTTGCATGAGCCCGAGAAGAATGCCAGAGAAATCACACAGATCCAGGACACAAATGACATCAATGACATCACATATGCAGACCTGAATCTGCCCAAAGACAAGAAGCCTGCTCCCAGGGCTGCCGAGTCCAACAACCACACGGAGTATGCCAGCATTCAGACAGGCCCACCGCCCCGGCCAGAGGACACCCTCACCTACGCTGACCTGGACATGGTCCACCTCAACCGGGCGCCCAAACAGTCGGCCCCCAAACCTGAGCCGTCCTTCTCAGAGTATGCCAGCGTCCAGGTCCAAAGGAAGTGA

XM_004840662.1 Coding sequence

Sirpa signal-regulatory protein alpha, transcript variant X2

Length: 1521 bp    Location: 3158689..3202018   Strand: +
>XM_004840662.1
ATGGAGCCCGCCGGCCCGGCCCCCGGCCGCTTCGGGCCGCTGCTCTGCCTGCTGCTCGCGTCTTGTGCCTGGCCAGGAGCAGCCGCAGAGGAGACTCTGCAGGTGATTCAACCTGAAAACCCAGTGTTGGTCGCTGCTGGAGAGACAGCCACTCTGCGCTGCACTGTGACCTCCCTGCTCCCTCTGGGGCCCATCCGATGGTTCAGGGGGAAAGAACCAGGCCGGGAGTTAATCTACAATTTCAAAGGAGGCCACTTCCCCCGAGTCACAAATGTGTCAGACAACACACAGAGAGACACCAAGGACTTTTCCATCCGTATCAGTAACGTCACCCCAGTAGACGCTGGTACCTACTACTGTGTGAAGTTCGAGAAAACCACCTCTGAGGACACGGAATTTCGGTCTGGAAGAGGCACTGAGTTGTCTGTGCGTGCCAAACCCTCTCCCCCTGAGGTGTCAGGCCCTATGGCGAGGGCCACACCTGGCCAGACAGTGAGCTTCACCTGCAAGTCCCATGGCTTCTCCCCCCGAGACATCAGCCTGAAGTGGTTCAAAAATGGGAACGAGCTCTCCGACTCCCAGACCAGCGTGGATCCCATGGGAAAAATCATCTCCTACAGCATCTCCAGCACAGCCAAGGTGGTGCTGGCTCCTGGGGACGTTCACTCGCAGGTCATCTGTGAAGTGGCCCATGTCACCTTGCAGGGGGGCCCTCTTCGTGGGATTGCCAACTTATCAGCCAGCATCCGAGTTCCACCCACCTTGGAGGTCACCCAGCAGCCCACAATGACAGAGAACCAGGTGAACGTCACCTGCCAGGTGAAGAAGTTCTACCCCCAAAGACTGAAGCTCACCTGGTTGGAGAATGGAAATGTGTCCCGGACAGAAACGTCCTCTAATGTCACAGAGAACAAGGATGGGACCTACAACTGGACAAGCTGGATCTTGGTGAATTTATCTACTCACAGGGAGAAAGTAGTGCTCACCTGCCAGGTGGAGCATGATGGGCAGCCAGCAGCCACCAGAAACCTGACCGTGCCAGTCTCTGTCCCCACAAAAAAGGAGGGCATGGATACCACCCCTGAGAAAAATGCCAAAGACAACTGGAACATCTTTATCGTGGTGGGTGTGGTGTGCACCTTGTTGGTAGTCCTGCTGATGGCGACCCTCTACCTCCTCCGAATCAGGCAGAAAAAAGCCAAGGGATCCACTTCTTCTACAAGGTTGCATGAGCCCGAGAAGAATGCCAGAGAAATCACACAGGACACAAATGACATCAATGACATCACATATGCAGACCTGAATCTGCCCAAAGACAAGAAGCCTGCTCCCAGGGCTGCCGAGTCCAACAACCACACGGAGTATGCCAGCATTCAGACAGGCCCACCGCCCCGGCCAGAGGACACCCTCACCTACGCTGACCTGGACATGGTCCACCTCAACCGGGCGCCCAAACAGTCGGCCCCCAAACCTGAGCCGTCCTTCTCAGAGTATGCCAGCGTCCAGGTCCAAAGGAAGTGA

XM_004840672.1 Coding sequence

Nop56 NOP56 ribonucleoprotein

High confidence: 1 potential gene match
Length: 1788 bp    Location: 3803099..3808439   Strand: +
>XM_004840672.1
ATGGTTCTGCTGCACGTGCTTTTCGAGCACGCGGTCGGCTACGCGCTTTTGGCGCTGAAGGAAGTAGAGGAGATCAGTCTGTTGCTGCCTCAGGTGGAGGAGTGTGTGCTCAACCTGGGCAAGTTCCACAACATCGTTCGCCTGGTGGCCTTTTGTCCATTTTCCTCTTCCCAGGTTGCCTTAGAAAATGCCAATGCAGTGTCTGAAGGCATTGTTCATGAGGATCTCCGTCTGCTCCTGGAGACCCATCTGCCATCCAAAAAGAAGAAAGTACTCTTGGGGGTTGGGGACCCCAAGATTGGTGCTGCTATACAAGAGGAGTTGGGATACAACTGCCAGACTGGAGGCGTAATAGCTGAGATCCTGCGAGGAGTTCGTCTACACTTCCATAATCTGGTTAAAGGTCTGACAGATCTGTCAGCCTGTAAAGCGCAGCTAGGCCTGGGACACAGCTACTCTCGTGCCAAAGTTAAATTTAATGTGAACCGGGTAGACAACATGATCATCCAGTCCATCAGCCTCCTGGACCAACTGGATAAAGACATCAATACCTTTTCTATGCGTGTCAGGGAGTGGTATGGTTATCACTTTCCAGAGCTAGTGAAGATCATTAATGACAATGCTACATACTGCCAACTTGCTCAGTTCATTGGAAACCGAAGGGAGCTGAATGAGGAAAAATTGGAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAGGCCAAGGCTATTCTGGATGCCTCACGGTCCTCCATGGGCATGGACATATCTGCCATCGACTTGATAAACATCGAGAGCTTCTCCAGTCGAGTGGTGTCTTTGTCAGAGTATCGCCAGAGCCTACACACTTACCTCCGTTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGCGCACGTCTCATTGCTCACGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCGTCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGAGCCCTGAAGACAAGGGGTAACACACCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAGTGCAGTATTGCCTCCAGAATTGATTGCTTCTCTGAGGTGCCCACCAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTTGAGGAGCGCCTGTCCTTCTATGAGACTGGCGAGATTCCACGGAAGAATCTGGATGTCATGAAAGAGGCAGTGGTTCAGGCAGAGGAAGCTGCTGCTGAAATCACCAGGAAGCTAGAGAAACAGGAAAAGAAGCGCTTGAAGAAGGAAAAGAAGCGGCTGGCTGCACTGGCTGCTCTGGCATCTTCAGAAAACGGCAGTACTCCAGAGGAGCATGAGGAGACACAGGAAAAACCCAAAAAGAAAAAGCAAAAGCTCCAGGAGGCTCCTCAGGAGAATGGAATGGATGATCCATCTGTCTCAGTCTCCAAACCCAAAAAAAAGAAATCTTTTTCCAAGGAAGAGTTGGTTAGTAGTGATCTGGAAGAGACAGCTGGTGGCAGCATAAGTCCACCCAAAAGGAAAAAGTCTTTGCCCAAGGAGGAAACTGCTAGTGAACCAGAGGAGGCAGCCAGGAGTGTCCCCAAGAAAAAGAGAAAATTTTCTTCCAAGGAAGAGCCAGTCAGCAGTGGGTCTGAGGAGGCTGCTGCCAGCAAGGGCAGTGCCAAGAAAAAGAAAAAGCTCCAAAGAGCACCCCAGGAAGATTAG

XM_004840669.1 Coding sequence

Idh3b isocitrate dehydrogenase 3 (NAD+) beta, transcript variant X1

Length: 1152 bp    Location: 3814226..3808784   Strand: -
>XM_004840669.1
ATGGCGGCTTTGAACGGTGTCCGCTGGCTGACCCGAGCAGTGGTTGCCGTCCGGAGCCCTGGGGCATGGAGAGGTCTGAGTATTTCAGTCACAGCGAATGCAGCTTCTCAGGCTCAAGACATGAAAGTCGAGGGCGCATTTCCTGTGACCATGCTGCCGGGAGATGGCGTTGGGCCGGAGCTCATGCATGCTGTCAAGGAGGTGTTCAAGGCTGCTTCTGTCCCAGTGGAGTTCCAGGAGCACCACCTGAGTGAGGTGCAGAATATGGCCTCTGAGGAGAAGCTGGAGCAGGTGCTGAATTCCATGAAGGAGAACAAAGTGGCCATCATTGGAAAGATCCATACCCCAATGGAGTATAAGGGGGAACTAGCTTCCTATGATATGCGGCTAAGGCGTAAGTTGGATTTGTTTGCCAACGTAGTCCATGTGAAGTCCCTTCCTGGGTACATGACTCGGCATAACAATCTAGATCTGGTGATTATTCGAGAGCAGACAGAAGGGGAATACAGCTCTCTGGAGCATGAGAGTGCAAGGGGTGTGATTGAATGCTTAAAGATTGTTACTCGAACCAAATCTCAGCGGATTGCAAAGTTTGCCTTTGACTATGCCACCAAGAAGGGGCGGAGCAAGGTCACAGCTGTCCATAAGGCCAATATCATGAAACTTGGGGATGGGTTGTTCCTGCAGTGCTGTGAGGAAGTTGCTGAACTGTATCCCAAAATCAAGTTTGAGACAATGATCATAGACAACTGCTGCATGCAGCTGGTGCAGAATCCTTACCAGTTTGATGTGCTTGTGATGCCCAATCTCTATGGGAACATTATTGACAATCTGGCTGCTGGCCTGGTTGGGGGAGCTGGTGTGGTCCCTGGTGAGAGCTACAGTGCCGAGTATGCAGTTTTTGAGACGGGTGCCCGACATCCATTTGCCCAAGCAGTGGGCAGGAATATAGCCAACCCCACAGCCATGTTGCTGTCAGCTTCCAACATGCTTCGGCATCTCAATCTTGAGTATCACTCCAGCACGATTGCTGATGCAGTGAAGAAGGTGATCAAAGTTGGCAAGGTGCGGACTCGAGACATGGGCGGCTACAGCACCACAACCGACTTCATCAAGTCTGTCATCGGCCATCTACACCCCCATGGGGTCTAG

XM_004840688.1 Coding sequence

Pced1a PC-esterase domain containing 1A, transcript variant X5

Length: 1362 bp    Location: 3960352..3953955   Strand: -
>XM_004840688.1
ATGGTCTTCTGTCTGGAAAGCGAGGTGCTGCGCCGCCCGCTGCGAAGCGCCATGGTCCACTTCCAAGCTTCAGAAGTCCAGCAGCTGCTACACAACAAGTTCGTCGTCATCTTGGGGGACTCCATCCAGAGAGCTGTGTATAAGGATCTGGTGCTTCTGCTCCAGAAAGACTCGCTGCTCACAGTTGCCCAGTTGAAAGCCAAGGGGGAGCTGAGCTTTGAACAGGACCAGCTGGTGGCTGGGGGCCAGCTGGGTGAGCTGCACAACGGGACACAGTATCGTGAAGTCCGCCAGTTCTGCTCCGGTTCTGGCCATCACCTTGTGCGGTTCTACTTCCTCACCCGAGTTTACTCTGAGTACCTGGAGGATGTTCTGGAGGAGCTGACATATGGGCCTGCCCCGGACCTGGTGATCATCAACTCTTGCCTTTGGGATCTCTCCAGGTATGGCCGCTGTTCAATGGAGAGCTACCGAGAGAATCTGGAACGAGTATTCATACGCATGGACCAGGTGTTGCCAGACTCCTGTCTGCTGGTGTGGAACATGGCGATGCCCCTGGGAGAGCGTGTCACTGGAGGTTTCCTACTGCCAGAGCTCCAGCCCCTGGCAGCCACTTTGCGACGGGATGTGGTTGAGGGGAACTTCTATAGTGCTACACTGGCTGGGGACCACTACTTCGATGTTCTGGATCTCCACTTTCATTTCCGGCACGCAGTACAGCACCGTCATCGAGATGGTGTCCACTGGGACCAACATGCACACCGCCACCTCTCACACTTGCTTCTGACCCATGTGGCCGATGCTTGGGGCGTAGAGCTGCCCACGAGGGACCATCCCCCTGAACCATGGATTGAGGACTGGCCAGAGATGGATCATCCGTTCCAGGGAAGCCATAGGCAGCCCCCAGACTTCGGGGAGCAGCTGGCCTTACCCCCACCCCCACCCCCTCCTTTACCCCCTCCTATGTCTTTTTCCTACCCTCTTCCACAACCTTCACCACCTCCCTTGTTCCCACCCCTGCCCCAGGATACCTCTTTTTACCCAGGCCAGCCCTTCCCACCCCAGGAATTCTTCAGTTATAATCCAATAGAAGACTTCTCGATGCCACCCAATTTAGGGTGTGGCTCTCGAGTGAACTTTGTGCCTGGTCCCCTGCCACCTCCAGTCCCTGGCTCTGTCTCCCACGGTCAGCACCGGGGCCCAGTGGTCCACCGGGGGATGCCACGCTGTGTTCCCAACAGCCCCTACCATGTGCCAAGATTGGGGGGTCTCTGTAGACGACTCAGGCACTCAGACAGACTGATCCACACATACAAACTGGACAGGCGAGGACATACCCATTCAGGAACATGGCCTGGGTAG

XM_004840687.1 Coding sequence

Pced1a PC-esterase domain containing 1A, transcript variant X4

Length: 1362 bp    Location: 3960352..3953955   Strand: -
>XM_004840687.1
ATGGTCTTCTGTCTGGAAAGCGAGGTGCTGCGCCGCCCGCTGCGAAGCGCCATGGTCCACTTCCAAGCTTCAGAAGTCCAGCAGCTGCTACACAACAAGTTCGTCGTCATCTTGGGGGACTCCATCCAGAGAGCTGTGTATAAGGATCTGGTGCTTCTGCTCCAGAAAGACTCGCTGCTCACAGTTGCCCAGTTGAAAGCCAAGGGGGAGCTGAGCTTTGAACAGGACCAGCTGGTGGCTGGGGGCCAGCTGGGTGAGCTGCACAACGGGACACAGTATCGTGAAGTCCGCCAGTTCTGCTCCGGTTCTGGCCATCACCTTGTGCGGTTCTACTTCCTCACCCGAGTTTACTCTGAGTACCTGGAGGATGTTCTGGAGGAGCTGACATATGGGCCTGCCCCGGACCTGGTGATCATCAACTCTTGCCTTTGGGATCTCTCCAGGTATGGCCGCTGTTCAATGGAGAGCTACCGAGAGAATCTGGAACGAGTATTCATACGCATGGACCAGGTGTTGCCAGACTCCTGTCTGCTGGTGTGGAACATGGCGATGCCCCTGGGAGAGCGTGTCACTGGAGGTTTCCTACTGCCAGAGCTCCAGCCCCTGGCAGCCACTTTGCGACGGGATGTGGTTGAGGGGAACTTCTATAGTGCTACACTGGCTGGGGACCACTACTTCGATGTTCTGGATCTCCACTTTCATTTCCGGCACGCAGTACAGCACCGTCATCGAGATGGTGTCCACTGGGACCAACATGCACACCGCCACCTCTCACACTTGCTTCTGACCCATGTGGCCGATGCTTGGGGCGTAGAGCTGCCCACGAGGGACCATCCCCCTGAACCATGGATTGAGGACTGGCCAGAGATGGATCATCCGTTCCAGGGAAGCCATAGGCAGCCCCCAGACTTCGGGGAGCAGCTGGCCTTACCCCCACCCCCACCCCCTCCTTTACCCCCTCCTATGTCTTTTTCCTACCCTCTTCCACAACCTTCACCACCTCCCTTGTTCCCACCCCTGCCCCAGGATACCTCTTTTTACCCAGGCCAGCCCTTCCCACCCCAGGAATTCTTCAGTTATAATCCAATAGAAGACTTCTCGATGCCACCCAATTTAGGGTGTGGCTCTCGAGTGAACTTTGTGCCTGGTCCCCTGCCACCTCCAGTCCCTGGCTCTGTCTCCCACGGTCAGCACCGGGGCCCAGTGGTCCACCGGGGGATGCCACGCTGTGTTCCCAACAGCCCCTACCATGTGCCAAGATTGGGGGGTCTCTGTAGACGACTCAGGCACTCAGACAGACTGATCCACACATACAAACTGGACAGGCGAGGACATACCCATTCAGGAACATGGCCTGGGTAG

XM_004840685.1 Coding sequence

Pced1a PC-esterase domain containing 1A, transcript variant X2

Length: 1506 bp    Location: 3959441..3953955   Strand: -
>XM_004840685.1
ATGGGCTTTGCGAGGCGAGGGCTTTGCAGAACCGACTGGCCTCTCGGGGCGCAGGAACATGAAGGCGCGTGGTGCGCGACCGTGGCCTGCTCACCGGTGAACGGCACCGAGCCCCGTGACTTGCCGGTTGGTGTCGGTGACAGCATGGTCTTCTGTCTGGAAAGCGAGGTGCTGCGCCGCCCGCTGCGAAGCGCCATGGTCCACTTCCAAGCTTCAGAAGTCCAGCAGCTGCTACACAACAAGTTCGTCGTCATCTTGGGGGACTCCATCCAGAGAGCTGTGTATAAGGATCTGGTGCTTCTGCTCCAGAAAGACTCGCTGCTCACAGTTGCCCAGTTGAAAGCCAAGGGGGAGCTGAGCTTTGAACAGGACCAGCTGGTGGCTGGGGGCCAGCTGGGTGAGCTGCACAACGGGACACAGTATCGTGAAGTCCGCCAGTTCTGCTCCGGTTCTGGCCATCACCTTGTGCGGTTCTACTTCCTCACCCGAGTTTACTCTGAGTACCTGGAGGATGTTCTGGAGGAGCTGACATATGGGCCTGCCCCGGACCTGGTGATCATCAACTCTTGCCTTTGGGATCTCTCCAGGTATGGCCGCTGTTCAATGGAGAGCTACCGAGAGAATCTGGAACGAGTATTCATACGCATGGACCAGGTGTTGCCAGACTCCTGTCTGCTGGTGTGGAACATGGCGATGCCCCTGGGAGAGCGTGTCACTGGAGGTTTCCTACTGCCAGAGCTCCAGCCCCTGGCAGCCACTTTGCGACGGGATGTGGTTGAGGGGAACTTCTATAGTGCTACACTGGCTGGGGACCACTACTTCGATGTTCTGGATCTCCACTTTCATTTCCGGCACGCAGTACAGCACCGTCATCGAGATGGTGTCCACTGGGACCAACATGCACACCGCCACCTCTCACACTTGCTTCTGACCCATGTGGCCGATGCTTGGGGCGTAGAGCTGCCCACGAGGGACCATCCCCCTGAACCATGGATTGAGGACTGGCCAGAGATGGATCATCCGTTCCAGGGAAGCCATAGGCAGCCCCCAGACTTCGGGGAGCAGCTGGCCTTACCCCCACCCCCACCCCCTCCTTTACCCCCTCCTATGTCTTTTTCCTACCCTCTTCCACAACCTTCACCACCTCCCTTGTTCCCACCCCTGCCCCAGGATACCTCTTTTTACCCAGGCCAGCCCTTCCCACCCCAGGAATTCTTCAGTTATAATCCAATAGAAGACTTCTCGATGCCACCCAATTTAGGGTGTGGCTCTCGAGTGAACTTTGTGCCTGGTCCCCTGCCACCTCCAGTCCCTGGCTCTGTCTCCCACGGTCAGCACCGGGGCCCAGTGGTCCACCGGGGGATGCCACGCTGTGTTCCCAACAGCCCCTACCATGTGCCAAGATTGGGGGGTCTCTGTAGACGACTCAGGCACTCAGACAGACTGATCCACACATACAAACTGGACAGGCGAGGACATACCCATTCAGGAACATGGCCTGGGTAG

XM_004840686.1 Coding sequence

Pced1a PC-esterase domain containing 1A, transcript variant X3

Length: 1383 bp    Location: 3959322..3953955   Strand: -
>XM_004840686.1
ATGAGCCCTCTTCTGCCGCTGCTACCGCCACCTCCTGTAACCCTGAGCATCTTGGGAGGAGCCTGCGCAGGTCTCTTTTATCCTGGGGCGGGACCTAGGGCCGACCTGCCCTGTGTCCCCGCCCTCGAGCGGTTTAGTGGCCTCTCCCTGCAGCCGGTTGGTGTCGGTGACAGCATGGTCTTCTGTCTGGAAAGCGAGGTGCTGCGCCGCCCGCTGCGAAGCGCCATGGTCCACTTCCAAGCTTCAGAAGTCCAGCAGCTGCTACACAACAAGTTCGTCGTCATCTTGGGGGACTCCATCCAGAGAGCTGTGTATAAGGATCTGGTGCTTCTGCTCCAGAAAGACTCGCTGCTCACAGTTGCCCAGTTGAAAGCCAAGTACCTGGAGGATGTTCTGGAGGAGCTGACATATGGGCCTGCCCCGGACCTGGTGATCATCAACTCTTGCCTTTGGGATCTCTCCAGGTATGGCCGCTGTTCAATGGAGAGCTACCGAGAGAATCTGGAACGAGTATTCATACGCATGGACCAGGTGTTGCCAGACTCCTGTCTGCTGGTGTGGAACATGGCGATGCCCCTGGGAGAGCGTGTCACTGGAGGTTTCCTACTGCCAGAGCTCCAGCCCCTGGCAGCCACTTTGCGACGGGATGTGGTTGAGGGGAACTTCTATAGTGCTACACTGGCTGGGGACCACTACTTCGATGTTCTGGATCTCCACTTTCATTTCCGGCACGCAGTACAGCACCGTCATCGAGATGGTGTCCACTGGGACCAACATGCACACCGCCACCTCTCACACTTGCTTCTGACCCATGTGGCCGATGCTTGGGGCGTAGAGCTGCCCACGAGGGACCATCCCCCTGAACCATGGATTGAGGACTGGCCAGAGATGGATCATCCGTTCCAGGGAAGCCATAGGCAGCCCCCAGACTTCGGGGAGCAGCTGGCCTTACCCCCACCCCCACCCCCTCCTTTACCCCCTCCTATGTCTTTTTCCTACCCTCTTCCACAACCTTCACCACCTCCCTTGTTCCCACCCCTGCCCCAGGATACCTCTTTTTACCCAGGCCAGCCCTTCCCACCCCAGGAATTCTTCAGTTATAATCCAATAGAAGACTTCTCGATGCCACCCAATTTAGGGTGTGGCTCTCGAGTGAACTTTGTGCCTGGTCCCCTGCCACCTCCAGTCCCTGGCTCTGTCTCCCACGGTCAGCACCGGGGCCCAGTGGTCCACCGGGGGATGCCACGCTGTGTTCCCAACAGCCCCTACCATGTGCCAAGATTGGGGGGTCTCTGTAGACGACTCAGGCACTCAGACAGACTGATCCACACATACAAACTGGACAGGCGAGGACATACCCATTCAGGAACATGGCCTGGGTAG

XM_004840693.1 Coding sequence

Gnrh2 gonadotropin-releasing hormone 2

Length: 327 bp    Location: 4161804..4163538   Strand: +
>XM_004840693.1
ATGGCCAGCTCTAGGCTCAGCCTCCTGCTGCTGCTGCTGCTGCTGTTGCTACTGTTGCTGCTACTAACCACCTACCCTGGACCGTTGAGGGCTCAGTACTGGTCCCATGGCTGGTACCCTGGAGGAAAGCGAGCCTACAGCTCATCCCAGGATTCCCAGAATGTTCCCAGGCTCTCAGGAAGAATACTGGGCACTGCAGCGGGCAGCCTTGCTCAAGCTGCCCACAGACTCCCAAGTAAGGACCTGGCTCCCTCTGAGGACACTGTGCCCTGGGAGGGCAGAAGCATGTTTCGGTGGACTCTTCACAGGAAACAGCATCTGGTGTAA

XM_004840695.1 Coding sequence

LOC101717720 vasopressin-neurophysin 2-copeptin-like

Length: 492 bp    Location: 4210071..4208329   Strand: -
>XM_004840695.1
ATGCCTGACACCATGCTGCCTGCCTGCTTCCTCGGCCTGCTGGCCTTTACCTCTGCCTGCTACTTCCAGAACTGCCCGAGGGGCGGCAAGCGGGCCGTGACGGACACGGAGCTGAGACAGTGCCTCCCCTGCGGCCCCGGAGGCCAAGGGCGCTGCTTCGGGCCCAGTATCTGCTGTGCGGACGCGCTGGGCTGCTTCGTGGGGACGGCCGAGGCACTGCGCTGCCAGGAGGAGAACTACCTCCCGTCGCCCTGCCAGTCTGGCCAGAAGCCGTGCGGGAGCGGGGGACGCTGCGCGGCCAACGGTGTCTGCTGCAGCCCAGAGAGCTGTGTGATCCAGCCTGAGTGCCGCGAGGGCTTCCACCGCCTCGCCCGCGCCGGCGACCGGAGCAACGCCACGCAGCTGGACGGCCCCGCGGGGACGCTGTTGCTCCGTCTGGTGCAGCTGGCCGGGTTGCCGGATCCCAAGCCCGCCACGCCCGGCGGCTACTGA

XM_004840699.1 Coding sequence

Ubox5 U-box domain containing 5, transcript variant X4

Length: 1626 bp    Location: 4268202..4228564   Strand: -
>XM_004840699.1
ATGGTAATAAATCTTTGCCTCCCACAGTTCAGACCAAGAATTCACTGCAACAAGATATCAGCTGATGGTTATGAAGTAGAAAATCTCATCTCTGAAGACCTCACAAAGAGAAGCCATGGTTTTAGGACAGAGTATTTCATTAAGCCACCAGTCCACGTGACAGTTTCCTTTCCCTTTAATGTGGAAATCTGTAGGATTCACTTAGACCTCACAGCTTGGGGCAGCCAGAATGTCACTGGCCTGGAGATGTACACGTCCACCTTATCCAGCAGAGCCTCTTGGAGTGGGCCCAAGTGCCAGGGCCTCGGCTCCACCGAGCCCTCTGTGCCCAACAAAGAGGCGTTCACCTTGGTCGGCAAAGTCTTGCTGAAGAACCAGAGCCAAGTGGTATTCAGCCACCGGGGCTTCAAGGCCAGGCCACCTTTTAGCCCAGTGGAAGTCACACTTCCCTCCCCTGCAGTTATGGCCCAGGAGCTCTGGAATAAAGGGACTCTTTCCCTTTGCCATGTGGCCCACCTCAGGATCTGCATCACCCACGTGACGGGCAGTGGTGTCCCTTGCATCAAGAGGTTGGAGGTGTGGGGTCAGCCGGCCAAGACTTGCTCTCAGGAGGTGATAGACAGTGTCTTGCTGGTGGCCTCAGAGAGTATACCTCAGGACCTGGCCCTGCAGAACCGAGCCTTGCCCATGGAGAGTGACTGTCACTCCGAAGGCCAATCTGAGGGCCAGCAGGCCCCTTCCAGCCTGCGAGAGCTGGCTGAGGTGATTTGGGAAGTGCCTGAGGAGTTCCTGGATCCCATCACCCTGGAGATCATGCCCTGCCCCATGCTGCTGCCCTCGGGCAAGGTCATCGATCAGAGCACCCTAGAGAAGTGTAACCGCAGTGAGGCCACTTGGGGCCGAGTGCCCAGTGACCCATTCACAGGCATTGCCTTCACCCCGCACTCCCAACCCCTGCCACACCCCACCCTGAAGGCCCGCATAGACCACTTCCTGCTCCAGCACTCTGTCCCTAGCTGCCACCTGCTTGGGAGAGCACAGGCTGCATCAGCAGTGACCCCTTCTTCCATAACCCTGCCTTCTCGGAAAAGGAAGCTGGAGCAGGGGCACCGGGCCCCAGACAGTAGCCTTGGTGTGAACACTTCCTGCTTTCGGACCACAAACTTTCTGGTCTCTTCCACTGCTTCAGAACATTCCACCAAGAAAATGAAGGCCACCGACGAGCCTATCCTGATGCACATGGACTGCTCCACAGAATCAGTGTCCCATGAGCAAAAGCTGTCACAAAGCTTGGAAATGGCCTTGATGACCACCCTTGGCTCTATGCCTTCCTTCACACCCCGGCTGAATAGGGGACAGCTCCAGCACCTGGGCACAAGAGGAAGCAGCACTTCGGGGAGGCCAGGCGCCAGCTCAGGGCAGCCTGGCTGCCACCCAGGCCCCGAGTGCACCTCCTGCAAAAGAGTGTTTTCTTCCTACTTCAAAAAGGAGCCCATGTACCAGCTGCCCTGTGGCCACCTCCTGTGCCGCCCTTGCCTGGGTGAGAAGCAGCACTCCCTGCCCATGACCTGCACAGCCTGCCAGCAGCCCTTCACCAGCCAGGATGTGCTGCGGGTGCACTTCTGA

XM_004840698.1 Coding sequence

Ubox5 U-box domain containing 5, transcript variant X3

Length: 1626 bp    Location: 4268182..4228564   Strand: -
>XM_004840698.1
ATGGTAATAAATCTTTGCCTCCCACAGTTCAGACCAAGAATTCACTGCAACAAGATATCAGCTGATGGTTATGAAGTAGAAAATCTCATCTCTGAAGACCTCACAAAGAGAAGCCATGGTTTTAGGACAGAGTATTTCATTAAGCCACCAGTCCACGTGACAGTTTCCTTTCCCTTTAATGTGGAAATCTGTAGGATTCACTTAGACCTCACAGCTTGGGGCAGCCAGAATGTCACTGGCCTGGAGATGTACACGTCCACCTTATCCAGCAGAGCCTCTTGGAGTGGGCCCAAGTGCCAGGGCCTCGGCTCCACCGAGCCCTCTGTGCCCAACAAAGAGGCGTTCACCTTGGTCGGCAAAGTCTTGCTGAAGAACCAGAGCCAAGTGGTATTCAGCCACCGGGGCTTCAAGGCCAGGCCACCTTTTAGCCCAGTGGAAGTCACACTTCCCTCCCCTGCAGTTATGGCCCAGGAGCTCTGGAATAAAGGGACTCTTTCCCTTTGCCATGTGGCCCACCTCAGGATCTGCATCACCCACGTGACGGGCAGTGGTGTCCCTTGCATCAAGAGGTTGGAGGTGTGGGGTCAGCCGGCCAAGACTTGCTCTCAGGAGGTGATAGACAGTGTCTTGCTGGTGGCCTCAGAGAGTATACCTCAGGACCTGGCCCTGCAGAACCGAGCCTTGCCCATGGAGAGTGACTGTCACTCCGAAGGCCAATCTGAGGGCCAGCAGGCCCCTTCCAGCCTGCGAGAGCTGGCTGAGGTGATTTGGGAAGTGCCTGAGGAGTTCCTGGATCCCATCACCCTGGAGATCATGCCCTGCCCCATGCTGCTGCCCTCGGGCAAGGTCATCGATCAGAGCACCCTAGAGAAGTGTAACCGCAGTGAGGCCACTTGGGGCCGAGTGCCCAGTGACCCATTCACAGGCATTGCCTTCACCCCGCACTCCCAACCCCTGCCACACCCCACCCTGAAGGCCCGCATAGACCACTTCCTGCTCCAGCACTCTGTCCCTAGCTGCCACCTGCTTGGGAGAGCACAGGCTGCATCAGCAGTGACCCCTTCTTCCATAACCCTGCCTTCTCGGAAAAGGAAGCTGGAGCAGGGGCACCGGGCCCCAGACAGTAGCCTTGGTGTGAACACTTCCTGCTTTCGGACCACAAACTTTCTGGTCTCTTCCACTGCTTCAGAACATTCCACCAAGAAAATGAAGGCCACCGACGAGCCTATCCTGATGCACATGGACTGCTCCACAGAATCAGTGTCCCATGAGCAAAAGCTGTCACAAAGCTTGGAAATGGCCTTGATGACCACCCTTGGCTCTATGCCTTCCTTCACACCCCGGCTGAATAGGGGACAGCTCCAGCACCTGGGCACAAGAGGAAGCAGCACTTCGGGGAGGCCAGGCGCCAGCTCAGGGCAGCCTGGCTGCCACCCAGGCCCCGAGTGCACCTCCTGCAAAAGAGTGTTTTCTTCCTACTTCAAAAAGGAGCCCATGTACCAGCTGCCCTGTGGCCACCTCCTGTGCCGCCCTTGCCTGGGTGAGAAGCAGCACTCCCTGCCCATGACCTGCACAGCCTGCCAGCAGCCCTTCACCAGCCAGGATGTGCTGCGGGTGCACTTCTGA

XM_004840701.1 Coding sequence

Ubox5 U-box domain containing 5, transcript variant X6

Length: 1443 bp    Location: 4268182..4232317   Strand: -
>XM_004840701.1
ATGGTAATAAATCTTTGCCTCCCACAGTTCAGACCAAGAATTCACTGCAACAAGATATCAGCTGATGGTTATGAAGTAGAAAATCTCATCTCTGAAGACCTCACAAAGAGAAGCCATGGTTTTAGGACAGAGTATTTCATTAAGCCACCAGTCCACGTGACAGTTTCCTTTCCCTTTAATGTGGAAATCTGTAGGATTCACTTAGACCTCACAGCTTGGGGCAGCCAGAATGTCACTGGCCTGGAGATGTACACGTCCACCTTATCCAGCAGAGCCTCTTGGAGTGGGCCCAAGTGCCAGGGCCTCGGCTCCACCGAGCCCTCTGTGCCCAACAAAGAGGCGTTCACCTTGGTCGGCAAAGTCTTGCTGAAGAACCAGAGCCAAGTGGTATTCAGCCACCGGGGCTTCAAGGCCAGGCCACCTTTTAGCCCAGTGGAAGTCACACTTCCCTCCCCTGCAGTTATGGCCCAGGAGCTCTGGAATAAAGGGACTCTTTCCCTTTGCCATGTGGCCCACCTCAGGATCTGCATCACCCACGTGACGGGCAGTGGTGTCCCTTGCATCAAGAGGTTGGAGGTGTGGGGTCAGCCGGCCAAGACTTGCTCTCAGGAGGTGATAGACAGTGTCTTGCTGGTGGCCTCAGAGAGTATACCTCAGGACCTGGCCCTGCAGAACCGAGCCTTGCCCATGGAGAGTGACTGTCACTCCGAAGGCCAATCTGAGGGCCAGCAGGCCCCTTCCAGCCTGCGAGAGCTGGCTGAGGTGATTTGGGAAGTGCCTGAGGAGTTCCTGGATCCCATCACCCTGGAGATCATGCCCTGCCCCATGCTGCTGCCCTCGGGCAAGGTCATCGATCAGAGCACCCTAGAGAAGTGTAACCGCAGTGAGGCCACTTGGGGCCGAGTGCCCAGTGACCCATTCACAGGCATTGCCTTCACCCCGCACTCCCAACCCCTGCCACACCCCACCCTGAAGGCCCGCATAGACCACTTCCTGCTCCAGCACTCTGTCCCTAGCTGCCACCTGCTTGGGAGAGCACAGGCTGCATCAGCAGTGACCCCTTCTTCCATAACCCTGCCTTCTCGGAAAAGGAAGCTGGAGCAGGGGCACCGGGCCCCAGACAGTAGCCTTGGTGTGAACACTTCCTGCTTTCGGACCACAAACTTTCTGGTCTCTTCCACTGCTTCAGAACATTCCACCAAGAAAATGAAGGCCACCGACGAGCCTATCCTGATGCACATGGACTGCTCCACAGAATCAGTGTCCCATGAGCAAAAGCTGTCACAAAGCTTGGAAATGGCCTTGATGACCACCCTTGGCTCTATGCCTTCCTTCACACCCCGGCTGAATAGGGGACAGCTCCAGCACCTGGGCACAAGAGGAAGCAGCACTTCGGGGAGGCCAGGCGCCAGCTCAGGTAACCCAGGCCCATTGTTTCCTTAG

XM_004840708.1 Coding sequence

LOC101719551 proSAP-interacting protein 1-like, transcript variant X7

Length: 2013 bp    Location: 4277271..4271584   Strand: -
>XM_004840708.1
ATGGCGAAGCTGGAGACCCTGCCTGTGCGTGCTGATCCAGGGCGGGATCCCCTCCTGGCCTTTGCCCCCCGGCCCTCTGAGCTTGGACCCCCAGACCCCCGCCTGGCCATGGGCAGTGTGGGCAGTGGGGTGGCCCATGCCCAAGAGTTTGCCATGAAGAGTGTGGGCACTCGAACAGGGGGTGGGGGCAGTCAGGGGAGTTTCCCTGGCCCCCGAGGCAGTGGCAGTGGGACCAGTAGGGAGAGGCCTGGCCGATACCCCTCTGAGGACAAAACTCTCGCCAACTCTCTCTACCTCAATGGCGAGCTTCGGGGCAGTGACCATACAGATGTCTGTGGCAATGTGGTGGGCAGCAGTGGTGGCAGCAGCAGCAGCGGTGGCAGTGACAAAGCCCCACCACAGTATCGTGAGCCCAGCCACCCACCCAAGCTCCTGGCCACCTCTGGCAAGCTAGATCAGTGCTCAGAGCCACTAGTTCGGCCATCGGCCTTCAAGCCTGTTGTACCCAAGAATTTCCATTCCATGCAGAACTTGTGTCCCCCACAGACCAATGGAACCCCTGAGGGACGACAGGGCCCTGGTGGCCTCAAGGGTGGACTGGACAAGTCTCGGACCATGACCCCAGCGGGTGGGAGTGGGGGCGGCCTCTCAGACTCAGGCCGGAACTCACTCACAAGCCTGCCCACCTACAGCTCCAGCTACAGCCAACACTTGGCACCCCTGAGTGCTTCCACCAGCCACATCAACCGAATCGGCACTGCCAGCTATGGTAGTGGCAGCAATGGTGGGGGGTCAGGGTACCAGGACCTGGGGACCTCAGACAGTGGGCGGGCCTCCAGCAAGAGTGGGTCTTCGTTATCCATGGGGCGGCCAGGCCACCTGGGATCTGGGGAGGGTGGGGGTGGAGGCCTGCCATTTGCAGCCTGCTCACCACCCTCGCCCAGTACACTGATCCAGGAGCTGGAGGAGCGGTTGTGGGAGAAGGAGCAGGAGGTGGCAGCTCTGCGGCGCAGCCTGGAGCAGAGTGAGGCGGCTGTGGCCCAGGTGCTGGAGGAGCGGCAGAAGGCGTGGGAGCGCGAGCTGGCCGAGCTTCGGCAGGGCTGCAGTGGGAAGTTGCAGCAGGTGGCTCGCCGTGCCCAGCGTGCCCAGCAGGGCCTGCAGTTGCAGGTGCTGCGGCTGCAGCAGGACAAGAAGCAGCTGCAGGAGGAGGCAGCCCGGCTGATGCGGCAGCGGGAAGAGCTCGAGGACAAGGTGGCCGCTTGTCAGAAGGAGCAGGCCGACTTCCTGCCCCGGATGGAGGAAACTAAGTGGGAGGTGTGCCAGAAGGCCGGCGAGATTTCCCTCCTGAAACAGCAGTTGAAAGACTCACAAGCTGACGTGTCCCAAAAGCTGAGTGAGATCGTGGGGCTGCGCTCCCAGCTGCGGGAGGGCCGGGCCTCACTTCGGGAGAAGGAAGAGCAGCTGCTCAGCCTGAGGGACTCCTTTGGCAGCAAACAGGCCAGCCTGGAGCTGGCTGAGGGTGAGCTGCCTGCCACCTGCCACAAGCCAGTGCTGACCCCTGTGGACCCAGCCGACCCACAGGAGGCACTGGCCACCTGCGAGAGCGATGAGGCCAAGATGCGTCGTCAGGCTGGGGTGGCTGCTGCTGCATCCTTGGTTTCCATGGATGGGGAGGTGGATGCTGGGGGCGAGAGTGGGACCAGGGCCCTGCGACGGGAGGTGGGTCGGCTGCAGGCTGAGCTGGCAGCCGAGCGGCGGGCCCGGGAGCGCCAGGGTGCCAGCTTTGCAGAGGAGCGCCGAGTGTGGCTGGAGGAGAAGGAGAAGGTCATTGAGTACCAGAAGCAGCTGCAGCTGAGTTATGTGGAGATGTACCAGCGCAACCAGCAGCTGGAGCGGCGGCTGCGGGAGCGTGGGGCAGCAGGGGGTGCAAGCACACCTACCCCCCAACTTGGTGAGGAGAAGAAGGCCTGGACCCCTTCCCGCCTTGAGCGCATCGAGTCCACAGAAATCTGA

XM_004840706.1 Coding sequence

LOC101719551 proSAP-interacting protein 1-like, transcript variant X5

Length: 2013 bp    Location: 4277271..4271584   Strand: -
>XM_004840706.1
ATGGCGAAGCTGGAGACCCTGCCTGTGCGTGCTGATCCAGGGCGGGATCCCCTCCTGGCCTTTGCCCCCCGGCCCTCTGAGCTTGGACCCCCAGACCCCCGCCTGGCCATGGGCAGTGTGGGCAGTGGGGTGGCCCATGCCCAAGAGTTTGCCATGAAGAGTGTGGGCACTCGAACAGGGGGTGGGGGCAGTCAGGGGAGTTTCCCTGGCCCCCGAGGCAGTGGCAGTGGGACCAGTAGGGAGAGGCCTGGCCGATACCCCTCTGAGGACAAAACTCTCGCCAACTCTCTCTACCTCAATGGCGAGCTTCGGGGCAGTGACCATACAGATGTCTGTGGCAATGTGGTGGGCAGCAGTGGTGGCAGCAGCAGCAGCGGTGGCAGTGACAAAGCCCCACCACAGTATCGTGAGCCCAGCCACCCACCCAAGCTCCTGGCCACCTCTGGCAAGCTAGATCAGTGCTCAGAGCCACTAGTTCGGCCATCGGCCTTCAAGCCTGTTGTACCCAAGAATTTCCATTCCATGCAGAACTTGTGTCCCCCACAGACCAATGGAACCCCTGAGGGACGACAGGGCCCTGGTGGCCTCAAGGGTGGACTGGACAAGTCTCGGACCATGACCCCAGCGGGTGGGAGTGGGGGCGGCCTCTCAGACTCAGGCCGGAACTCACTCACAAGCCTGCCCACCTACAGCTCCAGCTACAGCCAACACTTGGCACCCCTGAGTGCTTCCACCAGCCACATCAACCGAATCGGCACTGCCAGCTATGGTAGTGGCAGCAATGGTGGGGGGTCAGGGTACCAGGACCTGGGGACCTCAGACAGTGGGCGGGCCTCCAGCAAGAGTGGGTCTTCGTTATCCATGGGGCGGCCAGGCCACCTGGGATCTGGGGAGGGTGGGGGTGGAGGCCTGCCATTTGCAGCCTGCTCACCACCCTCGCCCAGTACACTGATCCAGGAGCTGGAGGAGCGGTTGTGGGAGAAGGAGCAGGAGGTGGCAGCTCTGCGGCGCAGCCTGGAGCAGAGTGAGGCGGCTGTGGCCCAGGTGCTGGAGGAGCGGCAGAAGGCGTGGGAGCGCGAGCTGGCCGAGCTTCGGCAGGGCTGCAGTGGGAAGTTGCAGCAGGTGGCTCGCCGTGCCCAGCGTGCCCAGCAGGGCCTGCAGTTGCAGGTGCTGCGGCTGCAGCAGGACAAGAAGCAGCTGCAGGAGGAGGCAGCCCGGCTGATGCGGCAGCGGGAAGAGCTCGAGGACAAGGTGGCCGCTTGTCAGAAGGAGCAGGCCGACTTCCTGCCCCGGATGGAGGAAACTAAGTGGGAGGTGTGCCAGAAGGCCGGCGAGATTTCCCTCCTGAAACAGCAGTTGAAAGACTCACAAGCTGACGTGTCCCAAAAGCTGAGTGAGATCGTGGGGCTGCGCTCCCAGCTGCGGGAGGGCCGGGCCTCACTTCGGGAGAAGGAAGAGCAGCTGCTCAGCCTGAGGGACTCCTTTGGCAGCAAACAGGCCAGCCTGGAGCTGGCTGAGGGTGAGCTGCCTGCCACCTGCCACAAGCCAGTGCTGACCCCTGTGGACCCAGCCGACCCACAGGAGGCACTGGCCACCTGCGAGAGCGATGAGGCCAAGATGCGTCGTCAGGCTGGGGTGGCTGCTGCTGCATCCTTGGTTTCCATGGATGGGGAGGTGGATGCTGGGGGCGAGAGTGGGACCAGGGCCCTGCGACGGGAGGTGGGTCGGCTGCAGGCTGAGCTGGCAGCCGAGCGGCGGGCCCGGGAGCGCCAGGGTGCCAGCTTTGCAGAGGAGCGCCGAGTGTGGCTGGAGGAGAAGGAGAAGGTCATTGAGTACCAGAAGCAGCTGCAGCTGAGTTATGTGGAGATGTACCAGCGCAACCAGCAGCTGGAGCGGCGGCTGCGGGAGCGTGGGGCAGCAGGGGGTGCAAGCACACCTACCCCCCAACTTGGTGAGGAGAAGAAGGCCTGGACCCCTTCCCGCCTTGAGCGCATCGAGTCCACAGAAATCTGA

XM_004840717.1 Coding sequence

Slc4a11 solute carrier family 4, sodium borate transporter, member 11, transcript variant X5

Length: 2592 bp    Location: 4339877..4328675   Strand: -
>XM_004840717.1
ATGGCCGCGGCCAGCAGGCGCGTGTTCCATCTCCAGCCGTGCGAAAGCTCCTCTTTGGCCACATCAAGGAATGGATGCCTTGAGGACTCCAGTGACTACCTCAAGAATGATGTGGACAATGCTTCAGAGGTCCGGGAAGAAAGCCTGGGGGATGAGGTCTTTGACACGGTCAACTCCTCCATCGTGTCTGGCGAGAGCATCCAGTTTTTCGTCAATGTCAACCTTGAGGTGCAGCCCTCCATATCTGAAGGTGAAGCGCTGTCTGGCTGCGTGCTCCTGCACACATCCCGCAAGTACCTGAAGTTAAAGAACTTTGGGGAAGAGATCCGAGCACACCGGGACCTGGATGGCTTCCTGGCCCAGGCCAGCATCATCCTGAATGAAACAGCCACCTCCTTGGATGATGTGCTACGCACCATGCTGAGCCGCTTTGCCCAGGACCCCAACAACGCTGAACCCGACTGCAACTTGGACCTAATCATGGCCAAGCTCTTTACGGATGCAGGGGGCCCCACGGAGAGTAAAGTGCACCTGCTGTCAGATACCATCCAAGGGGTCACAGCCACGGTGAGAGGGGTGCAGTACCAGCAGTCATGGCTCTGCATCATCTGTACCATGAAAGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTGGTTCGCCCACAGAACTGGGGCGAAAACTCCTGTGAGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAAATGAAAAGCACCAAGACTGCAATGGAGGTGGCACGCACCTTCGCCACCATGTTTTCAGACATCACCTTCCGCCAGAAGCTCCTGAAGACCCGCACAGAGGACGAATTCAAGGAGGCATTGGTGCATCAGAGACAGCTGCTCACCATGACAATACCAAGAGCAAATGGACATGGCACAGGCTCCTTCCATGGCCATAGACACCCACAGCCCCCAAAGTGCAAGGACTTTATCCCTTTTGGGAGGGGCATCCGGGAAGACATCATGCGCAGGTTTCCTGTATACCCACTGGACTTCACTGATGGCATTATCGGGAAAAGCAAGGCTGTGGGCAAATACATAACCACCACCCTGTTCCTCTACTTCGCCTGCCTCCTGCCCACAATTGCTTTTGGATCCCTGAATGATGAGAACACAAATGGGGCCATTGATGTTCAGAAGACCATAGCTGGCCAGAGTATAGGAGGCCTCTTGTACGCGATCTTCTCCGGGCAGCCGCTGGTGATTCTGCTGACGACTGCACCCCTGGCCATCTACACCCAGGTGATTCGTGTCATCTGTGATGACTACAACTTGGACTTCAATGCTTTCTATGCGTGGACAGGCCTGTGGAACAGTTTCTTCCTTGCACTCTATGCCTTCTTCAACCTCAGCCTGGTCATGAGTCTCTTCAAGAGGTCAACAGAGGAAATCATTGCCCTGTTCATTTCCATCACCTTCGTGCTGGATGCTGTCAAGGGCATGATCAAAATCTTCTGGAAGTACTACTACGGTTACCACCACACAAAGAGAACAGATACCAGCCTCAACTCTGGCATCCACACAGCCTTCAACACCAATCTCCTGGCTGGTTCCATTGAGCTGGATGCCTCAAGCAGCCCAGATGCTGTGCACTCTGGCCAGGCAACTGCAGTGCTCAGCCTCCTCATCATGCTGGGTACCCTCTGGCTGGGCTACACTCTCTACCAGTTCAAGAAGAGCCCCTACCTGCACCCATATGTGCGAGAGATCCTGTCCGACTGTGCCCTGCCCATTGCAGTGCTCACCTTCTCCCTCCTCAGCTCCTATGGCTTCCAGGAAATTGAGATGAGCAGGTTCCGCTACAACCCCAGCGAGAACCTGTTTGAGGTGGCACAGATCGACTCACTGTCCCTGGGAGCCATTGGCAGTGCCATGGTCCTCGGTTTCCTGCTCTCCCTGCTCTTCTTCATCGAGCAGAACCTGGTGGCTGCCTTGGTCAATGCACCAGAGAACAGGCTGGTGAAAGGCACTGCCTACCACTGGGATCTCCTGCTCCTAGCCATCATCAACACGGGGCTGTCCCTATTTGGGCTGCCCTGGATCCACGCTGCCTACCCCCACTCTCCACTGCACGTGCGGGCCCTAGCTTTAGTGGAGGAGCGAGTGGAGAATGGGCACATTTATGAGACAATTGTGAATGTGAAGGAGACGAGGCTGACATCTCTGGGCGCCAGCATGCTAGTGGGTCTGTCCCTCCTGCTGCTGCCTTTCCCACTGCAGTGGATCCCCAAGCCTGTGCTCTATGGCCTCTTCCTCTACATTGCGCTTACCTCCTTGGATGGCAACCAGCTCTTCTCTCGTGTGGCCCTGCTGCTCAAGGAGCAGACATCATACCCACCCACCCACTACGTTCGGAGGGTGCCCCAGAGGAAGATCCACTACTTCACAGGCCTGCAGGTCCTGCAGCTGCTACTGCTCTGCGCCTTCGGCATGAGCACCCTGCCCTACATGAAGATGATCTTCCCCCTCATCATGATTCTCATGATTCCCATCCGCTACATCCTGCTGCCCCGAATCATTGAAGCCAAGTACTTGGATGCCATGGACGCTGAGCACTGGTCCTGA

XM_004840716.1 Coding sequence

Slc4a11 solute carrier family 4, sodium borate transporter, member 11, transcript variant X4

High confidence: 4 potential gene matches
Length: 2616 bp    Location: 4339877..4328675   Strand: -
>XM_004840716.1
ATGGCCGCGGCCAGCAGGCGCGTGTTCCATCTCCAGCCGTGCGAAAGCTCCTCTTTGGCCACATCAAGGAATGGATGCCTTGAGGACTCCAGTGAGTACTTCTCAGCTGCATCCCTGAGCTACCTCAAGAATGATGTGGACAATGCTTCAGAGGTCCGGGAAGAAAGCCTGGGGGATGAGGTCTTTGACACGGTCAACTCCTCCATCGTGTCTGGCGAGAGCATCCAGTTTTTCGTCAATGTCAACCTTGAGGTGCAGCCCTCCATATCTGAAGGTGAAGCGCTGTCTGGCTGCGTGCTCCTGCACACATCCCGCAAGTACCTGAAGTTAAAGAACTTTGGGGAAGAGATCCGAGCACACCGGGACCTGGATGGCTTCCTGGCCCAGGCCAGCATCATCCTGAATGAAACAGCCACCTCCTTGGATGATGTGCTACGCACCATGCTGAGCCGCTTTGCCCAGGACCCCAACAACGCTGAACCCGACTGCAACTTGGACCTAATCATGGCCAAGCTCTTTACGGATGCAGGGGGCCCCACGGAGAGTAAAGTGCACCTGCTGTCAGATACCATCCAAGGGGTCACAGCCACGGTGAGAGGGGTGCAGTACCAGCAGTCATGGCTCTGCATCATCTGTACCATGAAAGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTGGTTCGCCCACAGAACTGGGGCGAAAACTCCTGTGAGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAAATGAAAAGCACCAAGACTGCAATGGAGGTGGCACGCACCTTCGCCACCATGTTTTCAGACATCACCTTCCGCCAGAAGCTCCTGAAGACCCGCACAGAGGACGAATTCAAGGAGGCATTGGTGCATCAGAGACAGCTGCTCACCATGACAATACCAAGAGCAAATGGACATGGCACAGGCTCCTTCCATGGCCATAGACACCCACAGCCCCCAAAGTGCAAGGACTTTATCCCTTTTGGGAGGGGCATCCGGGAAGACATCATGCGCAGGTTTCCTGTATACCCACTGGACTTCACTGATGGCATTATCGGGAAAAGCAAGGCTGTGGGCAAATACATAACCACCACCCTGTTCCTCTACTTCGCCTGCCTCCTGCCCACAATTGCTTTTGGATCCCTGAATGATGAGAACACAAATGGGGCCATTGATGTTCAGAAGACCATAGCTGGCCAGAGTATAGGAGGCCTCTTGTACGCGATCTTCTCCGGGCAGCCGCTGGTGATTCTGCTGACGACTGCACCCCTGGCCATCTACACCCAGGTGATTCGTGTCATCTGTGATGACTACAACTTGGACTTCAATGCTTTCTATGCGTGGACAGGCCTGTGGAACAGTTTCTTCCTTGCACTCTATGCCTTCTTCAACCTCAGCCTGGTCATGAGTCTCTTCAAGAGGTCAACAGAGGAAATCATTGCCCTGTTCATTTCCATCACCTTCGTGCTGGATGCTGTCAAGGGCATGATCAAAATCTTCTGGAAGTACTACTACGGTTACCACCACACAAAGAGAACAGATACCAGCCTCAACTCTGGCATCCACACAGCCTTCAACACCAATCTCCTGGCTGGTTCCATTGAGCTGGATGCCTCAAGCAGCCCAGATGCTGTGCACTCTGGCCAGGCAACTGCAGTGCTCAGCCTCCTCATCATGCTGGGTACCCTCTGGCTGGGCTACACTCTCTACCAGTTCAAGAAGAGCCCCTACCTGCACCCATATGTGCGAGAGATCCTGTCCGACTGTGCCCTGCCCATTGCAGTGCTCACCTTCTCCCTCCTCAGCTCCTATGGCTTCCAGGAAATTGAGATGAGCAGGTTCCGCTACAACCCCAGCGAGAACCTGTTTGAGGTGGCACAGATCGACTCACTGTCCCTGGGAGCCATTGGCAGTGCCATGGTCCTCGGTTTCCTGCTCTCCCTGCTCTTCTTCATCGAGCAGAACCTGGTGGCTGCCTTGGTCAATGCACCAGAGAACAGGCTGGTGAAAGGCACTGCCTACCACTGGGATCTCCTGCTCCTAGCCATCATCAACACGGGGCTGTCCCTATTTGGGCTGCCCTGGATCCACGCTGCCTACCCCCACTCTCCACTGCACGTGCGGGCCCTAGCTTTAGTGGAGGAGCGAGTGGAGAATGGGCACATTTATGAGACAATTGTGAATGTGAAGGAGACGAGGCTGACATCTCTGGGCGCCAGCATGCTAGTGGGTCTGTCCCTCCTGCTGCTGCCTTTCCCACTGCAGTGGATCCCCAAGCCTGTGCTCTATGGCCTCTTCCTCTACATTGCGCTTACCTCCTTGGATGGCAACCAGCTCTTCTCTCGTGTGGCCCTGCTGCTCAAGGAGCAGACATCATACCCACCCACCCACTACGTTCGGAGGGTGCCCCAGAGGAAGATCCACTACTTCACAGGCCTGCAGGTCCTGCAGCTGCTACTGCTCTGCGCCTTCGGCATGAGCACCCTGCCCTACATGAAGATGATCTTCCCCCTCATCATGATTCTCATGATTCCCATCCGCTACATCCTGCTGCCCCGAATCATTGAAGCCAAGTACTTGGATGCCATGGACGCTGAGCACTGGTCCTGA

XM_004840711.1 Coding sequence

LOC101722265 chromosome unknown open reading frame, human C20orf194, transcript variant X1

Length: 3552 bp    Location: 4484485..4349822   Strand: -
>XM_004840711.1
ATGGACGTGTACCCCTCGCACAGGCTGGGGCTGCCCTGCGCCCGGTCCCCCGGCGGCTCTGGCCGCGGGTCGCCTTCCGTCAGCTGCGGCCGACTCCGCCAGGTTCAGAGCATCCTGAACCAGAGCAGCAAGTCGCGACCTGACGGGATCCTTTGCATTCTAGGAATTGATAGCAGGTACAATGAAGGCTGCAGAGAGCTGGCAAATTATCTTCTGTTTGGTTTATATAATCAGAATACCAGTGATTTTGAGAAAACAGGATTTTCTGAAGAAATTCTGGATGATGTAATTATGTTGATTAAATCAGATAGTGTCCATCTGTACTGTAATCCTGTCAACTATTGCCATCTGTTACCGTATGTGGCACACTGGAGAAATCTACATTTCCACTGCATGACTGAAAATGAGTATGAAGATGAGGAAGCTGCAGAAGAGTTTAAAATTTCGAGCTTTGTGGATATGGTTAGAGACTGTAGTAAAATTGGCATTCCTTACAGCTCCCAAGGTCACTTGCAGATATTTGATATGTTTGTGGTAGAGAAATGGCCAATTGTACAGGCCTTCGCACTTGAGGGCATTGGAGGAGATGGATTTTTTACCATGAAATATGAGCTGCAGGATGTGAGTTTGAATCTATGGAATGTCTACAGCAAGATGGATCCTATGTCACTCGAGAACTTGCTTTCAGAAGATTTGGTGGCTTTTGAACATCAGTGGACTAACTTCTTTGCTAATTTTGACACAGAAATTCCTTTCCTACTGGAACTTTCAGAATCACAAGCTGGTGAGCCATTCAGAAGTTACTTCAGTCATGGAATGATCTCCAGCCATATAACTGAAAACAGCCCTAATAGGCAGCCATTTGTTCTCTTTGGTAATCACTCCACGCGAGAAAACCTGAATGCTGGCAACTTTAACTTCCCTTCTGAAGGTCATCTGGTACGCAGCACTGGTCCTGGTGGGAGCTTTGCCAAACACATGGTAGCACAGTGTATCTCACCAAAGGGACCTCTTGCATGTTCAAGAACATACTTTTTTGGAGCTACTCATGTTCCTTACTTAGGTGATGATGACAGACTGTCCAAGAATAACAAGCTGCCCAAGAAAACTGAACAAATTAGGCTCTTGTCCCAGATATATGCTGCTGTTATTGAGGCTGTTTTGGCTGGCATTGCATGTTATGCTAAAACTTCCAGTCTAACAAAGGCAAAGGAATTAGCAGAGCAGTCCCTGGGATCTGGATTAGAATCCTTTGAGTTGGTTCAGTTTAAGGCAGCACTACGCTCCAAGACGGCTTTTCACATACATGCTGTGAATAATCAGGGAAGAATTGTGCCTCTGGATAATGAAGATAATTTATCCTTTGTGAAAACGGCTTGTATGACTGTCTATGACATTCCTGACTTGCTGGGAGAAAGAGGATGCTTAGGATCTGTGGTCTTCTCAGAATCATTTTTGACATCTCGGATCTTGGTTAAAGAAAAGGATGGCACTGTTACCACAGAGACCAGCTGCATAGTCCTGACGGCCACCATTCCCAGATTCTGCTTCTGGCTGGTAGAAGATGATGAAGTAAAATTGTCTGAGAAAACCCAGCAAGCAGTGAGGGAGGATGAGTGTTTCCTGGGCACTTTCCTAGCAGGAGGAGAAGGAGCATATCTTTATCCCAGCAATCTACAGCCCTGGCCTGAGGAAGGGAATGTGCTTTTCTTCTCCAGTGGCCTTTTGTTTTCTCACCGTCATCATGGAAATATCATCATTTCTAAGGATCACATGAATTCTATTTCTTTCTATGATGGGGATTCCACCAGTATTGTGGCTGCCCTTCTCATCGACTTCAAAAGCTCATTACTTCCTCACCTCCCAGTTCATTTCCATGGGTCAAGCAATTTTCTGATGATTGCCCTTTTCCCAAAATCAAAGATATATCAAGCATTTTACTCAGAGGTCTTCTCCCCCTGGCAACAGCAGGATAACTCAGGGCTCCCTTTAAAAGTGATCCAGGAAGATGGATTATCTGTGGAACAAAAGAGATTGCACTCCAGTGCACAGAAGCTCTTCGCTGTCCTGAGCCATCCCACTGGGGAGAAGTGGAGTTCTTTAAAACTGCTCTTAGCCAAACTCCCAGAGTTGGACTGGTTTTGCCAGCATTTTGCTGTCAGCAGCATTAGTCAGGAGCCTGTGATGCGGACCCATCTCCCAGTCCTGCTGCGCCAAGTTGAAGTTAGCCCTTTGCATGGAGTAGAGAATAACAAGGTAATTATTAGCATTGTAACCGGACTCCCAGGCTGTCATGCTAGTGAGCTCTGTGCTTTTCTGGTCACTCTGCATAAAGAATATGGCAGGTGGATCGTTTACCGCCAAATCATGGATAGCTCGGAATGTTTTCATGCTGCGCACTTTCAGAAATACCTTTCCAGCGCTCTGGAGGCCCAACAGAACCGTTCTGCCCGCCAGTCAGCCTACATCCGCAAGAAGACCAGACTGTTGGTGGTATTACAAGGCTACACAGATGTTATTGATGTTGTTCAGGCACTGCAGACCCATCCAGATGCAAATGTCAAGTCTTCCTTCACCATTGGTGCCATTACAGTGTGCGTGGATCCTCTAAGCTGCTACATGGAACACAGATTTCTCTTCCCGAAATGTCTTGACCAGTGTTCACAAGGTCTGGTGAATAATGTCGTGTTCACGAGTCTCACCATGGAGCAGAGGCACCCTCTCCTTGTTCAGCTGCAGAGCCTCTTCAGAGCTGCCAACCCTACTGCAGCCTTCATTCTGGCAGAAAACGGGATTATTACCAGGAATGAAGACATTGAGCTGATTCTCTCAGAAAATAGCTTTTCAAGTTCTCAGATGCTACGATCTCGATATTTAATGTACCCTGGCTGGTATGAAGGTAAATTCAGTGCTGGCTCAGTCTTTCCACTAATGGTTCAGATCTGTGTATGGTTTGGTCGACCCTTGGAGAAGACTCGCTTTGTGGCCAAGTGTAAAGCAATTCAGTCCTCCATCAAGCCAAGCCCCTTCTCTGGAAACATCTACCACATCCTGGGCAAAGTAAAGTTTTCAGACTCTGAAAGGACAATGGAGGTCTGCCACAACACTCTGGCCAATTCCCTGAGCATCGTGCCGGTTTTGGAGGGACCCAGGCCACCATCAGACTCAAGAAGCATCCCTCAAGACAGCAGCGGGCAGCAGGAGTGCTACCTTGTGTTCATTGGCTGCTCCTTGAAGGAAGATAGCCTCAAGGACTGGCTCCGGCAGTCAGCTAAGCAGAAGCCTCAGAGGAAAGCTCTGAAGACCAGGGGAATGCTGACCCAGCAGGAGATCAGGAACATCCATGTGAAACGCCACCTAGACCCCCTACCTGCAGGTTACTTCTACAATGGCACCCAGTTTGTTAACTTCTTTGGGGATAAGACTGATTTTCACCCTCTCATGGACCAGTTCATGAATGACTACGTGGAAGAAGCCAACCGGGAAATTGAGAGATACAACCGTGAGCTGGACCAGCAGGAGTACCATGACCTCTTTGAGCAGAAGCCCTAG

XM_004840725.1 Coding sequence

Atrn attractin, transcript variant X1

High confidence: 4 potential gene matches
Length: 4275 bp    Location: 4559146..4741711   Strand: +
>XM_004840725.1
ATGGTGGCTGCGGCGGCGGCGACTGAGGCGAGGCTGAGGAGGACGGCGAAGACTGCAGCACCCGCGGGCAGGAAGGGCGGGCAGCACCGAGACTGGGACGTGACTGGGACTGGGAGGCCGGGGCTAGGGGCCGGGCTGCGTCCCCCGCGGCGGCTGTCGCCGTCGCTGCCACCTTGGCGGCTTCTGCTGCTGCTCCCGCCGCTGCTCCTGCTGCTGCCCTGGGAGGCCGAGGCCGCTGCTGCGGCGGCGGCGGTGTCGAGCTCAGCCGCAGCTGAGGCGAAGGAATGTGACCGGCCTTGTGTCAACGGCGGTCGCTGCAACCCTGGTACCGGCCTGTGCGTCTGCCCCACCGGCTGGGTGGGCGAGCAATGCCAGCACTGCGGGGGCCGCTTCAGACTAACTGGATCTTCTGGGTTTGTAACAGATGGACCTGGAAATTATAAATATAAAACGAAGTGCACATGGCTCATTGAAGGACAACCAAATAGAATAATGAGACTTCGTTTTAATCATTTTGCTACGGAGTGTAGTTGGGACCATTTATATGTTTATGATGGAGACTCAATTTATGCACCACTAATTGCTGCCTTTAGTGGCCTCATTGTTCCCGAGAGAGATAGCAACGAGACTGTACCTGAGGTTGTTGTCACATCAGGTTATGCCCTGCTGCATTTTTTTAGTGATGCTGCTTATAATTTGACTGGATTTAATATCACTTACAATTTTGACATGTGTCCAAACAATTGCTCAGCCCGAGGAGTGTGTAAGATCAGTAACAGCAGCAACACTGTTGAATGTGAGTGTTATGAAAACTGGAAAGGTGAATCGTGTGACATTCCTTACTGTACAGACAACTGTGGCTTTCCTCACCGAGGCATCTGCAATTCAAGTGATGTCAGAGGATGCTCCTGCTTCTCTGAGTGGCAGGGTCCTGGATGTTCAGTTCCTGTGCCAGCTAACCAGTCATTTTGGATGCGAGAGGAATGTTCTAATTTAAAGCTCCCCAGAGCTTCTCATAAAGCTGTGGTCATTGGAAATATAATGTGGATTGTCGGAGGATATATGTTCAATCACTCAGATTACAACATGGTTCTAGCGTATGACCTTGTTTCTAAAGAATGGCTTCCGCTGAACCGTTCTGTGAACAATGTGGTTGTGAGATATGGTCATTCTTTAGCATTATATAAGGATAAAATTTACATGTATGGAGGAAAAATTGATTCAACAGGGAATGTGACCAATGAGTTGAGAGTGCTTCATATTCATAATGAGTCGTGGGCGTTGTTGACCCCAAAGGCAAAGGAACAGTATGCAGTGGTTGGGCACTCAGCACACATCATTACACTGAAAACTGGCCGAGTGGTCATGCTGGTCATTTTTGGTCACTGCCCTCTCTATGGCTATATAAGTAGTGTGCAGGAATATGACTTGGATAAGAACACATGGAATATATTACAGACCCAGGGTGCTCTTGTACAAGGGGGCTATGGCCACAGCAGTGTTTATGATCATAAGACCAAGGCCCTGTATATTCATGGTGGCTACAAGGCTTTCAGTGCAAATAAATACCGGCTCACTGATGACCTCTACAGATACGAAGTGGATACCCAAATGTGGACCATTCTTAAGGATAGCAGATTTTTCCGTTACTTGCACACAGCTGTGATAGTGAGTGGAACCATGCTGGTGTTTGGAGGAAATACACACAATGACACATCTATGAGCCATGGTGCCAAATGTTTCTCTTCAGATTTCATGGCTTATGACATTGCTTGTGACCGTTGGTCAGTGCTTCCCAGACCTGATCTCCACCATGATGTCAACAGATTTGGCCACTCAGCAGTCTTACACAACAGTACCATGTATGTGTTTGGTGGTTTCAACAGCCTGCTCCTCAGTGACATCTTGGTATTCACCTTGGAACAGTGTGAAACACATCGGAGTGAAGCTGCTTGCATAGCAGCAGGACCTGGTGTCCGGTGTGTGTGGGATGTGGAAACATCTCAGTGTGTCTCCTGGGAACTGGCAACAGAAGAACAAGCCAAAAAGTTAAAATCAGAATGTTTTTCCAAAAGAACTCTTGACCATGACAAATGTGACCAGAACACAGATTGCTACAGCTGCACAGCCAACACCAACGACTGCCACTGGTGCAGTGACCATTGTGCCCCTAGGAACCACAGCTGCACGGAAGGCCAGATCTCCATTTTCAAGTATGAGAATTGCCCCAAGGATAACCCCATGTACTACTGTAATAAGAAGACCAGTTGCAGGAGCTGCGCCCTTGATCAGAACTGCCAGTGGGAGCCCCGGAATCAGGAGTGCATTGCCCTGCCTGAAAACATTTGTGGCACGGGCTGGCATTTGGTTGGAAACTCATGTTTGAAAATTACTACTGCCAAGGAGAATTATGACAATGCTAAATTGTCCTGTAGAAATCACAATGCCTTTTTGGCTTCTCTAACAACCCAGAAGAAGGTGGAATTTGTCCTTAAGCAGCTGCGAATGATGCAGTCATCACAGACCATGTCCAAGCTCACCTTAACCCCATGGGTTGGCCTGAGGAAGATCAATGTGTCCTACTGGTGTTGGGAAGATATGTCTCCGTTTACAAATAGCCTACTGCAGTGGATGCCATCTGAGCCTAGCGATGCTGGCTTCTGTGGTATCTTGTCAGAACCCAGTACTCGAGGATTGAAGGCTGCAACCTGCATCAACCCACTGAATGGCAGCATCTGTGAAAGGCCTGCAAACCACAGTGCCAAGCAATGCCGGACACCATGTGCCTTGCGGACGGCGTGCGGGGAGTGCACCAGCAGTAGCTCTGAGTGTATGTGGTGCAGCAACATGAAGCAGTGCGTGGACTCCAATGCCTATGTGGCTTCCTTCCCTTTTGGCCAGTGCATGGAGTGGTATACAATGAGCAGCTGTCCCCCTGAAAATTGTTCAGGCTACTGTACATGCAGTCATTGCTTGGAGCAGCCAGGCTGTGGCTGGTGTACTGATCCCAGCAATACTGGGAAAGGGAAGTGCATAGAGGGCTCCTATAAAGGACCAGTGAAGATGCCTTCTCAGGCCTCTACAGGAATCACCTACCCACAGCCCCTTCTGAATTCCAGCATGTGTCTAGAGGATGGCAGATACAACTGGTCTTTCATTCACTGTCCAGCTTGCCAGTGCAATGGCCACAGCAAATGTATCAACCAGAGTATCTGTGAGAAGTGTGAGAACCTGACCACCGGCAAGCACTGCGAGACCTGCATATCTGGTTATTATGGAGACCCCACCAATGGAGGCAAATGCCAACCATGCAGGTGCAATGGGCATGCATCACTATGCAATACCAACACGGGCAAGTGCTTCTGTACCACCAAGGGCGTCAAGGGGGACGAGTGCCAGCTATGTGAGGTAGAAAATCGGTACCAAGGAAACCCTCTCAAAGGAACATGTTATTATACTCTTCTTATTGACTATCAGTTCACTTTTAGCCTGTCACAGGAAGATGACCGCTATTACACAGCCATCAATTTTGTGGCTACTCCTGATGAACAAAACAGGGATTTGGACATGTTCATCAATGCCTCTAAAAACTTCAACCTCAATATCACCTGGGCTGCCAGCTTCTCAGCTGGAACTCAAGCTGGAGAAGAGATGCCTGTTGTTTCAAAAACCAACATTAAAGAGTACAAAGATAGCTTCTCTAATGAGAAGTTTGATTTTCGCAACCACCCAAATATCACTTTCTTTGTTTATGTCAGTAATTTTACCTGGCCTGTCAAAATTCAGATCGCCTTCTCCCAGCACAGCAATTTTATGGACCTGGTACAGTTCTTCGTGACTTTCTTCAGTTGTTTCCTATCTTTGCTCCTGGTGGCTGCTGTGGTTTGGAAGATCAAACAAAGTTGTTGGGCCTCCAGGCGTAGAGAGCAACTTCTTCGAGAGATGCAGCAAATGGCCAGTCGACCCTTTGCTTCCGTAAATGTTGCCTTGGAAACAGATGAAGAGCCTCCTGACCTTATTGGGGGAAGTATAAAGACCGTTCCCAAGCCCATTGCCCTGGAGCCGTGTTTTGGCAACAAAGCTGCAGTCCTTTCTGTGTTCGTGAGGCTCCCTCGAGGCCTGGGTGGGATACCTCCTCCTGGGCAGTCAGGTCTTGCTGTGGCCAGCGCCCTGGTGGACATTTCTCAGCAGATGCCAATAGTGTACAAAGAAAAGTCAGGAGCAGTGAGAAACCGGAAGCAGCAGCCCCCTGCACAGCCTGGAACCTGCATTTGA

XM_004840726.1 Coding sequence

Atrn attractin, transcript variant X2

Length: 3861 bp    Location: 4559147..4718710   Strand: +
>XM_004840726.1
ATGGTGGCTGCGGCGGCGGCGACTGAGGCGAGGCTGAGGAGGACGGCGAAGACTGCAGCACCCGCGGGCAGGAAGGGCGGGCAGCACCGAGACTGGGACGTGACTGGGACTGGGAGGCCGGGGCTAGGGGCCGGGCTGCGTCCCCCGCGGCGGCTGTCGCCGTCGCTGCCACCTTGGCGGCTTCTGCTGCTGCTCCCGCCGCTGCTCCTGCTGCTGCCCTGGGAGGCCGAGGCCGCTGCTGCGGCGGCGGCGGTGTCGAGCTCAGCCGCAGCTGAGGCGAAGGAATGTGACCGGCCTTGTGTCAACGGCGGTCGCTGCAACCCTGGTACCGGCCTGTGCGTCTGCCCCACCGGCTGGGTGGGCGAGCAATGCCAGCACTGCGGGGGCCGCTTCAGACTAACTGGATCTTCTGGGTTTGTAACAGATGGACCTGGAAATTATAAATATAAAACGAAGTGCACATGGCTCATTGAAGGACAACCAAATAGAATAATGAGACTTCGTTTTAATCATTTTGCTACGGAGTGTAGTTGGGACCATTTATATGTTTATGATGGAGACTCAATTTATGCACCACTAATTGCTGCCTTTAGTGGCCTCATTGTTCCCGAGAGAGATAGCAACGAGACTGTACCTGAGGTTGTTGTCACATCAGGTTATGCCCTGCTGCATTTTTTTAGTGATGCTGCTTATAATTTGACTGGATTTAATATCACTTACAATTTTGACATGTGTCCAAACAATTGCTCAGCCCGAGGAGTGTGTAAGATCAGTAACAGCAGCAACACTGTTGAATGTGAGTGTTATGAAAACTGGAAAGGTGAATCGTGTGACATTCCTTACTGTACAGACAACTGTGGCTTTCCTCACCGAGGCATCTGCAATTCAAGTGATGTCAGAGGATGCTCCTGCTTCTCTGAGTGGCAGGGTCCTGGATGTTCAGTTCCTGTGCCAGCTAACCAGTCATTTTGGATGCGAGAGGAATGTTCTAATTTAAAGCTCCCCAGAGCTTCTCATAAAGCTGTGGTCATTGGAAATATAATGTGGATTGTCGGAGGATATATGTTCAATCACTCAGATTACAACATGGTTCTAGCGTATGACCTTGTTTCTAAAGAATGGCTTCCGCTGAACCGTTCTGTGAACAATGTGGTTGTGAGATATGGTCATTCTTTAGCATTATATAAGGATAAAATTTACATGTATGGAGGAAAAATTGATTCAACAGGGAATGTGACCAATGAGTTGAGAGTGCTTCATATTCATAATGAGTCGTGGGCGTTGTTGACCCCAAAGGCAAAGGAACAGTATGCAGTGGTTGGGCACTCAGCACACATCATTACACTGAAAACTGGCCGAGTGGTCATGCTGGTCATTTTTGGTCACTGCCCTCTCTATGGCTATATAAGTAGTGTGCAGGAATATGACTTGGATAAGAACACATGGAATATATTACAGACCCAGGGTGCTCTTGTACAAGGGGGCTATGGCCACAGCAGTGTTTATGATCATAAGACCAAGGCCCTGTATATTCATGGTGGCTACAAGGCTTTCAGTGCAAATAAATACCGGCTCACTGATGACCTCTACAGATACGAAGTGGATACCCAAATGTGGACCATTCTTAAGGATAGCAGATTTTTCCGTTACTTGCACACAGCTGTGATAGTGAGTGGAACCATGCTGGTGTTTGGAGGAAATACACACAATGACACATCTATGAGCCATGGTGCCAAATGTTTCTCTTCAGATTTCATGGCTTATGACATTGCTTGTGACCGTTGGTCAGTGCTTCCCAGACCTGATCTCCACCATGATGTCAACAGATTTGGCCACTCAGCAGTCTTACACAACAGTACCATGTATGTGTTTGGTGGTTTCAACAGCCTGCTCCTCAGTGACATCTTGGTATTCACCTTGGAACAGTGTGAAACACATCGGAGTGAAGCTGCTTGCATAGCAGCAGGACCTGGTGTCCGGTGTGTGTGGGATGTGGAAACATCTCAGTGTGTCTCCTGGGAACTGGCAACAGAAGAACAAGCCAAAAAGTTAAAATCAGAATGTTTTTCCAAAAGAACTCTTGACCATGACAAATGTGACCAGAACACAGATTGCTACAGCTGCACAGCCAACACCAACGACTGCCACTGGTGCAGTGACCATTGTGCCCCTAGGAACCACAGCTGCACGGAAGGCCAGATCTCCATTTTCAAGTATGAGAATTGCCCCAAGGATAACCCCATGTACTACTGTAATAAGAAGACCAGTTGCAGGAGCTGCGCCCTTGATCAGAACTGCCAGTGGGAGCCCCGGAATCAGGAGTGCATTGCCCTGCCTGAAAACATTTGTGGCACGGGCTGGCATTTGGTTGGAAACTCATGTTTGAAAATTACTACTGCCAAGGAGAATTATGACAATGCTAAATTGTCCTGTAGAAATCACAATGCCTTTTTGGCTTCTCTAACAACCCAGAAGAAGGTGGAATTTGTCCTTAAGCAGCTGCGAATGATGCAGTCATCACAGACCATGTCCAAGCTCACCTTAACCCCATGGGTTGGCCTGAGGAAGATCAATGTGTCCTACTGGTGTTGGGAAGATATGTCTCCGTTTACAAATAGCCTACTGCAGTGGATGCCATCTGAGCCTAGCGATGCTGGCTTCTGTGGTATCTTGTCAGAACCCAGTACTCGAGGATTGAAGGCTGCAACCTGCATCAACCCACTGAATGGCAGCATCTGTGAAAGGCCTGCAAACCACAGTGCCAAGCAATGCCGGACACCATGTGCCTTGCGGACGGCGTGCGGGGAGTGCACCAGCAGTAGCTCTGAGTGTATGTGGTGCAGCAACATGAAGCAGTGCGTGGACTCCAATGCCTATGTGGCTTCCTTCCCTTTTGGCCAGTGCATGGAGTGGTATACAATGAGCAGCTGTCCCCCTGAAAATTGTTCAGGCTACTGTACATGCAGTCATTGCTTGGAGCAGCCAGGCTGTGGCTGGTGTACTGATCCCAGCAATACTGGGAAAGGGAAGTGCATAGAGGGCTCCTATAAAGGACCAGTGAAGATGCCTTCTCAGGCCTCTACAGGAATCACCTACCCACAGCCCCTTCTGAATTCCAGCATGTGTCTAGAGGATGGCAGATACAACTGGTCTTTCATTCACTGTCCAGCTTGCCAGTGCAATGGCCACAGCAAATGTATCAACCAGAGTATCTGTGAGAAGTGTGAGAACCTGACCACCGGCAAGCACTGCGAGACCTGCATATCTGGTTATTATGGAGACCCCACCAATGGAGGCAAATGCCAACCATGCAGGTGCAATGGGCATGCATCACTATGCAATACCAACACGGGCAAGTGCTTCTGTACCACCAAGGGCGTCAAGGGGGACGAGTGCCAGCTATGTGAGGTAGAAAATCGGTACCAAGGAAACCCTCTCAAAGGAACATGTTATTATACTCTTCTTATTGACTATCAGTTCACTTTTAGCCTGTCACAGGAAGATGACCGCTATTACACAGCCATCAATTTTGTGGCTACTCCTGATGAACAAAACAGGGATTTGGACATGTTCATCAATGCCTCTAAAAACTTCAACCTCAATATCACCTGGGCTGCCAGCTTCTCAGCTGGAACTCAAGCTGGAGAAGAGATGCCTGTTGTTTCAAAAACCAACATTAAAGAGTACAAAGATAGCTTCTCTAATGAGAAGTTTGATTTTCGCAACCACCCAAATATCACTTTCTTTGTTTATGTCAGTAATTTTACCTGGCCTGTCAAAATTCAGATCGCCTTCTCCCAGCACAGCAATTTTATGGACCTGGTACAGTTCTTCGTGACTTTCTTCAGGTCAATCTATTGA

XM_004840735.1 Coding sequence

Spef1 sperm flagellar 1

High confidence: 4 potential gene matches
Length: 711 bp    Location: 4866783..4862872   Strand: -
>XM_004840735.1
ATGGCTAGCAGCATGGACGAAGAGGCGCTGCACCAGCTGTACTTGTGGGTAGACAACATCCCTCTGTCCCGACCCAAACGAAATCTCTCCCGCGACTTCAGCGACGGAGTCCTGGTTGCAGAGATCATCAAGTTTTACTTCCCCAAGATGGTGGAAATGCACAATTATGTCCCTGCCAACTCCCTCCAGCAGAAGCTCAGCAACTGGAGTCACCTGAACAGGAAGGTGCTGAACAAGCTGAACATCTTGGTACCAGATGATGTGATGCGCAAGATTGCGCAGTGTGTCCCAGGTGTGGTGGAGTTGGTGCTTATCCCGCTGCGGCAGCGCCTGGAGGAGCGGCAGAAGCGCAGGAAGCAGGGTGCTGGCTCCTTACAGGAGCTGGCTCCTCAGGATGGCAGTGGCTACATGGATGTGGGTTTGTCCCAGAAGGCCCGAGGGGAAGGTGTCCTGGACCCCCAGGGAGGAGGACAGCTCAGAGGGGGTGGGCAGCTGGTGGCCCGGCCTCCTGGGTATAACCAGGCCCAGCAGAGCGACCCAAGCTTTGTGCTCCAGATCGCCGAAAAAGAGCAGGAGCTGCTGGCCTCACAGGAGACGGTGCAGGTCCTGCAGATGAAGGTGAGGCGCCTGGAGCATCTGCTCCAGCTCAAGAATGTTCGCATTGAGGACCTGTCCCGGCGCCTCCAGCAGGCCGAGCGCAAGCCCCAGTGA

XM_004840736.1 Coding sequence

Cenpb centromere protein B, 80kDa

High confidence: 4 potential gene matches
Length: 1650 bp    Location: 4870900..4868453   Strand: -
>XM_004840736.1
ATGGGCCCCAAGCGGCGGCAGCTGACGTTCCGGGAGAAGTCGAGAATCATCCAGGAGGTGGAGGAGAATCCGGACCTCCGCAAAGGCGAGATCGCACGGCGCTTCAACATCCCGCCGTCCACGCTGAGCACCATCCTGAAGAACAAGCGCGCCATCCTGGCGTCGGAGCGCAAGTACGGTGTGGCCTCCACCTGCCGCAAGACCAACAAGCTGTCCCCTTACGACAAGCTCGAGGGATTGCTCATCGCCTGGTTCCAGCAGATCCGTGCCGCGGGCCTTCCCGTCAAGGGCATCATCCTAAAGGAGAAGGCGCTCCGGATAGCCGAGGAGCTGGGCATGGACGACTTCACTGCCTCCAACGGCTGGCTGGACCGCTTCCGCCGGCGCCACGGTGTGGTGTCCTGCAGCGGCGTGACGCGTGCCCGGGGCCGCAACTCTGCCCCCAGGGCCCCAGCGGCACCTGCCAGCCCAGCCGCGGTGCCCCCCGAGGGCAGTAGTGGGAGCGCACCTACCTGGCACGCAAGCGAAGAGCAGCCACCCTCGGTGGCCGAGGGCTACGCCTCGCAGGACGTGTTCAGCGCCACCGAGACCAGTCTGTGGTACGACTTTCTGCCCGACCAAGCTGCGGGGCTCTGCGGAGGCGATGGAAGGGCGCGCCAAGCCACCCAGCGCCTGAGTGTCTTGCTATGTGCCAACGCCGACGGCAGCGAAAAGCTGCCCCCATTGGTGGCTGGCAAGTCCGCCAAGCCCCGTGCAGGCCAAGGCGGCCTTCCCTGCGACTACACTGCCAACTCGAAGGGAGGTGTCACCACCCAGGCTCTGGCCAAGTACTTGAAGGCTCTGGACACCCGAATGGCTGCAGAGTCCCGCCGGGTCTTGCTGCTGGCCGGCCGCTTGGCTGCCCAGTCCCTGGACACTTCAGGCCTACGGCATGTGCAGCTGGCCTTCTTCCCTCCGGGCACTGTGCATCCGTTGGAGCGGGGAGTAGTTCAACAGGTGAAGGGCCACTACCGCCAGGCCATGCTCCTCAAGGCCATGGCGGCCCTGGAGGGCCAGGATCGCTCAGGCCTACAGCTGGGCCTCATGGAGGCTCTGCATTTCGTGGCTGCAGCCTGGCAGGCAGTGGAGCCTTCGGACATTGCCACTTGCTTTCGGGAGGCTGGCTTCGGGGGTGGCCCTAATGCTACCATCACCACCTCCCTGAAGAGTGAGGGAGAAGAAGAGGAGGAGGAGGAAGAGGAGGAGGAGAGCTCCTCTGAGGGCTTGGAGGCTGAGGACTGGGCCCAGGGAGTAGTGGAGGCTGGTGGCAGCTTTGGGGGTTACAGTACCCAGGAGGAGGCCCAGTGTCCTACCCTCCATTTCCTGGAAGGTGGGGAGGACTCTGAGTCAGACAGTGAGGAAGAGGAAGAAGATGAGGATGATGAGGAAGATGATGATGAAGAAGATGACGATGATGGTGATGAGGTGCCTGTACCCAGCTTTGGGGAGGCAATGGCTTACTTCGCCATGGTCAAGAGGTACCTGACCTCCTTCCCCATTGATGACCGTGTACAGAGCCACATCCTCCACCTGGAACATGATCTGGTCCACGTGACTAGGAAGAACCATGCCAGGCAGGCAGGAGTTCGGGGTCTTGGACATCAAAGCTGA

XM_004840737.1 Coding sequence

Cdc25b cell division cycle 25B, transcript variant X1

High confidence: 4 potential gene matches
Length: 1746 bp    Location: 4882516..4892926   Strand: +
>XM_004840737.1
ATGGAGGGGCCCCCGCCCCAGCCCGAGCCTGCGCCCGGCTCGGCTCTCAGCCCGGCCGTCGTGCGCACTGGCGCCCAGCGCCTGGGCCACCACCCCGGCCTCCAGCTGGGTTCTCAGGGCCTCCTGGGGTCCCCGGAGCGCGCGGCCTCTTCCTCTCCAGTCACCACCCTCACCCAGACCATGCACAAGCTCGCTGGGCTCGGCAGTGATTCCCCAACGTGTCAGGTAGGGACCCTGCCCCTCCGAAGTCAGCTAACTCGCCTATCCCTGTCTCGGCGGGCATCAGAATCCTCCTTGTCGTCTGAGTCCTCAGAATCTTCTGATGCAGGTCTCTGCATGGATTCTCCCAGTCCTATGGACCCCCAGATGGCAGAGCAGATGTTTGAACAGGCCATCCAGGCAGCCAGCCGGGTCATTCGAAATGATCATTTTGCCATCAGACGCTTCCAGTCCTTGCCAGTGAAGCTGCTGGGCCACAGCCCTGTGCTCCGGAACATCACCAACTCCCAAGTACTAGACTGCTGGAGCAAGAGCGAGTCGGGTGGCAGAGCTGCCATCAGTCCTGAAGAGGATAAGGAGAATGAGGGATTTGTTTTCAAGATGCCATGGAAGCCTACACATCCCAGCCCTGCTCATACCCTGGTGGGGTGGGCCAGCCGCAGAGAGGCCTTTACCCAGAGGCCAAACTCGGCCCCCAACCTGATGTGTCTCACTCCTGAGCGGAAGATGGAAGTGGAGGAGCTGAGCCCCATGGCTCAGTCTCACTGCCTCTCCCTGACTCCTGCTGAGGGAGCTGCTGAGGAAGATGATGGATTTGTGGACATCCTGGAGAGTGATTTAAAGGAGGATGATGCAGTCCCTGCAGGAATGGAGAGCCTCATTAGTGCCCCACTGGTCAAGACCTTGGATAAGGAAGAGGAGCAGGACCTCGTCATGTTCAGCAAGTGCCAGCGGCTCTTCCGTTCTCCATCCATGCCCTGCAGTGTGATCCGGCCCATTCTCAAGAGACTCGAGCGGCCCCAGGACAGGGATATGCCTGTACAGAGCAAGCGGAGGAGGAGCGTGACCCTTCTGGAGGAGCAGCAGCAGCCTGAGGAACCTAAAGCACGAGTTCTCCGCTCAAAGTCCTTGTGTCATGATGAGATTGAGAGCATCCTGGACAGTGACCACCGAGGACTCATTGGAGATTACTCTAAGGCCTTCCTCCTACAGACAGTGGATGGCAGACACCAAGACCTCAAATACATCTCTCCAGAAACCGTGGTGGCCCTGTTGATGGGCAAGTTCAGCAATATTGTGGAGAAGTTTGTGATTGTGGATTGCAGATACCCCTATGAGTATGAAGGCGGGCACATCAAGACTGCGGTGAACTTGCCCCTTGAACGAGATGCTGAGACCTTCCTGCTGCAGAGCCCAATCACACCCTGTAGCCTGGATAAGAGGATCATCCTCATTTTCCACTGTGAATTCTCCTCAGAGCGTGGGCCCCGCATGTGCCGATTCATCAGGGAACGTGATCGTGCAGCCAATGACTACCCCAGGCTCTACTACCCCGAGATGTACGTCCTCAAGGGCGGCTACAAGGAGTTCTTCCCACAGCACCCGAACTTCTGTGAACCCCGGGACTACCGGCCCATGAATCACGAGGGCTTCAGGGAGGAGCTGAGGACCTTCCGCCTCAAGATGCGCAGCTGGGCTGGGGAGCGGAGCAGGCGTGAGCTCTGTAGCCGGCTGCAGGAACAGTGA

XM_004840740.1 Coding sequence

Cdc25b cell division cycle 25B, transcript variant X4

Length: 1623 bp    Location: 4882516..4892926   Strand: +
>XM_004840740.1
ATGGAGGGGCCCCCGCCCCAGCCCGAGCCTGCGCCCGGCTCGGCTCTCAGCCCGGCCGTCGTGCGCACTGGCGCCCAGCGCCTGGGCCACCACCCCGGCCTCCAGCTGGGTTCTCAGGGCCTCCTGGGGTCCCCGGAGCGCGCGGCCTCTTCCTCTCCAGTCACCACCCTCACCCAGACCATGCACAAGCTCGCTGGGCTCGGCAGTGATTCCCCAACGTGTCAGGTAGGGACCCTGCCCCTCCGAAGTCAGCTAACTCGCCTATCCCTGTCTCGGCGGGCATCAGAATCCTCCTTGTCGTCTGAGTCCTCAGAATCTTCTGATGCAGGTCTCTGCATGGATTCTCCCAGTCCTATGGACCCCCAGATGGCAGAGCAGATGTTTGAACAGGCCATCCAGGCAGCCAGCCGGGTCATTCGAAATGATCATTTTGCCATCAGACGCTTCCAGTCCTTGCCAGAGGGATTTGTTTTCAAGATGCCATGGAAGCCTACACATCCCAGCCCTGCTCATACCCTGGTGGGGTGGGCCAGCCGCAGAGAGGCCTTTACCCAGAGGCCAAACTCGGCCCCCAACCTGATGTGTCTCACTCCTGAGCGGAAGATGGAAGTGGAGGAGCTGAGCCCCATGGCTCAGTCTCACTGCCTCTCCCTGACTCCTGCTGAGGGAGCTGCTGAGGAAGATGATGGATTTGTGGACATCCTGGAGAGTGATTTAAAGGAGGATGATGCAGTCCCTGCAGGAATGGAGAGCCTCATTAGTGCCCCACTGGTCAAGACCTTGGATAAGGAAGAGGAGCAGGACCTCGTCATGTTCAGCAAGTGCCAGCGGCTCTTCCGTTCTCCATCCATGCCCTGCAGTGTGATCCGGCCCATTCTCAAGAGACTCGAGCGGCCCCAGGACAGGGATATGCCTGTACAGAGCAAGCGGAGGAGGAGCGTGACCCTTCTGGAGGAGCAGCAGCAGCCTGAGGAACCTAAAGCACGAGTTCTCCGCTCAAAGTCCTTGTGTCATGATGAGATTGAGAGCATCCTGGACAGTGACCACCGAGGACTCATTGGAGATTACTCTAAGGCCTTCCTCCTACAGACAGTGGATGGCAGACACCAAGACCTCAAATACATCTCTCCAGAAACCGTGGTGGCCCTGTTGATGGGCAAGTTCAGCAATATTGTGGAGAAGTTTGTGATTGTGGATTGCAGATACCCCTATGAGTATGAAGGCGGGCACATCAAGACTGCGGTGAACTTGCCCCTTGAACGAGATGCTGAGACCTTCCTGCTGCAGAGCCCAATCACACCCTGTAGCCTGGATAAGAGGATCATCCTCATTTTCCACTGTGAATTCTCCTCAGAGCGTGGGCCCCGCATGTGCCGATTCATCAGGGAACGTGATCGTGCAGCCAATGACTACCCCAGGCTCTACTACCCCGAGATGTACGTCCTCAAGGGCGGCTACAAGGAGTTCTTCCCACAGCACCCGAACTTCTGTGAACCCCGGGACTACCGGCCCATGAATCACGAGGGCTTCAGGGAGGAGCTGAGGACCTTCCGCCTCAAGATGCGCAGCTGGGCTGGGGAGCGGAGCAGGCGTGAGCTCTGTAGCCGGCTGCAGGAACAGTGA

XM_004840738.1 Coding sequence

Cdc25b cell division cycle 25B, transcript variant X2

Length: 1710 bp    Location: 4882516..4892926   Strand: +
>XM_004840738.1
ATGGAGGGGCCCCCGCCCCAGCCCGAGCCTGCGCCCGGCTCGGCTCTCAGCCCGGCCGTCGTGCGCACTGGCGCCCAGCGCCTGGGCCACCACCCCGGCCTCCAGCTGGGTTCTCAGGGCCTCCTGGGGTCCCCGGAGCGCGCGGCCTCTTCCTCTCCAGTCACCACCCTCACCCAGACCATGCACAAGCTCGCTGGGCTCGGCAGCCGAAGTCAGCTAACTCGCCTATCCCTGTCTCGGCGGGCATCAGAATCCTCCTTGTCGTCTGAGTCCTCAGAATCTTCTGATGCAGGTCTCTGCATGGATTCTCCCAGTCCTATGGACCCCCAGATGGCAGAGCAGATGTTTGAACAGGCCATCCAGGCAGCCAGCCGGGTCATTCGAAATGATCATTTTGCCATCAGACGCTTCCAGTCCTTGCCAGTGAAGCTGCTGGGCCACAGCCCTGTGCTCCGGAACATCACCAACTCCCAAGTACTAGACTGCTGGAGCAAGAGCGAGTCGGGTGGCAGAGCTGCCATCAGTCCTGAAGAGGATAAGGAGAATGAGGGATTTGTTTTCAAGATGCCATGGAAGCCTACACATCCCAGCCCTGCTCATACCCTGGTGGGGTGGGCCAGCCGCAGAGAGGCCTTTACCCAGAGGCCAAACTCGGCCCCCAACCTGATGTGTCTCACTCCTGAGCGGAAGATGGAAGTGGAGGAGCTGAGCCCCATGGCTCAGTCTCACTGCCTCTCCCTGACTCCTGCTGAGGGAGCTGCTGAGGAAGATGATGGATTTGTGGACATCCTGGAGAGTGATTTAAAGGAGGATGATGCAGTCCCTGCAGGAATGGAGAGCCTCATTAGTGCCCCACTGGTCAAGACCTTGGATAAGGAAGAGGAGCAGGACCTCGTCATGTTCAGCAAGTGCCAGCGGCTCTTCCGTTCTCCATCCATGCCCTGCAGTGTGATCCGGCCCATTCTCAAGAGACTCGAGCGGCCCCAGGACAGGGATATGCCTGTACAGAGCAAGCGGAGGAGGAGCGTGACCCTTCTGGAGGAGCAGCAGCAGCCTGAGGAACCTAAAGCACGAGTTCTCCGCTCAAAGTCCTTGTGTCATGATGAGATTGAGAGCATCCTGGACAGTGACCACCGAGGACTCATTGGAGATTACTCTAAGGCCTTCCTCCTACAGACAGTGGATGGCAGACACCAAGACCTCAAATACATCTCTCCAGAAACCGTGGTGGCCCTGTTGATGGGCAAGTTCAGCAATATTGTGGAGAAGTTTGTGATTGTGGATTGCAGATACCCCTATGAGTATGAAGGCGGGCACATCAAGACTGCGGTGAACTTGCCCCTTGAACGAGATGCTGAGACCTTCCTGCTGCAGAGCCCAATCACACCCTGTAGCCTGGATAAGAGGATCATCCTCATTTTCCACTGTGAATTCTCCTCAGAGCGTGGGCCCCGCATGTGCCGATTCATCAGGGAACGTGATCGTGCAGCCAATGACTACCCCAGGCTCTACTACCCCGAGATGTACGTCCTCAAGGGCGGCTACAAGGAGTTCTTCCCACAGCACCCGAACTTCTGTGAACCCCGGGACTACCGGCCCATGAATCACGAGGGCTTCAGGGAGGAGCTGAGGACCTTCCGCCTCAAGATGCGCAGCTGGGCTGGGGAGCGGAGCAGGCGTGAGCTCTGTAGCCGGCTGCAGGAACAGTGA

XM_004840743.1 Coding sequence

Ap5s1 adaptor-related protein complex 5, sigma 1 subunit, transcript variant X2

Length: 603 bp    Location: 4903492..4907702   Strand: +
>XM_004840743.1
ATGGTCCACGCCTTTCTCATACATACTTTGAGGACCCCGAATGCAGAGGCCACAGGCTTTTGCCGAGTGCTCTACTCTTGCGTCTTTGGTGCTGAGAAGTCACCAGATGATCCAAGGCCACACGGTGCAGAGAGGGACAGGCTCCTCCGAAAGGAACAGATTTTGGCAGTGGCCAGGCAGGTGGAGTCGATGTGTCAACTGCAGCAGCTGGCATCAGGCCGCCCATCCTTGGACCTGCAGACCCAGATCTGTGACGAGCCTGTGCCCCTGCATGAGTCCCCACATGGGGTCTTCGGGCTGGCGGCAGGAGACCCCTTCCGGGAGCCTCACACCGTGGTGTGGTTGGGAGTGCTGTCCCTAGGCTTTGCCCTGGTGCTCGACGCCCATGACAACCTGCTGCTGGCAGAGAGCACACTCCGCCTGCTGGCCCGCCTCCTCCTGGACCACCTCCGTCTGCTGACCCCAGGCTCCAGCCTCCTGCTGCGGGCCGACCATGTTGAGGGCGTCCTCTCCCGCTTCCTGCCCCATGGCCAGCTGCTCTTCCTCAATGACCAGTTCGTCCAGGCTCTGGAGAAGGAATTCAGTGCTTCCTGGCCCCGCTGA

XM_004840744.1 Coding sequence

Ap5s1 adaptor-related protein complex 5, sigma 1 subunit, transcript variant X3

Length: 603 bp    Location: 4904105..4907702   Strand: +
>XM_004840744.1
ATGGTCCACGCCTTTCTCATACATACTTTGAGGACCCCGAATGCAGAGGCCACAGGCTTTTGCCGAGTGCTCTACTCTTGCGTCTTTGGTGCTGAGAAGTCACCAGATGATCCAAGGCCACACGGTGCAGAGAGGGACAGGCTCCTCCGAAAGGAACAGATTTTGGCAGTGGCCAGGCAGGTGGAGTCGATGTGTCAACTGCAGCAGCTGGCATCAGGCCGCCCATCCTTGGACCTGCAGACCCAGATCTGTGACGAGCCTGTGCCCCTGCATGAGTCCCCACATGGGGTCTTCGGGCTGGCGGCAGGAGACCCCTTCCGGGAGCCTCACACCGTGGTGTGGTTGGGAGTGCTGTCCCTAGGCTTTGCCCTGGTGCTCGACGCCCATGACAACCTGCTGCTGGCAGAGAGCACACTCCGCCTGCTGGCCCGCCTCCTCCTGGACCACCTCCGTCTGCTGACCCCAGGCTCCAGCCTCCTGCTGCGGGCCGACCATGTTGAGGGCGTCCTCTCCCGCTTCCTGCCCCATGGCCAGCTGCTCTTCCTCAATGACCAGTTCGTCCAGGCTCTGGAGAAGGAATTCAGTGCTTCCTGGCCCCGCTGA

XM_004840748.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X3

Length: 1590 bp    Location: 4936539..4951064   Strand: +
>XM_004840748.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840754.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X9

Length: 1590 bp    Location: 4936539..4951064   Strand: +
>XM_004840754.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840755.1 Coding sequence

Mavs mitochondrial antiviral signaling protein, transcript variant X10

High confidence: 4 potential gene matches
Length: 1590 bp    Location: 4936539..4951064   Strand: +
>XM_004840755.1
ATGACCTGCGCTGAGGAAAAGACTTATAAGTTTATCTGCCGCCATCATAGTAATTTTTGCCATGTTGATGTTCTGGAGATTCTTCCTTACCTGCCCTGCCTGACACCCAGTGACCAGGATCGACTGCGTGCCTCCTACACACGCCTGGGGAACAGAGACACACTGTGGGACCTCTTCAACACCCTCCAGCGGCGGACAGGCTGGGTGGAGTACCTCGTTGGGGCGCTGAGGACCTGTGAGCTGAGTGGGCTCGCTGATCAAGTGAATCGTGTGTACCAGAGCTCCCAGCCTGGTGGGACTCCATCCCAGGCCCCAGGCCCAGTGAAAGCACTGGAAGTTCCTGCTGAGGTTCCAGCAGCCCATAACTCTGGCACAACCCACAGTGTCCCCCACAATGGCTACCGAGAGGAGCCAAGTTACCCCTGGCCTGTCCAGGACACCCAGCCACCAGAGTCCCCCAGGGAGAGTTCAGAGCAGGTCCCACAGACAACCAGTTTGGGGGCCATCCCAAGGAGGCCCAGTGGATCCTTGGAGCCCTCCTCTGACCTGCCAGCCCTCAGTCCTCTGACCCCCAGCAGGCATCAGGAGCAGAACCCAAAACTGGGCAGCACACAGGGGACAGGCCCAGTGTCCAGCCCCACATCACCCAGAGGACCTGTGTCTCCAACTGTCTCCTTCCAGCCCCTGGCCCGTGCCACCCCCAGGGTGAGCCGCTTGCCTGGACCCGCATGGGCAGCGGCAGCCATGTCTGTTAGCCCCTCCTTTTCCTCCTCTCCTTCTTCCACTAGCTCGCCTTCTACAGGCAGTGCGGGTAACCAGGCCAGGGCCTCCACCTGCCCCAGTGAGGTACCCACAGAGGTACCCACCAACTCTGTTACTACCAGCTCAGTGCCTTCTCCCACCACTCTGAAGCCTGTGACCACTATGACCTCCAAAGTGCCTGCTAGCCCGGCACCTGTCAGCATTGTGCCTTCCAAGGTGCCCACCAGCTTGAAGCCCCCTGGTGCTAATGTGCTCACCAATCCAGCACCATCCAAATTGCCTATCAACTCAGCACGTGCTGGCATAATGCCATCCAAAGTGCCTACTAGCATGGTGTCCACCAAGGCGCCTAACAACACAGTGCTGTCCACTGGGAGCAGCACCAGAGCCAAGGAGATCGCAGAGGCTCCAGCACCTACAGCTACTATTGGAGCCAGCTCACCCTGGCCGAAGAGCAGCTCTGGGGACCTACAATCTTCATCAGAAATGAGCAAGCCTGGCGAGCTACAATCCCAGCAGTACAGCCAACCATACTCCGGCTGTTCTGCAGACCTCGCCATCAGCCCCAGCAGCTCCCTGGCCTCAGAGCCTACCCATGGCCCAGAGGAGAATGAGTATGCGTCCTTTGGGATCCGTGTGGCTGAGGATCCCAGTGCCAACCTCATGGCTGTCAACCCTGAGCCTTGCACTGTCTTGCAAGCCCAGAAAGAGGAGAAAGAGACAAATATTGGATGGTCAGTGTCCTGGACTTCCTGGCTTGGAGCAGCTGTGGCAAGTGCCCTCCTGGGTGTGCTCCTGGCGGTGCTGTACCGGCGGCGCTCACTCTAG

XM_004840758.1 Coding sequence

Rnf24 ring finger protein 24, transcript variant X3

High confidence: 3 potential gene matches
Length: 447 bp    Location: 5073298..5010471   Strand: -
>XM_004840758.1
ATGAGCTCGGATTTCCCACACTACAACTTCAGGATGCCTAATATTGGATTCCAGAATCTGCCTCTCAACATATATATTGTGGTTTTTGGCACTGCTATATTTGTCTTCATTCTTAGTTTACTCTTCTGTTGCTACCTGATTAGGCTAAGACATCAAGCACACAAAGAATTTTATGCCTACAAACAGGTTATATTAAAAGAGAAAGTGAAAGAGCTGAATTTACATGAGCTCTGTGCAGTGTGTCTAGAAGACTTCAAGCCCAGAGATGAGTTGGGGATTTGTCCATGTAAGCATGCCTTCCACAGAAAGTGCCTTATTAAGTGGCTGGAGGTTCGGAAAGTGTGTCCACTGTGCAACATGCCAGTTCTGCAGCTGGCCCAGTTGCACAGTAAGCAGAACCATGGTCCCCCCCAGGGACCCCTTCCTGGAGCAGAGAACATTGTATAG

XM_004840766.1 Coding sequence

Smox spermine oxidase, transcript variant X7

Length: 1020 bp    Location: 5215998..5250969   Strand: +
>XM_004840766.1
ATGCAAAGTTGTGAATCCAGTGGCGAAAGTGCGGATGACCCTCTCAGTTGTGGCCTGCGGAGAAGGGGACAGCCTCGAGTTGTGGTGATTGGTGCTGGCTTGGCTGGCCTGGCTGCAACCAAAGCGCTTCTGGAGCAGGGCTTCACAGATGTCACTGTCCTCGAGGCTTCTAGCCGCATCGGAGGCCGCGTGCAAAGCGTGAAACTCGGACACGCCACCTTTGAGCTGGGAGCCACCTGGATCCATGGCTCCCATGGGAATCCTGTCTATCATCTAGCAGAAGCCAACGGCCTCTTGGAAGAGACAACCGATGGTGAGCGCAGCGTGGGCCGCATCAGCCTCTACTCCAAGAATGGCGTGGCCTGCTACCTTACCAACCGCAGCCGCAGGATCCCCAAGGATGTGGTTGAGGAATTCAGCGATTTATACAACGAGGTCTATAACTTGACCCAGGAGTTCTTCCGGCATGGTAAACCAGTCAATGCGGAGAGTCAGAACAGCGTTGGGGTGTTCACCCGGGAGGAGGTGCGCAACCGCGTCAGGGATGAGCCTGATGACCCGGAGACCACCAAGCGCCTGAAACTTGCCATGATGCAGCAGTACCTGAAGGGAACCCCAACATTCCAAAACCTCGGCGAATCCTGCGCTCGGCCTGGGGTAGCAACCCTTACTTCCGAGGCTCCTACTCATACACGCAGGTGGGCTCAAGTGGGGCAGACGTGGAGAAGCTGGCCAAGCCGCTGCCCTACACAGAGAGCTCCAAGACCGCGCCCATGCAGGTGCTGTTCTCGGGGGAGGCCACCCACCGCAAGTACTACTCCACTACTCACGGTGCTCTGCTGTCCGGCCAGCGCGAGGCTGCTCGTCTCATCGAGATGTATCGAGACCTCTTCCAGCAGGGTCCCTGAGGGCTTCGTGTTCTTCCTAGAACCACTAACTCAGGACTGTTGGCCCCTGCCCTTGCCCCTGTGTGCTCCTAACTTCCTAATCTTCTGTAGAATGGATTTTGATCTTTCGTAG

XM_004840760.1 Coding sequence

Smox spermine oxidase, transcript variant X1

Length: 1758 bp    Location: 5215998..5250731   Strand: +
>XM_004840760.1
ATGCAAAGTTGTGAATCCAGTGGCGAAAGTGCGGATGACCCTCTCAGTTGTGGCCTGCGGAGAAGGGGACAGCCTCGAGTTGTGGTGATTGGTGCTGGCTTGGCTGGCCTGGCTGCAACCAAAGCGCTTCTGGAGCAGGGCTTCACAGATGTCACTGTCCTCGAGGCTTCTAGCCGCATCGGAGGCCGCGTGCAAAGCGTGAAACTCGGACACGCCACCTTTGAGCTGGGAGCCACCTGGATCCATGGCTCCCATGGGAATCCTGTCTATCATCTAGCAGAAGCCAACGGCCTCTTGGAAGAGACAACCGATGGTGAGCGCAGCGTGGGCCGCATCAGCCTCTACTCCAAGAATGGCGTGGCCTGCTACCTTACCAACCGCAGCCGCAGGATCCCCAAGGATGTGGTTGAGGAATTCAGCGATTTATACAACGAGGTCTATAACTTGACCCAGGAGTTCTTCCGGCATGGTAAACCAGTCAATGCGGAGAGTCAGAACAGCGTTGGGGTGTTCACCCGGGAGGAGGTGCGCAACCGCGTCAGGGATGAGCCTGATGACCCGGAGACCACCAAGCGCCTGAAACTTGCCATGATGCAGCAGTACCTGAAGGTAGAAAGCTGTGAGAGCAGCTCACACAGCATAGACGAAGTATCCCTGAGCGCCTTCGGGGAGTGGACCGAGATCCCTGGTGCCCACCACGTCATCCCCTCAGGCTTCATGCGGGTCGTGGAGCTGCTGGCTGAGGGCATCCCGGCCCATGTAATCCAGCTGGGGAAACCTGTCCGGTGTATTCACTGGGACCAGGCCTCTGCCCGCCCCCGGGGTCCTGAGATCCAGCCTCGGGACAAGGGTGACCACAATCACGACACAGGGGAGGACAACCAGAGTGGAGAGAGTTCCCAGGGGCATGGATGGGATGAGGATGAGCAGTGGCCGGTGGTGGTGGAGTGCGAAGACTGCGAGGTGATCCCAGCAGACCACGTGATTGTGACCGTGTCCCTGGGTGTGCTCAAGAGGCAGTACACCAGCTTCTTCCAGCCGGGCCTGCCCACAGAAAAGGTGGCTGCCATCCACCGCCTGGGCATTGGCACCACTGACAAGATCTTCCTTGAATTTGAGGAGCCCTTCTGGGGTCCTGAGTGCAACAGCCTGCAGTTTGTGTGGGAGGATGAGGCTGAGAGCCACACCCTCACCTACCCACCTGAGCAGTGGTACCGCAAAATCTGTGGCTTCGACGTCCTCTACCCCCCTGAGCGCTATGGCCATGTGCTGAGTGGCTGGATCTGTGGGGAGGAGGCCCTTGTCATGGAGAGGTGTGATGACGAGGCAGTGGCCGAGATCTGCACAGAGATGTTGCGTCAGTTCACAGGGAACCCCAACATTCCAAAACCTCGGCGAATCCTGCGCTCGGCCTGGGGTAGCAACCCTTACTTCCGAGGCTCCTACTCATACACGCAGGTGGGCTCAAGTGGGGCAGACGTGGAGAAGCTGGCCAAGCCGCTGCCCTACACAGAGAGCTCCAAGACCGCGCACAGAGGCACCACAAAGCAGCAGCCTGGTCACCTTTTATCATCTAAGTTTCCAGAACAGTCTCTGGACCCTAGTAGGGGCTCCATAAAGCCCATGCAGGTGCTGTTCTCGGGGGAGGCCACCCACCGCAAGTACTACTCCACTACTCACGGTGCTCTGCTGTCCGGCCAGCGCGAGGCTGCTCGTCTCATCGAGATGTATCGAGACCTCTTCCAGCAGGGTCCCTGA

XM_004840762.1 Coding sequence

Smox spermine oxidase, transcript variant X3

Length: 1758 bp    Location: 5216426..5250731   Strand: +
>XM_004840762.1
ATGCAAAGTTGTGAATCCAGTGGCGAAAGTGCGGATGACCCTCTCAGTTGTGGCCTGCGGAGAAGGGGACAGCCTCGAGTTGTGGTGATTGGTGCTGGCTTGGCTGGCCTGGCTGCAACCAAAGCGCTTCTGGAGCAGGGCTTCACAGATGTCACTGTCCTCGAGGCTTCTAGCCGCATCGGAGGCCGCGTGCAAAGCGTGAAACTCGGACACGCCACCTTTGAGCTGGGAGCCACCTGGATCCATGGCTCCCATGGGAATCCTGTCTATCATCTAGCAGAAGCCAACGGCCTCTTGGAAGAGACAACCGATGGTGAGCGCAGCGTGGGCCGCATCAGCCTCTACTCCAAGAATGGCGTGGCCTGCTACCTTACCAACCGCAGCCGCAGGATCCCCAAGGATGTGGTTGAGGAATTCAGCGATTTATACAACGAGGTCTATAACTTGACCCAGGAGTTCTTCCGGCATGGTAAACCAGTCAATGCGGAGAGTCAGAACAGCGTTGGGGTGTTCACCCGGGAGGAGGTGCGCAACCGCGTCAGGGATGAGCCTGATGACCCGGAGACCACCAAGCGCCTGAAACTTGCCATGATGCAGCAGTACCTGAAGGTAGAAAGCTGTGAGAGCAGCTCACACAGCATAGACGAAGTATCCCTGAGCGCCTTCGGGGAGTGGACCGAGATCCCTGGTGCCCACCACGTCATCCCCTCAGGCTTCATGCGGGTCGTGGAGCTGCTGGCTGAGGGCATCCCGGCCCATGTAATCCAGCTGGGGAAACCTGTCCGGTGTATTCACTGGGACCAGGCCTCTGCCCGCCCCCGGGGTCCTGAGATCCAGCCTCGGGACAAGGGTGACCACAATCACGACACAGGGGAGGACAACCAGAGTGGAGAGAGTTCCCAGGGGCATGGATGGGATGAGGATGAGCAGTGGCCGGTGGTGGTGGAGTGCGAAGACTGCGAGGTGATCCCAGCAGACCACGTGATTGTGACCGTGTCCCTGGGTGTGCTCAAGAGGCAGTACACCAGCTTCTTCCAGCCGGGCCTGCCCACAGAAAAGGTGGCTGCCATCCACCGCCTGGGCATTGGCACCACTGACAAGATCTTCCTTGAATTTGAGGAGCCCTTCTGGGGTCCTGAGTGCAACAGCCTGCAGTTTGTGTGGGAGGATGAGGCTGAGAGCCACACCCTCACCTACCCACCTGAGCAGTGGTACCGCAAAATCTGTGGCTTCGACGTCCTCTACCCCCCTGAGCGCTATGGCCATGTGCTGAGTGGCTGGATCTGTGGGGAGGAGGCCCTTGTCATGGAGAGGTGTGATGACGAGGCAGTGGCCGAGATCTGCACAGAGATGTTGCGTCAGTTCACAGGGAACCCCAACATTCCAAAACCTCGGCGAATCCTGCGCTCGGCCTGGGGTAGCAACCCTTACTTCCGAGGCTCCTACTCATACACGCAGGTGGGCTCAAGTGGGGCAGACGTGGAGAAGCTGGCCAAGCCGCTGCCCTACACAGAGAGCTCCAAGACCGCGCACAGAGGCACCACAAAGCAGCAGCCTGGTCACCTTTTATCATCTAAGTTTCCAGAACAGTCTCTGGACCCTAGTAGGGGCTCCATAAAGCCCATGCAGGTGCTGTTCTCGGGGGAGGCCACCCACCGCAAGTACTACTCCACTACTCACGGTGCTCTGCTGTCCGGCCAGCGCGAGGCTGCTCGTCTCATCGAGATGTATCGAGACCTCTTCCAGCAGGGTCCCTGA

XM_004840764.1 Coding sequence

Smox spermine oxidase, transcript variant X5

Length: 1758 bp    Location: 5235128..5250731   Strand: +
>XM_004840764.1
ATGCAAAGTTGTGAATCCAGTGGCGAAAGTGCGGATGACCCTCTCAGTTGTGGCCTGCGGAGAAGGGGACAGCCTCGAGTTGTGGTGATTGGTGCTGGCTTGGCTGGCCTGGCTGCAACCAAAGCGCTTCTGGAGCAGGGCTTCACAGATGTCACTGTCCTCGAGGCTTCTAGCCGCATCGGAGGCCGCGTGCAAAGCGTGAAACTCGGACACGCCACCTTTGAGCTGGGAGCCACCTGGATCCATGGCTCCCATGGGAATCCTGTCTATCATCTAGCAGAAGCCAACGGCCTCTTGGAAGAGACAACCGATGGTGAGCGCAGCGTGGGCCGCATCAGCCTCTACTCCAAGAATGGCGTGGCCTGCTACCTTACCAACCGCAGCCGCAGGATCCCCAAGGATGTGGTTGAGGAATTCAGCGATTTATACAACGAGGTCTATAACTTGACCCAGGAGTTCTTCCGGCATGGTAAACCAGTCAATGCGGAGAGTCAGAACAGCGTTGGGGTGTTCACCCGGGAGGAGGTGCGCAACCGCGTCAGGGATGAGCCTGATGACCCGGAGACCACCAAGCGCCTGAAACTTGCCATGATGCAGCAGTACCTGAAGGTAGAAAGCTGTGAGAGCAGCTCACACAGCATAGACGAAGTATCCCTGAGCGCCTTCGGGGAGTGGACCGAGATCCCTGGTGCCCACCACGTCATCCCCTCAGGCTTCATGCGGGTCGTGGAGCTGCTGGCTGAGGGCATCCCGGCCCATGTAATCCAGCTGGGGAAACCTGTCCGGTGTATTCACTGGGACCAGGCCTCTGCCCGCCCCCGGGGTCCTGAGATCCAGCCTCGGGACAAGGGTGACCACAATCACGACACAGGGGAGGACAACCAGAGTGGAGAGAGTTCCCAGGGGCATGGATGGGATGAGGATGAGCAGTGGCCGGTGGTGGTGGAGTGCGAAGACTGCGAGGTGATCCCAGCAGACCACGTGATTGTGACCGTGTCCCTGGGTGTGCTCAAGAGGCAGTACACCAGCTTCTTCCAGCCGGGCCTGCCCACAGAAAAGGTGGCTGCCATCCACCGCCTGGGCATTGGCACCACTGACAAGATCTTCCTTGAATTTGAGGAGCCCTTCTGGGGTCCTGAGTGCAACAGCCTGCAGTTTGTGTGGGAGGATGAGGCTGAGAGCCACACCCTCACCTACCCACCTGAGCAGTGGTACCGCAAAATCTGTGGCTTCGACGTCCTCTACCCCCCTGAGCGCTATGGCCATGTGCTGAGTGGCTGGATCTGTGGGGAGGAGGCCCTTGTCATGGAGAGGTGTGATGACGAGGCAGTGGCCGAGATCTGCACAGAGATGTTGCGTCAGTTCACAGGGAACCCCAACATTCCAAAACCTCGGCGAATCCTGCGCTCGGCCTGGGGTAGCAACCCTTACTTCCGAGGCTCCTACTCATACACGCAGGTGGGCTCAAGTGGGGCAGACGTGGAGAAGCTGGCCAAGCCGCTGCCCTACACAGAGAGCTCCAAGACCGCGCACAGAGGCACCACAAAGCAGCAGCCTGGTCACCTTTTATCATCTAAGTTTCCAGAACAGTCTCTGGACCCTAGTAGGGGCTCCATAAAGCCCATGCAGGTGCTGTTCTCGGGGGAGGCCACCCACCGCAAGTACTACTCCACTACTCACGGTGCTCTGCTGTCCGGCCAGCGCGAGGCTGCTCGTCTCATCGAGATGTATCGAGACCTCTTCCAGCAGGGTCCCTGA

XM_004840769.1 Coding sequence

Prnp prion protein, transcript variant X2

Length: 735 bp    Location: 5785197..5802162   Strand: +
>XM_004840769.1
ATGGTGAACGCTGGCTGCTGGCTACTGGTTCTTTTTGTGGCTACATGGAGTGACATTGGCCTCTGCAAGAAGCGACCAAAACCAGGAGGAGGATGGAACAGCGGGGGCAGCCGTTACCCATCTCACAGCGGGGGCAACTGGGGCCAGCCCCATGGCGGTGGCTGGGGACAGCCCCATGGTGGTAGTTGGGGCCAGCCCCATGGTGGAGGCTGGGGACAGCCCCATGGTGGTGGCTGGGGTCATGGAGGTGGCACCTACAATCAGTGGAACAAACCCAGTAAGCCCAAAACCAACATGAAGCATATGGCAGGCGCTGCAGCGGCGGGGGCAGTGGTGGGAGGTCTGACTGGCTACATGCTGGGGAGTGCCATGAGCAGGCCCCTCATCCATTTCGGCAGTGATTATGAGGACCGTTACTACCGTGAGAACATGTACCGTTACCCCAACCAAGTGTACTACAGGCCCGTGGATCAGTACAACAACCAGAACAGCTTTGTGCAGGACTGCGTCAATATCACGATCAAGCAGCACACAGTCACCACCACCACCAAAGGGGAGAACTTCACCGAGACCGACGTGAAGATAATGGAGCGCGTACTGGAGCAGATGTGCACCACGCAGTACCAGAAGGAGTCCCAGGCCTACTACTACCGCGGAAGAGCCGGCTTGGTGCTCTTCTCCTCCCCACCTGTGATCCTCCTCATCTCCTTCCTCATCTTCCTGATAGTGGGATGA

XM_004840773.1 Coding sequence

Rassf2 Ras association (RalGDS/AF-6) domain family member 2, transcript variant X1

Length: 1098 bp    Location: 5894541..5857607   Strand: -
>XM_004840773.1
ATGGATTACAGTCACCAAACTTCCCTAGTCCCACGTGGGCAAGATAAATACATTTCCAAGAATGAACTTCTCCTGCACCTGAAGACCTACAACCTGTACTATGAGGGCCAGAACTTGCAGCTGCGACACAGGGAGGAAGAAGATGAGTTCATCGTGGAGGGGCTGCTGAACATCTCCTGGGGGCTGCGCCGGCCCATCCGTCTGCAGATGCAAGACGACAATGAGCGCATCCGGCCCCCGCCCTCCTCCTCGTCCTGGCACTCAGGCTGCAACCTGGGGGCTCAGGGCACCATCCTGAAGCCCCTCACCATGCCTGCCATTCAGATCTCAGAGGCGGACACCCCTCCCGAGGGTGACCAGACACCCAGCCTCACAGACACCAGGGGTCTGAAGCCCGTGCAGGAAGACACCCCACAGCTGATGCGCACGCGCAGTGATGTTGGGGTGCGTCGGCGTGGTAACGTGAGAACGCCCAGTGACCAGCGGCGAATCCGACGCCACCGCTTCTCCATCAATGGCCATTTTTACAACCACAAGACTTCCGTGTTCACGCCTGCCTATGGCTCTGTCACCAACGTCCGAATCAACAGCACCATGACTACCCCGCAGGTCCTGAAGCTGCTGCTCAACAAATTTAAGATTGAGAATTCAGCAGAGGAGTTTGCTTTGTACGTGGTCCACACCAGTGGTGAGAAACAGAAGCTGAAGACCACCGATTACCCACTGATTGCCCGCATCCTGCAGGGGCCCTGTGAGCAGGTCTCCAAGGTGTTCCTGATGGAGAAAGACCAGGTGGAGGAGGTCACCTATGACGTGGCCCAGTACATAAAGTTTGAGATGCCGGTCCTGAAAAGCTTCATCCAGAAGCTCCAGGAGGAGGAGGATCGGGAGGTGAAGAAGCTGATGCAGAAGTGTGGAAGTGAACACAGTAATGCAGTGGCTCATGAGTGGGCTAGTGAAGGTATCACCCAGTGCCACCTGATGTTAGCTGGTGCCTCCTGGGTGGGGTTGGGGGGGTCATCCGAAGGAAGGGTCTGTTGCCAGCTGCCTTCTACTATAGGCTATCTCTTGTCCCCAGGTACACTGTACTCCGGCTAA

XM_004840774.1 Coding sequence

Rassf2 Ras association (RalGDS/AF-6) domain family member 2, transcript variant X2

Length: 981 bp    Location: 5894539..5857607   Strand: -
>XM_004840774.1
ATGGATTACAGTCACCAAACTTCCCTAGTCCCACGTGGGCAAGATAAATACATTTCCAAGAATGAACTTCTCCTGCACCTGAAGACCTACAACCTGTACTATGAGGGCCAGAACTTGCAGCTGCGACACAGGGAGGAAGAAGATGAGTTCATCGTGGAGGGGCTGCTGAACATCTCCTGGGGGCTGCGCCGGCCCATCCGTCTGCAGATGCAAGACGACAATGAGCGCATCCGGCCCCCGCCCTCCTCCTCGTCCTGGCACTCAGGCTGCAACCTGGGGGCTCAGGGCACCATCCTGAAGCCCCTCACCATGCCTGCCATTCAGATCTCAGAGGCGGACACCCCTCCCGAGGGTGACCAGACACCCAGCCTCACAGACACCAGGGGTCTGAAGCCCGTGCAGGAAGACACCCCACAGCTGATGCGCACGCGCAGTGATGTTGGGGTGCGTCGGCGTGGTAACGTGAGAACGCCCAGTGACCAGCGGCGAATCCGACGCCACCGCTTCTCCATCAATGGCCATTTTTACAACCACAAGACTTCCGTGTTCACGCCTGCCTATGGCTCTGTCACCAACGTCCGAATCAACAGCACCATGACTACCCCGCAGGTCCTGAAGCTGCTGCTCAACAAATTTAAGATTGAGAATTCAGCAGAGGAGTTTGCTTTGTACGTGGTCCACACCAGTGGTGAGAAACAGAAGCTGAAGACCACCGATTACCCACTGATTGCCCGCATCCTGCAGGGGCCCTGTGAGCAGGTCTCCAAGGTGTTCCTGATGGAGAAAGACCAGGTGGAGGAGGTCACCTATGACGTGGCCCAGTACATAAAGTTTGAGATGCCGGTCCTGAAAAGCTTCATCCAGAAGCTCCAGGAGGAGGAGGATCGGGAGGTGAAGAAGCTGATGCAGAAGTACACTGTACTCCGGCTAATGATTAGCCAAAGGCTGGAGGAGATAGCTGACACTCCGGCAACAATCTGA

XM_004840781.1 Coding sequence

Cds2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 1338 bp    Location: 6159577..6231967   Strand: +
>XM_004840781.1
ATGACGGAGCTGAGGCAGAGGACGGCCCGCGAGCCGGACGCGCCGACGGAGGACAAGGAGTTGGAGTCAGAAGCAAAGGTTGATGGAGAGACTGCATCAGACAGCGAGAGCCGAGCAGACCTGGTTGCCCCGCCAGCTCCTGTGGATGACACCCCGGAGGTCCTCAACAGGGCCCTTTCTAACCTGTCTTCAAGATGGAAGAACTGGTGGGTGAGAGGCATCCTGACTTTGGCCATGATTGCATTTTTCTTCATCATCATTTACCTAGGACCAATGGTTTTAATGATGATCGTGATGTGTGTTCAGATAAAGTGTTTCCACGAGATCATCACTATCGGCTACAATGTCTACCACTCCTATGACCTGCCCTGGTTTAGGACCCTCAGCTGGTACTTTCTGCTGTGTGTAAACTATTTCTTCTATGGTGAGACGGTGACGGATTACTTCTTCACCCTGGTCCAGAGAGAAGAGCCTTTGCGGATTCTCAGTAAATACCACCGGTTCATTTCCTTCACCCTCTACCTAACCGGATTTTGCATGTTTGTACTAAGCCTGGTCAAGAAGCATTATCGACTGCAGTTCTACATGTTTGGCTGGACCCATGTAACACTACTGATTGTTGTAACCCAGTCACATCTCGTTATCCACAACCTGTTTGAAGGAATGATCTGGTTCATTGTCCCCATTTCCTGTGTGATCTGCAATGACATCATGGCCTATATGTTTGGCTTTTTCTTTGGTCGGACCCCACTCATCAAGCTCTCTCCCAAGAAGACATGGGAAGGCTTCATTGGGGGTTTCTTTGCTACTGTGGTGTTTGGCCTTCTGCTGTCCTATGTGATGTCTGGGTACAGATGCTTTGTCTGTCCCGTGGAGTACAACAATGACACCAACAGCTTCACCGTGGACTGTGAGCCTTCAGACCTGTTCCGCCTGCAGGAGTACAACATTCCTGGGGTGATCCATTCGGTCATTGGCTGGAAAACTGTTCGGATGTACCCCTTCCAGATTCACAGCATTGCCCTCTCCACCTTTGCCTCGCTCATAGGCCCTTTTGGAGGCTTCTTCGCAAGCGGCTTCAAGCGAGCCTTTAAAATCAAGGACTTTGCCAATACCATTCCTGGCCACGGAGGCATCATGGATCGCTTTGACTGCCAGTACCTGATGGCCACCTTTGTCAATGTGTACATCGCCAGTTTTATCAGGGGTCCTAACCCGAGCAAGCTGATTCAGCAGTTCCTGACCTTGCGGCCAGATCAGCAGCTCCACATCTTCAACACGCTTAAGTCTCACCTAATGGACAAGGGGATCCTGACACCTGCCGCAGAAGATGAGTAG

XM_004841157.1 Coding sequence

LOC101725482 protein FRG1-like

Length: 774 bp    Location: 6264563..6263790   Strand: -
>XM_004841157.1
ATGGTCGAGTACTCCTACGTAAAGTCCACCAAACTCGTGCTCAAAGGAACGAAAGCCAAAAGTAAGAAGAGAAAGAAAGAAAAGAAGAGAAAAAGAGAAGAGGATGAAGAAACCCAAGTTGATATTGTTGGAATGTGGTGGACAATAGCCAACTTTGGTGACATTTCAGGAACTATAGCCATTGAAATGGATAAAGGAACCAATATCCATGCACTTGACAATGGTCTTTTTACACTGAGAGCACCACATAAAGAAGTTGATGAAGGTCCTAGTCCTCCAGAGCAGTTTACTGCTGTCAAATTGTCTGATTCCAGAATTGCCCTGAAATCTGGCTATGGAAAATATCTTGGTATCAATTCAGATGGACTTCTTGTTGGGCGTTCAGATGCCATTGGACCAAAAGAAAAGTGGGAGCCAGTGTCTCAAGATGGGAAAATGGCTTTATTGGCCGCAAATAGTTGCTTTATTAGATGCAATGAATCAGGTGATATAGAAGCAAAAAGTAAAACAGCAGGAGAAGAAGAAATGATAAAGATTAGATCCTGTGCTGAAAGGGAAACCAAGAAAAAAGATGACATTCCAGGAGAAGACAAAGGGGATGTAAAACAGTGTGAAATCAACTACGTAAAAAAAATTCAGAGCTTCCAAGACCATAAACTTAAAATCAGTAAAGAAGACAGTAAAATTCTTAAAAAGGCTCGGAAAGATGGATTTTTGCATGAGACTCTTCTGGGCAGGAGAGCCAAGTTGAAAGCTGATAGATACTGCAACTGA

XM_004840785.1 Coding sequence

Prokr2 prokineticin receptor 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 1158 bp    Location: 6281131..6270628   Strand: -
>XM_004840785.1
ATGACAGCCCAGAGCAGAAACACCAGCTTTACACCCATCTTTAATCCATCCCAAGACCATGGCTCCTCGCTTTCCTTCAACCTGAGCTATGGCGATTACGACCTACCTCTGGATGAGGATGATGAGGACATGACCAAGACCTGGACCTTCTTCGCAGCCAAGATAGTCATCGGGGTGGCACTGGCAGGCATCATGCTGGTCTGTGGCATTGGCAACTTTATCTTTATTGCTGCCCTTGCCCGCTACAAGAAGCTGCGAAACCTCACCAACCTGCTTATTGCTAACCTGGCCATCTCCGACTTCCTAGTGGCCATTGTCTGCTGCCCCTTTGAGATGGACTACTACGTGGTACGAGAGCTCTCCTGGGAGCATGGCCACATGCTCTGCGCCTCCGTCAACTACCTACGCACTGTCTCCCTCTACGTCTCCACCAATGCCCTGCTGGCCATCGCTATTGACAGGTATCTGGCCATTGTCCACCCCTTGAAGCCAAGGATGAATTACCAAACGGCCTCCTTCCTCATCACTTTGGTCTGGATTGTCTCCATTCTTATTGCCATCCCATCGGCCTACTTCACGACAGAAACCGTCCTCTTTACTGTCAAGAACCAGGAGAAGATTTTCTGCGGCCAGATCTGGCCAGTGGACCAGCAGCTCTACTATAAGTCCTACTTTCTCTTCATCTTTGGCCTGGAGTTTGTGGGCCCCGTGGTCACCATGACCCTGTGCTACGCCAGGATCTCCCGGGAGCTCTGGTTTAAGGCTGTCCCCGGCTTTCAGACCGAGCAGATCCGCAAGCGGCTGCGCTGCCGCCGGAAGACCGTGCTGGTCCTCATGGGCATCCTCACCGCCTATGTGCTGTGCTGGGCGCCCTTCTATGGCTTCACCATCGTGCGCGACTTCTTCCCTTCCGTGTTCGTCAAGGAGAAGCACTACCTCACCGCTTTCTATGTGGTCGAGTGCATTGCCATGAGCAACAGCATGATCAACACCGTGTGCTTCGTGATGGTCAAGAACAACACCATGAAGTACTTCAAGAAGATAATGCTTCTCCACTGGCGTCCCTCCCGCCATGGAAGCAAGTCCAGTGCTGACCTTGACCTCAAAATGAGTGCAGTGCCAGCCACAGAAGAGGTGGACTGTATCCGGCTGAAGTGA

XM_004840783.1 Coding sequence

Prokr2 prokineticin receptor 2, transcript variant X1

Length: 1158 bp    Location: 6280845..6270628   Strand: -
>XM_004840783.1
ATGACAGCCCAGAGCAGAAACACCAGCTTTACACCCATCTTTAATCCATCCCAAGACCATGGCTCCTCGCTTTCCTTCAACCTGAGCTATGGCGATTACGACCTACCTCTGGATGAGGATGATGAGGACATGACCAAGACCTGGACCTTCTTCGCAGCCAAGATAGTCATCGGGGTGGCACTGGCAGGCATCATGCTGGTCTGTGGCATTGGCAACTTTATCTTTATTGCTGCCCTTGCCCGCTACAAGAAGCTGCGAAACCTCACCAACCTGCTTATTGCTAACCTGGCCATCTCCGACTTCCTAGTGGCCATTGTCTGCTGCCCCTTTGAGATGGACTACTACGTGGTACGAGAGCTCTCCTGGGAGCATGGCCACATGCTCTGCGCCTCCGTCAACTACCTACGCACTGTCTCCCTCTACGTCTCCACCAATGCCCTGCTGGCCATCGCTATTGACAGGTATCTGGCCATTGTCCACCCCTTGAAGCCAAGGATGAATTACCAAACGGCCTCCTTCCTCATCACTTTGGTCTGGATTGTCTCCATTCTTATTGCCATCCCATCGGCCTACTTCACGACAGAAACCGTCCTCTTTACTGTCAAGAACCAGGAGAAGATTTTCTGCGGCCAGATCTGGCCAGTGGACCAGCAGCTCTACTATAAGTCCTACTTTCTCTTCATCTTTGGCCTGGAGTTTGTGGGCCCCGTGGTCACCATGACCCTGTGCTACGCCAGGATCTCCCGGGAGCTCTGGTTTAAGGCTGTCCCCGGCTTTCAGACCGAGCAGATCCGCAAGCGGCTGCGCTGCCGCCGGAAGACCGTGCTGGTCCTCATGGGCATCCTCACCGCCTATGTGCTGTGCTGGGCGCCCTTCTATGGCTTCACCATCGTGCGCGACTTCTTCCCTTCCGTGTTCGTCAAGGAGAAGCACTACCTCACCGCTTTCTATGTGGTCGAGTGCATTGCCATGAGCAACAGCATGATCAACACCGTGTGCTTCGTGATGGTCAAGAACAACACCATGAAGTACTTCAAGAAGATAATGCTTCTCCACTGGCGTCCCTCCCGCCATGGAAGCAAGTCCAGTGCTGACCTTGACCTCAAAATGAGTGCAGTGCCAGCCACAGAAGAGGTGGACTGTATCCGGCTGAAGTGA

XM_004840795.1 Coding sequence

Trmt6 tRNA methyltransferase 6 homolog (S. cerevisiae), transcript variant X3

High confidence: 4 potential gene matches
Length: 1563 bp    Location: 6787437..6775944   Strand: -
>XM_004840795.1
ATGGAGGAGGAGGGACAAAGTGCTGGGGGCTGGAGGGACACCAAGGAACCTGAAGACCGGCTGCGTGCCATGGAGAGTTCAGGGGAGCAGCCGAGCGCACAGCCCCCGCTTCCTGGGGACCACTGCATTCGCGACGGCGACTTCGTGGTGCTGAAACGGGAAGATGTGTTCAAAGCAGTGCAGGTCCAGCGGAGAAAAAAAATAACTTTTGAAAAACAGTGGTTCTACCTGGACAACGTCATTGGCCATAGTTATGGAACCACATTTGAAGTGACTGGTGGGGGAAGTCTTCAGCCCAAGAAGAAGAAGGAAGAGTCTACTTCAGAGACTAAAGAAGCTGGCACTGACAATCGAAATATAATTGATGATGGGAAATCTCAGAAACTCACTCAAGATGACATAAAAGCTTTGAAAGACAAGGGCATTAAAGGAGAGGAAATAGTTCAGCAGTTAATTGAAAATAGTACAACATTCCGAGACAAGACAGAATTTGCTCAGGACAAATATATAAAAAAGAAGAAGAAGAAATATGAAGCCATCGTTACTATTTTGAAGCCATCCACTCGTATTCTTTCAATTATGTATTATGCAAGAGAGCCTGGAAAAATTAACCACATGAGATATGATACACTAGCGCAGATGTTGACATTGGGAAATATTCGTGCCGGCAATAAAATGATCGTCATGGAAACATGTTCGGGCTTGGTGCTGGGTGCAATGATGGAACGAATGGGAGGTTTTGGCTCCATTATTCAGCTGTACCCTGGGGATGGACCCATTCGGGTAGCAACAGCATGTTTTGGATTTCCCAAGTCTTTCCTCAGTGGTCTGTATGAATTCCCCCTCAACAAAGTAGACAGTCTCCTGAACGGCACATTTTCTGCTGAGATGTTATCTTCAGAGCCGAAAGACAATACTTCCATTGAAGAAAGTAATGGCATAGTCGAGGACAAGCAGACTCCTGAACAAGACACTGAGGACCCCATGACAGAGGCACCAGACAGCAGTCACCCAGAAGACCAAGAAACAATGGAAGTTGTTGCTCAAGGCCCAGAATATAAGGAGCCAAAGGAGAGAGGAAGCAAAAAAGCTTACATTCAGGAAAAGCAGAGGAGACAAGAAGAACAGAGGAAAAGACATTTAGAGGCTGCTGCTCTGCTGAGTGAAAGAAATGCAGATGGTTTAATCGTGGCAAGTCGTTTCCATCCCACTCCACTGCTGCTGGGTTTACTGGACTTTGTGGCCCCTTCACGGCCATTCGTGGTCTACTGTCAGTACAAAGAGCCTTTGTTGGAATGCTACACAAAACTGCGGGAGAGGGGAGGAGTCATCAACCTCAAGCTGTCTGAAACCTGGCTCCGAAATTACCAGGTTTTACCAGATCGAAGTCACCCCAAACTGCTGATGAGTGGAGGCGGGGGCTACCTTCTGTCAGGGTTCACCGTGGTCTCGGACAACGTTAGAGCAGATGCCACCCTCAGATGCAGCACAGGCACTTTAGAGTCCCTCAAGACAGAGGAGCCAGCAGCCAAAAAACAGAAATGCACAGAGTCTGGGTCTTAA

XM_004840794.1 Coding sequence

Trmt6 tRNA methyltransferase 6 homolog (S. cerevisiae), transcript variant X2

Length: 1662 bp    Location: 6787437..6776127   Strand: -
>XM_004840794.1
ATGGAGGAGGAGGGACAAAGTGCTGGGGGCTGGAGGGACACCAAGGAACCTGAAGACCGGCTGCGTGCCATGGAGAGTTCAGGGGAGCAGCCGAGCGCACAGCCCCCGCTTCCTGGGGACCACTGCATTCGCGACGGCGACTTCGTGGTGCTGAAACGGGAAGATGTGTTCAAAGCAGTGCAGGTCCAGCGGAGAAAAAAAATAACTTTTGAAAAACAGTGGTTCTACCTGGACAACGTCATTGGCCATAGTTATGGAACCACATTTGAAGTGACTGGTGGGGGAAGTCTTCAGCCCAAGAAGAAGAAGGAAGAGTCTACTTCAGAGACTAAAGAAGCTGGCACTGACAATCGAAATATAATTGATGATGGGAAATCTCAGAAACTCACTCAAGATGACATAAAAGCTTTGAAAGACAAGGGCATTAAAGGAGAGGAAATAGTTCAGCAGTTAATTGAAAATAGTACAACATTCCGAGACAAGACAGAATTTGCTCAGGACAAATATATAAAAAAGAAGAAGAAGAAATATGAAGCCATCGTTACTATTTTGAAGCCATCCACTCGTATTCTTTCAATTATGTATTATGCAAGAGAGCCTGGAAAAATTAACCACATGAGATATGATACACTAGCGCAGATGTTGACATTGGGAAATATTCGTGCCGGCAATAAAATGATCGTCATGGAAACATGTTCGGGCTTGGTGCTGGGTGCAATGATGGAACGAATGGGAGGTTTTGGCTCCATTATTCAGCTGTACCCTGGGGATGGACCCATTCGGGTAGCAACAGCATGTTTTGGATTTCCCAAGTCTTTCCTCAGTGGTCTGTATGAATTCCCCCTCAACAAAGTAGACAGTCTCCTGAACGGCACATTTTCTGCTGAGATGTTATCTTCAGAGCCGAAAGACAATACTTCCATTGAAGAAAGTAATGGCATAGTCGAGGACAAGCAGACTCCTGAACAAGACACTGAGGACCCCATGACAGAGGCACCAGACAGCAGTCACCCAGAAGACCAAGAAACAATGGAAGTTGTTGCTCAAGGCCCAGAATATAAGGAGCCAAAGGAGAGAGGAAGCAAAAAAGCTTACGAAAAGCAGAGGAGACAAGAAGAACAGAGGAAAAGACATTTAGAGGCTGCTGCTCTGCTGAGTGAAAGAAATGCAGATGGTTTAATCGTGGCAAGTCGTTTCCATCCCACTCCACTGCTGCTGGGTTTACTGGACTTTGTGGCCCCTTCACGGCCATTCGTGGTCTACTGTCAGTACAAAGAGCCTTTGTTGGAATGCTACACAAAACTGCGGGAGAGGGGAGGAGTCATCAACCTCAAGCTGTCTGAAACCTGGCTCCGAAATTACCAGGTATGTGTCCAGGAGCTGCCCTCTGGAGTTGCTTCCCTGTTTCTAGCCACAGCAATGGAAAAGTTTCCTCCTGTGACTTGGGAGAACATGCCCTTGACTTTTTCTGACTCTCTTTCCGGGTCAGACTGCATTATCAGTAACTCCAGCCCACAGCATTTAAAATGCAAACAGTTGTTCATATTTCCCCAAGGCCTTGGTGCCACTGTGGAGAGGGTAACCAGCAGAAGCTATAACAAGAAAGTGGCCCCCTCTCTCTCTGCTGGGACATCTTCACACCCCATGGCCAGGCAGGGTTGA

XM_004840802.1 Coding sequence

Fermt1 fermitin family member 1, transcript variant X2

Length: 2034 bp    Location: 6914224..6881473   Strand: -
>XM_004840802.1
ATGCTCTCCTCCAGTGACTTCACACCTGCATCCTGGGAGCTCGTGGTCCGAGTTGACCACCCAAACTCAGAGGAGCAGCGGGACATCACGCTAAGGGTGTCTGGGGACCTGCATGTGGGAGGCGTGATGCTCAAGCTGGTGGAGGAGATCAACATTGCCCAAGACTGGTCAGATTTCGCTCTGTGGTGGGAGCAGAAGCATTGCTGGCTTCTGAAAACCCACTGGACCCTGGACAAATGTGGGGTGCAGGCCGATGCCAGGCTTCTCTTCACCCCTCAGCACAAGATGCTGCGCCTCCGCCTGCCCAACCTGAAGACGGTGCGGATGCGCATCAGCTTCTCAGCCGTGGTGTTCAGAGCCATCAGCGACATCTGCAGAGCCCTGAATATTAGAAGATCAGAAGAACTTTCCTTGTTAAAGCCTTCTGGTGACTATATTAAGAAGAAAAAGAAGAAAGACAAAAACAATAAGGAGCCTGTGATTGAAGATATTCTGAACCTGGAGAGTTCTCCAACAAGTTCGGGTTCACCAGGAAGTGCTGGCTTATACAGCAAGACCATGACTCCCACCTATGACCCCATCAACGGGATGCCCGTGTCGTCCACCGTGACGTGGTTTGGTGACAGTCCCTTGGCAGGACAAAGCTGCAGCATCCTCGCCTTCAGCCAGCCCCCCCAGTCCCCAGAAGCACTGGCTGATATGTTCCAGCCCCGGTCCCTGGTGGAAAAAGCCAAGCTTAACACAGGTTGGCTGGACTCCTCGCGCTCCCTCATGGAACAAGGCATCCAGGAGGATGAGCAGCTGCTGTTACGATTTAAATACTACAGTTTCTTTGACTTGAATCCTAAATATGATGCTGTCAGAATAAACCAGCTCTACGAACAAGCCAGGTGGGCTATTCTCTTAGAAGAAATCGACTGCACGGAGGAAGAAATGCTGATCTTTGCGGCACTCCAGTATCACATCAGCAAGCTGTCACTGTCCACTGAATCTCAGGATTTTACAAACGAGTCTGAGGTTGACGAAGTTGAAGCTGCACTTTCTAACTTAGAAGTGACCCTCGAAGGTAGAAAATCAAACAGCACTCTGGAGGACATTACTGATATCCCTAAACTTACAGATAATCTCAAATTATTTAGGCCCAAGAAGCTAGTATTAAAAGGTTTCAAACAATATTGGTTCGTCTTTAAAGACACATCTATAGCCTACTTTAAAAATAAGGATCTTGAACAAGGGGAACCGGTAGAAAAACTAAACCTCAGAGGCTGTGAAGTTGTACCAGATGTGAATGTAGCAGGGAGAAAATTTGGAATCAAGTTACTAATCCCTATTGCTGATGGTATGAACGAAGTGTATTTGAGATGTGACCATGAGAACCAGTATGCCCGGTGGATGGCTGCCTGCATCTTGGCATCAAAGGGCAAAACCATGGCAGACAGCTCCTACCAGCCTGAGGTCCTCAACATCCTTTCATTTCTGAGGATGAAAAACCGGAACTCGTCATCTGAGGTGGCTTCCAGTCTTGAAAGCATGGACATGAACCCAGAGTGTTTCGTGTCTCCTCGGTGTGCAAAAAAGCACAAGTCTAAACAGCTGGCAGCCCGGGTCCTGGAAGCCCACCAGAACGTTGCCCAGATGTCCCTTATCGAAGCCAAGCTGCGGTTCATTCAGGCCTGGCAATCCCTACCAGAGTTTGGCCTCACCTACTACCTTGTCAGGTTTAAAGGAGCCAAGAAAGATGACATTCTGGGAGTTTCATATAATAGGTTGATCAGAATTGATGCAGCCACTGGGATTCCAATTACAACATGGAGATTCACTAATATGAAGCAGTGGAATGTCAACTGGGAAATCCGGCAGGTGGCGATCGAGTTTGACCAAAACGTCTCCATTGCGTTCACCTGCCTGAGCGCGGATTGCAAGGTCGTGCACGAGTACATCGGTGGCTACATTTTCCTGTCCACCCGCTCTAAGGACCAGAATGAAACGCTCGACGAGGACCTCTTTCACAAACTGACTGGTGGTCAGGACTGA

XM_004840793.1 Coding sequence

Trmt6 tRNA methyltransferase 6 homolog (S. cerevisiae), transcript variant X1

Length: 1668 bp    Location: 6787437..6776127   Strand: -
>XM_004840793.1
ATGGAGGAGGAGGGACAAAGTGCTGGGGGCTGGAGGGACACCAAGGAACCTGAAGACCGGCTGCGTGCCATGGAGAGTTCAGGGGAGCAGCCGAGCGCACAGCCCCCGCTTCCTGGGGACCACTGCATTCGCGACGGCGACTTCGTGGTGCTGAAACGGGAAGATGTGTTCAAAGCAGTGCAGGTCCAGCGGAGAAAAAAAATAACTTTTGAAAAACAGTGGTTCTACCTGGACAACGTCATTGGCCATAGTTATGGAACCACATTTGAAGTGACTGGTGGGGGAAGTCTTCAGCCCAAGAAGAAGAAGGAAGAGTCTACTTCAGAGACTAAAGAAGCTGGCACTGACAATCGAAATATAATTGATGATGGGAAATCTCAGAAACTCACTCAAGATGACATAAAAGCTTTGAAAGACAAGGGCATTAAAGGAGAGGAAATAGTTCAGCAGTTAATTGAAAATAGTACAACATTCCGAGACAAGACAGAATTTGCTCAGGACAAATATATAAAAAAGAAGAAGAAGAAATATGAAGCCATCGTTACTATTTTGAAGCCATCCACTCGTATTCTTTCAATTATGTATTATGCAAGAGAGCCTGGAAAAATTAACCACATGAGATATGATACACTAGCGCAGATGTTGACATTGGGAAATATTCGTGCCGGCAATAAAATGATCGTCATGGAAACATGTTCGGGCTTGGTGCTGGGTGCAATGATGGAACGAATGGGAGGTTTTGGCTCCATTATTCAGCTGTACCCTGGGGATGGACCCATTCGGGTAGCAACAGCATGTTTTGGATTTCCCAAGTCTTTCCTCAGTGGTCTGTATGAATTCCCCCTCAACAAAGTAGACAGTCTCCTGAACGGCACATTTTCTGCTGAGATGTTATCTTCAGAGCCGAAAGACAATACTTCCATTGAAGAAAGTAATGGCATAGTCGAGGACAAGCAGACTCCTGAACAAGACACTGAGGACCCCATGACAGAGGCACCAGACAGCAGTCACCCAGAAGACCAAGAAACAATGGAAGTTGTTGCTCAAGGCCCAGAATATAAGGAGCCAAAGGAGAGAGGAAGCAAAAAAGCTTACATTCAGGAAAAGCAGAGGAGACAAGAAGAACAGAGGAAAAGACATTTAGAGGCTGCTGCTCTGCTGAGTGAAAGAAATGCAGATGGTTTAATCGTGGCAAGTCGTTTCCATCCCACTCCACTGCTGCTGGGTTTACTGGACTTTGTGGCCCCTTCACGGCCATTCGTGGTCTACTGTCAGTACAAAGAGCCTTTGTTGGAATGCTACACAAAACTGCGGGAGAGGGGAGGAGTCATCAACCTCAAGCTGTCTGAAACCTGGCTCCGAAATTACCAGGTATGTGTCCAGGAGCTGCCCTCTGGAGTTGCTTCCCTGTTTCTAGCCACAGCAATGGAAAAGTTTCCTCCTGTGACTTGGGAGAACATGCCCTTGACTTTTTCTGACTCTCTTTCCGGGTCAGACTGCATTATCAGTAACTCCAGCCCACAGCATTTAAAATGCAAACAGTTGTTCATATTTCCCCAAGGCCTTGGTGCCACTGTGGAGAGGGTAACCAGCAGAAGCTATAACAAGAAAGTGGCCCCCTCTCTCTCTGCTGGGACATCTTCACACCCCATGGCCAGGCAGGGTTGA

XM_004840801.1 Coding sequence

Fermt1 fermitin family member 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 2199 bp    Location: 6914224..6881473   Strand: -
>XM_004840801.1
ATGCTCTCCTCCAGTGACTTCACACCTGCATCCTGGGAGCTCGTGGTCCGAGTTGACCACCCAAACTCAGAGGAGCAGCGGGACATCACGCTAAGGGTGTCTGGGGACCTGCATGTGGGAGGCGTGATGCTCAAGCTGGTGGAGGAGATCAACATTGCCCAAGACTGGTCAGATTTCGCTCTGTGGTGGGAGCAGAAGCATTGCTGGCTTCTGAAAACCCACTGGACCCTGGACAAATGTGGGGTGCAGGCCGATGCCAGGCTTCTCTTCACCCCTCAGCACAAGATGCTGCGCCTCCGCCTGCCCAACCTGAAGACGGTGCGGATGCGCATCAGCTTCTCAGCCGTGGTGTTCAGAGCCATCAGCGACATCTGCAGAGCCCTGAATATTAGAAGATCAGAAGAACTTTCCTTGTTAAAGCCTTCTGGTGACTATATTAAGAAGAAAAAGAAGAAAGACAAAAACAATAAGGAGCCTGTGATTGAAGATATTCTGAACCTGGAGAGTTCTCCAACAAGTTCGGGTTCACCAGGAAGTGCTGGCTTATACAGCAAGACCATGACTCCCACCTATGACCCCATCAACGGGATGCCCGTGTCGTCCACCGTGACGTGGTTTGGTGACAGTCCCTTGGCAGGACAAAGCTGCAGCATCCTCGCCTTCAGCCAGCCCCCCCAGTCCCCAGAAGCACTGGCTGATATGTTCCAGCCCCGGTCCCTGGTGGAAAAAGCCAAGCTTAACACAGGTTGGCTGGACTCCTCGCGCTCCCTCATGGAACAAGGCATCCAGGAGGATGAGCAGCTGCTGTTACGATTTAAATACTACAGTTTCTTTGACTTGAATCCTAAATATGATGCTGTCAGAATAAACCAGCTCTACGAACAAGCCAGGTGGGCTATTCTCTTAGAAGAAATCGACTGCACGGAGGAAGAAATGCTGATCTTTGCGGCACTCCAGTATCACATCAGCAAGCTGTCACTGTCCACTGAATCTCAGGATTTTACAAACGAGTCTGAGGTTGACGAAGTTGAAGCTGCACTTTCTAACTTAGAAGTGACCCTCGAAGGTAGAAAATCAAACAGCACTCTGGAGGACATTACTGATATCCCTAAACTTACAGATAATCTCAAATTATTTAGGCCCAAGAAGCTAGTATTAAAAGGTTTCAAACAATATTGGTTCGTCTTTAAAGACACATCTATAGCCTACTTTAAAAATAAGGATCTTGAACAAGGGGAACCGGTAGAAAAACTAAACCTCAGAGGCTGTGAAGTTGTACCAGATGTGAATGTAGCAGGGAGAAAATTTGGAATCAAGTTACTAATCCCTATTGCTGATGGTATGAACGAAGTGTATTTGAGATGTGACCATGAGAACCAGTATGCCCGGTGGATGGCTGCCTGCATCTTGGCATCAAAGGGCAAAACCATGGCAGACAGCTCCTACCAGCCTGAGGTCCTCAACATCCTTTCATTTCTGAGGATGAAAAACCGGAACTCGTCATCTGAGGTGGCTTCCAGTCTTGAAAGCATGGACATGAACCCAGAGTGTTTCGTGTCTCCTCGGTGTGCAAAAAAGCACAAGTCTAAACAGCTGGCAGCCCGGGTCCTGGAAGCCCACCAGAACGTTGCCCAGATGTCCCTTATCGAAGCCAAGCTGCGGTTCATTCAGGCCTGGCAATCCCTACCAGAGTTTGGCCTCACCTACTACCTTGTCAGGTTTAAAGGAGCCAAGAAAGATGACATTCTGGGAGTTTCATATAATAGGTTGATCAGAATTGATGCAGCCACTGGGATTCCAATTACAACATGGAGATTCACTAATATGAAGCAGTGGAATGTCAACTGGGAAATCCGGCAGGTGAGGGGAAGTTTCTGGTACTCAGTTTCTTTTGTTTGTGTTTTTGCAGTGCTGGAGATGGAACCCAGGACCTTGCACACCCTAGGCAGGTGCTCTGCCACTGAGCAGCACTACCACCTGTTAATGTGTTCCCCCAGAATTGCAGATTATTTTGACTTTAAGAAGGTGGCGATCGAGTTTGACCAAAACGTCTCCATTGCGTTCACCTGCCTGAGCGCGGATTGCAAGGTCGTGCACGAGTACATCGGTGGCTACATTTTCCTGTCCACCCGCTCTAAGGACCAGAATGAAACGCTCGACGAGGACCTCTTTCACAAACTGACTGGTGGTCAGGACTGA

XM_004840803.1 Coding sequence

Fermt1 fermitin family member 1, transcript variant X3

Length: 1809 bp    Location: 6914224..6887117   Strand: -
>XM_004840803.1
ATGCTCTCCTCCAGTGACTTCACACCTGCATCCTGGGAGCTCGTGGTCCGAGTTGACCACCCAAACTCAGAGGAGCAGCGGGACATCACGCTAAGGGTGTCTGGGGACCTGCATGTGGGAGGCGTGATGCTCAAGCTGGTGGAGGAGATCAACATTGCCCAAGACTGGTCAGATTTCGCTCTGTGGTGGGAGCAGAAGCATTGCTGGCTTCTGAAAACCCACTGGACCCTGGACAAATGTGGGGTGCAGGCCGATGCCAGGCTTCTCTTCACCCCTCAGCACAAGATGCTGCGCCTCCGCCTGCCCAACCTGAAGACGGTGCGGATGCGCATCAGCTTCTCAGCCGTGGTGTTCAGAGCCATCAGCGACATCTGCAGAGCCCTGAATATTAGAAGATCAGAAGAACTTTCCTTGTTAAAGCCTTCTGGTGACTATATTAAGAAGAAAAAGAAGAAAGACAAAAACAATAAGGAGCCTGTGATTGAAGATATTCTGAACCTGGAGAGTTCTCCAACAAGTTCGGGTTCACCAGGAAGTGCTGGCTTATACAGCAAGACCATGACTCCCACCTATGACCCCATCAACGGGATGCCCGTGTCGTCCACCGTGACGTGGTTTGGTGACAGTCCCTTGGCAGGACAAAGCTGCAGCATCCTCGCCTTCAGCCAGCCCCCCCAGTCCCCAGAAGCACTGGCTGATATGTTCCAGCCCCGGTCCCTGGTGGAAAAAGCCAAGCTTAACACAGGTTGGCTGGACTCCTCGCGCTCCCTCATGGAACAAGGCATCCAGGAGGATGAGCAGCTGCTGTTACGATTTAAATACTACAGTTTCTTTGACTTGAATCCTAAATATGATGCTGTCAGAATAAACCAGCTCTACGAACAAGCCAGGTGGGCTATTCTCTTAGAAGAAATCGACTGCACGGAGGAAGAAATGCTGATCTTTGCGGCACTCCAGTATCACATCAGCAAGCTGTCACTGTCCACTGAATCTCAGGATTTTACAAACGAGTCTGAGGTTGACGAAGTTGAAGCTGCACTTTCTAACTTAGAAGTGACCCTCGAAGGTAGAAAATCAAACAGCACTCTGGAGGACATTACTGATATCCCTAAACTTACAGATAATCTCAAATTATTTAGGCCCAAGAAGCTAGTATTAAAAGGTTTCAAACAATATTGGTTCGTCTTTAAAGACACATCTATAGCCTACTTTAAAAATAAGGATCTTGAACAAGGGGAACCGGTAGAAAAACTAAACCTCAGAGGCTGTGAAGTTGTACCAGATGTGAATGTAGCAGGGAGAAAATTTGGAATCAAGTTACTAATCCCTATTGCTGATGGTATGAACGAAGTGTATTTGAGATGTGACCATGAGAACCAGTATGCCCGGTGGATGGCTGCCTGCATCTTGGCATCAAAGGGCAAAACCATGGCAGACAGCTCCTACCAGCCTGAGGTCCTCAACATCCTTTCATTTCTGAGGATGAAAAACCGGAACTCGTCATCTGAGGTGGCTTCCAGTCTTGAAAGCATGGACATGAACCCAGAGTGTTTCGTGTCTCCTCGGTGTGCAAAAAAGCACAAGTCTAAACAGCTGGCAGCCCGGGTCCTGGAAGCCCACCAGAACGTTGCCCAGATGTCCCTTATCGAAGCCAAGCTGCGGTTCATTCAGGCCTGGCAATCCCTACCAGAGTTTGGCCTCACCTACTACCTTGTCAGAGAAGACAGATGGTGCTCAAGCAAAGTTTATTCTTCAGCCTGCAGTACAAAAGCGACTCTGCCGCTTTCTCATTTTACTACTTGGGAATAG

XM_004840805.1 Coding sequence

Bmp2 bone morphogenetic protein 2

High confidence: 4 potential gene matches
Length: 1188 bp    Location: 7706592..7716647   Strand: +
>XM_004840805.1
ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGGGCGGCGCGGCTGGCCTGATTCCCGAACTGGGCCGCAGGAAGTTCGCAGCGGCGTCGGGCCGCCCCTCGTCCCAGCCCTCGGACGACATCCTGAGCGAGTTCGAGTTGAGGCTGCTCAGCATGTTCGGCCTGAAGCAGAGACCCACCCCCAGCAGGGACGCCGTGGTGCCCCCTTACATGCTGGACCTGTACCGCCGGCACTCAGGCCAGCCCGGCGCGCCCGCCCCGGACCAGCGGCTCGAGAGGGCGGCCAGCCGCGCCAACACGGTGCGCAGCTTCCACCACGAAGAATCTTTGGAAGAACTGCCAGAAATCAGTGGGAAAACAACCCGGCGATTCTTCTTTAACTTAAGTTCTATTCCGACCGAAGAGTTTATCACCTCAGCAGAACTTCAGGTCTTCCGGGAACAAATGCAGGAAGCTTTGGGAGACAATACCAGCTTCCATCACCGAATTAATATTTATGAAATTATAAAACCTGCAGCAGCCAACTTGAGATTCCCTGTGACCAGACTTTTGGACACCAGGTTGGTAAATGAGAACACAAGCCGCTGGGAGAGTTTTGATGTCACCCCCGCTGTGATGCGCTGGACCGCGCAGGGACACGACAACCATGGGTTTGTGGTGGAAGTGGTCCATTTAGAGGAGAAGCATGATGTCTCAAAGAGGCACGTGAGGATTAGCAGGTCTTTACACCAGGATGAACACAGCTGGTCACAGATACGGCCCCTGCTAGTAACTTTTGGCCACGATGGGAAAGGGCATCCTCTACACAAAAGAGAAAAGCGTCAGGTGAAACACAAGCAGCGGAAGCGCCTGAAGTCCAGCTGTAAGAGACAGCCTTTGTACGTGGACTTCAGTGATGTGGGGTGGAATGACTGGATTGTGGCCCCTCCGGGGTATCATGCCTTCTACTGCCAGGGGGAATGCCCTTTTCCGCTGGCCGATCACCTCAACTCCACTAATCATGCCATTGTTCAGACCTTGGTCAACTCTGTGAACTCTAAGATCCCTAAGGCATGCTGTGTTCCAACGGACCTCAGTGCTATCTCCATGCTGTACCTTGACGAAAATGAAAAGGTCGTGTTAAAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGTCGTTAG

XM_004840806.1 Coding sequence

LOC101723776 OTU domain-containing protein 5-like

Length: 1677 bp    Location: 8606503..8604079   Strand: -
>XM_004840806.1
ATGACTATTCTCCCCAAGAAGAAGCCGCCACCTCCCGATGCCGACCCCCTCAAAGAGCCACCGCCCCCCGGGCCGCTGCCCCCAGCGCCAAGGCGCGGAGGGGGCGTGGGCGTGGGCGTGGGCGGCGGTGGCACGGGTGTGGGAGGTCACAATCATGATTCAGGCGTCGTAGGGGCCCATCCCCGGGCTTCACCAACCCAGAGCCCGCTACCCGGCCCGCCAGGCGGTCTTCACCGCTGGACGCTGGCCGTCCCGCCTGGCGCAGTGGCGGGCCCTGGGCCACAGCCGGCCTCTCCACCTCCTTGCGGGGCCCCTGGTGGTCCCGGCGGTGGTCTGGGTGACGCGCTGGGTGGAGCAGCGGCAGGGGTGCTAGTGGGTGGTGCCGTGGGAGTGGGCGGCTGCAGCTCTGGTCCTGGACATAGCAAGCGGCCGCGCCAAGCTCCTGGGGTTGGTGCAGTTGGCGAGGCCAGCCTGGAAGGTGAGGAGGTCGGTGCAGGCTACAACAGTGAAGATGAATATGAAGCAGCTGCTGCACGCATTGAGGCCATGGACCCTGTGACCGTCAAGCAGCAGGAACATTGGTTTGAAAAGGCCCTAAGGGACAAGAAAGCCTTCACCATCAAGCAGATGAAGGAGGACGGCGCCTGTCTATTCCGGGCTGTAGCTGACCAGGTATATGGAGACCAGGATATGCACGAAGTTGTGCGAAAGCACTGTATGGACTATCTGATGAAGAATGCTGACTACTACTCCAACTACGTCACAGAGGACTTCACCACCTACATCAACCGTAAGAGGAAAAACAACTGCCACGGAAACCACATTGAGATGCAGGCCATGGCGGAGATGTACAACCGTCCCTTGGAGGTGTACCAGTACAGCACAGAACCTATCAACACATTCCATGGGATCCATCAAAATGCGGATGAACCCATCCGTGTCAGCTATCATCGGAATATCCACTACAATTCAGTGGTGAATCCTAACAAGGCCACCATTGGTGTGGGGCTGGGCCTGCCATCATTCAAACCGGGGTTTGCAGAGCAGTCCCTGATGAAGAATGCCATACAAACTTCAGAGGAATCATGGATCGAACAGCAAATGTTAGAAGACAAGAAATGGGCCACAGACTGGGAGGCCACGAATGAGGCCATAGAGGAGCAGGTGGCTCACGAGTCCTACCTGCAGTGGCTAAGGGATCAGGAGAAACAAGCCCGCCAGGTCCGTGGCCCCAGCCAGACCCAGAAAACCAGCGCCACATGCAGTTCGGCCGCAGCAGCAGCCTCTAGTGGTCTGGAGGAGTGGACTAGCTGGTCTCCACGGCAGCAGAGTTCATCTTCTTCACCCGAGCACCCTGAGCTGCATGCTGAGCTGGGCATCAAGCCCCCTTCCCCAGGCACTGTCTTAGATCCTGCCAAACCTCCTTCACCCTGTGCGCCAGGTACAAGCAGTCAATTCTCGGCAGGGGCCAACCGGGCCACCTCCCCCCTTGTGTCCCTCTACCCTGCTCTGGAGTGCCGAGCCCTCATTCAGCAGATGTCTCCCTCTGCCTTCGGTCTGAATGACTGGGATGATGATGAGATCCTAGCGTCCGTGCTGGCAGTGTCCCAACAGGAATACCTAGACAGTATGAAGAAAAACAAAGTGCACAGAGGCCCTCCCCCAGACAAGAGTTGA

XM_004840807.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1113 bp    Location: 8824510..8762034   Strand: -
>XM_004840807.1
ATGCTCCCCCGGCTAGTTTGTATCAATGACTATGAACAACATGCTAAATCAGTCCTTCAAAAGTCTGTCTATGACTATTACAGGTCTGGGGCAAATGATCAGGAAACCTTGGCTGATAATATTGCAGCATTTTCCAGGTGGAAGCTGTTTCCCCGGATACTCCAGAATGTTGCTGAGGTTGACCTATCCACTTCTGTTTTAGGACAGAGGGTCAGCATGCCAATCTGTGCTGGGGCGACTGCCATGCAGTGCATGGCTCACGTGGATGGGGAACGAGCCACCGTACGAGCTTGTCAGACTCTGGGAACAGGCATGATGCTGAGCTCCTGGGCCACCTCCTCAATTGAAGAGGTCGCAGAGGCTTGTCCTGACGCCCTTCTCTGGATGCAGCTATACATCTACAAGGACCGTGAGGTCACCAAGCAGCTAGTGAAGCGAGCTGAGAAGATGGGCTACAAAGCAATATTTGTGACCATAGACACCCCTTACCTGGGCAACCGCTTTGATGATGTGCGTAACAGGTTCAAGCTGCCACCACAGCTCAGGATGAAAAATTTCGAAAGCAATGATTTAGCATTTTCTGCTAAGGAAAATTTTGGTGACAACAATGGACTTGCCGAATATGTGGCAAAGGCAATAGACCCATCTATTAGCTGGGAAGACATTACATGGCTGAGGGGACTGACATCACTGCCCATTGTGGCAAAGGGCATTTTGAGAGGTGATGATGCCAGGGAAGCAGTTAAACGTGGTATGGATGGGATCTTGGTGTCCAATCATGGGGCTCGACAACTCGATGGGGTGCCAGCCACAATTGATGCTTTGCCAGAAATTGTGGAAGCTGTGGAAGGGAAGNTGGAGGTCTTCCTGGATGGGGGTGTGAGGAAAGGCACGGATGTACTAAAAGCTCTGGCCCTGGGTGCCAAAGCTGTTTTTTTGGGGAGACCCATCATCTGGGGCTTGGCTTTCCAGGGAGAGAAAGGTGTCCAAAATGTCCTGGAAATACTAAAGGAAGAATTCCATTTGGCCATGGCACTGAGTGGGTGCCAGAATGTGAAAGTCATTGACAAGACATTGGTGAGGAAAAATCCTTTGGCTGTTTCCAAGATCTGA

XM_004840811.1 Coding sequence

Plcb1 phospholipase C, beta 1 (phosphoinositide-specific), transcript variant X3

Length: 3537 bp    Location: 9031132..9856389   Strand: +
>XM_004840811.1
ATGGCTGGGGCTCAACCCGGAGTGCATGCCTTGCAACTCAAGCCCGTGTGCGTGTCCGACAGCCTCAAGAAGGGCACCAAATTCGTCAAGTGGGATGATGACTCCACTATTGTTACTCCAATTATTTTGAGGACTGACCCTCAGGGATTTTTCTTTTACTGGACTGATCAAAATAAGGAGACGGAGCTGTTAGATCTCAGCCTTGTCAAGGATGCCAGGTGTGGGAAACATGCCAAGGCTCCTAAGGACCCCAAATTACGTGAACTTCTGGATGTAGGGAACATCGGGCACCTGGAGCATCGCATGATAACGGTGGTTTATGGGCCTGATCTAGTTAACATCTCCCATTTGAATCTCGTGGCTTTCCAAGAAGAAGTGGCCAAGGAATGGACAAATGAGGTTTTCAGTTTGGCAACAAACCTGTTGGCCCAAAACATGTCCAGGGACACATTTTTGGAAAAAGCCTACACTAAACTTAAGCTGCAAGTCACTCCAGAAGGACGCATTCCTCTTAAAAACATCTATCGATTGTTTTCAGCAGACCGAAAGCGAGTTGAAACTGCATTAGAGGCTTGTAGTCTTCCATCTTCAAGGAATGATTCAATACCTCAAGAAGATTTCACTCCAGATGTGTACAGAGTTTTCCTGAACAATCTTTGCCCTCGACCTGAGATTGATAACATCTTTTCTGAATTTGGTGCCAAAAGCAAACCATATCTTACTGTTGATCAGATGATGGATTTTATCAACCTTAAGCAGCGGGACCCCCGGCTAAATGAAATCCTTTATCCACCTCTGAAACATGAGCAAGTCCAAGTATTGATTGAAAAGTATGAACCCAACAATAGCCTTGCCAAAAAAGGACAGATATCGGTGGATGGATTTATGCGCTATCTGAGTGGAGAAGAAAATGGAGTTGTTTCACCTGAGAAACTGGATTTGAATGAAGATATGTCTCAGCCCTTGTCTCACTATTTCATTAACTCCTCACACAACACCTACCTCACAGCTGGCCAGCTGGCTGGAAATTCCTCTGTTGAGATGTATCGCCAAGTGCTTCTGTCTGGGTGTCGTTGTGTGGAGCTGGACTGCTGGAAAGGAAGAACTGCAGAAGAAGAGCCTGTCATCACCCACGGCTTCACCATGACAACTGAAATTTCCTTCAAGGAGGTGATAGAAGCAATCGCAGAGTGTGCATTTAAGACTTCACCTTTTCCAATTCTCCTCTCATTTGAAAACCACGTGGATTCCCCAAAGCAGCAAGCCAAGATGGCAGAGTATTGCCGGTTGATCTTTGGTGATGCCCTTCTCATGGAGCCACTGGAAAAATACCCACTGGAATCTGGAGTCCCTCTTCCAAGCCCTATGGATTTAATGTATAAAATTTTGGTGAAAAACAAGAAGAAATCACACAAGTCATCAGAAGGAAGTGGCAAAAAGAAGCTCTCTGAACAAGCTTCCAACACATACAGCGACTCCTCCAGCATGTTCGAGCCCTCATCCCCAGGAGCCGGTGAGGGGCTGGGAGGCGAAGCTGATACGGAGAGTGACGATGATGAAGATGATGACGACTGTAAAAAGTCTTCCATGGATGAGGGAACTGCTGGGAGTGAGGCTATGGCCACAGAAGAGATGTCTAATCTGGTGAATTATATTCAGCCGGTCAAGTTTGAATCATTTGAAATTTCAAAAAAAAGAAATAAAAGTTTTGAAATGTCTTCCTTTGTGGAAACCAAAGGACTTGAACAACTTACCAAGTCTCCTGTGGAATTTGTAGAATATAACAAAATGCAGCTTAGCAGAATATATCCGAAAGGAACACGTGTGGATTCATCCAACTACATGCCCCAGCTCTTTTGGAACGCCGGCTGTCAGATGGTGGCGCTGAATTTCCAGACAATGGACTTGGCTATGCAAATAAACATGGGGATGTACGAATACAACGGTAAGAGCGGCTACAGATTAAAGCCAGAGTTCATGAGGCGGCCCGACAAGCATTTTGATCCATTTACTGAAGGAATCGTAGATGGGATAGTGGCTAACACATTATCTGTCAAGATTATTTCAGGTCAGTTTCTTTCTGATAAGAAAGTTGGGACCTATGTGGAAGTGGATATGTTTGGTTTGCCTGTGGACACAAGGAGGAAGGCATTTAAGACCAAGACATCCCAAGGAAATGCTGTAAATCCTGTCTGGGAAGAAGAGCCTATTGTATTCAAAAAGGTGGTTCTTCCTTCTCTGGCCTGTTTGAGGATAGCAGTTTATGAAGAGGGAGGTAAATTCATTGGGCATCGGATCTTGCCAGTACAAGCCATTCGGCCAGGGTACCACTACATCTGTCTGAGGAATGAAAGGAACCAGCCTCTGACGCTGCCAGCTGTCTTTGTCTACATAGAAGTGAAAGACTATGTGCCAGATACATATGCAGACGTGATTGAAGCTTTGTCAAACCCAATTCGGTATGTGAATCTGATGGAGCAGAGAGCTAAGCAACTGGCTGCTTTGACACTGGAAGATGAAGAAGAAATAAAGAAAGAGGCTGATCCTGGGGAAACACCATCAGAGGCTCCTAGTGAAGCCAGGACAACTCCAGCAGAAAACGGGGTGAATCACACTACATCCCTGGCACCCAAGCAGCCCTCCCAGGCTTTGCACAGTCAACCAGCTCCAGGTTCTGTAAAGGCTCCTGCCAAAACAGAAGATCTTATTCAGACCGTCTTAACAGAAGTGGAGGCGCAGACTATAGAAGAGCTGAAGCAACAGAAATCATTTGTGAAACTTCAAAAGAAGCATTACAAAGAAATGAAAGACCTGGTTAAGAGACACCACAAGAAAACCACTGACCTGATCAAAGAACACACAACGAAATACAATGAAATTCAGAATGATTACTTGAGAAGGAGGGCAGCCTTGGAAAAGACTGCCAAAAAAGACAGCAAGAAAAAATCGGAACCCAGCAGCCCTGACCATGGCTCATCAACCATCGAGCAAGACCTTGCTGCCCTGGATGCCGAAATGACCCAAAAGTTAATAGACTTGAAGGACAAACAACAGCAGCAGCTACTAAATCTTCGGCAAGAGCAGTATTATAGTGAAAAATACCAGAAGCGAGAACATATTAAACTGCTTATTCAGAAGTTGATGGATGTCGCTGAAGAGTGTCAGAACAGTCAATTAAAGAAGCTCAAAGAAATCTGTGAGAAAGAGAAGAAAGAATTAAAGAAGAAAATGGATAAAAAGAGGCAGGAGAAGATAACAGAAGCTAAATCCAAAGACAAAAGCCAGATGGAAGAGGAGAAGACAGAGATGATTCGGTCATACATCCAGGAAGTGGTGCAGTACATCAAGAGGTTAGAAGAGGCACAAAGTAAAAGGCAAGAAAAACTTGTGGAGAAACACAAGGAGATTCGCCAGCAGATCCTGGATGAAAAGCCCAAGGGGGAAGGTTCCTCCTCATTCTTGTTGGAAACTTGCCATGAGGATCCCTCTGTTTCCCCCAACTTTACTCCCCCCAACCCTCAAGCTCTCAAGTGGTGA

XM_004840812.1 Coding sequence

Plcb1 phospholipase C, beta 1 (phosphoinositide-specific), transcript variant X4

High confidence: 4 potential gene matches
Length: 3522 bp    Location: 9031132..9856389   Strand: +
>XM_004840812.1
ATGGCTGGGGCTCAACCCGGAGTGCATGCCTTGCAACTCAAGCCCGTGTGCGTGTCCGACAGCCTCAAGAAGGGCACCAAATTCGTCAAGTGGGATGATGACTCCACTATTGTTACTCCAATTATTTTGAGGACTGACCCTCAGGGATTTTTCTTTTACTGGACTGATCAAAATAAGGAGACGGAGCTGTTAGATCTCAGCCTTGTCAAGGATGCCAGGTGTGGGAAACATGCCAAGGCTCCTAAGGACCCCAAATTACGTGAACTTCTGGATGTAGGGAACATCGGGCACCTGGAGCATCGCATGATAACGGTGGTTTATGGGCCTGATCTAGTTAACATCTCCCATTTGAATCTCGTGGCTTTCCAAGAAGAAGTGGCCAAGGAATGGACAAATGAGGTTTTCAGTTTGGCAACAAACCTGTTGGCCCAAAACATGTCCAGGGACACATTTTTGGAAAAAGCCTACACTAAACTTAAGCTGCAAGTCACTCCAGAAGGACGCATTCCTCTTAAAAACATCTATCGATTGTTTTCAGCAGACCGAAAGCGAGTTGAAACTGCATTAGAGGCTTGTAGTCTTCCATCTTCAAGGAATGATTCAATACCTCAAGAAGATTTCACTCCAGATGTGTACAGAGTTTTCCTGAACAATCTTTGCCCTCGACCTGAGATTGATAACATCTTTTCTGAATTTGGTGCCAAAAGCAAACCATATCTTACTGTTGATCAGATGATGGATTTTATCAACCTTAAGCAGCGGGACCCCCGGCTAAATGAAATCCTTTATCCACCTCTGAAACATGAGCAAGTCCAAGTATTGATTGAAAAGTATGAACCCAACAATAGCCTTGCCAAAAAAGGACAGATATCGGTGGATGGATTTATGCGCTATCTGAGTGGAGAAGAAAATGGAGTTGTTTCACCTGAGAAACTGGATTTGAATGAAGATATGTCTCAGCCCTTGTCTCACTATTTCATTAACTCCTCACACAACACCTACCTCACAGCTGGCCAGCTGGCTGGAAATTCCTCTGTTGAGATGTATCGCCAAGTGCTTCTGTCTGGGTGTCGTTGTGTGGAGCTGGACTGCTGGAAAGGAAGAACTGCAGAAGAAGAGCCTGTCATCACCCACGGCTTCACCATGACAACTGAAATTTCCTTCAAGGAGGTGATAGAAGCAATCGCAGAGTGTGCATTTAAGACTTCACCTTTTCCAATTCTCCTCTCATTTGAAAACCACGTGGATTCCCCAAAGCAGCAAGCCAAGATGGCAGAGTATTGCCGGTTGATCTTTGGTGATGCCCTTCTCATGGAGCCACTGGAAAAATACCCACTGGAATCTGGAGTCCCTCTTCCAAGCCCTATGGATTTAATGTATAAAATTTTGGTGAAAAACAAGAAGAAATCACACAAGTCATCAGAAGGAAGTGGCAAAAAGAAGCTCTCTGAACAAGCTTCCAACACATACAGCGACTCCTCCAGCATGTTCGAGCCCTCATCCCCAGGAGCCGGCGAAGCTGATACGGAGAGTGACGATGATGAAGATGATGACGACTGTAAAAAGTCTTCCATGGATGAGGGAACTGCTGGGAGTGAGGCTATGGCCACAGAAGAGATGTCTAATCTGGTGAATTATATTCAGCCGGTCAAGTTTGAATCATTTGAAATTTCAAAAAAAAGAAATAAAAGTTTTGAAATGTCTTCCTTTGTGGAAACCAAAGGACTTGAACAACTTACCAAGTCTCCTGTGGAATTTGTAGAATATAACAAAATGCAGCTTAGCAGAATATATCCGAAAGGAACACGTGTGGATTCATCCAACTACATGCCCCAGCTCTTTTGGAACGCCGGCTGTCAGATGGTGGCGCTGAATTTCCAGACAATGGACTTGGCTATGCAAATAAACATGGGGATGTACGAATACAACGGTAAGAGCGGCTACAGATTAAAGCCAGAGTTCATGAGGCGGCCCGACAAGCATTTTGATCCATTTACTGAAGGAATCGTAGATGGGATAGTGGCTAACACATTATCTGTCAAGATTATTTCAGGTCAGTTTCTTTCTGATAAGAAAGTTGGGACCTATGTGGAAGTGGATATGTTTGGTTTGCCTGTGGACACAAGGAGGAAGGCATTTAAGACCAAGACATCCCAAGGAAATGCTGTAAATCCTGTCTGGGAAGAAGAGCCTATTGTATTCAAAAAGGTGGTTCTTCCTTCTCTGGCCTGTTTGAGGATAGCAGTTTATGAAGAGGGAGGTAAATTCATTGGGCATCGGATCTTGCCAGTACAAGCCATTCGGCCAGGGTACCACTACATCTGTCTGAGGAATGAAAGGAACCAGCCTCTGACGCTGCCAGCTGTCTTTGTCTACATAGAAGTGAAAGACTATGTGCCAGATACATATGCAGACGTGATTGAAGCTTTGTCAAACCCAATTCGGTATGTGAATCTGATGGAGCAGAGAGCTAAGCAACTGGCTGCTTTGACACTGGAAGATGAAGAAGAAATAAAGAAAGAGGCTGATCCTGGGGAAACACCATCAGAGGCTCCTAGTGAAGCCAGGACAACTCCAGCAGAAAACGGGGTGAATCACACTACATCCCTGGCACCCAAGCAGCCCTCCCAGGCTTTGCACAGTCAACCAGCTCCAGGTTCTGTAAAGGCTCCTGCCAAAACAGAAGATCTTATTCAGACCGTCTTAACAGAAGTGGAGGCGCAGACTATAGAAGAGCTGAAGCAACAGAAATCATTTGTGAAACTTCAAAAGAAGCATTACAAAGAAATGAAAGACCTGGTTAAGAGACACCACAAGAAAACCACTGACCTGATCAAAGAACACACAACGAAATACAATGAAATTCAGAATGATTACTTGAGAAGGAGGGCAGCCTTGGAAAAGACTGCCAAAAAAGACAGCAAGAAAAAATCGGAACCCAGCAGCCCTGACCATGGCTCATCAACCATCGAGCAAGACCTTGCTGCCCTGGATGCCGAAATGACCCAAAAGTTAATAGACTTGAAGGACAAACAACAGCAGCAGCTACTAAATCTTCGGCAAGAGCAGTATTATAGTGAAAAATACCAGAAGCGAGAACATATTAAACTGCTTATTCAGAAGTTGATGGATGTCGCTGAAGAGTGTCAGAACAGTCAATTAAAGAAGCTCAAAGAAATCTGTGAGAAAGAGAAGAAAGAATTAAAGAAGAAAATGGATAAAAAGAGGCAGGAGAAGATAACAGAAGCTAAATCCAAAGACAAAAGCCAGATGGAAGAGGAGAAGACAGAGATGATTCGGTCATACATCCAGGAAGTGGTGCAGTACATCAAGAGGTTAGAAGAGGCACAAAGTAAAAGGCAAGAAAAACTTGTGGAGAAACACAAGGAGATTCGCCAGCAGATCCTGGATGAAAAGCCCAAGGGGGAAGGTTCCTCCTCATTCTTGTTGGAAACTTGCCATGAGGATCCCTCTGTTTCCCCCAACTTTACTCCCCCCAACCCTCAAGCTCTCAAGTGGTGA

XM_004840813.1 Coding sequence

Plcb4 phospholipase C, beta 4

High confidence: 4 potential gene matches
Length: 3585 bp    Location: 10047910..10431782   Strand: +
>XM_004840813.1
ATGGCCAAACCTTATGAATTTAACTGGCAGAAGGAAGTTCCTTCCTTTCTGCAAGAAGGAGCAGTTTTTGACAGATACGAAGAGGAATCCTACGTGTTTGAACCCAATTGCCTCTTCAAAGTGGATGAGTTCGGCTTCTTTCTGACCTGGAAAAGTGAAGGCAAGGAAGGACAAGTGTTAGAATGTTCTCTCATCAACAGTATTCGGCTGGGAGCCATTCCTAAGGATCCCAAAATCCTGGCTGCTCTGGAAGCTGTTGGAAGATCTGAAAATGATCTGGAAGGGCGGATAGTCTGTGTCTGCAGTGGTACAGATCTGGTGAACATCAGCTTCACTTACATGGTGGCAGAAAATCCAGAAGTCACTAAGCAATGGGTAGAAGGCCTGAGATCGATCATACACAACTTCAGGGCCAACAACGTCAGTCCAATGACATGCCTCAAGAAACACTGGATGAAATTGGCATTTATGACCAACCCCAGTAGTAAAATTCCAGTTAGGAGTATTACTAGAACGTTTGCATCGGGGAAAACAGAAAAAGTGATCTTTCAAGCGCTCAAGGAGTTAGGTCTTCCAAGTGGAAAGAACGATGAAATTGAGCCTGCTGCATTTACTTACGAAAAGTTCTATGAACTTACACAAAAGATTTGTCCTCGGACAGATATAGAAGATCTTTTTAAAAAAATCAATGGAGACAAAACTGATTATTTAACGGTAGACCAATTAGTGAGCTTTCTAAATGAACATCAACGAGATCCTCGACTGAATGAAATTTTATTCCCATTTTACGATGTTAAAAGGGCAATGCAAATCATTGAGAAGTATGAGCCTGACGAAGATTTGAAGAAAAAAGGCCTCATATCAAGTGATGGGTTTTGCAGATATCTGATGTCAGATGAAAATGCCCCAGTCTTCCTAGATCGCTTAGAACTTTACCAAGAAATGGACCATCCTCTGGCTCACTACTTCATCAGTTCTTCCCATAACACCTATCTCACTGGCCGACAGTTTGGTGGGAAATCTTCGGTAGAGATGTACAGACAAGTTCTCCTGGCTGGTTGCAGGTGTGTTGAACTTGATTGTTGGGATGGAAAAGGTGAAGATCAAGAACCGATAATAACTCATGGAAAAGCAATGTGCACAGATATCCTTTTTAAGGATGTAATTCAAGCCATCAAGGAAACTGCATTTGTCACATCGGAATATCCTGTAATTCTCTCCTTTGAAAATCACTGCAGCAAATATCAACAGTACAAGATGTCCAAATATTGTGAAGATCTATTCGGGGATCTCCTGTTGAAACAAGCACTTGAATCACATCCACTCGAGCCAGGCAGGCCTTTGCCTTCCCCCAATGACCTCAAAAGAAAAATACTCATCAAAAATAAACGTCTGAAACCCGAAGTTGAAAAAAAACAGCTGGAAGCTTTGAAAAGCATGATGGAAGCTGGAGAATCCGCTGCTCCAGCTAACATCTTAGAGGATGATAATGAAGAGGAAATAGAAAGTGCTGACCAGGAGGAGGAAGCTCACCCCGAATTCAAATTTGGAAGTGAACTTTCTGCAGATGACTTGGGTCATAAAGAAGCTGTTGTCAATAGCGTCAAGAAGGGCCTGGTTACTGTGGAAGACGAGCAGGCATGGATGGCGTCCTATAAATACGTAGGTGCTACCACTAATATCCATCCGTATTTATCCACAATGATCAACTACGCACAGCCCGTAAAGTTTCAAGGTTTCCATGTGGCAGAAGAACGGAATATTCATTATAACATGTCATCTTTTAATGAATCAGTCGGTCTTGGCTACTTGAAGACACATGCAATTGAATTTGTAAATTATAACAAACGGCAAATGAGTCGCATTTACCCCAAGGGAGGCCGAGTTGATTCCAGTAATTACATGCCTCAAATTTTCTGGAATGCTGGCTGCCAGATGGTTTCCCTGAACTATCAAACCCCAGATTTAGCGATGCAATTGAATCAGGGAAAATTTGAGTATAATGGATCATGCGGGTATCTTCTCAAACCAGACTTCATGAGGAGGCCAGATAGAACATTTGATCCCTTCTCAGAAACCCCAGTGGACGGGGTCATTGCAGCCACGTGTTCAGTACAGGTCATATCAGGGCAATTCTTATCAGATAAGAAAATTGGCACATATGTAGAAGTAGATATGTATGGATTGCCAACCGACACCATACGCAAGGAATTCCGAACTCGCATGGTCATGAACAATGGATTAAATCCAGTTTACAATGAAGAATCATTTGTATTTCGGAAGGTGATCCTGCCCGACCTTGCTGTCTTAAGAATAGCAGTGTATGATGATAACAACAAGCTGATTGGCCAGAGGATCCTTCCACTGGATGGCCTCCAAGCAGGATACCGACATATTTCCCTTCGAAATGAGGGAAATAAACCTTTGTCACTGCCAACAATTTTCTGCAATATTGTTCTTAAAACATATGTGCCTGATGGATTTGGAGACATTGTGGATGCTTTATCAGATCCAAAGAAATTTCTTTCAATTACTGAAAAGAGAGCAGACCAAATGAGAGCTATGGGCATTGAAACGAGTGACATAGCTGATGTACCCAGTGACACTTCCAAGAATGACAAGAAAGGAAAGGCCAACACAGCCAAAGCAAATGTGACCCCTCAGAGCAGCTCTGAGCTCAGACCAACAACCACAGCCACCATAGGCTCTGGCATGGAAGGCAAAAAAGGTATTGAACTTATCCCTCAAGTGAGGATAGAAGATTTAAAGCAGATGAAGGCTTACTTAAAGCATTTAAAGAAACAACAGAAAGAGCTCAATTCTTTAAAGAAGAAGCATGCAAAGGAGCACAGTACCATGCAGAAGTTACATTGCACACAAGTTGACAAAATCGTGGCACAGTACGACAAGGAGAAGTCGACTCATGAGAAAATCCTAGAGAAGGCTATGAAAAAGAAGGGGGGAAGCAATTGTCTTGAAATGAAAAAAGAAACAGAAATTAAAATTCAGACACTGACATCAGATCACAAATCTAAGGTCAAAGAGATTGTGGCACAGCACACAAAGGAATGGTCAGAAATGATCAACACCCACAGTGCTGAGGAGCAAGAAATCCGAGACCTGCACCTTAACCAGCAGTGTGAGTTGCTGAAGAAGCTACTGATCAATGCTCATGAGCAGCAAACCCAGCAGCTGAAACTGTCCCATGACAGGGAAAGCAAGGAAATGCGAGCCCACCAGGCTAAGATTTCTATGGAAAATAGCAAAGCTATCAGCCAAGATAAGTCTATCAAGAATAAAGCAGAACGGGAAAGGCGAGTCAGGGAGTTAAACAGCAGTAACACCAAAAAGTTTCTAGAAGAAAGAAAGAGACTCGCAGTGAAGCAGTCCAAAGAAATGGATCAGTTGAAAAAAGTCCAACTTGAACACCTTGAATTCCTAGAGAAACAGAATGAGCAGCTTTTGAAATCCTGTCATGCAGTGTCCCAAACGCAAGGCGAAGGAGATGCAGCAGATGGTGAAATTGGAAGCCGAGATGGACCGCAGACCAGCAACAGTAGTTTAAAACTCCAAAACGCAAACTGA

XM_004840817.1 Coding sequence

Snap25 synaptosomal-associated protein, 25kDa, transcript variant X1

Length: 621 bp    Location: 11218272..11302980   Strand: +
>XM_004840817.1
ATGGCTGAAGACGCGGACATGCGCAATGAGCTCGAGGAGATGCAGAGGAGGGCTGATCAGCTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTAGAAGAGAGTAAAGATGCTGGTATCAGGACTTTGGTTATGTTGGATGAACAAGGAGAACAACTGGAACGCATTGAGGAAGGGATGGACCAAATCAATAAGGACATGAAAGAAGCAGAAAAGAATTTGACGGACCTAGGAAAATTCTGCGGGCTTTGTGTGTGTCCCTGTAACAAGCTTAAATCAAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTTGTGGCCAGCCAGCCTGCTCGCGTGGTGGATGAACGGGAGCAGATGGCCATCAGTGGTGGCTTCATCCGCAGGGTAACAAATGATGCCCGAGAAAATGAAATGGATGAAAACCTGGAGCAGGTGAGCGGCATCATTGGAAACCTCCGTCACATGGCCCTGGATATGGGCAATGAGATTGATACACAGAATCGCCAGATCGACAGGATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA

XM_004840822.1 Coding sequence

Mkks McKusick-Kaufman syndrome, transcript variant X4

Length: 1569 bp    Location: 11447634..11422786   Strand: -
>XM_004840822.1
ATGTTGTCTCGATTAGAAGCTAAGAAGCCATCACTGTGTTACAGTGAACCACTCACAACTGAGAAAGTCAGGGCCACACTTTCTGTCTTGAAAGGCATCCTAACATCCTGCTATGGCCCTTCCGGGCGGCTGAAACAGCTGCACAACGGCATGGGGGGCGCTGTGTGCACAACCTCCCAGTCTGCAGTGCTGCTCCGCAACCTCTCAGTCACCCATCCCATATTAAAGATCCTGACAACATCCGTGCAGAACCATGTGTCCTGCTTCAGTGACTGTGGGTTATTCACAGCCATTCTTTGCTGCAACCTAATTGAAAATGTTCAGAAAACAGATTTGACAGTCACCACCACCATTAAACTTAATACACACCTTTTGAATTTCTGTACCAATTATCTCAGGTCTGAGGTCTGTGGTTGCCGAATCCCAGTCGATTTTAGTAATACCCCGATCCTCCTTTGTTTGGTGCGCAGTATTTTAACAAGTAAACCTGCCTGTATGCTCACCAGGAAGGAAATAGATCATATCAGTGTTTTGATTCTTAGAGCTTTTTTGCTTACAATTCCAGAAAACACAGAAGATCCCATCATTTTAGGAAAGAGTATAATTGTACCTTTAAAGGGTCAAAGAGTTACAGATTCTACTGTGTTACCCGGAGTACTCATTGAAGTGTCAGAAGTTCAATTAATGAAGATATTACTTGTCCGAAAATCAAGTCCCCTCAAGGTGGTGCTCTTTTCTACATCTTTATCCGGAGACTTTTCTGACCCTGGAGAAGGAAATGTGGTGGTCAGTGATGGGGTGTTTCTTGAAAATGCAGTCCTGGACCAGTTGATTAACCTAGGAAGGCAGTTAGTTAGTGACCGTGTGGAACTTGTCCTATGCCAAAAAGTTATACACCCGTCTTTGAAACAGTTCCTTACTACGCATCAAGTTATTGCCATAGACAGAGTGGGAGTGATGCTGATGGAGCCCCTAAGCAAAGTGACAGGAGCACAGCCTATTGGTTCCCTAGGCTCAATATCTCCTGGTAGTTATGGAAGCGTGAAAGACTGGTGCTCTGCTAAATTTGGCTGCAAACATTTTTTTCATCTTATTCCTAATGAAGCGACTGTCAGCAGCTTGCTTCTCTGCAACAGAAGTGACACTGCCTGGGATGAGCTGAAGCTCACATGTCAAACAGCACTGCATGTCTTGCAATTAATAATCAAGGAGCCATGGGTTTTGTTGGGAGGTGGCTGCACTGAAACTCATTTGGCTGCATATATCAGACACAAGACTTATGAGGAGCCAGGAAGTATTCTCCAAGATGATGGATGTACTCAAGCAGAACTTCAACTAATTGCTGAAGCTTTTTGCAGTGCTCTAGAGTCTCTCGCTGGCTCTTTGGAACATGATGGAGGTGAAATTCTGATTGACATGAAGTATGGACACTTTTGGTCAATTCAGGGGCGAGTTGCCATATTGCTCACAAACCAAGGATTGAGTAAGGCTTCCTACCAACATCCCACAAGGAACTGCAAAAACTGTAAGAGTGAATTTGGAAGCAGATCCTCCCTACTGGGAACTTGA

XM_004840819.1 Coding sequence

Mkks McKusick-Kaufman syndrome, transcript variant X1

Length: 1728 bp    Location: 11447635..11425185   Strand: -
>XM_004840819.1
ATGTTGTCTCGATTAGAAGCTAAGAAGCCATCACTGTGTTACAGTGAACCACTCACAACTGAGAAAGTCAGGGCCACACTTTCTGTCTTGAAAGGCATCCTAACATCCTGCTATGGCCCTTCCGGGCGGCTGAAACAGCTGCACAACGGCATGGGGGGCGCTGTGTGCACAACCTCCCAGTCTGCAGTGCTGCTCCGCAACCTCTCAGTCACCCATCCCATATTAAAGATCCTGACAACATCCGTGCAGAACCATGTGTCCTGCTTCAGTGACTGTGGGTTATTCACAGCCATTCTTTGCTGCAACCTAATTGAAAATGTTCAGAAAACAGATTTGACAGTCACCACCACCATTAAACTTAATACACACCTTTTGAATTTCTGTACCAATTATCTCAGGTCTGAGGTCTGTGGTTGCCGAATCCCAGTCGATTTTAGTAATACCCCGATCCTCCTTTGTTTGGTGCGCAGTATTTTAACAAGTAAACCTGCCTGTATGCTCACCAGGAAGGAAATAGATCATATCAGTGTTTTGATTCTTAGAGCTTTTTTGCTTACAATTCCAGAAAACACAGAAGATCCCATCATTTTAGGAAAGAGTATAATTGTACCTTTAAAGGGTCAAAGAGTTACAGATTCTACTGTGTTACCCGGAGTACTCATTGAAGTGTCAGAAGTTCAATTAATGAAGATATTACTTGTCCGAAAATCAAGTCCCCTCAAGGTGGTGCTCTTTTCTACATCTTTATCCGGAGACTTTTCTGACCCTGGAGAAGGAAATGTGGTGGTCAGTGATGGGGTGTTTCTTGAAAATGCAGTCCTGGACCAGTTGATTAACCTAGGAAGGCAGTTAGTTAGTGACCGTGTGGAACTTGTCCTATGCCAAAAAGTTATACACCCGTCTTTGAAACAGTTCCTTACTACGCATCAAGTTATTGCCATAGACAGAGTGGGAGTGATGCTGATGGAGCCCCTAAGCAAAGTGACAGGAGCACAGCCTATTGGTTCCCTAGGCTCAATATCTCCTGGTAGTTATGGAAGCGTGAAAGACTGGTGCTCTGCTAAATTTGGCTGCAAACATTTTTTTCATCTTATTCCTAATGAAGCGACTGTCAGCAGCTTGCTTCTCTGCAACAGAAGTGACACTGCCTGGGATGAGCTGAAGCTCACATGTCAAACAGCACTGCATGTCTTGCAATTAATAATCAAGGAGCCATGGGTTTTGTTGGGAGGTGGCTGCACTGAAACTCATTTGGCTGCATATATCAGACACAAGACTTATGAGGAGCCAGGAAGTATTCTCCAAGATGATGGATGTACTCAAGCAGAACTTCAACTAATTGCTGAAGCTTTTTGCAGTGCTCTAGAGTCTCTCGCTGGCTCTTTGGAACATGATGGAGGTGAAATTCTGATTGACATGAAGTATGGACACTTTTGGTCAATTCAGGCAGGTCCTTCCTCTGTTGTTAACTGGACAGATTTGCTTTCTAGATGTGGCTGTGGAGTATACAGTAGCCAGGAAGAACTTGGCTGGTCTTTCTTAAGAAGCACGTGTCATCCTTTTGTACCCCAGACCTGCCTTCCACATGAATCTTGGGAAGTCAGCCCACAATCAGCCCACAGCCTGACCCTGGACTGTTTGACTGCTAAGCTCAGTGGCCTACAGGTGGCTGTAGAGACAGCAAATTTGATATTAGATCTTGCCTATGTCATTGAAGATAAAAGCTGA

XM_004840824.1 Coding sequence

Jag1 jagged 1

High confidence: 4 potential gene matches
Length: 3657 bp    Location: 11683107..11647723   Strand: -
>XM_004840824.1
ATGCGGTCCCCACGGGCGCGCGGCCGGCCCGGGCGCCCCCTGAGCCTCCTGCTCGCCCTGCTCTGCGCCCTGCGAGCCAAGGTGTGCGGGGCCTCGGGTCAGTTCGAGTTGGAGATCCTGTCCATGCAGAACGCGAACGGAGAGCTGCAGAACGGGAACTGCTGCGGCGGCGCCCGGAACCCAGGGGACCGCAAGTGCACCCGCGACGAGTGTGACACGTACTTCAAAGTGTGCCTCAAGGAGTATCAATCTCGCGTCACGGCCGGGGGGCCCTGCAGCTTCGGCTCGGGGTCCACGCCTGTCATCGGGGGCAACACCTTCAACCTCAAGGCCAGCCGCAGCAACGACCGCAATCGCATCGTCCTGCCTTTCAGTTTCGCCTGGCCGAGGTCCTACACTTTGCTGGTGGAGGCGTGGGATTCCAGTAATGACACTGTTCAACCTGATAGCATCATTGAAAAGGCATCTCACTCGGGCATGATCAACCCCAGCCGGCAGTGGCAGGCACTGAAGCAGAACACGGGAGTTGCCCACTTTGAGTACCAGATCCGTGTGACCTGTGATGACTACTACTACGGCTTTGGCTGCAATAAGTTTTGCCGGCCCAGAGATGACTTCTTTGGACACTATGCCTGTGACCAGAATGGCAACAAAACGTGCATGGAAGGCTGGATGGGCCCCGAGTGTAACAAAGCTATTTGCCGACAGGGCTGTAGTCCCAAGCATGGATCTTGCAAAGTTCCGGGTAACTGCAGGTGCCAGTATGGCTGGCAAGGCCTGTACTGCGACAAATGCATCCCACACCCGGGATGTGTGCATGGCACCTGCATCGAGCCCTGGCAGTGCCTCTGTGAGACCAACTGGGGTGGCCAGCTGTGTGACAAAGATCTCAATTACTGTGGGACTCATCAGCCGTGTCTCAATGGGGGAACTTGTAGCAACACAGGTCCTGACAAGTATCAGTGTTCCTGCCCTGAGGGGTATTCAGGACCTAACTGTGAAATTGCTGAGCACGCCTGCCTCTCTGATCCCTGCCACAATGGAGGCAGCTGCAAGGAGACCTCCCTGGGGTTCGAGTGTGAGTGTTCTCTGGGCTGGACTGGGCCCACGTGCTCCACAAACATTGATGATTGTTCCCCAAATAACTGTTCCCATGGGGGCACCTGCCAGGACATGGTTAATGGATTTAAATGTGTGTGCCCTCCACAGTGGACCGGCAAGACATGCCAGTTAGATGCAAATGAATGTGAGGCCAAACCTTGTGTAAATGCCAAATCCTGTAAGAATCTGATCGCAAGCTACTACTGTGATTGTCTTCCAGGCTGGATGGGTCAGAATTGTGACATAAATATAAATGACTGCCTTGGCCAGTGTCAGAATGATGCCTCCTGTCAGGACTTGGTTAATGGTTATCGCTGTATCTGTCCACCTGGCTATGCAGGCGATCACTGTGAGAGAGACATCAATGAATGTGCCAGCAACCCGTGTTTGAACGGGGGCCACTGTCAGAATGAAATCAACAGATTCCAGTGTCTGTGTCCCACTGGTTTCTCGGGAAACCTCTGTCAGCTGGACGTAGATTACTGTGAACCCAACCCCTGCCAGAATGGGGCCCTGTGCTACAATCGTGCTAGCGACTATTTCTGCAAGTGCCCCCAGGACTATGAGGGCAAGAACTGCTCGCACCTGAAAGACCACTGCCGCACGACCCCCTGTGAAGTGATTGACAGCTGCACTGTGGCCATGGCTTCCAACGACACGCCTGAAGGGGTGCGGTATATCTCCTCTAACGTCTGTGGTCCCCACGGGAAGTGCAAGAGCCAGTCGGGAGGCAAATTCACCTGTGACTGTAACAAAGGCTTCACGGGAACGTACTGCCATGAAAATATTAATGACTGCGAAAGCAACCCCTGTAGAAATGGTGGCACTTGTATCGACGGTGTCAACTCCTACAAGTGTATCTGTAGCGATGGCTGGGAGGGGGCCTACTGTGAAACCAATATTAATGACTGTAGCCAGAACCCCTGCTACAATGGGGGCACATGTCGAGACCTGGTCAACGATTTTTACTGTGACTGTAAAAATGGTTGGAAAGGAAAGACCTGCCACTCACGTGACAGCCAGTGTGATGAGGCCACATGCAACAATGGTGGCACCTGCTATGACGAAGGAGATGCATTTAAGTGCATGTGTCCTGGTGGCTGGGAAGGAACAACCTGCAATATAGCCAGAAACAGTAGCTGCCTGCCCAGCCCCTGCCATAATGGGGGCACCTGTGTGGTCAACGGCGAGTCCTTCACATGTGTCTGCAAAGAAGGCTGGGAGGGGCTCATCTGTACACAGAATACCAATGACTGCAGCCCTCACCCCTGTTACAACAGTGGCACCTGCGTGGATGGGGACAACTGGTACCGGTGTGAATGTGCGGCAGGTTTTGCTGGGCCCGACTGCAGGATAAACATCAATGAATGCCAATCTTCACCTTGTGCCTTTGGGGCGACCTGTGTGGATGAGATCAATGGCTACCGGTGTGTCTGCCCCCCAGGCCATAGTGGTGCCAAGTGCCAGGAAGTTTCAGGGAAACCTTGCATCACTATGGGCAGTGTGATACCTGATGGGATCAAGTGGGATGATGACTGTAACACCTGCCAGTGCCAGAATGGACGGATTTCCTGCTCCAAGGTTTGGTGTGGCCCTCGACCTTGCCTGCTCCACCGAGGGCACAGCGAGTGCCCTGGTGGGCAGAGCTGCATCCCCATCCTGGATGACCAGTGCTTCGTGCGCCCCTGCACTGGTGTTGGCGAATGTCGCTCTTCTAGTCTGCAGCCAGTGAAGACCAAGTGCACCTCAGACTCCTACTACCAGGATAACTGTGCAAACATTACATTCACCTTTAACAAGGAGATGATGTCACCGGGTCTTACCACAGAGCACATTTGCAGTGAACTGAGGAATCTGAATATTTTGAAGAATGTGTCTGCTGAGTATTCAATCTACATAGCTTGTGAGCCCTCCCCTTCAGCAAACAACGAAATACACGTGGCCATTTCTACTGAAGACATACGGGATGATGGAAACCCTATTAAGGAAATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCACTTATTGCTGCTGTTGCAGAAGTGAGAGTTCAGAGGCGGCCTCTGAAGAACAGGACTGATTTCCTGGTTCCTCTGCTGAGCTCTGTCTTAACGGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGTGTGCGGAAACGGCGGAAGCCAAGCAGCCACACTCTCTCGGCCTCTGAGGACAACACCACCAACAACGTGCGGGAACAGCTGAACCAGATCAAAAACCCCATTGAGAAACATGGAGCCAACACTGTCCCCATCAAGGATTACGAGAACAAAAACTCCAAAATGTCTAAGATAAGGACACACAACTCAGAAGTTGAAGAGGATGACATGGATAAACACCAGCAGAAAGCCCGGTTTGCCAAACAGCCAGTGTACACACTGGTAGACAGAGAGGAGAAGCCCCCCAACAGCACGCCAACTAAGCACCCAAACTGGACAAACAAACAGGACAACAGGGACTTGGAGAGTGCCCAAAGCCTAAATCGGATGGAGTACATCGTATAG

XM_004840826.1 Coding sequence

Btbd3 BTB (POZ) domain containing 3, transcript variant X2

Length: 1386 bp    Location: 12849215..12879831   Strand: +
>XM_004840826.1
ATGGCTGCTGATATATTTCCCCGCAAAAAACCAGCCAACTCCAGCAGCACCACTGTCCAGCAGTACCACCAGCAGAATCTCAGTAACAACAACCTTATCCCAGCCCCCAATTGGCAAGGTCTCTATCCCACCATCAGAGAAAGAAATGCGGTGATGTTCAATAATGATTTGATGGCAGATGTACATTTTGTGGTTGGGCCACCAGGTGGGACTCAGCGGTTGCCAGGACACAAATATGTCTTAGCTGTTGGGAGCTCTGTCTTCCATGCGATGTTTTATGGAGAACTTGCTGAGGACAAAGATGAAATCCGTATACCAGATGTTGAACCTGCTGCTTTTCTCGCTATGCTAAAATATATCTATTGTGATGAAATTGACTTGGCTGCAGACACAGTGCTGGCCACACTGTATGCTGCCAAAAAGTACATTGTCCCTCACCTTGCCCGAGCCTGTGTGAATTTCCTGGAGACCAGCCTGAGTGCCAAGAACGCCTGTGTGCTGCTCTCCCAGAGCTGCCTATTCGAAGAGCCAGACCTGACCCAGCGCTGCTGGGAGGTGATCGATGCCCAGGCTGAGTTAGCTCTCAAGTCTGAGGGGTTCTGTGATATCGACTTCCAGACGCTAGAAAGCATCCTCCGCAGGGAAACTCTGAATGCCAAAGAAATTGTCGTTTTTGAGGCAGCTCTCAACTGGGCTGAAGTAGAATGCCAGCGACAAGATCTAGCCTTGAGCATTGAAAATAAACGCAAAGTCCTAGGAAAGGCACTTTACTTAATCCGCATACCCACAATGGCCCTTGATGACTTTGCAAATGGTGCTGCCCAGTCCGGAGTATTAACTCTCAATGAGACCAATGACATCTTCCTCTGGTACACTGCGGCCAAAAAGCCTGAGTTGCAGTTTGTGAGTAAAGCCCGCAAGGGTCTCGTCCCCCAGCGCTGTCACCGTTTCCAATCTTGTGCCTATCGGAGCAACCAGTGGCGCTATCGGGGCCGCTGTGACAGCATCCAATTTGCAGTTGACAAGAGAGTATTCATTGCAGGCTTTGGGCTGTATGGCTCCAGCTGTGGCTCTGCAGAGTACAGTGCCAAGATCGAACTCAAGCGTCAGGGCGTTGTCTTGGGGCAGAACTTGAGCAAGTATTTCTCAGATGGGTCCAGCAATACCTTCCCTGTGTGGTTTGAGTACCCAGTGCAGATCGAGCCAGACACCTTTTACACAGCCAGTGTGATCCTGGATGGCAATGAACTCAGCTACTTCGGACAAGAAGGCATGACGGAAGTTCAGTGTGGCAAAGTGACTGTCCAGTTTCAGTGCTCCTCAGATAGCACAAATGGCACTGGTGTACAGGGAGGGCAGATCCCTGAACTTATATTCTATGCTTGA

XM_004840827.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1659 bp    Location: 13957180..14149179   Strand: +
>XM_004840827.1
ATGTCTAATCCTAGAGCTAACGTCGTGAGCAATGGGACTCTCCCCAACCGCAAGAAACAGAGCAACACTTCTCAAGATGAAAAGCATACGAGTAATGGGGTAGTGAAAGAAAGACAGCAAAATGGAAACTCACATTGTTATGCAAAGACTATTGTTGAATCCTTCGAGGAACCGCCTCTTCCTACTTTGGTTACCACATACATGGGATATGGAATTGCAACCCTGTTTGGCTATTTCAGAGACTTTTTGAGAAACTCAGGACTAGAAAAATGCAATGCAGCTGTAGAGCGAGAAGAACAAAAACATTTTGTACCACTGTACCAAGACTTTGAGAATTTTTATAAGCGGAACCTTTACATGAGAATCAGAGACAACTGGAGCCGATCCATCTGCAGTGCCCCAGGGCCTCTTTTCGATGTGATGGAAAGGGTGTCAGATGACTATAACTGGACGTTCAGGTTTACTGGAAATATCATCAAAGATGTCATCAACATAGGCTCCTATAACTTCCTTGGACTTGCAGACAAGTATGATGAGTCTATGAGGACAGTAAAAGAGGTTTTAGAAACATATGGCACAGGTGTAGCCAGCACCAGACAAGAAATGGGTACCCTGGATAAGCATAAAGAGTTGGAGGATCTCTTGGCCAAGTTTCTGAATGTAGAAGCAGCAATGACCTTTGGGATGGGATTCGCAACAAACTCAACAAACATCCCTGTACTAGTTGGGAAGGGATGCCTCATTTTCAGTGATGAGCTGAACCACACCTCTATTGTCCTTGGGGCCCGACTCTCAGGCGCAACCATAAGGACCTTCAAACACAACAATATGCAATGCCTAGAGAACCTCCTGAGAGATGCTATCATCTATGGCCAACCTCGAACACACAGAGCTTGGAAAAAGATTCTCATCCTGGTGGAGGGCATCTACAGCATGGAAGGTTCCATTGTGAATCTACCTGAGATTGTGGCTCTAAAGAAGAAATACAAGGCCTACCTCTACATAGATGAAGCACACAGTATTGGGTCTGTGGGCCCAACTGGCCGGGGTGTCAGAGAATACTTTGGTCTAAACCCTGAAGACATCGATGTGTACATGGGCACATTCACCAAAAGTTTTGGAGCCTCGGGAGGTTACATAGCTGGAAAAAAGGATCTTGTGGATTATTTACGGTTTAACTCACATAGTGCTGCTTATGCTGTATCCATGAGCCCCCCAGTAGCAGAGCAAATCATCAGATCACTGAAATTACTCATGGGACTGGATGGGACTACACAAGGGTTGCAGAGACTACAACAGCTTGTAGCAAACACAAAATACTTCAGACAGACACTGAAGAAAATGGGATTCATTATCTATGGCAACGATGACTCTCCTGTTGTTCCCATGCTCCTTTACCAGCCTTGTAAAGTAGCGGCTTTTGCAAGGCATATGTTAGAGAGAAAAATTGGGGTGGTGGTCGTTGGATTTCCAGCCACTCCACTTGCAGAAGCTCGGGCTCGGTTCTGTTTATCAGCAGTACATACTCGGCAGATGTTAGACACAGTTTTGGAAGCCATTAATGAATTGGGTGATCTCCTGGCTTTGAAATATTCCCGGCAAAGGAAGTCATAATGCCCTGTACTCNNTGATGGAACCAGCTTTGAACTTGACGAATAA

XM_004840828.1 Coding sequence

LOC101702832 uncharacterized LOC101702832

Length: 600 bp    Location: 14185152..14186463   Strand: +
>XM_004840828.1
ATGGCCAGTAAGAAAGTTCTATTTCTTTCATTTCATTCTGAGGATTCACGCTGCTGGCACTGGGGTCCGGAAAGCGAGGTGGGCTTGGAAATTTGTGAAATGCACTGGAGCGAACGCCTAGACTGCAGCTGGGCTCCAGGGGAGGGAAGGGCTGGGCTGGCGCGGGGAGGAGGAAGGAGGAAACCCAGTAGGAGGCGGAGAGAACGCACTATAAAAGGCTCCTGCCTTGCACAGAGCCCGCCACTCCGAGCCACTTTGGGAAGGCCGGAGCCAGAGAAAGACCAAGAGCGAAGGAACGCGCGGTGCCACCGCGGTGACCTGCGCCCACAGCCGGACCTAGTGCGCTCTAGCATCCCAAGAGAAGATCCCACGTCCTCCTCTCCATTCCGATCCCTTCCTTCGCCAGCTCCCCCATGCAAAGCATGCGCCGCGCGCGGGAGCCCGAGGCTGCAGGGAGGTCATGAGGCGGAGGCCGGGGAGCAGCGGCTGCGTTACGGCAGCCTCCAAGTCCCCTCCAGGCGCTGCGCCCCCGGGATGAGTCCCCCAGACTCGACACAGCCAGAGCTGAGAGTCAGCGCTAGTGCCCTACCGACGTCCTGA

XM_004840831.1 Coding sequence

Tasp1 taspase, threonine aspartase, 1

High confidence: 4 potential gene matches
Length: 1263 bp    Location: 14633441..14352426   Strand: -
>XM_004840831.1
ATGACCATGGAGAAGGGGATGAGTTCTGGGCAAGGGCTGCCTTCCAGATCACCTCAGGCTTCAGCTGTTAAGCTAACAGCCAAAGAATTGGAAGCAAAGCAGTCCCATAAAGAGAAACGAGGGGGCTTTGTGCTGGTACATGCAGGTGCAGGTTATCATTCTGAGTCCAAAGCTAAGGAATATAAACATGTATGCAAACGAGCTTGTCAGAAGGCAATTGAGAAGTTACAGGCTGGTGCTCTGGCGACAGATGCAGTAACTGCGGCTCTCGTGGAACTTGAGGATTCTCCTTTTACAAATGCAGGAATGGGATCTAACCTAAATCTCTTAGGGGAAATTGAGTGTGATGCCAGCATAATGGATGGAAAATCCTTAAATTTTGGAGCAGTTGGAGCACTCAGTGGAATCAAAAACCCGGTCTCAGTTGCAAACAGACTCTTGTGTGAAGGACAGAAGGGCAAACTCTCAGCCGGCAGAATTCCTCCCTGTTTTTTAGTTGGAGAAGGAGCCTACAGATGGGCACTAGATCATGGAATTCCCTCTTGCCCTCCTAACATCATGACTACAAGATTCAGTTTAGCTGCATTTAAAAGAAACAAGAGGAAACTAGAGCTGGCGGAAAGGGTGGAAACAGATTTTATTCAACTGAAGAAAAGAAGACAATCAAGTGAAAAGGAAAATGACTCAGGCACTTTGGACACGGTGGGTGCTGTGGTTGTGGACCATGAAGGGAACGTTGCTGCTGCTGTTTCCAGTGGAGGCCTGGCTTTGAAACATCCAGGGAGGGTTGGGCAGGCTGCTCTTTATGGATGTGGCTGCTGGGCTGAAAATACTGGAGCTCATAATCCCTACTCCACAGCTGTGAGTACCTCAGGATGTGGAGAACATCTTGTGCGCACTATACTGGCTAGAGAATGTTCACATGCTTTACAAGCTGAAGATGCTCACCAAGCTCTGTTGGAGACTATGCAAAACAAGTTTATCAGTTCACCTTTCCTTGCCAGTGAAGATGGTGTGCTTGGTGGAGTGATTGTTCTTCGATCGTGCAGGTGTTCTGCAGAGCCCGACTCCTCCCAGAATAAGCAGACACTTCTAGTGGAATTTCTGTGGAGCCACACAACGGAGAGCATGTGTGTTGGATATATGTCAGCCCAGGATGGGAAAGCCAAGACTCACATTTCAAGACTCCCTCCTGGTGCGGTGGCAGGACAGTCGGTTGCAATCGAAGGTGGGGTTTGCCGCTTGGAGAGCCCAGTGAACTGA

XM_004840833.1 Coding sequence

Esf1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae), transcript variant X2

High confidence: 1 potential gene match
Length: 2469 bp    Location: 14778086..14708812   Strand: -
>XM_004840833.1
ATGTCATCCAAACAAGAAATAATGAATGACCAGCGGTTTAGGAAGGTTTCAAAGGACCCCAGATTCTGGGAAATGCCAGAAAAGGATCGAAAAGTCAAAATTGACAAGAGATTTCGAGCCATGTTTCATGACAAAAAGTTCAAATTGAACTATGCAGTTGATAAAAGAGGACGCCCTATCAACCACAGCACTACTGAGGACTTGAAACGTTTCTATGAGCTTTCAGATTCTGATTCTGATCTCTCTGATGAAGATAGCAAACCACTGAATCAACAGAAAATAAAAAAGAAAAACCGCCAGACAAAAAAAGAAATAGATTCAAAAAATATAATTGAGGAAAAGAAAGAAACCAAGAAAATTAATCAGAAGTATCCCGGAAATGATTTAGATGATTCCGAAAGAATTCAGGAAATGAAAAGTTCTAAGAAGATAGATTCAGAAATAAGTCCAAAGAAGGACAGCAAAGAACTTACACAAGAAGGTACAAAAGGAAAAAAAAGCATTATTGAACATAATAGAGACTCTTTTCCCAAAAGAAAACTAAAGACAGACCCAAGCACCTCTAAAACTGTGCAACCTCCCAAGATCAGTTGTTCTAAGACAGAAAGAGAAAAGCAATCAGTGGTTCCAGTCATAATAGGAGATAGTGATGCTAACGTGTCTGACAAAGATGTTCTGGAGGAAGATTCAGACAATGCTGATGAAAGTGATGAGGAATCTGAAGTTGAAATCACAGGTGGTGGTAGAGCTTCAGCTGATGGTGGAAGTGAAGATGAAGATAGTGAGGATGATGATGAAAGTGACAGTGGCCCTGATCTTGCAAGGGGTAAAGGAAATATAGAAACTAGTTCCGAAGATGAAGATGATTTGGCAGATTTATTTCCAGAAGAACCTGGTTTTGAGCATGCTTGGAGAGAATTAGATAAAGATGCGCCCCGGGCTAATGAGATTACACATCGACTAGCAGTTTGCAACATGGACTGGGATCGATTAAAGGCAAAAGATTTACTGGCTCTGTTCAACTCATTTAAGCCTAAAGGAGGTGTTATATTTTCCGTAAAGATATATCCTTCAGAGTTTGGAAAGGAGAGGATGAAGGAAGAGCAAGTTCAAGGACCAGTGGAGTTATTAAGCATTCCTGAAGATGCTCCTGAAAAGGACTGGACCTCTAGAGAAAAATTGAGAGATTATCAGTTCAAACGACTGAAGTACTATTATGCGGTAGTGGACTGTGATTCTCCTGAAACAGCAAGTAAAATTTATGAGGATTGTGATGGCCTCGAATTTGAAAGTAGTTGTTCTTTCATAGATCTAAGGTTTATACCAGATGATATTACTTTTGATGATGAGCCTAAGGATATAGCCTCAGAAGTGGATTTAACAGCGTATAAACCAAAATATTTCACATCTGCTGCAATGGGAACATCAACGGTGGAGATCACTTGGGATGAGACTGATCATGAAAGAATCACAACACTCAACAGGAAATTTAAAAAGGAAGAACTTTTGGACATGGATTTTCAAGCCTACTTAGCTTCCTCTAGTGAAGATGAAGAGTTGATAGAAGAGGAGCCACAAGATAATGATGAAGTCAGTGGAGAAGATGATGGGAAAGCAAAGAAAAGTCAGAAGGATGATGAAGAACAAATTGCTAAATACAGGCAGCTCTTGCAGGTTATTCAAGAAAAAGAAAAGAAAGGCAAAGAAAATGATATGGAAATGGAAATTAAGTGGGTTCCAGGCCTTAAAGAAAGTGCAGAAGAGATGGTAAAAAACAAATTGGAAGGAAAAGATAAACTGACCCCTTGGGAACAATTTTTAGAGAAGAAAAAAGAGAAAAAAAGACTAAAAAAGAAACAGAAGGCTCTTGCTGAAGAGGCTAGTGAAGATGAACTTCCCCCTGATGTCGATTTCAATGACCCATACTTTGCTGAAGAAGTTAAAAAAATAGGTTTAAAGAAAAAATCAATGAAATCTGCAAAAAATGCCACATCTCCAGAGGAAGAAATTGAAATTGAAAGACAAAAGGCTGAAATGGCTTTGCTTGTGATGGATGAGGAGGAAGACAGTAAAAAACACTTCAATTACAATAAGATTGTGGAGCACCAGAATCTAAGCAAAAAGAAGAAGAAACAGCTTATGAAAAAGAAAGAATTATTAGAAGATGACTTTGAGGTAAACGTTAGTGATGCACGATTTCAGGCAATGTATACTTCCCACTTGTTCAATTTGGATCCTTCAGATTCTAATTTCAAGAAAACAAAAGCTATGGAAAAAATCCTTCAGGAGAAAGCCCGGCAAAGAGAACGAAAAGAACAAGAAATTATTCAGGCAATAAAGAAAAAAGAAAGCGAGATTGAAAAGGTATCTCAGAAGAAGTCTATTGATCCTGCCTTGTCAGTGCTGATTAAATCTGTAAAAAACAAAACAGAACAGTTTCAAGCAAGAAAAAAACAAAGAGTCAAATAA

XM_004840835.1 Coding sequence

Ndufaf5 NADH dehydrogenase (ubiquinone) complex I, assembly factor 5

High confidence: 4 potential gene matches
Length: 1053 bp    Location: 14778109..14823893   Strand: +
>XM_004840835.1
ATGGTTCCGCGGCTGGAAATGCTGAGGACTGGTGTGGTGTGGCATCGATGGCTGAGGCCTCGCACTGCAAGAGTCCGAGCAGAGAACCTTGGTTGTCGAGAGGTTGCTTCCGGCGTCCCTCCCCTAGGCAGCAAGTCTCTTGGAGTCCTAAATATCTTCGATCGGGGTTTGAAGAGGAAACAGAAAAACTGGGCGGCCCAGCAGCCCGAGCCAACGAGATTTGACTACTTGAGGGAAGAGGTTGGAAGTCAGATTGCAGACCGTGTGTATGACATAGCAAGAGATTTCCCCCTTGCTTTGGATGTTGGCTGTGGAAGAGGTTACCTAGCACAATATTTGAATAAGGAAACGGTTGGAAAGTTTTTCCAAACAGACATTGCAGAAAATGCTTTGAAAAATTCCCTAGAAACAGAAATTCCTACTGTCAGTGTTTTAGCTGATGAAGAATTCCTTCCCTTTCAAGAAAATACATTTGATCTGGTGGTTAGCAGTTTAAGTTTGCACTGGGTTAATGACCTTCCTAGAGCACTAGAACAGATTCATTATGTTTTAAAACCAGATGGAGTATTTGTTGGTGCAATGTTTGGAGGCGACACACTGTATGAACTTCGGTGTTCATTACAGTTAGCAGAAACGGAAAGAGAAGGAGGATTTTCTCCACACATTTCTCCTTTTACTGCTGTCAGTGACCTAGGACATCTACTTGGGAGAGCTGGCTTTAATACACTGACTGTGGACACTGATGAAATTCAGGTTAACTATCCTGGAATGTTTGAATTGATGGAAGATTTACAAGGTATGGGAGAGAGTAACTGTTCCTGGAATAGAAAAGCCCTGCTGCACCGAGACACGATGCTGGCGGCTGCAGCAGTTTACAGAGAAATGTACAGAAATTTGGATGGTTCAGTACCTGCCACATACCAGATCTATCACATGATAGGATGGAAATACCATGATTCTCAGGCAAGACCGGCTGAAAGAGGTTCTGCAACTGTGTCATTTGGAGAGCTAGGGAAATTAAATCTTATGTTGCAGGGGAAAAAATCACAATAA

XM_004840839.1 Coding sequence

Macrod2 MACRO domain containing 2

Length: 1431 bp    Location: 14998093..17253851   Strand: +
>XM_004840839.1
ATGTACCCCAGCAACAAGAAGAAAAAGGTGTGGAGAGAGGAGAAAGAACGTTTACTGAAGATGTCCTTAGAGGAGAGGCGCAAAGAATATGTAAGAGACTATATTGCCCTGAACACCATTCTGTCCTGGAAGGAGGAGATGAAGGGCAAGAGCCAAAATGATGAAGAAAATACTCAGGAAACATCAAAAGTGAAGAAAAGTTTGAGTGATAAAGTTTCTCTCTATAGAGGTGACATCACATTGCTAGAGGTAGATGCTATAGTCAATGCGGCTAATGCCAGTCTTCTTGGAGGAGGTGGTGTGGATGGCTGCATTCATAGAGCAGCTGGCCCCTGTTTGCTAGCTGAATGTCGTAACCTGAATGGCTGTGAGACTGGACATGCAAAAATCACATGTGGCTATGACCTACCTGCAAAACATGTCATCCATACTGTAGGGCCAATAGCCAGAGGCCATATTAATGGTTCCCACAAGGAGGACCTTGCAAATTGCTATAAATCATCTCTGAAGCTAGTGAAGGAAAATAACCTCCGATCAGTTGCATTTCCCTGCATCTCAACAGGCATTTATGGTTTTCCTAATGAGCCTGCTGCAGTCATTGCCCTTGGCACCATTAAGGAATGGCTGGCCAAGAATCACCAGGAGGTGGAACGGATTATCTTTTGTGTCTTCCTAGAAGTTGACTTCAAAATCTACAAAAAGAAAATGAGTGAGTTTTTCCCTATGGATGATAATAATGAAGAAGAAGATGCTGACATGAAAGAAGAATCAGAAGGGCTAGAGCCAAAAGGTCTCTCTCCACCCCATAAGAAGAGCAAAGCAAAGAAGCCAGAATGTTCAAAAGACTCTAGTGAAGATGAGAATGGTCCGGAGGAAAAGCAAAGTGCAGAAGAAATTGAAGGGCAGAGCCAAGAAGCAGATGGTGTCAACACCGCCACTGTTCCCAGTCCTGGTACAGAAGAAACAGTTGAAGTTTGTAAAGATAAAGAATCTGAAAAGGATGACAATATTATAAAAGACATAACAGATCATTCTGTTGTTGACCAAGACCGCCCCAATGGGGAAGAGAATGATTCAACAAAGAATGAAATCAAAATCAAGACAGAATCTCAGAGCTCATATATGGAAACAGAAGAGCCTTCATCAAACCAAGAAGATGCCACAATTGTGGAGCAACCAGAAGTGATTCCACTGACAGATGACCAAGACGAAAAAGAAGGTGCAAACGCTCAAGGGGAGGACACACCTACAGCTTCTGTGAAAAGCCAGAGCTCTAGTGACACTGAACCTGCTACAGGTCCTGATGTTGAAATGAATAGTCAGGTTGACAGTGTAAATGACCCAACAGAGAGTCAGCAAGAAGATCACCAATTAAGAAGCCCCTGTGGGGCACAAGGTGAAGCAAAGGAACACAGAAATGAAACTCAATGA

XM_004840842.1 Coding sequence

Kif16b kinesin family member 16B, transcript variant X3

Length: 3768 bp    Location: 17750525..17464517   Strand: -
>XM_004840842.1
ATGGCATCTGTCAAGGTGGCCGTGAGAGTTCGGCCCATGAATCGCAGGGAAAAGGACTTGGAGGCCAAGTTCATTATTCAAATGGAGAAAAGCAAGACAACAATCACAAACTTAAAGCTACCAGAAGGAGGGACTGGGGATTCAGGAAGAGAACGCACCAAGACCTTCACCTATGACTTTTCTTTTTATTCTGCTGATACAAAGAGTCCAGATTATATTTCACAAGAAATGATTTTCAAAACCCTGGGCACAGATGTCATGAAATCTGCATTTGAAGGTTATAATGCTTGTGTCTTTGCATATGGGCAAACTGGATCTGGAAAGTCATACACTATGATGGGAGATTCTGGTGATTTGGGCTTAATACCTCGGATCTGTGAAGGGCTCTTCAGTCGGATAAATGAAACCACCCGATGGGATGAAGCATCCTTTCGGACTGAAGTCAGCTACTTAGAAATTTATAATGAACGTGTGAGAGACCTGCTTAGGCGGAAGTCATCTAAAACCTTCAATTTGAGAGTCCGAGAGCATCCAAAAGAAGGACCTTATGTCGAGGATTTATCCAAACATTTAGTACAGAATTATGGTGACGTGGAAGAACTGATGGATGCAGGGAATATCAACCGGACCACAGCAGCAACTGGGATGAACGATGTCAGTAGCAGGTCTCACGCCATCTTCACCATCAAGTTCACTCAGGCAAAGTTTGACTCTGAAATGCCATGTGAAACCGTGAGTAAGATCCACTTAGTCGATCTTGCCGGAAGTGAGCGTGCAGATGCCACTGGTGCCACGGGGGTCCGGCTCAAGGAAGGGGGGAACATTAACAAGTCCCTCGTGACTCTGGGAAATGTCATTTCTGCCTTAGCTGATTTATCTCAGGATGCAGCAAACCCTCTTGTAAAGAAGAAGCAAGTTTTTGTGCCTTACAGGGATTCTGTTTTGACTTGGTTGTTGAAAGATAGCCTTGGAGGAAACTCTAAAACTATCATGATTGCCACCATTTCACCTGCTGATGTCAATTATGGAGAAACCCTAAGTACTCTTCGCTATGCAAATAGAGCCAAAAACATCATCAACAAGCCTACCATTAACGAGGATGCCAACGTCAAACTTATCCGTGAGCTGCGAGCTGAAATAGCCAGGCTGAAAACACTGCTTGCTCAAGGGAATCAGATTGCCCTCTTAGACTCCCCTACAGCTTTAAGTATGGAGGAAAAACTTCAGCAGAATGAAGCAAGAGTTCAAGAATTGACTAAGGAATGGACAAACAAGTGGAATGAAACCCAAAATATTTTGAAAGAACAGACGCTAGCTCTTAGGAAGGAAGGGATTGGGGTTGTTTTGGATTCCGAACTACCTCACCTGATTGGCATTGATGATGACCTTCTGAGCACTGGAATCATCTTATATCACTTGAAGGAAGGTCAGACATATGTTGGTAGAGAAGATGCTTCAATGGAGCAAGATATTGTTCTTCATGGCCTTGACTTGGAGAGTGAGCACTGTGTCTTCGAAAATGTTGGGGGAACAGTGACGCTAATACCCCTGAGTGGTTCTCAGTGCTCTGTGAATGGTGTCCAGATCATGGAGGCCACACATCTAAATCAAGGTGCTGTGATACTCTTGGGAAGAACCAATATGTTTCGTTTTAATCACCCAAAGGAAGCTGCCAAGCTCAGGGAGAAGAGGAAGAGTGGCCTTCTGTCCTCCTTCAGCTTGTCCATGACCGACCTCTCAAAGTCCTGTGAGAACCTGTCTGCAGTCATGTTGTACAACCCCGGACTTGAATTTGAGCGACAACAGCGTGAAGAACTTGAAAAATTAGAAAGTAAGAGGAAGCTGATAGAAGAGATGGAGGAAAAGCAGAAGTCGGACAAGGCAGCGCTGGAGCGCATGCAGCAGGAGGTGGAGACGCAGCGCAAGGAGACAGAAATTGTTAAGCGTGAGATTCGCAAGCAGGAGGAGAGCCTCAAACGCCGCAGCTTCCACATTGAGAACAAGCTCAAGGACCTGCTTGCCGAGAAGGAAAAGTTTGAGGAGGAGAGGCTGCGTGAGCAGCAGGAGATCGAGCTGCAAAAGAAGAGACAGGAGGAAGAGAGCTTTCTCCATTGGCTCCAGGAATTCAGCAGCAGTGAGCAGCCTGAGAAGATGGAGATATTCCAGGAGCTGGACCGGCTGCAGCGGGAAAAAGATGAGCAGCACACCAAGCTGGCTCTGGAGAAGCAGAGGCTGGAGGAGCAGGAGCAGGAGCAGGTGCTGCTGTTGGCACAGCTTGAGGAGCAGCTTCAGGAGAGGCAGGAGATGGCCCCGCTGCTGTATGGCGAGGTTCTGAGGTCAGAGGAGGAAAAGCAGGAGCTTGAGGTCATCCGGGCTGTCCTCCTGCAGGCCAGGAAGGCCCTGGCTACAGGGGACACTGGCAGCCAGGGGCTGGACAGGGCCCAGCTGCATTTCCTAGAGTTCAAAAGAAAGCAGCTCATCCAGCTGGCCACCTCGGAACAAGAACTGGTCCAGCAAAAAGACCTCCTGAGTAAAGAAGTCCAGGAAGATCAGGAAGCCCTGCAGCACTTACAGTGTGAAAAGGATATGGACTGTAGGTTGTCGGCAAAAAATGATGGCCCAAGTATTTCCAGAGTGGCTCACGATTTAGAGAAAATAAAGGCAGCAGAATGCAGGCTGCGGTATAAAGAATGTCAGCTACAGGACCTCCTGCAAAATCACCTGCCAGCCCTGTTGGAAAAAAAGCAGAGAGCACTTGAAGTCCTTGACCAGGGCCCTCTCAGCTTGAACAACACTCTGTATCAAGTGGAAAAAGAAATGGAAGAAAAGGAAGAGCGACTTGCTCAGCACCAAGCCAGTGCCCGCCAGCTGCAGCAGCTCCAGGCCACCTTCGAATTCACCACCAATATCGCGAGACAAGAAGAGAAAGTGAGGAGAAAAGAGAAGGAGATTCTGGAGTCTCAGGAGAAGCAACAGAGAGAGGCACTGGAGCAGGCAGTGGCTAAGCTGTGGCACAGACAGTTGGCCCTGCAACAGCACTCCACCCTGGGCCTAGAGGGTGAGAAAGAGAGGCAGAAGCCAGCAGAGCAGAGCAGCAGCAGTGAGCAATTGGAGCTCCTGGCTGGCCTGGAAGCTGAGCAGGAGAACCTGGAGAAGGACCAGGACAGAATCAATGCTTACATTGAAGAAGAAGTCCAAAGACGTCTTCAGGATTTGCACCGCACAGTTGGTATTGCTAGGAATACTTCTACAGATATAACGAAAGATGAGAAACTTCACAATGACACCATTCAACGTAAGCTAAAATATGAGCGGATGGTTTCTCGCTCTTTGGGAGCAAATCCGGATGACCTGAAGGACCCAATTAAGATTAGTATTCCACGCTACATCCTCTGCGGGCAAGGGAAGGATGCACACTTCGAGTTTGAGGTCAAGATTACTGTCCTAGATGACACATGGACCGTATTCAGGCGGTATAGTCGTTTTCGAGACATGCATAAAACATTGAAGTTAAAGTATGCAGAGCTTGCTGGCCTTGAATTCCCTCCAAAGAAATTATTTGGAAACAAAGATGAACGTGTGATTGCTGAGAGGCGAAGTCATTTAGAGAAATACCTCAGGGACTTTTTCAGTGTGATGCTGCAGTCGGCGACATCTCCCCTGCACATCAGCAAAGTGGGGCTGACCCTTTCGAAACACACCATCTGTGAGTTCTCACCATTCTTCAAGAAAGGAGTCTTTGACTACAGCAGCTATGGAACAGGGTAG

XM_004840843.1 Coding sequence

Kif16b kinesin family member 16B, transcript variant X4

Length: 3576 bp    Location: 17750525..17527680   Strand: -
>XM_004840843.1
ATGGCATCTGTCAAGGTGGCCGTGAGAGTTCGGCCCATGAATCGCAGGGAAAAGGACTTGGAGGCCAAGTTCATTATTCAAATGGAGAAAAGCAAGACAACAATCACAAACTTAAAGCTACCAGAAGGAGGGACTGGGGATTCAGGAAGAGAACGCACCAAGACCTTCACCTATGACTTTTCTTTTTATTCTGCTGATACAAAGAGTCCAGATTATATTTCACAAGAAATGATTTTCAAAACCCTGGGCACAGATGTCATGAAATCTGCATTTGAAGGTTATAATGCTTGTGTCTTTGCATATGGGCAAACTGGATCTGGAAAGTCATACACTATGATGGGAGATTCTGGTGATTTGGGCTTAATACCTCGGATCTGTGAAGGGCTCTTCAGTCGGATAAATGAAACCACCCGATGGGATGAAGCATCCTTTCGGACTGAAGTCAGCTACTTAGAAATTTATAATGAACGTGTGAGAGACCTGCTTAGGCGGAAGTCATCTAAAACCTTCAATTTGAGAGTCCGAGAGCATCCAAAAGAAGGACCTTATGTCGAGGATTTATCCAAACATTTAGTACAGAATTATGGTGACGTGGAAGAACTGATGGATGCAGGGAATATCAACCGGACCACAGCAGCAACTGGGATGAACGATGTCAGTAGCAGGTCTCACGCCATCTTCACCATCAAGTTCACTCAGGCAAAGTTTGACTCTGAAATGCCATGTGAAACCGTGAGTAAGATCCACTTAGTCGATCTTGCCGGAAGTGAGCGTGCAGATGCCACTGGTGCCACGGGGGTCCGGCTCAAGGAAGGGGGGAACATTAACAAGTCCCTCGTGACTCTGGGAAATGTCATTTCTGCCTTAGCTGATTTATCTCAGGATGCAGCAAACCCTCTTGTAAAGAAGAAGCAAGTTTTTGTGCCTTACAGGGATTCTGTTTTGACTTGGTTGTTGAAAGATAGCCTTGGAGGAAACTCTAAAACTATCATGATTGCCACCATTTCACCTGCTGATGTCAATTATGGAGAAACCCTAAGTACTCTTCGCTATGCAAATAGAGCCAAAAACATCATCAACAAGCCTACCATTAACGAGGATGCCAACGTCAAACTTATCCGTGAGCTGCGAGCTGAAATAGCCAGGCTGAAAACACTGCTTGCTCAAGGGAATCAGATTGCCCTCTTAGACTCCCCTACAGCTTTAAGTATGGAGGAAAAACTTCAGCAGAATGAAGCAAGAGTTCAAGAATTGACTAAGGAATGGACAAACAAGTGGAATGAAACCCAAAATATTTTGAAAGAACAGACGCTAGCTCTTAGGAAGGAAGGGATTGGGGTTGTTTTGGATTCCGAACTACCTCACCTGATTGGCATTGATGATGACCTTCTGAGCACTGGAATCATCTTATATCACTTGAAGGAAGGTCAGACATATGTTGGTAGAGAAGATGCTTCAATGGAGCAAGATATTGTTCTTCATGGCCTTGACTTGGAGAGTGAGCACTGTGTCTTCGAAAATGTTGGGGGAACAGTGACGCTAATACCCCTGAGTGGTTCTCAGTGCTCTGTGAATGGTGTCCAGATCATGGAGGCCACACATCTAAATCAAGGTGCTGTGATACTCTTGGGAAGAACCAATATGTTTCGTTTTAATCACCCAAAGGAAGCTGCCAAGCTCAGGGAGAAGAGGAAGAGTGGCCTTCTGTCCTCCTTCAGCTTGTCCATGACCGACCTCTCAAAGTCCTGTGAGAACCTGTCTGCAGTCATGTTGTACAACCCCGGTCTTTTCCCTGTAAAAGGACCCATCTGTCTAAGACTTGAATTTGAGCGACAACAGCGTGAAGAACTTGAAAAATTAGAAAGTAAGAGGAAGCTGATAGAAGAGATGGAGGAAAAGCAGAAGTCGGACAAGGCAGCGCTGGAGCGCATGCAGCAGGAGGTGGAGACGCAGCGCAAGGAGACAGAAATTGTTAAGCGTGAGATTCGCAAGCAGGAGGAGAGCCTCAAACGCCGCAGCTTCCACATTGAGAACAAGCTCAAGGACCTGCTTGCCGAGAAGGAAAAGTTTGAGGAGGAGAGGCTGCGTGAGCAGCAGGAGATCGAGCTGCAAAAGAAGAGACAGGAGGAAGAGAGCTTTCTCCATTGGCTCCAGGAATTCAGCAGCAGTGAGCAGCCTGAGAAGATGGAGATATTCCAGGAGCTGGACCGGCTGCAGCGGGAAAAAGATGAGCAGCACACCAAGCTGGCTCTGGAGAAGCAGAGGCTGGAGGAGCAGGAGCAGGAGCAGGTGCTGCTGTTGGCACAGCTTGAGGAGCAGCTTCAGGAGAGGCAGGAGATGGCCCCGCTGCTGTATGGCGAGGTTCTGAGGTCAGAGGAGGAAAAGCAGGAGCTTGAGGTCATCCGGGCTGTCCTCCTGCAGGCCAGGAAGGCCCTGGCTACAGGGGACACTGGCAGCCAGGGGCTGGACAGGGCCCAGCTGCATTTCCTAGAGTTCAAAAGAAAGCAGCTCATCCAGCTGGCCACCTCGGAACAAGAACTGGTCCAGCAAAAAGACCTCCTGAGTAAAGAAGTCCAGGAAGATCAGGAAGCCCTGCAGCACTTACAGTGTGAAAAGGATATGGACTGTAGGTTGTCGGCAAAAAATGATGGCCCAAGTATTTCCAGAGTGGCTCACGATTTAGAGAAAATAAAGGCAGCAGAATGCAGGCTGCGGTATAAAGAATGTCAGCTACAGGACCTCCTGCAAAATCACCTGCCAGCCCTGTTGGAAAAAAAGCAGAGAGCACTTGAAGTCCTTGACCAGGGCCCTCTCAGCTTGAACAACACTCTGTATCAAGTGGAAAAAGAAATGGAAGAAAAGGAAGAGCGACTTGCTCAGCACCAAGCCAGTGCCCGCCAGCTGCAGCAGCTCCAGGCCACCTTCGAATTCACCACCAATATCGCGAGACAAGAAGAGAAAGTGAGGAGAAAAGAGAAGGAGATTCTGGAGTCTCAGGAGAAGCAACAGAGAGAGGCACTGGAGCAGGCAGTGGCTAAGCTGTGGCACAGACAGTTGGCCCTGCAACAGCACTCCACCCTGGGCCTAGAGGGTGAGAAAGAGAGGCAGAAGCCAGCAGAGCAGAGCAGCAGCAGTGAGCAATTGGAGCTCCTGGCTGGCCTGGAAGCTGAGCAGGAGAACCTGGAGAAGGACCAGGACAGAATCAATGCTTACATTGAAGAAGAAGTCCAAAGACGTCTTCAGGATTTGCACCGCACAGTTGGTATTGCTAGGAATACTTCTACAGATATAACGAAAGATGAGAAACTTCACAATGACACCATTCAACGTAAGCTAAAATATGAGCGGATGGTTTCTCGCTCTTTGGGAGCAAATCCGGATGACCTGAAGGACCCAATTAAGATTAGTATTCCACGCTACATCCTCTGCGGGCAAGGGAAGGATGCACACTTCGAGTTTGAGGTCAAGATTACTGTCCTAGATGACACATGGACCGTATTCAGGCGGTATAGTCGTTTTCGAGACATGCATAAAACATTGAAGTTAAAGTATGCAGAGATGGTCTCTTTGGCCTGA

XM_004840848.1 Coding sequence

Snrpb2 small nuclear ribonucleoprotein polypeptide B, transcript variant X4

High confidence: 4 potential gene matches
Length: 675 bp    Location: 17892940..17902321   Strand: +
>XM_004840848.1
ATGGATATTAGACCAAATCATACAATTTATATCAACAATATGAATGACAAAATTAAAAAAGAAGAATTGAAGCGATCCCTATATGCACTGTTTTCTCAGTTTGGGCATGTGGTAGATATTGTGGCTTTAAAGACTATGAAGATGCGAGGCCAGGCCTTTGTTATATTTAAAGAACTGGGTTCATCCACAAATGCTTTAAGACAGTTACAAGGATTCCCATTTTATGGCAAACCAATGCGAATCCAGTATGCAAAAACAGATTCTGATATAATATCTAAAATGCGTGGCACTTTTGCTGACAAGGAAAAGAAAAAAGAAAAGAAAAAAGCCAAAACTGTGGAACAAACTGCAACAACTGCAAACAAAAAGCCTGGCCAGGGAATATCAACAACTAATACCCAAGGAAATGCAACAACAAATCCTCAGGTCCCTGATTACCCTCCAAACTATATTTTATTCCTTAATAATTTACCAGAAGAGACTAACGAGATGATGCTGTCTATGCTGTTTAATC