Details from NCBI annotation

Gene Name Heterocephalus glaber isolate NMR 29 unplaced genomic scaffold, HetGla_female_1.0 scaffold00103, whole genome shotgun sequence

Genome Location

Related Sequences

XM_004866756.1 Coding sequence

Etfb electron-transfer-flavoprotein, beta polypeptide, transcript variant X1

High confidence: 4 potential gene matches
Length: 768 bp    Location: 3506169..3518760   Strand: +
>XM_004866756.1
ATGGCGGAGCTGCGCGCGCTCGTGGCTGTCAAGAGAGTCATCGACTTCGCGGTGAAGATCCGGGTGAAGCCTGACAAGACAGGGGTCGTCACTGATGGCGTGAAGCACTCCATGAACCCCTTCTGTGAGATTGCTGTGGAGGAGGCCGTGCGGCTCAAGGAGAAGAAGCTGGTGAAGGAGGTCATCGCTGTCAGCTGTGGCCCCGTGCAGTGCCAGGAGACCATCCGCACGGCCCTGGCCATGGGTGCAGACCGAGGCATCCACGTGGAGGTGCCAGCTGCAGAAGCCGACCGTGTGGGTCCCCTGCAGGTGGCCCGGGTCCTGGCCAAGCTGGCTGAGAGGGAGAAGGTGGACCTGGTGCTGCTGGGCAAACAGGCCATTGATGATGACTGTAACCAGACGGGTCAGATGACGGCTGGGCTTCTAGACTGGCCACAGGGCACCTTCGCCTCCCAGGTGACGCTGGAGGGGGCCAAGCTGAAAGTGGAGCGGGAGATTGACGGGGGCCTGGAGACCCTCCGCCTGAAGCTGCCGGCTGTGGTGACCACAGACCTGAGGCTCAATGAGCCCCGCTACGCCACGCTGCCCAACATCATGAAAGCCAAGAAGAAGAAGATCGAGGTGATCAAGGCCAGCGACCTGGGCGTGGACCTGAGCTCCAAGCTCACCGTGGTCAGCGTGGAGGACCCACCCCAGCGCACGGCTGGTGTCAAGGTGGAGACCACTGAAGACCTGGTGGCCAAGCTGAAGGAGGTTGGGCGGATCTGA

XM_004866851.1 Coding sequence

Nup62 nucleoporin 62kDa, transcript variant X2

Length: 1557 bp    Location: 4404245..4428231   Strand: +
>XM_004866851.1
ATGAGCGGGTTTAATTTCGGAAGCACTGGTGCTTCCACAGGTGGATTCACATTTGGCACTGCGAGAACAGCAACCACCACACCCTCAACGGGATTTTCTTTCTCCACTCCCGGCACTGGAGGGTTTACCTTTGGAACTCCCTCCCAGCCAGCTGCAAGTACCCCTTCAACCAGCCTCTTCTCACTCAACACCCAAGCTCCAGCAACTCAGACCACTGGATTCACTTTCGGAACAACTCCTGCTTCCACAGCAACTGGCTTTTCCTTAGGGATCAATACCCCAAAGCCAAGCTTGAGCAACATAGCTGCCGCCCCAGTTACGGCAAATCCCAGCGGCTTTGGGCTTGGCAGCAGCACCCTCACCAATGCCATATCAAGTGCTGTCACCTCCAGCCAGGGGACAGCATCCACTGGCTTTGTGTTCGGTTCCTCTACCACCTCCACAGCTCCAGCCACCACGTCTGGAGGGTTCTCCTTCACCAGTGGAAGCACGTCCCAGGCTGGGACCTCTGGCTTCAACATTGGCTCCCTGGGCAGTGTAGCCCAGGCCCAGCCCACGGCACTTCCCGGATTGCCCTTCACTGCAGCCACGCCAGCAGCCACTGCAGCGGGGGCCACCCAGCCAGCTGCACCCACAGCCACTGCCAGCAGTGCAGGGCCCACCCTCTTTGCCTCAATAGCAGCTGCTCCCACCTCGTCCACCACTGGGCTCGCCCTCTGTGTCCCAGCAACCACCACTGGAGCTCCTGGCGCTGGGACCCTGGGTTTCAGCCTAAAAGCCCCCGAAACCGCTTCTAGCACCTCAGCAGCAACATCCACCACTGTGGCCACAGCCAGCACCACTGCCGCCACCGGCTTTGCTTTGAATATAAAGCCACTGGTGCCAGCTACAATATCCAGCGGTGCAGCAGCAGGTGTGACTGCTGCATCTGGCTCCGTTGCAGCTACTGGGACATCCACCTCTCCTGTGATGACCTACGCACAGCTGGAGAGCCTGATCAACAAGTGGAGCCTGGAGCTGGAGGACCAGGAGCGCCACTTCCTCCAGCAGGCCACCCAGGTCAACGCCTGGGACCGCACGCTAATCGAGAATGGGGAGAAGATCACCAGCCTGCACCGTGAGGTGGAGAAGGTGAAGCTGGACCAAAGGAGGCTGGACCAGGAGCTCGACTTCATCCTGTCCCAGCAGAAGGAGCTGGAAGACCTGCTGAGCCCCCTGGAGGAGTCAGTGAAGGAGCAGAGCGGGACCATCTACCTGCAGCACGCCGACGAGGAGCGTGAGAAGACCTACAAGCTGGCTGAGAACATTGATGCCCAGCTGAAGCGCATGGCCCAGGACCTCAAGGACATCATCGAGCACCTGAACACGTCCGGAGGCCCTGCTGACACCAGCGACCCACTGCAGCAGATCTGCAAGATCCTCAACGCACACATGGACTCGCTGCAGTGGATCGACCAGAACTCGGCCCTTCTGCAGAGGAAGGTGGAGGAGGTGACCAAGGTGTGCGAGGGCCGCCGCAAGGAGCAGGAGCGCAGCTACAGGATCACATTTGACTGA

XM_004866743.1 Coding sequence

Znf350 zinc finger protein 350, transcript variant X4

Length: 1593 bp    Location: 3079480..3090711   Strand: +
>XM_004866743.1
ATGATCCAGGCCCAGGAGTCACTGACCCTGGAGGATGTGGCTGTGAGGTTCACCCGGGAGGAGTGGCAGCTCCTGGGCCCTGCTCAGAAGGACCTGTACCGGGACGTGATGCTGGAGAACTACAGCAGCCTGGTGTCAGTGGGGTATCAAGCCAGCCAGCCAGATTCCCTCTCCAGCTTGCTTTGTGGAGAACCATGGATGGTGGAGGATGAACTGCACTGTGGAACCCATTCAGACATCTGGAAGGCTGTTGATGATCTGCCAAGGCATTTACAAAACAAAAGCAAGGTGAACAGGTTGGAAGAGTGGCGTGAACACAATACATTTGAAAATGTTCAACAGAGCAAAACTCAATTTCTTTTGAGGCAAAATCATGACATATTTAACTTACATGGAAAAAGTATGAAGTCAGATTTAACTTTGGTTAACCAGAGCAAAAGCTGTGAAATAAAGAATCCCATGGCATTCCCCAGACGTGAGGAATCCTTTTTCCCTGCTAACTGTGAAAAACTTCATACTGAAATTTTATTTCCTGCAAGTCAAAAACACATCAGCATTAAATCTCAGTTCAGTAGCCGCAAGCCTAAGAAAACTCAGAAAGTAGAGAAACGTCATGTATGCAGTGAATGCGGGAAAGCCTTTGTCAAGAAGTCTTGGCTCACTGATCACGAGATCATCCATACTGGGGAGAAACCCCATCGATGTGGTCTGTGTGGGAAAGCCTTCTCCAGAAAGTTCATGCTCACTGAACACCACAGAACTCATACAGGAGAAAAACCTTACGCATGCACTGAGTGTGGCAAAGCCTTTCTCAAGAAATCACGACTCAGCATACATCAGAAAACTCATACAGGAGAGAAACAGTATATATGCAGTGAGTGTGGAAAGAGCTTCATCCAGAAAGGAAATCTCATTGTACATCAGCGAATTCATACAGGCGAGAAACCTTATATATGCAGTGAATGTGGAAAAGGCTTTATCCAAAAGACCTGCCTCATAGCACATCAGAGGTTTCATACTGGGAAGACTCCCTTTGTGTGCAGTGAATGTGGAAAATCCTGTTCACAGAGGTCGGGTCTCATTAAACATCAAAGGATTCACACAGGGGAGAAACCCTTTGTATGTAGTGACTGTGGGAAAGCCTTCACCACAAAGCAAAAGCTCATTGTTCATCAAAGAACTCATACAGGAGAGAAACCCTATGGCTGCAATGACTGTGGGAAAGCTTTTGCGTACATGTCTTGCCTGGTGAAGCATAAGAAAATACACACAAGGGAAAAGCAGAGACATACAATGAGGTCGGAAAAACCTGCTGAGAGTGACAGCTCGTTATATATTGGTGGCGTCATACAGGAGACAAACCCGGTTAGCACAGTGATTACCCAAGTGCCTTCTGTGGCCTCTCAGTCAGCACTGAACATCAGTGGCCTAGCAAATAGGAATGTAGTCCTTATGGGACAGCCGGTGGCCAGATGTGTGTCGTTAGGAGACAACCGAGAATTTACACAGGATAGAGACCTCGTGAATGCAGTGAATATGGTTGTGCCTTCAGTCATCAATTATGTCTTATTTTATGTCACAGAAAACCCATAG

XM_004866650.1 Coding sequence

Ube2s ubiquitin-conjugating enzyme E2S, transcript variant X2

High confidence: 4 potential gene matches
Length: 663 bp    Location: 1914063..1918746   Strand: +
>XM_004866650.1
ATGAACTCCAACGTGGAGAACCTGCCTCCCCACATCATACGCCTGGTGTACAAAGAGGTGACGACACTGACAGCCGACCCACCGGATGGCATCAAGGTCTTCCCCAACGAGGAGGACCTCACAGACCTGCAAGTCACCATTGAGGGCCCTGAGGGGACCCCCTATGCCGGGGGTCTGTTCCGCATGAAACTCCTGCTGGGGAAGGACTTCCCTGCCTCCCCACCCAAGGGCTACTTCCTGACCAAGATCTTCCACCCCAACGTGGGCGCCAATGGTGAGATCTGCGTCAACGTGCTCAAGCGGGACTGGACGGCCGAGCTGGGCATCCGGCATGTGCTGCTGACCATCAAGTGCCTGCTGATCCACCCCAACCCCGAGTCCGCTCTCAACGAGGAGGCGGGCCGCCTGCTGCTGGAGAACTATGAGGAGTATGCGGCACGCGCGCGCCTGCTCACCGAGATCCACGGCGGCTCAGGCGGGCCCAGCGCCAGGGTCCCTGCCGGGGGTGCCACAGCCTCCTCTGCCGACCCCTCTGCCCCTGCCAGCGTGGGGGGTCCGGGCGGGGCCGAGGGCCCCATGGCCAAGAAGCACGCAGGGGAGCGCGACAAGAAGCTGGCAGCGAAGAAGAAGACGGAGAAGAAGCGGGCGCTGCGGCGGCTGTAG

XM_004866768.1 Coding sequence

Siglec7 sialic acid binding Ig-like lectin 7, transcript variant X2

Length: 1404 bp    Location: 3655448..3645601   Strand: -
>XM_004866768.1
ATGCTGCTGCTGCTGCTGCTGCCTGTGCTGCTGCTGCTCTGGGTGCAGGAGGGGGTGTGGGGAGAGGCTTACTCCTTGAAGGTGCAGAGCCCGGTAACGGTGCAGGAGGGCCTGTGTGTCCATGTGCCCTGTGAGTTCACCCACCCCTATGAAGACCAGACTGAGTTGGACGCAGCTCACGGCTACTGGTTCCGGGAAAAGGCTGGGTTTACAAGACAGACTGTTGTGGTGGCCACAAATGATCCAAGTCAACCGGTGGAGAAGGAAACCAAGGGCCGATTCCACCTCACTGGGGATCCGCGAGCCAACAACTGCTCCCTGGACATCAGAGACGCCCAGAAGAAGGACGAAGGGTCATTCGTCTTTCGGATGGAGAGAGGACGGAAACGATACAGTTACATAGCATACCCGGTCTCTGTGCGTGTGACAGCCCTGACCCACACCCCCGGCATCCTCATCCCGGGGACCCTGCAGCCCGGCCGCCCCAGCAACCTGACCTGCTCTGTGCCCTGGGCCTGCGAGCGGGGGACGCCCCCCATCTTCTCCTGGGCGGGCGCCTCTGTGTCCCACCTGGACCCCGCGGTCACGAGCTCCCCCGTGCTCACCCTCACCCCGCGGCCCCAGGACCACGGCACCGCCCTCAGCTGTCAGGTGACTCTGCCCGCGGCCAGTGTGACCACGAGGACGACCGTGCAGCTCAACATCTCCTACGCTCCGCGGAACCTGACGGTAACGGTGGCCCCCGGAGCAGGCGCAGCACCCACAGCCCTGGCGAACGGCTCCTCCCTTCCAGTCGTGGAGGGCCAAGCTCTGCGCCTGCTCTGTGCGGTCGACAGCCACCCCCGTGCCAGGTTGAGCTGGTCCTGGGGGAACCTGACTCTGTGTCCCTCCGAGCCCGCGAACCCTGGGGTACTGGAGCTGACCCCAGAGCATCTCAGGGGTGAAGGAGAATTCACCTGCCGAGCGCAGAACGCTCTGGGCTCCCGGCATGTCTCGCTGAGCCTGTCCCTGCAGGATAAACAGGGGCTTCCACAGAGAGGGTGGGGAGTGACCGGAGTGACGCTGGGGGCCTTCGTGGGAGCTGGAACCACAACCCTGCTTTTCCTGTCCTTCTGCATCATCTTGGCCATATCATGGTCCTGGAGAAAGAAATCTGCGAAGCCAGCAGCGAGTGCAAGGGATCCAGATGCTGCTAGTGGCTCAGTCTCACAGGGTCCCCTGGTTGAATCCCAGCCAGATGACAGCTCCTCACACCAGCCTCTCCCATCTGTGGCTGCCCTCTCCTCAGAGGAGGAAGAAGAGATCCACTATGCATCCCTCAGTTTCCATGGGGTGAAGCCCAGGGACCCGCAAGAGCACCAGAGCATCACCAGTGAGTACTCGGAGATAAAGTTCCACGAGTGA

XM_004866770.1 Coding sequence

Siglec7 sialic acid binding Ig-like lectin 7, transcript variant X4

Length: 1230 bp    Location: 3655605..3653110   Strand: -
>XM_004866770.1
ATGACCACCTCACTTCCTCAGGCCGCTTGTGAACCAGGTTCCCCTCTGGGTCCTCATTATGTTTTAACACTCAGCATGCTCACCCGCACCGCCCCAGTGCCTCCCCTGCTCAGCCTTCCTGAGACTGACCGTCCAACCTGGGTCCTGCAGCTCTGGGTTCCTCAGAGTAGAGGCTGGAGGAGGAGCAGACTCCCCTGGGTGGACCCGCAGCTCCAGATCGACATGCTGCTGCTGCTGCTGCTGCCTGTGCTGCTGCTGCTCTGGGTGCAGGAGGGGGTGTGGGGAGAGGCTTACTCCTTGAAGGTGCAGAGCCCGGTAACGGTGCAGGAGGGCCTGTGTGTCCATGTGCCCTGTGAGTTCACCCACCCCTATGAAGACCAGACTGAGTTGGACGCAGCTCACGGCTACTGGTTCCGGGAAAAGGCTGGGTTTACAAGACAGACTGTTGTGGTGGCCACAAATGATCCAAGTCAACCGGTGGAGAAGGAAACCAAGGGCCGATTCCACCTCACTGGGGATCCGCGAGCCAACAACTGCTCCCTGGACATCAGAGACGCCCAGAAGAAGGACGAAGGGTCATTCGTCTTTCGGATGGAGAGAGGACGGAAACGATACAGTTACATAGCATACCCGGTCTCTGTGCGTGTGACAGCCCTGACCCACACCCCCGGCATCCTCATCCCGGGGACCCTGCAGCCCGGCCGCCCCAGCAACCTGACCTGCTCTGTGCCCTGGGCCTGCGAGCGGGGGACGCCCCCCATCTTCTCCTGGGCGGGCGCCTCTGTGTCCCACCTGGACCCCGCGGTCACGAGCTCCCCCGTGCTCACCCTCACCCCGCGGCCCCAGGACCACGGCACCGCCCTCAGCTGTCAGGTGACTCTGCCCGCGGCCAGTGTGACCACGAGGACGACCGTGCAGCTCAACATCTCCTACGCTCCGCGGAACCTGACGGTAACGGTGGCCCCCGGAGCAGGCGCAGACTCCTGCACAGATCCCTCGGCCCCGCAAGGATGGGGCGACTCGCACGCAGCGGAATTGAACTCTCCAGGCCCCTCCTCGCCCCTCCGCTGGATCCGCCTCCACCCTTCTCTCTCTCTCTATTCCCCCAGTAGCTTCCATCCAAGTGCTGGTGGAGGGAGACACACACGCACGCACACGCACGCACGCACACACGCACTCAGAACGCAGCAGTCTGTCCCAGGAGTGACCGTGACTCCCAGGCTGCGCTGA

XM_004866773.1 Coding sequence

Klk8 kallikrein-related peptidase 8, transcript variant X1

Length: 798 bp    Location: 3763956..3768485   Strand: +
>XM_004866773.1
ATGCCCCGCCCCCGCCCCGGCCGTGCAGGCCTGATGTGGACGGTCCTGCTGCTGCTGCTGCTGCTGCTGCTGGCCTCTTGGCCAGGCCGAACCGAGGCGCAGGTGAGCAAGGTTCTGCAGGGCAGTGAGTGCGAGCCCCACTCACAGCCGTGGCAGACGGCCTTGTTCCAGGGCGAGCGGCTGCTCTGCGGGGGCGTCCTGGTGGGCACCAGGTGGGTCCTCTCTGCAGCCCACTGTAAAAAAACAAAGTACACAGTGCGCCTGGGAGATCACAGCCTGCAGAGTAAGGATGAACCAGAACAAGAAATTTCTGTGGCTCAGTCCATCCAGCACCCCTGCTACAACAGCAGCAACAGTGAAGACCGCAATCACGATCTGATGCTCATCCGACTGAGAAAGCAGGCGTCCCTAGGCCCCAAAGTGCAGCCCATTGACCTGGCGAAGCATTGTGCCAAAGTTGGCCAGAAGTGCACCATCTCAGGCTGGGGCACTGTCACCAGTCCCAGAGAGAACTTTCCTGACACCCTCAACTGCGCAGAGGTGGAGATCTTCTCCCTGAGGAAGTGTGAGGAGGCCTACCCAGGGCAGGTCACAGACGGCATGGTCTGTGCGGGCAACAGCAATGGGGCCGACACCTGCCAGGGCGATTCCGGAGGCCCACTGGTATGTGACGGCGTTCTCCAGGGCATCACATCCTGGGGCTCAGACCCCTGCGGGAGGCCCAAGAAACCCGGTGTCTATACCAGCATCTGCCACTACCGCAAATGGATCAAGAAGACCATGGGCAACAGGGGCTGA

XM_004866779.1 Coding sequence

Klk6 kallikrein-related peptidase 6, transcript variant X2

Length: 897 bp    Location: 3785877..3793074   Strand: +
>XM_004866779.1
ATGCAGGCTTCCCGCTTGGCGTCTCTCCTCTCCCCCTGCTCTCCTGGTGGCTGCCTGCACTGCTCACTCTCTGCTCCCCACCTGCCTTCCTCGGGGCTCTCCCTCACCCCATCCAAGAATCCTGTGACCAGCAGGCAGCTGCCACCAGCAGGAATGGCCATGAAGATGCTGACCGTGGCCCTGGTTCTCCTGGCTGGAGCCTTCGCAGAGGAGCAGGAGAAACTGGTGCACGGAGGGCCCTGCCACAGGGACTCTCACCCCTACCAAGCTGCTCTCTACAACTCGGGCCACCTGCTCTGCGGCGGGGTCCTCATCGACCCGGAGTGGGTTCTCACGGCTGCCCACTGCAAAAAAGAGAAGCTTCATGTCTACCTAGGGAAGCACAACCTTCGACAGTCGAAGAATACAGAGGACATTTCTGTGATCAAGACTGTGGTCCACCCTGGCTACAATCCTGCCACCCATGACCAGGACATCATGTTGTTGCGTCTGTCCAAACCTGCCAAGCTCTCCGACTGGATCCAGCCACTGCCTCTGGAGAGGGACTGTGGGGCCAGATCACCCCGCTGCCACATCCTGGGCTGGGGCAAGACAGAACAAGGTGTCTTTCCTGACACCATCCAGTGTGCCTATGTCCACATCGTGCCCCAGGAGAAGTGCGATCAGGCCTACCCCGGCCAGATCACCAGGAACATGGTGTGTGCTGGAGATCCGGAAGAAGGAAAGGATGCCTGCCAGGGTGACTCCGGGGGCCCACTGGTCTGTGGAGGCCGCCTCCGGGGCCTGGTGTCCTGGGGTAACGTCCCCTGCGGATCCAAGGAGAAGCCAGGAGTCTACACTGACGTCTGCAGATACGTCAGCTGGATCCAAAGAACCATGCGAGGCCACTGGCCCTGA

XM_004866788.1 Coding sequence

Acpt acid phosphatase, testicular, transcript variant X2

High confidence: 4 potential gene matches
Length: 1278 bp    Location: 3902788..3896714   Strand: -
>XM_004866788.1
ATGGCCGGGCCGGGGTGTGGGGCCCGCAGCGCTGCTCCTCTCCTGCTCCTGCTGCTCCTGCCCCGGGCCCTGCCGGACGGACCCCTGCTGTTTGTGGCTCTGGTGTTCCGCCACGGCGACCGGGCCCCGCTGGCCTCCTACCCCACAGACCCGCACAAGGACGCCGCCCCCACCCTGTGGCCTCGAGGCCTGGGCCAGCTGACCGAGGAGGGGGTCCAACAGCAGCTGGAGCTGGGCCGCTTCCTGCGGAGGCGCTACAAGGCCTACCTGAGCCCGGAGTACCGGCGCGAGGAGGTGTACATCCGCAGCACCGACTTCGACCGCACACTGGAGAGCGCTCAGGCCATCCTGGCCGGGCTCTTCCCGGAGGCGTCCCCGAGGAGCTCCGAGGCCGACTGGAGGCCGATCCCGGTGCACACGGTGCCCGTGGCTGAGGACAAGCTGCTGAGGTTCCCCATGCGAAGCTGTCCCCGGTACCAGGAGCTGCTGCGGGAGTCCACGGAGGCGGCCGAGTACCAGGAAGCCCTGGAGGGCTGGACGGACTTCCTGAGTCGCCTGAGCAACTTCACAGGGCTGACGCTGGTGGGGGAGCCGCTCCGCAAGGCCTGGAAAGTTCTGGACACGCTGATCTGCCAGCGAGCCCACGGCCTTGCCCTCCCACCCTGGGCCTCCCCAGATGTCCTGAGGACACTCGGCCAGATCTCGGCTTTGGATATCAGGGCCCATGTGGGCCCGCCCCGGGCGGCAGAGAAGGCCCAGCTGACTGGGGGGATTCTGCTGGATGCCATCCTTGCCAACTTCTCCCGGGTCCAGAGCCTGGGGCTGCCCCTCAAGATGGTCATGTACTCTGCTCACGACAGCACCCTTCTGGCCTTGTACGGGGCCCTGGGCCTCTATGACGGGCACACCCCACCCTATGCTGCCTGCCTTGGCTTTGAGTTCCGGAGCTGCGCTGGGGACCCGGAGGAAGACGGAGCCGGAGGGAACATCACCGTCTCCCTCTTCTACCGCAACGACACCAACCGCCCGCCCCTGTCCCTCAGCGTCCCCGGGTGCCCAGCCCCCTGCCCGCTAGGGCGCTTCCGCCAGCTGACTGCTCCGGCCCGGCCTCCCGCCCGTGGGGCCGCCTGCCATGGCTCCCATAGGCCTGCCGCTGCCCCAGCCACCACAGTGCCCCTGCTGGCCGGAGCTGTGGCCGTGCTGGCGGTGCTGAGCCTGGGCCTGGGCCTCCTGGCCTGGAGACCCGGCTGCCTGCGAGCCCTGGGGGGTGCAGTGTGA

XM_004866787.1 Coding sequence

Acpt acid phosphatase, testicular, transcript variant X1

Length: 1356 bp    Location: 3902788..3896714   Strand: -
>XM_004866787.1
ATGGCCGGGCCGGGGTGTGGGGCCCGCAGCGCTGCTCCTCTCCTGCTCCTGCTGCTCCTGCCCCGGGCCCTGCCGGACGGACCCCTGCTGTTTGTGGCTCTGGTGTTCCGCCACGGCGACCGGGCCCCGCTGGCCTCCTACCCCACAGACCCGCACAAGGACGCCGCCCCCACCCTGTGGCCTCGAGGCCTGGGCCAGCTGACCGAGGAGGGGGTCCAACAGCAGCTGGAGCTGGGCCGCTTCCTGCGGAGGCGCTACAAGGCCTACCTGAGCCCGGAGTACCGGCGCGAGGAGGTGTACATCCGCAGCACCGACTTCGACCGCACACTGGAGAGCGCTCAGGCCATCCTGGCCGGGCTCTTCCCGGAGGCGTCCCCGAGGAGCTCCGAGGCCGACTGGAGGCCGATCCCGGTGCACACGGTGCCCGTGGCTGAGGACAAGCTGCTGAGGTTCCCCATGCGAAGCTGTCCCCGGTACCAGGAGCTGCTGCGGGAGTCCACGGAGGCGGCCGAGTACCAGGAAGCCCTGGAGGGCTGGACGGACTTCCTGAGTCGCCTGAGCAACTTCACAGGGCTGACGCTGGTGGGGGAGCCGCTCCGCAAGGCCTGGAAAGTTCTGGACACGCTGATCTGCCAGCGAGCCCACGGCCTTGCCCTCCCACCCTGGGCCTCCCCAGATGTCCTGAGGACACTCGGCCAGATCTCGGCTTTGGATATCAGGGCCCATGTGGGCCCGCCCCGGGCGGCAGAGAAGGCCCAGCTGACTGGGGGGATTCTGCTGGATGCCATCCTTGCCAACTTCTCCCGGGTCCAGAGCCTGGGGCTGCCCCTCAAGATGGTCATGTACTCTGCTCACGACAGCACCCTTCTGGCCTTGTACGGGGCCCTGGGCCTCTATGACGGGCACACCCCACCCTATGCTGCCTGCCTTGGCTTTGAGTTCCGGAGCTGCGCTGGGGACCCGGAGGAAGACGGAGCCGGAGGGAACATCACCGTCTCCCTCTTCTACCGCAACGACACCAACCGCCCGCCCCTGTCCCTCAGCGTCCCCGGGTGCCCAGCCCCCTGCCCGCTAGGGCGCTTCCGCCAGCTGACTGCTCCGGCCCGGCCTCCCGCCCGTGGGGCCGCCTGCCATGGCTCCCATAGGCCTGCCGCTGCCCCAGGTGACAGCCCTCTGCACTGGGGTGGGAACAAGGGGGCCCCCGGACCTGGGAGTCACGACCCCCGTGTTCTCACCGCAGCCACCACAGTGCCCCTGCTGGCCGGAGCTGTGGCCGTGCTGGCGGTGCTGAGCCTGGGCCTGGGCCTCCTGGCCTGGAGACCCGGCTGCCTGCGAGCCCTGGGGGGTGCAGTGTGA

XM_004867187.1 Coding sequence

LOC101700531 cuticle collagen 14-like

Length: 375 bp    Location: 3353385..3352478   Strand: -
>XM_004867187.1
ATGGGGCTGCGGGGCTCGGAGGGGTCAAGGGGTCCGCCAAGAGCGGGAGGGGGACCCAGATCTGGGGCAAGTCCAGCCCCTACCCCTTCCCCAAAGCGGGCCTGGACCGCGGGTTCCGCCCACGTCTGGTCCAGTGACCTGGAACGAGACCTGACCCGTGTCTCCGGGCCTCAGTTTCCCCCAGGAGAAACTGCCCGGGGTGGAGGCAGTGGGGAACAGGGATGCTCGGTCCGAGAATCTTCAAGATTCTCGCCTCCCGCTCCGCTCCCCCTCCCCCGGCCCCAGGCAGCCCCGGGGCATGCTGGGAACCCGGGCCGGGCTCCGGGCCAGGTTGGGGGGGCTCCTCCCTTCCCCTTCCTCCCCACCTTGGCCTGA

XM_004867099.1 Coding sequence

Calm3 calmodulin 3 (phosphorylase kinase, delta), transcript variant X1

Length: 654 bp    Location: 6962100..6957720   Strand: -
>XM_004867099.1
ATGACTAACTCTCTCCTTCCTGCTTTCCAGGCCGACCAGCTGACTGAGGAGCAGATCGCAGAGTTCAAGGAGGCCTTCTCCCTCTTCGACAAGGATGGAGACGGCACCATCACCACCAAGGAGTTGGGGACAGTGATGAGATCTCTGGGACAGAACCCCACTGAAGCAGAGCTGCAGGACATGATCAATGAGGTGGACGCAGACGGGAACGGGACCATTGACTTCCCGGAGTTTCTGACCATGATGGCCAGAAAGATGAAGGACACAGACAGCGAGGAGGAGATCCGAGAGGCGTTCCGAGTCTTTGACAAGGACGGGAACGGCTACATTAGTGCCGCAGAGCTGCGCCACGTAATGACGAACCTGGGGGAGAAGCTGACTGATGAGGAAGTGGATGAGATGATCAGAGAGGCTGACATCGACGGCGATGGCCAGGTCAATTATGAAGGTGAGCGGCACGGGCCCTGCCCCTGTTGCTGGGGAGGGCCGCTGGGTTCCGCCCTGCTCCTCACCAGCCTTCTCCGTCTCTGCAGAGTTTGTACAGATGATGACCGCGAAGTGAAGGCCCGGGCAGCTGGTGATGCCCGTTTTCCTGATCTCTCCTCTCGCGCGCTCTTCTCTCTTCAACACTCCCCTGCATACCCCGGGTTCTAG

XM_004867101.1 Coding sequence

Calm3 calmodulin 3 (phosphorylase kinase, delta), transcript variant X3

Length: 477 bp    Location: 6962100..6959135   Strand: -
>XM_004867101.1
ATGACTAACTCTCTCCTTCCTGCTTTCCAGGCCGACCAGCTGACTGAGGAGCAGATCGCAGAGTTCAAGGAGGCCTTCTCCCTCTTCGACAAGGATGGAGACGGCACCATCACCACCAAGGAGTTGGGGACAGTGATGAGATCTCTGGGACAGAACCCCACTGAAGCAGAGCTGCAGGACATGATCAATGAGGTGGACGCAGACGGGAACGGGACCATTGACTTCCCGGAGTTTCTGACCATGATGGCCAGAAAGATGAAGGACACAGACAGCGAGGAGGAGATCCGAGAGGCGTTCCGAGTCTTTGACAAGGACGGGAACGGCTACATTAGTGCCGCAGAGCTGCGCCACGTAATGACGAACCTGGGGGAGAAGCTGACTGATGAGGAAGTGGATGAGATGATCAGAGAGGCTGACATCGACGGCGATGGCCAGGTCAATTATGAAGAGTTTGTACAGATGATGACCGCGAAGTGA

XM_004867094.1 Coding sequence

Gng8 guanine nucleotide binding protein (G protein), gamma 8, transcript variant X3

Length: 219 bp    Location: 6937329..6940735   Strand: +
>XM_004867094.1
ATGACCATGTCCAACAACATGGCCAAGATCGCCGAGGCCCGAAAGACGGTGGAACAGCTGAAGCTGGAAGTGAACATCGACCGCATGAAGGTGTCGCAGGCGGCGGCGGAGCTCCTGGCTTTCTGCGAGACGCACGCCAAAGACGACCCCCTGGTGACTCCGGTACCCGCCGCTGAGAATCCTTTCCGAGACAAGCGCCTCTTTTGCGTCCTCCTGTGA

XM_004867035.1 Coding sequence

LOC101704668 3-alpha-hydroxysteroid sulfotransferase-like, transcript variant X2

Length: 858 bp    Location: 5940845..5962035   Strand: +
>XM_004867035.1
ATGGCAGATGTCTATGGGTGGTTTGAAGGGATAGCATTCCCTCTAGCGTATTTCAACCTGGAAGTCTTAAGAGAAGCACGGGACACATTTGTGGTGAAGGATGAAGATATAATAATGGTGACTTATCCCAAATCAGGAACCCACTGGTTGATTGAGATTATCTGCCTGATTCATTCCAAGGGGGATCCCAAGTGGATCCAATCAGTACCTACATGGCAACGTTCACCCTGGATTGAGACTACACATGGATATGAATTATTGAAGGATAAAGAGGGCCCACACATTTTCACATCTCACCTGCCCATTCAACTCTTCCCCAAGTCCTTTTTCAATTCCAAGGCCAAGGTGATTTATGGCATTAGGAATCCCAGAGATGTTCTCGTGTCTGCTTATTTTTTCTTAAGAAAAATGAATATTACTAAAAAACCAGAGACACTGCAAGAACATATGGAATGGTTCCTCCAGGGAAGTGTGATATATGGATCATGGTTTGAGCATGTTCGTGGCTGGCTGTCCATGAGAGACAGGGAAAATGTCCTGGTGGTGAGTTATGAAGATCTGACAAAGGACCCAAGAAGCACTGTGGAGAAGATCTGTCAATTCTTGGGAAAGAAGTTAAAACCAGAAGAAATAGATTTAGTCCTCAAGTATAGCTCCTATCAATTCATGAAGGAAAACAAGATGTCCAATTTCAGCACAATTCCTGATGAATATTTAGATAAGGGTTTCTCATTTCAAAGAAAAGGAGTCGCTGGGGACTGGAAGAATCACTTCACTGTAGCCCAAGCTGAAGCATTTGATGAAATATATCAGAAGAAGATGGCAGGCTTTCCTCCAAAGCTGTTTCCATGGGAATAA

XM_004866982.1 Coding sequence

Fgf21 fibroblast growth factor 21

High confidence: 4 potential gene matches
Length: 633 bp    Location: 5166832..5165195   Strand: -
>XM_004866982.1
ATGGACTGGGCCAGGGCTGAGTCTGAGCGCCCAGGGCTGTGGGTCCCCGCGGTGCTGGCTGTTCTTCTACTGGGAGCCTGCCAGGCACACCCCATCCCTGACTCCAGCCCCCTCCTCCAGTTTGGGGGCCAGGTCCGGCAGCGGCACCTCTACACAGACGATGCCCAGGACACGGAGGTGCACCTGGAGATCAGGGCCGATGGCTCAGTGGGGGGCGCTGCCCACCGGAGCCCTGAAAGTCTCCTGGAGCTGAAAGCCTTGAAGCCAGGAGTCATTCAGATCTTGGGGGTCAGGACTTCCAGGTTCCTGTGCCAGAGGCCTGACGGGACCCTGTATGGATCGCTCCACTTTGACCCTGAGGCCTGCAGCTTCCGGGAGCTGCTTCTTGCAGATGGCTACAACATCTACCAGTCTGAAGCTTACGGCCTCCCACTGCGCATGCTCCCCAGTGACTCCGCATCCCGGGATCCAGTGCCCCCGGGACCAGCCCGTTTTCTGCCACTGCCAGGCCTGCACCCTCCACCTCTGGAGCCACCAGGAATGCTACCCCCCGAACCCCCGGACGTGGGCTCCTCAGACCCTTTGAGCATGGTGGGGCCTTTACAGGGCCGCAGCCCCAGCTATGCTTTCTGA

XM_004867226.1 Coding sequence

LOC101720060 optic atrophy 3 protein homolog

Length: 564 bp    Location: 7612319..7617937   Strand: +
>XM_004867226.1
ATGGCGGGGGCTGACAGGAGCGCAGAAATCGAAGAAGGCCCCAGCAGACACTTCCGGGAGTCAGGCCCAGGCCCATCCTGGCTGAATTTTGCTGTTGCCCAGTGCTGCAACGGCGATTCGCCACGAGGGATCCCTGCTCCGTCCGGAGCGCGGTCACCCGGCCTGTACGCAGTGGGCTTGTACCACTGGGCGGAGATGAGGGCCAAAATGCACATCATGGGCTTCAGCGCCGAAGCCGTGAAGCCGCTCAACGAGGCGGCGGCCGCCGAGCTGGGCGCCGAGCTGCTGGGCGAAGCCATCATCTTCATCACCGCCTGCAGCTGCCTGATGCTGGAGTACTGGCGCCAGCAGTCGCACCAGCGCCGAAAGAAGGAGCAGCGGCGCCTGTCGTGGGACGCGCTGCAGGACGAGGTGGGCCAGCTGGCGCTGGAGCTCGAGGCGCTGAAGGCGCAGATGCGTGCGGCCGCCCCGCGGGCCGCGCTGGAGGAGCTGCGCGCCGAGCTGCGGGAGGTGCGCGTCCGGCTCTGCGACACCGACCCGCCGCCCGCGCCCCCGGGGGAGTAG

XM_004867219.1 Coding sequence

LOC101716593 translation initiation factor IF-2-like

Length: 648 bp    Location: 6469222..6461753   Strand: -
>XM_004867219.1
ATGAACACGCCAGAGGGGACGGCGAGGGCCGGCGGGCGGCTTCCTTTAGGAGGGCGCGCCCGCCGAGGGCCTCTAGCCGCGGCTGCTGCTGCTGAGGCTCCCGCTGCTGCCGCTCTAACTGCAGTGGCGGCTGCTGTCGCTGCTGCTGCTCCGGCTGCTGGCGCCTCCGCGTCGTGCCAATCGCCCCACTGCCGCCGCTGCCAGGCGCCCGCTCGCATGTGGTTCGCGCCGCGTCTCAGGCCGCCCGGCGGATCCCGGGACGCTCGGCGGCCGCTCGCCCCGCCCCGCCCCACTCCGCCCCCGCCCGGCGGGTCCCACGCCCCGCCTCCGCGTGACGCCACGGTCCCGCCCGCCCGCCGGGGACAACCAGTGAGCGGTACCCGCCGCCGTTGCCAGGGGAAACTCGCCGCCCCGTTACCCAGCAACAAGGCTGGCCCAACCAGGCGCGAGGACCCCCAGGCCCCGCCCGCCGCTGCCCACCGCGTGCCCAATGCCAAGCGGGCAGAGCCGGCCCGGCTCCCGGAGACGGCGAGCCCGCTCATTGGCCGCCGCCGCGTCTGCCCGGATCTAGGGGAGCCTTCGGCGCGGGGGGCAGGGAGCCGGGCCCCGGGGAGCTGCCAGGCGCTCGGCCCAGGCCTGCTGGGGTGA

XM_004867220.1 Coding sequence

LOC101717637 insulin growth factor-like family member 2-like

Length: 441 bp    Location: 7206466..7207162   Strand: +
>XM_004867220.1
TTGCCGCCCACGGGAACCACTGTGCCGCTGTGCCAGGCCCACTTGAAATGTGGGGACCAGTTCTACCACCCCCTGCAACACTGCTGCCTGAACGGTGCCCTCGTCCTCGTAGCCCGCACCCAAGGGTGTGGCAGCTGCCGCTTCAGAGTCTGCTTTGAGCAGTGCTGTCCCCAGTGGCCTCTTGGCCTGAAGGAGCCCTTCCCGGTGACGCTGAGGCTCGAGAATTGCTCCTCACCCCGTCTCCAGATGACGGGCTTTGTCACAAGGCCAACTGATGAACCCCCAGGCCATGGCACTGGAGGACTCCCGGATTCTGCCACCTGGATGAGCATGGAGAGTCAGCCTTGGACCCCTAAGAGGCGAGATGTGGAGTGGAGTGAGATGCAGTGTGGCTTTCCTGCTGAGTCCCCTGTGTCCCTAGCCCGCCTCTGCCCTGAGTGA

XM_004867221.1 Coding sequence

Nanos2 nanos homolog 2 (Drosophila)

High confidence: 4 potential gene matches
Length: 402 bp    Location: 7309389..7309790   Strand: +
>XM_004867221.1
ATGGACCTGCCATCGTTCGACATGTGGAGGGACTACTTCAACCTCAGCAAGGTGGTGCTGGCGCTGATCCAGAGCCGGAGCCAAAGGCTGGAGGTTGAGGAGACTGAGGAGACCGAGGGGCCCAGATCTAGGTCCCTGCTGGAGCGCGGTCTGGAGCCGGGGGCCACCTTATGCAACTTCTGCAAGCACAACGGGGAGTCCCGCCATGTCTACGCCTCACACCAGCTGAAGACCCCGGAGGGTGTGGTGCTGTGTCCCATCCTGAGGCACTATGTGTGTCCCCTGTGCGGGGCCACTGGTGGCCAGGCCCACACGCTCAAGTACTGCCCACTCAACGGCAACCAGCAATCCCTCTACCGCCGCAGTGGACGCAACTCGGCTGGCCGTAAGGTCAAGCACTGA

XM_004867216.1 Coding sequence

LOC101715204 cone-rod homeobox protein-like

Length: 465 bp    Location: 6123977..6124765   Strand: +
>XM_004867216.1
ATGGCCAAGATTTATAGCAAGGAGCAGCGTCAGGCGCTGGAAGCACATTTCAGGATGGACAGGTACCCCTCTGCCGAGGCTCAGAAGGCCCTGGCTGCCAGACTCAACCTAAAGGACTCCCACGTGAAGGTGTGGTTCTTGAGGCGCCGGGCTGCCTCTCTTCCACCAAAGCCTGCATCAAGGGTGCAGCGTCTACAGGGTCTGCGCCCTCTGCAGGGGCCCGCCGTGTGCACCCACTTCCTCCTCTGCTCCGGGCCCCACGCCTGCCCAGCTCCTGCCCCACACGAGCGGCCTGGGCCTGGGCTTGAGGGTGAGGGTACCCCTGGGCCTCCAGCCCCTGCCCCGGATGCCCAGGACACCTTCAGGATGCTCTCTGTCTCTACCGGGACCCCTGAATTCCTGGAGGGGGCGACCCCTGAGGACCAGGAGAAGGCAGGCTCAGCCAGACTGGGCTCCACCTCGTGA

XM_004867212.1 Coding sequence

Cabp5 calcium binding protein 5

High confidence: 4 potential gene matches
Length: 630 bp    Location: 5759466..5768361   Strand: +
>XM_004867212.1
ATGCAGTTTCCTATGGGCCCACCCTGCATCTTCTTGAGGAAAGGCATCGCTGAGAAACAGCGGGAGAGACCCCTGGGACAAGATGAGATTGAAGAGCTCCGAGAAGCATTTCTTGAGTTTGACAAGGACCGAGATGGGTTCTTCTCTTTTAAGGATCTGGGGAGTCTCATGAGAACAATGGGTTACGTGCCAACAGAGATGGAACTGACTGAACTGGGCCAACAAGTCTGCATGAACTTGGGTGGCCATGTAGACTTTGAGGACTTTGTGGAGCTGATGACCCCCAAATCCCTTGCAGAAACAGCTGGGATGATTGGTGTCCAGGAGATGCGAGATGCCTTCAAGGAGTTTGATGCAAACGGGGATGGGGAGATCACTCTGGGGGAGCTGCAGCAGGCCATGCAGAGGCTTCTGGGAGAGAAGCTCACAACCCAGGAGATTGCTGAGGTGGTGCAGGAGGCCGACATTAACAGAGATGGCACTGTTGACTTTGAAGAGTTTGTGAAAATGATGTCTCGTCGAGGAGGTCCTAGAAGCTCCAGATACTCTCTGCCTGGGAACATGGATGAAATGCGTGTGGAGGACCGAATCTCTGTGACCCCTTGCATGACAGTGGGTGGGAGGGTGTAG

XM_004867213.1 Coding sequence

Elspbp1 epididymal sperm binding protein 1

Length: 660 bp    Location: 5784340..5771009   Strand: -
>XM_004867213.1
ATGAAGGAAAAACCATTGACAACAACGGTGATAATGGTGATGTTTATGACAATTGATGAAGTGAAAGAGGACTGTGTCTTTCCTTTTACCTACAAGGGGTCCGTTTACTTCTCTTGCACCAAAATCAACAGCTTCCTCCCTTGGTGTTCAACCACAGCATTTTATGGTGGCAGGTGAAAATACTGTATGATGGAAGATTACCCACGATGTGTCTTCCCCTTCATCTTTTGTGGAAGGACCTATAACAGCTGCAACTCAGACGGCAGCTTCACAGGAAAGATGTGGTGCTCAGTCACGTCCAGCTTTGATGAGAAGCAGCAGTGGAAGTATCATGAGATGAATGAGTACGGGGGAAATTCTTTCAGCAAGCCCTGCATCTTCCCATCCAAGTATAGAAATAAGGGGATCTCCGAATGCCTTGAGGATGAAAGCAACAAGCTCTGGTGTCCAACCACAGAGAACATGGATAAAGATGGAAAGTGGAGCTTCTGTGCAGACACCAGAATTTCCTCAACAGCTCCTGGTTTTCCCTGCCACTTCCCATTCAACTACAAAAACAAGAATTATTTTAACTGCACCACCAAAGGATCAAAAGACAACCTTATGTGGTGTGCAACTTCTTACAACTATGACCAGGATCATACCTGGGTAGACTGCTGA

XM_004867214.1 Coding sequence

Bsph1 binder of sperm protein homolog 1

Length: 516 bp    Location: 5823293..5836426   Strand: +
>XM_004867214.1
ATGCCGACAGTGTATAAGGAAGTCATGAACCCCCTGAGCTCCGTGCAAAGAGCTCATGTGGCACGGCCATTGGAGGTGATGAGATATCTGGTGGGCTGGGTGGCGCTGGCCATCTGTATGTGTGGGCTCAATGCAGAACACATCAAGCACACCGAGCCCTTGAGCAGCGGTGGTGGGTTGGAATGTCTTTACTTGATTGCCCATTTACACCATCGGATTCCAGGTTTTCCAATACGATCCTGCGTCTTTCCATTTACCTATGGTGATGTACTCTACTACAATTGCATCTCCGTTCACAGTGACTTTGCCTGGTGTTCTTTTGACAGGAACTTCCAAGGCAGGTGGTGGTACTGCACTGCGATGGATCCTCCAAACTGTACCTTTCCATTCTACTTCAGAGGAGAAGTATTTCACAAATGCACCAAGAAAGGCTATGTTTTGAATCGCAGTTCGTGTTCATTGACAGCTGATTACAACAAAGATAAAAAATGGAAGCAGTGTTCTCCTCAGAAGTAA

XM_004867207.1 Coding sequence

Grin2d glutamate receptor, ionotropic, N-methyl D-aspartate 2D

Length: 3549 bp    Location: 5392973..5361074   Strand: -
>XM_004867207.1
ATGCGCCGCGCCGGGTGGCCCCGCGGCCCTCGGGGCCCCGCTAGGATGCTGCTGCTGCTCGCGTTGGCCTGCGCCAGCCCCTTCCCGGAGGAGGCACCGGGGCTGGGCGGGGGCCCCGGGCCGGGCGGGGGCGCGGGCGGGGCGCGGCCGCTCAACGTGGCGCTCGTGTTCTCGGGGCCCGCGTACGCGGCTGAGGCGGCGCGCCTGGGCCCGGCGGTGGCGGCGGCCGTGCGCAGTCCGGGCCTGGACGTGCGGCCGGTGGCGCTGGTGCTCAACGGCTCGGACCCACGCAGCCTCGTGCTGCAGCTCTGCGACCTGCTGTCGGGGCTGCGCGTGCACGGCGTCGTCTTCGAGGATGACTCACGCGCGCCCGCCGTCGCGCCCATCCTCGACTTCCTCTCGGCCCAGACCTCGCTCCCCATCGTGGCCGTGCACGGCGGAGCTGCGCTCGTGCTCACGCCCAAGGAGAAGGGCTCCACTTTCCTGCAGCTGGGCTCCTCCACGGAGCAGCAGCTTCAGGTCATCTTCGAGGTGCTGGAGGAGTACGACTGGACGTCCTTCGTGGCGGTGACTACGCGTGCCCCCGGCCACCGCGCCTTCCTGTCCTACATCGAGGTGCTGACCGACGGCAGCCTGGTGGGCTGGGAGCACCGCGGGGCGCTGACGCTGGACCCTGGCGCAGGCGAGGCGGTGCTGAGCGCGCAGCTCCGCAGCGTCAGCGCGCAGATCCGTCTGCTCTTCTGCGCGCGCGAGGAGGCTGAGCCTGTGTTCCGGGCCGCCGAGGAGGCAGGCCTCACCGGGGCCGGCTACGTGTGGTTCATGGTGGGACCCCAGCTGGCCGGAGGCGGGGGCTCAGGGGCCCCCGGGGAGCCCCTTCTTCTGCCAGGAGGCGCCCCACTGCCCGCAGGGCTGTTTGCAGTGCGCTCGGCGGGCTGGCGGGACGACTTGGCCCGGCGGGTGGCAGCTGGGGTGGCTGTGGTGGCCAGAGGTGCCCAGGCCCTGCTGCGGGACTACGGCTTCCTGCCCGAGCTGGGCCACGACTGCCGCGCCCAGAACCGCACCCACCGCGGGGAGAGTCTGCATCGGTACTTCATGAACATCACCTGGGATAACCGGGACTACTCCTTCAATGAGGAAGGCTTCCTGGTGAACCCCTCCCTGGTGGTCATTTCCCTCACCAGAGACAGGACTTGGGAGGTGGTGGGCAGCTGGGAGCAGCAGACTCTCCGCCTCAAGTACCCGCTGTGGTCCCGCTATGGCCGCTTCCTGCAGCCGGTGGACGACACGCAGCATCTCACGGTGGCCACGCTGGAAGAGAGACCCTTTGTCATCGTGGAGCCTGCTGACCCCATCAGCGGCACCTGCATCCGAGACTCCGTCCCCTGCCGGAGCCAGCTCAACCGCACGCACAGCCCTCCACCGGACGCCCCCCGCCCGGAAAAGCGGTGCTGCAAGGGCTTCTGCATTGACATTCTGAAGAGACTGGCGCACACCATCGGCTTCAGCTACGACCTCTACCTGGTCACCAATGGCAAACACGGGAAGAAGATCGACGGCGTTTGGAACGGCATGATTGGGGAGGTGTTCTACCAGCGCGCAGACATGGCCATCGGCTCCCTCACCATCAACGAGGAGCGATCTGAGATCGTGGACTTCTCTGTGCCCTTCGTGGAGACAGGCATCAGCGTCATGGTGGCCCGCAGCAATGGCACTGTGTCCCCATCTGCCTTCCTCGAGCCCTACAGCCCGGCTGTGTGGGTAATGATGTTTGTCATGTGCCTCACCGTGGTCGCCGTCACCGTTTTCATCTTCGAGTACCTCAGTCCCGTGGGTTACAACCGCAGCCTGGCCACGGGCAAGCGCCCTGGTGGCTCAACATTCACCATTGGGAAATCCATCTGGCTGCTCTGGGCCCTGGTGTTCAATAACTCGGTGCCTGTGGAGAACCCCCGGGGAACCACCAGCAAAATCATGGTGCTGGTGTGGGCCTTCTTCGCCGTCATCTTCCTCGCCAGCTACACAGCTAACCTGGCCGCCTTCATGATCCAGGAGGAGTATGTGGACACCGTGTCTGGGCTCAGTGACCGCAAGTTCCAGCGGCCCCAGGAGCAATACCCACCCCTGAAGTTTGGGACGGTGCCCAACGGGTCCACGGAGAAGAACATCCGCAGCAACTACCCCGACATGCACAGCTACATGGTGCGCTACCACCAGCCCCGTGTGGAGGAGGCCCTCACACAGCTCAAGGCAGGGAAGCTGGACGCCTTCATCTATGACGCTGCCGTGCTCAACTACATGGCACGCAAGGACGAGGGCTGCAAGCTGGTCACCATCGGCTCTGGCAAGGTCTTCGCCACCACTGGCTATGGCATCGCCCTCCACAAAGGCTCCCGCTGGAAGCGGCCCATCGACCTGGCACTGCTGCAGTTCCTGGGGGACGATGAGATCGAGATGCTGGAGCGGCTGTGGCTCTCCGGGATCTGCCACAACGACAAGATCGAGGTGATGAGCAGCAAGCTGGACATCGACAACATGGCCGGGGTCTTCTACATGCTGCTGGTGGCCATGGGCCTCTCCCTATTGGTCTTCGCCTGGGAGCACCTGGTGTACTGGCGCCTGCGGCACTGCCTGGGGCCTACGCACCGCATGGACTTCCTGCTGGCCTTTTCCAGAGGCATGTACAGCTGCTGCAGCGCTGAGACCGCCCCGCCGCCTGCCAAGCCGCCGCCGCCACCGCAGCCTTTGCCCAGCCCTGCCTACCCCGCGGCGCGCCCCGCACCAGGCCCGGCGCCCTTCATGCCCCGCGAGCGCGCCGCCGTGGACCGCTGGCGCCGGGCCAAGGGCGCGGGGCCGCCGGGGGGCGCGAGCTTGGCCGACGGCTTCCACCGCTACTATGGCCCCATAGAGCCGCAGGGCCTGGGTCTGGGCGAGGCGAGGGGGGCGTCCCGGGGCGCGGCCGGGCGCCCGCTGTCCCCGCCGGCCGCGCAGGCCCCGCAGAAGCCCCCGCCCTCCTACTTCGCCATCGTCCGCGACAAGGAGCCGGCCGAGCCCGCTGCGGGCTCCTTCCCCGGCTTCCCGTCGCCGCCCGCGCCCCCAGCCGCCGCCGTCGTCGGGCCGCCGCTGTGCCGCCTGGCCTTCGAGGACGAGAGCCCGCCGGCGCGGTGGCCGCGCGCGGACCCCGAAAGCCAGCCGCTGCTAGGCCCGGGCGCGGGCGGCGCGGGGGGCGCAGGGGGCGCCTCGATGTGCCCCCGCGCCTCGCACCGCGCACCCGCCGCCGCGCCCCACCACCACCGACACCGACGCGCCGCCGGGGCCTGGGACCTCCCGCCGCCCGCGCCCACCTCGCGCTCGCTGGAGGACCTCAGCTCGTGTCCCCGCGCCGCGCCCGCACGCAGGCTCACCGGGCCCTCGCGCCACGCTCGCCGGTGCCCACATGCCGCGCACTGGGGACCGCCGCTGCCCACTGCGCCCCACCGGAGACACCGGGGCGGGGAGCTGGGCACGCGCAGGGGCTCGGCGCACTTCTCTAGCCTCGAGTCCGAGGTATGA

XM_004867208.1 Coding sequence

LOC101712017 vomeronasal type-1 receptor 4-like

Length: 918 bp    Location: 5537704..5542419   Strand: +
>XM_004867208.1
ATGGCTGCAAGAACGATTTGTATTGGTGTTATGATGAACTCATCACTGTTTGCGATATTTATGTATACTTTTTTAACTCAGCCTAATCTTATGAAGCCCGTAGATTTCATTATGATCCATCTGACAGTGGTCAATACTTTGAATATCATCTTCACATTAATTCCACATATCATGGCATTATTTGGAGTAAGATATTTTTTGGATGACATTGGTTGTAAGGTAATTTCGTACACATACAGAATTACTCGGGGTGTTTCCATCTCAACTACCTCTCATCTGAGTGCATTTCAAGCCATCACTATCAGCCCTATGAATTCTATGTGGGTCTGGTTTAAGTCTAAACTTTCTTCATGGATTTTCCCCTCTTTCTTTGTCTTCTGGATTATCAACATGCTCATTTATATACACATCATTGAAACTGTAAGAGCCAATGGCAATTTCACTATTGTTGATCATAAATATTTTCATGCATACTGTCAAACTAGGCCATCTGAAAGCCACACTTCAGGACTATTTTCCAGCATCATGTTGATGGATGATCTCTTGTTTTTGGTCCTCATGATCTGGGCCAGCCTCTACATGGTGAGTCTCCTCTACAGACACCAGAGGAGAGCCCAGCATGTCCACAGACACAGCCTCTCTTCCCAGCCATCTCCTGAAATAAAAGTCACCCACAGTATCCTTTTAGTGGTAAGCCTCTTTGTGTTCTTCTATTGCTTGAAAAATTATTTTACTTATTATTCCTTTTATGGGCAGAAAAAGTTCCCAGGGTCTTTGGGCATTGGTGAAATGTTATCAGTGTGCTACCCAATCATCTGCCCTTTTATGATCATGAAGAATAAAAAAATTATTTCCTACTTCATTTCTTCCCTTTCAGGTACAAGAATTGTCTGTCCTAAAAGAGTACATAGTGGCTGA

XM_004867190.1 Coding sequence

Siglec10 sialic acid binding Ig-like lectin 10

Length: 2208 bp    Location: 3473595..3479483   Strand: +
>XM_004867190.1
ATGCCTGAGTCCCCAGGGCCCAGCTTCCGGCTCAGCTTCCCCTTCTGTTCGGCTACAATCAGCTACAGCACAAGTGCAGAACGAGCTCATCTGGGGCAGGTCCAGGTGATGCCTAGGACCATGCTGCTCCTGCTGTCCCTGCTGCTGGGCGGGTCCTGGGCTCAGCAGCCAGAATACCGGCTGGAAGTGGAGAAGTGGGTGTCAGTGCAGGAGGGCCTGTGCATCCTCGTGCCCTGCTCCTTCTCCTACCCCGGGGACACCTGGAACTCTGACCAAGTTTACGGCTACTGGTTCAAAGAAGGGACTGAAGTGGACAAGGGAAATCCAGTGGCCACGAACAACCCAAACAGAAACGTGCAATGGCGCACCCAGGGCCGATTCGAGCTCGTGGGAAATCCCCTGGAGAAGAGCTGTACCCTTCTGATCAGAGACGCGTGGTGGGACGACCAGGGGAAGTACTTCTTCCGAGTGGAGAAAGGAAGAAAGGTGAAATACAGCTTCAAGGACAAGATGTTCTGGCTAGAAGTGACAGACCTGACTCAGAAGCCGGATATCTTCATTCCTGAGACCCTGGAGCCCGGGCAGCCCGTGACTGCACTCTGCGTGTTTAACTGGAACTCCGAGCAATGCCCAGCTCCGGCCATCTCCTGGGCAGGACCCGCCCTGGCCTCAGGAGGCACCAGACCACCAGGCGCCCCCTACTTCATGCTCAGCCTCACCCCAAGACTGCAGGACCAGGATGCCGAGCTCACCTGTCGAGTGGACTTCTCCAGGGGCGGCCGGAGCACTCAGAGGACGGTCAGACTGAGCATAGCCTATGCCCCCGAACACCCTGTGATCAGCATTTCCCATGACAACGGGTCAGCCCCGGACACCCAGGGAAATGGCTCCTACCTGGAGGCCCAGAAAGGCCAGTTCCTGAGGCTCCTCTGTGCTGCTGACAGCCGGCCCCCCGCCACGCTGACCTGGGACCTGGAGGGCAGAGTCCTTGCTCAGTCCCCTCCCTCAGGACCCAGACCCCTAGGGCTAGAGCTGCCCGGGGTGAAGCCTGGGGACGCGGGGCGCTACACCTGCCGGGCAGAGAACAGGCTGGGCTCCCAGCACAGCACCCTGGAGCTCTCAGTGCAGTATCCTCCAGAGGACCTGAGAGTGACGGTTTCCCAAGCAAACAGGACAGTCCTGGAAATCCTCGGGAACGGCTCATCCCTGCCCGTCCTGGAGGGCCAGAGCCTGCGCCTGGTGTGTGTCACCCACAGCAGCCCCCCAGCCAGGCTGAGCTGGGCCCGGGGGACACAGCCCCTGAGCCCCTCCTGGCCCTCAGCCCCTGGGGTCCTGGAGCTGCCCCGGGTGCAGATGGAGCATGAAGGGGAAGTCAGCTGCCATGCGGAGAACCCGCTGGGCACCCGGAGTGTCTCTCTCAGCCTCTCTGTGCACTATGCCCCCCAGCTGCTGGGCCCCTGGTGCTCCTGGGAGGCCAAGGGTCTGGGGTGCAGCTGCTCCTACCGTGCCCGGCCTGTCCCGTCCCTGTGCTGGCGGCTCGGGGAGGCGCTGCTGGAGGGGAACAGCAGCAATGCCTCCCTCACGGTCACCTCCAGCTGGGCCGGGCCCTGGGCCAACAGCTCCCTGAGCTTCCCCGGGGGACTGAGCTCTGGGGATAGGCTCAGCTGCGAGGCAGGGAATGTGCACGGAGTCCAGAGGGCCACTGTCCTGCTGCTACTGGACAGGGCGCCCGTCTCCGCCGCGTTATCCAAGGGAGTGCTCCTGGGAATCGGTGGCACAGCGCTCCTTTCCCTCTGTCTCCTTCTCATCCTTGTGAAGGCGCTGAGGACCAGGTGGGCCCAGACGGAGACCCCGAAACCCAAGTTCTCCCGCAGCAGCACCATCCTGGAGTACATCAACGTGATCCCTAACGCCAGGCCCCTGGGTCGGAGTCGGAAGACCAAGCCAAGCAGCACTTCCCAGATCCCGTCTCCAGAAACCCACTCCCCAGCACGGAAGAAGAACCAAAAGGACCAGCGCTTGGCTTCCCTTGGCTGTCCAGAGCCCAAGACATCCACCAGCACCAAAGACTCTGAGATCAGCCCCGGGGGGCTCCACTATGCTACTATCACCTTCCCAGGCCTCCGGCCACAGGAGAACCAGCAGCCCACGGTCACCCATGAAGACTACACAGAAATCAAGTTCTACCGAGGGTCTCCTGGGCTTTAG

XM_004921188.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 432 bp    Location: 4964971..4965508   Strand: +
>XM_004921188.1
ATGGGAATAAAGGTTGGGTTTTAAGGGAAGGGCGGCTCCCGGAAAGACATGCTTTGGTTTGAAGGTGGGNTAAGTGCCTGATGGGTGAGTGCACCTTGTTCTGCACCCCTGCGCCCGACTCGGTAACTGCACGCGGCACCCCCACCCCCGACTCCCACGTAGACGGTCGTGCGGCCTGCGGGCNTCCCCCGGCGGACGAGGCTAATGGTTTGCTCCGCCCCGCCCACACAGAGGCCGCCCACTGGCTGCTGTCACGGCTCAGGACTCCTCGGTCAGACCAAATGCAGAGGAAGGGCCGAGCCCGGCCCTCGGACTCTCACCAGGGGAGAGGAGAGGGTGCTGCCTCTGCTCTCTGACTTTGAAAAAGGCGTCAGGGCTTGGTCGACCTCAGCTCCCCCAAGCCCGCCCGCCCCGCACCTCAAGATGCTCTAA

XM_004867203.1 Coding sequence

LOC101709134 neurotrophin-4-like

Length: 816 bp    Location: 5005670..5008695   Strand: +
>XM_004867203.1
ATGCGGCGCCCGGGCGAACGGGTGGCTGCCCCCTCCCTCTCCTGGGATGTCGGGAAGGAGGGGACCACCCGTGTCCTCTACAGGGGCCCTGCCAAGCTGGGGGGCCCCCAGCCCTGGCCCTCGGAGGTGCTGACAGCCCCCCTTTCCATTCGCAGGTGCTCAGAGATGCGCCCCGGCACCTGCTGCTCCCTCCCCATCCTCCTCCTCTCCCTCTTCCCCAGCGCCCCCGTGGAGTGCCACCCCTCACCCTCCACACTGCCCCCATTTCCGGCCCCCGAGTGGGACCTCCTGTCCCCCCGAGTAGCGCTGTCCAGGGGCGCCCCTGCTGGGCCCCCTCTGCTCTTCCTGCTGGAGGCCGGGGCCTTCGGGGAGCCAGCGGGCGCCCGGGCGAATCGCAGTCGGCGTGGGGTGAGCGAGACGGCCCCCGCCAGTCGCCGGGGTGAGCTGGCAGTGTGCGACGCGGTGAGCGGCTGGGTGACGGACCGGAGGACGGCGGTGGACTTGCGGGGGCGCGAGGTGGAGGTGCTGGGCGAGGTGCCCGGGGCGGGCGGCAGCCCCCTCCGCCAGTACTTCTTCGAGACTCGCTGCAAAGCCGACGGCGCGGGCGCGGGAGCGGGTGCAGGCGAGGGCGGGCCCGGGGCCGGCGGAGGGGGCTGCCGCGGCGTGGACCGGAAGCACTGGGTGTCGGAGTGTAAGGCCAAGCAGTCCTACGTGCGGGCGCTGACCGCCGACGCCCAGGGCCGTGTGGGCTGGCGATGGATTCGAATTGACACTGCCTGCGTCTGCACGCTCCTCAGCCGGACCGGCCGGGCCTGA

XM_004867196.1 Coding sequence

Klk13 kallikrein-related peptidase 13

High confidence: 4 potential gene matches
Length: 837 bp    Location: 3712425..3720830   Strand: +
>XM_004867196.1
ATGTGGCCCCTGGCCGCTGCCGTCGCCTGCCTGACCCTGGCCCTGTCAGGAGGCATCTCCCAGGAGTATCCTAAGATTCTGAATGGCACCAATGGGACCAGTGGGTTTCTACCTGGTGGCTACACCTGCCTGCCCCACTCCCAGCCCTGGCAGGCAGCCCTGCTGGTGAGAAGGCGGCTCCTCTGTGGGGGAGTCCTGGTCCACCCGAAGTGGGTCCTCACTGCTGCACACTGCATGAAAGCCGGGTACACAGTTCACCTAGGCAAGCACGTCCTGGGGCGCGTGGAGACCCGCGAGCAGGTGAGGGAGGTGGCCCGCTCTGTCCCCCACCCCGAATACCAGGTCAGCCCCACCCACCTGAACCACGACAACGACATCATGCTTCTGGAGCTGGCGAGCCCGGTCCAGCTGACAGGCCACATCCGCACCCTGCCCCTTTCCCGCAGTGACTGCCTGCCCCCCGGGACCTGCTGTCGGGTGTCGGGCTGGGGCACCACCACCAGCCCCCAGGTGAGTTACCCCAAAACCCTGCAGTGTGCGAACATCCCACTACGCTCAGACGAGGAGTGCCGTCGGGTCTACCCGGGGAAGATCACTGCTAACATGCTGTGTGCTGGCTCCAAAGAGGGGGGAAAAGACTCCTGCGAGGGTGACTCCGGGGGCCCCCTGGTATGCAATGGCACACTCCATGGCATCATCTCCTGGGGAGACTTCCCATGTGGACAGCCCAACCGACCTGGCGTCTACACTCGAGTCTCCAAATATGTCTCGTGGATCCATGAAACAATCAAAAAACACAAAACCCAGGAGCAGAAATGGACAAAGGGCGCACAATAA

XM_004867198.1 Coding sequence

Klk7 kallikrein-related peptidase 7

Length: 846 bp    Location: 3775249..3778432   Strand: +
>XM_004867198.1
ATGGTGGGATCCCATTTCCTGCCCCTGCTGTTTCTGCTGCTGGGCTCAGCCCTGGTAACTGCCGAATGGGATAGTGCAGACTCTCCTGGCATCCACACTGACAGTCACACTCACCAAGGAGCCCGTCAGCCTCACCAAGGAGACCGTGAGGGTGATGGGAACGGGGACAGGATTATTGAGGGCTACAAGTGCGAAAAAGGCTCACACCCTTGGCAAGTGGCCCTGCTCAAAGGCAGCCAGCTGCACTGCGGCGGCGTGCTGGTTGACAGGCGCTGGGTGCTCACGGCTGCCCACTGCAAGATGGGCCAGTACACTGTGCAGGTGGGGAGCAATGAGCTCGGAGACAGAAGAGCTCAGAGGATTAAGGCCACAAAATCATTCCGCCACCCGAGGTACTCCACGCAGACCCACGAGAATGACATCATGCTGGTGTGGCTCAATAAGCCAGCCAGGATGTCGTCCACTGTGAAGGCCGCCAACCTGCCCACCCGCTGCGAGCCTGCTGGGACCTCGTGTTCTGTCTCTGGCTGGGGCACTACAACCAGCCCTCAAGTGACCTTCCCAGCCCAGCTCATGTGCACAAATGTGAACCTCATCCCCCACAATGAGTGCAAGAAGGTGTACAAGGACCTGCTGGGACAATCCATGCTGTGCGCTGGCATCAAGGACTCCAAGACCAACACCTGCAACGGTGACTCAGGGGGACCACTGATGTGCAGAGGTACTGTGCAAGGCGTCGTGTCCTGGGGAACTTTCCCTTGTGGCAAACCCAACGACCCAGGTGTCTACACCCAACTCTGCAAGTACACCAACTGGGTGAAAAACACCATGAGAAGGCATTCCTAA

XM_004867199.1 Coding sequence

LOC101705888 kallikrein-1-like

Length: 768 bp    Location: 3843111..3841738   Strand: -
>XM_004867199.1
TCATTCTCCCTCTCCCTCTTCCGGGACCCCCTCTCCCCTGTGCCCCCATGTCCCTGTCTACTCCTCTGCCCTCATTGCCCCCACCCCGGTTACCCCAGCGACTACCAGGTCTGGCTGGGTCGCCACAGCCTGTTTGATGATGAAGACACAGCTCAGCACGTCACCGTCAGCCAGAGCTTCCCTCACCCACTGTTCAACATGAGCCTCCTGGAGCCGCATCCCAGCAACCCAGAGGACGACTACAGCCACGACCTGATGCTGCTCCGCCTGAAGGAGCCCGCGCGGATCACAGAGAGCGTGCAGGTCCTGGCGCTGCCCTCGGAACAACCCGAAACGGGGAGCACATGTGGTCTCAAGTGGGGCAGCACAGTACCAGGACCAAAAAAGGGTGTGTCGGGAACAGATCCTGCAGCCCGGGAGGATACCCAAGTCTGTGGTAGGAGGAGCCGAGGCCCTGCCTGGTGTGGACACAGCCCTGTCCTCCCTGGCCTGCTCCTGAGTTTCCAGACAGTCTCCTGTGGGGACTTCAAACTCCTGCCTAAGGGTGAATTGGACAAAGCTTTCATCAAGAAGGTGACCGAGGGCTGGGGATTTAGCTCAGTGATTTCGCCACCTGCTGCGCAAGCTGAAGGGGCCCTGCCTGCCTTCCGGGCGGGGCTCTGTAGTCCCCAAGTAGGAGAGCTGGGCATGCGGAATGAACCCCGGATTCTTCTCTTGGGGTCCTGGCTCCACCAATCAGCTGAGAGTACTTTTGCTCGACGCAGATAG

XM_004867191.1 Coding sequence

Vsig10l V-set and immunoglobulin domain containing 10 like

High confidence: 4 potential gene matches
Length: 2637 bp    Location: 3522041..3530023   Strand: +
>XM_004867191.1
ATGGACACCTTGCGGGCTCTGCCACTCTTCCTGCTCCTGGGGGTCTTTGCCACTCCTGGGCTTCAGCAAGCCAATTCCACCTCTGCCTCCTCCTCTTCCTCCTCGGGCTCCATCAGCTCCTCCTCCCACGGCCACACTTCAAAAGTGCCCCCCATCAACGGCCCCAGCCACCAGACTCCAGGGTCACCACCCTCTGCTGAAATTCCTGATTCCCAGCGGTTTCCCGAGACCCTGAATCCGAAGGATGTGCCTCAGTCCCTCTGGTCAAATGTTTCTGCTGACAGCCGGCAGTGGAGCTCAGAGCTCACCTTCTCTGAAATTCCTGGTTCTGAAGCATTTCCTGACACCTTGGATCCTCAACTTCCAGCCAAAGGCCCTGCTCCCTCCTCTGTTAAGACCCCAGCTTCAAACACTTCTGCTCAAGTCCCAGACACCAAAGTATCCACTGGGGGCCCGGGCTCAAAGCTCCCCACTAAAAACCTGGACCTTGAACTCTCTGGCCCGAACTCCGAATCCAAAGTTTCCTTGGTGACCCACCCAGCCGCAAGCTTCCCCCAGCAGGTCGGGGGCCCCCTGGCTGTGCTGGTGGGGACCACCATCCGGCTGCCCCTGGATCCAATGCCTTACCCCGGCCCCCCTGTCCCCCTGGTGGTCTGGCGCCGCGGCTCCAAGGTGCTGGCAGCTGGGGGCCTGGGGCCTGGGGCTCCCCTGATCAGCCTGGACCCTGCTCACCGAGCGCGCCTGCGATTCGACCAGGCCCGAGGGGGTCTGGAACTGGCCTCTGCCCAGCTGGCTGACGCGGGAGTCTACACGGTGGAGGTCATCCGGGGCGGGGTCTCTCGGCAAACCCGAGAGTTGCTGGTGGGCGTGTACGAGCCCCTGCCCCAGCTCTCGGTGCAGCCCCAGGCCCCTGAGACAGAGGAGGGGGCGGCCGAGCTGCGGCTGCGCTGCGTGGGGTGGAGGCCTGGCTGCGGGGAGCTCACCTGGAGCCGGGACGGACGCGCCCTGGGGGCCGGGAACCCCGAGGGAGCAGAGCCGCCCCGGATCCGCGCCGAGGGCGACCAGCTGCGCCTGGCGCGCCCCGTGCGCAGCGACCACGCTCGGTACACGTGCCGCGTGCGCAGCCCCTTCGGCCAGGCGGAGGCCGCCGCGGATCTCCGCGTCTTCTACGGGCCCGACCCTCCGGTCATCACGGTCGCCTCGGATCGCGACGCCGACCCCGCGCACTTTGTCACAGCGGGCAGCAACGTGACCTTGCGCTGCAGCGCCGCCTCACGGCCGCCCGCCGACATCGCGTGGAGCCTGGCGGACCCCGCCGAGGCCGCAGTGCCCGCGGGCCCGCGCCTCCTGCTGCCCGCCGTGGGACCTGGCCACGCCGGCGCGTACGCCTGCCTGGCTGCGAACCCGCGCACCGGCCGCCGCCGCCGCTCGGTACTGGACCTCACCGTGGCGGATCTGCCCCCCGGGTCCCCACAGTGCTCGGTGGAAGGGAGTCCCGGGGACCGCAGCCTCCGCTTCCGCTGCTCTTGGCCCGGCGGGGTTCCCGCCGCCTCCTTGCAGTTCCAGGGTCTCCCCCAAGGCGTCCGCGCGGGCCCTGCGCGCTCAGTGCTCCAGGCCACCGTCCCCGCCCACCCTCGGCTCGGCGGCGTTCCCGTCACCTGCCTCGCTCGCCACCTGGCTGCCACGCGCACCTGCACTGTCACCCCGGAGGCCCCCCGGGAGGTGCTGCTGCATCTGCTGGTGGAAGAGACGCGCTCAGGAGAGGCAGAGGTGGTCCTGCAGGCCTCTGGCTGTCACCAACCCTCCCGAGCTTTCTGGGCCCGGGAAGGCAGGCCCCTGGCTCCGGGAGGCGGGGGACGCCTGCGGCTCAGCGGGGATGGGTGCAGACTCCTCATTGGCAACTTCAGCCTGGACTGGGACCTGGGAAATTACTCCGTGCTGTGCAGCGGGGTGCTGGGTGCGGGGGGCGACCAGATCACCCTCATTGGCCCTTCCATTTCCTCCTGGAGGCTGCAGAGAGCCCGAGGCGCAGCAGTGCTGACTTGGGATGTGGAGCGCGGGGCCCTGATCAGTGGCTTTGAGATCCAGGCGCGCACAGAGGGGGCCGACCTCAGCAGGGCAACCGCTTACAGGAACTGGGTCTCCCTGCTAGTCCTGGGGCCGCAGGAGCGGTCAGCCGTGCTGTCTCTCCCTCCTGGGAGCCCCAGGACCTGGGCTTTGCGCATCCTGCCCCTGCTGGGGACTCATCCAGGGACTCCATCACAAATCCGACTCTACCAGGCAGGTCCCATCCTGGGCCCTGGGGCCATCATTGGCATTGTCCTGGGCTCTCTCCTGGGCATGGCCCTGCTGGTCACACTCATTCTCCTGTGTGTCTGCTGCCTGCTGCACTGTAGAGGAAAGTCTCCTAATTTGGAAAAGAAATATCCCCCGACCTCGGCGCCTGTGGTCTTCACCCCAGAAAAGGAGACGTGTGGTGTGACCCCAGTGCAGACCCCACAACTGCCGCCCTTCACATTTCTGCAGGAAGACCCCAGCCCAGCCAGGGCCCATCCAGCCGCCGGCCCCAAGACCCCCAAGACTGTCATCACTCCAGCTGGGGGCCCCAAAACTGTCCGAGCAGCCACGCAGGTGTGA

XM_004867192.1 Coding sequence

LOC101703008 sialic acid-binding Ig-like lectin 11-like

Length: 768 bp    Location: 3591578..3588017   Strand: -
>XM_004867192.1
ATGTCCCTACCTGTGCCTGGGTGGGACGCAGTGCAAGAGAAAAGACAGACCCACGTGACACAGGGACCAGAAAGGCAGAGAGCCCCATGCGAGCCTGGGCTCAGCCTTCCCTCTGTCTCTCCAGGACCTACAGCCCTGGCTGAGGGCTCATTATTCCGTGCTCAAGAGGGCCAGGCCCTGCGCTTGGTGTGTGTTGCAGACAGCAACCCCGCTGCCGAGCTGAGCTGGACCCGGGGCAGCCTGACCTTGCAGTCCTCACAGCAATCAGGCCATGGGGTTCTGCAGCTGCCTCAGGTGGAACTGGAGGATGATGGGAAATACGTGTGCAGCGCTCAGCACCGGCTGGGCTCTCAGATGGCCTCAGTGAGCCTCTTTGTGAAGAGCCCACCACAGCTGCTGGGCCCCTGGTGCTCCTGGGAGGCCGAGGGTCTGCGGTGCAGCTGGTCCTCCTGTGCCCAGCCTGTCCCGTCCCTGCGCTGGCGGCTCAGGGAGGGGATGCTGGAGGGGAACAGCAGCGACGCCTCCCTCATGGTCACCTCCAGCTGGGCCGGGCCCTGGGCCAACAGCTCCCTGCATCTCCTGCGGGGACTGAGCTCCAGCCTCAGGCTCAGCTGTGAGGCCTGGAATTCCCATGGGACACAGAGCATCACTGTTCTCCTGCTGCCAGAGAAACCTGGAGCCAAGATGGGAGCCGTTCAGGGAGCTGTTGGGGGAGCTGGTGTCATGGTCCTGCTCGCTGTCCGTCTCTGGCTCCTCTTCTTCATGTGA

XM_004867189.1 Coding sequence

LOC101701613 sialic acid-binding Ig-like lectin 13-like

Length: 879 bp    Location: 3462905..3465373   Strand: +
>XM_004867189.1
ATGCTGCCCTCTCTGCTGCTGCCCCTGCTGTGGGCAGGGTGTCTGGCTAATATTCCAGGATACCAGCTGACAGTGCCAGAGCCCGTGGTGGTGCAGGAGGGACAGAGCACCTTCATACCCTGCAGAGTCTCCTACCCCGGGAGATACTGGAGCAACTTTTCCCCAGCCTGGGGCTACTGGTTCAAGAAAGAGGCTAATTATGACCGGGATCCTCCAGTGGCCACAAATAACCCATCTCGTGAAGTGCAGAAAGAGACCCAGGGCCGATTCCACCTCCTTGGAGACCCCAGGACCTACAACTGCTCCCTGCGCATCAGAGATGCGCGCAACAAGGACACAGGAGTCTACTTCTTTAGGGTGGAGAGAGGCAGTGGCATGCAGTACAATTACAGACAGAACCAGCTCTGTGTGTTTGTGATGGAGACTCCTGACATCCACATCGCGGGGCCCCTGGAGTCTGGTCACCCTGGGAACATAACCTGTGCAGTGCCGTGGCCTTGTGAGCAGGGGACACCCCCCACTTTCTCCTGGATTGGGGTGAACCTCACTTCTACCCTGGGCCCCGAGACTCCCCGCTCTTCGGTGCTCACCATCAGCCCGGGACCTCATCACCATGGCACCAACCTCACCTGCCGAGTGACTTTCCCTGGAGCCAGTGTGGCAGTGGAGAGCACCGTCCAGCTCAGTGTGGCCTCTCCTGGGCAGCGCCACCACCCTACCTTGGATGCTGGGGTGCTGGAGCTGTCCCAGGTGGCTGCAGAGGATGGCGGAGATTTCACCTGCTGGGCTCCTGCCACGTCTCCCTGCGCCTGGCTGCCCAGGGTACTTCCTGTTCCTGCACCCAAATCTGTGGGGAACAGCAAGGGTGCTGGTCCCTAG

XM_004867183.1 Coding sequence

LOC101698727 vomeronasal type-1 receptor 1-like

Length: 897 bp    Location: 3182230..3183260   Strand: +
>XM_004867183.1
ATGAGAAAGACTCCTGGTGATTTTATCCTGAAATTACTTTTCCTGGCCCAGACTGGGGTCAGGGTGGTGGGGGATACCTTTCTTCTCTCAGCTTATGCCCCCACATCCTGTACTGGCCATGCACCAAGGCCCACACACCTGATTCTCACCCATGCGGCTGTGGCCAACTTCTTAGTCCTTCTCTCCAAGGGGATTCCCCACATGATGGTAATCTGGGGAATGACACCCATCCTGGGAAACACGGGATGTAAACTTGTCTATTATATCCACAGAGTGGCCCGAGGCCTTTCTCTCTGCACCACTTGCCTCCTGAGCAACTTTCAGGCCATCACCATTAGCCCCAGAGCTGGAGGGTGGGTGGGGCCCAAAGACCGATCTTGGAAGAAAATCAGTTTCTCCTGTGTTCTGTGTTGGATCTTCAACTTGCTGATAAATGTCTTTATTCCTATACGTATTGTGAGCCTTCGACATAACTGCAGTTCTACCATGGTATTGGACCATGGACTATGCTCTTCTGAAAAGCCTGAAACTTCTGCCTCAACAGGTACATTACTTTTGACATTCATGGATGTTGCGTTCCTGGGACTCATGACCTGGGCCAGTGTCTACATGATACTTCTCTTATATAAACACCAACAGCGAGTGAAGCATATTCACAGCACCAGTACCTCCCACAGATTCTCTCCTGAGGCAAAAGCCATGCAAACCATCCTCCTTACAGCAAGCATCTTTATTTTTCTTTATTCAGTCAATTCTTGTCTCACAATTTATGTTGCACTTTTCAAAGCTCACCTGTGGCTGCAACATATCACTACTTTTCTGGCAGCCTCTTATCCCACTACCAGTTCCTTGATACTGGTGTTTCAAGATTCCCAAGGATCAGCTTACTGCAGTTAA

XM_004867184.1 Coding sequence

LOC101699094 60S ribosome subunit biogenesis protein NIP7 homolog

Length: 528 bp    Location: 3184346..3185984   Strand: +
>XM_004867184.1
ATGGCGTGGGCCAGTGCCTACACGGAAGATACCCAGAAGAGGAATAATGAGAATCTTCAGCTGCTGGTTGACAGGCCCAATGGCACCTACTGTTTTAGGCTGCACAACGACCGGGTGTACTATGTGAGTGAGAAGATGCTGAAGTTGGCCTCCAATATCTCCGGGGACAAGCTGGTGTCACTGGGGACCAGCTTCGGAAAATTCACCAAGACTCACAAGTTTCGGCTGCACATTATGGCTCTAGATTACCTGGCACCTCACGCCAAGTATAAAGTGTGGATAAAGCCTGGAGCAGAGCAGTCCTTCCTGTATGGAAATCATGTATTGAAATCTGGTTTGGGCCAGATCACTGAAAATACTTCTCAGTACCAAGGAGTGGTGCTGTACTCCCTGGCAGACATCCCTTTGGGTTTTGTGGTAGCAGCAAAGTCTACCCAAGACTGTAGGAAAGTAGACCCCATGGCGATTGTGCTATTTCATCAAGCAGACGTTGGGGAATACATAGGGCATGAAGAGACGTTGACTTAA

XM_004867185.1 Coding sequence

LOC101699442 vomeronasal type-1 receptor 1-like

Length: 894 bp    Location: 3218169..3219062   Strand: +
>XM_004867185.1
ATGACTCCTGGTGATTTTATCCTGAAATTACTTTTCCTGGCCCAGACTGGGGTCGGGGTGGTGGGGAATACCTTTCTTCTCTCAGCTTATGCCCCCACATCCTGTACTGGCCATGCACCAAGGCCCACACACCTGATTCTCACCCATGCGGCTGTGGCCAACTTCTTAGTCCTTCTCTCCAAGGGGATTCCCCACATGATGGTAATCTGGGGAATGACACCCATCCTGGGAAACACGGGATGTAAACTTGTCTATTATATCCACAGAGTGGCCCGAGGCCTTTCTCTCTGCACCACTTGCCTCCTGAGCAACTTTCAGGCCATCACCATCAGCCCCAGAGCTGGAGGGTGGGTGGGGCCCAAAGACCGATCTTGGAAGAAAATCAGTTTCTCCTGTGTTCTGTGTTGGATCTTCAACTTGCTGATAAATACCTTTATTCCTATACATATTGAAGGCCTTCAACAAAATCACAATTCTACCAAGGTGCGGGACTATGGTTTATGTTCTTCCAGAAATTCTCAAACATCTACTCCAAAATACACATTTCTAATGACACTGGCAGATGTTGTGTTCCTGGGACTCATGGCTTGGGCCAGTGCCTACATGGCACTTCTCCTGTACAGACATCAGCAGCGAGTGAAGCATATTCACAGCAGCAGCAACACCCACAGATTCTCCCCTGAGACAAAAGCCACTCAAACCATCTTGCTTATAGCAAGCAACTTCATTTTGTTTTATTTAATCAGTTCTTTTCTTACCATTTATAATACTGTCTTTTTCAAATCTCGCCCGTGGCTGCAGCACATGACTACTTTTCTGGCAGCTTGTTATCCCACCGTCAGCCCCCTGATACTGATGCTTCGAGATCCTCGAGCACCAAATTGCTGCTCTTAA

XM_004867174.1 Coding sequence

Nlrp12 NLR family, pyrin domain containing 12

Length: 1083 bp    Location: 2596604..2611543   Strand: +
>XM_004867174.1
ATGCACCACAGGGAGCCCCTGTCCTCGCTGTGCCTCCTGCCGCTCGTGTGCTGCGTGGGGTGGACCCGCCCGGGGGCCACCAAGGCCTGTGCGCCCTCTACCCGCTCAGCCTGCTGTACCCAGGCCCGGCACCCCCACGCCGCCGGGTGGAGGAGGACGAGCCCGACCGAGGGCACTTCCGGGGCTGGCTCTCGGCTTGAGAGCAACCTGCTGCCCCAGGCCTACAGCAAGCACCTGACCACTGCCCTGTGTGCCCTCCTGGAGCTGACGGAGCTGGCCCTGTGCTGCAGTGCCCTGGGTGGCCACGGGGGTGTGGGTGCTGTGCCCGGGGCTGAGTCACCCTCGCTGCCGGCTACAGATGCTGCATGCCGCCTGCATGCATTCTTCGACCTGCTCAGCCGAGAAGCAGCTGAGTCTCTGGGCACCAGGGTGGGGCTAATAAGCAATAGGCTGGCTTTGCACAGGCTGAAGATCTGTCACCTCACCGCTGTTGCCTATGAAGACCTGGCCTGTGCCCTGGGTGTGAACCTGAGCCCGACAGAGCTGGACCCGGGCCTCAGCGATCTGGGGGACCTGGGGCAGGGCATCTGTTTCCTGGGCCCGGCCACCTGTGGGGCGCTGTCCCTTGTGCTGCAGGCCGGGTGCTTCAGGGAGCTGGATCTCAGCTCTGACAACCTGGGTGCTGAGGGCGCGAGGCTGTGCCCGGCCCTGACCGAGCTCTACCTGACCAACAATGCCCTGGGGGACGTGGGTGTGCAGCTGCTGTATGGCCGGGCCACGCGTCGGATTCGACTGGACGAAGGCGCTGCAAAGGCTGCAAAGGAAGATGAAGAGTCAGACCCAGCGCGGCGTGAACCGGGGTCGGGGCTGGACAGGGGGTTCCGGCTGGGGCGCCCGGGACCGCCGGCCTCCGACTGGGTTCATCACGGGCCCAGACACAGGAGGGAACCGGGAGTGTTTGGGCCAGGGCAGAGGGCGCTCCCCTCCCTGCGGCCTGGCCCGGCAGCATTCCTCACCCAGCAGGATCCGGGCCTTTCCCCACCGGGCGGTCTGGGGCTGGAGGGGCTCAGGTGGTCCCAATGA

XM_004867176.1 Coding sequence

LOC101724768 cationic amino acid transporter 3-like

Length: 2088 bp    Location: 2656709..2660593   Strand: +
>XM_004867176.1
ATGCCACTGCTGGAGCTGCGCGAGGTGGGCCGCAGGCTGGTGCGCAGGCGCCCCCTGGCGAAGGCCGATGGCGAGGGCGGCCGCCTGTCGCGCTGCCTGTCCACGCTGGACCTGGTGGTGCTGGGCGTGGGCAGTACGCTGGGGGCGGGCGTGTACGTACTGGCCGGCGAGGTGGCGAGGGACAAGGCTGGGCCGGCCATCGTGCTGTGCTTCCTGGTGGCCGCGCTGTCCTCCGTGCTGTCCGGGCTCTGCTACGCCGAGTTCGGAGCCCGTGTGCCCGGCTCGGGGTCCGCGTACCTCTACAGCTACGTCACAGTGGGCCAGCTGCTGGCCTTCATTACCGGCTGGAGCCTCATCCTGTCCTACATCATCGGAGCCGCCAGTGTGGCCCGGGCCTGGAGCGCCACCTTCGATGGCCTGATTGGCGGCCACATCACGCGGGGCCTGAGCGCCCGCATCTCCCTGCCTGCGCCTAACGTGCTGGCCGCGCATCCGGACTTCCTGGCGCTGGGCCTGGTGCTGCTGCTCACAGTGCTCCTGGCCGCGGGCGTGCGGGAGTCCGCGCTGGTCACCACGTTGTTCACTGTGCTGAACCTGCTGGCGCTGGCCTTTGTCATCGTCTCGGGCTTCGTCAAGGGCGACCTGCGCAACTGGCGGCTGGCGGAGGGGGACTACGCACTGGCCGAGTCCCGCCTCAACGGCACCGGCAGCTTGGGCGCCCTGGGCTCCGGAGGGTTCGTCCCCTTCGGCATGGACGGGATTCTCCGTGGAGCGGCCACGTGTTTCTTCGCCTTTATTGGTTTTGATTCCATCGCCACGGCAGGGGAAGAGGCCCGCAGCCCGCAGCGCTCCATCCCCCTGGGCATCGTGCTCTCGCTCCTCATCTGCTTCCTCGTGTACTTCGGCATCTCTGCGTCCCTCACGCTCATGATGCCCTACTTCCTCATCCAGCCCGAGAGCCCCCTGCCCGAGGCCTTCGTGCACGTGGGCTGGGCCCCAGCCCGCTACGCTGTGGCCGCGGGCACTCTGTGCGCGCTGTCCTCCAGCCTCCTGGGCTCCATGTTCCCCACGCCCCGGGTCATCTACGCCATGGCGGAGGACGGGCTCCTCTTCCGGGGCCTGGCGCAGGTGCACGCGCGCAGGCGTACCCCGACCCTGGCCACCGCGGCTTCCGGCGTCGTCGCAGCGTGCATGGCCTTCCTGTTCGAGCTCAGCGACCTCGTGGACCTCAGCTCCATCGGGACCCTGCTGTCCTACATGCTGGTGGCCTTTTCCGTCCTGGTGCTCAGGTACCAGCCGGACCGGGACCGGGATCGGGACCGGGACGCAGGCTCCGGCGGGGAGGAGAAGCCGGGGGCGGAAGCCGCATCTGTGCAGCCTGTGCGGCGGGCAGGGAGCTCGGGGCCGCTCCGGGGCCTCTGCGTCGCTGGAGCCGCCGCACCCACCGAGTGGTCAGGCCCCGCGGGGTTTCTGGGGCTGCTGCGGAGGGGCTGGTGGCCCCGCGCAGCCCCTTTGGGTGGACCCGTCCCCTCTGCCCTCCCTTTCCGGCGGTCTCCTTGGCTGTTTGTCTCACCAGCCGTCCGCGTGCAGCACATAGGTCCCGGGGAGCAGGCGCGCACCCCCACCCCGGGGTCCCAGTCCCCCCTCTGCAGCTCCTCCCCACTCCGTCCGCGCACCCGCTCACTTCTGTCTCCTCCGCTGCAAGTCCTGCTGCTGATCGTCCTATGCCTGCTCCTGGCCCGGTGGCCCGGGCGCCTGCTCTCGGGAGACCCGGGGTTCCTGGCGGGGGCCTCGCTGCTGCTGCTGCTCACTGTCGGGGTGGCGCTGCTCATCTGGAGGCAGCCCCAGAACCCTGCGCCCCTGCCCTTCAAGGTCCCGGGCCTGCCCCTGCTCCCCGCGCTGAGCATCGGCATGAACGTCTACCTGATGATGCAGATGAGCCCTGCCACCTGGGCCCGCTTCGCCGTCTGGATGCTGTTGGGATTCGCTATTTACTTTGGATATGGCATCTGGCACAGCCTGGAGGAGCAGGACCGCCAGCCGCCAGCCTCGAGCACCCAGAGCCTGCACGAAGACACCCGGTGCTGA

XM_004867177.1 Coding sequence

LOC101725519 vomeronasal type-1 receptor 2-like

Length: 900 bp    Location: 2701089..2701988   Strand: +
>XM_004867177.1
ATGGCCCCTGTGGATTTGAGAATTGCAGTGATCTTCCTTTTCCAGATTGTCACTGGAACTGCCGGGAACTTAGCACTCTTGGGTCATTATTGCATCCTGTACTTCAGTGGCTGCAGGTCCAGGCCCACAGATGTGATCCTCAGGCACCTGATCGTGGCCAACCTCTTGGTCATTCTCTCCAGAGGAATCCCAGAGACCATGGCAGCATTTGGGTTGCAAAACTTCCTCAGTGATGTTGGGTGCAAGCTTGTGTTCTATGTGCACAGGGTGGGCAGGGGTGTGTCCATGGGCAGCACCTGCCTCCTGAGTGTTTTCCAGGCCATCACCATCAGCCCCAGGAGCTCCAGGTGGGCAGAGCTGAAAAGGAAAGCCCTAAAATTTATTGGCTTGTCTAACATCCTCTGCTGGGGCCTGCACATGCTGCTAAATGTCAGAGTTCCTATGCTTATGAGTGACAAAGGGAACAACGGAAACAGCACAAAAACTATAGATTTTCAGTACTGTTCAGCTACCCTTCCTGACAAAGAAAAAGGATCATTGTTTGCAGTACTGATAATCTCCCATGACATTTTGTGTTTGGCGCTCATGATCTGGGCCAGTGGCTCCATGGTTTTCATTCTGTTCAGGCACAAACAGCGGGTCCAGCATCTCCACAGATACAGCTCACGCAGGTCTTCCCCTGAGACCAGAGCTTCGCAGAGTGTCCTCATCCTGGTGAGCGCCTTCGTGTTCTTCTATGCCCTGTCTTCCGCCCTTCATGTTTTGTTTTCTTTTCATTATGAAGGTACTTGGTGGCTGGTCACAACCTCTGTCATCAGCAATGCTTGTTTCCCCACTGCCAGACCCTCCATTCTCATGAGTCGTGAGTGCTCTCTATGCAGGCTCATCAAGAAGAATTAA

XM_004867178.1 Coding sequence

LOC101725895 vomeronasal type-1 receptor 2-like

Length: 903 bp    Location: 2710944..2711846   Strand: +
>XM_004867178.1
ATGGCCCCTGTGGATTTGAGAATTGCAGTGATCTTCCTTTTCCAGATTGTCACTGGAACTGCCGGGAACTTAGCACTCTTGGGTCATTATTGCATCCTGTACTTCAGTGGCTGCAGGTCCAGGTCCACAGATGTGATCCTCAGGCACCTGATCGTGGCCAACCTCTTGGTCATTCTCTCCAGAGGAATCCCAGAGACCATGGCAGCATTTGGGTTGCAAAGTTTCCTCAGTGATGTTGGGTGCAAGCTTGTGTTCTATGTGCACAGGGTGGGCAGGGGTGGGTCCATGGGCAGCACCTGCCTCCTGAGTGTTTTCCAGGCCATCACCATCAGCCCCAGGAGCTCCAGGTGGGCAGAGCTGAAAAGGAAAGCCCTAAAATTTATTGGCTTGTCTAACATCCTCTGCTGGGGCCTGCACATGCTGCTAAATGTCAGAGTTCCTATGCTTATGAGTGACAAAGGGAACAACGGAAACAGCACAAAAACTATAGATTTTCAGTACTGTTCAGCTACCCTTCCTGACAAAGAAAAAGATTCATTGTTTGGAGTGTTGGCATTCTCCCATGACATTCTGTGTTTGGCGCTCATGGTCTGGGCCAGTGGCTCCATAGTTTTCCATCTGTACAGGCACAAGCAGCGGGTCCACCATCTTCGTAGCCACAAAATCTCATCACCGTCTTCCCCTGAGACCAGAGCCACTCAAAGCACCCTCATCCTGGTCACTGCCTTCATATCCTTCTATGCCCTGTCTTCCATCATTCATGTTTTGTTTCTCCTTCATGATGGAACTGCCTGGTGGCTAGTCAAAACTTCTGCCTTCTCCAATACTTGTTTCCCCACTGCCAGCCCCCTAATTCTCATGAGTCGAGAGCGGTGTGTCTCCAGGGTCATTTGGAAGAAGTAA

XM_004867175.1 Coding sequence

LOC101724414 homeobox protein ARX-like

Length: 936 bp    Location: 2641451..2632795   Strand: -
>XM_004867175.1
ATGCCAGGCCCAGACCGAGGGTCACCTGGATCCCGGCGGAGAATCCAGGGCCAGGCGAGCCGGGATTGGGGCGTGGACGAAGGGACGCAGGGCGCAGCCCCTACTGAGGACCAAGCTGTCGCTGCACTTCTCACCTCGGAGCTGCGCCTGCACAGCAGGCCGAGGATGTCAGGCTGGCAGGCTCCTCTCCAAGCTGCACACATAAGTCCTGAGGATGGCTCCACACACGAGAAGTGCACGGACTCTGCTGTCAATGCGTGTGGCCTGGCACAGAGGGTCCTGCTGAGGCGGTGCACTGCGTTCTCCGAGAGGCAGCTGCAAGAGTTGAACCTGCTGTTCCGCAGGAACCCGTACCCAGGCCCCGGCCTGACAAAGCATCTGGCCTCCAGGATGAACATGCATCCCAGGGCGCTGCAGGTTTGGTTCAAGAACCAAAGAGCAAAGCTCAGGAGAGCAAATTGCCCCACCCACCACCCCAAGACGGAGATCGAGACCACGGCTGAGCCGGAAGCCAGAGCTGAGACCAGCGCACAGGCCCCGGCAGGCTGGCCCTGCGCACCTGGGGAGGGGACACTGCCAGGTGCCTACACAATGGCCCTGATCCGCACTGAGCGGGCAGTGCCCGCCTTCCAGCTGGACATCTGTCCACCCATGCTGCACGCCGGGGGCCACAGAGTTGTGCACTTCAGCTGCTGCCAGGACCCCTTGGTGTACTGCATGCACCCTGTCATGGACGCAGGGCAGCCCTGCCTTGTCCCCCTTCTGCCCCCTGTGGACGCCCACCCGGGCCACGCAGGCTCCCGCGCCTACGCACTCAGAGGGCGCACCACGTGGTCGCCCGTGTCCCCGGATCCTCCTGGACACGCAGCAGGGCCCGTCCTGAAGGGGAGCAAGTTCCCAGGAGACTCCTGCAAAGCCCTGACTGACCCCTGGTGA

XM_004921187.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1959 bp    Location: 2381812..2391255   Strand: +
>XM_004921187.1
ATGGGACCTCCGCTCCTGTGGGGATTTATGCGGCTCCGACAGCAGAAGTCTTCCGGCTGCAGCCCCGCGACCGCGGACACACTCCTGAGTGAGGGCTGCATTTGCCCTCCCCCATACCGGTGCTTCGCCCTCCCACGTTATTGCATCCCGTCTTCCCCTTTTCCCCTCCCTACACCTGGGAAGCTGATGCTGAAGCACCTGTCCTCTGACCGCGTGACCAGGGGAGGAGGCTGCAGCTTCCCCGGTGACTGCCACACCTGGCACCGAGACTGCACATGGGAGCTCTCTTCCAGGGCTGAGTCTGGGCCCCAGGCCCCGAGGGCAGGCAGGCTCTGGGCTGAGCCAGGACCTGTGATACCANCAGGGAAGCCGGTGACCCTCTGGTGTGAGGGGAGCCTGGAGGCCCAGGAGTACCGTCTGGAAAAACAGGGAAGCCCGGAGCCCTGGGACAGACTGATGTCACCGAAGTCTGGGGACAAGGCCAACTTCTCCGTCCCATCCATGACAGAGCACCATGCAGGGCCATATCACTGTCACTATCACAGCCCTGCTGTCTGGTCAGAGCGCAGTGAGCCCCTGGAGCTGCTGGGGACAGGAGCCCACAGCAAACCCAGCCTCTCAGCCCTGCCCAGCCCTGCGGTGACCTCAGGAGGGACCGTGACCCTCCAGTGTGGCTCACGGCAGAGGTTTAACAGGTTCCTTCTGACTCAGGAAGGAGAAGATGGGCTCTCCTGGACCCTGGACTCACAGCGAGGCCCCAGAGGGCAGGTCCAGGCCCTGTTCCTTGTGGACCCTGTGACCGCTGGCCACAGGTGGACGTTCAGATGCTACAGCTACGACAGGAACAATCCCCAGGTGTGGTCGGAGCCCAGTGACACCCTGGAGCTCCTGGTCTCAGGGCTGTCCAGGAAGCCCTCCCTCCTCACCCAGCCGGGCCCTGTCCTGGCCCCTGGACACAGCCTGACCCTGCAGTGTCGCTCTGACATCGCCTATGACAGGTTCGCTCTGTCCAAGGAGGGGGAACCTGACCTCCCCCAGCGCCCTGGCCAGCAGCCCCAGGCTGGGCTCTCTCAGGCCCACCTCCCCCGGGGCCCTGCCAGCAGCTCCCACGGGGGCCGCTACAGATGCTACGGTGGACACAGCCTCTCCTCCGAGTGGTCGGCCCCCAGTGAGCCCCTGGACATCCTGGTCACAGGACAGCTGCCTGTCACAGCCTCCCTCTCGGTGCAGCCGGGACCCATGGTGTCCCCAGGAGAGGATGTGGCCCTGCTGTGTGAGTCACGGAGCCTGGTGGACACTTTCCCCCTGTCCAAGGAGGGGNCCGCCGATCCCCCACTGCATCTGGGATCAGAGTCCCGAGCTCAGCAGTACCAGGTGGAATTCTCCATGAGAGCTGTGACCTCAGCCNCCGGGGGGACCTACGGGTGCTATGGCTCTCGCAGCTCCGCTCCCCACCTGTCCGCTGCACCCAGCGACCCCCTGCAGCTCACAGTCTCAGGTCATTCAGTCTCGGCTTCACTTCCCTCCCCGACTCCGCCACCCTGCCCAGGACTGGGAAGGCCCCTGAAGGTTCTGACCGGGGCCTCGGTGGCCTCCGTCCTGCTGCTGCTGCTGCTCCTCCTCCTCCTCGTCCTCCGACACTGGCGTCAGGGCGAAAGCAGGAAGGCGGCTCCGGCCCAGCCGCCACCGCCCAGGAAGAAAACCTCTGTGAGAGGGAGGGGGCGGGATGCTGCCGTGAACGACTCACTGCCTGAGGACGGGGTGGAGCTGGATGCTCGGGCCACTGGGCTGCAGCCCACCCGAGACAGCGACACCCTCTGGGCGCTGCTCACAGCCCAAGCCAGCCGGGCCAGCCAGGCCTCTCCTGCCCACCTGGCCGCACCTGGAGGCAGAGCCCAGGTCGGGCCCGGCTTCTTTCCACTGCTCACAGCTGTGTGCTGGGGGCAAGGACGACACTGA

XM_004867018.1 Coding sequence

Syngr4 synaptogyrin 4, transcript variant X5

High confidence: 4 potential gene matches
Length: 705 bp    Location: 5414553..5407309   Strand: -
>XM_004867018.1
ATGCGCCTCCCCAAAAGCCTGCAGGACCTTGCCAGCAGCGAGACCGTGCGCTTCCTGAGGAGGCCAAAGAGCATCACACGGATCCTCTCGGGGGTCTTCGCCCTGGTTGTCTTCTCCTCCCTGCTGACCGATGGCTACCAGAACACAACTGAGTCCCCGCAGCTGCACTGTGTGCTCCACAGCAACCACACAGCCTGCAGCCTCGCTGTGGGCGCTGGCATCCTCACCTTCCTCAGCTGCCTGGTCTTCCTTGCCCTGGACGCCCACAGGGCCCACGTGGTCAACACCCACCTCAAGGTGGTCCTGCGGCTCCTGGACATCATCCTGGCAGTTCTCTGGGCCGTCATCTGGTTCATGGGCTTCTGCTTTCTGGTCAACCAGTGGCACCACTCATCGCCCAAAGAGTTCCTCATGGGGAGCGCCAGCGCCAAGGCGGCCATTACCTTCGCTTTCTTCTCCATCTTTGTCTGGATATTCCAAGCCTACCTGGCATTCCAGGACCTCTGGAGTGATGTTGCGGTCCCCTACAAGCGCTGCCTGGATGAGAGTGGAGTGGTGCTGACCACCCTCTCCCCGCTGTCCACCTCCAGCTCAGTGAACATGCCCACCTCCGGCCCCACCAGCCAGACTTACTCCAGCTCTGCCCTGTCCCCTTATACAACCACCCTGAAGGCCCCCTGCCTGGCCATGATGCCCGACAGCTAA

XM_004866973.1 Coding sequence

Bax BCL2-associated X protein, transcript variant X4

Length: 432 bp    Location: 5055051..5050222   Strand: -
>XM_004866973.1
ATGGACGGGTCCGGGGAGCACCCCAGAGGAGGCGGGCCCACCAGCTCTGAGCACATCATGAAGACAGGGGCCCTTTTGCTTCAGGGGATGATTGCGGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTGCTGATGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTATTTTGCCAGCAAACTGGTGCTCAAGGCGCTGTGTACCAAGGTGCCGGAGCTGATCAGGACCATCATGGGCTGGACACTGGACTTCCTCCGCGAGCGGCTGCTGGGCTGGATCCAGGACCAGGGGGGTTGGGATGGCCTCCTCTCCTACTTCGGAACCCCGACCTGGCAGACGGTGACCATCTTCGTGGCTGGCGTGCTCACTGCCTCACTCACCATCTGGAAGAACTTGGGCTGA

XM_004867167.1 Coding sequence

Tmem86b transmembrane protein 86B

High confidence: 4 potential gene matches
Length: 729 bp    Location: 2035472..2036674   Strand: +
>XM_004867167.1
ATGGACCGCGGGGACGAGGGCCTGGCCCTGAAGGGGTTCTTCAGCCAACACCCAAGGGCCTGCAGGTGGCTGAGCCCCTTCCTGCTCGCCTGCTCCGTCTACTTCCTCCTTTGGACTCCTGAGCTCCGGCCCTCCTGGGCTGCAGCCCTGCTCAAGGGCCTGCCCGTGCTCTGCCTGGTGCTGTTGCTGGGGGCTGTCCCTGCTCTCCGGGGCCACGCCAGGCTCCTGCAGGGCACCCTCCTGTGCTCGGCCGTGGGGGACACCTGCCTGGTATGGCCTGAGACTTTCCTGCACGGCGTGGCCGCCTTTGCCGCCGCCCACCATCTCTACCTGCGGGCCTTCGGCCTCTCTCCGCTGTGGCTTGGCCTGCTGCTGCTCGCCCTCCTGGCCGCTGCCACCTACCTCAGCGTCCTGCTGCCGCACCTCCAGCCTGCCATGGCCAGGCCCATGGCGGCCTACGCACTGCTCCTGGCCGCTGTGCTGTGGCGAGGCCTGGCCCGGGGCGGGAGTGCCAGCCTCGGTGCCCTGCTCTTCGCGGTGTCTGATGCAGTGCTGGCCTGGGATGCCTTTGTGCAGCCGCTGCCTCACAGCCACCTGGTGACCATGGCCACCTACTACGCGGTGCAGGCTCTCATCACCCTGTCGGTGCTCAGGAGTCCCGAGGCCCAGGGCAGGGCAGGGTCAACTGAGGGCAGGACCAAGAGTCCCTCCTGCCGTGACCTCACCTGA

XM_004867163.1 Coding sequence

Nlrp8 NLR family, pyrin domain containing 8

Length: 2661 bp    Location: 1627914..1610964   Strand: -
>XM_004867163.1
ATGTGGTCTCCTCTTTCTAACCCTGTGCTCAGCACCGGCACCAAAGGACCTGCTGAGCGTAGCAGCCCTGTCGCAGTGCTCCACCCAGAGCCCGCCTACATCGCCTATCTGGGAGATCAGTGCCCCAGACAGACGCCTGCCTGCTCCCCCGCCTCCCTTCGGGACAATGGGCTCATGCTGTACATGGCCAAGCTGAGCACAGGGGAGCTACAAGGGTTCAAGCAGCTGCTAGTGGAGAAGCTCATGACCAGCTCCAGCCCCGTCACCGGGGACCAGCTGAGCTCGGCCAGCTGGGCGGAAGTGGTTCACCTCTTGGTGCAGCAGTTCCCTGGCCGGCAAGCTTGGGACGTGGCCCACAACATCTTTTCCAAGATGAACCAGAAGAAAATGTGTGTCAGGGTGCAAAAGGAGCTCAAAGGCCTTCTCCCAACCTGGGGGCCCGAGGATGAGCGTCCGGGAGAATCACAAATGACCCTGGACAAGGAGGAATCTGACCAGATAAGGGCGTACAAACTCCGAGTCACGGAGAAGTACTCCCCAGCGTGGGATGGGACGACATGGCCTGGAAGCCAGGCAGACTTCTTGTACCGAGCGGCTCGCAGGCACCAGGAGCTCTTGACGTGTCTCTTCCTGCCCAGGAAGCCCGAGTGTGCGCCGCCCAAGGCCGTGGTGATCCAGGGGACCCCGAGTATCGGGAAAACGACGCTGGCCAAGCAGGTGATGCTGGCGTGGGCCTGGGACTCATTCTACGCCCACAAGGCCTGGCACGCTTTCTACTTCCACTGCCAAGAAGTGACCCAGGTGCCAGAGCAGAGCTGCTTGGAGCTGATCGGGCACCAGCTACCTGGGTCCCCTGCTCTGGTGTCCAAGATCCTGTCCAATCCAGAGCTCCTCTTCGACGGCTTTGAGGAGCTCACACCCACTCTCCTGCAGGAGCCAGAGGCTCTCAGCGGAGACTGGAAGCAGCAGTTGCCCAGCTCCGCTCTGCTGAGCAGCTTGCTGAGCAAGACGATGCTGCCACAGGCCTCGCTGCTGGTGGCCGTGCGGCCGGCATCCTGGAACACCGTGAGCCACCTGCTCAGCCAAACCTCTATGGTCACCCTCACCGGGTTTGATAGGACAGAAACAATCGAGTACTTCAGGACATATTTTGGCCACAAGAGGGAGCTCGAACAGGCTGTGAGCTTCGCCCTGGAGAACGAGACGCTCTTGTCGCGGTGCCGGTGGGGTGTGTGGAGCGTGGATGTCTCCCGGCCGTGTCCCAATGCCACCTCCATGCTGGCCCTGCACCTCTCCACCCTCTTCCCAGACTTGGCCAAGGGTCTTCCTGGCCGGATGGCCCCGGGGCCCCTGGAGGGTCTGTGTCACCTGGCGGCCAGCGGCATGAGGATGGAGCAGTGGGTGTTCAGCAAGGGGGACCTGGTGAAGGCCAGGGTGGAGGACAGCAGTGTTGCCGCCTTTCTCAGTGCCAATATTCTCCGGAGGGTCAATGGTCAGAGCGACTGCTATGTCTTCGTCTTCTTTGTCTTCCAGGAGTTGTTTGCTGTCTTCTTTTACGTGCTCTTTTTCCCACAAAGACTGAAGAATTTCCAAGTGCTGGGCAGCATAGACATCCAGAGCCTGCTGGCCGGGCCTGTGGACGTCTGGCACTTCCTGACCAACATGGGGCTCTTCCTGTTCGGCCTCTTAAACTCGGACTGTGCCTCCATGATGGAGCGCGCCTTCCAGCACAGGGTAACCTCGGTGAACAGGGGCAAGGTGCTCAAAGTCCTGGCTGAGATGTACCAGTACCACCTGCCCATCCCAGGCTGTGGGCTGCAGCAGCTGTTCCACTGCCTGTCGGAGGTCGGCCAGGAGACCTTCCTGAGCTGGGCCCTGCGAGGCTTGTGCAAGGCCACTCTGACGCTGGACAGCGACCAGGACGCCCAGGCCTCTGCCTTTTGCCTCAAGCACTGCCGGGATCTGAAGCGGGTGGAGCTGACCCTCTCGGCAGCCCTCCAGGAGGCGCTGGGGCCCAAGCCTGTGGACAGCCTTCCCCTGGCTGCCACCAGCGAGGGCCTGGCGGGCCTGGAGATGACGGCTGTCACCATGGCGCCTGCCTTCGTGTGGCTGCTGGCAGCCGCCCTAAAGCACCCCGAGGGTCTCCTGCGCAGCCTGTCGTTAAAGGGTGTGGGCCCCAGCATGCTGCATGAAGACTTGTTCAGAGTCTTCGTTGAGAACTCTCACATGACGTCCCTGGAAATACAGTGCACAGAAGTGGGGTACCAGGCTGCGCAGCTTCTGCGTGCTACCCTCCACTCCCCCAAGTGCCACATTCAGAGTCTGAGGCTGGTGTCCTGCGTGGCCCCCCCTCGAGAGTGGGTCCTCCTGGCCCGCGACCTTCAAGACAGCGCACACCTGCAGACCCTGGCGCTGAGTGGAGCCTGCCTGGCGCTGTCGGCGGCGATCTTCGTGTCTGCGAGGCAGCTCCGGAGGTTGGCCTGCAGGCTGAGAAGGTGTGCTCTGACCTCGGCTTGCTGTCAGGACGTGGCCTCAGCTCTCGAGAGCAGCAGCGCCCTCCAAAGCCTGGACCTCAGCCTCAATGACCTCGGGGATGACGGCGCCGCCACTCTGTGCGAGGCCCTGGCGTGCCCCAGCTGCCACCTGCATGTCCTGGAGTGA

XM_004867164.1 Coding sequence

Nlrp4 NLR family, pyrin domain containing 4

Length: 2865 bp    Location: 1665643..1648264   Strand: -
>XM_004867164.1
ATGGCGTCGCCTTTCTTTTCTGACTTTGGCCTCATGTGGTACCTGGAGGAGCTCAAGAAGAAGGAGTTCATGAAGTTCAAGGAGCTGCTCAAGCAGGAGACTCCACTGCTTGGACTCAAGCAGATCTCCTGGGCTGAAGTGAAGAAAGCATCAAGGGAAGAACTTGCCAACCTACTGCTCAGGCATTACGAGGAGCAGCAAGCCTGGGATGTGACCTTCAGGGTCTTTCAGAAGCTGGGCAGGAGGGACCTCTGTGAGAAGGCCATGAGAGAGAGCACTGGAAATGCGAAGATATATCAGACTCACATGAGGGAGAAATTCACCGACTTCTTGTCCAGGGAGTCCATTCCCACGATGCATGAACAGTTGGATATGAATATCACGCAGGAAGAATGCAAATTTCTGGAACTCCTCTTCGAGCCCGAGAAGCAGACCCGCATTCTATGCTTGCTGGGAGCCCAAGGAGTTGGGAAAACAACTTTCCTGGCGAAGATGATCCTGGCCTGGTCCAAGGGCTTCGTCTACCAGGACAGATTTTCCTACATCTTCTACTTCTGCTGCAAGGAACTGAAGCAGCTGCCAGCGACGAGCTTGGCGGGACTGATCACCAGAGCCTGGCCCGGCACCTCTGCCCCTGTGAGTGAGATCATGGCCCACCCCGAGAAGCTCCTGTTCATGGCCGACAGTTTTGAAGAACTGGGCTCTGACCTGGCGGAGCCGGAGGACGAGCTCTGCAGCGACTGGGCGGAGGTGCAGCCACCAAAGCTGCTGCTGAGCAGTTTGCTGAGGAAGAAGATGGCCCCGGAGTGCTGCCTGCTTGTCACCGTCAACCCCAGGGCCGGGCAGGACCTGGAGGACAGGCTGGAGGACCCTGACATTAGGGAGCTCACGGGCTTGAAAGAGTTCGACGTAAAGTTCTACATCTGCCATATGTTCCCGGACAGGCGCAGAGCCTTGGAGGCTTTCAACGTCATCCTGAACAACGAGCAGCTCCTCTCGATGTGCCGGCTCCCTGTGCTCTGCTGGCTGGTGTGCACGACCCTGAAGCAGGAGATGGACAAAGGCATAGACGTGGCGCTCACCTGCCAGCGTCCCACCGCCCTGTATAGCTCCTTCCTCTTGGACCTCTTCACGCCTGAGGGTGCCGACGGCCCCAGCTGGCAGGGCCAGGCCCAGCTGCAGAGCCTGTGCTCCCTGGCCGTCCAGGGCATGTGGACCAACACCATGGTTTTCCGGGAGAAGGACCTCAGGAGGAACGGGATAGGCAGCTCCGACCTCTCTGCCTTGCTGGAGCTCAGGGTCCTCCTGCCGTGCTGGGAGACTGAGGGCTTGTACAAGTTCCTGCACTCCTCGGTGCAGGAGTTCTGCGCTGCCCTGTTCTACTTGCTCAAGAGCCCCGGCCACCACTCGCACCCAGCCGTGAGGGGCACGCAGGACCTCCTGCTGACCTTCCTCGAGAAATCCAGGGCCCACTGGGTGTTTGTTGGGTGCTTCCTGTTTGGCCTGTTGCATGAAAGGGAGTGTCAGAAGCTGGATGCCTTTTTTGGCTTCCAGCTGTCCAGTGAGGTAAAGCGGCAGCTGTATCAGTGCCTGCAGCAACTGGCAAAGGTGGCTGACAAGCTCCAGGGGCAGGTCAGCTTCCTGGCCTTATTCTATGCTCTGTTCGAGATGCAGGAGGAGGCCTTCCTGAACCAGGTGATGGACTTGATGCAAGATCTTGCCTTCTCCGTCTTCATTGAGACAGACCTGAGGGTTGCCGGCTACTGCTTAAAACACTGCTCTAACTTGAGGAAACTCAGCCTTTCCGCCCAGGGTGTCTTTAAGGAAGAAGGCAGGGAACAGAGCTCTGTCTCGAGCTCTGAGCTCCTCTGCTGGCACCAGGTGTGGTCAGTGCTCAGGACCTGCAGCCAACTCCAGATGCTGCAGGTGAAGGATGGCACCCTCAACGAGTCCGCCATGCTGAGTCTGTGTCAACAGCTGAGGCAGCCCAACTGTCTCCTCGAGAATCTTTTTGTCAACAATGTTACCTTCCACTGTGAGAGTTGGACTCTCTTTGAGGCATTCCCTCATAACCCAAATTTGAAATACGTGAACCTTAGCAACACCCAGCTGGGCCGCGACGATGTGAAGGTCCTCCACGGCGCGCTGAGCCACCCAACGAGCAGTGTGGAGAAGCTGCTGCTGGTAAATTGTAACCTGTCAGCTGACGATTGCAAGGCCTTGGCCGCCACCCTGATGGAGAGTAAGAAGCTGGACTCCCTGAACCTCTCCTGCAACAACCTGAAGAAGGGGGTGCGTGCTCTGTGCAAGGCACTGTGCCACCCCAACTGCACCCTGAAGTTCCTGGCGTTAAGCTTCTGCACCCTCAGGGAGTGGTGCTGGGACTACCTCGCTGAAGTTCTCCTGATCAGCAAGAGCCTGAGCCACCTGGACCTCAGCATAAACAGCTTGAGGGACGAGGGGCTGAAGGTCCTCTGTGACACTCTGAGATACCCGGTCTGCGCGCTGCAGATACTATGCCTGATGAAGTGCTCCATCACGGCGGAGGGCTGCAGAGACCTGGCCTCGGTCCTCACCAGCAGCCGGAACCTGAGAAGCCTGCAGATTGGGGGGAACAACATAGAGGACGCGGGGGTGAAGCTGCTCTGCCAGGCTCTGGCACAGCCCAGCTGCCTCTTGGAGACCCTGGGGGTGGAGGACTGCGGCCTAACCAGCGCCTGCTGCGAGGACCTGGTCACCGTGCTCACCACCAGCAAGACCCTGTTTATGCTGAACCTGCTTCAGAATCCCCTGGACCACGGTGGGGTGGCACTGCTGTGCCAGGGCCTGAGGCACCCTGAGTGTGCCCTGCGGGTGCTGGGGTGA

XM_004867165.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 2835 bp    Location: 1938077..1942961   Strand: +
>XM_004867165.1
ATGCAGCGGCTTTGGAACACCTGGCCAGCCCAGCCGCTCCAGGGCCCCTGAAAGTGGGTCCCCGTTCTGGGCAAGCTGCAGAAGACCCTCCAGAAGGGCGAGTACCTGCCCCTACGTCTGCTGCCCATGTTCGAGAGTAACTTCATGCAGGTGACAGAAATTGGGAGCCCCGTGTTCCTGCATCACAGAGCTAACCTGGTGACCATGGGTGTGGCTGCCTCTCTGCCTGGCCTGGTGCTTCCAGACATCCTGCTCTTCGCTCACCCCTGGGCCAGGGATGGCCCCTGCCTCGAGCTGACCAGGATGATCCCGCTGGACTTTGTGCCCCTCTACATCCATGACACATCTGCCCGGTGCCTGAAACTGTGGCTGGTCACTGCCCGCTGCTACTACCTGGACCTGGAGGCCCCTGACCACGAGATGGGCTTCCTGTTGGACTGTTGGGTGCGCCTCGCTCACCTGCTCCAGGAGCTGGCAACCGCCTGGGCCTCTTGGCCCCTGCACCGGTCTGGCCATGATGCGCCCCTGGCCGACGTGCCTCCCTCCACCTGGCGCCTGCAGGACCTGGCCCACGGCAGCCAGACAGCTACCACGGAGGAGCCCACCTTTCCTCGTAAGAGCCCCACTGTACAGAAGCCGAGGAAGGCCAAGGCCCTCCAGCGCAGGTTCAAGTCCCGGGCCGTGGGCGACTCCGTGCCTCTCATCTGGCCACAGCAGGAGTGTGCTGACTTGAGGACGAAGTCCACGGAAAAGAGGTGGCCAGGGCTTTTGCTGCTGGTGGGGGTTGGGAGACAGATGGAGACCCCGGCCCTGATGCCACCTGGTCCTACCGTGCCGTTCCTATGGGTGGCTCTGGTCCCGTCCCTGAAAGGCTCCGGCTGTGTTCTCTCCACCAGGGAAGGCCAGCATCACCATCCGCACCATCTTCAGCATCATCTCCAGCACCATCCACCAGGCCAGCTATCCCACAGGGCTGGGCCTGGCCGGGGTCTGAGGGAGGAGGGTGGGCCTTGGGACCCCGGGTCTGAGGGGGGAGGCTGGGAGCCAGGCCCTGCCCTGGCACTGACCCTGTACCCCTCTCCCACGACCAGGCCTGAGCACCTGACTCTGAGGCGGCCCCGGCCAGGAGGGCCTGACTGCAACCCCTTCCCGCTGTGTCTCACGGAGTGGCGCTGCCCTTTCTCGGCTGGGTCCATTGACTCCTTGGAGATGCTCCTGTGGCAGCGTGACACTGAGGAACTCCTGGACCCAGAATCCAGTACTCTGTCCTCCTCCTCCTTGGGCACAGCTCCATACTCCCCTGCCCTGTACTTCTTTCCGCCCTGTCCCTCTTTCCCCGGTCCTCAGGACAAGGCCAGACATGTGGACTCGAGGCTGGGCCAGGGGCCACCACGTCCCAGAAGGCCCCGGCTGGCGCTGGCCCACAGCGGGGAGCACCGCACCATGGACCAGTCGCAGAGGGCGCCAGCTGTCTTAGCCCCATCCTGGAAGACCCCAGCTGCCTCTGCTGGGCCCCAGAAGTCCCCAGCCACCTCCCCCCCGCCCATCCCAGAAGGCCCCGGCTGTGCTCCCCCACCCCACAAGCCACCGGCCCAGTCTCGGACAGTCCTGCCTGCACGCAGGAGTCCCCAGGCCCCAGAGAAGGGGCCTCTGTTCCTGCCCACCCTGTCCCAGCAGAGCTCTGCCCCACCACCCCAACCGCAGGCGGCCCCCAGCCCTCCCGCCTTGCAGGGGAAGCCCCCAGCCCGGCTCAACGTGGTGCTGGCAGGACCTCCTGGAGCGGATGTGACCGGGAGAAGCAAGTGCAAGGGGACACTGGTGCCCGGGGTGTTGGTGGGCAGCCAGGAGACGAATGGGATGGCGAGGACCCAGAAGGTGTCCCTGGAGCTGCCCTTTGCCACCACCGCCAAGGAGCCCAAGGAGGTGCTGGTCAGCCAAGCCCAGGAGGTCACCCTGCGGGGCTGGCGGGACCAGGCAAAGTTGGAGGACACGGCCCACAGGAGGAGGGAGGAGGTGTGGCTGGACCTGCCAGGCATGAGGTCCAAGGAGGCGGGGCAGNNCAGGAGAAGGGTGAGGACCCAGCAGGTGGCCATCGAGGGTCCTGGCCAGGAGTGCAGCAGGGCCTTCTCTGTGGAGGACCTCTTGCTGGCCAAGCGGCTGACCAAGGCCAACTCCAAAGAGCAGCGCCTGAGTCCCCCTATGGCTTCCCTGCCCTCCTGGCTCTCGGGGACTTCCCGGGCAGCAGCCCTGTGGCTGGATGTCCAGGTCTCGCTGCCCTTGAGTCCCAGCCAGCTGTCCCTGCTGCAGGACACACGAGTGGTGGTTAGGGAGCAGCCAGAGTTTCACCCCTGCATGAAGGAGCCAGTGGAGCGACAGACCGACCGAGAGCCACCCCAGGGCTCAGGCGGGCCTTCCAAGGGGCGCTTCAGCCCCATGCCTGGCTCTGACAGCCCGATGAGGGCTGCAGAGCCCCTGTTGCCCGTTCCCCCTCCCGCCTCGCTGTGGGAGGACTTGCTGAAACCTCCCCGCCTGCCAGCCTCTCAGCAGCTTTCAAGGGCCACAGAAGGGCCCCCGCGGATGCCCAGGCAAAGCGTCCTGCCAGTGCTCTTGGAAACTCAGAGTGTGAGGGAGGGGGCCACCAAGGCGCAGAGGACAAGGGGGAACCTGGGATTCCTTCAGCCTTTGGCCAGGTGTGTGCAGATGGCAGGCAGTTCGTGTCTGCTGTCAGCTGCATCATGTCTGAGGGCAGGCGGAGAGGACCCTTACTCCACTTGGTTCATTCTCTCTTCCTCTGGCCTGTCTCTCACTTCTGGGCGGTTGGAAGTTTTGTCTTGA

XM_004867157.1 Coding sequence

LOC101715340 vomeronasal type-1 receptor 1-like

Length: 1047 bp    Location: 794340..799012   Strand: +
>XM_004867157.1
ATGTGCTCTGCCAACTTGGATTTGGGGATTGTCTTCCTCACTCAGACAGGACTTGGCCTTGTGGGAAACTCCTACCTGCTCTGTATGTATAACTTCACTGTGCTCATTGGACATCACTTGAAACCGACAGATTTGATTCTTAATCAACTGGTATTGACCAATTTGGTGGTTCTTTTCTCGAAAGGTGTCCCTCAGACATTGTCAACTTTGGGATGGGAATATTTCCTGGATGATGCTGGGTGTAAACTTGTCTTCTACTTTTACAGAGTGAGCACTGGAGTGTCCTTCAGCACTGTCTGCCTCCTCAATGGCTTCCACACTATTAAGATCAACCCCAGTATTTGTAGATGGATGGAGCTCAAGATTAGATCCCTAAAGTTTACTGGCTTCTGCTGTTGCCTGTGTTGGATCCCACATCTCTTGATAAATTCATTTCTTCCTTTAATAGTATATGGTCCATTGAGTAAGAAAAATCTCAGCATAGAAAATAATTATGAGTATTGTTCTTGGATAACGCCACAAGGATATAGCCCATTATATACAGCCTTGTATTTTTTCCCTAACCTAATGAGTCTCATCTTCATGATCTGGGCCAGTGGCTCCATGGTCCTGGTCCTGCACAGACATAGGCTGCGAGTCCAGCACATTCGCAGACACAGCTTTTCCCCCAACCCTTCCCATGAGGCCAGAGCCACACGCACCATCCTGGTCCTGGTGAGCTCTTTTGTGACCTTTTATTCAGTCTATGTTATTTTCAGCATCTGGATGACTCTAGTCACACATCAAGGCCAGTGGATGGTGAACAGCTCTGTCCTGGTGGCCTCATGTTTCCCAGCATTCAGCCCCTTTGTGCTCATCATCAGTGACTCCAGGATCTCACAGCGCTGGTTTGCCTGCAGAGAGAAGACAAAAGAGACCCTGGGACCCCATCTGTTTTCCACACTTTCACAGGTATATATGGCTCAGGAGAAAAGCTTACGTATCATTCAAGGAAAACAAGGCAAGAAGCATGAAGGAAGAAATAGTAAAATTTACAGGATTTGGTAG

XM_004867159.1 Coding sequence

LOC101716717 olfactory receptor 5-like

Length: 939 bp    Location: 1295024..1295962   Strand: +
>XM_004867159.1
ATGGAGAGGCCCCTGGAGCCGACCAACATGACCAGGGTGCAGCAGTTTGTCCTCCTGGGCCTGTCCACCAGGCTGAGCAGCAGGAACACCCTCTTCGCCTTCTTCCTGGCCCTCTACCTGCTCACCCTCCTGGAGAACACGCTCATCATCTACCTCATCTACAGTCACAGTGAGCTCCGCAAGCCCATGTACTTCTTCCTGGGCAACCTCAGCGGCCTGGAGATGTGCTACGTGTCGGTGACCATGCCCACGCTGCTCGCGGGGCTGTGGACGGGGCCCTTCTATGTCCCTTTCACAGCCTGCATGACCCAGCTCTTCTTCTTCATAGTCCTCATCTGCACGGAGTGCACCCTCCTGGCCTCCATGGCCTATGACCGCTACGTGGCCATCTGCCACCCACTGCACTACTCACTGATCATGCGGCCCCAGGTCTGCCTGGGCCTGGCCCTGTCCTCCTGGCTGGGTGGACTGGTGGTCTCTGTGGCCAAGACCACGTGCATTGCCAGCCTGTCCTACTGTGGCCCCAATGTCCTCAATCAGTTCTTCTGTGATGTCTCCCCTCTGCTCAACCTGTCCTGCACCCACGTGGCCCTCACGGAGCTGGTGGACTTCATCTCCGCCATCGTCATCTTCTGTGGGACACTCCTGGTGGCCTTGGCCTCCTACTCGGCCATTGCCATGGCTGTGCTCCGCATGCCCTCAGCTGCTGCCCGGCGCAAGGCCTTCTCCACCTGTACCTCCCACCTGGTGGTGGTGGGCATCTTCTACTCAGCAGCTCTCTTCATCTACTGCCGGCCCAGCCGCATCAAGTCCATGGACCTCAACAAGGTGCTGTCGGTCATCTACACGGTGGCCACGCCCCTGTGCAACCCGGTCATCTACTGCCTGCGGAACAGGGAGGTCCACACGGCCCTGCGGAAGGCACTGCGCTGGCCCTGA

XM_004867092.1 Coding sequence

Gng8 guanine nucleotide binding protein (G protein), gamma 8, transcript variant X1

Length: 1896 bp    Location: 6920999..6930554   Strand: +
>XM_004867092.1
ATGATCCGGGCCTTCTCGTTCCCGGTGAGCCCCGAGCGGGGCCGGCTGCGGGGATGGCTGGAGGGCAGCCTGGCCGGGCTCTGCGAGTTGCACTGGCTCCGGGAGAGGCAGGAGTACCGCGTGCAGCAGGCGCTGCGGCTGGGCCAGCCCGGAATGGGGGGCGCCGAGGCCGAGGACGAGGAGGACGCCGACGAGGACGAGGATGCGGCGGCGGCGCGCCGGGCCGCTGCGGCCCTGGAGGAGCAGCTGGAGGCCCTGCCCGGGCTCATCTGGGACCTGGGCCAGCAGCTGGGAGACTTGAGCCTGGAGTCAGGGGGCCTGGACCAGGAGAGCGGGCGCAGCTCAGGCTTCTATGAAGACCCCAATTCCACAGGAGGCCCAGATTCGCCACCCTCGACCTTCTGTGGGGATAGTGGCTTCTCCGGATCTGGCTCCTATGGACGCCTGGGTCCCTCTGAGCCCCGGGGCATCTATGCCAGCGAGAGGCCCAAGTCCCTAGGAGACGCCAGTCCCTGCACTCCGGAGTCGGTGGGCGCTCGGGCGGCGGTGCCACGTTCCTACTCTGCGCCGTACCCGACGGCAGCGGGTTCCGCAGGCCCGGACGCCTGCTCCTCAGCCGAGCGGCGGGCGCGCGCGGGCCCCTTCCTGACGCCCAGCCCCCTGCACGCCGTGGCGCTGCGCAGCCCGCGCCCCTGCGGCCGCTCGCCAGTCAACTCGCCCGATGCAGCGGCGGGCGCGGGCCGGCCCCTGGACGGCTACATCTCGGAGCTCCTGCGCAGGCGCCGCCGCCGGGGGGCGGGCCAGCCCCGGACGAGTCCCGGGGGCGCGGATGTGGCCCCGCGGCGCCAGAACAGCGTGCGCCAGCGGCCACCCGACGCGTCCCCGCCCCCCGGAGGCGCGCGGCCCGCGCGGGAGCCCTCGGTGGAGCGCTCCGGGGGTCGCGCCGCCAGCCCCGCCGCCCTGGGCCGCGCCTGGGCCTCGTCGTGGGAGGAGGCGGCACCAGAGCCCGACGTGTCGCCCGCCGCGCCCTCGCCCCCCGACAGCCCCGCCGAGGGCCGTCTGGTGAAGGCGCAGTACATCCCGGCCGTGCAGGCCGCCACGCGCGGGCTCCCTGGCCGCGCCGCGCGCCGCAAAGCACCGCCGCTGACCCGCGGCCGCAGCGTGGAGCAGTCCCCGCCGCGGGAGCGTCCCCGGGCCGCCGGGCGTCGAGGACGCATGGCCGAGGCCTCGGGCCGCCGGGGTTCGCCCAGGGCACGCAAGGCCGCGCGCTCGCAGTCGGAGACCAGCCTGCTGGGCCGCGCCGCCGCAGCTCCTCCCGGGCCCCCCAAGTACCCCACGGCGGAACGGGAAGAGCCGCGGCCGCCCCGGCCCCGCCGCGGCCCAGCGCCCACGCTCGCAGCCCAGGCCGCCGGCTCCTGCCGCCGCTGGCGCTCCACGGCCGAGATCGATGCCCCCGATGGGCGCCGAGGGCGGCCCCGCGGCCCGGCGCCCCGCGCCCCGGGGCCCGTCCCGTCCCCATCCGCCCCCCAGCGCCGCCTGCTCTACGGCTGCGCGGGCAGCGACTCCGAGTGCTCGGCCGGCCGCCTGGGGCCTCTAGGACGCCGCGGGCCCCCGGGTGGCGTTGGTGGCGGCTACGGGGAAAGCGAATCCAGTGCCAGCGAGGGCGAGTCGCCTGCCTTTAGCTCGGCCTCCAGCGATTCGGACGGCAGCGGTGGCCTCGTGTGGCCGCAGCAGCTAGTGGCGGCCACCGCGGCCTCGGGGCCTGGAGGCGGTGCGGGCGGAGGGGCCCCTGCAGGCCCGGCCAAAGTCTTCGTGAAAATCAAGGCTTCCCACGCGCTGAAGAAAAAGATCTTGCGTTTCCGTTCTGGTTCTCTAAAGGTCATGACTACAGTGTGA

XM_004867150.1 Coding sequence

LOC101710674 uncharacterized LOC101710674

Length: 654 bp    Location: 185232..194473   Strand: +
>XM_004867150.1
ATGGCCTGGGAGACCCGCCTCCCCAAACCTGCTTCCCCTTTCAGTGTGGAAGTGAGGACCCACTCTGGCGGGGACCCTCGGGGTGTCCAGCGAGGCCGGCAGCCCGCGTCCCCTCTCCACCCGAGCCGCGGTCGGAAAGGCGTGAAACAGCACACTTCCGGCGGGCCCACGCTGCGTAAGGAAGTCCGCGAGCCCGGTCCTTTGCCGAGTCCGGGCTCCTGGAGAGGTGAGCCCCGCGAGCTCCCGGGTGCCCTTCGCCTCAGCCCCGGCACAGCTCTGGCCCCACGCCCTCTGGCCCTGCCCCGCGGTGGCTGCTGCGCGTCCGGCCCCGGCGCCGCAGCCTTGGGCCCCGTAGGACAGCGGCGTCGCGGTGCGTGGGGCTGCGGCAGTGCTCAGAGCCGGAGCCGGGAGTGGGCCTTCGTGGGCCTTCGAGGGCCGGCACTCACAGACGTCCTCGCCCTGCCGCCTCCAGGGTCCTGGACCGGTCTCCAGGCTCTTGTGGCTGACGACCACAAGCTGGATGGCGTAGAACAGAAATTTATTTTCACAGCCACAGATGGCACGGATCAGTGGCTGTCCTTGCCATGGCCTGTGTGCCATAGTGATCTACAGCCCAGTGTTCCCAGCATGTCCTGGTGGTCAGTCTGCCCCTGA

XM_004867152.1 Coding sequence

LOC101711772 zinc finger protein 614-like

Length: 207 bp    Location: 309991..309020   Strand: -
>XM_004867152.1
ATGAGCCAATTTTGCTTTTCTCACCAAGGGAGAAATCATACAGGAAAAAAACCCTATGAATGTGGTAAATTCTTTAACTGGAGCTCCAATTTAGTTTTACACAACAGAGCTAATGCTGGAAAGATGCTCTCTGAATGTAATGATCTGTATGAGAAGTGTCTCAGCCAGCACCCTCAATGCATGAGATGTTACAAAACTAATATTTAA

XM_004867153.1 Coding sequence

LOC101712480 zinc finger CCHC domain-containing protein 10-like

Length: 498 bp    Location: 385871..386368   Strand: +
>XM_004867153.1
ATGGTGACTCCCATGGATTGCCTCATAGCCCGTAGAAGAGCTGAAGTCAATAAGCAACATGTAAGGTGTCAGAAATACTTGGAATTTGGACACTGGACTTATGAATGCACTGGAAAAAGAAAATACCTACATAGGCCATCAAGAACAGCAGAACTAAAAAAAGCTTTAAAAGAAAAAGAAAACAGGTTGTTATTACAGCAAAGCATTGGAGAAACTAATAGAGAAAGAAAGACCAAGAAAAAAAGGTCCAAGAGTGTAACTAGTTCCAGCAGCGATAGCAGTGACAGTTCAGCCAGTGACTCTTCATCAGGGAGCGAGGACACAGCTACCTCCTCCTCCGAGGACGGGGGCTCCGACGAGAGCTCCTCCTGCTGGTCCTCCTCAGCCGCCTCCTCCTGCTCCTCCTCGGACTCAGCCTCGGGCTCCAGCTCTCGCAGCAGCAGCAGGGAGAGCAGCTCTGAGGGTGAGCCACTGAAGAAGAAGAAGGAGAAGGAGGAG

XM_004867142.1 Coding sequence

Qpctl glutaminyl-peptide cyclotransferase-like, transcript variant X2

Length: 867 bp    Location: 7488195..7481310   Strand: -
>XM_004867142.1
ATGCGTTCCGGGGGCCGCGGGCGGCCCCGGCTGCGGCTCGGCGAACGCGGCCTTCTAGAGCCACCTTCACTGCCCAAGCGCCGCCTGCTAGCGCGGCTGCAGCTGTTTCCTCTGCTGCTGGCTGTGGCCGTGGGATTGGCGCTCTACATCATCTGGAGCGGCTGGCACCGCGGGATTGAGGAGCTGTCAAGGGGCCGGGAGTTGCGGGCTCCTCTAGTTGGAAACCTCCCTGAAGCCCAGCTGCGGAAAGTGGTGGGACAACTGGATCCTCAGCGGCTCTGGAATACTTATTTGCGTCCTCTGTTGATTGTTCGAACCCCCGGTAGCCCCGGTAATCTCCAAGTCAGAAAGGCAGCCCCAGTGACGCTGCAGCTGCTGTTCTTGGACGGTGAAGAGGCGCTGAAGGAGTGGGGACCCAAGGATTCCCTTTATGGCTCCCGGCACCTAGCCCAGCTCATGGCATCCATGCCCCACAGTCCTGGCCCCACCAGGATTCAGGCCATTGAGCTCTTTGTGCTGCTTGATCTCCTGGGAGCCCCCAGTCCGACCTTCTACAGCCACTTTCCCCACACGAACCGCTGGTTCCATCGGCTGCGGAGCATCGAGAAGCGTCTGCACCGTTTGAACCTGCTGCAGGCTCACCCCCAGGAAGTGATGTACTTCCAGCCCGGGGAGCCGCCGGGCTCTGTGGAAGATGACCATATCCCCTTCCTCCGCAGAGGGGTCCCGGTGCTTCACCTCATTGCCACGCCCTTCCCCTCTGTGTGGCACACACCTGGCGACACAGAGGCCAATCTCCACCCGCCCACTGTGCACAACCTCAGCCGCATCCTGGCCGTGTTCCTCGCTGAATACCTGGGGCTGTAG

XM_004867145.1 Coding sequence

Opa3 optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)

High confidence: 3 potential gene matches
Length: 543 bp    Location: 7580823..7604773   Strand: +
>XM_004867145.1
ATGGTGGTGGGCGCGTTCCCTATGGCGAAGCTGCTATACCTCGGCATCCGGCAGGTCAGCAAGCCGCTTGCCAACCGCATTAAGGAGGCTGCCCGCCGAAGCGAGTTCTTCAAGACCTATGTCTGCCTTCCGCCGGCACAGCTGTACCACTGGGTGGAGATGCGGACCAAGATGCGCATCATGGGCTTCCGGGGCACGGTCATCAAGCCGCTCAACGAGGAGGCGGCCGCTGAGCTGGGCGCCGAGCTGCTGGGCGAAGCCACCATCTTCATCGTGGGCGGGGGCTGCCTGGTGCTGGAGTACTGGCGCCACCAGACGCAGCAGCGCCACAAGGAGGAGGAGCAGCGCGCTGCCTGGGACGCGCTGCGGGACGAAGTGGGCCACCTGGCACTGGCGCTCGAGGCGCTGCAGGCGCAGGTGCAAGCGGCGTCGTCTCAGAGCGCCCTGGAGGAGCTGCGCGCCGAGCTGCAGGAGGTGCGCGCGCAGCTCTGCGCCCCTGACCCGCCGCCCGCGTGCCACGCAGCGTCTTCCTCCAAGAAATAG

XM_004867140.1 Coding sequence

Snrpd2 small nuclear ribonucleoprotein D2 polypeptide 16.5kDa

High confidence: 1 potential gene match
Length: 357 bp    Location: 7488670..7495303   Strand: +
>XM_004867140.1
ATGAGCCTCCTCAATAAGCCCAAGAGTGAGATGACCCCAGAGGAGCTGCAAAAGCGGGAGGAGGAGGAATTTAACACAGGTCCACTCTCTGTGCTGACCCAGTCAGTCAAGAACAACACTCAGGTGCTCATCAACTGCCGCAACAACAAGAAACTCCTGGGCCGTGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAGAACGTGAAGGAGATGTGGACTGAGGTCCCCAAGAGCGGCAAGGGCAAGAAGAAGTCCAAGCCGGTCAACAAGGACCGCTACATCTCCAAGATGTTCTTGCGCGGGGACTCAGTCATCGTGGTGCTGCGGAACCCGCTCATCGCTGGCAAGTAG

XM_004867129.1 Coding sequence

Dmpk dystrophia myotonica-protein kinase, transcript variant X2

Length: 2067 bp    Location: 7419567..7428615   Strand: +
>XM_004867129.1
ATGTCAGCCGAGGTACGGCTGAGGCGGCTCCAGCAGCTGGCGCTGGACCCCAGCTTCCTGGGGCTGGAGCCCCTGCTCGACCTTCTCCTGGGCGTCCACCAGGAGCTGGGTGCCTCCGACCTGGCCCAGGACAAGTACGTGGCCAACTTCTTACAGTGGGCGGAGCCCATTGTGGCCAGGCTTAAGGAGATCCGACTGCAGAGGGATGACTTTGAGATTCTGAAAGTAATTGGACGCGGGGCGTTCAGCGAGGTAGCGGTGGTGAAGATGAAGCAGACGGGCCAGGTGTACGCCATGAAGATCATGAATAAGTGGGACATGCTGAAGAGAGGCGAGGTGTCGTGCTTCCGCGAAGAGAGGGACGTGTTGGTGAACGGCGACCGCCGTTGGATCACGCAGCTGCACTTCGCCTTCCAGGACGAGAACTACCTGTACCTGGTCATGGAATACTACGTGGGCGGGGACCTGCTAACGCTGCTGAGCAAGTTTGGGGAGCGGATCCCGGCCGAGATGGCGCGCTTCTACCTGGCCGAGATTGTCATGGCCATAGACTCAGTGCACCGGCTGGGCTATGTGCACAGGGACATCAAACCAGATAACATCCTGCTGGACCGCTGCGGCCACATCCGCCTGGCGGACTTTGGCTCCTGCCTAAAGCTGCGGGAGGATGGAACGGTGCGGTCGTTGGTGGCTGTGGGCACCCCGGACTACTTGTCTCCTGAGATCCTGCAGGCTGTGGGCGGCGGACCTGGGACAGGCAGCTACGGGCCAGAGTGTGACTGGTGGGCGCTGGGTGTGTTCGCCTACGAAATGTTCTATGGTCAGACGCCCTTCTACGCGGACTCCACGGCTGAGACCTACGGCAAAATCGTGCACTACAAGGAGCACCTGTCTTTGCCGCTTGCAGACATGGGGGTCCCCGAGGAGGCTCGGGACCTCATCCAGGGGCTGCTGTGTCCCCCGGAAATTCGGTTGGGCCGGGATGGAGCGGAGGATTTCCGGAAGCATCCTTTCTTCTTTGGCCTAGACTGGGAAGGTCTTCGTGACAGCGTGCCCCCTTTCACACCGGACTTCGAGGGTGCCACCGACACATGCAACTTCGATGTGGTGGAGGATGGGCTCACTGCCATGGAGACACTGTCGGACATGCAGGAAGGCATACCACTGGGGGTGCACCTGCCTTTTGTGGGCTTCTCCTACTCCTGCTTGGCCCTCAGGGACAATGAGGTCCCAGACCCCACACCCATGGAACTGGAGGCCCAGCAGTTGCCTGAGCCACATGTGCAAGTGCCCAGTGTGGAGCCCACAGTGTACCCACCAGAAGAAACAGCTGAAGTGCCAGATCCACCAGCTGTCCCTGCAGCAGAGGAGACAGCGGCAGGGGAGGAGGTGACACTGCGGGAGCTCCAGGAAGCCCTGGAGGAGGAGGTTCGCACCAGGCAGAGCCTGAGCCGGGAGCTGGAGGCCATCCGCACCACCAACCAGAGCTTCGCCAGTCAGCTACTCGAGGCTGAAGCCCGGAACCGAGACCTAGAGGCGCATGTTCGGCAGCTACAGGAGCGGATGGAGCTGCTGCAGGCCCCGGGAGCCGCAGGCGAGTCCCCCGCCACCCTGCTCCCCCGGGTGCAGAGCCTGTGTGCGACACCGTGGGAGGGCAGGGGCCCAGGCTGGGGCACGCCGCACCACCGCCCTCCTCCGCCCCTCCACGCGCCATCTGCCTCTCTTCTCCTTCCAGCTGTCACGGGGGTCCCCAGTCCCCGGGCCACGGATGCACTTTCCCATGTAAGACCCCTTTCTTTCCCCTGCCTCAGGCCTGCTACCCCCTCCCTGTCTCCTCGTCCAGATTTAGGGTTCACCCTACTTCTTTGGGGCTCCAGAAGGCAGACGCCATTCAGCCCCACATCGATCAGATTCTCCTCGGTTCAGGGCTTTCAACGGATCCTTTTCGGATCCTCAGAGATTCCCTTCCTGGCCTCGATTCCCCTTGCTGCCCTTCGCCCCCCGCCGTGGGCGGCTGGGCTAGTTTGGGCTCCGATCCGGTCACCTGTCCCTTCTCTCTCCAGCTAG

XM_004867133.1 Coding sequence

Dmpk dystrophia myotonica-protein kinase, transcript variant X6

Length: 1887 bp    Location: 7419567..7429572   Strand: +
>XM_004867133.1
ATGTCAGCCGAGGTACGGCTGAGGCGGCTCCAGCAGCTGGCGCTGGACCCCAGCTTCCTGGGGCTGGAGCCCCTGCTCGACCTTCTCCTGGGCGTCCACCAGGAGCTGGGTGCCTCCGACCTGGCCCAGGACAAGTACGTGGCCAACTTCTTACAGTGGGCGGAGCCCATTGTGGCCAGGCTTAAGGAGATCCGACTGCAGAGGGATGACTTTGAGATTCTGAAAGTAATTGGACGCGGGGCGTTCAGCGAGGTAGCGGTGGTGAAGATGAAGCAGACGGGCCAGGTGTACGCCATGAAGATCATGAATAAGTGGGACATGCTGAAGAGAGGCGAGGTGTCGTGCTTCCGCGAAGAGAGGGACGTGTTGGTGAACGGCGACCGCCGTTGGATCACGCAGCTGCACTTCGCCTTCCAGGACGAGAACTACCTGTACCTGGTCATGGAATACTACGTGGGCGGGGACCTGCTAACGCTGCTGAGCAAGTTTGGGGAGCGGATCCCGGCCGAGATGGCGCGCTTCTACCTGGCCGAGATTGTCATGGCCATAGACTCAGTGCACCGGCTGGGCTATGTGCACAGGGACATCAAACCAGATAACATCCTGCTGGACCGCTGCGGCCACATCCGCCTGGCGGACTTTGGCTCCTGCCTAAAGCTGCGGGAGGATGGAACGGTGCGGTCGTTGGTGGCTGTGGGCACCCCGGACTACTTGTCTCCTGAGATCCTGCAGGCTGTGGGCGGCGGACCTGGGACAGGCAGCTACGGGCCAGAGTGTGACTGGTGGGCGCTGGGTGTGTTCGCCTACGAAATGTTCTATGGTCAGACGCCCTTCTACGCGGACTCCACGGCTGAGACCTACGGCAAAATCGTGCACTACAAGGAGCACCTGTCTTTGCCGCTTGCAGACATGGGGGTCCCCGAGGAGGCTCGGGACCTCATCCAGGGGCTGCTGTGTCCCCCGGAAATTCGGTTGGGCCGGGATGGAGCGGAGGATTTCCGGAAGCATCCTTTCTTCTTTGGCCTAGACTGGGAAGGTCTTCGTGACAGCGTGCCCCCTTTCACACCGGACTTCGAGGGTGCCACCGACACATGCAACTTCGATGTGGTGGAGGATGGGCTCACTGCCATGGAGACACTGTCGGACATGCAGGAAGGCATACCACTGGGGGTGCACCTGCCTTTTGTGGGCTTCTCCTACTCCTGCTTGGCCCTCAGGGACAATGAGGTCCCAGACCCCACACCCATGGAACTGGAGGCCCAGCAGTTGCCTGAGCCACATGTGCAAGTGCCCAGTGTGGAGCCCACAGTGTACCCACCAGAAGAAACAGCTGAAGTGCCAGATCCACCAGCTGTCCCTGCAGCAGAGGAGACAGCGGCAGGGGAGGAGGTGACACTGCGGGAGCTCCAGGAAGCCCTGGAGGAGGAGGTTCGCACCAGGCAGAGCCTGAGCCGGGAGCTGGAGGCCATCCGCACCACCAACCAGAGCTTCGCCAGTCAGCTACTCGAGGCTGAAGCCCGGAACCGAGACCTAGAGGCGCATGTTCGGCAGCTACAGGAGCGGATGGAGCTGCTGCAGGCCCCGGGAGCCGCAGCTGTCACGGGGGTCCCCAGTCCCCGGGCCACGGATGCACTTTCCCATATGGCCCCCCGGCCGTGGCTCTGGGCCAGTGCCCGCTGGTGGGGCCAGGCCCCATGCTCCGCCGCCACCTGCTGCTCCCTGCCAGGGTCCCTAGGCCTGGCCTATCCGAGGCGTGTAGCCTGCTCCTGTTCGCCGCTGTTCTGGTTTGTGCCACCGCCCTGGGCTGCTTTGGGTTGGTGGCCCACGCGGGCCATCTCACCCCAGCCTGGCGTTGCCCGGGAGCAGCCTTCGCCCCCTGAACCCTAG

XM_004867135.1 Coding sequence

Dmpk dystrophia myotonica-protein kinase, transcript variant X8

Length: 1821 bp    Location: 7419567..7429572   Strand: +
>XM_004867135.1
ATGTCAGCCGAGGTACGGCTGAGGCGGCTCCAGCAGCTGGCGCTGGACCCCAGCTTCCTGGGGCTGGAGCCCCTGCTCGACCTTCTCCTGGGCGTCCACCAGGAGCTGGGTGCCTCCGACCTGGCCCAGGACAAGTACGTGGCCAACTTCTTACAGTGGGCGGAGCCCATTGTGGCCAGGCTTAAGGAGATCCGACTGCAGAGGGATGACTTTGAGATTCTGAAAGTAATTGGACGCGGGGCGTTCAGCGAGGTAGCGGTGGTGAAGATGAAGCAGACGGGCCAGGTGTACGCCATGAAGATCATGAATAAGTGGGACATGCTGAAGAGAGGCGAGGTGTCGTGCTTCCGCGAAGAGAGGGACGTGTTGGTGAACGGCGACCGCCGTTGGATCACGCAGCTGCACTTCGCCTTCCAGGACGAGAACTACCTGTACCTGGTCATGGAATACTACGTGGGCGGGGACCTGCTAACGCTGCTGAGCAAGTTTGGGGAGCGGATCCCGGCCGAGATGGCGCGCTTCTACCTGGCCGAGATTGTCATGGCCATAGACTCAGTGCACCGGCTGGGCTATGTGCACAGGGACATCAAACCAGATAACATCCTGCTGGACCGCTGCGGCCACATCCGCCTGGCGGACTTTGGCTCCTGCCTAAAGCTGCGGGAGGATGGAACGGTGCGGTCGTTGGTGGCTGTGGGCACCCCGGACTACTTGTCTCCTGAGATCCTGCAGGCTGTGGGCGGCGGACCTGGGACAGGCAGCTACGGGCCAGAGTGTGACTGGTGGGCGCTGGGTGTGTTCGCCTACGAAATGTTCTATGGTCAGACGCCCTTCTACGCGGACTCCACGGCTGAGACCTACGGCAAAATCGTGCACTACAAGGAGCACCTGTCTTTGCCGCTTGCAGACATGGGGGTCCCCGAGGAGGCTCGGGACCTCATCCAGGGGCTGCTGTGTCCCCCGGAAATTCGGTTGGGCCGGGATGGAGCGGACTTCGAGGGTGCCACCGACACATGCAACTTCGATGTGGTGGAGGATGGGCTCACTGCCATGGTGAGCGGGGGCGGGGAGACACTGTCGGACATGCAGGAAGGCATACCACTGGGGGTGCACCTGCCTTTTGTGGGCTTCTCCTACTCCTGCTTGGCCCTCAGGGACAATGAGGTCCCAGACCCCACACCCATGGAACTGGAGGCCCAGCAGTTGCCTGAGCCACATGTGCAAGTGCCCAGTGTGGAGCCCACAGTGTACCCACCAGAAGAAACAGCTGAAGTGCCAGATCCACCAGCTGTCCCTGCAGCAGAGGAGACAGCGGCAGGGGAGGAGGTGACACTGCGGGAGCTCCAGGAAGCCCTGGAGGAGGAGGTTCGCACCAGGCAGAGCCTGAGCCGGGAGCTGGAGGCCATCCGCACCACCAACCAGAGCTTCGCCAGTCAGCTACTCGAGGCTGAAGCCCGGAACCGAGACCTAGAGGCGCATGTTCGGCAGCTACAGGAGCGGATGGAGCTGCTGCAGGCCCCGGGAGCCGCAGCTGTCACGGGGGTCCCCAGTCCCCGGGCCACGGATGCACTTTCCCATCTAGATGGCCCCCCGGCCGTGGCTCTGGGCCAGTGCCCGCTGGTGGGGCCAGGCCCCATGCTCCGCCGCCACCTGCTGCTCCCTGCCAGGGTCCCTAGGCCTGGCCTATCCGAGGCGTGTAGCCTGCTCCTGTTCGCCGCTGTTCTGGTTTGTGCCACCGCCCTGGGCTGCTTTGGGTTGGTGGCCCACGCGGGCCATCTCACCCCAGCCTGGCGTTGCCCGGGAGCAGCCTTCGCCCCCTGA

XM_004867128.1 Coding sequence

Dmpk dystrophia myotonica-protein kinase, transcript variant X1

Length: 2082 bp    Location: 7419567..7428615   Strand: +
>XM_004867128.1
ATGTCAGCCGAGGTACGGCTGAGGCGGCTCCAGCAGCTGGCGCTGGACCCCAGCTTCCTGGGGCTGGAGCCCCTGCTCGACCTTCTCCTGGGCGTCCACCAGGAGCTGGGTGCCTCCGACCTGGCCCAGGACAAGTACGTGGCCAACTTCTTACAGTGGGCGGAGCCCATTGTGGCCAGGCTTAAGGAGATCCGACTGCAGAGGGATGACTTTGAGATTCTGAAAGTAATTGGACGCGGGGCGTTCAGCGAGGTAGCGGTGGTGAAGATGAAGCAGACGGGCCAGGTGTACGCCATGAAGATCATGAATAAGTGGGACATGCTGAAGAGAGGCGAGGTGTCGTGCTTCCGCGAAGAGAGGGACGTGTTGGTGAACGGCGACCGCCGTTGGATCACGCAGCTGCACTTCGCCTTCCAGGACGAGAACTACCTGTACCTGGTCATGGAATACTACGTGGGCGGGGACCTGCTAACGCTGCTGAGCAAGTTTGGGGAGCGGATCCCGGCCGAGATGGCGCGCTTCTACCTGGCCGAGATTGTCATGGCCATAGACTCAGTGCACCGGCTGGGCTATGTGCACAGGGACATCAAACCAGATAACATCCTGCTGGACCGCTGCGGCCACATCCGCCTGGCGGACTTTGGCTCCTGCCTAAAGCTGCGGGAGGATGGAACGGTGCGGTCGTTGGTGGCTGTGGGCACCCCGGACTACTTGTCTCCTGAGATCCTGCAGGCTGTGGGCGGCGGACCTGGGACAGGCAGCTACGGGCCAGAGTGTGACTGGTGGGCGCTGGGTGTGTTCGCCTACGAAATGTTCTATGGTCAGACGCCCTTCTACGCGGACTCCACGGCTGAGACCTACGGCAAAATCGTGCACTACAAGGAGCACCTGTCTTTGCCGCTTGCAGACATGGGGGTCCCCGAGGAGGCTCGGGACCTCATCCAGGGGCTGCTGTGTCCCCCGGAAATTCGGTTGGGCCGGGATGGAGCGGAGGATTTCCGGAAGCATCCTTTCTTCTTTGGCCTAGACTGGGAAGGTCTTCGTGACAGCGTGCCCCCTTTCACACCGGACTTCGAGGGTGCCACCGACACATGCAACTTCGATGTGGTGGAGGATGGGCTCACTGCCATGGTGAGCGGGGGCGGGGAGACACTGTCGGACATGCAGGAAGGCATACCACTGGGGGTGCACCTGCCTTTTGTGGGCTTCTCCTACTCCTGCTTGGCCCTCAGGGACAATGAGGTCCCAGACCCCACACCCATGGAACTGGAGGCCCAGCAGTTGCCTGAGCCACATGTGCAAGTGCCCAGTGTGGAGCCCACAGTGTACCCACCAGAAGAAACAGCTGAAGTGCCAGATCCACCAGCTGTCCCTGCAGCAGAGGAGACAGCGGCAGGGGAGGAGGTGACACTGCGGGAGCTCCAGGAAGCCCTGGAGGAGGAGGTTCGCACCAGGCAGAGCCTGAGCCGGGAGCTGGAGGCCATCCGCACCACCAACCAGAGCTTCGCCAGTCAGCTACTCGAGGCTGAAGCCCGGAACCGAGACCTAGAGGCGCATGTTCGGCAGCTACAGGAGCGGATGGAGCTGCTGCAGGCCCCGGGAGCCGCAGGCGAGTCCCCCGCCACCCTGCTCCCCCGGGTGCAGAGCCTGTGTGCGACACCGTGGGAGGGCAGGGGCCCAGGCTGGGGCACGCCGCACCACCGCCCTCCTCCGCCCCTCCACGCGCCATCTGCCTCTCTTCTCCTTCCAGCTGTCACGGGGGTCCCCAGTCCCCGGGCCACGGATGCACTTTCCCATGTAAGACCCCTTTCTTTCCCCTGCCTCAGGCCTGCTACCCCCTCCCTGTCTCCTCGTCCAGATTTAGGGTTCACCCTACTTCTTTGGGGCTCCAGAAGGCAGACGCCATTCAGCCCCACATCGATCAGATTCTCCTCGGTTCAGGGCTTTCAACGGATCCTTTTCGGATCCTCAGAGATTCCCTTCCTGGCCTCGATTCCCCTTGCTGCCCTTCGCCCCCCGCCGTGGGCGGCTGGGCTAGTTTGGGCTCCGATCCGGTCACCTGTCCCTTCTCTCTCCAGCTAG

XM_004867127.1 Coding sequence

Dmwd dystrophia myotonica, WD repeat containing

High confidence: 4 potential gene matches
Length: 2013 bp    Location: 7411594..7418370   Strand: +
>XM_004867127.1
ATGGCGGCGGGTGGCGGGGAGGGTGGCTCGGGCCCCGGCGCCGCCATGGGGGACTGCGCGGAGATCAAGTCGCAGTTCCGCACCCGCGAGGGCTTCTACAAGCTGCTCCCCGGCGACGGCGCCGCTCGCAGGTCGGGGCCGGCCTCCGCCCAGACCCCGGCGCCGCCCCAGCCGCCGCAGCCCCCGCCCGGCCCTGCCTCTACCTCTGGCCCCGGCGCGGCGGGCCCCGCGTCGTCCCCGCCGCCCGCAGGCCCCGGGCCCGGGCCCGCGCTGCCAGCCGTGCGCCTCAGCCTCGTGCGCCTCGGGGAGCCTGAAGGCTCGGGGCCTGGGGAGCCGCCCGCCACGCCCGCGGGACTGGGCGCAGGAGGAGACCGCGTCTGCTTCAATTTGGGCCGCGAGCTTTATTTCTACCCCGGCTGCTGCCGCCGCGGGAGCCAACGGTCCATTGACCTCAACAAGCCCATCGACAAACGGATCTACAAGGGCACCCAGCCCACCTGCCATGACTTCAACCAGTTCACTGCTGCCACGGAGACCATCTCCCTGCTGGTGGGTTTCTCGGCCGGCCAGGTGCAATACCTGGACCTCATCAAGAAGGACACCAGCAAGCTGTTCAATGAGGAGCGGCTGATTGACAAGACCAAGGTGACATATCTCAAGTGGCTGCCTGAATCTGAGAGCCTGTTCCTGGCTTCCCACGCTAGCGGCCACCTGTACTTGTACAATGTCAGCCACCCGTGCGCCTCAGCCCCACCCCAGTACAGCCTGCTGAAGCAGGGCGAGGGCTTTGCTGTCTACGCCGCCAAGAGCAAAGCACCCCGCAACCCGCTGGCCAAGTGGGCGGTGGGCGAAGGGCCCCTCAACGAGTTTGCCTTCTCGCCCGACGGCCGCCACCTGGCCTGTGTCAGCCAGGACGGCTGCCTGCGTGTCTTCCACTTCGACTCTATGCTGCTGCGGGGGCTCATGAAGAGCTACTTTGGGGGCCTGCTCTGCGTGTGCTGGAGCCCCGACGGCCGCTATGTAGTGACAGGAGGCGAAGACGACCTGGTCACTGTGTGGTCCTTCACTGAGGGCCGCGTGGTGGCTCGAGGCCACGGTCACAAATCCTGGGTCAACGCTGTGGCTTTTGACCCCTATACCACGCGGGCAGAAGAGGTGACAGCGGGCAGTGGTGACGGGGATGGGAGCGGCGAGGAGGAGGAGGAGCCTGAGGCCGCTGGCCCAGGCGCAGGCGGGGGTGCCCCGCTCTCCCCGCTGCCCAAGGCCGGCTCCATCACTTACCGCTTCGGTTCAGCGGGTCAGGACACGCAGTTCTGCCTGTGGGACCTCACGGAAGACGTGCTTTCCCCACACCCGCCCCTGACCCGCACACGCACTCTTCCTAGCACCCCGGGTGCCACGCCGCCAGCCACTGGCAACTCGAGGGGTCCGGAGCCTGGCCTGGGCCCCCTGCCCCGCTCCCTGTCCCGCTCTAACAGCCTCCCACACCCAGCAGGCGGTGGCAAGGCTGGCGGCCCAGGTGCTGCAGCGGAGCCGGGCACGCCGTTCAGCATTGGCCGCTTCGCCACGCTCACCCTGCAGGAGCGGCGGGACCGGGGGTCCGAGAAGGAGCACAAGCGCTACCATAGCCTGGGCAACATCAGCCGAGGGGGCAGTGGGGGCAGCGGTGGCGACAAGCCCAGCGGCCCTGCCCCCCGCAGCCGCCTGGACCCTGCCAAGGTGCTAGGCACCGCGCTGTGCCCACGCATCCACGAGGTGCCACTGCTGGAGCCCCTGGTGTGCAAGAAGATCGCCCAGGAGCGCCTGACGGTGCTGTTGTTCCTGGAGGACTGCATCATCACCGCCTGCCAGGAGGGCCTCATCTGCACCTGGGCCAGGCCCGGCAAGGCATTCACAGAGGAGGAGACCGAGGCCCAGGCAGGGGAAGGAAGTTGGCCCAGGTCACCCAGCAAGTCAGTGGTAGAGGGCATCTCCTCCCAGCCAGGCAACTCCCCGAGCGGCACAGTGGTGTGA

XM_004867130.1 Coding sequence

Dmpk dystrophia myotonica-protein kinase, transcript variant X3

Length: 2043 bp    Location: 7419567..7429572   Strand: +
>XM_004867130.1
ATGTCAGCCGAGGTACGGCTGAGGCGGCTCCAGCAGCTGGCGCTGGACCCCAGCTTCCTGGGGCTGGAGCCCCTGCTCGACCTTCTCCTGGGCGTCCACCAGGAGCTGGGTGCCTCCGACCTGGCCCAGGACAAGTACGTGGCCAACTTCTTACAGTGGGCGGAGCCCATTGTGGCCAGGCTTAAGGAGATCCGACTGCAGAGGGATGACTTTGAGATTCTGAAAGTAATTGGACGCGGGGCGTTCAGCGAGGTAGCGGTGGTGAAGATGAAGCAGACGGGCCAGGTGTACGCCATGAAGATCATGAATAAGTGGGACATGCTGAAGAGAGGCGAGGTGTCGTGCTTCCGCGAAGAGAGGGACGTGTTGGTGAACGGCGACCGCCGTTGGATCACGCAGCTGCACTTCGCCTTCCAGGACGAGAACTACCTGTACCTGGTCATGGAATACTACGTGGGCGGGGACCTGCTAACGCTGCTGAGCAAGTTTGGGGAGCGGATCCCGGCCGAGATGGCGCGCTTCTACCTGGCCGAGATTGTCATGGCCATAGACTCAGTGCACCGGCTGGGCTATGTGCACAGGGACATCAAACCAGATAACATCCTGCTGGACCGCTGCGGCCACATCCGCCTGGCGGACTTTGGCTCCTGCCTAAAGCTGCGGGAGGATGGAACGGTGCGGTCGTTGGTGGCTGTGGGCACCCCGGACTACTTGTCTCCTGAGATCCTGCAGGCTGTGGGCGGCGGACCTGGGACAGGCAGCTACGGGCCAGAGTGTGACTGGTGGGCGCTGGGTGTGTTCGCCTACGAAATGTTCTATGGTCAGACGCCCTTCTACGCGGACTCCACGGCTGAGACCTACGGCAAAATCGTGCACTACAAGGAGCACCTGTCTTTGCCGCTTGCAGACATGGGGGTCCCCGAGGAGGCTCGGGACCTCATCCAGGGGCTGCTGTGTCCCCCGGAAATTCGGTTGGGCCGGGATGGAGCGGAGGATTTCCGGAAGCATCCTTTCTTCTTTGGCCTAGACTGGGAAGGTCTTCGTGACAGCGTGCCCCCTTTCACACCGGACTTCGAGGGTGCCACCGACACATGCAACTTCGATGTGGTGGAGGATGGGCTCACTGCCATGGTGAGCGGGGGCGGGGAGACACTGTCGGACATGCAGGAAGGCATACCACTGGGGGTGCACCTGCCTTTTGTGGGCTTCTCCTACTCCTGCTTGGCCCTCAGGGACAATGAGGTCCCAGACCCCACACCCATGGAACTGGAGGCCCAGCAGTTGCCTGAGCCACATGTGCAAGTGCCCAGTGTGGAGCCCACAGTGTACCCACCAGAAGAAACAGCTGAAGTGCCAGATCCACCAGCTGTCCCTGCAGCAGAGGAGACAGCGGCAGGGGAGGAGGTGACACTGCGGGAGCTCCAGGAAGCCCTGGAGGAGGAGGTTCGCACCAGGCAGAGCCTGAGCCGGGAGCTGGAGGCCATCCGCACCACCAACCAGAGCTTCGCCAGTCAGCTACTCGAGGCTGAAGCCCGGAACCGAGACCTAGAGGCGCATGTTCGGCAGCTACAGGAGCGGATGGAGCTGCTGCAGGCCCCGGGAGCCGCAGGCGAGTCCCCCGCCACCCTGCTCCCCCGGGTGCAGAGCCTGTGTGCGACACCGTGGGAGGGCAGGGGCCCAGGCTGGGGCACGCCGCACCACCGCCCTCCTCCGCCCCTCCACGCGCCATCTGCCTCTCTTCTCCTTCCAGCTGTCACGGGGGTCCCCAGTCCCCGGGCCACGGATGCACTTTCCCATATGGCCCCCCGGCCGTGGCTCTGGGCCAGTGCCCGCTGGTGGGGCCAGGCCCCATGCTCCGCCGCCACCTGCTGCTCCCTGCCAGGGTCCCTAGGCCTGGCCTATCCGAGGCGTGTAGCCTGCTCCTGTTCGCCGCTGTTCTGGTTTGTGCCACCGCCCTGGGCTGCTTTGGGTTGGTGGCCCACGCGGGCCATCTCACCCCAGCCTGGCGTTGCCCGGGAGCAGCCTTCGCCCCCTGAACCCTAG

XM_004867122.1 Coding sequence

Pglyrp1 peptidoglycan recognition protein 1

High confidence: 4 potential gene matches
Length: 579 bp    Location: 7220227..7225163   Strand: +
>XM_004867122.1
ATGTCCAGCCGCTGCACGCTGCCTGCCTGGATCCTCCTTGCCCTCCTCGGAGTGGCTCAGGGAGCTCGGGGCCAGAGCAGCTGCGGCTCCATCGTACCTCGGAGGGACTGGAAGGCCTTGGCTTCCGACTGCACCGAGCGCATGACCCTGCCGGCACGCTACGTGGTGATATCGCACACGGCGGGCAGCACCTGCGACTGCCCGACCTCCTGTGAGCAGCAGGCCCGGAACGTGCAGTACTATCACATGCGCACGGAGGGCTGGTGCGACGTGGGCTACAACTTCCTGATTGGAGAAGACGGACTTGTCTATGAGGGCCGGGGCTGGAACACCAAGGGGGCCCACTCAGGTCCCAACTGGAACTCCAAATCCATTGGCATCAGCTTCATGGGCAACTACATGGAGCGGGTGCCCCCAAAACGGGCCGTCCGGGCAGCTCAGAATCTGTTGGCCTGTGGTGTGGATCGGGGAGCTCTGAGATCCAACTATGAGCTCAAAGGACACCGGGATGTGCAGGCCACGCTCTCTCCAGGTGATCAGCTCTACCAAATCATCCAGAGTTGGCCACACTATCGTTGA

XM_004867124.1 Coding sequence

Mypop Myb-related transcription factor, partner of profilin

High confidence: 4 potential gene matches
Length: 1191 bp    Location: 7317082..7326038   Strand: +
>XM_004867124.1
ATGGCCTCTGCGGCTGCGGGCGAGGCAGAGGAGACCACCCGGCTGCGCAAGCCGCGCTTCTCGTTCGAAGAGAATCAGATCCTGATCCGGGAGGTGCGTGCCCACTACCCGCAGCTGTACGGCGCGCAGAGCCGTCGAGTGAGCGTGGCTGAGCGGCGGCGCGTGTGGGACGGCATCGCAGCCAAGATCAATGGCATCACCAGCTGGAAGCGCACCGGGCAGGAGGTGCAGAAGCGCTGGAACGACTTCAAGCGCCGCACCAAAGAGAAGCTGGCCCGAGTACCGCACTCTACGCAGGGTGCGGGTCCTACAGCCGAGGACGCCTTCTCCGCCGAGGAGGAGACCATTTTTGCCATCCTGGGGCCCGGTGTGGCGGGGCCGGGGGCTGGTGCTGGGGCCGAGGAGCCGCCTGCAGCCGCCTCCTCACAGCCGCTGGCCCCAAGCGCCTGTGCCCAACGCTATGTGTTATCTGAGGACCGCAGGGAGGACCGACGGGCAGATATACCAGCCCACGGCAAGGGGGGCTCCAGCAGCCCCGAGCCGGAGCCCTGGGCCCGGCCCTCCTGCAATCCCCAGGAAGGGGGCTGCCCACAGTCCAAGGAGCGTGAGTCCCCGCCCCCTCCAGCCGTGCAGACTGTTCAGCTGCCCCGCCTGGCCTTGTCTCCACCGCCCTCTGCCCCTGCACCCCGACCCCCGCCGCTGACACAGGTGGCACCCGCACCCCCCAGCCCCCCACCCGCCCCTCGGCCTCCGCCCACGCCTTCGGCCCCAGACCCCTCCCTGGACTTCCTGCGAGCCCAGCAGGAGACTGCCCACGCCATCCGGGAGCTGGCTGGTACCCTTCGACAGGGCCTGGCCAAACTGAGCGAGGCTCTCAGCGCCCTGCTACCCCTTCTCCCCGGAACCCCAGTCGACCCACTGCCCCCGCCTCAGCCCCCGTCCCCGCCTCCTAGGCCAGTCCCGCCCCCACCTGCCCCCAAGGTGGAGGTCTCTGCAGAACCCGTGTCCGTGGTGGCTGCTGTCGTGGATGGGGCTGTGGTGGCCACCAGGGGGGTAATCATCCCTCCTCGGAGTGAGGAGGGGGTGCCTCGGCCACCCCAACCCCCACTCCCTGTACACGACTCACCCCCACACAAGAGGAGGAAAGGGTTCCCTACGCGGAAGAGGCGGGGCCGATGGAAATCTCCGTGA

XM_004867115.1 Coding sequence

Hif3a hypoxia inducible factor 3, alpha subunit, transcript variant X4

Length: 1911 bp    Location: 7157494..7133462   Strand: -
>XM_004867115.1
ATGGCGCTGGGGCTGCAGCGGGCAAGGTCGAGCACGGAGCTGCGCAAGGAGAAGTCCCGGGATGCGGCCCGCAGCCGGCGCAGCCAGGAGACCGAGGTGCTGTACCAGCTGGCGCACACGCTGCCCTTCGCGCGCGGCGTCAGCGCCCACCTGGACAAGGCTTCCATCATGCGCCTCACCATCAGCTACCTGCGCATGCACCGCCTCTGCGCCGCAGGTGAGTGGAACCAGGTGGGAGCCAAGGGAGAACCACTGGATGCCTGCTACCTGAAGGCCCTGGAGGGCTTCGTCATGGTGCTCACCACCGAGGGAGACATGGCTTACCTGTCTGAGAATGTCAGCAAACACCTGGGCCTCAGTCAGCTGGAGCTCATCGGACACAGTATATTTGATTTCGTCCATCCCTGTGACCAAGAGGAGCTCCAGGACGCCCTGACCCCCAGGCCGAGCCTGTCCAAGAAGAAGCCAGAGGCCCCCACCCAGCGGTGCTTCTCCTTGCGCATGAAGAGCACCCTCACCAGCCGTGGGCGCACCCTCAACCTCAAGGCAGCCACCTGGAAGGTGCTGCACTGCTCTGGACACATGAGGGCCTACAAGTCCTCAGGTCAGCCGGCCCTGGCCGGGAACCCCAGCTCCGAGCCCCCCCTGCAGTGCCTGGTGCTCATCTGCGAGGCCATCCCCCACCCGGGCAACCTGGAGCCCCCACTGGGCCGGGGCGCCTTCCTGACCCGCCACAGCCTGGACATGAAGTTCACCTACTGTGACGAGAGGATCGCAGAGGTCGCCGGCTACAGCCCAGATGACCTGATCGGCTGCTCCGCCTACGAGTACATCCACGCCCTGGACTCAGATGCAGTCAGCAGGAGCATTCATACCTTGCTGAGCAAGGGCCAGGCAGTGACAGGGCAGTATCGCTTCCTGGCCCGGAGTGGTGGCTACCTGTGGACCCAGACCCAGGCCACGGTGGTGTCTGGGGGCCGGGGCCCCCAGTCAGAGAGTATCATCTGCGTCCACTTCCTGATCAGCCGGGTGGAAGAGACTGGAGTGGTGCTGTCCCTGGAGCAAACAGAGCGACACTCTCGCAGACCCCTTCAGCGTGGCACCTCCTCTCAGAAGGATGGCCCTAATCCTGGGGACAGGCTTGATACCCCGGGTCCCTGGATCCTGGCCTTCCTGCACCCCCCTGCCCTGAGTGAGGCCACCCTGGCTGCTGACCCCCGCCGCTTCTGTAGCCCTGACCTGCGCCGCCTCCTGGCACCCATCCTGGATGGGGCTGCAGTAGCCACCACCCCCAGCACACCACAGGCCGCCTGGCGCCCCCGAAGTCCTCTCGCGGCTGATCTCCCAGATGAACTACTCGTGGGCATGGAGCGCATACACAGACTCGGTGCTGCTGGGAAGAACCCTGAGGCCGAGGACACAGATCTAAACATAGCTTCGGACGCCGATGCTCTGGACTTGGAGATGCTGGCCCCCTACATCTCCATGGATGATGACTTCCAGCTCAGCTCCAGCGAGCAGCTGCCCAGGGCCTTCCACAGACCTCCAGGGACCGTGCCCCGTCCCCGTGCTCAGAGCTTCCATGGCCTGTCACCTCCAACCCCTGAGCCCGCCCCGCTGCCACGCTGGGGGAGTGACCCCCGGCTGAGCTGCTCCAGCCCTCCCAGAGGGGACCCCTCAGCTTCCTCCTACACAGTCGGGGCTCGGAAGAGGGCCCTGGCCCAGAGCTCAGAGGATGAGGGGGTGGACCTGCTGGGCGTGAGACCCCCCAAACGGTCCCCCAGTCTAGACCCTGAAAACTTCCTGCTGCCTCCCGTCAGCCTGATGGGGAAGCCAGAGAGGGCCAGGGGCTGGCTGAAGGTCATACGGAAGATTAACGGTCCAGCTGAAGTCAGGACCTTGATCTTCTAG

XM_004867093.1 Coding sequence

Gng8 guanine nucleotide binding protein (G protein), gamma 8, transcript variant X2

High confidence: 4 potential gene matches
Length: 411 bp    Location: 6921110..6940735   Strand: +
>XM_004867093.1
ATGGCTGGAGGGCAGCCTGGCCGGGCTCTGCGAGTTGCACTGGCTCCGGGAGAGGCAGGAGTACCGCGTGCAGCAGGCGCTGCGGCTGGGCCAGCCCGGAATGGGGGGCGCCGAGGCCGAGGACGAGGAGGACGCCGACGAGGACGAGGATGCGGCGGCGGCGCGCCGGGCCGCTGCGGCCCTGGAGGAGCAGCTGCCATGTCCAACAACATGGCCAAGATCGCCGAGGCCCGAAAGACGGTGGAACAGCTGAAGCTGGAAGTGAACATCGACCGCATGAAGGTGTCGCAGGCGGCGGCGGAGCTCCTGGCTTTCTGCGAGACGCACGCCAAAGACGACCCCCTGGTGACTCCGGTACCCGCCGCTGAGAATCCTTTCCGAGACAAGCGCCTCTTTTGCGTCCTCCTGTGA

XM_004867095.1 Coding sequence

Gng8 guanine nucleotide binding protein (G protein), gamma 8, transcript variant X4

Length: 213 bp    Location: 6938759..6940735   Strand: +
>XM_004867095.1
ATGTCCAACAACATGGCCAAGATCGCCGAGGCCCGAAAGACGGTGGAACAGCTGAAGCTGGAAGTGAACATCGACCGCATGAAGGTGTCGCAGGCGGCGGCGGAGCTCCTGGCTTTCTGCGAGACGCACGCCAAAGACGACCCCCTGGTGACTCCGGTACCCGCCGCTGAGAATCCTTTCCGAGACAAGCGCCTCTTTTGCGTCCTCCTGTGA

XM_004867097.1 Coding sequence

Gng8 guanine nucleotide binding protein (G protein), gamma 8, transcript variant X6

Length: 213 bp    Location: 6938782..6940735   Strand: +
>XM_004867097.1
ATGTCCAACAACATGGCCAAGATCGCCGAGGCCCGAAAGACGGTGGAACAGCTGAAGCTGGAAGTGAACATCGACCGCATGAAGGTGTCGCAGGCGGCGGCGGAGCTCCTGGCTTTCTGCGAGACGCACGCCAAAGACGACCCCCTGGTGACTCCGGTACCCGCCGCTGAGAATCCTTTCCGAGACAAGCGCCTCTTTTGCGTCCTCCTGTGA

XM_004867119.1 Coding sequence

Ccdc61 coiled-coil domain containing 61, transcript variant X1

Length: 1539 bp    Location: 7242467..7225232   Strand: -
>XM_004867119.1
ATGGACCAGCCACCTGGCCTGCAGGTGGACTACGTCTTCCGGGGTGTGGAGCACGCCGTGCGCGTGGCGGTGTCAGGGCAGCTGCTGGAGCTGGAGGTGGAGGACCGGATGACAGCTGACCAGTGGCGGGGCGAGTTCGATGCCAGCTTCATTGAAGATTTGACCCACAAGACAGGCAACTTCAAACAGTTCAACATCTTCTGCAACATGCTGGAGTCAGCCCTTACCCAGAGCAGCGAGTCAGTGACCCTTGACCTGCTGACCTACACAGACCTGGAGTCCCTGCGGAACCGCAAGCTGGGCGGCCGCCCGGGCACCATGGCCCCCAGATCAGCCCAGCTCAACTCCAAGCGCTACCTGATCCTCATCTATTCTGTGGAGTTTGACAGGATTCACTACCCGCTGCCCCTCCCATACCAGGGCAAGCCAGACCCTGTGGTTCTGCAGGGCATCATCCGATCGCTGAAGGAGGAGCTGAGTCGCCTTCGGGGCCTGGATGCCCAGGATGCACGGGACACACGAGACACTGAGATCTGGCACCTGCGGGAGCAGGTGTCCCGCCTGGCGTCTGAGAAGCGCGAGCTGGAGGCGCAGCTGGGCCACTCACGGGAGGAGGCACTGGCCGGGCGGGCGGCTCGCCAGGAGGCCGAGCAGCTGCGCGGGCTGGTGCGCGGCCTGGAGCTGGAGCTGCGGCAGGAGCGCGGCCTCGGGCACCGGACGCCAGCCCGCCGGGGCCAGGACTGCCGCCGCCTGGCCAAGGAGCTGGAGGAGGTGAAGGCGTCGGAACGCAGCCTGCGAGCCCGGCTGAAGACCCTGAACAGCGAGCTGGCCTTGTACAAAAGGGGGAGGCGGACTCCGCCGGCGGCGCTGCCCGCGGCCCAGGAGGACCGGGCTTCGTCGTCGCGCGAGCGCTCCACGTCGCGGGGCCGCGGGGCCGCCCGCTCGTCCTCGCGCGAGAGCGGTCGCGGGGCCCGGGGTCGGGGCTGGCCCGCCCGCCCCTCGCCATCGCCCTCAGGTGGGCGCGCGCCGCGCTTCGACCCCACGGCCTTCGTGAAAGCCAAGGAGAAGAAGCAGAGGGAGATCAAGATGAAGCAGCAGCAGCGGAACCGATTGGGCAGTGGAGGAAGCGGGGACGGTCCGTCCATCTCGTGGTCTCGCCAGGCCCGGCCCCCCACTGGCGTGACCGGCAGAGGGGACGCAGCTAACCGCTCGCGCCACCGCAGCTCCTCGGTGGACAGTTTTCGCAGCCGCTGCTCCTCGGCCAGCTCCTGCAGCGAGTTTGAGGATTTCACCGAGTCGCTCTCCAGAGGCCTTCGCTGTCACCGCCGTGGAAAGCCACCCAGCTCCACACCTTGGAGTGGGTCTAACACAAAGTCCTCCCCCCGGGAAGGCTGCAGTCAGAGACGCCTGGCCAGTTCAGGGGGCTGGGTCCCCATCAAAGAGTACAGCTCGGACCACCAGGCGGCTGACATGGCCGAAATAGACGCCCGCCTGAAGGCCTTGCAGGAATATATGAACCGGCTGGACACGCGGTCATGA

XM_004867113.1 Coding sequence

Hif3a hypoxia inducible factor 3, alpha subunit, transcript variant X2

Length: 1998 bp    Location: 7152545..7128285   Strand: -
>XM_004867113.1
ATGGGCTTCCAACGAGACAGGTCGAGCACGGAGCTGCGCAAGGAGAAGTCCCGGGATGCGGCCCGCAGCCGGCGCAGCCAGGAGACCGAGGTGCTGTACCAGCTGGCGCACACGCTGCCCTTCGCGCGCGGCGTCAGCGCCCACCTGGACAAGGCTTCCATCATGCGCCTCACCATCAGCTACCTGCGCATGCACCGCCTCTGCGCCGCAGGTGAGTGGAACCAGGTGGGAGCCAAGGGAGAACCACTGGATGCCTGCTACCTGAAGGCCCTGGAGGGCTTCGTCATGGTGCTCACCACCGAGGGAGACATGGCTTACCTGTCTGAGAATGTCAGCAAACACCTGGGCCTCAGTCAGCTGGAGCTCATCGGACACAGTATATTTGATTTCGTCCATCCCTGTGACCAAGAGGAGCTCCAGGACGCCCTGACCCCCAGGCCGAGCCTGTCCAAGAAGAAGCCAGAGGCCCCCACCCAGCGGTGCTTCTCCTTGCGCATGAAGAGCACCCTCACCAGCCGTGGGCGCACCCTCAACCTCAAGGCAGCCACCTGGAAGGTGCTGCACTGCTCTGGACACATGAGGGCCTACAAGTCCTCAGGTCAGCCGGCCCTGGCCGGGAACCCCAGCTCCGAGCCCCCCCTGCAGTGCCTGGTGCTCATCTGCGAGGCCATCCCCCACCCGGGCAACCTGGAGCCCCCACTGGGCCGGGGCGCCTTCCTGACCCGCCACAGCCTGGACATGAAGTTCACCTACTGTGACGAGAGGATCGCAGAGGTCGCCGGCTACAGCCCAGATGACCTGATCGGCTGCTCCGCCTACGAGTACATCCACGCCCTGGACTCAGATGCAGTCAGCAGGAGCATTCATACCTTGCTGAGCAAGGGCCAGGCAGTGACAGGGCAGTATCGCTTCCTGGCCCGGAGTGGTGGCTACCTGTGGACCCAGACCCAGGCCACGGTGGTGTCTGGGGGCCGGGGCCCCCAGTCAGAGAGTATCATCTGCGTCCACTTCCTGATCAGCCGGGTGGAAGAGACTGGAGTGGTGCTGTCCCTGGAGCAAACAGAGCGACACTCTCGCAGACCCCTTCAGCGTGGCACCTCCTCTCAGAAGGATGGCCCTAATCCTGGGGACAGGCTTGATACCCCGGGTCCCTGGATCCTGGCCTTCCTGCACCCCCCTGCCCTGAGTGAGGCCACCCTGGCTGCTGACCCCCGCCGCTTCTGTAGCCCTGACCTGCGCCGCCTCCTGGCACCCATCCTGGATGGGGCTGCAGTAGCCACCACCCCCAGCACACCACAGGCCGCCTGGCGCCCCCGAAGTCCTCTCGCGGCTGATCTCCCAGATGAACTACTCGTGGGCATGGAGCGCATACACAGACTCGGTGCTGCTGGGAAGAACCCTGAGGCCGAGGACACAGATCTAAACATAGCTTCGGACGCCGATGCTCTGGACTTGGAGATGCTGGCCCCCTACATCTCCATGGATGATGACTTCCAGCTCAGCTCCAGCGAGCAGCTGCCCAGGGCCTTCCACAGACCTCCAGGGACCGTGCCCCGTCCCCGTGCTCAGAGCTTCCATGGCCTGTCACCTCCAACCCCTGAGCCCGCCCCGCTGCCACGCTGGGGGAGTGACCCCCGGCTGAGCTGCTCCAGCCCTCCCAGAGGGGACCCCTCAGCTTCCTCCTACACAGTCGGGGCTCGGAAGAGGGCCCTGGCCCAGAGCTCAGAGGATGAGGGGGTGGACCTGCTGGGCGTGAGACCCCCCAAACGGTCCCCCAGTCTAGACCCTGAAAACTTCCTGCTGCCTCCCGTCAGCCTGAGTTTCCTCCTGATGGGAGGCCAAGCCCCAGGGATCCAGCAGGACCCCCACACCCACTTCCTGGACATGGATGAGCCTTTGGGCCTGGGCCCCTCGCTGCTCTCTCTCTACCCAGACGAGGATGCTGCCCAGCCCAGGAGCCACTTCGTACCGGCCGCAGGCCTGGCCCAGGCCCCCTGA

XM_004867114.1 Coding sequence

Hif3a hypoxia inducible factor 3, alpha subunit, transcript variant X3

Length: 1911 bp    Location: 7157494..7133452   Strand: -
>XM_004867114.1
ATGGCGCTGGGGCTGCAGCGGGCAAGGTCGAGCACGGAGCTGCGCAAGGAGAAGTCCCGGGATGCGGCCCGCAGCCGGCGCAGCCAGGAGACCGAGGTGCTGTACCAGCTGGCGCACACGCTGCCCTTCGCGCGCGGCGTCAGCGCCCACCTGGACAAGGCTTCCATCATGCGCCTCACCATCAGCTACCTGCGCATGCACCGCCTCTGCGCCGCAGGTGAGTGGAACCAGGTGGGAGCCAAGGGAGAACCACTGGATGCCTGCTACCTGAAGGCCCTGGAGGGCTTCGTCATGGTGCTCACCACCGAGGGAGACATGGCTTACCTGTCTGAGAATGTCAGCAAACACCTGGGCCTCAGTCAGCTGGAGCTCATCGGACACAGTATATTTGATTTCGTCCATCCCTGTGACCAAGAGGAGCTCCAGGACGCCCTGACCCCCAGGCCGAGCCTGTCCAAGAAGAAGCCAGAGGCCCCCACCCAGCGGTGCTTCTCCTTGCGCATGAAGAGCACCCTCACCAGCCGTGGGCGCACCCTCAACCTCAAGGCAGCCACCTGGAAGGTGCTGCACTGCTCTGGACACATGAGGGCCTACAAGTCCTCAGGTCAGCCGGCCCTGGCCGGGAACCCCAGCTCCGAGCCCCCCCTGCAGTGCCTGGTGCTCATCTGCGAGGCCATCCCCCACCCGGGCAACCTGGAGCCCCCACTGGGCCGGGGCGCCTTCCTGACCCGCCACAGCCTGGACATGAAGTTCACCTACTGTGACGAGAGGATCGCAGAGGTCGCCGGCTACAGCCCAGATGACCTGATCGGCTGCTCCGCCTACGAGTACATCCACGCCCTGGACTCAGATGCAGTCAGCAGGAGCATTCATACCTTGCTGAGCAAGGGCCAGGCAGTGACAGGGCAGTATCGCTTCCTGGCCCGGAGTGGTGGCTACCTGTGGACCCAGACCCAGGCCACGGTGGTGTCTGGGGGCCGGGGCCCCCAGTCAGAGAGTATCATCTGCGTCCACTTCCTGATCAGCCGGGTGGAAGAGACTGGAGTGGTGCTGTCCCTGGAGCAAACAGAGCGACACTCTCGCAGACCCCTTCAGCGTGGCACCTCCTCTCAGAAGGATGGCCCTAATCCTGGGGACAGGCTTGATACCCCGGGTCCCTGGATCCTGGCCTTCCTGCACCCCCCTGCCCTGAGTGAGGCCACCCTGGCTGCTGACCCCCGCCGCTTCTGTAGCCCTGACCTGCGCCGCCTCCTGGCACCCATCCTGGATGGGGCTGCAGTAGCCACCACCCCCAGCACACCACAGGCCGCCTGGCGCCCCCGAAGTCCTCTCGCGGCTGATCTCCCAGATGAACTACTCGTGGGCATGGAGCGCATACACAGACTCGGTGCTGCTGGGAAGAACCCTGAGGCCGAGGACACAGATCTAAACATAGCTTCGGACGCCGATGCTCTGGACTTGGAGATGCTGGCCCCCTACATCTCCATGGATGATGACTTCCAGCTCAGCTCCAGCGAGCAGCTGCCCAGGGCCTTCCACAGACCTCCAGGGACCGTGCCCCGTCCCCGTGCTCAGAGCTTCCATGGCCTGTCACCTCCAACCCCTGAGCCCGCCCCGCTGCCACGCTGGGGGAGTGACCCCCGGCTGAGCTGCTCCAGCCCTCCCAGAGGGGACCCCTCAGCTTCCTCCTACACAGTCGGGGCTCGGAAGAGGGCCCTGGCCCAGAGCTCAGAGGATGAGGGGGTGGACCTGCTGGGCGTGAGACCCCCCAAACGGTCCCCCAGTCTAGACCCTGAAAACTTCCTGCTGCCTCCCGTCAGCCTGATGGGGAAGCCAGAGAGGGCCAGGGGCTGGCTGAAGGTCATACGGAAGATTAACGGTCCAGCTGAAGTCAGGACCTTGATCTTCTAG

XM_004867100.1 Coding sequence

Calm3 calmodulin 3 (phosphorylase kinase, delta), transcript variant X2

Length: 627 bp    Location: 6966527..6957720   Strand: -
>XM_004867100.1
ATGGCCGACCAGCTGACTGAGGAGCAGATCGCAGAGTTCAAGGAGGCCTTCTCCCTCTTCGACAAGGATGGAGACGGCACCATCACCACCAAGGAGTTGGGGACAGTGATGAGATCTCTGGGACAGAACCCCACTGAAGCAGAGCTGCAGGACATGATCAATGAGGTGGACGCAGACGGGAACGGGACCATTGACTTCCCGGAGTTTCTGACCATGATGGCCAGAAAGATGAAGGACACAGACAGCGAGGAGGAGATCCGAGAGGCGTTCCGAGTCTTTGACAAGGACGGGAACGGCTACATTAGTGCCGCAGAGCTGCGCCACGTAATGACGAACCTGGGGGAGAAGCTGACTGATGAGGAAGTGGATGAGATGATCAGAGAGGCTGACATCGACGGCGATGGCCAGGTCAATTATGAAGGTGAGCGGCACGGGCCCTGCCCCTGTTGCTGGGGAGGGCCGCTGGGTTCCGCCCTGCTCCTCACCAGCCTTCTCCGTCTCTGCAGAGTTTGTACAGATGATGACCGCGAAGTGAAGGCCCGGGCAGCTGGTGATGCCCGTTTTCCTGATCTCTCCTCTCGCGCGCTCTTCTCTCTTCAACACTCCCCTGCATACCCCGGGTTCTAG

XM_004867111.1 Coding sequence

Ppp5c protein phosphatase 5, catalytic subunit, transcript variant X3

Length: 1434 bp    Location: 7126272..7100309   Strand: -
>XM_004867111.1
ATGGCGATGGCGGAGGGCGAGCGGACTGAGTGTGCTGAGCCCCCTCGGGACGAGCCTCCGGCTGATGGCGCTCTGAAACGGGCAGAGGAGCTCAAGACACAGGCCAACGACTACTTCAAAGCCAAGGACTACGAGAATGCCATCAAGTTCTACAGCCAGGCCATCGAGCTAAACCCTAGCAATGCCATCTACTACGGCAACCGCAGCCTGGCCTACCTGCGCACCGAGTGCTACGGCTATGCCCTGGCCGACGCCACGCGGGCCATCGAGATCGACAAGAAGTACATCAAGGGCTATTACCGCCGGGCTGCCAGCAACATGGCACTGGGCAAGTTCCGGGCCGCCCTGCGTGACTACGAGACGGTGGTAAAGGTGAAGCCCCATGACAAAGATGCCAAAATGAAATACCAGGAGTGCAACAAGATCGTGAAGCAGAAGGCCTTCGAGCGTGCCATTGCGGGTGACGAGCACAAACGCTCTGTCGTGGACTCGCTCGACATTGAGAGCATGACCATCGAGGATGAGTACAGCGGGCCCAAGCTCGAGGACGGCAAAGTGACAATCACCTTCATGAAGGAGCTCATGCAGTGGTACAAGGAACAGAAGAAACTGCACCGGAAATGCGCCTACCAGACAGAGAAGATTACAGTGTGCGGGGACACCCACGGCCAGTTCTATGACCTCCTCAACATATTTGAGCTCAACGGTTTACCCTCAGAGACCAACCCCTACATATTTAATGGCGACTTCGTGGACCGAGGCTCCTTTTCCGTTGAAGTGATCCTCACCCTTTTCGGCTTTAAGCTCCTGTACCCAGATCACTTTCACCTACTTCGAGGCAACCATGAGACTGACAACATGAACCAGATCTATGGCTTTGAGGGTGAGGTGAAGGCCAAGTACACAGCCCAGATGTATGAGCTCTTCAGCGAGGTGTTTGAGTGGCTCCCGCTGGCCCAGTGCATCAATGGCAAAGTGCTGATCATGCACGGAGGCCTGTTCAGTGAAGACGGTGTCACCCTGGATGACATCCGGAAGATCGAGCGGAATCGGCAGCCCCCAGACTCGGGCCCCATGTGTGACCTGCTGTGGTCGGATCCGCAGCCCCAGAACGGGCGCTCGGTCAGCAAGCGGGGCGTGAGCTGTCAGTTTGGGCCGGATATCACCGCGGCCTTCCTGGAGGAGAACCACCTGGACTACATCATCCGCAGCCACGAGGTCAAGGCCGAGGGCTATGAGGTTGCCCATGGCGGCCGCTGCGTCACTGTCTTTTCTGCCCCCAACTACTGCGACCAGATGGGGAACAAGGCCTCTTACATCCACCTCCGGGGCTCCGACCTGCGGCCCCAGTTCCACCAGTTCACAGCAGTGCCTCATCCCAACGTGAAGCCCATGGCCTACGCCAACACGCTGCTGCAGCTAGGAATGATGTGA

XM_004867107.1 Coding sequence

Gpatch1 G patch domain containing 1, transcript variant X2

Length: 2685 bp    Location: 7079461..7042645   Strand: -
>XM_004867107.1
ATGGCGGCGCCGCACAGTGACAGTGAGGAGGACCTGGTCAGCTATGGGACGGGCCTGGAGCCTCTGGAAGAAGGTGAAAGACCAAAGAAACCAATTCCTCTTCAGAATCAGACTGTCAGAGATGAAAAGGGAAGGTATAAGCGATTTCATGGAGCCTTTAGTGGAGGTTTCTCTGCTGGATATTTCAATACTGTTGGCTCAAAAGAAGGATGGACACCCTCTACCTTTGTGTCTTCACGACAGAACAGAGCAGACAAATCTGTTCTTGGTCCTGAAGATTTTATGGATGAAGAGGATCTTAGTGAATTTGGGATAGCGCCTAAAGTGATTGTTACCACAGATGATTTTGCTTCCAAAACCAAAGATAGACTACAAGAAAAGGCCAGACAGTTGGCAGCTGCCACTGCCCCGATCCCTGGAGCCACTCTGCTTGAAGACTTCATAACACCAGCCAAATTATCTGTTGGTTTTGAATTGCTAAGAAAAATGGGTTGGAAGGAGGGACAAGGAATTGGTCCTCGAACAAAGAGAAGGTCACGCCGACAAAAACCTGATCCTGGAGTAAAAATCTATGGCTGTGCATTACCCCCTGGAGGCTCTGAAGGATCAGAGGATGAAGACAATGACTACTTGCCGGATAATGTGACGTTTGCACCCAAAGATGTCACTCCTGTGGATTTCACACCTAAGGATGATGTACATGGACTGGAGTACAAGGGCCTGGATCCCCACCAAGCTCTGTTTGGAACTTCAGCTGAACATTTGAATCTTTTCAGTGGAGGATCTGAGGGAGCCAGCAATCTTCTTGGAGATGCTGTACTAAATAAAGGAAGAAAACTGGGAATTTCAGGCCAGGCTTTTGGTGTCGGTGCCCTGGAAGAGGAAGATGATGATATTTATGCCACAGAAACGCTGTCCAAGTATGACACCATTTTGAAGGATGAGGAGCCTGGAGATGGACTCTATGGCTGGACAGCCCCCAGGGAGTATAAAAGTCAGAAAGAATCCAAGAAAGATCTTCGATATATTGGCAAAATTTTGGATGGATTTTCCTTGGCTTCTAAACCTTTATCATCTAAAAAAATTTATCCACCCCCTGAGCTGCCACAAGACTATCGACCAGTGCATTATTTCCGACCCGTGGTCACCGCCACCTCCGAGAATTCCCATTTACTTCGGGTCTTATCAGAGTCCACCAGAAAGGCAGTGCCTGACCCAGCGACACACAGTAGGCACCAACTGAATGCCTTCAAGCGGGGGGAGTTGCTAGGAGAGACGCCTGTCCAAGGTTCAGCGACTTCAGTGTTAGAGTTTCTGTCCCAAAAAGACAGAGAGAGGATCAAAGAAGTGAAGCAGGCAACTGACCTGAAAGCAGCGCAGCTCCAAGCCAGGAGTCTGGCGCAGAACGTGCCAAGCAGCGGAGCCGGGCCCTCTGTACCGGACCTTGGACACAGCTCTTGGTGCATGGCCCTGGGCGGAGGGACAGCCACCGTGAGACCCAGCAACTTCAAACCTTTTGCTAAAGATCCAGAGAAGCAAAAACGATATGAAGAGTTCTTAGTACAGATGAAAAAGGGTCAGAAAGATGCCCTGGAGCGCTGTCTGGACCCCAGCATGACCGAGTGGGAGCGAGGCCGTGAGCGGGAAGAGTTCTCGCGGGCAGCCCAGCTGTATGTGTCTTCCCATTCGACCCTCTCCTCCAGGTTCACCCATGCCAAGGAGGAAGACGATTCAGATCAAGTAGAAGTCCCACGAGACCAAGAGAATGATGTCAGTGACAAGCAGTCGGCTGTGAAGATGAAGATGTTTGGGAAGCTTACCCGAGACACATTTGAGTGGCACCCTGACAAGCTTCTGTGTAAGAGGTTCAATGTCCCTGACCCTTATCCAGGTTCCACTTTAGTGGGCTTACCAAGAGTGAAGCGTGACAAATACTCTGTCTTCAACTTTCTGACCCTTCCGGAGACTGAACCCACAGCACAAGCATCAAGTGAAAAAGCCCCTCAGCCCCGCAGCTTGGACAAGTCAAGGAAACCGTCCAGATGGGATACATCTCAACATGAAAAGAAAGAAGATTCCATTAGTGAATTTTTAAGTTTGGCTCGATCAAAAGTTGGTCCCGCTAAGCAAGAGTCCAGTCCCTCAGTAAAGCAAGGGGAAGAGCATGTGCCGGAATTACTCTCAAATAAGGCAGTAGACAAAGGTGTGGAGTCACAGCCCGAGGGAGAAGGCAGCCGCCCATCCATGGACTTATTCAAGGCCATCTTCGCCAGCTCCTCAGAGTCCTCCTCGTCGGAGGAAGAGCAAGACAACAGTGAGGATGAGCAGGCGGGCCCGAAGGCCAACTTCACAGGCTCCCAGGACACTGACTTGGGGGAAACTGTGCCTCTGGCACACGCTGCTGAGCCGGCGCCTCCTGAGCCTGCCCCAGTACCTGCCTTCCCGATACAGAAGATGCAGCTGGATGAACGGGAAGAGTTTGGCCCGAGGCTGCCCCCCGTCTTCTGCCCCAATGCTCGTCAGAAACCTGAGACACCTCAAAAAGAGAAATATAAAAAGAACAAAGAAAAACACAAGACCAAAAAAGAGCACAAACGAAAGAAAGAGAAGGCTGAAATGCCTCCCGCTAAAGAGGCAGTGATCGAATCCCGCCCAGCTTGTCCCAGAATCAGCTCTGCTCTGTGA

XM_004867096.1 Coding sequence

Gng8 guanine nucleotide binding protein (G protein), gamma 8, transcript variant X5

Length: 213 bp    Location: 6937330..6940735   Strand: +
>XM_004867096.1
ATGTCCAACAACATGGCCAAGATCGCCGAGGCCCGAAAGACGGTGGAACAGCTGAAGCTGGAAGTGAACATCGACCGCATGAAGGTGTCGCAGGCGGCGGCGGAGCTCCTGGCTTTCTGCGAGACGCACGCCAAAGACGACCCCCTGGTGACTCCGGTACCCGCCGCTGAGAATCCTTTCCGAGACAAGCGCCTCTTTTGCGTCCTCCTGTGA

XM_004867090.1 Coding sequence

Strn4 striatin, calmodulin binding protein 4, transcript variant X1

High confidence: 4 potential gene matches
Length: 2286 bp    Location: 6858123..6883514   Strand: +
>XM_004867090.1
ATGATGGAGGAGCGAGCGGCCGCCGCGGTCGCCGCCGCCGCCTCCGCCTCCTCCTGCCGCCCGCTCGGCTCCGCTGCGGGTCCTGGCCCGCCTGGGACGGGCCCCGTCTCCAGCCCTGCCCCCGGGCCCGGCCCAGCAGGAAAGGGTGGCGGCGGCGGAGGCAGCCCGGGGCCCGCGGCCGGCCCGGAGCCCCTGAGCCTCCCCGGGATCCTGCACTTTATTCAGCACGAGTGGGCGCGCTTCGAGGCCGAGAAGGCCCGCTGGGAGGCCGAACGCTCCGAGCTGCAGGCTCAGGTGGCCTTTCTCCAGGGAGAGCGGAAAGGGCAGGAGAATCTAAAGACAGACCTGGTGCGGCGGATCAAGATGTTAGAATACGCGCTGAAGCAGGAAAGGGCCAAATATCATAAACTGAAGTTTGGGACAGACCTGAACCAGGGGGAGAAGAAACCAGATCTGCCAGAACAAGTTCCCAATGGCCCTGTGGAGTCAGTCACCCTGGAGAACAGCCCTCTGGTGTGGAAGGAGGGACGGCAGCTGCTCCGACAGTACCTGGAAGAGGTGGGCTACACGGACACCATCCTTGACATGCGGTCCAAGCGTGTGCGCTCCCTGCTTGGACGCTCCCTAGAGCTCAACGGGGCTACTGAGTCCAGCGAGGGGCCCCCCAGGGTGGCACCTAATCCTGGGGGCCTCAGTGGCAGCGAGTCCCTGCTGGTGAAGCAGATTGAGGAGCAGATCAAGAGGAATGCAGCAGGCAAAGATGGCAAAGAGCGTCTGGGTAGCTCGGTGCTGGAGCAGATCCCCTTCCTGCAGAACTGCGAGGATGAGGACAGCGATGAGGATGATGAGCTGGACAGTGTGCAGCACAAGAAGCAGCGCGTGAAGCTCCCTTCCAAGGCCTTGGTGCCTGAGATGGAGGATGAGGATGAGGAGGACGACTCAGAGGATGCCATCAACGAGTTTGATTTCCTGGGCTCGGGAGAGGATGGGGAGGGGTCTCCAGGCCCTCGGCGGTGTACCAGTGAGGGGACCCCCCACGAGCTGGAGAGCCGTCGAGTCAAGCTCCAGGGAATTCTGGCCGACCTTCGGGACGTAGATGGGCTGCCCCACAAAGTGACAGGCCCACCTCCCGGCACACCCCAGCCCCGGCCCCACGAAGGTTCCTTTGGCTTCTCCTCAGACGTTTTCATCATGGACACTATCGGGGGCGGGGAGGTGAGCCTGGGGGACTTGGCAGATCTCACCGTCACCAACGACAACGACCTCAGCTGTGATCTGTCTGACAGCAAAGATGCCTTCAAGAAGACATGGAACCCCAAGTTCACCCTCCGCTCACACTATGATGGCATCCGCTCCCTGGCTTTCCATCACAGCCAGTCGGCACTGCTCACCGCCTCCGAGGACGGCACACTCAAGCTCTGGAACCTGCAGAAGGCAGTCACGGCCAAGAAGAATGCTGCACTGGACGTGGAACCAATCCATGCCTTCCGAGGTCACAGGGGGCCTGTGTTGGCGGTGGCTGTGGGCAGCAACAGTGAATACTGCTACAGTGGCGGTGCCGACGCCCGCATCCACAGCTGGAAAATTCCGGACCTCAACATGGACCCCTACGATGGTTACGACCCCAGCGTCCTGAGCCACATCCTAGAGGGCCATGGGGATGCCGTGTGGGGCTTGGCCTTCAGCCCCACCTCCCAGCGCCTGGCGTCCTGCTCTGCTGATGGCACCGTGCGCATCTGGGACCCCAGCAGCAGCCCGGCCTGCCTCTGTACCTTCCCTGCAGCCAGTGAGCACGGAGTTCCCACTTCAGTGGCCTTCACCAGCACCGAGCCTGCCCACATCGTGGCCTCCTTCCGCTCTGGTGACACCATCCTGTATGACCTAGAGACTGGCAGTGCCCTCCTCACGCTGGAGTCCCGGGGAAGCAGCGGCCTAAGCCAAATCAACCAGGTGGTGAGTCACCCCAACCAGCCCCTTACCATCACTGCCCATGACGACAGGGGCATCTGCTTCCTGGACAATCGGACAGGTAAATCCGTGCACTCCATGGTTGCCCACCTGGATGCGGTCACCTGCCTAGCTGTGGACCCCAATGGCGTTTTCCTGATGTCAGGAAGCCACGACTGCTCCCTGCGCCTGTGGAGCCTGGACAACAAGACGTGCGTGCAGGAGATCACAGCCCACCGCAAGAAGCATGAGGAGGCCATCCATGCTGTTGCCTGCCACCCCAGCAAGGCCCTCATCGCCAGTGCTGGCGCCGATGCCCTGGCCAAGGTCTTCGTATGA

XM_004867087.1 Coding sequence

Ap2s1 adaptor-related protein complex 2, sigma 1 subunit, transcript variant X2

High confidence: 4 potential gene matches
Length: 429 bp    Location: 6788254..6797026   Strand: +
>XM_004867087.1
ATGATCCGCTTCATCCTCATCCAGAACCGGGCCGGCAAGACGCGCCTGGCCAAGTGGTACATGCAGTTCGATGATGATGAGAAACAGAAGCTGATCGAGGAGGTGCACGCCGTGGTCACCGTCCGCGATGCCAAGCACACCAACTTTGTGGAGTTCCGGAACTTTAAGATCATTTACCGACGCTATGCCGGCTTGTACTTCTGCATCTGCGTGGACGTCAGCGACAACAACCTGGCCTACCTGGAGGCCATCCACAACTTTGTGGAGGTCTTGAACGAGTATTTCCACAATGTCTGCGAGCTGGACCTGGTGTTCAACTTCTACAAGGTTTACACGGTGGTGGACGAGATGTTCCTGGCCGGAGAGATCCGAGAGACGAGCCAGACAAAGGTGCTGAAGCAGCTGCTCATGCTGCAGTCACTGGAGTGA

XM_004867086.1 Coding sequence

Ap2s1 adaptor-related protein complex 2, sigma 1 subunit, transcript variant X1

Length: 489 bp    Location: 6788378..6797026   Strand: +
>XM_004867086.1
ATGGTAACGGGGCGCGCCACGCCCGAGACTAGCAGAGGGAGGGTCCACGCGCAAACAGCCAAGATCCGCTTCATCCTCATCCAGAACCGGGCCGGCAAGACGCGCCTGGCCAAGTGGTACATGCAGTTCGATGATGATGAGAAACAGAAGCTGATCGAGGAGGTGCACGCCGTGGTCACCGTCCGCGATGCCAAGCACACCAACTTTGTGGAGTTCCGGAACTTTAAGATCATTTACCGACGCTATGCCGGCTTGTACTTCTGCATCTGCGTGGACGTCAGCGACAACAACCTGGCCTACCTGGAGGCCATCCACAACTTTGTGGAGGTCTTGAACGAGTATTTCCACAATGTCTGCGAGCTGGACCTGGTGTTCAACTTCTACAAGGTTTACACGGTGGTGGACGAGATGTTCCTGGCCGGAGAGATCCGAGAGACGAGCCAGACAAAGGTGCTGAAGCAGCTGCTCATGCTGCAGTCACTGGAGTGA

XM_004867082.1 Coding sequence

Tmem160 transmembrane protein 160, transcript variant X1

High confidence: 4 potential gene matches
Length: 567 bp    Location: 6624823..6627245   Strand: +
>XM_004867082.1
ATGGGAGGCAGCTGGTGGTGGGCTCGTGCCGCTCGCCTGGCCAGACTCCGCTTCCGGGGGGTGCTGCTGCCTCCTCAGCGGCCCAGGAGCGGGGGCGCCCGGGGGTCCTTCGCCCCAGGCCACGGTCCCCGCGCTGGGGCTTCGCCGCCCCCAGTGTCCGAGCTGGACCGAGCGGACGCCTGGCTCCTCCGGAAGGCTCACGAGACAGCCTTCCTGTCCTGGTTCCGAAATGGCCTCCTGGCTTCGGGCATCGGGGTCATCTCCTTCATGCAGAGCGACATGGGACGGGAAGCCGCCTATGGCTTCTTCCTGCTGGGCGGTTTGTGCGTGGTGTGGGGCGGTGCCTCCTATGCCGTGGGCCTGACCTCGCTGCGTGGACCCATGCAACTGTCGCTGGGGGGCGCGGCAGCCGGTGTGGGCGCGGTCCTGGCCGCCAGCCTGCTGTGGGCCTGCGCTGTGGGCCTCTACATGGGGCAGCTCGAGCTCGACGTGGAACTGGTGCCCGACGATGACGGGGCGGCCACTGCCGAAGGCCCCGATGAAGCTGGCCGGCCGCCGCCCGAGTGA

XM_004867031.1 Coding sequence

LOC101703124 chromosome unknown open reading frame, human C19orf68, transcript variant X2

Length: 2580 bp    Location: 5665538..5650246   Strand: -
>XM_004867031.1
ATGGAGCTGCCAGAGCCCCCACCCTGCACAGTGGTGGGGAAGGAGGAACAGGAGCTGCTGAAGCGAGTCTTCTTCTCCTGGGCTGAGTTCAGCCGCTTCTTCGACAAGTGGTGCCAGCAGCGGTTGGTGGTGTTCTCCATCAAGAACTCCACGCGTGTGGCGCGCAGCCCCTGGGCCAGTGTGCCTCCGCTCTACAGGCTCATCCACGTGCTCAAGTACAGCTACGTGCTGCTGGTGTGCAAGGATGTGCGCTCATCCAGCCAGCCTGCAAAGTGGTCCTCCCAGCCCAGCTGCCCGGCCTTCATCACCCTCAAGCTGAGCCCGCTGCGGGACCGCCTCGTGGTGTCGGAGTGCCAGCTCACCCACTCGCACCCAGCCTGCCCACGAGAGTTCGCCTACCACTTCCGCCCTGGCCACCTGCTGGCCAACGCCTGCCTGCCCGTGCGCATAACCAACCGGATCTCCAAGCAGTTTGTGGCCCCGGACGACGTGCGCCGCTTGCTGTCCCGCTGCAAGGGCCCCGACCACGGAGTCCTGGACGCCCTGCATGTGCTGGAGGGGCTCTTCCGCACTGATCCCGAGGCCAAGGTGAGGCTGGTGTTCGTGGAGGACCAGGCCATGGTAGAGACTGTGTTCTTCCTGACATCTCGGACCAGGGCGCTGCTGCGGCGCTTCCCACGCATACTGCTGGTGGACCGGCTGCCAGGGCTACAGGGCACACTGGACCTGCTAGCGGTGCTGTGCGTGGACGGCGCGGGCCGTGCGCGCCAGGCCGCCTGTTGCGTGGCACGCCCGGGCACTCCAAGCCTCCTGCGCTTCGTGCTGGTCTCGCTGCTGCAGAGTGCGCCGGATGTCAAAGGCCGTGTGCGCTGCCTCACAGCTGGGCCGGAAGTGGCCGCGCAGGTCAGGGCCGTGCGCCAGCTGCTGCCTCGTGCGCGTGTGCAGATCTGCCGCGTGCAGGGCCTGGAGTCGCTCTTCAGCAAGGCACAGGAACTGGGCGGTGCCAGCTACGAGGACCCAGGCCTGTGGCCCCTGCTATGCCGCCTGGCCGGCGCCTCATCCTACACTGCCTATACCGAGGCACTGGCCGAGCTGCGTGCCCAGGGCCCGGACGCCTTCATGAAATACTTTAACCACAACTGGGCACCCCGCCAAAACATGTGGGTGCGTTTCCGTGCCTTTGAGGCGTCTGAAGATCTGGACGCCTGCGCCCTGGTACATGGCCATCGCAGGCGACTGCTGAGCCGCCTCAGCCCCTCACACAGCGTGGCGCAGTGCCTCCGTGACCTGGTGGCCATGCAGTGGGCGGATGCAGCTGGGGAGGCAGCCTCTGAGGGCGCTGATGGCCGGGGGGTGTGGCTGGATTGCGAGCTCAGGAGTGGAGCCCAGGTGGAGGGAGGGAGGGGCCTGGATGCTAGTGACAAGGGAGAGGCCCAGCCGGAAGGGGAAAAGGGGAGGGGTTTGCAGATGAGAGATTGGCCAGGGGTCCATTTGGAGGACCAGAAGGTGAGGGTGCTGGAAGGGGGTGTCTGGAGGGGACCTCAGTTGGAGAAAGAGCACTCGAGAGGGCCAGAGGTCAGAGATTGGAGGGGAGCCCACTTGGGGGATGGAAGCTCCAGGCTCCTGGAGATCACAGACCGGAGGGGGACCCAGTTTGAATCCAGGAGAGCTGGGAGTTTGGAGGGAAATCTCTGGAGGGGGGTCCAGCTGCAGCATGAGAGGGCAAGTGCACTGAAACCCCGAGACTGGAAGAGACCCGAGTTGGAGATAGAGAAGGGCAGAGGGGTAGCTGTCAGAAAGTGGCGAGAGATCCATTTGGAGAAGCCCTTGGACTTGGTTCCTGAGAGTGGAGACCAAAGAGGGGCTCAGTGGGCAGATGAGGGGCGGAGAGGGCCGGAGATCACGGAGGAGGGGGGGGGGCGGTCAGGGGTCAAGAGGAGACGGGGCCTGGAGGACCTAGTTGTAGTCCATCTGGGAGATGCCAAGGATACAGGCGTGGCAAATGGAGATGGAGGGGGATCCCGGCCTGTAGGCTCCAAGAGCAGAGCAGGACAAGGGATAGAGTGGGGGAACACAGGAGGACGGTGTCCAGGGCGGCCGAATGGAGTCCCATGTGCCGCCTCCAGGGGGACAGTGTTGGAAGGCAATCCGGAACGGTCAGTGATGAGGAGTGAGTCACTGGCTGCAGGGGAAGCCCTGCCGGAACGAGGTAAGGGAGAAGGCCCAAGGGAACCGAAGAGGCTTTGCTGCCCCTCCAGAGAGCAAGAGATGGACTGGGAGCCGCTGGCCAAATTCCGAGCAGCCTGTGGGCCAGAGCTGGCAGACCTGGTGGCCGAGGAACTGGCCTTCGCCAGGCAACATGGCACTCAGGGTTTCCACTGGACTGGAACTGGCTTTGCTCTCAAGGATGGTATCTCAGACTTCTTCTTGGATGGGGCCCTCACGTACTGCAGCTGCTCGATCCACGCTGCACGTCGTCTCCCCTGCCGGCACCTCTTTGCAGCACGCCTCCTCACTGGGGCCGCCTTATTTCACATGGACCTGCTCAGGGATTGCTGGGGGAGAGCCCAAGAGCCCTGA

XM_004867074.1 Coding sequence

Sae1 SUMO1 activating enzyme subunit 1, transcript variant X2

Length: 1041 bp    Location: 6556543..6485139   Strand: -
>XM_004867074.1
ATGGTGGAGAAGGAGGAGGTCGGTGGCGGCATCAGCGAGGAAGAGGCGGCGCAGTATGATCGGCAGATTCGTCTGTGGGGATTGGACGCTCAGAAACGGCTTCGGGCTTCCCGTGTGCTTCTTGTTGGCATGAAAGGACTTGGAGCTGAAATTGCCAAGAATCTCATCTTGGCAGGAGTGAAAGGACTGACCATGCTGGATCACGAACAGGTATCTTCAGGTGATCCTGGAGCTCAGTTCCTGATTCGAACTGGGTCCATTGGCCGAAATAGAGCTGAAGCCTCTTTGGAAAGAGCCCAGAATCTCAACCCCATGGTGGATGTGAAAGTGGACACTGAGGATATTGAGAAGAAACCTGAGTCATTTTTCACTCAATTTGATGCAGTGTGTCTGACATGCTGCTCCAGGGATGTCATAGTTAATGTTGACCAGATCTGTCACAAAAACAGCATCAAATTCTTCACAGGGGATGTTTTTGGCTACCATGGATACACATTTGCCAATCTTGGAGAGCATGAGTTTGTAGAGGAGAAAACCAAAGTTGCCAAAGTTAGCCAAGGAGTAGAAGATGGACCTGACACCAAGAGAGCAAAACTTGATTCCTCTGAGACTACAATGGTCAAAAAGAAGGTGGTTTTCTGCCCTGTCAAAGAGGCGCTGGAGGTGAACTGGAGCAGTGAGAAAGCAAAGGCCACTCTGAAGCGCACAACCTCCGATTACTTTCTCCTGCAAGTGCTTCTGAAATTCCGCACAGATAAAGGAAGAGACCCTAATTCTGATACCTATAAGGAAGATTCTGAGTTGCTGCTTCACATTCGGAATGATGTCCTTGACTCTCTGGGTGTGAGTCCTGACCTGCTTCCCGACGACTTTGTCAGGTACTGCTTCTCTGAGATGGCCCCAGTGTGTGCAGTGGTTGGAGGGATCTTGGCACAGGAAATTGTTAAGGCCCTGTCACAGCGCGATCCTCCTCACAACAACTTCTTCTTCTTTGATGGCATGAAGGGGAACGGAGTCGTGGAGTGCCTGGGCCCCAAGTGA

XM_004867083.1 Coding sequence

Tmem160 transmembrane protein 160, transcript variant X2

Length: 543 bp    Location: 6625457..6627245   Strand: +
>XM_004867083.1
ATGATTGGAGAAAGAAGTGATCCTGGTTGCAAGGGGAGGAGCCTCGAAGGGGAATGGGTGACAGGAGTGCATGGAGGGTCAGATATAGGATGGGGTGGGGGACTTGTAATGGGACCGGCCTGTTGGAACTACAGAGGGACTGGAGCTGGGGGAAGTGTGGATGCTTTTAAGTCGGCCTTACGCGCCTTCCTGTCCTGGTTCCGAAATGGCCTCCTGGCTTCGGGCATCGGGGTCATCTCCTTCATGCAGAGCGACATGGGACGGGAAGCCGCCTATGGCTTCTTCCTGCTGGGCGGTTTGTGCGTGGTGTGGGGCGGTGCCTCCTATGCCGTGGGCCTGACCTCGCTGCGTGGACCCATGCAACTGTCGCTGGGGGGCGCGGCAGCCGGTGTGGGCGCGGTCCTGGCCGCCAGCCTGCTGTGGGCCTGCGCTGTGGGCCTCTACATGGGGCAGCTCGAGCTCGACGTGGAACTGGTGCCCGACGATGACGGGGCGGCCACTGCCGAAGGCCCCGATGAAGCTGGCCGGCCGCCGCCCGAGTGA

XM_004867079.1 Coding sequence

Zc3h4 zinc finger CCCH-type containing 4, transcript variant X3

Length: 3798 bp    Location: 6572124..6609634   Strand: +
>XM_004867079.1
ATGCCACCCACATTCAGAGACACAAGTGCAGCAGTTTGGGAAGATGGTGAATTGGAAGAAGGTGAACTGGAAGATGATGGGGTGGAGGAGACCCAGGACACCCCAGGAGGGCAGGAGAGAAGCCGGAAAGAAAAGGGGGAGAAGCACCATAGTGACTCGGATGAGGAAAAGTCTCACAGGAGGCTGAAGCGGAAACGGAAGAAAGAGCGGGAGAAGGAGAAGAGGAGGTCGAAGAAGAGGAGGAAATCCAAACACAAACGCCATGCTTCTTCCAGCGATGACTTCTCCGACTTCTCAGATGACTCGGATTTCAGCCCTAGTGAGAAGGGGCACCGCAAGTACCGGGAGTACAGCCCCCCTTATGCTCCGTCCCACCAGCAGTATCCCCCATCACACACCACGTCCCTGCCCAAGAAGTCCTACTCCAAGATGGACAGCAAGGGCTACAGCATGTATGAAGACTACGAGAACGAGCAGTATGGAGAATATGAGGGGGACGAGGAGGAGGACATGGGCAAGGACGACTATGATGACTTCACCAAAGAACTGAACCAGTACCGCCGCTCCAAGGAGGGTAGCAGCCGAAGCCGAGGCAGCCGAGGCCGGGGCAGGGGATATAGAGGCCGAGGAAGCCGTGGAGGATCTCGAGGCCGAGGCATGGGCAGGGGCAGCCGAGGCCGAGGCCGAGGCTCTGTGGGAGGAGACCACCCAGAGGACGAGGAGGACTTCTACGAGGAGGAGATGGAGTATGGAGAAAGTGAGGAGCCAATGGGAGACGACGACTACGATGAATACTCCAAGGAGCTGAATCAGTACCGCCGATCTAAGGACGGCCGAGGCCGAGGGTTAAGTCGAGGCCGTGGCCGGGGTTCCCGGGGCCGAGGGAAAGGGATGGGCCGGGGTCGTGGCCGAGGTGGCAGCCGAGGAGGGATGAACAAGGGTGGAATGAACGATGACGAAGACTTCTACGACGATGACATGGGTGATGGCGGTGGGGGCAGCTACCGGAGGAATGACCATGACAAGCCCCACCAGCAGTCTGACAAGAAGGGCAAAGTCATCTGCAAGTACTTTGTGGAAGGGCGGTGCACGTGGGGAGACCACTGTAATTTTAGCCATGACATCGAACTGCCAAAGAAGCGAGAGCTGTGCAAGTTCTACATCACGGGGTTCTGCGCCCGAGCAGAGCACTGCCCCTACATGCACGGTGACTTTCCGTGTAAGCTGTACCACACCACTGGGAACTGCATCAATGGGGATGACTGCATGTTCTCACATGATCCTCTAACCGAGGAGACGCGAGAGCTCCTGGATAAGATGTTGGCAGATGATGCAGAAGCAGGTGCTGAAGACGAGAAGGAAGTTGAGGAACTGAAGAAGCAGGGCATCAACCCCCTGCCCAAACCACCCCCTGGTGTGGGCCTCCTGCCCACCCCCCCTCGGCCCCCTGGGCCCCAGGCCCCCACCTCTCCCAATGGCAGGCCCATGCAGGGTGGCCCCCCGCCGCCACCCCCTCCTCCACCCCCTCCTGCTGGGCCCCCTCAAATGCCCATGCCCATGCACGAGCCGCTGTCCCCACAGCAGCTGCAGCAGCAGCAGGACATGTACAACAAGAAGATCCCCTCCCTGTTCGAGATCGTTGTGCGGCCCACAGGACAGCTGGCTGAGAAGTTGGGTGTGAGGTTCCCTGGACCTGGTGGACCCCCAGGGCCAATGGGTCCTGGGCCCAACATGGGACCCCCTGGGCCAATGGGGGCCCCCATGCACCCCGACATGCATCCAGACATGCACCCAGACATGCACCCTGACATGCATCCGGACATGCACCCTGATATGCCAATGGGCCCTGGCATGAATCCTGGCCCCCCTGTGGGTCCCAGTGGCCCCTCCATGATGCCCTATGGTCCTGGAGACTCCCCACATTCTGGAATGATGCCCCCCATCCCACCAGCCCAGAACTTCTATGAAAATTTCTACCAGCAGCAGGAGGGCATGGAGATGGAGCCAGGCCTCATTGGGGATGCAGAGGACTACGGGCACTACGAAGAGCTCCCGGGGCAGCCAGGGGAGCCCCTCTTCCCTGAGCACCCTCTGGAGCCAGACAGCTTCTCTGAGGGAGGGCCCCCAGGCCGGCCAAAGCCGGGCACCGGTGTCCCCGACTTCCTGCCCTCCACCCAGAGGGCTCTGTACCTGAGGATCCAGCAGAAGCAGCAGGAGGAGGAAGAGAGAGCAAGGAGGCTGGCAGAGAGCAGCAAGCAGGACCGGGAGAATGAGGAAGGTGATACCGGAAACTGGTACTCAAGTGACGAGGACGAAGGTGGGAGCAGTGTCACCTCCATCCTCAAGACCCTGAGGCAGCAGACATCCAGCCGACCCCCGGCTTCAGTTGGGGAGCTGAGCAGCAGTGGGCTGGGGGATCCCCGCCTCCAGAAGGTGCACGCTACTGGAGGCCGACTGGCTGACCCCCGCCTCAGCCGGGACCCCAGACTCTCCCGCCATGCTGAGGCTTCCAGCGGGTCCGGCCCAGGAGACACTGGGCCCTCTGACCCCCGGCTGGCTCGCTCCCTGCCCGCCTCAAAGCCTGAGGGTAGCCTTCATTCCAGCCCTGCTGGCCCCAGCAGCTCCAAGGGCTCCGGCCCTCCCTCTCAGGAAGAAGAGGAGGGGGAGCGGGCTCTGCGGGAGAAGGCTGTGAACATTCCCCTGGACCCCCTGCCAGGGCACCCACTGCGGGACCCAAGGTCACAGCTGCAGCAGTTCAGCCACATCAAGAAGGATGTGACCCTGAGCAAGCCCAGCTTTGCCCGCACTGTGCTCTGGAATCCCGAGGACCTGATCCCTCTGCCCGTCCCCAAGCAGGACATGGTGCCCCCTGTACCTGCCGCCCTGCAGTCCATGCCTGCCTTGGACCCCAGGCTGCACCGTTCCAGCCCTGCAGGGCCCCCCAGCGCCCGCCAGCGCCCTGGCACCTCCACAGACCCCAGCACCTCCAGCTCTAACCTGCCTGACTTTGAACTCCTCTCTCGCATCCTCAAGACTGTTAATGTTCCTGGCCCCTCTGCAGCCCCCAGCCCAAGTGACAAGCCCAGTGACCCCAGGGTGCGGAAGGCCCCTACCGACCCTCGACTGCAGAAACCAGCAGACTCGGTAGCCTCCTCTCGTGCTGCCAAACCCAGCCCTCCCGAAGGATCCTCTCCAGCCTCCAGCCCCAATGGAGGGTCCTCCCCACCAGCCACAGCTCCCTACGACCCCCGAGTGCTGGCAGCTGGAGGCCTCGGCCAGGGCAGTGGCAGTGGGCAGAGCAGTGTGCTGAGTGGCATCAGCCTCTATGACCCGAGGACTCCCAACGCAGGTGGCAAAGCCGGGGAGCTGGGTGCTGATGCAGCTGCCCAGCCCAAGGGCCCTGAGGGTAACGGCAAGAGTGCCGTCTCTAAGACCAAGGAGCCCCCCTTCGTCCGCAAGTCTGCATTGGAGCAGCCAGAAGCAGGGAAAGCTGTTGCAGATGGGGGGACAGCCCCAGCCACAGACAGATACAACAGCTACAACCGACCCCGGTCCAAGGCTGCTGCAGCCTCCGCCGCTGCCACAGTCACTACACCTGCGGAGGGCGCCCCGCCCCAGCCCGGGGTACACAACCTGCCAGTGCCTGCACTCTTTGGGACTGCGAAGCCGGCGCCCAAGACAGGCTCGGGAAGCCCGTTTGCTGGCAACAGCCCGGCCCAAGAGGGCGAGCAGGATGCAGGGTCCCTGAAAGATGTTTTTAAAGGCTTCGACCCCACGGCCTCCCCCTTTTGCCAGTAG

XM_004867080.1 Coding sequence

Zc3h4 zinc finger CCCH-type containing 4, transcript variant X4

Length: 3783 bp    Location: 6573525..6609634   Strand: +
>XM_004867080.1
ATGTCTTACAATGGGTTGGGATGGGAAGATGGTGAATTGGAAGAAGGTGAACTGGAAGATGATGGGGTGGAGGAGACCCAGGACACCCCAGGAGGGCAGGAGAGAAGCCGGAAAGAAAAGGGGGAGAAGCACCATAGTGACTCGGATGAGGAAAAGTCTCACAGGAGGCTGAAGCGGAAACGGAAGAAAGAGCGGGAGAAGGAGAAGAGGAGGTCGAAGAAGAGGAGGAAATCCAAACACAAACGCCATGCTTCTTCCAGCGATGACTTCTCCGACTTCTCAGATGACTCGGATTTCAGCCCTAGTGAGAAGGGGCACCGCAAGTACCGGGAGTACAGCCCCCCTTATGCTCCGTCCCACCAGCAGTATCCCCCATCACACACCACGTCCCTGCCCAAGAAGTCCTACTCCAAGATGGACAGCAAGGGCTACAGCATGTATGAAGACTACGAGAACGAGCAGTATGGAGAATATGAGGGGGACGAGGAGGAGGACATGGGCAAGGACGACTATGATGACTTCACCAAAGAACTGAACCAGTACCGCCGCTCCAAGGAGGGTAGCAGCCGAAGCCGAGGCAGCCGAGGCCGGGGCAGGGGATATAGAGGCCGAGGAAGCCGTGGAGGATCTCGAGGCCGAGGCATGGGCAGGGGCAGCCGAGGCCGAGGCCGAGGCTCTGTGGGAGGAGACCACCCAGAGGACGAGGAGGACTTCTACGAGGAGGAGATGGAGTATGGAGAAAGTGAGGAGCCAATGGGAGACGACGACTACGATGAATACTCCAAGGAGCTGAATCAGTACCGCCGATCTAAGGACGGCCGAGGCCGAGGGTTAAGTCGAGGCCGTGGCCGGGGTTCCCGGGGCCGAGGGAAAGGGATGGGCCGGGGTCGTGGCCGAGGTGGCAGCCGAGGAGGGATGAACAAGGGTGGAATGAACGATGACGAAGACTTCTACGACGATGACATGGGTGATGGCGGTGGGGGCAGCTACCGGAGGAATGACCATGACAAGCCCCACCAGCAGTCTGACAAGAAGGGCAAAGTCATCTGCAAGTACTTTGTGGAAGGGCGGTGCACGTGGGGAGACCACTGTAATTTTAGCCATGACATCGAACTGCCAAAGAAGCGAGAGCTGTGCAAGTTCTACATCACGGGGTTCTGCGCCCGAGCAGAGCACTGCCCCTACATGCACGGTGACTTTCCGTGTAAGCTGTACCACACCACTGGGAACTGCATCAATGGGGATGACTGCATGTTCTCACATGATCCTCTAACCGAGGAGACGCGAGAGCTCCTGGATAAGATGTTGGCAGATGATGCAGAAGCAGGTGCTGAAGACGAGAAGGAAGTTGAGGAACTGAAGAAGCAGGGCATCAACCCCCTGCCCAAACCACCCCCTGGTGTGGGCCTCCTGCCCACCCCCCCTCGGCCCCCTGGGCCCCAGGCCCCCACCTCTCCCAATGGCAGGCCCATGCAGGGTGGCCCCCCGCCGCCACCCCCTCCTCCACCCCCTCCTGCTGGGCCCCCTCAAATGCCCATGCCCATGCACGAGCCGCTGTCCCCACAGCAGCTGCAGCAGCAGCAGGACATGTACAACAAGAAGATCCCCTCCCTGTTCGAGATCGTTGTGCGGCCCACAGGACAGCTGGCTGAGAAGTTGGGTGTGAGGTTCCCTGGACCTGGTGGACCCCCAGGGCCAATGGGTCCTGGGCCCAACATGGGACCCCCTGGGCCAATGGGGGCCCCCATGCACCCCGACATGCATCCAGACATGCACCCAGACATGCACCCTGACATGCATCCGGACATGCACCCTGATATGCCAATGGGCCCTGGCATGAATCCTGGCCCCCCTGTGGGTCCCAGTGGCCCCTCCATGATGCCCTATGGTCCTGGAGACTCCCCACATTCTGGAATGATGCCCCCCATCCCACCAGCCCAGAACTTCTATGAAAATTTCTACCAGCAGCAGGAGGGCATGGAGATGGAGCCAGGCCTCATTGGGGATGCAGAGGACTACGGGCACTACGAAGAGCTCCCGGGGCAGCCAGGGGAGCCCCTCTTCCCTGAGCACCCTCTGGAGCCAGACAGCTTCTCTGAGGGAGGGCCCCCAGGCCGGCCAAAGCCGGGCACCGGTGTCCCCGACTTCCTGCCCTCCACCCAGAGGGCTCTGTACCTGAGGATCCAGCAGAAGCAGCAGGAGGAGGAAGAGAGAGCAAGGAGGCTGGCAGAGAGCAGCAAGCAGGACCGGGAGAATGAGGAAGGTGATACCGGAAACTGGTACTCAAGTGACGAGGACGAAGGTGGGAGCAGTGTCACCTCCATCCTCAAGACCCTGAGGCAGCAGACATCCAGCCGACCCCCGGCTTCAGTTGGGGAGCTGAGCAGCAGTGGGCTGGGGGATCCCCGCCTCCAGAAGGTGCACGCTACTGGAGGCCGACTGGCTGACCCCCGCCTCAGCCGGGACCCCAGACTCTCCCGCCATGCTGAGGCTTCCAGCGGGTCCGGCCCAGGAGACACTGGGCCCTCTGACCCCCGGCTGGCTCGCTCCCTGCCCGCCTCAAAGCCTGAGGGTAGCCTTCATTCCAGCCCTGCTGGCCCCAGCAGCTCCAAGGGCTCCGGCCCTCCCTCTCAGGAAGAAGAGGAGGGGGAGCGGGCTCTGCGGGAGAAGGCTGTGAACATTCCCCTGGACCCCCTGCCAGGGCACCCACTGCGGGACCCAAGGTCACAGCTGCAGCAGTTCAGCCACATCAAGAAGGATGTGACCCTGAGCAAGCCCAGCTTTGCCCGCACTGTGCTCTGGAATCCCGAGGACCTGATCCCTCTGCCCGTCCCCAAGCAGGACATGGTGCCCCCTGTACCTGCCGCCCTGCAGTCCATGCCTGCCTTGGACCCCAGGCTGCACCGTTCCAGCCCTGCAGGGCCCCCCAGCGCCCGCCAGCGCCCTGGCACCTCCACAGACCCCAGCACCTCCAGCTCTAACCTGCCTGACTTTGAACTCCTCTCTCGCATCCTCAAGACTGTTAATGTTCCTGGCCCCTCTGCAGCCCCCAGCCCAAGTGACAAGCCCAGTGACCCCAGGGTGCGGAAGGCCCCTACCGACCCTCGACTGCAGAAACCAGCAGACTCGGTAGCCTCCTCTCGTGCTGCCAAACCCAGCCCTCCCGAAGGATCCTCTCCAGCCTCCAGCCCCAATGGAGGGTCCTCCCCACCAGCCACAGCTCCCTACGACCCCCGAGTGCTGGCAGCTGGAGGCCTCGGCCAGGGCAGTGGCAGTGGGCAGAGCAGTGTGCTGAGTGGCATCAGCCTCTATGACCCGAGGACTCCCAACGCAGGTGGCAAAGCCGGGGAGCTGGGTGCTGATGCAGCTGCCCAGCCCAAGGGCCCTGAGGGTAACGGCAAGAGTGCCGTCTCTAAGACCAAGGAGCCCCCCTTCGTCCGCAAGTCTGCATTGGAGCAGCCAGAAGCAGGGAAAGCTGTTGCAGATGGGGGGACAGCCCCAGCCACAGACAGATACAACAGCTACAACCGACCCCGGTCCAAGGCTGCTGCAGCCTCCGCCGCTGCCACAGTCACTACACCTGCGGAGGGCGCCCCGCCCCAGCCCGGGGTACACAACCTGCCAGTGCCTGCACTCTTTGGGACTGCGAAGCCGGCGCCCAAGACAGGCTCGGGAAGCCCGTTTGCTGGCAACAGCCCGGCCCAAGAGGGCGAGCAGGATGCAGGGTCCCTGAAAGATGTTTTTAAAGGCTTCGACCCCACGGCCTCCCCCTTTTGCCAGTAG

XM_004867069.1 Coding sequence

Bbc3 BCL2 binding component 3, transcript variant X2

Length: 567 bp    Location: 6469158..6475880   Strand: +
>XM_004867069.1
ATGGCCCGTGCACGCCAGGAGGGCAGCTCTCCGGAGCCCGTAGACGGCCCTCGCCCTTTCCCCCTCGGCCGCCTGGTGCCCTCTGCTGTCTCCTGCGGTCTCTGCGAGCCCGGCCTGCCTGCCGCCCCCTCCACCCCTGCCCTGCTGCCGGCCGCCTACCTCTGCGCCCCCACCGCGCCACCCACCCTCACAGCCGCCCTGGGGGGCCCCCGCTGGCCTGGGGGGCCCCGCACCCGGCCCCGAGGCCCGCGCCCTGATGGTCCTCAGTTACCCCTCTCACCCGCTGAGCAGCACCTAGAGTCGACGGTGCCCAGCGCCCCGGAGGCCCTGGCGGGCGGTCCCACCCAGGCGGCCCCCGGGGTCCCGGGGGAGGAGGAGCAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCTGACGACCTCAACGCGCAGTACGAGCGGAGGAGACAAGAGGAGCAGCAGCGACACCGCCCGTCACCCTGGAGGGTGCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG

XM_004867068.1 Coding sequence

Bbc3 BCL2 binding component 3, transcript variant X1

Length: 615 bp    Location: 6469768..6475880   Strand: +
>XM_004867068.1
ATGTGGGGATTCGTGACCCGCCGGGGCGTTTGCGCCCCAGGGAGCGCCATGGCCCGTGCACGCCAGGAGGGCAGCTCTCCGGAGCCCGTAGACGGCCCTCGCCCTTTCCCCCTCGGCCGCCTGGTGCCCTCTGCTGTCTCCTGCGGTCTCTGCGAGCCCGGCCTGCCTGCCGCCCCCTCCACCCCTGCCCTGCTGCCGGCCGCCTACCTCTGCGCCCCCACCGCGCCACCCACCCTCACAGCCGCCCTGGGGGGCCCCCGCTGGCCTGGGGGGCCCCGCACCCGGCCCCGAGGCCCGCGCCCTGATGGTCCTCAGTTACCCCTCTCACCCGCTGAGCAGCACCTAGAGTCGACGGTGCCCAGCGCCCCGGAGGCCCTGGCGGGCGGTCCCACCCAGGCGGCCCCCGGGGTCCCGGGGGAGGAGGAGCAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCTGACGACCTCAACGCGCAGTACGAGCGGAGGAGACAAGAGGAGCAGCAGCGACACCGCCCGTCACCCTGGAGGGTGCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG

XM_004867067.1 Coding sequence

Prr24 proline rich 24, transcript variant X2

Length: 432 bp    Location: 6442812..6440145   Strand: -
>XM_004867067.1
ATGCGGGGCACGAGCTGCGTGGGCGGCGGTGGCGAGAGCCCCGGTGGCGGGGGGCTAAGCGAGGGTCCGCGGGGCCGCTGGCTGCGCCTGGCCCCTGTCTGCGCCTACTTTCTCTGCGTCTCTCTGGCCGCCGTGCTGCTCGCCGTGTACTATGGTCTCATCTGGGTCCCCACGCGGCCCCTTGCAGGTCCTGCCGGTCCCCTGCCCAGCGTGCCGCCCGCCCCGTGTGCCGCCCCGCCAGGCGTGCCGCCCGCCCCCGTCCCCGCCCCAGCTGCCGCCGCTGCCTGCCTGCTGGGAGCCCCGGGCGAGCCGAGGCCCCCACTTGATCTGCCGCGCAGTCGCCGCCGCCGCCACAGCGGCCCTGGGCGCCGCCCCCGCCGTCCGCCACCGAGAGAGAAGCCCGAGGCCGCGGGGGGCCGAGGACCCGGGTAA

XM_004867066.1 Coding sequence

Prr24 proline rich 24, transcript variant X1

Length: 432 bp    Location: 6442475..6440145   Strand: -
>XM_004867066.1
ATGCGGGGCACGAGCTGCGTGGGCGGCGGTGGCGAGAGCCCCGGTGGCGGGGGGCTAAGCGAGGGTCCGCGGGGCCGCTGGCTGCGCCTGGCCCCTGTCTGCGCCTACTTTCTCTGCGTCTCTCTGGCCGCCGTGCTGCTCGCCGTGTACTATGGTCTCATCTGGGTCCCCACGCGGCCCCTTGCAGGTCCTGCCGGTCCCCTGCCCAGCGTGCCGCCCGCCCCGTGTGCCGCCCCGCCAGGCGTGCCGCCCGCCCCCGTCCCCGCCCCAGCTGCCGCCGCTGCCTGCCTGCTGGGAGCCCCGGGCGAGCCGAGGCCCCCACTTGATCTGCCGCGCAGTCGCCGCCGCCGCCACAGCGGCCCTGGGCGCCGCCCCCGCCGTCCGCCACCGAGAGAGAAGCCCGAGGCCGCGGGGGGCCGAGGACCCGGGTAA

XM_004867071.1 Coding sequence

Bbc3 BCL2 binding component 3, transcript variant X4

Length: 567 bp    Location: 6469759..6475880   Strand: +
>XM_004867071.1
ATGGCCCGTGCACGCCAGGAGGGCAGCTCTCCGGAGCCCGTAGACGGCCCTCGCCCTTTCCCCCTCGGCCGCCTGGTGCCCTCTGCTGTCTCCTGCGGTCTCTGCGAGCCCGGCCTGCCTGCCGCCCCCTCCACCCCTGCCCTGCTGCCGGCCGCCTACCTCTGCGCCCCCACCGCGCCACCCACCCTCACAGCCGCCCTGGGGGGCCCCCGCTGGCCTGGGGGGCCCCGCACCCGGCCCCGAGGCCCGCGCCCTGATGGTCCTCAGTTACCCCTCTCACCCGCTGAGCAGCACCTAGAGTCGACGGTGCCCAGCGCCCCGGAGGCCCTGGCGGGCGGTCCCACCCAGGCGGCCCCCGGGGTCCCGGGGGAGGAGGAGCAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCTGACGACCTCAACGCGCAGTACGAGCGGAGGAGACAAGAGGAGCAGCAGCGACACCGCCCGTCACCCTGGAGGGTGCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG

XM_004867070.1 Coding sequence

Bbc3 BCL2 binding component 3, transcript variant X3

Length: 567 bp    Location: 6469764..6475880   Strand: +
>XM_004867070.1
ATGGCCCGTGCACGCCAGGAGGGCAGCTCTCCGGAGCCCGTAGACGGCCCTCGCCCTTTCCCCCTCGGCCGCCTGGTGCCCTCTGCTGTCTCCTGCGGTCTCTGCGAGCCCGGCCTGCCTGCCGCCCCCTCCACCCCTGCCCTGCTGCCGGCCGCCTACCTCTGCGCCCCCACCGCGCCACCCACCCTCACAGCCGCCCTGGGGGGCCCCCGCTGGCCTGGGGGGCCCCGCACCCGGCCCCGAGGCCCGCGCCCTGATGGTCCTCAGTTACCCCTCTCACCCGCTGAGCAGCACCTAGAGTCGACGGTGCCCAGCGCCCCGGAGGCCCTGGCGGGCGGTCCCACCCAGGCGGCCCCCGGGGTCCCGGGGGAGGAGGAGCAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCTGACGACCTCAACGCGCAGTACGAGCGGAGGAGACAAGAGGAGCAGCAGCGACACCGCCCGTCACCCTGGAGGGTGCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG

XM_004867072.1 Coding sequence

Bbc3 BCL2 binding component 3, transcript variant X5

High confidence: 1 potential gene match
Length: 567 bp    Location: 6467708..6475880   Strand: +
>XM_004867072.1
ATGGCCCGTGCACGCCAGGAGGGCAGCTCTCCGGAGCCCGTAGACGGCCCTCGCCCTTTCCCCCTCGGCCGCCTGGTGCCCTCTGCTGTCTCCTGCGGTCTCTGCGAGCCCGGCCTGCCTGCCGCCCCCTCCACCCCTGCCCTGCTGCCGGCCGCCTACCTCTGCGCCCCCACCGCGCCACCCACCCTCACAGCCGCCCTGGGGGGCCCCCGCTGGCCTGGGGGGCCCCGCACCCGGCCCCGAGGCCCGCGCCCTGATGGTCCTCAGTTACCCCTCTCACCCGCTGAGCAGCACCTAGAGTCGACGGTGCCCAGCGCCCCGGAGGCCCTGGCGGGCGGTCCCACCCAGGCGGCCCCCGGGGTCCCGGGGGAGGAGGAGCAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCTGACGACCTCAACGCGCAGTACGAGCGGAGGAGACAAGAGGAGCAGCAGCGACACCGCCCGTCACCCTGGAGGGTGCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG

XM_004866972.1 Coding sequence

Bax BCL2-associated X protein, transcript variant X3

Length: 540 bp    Location: 5055051..5050222   Strand: -
>XM_004866972.1
ATGGACGGGTCCGGGGAGCACCCCAGAGGAGGCGGGCCCACCAGCTCTGAGCACATCATGAAGACAGGGGCCCTTTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCACATGGGCGGGGATACCCTGGAGCTGGCCATGGAGCAGGTGCCCCAGGACCCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGGATTGGGGACGAACTGGACAGCAACATGGAGCTGCAGAGGATGATTGCGGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTGCTGATGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTATTTTGCCAGCAAACTGGTGCTCAAGGCGCTGTGTACCAAGGTGCCGGAGCTGATCAGGACCATCATGGGCTGGACACTGGACTTCCTCCGCGAGCGGCTGCTGGGCTGGATCCAGGACCAGGGGGGTTGGACGGTGACCATCTTCGTGGCTGGCGTGCTCACTGCCTCACTCACCATCTGGAAGAACTTGGGCTGA

XM_004867062.1 Coding sequence

C5ar2 complement component 5a receptor 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 1128 bp    Location: 6410889..6403002   Strand: -
>XM_004867062.1
ATGCGCCACCACGCCCAGGTCATCTGCTCTTCAGACCTCAGCCAGACCCTTCCCCGTGTCTCGGGCTCACTCTGGGTGAGAACTTTCTACATTTTCCAGCAGGCACCTGAGGTGCGGATGGAGAACTACTCTCTCAACTACGAGGTCGAGTATGGGGACTACGGGGACCTTCCTGATGTCCCCGTGGACTGCTCAAGTGGCGCCTGCCGGGCCATGGACACCCTCCGTGTGGCCCCGCTGCTGCTGTATGCTGCCATCTTCCTGGTGGGGGTGCCTGGCAACATCATGGTGGTCTGGGTGTCCAGGAAGTGGGCTGGCCACAGGCTCGGGGCCGCCTGGCTCCTGCACCTGGCAGTGGCCGACCTGCTGTGCTGTCTGTCGATGCTGCTCCTAGCGGTGCCCCTGGCGCGCCGTGGCCACTGGCCATTCGGGGAGCTGGGCTGTCGCCTGCTGCCTGCGGCTGTGCTGCTGTCCATGTTTGCCCGTGTGCTGCTCCTGGCAGCTCTCAGCACCGACCTCTGTCTGCTGGCGCTCGGGTGGGCCGGCTGGGCCGGGGCGGCACGGGCTCGCAGGGCGTGGATGGCCCGGGGGGTGGCCTGGACAGCGGCCCTGCTGCTCACGGTGCCCTCGGCCCTGCACCGCCGCCTGCACCAGGAGCATTTCCCATCCCGGCTCGTGTGTGGCGTGGACTATGGTGGCTCAGCCACCATGGAGGGCACGGTGACCGCTGTGCAGTTCATCTGCGGCTTCCTGGGGCCGCTGGTGGTCGTGGTCGGCTGCCACAGCATCCTGCTGCGCAAAGCGGCCTCACGTCGCTGGCCGCTAGGCACGGCCGTCGTGGTGAGCTTCTTTGTGTGCTGGGCCCCCTACCACCTGCTGGGGCTGGTGCTGGCTGCAGCAGCCCCAAACTCAGTGCTCCTGGCCCGGGCCCTGCGGGCTGAGCCCTGGGTCGTGGGCCTGGCCCTTGCTCACAGCTGCCTCAACCCCTTCCTCTTCCTGTATTTTGGGCGGGCTCAACTCCGCCAGTCACTGCCCGCTGCGTGTCACTGGGCCCTGCGGGAGTCCCAGGACCAGGAGGACAGTGTGGTCAGCAGGATGTCCACCGGCCAGGAACTGATGGAAGTGTAG

XM_004867063.1 Coding sequence

C5ar2 complement component 5a receptor 2, transcript variant X2

Length: 1011 bp    Location: 6405253..6403002   Strand: -
>XM_004867063.1
ATGGAGAACTACTCTCTCAACTACGAGGTCGAGTATGGGGACTACGGGGACCTTCCTGATGTCCCCGTGGACTGCTCAAGTGGCGCCTGCCGGGCCATGGACACCCTCCGTGTGGCCCCGCTGCTGCTGTATGCTGCCATCTTCCTGGTGGGGGTGCCTGGCAACATCATGGTGGTCTGGGTGTCCAGGAAGTGGGCTGGCCACAGGCTCGGGGCCGCCTGGCTCCTGCACCTGGCAGTGGCCGACCTGCTGTGCTGTCTGTCGATGCTGCTCCTAGCGGTGCCCCTGGCGCGCCGTGGCCACTGGCCATTCGGGGAGCTGGGCTGTCGCCTGCTGCCTGCGGCTGTGCTGCTGTCCATGTTTGCCCGTGTGCTGCTCCTGGCAGCTCTCAGCACCGACCTCTGTCTGCTGGCGCTCGGGTGGGCCGGCTGGGCCGGGGCGGCACGGGCTCGCAGGGCGTGGATGGCCCGGGGGGTGGCCTGGACAGCGGCCCTGCTGCTCACGGTGCCCTCGGCCCTGCACCGCCGCCTGCACCAGGAGCATTTCCCATCCCGGCTCGTGTGTGGCGTGGACTATGGTGGCTCAGCCACCATGGAGGGCACGGTGACCGCTGTGCAGTTCATCTGCGGCTTCCTGGGGCCGCTGGTGGTCGTGGTCGGCTGCCACAGCATCCTGCTGCGCAAAGCGGCCTCACGTCGCTGGCCGCTAGGCACGGCCGTCGTGGTGAGCTTCTTTGTGTGCTGGGCCCCCTACCACCTGCTGGGGCTGGTGCTGGCTGCAGCAGCCCCAAACTCAGTGCTCCTGGCCCGGGCCCTGCGGGCTGAGCCCTGGGTCGTGGGCCTGGCCCTTGCTCACAGCTGCCTCAACCCCTTCCTCTTCCTGTATTTTGGGCGGGCTCAACTCCGCCAGTCACTGCCCGCTGCGTGTCACTGGGCCCTGCGGGAGTCCCAGGACCAGGAGGACAGTGTGGTCAGCAGGATGTCCACCGGCCAGGAACTGATGGAAGTGTAG

XM_004867055.1 Coding sequence

Meis3 Meis homeobox 3, transcript variant X7

Length: 1152 bp    Location: 6369318..6376831   Strand: +
>XM_004867055.1
ATGGCCCGGAGGTACGATGAGCTGCCCCACTACCCAGGCATCGTGGATGGCACAGCAGCCCTGGCTGGCTTCTCAGAGGTGGCGCCCCCGGCACCCAGAGCCCCCGGGCCCTATGGCCCCCACCGGCTGCCCCCGCCCCCAGGCCTGGACAGTGACGGCCTGAAGAGGGAGAAGGATGAGATCTATGGACACCCACTCTTCCCGCTGCTAGCCCTGGTGTTTGAGAAATGTGAGCTGGCCACATGCTCACCCCGAGATGGGGCGGGAACTGGGCTGGGTGCGCCCCCCGGCGGCGATGTCTGCTCCTCCGATTCCTTCAACGAGGACATCGCTGCCTTTGCCAAGCAGGTCCGCTCCGAGAGGCCCCTCTTCTCCTCCAACCCAGAGCTGGACAATCTGATGATCCAGGCCATCCAGGTGCTGCGGTTCCACCTGCTGGAGCTGGAGAAGGTCCACGACCTGTGCGACAACTTCTGTCACCGCTACATCACCTGCCTCAAGGGAAAGATGCCCATCGACCTGGTCATCGAGGAGCGGGACAGTGGCTGCAGGGAGGATCTGGAGGACTTCCCAGCCTCCTGCCCCAGCCTCCCAGACCAGGATAATGCATGGATCAGAGACCAAGAGGACAGTGGGTCTGTGCGTCTGGGGACCCCGGGCCCATCCAGTGGGGGCCTGGCCTCGCAGAGTGGGGACAACGCCAGCGACCAAGGAGACGGGCTGGACACGGGCGTGGCCTCGCCCAGTTCTGGGGGAGAGGACGAGGAGCTGGACCAGGAGCGGCGGCGGAACAAGAAGCGGGGCATCTTCCCCAAAGTGGCCACCAACATCATGCGGGCCTGGCTGTTCCAGCACCTGTCGCACCCATACCCCTCCGAGGAGCAGAAGAAGCAGCTGGCGCAGGACACCGGGCTCACCATCCTGCAAGTGAACAACTGGTTCATCAACGCGCGGAGACGCATCGTGCAGCCCATGATCGACCAGTCCAACCGCACAGGCCAGGGTGCAGCCTTCAGCCCAGATGGCCAGCCCGTGGCTGGCTACGCGGAGACGCAGCCGCACCTGACTGTCCGGCCCCCGGGTAAGCCCCGCCCCTCCTATGGCCCCGCCCTCGACCAGCCCCCGCCTCTAAACGGATGTCCCACCTTCTGA

XM_004867058.1 Coding sequence

Dhx34 DEAH (Asp-Glu-Ala-His) box polypeptide 34, transcript variant X1

Length: 3954 bp    Location: 6400596..6384317   Strand: -
>XM_004867058.1
ATGAAAAAATCGGGCCCAGGTGATCAGAACCAAGGCCCACTTCGTGACAACGTTGTGGGTCACAGCATGGCTCCTCCCAGGACCAGGGAGGGGAGGGGTCACCGAGACCACCGCTGGCCTCCCAGCGAGGAAGAGGCCTGGGAGAGATGGGACTGGGATTGTCCAGAGACACGTGGCCTCTTTGAGGACGCCTTCTTCGGCGATGAGGATTACATCCGCCAGGGCTCTGAGGAGTGCCAGAAGTTCTGGGCCTTCTTTGAACGCCTGCAGCGATTCCAGAATCTCAAGACCTCCAAGAAGGAGGAAAAAGACCCCAGACCTCCCCAACACTGCATCCCGGCCCTGGCCGACCTGCCTCGCACTTACGATCCCCGCTACCGCATCAACCTCTCTGTGCTTGGCCCCGATGCATGGAGCACCCGGAGGCTGGGCAGTCGCCTGCCCCCGGAACGCGTGTCTGAGTTCCGCCAGGCCCTGCTGCACTACCTGGACTTCAGCCAGAAGCAGGCATTTGGGCGGCTGGCCAAGCTGCAGCGGGAGCGGGCTGCCCTTCCCATCGCCCAGTACAGGAACCGAATCCTGCAGATGCTGAAGCAGCACCAGGTGGTGGTGGTGGCCGGGGACACAGGGTGTGGCAAGTCCACCCAGGTACCCCAGTACTTGCTGGCTGGCGGCTTTAGCCATGTTGCCTGCACCCAGCCCCGGCGAATTGCCTGCGTCTCACTGGCCAAGCGCGTTGGCTTCGAGAGCCTCAGTCAGTATGGATCTCAGGTCGGCTACCAGATCCGCTTTGAAAGCACGCGCTCGGTGGCCACCAAGATCGTGTTCCTGACGGTGGGGCTGCTCCTGCGGCAGATCCAGCACGAGCCCAGCCTGCCCCAGTACAACGTCCTGATCGTGGATGAGGTCCACGAGCGGCAGCTGCACAGCGACTTCCTCCTGGGCGTCCTGCGGCGCCTGCTGCCCACGAGGCCTGACCTTAAGGTCGTCCTCATGTCGGCCACCATCAACATCGAGCTCTTCTCCAGCTACTTCGGCAATGCGCCCGTGGTGCAGGTGCCCGGGCGGCTCTTCCCCATCACGGTCATTTACCAGCCACAGGAGGCCGAGCAGACAGCCTCCAAGACTGAGAAGTTGGACCCGCGGCCCTTCCTGAGGGTGCTGGAGGCCATTGACAGTAAATACCCGCCTGAGGAGCGTGGGGACCTCCTGGTCTTCCTCAGCGGCATGGCAGAGATCAGTGCCGTGCTGGAGGCCGCCCAGACCTATGCCATCCACACGCAGCGCTGGGTGGTGCTCCCACTGCACAGCACGCTCTCCGTGGCCGACCAGGACAAGGTGTTCGATGTGGCCCCTCCTGGAGTCCGGAAATGCATCCTCTCCACCAACATCGCAGAGACTTCGGTCACCATCGACGGGATCCGCTTTGTCTTGGACTCCGGGAAGGTGAAGGAGATGAGCTACGACCCACAGGCCAAGCTGCAGCGGCTGCAAGAGTTCTGGATTAGCCAGGCCAGCGCTGAGCAACGCAAGGGCCGGGCAGGCCGCACAGGCCCTGGTGTCTGCTACCGCCTCTACGCCGAGTCTGACTATGACGCCTTCGCCCCCTACCCAGTCCCTGAAATCCGGAGGGTGGCCCTGGATGCACTGGTGCTGCAGATGAAGAGCATGAGTGTGGGGGACCCACGTACCTTCCCCTTCATCGAGCCGCCGCCCCCTGCCAGCCTGGAGACCGCCATCCTGTACCTCCGGGACCAGGGCGCGCTGGACGCCTCTGAGGCCCTCACGCCTATCGGCTGTCTGCTGGCCCAGCTGCCCGTGGACGTGGTGATCGGGAAGATGCTGATCCTGGGTTCCACGTTCAGCCTGGTGGAGCCAGTGCTCACCATTGCCGCTGCTCTCAGTGTGCAGTCGCCTTTCACGCGCAGTGCCCAGAGCAGCCTGGAGTGCGCGGCAGCACGCCGGCCCCTGGAGAGTGACCAGGGCGACCCCTTCACGCTCTTCAATGTCTTCAATGCCTGGGTGCAGGTGAAGGCTGAGCACAGCAGGATCTCTCGCAAGTGGTGCCGCCGCCGGGGCGTGGAGGAGCATCGGCTGTATGAGATGGCCAACCTGCGACGCCAGTTCAAGGAGCTGCTGGAGGACCACGGGCTGCAGGCTGGGGCCCAGGTGGTCAGGCCGCGGGACAGCTACAGTCGGCTGCAGCAGCGCCGGGAGCGCCGGGTCCTGCACCAGCTGAAGCGGCAGCATGAGGAGGGCAAGGGCCGCCGGCGCAAGGTGCTGCGGCTGCAGGAGGAGGCTGACGACGGCTCCAGTGACGAGGACCGTGCTGGCCCTGCTGCCCAGGGTGCCAGTGACAGCGTGGACATCCAGGACGTGAAGTTTAAGCTCCGGCACAACCTGGAGCAGCTGCAGGCAGCCGCCAGCTCAGCCCAGGAGCTGAGCCGGGAGCAGCTGGCCCTGCTCAAGCTGGTGCTGGCCCGAGGCCTTTACCCACAGCTGGCCGTGCCCGACCCGCTCAACAGTGGCCGCAAGGACTCGGACCAGATTTTCCACACCCAGGCCAAGCAGGGCGCAGTGCTGCACCCTACCTGCATCTTCACTGGCAGCCCCGAGGTGCTGCACACGTGGGAGCCGGAGGCCACGGGCGGCGGAGGGAGCCGAGGTGACAAGGACAAGATGAGCAGCAAGCACCAGCTCCTCACCTTCGTCTCCCTGCTGGAGACCAACAAGCTGTACCTGGTAAACTGTGTCCGCATCCCAGCCCTCCAGTCCCTGCTGCTGTTCAGCCGGTCCCTGGACACCAATGGTGACTGCTCCCGCCTGGTGGCCGACGGCTGGCTGGAGCTGCAGCTGGTGGACAGCGAGGGCGCTGTCCGGCTTCTGGCAGCTGCCCTACGCCTCCGTGCCCGCTGGGAGAGCGCTCTGGACCAGCAGCTGTCACACCAGGCCTGGCAGCGGCAGCGGCTTGAGGAAGAGGATGAGGCTGCACTCATCAGCCACACAGAGGTGGCCGCCCTGAGCAGGGAGCTACTGCAGTTCGTGGCCACCAAGGTTCCCTACAGCCTCCGGCGGCTCACAGGGCTGGAAGCCCAGAACCTCTACGTGGGACCCCAGACCATCCTGGCCACCCCCAGTCTCCCTGGCCTCTTCGGCAGCTCTACTCTGTCCCCACACCCCACCAAGGGTGGCTACAGCGTCACCAGCTTCCTCACCTATAACTGCCTCTCAAGTGACACGGACCTGTACAGCGACTGCCTGCGCACCTTCTGGACCTGCCCGCACTGCGGCCTGCACCTGCCGCTCACACCGCTGGAGCGCATGGCGCACGAGAGTGTCTGCACCACGGGCCCCGACGGCGCCCCAGGCAAGGGGGCGGCTCCTCCAGGTCCCCCACCCCACTTCCTGCCTCTCTTGCCTCTGGTCTCCTGGTCCCTACCCGTGTCTGTCTCTTTGGTGTCTCCATGGCCGAGTGCCTTTCTCCTTTCTCTGTCCCTCAGCTGTGTCTGCCTCGGTCACATCCCCTCATTGCCACCAAGGGGTGCTGCAGTGTCTGCCGCTGTGTCCCCTACACCGCAGGGAGACTGGGAGGCCCACGACTGCCGTCTCTGTCTCCCTGGTGGTGGCAGGGTACAGTGCAGCCTGTGCGTGGTTAGCGGGGAAGGCTTCCTGGAGGGCGCGAAGCTGGGCTCCCTGAGGTGTGGAGAGACGGAGCCCGGCAGGCGCCCCTCAGAGCCTCCCCTCCCGCAGGCGCTGAGGAAGCTGCCCCTGAGCACCCCCAGAAGCCATCGGCCCTGCAGAGGCCCTACCACTGCGACACCTGCCAGAAGGACTTCCTGTTCACACCCACCGAGGCTCTGCGCCACCGCAGGCAGCACGTGTGAGCCGCCACCACCACCTGTTCCCTGCGACCCCTGCACCGGCCAGGCTCAGAGCAGTGCTGGTCCCGTCTGA

XM_004867059.1 Coding sequence

Dhx34 DEAH (Asp-Glu-Ala-His) box polypeptide 34, transcript variant X2

Length: 3954 bp    Location: 6400585..6384317   Strand: -
>XM_004867059.1
ATGAAAAAATCGGGCCCAGGTGATCAGAACCAAGGCCCACTTCGTGACAACGTTGTGGGTCACAGCATGGCTCCTCCCAGGACCAGGGAGGGGAGGGGTCACCGAGACCACCGCTGGCCTCCCAGCGAGGAAGAGGCCTGGGAGAGATGGGACTGGGATTGTCCAGAGACACGTGGCCTCTTTGAGGACGCCTTCTTCGGCGATGAGGATTACATCCGCCAGGGCTCTGAGGAGTGCCAGAAGTTCTGGGCCTTCTTTGAACGCCTGCAGCGATTCCAGAATCTCAAGACCTCCAAGAAGGAGGAAAAAGACCCCAGACCTCCCCAACACTGCATCCCGGCCCTGGCCGACCTGCCTCGCACTTACGATCCCCGCTACCGCATCAACCTCTCTGTGCTTGGCCCCGATGCATGGAGCACCCGGAGGCTGGGCAGTCGCCTGCCCCCGGAACGCGTGTCTGAGTTCCGCCAGGCCCTGCTGCACTACCTGGACTTCAGCCAGAAGCAGGCATTTGGGCGGCTGGCCAAGCTGCAGCGGGAGCGGGCTGCCCTTCCCATCGCCCAGTACAGGAACCGAATCCTGCAGATGCTGAAGCAGCACCAGGTGGTGGTGGTGGCCGGGGACACAGGGTGTGGCAAGTCCACCCAGGTACCCCAGTACTTGCTGGCTGGCGGCTTTAGCCATGTTGCCTGCACCCAGCCCCGGCGAATTGCCTGCGTCTCACTGGCCAAGCGCGTTGGCTTCGAGAGCCTCAGTCAGTATGGATCTCAGGTCGGCTACCAGATCCGCTTTGAAAGCACGCGCTCGGTGGCCACCAAGATCGTGTTCCTGACGGTGGGGCTGCTCCTGCGGCAGATCCAGCACGAGCCCAGCCTGCCCCAGTACAACGTCCTGATCGTGGATGAGGTCCACGAGCGGCAGCTGCACAGCGACTTCCTCCTGGGCGTCCTGCGGCGCCTGCTGCCCACGAGGCCTGACCTTAAGGTCGTCCTCATGTCGGCCACCATCAACATCGAGCTCTTCTCCAGCTACTTCGGCAATGCGCCCGTGGTGCAGGTGCCCGGGCGGCTCTTCCCCATCACGGTCATTTACCAGCCACAGGAGGCCGAGCAGACAGCCTCCAAGACTGAGAAGTTGGACCCGCGGCCCTTCCTGAGGGTGCTGGAGGCCATTGACAGTAAATACCCGCCTGAGGAGCGTGGGGACCTCCTGGTCTTCCTCAGCGGCATGGCAGAGATCAGTGCCGTGCTGGAGGCCGCCCAGACCTATGCCATCCACACGCAGCGCTGGGTGGTGCTCCCACTGCACAGCACGCTCTCCGTGGCCGACCAGGACAAGGTGTTCGATGTGGCCCCTCCTGGAGTCCGGAAATGCATCCTCTCCACCAACATCGCAGAGACTTCGGTCACCATCGACGGGATCCGCTTTGTCTTGGACTCCGGGAAGGTGAAGGAGATGAGCTACGACCCACAGGCCAAGCTGCAGCGGCTGCAAGAGTTCTGGATTAGCCAGGCCAGCGCTGAGCAACGCAAGGGCCGGGCAGGCCGCACAGGCCCTGGTGTCTGCTACCGCCTCTACGCCGAGTCTGACTATGACGCCTTCGCCCCCTACCCAGTCCCTGAAATCCGGAGGGTGGCCCTGGATGCACTGGTGCTGCAGATGAAGAGCATGAGTGTGGGGGACCCACGTACCTTCCCCTTCATCGAGCCGCCGCCCCCTGCCAGCCTGGAGACCGCCATCCTGTACCTCCGGGACCAGGGCGCGCTGGACGCCTCTGAGGCCCTCACGCCTATCGGCTGTCTGCTGGCCCAGCTGCCCGTGGACGTGGTGATCGGGAAGATGCTGATCCTGGGTTCCACGTTCAGCCTGGTGGAGCCAGTGCTCACCATTGCCGCTGCTCTCAGTGTGCAGTCGCCTTTCACGCGCAGTGCCCAGAGCAGCCTGGAGTGCGCGGCAGCACGCCGGCCCCTGGAGAGTGACCAGGGCGACCCCTTCACGCTCTTCAATGTCTTCAATGCCTGGGTGCAGGTGAAGGCTGAGCACAGCAGGATCTCTCGCAAGTGGTGCCGCCGCCGGGGCGTGGAGGAGCATCGGCTGTATGAGATGGCCAACCTGCGACGCCAGTTCAAGGAGCTGCTGGAGGACCACGGGCTGCAGGCTGGGGCCCAGGTGGTCAGGCCGCGGGACAGCTACAGTCGGCTGCAGCAGCGCCGGGAGCGCCGGGTCCTGCACCAGCTGAAGCGGCAGCATGAGGAGGGCAAGGGCCGCCGGCGCAAGGTGCTGCGGCTGCAGGAGGAGGCTGACGACGGCTCCAGTGACGAGGACCGTGCTGGCCCTGCTGCCCAGGGTGCCAGTGACAGCGTGGACATCCAGGACGTGAAGTTTAAGCTCCGGCACAACCTGGAGCAGCTGCAGGCAGCCGCCAGCTCAGCCCAGGAGCTGAGCCGGGAGCAGCTGGCCCTGCTCAAGCTGGTGCTGGCCCGAGGCCTTTACCCACAGCTGGCCGTGCCCGACCCGCTCAACAGTGGCCGCAAGGACTCGGACCAGATTTTCCACACCCAGGCCAAGCAGGGCGCAGTGCTGCACCCTACCTGCATCTTCACTGGCAGCCCCGAGGTGCTGCACACGTGGGAGCCGGAGGCCACGGGCGGCGGAGGGAGCCGAGGTGACAAGGACAAGATGAGCAGCAAGCACCAGCTCCTCACCTTCGTCTCCCTGCTGGAGACCAACAAGCTGTACCTGGTAAACTGTGTCCGCATCCCAGCCCTCCAGTCCCTGCTGCTGTTCAGCCGGTCCCTGGACACCAATGGTGACTGCTCCCGCCTGGTGGCCGACGGCTGGCTGGAGCTGCAGCTGGTGGACAGCGAGGGCGCTGTCCGGCTTCTGGCAGCTGCCCTACGCCTCCGTGCCCGCTGGGAGAGCGCTCTGGACCAGCAGCTGTCACACCAGGCCTGGCAGCGGCAGCGGCTTGAGGAAGAGGATGAGGCTGCACTCATCAGCCACACAGAGGTGGCCGCCCTGAGCAGGGAGCTACTGCAGTTCGTGGCCACCAAGGTTCCCTACAGCCTCCGGCGGCTCACAGGGCTGGAAGCCCAGAACCTCTACGTGGGACCCCAGACCATCCTGGCCACCCCCAGTCTCCCTGGCCTCTTCGGCAGCTCTACTCTGTCCCCACACCCCACCAAGGGTGGCTACAGCGTCACCAGCTTCCTCACCTATAACTGCCTCTCAAGTGACACGGACCTGTACAGCGACTGCCTGCGCACCTTCTGGACCTGCCCGCACTGCGGCCTGCACCTGCCGCTCACACCGCTGGAGCGCATGGCGCACGAGAGTGTCTGCACCACGGGCCCCGACGGCGCCCCAGGCAAGGGGGCGGCTCCTCCAGGTCCCCCACCCCACTTCCTGCCTCTCTTGCCTCTGGTCTCCTGGTCCCTACCCGTGTCTGTCTCTTTGGTGTCTCCATGGCCGAGTGCCTTTCTCCTTTCTCTGTCCCTCAGCTGTGTCTGCCTCGGTCACATCCCCTCATTGCCACCAAGGGGTGCTGCAGTGTCTGCCGCTGTGTCCCCTACACCGCAGGGAGACTGGGAGGCCCACGACTGCCGTCTCTGTCTCCCTGGTGGTGGCAGGGTACAGTGCAGCCTGTGCGTGGTTAGCGGGGAAGGCTTCCTGGAGGGCGCGAAGCTGGGCTCCCTGAGGTGTGGAGAGACGGAGCCCGGCAGGCGCCCCTCAGAGCCTCCCCTCCCGCAGGCGCTGAGGAAGCTGCCCCTGAGCACCCCCAGAAGCCATCGGCCCTGCAGAGGCCCTACCACTGCGACACCTGCCAGAAGGACTTCCTGTTCACACCCACCGAGGCTCTGCGCCACCGCAGGCAGCACGTGTGAGCCGCCACCACCACCTGTTCCCTGCGACCCCTGCACCGGCCAGGCTCAGAGCAGTGCTGGTCCCGTCTGA

XM_004867051.1 Coding sequence

Meis3 Meis homeobox 3, transcript variant X3

Length: 1335 bp    Location: 6369318..6376043   Strand: +
>XM_004867051.1
ATGGCCCGGAGGTACGATGAGCTGCCCCACTACCCAGGCATCGTGGATGGCACAGCAGCCCTGGCTGGCTTCTCAGAGGTGGCGCCCCCGGCACCCAGAGCCCCCGGGCCCTATGGCCCCCACCGGCTGCCCCCGCCCCCAGGCCTGGACAGTGACGGCCTGAAGAGGGAGAAGGATGAGATCTATGGACACCCACTCTTCCCGCTGCTAGCCCTGGTGTTTGAGAAATGTGAGCTGGCCACATGCTCACCCCGAGATGGGGCGGGAACTGGGCTGGGTGCGCCCCCCGGCGGCGATGTCTGCTCCTCCGATTCCTTCAACGAGGACATCGCTGCCTTTGCCAAGCAGGTCCGCTCCGAGAGGCCCCTCTTCTCCTCCAACCCAGAGCTGGACAATCTGATGATCCAGGCCATCCAGGTGCTGCGGTTCCACCTGCTGGAGCTGGAGAAGGTCCACGACCTGTGCGACAACTTCTGTCACCGCTACATCACCTGCCTCAAGGGAAAGATGCCCATCGACCTGGTCATCGAGGAGCGGGACAGTGGCTGCAGGGAGGATCTGGAGGACTTCCCAGCCTCCTGCCCCAGCCTCCCAGACCAGGATAATGCATGGATCAGAGACCAAGAGGACAGTGGGTCTGTGCGTCTGGGGACCCCGGGCCCATCCAGTGGGGGCCTGGCCTCGCAGAGTGGGGACAACGCCAGCGACCAAGGAGACGGGCTGGACACGGGCGTGGCCTCGCCCAGTTCTGGGGGAGAGGACGAGGAGCTGGACCAGGAGCGGCGGCGGAACAAGAAGCGGGGCATCTTCCCCAAAGTGGCCACCAACATCATGCGGGCCTGGCTGTTCCAGCACCTGTCGGTCAGTCCTGCTGCCGGGGCCATGGGGATGCTGGCAGGGCCACAAAGGCCAGGCAGGAGGGCCCGGGGTGAGACTGGAGGGCGACTGGAGAGATGCGCATGGATTGGGAGGGCAGAGCGAAGCCCAGCCTTCCCTGGGTGCAGGGCGCTCCTAGGGGTCCCCACTTGCCCAGGGCTCCCCACAGCCCACCGACCCAACATCGGGGAGGGAGGCTCCATTGGGATCTGCCCAGAGAGGTTAGGGGACTTGCTCAAGGCCACACAAGCAGAAGTGGTTTCAAACTCAGGCAGTCTGGCCTTAACCAGTGCACCACACTGTCCCATGGAGAGTGGCGGGAAAATAGACAGGGAGAGGCTGACAAAGAGAAAAGACAGAGATGGAGAGGGGCAGTCAGAACAAGATAGAGACTTAGCTGGATTCGAGTCGGTAAGCCCAGCACTGTGGGAGGCTGAGGCAGGAGAACTGCAAGTTTGA

XM_004867050.1 Coding sequence

Meis3 Meis homeobox 3, transcript variant X2

Length: 1359 bp    Location: 6369318..6376043   Strand: +
>XM_004867050.1
ATGGCCCGGAGGTACGATGAGCTGCCCCACTACCCAGGCATCGTGGATGGCACAGCAGCCCTGGCTGGCTTCTCAGAGGTGGCGCCCCCGGCACCCAGAGCCCCCGGGCCCTATGGCCCCCACCGGCTGCCCCCGCCCCCAGGCCTGGACAGTGACGGCCTGAAGAGGGAGAAGGATGAGATCTATGGACACCCACTCTTCCCGCTGCTAGCCCTGGTGTTTGAGAAATGTGAGCTGGCCACATGCTCACCCCGAGATGGGGCGGGAACTGGGCTGGGTGCGCCCCCCGGCGGCGATGTCTGCTCCTCCGATTCCTTCAACGAGGACATCGCTGCCTTTGCCAAGCAGGTCCGCTCCGAGAGGCCCCTCTTCTCCTCCAACCCAGAGCTGGACAATCTGATGATCCAGGCCATCCAGGTGCTGCGGTTCCACCTGCTGGAGCTGGAGAAGGGAAAGATGCCCATCGACCTGGTCATCGAGGAGCGGGACAGTGGCTGCAGGGAGGATCTGGAGGACTTCCCAGCCTCCTGCCCCAGCCTCCCAGACCAGACTCCACGGTGCTTGGATTATAGGTGTGCATCCCCCATGCCCAGCTGTGAACCCCATCTTGAGCCAAGGCACAAAGATAATGCATGGATCAGAGACCAAGAGGACAGTGGGTCTGTGCGTCTGGGGACCCCGGGCCCATCCAGTGGGGGCCTGGCCTCGCAGAGTGGGGACAACGCCAGCGACCAAGGAGACGGGCTGGACACGGGCGTGGCCTCGCCCAGTTCTGGGGGAGAGGACGAGGAGCTGGACCAGGAGCGGCGGCGGAACAAGAAGCGGGGCATCTTCCCCAAAGTGGCCACCAACATCATGCGGGCCTGGCTGTTCCAGCACCTGTCGGTCAGTCCTGCTGCCGGGGCCATGGGGATGCTGGCAGGGCCACAAAGGCCAGGCAGGAGGGCCCGGGGTGAGACTGGAGGGCGACTGGAGAGATGCGCATGGATTGGGAGGGCAGAGCGAAGCCCAGCCTTCCCTGGGTGCAGGGCGCTCCTAGGGGTCCCCACTTGCCCAGGGCTCCCCACAGCCCACCGACCCAACATCGGGGAGGGAGGCTCCATTGGGATCTGCCCAGAGAGGTTAGGGGACTTGCTCAAGGCCACACAAGCAGAAGTGGTTTCAAACTCAGGCAGTCTGGCCTTAACCAGTGCACCACACTGTCCCATGGAGAGTGGCGGGAAAATAGACAGGGAGAGGCTGACAAAGAGAAAAGACAGAGATGGAGAGGGGCAGTCAGAACAAGATAGAGACTTAGCTGGATTCGAGTCGGTAAGCCCAGCACTGTGGGAGGCTGAGGCAGGAGAACTGCAAGTTTGA

XM_004867047.1 Coding sequence

Slc8a2 solute carrier family 8 (sodium/calcium exchanger), member 2, transcript variant X1

Length: 2766 bp    Location: 6333678..6360016   Strand: +
>XM_004867047.1
ATGGCGGCCCTGGCCTTGGTGGGGCTCGCACTCCTCCTGGGGGCTCCCCTGTGCTCAGGGGGGGCCACCCCCACCCCTTCCCTGCCACCTCCCCCGGCCAATGACAGCGACACCAGCACAGGGGGCTGCCAGGGCTCCTACCGCTGCCAGCCCGGGGTGCTGCTGCCCGTGTGGGAGCCCGACGACCCATCCCTGGGGGACAAGGCGGCGCGCGCTGTGGTGTACTTCGTGGCCATGGTCTACATGTTCCTGGGCGTGTCTATCATCGCCGACCGCTTCATGGCATCCATCGAGGTCATCACGTCCAAGGAGAAGGAGATCACCATCACCAAGGCCAACGGCGAGACCAGTGTGGGCACCGTGCGCATCTGGAACGAGACCGTGTCCAACCTCACGCTCATGGCCCTGGGCTCCTCGGCGCCCGAGATCCTGCTGTCTGTCATCGAGGTCTGCGGCCACAACTTCCAGGCGGGCGAGCTGGGCCCAGGCACCATCGTGGGCAGCGCCGCCTTCAACATGTTCGTGGTCATCGCTGTTTGCGTCTACGTCATCCCCGCCGGCGAGAGCCGCAAGATCAAGCACCTGAGAGTCTTTTTTGTCACTGCCTCTTGGAGTATCTTCGCCTACGTCTGGCTTTATCTCATCCTTGCTGTGTTTTCCCCGGGTGTGGTCCAGGTGTGGGAAGCGCTGCTGACGCTCATCTTCTTCCCGGTGTGCGTGGTGTTCGCCTGGATGGCCGACAAGCGGCTGCTCTTCTACAAGTACGTGTACAAGCGCTACCGCACCGACCCGCGCAGCGGCATCATCATCGGCGCCGAGGGCGACCCGCCCAAGAGCATCGAGCTGGACGGCACGTTCGTGGGGGCCGAGGCAACGGGCGAGCTGGGCGCGCTGGGCCCGGGCCCCGCCGAGGCGCGTGAGCTGGACGCCAGCCGCCGCGAGGTCATCCAGATCCTCAAGGACCTCAAGCAGAAGCACCCGGACAAGGACCTGGAGCAGCTGGTGGGCATCGCCAACTACTACGCGCTGCTGCACCAGCAGAAGAGCCGCGCCTTCTACCGCATCCAGGCCACGAGGCTGATGACCGGCGCGGGCAACGTGCTGCGGCGGCACGCGGCGGACGCGTCGCGCAGGGCGGCGCCGCCAGAGGGCGCCGTCGAGGACGAGGATGACGGCGCCAGCCGCATCTTCTTCGAGCCCAGCCTGTACCACTGCCTGGAGAACTGCGGCTCCGTGCTGCTGTCCGTCACCTGCCAGGGCGGCGAGGGCAACAGCACCTTCTACGTGGACTACCGCACGGAGGACGGCTCTGCCAAGGCGGGCTCCGACTACGAGTACAGCGAGGGCACGCTGGTGTTCAAGCCGGGCGAGACGCAGAAGGAGCTGCGCATTGGCATCATCGACGACGACATCTTCGAGGAGGACGAGCACTTCTTCGTGCGGCTGCTCAACCTGCGCGTGGGCGACGCGCAGGGCATGTTCGAGCCCGACGGCGGCGGGCGGCCCAAGGGGCGGCTGGTGGCGCCGCTGCTGGCCACCGTCACCATCCTGGACGACGACCACGCGGGCATCTTCTCCTTCCAGGACCGCCTGCTGCACGTGAGCGAGTGCATGGGCACTGTGGATGTGCGCGTTGTGCGCAGCTCGGGCGCGCGCGGCACCGTGCGCCTCCCCTACCGCACGGTGGACGGCACGGCGCGCGGCGGTGGCGTGCACTACGAGGACGCGTGTGGAGAGCTGGAGTTCGGCGACGACGAGACCATGAAAACGCTCCAGGTGAAAATCGTGGACGACGAGGAGTACGAGAAAAAGGATAACTTCTTCATTGAGCTGGGCCAGCCCCAGTGGCTTAAGCGAGGGATTTCAGCTCTGCTGCTCAATCAAGGAGATGGGGACAGGAAGCTGACGGCCGAGGAGGAGGAGGCCCGAAGGATAGCGGAGATGGGCAAGCCGGTTCTGGGGGAGAACTGCCGGCTGGAGGTCATCATCGAGGAATCCTATGACTTTAAGAACACAGTGGATAAACTCATCAAGAAAACGAACTTGGCCTTGGTGATCGGAACCCATTCGTGGAGGGAGCAGTTTTTAGAAGCAGTGACAGTGAGTGCAGGGGATGAGGAGGAAGAAGAGGATGGGTCCCGAGAGGAGCGGCTGCCATCCTGCTTTGACTACGTGATGCACTTCCTGACGGTGTTCTGGAAGGTGCTGTTCGCCTGCGTGCCCCCCACTGAGTACTGCCACGGCTGGGCCTGCTTTGGCGTCTGCATCCTGGTCATCGGCCTGCTCACCGCCCTCATCGGGGACCTGGCCTCCCACTTTGGGTGCACCGTGGGCCTCAAAGACTCTGTCAATGCTGTTGTCTTCGTGGCACTGGGCACCTCCATCCCCGACACGTTCGCCAGCAAGGTGGCGGCGCTGCAGGACCAGTGCGCGGACGCGTCCATCGGCAACGTGACGGGCTCCAACGCGGTGAACGTGTTCCTGGGCCTGGGTGTGGCCTGGTCGGTGGCTGCCGTGTACTGGGCGGTGCAGGGCCGGCCCTTCGAGGTGCGCACCGGCACGCTGGCCTTCTCCGTCACGCTCTTCACCGTCTTCGCCTTCGTGGGCATCGCCGTGCTGCTCTACCGGCGCCGGCCGCACATCGGCGGCGAGCTGGGCGGCCCGCGCGGGCCCAAGCTCGCCACCGCCGCGCTCTTCCTGGGCCTCTGGCTCCTCTACATCCTCTTCGCCAGCCTCGAGGCGTACTGCCACATCCGCGGCTTCTAG

XM_004867036.1 Coding sequence

LOC101704668 3-alpha-hydroxysteroid sulfotransferase-like, transcript variant X3

Length: 585 bp    Location: 5940845..5962035   Strand: +
>XM_004867036.1
ATGGCAGATGTCTATGGGTGGTTTGAAGGGATAGCATTCCCTCTAGCGTATTTCAACCTGGAAGTCTTAAGAGAAGCACGGGACACATTTGTGGTGAAGGATGAAGATATAATAATGGTGACTTATCCCAAATCAGGAACCCACTGGTTGATTGAGATTATCTGCCTGATTCATTCCAAGGGGGATCCCAAGTGGATCCAATCAGTACCTACATGGCAACGTTCACCCTGGATTGAGACTACACATGGATATGAATTATTGAAGGATAAAGAGGGCCCACACATTTTCACATCTCACCTGCCCATTCAACTCTTCCCCAAGTCCTTTTTCAATTCCAAGGCCAAGGTGATTTATGGCATTAGGAATCCCAGAGATGTTCTCGTGTCTGCTTATTTTTTCTTAAGAAAAATGAATATTACTAAAAAACCAGAGACACTGCAAGAACATATGGAATGGTTCCTCCAGGGAAGTGGAGTCGCTGGGGACTGGAAGAATCACTTCACTGTAGCCCAAGCTGAAGCATTTGATGAAATATATCAGAAGAAGATGGCAGGCTTTCCTCCAAAGCTGTTTCCATGGGAATAA

XM_004867046.1 Coding sequence

Kptn kaptin (actin binding protein), transcript variant X2

Length: 1308 bp    Location: 6325039..6331915   Strand: +
>XM_004867046.1
ATGGGGGAGGCGGCCGTGGCCGTGGGCCCTTGTCCCCTGCGCGAGGACAGCTTCACGCGCTTCTCGTCGCAGAGCAATGTGTACGGTCTGGCCGGCGGCGCCAACGGGCGCGGGGAGCTGCTGGCCGCCACCCTTAAAGGCAAAGTGCTCGGCTTCCGCTACCAAGACCTCCGGCAGAAAATCCGGCCCGTGGCCAAGGAGCTGCAGTTCAACTATATCCCCGTGGATGCAGAAATTGTCTCCATCGACACCTTCAACAAGTCGCCCCCAAAGCGGGGCCTAGTAGTGGGGATCACGTTCATCAAGGATTCAGGGGACAAGGCCAGCCCCTTCCTTAACATTTACTGTGACTACGAGCCTGGCTCTGAGTACAACCTGGACTCCATCGCCCAGAGCTGCCTGAACCTGGAGCTCCAATTCACGCCTTTCCAGCTGTGCCATGCAGAAGTCCAGGTTGGGGATCAGCTGGAGACCGTGTTTCTCCTGAGCGGGAATGACCCGGCCATTCATCTCTACAAGGAGAATGAGGGGCTGCATCAGTTTGAGGAACAGCCTGTGGAAAACCTCTTCCCAGAGCTCACAAACCTGAGCAGCAGTGTCCTCTGGCTGGACGTCCACAACCTCCCCGGCACGTCACGTCGCCTCTCAGCCCTGGGCTGTCAGAGTGGTTATGTCCGCGTCGCCCACGTGGACCAGCAGCGCCGAGAGGTCTTGCAGATGTGGACGGTCCTGCAGGATGGCCCCATCTCCCGCGTGATCCTGTTCAGCCTCGAGGCCCCTGACCAGGCCAAGGACAGGCCACGGCAGGAGGAGTACAGCGTGCTTGTGGCCAGCATGGTGGAGCCAGCCGTGGTGTACCGGGACCTGCTGAACCGGGGCCTTGAGGACCAACTTCTCCTGCCCGCCAGTGACCAATTTGACAGTGTCCTCTGTGGCCTGGTCACCGATGTGGACTTGGATGGACGGCCGGAAGTCCTGGTGGCCACCTATGGACAGGAGCTGCTCTGCTATAAGTACTGTGGCCCGGAGTCGGGGCGCCCGGAGGCCAAGCATGGCTTCTGCCTGCTGTGGCAGCGGAGCTTCTCCAGCCCCCTGCTGGCCATGGCGCACGTGGACCTGACCGGCGACGGGCTGCAGGAGCTGGCTGTGGTCTCCCTGAAGGGGGTGCACATCCTGCAGCACAGCCTGATCCAGGCCTCTGAGCTCGTCCTGACCCGGCTTCAGCGCCAAGTGGAGCAGAAGAGACAGCAGTCACAGGGACCCGGGGTCAGTGTGGGTCCGGGGCCTGGCGAGACCACAGCCTCCTGA

XM_004867019.1 Coding sequence

Emp3 epithelial membrane protein 3, transcript variant X1

Length: 492 bp    Location: 5437643..5432206   Strand: -
>XM_004867019.1
ATGTCGCTCCTCCTGCTGGTGGTCTCTGCCCTTCACATCCTCATCCTCATCCTGCTTTTCGTGGCCACTCTGGATAAGTCCTGGTGGACCCTCCCGGGGAAGGAGTCCCTGAACCTCTGGTACGACTGCACGTGGAACAACGACACCAAAACGTGGGCCTGCAGTAACGTCAGCGACAACGGTTGGCTGAAGGCTGTGCAGGTACTCATGGTGCTGTCCCTCATCCTGTGCTGCCTGTCCTTCATCTTGTTCATGTTCCAGCTGTACACCATGCGTCGAGGGGGGCTCTTCTACGCCACCGGCCTCTGCCAGCTCTGCACCAGCGTGGCTGTGTTCTCGGGGGCCCTGATCTATGCCATCCACGCCAAGGAGATCGTGGTGAAGCACCCGCGCGGGGGCAGCTTCGGGTACTGCTTTGCGCTGGCCTGGGTGGCCTTCCCCCTGGCGCTGGTCAGCGGCATCGTCTACATCCACCTGCGGAAGCGAGAGTGA

XM_004867039.1 Coding sequence

Sepw1 selenoprotein W, 1

Length: 333 bp    Location: 6132693..6129073   Strand: -
>XM_004867039.1
ATGCCCAGTGCACGCAGCGCGGCGCAGCTGGAGGTAGCTGCTCGGTTGTTGCCATTGCTGCTCGCCGTCATGGCCCTATCGGTGCGAGTCGTTTATTGTGGCGCTTGAGGCTATAAGCCCAAGTATCTCCAGCTCAAGGAGAAGCTGGAAGATGAGTTCCCCGGATGCCTAGACATCTGTGGTGAGGGGACGCCCCAGTCCACCGGCTTCTTTGAAGTGACCATAGCCGGGAAGCTGGTTCACTCCAAGAAGGGAGGTGATGGCTTCGTGGACACGAACAGCAAGTTTCGGAAGCTGGTGGCCGCCATCAAAGCCGCCTTGGCTCAGGGCTAG

XM_004867034.1 Coding sequence

LOC101704668 3-alpha-hydroxysteroid sulfotransferase-like, transcript variant X1

Length: 867 bp    Location: 5940845..5957933   Strand: +
>XM_004867034.1
ATGGCAGATGTCTATGGGTGGTTTGAAGGGATAGCATTCCCTCTAGCGTATTTCAACCTGGAAGTCTTAAGAGAAGCACGGGACACATTTGTGGTGAAGGATGAAGATATAATAATGGTGACTTATCCCAAATCAGGAACCCACTGGTTGATTGAGATTATCTGCCTGATTCATTCCAAGGGGGATCCCAAGTGGATCCAATCAGTACCTACATGGCAACGTTCACCCTGGATTGAGACTACACATGGATATGAATTATTGAAGGATAAAGAGGGCCCACACATTTTCACATCTCACCTGCCCATTCAACTCTTCCCCAAGTCCTTTTTCAATTCCAAGGCCAAGGTGATTTATGGCATTAGGAATCCCAGAGATGTTCTCGTGTCTGCTTATTTTTTCTTAAGAAAAATGAATATTACTAAAAAACCAGAGACACTGCAAGAACATATGGAATGGTTCCTCCAGGGAAGTGTGATATATGGATCATGGTTTGAGCATGTTCGTGGCTGGCTGTCCATGAGAGACAGGGAAAATGTCCTGGTGGTGAGTTATGAAGATCTGACAAAGGACCCAAGAAGCACTGTGGAGAAGATCTGTCAATTCTTGGGAAAGAAGTTAAAACCAGAAGAAATAGATTTAGTCCTCAAGTATAGCTCCTATCAATTCATGAAGGAAAACAAGATGTCCAATTTCAGCACAATTCCTGATGAATATTTAGATAAGGGTTTCTCATTTCAAAGAAAAGCCTCTACTGAAGCAGAAAAATGGCTGTATAATGACATGGAAGGAAAACATTGCTCACTTCATGGCAGTCAAAAAGCAGACACCAAATCAGAGGAAGGAGTGCTGGCAGGATATGGTCCCTGA

XM_004867022.1 Coding sequence

Emp3 epithelial membrane protein 3, transcript variant X4

Length: 492 bp    Location: 5440091..5432206   Strand: -
>XM_004867022.1
ATGTCGCTCCTCCTGCTGGTGGTCTCTGCCCTTCACATCCTCATCCTCATCCTGCTTTTCGTGGCCACTCTGGATAAGTCCTGGTGGACCCTCCCGGGGAAGGAGTCCCTGAACCTCTGGTACGACTGCACGTGGAACAACGACACCAAAACGTGGGCCTGCAGTAACGTCAGCGACAACGGTTGGCTGAAGGCTGTGCAGGTACTCATGGTGCTGTCCCTCATCCTGTGCTGCCTGTCCTTCATCTTGTTCATGTTCCAGCTGTACACCATGCGTCGAGGGGGGCTCTTCTACGCCACCGGCCTCTGCCAGCTCTGCACCAGCGTGGCTGTGTTCTCGGGGGCCCTGATCTATGCCATCCACGCCAAGGAGATCGTGGTGAAGCACCCGCGCGGGGGCAGCTTCGGGTACTGCTTTGCGCTGGCCTGGGTGGCCTTCCCCCTGGCGCTGGTCAGCGGCATCGTCTACATCCACCTGCGGAAGCGAGAGTGA

XM_004867028.1 Coding sequence

Lig1 ligase I, DNA, ATP-dependent, transcript variant X2

Length: 2754 bp    Location: 5665682..5708823   Strand: +
>XM_004867028.1
ATGCAGCGGAGTATCATGTCATTTTTCCACCCCATGAAAGAGGGTAAAGCAAAGAAGCCTGAGAAGGAGACAAACAACAGCAGCAGAGAGATGGAGCCCCCTCCAAAGGTGGCACTAAAGGAGTGGAACAGAGTGGTGCCTGAGAGCGAGTCTCCGGTGAAGAGGCCGAAGAGGAAGGTGGTCCCGGCCTTGAGCAGTGAAGGGGAGGAGGAAGATGAAGCTCTCAGCCCCACCAAAGACCAGAATCCTGGGCCAGGCTCCCCACAGGGGTCCCCTTCCAGTCCTGCCACAAGTCCCAAGAATAGCCCTTCCCTCTCGGACACCTCCCCCATGGATGTCTCCCCATCAGGAATCCCAAAGCGTCTCACAGCTCGGAAGCAGCTCCCAAAACGAGTAATTCAGGCTGACCTGGAAGATCAGAGTGAGGACAGGAACAGGGAAGCCAAGAGGAGGAGGAAGGAGGAGAAAGAAGCAGAGGTGCCAGGAGAAAGCCCCACAGAGACTGGGGTGGCAGAAGTGAAGGAAGAGGAGGAGAGGGGCCAGCCCTGGACACCGCCTGAGCTCCCAGCGCCCCCCACAGAGACCCCAACAGAGACAGAAAGTGTTTCCACACCCAAGGGGACTGGGAAGCAGGAGCCACAGGAAAAGGACCGGAACAAGGCTGCTCCCAGAGGACCCAGGACCCTCAGCAGTTTCTTCATGCCCCGGAAGCCGGCAGTCAGAACCCAAGTGAAGGAGCAGTCAGGTACTCCGGGAAAGGAGGAGGCCGAGGGATCCCTGGACCCAGTAAGCTACAATCCCGCCAAGAACAACTACCATCCCATTGAGGATGCCTGCTGGAGTCGGGGCCAGAAGGTCCCTTACCTGGCCGTGGCCCGGACGTTTGAGAAGATTGAGGAGGTTTCTGCTCGGCTCCGGATGGTGGAGACGCTGAGTAACCTGCTGCGCTCTGTGGTGGCCCTGTCCCCTCCAGACCTGCTCCCTGTCCTCTACCTCACCCTTAACCGCCTTGGGCCTCCCCAGCAGGGCCTGGAGCTTGGCGTTGGCGATGGTGTCCTTCTCAAGGCCGTAGCCCAGGCCACAGGCCGGCAGCTGGAATCTGTCCGGGCCGAGGCTGTTGAGAAGGGTGACGTGGGGCTGGTGGCCGAGAACAGCCGTAGCACCCAGAGACTCATGCTGCCGCCGCCTCCTCTTACCAGCGCTGGGGTCTTCTCCAAGTTCCGGGACATCGCCCAGCTCACCGGCAGCGCTGCCGTGACCAAGAAGATGGATATCATCAAAGGCCTCTTTGTCGCCTGCCGCCACTCAGAAGCCCGCTTCATCGCCAGGGCCCTGAGTGGACGGCTTCGCCTTGGGCTGGCCGAGCAGTCGGTGCTCGCTGCCCTCTCCCAGGCTGTGAGCCTCACACCCCCAGGCCAAGAATTCCCTCCAGCCGTGGTGGATGCTGGGAAGGGCAAGACTGCAGAGGCCAGAAAGACGTGGCTGGAGGAACAAGGCATGATCTTGAAGCAGACGTTTTGTGAGGTGCCTGACCTGGACCGAATCATCCCTGTGCTTCAGGAGCATGGCCTGGAGCATCTCCCGGAGCACTGCAGGCTGAGCCCAGGCGTCCCTCTGAAGCCGATGTTGGCCCATCCCACTCGGGGTGTCAGTGAAGTCCTGAAACGCTTTGAGGAGGCAGCCTTCACCTGCGAGTACAAATACGATGGGCAGAGGGCACAGATCCATGTTGTGGAAGGCGGGGAAGTGAAGATCTTCAGCAGGAATCAGGAAGACAACACGGGAAAGTACCCCGACATCATCAGCCGCATCCCCAAGATTAAACTCCCCTCAGTCACATCCTTTATCCTGGACACCGAAGCAGTGGCTTGGGACCGGGAGAAGAAGCAGATCCAGCCGTTCCAAGTGCTTACCACTCGCAAGCGGAAGGAGGTAGACGCGGCAGAGATCCAGGTGCAGGTGTGTCTGTATGCTTTCGACCTCATCTTCCTCAACGGAGAGTCCCTGGTCCGTCAGCCCCTGTCACAACGCCGGCAGCTGCTCCGGGAGAACTTTGTAGAGACGGAGGGCGAGTTTGTCTTCGCTACCTCCCTGGACACCAAGGACATGGAGCAGATAGCTGAGTTCTTGGAGCAATCGGTGAAAGACTCCTGCGAGGGGCTGATGGTGAAGACCTTGGATGTGAATGCCACCTACGAGATCGCCAAGAGGTCGCACAACTGGCTCAAGCTGAAGAAGGACTACCTCGATGGTGTGGGTGACACCCTGGACCTCGTGGTGATCGGTGCCTACCTGGGCCGGGGAAAGCGGGCCGGCCGCTATGGAGGCTTTCTGCTGGCTGTCTATGATAAGGAGAGCGAGGAGCTGCAGGCCATATGCAAGCTTGGAACGGGCTTCAGCGATGAGCAGCTGGAAGAGCATTACCAGAGCCTCCAGGCCCTGGTGCTGCCCACCCCACGCCCCTACGTGCGGGCTGACGGTGCTGTGGCGCCCGACCACTGGCTGGACCCCAGCGCCGTGTGGGAGGTGAAGTGCGCTGATCTCTCGCTCTCCCCCGTCTACCCTGCTGCCCGGGGCCTGGTGGACAGTGAGAAGGGCATCTCCCTTCGCTTCCCTCGGTTTATTCGCGTCCGTGAAGATAAGAAGCCAGAGGAGGCCACTACCAGTGCCCAGGTGGCCTGTCTGTATCGCAAGCAAAGTCAAATTCAGAACCAAGGTATTGACTCAGACTCTGATAATGAAGATTTCTACTAA

XM_004866991.1 Coding sequence

Sphk2 sphingosine kinase 2, transcript variant X2

Length: 1959 bp    Location: 5254283..5246328   Strand: -
>XM_004866991.1
ATGAACCAACACCTTGAATCAGAGGAGCAGTGGAACCAGAGACCGGAGCAGCAGGTCACCAGGAGTTGGGGCCACAGGCCTAGGAGAGCCCTGGATAGGGCTGAGGCCATGGCCCCCCCACCAGCAACACTGGCTGCCAGCACCCCGCTCCTGCATGGCGAATTTGGCTCCTACCCAGCCCGAGGCTCACGATTTGCCCTCACCCTCACATCACAGGCCCTGCACATACAGCGGCTGCTCCCAAAGCCCGAAGCCCGGCCCCGGGATGGCCTGGTCCCCCTGTCTGTGATCTCAGGCTGCTGCACCCTGCGAAGCCACAGCCCCTCAGACTCGGCAGCCTACTTATGCATCTATACCTACCTGTGGGGCCGTCGAGGCCGCCGCAGAGCCGCCCGCACCTTTCAGGCCGATGGGGCTGCAACCTATGAGGAGAACCGTGCGGAGGCCCAGCGCTGGGTCACTGCCCTCATGAGTCTGCTCCGAGGATTGCCCCTGCCTGGGGAAGGGGAGATCAGCCCTGAGCTCCTGCCACGGCCACCCCGGTTGCTACTCTTGGTCAATCCCTTTGGGGGACGGGGCCAGGCCTGGCAGTGGTGTGAAAACCATGTGCTGCCCATGATTTCCGAAGCTGGGCTGTCCTTCAACCTCATTCAGACAGAGAGACATAACCATGCCCGAGAGCTGGTCCAGGGGCTGAGCCTGAGTGAGTGGGATGGCATCGTCACCCTCTCAGGAGACGGGCTGTTCTGTGAGGTGCTGAACGGACTCCTGGATCGCCCAGACTGGGAGCAGGCAGTGAAGATGCCCCTGGGGATTCTCCCCTGTGGCTCGGGCAACGCACTGGCTGGAGCCGTGAACAGGCATGGGGGGTTTGCACCAGCGCTGGGCCTGGACCTGCTGCTCAACTGCTCCCTGCTGCTCTGCCGTGGTGGCAGCCATCCACTGGACCTGCTCTCTGTGACGCTGGCCTCAGGCTCCCGCTGTTTCTCCTTCCTGTCTGTGGCCTGGGGCTTTGTGTCAGATGTGGACATCCAGAGTGAGCGCTTCAGAGCCCTAGGCAGAGCCCGATTCACCCTGGGCACAGTGCTGGGCCTTGCCACATTGCGCACCTACCATGGACGCCTCTCCTACCTCCCTGCTGCTGTGGAGTCAGCCTCACCTGGTCCTGCCAACGGCCTGCCCCGGGCCAAGTCAGAGCTGGCCCTGGCCCCAGCTCCAGCCCCGCCCACAGACCACTCCCCTTTGCATCGCTCAGTGTCTGACCTGCCCCTGCCCTTGCCTCAGCCTGCCTTGACCTCCCCTGGCTCACCTGATCCCTTACCTGTGCTGTCCTTCAACGGTGGGGCCCCAGAGCTGGCTGGGGACTGGGGTGGCACTGGGGAAGCTCCACTGTCCCCAGACCCACTCCTGCCCTCGCCCTCTGGCTCCCCCAAGGCAGCTCCACTCTCTCCCATCACAGAAGGGCCCCCAGAAATGCCTGCAGCCTCTGGGTTTCCACCCCACACCACCGCTGCACCAGTAGCCTCTGCCGGGGGCCCACAGGACCACTTGTTACCTCCATTGGGCACCCCGCTGCCCCCAGGCTGGGTGACAGTGGAGGGAGACTTTGTGCTGGTGTTGGCGCTCTCTCCCAGCCACCTGGGTGCCGATCTGCTGGCGGTTCCCCACGCAAGCTTTGACGACGGCGTGGTACACCTGCTGTGGGTGAGGGCAGGAATCTCGAGGGCCATGCTGCTGCGCCTATTCCTGGCCATGGAGCGGGGGAGCCATTTCAATTTGGGCTGCCCGCATGTCGGCTATGCCCCGGCCCGTGCGTTCCGCCTGGAGCCACTCACGCCCCGAGGCATGCTCACAGTGGACGGGGAGCTGGTGGAGTATGGGCCGCTGCAAGGGCAGATACACCCAGGCCTCGGTACGCTGCTCACAGGGCCTCCTGGCCACACCGGGCAGGGACCCTGA

XM_004866999.1 Coding sequence

Spaca4 sperm acrosome associated 4

High confidence: 4 potential gene matches
Length: 384 bp    Location: 5264047..5263396   Strand: -
>XM_004866999.1
ATGGTCTTCGGCTGGCTGCAGCTGCTGCTGCTGGTGACGGTGCTGCCTCAGGGCACGACGGGCATCAAGGACTGTTTCTTCTGCGAGCTGACCGACTCCATGCGCTGCCCCGGCACCCCCATGCACTGCGGGGACGAGGAGGACTGCTTCACGGGCCGCGGGGTGGCCCAGGGTGTGGGGCCTGTCATCAACAAAGGCTGCGTGCGTGCCCCCAGCTGTGGCCGCGAGGAGCCTGTGAGCTACATGGGCCTCACCTACATCCTCACCACCACCTGCTGCTCCGGCCACCTGTGCAACCACGGCCCAAGCCCCACGGGCCACCCGACGGTGACAGCCACCGCCAGCCTGGTGCTGGGCCTGCTGCTGCTCCCACACCTGCTGTGA

XM_004866988.1 Coding sequence

Ca11 carbonic anhydrase XI, transcript variant X3

Length: 972 bp    Location: 5234336..5240038   Strand: +
>XM_004866988.1
ATGCGGGGAGCCCCTCGAGCGCTGGTCCTATGGGCCGCACTGGGGGCGGCAGCGCACATCGGACCCGCGCCTGACCCGGAGGACTGGTGGAGCTACAAGGATAATCTCCAGGGAAACTTCGTGCCAGGGCCTCCGTTCTGGGGCCTGGTGAACGCAGCCTGGAGTCTGTGTGCTGTGGGGAAGCGCCAGAGCCCTGTGGATGTGGAGCTGAAGAGGGTCCTTTACGACCCCTTCCTGCCCCCACTGAGGCTCAGCACAGGAGGAGAGAAGCTCCAGGGAACACTGTACAACACCGGCCGTCATGTTTCCTTCCTGCCTGCACCCCGGCCAGTGGTCAATGTGTCTGGGGGTCCCCTCCTTTACAGCCACCGACTCAGTGAACTGCGGCTGCTCTTTGGAGCTCGAGATGGAGCTGGCTCTGAACACCAGATCAACCATCAGGGCTTCTCTGCTGAGGTGCAGCTCATTCACTTCAACCAGGAACTCTATGGGAATCTCAGCGCAGCCTCCCGAGGGCCCAATGGCCTGGCCATTCTCAGCCTCTTTGTCAACGTGGCTGGTAGCTCAAACCCGTTCCTCAGTCGCCTCCTCAACCGAGACACCATTACCCGAATCTCCTACAAGAATGATGCCTACTTTCTTCAAGACCTGAGCCTGGAGCTCCTGTTCCCCGAATCCTTTGGCTTCATCACCTACCAGGGCTCTCTCAGCACCCCACCCTGCTCAGAGACTGTCACCTGGATCCTCATTGACCGGCCTCTTAACATCACCTCTCTCCAGATGCACTCCCTGAGACTCCTGAGCCAGAATCCTCCGTCCCAGATCTTCCAGAGCCTCAGCGGGAACGCCCGGCCCCTGCAGCCTTTGGCCCACAGGGCCTTGAGGGGCAACAGGGACCCCCGGCACCCCGAGAGGCGCTGCCGAGGCCCAAACTACCGCCTGCATGTGGATGGTGCCCCCCAGGGTCGCTGA

XM_004866986.1 Coding sequence

Ca11 carbonic anhydrase XI, transcript variant X1

Length: 1179 bp    Location: 5234336..5239517   Strand: +
>XM_004866986.1
ATGCGGGGAGCCCCTCGAGCGCTGGTCCTATGGGCCGCACTGGGGGCGGCAGCGCACATCGGACCCGCGCCTGACCCGGAGGACTGGTGGAGCTACAAGGATAATCTCCAGGGAAACTTCGTGCCAGGGCCTCCGTTCTGGGGCCTGGTGAACGCAGCCTGGAGTCTGTGTGCTGTGGGGAAGCGCCAGAGCCCTGTGGATGTGGAGCTGAAGAGGGTCCTTTACGACCCCTTCCTGCCCCCACTGAGGCTCAGCACAGGAGGAGAGAAGCTCCAGGGAACACTGTACAACACCGGCCGTCATGTTTCCTTCCTGCCTGCACCCCGGCCAGTGGTCAATGTGTCTGGGGGTCCCCTCCTTTACAGCCACCGACTCAGTGAACTGCGGCTGCTCTTTGGAGCTCGAGATGGAGCTGGCTCTGAACACCAGATCAACCATCAGGGCTTCTCTGCTGAGGTGCAGCTCATTCACTTCAACCAGGAACTCTATGGGAATCTCAGCGCAGCCTCCCGAGGGCCCAATGGCCTGGCCATTCTCAGCCTCTTTGTCAACGTGGCTGGTAGCTCAAACCCGTTCCTCAGTCGCCTCCTCAACCGAGACACCATTACCCGAATCTCCTACAAGAATGATGCCTACTTTCTTCAAGACCTGAGCCTGGAGCTCCTGTTCCCCGAATCCTTTGGCTTCATCACCTACCAGGGCTCTCTCAGCACCCCACCCTGCTCAGAGACTGTCACCTGGATCCTCATTGACCGGCCTCTTAACATCACCTCTCTCCAGATGCACTCCCTGAGACTCCTGAGCCAGAATCCTCCGTCCCAGATCTTCCAGAGCCTCAGCGGGAACGCCCGGCCCCTGCAGCCTTTGGCCCACAGGGCCTTGAGGGGCAACAGGGACCCCCGGCACCCCGAGAGGCGCTGCCGAGGCCCAAACTACCGCCTGCATGGTATGGCCCAGGCTGCCGCCCCTCCACGTCCTGGTCCAATCTGCTTCTATGTCTCCCCTTGGCGTCTCAAAAGGATCCAGTGCCCCCTTCTGTGTGGCCTAGCCCCAGCGCTGACTTCTCAGTCCCTTCCCCCTCCGTGTCAAAGTGGTACAGTCCACACCTCCCCCCCCCCCCCCCCAAGATCATTTCCTTTTTACTGCTTTGGACCTTGGTATATAACCGGAGCCTCCTAG

XM_004866990.1 Coding sequence

Sphk2 sphingosine kinase 2, transcript variant X1

Length: 1959 bp    Location: 5254283..5246328   Strand: -
>XM_004866990.1
ATGAACCAACACCTTGAATCAGAGGAGCAGTGGAACCAGAGACCGGAGCAGCAGGTCACCAGGAGTTGGGGCCACAGGCCTAGGAGAGCCCTGGATAGGGCTGAGGCCATGGCCCCCCCACCAGCAACACTGGCTGCCAGCACCCCGCTCCTGCATGGCGAATTTGGCTCCTACCCAGCCCGAGGCTCACGATTTGCCCTCACCCTCACATCACAGGCCCTGCACATACAGCGGCTGCTCCCAAAGCCCGAAGCCCGGCCCCGGGATGGCCTGGTCCCCCTGTCTGTGATCTCAGGCTGCTGCACCCTGCGAAGCCACAGCCCCTCAGACTCGGCAGCCTACTTATGCATCTATACCTACCTGTGGGGCCGTCGAGGCCGCCGCAGAGCCGCCCGCACCTTTCAGGCCGATGGGGCTGCAACCTATGAGGAGAACCGTGCGGAGGCCCAGCGCTGGGTCACTGCCCTCATGAGTCTGCTCCGAGGATTGCCCCTGCCTGGGGAAGGGGAGATCAGCCCTGAGCTCCTGCCACGGCCACCCCGGTTGCTACTCTTGGTCAATCCCTTTGGGGGACGGGGCCAGGCCTGGCAGTGGTGTGAAAACCATGTGCTGCCCATGATTTCCGAAGCTGGGCTGTCCTTCAACCTCATTCAGACAGAGAGACATAACCATGCCCGAGAGCTGGTCCAGGGGCTGAGCCTGAGTGAGTGGGATGGCATCGTCACCCTCTCAGGAGACGGGCTGTTCTGTGAGGTGCTGAACGGACTCCTGGATCGCCCAGACTGGGAGCAGGCAGTGAAGATGCCCCTGGGGATTCTCCCCTGTGGCTCGGGCAACGCACTGGCTGGAGCCGTGAACAGGCATGGGGGGTTTGCACCAGCGCTGGGCCTGGACCTGCTGCTCAACTGCTCCCTGCTGCTCTGCCGTGGTGGCAGCCATCCACTGGACCTGCTCTCTGTGACGCTGGCCTCAGGCTCCCGCTGTTTCTCCTTCCTGTCTGTGGCCTGGGGCTTTGTGTCAGATGTGGACATCCAGAGTGAGCGCTTCAGAGCCCTAGGCAGAGCCCGATTCACCCTGGGCACAGTGCTGGGCCTTGCCACATTGCGCACCTACCATGGACGCCTCTCCTACCTCCCTGCTGCTGTGGAGTCAGCCTCACCTGGTCCTGCCAACGGCCTGCCCCGGGCCAAGTCAGAGCTGGCCCTGGCCCCAGCTCCAGCCCCGCCCACAGACCACTCCCCTTTGCATCGCTCAGTGTCTGACCTGCCCCTGCCCTTGCCTCAGCCTGCCTTGACCTCCCCTGGCTCACCTGATCCCTTACCTGTGCTGTCCTTCAACGGTGGGGCCCCAGAGCTGGCTGGGGACTGGGGTGGCACTGGGGAAGCTCCACTGTCCCCAGACCCACTCCTGCCCTCGCCCTCTGGCTCCCCCAAGGCAGCTCCACTCTCTCCCATCACAGAAGGGCCCCCAGAAATGCCTGCAGCCTCTGGGTTTCCACCCCACACCACCGCTGCACCAGTAGCCTCTGCCGGGGGCCCACAGGACCACTTGTTACCTCCATTGGGCACCCCGCTGCCCCCAGGCTGGGTGACAGTGGAGGGAGACTTTGTGCTGGTGTTGGCGCTCTCTCCCAGCCACCTGGGTGCCGATCTGCTGGCGGTTCCCCACGCAAGCTTTGACGACGGCGTGGTACACCTGCTGTGGGTGAGGGCAGGAATCTCGAGGGCCATGCTGCTGCGCCTATTCCTGGCCATGGAGCGGGGGAGCCATTTCAATTTGGGCTGCCCGCATGTCGGCTATGCCCCGGCCCGTGCGTTCCGCCTGGAGCCACTCACGCCCCGAGGCATGCTCACAGTGGACGGGGAGCTGGTGGAGTATGGGCCGCTGCAAGGGCAGATACACCCAGGCCTCGGTACGCTGCTCACAGGGCCTCCTGGCCACACCGGGCAGGGACCCTGA

XM_004866987.1 Coding sequence

Ca11 carbonic anhydrase XI, transcript variant X2

Length: 1068 bp    Location: 5234336..5239517   Strand: +
>XM_004866987.1
ATGCGCATTTCAAGTAGGCCTCCGTTCTGGGGCCTGGTGAACGCAGCCTGGAGTCTGTGTGCTGTGGGGAAGCGCCAGAGCCCTGTGGATGTGGAGCTGAAGAGGGTCCTTTACGACCCCTTCCTGCCCCCACTGAGGCTCAGCACAGGAGGAGAGAAGCTCCAGGGAACACTGTACAACACCGGCCGTCATGTTTCCTTCCTGCCTGCACCCCGGCCAGTGGTCAATGTGTCTGGGGGTCCCCTCCTTTACAGCCACCGACTCAGTGAACTGCGGCTGCTCTTTGGAGCTCGAGATGGAGCTGGCTCTGAACACCAGATCAACCATCAGGGCTTCTCTGCTGAGGTGCAGCTCATTCACTTCAACCAGGAACTCTATGGGAATCTCAGCGCAGCCTCCCGAGGGCCCAATGGCCTGGCCATTCTCAGCCTCTTTGTCAACGTGGCTGGTAGCTCAAACCCGTTCCTCAGTCGCCTCCTCAACCGAGACACCATTACCCGAATCTCCTACAAGAATGATGCCTACTTTCTTCAAGACCTGAGCCTGGAGCTCCTGTTCCCCGAATCCTTTGGCTTCATCACCTACCAGGGCTCTCTCAGCACCCCACCCTGCTCAGAGACTGTCACCTGGATCCTCATTGACCGGCCTCTTAACATCACCTCTCTCCAGATGCACTCCCTGAGACTCCTGAGCCAGAATCCTCCGTCCCAGATCTTCCAGAGCCTCAGCGGGAACGCCCGGCCCCTGCAGCCTTTGGCCCACAGGGCCTTGAGGGGCAACAGGGACCCCCGGCACCCCGAGAGGCGCTGCCGAGGCCCAAACTACCGCCTGCATGGTATGGCCCAGGCTGCCGCCCCTCCACGTCCTGGTCCAATCTGCTTCTATGTCTCCCCTTGGCGTCTCAAAAGGATCCAGTGCCCCCTTCTGTGTGGCCTAGCCCCAGCGCTGACTTCTCAGTCCCTTCCCCCTCCGTGTCAAAGTGGTACAGTCCACACCTCCCCCCCCCCCCCCCCAAGATCATTTCCTTTTTACTGCTTTGGACCTTGGTATATAACCGGAGCCTCCTAG

XM_004866968.1 Coding sequence

Gys1 glycogen synthase 1 (muscle), transcript variant X3

Length: 2016 bp    Location: 5029057..5045191   Strand: +
>XM_004866968.1
ATGCCTTTGAGCCGCACGTTGTCTGTGTCCTCACTGCCAGGCCTGGAAGAGTGGGAGGATGAGTTCGACCTGGAGAACACAGTGCTCTTCGAAGTGGCCTGGGAGGTGGCCAACAAGGTGGGGGGCATCTACACGGTGCTGCAGACCAAGGCGAAGGTGACAGGGGACGAGTGGGGCGACAACTACTACCTGGTGGGACCGTACACGGAGCAGGGCGTGAGGACCCAGGTGGAGCTGCTTGAGCCCCCGACCCCGGCCTTTAAGAAGACGCTGGACTCCATGAACAGCAAGGGCTGCAAGTTCCTGGCCCAGAGTGAGGAGAAGCCACATGTGGTTGCCCACTTCCATGAGTGGTTGGCAGGCGTTGGGCTCTGCCTGTGCCGTGCCCGGCGGCTGCCTGTGGCAACCATCTTCACCACCCATGCCACGCTGCTGGGGCGTTACCTGTGCGCTGGTGCTGTAGACTTCTACAACAACCTGGAGAATTTCAATGTAGACAAGGAAGCAGGGGAGAGACAAATCTATCACCGCTACTGCATGGAGCGGGCAGCAGCCCACTGTGCTCATGTCTTCACCACCGTGTCCCAGATAACTGCCATTGAGGCGCAGCACCTACTCAAGAGGAAGCCAGATATTGTGACCCCCAACGGACTGAATGTGAAGAAGTTCTCTGCCATGCATGAGTTCCAGAACCTCCATGCTCAGAGCAAAGCGCGGATCCAGGAATTTGTCCGGGGCCATTTTTATGGGCACCTGGACTTCAACTTGGACAAGACTTTGTATTTCTTTATTGCTGGCCGCTACGAGTTCTCTAACAAGGGGGCGGACGTCTTCCTGGAAGCCTTGGCCCGGCTCAACTACCTGCTCAGAGTGAATGGCAGTGAACAGACGGTGGTCGCCTTCTTCATCATGCCGGCTCGGACCAACAACTTCAACGTGGAAACCCTCAAGGGCCAGGCTGTGCGCAAGCAGCTGTGGGACACGGCCAACGCGGTGAAGGAGAAGTTTGGGAGGAAGCTGTATGAATCCTTACTGGTGGGGAGTCTCCCAGACATGAATAAGATGCTGGACAAAGAGGACTTCACTATGATGAAGAGGGCCATCTTTGCCACACAGCGGCAGTCCTTCCCTCCTGTGTGCACCCACAATATGCTGGACGACTCCTCAGACCCCATCCTGACCACCATCCGCCGGATTGGCCTCTTCAATAGCAGCGCGGACAGGGTTAAGGTGATTTTTCACCCAGAGTTCCTCTCCTCTACAAGCCCCCTGCTCCCTGTGGACTATGAGGAGTTTGTGCGTGGCTGTCACCTTGGGGTCTTCCCCTCCTACTATGAGCCTTGGGGCTACACACCAGCCGAGTGTACGGTCATGGGCATCCCCAGTATCTCCACCAACCTCTCCGGCTTTGGCTGCTTCATGGAGGAGCACATCGCAGACCCCTCAGCTTACGGTATCTACATTCTGGACCGGCGGTTCCGCAGCCTGGACGATTCCTGCTCACAGCTCACCTCCTTCCTCTACAGCTTCTGCCAGCAGAGCCGCAGACAGCGCATCATCCAGCGGAACCGCACAGAGCGTCTCTCCGACCTTCTGGACTGGAAATACCTAGGCCGGTACTATATGTCTGCACGCCACATGGCCCTGGCCAAGGCCTTTCCGGATCATTTCACCTACGAGCCCCACGAAGCGGATGCAGCCCAGGGCTACCGCTACCCACGGCCGGCCTCAGTGCCGCCGTCACCCTCGTTGTCACGACACTCGAGTCCGCACCAGAGCGAGGATGAGGAGGAACCCCGGGAAGGGCCACTTGAAGATGGCGAACGATACGACGAGGACGAGGAAGCTGCCAAGGATCGGCGCAACATCCGCGCCCCCGAGTGGCCACGCCGCTCCTCCTGCACCTCTTCCACAGGCAAGCGCAGCAACTCGGTGGACACTGCGCCCTCCAGCTCGCTGAGCACGCCCAGTGAGCCCCTCAGCCCCGCCAGCTCTCTGGGGGAGGAGCGCAACTAA

XM_004866979.1 Coding sequence

Hsd17b14 hydroxysteroid (17-beta) dehydrogenase 14, transcript variant X1

Length: 825 bp    Location: 5125781..5134516   Strand: +
>XM_004866979.1
ATGGCATCGGGAACTCGCTATGCAGGGAAGGTGGTGATCGTGACAGGGGGCGGGCGCGGCATCGGAGCGGGAATCGTCCGAGCCTTTGCTGACAGTGGGGCACATGTGGTCATCTGTGACAAGGATGAGTCCAGCGCCCGAGTCCTGGAGCAGCAGCTCCCCGGCGCCATCTTTATCCGCTCTGATGTGACTCAAGAGGAGGATCTTCGGACCCTGATTGCTGAGACCATCCGCCGATTTGGTCACCTGGATTGTGTGGTTAACAATGCCGGCTACCATCCACCTGCAGAGAGGCTAGAGGACACCTCTGCCCAGGACTTTCGGCAGCTGCTGGAGCTGAACCTGCTGAGCATCTACACCCTGACCAAGCTCGCCCTCCCCCACCTGCGGAAGGTCCAGGGCAACATCATCAACATCTCCAGCTTGACTGGGGCCATTGGCCAGTCCCAGGCAGTGCTCTACTCTGCCACCAAGGGGGCAGTCACAGCCATGACCAAAGCCTTGGCCTTGGACGAGTGCAAATATGGCGTCCGAGTCAACTGTATCGCCCCAGGGAACATCTGGACCCCGCTGTGGGAGATGGTGGCAGCCTCCTCGCCAGACCCCGAGGCCGAGATCCGGGAGGGGGTGCTGGCTCAGCCGATGGGCCGCATGGGCAAGCCCGCTGAGGTGGGCGCCGCAGCTGTGTTCCTGGCCTCCGAAGCCACCTTCTGCACAGGCACGGAGTTCCGCATGACGGGAGGCGCAGAGCTGGGCTACGGGTGTAAAGCCAGTCGGGACACCCCTCTGGAGATCCCCACGCTCCCTCCTGATTTCCCTCACTAG

XM_004866969.1 Coding sequence

Dhdh dihydrodiol dehydrogenase (dimeric)

High confidence: 4 potential gene matches
Length: 618 bp    Location: 5069997..5055330   Strand: -
>XM_004866969.1
ATGCTGGGGCGGGGCATCAAGGCCAGACTTGGTTCCTTAAACTTTGACTTGAGTCTAAGTGCTGGCGAAGGAGCACTCGATCCCAAAATACCGGGGCTTGGAGTTGTGCAGATGGCGCTCCGCTGGGGCATCGTGTCCGTCGGCCTCATCTCCAGCGACTTCACCACTGTGCCGGGCCCGCTGCCCCGCTCCGACCACCAGTCTGATCCCGGCGTCCTCCGGGTGGTGGCGGTAGCGGCCCGCGAGCTGAGCCGGGCGCAGGGGTTTGCGCGGAAACACGGCGTCCCCAAGGCGTACGGCTCCCCTGAGGAGCTGGCCAAGGGCCCGAATGTGGAAGTGGCCTATATTGGCACTCAGCACCCTCAGCACAAGGCTTCGGTGCTGATGTCTCTGGCAGTAGGCAAGGCTGTCCTGTGTGAGAAGCCCATGGGTATGAACGCTCCAGAAGTTCGCAAGATGGTCTCAGAGGCCCAAACCCAAGGTCTCTTCCTTATGGAGGCACTCACAGGCTTCAGCCATCGGAAACCTCTTGCCCAGATGCACACTGCTTTGGTTTCTGAGCCTTTGCACTTGCTGTTCTTCTGCGTGGGGGAGACTCAAACTCTGCCGAAAATTTAA

XM_004866971.1 Coding sequence

Bax BCL2-associated X protein, transcript variant X2

Length: 522 bp    Location: 5069526..5050222   Strand: -
>XM_004866971.1
ATGAAGACAGGGGCCCTTTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCACATGGGCGGGGATACCCTGGAGCTGGCCATGGAGCAGGTGCCCCAGGACCCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGGATTGGGGACGAACTGGACAGCAACATGGAGCTGCAGAGGATGATTGCGGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTGCTGATGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTATTTTGCCAGCAAACTGGTGCTCAAGGCGCTGTGTACCAAGGTGCCGGAGCTGATCAGGACCATCATGGGCTGGACACTGGACTTCCTCCGCGAGCGGCTGCTGGGCTGGATCCAGGACCAGGGGGGTTGGGATGGCCTCCTCTCCTACTTCGGAACCCCGACCTGGCAGACGGTGACCATCTTCGTGGCTGGCGTGCTCACTGCCTCACTCACCATCTGGAAGAACTTGGGCTGA

XM_004866970.1 Coding sequence

Bax BCL2-associated X protein, transcript variant X1

High confidence: 4 potential gene matches
Length: 579 bp    Location: 5055051..5050222   Strand: -
>XM_004866970.1
ATGGACGGGTCCGGGGAGCACCCCAGAGGAGGCGGGCCCACCAGCTCTGAGCACATCATGAAGACAGGGGCCCTTTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCACATGGGCGGGGATACCCTGGAGCTGGCCATGGAGCAGGTGCCCCAGGACCCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGGATTGGGGACGAACTGGACAGCAACATGGAGCTGCAGAGGATGATTGCGGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTGCTGATGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTATTTTGCCAGCAAACTGGTGCTCAAGGCGCTGTGTACCAAGGTGCCGGAGCTGATCAGGACCATCATGGGCTGGACACTGGACTTCCTCCGCGAGCGGCTGCTGGGCTGGATCCAGGACCAGGGGGGTTGGGATGGCCTCCTCTCCTACTTCGGAACCCCGACCTGGCAGACGGTGACCATCTTCGTGGCTGGCGTGCTCACTGCCTCACTCACCATCTGGAAGAACTTGGGCTGA

XM_004866944.1 Coding sequence

Cd37 CD37 molecule, transcript variant X2

Length: 939 bp    Location: 4841702..4837871   Strand: -
>XM_004866944.1
ATGTCGGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTGTTCAACCTCTTCTTCTTCGCCCTTGGCAGCCTGATTTTCTGCTTCGGCATCTGGATTCTCATCGACAAGACCAGCTTCGTGTCCTTTGTGGGCTTGTCCTTCGTGCCCCTGCAGACCTGGTCCAAGATCCTGGCAATCTCAGGGGTTCTCACCATGGGCCTCGCTCTCCTGGGTTGTGTGGGAGCCCTCAAGGAACTCCGAAGCCTTCTGGGTATGGTGAGTGCCCCACCCCTATCCCTAGAGCCACTCCCCAGCCTCAAGAGTCCCCTGGGGAGGGGTCAGCCTGACCTCTCCCCTCTGCTCCAGTATTTCGGGATGCTGCTGCTCCTGTTTGCCACGGAGATCACCCTGGGCATCCTCATCTCCACCCAGCGGGTCCGGCTGGAGCGAAGGGTGAAGGAGCTCGTGCTGAGCACCATCCAAAACTACGGCTCCAACCCGGAGGAGACAGCGGCCGAGGAGAGCTGGGACTACGCCCAGTTCCAGCTGCGCTGCTGCGGCTGGCACTCTCCGCAGGACTGGTTCCAGGTCCTCATCCTGAGAGGCAACGCGTCAGAGGCGGACCGCGTGCCCTGCTCCTGCTACAACTCGTCGGCGACCAACGACTCCGCAATCTTTGATAAGATCTACTCACCGCAGCCCGGCCGGCTCGGACCTCGGGCGAGGCCCAGGCACAGCACAGACCTGTGCTCCGTGCCCGCAAATGGCCACATCTACAGCGAGGGCTGCGCGAAAAGCCTCCGGACGTGGCTGCACAACAATCTCATCTCCATAGTGGGCATTTGTCTGGGCGTCGGTCTACTCGAGGTGATTTGGCCCCGCTCCCACTCGCGATTGGTCCCAGTCAGCAGATGGTCCCGCCCTCAAGCCCGGAGGACGCATGCGTAA

XM_004866963.1 Coding sequence

Ruvbl2 RuvB-like 2 (E. coli), transcript variant X2

Length: 1542 bp    Location: 5027998..5014484   Strand: -
>XM_004866963.1
ATGGGGCTGATCGCCGAACCGTTGGTGACAGCTGAGTGTGGCAGCAGGGACTGGGGTTCGGTCTGTTGCCTGCCTGTGCAGGAAAGGAGTTTCTCCTGGCAGATGGGAAGGGGGGACAGGATACCACAAGGGTCCTTCTTATGCATCTTCCTGCACCCCCAGACCGCCACAACCAAAGTCCCAGAGATCCGAGATGTGACGAGGATCGAGCGTATCGGTGCGCACTCCCACATACGGGGACTGGGGCTGGATGATGCCTTGGAGCCGCGCCAGGCTTCACAGGGAATGGTGGGTCAGCTGGCAGCCCGGCGAGCAGCTGGTGTGGTGCTGGAGATGATCCGAGAGGGGAAGATTGCTGGGCGGGCAGTCCTCATTGCAGGCCAGCCGGGCACTGGAAAGACGGCCATTGCCATGGGCATGGCACAGGCCCTGGGCCCCGACACCCCATTCACGGCCATTGCTGGCAGCGAGATCTTCTCCCTGGAGATGAGCAAGACTGAGGCGCTGACACAGGCCTTCCGCCGCTCCATTGGCGTTCGCATCAAGGAGGAGACCGAGATCATCGAAGGGGAGGTGGTGGAGATCCAGATTGATCGGCCGGCGACGGGGACGGGCTCCAAAGTGGGCAAGCTGACCCTCAAGACCACAGAGATGGAGACCATCTATGACCTGGGCACCAAGATGATCGAGTCGCTGACGAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCCACGGGCAAGATCTCCAAGCTGGGCCGCTCCTTCACGCGCGCCCGCGACTACGATGCCATGGGCTCCCAGACCAAGTTCGTGCAGTGCCCGGATGGAGAGCTGCAGAAGCGCAAGGAGGTGGTGCACACCGTGTCCCTGCACGAGATTGACGTCATCAACTCCCGCACCCAGGGCTTCCTGGCCCTCTTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGAGAGCAGATCAACGCCAAGGTTGCAGAGTGGCGCGAGGAGGGCAAGGCGGAGATTATCCCAGGGGTGCTTTTCATCGACGAGGTCCACATGCTGGACATTGAGAGCTTCTCTTTCCTCAACCGGGCCCTAGAGAGTGACATGGCACCCGTCCTCATCATGGCCACCAACCGGGGCATCACACGGATCCGGGGCACCAGCTACCAGAGCCCTCACGGCATCCCCATCGACCTGCTGGACCGGCTGCTCATTGTCTCCACCTCGCCGTACAGCGAGAAGGACACCAAGCAGATCCTCCGTATCCGGTGCGAGGAGGAGGATGTGGAGATGAGTGAGGACGCCTACACCGTGCTCACTCGCATCGGGCTGGAGACGTCCCTGCGCTACGCCATTCAGCTCATCACGGCAGCCAGCCTCGTGTGCCGGAAACGCAAGGGCACGGAGGTGCAGGTGGATGACATCAAACGGGTCTACTCGCTCTTCCTGGATGAATCCCGCTCCACGCAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAGCTCAAAGGTGAAACCATGGACACCTCATGA

XM_004866959.1 Coding sequence

Lin7b lin-7 homolog B (C. elegans), transcript variant X3

Length: 504 bp    Location: 4968516..4965968   Strand: -
>XM_004866959.1
ATGGCTGCGCTGGTCGAGCCGCTGGGGCTGGAGCGGGACGTGTCCCGGGCCGTGGAGCTCCTCGAGCGGCTCCAGCGCAGCGGAGAGCTGCCGCCCCAGAAGCTGCAGGCTCTCCAGCGGGTTCTGCAGAGCCGCTTCTGCTCCGCCATCCGCGAGGTGTATGAGCAGCTCTATGACACGTTGGACATCACAGGCAGCGCTGAGATCCGGGCTCATGCCACGGCCAAGGCCACAGTGGCTGCCTTCACAGCTAGTGAGGGTCACGCACATCCCAGGGTGGTGGAACTGCCCAAGACGGATGAGGGCCTGGGCTTCAACATCATGGGAGGCAAAGAGCAGAACTCACCCATCTACATCTCACGTGTCATCCCAGGAGGCGTGGCTGACCGTCACGGAGGCCTCAAGCGTGGGGACCAGCTGCTGTCTGTCAACGGTGTGCTGTGCATCGGCCTGCCCTGCAGAGCGTGGAGGGCGAGCAGCACGAGAAGGCGGTGGAGCTGCTGA

XM_004866946.1 Coding sequence

Cd37 CD37 molecule, transcript variant X4

Length: 855 bp    Location: 4841702..4838535   Strand: -
>XM_004866946.1
ATGTCGGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTGTTCAACCTCTTCTTCTTCGCCCTTGGCAGCCTGATTTTCTGCTTCGGCATCTGGATTCTCATCGACAAGACCAGCTTCGTGTCCTTTGTGGGCTTGTCCTTCGTGCCCCTGCAGACCTGGTCCAAGATCCTGGCAATCTCAGGGGTTCTCACCATGGGCCTCGCTCTCCTGGGTTGTGTGGGAGCCCTCAAGGAACTCCGAAGCCTTCTGGGTATGTATTTCGGGATGCTGCTGCTCCTGTTTGCCACGGAGATCACCCTGGGCATCCTCATCTCCACCCAGCGGGTCCGGCTGGAGCGAAGGGTGAAGGAGCTCGTGCTGAGCACCATCCAAAACTACGGCTCCAACCCGGAGGAGACAGCGGCCGAGGAGAGCTGGGACTACGCCCAGTTCCAGCTGCGCTGCTGCGGCTGGCACTCTCCGCAGGACTGGTTCCAGGTCCTCATCCTGAGAGGCAACGCGTCAGAGGCGGACCGCGTGCCCTGCTCCTGCTACAACTCGTCGGCGACCAACGACTCCGCAATCTTTGATAAGATCTACTCACCGCAGCCCGGCCGGCTCGGACCTCGGGCGAGGCCCAGGCACAGCACAGACCTGTGCTCCGTGCCCGCAAATGGCCACATCTACAGCGAGGTAGCTGAGGGTTTGGGGCCTGAGCTGCTCCAAGGGGAGGTGGCCTTTGCCAGGGGGCGTGGTCCGGTTGTGGGCGTGGTCCGGAGAGGCGTGGCTACAAGGGGATCTGTCCAACTAAGGGGAGAGAGCAACGCGAGGGGGCGGAGCCTTACAAAGGGACAGGGTGTGTAA

XM_004866962.1 Coding sequence

Ruvbl2 RuvB-like 2 (E. coli), transcript variant X1

Length: 1584 bp    Location: 5028007..5014484   Strand: -
>XM_004866962.1
ATGGGGCTGATCGCCGAACCGTTGGTGACAGCTGAGTGTGGCAGCAGGGACTGGGGTTCGGTCTGTTGCCTGCCTGTGCAGGAAAGGAGTTTCTCCTGGCAGATGGGAAGGGGGGACAGGATACCACAAGGGTCCTTCTTATGCATCTTCCTGCACCCCCAGACCGCCACAACCAAAGTCCCAGAGATCCGAGATGTGACGAGGATCGAGCGTATCGGTGCGCACTCCCACATACGGGGACTGGGGCTGGATGATGCCTTGGAGCCGCGCCAGGCTTCACAGGGAATGGTGGGTCAGCTGGCAGCCCGGCGAGCAGCTGGTGTGGTGCTGGAGATGATCCGAGAGGGGAAGATTGCTGGGCGGGCAGTCCTCATTGCAGGCCAGCCGGGCACTGGAAAGACGGCCATTGCCATGGGCATGGCACAGGCCCTGGGCCCCGACACCCCATTCACGGCCATTGCTGGCAGCGAGATCTTCTCCCTGGAGATGAGCAAGACTGAGGCGCTGACACAGGCCTTCCGCCGCTCCATTGGCGTTCGCATCAAGGAGGAGACCGAGATCATCGAAGGGGAGGTGGTGGAGATCCAGATTGATCGGCCGGCGACGGGGACGGGCTCCAAAGTGGGCAAGCTGACCCTCAAGACCACAGAGATGGAGACCATCTATGACCTGGGCACCAAGATGATCGAGTCGCTGACGAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCCACGGGCAAGATCTCCAAGCTGGGCCGCTCCTTCACGCGCGCCCGCGACTACGATGCCATGGGCTCCCAGACCAAGTTCGTGCAGTGCCCGGATGGAGAGCTGCAGAAGCGCAAGGAGGTGGTGCACACCGTGTCCCTGCACGAGATTGACGTCATCAACTCCCGCACCCAGGGCTTCCTGGCCCTCTTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGAGAGCAGATCAACGCCAAGGTTGCAGAGTGGCGCGAGGAGGGCAAGGCGGAGATTATCCCAGGGGTGCTTTTCATCGACGAGGTCCACATGCTGGACATTGAGAGCTTCTCTTTCCTCAACCGGGCCCTAGAGAGTGACATGGCACCCGTCCTCATCATGGCCACCAACCGGGGCATCACACGGATCCGGGGCACCAGCTACCAGAGCCCTCACGGCATCCCCATCGACCTGCTGGACCGGCTGCTCATTGTCTCCACCTCGCCGTACAGCGAGAAGGACACCAAGCAGATCCTCCGTATCCGGTGCGAGGAGGAGGATGTGGAGATGAGTGAGGACGCCTACACCGTGCTCACTCGCATCGGGCTGGAGACGTCCCTGCGCTACGCCATTCAGCTCATCACGGCAGCCAGCCTCGTGTGCCGGAAACGCAAGGGCACGGAGGTGCAGGTGGATGACATCAAACGGGTCTACTCGCTCTTCCTGGATGAATCCCGCTCCACGCAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAGCTCAGTGAGTGTCCCGCCCCTCCTCCTGCCATTGTCACCTTCCTGCCATTGTCACCCTCTGAGCTACCCTGA

XM_004866961.1 Coding sequence

LOC101710917 lutropin subunit beta-like

Length: 426 bp    Location: 5013517..5014429   Strand: +
>XM_004866961.1
ATGGAGATGCTCCAGGGGCTGCTGCTGGGACTGCTGCTGAGCGCGAGCGGGGCGTGGGCCTCCAGGGGCCTGCTGCGGCCCCTCTGCCGACCCATCAATGCCACCTTGGCCGCCGAGAACGAGGCCTGCCCGGTGTGTGTCACCTTCACCACCAGCATCTGTGCCGGCTACTGCCCCAGCATGATGCGGGTGCTGCCGGCCGCCCTGCCACCTGTGCCCCAGCCAGTGTGCACCTACCGCGAGCTGCGCTTCACCTCCATCCGGCTCCCCGGCTGCCCACCCGGTGTAGACCCTGTGGTCTCCTTCCCCGTGGCGCTCAGCTGCCACTGTGGGCCCTGTCGCCTCAGCAGCTCTGACTGCGGGGGCCCCAGGGCCCAGCCCTTGGCCTGTGACCTCCCCCACCTCCCAGGTGTCCTCTTCCTCTAA

XM_004866958.1 Coding sequence

Lin7b lin-7 homolog B (C. elegans), transcript variant X2

High confidence: 4 potential gene matches
Length: 624 bp    Location: 4968516..4965537   Strand: -
>XM_004866958.1
ATGGCTGCGCTGGTCGAGCCGCTGGGGCTGGAGCGGGACGTGTCCCGGGCCGTGGAGCTCCTCGAGCGGCTCCAGCGCAGCGGAGAGCTGCCGCCCCAGAAGCTGCAGGCTCTCCAGCGGGTTCTGCAGAGCCGCTTCTGCTCCGCCATCCGCGAGGTGTATGAGCAGCTCTATGACACGTTGGACATCACAGGCAGCGCTGAGATCCGGGCTCATGCCACGGCCAAGGCCACAGTGGCTGCCTTCACAGCTAGTGAGGGTCACGCACATCCCAGGGTGGTGGAACTGCCCAAGACGGATGAGGGCCTGGGCTTCAACATCATGGGAGGCAAAGAGCAGAACTCACCCATCTACATCTCACGTGTCATCCCAGGAGGCGTGGCTGACCGTCACGGAGGCCTCAAGCGTGGGGACCAGCTGCTGTCTGTCAACGGTGTGAGCGTGGAGGGCGAGCAGCACGAGAAGGCGGTGGAGCTGCTGAAGGCGGCCCAGGGCTCTGTGAAGCTGGTGGTTCGGTACACGCCCCGCGTGCTGGAGGAGATGGAGGCCCGCTTTGAGAAGATGCGCTCCGCCCGCCGGCGCCAGCAGCACCAGAGCTACTCGTCTTTGGAGTCTCGAGGCTGA

XM_004866957.1 Coding sequence

Lin7b lin-7 homolog B (C. elegans), transcript variant X1

Length: 651 bp    Location: 4968516..4965537   Strand: -
>XM_004866957.1
ATGGCTGCGCTGGTCGAGCCGCTGGGGCTGGAGCGGGACGTGTCCCGGGCCGTGGAGCTCCTCGAGCGGCTCCAGCGCAGCGGAGAGCTGCCGCCCCAGAAGCTGCAGGCTCTCCAGCGGGTTCTGCAGAGCCGCTTCTGCTCCGCCATCCGCGAGGTGTATGAGCAGCTCTATGACACGTTGGACATCACAGGCAGCGCTGAGATCCGGGCTCATGCCACGGCCAAGGCCACAGTGGCTGCCTTCACAGCTAGTGAGGGTCACGCACATCCCAGGGTGGTGGAACTGCCCAAGACGGATGAGGGCCTGGGCTTCAACATCATGGGAGGCAAAGAGCAGAACTCACCCATCTACATCTCACGTGTCATCCCAGGAGGCGTGGCTGACCGTCACGGAGGCCTCAAGCGTGGGGACCAGCTGCTGTCTGTCAACGGTGTGCCAGCTGTGCATCGGCCTGCCCTGCAGAGCGTGGAGGGCGAGCAGCACGAGAAGGCGGTGGAGCTGCTGAAGGCGGCCCAGGGCTCTGTGAAGCTGGTGGTTCGGTACACGCCCCGCGTGCTGGAGGAGATGGAGGCCCGCTTTGAGAAGATGCGCTCCGCCCGCCGGCGCCAGCAGCACCAGAGCTACTCGTCTTTGGAGTCTCGAGGCTGA

XM_004866837.1 Coding sequence

Myh14 myosin, heavy chain 14, non-muscle, transcript variant X4

Length: 6099 bp    Location: 4231067..4176625   Strand: -
>XM_004866837.1
ATGGCGGCCGTGACGCTGTCAGTGCCCGGGCGCAAGGTGCCCCCCAGGCCGGGCCCAGTGCCGGAGGCAGCGCAGCCCTTCTTGTTCGCCCCGTGCTCCCCGGGCTCGGGAGCGGGCAGTCCCCCGCAGGTGGAGTGGACGGCCCGGCGCCTGGTGTGGGTCCCTTCGGAGCTGCACGGGTTCGAGGCGGCCGCACTGCGCGACGAGGGCGATGAGGAGGCCGAGGTGGAGCTGGCGGAGAGCGGGCGGCGGCTGCGGCTGCCGCGGGACCAGATCCAGCGCATGAACCCGCCCAAGTTCAGCAAGGCCGAGGACATGGCCGAGCTCACCTGCCTGAACGAGGCCTCGGTGCTGCACAACCTGCGCGAGCGCTACTACTCCGGCCTCATCTACACCTACTCCGGCCTGTTCTGTGTGGTCATCAACCCCTACAAGCAGCTGCCCATCTACACAGAGGCCATTGTGGAGATGTACCGGGGTAAGAAGCGCCACGAGGTGCCGCCCCACGTGTATGCAGTGACGGAGGGGGCCTACAGGAGCATGCTTCAAGACCGAGAGGACCAGTCCATCCTCTGCACCGGGGAGTCTGGAGCCGGGAAGACAGAGAACACCAAGAAGGTCATCCAGTACCTGGCGCACGTGGCATCGTCGCCCAAGGGCAGGAAGGAGCCGGGAGTCCCTCAGGGTGCTCCCTCTCCGGTTCTCACCCAGGTCTTGTCCCGCGCCCGCCAGGGGGAGCTGGAGCGGCAGCTTCTCCAGGCCAACCCGGTCCTGGAGGCCTTCGGCAACGCCAAGACGGTGAAGAACGACAACTCCTCGCGCTTCGGCAAATTCATCCGCATCAACTTTGACGTCGCGGGGTACATCGTGGGCGCCAACATCGAGACCTACCTGCTGGAGAAGTCGCGCGCCATCCGCCAGGCCAAGGACGAGTGCAGCTTCCACATCTTCTACCAGCTGCTGGGGGGCGCGGGGGAGCAGCTCAAAGCCGACCTCCTCCTGGAGCCCTTCTCGCACTACCGCTTCCTGACCAGCGGGCCGCCATCCACCGCCAGCCAGGAGCGGGAGCCGTTCCAGGAGACCCTGGAGTCCCTGCGGGTGCTGGGCTTCACGCCCGAGGAGATCACCTCTATGCTGCGGATGGTGTCCGCCGTGCTGCAGTTCGGCAACGTCATCCTCAAGAGCGAGCGCAACACGGACCAGGCCACCATGCCGGACAACACAGCTGCACAGAAGCTATGCCGTCTTCTGGGGCTGGGGGTGACCGACTTCTCCAGAGCCCTGCTCACGCCCCGCATAAAGGTTGGCCGAGATTACGTCCAGAAAGCCCAGACCAAGGAGCAGGCCGACTTCGCGCTGGAGGCTCTGGCCAAGGCCACCTACGAGCGCCTCTTCCGCTGGCTGGTCCTGCGCCTCAACCGCGCCCTGGACCGCAGCCCGCGCCAGGGCGCCTCCTTCCTGGGCATCTTGGACATCGCCGGCTTCGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGTTGTTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATTCCCTGGACCTTCCTGGACTTCGGCCTCGACCTGCAGCCCTGCATCGACCTCATCGAGCGCCCGGCCAACCCGCCCGGGCTTCTGGCCCTGCTGGATGAGGAGTGCTGGTTCCCGAAGGCCACGGACAAATCGTTCGTGGAGAAGGTGGCCCAGGAGCAGGGCGGCCACCCCAAGTTCCAGCGCCCCAGGCAACTGCGGGACCAGGCTGACTTCAGCGTCCTGCACTATGCTGGAAAGGTCGACTACAAGGCCAATGAGTGGCTGATGAAGAACATGGACCCGCTGAATGACAACGTGGCAGCCTTGCTCCACCAGAGCACAGACCGGATGACTGCGGAGATCTGGAAAGACGAACATGGGGACCTCCCGCAGGCCTCTTTCCTGGGGTCCTTAGGCGGCCCCCTGCACGAAGTCCCTCCAATGGAGAGCATCGTGGGGCTGGAGCAGGTGAGCAGCCTCGGGGATGGCCCACCGGGTGGCCGCCCGCGCCGCGGGATGTTCCGGACGGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTGATGGCCACACTCAGCAACACCAACCCCAGCTTCATCCGCTGCATCATCCCCAACCACGAGAAGCGGGCTGGGAAGCTGGAGCCACGGCTGGTGCTGGAGCAGCTCCGCTGCAATGGCGTCCTCGAGGGCATCCGCATCTGCCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGGTACGAGATCCTGACGCCCAATGCCATCCCCAAGGGCTTCATGGACGGGAAGCAGGCCTGCGAGAAGATGATCCAGGCTCTGGAGCTGGACCCCAACCTGTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCGGGGGTCCTGGCCCAGCTGGAGGAGGAGCGGGACCTGAAGGTCACAGACATCATTGTGTCCTTCCAAGCAGCTGCCCGGGGATACCTGGCACGCAGGGCCTTCCAGAGGCGCCAGCAGCAGCAGAGCGCGCTGAGGGTGATGCAGAGGAACTGTGCGGCCTACCTCAAGCTCAGGCACTGGCAGTGGTGGCGGCTGTTCATCAAGGTGAAGCCGCTGCTGCAGGTGACGCGGCAGGACGAGGTGCTGCAGGCGCGCGCCCAGGAGCTGCAGAAGGTGCAGGAGCTGCAGCAACAGAGCGCGCGCCAAGTGGGGGAGCTGCAGGACCGCGTGGCGCAGCTGGAGGAGGAGCGCACCCGCTTGGCCGAGCAGTTGCGGGCGGAGGCCGAGCTTTGCGCGGAGGCGGAGGAGACTCGCGGACGTCTAGCGACCCGCAAGCAGGAGCTGGAGCTGGTGGTGACGGAGCTGGAGGCCCGCATGGGCGAGGAGGAGGAGTGCAGCCGCCAGCTGCAGGCCGAGAAGCGGAGGCTGCAGCTGCACATCCAGGAGCTGGAGACCCACTTGGAGGCCGAGGAGGGGGCGCGGCAGAAGCTACAGCTGGAGAAGGTGACGACTGAGGCGAGGCTGAAGAAGTTCGAGGAGGACTTGCTGCTCCTGGAGGACCAGAACGCCAAGCTGGGCAAGGAGCGCCGGCTGCTGGAGGAGCGCCTGGCCGAGTTCTCCTCGGCGGCGGCGGAGGAGGAGGAGAAGATCAAGAGCCTGAACAAGCTGCGGCTCAAATACGAGGCCACCATCGCGGACATGGAGGACCGCCTGCGGAAGGAGGAGAAGGGGCGCCAGGAGCTGGAGAAGCTGAAGCGGCGGCTGGACGGGGAGAGCTCCGAGCTGCAGGAGCAGATGGCGGGGCAGCAGCAGCGCGCCGAGGAGCTGCGGGCCCAGCTGGGCCGCAAGGAGGAGGAGCTGCAGGCGGCGCTGGCCAGGGCAGAGGAGGAGGGCGGGGCCCGGACCCAGCTGCTGAAGTCCCTTCGCGAGGCGCAGGCCGGCCTAGCCGAGGCCCAGGAGGACCTGGAGGCCGAGCGCGCGGCCAGGGCCAAGGCCGAGAAGCATCGCCGCGACCTGGGCGAGGAGCTGGAGGCGCTGCGCGGGGAGCTGGAGGACACGCTGGACTCCACGAACGCGCAGCAGGAGCTGCGGACCAAGAGAGAACAGGAGGTGACAGAACTGAAGAAGACGCTGGAAGAGGAGACCCGGATTCACGAGGTGGCCGTGCAGGAGCTGAGGCAACGGCACGGCCAGGCGCTGGGGGAGCTGGCGGAGCAGCTGGAGCAAGCGCGACGGGGCAAAGGCGCTTGGGAGAAGACGAGGCTGGCTCTGGAGGCAGAGGTGTCCGAGCTGCGGGCGGAGCTGAGCAGCCTGCAGTCTGCACGCCAGGAGGGAGAGCAGAGGCGTAGGCGTCTGGAGTCGCAGCTGCAGGAGGTGCAGGGCCGGGCTGGTGACGGAGAGCGCGCACGTGTGGAGGCTGCGGAGAAGCTGCAGCGAGCGCAGGCTGAGCTGGAGACCGTGTCTGGGGCGCTGAGTGAGGCCGAGTCCAGAGCCATCCGGCTGGGCAAGGAGCTGAGCAGCACCGAGGCGCAGCTGCACGACGCCCAGGAGCTGCTTCAGGAGGAGACCCGGGCAAAGCTGGCCCTGGGCTCGCGGGTTCGCGCCCTGGAGGCTGAGGCCTCGGGGCTGCGCGAGCAGATAGAAGAGGAAGCCGCTGCCAGGGAGCGTGCGGGCCGTGAGCTCCAGACTGCCCAGGCCCAGCTGTCAGAGTGGCGGCGCCGCCAGGAGGAGGAGGCGGGAGCACTGGAGGCGGGGGAGGAGGCCCGGCGCCGCGCGGCCCGGGAGGCCGAGGCCCTGGCCCAGCGCCTGGCGGAGAAGACGGAGGCTGCGGAGCGGCTGGAGCGGGGCCGCCGCCGGCTGCAGCAGGAGCTGGACGACGCCACGGTGGACCTGGAGCAGCAGCGGCAGCTCGTGAGCTCGCTGGAGAAGAAGCAGCGCAAATTCGACCAGCTTCTGGCTGAGGAGAAGGCAGCTGTGCTCCGCGCAGCAGAGGAACGTGAGCGGGTGGAAGCCGAGGGCCGGGAGCGCGAGGCTCGGGCCTTGTCCCTGACACGAGCCCTGGAAGAGGAACAGGAGGCCCGGGAGGAGCTGGAGCGCCAGAACCGGGCACTGCGGGCCGAGATGGAGGCGCTACTGAGCAGCAAGGATGATGTCGGCAAGAGTGTGCACGAACTGGAACGCGCCCGCAGGGTGGCGGAGCAGGCAGCCAACGACCTGCGAGCACAGGTGACGGAGCTGGAGGACGAGCTGACGGCGGCCGAGGACGCCAAGCTGCGCCTGGAGGTGACCGTGCAGGCTCTGAAGGCACAGCACGAGCGCGACCTGCAGGGCCGCGACGAGGCCGGCGAGGAGAGGCGGAGGCAGCTGGCCAAGCAGCTGAGGGATGCGGAGGTGGAGCGCGACGAGGAGCGGAAGCAGCGCGCCCTGGCCTTGGCCGCCCGCAAGAAGCTGGAGGCGGAGCTGGAGGAGCTGAAGGCGCAGATGGCGGCCGCTGGGCAGGGCAAGGAGGAGGCGGTGAAGCAGCTGCGTAAGATGCAGGCCCAGATGAAGGAGCTGTGGCGGGAGGTGGAGGAGTCACGCACCTCCCGGGAGGAGATCTTTGTCCAGAACCGGGAGAGTGAAAAGCGCCTCAAGGGGCTGGAAGCAGACGTGCTACGGTTGCAGGAGGAGCTGGCAGCCTCAGACCGTGCGCGGCGACAGGCGCAGCAGGACCGGGATGAGATGGCCGATGAGCTGGCCAATGGCAGCCTTAGCAAGGCGGCCCTGCTGGAGGAGAAGCGGCAGCTGGAGGGGCGCCTGGGGCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGAGCAATGCCGAGCTGCTCAATGACCGCTACCGCAAGCTGCTGCTGCAGGTGGAGACCCTGACCACAGAGCTGTCTGCTGAGCGTAGTTTCTCAGCCAAGGCTGAGAGTGGCCGGCAGCAACTGGAGCGGCAGATCCAGGAGCTCCGGGGACACCTGGGTGAAGAGGATGCTGGGGCCCGGGCCCGCCAGAAGATGATGATTGCCACCCTTGAGTCTAAGCTGGCCCAGGCTGAGGAGCAGCTGGAGCAAGAGACCAGGGAGCGCATCCTCTCTGGCAAGCTAGTACGCAGAGCCGAGAAGCGGTTGAAGGAGGTGGTTCTGCAGGTGGAGGAGGAGCGGAGGGTGGCTGACCAGCTCCGGGACCAGCTGGAGAAAGGGAACCTCCGGCTGAAGCAGCTGAAGCGGCAGCTGGAGGAGGCGGAGGAGGAGGCGTCCCGGGCCCAGGCCGGCCGCCGCAGGCTGCAGCGGGAGCTGGAGGACGTCACCGAGTCCGCCGAGTCCATGAACCGCGAGGTGACCACGCTGAGGAACCGGCTCCGGCGCGGCCCGCTTACCTTCACCACGCGCACAGTGCGCCAGGTGTTCCGCCTGGAGGAGGGCGTGGCTTCCGATGAGGAGGAGGTGGAGGGGGCGGAGCCAGGGTCGGCCCTGCCGCAGGAGCCCGAGTGTCCCCCGCCAGCCCAGCCCCAGTGA

XM_004866839.1 Coding sequence

Myh14 myosin, heavy chain 14, non-muscle, transcript variant X6

Length: 6006 bp    Location: 4231067..4176625   Strand: -
>XM_004866839.1
ATGGCGGCCGTGACGCTGTCAGTGCCCGGGCGCAAGGTGCCCCCCAGGCCGGGCCCAGTGCCGGAGGCAGCGCAGCCCTTCTTGTTCGCCCCGTGCTCCCCGGGCTCGGGAGCGGGCAGTCCCCCGCAGGTGGAGTGGACGGCCCGGCGCCTGGTGTGGGTCCCTTCGGAGCTGCACGGGTTCGAGGCGGCCGCACTGCGCGACGAGGGCGATGAGGAGGCCGAGGTGGAGCTGGCGGAGAGCGGGCGGCGGCTGCGGCTGCCGCGGGACCAGATCCAGCGCATGAACCCGCCCAAGTTCAGCAAGGCCGAGGACATGGCCGAGCTCACCTGCCTGAACGAGGCCTCGGTGCTGCACAACCTGCGCGAGCGCTACTACTCCGGCCTCATCTACACCTACTCCGGCCTGTTCTGTGTGGTCATCAACCCCTACAAGCAGCTGCCCATCTACACAGAGGCCATTGTGGAGATGTACCGGGGTAAGAAGCGCCACGAGGTGCCGCCCCACGTGTATGCAGTGACGGAGGGGGCCTACAGGAGCATGCTTCAAGACCGAGAGGACCAGTCCATCCTCTGCACCGGGGAGTCTGGAGCCGGGAAGACAGAGAACACCAAGAAGGTCATCCAGTACCTGGCGCACGTGGCATCGTCGCCCAAGGGCAGGAAGGAGCCGGGAGTCCCTGTAAGCCAGCGCCCCCGCGCCCGCCAGGGGGAGCTGGAGCGGCAGCTTCTCCAGGCCAACCCGGTCCTGGAGGCCTTCGGCAACGCCAAGACGGTGAAGAACGACAACTCCTCGCGCTTCGGCAAATTCATCCGCATCAACTTTGACGTCGCGGGGTACATCGTGGGCGCCAACATCGAGACCTACCTGCTGGAGAAGTCGCGCGCCATCCGCCAGGCCAAGGACGAGTGCAGCTTCCACATCTTCTACCAGCTGCTGGGGGGCGCGGGGGAGCAGCTCAAAGCCGACCTCCTCCTGGAGCCCTTCTCGCACTACCGCTTCCTGACCAGCGGGCCGCCATCCACCGCCAGCCAGGAGCGGGAGCCGTTCCAGGAGACCCTGGAGTCCCTGCGGGTGCTGGGCTTCACGCCCGAGGAGATCACCTCTATGCTGCGGATGGTGTCCGCCGTGCTGCAGTTCGGCAACGTCATCCTCAAGAGCGAGCGCAACACGGACCAGGCCACCATGCCGGACAACACAGCTGCACAGAAGCTATGCCGTCTTCTGGGGCTGGGGGTGACCGACTTCTCCAGAGCCCTGCTCACGCCCCGCATAAAGGTTGGCCGAGATTACGTCCAGAAAGCCCAGACCAAGGAGCAGGCCGACTTCGCGCTGGAGGCTCTGGCCAAGGCCACCTACGAGCGCCTCTTCCGCTGGCTGGTCCTGCGCCTCAACCGCGCCCTGGACCGCAGCCCGCGCCAGGGCGCCTCCTTCCTGGGCATCTTGGACATCGCCGGCTTCGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGTTGTTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATTCCCTGGACCTTCCTGGACTTCGGCCTCGACCTGCAGCCCTGCATCGACCTCATCGAGCGCCCGGCCAACCCGCCCGGGCTTCTGGCCCTGCTGGATGAGGAGTGCTGGTTCCCGAAGGCCACGGACAAATCGTTCGTGGAGAAGGTGGCCCAGGAGCAGGGCGGCCACCCCAAGTTCCAGCGCCCCAGGCAACTGCGGGACCAGGCTGACTTCAGCGTCCTGCACTATGCTGGAAAGGTCGACTACAAGGCCAATGAGTGGCTGATGAAGAACATGGACCCGCTGAATGACAACGTGGCAGCCTTGCTCCACCAGAGCACAGACCGGATGACTGCGGAGATCTGGAAAGACGTGGAGAGCATCGTGGGGCTGGAGCAGGTGAGCAGCCTCGGGGATGGCCCACCGGGTGGCCGCCCGCGCCGCGGGATGTTCCGGACGGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTGATGGCCACACTCAGCAACACCAACCCCAGCTTCATCCGCTGCATCATCCCCAACCACGAGAAGCGGGCTGGGAAGCTGGAGCCACGGCTGGTGCTGGAGCAGCTCCGCTGCAATGGCGTCCTCGAGGGCATCCGCATCTGCCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGGTACGAGATCCTGACGCCCAATGCCATCCCCAAGGGCTTCATGGACGGGAAGCAGGCCTGCGAGAAGATGATCCAGGCTCTGGAGCTGGACCCCAACCTGTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCGGGGGTCCTGGCCCAGCTGGAGGAGGAGCGGGACCTGAAGGTCACAGACATCATTGTGTCCTTCCAAGCAGCTGCCCGGGGATACCTGGCACGCAGGGCCTTCCAGAGGCGCCAGCAGCAGCAGAGCGCGCTGAGGGTGATGCAGAGGAACTGTGCGGCCTACCTCAAGCTCAGGCACTGGCAGTGGTGGCGGCTGTTCATCAAGGTGAAGCCGCTGCTGCAGGTGACGCGGCAGGACGAGGTGCTGCAGGCGCGCGCCCAGGAGCTGCAGAAGGTGCAGGAGCTGCAGCAACAGAGCGCGCGCCAAGTGGGGGAGCTGCAGGACCGCGTGGCGCAGCTGGAGGAGGAGCGCACCCGCTTGGCCGAGCAGTTGCGGGCGGAGGCCGAGCTTTGCGCGGAGGCGGAGGAGACTCGCGGACGTCTAGCGACCCGCAAGCAGGAGCTGGAGCTGGTGGTGACGGAGCTGGAGGCCCGCATGGGCGAGGAGGAGGAGTGCAGCCGCCAGCTGCAGGCCGAGAAGCGGAGGCTGCAGCTGCACATCCAGGAGCTGGAGACCCACTTGGAGGCCGAGGAGGGGGCGCGGCAGAAGCTACAGCTGGAGAAGGTGACGACTGAGGCGAGGCTGAAGAAGTTCGAGGAGGACTTGCTGCTCCTGGAGGACCAGAACGCCAAGCTGGGCAAGGAGCGCCGGCTGCTGGAGGAGCGCCTGGCCGAGTTCTCCTCGGCGGCGGCGGAGGAGGAGGAGAAGATCAAGAGCCTGAACAAGCTGCGGCTCAAATACGAGGCCACCATCGCGGACATGGAGGACCGCCTGCGGAAGGAGGAGAAGGGGCGCCAGGAGCTGGAGAAGCTGAAGCGGCGGCTGGACGGGGAGAGCTCCGAGCTGCAGGAGCAGATGGCGGGGCAGCAGCAGCGCGCCGAGGAGCTGCGGGCCCAGCTGGGCCGCAAGGAGGAGGAGCTGCAGGCGGCGCTGGCCAGGGCAGAGGAGGAGGGCGGGGCCCGGACCCAGCTGCTGAAGTCCCTTCGCGAGGCGCAGGCCGGCCTAGCCGAGGCCCAGGAGGACCTGGAGGCCGAGCGCGCGGCCAGGGCCAAGGCCGAGAAGCATCGCCGCGACCTGGGCGAGGAGCTGGAGGCGCTGCGCGGGGAGCTGGAGGACACGCTGGACTCCACGAACGCGCAGCAGGAGCTGCGGACCAAGAGAGAACAGGAGGTGACAGAACTGAAGAAGACGCTGGAAGAGGAGACCCGGATTCACGAGGTGGCCGTGCAGGAGCTGAGGCAACGGCACGGCCAGGCGCTGGGGGAGCTGGCGGAGCAGCTGGAGCAAGCGCGACGGGGCAAAGGCGCTTGGGAGAAGACGAGGCTGGCTCTGGAGGCAGAGGTGTCCGAGCTGCGGGCGGAGCTGAGCAGCCTGCAGTCTGCACGCCAGGAGGGAGAGCAGAGGCGTAGGCGTCTGGAGTCGCAGCTGCAGGAGGTGCAGGGCCGGGCTGGTGACGGAGAGCGCGCACGTGTGGAGGCTGCGGAGAAGCTGCAGCGAGCGCAGGCTGAGCTGGAGACCGTGTCTGGGGCGCTGAGTGAGGCCGAGTCCAGAGCCATCCGGCTGGGCAAGGAGCTGAGCAGCACCGAGGCGCAGCTGCACGACGCCCAGGAGCTGCTTCAGGAGGAGACCCGGGCAAAGCTGGCCCTGGGCTCGCGGGTTCGCGCCCTGGAGGCTGAGGCCTCGGGGCTGCGCGAGCAGATAGAAGAGGAAGCCGCTGCCAGGGAGCGTGCGGGCCGTGAGCTCCAGACTGCCCAGGCCCAGCTGTCAGAGTGGCGGCGCCGCCAGGAGGAGGAGGCGGGAGCACTGGAGGCGGGGGAGGAGGCCCGGCGCCGCGCGGCCCGGGAGGCCGAGGCCCTGGCCCAGCGCCTGGCGGAGAAGACGGAGGCTGCGGAGCGGCTGGAGCGGGGCCGCCGCCGGCTGCAGCAGGAGCTGGACGACGCCACGGTGGACCTGGAGCAGCAGCGGCAGCTCGTGAGCTCGCTGGAGAAGAAGCAGCGCAAATTCGACCAGCTTCTGGCTGAGGAGAAGGCAGCTGTGCTCCGCGCAGCAGAGGAACGTGAGCGGGTGGAAGCCGAGGGCCGGGAGCGCGAGGCTCGGGCCTTGTCCCTGACACGAGCCCTGGAAGAGGAACAGGAGGCCCGGGAGGAGCTGGAGCGCCAGAACCGGGCACTGCGGGCCGAGATGGAGGCGCTACTGAGCAGCAAGGATGATGTCGGCAAGAGTGTGCACGAACTGGAACGCGCCCGCAGGGTGGCGGAGCAGGCAGCCAACGACCTGCGAGCACAGGTGACGGAGCTGGAGGACGAGCTGACGGCGGCCGAGGACGCCAAGCTGCGCCTGGAGGTGACCGTGCAGGCTCTGAAGGCACAGCACGAGCGCGACCTGCAGGGCCGCGACGAGGCCGGCGAGGAGAGGCGGAGGCAGCTGGCCAAGCAGCTGAGGGATGCGGAGGTGGAGCGCGACGAGGAGCGGAAGCAGCGCGCCCTGGCCTTGGCCGCCCGCAAGAAGCTGGAGGCGGAGCTGGAGGAGCTGAAGGCGCAGATGGCGGCCGCTGGGCAGGGCAAGGAGGAGGCGGTGAAGCAGCTGCGTAAGATGCAGGCCCAGATGAAGGAGCTGTGGCGGGAGGTGGAGGAGTCACGCACCTCCCGGGAGGAGATCTTTGTCCAGAACCGGGAGAGTGAAAAGCGCCTCAAGGGGCTGGAAGCAGACGTGCTACGGTTGCAGGAGGAGCTGGCAGCCTCAGACCGTGCGCGGCGACAGGCGCAGCAGGACCGGGATGAGATGGCCGATGAGCTGGCCAATGGCAGCCTTAGCAAGGCGGCCCTGCTGGAGGAGAAGCGGCAGCTGGAGGGGCGCCTGGGGCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGAGCAATGCCGAGCTGCTCAATGACCGCTACCGCAAGCTGCTGCTGCAGGTGGAGACCCTGACCACAGAGCTGTCTGCTGAGCGTAGTTTCTCAGCCAAGGCTGAGAGTGGCCGGCAGCAACTGGAGCGGCAGATCCAGGAGCTCCGGGGACACCTGGGTGAAGAGGATGCTGGGGCCCGGGCCCGCCAGAAGATGATGATTGCCACCCTTGAGTCTAAGCTGGCCCAGGCTGAGGAGCAGCTGGAGCAAGAGACCAGGGAGCGCATCCTCTCTGGCAAGCTAGTACGCAGAGCCGAGAAGCGGTTGAAGGAGGTGGTTCTGCAGGTGGAGGAGGAGCGGAGGGTGGCTGACCAGCTCCGGGACCAGCTGGAGAAAGGGAACCTCCGGCTGAAGCAGCTGAAGCGGCAGCTGGAGGAGGCGGAGGAGGAGGCGTCCCGGGCCCAGGCCGGCCGCCGCAGGCTGCAGCGGGAGCTGGAGGACGTCACCGAGTCCGCCGAGTCCATGAACCGCGAGGTGACCACGCTGAGGAACCGGCTCCGGCGCGGCCCGCTTACCTTCACCACGCGCACAGTGCGCCAGGTGTTCCGCCTGGAGGAGGGCGTGGCTTCCGATGAGGAGGAGGTGGAGGGGGCGGAGCCAGGGTCGGCCCTGCCGCAGGAGCCCGAGTGTCCCCCGCCAGCCCAGCCCCAGTGA

XM_004866947.1 Coding sequence

Cd37 CD37 molecule, transcript variant X5

High confidence: 4 potential gene matches
Length: 846 bp    Location: 4841702..4837247   Strand: -
>XM_004866947.1
ATGTCGGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTGTTCAACCTCTTCTTCTTCGCCCTTGGCAGCCTGATTTTCTGCTTCGGCATCTGGATTCTCATCGACAAGACCAGCTTCGTGTCCTTTGTGGGCTTGTCCTTCGTGCCCCTGCAGACCTGGTCCAAGATCCTGGCAATCTCAGGGGTTCTCACCATGGGCCTCGCTCTCCTGGGTTGTGTGGGAGCCCTCAAGGAACTCCGAAGCCTTCTGGGTATGTATTTCGGGATGCTGCTGCTCCTGTTTGCCACGGAGATCACCCTGGGCATCCTCATCTCCACCCAGCGGGTCCGGCTGGAGCGAAGGGTGAAGGAGCTCGTGCTGAGCACCATCCAAAACTACGGCTCCAACCCGGAGGAGACAGCGGCCGAGGAGAGCTGGGACTACGCCCAGTTCCAGCTGCGCTGCTGCGGCTGGCACTCTCCGCAGGACTGGTTCCAGGTCCTCATCCTGAGAGGCAACGCGTCAGAGGCGGACCGCGTGCCCTGCTCCTGCTACAACTCGTCGGCGACCAACGACTCCGCAATCTTTGATAAGATCTACTCACCGCAGCCCGGCCGGCTCGGACCTCGGGCGAGGCCCAGGCACAGCACAGACCTGTGCTCCGTGCCCGCAAATGGCCACATCTACAGCGAGGGCTGCGCGAAAAGCCTCCGGACGTGGCTGCACAACAATCTCATCTCCATAGTGGGCATTTGTCTGGGCGTCGGTCTACTCGAGCTCGGCTTCATGACGCTCTCGATATTCATGTGCAGAAACCTGGAATACGTCTATGACCGACTTGCTCGATACCGCTAA

XM_004866945.1 Coding sequence

Cd37 CD37 molecule, transcript variant X3

Length: 936 bp    Location: 4841702..4837247   Strand: -
>XM_004866945.1
ATGTCGGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTGTTCAACCTCTTCTTCTTCGCCCTTGGCAGCCTGATTTTCTGCTTCGGCATCTGGATTCTCATCGACAAGACCAGCTTCGTGTCCTTTGTGGGCTTGTCCTTCGTGCCCCTGCAGACCTGGTCCAAGATCCTGGCAATCTCAGGGGTTCTCACCATGGGCCTCGCTCTCCTGGGTTGTGTGGGAGCCCTCAAGGAACTCCGAAGCCTTCTGGGTATGGTGAGTGCCCCACCCCTATCCCTAGAGCCACTCCCCAGCCTCAAGAGTCCCCTGGGGAGGGGTCAGCCTGACCTCTCCCCTCTGCTCCAGTATTTCGGGATGCTGCTGCTCCTGTTTGCCACGGAGATCACCCTGGGCATCCTCATCTCCACCCAGCGGGTCCGGCTGGAGCGAAGGGTGAAGGAGCTCGTGCTGAGCACCATCCAAAACTACGGCTCCAACCCGGAGGAGACAGCGGCCGAGGAGAGCTGGGACTACGCCCAGTTCCAGCTGCGCTGCTGCGGCTGGCACTCTCCGCAGGACTGGTTCCAGGTCCTCATCCTGAGAGGCAACGCGTCAGAGGCGGACCGCGTGCCCTGCTCCTGCTACAACTCGTCGGCGACCAACGACTCCGCAATCTTTGATAAGATCTACTCACCGCAGCCCGGCCGGCTCGGACCTCGGGCGAGGCCCAGGCACAGCACAGACCTGTGCTCCGTGCCCGCAAATGGCCACATCTACAGCGAGGGCTGCGCGAAAAGCCTCCGGACGTGGCTGCACAACAATCTCATCTCCATAGTGGGCATTTGTCTGGGCGTCGGTCTACTCGAGCTCGGCTTCATGACGCTCTCGATATTCATGTGCAGAAACCTGGAATACGTCTATGACCGACTTGCTCGATACCGCTAA

XM_004866949.1 Coding sequence

Dkkl1 dickkopf-like 1, transcript variant X1

Length: 693 bp    Location: 4820050..4816390   Strand: -
>XM_004866949.1
ATGTGGCATCCGCTGGTCCTGCTGCTGCTGCTGCTCCCCTGCGCCCTGCTGCCCGCTTCGTCCGCGGCCCCCATTGGCGACGGTGACACCCAAGAGAGCTCTTCGGATTTCCTAGGCCTCCAGGGCCTTCTCCAAGGCTTCGGGCGACTCTTCCTGAAAGATGACCTGCTGCGGGGTCTGGACAGCATCTTCTCCTTCCTTATGGACTCCCGGGGCCTCCCCAGAGATTTCCACCAAGAGCAGGACCAGAAGCAGCGGGTGGGGAACAAGACCCTCTCCAGCCACCTCCAGATTGACAAGGTGACTGACAACAAGACAGGAGAGGTGCTCATCTCTGAGAAGGTGGTGGCCTCCATGGAGCCAGAGGAAAGCCTGGAAGGTGACCAGGTTCCCAAGGAGGAGAAGGAAGCCCCAGTGCCCGCCAGAAACGCTATGGGCAGCTTCCATCTGGAAGCCCACCACCCAGCCTTCTGGATCATTAAGGTGCCTCGGAGGAAGTCCCACCAGGATGCTCAAGAGGACGGTGGCTGGCTAAGGGAGAAGAAACACCGCCTGCAGGCCATCAGGGATGGGCTCCGAGAGGGCACCCACAAAGGTGTCCTTGAACATGGGACCCAGGACTCCTCCTACTCCAGGCTGCCTACCCGAAAGACCCACTTCCTATACATCCTCAGGCCCTCCCACCAGCTATAG

XM_004866940.1 Coding sequence

Slc6a16 solute carrier family 6, member 16, transcript variant X1

Length: 2319 bp    Location: 4849489..4869055   Strand: +
>XM_004866940.1
ATGGCGGGAGCACAGCGACAAGAGAAGAACATGGCCCCAGAAACGAGGTCTGCTCAGGAAGGGGATCCCTCCCTTGCAGCTCACAGAGGTACTCCTGACAGTCAGCCTGGGAGGGAGCCAGAGCCCCACACTTTGGAATCGGTGCTGGAAACAAGCTGGTCTAGTGAGTCCGAGCTTTCCCAGACTTACTCAGGACTCTCTGCCTCGGGACAAACATCAACCTCGTCTGAAATGATCTGGTCTTTGGGGCCTGAAGATTCACTGCCCCAGGTCTCGAATGCTCAGGCCTGGGAGATGTACACTTTAGAGACCCAGGCCAGGGCTGGACAACTGCACCAAAGTTCTGCAGTGGAGGTGACACCTGTCTCAGTCCTGAAGCCGAAACCCTCGAAGGAGAAGGAAGAACTGGCCAACAGAGAAGAAAGCGATGACTTCTTTGTTCGTCCGCTCTGGCCCAGGACGGTTGAGTACATCCTGACCCTGATGGGCTACATCGTGAAGCCAGCCAATATCTGGAGCTCTGTGTACCTGTGGCTTCACAAAGGAGGTGGCACCTTCTTCTTCATCTACACTGTCATCCTGCTGATTGTCGGGACCCCTCTGCTCTTCCTGGAGATGGCAGTTGGTCAGAGAATGCATCGGAACAGCATGGACACATGGCAGATCATTGCCCCTTGGGCTGGTGGCGTAGGCTACGCCAGCTTTATAATGTGTTTCATCACGAGCACGTACACGAATGTGTTGAATGCCTGGATCCTCTTCTACCTGAGCCACACCTTCCAGTTCCCTCTTCCATGGGAGAAATGTCCCTTATTGAAGAATTCCAGTGACTTTGATCCTGAGTGCGCACAGACGACACCCTCCATGTACTTCTGGTACCAGCAGACCCTGAAGGTCTCAGACAGGATCGAGGATGGTGGGCTGGTGGTCTCGAGTCTCAGCCTGCCTTTCTTTGTGTCCTGGTGTCTTGTTAGTGCCTTCATGATCAAGGGGCTCAAGTTCCTAGGGAAGGGCATGTTTATCTTGATGTCACTTTCCTATATCATCTTCTTCTGCTTCTTCATCTGGAGTCTACACCTGGAAGGGGCAAAATACGGCCTTAAACATTTGCTAGCTGCCAAGATGTCGGCTGTGTATGACCTGAGTGTGTGGTCGGTAGCAGGAGGCCAAGTTTTGTTTGATCTGGGCCTAGGCTTTGGCCCCATTGCCTCCTTATCCTCCCACATGCCCCAGTCCAACAACTGTCTCGGCGATGCCTTTGTCATGGCTCTGATCTACCTGGTCACCTTGCTCTTCATGACACCTTTCATCCTCGCCCTCCTGGGCTTCTGGGCTACAGTCCTCACACATCGCTGCACTGAGAAGAACATGGAAATGCTGTTGATGCTGGTGAACATGGGGATACTGCCTCCTGAGGCTAAGCCCCCTGATGACCTGAACAACGACCCCACCTCCACCTACAGCTCCTGGCTTAGCGGCCTCGCCCAGGATATCAAGAGCCTGGTGCTCAGCAAGGTGTCCAAGTGTGACAGAGAGTTGAGGATTCTGCAGGCTAAGGAGGGCCCAGGCTTTGTATTCCTGTCCTTTGCTGAAGCCGTATCCTTCCTTCCTCGGTCAATCTTCTGGTGCATCCTCTTCTTCTTGATGCTGCTGTTGCTAAGCTTGAGCACCACGATAGGATTCATGCAAGGCCTCATTATCCCGCTCCAGGACCCCTCCTCTTTCCTCAGAAAACAAACCAAGCTGCTCACAGGGAGCATCTCTATGCTGCTGTTCCTATGTGGTCTGTACTTCACTCGTCCCCCTGGCGTTTACATCATCAAGCTGGTGAGGGAATACTGGACCCCCATGCCCATCATCTTCATCATCATCTGTGAAAACATTGCCGTGGCCTGGGCCTTCAGGGCCAAGAGGTTTCTTGGAGACCTGATGAACCTGGCGCAGGGCTTCACCCTCCGCTTCTACAGCTGGGTGTGGAGCTACTTGACTCCGGTCATGCTGCTCGTCATGTTTGTAGCCCTCCTGGTTCAGCGCTGTGTGAAGCCCATCACCTACCTGGCCTGGGACTCAAGCAATTCTACAGAGGTGACTCGAGAGTACCCGTCGTGGGCGCTGCTCTTGATGATCATACTTCTCCTCATTGTCATCGCTCCCATCCCTGTGTACCTCTTCTACGGCCTCGCCCACGGGATTCCCTTCAGGCCCAGTGGTGGGGACAAGCGTGGAAAATCCTCCACACCCCTGCGTCAGGGGAACCAGATGATGCCGGGTAAGGAGGCCCAAGAGAAAGAAGTTCACCAAGATAATAAAGGGACGTGA

XM_004866942.1 Coding sequence

Slc6a16 solute carrier family 6, member 16, transcript variant X3

Length: 2043 bp    Location: 4857505..4869055   Strand: +
>XM_004866942.1
ATGCATTTGGCCCGCATGCGCAGTGCTGCCTCAGGGTCCAGCTGCAGTATCCGCTTTGGTACAGCTCTTTCACGGCCCACTTTTTTTCTGTTCTTTTTCAGCACACTCCTTGGCCATACTCACGTAGAGCATTTGAGGAGGCAGCGAAACAAGATCAGGATGGCGGGAGCACAGCGACAAGAGAAGAACATGGCCCCAGAAACGAGGTCTGCTCAGGAAGGGGATCCCTCCCTTGCAGCTCACAGAGGTACTCCTGACAGTCAGCCTGGGAGGGAGCCAGAGCCCCACACTTTGGAATCGGTGCTGGAAACAAGCTGGTCTAGTGAGTCCGAGCTTTCCCAGACTTACTCAGGACTCTCTGCCTCGGGACAAACATCAACCTCGTCTGAAATGATCTGGTCTTTGGGGCCTGAAGATTCACTGCCCCAGGTCTCGAATGCTCAGGCCTGGGAGATGTACACTTTAGAGACCCAGGCCAGGGCTGGACAACTGCACCAAAGTTCTGCAGTGGAGGTGACACCTGTCTCAGTCCTGAAGCCGAAACCCTCGAAGGAGAAGGAAGAACTGGCCAACAGAGAAGAAAGCGATGACTTCTTTGTTCGTCCGCTCTGGCCCAGGACGGTTGAGTACATCCTGACCCTGATGGGCTACATCGTGAAGCCAGCCAATATCTGGAGCTCTGTGTACCTGTGGCTTCACAAAGGAGGTGGCACCTTCTTCTTCATCTACACTGTCATCCTGCTGATTGTCGGGACCCCTCTGCTCTTCCTGGAGATGGCAGTTGGTCAGAGAATGCATCGGAACAGCATGGACACATGGCAGATCATTGCCCCTTGGGCTGGTGGCGTAGGCTACGCCAGCTTTATAGGCATGTTTATCTTGATGTCACTTTCCTATATCATCTTCTTCTGCTTCTTCATCTGGAGTCTACACCTGGAAGGGGCAAAATACGGCCTTAAACATTTGCTAGCTGCCAAGATGTCGGCTGTGTATGACCTGAGTGTGTGGTCGGTAGCAGGAGGCCAAGTTTTGTTTGATCTGGGCCTAGGCTTTGGCCCCATTGCCTCCTTATCCTCCCACATGCCCCAGTCCAACAACTGTCTCGGCGATGCCTTTGTCATGGCTCTGATCTACCTGGTCACCTTGCTCTTCATGACACCTTTCATCCTCGCCCTCCTGGGCTTCTGGGCTACAGTCCTCACACATCGCTGCACTGAGAAGAACATGGAAATGCTGTTGATGCTGGTGAACATGGGGATACTGCCTCCTGAGGCTAAGCCCCCTGATGACCTGAACAACGACCCCACCTCCACCTACAGCTCCTGGCTTAGCGGCCTCGCCCAGGATATCAAGAGCCTGGTGCTCAGCAAGGTGTCCAAGTGTGACAGAGAGTTGAGGATTCTGCAGGCTAAGGAGGGCCCAGGCTTTGTATTCCTGTCCTTTGCTGAAGCCGTATCCTTCCTTCCTCGGTCAATCTTCTGGTGCATCCTCTTCTTCTTGATGCTGCTGTTGCTAAGCTTGAGCACCACGATAGGATTCATGCAAGGCCTCATTATCCCGCTCCAGGACCCCTCCTCTTTCCTCAGAAAACAAACCAAGCTGCTCACAGGGAGCATCTCTATGCTGCTGTTCCTATGTGGTCTGTACTTCACTCGTCCCCCTGGCGTTTACATCATCAAGCTGGTTTCTTGGAGACCTGATGAACCTGGCGCAGGGCTTCACCCTCCGCTTCTACAGCTGGGTGTGGAGCTACTTGACTCCGGTCATGCTGCTCGTCATGTTTGTAGCCCTCCTGGTTCAGCGCTGTGTGAAGCCCATCACCTACCTGGCCTGGGACTCAAGCAATTCTACAGAGGTGACTCGAGAGTACCCGTCGTGGGCGCTGCTCTTGATGATCATACTTCTCCTCATTGTCATCGCTCCCATCCCTGTGTACCTCTTCTACGGCCTCGCCCACGGGATTCCCTTCAGGCCCAGTGGTGGGGACAAGCGTGGAAAATCCTCCACACCCCTGCGTCAGGGGAACCAGATGATGCCGGGTAA

XM_004866932.1 Coding sequence

Aldh16a1 aldehyde dehydrogenase 16 family, member A1, transcript variant X3

Length: 2232 bp    Location: 4757457..4745000   Strand: -
>XM_004866932.1
ATGCGCACTGGAGAGAATTTGGCCAATTGCCTCCTGGCAGAGCCTGATGATGTGGCTGCAGCAGTGAAGGCAGCCTTGGATGCACGGGGAAGCTGGAGTGGAGTCCCCGGAGGCGAGCGGGCCCAGCACCTGACCAGGCTGGCCAAGATGATCCAGAAGCACCAGCAGCTTCTGTGGACCCTGGATTCCCTGCTCACTGGGCGGGCCATTCGGGAAGTTCGCAGTGGGGATGTCCCACTGGCCCAGCAGCTGCTGCAGTACCATGCAGTCCAAGCTCATGTCCAGGAAGAGGTACTGGCAGGCTGGAAGCCCATGGGTGTTATTGGCCTCATCTTACCACCCACGTTCTCCTTCCTAGAGATGATGTGGAGAATTTGCCCTGCCCTGGCAGTGGGCTGCACCGTGGTGGCCATTGTACCCCCAGGCTCCCCAAGCACCCTCCTCCTGGCCCAGCTGGCAGGGGGCCTTGGCACATTCTGCGGGATCCTCAATGTGATTGTTGGCCCTGCCTCCCTGGGGCCCACTCTGGGCCGATGTCCTGGAGTGCAGAAGGTGGCCTTCTGTGGAGCTGCAGAGGAAGCGCGTGTCCTGCGGCAGAGCCTGGCTGGCCACAGGCTGGAGCTGAGTCTGGCGCTGGACTTGGAATCACTACTGCTGGTCATGGACTCAGCCGACCTGGACTCAGCCGTGGAGGGCGTTGTGGATGCAGCCTGGTCTGACCGCAGCCCGGGCGGCCTCCGGCTCCTGGTCCAAGAATCTGTGTGGGAGGAAACCATGAGGCGACTCCAATCGAGGATGAGGCGGCTGCGGAGTGGCCCAGGCCTGGACGGGGCCGTGGACATGGGGACCCGAGGGGCTGCTGCCTGTGATGTGGCCCAGCGCTGTGTGCAGGAGGCCAGGAGTCAGGGTGCAGAGGTGTTCCAGGCTGTCACTGTGCCCTCAGGTGGCCCACTCTTTCCCCCAACATTGGTCTCTGGCCTGCCCCCCGCCGCACCATGTGCCCAGGCAGAAGTCCCGTGGCCGCTGGTCATGGCCTCCCCTTTCCGCACAGCCAAGGAGGCGCTGGCCATGGCCAACAGCACACCTCGGGGAGGCAGCGCCAGTGTGTGGAGCGAGAGGCTGGGGCAGGCGCTGGAGCTGGCCTATGGGCTCCGGGTGGGCACAGTCTGGATCAACACCCATGGCCTCAGAGACCCTGCAGTGCCCATAGGTGGCTGCAAGGAGAGTGGGTCTTCCTGGCACGGGGGCCTGGATGGTCTGTATGAGTACCTGCAGCCCTCGGGGACCCCTGGCCAGCTGCCTTTTGTTTTTGAGCATCTGAACTATGACAGCTTCGGCCTTGCCTTACCCACAGCCCTGCCAGCATGGCCCGAAACAGGGCCCAGCCCAGTGCCTCCCTATGGGCTCTTTATCCGGGGCCGATTCCAGCCTTCGGGAGCCGGGAGCTCTAGGCCCATCTGGGATTCTTCTGGCAAACTCCATGGCTACGTGGCTGAGGGTGCAGCTGAGGATGTGCGAGGCGCTGTGGAAGCCGCTCACCAGGCTGCCACTGGCTGGGAGCGTCAGTCCCCAGGGGCCCGGGCGGCCCTGCTGGTGGCGCTGGCAGCTGCGCTGGAGCACAGGGGACCCGGCCTGGCCTCGAGGCTGCAGCGGCATGGAGTGGAGCTCGAGGCTGCCAAGGTGGAGGTGGAGCTCAGCGCCAGGCGACTCCGGGCGTGGGCAGCCCAGGCCCAGGCCCAAGCCCAGGGCCACACCCTGCAGGTAGCAGGGCTCAGAGGCCCTGTGCTCCGCCTTCGGGAGCCACTGGGTGTGCTGGCAGTCGTGTGCCCTGACGAGTGGCCTCTGCTCGCCTTCGTGTCCCTGCTGGCCCCTGCCCTGGCGCACGGCAACACTGTGGTCTTGGTGCCCAGCGGGACCTGTCCCCTGCTGGCCCTGGAGATCTGCCAGGATGTGGCCTCGCTGTTCCCCGCTGGACTGGTGAACGTAGTGACAGGAGATCGTGACCACCTGACGCGCTGCCTGGCCTTGCACCAGGATGTCCAGGCGCTGTGGTATTTCGGATCTGCAGAGGGCTCCCAGTTCGTGGAGTGGGCCTCGGCGGGAAACCTCAAGCCTGTGTGGGTGAACAGTGGATGCCCAAGGGCCTGGGAGCAGGAGCCCCAGGGGGCAGGCCCAGAGCTGAGGCTGCGGGCAGCACGGACCAAGGCCCTGTGGCTGCCCATGGGGGACTAA

XM_004866924.1 Coding sequence

Flt3lg fms-related tyrosine kinase 3 ligand, transcript variant X2

Length: 804 bp    Location: 4739214..4733941   Strand: -
>XM_004866924.1
ATGACAGTGCTGGCGCCAGCCTGGAGACCATCGTGCCCCCTGCTGCTGCTCCTACTGCTCCTGCTGCTGAGCCCCCGCTTGCACGGGACCTCCAGCTGCTCTTTCTCCCACAACCCCATCTCCTCCGACTTCAAAATCAAATTCAGCACACTGTCTGACTACCTGCTCAAGGATTATCCAGTCACTGTGGCCGCCAACCTGCAGGACGTGAGTCACACATGGGCAGGGCCTGGGATGGAGGTGGGAAGCGGACTGCAGAGACAGCACCTGCGGGACCAGGAGCAGTTCTGTGCGAAGCTCTGGCACCTGGTCCTGGCCCAGCGCTGGATGGAGCGACTCAAGACGGTGGCTGGGTTAAAGATTCGAGAGCTCCTGGAGACTGTCGACACGGAGATTCACTTTGTCACCTCATGTGCCTTCCAGCCCCTCCCCAGCTGCCTCCGCTTCGTCCAGACCAACATCTCCCACCTCCTGCAGGACACTGTGGCTCAGCTGGAGGCCATGAAGCCCTGGATCACCCACAGGAACTTCTCTCAGTGCCTGGAGCTCCGGTGCCAGCCCGACCCCTCCACTCCATTGCCCCCAAGGAGTCCCGGGGCTTTGGAGGCAACAGAGCTGCCCACCCCGCCATCCCACTCCCTGCTCCTGCTGTTGCTGCTGCTGCTGCCCGCCGCCCTCCTGCTGCTGCTCGCCTCCGTCTGGTGTTGGCAGCGGAGGCCGCGATCAAGGTGCAGGGCGCCAGGCCCCCAGGAGCCGGTGCCCCCTCCCTGCAGCCCCCAGGACGTCCCGCTCCTGCAGAGCTGA

XM_004866926.1 Coding sequence

Flt3lg fms-related tyrosine kinase 3 ligand, transcript variant X4

Length: 762 bp    Location: 4739214..4735907   Strand: -
>XM_004866926.1
ATGACAGTGCTGGCGCCAGCCTGGAGACCATCGTGCCCCCTGCTGCTGCTCCTACTGCTCCTGCTGCTGAGCCCCCGCTTGCACGGGACCTCCAGCTGCTCTTTCTCCCACAACCCCATCTCCTCCGACTTCAAAATCAAATTCAGCACACTGTCTGACTACCTGCTCAAGGATTATCCAGTCACTGTGGCCGCCAACCTGCAGGACGTGAGTCACACATGGGCAGGGCCTGGGATGGAGGTGGGAAGCGGACTGCAGAGACAGCACCTGCGGGACCAGGAGCAGTTCTGTGCGAAGCTCTGGCACCTGGTCCTGGCCCAGCGCTGGATGGAGCGACTCAAGACGGTGGCTGGGTTAAAGATTCGAGAGCTCCTGGAGACTGTCGACACGGAGATTCACTTTGTCACCTCATGTGCCTTCCAGGACACTGTGGCTCAGCTGGAGGCCATGAAGCCCTGGATCACCCACAGGAACTTCTCTCAGTGCCTGGAGCTCCGGTGCCAGCCCGACCCCTCCACTCCATTGCCCCCAAGGAGTCCCGGGGCTTTGGAGGCAACAGAGCTGCCCACCCCGCCATCCCACTCCCTGCTCCTGCTGTTGCTGCTGCTGCTGCCCGCCGCCCTCCTGCTGCTGCTCGCCTCCGTCTGGTGTTGGCAGCGGAGGCCGCGATCAAGGTGCAGGGCGCCAGGCCCCCAGGAGCCGGTGAGCCCGCGGGGTGGGGGCGGGGAGGGGCTGGAGCTGGAGGCCCCGCCCCTGGCCTGA

XM_004866929.1 Coding sequence

Pih1d1 PIH1 domain containing 1

High confidence: 4 potential gene matches
Length: 873 bp    Location: 4757477..4761975   Strand: +
>XM_004866929.1
ATGTCGAGCTCAACACTGCTGGAACCAGAGCTGAGGGAGGCAGAGACGCTGGGTGATGAAACGGTGCGGTTCCAAGAGCTGCTGTTGCAGGCTTCCAGGGAGCTCCAGCAAGCCCAGGCAACCACACCAGAATCTACACAGATCCAGCCTCAGCCTGGTTTCTGCATAAAGACCAACTCATCGGAAGGAAAGGTTTTCATCAACATCTGTCACTCTCCCTCCATCCCTCCTCCGGCTGACTTGACCGAGGATGAGCTGCTTCAAATGCTGGAGGAAGACCAAGCTGGGTTTCGAATCCCCATGAGTCTGGGAGAGCCACATGCTGAGCTGGATGCAAAAGGCCAGGGCTGTACTGCCTATGATGTAGCTGTCAACAGCGACTTCTACCGGAGGATGCAGAACAGCAATTTCCTGCGGGAGCTCGTGGTCACCATCGCCAGGGAGGGCCTTGAGGACAAATACGGCTTGCAGCTGAATCCAGAATGGCGCATGTTGAAGAACCGGACTTTCCTGGGCTCCATCTCGCAGCAGAACATCCGCTCCAAGCAGCATCCTCGGATCCAGGAGCTGGGGAACCTACACATGCCTGGCCCCCGGGGGCCTGAGGGAGGCCCTGAGAAGCCGCACCTGAGCCTTTGGCTGGAAGCCCCCGATCTCCTCTTGGCTGAAATTGACCTCCCCAAACTGGATGGAGCCTTGGGGCTGTCCCTGGAGATTGGGGAGAACCGTCTGGCAATGGGGGGCTCCCAGCAGCTGTATCACCTGGATGCCTACATCCCCCTGCGGATCAACTCCGAGGAGAGCAAAGCAGCCTTCCACCGGAAGCGGAAGCAACTGATGGTGGCCATGCCCCTTCTACCGGTGCCTTCTTAA

XM_004866927.1 Coding sequence

Flt3lg fms-related tyrosine kinase 3 ligand, transcript variant X5

Length: 690 bp    Location: 4739214..4735907   Strand: -
>XM_004866927.1
ATGACAGTGCTGGCGCCAGCCTGGAGACCATCGTGCCCCCTGCTGCTGCTCCTACTGCTCCTGCTGCTGAGCCCCCGCTTGCACGGGACCTCCAGCTGCTCTTTCTCCCACAACCCCATCTCCTCCGACTTCAAAATCAAATTCAGCACACTGGAGCAGTTCTGTGCGAAGCTCTGGCACCTGGTCCTGGCCCAGCGCTGGATGGAGCGACTCAAGACGGTGGCTGGGTTAAAGATTCGAGAGCTCCTGGAGACTGTCGACACGGAGATTCACTTTGTCACCTCATGTGCCTTCCAGCCCCTCCCCAGCTGCCTCCGCTTCGTCCAGACCAACATCTCCCACCTCCTGCAGGACACTGTGGCTCAGCTGGAGGCCATGAAGCCCTGGATCACCCACAGGAACTTCTCTCAGTGCCTGGAGCTCCGGTGCCAGCCCGACCCCTCCACTCCATTGCCCCCAAGGAGTCCCGGGGCTTTGGAGGCAACAGAGCTGCCCACCCCGCCATCCCACTCCCTGCTCCTGCTGTTGCTGCTGCTGCTGCCCGCCGCCCTCCTGCTGCTGCTCGCCTCCGTCTGGTGTTGGCAGCGGAGGCCGCGATCAAGGTGCAGGGCGCCAGGCCCCCAGGAGCCGGTGAGCCCGCGGGGTGGGGGCGGGGAGGGGCTGGAGCTGGAGGCCCCGCCCCTGGCCTGA

XM_004866928.1 Coding sequence

Flt3lg fms-related tyrosine kinase 3 ligand, transcript variant X6

Length: 690 bp    Location: 4739214..4735907   Strand: -
>XM_004866928.1
ATGACAGTGCTGGCGCCAGCCTGGAGACCATCGTGCCCCCTGCTGCTGCTCCTACTGCTCCTGCTGCTGAGCCCCCGCTTGCACGGGACCTCCAGCTGCTCTTTCTCCCACAACCCCATCTCCTCCGACTTCAAAATCAAATTCAGCACACTGTCTGACTACCTGCTCAAGGATTATCCAGTCACTGTGGCCGCCAACCTGCAGGACGAGCAGTTCTGTGCGAAGCTCTGGCACCTGGTCCTGGCCCAGCGCTGGATGGAGCGACTCAAGACGGTGGCTGGGTTAAAGATTCGAGAGCTCCTGGAGACTGTCGACACGGAGATTCACTTTGTCACCTCATGTGCCTTCCAGGACACTGTGGCTCAGCTGGAGGCCATGAAGCCCTGGATCACCCACAGGAACTTCTCTCAGTGCCTGGAGCTCCGGTGCCAGCCCGACCCCTCCACTCCATTGCCCCCAAGGAGTCCCGGGGCTTTGGAGGCAACAGAGCTGCCCACCCCGCCATCCCACTCCCTGCTCCTGCTGTTGCTGCTGCTGCTGCCCGCCGCCCTCCTGCTGCTGCTCGCCTCCGTCTGGTGTTGGCAGCGGAGGCCGCGATCAAGGTGCAGGGCGCCAGGCCCCCAGGAGCCGGTGAGCCCGCGGGGTGGGGGCGGGGAGGGGCTGGAGCTGGAGGCCCCGCCCCTGGCCTGA

XM_004866917.1 Coding sequence

Fcgrt Fc fragment of IgG, receptor, transporter, alpha, transcript variant X3

High confidence: 4 potential gene matches
Length: 1122 bp    Location: 4718964..4710212   Strand: -
>XM_004866917.1
ATGGGGGAGCCCCGGCCGCAGCCCTGGGCGCTCAGTCTCCTGCTCCTGCTCCTGTTCCTGCCTCAGACCTCGGGCGCAGAGAACCATCTGTGCCTCCTGTACCACCTCACAGCTGTGTCGTCCCCTGCCTCAGGGTCACCTGCCTTCTGGGTGTCAGGCTGGCTGGGGCCACAGCAGTACCTGAGCTACAGCAGCCTGCGCAAGGAGGCCGAGCCCTGCGGGGCCTGGGTCTGGGAAAAACAGGTGTCCTGGTACTGGGAGGAGGAGACGACAGACCTGAGAAACAAGGAGAGGCTCTTCCTGGACGCTCTCAAAGCCCTGGAGGAAAAAGCCACCCCAGGTCCCTACACCCTGCAGGGCCTGCTGGGCTGTGAGCTGAGCTCTGACAACACTTCGGTGCCCACTGCCCTGTTCGCCCTGAACGGCGAGGACCTCATGCAGTTCCACCCCAGGAACGGCACCTGGACGGGTGACTGGCCCGAGGCCCTGGCCATCAGCACAAAGTGGCAGCAGCAGGCCGAGGCCGTGGACAAGGAGAGGACCTTCCTGCTCAGCTCCTGCCCGCAGCGGCTGCTGGGCCACCTGGAGCGGGGTCACAGGAACCTGGAGTGGAAGGAGCCGCCTTCCATGCGCCTGAAGGCCCGGCCTGACATCAATGGCTTCTCCGTGCTCACCTGCAGCGCCTTTTCCTTCTACCCCCCGGAGCTGCAGCTGCGCTTCCTGCGCAACGGGCTGGCAGCCGGCACCGGGGTGGGTGGCTTCGGCCCCAACGGCGATGGCTCCTTCCACGCGTGGTCATCGCTCCAGGTGCAGCGCGGGGATGAGCACCACTACCGCTGCCTGGTGCAGCACGCTGGGCTGCAGAAGCCGCTCTTAGTGGAGCTGGAGTCGCCGGCAGAGTCCTCCGTGCCGGTGGTGGTGGGCCTTGTCATGGGCTTCCTGGTGCTCGCAGCGGCGGCCGTGGGAGGAGCCCTGCTGTGGCGGAGGACGCGGAGCGGGCTGCCAGGTGAGGCAGGCGGTGAGCCTCAGCGCACACGCAGCTGGGGTCAGAGGCTTGGAGAAAGGGACCGGGGGAGGTGGGACCAGAGCGGAGCGGAGTGGGAGACAGAGGCCCAGAGGTAG

XM_004866920.1 Coding sequence

Rpl13a ribosomal protein L13a, transcript variant X3

Length: 606 bp    Location: 4732321..4728298   Strand: -
>XM_004866920.1
ATGGCCGAGGCCATCTCCTGGGCCGTCTGGCGGCCATCGTGGCCAAGCAGGTTCTGCTCGGCCGGAAGGTGGTGGTTGTGCGCTGCGAGGGCATCAACATTTCTGGCAACTTCTACAGAAACAAGTGCGTACTGTGCTCTCCCCCCAGTAAAGTACCTGGCCTTCCTCCGCAAGCGGATGAACACCAACCCGTCCCGCGGCCCCTACCACTTCCGGGCCCCCAGCCGCATCTTCTGGCGGACCGTGCGAGGTATGCTGCCACACAAGACCAAACGAGGCCAGGCAGCCCTGGACCGCCTCAAGGTGTTCGATGGGATCCCGCCACCCTATGACAAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTGGTCCGCCTGAAGCCTACAAGGAAGTTTGCCTACCTGGGCCGCCTGGCTCATGAGGTTGGCTGGAAGTATCAGGCGGTGACAGCCACCCTGGAGGAGAAAAGGAAGGAGAAGGCCAAGATCCACTACCGGAAGAAGAAACAGATTATGAGGCTACGGAAACAGGCCGAAAAGAACGTGGAAAAGAAAATCAGCAAGTTCACAGAGGTCCTCAAGACCCACGGACTCCTGGTCTGA

XM_004866918.1 Coding sequence

Rpl13a ribosomal protein L13a, transcript variant X1

Length: 684 bp    Location: 4732321..4728298   Strand: -
>XM_004866918.1
ATGTGGCCCGGCTGGGGCCGGTCCAGCTGTCATTCTCTTAACGCCTCTCACCACATCTCTCACAGGTCCTGGTGCTGGATGGCCGAGGCCATCTCCTGGGCCGTCTGGCGGCCATCGTGGCCAAGCAGGTTCTGCTCGGCCGGAAGGTGGTGGTTGTGCGCTGCGAGGGCATCAACATTTCTGGCAACTTCTACAGAAACAAGTGCGTACTGTGCTCTCCCCCCAGTAAAGTACCTGGCCTTCCTCCGCAAGCGGATGAACACCAACCCGTCCCGCGGCCCCTACCACTTCCGGGCCCCCAGCCGCATCTTCTGGCGGACCGTGCGAGGTATGCTGCCACACAAGACCAAACGAGGCCAGGCAGCCCTGGACCGCCTCAAGGTGTTCGATGGGATCCCGCCACCCTATGACAAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTGGTCCGCCTGAAGCCTACAAGGAAGTTTGCCTACCTGGGCCGCCTGGCTCATGAGGTTGGCTGGAAGTATCAGGCGGTGACAGCCACCCTGGAGGAGAAAAGGAAGGAGAAGGCCAAGATCCACTACCGGAAGAAGAAACAGATTATGAGGCTACGGAAACAGGCCGAAAAGAACGTGGAAAAGAAAATCAGCAAGTTCACAGAGGTCCTCAAGACCCACGGACTCCTGGTCTGA

XM_004866919.1 Coding sequence

Rpl13a ribosomal protein L13a, transcript variant X2

Length: 612 bp    Location: 4732367..4728298   Strand: -
>XM_004866919.1
ATGGCGGAGGGGCAGGTCCTGGTGCTGGATGGCCGAGGCCATCTCCTGGGCCGTCTGGCGGCCATCGTGGCCAAGCAGGTTCTGCTCGGCCGGAAGGTGGTGGTTGTGCGCTGCGAGGGCATCAACATTTCTGGCAACTTCTACAGAAACAAGTTAAAGTACCTGGCCTTCCTCCGCAAGCGGATGAACACCAACCCGTCCCGCGGCCCCTACCACTTCCGGGCCCCCAGCCGCATCTTCTGGCGGACCGTGCGAGGTATGCTGCCACACAAGACCAAACGAGGCCAGGCAGCCCTGGACCGCCTCAAGGTGTTCGATGGGATCCCGCCACCCTATGACAAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTGGTCCGCCTGAAGCCTACAAGGAAGTTTGCCTACCTGGGCCGCCTGGCTCATGAGGTTGGCTGGAAGTATCAGGCGGTGACAGCCACCCTGGAGGAGAAAAGGAAGGAGAAGGCCAAGATCCACTACCGGAAGAAGAAACAGATTATGAGGCTACGGAAACAGGCCGAAAAGAACGTGGAAAAGAAAATCAGCAAGTTCACAGAGGTCCTCAAGACCCACGGACTCCTGGTCTGA

XM_004866646.1 Coding sequence

Isoc2 isochorismatase domain containing 2, transcript variant X2

Length: 519 bp    Location: 1891535..1896755   Strand: +
>XM_004866646.1
ATGGCAGCAGCCAGGCCGGGCCTGGGCCGAATCCTCCCAGGATCGTCCATCCTATTCCTGTGCGACATGCAGGAGAAGTTCCGCCACAGCATCGCGTACTTCCCGGAGGTGGTGGCCGTGGCCGCACGGATGCTCAGGGCATCCCGGCTTCTGGAGGTCCCAGCTGTGCTGACGGAGCAATATCCCCAAGGCCTGGGCCCCACGGTTCCAGAGCTGGGTGCTGAGGGCCTCCCAGCCCTGAGTAAAACCTGCTTCAGCATGGTGCCTGCCGTGCAGCAGGAGCTGGACAGCCGGCCCCAGCTTCAGTCCGTGCTGCTCTGCGGCATCGAGGCGCAGGCCTGCATCCTGAACACAGCTCTCGACCTGCTGGACAGGGGACTGCAGGTCCACGTCGTGGTGGACGCCTGCTCCTCTCGAAGATCCAGAAGATCATTAAGGAGCCCGCTCCGGACAGCGGGCTGCTGGGTCTCTTCCAAGGCCAGAAGCCCCTCTTCTGATGAACTCAGGACCCTGACTTGA

XM_004866911.1 Coding sequence

Prrg2 proline rich Gla (G-carboxyglutamic acid) 2, transcript variant X2

Length: 600 bp    Location: 4674386..4667974   Strand: -
>XM_004866911.1
ATGAGGAGCCACCCTTCCCTGCTGCTGCTCTATATGGGATTGGCTGTCTGCCTGGATTCCTCACCCAGTGAAAAGCAAGACCAAGGCCCAGAAGTCTTCCTTGCCCATCCAGTGGCCCATAGGTTCCTGGGGGCCCTCAGGCGGGTCCCACGAGCCAATAACTGGGACCTGGAGCTGTTCACCCAGGGGAACCTGGAGCGGGAGTGCATCGAGGAGCAGTGTTCCTGGGAGGAGGCCAGGGAGTGCTTTGAGGACAACACCCTGACGAAGCGCTTTTGGGAGACCTACCCCTACAATGGCAAAGGAGGGCATAGACAAGTGGACGGAGCAGCCCTGGCTGTGGGGCTGACATCTGGCATCCTGCTCATCGTGTTGGTTGGCCTGGGAGCCTTCTGGTATCTGCATTATCAGCGGCGGCACCAGAACCCAAGGCAGCAGCTGAGTCCCCAAGAGAGCAGCCTCATCAGCCCTCTGAGCCCACCGACTCCCCTGCCTCCACCTGGACCGCCAGGCCTCCCCACCTACGAACAGGCGCTGGCGGCCTCTGGGGTGCACGACGCACCTCCACCCCCTTACTCAAGCCTCAGGAGGCCTCAGTGA

XM_004866910.1 Coding sequence

Prrg2 proline rich Gla (G-carboxyglutamic acid) 2, transcript variant X1

Length: 600 bp    Location: 4674386..4667974   Strand: -
>XM_004866910.1
ATGAGGAGCCACCCTTCCCTGCTGCTGCTCTATATGGGATTGGCTGTCTGCCTGGATTCCTCACCCAGTGAAAAGCAAGACCAAGGCCCAGAAGTCTTCCTTGCCCATCCAGTGGCCCATAGGTTCCTGGGGGCCCTCAGGCGGGTCCCACGAGCCAATAACTGGGACCTGGAGCTGTTCACCCAGGGGAACCTGGAGCGGGAGTGCATCGAGGAGCAGTGTTCCTGGGAGGAGGCCAGGGAGTGCTTTGAGGACAACACCCTGACGAAGCGCTTTTGGGAGACCTACCCCTACAATGGCAAAGGAGGGCATAGACAAGTGGACGGAGCAGCCCTGGCTGTGGGGCTGACATCTGGCATCCTGCTCATCGTGTTGGTTGGCCTGGGAGCCTTCTGGTATCTGCATTATCAGCGGCGGCACCAGAACCCAAGGCAGCAGCTGAGTCCCCAAGAGAGCAGCCTCATCAGCCCTCTGAGCCCACCGACTCCCCTGCCTCCACCTGGACCGCCAGGCCTCCCCACCTACGAACAGGCGCTGGCGGCCTCTGGGGTGCACGACGCACCTCCACCCCCTTACTCAAGCCTCAGGAGGCCTCAGTGA

XM_004866912.1 Coding sequence

Prrg2 proline rich Gla (G-carboxyglutamic acid) 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 600 bp    Location: 4674861..4667974   Strand: -
>XM_004866912.1
ATGAGGAGCCACCCTTCCCTGCTGCTGCTCTATATGGGATTGGCTGTCTGCCTGGATTCCTCACCCAGTGAAAAGCAAGACCAAGGCCCAGAAGTCTTCCTTGCCCATCCAGTGGCCCATAGGTTCCTGGGGGCCCTCAGGCGGGTCCCACGAGCCAATAACTGGGACCTGGAGCTGTTCACCCAGGGGAACCTGGAGCGGGAGTGCATCGAGGAGCAGTGTTCCTGGGAGGAGGCCAGGGAGTGCTTTGAGGACAACACCCTGACGAAGCGCTTTTGGGAGACCTACCCCTACAATGGCAAAGGAGGGCATAGACAAGTGGACGGAGCAGCCCTGGCTGTGGGGCTGACATCTGGCATCCTGCTCATCGTGTTGGTTGGCCTGGGAGCCTTCTGGTATCTGCATTATCAGCGGCGGCACCAGAACCCAAGGCAGCAGCTGAGTCCCCAAGAGAGCAGCCTCATCAGCCCTCTGAGCCCACCGACTCCCCTGCCTCCACCTGGACCGCCAGGCCTCCCCACCTACGAACAGGCGCTGGCGGCCTCTGGGGTGCACGACGCACCTCCACCCCCTTACTCAAGCCTCAGGAGGCCTCAGTGA

XM_004866908.1 Coding sequence

Nosip nitric oxide synthase interacting protein, transcript variant X2

Length: 1224 bp    Location: 4674405..4689995   Strand: +
>XM_004866908.1
ATGCCTAATACTATACGTACTACGCAATCCCTATATGCATTCCAGTTTCATTATCCGGAACCTTCTAGCTGCAACTCACGTTTCCGGAGGGAGGAAGAAAAGAAGAAAGGACTTACCAAGCCTGGCGAGGTACTTCGGCAACTAGGGGCAGCCTTATTTCCGGTCTGTACTACTAGGCGGAAGGAGGCGGAACGGAGGGAAAGAGCAACACTCCCTTCCGGTGTAGTGGCTCAGCAGCGACGAGAGAACGAGGAGTCGTTTGTGAGGATGACTCGGCATGGCAAGAACTGCACAGCGGGGGCGGTGTACACCTATCACGAGAAGAAGAAGGACACAGCGGCCTCAGGCTATGGGACCCAGAACATCCGACTGAGCCGCGATGCAGTGAAGGACTTCGACTGCTGCTGCCTGTCTTTGCAGCCCTGCCATGACCCTGTTGTCACCCCAGATGGCTACCTGTATGAGCGTGAGGCTATCCTGGAGTACATTCTGCACCAGAAGAGGGAGATTGCCCGGCAGATGAAGGCCTACGAGAAGCAGCGCGGCGCGCGGCGTGAGGAGCAGAAGCAGCTGCATCGGGCGGCGGCGCAGGACCAGGTGCGAGGCTTCCTGGAGAAGGAGGCGGCCATCGTGAGCCGCCCACTCAACCCTTTCGAGGCCAAGGTGGCCGAGGGCCCCGGCTCAGATGACGCGAAGCCCGGGCCCAGCGCGGGGGCTCCAGGCAAGGCGAAGGAGAAGGACAAGGAGCTGCCCAGCTTCTGGATCCCGTCACTGACTCCCGAGGCCAAGGCCACCAAGCTGGAGAAGCCGTCGCGCACCGTCGCCTGCCCCATGTCCGGGAAGCCGTTGCGCATGGCGGACCTGACGCCCGTGCGCTTCACGCTGCTCGACGACTCCGTGGACCGCGTGGGGCTCATCACGCGCAGCGAGCGCTACGTGTGCGCCGTGACCCGCGACAGTCTCAGCAACGCCACACCGTGCGCCGTGCTGAGGCCCTCCGGGGCCGTGGTCACCCTCGAATGTGTGGAGAAGCTGATTCGCAAGGACATGGTGGACCCGGTGAACGGGGACAAGCTCACGGAGCGTGACATCATCGTGCTGCAGCGCGTGAGCCGCCCGTCCCCTCATCCCCTCCCTTCCCCTTTCCTAGTCTCACCCTTTCACCCCCAAACCCCGCCCAGCTCGGGCCACGCCCTGGGCCGGGCCACGCCTATCCTAGTGTGA

XM_004866906.1 Coding sequence

Prr12 proline rich 12, transcript variant X2

High confidence: 4 potential gene matches
Length: 6069 bp    Location: 4667395..4641028   Strand: -
>XM_004866906.1
ATGGACAGGAACTACCCCAGCGCCGGCTTCGGGGACCCGCTCGGCGCCGGGGCGGGATGGAGTTACGAGAGGTCAGCGAAAGCTAGCTTGGTCTATGGCAGCTCCAGGACCTCACACCCCGAGACGGACATCTTACACCGACAGGCCTACGCGGCCCCCCACCCACTGCAAAGCTATGCCACCAACCACCACCCGGCAGGCCTCTCTGGACTCTTCGACACTGGCCTCCACCACGCGGGCTCAGCAGGGCCCGACGCCTCCGTCATGAACCTCATCTCCGCCCTGGAGTCCCGGGGCCCCCAACCTGGCCCTTCAGCCTCCTCTCTCTTGTCCCAGTTCCGCAGTCCTTCCTGGCAAACAGCCATGCACACTCCAGGCCCCACGGAGCTCTTCATCTCGGGCGCCCTCCCAGGTTCCAGCACCTTCCCATCCTCCTCTGCCCTGTCGGCCTACCAGCACCCGGCTTCCTTCGGCAGCCGCCCCTTCCCAGTGCCCTCGTCCCTCAGCCTCCAGGACCCCCCATTCAGCCCTCCCGCTAATGGGCTCCTGTCCCCTCACGAAGTGCTGCATTTGAAGCCCTCGCAGGCACCCACGGTGCCCTCCTCATTGGGCTTCGAGCGCCTAGCTGGGGGCGGTGTCCTGGGCCCTGCTGGCCTCGGCCCAGCCCAGACGCCACCTTATCGCCCTGGCCCCCCAGATCCACCCCCACCTCCCCGCCACCTCCCAGCTCAGTTCAATCTGCTGGCTTCTTCTTCCGCCGCCGCCGCCGCCGCCGCCGCCGAGCAGTCTTCCCCACAGCTCTACAACTTCTCCGGTGCTGCCCCGGGCCCGCCCCCCCCAGAGCGGGCCTTGCCCCGCCAGGATACCGTCATCAAGCACTACCAGCGGCCAGCCAGTGCCCAGCCCCCGCCACCAGCCCATGCCCTCCAGCACTACCTGAGCTGTGGAGGCAGCTACCCTTCCATGGGCCACCGGGCCAACTTGGCCTGCAGCCCCCTGGGTGGTGGCGAGCCCTCCCCAGGCGCTACTGAACCCAGCAAGGCTGGTCCTAGTGGAGCCACAGCAGGAGCATCAGGCCGGGCCACCGGCCCGGAGGTGGCTGGGGGAGGTGGGGCCGGGGGTGGCGGCGGAGGCTACCGCCCCATCATTCAATCGCCTGGTTATAAGACAGGCAAAGGTGGTTATGGAGCCACGGCAGGGGGTGCCACCAGGCCCCCACCACCCCGCTCGACGGCCACACCCAAATGCCAGAGCCTGGGGGGGCCAGCAGCAGCATATGCCACAGGGAAGGCCTCTGGGGCTGGTGGGGCTGGGGGCCAGGCCTATTCCCCTGGTCAGCCCCAAGGGCTCCTGGGACCCCAGGCCTACGGGCAAGGCTTTGGAGGGGGTCAGGCACAGGACTTGAGCAAAGGCCCCAGCTACTCAGGGGGCCCCCCGCAGCCTCCCAGTGGCCCGCCACCTTCTGGCCTAGCCACATGTCAGAGCTACTCCCCTGACCAACTGCAGGGGCAGCTGTATGGGGTGCAGGGCGAGCCATACCCAGGGCCTGCTGCCCACTCCCAGGGTCTGCCTACGGCCAGTCCCTCCCTCAGCTATAGCACCGGCCATTCCCCAGCACTCTCAGGCCATGGAGGTGGCTGGGGACCCAGCTCCCTGGGAGGTGGTGGGGAGGCCAGCCCCTCTCACATCATTCGTCCACTCCAGTCGCCACCCACCACTGGCCGCCCTCCTGGAGTGGGCTCTCCAGGAGCCCCCGGCAAATACCTGAGCTCAGTCTTAGCTTCAGCCCCATTCCTGGCAACCCCGGGAGGTGGCAGCTATGCAGCCGGAGCGGGCAGCTATAAGGGCAAAGGGGATGGCTCCGACCTGCTGGCCCCAGGTGGCCCCCCGGCCGAGCGCACTGAGGATGAGGAGTTCCTCATTCAGCACCTCCTGCAGGCACCCAGCCCACCGAGGACTTCAGGGGCAGAGGGCTTGGTGGGCGAGGAGGGGTCAGCAGATGCTTCCAAGGGACTTGGGGGTAGTGGTGGGGCTGGGGGACCACCAGGCACACCCTACGAGCTGGCCAAGGAAGACCCCCAGAGGTACCACCTGCAGAGCGTCATCCGCACCAGTGCCAGCCTGGATGAGGGAGCCACTACAGCCCTGGAGCTGGGCCTGGGGAGGCTGAAGGAAAAGAAGAAAGGGCCAGAGCGGGGTGGCGAGACCCCCGAGGGACTGGCCACCTCTGTTGTCCACTATGGGGCGGGTGCCAAGGAGCTAGGGGCCTTCTTGCAAAAGAGTCCACCGCGCCCTCCACCCACGGCTCAGCCCAACCCCCATGGCCTCCTCCTGGAGGCCGGAGGCCCTGACCTCCCCATGGTGCTGCCTCCGCCTCCACCCCAGCTACTCCCCTCGGTCCTCAGCCATGCCCCCAGCCCCTCTCCGAGCACCCCTAAAGTTGGCGTCCACCTCCTTGAACCAGCCCCCCGTGATGGGGCACCCCAGCCACCTCCGCCCCCACCCCCACCCCCCATGCCTCTGCAGCTCGAGGCCCACCTCCGCGGCCACAGCCTGGAGCCTGCGGCACCCAGCCCCCGCCTGCGACCTGAGGACGGCTTGGAGCCTCCTGGTGCCATGCAGGAATTGCTTGGGGCCCTGGAGCCGCTGCCCCCAGGGCCTGGTGATAGTGTGGGCCCCCCTAACTCAGAGGGCAAAGATCCTGCCGGATCCTACCGAAGCCCCAGCCCACAGGGCACCAAGGCTCCGCGCTTCGTGCCACTCACCTCCATCTGCTTCCCTGACTCCTTGCTCCAGGACGAGGAGCGAAGCTTCTTCCCTACCATGGAAGAGATGTTTGGTGGAGGGGCAGCAGATGATTATGGCAAGACTGGGCCACCCGAGGACGAGGAGGATCCCAAGGCAGTTGGGCCACCTCCGGGGCCCCCTGCCTACGACCCCTATGGGCCCTACTGCCCTGGTCGGGCGTCTGGAGCTGGGCCTGAGACACCAGGCCTGGGCCTGGATCCCAACAAGCCGCCCGAGCTGCCCTCCACCGTCAACGCTGAGCCGCTGGGCCTGATCCAGAGCGGGCCACATCAGGCGGCTCCACCTCCACCACCACCTCCACCACCACCTCCCCCATCCGCCTCGGAGCCCAAGGGTGGCCTCACCTCACCCATCTTCTGCTCAACCAAGCCAAAGAAGCTGCTCAAGACGTCCTCCTTTCACCTGCTGCGGCGCCGAGACCCACCCTTCCAGACTCCCAAGAAGCTGTATGCCCAGGAGTATGAGTTCGAGGCCGACGAAGACAAGGCCGACGTCCCTGCTGACATCCGCCTCAACCCCCGGCGCCTGCCTGACCTGGTGTCCAGCTGCCGCTCCCGGCCGGCCCTTTCGCCCCTGGGTGACATTGACTTCTGTCCGCCCAATCCAGGCCCCGATGGCCCCCGGCGCCGAGGCCGCAAGCCCACCAAGGCCAAGCGTGAGGGTCCTCCCCGCCCACGGGGCAGGCCCCGAATCCGCCCCCTGGAGGTGCCCACCGCCACAGGGCCTGCCTTGACTGCCACTGCTGATGGGCCCAAGAAACCTCGGGGCCGGGGCAGGGGCAGGGGCAGGAAGGCAGAGGAGGCAGGAGGCACCCGGTTGGAGCCCCTGAAGCCACTGAAGATCAAGCTGTCTGTGCCCAAGCCAGGTGAGGGTCTGGGAGCCTCGTCAGGTGATGCCATATCAGGCCCCGACCACAACAGCCTAGACTCCAGCCTGACTCGGGAGAAGATTGAGGCCAAGATCAAGGAGGTAGAAGAGAAGCAGCCGGAGATGAAGTCAGGCTTCATGGCTTCCTTCCTGGACTTCCTCAAGTCAGGCAAGCGCCACCCACCACTCTATCAGGCGGGCTTGACGCCGCCGCTCAGTCCGCCCAAGAGCGTGCCATCCTCTGTGCCAGCCCGAGGCTTGCAGCCCCAGGCACCCGCTGCTCCTGCAGTGCCGCATCCTCCACCTGAGGGCGCCTTTGGGCTGGGGGGTGCCCTGGAGGCCGCTGAGAGTGAGGGGCTGGGGCTGGGCTGCCCTTCGCCCTGCAAGCGGCTGGACGAGGAGCTGAAGCGGAACCTTGAGACTCTGCCCTCTTTCTCCTCGGATGAGGAAGACTCTGTGGCCAAGAACCGGGACCTGCAGGAGAGCATCTCGTCTGCCATCTCTGCCCTGGATGACCCACCTCTCACTGGGCCTAAGGATACTTCCACCCCGGAGGGGCCACCTTTGGCCACAGCAGCGACAGTCACGGGGCCACCCCCTCTCCCAGGGCTCCCCAGTGCCAACAGCAATGGCACGCCCGAGCCCCCGCTGCTGGAGGAGAAACCCCCACCCTCCCCACCTCCTGCCCCGACGCCGACGCCTCCACCTCCGCCCCCCCCTCTGCCAGCGCCAGTGCCAGCGCCAGTCCTGCCCGATCCGCCCCCACTGGTTGCCCCTGTGCCTAGCTCGCCGCCTCCTCCACCTCCGCCACCGCCTCCACCTCCGCCGGCCCTGCCCTCTCCGCCCCCGCCTGCCACTGCCCCGCCAGCACCCCCTCCCGAGGAGCCTGCCGCCCCGTCCCCCGAGGACCCCGAGCCACCGGACGCCCGGCCCTTGCACCTGGCCAAGAAGCAAGAGACTGCGGCCGTGTGCGGGGAGACCGACGAGGAGGCCGGGGAGAGCGGCGGCGAGGGCATCTTCCGGGAGCGGGACGAGTTTGTCATCCGTGCGGAGGACATCCCGTCCCTCAAGCTGGCGCTGCAGACAGGGCGTGAGCCCCCGCCCATCTGGCGCGTGCAGAAGGCCCTTCTGCAGAAGTTCACTCCTGAGATCAAGGACGGCCAGCGACAGTTTTGTGCCACCAGTAATTATTTGGGGTATTTTGGGGATGCAAAAAATCGGTACCAGCGACTGTATGTCAAGTTCCTGGAGAACGTCAATAAGAAGGATTACGTGAGGGTCTGTGCGCGGAAACCCTGGCACCGGCCCCCAGTGCCTGTGAGGCGCTCGGGGCAGACCAAGGGCCCTGCATCCGCGCCTCCTCCCAAGGCCCCAGCACCACCTCCCAAGCCTGAGCTGCCGGAGAAGGCACCATCGGAAAAGCCCCCAGAGCAGACACCCCAGACAGCTGTCCCTGAGGCTCCGGCCCCTGAGAAGCCATCGGCACCGCGGCCTGCAGAGAAGGACAAGGACAAGGAGCGGGTGACACGAGGAGAGCGGCCGTCACGGGGCGAGCGGGGCGCAGGTGGGCGGCAGACCCGCCCTGAGCGCAGCCTTGCCACGGCCCAGCCCCCTACTGCCCGGCCCCCCAAGGCCCGGCCCCCCAAGGTGAAGGCTGAGCCGCCCCCTAAGAAGAGGAAGAAGTGGCTGAAGGAGGCAGTGGGCAATGCCTCGTCAGGTGGGGGTCCGGCAGGCAGCTCCTCGGACTCGGATTCCTCACCTGGAGCTCCCAGCGAGGACGAGCGGGCGGTACCAGGGCGTCTTCTAAAGACCCGGGCAATGCGGGAGATGTACCGGAGCTATGTGGAGATGCTGGTGAGCACGGCCCTTGACCCGGACATGATCCAGGCCCTGGAGGACACGCACGATGAGCTATACCTCCCACCCATGCGGAAGATCGATGGCCTCCTCAATGAGCACAAGAAAAAAGTCCTTAAGCGGCTGTCGTTGAGCCCTGCCCTACAGGACGCCCTGCACACGTTCCCTCAGCTTCAAGTGGAGCAGAGTGGGGAGGGCTCCCCCGAAGAGGGCGCCGTGCGGCTACGGCCAGCCGGGGAGCCCTACAACCGCAAGACCCTGAGCAAGCTCAAGAGGAGTGTGGTGCGAGCCCAGGAGTTCAAGGTGGAGCTGGAGAAGTCAGGATACTACACACTCTACCATTCCCTCCACCACTACAAATACCACACCTTCCTGCGCTGCCGGGACCAGACCCTGGCCATCGAGGGCGGCGCCGAGGACCTGGGCCAGGAGGAGGTGGTCCAGCAGTGCATGCGGAACCAGCCGTGGCTGGAGCAGCTCTTCGACTCGTTCAGCGACCTGCTGGCCCAAGCACAGGCCCACAGCCGCTGTGGGTGA

XM_004866905.1 Coding sequence

Prr12 proline rich 12, transcript variant X1

Length: 6126 bp    Location: 4667395..4642093   Strand: -
>XM_004866905.1
ATGGACAGGAACTACCCCAGCGCCGGCTTCGGGGACCCGCTCGGCGCCGGGGCGGGATGGAGTTACGAGAGGTCAGCGAAAGCTAGCTTGGTCTATGGCAGCTCCAGGACCTCACACCCCGAGACGGACATCTTACACCGACAGGCCTACGCGGCCCCCCACCCACTGCAAAGCTATGCCACCAACCACCACCCGGCAGGCCTCTCTGGACTCTTCGACACTGGCCTCCACCACGCGGGCTCAGCAGGGCCCGACGCCTCCGTCATGAACCTCATCTCCGCCCTGGAGTCCCGGGGCCCCCAACCTGGCCCTTCAGCCTCCTCTCTCTTGTCCCAGTTCCGCAGTCCTTCCTGGCAAACAGCCATGCACACTCCAGGCCCCACGGAGCTCTTCATCTCGGGCGCCCTCCCAGGTTCCAGCACCTTCCCATCCTCCTCTGCCCTGTCGGCCTACCAGCACCCGGCTTCCTTCGGCAGCCGCCCCTTCCCAGTGCCCTCGTCCCTCAGCCTCCAGGACCCCCCATTCAGCCCTCCCGCTAATGGGCTCCTGTCCCCTCACGAAGTGCTGCATTTGAAGCCCTCGCAGGCACCCACGGTGCCCTCCTCATTGGGCTTCGAGCGCCTAGCTGGGGGCGGTGTCCTGGGCCCTGCTGGCCTCGGCCCAGCCCAGACGCCACCTTATCGCCCTGGCCCCCCAGATCCACCCCCACCTCCCCGCCACCTCCCAGCTCAGTTCAATCTGCTGGCTTCTTCTTCCGCCGCCGCCGCCGCCGCCGCCGCCGAGCAGTCTTCCCCACAGCTCTACAACTTCTCCGGTGCTGCCCCGGGCCCGCCCCCCCCAGAGCGGGCCTTGCCCCGCCAGGATACCGTCATCAAGCACTACCAGCGGCCAGCCAGTGCCCAGCCCCCGCCACCAGCCCATGCCCTCCAGCACTACCTGAGCTGTGGAGGCAGCTACCCTTCCATGGGCCACCGGGCCAACTTGGCCTGCAGCCCCCTGGGTGGTGGCGAGCCCTCCCCAGGCGCTACTGAACCCAGCAAGGCTGGTCCTAGTGGAGCCACAGCAGGAGCATCAGGCCGGGCCACCGGCCCGGAGGTGGCTGGGGGAGGTGGGGCCGGGGGTGGCGGCGGAGGCTACCGCCCCATCATTCAATCGCCTGGTTATAAGACAGGCAAAGGTGGTTATGGAGCCACGGCAGGGGGTGCCACCAGGCCCCCACCACCCCGCTCGACGGCCACACCCAAATGCCAGAGCCTGGGGGGGCCAGCAGCAGCATATGCCACAGGGAAGGCCTCTGGGGCTGGTGGGGCTGGGGGCCAGGCCTATTCCCCTGGTCAGCCCCAAGGGCTCCTGGGACCCCAGGCCTACGGGCAAGGCTTTGGAGGGGGTCAGGCACAGGACTTGAGCAAAGGCCCCAGCTACTCAGGGGGCCCCCCGCAGCCTCCCAGTGGCCCGCCACCTTCTGGCCTAGCCACATGTCAGAGCTACTCCCCTGACCAACTGCAGGGGCAGCTGTATGGGGTGCAGGGCGAGCCATACCCAGGGCCTGCTGCCCACTCCCAGGGTCTGCCTACGGCCAGTCCCTCCCTCAGCTATAGCACCGGCCATTCCCCAGCACTCTCAGGCCATGGAGGTGGCTGGGGACCCAGCTCCCTGGGAGGTGGTGGGGAGGCCAGCCCCTCTCACATCATTCGTCCACTCCAGTCGCCACCCACCACTGGCCGCCCTCCTGGAGTGGGCTCTCCAGGAGCCCCCGGCAAATACCTGAGCTCAGTCTTAGCTTCAGCCCCATTCCTGGCAACCCCGGGAGGTGGCAGCTATGCAGCCGGAGCGGGCAGCTATAAGGGCAAAGGGGATGGCTCCGACCTGCTGGCCCCAGGTGGCCCCCCGGCCGAGCGCACTGAGGATGAGGAGTTCCTCATTCAGCACCTCCTGCAGGCACCCAGCCCACCGAGGACTTCAGGGGCAGAGGGCTTGGTGGGCGAGGAGGGGTCAGCAGATGCTTCCAAGGGACTTGGGGGTAGTGGTGGGGCTGGGGGACCACCAGGCACACCCTACGAGCTGGCCAAGGAAGACCCCCAGAGGTACCACCTGCAGAGCGTCATCCGCACCAGTGCCAGCCTGGATGAGGGAGCCACTACAGCCCTGGAGCTGGGCCTGGGGAGGCTGAAGGAAAAGAAGAAAGGGCCAGAGCGGGGTGGCGAGACCCCCGAGGGACTGGCCACCTCTGTTGTCCACTATGGGGCGGGTGCCAAGGAGCTAGGGGCCTTCTTGCAAAAGAGTCCACCGCGCCCTCCACCCACGGCTCAGCCCAACCCCCATGGCCTCCTCCTGGAGGCCGGAGGCCCTGACCTCCCCATGGTGCTGCCTCCGCCTCCACCCCAGCTACTCCCCTCGGTCCTCAGCCATGCCCCCAGCCCCTCTCCGAGCACCCCTAAAGTTGGCGTCCACCTCCTTGAACCAGCCCCCCGTGATGGGGCACCCCAGCCACCTCCGCCCCCACCCCCACCCCCCATGCCTCTGCAGCTCGAGGCCCACCTCCGCGGCCACAGCCTGGAGCCTGCGGCACCCAGCCCCCGCCTGCGACCTGAGGACGGCTTGGAGCCTCCTGGTGCCATGCAGGAATTGCTTGGGGCCCTGGAGCCGCTGCCCCCAGGGCCTGGTGATAGTGTGGGCCCCCCTAACTCAGAGGGCAAAGATCCTGCCGGATCCTACCGAAGCCCCAGCCCACAGGGCACCAAGGCTCCGCGCTTCGTGCCACTCACCTCCATCTGCTTCCCTGACTCCTTGCTCCAGGACGAGGAGCGAAGCTTCTTCCCTACCATGGAAGAGATGTTTGGTGGAGGGGCAGCAGATGATTATGGCAAGACTGGGCCACCCGAGGACGAGGAGGATCCCAAGGCAGTTGGGCCACCTCCGGGGCCCCCTGCCTACGACCCCTATGGGCCCTACTGCCCTGGTCGGGCGTCTGGAGCTGGGCCTGAGACACCAGGCCTGGGCCTGGATCCCAACAAGCCGCCCGAGCTGCCCTCCACCGTCAACGCTGAGCCGCTGGGCCTGATCCAGAGCGGGCCACATCAGGCGGCTCCACCTCCACCACCACCTCCACCACCACCTCCCCCATCCGCCTCGGAGCCCAAGGGTGGCCTCACCTCACCCATCTTCTGCTCAACCAAGCCAAAGAAGCTGCTCAAGACGTCCTCCTTTCACCTGCTGCGGCGCCGAGACCCACCCTTCCAGACTCCCAAGAAGCTGTATGCCCAGGAGTATGAGTTCGAGGCCGACGAAGACAAGGCCGACGTCCCTGCTGACATCCGCCTCAACCCCCGGCGCCTGCCTGACCTGGTGTCCAGCTGCCGCTCCCGGCCGGCCCTTTCGCCCCTGGGTGACATTGACTTCTGTCCGCCCAATCCAGGCCCCGATGGCCCCCGGCGCCGAGGCCGCAAGCCCACCAAGGCCAAGCGTGAGGGTCCTCCCCGCCCACGGGGCAGGCCCCGAATCCGCCCCCTGGAGGTGCCCACCGCCACAGGGCCTGCCTTGACTGCCACTGCTGATGGGCCCAAGAAACCTCGGGGCCGGGGCAGGGGCAGGGGCAGGAAGGCAGAGGAGGCAGGAGGCACCCGGTTGGAGCCCCTGAAGCCACTGAAGATCAAGCTGTCTGTGCCCAAGCCAGGTGAGGGTCTGGGAGCCTCGTCAGGTGATGCCATATCAGGCCCCGACCACAACAGCCTAGACTCCAGCCTGACTCGGGAGAAGATTGAGGCCAAGATCAAGGAGGTAGAAGAGAAGCAGCCGGAGATGAAGTCAGGCTTCATGGCTTCCTTCCTGGACTTCCTCAAGTCAGGCAAGCGCCACCCACCACTCTATCAGGCGGGCTTGACGCCGCCGCTCAGTCCGCCCAAGAGCGTGCCATCCTCTGTGCCAGCCCGAGGCTTGCAGCCCCAGGCACCCGCTGCTCCTGCAGTGCCGCATCCTCCACCTGAGGGCGCCTTTGGGCTGGGGGGTGCCCTGGAGGCCGCTGAGAGTGAGGGGCTGGGGCTGGGCTGCCCTTCGCCCTGCAAGCGGCTGGACGAGGAGCTGAAGCGGAACCTTGAGACTCTGCCCTCTTTCTCCTCGGATGAGGAAGACTCTGTGGCCAAGAACCGGGACCTGCAGGAGAGCATCTCGTCTGCCATCTCTGCCCTGGATGACCCACCTCTCACTGGGCCTAAGGATACTTCCACCCCGGAGGGGCCACCTTTGGCCACAGCAGCGACAGTCACGGGGCCACCCCCTCTCCCAGGGCTCCCCAGTGCCAACAGCAATGGCACGCCCGAGCCCCCGCTGCTGGAGGAGAAACCCCCACCCTCCCCACCTCCTGCCCCGACGCCGACGCCTCCACCTCCGCCCCCCCCTCTGCCAGCGCCAGTGCCAGCGCCAGTCCTGCCCGATCCGCCCCCACTGGTTGCCCCTGTGCCTAGCTCGCCGCCTCCTCCACCTCCGCCACCGCCTCCACCTCCGCCGGCCCTGCCCTCTCCGCCCCCGCCTGCCACTGCCCCGCCAGCACCCCCTCCCGAGGAGCCTGCCGCCCCGTCCCCCGAGGACCCCGAGCCACCGGACGCCCGGCCCTTGCACCTGGCCAAGAAGCAAGAGACTGCGGCCGTGTGCGGGGAGACCGACGAGGAGGCCGGGGAGAGCGGCGGCGAGGGCATCTTCCGGGAGCGGGACGAGTTTGTCATCCGTGCGGAGGACATCCCGTCCCTCAAGCTGGCGCTGCAGACAGGGCGTGAGCCCCCGCCCATCTGGCGCGTGCAGAAGGCCCTTCTGCAGAAGTTCACTCCTGAGATCAAGGACGGCCAGCGACAGTTTTGTGCCACCAGTAATTATTTGGGGTATTTTGGGGATGCAAAAAATCGGTACCAGCGACTGTATGTCAAGTTCCTGGAGAACGTCAATAAGAAGGATTACGTGAGGGTCTGTGCGCGGAAACCCTGGCACCGGCCCCCAGTGCCTGTGAGGCGCTCGGGGCAGACCAAGGGCCCTGCATCCGCGCCTCCTCCCAAGGCCCCAGCACCACCTCCCAAGCCTGAGCTGCCGGAGAAGGCACCATCGGAAAAGCCCCCAGAGCAGACACCCCAGACAGCTGTCCCTGAGGCTCCGGCCCCTGAGAAGCCATCGGCACCGCGGCCTGCAGAGAAGGACAAGGACAAGGAGCGGGTGACACGAGGAGAGCGGCCGTCACGGGGCGAGCGGGGCGCAGGTGGGCGGCAGACCCGCCCTGAGCGCAGCCTTGCCACGGCCCAGCCCCCTACTGCCCGGCCCCCCAAGGCCCGGCCCCCCAAGGTGAAGGCTGAGCCGCCCCCTAAGAAGAGGAAGAAGTGGCTGAAGGAGGCAGTGGGCAATGCCTCGTCAGGTGGGGGTCCGGCAGGCAGCTCCTCGGACTCGGATTCCTCACCTGGAGCTCCCAGCGAGGACGAGCGGGCGGTACCAGGGCGTCTTCTAAAGACCCGGGCAATGCGGGAGATGTACCGGAGCTATGTGGAGATGCTGGTGAGCACGGCCCTTGACCCGGACATGATCCAGGCCCTGGAGGACACGCACGATGAGCTATACCTCCCACCCATGCGGAAGATCGATGGCCTCCTCAATGAGCACAAGAAAAAAGTCCTTAAGCGGCTGTCGTTGAGCCCTGCCCTACAGGACGCCCTGCACACGTTCCCTCAGCTTCAAGTGGAGCAGAGTGGGGAGGGCTCCCCCGAAGAGGGCGCCGTGCGGCTACGGCCAGCCGGGGAGCCCTACAACCGCAAGACCCTGAGCAAGCTCAAGAGGAGTGTGGTGCGAGCCCAGGAGTTCAAGGTGGAGCTGGAGAAGTCAGGATACTACACACTCTACCATTCCCTCCACCACTACAAATACCACACCTTCCTGCGCTGCCGGGACCAGGTGAGCCACAGGGCACCCTCACCTGGGGTGTCCCCTTCACAAGTGAGCTCAGGACCTGCGAATCCAGATCTGCCCTCCTCCCTCAGACCCAGGGTTCAGGCCCAGCCTCCTCCCTCAGACCCAGGGCTCCAGCTCCCATCCCTTCTGCCCTGGGAGGCCGGTCCCTGGCCACCCTCCATCTCGAGCCCCCGGCACCCCATTTAA

XM_004866907.1 Coding sequence

Nosip nitric oxide synthase interacting protein, transcript variant X1

Length: 1257 bp    Location: 4672384..4689995   Strand: +
>XM_004866907.1
ATGGTTAGGCTTCTGGCCCTGGCCCCACACTGGGAAGCAGCAACCGCTCAGCAACCAATATGCTCTGAAGGGGCTGAGTTTCATTATCCGGAACCTTCTAGCTGCAACTCACGTTTCCGGAGGGAGGAAGAAAAGAAGAAAGGACTTACCAAGCCTGGCGAGGTACTTCGGCAACTAGGGGCAGCCTTATTTCCGGTCTGTACTACTAGGCGGAAGGAGGCGGAACGGAGGGAAAGAGCAACACTCCCTTCCGGTGTAGTGGCTCAGCAGCGACGAGAGAACGAGGAGTCGTTTGTGAGGATGACTCGGCATGGCAAGAACTGCACAGCGGGGGCGGTGTACACCTATCACGAGAAGAAGAAGGACACAGCGGCCTCAGGCTATGGGACCCAGAACATCCGACTGAGCCGCGATGCAGTGAAGGACTTCGACTGCTGCTGCCTGTCTTTGCAGCCCTGCCATGACCCTGTTGTCACCCCAGATGGCTACCTGTATGAGCGTGAGGCTATCCTGGAGTACATTCTGCACCAGAAGAGGGAGATTGCCCGGCAGATGAAGGCCTACGAGAAGCAGCGCGGCGCGCGGCGTGAGGAGCAGAAGCAGCTGCATCGGGCGGCGGCGCAGGACCAGGTGCGAGGCTTCCTGGAGAAGGAGGCGGCCATCGTGAGCCGCCCACTCAACCCTTTCGAGGCCAAGGTGGCCGAGGGCCCCGGCTCAGATGACGCGAAGCCCGGGCCCAGCGCGGGGGCTCCAGGCAAGGCGAAGGAGAAGGACAAGGAGCTGCCCAGCTTCTGGATCCCGTCACTGACTCCCGAGGCCAAGGCCACCAAGCTGGAGAAGCCGTCGCGCACCGTCGCCTGCCCCATGTCCGGGAAGCCGTTGCGCATGGCGGACCTGACGCCCGTGCGCTTCACGCTGCTCGACGACTCCGTGGACCGCGTGGGGCTCATCACGCGCAGCGAGCGCTACGTGTGCGCCGTGACCCGCGACAGTCTCAGCAACGCCACACCGTGCGCCGTGCTGAGGCCCTCCGGGGCCGTGGTCACCCTCGAATGTGTGGAGAAGCTGATTCGCAAGGACATGGTGGACCCGGTGAACGGGGACAAGCTCACGGAGCGTGACATCATCGTGCTGCAGCGCGTGAGCCGCCCGTCCCCTCATCCCCTCCCTTCCCCTTTCCTAGTCTCACCCTTTCACCCCCAAACCCCGCCCAGCTCGGGCCACGCCCTGGGCCGGGCCACGCCTATCCTAGTGTGA

XM_004866836.1 Coding sequence

Myh14 myosin, heavy chain 14, non-muscle, transcript variant X3

Length: 6102 bp    Location: 4231067..4176625   Strand: -
>XM_004866836.1
ATGGCGGCCGTGACGCTGTCAGTGCCCGGGCGCAAGGTGCCCCCCAGGCCGGGCCCAGTGCCGGAGGCAGCGCAGCCCTTCTTGTTCGCCCCGTGCTCCCCGGGCTCGGGAGCGGGCAGTCCCCCGCAGGTGGAGTGGACGGCCCGGCGCCTGGTGTGGGTCCCTTCGGAGCTGCACGGGTTCGAGGCGGCCGCACTGCGCGACGAGGGCGATGAGGAGGCCGAGGTGGAGCTGGCGGAGAGCGGGCGGCGGCTGCGGCTGCCGCGGGACCAGATCCAGCGCATGAACCCGCCCAAGTTCAGCAAGGCCGAGGACATGGCCGAGCTCACCTGCCTGAACGAGGCCTCGGTGCTGCACAACCTGCGCGAGCGCTACTACTCCGGCCTCATCTACACCTACTCCGGCCTGTTCTGTGTGGTCATCAACCCCTACAAGCAGCTGCCCATCTACACAGAGGCCATTGTGGAGATGTACCGGGGTAAGAAGCGCCACGAGGTGCCGCCCCACGTGTATGCAGTGACGGAGGGGGCCTACAGGAGCATGCTTCAAGACCGAGAGGACCAGTCCATCCTCTGCACCGGGGAGTCTGGAGCCGGGAAGACAGAGAACACCAAGAAGGTCATCCAGTACCTGGCGCACGTGGCATCGTCGCCCAAGGGCAGGAAGGAGCCGGGAGTCCCTGGGGAGCTGGAGCGGCAGCTTCTCCAGGCCAACCCGGTCCTGGAGGCCTTCGGCAACGCCAAGACGGTGAAGAACGACAACTCCTCGCGCTTCGGCAAATTCATCCGCATCAACTTTGACGTCGCGGGGTACATCGTGGGCGCCAACATCGAGACCTACCTGCTGGAGAAGTCGCGCGCCATCCGCCAGGCCAAGGACGAGTGCAGCTTCCACATCTTCTACCAGCTGCTGGGGGGCGCGGGGGAGCAGCTCAAAGCCGACCTCCTCCTGGAGCCCTTCTCGCACTACCGCTTCCTGACCAGCGGGCCGCCATCCACCGCCAGCCAGGAGCGGGAGCCGTTCCAGGAGACCCTGGAGTCCCTGCGGGTGCTGGGCTTCACGCCCGAGGAGATCACCTCTATGCTGCGGATGGTGTCCGCCGTGCTGCAGTTCGGCAACGTCATCCTCAAGAGCGAGCGCAACACGGACCAGGCCACCATGCCGGACAACACAGCTGCACAGAAGCTATGCCGTCTTCTGGGGCTGGGGGTGACCGACTTCTCCAGAGCCCTGCTCACGCCCCGCATAAAGGTTGGCCGAGATTACGTCCAGAAAGCCCAGACCAAGGAGCAGGCCGACTTCGCGCTGGAGGCTCTGGCCAAGGCCACCTACGAGCGCCTCTTCCGCTGGCTGGTCCTGCGCCTCAACCGCGCCCTGGACCGCAGCCCGCGCCAGGGCGCCTCCTTCCTGGGCATCTTGGACATCGCCGGCTTCGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGTTGTTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATTCCCTGGACCTTCCTGGACTTCGGCCTCGACCTGCAGCCCTGCATCGACCTCATCGAGCGCCCGGCCAACCCGCCCGGGCTTCTGGCCCTGCTGGATGAGGAGTGCTGGTTCCCGAAGGCCACGGACAAATCGTTCGTGGAGAAGGTGGCCCAGGAGCAGGGCGGCCACCCCAAGTTCCAGCGCCCCAGGCAACTGCGGGACCAGGCTGACTTCAGCGTCCTGCACTATGCTGGAAAGGTCGACTACAAGGCCAATGAGTGGCTGATGAAGAACATGGACCCGCTGAATGACAACGTGGCAGCCTTGCTCCACCAGAGCACAGACCGGATGACTGCGGAGATCTGGAAAGACGAACATGGGGACCTCCCGCAGGCCTCTTTCCTGGGCTCCTTCCCTCCGCTGTCCCCCGGATCCACAGGGAAGTGCTGCTCTCCCTCTTCCCCGCCAGGGGGTGGGTACCTCTGTCCCCTCTCCTTGGAGAGCATCGTGGGGCTGGAGCAGGTGAGCAGCCTCGGGGATGGCCCACCGGGTGGCCGCCCGCGCCGCGGGATGTTCCGGACGGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTGATGGCCACACTCAGCAACACCAACCCCAGCTTCATCCGCTGCATCATCCCCAACCACGAGAAGCGGGCTGGGAAGCTGGAGCCACGGCTGGTGCTGGAGCAGCTCCGCTGCAATGGCGTCCTCGAGGGCATCCGCATCTGCCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGGTACGAGATCCTGACGCCCAATGCCATCCCCAAGGGCTTCATGGACGGGAAGCAGGCCTGCGAGAAGATGATCCAGGCTCTGGAGCTGGACCCCAACCTGTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCGGGGGTCCTGGCCCAGCTGGAGGAGGAGCGGGACCTGAAGGTCACAGACATCATTGTGTCCTTCCAAGCAGCTGCCCGGGGATACCTGGCACGCAGGGCCTTCCAGAGGCGCCAGCAGCAGCAGAGCGCGCTGAGGGTGATGCAGAGGAACTGTGCGGCCTACCTCAAGCTCAGGCACTGGCAGTGGTGGCGGCTGTTCATCAAGGTGAAGCCGCTGCTGCAGGTGACGCGGCAGGACGAGGTGCTGCAGGCGCGCGCCCAGGAGCTGCAGAAGGTGCAGGAGCTGCAGCAACAGAGCGCGCGCCAAGTGGGGGAGCTGCAGGACCGCGTGGCGCAGCTGGAGGAGGAGCGCACCCGCTTGGCCGAGCAGTTGCGGGCGGAGGCCGAGCTTTGCGCGGAGGCGGAGGAGACTCGCGGACGTCTAGCGACCCGCAAGCAGGAGCTGGAGCTGGTGGTGACGGAGCTGGAGGCCCGCATGGGCGAGGAGGAGGAGTGCAGCCGCCAGCTGCAGGCCGAGAAGCGGAGGCTGCAGCTGCACATCCAGGAGCTGGAGACCCACTTGGAGGCCGAGGAGGGGGCGCGGCAGAAGCTACAGCTGGAGAAGGTGACGACTGAGGCGAGGCTGAAGAAGTTCGAGGAGGACTTGCTGCTCCTGGAGGACCAGAACGCCAAGCTGGGCAAGGAGCGCCGGCTGCTGGAGGAGCGCCTGGCCGAGTTCTCCTCGGCGGCGGCGGAGGAGGAGGAGAAGATCAAGAGCCTGAACAAGCTGCGGCTCAAATACGAGGCCACCATCGCGGACATGGAGGACCGCCTGCGGAAGGAGGAGAAGGGGCGCCAGGAGCTGGAGAAGCTGAAGCGGCGGCTGGACGGGGAGAGCTCCGAGCTGCAGGAGCAGATGGCGGGGCAGCAGCAGCGCGCCGAGGAGCTGCGGGCCCAGCTGGGCCGCAAGGAGGAGGAGCTGCAGGCGGCGCTGGCCAGGGCAGAGGAGGAGGGCGGGGCCCGGACCCAGCTGCTGAAGTCCCTTCGCGAGGCGCAGGCCGGCCTAGCCGAGGCCCAGGAGGACCTGGAGGCCGAGCGCGCGGCCAGGGCCAAGGCCGAGAAGCATCGCCGCGACCTGGGCGAGGAGCTGGAGGCGCTGCGCGGGGAGCTGGAGGACACGCTGGACTCCACGAACGCGCAGCAGGAGCTGCGGACCAAGAGAGAACAGGAGGTGACAGAACTGAAGAAGACGCTGGAAGAGGAGACCCGGATTCACGAGGTGGCCGTGCAGGAGCTGAGGCAACGGCACGGCCAGGCGCTGGGGGAGCTGGCGGAGCAGCTGGAGCAAGCGCGACGGGGCAAAGGCGCTTGGGAGAAGACGAGGCTGGCTCTGGAGGCAGAGGTGTCCGAGCTGCGGGCGGAGCTGAGCAGCCTGCAGTCTGCACGCCAGGAGGGAGAGCAGAGGCGTAGGCGTCTGGAGTCGCAGCTGCAGGAGGTGCAGGGCCGGGCTGGTGACGGAGAGCGCGCACGTGTGGAGGCTGCGGAGAAGCTGCAGCGAGCGCAGGCTGAGCTGGAGACCGTGTCTGGGGCGCTGAGTGAGGCCGAGTCCAGAGCCATCCGGCTGGGCAAGGAGCTGAGCAGCACCGAGGCGCAGCTGCACGACGCCCAGGAGCTGCTTCAGGAGGAGACCCGGGCAAAGCTGGCCCTGGGCTCGCGGGTTCGCGCCCTGGAGGCTGAGGCCTCGGGGCTGCGCGAGCAGATAGAAGAGGAAGCCGCTGCCAGGGAGCGTGCGGGCCGTGAGCTCCAGACTGCCCAGGCCCAGCTGTCAGAGTGGCGGCGCCGCCAGGAGGAGGAGGCGGGAGCACTGGAGGCGGGGGAGGAGGCCCGGCGCCGCGCGGCCCGGGAGGCCGAGGCCCTGGCCCAGCGCCTGGCGGAGAAGACGGAGGCTGCGGAGCGGCTGGAGCGGGGCCGCCGCCGGCTGCAGCAGGAGCTGGACGACGCCACGGTGGACCTGGAGCAGCAGCGGCAGCTCGTGAGCTCGCTGGAGAAGAAGCAGCGCAAATTCGACCAGCTTCTGGCTGAGGAGAAGGCAGCTGTGCTCCGCGCAGCAGAGGAACGTGAGCGGGTGGAAGCCGAGGGCCGGGAGCGCGAGGCTCGGGCCTTGTCCCTGACACGAGCCCTGGAAGAGGAACAGGAGGCCCGGGAGGAGCTGGAGCGCCAGAACCGGGCACTGCGGGCCGAGATGGAGGCGCTACTGAGCAGCAAGGATGATGTCGGCAAGAGTGTGCACGAACTGGAACGCGCCCGCAGGGTGGCGGAGCAGGCAGCCAACGACCTGCGAGCACAGGTGACGGAGCTGGAGGACGAGCTGACGGCGGCCGAGGACGCCAAGCTGCGCCTGGAGGTGACCGTGCAGGCTCTGAAGGCACAGCACGAGCGCGACCTGCAGGGCCGCGACGAGGCCGGCGAGGAGAGGCGGAGGCAGCTGGCCAAGCAGCTGAGGGATGCGGAGGTGGAGCGCGACGAGGAGCGGAAGCAGCGCGCCCTGGCCTTGGCCGCCCGCAAGAAGCTGGAGGCGGAGCTGGAGGAGCTGAAGGCGCAGATGGCGGCCGCTGGGCAGGGCAAGGAGGAGGCGGTGAAGCAGCTGCGTAAGATGCAGGCCCAGATGAAGGAGCTGTGGCGGGAGGTGGAGGAGTCACGCACCTCCCGGGAGGAGATCTTTGTCCAGAACCGGGAGAGTGAAAAGCGCCTCAAGGGGCTGGAAGCAGACGTGCTACGGTTGCAGGAGGAGCTGGCAGCCTCAGACCGTGCGCGGCGACAGGCGCAGCAGGACCGGGATGAGATGGCCGATGAGCTGGCCAATGGCAGCCTTAGCAAGGCGGCCCTGCTGGAGGAGAAGCGGCAGCTGGAGGGGCGCCTGGGGCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGAGCAATGCCGAGCTGCTCAATGACCGCTACCGCAAGCTGCTGCTGCAGGTGGAGACCCTGACCACAGAGCTGTCTGCTGAGCGTAGTTTCTCAGCCAAGGCTGAGAGTGGCCGGCAGCAACTGGAGCGGCAGATCCAGGAGCTCCGGGGACACCTGGGTGAAGAGGATGCTGGGGCCCGGGCCCGCCAGAAGATGATGATTGCCACCCTTGAGTCTAAGCTGGCCCAGGCTGAGGAGCAGCTGGAGCAAGAGACCAGGGAGCGCATCCTCTCTGGCAAGCTAGTACGCAGAGCCGAGAAGCGGTTGAAGGAGGTGGTTCTGCAGGTGGAGGAGGAGCGGAGGGTGGCTGACCAGCTCCGGGACCAGCTGGAGAAAGGGAACCTCCGGCTGAAGCAGCTGAAGCGGCAGCTGGAGGAGGCGGAGGAGGAGGCGTCCCGGGCCCAGGCCGGCCGCCGCAGGCTGCAGCGGGAGCTGGAGGACGTCACCGAGTCCGCCGAGTCCATGAACCGCGAGGTGACCACGCTGAGGAACCGGCTCCGGCGCGGCCCGCTTACCTTCACCACGCGCACAGTGCGCCAGGTGTTCCGCCTGGAGGAGGGCGTGGCTTCCGATGAGGAGGAGGTGGAGGGGGCGGAGCCAGGGTCGGCCCTGCCGCAGGAGCCCGAGTGTCCCCCGCCAGCCCAGCCCCAGTGA

XM_004866835.1 Coding sequence

Myh14 myosin, heavy chain 14, non-muscle, transcript variant X2

Length: 6102 bp    Location: 4231067..4176625   Strand: -
>XM_004866835.1
ATGGCGGCCGTGACGCTGTCAGTGCCCGGGCGCAAGGTGCCCCCCAGGCCGGGCCCAGTGCCGGAGGCAGCGCAGCCCTTCTTGTTCGCCCCGTGCTCCCCGGGCTCGGGAGCGGGCAGTCCCCCGCAGGTGGAGTGGACGGCCCGGCGCCTGGTGTGGGTCCCTTCGGAGCTGCACGGGTTCGAGGCGGCCGCACTGCGCGACGAGGGCGATGAGGAGGCCGAGGTGGAGCTGGCGGAGAGCGGGCGGCGGCTGCGGCTGCCGCGGGACCAGATCCAGCGCATGAACCCGCCCAAGTTCAGCAAGGCCGAGGACATGGCCGAGCTCACCTGCCTGAACGAGGCCTCGGTGCTGCACAACCTGCGCGAGCGCTACTACTCCGGCCTCATCTACACCTACTCCGGCCTGTTCTGTGTGGTCATCAACCCCTACAAGCAGCTGCCCATCTACACAGAGGCCATTGTGGAGATGTACCGGGGTAAGAAGCGCCACGAGGTGCCGCCCCACGTGTATGCAGTGACGGAGGGGGCCTACAGGAGCATGCTTCAAGACCGAGAGGACCAGTCCATCCTCTGCACCGGGGAGTCTGGAGCCGGGAAGACAGAGAACACCAAGAAGGTCATCCAGTACCTGGCGCACGTGGCATCGTCGCCCAAGGGCAGGAAGGAGCCGGGAGTCCCTGCTTCCGCCAGCACCATATCTTATGGGGAGCTGGAGCGGCAGCTTCTCCAGGCCAACCCGGTCCTGGAGGCCTTCGGCAACGCCAAGACGGTGAAGAACGACAACTCCTCGCGCTTCGGCAAATTCATCCGCATCAACTTTGACGTCGCGGGGTACATCGTGGGCGCCAACATCGAGACCTACCTGCTGGAGAAGTCGCGCGCCATCCGCCAGGCCAAGGACGAGTGCAGCTTCCACATCTTCTACCAGCTGCTGGGGGGCGCGGGGGAGCAGCTCAAAGCCGACCTCCTCCTGGAGCCCTTCTCGCACTACCGCTTCCTGACCAGCGGGCCGCCATCCACCGCCAGCCAGGAGCGGGAGCCGTTCCAGGAGACCCTGGAGTCCCTGCGGGTGCTGGGCTTCACGCCCGAGGAGATCACCTCTATGCTGCGGATGGTGTCCGCCGTGCTGCAGTTCGGCAACGTCATCCTCAAGAGCGAGCGCAACACGGACCAGGCCACCATGCCGGACAACACAGCTGCACAGAAGCTATGCCGTCTTCTGGGGCTGGGGGTGACCGACTTCTCCAGAGCCCTGCTCACGCCCCGCATAAAGGTTGGCCGAGATTACGTCCAGAAAGCCCAGACCAAGGAGCAGGCCGACTTCGCGCTGGAGGCTCTGGCCAAGGCCACCTACGAGCGCCTCTTCCGCTGGCTGGTCCTGCGCCTCAACCGCGCCCTGGACCGCAGCCCGCGCCAGGGCGCCTCCTTCCTGGGCATCTTGGACATCGCCGGCTTCGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGTTGTTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATTCCCTGGACCTTCCTGGACTTCGGCCTCGACCTGCAGCCCTGCATCGACCTCATCGAGCGCCCGGCCAACCCGCCCGGGCTTCTGGCCCTGCTGGATGAGGAGTGCTGGTTCCCGAAGGCCACGGACAAATCGTTCGTGGAGAAGGTGGCCCAGGAGCAGGGCGGCCACCCCAAGTTCCAGCGCCCCAGGCAACTGCGGGACCAGGCTGACTTCAGCGTCCTGCACTATGCTGGAAAGGTCGACTACAAGGCCAATGAGTGGCTGATGAAGAACATGGACCCGCTGAATGACAACGTGGCAGCCTTGCTCCACCAGAGCACAGACCGGATGACTGCGGAGATCTGGAAAGACGAACATGGGGACCTCCCGCAGGCCTCTTTCCTGGGCTCCTTCCCTCCGCTGTCCCCCGGATCCACAGGGAAGTGCTGCTCTCCCTCTTCCCCGCCAGGGGTGGAGAGCATCGTGGGGCTGGAGCAGGTGAGCAGCCTCGGGGATGGCCCACCGGGTGGCCGCCCGCGCCGCGGGATGTTCCGGACGGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTGATGGCCACACTCAGCAACACCAACCCCAGCTTCATCCGCTGCATCATCCCCAACCACGAGAAGCGGGCTGGGAAGCTGGAGCCACGGCTGGTGCTGGAGCAGCTCCGCTGCAATGGCGTCCTCGAGGGCATCCGCATCTGCCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGGTACGAGATCCTGACGCCCAATGCCATCCCCAAGGGCTTCATGGACGGGAAGCAGGCCTGCGAGAAGATGATCCAGGCTCTGGAGCTGGACCCCAACCTGTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCGGGGGTCCTGGCCCAGCTGGAGGAGGAGCGGGACCTGAAGGTCACAGACATCATTGTGTCCTTCCAAGCAGCTGCCCGGGGATACCTGGCACGCAGGGCCTTCCAGAGGCGCCAGCAGCAGCAGAGCGCGCTGAGGGTGATGCAGAGGAACTGTGCGGCCTACCTCAAGCTCAGGCACTGGCAGTGGTGGCGGCTGTTCATCAAGGTGAAGCCGCTGCTGCAGGTGACGCGGCAGGACGAGGTGCTGCAGGCGCGCGCCCAGGAGCTGCAGAAGGTGCAGGAGCTGCAGCAACAGAGCGCGCGCCAAGTGGGGGAGCTGCAGGACCGCGTGGCGCAGCTGGAGGAGGAGCGCACCCGCTTGGCCGAGCAGTTGCGGGCGGAGGCCGAGCTTTGCGCGGAGGCGGAGGAGACTCGCGGACGTCTAGCGACCCGCAAGCAGGAGCTGGAGCTGGTGGTGACGGAGCTGGAGGCCCGCATGGGCGAGGAGGAGGAGTGCAGCCGCCAGCTGCAGGCCGAGAAGCGGAGGCTGCAGCTGCACATCCAGGAGCTGGAGACCCACTTGGAGGCCGAGGAGGGGGCGCGGCAGAAGCTACAGCTGGAGAAGGTGACGACTGAGGCGAGGCTGAAGAAGTTCGAGGAGGACTTGCTGCTCCTGGAGGACCAGAACGCCAAGCTGGGCAAGGAGCGCCGGCTGCTGGAGGAGCGCCTGGCCGAGTTCTCCTCGGCGGCGGCGGAGGAGGAGGAGAAGATCAAGAGCCTGAACAAGCTGCGGCTCAAATACGAGGCCACCATCGCGGACATGGAGGACCGCCTGCGGAAGGAGGAGAAGGGGCGCCAGGAGCTGGAGAAGCTGAAGCGGCGGCTGGACGGGGAGAGCTCCGAGCTGCAGGAGCAGATGGCGGGGCAGCAGCAGCGCGCCGAGGAGCTGCGGGCCCAGCTGGGCCGCAAGGAGGAGGAGCTGCAGGCGGCGCTGGCCAGGGCAGAGGAGGAGGGCGGGGCCCGGACCCAGCTGCTGAAGTCCCTTCGCGAGGCGCAGGCCGGCCTAGCCGAGGCCCAGGAGGACCTGGAGGCCGAGCGCGCGGCCAGGGCCAAGGCCGAGAAGCATCGCCGCGACCTGGGCGAGGAGCTGGAGGCGCTGCGCGGGGAGCTGGAGGACACGCTGGACTCCACGAACGCGCAGCAGGAGCTGCGGACCAAGAGAGAACAGGAGGTGACAGAACTGAAGAAGACGCTGGAAGAGGAGACCCGGATTCACGAGGTGGCCGTGCAGGAGCTGAGGCAACGGCACGGCCAGGCGCTGGGGGAGCTGGCGGAGCAGCTGGAGCAAGCGCGACGGGGCAAAGGCGCTTGGGAGAAGACGAGGCTGGCTCTGGAGGCAGAGGTGTCCGAGCTGCGGGCGGAGCTGAGCAGCCTGCAGTCTGCACGCCAGGAGGGAGAGCAGAGGCGTAGGCGTCTGGAGTCGCAGCTGCAGGAGGTGCAGGGCCGGGCTGGTGACGGAGAGCGCGCACGTGTGGAGGCTGCGGAGAAGCTGCAGCGAGCGCAGGCTGAGCTGGAGACCGTGTCTGGGGCGCTGAGTGAGGCCGAGTCCAGAGCCATCCGGCTGGGCAAGGAGCTGAGCAGCACCGAGGCGCAGCTGCACGACGCCCAGGAGCTGCTTCAGGAGGAGACCCGGGCAAAGCTGGCCCTGGGCTCGCGGGTTCGCGCCCTGGAGGCTGAGGCCTCGGGGCTGCGCGAGCAGATAGAAGAGGAAGCCGCTGCCAGGGAGCGTGCGGGCCGTGAGCTCCAGACTGCCCAGGCCCAGCTGTCAGAGTGGCGGCGCCGCCAGGAGGAGGAGGCGGGAGCACTGGAGGCGGGGGAGGAGGCCCGGCGCCGCGCGGCCCGGGAGGCCGAGGCCCTGGCCCAGCGCCTGGCGGAGAAGACGGAGGCTGCGGAGCGGCTGGAGCGGGGCCGCCGCCGGCTGCAGCAGGAGCTGGACGACGCCACGGTGGACCTGGAGCAGCAGCGGCAGCTCGTGAGCTCGCTGGAGAAGAAGCAGCGCAAATTCGACCAGCTTCTGGCTGAGGAGAAGGCAGCTGTGCTCCGCGCAGCAGAGGAACGTGAGCGGGTGGAAGCCGAGGGCCGGGAGCGCGAGGCTCGGGCCTTGTCCCTGACACGAGCCCTGGAAGAGGAACAGGAGGCCCGGGAGGAGCTGGAGCGCCAGAACCGGGCACTGCGGGCCGAGATGGAGGCGCTACTGAGCAGCAAGGATGATGTCGGCAAGAGTGTGCACGAACTGGAACGCGCCCGCAGGGTGGCGGAGCAGGCAGCCAACGACCTGCGAGCACAGGTGACGGAGCTGGAGGACGAGCTGACGGCGGCCGAGGACGCCAAGCTGCGCCTGGAGGTGACCGTGCAGGCTCTGAAGGCACAGCACGAGCGCGACCTGCAGGGCCGCGACGAGGCCGGCGAGGAGAGGCGGAGGCAGCTGGCCAAGCAGCTGAGGGATGCGGAGGTGGAGCGCGACGAGGAGCGGAAGCAGCGCGCCCTGGCCTTGGCCGCCCGCAAGAAGCTGGAGGCGGAGCTGGAGGAGCTGAAGGCGCAGATGGCGGCCGCTGGGCAGGGCAAGGAGGAGGCGGTGAAGCAGCTGCGTAAGATGCAGGCCCAGATGAAGGAGCTGTGGCGGGAGGTGGAGGAGTCACGCACCTCCCGGGAGGAGATCTTTGTCCAGAACCGGGAGAGTGAAAAGCGCCTCAAGGGGCTGGAAGCAGACGTGCTACGGTTGCAGGAGGAGCTGGCAGCCTCAGACCGTGCGCGGCGACAGGCGCAGCAGGACCGGGATGAGATGGCCGATGAGCTGGCCAATGGCAGCCTTAGCAAGGCGGCCCTGCTGGAGGAGAAGCGGCAGCTGGAGGGGCGCCTGGGGCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGAGCAATGCCGAGCTGCTCAATGACCGCTACCGCAAGCTGCTGCTGCAGGTGGAGACCCTGACCACAGAGCTGTCTGCTGAGCGTAGTTTCTCAGCCAAGGCTGAGAGTGGCCGGCAGCAACTGGAGCGGCAGATCCAGGAGCTCCGGGGACACCTGGGTGAAGAGGATGCTGGGGCCCGGGCCCGCCAGAAGATGATGATTGCCACCCTTGAGTCTAAGCTGGCCCAGGCTGAGGAGCAGCTGGAGCAAGAGACCAGGGAGCGCATCCTCTCTGGCAAGCTAGTACGCAGAGCCGAGAAGCGGTTGAAGGAGGTGGTTCTGCAGGTGGAGGAGGAGCGGAGGGTGGCTGACCAGCTCCGGGACCAGCTGGAGAAAGGGAACCTCCGGCTGAAGCAGCTGAAGCGGCAGCTGGAGGAGGCGGAGGAGGAGGCGTCCCGGGCCCAGGCCGGCCGCCGCAGGCTGCAGCGGGAGCTGGAGGACGTCACCGAGTCCGCCGAGTCCATGAACCGCGAGGTGACCACGCTGAGGAACCGGCTCCGGCGCGGCCCGCTTACCTTCACCACGCGCACAGTGCGCCAGGTGTTCCGCCTGGAGGAGGGCGTGGCTTCCGATGAGGAGGAGGTGGAGGGGGCGGAGCCAGGGTCGGCCCTGCCGCAGGAGCCCGAGTGTCCCCCGCCAGCCCAGCCCCAGTGA

XM_004866840.1 Coding sequence

Myh14 myosin, heavy chain 14, non-muscle, transcript variant X7

High confidence: 4 potential gene matches
Length: 5979 bp    Location: 4231067..4176625   Strand: -
>XM_004866840.1
ATGGCGGCCGTGACGCTGTCAGTGCCCGGGCGCAAGGTGCCCCCCAGGCCGGGCCCAGTGCCGGAGGCAGCGCAGCCCTTCTTGTTCGCCCCGTGCTCCCCGGGCTCGGGAGCGGGCAGTCCCCCGCAGGTGGAGTGGACGGCCCGGCGCCTGGTGTGGGTCCCTTCGGAGCTGCACGGGTTCGAGGCGGCCGCACTGCGCGACGAGGGCGATGAGGAGGCCGAGGTGGAGCTGGCGGAGAGCGGGCGGCGGCTGCGGCTGCCGCGGGACCAGATCCAGCGCATGAACCCGCCCAAGTTCAGCAAGGCCGAGGACATGGCCGAGCTCACCTGCCTGAACGAGGCCTCGGTGCTGCACAACCTGCGCGAGCGCTACTACTCCGGCCTCATCTACACCTACTCCGGCCTGTTCTGTGTGGTCATCAACCCCTACAAGCAGCTGCCCATCTACACAGAGGCCATTGTGGAGATGTACCGGGGTAAGAAGCGCCACGAGGTGCCGCCCCACGTGTATGCAGTGACGGAGGGGGCCTACAGGAGCATGCTTCAAGACCGAGAGGACCAGTCCATCCTCTGCACCGGGGAGTCTGGAGCCGGGAAGACAGAGAACACCAAGAAGGTCATCCAGTACCTGGCGCACGTGGCATCGTCGCCCAAGGGCAGGAAGGAGCCGGGAGTCCCTGGGGAGCTGGAGCGGCAGCTTCTCCAGGCCAACCCGGTCCTGGAGGCCTTCGGCAACGCCAAGACGGTGAAGAACGACAACTCCTCGCGCTTCGGCAAATTCATCCGCATCAACTTTGACGTCGCGGGGTACATCGTGGGCGCCAACATCGAGACCTACCTGCTGGAGAAGTCGCGCGCCATCCGCCAGGCCAAGGACGAGTGCAGCTTCCACATCTTCTACCAGCTGCTGGGGGGCGCGGGGGAGCAGCTCAAAGCCGACCTCCTCCTGGAGCCCTTCTCGCACTACCGCTTCCTGACCAGCGGGCCGCCATCCACCGCCAGCCAGGAGCGGGAGCCGTTCCAGGAGACCCTGGAGTCCCTGCGGGTGCTGGGCTTCACGCCCGAGGAGATCACCTCTATGCTGCGGATGGTGTCCGCCGTGCTGCAGTTCGGCAACGTCATCCTCAAGAGCGAGCGCAACACGGACCAGGCCACCATGCCGGACAACACAGCTGCACAGAAGCTATGCCGTCTTCTGGGGCTGGGGGTGACCGACTTCTCCAGAGCCCTGCTCACGCCCCGCATAAAGGTTGGCCGAGATTACGTCCAGAAAGCCCAGACCAAGGAGCAGGCCGACTTCGCGCTGGAGGCTCTGGCCAAGGCCACCTACGAGCGCCTCTTCCGCTGGCTGGTCCTGCGCCTCAACCGCGCCCTGGACCGCAGCCCGCGCCAGGGCGCCTCCTTCCTGGGCATCTTGGACATCGCCGGCTTCGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGTTGTTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATTCCCTGGACCTTCCTGGACTTCGGCCTCGACCTGCAGCCCTGCATCGACCTCATCGAGCGCCCGGCCAACCCGCCCGGGCTTCTGGCCCTGCTGGATGAGGAGTGCTGGTTCCCGAAGGCCACGGACAAATCGTTCGTGGAGAAGGTGGCCCAGGAGCAGGGCGGCCACCCCAAGTTCCAGCGCCCCAGGCAACTGCGGGACCAGGCTGACTTCAGCGTCCTGCACTATGCTGGAAAGGTCGACTACAAGGCCAATGAGTGGCTGATGAAGAACATGGACCCGCTGAATGACAACGTGGCAGCCTTGCTCCACCAGAGCACAGACCGGATGACTGCGGAGATCTGGAAAGACGTGGAGAGCATCGTGGGGCTGGAGCAGGTGAGCAGCCTCGGGGATGGCCCACCGGGTGGCCGCCCGCGCCGCGGGATGTTCCGGACGGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTGATGGCCACACTCAGCAACACCAACCCCAGCTTCATCCGCTGCATCATCCCCAACCACGAGAAGCGGGCTGGGAAGCTGGAGCCACGGCTGGTGCTGGAGCAGCTCCGCTGCAATGGCGTCCTCGAGGGCATCCGCATCTGCCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGGTACGAGATCCTGACGCCCAATGCCATCCCCAAGGGCTTCATGGACGGGAAGCAGGCCTGCGAGAAGATGATCCAGGCTCTGGAGCTGGACCCCAACCTGTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCGGGGGTCCTGGCCCAGCTGGAGGAGGAGCGGGACCTGAAGGTCACAGACATCATTGTGTCCTTCCAAGCAGCTGCCCGGGGATACCTGGCACGCAGGGCCTTCCAGAGGCGCCAGCAGCAGCAGAGCGCGCTGAGGGTGATGCAGAGGAACTGTGCGGCCTACCTCAAGCTCAGGCACTGGCAGTGGTGGCGGCTGTTCATCAAGGTGAAGCCGCTGCTGCAGGTGACGCGGCAGGACGAGGTGCTGCAGGCGCGCGCCCAGGAGCTGCAGAAGGTGCAGGAGCTGCAGCAACAGAGCGCGCGCCAAGTGGGGGAGCTGCAGGACCGCGTGGCGCAGCTGGAGGAGGAGCGCACCCGCTTGGCCGAGCAGTTGCGGGCGGAGGCCGAGCTTTGCGCGGAGGCGGAGGAGACTCGCGGACGTCTAGCGACCCGCAAGCAGGAGCTGGAGCTGGTGGTGACGGAGCTGGAGGCCCGCATGGGCGAGGAGGAGGAGTGCAGCCGCCAGCTGCAGGCCGAGAAGCGGAGGCTGCAGCTGCACATCCAGGAGCTGGAGACCCACTTGGAGGCCGAGGAGGGGGCGCGGCAGAAGCTACAGCTGGAGAAGGTGACGACTGAGGCGAGGCTGAAGAAGTTCGAGGAGGACTTGCTGCTCCTGGAGGACCAGAACGCCAAGCTGGGCAAGGAGCGCCGGCTGCTGGAGGAGCGCCTGGCCGAGTTCTCCTCGGCGGCGGCGGAGGAGGAGGAGAAGATCAAGAGCCTGAACAAGCTGCGGCTCAAATACGAGGCCACCATCGCGGACATGGAGGACCGCCTGCGGAAGGAGGAGAAGGGGCGCCAGGAGCTGGAGAAGCTGAAGCGGCGGCTGGACGGGGAGAGCTCCGAGCTGCAGGAGCAGATGGCGGGGCAGCAGCAGCGCGCCGAGGAGCTGCGGGCCCAGCTGGGCCGCAAGGAGGAGGAGCTGCAGGCGGCGCTGGCCAGGGCAGAGGAGGAGGGCGGGGCCCGGACCCAGCTGCTGAAGTCCCTTCGCGAGGCGCAGGCCGGCCTAGCCGAGGCCCAGGAGGACCTGGAGGCCGAGCGCGCGGCCAGGGCCAAGGCCGAGAAGCATCGCCGCGACCTGGGCGAGGAGCTGGAGGCGCTGCGCGGGGAGCTGGAGGACACGCTGGACTCCACGAACGCGCAGCAGGAGCTGCGGACCAAGAGAGAACAGGAGGTGACAGAACTGAAGAAGACGCTGGAAGAGGAGACCCGGATTCACGAGGTGGCCGTGCAGGAGCTGAGGCAACGGCACGGCCAGGCGCTGGGGGAGCTGGCGGAGCAGCTGGAGCAAGCGCGACGGGGCAAAGGCGCTTGGGAGAAGACGAGGCTGGCTCTGGAGGCAGAGGTGTCCGAGCTGCGGGCGGAGCTGAGCAGCCTGCAGTCTGCACGCCAGGAGGGAGAGCAGAGGCGTAGGCGTCTGGAGTCGCAGCTGCAGGAGGTGCAGGGCCGGGCTGGTGACGGAGAGCGCGCACGTGTGGAGGCTGCGGAGAAGCTGCAGCGAGCGCAGGCTGAGCTGGAGACCGTGTCTGGGGCGCTGAGTGAGGCCGAGTCCAGAGCCATCCGGCTGGGCAAGGAGCTGAGCAGCACCGAGGCGCAGCTGCACGACGCCCAGGAGCTGCTTCAGGAGGAGACCCGGGCAAAGCTGGCCCTGGGCTCGCGGGTTCGCGCCCTGGAGGCTGAGGCCTCGGGGCTGCGCGAGCAGATAGAAGAGGAAGCCGCTGCCAGGGAGCGTGCGGGCCGTGAGCTCCAGACTGCCCAGGCCCAGCTGTCAGAGTGGCGGCGCCGCCAGGAGGAGGAGGCGGGAGCACTGGAGGCGGGGGAGGAGGCCCGGCGCCGCGCGGCCCGGGAGGCCGAGGCCCTGGCCCAGCGCCTGGCGGAGAAGACGGAGGCTGCGGAGCGGCTGGAGCGGGGCCGCCGCCGGCTGCAGCAGGAGCTGGACGACGCCACGGTGGACCTGGAGCAGCAGCGGCAGCTCGTGAGCTCGCTGGAGAAGAAGCAGCGCAAATTCGACCAGCTTCTGGCTGAGGAGAAGGCAGCTGTGCTCCGCGCAGCAGAGGAACGTGAGCGGGTGGAAGCCGAGGGCCGGGAGCGCGAGGCTCGGGCCTTGTCCCTGACACGAGCCCTGGAAGAGGAACAGGAGGCCCGGGAGGAGCTGGAGCGCCAGAACCGGGCACTGCGGGCCGAGATGGAGGCGCTACTGAGCAGCAAGGATGATGTCGGCAAGAGTGTGCACGAACTGGAACGCGCCCGCAGGGTGGCGGAGCAGGCAGCCAACGACCTGCGAGCACAGGTGACGGAGCTGGAGGACGAGCTGACGGCGGCCGAGGACGCCAAGCTGCGCCTGGAGGTGACCGTGCAGGCTCTGAAGGCACAGCACGAGCGCGACCTGCAGGGCCGCGACGAGGCCGGCGAGGAGAGGCGGAGGCAGCTGGCCAAGCAGCTGAGGGATGCGGAGGTGGAGCGCGACGAGGAGCGGAAGCAGCGCGCCCTGGCCTTGGCCGCCCGCAAGAAGCTGGAGGCGGAGCTGGAGGAGCTGAAGGCGCAGATGGCGGCCGCTGGGCAGGGCAAGGAGGAGGCGGTGAAGCAGCTGCGTAAGATGCAGGCCCAGATGAAGGAGCTGTGGCGGGAGGTGGAGGAGTCACGCACCTCCCGGGAGGAGATCTTTGTCCAGAACCGGGAGAGTGAAAAGCGCCTCAAGGGGCTGGAAGCAGACGTGCTACGGTTGCAGGAGGAGCTGGCAGCCTCAGACCGTGCGCGGCGACAGGCGCAGCAGGACCGGGATGAGATGGCCGATGAGCTGGCCAATGGCAGCCTTAGCAAGGCGGCCCTGCTGGAGGAGAAGCGGCAGCTGGAGGGGCGCCTGGGGCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGAGCAATGCCGAGCTGCTCAATGACCGCTACCGCAAGCTGCTGCTGCAGGTGGAGACCCTGACCACAGAGCTGTCTGCTGAGCGTAGTTTCTCAGCCAAGGCTGAGAGTGGCCGGCAGCAACTGGAGCGGCAGATCCAGGAGCTCCGGGGACACCTGGGTGAAGAGGATGCTGGGGCCCGGGCCCGCCAGAAGATGATGATTGCCACCCTTGAGTCTAAGCTGGCCCAGGCTGAGGAGCAGCTGGAGCAAGAGACCAGGGAGCGCATCCTCTCTGGCAAGCTAGTACGCAGAGCCGAGAAGCGGTTGAAGGAGGTGGTTCTGCAGGTGGAGGAGGAGCGGAGGGTGGCTGACCAGCTCCGGGACCAGCTGGAGAAAGGGAACCTCCGGCTGAAGCAGCTGAAGCGGCAGCTGGAGGAGGCGGAGGAGGAGGCGTCCCGGGCCCAGGCCGGCCGCCGCAGGCTGCAGCGGGAGCTGGAGGACGTCACCGAGTCCGCCGAGTCCATGAACCGCGAGGTGACCACGCTGAGGAACCGGCTCCGGCGCGGCCCGCTTACCTTCACCACGCGCACAGTGCGCCAGGTGTTCCGCCTGGAGGAGGGCGTGGCTTCCGATGAGGAGGAGGTGGAGGGGGCGGAGCCAGGGTCGGCCCTGCCGCAGGAGCCCGAGTGTCCCCCGCCAGCCCAGCCCCAGTGA

XM_004866861.1 Coding sequence

Tbc1d17 TBC1 domain family, member 17, transcript variant X2

Length: 2154 bp    Location: 4454171..4444945   Strand: -
>XM_004866861.1
ATGGAGAGATCTTGCTACAGAGTGGTGTTTGAGAAGGGAGGCGTGTACCTGCACACCAGCGCCCGGAAACATCAGGACGCGGACTCCCTCATCGCGGGCGTTATCCGTGTCGTGGAGAAGGACAATGACGTCCTCCTGCACTGGGCTCCTGTGGAGGAGGCTGGAGATTGCACCCAAATCCTCTTCTCCAAGAAGGACTCTAGTGGGGGTGACCCCTGCACCTCTGAGGAGGAACCCACCTTTGACCCTGGCTATGAACCTGACTGGGCTGTCATCAGTACCGTGCGGCCACGGCTCCACCACTCAGAGCCTGCCAGAGGTACAGAGCCCAGCTCCCCCCGGGCTCAGTGGGCCTTCTCAGTGAGTCTGGGGGAGCTGAAGTCCATCCGCCGATCCAAGCCAGGCCTTAGCTGGGCCTACCTGGTTCTGGTGACCCAAGCCGGAGGCTCCCTGCCTGCCCTGCACTTCCACCGAGGAGGCACCCGAGCCCTGCTTCGAGTCCTCAGCCGCTACTTGCTACTGGCCAGCTCCCCGCAGGACTCCCGCCTCTACCTTGTCTTTCCCCATGACTCCTCTGCCCTCTCCAACTCCTTCCACCACCTGCAGCTCTTTGATCAGGACAGCTCCAATGTGGTCTCTCGCTTCCTCCAAGACCCCTACTCCACCACCTTCAGCAGCTTCTCCCGCGTGACCAACTTTTTCCGGGGAGCCTTGCAGCCACACCCCGAGGGGGCCTCCTCTCCTGACCTTCGCCCCCCACCCGATGATGAGCCTGGGTTTGAGGTCATCTCCTGTGTGGAGCTGGGGCCACGGCCAGCCGTGGAGCGTGCCCCTCCTGTCACAGAGGAGGAGTGGGCCCGCCACGTGGGCCCCGAGGGCCGCCTGCAGCAGGTCCCTGAGCTGAAGAACCGGATCTTCTCGGGGGGTCTGAGCCCCAGCCTGCGGCGCGAGGCCTGGAAGTTCCTCCTGGGCTACCTCAGCTGGGAGGGCTCAGCCGAGGAGCACAAGGCCCACCTGCGCAAGAAAACGGATGAGTATTTCCGCATGAAGCTGCAGTGGAAGTCCGTGAGCCCTGAGCAGGAGCGGAGGAACTCACTCCTGCACGGATACCGCAGCCTCATTGAGAGAGACGTGAGCCGCACTGACAGGACCAACAAGTTCTATGAGGGCCCTGAGAACCCGGGGCTGGGGCTGCTGAACGACATCCTCCTCACCTACTGCATGTACCACTTTGACCTCGGCTATGTCCAGGGCATGAGTGACCTTCTCTCCCCGATCCTCTACGTCATTCAGAACGAGGTGGATGCCTTCTGGTGTTTCTGTGGCTTCATGGACCTCGTGCACGGGAACTTTGAGGAGAGTCAGGAGACCATGAAGCGGCAGCTGGGGCAGCTCCTGCTACTGCTAAAGGTGCTGGACCAGCCGCTGTGTGACTTCCTGGACTCCCAGGACTCCGGCTCTCTCTGCTTCTGCTTCCGGTGGCTGCTTATCTGGTTCAAGAGGGAATTCCCCTTCCCGGACATCCTCCGGCTGTGGGAGGTGCTGTGGACGAGGCTTCCCGGTCCTAATCTGCACCTGCTGGTGGCCTGCGCCATCCTGGACATGGAGCGGGACACCCTCATGCTGTCAGGCTTCGGCTCCAACGAGATCCTGAAGCACATCAACGAGCTGACCATGAAGCTGAGCGTGGAGGACGTGCTGACGCGTGCCGAGGCGCTGTACTGGCAGCTCACCGCCTGCCCGGTGAGTCCAGTCCGGGCCTCTACCCCAGCCCCACCGCGGCGCCCCCAGGGCGTTTCTGACCCCCGCCTGTCCGCAGGAGCTGCCCCACAACGTGCAGGAAGTCCTGGGCCTGGCGCCGCCCGCGGAGCCCCCCAGCCCCTCGCCTCCGGTCTCCCCGCTGCCGCTGTCGCCTACACGTGCCCCGTCGACCCCGCCGCCCGCCGCCGCCGCCGCCGCCGCTGCCCCGCAGCCAGACAGCAGCCTGGAGATCCTGCCCGAGGAGGGGGATGGGCCCGACTCCTAGCCCCCAGCGGCCCCAGCGGCGCTCCGCACCGGCACTTTAGGGGCCCTGCGCCCCTCGAGGCAGGGAGGGACCTGCGGGCAGGGTGGCGCGGCCGCTGGGCTCCTGAGGCGCAGGCCCCGCCAAGCTGA

XM_004866860.1 Coding sequence

Tbc1d17 TBC1 domain family, member 17, transcript variant X1

Length: 2238 bp    Location: 4454173..4444945   Strand: -
>XM_004866860.1
ATGGAGAGATCTTGCTACAGAGTGGTGTTTGAGAAGGGAGGCGTGTACCTGCACACCAGCGCCCGGAAACATCAGGACGCGGACTCCCTCATCGCGGGCGTTATCCGTGTCGTGGAGAAGGACAATGACGTCCTCCTGCACTGGGCTCCTGTGGAGGAGGCTGGAGATTGCACCCAAATCCTCTTCTCCAAGAAGGACTCTAGTGGGGGTGACCCCTGCACCTCTGAGGAGGAACCCACCTTTGACCCTGGCTATGAACCTGACTGGGCTGTCATCAGTACCGTGCGGCCACGGCTCCACCACTCAGAGCCTGCCAGAGGTACAGAGCCCAGCTCCCCCCGGGCTCAGTGGGCCTTCTCAGTGAGTCTGGGGGAGCTGAAGTCCATCCGCCGATCCAAGCCAGGCCTTAGCTGGGCCTACCTGGTTCTGGTGACCCAAGCCGGAGGCTCCCTGCCTGCCCTGCACTTCCACCGAGGAGGCACCCGAGCCCTGCTTCGAGTCCTCAGCCGCTACTTGCTACTGGCCAGCTCCCCGCAGGACTCCCGCCTCTACCTTGTCTTTCCCCATGACTCCTCTGCCCTCTCCAACTCCTTCCACCACCTGCAGCTCTTTGATCAGGACAGCTCCAATGTGGTCTCTCGCTTCCTCCAAGACCCCTACTCCACCACCTTCAGCAGCTTCTCCCGCGTGACCAACTTTTTCCGGGGAGCCTTGCAGCCACACCCCGAGGGGGCCTCCTCTCCTGACCTTCGCCCCCCACCCGATGATGAGCCTGGGTTTGAGGTCATCTCCTGTGTGGAGCTGGGGCCACGGCCAGCCGTGGAGCGTGCCCCTCCTGTCACAGAGGAGGAGTGGGCCCGCCACGTGGGCCCCGAGGGCCGCCTGCAGCAGGTCCCTGAGCTGAAGAACCGGATCTTCTCGGGGGGTCTGAGCCCCAGCCTGCGGCGCGAGGCCTGGAAGTTCCTCCTGGGCTACCTCAGCTGGGAGGGCTCAGCCGAGGAGCACAAGGCCCACCTGCGCAAGAAAACGGATGAGTATTTCCGCATGAAGCTGCAGTGGAAGTCCGTGAGCCCTGAGCAGGAGCGGAGGAACTCACTCCTGCACGGATACCGCAGCCTCATTGAGAGAGACGTGAGCCGCACTGACAGGACCAACAAGTTCTATGAGGGCCCTGAGAACCCGGGGCTGGGGCTGCTGAACGACATCCTCCTCACCTACTGCATGTACCACTTTGACCTCGGTGTGGCAACGGGCAGGGAGGGGTGGGCTGAGTCCCTCAAGGGTGCCGAGGGCCTGAACAGCACCCTGATCCCATGTCCCCCAGGCTATGTCCAGGGCATGAGTGACCTTCTCTCCCCGATCCTCTACGTCATTCAGAACGAGGTGGATGCCTTCTGGTGTTTCTGTGGCTTCATGGACCTCGTGCACGGGAACTTTGAGGAGAGTCAGGAGACCATGAAGCGGCAGCTGGGGCAGCTCCTGCTACTGCTAAAGGTGCTGGACCAGCCGCTGTGTGACTTCCTGGACTCCCAGGACTCCGGCTCTCTCTGCTTCTGCTTCCGGTGGCTGCTTATCTGGTTCAAGAGGGAATTCCCCTTCCCGGACATCCTCCGGCTGTGGGAGGTGCTGTGGACGAGGCTTCCCGGTCCTAATCTGCACCTGCTGGTGGCCTGCGCCATCCTGGACATGGAGCGGGACACCCTCATGCTGTCAGGCTTCGGCTCCAACGAGATCCTGAAGCACATCAACGAGCTGACCATGAAGCTGAGCGTGGAGGACGTGCTGACGCGTGCCGAGGCGCTGTACTGGCAGCTCACCGCCTGCCCGGTGAGTCCAGTCCGGGCCTCTACCCCAGCCCCACCGCGGCGCCCCCAGGGCGTTTCTGACCCCCGCCTGTCCGCAGGAGCTGCCCCACAACGTGCAGGAAGTCCTGGGCCTGGCGCCGCCCGCGGAGCCCCCCAGCCCCTCGCCTCCGGTCTCCCCGCTGCCGCTGTCGCCTACACGTGCCCCGTCGACCCCGCCGCCCGCCGCCGCCGCCGCCGCCGCTGCCCCGCAGCCAGACAGCAGCCTGGAGATCCTGCCCGAGGAGGGGGATGGGCCCGACTCCTAGCCCCCAGCGGCCCCAGCGGCGCTCCGCACCGGCACTTTAGGGGCCCTGCGCCCCTCGAGGCAGGGAGGGACCTGCGGGCAGGGTGGCGCGGCCGCTGGGCTCCTGAGGCGCAGGCCCCGCCAAGCTGA

XM_004866859.1 Coding sequence

Il4i1 interleukin 4 induced 1, transcript variant X3

Length: 1566 bp    Location: 4429129..4444551   Strand: +
>XM_004866859.1
ATGCACGATCCCGACTATGAGCTGCTGCTCAAGGTGGTGACCCAGGGCCTCAATCGGACCTTGCAGCCCCAGAAGGTGATTGTGGTTGGCGCTGGTGTGGCCGGGCTGGTGGCTGCCAAGGTGCTCAGTGATGGTGGACACAAGGTCACCGTTCTGGAGGCAGATAACAGGATCGGGGGCCGCATCCTCACCTTCCGGGACCCTAAGACCAGCTGGTCTGGGGAGCTAGGAGCCATGCGCATGCCCAGCTCCCACAGGATCCTGCACATGCTCTGCAAGAGCCTGGGGCTCAACCTGACAAAATTCACCCAGTATGACGAGAACACGTGGACAGAAGTGAACGGCGTGAAGCTGCGGAACTACGTGGTGGAGAAGATGCCCGAGAAGCTGGGCTACAAACTGCGCCCCAAAGAGAGGGGCCGCTCCCCAGAGGACATCTACCAGATGGCTCTCAACAAGGCCCAGAAAGATGTCAAGGCGCTGGGCTGCAGAAAGGCACTGAGGAAGTTTGAAAGGCACACGCTCCTGGAATTCCTCCGCGGGGAGGGCAATCTCAGCCGACCAGCAGTGCAGCTTCTGGGAGACGTGATGTCCAAGGATGGCTTCTTCTATCTCAGCTTCGAAGAGGCCTTGCGCGCTCATAGCTGCCTCAGCGACCAGCTCCGGTACAGCCGCATCGTGGGCGGCTGGGACTTGCTGCCGCGCGCGCTGCTGAGCTCGCTGTCTGGCCCCGTGCTGCTGAACGCGCCTGTCGTGGCCGTGACCCAGGGCACGCGCGACGTGCGGGTGCACATCGCGACCTCGAGCCAGTCGCGGAGCCTGAAGGCTCTGACGGCCGATGTGGTGCTGCTGACGGCCAGTGGGCCGGCGCTGCAGCGCATGACCTTCTCGCCGCCGCTGTCGCGCGAGCGCCAGGAGGCGCTGCGCAGGCTGCACTACGTGCCGGCCACCAAGGTGTTCCTGAGCTTCCGCCGGCCCTTCTGGCAGGACGAGGGCATCGAGGGCGGCCACTCGAACACCGACCGCCCGTCGCGCGCGGTTTTCTACCCTCCGCCAGGCGAGGGCGCGCTGCTGCTGGCTTCGTACACGTGGTCGGACGCCACCAACGCGTTCGCGGGCCTGGGCACCGAAGAAGTGCTGCGCCTGGCGCTCACCGACGTGGCGGCGCTGCATGGACCGCACGTCTACCGGCTCTGGGACGGCACCGGTATTGTCAAGCGCTGGGCTGAAGACCCACACAGCCAGGGCGGCTTCGTGGTGCAGCCGCCCGTGCTCTGGCAAACCGACGGCGACGAAGACTCCGAGGCCTTTGCACAGCCCTACGATTGGACGACCCCCCACGGCCGCATCTACTTCGCGGGCGAGCACACGGCCTACCCTCACGGCTGGGTGGAGACAGCCGTCAAGTCGGCGCTTCGGGCCGCCCTGCGGATCAACAGCCCCGAGGGTCAGGCGTGCACGGAGGCCCCGCAGCAGCTGGGGGCCGAGCACCAGGCTACCTACCGCGTCCCAGGCCATCCCCTCCTGCGGCTCCCGCACTCCACCCACCGGAAGACCTCACATTAA

XM_004866838.1 Coding sequence

Myh14 myosin, heavy chain 14, non-muscle, transcript variant X5

Length: 6003 bp    Location: 4231067..4176625   Strand: -
>XM_004866838.1
ATGGCGGCCGTGACGCTGTCAGTGCCCGGGCGCAAGGTGCCCCCCAGGCCGGGCCCAGTGCCGGAGGCAGCGCAGCCCTTCTTGTTCGCCCCGTGCTCCCCGGGCTCGGGAGCGGGCAGTCCCCCGCAGGTGGAGTGGACGGCCCGGCGCCTGGTGTGGGTCCCTTCGGAGCTGCACGGGTTCGAGGCGGCCGCACTGCGCGACGAGGGCGATGAGGAGGCCGAGGTGGAGCTGGCGGAGAGCGGGCGGCGGCTGCGGCTGCCGCGGGACCAGATCCAGCGCATGAACCCGCCCAAGTTCAGCAAGGCCGAGGACATGGCCGAGCTCACCTGCCTGAACGAGGCCTCGGTGCTGCACAACCTGCGCGAGCGCTACTACTCCGGCCTCATCTACACCTACTCCGGCCTGTTCTGTGTGGTCATCAACCCCTACAAGCAGCTGCCCATCTACACAGAGGCCATTGTGGAGATGTACCGGGGTAAGAAGCGCCACGAGGTGCCGCCCCACGTGTATGCAGTGACGGAGGGGGCCTACAGGAGCATGCTTCAAGACCGAGAGGACCAGTCCATCCTCTGCACCGGGGAGTCTGGAGCCGGGAAGACAGAGAACACCAAGAAGGTCATCCAGTACCTGGCGCACGTGGCATCGTCGCCCAAGGGCAGGAAGGAGCCGGGAGTCCCTGCTTCCGCCAGCACCATATCTTATGGGGAGCTGGAGCGGCAGCTTCTCCAGGCCAACCCGGTCCTGGAGGCCTTCGGCAACGCCAAGACGGTGAAGAACGACAACTCCTCGCGCTTCGGCAAATTCATCCGCATCAACTTTGACGTCGCGGGGTACATCGTGGGCGCCAACATCGAGACCTACCTGCTGGAGAAGTCGCGCGCCATCCGCCAGGCCAAGGACGAGTGCAGCTTCCACATCTTCTACCAGCTGCTGGGGGGCGCGGGGGAGCAGCTCAAAGCCGACCTCCTCCTGGAGCCCTTCTCGCACTACCGCTTCCTGACCAGCGGGCCGCCATCCACCGCCAGCCAGGAGCGGGAGCCGTTCCAGGAGACCCTGGAGTCCCTGCGGGTGCTGGGCTTCACGCCCGAGGAGATCACCTCTATGCTGCGGATGGTGTCCGCCGTGCTGCAGTTCGGCAACGTCATCCTCAAGAGCGAGCGCAACACGGACCAGGCCACCATGCCGGACAACACAGCTGCACAGAAGCTATGCCGTCTTCTGGGGCTGGGGGTGACCGACTTCTCCAGAGCCCTGCTCACGCCCCGCATAAAGGTTGGCCGAGATTACGTCCAGAAAGCCCAGACCAAGGAGCAGGCCGACTTCGCGCTGGAGGCTCTGGCCAAGGCCACCTACGAGCGCCTCTTCCGCTGGCTGGTCCTGCGCCTCAACCGCGCCCTGGACCGCAGCCCGCGCCAGGGCGCCTCCTTCCTGGGCATCTTGGACATCGCCGGCTTCGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGTTGTTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATTCCCTGGACCTTCCTGGACTTCGGCCTCGACCTGCAGCCCTGCATCGACCTCATCGAGCGCCCGGCCAACCCGCCCGGGCTTCTGGCCCTGCTGGATGAGGAGTGCTGGTTCCCGAAGGCCACGGACAAATCGTTCGTGGAGAAGGTGGCCCAGGAGCAGGGCGGCCACCCCAAGTTCCAGCGCCCCAGGCAACTGCGGGACCAGGCTGACTTCAGCGTCCTGCACTATGCTGGAAAGGTCGACTACAAGGCCAATGAGTGGCTGATGAAGAACATGGACCCGCTGAATGACAACGTGGCAGCCTTGCTCCACCAGAGCACAGACCGGATGACTGCGGAGATCTGGAAAGACGTGGAGAGCATCGTGGGGCTGGAGCAGGTGAGCAGCCTCGGGGATGGCCCACCGGGTGGCCGCCCGCGCCGCGGGATGTTCCGGACGGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTGATGGCCACACTCAGCAACACCAACCCCAGCTTCATCCGCTGCATCATCCCCAACCACGAGAAGCGGGCTGGGAAGCTGGAGCCACGGCTGGTGCTGGAGCAGCTCCGCTGCAATGGCGTCCTCGAGGGCATCCGCATCTGCCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGGTACGAGATCCTGACGCCCAATGCCATCCCCAAGGGCTTCATGGACGGGAAGCAGGCCTGCGAGAAGATGATCCAGGCTCTGGAGCTGGACCCCAACCTGTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCGGGGGTCCTGGCCCAGCTGGAGGAGGAGCGGGACCTGAAGGTCACAGACATCATTGTGTCCTTCCAAGCAGCTGCCCGGGGATACCTGGCACGCAGGGCCTTCCAGAGGCGCCAGCAGCAGCAGAGCGCGCTGAGGGTGATGCAGAGGAACTGTGCGGCCTACCTCAAGCTCAGGCACTGGCAGTGGTGGCGGCTGTTCATCAAGGTGAAGCCGCTGCTGCAGGTGACGCGGCAGGACGAGGTGCTGCAGGCGCGCGCCCAGGAGCTGCAGAAGGTGCAGGAGCTGCAGCAACAGAGCGCGCGCCAAGTGGGGGAGCTGCAGGACCGCGTGGCGCAGCTGGAGGAGGAGCGCACCCGCTTGGCCGAGCAGTTGCGGGCGGAGGCCGAGCTTTGCGCGGAGGCGGAGGAGACTCGCGGACGTCTAGCGACCCGCAAGCAGGAGCTGGAGCTGGTGGTGACGGAGCTGGAGGCCCGCATGGGCGAGGAGGAGGAGTGCAGCCGCCAGCTGCAGGCCGAGAAGCGGAGGCTGCAGCTGCACATCCAGGAGCTGGAGACCCACTTGGAGGCCGAGGAGGGGGCGCGGCAGAAGCTACAGCTGGAGAAGGTGACGACTGAGGCGAGGCTGAAGAAGTTCGAGGAGGACTTGCTGCTCCTGGAGGACCAGAACGCCAAGCTGGGCAAGGAGCGCCGGCTGCTGGAGGAGCGCCTGGCCGAGTTCTCCTCGGCGGCGGCGGAGGAGGAGGAGAAGATCAAGAGCCTGAACAAGCTGCGGCTCAAATACGAGGCCACCATCGCGGACATGGAGGACCGCCTGCGGAAGGAGGAGAAGGGGCGCCAGGAGCTGGAGAAGCTGAAGCGGCGGCTGGACGGGGAGAGCTCCGAGCTGCAGGAGCAGATGGCGGGGCAGCAGCAGCGCGCCGAGGAGCTGCGGGCCCAGCTGGGCCGCAAGGAGGAGGAGCTGCAGGCGGCGCTGGCCAGGGCAGAGGAGGAGGGCGGGGCCCGGACCCAGCTGCTGAAGTCCCTTCGCGAGGCGCAGGCCGGCCTAGCCGAGGCCCAGGAGGACCTGGAGGCCGAGCGCGCGGCCAGGGCCAAGGCCGAGAAGCATCGCCGCGACCTGGGCGAGGAGCTGGAGGCGCTGCGCGGGGAGCTGGAGGACACGCTGGACTCCACGAACGCGCAGCAGGAGCTGCGGACCAAGAGAGAACAGGAGGTGACAGAACTGAAGAAGACGCTGGAAGAGGAGACCCGGATTCACGAGGTGGCCGTGCAGGAGCTGAGGCAACGGCACGGCCAGGCGCTGGGGGAGCTGGCGGAGCAGCTGGAGCAAGCGCGACGGGGCAAAGGCGCTTGGGAGAAGACGAGGCTGGCTCTGGAGGCAGAGGTGTCCGAGCTGCGGGCGGAGCTGAGCAGCCTGCAGTCTGCACGCCAGGAGGGAGAGCAGAGGCGTAGGCGTCTGGAGTCGCAGCTGCAGGAGGTGCAGGGCCGGGCTGGTGACGGAGAGCGCGCACGTGTGGAGGCTGCGGAGAAGCTGCAGCGAGCGCAGGCTGAGCTGGAGACCGTGTCTGGGGCGCTGAGTGAGGCCGAGTCCAGAGCCATCCGGCTGGGCAAGGAGCTGAGCAGCACCGAGGCGCAGCTGCACGACGCCCAGGAGCTGCTTCAGGAGGAGACCCGGGCAAAGCTGGCCCTGGGCTCGCGGGTTCGCGCCCTGGAGGCTGAGGCCTCGGGGCTGCGCGAGCAGATAGAAGAGGAAGCCGCTGCCAGGGAGCGTGCGGGCCGTGAGCTCCAGACTGCCCAGGCCCAGCTGTCAGAGTGGCGGCGCCGCCAGGAGGAGGAGGCGGGAGCACTGGAGGCGGGGGAGGAGGCCCGGCGCCGCGCGGCCCGGGAGGCCGAGGCCCTGGCCCAGCGCCTGGCGGAGAAGACGGAGGCTGCGGAGCGGCTGGAGCGGGGCCGCCGCCGGCTGCAGCAGGAGCTGGACGACGCCACGGTGGACCTGGAGCAGCAGCGGCAGCTCGTGAGCTCGCTGGAGAAGAAGCAGCGCAAATTCGACCAGCTTCTGGCTGAGGAGAAGGCAGCTGTGCTCCGCGCAGCAGAGGAACGTGAGCGGGTGGAAGCCGAGGGCCGGGAGCGCGAGGCTCGGGCCTTGTCCCTGACACGAGCCCTGGAAGAGGAACAGGAGGCCCGGGAGGAGCTGGAGCGCCAGAACCGGGCACTGCGGGCCGAGATGGAGGCGCTACTGAGCAGCAAGGATGATGTCGGCAAGAGTGTGCACGAACTGGAACGCGCCCGCAGGGTGGCGGAGCAGGCAGCCAACGACCTGCGAGCACAGGTGACGGAGCTGGAGGACGAGCTGACGGCGGCCGAGGACGCCAAGCTGCGCCTGGAGGTGACCGTGCAGGCTCTGAAGGCACAGCACGAGCGCGACCTGCAGGGCCGCGACGAGGCCGGCGAGGAGAGGCGGAGGCAGCTGGCCAAGCAGCTGAGGGATGCGGAGGTGGAGCGCGACGAGGAGCGGAAGCAGCGCGCCCTGGCCTTGGCCGCCCGCAAGAAGCTGGAGGCGGAGCTGGAGGAGCTGAAGGCGCAGATGGCGGCCGCTGGGCAGGGCAAGGAGGAGGCGGTGAAGCAGCTGCGTAAGATGCAGGCCCAGATGAAGGAGCTGTGGCGGGAGGTGGAGGAGTCACGCACCTCCCGGGAGGAGATCTTTGTCCAGAACCGGGAGAGTGAAAAGCGCCTCAAGGGGCTGGAAGCAGACGTGCTACGGTTGCAGGAGGAGCTGGCAGCCTCAGACCGTGCGCGGCGACAGGCGCAGCAGGACCGGGATGAGATGGCCGATGAGCTGGCCAATGGCAGCCTTAGCAAGGCGGCCCTGCTGGAGGAGAAGCGGCAGCTGGAGGGGCGCCTGGGGCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGAGCAATGCCGAGCTGCTCAATGACCGCTACCGCAAGCTGCTGCTGCAGGTGGAGACCCTGACCACAGAGCTGTCTGCTGAGCGTAGTTTCTCAGCCAAGGCTGAGAGTGGCCGGCAGCAACTGGAGCGGCAGATCCAGGAGCTCCGGGGACACCTGGGTGAAGAGGATGCTGGGGCCCGGGCCCGCCAGAAGATGATGATTGCCACCCTTGAGTCTAAGCTGGCCCAGGCTGAGGAGCAGCTGGAGCAAGAGACCAGGGAGCGCATCCTCTCTGGCAAGCTAGTACGCAGAGCCGAGAAGCGGTTGAAGGAGGTGGTTCTGCAGGTGGAGGAGGAGCGGAGGGTGGCTGACCAGCTCCGGGACCAGCTGGAGAAAGGGAACCTCCGGCTGAAGCAGCTGAAGCGGCAGCTGGAGGAGGCGGAGGAGGAGGCGTCCCGGGCCCAGGCCGGCCGCCGCAGGCTGCAGCGGGAGCTGGAGGACGTCACCGAGTCCGCCGAGTCCATGAACCGCGAGGTGACCACGCTGAGGAACCGGCTCCGGCGCGGCCCGCTTACCTTCACCACGCGCACAGTGCGCCAGGTGTTCCGCCTGGAGGAGGGCGTGGCTTCCGATGAGGAGGAGGTGGAGGGGGCGGAGCCAGGGTCGGCCCTGCCGCAGGAGCCCGAGTGTCCCCCGCCAGCCCAGCCCCAGTGA

XM_004866830.1 Coding sequence

Nr1h2 nuclear receptor subfamily 1, group H, member 2, transcript variant X5

Length: 1071 bp    Location: 4140613..4136052   Strand: -
>XM_004866830.1
ATGTCTTCCCCCACCACGAGTTCCGTGGACAGTGCCCAGCCCGGAAATGCCCCCCCTCAGCCCAGCACCTCCTCCTCTTCACCCACTATAAAGAAAGAGGGCCCTGAGCCGTGGCTCGAGGGTCCGGACCCTGATGTCCCAGGCACCAATGGGGCCAGCTCGGCCTGCATCGTGGGTGTCCTCTCGGAAGAACAGATCCGGAAGAAGAAGATTCAGAAGCAGCAGCAGCAGCAGTCACCTGTGGAGCCAAAGGGCAGTGGCAGCTCAGCCTGCGGGCCTGGGGCGTCCCTGGGAGGGTCCGAGCTGGGTGGCCAGGGCCCCGGCGAAGGCGAAGGTGTCCAGTTAACAGCAGCCCAGGAGCTCATGATCCAGCAGTTGGTGGCAGCCCAGCTGCAGTGCAACAAACGCTCCTTCTCTGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGTGCAGACCCGCAGTCCCGTGATGCCCGCCAGCAGCGCTTCGCCCACTTCACGGAGCTGGCCATCATCTCGGTCCAGGAGATCGTGGACTTTGCCAAACAGGTGCCTGGCTTCCTGCAGCTGGGCCGCGAGGACCAGATCGCCCTCCTGAAGGCGTCCACCATCGAGATCATGCTCCTGGAGACAGCCCGGCGCTACAACCATGAGACAGAGTGCATCACCTTTCTGAAGGACTTCACCTACAGCAAGGATGACTTCCACCGCGCAGGCCTGCAGGTGGAGTTCATCAACCCCATCTTCGAGTTCTCAAGAGCCATGCGGCGGCTGGGCCTAGACGACGCTGAGTACGCCCTGCTTATTGCTATCAACATCTTCTCTGCTGACCGCCCCAACGTGCAGGAGCCCAGCCGCGTGGAGGCGCTACAGCAGCCCTATGTGGAGGCGCTGCTGTCCTACACGCGCATCAAGAGGCCGCAGGACCAGCTCCGCTTCCCTCGAATGCTGATGAAGCTTGTGAGCCTGCGAACGCTCAGCTCTGTGCACTCAGAGCAGGTCTTCGCCCTGCGGCTGCAGGACAAGAAGCTGCCGCCTCTGCTCTCAGAGATCTGGGACGTCCACGAGTAG

XM_004866829.1 Coding sequence

Nr1h2 nuclear receptor subfamily 1, group H, member 2, transcript variant X4

Length: 1236 bp    Location: 4140613..4136052   Strand: -
>XM_004866829.1
ATGTCTTCCCCCACCACGAGTTCCGTGGACAGTGCCCAGCCCGTCATCCTAGAACCAGATGAGGAGCCCGAGCCAGAGCGCAAGCGAAAGAAGGGCCCAGCTCCAAAGATGCTGGGCCACGAGCTCTGCCGCGTGTGTGGGGACAAGGCCTCTGGCTTCCACTACAATGTGCTGAGCTGCGAAGGCTGCAAAGGCTTCTTTCGGCGCAGCGTGGTCCATGGTGGAGCAGGGCGCTACGTCTGCCGGGGCGGTGGAACCTGCCAAATGGATGCCTTCATGCGGCGCAAGTGCCAGCAGTGCCGGCTGCGCAAGTGCAAGGAGGCGGGGATGAGGGAGCAGTGTGTCCTCTCGGAAGAACAGATCCGGAAGAAGAAGATTCAGAAGCAGCAGCAGCAGCAGTCACCTGTGGAGCCAAAGGGCAGTGGCAGCTCAGCCTGCGGGCCTGGGGCGTCCCTGGGAGGGTCCGAGCTGGGTGGCCAGGGCCCCGGCGAAGGCGAAGGTGTCCAGTTAACAGCAGCCCAGGAGCTCATGATCCAGCAGTTGGTGGCAGCCCAGCTGCAGTGCAACAAACGCTCCTTCTCTGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGTGCAGACCCGCAGTCCCGTGATGCCCGCCAGCAGCGCTTCGCCCACTTCACGGAGCTGGCCATCATCTCGGTCCAGGAGATCGTGGACTTTGCCAAACAGGTGCCTGGCTTCCTGCAGCTGGGCCGCGAGGACCAGATCGCCCTCCTGAAGGCGTCCACCATCGAGATCATGCTCCTGGAGACAGCCCGGCGCTACAACCATGAGACAGAGTGCATCACCTTTCTGAAGGACTTCACCTACAGCAAGGATGACTTCCACCGCGCAGGCCTGCAGGTGGAGTTCATCAACCCCATCTTCGAGTTCTCAAGAGCCATGCGGCGGCTGGGCCTAGACGACGCTGAGTACGCCCTGCTTATTGCTATCAACATCTTCTCTGCTGACCGCCCCAACGTGCAGGAGCCCAGCCGCGTGGAGGCGCTACAGCAGCCCTATGTGGAGGCGCTGCTGTCCTACACGCGCATCAAGAGGCCGCAGGACCAGCTCCGCTTCCCTCGAATGCTGATGAAGCTTGTGAGCCTGCGAACGCTCAGCTCTGTGCACTCAGAGCAGGTCTTCGCCCTGCGGCTGCAGGACAAGAAGCTGCCGCCTCTGCTCTCAGAGATCTGGGACGTCCACGAGTAG

XM_004866832.1 Coding sequence

LOC101701949 potassium voltage-gated channel subfamily C member 3-like, transcript variant X1

Length: 2274 bp    Location: 4161068..4172460   Strand: +
>XM_004866832.1
ATGCTGAGCTCAGTCTGCGTCTCGTCCTTCCCCCGGCGCCAGGGGGCCAGCAAGCAGCAGCCGGCGCCACCACCGCAGCAGCCCGAGTCCCCGCCGCCGCTGTCCCCGCCACCGCCGCCGCCGCTGCAGCCTGCGCAGCCCGGCCCAGCCGCATCCCCGGCGGGCCCCCAGGCACCCCGAGGGCCCGGGGACCGCCGCGCCGAGCCATGCCCCGGGCTGCCAGCGGCGGCCATGGGGCGGCACGGCGGCGGCGGTGGCGACAGCGGCAAGATCGTGATCAACGTGGGCGGCGTGCGCCATGAGACGTACCGCTCGACGCTGCGCACCCTGCCGGGTACGCGGCTGGCCGGCCTGACGGAGCCCGAGGCGGCCGCGCGCTTCGACTACGACCCCGGCGCAGACGAGTTCTTCTTCGACCGGCACCCGGGCGTCTTCGCCTACGTGCTCAACTACTACCGCACGGGCAAGCTGCACTGCCCGGCCGACGTGTGCGGGCCGCTCTTCGAGGAGGAGCTGGGCTTCTGGGGCATCGACGAGACCGACGTGGAGGCCTGCTGCTGGATGACCTACCGGCAGCACCGCGACGCGGAGGAGGCGCTCGACTCCTTCGAGGCCCCGGACCCTGCGGGCGCCGCCAATGCCGCTGCCGCGGGAGCGCACGACACGGGCCTGGACGACGAGGCGGGCGCGGGCGGCGGCGGCCTGGATGGCGCGGGCGGCGAGCTCAAGCGCCTCTGCTTCCAGGACTCGGGCGGCGGCGCCGGGGGCCCGCCAGGGGGCGCGGGCGGCGCGGGCGGCACGTGGTGGCGCCGCTGGCAGCCCCGTGTGTGGGCGCTCTTCGAGGACCCCTACTCGTCGCGGGCTGCCAGGTATGTGGCCTTCGCCTCGCTCTTCTTCATCCTCATCTCCATCACCACCTTCTGCCTGGAGACCCACGAGGGCTTCATCCACATCAGCAACAAGACTGTGACGCAGGCCTCCCCGATCCCCGGGGCCCCGCCGGAGAATATCACCAACGTGGAGGTGGAGACAGAGCCCTTCCTGACCTACGTGGAGGGCGTGTGCGTGGTCTGGTTCACCTTTGAGTTCCTCATGCGCATCACCTTCTGCCCGGACAAGGTGGAGTTTCTCAAGAGCAGCCTCAACATCATCGACTGTGTGGCCATTCTGCCCTTCTACCTGGAGGTCGGCCTCTCGGGCCTCAGCTCCAAGGCCGCCAAGGACGTGTTGGGCTTCCTGCGCGTCGTGCGCTTTGTCCGAATCTTGCGTATCTTCAAGCTGACCCGCCACTTCGTGGGGCTGCGGGTGCTGGGCCACACGCTTCGTGCCAGCACCAATGAGTTCCTGCTGCTCATCATCTTCCTGGCCCTGGGGGTGCTCATCTTTGCCACCATGATCTACTATGCTGAGCGCATTGGCGCCGACCCGGACGACATCCTGGGGTCCAACCACACCTACTTCAAGAACATCCCCATCGGCTTCTGGTGGGCTGTGGTCACCATGACGACCCTGGGCTATGGAGACATGTACCCCAAGACGTGGTCTGGGATGCTGGTTGGGGCGCTGTGTGCCCTGGCAGGGGTGCTGACTATCGCCATGCCTGTTCCTGTCATTGTCAACAATTTTGGCATGTACTATTCGCTGGCCATGGCCAAACAGAAGCTGCCTAAGAAGAAGAACAAACACATCCCCCGGCCCCCCCAGCCTGGCTCGCCCAACTACTGCAAGCCTGACCCACCCCCGCCACCTCCAACACACCCTCACCACGGCAGCGGGGGCATCAGCCCCCCCCCACCCATCAGCCCACCCTCCGTGGGGGTGACTGTGGCTGGGGCCTACCCGCCGGGGCCCCACACGCACCCCGGGCTGCTCAGGGGGGGTGCAGGGGGACTGGGGATCATGGGGCTGCCTCCCCTGCCGGCCCCTGGTGAGCCCTGCCCACTGGCTCAGGAGGAAGTGGTTGAAATCAACAGGGCAGATCCCCGCCCCAATGGCGATCCTGCTGCAGCTGCGCTGGCCCACGAGGATTGTCCCGCCATCGACCAGCCCGCCGCGTCCCCCGAGGACAAGAGCCCCATCACCCCCGGAAGCCGGGGCCGCTACAGCCGGGACCGTGCCTGCTTTCTCCTCACCGACTATGCCCCTTCCCCTGACGGCTCCATCCGAAAAGCCACTGGTGCTCCCCCCCTGCTCCCCCACGACTGGCGTAAGCCAGGCCCCCCAAGCTTCTTGCCCGACCTCAACGCCAACGCCGCAGCCTGGATATCCCCCTAG

XM_004866831.1 Coding sequence

LOC101701612 potassium voltage-gated channel subfamily C member 3-like

Length: 252 bp    Location: 4172529..4175721   Strand: +
>XM_004866831.1
ATGTCTCTCGCCCTCTCCCTTGTCTCTCTCTCTCCCTGTCTTGGGGGTCTCTCCGTGGGACCTGCCCCGCGCCCCATCTCCATGCTTCCTCCTCGTGTTTCTGCCCCTTCCCCAGGTTACGAGAAATCCCGCAGCCTGAGCAGCATCGCGGGCCTGAGCGGGGTGTCCCTGCGCCTCGCGCCCCTTGCCACCCCCCCTGGCTCTCCCCGGGCCACCCGCCGCGCCCCCCCAACCCTGCCCTCCATCCTCTAG

XM_004866823.1 Coding sequence

Spib Spi-B transcription factor (Spi-1/PU.1 related)

High confidence: 3 potential gene matches
Length: 792 bp    Location: 4116657..4111939   Strand: -
>XM_004866823.1
ATGCTCGCCCTGGAGGCTGCACAGCTCGACGGGCCACACTTCAGCTTTCTGTACCCAGATGGCGTCTTCTATGACCTGGACAGCTGCAAGCACCCCGGCTACCCCGACTCAGAGGGGGCTCCTGACTCCCTGTGGGGCTGGACCGAGGCCCCGCCTGTCCCCGCAGCCCCCTACGAAGCCTTCGACCCGGCAGCGGCCACCTTTGGCCCCCCCCAGGCCGCCCAGCTCTGCTACGGCCCCTCCGCCTACAGCCCCGCGGGGACCCTCGAGCCGGCCCCCAGCCTGGAGACACCGGGGCCCGGCCTCCCCGCGTACCCTACGGAGGACTTTGCCGGCCAGACCCTAGGCCCCCTGGCCTACGCCCCGTACCCCAGCCCGGGGCTGTCGGAGGAGGAGGAGCTGCTGCTGCTGGACAGCCCCGCCCTGGAGGTCTCTGACAGCGAGTCTGACGAGACCCTCGGCAGCAGCCCCGAGGGGAGGGGCTCCGAGGCAGGGGCCCGCAAGAAGCTGCGCCTGTACCAGTTCCTGCTGGGGCTGCTGACTCGCGGCGACATGCGCGAGTGCGTGTGGTGGGTGGAGCCGGGCGCCGGCGTCTTCCAGTTCTCCTCGAAGCACAAGGAGCTCCTGGCGCGCCGCTGGGGCCAGCAGAAGGGCAACCGCAAGCGCATGACCTACCAGAAGCTGGCGCGCGCACTGCGCAACTACGCCAAGACCGGCGAGATCCGCAAGGTCAAGCGCAAGCTCACCTACCAGTTCGACAGCGCGCTGCTGCCGGGTGTGCGCCGCGCCTGA

XM_004866821.1 Coding sequence

Fam71e1 family with sequence similarity 71, member E1, transcript variant X3

Length: 570 bp    Location: 4085012..4089655   Strand: +
>XM_004866821.1
ATGGCAGGACGCCTCCCGGTTCCAGCCTGTGCCCCGGAAGGTCCCGGGTGGCTCCAGCGCCACCTCCTGAGCGGCGAGTTCGACCAGCTGCGGGACTTCCCCATCTTTGAGAGCAATTTCGTGCAGGTGACCCGGTTTGGAGAAGTCGCCAATAAGGTCACCATGGGGGTGGCAGCCTCCAGTCCAGCCCTGGAACTCCCAGATCTGTTGCTGCTGGCTGGCCCTACCAAGGAGGACGGATGTCTGCAGCTTCACGGGCTTTTCCCCCTGCAGTTCGTCCAGCTCTTTGTCCACAAGGAAAGCCGCCAGCAGCTCAAGGTCAAGTTCTGCACCGGCCGCACCTTCTACCTGCAGCTGCGGGGCCCGGCCGAGACCCGGGACCTCGAGTTCAGCCAGTGGGTGCGGCTGCTGTACCGCCTGCGCTTCTACTCGGGCCAGGGGGCCGTGCCCTTCACGCAGCAGGAGTGGGGCGGCAGCAGGAGTGGGGGCTCCGAGACACTCTCTCCCACCCAGCTTCAAGTCCGGGAAGCCAGGCTCAATCCACAGACCTCGGAACTCTGGGGACTCTGA

XM_004866822.1 Coding sequence

Fam71e1 family with sequence similarity 71, member E1, transcript variant X4

High confidence: 4 potential gene matches
Length: 522 bp    Location: 4085012..4089655   Strand: +
>XM_004866822.1
ATGGGGGTGGCAGCCTCCAGTCCAGCCCTGGAACTCCCAGATCTGTTGCTGCTGGCTGGCCCTACCAAGGAGGACGGATGTCTGCAGCTTCACGGGCTTTTCCCCCTGCAGTTCGTCCAGCTCTTTGTCCACAAGGAAAGCCGCCAGCAGCTCAAGGTCAAGTTCTGCACCGGCCGCACCTTCTACCTGCAGCTGCGGGGCCCGGCCGAGACCCGGGACCTCGAGTTCAGCCAGTGGGTGCGGCTGCTGTACCGCCTGCGCTTCTACTCGGGCCAGGGGGCCGTGCCCTTCACGCAGCAGGAGTGGGGCGGCAGCAGGAGTGGGGGTACGAGGAGGAGACAGACGGGGACCAGGAGGAGCGGGAGAGGGGCTGGCGGGACCAGGCTCCGAGACACTCTCTCCCACCCAGCTTCAAGTCCGGGAAGCCAGGCTCAATCCACAGACCTCGGAACTCTGGGGACTCTGATTCTGCTGGGACCAGAGCTTGAAGCACCGACCCAGGCCACGCAGATGGATTATTAG

XM_004866812.1 Coding sequence

LOC101725004 josephin-2-like, transcript variant X6

Length: 855 bp    Location: 4063994..4066100   Strand: +
>XM_004866812.1
ATGGCCCCTGCTGGGGTCCGGCGGAAGGTGGGGGTGGTGGGCTATGGCCGCCTGGGACAGTCCCTCGTCTCCCGCCTTCTGGCTCAGGGATCTGAACTGGGCCTTGAACTTGTATTTGTCTGGAACCGAGACCCAGGCCGCATGGCAGGGAGCGTGCCCCCGTCCCTGCAGCTCCACAGCCTCACTGCCCTTGGGGAAAGGCACCCTGATCTGGTGGTAGAAGTGGCCCATCCCAAAATAATCCAGGAATCTGGGGCACACATCCTGCGCCATGCCAACCTCCTGGTGGGGTCCCCATCAGCCCTGGCTGACCAGACCACACAGCAGCAGCTCCTTGCCGCCTCCCACCACTGGGGCCACGCCATGTTTGTGGCTCGAGGAGCACTGTGGGGGACTGAGGACATCTCGAGATTGGATGCAGCCGGAGGCCTCCAGAGCCTTCGAGTCACCATGGCCACACACCCAGATGGCTTCCGGCTAGAGGGACCCCTAGCTACCACTCACAGCACTGGGCCTCGCACTGTGCTCTACGAAGGCCCTGTCCGTGGGCTCTGCCCCTTTGCTCCCCGAAACTCCAACACCATGGCAGCTGCTGCCCTGGCTGCCCCCAGCCTAGGCTTTGACAACGTGATCGGGGTGCTTGTGGCGGATCTCAGCCTCGCGGACATGCACGTGGTGGACGTGGAGCTGAGAGGACCCCCGGGGCCCACGGGCCGGAATTTCGCTGTGCACACCCACCGGGAGAACCCAGCGGAGCCAGGCGCTGTCACCGGCTCCGCCACTGTTGCTGCCTTCTGGCGCAGCCTCCTGGGCTGCTGCGAGCTGCCCTCCAGGCCAGGGATCCATCTCTGCTGA

XM_004866813.1 Coding sequence

LOC101725004 josephin-2-like, transcript variant X7

Length: 567 bp    Location: 4065843..4070352   Strand: +
>XM_004866813.1
ATGTCCCAGGCCCCAGGAGCACGGCCGAGCCCACCCTCCGTGTACCACGAGCGGCAGCGCCTGGAGCTGTGTGCCGTCCACGCCCTCAACAACGTTCTGCAGCAGCAGCTCTTTAGCCAGGAGGCTGCCGATGAGATCTGCAAGAGGCTGGCCCCCGACTCCCGGCTGAACCCCCACCGCAGCCTCCTGGGTACCGGCAACTATGACGTCAACGTGATCATGGCGGCCCTGCAGGGGCTGGGCCTGGCCGCTGTATGGTGGGACCGCAGGAGGCCCCTGTCCCAGCTGGCCCTGCCCCAGGTGCTGGGGCTGATCCTGAACCTGCCCTCGCCCGTGTCGCTGGGGCTGCTGTCCCTGCCACTGCGCCGGCGGCACTGGGTGGCCCTGCGCCAGGTGGACGGCATCTACTACAACCTCGACTCCAAACTGCGGGCGCCGGAGGCCCTTGGGGACGAGGATGGTGTCAGGGCCTTTGTGGCGGCCGCCCTGGCCCGAGGGCTGTGTGAGGTGCTGCTGGTGGTGACCAAGGAGGTGGAGGAGAAGGGCTGCTGGCTGCAGACAGACTGA

XM_004866817.1 Coding sequence

Emc10 ER membrane protein complex subunit 10, transcript variant X4

Length: 771 bp    Location: 4084847..4080641   Strand: -
>XM_004866817.1
ATGGTAATGGCAGCGTCCGGCGCGAGCGCATCCCGCTTGCTACTCCTCTTGCTGATAGTGGCAGCAGCGCCCAGTCGGGCCAGGGGCAGCGGCTGCCGGGCTGGGGCCGCTGCACGGGGGGTTGGGGCAGAAGGCCGTGAAGGGGAGAGCTGTGGCACCGTGGGGTTGCTGCTGGAGCACTCCTTTGAGATCGATGACGCTGCCCACTTCCGGAAGCGGGGCTCGCTGCTGTGGAACCAGCAGGATGGCACCTTGTCCCCGTCTCAGCGGCAGCTCAGTGAGGAGGAGCGGGGCCGGCTTCGGGACGTGGCAGCCCTGAATGGCCTGTACCGGGTGCGGGTCCCCAGACGGCCCGGGGCCCTCGACAGCTCAGAGGCTGGCGGCTATGTCTCTTCCTTTGTGCCTGCGTGCTCCCTGGTGGAGTCGCATCTCTCCGACCAGCTGACCCTGCACGTAGACGTGGCCGGCAATGTGGTGGGGGTGTCCGTGGTGACGGACCCCGGGGGCTGCCGGGGCCACGAGGTGGAAGACGTGGACCTGGAGCTGTTCAATACCTCGGTGCAGCTGCAGCCGCCGGGCACCGCCCCGGGCCCTGAGACAGCAGCCTTCATCGAGCGCTTGGAGATGGAGCAGGCCCAGAAGGCCAAGAACCCCCAGGAGCAGAAGTCCTTTTTCGCCAAATATTGGCGCCTCATCCTGGGGGGGGCCGTGTTGCTCACAGTGCTGCGTCCCGCTGCCCCGGGGCCCGCGCCGCCGCCGCAGGAGGCCTGA

XM_004866815.1 Coding sequence

Emc10 ER membrane protein complex subunit 10, transcript variant X2

High confidence: 4 potential gene matches
Length: 957 bp    Location: 4084855..4080893   Strand: -
>XM_004866815.1
ATGGTTGGGGCAGAAGGCCGTGAAGGGGAGAGCTGTGGCACCGTGGGGTTGCTGCTGGAGCACTCCTTTGAGATCGATGACGCTGCCCACTTCCGGAAGCGGGGCTCGCTGCTGTGGAACCAGCAGGATGGCACCTTGTCCCCGTCTCAGCGGCAGCTCAGTGAGGAGGAGCGGGGCCGGCTTCGGGACGTGGCAGCCCTGAATGGCCTGTACCGGGTGCGGGTCCCCAGACGGCCCGGGGCCCTCGACAGCTCAGAGGCTGGCGGCTATGTCTCTTCCTTTGTGCCTGCGTGCTCCCTGGTGGAGTCGCATCTCTCCGACCAGCTGACCCTGCACGTAGACGTGGCCGGCAATGTGGTGGGGGTGTCCGTGGTGACGGACCCCGGGGGCTGCCGGGGCCACGAGGTGGAAGACGTGGACCTGGAGCTGTTCAATACCTCGGTGCAGCTGCAGCCGCCGGGCACCGCCCCGGGCCCTGAGACAGCAGCCTTCATCGAGCGCTTGGAGATGGAGCAGGCCCAGAAGGCCAAGAACCCCCAGGAGCAGAAGTCCTTTTTCGCCAAATATGTGAGTGGGGGCCCTGGCCTCTCCGCTTCCTCACAGCCCCACCCAGCCTCCTCCCCTGTCCACACGCCCTTGCACGTCCATCCCTGTGCCCATCCGGTGCCTGGGCCGAGGACCGGAGCTGGGGGGTACAGGGCACAGGGATTTGTGGGCACAGCATGGAGGGGGAGACCAGGCAGGGACAGAGATGGGCCGGTGGCCTCACCCGAGCTGGGCTCCAGGAGGCAGGACAAGAGGGCTACAGAGGGTCAGCAAGGCCGGGCTGCCCGCGGGCTGAGGGTGCTGGCGGCCTGGGAAGCCCAGGGCAGCTGCTTGTGTCCTGACGGCCCACCAGCAGAGGCCCAGGGAAGGAGGCCCGGAGAGGCCCTGCCACGTGCTCTGGGGCCCCGCTGA

XM_004866809.1 Coding sequence

LOC101725004 josephin-2-like, transcript variant X3

Length: 1395 bp    Location: 4063994..4070352   Strand: +
>XM_004866809.1
ATGGCCCCTGCTGGGGTCCGGCGGAAGGTGGGGGTGGTGGGCTATGGCCGCCTGGGACAGTCCCTCGTCTCCCGCCTTCTGGCTCAGGGATCTGAACTGGGCCTTGAACTTGTATTTGTCTGGAACCGAGACCCAGGCCGCATGGCAGGGAGCGTGCCCCCGTCCCTGCAGCTCCACAGCCTCACTGCCCTTGGGGAAAGGCACCCTGATCTGGTGGTAGAAGTGGCCCATCCCAAAATAATCCAGGAATCTGGGGCACACATCCTGCGCCATGCCAACCTCCTGGTGGGGTCCCCATCAGCCCTGGCTGACCAGACCACACAGCAGCAGCTCCTTGCCGCCTCCCACCACTGGGGCCACGCCATGTTTGTGGCTCGAGGAGCACTGTGGGGGACTGAGGACATCTCGAGATTGGATGCAGCCGGAGGCCTCCAGAGCCTTCGAGTCACCATGGCCACACACCCAGATGGCTTCCGGCTAGAGGGACCCCTAGCTACCACTCACAGCACTGGGCCTCGCACTGTGCTCTACGAAGGCCCTGTCCGTGGGCTCTGCCCCTTTGCTCCCCGAAACTCCAACACCATGGCAGCTGCTGCCCTGGCTGCCCCCAGCCTAGGCTTTGACAACGTGATCGGGGTGCTTGTGGCGGATCTCAGCCTCGCGGACATGCACGTGGTGGACGTGGAGCTGAGAGGACCCCCGGGGCCCACGGGCCGGAATTTCGCTGTGCACACCCACCGGGAGAACCCAGCGGAGCCAGGCGCTGTCACCGGCTCCGCCACTGTTGCTGCCTTCTGGCGCAGCCTCCTGGCAGGAGCCGAGGGCAGCATGTCCCAGGCCCCAGGAGCACGGCCGAGCCCACCCTCCGTGTACCACGAGCGGCAGCGCCTGGAGCTGTGTGCCGTCCACGCCCTCAACAACGTTCTGCAGCAGCAGCTCTTTAGCCAGGAGGCTGCCGATGAGATCTGCAAGAGGCTGGCCCCCGACTCCCGGCTGAACCCCCACCGCAGCCTCCTGGGTACCGGCAACTATGACGTCAACGTGATCATGGCGGCCCTGCAGGGGCTGGGCCTGGCCGCTGTATGGTGGGACCGCAGGAGGCCCCTGTCCCAGCTGGCCCTGCCCCAGGTGCTGGGGCTGATCCTGAACCTGCCCTCGCCCGTGTCGCTGGGGCTGCTGTCCCTGCCACTGCGCCGGCGGCACTGGGTGGCCCTGCGCCAGGTGGACGGCATCTACTACAACCTCGACTCCAAACTGCGGGCGCCGGAGGCCCTTGGGGACGAGGATGGTGTCAGGGCCTTTGTGGCGGCCGCCCTGGCCCGAGGGCTGTGTGAGGTGCTGCTGGTGGTGACCAAGGAGGTGGAGGAGAAGGGCTGCTGGCTGCAGACAGACTGA

XM_004866811.1 Coding sequence

LOC101725004 josephin-2-like, transcript variant X5

Length: 1032 bp    Location: 4064465..4070352   Strand: +
>XM_004866811.1
ATGTTTGTGGCTCGAGGAGCACTGTGGGGGACTGAGGACATCTCGAGATTGGATGCAGCCGGAGGCCTCCAGAGCCTTCGAGTCACCATGGCCACACACCCAGATGGCTTCCGGCTAGAGGGACCCCTAGCTACCACTCACAGCACTGGGCCTCGCACTGTGCTCTACGAAGGCCCTGTCCGTGGGCTCTGCCCCTTTGCTCCCCGAAACTCCAACACCATGGCAGCTGCTGCCCTGGCTGCCCCCAGCCTAGGCTTTGACAACGTGATCGGGGTGCTTGTGGCGGATCTCAGCCTCGCGGACATGCACGTGGTGGACGTGGAGCTGAGAGGACCCCCGGGGCCCACGGGCCGGAATTTCGCTGTGCACACCCACCGGGAGAACCCAGCGGAGCCAGGCGCTGTCACCGGCTCCGCCACTGTTGCTGCCTTCTGGCGCAGCCTCCTGGCAGGAGCCGAGGGCAGCATGTCCCAGGCCCCAGGAGCACGGCCGAGCCCACCCTCCGTGTACCACGAGCGGCAGCGCCTGGAGCTGTGTGCCGTCCACGCCCTCAACAACGTTCTGCAGCAGCAGCTCTTTAGCCAGGAGGCTGCCGATGAGATCTGCAAGAGGCTGGCCCCCGACTCCCGGCTGAACCCCCACCGCAGCCTCCTGGGTACCGGCAACTATGACGTCAACGTGATCATGGCGGCCCTGCAGGGGCTGGGCCTGGCCGCTGTATGGTGGGACCGCAGGAGGCCCCTGTCCCAGCTGGCCCTGCCCCAGGTGCTGGGGCTGATCCTGAACCTGCCCTCGCCCGTGTCGCTGGGGCTGCTGTCCCTGCCACTGCGCCGGCGGCACTGGGTGGCCCTGCGCCAGGTGGACGGCATCTACTACAACCTCGACTCCAAACTGCGGGCGCCGGAGGCCCTTGGGGACGAGGATGGTGTCAGGGCCTTTGTGGCGGCCGCCCTGGCCCGAGGGCTGTGTGAGGTGCTGCTGGTGGTGACCAAGGAGGTGGAGGAGAAGGGCTGCTGGCTGCAGACAGACTGA

XM_004866802.1 Coding sequence

LOC101723695 leucine-rich repeat-containing protein 4B-like, transcript variant X1

Length: 2127 bp    Location: 4042519..4062160   Strand: +
>XM_004866802.1
ATGGCGCGTGCCCACTCCCCGTGCCCCCCACTGCCGCCCGGTAGGATGTCCTGGCCCCACGGGGCGCTGCTCTTCCTGTGGCTCTTCTCCCCACCCCTGGGGGCCGGCGGGGGCAGCGTGGCCGTCGCAGCGGCCGCAGGAGGGGGCTCCCCACCGGCCACCTCCTGCCCAGCCGCCTGCTCCTGCAGCAACCAGGCCAGCCGGGTCATCTGCACTCGGAGAGAGCTGGCCGAGGTCCCTGCCAGCATCCCCGTCAACACGCGGTACCTGAACCTGCAGGAGAACGGCATCCAGGTGATCCGCACGGACACGTTCAAGCACCTGCGCCACCTGGAGATCCTGCAGCTGAGCAAGAACCTGGTGCGGAAGGTCGAGGTGGGCGCCTTCAACGGGCTGCCCAGCCTGAACACGCTGGAGCTCTTCGACAACCGGCTGACCACGGTGCCCACGCAGGCCTTCGAGTACCTGTCCAAGCTGCGGGAGCTCTGGCTGCGCAACAACCCCATCGAGAGCATCCCCTCCTACGCCTTCAACCGCGTGCCCTCGCTGCGCCGCCTCGACCTGGGTGAGCTCAAGCGGCTGGAGTACATCTCCGAGGCGGCCTTCGAGGGGCTGGTCAACCTGCGCTACCTCAACCTGGGCATGTGCAACCTCAAGGACATCCCCAACCTGACGGCCCTGGTGCGCCTGGAGGAGCTGGAGCTGTCGGGCAACCGGCTGGACCTGATCCGCCCCGGCTCCTTCCAGGGCCTCACCAGCCTGCGGAAGCTGTGGCTCATGCACGCCCAGGTGGCCACCATCGAGCGCAACGCCTTCGACGACCTCAAGTCGCTGGAGGAGCTCAACCTGTCCCACAACAACCTGATGTCGCTGCCCCACGACCTGTTCACGCCCCTGCACCGCCTCGAGCGCGTGCACCTCAACCACAATCCCTGGCACTGCAACTGCGACGTGCTCTGGCTGAGCTGGTGGCTCAAGGAGACGGTGCCCAGCAACACCACCTGCTGCGCACGCTGCCACGCGCCCGCGGGGCTCAAGGGTCGCTACATCGGCGAGCTGGACCAGTCGCACTTCACCTGCTACGCGCCCGTCATCGTGGAGCCGCCCACGGACCTCAACGTCACCGAGGGGATGGCGGCCGAGCTCAAGTGCCGCACGGGCACCTCCATGACCTCGGTGAACTGGCTGACGCCCAACGGCACGCTCATGACGCACGGCTCCTACCGCGTGCGCATCTCCGTGCTGCACGATGGCACGCTCAACTTCACCAACGTCACCGTGCAGGACACCGGCCAGTACACGTGCATGGTGACGAACTCGGCCGGCAACACCACGGCCTCCGCCACCCTCAACGTCTCCGCCGTGGACCCCGTGGCGGCCGGGGGCGGCGGAGCCCCGGGGGGCGGCGCTGGCGGCGTCACAGGGGGCAGCGGCGGCTACACCTACTTCACCACGGTGACGGTGGAGACGCTGGAGACGCAGCCGGGGGAGGAGGCGCTGCAGCCCCGCGGGACGGAGAAGGAGCCCCCGGGGCCCACGACTGACGGCGCCTGGGGCGGGGCGCGGCCCGGGGACGCCTTGGGCCCGGCCTCGTCGTCCACCACGGCGCCTGCGCCGCGCTCCTCGCGGCCCACGGAGAAGGCGTTCACGGTGCCCATCACGGACGTGACGGAGAACGCCCTCAAGGACCTGGACGACGTGATGAAGACCACCAAGATCATCATCGGCTGCTTCGTGGCCATCACATTCATGGCAGCGGTGATGCTCGTGGCCTTCTACAAGCTGCGCAAGCAGCACCAGATGCACAAGCATCACGGGCCCACGCGCACCGTGGAGATCATCAACGTGGAGGACGAGCTGCCCGCCGCCTCGGCCGTGTCCGTGGCCGCCGCCGCCGTGGCCGGGGGCGCGGGCGTGGGCGGCGACAGCCACCTGGCGCTGCCGGCTCTGGAGCGCGACCACCTCAACCACCACCACTACGTGACGGCCGCCTTCAAGGCGCACTACGGCGGCGCGGCGGGCGGCGGGGGCTGCGGGGGCAAAGGCCCGGCCGGCCTCAACTCCATCCACGAACCTCTGCTCTTCAAGAGCGGCTCCAAGGAGAACGTGCAAGAGACGCAGATCTGA

XM_004866806.1 Coding sequence

LOC101723695 leucine-rich repeat-containing protein 4B-like, transcript variant X5

Length: 2127 bp    Location: 4043022..4062160   Strand: +
>XM_004866806.1
ATGGCGCGTGCCCACTCCCCGTGCCCCCCACTGCCGCCCGGTAGGATGTCCTGGCCCCACGGGGCGCTGCTCTTCCTGTGGCTCTTCTCCCCACCCCTGGGGGCCGGCGGGGGCAGCGTGGCCGTCGCAGCGGCCGCAGGAGGGGGCTCCCCACCGGCCACCTCCTGCCCAGCCGCCTGCTCCTGCAGCAACCAGGCCAGCCGGGTCATCTGCACTCGGAGAGAGCTGGCCGAGGTCCCTGCCAGCATCCCCGTCAACACGCGGTACCTGAACCTGCAGGAGAACGGCATCCAGGTGATCCGCACGGACACGTTCAAGCACCTGCGCCACCTGGAGATCCTGCAGCTGAGCAAGAACCTGGTGCGGAAGGTCGAGGTGGGCGCCTTCAACGGGCTGCCCAGCCTGAACACGCTGGAGCTCTTCGACAACCGGCTGACCACGGTGCCCACGCAGGCCTTCGAGTACCTGTCCAAGCTGCGGGAGCTCTGGCTGCGCAACAACCCCATCGAGAGCATCCCCTCCTACGCCTTCAACCGCGTGCCCTCGCTGCGCCGCCTCGACCTGGGTGAGCTCAAGCGGCTGGAGTACATCTCCGAGGCGGCCTTCGAGGGGCTGGTCAACCTGCGCTACCTCAACCTGGGCATGTGCAACCTCAAGGACATCCCCAACCTGACGGCCCTGGTGCGCCTGGAGGAGCTGGAGCTGTCGGGCAACCGGCTGGACCTGATCCGCCCCGGCTCCTTCCAGGGCCTCACCAGCCTGCGGAAGCTGTGGCTCATGCACGCCCAGGTGGCCACCATCGAGCGCAACGCCTTCGACGACCTCAAGTCGCTGGAGGAGCTCAACCTGTCCCACAACAACCTGATGTCGCTGCCCCACGACCTGTTCACGCCCCTGCACCGCCTCGAGCGCGTGCACCTCAACCACAATCCCTGGCACTGCAACTGCGACGTGCTCTGGCTGAGCTGGTGGCTCAAGGAGACGGTGCCCAGCAACACCACCTGCTGCGCACGCTGCCACGCGCCCGCGGGGCTCAAGGGTCGCTACATCGGCGAGCTGGACCAGTCGCACTTCACCTGCTACGCGCCCGTCATCGTGGAGCCGCCCACGGACCTCAACGTCACCGAGGGGATGGCGGCCGAGCTCAAGTGCCGCACGGGCACCTCCATGACCTCGGTGAACTGGCTGACGCCCAACGGCACGCTCATGACGCACGGCTCCTACCGCGTGCGCATCTCCGTGCTGCACGATGGCACGCTCAACTTCACCAACGTCACCGTGCAGGACACCGGCCAGTACACGTGCATGGTGACGAACTCGGCCGGCAACACCACGGCCTCCGCCACCCTCAACGTCTCCGCCGTGGACCCCGTGGCGGCCGGGGGCGGCGGAGCCCCGGGGGGCGGCGCTGGCGGCGTCACAGGGGGCAGCGGCGGCTACACCTACTTCACCACGGTGACGGTGGAGACGCTGGAGACGCAGCCGGGGGAGGAGGCGCTGCAGCCCCGCGGGACGGAGAAGGAGCCCCCGGGGCCCACGACTGACGGCGCCTGGGGCGGGGCGCGGCCCGGGGACGCCTTGGGCCCGGCCTCGTCGTCCACCACGGCGCCTGCGCCGCGCTCCTCGCGGCCCACGGAGAAGGCGTTCACGGTGCCCATCACGGACGTGACGGAGAACGCCCTCAAGGACCTGGACGACGTGATGAAGACCACCAAGATCATCATCGGCTGCTTCGTGGCCATCACATTCATGGCAGCGGTGATGCTCGTGGCCTTCTACAAGCTGCGCAAGCAGCACCAGATGCACAAGCATCACGGGCCCACGCGCACCGTGGAGATCATCAACGTGGAGGACGAGCTGCCCGCCGCCTCGGCCGTGTCCGTGGCCGCCGCCGCCGTGGCCGGGGGCGCGGGCGTGGGCGGCGACAGCCACCTGGCGCTGCCGGCTCTGGAGCGCGACCACCTCAACCACCACCACTACGTGACGGCCGCCTTCAAGGCGCACTACGGCGGCGCGGCGGGCGGCGGGGGCTGCGGGGGCAAAGGCCCGGCCGGCCTCAACTCCATCCACGAACCTCTGCTCTTCAAGAGCGGCTCCAAGGAGAACGTGCAAGAGACGCAGATCTGA

XM_004866804.1 Coding sequence

LOC101723695 leucine-rich repeat-containing protein 4B-like, transcript variant X3

Length: 2127 bp    Location: 4044196..4062160   Strand: +
>XM_004866804.1
ATGGCGCGTGCCCACTCCCCGTGCCCCCCACTGCCGCCCGGTAGGATGTCCTGGCCCCACGGGGCGCTGCTCTTCCTGTGGCTCTTCTCCCCACCCCTGGGGGCCGGCGGGGGCAGCGTGGCCGTCGCAGCGGCCGCAGGAGGGGGCTCCCCACCGGCCACCTCCTGCCCAGCCGCCTGCTCCTGCAGCAACCAGGCCAGCCGGGTCATCTGCACTCGGAGAGAGCTGGCCGAGGTCCCTGCCAGCATCCCCGTCAACACGCGGTACCTGAACCTGCAGGAGAACGGCATCCAGGTGATCCGCACGGACACGTTCAAGCACCTGCGCCACCTGGAGATCCTGCAGCTGAGCAAGAACCTGGTGCGGAAGGTCGAGGTGGGCGCCTTCAACGGGCTGCCCAGCCTGAACACGCTGGAGCTCTTCGACAACCGGCTGACCACGGTGCCCACGCAGGCCTTCGAGTACCTGTCCAAGCTGCGGGAGCTCTGGCTGCGCAACAACCCCATCGAGAGCATCCCCTCCTACGCCTTCAACCGCGTGCCCTCGCTGCGCCGCCTCGACCTGGGTGAGCTCAAGCGGCTGGAGTACATCTCCGAGGCGGCCTTCGAGGGGCTGGTCAACCTGCGCTACCTCAACCTGGGCATGTGCAACCTCAAGGACATCCCCAACCTGACGGCCCTGGTGCGCCTGGAGGAGCTGGAGCTGTCGGGCAACCGGCTGGACCTGATCCGCCCCGGCTCCTTCCAGGGCCTCACCAGCCTGCGGAAGCTGTGGCTCATGCACGCCCAGGTGGCCACCATCGAGCGCAACGCCTTCGACGACCTCAAGTCGCTGGAGGAGCTCAACCTGTCCCACAACAACCTGATGTCGCTGCCCCACGACCTGTTCACGCCCCTGCACCGCCTCGAGCGCGTGCACCTCAACCACAATCCCTGGCACTGCAACTGCGACGTGCTCTGGCTGAGCTGGTGGCTCAAGGAGACGGTGCCCAGCAACACCACCTGCTGCGCACGCTGCCACGCGCCCGCGGGGCTCAAGGGTCGCTACATCGGCGAGCTGGACCAGTCGCACTTCACCTGCTACGCGCCCGTCATCGTGGAGCCGCCCACGGACCTCAACGTCACCGAGGGGATGGCGGCCGAGCTCAAGTGCCGCACGGGCACCTCCATGACCTCGGTGAACTGGCTGACGCCCAACGGCACGCTCATGACGCACGGCTCCTACCGCGTGCGCATCTCCGTGCTGCACGATGGCACGCTCAACTTCACCAACGTCACCGTGCAGGACACCGGCCAGTACACGTGCATGGTGACGAACTCGGCCGGCAACACCACGGCCTCCGCCACCCTCAACGTCTCCGCCGTGGACCCCGTGGCGGCCGGGGGCGGCGGAGCCCCGGGGGGCGGCGCTGGCGGCGTCACAGGGGGCAGCGGCGGCTACACCTACTTCACCACGGTGACGGTGGAGACGCTGGAGACGCAGCCGGGGGAGGAGGCGCTGCAGCCCCGCGGGACGGAGAAGGAGCCCCCGGGGCCCACGACTGACGGCGCCTGGGGCGGGGCGCGGCCCGGGGACGCCTTGGGCCCGGCCTCGTCGTCCACCACGGCGCCTGCGCCGCGCTCCTCGCGGCCCACGGAGAAGGCGTTCACGGTGCCCATCACGGACGTGACGGAGAACGCCCTCAAGGACCTGGACGACGTGATGAAGACCACCAAGATCATCATCGGCTGCTTCGTGGCCATCACATTCATGGCAGCGGTGATGCTCGTGGCCTTCTACAAGCTGCGCAAGCAGCACCAGATGCACAAGCATCACGGGCCCACGCGCACCGTGGAGATCATCAACGTGGAGGACGAGCTGCCCGCCGCCTCGGCCGTGTCCGTGGCCGCCGCCGCCGTGGCCGGGGGCGCGGGCGTGGGCGGCGACAGCCACCTGGCGCTGCCGGCTCTGGAGCGCGACCACCTCAACCACCACCACTACGTGACGGCCGCCTTCAAGGCGCACTACGGCGGCGCGGCGGGCGGCGGGGGCTGCGGGGGCAAAGGCCCGGCCGGCCTCAACTCCATCCACGAACCTCTGCTCTTCAAGAGCGGCTCCAAGGAGAACGTGCAAGAGACGCAGATCTGA

XM_004866780.1 Coding sequence

Klk6 kallikrein-related peptidase 6, transcript variant X3

Length: 744 bp    Location: 3785644..3793074   Strand: +
>XM_004866780.1
ATGGCCATGAAGATGCTGACCGTGGCCCTGGTTCTCCTGGCTGGAGCCTTCGCAGAGGAGCAGGAGAAACTGGTGCACGGAGGGCCCTGCCACAGGGACTCTCACCCCTACCAAGCTGCTCTCTACAACTCGGGCCACCTGCTCTGCGGCGGGGTCCTCATCGACCCGGAGTGGGTTCTCACGGCTGCCCACTGCAAAAAAGAGAAGCTTCATGTCTACCTAGGGAAGCACAACCTTCGACAGTCGAAGAATACAGAGGACATTTCTGTGATCAAGACTGTGGTCCACCCTGGCTACAATCCTGCCACCCATGACCAGGACATCATGTTGTTGCGTCTGTCCAAACCTGCCAAGCTCTCCGACTGGATCCAGCCACTGCCTCTGGAGAGGGACTGTGGGGCCAGATCACCCCGCTGCCACATCCTGGGCTGGGGCAAGACAGAACAAGGTGTCTTTCCTGACACCATCCAGTGTGCCTATGTCCACATCGTGCCCCAGGAGAAGTGCGATCAGGCCTACCCCGGCCAGATCACCAGGAACATGGTGTGTGCTGGAGATCCGGAAGAAGGAAAGGATGCCTGCCAGGGTGACTCCGGGGGCCCACTGGTCTGTGGAGGCCGCCTCCGGGGCCTGGTGTCCTGGGGTAACGTCCCCTGCGGATCCAAGGAGAAGCCAGGAGTCTACACTGACGTCTGCAGATACGTCAGCTGGATCCAAAGAACCATGCGAGGCCACTGGCCCTGA

XM_004866798.1 Coding sequence

Syt3 synaptotagmin III, transcript variant X5

Length: 1758 bp    Location: 3991819..4003608   Strand: +
>XM_004866798.1
ATGTCTGGAGACTACGAGGAAGACCTCTGCCGGCGAGCGCTCATCCTGGTCTCAGAGCTCTGTGCGAGGTTCCGAGACACTGACACCAGAGACAGATGCCAGGAGTTCAACAGCCGGATCCCCGGCTACCCCCGGGGCCCCGACGCAGACATTTCTGTGAGTCTGCTGTCGGTCATCGTGACCTTCTGTGGCATTGTCCTTCTCGGCGTCTCCCTCTTCGTGTCCTGGAAGTTGTGCTGGGTGCCCTGGAGGGACAAGGGCGGCTCTGCGGTGGGCGGCGGCCCCCTGCGCAAAGACCTGGGCCCTGGTGTGGGGCTGGCAGGGCTGGTGGGCGGCGGACACCTGGGCACCGGCCTGGGCGGGCACCCTCTGCTGGGCGGCCACCACGCCCACGCCCACGCCGCCCAGCACCCGCCCTTCGCCGAGCTGCTGGAGCCGGGCGGCCTGGGGGGCTCCGACCCCCCCGAGCCCTCCTACTTGGACATGGACTCCTATCCCGAGGCTGCAGCCGCCGCTGTGGTGGCTGCCGGGGTCAAACCGAGCCAGACGTCGCCTGAGCTGCCCTCCGAGGCCGGGGCGGGCTCGGGGCTGCTGCTGCTGCCGCCCAGCGGTGGTGGCTTGCCCAGCGCCCAGTCGCATCACCAGGTCACAAGCCTCGCACCCAGCACCAGGTACCCAGCCCTGCCTCGGCCCCTCACGCAGCAGACCCTGACTACACAGTCAGACCCCAGCAGTGAGGAGCGGCCACCCGCCCTCCCCCTGCCTCTGCCCGGCGGTGAGGAGAAGGCCAAACTCATCGGCCAGATCAAGCCGGAGCTGTACCAGGGGACTGGGCCAGGTGGCCGGAGGGGCGGCGGAGGCTCAGGCGAGGCGGGGACCCCCTGCGGCCGCATCAGCTTTGCCCTGAGGTATCTGTACGGCTCCGACCAGCTGGTGGTGCGGATCCTGCAGGCCTTGGACCTCCCGGCCAAGGACTCCAATGGCTTCTCAGACCCCTACGTGAAGATCTACCTGCTACCCGACCGCAAGAAGAAATTTCAGACTAAGGTGCACAGGAAGACCCTGAACCCCGTCTTCAATGAGACGTTCCAGTTCTCGGTGCCCCTGGCTGAGCTGGCCCAGCGCAAGCTGCACTTCAGCGTCTATGACTTTGACCGCTTCTCGCGGCATGACCTCATCGGCCAGGTGGTGCTAGACAACCTCCTGGAGCTGGCTGAGCAGCCCCCCGACCGCCCGCTCTGGAGGGACATCATGGAGGGTGGCTCGGAAAAGGCAGATCTTGGGGAGCTCAACTTTTCACTCTGCTACCTCCCCACGGCCGGGCGCCTCACCGTGACCATCATTAAAGCCTCTAACCTCAAAGCGATGGACCTCACGGGCTTCTCAGACCCCTACGTAAAGGCCTCTCTGATCAGCGAGGGGCGGCGTCTGAAGAAGCGCAAAACCTCCATCAAGAAGAACACGCTGAACCCCACGTACAACGAGGCGCTGGTGTTCGACGTGGCCCCCGAGAGCGTGGAAAACGTGGGGCTCAGCATCGCCGTGGTGGACTACGATTGCATCGGGCACAATGAGGTGATCGGCGTGTGCCGCGTGGGCCCCGAGGCCGCCGACCCCCACGGCCGCGAGCACTGGGCCGAGATGCTGGCCAACCCGCGCAAGCCTGTGGAGCACTGGCACCAGCTGGTGGAGGAGAAGACTCTGACCAGCTTCACAAAAGGCGGCAAAGGACTATCAGAGAAGGAGAACTCAGAGTGA

XM_004866800.1 Coding sequence

Syt3 synaptotagmin III, transcript variant X7

Length: 1758 bp    Location: 3991819..4003608   Strand: +
>XM_004866800.1
ATGTCTGGAGACTACGAGGAAGACCTCTGCCGGCGAGCGCTCATCCTGGTCTCAGAGCTCTGTGCGAGGTTCCGAGACACTGACACCAGAGACAGATGCCAGGAGTTCAACAGCCGGATCCCCGGCTACCCCCGGGGCCCCGACGCAGACATTTCTGTGAGTCTGCTGTCGGTCATCGTGACCTTCTGTGGCATTGTCCTTCTCGGCGTCTCCCTCTTCGTGTCCTGGAAGTTGTGCTGGGTGCCCTGGAGGGACAAGGGCGGCTCTGCGGTGGGCGGCGGCCCCCTGCGCAAAGACCTGGGCCCTGGTGTGGGGCTGGCAGGGCTGGTGGGCGGCGGACACCTGGGCACCGGCCTGGGCGGGCACCCTCTGCTGGGCGGCCACCACGCCCACGCCCACGCCGCCCAGCACCCGCCCTTCGCCGAGCTGCTGGAGCCGGGCGGCCTGGGGGGCTCCGACCCCCCCGAGCCCTCCTACTTGGACATGGACTCCTATCCCGAGGCTGCAGCCGCCGCTGTGGTGGCTGCCGGGGTCAAACCGAGCCAGACGTCGCCTGAGCTGCCCTCCGAGGCCGGGGCGGGCTCGGGGCTGCTGCTGCTGCCGCCCAGCGGTGGTGGCTTGCCCAGCGCCCAGTCGCATCACCAGGTCACAAGCCTCGCACCCAGCACCAGGTACCCAGCCCTGCCTCGGCCCCTCACGCAGCAGACCCTGACTACACAGTCAGACCCCAGCAGTGAGGAGCGGCCACCCGCCCTCCCCCTGCCTCTGCCCGGCGGTGAGGAGAAGGCCAAACTCATCGGCCAGATCAAGCCGGAGCTGTACCAGGGGACTGGGCCAGGTGGCCGGAGGGGCGGCGGAGGCTCAGGCGAGGCGGGGACCCCCTGCGGCCGCATCAGCTTTGCCCTGAGGTATCTGTACGGCTCCGACCAGCTGGTGGTGCGGATCCTGCAGGCCTTGGACCTCCCGGCCAAGGACTCCAATGGCTTCTCAGACCCCTACGTGAAGATCTACCTGCTACCCGACCGCAAGAAGAAATTTCAGACTAAGGTGCACAGGAAGACCCTGAACCCCGTCTTCAATGAGACGTTCCAGTTCTCGGTGCCCCTGGCTGAGCTGGCCCAGCGCAAGCTGCACTTCAGCGTCTATGACTTTGACCGCTTCTCGCGGCATGACCTCATCGGCCAGGTGGTGCTAGACAACCTCCTGGAGCTGGCTGAGCAGCCCCCCGACCGCCCGCTCTGGAGGGACATCATGGAGGGTGGCTCGGAAAAGGCAGATCTTGGGGAGCTCAACTTTTCACTCTGCTACCTCCCCACGGCCGGGCGCCTCACCGTGACCATCATTAAAGCCTCTAACCTCAAAGCGATGGACCTCACGGGCTTCTCAGACCCCTACGTAAAGGCCTCTCTGATCAGCGAGGGGCGGCGTCTGAAGAAGCGCAAAACCTCCATCAAGAAGAACACGCTGAACCCCACGTACAACGAGGCGCTGGTGTTCGACGTGGCCCCCGAGAGCGTGGAAAACGTGGGGCTCAGCATCGCCGTGGTGGACTACGATTGCATCGGGCACAATGAGGTGATCGGCGTGTGCCGCGTGGGCCCCGAGGCCGCCGACCCCCACGGCCGCGAGCACTGGGCCGAGATGCTGGCCAACCCGCGCAAGCCTGTGGAGCACTGGCACCAGCTGGTGGAGGAGAAGACTCTGACCAGCTTCACAAAAGGCGGCAAAGGACTATCAGAGAAGGAGAACTCAGAGTGA

XM_004866789.1 Coding sequence

Shank1 SH3 and multiple ankyrin repeat domains 1, transcript variant X1

Length: 6435 bp    Location: 3936911..3978630   Strand: +
>XM_004866789.1
ATGACCCACAGCCCCGCGACAAGCGAGGACGAGGAACGCCACAGTGCCAGCGAGTGTCCCGAGGGGGGCTCAGCGTCCGACAGCTCCCCAGACGGGCCAGGGCGAGGCCTCCGGGGGACCCGGGGCCAGGGCAGTGGGGCACCTGGTAACCTGGCCTCGGCCCGAGGCCTCCAGGGCCGCTCCATGTCTGTCCCTGACGACGCCCACTTCAGCATGATGGTCTTCAGGATTGGCATCCCGGACCTGCACCAGACAAAATGCCTGCGCTTCAACCCCGATGCCACCATCTGGACAGCCAAGCAGCAGGTGCTCTGCGCCCTGAGCGAGAGCCTGCAGGACGTGCTCAACTACGGCCTCTTCCAGCCGGCCACCTCCGGCCGCGACGCCAACTTCCTGGAGGAGGAGCGGCTGCTACGGGAGTACCCCCAGTCCTTCGAGAAGGGGGTCCCCTACCTGGAGTTCCGATACAAGACCCGAGTTTACAAACAGACCAACCTGGACGAGAAGCAGCTGGCCAAGCTGCACACGAAGACAGGGTTGAAGAAGTTCCTGGAGTATGTGCAGCTCGGGACGTCTGACAAGGTGGCGCGACTGCTGGACAAGGGGCTGGACCCCAACTACCACGACTCGGATTCGGGAGAGACCCCCTTGACTCTAGCGGCCCAGACTGAAGGCTCTGTAGAGGTGATTCGAACTCTGTGCCTGGGTGGAGCCCACATTGACTTCCGGGCCCGGGATGGCATGACAGCGCTGCACAAGGCCGCGTGTGCCCGACACTGCCTGGCGCTCACGGCACTCCTGGACCTCGGGGGATCCCCCAACTACAAGGACCGCCGGGGCCTAACCCCTCTGTTCCACACCGCCATGGTGGGGGGGGACCCCCGCTGCTGCGAGCTGCTTCTGTACAACAGAGCCCAGCTGGGCATAGCAGACGAGAATGGCTGGCAGGAGATTCACCAGGCCTGTCAGCGGGGCCACTCTCAGCACCTGGAGCACCTGCTCTTCTACGGGGCTGAGCCTGGAGCCCAGAATGCCTCGGGGAACACGGCCCTGCACATCTGTGCTCTCTACAACAAGGAGACCTGCGCCAGGATCCTCCTGTATCGAGGGGCCAACAAGGATGTGAAGAATAATAGCGGACAGACACCCTTTCAGGTGGCAGTGATTGCTGGGAACTTCGAGCTAGGGGAGCTCATCCGGAACCATCGGGAGCAGGATGTGGTGCCCTTTCAGGAGTCCCCAAAGTACGCGGCTCGGCGACGGGGACCCCCAGGGGCAGGGTTGACAGTGCCCCCTGCGCTGCTCAGGGCCAACAGCGACACCAGCATGGCGCTGCCCGACTGGATGGTGTTCTCTGCCCCGGGGCCCTCACCCTCCGGGGCCCCGGGCCCTACCTCAGGGCCCCAGGTCCAGTCACAGCCCTCAGCCCCCAGCACCAAGCTCAGCAGCGGGACCCTCCGAAGTGCCAGCAGCCCTCGGGGCGCCAGGGCCCGGTCCCCATCCCGAGGGAGGCACCCCGAGGATGCCAAGAGGCAACCCCGAGGACGGCCCAGCTCCAGCGGGACGCCCCGGGAAGGGCCTGCCGGGGGAACGGGGGGCTCCGGGGGTCCTGGGGGCTCCCTGGGCAGCCGAGGCCGAAGGAGGAAACTCTACTCAGCAGTCCCTGGACGCTCCTTCATGGCTGTGAAGTCGTACCAGGCCCAAGGCGAGGGCGAGATCTCCCTGAGCAAGGGCGAGAAGATCAAAGTGCTCAGCATCGGGGAAGGAGGCTTCTGGGAAGGGCAGGTCAAAGGTCGAGTAGGCTGGTTCCCCTCTGACTGCCTGGAAGAGGTGGCAAACCGCTCCCAGGAGGGAAAGCAAGAGAGCCGCAGCGACAAGGCAAAGAGACTCTTCCGACATTATACCGTGGGCTCCTACGACAGCTTCGATGCCCCAAGCTTGATGGATGGGATTGGCCCAGGGAGCGATTACATCATTAAGGAGAAAACAGTCTTGCTGCAGAAGAGGGACAGCGAGGGGTTTGGGTTCGTGCTCCGGGGGGCCAAGGCGCAGACCCCCATCGAGGAGTTCACCCCTACCCCGGCCTTCCCGGCGCTGCAGTACCTCGAGTCCGTGGACGAGGGGGGCGTGGCATGGCGGGCTGGACTGCGAATGGGAGACTTCCTCATCGAGGTGAACGGGCAGAATGTGGTGAAGGTCGGCCACCGCCAGGTGGTGAACATGATCCGCCAAGGGGGCAACACGCTCATGGTGAAGGTGGTGATGGTCACCAGGCACCCGGACATGGACGAGGCCGTCCACAAGAAAGCACCCCAGCAGGCGAAGCGGCTCCCGCCCCCAGCGATCTCCCTGCGCTCCAAGTCAATGACCTCCGAGCTGGAGGAAATGGTCTCCCCCTGGAGGAAGAAGAGCGAGTATGAGCAACCTCCTACGCCGGTGCCCAGCATGGAGAAAAAGCGGACAGTGTATCAGATGGCTCTCAACAAACTGGACGAGATACTGGCTGCAGCCCAGCAGACTATCAGCGCGAGCGAGAGCCCTGCGCCGGGAGGCCTGGCGTCCCTGGGCAAGCACCGGCCCAAAGGCTTTTTCGCCACCGAGTCAAGCTTCGATCCCCATCACCGCTCCCAGCCAAGTTACGAGCGCCCTTCCTTCCTGCCTCCTGGACCTGGGCTCATGCTCCGACAAAAATCTATCGGGGCTGCAGAGGATGACAGACCGTACCTAGCACCCCCAGCCATGAAGTTCAGCCGCAGCCTGTCTGTGCCGGGCTCGGAGGACATCCCCCCGCCGCCCACCACGTCCCCACCAGAGCCCCCGTACAGCACACCCCCGGCCCCCTCCTCCTCGGGCCGCCTCACCCCGTCCCCGCGGGGAGGCCCCTTCAACCCCGGCTCCGGGGGACCCCTCCCCGCCTCCTCCCCAGCGTCCTTTGACGGCCCCTCCCCTCCCGACACGCGCGTGGGGGGCCGGGACAAGAGCCTGTACCACGGTGGCCCCTTGCCCCCTGCGCACCACCACCACCACCACCACCACCACCACCACGCGCACCCGCCGCACCCGCCCGAGATGGAGACGGGCGCCCCCGACGACGCCCCGCCACGCCTGGCTCTGGGGCCCCAGCCCAGCCTGCGGGGCTGGAGGGGCGGCGGGCCCAGCCCGAGCCCGGGGGCGCCCTCACCGTCGCACCACGCGGGGGCTGGCGCCGGGGGCGCCCCGCAAGCCCCGGCCCTGCGCTACTTCCAGCTGCCGCCGCGCGCCGCTAGCGCCGCCATGTACGTGCCCGCGCGCTCCGGCCGCGGCCGCAAGGGGCCGCTGGTCAAGCAGACCAAGGTGGAGGGCGAGCCGCACAAGGGCGCCCTGCCTCCCGCCGCGCCCGGGTCCCCCGCGTCGCCGCAGCCGCTGCCCCCCGCGCCCGCGCCGGCCGAGAAGAACTCCATCCCCATCCCCACCATCATCATCAAGGCTCCGTCCACCAGCAGCAGCGGCCGCAGCAGCCAGGGCAGCAGCACCGAGGCCGAGCCGCCCACCCAGCCCGAGACCCCCGCAGGCGGCGGGGGCTCGTCATCCAGCCCAGCGCCGCCCCTGTCGCCCGTGCCGCCCTCGCCGTCGCCCGTGCCCACGCCCGCGTCGCCCAGCGGCCCGGCCACCCTGGACTTCACCAGCCAGTTCGGGGCGGCGCTGGTGGGCGCGGCGCGCAGGGATGGCGGCTGGCAGAACGAGGCCCGCCGGCGCTCCACGCTCTTCCTTTCCACGGACGCGGGAGACGAGGAAGGCGGCGAAGGCGGGCTGGGCGCCGGGGCCACCCCGGGCCCGCGGCTGCGCCACTCCAAGTCCATCGACGAGGGCATGTTCTCCGCCGAGCCCTACCTCCGCCTGGAGTCTGCGGGCGGCTCGGGGAGCTCCGGCTACGCGGGCTACTCGGCGGGCGCACGCGCCTACGCGGGCAGCGGGGCCAGCAGCGCCTTCTCCAGCTTCCTGCCCCCGCGGCCCCTGCTGCACCCGCTCACCGGCAAGGCCCTGGACCCGGCCTCCCCGCTCGGGCTGGCGCTGGCCGCCCGTGAGCGCGCGCTGAAGGAGTCCTCAGAGGGCGGCGGCGCCCCCCAGCCCCCGCCCCGCCCCCCCTCGCCCCGCTACGACGCGCCGCCGCCCACCCCGCATCACCACTCGCCCCACGCGCACCACGAGCCCGTGCTGCGCCTCTGGGGGGCGCCGCCGCCCGACCCCCCGCGCCGGGAGCTGGGCTACCGAGCGGGGCTGGGCGGGCCAGAGAAGCCGCTCCCCGCCAGCCCACCCGCCGCGCGGCGCTCGCTGCTGCACCGCCTGCCGCCCACGGCGCCCGGCGTGGGGCCCCTGCTGCTGCAGCTGGGGCCCGAGCCTCCCGCCCCACACCCCGGGGTCAGCAAGGCCTGGAGGTCTGGAGGCGCGGAGGAGCCTGAGCGGCTACCCCTCCACGTGCGCTTCCTCGAGAACTGTCAGCCGCGCGCCAGGCCGGCGGCGGTCTCCAGGGGGCCCTCGGCGGAGGATGGGCCCGGGGTCCCGCCGCTCAGCCCGCGCCGCTCCGTGCCCGCCTGTCCCACGTCCCCGCGGGGCGGCGAGGAGAATGGGCTCCCTCTGCTCGTGCTGCCGCCGCCGGCCCCGTCGGTGGACGCGGACGACGGTGACTTCCTCTTTGCGGAGCCGCTTCCCCCACCCCTCGAGTTTTCCAACAGCTTCGAGAAGCCGGAGTCGCCCCTCACGCCGGGCCCCCCCCAGCCGCTCCCGGACCCCCCTGCTCCAGTCACCCCCCTGCCCCCCGTGCCCCCCCCGGCGGCAGCCGCCCCTGGCCCGCCCGCCCTGGACTCCACTGCATCCAGCCTGACGTCCTATGACAGCGAGGTGGCCACGCTCACTCAGGGGCCCCCCGCGGCTCCCGGGGACCACCCCACCCCAGGCCCGCCGGCCCCAGCGGCCCCAGCGCCCCCCGCCCCGCAGCCGGGCCCAGATCCGCCACCGGGCACGGACTCCGGGATCGAGGAGGTGGACAGTCGCAGCAGCAGTGACCACCCCTTGGAGACCATCAGCAGCGCGTCCACGCTGAGCAGCCTGTCTGCCGAGGGCGGGGGCGGGGTGGCCAGCGGGCCTGAGCTGCTGGACACCTACGTGGCCTACTTGGACGGCCAGGCCTTCGGGGGCAGCGGGCCGCCGTATCCCCCGCAGCTCACGACTCCCTCGAAGCTCCGAGGCCGGGCGCTGGGGGCAGCCGGAGGCCTTCGACCCGGCCCCAGTGGCGGGCTCCGAGACCCTGTCACCCCCACCAGCCCCACGGTCTCTGTGACTGGGGCCGGAAACGACGGGCTGCTGGCCCTGAGCGCCTGTTCGGGGCCCTCTTCGGCAGGCGTGGCCGGGGGCCCGGTATCGGTGGAGCCGGAAGTCCCCCCGGTGCCCTTGCCTGCCGCCGCCTCCCTGCCTCGGAAGCTACTGCCCTGGGAGGAGGGCCCGGGCCCGCCACCACCACCCCTGTCTGGGCCCCTGTCCCAGCCTCAGGCCTCCGCCTTGGCCACCGTCAAAGCCAGCATCATCAGCGAACTCAGCTCCAAGCTCCAGCAGTTCGGGGGCTCCTCAGCAGCTGGAGGGGCTCTGCCTTGGGCCCGGGGAGGCAGCGGGGGCACTGGGGACAGCCACCACGGTGGAGCCGGCTACGTCCCCGAGAGGACCTCCTCCCTGCAGCGGCAGAGGCTCTCCGACGACTCCCAGTCCTCGCTCCTCCCCAAGCCCGTGGGCAGCCTGTTTCAGAACTGGCCCAAGCCACCTCTGCCGCCACTCCCCACTGGATCCGGGGTGTCGCCTTCAGCCACTGCACCCCCGGGGGCCATCTCACCTTCTGCTTCCTCCTCCTCCACCTCCTCCCGCCACCTCCAGGGCGTAGAGTTCGAGATGCGGCCCCCCCTGCTCCGCCGGGCCCCCAGCCCCTCGCTGCTGCCCGCCTCGGAGCACAAGGTCAGCCCAGCACCCAGGCCCTCGTCCCTGCCCATCCTGCCTTCAGGCCCTCTCTACCCGGGCCTCTTCGACATCCGCGGCTCCCCCACCGGTGGGGCGGGGGGCTCCGCGGACCCCTTCGCCCCTGTCTTCGTGCCGCCGCACGCGGGGATGTCCGGGGGCCTGGGAGGAGCCTTGTCGGGGGCCTCTCGCTCCCTGTCGCCCACCCGCCTGCTGTCGCTGCCCCCGGACAAACCGTTTGGCGCCAAACCTCTGGGCTTCTGGACCAAGTTCGATGTGGCCGACTGGCTAGAGTGGCTGGGCCTGGCCGAGCACCGGGCCCGCTTCCTGGACCACGAGATCGACGGCTCCCACCTGCCCGCCTTGACCAAGGAGGACTATGTGGACCTGGGGGTCACCAGGGTGGGCCACCGCATGAACATCGACCGGGCTCTCAAGTTTTTCCTGGAGAGGTGA

XM_004866791.1 Coding sequence

Shank1 SH3 and multiple ankyrin repeat domains 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 6411 bp    Location: 3936911..3978630   Strand: +
>XM_004866791.1
ATGACCCACAGCCCCGCGACAAGCGAGGACGAGGAACGCCACAGTGCCAGCGAGTGTCCCGAGGGGGGCTCAGCGTCCGACAGCTCCCCAGACGGGCCAGGGCGAGGCCTCCGGGGGACCCGGGGCCAGGGCAGTGGGGCACCTGGTAACCTGGCCTCGGCCCGAGGCCTCCAGGGCCGCTCCATGTCTGTCCCTGACGACGCCCACTTCAGCATGATGGTCTTCAGGATTGGCATCCCGGACCTGCACCAGACAAAATGCCTGCGCTTCAACCCCGATGCCACCATCTGGACAGCCAAGCAGCAGGTGCTCTGCGCCCTGAGCGAGAGCCTGCAGGACGTGCTCAACTACGGCCTCTTCCAGCCGGCCACCTCCGGCCGCGACGCCAACTTCCTGGAGGAGGAGCGGCTGCTACGGGAGTACCCCCAGTCCTTCGAGAAGGGGGTCCCCTACCTGGAGTTCCGATACAAGACCCGAGTTTACAAACAGACCAACCTGGACGAGAAGCAGCTGGCCAAGCTGCACACGAAGACAGGGTTGAAGAAGTTCCTGGAGTATGTGCAGCTCGGGACGTCTGACAAGGTGGCGCGACTGCTGGACAAGGGGCTGGACCCCAACTACCACGACTCGGATTCGGGAGAGACCCCCTTGACTCTAGCGGCCCAGACTGAAGGCTCTGTAGAGGTGATTCGAACTCTGTGCCTGGGTGGAGCCCACATTGACTTCCGGGCCCGGGATGGCATGACAGCGCTGCACAAGGCCGCGTGTGCCCGACACTGCCTGGCGCTCACGGCACTCCTGGACCTCGGGGGATCCCCCAACTACAAGGACCGCCGGGGCCTAACCCCTCTGTTCCACACCGCCATGGTGGGGGGGGACCCCCGCTGCTGCGAGCTGCTTCTGTACAACAGAGCCCAGCTGGGCATAGCAGACGAGAATGGCTGGCAGGAGATTCACCAGGCCTGTCAGCGGGGCCACTCTCAGCACCTGGAGCACCTGCTCTTCTACGGGGCTGAGCCTGGAGCCCAGAATGCCTCGGGGAACACGGCCCTGCACATCTGTGCTCTCTACAACAAGGAGACCTGCGCCAGGATCCTCCTGTATCGAGGGGCCAACAAGGATGTGAAGAATAATAGCGGACAGACACCCTTTCAGGTGGCAGTGATTGCTGGGAACTTCGAGCTAGGGGAGCTCATCCGGAACCATCGGGAGCAGGATGTGGTGCCCTTTCAGGAGTCCCCAAAGTACGCGGCTCGGCGACGGGGACCCCCAGGGGCAGGGTTGACAGTGCCCCCTGCGCTGCTCAGGGCCAACAGCGACACCAGCATGGCGCTGCCCGACTGGATGGTGTTCTCTGCCCCGGGGCCCTCACCCTCCGGGGCCCCGGGCCCTACCTCAGGGCCCCAGGTCCAGTCACAGCCCTCAGCCCCCAGCACCAAGCTCAGCAGCGGGACCCTCCGAAGTGCCAGCAGCCCTCGGGGCGCCAGGGCCCGGTCCCCATCCCGAGGGAGGCACCCCGAGGATGCCAAGAGGCAACCCCGAGGACGGCCCAGCTCCAGCGGGACGCCCCGGGAAGGGCCTGCCGGGGGAACGGGGGGCTCCGGGGGTCCTGGGGGCTCCCTGGGCAGCCGAGGCCGAAGGAGGAAACTCTACTCAGCAGTCCCTGGACGCTCCTTCATGGCTGTGAAGTCGTACCAGGCCCAAGGCGAGGGCGAGATCTCCCTGAGCAAGGGCGAGAAGATCAAAGTGCTCAGCATCGGGGAAGGAGGCTTCTGGGAAGGGCAGGTCAAAGGTCGAGTAGGCTGGTTCCCCTCTGACTGCCTGGAAGAGGTGGCAAACCGCTCCCAGGAGGGAAAGCAAGAGAGCCGCAGCGACAAGGCAAAGAGACTCTTCCGACATTATACCGTGGGCTCCTACGACAGCTTCGATGCCCCAAGCTTGATGGATGGGATTGGCCCAGGGAGCGATTACATCATTAAGGAGAAAACAGTCTTGCTGCAGAAGAGGGACAGCGAGGGGTTTGGGTTCGTGCTCCGGGGGGCCAAGGCGCAGACCCCCATCGAGGAGTTCACCCCTACCCCGGCCTTCCCGGCGCTGCAGTACCTCGAGTCCGTGGACGAGGGGGGCGTGGCATGGCGGGCTGGACTGCGAATGGGAGACTTCCTCATCGAGGTGAACGGGCAGAATGTGGTGAAGGTCGGCCACCGCCAGGTGGTGAACATGATCCGCCAAGGGGGCAACACGCTCATGGTGAAGGTGGTGATGGTCACCAGGCACCCGGACATGGACGAGGCCGTCCACAAGAAAGCACCCCAGCAGGCGAAGCGGCTCCCGCCCCCAGCGATCTCCCTGCGCTCCAAGTCAATGACCTCCGAGCTGGAGGAAATGGAGTATGAGCAACCTCCTACGCCGGTGCCCAGCATGGAGAAAAAGCGGACAGTGTATCAGATGGCTCTCAACAAACTGGACGAGATACTGGCTGCAGCCCAGCAGACTATCAGCGCGAGCGAGAGCCCTGCGCCGGGAGGCCTGGCGTCCCTGGGCAAGCACCGGCCCAAAGGCTTTTTCGCCACCGAGTCAAGCTTCGATCCCCATCACCGCTCCCAGCCAAGTTACGAGCGCCCTTCCTTCCTGCCTCCTGGACCTGGGCTCATGCTCCGACAAAAATCTATCGGGGCTGCAGAGGATGACAGACCGTACCTAGCACCCCCAGCCATGAAGTTCAGCCGCAGCCTGTCTGTGCCGGGCTCGGAGGACATCCCCCCGCCGCCCACCACGTCCCCACCAGAGCCCCCGTACAGCACACCCCCGGCCCCCTCCTCCTCGGGCCGCCTCACCCCGTCCCCGCGGGGAGGCCCCTTCAACCCCGGCTCCGGGGGACCCCTCCCCGCCTCCTCCCCAGCGTCCTTTGACGGCCCCTCCCCTCCCGACACGCGCGTGGGGGGCCGGGACAAGAGCCTGTACCACGGTGGCCCCTTGCCCCCTGCGCACCACCACCACCACCACCACCACCACCACCACGCGCACCCGCCGCACCCGCCCGAGATGGAGACGGGCGCCCCCGACGACGCCCCGCCACGCCTGGCTCTGGGGCCCCAGCCCAGCCTGCGGGGCTGGAGGGGCGGCGGGCCCAGCCCGAGCCCGGGGGCGCCCTCACCGTCGCACCACGCGGGGGCTGGCGCCGGGGGCGCCCCGCAAGCCCCGGCCCTGCGCTACTTCCAGCTGCCGCCGCGCGCCGCTAGCGCCGCCATGTACGTGCCCGCGCGCTCCGGCCGCGGCCGCAAGGGGCCGCTGGTCAAGCAGACCAAGGTGGAGGGCGAGCCGCACAAGGGCGCCCTGCCTCCCGCCGCGCCCGGGTCCCCCGCGTCGCCGCAGCCGCTGCCCCCCGCGCCCGCGCCGGCCGAGAAGAACTCCATCCCCATCCCCACCATCATCATCAAGGCTCCGTCCACCAGCAGCAGCGGCCGCAGCAGCCAGGGCAGCAGCACCGAGGCCGAGCCGCCCACCCAGCCCGAGACCCCCGCAGGCGGCGGGGGCTCGTCATCCAGCCCAGCGCCGCCCCTGTCGCCCGTGCCGCCCTCGCCGTCGCCCGTGCCCACGCCCGCGTCGCCCAGCGGCCCGGCCACCCTGGACTTCACCAGCCAGTTCGGGGCGGCGCTGGTGGGCGCGGCGCGCAGGGATGGCGGCTGGCAGAACGAGGCCCGCCGGCGCTCCACGCTCTTCCTTTCCACGGACGCGGGAGACGAGGAAGGCGGCGAAGGCGGGCTGGGCGCCGGGGCCACCCCGGGCCCGCGGCTGCGCCACTCCAAGTCCATCGACGAGGGCATGTTCTCCGCCGAGCCCTACCTCCGCCTGGAGTCTGCGGGCGGCTCGGGGAGCTCCGGCTACGCGGGCTACTCGGCGGGCGCACGCGCCTACGCGGGCAGCGGGGCCAGCAGCGCCTTCTCCAGCTTCCTGCCCCCGCGGCCCCTGCTGCACCCGCTCACCGGCAAGGCCCTGGACCCGGCCTCCCCGCTCGGGCTGGCGCTGGCCGCCCGTGAGCGCGCGCTGAAGGAGTCCTCAGAGGGCGGCGGCGCCCCCCAGCCCCCGCCCCGCCCCCCCTCGCCCCGCTACGACGCGCCGCCGCCCACCCCGCATCACCACTCGCCCCACGCGCACCACGAGCCCGTGCTGCGCCTCTGGGGGGCGCCGCCGCCCGACCCCCCGCGCCGGGAGCTGGGCTACCGAGCGGGGCTGGGCGGGCCAGAGAAGCCGCTCCCCGCCAGCCCACCCGCCGCGCGGCGCTCGCTGCTGCACCGCCTGCCGCCCACGGCGCCCGGCGTGGGGCCCCTGCTGCTGCAGCTGGGGCCCGAGCCTCCCGCCCCACACCCCGGGGTCAGCAAGGCCTGGAGGTCTGGAGGCGCGGAGGAGCCTGAGCGGCTACCCCTCCACGTGCGCTTCCTCGAGAACTGTCAGCCGCGCGCCAGGCCGGCGGCGGTCTCCAGGGGGCCCTCGGCGGAGGATGGGCCCGGGGTCCCGCCGCTCAGCCCGCGCCGCTCCGTGCCCGCCTGTCCCACGTCCCCGCGGGGCGGCGAGGAGAATGGGCTCCCTCTGCTCGTGCTGCCGCCGCCGGCCCCGTCGGTGGACGCGGACGACGGTGACTTCCTCTTTGCGGAGCCGCTTCCCCCACCCCTCGAGTTTTCCAACAGCTTCGAGAAGCCGGAGTCGCCCCTCACGCCGGGCCCCCCCCAGCCGCTCCCGGACCCCCCTGCTCCAGTCACCCCCCTGCCCCCCGTGCCCCCCCCGGCGGCAGCCGCCCCTGGCCCGCCCGCCCTGGACTCCACTGCATCCAGCCTGACGTCCTATGACAGCGAGGTGGCCACGCTCACTCAGGGGCCCCCCGCGGCTCCCGGGGACCACCCCACCCCAGGCCCGCCGGCCCCAGCGGCCCCAGCGCCCCCCGCCCCGCAGCCGGGCCCAGATCCGCCACCGGGCACGGACTCCGGGATCGAGGAGGTGGACAGTCGCAGCAGCAGTGACCACCCCTTGGAGACCATCAGCAGCGCGTCCACGCTGAGCAGCCTGTCTGCCGAGGGCGGGGGCGGGGTGGCCAGCGGGCCTGAGCTGCTGGACACCTACGTGGCCTACTTGGACGGCCAGGCCTTCGGGGGCAGCGGGCCGCCGTATCCCCCGCAGCTCACGACTCCCTCGAAGCTCCGAGGCCGGGCGCTGGGGGCAGCCGGAGGCCTTCGACCCGGCCCCAGTGGCGGGCTCCGAGACCCTGTCACCCCCACCAGCCCCACGGTCTCTGTGACTGGGGCCGGAAACGACGGGCTGCTGGCCCTGAGCGCCTGTTCGGGGCCCTCTTCGGCAGGCGTGGCCGGGGGCCCGGTATCGGTGGAGCCGGAAGTCCCCCCGGTGCCCTTGCCTGCCGCCGCCTCCCTGCCTCGGAAGCTACTGCCCTGGGAGGAGGGCCCGGGCCCGCCACCACCACCCCTGTCTGGGCCCCTGTCCCAGCCTCAGGCCTCCGCCTTGGCCACCGTCAAAGCCAGCATCATCAGCGAACTCAGCTCCAAGCTCCAGCAGTTCGGGGGCTCCTCAGCAGCTGGAGGGGCTCTGCCTTGGGCCCGGGGAGGCAGCGGGGGCACTGGGGACAGCCACCACGGTGGAGCCGGCTACGTCCCCGAGAGGACCTCCTCCCTGCAGCGGCAGAGGCTCTCCGACGACTCCCAGTCCTCGCTCCTCCCCAAGCCCGTGGGCAGCCTGTTTCAGAACTGGCCCAAGCCACCTCTGCCGCCACTCCCCACTGGATCCGGGGTGTCGCCTTCAGCCACTGCACCCCCGGGGGCCATCTCACCTTCTGCTTCCTCCTCCTCCACCTCCTCCCGCCACCTCCAGGGCGTAGAGTTCGAGATGCGGCCCCCCCTGCTCCGCCGGGCCCCCAGCCCCTCGCTGCTGCCCGCCTCGGAGCACAAGGTCAGCCCAGCACCCAGGCCCTCGTCCCTGCCCATCCTGCCTTCAGGCCCTCTCTACCCGGGCCTCTTCGACATCCGCGGCTCCCCCACCGGTGGGGCGGGGGGCTCCGCGGACCCCTTCGCCCCTGTCTTCGTGCCGCCGCACGCGGGGATGTCCGGGGGCCTGGGAGGAGCCTTGTCGGGGGCCTCTCGCTCCCTGTCGCCCACCCGCCTGCTGTCGCTGCCCCCGGACAAACCGTTTGGCGCCAAACCTCTGGGCTTCTGGACCAAGTTCGATGTGGCCGACTGGCTAGAGTGGCTGGGCCTGGCCGAGCACCGGGCCCGCTTCCTGGACCACGAGATCGACGGCTCCCACCTGCCCGCCTTGACCAAGGAGGACTATGTGGACCTGGGGGTCACCAGGGTGGGCCACCGCATGAACATCGACCGGGCTCTCAAGTTTTTCCTGGAGAGGTGA

XM_004866783.1 Coding sequence

Klk4 kallikrein-related peptidase 4

High confidence: 4 potential gene matches
Length: 768 bp    Location: 3828676..3832023   Strand: +
>XM_004866783.1
ATGATGGTCACAGCAGGAAACCCCTGGGGCTGGCTTCTGGGGTACCTCGTCCTTGGGGTCACAGGTACCTGGTCCTCGCACCCCGGCAGCCACATCATCAACGGTGAGGACTGCGCCCCGCACTCGCAGCCCTGGCAGGCGGCGCTGCTCTTGGACAACGAACTGTTCTGCTCGGGGGTCCTGGTGCACCCGCAGTGGGTGCTGTCCGCCGCGCACTGCTTGCTGGACTCCTACAGCGTGGGGCTGGGGCTGCACAACCTCGGGACCAGCCACGAGCCGGGCAGCCGGGTCCTGGAGCCCCTCCTGTCCATCCGGCACCCCGAGTACGACAACCCCGCCTTCGCCAACGACCTCATGCTCATCAAGCTGAAAGAGGCGGTGCCCGAGTCCAGCACCATCCGGAGCATCAGTGTGGCCTCCCGGTGCCCCGTGGAGGGGGACGCGTGTCTGGTCTCCGGCTGGGGCCGCCTGGCCAACGGCGGACTGCCCAGCCGGCTGCAGTGCGTGAACATCTCCGTGGCGCCCCAGGAGGTCTGCAGCGAGGTCTACGACTCCGTGTACCACTACAGCATGTTCTGTGCCGGCGGAGGGCCGAACCGCAGGGACTCCTGCCACGGTGACTCTGGGGGGCCCTTGGTGTGCAACAGGTCCCTGCAGGGCCTTGTGTCTTTAGGACACATCCCGTGTGGCCAGCCTGGCTCACCGAGCGTCTACACCAACCTCTGCAAATTCACTGACTGGATACAGCAAACCATGCACACCAGTTAG

XM_004866786.1 Coding sequence

Klk1 kallikrein 1

High confidence: 1 potential gene match
Length: 792 bp    Location: 3869294..3873350   Strand: +
>XM_004866786.1
ATGTGGTTCCTGATTCTGGGCCTCACCCTGTTCCTGGGGGAGACTGGTGCGGCGCCAACCATCCAGTCCCGAATCGTAGGAGGCCAGAGCTGTCCGAAGGCTTCCCAGCCCTGGCAGGCGGCTTTGTACCACTTCAGCAACATCCAGTGCGGGGCCGTCCTGGTGGACCCTCAGTGGGTGCTCACGGCCGCCCACTGCATCAGCAACGACTACCAGGTCTGGCTGGGTCGCCACAGCCTGTTTGATGATGAAGACACAGCTCAGCACGTCACCGTCAGCCAGAGCTTCCCTCACCCACTGTTCAACATGAGCCTCCTGGAGCCGCATCCCAGCAACCCAGAGGACGACTACAGCCACGACCTGATGCTGCTCCGCCTGAAGGAGCCCGCGCGGATCACAGAGAGCGTGCAGGTCCTGGCGCTGCCCTCGGAAGCAGCAGCGGTGGCAGCCAAGTGCCTGGCCTCGGGCTGGGGCAGCATAAACCCGGATGCCGACCATGCTGTGTACCCAGACAACCTGCAGTGTGTGGACCTCAAAATCCTGCCCAATGAGGACTGCGCAAATGCCCACGTGGTGAAGGTGACAGACAGCATGCTGTGTGCGGGGCACCCGGAAGGTGGCAAAGACACCTGTGTGGGTGACTCGGGGGGCCCACTGGTCTGTGATAGAGTGCTGCACGGAATCACATCATGGGGCTACAACCCATGCGGAATCCCCGGGACACCTGGCATCTACACCAATATCAAACAGCACCTAGAGTGGATAAATGAAATCATGGCAAAAAATCCCTGA

XM_004866785.1 Coding sequence

Klk15 kallikrein-related peptidase 15, transcript variant X2

Length: 753 bp    Location: 3862479..3867187   Strand: +
>XM_004866785.1
ATGTGGCTCCTGCTCACCTTCTCCTTCCTGCTGATGTCTGCAGCCCAGGACAGTGATGAAGAGTGTGCGCCCCACTCCCAGCCGTGGCAAGTGGCCCTCTTCGGGCGTGGACGCTTCAACTGCGGGGCTTCCCTCATCTCCCCGCGCTGGGTGCTGACTGCTGCCCACTGCCAGACCCGCTTCATGACAGTGCGCCTGGGTGAGCACAACCTGCGCAAGCGCGATGGCCCTGAGCAGCTGCGTCTTGTTTCGCGCATCATCCCACATCCGGGCTACAAAGCGCGAAGCCACCGCCATGACGTCATGCTGCTCCAGTTAGCTCGGCCCGCACGTCTGACCCGCCAGGTGCGACCAGTGCCTCTGCCCACGCGTTGCCCGCAACCTGGTGAGCCCTGCGTGGTGTCCGGCTGGGGCCTGGTGTCAGACAACAAGCCAGAGACCACAGGAAGCTCTGAGTCACAAGTGACCCTCCCAGATACCCTGCACTGTGCCAACATCAGCGTTATCTCCCAAGCGTCTTGTAACAAGGACTACCCAGGGTACCTGATGGACACCATGGTGTGCGCCACAGTGGAGGGCAGAGGCACGGACTCCTGTGAGGGTGACTCCGGGGGACCCATGGTCTGTGGGGGTGCCCTGCAGGGCATTGTGTCCTGGGGCGACGTACCTTGTGACACTACCACCAAGGCTGGTGTCTACACCAAAGTATGCCGCTACTTGCAGTGGATCAGGGAAACCATGAAGAGGAACTAA

XM_004866776.1 Coding sequence

Klk8 kallikrein-related peptidase 8, transcript variant X4

Length: 765 bp    Location: 3763956..3768485   Strand: +
>XM_004866776.1
ATGCCCCGCCCCCGCCCCGGCCGTGCAGGCCTGATGTGGACGGTCCTGCTGCTGCTGCTGCTGCTGCTGCTGGCCTCTTGGCCAGGCCGAACCGAGGCGCAGGTGAGCAAGGTTCTGCAGGGCAGTGAGTGCGAGCCCCACTCACAGCCGTGGCAGACGGCCTTGTTCCAGGGCGAGCGGCTGCTCTGCGGGGGCGTCCTGGTGGGCACCAGAAAGTACACAGTGCGCCTGGGAGATCACAGCCTGCAGAGTAAGGATGAACCAGAACAAGAAATTTCTGTGGCTCAGTCCATCCAGCACCCCTGCTACAACAGCAGCAACAGTGAAGACCGCAATCACGATCTGATGCTCATCCGACTGAGAAAGCAGGCGTCCCTAGGCCCCAAAGTGCAGCCCATTGACCTGGCGAAGCATTGTGCCAAAGTTGGCCAGAAGTGCACCATCTCAGGCTGGGGCACTGTCACCAGTCCCAGAGAGAACTTTCCTGACACCCTCAACTGCGCAGAGGTGGAGATCTTCTCCCTGAGGAAGTGTGAGGAGGCCTACCCAGGGCAGGTCACAGACGGCATGGTCTGTGCGGGCAACAGCAATGGGGCCGACACCTGCCAGGGCGATTCCGGAGGCCCACTGGTATGTGACGGCGTTCTCCAGGGCATCACATCCTGGGGCTCAGACCCCTGCGGGAGGCCCAAGAAACCCGGTGTCTATACCAGCATCTGCCACTACCGCAAATGGATCAAGAAGACCATGGGCAACAGGGGCTGA

XM_004866774.1 Coding sequence

Klk8 kallikrein-related peptidase 8, transcript variant X2

Length: 798 bp    Location: 3763957..3768485   Strand: +
>XM_004866774.1
ATGCCCCGCCCCCGCCCCGGCCGTGCAGGCCTGATGTGGACGGTCCTGCTGCTGCTGCTGCTGCTGCTGCTGGCCTCTTGGCCAGGCCGAACCGAGGCGCAGGTGAGCAAGGTTCTGCAGGGCAGTGAGTGCGAGCCCCACTCACAGCCGTGGCAGACGGCCTTGTTCCAGGGCGAGCGGCTGCTCTGCGGGGGCGTCCTGGTGGGCACCAGGTGGGTCCTCTCTGCAGCCCACTGTAAAAAAACAAAGTACACAGTGCGCCTGGGAGATCACAGCCTGCAGAGTAAGGATGAACCAGAACAAGAAATTTCTGTGGCTCAGTCCATCCAGCACCCCTGCTACAACAGCAGCAACAGTGAAGACCGCAATCACGATCTGATGCTCATCCGACTGAGAAAGCAGGCGTCCCTAGGCCCCAAAGTGCAGCCCATTGACCTGGCGAAGCATTGTGCCAAAGTTGGCCAGAAGTGCACCATCTCAGGCTGGGGCACTGTCACCAGTCCCAGAGAGAACTTTCCTGACACCCTCAACTGCGCAGAGGTGGAGATCTTCTCCCTGAGGAAGTGTGAGGAGGCCTACCCAGGGCAGGTCACAGACGGCATGGTCTGTGCGGGCAACAGCAATGGGGCCGACACCTGCCAGGGCGATTCCGGAGGCCCACTGGTATGTGACGGCGTTCTCCAGGGCATCACATCCTGGGGCTCAGACCCCTGCGGGAGGCCCAAGAAACCCGGTGTCTATACCAGCATCTGCCACTACCGCAAATGGATCAAGAAGACCATGGGCAACAGGGGCTGA

XM_004866775.1 Coding sequence

Klk8 kallikrein-related peptidase 8, transcript variant X3

Length: 798 bp    Location: 3764036..3768485   Strand: +
>XM_004866775.1
ATGCCCCGCCCCCGCCCCGGCCGTGCAGGCCTGATGTGGACGGTCCTGCTGCTGCTGCTGCTGCTGCTGCTGGCCTCTTGGCCAGGCCGAACCGAGGCGCAGGTGAGCAAGGTTCTGCAGGGCAGTGAGTGCGAGCCCCACTCACAGCCGTGGCAGACGGCCTTGTTCCAGGGCGAGCGGCTGCTCTGCGGGGGCGTCCTGGTGGGCACCAGGTGGGTCCTCTCTGCAGCCCACTGTAAAAAAACAAAGTACACAGTGCGCCTGGGAGATCACAGCCTGCAGAGTAAGGATGAACCAGAACAAGAAATTTCTGTGGCTCAGTCCATCCAGCACCCCTGCTACAACAGCAGCAACAGTGAAGACCGCAATCACGATCTGATGCTCATCCGACTGAGAAAGCAGGCGTCCCTAGGCCCCAAAGTGCAGCCCATTGACCTGGCGAAGCATTGTGCCAAAGTTGGCCAGAAGTGCACCATCTCAGGCTGGGGCACTGTCACCAGTCCCAGAGAGAACTTTCCTGACACCCTCAACTGCGCAGAGGTGGAGATCTTCTCCCTGAGGAAGTGTGAGGAGGCCTACCCAGGGCAGGTCACAGACGGCATGGTCTGTGCGGGCAACAGCAATGGGGCCGACACCTGCCAGGGCGATTCCGGAGGCCCACTGGTATGTGACGGCGTTCTCCAGGGCATCACATCCTGGGGCTCAGACCCCTGCGGGAGGCCCAAGAAACCCGGTGTCTATACCAGCATCTGCCACTACCGCAAATGGATCAAGAAGACCATGGGCAACAGGGGCTGA

XM_004866777.1 Coding sequence

Klk8 kallikrein-related peptidase 8, transcript variant X5

Length: 645 bp    Location: 3764824..3768485   Strand: +
>XM_004866777.1
ATGCAGTTCTGGGGTCTTCTGGGCTCTGGGACTGCCCCCAAAGGTGCTGATCCAACCCTCTCTCTCCTGCTGCAGGCCGAACCGAGGCGCAGAAAGTACACAGTGCGCCTGGGAGATCACAGCCTGCAGAGTAAGGATGAACCAGAACAAGAAATTTCTGTGGCTCAGTCCATCCAGCACCCCTGCTACAACAGCAGCAACAGTGAAGACCGCAATCACGATCTGATGCTCATCCGACTGAGAAAGCAGGCGTCCCTAGGCCCCAAAGTGCAGCCCATTGACCTGGCGAAGCATTGTGCCAAAGTTGGCCAGAAGTGCACCATCTCAGGCTGGGGCACTGTCACCAGTCCCAGAGAGAACTTTCCTGACACCCTCAACTGCGCAGAGGTGGAGATCTTCTCCCTGAGGAAGTGTGAGGAGGCCTACCCAGGGCAGGTCACAGACGGCATGGTCTGTGCGGGCAACAGCAATGGGGCCGACACCTGCCAGGGCGATTCCGGAGGCCCACTGGTATGTGACGGCGTTCTCCAGGGCATCACATCCTGGGGCTCAGACCCCTGCGGGAGGCCCAAGAAACCCGGTGTCTATACCAGCATCTGCCACTACCGCAAATGGATCAAGAAGACCATGGGCAACAGGGGCTGA

XM_004866769.1 Coding sequence

Siglec7 sialic acid binding Ig-like lectin 7, transcript variant X3

Length: 1329 bp    Location: 3655605..3653201   Strand: -
>XM_004866769.1
ATGACCACCTCACTTCCTCAGGCCGCTTGTGAACCAGGTTCCCCTCTGGGTCCTCATTATGTTTTAACACTCAGCATGCTCACCCGCACCGCCCCAGTGCCTCCCCTGCTCAGCCTTCCTGAGACTGACCGTCCAACCTGGGTCCTGCAGCTCTGGGTTCCTCAGAGTAGAGGCTGGAGGAGGAGCAGACTCCCCTGGGTGGACCCGCAGCTCCAGATCGACATGCTGCTGCTGCTGCTGCTGCCTGTGCTGCTGCTGCTCTGGGTGCAGGAGGGGGTGTGGGGAGAGGCTTACTCCTTGAAGGTGCAGAGCCCGGTAACGGTGCAGGAGGGCCTGTGTGTCCATGTGCCCTGTGAGTTCACCCACCCCTATGAAGACCAGACTGAGTTGGACGCAGCTCACGGCTACTGGTTCCGGGAAAAGGCTGGGTTTACAAGACAGACTGTTGTGGTGGCCACAAATGATCCAAGTCAACCGGTGGAGAAGGAAACCAAGGGCCGATTCCACCTCACTGGGGATCCGCGAGCCAACAACTGCTCCCTGGACATCAGAGACGCCCAGAAGAAGGACGAAGGGTCATTCGTCTTTCGGATGGAGAGAGGACGGAAACGATACAGTTACATAGCATACCCGGTCTCTGTGCGTGTGACAGCCCTGACCCACACCCCCGGCATCCTCATCCCGGGGACCCTGCAGCCCGGCCGCCCCAGCAACCTGACCTGCTCTGTGCCCTGGGCCTGCGAGCGGGGGACGCCCCCCATCTTCTCCTGGGCGGGCGCCTCTGTGTCCCACCTGGACCCCGCGGTCACGAGCTCCCCCGTGCTCACCCTCACCCCGCGGCCCCAGGACCACGGCACCGCCCTCAGCTGTCAGGTGACTCTGCCCGCGGCCAGTGTGACCACGAGGACGACCGTGCAGCTCAACATCTCCTGTGAGAGCTGGGCGGGAAGGCGGGCTGGGGACGGAGAGGGCTCCGGGGCGGGAGAGGGGCTGGGTCCGGGCTGGGCGCCGGTCCTGGAATCTCGGGGCTGGGGCAGGGGCCGGAGGGCGCAGCCTCCCCCCTCCCGCCTCTGCAGCCCCTGGGGCGGAGGGCCGATGTTCCCGCCTCGCCACGGCCACCGACGGCCCTGCCTTGTCTCTTGCCCCAGACGCTCCGCGGAACCTGACGGTAACGGTGGCCCCCGGAGCAGGCGCAGACTCCTGCACAGATCCCTCGGCCCCGCAAGGATGGGGCGACTCGCACGCAGCGGAATTGAACTCTCCAGGCCCCTCCTCGCCCCTCCGCTGGATCCGCCTCCACCCTTCTCTCTCTCTCTATTCCCCCAGTAG

XM_004866757.1 Coding sequence

Etfb electron-transfer-flavoprotein, beta polypeptide, transcript variant X2

Length: 705 bp    Location: 3506169..3518760   Strand: +
>XM_004866757.1
ATGGCGGAGCTGCGCGCGCTCGTGGCTGTCAAGAGAGTCATCGACTTCGCGGTGAAGATCCGGGTGAAGCCTGACAAGACAGGGGTCGTCACTGATGGCGTGAAGCACTCCATGAACCCCTTCTGTGAGATTGCTGTGGAGGAGGCCGTGCGGCTCAAGGAGAAGAAGCTGGTGAAGGAGGTCATCGCTGTCAGCTGTGGCCCCGTGCAGTGCCAGGAGACCATCCGCACGGCCCTGGCCATGGGTGCAGACCGAGGCATCCACGTGGAGGTGCCAGCTGCAGAAGCCGACCGTGTGGGTCCCCTGCAGGTGGCCCGGGTCCTGGCCAAGCTGGCTGAGAGGGAGAAGGTGGACCTGGTGCTGCTGGGCAAACAGGGCACCTTCGCCTCCCAGGTGACGCTGGAGGGGGCCAAGCTGAAAGTGGAGCGGGAGATTGACGGGGGCCTGGAGACCCTCCGCCTGAAGCTGCCGGCTGTGGTGACCACAGACCTGAGGCTCAATGAGCCCCGCTACGCCACGCTGCCCAACATCATGAAAGCCAAGAAGAAGAAGATCGAGGTGATCAAGGCCAGCGACCTGGGCGTGGACCTGAGCTCCAAGCTCACCGTGGTCAGCGTGGAGGACCCACCCCAGCGCACGGCTGGTGTCAAGGTGGAGACCACTGAAGACCTGGTGGCCAAGCTGAAGGAGGTTGGGCGGATCTGA

XM_004866758.1 Coding sequence

Etfb electron-transfer-flavoprotein, beta polypeptide, transcript variant X3

Length: 675 bp    Location: 3506169..3518624   Strand: +
>XM_004866758.1
ATGGCGGAGCTGCGCGCGCTCGTGGCTGTCAAGAGAGTCATCGACTTCGCGGTGAAGATCCGGGTGAAGCCTGACAAGACAGGGGTCGTCACTGATGGCGTGAAGCACTCCATGAACCCCTTCTGTGAGATTGCTGTGGAGGAGGCCGTGCGGCTCAAGGAGAAGAAGCTGGTGAAGGAGGTCATCGCTGTCAGCTGTGGCCCCGTGCAGTGCCAGGAGACCATCCGCACGGCCCTGGCCATGGGTGCAGACCGAGGCATCCACGTGGAGGTGCCAGCTGCAGAAGCCGACCGTGTGGGTCCCCTGCAGGTGGCCCGGGTCCTGGCCAAGCTGGCTGAGAGGGAGAAGGTGGACCTGGTGCTGCTGGGCAAACAGGCCATTGATGATGACTGTAACCAGACGGGTCAGATGACGGCTGGGCTTCTAGACTGGCCACAGGGCACCTTCGCCTCCCAGGTGACGCTGGAGGGGGCCAAGCTGAAAGTGGAGCGGGAGATTGACGGGGGCCTGGAGACCCTCCGCCTGAAGCTGCCGGCTGTGGTGACCACAGACCTGAGGCTCAATGAGCCCCGCTACGCCACGCTGCCCAACATCATGACGATGGGTCCCTCAGTCCCTGCTGGCCAACACGGGGCTCCCTGCAGGGGGCTTGCTAAAGAAGGGCTACTGGCATAG

XM_004866764.1 Coding sequence

LOC101712244 sialic acid-binding Ig-like lectin 13-like, transcript variant X2

Length: 879 bp    Location: 3593387..3591883   Strand: -
>XM_004866764.1
ATGCTGGCACCTCTGCTGCTGCCCCTGCTGTGGGCAGGGTCTCTGGCTAATATTCCAGGATACCAGCTGACAGTGCCAGAGCCCGTGGTGGTGCAGGAGGGACAGAGCACCTTCATAGCCTGCAGAGTCTCCTACCCCGGGAGATACTGGAGCAACTTTTCCCCAGCCTGGGGCTACTGGTTCAAGAAAGAGGCTAATTATGACCGGGATCCTCCAGTGGTCACAAATAACCCATCTCGTGAAGTGCAGAAAGAGACCCAGGGCCAATTCCACCTCCTTGGAGACCCCAGGACCTACAACTGCTCCCTGCGCATCAGAGATGCGCGCAACAAGGACATAGGAGTCTACTTCTTTAGGGTGGAGAGAGGCAGTGGCATGCAGTACAATTACAGACAGAACCAGCTCTGTGTGTTTGTGATGGAGACTCCTGACATCCACATCGCGGGGCCCCTGGAGTCTGGTCACCCTGGGAACATAACCTGTGCAGTGCCGTGGCCTTGTGAGCAGGGGACACCCCCCACTTTCTCCTGGATTGGGGTGAACCTCACTTCTACCCTGGGCCCCGAGACTCCCCGCTCTTCGGTGCTCACCATCAGCCCGGGACCTCATCACCATGGCACCAACCTCACCTGCCGAGTGACTTTCCCTGGAGCCAGTGTGGCAGTGGAGAGCACCGTCCAGCTCAGTGTGGCCTATGCCCCATGGAACCTGACCATCCAGGTGTTCCAGGGAAATGGCACAGGTAGGGCCCAGCCTGTCCTTCCTGGGGGTGTAGGAGAAGAGCTTGGACAGAAGGAGGGAGCAGGCCAGGTGCCTGGCAGTAAGGGTGGGATCCCTGCACCCACTCGTCACCCTACACACCCACTCCTCAGGCACTGA

XM_004866763.1 Coding sequence

LOC101712244 sialic acid-binding Ig-like lectin 13-like, transcript variant X1

Length: 906 bp    Location: 3593387..3591883   Strand: -
>XM_004866763.1
ATGCTGGCACCTCTGCTGCTGCCCCTGCTGTGGGCAGGGTCTCTGGCTAATATTCCAGGATACCAGCTGACAGTGCCAGAGCCCGTGGTGGTGCAGGAGGGACAGAGCACCTTCATAGCCTGCAGAGTCTCCTACCCCGGGAGATACTGGAGCAACTTTTCCCCAGCCTGGGGCTACTGGTTCAAGAAAGAGGCTAATTATGACCGGGATCCTCCAGTGGTCACAAATAACCCATCTCGTGAAGTGCAGAAAGAGACCCAGGGCCAATTCCACCTCCTTGGAGACCCCAGGACCTACAACTGCTCCCTGCGCATCAGAGATGCGCGCAACAAGGACATAGGAGTCTACTTCTTTAGGGTGGAGAGAGGCAGTGGCATGCAGTACAATTACAGACAGAACCAGCTCTGTGTGTTTGTGATGGTGCCTCGCTCCTCCCCGGCTCTAACAGAGACTCCTGACATCCACATCGCGGGGCCCCTGGAGTCTGGTCACCCTGGGAACATAACCTGTGCAGTGCCGTGGCCTTGTGAGCAGGGGACACCCCCCACTTTCTCCTGGATTGGGGTGAACCTCACTTCTACCCTGGGCCCCGAGACTCCCCGCTCTTCGGTGCTCACCATCAGCCCGGGACCTCATCACCATGGCACCAACCTCACCTGCCGAGTGACTTTCCCTGGAGCCAGTGTGGCAGTGGAGAGCACCGTCCAGCTCAGTGTGGCCTATGCCCCATGGAACCTGACCATCCAGGTGTTCCAGGGAAATGGCACAGGTAGGGCCCAGCCTGTCCTTCCTGGGGGTGTAGGAGAAGAGCTTGGACAGAAGGAGGGAGCAGGCCAGGTGCCTGGCAGTAAGGGTGGGATCCCTGCACCCACTCGTCACCCTACACACCCACTCCTCAGGCACTGA

XM_004866759.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 783 bp    Location: 3502303..3505660   Strand: +
>XM_004866759.1
ATGGTGTGGGTGGGAGGGGCACTGGACCGCAGAGGGGACTTTGCCCTGGAGGAGGGAGGTCCCTGGAAAGACAGGTTCCTCAGCTCTGCGGCTGGGGGAGGTCTCCAAGTCCCCTGTAGGAGGACTGGGGAATGGGGGGGGGTCACGTGTCCCCAGGCGGGGTTGCTAAGGGACCCGGATTGTGGAGGGAACTGGATTGTGGAGGGACCTGGGGTGGGCTCTGAGGGGGTCGGGTGTCAGCCTGTCCTACCTCTGTGGCCCGGCAGCAGCCTGCCTGGCATGGGAGTGAAGCGGAACCTGCAGGGCTGGGGCACTTTGCTCAGCCTCTTGGCCAACATCTTCACCATCCTGTCCACTGCAACCAACTACTGGATTCGCCAGCAGAAGGGGCACAGTGGCCTGTGGCTGGAGTGCACCCAGGGCCTGTGCTCCAACATCCCCTGCCAGACCACGATCTCATTGGCCGGGGCGTGCATGGTGCTGGCGGGTGGCGTCTGGGTGGTGGCCACGAAGGTGGCGTTGTGGATTCTGTGTCAGGGCGGACTATCGCTGCGGGGCCGGACTACAAGCACGCTGCTCTTCATCAGCGGGCTGCTGCTGCTGACGGCGCTGACCAGCTACACAGCGGGGAGTGAGAGGAAGGATGACGCCTTCTTCTCCTGGTCCTATTTTTCAGGGTGGCTGGCTTTACCTTTCTCTGTTCTCGCGGGCTGCTGCTTCCGGCTGGCGGACCTGATCCTGCAGAGCACCGAGGCCATCGGCGACTTCCCCGTGTGCCTGTGA

XM_004866753.1 Coding sequence

Siglec14 sialic acid binding Ig-like lectin 14

Length: 849 bp    Location: 3380499..3386635   Strand: +
>XM_004866753.1
ATGCTGGCCCTGCTGCTACTGTTTCTGCTGTGCACCCGGTCGCTGCAGGAGGATCCAGGGTTCCAGCTACGGGTGCAGGGGTCAGTGACGGTGCAGCAGGGCCTGTGTGTGCTGGTGCCCTGCTCTTTCTCCTACCCCTCCCGTGTGTGGTCTTCTTCCGGACAGCTCTTCATCTCCTGGTTCCGAGCCAGGAGCCACATGAACTATGATGATCCTGTGGCCACAAATGACCCAGACTATGAAGTACAGGAAGAGACCAAGGGCCGATTCCAGCTTGTCGGGGAAGTCAAGAGCAGAGACTGCTCCTTGAACATCAGAGGCGCCAGGATGGAGGATGAGGGAAGTTACGCCTTCAAAATAGACACAAGAAAGATAAAATATGCTTACAGAGACAAGAAGCTGAATTTGCAGGTGACAGCCCTGACAGAGAAACCCATCATCCACATCGCTGAGCCTCTGGAGTCCAGCCGCCCCACACAGCTGACCTGCAGCCTGCCAGGATCCTGCGAAGGAGGGCCCCCCCTCACCTTCTCCTGGTCGGGGGACGCCCTGAACTCCATGGACTCTGGGGCCCTGACTTCCTCGGTGCTCACTCTCACCCCTCGGCCCCAGGACCACGACACCAACCTCACCTGCCAGGTGCAACTCGGAGGAGCTCAGGTGACCACGGAGAGGACCATCAGGCTCAGTGTCTCCTCTGAGCAGCAGTGGGATTCCTGGCCCCTGGTCTTCATGGTGATCAGGGGGATCCTCATGGCGGCTGGCTTCCTCCTCACCTATGGCCTCACCTGGATCTACTACAGCAGGTGTGCAGATGCCCAAGGGCCCAGGGCAGAGAGTTCTCCCTGA

XM_004866751.1 Coding sequence

Fpr1 formyl peptide receptor 1

Length: 1044 bp    Location: 3305280..3309963   Strand: +
>XM_004866751.1
ATGGTGACCAATGCCTCTCTCCCCATGAACGAGTCTGCAGGGACTCTGACTGCACCTGCCGGCTATATTGTCCTGGACGTCTTCTCTTATGCAGTACTGGCCGTCACCTTTGTCCTGGGTGTGCTGGGCAATGGGTTGGTGATCTGGGTGGCTGGATTCCGCATGAAGCGCACAGTCACCACCATCTGTTACCTGAACCTGGCCTTAGCTGACTTCTCTTTCTCTATGACTTTGCCTTTCCTCATGGTCCAGCAGGCCTGGGGAGGAAACTGGCCTTTGGGTTGGTTCATGTGCAAGTTCATTTTTACCATAGTGGACATTAACCTGTTTGGAAGTGTCTTCCTGATTGCTCTGATCGCTCTGGACCGCTGTATTTGTGTCCTGCATCCGGTGTGGGCCCAGAACCACCGCACTGTGAGTCTGGCCAAGAAGGTCATCATAGTGCTGTGGATATGTGCCCTGCTCCTTACCTTGCCAGTTATCATTCGTGTGACTACAGTGATCTGTTCACCTGGGAAAACAGCCTGCACCTTTGACTTCGCACCCTGGACCACAGACCCTGAAGAGAACATGAAAGTGAACATCTCCATGCAGACTGTGCGAGGGATCATCCGGTTCATTATTGGCTTCAGCCTGCCCATGTCCACTGTTGCCATCTGCTATGGTCTGATTGCCACGAAAATGTACAGGCAAGGCCTGATCCAATCCAGCCGTCCCTTACGGGTTCTCTCTTTTATCGTCATTGCCTTTTTTCTCTGCTGGTGTCCTTTTCAGGTGGTGGCTCTCATAGCCACCATCAGAATCCGAGACTTCTTGAGTGGGATGAGTGGACACCTTAGAACTGCAGTGAAAGTAACAATTTCCGTGGCCTTCTTCAACAGCTGTCTCAACCCGATGCTCTATGTCTTCATGGGCAGGGACTTCCGAGAGAGACTGATCCGCTCCCTGCCCGCCAGTCTGGAGAGGGCCCTGACCGAGGACTCCACCCCGACCAGTGACACAACAACCAATTCCCCTGCACCTCCTGCAGAGGTCCAGTTATAG

XM_004866747.1 Coding sequence

LOC101706116 N-formyl peptide receptor 2-like

Length: 1059 bp    Location: 3239685..3238627   Strand: -
>XM_004866747.1
ATGGAAGCCAACATCTCAATTCCTCCATATGAATCTGAAGGGATGCTCCATGAGTTTGCTGGCTATACTGTTCTGTGGATACTCCCAATGATGCTACTCTCACTCACTTTTGTCCTTGGTGTGCTGGGCAATGGGTTGGTGATCTGGGTGGCTGGATTCCGGATGGTGCACACAGTCACCATCATCTATTACTTGAACCTGGCCTTTGCTGACTTCTCCTTCAGTGCCACCCTACCTTTCCTCATTGTTTCCATGGCCATGAGAGGATTTTGGCCTTTTGGCTGGTTCTTATGCAAGTTCACTAACATCATGATGGCCATAAATCAATACGGAAGCATCTTCCTGATTGCTGTCATTGCTCTGGACCGCTGTATTTGTGTACTTTATCCAGTGTGGGTCCAGAACCACCGCAGTATTACTCTGGCCAAGAAGGTGATCACTGGACCCTGGATTCTTGCCGGAGTCTTTGCTTTGCCAACTTTCATCTTCTCAAATACAATAAATGATCGACAAGGGAATGTTCACTGTTTGGTCTCCTTGGAATCTTTGGGATCTACAGAGGAAGAGCAGGTGAAGATACTCATTGCAATATTACTACCTCTTGGGATTGTCCGGTTCATTATTGGCTTCTGTATGCCCATGTCCACCATCTTCATCTGTTATGGGCTCATCACTGGCAAGATTCATAGAACAGGCATCATGAAGTCCAGCCGTCCCTTTTGGGTTCTCACTGCTGTTGTGGCTTCCTTCTTCATTTGTTGGTTCCCCTTTCAACTGATTGTCCTTCTAGTCTCAGTCTGGGCCAAAGAGATCACAATGTATGAAGATAATTACAAAGTACTCCTGGTACTGATCCCTCAAACAATGTCCCTGGCCTGCTTCAACAGCTGCCTCAACCCAATACTCTATGTCTTTGTGGGTCACGACTTCCGAGAGAGACTGATCCACTCCCTGCCCATCAGATTGGAGAAGGCCCTGAGTGAGGACTTGGTCCAGACCATCAACACAGCCGCCAGTTCTGGGGCACCTCTTGCAGAGGGGGAGTTAAGAGCAATGTAA

XM_004866749.1 Coding sequence

LOC101706468 N-formyl peptide receptor 2-like, transcript variant X2

Length: 1056 bp    Location: 3282154..3275955   Strand: -
>XM_004866749.1
ATGGCATCGAACTTCTCCATCCCTTTCAATGGATCTGAAGAAATGCCTTATGAATCAACTGGCTACGCTGTTCTGCGGATACTCCCATTGGTGGTACTCTCGGTCACCTTTGTCCTGGGTGTGCTGGGCAATGGCTTGGTGATCTGGGTGGCTGGATTCCGGATGGCGCACACAGTCACCACCATCTGTTACCTGAACCTGGCCTTAGCTGACTTCTCCTTCACTGCCACCCTGCCTTTCCTCATTGTCTCCATGGCCATGGGAGAAAAATGGCCTTTTGGCTGGTTCCTCTGCAAGTTGATTCACATAGTTGTGGACATAAACCTGTTTGGAAGTGTCTTCCTGATTGCTCTGATCGCTCTGGATCGCTGTATTTGTGTGTTGCATCCAGTGTGGGCTCAGAACCACCGCACTGTGAGTCTGGCCAAGAAGGTCATCATCGGACCCTGGATTCTTGCCCTAGTCCTTACCTTGCCAGTTTTCATCTTCTTGACCACAGGAAGTGACGCGAACGGGAACACATACTGTACCTTCTCTTTTGTATCCTGGGGAGACACTATTGAAAAGAGGCTGAAGGTGGCCATCGCCATGTTGACAGCTAGAGGGATCATCCGGTTCATTATTGGCTTCAGCATGCCCATGTCCATGGTCGCCATCTGCTATGGGCTCATCGCTGCCAAGATTCGCAGAAAAGGCTTGATGAATTCCAGCCGTCCCTTTCGGGTCCTCACTGCTGTTGTGGCTTCCTTCTTCATCTGTTGGTTCCCCTTTCAATTGGTTGCCCTTTTAAGCACTGTGTGGCTCAAAGAGATGTTGTTTGAGGGCAAGTACAAAGTCTTTGCCATCCTGGTCGGCCCAGCAAGGTCCCTGGCCTTCTTCAACAGCTGTCTCAACCCAATGCTCTATGTCTTTGTGGGGCAGGACTTCCGAGAGAGACTGATCCACTCCCTGCCCGCCAGTCTGGAGAGGGCCCTGAGTGAGGACTCAGCCCCGACCAGTGACACAGCCACCAATTCTGCTGCACCTCCTGCAGAGGAGGAGCTAAAAGCAATGTGA

XM_004866748.1 Coding sequence

LOC101706468 N-formyl peptide receptor 2-like, transcript variant X1

Length: 1056 bp    Location: 3262341..3255850   Strand: -
>XM_004866748.1
ATGGCATCGAACTTCTCCATCCCTTTCAATGGATCTGAAGAAATGCCTTATGAATCAACTGGCTATGCTGTTCTGCAGATACTCCCATTGGTGGTACTCTCGGTCACCTTTGTCCTGGGTGTGCTGGGCAATGGCTTGGTGATCTGGGTGGCTGGATTCCGGATGGCGCACACAGTCACCACCATCTGTTACCTGAACCTGGCCTTAGCTGACTTCTCCTTCACTGCCACCCTACCTTTCCTCATTGTCTCCATGGCCATGGGAGAAAAATGGCCTTTTGGCTGGTTCCTCTGCAAGTTGATTCACATAGTTGTGGACATAAACCTGTTTGGAAGTGTCTTCCTGATTGCTCTGATCGCTCTGGATCGCTGTATTTGTGTGTTGCATCCAGTGTGGGCTCAGAACCACCGCACTGTGAGTCTGGCCAAGAAGGTCATCATCGGACCCTGGATTCTTGCCCTAGTCCTTACCTTGCCAGTTTTCATCTTCTTGACCACAGGAAGTGACGTGAACGGGAACACATACTGTGGCTTCTCTTTTGTATCCTGGGGAGACACTGTTGAAAAGAGGCTGAAGGTGGCCATCGCCATGTTGACAGCTAGAGGGATCATCCGGTTCATTATTGGCTTCAGCATGCCCATGTCCATGGTCGCCATCTGCTATGGGCTCATCGCTGCCAAGATTCGCAGAAAAGGCATGATGAATTCCAGCCGTCCCTTTCGGGTCCTCACTGCTGTTGTGGCTTCCTTCTTCATCTGTTGGTGCCCCTTTCAATTGATTGCCCTTCTAAGAACAGTGTGGCTCAAAGAGATGTTGTTAAAGGGCAAGCACAAAGTCTTGGCCATCCTGCTCAACCCAGCAAGGTCCCTGGCCTTCTTCAACAGCTGTCTCAACCCAATGCTCTATGTCTTTGTGGGGCAGGACTTCCGAGAGAGACTGATCCACTCCCTGCCCGCCAGTCTGGAGAGGGCCCTGAGTGAGGACTCAGCCCCGACCAGTGACACAGCCACCAATTCTGCTGCACCTCCTGCAGAGGAGGAGCTAAAAGCAATGTGA

XM_004866740.1 Coding sequence

Znf350 zinc finger protein 350, transcript variant X1

Length: 1593 bp    Location: 3081380..3090711   Strand: +
>XM_004866740.1
ATGATCCAGGCCCAGGAGTCACTGACCCTGGAGGATGTGGCTGTGAGGTTCACCCGGGAGGAGTGGCAGCTCCTGGGCCCTGCTCAGAAGGACCTGTACCGGGACGTGATGCTGGAGAACTACAGCAGCCTGGTGTCAGTGGGGTATCAAGCCAGCCAGCCAGATTCCCTCTCCAGCTTGCTTTGTGGAGAACCATGGATGGTGGAGGATGAACTGCACTGTGGAACCCATTCAGACATCTGGAAGGCTGTTGATGATCTGCCAAGGCATTTACAAAACAAAAGCAAGGTGAACAGGTTGGAAGAGTGGCGTGAACACAATACATTTGAAAATGTTCAACAGAGCAAAACTCAATTTCTTTTGAGGCAAAATCATGACATATTTAACTTACATGGAAAAAGTATGAAGTCAGATTTAACTTTGGTTAACCAGAGCAAAAGCTGTGAAATAAAGAATCCCATGGCATTCCCCAGACGTGAGGAATCCTTTTTCCCTGCTAACTGTGAAAAACTTCATACTGAAATTTTATTTCCTGCAAGTCAAAAACACATCAGCATTAAATCTCAGTTCAGTAGCCGCAAGCCTAAGAAAACTCAGAAAGTAGAGAAACGTCATGTATGCAGTGAATGCGGGAAAGCCTTTGTCAAGAAGTCTTGGCTCACTGATCACGAGATCATCCATACTGGGGAGAAACCCCATCGATGTGGTCTGTGTGGGAAAGCCTTCTCCAGAAAGTTCATGCTCACTGAACACCACAGAACTCATACAGGAGAAAAACCTTACGCATGCACTGAGTGTGGCAAAGCCTTTCTCAAGAAATCACGACTCAGCATACATCAGAAAACTCATACAGGAGAGAAACAGTATATATGCAGTGAGTGTGGAAAGAGCTTCATCCAGAAAGGAAATCTCATTGTACATCAGCGAATTCATACAGGCGAGAAACCTTATATATGCAGTGAATGTGGAAAAGGCTTTATCCAAAAGACCTGCCTCATAGCACATCAGAGGTTTCATACTGGGAAGACTCCCTTTGTGTGCAGTGAATGTGGAAAATCCTGTTCACAGAGGTCGGGTCTCATTAAACATCAAAGGATTCACACAGGGGAGAAACCCTTTGTATGTAGTGACTGTGGGAAAGCCTTCACCACAAAGCAAAAGCTCATTGTTCATCAAAGAACTCATACAGGAGAGAAACCCTATGGCTGCAATGACTGTGGGAAAGCTTTTGCGTACATGTCTTGCCTGGTGAAGCATAAGAAAATACACACAAGGGAAAAGCAGAGACATACAATGAGGTCGGAAAAACCTGCTGAGAGTGACAGCTCGTTATATATTGGTGGCGTCATACAGGAGACAAACCCGGTTAGCACAGTGATTACCCAAGTGCCTTCTGTGGCCTCTCAGTCAGCACTGAACATCAGTGGCCTAGCAAATAGGAATGTAGTCCTTATGGGACAGCCGGTGGCCAGATGTGTGTCGTTAGGAGACAACCGAGAATTTACACAGGATAGAGACCTCGTGAATGCAGTGAATATGGTTGTGCCTTCAGTCATCAATTATGTCTTATTTTATGTCACAGAAAACCCATAG

XM_004866734.1 Coding sequence

LOC101699320 leukocyte immunoglobulin-like receptor subfamily B member 4-like, transcript variant X4

Length: 1275 bp    Location: 2622227..2616204   Strand: -
>XM_004866734.1
ATGACCCCCAGCCTCACGGCGCTGCTCTGCCTGGGGCTGAGTCTGGGCCCCAGGACCCGAGGGCAGGCAGGGACCCTCCCCACCCCCAGGCTCTGGGCTGAGCCAGGACCTGTGATACCATGGGGGAAGCCTGTGACCCTCTGGTGTGAGGGGAGCCTGGAGGCCCAGGAGTACCATGTAGATTACGAGGGAATCCCAGTGCCCTGGGACAGACAGGCCCAACTGGAGCCCAGGAACAAGGCCAAGTTCTTCATAGGATCCATGACACAGCACTATGCAGGGCGATATCACTGTTACTATCGCAGCCCTGCTGGCTGGTCAGAGCGCAGTGAGCCCCTGGAGCTGGTGGTGACAGGAGCCTACAGCAAACCCAGCCTCTCAGCCCTGCCCAGCCCTGCAGTGACCTCAGGAGGGACCGTGACCCTCCAGTGTGGCTCATGGCTAAGATTTGGCAAGTTCCTTCTGACTCAGGAAGGAGAAGATGGGCTCTCCTGGACCCTGGACTCACAGCGAGGCCCCAGTGGGCAGTTCCAGGCCCTGTTCCCTGTGGGCCCTGTGACCGCTGGCCACAGGTGGATGTTCAGATGCTACGGCTATGACAGGAACAATCCCCAGGTGTGGTCGGAGCCCAGTGACACCCTGGAGCTCCTGGTCTCAGGACTGGGAAGGCACCTGAAGGTTCTGATCGGGGCCTCGGTGGCCTCCGTCCTGCTGCTGCTGCTGCTCCTCCTCCTCCTCGTCCTCCGACACTGGCGTCAGGGCGAAAGCAGGAAGGCGGCCCAGAGAGAGGCTGACTTCCCACGGCCTGTGGGGGCCACGGGCCCAGTGCCCCAGCACGGAGGCCTGCAGAACAGCTCCGGCCCAGCCGCCACCACCCAGGAAGAAAACCTCTATGCTGCCGTGAACGACTCACCGCCTGAGGACGGGGTGGAGCTGGACGCTTGGAGCCCACCTGATGAAGACCCCCAGGGAGCGGTATACGCCCAGGTGAAGCACGCAGCACCCAGGGGCAGAGGGGCCGCCCCTCCCGCGGCCCCGTCCGGGGAGCTCCTGGACACCAAGGATGGACAGGCAGGGGAGGACAGGCAGACGGACGCTCAGGCTGCAGCCCCTGAGGGTCCCCAGGACGTGACCTACGCCCAGCTGTGCAGCTGGACGCTCGGACGGGGCACAGCGGCGCCTCCTCCCTCCCGGCCCGGGGCCCTCCCAGCCGAGCCCAGTGTGTATGCTGCCCTGGCGTCCTCGCCCCGAGCCATCCCCAGGGACACTGAGTGA

XM_004866732.1 Coding sequence

LOC101699320 leukocyte immunoglobulin-like receptor subfamily B member 4-like, transcript variant X2

Length: 1359 bp    Location: 2622227..2616204   Strand: -
>XM_004866732.1
ATGACCCCCAGCCTCACGGCGCTGCTCTGCCTGGGGCTGAGTCTGGGCCCCAGGACCCGAGGGCAGGCAGGGACCCTCCCCACCCCCAGGCTCTGGGCTGAGCCAGGACCTGTGATACCATGGGGGAAGCCTGTGACCCTCTGGTGTGAGGGGAGCCTGGAGGCCCAGGAGTACCATGTAGATTACGAGGGAATCCCAGTGCCCTGGGACAGACAGGCCCAACTGGAGCCCAGGAACAAGGCCAAGTTCTTCATAGGATCCATGACACAGCACTATGCAGGGCGATATCACTGTTACTATCGCAGCCCTGCTGGCTGGTCAGAGCGCAGTGAGCCCCTGGAGCTGGTGGTGACAGGAGCCTACAGCAAACCCAGCCTCTCAGCCCTGCCCAGCCCTGCAGTGACCTCAGGAGGGACCGTGACCCTCCAGTGTGGCTCATGGCTAAGATTTGGCAAGTTCCTTCTGACTCAGGAAGGAGAAGATGGGCTCTCCTGGACCCTGGACTCACAGCGAGGCCCCAGTGGGCAGTTCCAGGCCCTGTTCCCTGTGGGCCCTGTGACCGCTGGCCACAGGTGGATGTTCAGATGCTACGGCTATGACAGGAACAATCCCCAGGTGTGGTCGGAGCCCAGTGACACCCTGGAGCTCCTGGTCTCAGGACTGGGAAGGCACCTGAAGGTTCTGATCGGGGCCTCGGTGGCCTCCGTCCTGCTGCTGCTGCTGCTCCTCCTCCTCCTCGTCCTCCGACACTGGCGTCAGGGCGAAAGCAGGAAGGCGGGTGAGTGGGGACAGCCCAGAGAGAGGCTGACTTCCCACGGCCTGTGGGGGCCACGGGCCCAGTGCCCCAGCACGGAGGCCTGCAGAACAGGTACTTCCTGCCCGGGGACCCGGACGCCCGCCAGCCACCCCCACGGCCCTGACACCCCTTGTCTCCCCAGCTCCGGCCCAGCCGCCACCACCCAGGAAGAAAACCTCTATGCTGCCGTGAACGACTCACCGCCTGAGGACGGGGTGGAGCTGGACGCTTGGAGCCCACCTGATGAAGACCCCCAGGGAGCGGTATACGCCCAGGTGAAGCACGCAGCACCCAGGGGCAGAGGGGCCGCCCCTCCCGCGGCCCCGTCCGGGGAGCTCCTGGACACCAAGGATGGACAGGCAGGGGAGGACAGGCAGACGGACGCTCAGGCTGCAGCCCCTGAGGGTCCCCAGGACGTGACCTACGCCCAGCTGTGCAGCTGGACGCTCGGACGGGGCACAGCGGCGCCTCCTCCCTCCCGGCCCGGGGCCCTCCCAGCCGAGCCCAGTGTGTATGCTGCCCTGGCGTCCTCGCCCCGAGCCATCCCCAGGGACACTGAGTGA

XM_004866736.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1641 bp    Location: 2677648..2667751   Strand: -
>XM_004866736.1
ATGACCGGGGCTGACCTGCTGGGCAGCGTCCTCTGGCGGGGCGCTGACGGCGTGACCGGGATGAGGAGTCCGGGACGAGGAAACGCCAGGATAACAGACCCAGTCCTGAGAGTTGAGACCATGGCCCACGTGGGGGAGTACTACAGGAAACTCTGCCAGCAGACTCTGCGCTACATCCGGGCATTTCTGAACCACCGGGAGCCCGGAGCGCAGGGCGTGCTGTCGTTCGCGGACGTGGCCCTGGTCTTCTCCCAGGAGGAGTGGGCGAGCCTGACCCCCGTCCAGAGGGACCTGTACTGGGACGTGATGCTGGAGAACTACAACAACCTGGTGTCCCTGGATTTGGAGCCATCATATGCAGCTAAGAGTTTAGCTATACAAAAGAGCTTTTATAAAATTAATCTTCACAGAAGGAATGCGCACCGGAGAAGCCAATCCTGTCCCGCTAACAGAATGTGTGGAGGTGAGTCTGAAAGATCCCAAGGCCCTGGAGGGAGGAATCTCGGCCGAGAGGGGAACTCCAGCCAGGCGGCAGCTAAGTCCCGCTGGGAGGGTCGCCCAGCCTCTCGGCCGCACAGGGAGAACGCCTACGAGTGCACCGACTGCGGGAAGGGCTTCAGCCGCAGCTACCAGTTGAGCCAGCACCAGAAGATCCACACGGGCGAGAAGCCCTACGAGTGCAAGGACNNNNGCAAGGCCTTCCGCTGGGGCTCCAGCCTGGTCATCCACAGGAGGATCCACACAGGCGAGAAGCCCTACGAGTGCAAGGACTGCGGCAAGGCCTTCAGGCGGGGCGACGAGCTCACTCAGCACCTGCGCTTTCATACCGGCGAGAAAGACTACGAGTGCAAGGACTGCGGCAAGACCTTCAGCCGCCTCTACAAGCTCATCCAGCACAAGAGGATCCACAGCGGCGAGAAGCCCTACGAGTGCAAGGACTGCGGGAAGGCCTTCATCTGCGGCTCCAGCCTCATCCAGCACAAGAGGGTCCACACCGGGGAGAAGCCCTTCGAGTGCCAGGAGTGCGGGAAGTCCTTCACCCGCGTCAACTACCTCACTCAGCACCAGAAGATCCACACGGGCGAGAAGCCGCACGAGTGCAAGGAGTGCGGGAAGGCCTTCCGCTGGGCCTCCAGCCTCGTGAAGCACGAGCGCATCCACACCGGGGAGAAGCCGTACAGGTGTGCCGAGTGCGGCAAGGGCTTCAACTGCGGCTACCACCTCACCCAGCACGAGCGCATCCACACCGGCGAGACCCCGTTCAAGTGCAAGGAGTGTGGGAAGGCCTTCATTTACGGCTCGAGCCTGGTGAAGCACGAGAGGATCCACACCGGGGAGAAGCCGCACGAGTGCACCGACTGCGGGAAGGCCTTCAGCCACGGCCACCAACTCACGCAGCACCAGAAGACCCACACGGCGAAGCCTCACGTGTGCAAGGAGTGCGGGAAGGTGTGCAAGCACTCAAGCCACCTGAAGGGACATCTGCGGGTGCATNAAGAATTTGTAAGTCGGAGGAAAGAGTGTGCCAAAGCGTCCATCCTCCATTCCTTCCTTGGTTCCCCACCAGGAGGAAGTCATGATTTAATTTCACACGAGAAAGCCTCCCCTGGTCCTCCTTACGCTTACAGACCACAGCAGTAA

XM_004866691.1 Coding sequence

Cdc42ep5 CDC42 effector protein (Rho GTPase binding) 5, transcript variant X3

Length: 474 bp    Location: 2272800..2276418   Strand: +
>XM_004866691.1
ATGATCCGCCCAGCTCCGCAGCTTGCACTGACCCCCCTCCCCCCGCAGATGCCGGTGCTGAAGCAGCCGGGCCCAGCGCAGCCCAAGAAGCGCAGCCCAAGAGGCGGTGCGCTGTCCATCTCGGCGCCGCTCGGTGACTTCCGGCACACGCTGCACGTGGGGCGCGGCGGCGACACCTTCGGGGACACCTCCTTCCTGAGCCGCCACGGGGCCGCGCCGCCCGCCGCCGAGCCCCACTCGAAGCCCGCGGGGACCCCGCCGCCCCCGCCCGCGGCGCCCCCAGACCCGCTGCTGTCCTTCCACCTGGACCTGGGCCCCTCCATGCTGGACGCCGTGCTGGGCGTCATGGATGCGGGGCGCGCGGGAGCGGCTGCCCAGCCGGAAGCAGACGCACGCCCTGGGACGCAGCCCCGCCGGGGCCCCCGCAGCCGCCCCGACGCCCGCCTGGAGCTGGACCGCGGGCTCGGCCTGTAG

XM_004866729.1 Coding sequence

Myadm myeloid-associated differentiation marker, transcript variant X1

Length: 948 bp    Location: 2573246..2568128   Strand: -
>XM_004866729.1
ATGCCGGTGACGGTGACCCGCACAACCATCACGACCACGTCGTCCTCCACCGTCGTGGGGTCCCCTCGGGCACTGACCCAACCCCTGGGCCTGCTCCGCCTGCTGCAGCTGGTGTCCACCTGCGTGGCCTTCTCGCTGGTGGCCAGCGTGGGCGCCTACACAGGGCCCATGGGACACTGGGCCATGTTCACCTGGTGCTTCTGCTTTGCCGTGACCCTCATCGTCCTAGTGGTGGAGCTGGCCGGGCTGCAGGCACACTTCCCCCTGTCCTGGCGCAACTTCCCCATCACCTATGCCTGCTACGCCGCCCTCTTCTGCCTGACATCCTCCATCATCTACCCCACCACCTACGTGCAGTTCATGTCCCACGGCCGCTCCCGTGACCACGCCATCGCCGCTACCACCTTCTCCTGCGTTGCCTGTCTGGCATACGCCACCGAAGTGGCCTGGACCCGGGCAAGGCCCGGGGAGGTCACTGGCTACATGGCCACTGTGCCCGGGCTGCTCAAGGTGCTGGAGACCTTCGTGGCCTGTGTCATCTTCGTCTTCATCAGCGACCCCTACCTGTACCAGCGCGCGCCGGCCCTGGAGTGGTGCGTGGCGGTGTACTCCATCTGCTTCATCCTGGCTGCCGTGGCCATCCTGCTGAACCTGGGCGAATGCACCGGCGTGCTGCCCTTCCCCTTCCCCAGCTTCCTGTCGGGCCTGGCCCTGCTCTCAGTCCTCATGTATGCCTCCGCCCTCGTCCTCTGGCCTCTCTACCACTTCAATGAGAAGTACGGCGGCCAGCCCCGCCGGGCCTGGGACTCGGGCTGCGGCTCCAGACATACCCACATTGTGTGTACCTGGGACCGCAAACTGGCGGTGGCCGTCCTGACGGGCATTAACCTGCTGGCCTACCTGGCTGACCTGGCGCACTCTGCCCGACTGGTGTTCGTCAAGGTCTAA

XM_004866727.1 Coding sequence

Cacng7 calcium channel, voltage-dependent, gamma subunit 7

High confidence: 4 potential gene matches
Length: 828 bp    Location: 2546901..2529658   Strand: -
>XM_004866727.1
ATGAGTCACTGCAGCAGCCGCGCCCTGACCCTGCTGAGCAGCGTGTTCGGCGCCTGCGGCCTGCTGCTGGTGGGCATCGCTGTGAGCACCGACTACTGGCTGTACATGGAAGAGGGCACGGTGCTGCCGCAGAACCAGACCACCGAGGTCAAGATGGCGCTGCACGCTGGCCTCTGGCGGGTCTGCTTCTTCGCAGGTCGGGAGAAGGGCCGCTGCGTGGCCTCAGAATACTTCCTCGAACCAGAGATCAACTTGGTGACGGAAAACACGGAGAACATTCTGAAGACGGTGCGCACGGCCACGCCCTTTCCCATGGTCAGCCTGTTTCTGGTGTTCACCGCCTTTGTCATCAGCAACATCGGCCACATCCGCCCGCAGAGGACCATCCTGGCCTTCGTCTCCGGCATCTTCTTCATCCTCTCGGGCCTCTCCTTGGTGGTGGGCTTGGTTCTTTACATCTCCAGCATCAACGACGAGGTCATGAACAGGCCCAGCAGCTCCGAGCAGTACTTTCATTATCGCTATGGGTGGTCTTTCGCCTTCGCTGCCTCCTCCTTCCTGCTCAAAGAGGGGGCCGGCGTGATGTCGGTGTACCTGTTCACCAAGCGCTACGCCGAGGAGGAGATGTACCGCCCGCACCCGGCCTTCTACCGCCCGCGGCTCAGTGACTGCTCCGACTACTCGGGCCAGTTCCTGCAGCCCGAGGCCTGGCGCCGCGGCCGCAGCCCCTCAGACATCTCCAGCGACGTCTCCATCCAGATGACGCAGAACTACCCTCCAGCCATCAAGTACCCGGACCACCTGCACATCTCCACCTCGCCCTGCTGA

XM_004866723.1 Coding sequence

Ndufa3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa

High confidence: 3 potential gene matches
Length: 255 bp    Location: 2461444..2459430   Strand: -
>XM_004866723.1
ATGGCTGCTAGAATTGCTGCCTTCTTCAAGAATGCCTGGGGCCAGGAGCCGGTGCTGGTCGTGTCCTTAGCTATCGCGGGCCTCGCTGCAATTCTGCCCGTAGTCAGCCCCTACACCAAGTACTCCATCATGGTCAACAAGGCCATGCCCTACAACTACCCAGTGCCCGTCCGAGATGATGGGAACATGCCTGATGTGCCCAGCCACCCCCAGGACCCCCAGGGCCCCAACCTGGAGTGGCTAAAGAAACTGTGA

XM_004866725.1 Coding sequence

Prpf31 pre-mRNA processing factor 31, transcript variant X1

Length: 1500 bp    Location: 2455383..2445144   Strand: -
>XM_004866725.1
ATGTCTCTGGCAGATGAGCTTTTGGCTGACCTTGAGGAGGCAGCTGAAGAGGAGGAAGGAGGAAGCTTTGGAGAGGAGGAAGAGGAGCCAGCGATTGAGGATGTACAGGAGGAGACACAGCTGGATCTCTCTGGGGATTCAGTCAAGAGTATCGCCAAGCTGTGGGATAGCAAGATGTTTGCTGAGATCATGATGAAGATTGAGGAGTACATCAGCAAGCAAGCCAAAGCTTCAGAAGTGATGGGGCCGGTGGAGGCAGCCCCCGAGTACCGTGTCATTGTGGACGCCAACAACCTGACTGTGGAGATCGAAAATGAGCTGAACATCATCCATAAGTTCATCCGGGACAAGTACTCGAAGAGGTTCCCCGAGCTGGAGTCCTTGGTCCCCAACGCACTGGACTACATCCGCACGGTCAAGGAGCTGGGCAACAGCCTGGACAAGTGCAAGAACAACGAGAACCTGCAGCAGATCCTCACCAACGCCACCATCATGGTGGTCAGCGTCACGGCCTCCACCACCCAGGGGCAGCAGCTGTCGGAGGAGGAGCTGGAGCGGCTGGAGGAGGCCTGCGACATGGCCCTGGAGCTGAACGCGTCCAAGCACCGCATCTACGAGTACGTGGAGTCCCGCATGTCCTTCATCGCCCCCAGCCTGTCCATCATCGTGGGCGCCTCCACGGCAGCCAAGATCATGGGTGTGGCCGGCGGCCTGACCAACCTCTCCAAGATGCCCGCCTGCAACATCATGCTGCTCGGGGCCCAGCGCAAGACACTGTCCGGCTTCTCATCTACCTCCGTGCTGCCCCACACTGGCTACATCTACCACAGCGACATCGTGCAGTCCCTGCCCCCGGATCTGCGGCGGAAGGCGGCCCGGCTGGTGGCCGCCAAATGCACACTGGCCGCCCGCGTGGACAGTTTCCACGAGAGCTCGGAGGGGAAGGTGGGCTATGAACTGAAGGACGAGATCGAGCGCAAATTTGACAAGTGGCAGGAGCCGCCGCCTGTGAAGCAGGTGAAGCCCCTGCCCGCACCCCTGGATGGGCAGCGGAAGAAGCGAGGGGGCCGCAGGTACCGCAAGATGAAGGAGCGGCTGGGACTGACAGAGATCCGGAAGCAGGCCAACCGCATGAGCTTCGGAGAGATCGAGGAGGACGCCTACCAGGAGGACCTGGGCTTCAGCCTGGGCCACCTCGGCAAGTCGGGCAGTGGGCGCGTGCGCCAGACACAGGTGAACGACGCCACCAAGGCCAGGATCTCCAAGACGCTGCAGCGGACCCTGCAGAAGCAGAGCGTGGTGTATGGCGGGAAGTCCACCATCCGCGACCGCTCCTCGGGCACCGCCTCCAGCGTGGCTTTCACCCCCCTCCAGGGTCTGGAGATCGTGAACCCACAGGCAGCGGAGAAGAAGGTGGCCGAGGCCAACCAGAAGTATTTCTCCAGCATGGCCGAGTTCCTCAAGGTCAAGAGCGAGAAGAGCGGCATCACGTCCACCTGA

XM_004866716.1 Coding sequence

Tsen34 tRNA splicing endonuclease 34 homolog (S. cerevisiae), transcript variant X5

Length: 912 bp    Location: 2407035..2400685   Strand: -
>XM_004866716.1
ATGCTGGTGGTGGAGGTGGCGAACGGCCGCTCGCTGGTGTGGGGGGCCGAGGCGGTTCAGGCGCTGCGGGAGCGCCTGGGCGTGGGGGGCCGCACGGTGGGCGCCCTGCCCCGCGGGCCCCGGCAGAACTCGCGCCTGGGCCTCCCGTTGCTGCTTTTGCCGGAGGAGGCGCGGCTCCTGGCCGAGATCGGCGCCGTGACCCTGGTCAGCTCCCCTCGCCGGGATCCCAGCCAGCACAGCCTGGCTCTGGCATCGTTCAGACGCCAGCAAGAGCAGAGCTTCCAGGAGCAAAGCGCGTTGGCGGCCGAGGCCCGTGAGAACCGGCGTCAGGAGCTCCTGGAGAAGATTGCAGAGGGCCAGGCTGCCAAGAAGCAGAAGCTGGAGCAGGATTCCGAGGCCGGCGGGAGCCGAGCCGCGGAAGAGAGCGAGATCGGAGGTGGCCAGGCCTCCGGGGAGCAGGAGGAAGCAGTGCCTTCTTCTCAAGCAGCTTCAGATGGGGCGGCGCCCTTGCCCAGGTCTGCCCTGCTGGTCCAGCTGGCCACCGCCAGGCCTCGGCCTGTTAAGGCCAGGCCCCTGGACTGGCGCGTGCAGTCCAAAGACTGGCCCCACGCCGGCCGGCCCGCCCACGAGCTGCGCTACAGCATCTACAGAGATCTGTGGGAGCGAGGCTTTTTCCTCAGCGCCGCCGGCAAGTTCGGCGGCGACTTCCTGGTGTATCCTGGTGACCCGCTCCGTTTCCATGCCCACTACATTGCCCAGTGCTGGGCTCCGGAGGACCCCATTCCACTGCAGGACCTGGTCTCTGCCGGCCGCCTGGGAACAAGTGTGAGGAAGACGCTGCTGCTGTGCTCCCCACAGCCTGATGTAAATGACCTCAATAGAATCTCGACTTCCTGCACATTTATTGGCTGA

XM_004866714.1 Coding sequence

Tsen34 tRNA splicing endonuclease 34 homolog (S. cerevisiae), transcript variant X3

Length: 918 bp    Location: 2406991..2400685   Strand: -
>XM_004866714.1
ATGAGGATGCTGGTGGTGGAGGTGGCGAACGGCCGCTCGCTGGTGTGGGGGGCCGAGGCGGTTCAGGCGCTGCGGGAGCGCCTGGGCGTGGGGGGCCGCACGGTGGGCGCCCTGCCCCGCGGGCCCCGGCAGAACTCGCGCCTGGGCCTCCCGTTGCTGCTTTTGCCGGAGGAGGCGCGGCTCCTGGCCGAGATCGGCGCCGTGACCCTGGTCAGCTCCCCTCGCCGGGATCCCAGCCAGCACAGCCTGGCTCTGGCATCGTTCAGACGCCAGCAAGAGCAGAGCTTCCAGGAGCAAAGCGCGTTGGCGGCCGAGGCCCGTGAGAACCGGCGTCAGGAGCTCCTGGAGAAGATTGCAGAGGGCCAGGCTGCCAAGAAGCAGAAGCTGGAGCAGGATTCCGAGGCCGGCGGGAGCCGAGCCGCGGAAGAGAGCGAGATCGGAGGTGGCCAGGCCTCCGGGGAGCAGGAGGAAGCAGTGCCTTCTTCTCAAGCAGCTTCAGATGGGGCGGCGCCCTTGCCCAGGTCTGCCCTGCTGGTCCAGCTGGCCACCGCCAGGCCTCGGCCTGTTAAGGCCAGGCCCCTGGACTGGCGCGTGCAGTCCAAAGACTGGCCCCACGCCGGCCGGCCCGCCCACGAGCTGCGCTACAGCATCTACAGAGATCTGTGGGAGCGAGGCTTTTTCCTCAGCGCCGCCGGCAAGTTCGGCGGCGACTTCCTGGTGTATCCTGGTGACCCGCTCCGTTTCCATGCCCACTACATTGCCCAGTGCTGGGCTCCGGAGGACCCCATTCCACTGCAGGACCTGGTCTCTGCCGGCCGCCTGGGAACAAGTGTGAGGAAGACGCTGCTGCTGTGCTCCCCACAGCCTGATGTAAATGACCTCAATAGAATCTCGACTTCCTGCACATTTATTGGCTGA

XM_004866715.1 Coding sequence

Tsen34 tRNA splicing endonuclease 34 homolog (S. cerevisiae), transcript variant X4

Length: 912 bp    Location: 2406831..2400686   Strand: -
>XM_004866715.1
ATGCTGGTGGTGGAGGTGGCGAACGGCCGCTCGCTGGTGTGGGGGGCCGAGGCGGTTCAGGCGCTGCGGGAGCGCCTGGGCGTGGGGGGCCGCACGGTGGGCGCCCTGCCCCGCGGGCCCCGGCAGAACTCGCGCCTGGGCCTCCCGTTGCTGCTTTTGCCGGAGGAGGCGCGGCTCCTGGCCGAGATCGGCGCCGTGACCCTGGTCAGCTCCCCTCGCCGGGATCCCAGCCAGCACAGCCTGGCTCTGGCATCGTTCAGACGCCAGCAAGAGCAGAGCTTCCAGGAGCAAAGCGCGTTGGCGGCCGAGGCCCGTGAGAACCGGCGTCAGGAGCTCCTGGAGAAGATTGCAGAGGGCCAGGCTGCCAAGAAGCAGAAGCTGGAGCAGGATTCCGAGGCCGGCGGGAGCCGAGCCGCGGAAGAGAGCGAGATCGGAGGTGGCCAGGCCTCCGGGGAGCAGGAGGAAGCAGTGCCTTCTTCTCAAGCAGCTTCAGATGGGGCGGCGCCCTTGCCCAGGTCTGCCCTGCTGGTCCAGCTGGCCACCGCCAGGCCTCGGCCTGTTAAGGCCAGGCCCCTGGACTGGCGCGTGCAGTCCAAAGACTGGCCCCACGCCGGCCGGCCCGCCCACGAGCTGCGCTACAGCATCTACAGAGATCTGTGGGAGCGAGGCTTTTTCCTCAGCGCCGCCGGCAAGTTCGGCGGCGACTTCCTGGTGTATCCTGGTGACCCGCTCCGTTTCCATGCCCACTACATTGCCCAGTGCTGGGCTCCGGAGGACCCCATTCCACTGCAGGACCTGGTCTCTGCCGGCCGCCTGGGAACAAGTGTGAGGAAGACGCTGCTGCTGTGCTCCCCACAGCCTGATGTAAATGACCTCAATAGAATCTCGACTTCCTGCACATTTATTGGCTGA

XM_004866711.1 Coding sequence

Mboat7 membrane bound O-acyltransferase domain containing 7, transcript variant X2

High confidence: 3 potential gene matches
Length: 1425 bp    Location: 2407196..2417574   Strand: +
>XM_004866711.1
ATGTCACCCGAGGAGTGGACGTATCTGGTGGTTCTTCTCATCTCCATCCCCATCGGCTTCCTCTTTAAGAAAGCTGGACCTGGGCTGAAGAGATGGGGGGCGGCGGCGGTGGGCCTGGGGCTCACCGTGTTCACCTGCGGCCCCCACACTCTGCACTCCCTGATCACAATGCTGGGGACCTGGGCCCTCATTCAGGCCCAGCCCTGCTCCTGCCACGCCCTGGCTCTCGCCTGGACCTTCTCCTACCTCCTCTTCTTCCGAGCCCTCAGCCTGCTGGGCCTGCCGACTCCTACACCCTTCACCAATGCCGTCCAGCTGCTGTTGACACTGAAGCTGGTGAGTCTGGCCAGTGACGTCCAGGACCTGCACTTGGCCCAGCGGAAGGAAATGGCCTCCGGCTTCAGCAAGGCGCCCACCCTGGGGCTGCTGCCCCATGTTCCCTCCTTGATGGAGACGCTGAGCTATAGCTACTGCTACGTGGGAATCATGACAGGCCCATTCTTCCGCTACCGCACCTACCTGGATTGGCTGGAGCAGCCCTTCCCGGAGGCTCTGCCCAGCCTGAGGCCCCTGCTCTGCCGGGCCTGGCCGGCCCCGCTCTTCGGCCTGCTCTTCCTGCTGTCCTCCCACCTCTTCCCTTTGGAGGCCGTGCGTGAAGATGCCTTCTACGCCCGCCCGCTGCCTACCCGCCTCTTCTACATGATCCCCGTCTTCTTCGCCTTCCGCATGCGCTTCTACGTGGCCTGGATTGCTGCCGAGTGTGGCTGCATTGCTGCTGGCTTTGGGGCCTACCCTGTGGCCGCCAAGGCCCGGGCCGGGGGCGGCCCCACCCTCCAATGCCCACCCCCTAGCAGTCTGGAGAAGGCAGCTGCCCTGGAGTATGACTATGAGACGATCCGCAACATCGACTGCTACAACACAGACTTCTGCATGCGTGTGCGGGAGGGCATGCGGTACTGGAACATGACGGTGCAGTGGTGGCTGGCACAGTACATCTACAAGAGTGCACCTGCCAGCTCCTACGTCCTGAGGAGCGCCTGGACCATGTTGCTGAGCGCCTACTGGCACGGCCTGCACCCTGGCTACTATCTCAGCTTCCTGACCGTCCCGCTGTGCCTGGCTGCCGAGGGCTGTTTGGAGTCCGCCCTGTGGGGGCGGCTGAGCCCCAGGGGCCAGAAAGTGTGGTACTGGGTGCACTGGTTCCTGAAGATGCGCGCCTACGACTACATGTGCATGGGCTTTGTGCTCCTGTCCATGGGCAGCACGCTCCGGTACTGGGCCTCTGTCTACTTCTGCGTGCACATCCTGGCCGGGGCCTGCCTGGGGCTGGGGCTGGCTTTGGGTGGGGGCAGGCGCAGCCTGCGGAAGACTGCGTCCGAGTCCCAGGCCGCCAGCACGGCCCCAGAGAAGCTCCGGGAGGAGTGA

XM_004866689.1 Coding sequence

Cdc42ep5 CDC42 effector protein (Rho GTPase binding) 5, transcript variant X1

Length: 603 bp    Location: 2272082..2276418   Strand: +
>XM_004866689.1
ATGCCTGGGCCCCTCACCCCCTCCCGGAGCGACTTGACACCTCATTGCCAGGTGAGATCTGCCAGCCAGGAGGAAGGAGGAAGAAGGGCAAGTGGGCGGGTTAGCAGGCAGGCGAAGGTGGACTCTGATCCCCGGCTCAAGGAGGACCAAGCACCCTCAGGCTGTGAGAACCTCGAGATGCCGGTGCTGAAGCAGCCGGGCCCAGCGCAGCCCAAGAAGCGCAGCCCAAGAGGCGGTGCGCTGTCCATCTCGGCGCCGCTCGGTGACTTCCGGCACACGCTGCACGTGGGGCGCGGCGGCGACACCTTCGGGGACACCTCCTTCCTGAGCCGCCACGGGGCCGCGCCGCCCGCCGCCGAGCCCCACTCGAAGCCCGCGGGGACCCCGCCGCCCCCGCCCGCGGCGCCCCCAGACCCGCTGCTGTCCTTCCACCTGGACCTGGGCCCCTCCATGCTGGACGCCGTGCTGGGCGTCATGGATGCGGGGCGCGCGGGAGCGGCTGCCCAGCCGGAAGCAGACGCACGCCCTGGGACGCAGCCCCGCCGGGGCCCCCGCAGCCGCCCCGACGCCCGCCTGGAGCTGGACCGCGGGCTCGGCCTGTAG

XM_004866678.1 Coding sequence

Syt5 synaptotagmin V, transcript variant X2

Length: 993 bp    Location: 2071711..2078376   Strand: +
>XM_004866678.1
ATGTTCCCAGAGCCCCCGACCCCGGGGCCTCCAGCTTCCGCCGCGCCTCCGGACTCCAGCCGCATCCGCCAGGGCGCAGTGCCGCCCTGGGCCCTGGCCACCATCGTGCTGGTCTCAGGCCTCCTGGTCTTCAGCTGCTGTTTCTGTCTCTGCCGGAAGCGTTGTCGGAGGCGGATGGGCAAGAAGAACCAGGCACAAGCCCAAGTCCACCTTCAGGAAGTGAAGGAGCTGGGCCAGAGTTACATAGACAAGGTGCAGCCAGAAGTAGAGGAGCTGGAGCCCATGCCAGCTGGGCCAGGGCAGCAGGTAGCAGAGAAGCATGAGCTAGGACGACTGCAGTACTCACTGGACTATGACTTTCAGAGTGGTCAGCTGCTGGTGGGCATCCTGCAAGCGGAGGGACTGGCGGCCTTGGACCTGGGTGGCTCCTCGGACCCCTACGTGCGGGTCTACCTGCTACCAGACAAGCGGAGGCGACACGAGACCAAGGTGCATCGGCAGACACTGAACCCACACTTTGGGGAGGCCTTCACCTTCAAGCTGGAGAAGCTAGGGGACATCTGCTTCTCTCTCCGCTATGTCCCCACGGCTGGGAAGCTCACTGTCATTGTCCTGGAGGCTAAAAACCTGAAGAAGATGGACGTAGGAGGACTGTCAGATCCCTACGTCAAGGTCCACCTGCTGCAGGGGGGCAAAAAGGTGCGGAAGAAGAAAACCACTATCAAGAAGAACACGCTGAACCCCTACTACAATGAGGCCTTCAGCTTTGAGGTGCCCTGTGACCAAGTCCAGAAGGTGCAGGTGGAGCTGACCGTGCTGGACTACGACAAGCTGGGCAGGAACGAGGCGGTCGGGCGGGTGGCGGTGGGCGTGGCCGCCGGCGGGGCTGGCCTGCGGCACTGGGCGGACATGCTGGCCAACCCCCGGCGGCCGGTGGCGCAGTGGCACTCGCTGCGGCCCCCTGACCGAGTGAGGCCACCGCCTGCACCCTGA

XM_004866680.1 Coding sequence

Tnnt1 troponin T type 1 (skeletal, slow), transcript variant X2

Length: 795 bp    Location: 2093944..2100647   Strand: +
>XM_004866680.1
ATGTCGGACACCGAGGAGCAGGACTATGAGGAGGAGCAGGCTGAAGAGGAGGAGCCCGCCGAGGAGGAGGAGGAGGAAGCCCCCGAGGAGCCGGAGCCGGAGGCAGAGCGAGAAGAGGAGCGCCCCAAACCAAGCCGTCCAGTGGTGCCCCCGTTGATCCCCCCCAAGATCCCAGAAGGGGAGCGCGTGGACTTTGATGACATCCACCGCAAGCGCATGGAGAAGGACCTCCTGGAGCTGCAGACGCTCATCGACGTGCACTTTGAGCAGCGCAAGAAGGAGGAGGAGGAGCTGGTGGCGCTGAAGGATCGCATTGAGCGGCGCCGGGCGGAGAGGGCTGAGCAGCAGCGCTTCAGGACTGAGAAGGAGCGCGAGCGGCAGGCCAAGCTGGCGGAGGAGAAGATGCGGAAGGAGGAGGAGGAGGCCAAGAAGCGAGCAGAGGACGATGCCAAGAAGAAGAAAGTGCTGTCCAACATGGGGGCCCACTTCGGGGGTTACCTGGTCAAGGCAGAGCAGAAGCGGGGGAAGCGGCAGACTGGGCGGGAGATGAAGCTGCGGATCCTGTCTGAGCGGAAGAAGCCCCTGAACATCGACCACATGGGCGAGGAGCAGCTCAGGGACAAGGCCCAGGAGCTGTCAGACTGGATCCACCAGCTGGAGTCTGAGAAGTTCGACTTGATGGCGAAGCTGAAGCAGCAGAAATACGAGATCAATGTGCTGTACAACCGCATCAGCCACGCTCAGAAGTTCCGGAAGGGTGCAGGAAAGGGCCGCGTCGGAGGCCGCTGGAAGTGA

XM_004866665.1 Coding sequence

Ppp6r1 protein phosphatase 6, regulatory subunit 1, transcript variant X2

Length: 2643 bp    Location: 2014294..2034848   Strand: +
>XM_004866665.1
ATGTTTTGGAAGTTTGACCTGCACACAAGCTCGCACCTGGACACGCTGCTGGAGCGGGAGGACCTGAGCCTACCCGAGCTGCTGGATGAGGAGGACGTGCTGCAGGAGTGCAAAGTCGTGAACCGCAAGCTGCTGGACTTCCTGCTGCAGCCGCTGCACCTGCAGGCCATGGTGGCCTGGGTCACCCAGGAGCCCCCAGCCAATGCCGAGGAGCGGCTGCGCTACAAGTACCCCAGCGTGGCCTGCGAGATCCTCACCTCAGACGTGCCCCAGATCAACGATGCCCTGGGTGCAGATGAGTCACTCCTGAACCGGCTGTACGGCTTCCTGCAGAGCAGCAGCAGCCTCAACCCGCTGCTGGCCAGCTTCTTCAGCAAGGTCATGGGCATCCTCATCAACCGCAAGACAGACCAGCTCGTGTCTTTCCTGCGCAAGAAGGACGACTTTGTGGACCTGCTGCTGCGGCACATTGGCACCTCAGCCATCATGGACCTCCTGCTGCGCCTGCTCACCTGCGTGGAGCGGCCCCAGCTGCGGCAAGATGTCTTCACTTGGCTCAATGAGGAGAAAATCATCCAGCGGCTGATCGACCAGATCCACCCATCAAAGGATGACAATCAACATTCCAACGCATCTCAGTCTCTGTGCGACATCATCCGCCTGAGCCGGGAGCAGCTGATGCAGGGCCAGGACAGCCTGGAGCCCGACCAGCTGCTGGCCACCCTGGAAAAGCAGGAGACCATGGAGCAGCTGCTCAGCAACATGTTCGAGGGGGAGCTGAGCCAGTCTGTGCTCGTCAGCGGGATCCAGGTGCTGCTCACTCTGCTGGAGCCCAGGCGGCCCAGGTCAGAGTCCGTGACAATGAACAACTTCTTCAGCAGTGTGGATGGGCAGCTGGAGCTCCTGGCCCAGGGGGCCCTGGATAACACTGTGTCCAGCACGGGGGCCCTGCATGCCCTTCGCCCACGGCTCAGCCGCTTCCACCAGCTCCTGCTCGAGCCTCTCGAGCTGGAGCCGCTGCAGATGACATGGGGCAGCCTGGCCCCGCCCCTGGGCAACACGCGGCTGCACGTGGTCAAGCTCCTGGCCAGCGCCCTGAGTGCCAATGACACTGCCCTGACACGGGAGCTCCTGGTGCTGGACGTGCCCAACACCATGCTGGACCTCTTCTTCCACTACGTCTTCAACAACTTCCTGCACACGCAAGTGGAGGTGTGTGTGAGCGCCATGCTGAGCGCGGGGCCCCCTCCCCACAGCGGCTCTGAGACGCCGGGCCAGAACCCCGTGCTGAAACACCTGCTGCAGCACTGCCGCCTGGTGGAGCGGATCCTCACATCCTGGGAGGAGAATGACTGTGTCCAGTCCGGGGGTGGCCCAAGGAAGGGCTACATGGGCCACTTGACACGGGTGGCCAATGCTTTGGTGCAAAACGCGGAGCAGGGGCCCAACGCTGAGCAGCTGGGGCAGTTGCTGAAGGAGCTGCCGGGTGAGCAGCTGGAGCGGTGGGAAGCGTTTGTGTCGGGACCCCTGGCCGAGACCAACAAGAGGAACACTGTGGACCTGGTGAACACCCACCACCTGCACTCCTCCAGTGACGACGAGGACGACCGGCTCAAGGAGTTCAGCTTCCCCGAGGAGGCCGTGCTGCAGCAGGCCTTCATGGACTTCCAGATGCAGCGCATGACCTCGGCCTTCATCGACCACTTTGGCTTTAACGACGAGGAGTTTGGGGAGCAGGAGGAAAGCGTGAACGCGCCTTTCGATAAAACGGCCAACATCACCTTCTCCCTCAACGCCGACGACGAGAACCCCAACGCCAACCTGCTCGAGATATGCTACAAGGACCGCATCCAGCAGTTTGATGACGAGGAGGAGGAAGATGAGGAGGGCCAGGGCTCTGGGGAGTCGGATGGAGAGTACGGTGCCTGGCAGGGCAGCCCGCTGAGCAGGGCAGCCCGCTCGGGCCAGCCCCCCGGGGCCCGGAGTGGAGGCAGCACTGACAGTGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAAGAGGAGGAGGGTGGCGGCGCCCCCATGCCCCCCGGCCCTCAGCCTCCCGGTAAGTGTGGGTCCCTGGGCAGGGCGGGGCACCTGCCTGCCGCTCCTCGCTCACCCTCCTTCCCACCCCACCGCCCAGGCCCCAGCTGGACAGCCGCCTTCGCACCAGTGCCTGTGGACGCCCTGCCAGGCCCCTCCAACTCTGGGGCAGAGGAGCTGCTGCCCCCTGTCCAGAAGCCGAGCAGCCCCCCGACCCCTGTCAGCCCGCAGCTCAGGTCTCAGGGCCCCGTTCCCCCCTCAGCACCTCAGATGGCAGCAGATGGTAGCAAAGTAGAGGAGCCCTCTGCCCCCTGCCAGGCCCTGGTCAGTGTCGAGGCCCTCCAGGCTGCCCTGCACGGGATGCGCTCTGCCCCCAGCTCCTCGGACAGTGCCCCCAGAGACCCCTCTACCTCTGTCCCAGCCTCCGGGGCCCAGCACCCCTCCCAGACCACAGAGGGGGAGAAGAACCCGGAGCCCTTGGGGCTTCCCCCAAGCCAGAGTGCCCAGGCCCGCGAGCCACCTCCGATGCCCAACGGCTCGGCTCCAGTAGCACCCCTCTCCCCGGGCTCCCAGTAG

XM_004866645.1 Coding sequence

Isoc2 isochorismatase domain containing 2, transcript variant X1

Length: 615 bp    Location: 1891540..1896755   Strand: +
>XM_004866645.1
ATGGCAGCAGCCAGGCCGGGCCTGGGCCGAATCCTCCCAGGATCGTCCATCCTATTCCTGTGCGACATGCAGGAGAAGTTCCGCCACAGCATCGCGTACTTCCCGGAGGTGGTGGCCGTGGCCGCACGGATGCTCAGGGCATCCCGGCTTCTGGAGGTCCCAGCTGTGCTGACGGAGCAATATCCCCAAGGCCTGGGCCCCACGGTTCCAGAGCTGGGTGCTGAGGGCCTCCCAGCCCTGAGTAAAACCTGCTTCAGCATGGTGCCTGCCGTGCAGCAGGAGCTGGACAGCCGGCCCCAGCTTCAGTCCGTGCTGCTCTGCGGCATCGAGGCGCAGGCCTGCATCCTGAACACAGCTCTCGACCTGCTGGACAGGGGACTGCAGGTCCACGTCGTGGTGGACGCCTGCTCCTCTCGAAGCCAGGTGGACAGGCTGGTGGCGCTGGGCCGCATGCGGCAGAGCGGTGCCTTCCTCTCCACCAGCGAGGGGCTCATTCTGCAGCTTGTGGGTGACGCCTCCCATCCCCGGTTCAAGGAGATCCAGAAGATCATTAAGGAGCCCGCTCCGGACAGCGGGCTGCTGGGTCTCTTCCAAGGCCAGAAGCCCCTCTTCTGA

XM_004866657.1 Coding sequence

LOC101706975 cytochrome c oxidase subunit 6B2-like, transcript variant X2

Length: 267 bp    Location: 1943066..1944077   Strand: +
>XM_004866657.1
ATGTTGGGTGTCGAAGCCCAGAAGTCCCCCAAGGGGAAATGGACCATGCCACCCTTTGACCCGCGCTTCCCCAACCAGAACCAGATCCATAACTGCTACCAGAACTTCCTGGACTACCACCGCTGCGTTAAGGCAATGAGCCGCTGCGGCCAGAGCTCGCAGCTCTGCGAGTACTATTTCCGCGTGTACCGCTTGCTGTGCCCCCTCAGCTGGGTGCAGCGCTGGAACCAGCAGATCCAGGACGGGCCTTTCGCAGGCAAAATCTGA

XM_004866661.1 Coding sequence

Brsk1 BR serine/threonine kinase 1, transcript variant X3

Length: 2100 bp    Location: 1995200..1978942   Strand: -
>XM_004866661.1
ATGTCGTCCGGGGCCAAGGAGGGCGGAGGGGGCTCCCCCGCCTACCACCTCCCGCACCCCCACGCGCACCCCCCGCAGCACGCCCAGTATGTGGGCCCCTATCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGACTGGTTAAGCTCGGGGTCCACTGCATCACGGGTCAGAAGGTCGCCATCAAGATCGTGAACCGGGAGAAGCTGTCAGAGTCGGTGCTGATGAAGGTGGAGCGGGAGATCGCCATCCTGAAGCTCATCGAACACCCGCACGTGCTCAAGCTCCACGACGTCTATGAGAACAAGAAATATTTGTATCTGGTTCTGGAGCATGTCTCTGGCGGGGAGCTCTTCGACTACCTGGTGAAGAAGGGGAGGCTGACACCCAAGGAGGCCCGGAAGTTCTTCCGCCAGATTGTGTCGGCCCTGGACTTTTGCCACAGCTACTCCATCTGCCACAGGGACCTGAAGCCCGAGAACCTGTTGCTGGATGAGAAGAACAATATTCGAATTGCGGACTTCGGCATGGCATCCCTGCAGGTGGGGGACAGCCTTCTGGAGACCAGCTGTGGGTCCCCCCACTATGCGTGTCCGGAGGTGATCAAGGGGGAGAAGTATGATGGCCGCCGTGCAGACATGTGGAGCTGTGGGGTCATCCTCTTCGCCCTGCTCGTGGGGGCTCTGCCCTTCGACGACGACAACCTCCGCCAGCTGCTGGAGAAGGTGAAGCGAGGCGTCTTCCACATGCCCCACTTCATCCCTCCCGACTGCCAGAGCCTCCTGCGGGGGATGATCGAGGTGGAGCCCGAAAAGAGGCTGAGCCTGGAGCAAATACAGAAACATCCTTGGTACCTGGGCGGGAAGCACGAGCCCGACCCCTGCCTGGAGCCAGCCCCGGGCCGCAGGGTAGCCATGCGGAGCCTGCCTTCTAATGGTGAGCTGGACCCTGATGTCCTGGAGAGCATGGCATCGCTGGGCTGCTTCAGGGATCGTGACCGGCTGCACCGAGAGCTGCGCAGCGAGGAGGAGAACCAAGAAAAGATGATCTACTACCTGCTGTTGGACCGGAAGGAGCGGTATCCCAGCTGTGAAGACCAGGACCTGCCTCCCCGGAATGATGCTGACCCGCCTCGGAAGCGCGTAGATTCCCCTATGCTGAGCCGGCACGGGAAGCGGCGGCCGGAGCGAAAGTCCATGGAAGTCCTAAGCATCACGGACGCCGGGGGTGGCGGCTCCCCAGTGCCCACCCGCCGGGCCTTGGAGATGGCCCAGCACAGCCAGAGATCCCGTAGCGTCAGTGGCGCCTCCACCGGCCTGTCCTCCAGCCCTCTCAGCAGCCCAAGGCAGCCCCCGCCCCCCAGCGCCCGCTCCACGCCCCTGCCCGGACCCCCAGGCTCCCCGCGCTCCTCCGGAGGGACCCCCTTGCACTCGCCCCTGCACACGCCCCGGGCCAGCCCCACGGGGACCCCGGGGACGACGCCACCCCCCAGTCCCGGCGGTGGCGTTGGGGGAGCCGCCTGGAGGAGTCGGCTCAACTCCATCCGCAACAGCTTCCTGGGCTCCCCTCGCTTCCACCGGCGCAAGATGCAGGTCCCCACCGCTGAGGAGATGTCCAGTTTGACACCAGAGTCCTCTCCGGAACTGGCCAAACGCTCCTGGTTTGGGAACTTCATCTCCCTGGACAAAGAAGAACAAATATTCCTCGTGCTCAAGGACAAACCGCTCAGCAGCATCAAAGCGGACATTGTCCACGCCTTCCTGTCGATCCCCAGCCTGAGTCATAGTGTACTGTCACAGACCAGCTTCAGGGCCGAATACAAGACCAGTGGCGGCCCCTCCGTCTTCCAGAAGCCTGTCCGCTTCCAGGTGGACATCAGCTCCTCTGAGGGCCCTGAGCCCTCTCCCCACCGGGATGGCAGCAGTGGAGGTGGCATCTACTCCGTCACCTTTACTCTCATCTCTGGTCCCAGCCGGCGGTTCAAGCGTGTGGTGGAGACGATCCAGGCGCAGCTGCTGAGCACGCACGACCAGCCATCCGTGCAGGCCCTGGCAGGCCTTCTGCCACAGAGTTCCAGACCCCTGCTCTGGAGAGGGTGA

XM_004866649.1 Coding sequence

Ube2s ubiquitin-conjugating enzyme E2S, transcript variant X1

Length: 759 bp    Location: 1913738..1918746   Strand: +
>XM_004866649.1
ATGTTCGCTCTCCGGCTCCCGTGTACTGCCTGTGGCCAGCCCGTGGCGCAGCGCCCTTCCAAACTTCTCTGGTTTCTGTCTGCAGCTTGTAGAGAGAGGAACTCCAACGTGGAGAACCTGCCTCCCCACATCATACGCCTGGTGTACAAAGAGGTGACGACACTGACAGCCGACCCACCGGATGGCATCAAGGTCTTCCCCAACGAGGAGGACCTCACAGACCTGCAAGTCACCATTGAGGGCCCTGAGGGGACCCCCTATGCCGGGGGTCTGTTCCGCATGAAACTCCTGCTGGGGAAGGACTTCCCTGCCTCCCCACCCAAGGGCTACTTCCTGACCAAGATCTTCCACCCCAACGTGGGCGCCAATGGTGAGATCTGCGTCAACGTGCTCAAGCGGGACTGGACGGCCGAGCTGGGCATCCGGCATGTGCTGCTGACCATCAAGTGCCTGCTGATCCACCCCAACCCCGAGTCCGCTCTCAACGAGGAGGCGGGCCGCCTGCTGCTGGAGAACTATGAGGAGTATGCGGCACGCGCGCGCCTGCTCACCGAGATCCACGGCGGCTCAGGCGGGCCCAGCGCCAGGGTCCCTGCCGGGGGTGCCACAGCCTCCTCTGCCGACCCCTCTGCCCCTGCCAGCGTGGGGGGTCCGGGCGGGGCCGAGGGCCCCATGGCCAAGAAGCACGCAGGGGAGCGCGACAAGAAGCTGGCAGCGAAGAAGAAGACGGAGAAGAAGCGGGCGCTGCGGCGGCTGTAG

XM_004866641.1 Coding sequence

Nat14 N-acetyltransferase 14 (GCN5-related, putative), transcript variant X1

Length: 711 bp    Location: 1870250..1868393   Strand: -
>XM_004866641.1
ATGGGGGGCAAGGGGACGGAGGTGCCGACCTACGTGTTTTCCCCAGGTGCACGCCGGCTCCCTTCTGGGGCCGGCAGCCTCGGGTCTGTCATGGCCCCCAGCCACCTGTCCGTGCGGGAGATGCGGGAAGACGAGAAGACCCTGGTGCTGGAGATGCTGAAGGCTGGCGTGAAGGACACTGAAAACCGCGTGGCCCTCCACGCGCTCACACGGCCCCCGGCCCTGCTGCTCCTGGCAGCGGCCAGCAGTGCCTTGCGATTCGTCCTGGCCTCCTTCGCCCTGGCCCTCCTGCTGCCCGTGTTCCTGGCCGTGGCCGCTGTGAAGCTGGGCCTGCGAGCCCGGTGGGGCTCTCTGCCTCCCCCCAACAGCCTGGGGGGCCCCTGGGTGGCCGTGCGGGGCTCTGGTGACGTGTGTGGAGTCCTGGCCTTGGCTCCTGGCCCCACCCCAGGGGATGGAGCCCGGGTCACGCGACTCTCCGTCTCTCGCTGGCACCGCCGCCAGGGCGTGGGCCGCAGGCTGCTGGCCTTCGCGGAGGACCGGGCCCGAGCCTGGGCGGGTGGCGTGGGGGGTCCCCGGGCCCGGCTTGTGGTCCCAGTGGCTGTGCTGCTTGGGGGGGCAGTAGGGCTGCTGGAGGGCTGCGGCTACCAGGCTGAGGGCGGCTGGGGCTGCATGGGCTACACGCTGGTGAGGGAGTTCAGCAAGGACCTGTGA

XM_004866637.1 Coding sequence

LOC101700527 zinc finger protein 579-like, transcript variant X2

Length: 1593 bp    Location: 1820000..1823105   Strand: +
>XM_004866637.1
ATGGATCCGCAGCCCCCTCCGCCGGCGCAGGGCAGCCCTCCTCACCGCGGCCGGGGCCGGGGCCGAGGCCGGGGCCGCGGCCGGGGCCGGGGCCGGGGCCGCGGGGGTGCGGGAGCCCCGCGAGCGCCCCTGCCGTGCCCCACCTGCGGCCGCCTCTTCCGCTTCCCCTACTACCTCTCGCGGCACCGGCTGAGCCACTCGGGGCTGCGGCCTCACGCGTGCCCGCTGTGCCCCAAAGCCTTCCGGCGGCCCGCGCACCTGTCGCGCCACCTGCGGGGCCACGGCCCGCAGCCCCCGCTGCGCTGCGCCGCCTGTCCGCGCACCTTCCCGGAGCCCGCGCAGCTGCGCCGCCACCTGGCGCAGGAGCACGCAGGCGGCGAGGTGGAACTGGCCACGGAGCGTGCGGCCAAGGAGGAGGGCGAGGGCGCTGAGCAGCCGGCGGCGGGCGCCGAGGGTGAGCCGTGGGCCCCCGGGGAGCCCGAGCCGGCCGTGACCCCGAGCACGGAGCTGCACACACCCGAGCCCGAGGCTGTCGAGGCCGGGGCGGCCGAGCTGCGCGCGGAGCTGGCGCTGGCGGCCGGGCGGCAGGAGGAGAAGCAGGTGCTGCTGCAGGCCGACTGGACGCTGCTGTGCCTGCGCTGCCGCGAGGCCTTCGCCACCAAGGGCGAGCTCAAGGCGCACCCGTGCCTGCGCCCTGAGGGCGAGCAGGAGGCCGAGGGTGGGCCGCCGCCGCGGCCCAAGCGACACCAGTGCTCCATCTGCCTCAAGGCCTTCGCCAGGCCCTGGTCGCTGTCTCGCCACCGGCTGGTCCACTCCACCGACCGCCCGTTCGTGTGCCCGGACTGCGGCCTGGCCTTCCGCCTGGCCTCCTACCTCCGCCAGCACCGCCGCGTGCACGGCCCGCTCAGCCTGCTGGTGCCGCTGCCCAAGAAGGACGACAGAGCCGCGGGCGCCCGGAACTCGGGCCGGGGACCCGAGGGCGGCGAGGGCGCCACGGAGGGGGGCGACGGCGGCGAGAACGGGGGCGACGCGGGCCCCGCGCGCCCCCCCGCCGGCGAGCCCCGCTTCTGGTGCCCTGAGTGCGGCAAGGGCTTCCGTCGCCGCGCGCACCTGCGCCAGCACGGCGTCACGCACTCGGGCGCGCGCCCCTTCCAGTGCGTGCGCTGCCAGCGCGAGTTCAAGCGTCTGGCCGACCTGGCGCGCCACGCGCAGGTGCACGCGGGTGGCCCGGCCCCGCACCTCTGCCCTCGGTGCCCGCGGCGCTTCTCGCGTGCCTACAGCCTTCTGCGCCACCAGCGATGCCACCGCGCCGAGCTGGAGCTGGAGAGGGCGGCCGCGCTGCAGGCCCTGCAGGCCCAGGCTTCGCAGTCCCCGGCTCCGCTGGAGCAGGAAGCCGAGGGGCTCCCGCTGCCCGTTGTGCGCATCAAGGAGGAACCGCCCTCGCCGGGGACTCTGCCCCAGTCCCCGGCGGCACCCCCGGTCTTCCTCAGCGCCTCCTGCTTCGACAGCCAAGACCACTCAGCCTTCAAGATGGAAGAGGACGAGGTGGACAGCAAAGCCCAGCTGCGTGGCTTGGGCGGCCTGGCCTCCTGA

XM_004866631.1 Coding sequence

LOC101698839 zinc finger protein 865-like, transcript variant X2

Length: 3264 bp    Location: 1803681..1796356   Strand: -
>XM_004866631.1
ATGGGTGTTCAACAGCTGCAAGCGCCCGGGGACGCTACAGACAACAGTAGGCAGAGCCCTGTGTCTACGCAGAGTGGATGTGCTGGGAGAGAGGCGAAGAAAGGGTCTCCCAGCTCCGCTGAGATGGAGTCGAACCCAGCGGGGGGCAGCGGGAACGGCGGCCTGGGGGGCGAGGATGGCGTGCATTTCCAGAGCTACCCCTTCGACTTCCTGGAGTTCCTCAACCACCAGCGCTTCGAGCCCATGGAGCTATACGGGGAGCACGCCAAGGCCGTGGCTGCGCTGCCCTGCGCCCCGGGCCCCCCGCCGCCGCCGCCGCCGCAGCCCCCGCCGCCGCAGTTCGACTACCCGCCACCGGCCAGCTTCAAGCCCAAGGCCGAGGCGCCATCCTCAGCTTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCACCTCCTCCTCTTCCTCGTCCTCCACCTCCTCCGCCCCAGCCAAGAAGCCCGACCCGCCGCTGCCGCCCGCCTTTGGGGCACCCCCACCCCCGCTCTTCGACGCCGCCTTCCCTGCCCCGCAGTGGGGCATCGTGGACCTCTCCGGCCACCAGCACCTGTTCGGGAACCTGAAGCGCGGCGGGCCGGCGGCAGGGCCGGGCGTGGCGCCCGGTCTTGGTGCACCCGCGGGGACCCCGGGGCCGCTGCCCGCGCCCTCACAGACCCCACCTGGCCCCGCCGCCACGGGGGCGGCCTGCGACCCCGCCAAGGACGACAAAGGCTACTTCCGGCGGCTCAAGTACCTGATGGAGCGGCGCTTCCCTTGTGGTGTGTGCCAGAAATCCTTCAAGCAGTCCTCGCACCTGGTGCAGCACATGCTCGTGCACTCGGGCGAGCGGCCCTACGAGTGCGGCGTGTGCGGCCGCACTTACAACCACGTGTCCAGCCTCATCCGCCACCGCCGCTGCCACAAGGACACGCCGGCCGCGGGGGCCCCGCCGGCGCCCCCTGGTGCTCCACTCGCGGCCCCACTGGGCCTCCCCACCGGTGCCGCTGCAGGTGTCACCCCTGCCCCAGTGGGGCCCGCTCCCGCACCCCCAGCCGATGGCAGTGCCACCCCCACCCCTGCGGGCATCCCCGGGCCCCCTGCGGCCAGCGCGGGTGGAGATGGCCCATTCGCCTGCCCGCTGTGCTGGAAGGTGTTCAAGAAGCCCAGCCACCTGCACCAGCACCAGATCATCCACACGGGCGAGAAGCCCTTCTCCTGCTCTGTGTGCAGCAAGAGCTTCAACCGGCGCGAAAGCCTCAAGCGGCACGTGAAGACGCACTCAGCCGACCTGCTGCGCCTGCCCTGCGGCGTGTGCGGCAAGGCCTTCCGCGACGCCGCCTACCTGCTCAAGCACCAGGCGGCACACGCGGGGGCGGGGGCGGGGGCGCGGCCGGCCTACGCCTGCGACCTGTGCGGCAAGTCCTACTCGGCCCCGCAGAGCCTGTTGCGCCACAAGGCCGCGCATGCGCCACCCGCTGCCCCCGAGGCGCCCAAGGACTCGGCGGCTTCGGCCGTCCCGCCGCCCGCGCCTGCCTTCCCCGCCGGCCCCTACCTGCTGCCCACGGAGCCGCCCGCGGGCGACAGTGAGAAGGCGGCGGCAGCTGCTGCCGCGGCCGTGGTGTACGGCGCTGTGCCCGTGCCACTGCTGGGCGCGCACCCGCTGCTGCTCGGGGGGCCGGGGGCCGGGGGCGCGGGTGGTGCAGGCGGTGCGGGCGGCGCGGCTGGAAAGACCTTCTGCTGCGGGATCTGCGGGCGCGGCTTCGGCCGCCGTGAGACGCTGAAGCGCCACGAGCGGATCCACACGGGCGAGAAGCCGCACCAGTGCCCGGTGTGCGGGAAGCGCTTCCGCGAGTCCTTCCACCTGAGCAAGCACCACGTGGTGCACACGCGCGAGCGGCCCTACAAGTGCGAGCTCTGCGGCAAGGTCTTCGGCTACCCGCAGAGCCTCACGCGCCACCGCCAGGTGCACCGGCTGCAGCTGCCCTGCGCCCTGGCTGGGGCCGCCGGGCTGCCAGCTGCCCAAGGCGCCCCGGGAGCCTGCGGAGCCGGGGCCTCCAGCGCTGGGGGGGCGGGCCCCGCCGATGCGCTCAGCTACGCGTGCTCGGACTGCGGCGAACACTTCCCCGACCTCTTCCACGTCATGAGCCACAAGGAGGCGCACATGTCCGAGAAACCTTACGGCTGCGACGCCTGCGGCAAGACCTTCGGCTTCATCGAGAACCTCATGTGGCACAAGCTGGTGCATCAGGCCGCCCCCGAGCGCTTGCTGCCCACTGGTCCCCAGCCCGCAGAGAGCTCGGGTGGCACCGACGCGGCCAGTGTACTGGACAACGGGCTGGCTGGAGAGGTGGGCGCAGCTGTGGCGGCCCTGGCCGGGGTGTCGGGGGGCGAGGACGCGGGCGGCGCTTCTGCTGGGGCCGGTGCGGGCGCGGGCGCGGGTCCAGAACGCTTCAGCTGCGCCACGTGTGGCCAGAGCTTCAAGCACTTCCTGGGCCTGGTGACGCACAAGTACGTGCACCTGGTGCGGCGGACCCTGGGCTGCGGCCTCTGCGGCCAGAGCTTTGCGGGCGCCTACGACCTGCTCCTGCATCGCCGCAGCCACCGCCAGAAGCGCGGCTTTCGCTGCCCAGTGTGCGGGAAGCGCTTCTGGGAGGCAGCTTTGCTCATGCGCCATCAGCGCTGCCACACGGAGCAGCGGCCCTACCGGTGCGGCGTGTGCGGCCGGGGCTTCCTGCGTTCCTGGTACCTGCGACAGCACCGCGTGGTGCACACCGGCGAGCGCGCCTTCAAGTGCGGTGTGTGTGCTAAGCGCTTCGCGCAGTCGTCCAGCCTGGCCGAGCACCGCAGGCTGCATGCTGTGGCGCGGCCCCAGCGCTGCGGTGCGTGTGGCAAAACCTTCCGTTACCGCTCCAACCTGCTGGAGCACCAGCGGCTGCACCTGGGCGAGCGAGCCTACCGCTGCGAGCACTGCGGCAAGGGCTTCTTCTACCTGAGCTCCGTGCTGCGCCACCAGCGTGCCCACGAGCCGCCGCGGCCCGAGCTGCGCTGCCCCGCCTGCCTCAAGGCCTTCAAAGACCCTGGCTACTTTCGCAAGCACCTGGCGGCCCACCAGGGTGGCCGGCCCTTCCGCTGCTCCTCCTGCGGCGAGGGCTTCTCCAACACCTACGGGCTGAAGAAGCACCGCCTGGTGCACAAGGCCGACGGCCTCGGAGCGCCGGGGGCTGGGGCCCTCGCCGGGAAGGACGCCTGA

XM_004866628.1 Coding sequence

Znf524 zinc finger protein 524, transcript variant X1

Length: 801 bp    Location: 1807804..1804875   Strand: -
>XM_004866628.1
ATGGACACCCCCAGCCCAGGCCCGTTGCCTTCTTCACCTTTGCCCGGGGAGGAAGAGAAGCCTCAGGCTTTACTTCCTCCTGTGCCCCGGGGCCGCCGAGGGCGACCTCCGGGGGGTGCCGCCTCCTGTCACCGGAAGCTCAAGTCCTCGCTTCCCCGAAAGCGGGGCCGACCCCCCAAGTCAGGGCCCGAGCTCTCGCTGGCACAGGGGCTGCCGGCAGCTGCAGTGGACAGCGGCGACGGCGAAGGAGGCAGCGACCTCCTGCTGATCGATGACCAGGGCGTGCCCTACACAGTCTCGGAGGGCTCGGTGGCCGCTGGGCCTCAGGTCTCCGGCCCTCGGAGGGCCCCGCATTTCTGCCCTGTGTGCCTGAGGGCCTTCCCTTACCTCTCCGACCTGGAGCGCCACAGCATCTCGCACTCGGAGCTGAAGCCACATGAGTGCAAGGATTGCGGCAAGACCTTCAAGCGGTCCAGCCACCTGCGGCGACACTGCAACATCCACGCGGGGCTCCGGCCCTTCCTGTGCGCTCTGTGCCCGCGCCGCTTCCGCGAGGCCGGCGAGCTGGCGCACCACCACCGCGTGCACTCGGGCGAGCGCCCCTACCAGTGCCCCGTGTGCCGTCTGCGCTTCACCGAGGCCAACACGCTTCGGCGTCACTCCAAGCGCAAGCACCCCGAGGCCCTGGGGCTGCCCGTGTGTCGCCCGGACCCGAGGCCAGAGCCGCCGTGGGACAATGAGGGCATCCCGGCCACCGAGGGAGCGCACGAGGAGGGCTCCGAGGGGAACGAGCCCGCCTGA

XM_004866629.1 Coding sequence

Znf524 zinc finger protein 524, transcript variant X2

Length: 801 bp    Location: 1806245..1804875   Strand: -
>XM_004866629.1
ATGGACACCCCCAGCCCAGGCCCGTTGCCTTCTTCACCTTTGCCCGGGGAGGAAGAGAAGCCTCAGGCTTTACTTCCTCCTGTGCCCCGGGGCCGCCGAGGGCGACCTCCGGGGGGTGCCGCCTCCTGTCACCGGAAGCTCAAGTCCTCGCTTCCCCGAAAGCGGGGCCGACCCCCCAAGTCAGGGCCCGAGCTCTCGCTGGCACAGGGGCTGCCGGCAGCTGCAGTGGACAGCGGCGACGGCGAAGGAGGCAGCGACCTCCTGCTGATCGATGACCAGGGCGTGCCCTACACAGTCTCGGAGGGCTCGGTGGCCGCTGGGCCTCAGGTCTCCGGCCCTCGGAGGGCCCCGCATTTCTGCCCTGTGTGCCTGAGGGCCTTCCCTTACCTCTCCGACCTGGAGCGCCACAGCATCTCGCACTCGGAGCTGAAGCCACATGAGTGCAAGGATTGCGGCAAGACCTTCAAGCGGTCCAGCCACCTGCGGCGACACTGCAACATCCACGCGGGGCTCCGGCCCTTCCTGTGCGCTCTGTGCCCGCGCCGCTTCCGCGAGGCCGGCGAGCTGGCGCACCACCACCGCGTGCACTCGGGCGAGCGCCCCTACCAGTGCCCCGTGTGCCGTCTGCGCTTCACCGAGGCCAACACGCTTCGGCGTCACTCCAAGCGCAAGCACCCCGAGGCCCTGGGGCTGCCCGTGTGTCGCCCGGACCCGAGGCCAGAGCCGCCGTGGGACAATGAGGGCATCCCGGCCACCGAGGGAGCGCACGAGGAGGGCTCCGAGGGGAACGAGCCCGCCTGA

XM_004866619.1 Coding sequence

U2af2 U2 small nuclear RNA auxiliary factor 2, transcript variant X4

Length: 1464 bp    Location: 1755980..1748138   Strand: -
>XM_004866619.1
ATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCTCCTGGCAACCCAGTCTTGGCTGTGCAGATCAACCAGGACAAGAACTTTGCCTTTCTGGAGTTCCGCTCAGTGGATGAGACGACCCAGGCCATGGCCTTCGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCTCACGACTACCAGCCGCTGCCCGGCATGTCGGAGAACCCCTCGGTCTATGTGCCTGGAGTTGTGTCTACTGTGGTCCCTGACTCTGCCCATAAGCTGTTTATCGGGGGTCTACCTAATTACCTGAACGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTCAAGGATAGTGCCACAGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACCGACCAGGCCATCGCGGGGCTGAACGGCATGCAGCTGGGGGACAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGCGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCCGTGACCCTGCAAGTGCCGGGCCTGATGAGCTCGCAGGTGCAGATGGGCGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCCGAGGAGCTGCTGGATGATGAGGAGTATGAGGAGATCGTGGAGGATGTGCGGGATGAGTGCAGCAAGTACGGGCTGGTGAAGTCCATCGAGATCCCCCGGCCCGTGGATGGCGTGGAGGTGCCCGGCTGTGGAAAGGTCAGCACTCACCCTGGCCTGTGTCTCGCCGGCCACAAGTGGGCTCCGCGTTCCTCTCCCCGCGGGACTGGTGTGTGTGAGCGCGGCGGGAGTGCACACCTGCAGTCCCAGCACTGTGTGAGGCCCCCTGCATCCACACAGGCAGGCTCGGGTCCCTGGCATCACCATGTGGGTGGCGGCGGTGAGGGCGTGGCTGGCATTCACCCGTCCACCTGGTTGGTGTACCGATGGCGCTTGTGCTGTGCCCAGCGAATGAGCGAGCCAGCATTCTGCCATGAACAGGGCCCCCAGTCCTGGGGCAGTGCAGGAGCAGCCCGGCAAGCCTGGCCAAAGTTGGGGCTGAGGTGTTCTGGGGAGCAGGGTGAAGAGGCCCTGGCCCTGGCCCTGGCATCCGCTGAGCTGTTACCTCACTGCGTCCTGCTTGTGTTTTTAGGTTTCATATTAGGGCTTTTACAGACCTACTCAAGACTGATAATGGTACACCCCATCACCCACCTATCATTGCCATTTATTCAGCTTAATTTGTTTTCTTTTTTGGTACTGGGGATCAAACTCTCAGGAATGTGTGCTTGCCAGGCAGACGGGGTGCCACTGAGCTACATCCCCGGCAACTCAGCTTATTCTTGCCCCCACTTTTTTGTAATACTTGAAGCATCTCAGGTGTATTTCCTCTGA

XM_004866621.1 Coding sequence

U2af2 U2 small nuclear RNA auxiliary factor 2, transcript variant X6

Length: 1419 bp    Location: 1757220..1749810   Strand: -
>XM_004866621.1
ATGACTCCGAGGGCCTGGTTCTTGGTCCTGCGCTTTCTGTGGCCTTCCCTGGGACTGTCTTTAGGGGGCTGGTCTGTTTCTAGTGTCCTCCCTGTCTGCTGGAGGAGGGCCCCCTTGGGTTGTCCATTTCAGGGGTGTCAGTGTTGTTACTCAGGAGCTCCTTCCTCCCTGTCTCCCTCTGTTCTCTTCTCAAGGGTGAGGAGGGTTGGGGCATCAGGTCCTTCTGCCCAGTTTCCCTGTGGATGGAGGGTCTGTCTGCCCCTGTCCTTCCTCACTTCTGTGTCCTGGGGGTGGTGGAGGCGCAGAGGGGAGGGAGACAGCAGGGCTGAGGTGGGCTGCTCATCCTCCTCGGCTTTGTCCCAGCCCTGGGGCTCAGTGCCCTTGGGGGGTGTGGCGTGTGGGGAAGCCACAGGTTGCCAGTCACCCCTCCCCATACCATGCCTTTTTCTCCCACCCTGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCATGGTGGATTGATCCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTGCGTAAATACTGGGACGTGCCGCCACCCGGCTTTGAGCACATCACCCCGATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACCGCCCTCCTTCCCACCATGACCCCTGATGGTCTGGCTGTGACCCCAACGCCGGTGCCCGTGGTTGGAAGCCAGATGACCAGACAGGCCCGGCGCCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCTCCTGGCAACCCAGTCTTGGCTGTGCAGATCAACCAGGACAAGAACTTTGCCTTTCTGGAGTTCCGCTCAGTGGATGAGACGACCCAGGCCATGGCCTTCGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCTCACGACTACCAGCCGCTGCCCGGCATGTCGGAGAACCCCTCGGTCTATGTGCCTGGAGTTGTGTCTACTGTGGTCCCTGACTCTGCCCATAAGCTGTTTATCGGGGGTCTACCTAATTACCTGAACGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTCAAGGATAGTGCCACAGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACCGACCAGGTGAGCCTGGGGGCCTGGCTGCCCGCCATGTCTGCCCTGTCCTTGCTGTTGCAGCTGGGGTGCCCTCCTGGGACGAGGTGGGAGGTGGCTGCCCCAAGGAAGGTCCTGCGCTTTGCGCCCGCTCCAAACTCACTTTTGCGGTCCCGTTTCCCCACCGATGCCTTGGTCTGGGGGAGGAGCCAGGCTCCTGGGCCTTGA

XM_004866620.1 Coding sequence

U2af2 U2 small nuclear RNA auxiliary factor 2, transcript variant X5

Length: 1464 bp    Location: 1755992..1748138   Strand: -
>XM_004866620.1
ATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCTCCTGGCAACCCAGTCTTGGCTGTGCAGATCAACCAGGACAAGAACTTTGCCTTTCTGGAGTTCCGCTCAGTGGATGAGACGACCCAGGCCATGGCCTTCGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCTCACGACTACCAGCCGCTGCCCGGCATGTCGGAGAACCCCTCGGTCTATGTGCCTGGAGTTGTGTCTACTGTGGTCCCTGACTCTGCCCATAAGCTGTTTATCGGGGGTCTACCTAATTACCTGAACGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTCAAGGATAGTGCCACAGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACCGACCAGGCCATCGCGGGGCTGAACGGCATGCAGCTGGGGGACAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGCGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCCGTGACCCTGCAAGTGCCGGGCCTGATGAGCTCGCAGGTGCAGATGGGCGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCCGAGGAGCTGCTGGATGATGAGGAGTATGAGGAGATCGTGGAGGATGTGCGGGATGAGTGCAGCAAGTACGGGCTGGTGAAGTCCATCGAGATCCCCCGGCCCGTGGATGGCGTGGAGGTGCCCGGCTGTGGAAAGGTCAGCACTCACCCTGGCCTGTGTCTCGCCGGCCACAAGTGGGCTCCGCGTTCCTCTCCCCGCGGGACTGGTGTGTGTGAGCGCGGCGGGAGTGCACACCTGCAGTCCCAGCACTGTGTGAGGCCCCCTGCATCCACACAGGCAGGCTCGGGTCCCTGGCATCACCATGTGGGTGGCGGCGGTGAGGGCGTGGCTGGCATTCACCCGTCCACCTGGTTGGTGTACCGATGGCGCTTGTGCTGTGCCCAGCGAATGAGCGAGCCAGCATTCTGCCATGAACAGGGCCCCCAGTCCTGGGGCAGTGCAGGAGCAGCCCGGCAAGCCTGGCCAAAGTTGGGGCTGAGGTGTTCTGGGGAGCAGGGTGAAGAGGCCCTGGCCCTGGCCCTGGCATCCGCTGAGCTGTTACCTCACTGCGTCCTGCTTGTGTTTTTAGGTTTCATATTAGGGCTTTTACAGACCTACTCAAGACTGATAATGGTACACCCCATCACCCACCTATCATTGCCATTTATTCAGCTTAATTTGTTTTCTTTTTTGGTACTGGGGATCAAACTCTCAGGAATGTGTGCTTGCCAGGCAGACGGGGTGCCACTGAGCTACATCCCCGGCAACTCAGCTTATTCTTGCCCCCACTTTTTTGTAATACTTGAAGCATCTCAGGTGTATTTCCTCTGA

XM_004866618.1 Coding sequence

U2af2 U2 small nuclear RNA auxiliary factor 2, transcript variant X3

Length: 1692 bp    Location: 1757220..1747237   Strand: -
>XM_004866618.1
ATGACTCCGAGGGCCTGGTTCTTGGTCCTGCGCTTTCTGTGGCCTTCCCTGGGACTGTCTTTAGGGGGCTGGTCTGTTTCTAGTGTCCTCCCTGTCTGCTGGAGGAGGGCCCCCTTGGGTTGTCCATTTCAGGGGTGTCAGTGTTGTTACTCAGGAGCTCCTTCCTCCCTGTCTCCCTCTGTTCTCTTCTCAAGGGTGAGGAGGGTTGGGGCATCAGGTCCTTCTGCCCAGTTTCCCTGTGGATGGAGGGTCTGTCTGCCCCTGTCCTTCCTCACTTCTGTGTCCTGGGGGTGGTGGAGGCGCAGAGGGGAGGGAGACAGCAGGGCTGAGGTGGGCTGCTCATCCTCCTCGGCTTTGTCCCAGCCCTGGGGCTCAGTGCCCTTGGGGGGTGTGGCGTGTGGGGAAGCCACAGGTTGCCAGTCACCCCTCCCCATACCATGCCTTTTTCTCCCACCCTGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCATGGTGGATTGATCCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTGCGTAAATACTGGGACGTGCCGCCACCCGGCTTTGAGCACATCACCCCGATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACCGCCCTCCTTCCCACCATGACCCCTGATGGTCTGGCTGTGACCCCAACGCCGGTGCCCGTGGTTGGAAGCCAGATGACCAGACAGGCCCGGCGCCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCTCCTGGCAACCCAGTCTTGGCTGTGCAGATCAACCAGGACAAGAACTTTGCCTTTCTGGAGTTCCGCTCAGTGGATGAGACGACCCAGGCCATGGCCTTCGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCTCACGACTACCAGCCGCTGCCCGGCATGTCGGAGAACCCCTCGGTCTATGTGCCTGGAGTTGTGTCTACTGTGGTCCCTGACTCTGCCCATAAGCTGTTTATCGGGGGTCTACCTAATTACCTGAACGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTCAAGGATAGTGCCACAGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACCGACCAGGCCATCGCGGGGCTGAACGGCATGCAGCTGGGGGACAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGCGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCCGTGACCCTGCAAGTGCCGGGCCTGATGAGCTCGCAGGTGCAGATGGGCGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCCGAGGAGCTGCTGGATGATGAGGAGTATGAGGAGATCGTGGAGGATGTGCGGGATGAGTGCAGCAAGTACGGGCTGGTGAAGTCCATCGAGATCCCCCGGCCCGTGGATGGCGTGGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCGGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACCGGCCGCAAGTTCGCCAACAGAGTGGTGGTCACCAAGTACTGTGACCCCGACTCCTACCACCGCCGGGACTTCTGGTAG

XM_004866616.1 Coding sequence

U2af2 U2 small nuclear RNA auxiliary factor 2, transcript variant X1

Length: 2232 bp    Location: 1757220..1748134   Strand: -
>XM_004866616.1
ATGACTCCGAGGGCCTGGTTCTTGGTCCTGCGCTTTCTGTGGCCTTCCCTGGGACTGTCTTTAGGGGGCTGGTCTGTTTCTAGTGTCCTCCCTGTCTGCTGGAGGAGGGCCCCCTTGGGTTGTCCATTTCAGGGGTGTCAGTGTTGTTACTCAGGAGCTCCTTCCTCCCTGTCTCCCTCTGTTCTCTTCTCAAGGGTGAGGAGGGTTGGGGCATCAGGTCCTTCTGCCCAGTTTCCCTGTGGATGGAGGGTCTGTCTGCCCCTGTCCTTCCTCACTTCTGTGTCCTGGGGGTGGTGGAGGCGCAGAGGGGAGGGAGACAGCAGGGCTGAGGTGGGCTGCTCATCCTCCTCGGCTTTGTCCCAGCCCTGGGGCTCAGTGCCCTTGGGGGGTGTGGCGTGTGGGGAAGCCACAGGTTGCCAGTCACCCCTCCCCATACCATGCCTTTTTCTCCCACCCTGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCATGGTGGATTGATCCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTGCGTAAATACTGGGACGTGCCGCCACCCGGCTTTGAGCACATCACCCCGATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACCGCCCTCCTTCCCACCATGACCCCTGATGGTCTGGCTGTGACCCCAACGCCGGTGCCCGTGGTTGGAAGCCAGATGACCAGACAGGCCCGGCGCCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCTCCTGGCAACCCAGTCTTGGCTGTGCAGATCAACCAGGACAAGAACTTTGCCTTTCTGGAGTTCCGCTCAGTGGATGAGACGACCCAGGCCATGGCCTTCGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCTCACGACTACCAGCCGCTGCCCGGCATGTCGGAGAACCCCTCGGTCTATGTGCCTGGAGTTGTGTCTACTGTGGTCCCTGACTCTGCCCATAAGCTGTTTATCGGGGGTCTACCTAATTACCTGAACGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTCAAGGATAGTGCCACAGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACCGACCAGGCCATCGCGGGGCTGAACGGCATGCAGCTGGGGGACAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGCGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCCGTGACCCTGCAAGTGCCGGGCCTGATGAGCTCGCAGGTGCAGATGGGCGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCCGAGGAGCTGCTGGATGATGAGGAGTATGAGGAGATCGTGGAGGATGTGCGGGATGAGTGCAGCAAGTACGGGCTGGTGAAGTCCATCGAGATCCCCCGGCCCGTGGATGGCGTGGAGGTGCCCGGCTGTGGAAAGGTCAGCACTCACCCTGGCCTGTGTCTCGCCGGCCACAAGTGGGCTCCGCGTTCCTCTCCCCGCGGGACTGGTGTGTGTGAGCGCGGCGGGAGTGCACACCTGCAGTCCCAGCACTGTGTGAGGCCCCCTGCATCCACACAGGCAGGCTCGGGTCCCTGGCATCACCATGTGGGTGGCGGCGGTGAGGGCGTGGCTGGCATTCACCCGTCCACCTGGTTGGTGTACCGATGGCGCTTGTGCTGTGCCCAGCGAATGAGCGAGCCAGCATTCTGCCATGAACAGGGCCCCCAGTCCTGGGGCAGTGCAGGAGCAGCCCGGCAAGCCTGGCCAAAGTTGGGGCTGAGGTGTTCTGGGGAGCAGGGTGAAGAGGCCCTGGCCCTGGCCCTGGCATCCGCTGAGCTGTTACCTCACTGCGTCCTGCTTGTGTTTTTAGGTTTCATATTAGGGCTTTTACAGACCTACTCAAGACTGATAATGGTACACCCCATCACCCACCTATCATTGCCATTTATTCAGCTTAATTTGTTTTCTTTTTTGGTACTGGGGATCAAACTCTCAGGAATGTGTGCTTGCCAGGCAGACGGGGTGCCACTGAGCTACATCCCCGGCAACTCAGCTTATTCTTGCCCCCACTTTTTTGTAATACTTGAAGCATCTCAGGTGTATTTCCTCTGA

XM_004866610.1 Coding sequence

LOC101722414 NACHT, LRR and PYD domains-containing protein 8-like

Length: 156 bp    Location: 1615589..1613750   Strand: -
>XM_004866610.1
ATGAAGCTGGCCTGCCCGGGCGTGGCCGTCTCCCTGGGGAGCAGCCGGACGCTGACGCACCTGAGCCTGGCGGGCAATGCCCTGAAGGATGAAGGGGCGAGGCACATCTGGGAGAGCCTGGCAAGCGCGGCGCTGCCCCTCCAGAGGCTGGTGTGA

XM_004866612.1 Coding sequence

Epn1 epsin 1, transcript variant X2

Length: 1947 bp    Location: 1743917..1732895   Strand: -
>XM_004866612.1
ATGGTCAGCATCTCGTCCTTGCCTTTGAGGGCCAGTGGGGATTCTCCACAGGGGCAGCTCAGGCTCGGGCTGGCCTGCATCTCCTTTGTGTTTCCAAAGACCTCCTCTCCCCTCAGATGTGGTGATCTACCAGCGCTTTGTGTGGACAACCCCTGTGATTGCCATACCTCTGGACGCCCCCGGGGGCCTGAGCCCCTCAACTTCACCACCGGCACCATGTCGACCTCATCACTCCGGCGCCAGATGAAGAACATCGTCCACAACTACTCAGAGGCCGAGATCAAGGTCCGAGAGGCCACAAGCAATGACCCCTGGGGCCCGTCCAGCTCCCTCATGTCGGAGATCGCTGACCTCACCTACAACGTGGTGGCCTTCTCGGAGATCATGAGCATGATCTGGAAGCGGCTCAATGACCATGGCAAGAACTGGAGGCATGTCTACAAGGCCATGACGCTGATGGAGTACCTCATCAAGACGGGCTCGGAGCGCGTGTCGCAGCAGTGCAAGGAGAACATGTACGCAGTCCAGACGCTGAAGGACTTCCAGTACGTGGATCGTGACGGCAAGGACCAGGGCGTGAACGTGCGCGAGAAGGCCAAGCAGCTGGTGGCCCTGCTGCGGGACGAGGACCGGCTTCGGGAGGAGCGGGCCCACGCACTCAAGACCAAGGAGAAGCTAGCCCAGACGGCCACAGCCTCCTCGGCAGCCGTGGGCTCTGGGCCCCCACCTGAGGCCGAGCAGGCGTGGCCACAGAGCAGCGGGGAGGAAGAGCTGCAGCTGCAGCTGGCCCTGGCCATGAGCAAGGAGGAGGCCGATCAGCCGCCGTCCTGCGGCCCCGAGGACGACGTCCAGCTCCAGCTGGCCCTTAGTTTGAGCCGAGAGGAGCACGATAAGGAGGAGCGGATCCGGCGCGGGGATGACCTGAGGCTGCAGATGGCCATCGAGGAGAGCAAGAGGGACACGGGGGGCAAGGAGGAGTCATCCCTCATGGACCTCGCTGACGTCTTCTCAGCCCCGGCTCCTGCATCTGCTTCGGACCCCTGGGGGGCACCAGCGCCCATGGCTGCTGCTGTCCCTGCAGCTGCCCCTGCCTCGGACCCCTGGGGGGGAGCTGCTGTCCCTCCAGCTGCTGACCCCTGGGGCGGTCCGGCTCCCACGCCGGCCTCTGGGGACCCCTGGAGGCCAGCTGCCTCCACAGGGCCCTCAGCGGACCCGTGGGGTGGGACCCCAGCCCCCACAGCAGGAGAGGGGCCCACACCCGACCCATGGGGAGGCTCTGAGGGCGGGGCCCCCGTCAGTGGACCCCCAGCCTCTGATCCCTGGGCACCAGCGCCAGCCTTCTCGGACCCCTGGGGAGGGTCCCCTGCCAAGCCAAGCACCAATGGCACTGCAGTGGCTGGGGGCTTCGACGCTGAGCCTGATGAGTTCTCAGACTTTGACCGACTCCGCACGGCGCTGCCAGCCTCGGGGAGCAGCACGGGGGAGCTGGAGCTGCTAGCAGGAGAGGTGCCCGCCTGCAGCCCAGGGGCCTTCGACATGAGTGGGGTCGGGGGCTCCCTGGCCGAGGCCGTGGGGAGCCCCCCACCCACAGCCGGCCTGGCCCCCACGCCCCCCACACGGAAGACCCCAGAGTCATTCCTGGGCCCCAACGCAGCCCTCGTGGACCTGGACTCGCTGGTGAGCCGGCCGGGCCCCGCACCACCAGGAGCCAAGGCCTCGAACCCCTTCCTGCCGAGTGGAGCCCCGGCTGCTGGCCCCTCCGTAACCAACCCCTTCCAGCCAGCACCCCCGGCGACACTCACCTTGAATCAGCTCCGCCTCAGCCCTGTGCCCCCCGCCCCCGGGGTGCCGCCCACCTACATCTCTCCCCTTGGTGGGGGCCCCGGCCTGCCACCCATGATGCCCCCCGGGCCCCCGGCCCCCAACACTAACCCCTTCCTCCTGTAA

XM_004866608.1 Coding sequence

Znf667 zinc finger protein 667, transcript variant X6

Length: 1755 bp    Location: 1500868..1489748   Strand: -
>XM_004866608.1
ATGCTTATTGAACTTTTCCTGGTGGTCCCACATCGCCCGTGTTTGGAATGTGTCTGCCATTTCTCCAGCCCTGTGGAAACCCAAGCCTGTGGTCTTTGCCTTCGGAGGCCAAATGTCATCACCTTACTGGAGAAAGGGAAGGAGCCCTGGATCGTGGAGCCACCAAGGAGACGCTGGTGCCCCGATTTAGCATCTAAGTGTGAGATCGAGAAATTACCACCAAATCAGTGCAGCAAATCTAAGCAAAGCTTCTATCAAAGACCAGTTTCTATACAAATAAAGATTCCCACAGGCAAGAGGGTAGAGTTACTCCGAAGAAGGGCCAAGAAAGGGCTTTCAGCGAAGAAATCTTTGAAATGCAAGGACTGTGGGAAAATCTTCAGTCAGAGATCATCCCTCAAACTTCATCAGAATGCTCACACTGGAGAGAGGCCTTATGAATGCAGTCGTTGTAGAAAAGTTTTCAGACAGATCACATCCCTCATCCTTCACCAGAGAATTCACAATGAAAAGAAAAGCTATGGATGTGATCAGTGTGGGAAAGGCTTCAGTAAAAGCATAACCCTTATTCTACACAGGAGAATTCATAGTAGAAAGGAAACTTCTGACAATGGGATGGCCTCCAGTCCCAATACTTCTCTCAGTGCCCACCCCAGCAGTCATGTTGTCAAGAAGGCCCTCCAGTGCAGAAAATGTGGGAGAGCCTTTAGTCGTGTGGCAGCCCTTTTACTTCATAGGAGAATTCACAGTAGAAGGAAAATACATAAGTGCAATACTTGTGGGAAGGGCTTCAAAAAGAAATCAGTCCTTATTACACACAAAAGAATTCATACCAGAGAGAAAGCCCACAAAAAGGAGAAGGCCTTAGGTCAGAGTATACAGCGAAGAAATCGATTTTTAGAAAATCCTTTTAAATGCAGAAAGTGTGGTAAGTCCTTTCATAGGATTTCACCCCTTCTGCTTCATCAGAAAGTCCACACTTCAAGGAAACCCTACAAATGTGATAATTGCAATAAGGATTTTCAGCGGCTTTCAACCCTTATTCTCCATGAGAAAATTCATAAGAGAGAGATACTTTATCGATGTAATAAATGTCCGAAAGTCTTCAAGCGGAATTCAACCCTTATTCAACACCTGAAACTTCACAAAAGGAAGAAGAAACTCTTCGAGTGTAAAGAGTGTGGAAAGATGTTCTCTGGAACTGCAAACCTTAAAATACACCAGAACATACATTCTGAAGAGAAGCCTTTCAAATGCAGTAAGTGTAGTAAGGTGTTTGGCCGCCAGTCATTTCTTATTGAACATCAGCGAATTCATACTGGAGAAAAACCCTATCAGTGTGAGGAATGTGGGAAAGCCTTCAGTCACCGGATATCGCTTACTCGACACAAGAGAATACACACCGAAGACAGACCCTATGAATGTGATCAGTGTGGGAAAGCCTTCAGCCAGAGTGCCCATCTTGCCCAGCATGAGCGAATCCACACTGGAGAGAAGCCATACATATGCAAGATCTGTAAGAAGGCCTTCAGTCAGCGCACATCCCTTATTCTGCATGAAAGAAGTCACACTGGAGAGAAGCCTTATGAGTGTAATGAGTGCAGGAAAGCATTTAGCAGTGGCTCAGACCTTATTCGACACCAGAGAAGTCATTCTTCAGAGAAACCCTATGAATGTAGTAAATGTGGGAAGGCGTATAGCAGGAGCTCATCCCTGATTCGACATCAGAGCACACATCCTGAAGAAAAAGCCTAA

XM_004866611.1 Coding sequence

Epn1 epsin 1, transcript variant X1

Length: 1959 bp    Location: 1743917..1732895   Strand: -
>XM_004866611.1
ATGGTCAGCATCTCGTCCTTGCCTTTGAGGGCCAGTGGGGATTCTCCACAGGGGCAGCTCAGGCTCGGGCTGGCCTGCATCTCCTTTGTGTTTCCAAAGACCTCCTCTCCCCTCAGATGTGGTGATCTACCAGCGCTTTGTGTGGACAACCCCTGTGATTGCCATACCTCTGGACGCCCCCGGGGGCCTGAGCCCCTCAACTTCACCACCGGCACCATGTCGACCTCATCACTCCGGCGCCAGATGAAGAACATCGTCCACAACTACTCAGAGGCCGAGATCAAGGTCCGAGAGGCCACAAGCAATGACCCCTGGGGCCCGTCCAGCTCCCTCATGTCGGAGATCGCTGACCTCACCTACAACGTGGTGGCCTTCTCGGAGATCATGAGCATGATCTGGAAGCGGCTCAATGACCATGGCAAGAACTGGAGGCATGTCTACAAGGCCATGACGCTGATGGAGTACCTCATCAAGACGGGCTCGGAGCGCGTGTCGCAGCAGTGCAAGGAGAACATGTACGCAGTCCAGACGCTGAAGGACTTCCAGTACGTGGATCGTGACGGCAAGGACCAGGGCGTGAACGTGCGCGAGAAGGCCAAGCAGCTGGTGGCCCTGCTGCGGGACGAGGACCGGCTTCGGGAGGAGCGGGCCCACGCACTCAAGACCAAGGAGAAGCTAGCCCAGACGGCCACAGCCTCCTCGGCAGCCGTGGGCTCTGGGCCCCCACCTGAGGCCGAGCAGGCGTGGCCACAGAGCAGCGGGGAGGAAGAGCTGCAGCTGCAGCTGGCCCTGGCCATGAGCAAGGAGGAGGCCGATCAGGAGGAGCGGATCCGGCGCGGGGATGACCTGAGGCTGCAGATGGCCATCGAGGAGAGCAAGAGGGACACGGGGGGCAAGGAGGAGTCATCCCTCATGGACCTCGCTGACGTCTTCTCAGCCCCGGCTCCTGCATCTGCTTCGGACCCCTGGGGGGCACCAGCGCCCATGGCTGCTGCTGTCCCTGCAGCTGCCCCTGCCTCGGACCCCTGGGGGGGAGCTGCTGTCCCTCCAGCTGCTGACCCCTGGGGCGGTCCGGCTCCCACGCCGGCCTCTGGGGACCCCTGGAGGCCAGCTGCCTCCACAGGGCCCTCAGCGGACCCGTGGGGTGGGACCCCAGCCCCCACAGCAGGAGAGGGGCCCACACCCGACCCATGGGGAGGCTCTGAGGGCGGGGCCCCCGTCAGTGGACCCCCAGCCTCTGATCCCTGGGCACCAGCGCCAGCCTTCTCGGACCCCTGGGGAGGGTCCCCTGCCAAGCCAAGCACCAATGGCACTGCAGTGGCTGGGGGCTTCGACGCTGAGCCTGATGAGTTCTCAGACTTTGACCGACTCCGCACGGCGCTGCCAGCCTCGGGGAGCAGCACGGATGTAGAGGCAAGTTGCCAAAATGGTACCAAGAATGCCCTCCGGAGATCGGCCACCCGCTGTCCCTGCCGACCCTCCCTGGCTCTGGGCCCCTTTCCAGTGGGGGGAGCTGGAGCTGCTAGCAGGAGAGGTGCCCGCCTGCAGCCCAGGGGCCTTCGACATGAGTGGGGTCGGGGGCTCCCTGGCCGAGGCCGTGGGGAGCCCCCCACCCACAGCCGGCCTGGCCCCCACGCCCCCCACACGGAAGACCCCAGAGTCATTCCTGGGCCCCAACGCAGCCCTCGTGGACCTGGACTCGCTGGTGAGCCGGCCGGGCCCCGCACCACCAGGAGCCAAGGCCTCGAACCCCTTCCTGCCGAGTGGAGCCCCGGCTGCTGGCCCCTCCGTAACCAACCCCTTCCAGCCAGCACCCCCGGCGACACTCACCTTGAATCAGCTCCGCCTCAGCCCTGTGCCCCCCGCCCCCGGGGTGCCGCCCACCTACATCTCTCCCCTTGGTGGGGGCCCCGGCCTGCCACCCATGATGCCCCCCGGGCCCCCGGCCCCCAACACTAA

XM_004866603.1 Coding sequence

Znf667 zinc finger protein 667, transcript variant X1

Length: 1959 bp    Location: 1503360..1489748   Strand: -
>XM_004866603.1
ATGCCTGCTACACGAGGGAGATCTAGGCCCAAGCCTCAGAACCCCAAATGCTTATTGAACTTTTCCTGGTGGTCCCACATCGCCCGTGTTTGGAATGTGTCTGCCATTTCTCCAGCCCTGTGGAAACCCAAGCCTGTGGTGAGTAGACGGGTGACTTTTTCATTTCAGGCACCAGTGACATTTTCAGACTTGGCCATCTACTTCTCCCAGGAGGAGTGGGAATGGCTGAGCCCCACGCAGAAGGAGTTATACGAAGAGGTCATGTTAGAGAACTATCGGAACCTGGTGTCGGTTGGTCTTTGCCTTCGGAGGCCAAATGTCATCACCTTACTGGAGAAAGGGAAGGAGCCCTGGATCGTGGAGCCACCAAGGAGACGCTGGTGCCCCGATTTAGCATCTAAGTGTGAGATCGAGAAATTACCACCAAATCAGTGCAGCAAATCTAAGCAAAGCTTCTATCAAAGACCAGTTTCTATACAAATAAAGATTCCCACAGGCAAGAGGGTAGAGTTACTCCGAAGAAGGGCCAAGAAAGGGCTTTCAGCGAAGAAATCTTTGAAATGCAAGGACTGTGGGAAAATCTTCAGTCAGAGATCATCCCTCAAACTTCATCAGAATGCTCACACTGGAGAGAGGCCTTATGAATGCAGTCGTTGTAGAAAAGTTTTCAGACAGATCACATCCCTCATCCTTCACCAGAGAATTCACAATGAAAAGAAAAGCTATGGATGTGATCAGTGTGGGAAAGGCTTCAGTAAAAGCATAACCCTTATTCTACACAGGAGAATTCATAGTAGAAAGGAAACTTCTGACAATGGGATGGCCTCCAGTCCCAATACTTCTCTCAGTGCCCACCCCAGCAGTCATGTTGTCAAGAAGGCCCTCCAGTGCAGAAAATGTGGGAGAGCCTTTAGTCGTGTGGCAGCCCTTTTACTTCATAGGAGAATTCACAGTAGAAGGAAAATACATAAGTGCAATACTTGTGGGAAGGGCTTCAAAAAGAAATCAGTCCTTATTACACACAAAAGAATTCATACCAGAGAGAAAGCCCACAAAAAGGAGAAGGCCTTAGGTCAGAGTATACAGCGAAGAAATCGATTTTTAGAAAATCCTTTTAAATGCAGAAAGTGTGGTAAGTCCTTTCATAGGATTTCACCCCTTCTGCTTCATCAGAAAGTCCACACTTCAAGGAAACCCTACAAATGTGATAATTGCAATAAGGATTTTCAGCGGCTTTCAACCCTTATTCTCCATGAGAAAATTCATAAGAGAGAGATACTTTATCGATGTAATAAATGTCCGAAAGTCTTCAAGCGGAATTCAACCCTTATTCAACACCTGAAACTTCACAAAAGGAAGAAGAAACTCTTCGAGTGTAAAGAGTGTGGAAAGATGTTCTCTGGAACTGCAAACCTTAAAATACACCAGAACATACATTCTGAAGAGAAGCCTTTCAAATGCAGTAAGTGTAGTAAGGTGTTTGGCCGCCAGTCATTTCTTATTGAACATCAGCGAATTCATACTGGAGAAAAACCCTATCAGTGTGAGGAATGTGGGAAAGCCTTCAGTCACCGGATATCGCTTACTCGACACAAGAGAATACACACCGAAGACAGACCCTATGAATGTGATCAGTGTGGGAAAGCCTTCAGCCAGAGTGCCCATCTTGCCCAGCATGAGCGAATCCACACTGGAGAGAAGCCATACATATGCAAGATCTGTAAGAAGGCCTTCAGTCAGCGCACATCCCTTATTCTGCATGAAAGAAGTCACACTGGAGAGAAGCCTTATGAGTGTAATGAGTGCAGGAAAGCATTTAGCAGTGGCTCAGACCTTATTCGACACCAGAGAAGTCATTCTTCAGAGAAACCCTATGAATGTAGTAAATGTGGGAAGGCGTATAGCAGGAGCTCATCCCTGATTCGACATCAGAGCACACATCCTGAAGAAAAAGCCTAA

XM_004866605.1 Coding sequence

Znf667 zinc finger protein 667, transcript variant X3

Length: 1959 bp    Location: 1502535..1489748   Strand: -
>XM_004866605.1
ATGCCTGCTACACGAGGGAGATCTAGGCCCAAGCCTCAGAACCCCAAATGCTTATTGAACTTTTCCTGGTGGTCCCACATCGCCCGTGTTTGGAATGTGTCTGCCATTTCTCCAGCCCTGTGGAAACCCAAGCCTGTGGTGAGTAGACGGGTGACTTTTTCATTTCAGGCACCAGTGACATTTTCAGACTTGGCCATCTACTTCTCCCAGGAGGAGTGGGAATGGCTGAGCCCCACGCAGAAGGAGTTATACGAAGAGGTCATGTTAGAGAACTATCGGAACCTGGTGTCGGTTGGTCTTTGCCTTCGGAGGCCAAATGTCATCACCTTACTGGAGAAAGGGAAGGAGCCCTGGATCGTGGAGCCACCAAGGAGACGCTGGTGCCCCGATTTAGCATCTAAGTGTGAGATCGAGAAATTACCACCAAATCAGTGCAGCAAATCTAAGCAAAGCTTCTATCAAAGACCAGTTTCTATACAAATAAAGATTCCCACAGGCAAGAGGGTAGAGTTACTCCGAAGAAGGGCCAAGAAAGGGCTTTCAGCGAAGAAATCTTTGAAATGCAAGGACTGTGGGAAAATCTTCAGTCAGAGATCATCCCTCAAACTTCATCAGAATGCTCACACTGGAGAGAGGCCTTATGAATGCAGTCGTTGTAGAAAAGTTTTCAGACAGATCACATCCCTCATCCTTCACCAGAGAATTCACAATGAAAAGAAAAGCTATGGATGTGATCAGTGTGGGAAAGGCTTCAGTAAAAGCATAACCCTTATTCTACACAGGAGAATTCATAGTAGAAAGGAAACTTCTGACAATGGGATGGCCTCCAGTCCCAATACTTCTCTCAGTGCCCACCCCAGCAGTCATGTTGTCAAGAAGGCCCTCCAGTGCAGAAAATGTGGGAGAGCCTTTAGTCGTGTGGCAGCCCTTTTACTTCATAGGAGAATTCACAGTAGAAGGAAAATACATAAGTGCAATACTTGTGGGAAGGGCTTCAAAAAGAAATCAGTCCTTATTACACACAAAAGAATTCATACCAGAGAGAAAGCCCACAAAAAGGAGAAGGCCTTAGGTCAGAGTATACAGCGAAGAAATCGATTTTTAGAAAATCCTTTTAAATGCAGAAAGTGTGGTAAGTCCTTTCATAGGATTTCACCCCTTCTGCTTCATCAGAAAGTCCACACTTCAAGGAAACCCTACAAATGTGATAATTGCAATAAGGATTTTCAGCGGCTTTCAACCCTTATTCTCCATGAGAAAATTCATAAGAGAGAGATACTTTATCGATGTAATAAATGTCCGAAAGTCTTCAAGCGGAATTCAACCCTTATTCAACACCTGAAACTTCACAAAAGGAAGAAGAAACTCTTCGAGTGTAAAGAGTGTGGAAAGATGTTCTCTGGAACTGCAAACCTTAAAATACACCAGAACATACATTCTGAAGAGAAGCCTTTCAAATGCAGTAAGTGTAGTAAGGTGTTTGGCCGCCAGTCATTTCTTATTGAACATCAGCGAATTCATACTGGAGAAAAACCCTATCAGTGTGAGGAATGTGGGAAAGCCTTCAGTCACCGGATATCGCTTACTCGACACAAGAGAATACACACCGAAGACAGACCCTATGAATGTGATCAGTGTGGGAAAGCCTTCAGCCAGAGTGCCCATCTTGCCCAGCATGAGCGAATCCACACTGGAGAGAAGCCATACATATGCAAGATCTGTAAGAAGGCCTTCAGTCAGCGCACATCCCTTATTCTGCATGAAAGAAGTCACACTGGAGAGAAGCCTTATGAGTGTAATGAGTGCAGGAAAGCATTTAGCAGTGGCTCAGACCTTATTCGACACCAGAGAAGTCATTCTTCAGAGAAACCCTATGAATGTAGTAAATGTGGGAAGGCGTATAGCAGGAGCTCATCCCTGATTCGACATCAGAGCACACATCCTGAAGAAAAAGCCTAA

XM_004866602.1 Coding sequence

Znf444 zinc finger protein 444, transcript variant X2

Length: 984 bp    Location: 1578917..1569538   Strand: -
>XM_004866602.1
ATGGAGGCCCCTGCACCCCTGCCTGTGAAGCAGGAGGAGCCAGCCGCCGAGGGCCTGGCCCCAGCCCCGGAGACGCTGGACTCCCCCGCCCTGGACTCCCCCACCCCGGACTCGCCCTGGCACCGCTTCCGCCACTTCCAGCTGGGTGCGGCACCGGGGCCCCGCGAGGCCCTGGGGCTGCTGCGCGCCTTGTGCCGTGCCTGGCTGAGGCCTGAGGTGCGCACCAAGGAGCAGATGCTGGAGCTGCTGGTGCTGGAGCGCTTCCTGAGCGCGCTCCCGGCCGGTGCCCGAGCCTGGGTGTGCAGCCGGCGGCCCCGCAGCGGGGATGAGGCCGTGGCCCTGCTGGAGGAGCTCTGGGGACCTGTGGCCTCCCCAGATCGGTCATCAGTAGTGCGAGCACCTCAGGACGTGACAGAAGGCGCCGGGGCCGGTGTTGGAAAGGAAGATGGTGGGGTGATGCCCTTTGGAGCTGTGGGCCCTGAGCCGGAGGTGCCGGTGACGGGAGATGCCTGGGCCGCGTGGCCGCCCAAGCAGGAGCGCGACAGCCCCCCGCCTGCCGCCCCGGGCACCCTCGGGACCCCCTGCCCCGAGTGCGGTCAGACGCCCGCGCCCGCGCCACGGCCCCCGCGCGAGAAGCCGCACGCCTGCCCCGAGTGCGGCAAGGCCTTCCGGCGCAAGGAGCACCTGCGGCGCCACCGCGGCACGCACCCCGGGGCAGCGGGGCCAGCGCGGCGCCACCCGGCCACGCGCGAGAGGCCGCACGCCTGCTGCGACTGCGGCAAGGCCTTCTACTGGCGCGAGCACCTGGTGCGCCACCGCAAGACGCACTCGGGCGCGCGGCCCTTCGCCTGCAGGGAGTGTGGCAAAGGCTTTGGCCGCCGTGAGCACGTGCTGCGCCACCAGCGCATCCACGGCCGCGCCGCACGGGCGCAGGGCCCGGCGACCGAGGGCGGTGGCGCCTTCCCGCCCTGGCCGCTGGGGTAG

XM_004866595.1 Coding sequence

Zfp28 ZFP28 zinc finger protein, transcript variant X2

Length: 885 bp    Location: 1423135..1412490   Strand: -
>XM_004866595.1
ATGAGGGGAGCCGGGGCGGGCGTCCGTGGGGCCTTCCTGGGGCGAGGTGACCGCCGCCCCAAGCCCAGAGCTCCGGCCGCCGCTGCCCACCCTGCCCGCGGAAGGCCGCGCTCCAGCGGTGGCTCCGTCCCCAGAGGCCGGCGAGGAGCGGTGGCCTCGGGTCCCGTGCGCAGAGCGCTGCTTTCCTGGGACACTGCCCTCCAGGAGAGGAACCCCAGGCTGGAGGCCGCAGGGACAGGAGCTAAACTTAAAGTCATGTCCCAGGGCTTGGTGACATTTGGGGATGTGGCTGTAGATTTCTCCCAAGAGGAGTGGGAATGGCTGAACGCCACCCAGAGGAGTCTGTATAGGAAGGTGATGTTGGAGAACTACTGGAACCTGGCATCGCTCGGCCTCTGTGCTTCTAAGCCTGATATGATCTCCTCACTGGAGCAAGGACCAGATCCTTGGATGGCGAGGAGAAAGCGAACAGGAGGCCAGCACCCTGATTGGAAGGCTGTGTGTGAGACCAAGGAATTTCCTCCAAAGAACTCAGCTGAGGAAAAGCTGTGCCAGGCAGCTGGAACACAGAGGCCCACAAACTACAGCCTGGAGTACTCTTTGATGGGGGAGAGCTGGAATTATGATACTCTGTTCAAGACACAGCCGAACATGGTGACCAGCGCGAATGTGGCTGTAGGCTTTGCCCCGCAGCTGGAGCCAGCGCAGAAGAGTTTCTGTAAGACTGTGCTATGGGAGAACCATGGTGCCCTGGGGGCCCTAGGCCACTGTGTTTCAAAGCCAGATTTAGTGGCTTTCCTGGAGTCGGGGAAGGAGCACTGGGTGGTGCAGAGAGAGCTGGTGGCAGGGCTGTTCCCAGCTGGTCCTGTGAGAAGCACAGACTGA

XM_004866600.1 Coding sequence

Znf787 zinc finger protein 787, transcript variant X4

Length: 1149 bp    Location: 1591881..1602373   Strand: +
>XM_004866600.1
ATGGAGCTGCGGGAAGAGGCCTGGTCTCCGGGGCCGCTGGACTCCGAGGACCAGCAGATGGCCAGTCAGGAAAACCCAGTGGACATCCTCATCATGGATGACGACGACGTCCCCAGCTGGCCCCCCGCCAAGCTGGCCCCGCCCCCGACGGCGCCTCCCGCCGGCCCCCCACCCCGGCCGCGGCCGCCGGCGCCCTACATCTGCAACGAGTGCGGCAAGAGCTTCAGCCATTGGTCCAAGCTGACGCGCCACCAGCGCACGCACACGGGCGAGCGACCGAACGCGTGCGCCGACTGCGGCAAGACCTTCTCGCAGAGCTCGCACCTGGTGCAGCACCGCCGCATCCACACGGGCGAGAAGCCCTACGCCTGCTCCGAGTGCGGCAAGCGCTTCAGCTGGAGCTCCAACCTCATGCAGCACCAGCGCATCCACACGGGCGAGAAGCCCTACGCCTGTCCCGACTGCGGCCGCAGCTTCACGCAGAGCAAGAGCCTGGCCAAGCACCGGCGCTCGCACAGCGGCCTCAAGCCCTTCGTGTGCCCGCGCTGCGGCCGCGGCTTCAGCCAGCCCAAGAGCCTGGCGCGCCACTTGCGGCTGCACCCCGAGCTCGCGGGCCCTGGCGTGGCCGCGCGCGTGCTGGCGGCCTCTGTGCGCCGTGCCCAGGCGCCCGAGGCGGCGGCGGCTGCGGACGGCGAGATTGCCATCCCGGTGGGAGACGGCGAGGGCATCATTGTGGTGGGCGCCCCGGGCGAGGGCGCAGGCGCGACAGCTGTGGCTGTGGGCAGCGGGGGCGCGCGGGCAGCTGGGGCCCCGCGGTCGCGCCGCGCGCCGGCGCCCAAGCCCTACGTGTGCGCGGAGTGCGGGAAGGGCTTTGGGCACGCCGCGGGGCTGCTGGCGCACCAGCGGGCGCAGCACGGCGACGGCCCAGGCGCCGCGGGCGGTGAGGAGCCCGCACACATTTGCGTGGAGTGCGGTGAGGGCTTCGTGCAGGGCGCGGCGCTGCGCAGGCACAAGCGCGTGCACGCCGTGGGCGCCCCCACAGTCTGCGGCGGCTGCGGACAAAGCTTCTATGGTGCGGGCGGCGAGGACGAGGAGGCCGAGGATGGCGCGCCCCGCTGCCCCGAGTGCCGCGCCGGGGATGCTCGGTAG

XM_004866598.1 Coding sequence

Znf787 zinc finger protein 787, transcript variant X2

Length: 1149 bp    Location: 1593163..1602373   Strand: +
>XM_004866598.1
ATGGAGCTGCGGGAAGAGGCCTGGTCTCCGGGGCCGCTGGACTCCGAGGACCAGCAGATGGCCAGTCAGGAAAACCCAGTGGACATCCTCATCATGGATGACGACGACGTCCCCAGCTGGCCCCCCGCCAAGCTGGCCCCGCCCCCGACGGCGCCTCCCGCCGGCCCCCCACCCCGGCCGCGGCCGCCGGCGCCCTACATCTGCAACGAGTGCGGCAAGAGCTTCAGCCATTGGTCCAAGCTGACGCGCCACCAGCGCACGCACACGGGCGAGCGACCGAACGCGTGCGCCGACTGCGGCAAGACCTTCTCGCAGAGCTCGCACCTGGTGCAGCACCGCCGCATCCACACGGGCGAGAAGCCCTACGCCTGCTCCGAGTGCGGCAAGCGCTTCAGCTGGAGCTCCAACCTCATGCAGCACCAGCGCATCCACACGGGCGAGAAGCCCTACGCCTGTCCCGACTGCGGCCGCAGCTTCACGCAGAGCAAGAGCCTGGCCAAGCACCGGCGCTCGCACAGCGGCCTCAAGCCCTTCGTGTGCCCGCGCTGCGGCCGCGGCTTCAGCCAGCCCAAGAGCCTGGCGCGCCACTTGCGGCTGCACCCCGAGCTCGCGGGCCCTGGCGTGGCCGCGCGCGTGCTGGCGGCCTCTGTGCGCCGTGCCCAGGCGCCCGAGGCGGCGGCGGCTGCGGACGGCGAGATTGCCATCCCGGTGGGAGACGGCGAGGGCATCATTGTGGTGGGCGCCCCGGGCGAGGGCGCAGGCGCGACAGCTGTGGCTGTGGGCAGCGGGGGCGCGCGGGCAGCTGGGGCCCCGCGGTCGCGCCGCGCGCCGGCGCCCAAGCCCTACGTGTGCGCGGAGTGCGGGAAGGGCTTTGGGCACGCCGCGGGGCTGCTGGCGCACCAGCGGGCGCAGCACGGCGACGGCCCAGGCGCCGCGGGCGGTGAGGAGCCCGCACACATTTGCGTGGAGTGCGGTGAGGGCTTCGTGCAGGGCGCGGCGCTGCGCAGGCACAAGCGCGTGCACGCCGTGGGCGCCCCCACAGTCTGCGGCGGCTGCGGACAAAGCTTCTATGGTGCGGGCGGCGAGGACGAGGAGGCCGAGGATGGCGCGCCCCGCTGCCCCGAGTGCCGCGCCGGGGATGCTCGGTAG

XM_004866594.1 Coding sequence

Zfp28 ZFP28 zinc finger protein, transcript variant X1

Length: 999 bp    Location: 1423135..1413654   Strand: -
>XM_004866594.1
ATGAGGGGAGCCGGGGCGGGCGTCCGTGGGGCCTTCCTGGGGCGAGGTGACCGCCGCCCCAAGCCCAGAGCTCCGGCCGCCGCTGCCCACCCTGCCCGCGGAAGGCCGCGCTCCAGCGGTGGCTCCGTCCCCAGAGGCCGGCGAGGAGCGGTGGCCTCGGGTCCCGTGCGCAGAGCGCTGCTTTCCTGGGACACTGCCCTCCAGGAGAGGAACCCCAGGCTGGAGGCCGCAGGGACAGGAGCTAAACTTAAAGTCATGTCCCAGGGCTTGGTGACATTTGGGGATGTGGCTGTAGATTTCTCCCAAGAGGAGTGGGAATGGCTGAACGCCACCCAGAGGAGTCTGTATAGGAAGGTGATGTTGGAGAACTACTGGAACCTGGCATCGCTCGGCCTCTGTGCTTCTAAGCCTGATATGATCTCCTCACTGGAGCAAGGACCAGATCCTTGGATGGCGAGGAGAAAGCGAACAGGAGGCCAGCACCCTGATTGGAAGGCTGTGTGTGAGACCAAGGAATTTCCTCCAAAGAACTCAGCTGAGGAAAAGCTGTGCCAGGCAGCTGGAACACAGAGGCCCACAAACTACAGCCTGGAGTACTCTTTGATGGGGGAGAGCTGGAATTATGATACTCTGTTCAAGACACAGCCGAACATGGTGACCAGCGCGAATGTGGCTGTAGGCTTTGCCCCGCAGCTGGAGCCAGCGCAGAAGAGTTTCTGTAAGACTGTGCTATGGGAGAACCATGGTGCCCTGGGGGCCCTAGGCCACTGTGTTTCAAAGCCAGATTTAGTGGCTTTCCTGGAGTCGGGGAAGGAGCACTGGGTGGTGCAGAGAGAGCTGGTGGCAGGGCTGTTCCCAGGTGAGTGTGGAGAGTCATGTGGTGAAGTCACTGCAGGGGAGAGCTTAGCTATTGTCCACCAAACTGGTCCACAAATGGTCACGGCATCTGGGCCAAGTCCTCCAGGTCTGGAGAGAAAACCAGACTCTGGGATTTCATAG

XM_004866588.1 Coding sequence

Peg3 paternally expressed 3, transcript variant X5

Length: 4173 bp    Location: 1196230..1222068   Strand: +
>XM_004866588.1
ATGTGCCCGCGGGAAGACGACACCAGCAGTGACATGACCAGTGATGATGACGAGGACGACAACGACGTGAGCCCCAACGGAGAAGGAGCGCCGTCACCTCAGCCAGTCGGCTCCTTCAGCAGGCTGCCCCCGCAGGACCTGTCCCTTCCTGAAATGGCAGACACAAGCTTTGAGGTGGACAGCAGCGACGGCAGGGACACCATGGGCATGGACTGGGAGGCCCAACTGCAGAATGCCCAGTTCTACCAGCATGTCATGAGCCTGTATGAGGACAGGAAACCGCAGAACACGATCCAGGACAACATGGAGAGCTACAGGAAGCTGCTCTCCCTGGGGATGCAGCTTGCCGAAGACTACCGGCACTCCCACATGACACAGGGCCACTCATTGTGGGGCAACAGAGATGCCTACCCCAGCACCAGCCAAGGTCTCCACATTGTGCCGGAAGCCATAAAGTCAGCCCAGCAGCAGGGAGTCTGCAAAGACGAATCTTCCTGTGGAATGATCATGGAAAACCTCATCAAAGAAATGTCCCATGGCCCCAAGGCAGGAAGAGCGAGGGAGTCCAGTGAGGGGCTTCAGGAGTTCGGTGATGACTGGAAGGACGCTTCGTGTGGCAAGACAGACTCGGCGATCCAGGGGAGGGGTTTTGAAGGGAATTCATTCAGGGGAGGCTTCAGGTTCACCTCAAACCTTGTCTCCAGAAAGAAAGTCCTGGAAAGAAAGAGGTGCTGTCATTTTGACGCTGATGGGAAGGCCCCAGTTCGCGATCACAGAGGCTGTGCCAGGAAGAAGCCCTTGGAGTGTGGGGGTGAGACGAGGGAAGCCGTGAGCGTGAGCAACCTGAGCAGCCTCAGCTGCGCCCCCGCCTCGGAGTCACAGCCCGTCGATTTGGGGGTGATGCCGTATCTGTGCGAAGAGTGCGGGAGGTCGTTCGCTGTCGTCTCAGAATTTGTGGAGCACCAGATCCTGCACACTAGGGAGAATCTTTATGAGTATGGTGAGTCCTTCATGCACAGCGTGGCTGTCAGCGAGGTTCGGAGCAGTGGAGGGGAGTGCTTGGAGTGCAAGGAGTGCGGGGAGGCCTGCGCTACGAGCTCTGCCCTGGCCGAGCATTGCAAGACCCACGCCAGAGAGTACTTCAAGGAGTGCAAGGGTCAGGACAGTGAGGGGACCCAAGTGCTCAGCCCGACCTTCAGTGCGCTTCAGAAGATATACGGGCAAAACAAATTCTACGAGTGCAAGGTGTGTAAGGAAACCTTCCTTCACAGCTCGGCCCTGATGGAGCACCAGAAAACCCATGGGAGAGGAGACGTCACCGATGACAGAGATGGCGAATGCTGGCCCGAGCGTGAAGGCCAGCGCAGGGAATCACTTCTGCCCTGCTCGAGCCTGCATGGGTTTCAGAAGATGGATGGCAAAGAGAAAATCCACAAATGTGAGGTGTGTGGGGAGTCGTTCCTTCACAGCTCACCCCTGAAAGAGCATCAGAAAATACACTTGGGAGGAAATCCATTTGAAAATAAGAGTGAATTGTGTGAGGAAACCCCCGTTCCTGGGCAGTCCCTTAGAAGGCGGCAGAACACCTCCCCTCAGGACAGCCTCTTCGACTTTACCGAGGGCAGGGTTGCCTTGGTGCAGAGCCCGGACCTTGGTGAGGGTCAGAAAATTCATTCTCGAAAGAACTTCTTCAAAGGCAAGGGTTACGAGAAACCCGTCACTCACAGAGGGCCCTCCTCAGAGTCTCAGAAGAGCCATACCCTTAGCAGACCGCCTGAAGACGAAGACAAAGACGAGGAGGAGGCATTCACCATCAGCTCCAGTCCCCATGAAGATCGGAAGTTTCCCTTGGAAGAAAATGTCCTTCAGGGGAAACCGTACGAGAAGTCTGTTGTTTTCAGCACGGCCTCTGCTGATGCTCAGAAACGGCCCACAGTGGGGCTCAGAAGACCAAAGCTACCGGCAGAGTCTCCCCTTCAGAGCTCTGATGTTATTAACTGTCAGAAAGTCTATGCTCCAGGGGACGCCTGTGAAGGCAAAGGTTACAAGAGGCCCATCGTCCATGGCTGGGCTGCCCCCACACCTCTGAAATGTCCCAGAGGGAATGAACAGGTTGAATGTGGTGAGAAGGGAGAATCCTCCATGTATCTCTCAGACCTTCATAACAAGTGGCAGGGGATTCCCACCAGAGAGCACCCATGTGAGGGGGATAAGAATACCAGCTACAAGGGCTACACCATGCAGAGTGCACCCCACACTGAGCCTCAAAGAAGTCGTGCTGGAGGGGGAGCTGGTGAATTTAAGCCAGATGGCAAATTGACCATTCCCAGCTCAAATGTTCGTGAACACCAGAAGGCTCGGGCTAAAAGGAAATACATTGAGCCCCGGAGCAACGAGACCTCTGCACTTCATTCCCTGCTATCTGGGGAGCTGCCAACAGTTTGTGCTAGAGAGAAGCTCTGTGGACGTCAGGAGTGTGGAGAGTCCTTTGCTTGTAGCTCCGACCTCGCTGAACACCAGAAGATTCACAACGGAGAGAAGCCCTGTGGAAGCAGGAACTATGAGCGATCTGCCATTCACAACTTCTCCCCTGCTGACCCTCAGACAAGTTATACCCAAGAGCACTGTACTGAGGAGCAAGCATGCAACAAACCTAGGGAGTTGGGGCCGGGCTCTGCTGCCAGCAGCAACCTCGATGCACATCAGACAGCTGACGCCCAAGAGAAGCCCCACGGCGAGGAGCCCCATGGGCAGGAGACCAGGGGAGACCCTGCCGCTCAGGCCTCTGAGTTGGATGAGCCCGATGGCACCGTCTATGAACGTCAGGACTGTGGGCTGGACTTCGCAGCCCTCTCAGACCTCAGGGGCCACCAGGATGTCCAGAGCAGGAAGCGCCATGTTGACAGTTGTGAGTCCGGACATCCGGAAGTTCACACGCATTCCGTCAGCAAATGTGAGAAAGTGTGCAGCGGTGAGCAGCTCGACGAATGCCCCAAGCGTGGGGAGCCTTTTCTTCACAGCTCCTTCCTCTTCAAGCATCAGAGGATTCATGAACAAGACCAGTCGTGCACCATGGAGGCATGTGATGACAATTTCATCTCTCTCTCACCTGTGAAGCCACAGAGGAACCGTGCCATTGGGAGGAACCCCGGCTTGGCCATTCGATGCAGTCAGTGCACACAAGGCTTCCTCCGTAGCTCCACCCTGGACATGCACACAAGGCATCTCAGGGATGACAAGTCAGTGGAGCAGAGTGAGAGGCCTGAGATTTTCTGTCAGGGCCACGCCCTCACTGAACTTCCGGGGAGTGAAACCAGAGAGAAACTCATGGAGTGTCTGTTGTGTGAGGAGAGCGTCTTCACTCCGAGAGAGCTTGGGGATCACCACAGGAAGGTTCACAAAGATGAGCCCCACGAGTACCAGCCCTCTGACACGCGGGCCTCGCTTCTCACCAGGCCCCTCAGAAAACCCAAACCATTCTTTGAATGCAAGGACTGTGGGCAGCCCTTTATTCCTGACACAGACCTCACTGGACACCACGGATTTTATCCTGAGGAAGCTACCACTGCCCAGGAGGCTGAAGCTGATGTCCTCATTCCACAAGAAGCTCTGCAGATTCAGGGCTCAAATGCGGACGCTGCCGAGCCAGGCATGGAGGTGGCAGAGCCAGGGGTAGAAGCTGCTGAGGCCAGCGGAGAGGCCAAAGGGCCAGATGAAGAGGCCACTGAGCCCAGCGGGGAGGCCGAGGCCCAGCCCACTGGGGATGCTGACGAACCAGATGGGGCCGGGATTGAAGACCCAGAAGAAAGCAGCAGAGAGCCAGAGGGAGATGCTGATGAGCCCGACGGCGCGGGGATAGCGGACCCAGAAGAAGGAGGTGCTGATCCAGAGGTCTGGGTGGAGGGGTCGTACTACAGCTGCCCCGAGTGCGCGGAGATCTTCCTGTCCAGCACGGCCTTCGGTGAGCACCTGCAGATCCACGCCCGCGTGGTCATCCTGGAGCCTGCGAATGCCCTGGGCCACTGCTCCGGCTACATGGCGCGTGCCCGGCAGGCCGGCCAGAAGCCCTTCAGGTGTGGGGTCTGTGGCCAGCCCTTTGGCCACTTCCCGCCCCTCGCTAGGCACCAGAACACGCACAGGCGTGAGTGTCGGGGATGGAGGGCCTTCACCTAG

XM_004866583.1 Coding sequence

LOC101714149 olfactory receptor 5-like

Length: 939 bp    Location: 1303392..1304330   Strand: +
>XM_004866583.1
ATGGAGAGGCCCCTGGCGCCGGCCAACATGACCAGGGTGCAGCAGTTCGTCCTCCTGGGCCTGTCCACCAGGCTGCGCAGCAGGGAAGCCCTCTTTGCCTTTTTCCTGGCCCTCTACCTGCTCACCCTCCTGGAGAACACGCTCATCATCTACCTCATCTGCAGTCACAGTGAGCTCCGCAAGCCCATGTACTTCTTCCTGGGCAACCTCAGCGGCCTGGAGATGTGCTACGTGTCAGTGACCATGCCCACGCTGCTTGCGGGGCTGTGGACTGGGCCCTACCATATTTCCTTCATGGGCTGCATGACCCAGCTCTTCTTTTTCATAAACCTTGTTGGGACAGAATGCATCCTCCTGGCCTCCATGGCCTATGACCGCTACGTGGCCATCTGCCGCCCACTGCACTACCCACTGCTCATGCGTCCCCAGGTCTGCCTGGGCCTGGCCCTGTCCTCCTGGCTGGGTGGGCTGGTGGTCTCTGTGGCCAAGACCACGTGCATCGCCACCCTGTCCTACTGTGGTCCCAACGTCCTCAATCAGTTCTTCTGTGACGTCTCCCCTCTGCTCAACCTGTCCTGCACCCACGTCGCCCTCACAGAGCTGGTGGACTTCATCTCAGCCATCATCATTCTCTGGGGTTGCTTCCTCATGACCATGGCCTCCTACATGGCCATCACCATGGCTGTGCTCCGCATGCCCTCAGCTGCTGCCCGCCACAAAGCCTTCTCCACCTGTGCCTCCCACCTGGTGGTGGTGGGCATCTTCTACTCAGTCACTATCTTCATCTATGCCCGCCCCAGCCGCATAGAAGCCATGGACCTCAACAAGGTGCTGTCGGTCATCTACACGGTGGTCACACCCATGTGCAACCCGGTCATCTACTGCCTGAGGAACAGGGAGGTCCAGGCGGCTTTCAGAAGAACCCTGCAGTGGTCCTGA

XM_004866585.1 Coding sequence

Peg3 paternally expressed 3, transcript variant X2

Length: 4173 bp    Location: 1193656..1222068   Strand: +
>XM_004866585.1
ATGTGCCCGCGGGAAGACGACACCAGCAGTGACATGACCAGTGATGATGACGAGGACGACAACGACGTGAGCCCCAACGGAGAAGGAGCGCCGTCACCTCAGCCAGTCGGCTCCTTCAGCAGGCTGCCCCCGCAGGACCTGTCCCTTCCTGAAATGGCAGACACAAGCTTTGAGGTGGACAGCAGCGACGGCAGGGACACCATGGGCATGGACTGGGAGGCCCAACTGCAGAATGCCCAGTTCTACCAGCATGTCATGAGCCTGTATGAGGACAGGAAACCGCAGAACACGATCCAGGACAACATGGAGAGCTACAGGAAGCTGCTCTCCCTGGGGATGCAGCTTGCCGAAGACTACCGGCACTCCCACATGACACAGGGCCACTCATTGTGGGGCAACAGAGATGCCTACCCCAGCACCAGCCAAGGTCTCCACATTGTGCCGGAAGCCATAAAGTCAGCCCAGCAGCAGGGAGTCTGCAAAGACGAATCTTCCTGTGGAATGATCATGGAAAACCTCATCAAAGAAATGTCCCATGGCCCCAAGGCAGGAAGAGCGAGGGAGTCCAGTGAGGGGCTTCAGGAGTTCGGTGATGACTGGAAGGACGCTTCGTGTGGCAAGACAGACTCGGCGATCCAGGGGAGGGGTTTTGAAGGGAATTCATTCAGGGGAGGCTTCAGGTTCACCTCAAACCTTGTCTCCAGAAAGAAAGTCCTGGAAAGAAAGAGGTGCTGTCATTTTGACGCTGATGGGAAGGCCCCAGTTCGCGATCACAGAGGCTGTGCCAGGAAGAAGCCCTTGGAGTGTGGGGGTGAGACGAGGGAAGCCGTGAGCGTGAGCAACCTGAGCAGCCTCAGCTGCGCCCCCGCCTCGGAGTCACAGCCCGTCGATTTGGGGGTGATGCCGTATCTGTGCGAAGAGTGCGGGAGGTCGTTCGCTGTCGTCTCAGAATTTGTGGAGCACCAGATCCTGCACACTAGGGAGAATCTTTATGAGTATGGTGAGTCCTTCATGCACAGCGTGGCTGTCAGCGAGGTTCGGAGCAGTGGAGGGGAGTGCTTGGAGTGCAAGGAGTGCGGGGAGGCCTGCGCTACGAGCTCTGCCCTGGCCGAGCATTGCAAGACCCACGCCAGAGAGTACTTCAAGGAGTGCAAGGGTCAGGACAGTGAGGGGACCCAAGTGCTCAGCCCGACCTTCAGTGCGCTTCAGAAGATATACGGGCAAAACAAATTCTACGAGTGCAAGGTGTGTAAGGAAACCTTCCTTCACAGCTCGGCCCTGATGGAGCACCAGAAAACCCATGGGAGAGGAGACGTCACCGATGACAGAGATGGCGAATGCTGGCCCGAGCGTGAAGGCCAGCGCAGGGAATCACTTCTGCCCTGCTCGAGCCTGCATGGGTTTCAGAAGATGGATGGCAAAGAGAAAATCCACAAATGTGAGGTGTGTGGGGAGTCGTTCCTTCACAGCTCACCCCTGAAAGAGCATCAGAAAATACACTTGGGAGGAAATCCATTTGAAAATAAGAGTGAATTGTGTGAGGAAACCCCCGTTCCTGGGCAGTCCCTTAGAAGGCGGCAGAACACCTCCCCTCAGGACAGCCTCTTCGACTTTACCGAGGGCAGGGTTGCCTTGGTGCAGAGCCCGGACCTTGGTGAGGGTCAGAAAATTCATTCTCGAAAGAACTTCTTCAAAGGCAAGGGTTACGAGAAACCCGTCACTCACAGAGGGCCCTCCTCAGAGTCTCAGAAGAGCCATACCCTTAGCAGACCGCCTGAAGACGAAGACAAAGACGAGGAGGAGGCATTCACCATCAGCTCCAGTCCCCATGAAGATCGGAAGTTTCCCTTGGAAGAAAATGTCCTTCAGGGGAAACCGTACGAGAAGTCTGTTGTTTTCAGCACGGCCTCTGCTGATGCTCAGAAACGGCCCACAGTGGGGCTCAGAAGACCAAAGCTACCGGCAGAGTCTCCCCTTCAGAGCTCTGATGTTATTAACTGTCAGAAAGTCTATGCTCCAGGGGACGCCTGTGAAGGCAAAGGTTACAAGAGGCCCATCGTCCATGGCTGGGCTGCCCCCACACCTCTGAAATGTCCCAGAGGGAATGAACAGGTTGAATGTGGTGAGAAGGGAGAATCCTCCATGTATCTCTCAGACCTTCATAACAAGTGGCAGGGGATTCCCACCAGAGAGCACCCATGTGAGGGGGATAAGAATACCAGCTACAAGGGCTACACCATGCAGAGTGCACCCCACACTGAGCCTCAAAGAAGTCGTGCTGGAGGGGGAGCTGGTGAATTTAAGCCAGATGGCAAATTGACCATTCCCAGCTCAAATGTTCGTGAACACCAGAAGGCTCGGGCTAAAAGGAAATACATTGAGCCCCGGAGCAACGAGACCTCTGCACTTCATTCCCTGCTATCTGGGGAGCTGCCAACAGTTTGTGCTAGAGAGAAGCTCTGTGGACGTCAGGAGTGTGGAGAGTCCTTTGCTTGTAGCTCCGACCTCGCTGAACACCAGAAGATTCACAACGGAGAGAAGCCCTGTGGAAGCAGGAACTATGAGCGATCTGCCATTCACAACTTCTCCCCTGCTGACCCTCAGACAAGTTATACCCAAGAGCACTGTACTGAGGAGCAAGCATGCAACAAACCTAGGGAGTTGGGGCCGGGCTCTGCTGCCAGCAGCAACCTCGATGCACATCAGACAGCTGACGCCCAAGAGAAGCCCCACGGCGAGGAGCCCCATGGGCAGGAGACCAGGGGAGACCCTGCCGCTCAGGCCTCTGAGTTGGATGAGCCCGATGGCACCGTCTATGAACGTCAGGACTGTGGGCTGGACTTCGCAGCCCTCTCAGACCTCAGGGGCCACCAGGATGTCCAGAGCAGGAAGCGCCATGTTGACAGTTGTGAGTCCGGACATCCGGAAGTTCACACGCATTCCGTCAGCAAATGTGAGAAAGTGTGCAGCGGTGAGCAGCTCGACGAATGCCCCAAGCGTGGGGAGCCTTTTCTTCACAGCTCCTTCCTCTTCAAGCATCAGAGGATTCATGAACAAGACCAGTCGTGCACCATGGAGGCATGTGATGACAATTTCATCTCTCTCTCACCTGTGAAGCCACAGAGGAACCGTGCCATTGGGAGGAACCCCGGCTTGGCCATTCGATGCAGTCAGTGCACACAAGGCTTCCTCCGTAGCTCCACCCTGGACATGCACACAAGGCATCTCAGGGATGACAAGTCAGTGGAGCAGAGTGAGAGGCCTGAGATTTTCTGTCAGGGCCACGCCCTCACTGAACTTCCGGGGAGTGAAACCAGAGAGAAACTCATGGAGTGTCTGTTGTGTGAGGAGAGCGTCTTCACTCCGAGAGAGCTTGGGGATCACCACAGGAAGGTTCACAAAGATGAGCCCCACGAGTACCAGCCCTCTGACACGCGGGCCTCGCTTCTCACCAGGCCCCTCAGAAAACCCAAACCATTCTTTGAATGCAAGGACTGTGGGCAGCCCTTTATTCCTGACACAGACCTCACTGGACACCACGGATTTTATCCTGAGGAAGCTACCACTGCCCAGGAGGCTGAAGCTGATGTCCTCATTCCACAAGAAGCTCTGCAGATTCAGGGCTCAAATGCGGACGCTGCCGAGCCAGGCATGGAGGTGGCAGAGCCAGGGGTAGAAGCTGCTGAGGCCAGCGGAGAGGCCAAAGGGCCAGATGAAGAGGCCACTGAGCCCAGCGGGGAGGCCGAGGCCCAGCCCACTGGGGATGCTGACGAACCAGATGGGGCCGGGATTGAAGACCCAGAAGAAAGCAGCAGAGAGCCAGAGGGAGATGCTGATGAGCCCGACGGCGCGGGGATAGCGGACCCAGAAGAAGGAGGTGCTGATCCAGAGGTCTGGGTGGAGGGGTCGTACTACAGCTGCCCCGAGTGCGCGGAGATCTTCCTGTCCAGCACGGCCTTCGGTGAGCACCTGCAGATCCACGCCCGCGTGGTCATCCTGGAGCCTGCGAATGCCCTGGGCCACTGCTCCGGCTACATGGCGCGTGCCCGGCAGGCCGGCCAGAAGCCCTTCAGGTGTGGGGTCTGTGGCCAGCCCTTTGGCCACTTCCCGCCCCTCGCTAGGCACCAGAACACGCACAGGCGTGAGTGTCGGGGATGGAGGGCCTTCACCTAG

XM_004866582.1 Coding sequence

LOC101713797 small integral membrane protein 17-like

Length: 351 bp    Location: 1377609..1366231   Strand: -
>XM_004866582.1
ATGCAGAGCCTCAGGCCTGAGCAGATGCAGGGGCTGCTGGAGCCAGAGAGGGTGAAGATGCTGCTGCCTCGGGAGAGCCGGGCCTGGGAGAAGCCATCCCAAGTCACCAAGGACTGGGTGGCGGTGGAGCTGGGGGCCTGCAGCTGTGACGGTGAAGGGAGAGACCTGTCTTCTCCAGAGTCTGGGTTTTCCCAGGAGTGGAGCTTGGTGGAGGAAGATGAAGAGTCAGAGGATGCCCAGGGCTTGGTGGAGTGGTCAAAAGCTCCACAACAAACGACCATAGTGTTGATAGTGTGTGTGCTGTTCTTGTTCCTGGTTTTGACGGGGATGCCTATGATGTTTCACGTTTGA

XM_004866578.1 Coding sequence

LOC101712015 zinc finger protein 805-like, transcript variant X3

Length: 1620 bp    Location: 1012274..1007933   Strand: -
>XM_004866578.1
ATGAAACCCACTCTTGCTTACCAGTCCTGGCCTGAGGGAGCCTTGGTTCATGATCATCAGACAGAAGGAGCCTCTGGGGACTTCCTGTTGGGTCCGCACCAGGGTCAGGATGAGCCCTGTGAAGTGCAGAAAAGACTTAGACCAGGGATGGAGGCCCCAAGGGAGAAGCTTCCTGGGAATAGAAGCCCTGGACATGATGGCATGGGATCAGCTGATAGTGTGTGTTCAAGGTCTGTGCAGGAGCACATCTCTCCAGACCCAGCTACCTGTATCTGTGATTCTAATATGCCAGCTGCAGATCCCTCGATCCGTGAAGGAGAAAATTCCTACAAATGCAAGGAATGTGGGAAAGTGTTTAAGAATGAACGCTTACTTATTCAACATAAGTGGATTCACACAGGAGTGAAGCGCTACGAATGTACAGAGTGTGGAAAGACCTTCCGCAAGAGCACTCACCTCCTCCAGCACCATATTGTCCATACCAGGGAGAGGCCGTATATGTGCTTGGAGTGTGACAAAGCCTTTAGCCGGAAATCATATCTTACTCAGCACCAACGTACGCACAGTGGAGAGAAGCCTTATAAGTGCAGTGAATGTGGACAGGCCTTTGCCCATCGCTCTACATTTGTTTTGCATAACAGAATGCACACTGGAGAAAAACCTTTTGTGTGCAAAGAGTGTGGCAAAGCCTTTCGAGATAGACGAGCTTTCAATCGTCACAACATCTTCCACACGGGAGAGAAGCCCTATCAGTGCTCAGAGTGTGGCAAGGCCTTCAACCAACGGTCTTACCTCACGTGGCACCAACAGACTCACAAGGGAGTGAAACCTTTCCAATGCAATGAGTGTGGGAGAGGATTCTGTGAGATTGCAGGCCTCATTCACCATTATGTCATCCACACTGGGGAGAAGCCCTATAAGTGTGTGGAGTGCGGGAAGGCCTTCCTCCGTGAGCCACACCTCAAGCAGCACCAGCGCATCCACACTGGGGAGAAGCCGTATGTGTGCAGTGAGTGTGGAAAGGCATTCGCCCACTATTCTACTTTGACCTTGCACAGAAGGGCTCACACTGGAGAAAAACCCTTCGAGTGCAAAGAGTGTGGGAAAGCCTTTACCAATCGGAAAGACCTCATCCGCCATGTCAGCATCCACACGGGAGAGAAGCCTTATGAGTGCATGGAATGTGGGAAGGCCTTCAACCGCAGGTCACACCTGATAAGGCACCATCGGATTCACAATGAGGAGAAGCCCTACAAATGCATGGAGTGTGGGAAAACCTTTTCACGGAGTACAAACCTCATTCAGCACTCCAACATTCACACTGGAGATAAGCCCTATAAATGCAATGAATGTGGAAAGGCCTTCAGCCTCAGCTCCTCCCTCCGGTACCATCAAAGGATGCACACAGGGAAAATCGCAGCTAGCGTCAGAGATGAGGGAAAGCCTTTCACAAGTGTGCAAGCCTCTGTCAACATTGAAGGACTCATATTGGGGAAAAATTTTCTTCACATAACCACTGACGAACATCAGTGTTCAAGGGAATCATCTAACACAGACTCTGGTCATTCATACCACAGAGAAACTGGGTTAGTGGCATCTCTATTAAAAAAATGTAAATAA

XM_004866580.1 Coding sequence

LOC101713087 zinc finger protein 805-like

Length: 1971 bp    Location: 1040684..1034709   Strand: -
>XM_004866580.1
ATGGAGGCACCTGAGGCTGGGAACGGGTCCGTCCACCAAAATCACCCACCCAGGCTGGGGAGGCGCTGGAGGTCGCCTGCCCCTCGGTCCTCGGCGTCCGCGATGGCGGCGGCGCAGGTTGCTGTGACCTTTGAAGATGTGGCTGTGAGATTTACTCAGGAGGAGTGGGAGCAGCTGGACCTTTCCAAGAGGACCTTATACTGGGAGGTGATGCTGGAGACCTGTGGACTTTTGACTGCTGTGGGCTGTCCCTTGTCCAAGTCAGAGCTTATCTACCAGTTGGAGCACAGCCAGGATCTATGGACGGCAACAGGAGTCCTCTTCCAAAGCTTTTATTCAGGTAATAGCAGAAAACCTAACAGCATGAAGCCCACTCCTGCTTACCAGGCCTGGCCTGAGGGAGCCTCCCTTCATGATTGTCAGTCAGAAGGAACCTCTGGGGACTTCCTGTTGGGGCTGCACCGGGGTCAGGATGAGCCGTGTGAGTTGCAAGAAGGATTCCTGAGACCAGGGACTGAGGTTCCAGGGGAGAAGCTTCCTGGGAATAGAAGGCCTGGACATGATGGCATGGGGTCAGCTGATAGTGTGTGTTCAAGGTCTGTGCAGGAGCACATCTCTCTATACCCAGCTTCATATATCTGTGACTCCCGTGGATCAGCTTCAGATCACTTGGTACATGAAGGAAAAAATCCCTTCAAATGCCAGGAATGTGGGAAACTGTTTAAGAAGGAACGGTTTCTCCTTCGCCATCAGTGGGTTCACATGATAGTGCGGCACTATGAGTGCACAGAGTGTGGGAAGTCCTTCCGCAAGAGCACTCAACTCCTCCAGCACCAGATGGTCCACACCGGAGAGAAGCCCTATAAGTGCCTGGAGTGTGGGAAGGCCTTCAGCCGTGGGACTCACCTTAGTCGGCACCAGCGAACACACAGTGGAGAGAAGCCTTATAAGTGCAGTGAGTGTGGACAGACCTTTGCCTACCGCTCCACAATGATTTTGCATAACAGGATCCACACTGGAGAAAAGCCCTTTGTGTGCAATGAGTGTGGCAAAGCCTTTCGAGATAAGGCAGGTTTCACTCGACACTACTTCATCCACACGGGAGAGAAGCCCTATCAGTGTTCGGAGTGCGGCAAGGCTTTCAACCAGCGGTCGTACCTCACGTGGCACCAACAGATTCACACTGGAGTGAAACCTTTCCAGTGCAATGAATGTGGGAGAGGATTTGGTGAGCGTTCAGCCCTCATTCACCACTATGTCACCCACACCGGGGAGAAGCCGTATATGTGTCTGGAGTGTGGGAAAGCCTTCCACCGAGGGTCATACCTCAAGCAGCACCAGCGCATCCACACCGGGGAAAAGCCATATGTATGTGGTGAGTGTGGAAAGGCTTTTGTCCACCGCTCTACATTCATCTTGCACAAAAAAGCCCACACTGGAGAAACACCTTATGAGTGCAAAGAATGTGGGAAAGCCTTTAGCGATAGGGCAGACCTCATTCGCCATTTCAGCATCCACACAGGAGAGAAACCGTCCGAGTGCATGGAATGTGGGAAGCTTTTCAACCACAGGTCAGGCCTCACCAGGCACCAGCGGATTCACAGTGGGGAGAAGCCCTACAAATGCATGGAGTGTGGGAAAACCTTTTTGCGGAGTGCACACCTCATCCGCCACTCCTTCATCCACACAGGAGAGAAGCCCTATAGGTGCAGTGAATGTGGAAAGGCCTTTACCTGCAACTCTTCTCTCACACAGCATCAAAAGAGGCACATGAAGAAGAACCCTGCCAGTGTCATAGAGGAGGAGAGACCTATCACAAGTGTGCAACCCTCTGCCAAAATTGAAGGACTCGTATTAGGGAAAGAGTTTCTTCATGTAACCACTGAGGAACATCACTGGTCAGGCGAATCGCCTAACACAACCTCGGGTTATTCATACCAGAGAGAAACTCAGTTAGCGCCATCTCTATGA

XM_004866573.1 Coding sequence

Znf772 zinc finger protein 772, transcript variant X4

Length: 1347 bp    Location: 917125..922491   Strand: +
>XM_004866573.1
ATGGCGATGGCCGCAGTAATGGACACCGCGCAGGTTCCGGTGAACTCAGAAGTAGTTATGGTACCTAAACAGGGGCAGGTGAACTTTGAGGACGTGTTCGTGTTCTTCTCCCAGGAGGAGTGGGAACTCCTTGATGAGGCTCAGAGGTTCCTGTACCAGGATGTGATGCTGGAGAACTTTGCTCTTATGGCCTCACTGGGTTATTGGCATGGAGTGGAGGATGAGGAGATACCTTGTGAGCAGAGCACTTCTATAGGAGTGTCACAGATCAGAAGTCCTAGGGGAAGCCCTTCTACCCAGAAGGCTCACTCCTGCAAGATGTATAGCCTGGTACTGAAAGACATTTTACACTTGGCTGAACACGAGGAACCACACACTGGGCAGATACCATACACAGGTGTAGTATGTGGGAAACAGTTCCAGTTCAGTGCAAACCTTCACCAGCACCAGAAACAACATGGTGAAGAGAAATCCTTTAGGAAGGAGGAAGGAAAGACTTTTCTTCAGAACAGCTGTCCTGTACAGCCCTCACCAATGCCTTTTACAACAGGAGAGAGCTGTAAGGACTCAGCAAGCAGCTTGAGCATTTTCCAGCACCAGGTCCCTCACAATGAGTGGAACCCACATGACAGCAGCATAAGGGAAGATGCCTCTCACAGTGGCCGAAGGCAGTACAAGTGCAGTGAATGTGGGAAAGCATTCAGCCGCAAAGACTCACTTGTTCAGCACCAGAGAGTCCACACTGGAGAAAGGCCTTATGAGTGTGGTGAATGTGGGAAAACCTTCAGCCGCAAACCTATACTTGCTCAGCACCAGAGGATCCACACTGGTGAAATGCCTTATGAGTGTGGCATTTGTGGAAAGGTTTTTAATCATAGTTCTAACCTTATTGTACATCAGAGAGTCCACACTGGAGCAAGGCCGTATAAATGCAGTGAGTGTGGGAAAGCCTACAGCCACAAATCCACACTTGTTCAACATGAGAGTGTACACACTGGAGAAAAGCCTTATGAGTGCAGTGAATGTGGGAAATATTTTGGTCACAAATACAGACTCATTAAACATTGGAGTGTTCACACTGGAGCAAGACCTTATGAGTGCATTGCATGTGGGAAGTTCTTCAGCCAAAGCTCTGATCTTATTGCACACCAAAGGGTTCACAATGGTGAGAAGCCATATGTGTGCAGCGAATGTGGAAAAGCCTTTAGCCACAAGCATGTACTTGTTCAGCACCACAGGATTCACACTGGAGAAAGACCATATAAGTGCAGTGAATGTGGGAAAGCCTTCAGACAAAGGGCTTCTCTCATCCGGCACTGGAAAGTTCACACTGCAGAAAGACCTTAG

XM_004866570.1 Coding sequence

Znf772 zinc finger protein 772, transcript variant X1

Length: 1380 bp    Location: 917173..922491   Strand: +
>XM_004866570.1
ATGGTACCTAAACAGGGGCAGGTGAACTTTGAGGACGTGTTCGTGTTCTTCTCCCAGGAGGAGTGGGAACTCCTTGATGAGGCTCAGAGGTTCCTGTACCAGGATGTGATGCTGGAGAACTTTGCTCTTATGGCCTCACTGGTTGCTTCCCTGGATTTGGGCAGTAGGCCCTGGATACTTGCCTGGGTGCATATGACTCCAGTCATTGCTGGAGAGACTCTAGCTGGGTGTGGTTATTGGCATGGAGTGGAGGATGAGGAGATACCTTGTGAGCAGAGCACTTCTATAGGAGTGTCACAGATCAGAAGTCCTAGGGGAAGCCCTTCTACCCAGAAGGCTCACTCCTGCAAGATGTATAGCCTGGTACTGAAAGACATTTTACACTTGGCTGAACACGAGGAACCACACACTGGGCAGATACCATACACAGGTGTAGTATGTGGGAAACAGTTCCAGTTCAGTGCAAACCTTCACCAGCACCAGAAACAACATGGTGAAGAGAAATCCTTTAGGAAGGAGGAAGGAAAGACTTTTCTTCAGAACAGCTGTCCTGTACAGCCCTCACCAATGCCTTTTACAACAGGAGAGAGCTGTAAGGACTCAGCAAGCAGCTTGAGCATTTTCCAGCACCAGGTCCCTCACAATGAGTGGAACCCACATGACAGCAGCATAAGGGAAGATGCCTCTCACAGTGGCCGAAGGCAGTACAAGTGCAGTGAATGTGGGAAAGCATTCAGCCGCAAAGACTCACTTGTTCAGCACCAGAGAGTCCACACTGGAGAAAGGCCTTATGAGTGTGGTGAATGTGGGAAAACCTTCAGCCGCAAACCTATACTTGCTCAGCACCAGAGGATCCACACTGGTGAAATGCCTTATGAGTGTGGCATTTGTGGAAAGGTTTTTAATCATAGTTCTAACCTTATTGTACATCAGAGAGTCCACACTGGAGCAAGGCCGTATAAATGCAGTGAGTGTGGGAAAGCCTACAGCCACAAATCCACACTTGTTCAACATGAGAGTGTACACACTGGAGAAAAGCCTTATGAGTGCAGTGAATGTGGGAAATATTTTGGTCACAAATACAGACTCATTAAACATTGGAGTGTTCACACTGGAGCAAGACCTTATGAGTGCATTGCATGTGGGAAGTTCTTCAGCCAAAGCTCTGATCTTATTGCACACCAAAGGGTTCACAATGGTGAGAAGCCATATGTGTGCAGCGAATGTGGAAAAGCCTTTAGCCACAAGCATGTACTTGTTCAGCACCACAGGATTCACACTGGAGAAAGACCATATAAGTGCAGTGAATGTGGGAAAGCCTTCAGACAAAGGGCTTCTCTCATCCGGCACTGGAAAGTTCACACTGCAGAAAGACCTTAG

XM_004866572.1 Coding sequence

Znf772 zinc finger protein 772, transcript variant X3

Length: 1362 bp    Location: 917791..922491   Strand: +
>XM_004866572.1
ATGGAGAAGCTCCCATTTCTGCCAAACATTGGAATAAGGTTGAAAAGTTGTTCTAGGTACATGAGGCAACATGAGCAAATACTTGAGGGGCAGGTGAACTTTGAGGACGTGTTCGTGTTCTTCTCCCAGGAGGAGTGGGAACTCCTTGATGAGGCTCAGAGGTTCCTGTACCAGGATGTGATGCTGGAGAACTTTGCTCTTATGGCCTCACTGGGTTATTGGCATGGAGTGGAGGATGAGGAGATACCTTGTGAGCAGAGCACTTCTATAGGAGTGTCACAGATCAGAAGTCCTAGGGGAAGCCCTTCTACCCAGAAGGCTCACTCCTGCAAGATGTATAGCCTGGTACTGAAAGACATTTTACACTTGGCTGAACACGAGGAACCACACACTGGGCAGATACCATACACAGGTGTAGTATGTGGGAAACAGTTCCAGTTCAGTGCAAACCTTCACCAGCACCAGAAACAACATGGTGAAGAGAAATCCTTTAGGAAGGAGGAAGGAAAGACTTTTCTTCAGAACAGCTGTCCTGTACAGCCCTCACCAATGCCTTTTACAACAGGAGAGAGCTGTAAGGACTCAGCAAGCAGCTTGAGCATTTTCCAGCACCAGGTCCCTCACAATGAGTGGAACCCACATGACAGCAGCATAAGGGAAGATGCCTCTCACAGTGGCCGAAGGCAGTACAAGTGCAGTGAATGTGGGAAAGCATTCAGCCGCAAAGACTCACTTGTTCAGCACCAGAGAGTCCACACTGGAGAAAGGCCTTATGAGTGTGGTGAATGTGGGAAAACCTTCAGCCGCAAACCTATACTTGCTCAGCACCAGAGGATCCACACTGGTGAAATGCCTTATGAGTGTGGCATTTGTGGAAAGGTTTTTAATCATAGTTCTAACCTTATTGTACATCAGAGAGTCCACACTGGAGCAAGGCCGTATAAATGCAGTGAGTGTGGGAAAGCCTACAGCCACAAATCCACACTTGTTCAACATGAGAGTGTACACACTGGAGAAAAGCCTTATGAGTGCAGTGAATGTGGGAAATATTTTGGTCACAAATACAGACTCATTAAACATTGGAGTGTTCACACTGGAGCAAGACCTTATGAGTGCATTGCATGTGGGAAGTTCTTCAGCCAAAGCTCTGATCTTATTGCACACCAAAGGGTTCACAATGGTGAGAAGCCATATGTGTGCAGCGAATGTGGAAAAGCCTTTAGCCACAAGCATGTACTTGTTCAGCACCACAGGATTCACACTGGAGAAAGACCATATAAGTGCAGTGAATGTGGGAAAGCCTTCAGACAAAGGGCTTCTCTCATCCGGCACTGGAAAGTTCACACTGCAGAAAGACCTTAG

XM_004866574.1 Coding sequence

Znf772 zinc finger protein 772, transcript variant X5

Length: 339 bp    Location: 917791..920792   Strand: +
>XM_004866574.1
ATGGAGAAGCTCCCATTTCTGCCAAACATTGGAATAAGGTTGAAAAGTTGTTCTAGGTACATGAGGCAACATGAGCAAATACTTGAGGGGCAGGTGAACTTTGAGGACGTGTTCGTGTTCTTCTCCCAGGAGGAGTGGGAACTCCTTGATGAGGCTCAGAGGTTCCTGTACCAGGATGTGATGCTGGAGAACTTTGCTCTTATGGCCTCACTGGTTGCTTCCCTGGATTTGGGCAGTAGGCCCTGGATACTTGCCTGGGTGCATATGACTCCAGTCATTGCTGGAGAGACTCTAGCTGGGTGTGGTAAGTGCAGGTTATTGGCATGGAGTGGAGGATGA

XM_004866569.1 Coding sequence

Znf304 zinc finger protein 304, transcript variant X2

Length: 1647 bp    Location: 974229..968780   Strand: -
>XM_004866569.1
ATGTCACAGATCAGGACTGAGTCAGGTCTTTTCTTCCAAAAAGCCCACCCCTGTGTGATGCATGATACACTCTTGAAAGCCATTTTGCACCTGGATGAATACCAGGGCTCATATGCTATGCAGAAACTGCACACGTGTGAGCGATGTGAGAGAGGATTTTCATTCATTGCAAAATTTTACCATCACCAGAGGTGGCATTGTGGAGACATTCCCTCTTGGGGGAATGATGGACTGGCCTCATCCGTGAAGAGCTGCACAGCCCGTGTGTTAGGGATACCTGTTGTGTCCAGGGAGGCCGGGATTGACTTGCTGAACAGCACTGGCCTCTTCCAGCCCTGGACCCCACACAGTGAAGTGATTGCATGGAGAAGGAATGAGTGGATGGAGTCTGTCCCAGCCAGCTCCAGTGTTGGCCAACCCCAGGAAGACCATCATGGACAGATGATTTTCAGTTGCAGGAATGATGGAAAAGTCTTCCTAAATACTGTTCCTCTTCATGACAGCCAGACAACTCAGACTGAGTCGAGTCCCTTTAGATGCCTACCATGTGGAAATGTGTTTGAGCAGAAGTTAAGTCTTTTCAATCACAGAGAAATCCACAGTGGAAAAAGAGCTCATGTGTGTAAGTGTGGAAAGACCTTCATTCACCCGTCTCACCTAAAAATGCACCAGGATTGCCACACTGGAAAAAGACATCACATGTGCAGTGAATGTGGAAAAACCTTCAGCCGTAAAGACACACTTGTTCAGCACCAGAGAGTTCACACTGGAGAGAGGCCTTTTAAGTGCAGCGAGTGTGGCAAAGCCTTCAGCCGTAAAGACACACTTGTTCAACACCAGAGATTTCACACTGGAGAGAGGCCTTACGAATGTAGCGAATGTGGGAAATTCTTTAGCCAAAGCTCTCACCTTATTGAGCACTGGAGAATTCATACTGGGGCAAGGCCTTATGAGTGCACTAAATGTGGGAAATTCTTTAGCCATAAATCCAGCCTCGTTAAACATCAGCGAGTCCACACAGGAGCAAGGTCTTACGTGTGCACCAAGTGTGGGCATGCTTTCAGCTGTAAAGACACACTTGTTCAGCACCAGATAATTCACACTGGAGTGAGGCCTTATGAATGCAGCCAGTGTGGGAAGGCCTTCAGCCGTAAGGACACCCTCGTGAAACACCAGAAAATCCACACTGGAGAAAGGCCTTATGAGTGCAGTGAATGTGGGAAGTTATTCAGACATAGCTCCAACCTTATTGTACACCAGAGAATTCACACTGGGGCAAAGCCTTACGAGTGCAGTGAATGTGGAAAGTGCTTTAGCCACAATTCTAGCCTCATTCTGCACCAGAGAGTTCACACTGGAGCAAGGCCTTATGTGTGCAGTGAGTGTGGGAAATCCTACATTAGTAGCTCTCACCTTGTTCAACACAAGAAAGTTCACACCGGAGCAAGGCCTTATGAGTGTGCTGAATGTGGGAAATTCTTTAGCCGCAACTTTAGCCTCCTTCTCCACCAGCGAGTTCACACTGGAGAAAGGCCTTATGTCTGTGATGCATGTGGGAAGGCCTACAGCAGGAGCTCCCATCTTGTGCGGCACCACAGAGTTCACCGTGGAGAGAGGCCTCACACATGCAGCTTTAGTGATCCTTAA

XM_004866565.1 Coding sequence

Zik1 zinc finger protein interacting with K protein 1, transcript variant X2

Length: 1407 bp    Location: 763862..756631   Strand: -
>XM_004866565.1
ATGGACCTCGAACAGGGTTGTGTGACTTTTGACGATGTGGCCATTTACTTCACATGGGAAGAATGGAGACTTCTTGATGAGGCTCAGAGGCTCCTGTATTTCAATGTAATGCTGCAGAACTTTGCACTTACAAGCTCACTAGGTTGTGGGCATGGAACACAGGATGAAGAGGCACCTTCTGAGCAGATAGGTTCTGTAGGAGTGTCACAGGCTCAGACTTGTAAGACAGGTCCATCCATAAAGAAGACTTACCTTTGTGAACAGTGTGTCCCAGGTCTGCAAGACATTTTGCACCTGGCTGATCCATTGGCACAGGAACCCAAGCATGGGACATGTATAACACTTCACAACAAAAAACATCACAGTACTTTAAAGAAACCCTTAAATAGGGTCATTGACAGTGTCTCATATTTGAAATGCTACCTATTGCACATGTCAGGAAAGCCCTTTCCCAGTTGGGATGTTGAGAAGGACCTTCCAGCCATGTTGAGCCTTCTCAAGTCCCTGGCCTTTCCTAGCAGTAAGAAGCCTAACTCAGTCATCAAAGGTGGAAAGGACATTCATAATCATAAAAGTCTTAAGTCAAGAGAATATGAGAAATCTAACCACAATCACACTGTTGTTCACCACTCAAGATCCTCCACTGGAAAAAAGCTTTATGAGTGCAGCAAATGTGGGAAAGCCTTCCGTGGAAAGTACTCACTTGATCAACACCAAAGAATCCATACGGGAGAAAAGCCTTGGGAGTGCAGTGAATGTGGGAAATTCTTTAGCCAAACCTCCCACCTGAATGATCATCGGAGAATCCACACTGGAGAAAGACCGTATGAATGCAATGAATGTGGAAAATTATTTAGACAAAATTCTAGCCTCATTGACCACCAGAAAATTCATACTGGAGCAAGGCCTTATGAGTGTGACCAGTGTGGGAAATCCTTTAGCCAAAAAGCTACCCTCATTAAACACCAAAGAGTTCACACTGGAGAAAGACCTTACAAGTGTACTGAATGTGGCAATTCTTTTAGTCAAAGTGCCATTCTTAACCAACATCAAAGAATCCATACTGGAGCAAAGCCTTATGAGTGTGGCCAGTGTGGGAAATCCTTTAGCCAAAAAGCTACTCTTATTAAACACCAGAGAGTTCACACTGGAGAAAGGCCCTATAAGTGTGGTGAATGTGGAAAATCCTTTAGTCAAAGCTCCATTCTTATTCAGCATCGGAGAATTCATACTGGAGCAAGGCCCTATGAATGTAGGCAATGTGGAAAATCTTTTAGTCAAAAGTCTGGCCTCATTCAACACCAGGTAGTCCACACTGGAGAAAGACCTTATGAGTGTGACACATGTGGGAATTCCTTTAGCCAGTGCTCTAGCCTCATTCACCACCAAAAATGTCACAACATGTAG

XM_004866564.1 Coding sequence

Zik1 zinc finger protein interacting with K protein 1, transcript variant X1

Length: 1452 bp    Location: 761059..756631   Strand: -
>XM_004866564.1
ATGAATCTGGGATCCTCACAGAGAAATGGATTTTGGAGTGACCTTTCCCCATCATGGCAGGGTTGTGTGACTTTTGACGATGTGGCCATTTACTTCACATGGGAAGAATGGAGACTTCTTGATGAGGCTCAGAGGCTCCTGTATTTCAATGTAATGCTGCAGAACTTTGCACTTACAAGCTCACTAGGTTGTGGGCATGGAACACAGGATGAAGAGGCACCTTCTGAGCAGATAGGTTCTGTAGGAGTGTCACAGGCTCAGACTTGTAAGACAGGTCCATCCATAAAGAAGACTTACCTTTGTGAACAGTGTGTCCCAGGTCTGCAAGACATTTTGCACCTGGCTGATCCATTGGCACAGGAACCCAAGCATGGGACATGTATAACACTTCACAACAAAAAACATCACAGTACTTTAAAGAAACCCTTAAATAGGGTCATTGACAGTGTCTCATATTTGAAATGCTACCTATTGCACATGTCAGGAAAGCCCTTTCCCAGTTGGGATGTTGAGAAGGACCTTCCAGCCATGTTGAGCCTTCTCAAGTCCCTGGCCTTTCCTAGCAGTAAGAAGCCTAACTCAGTCATCAAAGGTGGAAAGGACATTCATAATCATAAAAGTCTTAAGTCAAGAGAATATGAGAAATCTAACCACAATCACACTGTTGTTCACCACTCAAGATCCTCCACTGGAAAAAAGCTTTATGAGTGCAGCAAATGTGGGAAAGCCTTCCGTGGAAAGTACTCACTTGATCAACACCAAAGAATCCATACGGGAGAAAAGCCTTGGGAGTGCAGTGAATGTGGGAAATTCTTTAGCCAAACCTCCCACCTGAATGATCATCGGAGAATCCACACTGGAGAAAGACCGTATGAATGCAATGAATGTGGAAAATTATTTAGACAAAATTCTAGCCTCATTGACCACCAGAAAATTCATACTGGAGCAAGGCCTTATGAGTGTGACCAGTGTGGGAAATCCTTTAGCCAAAAAGCTACCCTCATTAAACACCAAAGAGTTCACACTGGAGAAAGACCTTACAAGTGTACTGAATGTGGCAATTCTTTTAGTCAAAGTGCCATTCTTAACCAACATCAAAGAATCCATACTGGAGCAAAGCCTTATGAGTGTGGCCAGTGTGGGAAATCCTTTAGCCAAAAAGCTACTCTTATTAAACACCAGAGAGTTCACACTGGAGAAAGGCCCTATAAGTGTGGTGAATGTGGAAAATCCTTTAGTCAAAGCTCCATTCTTATTCAGCATCGGAGAATTCATACTGGAGCAAGGCCCTATGAATGTAGGCAATGTGGAAAATCTTTTAGTCAAAAGTCTGGCCTCATTCAACACCAGGTAGTCCACACTGGAGAAAGACCTTATGAGTGTGACACATGTGGGAATTCCTTTAGCCAGTGCTCTAGCCTCATTCACCACCAAAAATGTCACAACATGTAG

XM_004866555.1 Coding sequence

Rps5 ribosomal protein S5, transcript variant X2

Length: 888 bp    Location: 184388..177990   Strand: -
>XM_004866555.1
ATGACCGAGTGGGAGACAGCTGCACCGGCGGTGGCCGAGACCCCTGACATTAAGCTCTTTGGCAAGTGGAGCACTGACGATGTACAAATAAATGACATTTCCTTGCAGGATTACATTGCAGTGAAAGAGAAGTATGCCAAGTACCTGCCCCACAGCGCGGGGCGCTATGCTGCCAAGCGCTTCCGCAAAGCTCAGTGCCCCATTGTGGAGCGGCTCACCAACTCCATGATGATGCACGGCCGCAACAACGGCAAGAAGCTCATGACCGTGCGCATCGTCAAGCATGCCTTCGAGATCATCCACCTGCTCACGGGCGAGGTAGTGCTCCGGGGTGGAGGGCGGGCCGTAACACTCCCAGCAAGCACCCTGGCACGTCACCTGCTCAGGGCCCATTCTCTGCCAGAACCCGCTGCAGGTCCTGGTGAACGCCATCATCAACAGTGGCCCCCGGGAAGACTCTACGCGCATTGGGCGAGCGGGAACAGTGCGGCGACAGGCAGTGGATGTGTCCCCACTGCGCCGGGTGAATCAGGTGGGTCCGTGGCCTGCGTGGGTAGCAGGCCAGGATCAGCCACCAGGGCTGGGTGGAGTCTCATCTGGGCAGGTAGGCTCGTCTGTGCCTGGTACATACGTCACCTGGAGCCTCACTTCCTCCAGGGGAGCTTCCTGGATTCCCACCCTGTGCCATCCAGGCCCTGGCACCCCCGCCCCGAGCTGGGTTTCATCCTGTTTCTAGCACACAGTTTACACTCTGTAAAACTTGAGGGGTTTGCGGGTTTGCTGGGGTATCCTTTCTTCTTGGACCATTTAACCTTTCTTTGCTGTCACTCAGAAGTTTCTCCTAAGAGTGAGACTTGCTGGGAATTTAGCCCAGTGGCGAGTGCTTGA

XM_004866556.1 Coding sequence

Rps5 ribosomal protein S5, transcript variant X3

Length: 708 bp    Location: 183667..178142   Strand: -
>XM_004866556.1
ATGTTGAGGGCTAGCTGGGCTCTGACTGTTTCTCCCTTCCCCCACCCCTTCTCTAGGATGACCGAGTGGGAGACAGCTGCACCGGCGGTGGCCGAGACCCCTGACATTAAGCTCTTTGGCAAGTGGAGCACTGACGATGTACAAATAAATGACATTTCCTTGCAGGATTACATTGCAGTGAAAGAGAAGTATGCCAAGTACCTGCCCCACAGCGCGGGGCGCTATGCTGCCAAGCGCTTCCGCAAAGCTCAGTGCCCCATTGTGGAGCGGCTCACCAACTCCATGATGATGCACGGCCGCAACAACGGCAAGAAGCTCATGACCGTGCGCATCGTCAAGCATGCCTTCGAGATCATCCACCTGCTCACGGGCGAGAACCCGCTGCAGGTCCTGGTGAACGCCATCATCAACAGTGGCCCCCGGGAAGACTCTACGCGCATTGGGCGAGCGGGAACAGTGCGGCGACAGGCAGTGGATGTGTCCCCACTGCGCCGGGTGAATCAGGTGGGTCCGTGGCCTGCGTGGGTAGCAGGCCAGGATCAGCCACCAGGGCTGGGTGGAGTCTCATCTGGGCAGGTAGGCTCGTCTGTGCCTGGTACATACGTCACCTGGAGCCTCACTTCCTCCAGGGGAGCTTCCTGGATTCCCACCCTGTGCCATCCAGGCCCTGGCACCCCCGCCCCGAGCTGGGTTTCATCCTGTTTCTAG

XM_004866558.1 Coding sequence

LOC101704792 RING finger protein 223-like

Length: 840 bp    Location: 176732..173827   Strand: -
>XM_004866558.1
ATGCCGTGCCCTCGGCCGCCCTGGCTCCGCCGCCCGCGTGCCCCCCAGGGCAGCGCAGAGGACGAAGATGGGGAGGAGGAGCGGGACGGCAGCCCCAGCGCCGGCCCCATGCTGTCCCCCGCGTCCCCCACCGAGTGCCTCATCTGCGTGTCACCCTTCGACGGCACCTTCAAGCTGCCCAAACGCCTGGACTGCGGCCACGTCTTCTGCCTCGAGTGCCTGGCACGCCTGTCCCTGGCCACGGTGGGCGGCGGCGACGCGGTGTCCTGCCCGGTGTGTCGCGCGCCCACGCGCCTGGTGCCGCGCCGAGGCCTCCCGGCTCTGCCCACCCTCGCTGCGCTGCTGCCCCGGGACGCGCGGCAGGCCGCCTCGGTGCGCTTCGACCGGCGCCGCGGGCTGCTGTACGTGCGCGCGCCCGCGCGCCCGCCCGCGCCCGCGCCGCCGCCGCCGCCGCTGCGCCTGGGCCGTCCGCTCTCTCGTCGCCTGTCGTTCCGCAGCCCGGCCTGGGCCCTCAACGCAGCAGTGGCTCTTGCTGCACTGGTGGCCGCGGGGCTGGTGGTCTCGGCCGTCTACATCTTTTTTCTCATCCCGCGCGCCGGGAATCCTGCGCGCCCGCAGCTCGTGGTGCTGGGCCCGGTGCCCGCGGCGCCCTGGACTCCGACCTGGACCCCAGCCAGGACGACGGAGGCCGCGGAGGGGAAGTCGGAGAGGACCTGGGGACCCAACCTCGGGACTTGGGAAGCAGAGCGTGAGATGCGGGGAGCAGAGCCAGGAGCTGAGGCCGGTCCCAGCAGGGCCCCACGGGCACGCGGTGGCAGGAAGGCCAGGGGAAGTTGGTAA

XM_004866551.1 Coding sequence

A1bg alpha-1-B glycoprotein, transcript variant X2

Length: 1635 bp    Location: 197629..200537   Strand: +
>XM_004866551.1
ATGGCTGCTCCTGTGGGCTTCCTGCTGCTCTGGGGTCTCACCCTGGGCCCAGCGAGCGAGGCGGCCACAATGGTTGAAACCTGGCCCAGCCTCTGGGCAGAGTCGGCCTTGCCGCTGAAGCCCTGGGCCCAGCTGCAGCTGACCTGCCGCGCGCGCCTGGCGACCCTGGAGTTCCAGCTGCTCAAGGACGGGGTGGCCCTGGAGCACGTGCGCCTTGACTTCCCCGCCATTGCCCACCAGTTTGTGCTGGGTGAGGTGACCAGGGACAACCGGGGCCTCTACCACTGCCGCGCCGGTCTGGGTTCGGGGTGGACCCAGCTGAGCGGCCTCGTGGAGGTGACGGGCACAGAGCCCTTGCCCCCGCCCCGGCTCTCGGCTGAGCCGGTGTCCTGGATAACACCCGGCCTGAACTCCACCCTGCGGTGCCGTGCGGCCTGGCACAGTGCGACCTTCCTGCTAAGGCGAGAAGGTGACCAGGCATCTCCTGTGGTGGCCGAGGGCGGAGAGGACGGAGAAGCCACTTTCCCGGTCCACCGGGCTGGCAACTACAGCTGCAGCTACCAGACCCATGCTGCGGGGAGCCTCTCTGTGCCCAGCGACACGGTGACCATCGAGGAGCTAGCCGTGCCCCCGCCGCCGGCGCTGGAGTTCAGGGGCGAGGACGCGAGGGTTCTGCGCCCCGGCGAGCGCGCATCCTTGCAGTGTGTGGCGCCCGTGAGCAGCGCGGACTTCGAGCTGCGGCGGCGCGGGGAGGCCCTGCGGGTGCCCATGAGCAGCACCAGCCCCGACCGCGTCTTTCTTGGCCTGAACTGGGCCGAGGCCGACGGCGGCCCCTATACCTGCCGCTACCGGCCTCTCCGCGCGGAAGTGGCCTGGTCGGCTGACAGCGCGCCTGTGCAGCTGGTGCGCAGCGACGGTGAGCTGCGGCGGGGCCGGAACTGGGACCCCCCTGCCTCGGCCTCCCGGCCTGGCTCCGTAGATGAGCAGGTTCCGAAGCGTCGGGCAAGTCCCGCGCCCCGCGCCCGCTCAGGCCCCTCTCCCGCAGGGTCGCTACCTGCGCCCGACCTCAGTGCCGACCCTGCCGGCCCGCGCCCCGTGCCCGGCTCCCTACTGCGCCTGCGCTGCCGCACGCCCAGGCTCGGGCTGCTCGTGGCGCTGGAGCGCGAGGACGCGCGTGGGCGCCGGCTGCTGGCCCTGCTGCGGCCTGCTCATGCCGAGGCGGAGTTCGAGCTGCGCGACGTCTCTGTGGCGGACTCGGCCAATTACAGCTGCATCTACGTGGACCCTGAGCTTCCCTTCGTGGGCTCCGCGCCCAGCGCTCGCCTGCAGCTGCGGGTGGACGGGCCTCCGCCCGCGCCGCGGCTCCGGGTCTTGGGGCCGCCGGTGACCCCGGGCCGCGACGCCGTCCTGCGCTGTGAGGGCTCCGTGCCCGGCGTGGTCTTCGAGCTGCTGCGTGCGGGCGAGGAGGAGGCCGTGGTGAGCGCCAGCTCCGCGAGCGCCGCTGCCGACCTGGTGCTGACCGCCGCTGGGTCCGGGCATGCGGGCAACTACAGCTGTCGCTACCGCGCATGGGGACCCGTGGCCTTCGAGTCGCCTTGGAGTGACCCGGTGGAGCTCCAGGTGGCAGGAAGCTGA

XM_004866549.1 Coding sequence

LOC101702057 signal recognition particle 9 kDa protein-like

Length: 417 bp    Location: 204661..203704   Strand: -
>XM_004866549.1
ATGGCCACCCGGCTCGGCTCGGCAACATCCCTCACGCCTATTGGTCGAGCGCGGCCTGCCCATCCAAAGGGGAGAGGGTTGTTACCGGAGACGCCGCCGTCTTCGGGCTGTCGGCGGTTGGTGGGCGGGCAGCCGAGAGCCCGCGTCCAGGCCGAGATGTCGCAGTGCCAGACCTGGGAGGAGTTCAGCCGCGCGGCCGAGAAGCTCTACCTTGCGGACCCGAGGAAAGCACGGGTGGTTCTCAAATATAGGCACCCTGATGGGAATTTGTGTATTAAAGTAACAGATGATTTAGTTTGTTTGGTGTACAGAACAGATCAAGCTCAAGATGTGAAGAAGATTGAGAAGTTCCACAGTCAGCTGATGCGATTTAGGGTAGCCAAGGCGTCCCGCAGTGTTACTATGGAAACAGACTGA

XM_004866548.1 Coding sequence

Znf8 zinc finger protein 8, transcript variant X2

Length: 1557 bp    Location: 252256..238124   Strand: -
>XM_004866548.1
ATGGACCCCGAGGACCACGTGGCGATCGTGGCAATGAGCGCTCGCCCGCCGGTGGAACGGCTGCAGGAACCAGTGACCTTCTGGGATGTGGCCGTGGACTTCACCCAGGAGGAGTGGGGGCAGCTGGACCCTACACAGAGGACGCTGTACCGCGACGTGATGCTGGAGACCTTCGGGCACCTGCTCTCTGTGGGCTGGGAGCCAGGCTTCCCCGAAGAGAAGCTGACTACTGGCACAGAAAGAGAAGAGTTCCCGAGGGTCACTGCCTGTCCTTCCCTGGCGGGGGTCACATGGCCGTGTGAGGGTGAGGGTGAGGGCCAGGCACACAGAAAGGACCAGAGTGACGGGTGGCAGCTGGCAGCTGGCCTTGAGGAGGGAGCAGCAGATCCCAGTCCAGGCTGTGAGAGGCTCAGACATGGGGAGAGCTGTGTGCTGAGCTCCAGCCCAAGTGCGTTCCTGAGTTCCAAGAGAGAGTATCCCTGTTCGGATGCACACGGGCCTGGCTCCGACCCTGAGCCGGACGTGGCCAGTGAGCCCCAAGGTAACCACAGGGCCTCCGGCCAGGCCGTCCTGGGCACAGAGCTGTCAAGGAGCCAGGGCCCTGACAAGCCGTACAAATGCACCGACTGCGGAAAGTCGTTCAACCACAACGCACACCTCACGGTGCACAAGAGGATCCACACAGGCGAGCGCCCGTACGTGTGCAAGGAGTGTGGGAAGGCGTTCAGCCAGAACTCGTCCCTCGTGCAGCACGAGCGCATTCACACAGGGGACAAGCCCTACAAGTGCGCGGAGTGCGGCAAGTCCTTCTGCCACAGCACGCACCTCACCGTGCACCGGCGCATCCACACCGGAGAGAAGCCCTACGCGTGCCAGGACTGCGGGAGGGCCTTCAACCAGAACTCATCCTTGGGCCGGCACCGGCGGACACACACTGGAGAGAAGCCCTACGCCTGCAGCGTGTGCGGGAAGGCCTTCTCACGCACCACCTGCCTCTTCCTGCACCTGCGCACGCACACGGAGGAGCGGCCCTATGAATGCAACCACTGTGGCAAGGGCTTCCGGCACAGCTCCTCGCTGGCCCAGCATCAGCGCAAGCACGCGGGGGAGCCGCCCTTCACCTGCCGCCCCATCTTTGAGCAGACAGCAGCCCTGCCCCGGCCCCAGTGGGCAGACGCTCTTGCCTGCACACCGCCTCTGAGCCAGGAGGAGAGGGCGCTGCGCAGCGACAGGCCCTTCAGATGCATCCAGTGTGGCAAGTGCTTCACCCAGAGCTCCCATCTTATCCGCCACCAGATCACTCACACCAGGGACCAGGAGCCATCCAGGCGGCCCCGGAGACGCCAGCAGCCCTGCAGCCGGGGCGCACAGCACACCCAGCACCCGCAGGGAGGGTCAGGACAGAGCAGGGATCAGGCCAGAGCAGCACAGCCAGCGAGCAGAGCCCTGGCCCTGTTTGACATCCACGAACTCATACAGGAGAAAAACCCTGTGCGCATCATTGGGGTGGAGGAGCCCATGGGCTCCACCGTGTTTGACCTCAGAGAGTCCACCTAG

XM_004866524.1 Coding sequence

Chmp2a charged multivesicular body protein 2A, transcript variant X2

Length: 702 bp    Location: 45456..48310   Strand: +
>XM_004866524.1
ATGACTCAGGCCTGCCGTTGGGCCCCTGCCACCATGGACCTGTTGTTTGGGCGCCGGAAGACGCCAGAGGAGCTGCTACGGCAGAACCAAAGGGCCCTAAACCGTGCTATGCGGGAGCTAGACCGGGAGCGACAGAAGCTGGAGACTCAGGAGAAGAAAATCATTGCAGACATCAAAAAGATGGCCAAGCAGGGACAGATGGATGCTGTGCGCATCATGGCAAAAGACCTAGTGCGTACACGGCGCTACGTGCGCAAGTTCGTATTGATGCGAGCCAACATCCAGGCTGTGTCCCTGAAGATACAGACGTTGAAGTCCAACAATTCAATGGCACAAGCTATGAAAGGGGTCACCAAAGCCATGGGCACCATGAACCGACAGCTGAAATTGCCCCAGATCCAGAAGATCATGATGGAGTTTGAGCGGCAGGCAGAGATCATGGACATGAAGGAGGAGATGATGAACGATGCCATAGACGATGCCATGGGAGATGAGGAAGATGAAGAGGAGAGTGATGCTGTAGTGTCCCAAGTCCTGGATGAACTGGGACTGAGCCTAACAGATGAGCTGTCAAATCTCCCCTCCACTGGAGGCTCACTTAGTGTGGCTGCTGGTGGGAAGAAAGCAGAGGCCACAGCTTCAGCCCTGGCTGATGCTGATGCAGACCTGGAAGAGCGGCTCAAGAACCTACGGAGAGACTGA

XM_004866546.1 Coding sequence

Znf274 zinc finger protein 274

Length: 2127 bp    Location: 337256..319640   Strand: -
>XM_004866546.1
ATGGCTGCCGGGCTGCCGAAGCCGTGGGTCTCTGAACCGGTGGTCTTTGAAGATATAACACTGACTTTTACCGCGGAGGAGTGGGGACTGCTGGACCTCAAACAGAAGTCCTTGTACAGGGAAGTGATGCTGGAGAACTACAAGAACCTGCTCTCAGTGGAACATCAGCTTTCCAAGCCAGATGTGGTATCTCAGTTAGAGGAGGCAGAAGACTTCTGGCCGGTGGAGAGAGACATTCTTCAACACACAATTCCAGAATGTCCTGGTGCTGAGGCTCCACTGGACTCTCAGTTGAGTCCTGTTCCTACTGAGAATCCCCTAGTAAACATCAAGGTTGTTGAGGTCCTCACCCTGAACCAGGAGGTGGCTGGTCCCCGGAATGCCCAGATCCAGGCCCTTTATGCTGAAGACAGTGGCCTGACCACAGACATCCTCAGGAAGCCAGCCCAGCAGCTGAGAACATATCCAGCAGACCCTGAAGTCGCTCACCAGAAGTTCCGGCAGTTCCAGTATGAGGAAGCCATGGGTGCCTGGGAGGCTGTGGCCCAGCTCCGTGAGTTGTGCCAACAGTGGCTACAGCCCAAGGTGCACTCCAAGGAACAGATCCTGGAGTTGCTGGTGCTGGAGCAGTTCCTGGGTGCACTGCCTGGGAAGTTCCGGACGTGGGTAGAGTTGCAGCACCCAGAGGACTGCCAGGCAGCCATAGCCCTGGTAGAAGATGTGATCTCAATGTCCAAGGAAGGTGCACTGCCTTCCCAGGTGTCTGCCTGCTTTCCCAAGGCTACCACTCAGCAGCAGAGGAAAGAGAAGGATACAGCCATCTTGCCAGTGGCAGAGCTGCCTGAGGAGCCGGTGACCTTCCAGGACGTGTCTGTGGACTTCAGCCAGGAGGAGTGGGGCCTGCTGGGCCCAGTGCAGAGGACTGAGTACCACGATGTGATGCTGGAGACCTTGGGAAACCTAGTCTCCGTGGGGTGGGAGACTGCAGCAGAAAACAAAGAGTTAATTCCAGATTCTAATGTTCCTGCTGAAGAACCCATTTATGACCCAAAAGTGAATGAATTGTCTAGGGAAGGCACCCAGCCCTCTGCCTTGGAAGATCTCTTGCAAGATGGCATCACAGAAGTCCTGCATGCAGCATTTCAAGAAGAGGAGTTTGCTGAAGACAAACCCATCCCCCAGAAGCACCTCACTGAGAACCCTGAGTCAAAAGCAGACCCTGGTCTCGACACAAGCCAAACTTCACCCCAGAAAATTCCTCCTAGGAAATGTTTCCGCAAACTACTCTCACAGTGTAAAAGTGTAACCCATAGTTCACACATAAAAGATCACCAGAAGGGCTATGAGCCAGGCAAAGCCAGGGACAGCATTGGTCACATGAGCCAAAGTTCACATGTGAAGGTTCAACAGAAGGGCTGTGAGTGGGGCAAAGCTGGGGAGAGCAGTGGTCAAGTGACCCAGCATTCACAAGTGAAACTTCACCGGAAGGGCTGTGAGCCAGGCAGAGCTGGGGAGAGCAGTGGTCTTGTGATACAGAATTCACATGTGAAAGCTCGTCAGAAGCCCAGTGGGCAGAACAAAGCTGGAGAGAGCAACGGTAGTAAGAAAACCGTTGGCCAACGGGTTCCACAGGTCATGTTTATAAAAATCCATAGTGGGAGCCAAATTTGCCGATGCAGTGTATGTGGGAAGTTGTTCCGAAATCCAAGGTACTTTTCTGTACATAAAAAAATCCATACAGGAGAGAAACCATATGTCTGTCAGGACTGTGGGAAAGCCTTCGTGCAGAGCTCTTCTCTCACACAGCACCAAAGGGTGCACAGTGGTGAGAGGCCCTTCCAGTGCCAGGAGTGTGGCAGGACCTTCAATGACCGCTCAGCTGTCACCCAGCACCTGCGCACCCACACTGGTGCCAAGCCCTATGCCTGCCAGGACTGTGGCAAGGCCTTCCGGCAGAGTTCCCACCTCACCCGGCACCATAGGACACACACTGGAGAGCGGCCCTACGTGTGCCACAAATGCGGGAAGGCCTTCACCCAGAGCTCCCATCTCATCGGCCACCAGAACACACATGGCAGGAGGAAGCATAAGAGGAAGCACAAGAAGCAGCCACCTCCTGCCTCCTAG

XM_004866542.1 Coding sequence

LOC101697455 extracellular calcium-sensing receptor-like, transcript variant X1

Length: 2571 bp    Location: 417357..434086   Strand: +
>XM_004866542.1
ATGGCGTCGCTGAGTGCGGTCACCCTGTCAAGTCCTGGTCCCTGGGAGCCGCGCGTTAGAAACGTGACTCTCCTATGCCTGTTGAAAATCGTGTCCAGCTGGGGCTACCGGGTGGCCCAGAGCTTCGTCTTTGCTGTCGAGGAGATCAACAGGAGCACCCGCCTGCTGCCCAACCTGACTCTGGGCTTCTCCATCCGCAACTCCGGGGACTCCATTCACAGGGCCCTGCATGAGACCCTGTCCTTCCTCACTGGCCAGGAGGATCCTGTCCCCAACTATGTGTGCCAGTTTGGTCCACCCCGGGTTGCCTTGGTGGGGGACACACGCTCGGCTCTGTCTGTGGCCATGGCCAGGCTGCTGGGGCTCTACAAGTTTCCCCAGGTCAGTTATGCATCCACACTGCCCAGCCTCAGTGACAAGACCCAGTTCCCATCCTTCCTGCGCACCCTGGCCAGTGACCTCAAGTCCTCCTATGCTGTAACCCAGCTGGTGCTGCACTTGGGATGGTCCTGGGTCATCATCCTGGCCCAAGATGATGACTTTGGGCAGCAGGCTGGTGCTCTAGCTGCTAGAGAACTGGGAGAGGCAGACATCTGCATCGAATTCCACGTCCCAGTCCCTTCCCAGCATTCCCCTGAGAAGATCAACGCTGTGGTTCAGAAGATGCAGACCAGCACTGCCACGGGGGTCCTGGTCTTCCTGAGCAACTCCAATTTCAAGCTTATCCTGCAGAGCCTGCTGGGTTTCAGTCTCCTGGGCCAGGTCTGGGTCAGTGAGGGCCTCCTGCACACGGCACTTGCCCTGGCCATGCCTGGCATCTCTCAGGTACTGCGGGGCACATTTGGCCTTCTGCGGCACAGTAGCCGGGTACATGGATTCCCTGAGTTTTTTGCCAGCTTACACCCAAATCGGACCCCAGAGGACATGTTCCTGGGGAGGTTTTGGGAGGCCACCTTTGGGTGCAGATGGCTGCATGCGAATGGCACAGTGTCAGGAGAAGTACGGCTGTGCTCAGGTAGTGAGAGTCTGAGAGGGCATGAACATCCTTTCCAAGACGTGAGTAGAGTGGACATTGCATACACAGCCGTCTACAGTGTAGCCCATGCCCTGCAGGACCTGGTGTCCTGTGAACATGGGGATGGCATGTGCACAGACCCCAAGCACTTCCAGCCCTGGCAGCTCCTTCACCCCCTCAGGAAGGTGCGCTTCCAGACCCCTGATGGGACCCACATCATGTTCGATGCCAATGGAGACTTGGTGACAACATATGATGTTTTCCAAGGGCAACAGAGCCCCAAGGGCCAGTTCCACTTTGTCCGCATTGGCACGATGGACCCTCATCGCTCTTCAGAGGACAGAATTATGATTCGCTTGAAAGATGGTGTGCAGTGGGGAGGATGCCTGCCTACTCTTTGCTGGGTCAAGTCACCCTTGTGCTCCAAGCAACAGGGTCTCTGCTGTCGCCCTGCAAACTGTTACCAGGTGCCCAGCTCTGTCTGCAGCACCAGCTGTGAACCAGGATCCAGTCAGATCCCCCAGCAGGGAGCCCCCCACTGCTGCTTTGAGTGCCGGCCCTGCCCCGAGGGACAGTTTACAGATCAGAGAGACATGAAGAGCTGTCGCCAGTGTCCCAAGGAGCAGTACCCAAGCCAGGCCAGAGACCGCTGCCTTCCCAGGACAGAGACCTTCCTGGCCTTCGATGAACCCCTGGGCCTTGCACTGACTTCGGTGGCGCTGGCGCTGGCCGGCCTGGCCTGCCTGGTCCTCGGGGTATTCCTGAGGTTCCGGGACACACCTGTGGTCAGGGCCAACAACAGGGCCCTCAGCTACGTGCTCCTGGTGTCCTTGGCCCTCTGTGCCCTGAGTCCCTTGCTGTTCCTTGGCCGCCCCTCACCCACCACCTGCCTCCTCCGCCAGACCACCTTTGCTGTGGTGTTCACTGTGGCCGTGTCCTGTGTCCTCGCCAAGACCCTCACTGTGGTCCTAGCCTTCAGGGTCACTAGGCCGGGACAGAGAATCCGCATGTGCCTTGGGCCCAACACCTCCTCTTTTGTGGTACTGGGTGCCTTGGTGGTGCAGGTCGTCCTCTGTGGGATCCGGCTGGGCACCTCCCCACCATTCCCACACAGTGACACAGCCTCAGAGGCAGGCCGCCTTGTGCTCCTGTGCCAGGAGGGCTCTGGTGTCGCCTTCTCCTGTGTGCTGGGCTACCTGGGCCTCCTGGCTGTGGGCACCTTCTCTGTGGCCTTCCTGGCCCGGGGCCTGCCGGATGCCTTCAACGAGACCAAGTTCCTCACCTTCAGCATGCTGCTCTTCTGCAGCGTCTGGACGGCCTTCCTACCCCTGTACCACAGTGCACGGGGCAAGGCCACTGTCGCTGTGGAGGTCTTCTCCATCTTGGCCTCCACTGCAGGACTGCTGGGTGGCATCTTCCTCCCCAAGTGCTACCTCATCCTGCTGAAGCCTGAGAGGAACACGCTGGCTGGGTTGAGGCTAGGTCACCAGGCTCAGAGTGCTCCATTTTCTCGCAGAAACACGGATACCCCCAGGCTCCCAGCACAGTACCCTTGA

XM_004866540.1 Coding sequence

Znf154 zinc finger protein 154

Length: 1269 bp    Location: 657655..651750   Strand: -
>XM_004866540.1
ATGGCGGTGGCCGCGCCGAGGTCCCCGGCCCAGGGAAGCGTGACCTTTGACGATGTGGCCATACACTTCTCCTGGGATGAATGGCATCTCCTTGACGAGGCTCAAAGATGCCTGTACCATGATGTGATGATGGAGAACTTGGCACTTATCACCTCCCTGGACACTCATCAGCATGAAAAGCTGCAGTTTGGCCAGAAATGCTTCAGAAGCAATGGGGGCAGGTTCTTGTTTGTGAACAGGTCCAAATTCCACGTGTCGTGGGAGCACTTTACCTGCAGGAGAGTGGGGAAGGACTTCCTACCCAGCTCAGAATTTCTTCATGATCGGGCCACGTGGACTAAGGAACAGTCAAACAGCAAAAGTAATTGTGGGGCTGTCTGTCACAGTGGAAAAACTCAATATGAGCAGCCGAAAGCCCCTAGTAGAGAACGCAGTTACATTTGTCATCAGTGTGGGAAATCTTTTAGTAAAAGCTACAGCCTCAATGATCATTGGAGAGTTCATACTGGTGAAAAGCCTTATGAGTGTGGGGAATGTGGGAAATCCTTCAGGCAGAGCTCTAGCCTCATTCAGCACCGGAGAGTTCACACTGGAGTGCGACCTCATGAATGTGAAGAATGTGGCAAATTATTTAGCAACAAGTCCAACCTCATTAAACATCGGAGAATTCACACTGGAGAAAGGCCTTATGAGTGCAGTGAATGTAGGAAATCCTTCAGTGAAAGCTCTGCACTCCTTCAACATCAGAGCGTTCACACTGGCGAAAGGCCTTATGAGTGCAATGAATGTGGGAAGTTCTTTACTTATCATTCCAGTCTTATAAAGCACCAGAAAGTTCATCGTGGATCAAGGCCTTATGAGTGCAGTGAATGTGGGAAATCATTTAGCCAAAACTCCAGCCTCATTGAACATAGGAGAGTTCACACTGGAGAAAGACCTTTTAAGTGCAGTGAATGTGGAAAATCATTTAGCCAAAGCTCTGCCCTCCTTCAGCATCGAAGAGTTCATACTGGAGAAAGGCCTTATGAGTGCAGCGAATGTGGGAAATTATTCACCTACAGTTCCAGTCTCCAAAAGCACCAGAGGGTTCACACTGGATCGAGGCCTTATGAATGCAGTGAATGTGGGAAATCCTTTACTCAGAACTCCAGCCTCATTAAACATAGGAGAGTTCATACTGGCGAAAGGCCTTATGAGTGCACCTACTGTGGAAAGTCCTTTAGCCATAACTCCAGCCTCCTTAAACACTTGAGAATTCATAGTCAATAA

XM_004866535.1 Coding sequence

Znf446 zinc finger protein 446, transcript variant X6

Length: 1512 bp    Location: 102643..98084   Strand: -
>XM_004866535.1
ATGCGCAGGTATTCGAGGCTCCGTCGGTTGACAGTGGGAGAGTTTTGGGGTTCGTATGCAAAGAAAGTGTGGCTGCTACACAAGGGAAGGAGCTCCCTAAACTGCAGCACTGCGGATTCCTCAAGAGCAACGGAGCGTCTCAGTCCAGAGAAGCCTCTGATAATGTTCCCCTGTTCTTGCTTGCTGAGGCTTATGGGAAATGTAGTCCAAGGAGGGCGGCGATGTCCACGGAACAGGCCTGGGATTGGCCAGGGTAGCGTCGCCAGGGCAACGAGCGGAGGGACCGTTCCGAGTGACGCCACTTCCCGGAAGTGGACTCCCAGCACTGGCGCGGAGGCTGAGGTTCCTCTTGGCAGTTCCAAGAAGACACAGAAAAGAATGCCATCCCCTCTCGGTCCCTCATACCTGCCCCTGGGGGACTCCGAGACCAACCTCAAGGGACCTGAAGGTGCCCGGCTTCGTTTCCGGGGATTCTGCTACAAGGAGGTGGCAGGGCCACGGGAAGCGCTGGCCCAGCTCCGAGAGCTGTGCCACCAGTGGTTGCGGCCTGAGTCCTGCTCCAAGGAGGAGATCCTAGAGCTGCTGGTGCTGGAGCAGTTCCTGGGCACACTGCCCCTTGAGATCCAGGCCTGGGTACGAAGGCAGCAGCCAGGCTGCCCTGAGGAGGCTGCTGCCCTGGTAGAGGGGCTGCAGCAGGACCCTGGACAGTTGCTAGGCTGGATCACAGCCCACATCCTGAAGCCAGAGGTGCTGCCTGCATCCCAGAAGACAGAGGAATCCTCAGGGAGCCCTCAGCCCTCAGCAACAGTGGATCCCTGTGGAGCAGCCCCAGGGGAGGGCCCACAGGATGCCAGGATGGAAGGGTCGGCCCAGCTCAGTTGCAGTGTGAAGGAGGAGCCCAGTGTGGATGGCCAGGAGATGGCACCTCTCAGCCCCTTACTTCCGGCCCCATCACCTGAGAGTCATCTGGAGCACCAAGAACCAGCCTCTACATCCTTCCAACTACCCAGGAATCAGGTCCGGGGGCAGAGGGACAGCCTGCTGTCTCCAGCGCTGGAAGGGACTTGTAACCTAGGCCGTGGAAATCTTGTTTGTGTGGCTTCCTCATCTCCAGAGAAGTCCCGGAGAGGTGACAGAGGAGGGACACCCCTTCCTGGCCATGACAGTGGCCTCCCCACAGGAGCGGTGGGTGCTGCTGGACCGGTCGCAGAAGGAGCTCTACTGGGATGCGATGCTGCAGAAGTACGGTTCTGCGGTGTCCCTGGGCGCTCGCACGCTCGTGCCCCGGAGCCCGTGCCACCACCCTGTGCGCCCCGCAGCACCCCACGCCGTGCACCAGGTCACGTGTGCCAGGACTGTGGCCACAGCTTCAGCTGGAAGTCGCAGCTGGTCATCCACCGCAAGGCCCACGCTGGCCAGCGGCGTCATGCCTGCGGGGACTGTGGCCGTGCCTTCGACTGGAAGTCGCAGCTGGTCATCCACCGAAAAAGCCACCAGCCGGAGGCACTGTGA

XM_004866531.1 Coding sequence

Znf446 zinc finger protein 446, transcript variant X2

Length: 1758 bp    Location: 102643..97055   Strand: -
>XM_004866531.1
ATGCGCAGGTATTCGAGGCTCCGTCGGTTGACAGTGGGAGAGTTTTGGGGTTCGTATGCAAAGAAAGTGTGGCTGCTACACAAGGGAAGGAGCTCCCTAAACTGCAGCACTGCGGATTCCTCAAGAGCAACGGAGCGTCTCAGTCCAGAGAAGCCTCTGATAATGTTCCCCTGTTCTTGCTTGCTGAGGCTTATGGGAAATGTAGTCCAAGGAGGGCGGCGATGTCCACGGAACAGGCCTGGGATTGGCCAGGGTAGCGTCGCCAGGGCAACGAGCGGAGGGACCGTTCCGAGTGACGCCACTTCCCGGAAGTGGACTCCCAGCACTGGCGCGGAGGCTGAGGTTCCTCTTGGCAGTTCCAAGAAGACACAGAAAAGAATGCCATCCCCTCTCGGTCCCTCATACCTGCCCCTGGGGGACTCCGAGACCAACCTCAAGGGACCTGAAGGTGCCCGGCTTCGTTTCCGGGGATTCTGCTACAAGGAGGTGGCAGGGCCACGGGAAGCGCTGGCCCAGCTCCGAGAGCTGTGCCACCAGTGGTTGCGGCCTGAGTCCTGCTCCAAGGAGGAGATCCTAGAGCTGCTGGTGCTGGAGCAGTTCCTGGGCACACTGCCCCTTGAGATCCAGGCCTGGGTACGAAGGCAGCAGCCAGGCTGCCCTGAGGAGGCTGCTGCCCTGGTAGAGGGGCTGCAGCAGGACCCTGGACAGTTGCTAGGCTGGATCACAGCCCACATCCTGAAGCCAGAGGTGCTGCCTGCATCCCAGAAGACAGAGGAATCCTCAGGGAGCCCTCAGCCCTCAGCAACAGTGGATCCCTGTGGAGCAGCCCCAGGGGAGGGCCCACAGGATGCCAGGATGGAAGGGTCGGCCCAGCTCAGTTGCAGTGTGAAGGAGGAGCCCAGTGTGGATGGCCAGGAGATGGCACCTCTCAGCCCCTTACTTCCGGCCCCATCACCTGAGAGTCATCTGGAGCACCAAGAACCAGCCTCTACATCCTTCCAACTACCCAGGAATCAGGTCCGGGGGCAGAGGGACAGCCTGCTGTCTCCAGCGCTGGAAGGGACTTGTAACCTAGGCCGTGGAAATCTTGTTTGTGTGGCTTCCTCATCTCCAGAGAAGTCCCGGAGAGGTGACAGAGGAGGGACACCCCTTCCTGGCCATGACAGTGGCCTCCCCACAGGAGCGGTGGGTGCTGCTGGACCGGTCGCAGAAGGAGCTCTACTGGGATGCGATGCTGCAGAAGCGCTCGCACGCTCGTGCCCCGGAGCCCGTGCCACCACCCTGTGCGCCCCGCAGCACCCCACGCCGTGCACCAGGTCACGTGTGCCAGGACTGTGGCCACAGCTTCAGCTGGAAGTCGCAGCTGGTCATCCACCGCAAGGCCCACGCTGGCCAGCGGCGTCATGCCTGCGGGGACTGTGGCCGTGCCTTCGACTGGAAGTCGCAGCTGGTCATCCACCGAAAAAGCCACCAGCCGGAGGCACTGTGAGGAGGAGCCAGCCCAGGATGGAGGCCAGGGCCTCACTGCCGGCAGTGGACACTCAGGAACTGGCGTGTACCCCGTGCAGCGGCAGGGCCCCAAGTCTGCCTGTGGAAGGTGACAAGAGGCCCAGGAAAGCACAGCTGGCTTCTCTTCCGAGTGACCTTCTTGTGACCTGTCCTTTTGTGGTGCTTGATGACCCGAGGAGAGGAATTGGCCTGGACCAGCTCACAAATGGCAAGAGAGTGTGCACGAGCCAGGAGGTTGTTGCACAGTGA

XM_004866523.1 Coding sequence

Chmp2a charged multivesicular body protein 2A, transcript variant X1

Length: 702 bp    Location: 45712..48310   Strand: +
>XM_004866523.1
ATGACTCAGGCCTGCCGTTGGGCCCCTGCCACCATGGACCTGTTGTTTGGGCGCCGGAAGACGCCAGAGGAGCTGCTACGGCAGAACCAAAGGGCCCTAAACCGTGCTATGCGGGAGCTAGACCGGGAGCGACAGAAGCTGGAGACTCAGGAGAAGAAAATCATTGCAGACATCAAAAAGATGGCCAAGCAGGGACAGATGGATGCTGTGCGCATCATGGCAAAAGACCTAGTGCGTACACGGCGCTACGTGCGCAAGTTCGTATTGATGCGAGCCAACATCCAGGCTGTGTCCCTGAAGATACAGACGTTGAAGTCCAACAATTCAATGGCACAAGCTATGAAAGGGGTCACCAAAGCCATGGGCACCATGAACCGACAGCTGAAATTGCCCCAGATCCAGAAGATCATGATGGAGTTTGAGCGGCAGGCAGAGATCATGGACATGAAGGAGGAGATGATGAACGATGCCATAGACGATGCCATGGGAGATGAGGAAGATGAAGAGGAGAGTGATGCTGTAGTGTCCCAAGTCCTGGATGAACTGGGACTGAGCCTAACAGATGAGCTGTCAAATCTCCCCTCCACTGGAGGCTCACTTAGTGTGGCTGCTGGTGGGAAGAAAGCAGAGGCCACAGCTTCAGCCCTGGCTGATGCTGATGCAGACCTGGAAGAGCGGCTCAAGAACCTACGGAGAGACTGA

XM_004866533.1 Coding sequence

Znf446 zinc finger protein 446, transcript variant X4

Length: 1620 bp    Location: 102643..97987   Strand: -
>XM_004866533.1
ATGCGCAGGTATTCGAGGCTCCGTCGGTTGACAGTGGGAGAGTTTTGGGGTTCGTATGCAAAGAAAGTGTGGCTGCTACACAAGGGAAGGAGCTCCCTAAACTGCAGCACTGCGGATTCCTCAAGAGCAACGGAGCGTCTCAGTCCAGAGAAGCCTCTGATAATGTTCCCCTGTTCTTGCTTGCTGAGGCTTATGGGAAATGTAGTCCAAGGAGGGCGGCGATGTCCACGGAACAGGCCTGGGATTGGCCAGGGTAGCGTCGCCAGGGCAACGAGCGGAGGGACCGTTCCGAGTGACGCCACTTCCCGGAAGTGGACTCCCAGCACTGGCGCGGAGGCTGAGGTTCCTCTTGGCAGTTCCAAGAAGACACAGAAAAGAATGCCATCCCCTCTCGGTCCCTCATACCTGCCCCTGGGGGACTCCGAGACCAACCTCAAGGGACCTGAAGGTGCCCGGCTTCGTTTCCGGGGATTCTGCTACAAGGAGGTGGCAGGGCCACGGGAAGCGCTGGCCCAGCTCCGAGAGCTGTGCCACCAGTGGTTGCGGCCTGAGTCCTGCTCCAAGGAGGAGATCCTAGAGCTGCTGGTGCTGGAGCAGTTCCTGGGCACACTGCCCCTTGAGATCCAGGCCTGGGTACGAAGGCAGCAGCCAGGCTGCCCTGAGGAGGCTGCTGCCCTGGTAGAGGGGCTGCAGCAGGACCCTGGACAGTTGCTAGGCTGGATCACAGCCCACATCCTGAAGCCAGAGGTGCTGCCTGCATCCCAGAAGACAGAGGAATCCTCAGGGAGCCCTCAGCCCTCAGCAACAGTGGATCCCTGTGGAGCAGCCCCAGGGGAGGGCCCACAGGATGCCAGGATGGAAGGGTCGGCCCAGCTCAGTTGCAGTGTGAAGGAGGAGCCCAGTGTGGATGGCCAGGAGATGGCACCTCTCAGCCCCTTACTTCCGGCCCCATCACCTGAGAGTCATCTGGAGCACCAAGAACCAGCCTCTACATCCTTCCAACTACCCAGGAATCAGGTGACAGAGGAGGGACACCCCTTCCTGGCCATGACAGTGGCCTCCCCACAGGAGCGGTGGGTGCTGCTGGACCGGTCGCAGAAGGAGCTCTACTGGGATGCGATGCTGCAGAAGTACGGTTCTGCGGTGTCCCTGGGTGAGGACCGCTTTGCCCTGGGTCCCCAAGCCCCACTCCCTGTCCGGGTGTATGCCTGCCTGATGGCCCCATCCGCAGGGCTGCCAGACCGGGAGCCAAACCCCGACCCAGAGCTGAGTCCGCGCCCTGCCCACCAGGACCTGCCCACTGCGCGGAAGCCCTACACTTGTGCGCAGTGCGGCTGTGGCTTTGACTGGAAGTCCGTCTTTGTAATGCACAGGCGCTCGCACGCTCGTGCCCCGGAGCCCGTGCCACCACCCTGTGCGCCCCGCAGCACCCCACGCCGTGCACCAGGTCACGTGTGCCAGGACTGTGGCCACAGCTTCAGCTGGAAGTCGCAGCTGGTCATCCACCGCAAGGCCCACGCTGGCCAGCGGCGTCATGCCTGCGGGGACTGTGGCCGTGCCTTCGACTGGAAGTCGCAGCTGGTCATCCACCGAAAAAGCCACCAGCCGGAGGCACTGTGA

XM_004866525.1 Coding sequence

Chmp2a charged multivesicular body protein 2A, transcript variant X3

High confidence: 4 potential gene matches
Length: 669 bp    Location: 45457..48310   Strand: +
>XM_004866525.1
ATGGACCTGTTGTTTGGGCGCCGGAAGACGCCAGAGGAGCTGCTACGGCAGAACCAAAGGGCCCTAAACCGTGCTATGCGGGAGCTAGACCGGGAGCGACAGAAGCTGGAGACTCAGGAGAAGAAAATCATTGCAGACATCAAAAAGATGGCCAAGCAGGGACAGATGGATGCTGTGCGCATCATGGCAAAAGACCTAGTGCGTACACGGCGCTACGTGCGCAAGTTCGTATTGATGCGAGCCAACATCCAGGCTGTGTCCCTGAAGATACAGACGTTGAAGTCCAACAATTCAATGGCACAAGCTATGAAAGGGGTCACCAAAGCCATGGGCACCATGAACCGACAGCTGAAATTGCCCCAGATCCAGAAGATCATGATGGAGTTTGAGCGGCAGGCAGAGATCATGGACATGAAGGAGGAGATGATGAACGATGCCATAGACGATGCCATGGGAGATGAGGAAGATGAAGAGGAGAGTGATGCTGTAGTGTCCCAAGTCCTGGATGAACTGGGACTGAGCCTAACAGATGAGCTGTCAAATCTCCCCTCCACTGGAGGCTCACTTAGTGTGGCTGCTGGTGGGAAGAAAGCAGAGGCCACAGCTTCAGCCCTGGCTGATGCTGATGCAGACCTGGAAGAGCGGCTCAAGAACCTACGGAGAGACTGA

XM_004866521.1 Coding sequence

Ube2m ubiquitin-conjugating enzyme E2M

Length: 780 bp    Location: 26970..31237   Strand: +
>XM_004866521.1
ATGAGGCCCATCATGCTGGGACCCTTGGGCCATCCACCCCCAGAAGATGATGAGCCTGTCATGGTGAAGCTGGAGGACTCTGAGGAAGAGGAAGAGGCTGCCCTGTGGGATCTGGGACCTGAGGCTGCACGCCTGCGCTTCCGAGGTTTCTGCTATGAGGAGGCAGTGGGACCCCAAGAGGCCCTGACCCAGCTTCGAGAGCTGTGTCACCAGTGGCTGCAGCCAGAGTTGCACTCCAAGGAGCAGATGATGGAGCTGCTGGTGCTGGAGCAATTCCTGTGTGTGCTGCCCCCTGAGATCCAGGCCCACGTGCAGGGGCAGCGGCCAAGTAGCCCTGAAGAGGCTGCTGCCTTAGTTGACAGGCTCCGTTGGGAGCTGGGCAGGCCTCGGAGATGGGTCACAGTCCAGGTGCAGGGCCAGGAAGTCCTGTCAGAGAAGATGGAGCCTTCCAGCTTCCAGCCTCCACCTCGGACCAAGCCTCAGACTCCAGATCCTGGACCTGAGACACCTCCTGGGGCTTCGCAGGAATTGCCGCTGGGCTTTCAGGTGAAAGAGGATCCAGAGGCTACGGAGGAGCCAGAGTTGCTGGAGTCTGGGCCTTTACCTGTGACCCAGGAGGCTGCACCCACTGTCCTACCTGAGGAGGCCCAGGGCTACAAGACTGCGCTGGAGCTGACCTCTCCCCACGGTGACACTGGCCCCGAGGGGTCCTCGTGGAGGGAGCAGCCTAGGGCCCTGTGGCTTGAGGAAGCTGGGGGCCTCTTCTCGCCAGGTGAGTGA

XM_004866522.1 Coding sequence

Ube2m ubiquitin-conjugating enzyme E2M

High confidence: 4 potential gene matches
Length: 552 bp    Location: 42616..45092   Strand: +
>XM_004866522.1
ATGATCAAGCTGTTCTCGCTGAAGCAGCAGAAGAAGGAGGAGGAGTCGGCCGGCGGCACCAAGGGCAGCAGCAAGAAGGCCTCGGCGGCGCAGCTGCGGATCCAGAAGGATATAAACGAGCTAAACCTGCCCAAAACGTGTGACATCAGTTTCTCAGACCCAGACGACCTCCTCAACTTCAAGCTGGTTATCTGTCCTGATGAGGGCTTCTACAAGAGTGGAAAGTTTGTGTTCAGTTTTAAGGTGGGCCAAGGTTACCCACATGACCCCCCCAAGGTGAAGTGTGAGACTATGGTTTATCACCCCAACATTGACCTCGAGGGGAACGTCTGCCTCAACATCCTCAGAGAGGACTGGAAGCCAGTCCTTACGATAAACTCCATAATTTATGGCCTGCAGTATCTCTTTTTGGAGCCCAACCCCGAGGACCCACTGAACAAGGAGGCCGCCGAGGTCTTGCAGAACAACCGGCGGCTGTTCGAGCAGAACGTCCAGCGCTCCATGCGAGGTGGCTACATCGGCTCCACCTATTTTGAGCGCTGCCTAAAATAG

XM_004866658.1 Coding sequence

Suv420h2 suppressor of variegation 4-20 homolog 2 (Drosophila)

High confidence: 4 potential gene matches
Length: 1461 bp    Location: 1950964..1945193   Strand: -
>XM_004866658.1
ATGCCCAGCTGTGCCCAGCGGCTTCCTGCTGTCTGTCAGAGGCAGCATGGTCCACAAAACATCATGGGGCCCGACAGAGTGACAGCCCGAGAGCTGTGTGAGAACGATGACCTGGCCACCAGCCTTGTTCTCGACCCCTACCTCGGCTTCCGCACCCATAAGATGAACGTCAGCCCTGTGCCCACCCTGCGGCGACAGCAGCACCTGCGCTCAGCGCTGGAGGCCTTCCTACGGCAGCGGGACCTGGAGGCTGCGTACCGGGCCCTGACACTGGGAGACTGGATGGCCCACTACTTTCAGAGCCGGGGCCCACGGCAGGAGGCTGCCCTCAAGACCCACGTGTTTCGCTACCTCCGTGCCTTCCTGCCTGACAGTGGCTTCACCATCCTGCCCTGTACCCGCTACTCCATGGAGACCAACGGGGCCAAGATCGTGTCCACCCGTGCTTGGAAGAAGAACGAGAAGCTGGAGCTGCTGGTAGGCTGCATCGCCGAGCTGCGGGAGGCCGACGAGGACCTGCTGCGGGCTGGCGAGAATGACTTCAGCATCATGTACTCCACCCGCAAGCGTAGCGCACAGCTGTGGCTAGGCCCTGCTGCCTTCATCAACCATGACTGCAAACCGAACTGCAAGTTTGTGCCTGCAGATGGCAATGCAGCCTGCGTGAAGGCGCTGCGGGATATTGAGCCAGGGGACGAGGTGACATGCTTCTATGGCGATGGCTTCTTTGGGGAGAAGAATGAGCACTGCGAATGCTACACCTGTGAGAGGAAGGGGGAGGGAGCCTTCCGCCTGCAGCCCAGGGAGCCTGAGCTGCCGCCACCGCCCCCTGACAAGTACGCGTTCCGGGAGACCAAGCGGCGGCTGCAGCGAGGCCAGGACAGCAGCTGGCAGAGCCTGCTGGGCCCGAGGGCCTGCACCCACCTGTCCCCCCTGCGCTGGGACCCGTTCTGTGCTGTCTGCCAGCCCCTGCGCCTGCCACCCTGCAGCTCCCGCCTGGACAGCTTGCCGCTCTGGGTCCAGTGGCTGCCCCAGCCCCCGCCCCGAGTGCGCCCCCGGAAGCGCCGGTGCCCCCAGCCCCGGCAGGCCCAGGCGCCCCCTGCTCTCTGCGAGGTCCAGGTCTCCCTGCACCGCTGGGGAGGCTGCAGCCCACACTGCCGCTTGCGCGCAGAGGCTCTGGTGGCCCTGGGGCTGCCCCATCGTGCCCGCTGGGCCCCCCAGCAGGACTGGCACTGGGCCCGCCGTTACGGGCTGCCTTATGTGGTGCGTGTGGACCTCAGCCGCCTGGCCCGGGCCCTGCCGGCCGCCCCTGCCCCTTCTGGCACCCTAGGCCCCACCCCTGCTCCCGCCCCTGTCCCCAAGCAGGCCCTTGCCTTTGCCTCCTTCTCCCCGCCCAGGCGTCTGCGGCTCGTGGTGAGCCACGGCTCCATCGACCTGGATGTCAACAGTGATGAGTCCTGA

XM_004866673.1 Coding sequence

Dnaaf3 dynein, axonemal, assembly factor 3, transcript variant X2

Length: 1521 bp    Location: 2081997..2087842   Strand: +
>XM_004866673.1
ATGACCACCCCGGCAGGCTCGGGCGCGGGCTTCGGCTGGGTGTCCTGGTGGGGCCTGTCGCCGGCTCTGGACCTGCAGGCGGAGGGCCCTGCTGCGCAAGCGGACGCGGACGCGGACGGGGACGCGGCGCGCGCCACCCCCGAGCTCAACGTGCTGCTGCTGGGCTCCGTGGACGGGCGCCACCTGCTGCGCACCCTGGCCCGGGCGGCTCGCTGGCCGCGCAGGAGGCTCAACTTCTATCTTCTGGAGCACAACCTGGAGGCTGTGGCCCGACACATGCTCATCTTCAGCCTCGCTCTGGAGGACCCCGAGAAGATGGGGCTGCAAGAGCAGAGCGAGGCCTTCCTGGAGGTGTGGGGGAACGCGCTGCTGCGGGCCCCGGTGGCCGCCTTCGTGCGCGAGCAGGCCTCCCGCCTGGCGCTCCTGGTCCCCGAGCCCGACCGCCTGGAGCGGGAGCTGCCCTGGCTCAGCCTGCGTGCGCTCAAGTTCCGCGAGCGCGATGAGCTGGAGGCCGTGCTCCGTTTCTGGTCCTGCGAGGAGCGGGGCCCACAGGCCTTCCCCATGGGCCGCCTGTGGGACGCGCGGGTGCGACACTACCTGGGCTCGCGCTACGACGCGCGGTGCGGGGTCAGCGACTGGGACCTGCGCATGAAGTTGCACGACCGCGGGGCCCAGGTCATCCACACCCAGGAATTCCGCCGCTGGAGGGACACAGGCGTCGCCTTTGAACTCAGAGACTCCAGCGCCTACCACGAGCCCAACCGGACCCTGGCGTCCGGCCGCCTCCTGACCCACTGCGGGGAGCGCGTGGCAGCGCGCGGGTACTGGGGGGACATCGCTACGGGGCCCTTCGTGGCCTTTGGCATCGAGGCGGATGACCAGAGCCTCCTGCAGACCAGGAACGGGCAGCCGACCAAGACTGCGGGAGAGATCACGCAACACAACGTGATGGAGGTGCTTCGAGAACTGGCCGCCTGGGGGCGCCCGAGAGACACGCAAGGGGACCGGGAGAAGCAACCCGAGCCGGAAGGCAGCCCGGAGCAGGAGACCTCGGGAGACCTGGCCCCGGCCCCCTTCAAGCTCCACTTCCTGTCGCTTGGATCCGCGCGCTCGCTGCACCACAAAGGCTGCTACCAGGCCCGCTTCCAGCTTCTCTACGTGGCCTGCGGCATGGTGCACCTGCTCGGCCCCGAACTCGCGGCCTGCATGGCCCCCGGCGGGAACCTGCTGGTGGAGTTGGCCCGGTTCCTGGTGGACCTGCGGCCCGAGCAGCTGCAGGCCTTCGCCGCCCGGGTCGGGGAGCTGGCGGGGGCAGCCGGCTTTACCCCGTGCGCTTCGGCCGGGCCCGCGGAGACCTTCGCACGCTTCGCCAAGCAGGGTGCGCGGGGCCCAGACACCCGCCCCAGAGCCCCTTCCGCGGCGCCCCCTGTCGCGGCTGCACCACCCCAGCCCCACGACCTGGCCTCCCACGCCACAACAGGACTGGACTCCGGAGCCCCAGTGCCCCTCTCTGACTTCTAA

XM_004867169.1 Coding sequence

Lair1 leukocyte-associated immunoglobulin-like receptor 1

High confidence: 3 potential gene matches
Length: 1317 bp    Location: 2328479..2337393   Strand: +
>XM_004867169.1
ATGGCCCCGCAGCCCACCGCCCTCCTGGCTCTGGGGCTCTGCCTCGGCCCCGTGATCCATGCGCAGGACGGGCCCCTGCCCAGACCCTCCATCTCTGCTAAGCCAGGCCCCATGATCACCCAGGGGAGCAACGCGACCATCCTGTGCGAGGCAGCTGCTGGGTTTGAATTATTCCGCCTGGAGACTTGTTTTGCCCAGAGTTGTCTCAAAGTTAGGGAAGAGAACAGTTTGTCTTGGAAGACAGAAGCCAGGTTTATCCTCAACTCAGTGAACACAGACATTGCTGGGCATTACAGGTGCATCTACCGGAAATCGGGCTACTGGTCTCCGCGCAGTGAGACCCTGGAGCTGGTGGTGACCAGTGTGGATGCCACCCAGGCCCCCAGGCCCCCAGTCTCAGGTTCGTCCCCAGGTCCCCGGACCATGCACCCTGCTGCCATCCTCTGTCCCCCTGCCTCCCACCCCTCCTCCCAACTTCAAGCCCTCTCCCCACTTCTCTGCACACCTGTCCCCTCCGCCTTCATGCCCCAAGCTCCCTGGAGCACTGGTCTCACTGGACCGCAGCTCCAGGTTTCCTCTGTGCTGGGCGCTGTTCCTGTCCGTGGCCAAGTGCAGGCCCGGGCCGGGTCAGAGCCCCAGGAGGAGGCGGGGAGCCAGGCTGCCCACAGGCGGGACCTGCGCCAGGACTCCACCTCCCCAAGAGCCACGCAGATGCCAGGGGGCAACAGTCACATGGCTGGATACCCTGGCTCTGTCTTTCCAGCCATGCCCGGCCTGAAGGCACAGCCCCTGTACATCCTCGTGGGGGTCTCTGCGGGCTTCATCGTCCTGCTGCTCCTGCTCCTCCTCTTCTGCCTCCATCGCCAGTGGCAGAAGAAACATGGGGCCCCCAGCAGCAGGGACCAGGAGCAGAGGCCACAGGAGAGGGCCAGCCTGGCTGTGGACAGCCCAGGGAGGGCAGCAGGTAAGGGGCCTGGGCAGAGGGTGGGAGGCCGGGAGCGTCAGGGGGTCTGGTCACATTCGCCCCCTGACATCCACCCAAGGCCTGACCTCATGTTTTCTCCTCCCCAGACTGGGCCACAGCTGACCAAACTCTTCAGCAGGGCGGAGAGCAGAGCACCTCTGACACGGGGCCCTCAGCGCCTCCCCTCCCTCCCCTGGGCCTCTCCGCAGACCCCGCTGCAGGGCCCCCAGGAAGTGATGTATGTTCAGCTGGACCATCGAGCCCTGGCACAGAGGGGGACCCAAGCAGTGTCCCCACCGTCCACGGCACCCCCTGAAGGGTCCAGTACATATGCCGTCCTCGCCAGACGCTGA

XM_004866710.1 Coding sequence

Mboat7 membrane bound O-acyltransferase domain containing 7, transcript variant X1

Length: 1425 bp    Location: 2407389..2417574   Strand: +
>XM_004866710.1
ATGTCACCCGAGGAGTGGACGTATCTGGTGGTTCTTCTCATCTCCATCCCCATCGGCTTCCTCTTTAAGAAAGCTGGACCTGGGCTGAAGAGATGGGGGGCGGCGGCGGTGGGCCTGGGGCTCACCGTGTTCACCTGCGGCCCCCACACTCTGCACTCCCTGATCACAATGCTGGGGACCTGGGCCCTCATTCAGGCCCAGCCCTGCTCCTGCCACGCCCTGGCTCTCGCCTGGACCTTCTCCTACCTCCTCTTCTTCCGAGCCCTCAGCCTGCTGGGCCTGCCGACTCCTACACCCTTCACCAATGCCGTCCAGCTGCTGTTGACACTGAAGCTGGTGAGTCTGGCCAGTGACGTCCAGGACCTGCACTTGGCCCAGCGGAAGGAAATGGCCTCCGGCTTCAGCAAGGCGCCCACCCTGGGGCTGCTGCCCCATGTTCCCTCCTTGATGGAGACGCTGAGCTATAGCTACTGCTACGTGGGAATCATGACAGGCCCATTCTTCCGCTACCGCACCTACCTGGATTGGCTGGAGCAGCCCTTCCCGGAGGCTCTGCCCAGCCTGAGGCCCCTGCTCTGCCGGGCCTGGCCGGCCCCGCTCTTCGGCCTGCTCTTCCTGCTGTCCTCCCACCTCTTCCCTTTGGAGGCCGTGCGTGAAGATGCCTTCTACGCCCGCCCGCTGCCTACCCGCCTCTTCTACATGATCCCCGTCTTCTTCGCCTTCCGCATGCGCTTCTACGTGGCCTGGATTGCTGCCGAGTGTGGCTGCATTGCTGCTGGCTTTGGGGCCTACCCTGTGGCCGCCAAGGCCCGGGCCGGGGGCGGCCCCACCCTCCAATGCCCACCCCCTAGCAGTCTGGAGAAGGCAGCTGCCCTGGAGTATGACTATGAGACGATCCGCAACATCGACTGCTACAACACAGACTTCTGCATGCGTGTGCGGGAGGGCATGCGGTACTGGAACATGACGGTGCAGTGGTGGCTGGCACAGTACATCTACAAGAGTGCACCTGCCAGCTCCTACGTCCTGAGGAGCGCCTGGACCATGTTGCTGAGCGCCTACTGGCACGGCCTGCACCCTGGCTACTATCTCAGCTTCCTGACCGTCCCGCTGTGCCTGGCTGCCGAGGGCTGTTTGGAGTCCGCCCTGTGGGGGCGGCTGAGCCCCAGGGGCCAGAAAGTGTGGTACTGGGTGCACTGGTTCCTGAAGATGCGCGCCTACGACTACATGTGCATGGGCTTTGTGCTCCTGTCCATGGGCAGCACGCTCCGGTACTGGGCCTCTGTCTACTTCTGCGTGCACATCCTGGCCGGGGCCTGCCTGGGGCTGGGGCTGGCTTTGGGTGGGGGCAGGCGCAGCCTGCGGAAGACTGCGTCCGAGTCCCAGGCCGCCAGCACGGCCCCAGAGAAGCTCCGGGAGGAGTGA

XM_004866722.1 Coding sequence

Leng1 leukocyte receptor cluster (LRC) member 1

High confidence: 4 potential gene matches
Length: 780 bp    Location: 2425306..2429851   Strand: +
>XM_004866722.1
ATGAACATCTTGCCCAAGAAGAGCTGGCACGTCCGGAACAAGGACAATGTTGCTCGCGTGCGCCGTGATGAGGCGCAGGCTCGGGAGGAGGAGAAGGAGCGTGAGCGGAAGGTGCTGCTCGCTGAGCAAGAGGCCCGCACAGAACTGCTCCGGAAGAAAGCCAGGCAGCAGAATCCACTGCCCGCGCTCCAGGCAGCAGAGGCGGGAGCTCCAGGTTCCGGTCCCGTGGACCTGTTTCGGGAGCTGCTGGAGGAAGGAAAAGGGGCGGCCGGAGGAAACAAAGAGTACGAGGAAGAGAAGCAGCAGGAGAAAGAGAGACAAGAGAAAGCCCTGGGCATCCTCACCTATCTGGGCCAGAGTGCAGCGGAGGCCCAGACGCAGCCACCCTGGTACCAGCTCCCCCCGAAGCGCGGGGCCCTCGAGCTGGGCCCAGGGCCAGATGAGAAGATGAAGAGTCGCCTGGACCCGTTGTGCGAGATGCAGAAGCATCTGGGGAGGAAGAGGAAGCACGGCCGAGAAGAAAGCAGCCTGGCCCGGAAGGGGAGGAAGGAGGGGCCCAAGGAGCCCCCATCACTGGACCGGCTCCGCGCTGAGCGTCTCCGGCGGGAAGCAGCAGAGCGGGCTCGGGCAGAGGCCCTGCTGGCCCGGGTCCAAGGCCGGGCACCCCAGGAGGACGACAAAGAGGAAGAGACAGATGATCGGCGCCGGCGGTACAACTCCCAGTTCAACCCCCAGCTGGCCCGGCGCCCCCGCTGGCAGGGTGCCCCTCTTTCGCAGTGA

XM_004866720.1 Coding sequence

Cnot3 CCR4-NOT transcription complex, subunit 3, transcript variant X1

High confidence: 4 potential gene matches
Length: 2241 bp    Location: 2441876..2429809   Strand: -
>XM_004866720.1
ATGGCGGACAAGCGCAAACTCCAAGGTGAGATTGATCGCTGCCTGAAGAAGGTGTCCGAGGGCGTGGAGCAGTTTGAGGACATTTGGCAGAAGCTCCACAATGCAGCCAATGCGAACCAGAAGGAGAAGTATGAGGCTGACCTGAAGAAGGAGATTAAGAAGCTACAAAGGCTGAGGGACCAGATCAAGACATGGGTCGCCTCCAATGAGATCAAGGACAAGCGGCAGCTCATAGACAACCGAAAACTCATCGAGACGCAAATGGAACGGTTCAAAGTTGTGGAGCGAGAGACCAAGACCAAAGCTTACAGCAAGGAGGGCCTGGGTCTGGCGCAGAAGGTGGACCCTGCCCAGAAGGAGAAGGAAGAGGTTGGCCAGTGGCTCACGAACACCATCGACACCCTAAACATGCAGGTGGACCAGTTTGAGAGCGAGGTGGAGTCTCTGTCAGTGCAGACACGCAAGAAGAAGGGTGACAAGGATCAGAAGCAGGACCGGATTGAGGGCCTGAAGCGTCACATCGAGAAGCACCGCTACCACGTGCGCATGCTGGAGACCATCCTGCGCATGCTGGACAACGACTCCATCCTCGTGGACGCCATCCGCAAGATCAAGGATGACGTCGAGTACTACGTCGACTCCTCTCAGGACCCTGACTTCGAGGAGAATGAGTTTCTCTACGATGACCTGGACCTCGAGGACATTCCACAGGCGCTGGTCGCCACCTCCCCCCCCAGCCACAGCCACATGGAGGACGAGATCTTCAATCAGTCCAGCAGCACGCCCACGTCCACCACCTCCAGCTCTCCCATCCCGCCCAGCCCAGCCAACTGCACCACGGAGAACTCTGAAGATGATAAGAAGAGGGGCCGCTCCACCGACAGTGAGGTCAGCCAGTCTCCAGCCAAAAATGGCTCCAAGCCTGTCCACAGCAGCCAGCACCCCCAGCCCCCAGCCGTGCCGCCTCCCTACCCCTCGGGGCCCCCACCTGCCACCTCTGCCTTGAGTGCTGCCCCTGGCAGCAATGGGGCCCCCACCCCGGCAGCACCGCCAAGTGCCCTGGGCCCCAAGGCCAGCCCAGCCCCCAGCACCCCTGCTCCCTACGCCCAGGCTGTGGCCCCGCCCACCCCCGGGCCCAGCCCCGCCCAGCCCCGGCCCCCCAGCGCCCAGCCTGGTGCCGCGAGTGGCAGCGCCGGAGGGGCGGGCGGCAGCAGTAACAGTGGTGCGGGCGGAGGGGCTGGCAAGCAGAACGGCGCCACCAGTTACAGCTCCGTCGTGGCAGACAGCCCCGCAGAGGTGGCCCTCAGCAGCAGCGGGGGCAGCAGCGCCAGCAGCCAGGCCCTGGGCCCCCCTTCAGGCCCGCACAACCCGCCTCCCAGCACTGCGAAGGAGCCTAGTGCAGCCGCCCCAACGGGGGCTGGGGGTGTGGCCCCCGGCTCAGGGAACAACTCTGGGGGCCCCAGCCTCCTGGTGCCGCTGCCCGTGAACCCCCCCAGCTCTCCCACGCCCAGCTTCAGTGAGGCCAAGGCGGCCGGTGCCCTGCTCAACGGGCCCCCGCAGTTCAGCAGCGCCCCCGAGATCAAGGCCCCCGAGCCCCTGAGCTCCCTGAAGTCCATGGCGGAGCGGGCAGCCATCAGCTCGGGCATCGAGGACCCTGTGCCCGCGTTACACCTGACCGAGCGAGACATCATCCTGAGCGGCACCTCGGCGCCCCCTGCCTCAGCCCAGCCAGCCCTGCAGCTGTCGGAGGTGAACATCCCGCTGTCGCTGGGTGTGTGCCCACTGGGGCCGGTGCCCCTCACCAAGGAGCAACTGTACCAGCAGGTCATGGAGGAGGCCGCCTGGCACCACATGCCCCACCCCTCCGACTCTGAGCGCATCCGGCAGTACCTCCCCCGGAACCCCTGCCCGACGCCCCCCTACCACCACCAGATGCCGCCCCCACACTCGGACACCGTGGAGTTCTACCAGCGCCTGTCCACCGAGACGCTCTTCTTCATCTTCTACTATCTGGAGGGCACCAAGGCGCAGTACTTGGCGGCCAAGGCCCTGAAGAAGCAGTCGTGGCGGTTCCACACCAAGTACATGATGTGGTTCCAGAGGCACGAGGAGCCCAAGACCATCACCGACGAGTTCGAGCAGGGCACCTACATCTACTTTGACTACGAGAAGTGGGGCCAGCGGAAGAAGGAGGGCTTCACCTTCGAGTACCGCTACCTGGAGGACCGGGACCTCCAGTGA

XM_004866735.1 Coding sequence

LOC101699320 leukocyte immunoglobulin-like receptor subfamily B member 4-like, transcript variant X5

Length: 1161 bp    Location: 2622227..2616204   Strand: -
>XM_004866735.1
ATGACCCCCAGCCTCACGGCGCTGCTCTGCCTGGGGCTGAGTCTGGGCCCCAGGACCCGAGGGCAGGCAGGGACCCTCCCCACCCCCAGGCTCTGGGCTGAGCCAGGACCTGTGATACCATGGGGGAAGCCTGTGACCCTCTGGTGTGAGGGGAGCCTGGAGGCCCAGGAGTACCATGTAGATTACGAGGGAATCCCAGTGCCCTGGGACAGACAGGCCCAACTGGAGCCCAGGAACAAGGCCAAGTTCTTCATAGGATCCATGACACAGCACTATGCAGGGCGATATCACTGTTACTATCGCAGCCCTGCTGGCTGGTCAGAGCGCAGTGAGCCCCTGGAGCTGGTGGTGACAGGAGCCTACAGCAAACCCAGCCTCTCAGCCCTGCCCAGCCCTGCAGTGACCTCAGGAGGGACCGTGACCCTCCAGTGTGGCTCATGGCTAAGATTTGGCAAGTTCCTTCTGACTCAGGAAGGAGAAGATGGGCTCTCCTGGACCCTGGACTCACAGCGAGGCCCCAGTGGGCAGTTCCAGGCCCTGTTCCCTGTGGGCCCTGTGACCGCTGGCCACAGGTGGATGTTCAGATGCTACGGCTATGACAGGAACAATCCCCAGGTGTGGTCGGAGCCCAGTGACACCCTGGAGCTCCTGGTCTCAGGACTGGGAAGGCACCTGAAGGTTCTGATCGGGGCCTCGGTGGCCTCCGTCCTGCTGCTGCTGCTGCTCCTCCTCCTCCTCGTCCTCCGACACTGGCGTCAGGGCGAAAGCAGGAAGGCGGATGCTGCCGTGAACGACTCACCGCCTGAGGACGGGGTGGAGCTGGACGCTTGGAGCCCACCTGATGAAGACCCCCAGGGAGCGGTATACGCCCAGGTGAAGCACGCAGCACCCAGGGGCAGAGGGGCCGCCCCTCCCGCGGCCCCGTCCGGGGAGCTCCTGGACACCAAGGATGGACAGGCAGGGGAGGACAGGCAGACGGACGCTCAGGCTGCAGCCCCTGAGGGTCCCCAGGACGTGACCTACGCCCAGCTGTGCAGCTGGACGCTCGGACGGGGCACAGCGGCGCCTCCTCCCTCCCGGCCCGGGGCCCTCCCAGCCGAGCCCAGTGTGTATGCTGCCCTGGCGTCCTCGCCCCGAGCCATCCCCAGGGACACTGAGTGA

XM_004866731.1 Coding sequence

LOC101699320 leukocyte immunoglobulin-like receptor subfamily B member 4-like, transcript variant X1

Length: 1494 bp    Location: 2622227..2616204   Strand: -
>XM_004866731.1
ATGACCCCCAGCCTCACGGCGCTGCTCTGCCTGGGGCTGAGTCTGGGCCCCAGGACCCGAGGGCAGGCAGGGACCCTCCCCACCCCCAGGCTCTGGGCTGAGCCAGGACCTGTGATACCATGGGGGAAGCCTGTGACCCTCTGGTGTGAGGGGAGCCTGGAGGCCCAGGAGTACCATGTAGATTACGAGGGAATCCCAGTGCCCTGGGACAGACAGGCCCAACTGGAGCCCAGGAACAAGGCCAAGTTCTTCATAGGATCCATGACACAGCACTATGCAGGGCGATATCACTGTTACTATCGCAGCCCTGCTGGCTGGTCAGAGCGCAGTGAGCCCCTGGAGCTGGTGGTGACAGGAGCCTACAGCAAACCCAGCCTCTCAGCCCTGCCCAGCCCTGCAGTGACCTCAGGAGGGACCGTGACCCTCCAGTGTGGCTCATGGCTAAGATTTGGCAAGTTCCTTCTGACTCAGGAAGGAGAAGATGGGCTCTCCTGGACCCTGGACTCACAGCGAGGCCCCAGTGGGCAGTTCCAGGCCCTGTTCCCTGTGGGCCCTGTGACCGCTGGCCACAGGTGGATGTTCAGATGCTACGGCTATGACAGGAACAATCCCCAGGTGTGGTCGGAGCCCAGTGACACCCTGGAGCTCCTGGTCTCAGGACTGGGAAGGCACCTGAAGGTTCTGATCGGGGCCTCGGTGGCCTCCGTCCTGCTGCTGCTGCTGCTCCTCCTCCTCCTCGTCCTCCGACACTGGCGTCAGGGCGAAAGCAGGAAGGCGGGTGAGTGGGGACAGCCCAGAGAGAGGCTGACTTCCCACGGCCTGTGGGGGCCACGGGCCCAGTGCCCCAGCACGGAGGCCTGCAGAACAGCTCCGGCCCAGCCGCCACCACCCAGGAAGAAAACCTCTGTGAGAGGGAGAGGGGCAGGGTGGGGGGTACCCCGAGCTCTCAGCATCCCAGGGGCTGGGAGTCAGACTGAGCCTCCACACAGCCTGGGGACCTCAGCACGGCTCCCTGGATCTGTGTCCCCAGCTGGGCCGGGGCTGGGGCCTGCGGGGCCGAGAGACCCCAGGGACTCTGGGCAGGAGGGGACCCCTTGTTCTGTCCCTGCAGATGCTGCCGTGAACGACTCACCGCCTGAGGACGGGGTGGAGCTGGACGCTTGGAGCCCACCTGATGAAGACCCCCAGGGAGCGGTATACGCCCAGGTGAAGCACGCAGCACCCAGGGGCAGAGGGGCCGCCCCTCCCGCGGCCCCGTCCGGGGAGCTCCTGGACACCAAGGATGGACAGGCAGGGGAGGACAGGCAGACGGACGCTCAGGCTGCAGCCCCTGAGGGTCCCCAGGACGTGACCTACGCCCAGCTGTGCAGCTGGACGCTCGGACGGGGCACAGCGGCGCCTCCTCCCTCCCGGCCCGGGGCCCTCCCAGCCGAGCCCAGTGTGTATGCTGCCCTGGCGTCCTCGCCCCGAGCCATCCCCAGGGACACTGAGTGA

XM_004866737.1 Coding sequence

Znf160 zinc finger protein 160, transcript variant X1

Length: 1767 bp    Location: 2767920..2795974   Strand: +
>XM_004866737.1
ATGCTACCTACGGAAGGAGCTTGGAGGAGGAGGAAACAGGAAGAAAAGGAGTCAGGAATGGCTCTTAGTCAGGAACACTTGACATTCAGGGATGTGGCAATAGAGTTCTCTCAGGAGGAGTGGAAATGCCTGAACCCTGCTCAGAGGACTTTATACAGGGATGTGATGTTGGAGAACTACAGGAACCTGGTCTCCCTGGGAATGTTTCTTCCTAACCTGAGTGTTATTTCCACATTGGAGCAAGGGAGAGAGCCCTGTACTATGGAAAATGAAATGAAAATAGCAAGAAATTCAAATGTGTGGGAATGTAGCAAAGGACTGAATACAGATACCTCTCCTAAATGTATAATTAAGGGATCATCACCAAAAGGGAAGAAAAGTACAGGAGAAATATTCAAAAGAGTGATGTTGGAAAGACATGAGAGGAGTGACATTAAAGGCTTTTCATTTAGGGATGTTCAAAAAAATATACATGGCTTTGAATTTCAGTGGAAAGATGATGAAAGAAATTACAATGGACTGCTTGTGGCCCAGAAAAAAAGTCTCACTGGTAGAAGAGATCAAGGTGGTAAAAGGGATGCAGGAAACAAGCTTATGAAAAATTGGCTTGGATTAAGCTTTCAGTCACATTTGCCTGAACTGCAAACACTTCAATCTGAAGGGAAAATTGATAGTAATGAGGTTGATAAGTCTATCAACAGTGGTTCCTCAGTTTTACCACCTCACAGAAATCCTTCTACTGTCAAAACACATATATCTCAGGTATATGGAAATAACTTTATTTATTCTTCATTACTCATACAAAGACAAAAAGCTCATGTTAGGGAAAAACCTTACAAATGTAATGAGTGTGGCAAAGTCTTCAGTTACACCTCATCTCTAGCACATCATCGGAGAATACATACAGGAGAGAAACTGTACAAATGTATCGAATGTGGTAAGGCATTTTTCAGACGTTCATACCTTTTGGTACATGAGAGACATCACACTGGAGCAAAACCTTACAAATGTAATGAATGTGGAAAAGTCTTCACTCAAAATTCACACCTTACAAGTCATCGGAGAATTCATACCGGGGAGAAGCCTTACAAATGTAATGAATGTGGCAAAGCCTTCAGTGTTCGTTCAAACCTCACTAATCATCACGTTATCCATACTGGAGAAAAACCTTATAAGTGTAATGAATGTGGCAAGGTCTTCAGTCAGACTTCAAGCCTTGCAATTCACCGGAGAACTCACACTGGAGAGAAACCTTATAGGTGTAATGAATGTGGCAAGGTCTTCAGTTCTCATTCAAATCTAAACACCCACCAGGTAATTCATACTGGAGAAAAACCCTATAAATGTTCTGAGTGTGGCAAGGTCTTCACTCAAAATTCACATCTTGCAAATCACTGGAGAATCCACACTGGAGAGAAACCTTACAAGTGTCATGAGTGTGGCAAAGCCTTTAGTGTGTATTCAAGCCTGACCACCCATCAGGCAATCCATACTGGAGAGAAACCCTACAAATGTGATGAGTGTGGCAAGGTCTTCACCCAAAACTCACACCTTGCGAGTCACCGGAGGACTCATACAGGAGAGAAACCATACAAGTGTGATAAGTGTGGCAAGGCCTTTAGTGTGCGTTCAAGCCTGACCACCCACCAGGCAATTCATACTGGAGAAAAACCTTACACGTGTAAAGACTGTGGCAAGGTCTTTAGTCGAAGTTCTAACCTTGTAAGTCACCGGAGAATTCATGCTGGGCAGAAACCTTACACGTGA

XM_004866738.1 Coding sequence

Znf160 zinc finger protein 160, transcript variant X2

Length: 1566 bp    Location: 2770965..2795974   Strand: +
>XM_004866738.1
ATGTTTCTTCCTAACCTGAGTGTTATTTCCACATTGGAGCAAGGGAGAGAGCCCTGTACTATGGAAAATGAAATGAAAATAGCAAGAAATTCAAATGTGTGGGAATGTAGCAAAGGACTGAATACAGATACCTCTCCTAAATGTATAATTAAGGGATCATCACCAAAAGGGAAGAAAAGTACAGGAGAAATATTCAAAAGAGTGATGTTGGAAAGACATGAGAGGAGTGACATTAAAGGCTTTTCATTTAGGGATGTTCAAAAAAATATACATGGCTTTGAATTTCAGTGGAAAGATGATGAAAGAAATTACAATGGACTGCTTGTGGCCCAGAAAAAAAGTCTCACTGGTAGAAGAGATCAAGGTGGTAAAAGGGATGCAGGAAACAAGCTTATGAAAAATTGGCTTGGATTAAGCTTTCAGTCACATTTGCCTGAACTGCAAACACTTCAATCTGAAGGGAAAATTGATAGTAATGAGGTTGATAAGTCTATCAACAGTGGTTCCTCAGTTTTACCACCTCACAGAAATCCTTCTACTGTCAAAACACATATATCTCAGGTATATGGAAATAACTTTATTTATTCTTCATTACTCATACAAAGACAAAAAGCTCATGTTAGGGAAAAACCTTACAAATGTAATGAGTGTGGCAAAGTCTTCAGTTACACCTCATCTCTAGCACATCATCGGAGAATACATACAGGAGAGAAACTGTACAAATGTATCGAATGTGGTAAGGCATTTTTCAGACGTTCATACCTTTTGGTACATGAGAGACATCACACTGGAGCAAAACCTTACAAATGTAATGAATGTGGAAAAGTCTTCACTCAAAATTCACACCTTACAAGTCATCGGAGAATTCATACCGGGGAGAAGCCTTACAAATGTAATGAATGTGGCAAAGCCTTCAGTGTTCGTTCAAACCTCACTAATCATCACGTTATCCATACTGGAGAAAAACCTTATAAGTGTAATGAATGTGGCAAGGTCTTCAGTCAGACTTCAAGCCTTGCAATTCACCGGAGAACTCACACTGGAGAGAAACCTTATAGGTGTAATGAATGTGGCAAGGTCTTCAGTTCTCATTCAAATCTAAACACCCACCAGGTAATTCATACTGGAGAAAAACCCTATAAATGTTCTGAGTGTGGCAAGGTCTTCACTCAAAATTCACATCTTGCAAATCACTGGAGAATCCACACTGGAGAGAAACCTTACAAGTGTCATGAGTGTGGCAAAGCCTTTAGTGTGTATTCAAGCCTGACCACCCATCAGGCAATCCATACTGGAGAGAAACCCTACAAATGTGATGAGTGTGGCAAGGTCTTCACCCAAAACTCACACCTTGCGAGTCACCGGAGGACTCATACAGGAGAGAAACCATACAAGTGTGATAAGTGTGGCAAGGCCTTTAGTGTGCGTTCAAGCCTGACCACCCACCAGGCAATTCATACTGGAGAAAAACCTTACACGTGTAAAGACTGTGGCAAGGTCTTTAGTCGAAGTTCTAACCTTGTAAGTCACCGGAGAATTCATGCTGGGCAGAAACCTTACACGTGA

XM_004867180.1 Coding sequence

LOC101696487 vomeronasal type-1 receptor 3-like

Length: 600 bp    Location: 2966253..2967288   Strand: +
>XM_004867180.1
ATGAGCCATGTTACTCAGAGGAGTGACTGTCATCACAATTTAAATGAAACTTTCAAAGGAAATGACAAAATGTGTTCTAAAGATCTGGCAGTAGGAATAATCTTCTTGTCTCAGACGATCACAAGTGTCCTTGGAAATATCTTCCTTCTTTACCATTATAGTTTCCTTTCCCACAAGGGCAACAGTACAAGGTCTACAGGTGTGATTCTGAAACACCTGTTTGTAGACAACCTCTTGGTTCTTCTTTCTACAGGAGTTCCTCACACAATCGTAGCCTTTGGGTTGAAACAATTCTTCAGTGATTTTGTGTGCAAATTGATCTCCTATGACAACAGAGTGGGCAGGATTGTGTCAATTGGTACCATCTGCATCTTGTGTGTTTTTCAGAACATCATGCTCAGCCCCATGAACTCCTATTGGAAAGATGTTAAAGGTAAAGCCCAAAAGTACATAGGCTTGTCCATTACCTTCTTCTGGATCCTAAACATGGTGGTCAATTTAATTATTCTTCTGTACACATTGTATTTGTCTACAGAAGGTTACAGCAGAAATATCAAGAAAATATATGCAGGATACTGTTGTCACCATGACTTGGGGTAG

XM_004867182.1 Coding sequence

LOC101697598 vomeronasal type-1 receptor 4-like

Length: 972 bp    Location: 3058444..3054186   Strand: -
>XM_004867182.1
ATGAATAAGACAATGTCTTCCATGGATATGGCAATAGGAATAATGCTCTTATCACAGACTACAGTTGGAATTCTTGGTAATTTCTCTCTTCTTTACTATTATCTAGTCCTTTACTATCAAGGGTGCATATTAAGGCCCACAGATTTGATTCTCAAGCACCTGTTTATAGCTAACACCTTTGTCATTCTCTCTCAGGGAGTTCCCCATACAATGTCAGCTTTTGGGTTGAAACATTCCTTCAGTGACTTTGGCTGTAAAGTCATTTTGTATATTCAGAGGGTGGGCAGAGGTGTGTCAGTTGGTACCACCTGCCTCTTGAGTGTCTTCCAGACCATCATGATCAGCCCCATGAACTCCTGTTGGAAAGATCTTAAGGTGAAAGTCCCAAGGTACATTGAATCCTCCATTTCCTTATGCTGGGTCCTGTATGTGGTGATAAGTTTAATTTTTCCTGTGTATATATATGCCAAATGGAATAGCAAAAATATAACAAAGGACAAATATTTTGGATTCTGTTCTACTGCAGGTAGTGACAAAATCACTTACTCAATATATACAGTATTATTTGTATTCCCTGAAGTTTTATTTTCTGTGCTCATAATCTGGGGGAGTGGTTCCATAATTTTCTTTCTCTATAGGCACAAGCAGCAGGTTCAATACATTCGCAGCACTATGGTTTCCCTCAGATCCTCCCCCGAGTCTAGAGCTACACAAAACATCTTTGTCCTGGTGTGCACATTTGTGATTTTTTACACTCTCTCCTCCCTATTATATATTTATGTTGCTTTCACGTATAATCCCAGTGTGTGGGTGATGAACATCAGTGCTCTCCTTTCTGTGTCCTTTCCCACGGTCAGCCCCTTTGTTGTCATGAACCGAGACCCCACTGTACCTAGGCTATGCTTCATCTGGATAAGAAATACAAAGAGTTGTAATGTAACTGGGAGAAAGCCTGGTTCATGTAATAGTTAA

XM_004867147.1 Coding sequence

Vasp vasodilator-stimulated phosphoprotein, transcript variant X2

High confidence: 4 potential gene matches
Length: 1254 bp    Location: 7629327..7619211   Strand: -
>XM_004867147.1
ATGATCAAGAGCTGTGACAGTGGACAAGTCCCTCCGCATCTCTGGGCCTCTGTTGCAGTCCCCACTTGCAAAAGGAGCTTTAAAAATGGTCCATCTCGAAGGGTTGCAGTGGGAACGAACGAGTCGGTTGTCTGTTCCAGCCGGGCCACTGTGATGCTTTATGATGACAGCAACAAGCGATGGCTCCCCGCAGGCACGGGTCCCCAGGCCTTCAGCCGCGTCCAGATCTACCACAATCCCACAGCCAATTCCTTCCGGGTCGTGGGCCGGAAGATGCAGCCGGATCAGCAGGTGGTCATCAACTGTGCCATCGTCCGGGGTGTCAAGTACAACCAGGCCACCCCCAACTTCCATCAGTGGCGAGATGCCCGCCAGGTCTGGGGCCTCAACTTTGGCAGCAAGGAGGACGCAGCGCAGTTTGCTGCCGGCATGGCCAGTGCCCTAGAGGCCTTGGAAGGAGGGGTGCCTCCTGGGCCTCCCACGCCCTCTACCTGGTCAGCCCAAAATGGTCCCTCTCCAGAGGAGCTGGAGCAACAGAAAAGGCAGCAGCTGGGCCAGCCAGAGCACACGGAGCGTGAGCGCCGAGTCTCCAATGCAGGAGGCCCTCCTGCTGCCCCAGCTGGGGTGCCACCCCCGCCTCCGGGACCTCCCCCTCCTCCAGGCCCCCCCCCACCTCCAGGCCTACCCCCTTCAGGGGTCCCAGCTGGACATGGAGCAGGGGGAGGCCCACCCCCTGCACCCCCTCTCCCTGCAGCACAGGGCCCCAGTGGTGGGGGTGCTGGGGCCCCCGGCCTGGCCGCAGCAATCGCTGGAGCCAAACTCAGGAAAGTCAGCAAGCAAGAGGAGGCCTCAGGGGGGCCCATGGTCCCCAAAGCTGAGAGCAGTCGAAGCACAGGTGGGCTCATGGAGGAGATGAACGCCATGCTGGCCCGGAGAAGGAAAGCTTCGCAAGTTGGAGAGAAACCCCCCAAGGATGAATCTGCCAGTGAGGAGCCAGAGGCCAGAGTCCCAGCCCAGAGTGAACCTGTACGGAGACCCTGGGAGAAGAACAGCACAACCTTGCCAAGGATAAAGTCATTGTCTTCAGTGGCTGCTTCTGAGCCTCACTCCTCCACACCCAGCTCTGCCAATGAGTCAGACCTGGATAGCGTGAAGCAGGAGCTTCTGGAAGAAGTGAGGAAGGAACTGCAGAAAGTCAAAGAGGAGATAATTGAAGCCTTTGTCCAGGAGCTGAGGAAGCGGGGTTCCCCCTGA

XM_004867110.1 Coding sequence

Ppp5c protein phosphatase 5, catalytic subunit, transcript variant X2

High confidence: 4 potential gene matches
Length: 1500 bp    Location: 7126272..7100309   Strand: -
>XM_004867110.1
ATGGCGATGGCGGAGGGCGAGCGGACTGAGTGTGCTGAGCCCCCTCGGGACGAGCCTCCGGCTGATGGCGCTCTGAAACGGGCAGAGGAGCTCAAGACACAGGCCAACGACTACTTCAAAGCCAAGGACTACGAGAATGCCATCAAGTTCTACAGCCAGGCCATCGAGCTAAACCCTAGCAATGCCATCTACTACGGCAACCGCAGCCTGGCCTACCTGCGCACCGAGTGCTACGGCTATGCCCTGGCCGACGCCACGCGGGCCATCGAGATCGACAAGAAGTACATCAAGGGCTATTACCGCCGGGCTGCCAGCAACATGGCACTGGGCAAGTTCCGGGCCGCCCTGCGTGACTACGAGACGGTGGTAAAGGTGAAGCCCCATGACAAAGATGCCAAAATGAAATACCAGGAGTGCAACAAGATCGTGAAGCAGAAGGCCTTCGAGCGTGCCATTGCGGGTGACGAGCACAAACGCTCTGTCGTGGACTCGCTCGACATTGAGAGCATGACCATCGAGGATGAGTACAGCGGGCCCAAGCTCGAGGACGGCAAAGTGACAATCACCTTCATGAAGGAGCTCATGCAGTGGTACAAGGAACAGAAGAAACTGCACCGGAAATGCGCCTACCAGATCCTGGTGCAGGTCAAGGAGGTCCTGTCCAAGCTGAGCACACTCGTGGAGACCACGCTCAAAGAGACAGAGAAGATTACAGTGTGCGGGGACACCCACGGCCAGTTCTATGACCTCCTCAACATATTTGAGCTCAACGGTTTACCCTCAGAGACCAACCCCTACATATTTAATGGCGACTTCGTGGACCGAGGCTCCTTTTCCGTTGAAGTGATCCTCACCCTTTTCGGCTTTAAGCTCCTGTACCCAGATCACTTTCACCTACTTCGAGGCAACCATGAGACTGACAACATGAACCAGATCTATGGCTTTGAGGGTGAGGTGAAGGCCAAGTACACAGCCCAGATGTATGAGCTCTTCAGCGAGGTGTTTGAGTGGCTCCCGCTGGCCCAGTGCATCAATGGCAAAGTGCTGATCATGCACGGAGGCCTGTTCAGTGAAGACGGTGTCACCCTGGATGACATCCGGAAGATCGAGCGGAATCGGCAGCCCCCAGACTCGGGCCCCATGTGTGACCTGCTGTGGTCGGATCCGCAGCCCCAGAACGGGCGCTCGGTCAGCAAGCGGGGCGTGAGCTGTCAGTTTGGGCCGGATATCACCGCGGCCTTCCTGGAGGAGAACCACCTGGACTACATCATCCGCAGCCACGAGGTCAAGGCCGAGGGCTATGAGGTTGCCCATGGCGGCCGCTGCGTCACTGTCTTTTCTGCCCCCAACTACTGCGACCAGATGGGGAACAAGGCCTCTTACATCCACCTCCGGGGCTCCGACCTGCGGCCCCAGTTCCACCAGTTCACAGCAGTGCCTCATCCCAACGTGAAGCCCATGGCCTACGCCAACACGCTGCTGCAGCTAGGAATGATGTGA

XM_004867065.1 Coding sequence

Ccdc9 coiled-coil domain containing 9

High confidence: 4 potential gene matches
Length: 1782 bp    Location: 6451478..6441788   Strand: -
>XM_004867065.1
ATGGCAGCCACATTGGATTTGAAATCAAAGGAAGAGAAGGATGCTGAGCTGGACAAGAGGATCGAGGCTCTCCGGCGGAAGAATGAAGCCCTCATCCGGCGCTACCAGGAAATCGAGGAGGACCGTAAAAAAGCCGAACTTGAAGGAGTAGCGGTGACAGCGCCCCGGAAGGGCCGAACGGTGGAGAAGGAGAATGTGGCGGTAGAGGAGAAGAGCCTGGGACCCTCACGGAGGTCTCCCGGGACCCTGCAGCCCCCAGGGGCCAGCAGAGGGGGGCGGGCTGCCCCACAGCAGGGAGTCCGGCCAGGCGTGGGCCGGGCATCACGAAGCTGGGAGGACAGTCCTGGGCAGCAGCCTCAAGGAGGAGCTGGTGGCTGGGGCCGGAGGGGCCGAGGCCGAAAGTCCCCTCATCTCTTGGGAGCTGGTGACAGCTCAGCTTCTGACCGCAAATCCAAGGAGTGGGAGGAGCGGCGAAGACAGAACATTGAGAAGATGAACGAGGAGATGGAGAAGATTGCAGAGTACGAACGCAACCAGCGGGAAGGGGTACTGGAGCCTAACCCAGTGAGGAACTTCCTGGATGACCCCCGGCGCCGCAGTGGACCCCTGGAGGAGCCTGAGCGGGACCGCCGGGAGGGCAGCCGCCGGCACGGGCGCAACTGGGGGGGCCCCGACTTCGAGCGGGTGCGCTGTGGCCTTGAGCACGAGCGGCAGGGCCGCCGTGCCAGTCCGGGTAGTGCTGGTGACATGACAATGTCCATGACGGGCCGGGAGCGGTCGGAGTACCTGCGCTGGAAGCAGGAGAGGGAGAAGATTGACCAGGAACGGCTGCAGCGACACCGCAAGCCCACTGGCCAGTGGCGACGCGAGTGGGATGCGGAGAAGACCGAGGTCATGTTCAAGGATGGCCCAGCCCCTGCCCACGAAGCATCCCATCGCTATGATGACCAGGCCTGGGCCCGGCCCCCCAAGCCTCCCACTTTTGGGGAGTTCCTGTCGAAGCACAAAGCTGAGGTCAGCAACCGACGGCGAAGAAAGAACAGCAGACCTCAGCCCAAGGCAGCCCCCCGGGCCTACAGTGACCATGATGACCGCTGGGAGATGAAAGAGGAGGCAGTGTCCCCAGCCCCCGAGGCCACACAGCTTGAGGAGAGGCCAGCACAGCCTCCAGAGACCCTGGCCTCTGCCCACCGGCCTCCTGAGGATGAGGGGGAGGATGACGAAGAGTGGGAGGATGTGAGTGAGGAGGTGACTGAGGAGGAGGAAGATGAGGAGGAAGAGGAAGAAGGGGAGGAGCAGCCCCAGGAGCAGCCGCAGGATCAGGAGCAACAGCAGCAGGAGCAGCAGCAGCAGCACATCAAAGAGGAAGAAGAAGGTGCCCAGAAACAGGAGGAAGAACTACCCCAAGAGCACCAAATGCATGAGGCTATGCCCACTGGGAGGCCCCCTAGCGAGCAGGCTGAAGAAGCGCCCAGACCTGAGGAGCCGCTGCCCCAGGGCCCTGCCACGCCCACCAGCCCCTTCTCGCTACCCGGTGGCCACCGGCCTGTGTCTGACTGGGGAGGTGACCAGCCAGCCCCTGCCTCCCCGGAGAGTAGGCCAGGCCTCCCAGGAACCCAGAGAGAAGAAGAGGAGGGGTCTGAGGCGATTCCAGGTGGGGTTCGTCTTCTCTCTGCAGAGGCGGGTCCCGAGGGCCAGGAGATGGCAGAGATCACCGACTTCCAGAGGGTGCGTTTCTGCAAGGTGGTGGCGGCCGCCCCGCCCCCGGGGGCCGCCCGCTGA

XM_004866826.1 Coding sequence

Nr1h2 nuclear receptor subfamily 1, group H, member 2, transcript variant X1

Length: 1530 bp    Location: 4141673..4136052   Strand: -
>XM_004866826.1
ATGTCCCAGGCACCAATGGGGCCAGCTCGGCCTGCATCGTGGGTGAGACGGGGTCCAGGGTCCGGGATAGGGAGCTGGCTCGGAGCTGGGAGGGGTATAGGCAGGGAGAAAGATAAGAAACATGTCCTTCCATTTGTCCTGGAGGCCTCCCGCTTCGAGTCATTCTCTTCGGCCACTGACTTGTGCGTCTTCCCCTCAGACTTGCTGGCCCTGGCTGTACGCATCTCCTCCTGTCACGCTGTGTCCTCTGGCTCTGCCTTGGGACGGCTCGTGGACCTGCGCCCTGGCTGCTGTCTCTTTGTGGCTCTTTCTCACGGTCTTTGTCTGCCCATCCCAGTCATCCTAGAACCAGATGAGGAGCCCGAGCCAGAGCGCAAGCGAAAGAAGGGCCCAGCTCCAAAGATGCTGGGCCACGAGCTCTGCCGCGTGTGTGGGGACAAGGCCTCTGGCTTCCACTACAATGTGCTGAGCTGCGAAGGCTGCAAAGGCTTCTTTCGGCGCAGCGTGGTCCATGGTGGAGCAGGGCGCTACGTCTGCCGGGGCGGTGGAACCTGCCAAATGGATGCCTTCATGCGGCGCAAGTGCCAGCAGTGCCGGCTGCGCAAGTGCAAGGAGGCGGGGATGAGGGAGCAGTGTGTCCTCTCGGAAGAACAGATCCGGAAGAAGAAGATTCAGAAGCAGCAGCAGCAGCAGTCACCTGTGGAGCCAAAGGGCAGTGGCAGCTCAGCCTGCGGGCCTGGGGCGTCCCTGGGAGGGTCCGAGCTGGGTGGCCAGGGCCCCGGCGAAGGCGAAGGTGTCCAGTTAACAGCAGCCCAGGAGCTCATGATCCAGCAGTTGGTGGCAGCCCAGCTGCAGTGCAACAAACGCTCCTTCTCTGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGTGCAGACCCGCAGTCCCGTGATGCCCGCCAGCAGCGCTTCGCCCACTTCACGGAGCTGGCCATCATCTCGGTCCAGGAGATCGTGGACTTTGCCAAACAGGTGCCTGGCTTCCTGCAGCTGGGCCGCGAGGACCAGATCGCCCTCCTGAAGGCGTCCACCATCGAGATCATGCTCCTGGAGACAGCCCGGCGCTACAACCATGAGACAGAGTGCATCACCTTTCTGAAGGACTTCACCTACAGCAAGGATGACTTCCACCGCGCAGGCCTGCAGGTGGAGTTCATCAACCCCATCTTCGAGTTCTCAAGAGCCATGCGGCGGCTGGGCCTAGACGACGCTGAGTACGCCCTGCTTATTGCTATCAACATCTTCTCTGCTGACCGCCCCAACGTGCAGGAGCCCAGCCGCGTGGAGGCGCTACAGCAGCCCTATGTGGAGGCGCTGCTGTCCTACACGCGCATCAAGAGGCCGCAGGACCAGCTCCGCTTCCCTCGAATGCTGATGAAGCTTGTGAGCCTGCGAACGCTCAGCTCTGTGCACTCAGAGCAGGTCTTCGCCCTGCGGCTGCAGGACAAGAAGCTGCCGCCTCTGCTCTCAGAGATCTGGGACGTCCACGAGTAG

XM_004867008.1 Coding sequence

Kcnj14 potassium inwardly-rectifying channel, subfamily J, member 14

High confidence: 4 potential gene matches
Length: 1305 bp    Location: 5349071..5346245   Strand: -
>XM_004867008.1
ATGGGCCTGGCCAGGGCCCTGCGCCGCCTGAGCGGCGCCCTGGAGCCAGGGGACAGCCGGGCGGGCGGCGAGGAGGAGGCGGGGCCGGGGCTGTGCCGCAACGGGTGGGCGCCTGCACAGGGCCCGGGCACGCGGCGGTGCGGGCGCCTCGTGAAGAAGGACGGGCACTGCAACGTGCGCTTCGTGAATCTGGGCGGTCAGGGCGCGCGCTACCTCAGCGACCTGTTCACCACGTGCGTGGACGTGCGCTGGCGCTGGATGTGCCTGCTCTTTTCCTGCTCCTTCCTCGCCTCCTGGCTGCTCTTCGGCCTGGCCTTCTGGCTCATCGCCTCGCTGCACGGCGACCTGGCCGCGCCACCGCCGCCCGCGCCCTGCTTTTCGCACGTGGCCAGCTTCCTGGCCGCCTTCCTCTTCGCGCTCGAGACGCAGACGTCCATCGGCTATGGCGTGCGCAGCGTCACCGAGGAGTGTCCAGCCGCCGTGGCCGCCGTCGTGCTGCAGTGCATCGCGGGCTGCGTGCTCGACGCCTTCGTCGTGGGTGCTGTCATGGCCAAGATGGCCAAGCCCAAGAAGCGCAACGAGACCCTGGTCTTCAGCGAGAACGCCGTGGTGGCGCTGCGCGACCGCCGCCTCTGCCTCATGTGGCGCGTGGGCAACCTGCGGCGCAGCCACCTGGTGGAGGCCCACGTGCGGGCCCAGCTGCTGCAGCCCCGTGTGACCCCAGAGGGTGAGTACATCCCGCTGGACCACCAGGATGTGGATGTGGGCTTCGATGGAGGCACCGATCGAATCTTCCTTGTGTCTCCCATCACCATCGTGCATAAGATCGACTCTGCCAGTCCTCTGTATGAGCTGGGACGTGCTGAGTTGGCCAGGGCCGACTTTGAGCTTGTGGTCATTCTTGAAGGCATGGTTGAGGCCACGGCCATGACCACACAGTGTCGCTCATCTTACCTCCCTGGAGAGCTGCTCTGGGGCCACCGTTTTGAGCCAGTCCTCTTCCAGCATGGCTCCCAGTATGAGGTGGACTATCGCCACTTCCATCGCACTTACGAGGTCCCAGGGACACCTGTGTGCAGTGCCAAGGAGCTGGATGAACGGGCAGAGCAGGCTGCCCACAGCCCCAAGTCCAGCTTCCCTGGCTCCCTGGCTGCATTTTGTTACGAGAATGAGCTTGCTCTGACCTGCTGCCAGGAGGAAGATGAGGAAGAGGAGACCAAAGAGGGGACTGGGGCAGAGACAGAAGATGGAGCTGCCAGCCCCCAAGTCCTCACACCAACCCTGGCTCTGAGCCTGCTCCCGTGA

XM_004867042.1 Coding sequence

Ehd2 EH-domain containing 2

High confidence: 4 potential gene matches
Length: 1632 bp    Location: 6168628..6156051   Strand: -
>XM_004867042.1
ATGTTCAGCTGGCTGAAGCGGGGCGGGGCGCGGGGCCAGCAGCCCGAGGCCATCCGCACGGTGACCTCGGCACTCAAGGAGCTGTACCGCGGCAAGCTGCTGCCACTGGAGGAGCACTACCGCTTTGGCGCCTTCCACTCGCCAGCCCTGGAGGACGCAGACTTCGACGGCAAGCCCATGGTGCTGGTGGCCGGCCAGTACAGCACCGGCAAGACCAGCTTCATCCAGTACCTGCTGGAACAGGAGGTGCCCGGCTCCCGCGTGGGGCCCGAGCCCACCACCGACTGCTTCGTGGCCGTCATGCACGGTGACACCGAGGGCACCGTGCCCGGCAACGCTCTGGTTGTGGACCCAGACAAACCCTTCCGAAAGCTCAACCCCTTCGGGAACACCTTCCTCAACAGGTTCATGTGCGCCCAGCTCCCCAACCAGGTCCTGGAGAGCATCAGCATCATCGACACCCCCGGCATCCTGTCGGGCGCCAAGCAGAGAGTGAGCCGGGGCTATGACTTCCCGGCAGTGCTGCGCTGGTTCTCGGAGCGCGTGGACCTCATCATCCTGCTCTTCGACGCGCACAAGCTGGAGATCTCCGATGAGTTCTCCGAGGCCATCGGCGCCCTGCGAGGCTACGAGGACAAGATCCGCGTGGTGCTCAACAAGGCCGACATGGTGGAGACACAGCAGCTGATGCGCGTGTACGGCGCCCTCATGTGGGCTCTGGGCAAGGTGGTGGGCACGCCCGAGGTCCTGCGCGTCTACATCGGCTCCTTCTGGTCGCAGCCCCTCCTCGTGCCCGACAACCGGCGCCTCTTCGAGCTGGAGGAGCAGGACCTGTTTCGTGACATCCAGGGCCTGCCTCGCCACGCCGCGCTGCGCAAGCTCAACGACCTGGTGAAGCGAGCCCGGCTGGCGAGGGTGCACGCCTATATCATCAGCTACCTGAAGAAGGAGATGCCCTCCGTGTTCGGGAAGGAGAACAAGAAGAAGCAGCTGATCCTCAAGCTGCCCGTCATCTTCGCCAAGATCCAGCTGGAGCACCACATCTCTCCAGGCGACTTTCCTGACTGCCAGAAGATGCAGGAGATGCTGATGGCCCATGACTTCACCAAGTTCCACTCGCTGAAGCCGAAGCTGCTGGAGGCGCTGGATGAGATGCTGACTCAGGACATTGCCAAGCTCATGCCCCTTCTTCGGCAGGAGGAGCTGGAGAGCACGGAGGTGGGGGTGCAGGGCGGCGCCTTCGAGGGCACCCACATGGGGCCCTTTGTGGAGCGGGGCCCCGATGAGGCGCTGGAGGATGGTGAGGAGGGCTCCGACGACGAGGCCGAGTGGGTGGTGACCAAGGACAAGTCCAAGTACGATGAGATCTTCTACAACCTGGTGCCGGCCGAGGGCAAGCTGAGCGGCTCCAAGGCCAAGAGCTGGATGGTGGGCACCAAGCTCCCCAACTCTGTGCTGGGGCGCATCTGGAAGCTGAGCGACGTGGACCGGGACGGCATGCTGGACGACGAGGAGTTCGCCCTGGCCAGCCACCTCATCGAGGCCAAGCTTGAGGGCCACGGGCTGCCCGCCAACCTGCCCCGCCGCCTCGTGCCACCCTCCAAGCGGCGCCAGAAAGGCTCTGCCGAGTGA

XM_004866983.1 Coding sequence

Izumo1 izumo sperm-egg fusion 1

High confidence: 4 potential gene matches
Length: 1053 bp    Location: 5171804..5176480   Strand: +
>XM_004866983.1
ATGGGCCTGCGTTTTGCCCTCCTGTTGGTGGCCCTGGCCTGCTGCCTGCTGCCTGCAAGGTGCTGTATCATATGTGACCCATCTGTGGTGGCAGCGCTAAAGTCCTTGGAGACAGATTACTTGCCTGGCCACCTGAGCACAAAGCATCACGCAGATGTGATGCAAACGGTGCAGCAGGGTGTGAAGGATTTCCAGAACCTGCAGTTCAAGGAGGAGTCCTACATGGGGGCTGTTGATGAGGACACACTGCAACAGGCATCCTGGAGTTTTCTGAAGGAATTGAAACGAATTACAGACAGTGATGTAAGAGGGGAGCTCTTCGTGAAGGAGCTGTTTTGGATGCTGCACCTACAGAAAGAGAACTTTGTCAAACTTGCTAAGCAGTTCCAAAATGAGGTTTATTGTCCTAACAAATGTGGCACGATGTTGCAGACTCTGATCTGGTGCAACAAGTGCAGGAAGGAGGTGCACACCTGTTTGAAGTCCTACGATTGCGGAAGTCGCAATGTGGAGGTCCATGAGATGGAAGACATGATCCTGGACTGTCATCTCAACTGGCACCAGGCCTCTCAAGGACTCACTGACTACAGCTTTTACAGGGTTTGGGGGAACAATTCTGAGACCTTGGAGTCCAAGGGAAAGGAGTCCCTCCTGACCAAGCCTTTGGTGGGGCCAGAGGATGCAGGCGACTACCGCTGTGAGTTGGGCACCGTGAGTTACGGCCCAGCCACGATCATCTATTTCCACGTCACAGTGTTGCCCAAAAGGCTGGAGGAGGAGCAGCAGTCATCAAACGTAACCTCAGAACTCCTGGAGTCCTTGCCTGAGACCCTCCAGCCTCCAAAGCCCGAGAATATCCTGAGACGCCGCCTCTTAGGGATGCTGATCTGTGGCTCTGTGGGCTCTATACTTCTGATAGCTGGCAGCTTGGCCACTGTGTTATTTCACAGGGGCAAGACGACCACGGCCAACCCGAAGTGCTCACCGGTCAATAGTGACAACGAAGCTGCTGCGCAACCAAAGGAAAAGGCCACAGATCTGGAGAGCCAATAA

XM_004866978.1 Coding sequence

Bcat2 branched chain amino-acid transaminase 2, mitochondrial

High confidence: 4 potential gene matches
Length: 1182 bp    Location: 5134590..5147092   Strand: +
>XM_004866978.1
ATGGCCGCAGTCGCACTGGGGCAGATATGGGCCCGAAAACTTCTCCCTGTCGCTTGGCTTCTGTGTGGTCCCAGAAGATGTGCTTCTTCCAACTTCAAGGCTGCAGACCTGCAAATGCAAATGACACAAGAGCCGAAAAAGAAGCCCAGCTCCAGTGAGCCCCTGGTGTTTGGGAAGATGTTTACTGACCACATGCTGATGGTGGAGTGGAATGGAGCAAAGGGCTGGGGCCAGCCCCGGATCCAGCCCTTCCAGAATCTCATGCTGCATCCGGCCTGCTCTGGTCTCCACTACTCCCTGCAGCTCTTTGAGGGCTTGAAGGCCTATAGAGGCAGGGACCAGCAGATTCGCCTCTTCCGACCCTGGCTCAACATGGACCGGATGCTGCGCTCGGCCCAGCGGCTCTGCCTGCCGACTTTTGACAAGGCCGAACTGCTGGAGTGTATCCGCCGCCTCGTGGAGGTGGAGAAGGACTGGGTTCCCAACGGGGCTGGCACCAGTCTCTACGTGCGGCCTGTGTTCATCGGGAATGAGCCCTCACTGGGTGTCGGTTGTGTCACACAAGCCCTCCTGTTCGTCATTCTCTGCCCCGTGGGCTCCTATTTCCCCGGAGACTCCATGGCCCCCGTCTCCCTGCTCGCAGACCCAACATTTATCCGAGCCTGGATGGGGGGTGTCGGTGACTACAAGCTGGGTGGGAATTATGGGCCCACTGTGTTAGTGCAACGGGAGGCTCAGAAGAAGGGCTGCGAGCAGGTGCTCTGGCTGTACGGGCCCGACCAGCAGCTCACTGAGGTTGGCACCATGAACATCTTCATCTACTGGACCTACGAGGATGGTGTACTGGAGTTGGTGACACCCCCGCTGGACGGGATAATCCTGCCTGGAGTCGTCAGACAGAGCCTGCTGGACCTGGCCCAGTCCTGGGGTGAGTTCCGGGTAGCGGAGCGCAAGATCACCATGAAGGAGTTGCTGCACGCGCTGGAGGAGCAGCGGGTACGGGAAATCTTTGGCTCTGGCACTGCTTGCCAGGTCTGCCCTGTGCACCGGATCCTGTACGAAGGCAAGAACATCCACATTCCCACCATGGAACATGGGCCTGAGCTTATCCTTCGCTTCCAGAAGGAGCTAAGGGGAATTCAGTACGGAACCAGCCCGCATGAGTGGATCCTCTCTGTCTGA

XM_004866939.1 Coding sequence

Ccdc155 coiled-coil domain containing 155

High confidence: 4 potential gene matches
Length: 1713 bp    Location: 4803244..4783609   Strand: -
>XM_004866939.1
ATGGACCTGCCAGAGAGCCAGGCTGGCGGCCCGGCTGCAGAAATTTACCACCGGGAGCAGCCGGAAGACATGAGCCTGGGGCCACTGCTCAGCTTAGAGGAGCAGATACTCAACTCCACGTTTGAAGCTTGTGACCCTCAGAGGACAGGCACTGTGGCTGTCACCCATGTGCTGGCCTACCTGGAGGCTGTGACTGGCCAGGGCCCCCAGGACGCACGCCTCCAGACATTGGCCCAAAGCCTGGACCCCAACGGGGAGGGCCCTGGGGCCACTGTGGACTTGGACACCTTCCTGGTGGTCATGCGTGAATGGATTGCTGCCTGTCAGCTGCATGGGGGATTAGAGCTGGGAGAGGAGACCGCCTTTGAGGGAGCCCTGACCTCCCCGCAGCTGCCATCTGGATGCCTGGAAGCTGAGGAGCCAGCCAACCTGGAGAGCTTTGGAGGCGAAGACCCCAGGCCCGAGCTGCCAGCCACCACTGATCTGCTGAGCAGCCTGGAGGACCTGGAGCTCAGCAACCGGCGCCTGGCCGGGGAGAACGCCAAGCTGCAGCGCTGTGTGGAGACAGCCGAGGAGGGGTCCGCACGGCTTGGGGAGGAGATCCTGGCCCTGCGCAGGCAGCTTCGAAGCACACAGCAGGCTCTGCAGTCTGCCAAGGCCGTGGATGAGGAGCTGGAGGACTTGAAGACTCTGGCCAAGAGCCTGGAGGAGCAGAATCAAAGCCTCCTGGCCCAGGCCCGGCAGACGGAAAAGGAGCAGCAGCACCTGGTGGCAGAGGTGGAGACCCTGCAGAAGGAGAATGGGAAGCTGCTTGCCGAGCGGGATGGAGTGAAGAGGAGAAGTGAGGAGCTGGCCACAGAGAAGGATGCTTTGAAGCGGCAGCTCTATGAGTGTGAACGCCTCATTTGCCAACGGGACGCTGTTCTCTCAGAGCACGCGCTCCACACGGAGAGCCTGGCCCAGACGGTGGAGGAGTACAGGGCCACCACACGGGAACTGAGGTGGGAAATCTCTCACCTGGAGGAGCAGCTGAGTCAGGCCCAGGAGGCACCGGAAGAGCTGCTGGAAGAGGCCCAGGCCAGAGGAGCCAGCTGGACCAGGCCACTGCCCCCATCGCTGGGCCTGGAGATCAAGGCCATTTGGCAGAAACAAGAAGTGGCAGGTGCCAAGCTCTCTAGTCCCCTGTGTGGAGTGTGGCAGTGGGGAGAGATCACCCGAGAGCCCAGTGAGGAAGCTGAGTTTCCATCTGAAGCCCCAGGTGGGGGACAGAGAAACTCCAAGGGAGAGCCGACGTGCCTTGAAGGATTGGGGAAAGAGCTGTCGATATGGTTGCCTGGAAGAGAGGAAGAGGAGGCAGAGGAGGAAGCGAAGAGCCAGCTCATGGCTGACCTGACCATCCTTCTGAGAGACCCTCACCCTGGAGACATCCCAGGACGCTCTCCTGAGAGTCCTGATGAGCTGGCACTCCAGCAAGCCTTGGTGCCCGTGGTGAAGGAGCTGGTCCAAGTCGGGCGGCCCTGGGGCCACCACTGCCTGTCCCTGTTATGTCCCCAGCCACCCAGGGCCGCTCAGCACCCACTGCTCCCTGCCCGGGTCCTGGGCCCTGTGCTGCTGCTGCTGCTGCTCCTGCTCTCAGTACTGCTGCTGGGCCAGGCCCTGCCACCCACCTGGCCCCACCTGCAGCTCTGCTACCTCCAACCACCACCAGTGTAG

XM_004866887.1 Coding sequence

Tsks testis-specific serine kinase substrate, transcript variant X5

High confidence: 4 potential gene matches
Length: 1728 bp    Location: 4546432..4561003   Strand: +
>XM_004866887.1
ATGGCAAGTGTGGTCGTGAAGACCATCTGGCAGTCCAAGGAGTTCCATCAGGCTGGGGACACCCCTGCCAGGGTCGAGAGGAGGATCCAGCTGGGCCCCGAGGCTCCCGGGAGCATGACCGGCCCAGCCAAGGGAGTCAGGAAGAAAAAGAAGGCTGTGTCGTTCCACAGCGTGGAGCCGCGGACGCCACACGAGCCAGTGGACTGGTGTCTCAACCTCAGACGGTCCTCGGGCTGCACCAACGTGTCCCTGCTCAACCTGGCCGCCGCTGTGGAGCCCTGGGACTCCTCCGGCACCAACTGCATCACGGAAGACAGCGGCCCGCTGGAGCTGCCTGGCCCCCCGGCTGCCCCCGCCCCACCCTGGGCTGCGGATGACCCGGACATCAAGGAACTTCTGAGTGGGCTCAACAGTGGACTAGTCCATGCCAAGGACTCTGTCATCAGCTTGAAGGAAAAGACCAGCTGGGTAAACCAGCACGTGCAGACCCTGCAGAGCGAATGTTCCCTGCTGAGCGAGAATCTAGAGAGAAGGCGGCAGGAGGCGGAGGAGCTGGAGGGGTACTGTAGCCAACTCAAGGCAGGGACCCCACCTGGTGTCCTGACCCAGGAGAACTGCAAGAAGGTGACCCGCTCGGTGGAGGATGCTGAAATCAAAACGAACGTCTTGAAGCAGAACTCAGCCCTGTTGGAGGAGAAGCTGCGATACCTCCAGCAGGAACTGCAGGACGAGACGCCGAGGCAGGAGGTCGAGATGCAGGAGCTGGAGCAGAAGCTGGAGGCCAGCCTCTCCCACTCCGGCCTCTCAGGAAACCCCGAAGAGGCCGCAAGGTTACGAAGCACGGCCCCAGGCGGCTGTGGAACTGGGCCCGGGGCGGGAGAAACGCCCCACACGAGCGAGCAGGAGCTGCAGAAGGTCTCAGCCAGCCTGGAGGACCTGAGGAGGGAGGTGTCCTCACTGGCCGCACGGTGGCATCAAGAGGAGGGGGCGGTGCAGGAAGCCCTGAGGCTGCTCGGGGGTCTGGGCGGAAGGCTCGACGGCTTCATGGGTCAGTGGGAGCGCGCGCAATGCGACCAGACGCAGACAGCGCGGAGCCTGCAGGAGCTGCGCAGACAGGCGGACCAGCTGTGCACCTTGGTGGAGCGCTCAGCAGTGTCTCTGGCTTCCCTGAGGAGCGAACTGGAGGGGCTGGGTCCGGTCAAACCAATTCTGGAGGAGCTGGCACGGCAGTTTCGGAACTCTCAAAGGGTACCTGACCACTCCATGAACCCGGATCGGTCGTCCCAAGGCTCCTGTGCTCGCTGTGCCAGCCAGGGACAGCAATTGTCCATGGAGTCCCTGCAGCATCTGTTGGAGCGAGCGCTGACCCCACTAGTGGATGAGGTGAAGCAGAGAAACCTGACGCCTCCTGCCTGTCCCAGCTGCCAGAGGCTACACAAGAAGATTCTGGAGCTGGAGCGCCAGGCCTTGGCCAAACACATCCGGGCAGAGGCCCTGAGCTCCACCCTTCGGCTGGCCCAAGACGAGGCCTTACGGGCCAAGAATCTGCTCCTGACAGACAAGATGAAGCCGGAGGAGAAGGTGGCCACCCTGGACTATCTCCATCTGAAGATGTGCTCCCTCCATGACCAGCTCAGCAACCTGCCACTTGAGGGCTCCACAGGGACAATGGGGGAAGGAAGCGGAGGGGCTGCCCCAAAATGTGGGAGCCCAGCCCCCAAACAATAA

XM_004866866.1 Coding sequence

Akt1s1 AKT1 substrate 1 (proline-rich), transcript variant X1

High confidence: 4 potential gene matches
Length: 834 bp    Location: 4454309..4461598   Strand: +
>XM_004866866.1
ATGCCTTTTGAGGGCGGTGACGACGCCAGGCTGGCCATGCTGGCTACGGGCACGGCGCGGATGGCGGCGGCGCGGCCCGAGGAGCTGTGGGAGGCCGTGGTGGGGGCCGCCGAGCGCTTCCGGGCCCAGACTGGCACTGAGCTGGTGCTGCTGACCGCTGCGCCACCGCCGCCGCCACGCCCGGGGCCCTGTGCCTATGCAGCCCATGGCCGCGGGGCCCTGGCCGAGGCTGCCCGCCGCTGCCTCCAGGACATTGCACAGGCCCACAGAGCTGCGGCGGCCGCCCGGCCTCCCAGGCCCCCGCCAGTGCCCAGCCCCGATCCCAGCCCGCCCCGACCAGCCCTTCCCAGGGAGGACGAGGAGGAGGAGGAGGAGGAGGAGGAGGACCAGCCGACAGAGACAGAGACCTCCGGGGAGCGGCTGGGTGGCAGCGATAACGGAGGGCTCTTCGTGATGGACGAGGACACCACCCTCCAGGACCTGCCCCCCTTCTGTGAGTCGGACCCCGAGAGCACAGATGACGGTAGCCTGAGCGAAGATGCCCCTGCCGGCCCCCCGGCCTGTTCCATGCCCCCCGCCTCGGCCCTGCCCACGCAGCAGTACGCCAAGTCGCTGCCCGTGTCTGTGCCCGTCTGGGCCTTCAAGGAGAAGAGGACCGAGGCGAGGTCATCGGATGAGGAGAACGGACAGCCCTCCTCGCCCGACCTGGACCGCATCGCGGCGAGCATGCGCGCTCTGGTGCTGCGGGAGGCCGAGGATACCCAGGTGTTCGGGGACTTGCCGCGACCGCGGCTCAACACCAGCGACTTCCAGAAGCTGAAGCGGAAATACTGA

XM_004866669.1 Coding sequence

Ptprh protein tyrosine phosphatase, receptor type, H

High confidence: 4 potential gene matches
Length: 2532 bp    Location: 2042623..2071331   Strand: +
>XM_004866669.1
ATGGCCTGGGCTGCCGGGGGCCTTGGGGCCTGGGGGAGCTTGGTGCTGCTGGGTCTGTGCAGCTGGAGCGGGGCCAGGGCAGCTGCCCCAAATCCAGTGACCAAGCTGAGAGTGGACGCTCAGACCAACGACTCCATCAGCCTGGGCTGGGAGGAGCCCGAGGGCTCAGACCCACAGAACCTCACCTACTGGGTCCTGTGGACTGGAGACGGACACACAGGTGACACCCAGAGCACAGCCAACACCAGTGTCACCATGGAGGGGCTGCGTCCTGGGTCTTCATATGCATTTTCTGTGTGGGTGGAAAAAGATGGAGTGAACAGCAGCAGGGAGACTCTCAGCGCTGCCACAGCCCCCAACCCAGTGAGGAACCTGAGAGTGGACGCTCAGACCAATGACTCCATCAGCCTGCGCTGGGAGGAGCCCGAGGGCTCAGACCCACAGAACCTCACCTACTGGGTCCTATGGACTGGAGACAGACACACAGGCGACACCCAGAGCACAGCCAACACCAGTGTCACCGTGGAGGGGCTGCATCCTGGGTCTTCATATGCATTTTCTGTGTGGGTGGAAAGAGATGGAGTGAACAGCAGCAGGGAGACTCTCAGCGCTGCCACAGCCCCCAACCCAGTGAGGAACCTGAGAGTGGACGCTCAGACCAACGACTCCATCAGCCTCCTGGGCTGGGAGGAGCCCGAGGGCTCAGACCCACAGAACCTCACCTACTGGGTCCTGTGGACTGGAGACGGACACACAGGTGACACCCAGAGCACAGCCGACACCAGTGTCACCCTGCATGAGCTTCAGCCTGGATCCTTGTATGAATTTTCAGTGTGGTCTGAGAAGAATGGGATTAATAGTTCCAGTGAGACTCAAAATGCTGCCACAGCTCCCAATGCGGTCACACATCTTCAGAACACAAGTGAGACCAGCACCTCAGTCTCGCTGAGCTGGGCGGCCCCTGCAGACCCCCATTCACAGCTTTACACCTACCGGATCCAGTGGGCCAGCGAGGCACAGCCCCCAGAGGCTGGGACCGACTCCACCGGCAGGACAGAGGAGACGTGGTATGTGGTGGAGGCCCTCAGTCCTGGCACTCTGTACACCTTCAGAGTGTGCGCCGAGAGGCACAAGGTGGCCAGCTCCATGGAGAGCTTCCAGGCATCCACAGCTCCAGACTCTGTCAGCATTGCATCCTGCATCAGTGCCTCTGGGGGCTACGGGCTCTTCCTGAACTGGTCCTGCCCCTCTGGAGGCTACGAGGCCTTTGAGTTGGAGGTGGGCGGGCAGCGGGGCTCCCAAGACAGATCTTCCTGCGGGAGCCGCGTGTTCGTGCAGGGCCTTGGGCCTGCCCGGTCCTACACAGCCACTGTCACGACCATCTGGAGCGGGCTGAAGGCCAAGTCCGCCCCAGTGACCTGCTACACTGAGAGTATTGGGGTCATCGTTGGAGCCGTTGTGGGCGTCCTCCTGTGCCTCGTCCTTGCGGGCCTGCTGGTTTTGTTCCTGAAGAAGAGGAACCGGAAGAAGCAGAAGAGTCGCAATCTTTTCTCTCCCCTTCTCCCACACAGCTTCCCAGGGGACATCCTGGCCAAAGACTTCACTGACCACGTCCGGCGAAACGAGAAGGACAGCAACTGCGGCTTTGCAGATGAGTACCAGCAACTGTGCCTGGAGGGCGAGGGCCAGCCTCAGGAGGTTGCCTTGGCTCCTGAGAACAAGGCCAAGAACCGCTACAGAAACGTGCTGCCCTATGACTGGTCCCGGGTGCCCCTGCAGCCGCTCCGTGATGAGCCCGGCTCTGACTACATCAACGCCAGCTTCATCCCTGGCCTCTGGAGCCCCCAGGACTTCATCGCGGCCCAGGGCCCCCTGCTGCGGACCGTGGGTGACTTCTGGCGCCTGGTGTGGGAGCAGCAGAGCCGCACGATTGTGATGCTCACCAACTGTGTGGAGTCTGGCCGGGTGAAGTGTGAGCACTACTGGCCTCTGGACGCCCAGCCCTGCATCCATGGGCACCTGCAGGTGGCCCTGGTAGGCGAGGAGGTGACAGAGGACTGGGCGGTGCGGGACCTGCAGCTGCTCCACACGGAGGAGCAGAAGACTCTGCCTGTGCGGCAGTTCCACTACCTGGCCTGGCCAGACCACGGCGTGCCGCCCTCCCCAGACCCCTTGCTGGCTTTCTGGAGGGTGCTGAGGCAGTGGCTGGACGAGACCTCGGAGGGAGGCCGGCCAGTTGTGCACTGCAGCGCTGGCGTGGGCCGCACGGGCACCCTCATTGCCCTGGACGTCCTGCTGAGGCAGCTGGAGAGTGAGGGCCTTGTGGGGCCCTTCGGCTTCGTGAGGAAGATGAGGCAGAGCCGGCCCCTGATGGTGCAGACGGAGGCCCAGTACGTGTTCCTGCACCAGTGCATCCTGCGCTACCTCGAGCAGTCGGCCACCCAGGCCCAGAAGGAGGCAGAGTATGAGAATGTGGCGGGCCTCGTCTATGAGAATCCGTCTGCCATCCGGGCCCAGGAGCTGGAGGTCTGA

XM_004866844.1 Coding sequence

Vrk3 vaccinia related kinase 3, transcript variant X3

Length: 1395 bp    Location: 4320879..4352257   Strand: +
>XM_004866844.1
ATGATCTCCTTCTGTCCAGACTGTGGCAAAAGTATTGAAGCCACATTCAAATTCTGCCCCTACTGTGGAAAACCTTTGCCTACAGAGGAGCATGCAAAGTCCCCGACGTGTGTCAGGCGACGGGAATCGTCCTTGCAAGGTTCAAAGAGAGAGCAGAGCTCCAGGTCTGAAACCTCTCCCAAGAAAGTGAGATGGTCAAACATTGTCATCTCTTCCCAGTCATCCTTTCTCTCTGACGGTGGCAGTCCTGAGCCAGAAGATGCCGTGAGTTCTTCTGAGAGGTCCAAAGGGGCCAGGAGCAGACCCCCAACCCCCAAAAGCAGCCCAAAGTCCACCAAGTGCAGCCCTCAGACGCTGAAGCGGAGTCGGGCAACCATCTCTCTTGAGGCTTTGCCCTCGGGGACAGAGCTGATGGACAAAAATGGGCAGCGCTGGAGGCTGGGAGCGCTGCAGACCAGGGACGACCAGGGCATTCTCTACGCAGCCGAGTCCGCCTCTGTCCTCCCCTGCCAGTCAAGGTCTCAAAAACACCAATTCTCCATCAAACTGGATGCCAAAGATGGTCGCCTGTTCAATGAGCAGAACTTCTTCCAGCGGGCTGCCAAGCCTCTACAAGTGAATAAATGGAAGAAGCTGTACTCAACCCCGCTCCTGGCCATCCCCACCTGTATCGGTTTTGGTGTTCACCAGGACAAGTACAGGTTCTTGGTGTTCCCCAGCCTGGGTCGGAGCCTGCAGTCAGCCCTGGATGTGAGCCCGAAGCATGTGATACCGGAGAAGTGTGTGTTCCAGGTGGCCTGCCGGCTGCTGGATGCCCTGGAATTCCTCCATGAAAATGAGTATGTTCATGGGAATCTGACAGCAGAGAATGTCTTTGTGAATCCAGAAGATCTGAGCCAGGTGACCCTGGCAGGCTACAGCTTCTCCTTCCGCTATTGCCCAAGTGGCAGACATGTGGCCTACACAGAAGGCAGCAGGAGCCCCCACGAGGGGGACCTCGAGTTCATTAGCATGGATCTACATAAAGGATGTGGGCCCTCTCGCCGGAGTGACCTCCAGACCCTTGGCTACTGTATGCTGAAGTGGCTTTATGGGTCCCTGCCGTGGACAAACTTCCTTCCCAACACTGAGGAGATCATGAAGCAGAAGCAGAAGTATCTTGACAACCCAGAGCCACTCGGACTGTGTGGTCACCGCAGCAGATCCTCAGAGGCCCTGCAGCAGTACCTGATGGTGGTGATGGCCCTCAAGTACGAGGAGAAGCCGCCCTACGCCATCCTGAGGAACGGTCTGGAAGCCCTGCTGCAGGATCTGCAGGTGTCAGCCTATGACCCCCTCAACCTACAGATGGCACCCAGGCAGGACCCAGAACTTTCAACCTGCCGTTTGAAATAG

XM_004866848.1 Coding sequence

Siglec11 sialic acid binding Ig-like lectin 11, transcript variant X2

Length: 1956 bp    Location: 4372831..4364289   Strand: -
>XM_004866848.1
ATGCTGCTGCTGGCCCTGCTGCTGCCCCTTCTGTGGGCGGGGTCCCTGCAGGAGGAACCAAGCTACTGGCTGCGGGTGCAGAAGTTGGTGACAGTGCAGGAGACCCTGTGTGCCCTGGTGTCCTGCTCCTTCTCCTACCCCCAGGACCGCTGGAACCACTCGACCCCTGCTTATGGCTACTGGTACCAGCACAAGGAGGGTCCCAAAACTCATCATACAACAAATGAACTTGTGGCCACAAATGACCCACGCAAGAAAGCTGGACTGAGAAGCAAAGCTCGTTTCCAGCTGCTCGGGGACCCCAGGGCCTACAACTGCTCCCTGAGGATCGCAGAGCTCACACAGACACCGGACATCCACATGCCGGAGCTGCTGGTGTCTGGTCACTCCAGTCGCCTGGAGTGCTCCATGCCCGGGGCCTGCAGTGGGGCCCTGGCACCCACGTTCTTCTGGACCGGGGCTGCCCTGAGACCCTCGGGTTGGGGCTTGGGCATTCACAGATCTTCGGAGATCCTGCTCACACCACTCCCTCAGGACCACGGCACCCACCTCACCTGTCGGGTGACTCTCCCTCAGGCTGGAGTGACCAGGGAGAGGACTGTCCAGCTCAGTGTGTCCTATCCTCCTCAGAGCCTGACCCTCAGTGTCTCCACAGCAGATGACAGAGCCCCGGACACCCAGGGAAATGGCTCCTACCTGGAGGCCCAGAAAGGCCAGTTCCTGAGGCTCCTCTGTGCTGCTGACAGCCGGCCCCCGGCCACGCTGACCTGGGACCTGGAGGCCAGAGTCCTTGCTCAGTCCCAAACCTCAGGACGAAGACCTCTAAGGCTGGAGCTGCCCGGGGTGAAGCCTGGGGACGCGGGGCGCTACACCTGCCGGGCAGAGAACAGGCTGGGCTCCCAGCACAGCACCCTGGAGCTCTCAGTGCAGTATCCTCCAGAGGACCTGAGAGTGACGGTTTCCCAAGCAAACAGGACAGTCCTGGAAATCCTCGGGAACGGCTCATCCCTGCCCGTCCTGGAGGGCCAGAGCCTGCGCCTGGTGTGTGTCACCCACAGCAGCCCCCCAGCCAGGCTGAGCTGGGCCCGGGGGACACAGCCCCTGAGCCCCTCCTGGCCCTCAGCCCCTGGGGTCCTGGAGCTGCCCCGGGTGCAGATGGAGCATGAAGGGGAAGTCAGCTGCCATGCGGAGAACCCGCTGGGCACCCGGAGTGTCTCTCTCAGCCTCTCTGTGCACTATGCCCCCCAGCTGCTGGGCCCCTGGTGCTCCTGGGAGGCCGAGGGTCTGCGGTGCAGCTGCTTCTCCTGTGCCCGGCCTGTCCCGTCCCTGCGCTGGCGGCTCGGGGAGGCGCTGCTGGAGGGGAACAGCAGCAATGCCTCCCTCATGGTCACCTCCAGCTGGGCCGGGCCCTGGGCCAACAGCTCCCTGAGCTTCCCTGGGGGACTGAGCTCTGGGGATAGGCTCAGCTGCGAGGCAGGGAATGTGCACGGGGTCCAGAGGGCCACTGTCCTGCTGCTGCCGGGGAAGCCAGAGAGTTGGGGTGGATATGTGCTCGCAGCACTTGGGGGAGCTGCTGCCTCGGCTCTGCTCTCTCTCTGTGCCTGCCTGCTCTTCTCCAGGATGAAGACCCCCCAGAAGGAGGCGGTGAGGACAGTGGCCACAGAGAAGGGCGCATCCTGTGGCCCGACTCCTGTCTGTTGGGGTCACCTGAATGCATCTGGGTCAGACCACCCGTCATCTGCCATGGCTACCACAGGGGAGGAGCAGGGGCTCCATTACGCCTCCCTCAGCTTCCTGGGACTGAAGCCCCGGAAGCCTCAGAACCAGAAGGACTCCAGCACCACTGAGTGTTCATCTCTGGATGCTGCTTTCTCCCTGCTCCAAGCCACAAGGGAGTCTCCAGGCCAGAGCTGCTTCCTGGATTTGACCTATGTGTTTCAGTCCTTGTTTGATTGA

XM_004866660.1 Coding sequence

Brsk1 BR serine/threonine kinase 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 2214 bp    Location: 1995192..1975450   Strand: -
>XM_004866660.1
ATGTCGTCCGGGGCCAAGGAGGGCGGAGGGGGCTCCCCCGCCTACCACCTCCCGCACCCCCACGCGCACCCCCCGCAGCACGCCCAGTATGTGGGCCCCTATCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGACTGGTTAAGCTCGGGGTCCACTGCATCACGGGTCAGAAGGTCGCCATCAAGATCGTGAACCGGGAGAAGCTGTCAGAGTCGGTGCTGATGAAGGTGGAGCGGGAGATCGCCATCCTGAAGCTCATCGAACACCCGCACGTGCTCAAGCTCCACGACGTCTATGAGAACAAGAAATATTTGTATCTGGTTCTGGAGCATGTCTCTGGCGGGGAGCTCTTCGACTACCTGGTGAAGAAGGGGAGGCTGACACCCAAGGAGGCCCGGAAGTTCTTCCGCCAGATTGTGTCGGCCCTGGACTTTTGCCACAGCTACTCCATCTGCCACAGGGACCTGAAGCCCGAGAACCTGTTGCTGGATGAGAAGAACAATATTCGAATTGCGGACTTCGGCATGGCATCCCTGCAGGTGGGGGACAGCCTTCTGGAGACCAGCTGTGGGTCCCCCCACTATGCGTGTCCGGAGGTGATCAAGGGGGAGAAGTATGATGGCCGCCGTGCAGACATGTGGAGCTGTGGGGTCATCCTCTTCGCCCTGCTCGTGGGGGCTCTGCCCTTCGACGACGACAACCTCCGCCAGCTGCTGGAGAAGGTGAAGCGAGGCGTCTTCCACATGCCCCACTTCATCCCTCCCGACTGCCAGAGCCTCCTGCGGGGGATGATCGAGGTGGAGCCCGAAAAGAGGCTGAGCCTGGAGCAAATACAGAAACATCCTTGGTACCTGGGCGGGAAGCACGAGCCCGACCCCTGCCTGGAGCCAGCCCCGGGCCGCAGGGTAGCCATGCGGAGCCTGCCTTCTAATGGTGAGCTGGACCCTGATGTCCTGGAGAGCATGGCATCGCTGGGCTGCTTCAGGGATCGTGACCGGCTGCACCGAGAGCTGCGCAGCGAGGAGGAGAACCAAGAAAAGATGATCTACTACCTGCTGTTGGACCGGAAGGAGCGGTATCCCAGCTGTGAAGACCAGGACCTGCCTCCCCGGAATGATGCTGACCCGCCTCGGAAGCGCGTAGATTCCCCTATGCTGAGCCGGCACGGGAAGCGGCGGCCGGAGCGAAAGTCCATGGAAGTCCTAAGCATCACGGACGCCGGGGGTGGCGGCTCCCCAGTGCCCACCCGCCGGGCCTTGGAGATGGCCCAGCACAGCCAGAGATCCCGTAGCGTCAGTGGCGCCTCCACCGGCCTGTCCTCCAGCCCTCTCAGCAGCCCAAGGCAGCCCCCGCCCCCCAGCGCCCGCTCCACGCCCCTGCCCGGACCCCCAGGCTCCCCGCGCTCCTCCGGAGGGACCCCCTTGCACTCGCCCCTGCACACGCCCCGGGCCAGCCCCACGGGGACCCCGGGGACGACGCCACCCCCCAGTCCCGGCGGTGGCGTTGGGGGAGCCGCCTGGAGGAGTCGGCTCAACTCCATCCGCAACAGCTTCCTGGGCTCCCCTCGCTTCCACCGGCGCAAGATGCAGGTCCCCACCGCTGAGGAGATGTCCAGTTTGACACCAGAGTCCTCTCCGGAACTGGCCAAACGCTCCTGGTTTGGGAACTTCATCTCCCTGGACAAAGAAGAACAAATATTCCTCGTGCTCAAGGACAAACCGCTCAGCAGCATCAAAGCGGACATTGTCCACGCCTTCCTGTCGATCCCCAGCCTGAGTCATAGTGTACTGTCACAGACCAGCTTCAGGGCCGAATACAAGACCAGTGGCGGCCCCTCCGTCTTCCAGAAGCCTGTCCGCTTCCAGGTGGACATCAGCTCCTCTGAGGGCCCTGAGCCCTCTCCCCACCGGGATGGCAGCAGTGGAGGTGGCATCTACTCCGTCACCTTTACTCTCATCTCTGGTCCCAGCCGGCGGTTCAAGCGTGTGGTGGAGACGATCCAGGCGCAGCTGCTGAGCACGCACGACCAGCCATCCGTGCAGGCCCTGGCAGATGAGAAGAACGGAGCACAGCCCCGGCCTGCTGGCACCCCGCCCCGAAGCCTGCAGCCCCCACCCAGCCACCCGGACCCGGAGCTGAGCAGCTCTCCCCGCCGAGGCCCCCCCAAGGACAAGAAACTCCTGGCCACCAACGGGACCCCTTTGCCCTGA

XM_004866824.1 Coding sequence

Pold1 polymerase (DNA directed), delta 1, catalytic subunit, transcript variant X1

High confidence: 4 potential gene matches
Length: 3381 bp    Location: 4135044..4117601   Strand: -
>XM_004866824.1
ATGGATGGCAAGCGGCAGCAGGGCCCAGGGGCCGGGGTGCCCCCAAAGCGGGCTCGAGGGGGCCTCTGGGACGAGGAGCCTCCGCCGTCCCACTTCGAGGAGGACCTGGCGCTGCTGGAGGAGATAGAAGCTGAGCACAGGTTGCGGGAGCAGGAGGAGGAGGCGCTGCAGCTGGCCGTGGAGCGGGCCACCGACGGGCAGCTCTCCACAGCCACTGACCCCCGCTGGTTTCGGCCTCCCCCACCCCCGCTGGACCCTCAGACGGAGCCCCTCATCTTCCAGCAGCTGGAGATCGACCACTATGTGGGTTCAGCACGGCCCCTGCCAGGGTGGACTCCGCCGTCCAGCAGCCACGTGCCGGTGCTGCGTGCCTTCGGGGTCACTGACGAGGGGGTGTCCGTCTGCTGCCACATCCACGGCTTTGCGCCCTACTTCTACGTCCCCGCGCCGCCCGGGTTCGGGGCTGAGCATCTGGCGGAGCTGCAGCGGGAGCTGAACACGGCCATCAGCCGAGACCAGCGCGGCGGCAAGGAGCTCAGTGGGCCGGCCGTGCTGGCGGTGGAGCTGTGCTCCCGGGAGAGCATGTTTGGGTACCATGGACACGGCCCCTCGCCCTTCCTGCGCATCACCTTGGCGCTGCCCCGCCTCGTGGCACCCGCGCGCCGCCTCCTGGAGCAGGGCGTCCGCGTGGCGGGCCTGGGCACCCCCAGCCTCGCGCCCTACGAGGCCAACGTGGACTTCGAGATCCGGTTCATGGTGGACACCGACATCGTGGGCTGCAACTGGCTGGAACTCCCAGCGGGAAGATACGTCCTGAGGCAGGAGGAGCAGGTCACCCTGTGCGCGCTGGAGGCCGACGTGCTGTGGTCCCATGTGGTCAGCCACCCCCCTGAGGGGCCGTGGCAGCGCATCGCACCCCTGCGCGTGCTCAGCTTTGACATCGAGTGCGCAGGCCGCAAAGGCATCTTCCCTGAGCCCGAGCGGGACCCCGTGATCCAGATCTGCTCCCTGGGCCTGCGCTGGGGCGAGCCGGAGCCCTTCTTGCGCCTCGCACTCACCCTTCGGCCCTGTGCCCCCATCCTGGGTGCCCAGGTGCAGAGCTTCGAGCGGGAAGAGGACCTGCTCCAGGCCTGGTCTGTCTTCGTGCGCACCATGGACCCTGATGTGATCACCGGCTACAACATTCAGAACTTTGACCTCCCCTACCTCATCTCTCGCGCCCAGACCCTCAAGGTGAAGGCCTTCCCCCTGCTGGGCCGCGTGGTTGGGCTCCCCTCCAGCCTGCGGGACTCTTCGTTCCAGTCGAGGCAGATGGGCCGGCGGGACAGCAAGGTGGTCAGCATGGTGGGCCGTGTGCAGATGGACATGCTGCAGGTGCTGCTGCGGGAGCACAAGCTACGCTCCTACACGCTCAACGCCGTGAGCTTCCACTTCCTGGGCGAGCAGAAGGAGGACGTGCAGCACAGCATCATCGCAGACCTGCAGAACGGGAATGACCAGACGCGCCGCCGCCTGGCCGTGTACTGCCTCAAGGACGCCTACCTGCCGCTGCGGCTGCTGGAGCGGCTCATGGTGCTGGTGAACAACGTGGAGATGGCGCGCGTCACCGGCGTGCCCCTCAGCTACCTGCTCAGCCGTGGCCAGCAGGTCAAGGTCGTGTCCCAGCTGCTGCGGCAGGCCATGCGTGAGGGGCTGCTGATGCCCGTGGTGAAGACGGAGGGCAGCGAGGACTACACAGGAGCCACTGTCATCGAGCCCCTCAAGGGATACTACGACGTCCCCATCGCCACCCTGGACTTCTCCTCGCTGTACCCATCCATCATGATGGCCCACAACCTGTGCTACACCACGCTGCTGCGGCCTGGGGCCGCCCAGAAGCTGGGCCTGGACTCAGACCAGTTCATCAAAACACCCACGGGGGATGAGTTCGTGAAGATGTCGGTGCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTGCTCAGCGCCCGGAAGAGGGCCAAGGCTGAGCTGGCGCAGGAGACTGACCCCCTGCGGCGGCAGGTGCTGGACGGGCGGCAGCTGGCCCTGAAGGTGAGCGCCAACTCCGTGTATGGCTTCACAGGCGCCCAGGTGGGGAAGCTGCCATGCCTGGAGATCTCGCAGAGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGTCCAAGTACACGGTGAAGAACGGCTACAGCACTGACGCCAAGGTGGTGTACGGTGACACGGACTCCGTCATGTGCCGCTTCGGCGTCTCCTCCGTGGCCGAGGCGATGGACCTGGGGCGCGAGGCCGCAGACTGGGTGTCAGGCCACTTCCCACCGCCCATCCGGCTGGAGTTCGAGAAGGTCTACTTCCCCTACCTGCTCATCAGCAAGAAGCGCTACGCTGGCCTTCTCTTCTGCTCCCGGCCCGACGGCCACGACCGCATGGACTGCAAGGGCCTGGAGGCCGTGCGGAGGGACAACTGCCCACTGGTGGCCAACCTTGTCTCGGCCTCCCTGCGCCGCCTGCTCGTTGACCGAGACCCCGAGGGCGCCGTGGCCCACGCCAAGGACGTCATCTCGGACCTGCTGTGCAACCGCATTGACATCTCCCAGCTGGTGATCACCAAGGAGCTGACCCGCGCAGCGGCCGACTACGCGGGCAAGCAGGCGCATGTGGAGCTGGCCGAGAGGATGAGGAAGCGGGACCCCGGCAGCGCGCCCAGCCTGGGTGACCGTGTCCCCTACGTGATCATCGGCGCTGCCAAGGGCGTGGCCGCCTACATGAAGTCAGAGGACCCCCTATTCGTGCTGGAGCACAGCCTGCCCATCGACACGCAATACTACCTGGAGCAGCAGCTCGCCAAGCCCCTGCTGCGCATCTTCGAGCCCATCCTGGGCGAGGGCCGCGCAGAGGCCGTGCTACTACGCGGCGACCACACGCGCTGCAAGACCGTGCTCACGGGCAAGGTGGGCGGCCTCCTGGCCTTCGCCACACGCCGCAGCTGCTGCATCGGCTGCCGCACGGTGCTCAGCCACGAGGGAGCCGTGTGCAAGTTCTGCCAGCCTCGGGAGTCAGAGCTGTACCAGAAGGAGGTGAGTGGGACGGGCTGGGCTGGGGCTGGGCCGCCCTGCCAGCCCGCTCACCCCTGGCACCCCCAGGTGTCCCACCTGAACGCCCTGGAGGAGCGCTTCGCACGCCTGTGGACGCAGTGCCAGCGCTGTCAGGGCAGCCTGCATGAGGACGTCATCTGCACCAGCCGGGACTGCCCCATCTTCTACATGCGCAAGAAGGTGCGGAAGGACCTGGAGGACCAGGAGAAGCTGCTGCGCCGCTTCGGGCCCCCTGGCCCCGAGGCCTGGTGA

XM_004866717.1 Coding sequence

Tmc4 transmembrane channel-like 4, transcript variant X1

High confidence: 3 potential gene matches
Length: 2112 bp    Location: 2417781..2425209   Strand: +
>XM_004866717.1
ATGGAAGAAGGCCTCGGCTGGGAACCCGAAGCCTGGGAGCCCCCGGGCAGGGGGCTGGCCCCCCGGGAGGCCAGAGCAGGCCAGTCGCTGGCCTCCGTGCTGAGCGAGCTCCCCAGCGCTGCTACCCTTCGGTACCGTGGCCCTGGGGTGCTGCCCTGGGGGTCACTGGAGGAGGAAGATGAAGGAGGAAGGAGCGTCCAGGGCCTCACAGGTGCCGCCCAAATGGAGCTACAGGACCCTCGCCATTCCCGGGAACTGCCCTGGCCCATGCAGGCGAGACGGGTGCACAGGAAAAACCAGGCCAGGGAGCAAAGTGCCTGCAGCACCGGATCCAGGGTTGGCCACTGGGCCCCGCTGCTTGCCAGGGGCAAGGACCAGACGAAGGAAGGCCTCCGCAGCCTGCAGCCCTGGGCGTGGACTGTGAACAGGATAGGGGGCCAGTTTGGCGCCGGCACGGAGTCCTACTTCTCCCTGCTGCGCTTCCTGCTGCTTCTGAACGCACTGGCGTCAGTGCTGGTGGCCTGCATGGTGCTGCTGCCCACCTGGCTGGAAGGCGCTCCCCTGGGGCCTCCTGCCCCCAGTGCCTCGTCACCCTGCGGTTCCTACAGCCCCCACAGCCCGGGCCTGGCCACCTTCCCCTCCCAGCTCTTCAACTTGCTCTCGGGACAGGGCTACCTGGAATGGTCACCTCTCTTCTATGGGTTCTACCCGGCCCGCAGGCACCTGGCAGTCACCTACCTGTGCTCCGTCTTTGCCAGTGGCCTCATCTGCCTCCTGCTCATTCTGCGGCGCTCCGTGTCAGGACTGAAGCAGACACTGCTGGCCGAGTCGGGGGCTCTGACCAGCTACAGCCACCGGGTATTCTCGGCCTGGAACTTCGGCCTCTGCGGGGCCGAGCACGTGAGGCTGCGCCAGCGCAGGATCCTATACGAGCTGCAGGTGGAGCTGGAGGAAGCGGGGATCCGGCGCAGGGCCGCGGTGCGGACGCTGGGCCAGCAGGCCAGGGTGTGGCTGGTGCGGGTGCTGCTCAACCTGCTGGTGCTGGCGCTGCTGTGCGCGGCCTTCTACGGCGTCTACTGGGCCACGGGGGAAGCCGGGCAGCTGCAGGAGGCGCCCCTGGTCAAGCAGACGCCGCTGCTGCAGCTCGCGGTGAGCTACCTCCCGTCCATCTTCATCTCCGCGGTCAACGTCGTGCTGCCGCCCCTGTTCCAGCTCATCGGCTCGCTGGAGGGCTACACTCGGAGCCACCAGATCGTCTTCATCTTACTCAGGACCGTGTTTCTGCGCCTCGCCTCCCTGCTGTTCCTGCTCTTCTCCCTCTGGTCTCAGATCACCTGCGGGGGCGACGCCCAGGCCGAGCAGTGCCAAAGCTGTGGCTACAACCACAGAAAGTTCCCGTGCTGGGAGACTCGGGTAGGCCAGGAGATGTACAAACTCCTGCTCTTCGACCTGCTGAGCAGCCTGGCCTTGGCGCTCCTCCTCCAGTTTCCCCGCAGGATACTCTGTGGGCTCTGTCCCGGGGCGCTGGGGCGCTGGGCCGCGGCACTGGAATTCAAGGTCGCCGACGAGGTGCTGGGGCTCATCTACGCGCAGACGGTGGTATGGGTGGGGAGCTTTTTCTGCCCTTTACTGCCCCTGCTCAACACGGCCAAGTTCCTGCTGCTTTTCTATTTGAAGAAGCTCACTCTGTTTTCCACCTGCTCCCCGGCGGCCCGCACCTTCCGGGCCTCCATGGCGAGCTGCTGCTTCCCCCTGGTCCTCCTCCTGGGGCTGGCCCTCTCCGCCGTCCCCGCGCTCTCCAGCATCTTCCTAATCCCGCCTTCCAAGCTGTGCGGCCCGTTCCGGGGGAAAGTCTCCATCTGGGCCCAGATCCCTGAGTCCATCGAGACCCTGCCTCACACCGCCCAGAACTTCCTCTTCTTCCTGGGCTCCCAGGCTTTTGCAGTGCCGCTTCTGTTGATCTCCAGCATCCTGATGGCGTATACTGTGGCCCTGGCCAATTCCCAGGGACACCTCATCTCCCAGCTCAAACGCCAGATAGAGACGGAGGCGCGGAACAAAGTCTTCCTGGCGCGCGCCGTGGCGCTGGGCTCGGAGAGCGGGGCTCTGTGA

XM_004867136.1 Coding sequence

Six5 SIX homeobox 5

High confidence: 4 potential gene matches
Length: 2211 bp    Location: 7430525..7434737   Strand: +
>XM_004867136.1
ATGGCTACCTTGCCTGCTGAGCCGAGCGCTGGGCCGGCGGCCGGGGGGAAGGCGGTGGCGGCGGCAACCGAAGAGGAGGAGGAGGAAGCACGCCAGCTCTTGCAGACTTTGCAGGCGGCCGAGGGTGAGGCGGCGGCGGCGGCCGGGGCCGGGGCGGGCGAAGCGGCTGCGGGAGCGGAGGACTCGGGGTCCCCGGGCGTCCCCGGGTCACCCCCCGAGGCCGCTGCCGAGCCGCCCTCGGGCCTCCGCTTCTCGCCAGAGCAGGTGGCGTGCGTGTGCGAGGCGCTGCTGCAGGCGGGCCACGCCGGCCGCTTGAGCCGCTTCCTGGGCGCGCTGCCCCCGGCCGAGCGCCTACGTGGCAGCGACCCGGTGCTGCGCGCGCGGGCCCTGGTGGCCTTCCAGAGGGGCGAGTACGCCGAGCTCTACCGGCTCCTCGAGAGCCGGCCCTTCCCCGCCGCCCACCACGCCTTCCTGCAGGACCTCTACCTGCGCGCGCGCTACCATGAGGCTGAGCGGGCCCGCGGCCGCGCGCTGGGCGCAGTGGACAAATACCGACTGCGCAAGAAGTTCCCGCTGCCCAAGACCATCTGGGACGGCGAGGAGACCGTCTACTGCTTCAAGGAGCGCTCCCGCGCCGCGCTCAAGGCCTGCTACCGCGGCAACCGCTACCCGACCCCGGACGAGAAGCGCCGCCTGGCCACGCTCACCGGCCTCTCGCTCACGCAGGTCAGCAACTGGTTCAAGAACCGGCGACAGCGCGACCGAACCGGGGCTGGCGGCGGCGCTCCCTGCAAGAGTGAGTCTGATGGGAACCCCACTACTGAAGATGAGTCCAGCCGAAGTCCTGAGGACCTGGAGAGTGGAGTGGCCACCGTGGCTGCTGAGGCCCCCACCCAGAGCTCCATATTCTTGGGGGGGCCCACTCCTCCAGCTCCATGCCCTGCCTCCTCCTCCATCCTGGTGAACGGGAGCTTCCTGGCTGCCAGTAGCTCCCCGACAGTGCTCCTCAACGGCAGCCCTGTCATCATCAACAGCTTGGCCCTGGGCGAGGCCTCCAGCTTGGGCCCCCTGCTGCTGACAGGCGGAGGGGCCGCCCCTCCTCCACAGCCCAGTCCCCAGGGCACCAGCGAAGCCAAGACCTCCCTGGTCTTGGACCCTCAGACCGGTGAGGTTCGGCTGGAAGAGGCTCCATCTGAGGTCCCTGAGACCAAAGGGGCCCAGGTGGCTGCTTCATTGCCCACTGGAGAGGAGGTCTCAGGGCCCCTGCCCCAAGTGGTACCTGGCCCCCCATCTGCAGCCAACTTCTCTCTGCCCCCAGGACCAGTGCCCACGGTGGCTGCCCCCCAGGTGGTGCCACTGTCTCCACCCCCTGGGTATCCCACAGGCCTGGGTGCCACTTCCCCACTGTTGAACCTGCCCCAGGTGGTGCCTACTTCCCAGGTGGTGACCCTGCCCCAGGCCATGGGGCCACTGCAGCTGTTGGCAGCTGGCCCAGGCAGCCCTGTGAAGGTGGCAGCTGCAGCGGGCCCTGCCAATGTGCACCTGATAAACTCTGGGGTGGGCGTGACTGCCCTACAGCTGCCTTCGGCCACTGCCCCAGGAAACTTCCTCCTGGCCAACCCTGTATCCGGCAGCCCCATTGTCACAGGTGTGGCAGTGCAGCAGGGGAAGATCATCCTCACTGCCACCTTCCCCACTAGCATGCTGGTTTCCCAGGTCCTGCCACCAGCCCCCAGCCTGGCCCTTCCCCTGAAGCCAGAGACGACAATCTCCGTCCCTGAAGGAGCCCTCCCGGTGGTCCCCAGCCCCGCACTCCCAGAGGCCCATGCCTTGGGCACACTTTCTGCTCAGGTGCCGCCACCACCCACTGTGGCCACCTCTGTGGCCAGCCTGCCTTTCTCCTCGGAGTCCTCCAGCCTCCTGCCCAGCTTCCCAGCACCTCCGGCAGAGGGTCTGATGCTGTCACCTGCAGCTGTGCCTGTCTGGTCAGCAGGGCTAGAACTGAGCACAGGAGCAGAGGGACTGCTAGATGCAGAAAAGGGGCTGGAGACACAGGTCCCCCATGCTGTGCTGAGGCTGCCGGGCCCTGACCCCGAGGGGCTGCTCCTAGGGGCCAACGCAGCGGCCGAGGTTGACGAGGGGCTAGAAGCAGAGGCCAAGGTTCTGACTCAGCTGCAGTCAGTGCCTGTAGAGGAGCCCTTGGAACTGTGA

XM_004867148.1 Coding sequence

LOC101709949 myeloid zinc finger 1-like

Length: 1749 bp    Location: 23900..39119   Strand: +
>XM_004867148.1
TTCCTCCCGCTTCCAGCCTCCGATGAGGGCGCTTTGTGGTGGGAGTGGCTGGCCCCACATCCCTCCTGCAGAACACACCTCTGGGTTGGTTACACTCAGGCCCAAGACCCTGTGCCCAGGCTTGGGCTCCCCAGTTCCTGTGTGGAGTCTGCCCCTCAAGTGTGCCCCAGGTTTGTCAGATGGAACCCAGGAGCCTGGCTTCCTTGCCCCCCTTTCTGCAGGCCTTGCCATCTGCCTACTTTTGTCCTGGTGCCCAACCCATCCCTGTTTAAGCAGACCGGGTGTCTTCAAACGGCTCTGTCCCACCGTCCCCTCAGGGAAGCCTGCACTGACAGAGGGCCTGTTTCTGGGTTCCACGTGGGTCTGGGCAGAGGGCCCTATCTCAGGAGGGGCTCCCTCCGTACAGGCTTTGCGCTTCTGACAGACGGCGATTCCGCGGGGCCGGCGGTGCTGAGCCCGCAACTCGAAGTACCCTGGGATCTGGGCCGAGTCCGGCCGCCCTCGCGCGACAGCGACTCCAGCGCAAACGAAGACCCCTGCCTGGCTGCCGCTGGCTGGCACCCAGTCCGGGGCCGGGGCCGGCCGGGCTCGGGGGCCGGGCCGGGCCGGGGCGGTTGCTGCGACGTGTGCGGAAAGGTGTTCAGCCAGCGCAGCAACCTGCTTCGGCACCAGAAGATCCACACGGGCGAGCGCCCCTTCGTGTGCGGCCAGTGTGGCCGCAGCTTCAGCCGCAGTTCGCACCTGCTGCGCCACCAGCTCACGCATTCGGAGGAGCGGCCCTTTGTTTGCAGCGACTGCGGCCAAGGCTTTGCGCGTCGTGCCAGGCTGGAGGAGCACCAGCGCGTGCACACGGGCGAGCAGCCCTTCCGCTGCGCCGACTGCGGCCAGTGCTTCCGCCAGCGCGCTAACCTGCTGCAACACCAACGCGTGCACGGGGACCCCCCGGACTCGCGCCCTGCGCCGCCACCCCCCGCCCCCCCTGAAGCTCCTGGCCCCTTCCCGTGCAGCGAATGCCGCCAGAGCTTCGCGCGCCACGCAGTGCTGCTGGAACACCAGGCCGTGCACACCAGTGACAAGTGCTTCGGCTGTGCCGAGTGCGGCGAGCGCTTTGGCCGCCGCGCCGTGCTGCTGCAACACCGACGCGTGCACAGCGGCGAGCGGCCTTTCGCCTGCGCCGACTGCGGGCAGAGCTTCCGCCAGCGCTCCAACCTCACGCAGCACCGGCGCATCCACACGGGCGAGCGGCCTTTCGCCTGCGCTGAGTGCGGCAAAGCTTTCCGCCAGCGGCCCACTCTCACGCAGCACCTGCGTGTGCACACGGGCGAGCGGCCCTTTGCCTGCCCCGACTGTGGCCAGTGCTTCAGCCAGCGGCTCAAGCTCACGCGCCACCAGCGCACGCACACCGGCGAGAAGCCACACCGTTGTGCCGACTGCGGCCTGGGCTTCGCGCAAGTGTCGCGCCTCACCGAGCATCGGCGCGTGCACACAGGCGAGCGGCCCTTTGCCTGCGCCGACTGTGGCCAGTGCTTCCGCCAGCGCGCCAACCTGGCGCAGCACCGCCGCATCCACACGGGCGAGCGACCTTTCGCCTGCGCCGAATGCGGCAAGGCTTTCCGCCAGCGGCCCACGCTCACGCAGCACCTGCGCACTCACCGGCGGGAGCGGCCCTTTGCCTGCCAGGACTGCGGCCGCCGCTTCCACCAGAGTACGAAGCTCCTCCAGCACCAGCGCGTGCACTGCGCGGAGTAG

XM_004866528.1 Coding sequence

Zbtb45 zinc finger and BTB domain containing 45, transcript variant X2

Length: 1431 bp    Location: 72854..77449   Strand: +
>XM_004866528.1
ATGATGGCGGTGGCCGAGGCGGTGCACCACATCCACCTGCAGAACTTCTCGCGCTCGCTGCTGGAGACCCTCAACGGGCAGAGGCTGGGCGGGCACTTCTGCGACGTGACCGTGCGCATCCGTGAAGCCTCGCTGCGCGCACACCGCTGTGTGTTGGCCGCTGGCTCGCCCTTTTTCCAAGATAAGCTGCTGCTCGGCCACTCGGAGATCCGCGTGCCGCCAGTGGTGCCCGCGCAGACGGTGCGCCAGCTCGTAGAGTTCCTCTATAGCGGCTCGCTAGTGGTGGCACAGGGGGAGGCGCTGCAGGTGCTTACTGCCGCGTCGGTGCTGCGCATCCAGACGGTCATTGACGAGTGCACGCAGATCATTGCGCGTGCGCGCACTCCCAGCGCCCCCACACTCTTGCCCGCGCCGGTGCCCCCGCCGCTGGCTCCCGCGCAGCTGCGCCACCGCCTGCGCCACCTGCTGGCCGCGCGCCCCCTAGGCCCCCCGGGCGCTGCGCACAGCCGCAAGCAGCGCCAGCCCGCGCGCCTGCAGCTGCCCGCGCCAGCCGCTCTCACTCGGGCGGAGGGGTCCACGGCCAGCCCCGTCCTGCCCGCCTTGCCCGATGACAGGGGTGACGACGACGAGGACACCGAGGAGGACACTGATGGTGAGGATGGTGAGGGCGCTGCGCCCCCCGCTTTCCCTGACTGCGCACCCGGCTTTCTCCCGGCGGCAGCGGACGCGGCGCAAGAGGAGCCGCCTCGGCCTCCCAGCCTCGAAGACCACGACGGCGCGGGCAGGGACTTCCTTCGGGGGGCCGCGGCTGCCGAGGACGTGTTTGTGGACGGCTTCGGGCCCGCCTGGCGGGAGGAGGACGGCCCGGCCCCAGAGGGCGGCTCTGCTGAGCCCCCTGCGCCGCCCGACTGTGCCCTGGCTGGGCCGCGCCTGCTGCCGCCCGCTGCCAAGACCCCGGGGCCGCCAGTCGCTCTCTTCCCCTTCCACCTGGGGGCCCCCGGCCCGCCCGCACCCCCGGGGCCTGCCTTCTACCCCACGCTGCAGCCTGACCCCCCCAACACTCAGCTAGGGGAGGCCCCAGCCCCTCCTGTGCCGCCCGCCTACGAGTGCGGCCATTGTCGCAAGACCTTCAGCTCGCGGAAGAATTACACCAAGCATATGTTCATCCACTCGGGGGAGAAACCTCACCAGTGTGCCGTGTGCTGGCGATCCTTCTCGCTGCGAGACTACCTGCTCAAGCACATGGTCACGCACACTGGCGTGCGTGCCTTCCAGTGTGCTGTCTGTGCCAAGCGCTTCACGCAGAAGAGCTCGCTCAATGTGCACATGCGCACACACCGGCCGGAGCGTGCATCCTGCCCAGCCTGCGGCAAAGTCTTTTCTCACCGTGCACTGCTGGAGCGCCACCTGGCCACGCACCCCACGCCCTGA

XM_004866532.1 Coding sequence

Znf446 zinc finger protein 446, transcript variant X3

Length: 1713 bp    Location: 102643..97055   Strand: -
>XM_004866532.1
ATGCGCAGGTATTCGAGGCTCCGTCGGTTGACAGTGGGAGAGTTTTGGGGTTCGTATGCAAAGAAAGTGTGGCTGCTACACAAGGGAAGGAGCTCCCTAAACTGCAGCACTGCGGATTCCTCAAGAGCAACGGAGCGTCTCAGTCCAGAGAAGCCTCTGATAATGTTCCCCTGTTCTTGCTTGCTGAGGCTTATGGGAAATGTAGTCCAAGGAGGGCGGCGATGTCCACGGAACAGGCCTGGGATTGGCCAGGGTAGCGTCGCCAGGGCAACGAGCGGAGGGACCGTTCCGAGTGACGCCACTTCCCGGAAGTGGACTCCCAGCACTGGCGCGGAGGCTGAGGTTCCTCTTGGCAGTTCCAAGAAGACACAGAAAAGAATGCCATCCCCTCTCGGTCCCTCATACCTGCCCCTGGGGGACTCCGAGACCAACCTCAAGGGACCTGAAGGTGCCCGGCTTCGTTTCCGGGGATTCTGCTACAAGGAGGTGGCAGGGCCACGGGAAGCGCTGGCCCAGCTCCGAGAGCTGTGCCACCAGTGGTTGCGGCCTGAGTCCTGCTCCAAGGAGGAGATCCTAGAGCTGCTGGTGCTGGAGCAGTTCCTGGGCACACTGCCCCTTGAGATCCAGGCCTGGGTACGAAGGCAGCAGCCAGGCTGCCCTGAGGAGGCTGCTGCCCTGGTAGAGGGGCTGCAGCAGGACCCTGGACAGTTGCTAGGCTGGATCACAGCCCACATCCTGAAGCCAGAGGTGCTGCCTGCATCCCAGAAGACAGAGGAATCCTCAGGGAGCCCTCAGCCCTCAGCAACAGTGGATCCCTGTGGAGCAGCCCCAGGGGAGGGCCCACAGGATGCCAGGATGGAAGGGTCGGCCCAGCTCAGTTGCAGTGTGAAGGAGGAGCCCAGTGTGGATGGCCAGGAGATGGCACCTCTCAGCCCCTTACTTCCGGCCCCATCACCTGAGAGTCATCTGGAGCACCAAGAACCAGCCTCTACATCCTTCCAACTACCCAGGAATCAGGAGCGGTGGGTGCTGCTGGACCGGTCGCAGAAGGAGCTCTACTGGGATGCGATGCTGCAGAAGTACGGTTCTGCGGTGTCCCTGGGCGCTCGCACGCTCGTGCCCCGGAGCCCGTGCCACCACCCTGTGCGCCCCGCAGCACCCCACGCCGTGCACCAGGTCACGTGTGCCAGGACTGTGGCCACAGCTTCAGCTGGAAGTCGCAGCTGGTCATCCACCGCAAGGCCCACGCTGGCCAGCGGCGTCATGCCTGCGGGGACTGTGGCCGTGCCTTCGACTGGAAGTCGCAGCTGGTCATCCACCGAAAAAGCCACCAGCCGGAGGCACTGTGAGGAGGAGCCAGCCCAGGATGGAGGCCAGGTCCGCTGCGACAGCCACTGTGCAACCTCAGTGACCACCCAGCCCACGCTCCTCACACAGGATGCAACGCGCGCTGACCGCACTCCTCCCTCCAGGGCCTCACTGCCGGCAGTGGACACTCAGGAACTGGCGTGTACCCCGTGCAGCGGCAGGGCCCCAAGTCTGCCTGTGGAAGGTGACAAGAGGCCCAGGAAAGCACAGCTGGCTTCTCTTCCGAGTGACCTTCTTGTGACCTGTCCTTTTGTGGTGCTTGATGACCCGAGGAGAGGAATTGGCCTGGACCAGCTCACAAATGGCAAGAGAGTGTGCACGAGCCAGGAGGTTGTTGCACAGTGA

XM_004866536.1 Coding sequence

Znf446 zinc finger protein 446, transcript variant X7

Length: 1512 bp    Location: 102643..97884   Strand: -
>XM_004866536.1
ATGCGCAGGTATTCGAGGCTCCGTCGGTTGACAGTGGGAGAGTTTTGGGGTTCGTATGCAAAGAAAGTGTGGCTGCTACACAAGGGAAGGAGCTCCCTAAACTGCAGCACTGCGGATTCCTCAAGAGCAACGGAGCGTCTCAGTCCAGAGAAGCCTCTGATAATGTTCCCCTGTTCTTGCTTGCTGAGGCTTATGGGAAATGTAGTCCAAGGAGGGCGGCGATGTCCACGGAACAGGCCTGGGATTGGCCAGGGTAGCGTCGCCAGGGCAACGAGCGGAGGGACCGTTCCGAGTGACGCCACTTCCCGGAAGTGGACTCCCAGCACTGGCGCGGAGGCTGAGGTTCCTCTTGGCAGTTCCAAGAAGACACAGAAAAGAATGCCATCCCCTCTCGGTCCCTCATACCTGCCCCTGGGGGACTCCGAGACCAACCTCAAGGGACCTGAAGGTGCCCGGCTTCGTTTCCGGGGATTCTGCTACAAGGAGGTGGCAGGGCCACGGGAAGCGCTGGCCCAGCTCCGAGAGCTGTGCCACCAGTGGTTGCGGCCTGAGTCCTGCTCCAAGGAGGAGATCCTAGAGCTGCTGGTGCTGGAGCAGTTCCTGGGCACACTGCCCCTTGAGATCCAGGCCTGGGTACGAAGGCAGCAGCCAGGCTGCCCTGAGGAGGCTGCTGCCCTGGTAGAGGGGCTGCAGCAGGACCCTGGACAGTTGCTAGGCTGGATCACAGCCCACATCCTGAAGCCAGAGGTGCTGCCTGCATCCCAGAAGACAGAGGAATCCTCAGGGAGCCCTCAGCCCTCAGCAACAGTGGATCCCTGTGGAGCAGCCCCAGGGGAGGGCCCACAGGATGCCAGGATGGAAGGGTCGGCCCAGCTCAGTTGCAGTGTGAAGGAGGAGCCCAGTGTGGATGGCCAGGAGATGGCACCTCTCAGCCCCTTACTTCCGGCCCCATCACCTGAGAGTCATCTGGAGCACCAAGAACCAGCCTCTACATCCTTCCAACTACCCAGGAATCAGGTGACAGAGGAGGGACACCCCTTCCTGGCCATGACAGTGGCCTCCCCACAGGAGCGGTGGGTGCTGCTGGACCGGTCGCAGAAGGAGCTCTACTGGGATGCGATGCTGCAGAAGTACGGTTCTGCGGTGTCCCTGGGCGCTCGCACGCTCGTGCCCCGGAGCCCGTGCCACCACCCTGTGCGCCCCGCAGCACCCCACGCCGTGCACCAGGTCACGTGTGCCAGGACTGTGGCCACAGCTTCAGCTGGAAGTCGCAGCTGGTCATCCACCGCAAGGCCCACGCTGGCCAGCGGCGTCATGCCTGCGGGGACTGTGGCCGTGCCTTCGACTGGAAGTCGCAGCTGGTCATCCACCGAAAAAGCCACCAGCCGGAGGCACTGTGAGGAGGAGCCAGCCCAGGATGGAGGCCAGGGCCTCACTGCCGGCAGTGGACACTCAGGAACTGGCGTGTACCCCGTGCAGCGGCAGGGCCCCAAGTCTGCCTGTGGAAGGTGA

XM_004866538.1 Coding sequence

Znf446 zinc finger protein 446, transcript variant X9

Length: 1377 bp    Location: 102643..98084   Strand: -
>XM_004866538.1
ATGCGCAGGTATTCGAGGCTCCGTCGGTTGACAGTGGGAGAGTTTTGGGGTTCGTATGCAAAGAAAGTGTGGCTGCTACACAAGGGAAGGAGCTCCCTAAACTGCAGCACTGCGGATTCCTCAAGAGCAACGGAGCGTCTCAGTCCAGAGAAGCCTCTGATAATGTTCCCCTGTTCTTGCTTGCTGAGGCTTATGGGAAATGTAGTCCAAGGAGGGCGGCGATGTCCACGGAACAGGCCTGGGATTGGCCAGGGTAGCGTCGCCAGGGCAACGAGCGGAGGGACCGTTCCGAGTGACGCCACTTCCCGGAAGTGGACTCCCAGCACTGGCGCGGAGGCTGAGGTTCCTCTTGGCAGTTCCAAGAAGACACAGAAAAGAATGCCATCCCCTCTCGGTCCCTCATACCTGCCCCTGGGGGACTCCGAGACCAACCTCAAGGGACCTGAAGGTGCCCGGCTTCGTTTCCGGGGATTCTGCTACAAGGAGGTGGCAGGGCCACGGGAAGCGCTGGCCCAGCTCCGAGAGCTGTGCCACCAGTGGTTGCGGCCTGAGTCCTGCTCCAAGGAGGAGATCCTAGAGCTGCTGGTGCTGGAGCAGTTCCTGGGCACACTGCCCCTTGAGATCCAGGCCTGGGTACGAAGGCAGCAGCCAGGCTGCCCTGAGGAGGCTGCTGCCCTGGTAGAGGGGCTGCAGCAGGACCCTGGACAGTTGCTAGGCTGGATCACAGCCCACATCCTGAAGCCAGAGGTGCTGCCTGCATCCCAGAAGACAGAGGAATCCTCAGGGAGCCCTCAGCCCTCAGCAACAGTGGATCCCTGTGGAGCAGCCCCAGGGGAGGGCCCACAGGATGCCAGGATGGAAGGGTCGGCCCAGCTCAGTTGCAGTGTGAAGGAGGAGCCCAGTGTGGATGGCCAGGAGATGGCACCTCTCAGCCCCTTACTTCCGGCCCCATCACCTGAGAGTCATCTGGAGCACCAAGAACCAGCCTCTACATCCTTCCAACTACCCAGGAATCAGGTGACAGAGGAGGGACACCCCTTCCTGGCCATGACAGTGGCCTCCCCACAGGAGCGGTGGGTGCTGCTGGACCGGTCGCAGAAGGAGCTCTACTGGGATGCGATGCTGCAGAAGCGCTCGCACGCTCGTGCCCCGGAGCCCGTGCCACCACCCTGTGCGCCCCGCAGCACCCCACGCCGTGCACCAGGTCACGTGTGCCAGGACTGTGGCCACAGCTTCAGCTGGAAGTCGCAGCTGGTCATCCACCGCAAGGCCCACGCTGGCCAGCGGCGTCATGCCTGCGGGGACTGTGGCCGTGCCTTCGACTGGAAGTCGCAGCTGGTCATCCACCGAAAAAGCCACCAGCCGGAGGCACTGTGA

XM_004866562.1 Coding sequence

Znf584 zinc finger protein 584, transcript variant X4

Length: 1233 bp    Location: 151351..143581   Strand: -
>XM_004866562.1
ATGGCCGACGCGGCGCAGGGCTTGGTGATATTCGAGGATGTGGCCCTGCATTTCTCCCAGGAGGAGTGGGGTCTTCTCACTGTGGCCCAGAGGAGCCTGTACCGTGACGTGATGCTGGAGAATTTTGCTCTCATTAGCTCGCTGGGTTGCTTGTGTAGAGTGAAGGATGAAGAAGCTCCTCCCAAGCAAGTGAAGAGTTGTGGAGTCCATGTGGGAGGACAGCCCTGCTCGTGTGGAGAGCAGGGTGACAGCCCAGCCACTAAAGGCCTCCAGCCTCAAGCCCCTCTCAGTGAGGGGAAGGCACGAGGGAGCCCTGAGCACAGGCCAGCCCTCCCTAACCCAAGTCAAAAGTCACAGGGTGTCCATGCCACACAGAAGCCCTTTAAGTGCAGTAACTGCAGAGAAAGCTTCCTGAAGGCGTTTGCTCTTCTCAACCACCTGATAACCCACCCTGAAGAGAGACATTCCCGATGCCCAGTAGGCGGAAGTGCCCCCACCGAGAACTCGGCCCTTCCTGATGACCAGAAAGACCTCCATGAAGAAGATGCCCATGTGTGTGGTGAGTGTGGGAAAGCCTTCAACTATGCATCCAAACTGAGGAAGCACCAGAAGATCCACATGGGCATTCGCCCTTTCCAGTGCAGCGAATGTGGGAAGACCTTCAGCCGCAAAGATGCCTTGGCGCTGCATGAGAGGACTCACACTGGAGAGCGGCCATATGAGTGCAGCAGGTGCGGCAAGGCCTTCAGTGTGCTCTCCACCCTCATTCGGCATCGGAAGGTCCACCTTAGAGAAAGGCCCTACGAGTGCAGGGAGTGTGGAAAGTTCTTCAAGTACAACAAGAGCTTTGTTCTTCACCAGAGAGTGCACACTGGAGAGAGGCCCTTTGTGTGTGAGCATTGTGGGAAAACCTATGTGACCCGCTCGGGCCTGTACCAGCACTGGAAGGTCCACACTGGAGAGCGACCGTACGGTTGCAGCCTGTGTGGGAAAACCTTCACCACCCGCTCCTACCGCAACCGGCACCAGCAGTTCCACACCGGGGAGCGGGCCTACACGTGCACTGAATGTGGGAAAGCCTTCAAGCACAGCTCTACCCTGCACCAGCACCGGAAAATTCATACGGCAGAGCCCTCCGAAGGCCAGCGCAGGCGGAGAAGCCGTCAGCGACTAGCAGCTGGCTCACCAGGAGAAAGCTTGTCCTGGAAAGGTGGGGAGAAGCAGCCTTCGTGA

XM_004866559.1 Coding sequence

Znf584 zinc finger protein 584, transcript variant X1

Length: 1386 bp    Location: 151351..143581   Strand: -
>XM_004866559.1
ATGGCCGACGCGGCGCAGGGCTTGGTGATATTCGAGGATGTGGCCCTGCATTTCTCCCAGGAGGAGTGGGGTCTTCTCACTGTGGCCCAGAGGAGCCTGTACCGTGACGTGATGCTGGAGAATTTTGCTCTCATTAGCTCGCTGGTCAGTTTTGGTAGTTTGTTCCCTGACAGAAGAACAGAGTGCCTTGACCATTGTGACACCCACCCAGCCAGCCCAGCCAGCCCAGCCAGCCGCAGGTTTTCCCAGCAGGTTTCAGCCCAAGCCAAGACCTTGACCTTCCCAGGAACTGACAAAGGTTGCTTGTGTAGAGTGAAGGATGAAGAAGCTCCTCCCAAGCAAGTGAAGAGTTGTGGAGTCCATGTGGGAGGACAGCCCTGCTCGTGTGGAGAGCAGGGTGACAGCCCAGCCACTAAAGGCCTCCAGCCTCAAGCCCCTCTCAGTGAGGGGAAGGCACGAGGGAGCCCTGAGCACAGGCCAGCCCTCCCTAACCCAAGTCAAAAGTCACAGGGTGTCCATGCCACACAGAAGCCCTTTAAGTGCAGTAACTGCAGAGAAAGCTTCCTGAAGGCGTTTGCTCTTCTCAACCACCTGATAACCCACCCTGAAGAGAGACATTCCCGATGCCCAGTAGGCGGAAGTGCCCCCACCGAGAACTCGGCCCTTCCTGATGACCAGAAAGACCTCCATGAAGAAGATGCCCATGTGTGTGGTGAGTGTGGGAAAGCCTTCAACTATGCATCCAAACTGAGGAAGCACCAGAAGATCCACATGGGCATTCGCCCTTTCCAGTGCAGCGAATGTGGGAAGACCTTCAGCCGCAAAGATGCCTTGGCGCTGCATGAGAGGACTCACACTGGAGAGCGGCCATATGAGTGCAGCAGGTGCGGCAAGGCCTTCAGTGTGCTCTCCACCCTCATTCGGCATCGGAAGGTCCACCTTAGAGAAAGGCCCTACGAGTGCAGGGAGTGTGGAAAGTTCTTCAAGTACAACAAGAGCTTTGTTCTTCACCAGAGAGTGCACACTGGAGAGAGGCCCTTTGTGTGTGAGCATTGTGGGAAAACCTATGTGACCCGCTCGGGCCTGTACCAGCACTGGAAGGTCCACACTGGAGAGCGACCGTACGGTTGCAGCCTGTGTGGGAAAACCTTCACCACCCGCTCCTACCGCAACCGGCACCAGCAGTTCCACACCGGGGAGCGGGCCTACACGTGCACTGAATGTGGGAAAGCCTTCAAGCACAGCTCTACCCTGCACCAGCACCGGAAAATTCATACGGCAGAGCCCTCCGAAGGCCAGCGCAGGCGGAGAAGCCGTCAGCGACTAGCAGCTGGCTCACCAGGAGAAAGCTTGTCCTGGAAAGGTGGGGAGAAGCAGCCTTCGTGA

XM_004866560.1 Coding sequence

Znf584 zinc finger protein 584, transcript variant X2

Length: 1275 bp    Location: 151351..143581   Strand: -
>XM_004866560.1
ATGCTGGAGAATTTTGCTCTCATTAGCTCGCTGGTCAGTTTTGGTAGTTTGTTCCCTGACAGAAGAACAGAGTGCCTTGACCATTGTGACACCCACCCAGCCAGCCCAGCCAGCCCAGCCAGCCGCAGGTTTTCCCAGCAGGTTTCAGCCCAAGCCAAGACCTTGACCTTCCCAGGAACTGACAAAGGTTGCTTGTGTAGAGTGAAGGATGAAGAAGCTCCTCCCAAGCAAGTGAAGAGTTGTGGAGTCCATGTGGGAGGACAGCCCTGCTCGTGTGGAGAGCAGGGTGACAGCCCAGCCACTAAAGGCCTCCAGCCTCAAGCCCCTCTCAGTGAGGGGAAGGCACGAGGGAGCCCTGAGCACAGGCCAGCCCTCCCTAACCCAAGTCAAAAGTCACAGGGTGTCCATGCCACACAGAAGCCCTTTAAGTGCAGTAACTGCAGAGAAAGCTTCCTGAAGGCGTTTGCTCTTCTCAACCACCTGATAACCCACCCTGAAGAGAGACATTCCCGATGCCCAGTAGGCGGAAGTGCCCCCACCGAGAACTCGGCCCTTCCTGATGACCAGAAAGACCTCCATGAAGAAGATGCCCATGTGTGTGGTGAGTGTGGGAAAGCCTTCAACTATGCATCCAAACTGAGGAAGCACCAGAAGATCCACATGGGCATTCGCCCTTTCCAGTGCAGCGAATGTGGGAAGACCTTCAGCCGCAAAGATGCCTTGGCGCTGCATGAGAGGACTCACACTGGAGAGCGGCCATATGAGTGCAGCAGGTGCGGCAAGGCCTTCAGTGTGCTCTCCACCCTCATTCGGCATCGGAAGGTCCACCTTAGAGAAAGGCCCTACGAGTGCAGGGAGTGTGGAAAGTTCTTCAAGTACAACAAGAGCTTTGTTCTTCACCAGAGAGTGCACACTGGAGAGAGGCCCTTTGTGTGTGAGCATTGTGGGAAAACCTATGTGACCCGCTCGGGCCTGTACCAGCACTGGAAGGTCCACACTGGAGAGCGACCGTACGGTTGCAGCCTGTGTGGGAAAACCTTCACCACCCGCTCCTACCGCAACCGGCACCAGCAGTTCCACACCGGGGAGCGGGCCTACACGTGCACTGAATGTGGGAAAGCCTTCAAGCACAGCTCTACCCTGCACCAGCACCGGAAAATTCATACGGCAGAGCCCTCCGAAGGCCAGCGCAGGCGGAGAAGCCGTCAGCGACTAGCAGCTGGCTCACCAGGAGAAAGCTTGTCCTGGAAAGGTGGGGAGAAGCAGCCTTCGTGA

XM_004866552.1 Coding sequence

A1bg alpha-1-B glycoprotein, transcript variant X3

Length: 1590 bp    Location: 197581..200537   Strand: +
>XM_004866552.1
ATGGTTGAAACCTGGCCCAGCCTCTGGGCAGAGTCGGCCTTGCCGCTGAAGCCCTGGGCCCAGCTGCAGCTGACCTGCCGCGCGCGCCTGGCGACCCTGGAGTTCCAGCTGCTCAAGGACGGGGTGGCCCTGGAGCACGTGCGCCTTGACTTCCCCGCCATTGCCCACCAGTTTGTGCTGGGTGAGGTGACCAGGGACAACCGGGGCCTCTACCACTGCCGCGCCGGTCTGGGTTCGGGGTGGACCCAGCTGAGCGGCCTCGTGGAGGTGACGGGCACAGAGCCCTTGCCCCCGCCCCGGCTCTCGGCTGAGCCGGTGTCCTGGATAACACCCGGCCTGAACTCCACCCTGCGGTGCCGTGCGGCCTGGCACAGTGCGACCTTCCTGCTAAGGCGAGAAGGTGACCAGGCATCTCCTGTGGTGGCCGAGGGCGGAGAGGACGGAGAAGCCACTTTCCCGGTCCACCGGGCTGGCAACTACAGCTGCAGCTACCAGACCCATGCTGCGGGGAGCCTCTCTGTGCCCAGCGACACGGTGACCATCGAGGAGCTAGCCGTGCCCCCGCCGCCGGCGCTGGAGTTCAGGGGCGAGGACGCGAGGGTTCTGCGCCCCGGCGAGCGCGCATCCTTGCAGTGTGTGGCGCCCGTGAGCAGCGCGGACTTCGAGCTGCGGCGGCGCGGGGAGGCCCTGCGGGTGCCCATGAGCAGCACCAGCCCCGACCGCGTCTTTCTTGGCCTGAACTGGGCCGAGGCCGACGGCGGCCCCTATACCTGCCGCTACCGGCCTCTCCGCGCGGAAGTGGCCTGGTCGGCTGACAGCGCGCCTGTGCAGCTGGTGCGCAGCGACGGTGAGCTGCGGCGGGGCCGGAACTGGGACCCCCCTGCCTCGGCCTCCCGGCCTGGCTCCGTAGATGAGCAGGTTCCGAAGCGTCGGGCAAGTCCCGCGCCCCGCGCCCGCTCAGGCCCCTCTCCCGCAGGGTCGCTACCTGCGCCCGACCTCAGTGCCGACCCTGCCGGCCCGCGCCCCGTGCCCGGCTCCCTACTGCGCCTGCGCTGCCGCACGCCCAGGCTCGGGCTGCTCGTGGCGCTGGAGCGCGAGGACGCGCGTGGGCGCCGGCTGCTGGCCCTGCTGCGGCCTGCTCATGCCGAGGCGGAGTTCGAGCTGCGCGACGTCTCTGTGGCGGACTCGGCCAATTACAGCTGCATCTACGTGGACCCTGAGCTTCCCTTCGTGGGCTCCGCGCCCAGCGCTCGCCTGCAGCTGCGGGTGGACGGTGACCCCGTCCCACCCTGCCCAGGGCCTCCGCCCGCGCCGCGGCTCCGGGTCTTGGGGCCGCCGGTGACCCCGGGCCGCGACGCCGTCCTGCGCTGTGAGGGCTCCGTGCCCGGCGTGGTCTTCGAGCTGCTGCGTGCGGGCGAGGAGGAGGCCGTGGTGAGCGCCAGCTCCGCGAGCGCCGCTGCCGACCTGGTGCTGACCGCCGCTGGGTCCGGGCATGCGGGCAACTACAGCTGTCGCTACCGCGCATGGGGACCCGTGGCCTTCGAGTCGCCTTGGAGTGACCCGGTGGAGCTCCAGGTGGCAGGAAGCTGA

XM_004866553.1 Coding sequence

A1bg alpha-1-B glycoprotein, transcript variant X4

High confidence: 3 potential gene matches
Length: 1530 bp    Location: 197632..200537   Strand: +
>XM_004866553.1
ATGGCTGCTCCTGTGGGCTTCCTGCTGCTCTGGGGTCTCACCCTGGGCCCAGCGAGCGAGGCGGCCACAATGGTTGAAACCTGGCCCAGCCTCTGGGCAGAGTCGGCCTTGCCGCTGAAGCCCTGGGCCCAGCTGCAGCTGACCTGCCGCGCGCGCCTGGCGACCCTGGAGTTCCAGCTGCTCAAGGACGGGGTGGCCCTGGAGCACGTGCGCCTTGACTTCCCCGCCATTGCCCACCAGTTTGTGCTGGGTGAGGTGACCAGGGACAACCGGGGCCTCTACCACTGCCGCGCCGGTCTGGGTTCGGGGTGGACCCAGCTGAGCGGCCTCGTGGAGGTGACGGGCACAGAGCCCTTGCCCCCGCCCCGGCTCTCGGCTGAGCCGGTGTCCTGGATAACACCCGGCCTGAACTCCACCCTGCGGTGCCGTGCGGCCTGGCACAGTGCGACCTTCCTGCTAAGGCGAGAAGGTGACCAGGCATCTCCTGTGGTGGCCGAGGGCGGAGAGGACGGAGAAGCCACTTTCCCGGTCCACCGGGCTGGCAACTACAGCTGCAGCTACCAGACCCATGCTGCGGGGAGCCTCTCTGTGCCCAGCGACACGGTGACCATCGAGGAGCTAGCCGTGCCCCCGCCGCCGGCGCTGGAGTTCAGGGGCGAGGACGCGAGGGTTCTGCGCCCCGGCGAGCGCGCATCCTTGCAGTGTGTGGCGCCCGTGAGCAGCGCGGACTTCGAGCTGCGGCGGCGCGGGGAGGCCCTGCGGGTGCCCATGAGCAGCACCAGCCCCGACCGCGTCTTTCTTGGCCTGAACTGGGCCGAGGCCGACGGCGGCCCCTATACCTGCCGCTACCGGCCTCTCCGCGCGGAAGTGGCCTGGTCGGCTGACAGCGCGCCTGTGCAGCTGGTGCGCAGCGACGGGTCGCTACCTGCGCCCGACCTCAGTGCCGACCCTGCCGGCCCGCGCCCCGTGCCCGGCTCCCTACTGCGCCTGCGCTGCCGCACGCCCAGGCTCGGGCTGCTCGTGGCGCTGGAGCGCGAGGACGCGCGTGGGCGCCGGCTGCTGGCCCTGCTGCGGCCTGCTCATGCCGAGGCGGAGTTCGAGCTGCGCGACGTCTCTGTGGCGGACTCGGCCAATTACAGCTGCATCTACGTGGACCCTGAGCTTCCCTTCGTGGGCTCCGCGCCCAGCGCTCGCCTGCAGCTGCGGGTGGACGGTGACCCCGTCCCACCCTGCCCAGGGCCTCCGCCCGCGCCGCGGCTCCGGGTCTTGGGGCCGCCGGTGACCCCGGGCCGCGACGCCGTCCTGCGCTGTGAGGGCTCCGTGCCCGGCGTGGTCTTCGAGCTGCTGCGTGCGGGCGAGGAGGAGGCCGTGGTGAGCGCCAGCTCCGCGAGCGCCGCTGCCGACCTGGTGCTGACCGCCGCTGGGTCCGGGCATGCGGGCAACTACAGCTGTCGCTACCGCGCATGGGGACCCGTGGCCTTCGAGTCGCCTTGGAGTGACCCGGTGGAGCTCCAGGTGGCAGGAAGCTGA

XM_004866547.1 Coding sequence

Znf8 zinc finger protein 8, transcript variant X1

Length: 1653 bp    Location: 252256..238124   Strand: -
>XM_004866547.1
ATGGACCCCGAGGACCACGTGGCGATCGTGGCAATGAGCGCTCGCCCGCCGGTGGAACGGCTGCAGGAACCAGTGACCTTCTGGGATGTGGCCGTGGACTTCACCCAGGAGGAGTGGGGGCAGCTGGACCCTACACAGAGGACGCTGTACCGCGACGTGATGCTGGAGACCTTCGGGCACCTGCTCTCTGTGGGTCCTGAGCTTCCTAAGCCCGATGTCATCTCCCAGCTGGAGCAAGGGGCTGAGTTCTGGGGTGGTGACCAAGGATGCCCCCAGAGCTGCTATTCAGGCTGGGAGCCAGGCTTCCCCGAAGAGAAGCTGACTACTGGCACAGAAAGAGAAGAGTTCCCGAGGGTCACTGCCTGTCCTTCCCTGGCGGGGGTCACATGGCCGTGTGAGGGTGAGGGTGAGGGCCAGGCACACAGAAAGGACCAGAGTGACGGGTGGCAGCTGGCAGCTGGCCTTGAGGAGGGAGCAGCAGATCCCAGTCCAGGCTGTGAGAGGCTCAGACATGGGGAGAGCTGTGTGCTGAGCTCCAGCCCAAGTGCGTTCCTGAGTTCCAAGAGAGAGTATCCCTGTTCGGATGCACACGGGCCTGGCTCCGACCCTGAGCCGGACGTGGCCAGTGAGCCCCAAGGTAACCACAGGGCCTCCGGCCAGGCCGTCCTGGGCACAGAGCTGTCAAGGAGCCAGGGCCCTGACAAGCCGTACAAATGCACCGACTGCGGAAAGTCGTTCAACCACAACGCACACCTCACGGTGCACAAGAGGATCCACACAGGCGAGCGCCCGTACGTGTGCAAGGAGTGTGGGAAGGCGTTCAGCCAGAACTCGTCCCTCGTGCAGCACGAGCGCATTCACACAGGGGACAAGCCCTACAAGTGCGCGGAGTGCGGCAAGTCCTTCTGCCACAGCACGCACCTCACCGTGCACCGGCGCATCCACACCGGAGAGAAGCCCTACGCGTGCCAGGACTGCGGGAGGGCCTTCAACCAGAACTCATCCTTGGGCCGGCACCGGCGGACACACACTGGAGAGAAGCCCTACGCCTGCAGCGTGTGCGGGAAGGCCTTCTCACGCACCACCTGCCTCTTCCTGCACCTGCGCACGCACACGGAGGAGCGGCCCTATGAATGCAACCACTGTGGCAAGGGCTTCCGGCACAGCTCCTCGCTGGCCCAGCATCAGCGCAAGCACGCGGGGGAGCCGCCCTTCACCTGCCGCCCCATCTTTGAGCAGACAGCAGCCCTGCCCCGGCCCCAGTGGGCAGACGCTCTTGCCTGCACACCGCCTCTGAGCCAGGAGGAGAGGGCGCTGCGCAGCGACAGGCCCTTCAGATGCATCCAGTGTGGCAAGTGCTTCACCCAGAGCTCCCATCTTATCCGCCACCAGATCACTCACACCAGGGACCAGGAGCCATCCAGGCGGCCCCGGAGACGCCAGCAGCCCTGCAGCCGGGGCGCACAGCACACCCAGCACCCGCAGGGAGGGTCAGGACAGAGCAGGGATCAGGCCAGAGCAGCACAGCCAGCGAGCAGAGCCCTGGCCCTGTTTGACATCCACGAACTCATACAGGAGAAAAACCCTGTGCGCATCATTGGGGTGGAGGAGCCCATGGGCTCCACCGTGTTTGACCTCAGAGAGTCCACCTAG

XM_004866545.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1623 bp    Location: 337299..365131   Strand: +
>XM_004866545.1
ATGAGACTGACAACGGTGGCTCAGAAGGTTCCTATGGAAGAACTGTCCTGTNGTATGGAAATGGAAGGATTGGTGAGGGATGACCCTTGCTTGCTGGTTCTGGGTGACAACTGGGAGTGTGAGAACCAGAAGAGACATCTGAGGCAATCTACTTTACCACAGGAGAAACCAGGAGCTCAGGAAGCAGTCTCTGAATATCTTGGCTTTGGGAAGCATTTGAGTGCAAGGTTGGGCCTTCCACCATCACAGAGAGTTCCTACAACAAATGATTTCCATGATGCAGATGCCAAAATGTTGGACTGTGACCAAGCCTTACACAATTGTTCCAAAAAGTATGTAGGCAAGAGAACTGGTGACAGTGATGCCTGTGGAAAAGCCTTCCACCACTCCTCAGAAGTTACTCAGCTTGGAAGACATCAAATGAGAGACGAGCCCTATAAATACCCTGAAAATGTTAAAGCCATCAACCATTTTACCCATGTTGATGATCAAAAAATAATGAAAAGAGGAAAGAAACTGTATGAAGGCAATGACTTTGGGCACATCTTTTCCCTGAGGTCATCTCTAAGTGAAAACAGGAGGCATCACCCCACTGAGAAACCATATAAATGTACTGAATGTGGCAAATGCTTCAAACGCAATTCTTCTCTGGTTTTGCATCACCGAACTCACACTGGAGAGAAACCTTATACCTGTAATGAGTGTGGAAAATCCTTTTCTAAGAACTACAACCTGATTGTGCATCAAAGGATCCATACAGGAGAGAAGCCGTATAAATGCAGTAAGTGTGGAAAAGCCTTTAGTGATGGGTCAGCTCTGACCCAACACCAGAGGATTCACACAGGTGAGAAGCCTTATGAATGTCTAGAATGTGGAAAAACCTTTAACCGAAATTCATCTTTGATTTTACATCAAAGAACTCATACAGGAGAAAAACCATATAGATGCAATGAGTGTGGGAAACCCTTCACTGACATCTCTCACCTTACTGTGCATCTCAGAATCCACACAGGTGAGAAGCCCTATGAGTGCAGCAAGTGTGGAAAGGCTTTCCGAGATGGCTCGTACCTCACCCAGCATGAGAGGACTCACACTGGAGAGAAGCCCTTTGAATGTGTAGAGTGTGGGAAATCCTTCAACCGCAATTCCCACCTTATTGTGCATCAAAAAATCCATTCTGGGGAGAAACCCTATGAGTGTAAAGAGTGTGGGAAGACGTTTATTGAGAGTGCATACCTCATCAGACACCAGAGGATTCATACTGGTGAGAAGCCCTACGGCTGTAACCAGTGTCAGAAGCTTTTCAGAAACATCGCTGGCCTTATCCGGCACCAGAGGACTCATACTGGTGAGAAGCCCTATGAGTGTAATCAGTGTGGTAAAGCTTTCCGGGATAGCTCCTGTCTGACCAAGCACCAGAGGATTCACACCAAGGAATCTCCATACCAGTGTCTGCAATGTGGGAAGTCCTTCAAGCAGAACTCTCATCTGGCAGTTCATCAGAGACTGCATAACAGGGAGGGCCCCTACCAGTGTCCTCAGTGTGAGAAGTCATTCAGGAGGAGTTCATCCCTTGTCCGACATCAGAGAACACACCCTGAAGAGCAGCCTTTGGAAACATAA

XM_004866543.1 Coding sequence

LOC101697455 extracellular calcium-sensing receptor-like, transcript variant X2

Length: 2478 bp    Location: 417357..434086   Strand: +
>XM_004866543.1
ATGGCGTCGCTGAGTGCGGTCACCCTGTCAAGTCCTGGTCCCTGGGAGCCGCGCGTTAGAAACGTGACTCTCCTATGCCTGTTGAAAATCGTGTCCAGCTGGGGCTACCGGGTGGCCCAGAGCTTCGTCTTTGCTGTCGAGGAGATCAACAGGAGCACCCGCCTGCTGCCCAACCTGACTCTGGGCTTCTCCATCCGCAACTCCGGGGACTCCATTCACAGGGCCCTGCATGAGACCCTGTCCTTCCTCACTGGCCAGGAGGATCCTGTCCCCAACTATGTGTGCCAGTTTGGTCCACCCCGGGTTGCCTTGGTGGGGGACACACGCTCGGCTCTGTCTGTGGCCATGGCCAGGCTGCTGGGGCTCTACAAGTTTCCCCAGGTCAGTTATGCATCCACACTGCCCAGCCTCAGTGACAAGACCCAGTTCCCATCCTTCCTGCGCACCCTGGCCAGTGACCTCAAGTCCTCCTATGCTGTAACCCAGCTGGTGCTGCACTTGGGATGGTCCTGGGTCATCATCCTGGCCCAAGATGATGACTTTGGGCAGCAGGCTGGTGCTCTAGCTGCTAGAGAACTGGGAGAGGCAGACATCTGCATCGAATTCCACGTCCCAGTCCCTTCCCAGCATTCCCCTGAGAAGATCAACGCTGTGGTTCAGAAGATGCAGACCAGCACTGCCACGGGGGTCCTGGTCTTCCTGAGCAACTCCAATTTCAAGCTTATCCTGCAGAGCCTGCTGGGTTTCAGTCTCCTGGGCCAGGTCTGGGTCAGTGAGGGCCTCCTGCACACGGCACTTGCCCTGGCCATGCCTGGCATCTCTCAGGTACTGCGGGGCACATTTGGCCTTCTGCGGCACAGTAGCCGGGTACATGGATTCCCTGAGTTTTTTGCCAGCTTACACCCAAATCGGACCCCAGAGGACATGTTCCTGGGGAGGTTTTGGGAGGCCACCTTTGGGTGCAGATGGCTGCATGCGAATGGCACAGTGTCAGGAGAAGTACGGCTGTGCTCAGGTAGTGAGAGTCTGAGAGGGCATGAACATCCTTTCCAAGACGTGAGTAGAGTGGACATTGCATACACAGCCGTCTACAGTGTAGCCCATGCCCTGCAGGACCTGGTGTCCTGTGAACATGGGGATGGCATGTGCACAGACCCCAAGCACTTCCAGCCCTGGCAGCTCCTTCACCCCCTCAGGAAGGTGCGCTTCCAGACCCCTGATGGGACCCACATCATGTTCGATGCCAATGGAGACTTGGTGACAACATATGATGTTTTCCAAGGGCAACAGAGCCCCAAGGGCCAGTTCCACTTTGTCCGCATTGGCACGATGGACCCTCATCGCTCTTCAGAGGACAGAATTATGATTCGCTTGAAAGATGGTGTGCAGGTGCCCAGCTCTGTCTGCAGCACCAGCTGTGAACCAGGATCCAGTCAGATCCCCCAGCAGGGAGCCCCCCACTGCTGCTTTGAGTGCCGGCCCTGCCCCGAGGGACAGTTTACAGATCAGAGAGACATGAAGAGCTGTCGCCAGTGTCCCAAGGAGCAGTACCCAAGCCAGGCCAGAGACCGCTGCCTTCCCAGGACAGAGACCTTCCTGGCCTTCGATGAACCCCTGGGCCTTGCACTGACTTCGGTGGCGCTGGCGCTGGCCGGCCTGGCCTGCCTGGTCCTCGGGGTATTCCTGAGGTTCCGGGACACACCTGTGGTCAGGGCCAACAACAGGGCCCTCAGCTACGTGCTCCTGGTGTCCTTGGCCCTCTGTGCCCTGAGTCCCTTGCTGTTCCTTGGCCGCCCCTCACCCACCACCTGCCTCCTCCGCCAGACCACCTTTGCTGTGGTGTTCACTGTGGCCGTGTCCTGTGTCCTCGCCAAGACCCTCACTGTGGTCCTAGCCTTCAGGGTCACTAGGCCGGGACAGAGAATCCGCATGTGCCTTGGGCCCAACACCTCCTCTTTTGTGGTACTGGGTGCCTTGGTGGTGCAGGTCGTCCTCTGTGGGATCCGGCTGGGCACCTCCCCACCATTCCCACACAGTGACACAGCCTCAGAGGCAGGCCGCCTTGTGCTCCTGTGCCAGGAGGGCTCTGGTGTCGCCTTCTCCTGTGTGCTGGGCTACCTGGGCCTCCTGGCTGTGGGCACCTTCTCTGTGGCCTTCCTGGCCCGGGGCCTGCCGGATGCCTTCAACGAGACCAAGTTCCTCACCTTCAGCATGCTGCTCTTCTGCAGCGTCTGGACGGCCTTCCTACCCCTGTACCACAGTGCACGGGGCAAGGCCACTGTCGCTGTGGAGGTCTTCTCCATCTTGGCCTCCACTGCAGGACTGCTGGGTGGCATCTTCCTCCCCAAGTGCTACCTCATCCTGCTGAAGCCTGAGAGGAACACGCTGGCTGGGTTGAGGCTAGGTCACCAGGCTCAGAGTGCTCCATTTTCTCGCAGAAACACGGATACCCCCAGGCTCCCAGCACAGTACCCTTGA

XM_004867154.1 Coding sequence

Znf606 zinc finger protein 606

Length: 4296 bp    Location: 491611..546302   Strand: +
>XM_004867154.1
ATGGCAGCCATCAACCCCTGGAGCACATGGGGTGCCCTTATGGACCAGTCCTGGGGGATGGTAGCAGTTGACCCGTGGGCCTCCTGGGCTCTCTGTCCTCAGGACCCCATGTGGCATGTGGAGGAGAGCCCTGAGGAGGGAAGTGCAGCTGGGCTCCCAACAGCCCAGATCCAGGAGCCGGTGACCTTCCGAGATGTGGCCGTGGACTTCACCCAGGAGGAGTGGGGGCAGCTGGACCCTACACAGAGGATGCTGTACCGCGACGTGATGCTGGAGACCTTCGGCCACCTGCTGTCTGTGGGGCACCAGATCACCAAGCCTGAGGTCATCTCCCTGTTAGAGCAAGGAGAGGAGCCGTGGTTGGTGGAGCCCATGCATCCTCAGAGCTCTTGTCCAGAGTGGATGAGAAATCTTGAAAATAAAGCACTGATCCCAGCACAGAGTGTTTTTGAGGAAGAACAACCCCATGGCATAAAGTTGGGAAGATGCCTATGGGATGATTCTTGGTTCTCCAGATTAGGAGTTTTGGGATATAAAGACCAATTAGAAATGTACCACATGAACCAGAGTACAGCTATGAGGCAAATGGTCTTCATGCAAAAACAAGTACTGTCTCAAAGAGGTTCTGAATTCTGTGAACTTGGGGCAGAGTATAGCCAGAGCTTAAACTTTGTTCCATCTCAGAGAGTTTCCCAGTTAGAACATTTTTATAAGCCTGACATGCAGGCTGAAAGTTGGAGATATAACTCAGCCATAATGTATGCAGATAAGATTATCTGTGACAATAATAATTGTGACAAAGCATTTAACCAATCCATTCAACATGTTTATCCTGGAAGAATGCAGATTGGAGATGATCTTTTCAAATGTACTGATGCTGTGAAATCCTTCAATAATGTCATACATTATGGTGATCATAAAGGAATACACACGGGAGAAAAACTGTATGAGTATAAGGAATGCCATCAAATTTTTAATCAGAGTCCTTCATTTAATGAACACCCAAGGCTTCATTTTGGAGAAAACCAGTATTACAAAGAATATGAAAATATCTTTTACTTTTCATCCTTTATGGAACATCAAAAAATTGGCACTGTAGAGAAAGCATATAAATACAATGAATGGGAGAAAGTCTTTGGATATGATTCATTCCTTACTCAACACACGGGCACGTACACTGCAGAGAAACCCTATGATTGTAACGAATGTGGGACATCTTTCATCTGGAGCTCTTATCTTTTTCAACATAAGAAAACTCATGCTGGAGAGAAACCCTATGAATGTGATAAATGTGGAAAAGTTTTTAGGAATCGTTCAGCCCTTACCAAACATGAACGGACTCACACTGGAATAAAACCCTATGAATGTAACAAATGTGGGAAAGCCTTCAGCTGGAATTCTCATCTGATTGTACACAAGAGAGTCCATACAGGAGAAAAGCCTTATGTGTGTAACGAGTGTGGAAAGTCCTTCAACTGGAACTCCCATCTCATTGGACACCAGAGGACTCATACTGGAGAGAAACCATTTGAATGTAGGGAATGTGGGAAGTCATTCAGCTGGAGCTCCCATCTCATTGCTCACATGAGAATGCATACAGGAGAGAAACCCTTTAAATGTGATGAATGTGAAAAAGCTTTTCGAGATTATTCGGCCCTTAGTAAACATGAAAGAACTCACTCTGGAGCAAAACCTTATAAATGTACAGAGTGTGGAAAATCCTTCAGCTGGAGCTCCCATCTCATTGCTCATCAGAGAACTCACACAGGAGAGAAACCCTATAACTGTCAAGAATGTGGCAAAGCATTTCGGGAACGCTCAGCCCTCACCAAACATGAGATTATTCATTCTGGAATTAAACCTTATGAATGTAATAAATGTGGAAAATCTTGTAGCCAGATGGCTCACCTTGTTAGACATCAAAGGACTCACACTGGAGAGAAACCCTATGAATGCAATAAATGTGGGAAATCCTTTAGTCAGAGCTGTCACCTAGTTGCTCATCGGAGAATCCACACTGGTGAGAAACCCTATAAATGTAATCAGTGTGAAAGATCCTTTAACTGTAGCTCTCACCTTATTGCGCATCGGAGAACTCATACTGGAGAGAAACCATATAGGTGTAATGAATGTGGGAAAGCATTTAACGAGAGTTCTTCCCTTATTGTGCACCTGAGAAACCATACTGGAGAAAAACCCTACAAATGCAATCATTGTGAGAAGGCTTTCTGTAAGAACTCATCCCTTATTATTCATCAGAGAATGCACAGTGGACAGAAGCGCTTCATATGCAGTGACTGTGGAAGAGCCTTCAGTGGTCACTCATCCCTGCTTCAGCACCAGAGGAGTCACAGTGAAGGGAAACTGCTTCGAATGGTAAAGGCAGAGGAAAGACAACAGTTCACATTGCTTTATGAAAATGTCCAGATTCCACTGTTAGGAGACCAGGAGGGCTCTGAGGACAGTGGACCCGAGGAGTCCACACACCTGCTTCTGGAGAATGAGAAGGAGCTGGGCAATTTCACTAGCTCAGGATCTGAATGCTGTGACAGGACCGAGAAGACAGAGAGCAGCGGTCGTGCCCTGCACAGAGTCGGGTCCGCAGTGTCCCTGTCGCGCGGCTCCCGCCCCGGGCGCCCACAGAGTCAGTCGATGGCGGCCGCATCGAGGGGCCCGGCCCAGGATTCTTCCAGTCCTTGGTTCCTGGGGCCCTGGAGAAACCCCAAGCCCGGGGACCTCAGTCCGTGCCAGCCTGTATGGAGAGGTATGAAAGGAGCTCTCGTTTCTCTTCAGTGTGAGCAGGTGTGGAAGGTTATCCCAGAAAGACATCAAATGCACCCATGCTCAGAGGGGACTGTGATCTTTGAGGATGTGGCTGTGTACTTTTCCTGGGAGGAATGGGATCTCCTTGATGAGACACAGAGAGACCTGTACCACAGTGTGATGCTGGAGAACTTGGCACTTGTAACCTCCTTGGGTTGTTTGTGTGAAGCAGAAGGTGAGAAGACAAATTCTCTGCTGACTGTTTCTGCACAAAGAAGGCCCATTTCTCCTGAGAAGGCCTATGCCTGTGAGATATGTGGACCAGTCTTGAGAGACATTTTATACTTGATGGAGCACCAGCACTGTGGGCAGAAACAGTACATGGATGGGGCATGTGGGAAACAATTGCAGTTTACTGCATATCTTCATCAGCACCAGAAGCAGCACACTGGGAAGAAATTCTTCAGAAGTGATGTGGGTAGAAACTTGTTTCTGAGCAGCTACAGATTCGAGGTATCTGAGAAACCCTTTCTCTGCAGAAATGTTGGGAAGGACTTCCTGGTCAGGTCAAACTTTCTGCAGCAACAGGCCCCTCACAATGATGAGAAGTCAAGCAGCAGAACCAAGAGCACACTGGGCTTTCCTAGTGTAAAAAGTCACTACAGCTGGGGAGAGCAGATGAAAACTTTGAGCTACAAACAGGCACTTGTTCCACATCAGAGAATCTTGAGTAAAGAAAGATCTTACATGTGCACTGAATGTGGGAAATCCTTTAGTACAAGCAGTAGCCTCAATGATCATCTAAGAATTCACACATTAGAAAAGCCTTATGAATGTGGAGAATGTGGGAAATGCTATAGGCAAAGCTCTAGCCTCATTACACACCGAAGAGTCCACACTGGAATAAAACTTCATCAGTGTGATGAATGCGGAAAGTTAGTTAGTAGGAAGTATGACCTCTTCATCCATCAAAGAGTTCACACTGGAGAAAGACCTTATGGGTGCAGCAAATGTGGGAAATCATTTAGGCATAGCTCTAGCCTTGTTACACACCAGAGGATTCACACTGGAACAAGGCCTTATGAGTGTCGCAAATGTGGGAAATCCTTTACCCATAGCTCCACACTCCTTCAACACCAAAGAGTTCACTCTGGAGAAAGGCCTTATGAGTGCGGTGAATGTGAGAAATCCTTTAGCCAGAGCTCTAGCCTCATTAGACATCAGAGAAGTCACACAGGAGAAAGGCCTTATGAGTGTGGGGAATGTCAAAAATCCTTTAGCCACCACTCTAGCCTCATTAGACACCAAAGGATTCATACTGGAGAAAGGCCTTTTGAGTGTAATCAGTGTGGGAAATCCTTTAGCCAGAGCTCTAACCTCAATGATCACCAGAGAGTTCACAATGGGGAAAGGCCTTATGAGTGCAGTGAGTGTGGGAAGTCCTTTACCTTCACCACCAACCTCCTGAAACATCAGAATGTTCACAAGGATAAAGGCCTTTCAGCAACACAAGTAGGGTCTTTTTTGGACTGA

XM_004866541.1 Coding sequence

Znf551 zinc finger protein 551

Length: 1935 bp    Location: 596080..610887   Strand: +
>XM_004866541.1
ATGAGGGCAGCTGTGCCGAGGGGCCCCGCCCAGGATACGACCTTTGAGGATGTAGCCATTTACTTCTCCCAGGAGGAATGGGAGCTCCTTGATGAGGCTCAGAGACTCCTGTACTGTGATGTGATGCTGGAGATCTTTGCACTTGTGTTGTCCCTGGGTTGCTACTGTGGGACAGATGATGAGAAGATAACTTCTGAGTACAGTGTACAAATGGAAAGAATGTCACAGGTCAGGACTTCTAAGGCAAATCCATCCACCCAGGACACTCAACCCTGTGAAAAATATGTTCCAGCCTTGGAAGACACTTTGTACCAGGCTGAGCACAAAATCACATGCCCTGTTCAGAAATCGTACTTGGGTGGCACAAGTGTTAGAGACTTCTCTTTCGATACAAATCTTCAGCACCAAAAGCATTATGGTAGAGAACAGCCCCAGGGAAGGGATGTGGACAGGGCCTCCTTTGTGGCCAGCTTCAGGTTCCATGTCTTGACCAAGTCTTTCCCCTGTGGAGAGCCTGGCATGGACTTCCTTCAGCAGCAGACCATTTGTAATGATGAGCAGCCACACAGTAGCAGCATCAAGTGCAGGGAAGCATTTTGGACTGGAAACGGACATTGCAAGTGGGATGAATGCAGAAAAGCTTCAACTCTTAAGCACATACTTGTTCAAGAGCAGTGTGTCTGTGCTGGAGAAGGGCTTCGTGAATGTAGCAAATGTGAGAAAGCCTTCACCTGCAAGTTCATATTTTTCCAGCACCAGGATACTCATTTTGGACAAAGAACATCTGAATGTGAGTATGGAAAATCCCTTTGCAACAAGTGCCACCTTATTGGGCCTAAAAGATTTCACACTAGAGCAAGCCCTCATGAATGTAACGAATGTGGAAATGCCTTTATCCACAAGTCTGACAAGAGACAGCACAGTGGAAGAATGCCTTATGAGTGTGGGGAATGTAGCAAATCTTTTACCTACAAATCTAACCTCATTGAACACCAGAGAGTTCACACAGGAGAAAGGCCTTACACATGTAGCAAGTGTGGGAAATCCTTTAGACAGAGCTCCAGCCTCTTTCGACACAAGAGAGTCCACACTGGACAAAAGTCTTATGAATGCTGTTATTGTGGGAATGCCTTTAGCTGCAAATCTGAACTCATTCAACACCAGAGAATTCATAGTGGAGAAAGGCATTATGAGTGCAGTGAATGTGGGAAAACCTTTAGACAGTATTATAACCTCATCAGACACTGGAATGTTCACACTGGCGATAAGCCTTATGAGTGTGGTGAATGTGCAAAATCCTTTAGCCGCAAATTTACCCTCATTCAACACCAGAGTGTTCACACTGGACAAAGGCCTTATGAGTGCAGTGAATGTGGGAAATCCTTTATCCGGAAATCTGACCTCATTCAGCACCAAAGAATTCACACTGGCATAAGACCTCATGAGTGTGATGAATGTGGGAAATCTTTTAGACAACGCTCTGGCCTCATTCAACACCAGAGAGTTCATTCTGGAGAAAAGCCTTATAAGTGCAGTAAATGTGGAAAAACCTTCAGTCAGAGTGCGACCCTCATTCAACACCAGCGAGTTCACACTGGAGAAAAGCCTTATGAGTGCGGTGAATGTGGAAAATCCTTCAGTCAAAGCTCTACCCTCATCCAGCACCAGAGAGGTCACACTGGAGAAAGGCCTTATAAGTGCAGTGAATGTGGGAAACCCTTTACTCACAAATCTGACCTCATTCAGCATCAAAGAGTTCACGCTGGAGAAAGGNNNNNNNNNNNCAGTGAATGTGGGAAACCCTTTACTCACAAATCTGACCTCATTCAGCATCAAAGAGTTCACGCTGGAGAAAGGCCTTATAAGTGCAGTGAATGTGAAAAATCCTTTCGTCGCAAATCTAATCTGACTCGTCACTTGCAAGTTCATGCCTAA

XM_004867155.1 Coding sequence

LOC101714271 zinc finger and SCAN domain-containing protein 4-like

Length: 1188 bp    Location: 705632..690520   Strand: -
>XM_004867155.1
ATGGCCAAGTTTCGGAGTCATTTGGCCCCCGGTGGGAACTTATTCTGTGCACATTGCTTGCAAGGTTTGGAATGTGGTCACGGCAGTCGGGGCTCCACAGGTCCCGATCGACCTTTGGCACTCGATCGGGACAGGACTACGCCAGAAAAGCATACCAAGGAAGAGATTATTTCTCAGTTAGCCATGGAGCAGTTTATGCTTAGTGGATACTGCAGGGACAAGTCTGTGCTGAAAAAGAAATGGGAAGCAAGTGGTAGAAACCTGGAGAAATTAATGGAAGACCTGACGGATGACTGTATGAAGCCACCTGTGGTAGTCCACGTCTGCATGCAAGGACAGGAAGCTCTCTTTTCTGAGGATATGTCCTTAAGAGAAGTCATTGTTCATCTGAAAAAGCAGCTGTCAGCAGAAGCCTTAGCCGGAGAGACTCTGGGGACATGCTCTCAGGGTTCCCAGAATGCTCCTTTGGAAACAAGACAAGGAAGTGAATATAAAGATGGCTGCACCAATTCCTGGGAAATTACTCAAGAAAAGGACAATATTACTAATCCAGAAGAAGAAACAGTTTCCCCACTTATTATCCCGGAAGAGAACTGTCCTAGGCCTGCAGAGGGAGGTGTTTCTTGGGAGAACACACATAACTCTGGAAGAGCAAGGTTGGGCACCTGCCAGTTGCAGGAAGAGTCCGCGAAGGCATCTTCTTACCAAGATGTCCCTGTGGATGTGGGACCAGGGTTTTTCTCTAGGTCAGACCAGTCCTCCCCTGAACCTGTCCCTCCCAACCACAGCAATGACGGAAACTCCACCGGTGAGGGACACCAAGAAAAATTCCATGGAGGCCAAAAATCATACAAATGTGAGGAGTGTCCCAAGACATTTGTTTATCTCTCCCATTTATTAGCCCACCAAAGAAGACATAGGAATGAGAGGCCGTTTGTTTGTGCTGAGTGTAACAAAGGGTTCTTCCAGACATCAGATCTACGTGTGCATCAGATGATTCACAAGAAAGAGAAGCCTTTCACATGCAGCAGATGTGGAAAGTCCTTTACACATAAAACAAACCTGCAGGCTCATGAGAGAATTCACACAGGAGAGAAGCCCTATAAATGCACCCTTTGCCACAGAAGCTTCCGCCAGTCATCCACATACTATCGTCACCAGAAGATTCATGAGAAACTGCCATCCTAA

XM_004866566.1 Coding sequence

LOC101707932 zinc finger protein 416-like

Length: 1854 bp    Location: 776361..769327   Strand: -
>XM_004866566.1
ATGGACTTCGCACAGGACTGTGTGACCTTTGAGGACGTGGCCATTTCCTTCTCCCAGGAAGAGTGGGGGCTTCTTGATGAGACTCAGAGGCTCCTGTACCTCGGTGTGATGCTGGAGAACTTTGCACTTGTAACTTCACTGGTTTGTTGGCATGGAATGGAGAACGAAGAGATTGCTTCTGAGCAGGTTTCTACAGAAGGATCATCACAGGTCACAACTCCAAAGAGAAGTTCATCCACCCAGGACACTCACCCCTGTGAAGTTTGTGTCCCAGTCCTAAAAGATATTTTGCAAATGACAGATGAACCTGCACAGAAACCATACTTGATGGGTGCACATCCAAACCTTCACCAGGACCAGAACACTCACAATTCAGAGGAAGCTTTGAAAAGGGAATTGGACAACACTTCATTTAGGAAGAGCTGCAGATTGCATGTGTCAGGAAAGACCTTCACCTGGGGGATAGTTGGAAAGGACTTCTTGTCCACATTGGATTTTATCCAGCCTCCGTCCAGTCCCAGCTGTGAGAAGTCAAACACAATCACTGAGTTTGGGGAGACCTTTCCTACTGGAATAAGCCATTACAAATGGGGTGAATTAAGAAAAGCTTCCAGCCACAAACACACTTTTGTTCACCACCCAAGAATCTGTACTGGAAAAAGGCTTTATGAATCTACCAAATATGGGAAAGCCTACCCCTGCAAGTACTCACTTACTCAGCTTCAGAAAATGCACAATAGAGAAAGGCCTTACGAGTGCAGTGTCTGTGGGAAATCTTTTAGCCAAACCTCCCACTTGAATGACCACCACAGAATCCACACTGGAGAAAGACCTTATGAGTGTGATCAGTGTAGAAAATCATTTAGCCAAAGAGCTACTCTTATTAAACATTACAGAGTTCACACTGGAGAAAGGCCCTATGAGTGTGGTAAATGTGGAAAATCCTTTAGCCAAAGTTCTAACCTCATTGAACACTGCAGAATTCACACTGGAGAAAGGCCTTATGAGTGTGAAGAATGTGGGAAAGCATTTGGGTCCAAATCCACTCTTGTTCGGCACCAGAGAACTCACACAGGTGAAAAGCCTTATGAGTGTGGTGAATGTGGGAAATTCTTCACACAGAGCCACAGCTTGCTTGAACACCGGATAATTCACACTGGAGCAAGGCCTTATGAGTGTAGCCAGTGTGGAAAATCCTTTGGCCTAAAGTACAGCCTCATTCAACATCAGTTAATTCACAGTGGAGCTAGGCCTTTTGAGTGTGACCAGTGTGGAAAATCTTTTAGCCAAAGGGCGACCCTCAATAAACATCACAAAGTTCACACTGCAGAAAGGCCTTATGAATGTAGGGAATGTGGGAAGGCATTTATGTTCAAATCCAAACTTGTTCGGCACCAGCGGACGCACACTGGAGAAAGACCTTTTGAGTGCAGTGAGTGTGGGAAATTCTTTAGACAAAGCTACACCCTTGTTGAACACCAGAAAATTCACACTGGATTAAGGCCTTATGAATGTGGTCAGTGTGGGAAGTCCTTTATCCAAAAGTCTGCCCTTATTCAACACCAGGTAGTTCACACTGGAGAAAGGCCTTATGAGTGTGGCAGATGTGGGAAATCTTTTACACAACACTCTGGTCTCATTCTCCACCGAAAATCTCACACCATGGAGAGGACTTGTGAAGACAACAAATATGGAGAAGCCTGAAGCTTGAGGTCGAGCACCATTTAACTCCTGAAAGTTCATACTTTAGAAAGGCCTCAGACCTATAGGGAATGTGTTATTTCTTTTTTCAGTATTAGCCTTTGTGAGGGAACCACTTGCTTGAAGTTAAACCTCATACTTCCATATACCTAG

XM_004866575.1 Coding sequence

Znf550 zinc finger protein 550

Length: 1206 bp    Location: 870037..859479   Strand: -
>XM_004866575.1
ATGGCGGCGCGGGCGGAGGCGGCGCGGGTCTTGGTGACCTTCAGTGACGTGGCTGTTACCTTCACCCCGGAGGAGTGGAGACAGCTGGACTTGGCCCAGAGAACTCTGTATCAGGAGGTGATGCTGGAGACCTGTGCAATTCTGGTCTCACTAGGGCACCAGGTTCCTAAACCAGAGTTGATCTACCTGCCAGAACACGGACAGGAGCTGTGGACAGTGAAGAAAGGCCTCTTGCCTAGCACCTATGCAGATGACAGAGCACAACTTCAGACCAGAATGCCAACCACCTGTTTCCCAGTTAAATCTGAGGGAATCTTGCTCCGGGGAAGGCTGACTCAGGAAGGGATTTTGAAAAGGCAAAAAAGCTGTCCTAAGGAGACCTGTCCTGTGAGCACATGTCCTGAAGATGATGGTTTGGAAACAGATGGTGGTTTGCACCCCAGGGTGTTACAGGAGCAAACCCGTCCAGATGTTCTCTGTGTACATCCAGATGACTCTCAGCGACCTGGGAAAGACACCTCAGTTCTTGCAGGGACGAACCCATACAGATGCAAGCAGTGTGGGAAAGGTTTTAGCAGGAAGTGGTATCTTGTTCGACATCAGTGGGTTCATACCGGTCTGAAGCCCTATGTGTGCAGTGCATGTGGGAAAGCCTTCAGTCAGAACTCAACCCTCATTCGTCACTACTTCATTCACACTGGGGAGAAGCCATACACATGTGTCGAGTGTGGGAAGGCCTTCAAACGCAGGGCATACCTGAAACAGCACCATCCTGTCCACACTGGGGAGAAGCCCTATGAGTGTGTGCAGTGTGGGAAGGCCTTCACCCACCGCTCTACATTTATTCGCCATAGTAGGACACACACTGGAGAAAAACCCTTTGAGTGCAAAGAATGTGAGAAAACCTTCACCAGTAAAGCACACCTGATTCAACACTATCTTGTTCACACTGGAGAGAAGCCCTACAAGTGCATGGACTGTGGGAAGGCCTTCCGGTGCAGTGCGGAACTGGTGCAGCACCAGCGGGTCCACACTGGGGAGAAGCCCTATGAGTGTGCCCAGTGCGGAAAGGCCTTCCACCGCAGCATGTACCTGGTCCAGCACTTGGTCATCCACACTGGGGAGATGCCCTACAAGTGCATTGAGTGTGGCAAGGCTTTCAAACGCCGGTCACACCTCCTGCAGCACCAGCGGGTCCACTCTTGA

XM_004866576.1 Coding sequence

LOC101712015 zinc finger protein 805-like, transcript variant X1

Length: 1983 bp    Location: 1029990..1007933   Strand: -
>XM_004866576.1
ATGGGGGAAACTGAGGCTGGGAACGGGTCCGTCCACCAAAATCACCCACCCAGGCTGGGGAGGCGCTGGAGGTCGCCTGCCCCTCGGTCCTCGGCGTCCGCGATGGCGGCGGCGCAGGTGGCTGTGACCTTCGAAGATGTGGTTATAAGATTCAATCAGGAGGAATGGGATCAGCTGGACCTTTCCAAGAGGACCTTATACTGGGAGGTGATGCTGGAGACCTGTGGGCTTCTCATAGCTGTGGGCTGTCCTTTGTCCAAGTCAGAGCTGCTTTCCCAGTTGGAGCACAGACAGGCATTAAGGAAAGCCAAAGATGACCTATCCCAGAGCTTCTGTCCAGGTAACAGCACAAAACTTAACAGCATGAAACCCACTCTTGCTTACCAGTCCTGGCCTGAGGGAGCCTTGGTTCATGATCATCAGACAGAAGGAGCCTCTGGGGACTTCCTGTTGGGTCCGCACCAGGGTCAGGATGAGCCCTGTGAAGTGCAGAAAAGACTTAGACCAGGGATGGAGGCCCCAAGGGAGAAGCTTCCTGGGAATAGAAGCCCTGGACATGATGGCATGGGATCAGCTGATAGTGTGTGTTCAAGGTCTGTGCAGGAGCACATCTCTCCAGACCCAGCTACCTGTATCTGTGATTCTAATATGCCAGCTGCAGATCCCTCGATCCGTGAAGGAGAAAATTCCTACAAATGCAAGGAATGTGGGAAAGTGTTTAAGAATGAACGCTTACTTATTCAACATAAGTGGATTCACACAGGAGTGAAGCGCTACGAATGTACAGAGTGTGGAAAGACCTTCCGCAAGAGCACTCACCTCCTCCAGCACCATATTGTCCATACCAGGGAGAGGCCGTATATGTGCTTGGAGTGTGACAAAGCCTTTAGCCGGAAATCATATCTTACTCAGCACCAACGTACGCACAGTGGAGAGAAGCCTTATAAGTGCAGTGAATGTGGACAGGCCTTTGCCCATCGCTCTACATTTGTTTTGCATAACAGAATGCACACTGGAGAAAAACCTTTTGTGTGCAAAGAGTGTGGCAAAGCCTTTCGAGATAGACGAGCTTTCAATCGTCACAACATCTTCCACACGGGAGAGAAGCCCTATCAGTGCTCAGAGTGTGGCAAGGCCTTCAACCAACGGTCTTACCTCACGTGGCACCAACAGACTCACAAGGGAGTGAAACCTTTCCAATGCAATGAGTGTGGGAGAGGATTCTGTGAGATTGCAGGCCTCATTCACCATTATGTCATCCACACTGGGGAGAAGCCCTATAAGTGTGTGGAGTGCGGGAAGGCCTTCCTCCGTGAGCCACACCTCAAGCAGCACCAGCGCATCCACACTGGGGAGAAGCCGTATGTGTGCAGTGAGTGTGGAAAGGCATTCGCCCACTATTCTACTTTGACCTTGCACAGAAGGGCTCACACTGGAGAAAAACCCTTCGAGTGCAAAGAGTGTGGGAAAGCCTTTACCAATCGGAAAGACCTCATCCGCCATGTCAGCATCCACACGGGAGAGAAGCCTTATGAGTGCATGGAATGTGGGAAGGCCTTCAACCGCAGGTCACACCTGATAAGGCACCATCGGATTCACAATGAGGAGAAGCCCTACAAATGCATGGAGTGTGGGAAAACCTTTTCACGGAGTACAAACCTCATTCAGCACTCCAACATTCACACTGGAGATAAGCCCTATAAATGCAATGAATGTGGAAAGGCCTTCAGCCTCAGCTCCTCCCTCCGGTACCATCAAAGGATGCACACAGGGAAAATCGCAGCTAGCGTCAGAGATGAGGGAAAGCCTTTCACAAGTGTGCAAGCCTCTGTCAACATTGAAGGACTCATATTGGGGAAAAATTTTCTTCACATAACCACTGACGAACATCAGTGTTCAAGGGAATCATCTAACACAGACTCTGGTCATTCATACCACAGAGAAACTGGGTTAGTGGCATCTCTATTAAAAAAATGTAAATAA

XM_004866577.1 Coding sequence

LOC101712015 zinc finger protein 805-like, transcript variant X2

Length: 1983 bp    Location: 1029990..1007933   Strand: -
>XM_004866577.1
ATGGGGGAAACTGAGGCTGGGAACGGGTCCGTCCACCAAAATCACCCACCCAGGCTGGGGAGGCGCTGGAGGTCGCCTGCCCCTCGGTCCTCGGCGTCCGCGATGGCGGCGGCGCAGGTTGCTGTGACCTTTGAAGATGTGGCTGTGAGATTTACTCAGGAGGAGTGGGAGCAGCTGGACCTTTCCAAGAGGACCTTATACTGGGAGGTGATGCTGGAGACCTGTGGACTTTTGACTGCTGTGGGCTGTCCTTTGTCCAAGTCAGAGCTGCTTTCCCAGTTGGAGCACAGACAGGCATTAAGGAAAGCCAAAGATGACCTATCCCAGAGCTTCTGTCCAGGTAACAGCACAAAACTTAACAGCATGAAACCCACTCTTGCTTACCAGTCCTGGCCTGAGGGAGCCTTGGTTCATGATCATCAGACAGAAGGAGCCTCTGGGGACTTCCTGTTGGGTCCGCACCAGGGTCAGGATGAGCCCTGTGAAGTGCAGAAAAGACTTAGACCAGGGATGGAGGCCCCAAGGGAGAAGCTTCCTGGGAATAGAAGCCCTGGACATGATGGCATGGGATCAGCTGATAGTGTGTGTTCAAGGTCTGTGCAGGAGCACATCTCTCCAGACCCAGCTACCTGTATCTGTGATTCTAATATGCCAGCTGCAGATCCCTCGATCCGTGAAGGAGAAAATTCCTACAAATGCAAGGAATGTGGGAAAGTGTTTAAGAATGAACGCTTACTTATTCAACATAAGTGGATTCACACAGGAGTGAAGCGCTACGAATGTACAGAGTGTGGAAAGACCTTCCGCAAGAGCACTCACCTCCTCCAGCACCATATTGTCCATACCAGGGAGAGGCCGTATATGTGCTTGGAGTGTGACAAAGCCTTTAGCCGGAAATCATATCTTACTCAGCACCAACGTACGCACAGTGGAGAGAAGCCTTATAAGTGCAGTGAATGTGGACAGGCCTTTGCCCATCGCTCTACATTTGTTTTGCATAACAGAATGCACACTGGAGAAAAACCTTTTGTGTGCAAAGAGTGTGGCAAAGCCTTTCGAGATAGACGAGCTTTCAATCGTCACAACATCTTCCACACGGGAGAGAAGCCCTATCAGTGCTCAGAGTGTGGCAAGGCCTTCAACCAACGGTCTTACCTCACGTGGCACCAACAGACTCACAAGGGAGTGAAACCTTTCCAATGCAATGAGTGTGGGAGAGGATTCTGTGAGATTGCAGGCCTCATTCACCATTATGTCATCCACACTGGGGAGAAGCCCTATAAGTGTGTGGAGTGCGGGAAGGCCTTCCTCCGTGAGCCACACCTCAAGCAGCACCAGCGCATCCACACTGGGGAGAAGCCGTATGTGTGCAGTGAGTGTGGAAAGGCATTCGCCCACTATTCTACTTTGACCTTGCACAGAAGGGCTCACACTGGAGAAAAACCCTTCGAGTGCAAAGAGTGTGGGAAAGCCTTTACCAATCGGAAAGACCTCATCCGCCATGTCAGCATCCACACGGGAGAGAAGCCTTATGAGTGCATGGAATGTGGGAAGGCCTTCAACCGCAGGTCACACCTGATAAGGCACCATCGGATTCACAATGAGGAGAAGCCCTACAAATGCATGGAGTGTGGGAAAACCTTTTCACGGAGTACAAACCTCATTCAGCACTCCAACATTCACACTGGAGATAAGCCCTATAAATGCAATGAATGTGGAAAGGCCTTCAGCCTCAGCTCCTCCCTCCGGTACCATCAAAGGATGCACACAGGGAAAATCGCAGCTAGCGTCAGAGATGAGGGAAAGCCTTTCACAAGTGTGCAAGCCTCTGTCAACATTGAAGGACTCATATTGGGGAAAAATTTTCTTCACATAACCACTGACGAACATCAGTGTTCAAGGGAATCATCTAACACAGACTCTGGTCATTCATACCACAGAGAAACTGGGTTAGTGGCATCTCTATTAAAAAAATGTAAATAA

XM_004866593.1 Coding sequence

Znf805 zinc finger protein 805

Length: 1893 bp    Location: 1077167..1065995   Strand: -
>XM_004866593.1
ATGGCGGCGGCACTGGTGGACCCGGCGCAGGTGCCTGTGACCTTCGAGGATGTGGCCGTGACCTTCACCCAGGAGGAGTGGGGGCAGCTGGACCTGGCTCAGAGGGCCTTGTACCAGGAGGTGATGCTGGAGAACTGTGGGCTCCTGGTCTCACTGGGGTGTCCTGTTCCCACACCTGAGCTGATCCAGCAGCTAAAGCACAGGCAGCAGCCGTGGACAGCGAGGCTGGTCTGTGCCCAAAGCACACAGTCAGATGACAGTGGAAAAACCAAAGCCACAGAATCCACCACGTCTGAGCCAGCCTTGTGTGAGGGAGCCGGGCTTCAGGGGCATTTGTCGAGTGGAGCCTCCCGGGGCTCCCCATGGATGCAAGCTCTGTGTCAGGGCCGCCCGCCAGACAGGCAGGAAGGATGTTGGAGATCAGGGGGTCAAGCCCTGAGGGAGAAGCTTCCCAGGAGCTCGAGCGCTGGCCCTGGTGGCTTAGGGACCGAAGATAGAGTGCATCTGAGGGCTGTGCAGGAGCAGGTTCCTGCAGGAGATGCAGGAGATGTGCCACCCTGTGCAGCACACAGCCCCAGGGGAGATGCCGTGACCAGGGAGCAAGAGGAAAACATCTTCCGGTGTGGCGAGTGCGGGAAGGTGTTTAACAAGAAACGCCTTCTTGCTCGACACGAGAGGATCCACTCTGGCGTGAAGCCCTACGAGTGCGTCGAGTGTGGGAAGACCTTCAGCAAGAGCACCTACCTCCTTCAGCACCACATGGTCCACACCGGGGAGAAGCCGTATAAGTGCATGGAGTGTGGCAAGGCCTTCAGCCGAAAGTCACACCTTACGCAGCACCAGCGCATCCACAGTGGAGAGAAGCCTTATAAATGCAGTGAGTGTGGAAAGGCCTTCACCCACCGCTCCACATTTGTCTTGCATAACAGGAGCCACACTGGAGAGAAGCCTTTTGTGTGCAAAGAGTGTGGCAAAGCCTTTCGAGATAGGCCGGGGTTCATTCGACACTACATCATCCACAGTGGAGAGAACCCCTATGAGTGCTTCGAGTGTGGGAAGGTCTTCAAGCACAGGTCGTACCTCATGTGGCACCAGCAGACCCACACGGGTGAGAAGCCCTACGAGTGCAGCGAGTGTGGGAAAGCATTTTGTGAGAGCGCGGCCCTCATCCACCACTACGTCATCCACACCGGGGAGAAGCCCTTCGAGTGCCCGGAGTGCGGCAAGGCCTTCAACCACAGGTCCTACCTCAAGAGGCACCAGCGCATCCACACTGGGGAGAAGCCCTACGTGTGTGGCGAGTGCGGGAAGGCCTTCACCCACTGCTCCACCTTCATCTTGCACAAAAGGGCCCACACTGGAGAAAAGCCCTTCGAGTGCAAAGAGTGTGGGAAAGCCTTCAGCAACCGGGCAGACCTCATCCGCCACTTCAGCATCCACACAGGAGAGAAGCCCTACGAGTGCACGGACTGCGGCAAGGCCTTCAACCGCAGGTCAGGCCTCACCAGGCACCAGAGAATTCACAGTGGCGAGAAGCCCTATGAATGTGTCGAGTGTGGGAAGACCTTTTGCTGGAGCACAAATCTCATCCGCCACTCCATCATCCACACAGGAGAGAAGCCCTATGAATGCAATGAATGCGGAAAGGCCTTCAGCCGAAGCTCCTCACTCACACATCATCAAAGGATGCACACGGGGAGAAACCCAGCCAGTGCTGGAGAGGAGGGACGGCCTTTCACAAGTGCACAAGCCTCTGTCAACATCCAAGAACTTCTACTGGGAAATGACTTCTTGAATGTAACCAGTGAAGAAAATCTTTTACGGGAGGAAACATCTTACACGGCATCTGACCGTTCATACCAAAGAGAAAGCCCCCAGATGTCTTCACTATGA

XM_004867158.1 Coding sequence

Aurkc aurora kinase C

High confidence: 3 potential gene matches
Length: 912 bp    Location: 1094754..1090012   Strand: -
>XM_004867158.1
ATGGAGACCGACGCGTCTGCGTCCGCGCCTCTCCTCCAGACCTGCCTGCAGGCTGCGCACCCCGAGCAGCCCGGGCAACCCGCCAGGAGGCCCCTCGCCATCCAGGACTTCGACATCGGGTGTCCTCTGGGCAAGGGCAAGTTCGGGAGTGTGTACCTGGCCCGGCTCAAAGAAAGCCGTTTCATCGTGGCCCTGAAGGTCCTCTTCAAATCCCAGATAGAGAAGGAGGGAGTGGAGCACCAGCTGCGCAGGGAGGTGGAGATCCAGGCGCATCTGCATCACCCCAATATCTTGCGCCTCTACAACTACTTCCATGACACCCGCCGGGTTTACCTGATTCTGGAGTACGCTCCGCGGGGTGAGCTCTACAAGGAGCTGCTCAGAAGCCACACCTTGGATGAGAAGCGGACGGCCACGATCATGGAGGAGCTGGCAGATGCCCTGGCCTACTGCCATGCCAAGAAGGTGATCCACAGGGACATCAAGCCAGAGAACCTGCTGCTCGGGTTCAGGGGTGAGGTGAAGATTGCAGACTTCGGCTGGTCAGTGCACACCCCGTCGCTGAGGAGGAAGACAATGTGCGGGACTCTGGACTACCTGCCACCGGAGATGATTGAGGGGCGGACATACGACGAGAAGGTGGACCTCTGGTGCATCGGGGTGCTGTGCTACGAGCTGCTGGTGGGAAGCCCACCCTTCGAGAGCGCCTCGCACAGCGAGACCTACAGGCGCATCCTCAAGGTGGACGTGAGGTTTCCCCCCGCGATGCCTGTGGGGGCCCAGGACCTGATCTCCAGGCTTCTGAGGTTCCAGCCCGGGGAGCGGCTGCCCCTGAGCCAGATCCTGGTGCACCCCTGGGTCAAGGCCCACTCCCGGAGGGTGCTGCCACCCTGTGCTCAGGCGGCTCCCTGA

XM_004866695.1 Coding sequence

Cdc42ep5 CDC42 effector protein (Rho GTPase binding) 5, transcript variant X7

Length: 426 bp    Location: 2272082..2276418   Strand: +
>XM_004866695.1
ATGCCGGTGCTGAAGCAGCCGGGCCCAGCGCAGCCCAAGAAGCGCAGCCCAAGAGGCGGTGCGCTGTCCATCTCGGCGCCGCTCGGTGACTTCCGGCACACGCTGCACGTGGGGCGCGGCGGCGACACCTTCGGGGACACCTCCTTCCTGAGCCGCCACGGGGCCGCGCCGCCCGCCGCCGAGCCCCACTCGAAGCCCGCGGGGACCCCGCCGCCCCCGCCCGCGGCGCCCCCAGACCCGCTGCTGTCCTTCCACCTGGACCTGGGCCCCTCCATGCTGGACGCCGTGCTGGGCGTCATGGATGCGGGGCGCGCGGGAGCGGCTGCCCAGCCGGAAGCAGACGCACGCCCTGGGACGCAGCCCCGCCGGGGCCCCCGCAGCCGCCCCGACGCCCGCCTGGAGCTGGACCGCGGGCTCGGCCTGTAG

XM_004866586.1 Coding sequence

Peg3 paternally expressed 3, transcript variant X3

Length: 4173 bp    Location: 1193656..1222068   Strand: +
>XM_004866586.1
ATGTGCCCGCGGGAAGACGACACCAGCAGTGACATGACCAGTGATGATGACGAGGACGACAACGACGTGAGCCCCAACGGAGAAGGAGCGCCGTCACCTCAGCCAGTCGGCTCCTTCAGCAGGCTGCCCCCGCAGGACCTGTCCCTTCCTGAAATGGCAGACACAAGCTTTGAGGTGGACAGCAGCGACGGCAGGGACACCATGGGCATGGACTGGGAGGCCCAACTGCAGAATGCCCAGTTCTACCAGCATGTCATGAGCCTGTATGAGGACAGGAAACCGCAGAACACGATCCAGGACAACATGGAGAGCTACAGGAAGCTGCTCTCCCTGGGGATGCAGCTTGCCGAAGACTACCGGCACTCCCACATGACACAGGGCCACTCATTGTGGGGCAACAGAGATGCCTACCCCAGCACCAGCCAAGGTCTCCACATTGTGCCGGAAGCCATAAAGTCAGCCCAGCAGCAGGGAGTCTGCAAAGACGAATCTTCCTGTGGAATGATCATGGAAAACCTCATCAAAGAAATGTCCCATGGCCCCAAGGCAGGAAGAGCGAGGGAGTCCAGTGAGGGGCTTCAGGAGTTCGGTGATGACTGGAAGGACGCTTCGTGTGGCAAGACAGACTCGGCGATCCAGGGGAGGGGTTTTGAAGGGAATTCATTCAGGGGAGGCTTCAGGTTCACCTCAAACCTTGTCTCCAGAAAGAAAGTCCTGGAAAGAAAGAGGTGCTGTCATTTTGACGCTGATGGGAAGGCCCCAGTTCGCGATCACAGAGGCTGTGCCAGGAAGAAGCCCTTGGAGTGTGGGGGTGAGACGAGGGAAGCCGTGAGCGTGAGCAACCTGAGCAGCCTCAGCTGCGCCCCCGCCTCGGAGTCACAGCCCGTCGATTTGGGGGTGATGCCGTATCTGTGCGAAGAGTGCGGGAGGTCGTTCGCTGTCGTCTCAGAATTTGTGGAGCACCAGATCCTGCACACTAGGGAGAATCTTTATGAGTATGGTGAGTCCTTCATGCACAGCGTGGCTGTCAGCGAGGTTCGGAGCAGTGGAGGGGAGTGCTTGGAGTGCAAGGAGTGCGGGGAGGCCTGCGCTACGAGCTCTGCCCTGGCCGAGCATTGCAAGACCCACGCCAGAGAGTACTTCAAGGAGTGCAAGGGTCAGGACAGTGAGGGGACCCAAGTGCTCAGCCCGACCTTCAGTGCGCTTCAGAAGATATACGGGCAAAACAAATTCTACGAGTGCAAGGTGTGTAAGGAAACCTTCCTTCACAGCTCGGCCCTGATGGAGCACCAGAAAACCCATGGGAGAGGAGACGTCACCGATGACAGAGATGGCGAATGCTGGCCCGAGCGTGAAGGCCAGCGCAGGGAATCACTTCTGCCCTGCTCGAGCCTGCATGGGTTTCAGAAGATGGATGGCAAAGAGAAAATCCACAAATGTGAGGTGTGTGGGGAGTCGTTCCTTCACAGCTCACCCCTGAAAGAGCATCAGAAAATACACTTGGGAGGAAATCCATTTGAAAATAAGAGTGAATTGTGTGAGGAAACCCCCGTTCCTGGGCAGTCCCTTAGAAGGCGGCAGAACACCTCCCCTCAGGACAGCCTCTTCGACTTTACCGAGGGCAGGGTTGCCTTGGTGCAGAGCCCGGACCTTGGTGAGGGTCAGAAAATTCATTCTCGAAAGAACTTCTTCAAAGGCAAGGGTTACGAGAAACCCGTCACTCACAGAGGGCCCTCCTCAGAGTCTCAGAAGAGCCATACCCTTAGCAGACCGCCTGAAGACGAAGACAAAGACGAGGAGGAGGCATTCACCATCAGCTCCAGTCCCCATGAAGATCGGAAGTTTCCCTTGGAAGAAAATGTCCTTCAGGGGAAACCGTACGAGAAGTCTGTTGTTTTCAGCACGGCCTCTGCTGATGCTCAGAAACGGCCCACAGTGGGGCTCAGAAGACCAAAGCTACCGGCAGAGTCTCCCCTTCAGAGCTCTGATGTTATTAACTGTCAGAAAGTCTATGCTCCAGGGGACGCCTGTGAAGGCAAAGGTTACAAGAGGCCCATCGTCCATGGCTGGGCTGCCCCCACACCTCTGAAATGTCCCAGAGGGAATGAACAGGTTGAATGTGGTGAGAAGGGAGAATCCTCCATGTATCTCTCAGACCTTCATAACAAGTGGCAGGGGATTCCCACCAGAGAGCACCCATGTGAGGGGGATAAGAATACCAGCTACAAGGGCTACACCATGCAGAGTGCACCCCACACTGAGCCTCAAAGAAGTCGTGCTGGAGGGGGAGCTGGTGAATTTAAGCCAGATGGCAAATTGACCATTCCCAGCTCAAATGTTCGTGAACACCAGAAGGCTCGGGCTAAAAGGAAATACATTGAGCCCCGGAGCAACGAGACCTCTGCACTTCATTCCCTGCTATCTGGGGAGCTGCCAACAGTTTGTGCTAGAGAGAAGCTCTGTGGACGTCAGGAGTGTGGAGAGTCCTTTGCTTGTAGCTCCGACCTCGCTGAACACCAGAAGATTCACAACGGAGAGAAGCCCTGTGGAAGCAGGAACTATGAGCGATCTGCCATTCACAACTTCTCCCCTGCTGACCCTCAGACAAGTTATACCCAAGAGCACTGTACTGAGGAGCAAGCATGCAACAAACCTAGGGAGTTGGGGCCGGGCTCTGCTGCCAGCAGCAACCTCGATGCACATCAGACAGCTGACGCCCAAGAGAAGCCCCACGGCGAGGAGCCCCATGGGCAGGAGACCAGGGGAGACCCTGCCGCTCAGGCCTCTGAGTTGGATGAGCCCGATGGCACCGTCTATGAACGTCAGGACTGTGGGCTGGACTTCGCAGCCCTCTCAGACCTCAGGGGCCACCAGGATGTCCAGAGCAGGAAGCGCCATGTTGACAGTTGTGAGTCCGGACATCCGGAAGTTCACACGCATTCCGTCAGCAAATGTGAGAAAGTGTGCAGCGGTGAGCAGCTCGACGAATGCCCCAAGCGTGGGGAGCCTTTTCTTCACAGCTCCTTCCTCTTCAAGCATCAGAGGATTCATGAACAAGACCAGTCGTGCACCATGGAGGCATGTGATGACAATTTCATCTCTCTCTCACCTGTGAAGCCACAGAGGAACCGTGCCATTGGGAGGAACCCCGGCTTGGCCATTCGATGCAGTCAGTGCACACAAGGCTTCCTCCGTAGCTCCACCCTGGACATGCACACAAGGCATCTCAGGGATGACAAGTCAGTGGAGCAGAGTGAGAGGCCTGAGATTTTCTGTCAGGGCCACGCCCTCACTGAACTTCCGGGGAGTGAAACCAGAGAGAAACTCATGGAGTGTCTGTTGTGTGAGGAGAGCGTCTTCACTCCGAGAGAGCTTGGGGATCACCACAGGAAGGTTCACAAAGATGAGCCCCACGAGTACCAGCCCTCTGACACGCGGGCCTCGCTTCTCACCAGGCCCCTCAGAAAACCCAAACCATTCTTTGAATGCAAGGACTGTGGGCAGCCCTTTATTCCTGACACAGACCTCACTGGACACCACGGATTTTATCCTGAGGAAGCTACCACTGCCCAGGAGGCTGAAGCTGATGTCCTCATTCCACAAGAAGCTCTGCAGATTCAGGGCTCAAATGCGGACGCTGCCGAGCCAGGCATGGAGGTGGCAGAGCCAGGGGTAGAAGCTGCTGAGGCCAGCGGAGAGGCCAAAGGGCCAGATGAAGAGGCCACTGAGCCCAGCGGGGAGGCCGAGGCCCAGCCCACTGGGGATGCTGACGAACCAGATGGGGCCGGGATTGAAGACCCAGAAGAAAGCAGCAGAGAGCCAGAGGGAGATGCTGATGAGCCCGACGGCGCGGGGATAGCGGACCCAGAAGAAGGAGGTGCTGATCCAGAGGTCTGGGTGGAGGGGTCGTACTACAGCTGCCCCGAGTGCGCGGAGATCTTCCTGTCCAGCACGGCCTTCGGTGAGCACCTGCAGATCCACGCCCGCGTGGTCATCCTGGAGCCTGCGAATGCCCTGGGCCACTGCTCCGGCTACATGGCGCGTGCCCGGCAGGCCGGCCAGAAGCCCTTCAGGTGTGGGGTCTGTGGCCAGCCCTTTGGCCACTTCCCGCCCCTCGCTAGGCACCAGAACACGCACAGGCGTGAGTGTCGGGGATGGAGGGCCTTCACCTAG

XM_004866589.1 Coding sequence

Peg3 paternally expressed 3, transcript variant X6

Length: 4173 bp    Location: 1194934..1222068   Strand: +
>XM_004866589.1
ATGTGCCCGCGGGAAGACGACACCAGCAGTGACATGACCAGTGATGATGACGAGGACGACAACGACGTGAGCCCCAACGGAGAAGGAGCGCCGTCACCTCAGCCAGTCGGCTCCTTCAGCAGGCTGCCCCCGCAGGACCTGTCCCTTCCTGAAATGGCAGACACAAGCTTTGAGGTGGACAGCAGCGACGGCAGGGACACCATGGGCATGGACTGGGAGGCCCAACTGCAGAATGCCCAGTTCTACCAGCATGTCATGAGCCTGTATGAGGACAGGAAACCGCAGAACACGATCCAGGACAACATGGAGAGCTACAGGAAGCTGCTCTCCCTGGGGATGCAGCTTGCCGAAGACTACCGGCACTCCCACATGACACAGGGCCACTCATTGTGGGGCAACAGAGATGCCTACCCCAGCACCAGCCAAGGTCTCCACATTGTGCCGGAAGCCATAAAGTCAGCCCAGCAGCAGGGAGTCTGCAAAGACGAATCTTCCTGTGGAATGATCATGGAAAACCTCATCAAAGAAATGTCCCATGGCCCCAAGGCAGGAAGAGCGAGGGAGTCCAGTGAGGGGCTTCAGGAGTTCGGTGATGACTGGAAGGACGCTTCGTGTGGCAAGACAGACTCGGCGATCCAGGGGAGGGGTTTTGAAGGGAATTCATTCAGGGGAGGCTTCAGGTTCACCTCAAACCTTGTCTCCAGAAAGAAAGTCCTGGAAAGAAAGAGGTGCTGTCATTTTGACGCTGATGGGAAGGCCCCAGTTCGCGATCACAGAGGCTGTGCCAGGAAGAAGCCCTTGGAGTGTGGGGGTGAGACGAGGGAAGCCGTGAGCGTGAGCAACCTGAGCAGCCTCAGCTGCGCCCCCGCCTCGGAGTCACAGCCCGTCGATTTGGGGGTGATGCCGTATCTGTGCGAAGAGTGCGGGAGGTCGTTCGCTGTCGTCTCAGAATTTGTGGAGCACCAGATCCTGCACACTAGGGAGAATCTTTATGAGTATGGTGAGTCCTTCATGCACAGCGTGGCTGTCAGCGAGGTTCGGAGCAGTGGAGGGGAGTGCTTGGAGTGCAAGGAGTGCGGGGAGGCCTGCGCTACGAGCTCTGCCCTGGCCGAGCATTGCAAGACCCACGCCAGAGAGTACTTCAAGGAGTGCAAGGGTCAGGACAGTGAGGGGACCCAAGTGCTCAGCCCGACCTTCAGTGCGCTTCAGAAGATATACGGGCAAAACAAATTCTACGAGTGCAAGGTGTGTAAGGAAACCTTCCTTCACAGCTCGGCCCTGATGGAGCACCAGAAAACCCATGGGAGAGGAGACGTCACCGATGACAGAGATGGCGAATGCTGGCCCGAGCGTGAAGGCCAGCGCAGGGAATCACTTCTGCCCTGCTCGAGCCTGCATGGGTTTCAGAAGATGGATGGCAAAGAGAAAATCCACAAATGTGAGGTGTGTGGGGAGTCGTTCCTTCACAGCTCACCCCTGAAAGAGCATCAGAAAATACACTTGGGAGGAAATCCATTTGAAAATAAGAGTGAATTGTGTGAGGAAACCCCCGTTCCTGGGCAGTCCCTTAGAAGGCGGCAGAACACCTCCCCTCAGGACAGCCTCTTCGACTTTACCGAGGGCAGGGTTGCCTTGGTGCAGAGCCCGGACCTTGGTGAGGGTCAGAAAATTCATTCTCGAAAGAACTTCTTCAAAGGCAAGGGTTACGAGAAACCCGTCACTCACAGAGGGCCCTCCTCAGAGTCTCAGAAGAGCCATACCCTTAGCAGACCGCCTGAAGACGAAGACAAAGACGAGGAGGAGGCATTCACCATCAGCTCCAGTCCCCATGAAGATCGGAAGTTTCCCTTGGAAGAAAATGTCCTTCAGGGGAAACCGTACGAGAAGTCTGTTGTTTTCAGCACGGCCTCTGCTGATGCTCAGAAACGGCCCACAGTGGGGCTCAGAAGACCAAAGCTACCGGCAGAGTCTCCCCTTCAGAGCTCTGATGTTATTAACTGTCAGAAAGTCTATGCTCCAGGGGACGCCTGTGAAGGCAAAGGTTACAAGAGGCCCATCGTCCATGGCTGGGCTGCCCCCACACCTCTGAAATGTCCCAGAGGGAATGAACAGGTTGAATGTGGTGAGAAGGGAGAATCCTCCATGTATCTCTCAGACCTTCATAACAAGTGGCAGGGGATTCCCACCAGAGAGCACCCATGTGAGGGGGATAAGAATACCAGCTACAAGGGCTACACCATGCAGAGTGCACCCCACACTGAGCCTCAAAGAAGTCGTGCTGGAGGGGGAGCTGGTGAATTTAAGCCAGATGGCAAATTGACCATTCCCAGCTCAAATGTTCGTGAACACCAGAAGGCTCGGGCTAAAAGGAAATACATTGAGCCCCGGAGCAACGAGACCTCTGCACTTCATTCCCTGCTATCTGGGGAGCTGCCAACAGTTTGTGCTAGAGAGAAGCTCTGTGGACGTCAGGAGTGTGGAGAGTCCTTTGCTTGTAGCTCCGACCTCGCTGAACACCAGAAGATTCACAACGGAGAGAAGCCCTGTGGAAGCAGGAACTATGAGCGATCTGCCATTCACAACTTCTCCCCTGCTGACCCTCAGACAAGTTATACCCAAGAGCACTGTACTGAGGAGCAAGCATGCAACAAACCTAGGGAGTTGGGGCCGGGCTCTGCTGCCAGCAGCAACCTCGATGCACATCAGACAGCTGACGCCCAAGAGAAGCCCCACGGCGAGGAGCCCCATGGGCAGGAGACCAGGGGAGACCCTGCCGCTCAGGCCTCTGAGTTGGATGAGCCCGATGGCACCGTCTATGAACGTCAGGACTGTGGGCTGGACTTCGCAGCCCTCTCAGACCTCAGGGGCCACCAGGATGTCCAGAGCAGGAAGCGCCATGTTGACAGTTGTGAGTCCGGACATCCGGAAGTTCACACGCATTCCGTCAGCAAATGTGAGAAAGTGTGCAGCGGTGAGCAGCTCGACGAATGCCCCAAGCGTGGGGAGCCTTTTCTTCACAGCTCCTTCCTCTTCAAGCATCAGAGGATTCATGAACAAGACCAGTCGTGCACCATGGAGGCATGTGATGACAATTTCATCTCTCTCTCACCTGTGAAGCCACAGAGGAACCGTGCCATTGGGAGGAACCCCGGCTTGGCCATTCGATGCAGTCAGTGCACACAAGGCTTCCTCCGTAGCTCCACCCTGGACATGCACACAAGGCATCTCAGGGATGACAAGTCAGTGGAGCAGAGTGAGAGGCCTGAGATTTTCTGTCAGGGCCACGCCCTCACTGAACTTCCGGGGAGTGAAACCAGAGAGAAACTCATGGAGTGTCTGTTGTGTGAGGAGAGCGTCTTCACTCCGAGAGAGCTTGGGGATCACCACAGGAAGGTTCACAAAGATGAGCCCCACGAGTACCAGCCCTCTGACACGCGGGCCTCGCTTCTCACCAGGCCCCTCAGAAAACCCAAACCATTCTTTGAATGCAAGGACTGTGGGCAGCCCTTTATTCCTGACACAGACCTCACTGGACACCACGGATTTTATCCTGAGGAAGCTACCACTGCCCAGGAGGCTGAAGCTGATGTCCTCATTCCACAAGAAGCTCTGCAGATTCAGGGCTCAAATGCGGACGCTGCCGAGCCAGGCATGGAGGTGGCAGAGCCAGGGGTAGAAGCTGCTGAGGCCAGCGGAGAGGCCAAAGGGCCAGATGAAGAGGCCACTGAGCCCAGCGGGGAGGCCGAGGCCCAGCCCACTGGGGATGCTGACGAACCAGATGGGGCCGGGATTGAAGACCCAGAAGAAAGCAGCAGAGAGCCAGAGGGAGATGCTGATGAGCCCGACGGCGCGGGGATAGCGGACCCAGAAGAAGGAGGTGCTGATCCAGAGGTCTGGGTGGAGGGGTCGTACTACAGCTGCCCCGAGTGCGCGGAGATCTTCCTGTCCAGCACGGCCTTCGGTGAGCACCTGCAGATCCACGCCCGCGTGGTCATCCTGGAGCCTGCGAATGCCCTGGGCCACTGCTCCGGCTACATGGCGCGTGCCCGGCAGGCCGGCCAGAAGCCCTTCAGGTGTGGGGTCTGTGGCCAGCCCTTTGGCCACTTCCCGCCCCTCGCTAGGCACCAGAACACGCACAGGCGTGAGTGTCGGGGATGGAGGGCCTTCACCTAG

XM_004866587.1 Coding sequence

Peg3 paternally expressed 3, transcript variant X4

Length: 4173 bp    Location: 1196230..1222068   Strand: +
>XM_004866587.1
ATGTGCCCGCGGGAAGACGACACCAGCAGTGACATGACCAGTGATGATGACGAGGACGACAACGACGTGAGCCCCAACGGAGAAGGAGCGCCGTCACCTCAGCCAGTCGGCTCCTTCAGCAGGCTGCCCCCGCAGGACCTGTCCCTTCCTGAAATGGCAGACACAAGCTTTGAGGTGGACAGCAGCGACGGCAGGGACACCATGGGCATGGACTGGGAGGCCCAACTGCAGAATGCCCAGTTCTACCAGCATGTCATGAGCCTGTATGAGGACAGGAAACCGCAGAACACGATCCAGGACAACATGGAGAGCTACAGGAAGCTGCTCTCCCTGGGGATGCAGCTTGCCGAAGACTACCGGCACTCCCACATGACACAGGGCCACTCATTGTGGGGCAACAGAGATGCCTACCCCAGCACCAGCCAAGGTCTCCACATTGTGCCGGAAGCCATAAAGTCAGCCCAGCAGCAGGGAGTCTGCAAAGACGAATCTTCCTGTGGAATGATCATGGAAAACCTCATCAAAGAAATGTCCCATGGCCCCAAGGCAGGAAGAGCGAGGGAGTCCAGTGAGGGGCTTCAGGAGTTCGGTGATGACTGGAAGGACGCTTCGTGTGGCAAGACAGACTCGGCGATCCAGGGGAGGGGTTTTGAAGGGAATTCATTCAGGGGAGGCTTCAGGTTCACCTCAAACCTTGTCTCCAGAAAGAAAGTCCTGGAAAGAAAGAGGTGCTGTCATTTTGACGCTGATGGGAAGGCCCCAGTTCGCGATCACAGAGGCTGTGCCAGGAAGAAGCCCTTGGAGTGTGGGGGTGAGACGAGGGAAGCCGTGAGCGTGAGCAACCTGAGCAGCCTCAGCTGCGCCCCCGCCTCGGAGTCACAGCCCGTCGATTTGGGGGTGATGCCGTATCTGTGCGAAGAGTGCGGGAGGTCGTTCGCTGTCGTCTCAGAATTTGTGGAGCACCAGATCCTGCACACTAGGGAGAATCTTTATGAGTATGGTGAGTCCTTCATGCACAGCGTGGCTGTCAGCGAGGTTCGGAGCAGTGGAGGGGAGTGCTTGGAGTGCAAGGAGTGCGGGGAGGCCTGCGCTACGAGCTCTGCCCTGGCCGAGCATTGCAAGACCCACGCCAGAGAGTACTTCAAGGAGTGCAAGGGTCAGGACAGTGAGGGGACCCAAGTGCTCAGCCCGACCTTCAGTGCGCTTCAGAAGATATACGGGCAAAACAAATTCTACGAGTGCAAGGTGTGTAAGGAAACCTTCCTTCACAGCTCGGCCCTGATGGAGCACCAGAAAACCCATGGGAGAGGAGACGTCACCGATGACAGAGATGGCGAATGCTGGCCCGAGCGTGAAGGCCAGCGCAGGGAATCACTTCTGCCCTGCTCGAGCCTGCATGGGTTTCAGAAGATGGATGGCAAAGAGAAAATCCACAAATGTGAGGTGTGTGGGGAGTCGTTCCTTCACAGCTCACCCCTGAAAGAGCATCAGAAAATACACTTGGGAGGAAATCCATTTGAAAATAAGAGTGAATTGTGTGAGGAAACCCCCGTTCCTGGGCAGTCCCTTAGAAGGCGGCAGAACACCTCCCCTCAGGACAGCCTCTTCGACTTTACCGAGGGCAGGGTTGCCTTGGTGCAGAGCCCGGACCTTGGTGAGGGTCAGAAAATTCATTCTCGAAAGAACTTCTTCAAAGGCAAGGGTTACGAGAAACCCGTCACTCACAGAGGGCCCTCCTCAGAGTCTCAGAAGAGCCATACCCTTAGCAGACCGCCTGAAGACGAAGACAAAGACGAGGAGGAGGCATTCACCATCAGCTCCAGTCCCCATGAAGATCGGAAGTTTCCCTTGGAAGAAAATGTCCTTCAGGGGAAACCGTACGAGAAGTCTGTTGTTTTCAGCACGGCCTCTGCTGATGCTCAGAAACGGCCCACAGTGGGGCTCAGAAGACCAAAGCTACCGGCAGAGTCTCCCCTTCAGAGCTCTGATGTTATTAACTGTCAGAAAGTCTATGCTCCAGGGGACGCCTGTGAAGGCAAAGGTTACAAGAGGCCCATCGTCCATGGCTGGGCTGCCCCCACACCTCTGAAATGTCCCAGAGGGAATGAACAGGTTGAATGTGGTGAGAAGGGAGAATCCTCCATGTATCTCTCAGACCTTCATAACAAGTGGCAGGGGATTCCCACCAGAGAGCACCCATGTGAGGGGGATAAGAATACCAGCTACAAGGGCTACACCATGCAGAGTGCACCCCACACTGAGCCTCAAAGAAGTCGTGCTGGAGGGGGAGCTGGTGAATTTAAGCCAGATGGCAAATTGACCATTCCCAGCTCAAATGTTCGTGAACACCAGAAGGCTCGGGCTAAAAGGAAATACATTGAGCCCCGGAGCAACGAGACCTCTGCACTTCATTCCCTGCTATCTGGGGAGCTGCCAACAGTTTGTGCTAGAGAGAAGCTCTGTGGACGTCAGGAGTGTGGAGAGTCCTTTGCTTGTAGCTCCGACCTCGCTGAACACCAGAAGATTCACAACGGAGAGAAGCCCTGTGGAAGCAGGAACTATGAGCGATCTGCCATTCACAACTTCTCCCCTGCTGACCCTCAGACAAGTTATACCCAAGAGCACTGTACTGAGGAGCAAGCATGCAACAAACCTAGGGAGTTGGGGCCGGGCTCTGCTGCCAGCAGCAACCTCGATGCACATCAGACAGCTGACGCCCAAGAGAAGCCCCACGGCGAGGAGCCCCATGGGCAGGAGACCAGGGGAGACCCTGCCGCTCAGGCCTCTGAGTTGGATGAGCCCGATGGCACCGTCTATGAACGTCAGGACTGTGGGCTGGACTTCGCAGCCCTCTCAGACCTCAGGGGCCACCAGGATGTCCAGAGCAGGAAGCGCCATGTTGACAGTTGTGAGTCCGGACATCCGGAAGTTCACACGCATTCCGTCAGCAAATGTGAGAAAGTGTGCAGCGGTGAGCAGCTCGACGAATGCCCCAAGCGTGGGGAGCCTTTTCTTCACAGCTCCTTCCTCTTCAAGCATCAGAGGATTCATGAACAAGACCAGTCGTGCACCATGGAGGCATGTGATGACAATTTCATCTCTCTCTCACCTGTGAAGCCACAGAGGAACCGTGCCATTGGGAGGAACCCCGGCTTGGCCATTCGATGCAGTCAGTGCACACAAGGCTTCCTCCGTAGCTCCACCCTGGACATGCACACAAGGCATCTCAGGGATGACAAGTCAGTGGAGCAGAGTGAGAGGCCTGAGATTTTCTGTCAGGGCCACGCCCTCACTGAACTTCCGGGGAGTGAAACCAGAGAGAAACTCATGGAGTGTCTGTTGTGTGAGGAGAGCGTCTTCACTCCGAGAGAGCTTGGGGATCACCACAGGAAGGTTCACAAAGATGAGCCCCACGAGTACCAGCCCTCTGACACGCGGGCCTCGCTTCTCACCAGGCCCCTCAGAAAACCCAAACCATTCTTTGAATGCAAGGACTGTGGGCAGCCCTTTATTCCTGACACAGACCTCACTGGACACCACGGATTTTATCCTGAGGAAGCTACCACTGCCCAGGAGGCTGAAGCTGATGTCCTCATTCCACAAGAAGCTCTGCAGATTCAGGGCTCAAATGCGGACGCTGCCGAGCCAGGCATGGAGGTGGCAGAGCCAGGGGTAGAAGCTGCTGAGGCCAGCGGAGAGGCCAAAGGGCCAGATGAAGAGGCCACTGAGCCCAGCGGGGAGGCCGAGGCCCAGCCCACTGGGGATGCTGACGAACCAGATGGGGCCGGGATTGAAGACCCAGAAGAAAGCAGCAGAGAGCCAGAGGGAGATGCTGATGAGCCCGACGGCGCGGGGATAGCGGACCCAGAAGAAGGAGGTGCTGATCCAGAGGTCTGGGTGGAGGGGTCGTACTACAGCTGCCCCGAGTGCGCGGAGATCTTCCTGTCCAGCACGGCCTTCGGTGAGCACCTGCAGATCCACGCCCGCGTGGTCATCCTGGAGCCTGCGAATGCCCTGGGCCACTGCTCCGGCTACATGGCGCGTGCCCGGCAGGCCGGCCAGAAGCCCTTCAGGTGTGGGGTCTGTGGCCAGCCCTTTGGCCACTTCCCGCCCCTCGCTAGGCACCAGAACACGCACAGGCGTGAGTGTCGGGGATGGAGGGCCTTCACCTAG

XM_004866591.1 Coding sequence

Peg3 paternally expressed 3, transcript variant X8

Length: 4002 bp    Location: 1214278..1222068   Strand: +
>XM_004866591.1
ATGAGGGCAAGGAATATGTGTCATGTGGCTTTGGGATCTGCCTCAGAGTGCAGCACCAAGAATGCCCAGTTCTACCAGCATGTCATGAGCCTGTATGAGGACAGGAAACCGCAGAACACGATCCAGGACAACATGGAGAGCTACAGGAAGCTGCTCTCCCTGGGGATGCAGCTTGCCGAAGACTACCGGCACTCCCACATGACACAGGGCCACTCATTGTGGGGCAACAGAGATGCCTACCCCAGCACCAGCCAAGGTCTCCACATTGTGCCGGAAGCCATAAAGTCAGCCCAGCAGCAGGGAGTCTGCAAAGACGAATCTTCCTGTGGAATGATCATGGAAAACCTCATCAAAGAAATGTCCCATGGCCCCAAGGCAGGAAGAGCGAGGGAGTCCAGTGAGGGGCTTCAGGAGTTCGGTGATGACTGGAAGGACGCTTCGTGTGGCAAGACAGACTCGGCGATCCAGGGGAGGGGTTTTGAAGGGAATTCATTCAGGGGAGGCTTCAGGTTCACCTCAAACCTTGTCTCCAGAAAGAAAGTCCTGGAAAGAAAGAGGTGCTGTCATTTTGACGCTGATGGGAAGGCCCCAGTTCGCGATCACAGAGGCTGTGCCAGGAAGAAGCCCTTGGAGTGTGGGGGTGAGACGAGGGAAGCCGTGAGCGTGAGCAACCTGAGCAGCCTCAGCTGCGCCCCCGCCTCGGAGTCACAGCCCGTCGATTTGGGGGTGATGCCGTATCTGTGCGAAGAGTGCGGGAGGTCGTTCGCTGTCGTCTCAGAATTTGTGGAGCACCAGATCCTGCACACTAGGGAGAATCTTTATGAGTATGGTGAGTCCTTCATGCACAGCGTGGCTGTCAGCGAGGTTCGGAGCAGTGGAGGGGAGTGCTTGGAGTGCAAGGAGTGCGGGGAGGCCTGCGCTACGAGCTCTGCCCTGGCCGAGCATTGCAAGACCCACGCCAGAGAGTACTTCAAGGAGTGCAAGGGTCAGGACAGTGAGGGGACCCAAGTGCTCAGCCCGACCTTCAGTGCGCTTCAGAAGATATACGGGCAAAACAAATTCTACGAGTGCAAGGTGTGTAAGGAAACCTTCCTTCACAGCTCGGCCCTGATGGAGCACCAGAAAACCCATGGGAGAGGAGACGTCACCGATGACAGAGATGGCGAATGCTGGCCCGAGCGTGAAGGCCAGCGCAGGGAATCACTTCTGCCCTGCTCGAGCCTGCATGGGTTTCAGAAGATGGATGGCAAAGAGAAAATCCACAAATGTGAGGTGTGTGGGGAGTCGTTCCTTCACAGCTCACCCCTGAAAGAGCATCAGAAAATACACTTGGGAGGAAATCCATTTGAAAATAAGAGTGAATTGTGTGAGGAAACCCCCGTTCCTGGGCAGTCCCTTAGAAGGCGGCAGAACACCTCCCCTCAGGACAGCCTCTTCGACTTTACCGAGGGCAGGGTTGCCTTGGTGCAGAGCCCGGACCTTGGTGAGGGTCAGAAAATTCATTCTCGAAAGAACTTCTTCAAAGGCAAGGGTTACGAGAAACCCGTCACTCACAGAGGGCCCTCCTCAGAGTCTCAGAAGAGCCATACCCTTAGCAGACCGCCTGAAGACGAAGACAAAGACGAGGAGGAGGCATTCACCATCAGCTCCAGTCCCCATGAAGATCGGAAGTTTCCCTTGGAAGAAAATGTCCTTCAGGGGAAACCGTACGAGAAGTCTGTTGTTTTCAGCACGGCCTCTGCTGATGCTCAGAAACGGCCCACAGTGGGGCTCAGAAGACCAAAGCTACCGGCAGAGTCTCCCCTTCAGAGCTCTGATGTTATTAACTGTCAGAAAGTCTATGCTCCAGGGGACGCCTGTGAAGGCAAAGGTTACAAGAGGCCCATCGTCCATGGCTGGGCTGCCCCCACACCTCTGAAATGTCCCAGAGGGAATGAACAGGTTGAATGTGGTGAGAAGGGAGAATCCTCCATGTATCTCTCAGACCTTCATAACAAGTGGCAGGGGATTCCCACCAGAGAGCACCCATGTGAGGGGGATAAGAATACCAGCTACAAGGGCTACACCATGCAGAGTGCACCCCACACTGAGCCTCAAAGAAGTCGTGCTGGAGGGGGAGCTGGTGAATTTAAGCCAGATGGCAAATTGACCATTCCCAGCTCAAATGTTCGTGAACACCAGAAGGCTCGGGCTAAAAGGAAATACATTGAGCCCCGGAGCAACGAGACCTCTGCACTTCATTCCCTGCTATCTGGGGAGCTGCCAACAGTTTGTGCTAGAGAGAAGCTCTGTGGACGTCAGGAGTGTGGAGAGTCCTTTGCTTGTAGCTCCGACCTCGCTGAACACCAGAAGATTCACAACGGAGAGAAGCCCTGTGGAAGCAGGAACTATGAGCGATCTGCCATTCACAACTTCTCCCCTGCTGACCCTCAGACAAGTTATACCCAAGAGCACTGTACTGAGGAGCAAGCATGCAACAAACCTAGGGAGTTGGGGCCGGGCTCTGCTGCCAGCAGCAACCTCGATGCACATCAGACAGCTGACGCCCAAGAGAAGCCCCACGGCGAGGAGCCCCATGGGCAGGAGACCAGGGGAGACCCTGCCGCTCAGGCCTCTGAGTTGGATGAGCCCGATGGCACCGTCTATGAACGTCAGGACTGTGGGCTGGACTTCGCAGCCCTCTCAGACCTCAGGGGCCACCAGGATGTCCAGAGCAGGAAGCGCCATGTTGACAGTTGTGAGTCCGGACATCCGGAAGTTCACACGCATTCCGTCAGCAAATGTGAGAAAGTGTGCAGCGGTGAGCAGCTCGACGAATGCCCCAAGCGTGGGGAGCCTTTTCTTCACAGCTCCTTCCTCTTCAAGCATCAGAGGATTCATGAACAAGACCAGTCGTGCACCATGGAGGCATGTGATGACAATTTCATCTCTCTCTCACCTGTGAAGCCACAGAGGAACCGTGCCATTGGGAGGAACCCCGGCTTGGCCATTCGATGCAGTCAGTGCACACAAGGCTTCCTCCGTAGCTCCACCCTGGACATGCACACAAGGCATCTCAGGGATGACAAGTCAGTGGAGCAGAGTGAGAGGCCTGAGATTTTCTGTCAGGGCCACGCCCTCACTGAACTTCCGGGGAGTGAAACCAGAGAGAAACTCATGGAGTGTCTGTTGTGTGAGGAGAGCGTCTTCACTCCGAGAGAGCTTGGGGATCACCACAGGAAGGTTCACAAAGATGAGCCCCACGAGTACCAGCCCTCTGACACGCGGGCCTCGCTTCTCACCAGGCCCCTCAGAAAACCCAAACCATTCTTTGAATGCAAGGACTGTGGGCAGCCCTTTATTCCTGACACAGACCTCACTGGACACCACGGATTTTATCCTGAGGAAGCTACCACTGCCCAGGAGGCTGAAGCTGATGTCCTCATTCCACAAGAAGCTCTGCAGATTCAGGGCTCAAATGCGGACGCTGCCGAGCCAGGCATGGAGGTGGCAGAGCCAGGGGTAGAAGCTGCTGAGGCCAGCGGAGAGGCCAAAGGGCCAGATGAAGAGGCCACTGAGCCCAGCGGGGAGGCCGAGGCCCAGCCCACTGGGGATGCTGACGAACCAGATGGGGCCGGGATTGAAGACCCAGAAGAAAGCAGCAGAGAGCCAGAGGGAGATGCTGATGAGCCCGACGGCGCGGGGATAGCGGACCCAGAAGAAGGAGGTGCTGATCCAGAGGTCTGGGTGGAGGGGTCGTACTACAGCTGCCCCGAGTGCGCGGAGATCTTCCTGTCCAGCACGGCCTTCGGTGAGCACCTGCAGATCCACGCCCGCGTGGTCATCCTGGAGCCTGCGAATGCCCTGGGCCACTGCTCCGGCTACATGGCGCGTGCCCGGCAGGCCGGCCAGAAGCCCTTCAGGTGTGGGGTCTGTGGCCAGCCCTTTGGCCACTTCCCGCCCCTCGCTAGGCACCAGAACACGCACAGGCGTGAGTGTCGGGGATGGAGGGCCTTCACCTAG

XM_004867160.1 Coding sequence

LOC101717067 olfactory receptor 5-like

Length: 957 bp    Location: 1310116..1309160   Strand: -
>XM_004867160.1
ATGGAGTGGTCTCTGGAATTCACTAACAGATCTGGCAACCAGGACTTTATCCTCCTGGGTCTGTCCGCCAGGCCACGCACCAGAGACGTCCTCTTCGCTGCATTCCTGGCCCTCTACCTGCTGATCCTCCTGGAGAACACGCTCATCATCTACCTCACCTGCAGCTGTTGCGAGCTCCGCAAGCCCATGTACTTCTTCCTGGGCAACCTCAGCGGTCTGGAGCTGTGCTACGTGTCGGTGACCATGCCCACGCTGCTCGCGGGGCTGAGGGCGGGTGTTTGCCGCGTGTCCTTTCCTGCCTGCATGGCGCAGCTCTTTCTCTTCCTGGCCCTCATCGGTACCAAGTGCACGCTGCTGGCCTCCATGGCCTACGACCGCTACGTGGCCGTCTGCCTCCCGCTGCACTATCCACTGCGCATGCGGCCCCCGGTCTGCCGGGGCCTGGCCGCGGGCTCGTGGCTGGGGGGGCTGGGGGTGTCGGCGGCCCGGACCGCGTGCGTCGCCCGCCTCACCCGCTGCGGGCCGGGCGTCCTCAACCACTTCTTCTGCGACGCCGGGGTCCTGCGCGGCGGGGCCTGCGGGCCTGCGGCTGGGGCGAAGCTGGCCGACGCCCTGGCGGCCGGGGCCGTGGTGGGCGGGTCGCTGCTGGCCGCCCTGGCCGCCTACGCAGCCATCGCGGTCGCCGTGCTGCGCCTGCCCTCGGCCGCCGCGGCGCGCAGGGCCCTGGCCGCCTGCGCCTCGCACCTGGCCGTCATGGGCGTCTTCTACTCCGCGGTGCTCTTCGTGGACTCCCGGCCGGGCCGAGGCCACCCCGCTGACCTCAACAAGGTGCTGTCGCTTCTCTACACGGCGGTCACGCCCGCGTGCAGCCCGGTCGTCTACTGCCTGCGCAACCGCCAGGTGCAGGCCGCCCTGCAGAGGGTACTTTGCCGCCGCGTAGGCTCTCGCGAGAACTGA

XM_004866604.1 Coding sequence

Znf667 zinc finger protein 667, transcript variant X2

Length: 1959 bp    Location: 1503935..1489748   Strand: -
>XM_004866604.1
ATGCCTGCTACACGAGGGAGATCTAGGCCCAAGCCTCAGAACCCCAAATGCTTATTGAACTTTTCCTGGTGGTCCCACATCGCCCGTGTTTGGAATGTGTCTGCCATTTCTCCAGCCCTGTGGAAACCCAAGCCTGTGGTGAGTAGACGGGTGACTTTTTCATTTCAGGCACCAGTGACATTTTCAGACTTGGCCATCTACTTCTCCCAGGAGGAGTGGGAATGGCTGAGCCCCACGCAGAAGGAGTTATACGAAGAGGTCATGTTAGAGAACTATCGGAACCTGGTGTCGGTTGGTCTTTGCCTTCGGAGGCCAAATGTCATCACCTTACTGGAGAAAGGGAAGGAGCCCTGGATCGTGGAGCCACCAAGGAGACGCTGGTGCCCCGATTTAGCATCTAAGTGTGAGATCGAGAAATTACCACCAAATCAGTGCAGCAAATCTAAGCAAAGCTTCTATCAAAGACCAGTTTCTATACAAATAAAGATTCCCACAGGCAAGAGGGTAGAGTTACTCCGAAGAAGGGCCAAGAAAGGGCTTTCAGCGAAGAAATCTTTGAAATGCAAGGACTGTGGGAAAATCTTCAGTCAGAGATCATCCCTCAAACTTCATCAGAATGCTCACACTGGAGAGAGGCCTTATGAATGCAGTCGTTGTAGAAAAGTTTTCAGACAGATCACATCCCTCATCCTTCACCAGAGAATTCACAATGAAAAGAAAAGCTATGGATGTGATCAGTGTGGGAAAGGCTTCAGTAAAAGCATAACCCTTATTCTACACAGGAGAATTCATAGTAGAAAGGAAACTTCTGACAATGGGATGGCCTCCAGTCCCAATACTTCTCTCAGTGCCCACCCCAGCAGTCATGTTGTCAAGAAGGCCCTCCAGTGCAGAAAATGTGGGAGAGCCTTTAGTCGTGTGGCAGCCCTTTTACTTCATAGGAGAATTCACAGTAGAAGGAAAATACATAAGTGCAATACTTGTGGGAAGGGCTTCAAAAAGAAATCAGTCCTTATTACACACAAAAGAATTCATACCAGAGAGAAAGCCCACAAAAAGGAGAAGGCCTTAGGTCAGAGTATACAGCGAAGAAATCGATTTTTAGAAAATCCTTTTAAATGCAGAAAGTGTGGTAAGTCCTTTCATAGGATTTCACCCCTTCTGCTTCATCAGAAAGTCCACACTTCAAGGAAACCCTACAAATGTGATAATTGCAATAAGGATTTTCAGCGGCTTTCAACCCTTATTCTCCATGAGAAAATTCATAAGAGAGAGATACTTTATCGATGTAATAAATGTCCGAAAGTCTTCAAGCGGAATTCAACCCTTATTCAACACCTGAAACTTCACAAAAGGAAGAAGAAACTCTTCGAGTGTAAAGAGTGTGGAAAGATGTTCTCTGGAACTGCAAACCTTAAAATACACCAGAACATACATTCTGAAGAGAAGCCTTTCAAATGCAGTAAGTGTAGTAAGGTGTTTGGCCGCCAGTCATTTCTTATTGAACATCAGCGAATTCATACTGGAGAAAAACCCTATCAGTGTGAGGAATGTGGGAAAGCCTTCAGTCACCGGATATCGCTTACTCGACACAAGAGAATACACACCGAAGACAGACCCTATGAATGTGATCAGTGTGGGAAAGCCTTCAGCCAGAGTGCCCATCTTGCCCAGCATGAGCGAATCCACACTGGAGAGAAGCCATACATATGCAAGATCTGTAAGAAGGCCTTCAGTCAGCGCACATCCCTTATTCTGCATGAAAGAAGTCACACTGGAGAGAAGCCTTATGAGTGTAATGAGTGCAGGAAAGCATTTAGCAGTGGCTCAGACCTTATTCGACACCAGAGAAGTCATTCTTCAGAGAAACCCTATGAATGTAGTAAATGTGGGAAGGCGTATAGCAGGAGCTCATCCCTGATTCGACATCAGAGCACACATCCTGAAGAAAAAGCCTAA

XM_004866854.1 Coding sequence

Nup62 nucleoporin 62kDa, transcript variant X5

High confidence: 4 potential gene matches
Length: 1557 bp    Location: 4410186..4428231   Strand: +
>XM_004866854.1
ATGAGCGGGTTTAATTTCGGAAGCACTGGTGCTTCCACAGGTGGATTCACATTTGGCACTGCGAGAACAGCAACCACCACACCCTCAACGGGATTTTCTTTCTCCACTCCCGGCACTGGAGGGTTTACCTTTGGAACTCCCTCCCAGCCAGCTGCAAGTACCCCTTCAACCAGCCTCTTCTCACTCAACACCCAAGCTCCAGCAACTCAGACCACTGGATTCACTTTCGGAACAACTCCTGCTTCCACAGCAACTGGCTTTTCCTTAGGGATCAATACCCCAAAGCCAAGCTTGAGCAACATAGCTGCCGCCCCAGTTACGGCAAATCCCAGCGGCTTTGGGCTTGGCAGCAGCACCCTCACCAATGCCATATCAAGTGCTGTCACCTCCAGCCAGGGGACAGCATCCACTGGCTTTGTGTTCGGTTCCTCTACCACCTCCACAGCTCCAGCCACCACGTCTGGAGGGTTCTCCTTCACCAGTGGAAGCACGTCCCAGGCTGGGACCTCTGGCTTCAACATTGGCTCCCTGGGCAGTGTAGCCCAGGCCCAGCCCACGGCACTTCCCGGATTGCCCTTCACTGCAGCCACGCCAGCAGCCACTGCAGCGGGGGCCACCCAGCCAGCTGCACCCACAGCCACTGCCAGCAGTGCAGGGCCCACCCTCTTTGCCTCAATAGCAGCTGCTCCCACCTCGTCCACCACTGGGCTCGCCCTCTGTGTCCCAGCAACCACCACTGGAGCTCCTGGCGCTGGGACCCTGGGTTTCAGCCTAAAAGCCCCCGAAACCGCTTCTAGCACCTCAGCAGCAACATCCACCACTGTGGCCACAGCCAGCACCACTGCCGCCACCGGCTTTGCTTTGAATATAAAGCCACTGGTGCCAGCTACAATATCCAGCGGTGCAGCAGCAGGTGTGACTGCTGCATCTGGCTCCGTTGCAGCTACTGGGACATCCACCTCTCCTGTGATGACCTACGCACAGCTGGAGAGCCTGATCAACAAGTGGAGCCTGGAGCTGGAGGACCAGGAGCGCCACTTCCTCCAGCAGGCCACCCAGGTCAACGCCTGGGACCGCACGCTAATCGAGAATGGGGAGAAGATCACCAGCCTGCACCGTGAGGTGGAGAAGGTGAAGCTGGACCAAAGGAGGCTGGACCAGGAGCTCGACTTCATCCTGTCCCAGCAGAAGGAGCTGGAAGACCTGCTGAGCCCCCTGGAGGAGTCAGTGAAGGAGCAGAGCGGGACCATCTACCTGCAGCACGCCGACGAGGAGCGTGAGAAGACCTACAAGCTGGCTGAGAACATTGATGCCCAGCTGAAGCGCATGGCCCAGGACCTCAAGGACATCATCGAGCACCTGAACACGTCCGGAGGCCCTGCTGACACCAGCGACCCACTGCAGCAGATCTGCAAGATCCTCAACGCACACATGGACTCGCTGCAGTGGATCGACCAGAACTCGGCCCTTCTGCAGAGGAAGGTGGAGGAGGTGACCAAGGTGTGCGAGGGCCGCCGCAAGGAGCAGGAGCGCAGCTACAGGATCACATTTGACTGA

XM_004866606.1 Coding sequence

Znf667 zinc finger protein 667, transcript variant X4

Length: 1824 bp    Location: 1503360..1489748   Strand: -
>XM_004866606.1
ATGCCTGCTACACGAGGGAGATCTAGGCCCAAGGCACCAGTGACATTTTCAGACTTGGCCATCTACTTCTCCCAGGAGGAGTGGGAATGGCTGAGCCCCACGCAGAAGGAGTTATACGAAGAGGTCATGTTAGAGAACTATCGGAACCTGGTGTCGGTTGGTCTTTGCCTTCGGAGGCCAAATGTCATCACCTTACTGGAGAAAGGGAAGGAGCCCTGGATCGTGGAGCCACCAAGGAGACGCTGGTGCCCCGATTTAGCATCTAAGTGTGAGATCGAGAAATTACCACCAAATCAGTGCAGCAAATCTAAGCAAAGCTTCTATCAAAGACCAGTTTCTATACAAATAAAGATTCCCACAGGCAAGAGGGTAGAGTTACTCCGAAGAAGGGCCAAGAAAGGGCTTTCAGCGAAGAAATCTTTGAAATGCAAGGACTGTGGGAAAATCTTCAGTCAGAGATCATCCCTCAAACTTCATCAGAATGCTCACACTGGAGAGAGGCCTTATGAATGCAGTCGTTGTAGAAAAGTTTTCAGACAGATCACATCCCTCATCCTTCACCAGAGAATTCACAATGAAAAGAAAAGCTATGGATGTGATCAGTGTGGGAAAGGCTTCAGTAAAAGCATAACCCTTATTCTACACAGGAGAATTCATAGTAGAAAGGAAACTTCTGACAATGGGATGGCCTCCAGTCCCAATACTTCTCTCAGTGCCCACCCCAGCAGTCATGTTGTCAAGAAGGCCCTCCAGTGCAGAAAATGTGGGAGAGCCTTTAGTCGTGTGGCAGCCCTTTTACTTCATAGGAGAATTCACAGTAGAAGGAAAATACATAAGTGCAATACTTGTGGGAAGGGCTTCAAAAAGAAATCAGTCCTTATTACACACAAAAGAATTCATACCAGAGAGAAAGCCCACAAAAAGGAGAAGGCCTTAGGTCAGAGTATACAGCGAAGAAATCGATTTTTAGAAAATCCTTTTAAATGCAGAAAGTGTGGTAAGTCCTTTCATAGGATTTCACCCCTTCTGCTTCATCAGAAAGTCCACACTTCAAGGAAACCCTACAAATGTGATAATTGCAATAAGGATTTTCAGCGGCTTTCAACCCTTATTCTCCATGAGAAAATTCATAAGAGAGAGATACTTTATCGATGTAATAAATGTCCGAAAGTCTTCAAGCGGAATTCAACCCTTATTCAACACCTGAAACTTCACAAAAGGAAGAAGAAACTCTTCGAGTGTAAAGAGTGTGGAAAGATGTTCTCTGGAACTGCAAACCTTAAAATACACCAGAACATACATTCTGAAGAGAAGCCTTTCAAATGCAGTAAGTGTAGTAAGGTGTTTGGCCGCCAGTCATTTCTTATTGAACATCAGCGAATTCATACTGGAGAAAAACCCTATCAGTGTGAGGAATGTGGGAAAGCCTTCAGTCACCGGATATCGCTTACTCGACACAAGAGAATACACACCGAAGACAGACCCTATGAATGTGATCAGTGTGGGAAAGCCTTCAGCCAGAGTGCCCATCTTGCCCAGCATGAGCGAATCCACACTGGAGAGAAGCCATACATATGCAAGATCTGTAAGAAGGCCTTCAGTCAGCGCACATCCCTTATTCTGCATGAAAGAAGTCACACTGGAGAGAAGCCTTATGAGTGTAATGAGTGCAGGAAAGCATTTAGCAGTGGCTCAGACCTTATTCGACACCAGAGAAGTCATTCTTCAGAGAAACCCTATGAATGTAGTAAATGTGGGAAGGCGTATAGCAGGAGCTCATCCCTGATTCGACATCAGAGCACACATCCTGAAGAAAAAGCCTAA

XM_004867162.1 Coding sequence

LOC101718433 zinc finger and SCAN domain-containing protein 5B-like

Length: 1503 bp    Location: 1553370..1549329   Strand: -
>XM_004867162.1
ATGTCCACCCCCCCAAAGACCGAGCAGGGGGAGCCTGGGTGGGACCCAGGGAAGCAGGAAGGGGACCTGGAGAGGTGGCACGTGAGCTTCAGGGCCTTCTGCTGGAAGGGCTCTGACCCTGTGCAGGAACTGCGGCAGCTGTCGGAGCTGTGCCACCGCTGGCTGCGGCCTGACTTGCACTCCACGGAGCAGATCCTGGACCGGCTGGTGCTGGAGCAGCTGCTAATCACGGCGCCAGAGGACCTGCAGGTGCAGATCTGGGAGAACCGTGTGCAGAGCTGTGAGGAGCTGGAGGAGCTGCTTCAGGGCCACAGGAGGCCCCTGGGCTCGATGCTGGCACACGTCCAGTGCACAGGTCCAGTCCCCACCTTAGGGGTGCCGAGCACCCGTGTCCGGGCCCAGGCAGGTACTGAGCTGAGCAGCAGCGGCTGGGACTGCGGGGCCTCCAGGGCCCAGCGGTGCCCGGGGAGGCAGATGCTGGACACGCGGTCGCTGGGAGGCGCGAGGCCGCAGTCCATCGTCATCTGTGAAGGACAGAAATTCCTCCTGCGGGCCGAAGATGTGGAGATGGCCAACCAGGCCGGGGAGCTGGACGTCAGGATGGACTCGTCCACCGAGCTCTGGTCCCCGGAGGGCAGGGACCAAGCCGGGGCGGAGCAGCCGTGGGGCCAGGGCGAAGCTGTGCTGCCCGAGGCGGCTTCCAAGGAAGGACACCCAGAGGTTCTGCAAAAGCCCCTGGAGCGGGAGCTGGGGCACAGGGAGGACGTGTCGGCGTTGGAGGCCTGGGAGCCTCTGCTCCTGCCGGGCCCTGGTGCCGAGGGGACCCAGCACCACCACGCCTCTCCTGAGGCCGAGAATGAGGCTGCCGAGCGTGTACCTGGAGGAGAACCCCTGAGTCCCAGACGCCCCCGGAAAAGGAGCCCAGACCAGGCCCTGTCCCTGGGAGGTCCCCAGGCAGGGGCCGAGTCCCCTGAGGAGCAAGGCGGGGTGAACTCGGCAGAGACCCTGCGCTCCCCTGGCGCGGCAGCCAGGCCCGCCCCGCACTGCTGCAGCACGTGCAGCAAGACGTACCTGTACCGGTCGCAGCTGGTCATCCACGAGCGCTCGCACACGGGCGAGCGGCCCTTCCGCTGCGACCAGTGCAACAAGGGCTTCATGCAGCCGTCCGACCTGCGCGTGCACCTGCGCATCCACACAGGCGAGCGGCCCTTCCACTGCTGCCTCTGCCCCAAGGCCTTCACTCACGAGTCCACGCTGCTGGGGCACCTGCGCATGCACACCCGGGAGCAGCCCTATGTGTGTGAGCACTGCGGCAAGAGCTTCAGCCACCGTGGCAACCTCAACGTACACATGCGGATCCACACGCAGGCCAAGCCCTACCGGTGCCCCGTGTGCGGCCACGCCTTCCGCCAGCTGGGCACCATGAAGCGCCACTGCAAGATACACGTGCAGAGGAGTCCTGGGGATGGCCCTGCAGGGCCAGAGCCACAGGAGATGGAGTAG

XM_004866601.1 Coding sequence

Znf444 zinc finger protein 444, transcript variant X1

Length: 984 bp    Location: 1578917..1569538   Strand: -
>XM_004866601.1
ATGGAGGCCCCTGCACCCCTGCCTGTGAAGCAGGAGGAGCCAGCCGCCGAGGGCCTGGCCCCAGCCCCGGAGACGCTGGACTCCCCCGCCCTGGACTCCCCCACCCCGGACTCGCCCTGGCACCGCTTCCGCCACTTCCAGCTGGGTGCGGCACCGGGGCCCCGCGAGGCCCTGGGGCTGCTGCGCGCCTTGTGCCGTGCCTGGCTGAGGCCTGAGGTGCGCACCAAGGAGCAGATGCTGGAGCTGCTGGTGCTGGAGCGCTTCCTGAGCGCGCTCCCGGCCGGTGCCCGAGCCTGGGTGTGCAGCCGGCGGCCCCGCAGCGGGGATGAGGCCGTGGCCCTGCTGGAGGAGCTCTGGGGACCTGTGGCCTCCCCAGATCGGTCATCAGTAGTGCGAGCACCTCAGGACGTGACAGAAGGCGCCGGGGCCGGTGTTGGAAAGGAAGATGGTGGGGTGATGCCCTTTGGAGCTGTGGGCCCTGAGCCGGAGGTGCCGGTGACGGGAGATGCCTGGGCCGCGTGGCCGCCCAAGCAGGAGCGCGACAGCCCCCCGCCTGCCGCCCCGGGCACCCTCGGGACCCCCTGCCCCGAGTGCGGTCAGACGCCCGCGCCCGCGCCACGGCCCCCGCGCGAGAAGCCGCACGCCTGCCCCGAGTGCGGCAAGGCCTTCCGGCGCAAGGAGCACCTGCGGCGCCACCGCGGCACGCACCCCGGGGCAGCGGGGCCAGCGCGGCGCCACCCGGCCACGCGCGAGAGGCCGCACGCCTGCTGCGACTGCGGCAAGGCCTTCTACTGGCGCGAGCACCTGGTGCGCCACCGCAAGACGCACTCGGGCGCGCGGCCCTTCGCCTGCAGGGAGTGTGGCAAAGGCTTTGGCCGCCGTGAGCACGTGCTGCGCCACCAGCGCATCCACGGCCGCGCCGCACGGGCGCAGGGCCCGGCGACCGAGGGCGGTGGCGCCTTCCCGCCCTGGCCGCTGGGGTAG

XM_004866597.1 Coding sequence

Znf787 zinc finger protein 787, transcript variant X1

Length: 1149 bp    Location: 1589539..1602373   Strand: +
>XM_004866597.1
ATGGAGCTGCGGGAAGAGGCCTGGTCTCCGGGGCCGCTGGACTCCGAGGACCAGCAGATGGCCAGTCAGGAAAACCCAGTGGACATCCTCATCATGGATGACGACGACGTCCCCAGCTGGCCCCCCGCCAAGCTGGCCCCGCCCCCGACGGCGCCTCCCGCCGGCCCCCCACCCCGGCCGCGGCCGCCGGCGCCCTACATCTGCAACGAGTGCGGCAAGAGCTTCAGCCATTGGTCCAAGCTGACGCGCCACCAGCGCACGCACACGGGCGAGCGACCGAACGCGTGCGCCGACTGCGGCAAGACCTTCTCGCAGAGCTCGCACCTGGTGCAGCACCGCCGCATCCACACGGGCGAGAAGCCCTACGCCTGCTCCGAGTGCGGCAAGCGCTTCAGCTGGAGCTCCAACCTCATGCAGCACCAGCGCATCCACACGGGCGAGAAGCCCTACGCCTGTCCCGACTGCGGCCGCAGCTTCACGCAGAGCAAGAGCCTGGCCAAGCACCGGCGCTCGCACAGCGGCCTCAAGCCCTTCGTGTGCCCGCGCTGCGGCCGCGGCTTCAGCCAGCCCAAGAGCCTGGCGCGCCACTTGCGGCTGCACCCCGAGCTCGCGGGCCCTGGCGTGGCCGCGCGCGTGCTGGCGGCCTCTGTGCGCCGTGCCCAGGCGCCCGAGGCGGCGGCGGCTGCGGACGGCGAGATTGCCATCCCGGTGGGAGACGGCGAGGGCATCATTGTGGTGGGCGCCCCGGGCGAGGGCGCAGGCGCGACAGCTGTGGCTGTGGGCAGCGGGGGCGCGCGGGCAGCTGGGGCCCCGCGGTCGCGCCGCGCGCCGGCGCCCAAGCCCTACGTGTGCGCGGAGTGCGGGAAGGGCTTTGGGCACGCCGCGGGGCTGCTGGCGCACCAGCGGGCGCAGCACGGCGACGGCCCAGGCGCCGCGGGCGGTGAGGAGCCCGCACACATTTGCGTGGAGTGCGGTGAGGGCTTCGTGCAGGGCGCGGCGCTGCGCAGGCACAAGCGCGTGCACGCCGTGGGCGCCCCCACAGTCTGCGGCGGCTGCGGACAAAGCTTCTATGGTGCGGGCGGCGAGGACGAGGAGGCCGAGGATGGCGCGCCCCGCTGCCCCGAGTGCCGCGCCGGGGATGCTCGGTAG

XM_004866599.1 Coding sequence

Znf787 zinc finger protein 787, transcript variant X3

Length: 1149 bp    Location: 1593054..1602373   Strand: +
>XM_004866599.1
ATGGAGCTGCGGGAAGAGGCCTGGTCTCCGGGGCCGCTGGACTCCGAGGACCAGCAGATGGCCAGTCAGGAAAACCCAGTGGACATCCTCATCATGGATGACGACGACGTCCCCAGCTGGCCCCCCGCCAAGCTGGCCCCGCCCCCGACGGCGCCTCCCGCCGGCCCCCCACCCCGGCCGCGGCCGCCGGCGCCCTACATCTGCAACGAGTGCGGCAAGAGCTTCAGCCATTGGTCCAAGCTGACGCGCCACCAGCGCACGCACACGGGCGAGCGACCGAACGCGTGCGCCGACTGCGGCAAGACCTTCTCGCAGAGCTCGCACCTGGTGCAGCACCGCCGCATCCACACGGGCGAGAAGCCCTACGCCTGCTCCGAGTGCGGCAAGCGCTTCAGCTGGAGCTCCAACCTCATGCAGCACCAGCGCATCCACACGGGCGAGAAGCCCTACGCCTGTCCCGACTGCGGCCGCAGCTTCACGCAGAGCAAGAGCCTGGCCAAGCACCGGCGCTCGCACAGCGGCCTCAAGCCCTTCGTGTGCCCGCGCTGCGGCCGCGGCTTCAGCCAGCCCAAGAGCCTGGCGCGCCACTTGCGGCTGCACCCCGAGCTCGCGGGCCCTGGCGTGGCCGCGCGCGTGCTGGCGGCCTCTGTGCGCCGTGCCCAGGCGCCCGAGGCGGCGGCGGCTGCGGACGGCGAGATTGCCATCCCGGTGGGAGACGGCGAGGGCATCATTGTGGTGGGCGCCCCGGGCGAGGGCGCAGGCGCGACAGCTGTGGCTGTGGGCAGCGGGGGCGCGCGGGCAGCTGGGGCCCCGCGGTCGCGCCGCGCGCCGGCGCCCAAGCCCTACGTGTGCGCGGAGTGCGGGAAGGGCTTTGGGCACGCCGCGGGGCTGCTGGCGCACCAGCGGGCGCAGCACGGCGACGGCCCAGGCGCCGCGGGCGGTGAGGAGCCCGCACACATTTGCGTGGAGTGCGGTGAGGGCTTCGTGCAGGGCGCGGCGCTGCGCAGGCACAAGCGCGTGCACGCCGTGGGCGCCCCCACAGTCTGCGGCGGCTGCGGACAAAGCTTCTATGGTGCGGGCGGCGAGGACGAGGAGGCCGAGGATGGCGCGCCCCGCTGCCCCGAGTGCCGCGCCGGGGATGCTCGGTAG

XM_004866614.1 Coding sequence

Epn1 epsin 1, transcript variant X4

Length: 1743 bp    Location: 1746896..1732895   Strand: -
>XM_004866614.1
ATGTCGACCTCATCACTCCGGCGCCAGATGAAGAACATCGTCCACAACTACTCAGAGGCCGAGATCAAGGTCCGAGAGGCCACAAGCAATGACCCCTGGGGCCCGTCCAGCTCCCTCATGTCGGAGATCGCTGACCTCACCTACAACGTGGTGGCCTTCTCGGAGATCATGAGCATGATCTGGAAGCGGCTCAATGACCATGGCAAGAACTGGAGGCATGTCTACAAGGCCATGACGCTGATGGAGTACCTCATCAAGACGGGCTCGGAGCGCGTGTCGCAGCAGTGCAAGGAGAACATGTACGCAGTCCAGACGCTGAAGGACTTCCAGTACGTGGATCGTGACGGCAAGGACCAGGGCGTGAACGTGCGCGAGAAGGCCAAGCAGCTGGTGGCCCTGCTGCGGGACGAGGACCGGCTTCGGGAGGAGCGGGCCCACGCACTCAAGACCAAGGAGAAGCTAGCCCAGACGGCCACAGCCTCCTCGGCAGCCGTGGGCTCTGGGCCCCCACCTGAGGCCGAGCAGGCGTGGCCACAGAGCAGCGGGGAGGAAGAGCTGCAGCTGCAGCTGGCCCTGGCCATGAGCAAGGAGGAGGCCGATCAGGAGGAGCGGATCCGGCGCGGGGATGACCTGAGGCTGCAGATGGCCATCGAGGAGAGCAAGAGGGACACGGGGGGCAAGGAGGAGTCATCCCTCATGGACCTCGCTGACGTCTTCTCAGCCCCGGCTCCTGCATCTGCTTCGGACCCCTGGGGGGCACCAGCGCCCATGGCTGCTGCTGTCCCTGCAGCTGCCCCTGCCTCGGACCCCTGGGGGGGAGCTGCTGTCCCTCCAGCTGCTGACCCCTGGGGCGGTCCGGCTCCCACGCCGGCCTCTGGGGACCCCTGGAGGCCAGCTGCCTCCACAGGGCCCTCAGCGGACCCGTGGGGTGGGACCCCAGCCCCCACAGCAGGAGAGGGGCCCACACCCGACCCATGGGGAGGCTCTGAGGGCGGGGCCCCCGTCAGTGGACCCCCAGCCTCTGATCCCTGGGCACCAGCGCCAGCCTTCTCGGACCCCTGGGGAGGGTCCCCTGCCAAGCCAAGCACCAATGGCACTGCAGTGGCTGGGGGCTTCGACGCTGAGCCTGATGAGTTCTCAGACTTTGACCGACTCCGCACGGCGCTGCCAGCCTCGGGGAGCAGCACGGATGTAGAGGCAAGTTGCCAAAATGGTACCAAGAATGCCCTCCGGAGATCGGCCACCCGCTGTCCCTGCCGACCCTCCCTGGCTCTGGGCCCCTTTCCAGTGGGGGGAGCTGGAGCTGCTAGCAGGAGAGGTGCCCGCCTGCAGCCCAGGGGCCTTCGACATGAGTGGGGTCGGGGGCTCCCTGGCCGAGGCCGTGGGGAGCCCCCCACCCACAGCCGGCCTGGCCCCCACGCCCCCCACACGGAAGACCCCAGAGTCATTCCTGGGCCCCAACGCAGCCCTCGTGGACCTGGACTCGCTGGTGAGCCGGCCGGGCCCCGCACCACCAGGAGCCAAGGCCTCGAACCCCTTCCTGCCGAGTGGAGCCCCGGCTGCTGGCCCCTCCGTAACCAACCCCTTCCAGCCAGCACCCCCGGCGACACTCACCTTGAATCAGCTCCGCCTCAGCCCTGTGCCCCCCGCCCCCGGGGTGCCGCCCACCTACATCTCTCCCCTTGGTGGGGGCCCCGGCCTGCCACCCATGATGCCCCCCGGGCCCCCGGCCCCCAACACTAA

XM_004866623.1 Coding sequence

U2af2 U2 small nuclear RNA auxiliary factor 2, transcript variant X8

Length: 1428 bp    Location: 1761279..1747237   Strand: -
>XM_004866623.1
ATGTCGGACTTCGATGAATTCGAGCGGCAGCTCAACGAGAATAAGCAAGAGCGGGACAAAGAGAACCGGCACCGGAAGCGCAGCCACAGCCGTTCTCGGAGCCGGGACCGAAAGCGCCGGAGCCGGAGCCGAGACCGGCGCAACCGGGACCAGCGCAGTGCGTCCCGGGACAGGAGGCGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCATGGTGGATTGATCCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTGCGTAAATACTGGGACGTGCCGCCACCCGGCTTTGAGCACATCACCCCGATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACCGCCCTCCTTCCCACCATGACCCCTGATGGTCTGGCTGTGACCCCAACGCCGGTGCCCGTGGTTGGAAGCCAGATGACCAGACAGGCCCGGCGCCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCTCCTGGCAACCCAGTCTTGGCTGTGCAGATCAACCAGGACAAGAACTTTGCCTTTCTGGAGTTCCGCTCAGTGGATGAGACGACCCAGGCCATGGCCTTCGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCTCACGACTACCAGCCGCTGCCCGGCATGTCGGAGAACCCCTCGGTCTATGTGCCTGGAGTTGTGTCTACTGTGGTCCCTGACTCTGCCCATAAGCTGTTTATCGGGGGTCTACCTAATTACCTGAACGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTCAAGGATAGTGCCACAGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACCGACCAGGCCATCGCGGGGCTGAACGGCATGCAGCTGGGGGACAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGCGCCAAGAATGCCACGCTGGTGAGCCCCCCGAGCACCATCAACCAGACCCCCGTGACCCTGCAAGTGCCGGGCCTGATGAGCTCGCAGGTGCAGATGGGCGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCCGAGGAGCTGCTGGATGATGAGGAGTATGAGGAGATCGTGGAGGATGTGCGGGATGAGTGCAGCAAGTACGGGCTGGTGAAGTCCATCGAGATCCCCCGGCCCGTGGATGGCGTGGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCGGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACCGGCCGCAAGTTCGCCAACAGAGTGGTGGTCACCAAGTACTGTGACCCCGACTCCTACCACCGCCGGGACTTCTGGTAG

XM_004866622.1 Coding sequence

U2af2 U2 small nuclear RNA auxiliary factor 2, transcript variant X7

High confidence: 4 potential gene matches
Length: 1416 bp    Location: 1761276..1747237   Strand: -
>XM_004866622.1
ATGTCGGACTTCGATGAATTCGAGCGGCAGCTCAACGAGAATAAGCAAGAGCGGGACAAAGAGAACCGGCACCGGAAGCGCAGCCACAGCCGTTCTCGGAGCCGGGACCGAAAGCGCCGGAGCCGGAGCCGAGACCGGCGCAACCGGGACCAGCGCAGTGCGTCCCGGGACAGGAGGCGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCATGGTGGATTGATCCGCTCCCCCCGCCATGAGAAGAAGAAGAAGGTGCGTAAATACTGGGACGTGCCGCCACCCGGCTTTGAGCACATCACCCCGATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACCGCCCTCCTTCCCACCATGACCCCTGATGGTCTGGCTGTGACCCCAACGCCGGTGCCCGTGGTTGGAAGCCAGATGACCAGACAGGCCCGGCGCCTCTATGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCTCCTGGCAACCCAGTCTTGGCTGTGCAGATCAACCAGGACAAGAACTTTGCCTTTCTGGAGTTCCGCTCAGTGGATGAGACGACCCAGGCCATGGCCTTCGATGGCATCATCTTCCAGGGCCAGTCGCTGAAGATCCGCAGGCCTCACGACTACCAGCCGCTGCCCGGCATGTCGGAGAACCCCTCGGTCTATGTGCCTGGAGTTGTGTCTACTGTGGTCCCTGACTCTGCCCATAAGCTGTTTATCGGGGGTCTACCTAATTACCTGAACGATGACCAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTCAAGGATAGTGCCACAGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACCGACCAGGCCATCGCGGGGCTGAACGGCATGCAGCTGGGGGACAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGCGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCCGTGACCCTGCAAGTGCCGGGCCTGATGAGCTCGCAGGTGCAGATGGGCGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCCGAGGAGCTGCTGGATGATGAGGAGTATGAGGAGATCGTGGAGGATGTGCGGGATGAGTGCAGCAAGTACGGGCTGGTGAAGTCCATCGAGATCCCCCGGCCCGTGGATGGCGTGGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCGGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACCGGCCGCAAGTTCGCCAACAGAGTGGTGGTCACCAAGTACTGTGACCCCGACTCCTACCACCGCCGGGACTTCTGGTAG

XM_004866626.1 Coding sequence

Znf581 zinc finger protein 581

Length: 594 bp    Location: 1769173..1767299   Strand: -
>XM_004866626.1
ATGCTGGTGCTGCCGCCCCCTTGTCCCCAACCCCTGGCGCTTCCCTCAGTAGAGCCCATGGAGGCCCCGCTCCCTCGTTCGGGCAGGTGCCTGGAACCTGGACCTTCCTCCTCCATCGCACCACCCCAGACTTCGACCTCTCCGAGGCCAAGCCACTACCTTCTCATTGACACCGAGGGTGTCCCCTACACTGTGCTGGTGGATGAGGAGTCACAGAGGGAGCCCAGGGCCGATGGGGCTATGGCCCAGAAAAAGTGCTACAGCTGCCCGGTGTGCTCGAGGGTGTTCGAGTACATGTCCTACCTTCAGCGACACAGCATCACCCACTCGGAGGTGAAGCCCTTCGAGTGCGACACGTGCGGGAAGGCGTTCAAGCGGGCCAGCCACCTGGCGCGGCACCACTCCATCCACAGGGCAGGCGGCGGGCGGCCCTACAGCTGCCCGCTGTGCCCGCGCCGCTTCCGGGATGCTGGTGAGCTGGCCCAGCACAGCCGGGTGCACTCTGGGGAGCGCCCGTTCCAGTGCCCACACTGCCCGCGCCGCTTTATGGAGCAGAACACGCTGCAGAAGCACACGCGGTGGAAACATCCTTGA

XM_004866625.1 Coding sequence

Znf580 zinc finger protein 580, transcript variant X2

Length: 519 bp    Location: 1771209..1769405   Strand: -
>XM_004866625.1
ATGCTGCTGCTGCCGCCGCGGCCGCCCCATCCTCGGTCCTCTTCCCCCGAGGCCATGGACCCACCGCCCCCCAAGGCTCCCCCTTTTCCCAAGGCGGAGGGCGCCGCTTCCACGCCCTCCTCGGCGGCTGGGCCCCGGCCCCCGCGGTTGGGCCGCCACCTGCTCATCGACGCCAACGGGGTACCCTACACATACACAGTGCCGCTGGAGGAGGAGCCCCGGGGCCCCCAGCAGCGCGAAGCGCCCCCAGGGGAACCCGGCCCTCGAAAGGGCTACAGCTGCCCAGAGTGTGCCCGGGTCTTCGCCAGCCCGCTGCGGCTGCAGAGCCACCGCGTGTCGCACTCGGACCTCAAGCCCTTTACGTGCGGCGCCTGTGGCAAGGCCTTCAAGCGCTCCAGCCACTTGTCGCGGCACCGCGCCACGCACCGCGCCCGCTCCGGCCCGCCGCACTCGTGCCCGCTGTGCCCGCGCCGCTTCCAGGACGCGGCCGAGCTGGCGCAGCACGTGCGCCTGCACTGA

XM_004866624.1 Coding sequence

Znf580 zinc finger protein 580, transcript variant X1

Length: 519 bp    Location: 1771207..1769405   Strand: -
>XM_004866624.1
ATGCTGCTGCTGCCGCCGCGGCCGCCCCATCCTCGGTCCTCTTCCCCCGAGGCCATGGACCCACCGCCCCCCAAGGCTCCCCCTTTTCCCAAGGCGGAGGGCGCCGCTTCCACGCCCTCCTCGGCGGCTGGGCCCCGGCCCCCGCGGTTGGGCCGCCACCTGCTCATCGACGCCAACGGGGTACCCTACACATACACAGTGCCGCTGGAGGAGGAGCCCCGGGGCCCCCAGCAGCGCGAAGCGCCCCCAGGGGAACCCGGCCCTCGAAAGGGCTACAGCTGCCCAGAGTGTGCCCGGGTCTTCGCCAGCCCGCTGCGGCTGCAGAGCCACCGCGTGTCGCACTCGGACCTCAAGCCCTTTACGTGCGGCGCCTGTGGCAAGGCCTTCAAGCGCTCCAGCCACTTGTCGCGGCACCGCGCCACGCACCGCGCCCGCTCCGGCCCGCCGCACTCGTGCCCGCTGTGCCCGCGCCGCTTCCAGGACGCGGCCGAGCTGGCGCAGCACGTGCGCCTGCACTGA

XM_004866630.1 Coding sequence

LOC101698839 zinc finger protein 865-like, transcript variant X1

Length: 3576 bp    Location: 1804828..1796356   Strand: -
>XM_004866630.1
ATGGAGTGGGCGTGGTTCCCACAAGGGGGCGGGGCTCTAGCGTGGGACCCGAGCCCAGGGTGTGCCTCCACCGGATGTCCAGGGCTTGTGGGCGGAGCCCTAAGAGGCAGCAGGCGCACACAGCGCAGGCGCACTTGCGGGCGGTTGCCTACAGGAAGCAGCCTCAGCTTTCCCCGCCCGCACGCGCCACACGGTGCGCAGGCGCACTTCCTCTCTCTTTCCGCCACCGCCACCTCTTCTGCAGCCTCCACGCCGGCGCCTCGGGAACGGGAGCAACTTCCGCTTCCGGGCGGGCGGCGCGGGGCTGCTGAGGAGGGGGAGGGGGCGGCACTTCCGGTCGGGGTCTCGGGTCTCCCCGGAGCGGCGGCGCCTCCTCCGCCTCCTAGGCCTCCTCCCGGCGGAGACCCCGGCGCCGGGTCTCCCAGCTCCGCTGAGATGGAGTCGAACCCAGCGGGGGGCAGCGGGAACGGCGGCCTGGGGGGCGAGGATGGCGTGCATTTCCAGAGCTACCCCTTCGACTTCCTGGAGTTCCTCAACCACCAGCGCTTCGAGCCCATGGAGCTATACGGGGAGCACGCCAAGGCCGTGGCTGCGCTGCCCTGCGCCCCGGGCCCCCCGCCGCCGCCGCCGCCGCAGCCCCCGCCGCCGCAGTTCGACTACCCGCCACCGGCCAGCTTCAAGCCCAAGGCCGAGGCGCCATCCTCAGCTTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCACCTCCTCCTCTTCCTCGTCCTCCACCTCCTCCGCCCCAGCCAAGAAGCCCGACCCGCCGCTGCCGCCCGCCTTTGGGGCACCCCCACCCCCGCTCTTCGACGCCGCCTTCCCTGCCCCGCAGTGGGGCATCGTGGACCTCTCCGGCCACCAGCACCTGTTCGGGAACCTGAAGCGCGGCGGGCCGGCGGCAGGGCCGGGCGTGGCGCCCGGTCTTGGTGCACCCGCGGGGACCCCGGGGCCGCTGCCCGCGCCCTCACAGACCCCACCTGGCCCCGCCGCCACGGGGGCGGCCTGCGACCCCGCCAAGGACGACAAAGGCTACTTCCGGCGGCTCAAGTACCTGATGGAGCGGCGCTTCCCTTGTGGTGTGTGCCAGAAATCCTTCAAGCAGTCCTCGCACCTGGTGCAGCACATGCTCGTGCACTCGGGCGAGCGGCCCTACGAGTGCGGCGTGTGCGGCCGCACTTACAACCACGTGTCCAGCCTCATCCGCCACCGCCGCTGCCACAAGGACACGCCGGCCGCGGGGGCCCCGCCGGCGCCCCCTGGTGCTCCACTCGCGGCCCCACTGGGCCTCCCCACCGGTGCCGCTGCAGGTGTCACCCCTGCCCCAGTGGGGCCCGCTCCCGCACCCCCAGCCGATGGCAGTGCCACCCCCACCCCTGCGGGCATCCCCGGGCCCCCTGCGGCCAGCGCGGGTGGAGATGGCCCATTCGCCTGCCCGCTGTGCTGGAAGGTGTTCAAGAAGCCCAGCCACCTGCACCAGCACCAGATCATCCACACGGGCGAGAAGCCCTTCTCCTGCTCTGTGTGCAGCAAGAGCTTCAACCGGCGCGAAAGCCTCAAGCGGCACGTGAAGACGCACTCAGCCGACCTGCTGCGCCTGCCCTGCGGCGTGTGCGGCAAGGCCTTCCGCGACGCCGCCTACCTGCTCAAGCACCAGGCGGCACACGCGGGGGCGGGGGCGGGGGCGCGGCCGGCCTACGCCTGCGACCTGTGCGGCAAGTCCTACTCGGCCCCGCAGAGCCTGTTGCGCCACAAGGCCGCGCATGCGCCACCCGCTGCCCCCGAGGCGCCCAAGGACTCGGCGGCTTCGGCCGTCCCGCCGCCCGCGCCTGCCTTCCCCGCCGGCCCCTACCTGCTGCCCACGGAGCCGCCCGCGGGCGACAGTGAGAAGGCGGCGGCAGCTGCTGCCGCGGCCGTGGTGTACGGCGCTGTGCCCGTGCCACTGCTGGGCGCGCACCCGCTGCTGCTCGGGGGGCCGGGGGCCGGGGGCGCGGGTGGTGCAGGCGGTGCGGGCGGCGCGGCTGGAAAGACCTTCTGCTGCGGGATCTGCGGGCGCGGCTTCGGCCGCCGTGAGACGCTGAAGCGCCACGAGCGGATCCACACGGGCGAGAAGCCGCACCAGTGCCCGGTGTGCGGGAAGCGCTTCCGCGAGTCCTTCCACCTGAGCAAGCACCACGTGGTGCACACGCGCGAGCGGCCCTACAAGTGCGAGCTCTGCGGCAAGGTCTTCGGCTACCCGCAGAGCCTCACGCGCCACCGCCAGGTGCACCGGCTGCAGCTGCCCTGCGCCCTGGCTGGGGCCGCCGGGCTGCCAGCTGCCCAAGGCGCCCCGGGAGCCTGCGGAGCCGGGGCCTCCAGCGCTGGGGGGGCGGGCCCCGCCGATGCGCTCAGCTACGCGTGCTCGGACTGCGGCGAACACTTCCCCGACCTCTTCCACGTCATGAGCCACAAGGAGGCGCACATGTCCGAGAAACCTTACGGCTGCGACGCCTGCGGCAAGACCTTCGGCTTCATCGAGAACCTCATGTGGCACAAGCTGGTGCATCAGGCCGCCCCCGAGCGCTTGCTGCCCACTGGTCCCCAGCCCGCAGAGAGCTCGGGTGGCACCGACGCGGCCAGTGTACTGGACAACGGGCTGGCTGGAGAGGTGGGCGCAGCTGTGGCGGCCCTGGCCGGGGTGTCGGGGGGCGAGGACGCGGGCGGCGCTTCTGCTGGGGCCGGTGCGGGCGCGGGCGCGGGTCCAGAACGCTTCAGCTGCGCCACGTGTGGCCAGAGCTTCAAGCACTTCCTGGGCCTGGTGACGCACAAGTACGTGCACCTGGTGCGGCGGACCCTGGGCTGCGGCCTCTGCGGCCAGAGCTTTGCGGGCGCCTACGACCTGCTCCTGCATCGCCGCAGCCACCGCCAGAAGCGCGGCTTTCGCTGCCCAGTGTGCGGGAAGCGCTTCTGGGAGGCAGCTTTGCTCATGCGCCATCAGCGCTGCCACACGGAGCAGCGGCCCTACCGGTGCGGCGTGTGCGGCCGGGGCTTCCTGCGTTCCTGGTACCTGCGACAGCACCGCGTGGTGCACACCGGCGAGCGCGCCTTCAAGTGCGGTGTGTGTGCTAAGCGCTTCGCGCAGTCGTCCAGCCTGGCCGAGCACCGCAGGCTGCATGCTGTGGCGCGGCCCCAGCGCTGCGGTGCGTGTGGCAAAACCTTCCGTTACCGCTCCAACCTGCTGGAGCACCAGCGGCTGCACCTGGGCGAGCGAGCCTACCGCTGCGAGCACTGCGGCAAGGGCTTCTTCTACCTGAGCTCCGTGCTGCGCCACCAGCGTGCCCACGAGCCGCCGCGGCCCGAGCTGCGCTGCCCCGCCTGCCTCAAGGCCTTCAAAGACCCTGGCTACTTTCGCAAGCACCTGGCGGCCCACCAGGGTGGCCGGCCCTTCCGCTGCTCCTCCTGCGGCGAGGGCTTCTCCAACACCTACGGGCTGAAGAAGCACCGCCTGGTGCACAAGGCCGACGGCCTCGGAGCGCCGGGGGCTGGGGCCCTCGCCGGGAAGGACGCCTGA

XM_004866633.1 Coding sequence

LOC101698839 zinc finger protein 865-like, transcript variant X4

Length: 3264 bp    Location: 1803683..1796356   Strand: -
>XM_004866633.1
ATGGGTGTTCAACAGCTGCAAGCGCCCGGGGACGCTACAGACAACAGTAGGCAGAGCCCTGTGTCTACGCAGAGTGGATGTGCTGGGAGAGAGGCGAAGAAAGGGTCTCCCAGCTCCGCTGAGATGGAGTCGAACCCAGCGGGGGGCAGCGGGAACGGCGGCCTGGGGGGCGAGGATGGCGTGCATTTCCAGAGCTACCCCTTCGACTTCCTGGAGTTCCTCAACCACCAGCGCTTCGAGCCCATGGAGCTATACGGGGAGCACGCCAAGGCCGTGGCTGCGCTGCCCTGCGCCCCGGGCCCCCCGCCGCCGCCGCCGCCGCAGCCCCCGCCGCCGCAGTTCGACTACCCGCCACCGGCCAGCTTCAAGCCCAAGGCCGAGGCGCCATCCTCAGCTTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCACCTCCTCCTCTTCCTCGTCCTCCACCTCCTCCGCCCCAGCCAAGAAGCCCGACCCGCCGCTGCCGCCCGCCTTTGGGGCACCCCCACCCCCGCTCTTCGACGCCGCCTTCCCTGCCCCGCAGTGGGGCATCGTGGACCTCTCCGGCCACCAGCACCTGTTCGGGAACCTGAAGCGCGGCGGGCCGGCGGCAGGGCCGGGCGTGGCGCCCGGTCTTGGTGCACCCGCGGGGACCCCGGGGCCGCTGCCCGCGCCCTCACAGACCCCACCTGGCCCCGCCGCCACGGGGGCGGCCTGCGACCCCGCCAAGGACGACAAAGGCTACTTCCGGCGGCTCAAGTACCTGATGGAGCGGCGCTTCCCTTGTGGTGTGTGCCAGAAATCCTTCAAGCAGTCCTCGCACCTGGTGCAGCACATGCTCGTGCACTCGGGCGAGCGGCCCTACGAGTGCGGCGTGTGCGGCCGCACTTACAACCACGTGTCCAGCCTCATCCGCCACCGCCGCTGCCACAAGGACACGCCGGCCGCGGGGGCCCCGCCGGCGCCCCCTGGTGCTCCACTCGCGGCCCCACTGGGCCTCCCCACCGGTGCCGCTGCAGGTGTCACCCCTGCCCCAGTGGGGCCCGCTCCCGCACCCCCAGCCGATGGCAGTGCCACCCCCACCCCTGCGGGCATCCCCGGGCCCCCTGCGGCCAGCGCGGGTGGAGATGGCCCATTCGCCTGCCCGCTGTGCTGGAAGGTGTTCAAGAAGCCCAGCCACCTGCACCAGCACCAGATCATCCACACGGGCGAGAAGCCCTTCTCCTGCTCTGTGTGCAGCAAGAGCTTCAACCGGCGCGAAAGCCTCAAGCGGCACGTGAAGACGCACTCAGCCGACCTGCTGCGCCTGCCCTGCGGCGTGTGCGGCAAGGCCTTCCGCGACGCCGCCTACCTGCTCAAGCACCAGGCGGCACACGCGGGGGCGGGGGCGGGGGCGCGGCCGGCCTACGCCTGCGACCTGTGCGGCAAGTCCTACTCGGCCCCGCAGAGCCTGTTGCGCCACAAGGCCGCGCATGCGCCACCCGCTGCCCCCGAGGCGCCCAAGGACTCGGCGGCTTCGGCCGTCCCGCCGCCCGCGCCTGCCTTCCCCGCCGGCCCCTACCTGCTGCCCACGGAGCCGCCCGCGGGCGACAGTGAGAAGGCGGCGGCAGCTGCTGCCGCGGCCGTGGTGTACGGCGCTGTGCCCGTGCCACTGCTGGGCGCGCACCCGCTGCTGCTCGGGGGGCCGGGGGCCGGGGGCGCGGGTGGTGCAGGCGGTGCGGGCGGCGCGGCTGGAAAGACCTTCTGCTGCGGGATCTGCGGGCGCGGCTTCGGCCGCCGTGAGACGCTGAAGCGCCACGAGCGGATCCACACGGGCGAGAAGCCGCACCAGTGCCCGGTGTGCGGGAAGCGCTTCCGCGAGTCCTTCCACCTGAGCAAGCACCACGTGGTGCACACGCGCGAGCGGCCCTACAAGTGCGAGCTCTGCGGCAAGGTCTTCGGCTACCCGCAGAGCCTCACGCGCCACCGCCAGGTGCACCGGCTGCAGCTGCCCTGCGCCCTGGCTGGGGCCGCCGGGCTGCCAGCTGCCCAAGGCGCCCCGGGAGCCTGCGGAGCCGGGGCCTCCAGCGCTGGGGGGGCGGGCCCCGCCGATGCGCTCAGCTACGCGTGCTCGGACTGCGGCGAACACTTCCCCGACCTCTTCCACGTCATGAGCCACAAGGAGGCGCACATGTCCGAGAAACCTTACGGCTGCGACGCCTGCGGCAAGACCTTCGGCTTCATCGAGAACCTCATGTGGCACAAGCTGGTGCATCAGGCCGCCCCCGAGCGCTTGCTGCCCACTGGTCCCCAGCCCGCAGAGAGCTCGGGTGGCACCGACGCGGCCAGTGTACTGGACAACGGGCTGGCTGGAGAGGTGGGCGCAGCTGTGGCGGCCCTGGCCGGGGTGTCGGGGGGCGAGGACGCGGGCGGCGCTTCTGCTGGGGCCGGTGCGGGCGCGGGCGCGGGTCCAGAACGCTTCAGCTGCGCCACGTGTGGCCAGAGCTTCAAGCACTTCCTGGGCCTGGTGACGCACAAGTACGTGCACCTGGTGCGGCGGACCCTGGGCTGCGGCCTCTGCGGCCAGAGCTTTGCGGGCGCCTACGACCTGCTCCTGCATCGCCGCAGCCACCGCCAGAAGCGCGGCTTTCGCTGCCCAGTGTGCGGGAAGCGCTTCTGGGAGGCAGCTTTGCTCATGCGCCATCAGCGCTGCCACACGGAGCAGCGGCCCTACCGGTGCGGCGTGTGCGGCCGGGGCTTCCTGCGTTCCTGGTACCTGCGACAGCACCGCGTGGTGCACACCGGCGAGCGCGCCTTCAAGTGCGGTGTGTGTGCTAAGCGCTTCGCGCAGTCGTCCAGCCTGGCCGAGCACCGCAGGCTGCATGCTGTGGCGCGGCCCCAGCGCTGCGGTGCGTGTGGCAAAACCTTCCGTTACCGCTCCAACCTGCTGGAGCACCAGCGGCTGCACCTGGGCGAGCGAGCCTACCGCTGCGAGCACTGCGGCAAGGGCTTCTTCTACCTGAGCTCCGTGCTGCGCCACCAGCGTGCCCACGAGCCGCCGCGGCCCGAGCTGCGCTGCCCCGCCTGCCTCAAGGCCTTCAAAGACCCTGGCTACTTTCGCAAGCACCTGGCGGCCCACCAGGGTGGCCGGCCCTTCCGCTGCTCCTCCTGCGGCGAGGGCTTCTCCAACACCTACGGGCTGAAGAAGCACCGCCTGGTGCACAAGGCCGACGGCCTCGGAGCGCCGGGGGCTGGGGCCCTCGCCGGGAAGGACGCCTGA

XM_004866632.1 Coding sequence

LOC101698839 zinc finger protein 865-like, transcript variant X3

Length: 3264 bp    Location: 1803650..1796356   Strand: -
>XM_004866632.1
ATGGGTGTTCAACAGCTGCAAGCGCCCGGGGACGCTACAGACAACAGTAGGCAGAGCCCTGTGTCTACGCAGAGTGGATGTGCTGGGAGAGAGGCGAAGAAAGGGTCTCCCAGCTCCGCTGAGATGGAGTCGAACCCAGCGGGGGGCAGCGGGAACGGCGGCCTGGGGGGCGAGGATGGCGTGCATTTCCAGAGCTACCCCTTCGACTTCCTGGAGTTCCTCAACCACCAGCGCTTCGAGCCCATGGAGCTATACGGGGAGCACGCCAAGGCCGTGGCTGCGCTGCCCTGCGCCCCGGGCCCCCCGCCGCCGCCGCCGCCGCAGCCCCCGCCGCCGCAGTTCGACTACCCGCCACCGGCCAGCTTCAAGCCCAAGGCCGAGGCGCCATCCTCAGCTTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCACCTCCTCCTCTTCCTCGTCCTCCACCTCCTCCGCCCCAGCCAAGAAGCCCGACCCGCCGCTGCCGCCCGCCTTTGGGGCACCCCCACCCCCGCTCTTCGACGCCGCCTTCCCTGCCCCGCAGTGGGGCATCGTGGACCTCTCCGGCCACCAGCACCTGTTCGGGAACCTGAAGCGCGGCGGGCCGGCGGCAGGGCCGGGCGTGGCGCCCGGTCTTGGTGCACCCGCGGGGACCCCGGGGCCGCTGCCCGCGCCCTCACAGACCCCACCTGGCCCCGCCGCCACGGGGGCGGCCTGCGACCCCGCCAAGGACGACAAAGGCTACTTCCGGCGGCTCAAGTACCTGATGGAGCGGCGCTTCCCTTGTGGTGTGTGCCAGAAATCCTTCAAGCAGTCCTCGCACCTGGTGCAGCACATGCTCGTGCACTCGGGCGAGCGGCCCTACGAGTGCGGCGTGTGCGGCCGCACTTACAACCACGTGTCCAGCCTCATCCGCCACCGCCGCTGCCACAAGGACACGCCGGCCGCGGGGGCCCCGCCGGCGCCCCCTGGTGCTCCACTCGCGGCCCCACTGGGCCTCCCCACCGGTGCCGCTGCAGGTGTCACCCCTGCCCCAGTGGGGCCCGCTCCCGCACCCCCAGCCGATGGCAGTGCCACCCCCACCCCTGCGGGCATCCCCGGGCCCCCTGCGGCCAGCGCGGGTGGAGATGGCCCATTCGCCTGCCCGCTGTGCTGGAAGGTGTTCAAGAAGCCCAGCCACCTGCACCAGCACCAGATCATCCACACGGGCGAGAAGCCCTTCTCCTGCTCTGTGTGCAGCAAGAGCTTCAACCGGCGCGAAAGCCTCAAGCGGCACGTGAAGACGCACTCAGCCGACCTGCTGCGCCTGCCCTGCGGCGTGTGCGGCAAGGCCTTCCGCGACGCCGCCTACCTGCTCAAGCACCAGGCGGCACACGCGGGGGCGGGGGCGGGGGCGCGGCCGGCCTACGCCTGCGACCTGTGCGGCAAGTCCTACTCGGCCCCGCAGAGCCTGTTGCGCCACAAGGCCGCGCATGCGCCACCCGCTGCCCCCGAGGCGCCCAAGGACTCGGCGGCTTCGGCCGTCCCGCCGCCCGCGCCTGCCTTCCCCGCCGGCCCCTACCTGCTGCCCACGGAGCCGCCCGCGGGCGACAGTGAGAAGGCGGCGGCAGCTGCTGCCGCGGCCGTGGTGTACGGCGCTGTGCCCGTGCCACTGCTGGGCGCGCACCCGCTGCTGCTCGGGGGGCCGGGGGCCGGGGGCGCGGGTGGTGCAGGCGGTGCGGGCGGCGCGGCTGGAAAGACCTTCTGCTGCGGGATCTGCGGGCGCGGCTTCGGCCGCCGTGAGACGCTGAAGCGCCACGAGCGGATCCACACGGGCGAGAAGCCGCACCAGTGCCCGGTGTGCGGGAAGCGCTTCCGCGAGTCCTTCCACCTGAGCAAGCACCACGTGGTGCACACGCGCGAGCGGCCCTACAAGTGCGAGCTCTGCGGCAAGGTCTTCGGCTACCCGCAGAGCCTCACGCGCCACCGCCAGGTGCACCGGCTGCAGCTGCCCTGCGCCCTGGCTGGGGCCGCCGGGCTGCCAGCTGCCCAAGGCGCCCCGGGAGCCTGCGGAGCCGGGGCCTCCAGCGCTGGGGGGGCGGGCCCCGCCGATGCGCTCAGCTACGCGTGCTCGGACTGCGGCGAACACTTCCCCGACCTCTTCCACGTCATGAGCCACAAGGAGGCGCACATGTCCGAGAAACCTTACGGCTGCGACGCCTGCGGCAAGACCTTCGGCTTCATCGAGAACCTCATGTGGCACAAGCTGGTGCATCAGGCCGCCCCCGAGCGCTTGCTGCCCACTGGTCCCCAGCCCGCAGAGAGCTCGGGTGGCACCGACGCGGCCAGTGTACTGGACAACGGGCTGGCTGGAGAGGTGGGCGCAGCTGTGGCGGCCCTGGCCGGGGTGTCGGGGGGCGAGGACGCGGGCGGCGCTTCTGCTGGGGCCGGTGCGGGCGCGGGCGCGGGTCCAGAACGCTTCAGCTGCGCCACGTGTGGCCAGAGCTTCAAGCACTTCCTGGGCCTGGTGACGCACAAGTACGTGCACCTGGTGCGGCGGACCCTGGGCTGCGGCCTCTGCGGCCAGAGCTTTGCGGGCGCCTACGACCTGCTCCTGCATCGCCGCAGCCACCGCCAGAAGCGCGGCTTTCGCTGCCCAGTGTGCGGGAAGCGCTTCTGGGAGGCAGCTTTGCTCATGCGCCATCAGCGCTGCCACACGGAGCAGCGGCCCTACCGGTGCGGCGTGTGCGGCCGGGGCTTCCTGCGTTCCTGGTACCTGCGACAGCACCGCGTGGTGCACACCGGCGAGCGCGCCTTCAAGTGCGGTGTGTGTGCTAAGCGCTTCGCGCAGTCGTCCAGCCTGGCCGAGCACCGCAGGCTGCATGCTGTGGCGCGGCCCCAGCGCTGCGGTGCGTGTGGCAAAACCTTCCGTTACCGCTCCAACCTGCTGGAGCACCAGCGGCTGCACCTGGGCGAGCGAGCCTACCGCTGCGAGCACTGCGGCAAGGGCTTCTTCTACCTGAGCTCCGTGCTGCGCCACCAGCGTGCCCACGAGCCGCCGCGGCCCGAGCTGCGCTGCCCCGCCTGCCTCAAGGCCTTCAAAGACCCTGGCTACTTTCGCAAGCACCTGGCGGCCCACCAGGGTGGCCGGCCCTTCCGCTGCTCCTCCTGCGGCGAGGGCTTCTCCAACACCTACGGGCTGAAGAAGCACCGCCTGGTGCACAAGGCCGACGGCCTCGGAGCGCCGGGGGCTGGGGCCCTCGCCGGGAAGGACGCCTGA

XM_004866636.1 Coding sequence

LOC101700527 zinc finger protein 579-like, transcript variant X1

Length: 1593 bp    Location: 1820000..1823105   Strand: +
>XM_004866636.1
ATGGATCCGCAGCCCCCTCCGCCGGCGCAGGGCAGCCCTCCTCACCGCGGCCGGGGCCGGGGCCGAGGCCGGGGCCGCGGCCGGGGCCGGGGCCGGGGCCGCGGGGGTGCGGGAGCCCCGCGAGCGCCCCTGCCGTGCCCCACCTGCGGCCGCCTCTTCCGCTTCCCCTACTACCTCTCGCGGCACCGGCTGAGCCACTCGGGGCTGCGGCCTCACGCGTGCCCGCTGTGCCCCAAAGCCTTCCGGCGGCCCGCGCACCTGTCGCGCCACCTGCGGGGCCACGGCCCGCAGCCCCCGCTGCGCTGCGCCGCCTGTCCGCGCACCTTCCCGGAGCCCGCGCAGCTGCGCCGCCACCTGGCGCAGGAGCACGCAGGCGGCGAGGTGGAACTGGCCACGGAGCGTGCGGCCAAGGAGGAGGGCGAGGGCGCTGAGCAGCCGGCGGCGGGCGCCGAGGGTGAGCCGTGGGCCCCCGGGGAGCCCGAGCCGGCCGTGACCCCGAGCACGGAGCTGCACACACCCGAGCCCGAGGCTGTCGAGGCCGGGGCGGCCGAGCTGCGCGCGGAGCTGGCGCTGGCGGCCGGGCGGCAGGAGGAGAAGCAGGTGCTGCTGCAGGCCGACTGGACGCTGCTGTGCCTGCGCTGCCGCGAGGCCTTCGCCACCAAGGGCGAGCTCAAGGCGCACCCGTGCCTGCGCCCTGAGGGCGAGCAGGAGGCCGAGGGTGGGCCGCCGCCGCGGCCCAAGCGACACCAGTGCTCCATCTGCCTCAAGGCCTTCGCCAGGCCCTGGTCGCTGTCTCGCCACCGGCTGGTCCACTCCACCGACCGCCCGTTCGTGTGCCCGGACTGCGGCCTGGCCTTCCGCCTGGCCTCCTACCTCCGCCAGCACCGCCGCGTGCACGGCCCGCTCAGCCTGCTGGTGCCGCTGCCCAAGAAGGACGACAGAGCCGCGGGCGCCCGGAACTCGGGCCGGGGACCCGAGGGCGGCGAGGGCGCCACGGAGGGGGGCGACGGCGGCGAGAACGGGGGCGACGCGGGCCCCGCGCGCCCCCCCGCCGGCGAGCCCCGCTTCTGGTGCCCTGAGTGCGGCAAGGGCTTCCGTCGCCGCGCGCACCTGCGCCAGCACGGCGTCACGCACTCGGGCGCGCGCCCCTTCCAGTGCGTGCGCTGCCAGCGCGAGTTCAAGCGTCTGGCCGACCTGGCGCGCCACGCGCAGGTGCACGCGGGTGGCCCGGCCCCGCACCTCTGCCCTCGGTGCCCGCGGCGCTTCTCGCGTGCCTACAGCCTTCTGCGCCACCAGCGATGCCACCGCGCCGAGCTGGAGCTGGAGAGGGCGGCCGCGCTGCAGGCCCTGCAGGCCCAGGCTTCGCAGTCCCCGGCTCCGCTGGAGCAGGAAGCCGAGGGGCTCCCGCTGCCCGTTGTGCGCATCAAGGAGGAACCGCCCTCGCCGGGGACTCTGCCCCAGTCCCCGGCGGCACCCCCGGTCTTCCTCAGCGCCTCCTGCTTCGACAGCCAAGACCACTCAGCCTTCAAGATGGAAGAGGACGAGGTGGACAGCAAAGCCCAGCTGCGTGGCTTGGGCGGCCTGGCCTCCTGA

XM_004866638.1 Coding sequence

LOC101701108 putative uncharacterized serine/threonine-protein kinase SgK110-like

Length: 1266 bp    Location: 1836022..1838791   Strand: +
>XM_004866638.1
ATGGCCACACAGACAGTGACGCCCGGCCAGAGGGCGACGGAGAGGGACGAGTCCCGGCCAGCCCCTCACGCAGCCCCCAGTGAGGACTGGGCCGTGGGGCCTGGGCGCTGGTGGCGTCACGGGGACCCCAGACTGAGGCGTCCGCCCCAGGCCCCCACACCAGGCAGCCCTGGGATGGAGCTCAGGGCCTCTGAGACTCCTGAGGATGGGGACCTGGAGGAGGACACGGCCACTGCCCTGCTGCGCCTGGTGGAGCTGACAGCCGCACGGGTGACCCCGCTTTGCAGCCTGCGGGTCCAGTACCGCCTGCTCCGGAAGCTGGGTGCGGGCTCCTACGGCCGGGTGCTCCTGGCCCAGCCTCGCCATGGGGGCCCAGCCGTGGCCCTCAAGCTCCTCCGCTGCGACTCAGTCCCGAGAGCCACCTTCCTAAGAGAGTTCTGCGTGGGCCACTGCGTGTCCTCACACCCTGGCCTGCTGCGCACACTGGGGCTCCCCCTGCAGACACCCAGACACTTTGCCTTTGCCCAGGAGTTTGCACCCTGGGGGGACCTCAGCGGGATGCTCCAGGAGAAGGGCCTGCCGGAGTCCATGCTGAAGCGGGTGGCCGCCCAGCTGGCTGGGGCCCTGGACTTCCTGCACGGCCGCGGGCTGGTGCACGCCGATGTCAAGCCGGACAACGTGCTGGTCTTTGATCCAGCCTGCAGCCGTGTGGCCCTGGGCGACCTGGGTCTGACCCGGCCCGAGGGCAGCCCGGCCCCTGCACCACCAGCCCCACTGCCCACCGCGCCACCCGAGCTCTGCCTGCTGCTGCCGCCCGCCACGCTGCCCCTGCGGCCAGCTGTGGACGCCTGGGGCCTGGGCGTGCTGCTCTTCTGCGCTGCCACTGCCTGCTTCCCCTGGGACGTGGCGCTGGCCCCCGACCCTGAGTTCGAGGCCTTCGCCAGCTGGATGACCGCCAGGCCGCAGCCCCCTCAGCCACCTGCGCCCTGGGACCAGTTTGCACCCCCGGCTCTGGCCCTGCTGCAGGGGCTTCTGGACCTGGACCCTGACACCAGGAGCCCCCCGCTGGCCATCCTGAGCGTGCTGGGAGAAGACTGGGGCTTGGAGGCCAACGGAGAGGGTCCTGGGGGCTCCCTGAGCACTGACAGGGAGGAGGGGGACACAGGAGGGTCGAGCTTGGAGGAGGAGACGGACGAGGACGGGGATGAAGGCAGAGGGGGCGGGAACACGGGGACAGACGGTGGAGCCGCCCGGCCAGGTGACTGA

XM_004866640.1 Coding sequence

Ssc5d scavenger receptor cysteine rich domain containing (5 domains)

High confidence: 4 potential gene matches
Length: 4176 bp    Location: 1867876..1849816   Strand: -
>XM_004866640.1
ATGAGGGTCTTGGCCTGTCTCCTCGCAGCACTGGTGGGGATCCAGGCCGTTGACCGGCTGCGCCTGGCCGATGGCCCCCACGGCTGTGCCGGCCGCCTGGAGGTCTGGTATGGCAGCCGCTGGGGCACCGTGTGTGACGACGGATGGGACCTGCAGGATGCCGCGGTGGCCTGCCGGGAGCTGGGCTGCGGAGGGGCGCTGGCCGCCCCCGGGGGCGCCTTCTTTGGGGAGGGCACAGGGCCCGTGTGGCTCAGTGAGCTGGCCTGCCAGGGCCTCGAGGAGCGGCTGGGCCTCTGTCCCCACCGGGGCTGGAAGGCCCACATCTGCTCGCACGAGGAGGACGCGGGCGTGGTCTGCACAGGCCAGCGTGCGGCAGACTCTCAGCATGACTCAACCTCCCCGCTGGATGGGGAGCCCAGGCCTGGCTCCGAGGAGCCCCCTGTGACTCACGCCCCCCGCCCAGCTGGAAGCCCCCAGAACGGCCCCCGGAAGAAAAGCCCCCGGCCACCCAAGCAGGCCAAGTCCACCAGAGCCCCTTTGCTGACCACCGGGGCCCCCCGCCAAGACCGGCTGCGCCTGGTCTCGGGCCCCCACAGCTGTGCCGGCCGCCTGGAGGTCTGGCACGGCGGGCGCTGGGGGTCCGTGTGTGACGACGGATGGGACCTGCAGGACGCCGCGGTGGCCTGCCGGGAGCTGGGCTGCGGAGGGGCGCTGGCCGCCCCCGGGGGCGCCAGATTCGGGCCTGGCTCGGGGCCCGTGTGGATGGACGACGTGGGCTGTGCAGGAGCAGAGCAGGCCCTCCGGGACTGTCCCCGAAGCCCCTGGGGCCGGAGCAACTGTGACCACAGGGAGGACGCCGGGCTGGTGTGCACGGGGCCTGCCCCGAGGCTGCGCCTGGCCGATGGCCCCCATGGCTGTGCCGGCCGCCTGGAGGTCTGGCACGGCGGGCGCTGGGGGTCCGTGTGTGACGACGCCTGGGACCTGCAGGACGCCGCGGTGGCCTGCCGGGAGCTGGGCTGCGGAGGGGCGCTGGCCGCTCCGGGGGCCGCCTTCTTTGGGGAGGGGTCCGGCCCCATCGTCCTGGATGATCTTCGGTGTCGGGGAAACGAGACGGCCTTGCGGTTCTGCCCCGCGCGGCCCTGGGGCCAGCACGACTGTCACCACCGGGAGGACGCTGGGGCTGTGTGTGACGGCATGCCTCTCGGCTACGCAACCCCCACCCGCCCTGTGGTGGACAGCAACAGCTCAGGGCCCGGGACGTCCGCGCCCGGGGCGTGGACACTGGGACCCCTGTCCAGCACAGTGAGCCAGGCTCCCAGGATGCCAGGCAGCTTGCCTCCTGCAGCCTCTCCGACTGCCCCTCAGGAGCCTGGGCCAGATGCAGGGTCTCCTCAGCTGCGCCTGGTGGCCGGGCCCAGCAGGTGCTCAGGCCGGCTGGAGGTCTGGCATGACGGGCGCTGGGGGACAGTGTGTGATGACAGCTGGGACCTGCGGGACTCAGCCGTGGTCTGCCGGGAGCTGGGCTGCAGGGGGCCTCGGCAGCCAGATCCCGCTGTGGGCCGCTTCGGCTGGGGTGCGGGTCCCATTTGGCTGGATGATGTGGGCTGTGTGGGGACCGAGGCTTCGCTGTCTGACTGCCCTGCTGCTCCCTGGGGGAAGCACAACTGCGCTCACAATGAGGATGTCGGGGTCATGTGTACTGGGACCCCTGGCTTGGACACCATCTCAGACCCCTTCAGCTGGAGCTGGCTCCCTGGGCTGGGTAGAGATCGGGATGCTTGGCTCCCAGGAGAACTGGCCACCAAGCCCTCTGCAAGTCTGACCTCCATTGTTCCCGAGAAAACAACCACTAAGGCTCCACGGAAAACCCCCAAGAGTACTAAGAAGTGGGTGACCAAACATGCAAAGAGACCAACTGCTCAGCCCCCCAGGATGCCAACTACTAAACACTCCAGGGGCCTGGGGACCCAGAGCCCCCCAGAACTAACCTCACAGACCACAACCCTGACTACTGAGGCCTCCTCAAAGCAAACCTCTGAGTTATTAAAAAGGCTGCTCACAGAGGCTCCCCACAGATGGACCTCACACACCACCTCCAAGCCAACTCCTCAGGCCCCCTGGACATGGCCCTCAGGGACCATGACAACGCTGTCCCCTCAAGGCCCTCAAGAAATGACCTCTGAGACCACCATCGAGAAAATCCGTCAGGCTTCCCTGGAGCCATCTGCTGAGACCCCAGCCTTCTCCCCCACGGCCAGCATCCCTGGGGAACCAGGCCCCTTCCGGGTTCGTCTGGCCGACGGACCCAACAGGTGTGCTGGCCGGCTAGAAGTGTGGCATGCCGGACGCTGGGGGACGGTCTGTGACGACAGCTGGGACCTGCGGGATGCCACTGTGGTCTGCTGGGAACTGGGTTGTGGAAAGGTCCGGCCCCGAGTGGGCAAAACCCACTACGGCCCTGGGACCGGGCCCATCTGGTTGGATGACATGGGCTGTAAGGGAAGTGAGACCTCGCTGAGCGACTGCCCCTCAGGGGGCTGGGGGAAGCACAACTGTGACCATGAGGAAGACGTGGGGTTTACCTGCACTGGCTACACAGATGATGATGATTATCCCCCCTGGACCTGGGACCCCACTTCAGGAGAAGACCTGGCCAAAGGGGCCACCATGGCACCAGGGCCTGGACGTGCGCTTCCATGGAGCAGCACCAGGCACCCAGCGATCTCCTCCCCAGCAACACGGCTCCTTTCGGTCACAGGTGACCAGGAGGGGTACAAGCCTTCCGGGACATGGGACACGCCTTGGGGCAGGGGCTCAGCCAAACGGACGCCCACCACAGCACCCACGCTTTCCAGTGGCACCTCCAGGCCCCCAGGACATCCCTCTCTGGCTCCCAGGGCCCACGGGGACACAGGTTCCCCACAGAGGGCCGGGCCCGAGCGTCGCCTGCTGCGCCCCACTGCAGCCCGGGCGGCACCCCAGACGCGGCCCCCGGCCCCCTCTGCCTTGCCGGGGCCCCGGGGCCTGCAGCCCACCTCTGGCCCGGCCTCTGTCCTCCCCGGCACCTCAGTGGCCGGCCCGGACCTGCCCTCCTCGACCACGCCCGACCTCTCCCCGGCACCGACCCCTCCGCCCACTGCGCCCCGGGAGCTGACGTCTGACCCCTCCGTACCGCCAGAGGGGACCCCAGGGCCAAACACAGCCCCATACTGGGGGACAGCCGTAGGGACTTCCGGGTCCCCAGAGCCCTCCACAAGCCCGCACCCCACTGCCACCACATACTCCCCCACCACCCCATACCCCACTATAACCCCGAACCCCACCACAACCGCAAACCCCACCACCAGCCCACACTACACCACAACCCTGCAACCCATGGCAACCCCGCTCCCTGCTTCAACCCTTCCCACCACCACAATCCCTCTCCCCGCCACGACCCCCCACCCCACAGCGACTCCCCATCCTGCCACCACCACTCGCCCGGCCAGGACGGCCGACCCCTCCTCCACCCCTATGGTCACTACCAAGTCTCTTCCAACCTCCCTGGGGCCAGAATCACCCTCTTCCACTACAGTGCCAAGGGCTACATCCAGCCTGGGTCCCCAGGTGACCTTCGAGGGGACCCCTCACACCCCCACATCTCAGATGCAGAGCCCAGTGCCCTCTCCAGCCTCAGAGGCCAGCCCCTCCAGGGCCCCTCTAACCTCAAGCAGGGGCCCACTGTCCACTGAGGACTTCAGGCCACCCAGGAGCCAGAACCCCACACTAACCCCAGGCCCAGCCTCCGAGCCCATTCTGCCCTCCGATCCCCACTCCGATCAACTCCCCCATGACCACCCCCCTCTAGGGCCAACCCCTGGTCAGACCCTGGGCCCCCTTGGCCCGTGTGCCTGCCCAGCAGCCCCTGTGAGGGTCAGGGCTTGTGAGCCGCCTGCCTTGGTGGAGCTGGTGGCTGCTGTGAGGGACGTTGGTGGCCAGCTGCAGAGGCTGGCCACGGTCCTGGAACAAGACTGGCAGGAGCGCCAAGCCCTCGGGCTAGGGCTGGCCCAGTTGGGCCTGGGGCAGCTGGGTGAGACAGTAAGGAGACTGGCAGAGGTGGCCTGGGCCCCCAGCACTCCTGTGTCCACTTCCACCACCCCCGAGGAAGAGGAGAGGCCTCTGAGGGGAGATGTATGA

XM_004866644.1 Coding sequence

LOC101702740 zinc finger protein 628-like, transcript variant X2

Length: 3048 bp    Location: 1874523..1870969   Strand: -
>XM_004866644.1
ATGGTCGGCTCCCAAGCAGACATGGTGCCTGCCTCCACCACCGAGGGGCCAGGGGAGAAGCTGGCGCCGGCGGCCCCCGCGACCACGGCCCAGTATGAGTGCGGGGAGTGCGGCAAGTCTTTCCGGTGGTCGTCCAGGCTCCTGCATCACCAGCGCACGCACACTGGCGAGCGGCCCTACAAGTGCCCCGACTGCCCCAAGGCCTTCAAGGGCTCCTCTGCACTGCTCTACCATCAGCGAGGCCACACGGGCGAGCGGCCCTACCAGTGCCCCGACTGCCCCAAGGCCTTCAAGCGCTCATCGCTGCTGCAGATCCACCGCAGTGTGCACACCGGCCTGCGCGCCTTCACCTGCGGCCAGTGTGGCCTGGCCTTCAAGTGGTCATCGCACTACCAGTACCACCTGCGGCAGCACACGGGCGAGCGGCCCTACCCGTGCCCGGACTGCCCCAAGGCCTTCAAGAACTCGTCCAGCCTGCGGCGCCACCGGCATGTCCACACGGGCGAGCGGCCCTACACGTGCGGCGTGTGCGGCAAGAGCTTCACGCAGAGCACCAACCTGCGGCAGCACCAGCGCGTGCACACGGGCGAGCGCCCCTTCCGCTGCGCACTCTGCCCCAAGACCTTCACGCACTCGTCCAACCTGCTGCTGCACCAGCGCACGCACGGGCCCTCTGACTCTCCTGGCCGCACCGTGCCCACGCCCACGCCCCACGAGCCCTGCGGGGTGGGCCCGGGCCTGGTGGCCGAGACCTTCGTGCAGCAGCCCCGCAGCCCGCCCCCGGTGGTGCCCGAGCTCTTCCTGGCGGCGGCGGAGACCACGGTGGAGCTGGTGCTGCGCTGCGATGGCTGCGACCAGGGCTTCGGCAGCGAGGAGCTGCTCCTGGAGCACCAGCCCTGCCCTGGGCCGGCCGCCCCCGACCCCCCAGCGGTGCTGTCCCCGCTGCCTCTGCCCCTGCCGCAGCCCCCTCCGGCCGCCGTGGTCGCTGCCCCAGGCTTCGCCTGCCCGCCCTGCGGGAAGTCCTTCCGCACAGTGGCCGGCCTCTCCCGCCACCAGCACAGCCACAGGGCGGCCGGTGGGCAGGCCTTCCGCTGCGGCAGCTGCGACGGCGCCTTCCCGCAGCTGGCCAGCCTCCTGGTGCACCAGCAGAGCCATGTGGAGGAGGCGGCGGCCGGGCGCCCGCCCCCGCAGGCTGAGGCCGCTGAGGTCACGTGCCCCCAGGAGCCACTGGTCCCTGCCGTGCCTGCTCCGCCGCTGCCTGCCCCGGCCTCCACAGAGCGGCCCTACAAGTGCACGGAGTGTGGCAAGGCCTTCAAGGGCTCCTCGGGGCTGCGCTACCACCTGCGGGACCACACGGGCGAGCGGCCCTACCAGTGTGGCGAGTGTGGCAAGGCCTTCAAGCGCTCGTCGCTGCTGGCCATCCATCAGCGCGTGCACACCGGCCTGCGCGCCTTCACCTGCGGCCAGTGTGGCCTCACCTTCAAGTGGTCCTCGCACTACCAGTACCACCTGCGTCTGCACTCGGGCGAGCGGCCCTACGCCTGCGGCGAATGTGGCAAGGCCTTCCGCAACACCTCGTGCCTGCGGCGCCACCGGCATGTCCACACGGGCGAGAGGCCTCACGCATGCAGCGTGTGCGGCAAGAGCTTCGCACAGACCTCCAACCTGCGGCAGCACCAGCGCGTGCACACGGGCGAGCGCCCCTTCCGCTGTGCGCTCTGCCCCAAGACCTTCACGCACTCGTCCAACCTGCTGCTGCACCAGCGCACGCACTCAGCCGAGCGCCCCTTCACCTGTGCCATCTGCGGCCGCGGCTTCGTCATGGCTGCCTACCTGCAGCGGCACATGAGGACGCACACCCCGGCCCAGGCGGCCTCTGGTGCTGCAGCCCCCCAGCCCCCGGCCCCGCTGGCCGCAGCCCCAGCCCCGCTGGCCACCCAGGATGTCCACGTGCTCCCCCACCTCCAGGCCACACTTTCCCTCGAGGTGGCGGGGGGCACGGCCCAGGCCCCGCCCCCAGGCCCAGCAGCACCCAACTCCCAGACATTTCTCCTGGTGCAGACCGCCCAGGGCCTCCAGCTGATCCCCAGCAGTGTCCAGCCCCCCACCCCGCCGCCCCCACCTGCTCCCCCTAAGCTTATCCTGCTGCCCCCCTCCGGTGCTGGGGGTGGACCAGCGAGGCAGGGGCCTCGGGCTCTGGGAAAAGCTGGCCAGGGTGCAGGAGTGGTTTGGCTACCGGGGCCTGGCGGCCTGGGGGTGCAGGGGGGTGGTGGTGCAGGGGGCAGTGGGGGAGGGCAGAGCCTCATTGTCTTGCAGAATGTAGGGAGTGGGGATGCAGGGCCTCAGGAAGTGAGTGGGGTCCAGCTCCAGCCGGCCCAGGAAGTGACCACAGTCCAGCTCCAGCCGGCCCAGGAAGTGACCACGGTCCAGCTCCAGCCGGCCCAGGAAGTGACCACGGTCCAGCTGCAGCCTTTGGCAGGCCAGCTGTCCAATTCCAGTGGAGGAGCAGTGACCACCGAGGCCCCCAACCTGCTGGTGGTCCAGAGCGAGGCAGCTGAGGAGCTGCTTGCGGCCCCAGGTCCTGGAGAGGCCGGGGATGGCGAGGCCAGCGCGGGTGTGGTGCAGGATGTTGTCTTTGAGACGCTGCAGACAGACGAGGGGCTGCAGAGCGTGCTGGTGCTGAGCGGAGCGGATGGGGAGCAGACACGGCTGTGTGTGCAGGAGGTAGAAACCCTTCCTACTGGGCTGACTGAGCCACCTGCCTCAGCTCCTCCTGGACAGAAACTGCTCATCATCCGCAGCGCCCCTGCCGCCGAGCTGCTGGAAAACCGCAGCGTGGGGGGAGGCACCGCCACGCTGCAGCTCCTGGCCCCTCCGCCCCCTGGCCCAGTCTCTGCCCCTGCGGCAGCGGTACCCGCGGCTACTGCCCCCCAGATGGTGCAGGTGGTCCCCGCAGGGACCGCGCCTGGGCTTGTGAGCCCGCAGGCCCTGCCCTCCATCCAGATCGTGCAGACGCTGCCCGCTGTCCAGCTGGTGCACACGTTTTGA

XM_004866647.1 Coding sequence

Shisa7 shisa homolog 7 (Xenopus laevis), transcript variant X1

Length: 1680 bp    Location: 1900580..1909125   Strand: +
>XM_004866647.1
ATGCCGGCCCTGCTGCTGCTGCTCGCGACGCTGGTGCTGCTAGGCTCGGCCGCCGGCCCGGTCCGGGCGCATCCGCCCAACGCCACGCGCGCCGCGCCCCCGGGCCCGCTGCCCGCGCTGCTCGCGCACCTGCGGCGCCTGACCGGGGCGCTAGCCGGCGGTGGGGACGCGGGCGGCGCGGGCGCCAACGGCACCAGGACGGGGCCCGCGGGCGGCCCGGGCGCCGCTGCGCGCGCCCCCCCGCCGGCCGAGCTGTGCCACGGCTACTACGACGTCATGGGCCAGTACGACGCTACCTTCAACTGCAGCACCGGCAACTACCGCTTCTGCTGCGGCACGTGCCACTACCGCTTCTGCTGCGAGCACCGCCATATGCGCCTGGCGCAGGCGTCCTGCTCCAACTACGACACGCCGCGCTGGGCCACCACGCCGCCGCCGCTGGCCGGGGGTGCGGGGGGCTCGGGGGCCGCGGGCGGAGGCCTGGGGCCCGGCCAGGCCGGGTGGCTGGAGGGCGGCCGCGCGGGGGGGCCTGGAGGGCGCGGGGGCGAGGGCCCCGGGGGCAGCACGGCCTACGTGGTGTGCGGGGTCATCAGCTTCGCCCTGGCCGTGGGCGTTGGCGCCAAGGTGGCCTTCAGCAAGGCGTCGCGCGCGCCCAGGGCGCACCAGGAGATCAACGTGCCCAGGGCTCTGGTGGATATTCTGAGGCACCAGGGCGGGCCTGGGACCCGCCAGGACAGAGCCCGAAGCAGCTCCCTGACCCCGGGGATCGGGGGTTCCGACAGCATGGGCCCCAGGACGCCCAAGAACCTCTACAACACCATGAAGCCATCCAACCTCGATAACCTGCACCACAACTACCTGCACCTCAACATCAGCAGTCCCACGCACCACGCTGTCAGGCTGGACTGGCGCCCGGTGCCCCCGCCCAGCCCCCCACTGCACTACTCCACGCTGTCCTGCTCCCGGTCCTTCCACAACCTCTCACACCTGCCCCCCTCGTACGAGGTGGCCGTGAAGTCGGAGCTGAACCGGTATTCCTCCCTCAAGAGGCTGGCCGAAAAGGACTTGGACGACGTGTACCTGAAGCGGCGGCCGCTGGCCGAAGGACCCCGCGGGACGCTGCCACTGCACGCGCTGCGGCGCCCGGGCACCGGGGGCGGCTACCGCGCCGACGGCTGGGGCGGCCCTGAGCCGCTGAGCCTGGCGCCCGCCCCGCACCCGCGCCGCGTGATGTCGCAGGAGCACCTGCTGGGCGACGGCGGCCGCTCGCGCCACGAGTTCACGCTGCCGCGCGCGCGCCTGGTGTCGCAGGAGCACCTGCTGCTGTCGTCGCCCGAGGCCCTGCGCCAGAGCCGGGAGCACCTGCTGTCGCCGCCGCGCAGTCCCGCGCTGCCCCCCGACCGCGCCGGCCTGGCCGCCTCTCACTCCAACCTGCTGCTGGGGCCCGCGGGGCCGCCCACGCCGCTGCACGCCCTGCCCCCCGCCGGCCTGCACGCGCCTCTGCACCACCACGCGCTGCACGGCTCCCCGCAGCCCGCCTGGGCCGCCGAGGGCGGGGGGACGCTGGCGCGGCGCGCGCCCTTCCAGCGCCAGGGCACCCTGGAGCAGCTGCAGTTCATCCCGGGCCACCACCTGCCGCAGCACCTGCGCACTGCCAGCAAGAACGAGGTGACCGTGTGA

XM_004866648.1 Coding sequence

Shisa7 shisa homolog 7 (Xenopus laevis), transcript variant X2

High confidence: 4 potential gene matches
Length: 1614 bp    Location: 1900580..1909125   Strand: +
>XM_004866648.1
ATGCCGGCCCTGCTGCTGCTGCTCGCGACGCTGGTGCTGCTAGGCTCGGCCGCCGGCCCGGTCCGGGCGCATCCGCCCAACGCCACGCGCGCCGCGCCCCCGGGCCCGCTGCCCGCGCTGCTCGCGCACCTGCGGCGCCTGACCGGGGCGCTAGCCGGCGGTGGGGACGCGGGCGGCGCGGGCGCCAACGGCACCAGGACGGGGCCCGCGGGCGGCCCGGGCGCCGCTGCGCGCGCCCCCCCGCCGGCCGAGCTGTGCCACGGCTACTACGACGTCATGGGCCAGTACGACGCTACCTTCAACTGCAGCACCGGCAACTACCGCTTCTGCTGCGGCACGTGCCACTACCGCTTCTGCTGCGAGCACCGCCATATGCGCCTGGCGCAGGCGTCCTGCTCCAACTACGACACGCCGCGCTGGGCCACCACGCCGCCGCCGCTGGCCGGGGGTGCGGGGGGCTCGGGGGCCGCGGGCGGAGGCCTGGGGCCCGGCCAGGCCGGGTGGCTGGAGGGCGGCCGCGCGGGGGGGCCTGGAGGGCGCGGGGGCGAGGGCCCCGGGGGCAGCACGGCCTACGTGGTGTGCGGGGTCATCAGCTTCGCCCTGGCCGTGGGCGTTGGCGCCAAGGTGGCCTTCAGCAAGGCGTCGCGCGCGCCCAGGGCGCACCAGGAGATCAACGTGCCCAGGGCTCTGGTGGATATTCTGAGGCACCAGGGCGGGCCTGGGACCCGCCAGGACAGAGCCCGAAGCAGCTCCCTGACCCCGGGGATCGGGGGTTCCGACAGCATGGGCCCCAGGACGCCCAAGAACCTCTACAACACCATGAAGCCATCCAACCTCGACTGGCGCCCGGTGCCCCCGCCCAGCCCCCCACTGCACTACTCCACGCTGTCCTGCTCCCGGTCCTTCCACAACCTCTCACACCTGCCCCCCTCGTACGAGGTGGCCGTGAAGTCGGAGCTGAACCGGTATTCCTCCCTCAAGAGGCTGGCCGAAAAGGACTTGGACGACGTGTACCTGAAGCGGCGGCCGCTGGCCGAAGGACCCCGCGGGACGCTGCCACTGCACGCGCTGCGGCGCCCGGGCACCGGGGGCGGCTACCGCGCCGACGGCTGGGGCGGCCCTGAGCCGCTGAGCCTGGCGCCCGCCCCGCACCCGCGCCGCGTGATGTCGCAGGAGCACCTGCTGGGCGACGGCGGCCGCTCGCGCCACGAGTTCACGCTGCCGCGCGCGCGCCTGGTGTCGCAGGAGCACCTGCTGCTGTCGTCGCCCGAGGCCCTGCGCCAGAGCCGGGAGCACCTGCTGTCGCCGCCGCGCAGTCCCGCGCTGCCCCCCGACCGCGCCGGCCTGGCCGCCTCTCACTCCAACCTGCTGCTGGGGCCCGCGGGGCCGCCCACGCCGCTGCACGCCCTGCCCCCCGCCGGCCTGCACGCGCCTCTGCACCACCACGCGCTGCACGGCTCCCCGCAGCCCGCCTGGGCCGCCGAGGGCGGGGGGACGCTGGCGCGGCGCGCGCCCTTCCAGCGCCAGGGCACCCTGGAGCAGCTGCAGTTCATCCCGGGCCACCACCTGCCGCAGCACCTGCGCACTGCCAGCAAGAACGAGGTGACCGTGTGA

XM_004866651.1 Coding sequence

Rpl28 ribosomal protein L28, transcript variant X1

Length: 450 bp    Location: 1925041..1922806   Strand: -
>XM_004866651.1
ATGTCTGCGCATTTGCAGTGGATGATTGTGCGGAACTGCTCCAGCTTCCTGATCAAGAGGAATAAGCAGACGTACAGCACGGAGCCCAATAACCTGAAGGCCCGCAACTCCTTTCGTTACAACGGGCTGATTCACCGAAAGACGGTGGGCGTGGAGCCCGCGGCCGACGGCAAGGGGGTCGTGGTGGTCATGAAGCGGAGATCAGGGCAGCGGAAGCCAGCCACCTCCTACGTGCGCACCACCATCAACAAGAATGCACGCGCCACCCTCAGCAGCATCCGCCACATGATCCGCAAGAACAAGTACCGCCCGGACCTGCGCATGGTGAGGGTTGGTCCAGGGCTGGGGAGGGACGGGGACCCTCTGCGCCCCACTTCAAGGACTCTGCCCCCCCTTCACAGGCCGCCATCCGAAGAGCCAGTGCCATTCTGCGCAGCCAGAAGCCTGTGA

XM_004866654.1 Coding sequence

LOC101706234 transmembrane protein 190-like

Length: 447 bp    Location: 1929499..1928335   Strand: -
>XM_004866654.1
ATGGTGGGCTCGGGGATCCCAGTGTTGGGCCTGTTCCTGCTGATGCAGGGTCCAGGTGATGGGATCGGAATCCACAGATTCTTCTACCTGTGGAGCTGTGAGGGTGATGTGTGGGACTGGGAGAGCTGTGGGGGTCAGGCGGCCATCGAGAGCCCCAACCTCTGCCTGCGCCTGCGCTGCTGCTACAGAGATGGGGTCTGCTACCACCAGCGGCCAGATGAAACCATGTTCAAGAAGCACATGTGGGCCCTGGGCTGGGTCTGCGGAAGCCCCCTCCTCCTGATCTGTGGCATCTGCCTGTTCTGGTGGGCCCGGCGCTGGGACATGCTGCACCTGCCGCGCTTCCTGCAGGGCAAGTGTGACCTGTCCAGTACTGTGTCGCTGCTGTCCAAGGACCAGGCATCAAGTGAGAAGAAGACCTCTGTCGACCAAGAGCCCATGGGGTGA

XM_004866655.1 Coding sequence

Il11 interleukin 11

High confidence: 4 potential gene matches
Length: 600 bp    Location: 1933179..1936893   Strand: +
>XM_004866655.1
ATGAACTGTGTTTGTCGCCTGGTCCTGGTGGTGCTGAGCCTCTGGCCAGAGAGAGCTGCTGCCCGAGGGCCACCTCCTGGTCCCCCTCGAGCGGCCCCAGACCCTCGGGCAGAGCTGGACAGTGCGGTCCTCCTTACCCGCTCCCTCCTGGTGGACACGCGGCAGCTGGCCGCACAGCTGAGAGACAAGTTCCCCGTGGACGGGGACCACAGCCTGGACTCCCTTCCCACTCTGGCCATGAGTGCGAGTGCACTGGGAGCCCTGCAGCTGCCCAGCGTGCTCACGAGGTTGCGGACTGACCTGCTGTCCTACCTGCGACACGTGCAGTGGCTGCGCCGGGTGGGTGGCCCTTCGCTGAGGACCCTGGAGCCTGAGCTGGGCACCCTGCAGGCCCGGCTGGACCGGCTCCTGCGCAGGCTGCAGCTCCTGATGTCCGTCCTGGCCCTGCCCCAGGTGCCCCCAGAACCGCCCACACCACCCCTGGCACCTCCTGCCTCAGCCTGGGGAGGCATCCGGGCGGCCCACGCCGTCCTGGGTGGGCTGCACCTCACCCTGGACTGGGCCGTGCGGGGGCTGCTGCTGCTGAAGACCCGGCTGTGA

XM_004866656.1 Coding sequence

LOC101706975 cytochrome c oxidase subunit 6B2-like, transcript variant X1

Length: 267 bp    Location: 1943059..1944077   Strand: +
>XM_004866656.1
ATGTTGGGTGTCGAAGCCCAGAAGTCCCCCAAGGGGAAATGGACCATGCCACCCTTTGACCCGCGCTTCCCCAACCAGAACCAGATCCATAACTGCTACCAGAACTTCCTGGACTACCACCGCTGCGTTAAGGCAATGAGCCGCTGCGGCCAGAGCTCGCAGCTCTGCGAGTACTATTTCCGCGTGTACCGCTTGCTGTGCCCCCTCAGCTGGGTGCAGCGCTGGAACCAGCAGATCCAGGACGGGCCTTTCGCAGGCAAAATCTGA

XM_004867166.1 Coding sequence

Tmem150b transmembrane protein 150B

High confidence: 4 potential gene matches
Length: 807 bp    Location: 1970662..1975413   Strand: +
>XM_004867166.1
ATGTGGAGCTACCTGTTCCTTCTGCCCATCTTCCTGGCGCTCTGGGCTATCGCTGGTGTCTGGATTGTTTTTGCGATTGCTGTGGTCAACGGGTCTGTGAACCTCACCCATGGCTTCCCTTACATCAGTATCTGTGGCTCCTACCCCCCTCAGAGCTGCATCTTCGGCCAGGTTCTCAATATGGGGGCTGCTGTGGCCGCCTGGATCTGCATTGTGCGTTATCAGCAGCTCCGGGACTGGGGCGTCAGAACGTGGCTTAACAAGTTGACCCTGTGGTCTGGGCTCATCTGTGCTCTAGGGACCTCGGTGGTTGGCAACTTTCAGGAAAAACACCAGAAGCCCACGCACCTGGTGGGGGCCTTTTTCGCCTTCATCGTGGGCAACATCTACTTCTGGCTGCAGCTCCTTCTGTCCTGGCAGATGAAGAGCCGGCCCCAGCCCGGGGAGCCCTGGATCCGGCCGCTGCGCCTGAGCCTGTGCAGCCTGTGCAGCCTCCTCATCGTGGCCATGCTCCTCCTCCACCACTGGCCGCTGCGCTCCGCCTCCGCCGCCTGCGAGTGGGCCCTGGCCATGCTGCTCTTCACGCTCTTCGGCCTCTTTGCCGTGGACTTCTCAGGCCTGGATGGCTGCACCCTGTGCCTGCGGCCAGGGCAGAGCCCGGAGCCCCAGCCTGCGGCCCCCACGGCCCCGCAGTCCCCGCGGGCGCCCAGAGCCGACCTCCCTCGCGCCTGTGGAGGAAGCGGGGGACACTCGGAGCCGCTGCGAGGCCGGCGCCCCAGTGCCCGCCGGTCCCCGCCCCTGCAGTGA

XM_004866659.1 Coding sequence

Brsk1 BR serine/threonine kinase 1, transcript variant X1

Length: 2337 bp    Location: 1995189..1975450   Strand: -
>XM_004866659.1
ATGTCGTCCGGGGCCAAGGAGGGCGGAGGGGGCTCCCCCGCCTACCACCTCCCGCACCCCCACGCGCACCCCCCGCAGCACGCCCAGTATGTGGGCCCCTATCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGACTGGTTAAGCTCGGGGTCCACTGCATCACGGGTCAGAAGGTCGCCATCAAGATCGTGAACCGGGAGAAGCTGTCAGAGTCGGTGCTGATGAAGGTGGAGCGGGAGATCGCCATCCTGAAGCTCATCGAACACCCGCACGTGCTCAAGCTCCACGACGTCTATGAGAACAAGAAATATTTGTATCTGGTTCTGGAGCATGTCTCTGGCGGGGAGCTCTTCGACTACCTGGTGAAGAAGGGGAGGCTGACACCCAAGGAGGCCCGGAAGTTCTTCCGCCAGATTGTGTCGGCCCTGGACTTTTGCCACAGCTACTCCATCTGCCACAGGGACCTGAAGCCCGAGAACCTGTTGCTGGATGAGAAGAACAATATTCGAATTGCGGACTTCGGCATGGCATCCCTGCAGGTGGGGGACAGCCTTCTGGAGACCAGCTGTGGGTCCCCCCACTATGCGTGTCCGGAGGTGATCAAGGGGGAGAAGTATGATGGCCGCCGTGCAGACATGTGGAGCTGTGGGGTCATCCTCTTCGCCCTGCTCGTGGGGGCTCTGCCCTTCGACGACGACAACCTCCGCCAGCTGCTGGAGAAGGTGAAGCGAGGCGTCTTCCACATGCCCCACTTCATCCCTCCCGACTGCCAGAGCCTCCTGCGGGGGATGATCGAGGTGGAGCCCGAAAAGAGGCTGAGCCTGGAGCAAATACAGAAACATCCTTGGTACCTGGGCGGGAAGCACGAGCCCGACCCCTGCCTGGAGCCAGCCCCGGGCCGCAGGGTAGCCATGCGGAGCCTGCCTTCTAATGGTGAGCTGGACCCTGATGTCCTGGAGAGCATGGCATCGCTGGGCTGCTTCAGGGATCGTGACCGGCTGCACCGAGAGCTGCGCAGCGAGGAGGAGAACCAAGAAAAGATGATCTACTACCTGCTGTTGGACCGGAAGGAGCGGTATCCCAGCTGTGAAGACCAGGACCTGCCTCCCCGGAATGATGCTGACCCGCCTCGGAAGCGCGTAGATTCCCCTATGCTGAGCCGGCACGGGAAGCGGCGGCCGGAGCGAAAGTCCATGGAAGTCCTAAGCATCACGGACGCCGGGGGTGGCGGCTCCCCAGTGCCCACCCGCCGGGCCTTGGAGATGGCCCAGCACAGCCAGAGATCCCGTAGCGTCAGTGGCGCCTCCACCGGCCTGTCCTCCAGCCCTCTCAGCAGCCCAAGGAGTCCGGTGTTTTCCTTCTCGCCCGAGCCGGGGGCTGTAGATGAGGCCCGAGGCGGGGGCTCCCCGACATCTAAAACACAGACGCTGCCTTCTCGAGGCCCCAGAGGCGGGGGGACCGGGGAGCAGCCCCCGCCCCCCAGCGCCCGCTCCACGCCCCTGCCCGGACCCCCAGGCTCCCCGCGCTCCTCCGGAGGGACCCCCTTGCACTCGCCCCTGCACACGCCCCGGGCCAGCCCCACGGGGACCCCGGGGACGACGCCACCCCCCAGTCCCGGCGGTGGCGTTGGGGGAGCCGCCTGGAGGAGTCGGCTCAACTCCATCCGCAACAGCTTCCTGGGCTCCCCTCGCTTCCACCGGCGCAAGATGCAGGTCCCCACCGCTGAGGAGATGTCCAGTTTGACACCAGAGTCCTCTCCGGAACTGGCCAAACGCTCCTGGTTTGGGAACTTCATCTCCCTGGACAAAGAAGAACAAATATTCCTCGTGCTCAAGGACAAACCGCTCAGCAGCATCAAAGCGGACATTGTCCACGCCTTCCTGTCGATCCCCAGCCTGAGTCATAGTGTACTGTCACAGACCAGCTTCAGGGCCGAATACAAGACCAGTGGCGGCCCCTCCGTCTTCCAGAAGCCTGTCCGCTTCCAGGTGGACATCAGCTCCTCTGAGGGCCCTGAGCCCTCTCCCCACCGGGATGGCAGCAGTGGAGGTGGCATCTACTCCGTCACCTTTACTCTCATCTCTGGTCCCAGCCGGCGGTTCAAGCGTGTGGTGGAGACGATCCAGGCGCAGCTGCTGAGCACGCACGACCAGCCATCCGTGCAGGCCCTGGCAGATGAGAAGAACGGAGCACAGCCCCGGCCTGCTGGCACCCCGCCCCGAAGCCTGCAGCCCCCACCCAGCCACCCGGACCCGGAGCTGAGCAGCTCTCCCCGCCGAGGCCCCCCCAAGGACAAGAAACTCCTGGCCACCAACGGGACCCCTTTGCCCTGA

XM_004866663.1 Coding sequence

Hspbp1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1077 bp    Location: 1997747..2009683   Strand: +
>XM_004866663.1
ATGGCGGACAAAGGCTCGGGGGGCAGTCGCCTTCCCCTGGCGTTGCCCCCAGCCTCCCAGGGCTGCTCCTCAGGGGGCAGCGGCGGCTCCTCTGCTGAGGGCTCGGGCAACCCCCGGCCACCGCGCAACCTGCAAGGCCTGCTGCAGATGGCCATCACGGCGGGCTCGATGGAGCCAGACCCCCCTCCAGAACCCATGAGCGAGGAGAGGCGGCAGTGGCTGCAGGAGGCCATGTCAGCTGCCTTCCGTGGCCAGCGGGAGGAGGTAGAGCAGATGAAGAGCTGCCTCCGAGTGCTATCCCAGCCCATGCCTGCTGCAGCTGGGGAGACCGAACTGGCTGCTGACCAGCAGGAACGAGAGGGGGCCCTGGAGCTGCTGGCTGACCTGTGTGAGAACATGGACAATGCTGCAGACTTCTGCCAGCTGTCGGGGATGCACCTGCTGGTGGGCCGCTACCTCGAGGCCGGTGCTGCGGGGCTGCGGTGGCGCGCAGCACAGCTCATCGGCACGTGCAGCCAGAACGTGGCGGCCATCCAGGAGCAGGTGCTGGGCCTCGGTGCCCTGCGCAAGCTGCTGCGGCTGCTCGACCGCGACCCCTGCGACACTGTCCGTGTCAAGGCGCTCTTCGCCATCTCCTGCCTTGTGCGGGAGCAGGAGGCAGGGCTGCTGCAGTTCCTCCGCCTGGACGGCTTCTCCGTGCTGATGCGGGCCATGCAGCAGCAGGTGCAGAAGCTCAAGGTGAAGTCGGCATTCCTGCTGCAGAACCTGCTGGTGGGCCACCCGGAGCACAAAGGGACCCTGTGCTCCATGGGGATGGTCCAGCAGCTGGTGGCCCTCGTGCAGACTGAACACAGCCCTTTCCACGAGCACGTGCTTGGGGCCCTGTGCAGCCTGGTGACAGACTTCCCCCAGGGCGTGCGCGAATGCCGGGAGCCTGAGCTGGGGCTGGAGGAGCTGCTACGCCACCGCTGCCAGCTGCTGCAGCAGCGCGAGGAGTACCAGGAGGAGCTGGAGTTCTGTGAGAAGCTGCTGCAGACCTGCTTCTCCAGTCCCATGGACGACAGCATGGATCGGTGA

XM_004866662.1 Coding sequence

Hspbp1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1, transcript variant X1

Length: 1077 bp    Location: 1997747..2009683   Strand: +
>XM_004866662.1
ATGGCGGACAAAGGCTCGGGGGGCAGTCGCCTTCCCCTGGCGTTGCCCCCAGCCTCCCAGGGCTGCTCCTCAGGGGGCAGCGGCGGCTCCTCTGCTGAGGGCTCGGGCAACCCCCGGCCACCGCGCAACCTGCAAGGCCTGCTGCAGATGGCCATCACGGCGGGCTCGATGGAGCCAGACCCCCCTCCAGAACCCATGAGCGAGGAGAGGCGGCAGTGGCTGCAGGAGGCCATGTCAGCTGCCTTCCGTGGCCAGCGGGAGGAGGTAGAGCAGATGAAGAGCTGCCTCCGAGTGCTATCCCAGCCCATGCCTGCTGCAGCTGGGGAGACCGAACTGGCTGCTGACCAGCAGGAACGAGAGGGGGCCCTGGAGCTGCTGGCTGACCTGTGTGAGAACATGGACAATGCTGCAGACTTCTGCCAGCTGTCGGGGATGCACCTGCTGGTGGGCCGCTACCTCGAGGCCGGTGCTGCGGGGCTGCGGTGGCGCGCAGCACAGCTCATCGGCACGTGCAGCCAGAACGTGGCGGCCATCCAGGAGCAGGTGCTGGGCCTCGGTGCCCTGCGCAAGCTGCTGCGGCTGCTCGACCGCGACCCCTGCGACACTGTCCGTGTCAAGGCGCTCTTCGCCATCTCCTGCCTTGTGCGGGAGCAGGAGGCAGGGCTGCTGCAGTTCCTCCGCCTGGACGGCTTCTCCGTGCTGATGCGGGCCATGCAGCAGCAGGTGCAGAAGCTCAAGGTGAAGTCGGCATTCCTGCTGCAGAACCTGCTGGTGGGCCACCCGGAGCACAAAGGGACCCTGTGCTCCATGGGGATGGTCCAGCAGCTGGTGGCCCTCGTGCAGACTGAACACAGCCCTTTCCACGAGCACGTGCTTGGGGCCCTGTGCAGCCTGGTGACAGACTTCCCCCAGGGCGTGCGCGAATGCCGGGAGCCTGAGCTGGGGCTGGAGGAGCTGCTACGCCACCGCTGCCAGCTGCTGCAGCAGCGCGAGGAGTACCAGGAGGAGCTGGAGTTCTGTGAGAAGCTGCTGCAGACCTGCTTCTCCAGTCCCATGGACGACAGCATGGATCGGTGA

XM_004866664.1 Coding sequence

Ppp6r1 protein phosphatase 6, regulatory subunit 1, transcript variant X1

Length: 2643 bp    Location: 2013371..2034848   Strand: +
>XM_004866664.1
ATGTTTTGGAAGTTTGACCTGCACACAAGCTCGCACCTGGACACGCTGCTGGAGCGGGAGGACCTGAGCCTACCCGAGCTGCTGGATGAGGAGGACGTGCTGCAGGAGTGCAAAGTCGTGAACCGCAAGCTGCTGGACTTCCTGCTGCAGCCGCTGCACCTGCAGGCCATGGTGGCCTGGGTCACCCAGGAGCCCCCAGCCAATGCCGAGGAGCGGCTGCGCTACAAGTACCCCAGCGTGGCCTGCGAGATCCTCACCTCAGACGTGCCCCAGATCAACGATGCCCTGGGTGCAGATGAGTCACTCCTGAACCGGCTGTACGGCTTCCTGCAGAGCAGCAGCAGCCTCAACCCGCTGCTGGCCAGCTTCTTCAGCAAGGTCATGGGCATCCTCATCAACCGCAAGACAGACCAGCTCGTGTCTTTCCTGCGCAAGAAGGACGACTTTGTGGACCTGCTGCTGCGGCACATTGGCACCTCAGCCATCATGGACCTCCTGCTGCGCCTGCTCACCTGCGTGGAGCGGCCCCAGCTGCGGCAAGATGTCTTCACTTGGCTCAATGAGGAGAAAATCATCCAGCGGCTGATCGACCAGATCCACCCATCAAAGGATGACAATCAACATTCCAACGCATCTCAGTCTCTGTGCGACATCATCCGCCTGAGCCGGGAGCAGCTGATGCAGGGCCAGGACAGCCTGGAGCCCGACCAGCTGCTGGCCACCCTGGAAAAGCAGGAGACCATGGAGCAGCTGCTCAGCAACATGTTCGAGGGGGAGCTGAGCCAGTCTGTGCTCGTCAGCGGGATCCAGGTGCTGCTCACTCTGCTGGAGCCCAGGCGGCCCAGGTCAGAGTCCGTGACAATGAACAACTTCTTCAGCAGTGTGGATGGGCAGCTGGAGCTCCTGGCCCAGGGGGCCCTGGATAACACTGTGTCCAGCACGGGGGCCCTGCATGCCCTTCGCCCACGGCTCAGCCGCTTCCACCAGCTCCTGCTCGAGCCTCTCGAGCTGGAGCCGCTGCAGATGACATGGGGCAGCCTGGCCCCGCCCCTGGGCAACACGCGGCTGCACGTGGTCAAGCTCCTGGCCAGCGCCCTGAGTGCCAATGACACTGCCCTGACACGGGAGCTCCTGGTGCTGGACGTGCCCAACACCATGCTGGACCTCTTCTTCCACTACGTCTTCAACAACTTCCTGCACACGCAAGTGGAGGTGTGTGTGAGCGCCATGCTGAGCGCGGGGCCCCCTCCCCACAGCGGCTCTGAGACGCCGGGCCAGAACCCCGTGCTGAAACACCTGCTGCAGCACTGCCGCCTGGTGGAGCGGATCCTCACATCCTGGGAGGAGAATGACTGTGTCCAGTCCGGGGGTGGCCCAAGGAAGGGCTACATGGGCCACTTGACACGGGTGGCCAATGCTTTGGTGCAAAACGCGGAGCAGGGGCCCAACGCTGAGCAGCTGGGGCAGTTGCTGAAGGAGCTGCCGGGTGAGCAGCTGGAGCGGTGGGAAGCGTTTGTGTCGGGACCCCTGGCCGAGACCAACAAGAGGAACACTGTGGACCTGGTGAACACCCACCACCTGCACTCCTCCAGTGACGACGAGGACGACCGGCTCAAGGAGTTCAGCTTCCCCGAGGAGGCCGTGCTGCAGCAGGCCTTCATGGACTTCCAGATGCAGCGCATGACCTCGGCCTTCATCGACCACTTTGGCTTTAACGACGAGGAGTTTGGGGAGCAGGAGGAAAGCGTGAACGCGCCTTTCGATAAAACGGCCAACATCACCTTCTCCCTCAACGCCGACGACGAGAACCCCAACGCCAACCTGCTCGAGATATGCTACAAGGACCGCATCCAGCAGTTTGATGACGAGGAGGAGGAAGATGAGGAGGGCCAGGGCTCTGGGGAGTCGGATGGAGAGTACGGTGCCTGGCAGGGCAGCCCGCTGAGCAGGGCAGCCCGCTCGGGCCAGCCCCCCGGGGCCCGGAGTGGAGGCAGCACTGACAGTGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAAGAGGAGGAGGGTGGCGGCGCCCCCATGCCCCCCGGCCCTCAGCCTCCCGGTAAGTGTGGGTCCCTGGGCAGGGCGGGGCACCTGCCTGCCGCTCCTCGCTCACCCTCCTTCCCACCCCACCGCCCAGGCCCCAGCTGGACAGCCGCCTTCGCACCAGTGCCTGTGGACGCCCTGCCAGGCCCCTCCAACTCTGGGGCAGAGGAGCTGCTGCCCCCTGTCCAGAAGCCGAGCAGCCCCCCGACCCCTGTCAGCCCGCAGCTCAGGTCTCAGGGCCCCGTTCCCCCCTCAGCACCTCAGATGGCAGCAGATGGTAGCAAAGTAGAGGAGCCCTCTGCCCCCTGCCAGGCCCTGGTCAGTGTCGAGGCCCTCCAGGCTGCCCTGCACGGGATGCGCTCTGCCCCCAGCTCCTCGGACAGTGCCCCCAGAGACCCCTCTACCTCTGTCCCAGCCTCCGGGGCCCAGCACCCCTCCCAGACCACAGAGGGGGAGAAGAACCCGGAGCCCTTGGGGCTTCCCCCAAGCCAGAGTGCCCAGGCCCGCGAGCCACCTCCGATGCCCAACGGCTCGGCTCCAGTAGCACCCCTCTCCCCGGGCTCCCAGTAG

XM_004866668.1 Coding sequence

Ppp6r1 protein phosphatase 6, regulatory subunit 1, transcript variant X5

Length: 2571 bp    Location: 2013371..2034848   Strand: +
>XM_004866668.1
ATGTTTTGGAAGTTTGACCTGCACACAAGCTCGCACCTGGACACGCTGCTGGAGCGGGAGGACCTGAGCCTACCCGAGCTGCTGGATGAGGAGGACGTGCTGCAGGAGTGCAAAGTCGTGAACCGCAAGCTGCTGGACTTCCTGCTGCAGCCGCTGCACCTGCAGGCCATGGTGGCCTGGGTCACCCAGGAGCCCCCAGCCAATGCCGAGGAGCGGCTGCGCTACAAGTACCCCAGCGTGGCCTGCGAGATCCTCACCTCAGACGTGCCCCAGATCAACGATGCCCTGGGTGCAGATGAGTCACTCCTGAACCGGCTGTACGGCTTCCTGCAGAGCAGCAGCAGCCTCAACCCGCTGCTGGCCAGCTTCTTCAGCAAGGTCATGGGCATCCTCATCAACCGCAAGACAGACCAGCTCGTGTCTTTCCTGCGCAAGAAGGACGACTTTGTGGACCTGCTGCTGCGGCACATTGGCACCTCAGCCATCATGGACCTCCTGCTGCGCCTGCTCACCTGCGTGGAGCGGCCCCAGCTGCGGCAAGATGTCTTCACTTGGCTCAATGAGGAGAAAATCATCCAGCGGCTGATCGACCAGATCCACCCATCAAAGGATGACAATCAACATTCCAACGCATCTCAGTCTCTGTGCGACATCATCCGCCTGAGCCGGGAGCAGCTGATGCAGGGCCAGGACAGCCTGGAGCCCGACCAGCTGCTGGCCACCCTGGAAAAGCAGGAGACCATGGAGCAGCTGCTCAGCAACATGTTCGAGGGGGAGCTGAGCCAGTCTGTGCTCGTCAGCGGGATCCAGGTGCTGCTCACTCTGCTGGAGCCCAGGCGGCCCAGGTCAGAGTCCGTGACAATGAACAACTTCTTCAGCAGTGTGGATGGGCAGCTGGAGCTCCTGGCCCAGGGGGCCCTGGATAACACTGTGTCCAGCACGGGGGCCCTGCATGCCCTTCGCCCACGGCTCAGCCGCTTCCACCAGCTCCTGCTCGAGCCTCTCGAGCTGGAGCCGCTGCAGATGACATGGGGCAGCCTGGCCCCGCCCCTGGGCAACACGCGGCTGCACGTGGTCAAGCTCCTGGCCAGCGCCCTGAGTGCCAATGACACTGCCCTGACACGGGAGCTCCTGGTGCTGGACGTGCCCAACACCATGCTGGACCTCTTCTTCCACTACGTCTTCAACAACTTCCTGCACACGCAAGTGGAGGTGTGTGTGAGCGCCATGCTGAGCGCGGGGCCCCCTCCCCACAGCGGCTCTGAGACGCCGGGCCAGAACCCCGTGCTGAAACACCTGCTGCAGCACTGCCGCCTGGTGGAGCGGATCCTCACATCCTGGGAGGAGAATGACTGTGTCCAGTCCGGGGGTGGCCCAAGGAAGGGCTACATGGGCCACTTGACACGGGTGGCCAATGCTTTGGTGCAAAACGCGGAGCAGGGGCCCAACGCTGAGCAGCTGGGGCAGTTGCTGAAGGAGCTGCCGGGTGAGCAGCTGGAGCGGTGGGAAGCGTTTGTGTCGGGACCCCTGGCCGAGACCAACAAGAGGAACACTGTGGACCTGGTGAACACCCACCACCTGCACTCCTCCAGTGACGACGAGGACGACCGGCTCAAGGAGTTCAGCTTCCCCGAGGAGGCCGTGCTGCAGCAGGCCTTCATGGACTTCCAGATGCAGCGCATGACCTCGGCCTTCATCGACCACTTTGGCTTTAACGACGAGGAGTTTGGGGAGCAGGAGGAAAGCGTGAACGCGCCTTTCGATAAAACGGCCAACATCACCTTCTCCCTCAACGCCGACGACGAGAACCCCAACGCCAACCTGCTCGAGATATGCTACAAGGACCGCATCCAGCAGTTTGATGACGAGGAGGAGGAAGATGAGGAGGGCCAGGGCTCTGGGGAGTCGGATGGAGAGTACGGTGCCTGGCAGGGCAGCCCGCTGAGCAGGGCAGCCCGCTCGGGCCAGCCCCCCGGGGCCCGGAGTGGAGGCAGCACTGACAGTGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAAGAGGAGGAGGGTGGCGGCGCCCCCATGCCCCCCGGCCCTCAGCCTCCCGGTAAGTGTGGGTCCCTGGGCAGGGCGGGGCACCTGCCTGCCGCTCCTCGCTCACCCTCCTTCCCACCCCACCGCCCAGGCCCCAGCTGGACAGCCGCCTTCGCACCAGTGCCTGTGGACGCCCTGCCAGGCCCCTCCAACTCTGGGGCAGAGGAGCTGCTGCCCCCTGTCCAGAAGCCGAGCAGCCCCCCGACCCCTGTCAGCCCGCAGCTCAGGTCTCAGGGCCCCGTTCCCCCCTCAGCACCTCAGATGGCAGCAGATGGTAGCAAAGTAGAGGAGCCCTCTGCCCCCTGCCAGGCCCTGGTCAGTGTCGAGGCCCTCCAGGCTGCCCTGCACGGGATGCGCTCTGCCCCCAGCTCCTCGGACAGTGCCCCCAGAGACCCCTCTACCTCTGTCCCAGCCTCCGGGGCCCAGCACCCCTCCCAGACCACAGAGGGGGAGAAGAACCCGGAGCCCTTGGGGCTTCCCCCAAGCCAGAGGTAG

XM_004866667.1 Coding sequence

Ppp6r1 protein phosphatase 6, regulatory subunit 1, transcript variant X4

Length: 2583 bp    Location: 2013371..2034848   Strand: +
>XM_004866667.1
ATGTTTTGGAAGTTTGACCTGCACACAAGCTCGCACCTGGACACGCTGCTGGAGCGGGAGGACCTGAGCCTACCCGAGCTGCTGGATGAGGAGGACGTGCTGCAGGAGTGCAAAGTCGTGAACCGCAAGCTGCTGGACTTCCTGCTGCAGCCGCTGCACCTGCAGGCCATGGTGGCCTGGGTCACCCAGGAGCCCCCAGCCAATGCCGAGGAGCGGCTGCGCTACAAGTACCCCAGCGTGGCCTGCGAGATCCTCACCTCAGACGTGCCCCAGATCAACGATGCCCTGGGTGCAGATGAGTCACTCCTGAACCGGCTGTACGGCTTCCTGCAGAGCAGCAGCAGCCTCAACCCGCTGCTGGCCAGCTTCTTCAGCAAGGTCATGGGCATCCTCATCAACCGCAAGACAGACCAGCTCGTGTCTTTCCTGCGCAAGAAGGACGACTTTGTGGACCTGCTGCTGCGGCACATTGGCACCTCAGCCATCATGGACCTCCTGCTGCGCCTGCTCACCTGCGTGGAGCGGCCCCAGCTGCGGCAAGATGTCTTCACTTGGCTCAATGAGGAGAAAATCATCCAGCGGCTGATCGACCAGATCCACCCATCAAAGGATGACAATCAACATTCCAACGCATCTCAGTCTCTGTGCGACATCATCCGCCTGAGCCGGGAGCAGCTGATGCAGGGCCAGGACAGCCTGGAGCCCGACCAGCTGCTGGCCACCCTGGAAAAGCAGGAGACCATGGAGCAGCTGCTCAGCAACATGTTCGAGGGGGAGCTGAGCCAGTCTGTGCTCGTCAGCGGGATCCAGGTGCTGCTCACTCTGCTGGAGCCCAGGCGGCCCAGGTCAGAGTCCGTGACAATGAACAACTTCTTCAGCAGTGTGGATGGGCAGCTGGAGCTCCTGGCCCAGGGGGCCCTGGATAACACTGTGTCCAGCACGGGGGCCCTGCATGCCCTTCGCCCACGGCTCAGCCGCTTCCACCAGCTCCTGCTCGAGCCTCTCGAGCTGGAGCCGCTGCAGATGACATGGGGCAGCCTGGCCCCGCCCCTGGGCAACACGCGGCTGCACGTGGTCAAGCTCCTGGCCAGCGCCCTGAGTGCCAATGACACTGCCCTGACACGGGAGCTCCTGGTGCTGGACGTGCCCAACACCATGCTGGACCTCTTCTTCCACTACGTCTTCAACAACTTCCTGCACACGCAAGTGGAGGTGTGTGTGAGCGCCATGCTGAGCGCGGGGCCCCCTCCCCACAGCGGCTCTGAGACGCCGGGCCAGAACCCCGTGCTGAAACACCTGCTGCAGCACTGCCGCCTGGTGGAGCGGATCCTCACATCCTGGGAGGAGAATGACTGTGTCCAGTCCGGGGGTGGCCCAAGGAAGGGCTACATGGGCCACTTGACACGGGTGGCCAATGCTTTGGTGCAAAACGCGGAGCAGGGGCCCAACGCTGAGCAGCTGGGGCAGTTGCTGAAGGAGCTGCCGGGTGAGCAGCTGGAGCGGTGGGAAGCGTTTGTGTCGGGACCCCTGGCCGAGACCAACAAGAGGAACACTGTGGACCTGGTGAACACCCACCACCTGCACTCCTCCAGTGACGACGAGGACGACCGGCTCAAGGAGTTCAGCTTCCCCGAGGAGGCCGTGCTGCAGCAGGCCTTCATGGACTTCCAGATGCAGCGCATGACCTCGGCCTTCATCGACCACTTTGGCTTTAACGACGAGGAGTTTGGGGAGCAGGAGGAAAGCGTGAACGCGCCTTTCGATAAAACGGCCAACATCACCTTCTCCCTCAACGCCGACGACGAGAACCCCAACGCCAACCTGCTCGAGATATGCTACAAGGACCGCATCCAGCAGTTTGATGACGAGGAGGAGGAAGATGAGGAGGGCCAGGGCTCTGGGGAGTCGGATGGAGAGTACGGTGCCTGGCAGGGCAGCCCGCTGAGCAGGGCAGCCCGCTCGGGCCAGCCCCCCGGGGCCCGGAGTGGAGGCAGCACTGACAGTGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAAGAGGAGGAGGGTGGCGGCGCCCCCATGCCCCCCGGCCCTCAGCCTCCCGGCCCCAGCTGGACAGCCGCCTTCGCACCAGTGCCTGTGGACGCCCTGCCAGGCCCCTCCAACTCTGGGGCAGAGGAGCTGCTGCCCCCTGTCCAGAAGCCGAGCAGCCCCCCGACCCCTGTCAGCCCGCAGCTCAGGCGCCTCTTGTTTCCCAGGTCTCAGGGCCCCGTTCCCCCCTCAGCACCTCAGATGGCAGCAGATGGTAGCAAAGTAGAGGAGCCCTCTGCCCCCTGCCAGGCCCTGGTCAGTGTCGAGGCCCTCCAGGCTGCCCTGCACGGGATGCGCTCTGCCCCCAGCTCCTCGGACAGTGCCCCCAGAGACCCCTCTACCTCTGTCCCAGCCTCCGGGGCCCAGCACCCCTCCCAGACCACAGAGGGGGAGAAGAACCCGGAGCCCTTGGGGCTTCCCCCAAGCCAGAGTGCCCAGGCCCGCGAGCCACCTCCGATGCCCAACGGCTCGGCTCCAGTAGCACCCCTCTCCCCGGGCTCCCAGTAG

XM_004866666.1 Coding sequence

Ppp6r1 protein phosphatase 6, regulatory subunit 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 2643 bp    Location: 2013371..2034203   Strand: +
>XM_004866666.1
ATGTTTTGGAAGTTTGACCTGCACACAAGCTCGCACCTGGACACGCTGCTGGAGCGGGAGGACCTGAGCCTACCCGAGCTGCTGGATGAGGAGGACGTGCTGCAGGAGTGCAAAGTCGTGAACCGCAAGCTGCTGGACTTCCTGCTGCAGCCGCTGCACCTGCAGGCCATGGTGGCCTGGGTCACCCAGGAGCCCCCAGCCAATGCCGAGGAGCGGCTGCGCTACAAGTACCCCAGCGTGGCCTGCGAGATCCTCACCTCAGACGTGCCCCAGATCAACGATGCCCTGGGTGCAGATGAGTCACTCCTGAACCGGCTGTACGGCTTCCTGCAGAGCAGCAGCAGCCTCAACCCGCTGCTGGCCAGCTTCTTCAGCAAGGTCATGGGCATCCTCATCAACCGCAAGACAGACCAGCTCGTGTCTTTCCTGCGCAAGAAGGACGACTTTGTGGACCTGCTGCTGCGGCACATTGGCACCTCAGCCATCATGGACCTCCTGCTGCGCCTGCTCACCTGCGTGGAGCGGCCCCAGCTGCGGCAAGATGTCTTCACTTGGCTCAATGAGGAGAAAATCATCCAGCGGCTGATCGACCAGATCCACCCATCAAAGGATGACAATCAACATTCCAACGCATCTCAGTCTCTGTGCGACATCATCCGCCTGAGCCGGGAGCAGCTGATGCAGGGCCAGGACAGCCTGGAGCCCGACCAGCTGCTGGCCACCCTGGAAAAGCAGGAGACCATGGAGCAGCTGCTCAGCAACATGTTCGAGGGGGAGCTGAGCCAGTCTGTGCTCGTCAGCGGGATCCAGGTGCTGCTCACTCTGCTGGAGCCCAGGCGGCCCAGGTCAGAGTCCGTGACAATGAACAACTTCTTCAGCAGTGTGGATGGGCAGCTGGAGCTCCTGGCCCAGGGGGCCCTGGATAACACTGTGTCCAGCACGGGGGCCCTGCATGCCCTTCGCCCACGGCTCAGCCGCTTCCACCAGCTCCTGCTCGAGCCTCTCGAGCTGGAGCCGCTGCAGATGACATGGGGCAGCCTGGCCCCGCCCCTGGGCAACACGCGGCTGCACGTGGTCAAGCTCCTGGCCAGCGCCCTGAGTGCCAATGACACTGCCCTGACACGGGAGCTCCTGGTGCTGGACGTGCCCAACACCATGCTGGACCTCTTCTTCCACTACGTCTTCAACAACTTCCTGCACACGCAAGTGGAGGTGTGTGTGAGCGCCATGCTGAGCGCGGGGCCCCCTCCCCACAGCGGCTCTGAGACGCCGGGCCAGAACCCCGTGCTGAAACACCTGCTGCAGCACTGCCGCCTGGTGGAGCGGATCCTCACATCCTGGGAGGAGAATGACTGTGTCCAGTCCGGGGGTGGCCCAAGGAAGGGCTACATGGGCCACTTGACACGGGTGGCCAATGCTTTGGTGCAAAACGCGGAGCAGGGGCCCAACGCTGAGCAGCTGGGGCAGTTGCTGAAGGAGCTGCCGGGTGAGCAGCTGGAGCGGTGGGAAGCGTTTGTGTCGGGACCCCTGGCCGAGACCAACAAGAGGAACACTGTGGACCTGGTGAACACCCACCACCTGCACTCCTCCAGTGACGACGAGGACGACCGGCTCAAGGAGTTCAGCTTCCCCGAGGAGGCCGTGCTGCAGCAGGCCTTCATGGACTTCCAGATGCAGCGCATGACCTCGGCCTTCATCGACCACTTTGGCTTTAACGACGAGGAGTTTGGGGAGCAGGAGGAAAGCGTGAACGCGCCTTTCGATAAAACGGCCAACATCACCTTCTCCCTCAACGCCGACGACGAGAACCCCAACGCCAACCTGCTCGAGATATGCTACAAGGACCGCATCCAGCAGTTTGATGACGAGGAGGAGGAAGATGAGGAGGGCCAGGGCTCTGGGGAGTCGGATGGAGAGTACGGTGCCTGGCAGGGCAGCCCGCTGAGCAGGGCAGCCCGCTCGGGCCAGCCCCCCGGGGCCCGGAGTGGAGGCAGCACTGACAGTGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAAGAGGAGGAGGGTGGCGGCGCCCCCATGCCCCCCGGCCCTCAGCCTCCCGGTAAGTGTGGGTCCCTGGGCAGGGCGGGGCACCTGCCTGCCGCTCCTCGCTCACCCTCCTTCCCACCCCACCGCCCAGGCCCCAGCTGGACAGCCGCCTTCGCACCAGTGCCTGTGGACGCCCTGCCAGGCCCCTCCAACTCTGGGGCAGAGGAGCTGCTGCCCCCTGTCCAGAAGCCGAGCAGCCCCCCGACCCCTGTCAGCCCGCAGCTCAGGTCTCAGGGCCCCGTTCCCCCCTCAGCACCTCAGATGGCAGCAGATGGTAGCAAAGTAGAGGAGCCCTCTGCCCCCTGCCAGGCCCTGGTCAGTGTCGAGGCCCTCCAGGCTGCCCTGCACGGGATGCGCTCTGCCCCCAGCTCCTCGGACAGTGCCCCCAGAGACCCCTCTACCTCTGTCCCAGCCTCCGGGGCCCAGCACCCCTCCCAGACCACAGAGGGGGAGAAGAACCCGGAGCCCTTGGGGCTTCCCCCAAGCCAGAGTGCCCAGGCCCGCGAGCCACCTCCGATGCCCAACGGCTCGGCTCCAGTAGCACCCCTCTCCCCGGGCTCCCAGTGA

XM_004866677.1 Coding sequence

Syt5 synaptotagmin V, transcript variant X1

High confidence: 4 potential gene matches
Length: 1161 bp    Location: 2071711..2078376   Strand: +
>XM_004866677.1
ATGTTCCCAGAGCCCCCGACCCCGGGGCCTCCAGCTTCCGCCGCGCCTCCGGACTCCAGCCGCATCCGCCAGGGCGCAGTGCCGCCCTGGGCCCTGGCCACCATCGTGCTGGTCTCAGGCCTCCTGGTCTTCAGCTGCTGTTTCTGTCTCTGCCGGAAGCGTTGTCGGAGGCGGATGGGCAAGAAGAACCAGGCACAAGCCCAAGTCCACCTTCAGGAAGTGAAGGAGCTGGGCCAGAGTTACATAGACAAGGTGCAGCCAGAAGTAGAGGAGCTGGAGCCCATGCCAGCTGGGCCAGGGCAGCAGGTAGCAGAGAAGCATGAGCTAGGACGACTGCAGTACTCACTGGACTATGACTTTCAGAGTGGTCAGCTGCTGGTGGGCATCCTGCAAGCGGAGGGACTGGCGGCCTTGGACCTGGGTGGCTCCTCGGACCCCTACGTGCGGGTCTACCTGCTACCAGACAAGCGGAGGCGACACGAGACCAAGGTGCATCGGCAGACACTGAACCCACACTTTGGGGAGGCCTTCACCTTCAAGGTCCCCTATGTGGAGCTGGGAGGCAGAGTGCTGGTCATGGCAGTGTACGACTTCGACCGCTTCTCCCGCAATGATGCCATTGGGGAGGTGCGGGTCCCCATGAGCTCAGTGGACTTGGGGCGGCCAGTGCAGGCCTGGCAGGAACTGCAGGCTGCTCCCAGGGAGGAGCTGGAGAAGCTAGGGGACATCTGCTTCTCTCTCCGCTATGTCCCCACGGCTGGGAAGCTCACTGTCATTGTCCTGGAGGCTAAAAACCTGAAGAAGATGGACGTAGGAGGACTGTCAGATCCCTACGTCAAGGTCCACCTGCTGCAGGGGGGCAAAAAGGTGCGGAAGAAGAAAACCACTATCAAGAAGAACACGCTGAACCCCTACTACAATGAGGCCTTCAGCTTTGAGGTGCCCTGTGACCAAGTCCAGAAGGTGCAGGTGGAGCTGACCGTGCTGGACTACGACAAGCTGGGCAGGAACGAGGCGGTCGGGCGGGTGGCGGTGGGCGTGGCCGCCGGCGGGGCTGGCCTGCGGCACTGGGCGGACATGCTGGCCAACCCCCGGCGGCCGGTGGCGCAGTGGCACTCGCTGCGGCCCCCTGACCGAGTGAGGCCACCGCCTGCACCCTGA

XM_004866675.1 Coding sequence

Dnaaf3 dynein, axonemal, assembly factor 3, transcript variant X4

Length: 1338 bp    Location: 2081997..2087842   Strand: +
>XM_004866675.1
ATGACCACCCCGGCAGGCTCGGGCGCGGGCTTCGGCTGGGTGTCCTGGTGGGGCCTGTCGCCGGCTCTGGACCTGCAGGCGGAGGGCCCTGCTGCGCAAGCGGACGCGGACGCGGACGGGGACGCGGCGCGCGCCACCCCCGAGCTCAACGTGCTGCTGCTGGGCTCCGTGGACGGGCGCCACCTGCTGCGCACCCTGGCCCGGGCGGCTCGCTGGCCGCGCAGGAGGCTCAACTTCTATCTTCTGGAGCACAACCTGGAGGCTGTGGCCCGACACATGCTCATCTTCAGCCTCGCTCTGGAGGACCCCGAGAAGATGGGGCTGCAAGAGCAGAGCGAGGCCTTCCTGGAGGTGTGGGGGAACGCGCTGCTGCGGGCCCCGGTGGCCGCCTTCGTGCGCGAGCAGGCCTCCCGCCTGGCGCTCCTGGTCCCCGAGCCCGACCGCCTGGAGCGGGAGCTGCCCTGGCTCAGCCTGCGTGCGCTCAAGGCCCAGGTCATCCACACCCAGGAATTCCGCCGCTGGAGGGACACAGGCGTCGCCTTTGAACTCAGAGACTCCAGCGCCTACCACGAGCCCAACCGGACCCTGGCGTCCGGCCGCCTCCTGACCCACTGCGGGGAGCGCGTGGCAGCGCGCGGGTACTGGGGGGACATCGCTACGGGGCCCTTCGTGGCCTTTGGCATCGAGGCGGATGACCAGAGCCTCCTGCAGACCAGGAACGGGCAGCCGACCAAGACTGCGGGAGAGATCACGCAACACAACGTGATGGAGGTGCTTCGAGAACTGGCCGCCTGGGGGCGCCCGAGAGACACGCAAGGGGACCGGGAGAAGCAACCCGAGCCGGAAGGCAGCCCGGAGCAGGAGACCTCGGGAGACCTGGCCCCGGCCCCCTTCAAGCTCCACTTCCTGTCGCTTGGATCCGCGCGCTCGCTGCACCACAAAGGCTGCTACCAGGCCCGCTTCCAGCTTCTCTACGTGGCCTGCGGCATGGTGCACCTGCTCGGCCCCGAACTCGCGGCCTGCATGGCCCCCGGCGGGAACCTGCTGGTGGAGTTGGCCCGGTTCCTGGTGGACCTGCGGCCCGAGCAGCTGCAGGCCTTCGCCGCCCGGGTCGGGGAGCTGGCGGGGGCAGCCGGCTTTACCCCGTGCGCTTCGGCCGGGCCCGCGGAGACCTTCGCACGCTTCGCCAAGCAGGGTGCGCGGGGCCCAGACACCCGCCCCAGAGCCCCTTCCGCGGCGCCCCCTGTCGCGGCTGCACCACCCCAGCCCCACGACCTGGCCTCCCACGCCACAACAGGACTGGACTCCGGAGCCCCAGTGCCCCTCTCTGACTTCTAA

XM_004866672.1 Coding sequence

Dnaaf3 dynein, axonemal, assembly factor 3, transcript variant X1

Length: 1521 bp    Location: 2081997..2087842   Strand: +
>XM_004866672.1
ATGACCACCCCGGCAGGCTCGGGCGCGGGCTTCGGCTGGGTGTCCTGGTGGGGCCTGTCGCCGGCTCTGGACCTGCAGGCGGAGGGCCCTGCTGCGCAAGCGGACGCGGACGCGGACGGGGACGCGGCGCGCGCCACCCCCGAGCTCAACGTGCTGCTGCTGGGCTCCGTGGACGGGCGCCACCTGCTGCGCACCCTGGCCCGGGCGGCTCGCTGGCCGCGCAGGAGGCTCAACTTCTATCTTCTGGAGCACAACCTGGAGGCTGTGGCCCGACACATGCTCATCTTCAGCCTCGCTCTGGAGGACCCCGAGAAGATGGGGCTGCAAGAGCAGAGCGAGGCCTTCCTGGAGGTGTGGGGGAACGCGCTGCTGCGGGCCCCGGTGGCCGCCTTCGTGCGCGAGCAGGCCTCCCGCCTGGCGCTCCTGGTCCCCGAGCCCGACCGCCTGGAGCGGGAGCTGCCCTGGCTCAGCCTGCGTGCGCTCAAGTTCCGCGAGCGCGATGAGCTGGAGGCCGTGCTCCGTTTCTGGTCCTGCGAGGAGCGGGGCCCACAGGCCTTCCCCATGGGCCGCCTGTGGGACGCGCGGGTGCGACACTACCTGGGCTCGCGCTACGACGCGCGGTGCGGGGTCAGCGACTGGGACCTGCGCATGAAGTTGCACGACCGCGGGGCCCAGGTCATCCACACCCAGGAATTCCGCCGCTGGAGGGACACAGGCGTCGCCTTTGAACTCAGAGACTCCAGCGCCTACCACGAGCCCAACCGGACCCTGGCGTCCGGCCGCCTCCTGACCCACTGCGGGGAGCGCGTGGCAGCGCGCGGGTACTGGGGGGACATCGCTACGGGGCCCTTCGTGGCCTTTGGCATCGAGGCGGATGACCAGAGCCTCCTGCAGACCAGGAACGGGCAGCCGACCAAGACTGCGGGAGAGATCACGCAACACAACGTGATGGAGGTGCTTCGAGAACTGGCCGCCTGGGGGCGCCCGAGAGACACGCAAGGGGACCGGGAGAAGCAACCCGAGCCGGAAGGCAGCCCGGAGCAGGAGACCTCGGGAGACCTGGCCCCGGCCCCCTTCAAGCTCCACTTCCTGTCGCTTGGATCCGCGCGCTCGCTGCACCACAAAGGCTGCTACCAGGCCCGCTTCCAGCTTCTCTACGTGGCCTGCGGCATGGTGCACCTGCTCGGCCCCGAACTCGCGGCCTGCATGGCCCCCGGCGGGAACCTGCTGGTGGAGTTGGCCCGGTTCCTGGTGGACCTGCGGCCCGAGCAGCTGCAGGCCTTCGCCGCCCGGGTCGGGGAGCTGGCGGGGGCAGCCGGCTTTACCCCGTGCGCTTCGGCCGGGCCCGCGGAGACCTTCGCACGCTTCGCCAAGCAGGGTGCGCGGGGCCCAGACACCCGCCCCAGAGCCCCTTCCGCGGCGCCCCCTGTCGCGGCTGCACCACCCCAGCCCCACGACCTGGCCTCCCACGCCACAACAGGACTGGACTCCGGAGCCCCAGTGCCCCTCTCTGACTTCTAA

XM_004866676.1 Coding sequence

Dnaaf3 dynein, axonemal, assembly factor 3, transcript variant X5

Length: 1245 bp    Location: 2082844..2087842   Strand: +
>XM_004866676.1
ATGCTCATCTTCAGCCTCGCTCTGGAGGACCCCGAGAAGATGGGGCTGCAAGAGCAGAGCGAGGCCTTCCTGGAGGTGTGGGGGAACGCGCTGCTGCGGGCCCCGGTGGCCGCCTTCGTGCGCGAGCAGGCCTCCCGCCTGGCGCTCCTGGTCCCCGAGCCCGACCGCCTGGAGCGGGAGCTGCCCTGGCTCAGCCTGCGTGCGCTCAAGTTCCGCGAGCGCGATGAGCTGGAGGCCGTGCTCCGTTTCTGGTCCTGCGAGGAGCGGGGCCCACAGGCCTTCCCCATGGGCCGCCTGTGGGACGCGCGGGTGCGACACTACCTGGGCTCGCGCTACGACGCGCGGTGCGGGGTCAGCGACTGGGACCTGCGCATGAAGTTGCACGACCGCGGGGCCCAGGTCATCCACACCCAGGAATTCCGCCGCTGGAGGGACACAGGCGTCGCCTTTGAACTCAGAGACTCCAGCGCCTACCACGAGCCCAACCGGACCCTGGCGTCCGGCCGCCTCCTGACCCACTGCGGGGAGCGCGTGGCAGCGCGCGGGTACTGGGGGGACATCGCTACGGGGCCCTTCGTGGCCTTTGGCATCGAGGCGGATGACCAGAGCCTCCTGCAGACCAGGAACGGGCAGCCGACCAAGACTGCGGGAGAGATCACGCAACACAACGTGATGGAGGTGCTTCGAGAACTGGCCGCCTGGGGGCGCCCGAGAGACACGCAAGGGGACCGGGAGAAGCAACCCGAGCCGGAAGGCAGCCCGGAGCAGGAGACCTCGGGAGACCTGGCCCCGGCCCCCTTCAAGCTCCACTTCCTGTCGCTTGGATCCGCGCGCTCGCTGCACCACAAAGGCTGCTACCAGGCCCGCTTCCAGCTTCTCTACGTGGCCTGCGGCATGGTGCACCTGCTCGGCCCCGAACTCGCGGCCTGCATGGCCCCCGGCGGGAACCTGCTGGTGGAGTTGGCCCGGTTCCTGGTGGACCTGCGGCCCGAGCAGCTGCAGGCCTTCGCCGCCCGGGTCGGGGAGCTGGCGGGGGCAGCCGGCTTTACCCCGTGCGCTTCGGCCGGGCCCGCGGAGACCTTCGCACGCTTCGCCAAGCAGGGTGCGCGGGGCCCAGACACCCGCCCCAGAGCCCCTTCCGCGGCGCCCCCTGTCGCGGCTGCACCACCCCAGCCCCACGACCTGGCCTCCCACGCCACAACAGGACTGGACTCCGGAGCCCCAGTGCCCCTCTCTGACTTCTAA

XM_004866670.1 Coding sequence

Tnni3 troponin I type 3 (cardiac), transcript variant X1

High confidence: 4 potential gene matches
Length: 636 bp    Location: 2088617..2092771   Strand: +
>XM_004866670.1
ATGGCGGACGAGAGCAGCGACGCGGCGGGGGAGCCGCGACCCGCGCCCGCCCCGGTCCGACGCCGCTCCTCTGCCAACTACCGCGCCTACGCCACGGAGCCGCACGCCAAGAAAAAGTCTAAGATCTCCGCCTCCAGAAAGCTGCAGTTGAAGACGCTGATGCTGCTGATCGGGAAGCAGGAGCTGGAGCGCGAGGCGGAGGAGCGGCGCGCAGAGAAGGGGCGCGCGCTGAGCACGCGGTGCCAGCCCCTGGAGCTGGCCGGGCTGGGCTCCGCCGAGCTGCAGGACTTGTGCCGGCAGCTCCATGCCCTGGTGGACAAGGCAGATGAAGAGAGATATGACGTAGAGGCCAAAGTTACACAGAACATCACGGAGATCGCAGACCTGACCCAGAAGATCTTCGATCTCCGTGGCAAGTTTAAGCGGCCCACCCTGCGGAGAGTTCGGATCTCTGCAGATGCCATGATGCAGGCCCTGCTGGGAGCCCGGGCCAAGGAATCCTTGGATCTGCGGGCCCACCTCAAGCAGGTGAAGAAGGAAGACACCGAGAAGGAGAACCGGGAGGTGGGCGACTGGCGCAAGAACATCGATGCCCTGAGTGGCATGGAGGGCCGGAAGAAGAAGTTTGAGGGTTGA

XM_004866671.1 Coding sequence

Tnni3 troponin I type 3 (cardiac), transcript variant X2

Length: 546 bp    Location: 2088617..2092771   Strand: +
>XM_004866671.1
ATGGCGGACGAGAGCAGCGACGCGGCGGGGGAGCCGCGACCCGCGCCCGCCCCGGTCCGACGCCGCTCCTCTGCCAACTACCGCGCCTACGCCACGGAGCCGCACGCCAAGAAAAAGTCTAAGATCTCCGCCTCCAGAAAGCTGCAGTTGAAGACGCTGATGCTGCTGATCGGGAAGCAGGAGCTGGAGCGCGAGGCGGAGGAGCGGCGCGCAGAGAAGGGGCGCGCGCTGAGCACGCGGTGCCAGCCCCTGGAGCTGGCCGGGCTGGGCTCCGCCGAGCTGCAGATCGCAGACCTGACCCAGAAGATCTTCGATCTCCGTGGCAAGTTTAAGCGGCCCACCCTGCGGAGAGTTCGGATCTCTGCAGATGCCATGATGCAGGCCCTGCTGGGAGCCCGGGCCAAGGAATCCTTGGATCTGCGGGCCCACCTCAAGCAGGTGAAGAAGGAAGACACCGAGAAGGAGAACCGGGAGGTGGGCGACTGGCGCAAGAACATCGATGCCCTGAGTGGCATGGAGGGCCGGAAGAAGAAGTTTGAGGGTTGA

XM_004866679.1 Coding sequence

Tnnt1 troponin T type 1 (skeletal, slow), transcript variant X1

High confidence: 4 potential gene matches
Length: 801 bp    Location: 2095538..2100647   Strand: +
>XM_004866679.1
ATGCAAAGGCCCTGGATCGTGAAAGCTTGGGGCACCACCACTTGGAGGAGTGTTCGCTGGGGAAGTTGGTGGGCCCATGTGGGGAAGGTTTTCCCCCTGGTGGGGGTCCCCTGCTCATGGCCTCTGCCCTCTGCACGCAGCCGTCCAGTGGTGCCCCCGTTGATCCCCCCCAAGATCCCAGAAGGGGAGCGCGTGGACTTTGATGACATCCACCGCAAGCGCATGGAGAAGGACCTCCTGGAGCTGCAGACGCTCATCGACGTGCACTTTGAGCAGCGCAAGAAGGAGGAGGAGGAGCTGGTGGCGCTGAAGGATCGCATTGAGCGGCGCCGGGCGGAGAGGGCTGAGCAGCAGCGCTTCAGGACTGAGAAGGAGCGCGAGCGGCAGGCCAAGCTGGCGGAGGAGAAGATGCGGAAGGAGGAGGAGGAGGCCAAGAAGCGAGCAGAGGACGATGCCAAGAAGAAGAAAGTGCTGTCCAACATGGGGGCCCACTTCGGGGGTTACCTGGTCAAGGCAGAGCAGAAGCGGGGGAAGCGGCAGACTGGGCGGGAGATGAAGCTGCGGATCCTGTCTGAGCGGAAGAAGCCCCTGAACATCGACCACATGGGCGAGGAGCAGCTCAGGGACAAGGCCCAGGAGCTGTCAGACTGGATCCACCAGCTGGAGTCTGAGAAGTTCGACTTGATGGCGAAGCTGAAGCAGCAGAAATACGAGATCAATGTGCTGTACAACCGCATCAGCCACGCTCAGAAGTTCCGGAAGGGTGCAGGAAAGGGCCGCGTCGGAGGCCGCTGGAAGTGA

XM_004866681.1 Coding sequence

Ppp1r12c protein phosphatase 1, regulatory subunit 12C, transcript variant X1

High confidence: 4 potential gene matches
Length: 2385 bp    Location: 2105037..2122327   Strand: +
>XM_004866681.1
ATGTCTGGGGAGGATGGCCCGGCAGGCGGTCCGGGGGCCTCGGCGGCAGCCCGCGAACGGCGGCAGGAGCAACTGCGACAGTGGGGGGCGCGGGCGGGCGCCGAGCCGGGCGCCGAGCCGGGCGCCGAGCCGGGCCTCAGGGAACGGCGCGCCCGCACGGTCCGCTTCGAGCGCGCCGCCGAGTTCCTGGCGGCCTGCGCGGGCGGAGACCTGGACGAGGCGCTGCTGATGTTGCGTGCGGCAGAGCCGGGCTCCTGCGCCGAGCCAGACCCAGACCCCGCCGCCCCGCCGCCCGCCCTCGCCGTGCTCGACTCCACCAACGCCGACGGCATCAGCGCCCTGCACCAGGCCTGCATTGACGAGAACCTGGAGGTCGTCCGCTTCTTGGTGGAGCAGGGCGCCACCGTGAACCAGGCGGACAACGAGGGCTGGACGCCCCTGCACGTGGCCGCCTCCTGTGGCTACCTGGACATCGCCAGGTACCTCCTGAGCCATGGGGCCAACATCGCTGCTGTCAACAGTGACGGGGACCTGGCCCTGGACCTGGCCGAGTCGGATGCCATAGAGGGGCTGCTGCAGGCGGAGATCGCTCGCAGAGGTGTGGATGTGCAGGCAGCCAAGCGGGCGGAGGAGGAGCTGCTGCTTCATGACACGCGGTGCTGGCTGAATGGGGGCGCCATGCCCGAGGCCCGGCACCCACGCACGGGGGCCTCTGCCCTGCACGTGGCCGCCGCCAAGGGCTACATCGAGGTGATGAGGCTCCTGCTGCAGGCCGGCTATGACCCGGAGCTCCGAGATGGGGATGGCTGGACCCCCCTGCACGCGGCAGCCCACTGGGGTGTGGAGGACGCGTGTCGCCTGCTGGCCGAGCATGGCGGGGGCATGGACTCGCTGACCCACGCGGGGCAGCGGCCCTGTGACCTGGCAGATGAAGAGGTGCTGAGCCTGTTGGAGGAACTGGCTCAGAAGCAGGAGGACCTTCGACACCAGAAGGAAGCTGGCCGGAGCAGAGGCCAGGAGCCCCAGGTTCCATCCAGCAGCAAGCACAGGCGGAGCTCTGTGTGCCGCCTGAGCAGCCGCGAGAAGATCTCCCTGCAGGACCTGTCCAAGGAGCGCAGGCCAGGCGGGGCAGGGGGGCCGCCCATCCGGGACGAGGAGGAAGGGGAAGAGGGCCATCCCGAGCCGCCCCCTGCAGAACCCAGAGCCCTCAATGGCGTGTCCTCCCCGCCCCTCGCCAGTCCCCCGAGCCCTGTGCTGCCTGCCGCCGCCACTGCTGCACCCTGCTCTCAGCGTTTTGGCCTCCAGAAGACTGGGAGCTCTGGGGCTTTGGGGCCTACAGAGAGGCGGGGGGCCGAGGCAGCCACTGGGGCTGGGCTGCAGCGCTCGGCCTCCTCGTCCTGGCTGGAAGGGACCTTGGCGCAGGCCAGGGAGCCCTGTCTTGCCGGGATTCCCCCCACTCTCTCCCGGAAGACCCCGGAGCCCTGTCCCCTGTCTGGGGTTGCCAGGCCCCCACCCACCTTGTATAACTGCACTCCTCCCTCCAGCAGGGAGCTGGGGTCCCCAGCGAAGCCAAATGTCCCCCCAGCCTCCACCCCGGCCCCAGCGGACTCCCGTGACCGGCGGAGGTCCTACCAGATGCCTGCACGGGATGAGGAGTCCGAATCCCAGCGGAAAGCGCGCTCCCGCCTCATGCGCCAGTCTCGGAGGTCCACACAGGGCGTGACTCTGACAGACCTGAAGGAAGCAGAGAAGGTGGCAGGAAAGTCCACTGAGGCAGCGAAGCTGTCTCTGCGGGGCCTGGACCCTTCCCCGAGGCCCAGAGTCCCTGGAGTGGAGAACTCTGAGGGCCCTGCCCGGAGAGCAGAGGCGCCTGATGGGCAGGGCCAGGGACCACAGACTGCCAGGGAGCCCCGCAAGGCTGGCAGGGAGCGGTGGGGGCCTGCGGAGGGGGAGGAGGCGGAGCCCGAGGAGCACAGCTCCGAGTGCAGCAACCGTGTAGATGCCCTCGTGGCCCGGAGGCCTCGGCCGAAGCAGAACCTCACCCCAGAGCCCGAGCTGAAACCAGAGGAGCCAGACGGGGGCTTCAGGAAGCTGTACTCGGAGCTGCGCAGGGAGAACGAGCGGCTTCGAGAGGCCCTGACCGAGACCACACTGCGGCTGGCACAGCTCAAGGTAGAGCTGGAGCGGGCCACACAGCGGCAGGAACGCTTCGCAGAGAGGCCCGCCCTCCTGGAGCTGGAGAGATTTGAGCGCAGGGCCCTGGAGCACAAGGCTGCCGAGCTGGAGGAGGAGCTGAAGGCCCTGTCTGACCTCCGCGCTGATAACCAGCGGCTCAAGGATGAGAATGCAGCACTGATCCGAGTCATCAGCAAGCTGTCCAAGTGA

XM_004866682.1 Coding sequence

Ppp1r12c protein phosphatase 1, regulatory subunit 12C, transcript variant X2

Length: 2382 bp    Location: 2105037..2122327   Strand: +
>XM_004866682.1
ATGTCTGGGGAGGATGGCCCGGCAGGCGGTCCGGGGGCCTCGGCGGCAGCCCGCGAACGGCGGCAGGAGCAACTGCGACAGTGGGGGGCGCGGGCGGGCGCCGAGCCGGGCGCCGAGCCGGGCGCCGAGCCGGGCCTCAGGGAACGGCGCGCCCGCACGGTCCGCTTCGAGCGCGCCGCCGAGTTCCTGGCGGCCTGCGCGGGCGGAGACCTGGACGAGGCGCTGCTGATGTTGCGTGCGGCAGAGCCGGGCTCCTGCGCCGAGCCAGACCCAGACCCCGCCGCCCCGCCGCCCGCCCTCGCCGTGCTCGACTCCACCAACGCCGACGGCATCAGCGCCCTGCACCAGGCCTGCATTGACGAGAACCTGGAGGTCGTCCGCTTCTTGGTGGAGCAGGGCGCCACCGTGAACCAGGCGGACAACGAGGGCTGGACGCCCCTGCACGTGGCCGCCTCCTGTGGCTACCTGGACATCGCCAGGTACCTCCTGAGCCATGGGGCCAACATCGCTGCTGTCAACAGTGACGGGGACCTGGCCCTGGACCTGGCCGAGTCGGATGCCATAGAGGGGCTGCTGCAGGCGGAGATCGCTCGCAGAGGTGTGGATGTGCAGGCAGCCAAGCGGGCGGAGGAGGAGCTGCTGCTTCATGACACGCGGTGCTGGCTGAATGGGGGCGCCATGCCCGAGGCCCGGCACCCACGCACGGGGGCCTCTGCCCTGCACGTGGCCGCCGCCAAGGGCTACATCGAGGTGATGAGGCTCCTGCTGCAGGCCGGCTATGACCCGGAGCTCCGAGATGGGGATGGCTGGACCCCCCTGCACGCGGCAGCCCACTGGGGTGTGGAGGACGCGTGTCGCCTGCTGGCCGAGCATGGCGGGGGCATGGACTCGCTGACCCACGCGGGGCAGCGGCCCTGTGACCTGGCAGATGAAGAGGTGCTGAGCCTGTTGGAGGAACTGGCTCAGAAGCAGGAGGACCTTCGACACCAGAAGGAAGCTGGCCGGAGCAGAGGCCAGGAGCCCCAGGTTCCATCCAGCAGCAAGCACAGGCGGAGCTCTGTGTGCCGCCTGAGCAGCCGCGAGAAGATCTCCCTGCAGGACCTGTCCAAGGAGCGCAGGCCAGGCGGGGCAGGGGGGCCGCCCATCCGGGACGAGGAGGAAGGGGAAGAGGGCCATCCCGAGCCGCCCCCTGCAGAACCCAGAGCCCTCAATGGCGTGTCCTCCCCGCCCCTCGCCAGTCCCCCGAGCCCTGTGCTGCCTGCCGCCGCCACTGCTGCACCCTGCTCTCAGCGTTTTGGCCTCCAGAAGACTGGGAGCTCTGGGGCTTTGGGGCCTACAGAGAGGCGGGGGGCCGAGGCAGCCACTGGGGCTGGGCTGCAGCGCTCGGCCTCCTCGTCCTGGCTGGAAGGGACCTTGGCGCAGGCCAGGGAGCCCTGTCTTGCCGGGATTCCCCCCACTCTCTCCCGGAAGACCCCGGAGCCCTGTCCCCTGTCTGGGGTTGCCAGGCCCCCACCCACCTTGTATAACTGCACTCCTCCCTCCAGCAGGGAGCTGGGGTCCCCAGCGAAGCCAAATGTCCCCCCAGCCTCCACCCCGGCCCCAGCGGACTCCCGTGACCGGCGGAGGTCCTACCAGATGCCTGCACGGGATGAGGAGTCCGAATCCCAGCGGAAAGCGCGCTCCCGCCTCATGCGCCAGTCTCGGAGGTCCACACAGGGCGTGACTCTGACAGACCTGAAGGAAGCAGAGAAGGTGGCAGGAAAGTCCACTGAGGCAGCGAAGCTGTCTCTGCGGGGCCTGGACCCTTCCCCGAGGCCCAGAGTCCCTGGAGTGGAGAACTCTGAGGGCCCTGCCCGGAGAGAGGCGCCTGATGGGCAGGGCCAGGGACCACAGACTGCCAGGGAGCCCCGCAAGGCTGGCAGGGAGCGGTGGGGGCCTGCGGAGGGGGAGGAGGCGGAGCCCGAGGAGCACAGCTCCGAGTGCAGCAACCGTGTAGATGCCCTCGTGGCCCGGAGGCCTCGGCCGAAGCAGAACCTCACCCCAGAGCCCGAGCTGAAACCAGAGGAGCCAGACGGGGGCTTCAGGAAGCTGTACTCGGAGCTGCGCAGGGAGAACGAGCGGCTTCGAGAGGCCCTGACCGAGACCACACTGCGGCTGGCACAGCTCAAGGTAGAGCTGGAGCGGGCCACACAGCGGCAGGAACGCTTCGCAGAGAGGCCCGCCCTCCTGGAGCTGGAGAGATTTGAGCGCAGGGCCCTGGAGCACAAGGCTGCCGAGCTGGAGGAGGAGCTGAAGGCCCTGTCTGACCTCCGCGCTGATAACCAGCGGCTCAAGGATGAGAATGCAGCACTGATCCGAGTCATCAGCAAGCTGTCCAAGTGA

XM_004866685.1 Coding sequence

Eps8l1 EPS8-like 1, transcript variant X3

Length: 2175 bp    Location: 2134083..2124675   Strand: -
>XM_004866685.1
ATGAGCACCACAGCTGCCACCTCTGTCACCCCTGGCCCAGAAGCTGCCCCAAAGCCAAGTGCCAAGTCTATCTATGAGCAGAGGAAGCGTTACTCCACAGTGGTGATGGCCGATGTGTCCCAGTACCAGGTCAATCACCTGGTGACCTTCTGCTTGGGCGAGGAGGACGGCGTGCACACAGTGGAGGATGCATCCAGGAAGCTGGCTGTCATGGACAGCCAGGGCCGCGTCTGGACCCAGGAGATGCTGCTGCGCGTGTCCCCTGGCCATGTCACGCTGCTCGACCCGGCCTCCAAGGAGGAGCTGGAGTCCTATCCCTTGGGCTCCATAGTGCGCTGCGACGCGGTGACGCTGCCGGGCCGGAGCCGCTCGCTGCTGCTGCTGCTGGTGTGTCAGGAGCCCGAGCGCCCACAGCCCGACGTGCACTTCTTCCAGGGCCTACGGCTAGGGGCGGAGCTGATCCGAGAGGACATCCAGGGGGCTCTGCATAGTTACCGCTCGGGACGTGGGGAGCGCAGGGCAGCGGCGCTTAGGGCAGCGGAGGAGGAGCTGCAGCGCGGGACTGCGCCCGCCGCCCAGACCCCGCCCCTGCAGCGCCGCCCGTCTGTCCGCGCGGTGATCAGCTCAGCGGCGCCCACCGCAGGGCGCTGGGCGCCCCCGGTGCAGCGCATCCCCGAGGCGGAGGCGGAAACGGAGGCGGAGGCGAAGCCCGGCCCGGCGAGCGCCGCAGCGAGCAGGGCAGACCCCGCGAGTCCGGACCTGGGCCCGCGCGGCCCGGAGCTGGCCGGTCTGCAGGCGGAGCGCGAAGTGGACATCCTGAACCACGTGTTTGAGGACATAGAGACCTTCGTGTCGAGGCTGCAGAAGTCTGCGGAGGCCACCCGCGTGTTGGAGCACCGGGAGCGTGGCCGAAGGACCCGGCGCCGGGCGGCTGGGGAGGGCCTGCTGACGCTGCGGGCCAAGCCACCCTCGGAATCCGAGTATACGGACGTGCTTCAGAAAATCAAGTATGCCTTCAGCCTGCTGGCCCGACTGCGCGGCAACATCGCCAACCCCTCCTCCCCGGAGCTGCTGCACTTTCTGTTCGGACCGCTGCAGATGATCGTGAACACATCCGGTGGCCCTGAGTTCGCCAGCGCCGTAGGGCGGCCGCACCTGACCTCCGAGGCTGTGACGCTGCTGCGAGACAATGTCACCCCTCGGGAAAACGCGCTGTGGACCTCGCTCGGGGACTCCTGGACCCGCCCCGGGCTGGAGCTGCCCCTAGAGGAGGGACCCGCTTACAGCCCCAAATTTTACAGCGGCTGGGAGCCGCCGGCCACCGATCCCCAGGGCCGTGCCTGGGAGGACTCGGTGGAGAAGCAGCTCCAACACGAGCGGCAGCGCCAGCAGCAAAGCGCACCCCAAGTCGCCGTCAATGGTCACCCAGAGCCGGAGCCAGGGCCAGAGCCAGCAGGAAAGTGGGTCCTCTGTAATTACGACTTCCAGGCCCGCAACAGCAGCGAACTGTCCATCAAGCAGCGAGCAGTGCTGGAGGTCCTGGATGACAGGCGCAAGTGGTGGAAGGTTCGGGACCAACAGGGCCGGGAGGGTTATGTACCCTATAATATCCTGACACCCCATCCCGGACCCCGAGCGGACCACAGCCAGAGCCCTGCGCGAAGCCCGGAGAACAGCACGCCTCCTCCTAACCCCCCAGCTCCAGCCCGGGCCCCAGCTCCCGCTCAGCCCCACTGGGACAGCTGCGACAGCCTCAGCAACTTGGAGCCTAGCGAGAAGGAGAAATTCTCCCAGATGCTGAGTGTGAACGAGGAGCTGCAGGCGCGCCTGGCCCAGGGCCGCTCGGTTCCCAGCCGCGTAGCCCCGGGACCCCGCGCACCGGAGCCGCAGCTCAGCCGGAGCTCCGACGCCGCGGAGGTCCGCGCCTGGCTACAGGCCAAGGGGTTTAGCGTTGGGACTGTGGACGCGCTGGGCGTGCTGACAGGTGCGCAGCTCTTCTCGCTGCGGAAGGAGGAGCTGCGGGCGGTGAGCCCGGAGGAAGGCGCGCGCGTGCACAGCCAGCTCACGGTGCAGCGTGCGCTGCTAGAGGACAAAGAGAAAGTGTCCGAGCTGGAGGCGGTGATGGAGAAGCAGAAGAAGAAGGTGGAAGGCGAGATGAAAGCGGAGGTCATCTGA

XM_004866684.1 Coding sequence

Eps8l1 EPS8-like 1, transcript variant X2

Length: 2244 bp    Location: 2133746..2124675   Strand: -
>XM_004866684.1
ATGGCTTCCCAGCACCCTCACCGTGAAGGCCTTGTGGTGCTGCCTGGCACTCGGTGGGTTCTGCCCCAAATTCCCACAACCTCTCCCACTCTCTTTTCTTTCACCAGCCCAGAAGCTGCCCCAAAGCCAAGTGCCAAGTCTATCTATGAGCAGAGGAAGCGTTACTCCACAGTGGTGATGGCCGATGTGTCCCAGTACCAGGTCAATCACCTGGTGACCTTCTGCTTGGGCGAGGAGGACGGCGTGCACACAGTGGAGGATGCATCCAGGAAGCTGGCTGTCATGGACAGCCAGGGCCGCGTCTGGACCCAGGAGATGCTGCTGCGCGTGTCCCCTGGCCATGTCACGCTGCTCGACCCGGCCTCCAAGGAGGAGCTGGAGTCCTATCCCTTGGGCTCCATAGTGCGCTGCGACGCGGTGACGCTGCCGGGCCGGAGCCGCTCGCTGCTGCTGCTGCTGGTGTGTCAGGAGCCCGAGCGCCCACAGCCCGACGTGCACTTCTTCCAGGGCCTACGGCTAGGGGCGGAGCTGATCCGAGAGGACATCCAGGGGGCTCTGCATAGTTACCGCTCGGGACGTGGGGAGCGCAGGGCAGCGGCGCTTAGGGCAGCGGAGGAGGAGCTGCAGCGCGGGACTGCGCCCGCCGCCCAGACCCCGCCCCTGCAGCGCCGCCCGTCTGTCCGCGCGGTGATCAGCTCAGCGGCGCCCACCGCAGGGCGCTGGGCGCCCCCGGTGCAGCGCATCCCCGAGGCGGAGGCGGAAACGGAGGCGGAGGCGAAGCCCGGCCCGGCGAGCGCCGCAGCGAGCAGGGCAGACCCCGCGAGTCCGGACCTGGGCCCGCGCGGCCCGGAGCTGGCCGGTCTGCAGGCGGAGCGCGAAGTGGACATCCTGAACCACGTGTTTGAGGACATAGAGACCTTCGTGTCGAGGCTGCAGAAGTCTGCGGAGGCCACCCGCGTGTTGGAGCACCGGGAGCGTGGCCGAAGGACCCGGCGCCGGGCGGCTGGGGAGGGCCTGCTGACGCTGCGGGCCAAGCCACCCTCGGAATCCGAGTATACGGACGTGCTTCAGAAAATCAAGTATGCCTTCAGCCTGCTGGCCCGACTGCGCGGCAACATCGCCAACCCCTCCTCCCCGGAGCTGCTGCACTTTCTGTTCGGACCGCTGCAGATGATCGTGAACACATCCGGTGGCCCTGAGTTCGCCAGCGCCGTAGGGCGGCCGCACCTGACCTCCGAGGCTGTGACGCTGCTGCGAGACAATGTCACCCCTCGGGAAAACGCGCTGTGGACCTCGCTCGGGGACTCCTGGACCCGCCCCGGGCTGGAGCTGCCCCTAGAGGAGGGACCCGCTTACAGCCCCAAATTTTACAGCGGCTGGGAGCCGCCGGCCACCGATCCCCAGGGCCGTGCCTGGGAGGACTCGGTGGAGAAGCAGCTCCAACACGAGCGGCAGCGCCAGCAGCAAAGCGCACCCCAAGTCGCCGTCAATGGTCACCCAGAGCCGGAGCCAGGGCCAGAGCCAGCAGGAAAGTGGGTCCTCTGTAATTACGACTTCCAGGCCCGCAACAGCAGCGAACTGTCCATCAAGCAGCGAGCAGTGCTGGAGGTCCTGGATGACAGGCGCAAGTGGTGGAAGGTTCGGGACCAACAGGGCCGGGAGGGTTATGTACCCTATAATATCCTGACACCCCATCCCGGACCCCGAGCGGACCACAGCCAGAGCCCTGCGCGAAGCCCGAACAGCACGCCTCCTCCTAACCCCCCAGCTCCAGCCCGGGCCCCAGCTCCCGCTCAGCCCCACTGGGACAGCTGCGACAGCCTCAGCAACTTGGAGCCTAGCGAGAAGGAGAAATTCTCCCAGATGCTGAGTGTGAACGAGGAGCTGCAGGCGCGCCTGGCCCAGGGCCGCTCGGTTCCCAGCCGCGTAGCCCCGGGACCCCGCGCACCGGAGCCGCAGCTCAGCCGGAGCTCCGACGCCGCGGAGGTCCGCGCCTGGCTACAGGCCAAGGGGTTTAGCGTTGGGACTGTGGACGCGCTGGGCGTGCTGACAGGTGCGCAGCTCTTCTCGCTGCGGAAGGAGGAGCTGCGGGCGGTGAGCCCGGAGGAAGGCGCGCGCGTGCACAGCCAGCTCACGGTGCAGCGTGCGCTGCTAGAGGACAAAGAGAAAGTGTCCGAGCTGGAGGCGGTGATGGAGAAGCAGAAGAAGAAGGTGGAAGGCGAGATGAAAGCGGAGGTCATCTGA

XM_004866683.1 Coding sequence

Eps8l1 EPS8-like 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 2247 bp    Location: 2133739..2124675   Strand: -
>XM_004866683.1
ATGGCTTCCCAGCACCCTCACCGTGAAGGCCTTGTGGTGCTGCCTGGCACTCGGTGGGTTCTGCCCCAAATTCCCACAACCTCTCCCACTCTCTTTTCTTTCACCAGCCCAGAAGCTGCCCCAAAGCCAAGTGCCAAGTCTATCTATGAGCAGAGGAAGCGTTACTCCACAGTGGTGATGGCCGATGTGTCCCAGTACCAGGTCAATCACCTGGTGACCTTCTGCTTGGGCGAGGAGGACGGCGTGCACACAGTGGAGGATGCATCCAGGAAGCTGGCTGTCATGGACAGCCAGGGCCGCGTCTGGACCCAGGAGATGCTGCTGCGCGTGTCCCCTGGCCATGTCACGCTGCTCGACCCGGCCTCCAAGGAGGAGCTGGAGTCCTATCCCTTGGGCTCCATAGTGCGCTGCGACGCGGTGACGCTGCCGGGCCGGAGCCGCTCGCTGCTGCTGCTGCTGGTGTGTCAGGAGCCCGAGCGCCCACAGCCCGACGTGCACTTCTTCCAGGGCCTACGGCTAGGGGCGGAGCTGATCCGAGAGGACATCCAGGGGGCTCTGCATAGTTACCGCTCGGGACGTGGGGAGCGCAGGGCAGCGGCGCTTAGGGCAGCGGAGGAGGAGCTGCAGCGCGGGACTGCGCCCGCCGCCCAGACCCCGCCCCTGCAGCGCCGCCCGTCTGTCCGCGCGGTGATCAGCTCAGCGGCGCCCACCGCAGGGCGCTGGGCGCCCCCGGTGCAGCGCATCCCCGAGGCGGAGGCGGAAACGGAGGCGGAGGCGAAGCCCGGCCCGGCGAGCGCCGCAGCGAGCAGGGCAGACCCCGCGAGTCCGGACCTGGGCCCGCGCGGCCCGGAGCTGGCCGGTCTGCAGGCGGAGCGCGAAGTGGACATCCTGAACCACGTGTTTGAGGACATAGAGACCTTCGTGTCGAGGCTGCAGAAGTCTGCGGAGGCCACCCGCGTGTTGGAGCACCGGGAGCGTGGCCGAAGGACCCGGCGCCGGGCGGCTGGGGAGGGCCTGCTGACGCTGCGGGCCAAGCCACCCTCGGAATCCGAGTATACGGACGTGCTTCAGAAAATCAAGTATGCCTTCAGCCTGCTGGCCCGACTGCGCGGCAACATCGCCAACCCCTCCTCCCCGGAGCTGCTGCACTTTCTGTTCGGACCGCTGCAGATGATCGTGAACACATCCGGTGGCCCTGAGTTCGCCAGCGCCGTAGGGCGGCCGCACCTGACCTCCGAGGCTGTGACGCTGCTGCGAGACAATGTCACCCCTCGGGAAAACGCGCTGTGGACCTCGCTCGGGGACTCCTGGACCCGCCCCGGGCTGGAGCTGCCCCTAGAGGAGGGACCCGCTTACAGCCCCAAATTTTACAGCGGCTGGGAGCCGCCGGCCACCGATCCCCAGGGCCGTGCCTGGGAGGACTCGGTGGAGAAGCAGCTCCAACACGAGCGGCAGCGCCAGCAGCAAAGCGCACCCCAAGTCGCCGTCAATGGTCACCCAGAGCCGGAGCCAGGGCCAGAGCCAGCAGGAAAGTGGGTCCTCTGTAATTACGACTTCCAGGCCCGCAACAGCAGCGAACTGTCCATCAAGCAGCGAGCAGTGCTGGAGGTCCTGGATGACAGGCGCAAGTGGTGGAAGGTTCGGGACCAACAGGGCCGGGAGGGTTATGTACCCTATAATATCCTGACACCCCATCCCGGACCCCGAGCGGACCACAGCCAGAGCCCTGCGCGAAGCCCGGAGAACAGCACGCCTCCTCCTAACCCCCCAGCTCCAGCCCGGGCCCCAGCTCCCGCTCAGCCCCACTGGGACAGCTGCGACAGCCTCAGCAACTTGGAGCCTAGCGAGAAGGAGAAATTCTCCCAGATGCTGAGTGTGAACGAGGAGCTGCAGGCGCGCCTGGCCCAGGGCCGCTCGGTTCCCAGCCGCGTAGCCCCGGGACCCCGCGCACCGGAGCCGCAGCTCAGCCGGAGCTCCGACGCCGCGGAGGTCCGCGCCTGGCTACAGGCCAAGGGGTTTAGCGTTGGGACTGTGGACGCGCTGGGCGTGCTGACAGGTGCGCAGCTCTTCTCGCTGCGGAAGGAGGAGCTGCGGGCGGTGAGCCCGGAGGAAGGCGCGCGCGTGCACAGCCAGCTCACGGTGCAGCGTGCGCTGCTAGAGGACAAAGAGAAAGTGTCCGAGCTGGAGGCGGTGATGGAGAAGCAGAAGAAGAAGGTGGAAGGCGAGATGAAAGCGGAGGTCATCTGA

XM_004866686.1 Coding sequence

Rdh13 retinol dehydrogenase 13 (all-trans/9-cis), transcript variant X1

Length: 1020 bp    Location: 2143056..2159009   Strand: +
>XM_004866686.1
ATGACCACTCTTCATGTGCTCCTCTGCCACCCTGTTGCCCAGCCCCACCCGATGTGTGTGCAGCACCCTCGGGAACAGAGGGACCATGTCACTGGTGGCACTTGTCCCAGCAAGGCCACCATACCCGGGAAGACTGTCATCGTGACGGGAGCCAACACGGGCATTGGGAAGCAGACTGCCTTGGAACTGGCCAGAAGAGGAGGCCACATCATCCTGGCCTGCCGAGACCTGGAGAAGTGTGAGGCGGCGGCCAAGGACATCCGCGGGGAGACCCTCAACCTCCATGTGCACGCGCGCCGGCTGGACCTGGCTTCCCTCAGGTCCGTGCGGGAGTTTGCTGCCAGGATCGTCAAAGAGGAAGAGCGAGTGGATGTTCTCATCAACAATGCGGCCGTGATGCGCTGCCCACAATGGGCCACCGAGGACGGCTTTGAGATGCAGCTGGGCATCAACCACCTGGGTCATTTTCTTTTGACAAACTTGCTGCTGGACAAGCTGAAAGCCTCAGCCCCTTCGAGGATCATCAACCTCTCATCCCTGGCCCACATTGCTGGGCACATTGACTTTGATGACTTGAACTGGCAGAAGAGGAAGTACAACACCAAGGCTGCCTACTGTCAGAGCAAGCTGGCCATCGTCCTCTTCACCAAGGAGCTGAGCCGGCGGCTGCAGGGCACGGGTGTGACCGTCAATGCTTTGCATCCTGGTGTGGCCAGGACAGAGCTGGGCAGACACACTGGCATGCACAACTCCACCTTCTCCAGCTTCACACTTGGGCCCATCTTTTGGCTGCTAGTCAAGAGCCCCCAGCTGGCGGCCCAGCCCAGCACCTACCTGGCTGTGGCGGAGGAACTGGAAGGTGTTTCTGGAAAGTACTTTGATGGACTCAAAGAGATAGCACCAGCCCCTGAGGCTGAGGATGAGGAGGTAGCTCAGAGGCTTTGGGTTGAAAGTGCCCGCCTTGTGGGCTTGGACATGTCCCATGAGTCCCGTGTGAGGGGACAGTCCTGCCCCAGATAA

XM_004867168.1 Coding sequence

LOC101720880 leukocyte immunoglobulin-like receptor subfamily A member 6-like

Length: 2223 bp    Location: 2163051..2207544   Strand: +
>XM_004867168.1
ATGGCCCCTGGGATGGCTCTGCTGCTTGGACTTGTGTCTGCTCTGGACCAGAGGCTCTGGGCCCACAGTGGGTCACCCTCCCAGCCCTCCATCTGGGCAGAGCCAGGAGCTGTGACTCCCAATGGCAGCTCTGTGAGCATCTTCTGCAGGGTCCCTCCAGGGGTGACAAGGTTGTACCTGTTTCGTGGGGAACCCAGCGACATGTGGCATGACATCAGCTCTGAAGGAGCCCAAGATGTGGTTGAGTTCCTCCTCCAGAATGTGGTACACACGAACGCAGGGACGTACCACTGTGTCTACTGGGAGCGAGAAGTCTGGGTAGGATTCAGTGAGTCATTGGAACTGACGGTGACAGGCATCTACAAGGACAAACCGTCTCTGACTACTCACCCAGGTCCCCAGGTGGCCTCGGGAGGAAACGTGACTCTCCTGTGTCAGGCGCCTCACTTTTATGACAACTTCATTCTTTGCAGGAACAGAGGAGCTTCCCTCCCCCAGGACTGCTCACACCAGGGCCACCACTCGTTCCTCATCTCCCCAGACAGCCTGGCCGAAGGTGGGACCTACACGTGCTATGTGTCTCATAGAACGTACTCCTGCCTCTGGTCCCTGCCCAGCGACCCTCTTGACCTTTCTTTCACAGATTACAGAGCAGAGAATATCATCCAGTTGAGTCTGGCTGCCCTTGTCCTGTTAGTCCTCATGGCTTTGCTGATGGATGCCTGGAAGAGCAGAGGAGACCTGGGCCCTCCAGGGACCACCTCATTGCGTCTGCATCAGTCCAAACCCGGAGGAGAGCCGTATGACAGGCATCTAGAGGGAGGCCAGGAGATGGTGGAGTTCTCCCTGCAGGGGGTCACACAGGCCATGGCAGGGGTCTATTACTGCCATTACTGGAAGAAAGAAATCTGGTCAGAATGCACTGAGTCCCTGGAGCTGATGAATGACAAACCCTCCCTGACTGCTGTCCGAGGCCCCCAGGTGGCCTCAGGAGGAAACGTGACTCTCCTGTGTCACTCGCTGTACCTCTATGACTCCTACCTCCTGTGCAGGGGAGGCGGGGCTTCCTTCCCCCAGGCCTGTTCACGGCAGCAGCACAGCTCATTCCTCATCTCCCCTGTGAGCCTGGGCCAGGCCGGGACCTACGTGTGCTATGGCTCTCTTGACCTCAGCTCCTATCTCTGGACTCTGCCCAGCGACCCCCTTGACCTTATGGTCTCCATGGCTGAGGACCCCAGGGAGGTGACCTACGCCCAGCTGTGGCCAGAGGGGCTCAGGGAGAGTGCTGCCCTGCTCCCCTCCTGTGAGCCTGAGGAGCCGTCCACGCAGCCCTGCCACCTCCCCAAGCCCTCCCTGCAGGCTCTGCCCAGCTCCCTGGTGCCCCTGGAGAAGTCGGTGACCATCCGGTGCCGGGGGCCCCCGAGGGTGGACCTGTACCGCCTGGAGAAACTGGGGTCCAGGAGGTATGAGGACCAGGCCGACCTCTTCATCCCGGCCATGAAGACCAGCCACGCTGGACGCTACCGCTGCTCCTACCAGAACCGGTCACGCTGGTCGCTGCCCAGCGACAACCTGGAGCTGGTTGCTACTGGAGTCTACAGGAAGCCCTCGCTCTCCGCGCACCCCAGCCCGGCCGTGTCCCCCGGGGGCGACGTGACCCTGCAGTGCCGGACCCAGTACGGCTTTGACCAGTTCGCCCTGTACAAGGAGGGGGACGCCGGGCCCCATAAGCGGCCCGAGAAGTGGTACCGGGCCGACTTCTCCCTCATCACGGTGACGGCCGCCCACAGCGGGACATACCGGTGCTACAGCTTCTCCAGCGCAGCCCCCTTCCTGTGGTCGGCGCCCAGCGAGCCCCTGGAGCTCAGGGTCACAGGAGCCTCTGAGGCCCCCACCCAGTCGCCCACACAGGCACCTTCCTCCACGACAGAATCCTCCAGGACACCCAGCATCTCGCCCATGAACATAGGCTCCACAATTGCGACATCTAGGAACAACGCTGTCTCTCCCAGGGGCTCAAGCCCTCCTCTGGGTAAGTGGGCCTCCCAGGCCTCTCCCTGCTCGCCGCCTCCTCCCCGGAAGTGCACCCCGGAAACGCACCCTTTCTCTGTAGAGGAGCCCAGGCTCCCTGGTCCCGTGTGTGCAGCATTAACGGGACAGGGTGATCAGCGCGAGCTCCAGACTGGGCAACAAGATCAGGTGGGGAGGTTAGGGTTTTCCTGA

XM_004866688.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1623 bp    Location: 2246356..2214442   Strand: -
>XM_004866688.1
ATGTCACCGAAGTCTGGGGACAAGGCCAACTTCTCCGTCCCATCCATGACAGAGCACCATGCAGGGCCATATCACTGTCACTATCGCAGCCGTGCTGTCTGGTCAGAGCGCAGTGAGCCCCTGGAGCTGCTGGGGACAGGAGCCCACAGCAAACCCAGCCTCTCAGCCCTGCCCAGCCCTGCGGTGACCTCAGGAGGGACCGTGACCCTCCAGTGTGGCTCACGGCAGAGGTTTAACAGGTTCCTTCTGACTCAGGAAGGAGAAGATGGGCTCTCCTGGACCCTGGACTCACAGCGAGGCCCCGGAGGGCAGGTCCAGGCCCTGTTCCCTGTGGGCCCTGTGACCGCTGGCCACAGGTGGACGTTCAGATGCTACGGCTACGACAGGAGCAAACTCCAGGACGCAGCTCCGCTGAGCAGCACAGTCAGGGCTCAGCACATCCATGCAGGGCCATATCACTGTCACTATCGCAGCCCTGCTGTCTGGTCAGAGCGCAGTGAGCCCCTGGAGCTGCTGGGGACAGGAGCCCACAGCAAACCCAGCCTCTCAGCCCTGCCCAGCCCTGCGGTGACCTCAGGAGGGACCGTGACCCTCCAGTGTGGCTCACGGCAGAGGTTTAACAGGTTCCTTCTGACTCAGGAAGGAGAAGATGGGCTCTCCTGGACCCTGGACTCACAGCGAGGCCCCAGAGGGCAGGTCCAGGCCCTGTTCCTTGTGGACCCTGTGATCCCCGGCCACAGGTGGACGTTCAGATGCTACGGCTATGACAGGAACAATCCCCAGGTGCGGTCGGAGCCCAGTGACACCCTGGAGCTTCTGGTCTCAGGGCTGTCCAGGAAGCCCTCCCTCCTCACCCAGCCGGGCCCTGTCCTGGGCCCTGGACACAGCCTGACCCTGCAGTGTCGCTCTGACATCGCCTATGACAGGTTCGCTCTGTCCAAGGAGGGGGAACCTGACCTCCCCCAGCGCCCTGGCCAACAGCCCCAGGCTGGGCTCTCTCAGGCCCACTTCCCCCTGGGCCCTGCCAGCAGCTCCCACGGGGGCCGCTACAGATGCTACGGTGGACACAGCCTCTCCTCCGAGTGGTCGGCCCCCAGTGAGCCCCTGGACATCCTGGTCACAGGACAGCTGCCTGTCACAGCCTCCCTCTCGGTGCAGCCGGGACCCATGGTGTCCCCAGGAGAGGATGTGGCCCTGCTGTGTGAGTCACGGAGCCTGGTGGACACTTTCCCCCTGTCCAAGGAGGGGNCCGCCGATCCCCCACTGCATCTGGGATCAGAGTCCCGAGCTCAGCAGTACCAGGTGGAATTCTCCATGAGAGCTGTGACCTCAGCCCCGNGGGGGACCTACGGGTGCTATGGCTCTCGCAGCTCCGCTCCCCACCTGTTGGCGCAGCCCAGAGACCCCCGGCAGCTCAGAGTCTCAGGAGGAGCTGGGACAATTGGGCCAGCAAAGAACAAATCAGATCCCAATGCTGCCAGAGAAGGACCTGAGATGCAGCCAGAGGTGAACACCAGAGAGGACAGTGCATCTTCTGAGCAGCAGAGTCCTGGGCATTCATCTGAAGTTCCCAGGAGACCGGGGAAGAAGATCTGGGGTTGTCAGTTGGGGGCTGTCAGCTGA

XM_004866694.1 Coding sequence

Cdc42ep5 CDC42 effector protein (Rho GTPase binding) 5, transcript variant X6

Length: 426 bp    Location: 2272082..2276418   Strand: +
>XM_004866694.1
ATGCCGGTGCTGAAGCAGCCGGGCCCAGCGCAGCCCAAGAAGCGCAGCCCAAGAGGCGGTGCGCTGTCCATCTCGGCGCCGCTCGGTGACTTCCGGCACACGCTGCACGTGGGGCGCGGCGGCGACACCTTCGGGGACACCTCCTTCCTGAGCCGCCACGGGGCCGCGCCGCCCGCCGCCGAGCCCCACTCGAAGCCCGCGGGGACCCCGCCGCCCCCGCCCGCGGCGCCCCCAGACCCGCTGCTGTCCTTCCACCTGGACCTGGGCCCCTCCATGCTGGACGCCGTGCTGGGCGTCATGGATGCGGGGCGCGCGGGAGCGGCTGCCCAGCCGGAAGCAGACGCACGCCCTGGGACGCAGCCCCGCCGGGGCCCCCGCAGCCGCCCCGACGCCCGCCTGGAGCTGGACCGCGGGCTCGGCCTGTAG

XM_004866690.1 Coding sequence

Cdc42ep5 CDC42 effector protein (Rho GTPase binding) 5, transcript variant X2

Length: 474 bp    Location: 2272082..2276418   Strand: +
>XM_004866690.1
ATGATCCGCCCAGCTCCGCAGCTTGCACTGACCCCCCTCCCCCCGCAGATGCCGGTGCTGAAGCAGCCGGGCCCAGCGCAGCCCAAGAAGCGCAGCCCAAGAGGCGGTGCGCTGTCCATCTCGGCGCCGCTCGGTGACTTCCGGCACACGCTGCACGTGGGGCGCGGCGGCGACACCTTCGGGGACACCTCCTTCCTGAGCCGCCACGGGGCCGCGCCGCCCGCCGCCGAGCCCCACTCGAAGCCCGCGGGGACCCCGCCGCCCCCGCCCGCGGCGCCCCCAGACCCGCTGCTGTCCTTCCACCTGGACCTGGGCCCCTCCATGCTGGACGCCGTGCTGGGCGTCATGGATGCGGGGCGCGCGGGAGCGGCTGCCCAGCCGGAAGCAGACGCACGCCCTGGGACGCAGCCCCGCCGGGGCCCCCGCAGCCGCCCCGACGCCCGCCTGGAGCTGGACCGCGGGCTCGGCCTGTAG

XM_004866693.1 Coding sequence

Cdc42ep5 CDC42 effector protein (Rho GTPase binding) 5, transcript variant X5

Length: 426 bp    Location: 2272082..2276418   Strand: +
>XM_004866693.1
ATGCCGGTGCTGAAGCAGCCGGGCCCAGCGCAGCCCAAGAAGCGCAGCCCAAGAGGCGGTGCGCTGTCCATCTCGGCGCCGCTCGGTGACTTCCGGCACACGCTGCACGTGGGGCGCGGCGGCGACACCTTCGGGGACACCTCCTTCCTGAGCCGCCACGGGGCCGCGCCGCCCGCCGCCGAGCCCCACTCGAAGCCCGCGGGGACCCCGCCGCCCCCGCCCGCGGCGCCCCCAGACCCGCTGCTGTCCTTCCACCTGGACCTGGGCCCCTCCATGCTGGACGCCGTGCTGGGCGTCATGGATGCGGGGCGCGCGGGAGCGGCTGCCCAGCCGGAAGCAGACGCACGCCCTGGGACGCAGCCCCGCCGGGGCCCCCGCAGCCGCCCCGACGCCCGCCTGGAGCTGGACCGCGGGCTCGGCCTGTAG

XM_004866692.1 Coding sequence

Cdc42ep5 CDC42 effector protein (Rho GTPase binding) 5, transcript variant X4

Length: 474 bp    Location: 2273138..2276418   Strand: +
>XM_004866692.1
ATGATCCGCCCAGCTCCGCAGCTTGCACTGACCCCCCTCCCCCCGCAGATGCCGGTGCTGAAGCAGCCGGGCCCAGCGCAGCCCAAGAAGCGCAGCCCAAGAGGCGGTGCGCTGTCCATCTCGGCGCCGCTCGGTGACTTCCGGCACACGCTGCACGTGGGGCGCGGCGGCGACACCTTCGGGGACACCTCCTTCCTGAGCCGCCACGGGGCCGCGCCGCCCGCCGCCGAGCCCCACTCGAAGCCCGCGGGGACCCCGCCGCCCCCGCCCGCGGCGCCCCCAGACCCGCTGCTGTCCTTCCACCTGGACCTGGGCCCCTCCATGCTGGACGCCGTGCTGGGCGTCATGGATGCGGGGCGCGCGGGAGCGGCTGCCCAGCCGGAAGCAGACGCACGCCCTGGGACGCAGCCCCGCCGGGGCCCCCGCAGCCGCCCCGACGCCCGCCTGGAGCTGGACCGCGGGCTCGGCCTGTAG

XM_004866699.1 Coding sequence

LOC101720059 leukocyte receptor cluster member 9-like

Length: 669 bp    Location: 2276432..2277664   Strand: +
>XM_004866699.1
ATGCCACCCGAGGTCCCGGCCAGTGTGGGTGCTGCCGCCTCCATGGCCGAGGTGTCCCCAGGCCCCAGCGCCGTCCCGGCAGGACTGCCCTCGACACCCACAGCGACGGAAGGGGAGCCAGTGCTGCGGCCCGAGGCACCCCCGGCCTGCCTCTTCCGGGAGGGCCGCTGCCGCCAGCCCCACTCCGGAGCTCCCGTGCCGCCCGTCCGCCCGGCGCAGCCAGAGGTGGGGGCCAAAAAGCCGCCCCTGCGCACGGCCGCAGCCGTCATCCAGCGCATCCTCTGGGACCCGCGCCTGGACCCCGCCGACTTCTCGGTGGGCTACGCCGACCGCTTCCTGGGCGTGCGCAAGGAGCCGTTCAGCGCCTTCTGCTGGGACCAGCCGCTGGCGGCGCTGGGCCCGGGCGTGCTGGCCGTGCCGCAGCACCGCGTGCGCTACTTCCGCTGCCGCGGCCGCCTAGTGTGGGACCGCGCCTCGCGAACAGACCTGGTCTTCGGCTCTGGCTCGGCGGCCGGCCGCGGACCCACCATCCTGGACTTGCTAGACAGCGAGGACGCCGCGGGGAGCTCGGAGCCGGCCGACCCCGAGGACCCCGAGCCTGGAGTAGAGAAGCAGGACGACGACCCCGGAACGCAGCTGCGGGACGAGGGAGCCGACCCCGCGGACTGA

XM_004866697.1 Coding sequence

Leng8 leukocyte receptor cluster (LRC) member 8, transcript variant X2

High confidence: 4 potential gene matches
Length: 2400 bp    Location: 2289149..2278115   Strand: -
>XM_004866697.1
ATGGCTGCCAATGTGGGTGACCAGCGTAACACAGATTGGTCTTCGCAGTACAGCATGGTGGCTGGGGCTGGCAGAGAGAATGGCATGGAGACCCCCATGCATGAAAACCCTGAGTGGGAGAAAGCCCGCCAGGCCCTGGCCAGCATCAGCAAAGCAGGAGCTGCTGGCAGCTCAAAGGCCAGCAGCAATGGGCCTGTGGCCAGTGCACAATATGTGTCTCAGGCAGAAGCCTCAGCTCTGCAGCAGCAGCAGTACTACCAGTGGTACCAGCAGTACAACTATGCCTATCCCTATAGCTACTACTATCCCATGAGCATGTACCAGAGCTATGGCTCCCCCTCCCAGTATGGGATGGCTGGCTCCTATGGCTCAGCCACCGCCCAGCAGCCTTCAGCACCCCAGCACCAAGGGACTCTGAACCAGCCCCCGGTCCCCGGCATGGATGACAGCATGGCCTACCAGGCCTCTCCACAGCAGCTGCCCGCGGCCCAGCCCCCACAGCCGTCAAACCCCCCCCATGGGGCCCATGCTCTGAGCAGTGGCCCCCAGCCTGGGACAGCGCCCACCACGCAGCACAGCCAGGCGGGCCCCCCTGCAGGCCAGGCTTATGGCCCACATGCCTACCCCGAGCCTGCCAAGCCCAAGAAGGGCCAGCAGCTGTGGAACCGCATGAAGCCAGCCCCTGGGACCGGGGGTCTCAAGTTCAACATTCAGAAGCGGCCCTTTGCTGTCACCAACCAGAGCTTTGGCTCCAGCGCAGAGGGCCAGCACAGCAGCTTTGGCCCCCAGCCCAGCCTGGAGAAAGCCCAGAACCACAGTGGGCCTTCCCCCCGGGGGAACCTGTCTGGGAAGCCTGACGATTGGCCACAGGACATGAAGGAGTACGTGGAGCGCTGCTTCACAGCCTGTGAGTCAGAGGAAGATAAGGACCGGACGGAGAAGCTGCTCAAGGAGGTGCTGCAGGCTCGGCTGCAGGATGGCTCGGCCTACACCATCGACTGGAGCCGCGAGCCTCTGCCAGGGCTGACCAGGGAGCCTGTGGCTGAGAGCCCCAAGAAGAAGCGGTGGGAGGCCCCTAGCAGCCTTCACCCTCCCAGGGGGGCAGGCTCAGTGACCAGGGGCGGGGGTGCCCAGTCCCAGCGAGGGACACCAGGGGCTGGGGGTGCTGGCCGAGCCCGGGGCAGCAGCTTCGCCAAGTTCGGCAACCGAAATGTCTTCATGAAGGACAACAGCTCTTCCTCCAGCACGGACTCCCGCTCCCGCTCCTCCTCCAGATCCCCCACACGCCACTTCCGGAGAAGTGACTCCCACTCGGACTCCGATAGCTCCTACTCGGGGAACGAGTGTCACCCTGTGGCCCGCAGGAACCCGCCCCCCAAGGGCCGGGGTGGTCGAGGGGCCCACATGGACCGGGGCCGAGGCAGGGCACAGCGAGGGAAGAGGCACGATCTGGCTCCTACCAAGCGCAGCCGCAAGAAGATGGCAGCGCTGGAGTGTGAGGACCCGGAGCGTGAGCTGAAGAAGCAGAAGCGAGCGGCCCGCTTCCAGCACGGGCATTCCCGCCGCCTGCGCCTTGAGCCCCTGGTGCTGCAGATGAGCAATCTGGACAGTGGTGGAGCTGACCCTGACTGGCAGGAGCTGCAGATCGTGGGCACCTGTCCAGACATCACCAAGCATTACCTGCGTCTCACCTGTGCCCCTGACCCTTCCACTGTGCGCCCCGTGGCAGTTCTGAAGAAGTCTCTGTGCATGGTCAAATCCCACTGGAAGGAGAAGCAGGACTATGCCTTCGCCTGCGAGCAGATGAAGTCCATCCGGCAGGACCTGACGGTGCAAGGTGTCCGCACGGAGTTCACCGTGGAGGTGTATGAGACCCACGCCCGCATCGCCTTGGAGAAGGGTGACCACGAAGAGTTCAACCAGTGCCAGACACAGCTCAAGTCTCTGTACGCAGAGAACTTGCCAGGCAATGTGGGCGAGTTTACTGCCTACCGGATCCTCTACTACATGTTCACCAAGAACTCAGGAGACATCACCACGGAGCTGGCGTACCTCACACGGGAGCTGAAGGCAGACCCTTGTGTGGCCCATGCACTGGCACTGCGGGCAGCCTGGGCCCTGGGCAACTACCACCGCTTCTTCCGCCTCTACTGCCACGCGCCCTGCATGTCTGGCTACCTCGTGGACAAGTTTGCAGACCGGGAGCGCAAGGCTGCCCTCAAGGCAATGATCAAAACCTTCCGCCCAGCGCTGCCCGTCTCCTACCTGCAGGCCGAGCTGGCCTTCGAGGGCGAGGCTGCCTGCCGGGCCTTCCTAGAGCCCCTGGGCCTGGCCTACACGGGCCCCGACAGCTCCAGCATCGACTGCCGCCTCAGCCTGGCGCAGCTGCCAGCCTTCTGA

XM_004866696.1 Coding sequence

Leng8 leukocyte receptor cluster (LRC) member 8, transcript variant X1

Length: 2430 bp    Location: 2289149..2279218   Strand: -
>XM_004866696.1
ATGGCTGCCAATGTGGGTGACCAGCGTAACACAGATTGGTCTTCGCAGTACAGCATGGTGGCTGGGGCTGGCAGAGAGAATGGCATGGAGACCCCCATGCATGAAAACCCTGAGTGGGAGAAAGCCCGCCAGGCCCTGGCCAGCATCAGCAAAGCAGGAGCTGCTGGCAGCTCAAAGGCCAGCAGCAATGGGCCTGTGGCCAGTGCACAATATGTGTCTCAGGCAGAAGCCTCAGCTCTGCAGCAGCAGCAGTACTACCAGTGGTACCAGCAGTACAACTATGCCTATCCCTATAGCTACTACTATCCCATGAGCATGTACCAGAGCTATGGCTCCCCCTCCCAGTATGGGATGGCTGGCTCCTATGGCTCAGCCACCGCCCAGCAGCCTTCAGCACCCCAGCACCAAGGGACTCTGAACCAGCCCCCGGTCCCCGGCATGGATGACAGCATGGCCTACCAGGCCTCTCCACAGCAGCTGCCCGCGGCCCAGCCCCCACAGCCGTCAAACCCCCCCCATGGGGCCCATGCTCTGAGCAGTGGCCCCCAGCCTGGGACAGCGCCCACCACGCAGCACAGCCAGGCGGGCCCCCCTGCAGGCCAGGCTTATGGCCCACATGCCTACCCCGAGCCTGCCAAGCCCAAGAAGGGCCAGCAGCTGTGGAACCGCATGAAGCCAGCCCCTGGGACCGGGGGTCTCAAGTTCAACATTCAGAAGCGGCCCTTTGCTGTCACCAACCAGAGCTTTGGCTCCAGCGCAGAGGGCCAGCACAGCAGCTTTGGCCCCCAGCCCAGCCTGGAGAAAGCCCAGAACCACAGTGGGCCTTCCCCCCGGGGGAACCTGTCTGGGAAGCCTGACGATTGGCCACAGGACATGAAGGAGTACGTGGAGCGCTGCTTCACAGCCTGTGAGTCAGAGGAAGATAAGGACCGGACGGAGAAGCTGCTCAAGGAGGTGCTGCAGGCTCGGCTGCAGGATGGCTCGGCCTACACCATCGACTGGAGCCGCGAGCCTCTGCCAGGAGAACCTTGGGGTTGCTCCCTCTCCTGCACTGCAGCAGCCGAACCGCTGGGGCTGACCAGGGAGCCTGTGGCTGAGAGCCCCAAGAAGAAGCGGTGGGAGGCCCCTAGCAGCCTTCACCCTCCCAGGGGGGCAGGCTCAGTGACCAGGGGCGGGGGTGCCCAGTCCCAGCGAGGGACACCAGGGGCTGGGGGTGCTGGCCGAGCCCGGGGCAGCAGCTTCGCCAAGTTCGGCAACCGAAATGTCTTCATGAAGGACAACAGCTCTTCCTCCAGCACGGACTCCCGCTCCCGCTCCTCCTCCAGATCCCCCACACGCCACTTCCGGAGAAGTGACTCCCACTCGGACTCCGATAGCTCCTACTCGGGGAACGAGTGTCACCCTGTGGCCCGCAGGAACCCGCCCCCCAAGGGCCGGGGTGGTCGAGGGGCCCACATGGACCGGGGCCGAGGCAGGGCACAGCGAGGGAAGAGGCACGATCTGGCTCCTACCAAGCGCAGCCGCAAGAAGATGGCAGCGCTGGAGTGTGAGGACCCGGAGCGTGAGCTGAAGAAGCAGAAGCGAGCGGCCCGCTTCCAGCACGGGCATTCCCGCCGCCTGCGCCTTGAGCCCCTGGTGCTGCAGATGAGCAATCTGGACAGTGGTGGAGCTGACCCTGACTGGCAGGAGCTGCAGATCGTGGGCACCTGTCCAGACATCACCAAGCATTACCTGCGTCTCACCTGTGCCCCTGACCCTTCCACTGTGCGCCCCGTGGCAGTTCTGAAGAAGTCTCTGTGCATGGTCAAATCCCACTGGAAGGAGAAGCAGGACTATGCCTTCGCCTGCGAGCAGATGAAGTCCATCCGGCAGGACCTGACGGTGCAAGGTGTCCGCACGGAGTTCACCGTGGAGGTGTATGAGACCCACGCCCGCATCGCCTTGGAGAAGGGTGACCACGAAGAGTTCAACCAGTGCCAGACACAGCTCAAGTCTCTGTACGCAGAGAACTTGCCAGGCAATGTGGGCGAGTTTACTGCCTACCGGATCCTCTACTACATGTTCACCAAGAACTCAGGAGACATCACCACGGAGCTGGCGTACCTCACACGGGAGCTGAAGGCAGACCCTTGTGTGGCCCATGCACTGGCACTGCGGGCAGCCTGGGCCCTGGGCAACTACCACCGCTTCTTCCGCCTCTACTGCCACGCGCCCTGCATGTCTGGCTACCTCGTGGACAAGTTTGCAGACCGGGAGCGCAAGGCTGCCCTCAAGGCAATGATCAAAACGTATGTGGCACTTTGCTGTGGCCCTGCCACGCTTCTCACCCTCTCTGTGCTCCTGGAGGTCTTGGGCCTTCTGCCCGTGCTGGAGTCTCCTTCCACCCTCCATACTCCCTCACTCTCCTCAGTTCCTCCTCCCCTGCTCTGA

XM_004866698.1 Coding sequence

Leng8 leukocyte receptor cluster (LRC) member 8, transcript variant X3

Length: 2253 bp    Location: 2288863..2279218   Strand: -
>XM_004866698.1
ATGGCTGCCAATGTGGGTGACCAGCGTAACACAGATTGGTCTTCGCAGTACAGCATGGTGGCTGGGGCTGGCAGAGAGAATGGCATGGAGACCCCCATGCATGAAAACCCTGAGTGGGAGAAAGCCCGCCAGGCCCTGGCCAGCATCAGCAAAGCAGGAGCTGCTGGCAGCTCAAAGGCCAGCAGCAATGGGCCTGTGGCCAGTGCACAATATGTGTCTCAGGCAGAAGCCTCAGCTCTGCAGCAGCAGCAGTACTACCAGTGGTACCAGCAGTACAACTATGCCTATCCCTATAGCTACTACTATCCCATGAGCATGTACCAGAGCTATGGCTCCCCCTCCCAGTATGGGATGGCTGGCTCCTATGGCTCAGCCACCGCCCAGCAGCCTTCAGCACCCCAGCACCAAGGGACTCTGAACCAGCCCCCGGTCCCCGGCATGGATGACAGCATGGCCTACCAGGCCTCTCCACAGCAGCTGCCCGCGGCCCAGCCCCCACAGCCGTCAAACCCCCCCCATGGGGCCCATGCTCTGAGCAGTGGCCCCCAGCCTGGGACAGCGCCCACCACGCAGCACAGCCAGGCGGGCCCCCCTGCAGGCCAGGCTTATGGCCCACATGCCTACCCCGAGCCTGCCAAGCCCAAGAAGGGCCAGCAGCTGTGGAACCGCATGAAGCCAGCCCCTGGGACCGGGGGTCTCAAGTTCAACATTCAGAAGCGGCCCTTTGCTGTCACCAACCAGAGCTTTGGCTCCAGCGCAGAGGGCCAGCACAGCAGCTTTGGCCCCCAGCCCAGCCTGGAGAAAGCCCAGAACCACAGTGGGCCTTCCCCCCGGGGGAACCTGTCTGGGAAGCCTGACGATTGGCCACAGGACATGAAGGAGTACGTGGAGCGCTGCTTCACAGCCTGTGAGTCAGAGGAAGATAAGGACCGGACGGAGAAGCTGCTCAAGGAGGTGCTGCAGGCTCGGCTGCAGGATGGCTCGGCCTACACCATCGACTGGAGCCGCGAGCCTCTGCCAGGGACAACAGCTCTTCCTCCAGCACGGACTCCCGCTCCCGCTCCTCCTCCAGATCCCCCACACGCCACTTCCGGAGAAGGTGTGCCAACTTGGAAGGACTGGAGGGCGGGCAGGATGGGCTGCCTGAGACCTGACGCTCCCGCTTCCTTGTGCAGTGACTCCCACTCGGACTCCGATAGCTCCTACTCGGGGAACGAGTGTCACCCTGTGGCCCGCAGGAACCCGCCCCCCAAGGGCCGGGGTGGTCGAGGGGCCCACATGGACCGGGGCCGAGGCAGGGCACAGCGAGGGAAGAGGCACGATCTGGCTCCTACCAAGCGCAGCCGCAAGAAGATGGCAGCGCTGGAGTGTGAGGACCCGGAGCGTGAGCTGAAGAAGCAGAAGCGAGCGGCCCGCTTCCAGCACGGGCATTCCCGCCGCCTGCGCCTTGAGCCCCTGGTGCTGCAGATGAGCAATCTGGACAGTGGTGGAGCTGACCCTGACTGGCAGGAGCTGCAGATCGTGGGCACCTGTCCAGACATCACCAAGCATTACCTGCGTCTCACCTGTGCCCCTGACCCTTCCACTGTGCGCCCCGTGGCAGTTCTGAAGAAGTCTCTGTGCATGGTCAAATCCCACTGGAAGGAGAAGCAGGACTATGCCTTCGCCTGCGAGCAGATGAAGTCCATCCGGCAGGACCTGACGGTGCAAGGTGTCCGCACGGAGTTCACCGTGGAGGTGTATGAGACCCACGCCCGCATCGCCTTGGAGAAGGGTGACCACGAAGAGTTCAACCAGTGCCAGACACAGCTCAAGTCTCTGTACGCAGAGAACTTGCCAGGCAATGTGGGCGAGTTTACTGCCTACCGGATCCTCTACTACATGTTCACCAAGAACTCAGGAGACATCACCACGGAGCTGGCGTACCTCACACGGGAGCTGAAGGCAGACCCTTGTGTGGCCCATGCACTGGCACTGCGGGCAGCCTGGGCCCTGGGCAACTACCACCGCTTCTTCCGCCTCTACTGCCACGCGCCCTGCATGTCTGGCTACCTCGTGGACAAGTTTGCAGACCGGGAGCGCAAGGCTGCCCTCAAGGCAATGATCAAAACGTATGTGGCACTTTGCTGTGGCCCTGCCACGCTTCTCACCCTCTCTGTGCTCCTGGAGGTCTTGGGCCTTCTGCCCGTGCTGGAGTCTCCTTCCACCCTCCATACTCCCTCACTCTCCTCAGTTCCTCCTCCCCTGCTCTGA

XM_004866704.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X5

Length: 1461 bp    Location: 2305927..2291275   Strand: -
>XM_004866704.1
ATGGGGGCGCCCCCGGGCTACCGGCCGTCGGCCTGGGTGCACCTCCTGCACCAGCTGCCCCGCGCCGACTTCCAGCTGCGTCCGGTGCCCAGCGGCTTCGCGCCTCAGGAGCAGGGGTACCAGCAGGCCCTGATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGGTGAGAGCTGTGGGCAAGGGAAACAGCACGGAGGGGCCTACAAGTGGGGACCCCCATGGGAAGGGGGCAGGGCATTGGCCATGGGTCCTCCCTCCTGTCTTCTCCCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGACTACAGTGCTGCGCTGCGAGGCCTGTGCGAAGACGCTCTGGAGGGCCTGCTCTTCCTGCTGCTCTTCTCCCTCCTGTCTGCCGGGGCTCTAGTCACCACCCTCTGCAGCCTGCCCCGAGCCTGGGCCCTCTTCACGCCCAGTGATGACTACGATGACACCGAGGATGATGACCCTTTCAACCCTCAGGAATCCAAGCGCTTTGTTCAGTGGCAGTCGTCTATCTGA

XM_004866700.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X1

Length: 1590 bp    Location: 2305927..2291275   Strand: -
>XM_004866700.1
ATGGGGGCGCCCCCGGGCTACCGGCCGTCGGCCTGGGTGCACCTCCTGCACCAGCTGCCCCGCGCCGACTTCCAGCTGCGTCCGGTGCCCAGCGGCTTCGCGCCTCAGGAGCAGGGGTACCAGCAGGCCCTGATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGGTGAGAGCTGTGGGCAAGGGAAACAGCACGGAGGGGCCTACAAGTGGGGACCCCCATGGGAAGGGGGCAGGGCATTGGCCATGGGTCCTCCCTCCTGTCTTCTCCCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGACTACAGTGCTGCGCTGCGAGGCCTGTGCGAAGACGCTCTGGAGGGCCTGCTCTTCCTGCTGCTCTTCTCCCTCCTGTCTGCCGGGGCTCTAGTCACCACCCTCTGCAGCCTGCCCCGAGCCTGGGCCCTCTTCACGCCCAGGTCAGCAGGGGAGAGAGGGCAGGGTCCTGGGGGAGGGGACAGGAGGCACCCCCCGGGGCACTACTGGGGAGGGTGTGGCCTCCTGATGGGTCCCCATCCTGCTTCTCTGCCACTCCCATCACACCCCAGTGATGACTACGATGACACCGAGGATGATGACCCTTTCAACCCTCAGGAATCCAAGCGCTTTGTTCAGTGGCAGTCGTCTATCTGA

XM_004866707.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X8

Length: 1353 bp    Location: 2305927..2291276   Strand: -
>XM_004866707.1
ATGGGGGCGCCCCCGGGCTACCGGCCGTCGGCCTGGGTGCACCTCCTGCACCAGCTGCCCCGCGCCGACTTCCAGCTGCGTCCGGTGCCCAGCGGCTTCGCGCCTCAGGAGCAGGGGTACCAGCAGGCCCTGATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGACTACAGTGCTGCGCTGCGAGGCCTGTGCGAAGACGCTCTGGAGGGCCTGCTCTTCCTGCTGCTCTTCTCCCTCCTGTCTGCCGGGGCTCTAGTCACCACCCTCTGCAGCCTGCCCCGAGCCTGGGCCCTCTTCACGCCCAGTGATGACTACGATGACACCGAGGATGATGACCCTTTCAACCCTCAGGAATCCAAGCGCTTTGTTCAGTGGCAGTCGTCTATCTGA

XM_004866703.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X4

Length: 1482 bp    Location: 2305927..2291276   Strand: -
>XM_004866703.1
ATGGGGGCGCCCCCGGGCTACCGGCCGTCGGCCTGGGTGCACCTCCTGCACCAGCTGCCCCGCGCCGACTTCCAGCTGCGTCCGGTGCCCAGCGGCTTCGCGCCTCAGGAGCAGGGGTACCAGCAGGCCCTGATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGACTACAGTGCTGCGCTGCGAGGCCTGTGCGAAGACGCTCTGGAGGGCCTGCTCTTCCTGCTGCTCTTCTCCCTCCTGTCTGCCGGGGCTCTAGTCACCACCCTCTGCAGCCTGCCCCGAGCCTGGGCCCTCTTCACGCCCAGGTCAGCAGGGGAGAGAGGGCAGGGTCCTGGGGGAGGGGACAGGAGGCACCCCCCGGGGCACTACTGGGGAGGGTGTGGCCTCCTGATGGGTCCCCATCCTGCTTCTCTGCCACTCCCATCACACCCCAGTGATGACTACGATGACACCGAGGATGATGACCCTTTCAACCCTCAGGAATCCAAGCGCTTTGTTCAGTGGCAGTCGTCTATCTGA

XM_004866702.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X3

Length: 1491 bp    Location: 2305927..2291276   Strand: -
>XM_004866702.1
ATGGGGGCGCCCCCGGGCTACCGGCCGTCGGCCTGGGTGCACCTCCTGCACCAGCTGCCCCGCGCCGACTTCCAGCTGCGTCCGGTGCCCAGCGGCTTCGCGCCTCAGGAGCAGGGGTACCAGCAGGCCCTGATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGGTGAGAGCTGTGGGCAAGGGAAACAGCACGGAGGGGCCTACAAGTGGGGACCCCCATGGGAAGGGGGCAGGGCATTGGCCATGGGTCCTCCCTCCTGTCTTCTCCCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGACTACAGTGCTGCGCTGCGAGGCCTGTGCGAAGACGCTCTGGAGGGCCTGCTCTTCCTGCTGCTCTTCTCCCTCCTGTCTGCCGGGGCTCTAGTCACCACCCTCTGCAGCCTGCCCCGAGCCTGGGCCCTCTTCACGCCCAGGAATCCAAGCGCTTTGTTCAGTGGCAGTCGTCTATCTGAGCCCCTTCTCTCTGCCAGCCTGGAGCCTGTCTCCCCTCCTCGTTCCTTTCCTGGCTGCCAGAGGAGACCCCACTAA

XM_004866706.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X7

High confidence: 4 potential gene matches
Length: 1383 bp    Location: 2305927..2291277   Strand: -
>XM_004866706.1
ATGGGGGCGCCCCCGGGCTACCGGCCGTCGGCCTGGGTGCACCTCCTGCACCAGCTGCCCCGCGCCGACTTCCAGCTGCGTCCGGTGCCCAGCGGCTTCGCGCCTCAGGAGCAGGGGTACCAGCAGGCCCTGATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGACTACAGTGCTGCGCTGCGAGGCCTGTGCGAAGACGCTCTGGAGGGCCTGCTCTTCCTGCTGCTCTTCTCCCTCCTGTCTGCCGGGGCTCTAGTCACCACCCTCTGCAGCCTGCCCCGAGCCTGGGCCCTCTTCACGCCCAGGAATCCAAGCGCTTTGTTCAGTGGCAGTCGTCTATCTGAGCCCCTTCTCTCTGCCAGCCTGGAGCCTGTCTCCCCTCCTCGTTCCTTTCCTGGCTGCCAGAGGAGACCCCACTAA

XM_004866705.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X6

Length: 1458 bp    Location: 2305104..2291277   Strand: -
>XM_004866705.1
ATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGGTGAGAGCTGTGGGCAAGGGAAACAGCACGGAGGGGCCTACAAGTGGGGACCCCCATGGGAAGGGGGCAGGGCATTGGCCATGGGTCCTCCCTCCTGTCTTCTCCCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGACTACAGTGCTGCGCTGCGAGGCCTGTGCGAAGACGCTCTGGAGGGCCTGCTCTTCCTGCTGCTCTTCTCCCTCCTGTCTGCCGGGGCTCTAGTCACCACCCTCTGCAGCCTGCCCCGAGCCTGGGCCCTCTTCACGCCCAGGTCAGCAGGGGAGAGAGGGCAGGGTCCTGGGGGAGGGGACAGGAGGCACCCCCCGGGGCACTACTGGGGAGGGTGTGGCCTCCTGATGGGTCCCCATCCTGCTTCTCTGCCACTCCCATCACACCCCAGTGATGACTACGATGACACCGAGGATGATGACCCTTTCAACCCTCAGGAATCCAAGCGCTTTGTTCAGTGGCAGTCGTCTATCTGA

XM_004866708.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X9

Length: 1335 bp    Location: 2305927..2294850   Strand: -
>XM_004866708.1
ATGGGGGCGCCCCCGGGCTACCGGCCGTCGGCCTGGGTGCACCTCCTGCACCAGCTGCCCCGCGCCGACTTCCAGCTGCGTCCGGTGCCCAGCGGCTTCGCGCCTCAGGAGCAGGGGTACCAGCAGGCCCTGATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGGTGAGAGCTGTGGGCAAGGGAAACAGCACGGAGGGGCCTACAAGTGGGGACCCCCATGGGAAGGGGGCAGGGCATTGGCCATGGGTCCTCCCTCCTGTCTTCTCCCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGCTCCACCTCCCAACAGCACACTCAGCCACCGAGCTCACCAGTGGATGAATCCTCAGATGAGTACAGCACACCATGACTCAACCACCCCCCCAAAGCCCTAG

XM_004866701.1 Coding sequence

Ttyh1 tweety homolog 1 (Drosophila), transcript variant X2

Length: 1533 bp    Location: 2305927..2295395   Strand: -
>XM_004866701.1
ATGGGGGCGCCCCCGGGCTACCGGCCGTCGGCCTGGGTGCACCTCCTGCACCAGCTGCCCCGCGCCGACTTCCAGCTGCGTCCGGTGCCCAGCGGCTTCGCGCCTCAGGAGCAGGGGTACCAGCAGGCCCTGATGCTGGTGGCGGCCTTGGCGGGCCTGGGCCTGGCCCTCAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCCGGTCCCCCGAACCCCCCGGGGCCAAGAGCCCCCCGCCCGGGGGAGGCTGTGTCACCTGGAGCTGCATTGCCGCTCTCCTCGTCGGCTGTGCTGGCATTGGCATTGGTTTCTATGGCAACAGCGAGACCAGTGATGGAGTGTCCCAGCTCAGCGCGGCGTTGCTGCATGCCAACCACACACTCAGCACCATTGACCACCTGGTGCTGGAGACCGTGGAGGGGCTGGACAAGGCGGTGCGCTCAGAACTGACCACCCTGGAGGAGGTGCTGACGCCACGCACAGAGCTGGTGGCTGCTGCCCGGGGGGCTCGGCGGCAGGCAGAGGCGGTGGCCCAGCAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCTCTGCAGGTGGCCGAAGACGTGTCCTTTGTGGAGGAGTACAGGTGGCTGGCGTACGTCCTCCTGCTGCTCCTGGAGCTCCTGGTCTGCCTCTTCACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGGCTGTGATGACGGCCGTGAGTCTCCTGGTGCTTGTCCTCAGCTGGGGATCCATGGGCCTAGAGGCAGCCACGGCTGTGGGTCTCAGCGACTTCTGCTCCAATCCAGACACTTACGTCTTGAACCTGACCCAAGAGGAGACAGGGCTCAGCTCAGACATCCTGAACTATTATTTCCTGTGCAGCCAGGCCATCTCCAACCCCTTCCAGCAGGTGAGAGCTGTGGGCAAGGGAAACAGCACGGAGGGGCCTACAAGTGGGGACCCCCATGGGAAGGGGGCAGGGCATTGGCCATGGGTCCTCCCTCCTGTCTTCTCCCAGAGGCTGACACTGTCCCAGCGAGCTCTGGCCAACATCCACGCCCAGCTACAGGGCCTGGAGCGAGAAGCTGCCCCCCAGTTCCCATCTGCACAGAAGCCTCTGCTGTCCTTGGAGGAGACACTGAATGTGACAGAGGGAAACTTCCACCAGTTGGTGGCACTGCTGCACTGCCGTGGCCTGCACAAGGGACACTTGGAAGCCTGGAAGGAAGCACACCCTCGTGTACCAGTGGATTTTGTCTTACTCGCTTCCCCCACCACGAAGACACCATACCCGATACCTACAATGCAGAGGAGGCGTTTACTTTGGCTCCTGGCTACAGAAGTTCCAGCCCACGGTCGGCAGGCTCAAATGCAGAACAGCATGGTGGAAGGGCCTGAGTGGAGGAAGCTGCTCACATCACGGTGGCCAGGAAGCAGAGAGAGGGAGGAGCCAGGCAGGGAGAGGGACCTGTCCACCTCACGCCCCGTGACCTCTCTTCTCTAG

XM_004867170.1 Coding sequence

LOC101722300 collagen alpha-2(I) chain-like

Length: 2292 bp    Location: 2374783..2368171   Strand: -
>XM_004867170.1
ATGTTCTGTCACAAAATAAGGACACAGCAGCTGAGGAGACCCAAGGGCGCGCTGTGGAGCGGGCGCTGGCGGCTGACCGGAGCAGACACCCGCACCCTCGGGCTGGGAGTGCGGACGGCCTGGCGCTCACTGCACAAGGCTGCATCCCGGGAAGCTGTGGCGTGGACGTGCGGGGCTCCGGGTCCCAGGTTCTCAGCGGGGATCCCGGGCCCTGGGGCCTCCGACAGTGTTCAGAGGCGTTTCCGGGAGTCGCCACAAGAGGGCGCCGCGGGCGAAGGCTCGCGAGCCGAGCCAGGAGGAGGAAACGCGGAGAGCAGAGGCGGCCCTCGCGGCGCCGCTTCCATCTCCCGGGCACGGGATGAGGCTATGAAGCGGGCGGATGGGGACAGGGACCCGAGCGCGCTCAGGGCACGGGAAGCTCCTGCTGATGCAAAGCGGAGCCCGGCGACTGGTCCAACAGCGACGTCCACAGCCGCCCCCCTCTCTGCGGAGCCCGGGCCTGGAGCGCAGGCAAAGCCGCGTGTGCGGAGCTTTCCTGTGCGCAGCGCTGTGTGCAGCGGGACGCACTCATCGGGTGCAGAGCGGGACAGGGACGGTGACGGAAGCAGGCGGCCGGGACCGGGAAGCGCAGGGAACGCTCAGCGCTTCTCTCCCAGCGCCTGGAGCCTCCTGCGCGGCGGCCCAGGGCAACGGGCAGGGGACAGCGGCGAGGACCCCGGGCCGGACCAGCCTGTGCGCCCCGTGGGCGTGACTTCCACCAGAGGATTAGAGGCCGCTGGCAGGCCGCGTGGTCCGCGCTTTCCGCGCTGCGGCGCTCAGTGTGAAATCCCCGCCGGCCAGGCCTCGCCCGCACACCCGGCCCCGCCCCCCGGAGCTGCGCCTTGCGGCCCGGGCTTGCCGCGCTGCTCTGCCTCGCTGAGTCCCTGGGACGGTGGGGGGGGGGGGCGGCCCGGAGCGGCGGGCAACGCGCGCGTCCCTCTGTTTTCCGGGGCTGAGTCCGAGCCCGCGGCTGGGCGCCTGGAAGCGCGAGTCGGGGGCGGCGGCCCACCCGGAGCGGCACCCTGGGCCCCCCCTGAGCCGAGCTCCAGACCCCACCTCTGGGCCGAGCCCGGCGCCGCGGTGCCCAAGGGGCAGCCAGTGACCGTGTGGTGCCAGGGCCCGCCGGACGCCGAGGAGTTCCGGCTGCAGTTCGAGGGGCGCCTCTTTGCCCGGGGGAGGCCGCGGAGCCCCGGGGCGCCGTGCAGAGTCCCGGTCCTCATCCCGGCCCTGAGCTCCCACAGCGAGGGGCTCTGGTCGGAGCCCAGCGACGCCCTGGACCTGGTGGTGACAGGTGACCCCCGTGCTTCCCGGTCCAATTTAGAAAGGGGCCGGGGCCGCGGATCGCGCCCCCACCCGGTGCCGGTGCTGCCGCCCAGGACCGAAGCCAGACACCGGGTGCAGGGGGCTCCCCGAGACAGGAGGGGCGTCACCCACCGCCCGCCCACAGAGATGCCCTTGGGGGAGCAAGTGACCTTGTTCTGCCGCCTGGAGACAGCGACCGCGACTGGCGAGTTCTTCCTGCTCCAGGAGGGGAGGCCCAGGAGCCTGCCGCAAGGCCGGGGCTCCATCCAGGCAGAGTTCCCCCTGGGCCCGGTGACCGCGGCCCACCAGGGCACCGACAGATGCTTTGGCTCCTACTACAGCCATGCCTGGTCCTTCCCCAGCGCTCCCGTGGAGCTCCGGGTCGCGGGTGAGGACAGCCCCCACCCCCAAAGGGAATGGGGAAGATCCAAAGGGACTTACATTTCGGCTGCGGACGCTGAGGAGCCCTGCGCGATGCCCACAGAGCCGGGCGCCCGGAAAGGTCAGTGGCAGCGGCGGCGGCTGTTCGGCGGGGCTGGCGGGGCGGCGGCCGGGAGGGCGGAGGCGACGCCGGGTCCACGCTCAACCGGCTCTGCTCGGTCCGCAAGCCCGCTGCTCTGGGGCCTCACCGCCCAGAACCTCCTGTGGCTCGGCCTGGCGCTGCTGGCCCTGGCGGCCCTCGTGGCTGAAGAGCGGTTGAGCAGGAAGAGGGCGCGCGTGAGCCCACGGAGTCGCAGCGCGGGCGCGGGGCACCGCCAGGAGTACGAGGAGGGCGACTGTGAGGAGCGTGCCCAGCCGTGGCAGCTCTGCCCAGGCCCGGGCGCAGCGAAGCCCGGCTCCTCGCTGATTCCTGGAAGGACCCCGGGAGGCGCCTTCGTGCAGGCGCTGACACCAAGACCCTTCTGCAACTGCAGCCTCCCAGGAGCAGAGGCCCAGATCTTCTGTCCCTGA

XM_004866709.1 Coding sequence

Rps9 ribosomal protein S9, transcript variant X1

High confidence: 3 potential gene matches
Length: 585 bp    Location: 2394196..2391268   Strand: -
>XM_004866709.1
ATGCCGGTGGCGAGGAGCTGGGTTTGTCGCAAAACCTACGTAACCCCGCGGAGGCCCTTCGAGAAATCCCGCCTTGACCAAGAACTGAAGCTGATCGGCGAGTATGGGCTCCGGAACAAGCGTGAGGTCTGGAGGGTCAAATTTACTCTGGCCAAGATCCGAAAGGCTGCCCGGGAGCTGCTGACGCTGGACGAAAAGGACCCACGGCGGCTCTTCGAAGGTAACGCCCTCCTGCGGCGACTTGTCCGAATTGGGGTGCTGGACGAAGGCAAGATGAAGCTGGATTACATCCTGGGCCTGAAGATCGAGGACTTCCTGGAGAGGCGCTTGCAGACCCAGGTGTTCAAGCTGGGCCTGGCCAAGTCCATCCACCACGCCCGTGTGCTTATCCGCCAGCGCCACATCAGGGTCCGCAAGCAGGTGGTGAACATCCCGTCCTTCATTGTGCGCCTGGACTCCCAGAAGCACATTGACTTCTCCCTGCGATCCCCATATGGGGGAGGCCGCCCAGGCCGTGTGAAGAGGAAGAACGCCAAGAAGGGCCAGGGTGGGGCTGGAGCCGGAGATGACGAGGAGGAGGATTAA

XM_004866712.1 Coding sequence

Tsen34 tRNA splicing endonuclease 34 homolog (S. cerevisiae), transcript variant X1

Length: 978 bp    Location: 2406900..2400684   Strand: -
>XM_004866712.1
ATGAGCTCACGCAGGTCTCGGGTTGCAGAGCCAGAGCTGCCGCGAAGAGGCGCGCGGCTGGGGAGGATGCTGGTGGTGGAGGTGGCGAACGGCCGCTCGCTGGTGTGGGGGGCCGAGGCGGTTCAGGCGCTGCGGGAGCGCCTGGGCGTGGGGGGCCGCACGGTGGGCGCCCTGCCCCGCGGGCCCCGGCAGAACTCGCGCCTGGGCCTCCCGTTGCTGCTTTTGCCGGAGGAGGCGCGGCTCCTGGCCGAGATCGGCGCCGTGACCCTGGTCAGCTCCCCTCGCCGGGATCCCAGCCAGCACAGCCTGGCTCTGGCATCGTTCAGACGCCAGCAAGAGCAGAGCTTCCAGGAGCAAAGCGCGTTGGCGGCCGAGGCCCGTGAGAACCGGCGTCAGGAGCTCCTGGAGAAGATTGCAGAGGGCCAGGCTGCCAAGAAGCAGAAGCTGGAGCAGGATTCCGAGGCCGGCGGGAGCCGAGCCGCGGAAGAGAGCGAGATCGGAGGTGGCCAGGCCTCCGGGGAGCAGGAGGAAGCAGTGCCTTCTTCTCAAGCAGCTTCAGATGGGGCGGCGCCCTTGCCCAGGTCTGCCCTGCTGGTCCAGCTGGCCACCGCCAGGCCTCGGCCTGTTAAGGCCAGGCCCCTGGACTGGCGCGTGCAGTCCAAAGACTGGCCCCACGCCGGCCGGCCCGCCCACGAGCTGCGCTACAGCATCTACAGAGATCTGTGGGAGCGAGGCTTTTTCCTCAGCGCCGCCGGCAAGTTCGGCGGCGACTTCCTGGTGTATCCTGGTGACCCGCTCCGTTTCCATGCCCACTACATTGCCCAGTGCTGGGCTCCGGAGGACCCCATTCCACTGCAGGACCTGGTCTCTGCCGGCCGCCTGGGAACAAGTGTGAGGAAGACGCTGCTGCTGTGCTCCCCACAGCCTGATGTAAATGACCTCAATAGAATCTCGACTTCCTGCACATTTATTGGCTGA

XM_004866719.1 Coding sequence

Tmc4 transmembrane channel-like 4, transcript variant X3

Length: 1755 bp    Location: 2417774..2424641   Strand: +
>XM_004866719.1
ATGGAAGAAGGCCTCGGCTGGGAACCCGAAGCCTGGGAGCCCCCGGGCAGGGGGCTGGCCCCCCGGGAGGCCAGAGCAGGCCAGTCGCTGGCCTCCGTGCTGAGCGAGCTCCCCAGCGCTGCTACCCTTCGGTACCGTGGCCCTGGGGTGCTGCCCTGGGGGTCACTGGAGGAGGAAGATGAAGGAGGAAGGAGCGTCCAGGGCCTCACAGGTGCCGCCCAAATGGAGCTACAGGACCCTCGCCATTCCCGGGAACTGCCCTGGCCCATGCAGGCGAGACGGGTGCACAGGAAAAACCAGGCCAGGGAGCAAAGTGCCTGCAGCACCGGATCCAGGGTTGGCCACTGGGCCCCGCTGCTTGCCAGGGGCAAGGACCAGACGAAGGAAGGCCTCCGCAGCCTGCAGCCCTGGGCGTGGACTGTGAACAGGATAGGGGGCCAGTTTGGCGCCGGCACGGAGTCCTACTTCTCCCTGCTGCGCTTCCTGCTGCTTCTGAACGCACTGGCGTCAGTGCTGGTGGCCTGCATGGTGCTGCTGCCCACCTGGCTGGAAGGCGCTCCCCTGGGGCCTCCTGCCCCCAGTGCCTCGTCACCCTGCGGTTCCTACAGCCCCCACAGCCCGGGCCTGGCCACCTTCCCCTCCCAGCTCTTCAACTTGCTCTCGGGACAGGGCTACCTGGAATGGTCACCTCTCTTCTATGGGTTCTACCCGGCCCGCAGGCACCTGGCAGTCACCTACCTGTGCTCCGTCTTTGCCAGTGGCCTCATCTGCCTCCTGCTCATTCTGCGGCGCTCCGTGTCAGGACTGAAGCAGACACTGCTGGCCGAGTCGGGGGCTCTGACCAGCTACAGCCACCGGGTATTCTCGGCCTGGAACTTCGGCCTCTGCGGGGCCGAGCACGTGAGGCTGCGCCAGCGCAGGATCCTATACGAGCTGCAGGTGGAGCTGGAGGAAGCGGGGATCCGGCGCAGGGCCGCGGTGCGGACGCTGGGCCAGCAGGCCAGGGTGTGGCTGGTGCGGGTGCTGCTCAACCTGCTGGTGCTGGCGCTGCTGTGCGCGGCCTTCTACGGCGTCTACTGGGCCACGGGGGAAGCCGGGCAGCTGCAGGAGGCGCCCCTGGTCAAGCAGACGCCGCTGCTGCAGCTCGCGGTGAGCTACCTCCCGTCCATCTTCATCTCCGCGGTCAACGTCGTGCTGCCGCCCCTGTTCCAGCTCATCGGCTCGCTGGAGGGCTACACTCGGAGCCACCAGATCGTCTTCATCTTACTCAGGACCGTGTTTCTGCGCCTCGCCTCCCTGCTGTTCCTGCTCTTCTCCCTCTGGTCTCAGATCACCTGCGGGGGCGACGCCCAGGCCGAGCAGTGCCAAAGCTGTGGCTACAACCACAGAAAGTTCCCGTGCTGGGAGACTCGGGTAGGCCAGGAGATGTACAAACTCCTGCTCTTCGACCTGCTGAGCAGCCTGGCCTTGGCGCTCCTCCTCCAGTTTCCCCGCAGGATACTCTGTGGGCTCTGTCCCGGGGCGCTGGGGCGCTGGGCCGCGGCACTGGAATTCAAGGTCGCCGACGAGGTGCTGGGGCTCATCTACGCGCAGACGGTGGTATGGGTGGGGAGCTTTTTCTGCCCTTTACTGCCCCTGCTCAACACGGCCAAGTTCCTGCTGCTTTTCTATTTGAAGAAGCATCTTCCTAATCCCGCCTTCCAAGCTGTGCGGCCCGTTCCGGGGGAAAGTCTCCATCTGGGCCCAGATCCCTGA

XM_004866718.1 Coding sequence

Tmc4 transmembrane channel-like 4, transcript variant X2

Length: 1923 bp    Location: 2417775..2424881   Strand: +
>XM_004866718.1
ATGGAAGAAGGCCTCGGCTGGGAACCCGAAGCCTGGGAGCCCCCGGGCAGGGGGCTGGCCCCCCGGGAGGCCAGAGCAGGCCAGTCGCTGGCCTCCGTGCTGAGCGAGCTCCCCAGCGCTGCTACCCTTCGGTACCGTGGCCCTGGGGTGCTGCCCTGGGGGTCACTGGAGGAGGAAGATGAAGGAGGAAGGAGCGTCCAGGGCCTCACAGGTGCCGCCCAAATGGAGCTACAGGACCCTCGCCATTCCCGGGAACTGCCCTGGCCCATGCAGGCGAGACGGGTGCACAGGAAAAACCAGGCCAGGGAGCAAAGTGCCTGCAGCACCGGATCCAGGGTTGGCCACTGGGCCCCGCTGCTTGCCAGGGGCAAGGACCAGACGAAGGAAGGCCTCCGCAGCCTGCAGCCCTGGGCGTGGACTGTGAACAGGATAGGGGGCCAGTTTGGCGCCGGCACGGAGTCCTACTTCTCCCTGCTGCGCTTCCTGCTGCTTCTGAACGCACTGGCGTCAGTGCTGGTGGCCTGCATGGTGCTGCTGCCCACCTGGCTGGAAGGCGCTCCCCTGGGGCCTCCTGCCCCCAGTGCCTCGTCACCCTGCGGTTCCTACAGCCCCCACAGCCCGGGCCTGGCCACCTTCCCCTCCCAGCTCTTCAACTTGCTCTCGGGACAGGGCTACCTGGAATGGTCACCTCTCTTCTATGGGTTCTACCCGGCCCGCAGGCACCTGGCAGTCACCTACCTGTGCTCCGTCTTTGCCAGTGGCCTCATCTGCCTCCTGCTCATTCTGCGGCGCTCCGTGTCAGGACTGAAGCAGACACTGCTGGCCGAGTCGGGGGCTCTGACCAGCTACAGCCACCGGGTATTCTCGGCCTGGAACTTCGGCCTCTGCGGGGCCGAGCACGTGAGGCTGCGCCAGCGCAGGATCCTATACGAGCTGCAGGTGGAGCTGGAGGAAGCGGGGATCCGGCGCAGGGCCGCGGTGCGGACGCTGGGCCAGCAGGCCAGGGTGTGGCTGGTGCGGGTGCTGCTCAACCTGCTGGTGCTGGCGCTGCTGTGCGCGGCCTTCTACGGCGTCTACTGGGCCACGGGGGAAGCCGGGCAGCTGCAGGAGGCGCCCCTGGTCAAGCAGACGCCGCTGCTGCAGCTCGCGGTGAGCTACCTCCCGTCCATCTTCATCTCCGCGGTCAACGTCGTGCTGCCGCCCCTGTTCCAGCTCATCGGCTCGCTGGAGGGCTACACTCGGAGCCACCAGATCGTCTTCATCTTACTCAGGACCGTGTTTCTGCGCCTCGCCTCCCTGCTGTTCCTGCTCTTCTCCCTCTGGTCTCAGATCACCTGCGGGGGCGACGCCCAGGCCGAGCAGTGCCAAAGCTGTGGCTACAACCACAGAAAGTTCCCGTGCTGGGAGACTCGGGTAGGCCAGGAGATGTACAAACTCCTGCTCTTCGACCTGCTGAGCAGCCTGGCCTTGGCGCTCCTCCTCCAGTTTCCCCGCAGGATACTCTGTGGGCTCTGTCCCGGGGCGCTGGGGCGCTGGGCCGCGGCACTGGAATTCAAGGTCGCCGACGAGGTGCTGGGGCTCATCTACGCGCAGACGGTGGTATGGGTGGGGAGCTTTTTCTGCCCTTTACTGCCCCTGCTCAACACGGCCAAGTTCCTGCTGCTTTTCTATTTGAAGAAGCATCTTCCTGTAAGTGTGCGGGGCTCCCGCCTCCCCCTCGCCCTCAGCCGGCCTAAGACGCCTGCCCGCCGGAACCCAGCCTGTCTGCCTACAGAATCCCGCCTTCCAAGCTGTGCGGCCCGTTCCGGGGGAAAGTCTCCATCTGGGCCCAGATCCCTGAGTCCATCGAGACCCTGCCTCACACCGCCCAGAACTTCCTCTTCTTCCTGGGCTCCCAGGCTTTTGCAGTGCCGCTTCTGTTGA

XM_004866721.1 Coding sequence

Cnot3 CCR4-NOT transcription complex, subunit 3, transcript variant X2

Length: 2238 bp    Location: 2441870..2429809   Strand: -
>XM_004866721.1
ATGGCGGACAAGCGCAAACTCCAAGGTGAGATTGATCGCTGCCTGAAGAAGGTGTCCGAGGGCGTGGAGCAGTTTGAGGACATTTGGCAGAAGCTCCACAATGCAGCCAATGCGAACCAGAAGGAGAAGTATGAGGCTGACCTGAAGAAGGAGATTAAGAAGCTACAAAGGCTGAGGGACCAGATCAAGACATGGGTCGCCTCCAATGAGATCAAGGACAAGCGGCAGCTCATAGACAACCGAAAACTCATCGAGACGCAAATGGAACGGTTCAAAGTTGTGGAGCGAGAGACCAAGACCAAAGCTTACAGCAAGGAGGGCCTGGGTCTGGCGCAGAAGGTGGACCCTGCCCAGAAGGAGAAGGAAGAGGTTGGCCAGTGGCTCACGAACACCATCGACACCCTAAACATGCAGGTGGACCAGTTTGAGAGCGAGGTGGAGTCTCTGTCAGTGCAGACACGCAAGAAGAAGGGTGACAAGGATAAGCAGGACCGGATTGAGGGCCTGAAGCGTCACATCGAGAAGCACCGCTACCACGTGCGCATGCTGGAGACCATCCTGCGCATGCTGGACAACGACTCCATCCTCGTGGACGCCATCCGCAAGATCAAGGATGACGTCGAGTACTACGTCGACTCCTCTCAGGACCCTGACTTCGAGGAGAATGAGTTTCTCTACGATGACCTGGACCTCGAGGACATTCCACAGGCGCTGGTCGCCACCTCCCCCCCCAGCCACAGCCACATGGAGGACGAGATCTTCAATCAGTCCAGCAGCACGCCCACGTCCACCACCTCCAGCTCTCCCATCCCGCCCAGCCCAGCCAACTGCACCACGGAGAACTCTGAAGATGATAAGAAGAGGGGCCGCTCCACCGACAGTGAGGTCAGCCAGTCTCCAGCCAAAAATGGCTCCAAGCCTGTCCACAGCAGCCAGCACCCCCAGCCCCCAGCCGTGCCGCCTCCCTACCCCTCGGGGCCCCCACCTGCCACCTCTGCCTTGAGTGCTGCCCCTGGCAGCAATGGGGCCCCCACCCCGGCAGCACCGCCAAGTGCCCTGGGCCCCAAGGCCAGCCCAGCCCCCAGCACCCCTGCTCCCTACGCCCAGGCTGTGGCCCCGCCCACCCCCGGGCCCAGCCCCGCCCAGCCCCGGCCCCCCAGCGCCCAGCCTGGTGCCGCGAGTGGCAGCGCCGGAGGGGCGGGCGGCAGCAGTAACAGTGGTGCGGGCGGAGGGGCTGGCAAGCAGAACGGCGCCACCAGTTACAGCTCCGTCGTGGCAGACAGCCCCGCAGAGGTGGCCCTCAGCAGCAGCGGGGGCAGCAGCGCCAGCAGCCAGGCCCTGGGCCCCCCTTCAGGCCCGCACAACCCGCCTCCCAGCACTGCGAAGGAGCCTAGTGCAGCCGCCCCAACGGGGGCTGGGGGTGTGGCCCCCGGCTCAGGGAACAACTCTGGGGGCCCCAGCCTCCTGGTGCCGCTGCCCGTGAACCCCCCCAGCTCTCCCACGCCCAGCTTCAGTGAGGCCAAGGCGGCCGGTGCCCTGCTCAACGGGCCCCCGCAGTTCAGCAGCGCCCCCGAGATCAAGGCCCCCGAGCCCCTGAGCTCCCTGAAGTCCATGGCGGAGCGGGCAGCCATCAGCTCGGGCATCGAGGACCCTGTGCCCGCGTTACACCTGACCGAGCGAGACATCATCCTGAGCGGCACCTCGGCGCCCCCTGCCTCAGCCCAGCCAGCCCTGCAGCTGTCGGAGGTGAACATCCCGCTGTCGCTGGGTGTGTGCCCACTGGGGCCGGTGCCCCTCACCAAGGAGCAACTGTACCAGCAGGTCATGGAGGAGGCCGCCTGGCACCACATGCCCCACCCCTCCGACTCTGAGCGCATCCGGCAGTACCTCCCCCGGAACCCCTGCCCGACGCCCCCCTACCACCACCAGATGCCGCCCCCACACTCGGACACCGTGGAGTTCTACCAGCGCCTGTCCACCGAGACGCTCTTCTTCATCTTCTACTATCTGGAGGGCACCAAGGCGCAGTACTTGGCGGCCAAGGCCCTGAAGAAGCAGTCGTGGCGGTTCCACACCAAGTACATGATGTGGTTCCAGAGGCACGAGGAGCCCAAGACCATCACCGACGAGTTCGAGCAGGGCACCTACATCTACTTTGACTACGAGAAGTGGGGCCAGCGGAAGAAGGAGGGCTTCACCTTCGAGTACCGCTACCTGGAGGACCGGGACCTCCAGTGA

XM_004866726.1 Coding sequence

Prpf31 pre-mRNA processing factor 31, transcript variant X2

High confidence: 4 potential gene matches
Length: 1500 bp    Location: 2454660..2445144   Strand: -
>XM_004866726.1
ATGTCTCTGGCAGATGAGCTTTTGGCTGACCTTGAGGAGGCAGCTGAAGAGGAGGAAGGAGGAAGCTTTGGAGAGGAGGAAGAGGAGCCAGCGATTGAGGATGTACAGGAGGAGACACAGCTGGATCTCTCTGGGGATTCAGTCAAGAGTATCGCCAAGCTGTGGGATAGCAAGATGTTTGCTGAGATCATGATGAAGATTGAGGAGTACATCAGCAAGCAAGCCAAAGCTTCAGAAGTGATGGGGCCGGTGGAGGCAGCCCCCGAGTACCGTGTCATTGTGGACGCCAACAACCTGACTGTGGAGATCGAAAATGAGCTGAACATCATCCATAAGTTCATCCGGGACAAGTACTCGAAGAGGTTCCCCGAGCTGGAGTCCTTGGTCCCCAACGCACTGGACTACATCCGCACGGTCAAGGAGCTGGGCAACAGCCTGGACAAGTGCAAGAACAACGAGAACCTGCAGCAGATCCTCACCAACGCCACCATCATGGTGGTCAGCGTCACGGCCTCCACCACCCAGGGGCAGCAGCTGTCGGAGGAGGAGCTGGAGCGGCTGGAGGAGGCCTGCGACATGGCCCTGGAGCTGAACGCGTCCAAGCACCGCATCTACGAGTACGTGGAGTCCCGCATGTCCTTCATCGCCCCCAGCCTGTCCATCATCGTGGGCGCCTCCACGGCAGCCAAGATCATGGGTGTGGCCGGCGGCCTGACCAACCTCTCCAAGATGCCCGCCTGCAACATCATGCTGCTCGGGGCCCAGCGCAAGACACTGTCCGGCTTCTCATCTACCTCCGTGCTGCCCCACACTGGCTACATCTACCACAGCGACATCGTGCAGTCCCTGCCCCCGGATCTGCGGCGGAAGGCGGCCCGGCTGGTGGCCGCCAAATGCACACTGGCCGCCCGCGTGGACAGTTTCCACGAGAGCTCGGAGGGGAAGGTGGGCTATGAACTGAAGGACGAGATCGAGCGCAAATTTGACAAGTGGCAGGAGCCGCCGCCTGTGAAGCAGGTGAAGCCCCTGCCCGCACCCCTGGATGGGCAGCGGAAGAAGCGAGGGGGCCGCAGGTACCGCAAGATGAAGGAGCGGCTGGGACTGACAGAGATCCGGAAGCAGGCCAACCGCATGAGCTTCGGAGAGATCGAGGAGGACGCCTACCAGGAGGACCTGGGCTTCAGCCTGGGCCACCTCGGCAAGTCGGGCAGTGGGCGCGTGCGCCAGACACAGGTGAACGACGCCACCAAGGCCAGGATCTCCAAGACGCTGCAGCGGACCCTGCAGAAGCAGAGCGTGGTGTATGGCGGGAAGTCCACCATCCGCGACCGCTCCTCGGGCACCGCCTCCAGCGTGGCTTTCACCCCCCTCCAGGGTCTGGAGATCGTGAACCCACAGGCAGCGGAGAAGAAGGTGGCCGAGGCCAACCAGAAGTATTTCTCCAGCATGGCCGAGTTCCTCAAGGTCAAGAGCGAGAAGAGCGGCATCACGTCCACCTGA

XM_004867171.1 Coding sequence

Cacng6 calcium channel, voltage-dependent, gamma subunit 6

High confidence: 4 potential gene matches
Length: 792 bp    Location: 2499959..2492252   Strand: -
>XM_004867171.1
ATGATGTGGTCCAACTTCTTCATGCAAGAGGAGGACCGGCGGCGGGCGGCCCGGGGCCGGAGGCACGCGCAGGGCCAGCTAAAGAGAGGCCTGACGCCCGAGCAGGAAGCCAAGACCAAGCTGGCGCTGCTGCTGGCCGCTGTGGGCGCCACGCTGTCTGTGCTGTCGGTGGGCACCGAGTTCTGGGTGGAGCTCAACACCTACAAGGCCAACGGCAGCGCCGTCTGCGAGGCTGCCCACCTGGGGCTGTGGAAGGTGTGCACCAAGCGGCTGTGGCAGGCGGACGTGCCTGTGGACAGGGACACCTGTGGCCCCGCCGAGCTGCCTGGAGAAGCCAACTGCACCTACTTTAAATTCTTCACCACCGGGGAGAACGCGCGCATCTTCCAGAGAACCACAAGGAAAGAGGTGAACCTAGCAGCTGCAGTGATAGCAGTGCTGGGCCTTGTGGTCATGGCCTTGGGCTGCCTCTGTATCATCATGGTGCTCAGTAAAGGTGCAGAGTTCCTGCTCCGAGTGGGAGCTGTCTGCTTTGGCCTCTCAGGCCTGCTGCTCCTGGTGAGCGTGGAAGTATTCCGGCATTCCGTGTGGGCCCTGCTCCGGGACCGGGACGCGGACCTCCCCGAGCCCCGCCTGGGCCTGCGCCTGGCCTTCGAGTTCTCCTGGTCCCTGGGCTGTGGCGTGGCTGCCGGCCTCATCCTGCTGCTGGGGGGCGGCTGCTTCCTGCTGCTCAGCCTGCCGGCCCGGCCCTGGGGCTCCCTCTGCCCCAAGCGGGCCCACACGGCGGCCTAG

XM_004867173.1 Coding sequence

LOC101723698 uncharacterized LOC101723698

Length: 828 bp    Location: 2517885..2519922   Strand: +
>XM_004867173.1
ATGGCGTCCGGCTGCGGGGGGACAGGGAGAACTCCTTCCTCCCGGCCGCCACGGAAGCCCCAGCTGCTCCCGCCCGGTCCTCTCATCAGCCGCTTCCTCGGACCCCGACTGGCCCCGTCCACAAACGTCCTCCTCCTGGCCTGGACTGCACTGCGCTCGGGAAATACAGCCCCCTCTGCCCCGCAGGCCCCGGCCTCCCTGAGGACTACCCTCGGTGCCCTCACGGTCCCTCTCGCCTGCTTCGGAGGGTCCCCCGCCCCGGATCTCCCCAACCTGCGCGGACCCAACTCTCCTTCAGGGGACCAGAAGCCGCGAGCCCGCTCCTGCCACCCGCCAAGGCGTAAAGCGATCCCCCAGTCCACGCAGCGCTCAGGAAAACGCGATCTCCAAGACTTCAACTCTCTGACTCTGCACTCCCCCCACACCTCCGCTTCACCCCGTCGCTCTCCCGGCCGGGCGTCCCTTACCTGTGTCCCCCACTTTCCCGGACTTCTTTCCAAACCCCCGGCGGCGGCGAAGAGACCGGAACCCTTAGAGCAGCGGCGACACCTCCGAGAGCCCCGGTCCCGCCGCGGGGTGACCTTGGCCTCCCACGTCCCTGCGTCCTCCGCCCCCCGTCAGCTGGCCCCAGGCTGGGCTGCTCCAGGTCGGCTGGGGGGCGTCTCCATGGCGACGGCCTGGCGCCCCCTTCGCGCCTGCCCACACGCAGTCCCTTCCTGGCTGCTCGCTCCTGGCCAGGGCGCCCGGACCTGCGTCCCGCGGCCTGGGACGGCCCCTTCCCCTCTCTCCGGCCGGCGGACTTTCCTGCCTCTGCCTCCCCGGGGGTGA

XM_004866728.1 Coding sequence

Prkcg protein kinase C, gamma

High confidence: 4 potential gene matches
Length: 2094 bp    Location: 2565603..2548286   Strand: -
>XM_004866728.1
ATGGCCGGCCTGGGCCCCGGCGGAGGCGACTCCGAGGGGGGACCCCGACCTCTGTTTTGCAGAAAGGGGGCTCTGAGGCAGAAGGTGGTCCACGAAGTCAAGAGCCACAAGTTCACCGCTCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGTATTGGAAAACAGGGCCTGCAGTGTCAAGTCTGCAGCTTTGTGGTTCATCGGCGATGCCACGAATTCGTGACCTTCGAGTGTCCAGGTGCTGGGAAGGGCCCCCAGACGGACGACCCCCGGAACAAGCACAAGTTCCGCCTGCACAGTTACAGCAGCCCCACCTTCTGCGACCACTGCGGCTCGCTGCTGTACGGCCTGGTGCACCAGGGCATGAAGTGCTCCTGCTGCGAGATGAACGTGCACCGGCGCTGTGTGCGCAGCGTGCCCTCGCTGTGCGGTGTGGACCACACCGAGCGCCGTGGCCGCCTGCAGCTGGAGATCCGGGCCCCGACCAACGAGGAGATCCACGTCACCGTCGGCGAGGCCCGAAACCTCATTCCCATGGACCCCAACGGCCTGTCTGATCCCTACGTCAAACTGAAGCTCATCCCAGACCCGCGCAACCTGACCAAACAGAAGACTCGGACGGTGAAAGCCACGCTGAACCCCGTGTGGAACGAGACCTTCGTGTTCAACCTGAAGCCGGGGGACGTGGAGCGCAGGCTCAGCGTGGAGGTGTGGGACTGGGACCGGACTTCGCGCAACGACTTCATGGGGGCCATGTCCTTCGGGGTCTCGGAGCTGCTCAAGGCGCCCGTGGATGGCTGGTACAAGTTACTGAACCAGGAGGAGGGTGAATATTACAATGTGCCGGTGGCAGATGCTGACAACTGCAGCCTCCTCCAGAAGTTTGAGGCCTGCAACTACCCCTTGGAATTGTATGAGCGAGTTCGGATGGGCCCCACATCCTCCCCGATCCCCTCCCCATCCCCCAGCCCCACCGACTCCAAGCGCTGCTTCTTCGGGGCCAGCCCAGGACGCCTGCACATCTCCGACTTCAGCTTCCTCATGGTTCTAGGAAAAGGCAGTTTCGGGAAGGTGATGCTGGCGGAGCGCAGAGGCTCGGACGAGCTCTACGCCATCAAGATCCTGAAAAAGGACGTGATCGTCCAGGACGACGACGTGGACTGCACCCTGGTGGAGAAACGCGTGCTGGCTCTGGGGGGCCGAGGTCCAGGCGGACGGCCCCACTTCCTCACCCAGCTGCACTCCACCTTCCAGACTCCGGACCGCCTGTATTTCGTGATGGAGTATGTCACCGGGGGCGACCTGATGTACCACATTCAGCAGCTGGGCAAGTTCAAGGAGCCCCACGCAGCGTTCTATGCCGCAGAGATCGCCATCGGCCTCTTCTTCCTTCACAACCAGGGCATCATCTACAGGGACCTGAAGCTGGACAACGTGATGCTGGATGCCGAGGGGCACATCAAGATCACTGACTTCGGCATGTGCAAGGAAAACGTGTTCCCGGGGACCACAACGCGGACCTTCTGTGGGACCCCGGACTACATAGCCCCCGAGATCATTGCCTACCAGCCCTATGGGAAGTCCGTCGATTGGTGGTCCTTCGGGGTGCTGCTCTACGAAATGTTGGCAGGGCAGCCGCCCTTTGACGGGGAGGATGAGGAGGAGCTGTTTCAGGCCATCATGGAGCAGACAGTCACCTATCCCAAGTCACTTTCCCGGGAAGCTGTGGCCATCTGCAAGGGGTTCTTGACCAAACACCCAGCAAAGCGCCTGGGCTCCGGGCCCGACGGGGAACCCACAATCCGGGCGCACGGCTTTTTCCGCTGGATCGACTGGGACCGGCTGGAGCGGCTGGAGATCGCGCCTCCGTTCAGACCTCGCCCGTGTGGCCGCAGCGGTGAGAACTTCGACAAGTTCTTCACACGGGCGGCGCCAGCTCTGACCCCGCCAGACCGCCTGGTCCTGGCCAGCATCGACCAGGCGGATTTCCAGGGCTTCACCTACGTGAACCCCGACTTTGTACACCCAGACGCGCGCAGCCCCACCAGCCCCGTGCCCGTGCCCGTCATGTGA

XM_004866733.1 Coding sequence

LOC101699320 leukocyte immunoglobulin-like receptor subfamily B member 4-like, transcript variant X3

Length: 1308 bp    Location: 2622227..2616204   Strand: -
>XM_004866733.1
ATGACCCCCAGCCTCACGGCGCTGCTCTGCCTGGGGCTGAGTCTGGGCCCCAGGACCCGAGGGCAGGCAGGATCCATGACACAGCACTATGCAGGGCGATATCACTGTTACTATCGCAGCCCTGCTGGCTGGTCAGAGCGCAGTGAGCCCCTGGAGCTGGTGGTGACAGGAGCCTACAGCAAACCCAGCCTCTCAGCCCTGCCCAGCCCTGCAGTGACCTCAGGAGGGACCGTGACCCTCCAGTGTGGCTCATGGCTAAGATTTGGCAAGTTCCTTCTGACTCAGGAAGGAGAAGATGGGCTCTCCTGGACCCTGGACTCACAGCGAGGCCCCAGTGGGCAGTTCCAGGCCCTGTTCCCTGTGGGCCCTGTGACCGCTGGCCACAGGTGGATGTTCAGATGCTACGGCTATGACAGGAACAATCCCCAGGTGTGGTCGGAGCCCAGTGACACCCTGGAGCTCCTGGTCTCAGGACTGGGAAGGCACCTGAAGGTTCTGATCGGGGCCTCGGTGGCCTCCGTCCTGCTGCTGCTGCTGCTCCTCCTCCTCCTCGTCCTCCGACACTGGCGTCAGGGCGAAAGCAGGAAGGCGGGTGAGTGGGGACAGCCCAGAGAGAGGCTGACTTCCCACGGCCTGTGGGGGCCACGGGCCCAGTGCCCCAGCACGGAGGCCTGCAGAACAGCTCCGGCCCAGCCGCCACCACCCAGGAAGAAAACCTCTGTGAGAGGGAGAGGGGCAGGGTGGGGGGTACCCCGAGCTCTCAGCATCCCAGGGGCTGGGAGTCAGACTGAGCCTCCACACAGCCTGGGGACCTCAGCACGGCTCCCTGGATCTGTGTCCCCAGCTGGGCCGGGGCTGGGGCCTGCGGGGCCGAGAGACCCCAGGGACTCTGGGCAGGAGGGGACCCCTTGTTCTGTCCCTGCAGATGCTGCCGTGAACGACTCACCGCCTGAGGACGGGGTGGAGCTGGACGCTTGGAGCCCACCTGATGAAGACCCCCAGGGAGCGGTATACGCCCAGGTGAAGCACGCAGCACCCAGGGGCAGAGGGGCCGCCCCTCCCGCGGCCCCGTCCGGGGAGCTCCTGGACACCAAGGATGGACAGGCAGGGGAGGACAGGCAGACGGACGCTCAGGCTGCAGCCCCTGAGGGTCCCCAGGACGTGACCTACGCCCAGCTGTGCAGCTGGACGCTCGGACGGGGCACAGCGGCGCCTCCTCCCTCCCGGCCCGGGGCCCTCCCAGCCGAGCCCAGTGTGTATGCTGCCCTGGCGTCCTCGCCCCGAGCCATCCCCAGGGACACTGAGTGA

XM_004867179.1 Coding sequence

LOC101726623 vomeronasal type-1 receptor 2-like

Length: 639 bp    Location: 2745510..2737360   Strand: -
>XM_004867179.1
ATGATTCCTGACAAAGATCAAAATTCTGTTTTTGCAGTGTTGACATTGTCACATGACATTTTATGTTTGAAACTTATGATCTGGAGCAGTGGCTCCATGGTTTTCATTCTTCACAGGCACAAACATCGGACACAGCATATCCACAGACATAACATCTCATCCAGATCTTCCCCTGAGACCAGAGCCACTCGAAGCATCCTCATCCTGGTCTGTGCCTTTGTGTCCTTCTATATTCTGTCTTCCATCATGTATGTCTGGTTTATTTTTTTTCGCAAAGCTGTTTGGTGGCTGGTTAAAACCCAAGCCTTAACCAATGGTTCTTTCCCTACAACAAGGCCCTTTATTCTCATAACTCGAGAACACTGGGTATGTAAATTCATGTGGAAAAAGGGAACGCACATCTCACCTCATCAGTCATTAAATCGAATGTATGAATTCACAGGTTTCTTTGGATATCCATTCAAGGTGGATGAAAACCATTCTGGAACATACACAAAACTGAAGAGTGAGCACAGTCCACTTCCACAGCCGGCGCACAGCTCAGCTCCAGACCTTCCCGGGGCCCTCAGCAGGCCCCACACACTCCAGAGGAGCGCCGTCGCACCAGCGGACAACGCAATGGCCCGACCACAGAAGTAA

XM_004867181.1 Coding sequence

LOC101697233 vomeronasal type-1 receptor 4-like

Length: 1014 bp    Location: 3045760..3044747   Strand: -
>XM_004867181.1
ATGAGCCTAGCTCAAAGAAATGATTGCCACCACAGTTTACAGGAAATTTTAGAAGGAAATGACAAAATACCTTCCAGGGATTTGGCAGTAGGAATAATGTTTTTGTCACAGACTATGGTTGGAGTTCTGGGAAATTTTTCTCTTCTTTATCATTATTTTTTTCTTCGCCATGTGAAAAGCAGATTGAGGTCCATAGATTTGATTCTCAAGCACCTGTTTATAGCTAATTCTTTAGTTATTCTTTCAAAAGGACCTTCCCAGACAATGGTAGCCTTTGGGTCAAAACATTTATTCAGTGAATTTAGTTGCAGACTTATCTTATATGTCCTCAGAGTGGGCAGGGCTGTGTCAATTTTTACCACGTGCCTCTTGAGTGTCTTCCAGACTATCATAATCAGCCCCATGGACTCTTGTTGGAAGAATCTTAAAACAAAAGCTCCAAAGTACATTGGATTCTCCATGTCCCTCTGCTGGTTGCTACAAATAGGGGTACATTTCACATTCCCTCTGTATGTGTGGTATGTATCTGGAAAATCAGATAGCAGAAACATCACAAGGAAAAGACATATGGCACTCTGTTCTGTTGTAGATTATGGGACAATCATGGGTTCAGCCTATATTGCATTAGTAGTATTTCCTGAGGTTTCTTTTATTGTGCTCACAATCTGGGCCAGTGGCTCTATGATTTTTGTCCTGTACAGACACAAACAGCAGGTTAAACACATTCATAGCACTAATGTTTCCTCCACATCCTCTGAGTCCAGAGCCACCAAAAGCATCCTTCTCCTGGTGAGCACCTTTGTATCATTTTACATCATCTCCTCAACCTTTCACATTTGTAGTGCTCTTTCTTATAATCTCAGTTGGTGGTTGGTGAGGATTTCTGGCCTAATTTCTGTGTGTTTCCCAACTATCAGCCCCTTTCTGATCATGAGCCAGGATTCCTCTATATCCATGGTCTGGTTTGTATGGATAAGAAACAGAAAAAGTCCTCTTCTTCTCAGAAACATATAG

XM_004866739.1 Coding sequence

LOC101703470 serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform-like

Length: 1770 bp    Location: 2979305..3009189   Strand: +
>XM_004866739.1
ATGGCGGCGGCCGACGGCGATGACTCGCTCTACCCCATTGCGGTGCTCATAGATGAGCTCCGCAACGAGGATGTTCAGCTGCGCCTCAATAGCATCAAGAAGCTGTCCACCATTGCCTTGGCCCTAGGGGTTGAAAGGACCCGCAGTGAGCTCCTGCCCTTCCTAACAGACACCATCTACGACGAGGATGAGGTCCTCCTGGCACTGGCGGAGCAGCTGGGAACCTTCACCACTCTGGTGGGAGGCCCGGAGTACGTGCACTGCCTGCTGCCACCCCTGGAGTCACTGGCTACAGTGGAGGAGACGGTGGTGCGGGACAAGGCGGTGGAGTCCTTGCGGGCCATCTCCCATGAGCACTCGCCCTCGGACCTGGAGGCCCACTTCGTGCCGCTTGTGAAGAGGCTGGCGGGCGGCGACTGGTTCACCTCCCGCACCTCGGCCTGCGGCCTCTTCTCCGTCTGCTACCCCCGTGTGTCCAGTGCCGTGAAGGCCGAGCTCCGACAGTACTTCCGGAACCTGTGCTCAGACGACACCCCCATGGTTCGGCGGGCTGCAGCCTCCAAGCTGGGGGAGTTCGCCAAGGTGCTGGAGCTGGACAACGTCAAGAGTGAGATCATCCCCATGTTCTCCAATCTGGCCTCTGATGAGCAGGACTCAGTGCGGCTGCTGGCAGTGGAGGCATGTGTGAACATCGCCCAGCTCCTGCCCCAGGAGGACCTGGAGGCCCTGGTGATGCCCACCCTGCGCCAGGCTGCCGAGGACAAGTCCTGGCGTGTCCGCTACATGGTGGCCGATAAGTTCACAGAGCTCCAGAAAGCAGTGGGACCTGAGATCACCAAGACAGACCTAGTCCCTGCCTTCCAGAACCTGATGAAGGACTGTGAGGCCGAGGTGAGGGCCGCTGCCTCCCACAAGGTCAAAGAGTTCTGTGAAAATCTCTCTGCCGACTGTCGGGAGAATGTGATCATGACCCAGATCTTGCCGTGCATCAAGGAGCTGGTTTCAGATGCCAACCAACATGTCAAGTCCGCCCTGGCTTCGGTCATCATGGGCCTCTCCCCCATCCTGGGCAAAGATAACACCATCGAGCACCTCTTGCCCCTCTTTCTGGCTCAGCTGAAGGATGAGTGCCCTGAGGTACGGCTGAACATCATCTCCAACCTGGACTGTGTGAACGAGGTGATCGGCATCCGGCAGCTCTCCCAGTCCCTGCTCCCTGCCATTGTGGAGCTGGCTGAGGACGCCAAGTGGCGAGTACGGCTGGCCATCATCGAGTACATGCCCCTGCTGGCTGGGCAGCTGGGAGTGGAATTCTTTGATGAGAAACTCAACTCGTTGTGCATGGCCTGGCTAGTGGATCATGTCTATGCCATCCGGGAGGCAGCCACCAGCAACCTGAAGAAGTTGGTGGAGAAGTTTGGGAAGGAGTGGGCCCATGCCACTATCATCCCCAAGGTCTTGGCCATGTCTGGAGACCCCAACTACCTGCATCGCATGACCACGCTCTTCTGCATCAATGTGCTGTCGGAAGTCTGTGGGCAGGACATTACCACCAAGCACATGCTGCCCACAGTCCTGCGTATGGCTGGGGACCCGGTGGCCAATGTCCGCTTCAATGTGGCCAAGTCCTTACAGAAGATAGGTCCCATCCTGGACAATAGCACTCTCCAGAGTGAAGTCAAGCCCATCCTGGAGAAGCTGACCCAGGACCAGGATGTGGATGTCAAGTACTTTGCCCAGGAGGCTCTGACTGTTCTGTCCCTTGCCTGA

XM_004866741.1 Coding sequence

Znf350 zinc finger protein 350, transcript variant X2

Length: 1593 bp    Location: 3079480..3090711   Strand: +
>XM_004866741.1
ATGATCCAGGCCCAGGAGTCACTGACCCTGGAGGATGTGGCTGTGAGGTTCACCCGGGAGGAGTGGCAGCTCCTGGGCCCTGCTCAGAAGGACCTGTACCGGGACGTGATGCTGGAGAACTACAGCAGCCTGGTGTCAGTGGGGTATCAAGCCAGCCAGCCAGATTCCCTCTCCAGCTTGCTTTGTGGAGAACCATGGATGGTGGAGGATGAACTGCACTGTGGAACCCATTCAGACATCTGGAAGGCTGTTGATGATCTGCCAAGGCATTTACAAAACAAAAGCAAGGTGAACAGGTTGGAAGAGTGGCGTGAACACAATACATTTGAAAATGTTCAACAGAGCAAAACTCAATTTCTTTTGAGGCAAAATCATGACATATTTAACTTACATGGAAAAAGTATGAAGTCAGATTTAACTTTGGTTAACCAGAGCAAAAGCTGTGAAATAAAGAATCCCATGGCATTCCCCAGACGTGAGGAATCCTTTTTCCCTGCTAACTGTGAAAAACTTCATACTGAAATTTTATTTCCTGCAAGTCAAAAACACATCAGCATTAAATCTCAGTTCAGTAGCCGCAAGCCTAAGAAAACTCAGAAAGTAGAGAAACGTCATGTATGCAGTGAATGCGGGAAAGCCTTTGTCAAGAAGTCTTGGCTCACTGATCACGAGATCATCCATACTGGGGAGAAACCCCATCGATGTGGTCTGTGTGGGAAAGCCTTCTCCAGAAAGTTCATGCTCACTGAACACCACAGAACTCATACAGGAGAAAAACCTTACGCATGCACTGAGTGTGGCAAAGCCTTTCTCAAGAAATCACGACTCAGCATACATCAGAAAACTCATACAGGAGAGAAACAGTATATATGCAGTGAGTGTGGAAAGAGCTTCATCCAGAAAGGAAATCTCATTGTACATCAGCGAATTCATACAGGCGAGAAACCTTATATATGCAGTGAATGTGGAAAAGGCTTTATCCAAAAGACCTGCCTCATAGCACATCAGAGGTTTCATACTGGGAAGACTCCCTTTGTGTGCAGTGAATGTGGAAAATCCTGTTCACAGAGGTCGGGTCTCATTAAACATCAAAGGATTCACACAGGGGAGAAACCCTTTGTATGTAGTGACTGTGGGAAAGCCTTCACCACAAAGCAAAAGCTCATTGTTCATCAAAGAACTCATACAGGAGAGAAACCCTATGGCTGCAATGACTGTGGGAAAGCTTTTGCGTACATGTCTTGCCTGGTGAAGCATAAGAAAATACACACAAGGGAAAAGCAGAGACATACAATGAGGTCGGAAAAACCTGCTGAGAGTGACAGCTCGTTATATATTGGTGGCGTCATACAGGAGACAAACCCGGTTAGCACAGTGATTACCCAAGTGCCTTCTGTGGCCTCTCAGTCAGCACTGAACATCAGTGGCCTAGCAAATAGGAATGTAGTCCTTATGGGACAGCCGGTGGCCAGATGTGTGTCGTTAGGAGACAACCGAGAATTTACACAGGATAGAGACCTCGTGAATGCAGTGAATATGGTTGTGCCTTCAGTCATCAATTATGTCTTATTTTATGTCACAGAAAACCCATAG

XM_004866742.1 Coding sequence

Znf350 zinc finger protein 350, transcript variant X3

Length: 1593 bp    Location: 3079597..3090711   Strand: +
>XM_004866742.1
ATGATCCAGGCCCAGGAGTCACTGACCCTGGAGGATGTGGCTGTGAGGTTCACCCGGGAGGAGTGGCAGCTCCTGGGCCCTGCTCAGAAGGACCTGTACCGGGACGTGATGCTGGAGAACTACAGCAGCCTGGTGTCAGTGGGGTATCAAGCCAGCCAGCCAGATTCCCTCTCCAGCTTGCTTTGTGGAGAACCATGGATGGTGGAGGATGAACTGCACTGTGGAACCCATTCAGACATCTGGAAGGCTGTTGATGATCTGCCAAGGCATTTACAAAACAAAAGCAAGGTGAACAGGTTGGAAGAGTGGCGTGAACACAATACATTTGAAAATGTTCAACAGAGCAAAACTCAATTTCTTTTGAGGCAAAATCATGACATATTTAACTTACATGGAAAAAGTATGAAGTCAGATTTAACTTTGGTTAACCAGAGCAAAAGCTGTGAAATAAAGAATCCCATGGCATTCCCCAGACGTGAGGAATCCTTTTTCCCTGCTAACTGTGAAAAACTTCATACTGAAATTTTATTTCCTGCAAGTCAAAAACACATCAGCATTAAATCTCAGTTCAGTAGCCGCAAGCCTAAGAAAACTCAGAAAGTAGAGAAACGTCATGTATGCAGTGAATGCGGGAAAGCCTTTGTCAAGAAGTCTTGGCTCACTGATCACGAGATCATCCATACTGGGGAGAAACCCCATCGATGTGGTCTGTGTGGGAAAGCCTTCTCCAGAAAGTTCATGCTCACTGAACACCACAGAACTCATACAGGAGAAAAACCTTACGCATGCACTGAGTGTGGCAAAGCCTTTCTCAAGAAATCACGACTCAGCATACATCAGAAAACTCATACAGGAGAGAAACAGTATATATGCAGTGAGTGTGGAAAGAGCTTCATCCAGAAAGGAAATCTCATTGTACATCAGCGAATTCATACAGGCGAGAAACCTTATATATGCAGTGAATGTGGAAAAGGCTTTATCCAAAAGACCTGCCTCATAGCACATCAGAGGTTTCATACTGGGAAGACTCCCTTTGTGTGCAGTGAATGTGGAAAATCCTGTTCACAGAGGTCGGGTCTCATTAAACATCAAAGGATTCACACAGGGGAGAAACCCTTTGTATGTAGTGACTGTGGGAAAGCCTTCACCACAAAGCAAAAGCTCATTGTTCATCAAAGAACTCATACAGGAGAGAAACCCTATGGCTGCAATGACTGTGGGAAAGCTTTTGCGTACATGTCTTGCCTGGTGAAGCATAAGAAAATACACACAAGGGAAAAGCAGAGACATACAATGAGGTCGGAAAAACCTGCTGAGAGTGACAGCTCGTTATATATTGGTGGCGTCATACAGGAGACAAACCCGGTTAGCACAGTGATTACCCAAGTGCCTTCTGTGGCCTCTCAGTCAGCACTGAACATCAGTGGCCTAGCAAATAGGAATGTAGTCCTTATGGGACAGCCGGTGGCCAGATGTGTGTCGTTAGGAGACAACCGAGAATTTACACAGGATAGAGACCTCGTGAATGCAGTGAATATGGTTGTGCCTTCAGTCATCAATTATGTCTTATTTTATGTCACAGAAAACCCATAG

XM_004866750.1 Coding sequence

LOC101706468 N-formyl peptide receptor 2-like, transcript variant X3

Length: 1056 bp    Location: 3281205..3275955   Strand: -
>XM_004866750.1
ATGGCATCGAACTTCTCCATCCCTTTCAATGGATCTGAAGAAATGCCTTATGAATCAACTGGCTACGCTGTTCTGCGGATACTCCCATTGGTGGTACTCTCGGTCACCTTTGTCCTGGGTGTGCTGGGCAATGGCTTGGTGATCTGGGTGGCTGGATTCCGGATGGCGCACACAGTCACCACCATCTGTTACCTGAACCTGGCCTTAGCTGACTTCTCCTTCACTGCCACCCTGCCTTTCCTCATTGTCTCCATGGCCATGGGAGAAAAATGGCCTTTTGGCTGGTTCCTCTGCAAGTTGATTCACATAGTTGTGGACATAAACCTGTTTGGAAGTGTCTTCCTGATTGCTCTGATCGCTCTGGATCGCTGTATTTGTGTGTTGCATCCAGTGTGGGCTCAGAACCACCGCACTGTGAGTCTGGCCAAGAAGGTCATCATCGGACCCTGGATTCTTGCCCTAGTCCTTACCTTGCCAGTTTTCATCTTCTTGACCACAGGAAGTGACGCGAACGGGAACACATACTGTACCTTCTCTTTTGTATCCTGGGGAGACACTATTGAAAAGAGGCTGAAGGTGGCCATCGCCATGTTGACAGCTAGAGGGATCATCCGGTTCATTATTGGCTTCAGCATGCCCATGTCCATGGTCGCCATCTGCTATGGGCTCATCGCTGCCAAGATTCGCAGAAAAGGCTTGATGAATTCCAGCCGTCCCTTTCGGGTCCTCACTGCTGTTGTGGCTTCCTTCTTCATCTGTTGGTTCCCCTTTCAATTGGTTGCCCTTTTAAGCACTGTGTGGCTCAAAGAGATGTTGTTTGAGGGCAAGTACAAAGTCTTTGCCATCCTGGTCGGCCCAGCAAGGTCCCTGGCCTTCTTCAACAGCTGTCTCAACCCAATGCTCTATGTCTTTGTGGGGCAGGACTTCCGAGAGAGACTGATCCACTCCCTGCCCGCCAGTCTGGAGAGGGCCCTGAGTGAGGACTCAGCCCCGACCAGTGACACAGCCACCAATTCTGCTGCACCTCCTGCAGAGGAGGAGCTAAAAGCAATGTGA

XM_004866752.1 Coding sequence

Has1 hyaluronan synthase 1

High confidence: 4 potential gene matches
Length: 1749 bp    Location: 3327487..3336527   Strand: +
>XM_004866752.1
ATGACCCAGGACCTGCCCAAACCCGCCCGGACCGCGCGCCGCTGCTCCGGGCTGGCCCGGCGACTGCTGACCGTCGCCTTCGCCCTGCTCATCCTGTGCCTCATCACCTGGGCCTACGCGGCCGGGGTGCCTCTGGCCTCCGATCGCCACGGCCTCCTGGCCTTCGGCCTGTACGGCGCCTTCCTGTCGGCGCACCTGGTGGCGCAGAGCCTCTTCGCATACCTGGAGCACCGGCGGGTGGCGGCGGCGGCGCGGCGCGCGGCCAGGCGGGGGCTCCCGGACGCGGGCTCGGCGCGCACCGTGGCTCTGACCATCTCCGCCTACCAGGAGGACCCCGCCTACCTGCGCCAGTGCCTGGCGTCCGCGCGCGCCCTGCTGTACCCGCGCGCGCGCCTGCGCGTGCTCATGGTGGTGGACGGCAACGGCGCCGAGGACCTCTACATGGTGGACATGTTCCGCGAGGTCTTCGCCGACGAGGACCCCGCCACCTACGTGTGGGACGGCAACTACCACCAGCCCTGGGAACCTGCGGCGGCGGGCGCCGTGGGCGCGGGCGCCTACCGGGAGGTGGAAGCCGAGGACCCGGGGCGCCTGGCGGTGGAGGCGCTGGTCAGGACGCGCAGGTGCGTGTGCGTGGCGCAGCGCTGGGGCGGCAAGCGCGAGGTCATGTACACGGCCTTCAAGGCGCTGGGCGACTCGGTGGACTACGTGCAGGTGTGTGACTCAGACACAAGGCTGGACCCCATGGCGCTGCTGGAGCTGGTGCGGGTGCTGGATGAGGATCCCCAAGTCGGGGCGGTTGGGGGAGACGTTCGGATCCTTAACCCTCTGGACTCCTGGGTCAGCTTCCTGAGCAGCCTGCGGTACTGGGTTGCCTTCAATGTGGAGCGAGCTTGTCAGAGCTACTTTCACTGCGTGTCCTGCATCAGCGGCCCCCTGGGCCTGTACAGGAACAACCTCCTGCAGCAGTTCCTGGAGGCTTGGTACAACCAGAAGTTCCTGGGCACCCACTGCACTTTTGGGGATGACCGGCACCTCACCAACCGCATGCTCAGCATGGGCTACGCCACCAAGTACACGTCGCGCTCGCGCTGCTACTCGGAGACGCCGTCGTCCTTCCTGCGCTGGCTCAGCCAGCAGACGCGCTGGTCCAAGTCCTACTTCCGCGAGTGGCTGTACAACGCACTGTGGTGGCACCGGCACCACGCGTGGATGACCTACGAGGCGGTGGTGTCGGGGCTCTTCCCGTTCTTCGTGGCGGCCACCGTGCTGCGCCTGTTCTACGCGGGGCGCCCGTGGGCGCTGCTGTGGGTGCTGCTGTGCGTGCAGGGCGTGGCGCTGGCCAAGGCGGCCTTCGCGGCCTGGCTGCGCGGCTGCGGGCGCATGGTGCTGCTGTCGCTGTACGCGCCGCTCTACATGTGCGGCCTGCTGCCCGCCAAGTTCCTGGCGCTGGTCACCATGAACCAGAGCGGCTGGGGCACCTCGGGCCGCCGCAGGCTGGCGGCCAACTACGTCCCGGCGCTGCCGCTGGCGCTCTGGGCTCTGCTGCTGCTCGGGGGCCTGGTGCGCAGCGTGGCGCAGGAGGCCGGGGCCGACTGGAGCAGCCCCGCGCGGCTCGCCGAGGGCCGCCACCTGGCGGCGGGCGCGGCCGCCTACGCCGGCTACTGGGCCGCAATGATGGCGCTGTACTGGGTGGGCGTGCGCAGGCTCTGCCGGCGGCGGGCGGGGGGCTACCGCGTGCAGGTGTGA

XM_004867194.1 Coding sequence

Ctu1 cytosolic thiouridylase subunit 1

High confidence: 1 potential gene match
Length: 1041 bp    Location: 3680897..3687083   Strand: +
>XM_004867194.1
ATGCCCGCCCCGACCTGCGCCTCCTGCCACGCGGCCCGCGCCGCCCTCCGCCGCCCACGCTCGGGGCAGGCGCTGTGCGGACCCTGCTTCTGCGCCGCCTTCGAGGCCGAGGTGCTGCACACGGTGGTCGCGGGCCGCCTGCTACCGCCCGGCGCCGTGGTGGCTGTGGGCGCCTCGGGCGGCAAGGACTCCACCGTGCTCGCGCACGTGCTACGGGAGCTCGCGCCGCGCCTGGACGTCGCGCTGCGCCTCGTGGCCGTGGACGAGGGCATCGGCGGCTACCGCGACGAGGCGCTGGCGGCTGTGCGACGCCAGGCGGCGCGCTGGGAGCTGCCGCTCACCGTCGTGGCCTACGAGGACCTCTTCAGGGGCTGGACGATGGACGCCGTGGCCCGCAGCACGGCCGGCACCGGCCGCGGCCGCTCCTGCTGCACCTTCTGCGGGGTGCTGCGGCGCCGAGCGCTGGAGGAAGGGGCGCGCCTCGTGGGAGCCACGCACATCGTGACCGGCCACAACGCCGACGACATGGCCGAGACGGTGCTCATGAACTTCCTGCGCGGCGACGCGGCACGGCTGGCCCGGGGCGGGGGCCTGGGCTCTCGGGGCGAGGGGGGCGCCCTGCCGCGCTGCCGCCCGCTGCAGTTCGCCTCGCAGAAGGAGGTGGTGCTGTACGCGCACTTCCGCCGCCTCGACTACTTCTCCGAGGAGTGCGTGTACGCGCCCGAGGCCTTCCGCGGCCACGCGCGCGACCTGCTCAAGCGCCTGGAGGCGGTGCGGCCCACGGCGGCGCTGGACCTCGTGCACTCGGCCGAGCGCCTGGCGCTGGCCCCGGCCGTGCGGCCCCCGCGGCCCGGCGCCTGCTCCCGCTGCGGGGCGCTGGCCAGCCGCGCGCTCTGCCAGGCCTGCGCACTGCTGGACGGCCTGGCCCGCGGCCGGCCCCGCCTGGCCATCGGCGAGCGCGAGCACCGAGGCGGAGGGGACGCGGAGGGGACGCGGGGCCGCGCCCGAGCCGCCGTGGAGGCCGCCGCCGCCGCCCTATAG

XM_004867188.1 Coding sequence

LOC101701247 cytoplasmic tRNA 2-thiolation protein 1-like

Length: 1083 bp    Location: 3438788..3433809   Strand: -
>XM_004867188.1
ATGCCCGCCCCGACCTGCGCCTCCTGCCACGCGGCCCGCGCCGCCCTCCGCCGCCCACGCTCGGGGCAGGCGCTGTGCGGACCCTGCTTCTGCGCCGCCTTCGAGGCCGAGGTGCTGCACACGGTGGTCGCGGGCCGCCTGCTGCCGCCCGGCGCCGTGGTGGCTGTGGGCGCCTCGGGCGGCAAGGACTCCACCGTGCTCGCGCACGTGCTGCGGGAGCTCGCGCCTCGCCTGGACGTCGCGCTGCGCCTCGTGGCCGTGGACGAGGGCATCGGTGGCTACCGTGACGCGGCGCTGGCGGCTGTGCGACGCCAGGCGGCGCTCTGGGAGCTGCCGCTCACCGTCGTGGCCTACGAGGACCTCTTCGGGGGCTGGACGATGGACGCCGTGGCCTGCAGCACGGCCGGCACCGGCCTCGGCCGCTCCTGCTGCACCTTCTGCGGGGTGCTGCGGCGCCGAGCGCTGGAGGAAGGGGCGCGCCTCGTGGGAGCCACGCACATCGTGACCGGTGAGCAGCCGCAAAAACAAATAAATACAAAAAGTAAAAATAATAAAAAAGAGAAAGAGGAAAGAGGTGCAGCAGGCGGGTGCCGAGCGCGCCCCGAGTCCTCCGGGGCAGCTGTGCGGGCTTCTGGCTGTGCCTTCCTGCGCGGCGACTGGTCGAGGGGGCGCCCTGCCGCGTTGCAGTTCACCTCACAGAAGGAGGTGGTGTTGTACGCGCACTTCCGCCGCCTCGACTACTTCTCCGAGGAGTGCGTGTACGCGCCTGAGGCCTTCCGCGGCCACGAGCGCGACCTGCTCAAGCGCCTGGAGGCGGGGCGGCCTACAGCGGCCCTGGACCTCGTGCACTCGGCTGAGCGCCTGGCGCTGGTCCCGGCCGTGCGGCCCCCGCGGCCCGGCGCCTGCTCCTGCTGCGGGGCGCTGGCCAGCCGCGCGCTCTGCCAGGCCTGGGCACTGCTGGAGGGCCTGGCCCGCGGCCGGCCCCGCCTGGCCATCGGCGAGCGCGAGCACCGAGGTGCAGGGGACGCGGAGGGGCCGCGGGGCCTCGCCCAGGCCAAAGTGAAGGCCGCCGCCGCCCTGTAG

XM_004866760.1 Coding sequence

Nkg7 natural killer cell group 7 sequence, transcript variant X1

Length: 585 bp    Location: 3501900..3502797   Strand: +
>XM_004866760.1
ATGGAGCCCTGCCAGTCCTTGGCCCTGCTTGCTGGCTCCCTGGGCCTGGCGTCCTCCCTGGTGGCCATCAGCACCGACTTCTGGATAGTGGCCATGGGGGTGAGCTCAGCTCACTCGGGCCTCTGGCCAAAAGGGGGCCAGGACGATCCTGTCAAAGGCTACATCCACGTGACGCAGAGCTTCTGCATCCTGGCCGCCCTGTGGGGCCTGGTGGCCGTGGGCTTCCTGGTGCTGTCCTGCATCCCTTCACTGTCCGCCCCCGGCCGGGGCCCTCTGGTCTCCACGGTCACCACGTTCGCTGCAGCCCTCTCCATGCTGGTGGCCATGGTGGTGTATACCAGTGAACGGTGGGGCCAGGCTGTGCACTCCCAGGTCCAGACCTTCTTCTGCTGGTCCTTCTACCTGGGCTGGGTCTCCGCCTTCCTGTTCCTCTGTGCAGGTGACCACGCGGCCTCCTGGAGCTGGGAGGCCCCAGGGAGGGAGACACAGGCGGGAGGGGAAGCACTTACACTCTGGGCCACCCCAGGTGCCCTGAGTCTGCGCGCTCACTGCGGTGCCCAGCGGCCCGGCTACGAAAGCTTGTGA

XM_004867193.1 Coding sequence

Cd33 CD33 molecule

High confidence: 1 potential gene match
Length: 1350 bp    Location: 3632614..3610720   Strand: -
>XM_004867193.1
ATGAAGGGAGGGAAACCAGGCCCCGTGGCCGAGGTGGTGCTGGTGACCATTGTAGAGGTGGCTGTCAAGGTCCTGCTCCTCGGGCTCTGCCTCATCTTCCTCAGCACCAGCCTACGGGATGTGATTGCAGACACAGTCATCGTCCACTTCCTGCGCAGTCTGAACAGCCTTGTGTCCCCTCCGCGGACAGAGACAGTGACAAAAGCTATGTCCGGGCTGGAGGCCTCGCATGAGCTAAGCCCGGGATCCTCCAGCTCCGAGATGCTGCTTCCCCTGCTGCTGCTGTGGACAGGGAGGTGGGCCCAGGGAGCAGGGCCATGGGGGCCTCAGAGAGCTGATGGGCCTTTAGCCAGAGGGTGCTCAGCTGAGAGCCAGAGCTACAAGCTGGAAGTGCCACAGTCCATGCCTGTGCAGGAGGGTCAGTGTGTCCTTGTGACCTGCAGATTCTTCTACCCTTACAAGTACTCCCGGACTGGCTCTGTCTCTGGCTACTGGTTTCGAGAAGGGGCCAATACAAATACGGACTCCCCAGTGGCCACAAACGACCCACAAAAACCAGTGCAGGAGGGAACTCGGGACCGGTTCCACCTCCTCCTGGACCCACAGACCAGGAACTGCTCCCTGCAAATCAGAGATGCTCGGAGGGGCGACAGTGGTTCATACTTCTTTCGGGTGGAGGCAGGAAATGTACTATGGAATTACTGTGCACACCCGGTCTCTGTGGAAGTGACAGCCCTGACCCACACCCCCGGCATCCTCATCCCCGGCACCCTGCAGCCTGGCCGCCCCAGCAACCTGACCTGCTCTGTGCCCTGGGCCTGTGAGCAGGGGACGCCCCCCATCTTCTCCTGGACGTCAGCTGCCCTCAGCTCCCTGGGCCCCAGGACCCCCCGCTCCTCTGTGCTCACCCTCAGCCCCCGGCCCCAGGACCACGGCACCAACCTCACCTGTCAGGTGATGTTCCCTGGAGCCGGTGTGACCGTGGAGAGGACCGTGCAGCTCAACGTCACCGGGAATCACAGGACAAGAGCAACAGCAGGAGTGGTTTTGGGGGCCATCGGGGGAGCCGGTGTCACAGCCCTGCTCGCTGTCTGTCTCTGTGTCATCGTCTTCGTAGTGAAGACCCTCAGGAAGAAAGCTCCCAGGATTACAGAGGACATGAATGACATCGATCCTGCCACCAGGCCAGCCTCACTGGGTCACCCGCCAGAGTCCCAGCTGCAAGGCTCTGCTGAGCCCTGGGGTTCCTCGGGGGCGCCCCCCGCCTCAGGGGAGGAGGAGCAGCTGCACTATGCCTCCCTCAGCTTCCACCCCTGGAAGAAATCCTCCACGCCAATCAGGATCCACTGA

XM_004866766.1 Coding sequence

LOC101712837 sialic acid-binding Ig-like lectin 13-like, transcript variant X2

Length: 813 bp    Location: 3636229..3629408   Strand: -
>XM_004866766.1
ATGCTGCCGCCTCTGCTGCTGCCCCTGCTGTGGGCAGGGTCTCTGGCTCAGTATCCGAGATACAGGCTGCGCATGCCAAAGTCAGTGTTGGTGCCAGAGGGTCTGTGCGTCCTCGTGCCCTGCCAGTTCCACTACTACTTTGGCCTCAAGTCTGGCTCTGTGTCCGGCTCCTGGTTCCGGGAGGGCTCTGAATCTCTCCGGGACTTGCCAGTGGCCACAAACAACCCACAACAGCAAGTGCGGGAGGAGACTCGGGGCCGGTTCAGCCTCCTCTGGGACCCACAGACCAGGAACTGCTCCCTGCACATCAGGGATGCACGGAGAGGCGACAGCGGTTCATACTTCTTTTACATGCACCCAGAAAGCTCCAGGAGGAATTTCTATTGGAACCAGGTCACTGTGTACGTCGCAGCCCTGAATCACACACCGGACGTCTTCATGCCGGGGACTCTGGAGTCCGGCCGCCCCAGCAACCTGACCTGCTCTGTGCCCTGGGCCTGTGAGCAGGGGACGCCCCCCATTTTCTCCTGGGCGGGCGCCTCTGTATCCCACCTGGACCCCGCTGTCACCAGCTCCCCCGTGCTCACCCTCAGCCCCCGGCCCCAGGACCATGGCACAGCTCTCACCTGTCAGGTGATGCTCCCTGGAGCCGGTGTGACTGTGGAGAGGACTGTGCGGCTCAACGTCACCGATTCTGCCAGGAGCCCCACAGCTGGTGTCTCCCTGGGAGCCGGCTCAGGTAGGGAAGGGCGTCCTTGGGCTGGAGGGGAGGCCAGCACCAGGTCTCTGCTCGCCTTGGACACCACCTGGTGA

XM_004866767.1 Coding sequence

Siglec7 sialic acid binding Ig-like lectin 7, transcript variant X1

Length: 1419 bp    Location: 3655605..3653110   Strand: -
>XM_004866767.1
ATGACCACCTCACTTCCTCAGGCCGCTTGTGAACCAGGTTCCCCTCTGGGTCCTCATTATGTTTTAACACTCAGCATGCTCACCCGCACCGCCCCAGTGCCTCCCCTGCTCAGCCTTCCTGAGACTGACCGTCCAACCTGGGTCCTGCAGCTCTGGGTTCCTCAGAGTAGAGGCTGGAGGAGGAGCAGACTCCCCTGGGTGGACCCGCAGCTCCAGATCGACATGCTGCTGCTGCTGCTGCTGCCTGTGCTGCTGCTGCTCTGGGTGCAGGAGGGGGTGTGGGGAGAGGCTTACTCCTTGAAGGTGCAGAGCCCGGTAACGGTGCAGGAGGGCCTGTGTGTCCATGTGCCCTGTGAGTTCACCCACCCCTATGAAGACCAGACTGAGTTGGACGCAGCTCACGGCTACTGGTTCCGGGAAAAGGCTGGGTTTACAAGACAGACTGTTGTGGTGGCCACAAATGATCCAAGTCAACCGGTGGAGAAGGAAACCAAGGGCCGATTCCACCTCACTGGGGATCCGCGAGCCAACAACTGCTCCCTGGACATCAGAGACGCCCAGAAGAAGGACGAAGGGTCATTCGTCTTTCGGATGGAGAGAGGACGGAAACGATACAGTTACATAGCATACCCGGTCTCTGTGCGTGTGACAGCCCTGACCCACACCCCCGGCATCCTCATCCCGGGGACCCTGCAGCCCGGCCGCCCCAGCAACCTGACCTGCTCTGTGCCCTGGGCCTGCGAGCGGGGGACGCCCCCCATCTTCTCCTGGGCGGGCGCCTCTGTGTCCCACCTGGACCCCGCGGTCACGAGCTCCCCCGTGCTCACCCTCACCCCGCGGCCCCAGGACCACGGCACCGCCCTCAGCTGTCAGGTGACTCTGCCCGCGGCCAGTGTGACCACGAGGACGACCGTGCAGCTCAACATCTCCTGTGAGAGCTGGGCGGGAAGGCGGGCTGGGGACGGAGAGGGCTCCGGGGCGGGAGAGGGGCTGGGTCCGGGCTGGGCGCCGGTCCTGGAATCTCGGGGCTGGGGCAGGGGCCGGAGGGCGCAGCCTCCCCCCTCCCGCCTCTGCAGCCCCTGGGGCGGAGGGCCGATGTTCCCGCCTCGCCACGGCCACCGACGGCCCTGCCTTGTCTCTTGCCCCAGACGCTCCGCGGAACCTGACGACTCCTGCACAGATCCCTCGGCCCCGCAAGGATGGGGCGACTCGCACGCAGCGGAATTGAACTCTCCAGGCCCCTCCTCGCCCCTCCGCTGGATCCGCCTCCACCCTTCTCTCTCTCTCTATTCCCCCAGTAGCTTCCATCCAAGTGCTGGTGGAGGGAGACACACACGCACGCACACGCACGCACGCACACACGCACTCAGAACGCAGCAGTCTGTCCCAGGAGTGACCGTGACTCCCAGGCTGCGCTGA

XM_004867195.1 Coding sequence

Klk14 kallikrein-related peptidase 14

Length: 753 bp    Location: 3695840..3699678   Strand: +
>XM_004867195.1
ATGTTCCTCCTGCTGGCAGCCCTCCAAGTCCTGGCTGTAGCCACGGCCCAGGGCCCTGAGGATGATAACAAGGTAATCGGTGGCTACACCTGCGTCCAGAACTCCCAGCCGTGGCAGGTGGCTCTTCTGGCTGGGCCCGGGCGTCGGTTCTTGTGTGGAGGGGTCCTGTTGTCGGACCAGTGGGTCATCACTGCTGCTCATTGCGCCCGCCCGATCCTTCATGTTGCCTTGGGCAAGCACAACCTGAAGAAGTGGGAGGCCACCCAGCAGGTGCTGCGCGTGGAGCGCCAGGTGCCACACCCCCGCTACAACGCCCGGACCCACGACAGCGACCTGATGCTGCTGCGGCTGAGCCAGCGAGCACGGATCGGGAGGGCAGTGAGACCAATCAGCCTGGCCCAGTCCTGTGCCAGCCCAGGGACGTCCTGCCGTGTGTCAGGCTGGGGCACTACATCCAGCCCTATCGCCAGGTACCCCAATGCTCTGCAATGCGTGAATATCAACATCATCTCGAGTCCCCAGTGCCAGCGGGCCTATCCTAACATCACCGCCGGCATGGTCTGTGCTGGAGTCCCCCAGGGCGGGAAGGACTCTTGTCAGGGTGACTCTGGGGGGCCCCTTGTGTGCGGAGGACAGCTCCAGGGCCTCGTGTCCTGGGGGATGGAGCGCTGCGCCCTGCCTGGCTACCCTGGGGTCTACACCAACCTGTGCAAGTACCGCAGCTGGATCCAGAGAACGGAGCAGGGCCAGTGA

XM_004866778.1 Coding sequence

Klk6 kallikrein-related peptidase 6, transcript variant X1

Length: 930 bp    Location: 3785644..3793074   Strand: +
>XM_004866778.1
ATGTCCGGAGCACCCACAGCGGGACTCACAGGCAGGCAGGCTTCCCGCTTGGCGTCTCTCCTCTCCCCCTGCTCTCCTGGTGGCTGCCTGCACTGCTCACTCTCTGCTCCCCACCTGCCTTCCTCGGGGCTCTCCCTCACCCCATCCAAGAATCCTGTGACCAGCAGGCAGCTGCCACCAGCAGGAATGGCCATGAAGATGCTGACCGTGGCCCTGGTTCTCCTGGCTGGAGCCTTCGCAGAGGAGCAGGAGAAACTGGTGCACGGAGGGCCCTGCCACAGGGACTCTCACCCCTACCAAGCTGCTCTCTACAACTCGGGCCACCTGCTCTGCGGCGGGGTCCTCATCGACCCGGAGTGGGTTCTCACGGCTGCCCACTGCAAAAAAGAGAAGCTTCATGTCTACCTAGGGAAGCACAACCTTCGACAGTCGAAGAATACAGAGGACATTTCTGTGATCAAGACTGTGGTCCACCCTGGCTACAATCCTGCCACCCATGACCAGGACATCATGTTGTTGCGTCTGTCCAAACCTGCCAAGCTCTCCGACTGGATCCAGCCACTGCCTCTGGAGAGGGACTGTGGGGCCAGATCACCCCGCTGCCACATCCTGGGCTGGGGCAAGACAGAACAAGGTGTCTTTCCTGACACCATCCAGTGTGCCTATGTCCACATCGTGCCCCAGGAGAAGTGCGATCAGGCCTACCCCGGCCAGATCACCAGGAACATGGTGTGTGCTGGAGATCCGGAAGAAGGAAAGGATGCCTGCCAGGGTGACTCCGGGGGCCCACTGGTCTGTGGAGGCCGCCTCCGGGGCCTGGTGTCCTGGGGTAACGTCCCCTGCGGATCCAAGGAGAAGCCAGGAGTCTACACTGACGTCTGCAGATACGTCAGCTGGATCCAAAGAACCATGCGAGGCCACTGGCCCTGA

XM_004867197.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1746 bp    Location: 3740530..3749166   Strand: +
>XM_004867197.1
ATGGGGCTCGGCACCTTCCTGCTCCTGTGTGCTCTTGGTCTCAGCAGGGCAGACAGAGAGAAGATCTTCCATGGTGTTGAGTGCGTCCCTCACTCACAGCCCTGGCAGGTGGGGCTGTTTTCGGGCAGCAGCCTGCACTGTGGGGGGGTCCTCATCCACCCGAGGTGGGTGCTCCCAGCAGCTCACTGCAGCAGCAGCAGGTACTGGGTGCGCCTGGGGGAACACAGCCTCGGCAGGCTGGACTGGACGGAGCAGTTCCAGCGCAGCGGCCTCTCCGTGACCCACCTTGGCTACCAGGGAGCCCTGCAGAGCCGTGAGCATGACCTCCGGCTCCTGAGGCTGCTCACACCCATCCGCCTGACCTGCAGCGTCCAACCGCTGCCCCTGCCTAGCACTTGCGCGGCCGCTGGCACCAACCGCCACATCTCGGGCTGAGGCACCACCAACTGACCATGGGATCCATTCCCAGACCGACACCAGTGCCTCAACCCCTCTGCTGTCTCCACTGATGCCTGTCAGGCCGCGTTCCCTGGGAGAATCACAGCCAACACGGTGTGCGCAGGTGGTGTTGCCGGGAAGGATGGCTGCCGGCGAGACTCTGGGGGCCTGCTGGTGTGTGGGGGAGTCCTTCAGGGTCTGGTGTCCTGGGGGTCTGTGGGGCCTTGTGGGCAAAAAGGCATCCCAGGGGTCTACACCTTTGGGAGAGAGGAGAGGAGGATCAGGAAGAGATCTGGCTGCAAACAAACCCACGGTGGGAATTTGAAGCCGGGTTTCACAGATGAGGAAACCGAGGTGGCTCACGGGCTGGAAGTCATCAGACCCAAGCTACACAGCATCAAGAGCCCCACCTCTGTGACACCCCAGTTCCCCCCAGTCTTTGGAAAGGTGAAGGGAGAGCCCTGCCCTGTTCCCCTCCAGGCCATGAGGATTCTCTGGCTGATCACGCTTGCTCTGGTGACAGGGCACGTAGGGGGAGAGACCCGGATCATCAAAGGTTACCCGTGCCTGCCTCACTCCCAGCCCTGGCAAGTGGCCCTGTTCCAGAAGACACGACTGCTGTGCGGGGCGACCCTCATCGGCCCCCAATGGCTCCTGACCGCAGCCCACTGCCGCAAGCCGTGGATGTCTCTCACGNCCCCTCCGCATCTCCCCCACCTCTCCACCTCTGATTGCCCTCTCTCTCTCTGCAGCCATTACCGGGTCCTCCTGGGGGAGCACAACTTGAATCGGGAGGATGGCTGTGAGCAGAGGCAGACGGCCACCGAGTCCTTCCCCCACCCCGACTTCAACAACAGCCTCCCCAACAAGGACCACCGCAACGACATCATGCTCGTGAAGCTGCCCAGGCCGGCCGTCATCACCCAGGCCGTGCGACCCCTCTCCCTGCCTTCGCACTGTGTCACCGCTGGCACCAACTGCCTCATTTCCGGCTGGGGCACCACATCCAGCCCCCAGTTGCATCTGCCCCACACCTTGCGGTGCACCAACATCTCCATCATGAAGCACGAGGAGTGTGAGCGTGCCTACCCCGGCAACATCACAGACACCATGGTGTGCGCCAGCGTGCGGCAAGAGGGCAAGGACTCCTGTCAGGGTGACTCTGGGGGCCCTCTGGTCTGTAACCAGTCTCTCCAAGGCATTATCTCCTGGGGCCAGGACCCATGTGCAGTTTCCAGAAAGCCCGGTGTCTACACAAAAGTCTGCAAATATGTGGACTGGATTCAGAAGATTATGCACAACAATTAG

XM_004866771.1 Coding sequence

Klk9 kallikrein-related peptidase 9

Length: 756 bp    Location: 3757719..3762739   Strand: +
>XM_004866771.1
ATGAAGCTGGGGTTCGCCTGGGCTCTGCTCTCCCTTCTGGCTGGGCACAGCTGGGCAGACACCCGGGCCATCGGAGCCAAGGAATGTCCCCGAAACTCACAGCCCTGGCAGGCTGGCCTCTTCTTCCTCACCCGGCTCTTCTGTGGGGCAACCCTCATCAGTGACCGCTGGCTGCTCACAGCTGCCCACTGCCGAAAGTCGCGCCTGTGGGTCCGCCTTGGGGAGCACCACCTCTGGCAGTGGGAGGGTCCAGAGCAGCTGTTCCTGGCCAGAGACTTCTTCCCCCACCCCGGGTTCAACAGTGACCTCAGCGCCAATGACCACAACCATGACATCATGCTGATCCGGCTGCCCAGGCGGGCGCGTCTGGGGCCTGCCGTGCAGCCCCTCAACATCAGCAAGACCTGCATCTCCCCAGGCACGAAGTGCCTCATCTCAGGCTGGGGGGCGGTGTCCAGTCCCAAGGCGCAGTTCCCGCTCACGCTGCAGTGTGCCAACATCAACATCCTGGAGCCCACGCTCTGTCACTGGGCGTATCCGGGCCACATCTCAGACACCATGATCTGTGCAGGCCAGTGGGAAGGGGGCCGGGGCTCCTGCCAGGGTGACTCTGGGGGCCCCTTGGTCTGCAATGGGACCCTAGCGGGCGTTGTGTCTGGGGGCGGCGAGCCCTGCTCCAGACCCCAGCGACCCGCCGTCTATACTGGAACATGTCACTATTACGACTGGATTAAGAAAACCATGGAGGAAAACTGA

XM_004866781.1 Coding sequence

Klk6 kallikrein-related peptidase 6, transcript variant X4

Length: 744 bp    Location: 3785644..3793074   Strand: +
>XM_004866781.1
ATGGCCATGAAGATGCTGACCGTGGCCCTGGTTCTCCTGGCTGGAGCCTTCGCAGAGGAGCAGGAGAAACTGGTGCACGGAGGGCCCTGCCACAGGGACTCTCACCCCTACCAAGCTGCTCTCTACAACTCGGGCCACCTGCTCTGCGGCGGGGTCCTCATCGACCCGGAGTGGGTTCTCACGGCTGCCCACTGCAAAAAAGAGAAGCTTCATGTCTACCTAGGGAAGCACAACCTTCGACAGTCGAAGAATACAGAGGACATTTCTGTGATCAAGACTGTGGTCCACCCTGGCTACAATCCTGCCACCCATGACCAGGACATCATGTTGTTGCGTCTGTCCAAACCTGCCAAGCTCTCCGACTGGATCCAGCCACTGCCTCTGGAGAGGGACTGTGGGGCCAGATCACCCCGCTGCCACATCCTGGGCTGGGGCAAGACAGAACAAGGTGTCTTTCCTGACACCATCCAGTGTGCCTATGTCCACATCGTGCCCCAGGAGAAGTGCGATCAGGCCTACCCCGGCCAGATCACCAGGAACATGGTGTGTGCTGGAGATCCGGAAGAAGGAAAGGATGCCTGCCAGGGTGACTCCGGGGGCCCACTGGTCTGTGGAGGCCGCCTCCGGGGCCTGGTGTCCTGGGGTAACGTCCCCTGCGGATCCAAGGAGAAGCCAGGAGTCTACACTGACGTCTGCAGATACGTCAGCTGGATCCAAAGAACCATGCGAGGCCACTGGCCCTGA

XM_004866782.1 Coding sequence

Klk5 kallikrein-related peptidase 5

Length: 873 bp    Location: 3796532..3803978   Strand: +
>XM_004866782.1
ATGGCCAGAGCAGGAGATATCCGGATGTGGATGCTGGGTACCCTGATCACGGCCCTGATTCTGGGGGCCACAGAGCCTGTCCTTGCAGATGACGCCTCCTGTAACAACCCATCCGGCGGCAACCGGGTCCTTGGAGGCGAGGCCGAGGCCGGGGAGGACACCAGGTCCAACGACGAGGGCAGCAGCAGCCGCATCGTGAACGGGTCCGACTGCAAGAGGGACTCGCAGCCCTGGCAGGGCGCCCTGCTGCTGGCGCCCAGCAAGCTGTACTGCGGGGCGGTGCTGGTGCACCCCCAGTGGCTGCTGACCGCCGCGCACTGCCGGAAGCCGGTTTACAGGATCCGTCTCGGCCACCACTCTATGTCTCCCGTCTATGAGTCTGGACAGCAGATGTTCCGGGGCGTCAAATCCATCCCCCACCCTGGCTACTCCCACCCTGGCCACTCCAATGACCTCATGCTCATCAAACTGAACAAAGAAATCCAAGTCAGCCGCTCGGTCAGGCCTGTCAACATCACCTCCCACTGCCCCGCCCCCGGGACCCAGTGCCTGGTGTCAGGCTGGGGCAGCACCAGCAGCTTCCAGCACATCTTCCCCAGGACGCTCCAGTGCCTAAACATCAAAGTGCTGAGCCAGGAGAGGTGCAAGGACGCCTACCCCGGACAGATAGATGACACCATGTTCTGTGCCGGCGACGAGGATGCCAGAGACTCCTGCCAGGGCGACTCCGGGGGTCCCGTGGTGTGCAACAGCTACCTGCAGGGCCTGGTGTCCTGGGGTGACTTCCCCTGTGCCCAGCCCAACAGACCGGGCGTCTACACCAACCTCTGCCACTTCAACAAGTGGATCCACAACACCATCAAGAACAACTGA

XM_004866784.1 Coding sequence

Klk15 kallikrein-related peptidase 15, transcript variant X1

Length: 756 bp    Location: 3862479..3867187   Strand: +
>XM_004866784.1
ATGTGGCTCCTGCTCACCTTCTCCTTCCTGCTGATGTCTGCAGCAGCCCAGGACAGTGATGAAGAGTGTGCGCCCCACTCCCAGCCGTGGCAAGTGGCCCTCTTCGGGCGTGGACGCTTCAACTGCGGGGCTTCCCTCATCTCCCCGCGCTGGGTGCTGACTGCTGCCCACTGCCAGACCCGCTTCATGACAGTGCGCCTGGGTGAGCACAACCTGCGCAAGCGCGATGGCCCTGAGCAGCTGCGTCTTGTTTCGCGCATCATCCCACATCCGGGCTACAAAGCGCGAAGCCACCGCCATGACGTCATGCTGCTCCAGTTAGCTCGGCCCGCACGTCTGACCCGCCAGGTGCGACCAGTGCCTCTGCCCACGCGTTGCCCGCAACCTGGTGAGCCCTGCGTGGTGTCCGGCTGGGGCCTGGTGTCAGACAACAAGCCAGAGACCACAGGAAGCTCTGAGTCACAAGTGACCCTCCCAGATACCCTGCACTGTGCCAACATCAGCGTTATCTCCCAAGCGTCTTGTAACAAGGACTACCCAGGGTACCTGATGGACACCATGGTGTGCGCCACAGTGGAGGGCAGAGGCACGGACTCCTGTGAGGGTGACTCCGGGGGACCCATGGTCTGTGGGGGTGCCCTGCAGGGCATTGTGTCCTGGGGCGACGTACCTTGTGACACTACCACCAAGGCTGGTGTCTACACCAAAGTATGCCGCTACTTGCAGTGGATCAGGGAAACCATGAAGAGGAACTAA

XM_004866790.1 Coding sequence

Shank1 SH3 and multiple ankyrin repeat domains 1, transcript variant X2

Length: 6435 bp    Location: 3932308..3978630   Strand: +
>XM_004866790.1
ATGACCCACAGCCCCGCGACAAGCGAGGACGAGGAACGCCACAGTGCCAGCGAGTGTCCCGAGGGGGGCTCAGCGTCCGACAGCTCCCCAGACGGGCCAGGGCGAGGCCTCCGGGGGACCCGGGGCCAGGGCAGTGGGGCACCTGGTAACCTGGCCTCGGCCCGAGGCCTCCAGGGCCGCTCCATGTCTGTCCCTGACGACGCCCACTTCAGCATGATGGTCTTCAGGATTGGCATCCCGGACCTGCACCAGACAAAATGCCTGCGCTTCAACCCCGATGCCACCATCTGGACAGCCAAGCAGCAGGTGCTCTGCGCCCTGAGCGAGAGCCTGCAGGACGTGCTCAACTACGGCCTCTTCCAGCCGGCCACCTCCGGCCGCGACGCCAACTTCCTGGAGGAGGAGCGGCTGCTACGGGAGTACCCCCAGTCCTTCGAGAAGGGGGTCCCCTACCTGGAGTTCCGATACAAGACCCGAGTTTACAAACAGACCAACCTGGACGAGAAGCAGCTGGCCAAGCTGCACACGAAGACAGGGTTGAAGAAGTTCCTGGAGTATGTGCAGCTCGGGACGTCTGACAAGGTGGCGCGACTGCTGGACAAGGGGCTGGACCCCAACTACCACGACTCGGATTCGGGAGAGACCCCCTTGACTCTAGCGGCCCAGACTGAAGGCTCTGTAGAGGTGATTCGAACTCTGTGCCTGGGTGGAGCCCACATTGACTTCCGGGCCCGGGATGGCATGACAGCGCTGCACAAGGCCGCGTGTGCCCGACACTGCCTGGCGCTCACGGCACTCCTGGACCTCGGGGGATCCCCCAACTACAAGGACCGCCGGGGCCTAACCCCTCTGTTCCACACCGCCATGGTGGGGGGGGACCCCCGCTGCTGCGAGCTGCTTCTGTACAACAGAGCCCAGCTGGGCATAGCAGACGAGAATGGCTGGCAGGAGATTCACCAGGCCTGTCAGCGGGGCCACTCTCAGCACCTGGAGCACCTGCTCTTCTACGGGGCTGAGCCTGGAGCCCAGAATGCCTCGGGGAACACGGCCCTGCACATCTGTGCTCTCTACAACAAGGAGACCTGCGCCAGGATCCTCCTGTATCGAGGGGCCAACAAGGATGTGAAGAATAATAGCGGACAGACACCCTTTCAGGTGGCAGTGATTGCTGGGAACTTCGAGCTAGGGGAGCTCATCCGGAACCATCGGGAGCAGGATGTGGTGCCCTTTCAGGAGTCCCCAAAGTACGCGGCTCGGCGACGGGGACCCCCAGGGGCAGGGTTGACAGTGCCCCCTGCGCTGCTCAGGGCCAACAGCGACACCAGCATGGCGCTGCCCGACTGGATGGTGTTCTCTGCCCCGGGGCCCTCACCCTCCGGGGCCCCGGGCCCTACCTCAGGGCCCCAGGTCCAGTCACAGCCCTCAGCCCCCAGCACCAAGCTCAGCAGCGGGACCCTCCGAAGTGCCAGCAGCCCTCGGGGCGCCAGGGCCCGGTCCCCATCCCGAGGGAGGCACCCCGAGGATGCCAAGAGGCAACCCCGAGGACGGCCCAGCTCCAGCGGGACGCCCCGGGAAGGGCCTGCCGGGGGAACGGGGGGCTCCGGGGGTCCTGGGGGCTCCCTGGGCAGCCGAGGCCGAAGGAGGAAACTCTACTCAGCAGTCCCTGGACGCTCCTTCATGGCTGTGAAGTCGTACCAGGCCCAAGGCGAGGGCGAGATCTCCCTGAGCAAGGGCGAGAAGATCAAAGTGCTCAGCATCGGGGAAGGAGGCTTCTGGGAAGGGCAGGTCAAAGGTCGAGTAGGCTGGTTCCCCTCTGACTGCCTGGAAGAGGTGGCAAACCGCTCCCAGGAGGGAAAGCAAGAGAGCCGCAGCGACAAGGCAAAGAGACTCTTCCGACATTATACCGTGGGCTCCTACGACAGCTTCGATGCCCCAAGCTTGATGGATGGGATTGGCCCAGGGAGCGATTACATCATTAAGGAGAAAACAGTCTTGCTGCAGAAGAGGGACAGCGAGGGGTTTGGGTTCGTGCTCCGGGGGGCCAAGGCGCAGACCCCCATCGAGGAGTTCACCCCTACCCCGGCCTTCCCGGCGCTGCAGTACCTCGAGTCCGTGGACGAGGGGGGCGTGGCATGGCGGGCTGGACTGCGAATGGGAGACTTCCTCATCGAGGTGAACGGGCAGAATGTGGTGAAGGTCGGCCACCGCCAGGTGGTGAACATGATCCGCCAAGGGGGCAACACGCTCATGGTGAAGGTGGTGATGGTCACCAGGCACCCGGACATGGACGAGGCCGTCCACAAGAAAGCACCCCAGCAGGCGAAGCGGCTCCCGCCCCCAGCGATCTCCCTGCGCTCCAAGTCAATGACCTCCGAGCTGGAGGAAATGGTCTCCCCCTGGAGGAAGAAGAGCGAGTATGAGCAACCTCCTACGCCGGTGCCCAGCATGGAGAAAAAGCGGACAGTGTATCAGATGGCTCTCAACAAACTGGACGAGATACTGGCTGCAGCCCAGCAGACTATCAGCGCGAGCGAGAGCCCTGCGCCGGGAGGCCTGGCGTCCCTGGGCAAGCACCGGCCCAAAGGCTTTTTCGCCACCGAGTCAAGCTTCGATCCCCATCACCGCTCCCAGCCAAGTTACGAGCGCCCTTCCTTCCTGCCTCCTGGACCTGGGCTCATGCTCCGACAAAAATCTATCGGGGCTGCAGAGGATGACAGACCGTACCTAGCACCCCCAGCCATGAAGTTCAGCCGCAGCCTGTCTGTGCCGGGCTCGGAGGACATCCCCCCGCCGCCCACCACGTCCCCACCAGAGCCCCCGTACAGCACACCCCCGGCCCCCTCCTCCTCGGGCCGCCTCACCCCGTCCCCGCGGGGAGGCCCCTTCAACCCCGGCTCCGGGGGACCCCTCCCCGCCTCCTCCCCAGCGTCCTTTGACGGCCCCTCCCCTCCCGACACGCGCGTGGGGGGCCGGGACAAGAGCCTGTACCACGGTGGCCCCTTGCCCCCTGCGCACCACCACCACCACCACCACCACCACCACCACGCGCACCCGCCGCACCCGCCCGAGATGGAGACGGGCGCCCCCGACGACGCCCCGCCACGCCTGGCTCTGGGGCCCCAGCCCAGCCTGCGGGGCTGGAGGGGCGGCGGGCCCAGCCCGAGCCCGGGGGCGCCCTCACCGTCGCACCACGCGGGGGCTGGCGCCGGGGGCGCCCCGCAAGCCCCGGCCCTGCGCTACTTCCAGCTGCCGCCGCGCGCCGCTAGCGCCGCCATGTACGTGCCCGCGCGCTCCGGCCGCGGCCGCAAGGGGCCGCTGGTCAAGCAGACCAAGGTGGAGGGCGAGCCGCACAAGGGCGCCCTGCCTCCCGCCGCGCCCGGGTCCCCCGCGTCGCCGCAGCCGCTGCCCCCCGCGCCCGCGCCGGCCGAGAAGAACTCCATCCCCATCCCCACCATCATCATCAAGGCTCCGTCCACCAGCAGCAGCGGCCGCAGCAGCCAGGGCAGCAGCACCGAGGCCGAGCCGCCCACCCAGCCCGAGACCCCCGCAGGCGGCGGGGGCTCGTCATCCAGCCCAGCGCCGCCCCTGTCGCCCGTGCCGCCCTCGCCGTCGCCCGTGCCCACGCCCGCGTCGCCCAGCGGCCCGGCCACCCTGGACTTCACCAGCCAGTTCGGGGCGGCGCTGGTGGGCGCGGCGCGCAGGGATGGCGGCTGGCAGAACGAGGCCCGCCGGCGCTCCACGCTCTTCCTTTCCACGGACGCGGGAGACGAGGAAGGCGGCGAAGGCGGGCTGGGCGCCGGGGCCACCCCGGGCCCGCGGCTGCGCCACTCCAAGTCCATCGACGAGGGCATGTTCTCCGCCGAGCCCTACCTCCGCCTGGAGTCTGCGGGCGGCTCGGGGAGCTCCGGCTACGCGGGCTACTCGGCGGGCGCACGCGCCTACGCGGGCAGCGGGGCCAGCAGCGCCTTCTCCAGCTTCCTGCCCCCGCGGCCCCTGCTGCACCCGCTCACCGGCAAGGCCCTGGACCCGGCCTCCCCGCTCGGGCTGGCGCTGGCCGCCCGTGAGCGCGCGCTGAAGGAGTCCTCAGAGGGCGGCGGCGCCCCCCAGCCCCCGCCCCGCCCCCCCTCGCCCCGCTACGACGCGCCGCCGCCCACCCCGCATCACCACTCGCCCCACGCGCACCACGAGCCCGTGCTGCGCCTCTGGGGGGCGCCGCCGCCCGACCCCCCGCGCCGGGAGCTGGGCTACCGAGCGGGGCTGGGCGGGCCAGAGAAGCCGCTCCCCGCCAGCCCACCCGCCGCGCGGCGCTCGCTGCTGCACCGCCTGCCGCCCACGGCGCCCGGCGTGGGGCCCCTGCTGCTGCAGCTGGGGCCCGAGCCTCCCGCCCCACACCCCGGGGTCAGCAAGGCCTGGAGGTCTGGAGGCGCGGAGGAGCCTGAGCGGCTACCCCTCCACGTGCGCTTCCTCGAGAACTGTCAGCCGCGCGCCAGGCCGGCGGCGGTCTCCAGGGGGCCCTCGGCGGAGGATGGGCCCGGGGTCCCGCCGCTCAGCCCGCGCCGCTCCGTGCCCGCCTGTCCCACGTCCCCGCGGGGCGGCGAGGAGAATGGGCTCCCTCTGCTCGTGCTGCCGCCGCCGGCCCCGTCGGTGGACGCGGACGACGGTGACTTCCTCTTTGCGGAGCCGCTTCCCCCACCCCTCGAGTTTTCCAACAGCTTCGAGAAGCCGGAGTCGCCCCTCACGCCGGGCCCCCCCCAGCCGCTCCCGGACCCCCCTGCTCCAGTCACCCCCCTGCCCCCCGTGCCCCCCCCGGCGGCAGCCGCCCCTGGCCCGCCCGCCCTGGACTCCACTGCATCCAGCCTGACGTCCTATGACAGCGAGGTGGCCACGCTCACTCAGGGGCCCCCCGCGGCTCCCGGGGACCACCCCACCCCAGGCCCGCCGGCCCCAGCGGCCCCAGCGCCCCCCGCCCCGCAGCCGGGCCCAGATCCGCCACCGGGCACGGACTCCGGGATCGAGGAGGTGGACAGTCGCAGCAGCAGTGACCACCCCTTGGAGACCATCAGCAGCGCGTCCACGCTGAGCAGCCTGTCTGCCGAGGGCGGGGGCGGGGTGGCCAGCGGGCCTGAGCTGCTGGACACCTACGTGGCCTACTTGGACGGCCAGGCCTTCGGGGGCAGCGGGCCGCCGTATCCCCCGCAGCTCACGACTCCCTCGAAGCTCCGAGGCCGGGCGCTGGGGGCAGCCGGAGGCCTTCGACCCGGCCCCAGTGGCGGGCTCCGAGACCCTGTCACCCCCACCAGCCCCACGGTCTCTGTGACTGGGGCCGGAAACGACGGGCTGCTGGCCCTGAGCGCCTGTTCGGGGCCCTCTTCGGCAGGCGTGGCCGGGGGCCCGGTATCGGTGGAGCCGGAAGTCCCCCCGGTGCCCTTGCCTGCCGCCGCCTCCCTGCCTCGGAAGCTACTGCCCTGGGAGGAGGGCCCGGGCCCGCCACCACCACCCCTGTCTGGGCCCCTGTCCCAGCCTCAGGCCTCCGCCTTGGCCACCGTCAAAGCCAGCATCATCAGCGAACTCAGCTCCAAGCTCCAGCAGTTCGGGGGCTCCTCAGCAGCTGGAGGGGCTCTGCCTTGGGCCCGGGGAGGCAGCGGGGGCACTGGGGACAGCCACCACGGTGGAGCCGGCTACGTCCCCGAGAGGACCTCCTCCCTGCAGCGGCAGAGGCTCTCCGACGACTCCCAGTCCTCGCTCCTCCCCAAGCCCGTGGGCAGCCTGTTTCAGAACTGGCCCAAGCCACCTCTGCCGCCACTCCCCACTGGATCCGGGGTGTCGCCTTCAGCCACTGCACCCCCGGGGGCCATCTCACCTTCTGCTTCCTCCTCCTCCACCTCCTCCCGCCACCTCCAGGGCGTAGAGTTCGAGATGCGGCCCCCCCTGCTCCGCCGGGCCCCCAGCCCCTCGCTGCTGCCCGCCTCGGAGCACAAGGTCAGCCCAGCACCCAGGCCCTCGTCCCTGCCCATCCTGCCTTCAGGCCCTCTCTACCCGGGCCTCTTCGACATCCGCGGCTCCCCCACCGGTGGGGCGGGGGGCTCCGCGGACCCCTTCGCCCCTGTCTTCGTGCCGCCGCACGCGGGGATGTCCGGGGGCCTGGGAGGAGCCTTGTCGGGGGCCTCTCGCTCCCTGTCGCCCACCCGCCTGCTGTCGCTGCCCCCGGACAAACCGTTTGGCGCCAAACCTCTGGGCTTCTGGACCAAGTTCGATGTGGCCGACTGGCTAGAGTGGCTGGGCCTGGCCGAGCACCGGGCCCGCTTCCTGGACCACGAGATCGACGGCTCCCACCTGCCCGCCTTGACCAAGGAGGACTATGTGGACCTGGGGGTCACCAGGGTGGGCCACCGCATGAACATCGACCGGGCTCTCAAGTTTTTCCTGGAGAGGTGA

XM_004866793.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 591 bp    Location: 3986219..3978701   Strand: -
>XM_004866793.1
ATGCAGCCTGAGGTGGAGCCCCTGGGCTGCCCCAGCCTGGGCAACCCCAGCATGCACAGGGAGCCAGCTGCCCTCCTGGTGGACATGGAGGCCCCAGAAGAGATGCCACCTCGAAGCCTGGGGAGGCCTGTCAAATCCTCGAAGCAGTGCCTACAGCAGGTCGTTGCAGAATATGAGGCTCTGGACCGAGAGCTGCCATGCATACGGAAGTTCTCCACACCACCTGCCTCCCAGCCTCTCCGCCTTTGCATGGAGACCTTGGAGGATTTTACCCACGTGGAGGTGCTGGAGGCGCTGGAGGCCAAGTTACCTGGGGCCATGGAAAGCGGGCGCGTGAATAGCATACGCTTTGAGAACATGAACGTAATCTGTGGGACCNGCGGCCGCAGAGACCGGTGGCTCATCACCGTCGCTGACATTCAGACGCGCTCGCGCCTACTGCGCTCTGGGCTCAGCCCCCGCGGGCTGGAGCACCAGCTCGTGCTCCACGACGACCTACAGTAGGGCGACTACCGCTTGCACTTGCGCCGCTCGCTGGTCCGACGGCGCATGCTCGAGGCCCTGGGGTCGGAGCCAACCCAGGAAGACTGA

XM_004866795.1 Coding sequence

Syt3 synaptotagmin III, transcript variant X2

Length: 1758 bp    Location: 3991308..4003608   Strand: +
>XM_004866795.1
ATGTCTGGAGACTACGAGGAAGACCTCTGCCGGCGAGCGCTCATCCTGGTCTCAGAGCTCTGTGCGAGGTTCCGAGACACTGACACCAGAGACAGATGCCAGGAGTTCAACAGCCGGATCCCCGGCTACCCCCGGGGCCCCGACGCAGACATTTCTGTGAGTCTGCTGTCGGTCATCGTGACCTTCTGTGGCATTGTCCTTCTCGGCGTCTCCCTCTTCGTGTCCTGGAAGTTGTGCTGGGTGCCCTGGAGGGACAAGGGCGGCTCTGCGGTGGGCGGCGGCCCCCTGCGCAAAGACCTGGGCCCTGGTGTGGGGCTGGCAGGGCTGGTGGGCGGCGGACACCTGGGCACCGGCCTGGGCGGGCACCCTCTGCTGGGCGGCCACCACGCCCACGCCCACGCCGCCCAGCACCCGCCCTTCGCCGAGCTGCTGGAGCCGGGCGGCCTGGGGGGCTCCGACCCCCCCGAGCCCTCCTACTTGGACATGGACTCCTATCCCGAGGCTGCAGCCGCCGCTGTGGTGGCTGCCGGGGTCAAACCGAGCCAGACGTCGCCTGAGCTGCCCTCCGAGGCCGGGGCGGGCTCGGGGCTGCTGCTGCTGCCGCCCAGCGGTGGTGGCTTGCCCAGCGCCCAGTCGCATCACCAGGTCACAAGCCTCGCACCCAGCACCAGGTACCCAGCCCTGCCTCGGCCCCTCACGCAGCAGACCCTGACTACACAGTCAGACCCCAGCAGTGAGGAGCGGCCACCCGCCCTCCCCCTGCCTCTGCCCGGCGGTGAGGAGAAGGCCAAACTCATCGGCCAGATCAAGCCGGAGCTGTACCAGGGGACTGGGCCAGGTGGCCGGAGGGGCGGCGGAGGCTCAGGCGAGGCGGGGACCCCCTGCGGCCGCATCAGCTTTGCCCTGAGGTATCTGTACGGCTCCGACCAGCTGGTGGTGCGGATCCTGCAGGCCTTGGACCTCCCGGCCAAGGACTCCAATGGCTTCTCAGACCCCTACGTGAAGATCTACCTGCTACCCGACCGCAAGAAGAAATTTCAGACTAAGGTGCACAGGAAGACCCTGAACCCCGTCTTCAATGAGACGTTCCAGTTCTCGGTGCCCCTGGCTGAGCTGGCCCAGCGCAAGCTGCACTTCAGCGTCTATGACTTTGACCGCTTCTCGCGGCATGACCTCATCGGCCAGGTGGTGCTAGACAACCTCCTGGAGCTGGCTGAGCAGCCCCCCGACCGCCCGCTCTGGAGGGACATCATGGAGGGTGGCTCGGAAAAGGCAGATCTTGGGGAGCTCAACTTTTCACTCTGCTACCTCCCCACGGCCGGGCGCCTCACCGTGACCATCATTAAAGCCTCTAACCTCAAAGCGATGGACCTCACGGGCTTCTCAGACCCCTACGTAAAGGCCTCTCTGATCAGCGAGGGGCGGCGTCTGAAGAAGCGCAAAACCTCCATCAAGAAGAACACGCTGAACCCCACGTACAACGAGGCGCTGGTGTTCGACGTGGCCCCCGAGAGCGTGGAAAACGTGGGGCTCAGCATCGCCGTGGTGGACTACGATTGCATCGGGCACAATGAGGTGATCGGCGTGTGCCGCGTGGGCCCCGAGGCCGCCGACCCCCACGGCCGCGAGCACTGGGCCGAGATGCTGGCCAACCCGCGCAAGCCTGTGGAGCACTGGCACCAGCTGGTGGAGGAGAAGACTCTGACCAGCTTCACAAAAGGCGGCAAAGGACTATCAGAGAAGGAGAACTCAGAGTGA

XM_004866797.1 Coding sequence

Syt3 synaptotagmin III, transcript variant X4

Length: 1758 bp    Location: 3991490..4003608   Strand: +
>XM_004866797.1
ATGTCTGGAGACTACGAGGAAGACCTCTGCCGGCGAGCGCTCATCCTGGTCTCAGAGCTCTGTGCGAGGTTCCGAGACACTGACACCAGAGACAGATGCCAGGAGTTCAACAGCCGGATCCCCGGCTACCCCCGGGGCCCCGACGCAGACATTTCTGTGAGTCTGCTGTCGGTCATCGTGACCTTCTGTGGCATTGTCCTTCTCGGCGTCTCCCTCTTCGTGTCCTGGAAGTTGTGCTGGGTGCCCTGGAGGGACAAGGGCGGCTCTGCGGTGGGCGGCGGCCCCCTGCGCAAAGACCTGGGCCCTGGTGTGGGGCTGGCAGGGCTGGTGGGCGGCGGACACCTGGGCACCGGCCTGGGCGGGCACCCTCTGCTGGGCGGCCACCACGCCCACGCCCACGCCGCCCAGCACCCGCCCTTCGCCGAGCTGCTGGAGCCGGGCGGCCTGGGGGGCTCCGACCCCCCCGAGCCCTCCTACTTGGACATGGACTCCTATCCCGAGGCTGCAGCCGCCGCTGTGGTGGCTGCCGGGGTCAAACCGAGCCAGACGTCGCCTGAGCTGCCCTCCGAGGCCGGGGCGGGCTCGGGGCTGCTGCTGCTGCCGCCCAGCGGTGGTGGCTTGCCCAGCGCCCAGTCGCATCACCAGGTCACAAGCCTCGCACCCAGCACCAGGTACCCAGCCCTGCCTCGGCCCCTCACGCAGCAGACCCTGACTACACAGTCAGACCCCAGCAGTGAGGAGCGGCCACCCGCCCTCCCCCTGCCTCTGCCCGGCGGTGAGGAGAAGGCCAAACTCATCGGCCAGATCAAGCCGGAGCTGTACCAGGGGACTGGGCCAGGTGGCCGGAGGGGCGGCGGAGGCTCAGGCGAGGCGGGGACCCCCTGCGGCCGCATCAGCTTTGCCCTGAGGTATCTGTACGGCTCCGACCAGCTGGTGGTGCGGATCCTGCAGGCCTTGGACCTCCCGGCCAAGGACTCCAATGGCTTCTCAGACCCCTACGTGAAGATCTACCTGCTACCCGACCGCAAGAAGAAATTTCAGACTAAGGTGCACAGGAAGACCCTGAACCCCGTCTTCAATGAGACGTTCCAGTTCTCGGTGCCCCTGGCTGAGCTGGCCCAGCGCAAGCTGCACTTCAGCGTCTATGACTTTGACCGCTTCTCGCGGCATGACCTCATCGGCCAGGTGGTGCTAGACAACCTCCTGGAGCTGGCTGAGCAGCCCCCCGACCGCCCGCTCTGGAGGGACATCATGGAGGGTGGCTCGGAAAAGGCAGATCTTGGGGAGCTCAACTTTTCACTCTGCTACCTCCCCACGGCCGGGCGCCTCACCGTGACCATCATTAAAGCCTCTAACCTCAAAGCGATGGACCTCACGGGCTTCTCAGACCCCTACGTAAAGGCCTCTCTGATCAGCGAGGGGCGGCGTCTGAAGAAGCGCAAAACCTCCATCAAGAAGAACACGCTGAACCCCACGTACAACGAGGCGCTGGTGTTCGACGTGGCCCCCGAGAGCGTGGAAAACGTGGGGCTCAGCATCGCCGTGGTGGACTACGATTGCATCGGGCACAATGAGGTGATCGGCGTGTGCCGCGTGGGCCCCGAGGCCGCCGACCCCCACGGCCGCGAGCACTGGGCCGAGATGCTGGCCAACCCGCGCAAGCCTGTGGAGCACTGGCACCAGCTGGTGGAGGAGAAGACTCTGACCAGCTTCACAAAAGGCGGCAAAGGACTATCAGAGAAGGAGAACTCAGAGTGA

XM_004866796.1 Coding sequence

Syt3 synaptotagmin III, transcript variant X3

Length: 1758 bp    Location: 3991819..4003608   Strand: +
>XM_004866796.1
ATGTCTGGAGACTACGAGGAAGACCTCTGCCGGCGAGCGCTCATCCTGGTCTCAGAGCTCTGTGCGAGGTTCCGAGACACTGACACCAGAGACAGATGCCAGGAGTTCAACAGCCGGATCCCCGGCTACCCCCGGGGCCCCGACGCAGACATTTCTGTGAGTCTGCTGTCGGTCATCGTGACCTTCTGTGGCATTGTCCTTCTCGGCGTCTCCCTCTTCGTGTCCTGGAAGTTGTGCTGGGTGCCCTGGAGGGACAAGGGCGGCTCTGCGGTGGGCGGCGGCCCCCTGCGCAAAGACCTGGGCCCTGGTGTGGGGCTGGCAGGGCTGGTGGGCGGCGGACACCTGGGCACCGGCCTGGGCGGGCACCCTCTGCTGGGCGGCCACCACGCCCACGCCCACGCCGCCCAGCACCCGCCCTTCGCCGAGCTGCTGGAGCCGGGCGGCCTGGGGGGCTCCGACCCCCCCGAGCCCTCCTACTTGGACATGGACTCCTATCCCGAGGCTGCAGCCGCCGCTGTGGTGGCTGCCGGGGTCAAACCGAGCCAGACGTCGCCTGAGCTGCCCTCCGAGGCCGGGGCGGGCTCGGGGCTGCTGCTGCTGCCGCCCAGCGGTGGTGGCTTGCCCAGCGCCCAGTCGCATCACCAGGTCACAAGCCTCGCACCCAGCACCAGGTACCCAGCCCTGCCTCGGCCCCTCACGCAGCAGACCCTGACTACACAGTCAGACCCCAGCAGTGAGGAGCGGCCACCCGCCCTCCCCCTGCCTCTGCCCGGCGGTGAGGAGAAGGCCAAACTCATCGGCCAGATCAAGCCGGAGCTGTACCAGGGGACTGGGCCAGGTGGCCGGAGGGGCGGCGGAGGCTCAGGCGAGGCGGGGACCCCCTGCGGCCGCATCAGCTTTGCCCTGAGGTATCTGTACGGCTCCGACCAGCTGGTGGTGCGGATCCTGCAGGCCTTGGACCTCCCGGCCAAGGACTCCAATGGCTTCTCAGACCCCTACGTGAAGATCTACCTGCTACCCGACCGCAAGAAGAAATTTCAGACTAAGGTGCACAGGAAGACCCTGAACCCCGTCTTCAATGAGACGTTCCAGTTCTCGGTGCCCCTGGCTGAGCTGGCCCAGCGCAAGCTGCACTTCAGCGTCTATGACTTTGACCGCTTCTCGCGGCATGACCTCATCGGCCAGGTGGTGCTAGACAACCTCCTGGAGCTGGCTGAGCAGCCCCCCGACCGCCCGCTCTGGAGGGACATCATGGAGGGTGGCTCGGAAAAGGCAGATCTTGGGGAGCTCAACTTTTCACTCTGCTACCTCCCCACGGCCGGGCGCCTCACCGTGACCATCATTAAAGCCTCTAACCTCAAAGCGATGGACCTCACGGGCTTCTCAGACCCCTACGTAAAGGCCTCTCTGATCAGCGAGGGGCGGCGTCTGAAGAAGCGCAAAACCTCCATCAAGAAGAACACGCTGAACCCCACGTACAACGAGGCGCTGGTGTTCGACGTGGCCCCCGAGAGCGTGGAAAACGTGGGGCTCAGCATCGCCGTGGTGGACTACGATTGCATCGGGCACAATGAGGTGATCGGCGTGTGCCGCGTGGGCCCCGAGGCCGCCGACCCCCACGGCCGCGAGCACTGGGCCGAGATGCTGGCCAACCCGCGCAAGCCTGTGGAGCACTGGCACCAGCTGGTGGAGGAGAAGACTCTGACCAGCTTCACAAAAGGCGGCAAAGGACTATCAGAGAAGGAGAACTCAGAGTGA

XM_004866801.1 Coding sequence

Syt3 synaptotagmin III, transcript variant X8

High confidence: 4 potential gene matches
Length: 1758 bp    Location: 3991819..4003608   Strand: +
>XM_004866801.1
ATGTCTGGAGACTACGAGGAAGACCTCTGCCGGCGAGCGCTCATCCTGGTCTCAGAGCTCTGTGCGAGGTTCCGAGACACTGACACCAGAGACAGATGCCAGGAGTTCAACAGCCGGATCCCCGGCTACCCCCGGGGCCCCGACGCAGACATTTCTGTGAGTCTGCTGTCGGTCATCGTGACCTTCTGTGGCATTGTCCTTCTCGGCGTCTCCCTCTTCGTGTCCTGGAAGTTGTGCTGGGTGCCCTGGAGGGACAAGGGCGGCTCTGCGGTGGGCGGCGGCCCCCTGCGCAAAGACCTGGGCCCTGGTGTGGGGCTGGCAGGGCTGGTGGGCGGCGGACACCTGGGCACCGGCCTGGGCGGGCACCCTCTGCTGGGCGGCCACCACGCCCACGCCCACGCCGCCCAGCACCCGCCCTTCGCCGAGCTGCTGGAGCCGGGCGGCCTGGGGGGCTCCGACCCCCCCGAGCCCTCCTACTTGGACATGGACTCCTATCCCGAGGCTGCAGCCGCCGCTGTGGTGGCTGCCGGGGTCAAACCGAGCCAGACGTCGCCTGAGCTGCCCTCCGAGGCCGGGGCGGGCTCGGGGCTGCTGCTGCTGCCGCCCAGCGGTGGTGGCTTGCCCAGCGCCCAGTCGCATCACCAGGTCACAAGCCTCGCACCCAGCACCAGGTACCCAGCCCTGCCTCGGCCCCTCACGCAGCAGACCCTGACTACACAGTCAGACCCCAGCAGTGAGGAGCGGCCACCCGCCCTCCCCCTGCCTCTGCCCGGCGGTGAGGAGAAGGCCAAACTCATCGGCCAGATCAAGCCGGAGCTGTACCAGGGGACTGGGCCAGGTGGCCGGAGGGGCGGCGGAGGCTCAGGCGAGGCGGGGACCCCCTGCGGCCGCATCAGCTTTGCCCTGAGGTATCTGTACGGCTCCGACCAGCTGGTGGTGCGGATCCTGCAGGCCTTGGACCTCCCGGCCAAGGACTCCAATGGCTTCTCAGACCCCTACGTGAAGATCTACCTGCTACCCGACCGCAAGAAGAAATTTCAGACTAAGGTGCACAGGAAGACCCTGAACCCCGTCTTCAATGAGACGTTCCAGTTCTCGGTGCCCCTGGCTGAGCTGGCCCAGCGCAAGCTGCACTTCAGCGTCTATGACTTTGACCGCTTCTCGCGGCATGACCTCATCGGCCAGGTGGTGCTAGACAACCTCCTGGAGCTGGCTGAGCAGCCCCCCGACCGCCCGCTCTGGAGGGACATCATGGAGGGTGGCTCGGAAAAGGCAGATCTTGGGGAGCTCAACTTTTCACTCTGCTACCTCCCCACGGCCGGGCGCCTCACCGTGACCATCATTAAAGCCTCTAACCTCAAAGCGATGGACCTCACGGGCTTCTCAGACCCCTACGTAAAGGCCTCTCTGATCAGCGAGGGGCGGCGTCTGAAGAAGCGCAAAACCTCCATCAAGAAGAACACGCTGAACCCCACGTACAACGAGGCGCTGGTGTTCGACGTGGCCCCCGAGAGCGTGGAAAACGTGGGGCTCAGCATCGCCGTGGTGGACTACGATTGCATCGGGCACAATGAGGTGATCGGCGTGTGCCGCGTGGGCCCCGAGGCCGCCGACCCCCACGGCCGCGAGCACTGGGCCGAGATGCTGGCCAACCCGCGCAAGCCTGTGGAGCACTGGCACCAGCTGGTGGAGGAGAAGACTCTGACCAGCTTCACAAAAGGCGGCAAAGGACTATCAGAGAAGGAGAACTCAGAGTGA

XM_004866805.1 Coding sequence

LOC101723695 leucine-rich repeat-containing protein 4B-like, transcript variant X4

Length: 2127 bp    Location: 4032992..4062160   Strand: +
>XM_004866805.1
ATGGCGCGTGCCCACTCCCCGTGCCCCCCACTGCCGCCCGGTAGGATGTCCTGGCCCCACGGGGCGCTGCTCTTCCTGTGGCTCTTCTCCCCACCCCTGGGGGCCGGCGGGGGCAGCGTGGCCGTCGCAGCGGCCGCAGGAGGGGGCTCCCCACCGGCCACCTCCTGCCCAGCCGCCTGCTCCTGCAGCAACCAGGCCAGCCGGGTCATCTGCACTCGGAGAGAGCTGGCCGAGGTCCCTGCCAGCATCCCCGTCAACACGCGGTACCTGAACCTGCAGGAGAACGGCATCCAGGTGATCCGCACGGACACGTTCAAGCACCTGCGCCACCTGGAGATCCTGCAGCTGAGCAAGAACCTGGTGCGGAAGGTCGAGGTGGGCGCCTTCAACGGGCTGCCCAGCCTGAACACGCTGGAGCTCTTCGACAACCGGCTGACCACGGTGCCCACGCAGGCCTTCGAGTACCTGTCCAAGCTGCGGGAGCTCTGGCTGCGCAACAACCCCATCGAGAGCATCCCCTCCTACGCCTTCAACCGCGTGCCCTCGCTGCGCCGCCTCGACCTGGGTGAGCTCAAGCGGCTGGAGTACATCTCCGAGGCGGCCTTCGAGGGGCTGGTCAACCTGCGCTACCTCAACCTGGGCATGTGCAACCTCAAGGACATCCCCAACCTGACGGCCCTGGTGCGCCTGGAGGAGCTGGAGCTGTCGGGCAACCGGCTGGACCTGATCCGCCCCGGCTCCTTCCAGGGCCTCACCAGCCTGCGGAAGCTGTGGCTCATGCACGCCCAGGTGGCCACCATCGAGCGCAACGCCTTCGACGACCTCAAGTCGCTGGAGGAGCTCAACCTGTCCCACAACAACCTGATGTCGCTGCCCCACGACCTGTTCACGCCCCTGCACCGCCTCGAGCGCGTGCACCTCAACCACAATCCCTGGCACTGCAACTGCGACGTGCTCTGGCTGAGCTGGTGGCTCAAGGAGACGGTGCCCAGCAACACCACCTGCTGCGCACGCTGCCACGCGCCCGCGGGGCTCAAGGGTCGCTACATCGGCGAGCTGGACCAGTCGCACTTCACCTGCTACGCGCCCGTCATCGTGGAGCCGCCCACGGACCTCAACGTCACCGAGGGGATGGCGGCCGAGCTCAAGTGCCGCACGGGCACCTCCATGACCTCGGTGAACTGGCTGACGCCCAACGGCACGCTCATGACGCACGGCTCCTACCGCGTGCGCATCTCCGTGCTGCACGATGGCACGCTCAACTTCACCAACGTCACCGTGCAGGACACCGGCCAGTACACGTGCATGGTGACGAACTCGGCCGGCAACACCACGGCCTCCGCCACCCTCAACGTCTCCGCCGTGGACCCCGTGGCGGCCGGGGGCGGCGGAGCCCCGGGGGGCGGCGCTGGCGGCGTCACAGGGGGCAGCGGCGGCTACACCTACTTCACCACGGTGACGGTGGAGACGCTGGAGACGCAGCCGGGGGAGGAGGCGCTGCAGCCCCGCGGGACGGAGAAGGAGCCCCCGGGGCCCACGACTGACGGCGCCTGGGGCGGGGCGCGGCCCGGGGACGCCTTGGGCCCGGCCTCGTCGTCCACCACGGCGCCTGCGCCGCGCTCCTCGCGGCCCACGGAGAAGGCGTTCACGGTGCCCATCACGGACGTGACGGAGAACGCCCTCAAGGACCTGGACGACGTGATGAAGACCACCAAGATCATCATCGGCTGCTTCGTGGCCATCACATTCATGGCAGCGGTGATGCTCGTGGCCTTCTACAAGCTGCGCAAGCAGCACCAGATGCACAAGCATCACGGGCCCACGCGCACCGTGGAGATCATCAACGTGGAGGACGAGCTGCCCGCCGCCTCGGCCGTGTCCGTGGCCGCCGCCGCCGTGGCCGGGGGCGCGGGCGTGGGCGGCGACAGCCACCTGGCGCTGCCGGCTCTGGAGCGCGACCACCTCAACCACCACCACTACGTGACGGCCGCCTTCAAGGCGCACTACGGCGGCGCGGCGGGCGGCGGGGGCTGCGGGGGCAAAGGCCCGGCCGGCCTCAACTCCATCCACGAACCTCTGCTCTTCAAGAGCGGCTCCAAGGAGAACGTGCAAGAGACGCAGATCTGA

XM_004866803.1 Coding sequence

LOC101723695 leucine-rich repeat-containing protein 4B-like, transcript variant X2

Length: 2127 bp    Location: 4042519..4062160   Strand: +
>XM_004866803.1
ATGGCGCGTGCCCACTCCCCGTGCCCCCCACTGCCGCCCGGTAGGATGTCCTGGCCCCACGGGGCGCTGCTCTTCCTGTGGCTCTTCTCCCCACCCCTGGGGGCCGGCGGGGGCAGCGTGGCCGTCGCAGCGGCCGCAGGAGGGGGCTCCCCACCGGCCACCTCCTGCCCAGCCGCCTGCTCCTGCAGCAACCAGGCCAGCCGGGTCATCTGCACTCGGAGAGAGCTGGCCGAGGTCCCTGCCAGCATCCCCGTCAACACGCGGTACCTGAACCTGCAGGAGAACGGCATCCAGGTGATCCGCACGGACACGTTCAAGCACCTGCGCCACCTGGAGATCCTGCAGCTGAGCAAGAACCTGGTGCGGAAGGTCGAGGTGGGCGCCTTCAACGGGCTGCCCAGCCTGAACACGCTGGAGCTCTTCGACAACCGGCTGACCACGGTGCCCACGCAGGCCTTCGAGTACCTGTCCAAGCTGCGGGAGCTCTGGCTGCGCAACAACCCCATCGAGAGCATCCCCTCCTACGCCTTCAACCGCGTGCCCTCGCTGCGCCGCCTCGACCTGGGTGAGCTCAAGCGGCTGGAGTACATCTCCGAGGCGGCCTTCGAGGGGCTGGTCAACCTGCGCTACCTCAACCTGGGCATGTGCAACCTCAAGGACATCCCCAACCTGACGGCCCTGGTGCGCCTGGAGGAGCTGGAGCTGTCGGGCAACCGGCTGGACCTGATCCGCCCCGGCTCCTTCCAGGGCCTCACCAGCCTGCGGAAGCTGTGGCTCATGCACGCCCAGGTGGCCACCATCGAGCGCAACGCCTTCGACGACCTCAAGTCGCTGGAGGAGCTCAACCTGTCCCACAACAACCTGATGTCGCTGCCCCACGACCTGTTCACGCCCCTGCACCGCCTCGAGCGCGTGCACCTCAACCACAATCCCTGGCACTGCAACTGCGACGTGCTCTGGCTGAGCTGGTGGCTCAAGGAGACGGTGCCCAGCAACACCACCTGCTGCGCACGCTGCCACGCGCCCGCGGGGCTCAAGGGTCGCTACATCGGCGAGCTGGACCAGTCGCACTTCACCTGCTACGCGCCCGTCATCGTGGAGCCGCCCACGGACCTCAACGTCACCGAGGGGATGGCGGCCGAGCTCAAGTGCCGCACGGGCACCTCCATGACCTCGGTGAACTGGCTGACGCCCAACGGCACGCTCATGACGCACGGCTCCTACCGCGTGCGCATCTCCGTGCTGCACGATGGCACGCTCAACTTCACCAACGTCACCGTGCAGGACACCGGCCAGTACACGTGCATGGTGACGAACTCGGCCGGCAACACCACGGCCTCCGCCACCCTCAACGTCTCCGCCGTGGACCCCGTGGCGGCCGGGGGCGGCGGAGCCCCGGGGGGCGGCGCTGGCGGCGTCACAGGGGGCAGCGGCGGCTACACCTACTTCACCACGGTGACGGTGGAGACGCTGGAGACGCAGCCGGGGGAGGAGGCGCTGCAGCCCCGCGGGACGGAGAAGGAGCCCCCGGGGCCCACGACTGACGGCGCCTGGGGCGGGGCGCGGCCCGGGGACGCCTTGGGCCCGGCCTCGTCGTCCACCACGGCGCCTGCGCCGCGCTCCTCGCGGCCCACGGAGAAGGCGTTCACGGTGCCCATCACGGACGTGACGGAGAACGCCCTCAAGGACCTGGACGACGTGATGAAGACCACCAAGATCATCATCGGCTGCTTCGTGGCCATCACATTCATGGCAGCGGTGATGCTCGTGGCCTTCTACAAGCTGCGCAAGCAGCACCAGATGCACAAGCATCACGGGCCCACGCGCACCGTGGAGATCATCAACGTGGAGGACGAGCTGCCCGCCGCCTCGGCCGTGTCCGTGGCCGCCGCCGCCGTGGCCGGGGGCGCGGGCGTGGGCGGCGACAGCCACCTGGCGCTGCCGGCTCTGGAGCGCGACCACCTCAACCACCACCACTACGTGACGGCCGCCTTCAAGGCGCACTACGGCGGCGCGGCGGGCGGCGGGGGCTGCGGGGGCAAAGGCCCGGCCGGCCTCAACTCCATCCACGAACCTCTGCTCTTCAAGAGCGGCTCCAAGGAGAACGTGCAAGAGACGCAGATCTGA

XM_004866808.1 Coding sequence

LOC101725004 josephin-2-like, transcript variant X2

Length: 1425 bp    Location: 4063277..4070352   Strand: +
>XM_004866808.1
ATGCCCTGCCCAGGGGCGCCCTCTGCAGACCCACTGCCCATCTCTGGCCACTGGGGGCACCAGGGAGGTTCAGGCAGGGCCAAGGGTCAAATGTCCAAAGAGCAGCAGCTACGCAGCCTGCGTGGGGCACTGAGCAGGCAGGGAGGCCCAGCCGCAGAACACAAGACCCAAGGGCATGGCCCCTGCTGGGGTCCGGCGGAAGGTGGGGGTGGTGGGCTATGGCCGCCTGGGCACCCTGATCTGGTGGTAGAAGTGGCCCATCCCAAAATAATCCAGGAATCTGGGGCACACATCCTGCGCCATGCCAACCTCCTGGTGGGGTCCCCATCAGCCCTGGCTGACCAGACCACACAGCAGCAGCTCCTTGCCGCCTCCCACCACTGGGGCCACGCCATGTTTGTGGCTCGAGGAGCACTGTGGGGGACTGAGGACATCTCGAGATTGGATGCAGCCGGAGGCCTCCAGAGCCTTCGAGTCACCATGGCCACACACCCAGATGGCTTCCGGCTAGAGGGACCCCTAGCTACCACTCACAGCACTGGGCCTCGCACTGTGCTCTACGAAGGCCCTGTCCGTGGGCTCTGCCCCTTTGCTCCCCGAAACTCCAACACCATGGCAGCTGCTGCCCTGGCTGCCCCCAGCCTAGGCTTTGACAACGTGATCGGGGTGCTTGTGGCGGATCTCAGCCTCGCGGACATGCACGTGGTGGACGTGGAGCTGAGAGGACCCCCGGGGCCCACGGGCCGGAATTTCGCTGTGCACACCCACCGGGAGAACCCAGCGGAGCCAGGCGCTGTCACCGGCTCCGCCACTGTTGCTGCCTTCTGGCGCAGCCTCCTGGCAGGAGCCGAGGGCAGCATGTCCCAGGCCCCAGGAGCACGGCCGAGCCCACCCTCCGTGTACCACGAGCGGCAGCGCCTGGAGCTGTGTGCCGTCCACGCCCTCAACAACGTTCTGCAGCAGCAGCTCTTTAGCCAGGAGGCTGCCGATGAGATCTGCAAGAGGCTGGCCCCCGACTCCCGGCTGAACCCCCACCGCAGCCTCCTGGGTACCGGCAACTATGACGTCAACGTGATCATGGCGGCCCTGCAGGGGCTGGGCCTGGCCGCTGTATGGTGGGACCGCAGGAGGCCCCTGTCCCAGCTGGCCCTGCCCCAGGTGCTGGGGCTGATCCTGAACCTGCCCTCGCCCGTGTCGCTGGGGCTGCTGTCCCTGCCACTGCGCCGGCGGCACTGGGTGGCCCTGCGCCAGGTGGACGGCATCTACTACAACCTCGACTCCAAACTGCGGGCGCCGGAGGCCCTTGGGGACGAGGATGGTGTCAGGGCCTTTGTGGCGGCCGCCCTGGCCCGAGGGCTGTGTGAGGTGCTGCTGGTGGTGACCAAGGAGGTGGAGGAGAAGGGCTGCTGGCTGCAGACAGACTGA

XM_004866810.1 Coding sequence

LOC101725004 josephin-2-like, transcript variant X4

Length: 1155 bp    Location: 4063471..4066100   Strand: +
>XM_004866810.1
ATGCCCTGCCCAGGGGCGCCCTCTGCAGACCCACTGCCCATCTCTGGCCACTGGGGGCACCAGGGAGGTTCAGGCAGGGCCAAGGGTCAAATGTCCAAAGAGCAGCAGCTACGCAGCCTGCGTGGGGCACTGAGCAGGCAGGGAGGCCCAGCCGCAGAACACAAGACCCAAGGGCATGGCCCCTGCTGGGGTCCGGCGGAAGGACAGTCCCTCGTCTCCCGCCTTCTGGCTCAGGGATCTGAACTGGGCCTTGAACTTGTATTTGTCTGGAACCGAGACCCAGGCCGCATGGCAGGGAGCGTGCCCCCGTCCCTGCAGCTCCACAGCCTCACTGCCCTTGGGGAAAGGCACCCTGATCTGGTGGTAGAAGTGGCCCATCCCAAAATAATCCAGGAATCTGGGGCACACATCCTGCGCCATGCCAACCTCCTGGTGGGGTCCCCATCAGCCCTGGCTGACCAGACCACACAGCAGCAGCTCCTTGCCGCCTCCCACCACTGGGGCCACGCCATGTTTGTGGCTCGAGGAGCACTGTGGGGGACTGAGGACATCTCGAGATTGGATGCAGCCGGAGGCCTCCAGAGCCTTCGAGTCACCATGGCCACACACCCAGATGGCTTCCGGCTAGAGGGACCCCTAGCTACCACTCACAGCACTGGGCCTCGCACTGTGCTCTACGAAGGCCCTGTCCGTGGGCTCTGCCCCTTTGCTCCCCGAAACTCCAACACCATGGCAGCTGCTGCCCTGGCTGCCCCCAGCCTAGGCTTTGACAACGTGATCGGGGTGCTTGTGGCGGATCTCAGCCTCGCGGACATGCACGTGGTGGACGTGGAGCTGAGAGGACCCCCGGGGCCCACGGGCCGGAATTTCGCTGTGCACACCCACCGGGAGAACCCAGCGGAGCCAGGCGCTGTCACCGGCTCCGCCACTGTTGCTGCCTTCTGGCGCAGCCTCCTGGGTGCGGCCCTTCCTCCCCTGGCCCAGGTCCCTTCCCTGGGCCCAGGGCTCTTGTGCTCTGCGGAGCTTGGGTCTCAATCTCTGGTTCCAAGCTCGATTCCCTCTCCGCTGACCTTTATTCCTCATCTCCTGAACCTTCGCACTCCACCATCTGAATCTGTGTCCGTCTCTGTCCACGTCCCTTCTCTCGAGGTCTAG

XM_004866814.1 Coding sequence

Emc10 ER membrane protein complex subunit 10, transcript variant X1

Length: 1074 bp    Location: 4084852..4080893   Strand: -
>XM_004866814.1
ATGGTAATGGCAGCGTCCGGCGCGAGCGCATCCCGCTTGCTACTCCTCTTGCTGATAGTGGCAGCAGCGCCCAGTCGGGCCAGGGGCAGCGGCTGCCGGGCTGGGGCCGCTGCACGGGGGGTTGGGGCAGAAGGCCGTGAAGGGGAGAGCTGTGGCACCGTGGGGTTGCTGCTGGAGCACTCCTTTGAGATCGATGACGCTGCCCACTTCCGGAAGCGGGGCTCGCTGCTGTGGAACCAGCAGGATGGCACCTTGTCCCCGTCTCAGCGGCAGCTCAGTGAGGAGGAGCGGGGCCGGCTTCGGGACGTGGCAGCCCTGAATGGCCTGTACCGGGTGCGGGTCCCCAGACGGCCCGGGGCCCTCGACAGCTCAGAGGCTGGCGGCTATGTCTCTTCCTTTGTGCCTGCGTGCTCCCTGGTGGAGTCGCATCTCTCCGACCAGCTGACCCTGCACGTAGACGTGGCCGGCAATGTGGTGGGGGTGTCCGTGGTGACGGACCCCGGGGGCTGCCGGGGCCACGAGGTGGAAGACGTGGACCTGGAGCTGTTCAATACCTCGGTGCAGCTGCAGCCGCCGGGCACCGCCCCGGGCCCTGAGACAGCAGCCTTCATCGAGCGCTTGGAGATGGAGCAGGCCCAGAAGGCCAAGAACCCCCAGGAGCAGAAGTCCTTTTTCGCCAAATATGTGAGTGGGGGCCCTGGCCTCTCCGCTTCCTCACAGCCCCACCCAGCCTCCTCCCCTGTCCACACGCCCTTGCACGTCCATCCCTGTGCCCATCCGGTGCCTGGGCCGAGGACCGGAGCTGGGGGGTACAGGGCACAGGGATTTGTGGGCACAGCATGGAGGGGGAGACCAGGCAGGGACAGAGATGGGCCGGTGGCCTCACCCGAGCTGGGCTCCAGGAGGCAGGACAAGAGGGCTACAGAGGGTCAGCAAGGCCGGGCTGCCCGCGGGCTGAGGGTGCTGGCGGCCTGGGAAGCCCAGGGCAGCTGCTTGTGTCCTGACGGCCCACCAGCAGAGGCCCAGGGAAGGAGGCCCGGAGAGGCCCTGCCACGTGCTCTGGGGCCCCGCTGA

XM_004866819.1 Coding sequence

Fam71e1 family with sequence similarity 71, member E1, transcript variant X1

Length: 684 bp    Location: 4085012..4089655   Strand: +
>XM_004866819.1
ATGGCAGGACGCCTCCCGGTTCCAGCCTGTGCCCCGGAAGGTCCCGGGTGGCTCCAGCGCCACCTCCTGAGCGGCGAGTTCGACCAGCTGCGGGACTTCCCCATCTTTGAGAGCAATTTCGTGCAGGTGACCCGGTTTGGAGAAGTCGCCAATAAGGTCACCATGGGGGTGGCAGCCTCCAGTCCAGCCCTGGAACTCCCAGATCTGTTGCTGCTGGCTGGCCCTACCAAGGAGGACGGATGTCTGCAGCTTCACGGGCTTTTCCCCCTGCAGTTCGTCCAGCTCTTTGTCCACAAGGAAAGCCGCCAGCAGCTCAAGGTCAAGTTCTGCACCGGCCGCACCTTCTACCTGCAGCTGCGGGGCCCGGCCGAGACCCGGGACCTCGAGTTCAGCCAGTGGGTGCGGCTGCTGTACCGCCTGCGCTTCTACTCGGGCCAGGGGGCCGTGCCCTTCACGCAGCAGGAGTGGGGCGGCAGCAGGAGTGGGGGTACGAGGAGGAGACAGACGGGGACCAGGAGGAGCGGGAGAGGGGCTGGCGGGACCAGGCTCCGAGACACTCTCTCCCACCCAGCTTCAAGTCCGGGAAGCCAGGCTCAATCCACAGACCTCGGAACTCTGGGGACTCTGATTCTGCTGGGACCAGAGCTTGAAGCACCGACCCAGGCCACGCAGATGGATTATTAG

XM_004866820.1 Coding sequence

Fam71e1 family with sequence similarity 71, member E1, transcript variant X2

Length: 573 bp    Location: 4085012..4089655   Strand: +
>XM_004866820.1
ATGGCAGGACGCCTCCCGGTTCCAGCCTGTGCCCCGGAAGGTCCCGGGTGGCTCCAGCGCCACCTCCTGAGCGGCGAGTTCGACCAGCTGCGGGACTTCCCCATCTTTGAGAGCAATTTCGTGCAGGTGACCCGGTTTGGAGAAGTCGCCAATAAGGTCACCATGGGGGTGGCAGCCTCCAGTCCAGCCCTGGAACTCCCAGATCTGTTGCTGCTGGCTGGCCCTACCAAGGAGGACGGATGTCTGCAGCTTCACGGGCTTTTCCCCCTGCAGTTCGTCCAGCTCTTTGTCCACAAGGAAAGCCGCCAGCAGCTCAAGGTCAAGTTCTGCACCGGCCGCACCTTCTACCTGCAGCTGCGGGGCCCGGCCGAGACCCGGGACCTCGAGTTCAGCCAGTGGGTGCGGCTGCTGTACCGCCTGCGCTTCTACTCGGGCCAGGGGGCCGTGCCCTTCACGCAGCAGGAGTGGGGCGGCAGCAGGAGTGGGGCAGGCTCCGAGACACTCTCTCCCACCCAGCTTCAAGTCCGGGAAGCCAGGCTCAATCCACAGACCTCGGAACTCTGGGGACTCTGA

XM_004866818.1 Coding sequence

Mybpc2 myosin binding protein C, fast type

High confidence: 4 potential gene matches
Length: 3414 bp    Location: 4109057..4089427   Strand: -
>XM_004866818.1
ATGCCCGAGGCCAAACCAGCAGCCAAAAAGATCCCCAAAGGCAAAGATGCCCCCAAAGAAGCTCCCCCTAAGGATGCTCCTGCAGAGCCCCCAAAAGAAGCCCCACCTGAGGACCAGTCCCCCACTGCTGAGGAGCCCGGAGGCATTTTCCTGAAAAAGCCTGACTCTGTATCAGTGGAGACTGGAAAGGTTGCTGTCATAACGGCCAAGGTGAACGGGAAGGAGCTCCCGGACAAACCCACCATCAAGTGGTTCAAGGGCAAGTGGCAGGAGGTGGACAGCAAGAGTGGGGCCCGATTCTCCTTCAAGGAGTCCCACGACTCTGCCAGCAATGTGTACACCGTGGAGCTGCACATTGGGAAGGTGGTCCTGGGGGACCGGGGGGATTACCGCCTGGAGGTCAAAGCCAAGGACGCCTGCGACAGCTGTGGCTTCAGTATCGACGTGGAGGCGCCCCGTCAGGATGCCTCTGGGCAGAGCCTGGAGACTTTCAAGCGCACGGGTGAAGGGAAGTCAGAAGATGCAGGGGAGCTGGATTTCAGTGGCCTGTTGAAGAAGAGGGAGGTGGTCGAGGAGGAGAAGAGGAAGAAGAAGAAAGATGATGATGACTTGGGGATCCCCCCTGAGATCTGGGAACTCCTGAAAGGGGCCAAGAAGAGCGAGTACGAGAAGATCGCCTTCCAGTACGGCATCACGGACCTGCGCGGCATGCTGAAGCGGCTCAAGAAAGCCAAGGTGGAGGTCAAGAAGAGCGCAGCCTTCACGAAGAAGCTGGACCCCGCCTACCAGGTGGACAAGGGCAACAAGGTCAAGCTGATTGTGGAGATCAGCGACCCGGACCTTCCCCTCAAGTGGTTCAAGAATGGCCAGGAGATCAAGCCGAGCAGCAAGTACGTGTTTGAGAATGTGGGCAAGAAGCGGATCCTCACCATCAATAAGTGCACCCTGGCCGACGACGCTGCGTACGAGGTGGCCATCAAGGATGAGAAGTGCTTCACCGAGCTCTTTGTCAAAGAGCCCCCAGTCCTGATCATTACACCCCTGGAGGACCAGCAGGTGTTTGTGGGCGACCGGGTGGAGATGTCGGTGGAGGTGTCCGAAGAAGGTGCCCAGGTCATGTGGATGAAAGACGGCGTGGAAATGACGAAGGAGGACTCCTACAAGGCACGGTACCGCTTCAAGAAGGACGGCAAGCGGCACATCCTCATTTACTCGGACGTGACGCTGGAGGACGGCGGGCGCTTCCGGGTCATCACCAATGGCGGCCAGTGCGAGGCTGACCTCATCGTGGAAGAGAAACAGCTCGAAGTCCTACAAGACATCGCGGATCTGACGGTGAAGGCTGCGGAACAGGCCGTGTTTAAGTGCGAGGTGTCGGATGAGAAGGTGACAGGCAAATGGTACAAGAATGGGGTCGAGGTGCGGCCCAGCAAGAGGATCACCATCTCCCACGTTGGCAGGTTCCACAAGCTGGTGATCGATGACGTCCGCCCCGAGGACGAGGGAGACTACACATTCGTGCCCGATGGCTACGCGCTGTCCCTCTCAGCCAAGCTCAACTTCCTGGAAATCAAGGTGGAGTACGTCCCCAAGCAAGAGCCACCCAAGATCCACCTGGACTGCTCGGGGAAGACCTCCGATAACTCCATTGTGGTTGTGGCTGGCAACAAGTTGAGGCTGGATGTGTCCATCACAGGGGAGCCGCCTCCCACTGCCACCTGGCTGAGGGGAGATGAGGTGTTCTTGGCCACCGAGGGCAGGGTCCACATTGAGCAGCGGGTGGACTGCAGCAGCTTTGTGATCGAGAGCGCCGAGCGGGCAGACGAGGGCCGCTACACCATCAAAGTCGCCAACCCTGCGGGCGAGGACGTGGCCTCCATCTTCCTGCGGGTCGTGGATGTCCCGGACCCGCCGGAGGCTGTGCGTGTCACCTCGGTCGGAGAGGACTGGGCCATCCTGGTCTGGGAGCCGCCCAAGTGTGACGGGGGACAGCCGGTCACAGGGTACCTCCTGGAGCGGAAGAAGAAGGGCTCTCAGCGCTGGATGAAGCTGAACTTCGAGGTCTTCACGGAGACGACCTACGAGTCCACCAAGATGATCGAGGGCGTCCTCTATGAGATGCGGGTCTTCGCGGTCAACGCCATTGGCATCTCCCAGCCCAGCATGAACACCAAGCCCTTCATGCCCATCGCACCCACGAGCGCACCCCAGCACCTGATAGTGGAGGACGTGACAGACACCACCACCACGCTCAAGTGGCGGCCCCCGGACAGGATCGGGGCGGGCGGCATCGACGGCTACCTGGTGGAGTACTGCCTGGAGGGCTCCGAGGAGTGGGTCCCTGCTAACAAGGAGCCAGTGGAGCGCTGTGGCTTCACGGTCAAGGATCTCCCTACTGGGGCCAGGATCCTCTTCCGGGTCATCGGGGTCAACATCGCGGGCCGCAGTGAACCGGCTGCGCTGGTGCAGCCGGTCACCATCAGGGAGATCGTGGAGCAGCCCAAGATCCGCCTCCCCCGCCACCTGCGCCAGACCTACATCCGCAGAGTTGGGGAGCACCTCAACCTGGTCATCCCCTTCCAGGGCAAGCCGCGGCCCCAGGTGGCGTGGACAAAGGGCGGGGCCCCCGTGGACACCTCCCGCGTGCAGGTGCGCACCAGCGACTTCGACACCGTGTTCTTCGTGCGCCAGGCGGCCCGCTCCGACTCCGGGGAGTACGAGCTGACCGTGCAGATCGAGAACATGAAGGACGCGGCCACCATCCAAATCCGCGTCGTGGAAAAGGCAGGGCCCCCGGAGAACGTGATGGTGAAGGAGGTGTGGGGCACCAACGCGCTGGTGGGGTGGCAGCCCCCCAAAGACGACGGGAACAGTGAGGTCACGGGGTATTTCGTCCAGAAAGCCGACAAGAAGACCATGGAATGGTTCAACGTCTATGAACACACCCGGCACACCAGCTGTACTGTATCCGACCTCATCGTGGGCAACGAGTACTACTTCCGAGTGTTCAGTGAGAACATCTGCGGTCTCAGCGACTCGCCCGGGGTTTCGAAGAACACGGCTCGAATCCTTAAACAAGGAATCACCCTCAAATCACTTGATTATAAGGAGCATGACTTCCGGATGGCTCCCAAGTTCCTGACGCCCCTCATTGACCGGGTGGTTGTGGCTGGATACTCCGCAGCTCTCAACTGCGCCGTCAGAGGCGAACCGAAGCCAAAGGTGGTGTGGATGAAGAACAAGATGGAGATCGGTGAAGACCCCAAGTTCCTGATGACCAACTACCAGGGGGTCCTCACGCTCAACATCCGCCGGCCCTCGCCCTTCGACGCAGGCACCTACTCCTGCCGGGCCGTCAACGAGCTGGGGGAGGCGCTGGCTGAGTGCAGGCTGGATGTGCGAATGCCACAGTGA

XM_004866825.1 Coding sequence

Pold1 polymerase (DNA directed), delta 1, catalytic subunit, transcript variant X2

Length: 3315 bp    Location: 4135044..4117601   Strand: -
>XM_004866825.1
ATGGATGGCAAGCGGCAGCAGGGCCCAGGGGCCGGGGTGCCCCCAAAGCGGGCTCGAGGGGGCCTCTGGGACGAGGAGCCTCCGCCGTCCCACTTCGAGGAGGACCTGGCGCTGCTGGAGGAGATAGAAGCTGAGCACAGGTTGCGGGAGCAGGAGGAGGAGGCGCTGCAGCTGGCCGTGGAGCGGGCCACCGACGGGCAGCTCTCCACAGCCACTGACCCCCGCTGGTTTCGGCCTCCCCCACCCCCGCTGGACCCTCAGACGGAGCCCCTCATCTTCCAGCAGCTGGAGATCGACCACTATGTGGGTTCAGCACGGCCCCTGCCAGGGTGGACTCCGCCGTCCAGCAGCCACGTGCCGGTGCTGCGTGCCTTCGGGGTCACTGACGAGGGGGTGTCCGTCTGCTGCCACATCCACGGCTTTGCGCCCTACTTCTACGTCCCCGCGCCGCCCGGGTTCGGGGCTGAGCATCTGGCGGAGCTGCAGCGGGAGCTGAACACGGCCATCAGCCGAGACCAGCGCGGCGGCAAGGAGCTCAGTGGGCCGGCCGTGCTGGCGGTGGAGCTGTGCTCCCGGGAGAGCATGTTTGGGTACCATGGACACGGCCCCTCGCCCTTCCTGCGCATCACCTTGGCGCTGCCCCGCCTCGTGGCACCCGCGCGCCGCCTCCTGGAGCAGGGCGTCCGCGTGGCGGGCCTGGGCACCCCCAGCCTCGCGCCCTACGAGGCCAACGTGGACTTCGAGATCCGGTTCATGGTGGACACCGACATCGTGGGCTGCAACTGGCTGGAACTCCCAGCGGGAAGATACGTCCTGAGGCAGGAGGAGCAGGTCACCCTGTGCGCGCTGGAGGCCGACGTGCTGTGGTCCCATGTGGTCAGCCACCCCCCTGAGGGGCCGTGGCAGCGCATCGCACCCCTGCGCGTGCTCAGCTTTGACATCGAGTGCGCAGGCCGCAAAGGCATCTTCCCTGAGCCCGAGCGGGACCCCGTGATCCAGATCTGCTCCCTGGGCCTGCGCTGGGGCGAGCCGGAGCCCTTCTTGCGCCTCGCACTCACCCTTCGGCCCTGTGCCCCCATCCTGGGTGCCCAGGTGCAGAGCTTCGAGCGGGAAGAGGACCTGCTCCAGGCCTGGTCTGTCTTCGTGCGCACCATGGACCCTGATGTGATCACCGGCTACAACATTCAGAACTTTGACCTCCCCTACCTCATCTCTCGCGCCCAGACCCTCAAGGTGAAGGCCTTCCCCCTGCTGGGCCGCGTGGTTGGGCTCCCCTCCAGCCTGCGGGACTCTTCGTTCCAGTCGAGGCAGATGGGCCGGCGGGACAGCAAGGTGGTCAGCATGGTGGGCCGTGTGCAGATGGACATGCTGCAGGTGCTGCTGCGGGAGCACAAGCTACGCTCCTACACGCTCAACGCCGTGAGCTTCCACTTCCTGGGCGAGCAGAAGGAGGACGTGCAGCACAGCATCATCGCAGACCTGCAGAACGGGAATGACCAGACGCGCCGCCGCCTGGCCGTGTACTGCCTCAAGGACGCCTACCTGCCGCTGCGGCTGCTGGAGCGGCTCATGGTGCTGGTGAACAACGTGGAGATGGCGCGCGTCACCGGCGTGCCCCTCAGCTACCTGCTCAGCCGTGGCCAGCAGGTCAAGGTCGTGTCCCAGCTGCTGCGGCAGGCCATGCGTGAGGGGCTGCTGATGCCCGTGGTGAAGACGGAGGGCAGCGAGGACTACACAGGAGCCACTGTCATCGAGCCCCTCAAGGGATACTACGACGTCCCCATCGCCACCCTGGACTTCTCCTCGCTGTACCCATCCATCATGATGGCCCACAACCTGTGCTACACCACGCTGCTGCGGCCTGGGGCCGCCCAGAAGCTGGGCCTGGACTCAGACCAGTTCATCAAAACACCCACGGGGGATGAGTTCGTGAAGATGTCGGTGCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTGCTCAGCGCCCGGAAGAGGGCCAAGGCTGAGCTGGCGCAGGAGACTGACCCCCTGCGGCGGCAGGTGCTGGACGGGCGGCAGCTGGCCCTGAAGGTGAGCGCCAACTCCGTGTATGGCTTCACAGGCGCCCAGGTGGGGAAGCTGCCATGCCTGGAGATCTCGCAGAGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGTCCAAGTACACGGTGAAGAACGGCTACAGCACTGACGCCAAGGTGGTGTACGGTGACACGGACTCCGTCATGTGCCGCTTCGGCGTCTCCTCCGTGGCCGAGGCGATGGACCTGGGGCGCGAGGCCGCAGACTGGGTGTCAGGCCACTTCCCACCGCCCATCCGGCTGGAGTTCGAGAAGGTCTACTTCCCCTACCTGCTCATCAGCAAGAAGCGCTACGCTGGCCTTCTCTTCTGCTCCCGGCCCGACGGCCACGACCGCATGGACTGCAAGGGCCTGGAGGCCGTGCGGAGGGACAACTGCCCACTGGTGGCCAACCTTGTCTCGGCCTCCCTGCGCCGCCTGCTCGTTGACCGAGACCCCGAGGGCGCCGTGGCCCACGCCAAGGACGTCATCTCGGACCTGCTGTGCAACCGCATTGACATCTCCCAGCTGGTGATCACCAAGGAGCTGACCCGCGCAGCGGCCGACTACGCGGGCAAGCAGGCGCATGTGGAGCTGGCCGAGAGGATGAGGAAGCGGGACCCCGGCAGCGCGCCCAGCCTGGGTGACCGTGTCCCCTACGTGATCATCGGCGCTGCCAAGGGCGTGGCCGCCTACATGAAGTCAGAGGACCCCCTATTCGTGCTGGAGCACAGCCTGCCCATCGACACGCAATACTACCTGGAGCAGCAGCTCGCCAAGCCCCTGCTGCGCATCTTCGAGCCCATCCTGGGCGAGGGCCGCGCAGAGGCCGTGCTACTACGCGGCGACCACACGCGCTGCAAGACCGTGCTCACGGGCAAGGTGGGCGGCCTCCTGGCCTTCGCCACACGCCGCAGCTGCTGCATCGGCTGCCGCACGGTGCTCAGCCACGAGGGAGCCGTGTGCAAGTTCTGCCAGCCTCGGGAGTCAGAGCTGTACCAGAAGGAGGTGTCCCACCTGAACGCCCTGGAGGAGCGCTTCGCACGCCTGTGGACGCAGTGCCAGCGCTGTCAGGGCAGCCTGCATGAGGACGTCATCTGCACCAGCCGGGACTGCCCCATCTTCTACATGCGCAAGAAGGTGCGGAAGGACCTGGAGGACCAGGAGAAGCTGCTGCGCCGCTTCGGGCCCCCTGGCCCCGAGGCCTGGTGA

XM_004866828.1 Coding sequence

Nr1h2 nuclear receptor subfamily 1, group H, member 2, transcript variant X3

Length: 1368 bp    Location: 4140613..4136052   Strand: -
>XM_004866828.1
ATGTCTTCCCCCACCACGAGTTCCGTGGACAGTGCCCAGCCCGGAAATGCCCCCCCTCAGCCCAGCACCTCCTCCTCTTCACCCACTATAAAGAAAGAGGGCCCTGAGCCGTGGCTCGAGGGTCCGGACCCTGATGTCCCAGGCACCAATGGGGCCAGCTCGGCCTGCATCGTGGTCATCCTAGAACCAGATGAGGAGCCCGAGCCAGAGCGCAAGCGAAAGAAGGGCCCAGCTCCAAAGATGCTGGGCCACGAGCTCTGCCGCGTGTGTGGGGACAAGGCCTCTGGCTTCCACTACAATGTGCTGAGCTGCGAAGGCTGCAAAGGCTTCTTTCGGCGCAGCGTGGTCCATGGTGGAGCAGGGCGCTACGTCTGCCGGGGCGGTGGAACCTGCCAAATGGATGCCTTCATGCGGCGCAAGTGCCAGCAGTGCCGGCTGCGCAAGTGCAAGGAGGCGGGGATGAGGGAGCAGTGTGTCCTCTCGGAAGAACAGATCCGGAAGAAGAAGATTCAGAAGCAGCAGCAGCAGCAGTCACCTGTGGAGCCAAAGGGCAGTGGCAGCTCAGCCTGCGGGCCTGGGGCGTCCCTGGGAGGGTCCGAGCTGGGTGGCCAGGGCCCCGGCGAAGGCGAAGGTGTCCAGTTAACAGCAGCCCAGGAGCTCATGATCCAGCAGTTGGTGGCAGCCCAGCTGCAGTGCAACAAACGCTCCTTCTCTGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGTGCAGACCCGCAGTCCCGTGATGCCCGCCAGCAGCGCTTCGCCCACTTCACGGAGCTGGCCATCATCTCGGTCCAGGAGATCGTGGACTTTGCCAAACAGGTGCCTGGCTTCCTGCAGCTGGGCCGCGAGGACCAGATCGCCCTCCTGAAGGCGTCCACCATCGAGATCATGCTCCTGGAGACAGCCCGGCGCTACAACCATGAGACAGAGTGCATCACCTTTCTGAAGGACTTCACCTACAGCAAGGATGACTTCCACCGCGCAGGCCTGCAGGTGGAGTTCATCAACCCCATCTTCGAGTTCTCAAGAGCCATGCGGCGGCTGGGCCTAGACGACGCTGAGTACGCCCTGCTTATTGCTATCAACATCTTCTCTGCTGACCGCCCCAACGTGCAGGAGCCCAGCCGCGTGGAGGCGCTACAGCAGCCCTATGTGGAGGCGCTGCTGTCCTACACGCGCATCAAGAGGCCGCAGGACCAGCTCCGCTTCCCTCGAATGCTGATGAAGCTTGTGAGCCTGCGAACGCTCAGCTCTGTGCACTCAGAGCAGGTCTTCGCCCTGCGGCTGCAGGACAAGAAGCTGCCGCCTCTGCTCTCAGAGATCTGGGACGTCCACGAGTAG

XM_004867200.1 Coding sequence

Napsa napsin A aspartic peptidase

High confidence: 4 potential gene matches
Length: 1470 bp    Location: 4150366..4158523   Strand: +
>XM_004867200.1
ATGGAGATTAAAGGAGGGGGTGGGGACCGAGATGCCGCCACCCCCATGCGGGGCCAGGAGCCCGGACGGGCAGCTGTTGCCACCTGCAAACACTGCACACAGCCTGGAAACCCTATCCTCGCCCCCTCCCCGTGTCACTCCGAACCCCAGGGTGGGGCGTGGGCAGGGCTGAGTCTCAGGGCTCAGAAGAGGGGCCCCCGAGCCTGGGTCCTAGAGATGTCGTCACTACTGCTGTGGCCGCTGCTGCTGACCCTGCTCACCATGGAGCCCTCAGGGGCCGCCCTGGTCCGAGTCGAACTTCGCAGAGCCCACCTGCAACAGGGGATCCCGAACCCACTGCGGGCCTGGGCGGAGTCTACAGAGCCTTCCAGGCTGGGGCCCCCACCCAAAGGAGACAATCCCTTCTTGGTGCCTCTCTCCAAGTTCATGAATGTGCAGTATTTTGGGGAAATCGGGCTGGGAACGCCCCCACAAAACTTCTCCGTCGTCTTTGATACTGGCTCCTCCAACCTCTGGGTCCCCTCCAAGAGATGTCACTTCTTCAGTGTACCCTGCTGGTTCCACCACCGTTACGATCCCAAAGCCTCCAGCTCCTTCCGGCCCAACGGGACCAAGTTTGCCATCCAATATGGAACTGGACGGCTGAGCGGAATCCTGAGTGAGGACAAGCTGAATATCGGGGGAATCAGCAATGCATCGGTGACTTTTGGGGAGGCTCTGTGGGAGCCCAGCCTGGTCTTTGCTTTTGCCTCCTTCGATGGGATATTTGGCCTTGGCTTTCCCACTCTGGCTGTGGACAGAGTTCCACCTCCGCTGGATGTCCTGGTGGAGCAGGGGCTGCTGGAGAAGCCCATCTTCTCCTTTTACCTCAACAGGGACTTTGCAGGAGCTGATGGAGGCGAGCTGGTTCTGGGAGGCGCAGACCCAGCCCACTACATCCCACCCCTCACCTTCGTGCCGGTCACCGTCCCTGCCTACTGGCAGATCCACATGGAGCGAGTGAAGGTGGGCACGGGGCTGACTCTCTGTGCCCAGGGCTGTGCTGCCATCGTGGACACAGGCACGTCCCTCATCACGGGACCCTCTGAGGAGATCCGGGCCCTGCACAGGGCCATCGGGGGCCTTCCCTGGCTGGCTGGCGAGCACTTCATACTGTGCTCAAAAATCCCAACGCTACCCCCAGTCTCCTTTCTCCTTGGGGGGGTCTGGTTTAACCTCACGGCCCAGGACTACGTCATCCAGATTTCTCAGGGTGGCTTCCGCTTCTGCTTGTCCGGCTTCCACGCCTTGGATATGCCTCCGCCTGCAGGACCCCTCTGGATCCTCGGCGACGTCTTCTTAGGGGCCTACGTAGCGGTCTTCGACCGCGGGAGCACGAGCAGTGGCGCCCGAGTGGGCCTGGCGAGAGCTCGCGTTCCGGAAGCAGAGCCGGGAGGGGGCGGTACCGCGCAGGCGCAGTTCTCCGATTGA

XR_206149.1 Non-coding sequence

LOC101702516 PREDICTED: Heterocephalus glaber uncharacterized LOC101702516 (LOC101702516), misc_RNA.

Length: 1766 bp     
>XR_206149.1
GGAGGGTCAGGGCGCTGCGGGACGCGCGGCTCGGTCCCGGGCCCACCGCCTCCCGCTGCAGGTGTGCAGCTGGTTCGTATCTCCTCCCAACCCTCGCCCGCTCCCGTGCCTGTGTCTCTCGGTGTCCCTTTTTCTTCCCGATCTCTGAGTGTTTGTCCCGCCGCCTCTGTTCCTACCTGAGTCTGTGCCCCTCTTTTCTAGGGCTCTGCTCTCCCCGAGGGTCTCTGAACCTCCCTTCCTTTTCGGAGTCTCTATGCCTTTTCTCCCTTGGGCTCAGTCTCCTTTCCGCGGCTGTGACTTCATACCTTCCCCCTAGTCTTTTTGCGGGAGTCTCTGGACCCCCATTCCGCCGGGCGCCTGTCTCTCAGGTCTCTGCCCCGCTGGCCTCTGCTCTTTCATCTGGGCCTGGGTCCCCTCCATAGATCGCGGTCCCCTCCTGAGCGCTGTCTCCCTCTTCGCGGCTTGGCCCTCCACCTCTGCCTTTCATCTCTGGGAGGTCTCCCTGCCCTGGGTCGCTCTCCCTCCTGGTGTCTGTCCCTTCTTTGCGTCTCTGTGCTTTACTCCTTCCCAGGCTCCGCTCATTCACCTGGGTCGCTGGCTCCCCGGGTTCTCTGCCAGCCCCGGCTCCTCCCCTTCCCTGTCCCCCTGTGTACGAATCGCTGCCCTCTTTCCAGCTATCTAACTCCCTCTCTATGGGTCTCATCATTTTTTTTTTCTCTGTCCCCTCCCTGAGTCTCTCTTCCCCACCTCTCTCCCTTTCTAAATGTCTCTTTCTGGACGTCCCCTGTCTCTGGGCCTCTGTCCCCTTCTCTCAGGGCACCCCGCCCCACACACCCCGGTCTGACCCCCAGCCTGGCCGGGACTCCAGGCTGCGTCACTACGGAGAGTTGCAGAAGTGGGGCCCATCCTGCAGGCCAAGGAGGTGGTGCCCTCATTCCCCAGACCTCGGGCTCTCCCAGGACCCCAATCCAGGGAATGATCCTCGGGCAGCCCTCAAGCCTCTGATGGGACCCACCAGGGCCAAGGAAAGACCTGGGCACCACCTGTCCATGCCCCAAATTCTGGTGTGCCCCAGGCAGAAGCGGGCAACCCTGAGACCACCCCACCCCAGCTTTCCACTATCGGACTGCAGCCACACAGGAGATCAAGTGACCAAATCAGCGTTCTAGCAGAGGTCAGACGGCTACGTGGGGGATCTGTGAGTCTCGAGTCTCCGCCTGTCCCTTGGAGGGGATTTTGGGAGACAAGATGGACCCTGAGTTACAGGACACCCAGCTATGCTCACAGAGGAGGACACGGACTCCATGCTTGGCAACAGACACCAGGAGAGGAAAAGCTAATGCCTGTCCACTTCTTCTAATCTTTCCCCAGCCCTGCTCCCCCAATCTATCTTTTCCCGGACACTCAAAGCACAGAATTCCTGAAAGCTCCGAACTCCCAGCTCTGCCATCTCTGGAACTCCTTTCCAATCCTCCCTCCCTCCTTCCTCAGGGCCCGGCGATTGGGGATGGGTCTTCCCCTCCCTGATTTCCAAGACCTCTATTCTCATCGGTTCCAAATCCAGCAAAGGGAGTCTCACTAAAGCTGAAAATGTGAGGACTCGCCGCCTAAGATCTTTGATTGCTAAGACCTCCAAATACCTGGGTGCCCCAAAGCGTACAACCGAGCGGAGATCTCTCCGCTGTCATTTTTGGGTCCCATCTCCCAGTCCCCGCCTCCATAACTGGGATTCGAGTTGTCTTACGCCCCCCGCGGACCTGAACCTC

XM_004866833.1 Coding sequence

LOC101701949 potassium voltage-gated channel subfamily C member 3-like, transcript variant X2

Length: 2274 bp    Location: 4161068..4172955   Strand: +
>XM_004866833.1
ATGCTGAGCTCAGTCTGCGTCTCGTCCTTCCCCCGGCGCCAGGGGGCCAGCAAGCAGCAGCCGGCGCCACCACCGCAGCAGCCCGAGTCCCCGCCGCCGCTGTCCCCGCCACCGCCGCCGCCGCTGCAGCCTGCGCAGCCCGGCCCAGCCGCATCCCCGGCGGGCCCCCAGGCACCCCGAGGGCCCGGGGACCGCCGCGCCGAGCCATGCCCCGGGCTGCCAGCGGCGGCCATGGGGCGGCACGGCGGCGGCGGTGGCGACAGCGGCAAGATCGTGATCAACGTGGGCGGCGTGCGCCATGAGACGTACCGCTCGACGCTGCGCACCCTGCCGGGTACGCGGCTGGCCGGCCTGACGGAGCCCGAGGCGGCCGCGCGCTTCGACTACGACCCCGGCGCAGACGAGTTCTTCTTCGACCGGCACCCGGGCGTCTTCGCCTACGTGCTCAACTACTACCGCACGGGCAAGCTGCACTGCCCGGCCGACGTGTGCGGGCCGCTCTTCGAGGAGGAGCTGGGCTTCTGGGGCATCGACGAGACCGACGTGGAGGCCTGCTGCTGGATGACCTACCGGCAGCACCGCGACGCGGAGGAGGCGCTCGACTCCTTCGAGGCCCCGGACCCTGCGGGCGCCGCCAATGCCGCTGCCGCGGGAGCGCACGACACGGGCCTGGACGACGAGGCGGGCGCGGGCGGCGGCGGCCTGGATGGCGCGGGCGGCGAGCTCAAGCGCCTCTGCTTCCAGGACTCGGGCGGCGGCGCCGGGGGCCCGCCAGGGGGCGCGGGCGGCGCGGGCGGCACGTGGTGGCGCCGCTGGCAGCCCCGTGTGTGGGCGCTCTTCGAGGACCCCTACTCGTCGCGGGCTGCCAGGTATGTGGCCTTCGCCTCGCTCTTCTTCATCCTCATCTCCATCACCACCTTCTGCCTGGAGACCCACGAGGGCTTCATCCACATCAGCAACAAGACTGTGACGCAGGCCTCCCCGATCCCCGGGGCCCCGCCGGAGAATATCACCAACGTGGAGGTGGAGACAGAGCCCTTCCTGACCTACGTGGAGGGCGTGTGCGTGGTCTGGTTCACCTTTGAGTTCCTCATGCGCATCACCTTCTGCCCGGACAAGGTGGAGTTTCTCAAGAGCAGCCTCAACATCATCGACTGTGTGGCCATTCTGCCCTTCTACCTGGAGGTCGGCCTCTCGGGCCTCAGCTCCAAGGCCGCCAAGGACGTGTTGGGCTTCCTGCGCGTCGTGCGCTTTGTCCGAATCTTGCGTATCTTCAAGCTGACCCGCCACTTCGTGGGGCTGCGGGTGCTGGGCCACACGCTTCGTGCCAGCACCAATGAGTTCCTGCTGCTCATCATCTTCCTGGCCCTGGGGGTGCTCATCTTTGCCACCATGATCTACTATGCTGAGCGCATTGGCGCCGACCCGGACGACATCCTGGGGTCCAACCACACCTACTTCAAGAACATCCCCATCGGCTTCTGGTGGGCTGTGGTCACCATGACGACCCTGGGCTATGGAGACATGTACCCCAAGACGTGGTCTGGGATGCTGGTTGGGGCGCTGTGTGCCCTGGCAGGGGTGCTGACTATCGCCATGCCTGTTCCTGTCATTGTCAACAATTTTGGCATGTACTATTCGCTGGCCATGGCCAAACAGAAGCTGCCTAAGAAGAAGAACAAACACATCCCCCGGCCCCCCCAGCCTGGCTCGCCCAACTACTGCAAGCCTGACCCACCCCCGCCACCTCCAACACACCCTCACCACGGCAGCGGGGGCATCAGCCCCCCCCCACCCATCAGCCCACCCTCCGTGGGGGTGACTGTGGCTGGGGCCTACCCGCCGGGGCCCCACACGCACCCCGGGCTGCTCAGGGGGGGTGCAGGGGGACTGGGGATCATGGGGCTGCCTCCCCTGCCGGCCCCTGGTGAGCCCTGCCCACTGGCTCAGGAGGAAGTGGTTGAAATCAACAGGGCAGATCCCCGCCCCAATGGCGATCCTGCTGCAGCTGCGCTGGCCCACGAGGATTGTCCCGCCATCGACCAGCCCGCCGCGTCCCCCGAGGACAAGAGCCCCATCACCCCCGGAAGCCGGGGCCGCTACAGCCGGGACCGTGCCTGCTTTCTCCTCACCGACTATGCCCCTTCCCCTGACGGCTCCATCCGAAAAGCCACTGGTGCTCCCCCCCTGCTCCCCCACGACTGGCGTAAGCCAGGCCCCCCAAGCTTCTTGCCCGACCTCAACGCCAACGCCGCAGCCTGGATATCCCCCTAG

XM_004866834.1 Coding sequence

Myh14 myosin, heavy chain 14, non-muscle, transcript variant X1

Length: 6123 bp    Location: 4231067..4176625   Strand: -
>XM_004866834.1
ATGGCGGCCGTGACGCTGTCAGTGCCCGGGCGCAAGGTGCCCCCCAGGCCGGGCCCAGTGCCGGAGGCAGCGCAGCCCTTCTTGTTCGCCCCGTGCTCCCCGGGCTCGGGAGCGGGCAGTCCCCCGCAGGTGGAGTGGACGGCCCGGCGCCTGGTGTGGGTCCCTTCGGAGCTGCACGGGTTCGAGGCGGCCGCACTGCGCGACGAGGGCGATGAGGAGGCCGAGGTGGAGCTGGCGGAGAGCGGGCGGCGGCTGCGGCTGCCGCGGGACCAGATCCAGCGCATGAACCCGCCCAAGTTCAGCAAGGCCGAGGACATGGCCGAGCTCACCTGCCTGAACGAGGCCTCGGTGCTGCACAACCTGCGCGAGCGCTACTACTCCGGCCTCATCTACACCTACTCCGGCCTGTTCTGTGTGGTCATCAACCCCTACAAGCAGCTGCCCATCTACACAGAGGCCATTGTGGAGATGTACCGGGGTAAGAAGCGCCACGAGGTGCCGCCCCACGTGTATGCAGTGACGGAGGGGGCCTACAGGAGCATGCTTCAAGACCGAGAGGACCAGTCCATCCTCTGCACCGGGGAGTCTGGAGCCGGGAAGACAGAGAACACCAAGAAGGTCATCCAGTACCTGGCGCACGTGGCATCGTCGCCCAAGGGCAGGAAGGACCAGGGGGAGCTGGAGCGGCAGCTTCTCCAGGCCAACCCGGTCCTGGAGGCCTTCGGCAACGCCAAGACGGTGAAGAACGACAACTCCTCGCGCTTCGGCAAATTCATCCGCATCAACTTTGACGTCGCGGGGTACATCGTGGGCGCCAACATCGAGACCTACCTGCTGGAGAAGTCGCGCGCCATCCGCCAGGCCAAGGACGAGTGCAGCTTCCACATCTTCTACCAGCTGCTGGGGGGCGCGGGGGAGCAGCTCAAAGCCGACCTCCTCCTGGAGCCCTTCTCGCACTACCGCTTCCTGACCAGCGGGCCGCCATCCACCGCCAGCCAGGAGCGGGAGCCGTTCCAGGAGACCCTGGAGTCCCTGCGGGTGCTGGGCTTCACGCCCGAGGAGATCACCTCTATGCTGCGGATGGTGTCCGCCGTGCTGCAGTTCGGCAACGTCATCCTCAAGAGCGAGCGCAACACGGACCAGGCCACCATGCCGGACAACACAGCTGCACAGAAGCTATGCCGTCTTCTGGGGCTGGGGGTGACCGACTTCTCCAGAGCCCTGCTCACGCCCCGCATAAAGGTTGGCCGAGATTACGTCCAGAAAGCCCAGACCAAGGAGCAGGCCGACTTCGCGCTGGAGGCTCTGGCCAAGGCCACCTACGAGCGCCTCTTCCGCTGGCTGGTCCTGCGCCTCAACCGCGCCCTGGACCGCAGCCCGCGCCAGGGCGCCTCCTTCCTGGGCATCTTGGACATCGCCGGCTTCGAGATCTTCCAGCTGAACTCCTTCGAGCAGCTGTGCATCAACTACACCAACGAGAAGCTGCAGCAGTTGTTCAACCACACCATGTTCGTGCTGGAGCAGGAGGAGTACCAGCGCGAGGGCATTCCCTGGACCTTCCTGGACTTCGGCCTCGACCTGCAGCCCTGCATCGACCTCATCGAGCGCCCGGCCAACCCGCCCGGGCTTCTGGCCCTGCTGGATGAGGAGTGCTGGTTCCCGAAGGCCACGGACAAATCGTTCGTGGAGAAGGTGGCCCAGGAGCAGGGCGGCCACCCCAAGTTCCAGCGCCCCAGGCAACTGCGGGACCAGGCTGACTTCAGCGTCCTGCACTATGCTGGAAAGGTCGACTACAAGGCCAATGAGTGGCTGATGAAGAACATGGACCCGCTGAATGACAACGTGGCAGCCTTGCTCCACCAGAGCACAGACCGGATGACTGCGGAGATCTGGAAAGACGTGGAGAGCATCGTGGGGCTGGAGCAGGTGAGCAGCCTCGGGGATGGCCCACCGGGTGGCCGCCCGCGCCGCGGGATGTTCCGGACGGTGGGACAGCTCTACAAGGAGTCCCTGAGCCGCCTGATGGCCACACTCAGCAACACCAACCCCAGCTTCATCCGCTGCATCATCCCCAACCACGAGAAGCGGGCTGGGAAGCTGGAGCCACGGCTGGTGCTGGAGCAGCTCCGCTGCAATGGCGTCCTCGAGGGCATCCGCATCTGCCGCCAGGGCTTCCCCAACCGCATCCTCTTCCAGGAGTTCCGGCAGCGGTACGAGATCCTGACGCCCAATGCCATCCCCAAGGGCTTCATGGACGGGAAGCAGGCCTGCGAGAAGATGATCCAGGCTCTGGAGCTGGACCCCAACCTGTACCGCGTGGGACAGAGCAAGATCTTCTTCCGGGCGGGGGTCCTGGCCCAGCTGGAGGAGGAGCGGGACCTGAAGGTCACAGACATCATTGTGTCCTTCCAAGCAGCTGCCCGGGGATACCTGGCACGCAGGGCCTTCCAGAGGCGCCAGCAGCAGCAGAGCGCGCTGAGGGTGATGCAGAGGAACTGTGCGGCCTACCTCAAGCTCAGGCACTGGCAGTGGTGGCGGCTGTTCATCAAGGTGAAGCCGCTGCTGCAGGTGACGCGGCAGGACGAGGTGCTGCAGGCGCGCGCCCAGGAGCTGCAGAAGGTGCAGGAGCTGCAGCAACAGAGCGCGCGCCAAGTGGGGGAGCTGCAGGACCGCGTGGCGCAGCTGGAGGAGGAGCGCACCCGCTTGGCCGAGCAGTTGCGGGCGGAGGCCGAGCTTTGCGCGGAGGCGGAGGAGACTCGCGGACGTCTAGCGACCCGCAAGCAGGAGCTGGAGCTGGTGGTGACGGAGCTGGAGGCCCGCATGGGCGAGGAGGAGGAGTGCAGCCGCCAGCTGCAGGCCGAGAAGCGGAGGCTGCAGCTGCACATCCAGGAGCTGGAGACCCACTTGGAGGCCGAGGAGGGGGCGCGGCAGAAGCTACAGCTGGAGAAGGTGACGACTGAGGCGAGGCTGAAGAAGTTCGAGGAGGACTTGCTGCTCCTGGAGGACCAGAACGCCAAGCTGGGCAAGGAGCGCCGGCTGCTGGAGGAGCGCCTGGCCGAGTTCTCCTCGGCGGCGGCGGAGGAGGAGGAGAAGATCAAGAGCCTGAACAAGCTGCGGCTCAAATACGAGGCCACCATCGCGGACATGGAGGACCGCCTGCGGAAGGAGGAGAAGGGGCGCCAGGAGCTGGAGAAGCTGAAGCGGCGGCTGGACGGGGAGAGCTCCGAGCTGCAGGAGCAGATGGCGGGGCAGCAGCAGCGCGCCGAGGAGCTGCGGGCCCAGCTGGGCCGCAAGGAGGAGGAGCTGCAGGCGGCGCTGGCCAGGGCAGAGGAGGAGGGCGGGGCCCGGACCCAGCTGCTGAAGTCCCTTCGCGAGGCGCAGGCCGGCCTAGCCGAGGCCCAGGAGGACCTGGAGGCCGAGCGCGCGGCCAGGGCCAAGGCCGAGAAGCATCGCCGCGACCTGGGCGAGGAGCTGGAGGCGCTGCGCGGGGAGCTGGAGGACACGCTGGACTCCACGAACGCGCAGCAGGAGCTGCGGACCAAGAGAGAACAGGAGGTGACAGAACTGAAGAAGACGCTGGAAGAGGAGACCCGGATTCACGAGGTGGCCGTGCAGGAGCTGAGGCAACGGCACGGCCAGGCGCTGGGGGAGCTGGCGGAGCAGCTGGAGCAAGCGCGACGGGGCAAAGGCGCTTGGGAGAAGACGAGGCTGGCTCTGGAGGCAGAGGTGTCCGAGCTGCGGGCGGAGCTGAGCAGCCTGCAGTCTGCACGCCAGGAGGGAGAGCAGAGGCGTAGGCGTCTGGAGTCGCAGCTGCAGGAGGTGCAGGGCCGGGCTGGTGACGGAGAGCGCGCACGTGTGGAGGCTGCGGAGAAGCTGCAGCGAGCGCAGGCTGAGCTGGAGACCGTGTCTGGGGCGCTGAGTGAGGCCGAGTCCAGAGCCATCCGGCTGGGCAAGGAGCTGAGCAGCACCGAGGCGCAGCTGCACGACGCCCAGGAGCTGCTTCAGGAGGAGACCCGGGCAAAGCTGGCCCTGGGCTCGCGGGTTCGCGCCCTGGAGGCTGAGGCCTCGGGGCTGCGCGAGCAGATAGAAGAGGAAGCCGCTGCCAGGGAGCGTGCGGGCCGTGAGCTCCAGACTGCCCAGGCCCAGCTGTCAGAGTGGCGGCGCCGCCAGGAGGAGGAGGCGGGAGCACTGGAGGCGGGGGAGGAGGCCCGGCGCCGCGCGGCCCGGGAGGCCGAGGCCCTGGCCCAGCGCCTGGCGGAGAAGACGGAGGCTGCGGAGCGGCTGGAGCGGGGCCGCCGCCGGCTGCAGCAGGAGCTGGACGACGCCACGGTGGACCTGGAGCAGCAGCGGCAGCTCGTGAGCTCGCTGGAGAAGAAGCAGCGCAAATTCGACCAGCTTCTGGCTGAGGAGAAGGCAGCTGTGCTCCGCGCAGCAGAGGAACGTGAGCGGGTGGAAGCCGAGGGCCGGGAGCGCGAGGCTCGGGCCTTGTCCCTGACACGAGCCCTGGAAGAGGAACAGGAGGCCCGGGAGGAGCTGGAGCGCCAGAACCGGGCACTGCGGGCCGAGATGGAGGCGCTACTGAGCAGCAAGGATGATGTCGGCAAGAGTGTGCACGAACTGGAACGCGCCCGCAGGGTGGCGGAGCAGGCAGCCAACGACCTGCGAGCACAGGTGACGGAGCTGGAGGACGAGCTGACGGCGGCCGAGGACGCCAAGCTGCGCCTGGAGGTGACCGTGCAGGCTCTGAAGGCACAGCACGAGCGCGACCTGCAGGGCCGCGACGAGGCCGGCGAGGAGAGGCGGAGGCAGCTGGCCAAGCAGCTGAGGGATGCGGAGGTGGAGCGCGACGAGGAGCGGAAGCAGCGCGCCCTGGCCTTGGCCGCCCGCAAGAAGCTGGAGGCGGAGCTGGAGGAGCTGAAGGCGCAGATGGCGGCCGCTGGGCAGGGCAAGGAGGAGGCGGTGAAGCAGCTGCGTAAGATGCAGGCCCAGATGAAGGAGCTGTGGCGGGAGGTGGAGGAGTCACGCACCTCCCGGGAGGAGATCTTTGTCCAGAACCGGGAGAGTGAAAAGCGCCTCAAGGGGCTGGAAGCAGACGTGCTACGGTTGCAGGAGGAGCTGGCAGCCTCAGACCGTGCGCGGCGACAGGCGCAGCAGGACCGGGATGAGATGGCCGATGAGCTGGCCAATGGCAGCCTTAGCAAGGCGGCCCTGCTGGAGGAGAAGCGGCAGCTGGAGGGGCGCCTGGGGCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGAGCAATGCCGAGCTGCTCAATGACCGCTACCGCAAGCTGCTGCTGCAGGTGGAGACCCTGACCACAGAGCTGTCTGCTGAGCGTAGTTTCTCAGCCAAGGCTGAGAGTGGCCGGCAGCAACTGGAGCGGCAGATCCAGGAGCTCCGGGGACACCTGGGTGAAGAGGATGCTGGGGCCCGGGCCCGCCAGAAGATGATGATTGCCACCCTTGAGTCTAAGCTGGCCCAGGCTGAGGAGCAGCTGGAGCAAGAGACCAGGGAGCGCATCCTCTCTGGCAAGCTAGTACGCAGAGCCGAGAAGCGGTTGAAGGAGGTGGTTCTGCAGGTGGAGGAGGAGCGGAGGGTGGCTGACCAGCTCCGGGACCAGCTGGAGAAAGGGAACCTCCGGCTGAAGCAGCTGAAGCGGCAGCTGGAGGAGGCGGAGGAGGAGGCGTCCCGGGCCCAGGCCGGCCGCCGCAGGCTGCAGCGGGAGCTGGAGGACGTCACCGAGTCCGCCGAGTCCATGAACCGCGAGGTGACCACGCTGAGGAACCGGCTCCGGTATGGCGGCGGCGGGCTGTGCCCGGGGTGGGGGAGGCTGGGCCCTGCGGGGACAGAGGGGGCGGAGCCGAGGTCCCGGGGCGTGCGTGAGGAGCTTGGGCACAGGCACTTCCGCTCCCCTCTTTTCTGCCACGCCCGTGTCTCCGCCCGCAGGCGCGGCCCGCTTACCTTCACCACGCGCACAGTGCGCCAGGTGTTCCGCCTGGAGGAGGGCGTGGCTTCCGATGAGGAGGAGGTGGAGGGGGCGGAGCCAGGGTCGGCCCTGCCGCAGGAGCCCGAGTGTCCCCCGCCAGCCCAGCCCCAGTGA

XM_004866841.1 Coding sequence

Znf473 zinc finger protein 473

Length: 2655 bp    Location: 4320464..4298547   Strand: -
>XM_004866841.1
ATGGAAGAGAAGGAGGAGGAGCTTAAAAAAAGCCACTGGGCACAGGCAACTATGATGGAGGAATTTGCAACACACGACATGGGCATGGATTTCACCTTGGAGGATTGGGAGCAGCCAGGACTGGACCAGGGGGACCTGTTCTGGGACACAGCACTGGACAACTACCAGAACCTCCCTATGCTGAATCCCCCAAGACCCAGCCCAACATCCCATCCTGATGGTGAGGAAGAGTTGGTGGCCCTGATGAGGGGAAGCCCAGAAGGAATGGGCCCTGGCATGTCTGAGACCAAGAACTCCCCTCTGAAGCAGAATTTCTTGGAAGAAGGACTCTCCCAGGGAATTATGGAGGTGTTTTACAAGGATGACCCTTGGAACTCCAGACTTGAAGTCTGTCTAGATGAGAGCTGGTTAGATAATTTGCAGAGAGATCCAGAAAGTCTTCAGAAGTCTGATGATGTCACCAATAATGAAAGTACCACAGAATCCAGCAGTCACGAATTGAGCCACCTGAGTCCTTGCCTCCTTTCCATAGGAGAAGACTCTGTGACGGGTGTTACTGAAAAGAGCCTCACACTAGCTGAGTCAAAGGAATATAGGAGTGACTTTGCCTACAGCCCAGACCAGCGGCAGCAGGATGTTGTCCTGGGAGAGGAGAAGCCATATAAATGCAGTGAGTGTGAAGAAAGCTTCAGCCACGGTAATGACCTTATCCAACACTGGGTCACCCACATCAGGGAAGAGCCATCCGAACATCAAGAGGACCAGAGAGATTTCAGTCTGACTTCTTACTTGAGTGTGTGTCCTGTGACCCACAGAGGCTACAGATCCTACATATGTAAGGAATGTGGGAAAACTTTCAGTCAGAATATGCAGCTCCAGCGGCATCAAAAAATTCACAGTAGAGAAAAACCGTGTAAGAGTCAAGGTGGCAACTGTCCATCCAGTTATCATGGAGAGCCTATTAAGCATCAGAAAACTCCCAGAAGTCCTAAGTCCTACAAATGTAACAAATGTGACATGACTTTCACCCAGGCCCTTCATCTTATTGGGCACCGGAAAACACACACTCGGAAGCACTATGAATGTGTCACATGCCAGGCAGTCTTCACCTTGAGGAAACATTTCATCCAACATCAGAAAACTCATGCTGTAAAAACTACCTCAGAGTGTCAGGAGTGCGGGAAGACCTTCAAGCGGAGATTGTCACTTATCAAACACCAGGCTATTCATACTGGGGAGAAGCCTTACAAGTGTGATGAATGTGGGAAAGGCTTCAGCCACACCTCTACCCTGAAGATCCACCAGAAGGTTCATAGCAGAGAGAGACCTTACAAATGCAGTGATTGCAGCAAAGCCTTCTCCTGGAAAACTCACCTTCATGAACACCAGCAGGTTCACACAGGCAGCAGACCCCACAAGTGTCAGGAGTGTGTCCGGAGTTTCAGCCGACCCTCACACCTGATTCGACACCAGGCCACTCATGCCATGGAGAGGCTCTTTGGCTGTGCTGAATGCAGTCAGACCTTCAGTAATAAAGAGTACCTAGTGCGACACCAGAAAATCCACACCATCGAAGCCCCCTATGAGTGTCTAGAGTGTGGAGAATGCTTTGTTTGCAACTCAACCCTGAACTGCCACTTGAGTGTCCATGCCAGAGAAAAGCAAAGATTTGATGGGACCAGGAAAGTTTTGGATCAGAACCTAGGACAGAGAGAGCACCCAAGGCCTGATGAGAAACACTTTAAGTGTGACAAATGTGGAAAAGCATTTAACCGCAACAGATACCTCACTCAGCACAAGAAGATTCACACCAGGGTGCAGGTCTTTGAGTGCAACCAGTGTGGAAAAGCCTTCAGCCAGAGGACACAGCTCCTCTGCCATCAGACAGTGCACTCTGGGAAGAGGCCCCATGAATGTGGTGAGGATGAGGAAGTTGTCCTCAGGACCTCCCTCACCAGACATCAGCCTTCCCAAAGTGAGCACCCCTTTAAATGTAACGAATGTGGCAACACCTTCAGCCAAAGCACTCATCTCTCAGAACATCAATTAATTCACACTACAAAGAAGCCCTTCAAATGTAACGAGTGTGAGCGAGTATTCACACAGAGTAACTACCTTGTTCAGCACCAGAAAGCTCATGTCACAAAAAAGCACTTTTTGTGTAGCGAATGTGGGAAAATGTTCCATCAGAGTTCATGCTTTTCTAAGCACCTGAGAACTCACACAGGTGAGAAGCCCTTTGAATGTGGTGAATGTGGGAAAGCCTTTGGCATGAATGCTGAACTCATCCGACACCGGAGAGTTCACACAGGAGAGAAGCCTTACCTTTGTCAGGATTGTGGAAAAGCCTTCAGCCAGAGCTCGTGCCTTTCTATTCACCGGAGAGTTCACACTGGGGAGAAACCCTACCTGTGCAGCGAATGTGGGAAAGCCTTCACCCAAAGAGCTAATCTAACTCAGCATGAGAGGATTCACACTGGGGAGAAGCCATATGCCTGTGGTGTGTGTGGCAAAGCCTTTGGTTTCAGTGCCCATCTCACTCAGCACCAGAGAAGTCACACCCAGGAGAAACCTTACCAGTGTCAACATTGTCAGAAAGCCTTTAAGTGCTTTTTCACTCTCATCCGACACCAGCGAGTTCATGCTCGAAAGTAG

XM_004866842.1 Coding sequence

Vrk3 vaccinia related kinase 3, transcript variant X1

Length: 1515 bp    Location: 4320879..4352257   Strand: +
>XM_004866842.1
ATGATCTCCTTCTGTCCAGACTGTGGCAAAAGTATTGAAGCCACATTCAAATTCTGCCCCTACTGTGGAAAACCTTTGCCTACAGAGGAGCATGCAAAGTCCCCGACGTGTGTCAGGCGACGGGAATCGTCCTTGCAAGGTTCAAAGAGAGAGCAGAGCTCCAGGTCTGAAACCTCTCCCAAGAAAGTGAGATGGTCAAACATTGTCATCTCTTCCCAGTCATCCTTTCTCTCTGACGGTGGCAGTCCTGAGCCAGAAGATGCCGTGAGTTCTTCTGAGAGGTCCAAAGGGGCCAGGAGCAGACCCCCAACCCCCAAAAGCAGCCCAAAGTCCACCAAGTGCAGCCCTCAGACGCTGAAGCGGAGTCGGGCAACCATCTCTCTTGAGGCTTTGCCCTCGGGGACAGAGCTGATGGACAAAAATGGGCAGCGCTGGAGGCTGGGAGCGCTGCAGACCAGGGACGACCAGGGCATTCTCTACGCAGCCGAGTCCGCCTCTGTCCTCCCCTGCCAGTCAAGGTCTCAAAAACACCAATTCTCCATCAAACTGGATGCCAAAGATGGTCGCCTGTTCAATGAGCAGAACTTCTTCCAGCGGGCTGCCAAGCCTCTACAAGTGAATAAATGGAAGAAGCTGTACTCAACCCCGCTCCTGGCCATCCCCACCTGTATCGGTTTTGGTGTTCACCAGGACAAGTACAGGTTCTTGGTGTTCCCCAGCCTGGGTCGGAGCCTGCAGTCAGCCCTGGATGTGAGCCCGAAGCATGTGATACCGGAGAAGTGTGTGTTCCAGGTGGCCTGCCGGCTGCTGGATGCCCTGGAATTCCTCCATGAAAATGAGTATGTTCATGGGAATCTGACAGCAGAGAATGTCTTTGTGAATCCAGAAGATCTGAGCCAGGTGACCCTGGCAGGCTACAGCTTCTCCTTCCGCTATTGCCCAAGTGGCAGACATGTGGCCTACACAGAAGGCAGCAGGAGCCCCCACGAGGGGGACCTCGAGTTCATTAGCATGGATCTACATAAAGGATGTGGGCCCTCTCGCCGGAGTGACCTCCAGACCCTTGGCTACTGTATGCTGAAGTGGCTTTATGGGTCCCTGCCGTGGACAAACTTCCTTCCCAACACTGAGGAGATCATGAAGCAGAAGCAGAAACATGATGGGATGAATGAAATAAGCACGACACAGAGTTCAAGTCCCACAGGCTTTCTGCTGTGGGTGCCCCTCGAAGAGTGCAAATGGGTGTTCCCGAATCGACAGTGTTTATTACTAAGGTATCTTGACAACCCAGAGCCACTCGGACTGTGTGGTCACCGCAGCAGATCCTCAGAGGCCCTGCAGCAGTACCTGATGGTGGTGATGGCCCTCAAGTACGAGGAGAAGCCGCCCTACGCCATCCTGAGGAACGGTCTGGAAGCCCTGCTGCAGGATCTGCAGGTGTCAGCCTATGACCCCCTCAACCTACAGATGGCACCCAGGCAGGACCCAGAACTTTCAACCTGCCGTTTGAAATAG

XM_004866845.1 Coding sequence

Vrk3 vaccinia related kinase 3, transcript variant X4

Length: 1341 bp    Location: 4320879..4349286   Strand: +
>XM_004866845.1
ATGATCTCCTTCTGTCCAGACTGTGGCAAAAGTATTGAAGCCACATTCAAATTCTGCCCCTACTGTGGAAAACCTTTGCCTACAGAGGAGCATGCAAAGTCCCCGACGTGTGTCAGGCGACGGGAATCGTCCTTGCAAGGTTCAAAGAGAGAGCAGAGCTCCAGGTCTGAAACCTCTCCCAAGAAAGTGAGATGGTCAAACATTGTCATCTCTTCCCAGTCATCCTTTCTCTCTGACGGTGGCAGTCCTGAGCCAGAAGATGCCGTGAGTTCTTCTGAGAGGTCCAAAGGGGCCAGGAGCAGACCCCCAACCCCCAAAAGCAGCCCAAAGTCCACCAAGTGCAGCCCTCAGACGCTGAAGCGGAGTCGGGCAACCATCTCTCTTGAGGCTTTGCCCTCGGGGACAGAGCTGATGGACAAAAATGGGCAGCGCTGGAGGCTGGGAGCGCTGCAGACCAGGGACGACCAGGGCATTCTCTACGCAGCCGAGTCCGCCTCTGTCCTCCCCTGCCAGTCAAGGTCTCAAAAACACCAATTCTCCATCAAACTGGATGCCAAAGATGGTCGCCTGTTCAATGAGCAGAACTTCTTCCAGCGGGCTGCCAAGCCTCTACAAGTGAATAAATGGAAGAAGCTGTACTCAACCCCGCTCCTGGCCATCCCCACCTGTATCGGTTTTGGTGTTCACCAGGACAAGTACAGGTTCTTGGTGTTCCCCAGCCTGGGTCGGAGCCTGCAGTCAGCCCTGGATGTGAGCCCGAAGCATGTGATACCGGAGAAGTGTGTGTTCCAGGTGGCCTGCCGGCTGCTGGATGCCCTGGAATTCCTCCATGAAAATGAGTATGTTCATGGGAATCTGACAGCAGAGAATGTCTTTGTGAATCCAGAAGATCTGAGCCAGGTGACCCTGGCAGGCTACAGCTTCTCCTTCCGCTATTGCCCAAGTGGCAGACATGTGGCCTACACAGAAGGCAGCAGGAGCCCCCACGAGGGGGACCTCGAGTTCATTAGCATGGATCTACATAAAGGATGTGGGCCCTCTCGCCGGAGTGACCTCCAGACCCTTGGCTACTGTATGCTGAAGTGGCTTTATGGGTCCCTGCCGTGGACAAACTTCCTTCCCAACACTGAGGAGATCATGAAGCAGAAGCAGAAACATGATGGGATGAATGAAATAAGCACGACACAGAGTTCAAGTCCCACAGGCTTTCTGCTGTGGGTGCCCCTCGAAGAGTGCAAATGGGTGTTCCCGAATCGACAGTGTTTATTACTAAGGTATCTTGACAACCCAGAGCCACTCGGACTGTGTGGTCACCGCAGCAGATCCTCAGACAACATCTAA

XM_004866846.1 Coding sequence

Vrk3 vaccinia related kinase 3, transcript variant X5

Length: 1278 bp    Location: 4320879..4348651   Strand: +
>XM_004866846.1
ATGATCTCCTTCTGTCCAGACTGTGGCAAAAGTATTGAAGCCACATTCAAATTCTGCCCCTACTGTGGAAAACCTTTGCCTACAGAGGAGCATGCAAAGTCCCCGACGTGTGTCAGGCGACGGGAATCGTCCTTGCAAGGTTCAAAGAGAGAGCAGAGCTCCAGGTCTGAAACCTCTCCCAAGAAAGTGAGATGGTCAAACATTGTCATCTCTTCCCAGTCATCCTTTCTCTCTGACGGTGGCAGTCCTGAGCCAGAAGATGCCGTGAGTTCTTCTGAGAGGTCCAAAGGGGCCAGGAGCAGACCCCCAACCCCCAAAAGCAGCCCAAAGTCCACCAAGTGCAGCCCTCAGACGCTGAAGCGGAGTCGGGCAACCATCTCTCTTGAGGCTTTGCCCTCGGGGACAGAGCTGATGGACAAAAATGGGCAGCGCTGGAGGCTGGGAGCGCTGCAGACCAGGGACGACCAGGGCATTCTCTACGCAGCCGAGTCCGCCTCTGTCCTCCCCTGCCAGTCAAGGTCTCAAAAACACCAATTCTCCATCAAACTGGATGCCAAAGATGGTCGCCTGTTCAATGAGCAGAACTTCTTCCAGCGGGCTGCCAAGCCTCTACAAGTGAATAAATGGAAGAAGCTGTACTCAACCCCGCTCCTGGCCATCCCCACCTGTATCGGTTTTGGTGTTCACCAGGACAAGTACAGGTTCTTGGTGTTCCCCAGCCTGGGTCGGAGCCTGCAGTCAGCCCTGGATGTGAGCCCGAAGCATGTGATACCGGAGAAGTGTGTGTTCCAGGTGGCCTGCCGGCTGCTGGATGCCCTGGAATTCCTCCATGAAAATGAGTATGTTCATGGGAATCTGACAGCAGAGAATGTCTTTGTGAATCCAGAAGATCTGAGCCAGGTGACCCTGGCAGGCTACAGCTTCTCCTTCCGCTATTGCCCAAGTGGCAGACATGTGGCCTACACAGAAGGCAGCAGGAGCCCCCACGAGGGGGACCTCGAGTTCATTAGCATGGATCTACATAAAGGATGTGGGCCCTCTCGCCGGAGTGACCTCCAGACCCTTGGCTACTGTATGCTGAAGTGGCTTTATGGGTCCCTGCCGTGGACAAACTTCCTTCCCAACACTGAGGAGATCATGAAGCAGAAGCAGAAACATGATGGGATGAATGAAATAAGCACGACACAGAGTTCAAGTCCCACAGGCTTTCTGCTGTGGGTGCCCCTCGAAGAGTGCAAATGGGTGTTCCCGAATCGACAGTGTTTATTACTAAGGTGA

XM_004866849.1 Coding sequence

Siglec11 sialic acid binding Ig-like lectin 11, transcript variant X3

Length: 1770 bp    Location: 4372831..4364289   Strand: -
>XM_004866849.1
ATGCTGCTGCTGGCCCTGCTGCTGCCCCTTCTGTGGGCGGGGTCCCTGCAGGAGGAACCAAGCTACTGGCTGCGGGTGCAGAAGTTGGTGACAGTGCAGGAGACCCTGTGTGCCCTGGTGTCCTGCTCCTTCTCCTACCCCCAGGACCGCTGGAACCACTCGACCCCTGCTTATGGCTACTGGTACCAGCACAAGGAGGGTCCCAAAACTCATCATACAACAAATGAACTTGTGGCCACAAATGACCCACGCAAGAAAGCTGGACTGAGAAGCAAAGCTCGTTTCCAGCTGCTCGGGGACCCCAGGGCCTACAACTGCTCCCTGAGGATCGCAGGTGCCCAGCAGGGGGACAGTGGAAGTTACTATTTTCGGGTGGAGAGAGGAGTCATGAAATACAATTATGTGAGACCGGTGCTGACTGTGATTGTCACAGAGCTCACACAGACACCGGACATCCACATGCCGGAGCTGCTGGTGTCTGGTCACTCCAGTCGCCTGGAGTGCTCCATGCCCGGGGCCTGCAGTGGGGCCCTGGCACCCACGTTCTTCTGGACCGGGGCTGCCCTGAGACCCTCGGGTTGGGGCTTGGGCATTCACAGATCTTCGGAGATCCTGCTCACACCACTCCCTCAGGACCACGGCACCCACCTCACCTGTCGGGTGACTCTCCCTCAGGCTGGAGTGACCAGGGAGAGGACTGTCCAGCTCAGTGTGTCCTATCCTCCTCAGAGCCTGACCCTCAGTGTCTCCACAGCAGATGACAGAGCCCCGGACACCCAGGGAAATGGCTCCTACCTGGAGGCCCAGAAAGGCCAGTTCCTGAGGCTCCTCTGTGCTGCTGACAGCCGGCCCCCGGCCACGCTGACCTGGGACCTGGAGGCCAGAGTCCTTGCTCAGTCCCAAACCTCAGGACGAAGACCTCTAAGGCTGGAGCTGCCCGGGGTGAAGCCTGGGGACGCGGGGCGCTACACCTGCCGGGCAGAGAACAGGCTGGGCTCCCAGCACAGCACCCTGGAGCTCTCAGTGCAGTATCCTCCAGAGGACCTGAGAGTGACGGTTTCCCAAGCAAACAGGACAGTCCTGGAAATCCTCGGGAACGGCTCATCCCTGCCCGTCCTGGAGGGCCAGAGCCTGCGCCTGGTGTGTGTCACCCACAGCAGCCCCCCAGCCAGGCTGAGCTGGGCCCGGGGGACACAGCCCCTGAGCCCCTCCTGGCCCTCAGCCCCTGGGGTCCTGGAGCTGCCCCGGGTGCAGATGGAGCATGAAGGGGAAGTCAGCTGCCATGCGGAGAACCCGCTGGGCACCCGGAGTGTCTCTCTCAGCCTCTCTGTGCACTGGAAGCCAGAGAGTTGGGGTGGATATGTGCTCGCAGCACTTGGGGGAGCTGCTGCCTCGGCTCTGCTCTCTCTCTGTGCCTGCCTGCTCTTCTCCAGGATGAAGACCCCCCAGAAGGAGGCGGTGAGGACAGTGGCCACAGAGAAGGGCGCATCCTGTGGCCCGACTCCTGTCTGTTGGGGTCACCTGAATGCATCTGGGTCAGACCACCCGTCATCTGCCATGGCTACCACAGGGGAGGAGCAGGGGCTCCATTACGCCTCCCTCAGCTTCCTGGGACTGAAGCCCCGGAAGCCTCAGAACCAGAAGGACTCCAGCACCACTGAGTGTTCATCTCTGGATGCTGCTTTCTCCCTGCTCCAAGCCACAAGGGAGTCTCCAGGCCAGAGCTGCTTCCTGGATTTGACCTATGTGTTTCAGTCCTTGTTTGATTGA

XM_004866847.1 Coding sequence

Siglec11 sialic acid binding Ig-like lectin 11, transcript variant X1

Length: 2055 bp    Location: 4372831..4364289   Strand: -
>XM_004866847.1
ATGCTGCTGCTGGCCCTGCTGCTGCCCCTTCTGTGGGCGGGGTCCCTGCAGGAGGAACCAAGCTACTGGCTGCGGGTGCAGAAGTTGGTGACAGTGCAGGAGACCCTGTGTGCCCTGGTGTCCTGCTCCTTCTCCTACCCCCAGGACCGCTGGAACCACTCGACCCCTGCTTATGGCTACTGGTACCAGCACAAGGAGGGTCCCAAAACTCATCATACAACAAATGAACTTGTGGCCACAAATGACCCACGCAAGAAAGCTGGACTGAGAAGCAAAGCTCGTTTCCAGCTGCTCGGGGACCCCAGGGCCTACAACTGCTCCCTGAGGATCGCAGGTGCCCAGCAGGGGGACAGTGGAAGTTACTATTTTCGGGTGGAGAGAGGAGTCATGAAATACAATTATGTGAGACCGGTGCTGACTGTGATTGTCACAGAGCTCACACAGACACCGGACATCCACATGCCGGAGCTGCTGGTGTCTGGTCACTCCAGTCGCCTGGAGTGCTCCATGCCCGGGGCCTGCAGTGGGGCCCTGGCACCCACGTTCTTCTGGACCGGGGCTGCCCTGAGACCCTCGGGTTGGGGCTTGGGCATTCACAGATCTTCGGAGATCCTGCTCACACCACTCCCTCAGGACCACGGCACCCACCTCACCTGTCGGGTGACTCTCCCTCAGGCTGGAGTGACCAGGGAGAGGACTGTCCAGCTCAGTGTGTCCTATCCTCCTCAGAGCCTGACCCTCAGTGTCTCCACAGCAGATGACAGAGCCCCGGACACCCAGGGAAATGGCTCCTACCTGGAGGCCCAGAAAGGCCAGTTCCTGAGGCTCCTCTGTGCTGCTGACAGCCGGCCCCCGGCCACGCTGACCTGGGACCTGGAGGCCAGAGTCCTTGCTCAGTCCCAAACCTCAGGACGAAGACCTCTAAGGCTGGAGCTGCCCGGGGTGAAGCCTGGGGACGCGGGGCGCTACACCTGCCGGGCAGAGAACAGGCTGGGCTCCCAGCACAGCACCCTGGAGCTCTCAGTGCAGTATCCTCCAGAGGACCTGAGAGTGACGGTTTCCCAAGCAAACAGGACAGTCCTGGAAATCCTCGGGAACGGCTCATCCCTGCCCGTCCTGGAGGGCCAGAGCCTGCGCCTGGTGTGTGTCACCCACAGCAGCCCCCCAGCCAGGCTGAGCTGGGCCCGGGGGACACAGCCCCTGAGCCCCTCCTGGCCCTCAGCCCCTGGGGTCCTGGAGCTGCCCCGGGTGCAGATGGAGCATGAAGGGGAAGTCAGCTGCCATGCGGAGAACCCGCTGGGCACCCGGAGTGTCTCTCTCAGCCTCTCTGTGCACTATGCCCCCCAGCTGCTGGGCCCCTGGTGCTCCTGGGAGGCCGAGGGTCTGCGGTGCAGCTGCTTCTCCTGTGCCCGGCCTGTCCCGTCCCTGCGCTGGCGGCTCGGGGAGGCGCTGCTGGAGGGGAACAGCAGCAATGCCTCCCTCATGGTCACCTCCAGCTGGGCCGGGCCCTGGGCCAACAGCTCCCTGAGCTTCCCTGGGGGACTGAGCTCTGGGGATAGGCTCAGCTGCGAGGCAGGGAATGTGCACGGGGTCCAGAGGGCCACTGTCCTGCTGCTGCCGGGGAAGCCAGAGAGTTGGGGTGGATATGTGCTCGCAGCACTTGGGGGAGCTGCTGCCTCGGCTCTGCTCTCTCTCTGTGCCTGCCTGCTCTTCTCCAGGATGAAGACCCCCCAGAAGGAGGCGGTGAGGACAGTGGCCACAGAGAAGGGCGCATCCTGTGGCCCGACTCCTGTCTGTTGGGGTCACCTGAATGCATCTGGGTCAGACCACCCGTCATCTGCCATGGCTACCACAGGGGAGGAGCAGGGGCTCCATTACGCCTCCCTCAGCTTCCTGGGACTGAAGCCCCGGAAGCCTCAGAACCAGAAGGACTCCAGCACCACTGAGTGTTCATCTCTGGATGCTGCTTTCTCCCTGCTCCAAGCCACAAGGGAGTCTCCAGGCCAGAGCTGCTTCCTGGATTTGACCTATGTGTTTCAGTCCTTGTTTGATTGA

XM_004866855.1 Coding sequence

LOC101709833 cyclic AMP-dependent transcription factor ATF-5-like, transcript variant X1

Length: 825 bp    Location: 4405190..4400586   Strand: -
>XM_004866855.1
ATGTCACTCCTGGCGACCCTGGGGCTCGAGCTGGACAGAGCCGTGCTCCCAGCTAGCGGACTGGGCTGGCTCGTAGACTATGGGAAACTCCCCCTGGCCCCTGCCCCCCTGGCCCCCTATGAGGTCCTTGGGGGAGCCCTGGAGGGCGGGCTCCCAGGGGGAGGAGAGCCCCTGGCAGGTGATGGCTTCTCAGACTGGATGACAGAGCGAGTTGACTTCACGGCCCTCCTCCCTCTGGAGCCCCCCCTGCCCCCAGGCGCCCTCCCCCCACCTTCCCCGCCCACCGCTGACCTGGAAGCCATGGCCTCCCTGCTCAAAAAGGAGCTGGAGCAGATGGAAGATTTCTTCCTGGACGCCCCGCTCCTCCCGCCACCCTCCCCGCCGCCGCCGCCGCCCCCAGCCCCCTCCCTCCCCCTCCCTCCCTTTGACCTCCCCCAGCCCTCGGCCCTGGATACCCTCGACCTGCTGGCCATCTACTGCCGCGGCGAGGGCGGGCAGGGGGGGGACGCGGGTGTGGGACCCCTGCCCGCCCCCCCGCAGCCCCCCGCGCCGCAGCCTGCTCGCCCCGCCCCCTACCCCAACCCCGCCACCGCCCGAGGGGACCGCAAGCAGAAGAAGCGGGACCAGAACAAGTCGGCGGCTCTGAGGTACCGCCAGAGGAAGCGGGCGGAAGGCGAGGCCTTGGAGGGCGAGTGCCAGGGGCTGGAGGCGCGGAACCGGGAGCTGAGGGAGCGGGCCGAGTCAGTGGAGCGGGAGATCCAATACGTGAAGGACTTGCTCATCGAGGTGTACAAGGCGCGCAGTCAGCGCACACGCAGCAGCTAG

XM_004866856.1 Coding sequence

LOC101709833 cyclic AMP-dependent transcription factor ATF-5-like, transcript variant X2

Length: 825 bp    Location: 4403864..4400586   Strand: -
>XM_004866856.1
ATGTCACTCCTGGCGACCCTGGGGCTCGAGCTGGACAGAGCCGTGCTCCCAGCTAGCGGACTGGGCTGGCTCGTAGACTATGGGAAACTCCCCCTGGCCCCTGCCCCCCTGGCCCCCTATGAGGTCCTTGGGGGAGCCCTGGAGGGCGGGCTCCCAGGGGGAGGAGAGCCCCTGGCAGGTGATGGCTTCTCAGACTGGATGACAGAGCGAGTTGACTTCACGGCCCTCCTCCCTCTGGAGCCCCCCCTGCCCCCAGGCGCCCTCCCCCCACCTTCCCCGCCCACCGCTGACCTGGAAGCCATGGCCTCCCTGCTCAAAAAGGAGCTGGAGCAGATGGAAGATTTCTTCCTGGACGCCCCGCTCCTCCCGCCACCCTCCCCGCCGCCGCCGCCGCCCCCAGCCCCCTCCCTCCCCCTCCCTCCCTTTGACCTCCCCCAGCCCTCGGCCCTGGATACCCTCGACCTGCTGGCCATCTACTGCCGCGGCGAGGGCGGGCAGGGGGGGGACGCGGGTGTGGGACCCCTGCCCGCCCCCCCGCAGCCCCCCGCGCCGCAGCCTGCTCGCCCCGCCCCCTACCCCAACCCCGCCACCGCCCGAGGGGACCGCAAGCAGAAGAAGCGGGACCAGAACAAGTCGGCGGCTCTGAGGTACCGCCAGAGGAAGCGGGCGGAAGGCGAGGCCTTGGAGGGCGAGTGCCAGGGGCTGGAGGCGCGGAACCGGGAGCTGAGGGAGCGGGCCGAGTCAGTGGAGCGGGAGATCCAATACGTGAAGGACTTGCTCATCGAGGTGTACAAGGCGCGCAGTCAGCGCACACGCAGCAGCTAG

XM_004866850.1 Coding sequence

Nup62 nucleoporin 62kDa, transcript variant X1

Length: 1557 bp    Location: 4404245..4428231   Strand: +
>XM_004866850.1
ATGAGCGGGTTTAATTTCGGAAGCACTGGTGCTTCCACAGGTGGATTCACATTTGGCACTGCGAGAACAGCAACCACCACACCCTCAACGGGATTTTCTTTCTCCACTCCCGGCACTGGAGGGTTTACCTTTGGAACTCCCTCCCAGCCAGCTGCAAGTACCCCTTCAACCAGCCTCTTCTCACTCAACACCCAAGCTCCAGCAACTCAGACCACTGGATTCACTTTCGGAACAACTCCTGCTTCCACAGCAACTGGCTTTTCCTTAGGGATCAATACCCCAAAGCCAAGCTTGAGCAACATAGCTGCCGCCCCAGTTACGGCAAATCCCAGCGGCTTTGGGCTTGGCAGCAGCACCCTCACCAATGCCATATCAAGTGCTGTCACCTCCAGCCAGGGGACAGCATCCACTGGCTTTGTGTTCGGTTCCTCTACCACCTCCACAGCTCCAGCCACCACGTCTGGAGGGTTCTCCTTCACCAGTGGAAGCACGTCCCAGGCTGGGACCTCTGGCTTCAACATTGGCTCCCTGGGCAGTGTAGCCCAGGCCCAGCCCACGGCACTTCCCGGATTGCCCTTCACTGCAGCCACGCCAGCAGCCACTGCAGCGGGGGCCACCCAGCCAGCTGCACCCACAGCCACTGCCAGCAGTGCAGGGCCCACCCTCTTTGCCTCAATAGCAGCTGCTCCCACCTCGTCCACCACTGGGCTCGCCCTCTGTGTCCCAGCAACCACCACTGGAGCTCCTGGCGCTGGGACCCTGGGTTTCAGCCTAAAAGCCCCCGAAACCGCTTCTAGCACCTCAGCAGCAACATCCACCACTGTGGCCACAGCCAGCACCACTGCCGCCACCGGCTTTGCTTTGAATATAAAGCCACTGGTGCCAGCTACAATATCCAGCGGTGCAGCAGCAGGTGTGACTGCTGCATCTGGCTCCGTTGCAGCTACTGGGACATCCACCTCTCCTGTGATGACCTACGCACAGCTGGAGAGCCTGATCAACAAGTGGAGCCTGGAGCTGGAGGACCAGGAGCGCCACTTCCTCCAGCAGGCCACCCAGGTCAACGCCTGGGACCGCACGCTAATCGAGAATGGGGAGAAGATCACCAGCCTGCACCGTGAGGTGGAGAAGGTGAAGCTGGACCAAAGGAGGCTGGACCAGGAGCTCGACTTCATCCTGTCCCAGCAGAAGGAGCTGGAAGACCTGCTGAGCCCCCTGGAGGAGTCAGTGAAGGAGCAGAGCGGGACCATCTACCTGCAGCACGCCGACGAGGAGCGTGAGAAGACCTACAAGCTGGCTGAGAACATTGATGCCCAGCTGAAGCGCATGGCCCAGGACCTCAAGGACATCATCGAGCACCTGAACACGTCCGGAGGCCCTGCTGACACCAGCGACCCACTGCAGCAGATCTGCAAGATCCTCAACGCACACATGGACTCGCTGCAGTGGATCGACCAGAACTCGGCCCTTCTGCAGAGGAAGGTGGAGGAGGTGACCAAGGTGTGCGAGGGCCGCCGCAAGGAGCAGGAGCGCAGCTACAGGATCACATTTGACTGA

XM_004866852.1 Coding sequence

Nup62 nucleoporin 62kDa, transcript variant X3

Length: 1557 bp    Location: 4404245..4428231   Strand: +
>XM_004866852.1
ATGAGCGGGTTTAATTTCGGAAGCACTGGTGCTTCCACAGGTGGATTCACATTTGGCACTGCGAGAACAGCAACCACCACACCCTCAACGGGATTTTCTTTCTCCACTCCCGGCACTGGAGGGTTTACCTTTGGAACTCCCTCCCAGCCAGCTGCAAGTACCCCTTCAACCAGCCTCTTCTCACTCAACACCCAAGCTCCAGCAACTCAGACCACTGGATTCACTTTCGGAACAACTCCTGCTTCCACAGCAACTGGCTTTTCCTTAGGGATCAATACCCCAAAGCCAAGCTTGAGCAACATAGCTGCCGCCCCAGTTACGGCAAATCCCAGCGGCTTTGGGCTTGGCAGCAGCACCCTCACCAATGCCATATCAAGTGCTGTCACCTCCAGCCAGGGGACAGCATCCACTGGCTTTGTGTTCGGTTCCTCTACCACCTCCACAGCTCCAGCCACCACGTCTGGAGGGTTCTCCTTCACCAGTGGAAGCACGTCCCAGGCTGGGACCTCTGGCTTCAACATTGGCTCCCTGGGCAGTGTAGCCCAGGCCCAGCCCACGGCACTTCCCGGATTGCCCTTCACTGCAGCCACGCCAGCAGCCACTGCAGCGGGGGCCACCCAGCCAGCTGCACCCACAGCCACTGCCAGCAGTGCAGGGCCCACCCTCTTTGCCTCAATAGCAGCTGCTCCCACCTCGTCCACCACTGGGCTCGCCCTCTGTGTCCCAGCAACCACCACTGGAGCTCCTGGCGCTGGGACCCTGGGTTTCAGCCTAAAAGCCCCCGAAACCGCTTCTAGCACCTCAGCAGCAACATCCACCACTGTGGCCACAGCCAGCACCACTGCCGCCACCGGCTTTGCTTTGAATATAAAGCCACTGGTGCCAGCTACAATATCCAGCGGTGCAGCAGCAGGTGTGACTGCTGCATCTGGCTCCGTTGCAGCTACTGGGACATCCACCTCTCCTGTGATGACCTACGCACAGCTGGAGAGCCTGATCAACAAGTGGAGCCTGGAGCTGGAGGACCAGGAGCGCCACTTCCTCCAGCAGGCCACCCAGGTCAACGCCTGGGACCGCACGCTAATCGAGAATGGGGAGAAGATCACCAGCCTGCACCGTGAGGTGGAGAAGGTGAAGCTGGACCAAAGGAGGCTGGACCAGGAGCTCGACTTCATCCTGTCCCAGCAGAAGGAGCTGGAAGACCTGCTGAGCCCCCTGGAGGAGTCAGTGAAGGAGCAGAGCGGGACCATCTACCTGCAGCACGCCGACGAGGAGCGTGAGAAGACCTACAAGCTGGCTGAGAACATTGATGCCCAGCTGAAGCGCATGGCCCAGGACCTCAAGGACATCATCGAGCACCTGAACACGTCCGGAGGCCCTGCTGACACCAGCGACCCACTGCAGCAGATCTGCAAGATCCTCAACGCACACATGGACTCGCTGCAGTGGATCGACCAGAACTCGGCCCTTCTGCAGAGGAAGGTGGAGGAGGTGACCAAGGTGTGCGAGGGCCGCCGCAAGGAGCAGGAGCGCAGCTACAGGATCACATTTGACTGA

XM_004866853.1 Coding sequence

Nup62 nucleoporin 62kDa, transcript variant X4

Length: 1557 bp    Location: 4410225..4428231   Strand: +
>XM_004866853.1
ATGAGCGGGTTTAATTTCGGAAGCACTGGTGCTTCCACAGGTGGATTCACATTTGGCACTGCGAGAACAGCAACCACCACACCCTCAACGGGATTTTCTTTCTCCACTCCCGGCACTGGAGGGTTTACCTTTGGAACTCCCTCCCAGCCAGCTGCAAGTACCCCTTCAACCAGCCTCTTCTCACTCAACACCCAAGCTCCAGCAACTCAGACCACTGGATTCACTTTCGGAACAACTCCTGCTTCCACAGCAACTGGCTTTTCCTTAGGGATCAATACCCCAAAGCCAAGCTTGAGCAACATAGCTGCCGCCCCAGTTACGGCAAATCCCAGCGGCTTTGGGCTTGGCAGCAGCACCCTCACCAATGCCATATCAAGTGCTGTCACCTCCAGCCAGGGGACAGCATCCACTGGCTTTGTGTTCGGTTCCTCTACCACCTCCACAGCTCCAGCCACCACGTCTGGAGGGTTCTCCTTCACCAGTGGAAGCACGTCCCAGGCTGGGACCTCTGGCTTCAACATTGGCTCCCTGGGCAGTGTAGCCCAGGCCCAGCCCACGGCACTTCCCGGATTGCCCTTCACTGCAGCCACGCCAGCAGCCACTGCAGCGGGGGCCACCCAGCCAGCTGCACCCACAGCCACTGCCAGCAGTGCAGGGCCCACCCTCTTTGCCTCAATAGCAGCTGCTCCCACCTCGTCCACCACTGGGCTCGCCCTCTGTGTCCCAGCAACCACCACTGGAGCTCCTGGCGCTGGGACCCTGGGTTTCAGCCTAAAAGCCCCCGAAACCGCTTCTAGCACCTCAGCAGCAACATCCACCACTGTGGCCACAGCCAGCACCACTGCCGCCACCGGCTTTGCTTTGAATATAAAGCCACTGGTGCCAGCTACAATATCCAGCGGTGCAGCAGCAGGTGTGACTGCTGCATCTGGCTCCGTTGCAGCTACTGGGACATCCACCTCTCCTGTGATGACCTACGCACAGCTGGAGAGCCTGATCAACAAGTGGAGCCTGGAGCTGGAGGACCAGGAGCGCCACTTCCTCCAGCAGGCCACCCAGGTCAACGCCTGGGACCGCACGCTAATCGAGAATGGGGAGAAGATCACCAGCCTGCACCGTGAGGTGGAGAAGGTGAAGCTGGACCAAAGGAGGCTGGACCAGGAGCTCGACTTCATCCTGTCCCAGCAGAAGGAGCTGGAAGACCTGCTGAGCCCCCTGGAGGAGTCAGTGAAGGAGCAGAGCGGGACCATCTACCTGCAGCACGCCGACGAGGAGCGTGAGAAGACCTACAAGCTGGCTGAGAACATTGATGCCCAGCTGAAGCGCATGGCCCAGGACCTCAAGGACATCATCGAGCACCTGAACACGTCCGGAGGCCCTGCTGACACCAGCGACCCACTGCAGCAGATCTGCAAGATCCTCAACGCACACATGGACTCGCTGCAGTGGATCGACCAGAACTCGGCCCTTCTGCAGAGGAAGGTGGAGGAGGTGACCAAGGTGTGCGAGGGCCGCCGCAAGGAGCAGGAGCGCAGCTACAGGATCACATTTGACTGA

XM_004866857.1 Coding sequence

Il4i1 interleukin 4 induced 1, transcript variant X1

Length: 1698 bp    Location: 4429129..4444551   Strand: +
>XM_004866857.1
ATGGGCACTGAGCGAGCCCCCCAGGGCCAGCCATGCACCCTGCACCTCCTTGCCCTGGCCCCCATCCTCTTCAGCCTGGCACCCTCCCTGGCCTGGAAGGAGGCCTCCAGCCAGGACCCCTTCGAGAAATGCATGCACGATCCCGACTATGAGCTGCTGCTCAAGGTGGTGACCCAGGGCCTCAATCGGACCTTGCAGCCCCAGAAGGTGATTGTGGTTGGCGCTGGTGTGGCCGGGCTGGTGGCTGCCAAGGTGCTCAGTGATGGTGGACACAAGGTCACCGTTCTGGAGGCAGATAACAGGATCGGGGGCCGCATCCTCACCTTCCGGGACCCTAAGACCAGCTGGTCTGGGGAGCTAGGAGCCATGCGCATGCCCAGCTCCCACAGGATCCTGCACATGCTCTGCAAGAGCCTGGGGCTCAACCTGACAAAATTCACCCAGTATGACGAGAACACGTGGACAGAAGTGAACGGCGTGAAGCTGCGGAACTACGTGGTGGAGAAGATGCCCGAGAAGCTGGGCTACAAACTGCGCCCCAAAGAGAGGGGCCGCTCCCCAGAGGACATCTACCAGATGGCTCTCAACAAGGCCCAGAAAGATGTCAAGGCGCTGGGCTGCAGAAAGGCACTGAGGAAGTTTGAAAGGCACACGCTCCTGGAATTCCTCCGCGGGGAGGGCAATCTCAGCCGACCAGCAGTGCAGCTTCTGGGAGACGTGATGTCCAAGGATGGCTTCTTCTATCTCAGCTTCGAAGAGGCCTTGCGCGCTCATAGCTGCCTCAGCGACCAGCTCCGGTACAGCCGCATCGTGGGCGGCTGGGACTTGCTGCCGCGCGCGCTGCTGAGCTCGCTGTCTGGCCCCGTGCTGCTGAACGCGCCTGTCGTGGCCGTGACCCAGGGCACGCGCGACGTGCGGGTGCACATCGCGACCTCGAGCCAGTCGCGGAGCCTGAAGGCTCTGACGGCCGATGTGGTGCTGCTGACGGCCAGTGGGCCGGCGCTGCAGCGCATGACCTTCTCGCCGCCGCTGTCGCGCGAGCGCCAGGAGGCGCTGCGCAGGCTGCACTACGTGCCGGCCACCAAGGTGTTCCTGAGCTTCCGCCGGCCCTTCTGGCAGGACGAGGGCATCGAGGGCGGCCACTCGAACACCGACCGCCCGTCGCGCGCGGTTTTCTACCCTCCGCCAGGCGAGGGCGCGCTGCTGCTGGCTTCGTACACGTGGTCGGACGCCACCAACGCGTTCGCGGGCCTGGGCACCGAAGAAGTGCTGCGCCTGGCGCTCACCGACGTGGCGGCGCTGCATGGACCGCACGTCTACCGGCTCTGGGACGGCACCGGTATTGTCAAGCGCTGGGCTGAAGACCCACACAGCCAGGGCGGCTTCGTGGTGCAGCCGCCCGTGCTCTGGCAAACCGACGGCGACGAAGACTCCGAGGCCTTTGCACAGCCCTACGATTGGACGACCCCCCACGGCCGCATCTACTTCGCGGGCGAGCACACGGCCTACCCTCACGGCTGGGTGGAGACAGCCGTCAAGTCGGCGCTTCGGGCCGCCCTGCGGATCAACAGCCCCGAGGGTCAGGCGTGCACGGAGGCCCCGCAGCAGCTGGGGGCCGAGCACCAGGCTACCTACCGCGTCCCAGGCCATCCCCTCCTGCGGCTCCCGCACTCCACCCACCGGAAGACCTCACATTAA

XM_004866862.1 Coding sequence

Tbc1d17 TBC1 domain family, member 17, transcript variant X3

Length: 2034 bp    Location: 4454171..4445161   Strand: -
>XM_004866862.1
ATGGAGAGATCTTGCTACAGAGTGGTGTTTGAGAAGGGAGGCGTGTACCTGCACACCAGCGCCCGGAAACATCAGGACGCGGACTCCCTCATCGCGGGCGTTATCCGTGTCGTGGAGAAGGACAATGACGTCCTCCTGCACTGGGCTCCTGTGGAGGAGGCTGGAGATTGCACCCAAATCCTCTTCTCCAAGAAGGACTCTAGTGGGGGTGACCCCTGCACCTCTGAGGAGGAACCCACCTTTGACCCTGGCTATGAACCTGACTGGGCTGTCATCAGTACCGTGCGGCCACGGCTCCACCACTCAGAGCCTGCCAGAGGTACAGAGCCCAGCTCCCCCCGGGCTCAGTGGGCCTTCTCAGTGAGTCTGGGGGAGCTGAAGTCCATCCGCCGATCCAAGCCAGGCCTTAGCTGGGCCTACCTGGTTCTGGTGACCCAAGCCGGAGGCTCCCTGCCTGCCCTGCACTTCCACCGAGGAGGCACCCGAGCCCTGCTTCGAGTCCTCAGCCGCTACTTGCTACTGGCCAGCTCCCCGCAGGACTCCCGCCTCTACCTTGTCTTTCCCCATGACTCCTCTGCCCTCTCCAACTCCTTCCACCACCTGCAGCTCTTTGATCAGGACAGCTCCAATGTGGTCTCTCGCTTCCTCCAAGACCCCTACTCCACCACCTTCAGCAGCTTCTCCCGCGTGACCAACTTTTTCCGGGGAGCCTTGCAGCCACACCCCGAGGGGGCCTCCTCTCCTGACCTTCGCCCCCCACCCGATGATGAGCCTGGGTTTGAGGTCATCTCCTGTGTGGAGCTGGGGCCACGGCCAGCCGTGGAGCGTGCCCCTCCTGTCACAGAGGAGGAGTGGGCCCGCCACGTGGGCCCCGAGGGCCGCCTGCAGCAGGTCCCTGAGCTGAAGAACCGGATCTTCTCGGGGGGTCTGAGCCCCAGCCTGCGGCGCGAGGCCTGGAAGTTCCTCCTGGGCTACCTCAGCTGGGAGGGCTCAGCCGAGGAGCACAAGGCCCACCTGCGCAAGAAAACGGATGAGTATTTCCGCATGAAGCTGCAGTGGAAGTCCGTGAGCCCTGAGCAGGAGCGGAGGAACTCACTCCTGCACGGATACCGCAGCCTCATTGAGAGAGACGTGAGCCGCACTGACAGGACCAACAAGTTCTATGAGGGCCCTGAGAACCCGGGGCTGGGGCTGCTGAACGACATCCTCCTCACCTACTGCATGTACCACTTTGACCTCGGTGTGGCAACGGGCAGGGAGGGGTGGGCTGAGTCCCTCAAGGGTGCCGAGGGCCTGAACAGCACCCTGATCCCATGTCCCCCAGGCTATGTCCAGGGCATGAGTGACCTTCTCTCCCCGATCCTCTACGTCATTCAGAACGAGGTGGATGCCTTCTGGTGTTTCTGTGGCTTCATGGACCTCGTGCACGGGAACTTTGAGGAGAGTCAGGAGACCATGAAGCGGCAGCTGGGGCAGCTCCTGCTACTGCTAAAGGTGCTGGACCAGCCGCTGTGTGACTTCCTGGACTCCCAGGACTCCGGCTCTCTCTGCTTCTGCTTCCGGTGGCTGCTTATCTGGTTCAAGAGGGAATTCCCCTTCCCGGACATCCTCCGGCTGTGGGAGGTGCTGTGGACGAGGCTTCCCGGTCCTAATCTGCACCTGCTGGTGGCCTGCGCCATCCTGGACATGGAGCGGGACACCCTCATGCTGTCAGGCTTCGGCTCCAACGAGATCCTGAAGCACATCAACGAGCTGACCATGAAGCTGAGCGTGGAGGACGTGCTGACGCGTGCCGAGGCGCTGTACTGGCAGCTCACCGCCTGCCCGGAGCTGCCCCACAACGTGCAGGAAGTCCTGGGCCTGGCGCCGCCCGCGGAGCCCCCCAGCCCCTCGCCTCCGGTCTCCCCGCTGCCGCTGTCGCCTACACGTGCCCCGTCGACCCCGCCGCCCGCCGCCGCCGCCGCCGCCGCTGCCCCGCAGCCAGACAGCAGCCTGGAGATCCTGCCCGAGGAGGGGGATGGGCCCGACTCCTAG

XM_004866863.1 Coding sequence

Tbc1d17 TBC1 domain family, member 17, transcript variant X4

High confidence: 4 potential gene matches
Length: 1950 bp    Location: 4454168..4445161   Strand: -
>XM_004866863.1
ATGGAGAGATCTTGCTACAGAGTGGTGTTTGAGAAGGGAGGCGTGTACCTGCACACCAGCGCCCGGAAACATCAGGACGCGGACTCCCTCATCGCGGGCGTTATCCGTGTCGTGGAGAAGGACAATGACGTCCTCCTGCACTGGGCTCCTGTGGAGGAGGCTGGAGATTGCACCCAAATCCTCTTCTCCAAGAAGGACTCTAGTGGGGGTGACCCCTGCACCTCTGAGGAGGAACCCACCTTTGACCCTGGCTATGAACCTGACTGGGCTGTCATCAGTACCGTGCGGCCACGGCTCCACCACTCAGAGCCTGCCAGAGGTACAGAGCCCAGCTCCCCCCGGGCTCAGTGGGCCTTCTCAGTGAGTCTGGGGGAGCTGAAGTCCATCCGCCGATCCAAGCCAGGCCTTAGCTGGGCCTACCTGGTTCTGGTGACCCAAGCCGGAGGCTCCCTGCCTGCCCTGCACTTCCACCGAGGAGGCACCCGAGCCCTGCTTCGAGTCCTCAGCCGCTACTTGCTACTGGCCAGCTCCCCGCAGGACTCCCGCCTCTACCTTGTCTTTCCCCATGACTCCTCTGCCCTCTCCAACTCCTTCCACCACCTGCAGCTCTTTGATCAGGACAGCTCCAATGTGGTCTCTCGCTTCCTCCAAGACCCCTACTCCACCACCTTCAGCAGCTTCTCCCGCGTGACCAACTTTTTCCGGGGAGCCTTGCAGCCACACCCCGAGGGGGCCTCCTCTCCTGACCTTCGCCCCCCACCCGATGATGAGCCTGGGTTTGAGGTCATCTCCTGTGTGGAGCTGGGGCCACGGCCAGCCGTGGAGCGTGCCCCTCCTGTCACAGAGGAGGAGTGGGCCCGCCACGTGGGCCCCGAGGGCCGCCTGCAGCAGGTCCCTGAGCTGAAGAACCGGATCTTCTCGGGGGGTCTGAGCCCCAGCCTGCGGCGCGAGGCCTGGAAGTTCCTCCTGGGCTACCTCAGCTGGGAGGGCTCAGCCGAGGAGCACAAGGCCCACCTGCGCAAGAAAACGGATGAGTATTTCCGCATGAAGCTGCAGTGGAAGTCCGTGAGCCCTGAGCAGGAGCGGAGGAACTCACTCCTGCACGGATACCGCAGCCTCATTGAGAGAGACGTGAGCCGCACTGACAGGACCAACAAGTTCTATGAGGGCCCTGAGAACCCGGGGCTGGGGCTGCTGAACGACATCCTCCTCACCTACTGCATGTACCACTTTGACCTCGGCTATGTCCAGGGCATGAGTGACCTTCTCTCCCCGATCCTCTACGTCATTCAGAACGAGGTGGATGCCTTCTGGTGTTTCTGTGGCTTCATGGACCTCGTGCACGGGAACTTTGAGGAGAGTCAGGAGACCATGAAGCGGCAGCTGGGGCAGCTCCTGCTACTGCTAAAGGTGCTGGACCAGCCGCTGTGTGACTTCCTGGACTCCCAGGACTCCGGCTCTCTCTGCTTCTGCTTCCGGTGGCTGCTTATCTGGTTCAAGAGGGAATTCCCCTTCCCGGACATCCTCCGGCTGTGGGAGGTGCTGTGGACGAGGCTTCCCGGTCCTAATCTGCACCTGCTGGTGGCCTGCGCCATCCTGGACATGGAGCGGGACACCCTCATGCTGTCAGGCTTCGGCTCCAACGAGATCCTGAAGCACATCAACGAGCTGACCATGAAGCTGAGCGTGGAGGACGTGCTGACGCGTGCCGAGGCGCTGTACTGGCAGCTCACCGCCTGCCCGGAGCTGCCCCACAACGTGCAGGAAGTCCTGGGCCTGGCGCCGCCCGCGGAGCCCCCCAGCCCCTCGCCTCCGGTCTCCCCGCTGCCGCTGTCGCCTACACGTGCCCCGTCGACCCCGCCGCCCGCCGCCGCCGCCGCCGCCGCTGCCCCGCAGCCAGACAGCAGCCTGGAGATCCTGCCCGAGGAGGGGGATGGGCCCGACTCCTAG

XM_004866867.1 Coding sequence

Akt1s1 AKT1 substrate 1 (proline-rich), transcript variant X2

Length: 774 bp    Location: 4454309..4461598   Strand: +
>XM_004866867.1
ATGGCGGCGGCGCGGCCCGAGGAGCTGTGGGAGGCCGTGGTGGGGGCCGCCGAGCGCTTCCGGGCCCAGACTGGCACTGAGCTGGTGCTGCTGACCGCTGCGCCACCGCCGCCGCCACGCCCGGGGCCCTGTGCCTATGCAGCCCATGGCCGCGGGGCCCTGGCCGAGGCTGCCCGCCGCTGCCTCCAGGACATTGCACAGGCCCACAGAGCTGCGGCGGCCGCCCGGCCTCCCAGGCCCCCGCCAGTGCCCAGCCCCGATCCCAGCCCGCCCCGACCAGCCCTTCCCAGGGAGGACGAGGAGGAGGAGGAGGAGGAGGAGGAGGACCAGCCGACAGAGACAGAGACCTCCGGGGAGCGGCTGGGTGGCAGCGATAACGGAGGGCTCTTCGTGATGGACGAGGACACCACCCTCCAGGACCTGCCCCCCTTCTGTGAGTCGGACCCCGAGAGCACAGATGACGGTAGCCTGAGCGAAGATGCCCCTGCCGGCCCCCCGGCCTGTTCCATGCCCCCCGCCTCGGCCCTGCCCACGCAGCAGTACGCCAAGTCGCTGCCCGTGTCTGTGCCCGTCTGGGCCTTCAAGGAGAAGAGGACCGAGGCGAGGTCATCGGATGAGGAGAACGGACAGCCCTCCTCGCCCGACCTGGACCGCATCGCGGCGAGCATGCGCGCTCTGGTGCTGCGGGAGGCCGAGGATACCCAGGTGTTCGGGGACTTGCCGCGACCGCGGCTCAACACCAGCGACTTCCAGAAGCTGAAGCGGAAATACTGA

XM_004866868.1 Coding sequence

Akt1s1 AKT1 substrate 1 (proline-rich), transcript variant X3

Length: 774 bp    Location: 4454309..4461598   Strand: +
>XM_004866868.1
ATGGCGGCGGCGCGGCCCGAGGAGCTGTGGGAGGCCGTGGTGGGGGCCGCCGAGCGCTTCCGGGCCCAGACTGGCACTGAGCTGGTGCTGCTGACCGCTGCGCCACCGCCGCCGCCACGCCCGGGGCCCTGTGCCTATGCAGCCCATGGCCGCGGGGCCCTGGCCGAGGCTGCCCGCCGCTGCCTCCAGGACATTGCACAGGCCCACAGAGCTGCGGCGGCCGCCCGGCCTCCCAGGCCCCCGCCAGTGCCCAGCCCCGATCCCAGCCCGCCCCGACCAGCCCTTCCCAGGGAGGACGAGGAGGAGGAGGAGGAGGAGGAGGAGGACCAGCCGACAGAGACAGAGACCTCCGGGGAGCGGCTGGGTGGCAGCGATAACGGAGGGCTCTTCGTGATGGACGAGGACACCACCCTCCAGGACCTGCCCCCCTTCTGTGAGTCGGACCCCGAGAGCACAGATGACGGTAGCCTGAGCGAAGATGCCCCTGCCGGCCCCCCGGCCTGTTCCATGCCCCCCGCCTCGGCCCTGCCCACGCAGCAGTACGCCAAGTCGCTGCCCGTGTCTGTGCCCGTCTGGGCCTTCAAGGAGAAGAGGACCGAGGCGAGGTCATCGGATGAGGAGAACGGACAGCCCTCCTCGCCCGACCTGGACCGCATCGCGGCGAGCATGCGCGCTCTGGTGCTGCGGGAGGCCGAGGATACCCAGGTGTTCGGGGACTTGCCGCGACCGCGGCTCAACACCAGCGACTTCCAGAAGCTGAAGCGGAAATACTGA

XM_004866865.1 Coding sequence

Pnkp polynucleotide kinase 3'-phosphatase

High confidence: 4 potential gene matches
Length: 1584 bp    Location: 4462688..4467678   Strand: +
>XM_004866865.1
ATGGCGGAGGTAGAGGCCCAGGGTCACCTGTGGCTGGAGAGCCCTCCTGGGGGAGCGCCTCCTATCTTCCTTCCCTCGGACGGGCAAACCCTGGTCTTGGGCCGGGGACCCCTGACCCAGGTCACGGACCGGAAGTGCTCCAGGAACCAAGTGGAGCTGGTTGCAGACCCTGAGACTCGGACGGTAGCAGTGAAACAGCTGGGCGTTAACCCTTCTACTGCTGGGACTCAGGAGCTGAAGCCCGGTTTGGAGGGCTCTCTAGGGGTGGGGGACACACTGTATTTGGTCAATGGCCTGCACCCACTGACCCTGCGCTGGGAAGAGACCCCTACACCAGGATCCCAGCCAGACATTCCACCTGGCACCCCTCTGGTGACTCCAGACAAGGAGAGGAAGGAGGAGGAGGAGGAGGATGCTGAGCCCCAGAAAAAGAGGATGCGGAAGTCATCTCCTGGCTGGGAGAACTTGGAGAAGCTGCTGGTGTTCGTAGCCCCTGGGGTGAAGCCCCGGGGCAAGGTGGCTGCCTTTGATCTGGATGGGACCCTAATCACCACCCGCTCTGGGAAGGTCTTCCCCACGGGCCCCAGTGACTGGAGGATCTCATACCCAGAGGTTCCCAGGAGGCTCCAGCAGCTGGATACCCAGGGCTACAAGCTGGTGATCTTCACGAACCAGATGGCCATTGGCCGAGGGAAGCTGCGAGCAGAGGATTTCAAGGCCAAGGTGGAGGCTGTGGTAGAAAAGCTGGGGGTCCCCTTGCAGGTACTGGTGTCCACGCATGCGGGCCTGTGCCGGAAGCCGCTGACGGGCATGTGGGAGCATCTGCAGGAGCAGGCCAACGAGGGCATGCCCATCTCCCTCGGCGACAGCATCTTCGTGGGAGATGCCGCGGGCCGCCCGGCCAACTGGGCACCTGGGCGGAAGAAGAAAGACTTCTCTTGTGCCGACCGCCTGTTTGCCCTCAACCTTGGCCTGCCCTTTGCCACGCCTGAAGAGTTCTTCCTCAAGTGGCCAGTGGCCCGATTCGAGCTCCCGGCTTTCGACCCGAGGACCGTCTCCCGCGCAGGGCCGCTCTGCCTACCCGAGACTAGCTCCCTGCTGAACTCAGACCCAGAAGTGGTCGTCGCCGTGGGATTCCCCGGGGCCGGCAAGTCCACATTCCTCAAGGAGCACCTGGTGTCCGCCGGCTACGTGCACGTCAACAGGGACACGCTGGGCTCGTGGCAGCGCTGCGTGAGCGCGTGTGAGGCGGCTCTGAAGCAGGGGAAACGGGTGGCCATCGACAACACAAACCCAGACGCTGCGAGCCGGGCCAGGTACATCCAGTGCGCCAGAGACGCGGGTGCGCCCTGCCGCTGCTTCCTCTTTGCAGCCACACTGGAGCAGGCGCGCCACAACAACCGGTTCCGCGAGCTGACCGGTTCCTCTCACGCACCCGTGTCCGACGTGGTCATGTTCGGCTACAGGAAGCAGTTCGAGGCCCCGGCGCTCGCCGAAGGCTTCTCTGAGATCCTGAAGATCCCGTTCCGGCTGCAGTTGGAGCCGCCGTTGGAGAGGCTGTACCGCCAGTTCTCCGAGGGCTGA

XM_004866869.1 Coding sequence

Ptov1 prostate tumor overexpressed 1, transcript variant X1

Length: 1644 bp    Location: 4477075..4468427   Strand: -
>XM_004866869.1
ATGGTCCGTCCGCGCCGCGCCCCACACCGCTCCGGCGCTGGGGGCCTCTTGGGGGCTCGCGGCCGGCCCCCGAGGCCGCTGGTGGTGCGTGCCGTGCGCTCGCGCTCCTGGCCCGCCAGCTCCCGTGGCCCACAGCCGCCGCGGATCCGGGCCCGCTCGGCCCCTCCCATGGAAGGTGCTCGGGTCTTCGGGGCCCTGGGTCCCATTGGGCCCTCCTCCCCTGGGCTCTCCCTTGGGGGGCTGGCTGTCAGTGAGCACCGGCTCAGCAACAAGCTGCTTGCCTGGAGTGGCGTCCTGGAGTGGCAGGAGAAGCGCAGACCCTACTCTGACTCCACAGTGAAGCTGAAGCGGACCCTGCCCTGCCAGGCCTACGTGAACCAGGGCGAGAACCTGGAGACGGACCAGTGGCCACAGAAGTTGATCATGCAGCTGATCCCGCAGCAGCTGCTGACCACGCTGGGCCCCCTGTTCCGCAACTCCCAGCTGGCACAGTTCCGCTTCACCAACAGAGACTGTGACTCGCTCAAGGGGCTCTGTCGTGTCATGGGCAACGGCTTCGCTGGCTGCATGCTGTTCCCCCACATCTCCCCCTGCGAGGTCCGAGTGCTCATGCTCCTCTACTCATCCAAGAAGAAGATCTTCATGGGCCTCATCCCCTATGACCAGAGTGGCTTTGTCAACGCCATCCGGCAGGTCATCACCACCCGCAAGCAGGCAGTGGGACCTGGTGGTGTCCACTCAGGGCCTGTCCAGATTGTCAACAACAAATTCTTGGCATGGAGCGGAGTCATGGAATGGCAGGAGCCCAGGCCTGAGCCCAATAGTCGGTCCAAGAGGTGGCTACCATCACACGTCTACGTGAACCAAGGGGAGATCCTGAGGACCGAGCAGTGGCCAAGGAAGCTGTACATGCAGCTCATCCCGCAGCAGCTGCTGACCACCCTGGTGCCGCTGTTCCGGAACTCACGCCTTGTGCAGTTCCACTTCACCAAGGACCTGGAGACGCTGAAGAGCCTGTGCCGGATCATGGACAACGGCTTTGCTGGCTGCCTGCACTTCCCCCACACGGCCCCCTGCGAGGTGCGCGTACTCATGCTCCTCTACTCCTGCGAGAAGAAGATCTTCATCGGCCTCATCCCCCATGACCAGAGCGGCTTCATCAATGGCATCCGGCGTGTCATAGCCAACCAGCAGCAGGTCCTGCAGCGGAACCTGGAGCAGGAGCAGCAGCAGCGAGGGGTGAGGCCTGCCCCAGCGCCCCGTCCCATTCTGCCCGCCTCCCCCGTGCTGACCCCTTCCCCAACTTCCTCTGCAGATGGGGGGTTAGAGGCCCCTGGCCGGGTCCTCTGGGAGTCACAGAGGAGGCCCCCGCCGAGACTGGTGAGTGGCCACCCTGTTGCTGCGTGCAGATGGACCCTCAGACCTGCCAGGGGTGTTGGGAAACAGGGTGACCCCAGCCTTGGGACCACCAGAGAGTGGCACCGCAGTCCCTATGGTCCAGGGTGGCCTGGGCAGGGAAGGGGGTCTTGGGGCGGCACAACCAGGTCTGGCCCAGGAGGGCCCTTCCCAGTTCCCGGGGGCCCTGTGCTCTGGTCCCCCATGTCCCTCCCACTCTGTCCCTGCCCCCAGGTCAGATGCTTCTGA

XM_004866870.1 Coding sequence

Ptov1 prostate tumor overexpressed 1, transcript variant X2

Length: 1395 bp    Location: 4476947..4468427   Strand: -
>XM_004866870.1
ATGGTCCGTCCGCGCCGCGCCCCACACCGCTCCGGCGCTGGGGGCCTCTTGGGGGCTCGCGGCCGGCCCCCGAGGCCGCTGGTGGTGCGTGCCGTGCGCTCGCGCTCCTGGCCCGCCAGCTCCCGTGGCCCACAGCCGCCGCGGATCCGGGCCCGCTCGGCCCCTCCCATGGAAGGTGCTCGGGTCTTCGGGGCCCTGGGTCCCATTGGGCCCTCCTCCCCTGGGCTCTCCCTTGGGGGGCTGGCTGTCAGTGAGCACCGGCTCAGCAACAAGCTGCTTGCCTGGAGTGGCGTCCTGGAGTGGCAGGAGAAGCGCAGACCCTACTCTGACTCCACAGTGAAGCTGAAGCGGACCCTGCCCTGCCAGGCCTACGTGAACCAGGGCGAGAACCTGGAGACGGACCAGTGGCCACAGAAGTTGATCATGCAGCTGATCCCGCAGCAGCTGCTGACCACGCTGGGCCCCCTGTTCCGCAACTCCCAGCTGGCACAGTTCCGCTTCACCAACAGAGACTGTGACTCGCTCAAGGGGCTCTGTCGTGTCATGGGCAACGGCTTCGCTGGCTGCATGCTGTTCCCCCACATCTCCCCCTGCGAGGTCCGAGTGCTCATGCTCCTCTACTCATCCAAGAAGAAGATCTTCATGGGCCTCATCCCCTATGACCAGAGTGGCTTTGTCAACGCCATCCGGCAGGTCATCACCACCCGCAAGCAGGCAGTGGGACCTGGTGGTGTCCACTCAGGGCCTGTCCAGATTGTCAACAACAAATTCTTGGCATGGAGCGGAGTCATGGAATGGCAGGAGCCCAGGCCTGAGCCCAATAGTCGGTCCAAGAGGTGGCTACCATCACACGTCTACGTGAACCAAGGGGAGATCCTGAGGACCGAGCAGTGGCCAAGGAAGCTGTACATGCAGCTCATCCCGCAGCAGCTGCTGACCACCCTGGTGCCGCTGTTCCGGAACTCACGCCTTGTGCAGTTCCACTTCACCAAGGACCTGGAGACGCTGAAGAGCCTGTGCCGGATCATGGACAACGGCTTTGCTGGCTGCCTGCACTTCCCCCACACGGCCCCCTGCGAGGTGCGCGTACTCATGCTCCTCTACTCCTGCGAGAAGAAGATCTTCATCGGCCTCATCCCCCATGACCAGAGCGGCTTCATCAATGGCATCCGGCGTGTCATAGCCAACCAGCAGCAGGTCCTGCAGCGGAACCTGGAGCAGGAGCAGCAGCAGCGAGGGGTGAGGCCTGCCCCAGCGCCCCGTCCCATTCTGCCCGCCTCCCCCGTGCTGACCCCTTCCCCAACTTCCTCTGCAGATGGGGGGTTAGAGGCCCCTGGCCGGGTCCTCTGGGAGTCACAGAGGAGGCCCCCGCCGAGACTGGTCAGATGCTTCTGA

XR_206150.1 Non-coding sequence

Ptov1 PREDICTED: Heterocephalus glaber prostate tumor overexpressed 1 (Ptov1), transcript variant X3, misc_RNA.

Length: 1701 bp     
>XR_206150.1
GTATCGCCTGGTTTCACCCCCGTTTTGGTGTGCTCTTTCGCTCACCACGCCCCCCGAAGTTGTTTCTGGGTCGCACGACCTCGGAGCTCCTCCCCCACGGAGGAGCGGCCCATAGTGTCTTCCCCTGGCCATTCTTCCTTCACACGTCCCTTTTCCTGAGGCGCCTTCGCCCCGTTGGTACGCTCCGGCCACGCCCCCTCGTGTACGCCGTTGGTACGCGCCGGATCCCCCCGCTCTGCGCAGTGGTTTGGCCTCGGCGACCCCGCTGGCGGCGCGGTCCCCGCGATTGGTACGGCTCAGCCCGTCTCCCACGAAGCCGCGCGCCCGCGCCCCTCTGTCTGTGGAGGCCGCGGACCCCAGTCCGCTCTGCCCGCTCCCGCCATGGTCCGTCCGCGCCGCGCCCCACACCGCTCCGGCGCTGGGGGCCTCTTGGGGGCTCGCGGCCGGCCCCCGAGGCCGCTGGTGGTGCGTGCCGTGCGCTCGCGCTCCTGGCCCGCCAGCTCCCGTGGCCCACAGCCGCCGCGGATCCGGGCCCGCTCGGCCCCTCCCATGGAAGGTGCTCGGGTCTTCGGGGCCCTGGGTCCCATTGGGCCCTCCTCCCCTGGGCTCTCCCTTGGGGGGCTGGCTGTCAGTGAGCACCGGCTCAGCAACAAGCTGCTTGCCTGGAGTGGCGTCCTGGAGTGGCAGGAGAAGCGCAGACCCTACTCTGACTCCACAGTGAAGCTGAAGCGGACCCTGCCCTGCCAGGCCTACGTGAACCAGGGCGAGAACCTGGAGACGGACCAGTGGCCACAGAAGTTGATCATGCAGCTGATCCCGCAGCAGCTGCTGACCACGCTGGGCCCCCTGTTCCGCAACTCCCAGCTGGCACAGTTCCGCTTCACCAACAGAGACTGTGACTCGCTCAAGGGGCTCTGTCGTGTCATGGGCAACGGCTTCGCTGGCTGCATGCTGTTCCCCCACATCTCCCCCTGCGAGGTCCGAGTGCTCATGCTCCTCTACTCATCCAAGAAGAAGATCTTCATGGGCCTCATCCCCTATGACCAGAGTGGCTTTGTCAACGCCATCCGGCAGGTCATCACCACCCGCAAGCAGGCAGTGGGACCTGGTGGTGTCCACTCAGGGCCTGTCCAGATTGTCAACAACAAATTCTTGGCATGGAGCGGAGTCATGGAATGGCAGGAGCCCAGGCCTGAGCCCAATAGTCGGTCCAAGAGGTGGCTACCATCACACGTCTACGTGAACCAAGGGGAGATCCTGAGGACCGAGCAGTGGCCAAGGAAGCTGTACATGCAGCTCATCCCGCAGCAGCTGCTGACCACCCTGGTGCCGCTGTTCCGGAACTCACGCCTTGTGCAGTTCCACTTCACCAAGGACCTGGAGACGCTGAAGAGCCTGTGCCGGATCATGGACAACGGCTTTGCTGGCTGCCTGCACTTCCCCCACACGGCCCCCTGCGAGGTGCGCGTACTCATGCTCCTCTACTCCTGCGAGAAGAAGATCTTCATCGGCCTCATCCCCCATGACCAGAGCGGCTTCATCAATGGCATCCGGCGTGTCATAGCCAACCAGCAGCAGGTCCTGCAGCGGAACCTGGAGCAGGAGCAGCAGCAGCGAGGGATGGGGGGTTAGAGGCCCCTGGCCGGGTCCTCTGGGAGTCACAGAGGAGGCCCCCGCCGAGACTGGTCAGATGCTTCTGAG

XM_004866871.1 Coding sequence

Med25 mediator complex subunit 25, transcript variant X1

Length: 2385 bp    Location: 4503885..4486460   Strand: -
>XM_004866871.1
ATGGTCCCCGGGTCCGAGGGCCCGGCCCGGGCCGGGGGCCTGGTGGCCGATGTGGTGTTCGTGATCGAGGGTACAGCCAACCTGGGCCCCTACTTCGAGGAGTTGCGCAAGTACTACCTGCTCCCGGCCATCGAGTATTTCAATGGTGGTCCTCCTGCGGAGACGGACTTCGGGGGAGACTATGGGGGTACCCAGTACAGCCTTGTGGTCTTCAACACAGTGGACTGCGCCCCGGAGTCCTACGTACAATGTCATGCTCCCACCAGCAGCGCCTATGAGTTTGTCACCTGGCTTGATGGCATTAAGTTCATGGGCGGCGGTGGTGAGAGCTGCAGCCTCATCGCAGAAGGCCTCAGCACAGCCCTGCAGCTCTTTGATGACTTTAAGAAGATGCGCGAGCAGATTGGCCAGACACACCGAGTCTGCCTCCTCATCTGCAACTCACCACCGTACCTGCTTCCTGCTGTTGAGAGCACCACCTACTCGGGGTACACAACTGAGAGCCTTGTTCAGGAGATAGGGGAGCGTGGGATCCACTTCTCCATCGTGTCCCCTCGGAAGCTTCCTGCTCTGCGGCTTCTGTTCGAGAAGGCTGCCCCCCCAGCCATGCTGGAGACGCTACAGCCACCGGCGGACGTGAGCCAGGACCCGAGGCACATGGTGTTGGTGCGCGGGCTGGTGCTGCCTGTTGGGGGTGGCTCGGCCCCAGGCCCCCTCCAGCCCAAGCAACAGGTGCCTCTGCCACCCGCGCCACCCTCGGGTGCCACACTCTCAGCCGCACCTCAGCAGTCCCTGCCCCCTGTGCCGCCACAGTACCAGGTCCCCGGGAACCTGAGCGCAGCGCAGGTGGCTGCCCAGAATGCAGTGGAGGCTGCCAAGAACCAGAAGGCTGGACTTGGCCCCCGCTTCTCGCCCATCAACCCTCTCCAGCAGGCTCCTTCAGGAGTGGGACCCCCCTTCAGTCAGGCTACGGCCCCAGCATTACCTCCAGGGCCTTCTGGTGCCACCAAGGCGCCTCCTGCCTCTCAGCCCAACCTGGTCTCCACAGTGGCGCCTGGCCCGGGCCTGGCCCCTACCGCACAGCCTGGGGCACCATCCATGGCGGGCACAGTGGCCCCAGGTGGTGTCAGTGGTCCTTCCCCCGCCCAACTCGGGGCGCCAGCCCTCGGTGGGCAGCAGTCAGTCTCCAACAAGCTCCTGGCCTGGAGCGGGGTGCTTGAATGGCAGGAGAAACCGAAGCCCGCCTCAGTGGATGCCAACACCAAGCTGACCCGCTCCCTGCCCTGCCAGGTCTACGTGAATCATGGAGAGAACCTGAAGACAGAGCAGTGGCCACAGAAGCTGATCATGCAGCTCATCCCCCAGCAGCTGCTGGTGCGTAGCCTGAGGGGCCCCATCCAAGCTCCCCAAGCTCCCTGCCTCTGTCCGCTCCGCACTCCCAACACGGTGACCGCGGTGTCTCCACAGACCACCTTGGGCCCTCTGTTCCGGAACTCAAGGATGGTGCAGTTCCACTTCACCAATAAGGACCTGGAGTCCCTCAAAGGCCTCTACCGTATCATGGGCAACGGCTTCGCTGGCTGTGTGCACTTCCCCCACACGGCCCCCTGCGAGGTCCGAGTGCTCATGCTCCTCTATTCATCCAAGAAGAAGATCTTCATGGGCCTCATCCCCTACGACCAGAGTGGCTTTGTCAATGGCATCCGGCAGGTCATCACCAACCACAAGCAAGTCCAGCAGCAGAAACTGGAGCAGCAGCGTGGGATGGGACAGCAGGCACCCCCAGGCCTGGGCCCTATTCTGGAGGACCAAGCAAGGCCCTCGCAGAATCTGGTGAGGACAGGGTGGTGTGGGTCAGGGACAGGGTGGGACAGCCCCAGAGGATGTCTGACTCTCACTCCCCTGTTCGCTGAGGTGGAGGAATATGGGGCCTCTGACTTCTCCCTCACCCTCATTTCTCTTCCCAGCAGCTTCAGCTCCGCCCACCACAGCCCCAGCCTCAGGGTACTGTGGGGGCATCTGGGGCCACAGGGCAGCCCCAGCCCCCAGGTACCACCCAGGCCCCCCCAGGTGCCCCCCAAGGCCCTCCTGGAGCTGCCCCTGGCCCACCTCCTCCTGGACCCATCCTTCGGCCCCAGAACCCTGGGGCCAATCCCCAGCTGCGGAGCCTGCTTCTCAACCCGCCACCGCCCCAGACTGGGGTCCCCCCACCGCAGGCCTCCCTCCATCACCTCCAGCCACCAGGGGCTCCTGCATTGCTGCCACCACCGCACCAGAGCTTGGGGCAGCCCCAGCTGGGGCCCCCGCTCCTGCACCCACCACCCGCCCAGTCCTGGCCAGCTCAGCTTCCCCCGAGGGCTCCGATGCCAGGTCAGATGCTGCTGA

XM_004866880.1 Coding sequence

Fuz fuzzy planar cell polarity protein, transcript variant X4

Length: 1098 bp    Location: 4509295..4514163   Strand: +
>XM_004866880.1
ATGTTCGGCCAGAATCTGGAGGTGCAACTGAGCTCTGCGAGGACGGAGGACACGACTGTGGTGTGGAAAAGCTTCCATGACAGCATCACCCTCATTGTTCTGTCATCAGAGGAGGGCACCTCAGAGCTGAGGCTGGAGCGACTGCTGCAGATGGTATTTGGGGCCATGGTTCTTCTTGTAGGACTTGAAGAACTGACAAATATCCGAAATGTGGAGAGACTGAAGAAGGAGTTGAGGGCCAGTTACTGCCTCATCGACAGCTTCCTGGGGGACCCAGAGCTCATCGGGGACCTGACCCAGTGTGTGGACTGTGTGATTCCTCCAGAAGGGTCGCTCCTGCAGGAAGCCCTCTCTGGCTTTGCTGAGGCCACCGGGACGGTCTTCGTCAGTTTGGTGGTGTCGGGCCGAGTAGTCGCAGCGACCGAGGGCTGGTGGCGGCTGGGGATGCCTGAGGCCGTGCTGCTCCCTTGGCTTGTGGGGTCCCTGCCACCGCAGGCCGCTCGCGACTACCCCGTGTACCTACCGCATGGGAGCCCCACGGTCCCCCACAGGCTCCTGACCCTGACGCTGCTGCCCAGTCTGGAGCTGTGTCTGCTCTGCGGGCCGAGCCCACCCCTCAGCCAGCTAGGCGCGCAGCTTCTGGAGCGCTGGTGGCAGCCCCTGCTGGACCCACTGCGGGCCTGCCTGCCGCTGGGGCCCCGCGCGCTGCCCGAAGGCTTCCCCCTGCACACGGACATCCTCGGGCTGCTGCTCCTGAACCTGGAACTGAAACGCTGCCTCTTCACTGTGCAACCCTCGGGAAATAAAGAGCCTTCCCCAGAACAGCGCCGCCACCTCCTCCGCAACTTCTACACCCTGGTCACCAGCACATACTTCCCCCCAGAGCCTGGGGCATCCGAGAAGGCGGAGGATGCAGGGCACCGGTCCCAGCTGCCAAGAGCTTGCTACCTCGTGCTGGGGCCAGGCATGGGGTGGCAAGTAGTGGCTCTGCAGCTGGGGCCCCGACAGCTGCTGCTACTGCTGTCTCCTCAGAGCCCCACCCATGGGCTGCGAGCCCTGGCCACCCACACTCTGCATGCCCTCACCCCGTTCCTATGA

XM_004866878.1 Coding sequence

Fuz fuzzy planar cell polarity protein, transcript variant X2

Length: 1140 bp    Location: 4509448..4514163   Strand: +
>XM_004866878.1
ATGGGAGAGGAGGGGACAGGGGGCACTGTGCATCTGCTGTGCCTCGCAACCTCCAGCGGGGTCCCCCTGTTCTGCAGGAGCAGCCGGGGCGGTGCCCCAGCGCGTCAGCAGCTCCCGTTCTCTGTCATCGGCTCCCTCAATGGAGTCCACATGTTCGGCCAGAATCTGGAGGTGCAACTGAGCTCTGCGAGGACGGAGGACACGACTGTGGTTCTTCTTGTAGGACTTGAAGAACTGACAAATATCCGAAATGTGGAGAGACTGAAGAAGGAGTTGAGGGCCAGTTACTGCCTCATCGACAGCTTCCTGGGGGACCCAGAGCTCATCGGGGACCTGACCCAGTGTGTGGACTGTGTGATTCCTCCAGAAGGGTCGCTCCTGCAGGAAGCCCTCTCTGGCTTTGCTGAGGCCACCGGGACGGTCTTCGTCAGTTTGGTGGTGTCGGGCCGAGTAGTCGCAGCGACCGAGGGCTGGTGGCGGCTGGGGATGCCTGAGGCCGTGCTGCTCCCTTGGCTTGTGGGGTCCCTGCCACCGCAGGCCGCTCGCGACTACCCCGTGTACCTACCGCATGGGAGCCCCACGGTCCCCCACAGGCTCCTGACCCTGACGCTGCTGCCCAGTCTGGAGCTGTGTCTGCTCTGCGGGCCGAGCCCACCCCTCAGCCAGCTAGGCGCGCAGCTTCTGGAGCGCTGGTGGCAGCCCCTGCTGGACCCACTGCGGGCCTGCCTGCCGCTGGGGCCCCGCGCGCTGCCCGAAGGCTTCCCCCTGCACACGGACATCCTCGGGCTGCTGCTCCTGAACCTGGAACTGAAACGCTGCCTCTTCACTGTGCAACCCTCGGGAAATAAAGAGCCTTCCCCAGAACAGCGCCGCCACCTCCTCCGCAACTTCTACACCCTGGTCACCAGCACATACTTCCCCCCAGAGCCTGGGGCATCCGAGAAGGCGGAGGATGCAGGGCACCGGTCCCAGCTGCCAAGAGCTTGCTACCTCGTGCTGGGGCCAGGCATGGGGTGGCAAGTAGTGGCTCTGCAGCTGGGGCCCCGACAGCTGCTGCTACTGCTGTCTCCTCAGAGCCCCACCCATGGGCTGCGAGCCCTGGCCACCCACACTCTGCATGCCCTCACCCCGTTCCTATGA

XM_004866877.1 Coding sequence

Fuz fuzzy planar cell polarity protein, transcript variant X1

High confidence: 4 potential gene matches
Length: 1248 bp    Location: 4509450..4514163   Strand: +
>XM_004866877.1
ATGGGAGAGGAGGGGACAGGGGGCACTGTGCATCTGCTGTGCCTCGCAACCTCCAGCGGGGTCCCCCTGTTCTGCAGGAGCAGCCGGGGCGGTGCCCCAGCGCGTCAGCAGCTCCCGTTCTCTGTCATCGGCTCCCTCAATGGAGTCCACATGTTCGGCCAGAATCTGGAGGTGCAACTGAGCTCTGCGAGGACGGAGGACACGACTGTGGTGTGGAAAAGCTTCCATGACAGCATCACCCTCATTGTTCTGTCATCAGAGGAGGGCACCTCAGAGCTGAGGCTGGAGCGACTGCTGCAGATGGTATTTGGGGCCATGGTTCTTCTTGTAGGACTTGAAGAACTGACAAATATCCGAAATGTGGAGAGACTGAAGAAGGAGTTGAGGGCCAGTTACTGCCTCATCGACAGCTTCCTGGGGGACCCAGAGCTCATCGGGGACCTGACCCAGTGTGTGGACTGTGTGATTCCTCCAGAAGGGTCGCTCCTGCAGGAAGCCCTCTCTGGCTTTGCTGAGGCCACCGGGACGGTCTTCGTCAGTTTGGTGGTGTCGGGCCGAGTAGTCGCAGCGACCGAGGGCTGGTGGCGGCTGGGGATGCCTGAGGCCGTGCTGCTCCCTTGGCTTGTGGGGTCCCTGCCACCGCAGGCCGCTCGCGACTACCCCGTGTACCTACCGCATGGGAGCCCCACGGTCCCCCACAGGCTCCTGACCCTGACGCTGCTGCCCAGTCTGGAGCTGTGTCTGCTCTGCGGGCCGAGCCCACCCCTCAGCCAGCTAGGCGCGCAGCTTCTGGAGCGCTGGTGGCAGCCCCTGCTGGACCCACTGCGGGCCTGCCTGCCGCTGGGGCCCCGCGCGCTGCCCGAAGGCTTCCCCCTGCACACGGACATCCTCGGGCTGCTGCTCCTGAACCTGGAACTGAAACGCTGCCTCTTCACTGTGCAACCCTCGGGAAATAAAGAGCCTTCCCCAGAACAGCGCCGCCACCTCCTCCGCAACTTCTACACCCTGGTCACCAGCACATACTTCCCCCCAGAGCCTGGGGCATCCGAGAAGGCGGAGGATGCAGGGCACCGGTCCCAGCTGCCAAGAGCTTGCTACCTCGTGCTGGGGCCAGGCATGGGGTGGCAAGTAGTGGCTCTGCAGCTGGGGCCCCGACAGCTGCTGCTACTGCTGTCTCCTCAGAGCCCCACCCATGGGCTGCGAGCCCTGGCCACCCACACTCTGCATGCCCTCACCCCGTTCCTATGA

XM_004866879.1 Coding sequence

Fuz fuzzy planar cell polarity protein, transcript variant X3

Length: 1113 bp    Location: 4509787..4514163   Strand: +
>XM_004866879.1
ATGGGGGACACACCTAGGTGTGTGCGCTGGTTCGTCGCAGGGAGCTGCCAGGGAACATGGGAGAGGGGCTGGAAGCTCCAACACTTGGAACTCAAGGGCATCACCCTCATTGTTCTGTCATCAGAGGAGGGCACCTCAGAGCTGAGGCTGGAGCGACTGCTGCAGATGGTATTTGGGGCCATGGTTCTTCTTGTAGGACTTGAAGAACTGACAAATATCCGAAATGTGGAGAGACTGAAGAAGGAGTTGAGGGCCAGTTACTGCCTCATCGACAGCTTCCTGGGGGACCCAGAGCTCATCGGGGACCTGACCCAGTGTGTGGACTGTGTGATTCCTCCAGAAGGGTCGCTCCTGCAGGAAGCCCTCTCTGGCTTTGCTGAGGCCACCGGGACGGTCTTCGTCAGTTTGGTGGTGTCGGGCCGAGTAGTCGCAGCGACCGAGGGCTGGTGGCGGCTGGGGATGCCTGAGGCCGTGCTGCTCCCTTGGCTTGTGGGGTCCCTGCCACCGCAGGCCGCTCGCGACTACCCCGTGTACCTACCGCATGGGAGCCCCACGGTCCCCCACAGGCTCCTGACCCTGACGCTGCTGCCCAGTCTGGAGCTGTGTCTGCTCTGCGGGCCGAGCCCACCCCTCAGCCAGCTAGGCGCGCAGCTTCTGGAGCGCTGGTGGCAGCCCCTGCTGGACCCACTGCGGGCCTGCCTGCCGCTGGGGCCCCGCGCGCTGCCCGAAGGCTTCCCCCTGCACACGGACATCCTCGGGCTGCTGCTCCTGAACCTGGAACTGAAACGCTGCCTCTTCACTGTGCAACCCTCGGGAAATAAAGAGCCTTCCCCAGAACAGCGCCGCCACCTCCTCCGCAACTTCTACACCCTGGTCACCAGCACATACTTCCCCCCAGAGCCTGGGGCATCCGAGAAGGCGGAGGATGCAGGGCACCGGTCCCAGCTGCCAAGAGCTTGCTACCTCGTGCTGGGGCCAGGCATGGGGTGGCAAGTAGTGGCTCTGCAGCTGGGGCCCCGACAGCTGCTGCTACTGCTGTCTCCTCAGAGCCCCACCCATGGGCTGCGAGCCCTGGCCACCCACACTCTGCATGCCCTCACCCCGTTCCTATGA

XM_004866881.1 Coding sequence

Fuz fuzzy planar cell polarity protein, transcript variant X5

Length: 948 bp    Location: 4510044..4514163   Strand: +
>XM_004866881.1
ATGGTATTTGGGGCCATGGTTCTTCTTGTAGGACTTGAAGAACTGACAAATATCCGAAATGTGGAGAGACTGAAGAAGGAGTTGAGGGCCAGTTACTGCCTCATCGACAGCTTCCTGGGGGACCCAGAGCTCATCGGGGACCTGACCCAGTGTGTGGACTGTGTGATTCCTCCAGAAGGGTCGCTCCTGCAGGAAGCCCTCTCTGGCTTTGCTGAGGCCACCGGGACGGTCTTCGTCAGTTTGGTGGTGTCGGGCCGAGTAGTCGCAGCGACCGAGGGCTGGTGGCGGCTGGGGATGCCTGAGGCCGTGCTGCTCCCTTGGCTTGTGGGGTCCCTGCCACCGCAGGCCGCTCGCGACTACCCCGTGTACCTACCGCATGGGAGCCCCACGGTCCCCCACAGGCTCCTGACCCTGACGCTGCTGCCCAGTCTGGAGCTGTGTCTGCTCTGCGGGCCGAGCCCACCCCTCAGCCAGCTAGGCGCGCAGCTTCTGGAGCGCTGGTGGCAGCCCCTGCTGGACCCACTGCGGGCCTGCCTGCCGCTGGGGCCCCGCGCGCTGCCCGAAGGCTTCCCCCTGCACACGGACATCCTCGGGCTGCTGCTCCTGAACCTGGAACTGAAACGCTGCCTCTTCACTGTGCAACCCTCGGGAAATAAAGAGCCTTCCCCAGAACAGCGCCGCCACCTCCTCCGCAACTTCTACACCCTGGTCACCAGCACATACTTCCCCCCAGAGCCTGGGGCATCCGAGAAGGCGGAGGATGCAGGGCACCGGTCCCAGCTGCCAAGAGCTTGCTACCTCGTGCTGGGGCCAGGCATGGGGTGGCAAGTAGTGGCTCTGCAGCTGGGGCCCCGACAGCTGCTGCTACTGCTGTCTCCTCAGAGCCCCACCCATGGGCTGCGAGCCCTGGCCACCCACACTCTGCATGCCCTCACCCCGTTCCTATGA

XM_004866882.1 Coding sequence

Fuz fuzzy planar cell polarity protein, transcript variant X6

Length: 948 bp    Location: 4510130..4514163   Strand: +
>XM_004866882.1
ATGGTATTTGGGGCCATGGTTCTTCTTGTAGGACTTGAAGAACTGACAAATATCCGAAATGTGGAGAGACTGAAGAAGGAGTTGAGGGCCAGTTACTGCCTCATCGACAGCTTCCTGGGGGACCCAGAGCTCATCGGGGACCTGACCCAGTGTGTGGACTGTGTGATTCCTCCAGAAGGGTCGCTCCTGCAGGAAGCCCTCTCTGGCTTTGCTGAGGCCACCGGGACGGTCTTCGTCAGTTTGGTGGTGTCGGGCCGAGTAGTCGCAGCGACCGAGGGCTGGTGGCGGCTGGGGATGCCTGAGGCCGTGCTGCTCCCTTGGCTTGTGGGGTCCCTGCCACCGCAGGCCGCTCGCGACTACCCCGTGTACCTACCGCATGGGAGCCCCACGGTCCCCCACAGGCTCCTGACCCTGACGCTGCTGCCCAGTCTGGAGCTGTGTCTGCTCTGCGGGCCGAGCCCACCCCTCAGCCAGCTAGGCGCGCAGCTTCTGGAGCGCTGGTGGCAGCCCCTGCTGGACCCACTGCGGGCCTGCCTGCCGCTGGGGCCCCGCGCGCTGCCCGAAGGCTTCCCCCTGCACACGGACATCCTCGGGCTGCTGCTCCTGAACCTGGAACTGAAACGCTGCCTCTTCACTGTGCAACCCTCGGGAAATAAAGAGCCTTCCCCAGAACAGCGCCGCCACCTCCTCCGCAACTTCTACACCCTGGTCACCAGCACATACTTCCCCCCAGAGCCTGGGGCATCCGAGAAGGCGGAGGATGCAGGGCACCGGTCCCAGCTGCCAAGAGCTTGCTACCTCGTGCTGGGGCCAGGCATGGGGTGGCAAGTAGTGGCTCTGCAGCTGGGGCCCCGACAGCTGCTGCTACTGCTGTCTCCTCAGAGCCCCACCCATGGGCTGCGAGCCCTGGCCACCCACACTCTGCATGCCCTCACCCCGTTCCTATGA

XM_004866875.1 Coding sequence

Ap2a1 adaptor-related protein complex 2, alpha 1 subunit, transcript variant X3

Length: 2814 bp    Location: 4539961..4513977   Strand: -
>XM_004866875.1
ATGCCGGCCGTGTCCAAGGGCGATGGGATGCGGGGGCTTGCGGTGTTCATCTCCGACATCCGGAACTGTAAGAGCAAAGAGGCTGAGATCAAGAGAATTAACAAGGAGCTGGCCAACATCCGGTCCAAGTTCAAAGGGGACAAGGCTTTGGATGGCTACAGCAAGAAAAAATATGTGTGCAAACTGCTCTTCATCTTCCTGCTTGGCCACGACATTGACTTCGGACACATGGAGGCTGTGAACCTGCTCAGCTCCAATAAGTACACAGAGAAGCAGATAGGTTACCTGTTCATCTCTGTGCTGGTGAACTCAAACTCGGAGCTGATCCGGCTCATCAACAACGCCATCAAGAACGACCTGGCCAGCCGCAACCCCACCTTCATGTGCCTGGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGGCGAGGCCTTCGCTGCCGACATCCCCCGCATCCTGGTAGCTGGGGACAGCATGGACAGCGTGAAGCAGAGTGCCGCCCTGTGCCTGCTGCGCCTCTACAAGGCCTCGCCCGACCTGGTGCCCATGGGCGAGTGGACGGCGCGCGTGGTGCACTTGCTCAACGATCAGCACATGGGTGTGGTCACTGCTGCTGTGAGCCTCATCACATGTCTCTGCAAGAAGAACCCCGATGACTTCAAGACCTGCATCTCCCTGGCTGTGTCTCGCCTGAGCCGGATCGTGTCCTCAGCATCCACCGACCTCCAGGACTACACCTACTACTTCGTCCCCGCGCCCTGGCTCTCAGTGAAGCTCCTGCGGCTGCTGCAGTGCTACCCCCCGCCAGAGGACGCGGCTGTGAAGGGGCGGCTGGTGGAGAGCCTGGAGACCGTGCTTAACAAGGCCCAGGAGCCTCCCAAGTCCAAGAAGGTGCAGCACTCCAACGCCAAGAACGCCATCCTCTTTGAGACCATCAGTCTCATCATCCACTACGACAGTGAGCCCAACCTCTTGGTGCGCGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGAGAGACCAACCTGCGCTACCTGGCACTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCACGAGGCCGTCAAGACCCACATCGACACCGTCATCAACGCCCTCAAGACCGAGCGGGATGTCAGCGTGCGGCAGCGAGCAGCAGATCTCCTCTACGCCATGTGTGACCGGAGCAACGCCAAGCAGATTGTGTCGGAGATGCTGCGCTACCTGGAGACAGCTGACTACGCCATCCGGGAAGAGATTGTGCTGAAGGTGGCCATCCTGGCGGAGAAGTATGCCGTGGACTACAGCTGGTACGTGGACACCATCCTCAACCTCATCCGCATCGCAGGCGACTATGTGAGTGAGGAGGTGTGGTACCGTGTGCTGCAGATTGTCACCAACCGAGATGATGTCCAGGGCTATGCTGCCAAGACTGTTTTTGAGGCCCTCCAGGCCCCAGCCTGTCACGAGAACATGGTGAAAGTCGGTGGCTACATCCTTGGGGAGTTTGGGAACCTGATTGCTGGGGATCCCCGCTCCAGCCCGCCGGTGCAGTTCTCCCTGCTGCATTCCAAGTTCCACCTGTGCAGCGTTGCAACACGGGCGCTGCTGCTGTCCACCTACATCAAGTTCATCAACCTCTTCCCTGAGACCAAGGCCACCATCCAGGGCGTGCTGCGGGCCGGCTCCCAGCTGCGCAACGCCGATGTGGAGCTGCAGCAGCGCGCCGTGGAATACCTCACCCTCAGCTCTGTGGCCAGCACCGATGTCCTGGCCACGGTGCTGGAGGAGATGCCACCCTTCCCCGAGCGCGAGTCGTCCATCCTGGCCAAGCTGAAACGAAAGAAGGGCCCAGGGGCCGCCAGCGCCCTGGATGACGGCCGGAGGGACGCCAGCAGCAGTGACATCAATGGGGCTGTGGAGCCCACCCCCAGCACCGTGTCCACCCCCTCGCCCTCTGCTGACCTCCTGGGGCTGCGGGCAGCCCCTCCCCCAGCGGCAGCCCCGGCTCCTGCCAGTGCGGGAAACCTCCTGGTGGACGTGTTCTCCGATGGCCCGGCTGCCCAGCCCAGCCTGGGCCCCACCCCCGAGGAAGCCTTCCTCAGGTTTGTATGCAAGAACAACGGGGTCTTGTTCGAGAATCAGCTGCTGCAGATCGGAGTCAAATCGGAGTTCCGGCAGAACCTGGGCCGCATGTATCTCTTCTATGGCAACAAGACCTCCGTGCAGTTCCAGAACTTCTTGCCCACGGTCGTCCACCCAGGAGACCTCCAGACTCAGCTGGCTGTACAGACGAAGCGTGTGGCCGCACAGGTGGATGGTGGGGCGCAGGTGCAGCAGGTGCTCAACATAGAGTGTCTGAGGGACTTCCTGACGCCTCCGCTGCTGTCTGTGCGCTTCCGATACGGTGGTGCACCCCAGTCCCTCACCCTGAAGCTCCCGGTGACCATCAACAAGTTCTTCCAGCCCACGGAGATGGCAGCCCAGGACTTCTTCCAGCGTTGGAAGCAGCTGAGCCTCCCTCTGCAGGAGGCGCAGAAAATCTTCAAAGCCAACCACCCCATGGATGCAGAAGTCACCAAGGCCAAGCTCTTGGGGTTTGGCTCTGCCCTCCTGGACAATGTGGACCCTAACCCTGAGAACTTTGTGGGGGCCGGAATCATCCAGACGAAAGCCCTGCAGGTGGGCTGTCTGCTCCGGCTGGAGCCCAACGCCCAGGCTCAGATGTACCGGCTGACCCTGCGCACCAGCAAGGAGTCCGTCTCCCGTCACCTCTGTGAGCTTTTGGCCCAGCAGTTCTGA

XM_004866874.1 Coding sequence

Ap2a1 adaptor-related protein complex 2, alpha 1 subunit, transcript variant X2

Length: 2871 bp    Location: 4539961..4513977   Strand: -
>XM_004866874.1
ATGCCGGCCGTGTCCAAGGGCGATGGGATGCGGGGGCTTGCGGTGTTCATCTCCGACATCCGGAACTGTAAGAGCAAAGAGGCTGAGATCAAGAGAATTAACAAGGAGCTGGCCAACATCCGGTCCAAGTTCAAAGGGGACAAGGCTTTGGATGGCTACAGCAAGAAAAAATATGTGTGCAAACTGCTCTTCATCTTCCTGCTTGGCCACGACATTGACTTCGGACACATGGAGGCTGTGAACCTGCTCAGCTCCAATAAGTACACAGAGAAGCAGATAGGTTACCTGTTCATCTCTGTGCTGGTGAACTCAAACTCGGAGCTGATCCGGCTCATCAACAACGCCATCAAGAACGACCTGGCCAGCCGCAACCCCACCTTCATGTGCCTGGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGGCGAGGCCTTCGCTGCCGACATCCCCCGCATCCTGGTAGCTGGGGACAGCATGGACAGCGTGAAGCAGAGTGCCGCCCTGTGCCTGCTGCGCCTCTACAAGGCCTCGCCCGACCTGGTGCCCATGGGCGAGTGGACGGCGCGCGTGGTGCACTTGCTCAACGATCAGCACATGGGTGTGGTCACTGCTGCTGTGAGCCTCATCACATGTCTCTGCAAGAAGAACCCCGATGACTTCAAGACCTGCATCTCCCTGGCTGTGTCTCGCCTGAGCCGGATCGTGTCCTCAGCATCCACCGACCTCCAGGACTACACCTACTACTTCGTCCCCGCGCCCTGGCTCTCAGTGAAGCTCCTGCGGCTGCTGCAGTGCTACCCCCCGCCAGAGGACGCGGCTGTGAAGGGGCGGCTGGTGGAGAGCCTGGAGACCGTGCTTAACAAGGCCCAGGAGCCTCCCAAGTCCAAGAAGGTGCAGCACTCCAACGCCAAGAACGCCATCCTCTTTGAGACCATCAGTCTCATCATCCACTACGACAGTGAGCCCAACCTCTTGGTGCGCGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGAGAGACCAACCTGCGCTACCTGGCACTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCACGAGGCCGTCAAGACCCACATCGACACCGTCATCAACGCCCTCAAGACCGAGCGGGATGTCAGCGTGCGGCAGCGAGCAGCAGATCTCCTCTACGCCATGTGTGACCGGAGCAACGCCAAGCAGATTGTGTCGGAGATGCTGCGCTACCTGGAGACAGCTGACTACGCCATCCGGGAAGAGATTGTGCTGAAGGTGGCCATCCTGGCGGAGAAGTATGCCGTGGACTACAGCTGGTACGTGGACACCATCCTCAACCTCATCCGCATCGCAGGCGACTATGTGAGTGAGGAGGTGTGGTACCGTGTGCTGCAGATTGTCACCAACCGAGATGATGTCCAGGGCTATGCTGCCAAGACTGTTTTTGAGGCCCTCCAGGCCCCAGCCTGTCACGAGAACATGGTGAAAGTCGGTGGCTACATCCTTGGGGAGTTTGGGAACCTGATTGCTGGGGATCCCCGCTCCAGCCCGCCGGTGCAGTTCTCCCTGCTGCATTCCAAGTTCCACCTGTGCAGCGTTGCAACACGGGCGCTGCTGCTGTCCACCTACATCAAGTTCATCAACCTCTTCCCTGAGACCAAGGCCACCATCCAGGGCGTGCTGCGGGCCGGCTCCCAGCTGCGCAACGCCGATGTGGAGCTGCAGCAGCGCGCCGTGGAATACCTCACCCTCAGCTCTGTGGCCAGCACCGATGTCCTGGCCACGGTGCTGGAGGAGATGCCACCCTTCCCCGAGCGCGAGTCGTCCATCCTGGCCAAGCTGAAACGAAAGAAGGGCCCAGGGGCCGCCAGCGCCCTGGATGACGGCCGGAGGGACGCCAGCAGCAGTGACATCAATGGGGCTGTGGAGCCCACCCCCAGCACCGTGTCCACCCCCTCGCCCTCTGCTGACCTCCTGGGGCTGCGGGCAGCCCCTCCCCCAGCGGCAGCCCCGGCTCCTGCCAGTGCGGGAAACCTCCTGGTGGACGTGTTCTCCGATGGCCCGGCTGCCCAGCCCAGCCTGGGCCCCACCCCCGAGGAAGCCTTCCTCAGCCCAGGTCCTGAGGACATCGGCCCTCCCGTCCCAGAAGCGGATGAACTGCTGAATAAGTTTGTATGCAAGAACAACGGGGTCTTGTTCGAGAATCAGCTGCTGCAGATCGGAGTCAAATCGGAGTTCCGGCAGAACCTGGGCCGCATGTATCTCTTCTATGGCAACAAGACCTCCGTGCAGTTCCAGAACTTCTTGCCCACGGTCGTCCACCCAGGAGACCTCCAGACTCAGCTGGCTGTACAGACGAAGCGTGTGGCCGCACAGGTGGATGGTGGGGCGCAGGTGCAGCAGGTGCTCAACATAGAGTGTCTGAGGGACTTCCTGACGCCTCCGCTGCTGTCTGTGCGCTTCCGATACGGTGGTGCACCCCAGTCCCTCACCCTGAAGCTCCCGGTGACCATCAACAAGTTCTTCCAGCCCACGGAGATGGCAGCCCAGGACTTCTTCCAGCGTTGGAAGCAGCTGAGCCTCCCTCTGCAGGAGGCGCAGAAAATCTTCAAAGCCAACCACCCCATGGATGCAGAAGTCACCAAGGCCAAGCTCTTGGGGTTTGGCTCTGCCCTCCTGGACAATGTGGACCCTAACCCTGAGAACTTTGTGGGGGCCGGAATCATCCAGACGAAAGCCCTGCAGGTGGGCTGTCTGCTCCGGCTGGAGCCCAACGCCCAGGCTCAGATGTACCGGCTGACCCTGCGCACCAGCAAGGAGTCCGTCTCCCGTCACCTCTGTGAGCTTTTGGCCCAGCAGTTCTGA

XM_004866873.1 Coding sequence

Ap2a1 adaptor-related protein complex 2, alpha 1 subunit, transcript variant X1

High confidence: 4 potential gene matches
Length: 2937 bp    Location: 4539961..4513977   Strand: -
>XM_004866873.1
ATGCCGGCCGTGTCCAAGGGCGATGGGATGCGGGGGCTTGCGGTGTTCATCTCCGACATCCGGAACTGTAAGAGCAAAGAGGCTGAGATCAAGAGAATTAACAAGGAGCTGGCCAACATCCGGTCCAAGTTCAAAGGGGACAAGGCTTTGGATGGCTACAGCAAGAAAAAATATGTGTGCAAACTGCTCTTCATCTTCCTGCTTGGCCACGACATTGACTTCGGACACATGGAGGCTGTGAACCTGCTCAGCTCCAATAAGTACACAGAGAAGCAGATAGGTTACCTGTTCATCTCTGTGCTGGTGAACTCAAACTCGGAGCTGATCCGGCTCATCAACAACGCCATCAAGAACGACCTGGCCAGCCGCAACCCCACCTTCATGTGCCTGGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGGCGAGGCCTTCGCTGCCGACATCCCCCGCATCCTGGTAGCTGGGGACAGCATGGACAGCGTGAAGCAGAGTGCCGCCCTGTGCCTGCTGCGCCTCTACAAGGCCTCGCCCGACCTGGTGCCCATGGGCGAGTGGACGGCGCGCGTGGTGCACTTGCTCAACGATCAGCACATGGGTGTGGTCACTGCTGCTGTGAGCCTCATCACATGTCTCTGCAAGAAGAACCCCGATGACTTCAAGACCTGCATCTCCCTGGCTGTGTCTCGCCTGAGCCGGATCGTGTCCTCAGCATCCACCGACCTCCAGGACTACACCTACTACTTCGTCCCCGCGCCCTGGCTCTCAGTGAAGCTCCTGCGGCTGCTGCAGTGCTACCCCCCGCCAGAGGACGCGGCTGTGAAGGGGCGGCTGGTGGAGAGCCTGGAGACCGTGCTTAACAAGGCCCAGGAGCCTCCCAAGTCCAAGAAGGTGCAGCACTCCAACGCCAAGAACGCCATCCTCTTTGAGACCATCAGTCTCATCATCCACTACGACAGTGAGCCCAACCTCTTGGTGCGCGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGAGAGACCAACCTGCGCTACCTGGCACTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCACGAGGCCGTCAAGACCCACATCGACACCGTCATCAACGCCCTCAAGACCGAGCGGGATGTCAGCGTGCGGCAGCGAGCAGCAGATCTCCTCTACGCCATGTGTGACCGGAGCAACGCCAAGCAGATTGTGTCGGAGATGCTGCGCTACCTGGAGACAGCTGACTACGCCATCCGGGAAGAGATTGTGCTGAAGGTGGCCATCCTGGCGGAGAAGTATGCCGTGGACTACAGCTGGTACGTGGACACCATCCTCAACCTCATCCGCATCGCAGGCGACTATGTGAGTGAGGAGGTGTGGTACCGTGTGCTGCAGATTGTCACCAACCGAGATGATGTCCAGGGCTATGCTGCCAAGACTGTTTTTGAGGCCCTCCAGGCCCCAGCCTGTCACGAGAACATGGTGAAAGTCGGTGGCTACATCCTTGGGGAGTTTGGGAACCTGATTGCTGGGGATCCCCGCTCCAGCCCGCCGGTGCAGTTCTCCCTGCTGCATTCCAAGTTCCACCTGTGCAGCGTTGCAACACGGGCGCTGCTGCTGTCCACCTACATCAAGTTCATCAACCTCTTCCCTGAGACCAAGGCCACCATCCAGGGCGTGCTGCGGGCCGGCTCCCAGCTGCGCAACGCCGATGTGGAGCTGCAGCAGCGCGCCGTGGAATACCTCACCCTCAGCTCTGTGGCCAGCACCGATGTCCTGGCCACGGTGCTGGAGGAGATGCCACCCTTCCCCGAGCGCGAGTCGTCCATCCTGGCCAAGCTGAAACGAAAGAAGGGCCCAGGGGCCGCCAGCGCCCTGGATGACGGCCGGAGGGACGCCAGCAGCAGTGACATCAATGGGGCTGTGGAGCCCACCCCCAGCACCGTGTCCACCCCCTCGCCCTCTGCTGACCTCCTGGGGCTGCGGGCAGCCCCTCCCCCAGCGGCAGCCCCGGCTCCTGCCAGTGCGGGAAACCTCCTGGTGGACGTGTTCTCCGATGGCCCGGCTGCCCAGCCCAGCCTGGGCCCCACCCCCGAGGAAGCCTTCCTCAGCGAGCTGGAGCCGCCTGCCCCTGAGAGCCCCATGGCTTTGCTGGCTGACCCAGCTCCAGCTGCTGACCCAGGTCCTGAGGACATCGGCCCTCCCGTCCCAGAAGCGGATGAACTGCTGAATAAGTTTGTATGCAAGAACAACGGGGTCTTGTTCGAGAATCAGCTGCTGCAGATCGGAGTCAAATCGGAGTTCCGGCAGAACCTGGGCCGCATGTATCTCTTCTATGGCAACAAGACCTCCGTGCAGTTCCAGAACTTCTTGCCCACGGTCGTCCACCCAGGAGACCTCCAGACTCAGCTGGCTGTACAGACGAAGCGTGTGGCCGCACAGGTGGATGGTGGGGCGCAGGTGCAGCAGGTGCTCAACATAGAGTGTCTGAGGGACTTCCTGACGCCTCCGCTGCTGTCTGTGCGCTTCCGATACGGTGGTGCACCCCAGTCCCTCACCCTGAAGCTCCCGGTGACCATCAACAAGTTCTTCCAGCCCACGGAGATGGCAGCCCAGGACTTCTTCCAGCGTTGGAAGCAGCTGAGCCTCCCTCTGCAGGAGGCGCAGAAAATCTTCAAAGCCAACCACCCCATGGATGCAGAAGTCACCAAGGCCAAGCTCTTGGGGTTTGGCTCTGCCCTCCTGGACAATGTGGACCCTAACCCTGAGAACTTTGTGGGGGCCGGAATCATCCAGACGAAAGCCCTGCAGGTGGGCTGTCTGCTCCGGCTGGAGCCCAACGCCCAGGCTCAGATGTACCGGCTGACCCTGCGCACCAGCAAGGAGTCCGTCTCCCGTCACCTCTGTGAGCTTTTGGCCCAGCAGTTCTGA

XM_004866876.1 Coding sequence

Ap2a1 adaptor-related protein complex 2, alpha 1 subunit, transcript variant X4

Length: 2832 bp    Location: 4539961..4513977   Strand: -
>XM_004866876.1
ATGCCGGCCGTGTCCAAGGGCGATGGGATGCGGGGGCTTGCGGTGTTCATCTCCGACATCCGGAACTGTAAGAGCAAAGAGGCTGAGATCAAGAGAATTAACAAGGAGCTGGCCAACATCCGGTCCAAGTTCAAAGGGGACAAGGCTTTGGATGGCTACAGCAAGAAAAAATATGTGTGCAAACTGCTCTTCATCTTCCTGCTTGGCCACGACATTGACTTCGGACACATGGAGGCTGTGAACCTGCTCAGCTCCAATAAGTACACAGAGAAGCAGATAGGTTACCTGTTCATCTCTGTGCTGGTGAACTCAAACTCGGAGCTGATCCGGCTCATCAACAACGCCATCAAGAACGACCTGGCCAGCCGCAACCCCACCTTCATGTGCCTGGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGGCGAGGCCTTCGCTGCCGACATCCCCCGCATCCTGGTAGCTGGGGACAGCATGGACAGCGTGAAGCAGAGTGCCGCCCTGTGCCTGCTGCGCCTCTACAAGGCCTCGCCCGACCTGGTGCCCATGGGCGAGTGGACGGCGCGCGTGGTGCACTTGCTCAACGATCAGCACATGGGTGTGGTCACTGCTGCTGTGAGCCTCATCACATGTCTCTGCAAGAAGAACCCCGATGACTTCAAGACCTGCATCTCCCTGGCTGTGTCTCGCCTGAGCCGGATCGTGTCCTCAGCATCCACCGACCTCCAGGACTACACCTACTACTTCGTCCCCGCGCCCTGGCTCTCAGTGAAGCTCCTGCGGCTGCTGCAGTGCTACCCCCCGCCAGAGGACGCGGCTGTGAAGGGGCGGCTGGTGGAGAGCCTGGAGACCGTGCTTAACAAGGCCCAGGAGCCTCCCAAGTCCAAGAAGGTGCAGCACTCCAACGCCAAGAACGCCATCCTCTTTGAGACCATCAGTCTCATCATCCACTACGACAGTGAGCCCAACCTCTTGGTGCGCGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGAGAGACCAACCTGCGCTACCTGGCACTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCACGAGGCCGTCAAGACCCACATCGACACCGTCATCAACGCCCTCAAGACCGAGCGGGATGTCAGCGTGCGGCAGCGAGCAGCAGATCTCCTCTACGCCATGTGTGACCGGAGCAACGCCAAGCAGATTGTGTCGGAGATGCTGCGCTACCTGGAGACAGCTGACTACGCCATCCGGGAAGAGATTGTGCTGAAGGTGGCCATCCTGGCGGAGAAGTATGCCGTGGACTACAGCTGGTACGTGGACACCATCCTCAACCTCATCCGCATCGCAGGCGACTATGTGAGTGAGGAGGTGTGGTACCGTGTGCTGCAGATTGTCACCAACCGAGATGATGTCCAGGGCTATGCTGCCAAGACTGTTTTTGAGGCCCTCCAGGCCCCAGCCTGTCACGAGAACATGGTGAAAGTCGGTGGCTACATCCTTGGGGAGTTTGGGAACCTGATTGCTGGGGATCCCCGCTCCAGCCCGCCGGTGCAGTTCTCCCTGCTGCATTCCAAGTTCCACCTGTGCAGCGTTGCAACACGGGCGCTGCTGCTGTCCACCTACATCAAGTTCATCAACCTCTTCCCTGAGACCAAGGCCACCATCCAGGGCGTGCTGCGGGCCGGCTCCCAGCTGCGCAACGCCGATGTGGAGCTGCAGCAGCGCGCCGTGGAATACCTCACCCTCAGCTCTGTGGCCAGCACCGATGTCCTGGCCACGGTGCTGGAGGAGATGCCACCCTTCCCCGAGCGCGAGTCGTCCATCCTGGCCAAGCTGAAACGAAAGAAGGGCCCAGGGGCCGCCAGCGCCCTGGATGACGGCCGGAGGGACGCCAGCAGCAGTGACATCAATGGGGCTGTGGAGCCCACCCCCAGCACCGTGGTGAGCCCGGGGGCGGCTTCCACCCCCTCGCCCTCTGCTGACCTCCTGGGGCTGCGGGCAGCCCCTCCCCCAGCGGCAGCCCCGGCTCCTGCCAGTGCGGGAAACCTCCTGGTGGACGTGTTCTCCGATGGCCCGGCTGCCCAGCCCAGCCTGGGCCCCACCCCCGAGGAAGCCTTCCTCAGGTTTGTATGCAAGAACAACGGGGTCTTGTTCGAGAATCAGCTGCTGCAGATCGGAGTCAAATCGGAGTTCCGGCAGAACCTGGGCCGCATGTATCTCTTCTATGGCAACAAGACCTCCGTGCAGTTCCAGAACTTCTTGCCCACGGTCGTCCACCCAGGAGACCTCCAGACTCAGCTGGCTGTACAGACGAAGCGTGTGGCCGCACAGGTGGATGGTGGGGCGCAGGTGCAGCAGGTGCTCAACATAGAGTGTCTGAGGGACTTCCTGACGCCTCCGCTGCTGTCTGTGCGCTTCCGATACGGTGGTGCACCCCAGTCCCTCACCCTGAAGCTCCCGGTGACCATCAACAAGTTCTTCCAGCCCACGGAGATGGCAGCCCAGGACTTCTTCCAGCGTTGGAAGCAGCTGAGCCTCCCTCTGCAGGAGGCGCAGAAAATCTTCAAAGCCAACCACCCCATGGATGCAGAAGTCACCAAGGCCAAGCTCTTGGGGTTTGGCTCTGCCCTCCTGGACAATGTGGACCCTAACCCTGAGAACTTTGTGGGGGCCGGAATCATCCAGACGAAAGCCCTGCAGGTGGGCTGTCTGCTCCGGCTGGAGCCCAACGCCCAGGCTCAGATGTACCGGCTGACCCTGCGCACCAGCAAGGAGTCCGTCTCCCGTCACCTCTGTGAGCTTTTGGCCCAGCAGTTCTGA

XM_004866883.1 Coding sequence

Tsks testis-specific serine kinase substrate, transcript variant X1

Length: 1896 bp    Location: 4546432..4561003   Strand: +
>XM_004866883.1
ATGGCAAGTGTGGTCGTGAAGACCATCTGGCAGTCCAAGGAGTTCCATCAGGCTGGGGACACCCCTGCCAGGGTCGAGAGGAGGATCCAGCTGGGCCCCGAGGCTCCCGGGAGCATGACCGGCCCAGCCAAGGGAGTCAGGAAGAAAAAGAAGGCTGTGTCGTTCCACAGGGAGACCAGTGAAGGCAGAAGAAAGCAGGAAGCGGGGACTGAAGAGGCAGAAGAAAGGCAGCAGGGGCTGAAGAGAGAGAAGATAGCGGACCTGGGGGAAGGCGAGAATGAAGAAAGTGGGCTCGTGGAGCCGCGGACGCCACACGAGCCAGTGGACTGGTGTCTCAACCTCAGACGGTCCTCGGGCTGCACCAACGTGTCCCTGCTCAACCTGGCCGCCGCTGTGGAGCCCTGGGACTCCTCCGGCACCAACTGCATCACGGAAGACAGCGGCCCGCTGGAGCTGCCTGGCCCCCCGGCTGCCCCCGCCCCACCCTGGGCTGCGGATGACCCGGACATCAAGGAACTTCTGAGTGGGCTCAACAGTGGACTAGTCCATGCCAAGGACTCTGTCATCAGCTTGAAGGAAAAGACCAGCTGGGTAAACCAGCACGTGCAGACCCTGCAGAGCGAATGTTCCCTGCTGAGCGAGAATCTAGAGAGAAGGCGGCAGGAGGCGGAGGAGCTGGAGGGGTACTGTAGCCAACTCAAGGAGAACTGCAAGAAGGTGACCCGCTCGGTGGAGGATGCTGAAATCAAAACGAACGTCTTGAAGCAGAACTCAGCCCTGTTGGAGGAGAAGCTGCGATACCTCCAGCAGGAACTGCAGGACGAGACGCCGAGGCAGGAGGTCGAGATGCAGGAGCTGGAGCAGAAGCTGGAGGCCAGCCTCTCCCACTCCGGCCTCTCAGGAAACCCCGAAGAGGCCGCAAGGTTACGAAGCACGGCCCCAGGCGGCTGTGGAACTGGGCCCGGGGCGGGAGAAACGCCCCACACGAGCGAGCAGGAGCTGCAGAAGGTCTCAGCCAGCCTGGAGGACCTGAGGAGGGAGGTGTCCTCACTGGCCGCACGGTGGCATCAAGAGGAGGGGGCGGTGCAGGAAGCCCTGAGGCTGCTCGGGGGTCTGGGCGGAAGGCTCGACGGCTTCATGGGTCAGTGGGAGCGCGCGCAATGCGACCAGACGCAGACAGCGCGGAGCCTGCAGGAGCTGCGCAGACAGGCGGACCAGCTGTGCACCTTGGTGGAGCGCTCAGCAGTGTCTCTGGCTTCCCTGAGGAGCGAACTGGAGGGGCTGGGTCCGGTCAAACCAATTCTGGAGGAGCTGGCACGGCAGTTTCGGAACTCTCAAAGGGTACCTGACCACTCCATGAACCCGGATCGGTCGTCCCAAGGCTCCTGTGCTCGCTGTGCCAGCCAGGGACAGCAATTGTCCATGGAGTCCCTGCAGCATCTGTTGGAGCGAGCGCTGACCCCACTAGTGGATGAGGTGAAGCAGAGAAACCTGACGCCTCCTGCCTGTCCCAGCTGCCAGAGGCTACACAAGAAGATTCTGCCCAGTCCAGCAAGCCCAGCAGTGCCTACGCTCCTCTCCCCAGGAGCTGGAGCGCCAGGCCTTGGCCAAACACATCCGGGCAGAGGCCCTGAGCTCCACCCTTCGGCTGGCCCAAGACGAGGCCTTACGGGCCAAGAATCTGCTCCTGACAGACAAGATGAAGCCGGAGTGAGGAAGGAGGCAGAGGGCATGGGAGGAGGGGAGAAGGTGGCCACCCTGGACTATCTCCATCTGAAGATGTGCTCCCTCCATGACCAGCTCAGCAACCTGCCACTTGAGGGCTCCACAGGGACAATGGGGGAAGGAAGCGGAGGGGCTGCCCCAAAATGTGGGAGCCCAGCCCCCAAACAATAA

XM_004866884.1 Coding sequence

Tsks testis-specific serine kinase substrate, transcript variant X2

Length: 1821 bp    Location: 4546432..4561003   Strand: +
>XM_004866884.1
ATGGCAAGTGTGGTCGTGAAGACCATCTGGCAGTCCAAGGAGTTCCATCAGGCTGGGGACACCCCTGCCAGGGTCGAGAGGAGGATCCAGCTGGGCCCCGAGGCTCCCGGGAGCATGACCGGCCCAGCCAAGGGAGTCAGGAAGAAAAAGAAGGCTGTGTCGTTCCACAGGGAGACCAGTGAAGGCAGAAGAAAGCAGGAAGCGGGGACTGAAGAGGCAGAAGAAAGGCAGCAGGGGCTGAAGAGAGAGAAGATAGCGGACCTGGGGGAAGGCGAGAATGAAGAAAGTGGGCTCGTGGAGCCGCGGACGCCACACGAGCCAGTGGACTGGTGTCTCAACCTCAGACGGTCCTCGGGCTGCACCAACGTGTCCCTGCTCAACCTGGCCGCCGCTGTGGAGCCCTGGGACTCCTCCGGCACCAACTGCATCACGGAAGACAGCGGCCCGCTGGAGCTGCCTGGCCCCCCGGCTGCCCCCGCCCCACCCTGGGCTGCGGATGACCCGGACATCAAGGAACTTCTGAGTGGGCTCAACAGTGGACTAGTCCATGCCAAGGACTCTGTCATCAGCTTGAAGGAAAAGACCAGCTGGGTAAACCAGCACGTGCAGACCCTGCAGAGCGAATGTTCCCTGCTGAGCGAGAATCTAGAGAGAAGGCGGCAGGAGGCGGAGGAGCTGGAGGGGTACTGTAGCCAACTCAAGGAGAACTGCAAGAAGGTGACCCGCTCGGTGGAGGATGCTGAAATCAAAACGAACGTCTTGAAGCAGAACTCAGCCCTGTTGGAGGAGAAGCTGCGATACCTCCAGCAGGAACTGCAGGACGAGACGCCGAGGCAGGAGGTCGAGATGCAGGAGCTGGAGCAGAAGCTGGAGGCCAGCCTCTCCCACTCCGGCCTCTCAGGAAACCCCGAAGAGGCCGCAAGGTTACGAAGCACGGCCCCAGGCGGCTGTGGAACTGGGCCCGGGGCGGGAGAAACGCCCCACACGAGCGAGCAGGAGCTGCAGAAGGTCTCAGCCAGCCTGGAGGACCTGAGGAGGGAGGTGTCCTCACTGGCCGCACGGTGGCATCAAGAGGAGGGGGCGGTGCAGGAAGCCCTGAGGCTGCTCGGGGGTCTGGGCGGAAGGCTCGACGGCTTCATGGGTCAGTGGGAGCGCGCGCAATGCGACCAGACGCAGACAGCGCGGAGCCTGCAGGAGCTGCGCAGACAGGCGGACCAGCTGTGCACCTTGGTGGAGCGCTCAGCAGTGTCTCTGGCTTCCCTGAGGAGCGAACTGGAGGGGCTGGGTCCGGTCAAACCAATTCTGGAGGAGCTGGCACGGCAGTTTCGGAACTCTCAAAGGGTACCTGACCACTCCATGAACCCGGATCGGTCGTCCCAAGGCTCCTGTGCTCGCTGTGCCAGCCAGGGACAGCAATTGTCCATGGAGTCCCTGCAGCATCTGTTGGAGCGAGCGCTGACCCCACTAGTGGATGAGGTGAAGCAGAGAAACCTGACGCCTCCTGCCTGTCCCAGCTGCCAGAGGCTACACAAGAAGATTCTGGAGCTGGAGCGCCAGGCCTTGGCCAAACACATCCGGGCAGAGGCCCTGAGCTCCACCCTTCGGCTGGCCCAAGACGAGGCCTTACGGGCCAAGAATCTGCTCCTGACAGACAAGATGAAGCCGGAGGAGAAGGTGGCCACCCTGGACTATCTCCATCTGAAGATGTGCTCCCTCCATGACCAGCTCAGCAACCTGCCACTTGAGGGCTCCACAGGGACAATGGGGGAAGGAAGCGGAGGGGCTGCCCCAAAATGTGGGAGCCCAGCCCCCAAACAATAA

XM_004866885.1 Coding sequence

Tsks testis-specific serine kinase substrate, transcript variant X3

Length: 1773 bp    Location: 4546432..4561003   Strand: +
>XM_004866885.1
ATGGCAAGTGTGGTCGTGAAGACCATCTGGCAGTCCAAGGAGTTCCATCAGGCTGGGGACACCCCTGCCAGGGTCGAGAGGAGGATCCAGCTGGGCCCCGAGGCTCCCGGGAGCATGACCGGCCCAGCCAAGGGAGTCAGGAAGAAAAAGAAGGCTGTGTCGTTCCACAGCGTGGAGCCGCGGACGCCACACGAGCCAGTGGACTGGTGTCTCAACCTCAGACGGTCCTCGGGCTGCACCAACGTGTCCCTGCTCAACCTGGCCGCCGCTGTGGAGCCCTGGGACTCCTCCGGCACCAACTGCATCACGGAAGACAGCGGCCCGCTGGAGCTGCCTGGCCCCCCGGCTGCCCCCGCCCCACCCTGGGCTGCGGATGACCCGGACATCAAGGAACTTCTGAGTGGGCTCAACAGTGGACTAGTCCATGCCAAGGACTCTGTCATCAGCTTGAAGGAAAAGACCAGCTGGGTAAACCAGCACGTGCAGACCCTGCAGAGCGAATGTTCCCTGCTGAGCGAGAATCTAGAGAGAAGGCGGCAGGAGGCGGAGGAGCTGGAGGGGTACTGTAGCCAACTCAAGGAGAACTGCAAGAAGGTGACCCGCTCGGTGGAGGATGCTGAAATCAAAACGAACGTCTTGAAGCAGAACTCAGCCCTGTTGGAGGAGAAGCTGCGATACCTCCAGCAGGAACTGCAGGACGAGACGCCGAGGCAGGAGGTCGAGATGCAGGAGCTGGAGCAGAAGCTGGAGGCCAGCCTCTCCCACTCCGGCCTCTCAGGAAACCCCGAAGAGGCCGCAAGGTTACGAAGCACGGCCCCAGGCGGCTGTGGAACTGGGCCCGGGGCGGGAGAAACGCCCCACACGAGCGAGCAGGAGCTGCAGAAGGTCTCAGCCAGCCTGGAGGACCTGAGGAGGGAGGTGTCCTCACTGGCCGCACGGTGGCATCAAGAGGAGGGGGCGGTGCAGGAAGCCCTGAGGCTGCTCGGGGGTCTGGGCGGAAGGCTCGACGGCTTCATGGGTCAGTGGGAGCGCGCGCAATGCGACCAGACGCAGACAGCGCGGAGCCTGCAGGAGCTGCGCAGACAGGCGGACCAGCTGTGCACCTTGGTGGAGCGCTCAGCAGTGTCTCTGGCTTCCCTGAGGAGCGAACTGGAGGGGCTGGGTCCGGTCAAACCAATTCTGGAGGAGCTGGCACGGCAGTTTCGGAACTCTCAAAGGGTACCTGACCACTCCATGAACCCGGATCGGTCGTCCCAAGGCTCCTGTGCTCGCTGTGCCAGCCAGGGACAGCAATTGTCCATGGAGTCCCTGCAGCATCTGTTGGAGCGAGCGCTGACCCCACTAGTGGATGAGGTGAAGCAGAGAAACCTGACGCCTCCTGCCTGTCCCAGCTGCCAGAGGCTACACAAGAAGATTCTGCCCAGTCCAGCAAGCCCAGCAGTGCCTACGCTCCTCTCCCCAGGAGCTGGAGCGCCAGGCCTTGGCCAAACACATCCGGGCAGAGGCCCTGAGCTCCACCCTTCGGCTGGCCCAAGACGAGGCCTTACGGGCCAAGAATCTGCTCCTGACAGACAAGATGAAGCCGGAGTGAGGAAGGAGGCAGAGGGCATGGGAGGAGGGGAGAAGGTGGCCACCCTGGACTATCTCCATCTGAAGATGTGCTCCCTCCATGACCAGCTCAGCAACCTGCCACTTGAGGGCTCCACAGGGACAATGGGGGAAGGAAGCGGAGGGGCTGCCCCAAAATGTGGGAGCCCAGCCCCCAAACAATAA

XM_004866888.1 Coding sequence

Tsks testis-specific serine kinase substrate, transcript variant X6

Length: 1698 bp    Location: 4546432..4561003   Strand: +
>XM_004866888.1
ATGGCAAGTGTGGTCGTGAAGACCATCTGGCAGTCCAAGGAGTTCCATCAGGCTGGGGACACCCCTGCCAGGGTCGAGAGGAGGATCCAGCTGGGCCCCGAGGCTCCCGGGAGCATGACCGGCCCAGCCAAGGGAGTCAGGAAGAAAAAGAAGGCTGTGTCGTTCCACAGCGTGGAGCCGCGGACGCCACACGAGCCAGTGGACTGGTGTCTCAACCTCAGACGGTCCTCGGGCTGCACCAACGTGTCCCTGCTCAACCTGGCCGCCGCTGTGGAGCCCTGGGACTCCTCCGGCACCAACTGCATCACGGAAGACAGCGGCCCGCTGGAGCTGCCTGGCCCCCCGGCTGCCCCCGCCCCACCCTGGGCTGCGGATGACCCGGACATCAAGGAACTTCTGAGTGGGCTCAACAGTGGACTAGTCCATGCCAAGGACTCTGTCATCAGCTTGAAGGAAAAGACCAGCTGGGTAAACCAGCACGTGCAGACCCTGCAGAGCGAATGTTCCCTGCTGAGCGAGAATCTAGAGAGAAGGCGGCAGGAGGCGGAGGAGCTGGAGGGGTACTGTAGCCAACTCAAGGAGAACTGCAAGAAGGTGACCCGCTCGGTGGAGGATGCTGAAATCAAAACGAACGTCTTGAAGCAGAACTCAGCCCTGTTGGAGGAGAAGCTGCGATACCTCCAGCAGGAACTGCAGGACGAGACGCCGAGGCAGGAGGTCGAGATGCAGGAGCTGGAGCAGAAGCTGGAGGCCAGCCTCTCCCACTCCGGCCTCTCAGGAAACCCCGAAGAGGCCGCAAGGTTACGAAGCACGGCCCCAGGCGGCTGTGGAACTGGGCCCGGGGCGGGAGAAACGCCCCACACGAGCGAGCAGGAGCTGCAGAAGGTCTCAGCCAGCCTGGAGGACCTGAGGAGGGAGGTGTCCTCACTGGCCGCACGGTGGCATCAAGAGGAGGGGGCGGTGCAGGAAGCCCTGAGGCTGCTCGGGGGTCTGGGCGGAAGGCTCGACGGCTTCATGGGTCAGTGGGAGCGCGCGCAATGCGACCAGACGCAGACAGCGCGGAGCCTGCAGGAGCTGCGCAGACAGGCGGACCAGCTGTGCACCTTGGTGGAGCGCTCAGCAGTGTCTCTGGCTTCCCTGAGGAGCGAACTGGAGGGGCTGGGTCCGGTCAAACCAATTCTGGAGGAGCTGGCACGGCAGTTTCGGAACTCTCAAAGGGTACCTGACCACTCCATGAACCCGGATCGGTCGTCCCAAGGCTCCTGTGCTCGCTGTGCCAGCCAGGGACAGCAATTGTCCATGGAGTCCCTGCAGCATCTGTTGGAGCGAGCGCTGACCCCACTAGTGGATGAGGTGAAGCAGAGAAACCTGACGCCTCCTGCCTGTCCCAGCTGCCAGAGGCTACACAAGAAGATTCTGGAGCTGGAGCGCCAGGCCTTGGCCAAACACATCCGGGCAGAGGCCCTGAGCTCCACCCTTCGGCTGGCCCAAGACGAGGCCTTACGGGCCAAGAATCTGCTCCTGACAGACAAGATGAAGCCGGAGGAGAAGGTGGCCACCCTGGACTATCTCCATCTGAAGATGTGCTCCCTCCATGACCAGCTCAGCAACCTGCCACTTGAGGGCTCCACAGGGACAATGGGGGAAGGAAGCGGAGGGGCTGCCCCAAAATGTGGGAGCCCAGCCCCCAAACAATAA

XM_004866886.1 Coding sequence

Tsks testis-specific serine kinase substrate, transcript variant X4

Length: 1764 bp    Location: 4546432..4560936   Strand: +
>XM_004866886.1
ATGGCAAGTGTGGTCGTGAAGACCATCTGGCAGTCCAAGGAGTTCCATCAGGCTGGGGACACCCCTGCCAGGGTCGAGAGGAGGATCCAGCTGGGCCCCGAGGCTCCCGGGAGCATGACCGGCCCAGCCAAGGGAGTCAGGAAGAAAAAGAAGGCTGTGTCGTTCCACAGGGAGACCAGTGAAGGCAGAAGAAAGCAGGAAGCGGGGACTGAAGAGGCAGAAGAAAGGCAGCAGGGGCTGAAGAGAGAGAAGATAGCGGACCTGGGGGAAGGCGAGAATGAAGAAAGTGGGCTCGTGGAGCCGCGGACGCCACACGAGCCAGTGGACTGGTGTCTCAACCTCAGACGGTCCTCGGGCTGCACCAACGTGTCCCTGCTCAACCTGGCCGCCGCTGTGGAGCCCTGGGACTCCTCCGGCACCAACTGCATCACGGAAGACAGCGGCCCGCTGGAGCTGCCTGGCCCCCCGGCTGCCCCCGCCCCACCCTGGGCTGCGGATGACCCGGACATCAAGGAACTTCTGAGTGGGCTCAACAGTGGACTAGTCCATGCCAAGGACTCTGTCATCAGCTTGAAGGAAAAGACCAGCTGGGTAAACCAGCACGTGCAGACCCTGCAGAGCGAATGTTCCCTGCTGAGCGAGAATCTAGAGAGAAGGCGGCAGGAGGCGGAGGAGCTGGAGGGGTACTGTAGCCAACTCAAGGAGAACTGCAAGAAGGTGACCCGCTCGGTGGAGGATGCTGAAATCAAAACGAACGTCTTGAAGCAGAACTCAGCCCTGTTGGAGGAGAAGCTGCGATACCTCCAGCAGGAACTGCAGGACGAGACGCCGAGGCAGGAGGTCGAGATGCAGGAGCTGGAGCAGAAGCTGGAGGCCAGCCTCTCCCACTCCGGCCTCTCAGGAAACCCCGAAGAGGCCGCAAGGTTACGAAGCACGGCCCCAGGCGGCTGTGGAACTGGGCCCGGGGCGGGAGAAACGCCCCACACGAGCGAGCAGGAGCTGCAGAAGGTCTCAGCCAGCCTGGAGGACCTGAGGAGGGAGGTGTCCTCACTGGCCGCACGGTGGCATCAAGAGGAGGGGGCGGTGCAGGAAGCCCTGAGGCTGCTCGGGGGTCTGGGCGGAAGGCTCGACGGCTTCATGGGTCAGTGGGAGCGCGCGCAATGCGACCAGACGCAGACAGCGCGGAGCCTGCAGGAGCTGCGCAGACAGGCGGACCAGCTGTGCACCTTGGTGGAGCGCTCAGCAGTGTCTCTGGCTTCCCTGAGGAGCGAACTGGAGGGGCTGGGTCCGGTCAAACCAATTCTGGAGGAGCTGGCACGGCAGTTTCGGAACTCTCAAAGGGTACCTGACCACTCCATGAACCCGGATCGGTCGTCCCAAGGCTCCTGTGCTCGCTGTGCCAGCCAGGGACAGCAATTGTCCATGGAGTCCCTGCAGCATCTGTTGGAGCGAGCGCTGACCCCACTAGTGGATGAGGTGAAGCAGAGAAACCTGACGCCTCCTGCCTGTCCCAGCTGCCAGAGGCTACACAAGAAGATTCTGCCCAGTCCAGCAAGCCCAGCAGTGCCTACGCTCCTCTCCCCAGGAGCTGGAGCGCCAGGCCTTGGCCAAACACATCCGGGCAGAGGCCCTGAGCTCCACCCTTCGGCTGGCCCAAGACGAGGCCTTACGGGCCAAGAATCTGCTCCTGACAGACAAGATGAAGCCGGAGGAGAAGGTGGCCACCCTGGACTATCTCCATCTGAAGATGTGCTCCCTCCATGA

XM_004866890.1 Coding sequence

Tsks testis-specific serine kinase substrate, transcript variant X8

Length: 1548 bp    Location: 4546432..4560888   Strand: +
>XM_004866890.1
ATGGCAAGTGTGGTCGTGAAGACCATCTGGCAGTCCAAGGAGTTCCATCAGGCTGGGGACACCCCTGCCAGGGTCGAGAGGAGGATCCAGCTGGGCCCCGAGGCTCCCGGGAGCATGACCGGCCCAGCCAAGGGAGTCAGGAAGAAAAAGAAGGCTGTGTCGTTCCACAGCGTGGAGCCGCGGACGCCACACGAGCCAGTGGACTGGTGTCTCAACCTCAGACGGTCCTCGGGCTGCACCAACGTGTCCCTGCTCAACCTGGCCGCCGCTGTGGAGCCCTGGGACTCCTCCGGCACCAACTGCATCACGGAAGACAGCGGCCCGCTGGAGCTGCCTGGCCCCCCGGCTGCCCCCGCCCCACCCTGGGCTGCGGATGACCCGGACATCAAGGAACTTCTGAGTGGGCTCAACAGTGGACTAGTCCATGCCAAGGACTCTGTCATCAGCTTGAAGGAAAAGACCAGCTGGGTAAACCAGCACGTGCAGACCCTGCAGAGCGAATGTTCCCTGCTGAGCGAGAATCTAGAGAGAAGGCGGCAGGAGGCGGAGGAGCTGGAGGGGTACTGTAGCCAACTCAAGGAGAACTGCAAGAAGGTGACCCGCTCGGTGGAGGATGCTGAAATCAAAACGAACGTCTTGAAGCAGAACTCAGCCCTGTTGGAGGAGAAGCTGCGATACCTCCAGCAGGAACTGCAGGACGAGACGCCGAGGCAGGAGGTCGAGATGCAGGAGCTGGAGCAGAAGCTGGAGGCCAGCCTCTCCCACTCCGGCCTCTCAGGAAACCCCGAAGAGGCCGCAAGGTTACGAAGCACGGCCCCAGGCGGCTGTGGAACTGGGCCCGGGGCGGGAGAAACGCCCCACACGAGCGAGCAGGAGCTGCAGAAGGTCTCAGCCAGCCTGGAGGACCTGAGGAGGGAGGTGTCCTCACTGGCCGCACGGTGGCATCAAGAGGAGGGGGCGGTGCAGGAAGCCCTGAGGCTGCTCGGGGGTCTGGGCGGAAGGCTCGACGGCTTCATGGGTCAGTGGGAGCGCGCGCAATGCGACCAGACGCAGACAGCGCGGAGCCTGCAGGAGCTGCGCAGACAGGCGGACCAGCTGTGCACCTTGGTGGAGCGCTCAGCAGTGTCTCTGGCTTCCCTGAGGAGCGAACTGGAGGGGCTGGGTCCGGTCAAACCAATTCTGGAGGAGCTGGCACGGCAGTTTCGGAACTCTCAAAGGGTACCTGACCACTCCATGAACCCGGATCGGTCGTCCCAAGGCTCCTGTGCTCGCTGTGCCAGCCAGGGACAGCAATTGTCCATGGAGTCCCTGCAGCATCTGTTGGAGCGAGCGCTGACCCCACTAGTGGATGAGGTGAAGCAGAGAAACCTGACGCCTCCTGCCTGTCCCAGCTGCCAGAGGCTACACAAGAAGATTCTGGAGCTGGAGCGCCAGGCCTTGGCCAAACACATCCGGGCAGAGGCCCTGAGCTCCACCCTTCGGCTGGCCCAAGACGAGGCCTTACGGGCCAAGAATCTGCTCCTGACAGACAAGATGAAGCCGGAGTGA

XM_004866894.1 Coding sequence

Cpt1c carnitine palmitoyltransferase 1C, transcript variant X4

Length: 2577 bp    Location: 4591537..4578400   Strand: -
>XM_004866894.1
ATGGTCCTGTGGTGGGCAGAACTCCGGGGGCCGGTCGGCCAGGTGGTGGAGTCGTCCTACTGGGCTTGGACATACGCAAGCGAAAGACTTAGGTCCTGGGCTCAAAACCGGGGAGTAGGGGGGTGTGGGGTGTACGTCGCTTCGTTCCCAGCATCTCATCTGCACAAGCCTGACCTAGAGCCCCCCCCCCGTGACATGGCAGAAGCGCACCAGGCCGTGGGCTTCGTGCCCTCGCTGACCCCGGACGGAGCGGACCCAGAGCTCGCCGGCCAGGTGCTGCGGAACATCTACCTCTCGGGGCTTTGGTCCTGGAAAAGGCACCTTTCGCGTTTCCGGAATGACTTCCTCAGTGGCGTGCTCCCCGCCAGCCCCTTCAGCTGGCTCTTCCTCTTCAGTGCCATCCAGCTTGCCTGGTTCCTCCAGCTGGACCCTTCCCTGGGGCTGATGGAGAAGATTAAAGAGCTGCTGCCGGACTGGGCGGGACAGCACCACAGGCTCCGGGGAGTCCTGGCGGCTGCGCTGTTTGCCTCGTGTTTGTGGGGAGCCCTGATCTTCACGCTTCACGTGGCCCTGAGGCTGCTTCTGTCCTACCATGGCTGGCTGCTCGAGCCCCACGGGGCCATGTCCTCGGCCACCAAGACCTGGCTGGCCCTGGTTCGCATCTTCTCCGGCCGCCGCCCGATGCTCTTCAGCTACCAGCGCTCCCTGCCGCGCCAGCCAGTGCCCTCGGTGCAGGACACCGTGCGAAAGTACCTGGAGTCCATCCGGCCTGTCCTCTCGGACGAGGACTTCAACTGGAGGGCGGTGCTGGCCCAGGAGTTCCTGAAGCAGCAGGCGTCGCTGCTGCAGTGGTACCTGCGGCTCAAGTCCTGGTGGGCAGCCAACTATGTCAGCGACTGGTGGGAAGAGTTCGTGTACCTGCGCTCACGCAGCCCGCTGATGGTGAACAGCAACTATTACCTGACGGCAGCTCGCGCGGGGAACGCTGTCCATGCCCTGCTCCTGTACCGCCACCGGCTGCAGCGCCAGGAGATCTCCCCGACTCTGCTGATGGGAATGCGCCCCTTGTGCTCTGCCCAGTACGAGAGAATATTCAACACCACGCGGGTCCCGGGGGTGCAGAAAGACCACCTTCGCCACCTCCGCGACAGTCAGCACGTGGCTGTCCTCCACCGGGGCCGCTTCTTCCGCGTGGGGACCCACTCCCCGCACGGCCTGCTGCCCCCAAGGGCCCTGGAGCAGCAGTTTCAGCGCATCCTAGACGACCCTTCGCCTGCCTGTCCCCACGAGGAGCACCTGGCGGCCCTGACGGCCGCTCCCAGGGGCTTGTGGGCCCAGCTTCGCCAGACCCTCAAGACCCGCGCCGCCCACGCCCTGGAGGCCGTGGAGGGGGCCGCGTTCTTCGTGTCGCTGGACCCCGAGCCCGCGGGGCTCACCCGGGAGGACCCCGCGGGCTCGCTGGATGCCTATGCCCACGCCCTGCTGGCCGGCCGCGGCCATGACCGCTGGTTTGACAAATCCTTCACCCTGATCATCTTCTCCAATGGGAAGCTGGGCCTCAGCGTGGAGCACTCGTGGGCCGACTGCCCCATCTCAGGACACATGTGGGAGTTCACCCTGGCCACAGAGTGCTTCCAGCTGGGCTACTCGGCAGACGGCCACTGCAAGGGGTGCCCCGCCCCAGCGCTGCCCCCGCCCCAGCGGCTTCAGTGGGACCTTCCAGACCAGGTCCATCTGTCCATCTCTCTAGCGCTGCGGGGAGCCAAGGCTTTGTCTGGCAACATCGACTGCCACATCTTTCCCTTCTCCCACTTCGGCAAGAGCTTCATCAGACACTGCCACCTCTCCTCAGACAGCTTCGTCCAGATGGCCCTGCAGCTGGCCCACTTCCGGGACAGGGGTCAATTCTGCCTCACTTACGAGTCGGCCATGACTCGCTTGTTCCTGGAGGGCCGGACGGAGACAGTGCGATCTTGCACGAGGGAGGCCTGCAGCTTTGTGAGAGCCATGGAGGACAAAGAGAAGACAGACCCGCAGTGCCTCGTCCTGTTCCGCGCCGCAGTGGACAAGCACCAGGCGCTGCTCAAGGCGGCCATGAGCGGGCAGGGGGTCGACCGCCACCTCTTTGCGCTCTACGTCGTGTCGCGATTCCTTCATATGCAGTCGCCCTTCCTGGCCCAGGTTTACTCGGAGCAGTGGCAACTGTCCACCAGCCAGATCCCTGTTCAGCAGATGCACCTGTTTGATGTCCACAATTACCCGGATTATGTTTCCTCGGGTGGCGGATTTGGGCCCGCGGATGCCCACGGTTATGGTGTGTCTTACATCTTCATGGGGGATGACGCGATCACCTTCCACATCTCCAGCAAAAAATCCAGCACAAAAACGGACTCCCGCCGGCTGGGTCGGCACATCGAGGCTGCGCTGCTGGATGTGGCCTCCCTGTTTCAGGCCGGACAGCGTATGCAGCGCCGGTTCAGCGGTTCAGCGGAGGAAGACTCGGGGCACAGATGTGGATTTCTCTCCAGTAAAACTCTGAATTTTAAGACACCCACCGACTCTGAGCCCTTCCAGTAG

XM_004866892.1 Coding sequence

Cpt1c carnitine palmitoyltransferase 1C, transcript variant X2

Length: 2622 bp    Location: 4591537..4578400   Strand: -
>XM_004866892.1
ATGGTCCTGTGGTGGGCAGAACTCCGGGGGCCGGTCGGCCAGGTGGTGGAGTCGTCCTACTGGGCTTGGACATACGCAAGCGAAAGACTTAGGTCCTGGGCTCAAAACCGGGGAGTAGGGGGGTGTGGGGTGTACGTCGCTTCGTTCCCAGCATCTCATCTGCACAAGCCTGACCTAGAGCCCCCCCCCCGTGACATGGCAGAAGCGCACCAGGCCGTGGGCTTCGTGCCCTCGCTGACCCCGGACGGAGCGGACCCAGAGCTCGCCGGCCAGGTGCTGCGGAACATCTACCTCTCGGGGCTTTGGTCCTGGAAAAGGCACCTTTCGCGTTTCCGGAATGACTTCCTCAGTGGCGTGCTCCCCGCCAGCCCCTTCAGCTGGCTCTTCCTCTTCAGTGCCATCCAGCTTGCCTGGTTCCTCCAGCTGGACCCTTCCCTGGGGCTGATGGAGAAGATTAAAGAGCTGCTGCCGGACTGGGCGGGACAGCACCACAGGCTCCGGGGAGTCCTGGCGGCTGCGCTGTTTGCCTCGTGTTTGTGGGGAGCCCTGATCTTCACGCTTCACGTGGCCCTGAGGCTGCTTCTGTCCTACCATGGCTGGCTGCTCGAGCCCCACGGGGCCATGTCCTCGGCCACCAAGACCTGGCTGGCCCTGGTTCGCATCTTCTCCGGCCGCCGCCCGATGCTCTTCAGCTACCAGCGCTCCCTGCCGCGCCAGCCAGTGCCCTCGGTGCAGGACACCGTGCGAAAGTACCTGGAGTCCATCCGGCCTGTCCTCTCGGACGAGGACTTCAACTGGAGGGCGGTGCTGGCCCAGGAGTTCCTGAAGCAGCAGGCGTCGCTGCTGCAGTGGTACCTGCGGCTCAAGTCCTGGTGGGCAGCCAACTATGTCAGCGACTGGTGGGAAGAGTTCGTGTACCTGCGCTCACGCAGCCCGCTGATGGTGAACAGCAACTATTACCTGACGGCAGCTCGCGCGGGGAACGCTGTCCATGCCCTGCTCCTGTACCGCCACCGGCTGCAGCGCCAGGAGATCTCCCCGACTCTGCTGATGGGAATGCGCCCCTTGTGCTCTGCCCAGTACGAGAGAATATTCAACACCACGCGGGTCCCGGGGGTGCAGAAAGACCACCTTCGCCACCTCCGCGACAGTCAGCACGTGGCTGTCCTCCACCGGGGCCGCTTCTTCCGCGTGGGGACCCACTCCCCGCACGGCCTGCTGCCCCCAAGGGCCCTGGAGCAGCAGTTTCAGCGCATCCTAGACGACCCTTCGCCTGCCTGTCCCCACGAGGAGCACCTGGCGGCCCTGACGGCCGCTCCCAGGGGCTTGTGGGCCCAGCTTCGCCAGACCCTCAAGACCCGCGCCGCCCACGCCCTGGAGGCCGTGGAGGGGGCCGCGTTCTTCGTGTCGCTGGACCCCGAGCCCGCGGGGCTCACCCGGGAGGACCCCGCGGGCTCGCTGGATGCCTATGCCCACGCCCTGCTGGCCGGCCGCGGCCATGACCGCTGGTTTGACAAATCCTTCACCCTGATCATCTTCTCCAATGGGAAGCTGGGCCTCAGCGTGGAGCACTCGTGGGCCGACTGCCCCATCTCAGGACACATGTGGGAGTTCACCCTGGCCACAGAGTGCTTCCAGCTGGGCTACTCGGCAGACGGCCACTGCAAGGGGTGCCCCGCCCCAGCGCTGCCCCCGCCCCAGCGGCTTCAGTGGGACCTTCCAGACCAGGTCCATCTGTCCATCTCTCTAGCGCTGCGGGGAGCCAAGGCTTTGTCTGGCAACATCGACTGCCACATCTTTCCCTTCTCCCACTTCGGCAAGAGCTTCATCAGACACTGCCACCTCTCCTCAGACAGCTTCGTCCAGATGGCCCTGCAGCTGGCCCACTTCCGGGACAGGGGTCAATTCTGCCTCACTTACGAGTCGGCCATGACTCGCTTGTTCCTGGAGGGCCGGACGGAGACAGTGCGATCTTGCACGAGGGAGGCCTGCAGCTTTGTGAGAGCCATGGAGGACAAAGAGAAGACAGACCCGCAGTGCCTCGTCCTGTTCCGCGCCGCAGTGGACAAGCACCAGGCGCTGCTCAAGGCGGCCATGAGCGGGCAGGGGGTCGACCGCCACCTCTTTGCGCTCTACGTCGTGTCGCGATTCCTTCATATGCAGTCGCCCTTCCTGGCCCAGGTTTACTCGGAGCAGTGGCAACTGTCCACCAGCCAGATCCCTGTTCAGCAGATGCACCTGTTTGATGTCCACAATTACCCGGATTATGTTTCCTCGGGTGGCGGATTTGGGCCCGCGGATGCCCACGGTTATGGTGTGTCTTACATCTTCATGGGGGATGACGCGATCACCTTCCACATCTCCAGCAAAAAATCCAGCACAAAAACGGTGAGACAGACTTCATCCCGGCCTCCTCTCTCAGCCCCGGGCTCCTCTCCTGGTTCCCTGGGTCTGACGGTTCCTGCCTCCAGGACTCCCGCCGGCTGGGTCGGCACATCGAGGCTGCGCTGCTGGATGTGGCCTCCCTGTTTCAGGCCGGACAGCGTATGCAGCGCCGGTTCAGCGGTTCAGCGGAGGAAGACTCGGGGCACAGATGTGGATTTCTCTCCAGTAAAACTCTGA

XM_004866891.1 Coding sequence

Cpt1c carnitine palmitoyltransferase 1C, transcript variant X1

Length: 2625 bp    Location: 4591537..4578400   Strand: -
>XM_004866891.1
ATGGTCCTGTGGTGGGCAGAACTCCGGGGGCCGGTCGGCCAGGTGGTGGAGTCGTCCTACTGGGCTTGGACATACGCAAGCGAAAGACTTAGGTCCTGGGCTCAAAACCGGGGAGTAGGGGGGTGTGGGGTGTACGTCGCTTCGTTCCCAGCATCTCATCTGCACAAGCCTGACCTAGAGCCCCCCCCCCGTGACATGGCAGAAGCGCACCAGGCCGTGGGCTTCGTGCCCTCGCTGACCCCGGACGGAGCGGACCCAGAGCTCGCCGGCCAGGTGCTGCGGAACATCTACCTCTCGGGGCTTTGGTCCTGGAAAAGGCACCTTTCGCGTTTCCGGAATGACTTCCTCAGTGGCGTGCTCCCCGCCAGCCCCTTCAGCTGGCTCTTCCTCTTCAGTGCCATCCAGCTTGCCTGGTTCCTCCAGCTGGACCCTTCCCTGGGGCTGATGGAGAAGATTAAAGAGCTGCTGCCGGACTGGGCGGGACAGCACCACAGGCTCCGGGGAGTCCTGGCGGCTGCGCTGTTTGCCTCGTGTTTGTGGGGAGCCCTGATCTTCACGCTTCACGTGGCCCTGAGGCTGCTTCTGTCCTACCATGGCTGGCTGCTCGAGCCCCACGGGGCCATGTCCTCGGCCACCAAGACCTGGCTGGCCCTGGTTCGCATCTTCTCCGGCCGCCGCCCGATGCTCTTCAGCTACCAGCGCTCCCTGCCGCGCCAGCCAGTGCCCTCGGTGCAGGACACCGTGCGAAAGTACCTGGAGTCCATCCGGCCTGTCCTCTCGGACGAGGACTTCAACTGGAGGGCGGTGCTGGCCCAGGAGTTCCTGAAGCAGCAGGCGTCGCTGCTGCAGTGGTACCTGCGGCTCAAGTCCTGGTGGGCAGCCAACTATGTCAGCGACTGGTGGGAAGAGTTCGTGTACCTGCGCTCACGCAGCCCGCTGATGGTGAACAGCAACTATTACCTGACGGATTTCCTGTATGTCACACCCACGCCGCTGCAGGCAGCTCGCGCGGGGAACGCTGTCCATGCCCTGCTCCTGTACCGCCACCGGCTGCAGCGCCAGGAGATCTCCCCGACTCTGCTGATGGGAATGCGCCCCTTGTGCTCTGCCCAGTACGAGAGAATATTCAACACCACGCGGGTCCCGGGGGTGCAGAAAGACCACCTTCGCCACCTCCGCGACAGTCAGCACGTGGCTGTCCTCCACCGGGGCCGCTTCTTCCGCGTGGGGACCCACTCCCCGCACGGCCTGCTGCCCCCAAGGGCCCTGGAGCAGCAGTTTCAGCGCATCCTAGACGACCCTTCGCCTGCCTGTCCCCACGAGGAGCACCTGGCGGCCCTGACGGCCGCTCCCAGGGGCTTGTGGGCCCAGCTTCGCCAGACCCTCAAGACCCGCGCCGCCCACGCCCTGGAGGCCGTGGAGGGGGCCGCGTTCTTCGTGTCGCTGGACCCCGAGCCCGCGGGGCTCACCCGGGAGGACCCCGCGGGCTCGCTGGATGCCTATGCCCACGCCCTGCTGGCCGGCCGCGGCCATGACCGCTGGTTTGACAAATCCTTCACCCTGATCATCTTCTCCAATGGGAAGCTGGGCCTCAGCGTGGAGCACTCGTGGGCCGACTGCCCCATCTCAGGACACATGTGGGAGTTCACCCTGGCCACAGAGTGCTTCCAGCTGGGCTACTCGGCAGACGGCCACTGCAAGGGGTGCCCCGCCCCAGCGCTGCCCCCGCCCCAGCGGCTTCAGTGGGACCTTCCAGACCAGGTCCATCTGTCCATCTCTCTAGCGCTGCGGGGAGCCAAGGCTTTGTCTGGCAACATCGACTGCCACATCTTTCCCTTCTCCCACTTCGGCAAGAGCTTCATCAGACACTGCCACCTCTCCTCAGACAGCTTCGTCCAGATGGCCCTGCAGCTGGCCCACTTCCGGGACAGGGGTCAATTCTGCCTCACTTACGAGTCGGCCATGACTCGCTTGTTCCTGGAGGGCCGGACGGAGACAGTGCGATCTTGCACGAGGGAGGCCTGCAGCTTTGACCCGCAGTGCCTCGTCCTGTTCCGCGCCGCAGTGGACAAGCACCAGGCGCTGCTCAAGGCGGCCATGAGCGGGCAGGGGGTCGACCGCCACCTCTTTGCGCTCTACGTCGTGTCGCGATTCCTTCATATGCAGTCGCCCTTCCTGGCCCAGGTTTACTCGGAGCAGTGGCAACTGTCCACCAGCCAGATCCCTGTTCAGCAGATGCACCTGTTTGATGTCCACAATTACCCGGATTATGTTTCCTCGGGTGGCGGATTTGGGCCCGCGGATGCCCACGGTTATGGTGTGTCTTACATCTTCATGGGGGATGACGCGATCACCTTCCACATCTCCAGCAAAAAATCCAGCACAAAAACGGTGAGACAGACTTCATCCCGGCCTCCTCTCTCAGCCCCGGGCTCCTCTCCTGGTTCCCTGGGTCTGACGGTTCCTGCCTCCAGGACTCCCGCCGGCTGGGTCGGCACATCGAGGCTGCGCTGCTGGATGTGGCCTCCCTGTTTCAGGCCGGACAGCGTATGCAGCGCCGGTTCAGCGGTTCAGCGGAGGAAGACTCGGGGCACAGATGTGGATTTCTCTCCAGTAAAACTCTGA

XM_004866893.1 Coding sequence

Cpt1c carnitine palmitoyltransferase 1C, transcript variant X3

Length: 2610 bp    Location: 4591537..4578400   Strand: -
>XM_004866893.1
ATGGTCCTGTGGTGGGCAGAACTCCGGGGGCCGGTCGGCCAGGTGGTGGAGTCGTCCTACTGGGCTTGGACATACGCAAGCGAAAGACTTAGGTCCTGGGCTCAAAACCGGGGAGTAGGGGGGTGTGGGGTGTACGTCGCTTCGTTCCCAGCATCTCATCTGCACAAGCCTGACCTAGAGCCCCCCCCCCGTGACATGGCAGAAGCGCACCAGGCCGTGGGCTTCGTGCCCTCGCTGACCCCGGACGGAGCGGACCCAGAGCTCGCCGGCCAGGTGCTGCGGAACATCTACCTCTCGGGGCTTTGGTCCTGGAAAAGGCACCTTTCGCGTTTCCGGAATGACTTCCTCAGTGGCGTGCTCCCCGCCAGCCCCTTCAGCTGGCTCTTCCTCTTCAGTGCCATCCAGCTTGCCTGGTTCCTCCAGCTGGACCCTTCCCTGGGGCTGATGGAGAAGATTAAAGAGCTGCTGCCGGACTGGGCGGGACAGCACCACAGGCTCCGGGGAGTCCTGGCGGCTGCGCTGTTTGCCTCGTGTTTGTGGGGAGCCCTGATCTTCACGCTTCACGTGGCCCTGAGGCTGCTTCTGTCCTACCATGGCTGGCTGCTCGAGCCCCACGGGGCCATGTCCTCGGCCACCAAGACCTGGCTGGCCCTGGTTCGCATCTTCTCCGGCCGCCGCCCGATGCTCTTCAGCTACCAGCGCTCCCTGCCGCGCCAGCCAGTGCCCTCGGTGCAGGACACCGTGCGAAAGTACCTGGAGTCCATCCGGCCTGTCCTCTCGGACGAGGACTTCAACTGGAGGGCGGTGCTGGCCCAGGAGTTCCTGAAGCAGCAGGCGTCGCTGCTGCAGTGGTACCTGCGGCTCAAGTCCTGGTGGGCAGCCAACTATGTCAGCGACTGGTGGGAAGAGTTCGTGTACCTGCGCTCACGCAGCCCGCTGATGGTGAACAGCAACTATTACCTGACGGATTTCCTGTATGTCACACCCACGCCGCTGCAGGCAGCTCGCGCGGGGAACGCTGTCCATGCCCTGCTCCTGTACCGCCACCGGCTGCAGCGCCAGGAGATCTCCCCGACTCTGCTGATGGGAATGCGCCCCTTGTGCTCTGCCCAGTACGAGAGAATATTCAACACCACGCGGGTCCCGGGGGTGCAGAAAGACCACCTTCGCCACCTCCGCGACAGTCAGCACGTGGCTGTCCTCCACCGGGGCCGCTTCTTCCGCGTGGGGACCCACTCCCCGCACGGCCTGCTGCCCCCAAGGGCCCTGGAGCAGCAGTTTCAGCGCATCCTAGACGACCCTTCGCCTGCCTGTCCCCACGAGGAGCACCTGGCGGCCCTGACGGCCGCTCCCAGGGGCTTGTGGGCCCAGCTTCGCCAGACCCTCAAGACCCGCGCCGCCCACGCCCTGGAGGCCGTGGAGGGGGCCGCGTTCTTCGTGTCGCTGGACCCCGAGCCCGCGGGGCTCACCCGGGAGGACCCCGCGGGCTCGCTGGATGCCTATGCCCACGCCCTGCTGGCCGGCCGCGGCCATGACCGCTGGTTTGACAAATCCTTCACCCTGATCATCTTCTCCAATGGGAAGCTGGGCCTCAGCGTGGAGCACTCGTGGGCCGACTGCCCCATCTCAGGACACATGTGGGAGTTCACCCTGGCCACAGAGTGCTTCCAGCTGGGCTACTCGGCAGACGGCCACTGCAAGGGGTGCCCCGCCCCAGCGCTGCCCCCGCCCCAGCGGCTTCAGTGGGACCTTCCAGACCAGGTCCATCTGTCCATCTCTCTAGCGCTGCGGGGAGCCAAGGCTTTGTCTGGCAACATCGACTGCCACATCTTTCCCTTCTCCCACTTCGGCAAGAGCTTCATCAGACACTGCCACCTCTCCTCAGACAGCTTCGTCCAGATGGCCCTGCAGCTGGCCCACTTCCGGGACAGGGGTCAATTCTGCCTCACTTACGAGTCGGCCATGACTCGCTTGTTCCTGGAGGGCCGGACGGAGACAGTGCGATCTTGCACGAGGGAGGCCTGCAGCTTTGTGAGAGCCATGGAGGACAAAGAGAAGACAGACCCGCAGTGCCTCGTCCTGTTCCGCGCCGCAGTGGACAAGCACCAGGCGCTGCTCAAGGCGGCCATGAGCGGGCAGGGGGTCGACCGCCACCTCTTTGCGCTCTACGTCGTGTCGCGATTCCTTCATATGCAGTCGCCCTTCCTGGCCCAGGTTTACTCGGAGCAGTGGCAACTGTCCACCAGCCAGATCCCTGTTCAGCAGATGCACCTGTTTGATGTCCACAATTACCCGGATTATGTTTCCTCGGGTGGCGGATTTGGGCCCGCGGATGCCCACGGTTATGGTGTGTCTTACATCTTCATGGGGGATGACGCGATCACCTTCCACATCTCCAGCAAAAAATCCAGCACAAAAACGGACTCCCGCCGGCTGGGTCGGCACATCGAGGCTGCGCTGCTGGATGTGGCCTCCCTGTTTCAGGCCGGACAGCGTATGCAGCGCCGGTTCAGCGGTTCAGCGGAGGAAGACTCGGGGCACAGATGTGGATTTCTCTCCAGTAAAACTCTGAATTTTAAGACACCCACCGACTCTGAGCCCTTCCAGTAG

XM_004866895.1 Coding sequence

Cpt1c carnitine palmitoyltransferase 1C, transcript variant X5

High confidence: 4 potential gene matches
Length: 2460 bp    Location: 4591045..4578400   Strand: -
>XM_004866895.1
ATGGCAGAAGCGCACCAGGCCGTGGGCTTCGTGCCCTCGCTGACCCCGGACGGAGCGGACCCAGAGCTCGCCGGCCAGGTGCTGCGGAACATCTACCTCTCGGGGCTTTGGTCCTGGAAAAGGCACCTTTCGCGTTTCCGGAATGACTTCCTCAGTGGCGTGCTCCCCGCCAGCCCCTTCAGCTGGCTCTTCCTCTTCAGTGCCATCCAGCTTGCCTGGTTCCTCCAGCTGGACCCTTCCCTGGGGCTGATGGAGAAGATTAAAGAGCTGCTGCCGGACTGGGCGGGACAGCACCACAGGCTCCGGGGAGTCCTGGCGGCTGCGCTGTTTGCCTCGTGTTTGTGGGGAGCCCTGATCTTCACGCTTCACGTGGCCCTGAGGCTGCTTCTGTCCTACCATGGCTGGCTGCTCGAGCCCCACGGGGCCATGTCCTCGGCCACCAAGACCTGGCTGGCCCTGGTTCGCATCTTCTCCGGCCGCCGCCCGATGCTCTTCAGCTACCAGCGCTCCCTGCCGCGCCAGCCAGTGCCCTCGGTGCAGGACACCGTGCGAAAGTACCTGGAGTCCATCCGGCCTGTCCTCTCGGACGAGGACTTCAACTGGAGGGCGGTGCTGGCCCAGGAGTTCCTGAAGCAGCAGGCGTCGCTGCTGCAGTGGTACCTGCGGCTCAAGTCCTGGTGGGCAGCCAACTATGTCAGCGACTGGTGGGAAGAGTTCGTGTACCTGCGCTCACGCAGCCCGCTGATGGTGAACAGCAACTATTACCTGACGGATTTCCTGTATGTCACACCCACGCCGCTGCAGGCAGCTCGCGCGGGGAACGCTGTCCATGCCCTGCTCCTGTACCGCCACCGGCTGCAGCGCCAGGAGATCTCCCCGACTCTGCTGATGGGAATGCGCCCCTTGTGCTCTGCCCAGTACGAGAGAATATTCAACACCACGCGGGTCCCGGGGGTGCAGAAAGACCACCTTCGCCACCTCCGCGACAGTCAGCACGTGGCTGTCCTCCACCGGGGCCGCTTCTTCCGCGTGGGGACCCACTCCCCGCACGGCCTGCTGCCCCCAAGGGCCCTGGAGCAGCAGTTTCAGCGCATCCTAGACGACCCTTCGCCTGCCTGTCCCCACGAGGAGCACCTGGCGGCCCTGACGGCCGCTCCCAGGGGCTTGTGGGCCCAGCTTCGCCAGACCCTCAAGACCCGCGCCGCCCACGCCCTGGAGGCCGTGGAGGGGGCCGCGTTCTTCGTGTCGCTGGACCCCGAGCCCGCGGGGCTCACCCGGGAGGACCCCGCGGGCTCGCTGGATGCCTATGCCCACGCCCTGCTGGCCGGCCGCGGCCATGACCGCTGGTTTGACAAATCCTTCACCCTGATCATCTTCTCCAATGGGAAGCTGGGCCTCAGCGTGGAGCACTCGTGGGCCGACTGCCCCATCTCAGGACACATGTGGGAGTTCACCCTGGCCACAGAGTGCTTCCAGCTGGGCTACTCGGCAGACGGCCACTGCAAGGGGTGCCCCGCCCCAGCGCTGCCCCCGCCCCAGCGGCTTCAGTGGGACCTTCCAGACCAGGTCCATCTGTCCATCTCTCTAGCGCTGCGGGGAGCCAAGGCTTTGTCTGGCAACATCGACTGCCACATCTTTCCCTTCTCCCACTTCGGCAAGAGCTTCATCAGACACTGCCACCTCTCCTCAGACAGCTTCGTCCAGATGGCCCTGCAGCTGGCCCACTTCCGGGACAGGGGTCAATTCTGCCTCACTTACGAGTCGGCCATGACTCGCTTGTTCCTGGAGGGCCGGACGGAGACAGTGCGATCTTGCACGAGGGAGGCCTGCAGCTTTGTGAGAGCCATGGAGGACAAAGAGAAGACAGACCCGCAGTGCCTCGTCCTGTTCCGCGCCGCAGTGGACAAGCACCAGGCGCTGCTCAAGGCGGCCATGAGCGGGCAGGGGGTCGACCGCCACCTCTTTGCGCTCTACGTCGTGTCGCGATTCCTTCATATGCAGTCGCCCTTCCTGGCCCAGGTTTACTCGGAGCAGTGGCAACTGTCCACCAGCCAGATCCCTGTTCAGCAGATGCACCTGTTTGATGTCCACAATTACCCGGATTATGTTTCCTCGGGTGGCGGATTTGGGCCCGCGGATGCCCACGGTTATGGTGTGTCTTACATCTTCATGGGGGATGACGCGATCACCTTCCACATCTCCAGCAAAAAATCCAGCACAAAAACGGTGAGACAGACTTCATCCCGGCCTCCTCTCTCAGCCCCGGGCTCCTCTCCTGGTTCCCTGGGTCTGACGGTTCCTGCCTCCAGGACTCCCGCCGGCTGGGTCGGCACATCGAGGCTGCGCTGCTGGATGTGGCCTCCCTGTTTCAGGCCGGACAGCGTATGCAGCGCCGGTTCAGCGGTTCAGCGGAGGAAGACTCGGGGCACAGATGTGGATTTCTCTCCAGTAAAACTCTGA

XM_004866896.1 Coding sequence

Cpt1c carnitine palmitoyltransferase 1C, transcript variant X6

Length: 2274 bp    Location: 4591538..4578784   Strand: -
>XM_004866896.1
ATGGTCCTGTGGTGGGCAGAACTCCGGGGGCCGGTCGGCCAGGTGGTGGAGTCGTCCTACTGGGCTTGGACATACGCAAGCGAAAGACTTAGGTCCTGGGCTCAAAACCGGGGAGTAGGGGGGTGTGGGGTGTACGTCGCTTCGTTCCCAGCATCTCATCTGCACAAGCCTGACCTAGAGCCCCCCCCCCGTGACATGGCAGAAGCGCACCAGGCCGTGGGCTTCGTGCCCTCGCTGACCCCGGACGGAGCGGACCCAGAGCTCGCCGGCCAGGTGCTGCGGAACATCTACCTCTCGGGGCTTTGGTCCTGGAAAAGGCACCTTTCGCGTTTCCGGAATGACTTCCTCAGTGGCGTGCTCCCCGCCAGCCCCTTCAGCTGGCTCTTCCTCTTCAGTGCCATCCAGCTTGCCTGGTTCCTCCAGCTGGACCCTTCCCTGGGGCTGATGGAGAAGATTAAAGAGCTGCTGCCGGACTGGGCGGGACAGCACCACAGGCTCCGGGGAGTCCTGGCGGCTGCGCTGTTTGCCTCGTGTTTGTGGGGAGCCCTGATCTTCACGCTTCACGTGGCCCTGAGGCTGCTTCTGTCCTACCATGGCTGGCTGCTCGAGCCCCACGGGGCCATGTCCTCGGCCACCAAGACCTGGCTGGCCCTGGTTCGCATCTTCTCCGGCCGCCGCCCGATGCTCTTCAGCTACCAGCGCTCCCTGCCGCGCCAGCCAGTGCCCTCGGTGCAGGACACCGTGCGAAAGTACCTGGAGTCCATCCGGCCTGTCCTCTCGGACGAGGACTTCAACTGGAGGGCGGTGCTGGCCCAGGAGTTCCTGAAGCAGCAGGCGTCGCTGCTGCAGTGGTACCTGCGGCTCAAGTCCTGGTGGGCAGCCAACTATGTCAGCGACTGGTGGGAAGAGTTCGTGTACCTGCGCTCACGCAGCCCGCTGATGGTGAACAGCAACTATTACCTGACGGATTTCCTGTATGTCACACCCACGCCGCTGCAGGCAGCTCGCGCGGGGAACGCTGTCCATGCCCTGCTCCTGTACCGCCACCGGCTGCAGCGCCAGGAGATCTCCCCGACTCTGCTGATGGGAATGCGCCCCTTGTGCTCTGCCCAGTACGAGAGAATATTCAACACCACGCGGGTCCCGGGGGTGCAGAAAGACCACCTTCGCCACCTCCGCGACAGTCAGCACGTGGCTGTCCTCCACCGGGGCCGCTTCTTCCGCGTGGGGACCCACTCCCCGCACGGCCTGCTGCCCCCAAGGGCCCTGGAGCAGCAGTTTCAGCGCATCCTAGACGACCCTTCGCCTGCCTGTCCCCACGAGGAGCACCTGGCGGCCCTGACGGCCGCTCCCAGGGGCTTGTGGGCCCAGCTTCGCCAGACCCTCAAGACCCGCGCCGCCCACGCCCTGGAGGCCGTGGAGGGGGCCGCGTTCTTCGTGTCGCTGGACCCCGAGCCCGCGGGGCTCACCCGGGAGGACCCCGCGGGCTCGCTGGATGCCTATGCCCACGCCCTGCTGGCCGGCCGCGGCCATGACCGCTGGTTTGACAAATCCTTCACCCTGATCATCTTCTCCAATGGGAAGCTGGGCCTCAGCGTGGAGCACTCGTGGGCCGACTGCCCCATCTCAGGACACATGTGGGAGTTCACCCTGGCCACAGAGTGCTTCCAGCTGGGCTACTCGGCAGACGGCCACTGCAAGGGGTGCCCCGCCCCAGCGCTGCCCCCGCCCCAGCGGCTTCAGTGGGACCTTCCAGACCAGGTCCATCTGTCCATCTCTCTAGCGCTGCGGGGAGCCAAGGCTTTGTCTGGCAACATCGACTGCCACATCTTTCCCTTCTCCCACTTCGGCAAGAGCTTCATCAGACACTGCCACCTCTCCTCAGACAGCTTCGTCCAGATGGCCCTGCAGCTGGCCCACTTCCGGGGGTCAATTCTGCCTCACTTACGAGTCGGCCATGACTCGCTTGTTCCTGGAGGGCCGGACGGAGACAGTGCGATCTTGCACGAGGGAGGCCTGCAGCTTTGTGAGAGCCATGGAGGACAAAGAGAAGACAGACCCGCAGTGCCTCGTCCTGTTCCGCGCCGCAGTGGACAAGCACCAGGCGCTGCTCAAGGCGGCCATGAGCGGGCAGGGGGTCGACCGCCACCTCTTTGCGCTCTACGTCGTGTCGCGATTCCTTCATATGCAGTCGCCCTTCCTGGCCCAGGTTTACTCGGAGCAGTGGCAACTGTCCACCAGCCAGATCCCTGTTCAGCAGATGCACCTGTTTGA

XM_004866901.1 Coding sequence

Prmt1 protein arginine methyltransferase 1, transcript variant X5

Length: 765 bp    Location: 4602402..4593598   Strand: -
>XM_004866901.1
ATGGCGGCAGCCGAGGCCGCGAACTGCATCATGGAGGTTTCCTGTGGCCAGGCAGAAAGCAGCGAGAAGCCCAATGCCGAGGACATGACATCCAAAGACTACTACTTTGACTCCTATGCCCACTTCGGCATCCATGAGGAGATGCTGAAGGATGAAGTGCGGACCCTCACGTACCGGAACTCCATGTTCCACAACCGGCACCTCTTCAAGGACAAGGTGGTGCTGGACGTGGGCTCAGGCACGGGGATACTCTGCATGTTCGCAGCCAAGGCGGGGGCCCGGAAGGTCATCGGGATCGAATGTTCCAGTATCTCTGATTATGCCGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGGCCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTGCCGGTGGAGAAGGTGGACATCTACACTGTCAAGGTGGAAGACCTCACCTTTACCTCCCCGTTCTGCCTGCAAGTGAAGCGGAATGACTATGTGCACGCACTGGTGGCCTACTTCAACATCGAGTTCACGCGCTGCCACAAGCGGACCGGCTTCTCCACCAGCCCTGAGTCCCCGTACACACACTGGAAGCAGACAGTGTTCTACATGGAGGATTACCTGACAGTGAAGACGGGCGAGGAGATCTTCGGCACCATTGGCATGCGGCCCAACGCCAAGAATAACCGTGACCTGGACTTCACCATCGACCTGGACTTCAAGGGCCAGCTGTGCGAGCTGTCCTGCTCCACTGACTACCGGATGCGCTGA

XM_004866900.1 Coding sequence

Prmt1 protein arginine methyltransferase 1, transcript variant X4

Length: 858 bp    Location: 4602402..4593598   Strand: -
>XM_004866900.1
ATGGCGGCAGCCGAGGCCGCGAACTGCATCATGGAGGTTTCCTGTGGCCAGGCAGAAAGCAGCGAGAAGCCCAATGCCGAGGACATGACATCCAAAGACTACTACTTTGACTCCTATGCCCACTTCGGCATCCATGAGGAGATGCTGAAGGATGAAGTGCGGACCCTCACGTACCGGAACTCCATGTTCCACAACCGGCACCTCTTCAAGGACAAGGTGGTGCTGGACGTGGGCTCAGGCACGGGGATACTCTGCATGTTCGCAGCCAAGGCGGGGGCCCGGAAGGTCATCGGGATCGAATGTTCCAGTATCTCTGATTATGCCGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGGCCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTGCCGGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTGTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGAAGTGGACATCTACACTGTCAAGGTGGAAGACCTCACCTTTACCTCCCCGTTCTGCCTGCAAGTGAAGCGGAATGACTATGTGCACGCACTGGTGGCCTACTTCAACATCGAGTTCACGCGCTGCCACAAGCGGACCGGCTTCTCCACCAGCCCTGAGTCCCCGTACACACACTGGAAGCAGACAGTGTTCTACATGGAGGATTACCTGACAGTGAAGACGGGCGAGGAGATCTTCGGCACCATTGGCATGCGGCCCAACGCCAAGAATAACCGTGACCTGGACTTCACCATCGACCTGGACTTCAAGGGCCAGCTGTGCGAGCTGTCCTGCTCCACTGACTACCGGATGCGCTGA

XM_004866897.1 Coding sequence

Prmt1 protein arginine methyltransferase 1, transcript variant X1

Length: 1116 bp    Location: 4602346..4593598   Strand: -
>XM_004866897.1
ATGGCGGCAGCCGAGGCCGCGAACTGCATCATGGAGAATTTTGTAGCCACCTTGGCTAATGGGATGAGCCTCCAGCCGCCTCTTGAAGAAGTTTCCTGTGGCCAGGCAGAAAGCAGCGAGAAGCCCAATGCCGAGGACATGACATCCAAAGACTACTACTTTGACTCCTATGCCCACTTCGGCATCCATGAGGAGATGCTGAAGGATGAAGTGCGGACCCTCACGTACCGGAACTCCATGTTCCACAACCGGCACCTCTTCAAGGACAAGGTGGTGCTGGACGTGGGCTCAGGCACGGGGATACTCTGCATGTTCGCAGCCAAGGCGGGGGCCCGGAAGGTCATCGGGATCGAATGTTCCAGTATCTCTGATTATGCCGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGGCCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTGCCGGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTGTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCACCAGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTACGTGACGGCCATCGAGGACCGGCAGTACAAAGACTACAAGATCCACTGGTGGGAGAATGTGTACGGCTTCGACATGTCTTGCATCAAGGACGTGGCCATCAAGGAGCCCCTGGTGGACGTGGTGGACCCAAAGCAGCTGGTCACCAATGCCTGCCTCATAAAGGAAGTGGACATCTACACTGTCAAGGTGGAAGACCTCACCTTTACCTCCCCGTTCTGCCTGCAAGTGAAGCGGAATGACTATGTGCACGCACTGGTGGCCTACTTCAACATCGAGTTCACGCGCTGCCACAAGCGGACCGGCTTCTCCACCAGCCCTGAGTCCCCGTACACACACTGGAAGCAGACAGTGTTCTACATGGAGGATTACCTGACAGTGAAGACGGGCGAGGAGATCTTCGGCACCATTGGCATGCGGCCCAACGCCAAGAATAACCGTGACCTGGACTTCACCATCGACCTGGACTTCAAGGGCCAGCTGTGCGAGCTGTCCTGCTCCACTGACTACCGGATGCGCTGA

XM_004866899.1 Coding sequence

Prmt1 protein arginine methyltransferase 1, transcript variant X3

Length: 1029 bp    Location: 4600254..4593598   Strand: -
>XM_004866899.1
ATGGTTTCCTGTGGCCAGGCAGAAAGCAGCGAGAAGCCCAATGCCGAGGACATGACATCCAAAGACTACTACTTTGACTCCTATGCCCACTTCGGCATCCATGAGGAGATGCTGAAGGATGAAGTGCGGACCCTCACGTACCGGAACTCCATGTTCCACAACCGGCACCTCTTCAAGGACAAGGTGGTGCTGGACGTGGGCTCAGGCACGGGGATACTCTGCATGTTCGCAGCCAAGGCGGGGGCCCGGAAGGTCATCGGGATCGAATGTTCCAGTATCTCTGATTATGCCGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGGCCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTGCCGGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTGTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCACCAGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTACGTGACGGCCATCGAGGACCGGCAGTACAAAGACTACAAGATCCACTGGTGGGAGAATGTGTACGGCTTCGACATGTCTTGCATCAAGGACGTGGCCATCAAGGAGCCCCTGGTGGACGTGGTGGACCCAAAGCAGCTGGTCACCAATGCCTGCCTCATAAAGGAAGTGGACATCTACACTGTCAAGGTGGAAGACCTCACCTTTACCTCCCCGTTCTGCCTGCAAGTGAAGCGGAATGACTATGTGCACGCACTGGTGGCCTACTTCAACATCGAGTTCACGCGCTGCCACAAGCGGACCGGCTTCTCCACCAGCCCTGAGTCCCCGTACACACACTGGAAGCAGACAGTGTTCTACATGGAGGATTACCTGACAGTGAAGACGGGCGAGGAGATCTTCGGCACCATTGGCATGCGGCCCAACGCCAAGAATAACCGTGACCTGGACTTCACCATCGACCTGGACTTCAAGGGCCAGCTGTGCGAGCTGTCCTGCTCCACTGACTACCGGATGCGCTGA

XM_004866902.1 Coding sequence

Irf3 interferon regulatory factor 3

High confidence: 4 potential gene matches
Length: 1293 bp    Location: 4611448..4616319   Strand: +
>XM_004866902.1
ATGAAGAAGGGAGCTACTACAATGGCTAGCGCTGGAGGCCGGACCATGGGAACCCCAAAGCCAAGAATCTTGCCCTGGCTGCTATCGAAGCTGGACCGGGGGGAGCTGGAGGGCGTGGCCTGGCTGGACGCTAGGTGCAAGCGCTTCCGCATTCCTTGGAAGCATGGCCTGAGGCAGGATGCGCATCTGGAAGACTTCGGCATCTTCCAGGCCTGGGCTGAGGCCAGCGGCGCCTACATTCCTGGGAGGGATAAGCCCGACTTGCCAACTTGGAAGAGGAATTTCCGATCAGCCTTGAACCGGAAGGAAGGGTTGCGTTTAGTTGAGGACCGGAGCAAGGACCCTCACGACCCTCATAAGGTTTACGAGTTTGTGGACTCAGGAGCGAGGGACTCTTCCCAGCTCGACACCTCTCCGGAAACCAACGAGAGAGGCAGTACCTCTGACACCCAGGAAGACATCTTGGACCTGCTGAATGACATGGCCTTGGTCCCACTCCCAGATGGCAGGGCCCCTGAGTGGAGTCCTCTGCACTTGGACAACCCCATACCTTGTCCAAACCCAGCACCCTCTGAAAACCCACTGAAGCAGCTGCTGGTGTCCGAGGAACAGTGGGAGTTTGAGGTGACTGCCTTCTACCGGGGCCACCAGGTCTTCCAGCAGACCATCTTCCCCCAAGGGGGCCTGCGGCTTGTGGGCTCAGAAGCTGGGAACAGGATGCTGCCTGGGCAGTCAATAACACTGCCAGACCCTGAGGTGTCCCTGTCAGACCAGGGGGTGAAAGGCTATGTGAGGCGTGTGCTCAGCAGCCTGGGCGGAGGCCTGGCTCTGTGGCGGGCAGGGCAGCGGCTCTGTGCCCGGCGGCTGGGGCACTGCCATGCATACTGGGCCATGGGCGAGGAGCTGCTCCCTGACTGTGAGCACGGGCACAAAGGCGAAGTCACCAAGGACCTGGACCGCAACGTGTTTGACTTGGGGCCTTTTGTGGCAGATCTGATTGCCTTCATGGAAGGAAGTGGACACTCGCCACGCTACACTCTCTGGTTCTGCCTTGGGGAGTCATGGCCCCACAACCAGCCGTGGGTCAGGAGGCTTGTGATGGTCAAGATTATCCCCACCTGCCTCAAGGTCCTGTTAAACTTGGCCCGGTCGGAGGGTGCCTCCTCACTAGAAAACACCGTAGACTTGCACATTTCCAACAGCCAACCCCTCTCCCTCACCTCCGATCAGTACAAGGCCTACCTGCAGGACCTGGTCGAGGACATGGATTTCCAGGCTGCCAGGGAGGCCTGA

XM_004867201.1 Coding sequence

Scaf1 SR-related CTD-associated factor 1

High confidence: 4 potential gene matches
Length: 3867 bp    Location: 4631810..4617209   Strand: -
>XM_004867201.1
ATGTACCTACCAAAGGTAACCATGGAGGAAGAAGATGAGTCTCGAGGGAAGACAGAGGAGTCAGGCGAGGACCGGGGTGATGGTCCGCCTGACAGAGACCCCACGCTTTCTTCTTCTGCCTTTATCCTGCGGGCCATTCAGCAGGCCATGGGAAGCTCCCTGCAGGCGGATCTGCCGAATGATAAAGATGGCTCTCGGTGTCATGGCCTTCAGTGGAGGCGCTGCCGGAGCCCACGGTCAGAGCCCTGTCCCCAGGAATCAGGGGGCGCTGACACAGCTACTGTGCTGGACATGGCTGCCGACAGCTTCCTTGCAGGGCTGGTGAGCGTCCTTGACCCCCCGGATACCTGGGTTCCCAGCCACCTGGATCTGCGGCCCGGCGAAACCGAGGACATGCTGGAGCTGGTGGCTGAGGTCCGAATCGGGGACAGGGATCCCATCCCTCTACCTGTGCCCAGCCTGCTGCCCCGTCTCAGGGCCTGGAGGACAGGCAAAACGGTTTCCCCGCAGTCTCACTCTTCTCCACCCACCTGTGCTCGCCACCTCCTCACCCTGGGCACGGGAGATGGGGGCCCCGCCCCACGCCCCGCGCCCTCCTCTGCCTCCTCCTCCCCCTCCCCTGCCCCCCGATTCGACATCTATGACCCCTTCCACCCCACCGACGAGGCCTACTCCCCACCCCCTGCTCCGGAGCAAAAGTACGACCCCTTTGAGCCCACGGGCTCCAACCCCAGCTCATCAGCCGGGACACCCTCGCCAGAGGAGGAAGAGGAGGAGGAGGAGGAAGAAGAGGAGGAGGAAGAGGAGGAAGGGCTGTCGCAGAGCATCAGCCGCATCTCGGAGACCCTGGCGGGTATCTACGATGACAACAGCCTGAGCCAGGACTTCCCAGGTGATGAGAGCCCGCGCCCGGACCCCCAGCCCCCCCAGCCCCCAGCCGCCTCTGGAACTCCGCCCCAGGCCGACTCCACCCGGGCCGAGGCAGCCACTCGCCGGCGCGTCTTCGTGGTGGGAGCCGAGGCAGAGGCGTGTCGGGAAGGCAAGGTCTCGGTGGAGGTGGTTACTGCCGGAGGTGCTGCTCTGCCAACGCCCCTGCTGCCACCTCCTGACTCGGAGATCGAGGAGGGAGAGATTGTGCAGCCGGAGGAGGAGCCGCGGGTGGCCCTGTCCCTGTTCCGGCCCGGCGGCAGAGCTGCTGCCCGGCCACCGCCTGCCTCGGCAGCCCCCGCGGCTCAGCCACTCCCGCAGCCGCCCGCGCCCCGGGCCCCGGAGGGCGATGACTTCCTGTCCCTGCACGCAGAGTCGGACGGGGAGGGCGCGCTGCAGGTGGACCTGGGGGACCCGGGCCCTGCCCCGCCCGCCGCCGACACGCACTGGGGCGGCCTGGACCTGCGCCGCAAGATCCTCACGCAGCGGCGGGAGCGGTACCGCCAGCGCTCGCCGTCCCCAGCCTCCGTTCCCGCCGCGGCCGCGGCCTCCGCAGCCACGGGCCCGCCCACGCGCAAGAAGTCCAGGCGGGAGCGCAAGCGCAGCGGCGGCGGGGAGCCCAAGGAGCCCACCTCGTCCTCATCGGGCGCCCAGCCCGCGCCGCCCGCCCCGGCTTCGCCCTGGGACTCCAAGAAACACCGCTCCCGTGACCACAAGCCTGCCTCCCACACCTCGTCGTCCGCCCGCCGCCGCTCCCGCTCCCGCTCCGGTTCCCGCTCTGCCCGCCGTCGCTCGCGCAGCTCCGACCGCCGCCGTGGGAGCAGCCGCAGGTCCCGGTCCCGGGAGAAGCGGCGGCGACGGCGGCGCTCGGCCTCCCCGCCCCCGGCCACCTCGTCGTCGTCGTCCTCCAGACGCGAGCGGCACCGCGGCAAACACCGGGACGGCGGCAGCAGCAAGAAGAAGAAGAAGCGGTCTCGGTCCCGGGGTGAGAAGCGACCGGGGGACGGGGGCGACAAGGCCCCGGTGCTGGGGCAGCAGCCCTCCGGCGCCTCTGCGGGTGGCGAGCGAGACAGCCGGCGCCGGGGCGCGGTGCCACCCTCCATTCAGGACCTCACAGACCACGACCTCTTCGCCATCAAGCGGACCATCACGGTGGGCCGGCTTGACAAGTCGGACCCCCGAGGGCCCTCCCCGGTGCCTGCCGCCTCGCCGAAGCGTGAGGTCCTGTACGACTCGGAGGGACTGAGTGGGGAGGAGCGCGGGGGCAAGAGCAGCGAGAAGGACCGCCGGCGCTCAGGGGCTGCCTCCTCGTCCTCCTCCCGGGAGAAGGGGTCTCGTAGGAAGGCCCCGGATGGGGGGGACCGGGACCGGGACCGGGACAGGTCATCCAAGAAGGCCCGGCCTCCCAAGGAGTCAGCACCTCCCTCAGGGCCCCCGCCCAAGCCGCCCGTCAGCAGCGGCTCGGGCTCCTCTTCCTCCTCGTCGTCCTGCTCCTCCCGGAAGGTGAAGCTGCAGTCCAAGGTGGCCGTGCTCATCCGAGAGGGTGTCAGCAGCACCACCCCAGCCAAGGACTCTGCCTCTGCCGGCCTGGGCTCCATCGGAGTCAAATTCAGCCGCGACCGTGAGAGCCGCTCCCCCTTCCTGAAGCCTGACGAACGGGCTCCCGCGGAGGCCGCCAAAGCTACGCCGGGCAGCACCAAACCCAAAAAGACCAAGGTCAAGGCCAAGGCTGGGGCCAAGAAAGCCAAGGGGACCAAGGGAAAGACCAAGCCATCTAAGACCAGGAAAAAGATCCGCAGTGGGGGCAGCAGTGGGGCCAGCGGTGGCCCCGTGTCGCTGAAGAAGTCCAAGGCGGATAGCTGCAGCCAGGCAGCAGGGGCCAAGGGGGCTGAGGAGACTTCCTGGTCTGGGGAGGAACGGGCTGCCAAGGCCCCTAGTACCCCGCCCCCCAAGGCAGCCCCTCCGCCCCCGGCACTCACCCCAGATTCCCAGACGGTGGACAGTAGCTGCAAGACGCCTGAGGTCTCCTTCATGCCGGAGGAGGCCGCTGAGGAAGCTGGGATCCGAGGTGGGGCAGAGGAGGAGGAGGACGAGGAGGAGGAGGAGGAGGAGGAGCAGCAGCAGCCTGCCACCACCACAGCCACCAGCACGGCTCCAGCTGCCCCGAGCGCTGCCCCCAGTGCGGGCTCCACAGCCGGAGATTCAGGGGCAGAGGACGGGCCTGCGACCCGAGCCTCCCAGCTGCCCACGCTGCCCCCGCCCATGCCCTGGAACCTGCCAGCTGGTGTGGACTGTACCACCAGTGGCGTCCTGGCCTTGACTGCACTTCTCTTCAAGATGGAAGAGGCCAATTTGGCCAGCCGAGCAAAAGCTCAGGAGCTGATCCAGGCCACCAACCAGATCCTCAGCCACAGGAAGCCACCCTCAGCCCTGGGGGTGACCCCAGCTCCTGTGCCCACCTCTCTGGGTCTGCCCCCTGGCCCTTCCAGCTACCTGCTTCCTGGCAGCCTCCCTCTGGGGGGCTGTGGCTCTACCCCGCCCACCCCCACTGGGCTGGCTGCTGCGTCTGACAAGAGAGAGGGGAGCAGTAGCTCTGAGGGACGTGGAGACACAGACAAGTATCTGAAGAAGCTGCACACGCAGGAGCGGGCAGTGGAGGAGGTGAAGCTGGCCATCAAGCCGTACTATCAGAAAAAGGACATCACCAAGGAGGAGTACAAGGACATCCTGAGGAAGGCCGTCCACAAGATCTGCCACAGCAAAAGTGGGGAGATCAACCCGGTGAAGGTGAGCAACCTGGTGCGGGCCTACGTCCAGCGCTACCGCTACTTCCGCAAGCACGGCCGCAAGCCAGGGGACCCCCCAGGACCACCCCGGCCACCCAAGGAGCCTGGGCCCCCCGACAAGGGCGGCCCGGGGCTGCCCCTGCCCCCTCTGTGA

XM_004866904.1 Coding sequence

Rras related RAS viral (r-ras) oncogene homolog

High confidence: 4 potential gene matches
Length: 657 bp    Location: 4633326..4637937   Strand: +
>XM_004866904.1
ATGAGCAGCGGGGCGGCGTCCGGGACTGGGCGGGGGCGGCCCAGGGGCGGGGGGCCGGGACCTGGGGACCCCCCGCCCAGCGAGACACACAAGCTGGTGGTCGTGGGCGGCGGCGGCGTGGGCAAGAGCGCGCTGACCATCCAGTTCATCCAGTCCTACTTCGTGTCTGACTACGACCCCACCATTGAGGACTCCTACACGAAGATCTGTACTGTGGATGGCATCCCAGCCCGGCTGGACATCCTGGACACCGCGGGCCAGGAGGAGTTCGGGGCCATGCGGGAGCAGTACATGCGTGCGGGCCACGGCTTCCTGCTGGTGTTCGCTATTAACGACCGGCAGAGCTTCAACGAGGTGGGCAAGCTCTTCACGCAGATCCTCCGAGTCAAGGACCGCGACGACTTCCCAGTCGTGCTTGTTGGGAACAAGGCAGATCTGGAGACACAGCGGCAGGTGCCCCGATCTGAAGCCTCCAGTTTTGGCGCCTCGCACCACGTGGCCTACTTCGAGGCCTCGGCCAAACTGCGCCTCAACGTGGACGAGGCCTTCGAGCAGCTGGTGCGGGCTGTCCGGAAGTACCAGGAGCAGGAGCTCCCGCCCAGCCCGCCCAGCGCCCCGAGGAAGAAGGACGGAGGCTGCCCATGTGTCCTGCTGTAG

XM_004866913.1 Coding sequence

Rcn3 reticulocalbin 3, EF-hand calcium binding domain, transcript variant X1

High confidence: 4 potential gene matches
Length: 987 bp    Location: 4709150..4699299   Strand: -
>XM_004866913.1
ATGTGGCGCCCGTCACTCCTGCTGCTGCTGCTTCTGCTGCTGCGGCGCGGGGCGCAGGGAAAGCCATCCCCGGACGCCGGTCCTCACGGCCAGGCCAGGGTACACCAGGCGGCCCCCCTGAGTGACGCCCCGCATGACGACGCCCACGGAAACTTCCAGTACGACCACGAGGCCTTCCTAGGACGGGAAGTGGCCAAAGAATTCGACCAGCTCACCCCAGAGGAAAGCCAGGCCCGCCTTGGGCGCATCGTGGACCGCATGGACCGTGCTGGCGACGGGGATGGCTGGGTGTCGCTGGCCGAGCTTCGTGCGTGGATCGCGCACACGCAGCAGCGGCACATACGGGACTCGGTGAGCGCGGCCTGGGACACGTACGACACGGACCGCGACGGGCGCGTGGGTTGGGAGGAGCTCCGCAACGCCACCTATGGTCACTACGCGCCCGGGGAAGAATTCCACGATGTGGAGGATCCCGAGACCTATAAGAAGATGCTAGCCAGGGATGAGCGCCGTTTCCGGGTAGCCGACCAGGATGGGGACTCGATGGCCACTCGGGAGGAACTGACAGCCTTCCTGCACCCTGAGGAGTTTCCGCACATGCGTGACATCGTGGTAGCCGAAACCCTGGAGGACCTGGACAAGGACAAGGATGGCTATGTGCAGGTGGAGGAGTACATTGCGGACCTGTACTCTGCGGAGCCAGGGGCGGAGGAGCCGGCCTGGGTGCAGACAGAGCGGCAGCAGTTCCGGGACTTCCGCGACCTCAACAAGGATGGGCGGCTGGACGGCAGCGAGGTCGGCTACTGGGTGCTGCCACCGTCACAGGACCAGCCGCTGCTGGAGGCGAACCACCTGCTGCATGAGAGCGACCAGGACCAGGATGGGCGCCTGAGCAAGGCTGAGATCCTGGGGAACTGGAACATGTTCGTGGGCAGCCAGGCCACCAACTACGGCGAGGACCTGACCCGACACCACGACGAGCTCTGA

XM_004866914.1 Coding sequence

Rcn3 reticulocalbin 3, EF-hand calcium binding domain, transcript variant X2

Length: 831 bp    Location: 4709150..4699616   Strand: -
>XM_004866914.1
ATGTGGCGCCCGTCACTCCTGCTGCTGCTGCTTCTGCTGCTGCGGCGCGGGGCGCAGGGAAAGCCATCCCCGGACGCCGGTCCTCACGGCCAGGCCAGGGTACACCAGGCGGCCCCCCTGAGTGACGCCCCGCATGACGACGCCCACGGAAACTTCCAGTACGACCACGAGGCCTTCCTAGGACGGGAAGTGGCCAAAGAATTCGACCAGCTCACCCCAGAGGAAAGCCAGGCCCGCCTTGGGCGCATCGTGGACCGCATGGACCGTGCTGGCGACGGGGATGGCTGGGTGTCGCTGGCCGAGCTTCGTGCGTGGATCGCGCACACGCAGCAGCGGCACATACGGGACTCGGTGAGCGCGGCCTGGGACACGTACGACACGGACCGCGACGGGCGCGTGGGTTGGGAGGAGCTCCGCAACGCCACCTATGGTCACTACGCGCCCGGGGAAGAATTCCACGATGTGGAGGATCCCGAGACCTATAAGAAGATGCTAGCCAGGGATGAGCGCCGTTTCCGGGTAGCCGACCAGGATGGGGACTCGATGGCCACTCGGGAGGAACTGACAGCCTTCCTGCACCCTGAGGAGTTTCCGCACATGCGTGACATCGTGGTAGCCCGGACCTGTACTCTGCGGAGCCAGGGGCGGAGGAGCCGGCCTGGGTGCAGACAGAGCGGCAGCAGTTCCGGGACTTCCGCGACCTCAACAAGGATGGGCGGCTGGACGGCAGCGAGGTCGGCTACTGGGTGCTGCCACCGTCACAGGACCAGCCGCTGCTGGAGGCGAACCACCTGCTGCATGAGAGCGACCAGGACCAGGATGGGCGCCTGA

XM_004866916.1 Coding sequence

Fcgrt Fc fragment of IgG, receptor, transporter, alpha, transcript variant X2

Length: 1290 bp    Location: 4718991..4710024   Strand: -
>XM_004866916.1
ATGTGTGAGAGGAACTGGGGTCTCCAGTCACGAGAGCCAGGGCTGCAGGCCGGAAGGACTCGCTGGACGCTGGACAGAGGGGTGAGGGAGGCGGCCGGGCCCGGACCCTGGGGTCCGAGGAAGGAGATGGGTGGACAGAACTCCACGAAGCGAATTTCGGCCTGTCCAGGTCGCCCTCTCAGCATGGGGGAGCCCCGGCCGCAGCCCTGGGCGCTCAGTCTCCTGCTCCTGCTCCTGTTCCTGCCTCAGACCTCGGGCGCAGAGAACCATCTGTGCCTCCTGTACCACCTCACAGCTGTGTCGTCCCCTGCCTCAGGGTCACCTGCCTTCTGGGTGTCAGGCTGGCTGGGGCCACAGCAGTACCTGAGCTACAGCAGCCTGCGCAAGGAGGCCGAGCCCTGCGGGGCCTGGGTCTGGGAAAAACAGGTGTCCTGGTACTGGGAGGAGGAGACGACAGACCTGAGAAACAAGGAGAGGCTCTTCCTGGACGCTCTCAAAGCCCTGGAGGAAAAAGCCACCCCAGGTCCCTACACCCTGCAGGGCCTGCTGGGCTGTGAGCTGAGCTCTGACAACACTTCGGTGCCCACTGCCCTGTTCGCCCTGAACGGCGAGGACCTCATGCAGTTCCACCCCAGGAACGGCACCTGGACGGGTGACTGGCCCGAGGCCCTGGCCATCAGCACAAAGTGGCAGCAGCAGGCCGAGGCCGTGGACAAGGAGAGGACCTTCCTGCTCAGCTCCTGCCCGCAGCGGCTGCTGGGCCACCTGGAGCGGGGTCACAGGAACCTGGAGTGGAAGGAGCCGCCTTCCATGCGCCTGAAGGCCCGGCCTGACATCAATGGCTTCTCCGTGCTCACCTGCAGCGCCTTTTCCTTCTACCCCCCGGAGCTGCAGCTGCGCTTCCTGCGCAACGGGCTGGCAGCCGGCACCGGGGTGGGTGGCTTCGGCCCCAACGGCGATGGCTCCTTCCACGCGTGGTCATCGCTCCAGGTGCAGCGCGGGGATGAGCACCACTACCGCTGCCTGGTGCAGCACGCTGGGCTGCAGAAGCCGCTCTTAGTGGAGCTGGAGTCGCCGGCAGAGTCCTCCGTGCCGGTGGTGGTGGGCCTTGTCATGGGCTTCCTGGTGCTCGCAGCGGCGGCCGTGGGAGGAGCCCTGCTGTGGCGGAGGACGCGGAGCGGGCTGCCAGCACCCTGGATCTTCCTCCGCGGGGACGACATCGGGGCCCTGCTGCCCGGCCCCGGACTGCCCCAGGAGCCCGACTCTCCGGACGCCAACGGTGCTGCCTGA

XM_004866925.1 Coding sequence

Flt3lg fms-related tyrosine kinase 3 ligand, transcript variant X3

Length: 798 bp    Location: 4739214..4733941   Strand: -
>XM_004866925.1
ATGACAGTGCTGGCGCCAGCCTGGAGACCATCGTGCCCCCTGCTGCTGCTCCTACTGCTCCTGCTGCTGAGCCCCCGCTTGCACGGGACCTCCAGCTGCTCTTTCTCCCACAACCCCATCTCCTCCGACTTCAAAATCAAATTCAGCACACTGTCTGACTACCTGCTCAAGGATTATCCAGTCACTGTGGCCGCCAACCTGCAGGACGTGAGTCACACATGGGCAGGGCCTGGGATGGAGGTGGGAAGCGGACTGCAGAGACAGCACCTGCGGGACCAGGAGCAGTTCTGTGCGAAGCTCTGGCACCTGGTCCTGGCCCAGCGCTGGATGGAGCGACTCAAGACGGTGGCTGGGTTAAAGATTCGAGAGCTCCTGGAGACTGTCGACACGGAGATTCACTTTGTCACCTCATGTGCCTTCCAGCCCCTCCCCAGCTGCCTCCGCTTCGTCCAGACCAACATCTCCCACCTCCTGCAGGACACTGTGGCTCAGCTGGAGGCCATGAAGCCCTGGATCACCCACAGGAACTTCTCTCAGTGCCTGGAGCTCCGGTGCCAGCCCGACCCCTCCACTCCATTGCCCCCAAGGAGTCCCGGGGCTTTGGAGGCAACAGAGCTGCCCACCCCGCCATCCCACTCCCTGCTCCTGCTGTTGCTGCTGCTGCTGCCCGCCGCCCTCCTGCTGCTGCTCGCCTCCGTCTGGTGTTGGCAGCGGAGGCCGCGATCAAGGTGCCCCCTCCCTGCAGCCCCCAGGACGTCCCGCTCCTGCAGAGCTGAGCTGCCCAGCACCTGGTCCTGA

XM_004866923.1 Coding sequence

Flt3lg fms-related tyrosine kinase 3 ligand, transcript variant X1

Length: 816 bp    Location: 4739214..4735907   Strand: -
>XM_004866923.1
ATGACAGTGCTGGCGCCAGCCTGGAGACCATCGTGCCCCCTGCTGCTGCTCCTACTGCTCCTGCTGCTGAGCCCCCGCTTGCACGGGACCTCCAGCTGCTCTTTCTCCCACAACCCCATCTCCTCCGACTTCAAAATCAAATTCAGCACACTGTCTGACTACCTGCTCAAGGATTATCCAGTCACTGTGGCCGCCAACCTGCAGGACGTGAGTCACACATGGGCAGGGCCTGGGATGGAGGTGGGAAGCGGACTGCAGAGACAGCACCTGCGGGACCAGGAGCAGTTCTGTGCGAAGCTCTGGCACCTGGTCCTGGCCCAGCGCTGGATGGAGCGACTCAAGACGGTGGCTGGGTTAAAGATTCGAGAGCTCCTGGAGACTGTCGACACGGAGATTCACTTTGTCACCTCATGTGCCTTCCAGCCCCTCCCCAGCTGCCTCCGCTTCGTCCAGACCAACATCTCCCACCTCCTGCAGGACACTGTGGCTCAGCTGGAGGCCATGAAGCCCTGGATCACCCACAGGAACTTCTCTCAGTGCCTGGAGCTCCGGTGCCAGCCCGACCCCTCCACTCCATTGCCCCCAAGGAGTCCCGGGGCTTTGGAGGCAACAGAGCTGCCCACCCCGCCATCCCACTCCCTGCTCCTGCTGTTGCTGCTGCTGCTGCCCGCCGCCCTCCTGCTGCTGCTCGCCTCCGTCTGGTGTTGGCAGCGGAGGCCGCGATCAAGGTGCAGGGCGCCAGGCCCCCAGGAGCCGGTGAGCCCGCGGGGTGGGGGCGGGGAGGGGCTGGAGCTGGAGGCCCCGCCCCTGGCCTGA

XM_004866931.1 Coding sequence

Aldh16a1 aldehyde dehydrogenase 16 family, member A1, transcript variant X2

Length: 2262 bp    Location: 4758365..4745000   Strand: -
>XM_004866931.1
ATGGCGGAGACACACGCAAGGCCCAGCGTCCGCGAGATCTTCTCCACTCTGGAGTACGGACCCGCGCCGGAGAGCCACGCATGCGCACTGGCCTGGCTGGATGCCCAAAACCGCCTCTTGGGCCACTATGTAAATGGGAAGTGGCTAAAGCCAGAACACAGGAATTCAGTGCCTTGCCAGGACCCCGTCACAGGAGAGAATTTGGCCAATTGCCTCCTGGCAGAGCCTGATGATGTGGCTGCAGCAGTGAAGGCAGCCTTGGATGCACGGGGAAGCTGGAGTGGAGTCCCCGGAGGCGAGCGGGCCCAGCACCTGACCAGGCTGGCCAAGATGATCCAGAAGCACCAGCAGCTTCTGTGGACCCTGGATTCCCTGCTCACTGGGCGGGCCATTCGGGAAGTTCGCAGTGGGGATGTCCCACTGGCCCAGCAGCTGCTGCAGTACCATGCAGTCCAAGCTCATGTCCAGGAAGAGGTACTGGCAGGCTGGAAGCCCATGGGTGTTATTGGCCTCATCTTACCACCCACGTTCTCCTTCCTAGAGATGATGTGGAGAATTTGCCCTGCCCTGGCAGTGGGCTGCACCGTGGTGGCCATTGTACCCCCAGGCTCCCCAAGCACCCTCCTCCTGGCCCAGCTGGCAGGGGGCCTTGGCACATTCTGCGGGATCCTCAATGTGATTGTTGGCCCTGCCTCCCTGGGGCCCACTCTGGGCCGATGTCCTGGAGTGCAGAAGGTGGCCTTCTGTGGAGCTGCAGAGGGCGGCCTCCGGCTCCTGGTCCAAGAATCTGTGTGGGAGGAAACCATGAGGCGACTCCAATCGAGGATGAGGCGGCTGCGGAGTGGCCCAGGCCTGGACGGGGCCGTGGACATGGGGACCCGAGGGGCTGCTGCCTGTGATGTGGCCCAGCGCTGTGTGCAGGAGGCCAGGAGTCAGGGTGCAGAGGTGTTCCAGGCTGTCACTGTGCCCTCAGGTGGCCCACTCTTTCCCCCAACATTGGTCTCTGGCCTGCCCCCCGCCGCACCATGTGCCCAGGCAGAAGTCCCGTGGCCGCTGGTCATGGCCTCCCCTTTCCGCACAGCCAAGGAGGCGCTGGCCATGGCCAACAGCACACCTCGGGGAGGCAGCGCCAGTGTGTGGAGCGAGAGGCTGGGGCAGGCGCTGGAGCTGGCCTATGGGCTCCGGGTGGGCACAGTCTGGATCAACACCCATGGCCTCAGAGACCCTGCAGTGCCCATAGGTGGCTGCAAGGAGAGTGGGTCTTCCTGGCACGGGGGCCTGGATGGTCTGTATGAGTACCTGCAGCCCTCGGGGACCCCTGGCCAGCTGCCTTTTGTTTTTGAGCATCTGAACTATGACAGCTTCGGCCTTGCCTTACCCACAGCCCTGCCAGCATGGCCCGAAACAGGGCCCAGCCCAGTGCCTCCCTATGGGCTCTTTATCCGGGGCCGATTCCAGCCTTCGGGAGCCGGGAGCTCTAGGCCCATCTGGGATTCTTCTGGCAAACTCCATGGCTACGTGGCTGAGGGTGCAGCTGAGGATGTGCGAGGCGCTGTGGAAGCCGCTCACCAGGCTGCCACTGGCTGGGAGCGTCAGTCCCCAGGGGCCCGGGCGGCCCTGCTGGTGGCGCTGGCAGCTGCGCTGGAGCACAGGGGACCCGGCCTGGCCTCGAGGCTGCAGCGGCATGGAGTGGAGCTCGAGGCTGCCAAGGTGGAGGTGGAGCTCAGCGCCAGGCGACTCCGGGCGTGGGCAGCCCAGGCCCAGGCCCAAGCCCAGGGCCACACCCTGCAGGTAGCAGGGCTCAGAGGCCCTGTGCTCCGCCTTCGGGAGCCACTGGGTGTGCTGGCAGTCGTGTGCCCTGACGAGTGGCCTCTGCTCGCCTTCGTGTCCCTGCTGGCCCCTGCCCTGGCGCACGGCAACACTGTGGTCTTGGTGCCCAGCGGGACCTGTCCCCTGCTGGCCCTGGAGATCTGCCAGGATGTGGCCTCGCTGTTCCCCGCTGGACTGGTGAACGTAGTGACAGGAGATCGTGACCACCTGACGCGCTGCCTGGCCTTGCACCAGGATGTCCAGGCGCTGTGGTATTTCGGATCTGCAGAGGGCTCCCAGTTCGTGGAGTGGGCCTCGGCGGGAAACCTCAAGCCTGTGTGGGTGAACAGTGGATGCCCAAGGGCCTGGGAGCAGGAGCCCCAGGGGGCAGGCCCAGAGCTGAGGCTGCGGGCAGCACGGACCAAGGCCCTGTGGCTGCCCATGGGGGACTAA

XM_004866936.1 Coding sequence

LOC101702060 cell surface glycoprotein 1-like, transcript variant X2

Length: 1539 bp    Location: 4782193..4775727   Strand: -
>XM_004866936.1
ATGAAATCTTTCAGTCCGATCCTCTTCCTTCTGGTCTTCTTCCTTGCCCTCCTGGGCTCCCAGGCGGCACCTTCAGCCCCTCTGCCCCTGGGTTCTGACTTCCAAGGGATGGGCCGCCCCGGAACGACCTCCCCCGGCGCTTCTGAAAACGCCACTGGAGACGGGCCTAACCCACAGCACCCTGTGACTGTTCCTCCTGAGGCCCCGAAGATGCCTCATGCAGTTTCCCCTGAGACCACCCCCCTTAATGTCACTGAGACCCCTAGGCCTGATCTAGAAACCCCACACCCACAGTCTCCTGAGACCCCCCAGCCTGGCCCACTCACAACCTCAGTATCAGAATCCCCGGCCACCCCCCACCCTAACCCCTCCCAAGCAACACACCCAGAGCCTTCTGAGGAGACCCCCGACCCTGCCCTGACAGACACTCCACACCCCGGATCCTCTGAGACCCCAAAACCTAGTCCCTCAAAAACGACACCCCCAGAATATCTTGAGACCCCAAATACTAACCCTATGCAGACCGCACACCAAGAATCCACAGAGATCCCCAGACTTAACACCACTGAAATCTCACGTGTTAAAGGCCCTGACCCCACCAAGCCTCTTGACACCAAATCTCTAGAAGCCCATGATCCGGACACCGCTGAGACCCCAAGCTCTCAGTTCCCCCTGACCGTCCGTCCTGAGCCCACTGAAACCCTGCACCCAGAGACCCACAAGACCCATCACCCCAGCCCCACCGACACTCCCCAAACAGAGCCTCCCACAACCCACCACCAGGGTCCAACCAAGACCCCAAAAACTTCTGCCCTTGAAGTCTCCACTAGTCTCCACCCCGAAACCCCTGGACCCTTCAAGGACACAGCCACTGTACTCAGTGAGCTGCAGCCCAGTCCCCAGGCAGACACCCGTGCGGGCCCCCAGCCTGACCCCTCTCAACTGCCCACCCCAGATTCTCCAGCGACTCTTGAGACAAAGGCCCCCCAAAACTCTGACCCCAAAGGGCAAAGCACCCCTCTGCCCTCAGCCCGGATTGTGGGCCCCCCTGCTCCTCCAGAGCCACCCAGTCAGCTGCTCCCTGCAACTCCTTGGGCTCCTCAGCGGCGCAGCCGAGGCGAGAGAGTGAACACTATCATCGTGGTGGAGCACGTGAAAGAGACCGGCGTGACTCTAGTGGGGCGCCCACGCGGCTCGACTGGAGGGGCCCTGTGCCTGTTCTTTGCTGGGACCGGGCTTTTGATCTGCATCTTGCTGCTGCTGTGGTGTCTCTACCGGCGGGCAGCCCGGCACCGGCCCTTCGCACACCACCGGCTCCCGGACAGCGGAGACGAACCCGTTATGCACCTGGACGCCCCGAAGGACCCCTACAACCTCTACTTTTATGCGCCAGATGCCTGGGTCCCTTCGCACATCTCCACCAAGCAGCCGCCGCCCACACCCCCGCTGCCACCCAAGCTGCCCCCGCCGCCCCGCGGGGGACGCCCCCAGCGCCTGGAGCCGCTGTCCCCTGATACACTCCCCAACAACTTCGTGTGA

XM_004866943.1 Coding sequence

Cd37 CD37 molecule, transcript variant X1

Length: 945 bp    Location: 4841702..4838535   Strand: -
>XM_004866943.1
ATGTCGGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTGTTCAACCTCTTCTTCTTCGCCCTTGGCAGCCTGATTTTCTGCTTCGGCATCTGGATTCTCATCGACAAGACCAGCTTCGTGTCCTTTGTGGGCTTGTCCTTCGTGCCCCTGCAGACCTGGTCCAAGATCCTGGCAATCTCAGGGGTTCTCACCATGGGCCTCGCTCTCCTGGGTTGTGTGGGAGCCCTCAAGGAACTCCGAAGCCTTCTGGGTATGGTGAGTGCCCCACCCCTATCCCTAGAGCCACTCCCCAGCCTCAAGAGTCCCCTGGGGAGGGGTCAGCCTGACCTCTCCCCTCTGCTCCAGTATTTCGGGATGCTGCTGCTCCTGTTTGCCACGGAGATCACCCTGGGCATCCTCATCTCCACCCAGCGGGTCCGGCTGGAGCGAAGGGTGAAGGAGCTCGTGCTGAGCACCATCCAAAACTACGGCTCCAACCCGGAGGAGACAGCGGCCGAGGAGAGCTGGGACTACGCCCAGTTCCAGCTGCGCTGCTGCGGCTGGCACTCTCCGCAGGACTGGTTCCAGGTCCTCATCCTGAGAGGCAACGCGTCAGAGGCGGACCGCGTGCCCTGCTCCTGCTACAACTCGTCGGCGACCAACGACTCCGCAATCTTTGATAAGATCTACTCACCGCAGCCCGGCCGGCTCGGACCTCGGGCGAGGCCCAGGCACAGCACAGACCTGTGCTCCGTGCCCGCAAATGGCCACATCTACAGCGAGGTAGCTGAGGGTTTGGGGCCTGAGCTGCTCCAAGGGGAGGTGGCCTTTGCCAGGGGGCGTGGTCCGGTTGTGGGCGTGGTCCGGAGAGGCGTGGCTACAAGGGGATCTGTCCAACTAAGGGGAGAGAGCAACGCGAGGGGGCGGAGCCTTACAAAGGGACAGGGTGTGTAA

XM_004866937.1 Coding sequence

LOC101702060 cell surface glycoprotein 1-like, transcript variant X3

Length: 1539 bp    Location: 4778208..4775727   Strand: -
>XM_004866937.1
ATGAAATCTTTCAGTCCGATCCTCTTCCTTCTGGTCTTCTTCCTTGCCCTCCTGGGCTCCCAGGCGGCACCTTCAGCCCCTCTGCCCCTGGGTTCTGACTTCCAAGGGATGGGCCGCCCCGGAACGACCTCCCCCGGCGCTTCTGAAAACGCCACTGGAGACGGGCCTAACCCACAGCACCCTGTGACTGTTCCTCCTGAGGCCCCGAAGATGCCTCATGCAGTTTCCCCTGAGACCACCCCCCTTAATGTCACTGAGACCCCTAGGCCTGATCTAGAAACCCCACACCCACAGTCTCCTGAGACCCCCCAGCCTGGCCCACTCACAACCTCAGTATCAGAATCCCCGGCCACCCCCCACCCTAACCCCTCCCAAGCAACACACCCAGAGCCTTCTGAGGAGACCCCCGACCCTGCCCTGACAGACACTCCACACCCCGGATCCTCTGAGACCCCAAAACCTAGTCCCTCAAAAACGACACCCCCAGAATATCTTGAGACCCCAAATACTAACCCTATGCAGACCGCACACCAAGAATCCACAGAGATCCCCAGACTTAACACCACTGAAATCTCACGTGTTAAAGGCCCTGACCCCACCAAGCCTCTTGACACCAAATCTCTAGAAGCCCATGATCCGGACACCGCTGAGACCCCAAGCTCTCAGTTCCCCCTGACCGTCCGTCCTGAGCCCACTGAAACCCTGCACCCAGAGACCCACAAGACCCATCACCCCAGCCCCACCGACACTCCCCAAACAGAGCCTCCCACAACCCACCACCAGGGTCCAACCAAGACCCCAAAAACTTCTGCCCTTGAAGTCTCCACTAGTCTCCACCCCGAAACCCCTGGACCCTTCAAGGACACAGCCACTGTACTCAGTGAGCTGCAGCCCAGTCCCCAGGCAGACACCCGTGCGGGCCCCCAGCCTGACCCCTCTCAACTGCCCACCCCAGATTCTCCAGCGACTCTTGAGACAAAGGCCCCCCAAAACTCTGACCCCAAAGGGCAAAGCACCCCTCTGCCCTCAGCCCGGATTGTGGGCCCCCCTGCTCCTCCAGAGCCACCCAGTCAGCTGCTCCCTGCAACTCCTTGGGCTCCTCAGCGGCGCAGCCGAGGCGAGAGAGTGAACACTATCATCGTGGTGGAGCACGTGAAAGAGACCGGCGTGACTCTAGTGGGGCGCCCACGCGGCTCGACTGGAGGGGCCCTGTGCCTGTTCTTTGCTGGGACCGGGCTTTTGATCTGCATCTTGCTGCTGCTGTGGTGTCTCTACCGGCGGGCAGCCCGGCACCGGCCCTTCGCACACCACCGGCTCCCGGACAGCGGAGACGAACCCGTTATGCACCTGGACGCCCCGAAGGACCCCTACAACCTCTACTTTTATGCGCCAGATGCCTGGGTCCCTTCGCACATCTCCACCAAGCAGCCGCCGCCCACACCCCCGCTGCCACCCAAGCTGCCCCCGCCGCCCCGCGGGGGACGCCCCCAGCGCCTGGAGCCGCTGTCCCCTGATACACTCCCCAACAACTTCGTGTGA

XM_004866948.1 Coding sequence

Tead2 TEA domain family member 2

High confidence: 4 potential gene matches
Length: 1359 bp    Location: 4821721..4837257   Strand: +
>XM_004866948.1
ATGGGGGAACCCCGGGCTGGGGTCCCCCTGGAGGATGGCAGCGGCTGGACTGGCAGCGAGGAAGGCAGTGAGGAGGGCACGGGTGGCAGCGAGGGGGCCGGGGGCGATGGCGGCCCAGATGCAGAGGGTGTCTGGAGCCCCGACATCGAGCAGAGCTTCCAGGAGGCACTGGCCATCTACCCGCCCTGCGGCCGCCGGAAAATCATCCTGTCTGATGAAGGCAAGATGTATGGTCGGAATGAACTGATTGCGCGCTACATCAAGCTCAGAACTGGGAAGACCCGGACTCGGAAACAGGTCTCTAGTCACATCCAGGTTTTGGCTCGGAGGAAATCGAGAGAAATCCAGTCCAAGCTGAAGGCCCTGAATGTGGACCAGGTTTCCAAGGACAAGGCTTTCCAGACGATGGCTACCATGTCATCCGCTCAGCTCATCTCCGCACCTTCCTTGCAGGCCAAACTGGGTCCTGCTGGTCCTCAGGCCACTGAGCTGTTCCAGTTTTGGTCAGGGGGCTCTGGGCCCCCCTGGAATGTGCCAGATGTGAAGCCATTCTCACAGACACAGTTCTCCTTGTCACTGACACCCCCATCTACTGACCTCCCAGGGTACGAGCCCCCCCAAGCCCTCTCTCCCCTGCCCCCACCTGCCCCATCACCGCCAGCGTGGCAGAGTCGGGCCCTGGGCACTGCCCGTTTGCAGCTGGTGGAATTCTCAGCCTTTGTGGAACCGCCAGATGCAGTTGACTCTTACCAGAGGCACCTGTTCGTCCACATCAGCCAGCACTGTCCCAGCCCTGGCGCACCCCCGCTGGAGAGCGTGGACGTCCGGCAGATCTACGACAAATTTCCCGAGAAAAAGGGTGGTCTTCGGGAGCTGTATGATCGCGGGCCCCCCCATGCCTTTTTCCTGGTCAAGTTCTGGGCTGACCTGAACTGGGGCCCAAGCGGTGAGGAGGCAGGTGCTGGTGGTGGCAGCACTGGCAGCGGTGGCTTCTATGGAGTGAGCAGCCAGTACGAGAGTCTGGAGCACATGACCCTCACCTGCTCCTCCAAAGTCTGCTCCTTCGGCAAGCAGGTGGTGGAGAAGGTGGAGACGGAGCGGGCCCAGCTAGAGGATGGGCGGTTCGTGTATCGCCTGCTGCGTTCGCCCATGTGCGAGTACCTGGTGAATTTCCTGCACAAGCTTCGGCAGCTGCCCGAGCGCTACATGATGAACAGCGTCCTGGAGAACTTCACCATCCTGCAGGTGGTGACGAACAGAGACACCCAGGAACTGCTGCTGTGCACCGCCTACGTCTTCGAGGTCTCCACCAGTGAGCGTGGGGCCCAGCACCATATTTACCGCCTGGTCAGGGACTGA

XM_004866858.1 Coding sequence

Il4i1 interleukin 4 induced 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1674 bp    Location: 4435040..4444551   Strand: +
>XM_004866858.1
ATGGCCCGGCTGGCCCTGCACCTCCTTGCCCTGGCCCCCATCCTCTTCAGCCTGGCACCCTCCCTGGCCTGGAAGGAGGCCTCCAGCCAGGACCCCTTCGAGAAATGCATGCACGATCCCGACTATGAGCTGCTGCTCAAGGTGGTGACCCAGGGCCTCAATCGGACCTTGCAGCCCCAGAAGGTGATTGTGGTTGGCGCTGGTGTGGCCGGGCTGGTGGCTGCCAAGGTGCTCAGTGATGGTGGACACAAGGTCACCGTTCTGGAGGCAGATAACAGGATCGGGGGCCGCATCCTCACCTTCCGGGACCCTAAGACCAGCTGGTCTGGGGAGCTAGGAGCCATGCGCATGCCCAGCTCCCACAGGATCCTGCACATGCTCTGCAAGAGCCTGGGGCTCAACCTGACAAAATTCACCCAGTATGACGAGAACACGTGGACAGAAGTGAACGGCGTGAAGCTGCGGAACTACGTGGTGGAGAAGATGCCCGAGAAGCTGGGCTACAAACTGCGCCCCAAAGAGAGGGGCCGCTCCCCAGAGGACATCTACCAGATGGCTCTCAACAAGGCCCAGAAAGATGTCAAGGCGCTGGGCTGCAGAAAGGCACTGAGGAAGTTTGAAAGGCACACGCTCCTGGAATTCCTCCGCGGGGAGGGCAATCTCAGCCGACCAGCAGTGCAGCTTCTGGGAGACGTGATGTCCAAGGATGGCTTCTTCTATCTCAGCTTCGAAGAGGCCTTGCGCGCTCATAGCTGCCTCAGCGACCAGCTCCGGTACAGCCGCATCGTGGGCGGCTGGGACTTGCTGCCGCGCGCGCTGCTGAGCTCGCTGTCTGGCCCCGTGCTGCTGAACGCGCCTGTCGTGGCCGTGACCCAGGGCACGCGCGACGTGCGGGTGCACATCGCGACCTCGAGCCAGTCGCGGAGCCTGAAGGCTCTGACGGCCGATGTGGTGCTGCTGACGGCCAGTGGGCCGGCGCTGCAGCGCATGACCTTCTCGCCGCCGCTGTCGCGCGAGCGCCAGGAGGCGCTGCGCAGGCTGCACTACGTGCCGGCCACCAAGGTGTTCCTGAGCTTCCGCCGGCCCTTCTGGCAGGACGAGGGCATCGAGGGCGGCCACTCGAACACCGACCGCCCGTCGCGCGCGGTTTTCTACCCTCCGCCAGGCGAGGGCGCGCTGCTGCTGGCTTCGTACACGTGGTCGGACGCCACCAACGCGTTCGCGGGCCTGGGCACCGAAGAAGTGCTGCGCCTGGCGCTCACCGACGTGGCGGCGCTGCATGGACCGCACGTCTACCGGCTCTGGGACGGCACCGGTATTGTCAAGCGCTGGGCTGAAGACCCACACAGCCAGGGCGGCTTCGTGGTGCAGCCGCCCGTGCTCTGGCAAACCGACGGCGACGAAGACTCCGAGGCCTTTGCACAGCCCTACGATTGGACGACCCCCCACGGCCGCATCTACTTCGCGGGCGAGCACACGGCCTACCCTCACGGCTGGGTGGAGACAGCCGTCAAGTCGGCGCTTCGGGCCGCCCTGCGGATCAACAGCCCCGAGGGTCAGGCGTGCACGGAGGCCCCGCAGCAGCTGGGGGCCGAGCACCAGGCTACCTACCGCGTCCCAGGCCATCCCCTCCTGCGGCTCCCGCACTCCACCCACCGGAAGACCTCACATTAA

XM_004866864.1 Coding sequence

Tbc1d17 TBC1 domain family, member 17, transcript variant X5

Length: 1851 bp    Location: 4454171..4445161   Strand: -
>XM_004866864.1
ATGGAGAGATCTTGCTACAGAGACAATGACGTCCTCCTGCACTGGGCTCCTGTGGAGGAGGCTGGAGATTGCACCCAAATCCTCTTCTCCAAGAAGGACTCTAGTGGGGGTGACCCCTGCACCTCTGAGGAGGAACCCACCTTTGACCCTGGCTATGAACCTGACTGGGCTGTCATCAGTACCGTGCGGCCACGGCTCCACCACTCAGAGCCTGCCAGAGGTACAGAGCCCAGCTCCCCCCGGGCTCAGTGGGCCTTCTCAGTGAGTCTGGGGGAGCTGAAGTCCATCCGCCGATCCAAGCCAGGCCTTAGCTGGGCCTACCTGGTTCTGGTGACCCAAGCCGGAGGCTCCCTGCCTGCCCTGCACTTCCACCGAGGAGGCACCCGAGCCCTGCTTCGAGTCCTCAGCCGCTACTTGCTACTGGCCAGCTCCCCGCAGGACTCCCGCCTCTACCTTGTCTTTCCCCATGACTCCTCTGCCCTCTCCAACTCCTTCCACCACCTGCAGCTCTTTGATCAGGACAGCTCCAATGTGGTCTCTCGCTTCCTCCAAGACCCCTACTCCACCACCTTCAGCAGCTTCTCCCGCGTGACCAACTTTTTCCGGGGAGCCTTGCAGCCACACCCCGAGGGGGCCTCCTCTCCTGACCTTCGCCCCCCACCCGATGATGAGCCTGGGTTTGAGGTCATCTCCTGTGTGGAGCTGGGGCCACGGCCAGCCGTGGAGCGTGCCCCTCCTGTCACAGAGGAGGAGTGGGCCCGCCACGTGGGCCCCGAGGGCCGCCTGCAGCAGGTCCCTGAGCTGAAGAACCGGATCTTCTCGGGGGGTCTGAGCCCCAGCCTGCGGCGCGAGGCCTGGAAGTTCCTCCTGGGCTACCTCAGCTGGGAGGGCTCAGCCGAGGAGCACAAGGCCCACCTGCGCAAGAAAACGGATGAGTATTTCCGCATGAAGCTGCAGTGGAAGTCCGTGAGCCCTGAGCAGGAGCGGAGGAACTCACTCCTGCACGGATACCGCAGCCTCATTGAGAGAGACGTGAGCCGCACTGACAGGACCAACAAGTTCTATGAGGGCCCTGAGAACCCGGGGCTGGGGCTGCTGAACGACATCCTCCTCACCTACTGCATGTACCACTTTGACCTCGGCTATGTCCAGGGCATGAGTGACCTTCTCTCCCCGATCCTCTACGTCATTCAGAACGAGGTGGATGCCTTCTGGTGTTTCTGTGGCTTCATGGACCTCGTGCACGGGAACTTTGAGGAGAGTCAGGAGACCATGAAGCGGCAGCTGGGGCAGCTCCTGCTACTGCTAAAGGTGCTGGACCAGCCGCTGTGTGACTTCCTGGACTCCCAGGACTCCGGCTCTCTCTGCTTCTGCTTCCGGTGGCTGCTTATCTGGTTCAAGAGGGAATTCCCCTTCCCGGACATCCTCCGGCTGTGGGAGGTGCTGTGGACGAGGCTTCCCGGTCCTAATCTGCACCTGCTGGTGGCCTGCGCCATCCTGGACATGGAGCGGGACACCCTCATGCTGTCAGGCTTCGGCTCCAACGAGATCCTGAAGCACATCAACGAGCTGACCATGAAGCTGAGCGTGGAGGACGTGCTGACGCGTGCCGAGGCGCTGTACTGGCAGCTCACCGCCTGCCCGGAGCTGCCCCACAACGTGCAGGAAGTCCTGGGCCTGGCGCCGCCCGCGGAGCCCCCCAGCCCCTCGCCTCCGGTCTCCCCGCTGCCGCTGTCGCCTACACGTGCCCCGTCGACCCCGCCGCCCGCCGCCGCCGCCGCCGCCGCTGCCCCGCAGCCAGACAGCAGCCTGGAGATCCTGCCCGAGGAGGGGGATGGGCCCGACTCCTAG

XM_004866872.1 Coding sequence

Med25 mediator complex subunit 25, transcript variant X2

High confidence: 4 potential gene matches
Length: 2238 bp    Location: 4503885..4486421   Strand: -
>XM_004866872.1
ATGGTCCCCGGGTCCGAGGGCCCGGCCCGGGCCGGGGGCCTGGTGGCCGATGTGGTGTTCGTGATCGAGGGTACAGCCAACCTGGGCCCCTACTTCGAGGAGTTGCGCAAGTACTACCTGCTCCCGGCCATCGAGTATTTCAATGGTGGTCCTCCTGCGGAGACGGACTTCGGGGGAGACTATGGGGGTACCCAGTACAGCCTTGTGGTCTTCAACACAGTGGACTGCGCCCCGGAGTCCTACGTACAATGTCATGCTCCCACCAGCAGCGCCTATGAGTTTGTCACCTGGCTTGATGGCATTAAGTTCATGGGCGGCGGTGGTGAGAGCTGCAGCCTCATCGCAGAAGGCCTCAGCACAGCCCTGCAGCTCTTTGATGACTTTAAGAAGATGCGCGAGCAGATTGGCCAGACACACCGAGTCTGCCTCCTCATCTGCAACTCACCACCGTACCTGCTTCCTGCTGTTGAGAGCACCACCTACTCGGGGTACACAACTGAGAGCCTTGTTCAGGAGATAGGGGAGCGTGGGATCCACTTCTCCATCGTGTCCCCTCGGAAGCTTCCTGCTCTGCGGCTTCTGTTCGAGAAGGCTGCCCCCCCAGCCATGCTGGAGACGCTACAGCCACCGGCGGACGTGAGCCAGGACCCGAGGCACATGGTGTTGGTGCGCGGGCTGGTGCTGCCTGTTGGGGGTGGCTCGGCCCCAGGCCCCCTCCAGCCCAAGCAACAGGTGCCTCTGCCACCCGCGCCACCCTCGGGTGCCACACTCTCAGCCGCACCTCAGCAGTCCCTGCCCCCTGTGCCGCCACAGTACCAGGTCCCCGGGAACCTGAGCGCAGCGCAGGTGGCTGCCCAGAATGCAGTGGAGGCTGCCAAGAACCAGAAGGCTGGACTTGGCCCCCGCTTCTCGCCCATCAACCCTCTCCAGCAGGCTCCTTCAGGAGTGGGACCCCCCTTCAGTCAGGCTACGGCCCCAGCATTACCTCCAGGGCCTTCTGGTGCCACCAAGGCGCCTCCTGCCTCTCAGCCCAACCTGGTCTCCACAGTGGCGCCTGGCCCGGGCCTGGCCCCTACCGCACAGCCTGGGGCACCATCCATGGCGGGCACAGTGGCCCCAGGTGGTGTCAGTGGTCCTTCCCCCGCCCAACTCGGGGCGCCAGCCCTCGGTGGGCAGCAGTCAGTCTCCAACAAGCTCCTGGCCTGGAGCGGGGTGCTTGAATGGCAGGAGAAACCGAAGCCCGCCTCAGTGGATGCCAACACCAAGCTGACCCGCTCCCTGCCCTGCCAGGTCTACGTGAATCATGGAGAGAACCTGAAGACAGAGCAGTGGCCACAGAAGCTGATCATGCAGCTCATCCCCCAGCAGCTGCTGACCACCTTGGGCCCTCTGTTCCGGAACTCAAGGATGGTGCAGTTCCACTTCACCAATAAGGACCTGGAGTCCCTCAAAGGCCTCTACCGTATCATGGGCAACGGCTTCGCTGGCTGTGTGCACTTCCCCCACACGGCCCCCTGCGAGGTCCGAGTGCTCATGCTCCTCTATTCATCCAAGAAGAAGATCTTCATGGGCCTCATCCCCTACGACCAGAGTGGCTTTGTCAATGGCATCCGGCAGGTCATCACCAACCACAAGCAAGTCCAGCAGCAGAAACTGGAGCAGCAGCGTGGGATGGGACAGCAGGCACCCCCAGGCCTGGGCCCTATTCTGGAGGACCAAGCAAGGCCCTCGCAGAATCTGCTTCAGCTCCGCCCACCACAGCCCCAGCCTCAGGGTACTGTGGGGGCATCTGGGGCCACAGGGCAGCCCCAGCCCCCAGGTACCACCCAGGCCCCCCCAGGTGCCCCCCAAGGCCCTCCTGGAGCTGCCCCTGGCCCACCTCCTCCTGGACCCATCCTTCGGCCCCAGAACCCTGGGGCCAATCCCCAGCTGCGGAGCCTGCTTCTCAACCCGCCACCGCCCCAGACTGGGGTCCCCCCACCGCAGGCCTCCCTCCATCACCTCCAGCCACCAGGGGCTCCTGCATTGCTGCCACCACCGCACCAGAGCTTGGGGCAGCCCCAGCTGGGGCCCCCGCTCCTGCACCCACCACCCGCCCAGTCCTGGCCAGCTCAGCTTCCCCCGAGGGCTCCGATGCCAGGTCAGATGCTGCTGAGCGGGGGTCCCCGGGGCCCGGTTCCCCAGCCGGGCCTGCAGCCCAGCGTCATGGAGGACGACATCCTCATGGATCTCATCTGA

XM_004866889.1 Coding sequence

Tsks testis-specific serine kinase substrate, transcript variant X7

Length: 1671 bp    Location: 4546432..4560888   Strand: +
>XM_004866889.1
ATGGCAAGTGTGGTCGTGAAGACCATCTGGCAGTCCAAGGAGTTCCATCAGGCTGGGGACACCCCTGCCAGGGTCGAGAGGAGGATCCAGCTGGGCCCCGAGGCTCCCGGGAGCATGACCGGCCCAGCCAAGGGAGTCAGGAAGAAAAAGAAGGCTGTGTCGTTCCACAGGGAGACCAGTGAAGGCAGAAGAAAGCAGGAAGCGGGGACTGAAGAGGCAGAAGAAAGGCAGCAGGGGCTGAAGAGAGAGAAGATAGCGGACCTGGGGGAAGGCGAGAATGAAGAAAGTGGGCTCGTGGAGCCGCGGACGCCACACGAGCCAGTGGACTGGTGTCTCAACCTCAGACGGTCCTCGGGCTGCACCAACGTGTCCCTGCTCAACCTGGCCGCCGCTGTGGAGCCCTGGGACTCCTCCGGCACCAACTGCATCACGGAAGACAGCGGCCCGCTGGAGCTGCCTGGCCCCCCGGCTGCCCCCGCCCCACCCTGGGCTGCGGATGACCCGGACATCAAGGAACTTCTGAGTGGGCTCAACAGTGGACTAGTCCATGCCAAGGACTCTGTCATCAGCTTGAAGGAAAAGACCAGCTGGGTAAACCAGCACGTGCAGACCCTGCAGAGCGAATGTTCCCTGCTGAGCGAGAATCTAGAGAGAAGGCGGCAGGAGGCGGAGGAGCTGGAGGGGTACTGTAGCCAACTCAAGGAGAACTGCAAGAAGGTGACCCGCTCGGTGGAGGATGCTGAAATCAAAACGAACGTCTTGAAGCAGAACTCAGCCCTGTTGGAGGAGAAGCTGCGATACCTCCAGCAGGAACTGCAGGACGAGACGCCGAGGCAGGAGGTCGAGATGCAGGAGCTGGAGCAGAAGCTGGAGGCCAGCCTCTCCCACTCCGGCCTCTCAGGAAACCCCGAAGAGGCCGCAAGGTTACGAAGCACGGCCCCAGGCGGCTGTGGAACTGGGCCCGGGGCGGGAGAAACGCCCCACACGAGCGAGCAGGAGCTGCAGAAGGTCTCAGCCAGCCTGGAGGACCTGAGGAGGGAGGTGTCCTCACTGGCCGCACGGTGGCATCAAGAGGAGGGGGCGGTGCAGGAAGCCCTGAGGCTGCTCGGGGGTCTGGGCGGAAGGCTCGACGGCTTCATGGGTCAGTGGGAGCGCGCGCAATGCGACCAGACGCAGACAGCGCGGAGCCTGCAGGAGCTGCGCAGACAGGCGGACCAGCTGTGCACCTTGGTGGAGCGCTCAGCAGTGTCTCTGGCTTCCCTGAGGAGCGAACTGGAGGGGCTGGGTCCGGTCAAACCAATTCTGGAGGAGCTGGCACGGCAGTTTCGGAACTCTCAAAGGGTACCTGACCACTCCATGAACCCGGATCGGTCGTCCCAAGGCTCCTGTGCTCGCTGTGCCAGCCAGGGACAGCAATTGTCCATGGAGTCCCTGCAGCATCTGTTGGAGCGAGCGCTGACCCCACTAGTGGATGAGGTGAAGCAGAGAAACCTGACGCCTCCTGCCTGTCCCAGCTGCCAGAGGCTACACAAGAAGATTCTGGAGCTGGAGCGCCAGGCCTTGGCCAAACACATCCGGGCAGAGGCCCTGAGCTCCACCCTTCGGCTGGCCCAAGACGAGGCCTTACGGGCCAAGAATCTGCTCCTGACAGACAAGATGAAGCCGGAGTGA

XM_004866903.1 Coding sequence

Bcl2l12 BCL2-like 12 (proline rich)

High confidence: 4 potential gene matches
Length: 768 bp    Location: 4611360..4605821   Strand: -
>XM_004866903.1
ATGGCAGGCTCAGAAGAGCTGGGGCTCCGGGAGGACACGCTGAGGGTCCTAGCTGCCTTTCTGAGGCGGGGTGAGCCTGCCGGGTCCCTCACTCCATCTCCACCCAGGAGCCTTGCCCAAGTGGAGCCAACGGACTTCCTGAGCCGCCTTCGAAGATGTCTTCCCTGCCCCCTGGGACAAGGAACTGTTCCTCCTCAGTCCTCTCGGCCTTGCTCTCTGCCCCTGCACCCCTGCTATGGCTCAGAACCTGGCCCAGCTACTCCTGACTTCTATGCCCTAGTGGCTCAGCGGCTGGAACAGCTGGTCCAAGAGCAGCTGAGATGTCCGCCCAGCCCAGAGTTGCAGGGCCCCCCACCCACGGAGAAGGAAGCCCTCCTGCGGAGGCTGGTGGCCTTGCTGGAAGAGGAGGCGGAAGTCATCAACCAGAAGCTGGCGTCAGACCCCGCCCTGCGCCGCAGGCTGGCCCGCCTGTCTACCGGCTCTTTCGCCCGCCTAGTGGAACTGTTCTCCAGCCGGGAGGGCAGCCCCGGCCCCAGCCGCGCCAGCCCCTCGCTGCCATGCCCTGGGCCCCCACCGCCTTCCCCAGAGCCCCTAGCCCGCCTGGCCCTGGCCATGGAGCTGAGCCGGCGCGTGGCCCGGCTGGGGGGCACCCTGGCCGGACTCAGCGTGGAGCACGTGCAGAGCTTCACACCCTGGATCCAGGCCCAAGGGGGATGGGAGGGTATCCTGGCTGCATCCCCGGTGGACCTAAGCTTACCCTTGGACTGA

XM_004866909.1 Coding sequence

Nosip nitric oxide synthase interacting protein, transcript variant X3

High confidence: 3 potential gene matches
Length: 1212 bp    Location: 4672384..4690110   Strand: +
>XM_004866909.1
ATGGTTAGGCTTCTGGCCCTGGCCCCACACTGGGAAGCAGCAACCGCTCAGCAACCAATATGCTCTGAAGGGGCTGAGTTTCATTATCCGGAACCTTCTAGCTGCAACTCACGTTTCCGGAGGGAGGAAGAAAAGAAGAAAGGACTTACCAAGCCTGGCGAGGTACTTCGGCAACTAGGGGCAGCCTTATTTCCGGTCTGTACTACTAGGCGGAAGGAGGCGGAACGGAGGGAAAGAGCAACACTCCCTTCCGGTGTAGTGGCTCAGCAGCGACGAGAGAACGAGGAGTCGTTTGTGAGGATGACTCGGCATGGCAAGAACTGCACAGCGGGGGCGGTGTACACCTATCACGAGAAGAAGAAGGACACAGCGGCCTCAGGCTATGGGACCCAGAACATCCGACTGAGCCGCGATGCAGTGAAGGACTTCGACTGCTGCTGCCTGTCTTTGCAGCCCTGCCATGACCCTGTTGTCACCCCAGATGGCTACCTGTATGAGCGTGAGGCTATCCTGGAGTACATTCTGCACCAGAAGAGGGAGATTGCCCGGCAGATGAAGGCCTACGAGAAGCAGCGCGGCGCGCGGCGTGAGGAGCAGAAGCAGCTGCATCGGGCGGCGGCGCAGGACCAGGTGCGAGGCTTCCTGGAGAAGGAGGCGGCCATCGTGAGCCGCCCACTCAACCCTTTCGAGGCCAAGGTGGCCGAGGGCCCCGGCTCAGATGACGCGAAGCCCGGGCCCAGCGCGGGGGCTCCAGGCAAGGCGAAGGAGAAGGACAAGGAGCTGCCCAGCTTCTGGATCCCGTCACTGACTCCCGAGGCCAAGGCCACCAAGCTGGAGAAGCCGTCGCGCACCGTCGCCTGCCCCATGTCCGGGAAGCCGTTGCGCATGGCGGACCTGACGCCCGTGCGCTTCACGCTGCTCGACGACTCCGTGGACCGCGTGGGGCTCATCACGCGCAGCGAGCGCTACGTGTGCGCCGTGACCCGCGACAGTCTCAGCAACGCCACACCGTGCGCCGTGCTGAGGCCCTCCGGGGCCGTGGTCACCCTCGAATGTGTGGAGAAGCTGATTCGCAAGGACATGGTGGACCCGGTGAACGGGGACAAGCTCACGGAGCGTGACATCATCGTGCTGCAGCGCGGTGGCACCGGCTTCGCAGGCTCCGGGGTGAAGCTGCAGGCCGAGAAGTCGAGGCCAGTGATGCAGGCCTGA

XM_004867131.1 Coding sequence

Dmpk dystrophia myotonica-protein kinase, transcript variant X4

High confidence: 4 potential gene matches
Length: 2040 bp    Location: 7419567..7429572   Strand: +
>XM_004867131.1
ATGTCAGCCGAGGTACGGCTGAGGCGGCTCCAGCAGCTGGCGCTGGACCCCAGCTTCCTGGGGCTGGAGCCCCTGCTCGACCTTCTCCTGGGCGTCCACCAGGAGCTGGGTGCCTCCGACCTGGCCCAGGACAAGTACGTGGCCAACTTCTTACAGTGGGCGGAGCCCATTGTGGCCAGGCTTAAGGAGATCCGACTGCAGAGGGATGACTTTGAGATTCTGAAAGTAATTGGACGCGGGGCGTTCAGCGAGGTAGCGGTGGTGAAGATGAAGCAGACGGGCCAGGTGTACGCCATGAAGATCATGAATAAGTGGGACATGCTGAAGAGAGGCGAGGTGTCGTGCTTCCGCGAAGAGAGGGACGTGTTGGTGAACGGCGACCGCCGTTGGATCACGCAGCTGCACTTCGCCTTCCAGGACGAGAACTACCTGTACCTGGTCATGGAATACTACGTGGGCGGGGACCTGCTAACGCTGCTGAGCAAGTTTGGGGAGCGGATCCCGGCCGAGATGGCGCGCTTCTACCTGGCCGAGATTGTCATGGCCATAGACTCAGTGCACCGGCTGGGCTATGTGCACAGGGACATCAAACCAGATAACATCCTGCTGGACCGCTGCGGCCACATCCGCCTGGCGGACTTTGGCTCCTGCCTAAAGCTGCGGGAGGATGGAACGGTGCGGTCGTTGGTGGCTGTGGGCACCCCGGACTACTTGTCTCCTGAGATCCTGCAGGCTGTGGGCGGCGGACCTGGGACAGGCAGCTACGGGCCAGAGTGTGACTGGTGGGCGCTGGGTGTGTTCGCCTACGAAATGTTCTATGGTCAGACGCCCTTCTACGCGGACTCCACGGCTGAGACCTACGGCAAAATCGTGCACTACAAGGAGCACCTGTCTTTGCCGCTTGCAGACATGGGGGTCCCCGAGGAGGCTCGGGACCTCATCCAGGGGCTGCTGTGTCCCCCGGAAATTCGGTTGGGCCGGGATGGAGCGGAGGATTTCCGGAAGCATCCTTTCTTCTTTGGCCTAGACTGGGAAGGTCTTCGTGACAGCGTGCCCCCTTTCACACCGGACTTCGAGGGTGCCACCGACACATGCAACTTCGATGTGGTGGAGGATGGGCTCACTGCCATGGTGAGCGGGGGCGGGGAGACACTGTCGGACATGCAGGAAGGCATACCACTGGGGGTGCACCTGCCTTTTGTGGGCTTCTCCTACTCCTGCTTGGCCCTCAGGGACAATGAGGTCCCAGACCCCACACCCATGGAACTGGAGGCCCAGCAGTTGCCTGAGCCACATGTGCAAGTGCCCAGTGTGGAGCCCACAGTGTACCCACCAGAAGAAACAGCTGAAGTGCCAGATCCACCAGCTGTCCCTGCAGCAGAGGAGACAGCGGCAGGGGAGGAGGTGACACTGCGGGAGCTCCAGGAAGCCCTGGAGGAGGAGGTTCGCACCAGGCAGAGCCTGAGCCGGGAGCTGGAGGCCATCCGCACCACCAACCAGAGCTTCGCCAGTCAGCTACTCGAGGCTGAAGCCCGGAACCGAGACCTAGAGGCGCATGTTCGGCAGCTACAGGAGCGGATGGAGCTGCTGCAGGCCCCGGGAGCCGCAGGCGAGTCCCCCGCCACCCTGCTCCCCCGGGTGCAGAGCCTGTGTGCGACACCGTGGGAGGGCAGGGGCCCAGGCTGGGGCACGCCGCACCACCGCCCTCCTCCGCCCCTCCACGCGCCATCTGCCTCTCTTCTCCTTCCAGCTGTCACGGGGGTCCCCAGTCCCCGGGCCACGGATGCACTTTCCCATCTAGATGGCCCCCCGGCCGTGGCTCTGGGCCAGTGCCCGCTGGTGGGGCCAGGCCCCATGCTCCGCCGCCACCTGCTGCTCCCTGCCAGGGTCCCTAGGCCTGGCCTATCCGAGGCGTGTAGCCTGCTCCTGTTCGCCGCTGTTCTGGTTTGTGCCACCGCCCTGGGCTGCTTTGGGTTGGTGGCCCACGCGGGCCATCTCACCCCAGCCTGGCGTTGCCCGGGAGCAGCCTTCGCCCCCTGA

XM_004866915.1 Coding sequence

Fcgrt Fc fragment of IgG, receptor, transporter, alpha, transcript variant X1

Length: 1305 bp    Location: 4718994..4710212   Strand: -
>XM_004866915.1
ATGTGTGAGAGGAACTGGGGTCTCCAGTCACGAGAGCCAGGGCTGCAGGCCGGAAGGACTCGCTGGACGCTGGACAGAGGGGTGAGGGAGGCGGCCGGGCCCGGACCCTGGGGTCCGAGGAAGGAGATGGGTGGACAGAACTCCACGAAGCGAATTTCGGCCTGTCCAGGTCGCCCTCTCAGCATGGGGGAGCCCCGGCCGCAGCCCTGGGCGCTCAGTCTCCTGCTCCTGCTCCTGTTCCTGCCTCAGACCTCGGGCGCAGAGAACCATCTGTGCCTCCTGTACCACCTCACAGCTGTGTCGTCCCCTGCCTCAGGGTCACCTGCCTTCTGGGTGTCAGGCTGGCTGGGGCCACAGCAGTACCTGAGCTACAGCAGCCTGCGCAAGGAGGCCGAGCCCTGCGGGGCCTGGGTCTGGGAAAAACAGGTGTCCTGGTACTGGGAGGAGGAGACGACAGACCTGAGAAACAAGGAGAGGCTCTTCCTGGACGCTCTCAAAGCCCTGGAGGAAAAAGCCACCCCAGGTCCCTACACCCTGCAGGGCCTGCTGGGCTGTGAGCTGAGCTCTGACAACACTTCGGTGCCCACTGCCCTGTTCGCCCTGAACGGCGAGGACCTCATGCAGTTCCACCCCAGGAACGGCACCTGGACGGGTGACTGGCCCGAGGCCCTGGCCATCAGCACAAAGTGGCAGCAGCAGGCCGAGGCCGTGGACAAGGAGAGGACCTTCCTGCTCAGCTCCTGCCCGCAGCGGCTGCTGGGCCACCTGGAGCGGGGTCACAGGAACCTGGAGTGGAAGGAGCCGCCTTCCATGCGCCTGAAGGCCCGGCCTGACATCAATGGCTTCTCCGTGCTCACCTGCAGCGCCTTTTCCTTCTACCCCCCGGAGCTGCAGCTGCGCTTCCTGCGCAACGGGCTGGCAGCCGGCACCGGGGTGGGTGGCTTCGGCCCCAACGGCGATGGCTCCTTCCACGCGTGGTCATCGCTCCAGGTGCAGCGCGGGGATGAGCACCACTACCGCTGCCTGGTGCAGCACGCTGGGCTGCAGAAGCCGCTCTTAGTGGAGCTGGAGTCGCCGGCAGAGTCCTCCGTGCCGGTGGTGGTGGGCCTTGTCATGGGCTTCCTGGTGCTCGCAGCGGCGGCCGTGGGAGGAGCCCTGCTGTGGCGGAGGACGCGGAGCGGGCTGCCAGGTGAGGCAGGCGGTGAGCCTCAGCGCACACGCAGCTGGGGTCAGAGGCTTGGAGAAAGGGACCGGGGGAGGTGGGACCAGAGCGGAGCGGAGTGGGAGACAGAGGCCCAGAGGTAG

XM_004866952.1 Coding sequence

Trpm4 transient receptor potential cation channel, subfamily M, member 4, transcript variant X2

High confidence: 4 potential gene matches
Length: 4143 bp    Location: 4937835..4902335   Strand: -
>XM_004866952.1
ATGACTGCCCTTGATCTCTGGGTCACCCACCTTTGTCACTTGCTTTTCTCAGGGTCCCTCTCCCCCTTCCACAGGATTCTGTGCCCTTCTCATCCTGGGTTGTGTCCCCTCTCTGAGTGTCTGTCCCCAGGCTTTGTCTCTCTGTCTCTTTCTAGTCAGTGGACCCTCACCCCTTCAGCATCTGTGTCCCCTCCTACCCTCACTCAGTGGGCCCCGCCCCACCCCGCCCCATTTCTGCCCCCTCTCTCTGGGTCTGTCTTCCCTCTGATTCTGTACTCCACCAAATCTCTCTCTTCAGTCCATGTGTCCCCTCCCTTTCTGAGTCTCTGTCCCTGGCCCCCTGAATCACCCTCCGTGCCCCCACCCCATCCTCGGCCTCCGCGCCCACTCTGTCACTTTATCCGAGCCCGGCGGCGCTCTCTCCGCCTCCCGCTGACGTCTCGGGGACTCCCCGCCCCGCCGCCTGGGAAGTGGCGGATCCGGTTTGGTTCAGGGCGGGGCTGGCGGGGCTGCTGGGCTGCCTGCGGGGAGCCCGATGCCAGCATGGTGGCCCCCGAGAAGGAGCAGAGCTGGATCCCCAAGATCTTCAGGAAGAAGATTTGCACCACGTTCATAGCTGACCTCTCGGATCCCGGAGGGACCTTGTGCCAGTGTGGGCGCCCCTGGAGTGCCCACACCTCGGTGGCCGTGGAGGATGCATTTGGTGCGGCCGTGGTGACTGTGTGGGATAGTGATGTGCACACCACGGAGAAGCCCACCGATGCCTACGGGGACCTGGAATTCCTGGGCGCCGGCCGCAGGCCCAGCAATTTCCTCCGGCTGTCTGACCGCACGGATCCAGCAACCATTTATAGTCTGGTCACCCGCACATGGGGTTTCCGAGCCCCAAACCTTGTGGTGTCGGTCCTGGGGGGTTCGGGGGGCTCCGTCCTCCAGACCTGGCTGCAGGACCTGCTACGACGTGGGCTGGTGCGGGCAGCCCAGAGCACAGGGGCCTGGATTGTCACCGGGGGGCTGCACACTGGCATCGGCAGGCATGTGGGTGTGGCAGTGCGGGACCACCAGATGGCTAGCACCGGGGGCAGCAAGGTGGTGGCCATGGGTGTTGCGCCCTGGGGTGTGGTCTGGAACAGAGACACCCTCACCAACGCCAAGGGCTCGTTCCCTGCGAAGTACCGGTGGTGGCGCGGTGACCCGGAGGACGGGGTCGAGTTCCCCCTGGACTACAACTACTCGGCCTTCTTCCTGGTGGACGACGGCAGGCACGGCCGCCTGGGCGGCGAGGACCGATTCCGCCTGCGCTTCGAGTCCTATGTGGCGCAGCAGAAGACGGGCGTGGGCGGGACCGGAATTGACATCCCCGTCCTCCTCCTGCTGATCGGTGGGGATGAGAAGATGTTGAAGCGGGTAGAGGACGCCACCCAGGCACAGCTCCCCTGCCTCCTGGTGGCCGGCTCTGGGGGTGCTGCTGATTGCCTGGCCGAGATCCTGGAAGACTCTCTGGCCCCAGGGAGTGGGGGCACCAGGCGAGGTGAAGCCCAAGACTGGATCAGGCGTTTCTTCCCCAAAGGGGACCCCGGGGTCCTGCAGGCCCAGGTGGAGAGGATCATGACCCGGAAGGAGCTGCTGACCGTCTATTCATCGGAGGATGGCGCGGAGGAATTCGAGACCATCGTTTTGAAGGCCCTCGTGAAAGCCTGTAGGAGCTCTGAGGCCTCAGCCTACCTGGACGAGCTGCGTTTGGCTGTGGCTTGGAACCGCGTGGACATCGCTCAGAGTGAACTCTTCCGGGGGGACATCCAGTGGCGGTCCTTCCACTTGGAGGCGTCGCTCATGGACGCTCTGCTGAACGACCGACCCGAGTTCGTGCGCCTGCTCATCTCCCACGGCCTCAGCCTGGGCCACTTCCTGACGCCCGCGCGCCTGACCCAGCTCTACGGTGCAGCGCCCGCGCACTCGCTCATCCGCGCGCTTCTGGACCAGGCGGCCCACGGGGCGGCCACCAAAGCCCCGGGGCCCAAAGGGGACGCTGAGGAGCTCCGGCCGCCTCAGGTGGGGCAAGTGCTGAGGACGCTGCTGGGGGAGACGTGCGCGCCGAGGTACCCAGCCGTGAAAGCCCGGGACCCCCACACCGGCAAGGGCTGCTGCGAGACCGTTTTTCTGCTCTCTGATTGGGCCGCCTCGGAACCGGCTCTGGAAGCCAGCTTGGGGCAGGCTCCCTGGAGCGACTTCTTCCTCTGGGCACTGCTGCTCAACAGAGCCCAGATGGCCATGTACTTCTGGGAGATGGGCTCTAACGCTGTGTCCTCTGCTCTTGGGGCCTGTTTGCTCCTCCGAGTGATGGCCCGCCTGGAAGCTGAGGCGGAGGAGGCGGCCCGGCGGAAAGAGCTGGCCGCCAAGTTTGAGAGCATGGGTGTAGACCTCTTTGGAGAGTGCTACCGAAGCAGCGAGGAAAGGGCCTCCCGACTACTTCTCCGTCGCTGCCCGCTCTGGGGCGATGCTACCTGTCTCCAGCTTGCCATGCAGGCTGACGCTCGAGCCTTCTTTGCCCAGGATGGGGTCCAGTCGCTGCTGACACAGAAATGGTGGGGGGAGATGGACAGCACCACACCCACCTGGGCCCTGGTTCTCGCCTTCTTCTGTCCCCCACTGATCTGCACCAACCTCATCACCTTCAGGAAACCAGAAGAGGAGTGCACGCAGCATCAGAAGAACCCTGACGTTGACACGGACAGGGACATTAAGGGAGAGGGTCCCAATGGACCCAGCCACTCCTTGGTGAAGGTGCAGCCGCTAGGCCTTCGGGGCCGCTGGTCGTGCTTCTGGGGGTCGCCGGTGACAGCCTTCATGGGCAACGTGGTCAGCTACCTGCTCTTCCTGCTGCTCTTCGCGCGCGTGCTGCTCCTCGACTTCCAGCCAGGGGCACCGCGGCCCTGGGAGCTGCTGCTGTACTTCTGGGCCTTCACTCTGCTGTGTGAGGAGCTTCGCCAGGGCCTGAGCGGAGGCTGGGGGAGTCTGGTCAGCGGGGGACCCCGGCCCGGGCACATCGCGCTGCGCCACCGCCTGCAGCTCTATGTGGCCGACGCCTGGAACCAGTGCGACCTGCTGGCCCTCACCTGCTTCCTGTTGGGCGTGGGCTGCCGGCTGACCCCGGGTCTCTATGACCTGGGCCACACTGTGCTGTGCCTCGACTTCATGATCTTCACGCTGCGGTTGCTGCACATCTTTACAGTGAACAAGCAGCTGGGGCCCAAGATCGTCATCGTGAGCAAGATGATGAAGGATGTCTTCTTCTTCCTCTTCTTCCTGGGCGTCTGGCTGGTCGCCTATGGCGTGGCCACTGAGGGGCTGCTAAGGCCCCGCGACCGTGACCTCCTCAGTATCCTGCGTCGTGTCTTCTACCGGCCCTACCTGCAGATCTTTGGGCAGATCCCCCAGGAGGACATGGACGTGGCCCTCATGACGCCTATGAACTGCTCGTCTGAGGAGGGTGCCTGGGCTCAGCCTCCGGGGCCCCAGGCAGGCTCCTGCGTCTCGCTTTACGCCAACTGGCTGGTGGTGCTGCTCCTCATTGTCTTCCTGCTCGTGGCCAACATCCTGCTGCTCAATTTGCTCATCGCCATGTTCAGCTACACGTTTGGCAAAGTACAGGGCAACAGCGACCTCTATTGGAAGGCACAACGCTACAGCCTCATCCGGGAATTCCACTCTCGGCCTGCACTGGCCCCGCCCCTCATCGTGGTCTCCCACGTTCGACTCCTCATCAGGCGCCTTCGCAGATGCAGCTGGTCCAACAAGCCTACCTTTCCCGCCTTCCAGCACTTCCGTGTCCACCTCTCCAAGGAAGCCGAGCGGAAGCTACTGACATGGGAGTCCGTGCACAAGGAGAGCTTCCTGCTGGCCCGCGAGCGGGATAAGCGGGACAGTGACTCTGAGCGGCTGAAGCGCACGTCTCAGAAGGTGGATATGGTGTTGAAGCAGCTGGGACAGATCCGGGAGTATGATAGGCGCCTGAAAGGACTGGAGCAGGAGGTCCAGCACTGTAGCCGTGTCCTGGACTGGGTGGCCGAGGCCCTGAGCCGCTCTGCCATGCTGCCACCGGGCGGACCACCGCCCCCTTCCCGGCCTGGGTCGAAAGACTGA

XM_004866956.1 Coding sequence

Ppfia3 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3, transcript variant X2

High confidence: 4 potential gene matches
Length: 3579 bp    Location: 4959132..4942540   Strand: -
>XM_004866956.1
ATGATGTGCGAGGTGATGCCCACCATCAGCGAGGATGGCCGGCGGGGCTCGGCCCTGGGCCCGGACGAGGCGGGTGGCGAGCTGGAGCGCCTCATGGTCACCATGCTCACGGAGCGCGAGCGCCTGCTCGAGACGCTGCGCGAGGCGCAGGACGGGCTGGCGACGGCGCAGCTGCGGCTGCGCGAGCTGGGCCACGAAAAGGACTCGCTGCAGCGCCAGCTCAGCATCGCGCTGCCCCAGGAGTTTGCAGCTCTGACCAAGGAGTTGAATTTATGTCGGGAGCAGCTGCTGGAGAGGGAGGAAGAGATTGCGGAGCTGAAGGCGGAGCGGAACAACACACGGCTCCTCCTGGAACATCTAGAGTGCCTGGTGTCCAGGCACGAGAGGTCACTGCGCATGACCGTGGTGAAGCGCCAGGCCCAGTCACCGGGCGGGGTCTCCTCCGAGGTGGAGGTGCTCAAGGCGCTCAAGTCTCTCTTCGAGCACCACAAGGCCCTGGATGAGAAGGTCCGGGAGCGGCTGCGCATGGCGCTGGAGCGAGTCGCGGTGCTGGAGGAGGAGCTGGAGCTGAGCAATCAGGAGACTCTGAGCCTTCGAGAGCAGCTGTCTAGGCGGAGGTCTGGGCTGGAAGAGCCGGGAAAGGATGGAGATGGGCAGACCCTTGCCAATGGCCTGGGTCCAGATTCTAGCCGGCGCACTGCAGAGCTGGAGGAGGCCCTGGAGCGGCAGCGTGCAGAGGTGTGCCAGCTGCGGGAGCGCCTGGCCGTGCTGTGCCGTCAGATGAGCCAGCTGGAGGAGGAGCTGGGCACCGCTCACCGTGAGCTGGGCAAGGCCGAGGAGGCCAACTCCAAGCTCCAGCGTGACCTCAAGGAGGCGCTGGCTCAGCGGGAGGACATGGAGGAGCGGATCACCACGCTGGAGAAGCGCTACCTGAGCGCCCAGCGTGAGGCTACATCTCTGCATGACGCCAATGACAAGCTGGAGAACGAGCTGGCCAGCAAGGAGTCGCTGTACCGGCAGAGTGAAGAGAAGAGTCGGCAGCTGGCCGAGTGGCTGGACGACGCCAAGCAGAAGCTGCAGCAGACGCTGCAGAAGGCTGAGACCCTGCCCGAGATAGAGGCGCAGCTGGCCCAGCGAGTGGCCGCGCTCAACAAGGCTGAGGAACGTCATGGGAATTTTGAGGAGCGGCTTCGGCAGCTGGAAGCCCAGTTGGAGGAGAAGAACCAGGAGCTGCAGCGGGCGAGGCAGCGGGAAAAGATGAACGACGACCACAATAAGCGGCTGTCGGAGACAGTTGACAAGCTGCTGAGCGAGTCCAACGAGCGGCTGCAATTACACCTCAAGGAGCGCATGGGGGCGCTGGAGGAGAAGAACTCGCTGAGTGAGGAGATTGCCAACATGAAGAAGCTGCAGGATGAGTTGCTGCTGAACAAGGAGCAGCTCTTGGCTGAGATGGAGCGGATGCAGATGGAAATCGACCAGCTTCGGGGGAGGCCACCTTCCTCCTACTCCAGGTCTCTCCCTGGCAGTGCCCTGGAGCTCCGTTACTCTCAGGCACCCACGTTACCTTCTGGTGCCCCCTTGGACCCATATGGGGCTGGCAGTGGCCGGGCAGGCAAGAGGGGCCGCTGGTCAGGGGTCAAAGATGAGCCCTCCAAGGACTGGGAACGATCTACACCTGCTGGGTCCATGCCACCCCCATTCCCTGGGGAACTGGATGGTTCAGATGAGGAGGAGGCCGAAGGGATGTTTGGTGCAGAGCTACTGTCACCCAGTGGGCAGGCTGATGTGCAGACGCTGGCCATCATGCTCCAGGAGCAGCTGGAGGCCATCAACAAGGAGATCAAGTTAATCCAAGAAGAGAAGGAGACAACAGAACAGAGAGCCGAGGAGCTGGAGAGCCGAGTGTCCAGCTCTGGCCTGGACTCCCTGGGCCGCTACCGCAGCAGCTGCTCCCTGCCCCCCTCCCTCACCACCTCCACCCTCGCCAGCCCCTCCCCCCCCAGCTCTGGCCATTCCACACCTCGTCTGGCACCACCCAGCCCTGCCCGAGAGGGCACCGACAAGGCCAATCACGTCCCCAGGGAGGAGGTTTGTGCTCCACGAGGGGAGGGCCCAGCCATTCCAGGAGACACTCCACCGCCCACTCCTCGCTCTGCCCGTCTTGAGAGAATGACCCAGGCCTTAGCACTGCAGGCAGGGTCCTTGGAGGATGGGGGACCCTCGAGGGGAAGTGAGGGTACCCCAGATTCCTTGCACAAAGCCCCCAAAAAGAAGAGCATCAAGTCATCCATAGGCCGCCTCTTTGGCAAGAAAGAGAAGGGGCGGATGGGACCCCCAGGCCGGGACAGCTCTTCCCTGGCTGGAACCCCCTCGGAGGAGACACTGGCTGCCGATCCTCTGGGGCTGGCCAAGCTGACAGGCCCAGGAGACAAGGACCGGAGGAACAAGCGGAAGCACGAGCTCCTGGAAGAGGCCTGTCGCCAGGGCCTGCCTTTCGCTGCTTGGGACGGGCCCACCGTGGTCTCCTGGCTGGAGCTGTGGGTAGGCATGCCCGCGTGGTATGTGGCCGCCTGCCGGGCCAACGTCAAGAGCGGTGCCATCATGGCCAACTTGTCGGACACGGAGATCCAGCGCGAGATCGGCATCAGCAACCCGCTGCACCGGCTCAAGCTGCGCCTCGCCATCCAGGAGATGGTCTCGCTCACCTCCCCTTCGGCGCCCGCCTCCTCCCGCACGCCCACAGGAAACGTGTGGATGACACACGAGGAGATGGAGTCCCTGACGGCCGCAACGAAGCCCGAGACCAAGGAGATCAGCTGGGAGCAGATCCTGGCATATGGAGACATGAACCACGAGTGGGTGGGAAACGACTGGCTGCCCAGCCTGGGGCTGCCCCAGTACCGCAGCTACTTCATGGAGTCGCTGGTGGATGCCCGAATGTTAGATCACCTTAACAAGAAGGAACTCCGGGGCCAGCTCAAGATGGTGGACAGCTTCCACAGGGTGAGTCTACATTATGGGATTATGTGCCTAAAACGGCTGAACTATGACCGAAAGGACCTGGAGCGGAGAAGGGAAGAGAGCCAGACCCAGATCCGAGACGTCATGGTGTGGTCCAACGAGCGAGTCATGGGTTGGGTGTCCGGGCTGGGCCTGAAGGAATTCGCCACGAATCTCACGGAAAGCGGGGTGCATGGGGCTCTGCTCGCCCTGGACGAGACCTTCGACTACTCCGACCTGGCCTTGCTCCTGCAGATCCCCACGCAGAACGCGCAGGCCCGGCAACTCCTAGAGAAGGAATTCAGCAACCTCATCTCCTTAGGCACAGACAGGCGGCTGGACGAGGACAGCGCCAAGTCCTTCAGCCGCTCCCCATCCTGGCGGAAGATGTTCCGAGAGAAGGACCTCCGAGGCGTAACCCCCGACTCGGCTGAGATGTTGCCCCCCAACTTTCGTTCGGCTGCAGCAGGAGCCCTGGGCTCACCAGGGCTCCCTCTCCGAAAGCTGCAGCCTGAAGGCCAGACTTCTGGGAGCTCCCGGGCAGACGGCGTTTCGGTCCGGACCTACTCCTGCTAG

XM_004866960.1 Coding sequence

Snrnp70 small nuclear ribonucleoprotein 70kDa (U1)

High confidence: 4 potential gene matches
Length: 1371 bp    Location: 4988691..4973251   Strand: -
>XM_004866960.1
ATGACCCAGTTCCTGCCGCCCAACCTTCTAGCTCTCTTTGCCCCCCGTGACCCTATCCCATACCTACCACCGCTGGAGAAACTGCCACATGAAAAGCACCACAATCAACCTTACTGTGGCATTGCGCCATACATCCGAGAGTTTGAGGACCCTCGAGATGCCCCTCCTCCAACTCGTGCTGAAACCCGGGAGGAGCGCATGGAGAGGAAGAGACGAGAAAAGATTGAGAGGCGACAGCAGGAAGTGGAGACAGAGCTAAAAATGTGGGATCCACACAATGATCCCAATGCTCAGGGCGATGCCTTCAAGACTCTCTTTGTGGCCAGAGTGAACTATGACACAACAGAATCCAAGCTTCGGAGAGAGTTTGAAGTGTATGGACCCATCAAAAGAATACACATGGTCTACAGCAAGCGCTCGGGAAAGCCCCGTGGCTACGCCTTCATCGAGTACGAGCATGAGCGGGACATGCACTCCGCTTACAAACATGCAGATGGCAAGAAGATTGATGGCAGGAGAGTCCTTGTGGATGTGGAGAGGGGCCGGACTGTGAAGGGCTGGAGGCCTCGGCGGCTGGGAGGTGGCCTCGGTGGTACCAGAAGAGGTGGGGCCGATGTGAACATCCGGCATTCAGGCCGTGATGATACATCCCGCTATGATGAGAGGCCTGGCCCCTCCCCGCTTCCACACAGGGACCGGGACCGGGACCGCGAGCGGGAGCGTAGAGAGCGGAGCCGAGAGAGAGACAAGGAGCGGGAACGACGACGCTCCCGCTCTCGGGACCGGCGGAGGCGCTCACGGAGTCGAGACAAGGATGAACGGCGTCGGTCCAGGGAGCGAAGCAAGGACAAGGACCGAGACCGGAAGCGTAGAAGCAGCCGGAGCCGGGAACGGGCACGGCGGGAGCGGGAACGAAAGGAGGAGCTTCGTGGTGGTGGTGGTGGTGGTGGTGGTGGCGGCAGTGGTGGTGGCATCGGCAGCGGCGGTGGTGGTGGTGCCGGCGACATGGCTGAGCCCTCTGAGCCTGGTGACGCACCTCCTGACGATGGGCCTCCTGGGGAGCTTGGTCCTGATGGCCCTGACGGCCCAGAGGAGAAGGGCCGGGATCGTGACAGGGAACGACGTCGGAGTCACCGGAGTGAGCGGGAGCGACGCCGGGACCGGGATCGGGACCGGGATCGAGAGCACAAGCGGGGGGAGCGGGGTGGGGAGCGGGGCAGGGATGAGGCCCGGGGTGGGGGTGGGGGTGGCCAGGACAACGGGCTGGAAGGTCTAGGCAATGACAGCCGAGACATGTACATGGAGTCTGAGGGCGGTGACGGGTACATGGCTCCAGAGAACGGCTATCTCATGGAGGCGGCGCCCGAGTGA

XM_004866967.1 Coding sequence

Gys1 glycogen synthase 1 (muscle), transcript variant X2

Length: 2205 bp    Location: 5029057..5045191   Strand: +
>XM_004866967.1
ATGCCTTTGAGCCGCACGTTGTCTGTGTCCTCACTGCCAGGCCTGGAAGAGTGGGAGGATGAGTTCGACCTGGAGAACACAGTGCTCTTCGAAGTGGCCTGGGAGGTGGCCAACAAGGTGGGGGGCATCTACACGGTGCTGCAGACCAAGGCGAAGGTGACAGGGGACGAGTGGGGCGACAACTACTACCTGGTGGGACCGTACACGGAGCAGGGCGTGAGGACCCAGGTGGAGCTGCTTGAGCCCCCGACCCCGGCCTTTAAGAAGACGCTGGACTCCATGAACAGCAAGGGCTGCAAGGTGTATTTCGGGCGCTGGCTGATTGAGGGGGGCCCGCTGGTGGTGCTCCTGGATGTAGGGGCCTCAGCCTGGGCCCTGGAACGCTGGAAAGGAGAGCTCTGGGACACCTGCAACATCGGGGTGCCCTGGTACGACCGAGAGGCCAATGATGCTGTTCTCTTTGGCTTCCTCACCACCTGGTTCCTCGGTGAGGTAGGCCTTACCGCAGACCCCCCACATGTGGTTGCCCACTTCCATGAGTGGTTGGCAGGCGTTGGGCTCTGCCTGTGCCGTGCCCGGCGGCTGCCTGTGGCAACCATCTTCACCACCCATGCCACGCTGCTGGGGCGTTACCTGTGCGCTGGTGCTGTAGACTTCTACAACAACCTGGAGAATTTCAATGTAGACAAGGAAGCAGGGGAGAGACAAATCTATCACCGCTACTGCATGGAGCGGGCAGCAGCCCACTGTGCTCATGTCTTCACCACCGTGTCCCAGATAACTGCCATTGAGGCGCAGCACCTACTCAAGAGGAAGCCAGATATTGTGACCCCCAACGGACTGAATGTGAAGAAGTTCTCTGCCATGCATGAGTTCCAGAACCTCCATGCTCAGAGCAAAGCGCGGATCCAGGAATTTGTCCGGGGCCATTTTTATGGGCACCTGGACTTCAACTTGGACAAGACTTTGTATTTCTTTATTGCTGGCCGCTACGAGTTCTCTAACAAGGGGGCGGACGTCTTCCTGGAAGCCTTGGCCCGGCTCAACTACCTGCTCAGAGTGAATGGCAGTGAACAGACGGTGGTCGCCTTCTTCATCATGCCGGCTCGGACCAACAACTTCAACGTGGAAACCCTCAAGGGCCAGGCTGTGCGCAAGCAGCTGTGGGACACGGCCAACGCGGTGAAGGAGAAGTTTGGGAGGAAGCTGTATGAATCCTTACTGGTGGGGAGTCTCCCAGACATGAATAAGATGCTGGACAAAGAGGACTTCACTATGATGAAGAGGGCCATCTTTGCCACACAGCGGCAGTCCTTCCCTCCTGTGTGCACCCACAATATGCTGGACGACTCCTCAGACCCCATCCTGACCACCATCCGCCGGATTGGCCTCTTCAATAGCAGCGCGGACAGGGTTAAGGTGATTTTTCACCCAGAGTTCCTCTCCTCTACAAGCCCCCTGCTCCCTGTGGACTATGAGGAGTTTGTGCGTGGCTGTCACCTTGGGGTCTTCCCCTCCTACTATGAGCCTTGGGGCTACACACCAGCCGAGTGTACGGTCATGGGCATCCCCAGTATCTCCACCAACCTCTCCGGCTTTGGCTGCTTCATGGAGGAGCACATCGCAGACCCCTCAGCTTACGGTATCTACATTCTGGACCGGCGGTTCCGCAGCCTGGACGATTCCTGCTCACAGCTCACCTCCTTCCTCTACAGCTTCTGCCAGCAGAGCCGCAGACAGCGCATCATCCAGCGGAACCGCACAGAGCGTCTCTCCGACCTTCTGGACTGGAAATACCTAGGCCGGTACTATATGTCTGCACGCCACATGGCCCTGGCCAAGGCCTTTCCGGATCATTTCACCTACGAGCCCCACGAAGCGGATGCAGCCCAGGGCTACCGCTACCCACGGCCGGCCTCAGTGCCGCCGTCACCCTCGTTGTCACGACACTCGAGTCCGCACCAGAGCGAGGATGAGGAGGAACCCCGGGAAGGGCCACTTGAAGATGGCGAACGATACGACGAGGACGAGGAAGCTGCCAAGGATCGGCGCAACATCCGCGCCCCCGAGTGGCCACGCCGCTCCTCCTGCACCTCTTCCACAGGCAAGCGCAGCAACTCGGTGGACACTGCGCCCTCCAGCTCGCTGAGCACGCCCAGTGAGCCCCTCAGCCCCGCCAGCTCTCTGGGGGAGGAGCGCAACTAA

XM_004867202.1 Coding sequence

Kcna7 potassium voltage-gated channel, shaker-related subfamily, member 7

High confidence: 4 potential gene matches
Length: 1818 bp    Location: 4996088..5002211   Strand: +
>XM_004867202.1
ATGGAGCAATCGACGCGAGCACAGCGCGTGCTCTGGGACAGGGAGGCGCAATCTGCTGAGCAGGACCCCAGCAGACTGGAGCTGGGAACCGGCCTGCAAGGCACGACGCCCTCTGGCAGCTCTGGCAGCTTCCGGTTCCCAGTGGTGGAAGGCAAACTCTGCGACCCATTCCCAAGAAACCCAAAGCCATGGCCCAGAGACCACAGAGGCGAGAGTGTGGCCCCACAGGAGGCCACGAGCGAGTGGAACCCACCCGAGGGCCCGGATCCCGCCCAAGCAGAGGGCGCCACCCCCGCCCGCCGGCCGGTCACCGCTCCCTCCCCCGCGCCCTCTGCGCGGCCGGGCTATTTTTATGCGCGGACACCGGACACCGGGCTGGGGCGGCGGCGGCCGAGGCGGGGCACGGCGGGCCGGGCGTCGGGGCACACGGGCGTCCGCGGGGTCCGGGCAGCTCGGGCCATGGAGCCGCCGTGCGGCTGCTGCGAGCGGCTGGTGCTCAACGTGGCGGGGCTGCGCTTCGAGACGCGGGCGCGCACGCTGGGCCGCTTCCCGGACACGCTGCTCGGGGACCCGGCGCGCCGCAGCCGCTTCTACGACGGCGCGCGCCGCGAGTATTTCTTCGACCGGCACCGGCCCAGCTTCGACGCCGTGCTCTACTACTACCAGTCGGGCGGGCGGCTGCGGCGGCCGGCGCACGTGCCTCTCGACGTCTTCCTGGAGGAGGTGGCCTTCTACGGGCTGGGCGCCGCGGCCATGGCGCGCCTGCGCGAGGACGAGGGCTGCCCGGTGCCAGCCGAGCGCCCCCTGCCCCGCCGCGCCTTCGCGCGCCAGCTCTGGCTGCTCTTCGAGTTCCCTGAGAGCTCGCAGGCCGCGCGCGTGCTGGCTGTCGTCTCCGTGCTCGTCATCCTCGTCTCCATCGTCGTCTTCTGCCTCGAGACGCTGCCTGACTTCCGCGATGACCGCGACGACCCGGGGCTCGCTGCGGTAGCCGCCGCAGGCTCGTTCCCTGCTCGGCTGAATGGTTCCAGCCTCGTGCCTGGACCGCCACCCCGTCTGCCCTTCAATGACCCGTTCTTTGTGGTGGAGACGCTGTGCATCTTCTGGTTCTCCTTCGAGCTGCTGGTGCGCCTGCTAGCCTGCCCGAGCAAAGCCATCTTCTTCAAGAATGTGATGAACCTCATCGATTTCGTGGCCATCCTGCCATACTTTGTGGCGCTGGGCACCGAGCTGGCCCGGCAGCGGGGTGTGGGTCAGCCGGCCATGTCCCTGGCCATCCTGCGGGTCATCCGTTTGGTGCGTGTCTTTCGCATCTTCAAGCTCTCCCGGCACTCGAAGGGCCTGCAGATTCTGGGCCAGACACTTCGGGCCTCCATGCGTGAGCTGGGCCTCCTCATCTTCTTCCTCTTCATTGGGGTGGTCCTCTTTTCCAGCGCAGTCTACTTTGCTGAAGTTGACTCTGTGGAGTCCCATTTCACCAGCATCCCCGAGTCCTTCTGGTGGGCTGTGGTTACCATGACCACTGTTGGGTATGGAGACATGGCACCCGTCACTGTGGGTGGCAAGATAGTGGGCTCTCTGTGTGCCATTGCCGGCGTGCTGACCATTTCCCTGCCTGTGCCTGTCATTGTCTCCAACTTCAGCTACTTTTACCACCGGGAGACAGAAGGCGAGGAGGCCGGGATGTATAGCCACGTGGACACACAACCCTGCATCAACCTGGAGGGCAAGGCCAATGGGGGGTTGGTGGATGGAGAGGTGCCTGAGCTGCCACCTCCACTCTGGGTGCCCCCTGGGAAACACCTGGTCACTGAAGTGTGA

XM_004866965.1 Coding sequence

Ruvbl2 RuvB-like 2 (E. coli), transcript variant X4

Length: 1392 bp    Location: 5028889..5014484   Strand: -
>XM_004866965.1
ATGGCAACCGTGACCGCCACAACCAAAGTCCCAGAGATCCGAGATGTGACGAGGATCGAGCGTATCGGTGCGCACTCCCACATACGGGGACTGGGGCTGGATGATGCCTTGGAGCCGCGCCAGGCTTCACAGGGAATGGTGGGTCAGCTGGCAGCCCGGCGAGCAGCTGGTGTGGTGCTGGAGATGATCCGAGAGGGGAAGATTGCTGGGCGGGCAGTCCTCATTGCAGGCCAGCCGGGCACTGGAAAGACGGCCATTGCCATGGGCATGGCACAGGCCCTGGGCCCCGACACCCCATTCACGGCCATTGCTGGCAGCGAGATCTTCTCCCTGGAGATGAGCAAGACTGAGGCGCTGACACAGGCCTTCCGCCGCTCCATTGGCGTTCGCATCAAGGAGGAGACCGAGATCATCGAAGGGGAGGTGGTGGAGATCCAGATTGATCGGCCGGCGACGGGGACGGGCTCCAAAGTGGGCAAGCTGACCCTCAAGACCACAGAGATGGAGACCATCTATGACCTGGGCACCAAGATGATCGAGTCGCTGACGAAGGACAAGGTCCAGGCCGGGGACGTGATCACCATCGACAAGGCCACGGGCAAGATCTCCAAGCTGGGCCGCTCCTTCACGCGCGCCCGCGACTACGATGCCATGGGCTCCCAGACCAAGTTCGTGCAGTGCCCGGATGGAGAGCTGCAGAAGCGCAAGGAGGTGGTGCACACCGTGTCCCTGCACGAGATTGACGTCATCAACTCCCGCACCCAGGGCTTCCTGGCCCTCTTCTCAGGTGACACAGGGGAGATCAAGTCAGAAGTCCGAGAGCAGATCAACGCCAAGGTTGCAGAGTGGCGCGAGGAGGGCAAGGCGGAGATTATCCCAGGGGTGCTTTTCATCGACGAGGTCCACATGCTGGACATTGAGAGCTTCTCTTTCCTCAACCGGGCCCTAGAGAGTGACATGGCACCCGTCCTCATCATGGCCACCAACCGGGGCATCACACGGATCCGGGGCACCAGCTACCAGAGCCCTCACGGCATCCCCATCGACCTGCTGGACCGGCTGCTCATTGTCTCCACCTCGCCGTACAGCGAGAAGGACACCAAGCAGATCCTCCGTATCCGGTGCGAGGAGGAGGATGTGGAGATGAGTGAGGACGCCTACACCGTGCTCACTCGCATCGGGCTGGAGACGTCCCTGCGCTACGCCATTCAGCTCATCACGGCAGCCAGCCTCGTGTGCCGGAAACGCAAGGGCACGGAGGTGCAGGTGGATGACATCAAACGGGTCTACTCGCTCTTCCTGGATGAATCCCGCTCCACGCAGTACATGAAGGAGTACCAGGACGCCTTCCTCTTCAACGAGCTCAAAGGTGAAACCATGGACACCTCATGA

XM_004866975.1 Coding sequence

Nucb1 nucleobindin 1, transcript variant X1

Length: 1440 bp    Location: 5085490..5073022   Strand: -
>XM_004866975.1
ATGCTGGGATCGCGAGCTCGGGACTATCCACCGCCTGCCTCGCCTCCCACCAAGTGCGCCATGCCGCCCTCCGCGCCCCGCCGAGCCCTCGTCGTCTTGCTGTCGCCCCTCCTGTGGCTGCCGGCCGTGCTGCCCGTGCCCATCGAGCGGGCCGCTGCCAACCAGGAGCCGAGCCCCGCTACCGAGAGCCCGGACACGGGCCTGTACTACCACCGGTACCTCCAGGAAGTCATCAATGTGCTGGAGACGGACGGGCACTTCCGAGAGAAGCTGCAGGCCGCCAATGCTGAGGACATCAAGAGTGGGAAGCTGAGCCGAGAGCTGGACTTCGTCAGCCACCATGTCCGCACCAAGCTGGATGAGCTCAAGCGGCAGGAGGTGTCGCGGCTGCGGATGCTGCTCAAGGCCAAGATGGACGCCAAACAGGAGCCCAATGTTCAGGTGGATCACCTGAGTCTCCTGAAGCAGTTTGAACACCTGGACCCTCAGAACCAACACACGTTTGAGGCCCGAGACCTAGAACTGCTGATCCAGACAGCCACCCGGGACCTTGCCCAGTACGATGCGGCCCATCATGAAGAGTTCAAACGCTACGAGATGCTCAAGGAACACGAGAGACGCCAATATCTGGAGTCCCTGGGAGAGGAGCAGCGGAAAGAGGCAGAACGGAAGCTGGAAGAGCAACAGCGCCGGCACCGGGAACACCCCAAAGTCAATGTGCCAGGCAGCCAAGCACAGTTGAAGGAGGTGTGGGAGGAACTGGACGGATTGGACCCCAACAGGTTTAACCCCAAGACCTTCTTCATCTTGCATGATATCAACAGCGATGGGGTCCTGGATGAGCAGGAGCTAGAGGCCCTCTTCACCAAGGAGCTGGAGAAGGTGTATGATCCAAAGAATGAGGAGGATGACATGCGGGAGATGGAGGAGGAGCGGCTGCGCATGCGGGAGCATGTGATGAAGAACGTGGACACCAACCAGGACCGCCTTGTGACCCTAGAGGAGTTCCTCGCATCCACCCAGAGGAAGGAGTTTGGGGACACCGGAGAGGGATGGGAGACTGTGGAAATGCACCCTGCTTACACGGAGGAGGAGCTGAGGCGCTTCGAGGAGGAGCTGGCTGCCCGAGAGGCTGAGCTGAATGCCCAGGCCCAGCGCCTCAGCCAGGAGACCGAGGCCCTCGGGCGGTCACAGGACCAGCTTATAGCCCAGAGGCGAGAGCTGCAGCAGGCCGTTCTGCAAATGGAGCAGAGGAAGCAGCAGCAGCAAGACCAAAACCCACCCCCTGCCAACCCCCAGGGACAGCTCAAGTTCCACCCAGACACAGATGATGCTCCTGTCCCAGCTCCAGCCAGTGACCAGAAGGATGTGCAAGCTTCTGAAAAGAAAGCTCCCGAGCAGTCCCCAGAAGTGCCCCAGCTGGATTCCAAGCACCTCTGA

XM_004866976.1 Coding sequence

Nucb1 nucleobindin 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1440 bp    Location: 5085478..5073022   Strand: -
>XM_004866976.1
ATGCTGGGATCGCGAGCTCGGGACTATCCACCGCCTGCCTCGCCTCCCACCAAGTGCGCCATGCCGCCCTCCGCGCCCCGCCGAGCCCTCGTCGTCTTGCTGTCGCCCCTCCTGTGGCTGCCGGCCGTGCTGCCCGTGCCCATCGAGCGGGCCGCTGCCAACCAGGAGCCGAGCCCCGCTACCGAGAGCCCGGACACGGGCCTGTACTACCACCGGTACCTCCAGGAAGTCATCAATGTGCTGGAGACGGACGGGCACTTCCGAGAGAAGCTGCAGGCCGCCAATGCTGAGGACATCAAGAGTGGGAAGCTGAGCCGAGAGCTGGACTTCGTCAGCCACCATGTCCGCACCAAGCTGGATGAGCTCAAGCGGCAGGAGGTGTCGCGGCTGCGGATGCTGCTCAAGGCCAAGATGGACGCCAAACAGGAGCCCAATGTTCAGGTGGATCACCTGAGTCTCCTGAAGCAGTTTGAACACCTGGACCCTCAGAACCAACACACGTTTGAGGCCCGAGACCTAGAACTGCTGATCCAGACAGCCACCCGGGACCTTGCCCAGTACGATGCGGCCCATCATGAAGAGTTCAAACGCTACGAGATGCTCAAGGAACACGAGAGACGCCAATATCTGGAGTCCCTGGGAGAGGAGCAGCGGAAAGAGGCAGAACGGAAGCTGGAAGAGCAACAGCGCCGGCACCGGGAACACCCCAAAGTCAATGTGCCAGGCAGCCAAGCACAGTTGAAGGAGGTGTGGGAGGAACTGGACGGATTGGACCCCAACAGGTTTAACCCCAAGACCTTCTTCATCTTGCATGATATCAACAGCGATGGGGTCCTGGATGAGCAGGAGCTAGAGGCCCTCTTCACCAAGGAGCTGGAGAAGGTGTATGATCCAAAGAATGAGGAGGATGACATGCGGGAGATGGAGGAGGAGCGGCTGCGCATGCGGGAGCATGTGATGAAGAACGTGGACACCAACCAGGACCGCCTTGTGACCCTAGAGGAGTTCCTCGCATCCACCCAGAGGAAGGAGTTTGGGGACACCGGAGAGGGATGGGAGACTGTGGAAATGCACCCTGCTTACACGGAGGAGGAGCTGAGGCGCTTCGAGGAGGAGCTGGCTGCCCGAGAGGCTGAGCTGAATGCCCAGGCCCAGCGCCTCAGCCAGGAGACCGAGGCCCTCGGGCGGTCACAGGACCAGCTTATAGCCCAGAGGCGAGAGCTGCAGCAGGCCGTTCTGCAAATGGAGCAGAGGAAGCAGCAGCAGCAAGACCAAAACCCACCCCCTGCCAACCCCCAGGGACAGCTCAAGTTCCACCCAGACACAGATGATGCTCCTGTCCCAGCTCCAGCCAGTGACCAGAAGGATGTGCAAGCTTCTGAAAAGAAAGCTCCCGAGCAGTCCCCAGAAGTGCCCCAGCTGGATTCCAAGCACCTCTGA

XM_004866977.1 Coding sequence

Ppp1r15a protein phosphatase 1, regulatory subunit 15A

High confidence: 4 potential gene matches
Length: 1833 bp    Location: 5107749..5104390   Strand: -
>XM_004866977.1
ATGGCCCCAGGCCAAGTGCCTCATCACACCGGGCCCTGGCGGGATGCCCACTCCTTGTACCTACTGTCCCCGCTGATGGGTTTCCTGAGCTGGGCCTGGAGCCTCCTGAGGGGCCCAGGACCCCAACAGTCCTGGCTGCTTGAAGACAGAATAGGAGCAGATGAGATAGAAGCTGGAGTGGAGGGAGACAGCAGAGCCCCTGAGGAGGGGGATGGAGAGGCAGCAACAGGGCCCAGCCTCGACCTGAAAGCCAGCAGTTCTGCTCCTGAAGCCTGGGGACCTTCCTGTGGTGAGGATGTAGAGTACATCGAGGAAGAAGCAGACAGGCAGCCACCAAGGGAACTCACACACGGCCAGCCTGCACCCCTGTCCCCCAGCCTGCTGCTAAGTGCCCTGCAAGGTCCTGATAAGAGCCCCGAAGAGGAGCAGGCTGAAGGAAGGGAAGCTGCCGAAGAGGAGAGAGAGTCCAAGTCGTCTTATCTTTCATCACACTGCCAGGGTGGTCCCTGTAGGGAGGAGGAGGACAGGGAAGCTGTCAACAAAGAAGCTGGTGCCACCTCTGCTTCCTCTTTGGCCCCAGGACTCAAGCCCAGCACTTGGCTGTGTTGCCCAGGGGAGGAAGAGAGGCGAGCCACGGAGGACAAAGAAACAGAAAATAAAGAAGCTGGGGAGACCCCCATCTCTCCCTGGAGGTTGGGCTCCTGCCCCTTGGCCTGGCAGACTTGCTCAGGAGGAGCAGCTGAGAAAGACTCACAGGCCAGAGAAGCAGCTGAAAAAGGAGAAGCTGACCCAGAGCCATGGCCCTCAGTTCCCACCCAGGGGCTTCTGCTTGGGACCTGTGAGGATCAACCCAGAGAGAACACAGAGGAAGAGGAGGAGGAGGAAGATGAGGACTGGGATTCCAGATGGGCTGAGGAAGAGAGAGAATCAGAGGATTCTCCTACCCCTACCACAAATGCCTTTCTGAGAGCCTGGGTGTATCGGCCAGGAGAGGACACAGAGGAAGAGGAGGAGGAGGAAGATGGGGACAGAAATTCAGGTTCAGCAGAAGAGGGAGAAGCTGAGGCTTCCTCCTCCACCGGCCCCTTCCTGAGGGCCTGGGTGTACCGGCCTGGAGAGGACACAGAGGGGGAAGATGAGTGGGAGGAGAACCAGGACACAGGTGATTCAGGAGCAGCTGAGGAAGACGGAGAGGCTGACTGGGGCCCGCGCTCCTCCCTTCAGCTCCGGGGGGGCCCGGGGAGGGCCCGGACAGCCCCACCTGGAGGGGGGACAAGGGAAGAGCACGCTGCTGAGGCCTGGGCTGGAGCTGAGCCCCGCCCCCTCGCGGTGGCCATCTATGTCCCTGGACAGAAGCCCCCGGCTCCCTGGGCTGCTCCTAAGCTGCCCCTCCGACTGCAGAGGAGGCTCAGGTTGTCAGAGACCCTCACCCAGGATCGGGACCCTGAAACTCCCCAAAAGGATAGAAAGGTGCGCTTCTCTGAGAAGGTCATCGTGCATCTCCTGGCTGTATGGGCTGGGCCCGCCCAGGCCGCCCGCCGAGGCCCCTGGGAGCAGCTCGCCCGAGATCGCAGCCGCTTCGCCCGGCGCATCGCCAGGGCCCAAGAGGAGCTGGGCCCCTGCCTCACCCCTGCTGCGCGGGCCCAAGCCTGGGCTCGCCTGGGGAACTCACCCGGGTCCCTGGTCCCCACACCTGCCCCTCCACAGACCCCGCCTCCCTCCCCCGGCCCAGTCCCGGCCCCGCCCTTGATCCAAGCCCTGGCCTCATCCTGTCCCTCTGCTCCAGCTCAGGCCCCGCCTCCCTGCCTGGAGCTCAGTGGGAGGCGTGGTTAA

XM_004866980.1 Coding sequence

Hsd17b14 hydroxysteroid (17-beta) dehydrogenase 14, transcript variant X2

High confidence: 4 potential gene matches
Length: 825 bp    Location: 5125781..5134516   Strand: +
>XM_004866980.1
ATGGCATCGGGAACTCGCTATGCAGGGAAGGTGGTGATCGTGACAGGGGGCGGGCGCGGCATCGGAGCGGGAATCGTCCGAGCCTTTGCTGACAGTGGGGCACATGTGGTCATCTGTGACAAGGATGAGTCCAGCGCCCGAGTCCTGGAGCAGCAGCTCCCCGGCGCCATCTTTATCCGCTCTGATGTGACTCAAGAGGAGGATCTTCGGACCCTGATTGCTGAGACCATCCGCCGATTTGGTCACCTGGATTGTGTGGTTAACAATGCCGGCTACCATCCACCTGCAGAGAGGCTAGAGGACACCTCTGCCCAGGACTTTCGGCAGCTGCTGGAGCTGAACCTGCTGAGCATCTACACCCTGACCAAGCTCGCCCTCCCCCACCTGCGGAAGGTCCAGGGCAACATCATCAACATCTCCAGCTTGACTGGGGCCATTGGCCAGTCCCAGGCAGTGCTCTACTCTGCCACCAAGGGGGCAGTCACAGCCATGACCAAAGCCTTGGCCTTGGACGAGTGCAAATATGGCGTCCGAGTCAACTGTATCGCCCCAGGGAACATCTGGACCCCGCTGTGGGAGATGGTGGCAGCCTCCTCGCCAGACCCCGAGGCCGAGATCCGGGAGGGGGTGCTGGCTCAGCCGATGGGCCGCATGGGCAAGCCCGCTGAGGTGGGCGCCGCAGCTGTGTTCCTGGCCTCCGAAGCCACCTTCTGCACAGGCACGGAGTTCCGCATGACGGGAGGCGCAGAGCTGGGCTACGGGTGTAAAGCCAGTCGGGACACCCCTCTGGAGATCCCCACGCTCCCTCCTGATTTCCCTCACTAG

XM_004921189.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 1632 bp    Location: 5166730..5169845   Strand: +
>XM_004921189.1
ATGCGCTCCAGGTCTGGCTTGTCTGGGACAGTGGATTCCCACAGCACAGCGGCTCAGCGCGCCGCAGCGCGCGGGGTCCCCCCACCTCGGGGACCAGACGCGGGCCCTGCGCAGCGGCCGGACGTGGCCAGGCGGAGCGCATACCGCGGGCCTCGCGTGGATGCAGCTGCCGCCCGCGGGGGGCCTGTGGGTGCCACAGCCGTGGGAGGGGCCGGGCCGGGGCGGAGGGTGGGGCCCCCACCAGAATCAGCCGTGGAGGGGCGAGTGCCGCCCTATCCCCGGGCCGCGGAAGGGGCTCCAGATAAGGGCGGGCCCTTTCCTGCTAACTGCCCCGCGCGGGGGCAGAGGCTGTGCCTCTGCTCGTCCTCGCTTCCCGCCCCGGGACTCGCTGCCAGTCCGGGTGCCGGCGTGAAGGCCAGGGCTGCGGGCCTGGGGGACCCCGGCGTCCGGGAGGTGGGTGGATGTGGCCTGCGCTCTCTGCCCGCGCTCCTGGGCCTCGCGAAGCAGGCTCGGGAAGTGCCGCCGCCCTCCAGGCGCTCAGGTGAGTGCCCTGCGGATGCTGGAGGCCGCGACCCGGGCACCGGGCCCTGCGCCCTCTGCTCCAGTCTCATTTCCTCTTTGGCAGCCGAATGGGCCCCCAGCCCCCACCAGCTCTGCCTAGGCTTCCTCTTCATCTGCGTCCTCTCAGGGACATCTTTCTTTCTCTACCTCTATGACATGTTCCAAAATGGCCTTGGCCTATCTGTCCTGTGTCCGGACCACCACCTGCAGGCATCCCCAGTGGCCCTCTTATGCTTGCCGGGCACACCGCTGGGCTCCAACGCCTCTTCCTGTCCCCAGCACCCTGCCTCTCTCTTGGGAATCTGGACAATCCACCCAGACAGCCGCTTTGGTAGCCAGACGGGACAGCATACTCAGTGGCAGGAGCTGCAGCTGCACATCTGGATGTCCGAGGAGTATTCCCGCTTGAAGGACCCCTTTGTGAAGCTCTCTGGCTTCCCCTGCTCTTGGACTTTCTTCCACCATCTCCGGGAACAGATCCGAAGTGAGTTCACCCTTCACAACCACCTTCAGGAGGAGGCCCAGGGATTCCTGAGGGCGCTCCGCCTGGGCTATGTGGGGTCCNCGCCACGCACTTTTGTGGGGGTCCACATTCGCTGTGGGGACTATGTGCAGGTGATGCCCCAGCACTGCAAGGGTGTGACAGGTGACCGAGCTTACCTCCAGCAGGCCATGGACTGGTTCCGGGCCCGGCATGAGGACTCCATCTTTGTGGTCACCAGCAATGGCATGAAGTGGTGCAGGGAAAATATTGATACCTCCAGAGGCGATGTGGTCTTTGCGGGTGATGGGCAGGAAGGCACACTGGCGAAGNGATTCGCCCTGCTCACTCAGTGCAACCACACCATCATTACCATTGGCACCTTTGGCTTCTGGGCTGCTTACCTGGCTGGTGGTGACATCATCTACCTGGCCAACTTCACCCTGCCGGACTCTGACTTCCTGAATCTCTTCAAGCCTGAAGCTGCCTTCCCGCCGGAGTGGGTGGGCATCATTGCTGACCTGTCTCCACTCCAGGCACCCAACATGTGGATTGGGCCTTGGAAGGAACTAGGGAGACTTTACATATAG

XM_004866985.1 Coding sequence

Mamstr MEF2 activating motif and SAP domain containing transcriptional regulator

Length: 1209 bp    Location: 5190976..5196665   Strand: +
>XM_004866985.1
ATGACCCTGGCGGCTTCCTCTCAGCGCTCCCAAATCATCCGATCCAAGTTCCGATCTGTCCTCCAGCTTCGGATCCACAGACGGAATCAGGACCCAACCTCAGATCTGGATCCGTGGATCTCAGCCCCAGGCCTAGCTCTGGCCCCAGCCTTACCCTCTGCCCCAGCCCCTTTCCTCTTCGGCCCTGGGGTCCTGCTCCCTGATCCAGAGCGTTGCCCATGGCAACACCCACAGCAGGAGTCGCCCAAGGTCTCCCCCCACTGGAGAGCGCCCAAGCCCCAAGCAACCTTGACCTACCACCAGTACAGGCCCCCAGAGCAGGGCTACAGAGCCAGGGGAGAGCCAAGGGGGCCACCTCCATGGGGTGGGACGAGCTCACGGCAGCCATCTCCTAGGATGAAGCCCACACCCCTCACTCCCTCCCCACCAGGAGTCTCCAGCCCCTCGCCTTCTCCACACAGGTTGGAACTTCAGACCCTTAAGCTGGAAGAGCTGACGGTCTCAGAACTCCGGCAGCAGCTCCGCCTGAAGGGCCTCCCGGTATCAGGGACCAAGTCAATGCTCTTGGAGCGCATGCGCAGCGGCGCCCCACCCCGCGAGCTGCAGAAGCAGCGGCGCGAAGGAAACGCAGCCGACACTCCCTGGCCGCGTCTCAGACCCAAAGCCCTGGGAACCTCCCGGCGGCAGAGAGGGGTCAAAGCAAATCCCGCGCCTCCCAGGCCACCTCTTCCACATTCTGGGGATGCCGTGGTAACAGCCCCAGCTCCTGTTCCGACTCAGCCTCTGGCTCCAGTCCTGACACCTTCCTCAGCACCGGCCCCAGCGGATCTGACTTTGGAGGAGGAGCTGCAGGAAGCGATCCGGAGGGCACAGCTGCTTCCGAGCCGGGGTATCAATGACATCCTGGAGGATCAGGTGGATCCTGATGACCTGCTGCCCCCCATCCCCCTGGACTTCCCCAGCTCCTTCGACGTCCTGTCCCCCTCCCCGGACTCCGAAGGCCTCTCTGTTTTCTCCTCTTCGCTCCAGTCCCTGGTGAACTCCCCTTCCTCCTCTCCTGGGGCTCCTACAGAGGCCTTGGACTGGCTGGAGGCCCTGAGTGGGGGTCCTCCGCTGGGTTCTGGCCCCCCAGGCCCCAGCATCTTCTCTGTTGACTTATCTGAGTTTGGTGGTGCCCAGCTGTGGGACCTGCTGGAGGACCCGTGGTGA

XM_004867205.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1020 bp    Location: 5212797..5210795   Strand: -
>XM_004867205.1
ATGAAACCGCAGATAAGTGGGGAGTCAGCCATCAAGGAACTCAGGGTCACCTTCTGCTTCCTTTGTGTCATCTTCGTGGTGTCCACCGTCTTCCACTGCCATCAGCGCCTGGCTCTGGTGCCCACCCCCTGGGCCTCCTCGGCGCGCGTCCTGCTGGTCCCCAGTCCCCGGCACCTTCCGAGAGAGGGCGTGTTCACCGTCACCGCCATCGGCCGCCTGGGGAACCAGATGGGCCAGTACGCCACGCTGTACGCCCTGGCCAAGATGAACGGCCGGCCCGCCTACATCCCCGCGCGCATGCACAGCACGCTGGCCCCACTCTTCCGCATCAGCCTCCCCGTCCTGCACGGCGACAGGGGCCTCGCAGTTCCGTGGCAGAACTACCACCTGGACGACTGGATGCAGGAGCGCTACCGCCACATCCGCGGCCGCTACGTGCGCCTCACCGGCTACCCCTGCTCCTGGACCTTCTACCACCACCTGCGGCCCGAGATCCTGCGCGAGTTCAGCCTGCACGAGCACGTGCGCCGCCAGGCCCAGGCCTTCCTGCAGGGGCTGCGCGTGGGGGGCGCCCGGCCTCGCACCTTCGTGGGGGTGCACGTGCGGCGCGGCGACTACGTCCGCGTCATGCCCCGCGTGTGGAAGGGCGTGGTGGCCGACCGCGGGTACCTGGAGCAGGCCCTGGACTGGTTCCGGGCTCGCTACCCCGCCCCTGTCTTCGTGGTCACCAGCAACGGCATGGCCTGGTGCCGGGAGAACATCAACGCCTCCCGCGGGGACGTGGTGTTCGCGGGCGACGGCGTGGAGGGCTCGCCTGGCAGGGACTTCGCGCTGCTCACGCAGTGCAACCACACGGTCATGACCATCGGGACCTTCGGGATCTGGGCTGCCTACCTCGCGGGTGGGGACACCGTCTACCTGGCTAACTACACCCTGCCCGACTCTCCCTTCCTCAGAGTCTTCAAGCCCGAGGCGGCCTTCCTGCCGGAGTGGGTGGGCATCCCCGCAGCCTTTGGGTAG

XM_004866998.1 Coding sequence

Dbp D site of albumin promoter (albumin D-box) binding protein, transcript variant X2

High confidence: 4 potential gene matches
Length: 978 bp    Location: 5240365..5245992   Strand: +
>XM_004866998.1
ATGGCGCGGCCTCTGAGCGACAGGACTCCGGCTCCCCTGCTGCTGGGCAGCCCTGCCGGGGCCCCGCCTGGCGGGGGAGCGCTGCTCGGGCTGCGGAGCCTCCTGCAAGGGACCAGCAAGCCCAGAGAGCCGGCCAGCTGTCTCCTGAAGGAAAAGGAGCGCAAGGCGGCTCCGCCCGCACCCACGGTCCCGGGGCCGGGCCTGGAGACGCCGGGCCCGGCAGATGCCCCCGCTGGGGCGGTGGGAGGCAGCGGGTCCCCTCGGGGACGCCTGGGCGCCGTGCCTGGCCCGAGTCTGTTGGCGCCGCTGCTGTGGGAGCGTACGCTGCCTTTCGGCGACGTGGAGTACGTGGACCTGGACGCCTTCCTGCTGGAGCACGGGCTCCCACCCAGCCCGCCGCCCCCGGGCGGCTCGTCGCCTGCGCCCTCGCCCACGCGCACGCCTGCGCCCTCGCCCGGGCCCGGCTCCTGCGGCTCGGCCTCCCCGCGCTCCTCGCCCGGGCACGCCCCCGCCCGGCCCGCCCTGGGGGCCGCCGGCGGCCACCGCGCAGGCCTGACCCCTCGGGACACACCCAGTCCTGTGGACCCAGACACAGTGGAGGTGCTGATGACCTTTGAACCCGACCCAGCTGATCTTGCCCTGTCAAGCATTCCAGGCCATGAGACCTTTGACCCTCGGAGACACCGCTTCTCAGAGGAGGAACTTAAGCCCCAGCCAATCATGAAGAAGGCGAGGAAAATCCAGGTGCCAGAGGAGCAGAAGGACGAGAAGTATTGGAGCCGGCGGTACAAGAACAATGAAGCAGCCAAGCGGTCTCGCGATGCCCGGAGGCTCAAGGAGAACCAGATAACGGTGCGGGCGGCCTTCCTGGAAAAGGAGAATGCCCTGCTGCGGCAGGAGGTGGTGGCGGTGCGGCAGGAGCTGTCTCACTACCGGGCCGTGTTGTCTCGCTACCAGGCCCAGCATGGGGCCCTGTGA

XM_004866997.1 Coding sequence

Dbp D site of albumin promoter (albumin D-box) binding protein, transcript variant X1

Length: 978 bp    Location: 5240481..5245992   Strand: +
>XM_004866997.1
ATGGCGCGGCCTCTGAGCGACAGGACTCCGGCTCCCCTGCTGCTGGGCAGCCCTGCCGGGGCCCCGCCTGGCGGGGGAGCGCTGCTCGGGCTGCGGAGCCTCCTGCAAGGGACCAGCAAGCCCAGAGAGCCGGCCAGCTGTCTCCTGAAGGAAAAGGAGCGCAAGGCGGCTCCGCCCGCACCCACGGTCCCGGGGCCGGGCCTGGAGACGCCGGGCCCGGCAGATGCCCCCGCTGGGGCGGTGGGAGGCAGCGGGTCCCCTCGGGGACGCCTGGGCGCCGTGCCTGGCCCGAGTCTGTTGGCGCCGCTGCTGTGGGAGCGTACGCTGCCTTTCGGCGACGTGGAGTACGTGGACCTGGACGCCTTCCTGCTGGAGCACGGGCTCCCACCCAGCCCGCCGCCCCCGGGCGGCTCGTCGCCTGCGCCCTCGCCCACGCGCACGCCTGCGCCCTCGCCCGGGCCCGGCTCCTGCGGCTCGGCCTCCCCGCGCTCCTCGCCCGGGCACGCCCCCGCCCGGCCCGCCCTGGGGGCCGCCGGCGGCCACCGCGCAGGCCTGACCCCTCGGGACACACCCAGTCCTGTGGACCCAGACACAGTGGAGGTGCTGATGACCTTTGAACCCGACCCAGCTGATCTTGCCCTGTCAAGCATTCCAGGCCATGAGACCTTTGACCCTCGGAGACACCGCTTCTCAGAGGAGGAACTTAAGCCCCAGCCAATCATGAAGAAGGCGAGGAAAATCCAGGTGCCAGAGGAGCAGAAGGACGAGAAGTATTGGAGCCGGCGGTACAAGAACAATGAAGCAGCCAAGCGGTCTCGCGATGCCCGGAGGCTCAAGGAGAACCAGATAACGGTGCGGGCGGCCTTCCTGGAAAAGGAGAATGCCCTGCTGCGGCAGGAGGTGGTGGCGGTGCGGCAGGAGCTGTCTCACTACCGGGCCGTGTTGTCTCGCTACCAGGCCCAGCATGGGGCCCTGTGA

XM_004866996.1 Coding sequence

Sphk2 sphingosine kinase 2, transcript variant X7

Length: 1491 bp    Location: 5251457..5246328   Strand: -
>XM_004866996.1
ATGAGTCTGCTCCGAGGATTGCCCCTGCCTGGGGAAGGGGAGATCAGCCCTGAGCTCCTGCCACGGCCACCCCGGTTGCTACTCTTGGTCAATCCCTTTGGGGGACGGGGCCAGGCCTGGCAGTGGTGTGAAAACCATGTGCTGCCCATGATTTCCGAAGCTGGGCTGTCCTTCAACCTCATTCAGACAGAGAGACATAACCATGCCCGAGAGCTGGTCCAGGGGCTGAGCCTGAGTGAGTGGGATGGCATCGTCACCCTCTCAGGAGACGGGCTGTTCTGTGAGGTGCTGAACGGACTCCTGGATCGCCCAGACTGGGAGCAGGCAGTGAAGATGCCCCTGGGGATTCTCCCCTGTGGCTCGGGCAACGCACTGGCTGGAGCCGTGAACAGGCATGGGGGGTTTGCACCAGCGCTGGGCCTGGACCTGCTGCTCAACTGCTCCCTGCTGCTCTGCCGTGGTGGCAGCCATCCACTGGACCTGCTCTCTGTGACGCTGGCCTCAGGCTCCCGCTGTTTCTCCTTCCTGTCTGTGGCCTGGGGCTTTGTGTCAGATGTGGACATCCAGAGTGAGCGCTTCAGAGCCCTAGGCAGAGCCCGATTCACCCTGGGCACAGTGCTGGGCCTTGCCACATTGCGCACCTACCATGGACGCCTCTCCTACCTCCCTGCTGCTGTGGAGTCAGCCTCACCTGGTCCTGCCAACGGCCTGCCCCGGGCCAAGTCAGAGCTGGCCCTGGCCCCAGCTCCAGCCCCGCCCACAGACCACTCCCCTTTGCATCGCTCAGTGTCTGACCTGCCCCTGCCCTTGCCTCAGCCTGCCTTGACCTCCCCTGGCTCACCTGATCCCTTACCTGTGCTGTCCTTCAACGGTGGGGCCCCAGAGCTGGCTGGGGACTGGGGTGGCACTGGGGAAGCTCCACTGTCCCCAGACCCACTCCTGCCCTCGCCCTCTGGCTCCCCCAAGGCAGCTCCACTCTCTCCCATCACAGAAGGGCCCCCAGAAATGCCTGCAGCCTCTGGGTTTCCACCCCACACCACCGCTGCACCAGTAGCCTCTGCCGGGGGCCCACAGGACCACTTGTTACCTCCATTGGGCACCCCGCTGCCCCCAGGCTGGGTGACAGTGGAGGGAGACTTTGTGCTGGTGTTGGCGCTCTCTCCCAGCCACCTGGGTGCCGATCTGCTGGCGGTTCCCCACGCAAGCTTTGACGACGGCGTGGTACACCTGCTGTGGGTGAGGGCAGGAATCTCGAGGGCCATGCTGCTGCGCCTATTCCTGGCCATGGAGCGGGGGAGCCATTTCAATTTGGGCTGCCCGCATGTCGGCTATGCCCCGGCCCGTGCGTTCCGCCTGGAGCCACTCACGCCCCGAGGCATGCTCACAGTGGACGGGGAGCTGGTGGAGTATGGGCCGCTGCAAGGGCAGATACACCCAGGCCTCGGTACGCTGCTCACAGGGCCTCCTGGCCACACCGGGCAGGGACCCTGA

XM_004867000.1 Coding sequence

Fam83e family with sequence similarity 83, member E

High confidence: 4 potential gene matches
Length: 1458 bp    Location: 5259058..5267268   Strand: +
>XM_004867000.1
ATGGCGGCCTCCCAGCTGGCAGCACTGGAGGAAGCGGAGGCGGGGCCCGGGCTGCCGCTGACTGAGGCCAGCCCTGCCTTCCTGTATTCCGAGGGCCAACGGCTGGCCATCGAGGTGCTGCTGAGTGAGGGCGGGGATGCCTTCCAGGCCCGAGTGCGGCAGGAGGGGCTGCGGCCCTTCCTGAGCAAGGATGAGGTCCAAACCTTGGCAACGGCTGCTGAGGACTGGACAGAAGCCAGGCAGGAGTCTGGTGGGGCTGCAGAAGGAGCTGCCACCACCACCGCCAACCCGGCCACAGGCAGCCTGACCTACTGGCCTGGGGAGTCGGAGGAGCCAGTGCCCCTGCTGCGGCTAGGCTGGCCAGAGGACACCGCCTGGAAGGGCATCACCCGGGCACAGCTGTACACCCAGCCCCCCAGCGAGGGCCAGCCGCCCCTCAAGGAGCTGGTGCGCCGAGAAATCCAGGCTGCCCACAAGCTGGTGGCCGTGGTCATGGACGTCTTCACTGACCCAGACCTGCTTCTGGACCTGGTGGACGCGGCCACACGCCGCTGGATCCCTGTGTACCTACTCCTGGACCACCAGCGGCTGCCTGCTTTCCTGGCGCTGGCTGGGCAGCTGCGGGTGAACCCCTGGGCCACTGAGAACCTGGACATCCGCGTCGTGCGGGGCTGCACTTTCCGGAGTCGCTGGCGACGGCAGGTGAGCGGCGACGTTCGGGAGAAGTTTGTGCTGCTGGACGGAGACAGGGTCATCTCAGGGTCCTACAGCTTCACGTGGAGTGACGCTCGCCTGCACCGCGGCCTGCTCACCCTGCTGACCGGAGAAATCGCCGATGCCTTCAGCCACGAGTTCCGCACGCTCTACGCAGCCTCCGGGCCTCTCCCGCCCCCGCCGGCCGCAGACGCCCTGTTCCGCATTTCCGGGGACCCATCGCCCGCCCGCAGCCCGCACAGAGTGCTCCAGCGCTGCCCAGTCGCCCCGGTGTCACCCCTGCTGCCCGACAGCACCCTGGCCCACCGCCTGGCTGCCTGCTGCCTGCTGGAGGGGGACCCGAGGGAGGCCCCTGCACCCGCCCTCAGCGACGTCCTGCGCAGTGTGCAGGGGTCCCGGACAGCCAGCGGCCCCCCAGCCCGGCCCAGCCGCTCCCTGTGGGACCTGAGCCGCCTGTCTCAGCTGTCGGGCTCCAGCGACGGGGATGGTGAGCTCAAGTCCTGGGGCTCCAAGGACACCCCTGCCAAGGCCCTGATGAGACAGCGGGGCGCTGGGGATGCCCGGCCCCTCGCCCGGTGCCAGCCCTGGGGTAGCCCCCTGCCCCTGATCCCCGCCCGCCACCTCCGCTACCTGTCCCCGACCCGCAGAAGGTTTGGTGACAATGCTCCATCCAAGCTGGCGGAGCTCAGAGGCATCCAGCAGCCAGACTGGGCCTCTCGCTCAGGCCGAGGGGGGCGCCCCTGA

XM_004867001.1 Coding sequence

Sult2b1 sulfotransferase family, cytosolic, 2B, member 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1008 bp    Location: 5290860..5268001   Strand: -
>XM_004867001.1
ATGGATGGGCCCGGAGCCCCGGTGATGTGGGACAAGTTGGCGCATGTCTCGGAGATGAGCACGGATTTCCCGGGCGAATACTTCAGGTACAAGGGCGTCCTCTTCCCCGTCGGCCTCTACTCACCCGAGAGCGTCAGCCTGGTCGAGAACACCCAGGATGTGCTGGACGACGACATCTTCATCGTCACCTACCCCAAGTCAGGCACCTCCTGGATGATTGAGATCCTCAGCCTAATCCTGAAGGACGGGGATCCCTCCTGGATCCACTCGGTGCCCATCTGGGAGCGCTCGCCCTGGTGCGAGACAGTCGTAGGCGCCTTCACCCTCCCGGACCAGCCCAGGCCGCGCCTCCTGAGCTCCCACCTCCCCGTGCACATCTTCCCCAAGGCCGCTTTCGACACCAAGGCCAAGGTCATCTACGTGGGCCGGAATCCCCGCGACATCCTGGTGTCCTTCTACCATTACTCCAAGATTGCCCGGCAGCTGAAGGACCCCGGCACGCCTGACCAGTTCCTGCAAGACTTCCTCAAAGGCGAAGTGCAGTTTGGCTCCTGGTTCGACCACATTAAGGGCTGGATCCGGATGCAGGGCAAAGAGAACTTCCTGTTCCTCACCTACGAGGAACTCCAGCAGGACCTCCACGGCTCCGTGCAGCGCATCTGCGAGTTCCTGGGCCGGCCGCTGGCCGAGGAGGCGCTGGGCTCCGTGGTGGCCCACTCGACCTTCGGCGCCATGAAGGCCAACACCATGTCCAACTACACGCTGCTGCCCCCCACCCTGCTGGACCACCGCCTCGGGGCCTTCCTGCGCAAAGGGATCAGTGGCGACTGGAAGAACCACTTCACAGTGGCACAGAGCGAGGCCTTCGACCGTGTCTACCGAGAGCAGATGCGGGGGATGCCGGCCTTCCCTTGGGACAAGGACCTGGGGGACAACGGCCTGGACCCTGAGCCTGAGCCCGAGACCACCCCTGGCTCCAGCAAGGACTCCCAATCCCCCCACCAGTGA

XM_004867002.1 Coding sequence

Sult2b1 sulfotransferase family, cytosolic, 2B, member 1, transcript variant X2

Length: 843 bp    Location: 5273479..5268001   Strand: -
>XM_004867002.1
ATGGGAATGCAAAGTGACGCAGCCACTACGGGGAACAGCACCTCCTGGATGATTGAGATCCTCAGCCTAATCCTGAAGGACGGGGATCCCTCCTGGATCCACTCGGTGCCCATCTGGGAGCGCTCGCCCTGGTGCGAGACAGTCGTAGGCGCCTTCACCCTCCCGGACCAGCCCAGGCCGCGCCTCCTGAGCTCCCACCTCCCCGTGCACATCTTCCCCAAGGCCGCTTTCGACACCAAGGCCAAGGTCATCTACGTGGGCCGGAATCCCCGCGACATCCTGGTGTCCTTCTACCATTACTCCAAGATTGCCCGGCAGCTGAAGGACCCCGGCACGCCTGACCAGTTCCTGCAAGACTTCCTCAAAGGCGAAGTGCAGTTTGGCTCCTGGTTCGACCACATTAAGGGCTGGATCCGGATGCAGGGCAAAGAGAACTTCCTGTTCCTCACCTACGAGGAACTCCAGCAGGACCTCCACGGCTCCGTGCAGCGCATCTGCGAGTTCCTGGGCCGGCCGCTGGCCGAGGAGGCGCTGGGCTCCGTGGTGGCCCACTCGACCTTCGGCGCCATGAAGGCCAACACCATGTCCAACTACACGCTGCTGCCCCCCACCCTGCTGGACCACCGCCTCGGGGCCTTCCTGCGCAAAGGGATCAGTGGCGACTGGAAGAACCACTTCACAGTGGCACAGAGCGAGGCCTTCGACCGTGTCTACCGAGAGCAGATGCGGGGGATGCCGGCCTTCCCTTGGGACAAGGACCTGGGGGACAACGGCCTGGACCCTGAGCCTGAGCCCGAGACCACCCCTGGCTCCAGCAAGGACTCCCAATCCCCCCACCAGTGA

XM_004867004.1 Coding sequence

Lmtk3 lemur tyrosine kinase 3, transcript variant X2

Length: 3999 bp    Location: 5314143..5327150   Strand: +
>XM_004867004.1
ATGTGTGTGTTGTGTGCCCTTGCATGTATGATGTGCCTGTCTGCACACCTGCATGTGACATGTGTCTGTGTGTCTATGCTGAGATGTCCCTATACCTATGTGATGGGCACCCGCCACCACCTCCACCTCCCTTCCATCCTCGACAAGATGCCTGCCCCAGGCGCCCTCATCCTCCTCGCGGCCGTCTCCGCCTCCGGCTGCCTGGCGTCTCCGGCCCATCCCGATGGATTCGCCTTAGGCCGGGCCCCTCTGGCCCCTCCCTACGCTGTGGTCCTCATTTCCTGCTCTGGCCTATTGGCCTTCATCTTCCTCCTCCTCACCTGTCTGTGCTGCAAAAGGGGTGATGTCGGTTTCAAGGAGTTTGAGAACCCTGAAGGGGAGGACTGCTCCGGGGAGTACACGCCCCCTGCGGAGGAGACCTCCTCCTCACAGTCGCTGCCGGATGTCTACATCCTCCCGCTGGCTGAGGTCTCCCTGCCAATGCCTGCCCCGCAGCCTTCACACTCAGACATGACCACCCCCCTGGGCCTTAGCCGACAGCACCTCAGCTACCTGCAAGAGATCGGGAGTGGCTGGTTTGGGAAGGTGATCCTGGGAGAGATCTTCTCCGACTACACCCCGGCCCAGGTGGTGGTGAAGGAGCTCCGGGCCAGTGCCGGGCCACTGGAGCAGCGGAAGTTCATCTCGGAAGCCCAGCCTTACAGGAGCCTGCAGCACCCCAACGTCCTCCAGTGCCTGGGCCTGTGTGTGGAGACGCTGCCTTTCCTGCTGATTATGGAGTTCTGCCAGCTGGGGGACCTGAAGCGGTACCTCCGGGCCCAGCGGCCCCCCGAGGGCCTGTCCCCCGAACTGCCCCCGCGCGACCTGCGGACACTGCAGAGGATGGGCCTGGAGATCGCCCGGGGCCTGGCGCACCTGCACTCGCACAATTACGTGCACAGTGACCTGGCCCTGCGTAACTGCCTGCTGACTTCTGACCTCACGGTGCGCATCGGAGACTATGGGCTGGCGCACAGCAACTATAAGGAGGATTACTACCTGACCCCCGAGCGCCTGTGGATCCCGCTGCGCTGGGCAGCGCCCGAGCTCCTCGGGGAGCTGCACGGCACCTTCATGGTGGTGGACCAGAGCCGCGAGAGCAACATCTGGTCTTTGGGGGTGACCCTGTGGGAGCTGTTTGAGTTTGGGGCACAGCCCTACCGCCACTTGTCAGATGAGGAGGTCCTTGCCTTTGTTGTCCGACAGCAGCACGTCAAGCTGGCCCGGCCAAGGCTCAAGCTGCCCTACGGGGACTACTGGTATGACATCCTGCAGTCCTGCTGGCGGCCCCCGGCCCAGCGCCCCTCGGCCTCCGACCTCCAACTGCAGCTCACCTACCTGCTCTCGGAGCGGCCCCCCAGACCCCCACCCCCGCCGCCCCCACCCCGAGATGGTCCCTTCCCCTGGCCCTGGCCTCCATCACACAGTGCGCCACGCCCGGGGACCCTCTCCTCTCCATTCCCCCTTCTGGATGGCTTCCCCGGGGCGGACCCAGATGATGTGCTCACAGTCACCGAGAGCAGCCGTGGCCTCAACCTGGAGTGCCTCTGGGAGAAGGCCCGGCGTGGGGCCGGCCGGGGTGGGGGGGCACCTGCCTGGCAGCCAGCATCGGCGCCCCCAGCCCCCCACGCCAACCCCTCCAACCCTTTCTACGAGGCGCTGTCCACGCCCAGCGTGCTGCCGGTCATCAGCGCCCGCAGCCCCTCGGTCAGCAGCGAGTACTACATCCGCCTCGAGGAGCATGGCTCTCCGCCCGAGCCCCTCTTCCCCAACGACTGGGACCCCCTGGACCCAGGCCTGCCTGCTGCTCAAGCCCCCCAGGCCCCCTCCGAGGTCCCTCAGCTGGTGTCCGAGACCTGGGCCTCCCCCCTCTTCCCTGCGCCCCGGCCCTTCCCAGCCCAGTCCTCAGCATCTGGCAGCTTCCTGCTGAGCGGCTGGGACCCCGAGGGCCGGGGCGCTGGGGAGACCCTGGCAGGAGACCCCGCCGAGGTTCTGGGGGAGCGGGGTACTGCTCCGTGGGCCGAAGAAGAGGAGGAGGAAGAGGGCAGCTCCCCAGGGGAGGACAGCAGCAGCCTCGGGGTAGGGCCCAGCCACCGGGGGCCCCTGCCCTGTCCCCTGTGCAGCCGAGAGGGGCCCTGCTCCTGCCTGCCACTGGAGCGGGGGGACGCTGTGGCCGGCTGGGGGGGCCACCCTGCCCTTGGCTGTCCCCACCCCCCAGAGGACGACTCATCCCTGCGGGCAGAGCGGGGCTCCCTGGCCGACTTGCCCTTGGCCCCCCCCGCATCAGCTCCCCCCGAGTTTCTGGACCCCCTCATGGGGGCCGCAGCACCCCAGTACCCCGGGCGGGGACCACCTCCCGCTCCTCCGCCCCCACCGCCACCTCCCCGGGCATCCGCAGAACCAGCCGTGACTCCCGACCCCCCATCGGCCGTGGCCAGTCCAGGCTCAGGCCTGTCGTCTCCGGGCCCCAAGCCGGGGGACAGCGGCTACGAGACCGAGACCCCTTTTTCCCCCGAGGGAGCCTTCCCAGGTGGGGAGGCAGCCGAGGAGGAAGGGGTCCCTCGGCCTCGGGCTCCCCCCGAGCCACCCGACCCAGGAGCGCCCCGGCCACCCCCAGACCCGGGTCCCCTCCTACTCCCAGGGACCCGGGAGAAGCCAACCTTCGTAGTTCAAGTGAGCACCGAGCAGCTGCTGATGTCCCTGCGAGAAGATGTGACAAGGAACCTCCTAGGGGACAAGGGGGCGACACCCCGGGAAACAGGACTCAGGAAGGCGGGGAGAGGCCCCGGGAACAGAGAGAAAGTCCTGGGCCTGAACAGGGACCTGCCAGTCCTGGGCAGCGGGAAGAAAGCCCCAAGCCTAAGCCTACCCGTGAACGGGGTGACAGTGTTGGGGAACGGGGCCCAGAGAGCCCCGGACATCGAGGAGAAGCCTGCAGAGAACGGGGGCCTGGGGTCCCCAGAGAGAGAAGTGAAAGTGCTGTCGAATGGGGAGCTGACACCTCCAAGGAGGGAGGAGAAGGCCTTGGAGAATGGGGGGCCGAGGTCCCCAGAGGCCGGGGAGAAGGTTCTGGCGAATGGGGGGCCGATACCCCCCGGGATCGAGGAGAAGGTCTCAGAGAATGGGCTCCTGAGGTTCCCCAGGAACACGGAGAGGCTGACAGAGACTGGGCCTTGGAGAGCCCCAGGGCCCCGGGAGAAGACGCCCGAGAGTGGGGAGCCAGCCCCCGAGACCCCGCTGGAGAGAGCCCCTGTGCCCAGCGAGGTGGCCCTGCTCCAGAACGGCTTGGAGACAGCTCCTGGCCCCCTTGGCCCAGCCCCCAAGATCGGGATGCTGGACCCCGGGAAAGAGAGGAGAGCCCACGAGACTGGGGGGGTGCCGAGAGCCCCCGGGGCTGGGAGGCTGGACCTCGGGAGTGGGGGCCGAGCCCCAGTGGGCATGGGGATGGCCCCCGGCGGCGGCCTCGGAAGCGGCGTGGACGCAAAGGTCGGATGGGTAGACAGCAAGAAGCCACAGCCGCTGCCACCGCTACCACCCCCGGAAGCCCACCCGAGGAGGCCAGAGCCAGTGTCCCCGAGGGTCAGGCCCGAGGTGGCCCCCGAGGGAGAGCCCGGGGTCCCAGACAGCAGAGCCGGCGGAGACACGGCACTCAGCGGAGACGGGGACCCCTCCAAGCCCGAGAGGAAGGGCCCCGAGATGCCACGGCTGTTCTTGGACTTGGGACCCCCACAGGGGAACAGCGAGCAGATCAAAGGTGAGGAGCCCTGGGGAGGTGGGGGCTGGCGCCTTCTGGGGTGGGTGTGGCAGTGGGGATGCCAGTTCAGAGTGACTGCAGAGCCTGGAGTCATATTGCCCCAGCACAAACCCTGGCTCTTTCCCTTCCCTACTCTGCAGTCTTGGGCAGACATGCTTGCTGCTCCGTGCCTCAGTTTCCCCGTCTGTTGCTCAGTGTGGCTGTGA

XM_004867006.1 Coding sequence

Cyth2 cytohesin 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 1200 bp    Location: 5342558..5335174   Strand: -
>XM_004867006.1
ATGGAGGACGGTGTCTATGAACCCCCGGACCTGACCCCGGAGGAACGGATGGAGCTGGAGAACATCCGCCGGCGGAAACAGGAGCTGCTGGTGGAGATCCAGCGCCTCCGGGAGGAGCTCAGCGAAGCCATGAACGAGGTGGAGGGTCTGGAGGCCAATGAGGGCAGCAAGACTTTGCAGCGGAACCGAAAGATGGCAATGGGCAGGAAGAAATTCAACATGGACCCCAAGAAGGGCATCCAGTTCTTGGTGGACAATGAGCTGCTGCAGAACACACCCGAGGAGATCGCCCGCTTCCTGTACAAGGGCGAGGGGCTGAACAAGACTGCCATCGGGGACTACCTGGGGGAGAGGGAAGAACTGAACCTGGCAGTGCTCCATGCTTTTGTGGATCTGCATGAGTTCACCGACCTCAATTTGGTGCAGGCCCTCAGGCAATTTCTGTGGAGCTTTCGCCTCCCTGGAGAGGCCCAGAAAATTGACCGGATGATGGAGGCCTTTGCTCAGCGATACTGCCTGTGCAACCCTGGGGTTTTCCAGTCCACAGACACATGCTACGTGCTGTCCTTCGCTGTGATCATGCTGAACACCAGCCTGCACAATCCCAACGTCAGGGACAAGCCTGGCCTAGAGCGTTTTGTGGCAATGAACCGGGGCATCAACGAGGGCGGGGACCTCCCTGAGGAGCTGCTCAGGAATCTCTATGACAGCATCCGGAACGAGCCCTTCAAGATCCCTGAGGACGACGGGAACGACCTGACCCACACCTTCTTCAACCCAGACCGGGAGGGCTGGCTCCTTAAGCTGGGGGGCCGGGTGAAGACATGGAAGAGGCGCTGGTTCATCCTCACTGACAACTGCCTCTACTACTTCGAGTACACGACGGACAAGGAGCCCCGAGGAATCATTCCCCTGGAAAATCTGAGCATCCGAGAAGTGGATGATCCCCGGAAGCCAAACTGCTTTGAACTTTACATCCCCAACAACAAGGGGCAGCTCATCAAAGCCTGCAAAACAGAAGCAGACGGACGGGTGGTGGAGGGGAACCACATGGTGTACCGGATCTCAGCCCCTACGCAGGAGGAGAAGGACGAGTGGATCAAGTCCATTCAGGCTGCTGTGAGCGTGGACCCCTTCTATGAGATGCTGGCTGCGAGGAAGAAGAGGATTTCTGTCAAGAAGAAGCAGGAGCAGCCCTGA

XM_004867007.1 Coding sequence

Cyth2 cytohesin 2, transcript variant X3

Length: 1203 bp    Location: 5342558..5335174   Strand: -
>XM_004867007.1
ATGGAGGACGGTGTCTATGAACCCCCGGACCTGACCCCGGAGGAACGGATGGAGCTGGAGAACATCCGCCGGCGGAAACAGGAGCTGCTGGTGGAGATCCAGCGCCTCCGGGAGGAGCTCAGCGAAGCCATGAACGAGGTGGAGGGTCTGGAGGCCAATGAGGGCAGCAAGACTTTGCAGCGGAACCGAAAGATGGCAATGGGCAGGAAGAAATTCAACATGGACCCCAAGAAGGGCATCCAGTTCTTGGTGGACAATGAGCTGCTGCAGAACACACCCGAGGAGATCGCCCGCTTCCTGTACAAGGGCGAGGGGCTGAACAAGACTGCCATCGGGGACTACCTGGGGGAGAGGGAAGAACTGAACCTGGCAGTGCTCCATGCTTTTGTGGATCTGCATGAGTTCACCGACCTCAATTTGGTGCAGGCCCTCAGGCAATTTCTGTGGAGCTTTCGCCTCCCTGGAGAGGCCCAGAAAATTGACCGGATGATGGAGGCCTTTGCTCAGCGATACTGCCTGTGCAACCCTGGGGTTTTCCAGTCCACAGACACATGCTACGTGCTGTCCTTCGCTGTGATCATGCTGAACACCAGCCTGCACAATCCCAACGTCAGGGACAAGCCTGGCCTAGAGCGTTTTGTGGCAATGAACCGGGGCATCAACGAGGGCGGGGACCTCCCTGAGGAGCTGCTCAGGAATCTCTATGACAGCATCCGGAACGAGCCCTTCAAGATCCCTGAGGACGACGGGAACGACCTGACCCACACCTTCTTCAACCCAGACCGGGAGGGCTGGCTCCTTAAGCTGGGTGGGGGCCGGGTGAAGACATGGAAGAGGCGCTGGTTCATCCTCACTGACAACTGCCTCTACTACTTCGAGTACACGACGGACAAGGAGCCCCGAGGAATCATTCCCCTGGAAAATCTGAGCATCCGAGAAGTGGATGATCCCCGGAAGCCAAACTGCTTTGAACTTTACATCCCCAACAACAAGGGGCAGCTCATCAAAGCCTGCAAAACAGAAGCAGACGGACGGGTGGTGGAGGGGAACCACATGGTGTACCGGATCTCAGCCCCTACGCAGGAGGAGAAGGACGAGTGGATCAAGTCCATTCAGGCTGCTGTGAGCGTGGACCCCTTCTATGAGATGCTGGCTGCGAGGAAGAAGAGGATTTCTGTCAAGAAGAAGCAGGAGCAGCCCTGA

XM_004867020.1 Coding sequence

Emp3 epithelial membrane protein 3, transcript variant X2

Length: 492 bp    Location: 5436337..5432206   Strand: -
>XM_004867020.1
ATGTCGCTCCTCCTGCTGGTGGTCTCTGCCCTTCACATCCTCATCCTCATCCTGCTTTTCGTGGCCACTCTGGATAAGTCCTGGTGGACCCTCCCGGGGAAGGAGTCCCTGAACCTCTGGTACGACTGCACGTGGAACAACGACACCAAAACGTGGGCCTGCAGTAACGTCAGCGACAACGGTTGGCTGAAGGCTGTGCAGGTACTCATGGTGCTGTCCCTCATCCTGTGCTGCCTGTCCTTCATCTTGTTCATGTTCCAGCTGTACACCATGCGTCGAGGGGGGCTCTTCTACGCCACCGGCCTCTGCCAGCTCTGCACCAGCGTGGCTGTGTTCTCGGGGGCCCTGATCTATGCCATCCACGCCAAGGAGATCGTGGTGAAGCACCCGCGCGGGGGCAGCTTCGGGTACTGCTTTGCGCTGGCCTGGGTGGCCTTCCCCCTGGCGCTGGTCAGCGGCATCGTCTACATCCACCTGCGGAAGCGAGAGTGA

XM_004866687.1 Coding sequence

Rdh13 retinol dehydrogenase 13 (all-trans/9-cis), transcript variant X2

High confidence: 4 potential gene matches
Length: 1005 bp    Location: 2141902..2159009   Strand: +
>XM_004866687.1
ATGAACCGCTACTTGCTGCCGGTGTCCGTGGTGGGAACCGCGGTGGGCGGCGCGGTGCTGCTGAAGGACCATGTCACTGGTGGCACTTGTCCCAGCAAGGCCACCATACCCGGGAAGACTGTCATCGTGACGGGAGCCAACACGGGCATTGGGAAGCAGACTGCCTTGGAACTGGCCAGAAGAGGAGGCCACATCATCCTGGCCTGCCGAGACCTGGAGAAGTGTGAGGCGGCGGCCAAGGACATCCGCGGGGAGACCCTCAACCTCCATGTGCACGCGCGCCGGCTGGACCTGGCTTCCCTCAGGTCCGTGCGGGAGTTTGCTGCCAGGATCGTCAAAGAGGAAGAGCGAGTGGATGTTCTCATCAACAATGCGGCCGTGATGCGCTGCCCACAATGGGCCACCGAGGACGGCTTTGAGATGCAGCTGGGCATCAACCACCTGGGTCATTTTCTTTTGACAAACTTGCTGCTGGACAAGCTGAAAGCCTCAGCCCCTTCGAGGATCATCAACCTCTCATCCCTGGCCCACATTGCTGGGCACATTGACTTTGATGACTTGAACTGGCAGAAGAGGAAGTACAACACCAAGGCTGCCTACTGTCAGAGCAAGCTGGCCATCGTCCTCTTCACCAAGGAGCTGAGCCGGCGGCTGCAGGGCACGGGTGTGACCGTCAATGCTTTGCATCCTGGTGTGGCCAGGACAGAGCTGGGCAGACACACTGGCATGCACAACTCCACCTTCTCCAGCTTCACACTTGGGCCCATCTTTTGGCTGCTAGTCAAGAGCCCCCAGCTGGCGGCCCAGCCCAGCACCTACCTGGCTGTGGCGGAGGAACTGGAAGGTGTTTCTGGAAAGTACTTTGATGGACTCAAAGAGATAGCACCAGCCCCTGAGGCTGAGGATGAGGAGGTAGCTCAGAGGCTTTGGGTTGAAAGTGCCCGCCTTGTGGGCTTGGACATGTCCCATGAGTCCCGTGTGAGGGGACAGTCCTGCCCCAGATAA

XM_004867005.1 Coding sequence

Cyth2 cytohesin 2, transcript variant X1

Length: 1296 bp    Location: 5342176..5335174   Strand: -
>XM_004867005.1
ATGGACCCAGGAGTCCCGACGCCCGGGCTGCCTGTACTCACCACCCAGGAGCCCAGGCCAACAACTACCTCACCAGTTATGGAGTCAGAAAATCAAGGCCTCAGCCCCCTTCCAAAACCCCCGGACCTGACCCCGGAGGAACGGATGGAGCTGGAGAACATCCGCCGGCGGAAACAGGAGCTGCTGGTGGAGATCCAGCGCCTCCGGGAGGAGCTCAGCGAAGCCATGAACGAGGTGGAGGGTCTGGAGGCCAATGAGGGCAGCAAGACTTTGCAGCGGAACCGAAAGATGGCAATGGGCAGGAAGAAATTCAACATGGACCCCAAGAAGGGCATCCAGTTCTTGGTGGACAATGAGCTGCTGCAGAACACACCCGAGGAGATCGCCCGCTTCCTGTACAAGGGCGAGGGGCTGAACAAGACTGCCATCGGGGACTACCTGGGGGAGAGGGAAGAACTGAACCTGGCAGTGCTCCATGCTTTTGTGGATCTGCATGAGTTCACCGACCTCAATTTGGTGCAGGCCCTCAGGCAATTTCTGTGGAGCTTTCGCCTCCCTGGAGAGGCCCAGAAAATTGACCGGATGATGGAGGCCTTTGCTCAGCGATACTGCCTGTGCAACCCTGGGGTTTTCCAGTCCACAGACACATGCTACGTGCTGTCCTTCGCTGTGATCATGCTGAACACCAGCCTGCACAATCCCAACGTCAGGGACAAGCCTGGCCTAGAGCGTTTTGTGGCAATGAACCGGGGCATCAACGAGGGCGGGGACCTCCCTGAGGAGCTGCTCAGGAATCTCTATGACAGCATCCGGAACGAGCCCTTCAAGATCCCTGAGGACGACGGGAACGACCTGACCCACACCTTCTTCAACCCAGACCGGGAGGGCTGGCTCCTTAAGCTGGGGGGCCGGGTGAAGACATGGAAGAGGCGCTGGTTCATCCTCACTGACAACTGCCTCTACTACTTCGAGTACACGACGGACAAGGAGCCCCGAGGAATCATTCCCCTGGAAAATCTGAGCATCCGAGAAGTGGATGATCCCCGGAAGCCAAACTGCTTTGAACTTTACATCCCCAACAACAAGGGGCAGCTCATCAAAGCCTGCAAAACAGAAGCAGACGGACGGGTGGTGGAGGGGAACCACATGGTGTACCGGATCTCAGCCCCTACGCAGGAGGAGAAGGACGAGTGGATCAAGTCCATTCAGGCTGCTGTGAGCGTGGACCCCTTCTATGAGATGCTGGCTGCGAGGAAGAAGAGGATTTCTGTCAAGAAGAAGCAGGAGCAGCCCTGA

XM_004867009.1 Coding sequence

Grwd1 glutamate-rich WD repeat containing 1, transcript variant X1

Length: 1392 bp    Location: 5360602..5354259   Strand: -
>XM_004867009.1
ATGGGTCCCAAGGGAGCAGAAACCCAGTCACCTGCCAGAGAGGCTTCGAAGATGGCGGCCCGCAGGGGTCCGCAGAGCACGTGTTCTGCTGGGGAGCCCATGGAAACCGAATCCCGCGACACAGATTCCGAGGGCCCAGCCCAGGTCTACCTACCCGGCCGGGGGCCGCCACTGCGCGAAGGGGAGGAGCTGGTTATGGACGAGGAGGCCTATGTGCTCTACCACCGTGCGCAGACTGGCGCCCCCTGTCTTAGCTTCGATATAGTCCGAGATCACCTGGGAGACAACAGGACAGACCTTCCTCTTACACTTTACCTGTGTGCGGGGACCCAAGCGGAGAGCGCCCAGAGCAACAGACTGATGATGCTTCGGATGCACAATTTACACGGGACCAAGTCCCCACCCTCAGAGGGTAGTGATGAGGAGGAGGAGGAGGAAGATGAAGAGGATGAAGAAGAGCGGAAGCCTCAGCTGGAGCTGGCCATGGTCCCCCACTATGGTGGCATCAACCGGGTTCGGGTGTCCTGGCTGGGCGAGGAGCCTGTTGTGGCTGTGTGGTCGGAGAAAGGCCAGGTGGAGGTGTTCACATTGCGGAGGCTCCTGCAGGTGGTGGACGACCCCCAGGCCCTGGCCATCTTCCTCCGGGATGAGCAGGCCCGAGTGAAGCCCATCTTCACCTTTGCTGGCCACATGGGTGAGGGCTTTGCCCTTGACTGGTCCCCTCGGGTGCCAGGCCGCCTGCTGACCGGTGACTGCCAGAAGAACATCCATCTCTGGACGCCTACCGACGGTGGCTCATGGCATGTGGACCAGCGGCCATTTGTGGGCCACACACGCTCTGTGGAGGACCTGCAGTGGTCCCCAACTGAGGACACGGTATTCGCCTCTTGCTCAGCTGACGCCTCCATTCGCATATGGGACATCCGGGCGGCCCCTGGTAAGGCCTGCATGCTTACCACGGCCACCGCCCACCATGGGGACGTCAATGTCATCAGCTGGAGCCGCCAGGAGCCCTTCCTGCTCAGTGGTGGGGATGATGGGGTCCTCAAGGTCTGGGACCTGCGACAGTTCAAGTCTGGCTCCCCTGCGGCCACCTTCAAGCAACACGTGGCGCCCGTGACCTCCGTCGAGTGGCACCCACAGGACAGCGGGGTCTTTGCAGCCTCGGGTGCAGACAACCAGATCACGCAGTGGGACCTGGCTGTGGAGCGGGACCCCGAGGCAGGCAAGCTGGAGGCCGACCCAGGGCTGGCAGAGCTGCCCCAGCAGCTGCTGTTTGTCCACCAGGGCGAGACAGACCTGAAGGAGCTGCACTGGCACCCGCAGTGCCCCGGCCTCCTGGTCAGCACCGCCCTGTCGGGCTTCACCATCTTCCGCACCATCAGCGTCTGA

XM_004867011.1 Coding sequence

Kdelr1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1

High confidence: 4 potential gene matches
Length: 1017 bp    Location: 5396122..5405188   Strand: +
>XM_004867011.1
ATGCGGGGATTTGGGAGTATCTCACGCCGGCGACCCTCCAAGTTCCTCGGACTCAGCCGAGGAGTGCATTGGGCGCCAGACCTGCAAGGCAGGAGGTGGGCGACAGGGGGAGCCCGAGAACCGAAACCCCTCCCTCGGGGGCGGGGCCTGCAGCCCCGGACTCCTCCCCTCCCCCGCCCTCCTCCCTCTTCCCGGCTCTGGCTCATCCGCCTGCTCGGGCCTCGGTCCCCCTCCCAGAGCCCCCTCCCCGCAGTGCGGCCCACCGGAGGGCCCTCTCCCGCCCTCAGCCCAACCACCCGCCGGAACAGCAGCTCGGGGGCAGCCCCCCGCCAGTCCGCCTCCCCCCGTCTCAGCCCTGCCCGAGCCCTCCTCCCGGCCATGAACCTCTTCCGATTCCTGGGAGACCTCTCCCACCTCCTAGCCATCATCTTGCTGCTGCTCAAAATCTGGAAGTCCCGCTCGTGTGCCGGGATTTCAGGGAAGAGCCAGGTCCTGTTTGCTGTGGTGTTCACTGCCCGCTACCTGGACCTGTTCACCAACTACATCTCACTCTACAACACATGCATGAAGGTGGTCTACATAGCTTGTTCCTTCACCACTGTCTGGATGATTTATAGCAAGTTCAAAGCCACGTATGATGGGAACCATGACACGTTCCGAGTGGAGTTCCTTGTTTTTCCCACGGCTGTCCTCGCCTTTCTGGTCAACCATGACTTCACTCCTCTAGAGATCCTCTGGACTTTCTCCATCTACCTTGAGTCCGTGGCCATCTTGCCGCAGCTGTTCATGGTGAGCAAGACTGGCGAGGCGGAGACTATCACCAGCCACTACCTGTTCGCACTGGGCGTCTACCGCACACTCTATCTCTTTAACTGGATCTGGCGCTACCACTTCGAGGGCTTCTTCGACCTCATCGCCATCGTGGCTGGCCTGGTCCAGACGGTCCTCTATTGCGACTTCTTCTACCTCTACATCACCAAAGTCCTCAAGGGGAAGAAGCTGAGCTTGCCCGCATAG

XM_004867015.1 Coding sequence

Syngr4 synaptogyrin 4, transcript variant X2

Length: 705 bp    Location: 5413602..5407309   Strand: -
>XM_004867015.1
ATGCGCCTCCCCAAAAGCCTGCAGGACCTTGCCAGCAGCGAGACCGTGCGCTTCCTGAGGAGGCCAAAGAGCATCACACGGATCCTCTCGGGGGTCTTCGCCCTGGTTGTCTTCTCCTCCCTGCTGACCGATGGCTACCAGAACACAACTGAGTCCCCGCAGCTGCACTGTGTGCTCCACAGCAACCACACAGCCTGCAGCCTCGCTGTGGGCGCTGGCATCCTCACCTTCCTCAGCTGCCTGGTCTTCCTTGCCCTGGACGCCCACAGGGCCCACGTGGTCAACACCCACCTCAAGGTGGTCCTGCGGCTCCTGGACATCATCCTGGCAGTTCTCTGGGCCGTCATCTGGTTCATGGGCTTCTGCTTTCTGGTCAACCAGTGGCACCACTCATCGCCCAAAGAGTTCCTCATGGGGAGCGCCAGCGCCAAGGCGGCCATTACCTTCGCTTTCTTCTCCATCTTTGTCTGGATATTCCAAGCCTACCTGGCATTCCAGGACCTCTGGAGTGATGTTGCGGTCCCCTACAAGCGCTGCCTGGATGAGAGTGGAGTGGTGCTGACCACCCTCTCCCCGCTGTCCACCTCCAGCTCAGTGAACATGCCCACCTCCGGCCCCACCAGCCAGACTTACTCCAGCTCTGCCCTGTCCCCTTATACAACCACCCT