Details from NCBI annotation

Gene Name Heterocephalus glaber isolate NMR 29 unplaced genomic scaffold, HetGla_female_1.0 scaffold00099, whole genome shotgun sequence

Genome Location

Related Sequences

XM_004865419.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X2

Length: 3969 bp    Location: 1327505..1308920   Strand: -
>XM_004865419.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGGTGAGAGGCCGCGCCCCGCCCTGGGCCATGGCCACGCTCCTCGCGTACTCGTGCTGGCTCCGCCCCCGCTCCTGGGCCGCACACCGCATGTTCATTCCCTGGGGCCGCATCCCGGAGGGAGGGGCAGGGCCACTGAGCTCCCCACACTGCGGAGCCGGACTCGCCCGTCTCCCGACTCTCTTCCCACAGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGTCAGTCCTCAGACCGCGCCCAGGAGAGCGCGACCCGACCCCAGCTGTCCCCCCATCTGGCTCCCGTCTCCACCGCCCCTTCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGTGAGTGGGGAGCTCCGGGGTCCGTGGCAGGCAGCCGGGGGAGCTTCCAGAAGCAAGTGGGTTTGCCTGGCATCCTGGGGTCCCCTTTTCCCCCGTAAATCGGGTTGCTGGGGCCATGGCTCAGTGGTGCCTTGCCGGGACACTGGGACCCCCTCCCCCGCCCGGCCCCTGTGCGATCGCTCCGGCCTCACTTCCCCAGAGAGCACGCAGGGAGGTCAGGTCGGGCAGCCTGGCCCGGGGTCTGATGGGCCCGGGCCCCCAGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865422.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X5

Length: 3831 bp    Location: 1326275..1308920   Strand: -
>XM_004865422.1
ATGGCTTCCGCCTGCCAGCTCCTCCGCTGGGCCCTCGCCCTGGGGCTGGGCCTCACCTTCAAGGTCACACATGCCTTCCGGTCTCAAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGGTGAGAGGCCGCGCCCCGCCCTGGGCCATGGCCACGCTCCTCGCGTACTCGTGCTGGCTCCGCCCCCGCTCCTGGGCCGCACACCGCATGTTCATTCCCTGGGGCCGCATCCCGGAGGGAGGGGCAGGGCCACTGAGCTCCCCACACTGCGGAGCCGGACTCGCCCGTCTCCCGACTCTCTTCCCACAGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGTCAGTCCTCAGACCGCGCCCAGGAGAGCGCGACCCGACCCCAGCTGTCCCCCCATCTGGCTCCCGTCTCCACCGCCCCTTCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGTGAGTGGGGAGCTCCGGGGTCCGTGGCAGGCAGCCGGGGGAGCTTCCAGAAGCAAGTGGGTTTGCCTGGCATCCTGGGGTCCCCTTTTCCCCCGTAAATCGGGTTGCTGGGGCCATGGCTCAGTGGTGCCTTGCCGGGACACTGGGACCCCCTCCCCCGCCCGGCCCCTGTGCGATCGCTCCGGCCTCACTTCCCCAGAGAGCACGCAGGGAGGTCAGGTCGGGCAGCCTGGCCCGGGGTCTGATGGGCCCGGGCCCCCAGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865421.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X4

Length: 3912 bp    Location: 1326275..1308920   Strand: -
>XM_004865421.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGGTGAGAGGCCGCGCCCCGCCCTGGGCCATGGCCACGCTCCTCGCGTACTCGTGCTGGCTCCGCCCCCGCTCCTGGGCCGCACACCGCATGTTCATTCCCTGGGGCCGCATCCCGGAGGGAGGGGCAGGGCCACTGAGCTCCCCACACTGCGGAGCCGGACTCGCCCGTCTCCCGACTCTCTTCCCACAGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGTCAGTCCTCAGACCGCGCCCAGGAGAGCGCGACCCGACCCCAGCTGTCCCCCCATCTGGCTCCCGTCTCCACCGCCCCTTCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGTGAGTGGGGAGCTCCGGGGTCCGTGGCAGGCAGCCGGGGGAGCTTCCAGAAGCAAGTGGGTTTGCCTGGCATCCTGGGGTCCCCTTTTCCCCCGTAAATCGGGTTGCTGGGGCCATGGCTCAGTGGTGCCTTGCCGGGACACTGGGACCCCCTCCCCCGCCCGGCCCCTGTGCGATCGCTCCGGCCTCACTTCCCCAGAGAGCACGCAGGGAGGTCAGGTCGGGCAGCCTGGCCCGGGGTCTGATGGGCCCGGGCCCCCAGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865424.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X7

Length: 3762 bp    Location: 1326275..1308920   Strand: -
>XM_004865424.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGTCAGTGTAAATACGGGGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGTCAGTCCTCAGACCGCGCCCAGGAGAGCGCGACCCGACCCCAGCTGTCCCCCCATCTGGCTCCCGTCTCCACCGCCCCTTCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGTGAGTGGGGAGCTCCGGGGTCCGTGGCAGGCAGCCGGGGGAGCTTCCAGAAGCAAGTGGGTTTGCCTGGCATCCTGGGGTCCCCTTTTCCCCCGTAAATCGGGTTGCTGGGGCCATGGCTCAGTGGTGCCTTGCCGGGACACTGGGACCCCCTCCCCCGCCCGGCCCCTGTGCGATCGCTCCGGCCTCACTTCCCCAGAGAGCACGCAGGGAGGTCAGGTCGGGCAGCCTGGCCCGGGGTCTGATGGGCCCGGGCCCCCAGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865426.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X9

Length: 3639 bp    Location: 1326275..1308920   Strand: -
>XM_004865426.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGTCAGTGTAAATACGGGGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGGTGAGAGGCCGCGCCCCGCCCTGGGCCATGGCCACGCTCCTCGCGTACTCGTGCTGGCTCCGCCCCCGCTCCTGGGCCGCACACCGCATGTTCATTCCCTGGGGCCGCATCCCGGAGGGAGGGGCAGGGCCACTGAGCTCCCCACACTGCGGAGCCGGACTCGCCCGTCTCCCGACTCTCTTCCCACAGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004866048.1 Coding sequence

LOC101703466 putative methyl-CpG-binding domain protein 3-like 5-like

Length: 606 bp    Location: 1463518..1462913   Strand: -
>XM_004866048.1
ATGATAGCCCCACATTTACAGAGGAAGCCACACGTCCGGGGCCTCAAAGCCAAGCGCAGAGCTGCTGGGGGCTGTGTCCTCCCCGTGCGACTGACCAGCTGCATCTTCCCCAGGCCCGTGACGCTCATCACCGCCCACCCTGGCAATGAGGTCAGGTGCGGGCCCCACGAGGAGAAGCTGGAGAAGCCCCAGCAGCTGTGTTCAAGCTGGAGGCTGCAGGCACTCAAGCACCAAGGCAGCGAAGAAGAAGGTTTAAGCCAATTGGATTTCACAAACGCCTTCCCAGCCATGACTTCAGGAAGCCGAGGAGGATCCTGGGGCCAGGCTGCTGCTGAGAGCTCGCAGCCCGCCCCTGGCCTGTCTCCCTTCTGGAAAGAGATGATCCCGGAAGCTTTTCACCTTGTCCCTCCCCCTTCCAGCCAGCAGGTCACTTCCGCAGACATCCAGAGACAGGCTCGGAAAGTGAAGAGGGCCAGGGAGAGACTGGCCGAGGCCTTGAGGGCAGACAGCCTGGCCAGGGAGGCAGAGAGGCTGAGCAGCCAGGAGGAAAGGGCTGAAAACCAGGTGGAAACAGGAGCAGGAGCTGCTGGAGACTCGGAAATGTGA

XM_004865439.1 Coding sequence

Mbd3l1 methyl-CpG binding domain protein 3-like 1, transcript variant X1

Length: 576 bp    Location: 1496722..1505847   Strand: +
>XM_004865439.1
ATGATGGCCAAGATTTCACAAAGGAAACAACGTGACTGCGTAAACCAATCAAAACCAAAGTCTGGCTTAAGCATCTCAATTCCCTTGAGAATGTCCAGTTACGCATTCCAGAGACCAGTTACAAGAATTACATCCCATCCAGACAACGAGGTCAGATACCATCAATGGGAGGCAAACTTAGACAAACCCCAGCAGGTCTGCTTGTATAAGAGACTGCAAGGACTCCAGGCCTCCAGTAGCATAGGAGAACTTTTAAGTACTTTAGACCTTGCCAAAACTTTGCGCACACTTGTACCTAGTTGCACAAGTGCATCCCTGTCAGAGGCTCTGGCTGGTGGTGTGCGGTCCAGCTCTCTGCCTGGCCTTGGCCTGTCTTCCCATGCAGTGGAGATGATTCCAGGAATGGGTCTGGGTGTGCCCCAGCTCCTCTGCGAACAATTTCTGGTCACGGAGGAAGACATTAAGAAACAGGAAAGAAAAGTGGAGACAGCAAGAGAAAGACTGGCCATAGCACTGATTGCACACAGACTAGCTAGTGAGGGAGAGACAGTGAAGGGGCCACAAAAGGTGTCTTGA

XM_004865440.1 Coding sequence

Mbd3l1 methyl-CpG binding domain protein 3-like 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 576 bp    Location: 1501415..1505847   Strand: +
>XM_004865440.1
ATGATGGCCAAGATTTCACAAAGGAAACAACGTGACTGCGTAAACCAATCAAAACCAAAGTCTGGCTTAAGCATCTCAATTCCCTTGAGAATGTCCAGTTACGCATTCCAGAGACCAGTTACAAGAATTACATCCCATCCAGACAACGAGGTCAGATACCATCAATGGGAGGCAAACTTAGACAAACCCCAGCAGGTCTGCTTGTATAAGAGACTGCAAGGACTCCAGGCCTCCAGTAGCATAGGAGAACTTTTAAGTACTTTAGACCTTGCCAAAACTTTGCGCACACTTGTACCTAGTTGCACAAGTGCATCCCTGTCAGAGGCTCTGGCTGGTGGTGTGCGGTCCAGCTCTCTGCCTGGCCTTGGCCTGTCTTCCCATGCAGTGGAGATGATTCCAGGAATGGGTCTGGGTGTGCCCCAGCTCCTCTGCGAACAATTTCTGGTCACGGAGGAAGACATTAAGAAACAGGAAAGAAAAGTGGAGACAGCAAGAGAAAGACTGGCCATAGCACTGATTGCACACAGACTAGCTAGTGAGGGAGAGACAGTGAAGGGGCCACAAAAGGTGTCTTGA

XM_004865435.1 Coding sequence

Znf177 zinc finger protein 177, transcript variant X4

Length: 1401 bp    Location: 1711060..1721102   Strand: +
>XM_004865435.1
ATGGCTACAGGATTGCTGACAGCCCAGTCCCAGAACTCAGTGACCTTCCAGGAAGTGGCAGTGGACTTTTCCCATGAGGAATGGGCATTGCTGAACCCTGCTCAAAAAAGTCTATACAGAGATGTGACACTGGAGAACTTTAAGAACCTGGCCTCAGTGGCAGGTTACCAGGTCTGCAAACACAGTCTGACCTCCAAGGTGGAACAGGGAGAGCTGAGGACAGAGGAGAGAGAAGTTCTTCAAAGCGCCTGTGCAGGCTGGCAAGCTCAACTTAAATCAAAAGATGCAATTCCTATGCAGAATGTTCCTAGGGATACATCCAGTGGCATAAGGATGGTACGAACTCAACCTGGCACGAAACCTGTAGAAAGCAATCATTGTGAAAAATTCTTCAGAAAGAACCTTCATTTTTTTTATACCAGGCATTTCAAGGAAGAAAAGTCCTGTAGGTATATAGAATATGGCAAAGTCTTCAGACATTCTTCGGCTCCTAGGAGTCATGTGAAAAAAGCTTTCAGTGGGGAGTCAACCCTTATGAAACATTTAAGAATTCTCACAGGAGAGTGTGCTCATGAGTGTAATCAGTGTGGTATATCCCTCACTCTACATCCTTCCTTCTCAGCATATGGACAAATACATGCTGGAGAGAAACTCTGTAAATGCACTGACTATGGAAAAACATCTTCATTTAATGTTCACAAAAACATACAAACCATGGAGGAGGGCTTGGGACGTAATGAATGTGGGAAAGCTTTCACTGGCCCTGTATCCCTTCAGAAATATGTCAGAACTCACACTGGAGAGAAGTTCTATGAGTGCAGTGACTGTGGAAAAGTCTTCATTTTTCAGTCTTCCCTTAAGAAACACATGAGGTCCCACACTGGTGAGAAACCCTATGAATGTAATCATTGTGGGAAATCCTTCAGCCAGAGCTCTCATCTCAATGTGCACAGAAGAACTCACACTGGAGAGAAACCCTACCAATGTAAGGAATGTGGGAAGGCCTTCACTGTTCCTTCATCCCTTCAGAAACACGTGAGGACCCACACAGGAGAGAAACCCTATGAGTGCAGTGACTGTGGGAAAGCCTTCATTGATCAGTCATCCCTTAAGAAACACACACGATCTCACACTGGAGAAAAACCTTACAAGTGCAATCAATGTGGAAAATCCTTCAGCACAGGCTCTTACCTGATTGTGCACAAAAGAACTCACACTGGAGAGAAAACCTATGAGTGTAAAGAATGTGGAAAGGCGTTTAGAAATTCCTCTTGCCTGAGGGTACATGTGAGAACACACACTGGAGAGAAGCCCTATAAATGTATTGAGTGTGGAAAAGCTTTCAGCACAAGTACTAACCTTATAATGCACAAACGAATGCATACTGGACAGAAGGTATGA

XM_004865437.1 Coding sequence

Znf177 zinc finger protein 177, transcript variant X6

Length: 1398 bp    Location: 1711063..1721102   Strand: +
>XM_004865437.1
ATGGCTACAGGATTGCTGACAGCCCAGTCCCAGAACTCAGTGACCTTCCAGGAAGTGGCAGTGGACTTTTCCCATGAGGAATGGGCATTGCTGAACCCTGCTCAAAAAAGTCTATACAGAGATGTGACACTGGAGAACTTTAAGAACCTGGCCTCAGTGGGTTACCAGGTCTGCAAACACAGTCTGACCTCCAAGGTGGAACAGGGAGAGCTGAGGACAGAGGAGAGAGAAGTTCTTCAAAGCGCCTGTGCAGGCTGGCAAGCTCAACTTAAATCAAAAGATGCAATTCCTATGCAGAATGTTCCTAGGGATACATCCAGTGGCATAAGGATGGTACGAACTCAACCTGGCACGAAACCTGTAGAAAGCAATCATTGTGAAAAATTCTTCAGAAAGAACCTTCATTTTTTTTATACCAGGCATTTCAAGGAAGAAAAGTCCTGTAGGTATATAGAATATGGCAAAGTCTTCAGACATTCTTCGGCTCCTAGGAGTCATGTGAAAAAAGCTTTCAGTGGGGAGTCAACCCTTATGAAACATTTAAGAATTCTCACAGGAGAGTGTGCTCATGAGTGTAATCAGTGTGGTATATCCCTCACTCTACATCCTTCCTTCTCAGCATATGGACAAATACATGCTGGAGAGAAACTCTGTAAATGCACTGACTATGGAAAAACATCTTCATTTAATGTTCACAAAAACATACAAACCATGGAGGAGGGCTTGGGACGTAATGAATGTGGGAAAGCTTTCACTGGCCCTGTATCCCTTCAGAAATATGTCAGAACTCACACTGGAGAGAAGTTCTATGAGTGCAGTGACTGTGGAAAAGTCTTCATTTTTCAGTCTTCCCTTAAGAAACACATGAGGTCCCACACTGGTGAGAAACCCTATGAATGTAATCATTGTGGGAAATCCTTCAGCCAGAGCTCTCATCTCAATGTGCACAGAAGAACTCACACTGGAGAGAAACCCTACCAATGTAAGGAATGTGGGAAGGCCTTCACTGTTCCTTCATCCCTTCAGAAACACGTGAGGACCCACACAGGAGAGAAACCCTATGAGTGCAGTGACTGTGGGAAAGCCTTCATTGATCAGTCATCCCTTAAGAAACACACACGATCTCACACTGGAGAAAAACCTTACAAGTGCAATCAATGTGGAAAATCCTTCAGCACAGGCTCTTACCTGATTGTGCACAAAAGAACTCACACTGGAGAGAAAACCTATGAGTGTAAAGAATGTGGAAAGGCGTTTAGAAATTCCTCTTGCCTGAGGGTACATGTGAGAACACACACTGGAGAGAAGCCCTATAAATGTATTGAGTGTGGAAAAGCTTTCAGCACAAGTACTAACCTTATAATGCACAAACGAATGCATACTGGACAGAAGGTATGA

XM_004865472.1 Coding sequence

Olfm2 olfactomedin 2, transcript variant X1

Length: 1437 bp    Location: 2200225..2135246   Strand: -
>XM_004865472.1
ATGTCGGTTCCGCTGCTGAAGATCGGGGCTGTGCTGAGCACCATGGCCATGGTCACCAACTGGATGTCGCAGACGCTACCCTCGCTCGTGGGGCTCAACGGCACCGTGTCCCGCGCGGGCTCCTCCGAGAAAATCACTCTCTTCCAGAGCCCCGAGGAGGGCTGGCAGCTGTACACCTCGGCCCAGGCCCCTGACGGCAAATGCGTGTGCACCGCCGTGATCCCGGCACAGAGCACCTGTTCCCGGGACGGCCGGAGCCGGGAACTGCGGCAGCTGATGGAGAAGGTCCAGAACGTGTCCCAGTCCATGGAAGTCCTCGAGCTACGGACCTACCGTGACCTGCAGTACGTGCGCAGCATGGAGACCCTCATGCGCAGCCTGGACGCCAGGCTCCGGGCAGCCGATGGCTCCCTCTCGGCCAAGAGCTTCCAGGAGCTGAAGGACAGGATGACGGAGCTGCTGCCCCTGAGCTCGGTGCTGGAACAGTACAAGACCGACACACGGACCATCGTGCGGCTTCGGGAGGAGGTGCGGAACCTCTCAGGCAGCCTTGCCACCATCCAGGAGGAGATGGGTGCCTTCGGCTATGAGGACCTGCAGCAGCGCGTCATGGCCCTGGAGGCCCGGCTCCACGCCTGCGCCCAGAAGCTGGGATGTGGCAAGCTGACCGGGGTCAGCAACCCCATCACCATCCGGGCCATGGGGTCCCGCTTCGGCTCCTGGATGACCGACACGATGGCCCCCAGTGCGGACAGCCGGGTCTGGTACATGGATGGCTACTACAAGGGCCGGCGGGTCCTGGAGTTCCGCACCCTGGGCGATTTCATCAAAGGCCAGAACTTTATCCAGCACCTGCTGCCACAGCCCTGGGCAGGCACGGGCCACGTGGTGTACAACGGCTCGCTGTTCTACAACAAGTACCAGAGCAATGTGGTGGTCAAGTACCACTTCCGCTCCCGCTCGGTGCTGGTGCAGCGGAGCCTTCCGGGCGCCGGCTACAACAACACCTTCCCCTACTCCTGGGGCGGCTTCTCCGACATGGACTTCATGGTAGACGAGAGTGGGCTCTGGGCCGTCTACACCACCAACCAGAACGCGGGCAACATCGTGGTCAGCCGGCTGGACCCGCACTCCCTGGAGGTCATGAGGTCCTGGGACACCGGGTACCCCAAGCGCAGTGCAGGTGAGGCCTTCATGATCTGCGGTGTCCTCTATGTCACCAACTCCCACCTGGCGGGGGCCAAGGTCTACTTCGCCTACTTCACCAACACGTCCAGCTACGAGTACACGGACGTGCCCTTCCACAACCAGTACTCACACATCTCCATGCTGGATTACAACCCCCGCGAGCGGGCCCTGTACACCTGGAACAACGGCCACCAGGTGCTGTACAATGTCACCCTCTTCCACGTCATCAGCACCGCAGGGGACCCCTAG

XM_004865477.1 Coding sequence

Angptl6 angiopoietin-like 6

High confidence: 4 potential gene matches
Length: 1434 bp    Location: 2301392..2292325   Strand: -
>XM_004865477.1
ATGGCGGCGCCCCGGCTGCGCATGCTGCCGCTGCTGCTCCTGCTGGGCGCGTCGTGGGCGCGGGCGGGCGCGCCGCGCTGCACCTACACTTTCGTGCTGCCCGCGCAGAAGTTCACGGGCGCCGTGTGCTGGAGCGCGGCCGCACGGCCCGCGCCCGAGGCCGTCAACGCCAGTGAGGTGGCGGCGCTGCGCATGCGCATAGGCCGCCACGAGGAGCTGCTGCGCGAACTGCAGCGGCTGGCGGCGGCGGACGGCGCCGTGGCCGGCGAGGTGCGCGCGCTGCGCAAAGAGAGCCGCGGTCTGAGCGCGCGCCTGGGCCAGTTGCGCGCGCAGCTGCACCATGAAGCTGGGCCGAGTCCGGGGGCGGAGCCAAGTCCTGGGGTGGAGCCAAAATTGGAGGCGGATCTAGGGGCGGAGCCTGCCGCCGCGCTAGCTCTGCTTGGGGAGCGCGTGCTGAACGCATCCGCCGAGGCGCAGCGCGCCGCCGCCCGCTTCCACCAGCTGGACGAGAAGTTCCGGGAGCTGGCGCGGCTTGTCAGCCAGCAGAGCGGCCTCATCGCCCGCCTGGAGCGCCTGTGTCCCGGGGGCGCGGGCGAGCAGCAGCAGGTCCCGCCCCCGCCCCTGGTGCCTGTGGTTCCCTTGAGTCTGGTGGGCGGCACCAGTAACACCAGCAGGAGCCTGGCCCCAGCCCCAGAGTCCCTGAGAGAACAGACGCTGAAACAGCAGGGGCCCCTGGCCTCCCCCTCACCCGCTGGGCTCCCTGCCAGCCCCACCAAGCCAGCAGGCCCGTGGCAGGACTGTGCCGAGGCTCACCAGGCAGGCCACAGGCAGAGTGGAGTGTATGAGCTGCGCCTTGGCCGGCATGTGGTACCTGCATGGTGTGAGCAGCAGCTGGAGGGGGGTGGCTGGACTGTGATCCAGCGGCGGCAGGATGGCTCAGTCAACTTCTTCACCACCTGGCAGCAGTACAAGGTGGGCTTTGGGCAGCCGGACGGGGAGTACTGGCTGGGCCTTGAACCTGTGTACCAGCTGACCAGCCGCAGGGACCATGAGCTGCTGGTGCTGCTGGAGGACTGGGGGGGCCGCGGGGCCCGCGCCCACTACGACAGCTTCTCCCTGGAGCCTGAGAGCGACCACTACCGCCTGCGGCTCGGTCAATACCACGGGGACGCTGGGGATTCTCTTTCCTGGCACAACGACAAGCCTTTCAGCACAGTGGATAGGGACCGAGACTCCTATTCTGGACACTGTGCCCTGTACCAGCGTGGAGGGTGGTGGTACCACGCCTGTGCCCATTCCAACCTCAATGGTGTCTGGCACCGTGGTGGCCACTACCGAAGCCGCTACCAGGATGGCGTCTACTGGGCTGAGTTCCGAGGTGGGGCGTACTCGCTTAAGAAGGCTGCCATGCTCATCCGGCCCGCCAGGCTGTGA

XM_004865482.1 Coding sequence

LOC101712710 sphingosine 1-phosphate receptor 2-like, transcript variant X1

Length: 1059 bp    Location: 2394106..2390742   Strand: -
>XM_004865482.1
ATGGGCGCTTTCTACTCTGAGTACCTCAATTCCAACAAGGTCAAGGAGCACTACAATTACACCAAGGAGACTCTGGACATGCAGGAGACGCCATCCCGCCAGGTGGCCTCGGCCTTCATCATCATCCTGTGCTGTGCCATCGTGGTGGAAAACCTGCTGGTGCTCATCGCCGTGGGCCGTAACAGCAAGTTCCACTCGGCCATGTACTTGTTCCTGGGCAACCTGGCCGCATCCGACCTCCTGGCGGGCATGGCCTTCATTGCCAACACCTTGCTGTCGGGCTCCGTCACCCTGGGGCTGACGCCAGTGCAGTGGTTTGCCCGTGAGGGCTCGGCCTTCATCACCCTGTCCGCCTCTGTCTTCAGCCTTCTGGCCATCGCCATCGAGCGGCACGTGGCCATCGCTAAGGTCAAGCTGTATGGCAGTGACAAGAGCTGCCGTATGCTGCTGCTCATTGGGGCCTCATGGGTCATCTCGCTGGTCCTCGGCGGCCTCCCCATCCTGGGCTGGAACTGCCTGGGCCACCTGGACACCTGCTCTACTGTCCTGCCTCTCTACGCCAAGCAGTATGTGCTATGCGTGGTAACCATCTTTTCTGTCATCCTGTTGGCCATTGTCGCCCTGTACATCCGCATCTACTGCGTGGTCCGCTCGAGCCACGCAGATCTGGCTGGCCCGCAGACGCTGGCTCTGCTCAAGACTGTCACCATCGTGCTGGGCGTCTTCATCGTCTGCTGGCTGCCCGCCTTTAGCATCCTGCTCTTAGACTACGCCTGTCCCGTCCGGTCCTGCCCCATTCTCTACAAAGCCCACTACTTCTTTGCCTTTGCCACCCTTAACTCGCTGCTGAACCCTGTCATCTACACATGGCGGAGCCGAGACCTGCGGCGGGAGGTGCTGCGGCCACTGCAGTGCTGGCAGCGGGCGGCCAGGGGCCCAGGACGGCGGGACAGGACCCCAGGCCACCGCCTTCTGCCCCTTCGCAACTCCAGCTCGCTGGAGAGGGGCACGAACATGCCCACATCGCCCACGTTTCTGGAGGGCAACACAGTGGTCTGA

XM_004921181.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 828 bp    Location: 2419211..2424014   Strand: +
>XM_004921181.1
ATGCTGCAGTTATTCCGGGCCGGAGCGGGGGCCTGGCTTCGGTCCTCGGGCTGCAAGGCCCTGAGTTCGCTGGCGGAAGAAGTAGTCCTGCCGATGAAGAAGTCGGAGCCGGAGCCGCAGGCGAGCCCAGTTGTCCAAGAGCCTGTGCTGCGCCGATGCGAACTCCCGGTCCCCGCGCACCGGCGCCCGGTGCAGGCCTGGGTCGAGTCCCTGCGGGGTTACGAGCAGGAGCGTGTGGGCCTGGCTGAACTGCACCCCGATGTCTTCGCCACGGCGCCCCGGGTGGATGTCCTGCACCAGGTGGCCATCTGGCAGAGGAACTTCAAGAGAATTAGCTATGCCAAGACGAAGACAAGGGCCGAGGTGCGGGGCGGCGGCCGGAAGCCCTGGCAGCAGAAGGGCACTGGGCGTGCGAGGCACGGGAGCATCCGGTCCCCGATCTGGCGCGGTGGCGGCGTGGCGCATGGCCCTCGGGGCCCCAAGAGCTACTACTATATGCTGCCCATGAAGGTGCGAGTGCTAGGCCTCAAGGTGGCGCTGACAGTGAAGCTGGCGCAGGATGACCTGCATGTCGTGGACTCCCTGGAGCTGCCCACTGCAGATCCCCAGTACCTGATGGAGCTGGCCCGCCACCGCCACTGGGGCGACTCTGTGTTGCTCGTGGACCTGACACACGAGGAGATGCCGCAGAATGTCGTGGAGGCCACCAGCAGGCTCAAGACCTTCAACCTGATCCCAGCTGTCGGTGAGCAAAGGGCCGCCCACCCCAGAGTGAAGGCGTGTCAGTCCCCTTGTCAGAGCCATGGGTGGCTCGAGGCCTGCATGTGA

XM_004865485.1 Coding sequence

Icam5 intercellular adhesion molecule 5, telencephalin

High confidence: 4 potential gene matches
Length: 2751 bp    Location: 2454753..2461727   Strand: +
>XM_004865485.1
ATGCCAGGGCCTTCGCCAGGGCTGCGCCGGGCGCTACTCGGCCTCTGGGCTGCCCTGGGCCTGAAGATCCTCGGCCTCGCAGCGGTCGCGCAGGAGCCCTTCTGGGCGGACCTGCAGCCCCGTGTGGCGCTCGTGGAGCGCGGGGGCTCTCTGTGGCTGAATTGCAGCACCAACTGCCCTCGGCCAGAGCGCGGTGGCCTGGAGACCTCGCTGCGCCGCAACGGGACGCAGAGGGGCTTGCGCTGGCTGGCGCGGCAGCTAGTGGACATCCGCGAGCCAGAGACCCAGCCCGTGTGCTTCTTCCGCTGCGCGCGGCGCACGCTGCAGGCGCGCGGGCTCATCCGCACTTTCCAGAGGCCGGATCGCGTGGAGCTGGGGCCACTGCCTTCCTGGCAGCCGGTGGGCGAAAACTTCACCCTGAGCTGTAGGGTCCCGGGAGCCGGACCCCGCGGGAGCCTCACGCTGACCCTACTGCGGGGCGCCCAAGAGCTGATTCGCCGAAGCTTTACGGGGGAGCCGCCCCGAGCGCGGGGCGCGGTGCTCACCGCCACGGTCCTGGCGCGCAGGGAGGACCATGGAGCTAATTTCTCCTGCCGCGCGGAGCTGGACCTGCGGCCGCACGGCCTGGGGCTGTTTGAAAACACCTCGGAGCCCATACAGCTCCGAACCTTCACCCTGTCTCCAGACCCCCCGCGCCTCCTTGGTCCCAGGCTCTTAGAAGTGGGCTCAGAAAGTCCAGTGAGCTGCATCTTGGGCAAACTCTTTCCCGCCCCAGAGGCTGAGGTTTACCTCGCGCTGGGAGATCAGAGGCTGAATCCTGATGTCACTCTCGAGGGGGACACCCTCACGGCCACTACCACAGCCACCAGTAGCGCAGAGCAGGAGGGTGCCAGGCAGCTGGTCTGCAACGTGACCCTAGGGGGCGAAAGCCGCGAGGTCCAGGAAAACGTTACAGTCTACAGTTTCCCCGCGCCGCTCCTGACCCTGAGCAAGCCCAGCGCGCCTGAGGGGCAGATGGTGACAGTAACTTGCACAGCTGGGACTCAAGCTCTGGTCACCCTGGAGGGAATTCCAGCTGCAGCTCCGGGACAACCTGTCCAGCTCCAGCTCAATGCGACCGAGAACGACGACGGGCGCGACTTCGTCTGCTATGCCACCCTCGAGGTGGATGGGGAGACGCTTAGCAAGAACGACAGCACTGAGCTGCGCGTGCTCTACGCCCCCCGGCTAGACGACTCTGATTGTCCCAGGAGTTGGACGTGGCCCGAGGGCCCGGAGCAGACGCTGCGCTGCGACGCCCGCGGGAACCCGGAGCCCTCGGTGCACTGCGCACGGCCGGACAGCGGGGCGGTGCTGGCGCTGGGCCGGCCGGGCCCAGTGACACGCGCGCTGGCGGGCACCTACCGCTGCAGGGCCGCCAGTACGCAGGGCACGGCCGTCAAGGACGTGACGCTGACCGTGGAGTATGCGCCGGCGCTGGACATTGTGGGGTGCCCGGATCGCATTACTTGGGTGGAGGGAACCGAGGCATCGCTGAGCTGCGTGGCACATGGGGTCCCTGCCCCCGACGTGAGCTGCATGCGCTCTGGTGAGGCTGACGCAGTGGAGGGGCTGCTGCGTGTGGCCCGGGAGCACGCGGGCACCTACCACTGCGAGGCCACCAACACTCGAGGCTCTGTGGCCAAAACTGTAGCCATCACCGTGGAGTATGGCCCCAGTTTTGAGGAGCGGGGCTGCCCCAGCAACTGGACATGGGTGGAAGGATCCGGATCTCTGTTCTCCTGTGAGGTGGATGGGAAGCCACAGCCCAGCGTGGAGTGCGCAGGCTCCGAGGACGCCAACAAGGGGGTGGTGTTGCCGCTGGTCTTCTCCAAACCCAGCGCCCGAGGCCCCTCTCTCCCTAGTGACCTGCCACCCGGGGTCTACGTCTGCAACGCCACCAACCCCCACGGCTCTTCGGTCAAAACCGTGGTCGTGAGCGCGGAGTCACCGCCTCACATGGACGAGACCACCTGCCCCAGTCACCAGACGTGGCTGGAAGGGGCTCGAGATGCGGCGCTAGCCTGTGCCGCCCGGGGCCGCCCATCCCCACGCGTGCGCTGCCTGCGTGAGGGTGCACCCCAACCCGAGCGGCCGAGAGTGTCCCGGGAGGACGCAGGGATCTACCGCTGTGAGGCCACCAATGCCCATGGCATGGACTCCCGGACCATCACTGTGGGTGTGGAATACCGGCCAGTGGTGGCTGAGCTGGCTGCCTCGCCCCCTAGCGTGAGGCCTGGCGGGAATTTCACCCTGACCTGCCGCGCTGAGGCATGGCCTCCAGCGCAGATCAGCTGGCGCGCGCCCCCCGGGGCTTCCAACATCGGCCTGTCCAGCAACAATAGCACGCTGAGTGTGGCGGGAGCCCTGGGCAGCCACGGCGGCGAGTATGAATGCTCAGCCACCAACGCACATGGACGTCATGCACGGCGCATCATGGTGCGTGTGGCTGGTCCCTGGCTGTGGGTCGCCGTGGGCGGCGCGGCGGGGGGCGCGGCGCTGCTGGCCGCGGGAGCGGGCCTGGCCCTGTACGTGCGCTCCACTGCGTGCAAGAAGGGCGAGTACAACGTGCAGGAGGCCGAGAGCTCCGGTGAGGCCGTGTGTCTCAATGGCGCGGGCGGCGCGGCCAGCGGCAACGAGGAGGCGGGGGACACAGCCGCTGAGTCCCCGGCAGGGGGTGAGGTCTTCGCCATCCAGCTGACATCTGCGTGA

XM_004865487.1 Coding sequence

Fdx1l ferredoxin 1-like

High confidence: 4 potential gene matches
Length: 528 bp    Location: 2473600..2468759   Strand: -
>XM_004865487.1
ATGGCCGCCTCCACGGCCCGGGGCGGCGTGACTGTCAGGCTCCTGTTGCGAGCTGCCAGGGCCTCCTGGTGGAGTAGGACTGGGGAGGCAGCGTTGCTGACAACCAGGAAATTTCGGACGACAGGCAGGCGCCTGGCAGAAGGGGACATCGGCGGCCCTGAGCGGCCCGGGGACGTGGTGAACGTGGTGTTCGTAGACCGGTCAGGCCAGCGCATCCCGGTGAGCGGCAGAGTTGGGGACAATGTCCTCCATCTGGCCCAGCGCCACGGTGTGGACCTGGAAGGGGCCTGCGAAGCCTCCCTAGCATGCTCCACTTGCCATGTGTACGTGAGTGAGGCCCACCTGGATCTCCTGCCTACCCCTGAGGAGCGGGAGGATGACATGCTGGACATGGCACCCCTGCTCCAGGAGAACTCCCGCCTGGGCTGCCAGATTGTGCTGACCCGTGAGCTGGAAGGGGTGGAGTTCACCCTGCCCAAGATCACCAGGAACTTCTACGTGGATGGCCACATCCCCAAGCCCCACTGA

XM_004865488.1 Coding sequence

Icam3 intercellular adhesion molecule 3

Length: 633 bp    Location: 2496728..2495673   Strand: -
>XM_004865488.1
ATGAAACTGTCCCTGTTGGCTACCTGCTTACATCCATCCTTTTCCCCAGCCCTGCCCATGACTGCCCCGTACCTGGAGGCCCCCAGGTCCTTGGAGGTGGGCACGTGGAGGCCGGTGCATTGTGTTCTAGATGGGGTCTTCCCGGCCTCCGAGGCCCAGGTGCACCTGGCACTGGGGAACCAGACGCTGAATCCTACAGTCACGAGGGACGGTGACACACTCAAGGCCACCGCCATAGTGCACGTGGACCAAGAGGGGACCCAGAAGATTGCGTGCAACGTGACTTTGGCGGGAGTGAGTCGCTATGCACAGAACTTGACCACGGTCTTCAGTTTCCCAGGGCCCATTCTGAGCCTAAGCAGGACCAACATCCCCAAGGGGTCCACAGTGAATGTGACCTGCAAGGCCGGACCCCGAGCCCAGGTCATACTGGATGGGGTTCTGGCCCCATCTCCGGGAGAGCCCGCCCAGCTTCAGCTGATTGCCACTGACAGCGACAACGGACGCCACTTCATCTGCAATGCCACCCTCGTGGTCGCCGGAGAGCTCATATGTAGGAGCACGGCTGCCCAGCTGCGTGTCCTAGGTGAGCTGGTCACTCAGGCCTTTAAAACCTTCACTGCCTTGCCTTGA

XM_004865490.1 Coding sequence

Tyk2 tyrosine kinase 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 3555 bp    Location: 2518767..2499929   Strand: -
>XM_004865490.1
ATGCCCCTGTGTCATCGAGGAGGCTCTGAGAAGGGCAGCCAGCCTGCCAGGGATGAAGTGCAGCCCTTGGCCACCACGGGAGGCCTGCAGGTCCTTCTGCACTGGGCTGGCTCCAGTGGTGGGCAGCCCTGGGTCACCTTCGGTGAGGTCTCGCTGACGGCTGAGGAGATCTGCATCCGGGTCGCACACAGAATCGGCATCACACCAGCCTGCTTTAATCTCTTTGCTCTCTTTGATGCTGAGGCCCAAGTGTGGCTGCCCCCAAACCACATTCTGGAAGTTTCTGCAGACACAAGACAGACGCTGTATTTCCGCATGAGGTTTTACTTCCGGAACTGGCATGGCATGAATCCGCAGGAGCCACCTGTGTACCGCTGTGGACTCCCAGGGGCTGAGGCATCCTCAGAACAAGCAGAACAAGGGGTACAAGTCTTAGATCCAGCCTCTTTTGAGTACCTCTTTGAGCAGGGCAAGTATGAGTTTGTGAATGATGTGGTGTCGCTGCGGGAGCTGTCAAGTGAGGAGGAGATCCACCACTTTAAGAATGAGAGTCTAGGCATGGCCTTTCTGCACCTCTGCCACCTCGCTCTCTGCCGCAGTGTCCCCCTGGAGGAGGTGGCCAAGGAGATCAGCTTCACGCGCTGCATCCCGCGCTCCTTCCGGCAGCAGATCCGCCAGTACAATATGCTGACCCGGCTGCGCCTTCGGAGTGTCTTCCGACGCTTCCTGCATGCCTTCCAGCCAAACCACCTGTCCCAGCAGGTTGTCATGGTCAAGTACCTTGCCACCCTGGAGCATCTGGCACCCCGCTTTGGTGCCGAATGCATCCCTGTGCATCACCTGGAGCTCCTATTCCAGGCCGACAGGGAGCCCTGCTATATCCGGGACAGTGGGCAGCCCCCAGAAGCTGACCCCATGTCGGCCCCTGGACCCCCCACCCATGAGGTGCTGGTCACGGGTACCAGGGGCATCCAGTGGCGCCCGGTACAGCCAGAGAGTTCCAGTGCCAATGGCAGTGACAGCTGGAATCCGAAAGCCAGGCTGCCTGGGAAAAAGGCCAGTGCCCATGAGGAGGCAGGCAAGCAGCCAGTGGACAAGCCACAGGAGCCCTCTTGGACCTACTTCTGTGACTTCCAGGACATCACCCATGTGGTCCTGAAGGAATGTCGCATCAGCATCCACCGGCAGGACAATAAGTGCCTGGAGCTGAGCCTGTCCTCCCCGGCTGCTGCCCTGTCCTTTGCGGCGCTGGTGGACGGCTACTTCCGCCTGACTACCGACTCCAGCCACTACCTGTGCCATGAGGTGGCTCCTCCGAGGCTGGTCCTGAGCATCCAGGACGGCATCCACGGACCCCTGCTGGAGCCGTTTGTGCGGGCCAAGCTGCAGCTGGAAGAGGGCGTCTACCTCATCCACTGGAGCACCAGCCACCTTGAGCGCCTCATCCTCACGGTGGGCCAGCGTGACCCGACCCCTGGCGGCAGTGGTGTGCAGAGTGTGCGCCTCCGCAAGTTCCCCATTGAGCGGCAAGCCGGGGGCTTTGTGCTGGAGGGCTGGGGCCGCTCCTTCGCCAGCGTGCGGGACCTGCGGATGGCCCTGCAGGGCTGCTCTCTGCGGGCTGGGGACGACTGCTTCTCCCTGCGCCAGTGCTGCCTGCCCCAGCCAGGAGAGATCTCCAACCTCATCATCATTCGGGGGCCTCGGGCCAGCACCCGGCAGCTCAACCTCAGCCAGCTCAGCTTCCACAGGGTACAGCAGGATGACATCACCCAGCTGTCACACTTGGGCCAGGGCACAAGGACCAACGTGTATGAGGGTCTGCTGCGAGTGGGGACGCCCGAGGAGGACAAAGAGGACAGCATGGGCCCTGTGGAGCCCAGTGGGGGCTGTGGGCAGGAGCTGCGTGTGGTGCTGAAGGTGCTGGACCCAGGTCACCACGACATCACGCTGGCCTTCTACGAGACAGCCAGCCTCATGAGCCAGGTGTCCCATGCACACCTGGCCTTCCTGCATGGCGTATGCGTGCGCGGCTCCGAGAACGTCATGGTGACGGAGTTCGTGGAGCATGGGCCCCTGGACGTGTGGCTGCGGCGGGAGCGGGGCTGTGTGCCCCTGGCCTGGAAGCTGGTGGTGGCCCAGCAGCTGGCCAGTGCCCTCAGCTACCTGGAGGACAAGAACCTGGTGCACGGGAATGTGTGTGGCCGGAACATCCTCCTGGCCCGGCTGGGGCTGGCAGATGGCACCAGCCCATTCATCAAGCTCAGCGACCCAGGCGTGGGGCTGGCCGCCCTCTCCAGGGAGGAGCGGGTGGAACGCATCCCCTGGACTGCGCCCGAGTCCCTGCTTGCTGGGGCCAGCAGCCTGAGCACAACCACAGACAAGTGGGGCTTCGGTGCCACCCTGCTGGAGATCTGCTTCAACGGCGAGGTGCCCCTGCAGGGCCACACCCCCTCCGAGAAAGAGCGCTTCTACCAGAAGCAGCATCAGCTGCCCAAGCCTTTGTGCCCAGAGCTGGCCTCAATCACCAGCCAGTGCCTGAGCTACGAGCAGGCCCAGCGGCCATCCTTCCGCACCATCCTGCGCGACCTCACTCGGCTGCAGCCCCACAGTCTAGTAGATGTCTCAGCTCTGAACCCCGACTCACCTGCGTCAGACCCCACCGTTTTTCATAAGCGCTATTTGAGAAAGATCCGAGATTTGGGAGAGGGTCACTTTGGCAAGGTCAGCCTGTACTGCTACGACCCAAACAACGATGGCACTGGCGAGATGGTGGCAGTGAAATCCCTCAAGGCGGGCGGCGGGCCCCAGCTCAGCTCGGGCTGGAGGCGGGAGATCGACATCCTTCGCACTCTGTACCACGAGCACATTGTCAAGTACAAGGGCTGCTGTGAGGACCAAGGAGAGAAGTCGGTGCAGCTCGTCATGGAGTACGTGCCGCTGGGCAGCCTCCGGGACTACCTGCCCCGGCACAGCGTCGGCCTTGCCCAGCTGCTGCTGTTCGCCCAGCAGATCTGCGAGGGCATGGCCTACCTGCATGGGCAGCACTACATCCACAGAGACCTGGCGGCGCGCAACGTGCTGCTGGACAACGACAGGCTGGTGAAGATCGGGGATTTTGGCCTTGCCAAGGCCGTGCCTGAAGGCCACGAGTACTACCGCGTGCGCGAGGACGGGGACAGTCCCGTGTTCTGGTACGCCCCCGAGTGCCTCCAGGAGTGTAAGTTTTACTACGCGTCGGACGTCTGGTCCTTCGGGGTCACACTCTATGAGCTGCTGACGCACTGTGACTCCAGCCAGAGCCCCCCCTCGAAATTCATGGAGCTCATAGGCATCACCCAGGGCCAGATGACTGTGCTGAGGCTCACAGAGTTGCTGGCGCGAGGGGAGAGGCTGCCGTGGCCAGACAGATGTCCCCGGGAGATCTACCTCCTCATGAAGAACTGCTGGGAGGCCGAGGCCTCGTTCCGTCCCACCTTCCAGAACCTTGTCCCCATCCTCAAGTCGGAGCAAGAGAAATACCAAGGCCAGGCCCCCTCGTTGTTCAGTGTGTGCTGA

XM_004865493.1 Coding sequence

Cdc37 cell division cycle 37, transcript variant X1

Length: 1545 bp    Location: 2533488..2523761   Strand: -
>XM_004865493.1
ATGGTGGATTACAGCGTGTGGGACCACATCGAGGTGTCTGACGATGAGGACGAGACGCACCCCAACATCGACACGGCCAGCCTCTTCCGCTGGCGGCACCAGGCCCGCGTGGAGCGCATGGAGCAGTTCCAGAAGGAGAAGGAGGAGCTGGACAGGGGCTGCCGCGAGTGCAAGCGCAAGGTGGCTGAGTGCCAGCGCAAGCTGAAGGACCTGGAGGTGGCCGAGGGCGGCCAGGCAGAGCGGGAGCGGCTGCAGGCCGAGGCGCAGCAGCTTCGCAAGGAGGAACGGAGCTGGGAGCAGAAGCTGGAGGAGATCCGCAAGAAGGAGAAGAGCATGCCCTGGAACGTGGACACGCTCAGCAAGGACGGCTTCAGCAAGAGCATGGTCAATACCAAGCCTGAGAAGGCGGAGGAGGAGTCGGAGGAGGTCAGGGAGCAGAAACATAAAACCTTTGTGGAGAAGTATGAGAAGCAGATCAAGCACTTCGGGATGCTCCGCCGCTGGGATGACAGCCAGAAGTACCTGTCTGACAACGTGTACCTGGTGTGTGAGGAGACCGCCAACTACCTGGTGATCTGGTGCATCGACTTGGAGGTGGAGGAGAAATGTGCGCTCATGGAGCAGGTGGCCCACCAGACCATCGTCATGCAGTTCATTCTGGAGCTGGCCAAGAGCCTCAAGGTGGACCCCCGTGCCTGCTTCCGGCAGTTCTTCACGAAGATTAAGGTATCGGACTCACTGCTGCGTCAAGACAGCTTGGGTGTGGAGGACGGAGACCTGTCAGACGGCAGCCACAGTTTTGAGCTTGAAGACAGGAGAAGCCTGTGTGGGGAGTGGGGGTGGGTTAAGGAGGCCTATAGGGTTTCTGAGCTGGGAACACAGAGTAATGGAGCTCCCCTTCCTGAGACTGAGGAGACCGGGCAAGCTGGGCAGGAGGGAGTCGGAGCTCCCTGTAACCAGGCTGCGTCTGAGGACATCACGGACATGGTGGCGTGGTCTGTGGTCTTTAGTGGCAGACAAGGAGGTCTCAGGCGAGAGAGACGAGGAGAAGAGAGGTCAGGTTCTGGGGTGCCCGTGGTGCAGTTCCCATGCAGACGTGGGGCCCTTGTCCTGTGTGCGCCCCACTCCCTGCAGACGGCTGACCGCCAGTACATGGAGGGCTTCAACGACGAATTGGACGCCTTCAAGGAGCGCGTGCGTGGCCGTGCCAAGCTTCGCATTGAGAAGGCCATGAAGGAGTATGAGGAAGAGGAGCGCAAGAAGCGGCTGGGCCCTGGTGGCCTGGACCCAGTTGAGGTCTACGAGTCCCTGCCCGAGGAGCTGCAGAAGTGCTTCGATGTGAAGGACGTGCAGATGCTGCAGGACGCCATCAGTAAGATGGACCCCGCCGATGCTAAGTACCACATGCAGCGGTGCATCGACTCGGGGCTCTGGGTCCCCAACTCCAAGGCCAGCGAGCCCAAGGAGGGGGAGGAGGCGGGCCCCGGGGATCCATTGCTGGAAGCTGCAACCAAGCCAGGCGATGAGGAGGATGGCAGTGCCTGA

XM_004865495.1 Coding sequence

Pde4a phosphodiesterase 4A, cAMP-specific, transcript variant X1

Length: 2742 bp    Location: 2540331..2574706   Strand: +
>XM_004865495.1
ATGTGGAGCCTAGGAAGACGTCCTAAAAATGTGATGTACATGTTAGAGGGAACTTGGATGATGGAAGGTAGAGATGTTAGGCCCCAGAACTCAGGGTTGGAAATCAAGAGGGGGCCCCCCCAGACCCAAGGGGTGGGAAGGTGCCCTCAAGGGGTGGCTCACACGTGTCGGGGATACAGGGACTATACCCTATACCCCCATCAGCTAGCTACTCCCTCTGGTGGATATGGGTGGGGGTGTTCCTGGCGGAGGGGTTCAGTCTTTGTAGGCCAGGCCAGGCCACGCCCCATCCCGCCCGTGTCTCTCCGCAGAGGCCCCAGGAGACTCTGGAGGCCCCGCCCCAACATGCTGGGGGCAGACTCCCATCGCCCTAGCCGCTGTCTCTCATCCCGTCCCCGCCTGGGCTGGGCCCATCCTGAGCCCTTGGACCCTTGTGTCCCTCTGGCACCACGGCCCACCACACTGCCACTGCTGATCCCGCCGCGGATTTCCATCACCAGGGCAGAGGCCCACAGCTTCGAGGCGGAAAATGGGCCGACGCCATCCCCCGGCCGCAGCCCCCTGGACTCGCAGGCGAGCCCAGGCCTTGTGCTGCATGCTGGAGCAGCCACCAGCCAGCGCCGGGAGTCCTTTCTCTACCGCTCCGACAGCGACTATGACATGTCACCCAAGACCATGTCCCGCAACTCCTCGGTCGCCAGCGAGGCGCATGCGGAGGACCTCATTGTAACGCCCTTTGCCCAGGTGCTGGCCAGTCTCCGAAGTGTCCGAAGCAACTTCTCACTCCTGACCAATGTGCCCATTCCTAGCCACAAGCGGTCCCCGCTGGGAGGCCCCACCCCCGTCTGCAAGGCCACACTATCAGAGGAGACATGTCAGCAGCTGGCCCGGGAGACTTTGGAGGAGCTGGACTGGTGCCTGGAGCAGCTGGAGACCATGCAGACCTACCGCTCTGTCAGCGAGATGGCCTCGCATAAGTTCAAGAGGATGCTGAACCGCGAGCTCACACACCTGTCAGAAATGAGCAGGTCGGGAAACCAGGTCTCAGAGTACATTTCCACGACATTCCTGGACAAACAGAATGAAGTGGAGATCCCATCACCCACGATGAAAGATCGAGAGCCCCAGGAAGCGCTGCGACAGAGACCCTCCCAGCAGCTCCCGCCCCCGGTGCCACACCTGCAGCCCATGTCGCAGATCACCGGGGTGAAGAGGCTGTCACACAACAGCAGCCTGAACAACACCAGCATCCCCCGCTTTGGGGTGAAGACGGATCAGGAGGAGCTCCTGGCCCAAGAACTGGAGAACTTAAGCAAGTGGGGCCTGAACATCTTTTGCGTGTCCGATTATGCTGGAGGTCGCTCGCTGAGCTGTATCATGTACACGATATTCCAGGAGCGGGACTTGTTGAAGAAATTCCGAATCCCCTTGGACACGATGGTGACATACATGCGGACGCTGGAAGACCACTACCACGCCGATGTGGCCTACCACAACAGCCTGCACGCCGCCGACGTGTTGCAGTCCACCCACGTGCTGCTGGCCACGCCTGCCCTGGACGCGGTGTTCACAGACCTGGAGATTCTCGCAGCCCTCTTCGCAGCTGCCATTCATGATGTGGACCACCCTGGGGTCTCCAACCAGTTCCTCATCAACACAAACTCAGAGCTGGCGCTCATGTATAACGATGAGTCGGTGCTAGAGAACCACCACTTGGCTGTGGGCTTCAAGCTGCTCCAGGAAGAGAACTGTGACATCTTCCAGAACCTCGGCAAGCGCCAGCGGCAGAGCCTGCGCAAGATGGTCATCGACATGGTGCTGGCCACGGACATGTCCAAGCACATGACCCTCCTAGCTGATCTGAAGACCATGGTGGAAACTAAGAAAGTGACAAGCTCCGGAGTTCTCTTGCTGGACAACTACGCCGACCGCATCCAGGTCCTTCGGAACATGGTGCACTGCGCAGACCTCAGCAACCCCACCAAGCCACTGGAGCTGTACCGCCAGTGGACAGACCGCATCATGGCCGAGTTCTTCCAGCAGGGGGACCGAGAACGTGATCGGGGCATGGAGATCAGTCCCATGTGTGACAAGCACACAGCCTCCGTGGAGAAGTCGCAGGTGGGTTTCATCGACTACATCGTGCACCCGCTGTGGGAGACATGGGCAGACCTGGTGCACCCAGATGCGCAGGACATCCTGGACACGCTGGAAGACAACCGGGACTGGTACTACAGCGCCATCCGGCAGAGCCCATCGCCGCCGCCCGAGGAGGAGCCCGGTGAACCAGGCCACCCCGCCCCACCCGATAAGTTCCAGTTTGAGCTGACGCTGGAGGAGGAAGAGGAAGAGGAGGCAGCGCCAGCCCAGGATTTGTTGGAAGCTCGGGGATCATCCACGTCCGAGGAGCCAGCCAAGATCAAGGGCCAGGAGGCTGAGACAGGGCATTTGTCGCGGGGTTTGGGCTTGACGTGTGTTGCCCCTGCAGCGCAGGAGTCCATGGACGCGGGAAGCTGCGACCTGACCCTTGAAAGCCCCCTTCTGCCTGCCTTGAGGACCCAGTTCACGCCAGAGGAATCCCCGGGGCTCCTGGGCCTCCCCTCCACGGCGGCCGAGGTGGGGGCCCGAAGAGACCATCAGGCTGCCGAGAGGGCTTGCCGCGCATGTGCAGGGACGTCCGAGGAGGACCCAGCCTTGCTCCCGGTTCCGGGTGGGTGGGAGCCAGGTGTGGACCCTCCCTGA

XM_004865527.1 Coding sequence

Qtrt1 queuine tRNA-ribosyltransferase 1, transcript variant X1

Length: 1518 bp    Location: 2719813..2724520   Strand: +
>XM_004865527.1
ATGGCGGCAGGGGCTGCTGTGCCGACTTCTCTGGAGTCCGCCCCGCGGATCATGCGGCTGGTCGCCGAGTGCAGTCGCTCCAGGGCCCGCGCGGGCGAACTGCGGCTGCCGCATGGACCGGTGGCCACTCCCGTGTTCATGCCAGTGGGCACGCAGGCCACCATGAAGGGGATCACAACCGAGCAGCTGGACGCCCTGGGCTGCCGCATCTGTTTGGGAAACACCTACCACCTGGGGCTTAGGCCGGGCCCTGAGCTGATCCAGAAAGCCAACGGTCTCCATGGCTTCATGAACTGGCCTCACAACCTGCTGACGGACAGTGGCGGCTTCCAGATGGTGTCCCTGGTGGCTCTGTCTGAGGTGACGGAGGAGGGTGTCCGATTCCGGTCCCCTTACGATGGTGAAGAGACCCTTCTGAGCCCGGAGAGGTCCGTGGAGATCCAGAACTCCCTGGGCTCAGACATCATCATGCAGCTGGATGACGTGGTCAGCAGCACTGTGACTGGCCCGCGTGTGGAAGAGGCCATGCACAGGTCCGTCCGCTGGCTGGACAGGTGCATTGCAGCCCATCGGCAGCCCGACAAGCAGAACCTCTTCGCCATCATCCAGGGCGGGCTAGATGCGGACCTCCGGGCCACTTGCCTTGAAGGTGGGACCATCTGTGACCTAGAGATGACCAAGAGGGATGTGCCAGGCTTCGCCATCGGTGGCCTGAGCGGTGGTGAGAGCAAGGTGCAGTTCTGGAAGATGGTGGCGCTCAGCACGTCTAAGCTGCCGAAGGACAAGCCCCGCTACCTGATGGGGGTCGGGTATGTTGAGGGAAGAAGACCCTGCTTATGGGGAGCAGATTTCTGGGCACCCCTTACCCTGCATGGGGGTGTGTATGGGGGGCAAGGACACAGCCTTGCTGTAGGGGAACCGAGGAGGACACGGCTGTCTCAAGGTTGCCAGGGAGGGCACCTAGGAAGCCCACCCCAGAGCTTCAGCCTCTCTGCTGCCCTCCCCCACACCTGTACCCCCAGCTATGCCACTGATCTGGTGGTCTGCGTGGCTCTTGGATGCGACATGTTCGACTGTGTGTACCCCACACGAACTGCGCGTTTTGGCTCTGCCCTGGTGCCTACTGGGCAGCTGCAGTTGAAGAAAAAGCAGTATGAGAAGGACTTTGGCCCCATAGACCCAGAGTGCTCCTGCCCCACTTGCAAGAGGCACAGCAGGGCCTTCCTGCACACCCTGCTGCACAGCGACAACACGGCCGCCTTGCACCACCTCACTGTGCATAACATTGCCTACCAGGTGGGCAGGTACAGGTCGGGGGGGAGGTCCCCGGCGCCTGGCACCAATGCTGACCTTGGGCCCCTGCAGCTGCAGCTGATGAGCGCCATCCGAGCCAGCATCGTGGAGAAGCGCTTCCCTGACTTCGTGTGCAGCTTCATGAACACCATGTATGGGGACCAGACCCTCTGTCCCCCTTGGGCCACCGAAGCCCTGGCCTCTGTGGGCATCACACTGAGCTGA

XM_004865532.1 Coding sequence

Dnm2 dynamin 2, transcript variant X1

Length: 2607 bp    Location: 2727111..2804576   Strand: +
>XM_004865532.1
ATGGGCAACCGCGGGATGGAAGAGCTGATTCCGCTGGTCAACAAGCTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCCGTGGTGGGCGGCCAGAGCGCCGGCAAGAGCTCGGTGCTCGAGAATTTCGTGGGCCGGGACTTCCTTCCCCGAGGTTCAGGAATTGTCACCAGGCGGCCTCTCATTCTGCAGCTCATCTTCTCAAAAACAGAATATGCCGAGTTTCTGCACTGCAAGTCCAAAAAGTTTACAGACTTTGATGAAGTCCGGCAGGAGATCGAAGCGGAGACAGACCGAGTCACGGGGACCAACAAAGGCATCTCCCCAGTGCCCATCAACCTGCGGGTCTACTCGCCACATGTGCTGAACTTGACCCTCATTGACCTCCCGGGCATCACCAAGGTGCCCGTGGGGGACCAGCCCCCAGACATCGAGTACCAGATCAAGGACATGATCCTGCAGTTCATCAGCCGGGAGAGCAGCCTGATCCTGGCTGTGACGCCCGCCAACATGGACTTGGCCAACTCCGACGCCCTCAAGCTGGCCAAGGAGGTCGACCCCCAAGGCCTGCGGACCATCGGCGTCATCACCAAGCTCGACCTGATGGACGAGGGCACCGATGCCAGGGACGTCCTGGAGAACAAGCTGCTGCCCTTGCGGAGAGGCTATATCGGCGTGGTGAACCGCAGTCAGAAGGACATTGAGGGGAAGAAGGACATCCGTGCGGCGCTGGCGGCCGAGAGGAAGTTCTTCCTCTCCCACCCTGCGTACCGGCACATGGCCGACCGCATGGGCACCCCACATTTGCAGAAGACCCTGAATCAGCAACTGACCAACCACATCCGGGAGTCATTGCCCAACCTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAGTACAAGAACTTCCGGCCCGACGACCCCACGCGCAAAACCAAAGCCCTGCTGCAGATGGTCCAGCAATTTGGGGTAGACTTTGAGAAGAGGATTGAGGGCTCTGGAGACCAAGTGGACACGCTGGAGCTCTCGGGGGGCGCCCGTATCAACCGCATCTTCCACGAGCGCTTTCCCTTCGAGCTGGTGAAGATGGAGTTTGATGAGAAGGACTTAAGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGAGTCAGGACTGGGCTTTTCACCCCGGACTTGGCGTTCGAGGCCATTGTGAAAAAGCAGGTGGTGAAGCTGAAAGAGCCCTGTCTGAAATGTGTGGACCTGGTTATCCAGGAGCTAATCAATACAGTTAGGCAGTGTACCAGTAAGCTCTGCTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACATACATCCGGGAGCGAGAGGGGAGGACCAAGGACCAGATTCTTCTTCTGATCGACATCGAGCAGTCCTACATCAACACAAACCACGAAGATTTCATTGGATTTGCCAACGCCCAGCAGAGGAGCACGCAGCTGAATAAGAAGAGAGCCATCCCCAACCAGGGGGAGATCTTGGTGATCCGAAGGGGCTGGCTGACCATCAACAACATCAGCCTCATGAAGGGCGGCTCCAAGGAATACTGGTTTGTGCTCACGGCCGAGTCGCTGTCCTGGTACAAGGATGAAGAGGAGAAAGAGAAGAAGTACATGCTGCCCCTGGACAACCTCAAGATCCGGGACGTCGAGAAGGGCTTCATGTCCAACAAGCATGTGTTCGCTATCTTCAATACAGAGCAGAGGAACGTCTACAAGGACCTGCGGCAGATCGAGCTGGCCTGTGACTCCCAGGAGGACGTGGACAGCTGGAAAGCGTCATTCCTGCGCGCCGGCGTCTACCCTGAGAAGGACCAGGCGGAGAACGAGGACGTGGGGCAGGACACCTTCTCCATGGACCCACAGCTGGAGCGGCAGGTGGAGACCATCCGCAACCTGGTGGACTCATACGTGGCCATCATTAACAAGTCCATCCGCGACCTCATGCCAAAGACCATCATGCACCTCATGATCAACAACACCAAGGCCTTCATCCACCATGAGCTGCTGGCCTACCTGTACTCGTCGGCTGACCAGAGCAGCCTCATGGAGGAGTCGGCTGACCAGGCACAGCGGCGGGATGACATGCTGCGCATGTATCACGCGCTCAAGGAGGCGCTCACCATCATCGGTGACATCAGCACCAGCACTGTGTCCACGCCCGTGCCCCCGCCTGTCGACGACACCTGGCTACAGACCACTGCCAGCCACAGCCCCACCCCACAGCGTCGACCTCTGTCCAGTGTGCACCCGCCTGGCCGGCCACCAGCAGTGCGGGGCCCCACTCCTGGGCCCCCCCTGATTCCCATGCCCGTGGGGGCTGCAGCCTCCTTCTCGGCGCCCCCCATCCCGTCCCGGCCTGGACCCCAAGTGTTTGCCAACAATGACCCCTTCTCAGCCCCGCCGCAGATCCCATCTCGGCCAGTGCGGGTACCTCCTGGCATCCCCCCAGGAGTCCCCAGCAGAAGACCCCCTGCCGCGCCCAGCCGGCCCACCATTATCCGGCCCACCGAGCCCTCGCTGCTCGACTAG

XM_004865350.1 Coding sequence

Pet100 PET100 homolog (S. cerevisiae), transcript variant X2

Length: 222 bp    Location: 712163..713801   Strand: +
>XM_004865350.1
ATGGGGGTGAAGCTGGAGGTGTTTCGGATGATTGTGTACCTCACTTTCCCTGTGGCTATGTTCTGGATCTCCAATCAGGCCGAGTGGTTTGAGAGTTCTGTCATACAGCGCAAGAGAGAGCTATGGCCACCTGAGAAAGAGGACCAGCTGGAAGAATTCCGAGAGAAAATCCGGAAGCAGCGGGAGGAGAGACTCTTTCGAGCTGCCCAGCAGAGCTCCTGA

XM_004865349.1 Coding sequence

Pet100 PET100 homolog (S. cerevisiae), transcript variant X1

Length: 231 bp    Location: 712170..713801   Strand: +
>XM_004865349.1
ATGGGGGTGAAGCTGGAGGTGTTTCGGATGATTGTGTACCTCACTTTCCCTGTGGCTATGTTCTGGATCTCCAATCAGGCCGAGTGGTTTGAGAGTTCTGTCATACAGCGCAAGAGAGAGCTATGGCCACCTGAGAAAGAGGACCAGCGCCAAGAGCTGGAAGAATTCCGAGAGAAAATCCGGAAGCAGCGGGAGGAGAGACTCTTTCGAGCTGCCCAGCAGAGCTCCTGA

XM_004865782.1 Coding sequence

Gng7 guanine nucleotide binding protein (G protein), gamma 7

High confidence: 4 potential gene matches
Length: 207 bp    Location: 5803067..5685915   Strand: -
>XM_004865782.1
ATGTCAGCCACTAACAATGTAGCGCAGGCCCGGAAGCTCGTGGAGCAGCTACGGATCGAAGCCGGAATCGAGCGCATCAAGGTGTCCAAAGCTTCATCGGAGCTCATGAGCTACTGCGAGCAGCACGCAAGGAGCGACCCCTTGCTGGTTGGAGTCCCTGCCTCCGAGAACCCCTTCAAGGACAAGAAGCCGTGTATTATTCTATAG

XM_004865589.1 Coding sequence

Prkcsh protein kinase C substrate 80K-H, transcript variant X4

High confidence: 4 potential gene matches
Length: 1581 bp    Location: 3219219..3227369   Strand: +
>XM_004865589.1
ATGTTGCTGTTGATGCTGCTGATGCTGCCCCTCTGCTGGTCCGTGGAGGTCAAGAGGCCCCGGGGCGTCTCCCTCACTAACCATCACTTCTATGACAAATCCAAGCCTTTCACCTGCCTGGACGGCTCGGCCACAATCCCTTTTGATCAAGTCAACGATGACTACTGTGATTGCAAGGATGGTTCAGATGAGCCGGGCACAGCCGCCTGTCCTAATGGCAACTTCCACTGCACCAACACGGGCTACAAGCCCCTGTATATCCCCTCCAGCCGCGTCAATGATGGCATCTGTGACTGCTGCGATGGGACCGATGAGTACAACAGTGGCACTGTCTGCGAGAACACCTGCAAAGAGAAGGGCCTCAAAGAGAGAGAGTCCCTGCAGCAGATGGCAGAGGTCACCCGCGAGGGGTTCCGCCTGAAGAAGATCCTCGTTGAGGACTGGAAGAAGGCCCGGGAGGAGAAGCAGAAAAAGCTCACCGAGCTACAGGCTGGAAAGAAGTCTCTGGAAGACCAGGTGGAGGCCCTGCGGGCTTTGAAGGAAGAGGCTGAGAAGCCGGAGAAGGAGGCCAAGGAGCAGCACCAGAGGCTGTGGGAAGAGCAGCAGGCCGCTGTCAAGGCCCAGCGCGAGCAGGAGCAGGCGGCTGATGCCTTCCGGGAGCTGGATGACAACATGGACGGGGTGGTCTCGGTGGCCGAGCTGCAGACCCATCCAGAGCTGGACACAGATGGCGATGGGACTGTGTCTGAAGGGGAGGCCCAGGCCCTGCTCGGCGGGGACACACAGACGGATGCCAGCTCCTTCTACGACCGAGTCTGGGCCAGCATCAGGGACAAGTACCGGTCCGAGGCACTCCCTGCCGACCTCCCAGCACCTCTGGCCCCGGAGGTGATGGAGTCCAAGGAGGAGCAGCCCTCGGTGCCGACCCATCCCACGGAGTACGAGGAAGAGGAGGAGGAGGAAACCGAGGAAGAAGAGGAGGATGAAGAGCAGGATTCTGAGGAGGCCCCGTCCCCACTGGAGCCCTCCCAGCCGCCCAGCCCCAGCGAGGAGGACAAGATGCCACCCTATGATGAGCAGACACAGGCCTTCATTGATGCTGCCCAGGAGGCCCGCAGCAAGTTCGAGGAGGCTGAGCGGTCCCTGAAGGACATGGAGGAGTCCATCAGGAACCTGGAGCAGGAGATTTCCTTCGACTTTGGCCCCCAAGGGGAGTTCGCCTACCTGTACAGCCAGTGCTACGAGCTCAGCACCAATGAATACATCTACCGGCTCTGCCCCTTTAAACTCGTCTCCCAGAAACCGAAGCTGGGCGGCTCCCCCACCAACCTCGGCACGTGGGGCTCGTGGGCCGGGCCCGAGCACGACAGATTCAGCGCCATGAAGTACGAGCAGGGGACCGGCTGCTGGCAGGGCCCCAACCGCTCCACCACCGTGCGCCTGCTGTGCGGGAAGGAGACCGCGGTCACCAGCACCACCGAGCCCAGCCGATGCGAGTACCTCATGGAGCTCTCCACGCCGGCCGCCTGCCCGGAGCCGCCCCCTGAGCTCCCGGTGGACAGCGACCACGATGAGCTGTAG

XM_004865642.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X11

Length: 1548 bp    Location: 3812116..3805151   Strand: -
>XM_004865642.1
ATGGCAGAGAGCGAGAGGAGGGGGCTCGGCTGCTGGAACCCCATAGAGTTAGGGCAGCGGCTTCTTCTGCTGCTGTTGGTGGGCAGCTGTTCGGGGCGTATCCACCGACTGGCGCTGACGGGGGAGAAGCGAGCAGACATCCAACTCAATAGCTTCGGCTTCTACATCAATGGTTCCCTGGAAGTGGAGTTGAGCCTCTTGCGGCTGAGCCCCCAGGAGACAGAAGAGAAGTCGCCGTTGGTGGGGTTCAGCCTGAGCAGGGTTCGATCTGGCAGCATCCGATCCTACTCAGTAAGTGGGGGAGTGAGGAAGTACTGTGGGGGTACTGGGTGGGGCTGTCTCCTGTCTCTGGAGCCTGAAGACCCCTGCTCTTTCCCAGAAGTGGGGGCAGGAACAGATCCTGAGGGAAGGAGGGAGGCAGGGTGGGGCTGGGACCACAGGAAGCCGGAACCCAGGTTCCCTCTGCCCACTCCCAGGCCCAGGATTCCCATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTGCGGGTGCAGAGGCCCTGGAGGAAGGCGGGACAGGGGTACAGCTCAGGGGCCCCCACCCACCGCACCCCGCTCTCCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGTGTTGGTGAACCTGGCCAAGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATGTCTACTTCACACGCATCATCGCCATCCTGCTGCGCGTGGCTGTGCCCTTCCAGTGGCAATGGCTGTACCAGCTCTTAGTGGAGGGCTCCACGCTCGCCTTCTTTGTGCTCACGGGCTACAAGTTCCAGCCCACCAGGGACAACCCGTACCTGCAGCTGCCCCAGGAGGACGAGGAGGACGTACAGATGGAGCAAGTGATGACGGACTCTGGGTTCCGGGAAGGCCTCTCCAAAGTCAACAAAACAGCAAGCGGACGAGAGCAGTTGTGA

XM_004865636.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X5

Length: 2004 bp    Location: 3811213..3805151   Strand: -
>XM_004865636.1
ATGAAGAGGAGGGACAAGGGGCATGGGGACCGACTGTTGAAAAATTCAAACAAGGCATGGGATCTGCCACATAGTAGCTGCTCAATAAGTGTGGGGTTCAGCCTGAGCAGGGTTCGATCTGGCAGCATCCGATCCTACTCAGTAAGTGGGGGAGTGAGGAAGTACTGTGGGGGTACTGGGTGGGGCTGTCTCCTGTCTCTGGAGCCTGAAGACCCCTGCTCTTTCCCAGAAGTGGGGGCAGGAACAGATCCTGAGGGAAGGAGGGAGGCAGGGTGGGGCTGGGACCACAGGAAGCCGGAACCCAGGTTCCCTCTGCCCACTCCCAGGCCCAGGATTCCCATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGGTCCAGGTACGGAAGTATGGGGCACAGGAGAAACTGTTCATCTCTCCCGGGCTCCTCCCTGCCAAACCTGGGCTCCCCAAGGCAGAGCACACTGACACTCCTGAGGTGGACAGCGGAAACTCCACAGCTGGCAAAGCCAAGGCTAAACCTGCAGGGTCTCAGGTTTGGGGAGCTGGGGTGGGCCGGAGAAAGGTATACCCCAAGGGTGTTTGGGTTCCCAAGCCCGGGGCCAGCTGTTGGAAGGGCTCTGCCCCCTCAGGGTCCCGTTGAGAAGAACAAGGACCTGGTGTTGGACCTGGGCCACCTCAATGACTCCTACAACTTCAGTTTCCACGTGGTGATTGGCTCCAGGGCCGAGGAAGGCCAGTACAACCTCAACTTCCACAACTGCTACAACCTGATGCCTGGCCAGGAACGCCCCTTCGACCTCACAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTGCGGGTGCAGAGGCCCTGGAGGAAGGCGGGACAGGGGTACAGCTCAGGGGCCCCCACCCACCGCACCCCGCTCTCCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTGAGGGCCCCGCCCCCGGACGAGGCTCCTCCCAGGGCACTGGGGCGGTCAGTGCTGACCGCACCGTGTGTCCTCTGCCTGTGCCAGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGACTTTCCGCCCCGGGACTGTCTGCCCTGTCTGCCCCGGCCCCTCCGTCCTCCGTGACCCCAGCCCCCTCTGTGCGCCCTCCCCAGTGTTGGTGAACCTGGCCAAGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATGTCTACTTCACACGCATCATCGCCATCCTGCTGCGCGTGGCTGTGCCCTTCCAGTGGCAATGGCTGTACCAGCTCTTAGTGGAGGGCTCCACGCTCGCCTTCTTTGTGCTCACGGGCTACAAGTTCCAGCCCACCAGGGACAACCCGTACCTGCAGCTGCCCCAGGAGGACGAGGAGGACGTACAGATGGAGCAAGTGATGACGGACTCTGGGTTCCGGGAAGGCCTCTCCAAAGTCAACAAAACAGCAAGCGGACGAGAGCAGTTGTGA

XM_004865470.1 Coding sequence

Pin1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1, transcript variant X1

Length: 618 bp    Location: 2121001..2131645   Strand: +
>XM_004865470.1
ATGGCGGACGAGGAGAAGCTACCATCCGGCTGGGAGAAGCGCATGAGCCGCAGCTCAGGCCGCGTGTACTACTTCAACCACATCACCAATGCCAGCCAGTGGGAGCGGCCCAGCGGCACTGGCGGTGGTGGCGGTGGTGGTGGCGGCGGCGGCGGCAATAAAAATGGGCAGGGGGAGCCTGCCAGGGTCCGCTGCTCACACCTGCTCGTCAAGCACAGCCAGTCCCGGCGGCCCTCATCCTGGCGGCAGGAGAAGATCACCCGGACCAAGGAGGAGGCCTTGGAACTGATCAATGTGGTCGTGGTCTGTGAGCTCAGCAGTGGTCACAAAACACACAGACGGAGGGGCGCCCGGACAGTCACAGTTCTGAAGGCCGAAGCCCAAGATCAGGTTCCCGGCTACATCCAGAAGATCAAGTCGGGAGAAGAGGACTTTGAGTCTCTGGCCTCACAGTTCAGCGACTGCAGCTCGGCCAAGGCCAGGGGAGACCTGGGTGCCTTCAGCAGAGGTCAGATGCAGAAGCCATTTGAAGATGCCTCGTTTGCGCTGCGGACAGGGGAGATGAGCGGCCCGGTGTTCACGGACTCAGGCATCCATATCATCCTGCGCACGGAGTGA

XM_004865469.1 Coding sequence

Ubl5 ubiquitin-like 5, transcript variant X2

Length: 222 bp    Location: 2112801..2114392   Strand: +
>XM_004865469.1
ATGATCGAGGTTGTTTGCAACGACCGTTTGGGAAAGAAAGTCCGCGTGAAGTGCAACACCGATGACACCATCGGGGACCTTAAGAAACTGATCGCGGCCCAAACTGGCACCCGTTGGAACAAGATCGTTCTTAAGAAGTGGTACACGATTTTTAAGGACCACGTGTCTTTGGGGGACTATGAAATCCATGATGGGATGAACCTGGAGCTTTATTACCAATAG

XM_004865468.1 Coding sequence

Ubl5 ubiquitin-like 5, transcript variant X1

Length: 222 bp    Location: 2112793..2114392   Strand: +
>XM_004865468.1
ATGATCGAGGTTGTTTGCAACGACCGTTTGGGAAAGAAAGTCCGCGTGAAGTGCAACACCGATGACACCATCGGGGACCTTAAGAAACTGATCGCGGCCCAAACTGGCACCCGTTGGAACAAGATCGTTCTTAAGAAGTGGTACACGATTTTTAAGGACCACGTGTCTTTGGGGGACTATGAAATCCATGATGGGATGAACCTGGAGCTTTATTACCAATAG

XM_004865680.1 Coding sequence

LOC101711280 chromosome unknown open reading frame, human C19orf70

Length: 357 bp    Location: 4521263..4522912   Strand: +
>XM_004865680.1
ATGGTGGCCCGTGTGTGGTCGCTGATGAGGTTTCTCATCAAAGGCAGCGTGGCTGGGGGTGCCGTCTACCTGGTGTATGACCAGGAGCTGCTGGGACCCAGCGACAAGAGTGAGGCGGCCCTGCGGCGGGCGGAGGAGGTGGTTCCGCCGGCCATGTACCAGTTCAGCCAGTATGTGCGCAAGCAGACGGGCCTGCAGATCCCACAGCTCCCAGCCCCACCAAAGATTAACTTTACCCTCCGGGAGTCCTGGAATTCAGGCATCATCAAAGTGATGTCAGCCCTGTCGGTGGCCCCCACCATGGCCCTCGAGTACTCCAAGGAGGGCTGGGAGTATGTGAAGGAGCGCACCAAGTAG

XM_004866038.1 Coding sequence

LOC101697341 olfactory receptor 7D4-like

Length: 792 bp    Location: 90757..89966   Strand: -
>XM_004866038.1
ATGTATTTCTTCCTCTCCAACCTGTCCTTCTCTGACATCTGCCTCATCTCCACCACGGTCCCAAAGATGCTGGTGAACATCCAGATACAGAAGAAAGGCATCTCCTACATAGATTGCCTCACTCAGGTGTATTTTTTAAATACTTGTGCTGGAGTAGATAATTTCCTACTGGCTGTGATGGCCTATGACCGCTTTGTAGCCATCTGCCACCCTTTGAACTACATAATCATCATGAACACCCAGCTCTGTGGCTTTCTGGTCCTGCTCTCTTGGATCATCATGTTCTGGGTCTCCTTGATTCATATTCTACTAATGAAGCGACTGACCTTTTCTATAGGCACTGAAATCCCTCATCTCTTTTGTGAATTGGCTGAGGTTCTCAAGGTGGCCAGCTCTGATTCCCTCATCAGTAATATCTTCCTATACGTGGCAACTGCCCTGTTGGGTGGACTTCCCATCACTGGGATCCTCTTTTCTTACTCACAGATAATGTCTTCTTTATTAAGGATGTCCTCCACTGCCAGGAAGTATAAAGCATTTTCCACTTGTGGGTCTCACCTCTGTGTGGTCTCCCTGTTCTATGGAACAGGATGTGTGGTGTACCTCAGTTCTGCCGTGACTCTTTCTACCCAAAGCAGCACAGTTGCTTCTGTGATGTACACTGTGGTCACCCCAATGCTGAACCCCTTCATCTACAGCCTGAGGAACAAGGATGTGAAGGAGGCCATGGCAAGACTCCTCAGCAGAGCAGCCTCTGGCCATTCATGGACTGTTGACCTCAGAACTAAGTGA

XM_004866082.1 Coding sequence

Hcn2 hyperpolarization activated cyclic nucleotide-gated potassium channel 2

High confidence: 3 potential gene matches
Length: 2040 bp    Location: 7900629..7889616   Strand: -
>XM_004866082.1
ATGCTGCTGTTCATGGTGGGAAACCTCATCATCATTCCCGTGGGCATCACCTTCTTCAAGGATGAGACCACGGCACCCTGGATCGTGTTCAACGTGGTCTCGGACACCTTCTTCCTCATGGACCTGGTGCTCAACTTCCGCACGGGGATCGTGATCGAGGACAACACGGAAATCATCCTGGACCCCGAGAAGATCAAGAAGAAGTACCTGCGCACTTGGTTTGTGGTGGACTTCGTGTCCTCCATCCCAGTGGACTACATCTTCCTCATCGTGGAGAAGGGCATCGACTCTGAAGTCTATAAGACGGCGCGTGCCCTGCGCATCGTGCGCTTCACCAAGATCCTCAGCCTGCTGAGGCTGCTTCGCCTGTCCAGGCTCATCCGCTACATCCACCAGTGGGAGGAGATCTTCCACATGACCTATGACCTAGCGAGCGCAGTCATGCGCATCTGCAACCTCATCAGCATGATGCTGCTGCTCTGCCACTGGGACGGCTGCCTGCAGTTCCTGGTGCCCATGCTGCAGGACTTCCCCAGCAACTGCTGGGTCTCCATCAACAACATGGTGAACCACTCATGGAGCGAGCTCTACTCCTTCGCACTCTTCAAGGCCATGAGCCACATGCTGTGCATCGGGTATGGGAAGCAGGCACCCGAGAGCATGACGGACATCTGGCTCACCATGCTCAGCATGATCGTGGGCGCCACGTGCTATGCCATGTTCATCGGCCACGCCACTGCCCTCATCCAGTCGCTGGACTCCTCCCGGCGCCAGTACCAGGAGAAGTACAAGCAAGTGGAGCAGTACATGTCCTTCCACAAGCTGCCTGCCGACTTCCGCCAGAAGATCCACGACTACTACGAGCACCGATACCAGGGCAAGATGTTCGACGAAGATAGCATCCTGGGCGAGCTGAACGGGCCTCTGCGGGAGGAGATCGTCAACTTCAACTGCCGAAAGCTGGTGGCCTCCATGCCGCTCTTCGCCAACGCTGACCCCAACTTCGTCACGGCCATGCTGACGAAGCTCAAGTTCGAGGTCTTCCAGCCAGGCGACTACATCATCCGTGAGGGCACCATTGGCAAGAAGATGTACTTCATCCAACATGGCGTGGTCAGCGTGCTCACCAAGGGCAACAAGGAGATGAAGCTGTCAGACGGCTCCTACTTCGGGGAGATCTGCCTGCTCACGAGGGGCAGGCGCACGGCCAGCGTGCGCGCCGACACCTACTGCCGCCTCTACTCGCTCAGCGTAGACAACTTCAATGAGGTGCTGGAGGAGTACCCCATGATGCGGCGTGCCTTCGAGACGGTGGCCATCGACCGCCTGGACCGCATCGGCAAGAAGAACTCCATCTTGCTGCACAAGGTGCAGCACGACCTGAGCTCAGGCGTGTTCAACAACCAGGAGAACGCGATCATCCAGGAGATCGTCAAGTATGACCGCGAGATGGTGCAGCAGGCAGAGCTGGGCCAGCGCGTGGGGCTCTTCCCGCCGCCGCCCCCTCCACAGGTCACCTCGGCCATCGCCACGCTGCAGCAGGCGGTGGCCATGAGCTTCTGCCCCCAGGTGGCGCGGCCACTCGTGGGGCCGCTGGCGCTGGGTTCACCGCGCCTCGTGCGCCGCGCGCCCCCTGGGACCGCGCCCGCCGCCACAGCCTCTTCGCCCGGAACCGGGCCAGCAGCCAGCCCGCCGGGCGTGCCCGCCAGCCCCCGGGCCCCGCGGACCTTGCCCTACGGCGGCATACCCGGCTCGCCCGCAGGTCCCCGCGTCGGGCCCACACTACCCGCGCGCCGTCTGAGCCGTGCGTCGCGCCCACTGTCGGCCTCACAGCCCTCGCTGCCCCACGGCGCGCTCGGCCCGGGGCCCGCGAGCTCGGCGCGCCCGGCCAGCAGCTCCACGCCGCGCCTGGGGCCCGCGCCCGCCACACGCGCAGCCGCCCCCCCGAGCCCGGACCGCAGGGACTCGGCCTCACCCAGCGCCGCCGGCGGCCTCGACCCGCTGGACTCTGCGCGCTCTCGCCTCTCGTCCAACTTGTGA

XM_004866083.1 Coding sequence

Odf3l2 outer dense fiber of sperm tails 3-like 2

Length: 1125 bp    Location: 7967366..7976255   Strand: +
>XM_004866083.1
ATGGCCTACAGCCAGCGTGGCATCAACCAGCTCATGGGCTTCCCCCACATCTTAGCCCTTGTGGTGCTGCCCACCCCTGCCTCCTTGAACTTCACCTCCCTTGGAGTCAAAGCCAAGTCCTCAAGTGGTCTCAGGCCCGTTGCATGGCTCCCTTCACTCTGGCCTGACCCAGTAGTAGCCTGTAGCGGAGGCAGGAATACAGTCCTGTGTGGGACCAGTGTCCACCCCCGCAGGTTTCCAGGAGGCAGCAGCCAGTCCTGGCCGACCGAAGGCCGCTGCAGCACCCCAGCACCTGTGACTCCCACAGAGCTTGCTTCTCACTGCATCCCCTGTTCGTGTCCTCTCTGCTCTCCACGGCATCAGTCCTGGTCTGTTGGTTCCTGTCTGGTCCCCACCACCCCACACAGAGCCCAGTCAGGCTCCGGGCCAGGCTTGTACATCCTGCCCACCACCGTGGGCTTCGTTCACCACGACTGCACCAGGGTGACCGGTCCTGCCTACTCGCTCGCTCGGAAGCCCAGTGAAGCCCCTCCTCAGGACACCAGCCCGGGGCCCATCTACTTCCTGGACCCAAAGGTCACCCGCTTCGGCCGCAGCTGCACCCCTGCCTACTCCATGCAGGGCCGGGGCAAGTCTCGGGGTATGGAGGTGACGCCAGGCCCTGGGGCCTACAGCCCGGAAAAGGTGCCCCCTGTGCGCCAGCGGAACCCCCCAGCGTTCACCCTTGGCTTGCGCCTGTACCCAAAGCCCCCCGACTCCTCGGCCCCGGCCCCCAATGCCTACACCATGCCGCCACTCTGGGGCTCACAGATCTTGGTCAAACCCAGGAGCCCCAGCTACACAGTGGTGGGCCGCACGCCCCCTGCCCGCCTCCCACAGGACCCCGCCAAGTTCCCAGGCCCCGGCCAGTATGACAGCCCGGACCCCAACGCCTACCGCCAGCGCCGGCCAGCCTTCACCATGCTGGGCCGGCCCCGTGCCCCACAGCCCCTGGAGGAGACGCCTGGGCCTGGCAGCCACAGCCCCGAGCAGGTCACCGTGAACAGAGCCCGGGCCCCGGCGTACAGCATGGGTATCCGCCACTCGAAGCGGGCGGCCAGGTTGGCCCTGGACACCGCACCCTGA

XM_004865958.1 Coding sequence

Ndufs7 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase), transcript variant X2

Length: 762 bp    Location: 7303341..7298290   Strand: -
>XM_004865958.1
ATGCACCTGGAGAAACTGTTAGATCTGAGCCATCATGCGGGTTGGGGCCTGAGTGAGGGGAGGGGTGGCAGGCAGAGGAGCAAGGGGTTTGAGGTGGGAAGGGATGACTGGGAAGGGCTGGGCTCTGGGCTCAGGGCGGCCACTTACTGGAGTCTCTGCAGCTCCAGTGTGGGCGCGGTTGTGCAGGCGCGAGGTGTCCATCAGAGCTGGGCCGCCAAGGGCCCGGGCAGCACCCAGCCTGCTGTGGCCAACGTTGGAGCCCTGGTCCCAAAGCCCCCCACACTCCCCAGGAGCCGCGGCGAGTATGTGGTGGCCAAGCTGGATGACCTCATCAACTGGGCCCGCCGGAGCTCGCTGTGGCCCATGACCTTTGGCCTGGCCTGCTGCGCCGTGGAAATGATGCACATGGCTGCGCCCCGCTATGACATGGACCGCTTCGGCGTGGTCTTCCGCGCCAGCCCGCGCCAGGCTGATGTGATGATCGTGGCCGGCACACTTACCAACAAGATGGCCCCGGCACTCCGCAAGGTCTACGACCAGATGCCAGAGCCACGCTACGTCGTGTCCATGGGGAGCTGTGCCAACGGAGGAGGCTACTACCACTACTCCTACTCTGTTGTGAGGGGCTGTGACCGCATCGTGCCCGTGGACATCTATGTGCCAGGCTGCCCACCCACGGCCGAGGCCCTGCTCTACGGCATCCTGCAGCTGCAGCGGAAAATCAAGCGGGAGAAGAGAATTGGGATCTGGTACCGCCGGTAG

XM_004866061.1 Coding sequence

LOC101709599 EGF-like module-containing mucin-like hormone receptor-like 4-like

Length: 1887 bp    Location: 3445944..3398315   Strand: -
>XM_004866061.1
ATGAGAATAAAGTGTCTGTCCCTGCTACTGGCTCTCAGCATCTTGCTGGCTGTGTCAGGATCAGAAGCACAAAATTCTGGAGCTCCCTGTCCTCTATGCCCTGCGAATGCCGTCTGCTACAATCACACCCACTGTGTTTGTATGCATGGATTCCAGTCTCATTCTGGGAGGGATTACTTCATTGGGACCAAAGACAAATGTGAAGATATCAATGAGTGTAAGACTGGACGGGCAAAGTGCAAGAAAGTATCATACTGTAAAAATAAAATTGGAAGCTACATCTGCAGCTGTTTAATCAGTTCTTGGTTATACTGGATAGCTGGTATCGCTGAAATTGATCGTCCAGAATGTTATGAGAACCACATACAGAAGACACCATCACAAGAGAATGTTTGGGAACTTTCAACGCAAAATATTAGCAAAAAAGAAATTGCGAAAAGGGTTACCCGACTACTTCATCATGTGGAAATGACTATATGGAATCAGAGTTTTGATTCTCCAGGAAAGGGTAATAATCCTTCACTTAATATAGTCTATGAAACCAAGAAATGTCATGAGAAGACCTTTTTGGAAGCTGGAAATAACACAATGAATATCAATTGTGCTGGTGCTTTCAAAGGAGCCAGAAAAGATGTGAGTACAGTTGCTCTTATCACTTATGAATCTCTTGGGAATATTCTGAATGGATCCTTTTTTAACAATTCAAGAGGAATGCAAGGAGTAAAGCTGAACTCTCATGTTGTGAGTGGCACAGTTGGTTTGCAAGACAAAGTTTACCTGTCTGAACCTGTGCTCCTGACTTTTCAACATACTCAGCCTGGGATTGAGAATGTACAGCATTTCTGTGTCTACTGGGAAGGATCAGAGGAAGGGGGCAGCTGGTCAACAGAGGGCTGCCTTCGAATGGGCAGGAATGATTCCTACACCACATGCAAGTGTTACCACCTGTCCAGCTTTGCTGTCCTCATGGCTCTGAGCCCCAAGGAGGGCCCTGTGCTGACGGTGATCACCTACGTGGGGCTGAGCCTCTCCCTGCTGTGCCTCTTCCTAGCAGCCGTCACCTTCCTGCTGTGCCGACCCATCCAGAACACGGGCACCACCCTCCACTTGCACCTTGCTCTCTGCCTCTTCCTGGCCCACTTCCTGTTCCTCACAGGCATCAGAAGAACTGAGCCTAAGGTGCTGTGCTCCGTCATTGCAGGAGTGCTGCACTTTCTCTACCTGGCCGCCTTCATCTGGATGCTCCTGGAGGGGCTGCACCTCTTCCTCACCGTCAGGAACCTCCAGGTGGCCAACTACACCAGTGCAAGAAGATTCAAGAAGAGGTTCATGTACCCTCTGGGCTACGGCATCCCAGCTGTGATTGTCACTGTGTGTGCAATCGTCGGACACAAAAATTATGGAACAAGTACTCACTGCTGGCTCACAGCTGATAAAGGATTCATCTGGAGCTTCATGGGGCCAGTGGCAGTCATTATCACGATAAACCTTGGGTTCTACTTCCGAGTTCTATGGATTTTGAGAAGCAAACTTTCCTCCCTCAATAAAGAAGTCTCTACCATTCAGGACACCAGACTCATGACATTCAAAGCCATTTCTCAGCTCTTTGTCCTGGGATGTTCTTGGGGACTTGCCTTTTTCATGGCTGAAGGAGTAGGGGAGACAGTTGGATCAGCCATCACTTACTTATTCACCATCATCAATGTCCTGCAGGGGGTTTTGCTCTTTGTGGTGTACTGTCTTCTTAACCACCAGGTGCGAATGGAATACAAGAAGTGGTTTAGTAGGATGTGGAAAGGCACTGAAACCGACAGTGCTGATATGTCTCATTCTACTACCCACACCAAAATGGAGGAGCCAAGAAAACCATCAGAATATGCTCTTTGA

XM_004866049.1 Coding sequence

Muc16 mucin 16, cell surface associated

Length: 10029 bp    Location: 1573321..1508740   Strand: -
>XM_004866049.1
ATGGCTCTGAAGACCACTTCCACAGCCACTGTGACCACCACAGTCTCCATTCCCACCTTGAGAACACTCATTGTCCCAACATCAGCCAGTACAAGTCCAAAAGGAATGATCATTACAACCTCAACTGTTTCTCCTGCTGTTCCAGAGATGACAGCCTCATTGGCCACTCGTCTTAGAGAAGATACCAGCATAATAGTTTCCAAGGAAACTCCATCTTCCTTCAGTAGAGAATCAGAGACCACTACCTTGGTGGTCCCCAGTTCTGGGGCAGAGACCAGGCCAGCTACTCAAGCTCTGACTGCTTCCTCTGGTGAGTCAGGCACAGTGGACTCACTGATCACTCACCCTGCAGAGACAAGAACGCCTGTTTCCAGAACAACCTCCGAATTTCCACGTTCTGAATCGGATGCCACACTCTCAGTGGACAACAGTCCTAGGACAGAAACCAGTCCAGCCATTCCAACAACTGCTGTCTCATCTGACATCCCAGGGTTGACAACCTCACTGGTCACTACTTCTAGGACAGACACTGGCTCAACTAAACCAACTCTGACTCCTCCCGATGAACAAGAGAGCACAACCTCCTTGGTGACTGATCTTGGAGCACAAGGTTCAGCCATTCCAAGTCCAACTAGCTCACCTGGCATGTCAGAGATGGTGACAACACTGGTTAGTAGTTCTGAGACAGAGACAAGTACAAGCAGCCAAATTCCGACTGTCTCTCCAAATCAGATGGATATCACAGCTTCAAGGGTCACCCAATCTGGAACAAAAGTCAGTTCAGCGCTTCCAACTTGGACTATTTTGTCTGGCGGGTCACATGCAACAACTTCGTGGGTTACTCATTCTGTAGAGACCAGCTCAGCAGTTCCCAGAACAGCCCCAGGTTTTCCCCATAGTGAATCCAATACCACATCCCTAACAACCACCAGTCCTGTGGAAGAAACCAGTTCAGCTGTCTCCTCTTCCACTCTTTCACCCGATGGAACAAATATGGTGACCTTATTGGTCACTAGTTCCAGAAGAGCAACCAGTACAAGTATTCCAAATCCAACTAGTTCTGCTGGTGCATCAGAGACCACATCCTCATTGGTTACCCATCCTGGGCCACAGACTAGTTCAGCCATTCCAACTCTAACTGTCTCTCCTAGTGTACCAGGAACAATGACTTCATCAGTCACTAGTTCTAGAAAAAAGAATAGTATGGTTCCAATCCTGACTGTTTCCCCAGGGCCACCAGAGACCACAGCCTCATGGGTCACTCATCCTGAGTCAGAAGCCAGTTCTTCTGTTCCAACCCTGACTGTTTCAGCAAGTGAGCTGTATACAACAGCTTCACTGGTCTCCCATCCTACAGAGACCAAGTCAGCTGTTCCCAAAACAACCCTAAGTTTTTCCCATAGTGAATCCAATGCCACACCCTTAACAGCCATCAGTCCTGAAGAAGAAGTCAGGTCATCTGTCTCAAGTTCTACTGTTTTACCTGAGGTCCCAGGAGTAATGACTTCGCTGGTGACTAGATCTACAACAGTGGTTAGTACAAGTACTCCAACTGTGGCTCTTTCTTCTTCTAGATCAAGTATTACATCTTCAAGGGTCACCCATTCTGGGGCAGATTCCAGTTCAGCTGTTTCAACTCTGTCTATTTCAACTGCTGAGCCAGATACAACAGCCTCATCAGTCCCTCTTCCTGCAGGGACCAGCCCAACAATTCCCAGGACAACCCCTAAATTTTTCCATACTGAATCCAATACCATACCTTTAACAGCCACCAGTCCTGGGGAAGAAGCCAGTTCAGCTGTCTCAACTTCTGGTGTAGGGTTGCTGACTTCACTGGTCACTAGTGCTGGAACAGACCCCAGTATGTTTCCAACTCTCACTGTTCTCTCAGGCCAACAGCAGACCACAGACTCACGGGTAACCCATCCTAGATCAGAAGCCAGTTCTTCCACTCCAACTTTGTCTGTCTTTCCTGGTGAGCCAGATACAACTTTCCCCTTGGTCACCCATTCTGCAGAGACCAGCTCGACTGTTTTCATGAAAAGCCCGAGTTTTTCCCCTAGTGAAACACACTCCACAACCCCAACAGTCACCATTCCTGGGACAGAATCTAATTCAGCTGTTTCAACTACAACTATCTTGTCTGGTGTTCCAGATATGGTGACTTCACAGGTCCCTACTTCTGGAATAGATGCCAAAACAAGTAAACCAACTCTGACTCCTTCTGAACCAGCAATCACAACCACATTGGTCACCTCTGCTGGGACACAGACAAGTTCAACCATTCCAACTCTGGCTGTCTCCCCGGGCATATCAGAGATGACCTCACTGGTCACTAGCTCCGAGACAGAAACAAGTACAACAACTCCAATTCTCACTGTTTCCCCAGATCAACTGGATACAACAGCCTCATGGATGACCCATCCTGGGTCAGCTGCAAGTTCAGATTTTCCAACTCTGTCCATTGCCTCTGGTGAGCCAGATACAACAGCCTCATGGGTCATTCATCCTGCAGCAATCAGCCTACCAGTTTCCAGGACAATCCTCTATTTTCCCCATAGTATATCAGACACCACACCCTCAATGACTACCAGTCCTGAGGCAGAAGCCAGTTCAGCTGTTCCCACTCCCAGCATTTCACCTGAGGTACCAGGGGCAGTGACCTCATTAGTCACGAGTTCTAAAACTGTGATCAGTACAAGTACTTCAGCTTTGACTCATTCTTCTGGTGAACCAGAAACCACAGCCTTATTAGTCACCCATCCTGAGCCACGTTCATCCCTTCCAACTGTAGCTGTTTCCTCTAGTGTACCAGGGATAGTGACCACATTAGTCACAGAGACAAGCACAACTTATCCAAAGTTGACCAATTACTCACAAGAACCAAAGACTACAGCCTCAAGGGTCACCCATTCTGGGTCAGAAGCCAGTCCAACTATTTCAACTCTGACTGTTTTCCCTGGTGAGCCAGATACAATGGTTTCATTGGTCACTCATTCTTCAGAGACTAGGACACCTGTTTCCAGAACAGCCCCAGAGTTTCCCCAGAGCAAATCACACTTCACATCCTCAATGGCTACCAGCCCTGGGGCAAAAACCAGTTTACCTGTTCCAACTACAATGATCTCACCTGGTATACCAGGTACAGTGACCTCACAGGTTACTAATTCTGGGACAGACACAAGTACGGCTACTTCAACTCTGACTCCTTCTCCTGATGAAACAAAGATCACAGCTTCTGCAGTCACCTATCCCGGGGCACAGAGCAGTCCTGCTGTTCCAACTCTTACTGTTTTCTCTGGTGAACCAGCTACAACCTCATCGGTCACTCATTCTTCAAAAACCAGTACACCTGTTTCTAGAACAATCTCCGGTTTTTTGCATGGTGAATCAGATACCACACTCTCAATGGCCAGCAGTCCTAGGCCAGAATCCAGTTTGCCTGTGCCAACAACGAATGTCTCACCTGGGGAACCAGATGTGGTAACCTCACAGGTCACTACTGGGCCACCAACTGGTACAACAATTCCAACTATGACTGTATCTCCTAGTGAAACAGAAACCACGGCCTTAATGATCACCCACCCCAGTGCAGAGACAAGTACAAATTTTCCTGTTTCAACTATTTTTCCTCCTGTGTTGGAGACCATGGCCTCACCATCTGTCAGACCTGAGGTGGAGATTAGCACAGCTCTTCCAACTCAGACTGCTTCCCCTGGTGGACCAGAGATAGCAACTTCTCTCTTCACCTCTGCTGTGACTGAGCTGGGTAGAGTTGATCTAGGTCCAACAGCTTCACCTGGTATTCCTGTGGAAACAGCTTCATTGTCTGCTCATCCTGGGACAGAGACCAGCACAAGGACTCCAACTGCAACCCTTTTCTCTGGTCGATCAGAGGCCACAAGTTTATGGGTCACCAGCCCTGCACTAGAGGCCAGCACAGGCATTCCAACTCTGACTGTTCCCCCCAGTATCCCTTGGCTTTCCAGTGCCCCTACAACAACAGGTAAGCCTAAGGCCATAACTTCCTGGAGCACAGAAACTCCACCACCTGCAACATCAGCTGGACTCCTAGACTTTTCCAAAACTGTTGCAGGCCCCACTATGACCCTGATAACATCGGAGACCCCAACACTACCTACAACCAGTCACAGAGAAGGAGTGAGTCCAACCACTATGTTGAAAACTACAACTGTGGAGACCACTCATTTAGCTGCCACAGGTTCAAGTCCCACCACAGCTGAGATCACAAGCAACTTCAGTATTACAATAGCCAGAAGTCCATTTGCCTCAGAGACCACACCTGGGATGTATACTTTGGCTTCTGAGACTGTGACTTCAGGAACAAGTAAGAATAAATCCCCCACACCCATGACCCCTACTCTCAGCTCTACAGCTGTAGGAGTCAGCCCAGTCCTGGTGCCTTTCACACTCAACTTCACAATCACCAACCTGCATTACACTCCAGACATGGGGCACCCTGGCTCCTTGAACTTCAACTTCACGGAGAAGGTCTTGATCCACCTGCTCGAGCCCTTGTTCAAGAACACCAGCATCGGCACTGGCTACTCGGGCTGTAGATTGACCTTGCTCAGAAGTAAGAAGAATGAGGCAGCCACTGGAGTGGATGCTGTCTGCACCTACCAACCTTATCCCAAGGGCCCAGCTCTAGACAGAGAACAATTGTACCAAGAGCTGAGTCAGCTGACCCACGGTGTCACCAGGCTGGGCTCCTATGCCCTAGACAGAGACAGCCTCTATATCAACGGTTATAACCACCAGTACTGGATCCCTACTACCAGCAGTGCAAATCTGCCTCTGGTACCCTTCACCCTCAACTTCACTATCACCAACCTGCATCACGAGAAGGACATGGGGCGCCCAGGATCTGAGATATTCAACACCACAGAGAGGATCTTTAGCCACCTGCTGAAATCCTTATTTCAGAAGAGCAGTATTGGGCCCCTGTATTCTGGCTGCAGACTGATCCTGCTGAGGCCTGAGAAAGACAGAACAGCCACCGGAGTGGATGCTGTCTGCACTCACCATCCTGATCCCATGGGCCATGAGCTGGATAGGAAGAAGCTGTACTGGGAGCTGAGCCATGAGACCCATGGTGTCACTGAGCTGGGCTCCTACACCCTAGACAAGGACAGTCTCTACGTCAATGGTTATACCTTTCGAGCTTCTACTCCCACTCCTAGCAATGCTGTGACCTCTACACTCTCACCATGGACCCCTGCAGTACAAGACCACTTCATGAGCTCCACAGGAGAGGCCCCTTTTCTGATGCACTTCACCCTCAACTTCACCATCACCAACCTGGAATTCAAGGAGAACATGGAGCACCCGGGTTCCAGGAGGTTCAACAGCACTGAGACAATCCTGCAGAAGCTGCTCCAACCCTTGTTCCAGAAGAGCAGTCTGGGATCCCGCTATGCAGGCTGCAGACTGACCTCACTCAGTACGGTGCTTACCAGGCCCGAGAGGGATGGAGCAGCCACGAGAGTGGACGCTGTCTGCTCACATCACCCTGGACCTGAAGGCTTCAGACTGGACAGAGAGCGGCTATACTGGGAGCTGAGCCAGATGACCCACGGTGTCTCCCTCCTGGACCGCTACACCCTGGACAGGGACAGTCTCTATGTCAATGGATTCACTCATCAGGGCTCTGCACTCCTCACCAGCACTCCTGGGACCTCCACACTGGACCTGGGAACCTCTGGGGCTCCTTTCTCCACCTCCATCCCCACAACCATGAGCCCTACTCTGGTGCCCTTTACCATCAACCTCACCATCACGAACTTGCAGTTCATGCCGGGTATGGACCGTCCAGGATCCCTCAGGTTCAACAAAACCGAGGCCATCTTGCAGCACCTGCTTGGGCCTCTGATGAAGAACACCAGTATCAGCCCACTCTTCTCTGGCTGCAGTCTGACCTCGCTCAGGCCTGAGCAGGACGGATCAGCCACCAGAGTGGACCTCATCTGCACCCATCGCTCCAAGCCCACAGGCTCTGGGGTGGACAGAGAGCGGCTGTACTGGGAGCTGAGCAGTGAGACCCACAGTGCGACCCGGCTGGGCCCCTACAGCCTGGACAGGAACATTTCTGTGGCCTCTACCTGGATCTCATCAACATCGGCCACCCCTGTCTCCGTGTCCACAGCAGCCATCCCTCTCCTGGTGCCATTCACCATCAACTTTACCATCCTCAACCTGCTGTATGAGGAGGACATGAGTCACCCTGGGTCCCAGAAGTTTAACTTCACTGAGAGAGTCCTGCAGAAATTGCTCCAACCCTTGTTGAAGAACAGCAGTGTGGGAGCCCTCTATGCAGGCTGCAGGCTGACTTCTCTCAGGCCTGAGCAGGACGGATCAGCCACCAGAGTGGACCTCATCTGCACCCATCGCTCCAAGCCCACAGGCTCTGGGGTGGACAGAGAGCGGCTGTACTGGGAGCTGAGCAGTGAGACCCACAGTGCGACCCGGCTGGGCCCCTACAGCCTGGACAGGAACAGCCTTGATGTCAACGGTTACACCCATCGGTACCTGCCCTCCACCCCGAGCACGGCTGGTCCCATCCTGGCACCGTTCACCATCAACTTTACCATCCTCAACCTGGAGTATGAGAAGGACATGCATGAGACTGGCTCTCAGACGTTTAACTTCACGGACAGAGTCCTGCAAAAAGCGCTCCGGCGCTTGTTCAAGAACACAACTATCAGCCCCCTCTACTCTGGCTGCAGACTGACCTTGCTCAGGCCTGAGAAGGATGGGTCAGCCACAGGAGTGGACATAGTCTGCACCTATCATCCTGAACCTATGGGCCTCAAGCTGGACAGAGAACAGCTGTACTGGGAGCTGAGCCAGCTGACCCATGAGGTCACCCATCTGGGCCACTACAGCCTGGAAAAAAACAGTCTGTATGTTGACGGATACACCAACAGGACTGTGGTAGCTACCCCTAGTGGACCAGCCCTAGTGCCCTTCACCCTCAACTTTACCATCACCAACCTGCCATATGAGGAAGACATGCAGCCTGGAGAGTCCGGGAGATTCAGTACCATGGAGAAGGTCCTGCAGGACCTGCTCAGGCCCTTGTTCAAGAACACTACTGTTGGCTCCTTGTTCTCTGCATGCACACTGACCTTGCTGAGGTCTGAGAAGGGAGGGTCAGCCACAGGTGTGGACACAGTCTGTACCTATCATCCTGGCCCTGTGGGCCCCACACTGGACAGAAAGCAGCTGTACCAGGAGCTGATTCAGCTGACCCATAATGTCACCCAGCTGGGCAGCTACACCCTGGACCAGAACAGCCTCTATATCAACGGTTACACCCACCAGACTGCAGGAACTACACCCAGTGCCACTGAACCACCCTTGGTGCCTTTCACCCTCAACTTCACCATCACCAACCTGCCCTATGAAGAGGACATGTGGCCTCCAGGGTCCTGGAGGTTTAATAACACAGAGAAAGGCCTGCAGGACCTGCTCAAGCCCTTGTTCAAGAACACTGCTGTTGCCTCCCTGTACTCTGGCTGCAGACTGATCCTGCTCAGGCCCAAGAAGGACAAGGCATCCACTGGAGTAGATATGGTTTGCACCTACCACTCCGACCCTGCAGGCCCTGGACTGGACAGAGAGCAGTTACACTGGGAGCTGAGGCAGGGGACCCATGGGGTCACCCAGCTGGGTCCTTACACCCTGGACCAGGACAGCCTCTACATCAATGGTTATAACCAACTGACCCTGACAACTACCTCCAGCACAGCTGTGACCACCATGTCCATCCCAGCATCTTCTCTGGCTTCGCCCCCCACAAGCAGGCCCACAGCCAATGTTTCTACCACTATACTGGTCACACTCAACTTCACCATCACCAACATGTACTACACAGAGGAAATGGGAAACCCGGGTTCCTTGAAGTTTAACTTCACTGAGAGGATCCTTCAGCGCCAGCTCGGGTTTTTGCTTAATGAGACCAGTGTTGGACCACTCTACACTGGCTGCCAACTGGTTGCACTCAGGCGTGAGAACAGTGGGACAGCCATAGGAGTGAATATCATCTGTACCTTCCACTCTGACTCTCTGGGGCCTGGGCTGGACAGAGAGAAGCTGTACAGGGAGCTGAGTCGTGAAACCCATGGTGTCACCCAGCTGGGTCACTACACCCTGGACCACAGCAGTCTCTACGTCAATGGTTATACGTTTGGGGGCACAGCCACAACTCCCACCACCGAGGTCCATGAGGAGCTGTTCACCGTGAACTTCACCATCAACAACCTTCGCTACGCAGTGGACATGGGTCACCCTGGCTCCCTCAAGTTCAACATCACAGACACAGTCATGGAGCACCTGCTCAGCCCTTTGCTCCGGAGGAGTAGTCTGGGTGCTCGGTACACGGGATGCAGGCTCACCACACTGAGGTCTGTGAATAATGGTGCCCAGACACAGGTGGACATCCTCTGCACCTACCAACGGTCCCGCAGCAGCCCAGGCCTGTCTGTCAAGCAGGTGTTCCATGAGCTGAGCAGGCAGACCCAGGGCATCACCCGACTGGGTCCCTACTCTCTAGACAAAGACAGCCTCTACCTCAACAGTTATAATGAACCTGGTCCAAAGGAGCCTCCCACAACTCCTGAGCCAAACACCACATTCATGCCATTGTCAACATCTGTGCAGCCAGAAACCACAACAGCCATGGGCCACCACCTGAAGACCCTCACCCTCAACTTCACCATCTCCAACCTCAAGTATTCACCAGATATGAGCAATGGATCAGCCAAGTTCAACTCCACTGACAGGGTCCTGCAGTACCTGCTTGAATCCTTATTCCAGAAGACCGTCCTGGGCCCTTTCTACTCAGGTTGTAGGCTAACCTCCCTCAGGCCTGAGAAGGACAGAGAAGCCACTGGTGTGGATGTAATCTGCACCTATGGCCCTGACCCCATGGGTTCCGGGCTGGACAGCAAGCAGCTGTACTGGGAGCTGAGCCAGCTGACCCATGGCATCACTCAGCTGGGCAAGTACTCCCTAGACCAGGACAGCCTCTACATCAATGGCTATGTAACCCAGAATGGAACCATCTGGAGTGAGTACCAGCTAAGTTTCCACATCCTCAACTGGAACCTCAGCAACCCAGGCCCCACATCCTCAGAGTACACTGCCTTGCTGAGAGATATTGAGGACAAGGTCACCACACTCTTTACAGGCAGCCAGCTACAAGATGCCTTCCAATCCTGCCTGGTTACCAATTTGACGTTAGACTCCAAGTTGGTCACTATCAAGTTATTTTTCTCCACCTATCTGAATGCCAACCTTGTGAAGCAAGTTTTTCTAAATAAGACTTTGAATGCTTCGACCCACTGGCTGGGTGCCACCTACCAGTTGACGGACCTACATGTAATGGAAGTGAAGCCATCCATTCCTCTACCAACAGAAATGCCACCAGACACTTCCAGTTCCCAACAATTTCAGTTGAATTTCACCATCACCAACCTACCCTATTCCCAGGACACAGCCCACCCAGACACTACCCAATATCATCATAACAAAAGAAGCATTGAGAATGCGCTCAACCAGCTTTTCCGAAACAGCAGCATCAAGAGCTATTTTTCAGACTGTCAAGTTTTAGCATTCAGATCTGTCTCTCACATCAACCACACTGGGGTTGACTCCATATGCAACTTCTCACCCTTGGCTCGGAGTCTGGACAGAGTTGCCATCTATGAGGAATTCCTGCGATTGACCCAGAATGGTACCCAGTTGCAGAACTTCACTCTAGACAAGAACAGTGTCTTTGTGGATGGGTATTCTCCACACAAAAATGACGCTGTGATTAGAAACTCCGATCTCCCTTTCTGGGCCATCATCCTCATCTGCTTGGCGGGACTCCTGGCCCTCATCACCTGCCTGCTCTGCTGCTATCTGGTGATTGTCTGCCGACGGAAGAAGGAGGGAGACTACCAGGTCCAGCACCACCGCCTGGGCTATTACTTCCCACACTTGGACCTGAGGAAGCTGCAATGA

XM_004866039.1 Coding sequence

LOC101697718 olfactory receptor 7E24-like

Length: 930 bp    Location: 121934..122863   Strand: +
>XM_004866039.1
ATGGAAAGACAGAATCTCACACATGTCTCAGAGTTCTACCTCATGCGCTTCTCAGAGGATCCAGACCTGCAGCCCATCCTGTTTGGACTGTTCCTGTCCATGTACATAGTCACTGTGGTTGGGAACCTGCTCATCATTCTGGCCGTCAGCTCTGCTGCCCACCTTCACACCCCAATGTACTTCTTCCTCTCTAATCTATCCTTCACTGACCTTTGTTTCACCTCCTCTACAGTCCCAAAGTTGACTGTGGACATCCTAACTCAGAGCAGAGTCATCTCCTATGCAGACTGCCTGACACAGATATCACTTTTTATCTTTTTTGGATGTATGGAGAGTATGCTTCTGACTGTGATGGCCTATGACCGCTTTGTGGCCATCTGCCACCCGCTCCATTATTCAGTCATTATAAACCCTCATCACTGTGTCTTATTACTTTTGCTGTCAGTCTTTGTCAGCCTTTTAGATTCACAGATGCACAATTTAATTGCCTTACAAGTTACCTGTTTCAAAGATGTGGAAATTGCTAGTTTCTTTTGTAACCCTCCTCAACTCTTTGACCTTTCATGTTCTCATACCTTAATCAAAAATATAGTCACATATATGGTTGGTATCCTATTTGGGTTTTTTCCAATGTCAGGGATCATTTTATCCTACTATAAAATTGTTTCTGCCATTCTGAAAATCCCATCATCTGGGAGGAGGTACAAAGCCTTTTCTACCTGTGGTTCTCACCTGTCAGTTGTTTGCTTATTTTATGGAACAGGCCTAGGAACATATCTTGGTTCAGCTGTGTCATATTCTCCCAGCAAGGGCATGGTGGCCTCATTGATGTACACTGTGGTCACCCCTATGCTGAACCCCTTCATCTACAGCCTGAGGAACAGGGACATCAGCAGCACACTGAAGAGGATCCAATTTTGGAAAATCTAA

XM_004866044.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 8514 bp    Location: 1043275..982425   Strand: -
>XM_004866044.1
ATGGCCCAGGGGCCCCCGGCTCAGCTCCTGCTGGCTTGGGTGGCCCTGTCCTGCGTGGCGGGGGGCCAGGGCCACTGGGACGGGGCTGTGGGGCCTGCGGGTGCTGGACACGTTCGGAGGCGAGGCGGCCCCGGGATCCTCGGCGTCCTGCACGGGCCGAACGTGTGTGGCTCTCGCTTCCATGCCTACTGCTGCCCCGGCTGGAGGACGCTGCCCGGCGGGAACCAGTGTGTTGTGCGTGAGTGCGGCGCCTTCAGGAAGTGGGGTGTAGACAGCGGGTGCTGGGCAGGGGTCCCCGCTGCCACCTGCCAGCCAGCCCGGGCCTCCCTGTTCACAAGTGGATTTCACCCTGCCTCAGCCTCGGGCGGGCTCCCAGACCGTGCCACGCGCCAGCTTCCTTTGCCCCGAAGCTCCCGGGTCCCGGGCCCTCCGCGGCTTTCTATCTCTATCTCCCCGCTGCCGGCTTCTGGTTTCATTTTGGCTCTGGAATCGGAGTCCAATCCTAGGAGAGGCCCTGACCCTGCATCTAGGACCCCGACCCTCCCGTCTCTGGCCTGCACTCAGTACTCTGGTCCCAAAGCTTCTCTCCACCGCGCGAGCAGAACCCAGAGCCGGGGACTTGGGGAGCGCCCTGACCCGACTGCGCGCGAGTGTGCATCCCGCAGAGCACCCCGAGCGGGGCTGTCGCAGGCACGGTGCTGCTTCCTGTGCGCCCCTCCCGGTCCGTGGTGTGGGGGGGGCAGCTGCAGAGGGGAGACCTGTCTGTGCCGGAGGGGCCGAACGGACACCGTGTGTGGGCGGCCCGTCTGTGACCGCGGCTGCCACAACCGGGGCCGCTGCGTCGGGCCCAACCGCTGCGCCTGTGTGTACGGCTTCCTGGGGCCTCAGTGCGAGAGAGACTACCGCACGGGGCCCTGCTTTAGCCAAGTGGGCCCCAAGGGGTGCCAGCACCACCTGACCGGCCTCGTGTGCACCAAAGCGCTCTGCTGTGCCACCATGGGACGTGCCTGGGGCCTCCCATGCGAGCTGTGCCCTCCACAGCTACACCCCTGCCGCCGTGGCTTCATCCCTAGTGTCCACATGGGGTCTTGCCAAGACGTGGATGAGTGCCAGACCATCCGAGGCCTGTGTTGGGGGGGCAGCTGCATCAACACTGTGGGCTCCTTTGAGTGCCGCTGCCCGGCTGGGCACCGGCTCAGTGACAGCGGTACCAAGTGTGAAGATCTGGACGAGTGTCTCAGCGTCCCCAGCCTCTGCTTTGGGGGCACCTGCACCAACACAGTCGGGAGCTACATGTGTACCTGTCCCCGAGGCTTTGCCAGCAGCCTGGATGGCACCCACTGCCTGGACCTCCGAGTTGGCACCTGCTTCTCTGTACTAATTGGAGGTCGCTGTGCTGCGGACCTTGCTGGCCACTACTCTCACAGGCAGTGTTGCTGTGACAAAGGGAGATGCTGGATGGCCGGCTCGGCCCAGGAGCTCTGTCCTTCCAGGGGGTCCGGTGAATTCCAGCGGCTGTGTGTCCAGGGTTTGCTGCTGCTACCTTCCCACGTGGGGCCTTTCCCTGGCTTCCCGGGCTTCTGGTCCAACAGCAGGGGTCCTGCCCTGGGGCCTGCACAACACAGGGTCCCCCGCCCAGGCCCTGTTAACGCCAATATGGGTCCAGCCACCCTGAACCGGACCCTGGACATCTGCCACCATTTCGCCAACCCGTGTCCCCAGGGCCGCTGCNTGCCCACCCCTTCCAGCTACCGCTGCGAGTGCAGCGTGGGCTACGCCCAGGACAGGCGGGGCGAGTGCGTGGACGTGGACGAGTGCGCCGGGGCCGGCGGGGGCCTCTGCCACCCGGGCCACTGCGTCAACACGGAGGGCAGCTTCCGGTGTGTGTGCCCTGCAGGCTTCGAGCTGAGCCGGGATGGCAAGAGCTGCGTGGACCAGAACGAATGTGCTTCGGGCTCCGTGTGTCTGAATGGCGCCTGTATCAACGAAGATGGCAGCTTCACGTGTCTCTGCAGTCCTGGCTTCCTTCTGGCACCTGGCAGCACCCACTGCACGGACATCGATGAGTGCCAGACGCCCGGCATCTGCGGAAACAACCACTGCCACAACACCCAGGGCTCCTTCCGCTGCCAGTGCCCGGCCGGGCTGGACGTGGACGCTGACGGCCGCAAGTGCGTGGACACCCACGTGCGCGGCGCGTGCTTCGGGGCCGTGGAGAGGGGCGCCTGTGCCCGGCCCTTCCCGGACGCCGTCTCCAAGTCCGAGTGCTGCTGTGCCAGCCCGGAGCACGGCTTTGGGGCGCCCTGTCAGCCCTGTCCCGCCAGGAACTCCGCTGAATTCCAGGCACTGTGTAGCAGCGGACTGGGCATCACCACGGATGGTCAAGACATCAACGAGTGTGCCCTGGACCCCGAGGCCTGCACCAATGGTGTGTGCGAGAACCTTCACAGCAGCTACCGGTGCATCTGCAACCTGGGCTATGAAGCAAGTGCCACGGGCACGGAATGCACCGACGTGGACGAGTGTGCCCTCAACTCCTTCCTGTGTGACAACGGGCGGTGCCAGAACAGCCCCGGCAGCTACACCTGCTCCTGCCCTCAGGGCTTCAGCTTCCGGCAGGACACGGAGACCTGCGAAGACATCGATGAGTGTGTGTCCAGCCCATGCGTGAACGGTGTGTGCCGCAACCTGGCGGGCTCCTATGCATGCAAATGCGGCCCAGGCAGCCGGCTGGGGCCCTCTGGAGCTGTGTGCATAAACAGCACTAAGGGGACCTGCTGGCTGCAGATCCAGGGTGGGCACTGTGGGGCGAACCTGCAGGCGGTTTCTCTGCGGTCCGAGTGCTGCGCCACCCTGGGGGCTGCCTGGGGGAGCCCCTGCGAGCGCTGCGACCTGGACCCCGTGTGTGCACATGGCTTCGTCCACATGAGTGGTGTCACCTGCGAAGATGTGAATGAGTGCAAGTCCTTCCCTGGCATCTGTCAGCGTGGGCGCTGCGTCAACACCGAGGGCTCTTTCCACTGCGAGTGTCCCCAGGGCCTGGTGCTGGGTGCCTCGGGCTGGCTGTGTGTGGACGCGAGGCTGGAGCCATGCTTCCTACGCCGGGACAAGGACGACTGCGGGGCCCCCCTGCCCGGCAAGTACCGGATGGACGTGTGCTGCTGCTCCGTGGGGGCCGCGTGGGGAGCCGAGTGCGAGACGTGCCCGGAGCCCGACTCCGCAGAGTTCGCCAGCCTGTGTCCCCGAGGCCCGGGCTTCTCCAGCCGGGACCTCCTGTCGGGCCGGCCCTTCTTCCGAGAGGTGAACGAGTGCAGGGCGTGCCCCGGGGGGCTCTGTGGCCCGGCGCCTGCGTCAACACCCCGGGCAGCTTCGTGCCCGTGTTTCCGCGGCTACGCCAGCGGCTGGCTGCCGCCCAGGAGCTGCGTGGACGTGGATGAGTGTTCGAGGGACCCACTGCTCTGCCAGGGAGGCACCTGCACCAACACGGATGGGAGCTATGAGTGCCAGTGTCCCCCCGGACAGGCGCGCACATCTGAGGGCACTGCCTGTGAGGACGTGGACGAGTGTGCCCTGAGCAGCAGCCTGTGTCCCCACGGCCAGTGTGTCAACGTCATCGGCACCTTCCAGTGCTCATGTCACGCCGGCTTCCAGAACACGCCTGACAGCCAGGGCTGCGTGGATACCGATGAATGCCAGGTGTGGAACGGCAGCTGCGCAGTGCACTGCATTAACATTGAGGGCAGCTTCCAGTGCAGCTGTGGTCAGGGCTACTCGCTGCTGCCCGGCGGGAGGGCATGCACAGACGTGGACGAGTGTGAAGAGAACCCCAACATCTGTGGCCAGGGGCACTGTACCAACATGCCAGGAGGTCACCGCTGCCTATGCTATGCCGGCTTCACAGCTACACTGGACATGCAGAAGTGTATTGATGTGAATGAGTGTGACCTGAACCCCCACATCTGTCTCCATGGCAACTGCAAGAACATAGAAGGATCCTTTGTCTGCCACTGCCGGCTGGGCTATGCCATCAGGAAGGGGGCCTTGGGCTGCTCTGATGTGGATGAATGTGAGTTTGGAGGACACAACTGCGATGACCACGCCTCCTGCCTCAATGTCCCCGGGAGTTTCAGCTGCAGGTGTTGGCCAGGCTGGGTAGGGGATGGCTTTGAGTGCCAGGACTTGGATGAATGCGCTGCTCAGGGGCATCGCTGCAGCCCGAGAGCCGACTGCCTCAATGTCCCTGGCTCCTACCGCTGCGCCTGTCGGCAGGGATTCACTGGGGATGGCGTCTCCTGCGAAGACAGGGACGAATGTGCCGAGGACATGGACCTGTGCGAGAACGGGCAGTGCCTCGATGTCCCTGGCGGGTCCGTTGCTCGCTGCGGGCAGGGCGTGCTGAACTGGGTTCCTGCAGATGTGGACGAGTGCGCGCTTGGGAACCTGTGCGCCTTCGGAAGCTGCGAGAACCTGCCCGGCCTGTTCCGCTGCGCATGCGCAGATGGCTATGAGCGGGACCCGGGGGGCGGCCACTGCACTGATGTGAACGAGTGTGCAAACCCGGTGAACTGTATCAATGGCCTCTGTGTCAACACCCCCGGCGGCTACCTCTGCAGCTGCCCCCAGGACTTCGAGCTGAACCCCAGCAGGGTGGGATGCGTGGACACCCGGGCTGGGAACTGTTTCCTGGACACACAGGGCCGCGGGGATGGCGGCTTCTCCTGCAGAGCCAAGATCGGAGTTGGTGTCACCCGAGCCTCCTGCTGCTGCTCCCTGGGCCGGGCCTGGGGCAACCCCTGTGAGCTGTGCCCGATGGCCAACTCCACTGCGTACAGAACCCTGTGCCCAGGCGGTGAGGGCTTCCGGCCAAACCCCGTCACTGTCATTCTGGAAGATATTGATGAGTGCCAGGAGCTGCCAGGGCTGTGCCAGGGAGGCAACTGTGTGAACACCTTCGGCAGCTTCCAGTGTGAGTGCCCGGCAGGACACCAGCTCCATCGGGACACCCAAGTCTGTGAGGATATTGACGAATGCTCCATGCACGTGGGCATCTGTGGCCCTGGCACGTGCTACAACACCCTAGGGAGCTACACCTGTGTCTGCCTGCCCNAGTACCTGCAAGTCAACGGTGGCAACAACTGCATGAACGTGAGAAAGAGTCTCTGCTTCCGGCACTATAATGGCACCTGTGGGAATGAACTGGCCTTCAACGTGACCCGGAAGACGTGCTGCTGCGCCTACAACGTCGGCCAGGCCTGGAATAGACCCTGCGAGGCCTGCCCCACCCCCACCAGCCCCGATTACCAGGTCCTGTGTGGGAACCAGGTCCCGGGCTTCGTCGTCAACGTCCGCACGGGGGAGCCTGCTGACATTGACGAGTGTGGGGAGATTCCAGCTATCTGCACCCATGGCATCTGCGTCAACCAGGTTGGAAGTTTCCAGTGCGAGTGCCCCTCAGGCTTCGAGCACAACAGTGCCTTGCTGGCCTGCAAAGATGTGGACGAGTGTGCGGACAGGGAGAGGCCCTGCCCCAGGAACATGGAGTGCATCAACTTCCCCGGCAGCTACCGCTGCCAGTGCGCGCGGGGCTTCAGGCTGTCAGCCAGTGGGAACTGCGTGGGTCCGAACGAGTGTCAGGAGCGCCCCAATGTCTGTAGCCATGGCGACTGCGTGGACACGGAGGGCAGCTACAGGTGCCTGTGTCACCGCGGCTTCCGGGTCGTGGCAGACGGGACCCTATGCGTGGACCTCGATGAGTGCGAGAAGCAGCCGTGTGGAAACGGGACCTGCAAGAACACCGTTGGCTCCTACACCTGCCTCTGCTCCCCTGGCTTTGCGGCAGCCCGTGGCGGGAACTGTGTGGACATTGACGAGTGTCGCACCATGGCAGGGCAGGTGTGCCGATCAGGACAGTGCCTCAACAGAGCCGGCTCCTTCCACTGCCTCTGCCAGGAAGGCTTTGCGGTCACAGCTGATGGGAAGAACTGTGTGGACATCAACGAATGCTTGGAGGATCCCAACCTCTGCCTCTTTGGGACATGTACCAACAGTCCCGGGAGCTTCCAGTGCCTCTGCCCGCCTGGCTTTGCCCCCTCTGACCATGGGCACCGTTGCTTTGACACACGGCAGAGTTTCTGCTTCACTCGCTTTGAGGCTGGAAAGTGCTTGGTGCCTAAAGCTTTCAACACCACCAAGACCCGGTGCTGCTGCAGCAAGAGGCCGGGGGAGGCCTGGGGCGACCCCTGCGAGCTGTGTCCTCAGGAGGCCGGTGCTGCTTTTCAGGAGCTCTGTCCCTTTGGCCACGGGGCGGTCCCAGGCCCAGGGGATTCCAGAGAAGACGTGAACGAGTGCGCGGAGAACCCAGGCCTCTGCAGCGATGGTCTGTGTGTCAACACCGATGGCTCCTTCCGCTGCGAGTGTCCCTCTGGCTACAGCCTGGGCCCCACGGGCATCGGCTGTGTGGACACAGACGAGTGCTCTGGGGGGCAGCCCTGTGGGGAAGGCACGTGCAACAGTGTCATCCGGGGCTTCGAGTGTGCCTGCGCCGAGGGCTTTGAGCCCGGCCCCACGGCCAGCTGGGGGGACATGGACGAGTGCTTGCTGAACCCGCTGCTCTGCGCCTTCCGCTGCCACAACACCGAGGGCTCCTACATGTGTTCCTGCCCGGCTGGCTACGCCCTGCGTGAGGATGCGGCCACGTGCCAAGATGTGGATGAGTGTGCAGAGGGGTCACAAGACTGCCACGCCCTCGGCATGCTGTGCAAGAACCTCATCGGCACCTTCATGTGCATCTGCCCCCCGGGCATGCGGCCCCAGCCCAGCTCCAGGGAGGGCTGTATAGATGAGGACGAATGCCGAGCCCACCCCACCATCTGCACCCATGGCCAATGCATCAACACCGTGGGCAGCTTCCAGTGTGACTGTCACGAGGGCTTCCAGCCCAGCTCAACCCTCACTGAGTGCCACGATGCCCGGAAGGGACGCTGCTTCTCCGAGGTGCTGCAGGCCATGTGCCCGGGCCGCTGGAGCAGTGCTGAGGCTGTGCCCAGGGCCGTGTGCTGCTGTGGGGGTGGCCGTGGCTGGGGGCCCAGCTGCGAGCTCTGCCCTCTGCCTGGCACCTCTGCCTACAAGACACTGTGTCCCCATGGCTTGGGCTATACTACCGAAGGACGAGATGTGGACGAGTGCCATGTGCTTGCTCATCTGTGCGCCCACGGAGAGTGCATCAACAGCATGGGCTCCTTCCGTTGCCACTGCCAGGCCGGGTATGCGCCGGATGCCACTGCCACTGCCTGCCTGGATGTGGACGAGTGCGACCAAAACCCCAAGCCGTGTTCTTTCCTCTGCAAAAACACGGAAGGCAGCTTCCTGTGCACCTGCCCCCGGGGTTACCTACTGGAGGAAGACGGCAGGACCTGCAAAGACCTGGATGAGTGCTCCTCCCGGCAGCACCACAATTGCCAGTTCCTGTGCGTCAACACCATAGGTGCCTTCGCCTGCCGCTGCCCCCCGGGCTTCACTCAGCGTCACCAGGCCTGCTTCGACCAGGATGAGTGCTTGGCCCAGCCTGGCCCGTGTGGTGCCCATGGACGCTGCCTCAATGTCCCAGGCAGCTTCCGCTGTGAGTGCTACCAAGGCTTCACTCTGGACAGCTCAGGCCGCGGCTGCAAAGATGTGGATGAGTGTGACGGACCCCATCGCTGCCGTCATGGCTGTCAGAATGAGGTGGGGGGTTACCGCTGCAGCTGCCCCCAGGGCTTCACCCAGCACTCCCAGTGGGCGCAGTGTGTGGATGAGAACGAGTGTGCTGTGTCACCCACGGCCTGTGGCAGCGCCTCCTGCCACAACACCCTCGGTAGCTTCCGCTGCGTCTGCCCCTCTGGCTTTGACTTTGACCAGGCCCGCGGGGGCTGCCAGGATGTGGATGAGTGTGCTGGGCAGGGCAGCCCCTGTAGCTATGGCTGTGCCAACACTGCGGGTGGCTTCCTGTGCGGCTGCCCCAGAGGCTACTTCCGGGCCGGGCAAGGGCACTGTGTCTCTGCCCTGGCCTTCAGCTCTGGACAGCAGGAGGCCCCAAATGAGGAGGAGCAGCTCTTTCCAGAAGCCTGCTATGAATGCAAGATCAATGGCCTCACCCCTCAGGACCGGCACCGGCGCACCTCTCATCACCCACCTGGTCTTTCTCCTCAGGTGAGCATGGCCGCCCTCGACGCCGAAGTGCCCCTGACCTTGGGCCTGAACCTCTCACGCCTAAGCCAGGCCGAGCACATCCTGGAGCTGCGGCCAGCTCTGCAGGGCCTGCAAGGCCAAGTCCGCTACATCATTTCCCATGGCAACAGGCAAAGTTTCTTCTGCATGCAGCACCGGAGTGGCCTCAGCTTCCTGCAGCTGGGGTGGCGCAGGCCGGGGCCTGGAACATACCAGGTGGAGGTGGTGAGCGTGGCAGGGACCCAGGGTGTCTGGCAGGGACCCAAGGGCCGGGCCTTGCGGCTGAAGGTGCAATTGCAGCTCCTCTAG

XM_004866035.1 Coding sequence

LOC101726738 olfactory receptor 7G2-like

Length: 969 bp    Location: 16519..17487   Strand: +
>XM_004866035.1
ATGGAACCTAGAAACCAAACAGCCATCTCAGAATTCCTTCTCTTGGGACTGACAGATGATCCAGAGCTGCAGCCCCTCATTTTCATCCTATTCCTGTCCATGTACCTGGCAACCATCCTGGGAAACCTGCTCATCATCCTGGCCGTCAGATCTGACTCTCACCTCCACACTCCCATGTACATCTTCCTCTCCATTCTGTCCATTAATGACATGTGTTTAAGTACAACCACCATCCCACACATGCTGGTGAGCATTCAAACACAGGATCAGAGCATCTTTTACAGAAGCTGCCTTGCTCAGATCTGTTTAGTCTTGTTTTTTGGTAATTTTGAAAGTTGTCTCCTGGCAGTGATGGCCTATGACCGCTATGTGGCCATCTGCCATCCCCTTAGGTACATAGTCATCATGAGCACCCGTATGTGTCTTTCACTGAGTCTTTTCCCCTTGGTCATTAGCATCATGGACGCACTGCTCCACAGTCTGATGATCCTAAGGCTTTCCTTCTGCACAGAGCTGAGCATCCCCCACTTCTTCTGTGAACTTGCCCAGATAATCAGGCTCACTTGTTCTGACACTTTAGTTGATAACATAGTACTATACGTTGCAGCTTGCATCTTGGGTGGTGTACCTGCATTTGGAATCATGCTTTCTTATATTCACGTTGTGTCATCTATCTTGAGAATGCCATCATCAGAAAGAAAATATAAAGCGTTTTCTACCTGTGGCTCTCATCTCTTAGTTGTCACCTTATTCTATGGGACGGGTTTGGGAGTGTACATTAGTTCTTTCATAACTAACTCATCCAAAAATGTTGCAGTGGCTTCAGTGATGTATTCTGTGGTCCCTCAAATGATGAATCCCTTCATCTACAGCCTGAGGAACAGGGATATGCAGAAAGCTTTGTGGAAACTTATTAATAGGATAGCTTCTCTTCTGCAATGTGAGAGTGGTCTGGAACTGTGGGTCTAG

XM_004866024.1 Coding sequence

Cdc34 cell division cycle 34, transcript variant X2

Length: 849 bp    Location: 7942611..7936006   Strand: -
>XM_004866024.1
ATGGCTCGGCCGCTGGTGCCCAGTTCCCAGAAGGCGCTGCTGCTGGAACTCAAGGGGCTGCAGGAGGAACCGGTAGAGGGCTTCCGCGTGGCTCTGGTGGACGAGGGCGACCTGTACAACTGGGAGGTGGCCATCTTCGGGCCCCCCAACACCTACTACGAAGGCGGCTACTTCAAGGCCCGGCTCAAATTCCCCATCGACTACCCATACTCCCCACCAGCCTTCCGCTTCCTGACCAAGATGTGGCACCCGAACATCTATGAGGTGAGCCCGTGCTGCCATGCATGCATCTGCACACTCGTAGACACGGGCACGGGCACGGACACATGCACGCCTCCCATGAGGAGCGCTACACACGCGTGCACACATACCCACATCCCTCAGCCTGTGCTTGCCAAGTGCTGGGAGCCAGCTGACCAGTGCTACTCTCCTCCTCGCAGACAGGGGATGTGTGCATCTCCATCCTGCACCCCCCAGTCGATGACCCCCAGAGTGGGGAGCTGCCCTCAGAGCGGTGGAACCCCACACAGAATGTCAGGTGAGGGCACCACCTGTCCCCGGCCCAGACCCTCGCGGCACCCCCACTGTATCCCAGCTTGCGGCTCCTCATGTTCTGGGGTGCAGGTTTTTGTGTGCCTGGTGTCCCCTTCCCTGACCCACCGCTCCCCCAGGACCATCCTCCTGAGCGTGATATCCCTGCTGAATGAGCCCAACACCTTCTCGCCGGCCAACGTGGACGCCTCAGTGATGTACAGGAAGTGGAAGGAGAGCAAGGGCAAGGACCGCGAGTACACAGACATCATCCGCAGGTCCTGGGGACCAAGGTTGATGCAGAGCGCGACGGCGTGA

XM_004866034.1 Coding sequence

LOC101726004 uncharacterized LOC101726004

Length: 549 bp    Location: 8060255..8053226   Strand: -
>XM_004866034.1
ATGGACACCCAACTGCCCCGCGCACCACCGTGGGTACAAGGCGGGCAGCGTGCTGTGCCGTGTGACTTCCACCAGGTGGCTCAGTCTCCCGGGACCCACCCAGGCTGTTTGGAAGGAAAGCTAACTGGCAAAAACATGGACACAAGCAAGACGTCCTCCAGCCGGGGCAAGATAAACCAGACCCATCCACGCCCCGGAATATATGAGCCGCAGAGAAGTGAGCCATGGACCTCAGGAGCCATGGAGGAGCCAAGAGTGGAATGCACGCGGCCTCGACGCGTTCAGAAGCAGCGGCCTCACCAGGTGCACCCTGCGCAACTGTCCGAAGCCGAGGTGCAGACAACAGTCAGGAGAGCAGCCAGAGGCTTTTCCCAGGCATTTGGTCAGCGTGTGAAAAGCAGAGCCACACAGCACAGGATCAGGGGCACCAAGGACCTGCTGGGACCGAGTCTGGCTCCACCAGACCTGGTGACCCGCCCCCAGGGAGACCCGCTCCGGTCTGCCAGCCTGCCCGTCTGCCCAGCCTCCAGGACCAGGGCCTCTGCCTGA

XM_004866025.1 Coding sequence

Cdc34 cell division cycle 34, transcript variant X3

High confidence: 4 potential gene matches
Length: 705 bp    Location: 7942592..7935544   Strand: -
>XM_004866025.1
ATGGCTCGGCCGCTGGTGCCCAGTTCCCAGAAGGCGCTGCTGCTGGAACTCAAGGGGCTGCAGGAGGAACCGGTAGAGGGCTTCCGCGTGGCTCTGGTGGACGAGGGCGACCTGTACAACTGGGAGGTGGCCATCTTCGGGCCCCCCAACACCTACTACGAAGGCGGCTACTTCAAGGCCCGGCTCAAATTCCCCATCGACTACCCATACTCCCCACCAGCCTTCCGCTTCCTGACCAAGATGTGGCACCCGAACATCTATGAGACAGGGGATGTGTGCATCTCCATCCTGCACCCCCCAGTCGATGACCCCCAGAGTGGGGAGCTGCCCTCAGAGCGGTGGAACCCCACACAGAATGTCAGGACCATCCTCCTGAGCGTGATATCCCTGCTGAATGAGCCCAACACCTTCTCGCCGGCCAACGTGGACGCCTCAGTGATGTACAGGAAGTGGAAGGAGAGCAAGGGCAAGGACCGCGAGTACACAGACATCATCCGGAAGCAGGTCCTGGGGACCAAGGTTGATGCAGAGCGCGACGGCGTGAAGGTGCCCACCACACTGGCCGAGTACTGTGTGAAGAGCAAGGCACCAGCGCCCGACGAGGGGACGGACCTGCTCTACGACGACTACTATGAGGACGGCGAGGCGGACGAGGCTGGCAGCTGCCTGGGGGACGAGGACAGCTCCGGCAACGAGGGGTCCTGA

XM_004866021.1 Coding sequence

Polrmt polymerase (RNA) mitochondrial (DNA directed), transcript variant X2

Length: 3948 bp    Location: 7876667..7888990   Strand: +
>XM_004866021.1
ATGGCTGCGCTGCGCTGGGGCCGAGGTGCGGCGGATCTCAGCAGGGCGTTGCGGTCCTCTGGCCCCCCCTGCAACACGGCCAAAGAAGGGATCCTCGGTGGCCTCTGGAGTCCCAGAAGGAACTCCTCTGCCAGCCCCTGTGAGCAGGAACGCCGGAAGGACTGGGGCCATGTAGAACTACTGGAGGTACTGGAGGCCCGGGTGCGGCAGCTGCAGGCAGAGAGCGTGTCTGAAGTGACAGTGAAGAGGGTGGAGGTGGCTCAAGTCTCCGCTGACAGTGGCAGGGCTGGTGGCACCCTGCCACCTGTCAAGGCCAAGCTAAGGATCTCCGGGGCCTGGGGAAGGAAGCTGGACCAGGACCAGCAGATGCTACAGAAGCAGCAAAAGTTATTGCAGGAGAAGCTGCAGGCAAAGGGTCAGTTCCTGGTCCCCGAGTTCAAGCTCAGGGGTAAGGCCAAGGCCAAAGCCAAAGCTAAGCCCACAGCCATGGCCATGGCCAAATCCCCCACCAAGCCCATGGGCACGTCCACAACTGCATCCAAGGCCAAGCCATTGGCCACAGCTGCACCCAAGGCCAAGCCATTGGCCACAGCTGCACCCAAGGCCAAGCCATTGGCCACAGCTGCACCCAAGGCCAAGCCATTGGCCACAGCTGCACCCAAGGCCAAGCCATTGGCCACAGCTGCACCCAAGGCCAAGCCATTGGTCACAGCTGCACCCAAGGCCAAGCCTGCAGCCATGGCCGAACTGCCACTCTCTGAGCCCCAACTGGTGAGTGAGCAGCTGGCCAGTGAGAAAGGCAGAACGGAGAGACTAGCAGAGAAGCCTGAGGAGTGGGATCCCTTCCAGCTGTCTGTGGCTCCCCTGAATCTGAGCTGGAGCAAGCCACAGGGCCCACTGAACCTGGAGCAGCAGGCACGGCAGCAGAGGTTTCAGGCCTTCTTCGAGTGCTGCCTGGCCACCGAGCAGGTGACCCTCGCCCACCACATGTTGGTCAGAAAACACTTCTCGAAGTCCAAGCACTGGTGGATCACGCAAGCCATGTACAACACCGTCATGCTCGGCTGGGCTCGAGAGGGTTCCTACAAGGAACTGTTGTCTGTGCTGAGGATGATGAAATACAACGGCTTCACCCCAGATTTGCTTTCCTACGCCTCTATCCTGCAGTGCATGGGGCGGGTGGATCAGGATGTCACCATCATCCAAAGGTGTCTGGAGCAGATGGCCCAGGATGGTGTGCAGCTGGAGCAGCTGTTCTACGAGGAGACCCTGTCCAACGAGGAGAGGGCTGCGATGCTGCGGGCTGTGCTCAAGGCCAAGCCCGACTTCCGGCTGCCACAGCCCTCACCACAGGTCAACACCTCGCCGCTGCTCCGGGAGGTCTACTCCAAGGATGGCCCTGTGTCCTACCCGAGGCTGCACCTCCCCCTGAAGACACTGCAGGCCATGTTCCAGCAGCAGCTGAGTGTGGAGCTGGCCAGCATCGTCCATGTTGAGTCCGTGGAAAAGACCTTGTCGCCAACCCAGGAGACCCTGGAGGCGCGGAAGACCCTGGCAGCCCTGCACACAACCTGGGAGTCTGAGCTGCATAGCCAGCTGCAGAAGGCCAAGGCCCACCTGGCCAAGGTCACAAGCTACGGGCATCCCACGCTCTACCCCTTCCTGTGCACGGTCCCCGAGGATGAGCTGGTGCAGATGCTCCTACAGTTCCTGCACACAATGCCCGCCCAGGGCGAGCCGTTCGTGTACGTGGTGCACCGGCTGGCCATGCAGACCTTCCAGCGGCACATCGTGCAGCAGAGGCGGTGCCGTGGCCAGCTGCTGGCGCTGGAGCAGCGGTACATGCAGTACCTACAGCTGCTTGCCTCTGACACCCAGGTGGCTGAGCCCTGCCTGCCACGGCAGCACTGGGAGACGCTGGGGCCACCCGAGCCTGCACCACCACAGGTCTGGCCCCTCATGGAGCTCCTGTCACTGGGCAAGCTTCTCCTAGAGATCCTGGTGCAGTCAGTGCAGCTGCCGCCCAGCCTGGCCCTACCTCAGAGCTCCTCCTCCCAGCCAGTCCCTGTGCTGTACCACGTGTATACCTTCCGTGGTATACGCCAGATTGGCTTCCTGAGGCCACACCCGGCCTTCATTCAGCTGCTGGACGATGCTGCAGAGCCCTTGATGATCTTTGAGGCAACCGACATGCCCATGCTGTGCCCCCCACTGCCCTGGGCCTCGTCACAGTCTGGAGGCTTCCTGCTGAGCCCCACCAAGCTGATGCGCTCTGTGGATGGCTCCCTGCAGCACCAGAACCTGCTGGACAGCTGGCCGCCCACCGAGCTGCATGGCGCCCTGGACACCCTCACGCAGCTGGGCAACTGTGCCTGGCGTGTCAATGGGCGCGTGCTGGACCTGGTGCTGGAGATCTTCCGCAACAAGGGCTGTGCGCGCCTGGGTGTACCGCCACCTGCCTCTGAGGCACCGCGTCCACCGCTGGAGGACTTGCCACCCAATGCCTCACCGCATCGCAAGGCTGAGCTGCGGCAGGAGGTGGCCAGCTGCCTGAAGATCGCACGGGAGATGCATGGCCTGCGGCGGGAGGCCTTGTACCGCCTGTCGCTGGCCCAGCACCTGCGGCACCAGGTCTTCTGGCTGCCGCACAACATGGACTTCCGCGGCCGCAGTTACCCCTGCCCGCCCCACTTCAATCACCTGGGCAGCGACCTGGCCCGTGCCCTGCTGGAGTTTGCTGAGGGCCGCCCACTTGGCCCCCATGGTCTTGACTGGCTCAAGATCCACCTGATCAACCTCACTGGGGTCAAGAAGCGTGAGTCACTCCGCGTCCGCCTGGCCTTTGCCAACACCGTGATGGATGACATCCTGGACTCAGCTGACCAGCCCATGACGGGCCGGAAGTGGTGGATGGAAGCTGAGGACCCCTGGCAGACACTGGCGTGCTGCATGGAGGTGGCTGGGGCTGTGCGGTCCCCAGACCCTGCTGCCTATGTGTCCCATCTGCCCATTCACCAGGATGGCTCCTGCAATGGCCTGCAGCATTACGCCGCCTTGGGCCGAGATAGTGTGGGCGCTGCCTCTGTCAACTTGATGGCCTCGGACAAGCCACAGGATGTGTACAGTGGGGTGGCTGCACAGGTGGAGGTGTTCCGCACTCAGGATGCGAAGCAGGGGCTGAAGGTGGCCCAGGTGCTGGAGGGCTTCATCAGCCGCAAGGTGGTGAAGCAGACAGTCATGACCGTGGTCTACGGGGTCACCCTCTACGGCGGGCGCCTGCAAATCGAGAAGCGCCTCCGCGAGCTCAGTGACTTCCCACAGGTCTTTGTGTGGGAAGCCTCCCGTTACCTGGTGCGCCTGGTCTTCAAGAGCCTCCAGGAGATCTTCTCAAGCACCCGGACCATCCAGCACTGGCTGACCGAGAGCGCCCGCTTAATTGCCCAGGCGGGCTCAGCCGTGGAGTGGGTCACACCCCTGGGCATTCCCATTATCCAGCCCTACCACCGGGAGTCCAAGTTGCTCAGAGGCGGCCTCCAGAGCATCACCTGGAACAGCTCCGTGGATCCCACCAGGAAGCCCAACACGATGAAGCAGAAGAATGGCTTCCCGCCCAACTTCATCCACTCTCTGGACTCCTGCCACATGATGCTCACAGCCCTGCATTGCTACAGGAAGGGCCTGACCTTCGTCTCTGTGCATGACTGCTTCTGGACACACGCGTGTGACGTCCCCATCATGAATCAGGTGTGCCGAGAGCAGTTCATCAGGCTGCATAGCCAGCCCATCCTGGAGGACCTGTCCGCCTTTCTGGTGAGGCGCTTCTGCTCGGCAGACAGAGCCGAGCTCGGGACAGACACCAGGCAGCTGCTGGAGACGCTGTTATCCGTGCCGCAGAAAGGGGACTTTGACCTGCAGCAGGTGAAGAGCTCCACCTACTTCTTCAGCTGA

XM_004866019.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1161 bp    Location: 7920930..7913297   Strand: -
>XM_004866019.1
ATGGCGGCTGCGCTGCTTTTGGCGCTGGGCCTCGTGCTGCTGGACGTCCAGGGCACCTCCGCGGCGGCTGGCTTTCTCACAGGCCCACTGTCCCAGAAGGGGCGGGCAGGGGGCAGCATCTAGCTGCACTGCGAGGTGGTTGGCAGCCCTATCCCCGAGATCCAGTGGTGGTTTGAAGGGAACCAGGCCAGCAACTCCTGCTCCNTGCTCTGGGACGGTGCCCAGCAGGACCATGTCCACATCCACGCCGCCTACCACCAGCATGCGGCCAGCACCGTGTCCATCGAGGGCCTCACCGCCAAGGACGCGGGCACATATGAGTGCTTCGCCAGCAAGGACCCCAACCGTAACTACCTGACCTGGGCACCCAGAGTAAAATGGGTCCACACCCAGGCAAGCGTGGTGGTCCTTGAATTGGGCCCCATCACGACCACTGTGAATGACATTGGCTCCAAGGTGTACCTGACCTGCCTCATGAACCACAGTGACATCGCTGTCACGGGGCACCAGTGGCTGAGGGATGGCAAGGTGCTGAAGGAAGACGAACTGCCCGACCTGCACACCGAATACCAGATGAACAAGGAGGGCAGCATGGGCGAGTACTTCTGTGTCTTCCTGCCCGAGGAGGCTCTGGGCAGGGCCGCAGTCACAGTGCCTGGGCCCCCGGTGATCAAGGCCACCAGGAAGTCCGAGCACGCCAGTGAGGGGGAGACAGTCACACTGGTCTGCAAGTCCGACTCCTACCCCCCCATTGACACCTGGGTCTGGTACAAGGTGGTTGACTCCAGCTACCAGGTCATCACCAACGACTCCCAGAGCAAGTTCTTCGTGAGCTCCTCAGGGGCCAGGTCGGAGCTTCGCATCAAGGAGCTGGACATGACTCTCGACCCTGGCACCTACGCCTGCAACGGCACCAATGTAGAGGGCACCAGCCACGCCACCATTACCTTGCGTGTGCGCAGCCACCTGGCTGCACTTTGGCCCTTCCTGGGCATTGTGGCAGAGGTGCTGGTGCTGGTCACCATCATCTTCATCTATGAGAAGCGGCGGAAGCCAGATGAGCCCCTGGATGATGACGACGCAGGGTCCGTACCTCTGAAAGGCAACGCGCCCCACGTGAACGACAAAGGCAAGAACGTCCGCCAGAGGAACGCCACCTGA

XM_004866015.1 Coding sequence

Palm paralemmin, transcript variant X4

Length: 1086 bp    Location: 7833977..7812108   Strand: -
>XM_004866015.1
ATGGGGCGGGCAGGGCGCGGCCGGCTCTGGGGTCTGGGTCTCAGCGCTCGTGCCCACCCTGCTGATGTGAGGTCCCCTGCCCTCCAGGAGCGGCGGAAGAGGCAGGCGGAGATTGAGAACAAGCGGCGGCAGCTGGAGGATGACAGGCGGCAGCTACAGCACCTGAAGTCCAAGGCTCTGCGGGAACGCTGGCTGCTGGAGGGGACACCGTCTTCAGCCTCGGAGGGGGATGAGGACATGCGGAGGCAGATGCAGGAGGACGAGCAGAGGGCCCGGCTCCTGGAGGGGTCCATCTCCAGGCTGGAGAAGGAGATTGACCTGCTGGAGAACGGAGAGGTGGCCCCGGCCACGTCGAAGAACGCAGCCGTCCCCAGCCCAGCCCGAGCCCCAGCCCCCAGCCCTGCCCGGGAGGAGCCCAAGGCTGAGGTGGTGCTGAATTCACAGCAGACCGCGGCGGGCACGCCCAAAGCAGAGCAGCGAGTCTCCAACACCCCAGTGCGGACAGCAGATGGCTCCACCATGATGAAGGCAGTGGTCCATGCCGTTGACGGCACCGTGGAGAACGGGATTCACCCGCTCAGCTCCTCGGAGGTGGACGAACTCATCCACAAGGCAGACGAGGTCACCCTGAGTGAGGCCGAGGCCGGGGCCGGGGCCGGGGCAGCGGCAGAGACCCGGGGGTCGGCGGTGGCGGTGGCGGTGGAGGAGACCGTCCGGAACACGCCGCTGCGGCGAGAGATCACTGGGGTCCAGGCCCAGCCTGGTGAGGCCACATCAGGCCTGGCCAGTGCCCAGCCCAGCCAGGAGCCCCCGGTCACCATGATCTTCATGGGCTACCAGAATGTGGAGGACGAGTCCGAGACCAAGAAGGTGCTGGGGCTCCAAGACACCATCACAGCCGAGCTGGTGGTCATCGAGGACGCGGCTGAGCCCACGGAGGCCGCGCCGCCCAACGGCAGTGCGCCCGAAGCCCCCGCTGCCCCGAGCTCCAGGGAAGAGGACCGCGCCAGGCCCGAGGCCACCACCAGCGACCCCCAGGACCTCGATCTGAAAAAGCAACGCTGTAAATGCTGCTCAGTCATGTGA

XM_004866008.1 Coding sequence

LOC101717632 lipid phosphate phosphatase-related protein type 3-like, transcript variant X1

Length: 2199 bp    Location: 7740712..7750001   Strand: +
>XM_004866008.1
ATGATCTCCGCCAAGGAAAAGAATAAAAGCCCGAAGGACAGCATGACGCTTCTGCCCTGCTTCTACTTCGTGGAGCTGCCCATCGTGGCATCCTCCATCGTGTCCCTGTACTTCCTGGAGCTGACGGACCTTTTCAAGCCAGCCAAGGTCGGGTTCCAGTGCTATGACCGCACACTGTCCATGCCCTACGTGGAGACCAGTGAGGAGCTCATCCCGCTACTCATGCTGCTCAGCCTGGCATTTGCGGCCCCCGCCGCCTCGATCATGGTCGGCGAGGGCTTGCTGTACTGCCTGCAGTCTCGGCTCTGGGGCCGCGGTGGGGGACCCGGCGGGGCTGAGGGCAGCATCAATGCCGGCGGCTGCAATTTCAACTCCTTCCTGCGGCGCACGGTGCGCTTTGTGGGTGTCCACGTGTTCGGCCTCTGTGCCACCGCCCTGGTGACTGACGTCATCCAGCTGGCCACCGGCTACCACGCACCCTTCTTCCTCACTGTGTGCAAACCCAACTACACGCTGCTGGGCACCTCGTGTGAGGCGAACCCCTACATCACACAGGACATCTGCTCGGGCCATGATACTCACGCTATCCTGTCTGCACGGAAGACCTTCCCGTCACAGCACGCCACGCTCTCGGCCTTCGCCGCCGTCTACGTGTCGATGTACTTCAACTCTGTCATTTCGGATACCACCAAGCTGCTCAAGCCCATCCTGGTGTTTGCCTTCGCCATCGCTGCGGGCGTATGTGGGCTCACCCAGATCACGCAGTACCGAAGCCACCCGGTGGACGTCTACGCTGGCTTCCTCATCGGGGCTGGCATCGCCGCTTACCTGGCTTGCCACGCAGTGGGCAAATTCCAGGCTCTGCCCACCGAGAAGCCCACGGCCCCGGCACCCGCCAAAGACCCACTACGGGCGCTGACGCAGCGTGGCCACGACTCGGTTTACCAGCAGAACAAGTCCGTGAGCACCGACGAGCTGGGACCGCCCGGCCGGCTGGAGGGGGCGCCGCGGCCCGTGGCGCGCGAGAAGACGTCGCTGGGCAGCCTGAAGCGCGCCAGCGTGGACGTGGACCTGCTGGCCCCGCGGAGCCCCATGGGCAAGGAGAACATGGTGACCTTCAGCAACACCCTGCCGCGCGTCAGCACGCCCTCACTGGACGACCCAGCGCGCCGCCACATGACCATCCACGTGCCGCTCGACGCCTCCCGCTCCAAGCAACTCATCAGCCAGTGGAAGCAGAAGGCGCAGGAGGGGCGCGCGCTGGGGCTCCCGGACGAGGCCAGCCCCGCGCACCTGCGCACACCCGCCGAGCCCATGGCCGAGGAGGAGGAAGAGGAGGAGGACGAAGACGAGGAGGACGAAGACGAGGAGGAGGAAGACGAAGAGGAGGAAGAGGAGGAGGACGGGGCCCCCGCGCCACCCTCGTTGTACCCCACGGTGCAGGCGCGGCCAGGGCTGGGGCCACGCGTGCTGCTCCCGCCGCGCCCGGGCCCGCAGCCGCTCGTGCACATCCCCGAGGAGGGCGCGCCGGCGGCGGGCGCGGGTTTGTCCCCCAAGAGCGGCGCCGCAGTGCGCGCCAAGTGGCTGGTGATGGCGGAGAGGGGCGCGGCCCCGGTTCCTGCGGCCGCGGCACCGCCCCGCGCGCCCAACCCACCGCGCCTCCTGCAGGTGATCGCCATGTCCAAGGCGCCCGGCGCCAAGGCGGCGGCCGAGACTACGTCGTCGTCCAGCGCCAGCTCGGACTCCTCGCAGTATCGCTCGCCCTCGGACCGCGACTCAGCCAGCGTGGTCACCGTGGACGCGCACGCACCGCACCACCCCGTGGTGCACCTGTCGGCGGCCGGCGCGCCCTGGGAGTGGCGGGCGGCAGGCGGCGCTGCACGGGTCCCCGAGGGCGACAGCGGCTACGAGCTGGGGGATCTGGCCCGTGCTTTCCGCCCCGGCCCTCGGGCCCCGGGTACATCCCCTGGCTCATCCGTCAGCGACGCAGAGCAGGAAGAGCCGCGTTTCGCGGCCGTGGCAACGGTCAACCTGGCCACTGGTGAGGGGCTGCCCCCACCGGGCGCGGCGGATGGGGTTTTGGGGCCCGGCAGCCGCGAGGCCACGCTGCGGCGCCCGGGCCCAGGCGAGCGCGAGGCGGGCGAGGCAGAGGCGGAGAGCTACTACCGCAGGATGCAGGCCCGCCGCTTCCCGGACTGA

XM_004866007.1 Coding sequence

Ptbp1 polypyrimidine tract binding protein 1, transcript variant X8

Length: 1596 bp    Location: 7762589..7750323   Strand: -
>XM_004866007.1
ATGGACGGCATCGTCCCAGACATAGCAGTTGGTACAAAGCGGGGATCTGACGAGCTCTTTTCTACGTGTGTAACCAACGGGCCCTTTATCATGAGCAGCAACTCGGCTTCCACAGCAAACGGAAACGACAGCAAGAAGTTCAAAGGTGACAGCAGGAGTGCTGGCGTCCCCTCCAGAGTGATCCACATCCGAAAGCTGCCCAGCGACGTGACTGAAGGCGAGGTCATCTCCCTGGGGCTGCCCTTTGGGAAGGTCACCAATCTCCTGATGCTCAAGGGGAAGAACCAGGCTTTCATCGAGATGAACACGGAGGAGGCAGCCAACACCATGGTGAACTACTATACCTCTGTGACGCCTGTCCTGCGAGGTCAGCCCATCTACATCCAGTTCTCCAACCACAAAGAGCTCAAGACTGATAGCTCCCCGAACCAGGCGCGGGCCCAGGCAGCACTACAGGCTGTGAACTCTGTCCAGTCGGGGAACCTGGCCCTGGCTGCTTCGGCGGCTGCTGTGGACGCAGGGATGGCAATGGCTGGGCAGAGCCCCGTGCTCAGGATCATCGTGGAGAACCTCTTCTACCCCGTGACCCTGGATGTGCTGCACCAGATCTTCTCCAAGTTTGGCACTGTCCTGAAGATCATCACCTTCACGAAGAACAGTCAGTTCCAGGCGCTGCTCCAGTACGCCGACCCCGTGAGCGCCCAGCACGCCAAGCTGTCGCTGGACGGGCAGAACATCTACAACGCCTGCTGTACCCTGCGCATCGACTTCTCCAAGCTCACCAGCCTCAATGTCAAGTACAACAACGACAAAAGCCGTGACTATACGCGCCCAGACCTGCCCTCTGGGGACAGCCAGCCCTCGCTGGACCAGACCATGGCCGCAGCCTTCGGCTTGTCTGTCCCCAACGTGCACGGAGCGCTGGCGCCCCTGGCCATTCCCTCAGCAGCTGCAGCAGCAGCTGCAGCGGGCCGCATCGGCATCCCAGGCCTCGGGGGGGCCGGGAACTCTGTCCTGCTGGTCAGCAACCTCAACCCGGAGAGAGTCACACCCCAAAGCCTCTTTATTCTTTTCGGCGTTTACGGTGACGTGCAGCGGGTGAAGATCTTGTTCAACAAGAAGGAGAACGCACTGGTGCAGATGGCAGATGGGAGCCAGGCCCAGCTGGCCATGAGTCACCTGAACGGGCACAAGCTGCATGGGAAGCCGATCCGCATCACGCTGTCCAAGCACCAGAATGTGCAGTTGCCCAGGGAGGGCCAGGAGGACCAGGGCCTCACCAAGGACTATGGCAACTCGCCCCTGCATCGCTTCAAGAAGCCTGGCTCCAAGAACTTCCAGAACATCTTCCCACCCTCCGCCACACTGCACCTCTCCAACATCCCGCCCTCAGTATCTGAGGAAGACCTCAAGAGCCTCTTCTCCAGCAACGGGGGTGTGGTGAAGGGCTTCAAGTTCTTCCAGAAAGACCGCAAGATGGCGCTGATCCAGATGGGCTCAGTGGAGGAGGCTGTGCAGGCCCTCATCGACCTGCACAACCACGACCTGGGCGAGAACCACCACCTGCGGGTGTCCTTCTCCAAGTCCACCATCTAG

XM_004865945.1 Coding sequence

Reep6 receptor accessory protein 6, transcript variant X3

Length: 606 bp    Location: 7208112..7204227   Strand: -
>XM_004865945.1
ATGGACAGGTTGCGCCGGCTCTTCGAGCACTTTCTGGAACAGAGGAACTTTGCCACCGAAGCGCTCGAAGCGCTCGAAGCCAGGACCGGTGTCGAGAAGCGGTATCTGGCCGCGGGAGCTGTCACTGTGCTAAGCCTGTATCTTCTCTTTGGCCACGGGGCATCTCTACTCTGCAATCTTATCGGATTTGTGTACCCCGCCTATGCTTCAATCAAAGCTATCGAGAGTCCAAGCAAAGAAGACGACACTGTGTGGCTGACCTACTGGGTGGTGTACGCCCTGTTCGGGCTGGCAGAGTTCTTCAGCGATCTTCTGCTGTTCTGGTTCCCTTTCTACTACGTGGGCAAGTGCGCCTTCCTGTTGTTCTGCATGAGCCCCGGGCCCTGGAACGGGGCACTGCTGCTGTACCAGCGGCTCGTGCGTCCGCTCTTCCTAAAGCACCACGCGGCTGTGGACAGCGCCGTGAGCCAGCTCAGCGGCCAGGTCCTGGACACGGCGTCCGGAATAACAAGGGATGTGCTACGGGCCCTGGCCCTCGGCCGGGCATTCGTAACCCCGGCAGTGGTGGCGGAAGCCCCCATGGCCCTGGAAGGCGACTGTACGTAA

XM_004865946.1 Coding sequence

LOC101698832 chromosome unknown open reading frame, human C19orf25

Length: 354 bp    Location: 7217601..7220839   Strand: +
>XM_004865946.1
ATGGGCTCCAAGACCAAGAAGCGCGTGGTGCTGCCCACCCGCCCCGCACCCCCCACGGTGGAGCAGATCTTGGAGGACGTGCGGGGGGCGCCGGCCCAGGACCCCGTCTTCACCGCACTAGCCCCGGAAGAGCCTCCAGTCCCCTCCAGGAACACCGAGGATCCTGAGGCCCAGTGGGAGCGGTTCTATCTGCAGGGCCGGGCCTATGTGGCCACCAATGATCGGCTGCAGCAGGCCAGGGACCAGGTGAGGCAGAGGTGCGAGGACCTGTGTCGAGCCAGTGAGGAGCTGGAGCGGGACGTCGGCCAGGTGACACAGACTGTGCTGCCGGTGACCTCGGCCACCTCAGACTGA

XM_004865993.1 Coding sequence

Arid3a AT rich interactive domain 3A (BRIGHT-like), transcript variant X6

High confidence: 4 potential gene matches
Length: 1815 bp    Location: 7662691..7638669   Strand: -
>XM_004865993.1
ATGAAGCTGCAGGCGGTGATGGAGACCCTCTTGCAACGGCAGCAACGTGCACACCAGGAGCTAGAGGCCCGGCAGCAGCCACCACCGCCTGAGAACCCCACTGCAGGACCTGCAGCCCGGGCACGGGGCACCCCGGATGAGGACAGAGAGCCTGACAGTGCACGAATGCAGAGGGCACAGATGGCCGCGCTGGCTGCCATGCGGGCTGCTGCTGCAGGCCTCGGACACCCGCCCAGCCCTGGTGGCGGCTCTGAGGATGGTCCCCCTGGCTCAGAAGATGAGGACATGGACCAGGAGGGGGGTCCCAGCTCACCCGGCCGAGGCAAGGAGGGGCTAGGATGCTTGGAAGGAGATGGACACTTTGAGGATATGGGCTCCGATGATGACATGAAGCAAAAGTGGGAGGAGGAAGAGGAGCTCGAGGAGGACATGGGGGACGAGGAGGAGGACGAGGAGGAGGAGGAAGAGGACTTCGAGGAAGAGGAGGAGGACGATGAGGAAGAGGGGCTGGGCCCCCCGGGCCCTACAGGCCTGAGCTCCACAGGCCTCTTCCCCCGAAAGGCCCCACCAGCCCAGGCCTTCCGCGGAGATGGCGTCCCCAGGGCGCTGGGTGGCCCCGCACGGCTGGGAACTGGCCCTGCTCATCCCGGAGGAGCCACCCACGTGGCCTCTCAGCTGCAGCCGCCCGACCATGGGGACTGGACCTACGAGGAGCAGTTCAAGCAGCTCTACGAACTCGATGGGGACCCTAAGAGGAAGGAGTTCCTGGATGACTTGTTCAGCTTCATGCAGAAGCGAGGCACACCCGTGAACCGCATCCCCATCATGGCCAAGCAGGTGCTTGACCTGTTCATGCTGTACGTTCTGGTGACGGAGAAGGGCGGCCTGGTGGAGGTCATCAACAAGAAGCTGTGGCGGGAGATCACTAAGGGCCTCAACCTGCCCACCTCCATCACCAGCGCTGCCTTCACGCTGAGGACCCAGTATATGAAGTACTTGTATCCCTACGAGTGTGAGCGGCGTGGCCTCAGCAGCCCCAACGAGCTCCAGGCCGCCATCGATAGCAACAGGAGGGAAGGCCGGCGCCAGAGCTTCGGCGGCTCCCTCTTCGCCTATTCGCCAGGCAGTGCCCACGGCATGCTGTCCTCACCCAAGCTGCCCGTGCAGTCCCTGGGCCTGGCCGCCAGCACCAACGGCAGCTCCATCACCCCAGCCCCCAAGATCAAGAAAGAGGAGGACTCAGCCATCCCCATCACAGTCCCCAGCCGCTTGCCTGTGTCCCTGGCTGGCCACCCAGTGGTGGCAGCCCAGGCAGCAGTGCAAGCGGCAGCGGCCCAGGCAGCCGTGGCAGCGCAGGCAGCGGCCCTGGAGCACATCCGGGAGAAGCTGGAGTCTGGGGAGCCCCCGGAGAAGAAGATGGTGCTGGTCGCTGATGAGCAGCAGCGGCTCCTGCACCGGGCTCTGCAGCAGAACTTACTGGCCATGACTGCCCAGCTGCCCATGAGCATCCGGATCAACAGCCAAGCCTCTGAGAGCCGGCAGGACTCGGCTGTCAGCCTCGCAGGCGCCAACGGCAGCAACAGTATTAGTATGTCGGTCGAGCTCAACGGCATCATGTACACAGGGGTCCTGTTTGCTCAGCCGCCAGCCCCCACGCCACCCTCAGCACCCAGCAAAGGCAGTGGTGGTGGCAGTGGTGGCAGCAGCAGCAGCAACTCAGGTGGCCGGGGAGGACCCGCAGGGACCAGCTCGGGCAGCCAGGCAGGTGCAGCACCGCACCCCACGTCTTCTACCTCAAATAACTCATTGCCTTAA

XM_004865989.1 Coding sequence

Arid3a AT rich interactive domain 3A (BRIGHT-like), transcript variant X2

Length: 1815 bp    Location: 7666416..7638669   Strand: -
>XM_004865989.1
ATGAAGCTGCAGGCGGTGATGGAGACCCTCTTGCAACGGCAGCAACGTGCACACCAGGAGCTAGAGGCCCGGCAGCAGCCACCACCGCCTGAGAACCCCACTGCAGGACCTGCAGCCCGGGCACGGGGCACCCCGGATGAGGACAGAGAGCCTGACAGTGCACGAATGCAGAGGGCACAGATGGCCGCGCTGGCTGCCATGCGGGCTGCTGCTGCAGGCCTCGGACACCCGCCCAGCCCTGGTGGCGGCTCTGAGGATGGTCCCCCTGGCTCAGAAGATGAGGACATGGACCAGGAGGGGGGTCCCAGCTCACCCGGCCGAGGCAAGGAGGGGCTAGGATGCTTGGAAGGAGATGGACACTTTGAGGATATGGGCTCCGATGATGACATGAAGCAAAAGTGGGAGGAGGAAGAGGAGCTCGAGGAGGACATGGGGGACGAGGAGGAGGACGAGGAGGAGGAGGAAGAGGACTTCGAGGAAGAGGAGGAGGACGATGAGGAAGAGGGGCTGGGCCCCCCGGGCCCTACAGGCCTGAGCTCCACAGGCCTCTTCCCCCGAAAGGCCCCACCAGCCCAGGCCTTCCGCGGAGATGGCGTCCCCAGGGCGCTGGGTGGCCCCGCACGGCTGGGAACTGGCCCTGCTCATCCCGGAGGAGCCACCCACGTGGCCTCTCAGCTGCAGCCGCCCGACCATGGGGACTGGACCTACGAGGAGCAGTTCAAGCAGCTCTACGAACTCGATGGGGACCCTAAGAGGAAGGAGTTCCTGGATGACTTGTTCAGCTTCATGCAGAAGCGAGGCACACCCGTGAACCGCATCCCCATCATGGCCAAGCAGGTGCTTGACCTGTTCATGCTGTACGTTCTGGTGACGGAGAAGGGCGGCCTGGTGGAGGTCATCAACAAGAAGCTGTGGCGGGAGATCACTAAGGGCCTCAACCTGCCCACCTCCATCACCAGCGCTGCCTTCACGCTGAGGACCCAGTATATGAAGTACTTGTATCCCTACGAGTGTGAGCGGCGTGGCCTCAGCAGCCCCAACGAGCTCCAGGCCGCCATCGATAGCAACAGGAGGGAAGGCCGGCGCCAGAGCTTCGGCGGCTCCCTCTTCGCCTATTCGCCAGGCAGTGCCCACGGCATGCTGTCCTCACCCAAGCTGCCCGTGCAGTCCCTGGGCCTGGCCGCCAGCACCAACGGCAGCTCCATCACCCCAGCCCCCAAGATCAAGAAAGAGGAGGACTCAGCCATCCCCATCACAGTCCCCAGCCGCTTGCCTGTGTCCCTGGCTGGCCACCCAGTGGTGGCAGCCCAGGCAGCAGTGCAAGCGGCAGCGGCCCAGGCAGCCGTGGCAGCGCAGGCAGCGGCCCTGGAGCACATCCGGGAGAAGCTGGAGTCTGGGGAGCCCCCGGAGAAGAAGATGGTGCTGGTCGCTGATGAGCAGCAGCGGCTCCTGCACCGGGCTCTGCAGCAGAACTTACTGGCCATGACTGCCCAGCTGCCCATGAGCATCCGGATCAACAGCCAAGCCTCTGAGAGCCGGCAGGACTCGGCTGTCAGCCTCGCAGGCGCCAACGGCAGCAACAGTATTAGTATGTCGGTCGAGCTCAACGGCATCATGTACACAGGGGTCCTGTTTGCTCAGCCGCCAGCCCCCACGCCACCCTCAGCACCCAGCAAAGGCAGTGGTGGTGGCAGTGGTGGCAGCAGCAGCAGCAACTCAGGTGGCCGGGGAGGACCCGCAGGGACCAGCTCGGGCAGCCAGGCAGGTGCAGCACCGCACCCCACGTCTTCTACCTCAAATAACTCATTGCCTTAA

XM_004865960.1 Coding sequence

LOC101703228 PWWP domain-containing protein MUM1-like, transcript variant X1

Length: 2019 bp    Location: 7334033..7311147   Strand: -
>XM_004865960.1
ATGACGGATGCCAAGTACGTCCTCTGCAGATGGGAAGAGCGATTATGGCCTGCAAAGGTTTTGGACGGACCCAAGACTTCAAATGATGAGGGAGAAAAGGAATTCTTTCTAGATGTTCAAATACTCTCGCTAGATGAAAAAATTAAGGTGAAAAGCACAGAAGTTGAGACTCTGAAGAAGTCTCAGATTGAGAACATTGCCTCACTCTTGGCCTCGCAGACTGAAGTCCCCACTGCGCCCCTGAAGGAGCTGACCTACAGACGCTCGCTGCGGGTGGCCCTGGATATTTTGAATGAGAGAAGCAGTTCAAGTCTTGAGGAAAGCACCTCAAGGAGAAACAGATCTGCTCAGTGTCGAAGGGAGAACGAGCCTACCGAAGCGGCCTCCTCGCTCCGTAACTCTCTCTGTTCTTCCTTCCGCGAAGATGTGTCAGCCAGTTCTGGTTCGTCCGCTTGTGAAAAAGACCCTGAGTTCAAAGTGGACCATGAGGAGGGCCTGGGGAAAAGCAAGAGCCCGGGGGCCCTGTCAGCGGCTCCAGCTGGAGCTGGCCCTCAGGATGGGAGTGGGTGGAGGAGCCACGGCACAGGTCACAGCCTCGCTAAGAGGAAGGGGAGGAATGTGGCCCAGAGATCCAGCCAGTGCCAGGAGGCACCTGCCCTTTTGGGAGCACAGAGTGAGGAGCAGAGCACGGGCCAGGCCTCGCCGCCCCAAGCCCGGGAGGACGATCCGTGTGCCCGCGCTGAAGGACACGACCCTGGTTTGCCATCGGGCAGCCTCACAGTCCCGGCCCCGGAGAGGGCCAGAGGGCACCCCGTGAAGAGGCTGTGCCTGAGGCCACCTTCCACACAGCTGGAGCTGGAGCTGTCCCCCAGCCTGCGGCCCGGGGGATACATGACTCTGCGCAGTGCCGCTGCCAGCCCTTGTCCCTCAGACACTCGGGTGGAGGACTCACAACCCCCTCGTCTCCAGGACAGTGGCGACGACAGGCTGGAGGAAGACCCTCAAGCTTCTCAGGAGTGCACGGAGTTTAATTCCAACAACTCCATCCTGGATGAAGAGGAGGAAGATGAGGAGCCTCCGAGAATCCTTTTCTATCACGAACCGCGGTCGTTTGAAGTAGGAATGCTAGTCTGGCTTAAATACCAAAAATATCCCTTCTGGCCAGCAGTGGTCAAAAGCGTGAAGCGGCGGGAGAAGAAAGCAAGCGTGCTCTTCATCGAGCGGGACATGAACCCCAAAGGGCGTGGCATCACCGTGTCGCTCAGAAGACTGAAGCACTTTGACTGTAAGGAGAAGCAGGCGCTTCTGGACAAAGCCAAAGAGGACTTCGACCAGGCCATTGGCTGCTGCATCTCCCTCATCACCGACTACCGGGTGCGGCTAGGTTGTGGCTCTTTCACTGGCTCCTTTCTGGAATATTTCGCTGCTGACATCAGTTACCCTGTCCGGAAATCCATCCAGCAGGATGCTGAGGGGACCAGGTTCCCCCAGCTGAGCAGGGCGGACCCTGAGGAGCCAGAGGGCAACAGCCCCCTGGGCTGGAGGCGGCCCTGCAGGAAGGTGCTGCCTGACCGCTCACGGGCCGCCCGGGACCGCGCCAACCAGAAGCTGGTGGAGTACATCGTGAAGGCCCGAGGTGCTGAGAGCCACCTTCATGCCATCCTAAAGAGTGGCAAGCCATCTCGGTGGCTGAAGATGTTCCTGAGCTCGGGCCAGTATGTGACGTGCATGGAGACATACCTGGAGGACGAGGAGCAGCTGGACCGCGTGGTCAAGTACCTGCAGGGCGTCTACCAGGACATGGACGGTGACAAGCTGGCGAGGGCCAGCGGCGACCGCATCCGCTTTATCCTGGATGTGCTGCTACCCGAAGCCATCATCTGCGCCATCTCTGCCGTGGATGCGGTGGACTACAAGACGGCTGAGGAGAAGTACCTAAAGGGACCATCGCTCGGCTACCGGGAAAAACAAATATTTGATAATCAGGTCCTGGAAGAAAGGAGTCGGCGCCGCCGGTGA

XM_004865984.1 Coding sequence

Cnn2 calponin 2, transcript variant X2

Length: 807 bp    Location: 7601590..7595019   Strand: -
>XM_004865984.1
ATGAGCTCCACGCAGTTCAACAAGGGACCCTCGTACGGGCTGTCGGCCGAGGTCAAGAACCGGCTCCTGTCCAAGTACAACCCGCAGAAGGAGGCCGAGCTCCGCAGCTGGATCGAGGGCCTCACAGGCCTCGCCATCGGCCCTGACTTCCAGAAGGGCCTGAAGGATGGGGTTATCCTGTGCACACTCATGAACAAGCTGCAGCCGGGCTCTGTACCCAAGATCAACCGCTCCATGCAAAACTGGCACCAGCTAGAAAACCTCTCCAACTTCATCAAGGCCATGGTCAGCTATGGCATGAACCCCGTGGACCTATTCGAGGCCAATGACCTGTTTGAGAGCGGGAACATGACGCAGGTCCAGGTGTCTCTGCTTGCGCTGGCGGGGAAGATGGGCACGAACAAGTGCGCCAGCCAGTCGGGCATGACGGCCTATGGCACCCGGCGGCACCTCTACGACCCCAAGAACCACATCCTGCCCCCCATGGACCACTCCACCATCAGTCTGCAGATGGGCACGAACAAGTGCGCCAGCCAGGTGGGCATGAAGGCTCCAGGGACCCGACGCCACATCTATGACACCAAGTTGGGGACCGACAAGTGTGACAACTCCTCCATGTCCCTGCAGATGGGGTACACACAGGGCGCCAACCAGAGTGGCCAGGTGTTCGGCCTTGGCCGCCAGATCTATGATCCCAAGTATTGCCCTCAGGGCACAGTGGCAGATGGGGTACCCTCTGGAACCAGCAACCTCCCAGAGGATGCCTCGGAGTACCCGCCCTACTATCAGGAGGAAGCTGGCTGCTGA

XM_004865981.1 Coding sequence

Hmha1 histocompatibility (minor) HA-1, transcript variant X1

Length: 3543 bp    Location: 7572691..7557874   Strand: -
>XM_004865981.1
ATGAGGTCAGGGCTCCGGAATGTCCCAGGTGCCTTAGCAGCGCCTGGAGCACCTGCCTTCCTGCCGGCGCGGAGACCTCTGCTCTCTGGCCTTACCTGCCCCAGAGCAATGAGTGGGCATCGGATGGTCCTCAGGGGGCTGCTGGGCTGGGTGTGTGGTTGGACCAAGGCCTGGAGAGCTGGGTTTGGGACAGGCAGCTGTGGGCTTCCTGGCCTGTGCCCCAGACAGGCACCCCATCCTCCAAAGGAGCTGCCCAGGAAAGATGGGCTTGATGCTGTGTTCCCTGGACCCGGCCTGGAGCCTCCGGTCACGTCCTCTGGTGTCAAGAACACAGCCACCCTGAAGCGGCCCACCAGCCTCAGTCGCCACGCCAGTGCTGCTGGCTTCCCACTCTCTGGCGCTGGCTCCTGGACACTAGGCCGGGGCTACCGAAGCCCCCTGACAGCCGCCAGCCCTGCAGAGGTGCCCACCGAGGGGCCTGGCACCGAGGCCACGGATGACATCTCAAACCTGCTGGCTGATGTGGCTCGCTTCGCAGAGGGTCTGGAAAAACTCAAGGAGTGTGTATTGCATGATGATCTCCTGGAGGCCCGCCGGCCGCTGGCCCACGAGTGCCTGGGTGAGGCCCTGCGTGTGATGCGCCAGGTTATCTCCAAGTACCCGCTGCTGAACACTGTGGAGACACTGACTGCTGCAGGCACACTCATCGCCAAGGTTAAAGCCTTCCATTACGAATGTAACAATGAGTCGGACAAGAGGGAGTTCGAGAAGGCCCTGGAGACCATTGCAGTATCCTTCAGCAGCACTGTGTCTGAGTTCCTCATGGGCGAGGTGGACAGCAGCACACTCCTGGCCGTGCCACCGGGGGACCCCAGCCAGTCCATGGAGAGCCTGTACCAGGGCAGCGAGGGCTCCCCGCCCAGCGCCGAGGACTGCGAGGAGGGCTGCCCGCCCCCGGAGGAAGTGGACATGCTACTGCAGCGCTGCGAGGGCGGCGTGGACGCGGCTCTGCAGTACGCCAAGAATATGGCCAAGTACATGAAGGACCTTATTGGCTACCTGGAGAAGCGGACTGCGCTGGAGATGGAGCTCGCCAAAGGTCTGCAGAAACTTATCCATGGTGCCAGACAGAACATCACGCACGAGCCCCACATGCCCCTGCTGTCCATCTACTCGCTGGCCCTGGAGCAGGACCTGGAGTTTGGCCATGGCATGGTGCAGGCAGTGGGCACACTGCAGACCCAGACCTTCATGCAGCCCCTCACCCTGCGGCGGCTGGAACATGAGAGGCGCAGGAAGGAGATCAAGGAGTCCTGGCACCGCGCACAGCGGAAGCTGCAAGAGGCCGAGGCCAACCTGCGCAAGGCCAAGCAGAGCTATGTCCAGCGCTGCGAGGACCACGACAAGGCCCGCCTCCAAGTGGCCAAGGCCGAGGACGAGCAGGCGGCCACCTCACCTGGGGCGGGCAGCACAGCTTCCAAGACGCTGGACAAGCGGCGGCGGCTGGAGGAGGAAGCCAAGAACAAGGCGGATGAAGCCATGGCCACGTACCGCACGTGCGTGGCAGATGCTAAGACGCAGAAACAGGAGCTGGAGGACACAAAGGTGACCGCGCTGCGGCAGATCCAGGAGGTCATCCGCCAGAGCGACCAGACCATCAAGTCGGCCACCATCTCCTACTACCAGATGATGCACATGCAGACGGCGCCGTTGCCCGTGCACTTCCAGATGCTGTGTGAGAGCAGCAAGCTCTATGACCCTGGCCAGCAGTACGCATCGCATGTGCGACAGCTGCAGCGTGGCGAGGAGCCCGATGTGCGCTACGACTTCGAACCACATGTGTCTGCCAACGCCTGGTCCCCTGTCACACGTGCCCGGAAGAACAGCTTCAACATTGGCGACACTTTGGGGACAGAGGCCACCAGCAGCAGCCCCTCAGAGGAAGGAGGGCCCAGTGAAGGGACATCTGCCAAAGACCACAGGGGGGGACGGGGACACCAGGTGCACAAGTCGTGGCCAATCTCAGTCTCAGACTCGGACGGCAGCCTGGCCCCCAGCGACGGCTCAGGGGACTTTAAGAAGTTCCAGCGGATGTCATCCAGTGGCACTGTGTCATCCAGTGAGGAGCTGGTGGACCAAGAGGGTGGAGCAGGGACAGCGGAGTTTGAACAGGATGACATCAACAGCATGGCCCCCCAGCTGCCAGTGGCTGTGCCCAGTGGGCCCTTTCGCCATGTCGGGCTGTCCAAGGCAGCACGCACGCACCGGCTCCGGAAGCTCCGCACACCGGCCAAGTGCCGGGAATGTAACAGCTATGTCTACTTCCAGGGAGCTGAGTGTGAGGAGTGCTGTCTGGCCTGCCACAAGAAGTGCCTGGAGACCCTGGCCATCCAATGTGGCCACAAAAAGCTGCAGGGCCGCCTTCAGCTCTTCGGACAGGATTTCAGCCGCGCGACCTGGGGTACCCCGGATGGCATCCCGTTCATCGTGAAGAGGTGCCTGTGTGAGATCGAGCGGCGCGCGCTGCGCACCAAGGGCATCTACCGGGTCAACGGGGTGAAGACGCGTGTGGAGAAGCTGTGCCAGGCCTTTGAGACCAGCCAGGAGCTGGTGGAGCTATCACAGGCCTCGCCCCATGACATTAGCAATGTCCTCAAGCTCTACCTGCGCCAGCTGCCGGAGCCACTCATCTCCTTCCGCCTCTATCACGAGCTGGTAGGGCTGGCCAAGGACAGCCTGAAGGCAGAGGCTGAGGCCAAGGCAGCATCCCGGGGGGCCCGGCAGGATGGGTCTGAGAGCGAGGCGGCGGCCATGGCCATGGCGGGGCGCTTGCGGGAGCTGCTGCGGGACCTGCCCCCGGAGAACCAGGCCACGCTGCGGTACCTGCTGCGGCACCTGCGCAGGATTGTGGAGGTGGAACAGGACAACAAGATGACCCCTGGGAACCTAGGCATCGTGTTCGGGCCTACGCTGCTGCGGCCGCGGCCCACCGAAGCCACTGTCTCCCTGTCGTCACTGGTAGACTACCCCCACCAGGCTCGTGTCATCGAGACCCTCATCGTCCACTATAGCCTGGTGTTTGAGGACGAGCCAGAAGAGGGACTCAGGGCACAGGACGAGGCAAGCAGCCAGCGCTCAGAGGTGGTGGTGCCAGTGCCCTACCTGGAGGCCAGGGAGGCTGCCACCTATGCCCTGCAGGAGGAGGACAGGGGCCGAGAATCCCGAGTGGCATCCAATGATTCTGACTCAGAGCTAGAGGAAGCCTCGGACTCCCTGTCCTTGTCAGATGCCAGTGCCCTGCACCGCCTCAGCTTCCTGGAGAAGCAGGAAGGGGAGGCCAGCCCAGAGGAGGGTCCCCGAAGCCGGAGTGGCAGCGAGGAGCAGCTGGGGAATGAGGATGAAGAGGGCCCAGCCCAGCAGCTGTCCACATACAACACCAATCAGTCCAACAATGTGGCGCTTGCCCGGCTGCTGCCCATGAGGCTCCGCACCAAGTGCATCTCAGGGGCCAGCTGTGGACACAGGCGGCCAGAGTTCGTCTGA

XM_004865970.1 Coding sequence

Midn midnolin, transcript variant X3

Length: 1248 bp    Location: 7424064..7419769   Strand: -
>XM_004865970.1
ATGCAAGCCCTTGAGAGTTTGACAGAGACCCAGCCCCCAGCGGCGCCGGGGCCAGGCCGGGCTGGCGGAGAAGGCTTCCGGAAATACAGATTCATTTTATTTAAGCATCCGTGGCACCGACAGGGACCCCAGAGCCCAGAGAGGGGCGGCGAGAGGCCCCAGGTCAGTGACTTCTTGTCTGGCCGCTCACCGTTGACCCTGGCTCTGCGGGTCGGGGACCACATGATGTTCGTGCAGCTGCAGCTTGCAGCCCAGCACGCCCCACTACAGCACCGCCATGTACTGGCTGCTGCAGCTGCTGCGGCCACTGCCACCCGAGGAGACTCCAGCATAGCCACTCCCATGTCCTCACCCTGCCGGCCAGTGTCCAGTGCTGCCCGCATCCCCCCAGTGCCCGCCAGCCCTTCTCCCACATCTGCCTCACCTGTCACAGCTGGCTCCTTCCGATCCCACGCAGCCTCCACCACCTGCCCTGAGGTGGATTGCTCCCCCCCTGCCAGCAGCAGCGTCAGCCCCGGAGCCAGCACCCCTTCTACCCCTGGGAACAGCCCTAGTCCCCGCTCCCGAAAACCCGGCGCTGTCATCGAGAGCTTCGTAAACCATGCCCCAGGGGTCTTCTCAGGGACCTTCTCTGGCACGCTGCACCCAAACTGTCAGGACAGTAGCGGGCGGCCACGCCGAGACATTGGCACGATCCTCCAGATCCTCAATGACCTCCTGAGCGCCACGAGGCACTACCAGGGCATGCCCCCCTCTCTGACCCAGCTCCGCTGCCACGCCCAGTGCTCACCCGCCTCACCAGCCCCCGACTTCACCCCCAAAACTACCTCCTGCGAGAAGCTAGCGGCCGCACCCCCGGCCTCCCTGCTGCAAGGCCAGAGCCAGATACGCATGTGCAAGCCCCCTGGTGAGTGGCCTTCCTCCAGGATCCCTTTTCCCCACCCATCCGCCTGTCTCCTCAAGGCTTCTCTGTGTGCAATGTGGGCATCAAAGCAGCTGACCCACTGGGGAATGGCAGCTGTGGCTCCCCCCAAAAGGCACAGGCTGGGAGAGAAGGAGGCATGTGTGTGTCTGGTCACAAAGTATCCTTGTGAGCTCCTGAGGGGGCTCCAGCCCCACTTCCTCTTTGCCTCCCCCAGGGACCATCTCCAGATGGCATTGGGCACCTCCATGAATGACCAAGTCAGTTCTGGCAGGAGAGGCAGAGCTGGCAGGGTCCCCCGGCATCATGAGGACTTGGGAGACTAA

XM_004865962.1 Coding sequence

Efna2 ephrin-A2

High confidence: 4 potential gene matches
Length: 645 bp    Location: 7393318..7380839   Strand: -
>XM_004865962.1
ATGGCGCCCGCGCAGCGCCCGTGGTTCCCGCTTCTGCTGCTCCTGGTGCCGCTGCCGCCTCCTCCGCCTTGCGCGCGCGCCGAAGACGCCACCCGCGCCAACGCGGACCGCTACGCCGTCTATTGGAACCGCAGCAACCCCAGGTTCCACGTGGGGACGGCAGGCGACGGTGGTGGCTACACCGTGGAGGTGAGCATCAATGACTATCTGGACATCTACTGCCCGCACTATGGGGCGCCACTACCACCGGCCGAACGCATGGAGCACTACGTCCTCTACATGGTCAACGGCGAGGGTCACGCATCCTGTGACCACCGGCAGCGAGGCTTCAAGCGCTGGGAATGCAACCGGCCGGCTGCCCCAGGGGGGCCGCTCAAGTTCTCGGAGAAGTTCCAGCTCTTCACACCCTTCTCACTGGGGTTCGAGTTCCGCCCAGGCCACGAGTACTACTACATCTCTGCCACACCTCCTAATGCTGTGGACCGGCCCTGCCTTCGGCTCAAGGTGTACGTGCGGCCGACCAATGAGACCCTGTACGAGGCCCCAGAGCCGATCTTCACCAGTAACAACTCCTGCAGTGGCCTGGGCAGCTGCCGCCTCTTCCTGAGCACCGTCCCTGTGTTGTGGACCCTCCTGGGCTCCTAG

XM_004865413.1 Coding sequence

March2 membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase, transcript variant X4

Length: 741 bp    Location: 1183117..1197327   Strand: +
>XM_004865413.1
ATGACGACAGGCGACTGCTGCCACCTCCCAGGCTCCCTGTGCGACTGCTCAGGCAGCCCTGCTTTCTCCAAGGTCGTGGAGGCCACGGGCCTGGGGCCTCCGCAGTACGTGGCACAGGTAACTTCGAGGGACGGCCGGCTCCTCTCCACAGTCATCCGGGCCTTGGACACGCCGGGCGACTGTCCCTTCTGCCGGATCTGTCACGAGGGGGCCAATGGGGAGAGTCTGCTATCTCCGTGTGGCTGTACTGGCACGCTGGGTGCTGTGCACAAGAGCTGCCTGGAGAAGTGGCTGTCCTCGTCCAACACCAGCTACTGCGAGCTGTGCCATACGGAGTTTGCAGTGGAAAAGCGGCCCCGGCCTCTCACAGAGTGGCTGCGGGACCCAGGGCCACGCACGGAGAAGCGGACGCTGTGCTGCGACATGGTGTGCTTCCTGTTCATCACACCGCTGGCTGCTGTCTCGGGCTGGCTGTGCCTGCGTGGGGCCCAGGACCACCTTCGGCTGCACAGCCGGCTGGAGGCCGTGGGGCTGATTGCACTCACCATTGCCCTCTTCACCATCTACGTCCTCTGGACGCTGGTCTCTTTCCGGTACCACTGCCAGCTGTACTCTGAATGGAGAAGGACGAACCAGAAAGTCCGCCTGAAGATCCGGGCTGCTGATGGCTCCGAGGACACCCAGCACTCCCCGCTGGCAGCTGGACTCCTGAAAAAGGTGGCAGAGGAGACGCCTGTGTGA

XM_004865938.1 Coding sequence

Mbd3 methyl-CpG binding domain protein 3, transcript variant X1

High confidence: 4 potential gene matches
Length: 873 bp    Location: 7132274..7144596   Strand: +
>XM_004865938.1
ATGGAGCGGAAGAGGTGGGAGTGCCCGGCGCTCCCGCAGGGCTGGGAGAGGGAAGAAGTGCCCAGAAGGTCGGGGCTGTCGGCCGGCCACAGGGATGTCTTTTACTATAGCCCCAGCGGGAAGAAGTTCCGAAGCAAGCCCCAGCTGGCGCGCTACCTGGGCGGCTCCATGGACCTGAGCACCTTCGACTTCCGCACGGGCAAGATGCTGATGAGCAAGATGAACAAGAGCCGCCAGCGCGTGCGCTACGACTCCTCCAACCAGGTCAAGGGCAAGCCCGACCTCAACACGGCGCTGCCGGTGCGGCAGACGGCGTCCATCTTCAAGCAGCCGGTGACCAAGATCACCAACCACCCCAGCAACAAGGTCAAGAGTGATCCACAGAAGGCTGTGGACCAGCCTCGGCAGCTGTTCTGGGAGAAGAAGCTAAGCGGGCTGAGCGCCTTTGACATTGCGGAGGAGCTGGTCAGGACCATGGACCTGCCCAAGGGGCTGCAGGGGGTGGGCCCCGGCTGCACAGATGAGACCCTGCTCTCTGCCATCGCCAGTGCCCTGCACACCAGCACCATGCCAATCACAGGCCAGCTCTCGGCTGCCGTGGAGAAGAACCCTGGCGTGTGGCTGAACACCACGCAGCCCCTGTGCAAAGCCTTCATGGTGACCGATGAAGATATCAGGAAGCAAGAGGAGTTGGTGCAGCAGGTGCGGAAGCGGCTGGAGGAGGCACTGATGGCTGACATGCTGGCCCATGTGGAGGAGCTGGCTCGTGACGAGGCGCCCTTGGACAAGGCCTGCGGGGATGAGGAGGATGAGGAGGATGAGGAAGATGAGGAGGAGGAGCCCGAGCCAGACCCGGAGCTGGAGCGCGTCTAG

XM_004865939.1 Coding sequence

Mbd3 methyl-CpG binding domain protein 3, transcript variant X2

Length: 777 bp    Location: 7132264..7144596   Strand: +
>XM_004865939.1
ATGGAGCGGAAGAGCCCCAGCGGGAAGAAGTTCCGAAGCAAGCCCCAGCTGGCGCGCTACCTGGGCGGCTCCATGGACCTGAGCACCTTCGACTTCCGCACGGGCAAGATGCTGATGAGCAAGATGAACAAGAGCCGCCAGCGCGTGCGCTACGACTCCTCCAACCAGGTCAAGGGCAAGCCCGACCTCAACACGGCGCTGCCGGTGCGGCAGACGGCGTCCATCTTCAAGCAGCCGGTGACCAAGATCACCAACCACCCCAGCAACAAGGTCAAGAGTGATCCACAGAAGGCTGTGGACCAGCCTCGGCAGCTGTTCTGGGAGAAGAAGCTAAGCGGGCTGAGCGCCTTTGACATTGCGGAGGAGCTGGTCAGGACCATGGACCTGCCCAAGGGGCTGCAGGGGGTGGGCCCCGGCTGCACAGATGAGACCCTGCTCTCTGCCATCGCCAGTGCCCTGCACACCAGCACCATGCCAATCACAGGCCAGCTCTCGGCTGCCGTGGAGAAGAACCCTGGCGTGTGGCTGAACACCACGCAGCCCCTGTGCAAAGCCTTCATGGTGACCGATGAAGATATCAGGAAGCAAGAGGAGTTGGTGCAGCAGGTGCGGAAGCGGCTGGAGGAGGCACTGATGGCTGACATGCTGGCCCATGTGGAGGAGCTGGCTCGTGACGAGGCGCCCTTGGACAAGGCCTGCGGGGATGAGGAGGATGAGGAGGATGAGGAAGATGAGGAGGAGGAGCCCGAGCCAGACCCGGAGCTGGAGCGCGTCTAG

XM_004865902.1 Coding sequence

Mob3a MOB kinase activator 3A, transcript variant X2

High confidence: 4 potential gene matches
Length: 654 bp    Location: 6755156..6770513   Strand: +
>XM_004865902.1
ATGTCCAGCCCGTTCCTGAAACAGGTCTTCAACAAGGACAAGACCTTCCGGCCCAAGCGCAAGTTCGAGCCGGGCACGCAGCGCTTCGAGTTGCACAAGCGGGCGCAGGCGTCGCTCCACGCGGGGCTGGACCTGCGACAGGCCGTGCAGCTGCCACCAGGCGAGGAGCTCAATGACTGGGTGGCCGTGCACGTGGTGGACTTCTTCAACCGCCTCAACCTCATCTATGGCACGGTGAGCGATGGCTGCACCGAGCACTCATGTCCCATCATGTCCGGGGGCCCCAAGTACGAGTACCGCTGGCAGGATGAGCACCGGTTCCGCAAGCCCACGGCGCTGTCCGCCCCGCGCTACCTGGACCTGCTCATGGACTGGGTGGAAGTCCAGATCAACAATGAGGACATCTTCCCCACCAATGTTGGCACCCCGTTCCCCAAGAACTTCCTGCAGGCTGTGCGAAAGATCATGTCGCGCCTCTTCCGTGTCTTCGTACACGTCTACATCCACCACTTTGACTGCATCGCACAGATGGGCTCCGAGGCGCACGTGAACACCTGCTACAAGCACTTCTACTACTTTGTCACGGAGTTCGGCCTCATTGACACCAAGGAGCTGGAGCCTCTGAAAGAAATGACTGCTCGGATGTGTCTCTAA

XM_004865412.1 Coding sequence

March2 membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase, transcript variant X3

Length: 741 bp    Location: 1182329..1197327   Strand: +
>XM_004865412.1
ATGACGACAGGCGACTGCTGCCACCTCCCAGGCTCCCTGTGCGACTGCTCAGGCAGCCCTGCTTTCTCCAAGGTCGTGGAGGCCACGGGCCTGGGGCCTCCGCAGTACGTGGCACAGGTAACTTCGAGGGACGGCCGGCTCCTCTCCACAGTCATCCGGGCCTTGGACACGCCGGGCGACTGTCCCTTCTGCCGGATCTGTCACGAGGGGGCCAATGGGGAGAGTCTGCTATCTCCGTGTGGCTGTACTGGCACGCTGGGTGCTGTGCACAAGAGCTGCCTGGAGAAGTGGCTGTCCTCGTCCAACACCAGCTACTGCGAGCTGTGCCATACGGAGTTTGCAGTGGAAAAGCGGCCCCGGCCTCTCACAGAGTGGCTGCGGGACCCAGGGCCACGCACGGAGAAGCGGACGCTGTGCTGCGACATGGTGTGCTTCCTGTTCATCACACCGCTGGCTGCTGTCTCGGGCTGGCTGTGCCTGCGTGGGGCCCAGGACCACCTTCGGCTGCACAGCCGGCTGGAGGCCGTGGGGCTGATTGCACTCACCATTGCCCTCTTCACCATCTACGTCCTCTGGACGCTGGTCTCTTTCCGGTACCACTGCCAGCTGTACTCTGAATGGAGAAGGACGAACCAGAAAGTCCGCCTGAAGATCCGGGCTGCTGATGGCTCCGAGGACACCCAGCACTCCCCGCTGGCAGCTGGACTCCTGAAAAAGGTGGCAGAGGAGACGCCTGTGTGA

XM_004865888.1 Coding sequence

Dot1l DOT1-like histone H3K79 methyltransferase, transcript variant X1

Length: 5196 bp    Location: 6697515..6648403   Strand: -
>XM_004865888.1
ATGGGGGAGAAGCTGGAGCTGAGGCTCAAGTCGCCCGTGGGGGCCGAGCCCGCCGTCTATCCGTGGCCACTGCCGGTCTACGACAAACACCACGATGCTGCTCATGAAATCATCGAGACTATTCGATGGGTCTGTGAGGAAATCCCGGATCTCAAGCTGGCCATGGAGAATTATGTCTTAATTGACTATGATACCAAAAGCTTCGAGAGCATGCAGAGGCTGTGTGACAAGTACAACCGGGCCATCGACAGCATCCATCAGCTGTGGAAGGGCACCACCCAACCCATGAAGCTGAACACACGGCCGTCCAACGGGCTTCTGCGACACATCCTGCAGCAGGTCTACAACCACTCGGTGACTGACCCAGAGAAGCTTAACAACTATGAGCCCTTCTCCCCCGAGGTGTATGGGGAGACCTCCTTTGACCTGGTGGCCCAGATGATCGATGAGATCAAGATGACTGAGGATGATCTATTCGTGGACCTGGGCAGTGGTGTAGGACAGGTGGTCCTCCAGGTTGCTGCAGCCACCAACTGCAAACATCACTATGGAGTCGAGAAAGCAGACATCCCAGCCAAGTACGCGGAGACCATGGACCGAGAGTTCAGGAAGTGGATGAAATGGTATGGAAAAAAGCATGCAGAATACACACTGGAGCGGGGCGATTTCCTATCAGAAGAGTGGAGAGAGCGGATTGCCAACACGAGTGTTATATTTGTGAATAACTTTGCCTTTGGTCCTGAGGTGGATCACCAGCTGAAGGAGCGATTTGCAAACATGAAGGAAGGTGGCAGAATTGTGTCCTCGAAGCCCTTTGCACCTCTGAACTTCAGAATAAACAGCAGAAACTTGAGTGACATCGGCACCATCATGCGTGTGGTGGAGCTGTCGCCCCTGAAGGGCTCCGTATCATGGACGGGGAAGCCGGTCTCCTACTACCTGCACACTATTGACCGTACCATACTTGAAAATTATTTTTCTAGTCTGAAAAATCCAAAACTCAGGGAGGAACAGGAAGCTGCTAGGCGCCGGCAGCAGCGAGAGAACAAGAGCAATGCAACCACTCCAACCAAGGTCCCTGAGAGCAAGGCGGCTGGCCCCACCGAGACCCCCATGGATTCTGGTGCTGAGGAAGAGAAGACAGGGGTGACCACCGTCAAAAAGCCATCGCCCTCCAAAGCCCGGAAGAAGAAGCTGAACAAGAAAGGGCGGAAGATGGCTGGTCGGAAGCGTGGGCGGCCCAAGAAAATGAACACTGCGAACCCTGAGCGTAAGCCCAAAAAGAACCAAACTGCACTGGATCTCCTCCATGCCCAGACTGTGTCCCAGACGGCATCCTCCTCGCCCCAGGATGCTTACCGGTCCCCTCACAGCCCATTCTACCAGCTACCTCCAAGCATGCCTCGGCACGGCCCCAACCCGCTGCTGGTGGCGCCCACCCCACCCGCACTACAGAAGCTGCTAGAGTCCTTCAAGATCCAGTACCTGCAGTTCCTGGCATACACGAAGACACCGCAGTACAAGGCTAACCTGCAGCAGCTGCTGGACCAGGAGAAGGAACGGAATGCTCAGTTGCTGGGCACGGCTCAGCAGCTCTTTGGACACTGCCAGGCCCAGAAGGAAGAGATCCGAAGGCTTTTCCAGCAGAAACTCGATGAGCTGGGTGTGAAGGCACTGACCTACAATGACCTGATCCAAGCCCAGAAGGAGATCTCAGCCCATAACCAGCAGCTTCGGGAGCAGTCGGAGCAGCTGGAGAAGGACAACAGAGAGCTGCGAAGCCAGAGCCTGCAGCTGCTTCGGGCACGCTGCGAGGAGCTTAAGCTGGACTGGTCCACACTTTCCCTGGAGAACCTACGCAAGGAGAAGCAGGCACTTCGGAGCCAGATCTCTGAGAAGCAGCGGCACTGCCTGGAGCTGCAGATCAGTATCGTGGAGCTGGAGAAGAGCCAGCGGCAGCAGGAGCTCTTGCAGCTCAAGTCCTGTGTGCCTCCTGACGATGCACTGTCTGTGCACCTGCGTGGGAAGGGTGCCCTGAGCCGAGAGCTAGAGGCCGAGACCGCCGGCAGGCTGCACCTAGAGCTGGACTGTGCCAAGTTCTCCCTGCCTCCCTTCAGCAGCATGAGTCCCGAACTCTCCATGAATGGCCATGCCACCAGCTATGAGCTCTGTAGTGCGCTGAGCCGGCCCTCGTCCAAGCAGAACACCCCTCAGTACCTGGCTTCCCCCTTGGACCAGGAGGTTGTGCCCTGCACCCCCAGCCACAGTGGCCGGCCTCGGCTGGAGAAGCTGTCTGGCCTGGCTCTGCCCGACTACACCAGGCTTTCCCCGGCCAAGATCGTGTTGCGGCGGCACCTGAGCCAGGACCATGGAGGGTCAGCCAAGGCAGCAGCCAGTGAGCCACATCTGAGAGCTGAGCATGCCAAGGAGAACAGCCTTTCCTACCAGAGCCCTGGTCTGTCCAACAGCATGAAGCTGAGCCCTCAGGACCCAAGGCCCCCTTCTCCTGGGGCCATCCCCACAGTAGGGGAGAAGAACAGCGAGAAGGGCGGGAAGGAGCGCATTTACAGCAGCCATGGGGAGACCATCACCAGCCTGCCCATCAGCATCCCACTCAGCACTGTGCAGCCCAACAAGCTTCCTGTCAGCATTCCTCTGGCCAGCGTGGTGCTGCCCAGCCGCGCCGAGAGGGTGAGGAACACCCCTAGCCCTGGACCGCAGCCCCGAGACTCCTCATCCACTCTTGAAAAGCAGATCAGTGCTAATACCCACGGTGCTGGGAGCAGTGCCTCAGGAAGCCGGAGCCTGGCCCTGGCATCTTCAGGTTTCTCCTATGCTGGCTCCATGGCTATTAGTGGGGCCCTGGCTGGCAGTCCTGCACCACTGGTGCCTGGAGTTGAGCCAGCTACCTTTGACGAGTCCTCAGGCTCAGGGAACCTCTTCACCACTGTGGGGTCCCGAAGCACCACGCCACAGCACCCCCCTCTGCTGGCACAGCCTCGGAACTCGGGACCTGCCTCTCCCACCCACCAGCTCTCTGCTAGTCCCCGGCTTGTGGGGGCTGCCCAGGCCCTGCTTCCTGACACAGGCAAAGGTGATCTGCCCACTGATCCTGGCTTCTCGGACCCAGAGAGCGATGCCAAGAGGAGAATTGTGTTCACCATCTCGGCTGGTGTGGGCAGTGCCAAGCAGTCACCCTCCACCAAGCACAGCCCTCTGGCCCCAGGCACCCGAGGAGACTGTGGGCCAAGCCACGGGCAGGACAGCCGCAAGCGTGGCCGGAGGAAGCGCACGTCGGCTGGGACTCCCAGTCTGAGTGCAGGCGTGTCCCCCAAGCGACGAGCCCTGCCTACCGTTGCTGGTCTCTTCACCCAGTCCTCAGGGTCCCCTCTCAACCTCAGCTCCATGGTCAGTAACATCAACCAGCCTCTGGAGATCACGGCCATCTCATCCCCTGAGAACTCCCTGAAGAGCTCCCCCGTCCCCTACCAGGACCACGACCAGCCTCCCGTGCTCAAAAAGGAACGGCCCCTGAGCCAGACCAATGGGGCACACTATTCCCCGCTGACCTCAGACGAGGAGCCAGGCTCTGAAGATGAGCGCAGCAGTGCCCGAATTGAGAGAAAAATTGCAACTATTTCCTTGGAAAGCAAATCTCCCCCGAAAACCTTGGAAAATGGTGGCAGCTTGGGAAGGAAGCCAGCACCCGCAAGTGAGCCAGTCAACAGCAGCAAGTGGAAATCCACCTTCTCACCCATCTCCGACATAGGCCTGGCCAAGTCTGCTGACAGCCCTCTGCAGGCCAGCTCCACCCTGGGCCAGAACTCCTTGTTCTCATTCCGGCCAGCCTTGGAGGAACCCGCAGCAGCCGATACCAAGCTCGCCACCCACTCAAGGAAAAGCTTTTCTGGGTCACTGTCTGGCACCGATGGGCTCAGTCCTGGCACCAACCCTCCCAACGGCCTGGCCTTCAGTGGGGCCCTGGCCGCGGACCTCAGTTTACATGGCTTCAACGATGGTGCTTCCCTGTCCCACAAGGGCCCTGAGGCAGCCGGCCTGAGCTTTCCCTCGCAGCGGGCCAAGGAGGCTCCCCCGGAGGCCAACCCCTTCTTTAACAAGCGGCAGCTGGAGGGCCTAGGTGGCCTGAAGGGCGAGGGTGGCCCAGGCAAGGAGCCGGGCGAGCCAGGCCTGCCCCTTTGTGGGCCCACGGACAAGGCTGCTCTGCCACATGGCAGTAGGGCTAGCAAGGCCCGGGACCGTGAGCTTGACTTCAAGAATGGCCACAACCTGTTCATCTCTGCTGCCACCGTGCCCCCCGGGGGCCTCCTGGGTGGCCCCAGCCTTGCCCCAGCAGCATCTTCTACAGGCAGTGCGGCCTCAGCAGCCCAGGCACACCGCCCCTTTCTGGGCGCCTTCACCCCCGGGCCACAGTTCACCCTGGGCCCTGTGTCCCTGCAGGCCAACCTGGGTGCAGTGGCTGGCTCTTCCGTGCTACAGTCCCTGTTCAGCTCAGTGCCAGCCGCTGCTGGCCTGGTGCACGTGTCATCCGCCGCAACCCGCCTGACCAACTCGCATGCTATGGGCAGCTTCCCCTCCGGGGTGGCCGGCGGAACCGTTGGAGGTGTCTCTAACCACGCGGTGCCTTCCGCCTCTGCTCGCCCGTTTGGAGCCAGTGTCGGCAGCGGGGCTGTGTGCAGCAGCGCCACGCTGGGCCTGGGCCCACTGCAGGCGGCGGCCAGCACCTCGGCCTCTTCCTTTCAGGCCCCGGCCTCGGCCGAGACGCGGCCGCCCCCTCCACCTCCCCCGCTTCCTCCTCAGCACCTGGGCATCCTCCATGCACCCCCTCCACCTAACGTCACCTTGCCTCCTCCCCCTGCGCTGCTGGCCTCTAACCCTGAGCCCGTGCTTTTGCAGAACCTAGCGTCCATCCCAGCTAACAAAGCTTTTTTACCCCTCTCCTCTGCCGCCTCTCTGCAGCCTGCTAACGCCTCTCTGTCTGTCAAGCTCGCCTCTCTCCCGCACAAGGCCTCCCGCCCCTCCTTCACGGTACACCACCAGCCGTTGTCCCGGCTAGCCCTGGCGCAGGCTGCACCCGCTGTCCCACAGGCCAGCTCCACGGGGCCGTCTGCTGTGTGGGTTTCTCTTGGCATGCCGCCTCCTTATGCCGCGCACCTTTCGGGGGTTAAGCCCCGATAA

XM_004865892.1 Coding sequence

Izumo4 IZUMO family member 4, transcript variant X1

Length: 906 bp    Location: 6754705..6751868   Strand: -
>XM_004865892.1
ATGGCCCTACTACTGTGCTTGGGGTTGACTGTCGCGCTGGCCCGCGGTTGCCTTCATTGCCATAATAACTTCTCGGAGAAGTTCTCCTTCTACCGCCACAACGTGAACCTCAAGTCTTGGTGGGTGGGTGACATCCCTGTCTCGGGGGCTCTGCTCACCGACTGGAGCAAGGACACGATGAAGAAGCTACACTTAGCCATCCCGGCGGAGATCAGTGAGCGTGGAGCCCAAAGTGGGGAAGCTCCACGGTCATATGGGACCCCCCTGGGCCTAGCAGGGTGGCTCACCTGCCTCCTCCTCCCGCTCACAGCCCGTGAGGATCTGAACCAGGTGGCTGAAACTGTGTATCGGAAGATGGATCAGCTGTACCAGGGGAAGATGTACTTCCCTGGTAAGGCGCGGGCAGCTGAGGCAGGGAGGGACCTCTTAACCTGCCCACCCACGCTGCCGGAGCTTGAACTTCCTCCTCTGCCTCTGACACCAGGATATTTCCCCAATGAGCTGCGAGTCATCTTCCGCGAGCAGGTGCATCTCATCCAGAATGCCATCATCAAAAGCATCTTCCAGTACAAGACCATCTCCTGCCACAACTGCTCTGACTCGCACTTCGTCTGCTTTGGCTACAACTGCGAGTCCTCGGTAGAGTGGGAGAGCGCTGTGCGGGGCCTTCTCATTTACATACAGGACACCAGCACGAGGGTGGGCACTGTGGCCAGGGCTCTCTGTGCACCTGGGACTGCCAGCCACCTGTTCTGCCACCTCACCCATGTAACACCGTGTGGTCATCTCATGAACAAACCTCGCCTCCTTCCTCCTGCATCTCCTCGCCTGGGACACCCAGAACCACCCCAGCCTTCCTATCACCAAGCATCTTGTGTCTGGAGCCACAGCGCCTGGTCAACCTGA

XM_004865878.1 Coding sequence

Lsm7 LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)

High confidence: 3 potential gene matches
Length: 312 bp    Location: 6576723..6584303   Strand: +
>XM_004865878.1
ATGGCGGACAAAGAGAAGAAGAAGAAGGAGAGCATCTTGGATCTGTCCAAGTATATTGACAAGACAATCCGGGTGAAGTTCCAGGGGGGGCGCGAAGCCAGTGGAATCCTGAAGGGCTTCGACCCACTGCTCAACCTCGTGCTAGACGGGACCATTGAGTACATGCGAGACCCCGACGACCAGTACAAGCTGACGGAGGACACGCGGCAGCTGGGCCTGGTGGTGTGCCGTGGCACGTCGGTGGTGCTCATCTGCCCGCAGGATGGCATGGAGGCCATCCCCAACCCCTTCATCCAGCAGCAGGACGCCTAG

XM_004865856.1 Coding sequence

Pip5k1c phosphatidylinositol-4-phosphate 5-kinase, type I, gamma, transcript variant X8

High confidence: 4 potential gene matches
Length: 2049 bp    Location: 6369402..6324993   Strand: -
>XM_004865856.1
ATGGAGCTGGAGGTGCCGGACGAGGCGGAGAGCGCCGGGGGGGGGGCCGTGACGGCGGAGGCGGCCTGGGCGGCGGAGAGCGGGGCGGCGGCAGGCCTGGCTCAGAAGAAGGCAGCCCTGGCAGAGGCCCCGTCGATGACTGGACAGCCTGGCCCCGGCCATGGAAAGAAGCTGGGGCACCGAGGCGTGGACGCATCTGGCGAGACCACCTACAAGAAGACCACATCCTCCACTCTTAAGGGAGCCATCCAGCTGGGCATCGGCTACACCGTGGGCAACCTGAGCTCCAAGCCTGAGCGAGATGTCCTCATGCAAGACTTCTATGTGGTGGAGAGCATCTTCTTCCCCAGTGAAGGCAGCAACCTCACCCCTGCCCACCACTTCCAGGATTTTCGGTTCAAGACGTATGCTCCGGTTGCCTTCCGCTACTTCCGGGAGCTCTTTGGGATCCGGCCGGATGATTACCTGTACTCGCTGTGCAATGAGCCGCTCATCGAGCTCTCGAACCCGGGCGCCAGCGGCTCCCTCTTCTACGTCACCAGTGACGATGAGTTCATCATCAAGACCGTGATGCACAAGGAGGCCGAGTTCCTGCAGAAGCTGCTGCCCGGCTACTACATGAACCTCAACCAGAACCCCCGCACGCTGCTGCCCAAGTTCTACGGGCTGTACTGTGTGCAGTCGGGTGGCAAGAACATTCGCGTGGTGGTCATGAACAACGTGCTTCCGCGGGTCGTCAAGATGCACCTCAAGTTCGACCTCAAGGGCTCCACCTACAAGCGGCGTGCCAGCCGCAAGGAGAAGGAGAAGAGCCTGCCCACCTACAAGGACCTGGACTTCATGCAGGACATGCCCGAGGGGCTGCTACTTGATGCCGATACCTTTGGCGCCCTGGTCAAGACACTACAGCGCGACTGCCTGGTGCTGGAGAGCTTCAAGATCATGGACTACAGCCTGCTGCTCGGCGTCCACAACATCGACCAGCAGGAGAGGGAGCGGCAGGCGGAGGGTGCTCAGAGCACAGCGGACGAGAAGCGGCCAGTGGGCCAGAAGGCGCTCTACTCCACCGCCATGGAGTCCATCCAGGGTGGTGCCGTGCGCGGCGAGGCCATCGACACCGACGACACGATGGGTGGGATCCCAGCTGTGAACGGACGCGGAGAGCGGCTGCTGCTGCACATAGGTATCATCGATATCCTGCAGTCCTACAGGTTCATCAAGAAGCTCGAGCATACCTGGAAAGCCCTTGTCCATGATGGGGACACAGTCTCTGTCCACCGGCCCAGCTTCTACGCTGAACGCTTTTTCAAATTCATGAGCAACACGGTCTTTCGGAAGAACTCCTCCCTGAAGTCCTCACCGTCCAAGAAGGGGCGCAGTGCCCTCCTGGCTGTCAAGCCCCTGGGGCCCACAGCAGCCTTCTCAGCTAGCCAGATCCCCAGCGAGCGAGAAGATGCACAGTACGACCTTCGGGGGGCCCGCAGCTACCCCACCCTGGAGGATGAAGGGCGGCCCGACCTCCTGCCCTGCACTCCACCTTCCTTTGAAGAAGCCACCACCGCCTCCATAGCCACGACCCTGTCATCCACCTCCCTCTCCATCCCTGAGCGGTCCCCTTCTGAGTCCTCAGAGCAGCCTCGGTACAGGCGGCGCACACAGTCGTCCGGACAGGATGGCCGGCCCCAGGAGGAGCCACATGTGGAGGAAGACCTGCAGCAGATTACTGTGCAGGTGGAGCCCACATGCAGCGTGGAGATCGTGGTCCCCAAGGAGGACCCAGGGGTGGAGGCCTGCCCAGCGGGGGCCTCTGCATCCACCGCGGAAGCAGAAACCACCAGCCAGGCCTCAGAGCCCGCCAGCCAGGCCTCGGATGAGGAGGACGTGCCCGCCACTGACATCTACTTTCCCACCGACGACAGGAGCTGGGTGTACTCCCCGCTCCACTATAGCACGCAGCCCCAGCCCTCCGACGGCGAGAGTGACACAGTGAGTCCCCTGGGGGCCAGGGAATCCAGACAGATGGGGAAACAGGCTGGGGCGGGAGGGTGA

XM_004865825.1 Coding sequence

Aes amino-terminal enhancer of split, transcript variant X1

High confidence: 3 potential gene matches
Length: 594 bp    Location: 6113042..6121720   Strand: +
>XM_004865825.1
ATGATGTTTCCACAAAGCAGGCATTCGGGCTCCTCGCACCTCCCCCAGCAGCTCAAATTCACCACCTCGGACTCTTGCGACCGCATCAAAGACGAGTTCCAGCTCCTGCAGGCCCAGTACCACAGTCTGAAGCTGGAGTGTGACAAGCTGGCCAGCGAGAAGTCGGAGATGCAGCGCCACTATGTCATGTACTACGAGATGTCCTATGGCCTGAACATCGAGATGCACAAGCAGGCGGAGATCGTCAAGAGGCTGAACGGCATCTGTGCCCAGGTCCTGCCCTACCTCTCCCAGGAGCACCAGCAGCAGGTCCTGGGGGCCATCGAGAGGGCCAAGCAGGTCACGGCGCCCGAGCTGAATTCCATCATCCGGCAGCAGCTTCAGGCTCACCAGCTGTCGCAGCTGCAGGCCCTGGCGCTGCCCTTGACGCCCCTGCCCGTGGGGCTGCAGCCGCCGTCGCTGCCGGCCGTGAGTGCGGGCACCGGGCTGCTGTCGCTGTCGGCACTGGGCTCCCAGGCCCACCTGTCCAAGGAAGACAAGAACGGGCACGACGGCGACACCCACCAGGAGGACGACGGCGAGAAGTCCGATTAG

XM_004865797.1 Coding sequence

LOC101715337 chromosome unknown open reading frame, human C19orf77, transcript variant X2

Length: 300 bp    Location: 5886121..5888872   Strand: +
>XM_004865797.1
ATGGCTGGTGGGCCTGACGGCGGTTGTGGTCTTCCTGTTCATCGTCTTCGTGCTCTTACTGGCCAACCGCATCTGGTGCTCCAAAGCCAGTCTCATGGCCCTGTCCACATCTGCAGAGCCGAGGATGAGGAGACCACCATGAGAATACAGCCCAACCCTTACGAGAGCATGGGCCCAAGGAAAGACAGCAAGAAGGAGAAGAAACAGAAGAAAAAGGAGAAAGGAGGGGAGAGCAATTTGGGATTGGAGCTGGAAGAGAAAGAGCCCGAAGAGTATGAAGAGATCAAGACGAGTATGTGA

XM_004865726.1 Coding sequence

LOC101724173 chromosome unknown open reading frame, human C19orf10, transcript variant X2

Length: 471 bp    Location: 5115265..5124185   Strand: +
>XM_004865726.1
ATGGCGGCGCCCAGGGGAAATAGTGACGGCTGTGGTGGGGCCTGGTTTGCCGCGCTGCTCCTGGCGGCAGTGGCTCTGAGGCCGGCGGAGGCAGTGTCTGAGCCTACGACGGTGGCGTTTGACGTGCGGCCCGGTGGCGTCGTGCATTCCTTCTCCCAGAACGTGGGACCCGGGCAATGGCAGATGAGTCTGGGCACCAGCGAGGACCACCAGCACTTCACCTGCATCATCTGGAGGCCCCAGGGGAAGTCCTACCTCTACTTCACCCAGTTCAAGGCCGAGGTGCACGGTGCTGAAATCGAGTATGCCATGGCCTATTCGAAAGCTGCGTTTGAAAGAGAAAGTGACGTTCCCCTGAAAAATGAGGAATTTGAAGTGACCAAAGCAGCAGTGGCCCACAGGCCTGGCGCCTTCAGGGCTGAGCTGTCCAAGCTGGTGATCGTGGCCAAGGAAGCCCACAGCGAGCTGTGA

XM_004865796.1 Coding sequence

LOC101715337 chromosome unknown open reading frame, human C19orf77, transcript variant X1

Length: 363 bp    Location: 5886136..5888872   Strand: +
>XM_004865796.1
ATGAGCGCCCTGGGGATGCTGCTCGTGCTGGCGACCTTGCTCCTGCCGTCTGTCCAGGCCCAGCAGGCCACAGAACGTCACCTGAAGCCATGGCTGGTGGGCCTGACGGCGGTTGTGGTCTTCCTGTTCATCGTCTTCGTGCTCTTACTGGCCAACCGCATCTGGTGCTCCAAAGCCAGAGCCGAGGATGAGGAGACCACCATGAGAATACAGCCCAACCCTTACGAGAGCATGGGCCCAAGGAAAGACAGCAAGAAGGAGAAGAAACAGAAGAAAAAGGAGAAAGGAGGGGAGAGCAATTTGGGATTGGAGCTGGAAGAGAAAGAGCCCGAAGAGTATGAAGAGATCAAGACGAGTATGTGA

XM_004865734.1 Coding sequence

LOC101696481 hepatoma-derived growth factor-related protein 2-like, transcript variant X1

Length: 2016 bp    Location: 5251480..5231501   Strand: -
>XM_004865734.1
ATGCCGCACGCTTTCAAGCCCGGAGACTTAGTGTTCGCCAAGATGAAGGGTTACCCGCACTGGCCGGCCCGGATTGATGACATTGCCGATGGTGCTGTGAAGCCCCCTCCCAACAAATACCCCATCTTCTTCTTTGGTACACATGAAACAGCCTTCCTGGGACCCAAGGACCTGTTCCCGTATGACAAGTGCAAAGATAAGTATGGGAAACCCAACAAGAGGAAAGGCTTCAATGAGGGACTCTGGGAGATCCAGAACAACCCTCACGCCAGCTACAGCGCCCCTCCGCCAGTGAGTTCCTCTGAGAGCGAGGCCCCTGAAGCTGACCCTGCAGGTGGGAGTGACGCCGATGAGGACGAGGAGGGCCGGGGAGTCATGGCTGTCACAGCTGTGACTGCCGCAGCCGCCAGCGACAGGATGGAGAGTGACTCAGACTCTGATAAGAGCAGTGACAACAGCGGCCTGAAACGGAAGACATCGGCACTGAAGATGTCTGTCTCCAAGCGTGTCCGGAAGGCCTCTAGTGACCTGGACCAAGCCAGCGTGTCGCCCTCTGAAGAGGAGAACTCAGAGAGCTCGTCCGAGTCCGAGAAGACCAGCGACCAGGACTTCACGCCCGAGAAGAAAGCTGTGGTCCGGGCGCCGCGGCGGGCCTCCGTGGGTGGACGGAAGAAGAAGAAGGTGCCGGCAGCCTCGGATTCGGACTCCAAAGCCGATTCCGATGGGGCCAAGGAGGAGCCAGTGGCCCTGGCAAAGTCAGCGTCTCCCTCCTCTTCCTCCTCTTCCTCCGACTCTGACGTGTCTGTCAAGAAACCTCCTCGGGGCAGAAAGCCAGCAGAGAAGCCTCCCCCAAAGCCCCGAGGGCGGAAGCCAAAGCCTGAGCGGCCGCCTTCCACCTCCAGCAGTGACAGCGACAGCGACGAGGTGGACCGCATCAGTGAATGGAAACGGCGAGACGAGGAGCGGAGGCGGGAGCTGGAAGCCCGGAGGCGGCGGGAGCAGGAAGAGGAGCTGCGGAGGCTGCGTGAGCAGGAGAAGGAGGAGAAGGAGCGGCGGCGTGAGCGGGCTGAGCACGGGGAGGCTGAGCGAGGAGGCAGCAGTGGCAGCAGTGGGGACGAGCTTGGGGAGGACGACGAGCCTGTCAAGAAGCGGGGCCGCAAGGGCCGGGGCCGGGGGCCGCCCTCCTCCTCCGACTCGGAGCCCGAAGCAGAGCTGGAGAGAGAGGGGAAGAAATCCACCAAGAAGTTGCAACCTCAGAGCACAGAGCCCATGAGGAAGCCCAGCCAGAAGGAGAAGAGAGGGCGGCCTGAGGAGAAGCCCCGGACCAGGCCTGTGAAGGTAGAACGGACCCGGAAGCGGTCGGAAGGGCTCCTGCTGGACAGGAAGGGGGAAAAGAAGAAAGAACCTTCTGTGGAGGAGAAGCTGCAGAAGCTGCACAGCGAGATCAAGTTTGCCCTGAAGGTCGACAACCCGGACGTGAAGAGGTGTCTGAATGCTCTGGAGGAGCTGGGGACCCTGCAGGTGACCTCTCAGATCCTGCAGAAGAACACAGATGTGGTGGCCACGTTGAAGAAGATTCGCCGCTACAAAGCCAACAAAGAAGTGATGGAGAAGGCAGCGGAAGTCTACACTCGGCTCAAGTCTCGTGTCTTGGGGCCCAAGATCGAGGCAATCCAGAAAGCAAACAAAACTGGAACAGAGAAGGAGAAGGCTGAGGTGGAGAAGGCTGAGGAGAAGCTGGCCGGGGAGGAGACCACCAAGGAGAAGGCGGAGGATGAGCCCAGCCTGGATCTCTCAGCCCCTGTGAATGGCGAGGCCACGTCGCAGAAGGGGGAGAGCACGGAGGACAGGGAGCAGGAGGACGCGCAGGACTCGGAGGAGGGTCTACAGCGCAGCTCCTCAGAAGACCTGCACGACAGCCTACGGGAGGGCCCTGACCTGGACAGGCCCGGGAGCGAGCGGCAGGAGCGCGAGAGGGTGCGGCTGGACTCGGAGTCCCTGGACGAGGACAGCTGA

XM_004865711.1 Coding sequence

Uhrf1 ubiquitin-like with PHD and ring finger domains 1, transcript variant X2

Length: 2340 bp    Location: 4929687..4898841   Strand: -
>XM_004865711.1
ATGTGGGTCCAGGTGCGGACCATGGATGGCAAGGAGACTCACACCGTGGACTCGCTGTCCAGGCTGACCAAGGTAGAAGAACTGAGGCGGAAGATTCAGGAGCTATTTCACGTGGAACCCGGTTTGCAGAGGCTCTTTTACAGGGGCAAGCAGATGGAGGACGGCCACACGCTGTTTGATTATGATGTGCGCCTCAATGACACCATCCAGCTGCTGGTGCGCCAGAGCTTGGTGCTCCCATCCAGCCAGGAGAGGGACTCAGAGCTCTCAGACACGGACTCGGGCTGCTGCCTGGGCCAGAGTGAGTCGGACAAGTCATCCACACATGGCGAGGGGGCTGCCGACGCAGATAGCAAGGCTGGCCTGGCAGACAAGGATGTGGCTGAGACTGAGCAGGGGCTCTATAAGGTGAACGAGTACGTGGACGCACGGGACACAAACATGGGTGCGTGGTTCGAGGCGCAGGTGGTTGGGGTGCTTCGGAAGGTGAGGATGGCTGAGGACAAGCCCTGCAGCTCCACCACCAGCCCAACACCCGAGGAGAATGTCATCTACCGCGTGAAATACGATGACTACCCCGAGAACGGCGTGGTCACCATGCAGTCCCACAATGTGCGTGCACGGGCCCGCACCATCCTCAAGTGGCACGAGCTGGAGGTGGGCCAGGTGGTCATGCTCAACTACAACTCCGACCACCCCAGGGAGCGCGGCTTCTGGTACGACGCCGAGATCTGCAGGAAGCGTGAGACGCGCACGGGGCGGGAGCTCTACGCGAACATCAGGCTCGGGGACCATTCCCTCCACAACTGTCGCATCGTCTTCATGGACGAGGTATTCAAGATTGAGCGCCCAGGCGAGGCCCCCCCCGTGGTTGAGAACCCCATGAGACGCAAGAGTGGCCCGAGCTGCAAGTACTGCAAGGACGACCCCAACAAGCTGTGCCGCATATGCGCCTGCCACCGGTGCGGGGGCCGGGAGGCACCCGACAAGCAGCTGATGTGTGACGAGTGCGACATGGCGTACCACCTGTACTGCCTGGACCCGCCGCTCAGCAGTGTGCCGCCGCCCGAGGAGGACTGGTACTGCCCCGATTGCCGGAACGAGCCCAGCGAGGTGGTGCTGGCTGGGCAAAGGCTGCGAGAGAGCAAGAAGAAGGCGAAGATGGCGTCGGCCACGTCATCCTCTCAGCGGGACTGGGGAAAGGGCATGGCGTGCGTGGGGCGCACGAAGGAGTGCACTATTGTCCCGTCCAACCACTATGGACCCATCCCAGGCATCCCTGTGGGGACCATGTGGCGGTTCCGCGTGCAGGTCAGTGAGTCCGGTGTCCATCGGCCTCACGTTGCAGGCATCCATGGGCGGAGCAATGATGGGGCCTACTCCTTGGTCCTGGCTGGGGGCTATGAGGACGATGAGGACAATGGGAATTCTTTCACCTACACAGGTAGTGGTGGCCGAGATCTTTCTGGCAACAAGCGGACTGCTGGGCAGTCATCTGACCAGAAACTCACCAATACCAACAGGGCGCTGGCTCTCAACTGCTACGCCCCCATCAACGACAAGAAGGGCGCAGAGTCCAAGGAATGGCGCTCGGGGAAGCCAGTGCGGGTCGTGCGAAACATGAAGGGCGGCAAGCACAGCAAGTACGCACCTGCGGAGGGCAACCGCTATGATGGGATCTATAAGGTCGTGAAGTACTGGCCTGAGAAGGGCAAGTCTGGCTTTCTCGTGTGGCGCTACCTCCTGCGCAGGGATGACGTGGAACCTGGGCCCTGGACCAAGGAAGGGAAGGACCGCACCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAGGGTTACTTGGAAGCCCTGGCCAACCGGGACAAGGAGAACAAGAGGGCGGCCGAGGAGCAGGAAGACCTGTCGCCCTCCAAGAAGGGCAAGTGGAAGCGGAAGTCAGCAGGCCAGAGTGGGTCTCAGCCTCAGACCACCAAGAAGACCAAGCTGGAGCCCTACAGACTCACGGCTGAGCAGAGCAACCTCATCAAGGCGGATGAGAGCAACACGAAGCTGTGGACCGAGGTCCTCACGGCGCTCAGAGAAGGCTTGTTCCAGGTGTTCCTGAGCAAGGTGGAGGAGACGTTCCAGTGCATCTGCTGCCAGGAGCTGGTGTTCCAGCCTGTCACCACTGTGTGCCAGCACAACGTGTGCAAGGACTGCCTGGACAGGTCATTCCGTGCCCAGGTCTTCAGCTGCCCGGCCTGCCGCTATGACCTGGGCCGTGGCTACGCCATGCAGGTGAACACGGCACTCCAGACCATCCTCAGCCATTTCTTTCCCGGCTATGGCAGCGGCCGGTGA

XM_004865659.1 Coding sequence

Ndufa11 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa, transcript variant X1

Length: 840 bp    Location: 4319665..4326897   Strand: +
>XM_004865659.1
ATGGCGAAGAGGCTGCTCCATCAGTACACAGACATCCCAGACGGCACCGACTGCCACCGCAAGGCCTACGCTAGCACCGCTATCAGTACCACCGTCGGCCTGATCTGGTCTGGCTACAGCCTCACACACAGGGCCCCAGGCTCCATCCTCGAAGGCGTGGCCAGGGCCGGAAGGTACACATTTACCGCAGCCGCCATTGGGGCCATATTCGGCCTGACCTCCTGTATCAGTGCCCAGATCCGAGAAAAGCCCGACGACCCCCTGAACTACTTCCTCGGAGGCTGTGCCGGAGGCCTGACCCTGGGAGCACGCAGTGAGTGCCCACCTGCCCCTCCTCCCTCTCCACTCCACCCTGATAGCGGGGGCATCGCAGGGAAGGTACAGTGCCTCTCAGCACATTCCACAGGGCACTGTACCCTCCCTGCCACCCCTCCACCCTCTGCCTCTCATTGTGCCTCAGGGCCTTTGCATGCACTGAGCCCACTGCCTGGAGTGCTGCTCCTGCATGTGTCAGCACAGCTCCCCCATCCTGTCTGCATCTTGTCAGGGGACATAGGCCACTGGCTGTTATCAACTCTGGTCTTGAGGGCAAGAGGTGCTGTTTCCGCAAGGCCACTTGTCTCTCAGTGCCCCAAAGTGTGCAGGGCCCAGGAGCTGCAACCCTTACCAGCTGCACAGATGTGGGAATGGGGTCACTGCAGGCTTTCTCAGCAGCAGAGGGCACAGTGTGGTCGGGGCAGGAGCCTGGCCAGCCTGCACTTCCGGCCCGCACTCACCGGAGCTGGCCGGGTAGCTGAGGTCTCACCGGCCCCTGTCCCCAGCAGGCCTGGAAGGGTGTGA

XM_004865663.1 Coding sequence

Caps calcyphosine, transcript variant X1

Length: 747 bp    Location: 4313325..4311803   Strand: -
>XM_004865663.1
ATGTGGGACCAGGGAGCAGACGCAGGCCAGCTGGACAGCATGGACGCCGTGGACGCCACCATGGAGAAGCTGCGGGCGCAGTGTCTGGCGCGGGGGCCCTCAGGCATCCAGAGCCTGGCCAGGTTCTTCCGCCGCCTGGACCGGGATGGGAGCCGGTCCCTGGACGCAGTGGAGCTGCAGCGGGGCCTGGCTGAGCTGGGGCTGGTTCTGGAGCTGGCAGAGGCGGAGGCCATGTGCAGGCGCTGGGACCTTGATGGCAGTGGGACGCTGGACCTGCAGGAGTTTCTGCGGGCACTGCGGCCCCCCATGTCCCAGGCCCGGGAGGCCATCATTGCGGCCGCCTTTGCCAAGCTGGACCGCAGCGGGGACAGCGTGGTGACTGTGGACGACCTCCGTGGGGTGTACAGCGGCCGCAGCCACCCCAAGGTGTGCAGTGGGGAGTGGACAGAGGAGGAGGTGCTGCAGCGCTTCCTCGACAACTTTGACGCCCGTGACAAAGATGGGCAGGTGAGTGGCGCGAGGGGCCCTCCAGAGGCAGCTGCAGTGCCGGGCCCTCACACCCGTGTGCCTGCAGGTCACCCTGGAGGAGTTCCAGGACTACTACAGCGGGCTCAGTGCCTCCGTGGACACAGACGAGGAGTTCGTGGCCATGGTGACCAGCGCCTGGCAGCTCTGAGAAGCATGCCCAAGAGGCCCCCAGGTCCCTCCTCACCTGGCTGCGTGACCCCGAGCAGAGCCCAAAGGTGA

XM_004865625.1 Coding sequence

LOC101722518 protein crumbs homolog 3-like, transcript variant X5

Length: 363 bp    Location: 3571967..3578146   Strand: +
>XM_004865625.1
ATGGCGACCCCAGGCCTGGGGCTGCTCTGGGTACTTGGCCTGGCGCTGCTGCCCACCCGCTGGGGCCGAGCCTGGGGGGAAAACTCAACATCAACACCGGCCTCTTTGACGCAGGAGCCCAATGACTTCAGCTCCAATGGGGGCCTGTCTCAGGAGGGCCTTACTGCTATCATTGTGGTCTTCTCCATCCTTGGGGCTCTGGTCGTGGTGTCGGGGCTGGTGTTCATGGTACAGAAACTTCGGGAGAAGCGGCAGACGGAGGGCACCTACCGGCCCAGCAATGAGGAGCAGTTCTCCCACGCAGCCGAGGCCCGGGCCCCCCAGGACTCCAAGGAGACGGTTCGGGGCTGCCTGCCCATCTAG

XM_004865607.1 Coding sequence

Elof1 elongation factor 1 homolog (S. cerevisiae), transcript variant X2

High confidence: 4 potential gene matches
Length: 252 bp    Location: 3295577..3293032   Strand: -
>XM_004865607.1
ATGGGACGCAGGAAGTCGAAACGGAAGCCACCCCCCAAGAAGAAGATGACGGGCACCTTGGAGACCCAGTTTACCTGCCCCTTCTGCAACCACGAGAAGTCCTGTGACGTGAAAATGGACCGCGCCCGCAACACTGGAGTCATTTCCTGTACCGTGTGCCTAGAGGAATTCCAGACGCCCATCACTTATCTGTCAGAACCCGTGGACGTGTACAGCGATTGGATAGACGCCTGCGAGGCAGCCAATCAGTAG

XM_004865606.1 Coding sequence

Elof1 elongation factor 1 homolog (S. cerevisiae), transcript variant X1

Length: 339 bp    Location: 3294221..3293032   Strand: -
>XM_004865606.1
ATGGGACGCAGGAAGTCGAAACGGAAGCCACCCCCCAAGAAGAAGATGACGGGCACCTTGGAGACCCAGTTTACCTGCCCCTTCTGCAACCACGAGAAGTCCTGTGACGTGAAAATGGACCGCGCCCGCAACACTGGAGTCATTTCCTGTACCGTGTGCCTAGAGGAATTCCAGACGCCCATCACTTGTATCCTTGCCCACCAGCTTCTTAGGGGGATGGGAGAGCCAGTCGGGTGGCTAGGCCTGCCCTGGCCAAGGGAAGGGGGCTGGAGGCCATGCTGTGTGCCCTGGTGTCGGGCACCAGCCAACCAGAGGCATGGGTATCTCCTGCTGCCTTAA

XM_004865614.1 Coding sequence

LOC101720171 60S ribosomal protein L39-like

Length: 156 bp    Location: 3485250..3485405   Strand: +
>XM_004865614.1
ATGTCTTCTCACAAGACTTTCAGAATCACTCGATTCCTAGCCAAGAAACAAAAGCAGAATCATCCCATTCCTCAATGGATTCGGATGAAGACTGGTAATAAAATCAGGTACAACTCCAAGAGGAGACACTGGAGGAGGACCAACCTGGGACTGTAA

XM_004865547.1 Coding sequence

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4, transcript variant X2

Length: 4965 bp    Location: 2893096..2985968   Strand: +
>XM_004865547.1
ATGTCCACTCCAGACCCACCCCTGGGCGGAACTCCTCGGCCAGGCCCTTCCCCAGGCCCAGGCCCCTCACCTGGAGCCATGCTGGGCCCTAGCCCTGGCCCCTCACCGGGCTCAGCTCACAGCATGATGGGGCCTAGCCCCGGGCCTCCCTCAGCAGGACACCCCATCTCCACGCAGGGGCCTGGAGGGTACCCTCAGGACAACATGCACCAGATGCACAAGCCCATGGAGTCCCTGCATGAGAAGAGCATGTCGGAGGACCCACGCTACAACCAGATGAAGGGCATGGGGATGCGCTCGGGTGGCCACGCAGGCATGGGCCCCCCACCCAGCCCCATGGACCAGCACTCCCAAGGTTACCCCTCGCCCCTGGGCGGCTCCGAGCATGCCTCCAGTCCTGTTCCAGCCAGCGGCCCATCTTCGGGCCCCCAGATGTCGTCTGGGCCAGGAGGGGCCCCGCTGGACGGCACTGACCCCCAGGCCTTGGGGCAGCAGAGCCGGGGCCCCACCCCATTCAACCAGAACCAGCTGCACCAGCTTCGGGCACAGATCATGGCCTACAAGATGCTGGCCAGGGGACAGCCCCTGCCTGACCACCTGCAGATGGCCGTGCAGGGAAAGCGGCCCATGCCTGGGATGCAGCAGCAGATGCCCACGCTACCTCCGCCCTCTGTGTCTGCCACAGGGCCTGGGCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCGGGACCAGCACCTCCAAATTATAGCAGGCCTCATGGTATGGTAGGGCCCAACATGCCTCCCCCAGGACCCTCAGGTGTGCCCCCCGGGATGCCCGGCCAGCCCCCTGGAGGGCCTCCCAAGCCCTGGCCTGAAGGCCCCATGGTGAACGCTGCTGCTCCCACGAGCACCCCTCAGAAGCTGATCCCCCCACAGCCGACGGGCCGTCCTTCGCCCGCACCCCCTGCCGTCCCACCCGCTGCCTCGCCTGTGATGCCGCCCCAGACCCAGTCCCCGGGGCAGCCGGCCCAGCCTGCGCCCTTGGTGCCACTGCACCAGAAGCAGAGCCGCATCACTCCCATCCAGAAGCCCCGGGGCCTGGACCCCGTGGAGATCCTGCAGGAGCGCGAGTACAGGCTGCAGGCTCGCATCGCACACCGCATTCAGGAACTTGAAAATCTCCCCGGCTCCCTGGCTGGGGATCTGCGAACCAAAGCAACCATCGAGCTCAAGGCCCTCCGGCTGCTGAACTTCCAGCGGCAGCTGCGCCAGGAGGTGGTAGTGTGCATGCGCAGGGACACGGCCCTGGAGACAGCCCTCAATGCCAAGGCCTACAAGCGCAGCAAGCGGCAGTCCCTGCGTGAGGCCCGAATCACCGAGAAGCTGGAGAAGCAGCAGAAGATCGAGCAGGAGCGAAAGCGGCGCCAGAAGCACCAGGAATACCTCAATAGCATTCTTCAGCACGCCAAGGATTTCAAGGAATACCACAGATCCGTTACGGGAAAAATCCAGAAGCTGACCAAGGCGGTGGCCACGTACCATGCCAACACGGAGCGGGAGCAGAAGAAAGAAAACGAGCGCATCGAGAAGGAGAGGATGCGGAGGCTCATGGCGGAAGATGAAGAGGGTTACCGCAAGCTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACAGACGAGTATGTGGCCAACCTCACGGAGCTGGTGCGGCAGCACAAGGCCGCCCAGGTCGCCAAGGAGAAAAAGAAGAAGAAGAAGAAGAAGAAGGCAGAAAACGCTGAAGGACAGACGCCCGCGATCGGACCCGATGGCGAGCCTCTGGATGAGACCAGCCAGATGAGTGACCTCCCTGTGAAGGTGATCCACGTGGAGAGTGGCAAGATCCTCACAGGCACAGACGCCCCCAAAGCTGGGCAACTGGAGGCCTGGCTTGAGATGAACCCGGGGTATGAGGTGGCGCCGAGGTCTGATAGTGAAGAGAGCGGCTCAGAAGAAGAAGAGGAGGAGGAGGAGGAAGAGCAGCCACAGCCAGCACAGCCTCCCACCCTGCCTGTGGAGGAGAAGAAGAAGATCCCAGACCCTGACAGCGACGATGTCTCTGAGGTGGACGCACGGCACATCATTGAGAATGCCAAGCAAGACGTTGATGATGAGTATGGCGTGTCCCAGGCCCTTGCTCGCGGCCTGCAGTCCTACTATGCTGTGGCCCACGCTGTCACCGAGAGAGTGGACAAGCAGTCAGCACTCATGGTCAACGGCGTCCTCAAGCAGTACCAGATCAAAGGCTTGGAGTGGCTGGTGTCCCTGTACAACAACAACCTGAACGGCATCCTGGCTGACGAGATGGGCCTGGGGAAGACCATCCAGACCATCGCGCTCATCACATACCTCATGGAGCACAAGCGCATCAACGGGCCCTTCCTCATCATCGTGCCTCTCTCGACGCTGTCGAACTGGGCATACGAATTTGACAAGTGGGCCCCTTCCGTGGTGAAGGTGTCCTACAAGGGCTCTCCAGCAGCAAGACGAGCTTTCGTCCCCCAGCTCCGCAGTGGCAAGTTTAACGTCTTGCTGACGACCTACGAATACATCATCAAAGACAAGCACATCCTCGCCAAGATCCGCTGGAAGTACATGATCGTGGACGAGGGCCACCGCATGAAAAACCACCACTGCAAGCTGACGCAGGTGCTCAACACGCACTACGTGGCCCCACGTCGGCTGCTGCTCACGGGCACACCACTGCAGAACAAGCTGCCGGAGCTCTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTCAAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCACCCTTTGCCATGACAGGGGAGAAGGTGGACCTGAACGAAGAGGAAACCATCCTCATCATCCGTCGTTTGCACAAAGTGCTGCGGCCCTTCCTGCTCCGGCGGCTCAAGAAGGAAGTCGAGGCCCAGCTGCCTGAGAAGGTGGAGTATGTCATCAAGTGCGACATGTCTGCGCTCCAGCGCGTGCTCTACCGGCACATGCAGGCCAAGGGGGTGCTGCTCACTGACGGCTCTGAGAAGGACAAGAAGGGCAAAGGTGGCACCAAGACCCTGATGAACACCATCATGCAGCTAAGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATTGAGGAGTCCTTCTCTGAACACTTGGGCTTCACCGGCGGCATCGTGCAAGGGCTGGACCTGTATCGAGCCTCAGGCAAATTTGAGCTTCTCGATAGAATCCTCCCCAAACTTCGTGCCACCAACCACAAAGTGCTACTGTTCTGCCAGATGACCTCCCTCATGACGATCATGGAAGATTACTTTGCGTATCGCGGCTTTAAATACCTCAGGCTGGACGGAACCACAAAGGCGGAGGACCGGGGCATGCTGCTCAAGACCTTCAACGAGCCCGGCTCCGAGTACTTCATCTTCCTGCTCAGCACCCGCGCTGGTGGGCTGGGCCTCAACCTGCAGTCAGCAGACACTGTGATCATCTTCGACAGCGACTGGAACCCTCACCAGGACCTGCAAGCGCAAGACCGGGCACACCGCATTGGGCAGCAGAACGAGGTGCGCGTGCTCCGCCTCTGCACCGTGAACAGTGTGGAGGAGAAGATCCTGGCGGCTGCCAAGTACAAGCTCAACGTGGACCAGAAAGTGATCCAGGCGGGCATGTTTGACCAGAAGTCGTCCAGCCACGAGCGGCGCGCCTTCCTGCAGGCCATCCTGGAGCACGAGGAGCAGGACGAGAGCAGACACTGCAGCACGGGCAGCGGCAGTGCCAGCTTCGCCCACACGGCCCCTCCGCCAGCGGGCGTCACCCCCGACTTGGAGGAGCCACCTCTAAAGGAGGAAGACGAGGTGCCTGATGATGAGACGGTCAACCAGATGATTGCCCGGCACGAGGAGGAGTTCGACTTGTTCATGCGCATGGACCTGGACCGCCGGCGTGAAGAGGCTCGCAACCCCAAACGGAAGCCTCGTCTCATGGAGGAGGACGAGCTCCCATCCTGGATCATCAAGGATGATGCGGAGGTGGAGCGGCTGACGTGTGAGGAGGAGGAGGAGAAAATGTTTGGGCGTGGCTCCCGCCACCGCAAGGAGGTGGACTACAGCGACTCGCTGACAGAGAAGCAGTGGCTCAAGACCCTGAAGGCCATCGAGGAGGGCACGTTGGAGGAGATCGAAGAGGAGGTCCGGCAGAAGAAATCCTCGCGAAAGCGCAAGCGGGACAGCGATGCCGGCTCCTCGACACCGACCACCAGCACCCGCAGCCGCGACAAGGACGACGAGAGCAAGAAGCAGAAGAAGCGTGGACGGCCGCCCGCTGAGAAGCTCTCCCCAAACCCGCCCAACCTCACCAAGAAGATGAAGAAGATCGTGGACGCCGTGATCAAGTACAAGGACAGTAGCAGTGGACGGCAGCTCAGTGAGGTATTCATCCAGTTGCCCTCCCGCAAGGAGCTGCCTGAGTACTACGAGCTCATCCGCAAGCCTGTGGACTTCAAGAAGATCAAGGAGCGCATCCGCAACCACAAGTACCGTAGCCTCAACGACCTCGAAAAGGACGTGATGCTGCTCTGCCAGAACGCGCAGACCTTCAACCTGGAGGGCTCGCTGATCTACGAGGACTCCATCGTGCTGCAGTCGGTCTTCACCAGTGTCCGGCAGAAGATCGAGAAGGAGGAGGACAGTGAGGGCGAAGAGAGCGAGGAGGAGGAGGAAGCCGAGGAGGAGGGCTCGGAGTCCGAGTCCCGCTCTGTCAAGGTGAAGATTAAGCTGGGCCGCAAGGAGAAGGCCCAGGACCGGCTCAAGGGCAGCCGCCGCAGGCCCAGCCGAGGGTCCCGGGCCAAGCCGGTCGTGAGCGACGACGACAGTGAGGAGGAGCAGGAGGAGGACCGCTCAGGAAGTGGCAGCGAGGAGGACTGA

XM_004865546.1 Coding sequence

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4, transcript variant X1

Length: 4965 bp    Location: 2893096..2985968   Strand: +
>XM_004865546.1
ATGTCCACTCCAGACCCACCCCTGGGCGGAACTCCTCGGCCAGGCCCTTCCCCAGGCCCAGGCCCCTCACCTGGAGCCATGCTGGGCCCTAGCCCTGGCCCCTCACCGGGCTCAGCTCACAGCATGATGGGGCCTAGCCCCGGGCCTCCCTCAGCAGGACACCCCATCTCCACGCAGGGGCCTGGAGGGTACCCTCAGGACAACATGCACCAGATGCACAAGCCCATGGAGTCCCTGCATGAGAAGAGCATGTCGGAGGACCCACGCTACAACCAGATGAAGGGCATGGGGATGCGCTCGGGTGGCCACGCAGGCATGGGCCCCCCACCCAGCCCCATGGACCAGCACTCCCAAGGTTACCCCTCGCCCCTGGGCGGCTCCGAGCATGCCTCCAGTCCTGTTCCAGCCAGCGGCCCATCTTCGGGCCCCCAGATGTCGTCTGGGCCAGGAGGGGCCCCGCTGGACGGCACTGACCCCCAGGCCTTGGGGCAGCAGAGCCGGGGCCCCACCCCATTCAACCAGAACCAGCTGCACCAGCTTCGGGCACAGATCATGGCCTACAAGATGCTGGCCAGGGGACAGCCCCTGCCTGACCACCTGCAGATGGCCGTGCAGGGAAAGCGGCCCATGCCTGGGATGCAGCAGCAGATGCCCACGCTACCTCCGCCCTCTGTGTCTGCCACAGGGCCTGGGCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCGGGACCAGCACCTCCAAATTATAGCAGGCCTCATGGTATGGTAGGGCCCAACATGCCTCCCCCAGGACCCTCAGGTGTGCCCCCCGGGATGCCCGGCCAGCCCCCTGGAGGGCCTCCCAAGCCCTGGCCTGAAGGCCCCATGGTGAACGCTGCTGCTCCCACGAGCACCCCTCAGAAGCTGATCCCCCCACAGCCGACGGGCCGTCCTTCGCCCGCACCCCCTGCCGTCCCACCCGCTGCCTCGCCTGTGATGCCGCCCCAGACCCAGTCCCCGGGGCAGCCGGCCCAGCCTGCGCCCTTGGTGCCACTGCACCAGAAGCAGAGCCGCATCACTCCCATCCAGAAGCCCCGGGGCCTGGACCCCGTGGAGATCCTGCAGGAGCGCGAGTACAGGCTGCAGGCTCGCATCGCACACCGCATTCAGGAACTTGAAAATCTCCCCGGCTCCCTGGCTGGGGATCTGCGAACCAAAGCAACCATCGAGCTCAAGGCCCTCCGGCTGCTGAACTTCCAGCGGCAGCTGCGCCAGGAGGTGGTAGTGTGCATGCGCAGGGACACGGCCCTGGAGACAGCCCTCAATGCCAAGGCCTACAAGCGCAGCAAGCGGCAGTCCCTGCGTGAGGCCCGAATCACCGAGAAGCTGGAGAAGCAGCAGAAGATCGAGCAGGAGCGAAAGCGGCGCCAGAAGCACCAGGAATACCTCAATAGCATTCTTCAGCACGCCAAGGATTTCAAGGAATACCACAGATCCGTTACGGGAAAAATCCAGAAGCTGACCAAGGCGGTGGCCACGTACCATGCCAACACGGAGCGGGAGCAGAAGAAAGAAAACGAGCGCATCGAGAAGGAGAGGATGCGGAGGCTCATGGCGGAAGATGAAGAGGGTTACCGCAAGCTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACAGACGAGTATGTGGCCAACCTCACGGAGCTGGTGCGGCAGCACAAGGCCGCCCAGGTCGCCAAGGAGAAAAAGAAGAAGAAGAAGAAGAAGAAGGCAGAAAACGCTGAAGGACAGACGCCCGCGATCGGACCCGATGGCGAGCCTCTGGATGAGACCAGCCAGATGAGTGACCTCCCTGTGAAGGTGATCCACGTGGAGAGTGGCAAGATCCTCACAGGCACAGACGCCCCCAAAGCTGGGCAACTGGAGGCCTGGCTTGAGATGAACCCGGGGTATGAGGTGGCGCCGAGGTCTGATAGTGAAGAGAGCGGCTCAGAAGAAGAAGAGGAGGAGGAGGAGGAAGAGCAGCCACAGCCAGCACAGCCTCCCACCCTGCCTGTGGAGGAGAAGAAGAAGATCCCAGACCCTGACAGCGACGATGTCTCTGAGGTGGACGCACGGCACATCATTGAGAATGCCAAGCAAGACGTTGATGATGAGTATGGCGTGTCCCAGGCCCTTGCTCGCGGCCTGCAGTCCTACTATGCTGTGGCCCACGCTGTCACCGAGAGAGTGGACAAGCAGTCAGCACTCATGGTCAACGGCGTCCTCAAGCAGTACCAGATCAAAGGCTTGGAGTGGCTGGTGTCCCTGTACAACAACAACCTGAACGGCATCCTGGCTGACGAGATGGGCCTGGGGAAGACCATCCAGACCATCGCGCTCATCACATACCTCATGGAGCACAAGCGCATCAACGGGCCCTTCCTCATCATCGTGCCTCTCTCGACGCTGTCGAACTGGGCATACGAATTTGACAAGTGGGCCCCTTCCGTGGTGAAGGTGTCCTACAAGGGCTCTCCAGCAGCAAGACGAGCTTTCGTCCCCCAGCTCCGCAGTGGCAAGTTTAACGTCTTGCTGACGACCTACGAATACATCATCAAAGACAAGCACATCCTCGCCAAGATCCGCTGGAAGTACATGATCGTGGACGAGGGCCACCGCATGAAAAACCACCACTGCAAGCTGACGCAGGTGCTCAACACGCACTACGTGGCCCCACGTCGGCTGCTGCTCACGGGCACACCACTGCAGAACAAGCTGCCGGAGCTCTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTCAAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCACCCTTTGCCATGACAGGGGAGAAGGTGGACCTGAACGAAGAGGAAACCATCCTCATCATCCGTCGTTTGCACAAAGTGCTGCGGCCCTTCCTGCTCCGGCGGCTCAAGAAGGAAGTCGAGGCCCAGCTGCCTGAGAAGGTGGAGTATGTCATCAAGTGCGACATGTCTGCGCTCCAGCGCGTGCTCTACCGGCACATGCAGGCCAAGGGGGTGCTGCTCACTGACGGCTCTGAGAAGGACAAGAAGGGCAAAGGTGGCACCAAGACCCTGATGAACACCATCATGCAGCTAAGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATTGAGGAGTCCTTCTCTGAACACTTGGGCTTCACCGGCGGCATCGTGCAAGGGCTGGACCTGTATCGAGCCTCAGGCAAATTTGAGCTTCTCGATAGAATCCTCCCCAAACTTCGTGCCACCAACCACAAAGTGCTACTGTTCTGCCAGATGACCTCCCTCATGACGATCATGGAAGATTACTTTGCGTATCGCGGCTTTAAATACCTCAGGCTGGACGGAACCACAAAGGCGGAGGACCGGGGCATGCTGCTCAAGACCTTCAACGAGCCCGGCTCCGAGTACTTCATCTTCCTGCTCAGCACCCGCGCTGGTGGGCTGGGCCTCAACCTGCAGTCAGCAGACACTGTGATCATCTTCGACAGCGACTGGAACCCTCACCAGGACCTGCAAGCGCAAGACCGGGCACACCGCATTGGGCAGCAGAACGAGGTGCGCGTGCTCCGCCTCTGCACCGTGAACAGTGTGGAGGAGAAGATCCTGGCGGCTGCCAAGTACAAGCTCAACGTGGACCAGAAAGTGATCCAGGCGGGCATGTTTGACCAGAAGTCGTCCAGCCACGAGCGGCGCGCCTTCCTGCAGGCCATCCTGGAGCACGAGGAGCAGGACGAGAGCAGACACTGCAGCACGGGCAGCGGCAGTGCCAGCTTCGCCCACACGGCCCCTCCGCCAGCGGGCGTCACCCCCGACTTGGAGGAGCCACCTCTAAAGGAGGAAGACGAGGTGCCTGATGATGAGACGGTCAACCAGATGATTGCCCGGCACGAGGAGGAGTTCGACTTGTTCATGCGCATGGACCTGGACCGCCGGCGTGAAGAGGCTCGCAACCCCAAACGGAAGCCTCGTCTCATGGAGGAGGACGAGCTCCCATCCTGGATCATCAAGGATGATGCGGAGGTGGAGCGGCTGACGTGTGAGGAGGAGGAGGAGAAAATGTTTGGGCGTGGCTCCCGCCACCGCAAGGAGGTGGACTACAGCGACTCGCTGACAGAGAAGCAGTGGCTCAAGACCCTGAAGGCCATCGAGGAGGGCACGTTGGAGGAGATCGAAGAGGAGGTCCGGCAGAAGAAATCCTCGCGAAAGCGCAAGCGGGACAGCGATGCCGGCTCCTCGACACCGACCACCAGCACCCGCAGCCGCGACAAGGACGACGAGAGCAAGAAGCAGAAGAAGCGTGGACGGCCGCCCGCTGAGAAGCTCTCCCCAAACCCGCCCAACCTCACCAAGAAGATGAAGAAGATCGTGGACGCCGTGATCAAGTACAAGGACAGTAGCAGTGGACGGCAGCTCAGTGAGGTATTCATCCAGTTGCCCTCCCGCAAGGAGCTGCCTGAGTACTACGAGCTCATCCGCAAGCCTGTGGACTTCAAGAAGATCAAGGAGCGCATCCGCAACCACAAGTACCGTAGCCTCAACGACCTCGAAAAGGACGTGATGCTGCTCTGCCAGAACGCGCAGACCTTCAACCTGGAGGGCTCGCTGATCTACGAGGACTCCATCGTGCTGCAGTCGGTCTTCACCAGTGTCCGGCAGAAGATCGAGAAGGAGGAGGACAGTGAGGGCGAAGAGAGCGAGGAGGAGGAGGAAGCCGAGGAGGAGGGCTCGGAGTCCGAGTCCCGCTCTGTCAAGGTGAAGATTAAGCTGGGCCGCAAGGAGAAGGCCCAGGACCGGCTCAAGGGCAGCCGCCGCAGGCCCAGCCGAGGGTCCCGGGCCAAGCCGGTCGTGAGCGACGACGACAGTGAGGAGGAGCAGGAGGAGGACCGCTCAGGAAGTGGCAGCGAGGAGGACTGA

XM_004865548.1 Coding sequence

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4, transcript variant X3

Length: 4962 bp    Location: 2893096..2985968   Strand: +
>XM_004865548.1
ATGTCCACTCCAGACCCACCCCTGGGCGGAACTCCTCGGCCAGGCCCTTCCCCAGGCCCAGGCCCCTCACCTGGAGCCATGCTGGGCCCTAGCCCTGGCCCCTCACCGGGCTCAGCTCACAGCATGATGGGGCCTAGCCCCGGGCCTCCCTCAGCAGGACACCCCATCTCCACGCAGGGGCCTGGAGGGTACCCTCAGGACAACATGCACCAGATGCACAAGCCCATGGAGTCCCTGCATGAGAAGAGCATGTCGGAGGACCCACGCTACAACCAGATGAAGGGCATGGGGATGCGCTCGGGTGGCCACGCAGGCATGGGCCCCCCACCCAGCCCCATGGACCAGCACTCCCAAGGTTACCCCTCGCCCCTGGGCGGCTCCGAGCATGCCTCCAGTCCTGTTCCAGCCAGCGGCCCATCTTCGGGCCCCCAGATGTCGTCTGGGCCAGGAGGGGCCCCGCTGGACGGCACTGACCCCCAGGCCTTGGGGCAGCAGAGCCGGGGCCCCACCCCATTCAACCAGAACCAGCTGCACCAGCTTCGGGCACAGATCATGGCCTACAAGATGCTGGCCAGGGGACAGCCCCTGCCTGACCACCTGCAGATGGCCGTGCAGGGAAAGCGGCCCATGCCTGGGATGCAGCAGCAGATGCCCACGCTACCTCCGCCCTCTGTGTCTGCCACAGGGCCTGGGCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCGGGACCAGCACCTCCAAATTATAGCAGGCCTCATGGTATGGTAGGGCCCAACATGCCTCCCCCAGGACCCTCAGGTGTGCCCCCCGGGATGCCCGGCCAGCCCCCTGGAGGGCCTCCCAAGCCCTGGCCTGAAGGCCCCATGGTGAACGCTGCTGCTCCCACGAGCACCCCTCAGAAGCTGATCCCCCCACAGCCGACGGGCCGTCCTTCGCCCGCACCCCCTGCCGTCCCACCCGCTGCCTCGCCTGTGATGCCGCCCCAGACCCAGTCCCCGGGGCAGCCGGCCCAGCCTGCGCCCTTGGTGCCACTGCACCAGAAGCAGAGCCGCATCACTCCCATCCAGAAGCCCCGGGGCCTGGACCCCGTGGAGATCCTGCAGGAGCGCGAGTACAGGCTGCAGGCTCGCATCGCACACCGCATTCAGGAACTTGAAAATCTCCCCGGCTCCCTGGCTGGGGATCTGCGAACCAAAGCAACCATCGAGCTCAAGGCCCTCCGGCTGCTGAACTTCCAGCGGCAGCTGCGCCAGGAGGTGGTAGTGTGCATGCGCAGGGACACGGCCCTGGAGACAGCCCTCAATGCCAAGGCCTACAAGCGCAGCAAGCGGCAGTCCCTGCGTGAGGCCCGAATCACCGAGAAGCTGGAGAAGCAGCAGAAGATCGAGCAGGAGCGAAAGCGGCGCCAGAAGCACCAGGAATACCTCAATAGCATTCTTCAGCACGCCAAGGATTTCAAGGAATACCACAGATCCGTTACGGGAAAAATCCAGAAGCTGACCAAGGCGGTGGCCACGTACCATGCCAACACGGAGCGGGAGCAGAAGAAAGAAAACGAGCGCATCGAGAAGGAGAGGATGCGGAGGCTCATGGCGGAAGATGAAGAGGGTTACCGCAAGCTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACAGACGAGTATGTGGCCAACCTCACGGAGCTGGTGCGGCAGCACAAGGCCGCCCAGGTCGCCAAGGAGAAAAAGAAGAAGAAGAAGAAGAAGAAGGCAGAAAACGCTGAAGGACAGACGCCCGCGATCGGACCCGATGGCGAGCCTCTGGATGAGACCAGCCAGATGAGTGACCTCCCTGTGAAGGTGATCCACGTGGAGAGTGGCAAGATCCTCACAGGCACAGACGCCCCCAAAGCTGGGCAACTGGAGGCCTGGCTTGAGATGAACCCGGGGTATGAGGTGGCGCCGAGGTCTGATAGTGAAGAGAGCGGCTCAGAAGAAGAAGAGGAGGAGGAGGAGGAAGAGCAGCCACAGCCAGCACAGCCTCCCACCCTGCCTGTGGAGGAGAAGAAGAAGATCCCAGACCCTGACAGCGACGATGTCTCTGAGGTGGACGCACGGCACATCATTGAGAATGCCAAGCAAGACGTTGATGATGAGTATGGCGTGTCCCAGGCCCTTGCTCGCGGCCTGCAGTCCTACTATGCTGTGGCCCACGCTGTCACCGAGAGAGTGGACAAGCAGTCAGCACTCATGGTCAACGGCGTCCTCAAGCAGTACCAGATCAAAGGCTTGGAGTGGCTGGTGTCCCTGTACAACAACAACCTGAACGGCATCCTGGCTGACGAGATGGGCCTGGGGAAGACCATCCAGACCATCGCGCTCATCACATACCTCATGGAGCACAAGCGCATCAACGGGCCCTTCCTCATCATCGTGCCTCTCTCGACGCTGTCGAACTGGGCATACGAATTTGACAAGTGGGCCCCTTCCGTGGTGAAGGTGTCCTACAAGGGCTCTCCAGCAGCAAGACGAGCTTTCGTCCCCCAGCTCCGCAGTGGCAAGTTTAACGTCTTGCTGACGACCTACGAATACATCATCAAAGACAAGCACATCCTCGCCAAGATCCGCTGGAAGTACATGATCGTGGACGAGGGCCACCGCATGAAAAACCACCACTGCAAGCTGACGCAGGTGCTCAACACGCACTACGTGGCCCCACGTCGGCTGCTGCTCACGGGCACACCACTGCAGAACAAGCTGCCGGAGCTCTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTCAAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCACCCTTTGCCATGACAGGGGAGAAGGTGGACCTGAACGAAGAGGAAACCATCCTCATCATCCGTCGTTTGCACAAAGTGCTGCGGCCCTTCCTGCTCCGGCGGCTCAAGAAGGAAGTCGAGGCCCAGCTGCCTGAGAAGGTGGAGTATGTCATCAAGTGCGACATGTCTGCGCTCCAGCGCGTGCTCTACCGGCACATGCAGGCCAAGGGGGTGCTGCTCACTGACGGCTCTGAGAAGGACAAGAAGGGCAAAGGTGGCACCAAGACCCTGATGAACACCATCATGCAGCTAAGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATTGAGGAGTCCTTCTCTGAACACTTGGGCTTCACCGGCGGCATCGTGCAAGGGCTGGACCTGTATCGAGCCTCAGGCAAATTTGAGCTTCTCGATAGAATCCTCCCCAAACTTCGTGCCACCAACCACAAAGTGCTACTGTTCTGCCAGATGACCTCCCTCATGACGATCATGGAAGATTACTTTGCGTATCGCGGCTTTAAATACCTCAGGCTGGACGGAACCACAAAGGCGGAGGACCGGGGCATGCTGCTCAAGACCTTCAACGAGCCCGGCTCCGAGTACTTCATCTTCCTGCTCAGCACCCGCGCTGGTGGGCTGGGCCTCAACCTGCAGTCAGCAGACACTGTGATCATCTTCGACAGCGACTGGAACCCTCACCAGGACCTGCAAGCGCAAGACCGGGCACACCGCATTGGGCAGCAGAACGAGGTGCGCGTGCTCCGCCTCTGCACCGTGAACAGTGTGGAGGAGAAGATCCTGGCGGCTGCCAAGTACAAGCTCAACGTGGACCAGAAAGTGATCCAGGCGGGCATGTTTGACCAGAAGTCGTCCAGCCACGAGCGGCGCGCCTTCCTGCAGGCCATCCTGGAGCACGAGGAGCAGGACGAGAGCAGACACTGCAGCACGGGCAGCGGCAGTGCCAGCTTCGCCCACACGGCCCCTCCGCCAGCGGGCGTCACCCCCGACTTGGAGGAGCCACCTCTAAAGGAGGAAGACGAGGTGCCTGATGATGAGACGGTCAACCAGATGATTGCCCGGCACGAGGAGGAGTTCGACTTGTTCATGCGCATGGACCTGGACCGCCGGCGTGAAGAGGCTCGCAACCCCAAACGGAAGCCTCGTCTCATGGAGGAGGACGAGCTCCCATCCTGGATCATCAAGGATGATGCGGAGGTGGAGCGGCTGACGTGTGAGGAGGAGGAGGAGAAAATGTTTGGGCGTGGCTCCCGCCACCGCAAGGAGGTGGACTACAGCGACTCGCTGACAGAGAAGCAGTGGCTCAAGACCCTGAAGGCCATCGAGGAGGGCACGTTGGAGGAGATCGAAGAGGAGGTCCGGCAGAAGAAATCCTCGCGAAAGCGCAAGCGGGACAGCGATGCCGGCTCCTCGACACCGACCACCAGCACCCGCAGCCGCGACAAGGACGACGAGAGCAAGAAGCAGAAGAAGCGTGGACGGCCGCCCGCTGAGAAGCTCTCCCCAAACCCGCCCAACCTCACCAAGAAGATGAAGAAGATCGTGGACGCCGTGATCAAGTACAAGGACAGCAGTGGACGGCAGCTCAGTGAGGTATTCATCCAGTTGCCCTCCCGCAAGGAGCTGCCTGAGTACTACGAGCTCATCCGCAAGCCTGTGGACTTCAAGAAGATCAAGGAGCGCATCCGCAACCACAAGTACCGTAGCCTCAACGACCTCGAAAAGGACGTGATGCTGCTCTGCCAGAACGCGCAGACCTTCAACCTGGAGGGCTCGCTGATCTACGAGGACTCCATCGTGCTGCAGTCGGTCTTCACCAGTGTCCGGCAGAAGATCGAGAAGGAGGAGGACAGTGAGGGCGAAGAGAGCGAGGAGGAGGAGGAAGCCGAGGAGGAGGGCTCGGAGTCCGAGTCCCGCTCTGTCAAGGTGAAGATTAAGCTGGGCCGCAAGGAGAAGGCCCAGGACCGGCTCAAGGGCAGCCGCCGCAGGCCCAGCCGAGGGTCCCGGGCCAAGCCGGTCGTGAGCGACGACGACAGTGAGGAGGAGCAGGAGGAGGACCGCTCAGGAAGTGGCAGCGAGGAGGACTGA

XM_004865570.1 Coding sequence

Dock6 dedicator of cytokinesis 6, transcript variant X2

Length: 6141 bp    Location: 3110554..3063094   Strand: -
>XM_004865570.1
ATGGCGGCCGCCGAGCGCCGCGCCTTTGCGCACAAGATCAACAGGACGGTAGCCGCCGAGGTGCGGAAGCAGGTGTCCCGGGAGCGCAGCGGCTCTCCCCACTCCAGCAGGCGCTCCAGCAGTTCCCTGGGGGTCCCTCTGACAGAGGTCATTGAGCCCCTGGACTTCGAGGATGTGCTCCTCAGCTGGCCTCCAGATGCCGAGCCAGGGCCCCTCAGGGACCTGGTGGAATTCCCAGCTGATGACTTGGAGCTGCTGCTACAGCCCCGGGAGTCCAGGACCACGAAGCCTGGGGTCCCCGAGGATGGGATGGATGCCCAGGCCAGAGCTGCAGTGGAGATGTACACGGAGGACTGGGTCATTGTCCACAGGAGGTACCAGCACCTGAGTCCCGCTTACAGCCCCACCACCGCCGACACCCAGCGAGAGCGGCAGAAGGGCCTGGCCCGACAAGTGTTCGAGCAGGACACCTCCGGGGACGAGAGGTCCAGCCCCGAGGACGCGGACGACTCCCGGCGTTGCTCGGGCTCCCCCGACGACACCCCACGGAGCAGCGGTGCCTCTGGCATCTTTGACCTGAGGAACCTGGCGGCCGACTTGCTGCTGCCTTCGCTGCTGGAGCGGGCGGCGCCGGAGGAAGTAGATCGGCGCAACGAGGCCCTGCGGCGGCAGAGTCGGGCCCGTGCACTGCTTACACTCTACCCTGCGCCCGACGAGGAGGAGGCTGTGGAACGCTGCAGCTGCCCAGAGCCGCCCCGGGAGCACTTTGGACAGAGGATCCTGGTGAAGTGTCTGTCGCTCAAGTTTGAGATAGAAATCGAACCCATCTTTGGGATCCTGGCCCTGTATGATGTGCGGGAGAAAAAAAAGATTTCAGAGAATTTCTACTTTGACCTCAACTCGGACTCCATGAAGGGGCTACTTCGGGCGTATGGCACCCACCCTGCCATCTCCACCCTGGCCCGCTCCGCCATCTTCTCCGTGACCTACCCCTCACCTGACATCTTCCTGGTCATCAAGCTGGAGAAGGTGCTTCAGCAAGGGGACATCAGCGAGTGCTGTGAGCCCTACATGGTAATGAAGGAGGTGGACACGGCCAAGAACAAAGAGAAGCTGGAGAAGCTGCGTCTGGCAGCCGAGCAGTTCTGCACCCGTCTGGGCCGCTACCGCATGCCCTTCGCCTGGACAGCCGTGCACTTGGCCAACATCGTGAGCAGCGCGGGACAGTCAGACCGAGACTCGGACTCTGAGGGTGAGCGCCGACCGGCCTGGAGTGAGCGTCGCCGTCGGGGGCCCCAGGACCGATCCAGTGGTGGGGACGATGCCTGCAGCTTCTCTGGCTTCCGCCCGGCCACACTGACTGTGACCAACTTCTTCAAGCAGGAGGCTGAACGACTCAGCGACGAGGACCTCTTCAAATTCCTGGCGGACATGCGGCGCCCATCATCCTTGCTGCGGCGCCTGCGACCTGTGACCGCTCAGCTCAAGATCGACATTTCCCCGGCCCCCGAGAACCCCCACTTCTGCCTGAGCCCTGAGCTGCTTCACGTCAAGCCCTACCCAGATCCCAGGGCCCGGCCTACCAAGGAGATCCTGGAGTTCCCCGCCCGCGAGGTCTACGCCCCGCACACCTGCTACAGGAATCTGCTCTATGTGTACCCGCACAGCCTCAACTTCAGCAGCCGCCAGGGCTCCGTGCGCAACCTCGCCGTGCGGGTCCAGTACATGGCGGGCGAGGACCCCAGCCAGGCCCTGCCGGTGATCTTTGGCAAGTCCAGCTGCAGCGAATTCACCCGCGAGGCCTTCACACCAGTTGTCTACCATAACAAGTCCCCCGAATTCTACGAGGAGTTCAAGCTGCGGCTCCCGGCGTGTGTGACGGAGAACCATCACCTGCTTTTCACCATCTATCATGTCAGCTGCCAGCCCCGGCCCGGCACGGCTCTGGAGACGCCCGTGGGCTTCACCTGGATCCCACTGCTGCAACACGGCCACCTGAGGACCGGGCCCTTCTGCCTCCCCGTCTCCGTGGACCCGCCCCCGCCCAGCTACTCCGTGCTCACGCCCGATGTGGCGTTGCCGGGCATGCGCTGGGTGGACGGCCACAAGGGCGTGTTCAGCGTGGAGCTCATAGCCACATCCTCTGTGCACCCCCAGGACCCCCACCTGGACAAGTTCTTCACTCTGGTGCATGTCCTGGAGGAGGGAGCCTTCCCATTCCGGCTCAAGGACACTGTGGTGAACGAGGGCACCGTGGAGCAGGAGCTCCGTGCCAGCCTTGCGGCCCTGCGCCTGGCCAGCCCTGAGCCCCTGGTGGCCTTTTCCCACCATGTTCTGGACAAGCTCGTGCATCTGGTTGTGCGGCCCCCAATCATCAGTGGCCAGATGGTGAACTTAGGCCGTGGGGCCTTTGAGGCAATGGCCCACGTAGTCAGCCTTGTCCACCGGAGCCTAGAGGTGGTCCAGGACACCCGTGGTCACTGCCCAGTGCTGGCTGCCTATGTCCACTATGCCTTTCGCCTCCCTGGGGCTGAGCCCAGCCTCGCAGGTGGGGCCCCTCCAGTGATGGTGCAGGCTACCACACTGTCCCATGGCTCTGGCCGCCCCAACAGCCTCTATCTGACCCGTTCTAAGAGCATCAGCAGCAGCAACCCCGACCTGGCAATGGCCCCCGGCTCGGTGGATGATGAGGTTTCCCGCATCCTAGCCAGCAAGCTGCTGCACGAGGAGCTGGCACTGCAGTGGGTGGTCAGCGGCAGCACCGTGCGTGAGGCCGTCCTGCAGCACGCCTGGTTCTTCTTCCAGCTCATGGTGAAGAGCATGGCACTGCACCTGCTGCTGAGCCAGCGGCTGGATACACCCCGAAAGCTACGCTTTCCTGGGCGCTTCCTGGATGACATCTTGGCCCTCGTGGGATCTGTGGGCCTGGAGGTCATGACCCGAGTCTACAAGGACCTGGAACTAGCTGAGCGCCTCAATGCCAGCCTGGCCTTCTTTCTCAGCGACCTCTTGTCCTTAGTGGACCGTGGCTTTGTCTTCAGCCTGGTCCGAGCTCACTACAAACAGGTGGCCACGCGACTGCAGTCAGCTCCCAACCCCGCAGCACTGCTGACCCTACGCATGGACTTCACCCGGATCCTGTGCAGCCACGAGCACTATGTGACCCTCAACCTCCCCTGCTGCCCCTTGTCACCCCCGGCCTCGCCCTCCCCCTCTGTATCCTCCACCACCTCCCAGAGCTCTACCTTCTCCAGCCAGGCCCCAGATCCCAAGGTGACCAGCATGTTCGAGCTCAGTGGGCCGTTCCGGCAACAGCACTTTCTGGCTGGGCTCCTGCTAACGGAGCTGGCTCTGGCTCTCGAACCTGAGGCTGAGGGGGCATCCCTCTTGCACAAGAAGGCCATCAGCACCGTGCACAGCCTGCTTTGTAGCCACGACACTGACCCCCGCTACACTGAGGCCACTGTGAAGGCCCGAGTGGCCGAGCTGTACCTGCCACTGCTGTCACTTGCCCGGGACACCCTGCCACGGCTGCACGACTTTGCTGAGGGCCCAGGCCAGCGGTCAAGACTGGCCTCCATGCTGGACTCAGACACAGACGGTGAAGGGGATGGGGGGGGAACCATCAACCCCTCTGTGGCCATGGCCATCGCAGGGGGGCCCCTGCCCACGGGTTCCAGGACCAGCATCTCCCATGCCCCACCCACTGCATCTCGGCCAGGCTGTCCCCTCTCTGCAGAATCAAGCCGGACCTTACTGGTGTGTGTGCTATGGGTCCTAAAAAATGCAGAGCCGGCCCTCCTGCAGCGCTGGGCTGCTGACCTGGCCCTGCCTCAGCTAGGACGTCTCTTGGACTTGCTGTACCTCTGCTTGGCTGGTTTCGAGTACAAGGGGAAAAAGGCCTTTGAGCGCATCAACAGCCTCACATTCAAGAAGTCTCTGGACATGAAGGCCCGGCTAGAGGAGGCCATTCTGGGCACCATCGGGGCGAGGCAAGAGATGGTGCGGCGGAGCCGTGAGAGGAGCCCGTTCGGGACCCAGGATAACGTCCGCTGGCGCAAGAGCATCACACACTGGAGACAAACTTCGGACCGTGTGGACAAGAGCAAGGATGAAATGGAGCATGAGGCCTTGGTGGACGGGAACCTGGCCACAGAAGCCAGCCTGGTGGTTCTGGACACACTGGAAATCATTGTGCAGACAGTGCTGCTCTCGGAGGCGCGGGAGAGTGTGCTGGGTGCAGTGCTGAAGGTGGTGTTGTACAGTCTGGGGAGTGCTCAGAGTGCACTCTTCCTGCAGCATGGCCTGGCCACCCAGCGGGCCCTGGTGTCCAAGTTTCCAGAGCTGCTATTCGAAGAAGACACAGAGCTGTGTGCCGACCTCTGCCTGCGGCTCCTGCGACACTGCGGCAGCCGAATCAGCACCATCCGCACACAGGCCAGCGCCTCACTCTACCTCCTCATGCGCCAGAACTTTGAGATAGGCCATAACTTTGCCCGTGTGAAGATGCAGGTGACCATGTCTCTGTCATCCCTCGTGGGGACGACACAGAACTTTAGCGAAGAGCACCTGCGACGGTCCCTCAAGACCATCCTCACCTACGCCGAGGAGGATGTGGGGCTGCGGGACAGCACCTTTTCGGAGCAGGTCCAGGATCTGATGTTCAACCTGCATATGATCCTGACCGATACTGTGAAGATGAAGGAGCACCAGGAGGACCCGGAAATGCTCATCGACCTCATGTACAGGATTGCCCGGGGCTACCAGGGCTCCCCCGATCTTCGGCTGACCTGGCTGCAGAACATGGCCGGGAAGCACGCCGAGCTGGGCAACCATGCAGAGGCTGCACAGTGCATGGTACACGCAGCCGCCCTGGTGGCTGAGTACCTGGCACTGCTCGAGGACAGCCGCCACCTGCCAGTGGGCTGTGTGTCCTTCCAGAACATCTCTTCCAATGTGCTGGAGGAGTCTGCCATCTCCGACGACATCCTATCGCCGGATGAGGAGGGCTTCTGCTCTGGGAAGCACTTCACGGAGCTAGGGCTTGTGGGCCTGCTCGAGCAAGCAGCCACCTACTTCACCATGGGCGGGCTGTACGAGGCCGTGAACGAGGTCTGTAAGAACCTCATCCCCATCCTGGAAGCGCACCGGGACTACAAGAAGCTGGCGGCGGTGCACGGCAAGCTGCAGGAGGCCTTTACCAAGATCCTGCACCAGAGCTCAGGCTGGGAGCGCGTGTTCGGGACCTATTTCCGCGTGGGCTTCTACGGTGCACGCTTCGGGGACCTGGACGAGCAGGAGTTCGTGTACAAGGAGCCTTCGATCACGAAGCTGGCTGAGATCTCGCACCGGCTGGAGGAGTTCTACATGGAGCGGTTCGGGGACGACATAGTGGAGATTATCAAAGACTCTAACCCCGTGGACAAGTCCAAGCTTGACCCACAGAAGGCCTACATCCAGATCACCTACGTGGAGCCGCACTTCGATACATACGAGCTCAAGGACCGCGTGACCTACTTCGACCGCAACTACGGGCTGCGCACCTTCCTCTTCTGCACGCCCTTCACGCCCGACGGCCGTGCGCACGGCGAGCTGCACGAGCAGCACAAGCGCAAGACGCTGCTGAGCACGGAGCACGCCTTCCCCTACATCAAGACGCGCATCCGCGTGTGCCACCGCGAGGAGACGGTGCTGACCCCAGTGGAGGTGGCCATCGAGGACATGCAGAAGAAGACGCGGGAGCTGGCCTTTGCCACGGAGCAGGACCCGGCTGACTCCAAGATGCTGCAGATGGTGCTGCAGGGCTCCGTGGGGCCCACTGTGAACCAGGGGCCCTTGGAGGTGGCCCAGGTGTTCTTGGCAGAGATCCCGGAGGATCCCAAGCTCTTCCGGCATCACAACAAGCTGCGGCTTTGTTTCAAGGACTTCTGCAAAAAGTGTGAGGACGCCCTGCGGAAGAACAAGGCGCTGATCGGGCCGGACCAGAAGGAGTACCACCGCGAGCTGGAGCGCCACTACTGCCGCCTGCGAGAGGCCCTGCAGCCCCTGCTCACCCAGCGCCTGCCCCAGCTGCTGGCCCAAGTGCCAGCGGGCCTCAGGAACTCTCTGAACAGAGCAAGTCTCCGGAAGGCAGATCTCTGA

XM_004865569.1 Coding sequence

Dock6 dedicator of cytokinesis 6, transcript variant X1

High confidence: 4 potential gene matches
Length: 6342 bp    Location: 3110554..3063094   Strand: -
>XM_004865569.1
ATGGCGGCCGCCGAGCGCCGCGCCTTTGCGCACAAGATCAACAGGACGGTAGCCGCCGAGGTGCGGAAGCAGGTGTCCCGGGAGCGCAGCGGCTCTCCCCACTCCAGCAGGCGCTCCAGCAGTTCCCTGGGGGTCCCTCTGACAGAGGTCATTGAGCCCCTGGACTTCGAGGATGTGCTCCTCAGCTGGCCTCCAGATGCCGAGCCAGGGCCCCTCAGGGACCTGGTGGAATTCCCAGCTGATGACTTGGAGCTGCTGCTACAGCCCCGGGAGTCCAGGACCACGAAGCCTGGGGTCCCCGAGGATGGCCAGATGGATGCCCAGGCCAGAGCTGCAGTGGAGATGTACACGGAGGACTGGGTCATTGTCCACAGGAGGTACCAGCACCTGAGTCCCGCTTACAGCCCCACCACCGCCGACACCCAGCGAGAGCGGCAGAAGGGCCTGGCCCGACAAGTGTTCGAGCAGGACACCTCCGGGGACGAGAGGTCCAGCCCCGAGGACGCGGACGACTCCCGGCGTTGCTCGGGCTCCCCCGACGACACCCCACGGAGCAGCGGTGCCTCTGGCATCTTTGACCTGAGGAACCTGGCGGCCGACTTGCTGCTGCCTTCGCTGCTGGAGCGGGCGGCGCCGGAGGAAGTAGATCGGCGCAACGAGGCCCTGCGGCGGCAGAGTCGGGCCCGTGCACTGCTTACACTCTACCCTGCGCCCGACGAGGAGGAGGCTGTGGAACGCTGCAGCTGCCCAGAGCCGCCCCGGGAGCACTTTGGACAGAGGATCCTGGTGAAGTGTCTGTCGCTCAAGTTTGAGATAGAAATCGAACCCATCTTTGGGATCCTGGCCCTGTATGATGTGCGGGAGAAAAAAAAGATTTCAGAGAATTTCTACTTTGACCTCAACTCGGACTCCATGAAGGGGCTACTTCGGGCGTATGGCACCCACCCTGCCATCTCCACCCTGGCCCGCTCCGCCATCTTCTCCGTGACCTACCCCTCACCTGACATCTTCCTGGTCATCAAGCTGGAGAAGGTGCTTCAGCAAGGGGACATCAGCGAGTGCTGTGAGCCCTACATGGTAATGAAGGAGGTGGACACGGCCAAGAACAAAGAGAAGCTGGAGAAGCTGCGTCTGGCAGCCGAGCAGTTCTGCACCCGTCTGGGCCGCTACCGCATGCCCTTCGCCTGGACAGCCGTGCACTTGGCCAACATCGTGAGCAGCGCGGGACAGTCAGACCGAGACTCGGACTCTGAGGGTGAGCGCCGACCGGCCTGGAGTGAGCGTCGCCGTCGGGGGCCCCAGGACCGATCCAGTGGTGGGGACGATGCCTGCAGCTTCTCTGGCTTCCGCCCGGCCACACTGACTGTGACCAACTTCTTCAAGCAGGAGGCTGAACGACTCAGCGACGAGGACCTCTTCAAATTCCTGGCGGACATGCGGCGCCCATCATCCTTGCTGCGGCGCCTGCGACCTGTGACCGCTCAGCTCAAGATCGACATTTCCCCGGCCCCCGAGAACCCCCACTTCTGCCTGAGCCCTGAGCTGCTTCACGTCAAGCCCTACCCAGATCCCAGGGCCCGGCCTACCAAGGAGATCCTGGAGTTCCCCGCCCGCGAGGTCTACGCCCCGCACACCTGCTACAGGAATCTGCTCTATGTGTACCCGCACAGCCTCAACTTCAGCAGCCGCCAGGGCTCCGTGCGCAACCTCGCCGTGCGGGTCCAGTACATGGCGGGCGAGGACCCCAGCCAGGCCCTGCCGGTGATCTTTGGCAAGTCCAGCTGCAGCGAATTCACCCGCGAGGCCTTCACACCAGTTGTCTACCATAACAAGTCCCCCGAATTCTACGAGGAGTTCAAGCTGCGGCTCCCGGCGTGTGTGACGGAGAACCATCACCTGCTTTTCACCATCTATCATGTCAGCTGCCAGCCCCGGCCCGGCACGGCTCTGGAGACGCCCGTGGGCTTCACCTGGATCCCACTGCTGCAACACGGCCACCTGAGGACCGGGCCCTTCTGCCTCCCCGTCTCCGTGGACCCGCCCCCGCCCAGCTACTCCGTGCTCACGCCCGATGTGGCGTTGCCGGGCATGCGCTGGGTGGACGGCCACAAGGGCGTGTTCAGCGTGGAGCTCATAGCCACATCCTCTGTGCACCCCCAGGACCCCCACCTGGACAAGTTCTTCACTCTGGTGCATGTCCTGGAGGAGGGAGCCTTCCCATTCCGGCTCAAGGACACTGTGGTGAACGAGGGCACCGTGGAGCAGGAGCTCCGTGCCAGCCTTGCGGCCCTGCGCCTGGCCAGCCCTGAGCCCCTGGTGGCCTTTTCCCACCATGTTCTGGACAAGCTCGTGCATCTGGTTGTGCGGCCCCCAATCATCAGTGGCCAGATGGTGAACTTAGGCCGTGGGGCCTTTGAGGCAATGGCCCACGTAGTCAGCCTTGTCCACCGGAGCCTAGAGGTGGTCCAGGACACCCGTGGTCACTGCCCAGTGCTGGCTGCCTATGTCCACTATGCCTTTCGCCTCCCTGGGGCTGAGCCCAGCCTCGCAGGTGGGGCCCCTCCAGTGATGGTGCAGGCTACCACACTGTCCCATGGCTCTGGCCGCCCCAACAGCCTCTATCTGACCCGTTCTAAGAGCATCAGCAGCAGCAACCCCGACCTGGCAATGGCCCCCGGCTCGGTGGATGATGAGGTTTCCCGCATCCTAGCCAGCAAGGGCGTCGATCGCTCACACTCCTGGGTGAACTCTGCTTATGCTCCCGGAGGCACCAAGGCTGTGCTGCGGCGGGCGCCCCCTCATTGCAGGGCCGACCCCAGACAGGCCTTGGACCGCAGCTCTAGCCGAGCCTCTTCCTACCTCGAGGGCTCCTCCTCCACCCCACCAGCCACCCAGCCGAGACCCACTGTGCAGAAGCTGCTGCACGAGGAGCTGGCACTGCAGTGGGTGGTCAGCGGCAGCACCGTGCGTGAGGCCGTCCTGCAGCACGCCTGGTTCTTCTTCCAGCTCATGGTGAAGAGCATGGCACTGCACCTGCTGCTGAGCCAGCGGCTGGATACACCCCGAAAGCTACGCTTTCCTGGGCGCTTCCTGGATGACATCTTGGCCCTCGTGGGATCTGTGGGCCTGGAGGTCATGACCCGAGTCTACAAGGACCTGGAACTAGCTGAGCGCCTCAATGCCAGCCTGGCCTTCTTTCTCAGCGACCTCTTGTCCTTAGTGGACCGTGGCTTTGTCTTCAGCCTGGTCCGAGCTCACTACAAACAGGTGGCCACGCGACTGCAGTCAGCTCCCAACCCCGCAGCACTGCTGACCCTACGCATGGACTTCACCCGGATCCTGTGCAGCCACGAGCACTATGTGACCCTCAACCTCCCCTGCTGCCCCTTGTCACCCCCGGCCTCGCCCTCCCCCTCTGTATCCTCCACCACCTCCCAGAGCTCTACCTTCTCCAGCCAGGCCCCAGATCCCAAGGTGACCAGCATGTTCGAGCTCAGTGGGCCGTTCCGGCAACAGCACTTTCTGGCTGGGCTCCTGCTAACGGAGCTGGCTCTGGCTCTCGAACCTGAGGCTGAGGGGGCATCCCTCTTGCACAAGAAGGCCATCAGCACCGTGCACAGCCTGCTTTGTAGCCACGACACTGACCCCCGCTACACTGAGGCCACTGTGAAGGCCCGAGTGGCCGAGCTGTACCTGCCACTGCTGTCACTTGCCCGGGACACCCTGCCACGGCTGCACGACTTTGCTGAGGGCCCAGGCCAGCGGTCAAGACTGGCCTCCATGCTGGACTCAGACACAGACGGTGAAGGGGATGGGGGGGGAACCATCAACCCCTCTGTGGCCATGGCCATCGCAGGGGGGCCCCTGCCCACGGGTTCCAGGACCAGCATCTCCCATGCCCCACCCACTGCATCTCGGCCAGGCTGTCCCCTCTCTGCAGAATCAAGCCGGACCTTACTGGTGTGTGTGCTATGGGTCCTAAAAAATGCAGAGCCGGCCCTCCTGCAGCGCTGGGCTGCTGACCTGGCCCTGCCTCAGCTAGGACGTCTCTTGGACTTGCTGTACCTCTGCTTGGCTGGTTTCGAGTACAAGGGGAAAAAGGCCTTTGAGCGCATCAACAGCCTCACATTCAAGAAGTCTCTGGACATGAAGGCCCGGCTAGAGGAGGCCATTCTGGGCACCATCGGGGCGAGGCAAGAGATGGTGCGGCGGAGCCGTGAGAGGAGCCCGTTCGGGACCCAGGATAACGTCCGCTGGCGCAAGAGCATCACACACTGGAGACAAACTTCGGACCGTGTGGACAAGAGCAAGGATGAAATGGAGCATGAGGCCTTGGTGGACGGGAACCTGGCCACAGAAGCCAGCCTGGTGGTTCTGGACACACTGGAAATCATTGTGCAGACAGTGCTGCTCTCGGAGGCGCGGGAGAGTGTGCTGGGTGCAGTGCTGAAGGTGGTGTTGTACAGTCTGGGGAGTGCTCAGAGTGCACTCTTCCTGCAGCATGGCCTGGCCACCCAGCGGGCCCTGGTGTCCAAGTTTCCAGAGCTGCTATTCGAAGAAGACACAGAGCTGTGTGCCGACCTCTGCCTGCGGCTCCTGCGACACTGCGGCAGCCGAATCAGCACCATCCGCACACAGGCCAGCGCCTCACTCTACCTCCTCATGCGCCAGAACTTTGAGATAGGCCATAACTTTGCCCGTGTGAAGATGCAGGTGACCATGTCTCTGTCATCCCTCGTGGGGACGACACAGAACTTTAGCGAAGAGCACCTGCGACGGTCCCTCAAGACCATCCTCACCTACGCCGAGGAGGATGTGGGGCTGCGGGACAGCACCTTTTCGGAGCAGGTCCAGGATCTGATGTTCAACCTGCATATGATCCTGACCGATACTGTGAAGATGAAGGAGCACCAGGAGGACCCGGAAATGCTCATCGACCTCATGTACAGGATTGCCCGGGGCTACCAGGGCTCCCCCGATCTTCGGCTGACCTGGCTGCAGAACATGGCCGGGAAGCACGCCGAGCTGGGCAACCATGCAGAGGCTGCACAGTGCATGGTACACGCAGCCGCCCTGGTGGCTGAGTACCTGGCACTGCTCGAGGACAGCCGCCACCTGCCAGTGGGCTGTGTGTCCTTCCAGAACATCTCTTCCAATGTGCTGGAGGAGTCTGCCATCTCCGACGACATCCTATCGCCGGATGAGGAGGGCTTCTGCTCTGGGAAGCACTTCACGGAGCTAGGGCTTGTGGGCCTGCTCGAGCAAGCAGCCACCTACTTCACCATGGGCGGGCTGTACGAGGCCGTGAACGAGGTCTGTAAGAACCTCATCCCCATCCTGGAAGCGCACCGGGACTACAAGAAGCTGGCGGCGGTGCACGGCAAGCTGCAGGAGGCCTTTACCAAGATCCTGCACCAGAGCTCAGGCTGGGAGCGCGTGTTCGGGACCTATTTCCGCGTGGGCTTCTACGGTGCACGCTTCGGGGACCTGGACGAGCAGGAGTTCGTGTACAAGGAGCCTTCGATCACGAAGCTGGCTGAGATCTCGCACCGGCTGGAGGAGTTCTACATGGAGCGGTTCGGGGACGACATAGTGGAGATTATCAAAGACTCTAACCCCGTGGACAAGTCCAAGCTTGACCCACAGAAGGCCTACATCCAGATCACCTACGTGGAGCCGCACTTCGATACATACGAGCTCAAGGACCGCGTGACCTACTTCGACCGCAACTACGGGCTGCGCACCTTCCTCTTCTGCACGCCCTTCACGCCCGACGGCCGTGCGCACGGCGAGCTGCACGAGCAGCACAAGCGCAAGACGCTGCTGAGCACGGAGCACGCCTTCCCCTACATCAAGACGCGCATCCGCGTGTGCCACCGCGAGGAGACGGTGCTGACCCCAGTGGAGGTGGCCATCGAGGACATGCAGAAGAAGACGCGGGAGCTGGCCTTTGCCACGGAGCAGGACCCGGCTGACTCCAAGATGCTGCAGATGGTGCTGCAGGGCTCCGTGGGGCCCACTGTGAACCAGGGGCCCTTGGAGGTGGCCCAGGTGTTCTTGGCAGAGATCCCGGAGGATCCCAAGCTCTTCCGGCATCACAACAAGCTGCGGCTTTGTTTCAAGGACTTCTGCAAAAAGTGTGAGGACGCCCTGCGGAAGAACAAGGCGCTGATCGGGCCGGACCAGAAGGAGTACCACCGCGAGCTGGAGCGCCACTACTGCCGCCTGCGAGAGGCCCTGCAGCCCCTGCTCACCCAGCGCCTGCCCCAGCTGCTGGCCCAAGTGCCAGCGGGCCTCAGGAACTCTCTGAACAGAGCAAGTCTCCGGAAGGCAGATCTCTGA

XM_004865545.1 Coding sequence

LOC101700265 chromosome unknown open reading frame, human C19orf52

Length: 795 bp    Location: 2875580..2877228   Strand: +
>XM_004865545.1
ATGGCGACCGCTTCTCTGAAGAGATTTTGGACCAGAGGTCGCAGAGAAGCAGGTGGAGAAGGAACTAACGCGGCGCCTGCGAAACCGGGTGTGTGGGTGCGACTAGGTGCCTGGGCGCGCGCGCTGCTGCAGGACTACGGTGAGGCCTGCAGGGACGCGGCGGCGGCGGCGCGGGCCCGGCCTTGCCGCGCCGCCCTGTACTCTGCGCTGCTGGGCGGCGCAGCGGCTTGCTGCGCGCTGGCGCCGAGCGAGGCGGCCTTCGAGGAGGCGCTGATTGAAGCATCGGGAACTCTACTGCTGCTGGCGCCGGCCACGCGCAACCGAGACTCAGAATCCTTCCTGCAGAGGCTCCTCTGGCTGAGGGGCCGCGGGTGCCTGCGCCATGTAAACCTGGGGCTCTTCTCGCTCCTGTACGAGGCGCCCTTCGACGGCCAAGCCAGCCTCTACCGGGCTCGCTGCCGCTACCTGCAGCCCCGCTGGGTCGATTTCCCGGGCCGAATCCTGGATGTGGGGTTCGTGGGCCGCTGGTGGGTCCTGGGGGCCCGGATGCGAGACTGCGACATCAACCACGACGAGTTCCTCCACCTGCCCCCGCATTTGCGCGTCGTTGGGCCTCACCAGCTGCACTCCGAGGCCAACGAGCGGCTCTTTGATGAGAAGTACAAGGCCGTGGTGCTCACCGACGATCAGGTGGACCAGGCGCTGTGGGAGGAGCAGGTGTTGCAGAAGGAGAAAAAGGACAAGGTCACCCTGAGGCAGGCTGAGTCCCTTGTGCAGTCGGAGGTCGCTGGATGA

XM_004865508.1 Coding sequence

Cdkn2d cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4), transcript variant X2

Length: 576 bp    Location: 2636751..2634351   Strand: -
>XM_004865508.1
ATGATGCTGGAGGAGGTCCGCGCCGGCGACCGGCTGAGTGGGGCCGCGGCCCGGGGAGACGTGCAGGAGGTGCGCCGCCTGCTGTACCGCGAGCTCGTGCACCCGGACGCCCTCAACCGCTTCGGCAAGACGGCGCTGCAGGTGATGATGTTTGGCAGCCTCACCATCGCCCAGGAGCTGCTGAAACAGGGTGCCAGCCCCAATATCCAGGATGCCTCTGGCACCAGTCCGGTCCACGATGCAGCCCGAACTGGATTCCTGGACACCCTGAAGGTCCTCGTGGAATACGGCGCTGATGTCAACATGCCCGATGGCACTGGGTCACTGCCCATCCACCTGGCGGTGCGTGAGGGCCACGCCTCGGTGGTCAGCTTCCTGGCTCCGGAGTCTGATCTCCATCACAGGGACGCCGCGGGGCTCACACCTCTGGAGCTGGCACGGCAGAGGGGGGCTCAGGACCTCTTGGACATCCTGCAGGGGCACAAGAGAAGAGCTCTGCTAGGCGACAGACACCTGAACGGTTCAGTTTCTTCTGCACCCCAGGGGTGCAGACATGACCCAAGGGCAGAGCGTTAA

XM_004865504.1 Coding sequence

Kri1 KRI1 homolog (S. cerevisiae)

High confidence: 4 potential gene matches
Length: 2136 bp    Location: 2633904..2624414   Strand: -
>XM_004865504.1
ATGCCGGAACCGCGCGGGTCGTCGCCTCTGCGGGTGAACAAGGCTTTTGCGGCGCGGTATGGCCGCTACCGGGAGCGCGAGGAGCTGCAACGGCTGAAGGATCGCTATGGGGACCCGCACGGCGGCAGCGACTCCAGCTCCGAGTCTGACTCCAGCGACGAACGCGTGGAATTTGACCCCCAGCAGGAGCGAGACTTTTACAGGACACTCTCCCTGTTGAAGAAGAAGGACCCCCGCATTTATCAGAAAGATGCCACCTTCTATCAGAGAACAGGTTCACCCTCATCCTCGGAGAATGAGGAGGAGTCAGCAGCCCCACAGAAGCGGAAGAAAGTGCAACCTATGTACTTGAAAGACTACGAGAGGAAGGTCATCTTGGAGAAAGGCGGCAAGTACGTCGATGAGGAGAACTCAGATGGGGAGACCTCTGATCAGAGAGTCCAGCAGACTTCGTCTCAGAGTTATGTGGAGGAACAGAAGCAGCTTAGGGACAGCTTCCGGCCATTTGTGGAGGACAGCGAGGACGAGGACAGTGCTGGAGAAGGTGGCTCGGGCTTGCTGCAGAAGCGCAGGAAGACCAGGGAGGAGAAGGACCAGGAGGATGCTGACTACGTGGAGTGGCTGAAGGGACAGAAGGAGATTCAGAACCGCAAGTCCCTGAAGGAACTGATGCATCTCAAGGAATATTGGGACAACCCGGAGCTGGACGAAGGGGAGCAATTTCTGCGGGATTATATCCTCAACAAGCGCTACGAGGAGGAGGGCAGTGAGGAGGAGGGCGATGAGGAGGAGGAAGAGGAAGAGGAGGAGGAAGGGGTCCCTGGTCCCCCAGTCCAGGTGGCCGTGGACGACTCCTCTGACGAGGGGGAGCTATTCCTGAAGAAGCAGGAGGACTTCGAGCATAAGTACAACTTCCGCTTCGAGGAGCCGGATGCAGCCTTGGTCAAGACCTACCCACGCAGCATTGCGTCCTCCATGCGCCGCAGAGATGAGCGCAGGAAAGAGAAGAGGGAGGAGACCAGGGAGCGGAAGAAGAGGGAGAAGGCCAGGAAGCAGGAGGAGCTGAAGCAGTTAAAGAACCTGAAGAGGAAGGAGATTCTGGCCAAGCTGGAAAAGCTGCGACAAGTCACTGGCAACGAGACGCTGGGCCTGGAGGAGCAGGACCTCGAGGGTGACTTTGACCCCATCCAGCATGAGCAGCTGATGCAGAAATGCCTAGGCCATGACTTCTACAGTGCCGAGGAGGAGGAGAAGCCGCAGTTTGAGGAGGAGGACGGGCTTGAAGAGGACTGGAACTGGGACACGTGGGGTGGGCCGGAGCAGGACGGAGCATGGAACCAGCAGGAGCCACACTGTGAGGACCCTAATTTCAATATGGATGCAGACTATGACCCCAGCCAGCCTCGGAAAAAGTGGCTCGAGGCCCCCTCCACCGGCAGGAAGAAGCGCAAGTCGCTCTTTGCGTCAGCCGTGGGCCAGCAGAAGCCCGTGTTCGACCCTGGGGACAAGACCTTTGAGGAGTACCTGGATGAGTACTACCGGCTGGACTATGAGGACATCATCGATGACCTGCCCTGTCGCTTCAAGTACCGCAGTGTGGTACCCTGTGACTTCGGGCTCAGCACCGAGGAGATCCTGGGTGCTGATGACAAGGAGCTGAACCGATGGTGTTCCCTGAAGAAGACCTGCATGTACAGGTCGGAGCAGGAGGAGCTGCAGGACAAGCGGTCATACAGCCAGAAGGCCCAGAACTCCCGGAAGAAGCGGCAGATCTTCAAGTCGCTCTGCCCAGAGGAGACAGAGACAGCCACAGAAGACACCGGGGAACTGCAGAGACACCCAGCTGGCCCACAAGAGCAGCTGGTGGTGCCTGATGGAGGCCGTGGGAAGCAGTCCCAGCCCGAAAGCCCCCTGGCACAGGAAGATGAGGCCCCTATGTCACCTCACAAGACACCAGCCCCCCAGAAGCGGAGGAGGGGCAAGAAGGCACATTTGCTGGGCCCCACTGTGACACTCGGTGGCCGAGAGTTCAGCCGCCAGAGACTCCAGGCGTTTGGCCTCAACCCCAAGCGGCTCCACTTTCGCCAGCTGGGCCGGCAGCGCAGGAAGCAGCCGGGACCCAAGAGCCGTCCCTGA

XM_004865496.1 Coding sequence

Pde4a phosphodiesterase 4A, cAMP-specific, transcript variant X2

Length: 2547 bp    Location: 2543718..2574706   Strand: +
>XM_004865496.1
ATGGAGCCCCCGGCCGCCACCTCGGAGAGGAGCCTGTCTCTATCTCTGCCCGGGCCCCGGGAGGGCCAGGCCACCCTCAAGCCGCCCCCTCAGCACCTGTGGCGGCAGCCGCGAACCCCGATCCGTATCCAGCAGCGCGGCTACTCCGACAGCGCGGAGCGCTCGGACCCCGAGCGGCCGCCACACCGGCCCATAGAGCGCGCCGACGCCGTGGACACAAGCGACCGGCCCGGCCTGCGCACGACCCGCATGTCCTGGCCTTCGTCCTTCCACAGCACCGGCACAAGCAGCTGCGGCGCGGGCGGAGGCAGCGGCAGGCGCTTCGAGGCGGAAAATGGGCCGACGCCATCCCCCGGCCGCAGCCCCCTGGACTCGCAGGCGAGCCCAGGCCTTGTGCTGCATGCTGGAGCAGCCACCAGCCAGCGCCGGGAGTCCTTTCTCTACCGCTCCGACAGCGACTATGACATGTCACCCAAGACCATGTCCCGCAACTCCTCGGTCGCCAGCGAGGCGCATGCGGAGGACCTCATTGTAACGCCCTTTGCCCAGGTGCTGGCCAGTCTCCGAAGTGTCCGAAGCAACTTCTCACTCCTGACCAATGTGCCCATTCCTAGCCACAAGCGGTCCCCGCTGGGAGGCCCCACCCCCGTCTGCAAGGCCACACTATCAGAGGAGACATGTCAGCAGCTGGCCCGGGAGACTTTGGAGGAGCTGGACTGGTGCCTGGAGCAGCTGGAGACCATGCAGACCTACCGCTCTGTCAGCGAGATGGCCTCGCATAAGTTCAAGAGGATGCTGAACCGCGAGCTCACACACCTGTCAGAAATGAGCAGGTCGGGAAACCAGGTCTCAGAGTACATTTCCACGACATTCCTGGACAAACAGAATGAAGTGGAGATCCCATCACCCACGATGAAAGATCGAGAGCCCCAGGAAGCGCTGCGACAGAGACCCTCCCAGCAGCTCCCGCCCCCGGTGCCACACCTGCAGCCCATGTCGCAGATCACCGGGGTGAAGAGGCTGTCACACAACAGCAGCCTGAACAACACCAGCATCCCCCGCTTTGGGGTGAAGACGGATCAGGAGGAGCTCCTGGCCCAAGAACTGGAGAACTTAAGCAAGTGGGGCCTGAACATCTTTTGCGTGTCCGATTATGCTGGAGGTCGCTCGCTGAGCTGTATCATGTACACGATATTCCAGGAGCGGGACTTGTTGAAGAAATTCCGAATCCCCTTGGACACGATGGTGACATACATGCGGACGCTGGAAGACCACTACCACGCCGATGTGGCCTACCACAACAGCCTGCACGCCGCCGACGTGTTGCAGTCCACCCACGTGCTGCTGGCCACGCCTGCCCTGGACGCGGTGTTCACAGACCTGGAGATTCTCGCAGCCCTCTTCGCAGCTGCCATTCATGATGTGGACCACCCTGGGGTCTCCAACCAGTTCCTCATCAACACAAACTCAGAGCTGGCGCTCATGTATAACGATGAGTCGGTGCTAGAGAACCACCACTTGGCTGTGGGCTTCAAGCTGCTCCAGGAAGAGAACTGTGACATCTTCCAGAACCTCGGCAAGCGCCAGCGGCAGAGCCTGCGCAAGATGGTCATCGACATGGTGCTGGCCACGGACATGTCCAAGCACATGACCCTCCTAGCTGATCTGAAGACCATGGTGGAAACTAAGAAAGTGACAAGCTCCGGAGTTCTCTTGCTGGACAACTACGCCGACCGCATCCAGGTCCTTCGGAACATGGTGCACTGCGCAGACCTCAGCAACCCCACCAAGCCACTGGAGCTGTACCGCCAGTGGACAGACCGCATCATGGCCGAGTTCTTCCAGCAGGGGGACCGAGAACGTGATCGGGGCATGGAGATCAGTCCCATGTGTGACAAGCACACAGCCTCCGTGGAGAAGTCGCAGGTGGGTTTCATCGACTACATCGTGCACCCGCTGTGGGAGACATGGGCAGACCTGGTGCACCCAGATGCGCAGGACATCCTGGACACGCTGGAAGACAACCGGGACTGGTACTACAGCGCCATCCGGCAGAGCCCATCGCCGCCGCCCGAGGAGGAGCCCGGTGAACCAGGCCACCCCGCCCCACCCGATAAGTTCCAGTTTGAGCTGACGCTGGAGGAGGAAGAGGAAGAGGAGGCAGCGCCAGCCCAGGATTTGTTGGAAGCTCGGGGATCATCCACGTCCGAGGAGCCAGCCAAGATCAAGGGCCAGGAGGCTGAGACAGGGCATTTGTCGCGGGGTTTGGGCTTGACGTGTGTTGCCCCTGCAGCGCAGGAGTCCATGGACGCGGGAAGCTGCGACCTGACCCTTGAAAGCCCCCTTCTGCCTGCCTTGAGGACCCAGTTCACGCCAGAGGAATCCCCGGGGCTCCTGGGCCTCCCCTCCACGGCGGCCGAGGTGGGGGCCCGAAGAGACCATCAGGCTGCCGAGAGGGCTTGCCGCGCATGTGCAGGGACGTCCGAGGAGGACCCAGCCTTGCTCCCGGTTCCGGGTGGGTGGGAGCCAGGTGTGGACCCTCCCTGA

XM_004865471.1 Coding sequence

Pin1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1, transcript variant X2

High confidence: 3 potential gene matches
Length: 516 bp    Location: 2121213..2131645   Strand: +
>XM_004865471.1
ATGGCGGACGAGGAGAAGCTACCATCCGGCTGGGAGAAGCGCATGAGCCGCAGCTCAGGCCGCGTGTACTACTTCAACCACATCACCAATGCCAGCCAGTGGGAGCGGCCCAGCGGCACTGGCGGTGGTGGCGGTGGTGGTGGCGGCGGCGGCGGCAATAAAAATGGGCAGGGGGAGCCTGCCAGGGTCCGCTGCTCACACCTGCTCGTCAAGCACAGCCAGTCCCGGCGGCCCTCATCCTGGCGGCAGGAGAAGATCACCCGGACCAAGGAGGAGGCCTTGGAACTGATCAATGGCTACATCCAGAAGATCAAGTCGGGAGAAGAGGACTTTGAGTCTCTGGCCTCACAGTTCAGCGACTGCAGCTCGGCCAAGGCCAGGGGAGACCTGGGTGCCTTCAGCAGAGGTCAGATGCAGAAGCCATTTGAAGATGCCTCGTTTGCGCTGCGGACAGGGGAGATGAGCGGCCCGGTGTTCACGGACTCAGGCATCCATATCATCCTGCGCACGGAGTGA

XM_004865481.1 Coding sequence

Dnmt1 DNA (cytosine-5-)-methyltransferase 1

High confidence: 4 potential gene matches
Length: 4860 bp    Location: 2358882..2316042   Strand: -
>XM_004865481.1
ATGCCGGCCCGCACCGCCCCAGCCCGAGTGCCCGCTTTGGCTACTCCGGCCATCTCACTGCCCGACGATGTCCGCAGGCGGCTCAAAGACTTGGAAAGAGACAGTTTGACAGAAAAGGAGTGTGTGAAGGAGAAACTGAATCTCTTGCATGAATTTCTGCAAACGGAAATCAAGAATCAGCTGTGTGATTTGGAAACCAAATTACATAAAGAAGAGTTATCCGAGGAGGGCTACCTGGCTAAAGTCAAATCCCTTTTAAATAAAGATTTGTCTTTGGAGAATGGAGCTCATGCTTTCAATCGAGAAGTGAACGGCTGCCTAGAGAACGGGAGCCAGGCCAGCAGTGAAGCCTGGAGAGTACGAATAGCAGAGGCGCACAGCCCCCCGCACACCAGTTCCAAGCCTCGAGCGCCCCGGAGAAGCAAGTTGGACGGTGAGGGCCAGTCTGGAACTACACCCAGCCCAAAGGTGACCAGGAGAACGACCAGGCAGACCACTATCACATCTCATTTTGCAAAGGGCCCTGCCAAACGGAAACCTGAGGAAGACTCTGATCGGTCCAAGTCAGAGGAGTCTGTGGATGAAGAAGAGAGAGACCAGGAAGAGAAGAGACGAAGAATTACATTCAGAGAATCAGTTGCTGTGGCAGAATCTGAAACCGAAACCCTTAGAACCCACCTGGACCAGGAGGACGAGAGAGACGAAAGAGTAAAGGAAGACAGGAGACTTAGAAGTCAGACCAGAGAGCTAGCCCCGACACGGGGAGCTGAGGAAGAGGCCAACAGGGAAGCCAGGCCCAGGACTCAGGTGGACATGGATGGGGAAGGAGGCGAGAGGGATGATCGGAGGTCCAGATTTCAACTCAGAGACTTAGCTGCCAGACGGACGACTGAGGAGACAGAGACTGAACGTGCAACGCCGCAGACATCCCAGGACAGGGACGAGGATGAGAAGGAGGAGAAGAGACGTAAAACCATACCCAAAGAACCGGCGGAGAAGAAGCCACCTCGAGGCAAAACCATGATCAACTCCAGGCTCCAGCCCCCCAGGTGCGTCCAGTGTGGGCAGTACTTAGACGATGTCGACCTCAAGTACGAGCAGCACCCTCCTGACGCGCTGGAGGAGCCCCAGATGCTGACCAATGAGAAGCTGTCCATTTTTGACAACAACGAGTCCGGCTTTGAGAGCTACGAGGCTTTTCCTCAGCACAAGCTTACATGCTTCAGTGTATACTGTAAGCGAGGTCACCTCTGCCCAATAGACACCGGCCTCATCGAGAAGAACGTAAAACTCTATTTTTCTGGTACAGCAAAAGCGATCTATGAAGAAAACCCATCTCTAGAAGGTGGCGTTAATGGCAAAAATCTTGGCCCCATCAACGAATGGTGGATCGCCGGCTACGATGGAGGCGAGAAGGTACTCATTGGCTTCAGCACTGGTTTTGCCGAGTACTTTCTGATGGAGCCCAGCCCGGATTACAAACCCTTTTTTGGCCTGATACAGGAGAAGATCTACATGAGCAAGATTGTAATCGAGTTCCTCCAGGGTAATCCCGATGCCACCTATGAAGACCTGATCAACAAGATCGAGACCACTGTTCCCCCTTCCACAATCAACGTGAACCGGTTCACGGAGGACTCTCTCCTCCGCCATGCCCAGTTTGTGGTGAGTCAAGTAGAGAGTTACGATGATGCCAAGGACAGTGATGAGCAGCCCATCTTCCTGTCACCCTGCATGAGAGACCTCATCAAGCTGGCAGGGGTCACCCTGGGGCAGAGGCGAGCTGAAAGGCGTCAGACTGTGAGGCTCAGGAATTCTGCCAAGGAGAAGGACAAAGGACCCACAAAAGCCACCACCACCAAGCTGGTCTGCGAGATCTTCGACACTTTCTTTGCAGAGCAGATAGAAAAGGATGATAAAGAGGACAAGGAGAATGCCTTCAAACGGCGGCGCTGTGGCGTTTGTGAGGTTTGCCAGAGGCCTGAGTGTGGAAAGTGCAAGGCCTGTAAGGATATGCCGAAGTTTGGGGGGAGTGGCCGCAGCAAGCAGGCCTGCCTGAGGAGGAGGTGTCCCAATATGGCCATGAAGGAGGCAGAGGATGATGAGGAAGTGGATGACGACATCCCAGAGATGCCATCACCCAAAAAGATGCATCAGGGGAAGAAGATGAAGCAGAACAAGAATCGGATCTCTTGGGTTGGGGAAGCCATCAAGACTGATGGGAAGAAGAGTTACTACCAGCAGGTGTGCATGGACGGGGAGACCCTGGAGGTGGGAGACTGCGTCTCTGTCATCCCAGACGATCCCTCAAAGCCGCTGTATCTCGCAAGGGTGACGGCGCTGTGGGAGGACAGCAGCAATGGGCAGATGTTCCATGCACACTGGTTCTGCGCTGGCTCGGACACGGTCCTCGGGGCCACGTCGGACCCCCGGGAGCTGTTCCTGGTGGATGAGTGCGAGGACATGCAGCTCTCCTACATCCACAGCAAGGTCAACGTCATCTACAAACCGCCCTCCGAGAACTGGGCCATGGAGGGAGGCATGGATCCCGAGGCCACGCTTCCGGGGATCCCCAAAGATGGGAAGACCTACTTCTATCAGCTGTGGTATGACCAGGACTACGCGAGGTTCGAGTCCCCTCCCAAGATACAGCCAACAGAGGACAACAAGTACAAGTTCTGTGCAAGCTGCGCCCGCCTGGCGGAGATGAGGCAGAAGGAGATGCCCCGCGTCCTGGAGCAGCTGGAGGACATGGACACCCGGGTTCTCTATAGCTCTGCCACCAAGAACGGCATCCTGTACCGAGTGGGTGACGGCGTGTACCTGCCTCCTGAGGCCTTCACCTTCAACATCAAGCTGTCCAGCCCTGTGAAGCGCCCAAGGAAGGAGCCGGTGGATGAGGAGCTGTACCCAGAGCACTACCGGAAGTATTCTGACTACATTAAGGGCAGCAACCTGGACGCCCCAGAGCCCTACCGGATCGGCCGGATAAAGGAGATCTTCTGCCCCAAGAAGAGCAACGGCAAGCCCAACGAGGCGGAAATCAAGATCAAGCTCTACAAGTTCTACAGGCCCGAGAACACCCACAAGTCCAACCCCGCGAGCTACCATGCCGACATCAACCTGCTGTACTGGAGTGATGAGGAGGCCGTGGTGGAGTTCCGGGCCGTGCAGGGCCGCTGCACCGTGGAGTATGGGGAGGACCTGCCTGAGTGCCTGCAGGAGTACTCCACGGGCGGCCCCGACCGCTTCTACTTCCTCGAGGCCTACAATGCAAAGAGCAAAACCTTTGAGGATCCCCCGAACCATGCCCGAAGCCCAGGGAACAAGGGCAAAGGGAAGGGGAAAGGGAAAGGCAAGACGAAATCTCAGGCATTGGAGCCCAGTGAGCCAGAGCAGGCTATCGATCTGCCCAAGCTGCGGACGCTGGACGTGTTCTCGGGCTGCGGGGGGCTGTCGGAGGGCTTCCACCAGGCAGGCATCTGTGAGACGCTGTGGGCCATCGAGATGTGGGAGCCTGCAGCCCAGGCGTTCCGGCTGAACAACCCCGGCTCCACAGTATTCACCGAGGACTGCAACGTCCTGCTCAAGCTGGTCATGGCTGGAGAGGTGACCAACTTGCTCCGCCAGCGGCTGCCACAAAAGGGGGACGTGGAGATGCTGTGTGGTGGGCCCCCCTGCCAAGGCTTCAGTGGCATGAACCGCTTCAACTCTCGCACCTACTCCAAGTTCAAGAACTCCCTGGTGGTCTCCTTCCTTAGCTACTGTGACTACTACCGGCCCCGCTTCTTCCTGCTGGAGAATGTCAGGAACTTCGTCTCCTTCAAGCGCTCCATGGTGCTGAAGCTAACTCTGCGCTGCCTGGTCCGCATGGGCTACCAGTGCACCTTTGGCGTGCTGCAGGCCGGCCAGTACGGTGTGGCGCAGACTCGGCGGCGGGCCATCATCCTGGCCGCAGCCCCAGGGGAGAAGCTGCCCCTGTTCCCAGAGCCCCTGCACGTGTTTGCCCCCCGCGCCTGCCAGCTGAGCGTCGTGGTGGACGACAAGAAGTTCGTCAGCAACATCACGAGGCTGAGCTCGGCTCCCTTCCGAACCATCACGGTGCGGGACACCATGTCTGACCTCCCCGAGATCCGGAATGGAGCCTCTGCGCCTGAGATCGCCTACAACGGGGAGCCGCAGTCCTGGTTCCAGAGGCAGCTAAGGGGCTCGCACTACCAGCCCACCCTCAGGGACCACATCTGCAAGGATATGAGCCCGTTGGTGGCCGCCCGCATGCGGCACATCCCGCTAGCCCCTGGCTCAGACTGGCGCGACCTGCCCAACATCGAGGTGCATCTCACGGATGGCACCCTGGCCAAGAAGCTGCGCTACACCCACCATGACAAGAAGAACAGCTGCAGCAGCTCTGGCAACCTGCGCGGCGTCTGCTCCTGCGCAGAAGCCGCCGGTAGAGCCTGTGACCCCACAGCCAGGCAGTTCAACACCCTCATCCCCTGGTGCCTGCCGCACACTGGGAACAGGCACAACCACTGGGCGGGGCTGTACGGGCGCCTGGAGTGGGATGGCTTCTTCAGCACCACCGTCACCAACCCCGAGCCCATGGGCAAGCAGGGCCGAGTGCTGCACCCCGAGCAGCACCGTGTGGTGAGTGTGCGGGAGTGTGCCCGCTCCCAGGGCTTCCCTGACACCTACCGGCTCTTCGGCAACATTCTGGACCGGCACCGGCAGGTGGGAAACGCTGTGCCGCCTCCCCTGGCCAAAGCCATTGGCTTGGAGATCAAGCTGTGTATGTTGGCCAAAGCTCGAGAGGGCGCCTCAGTTAAAGTAAAGGAGGAGGAGACAGCATCGAAGGCCTAG

XM_004865396.1 Coding sequence

Cd320 CD320 molecule

High confidence: 4 potential gene matches
Length: 771 bp    Location: 1106314..1102016   Strand: -
>XM_004865396.1
ATGGCACGGGGCGGAGCACTGCGAACTACTGTTCTGAGCCTGGCGCTGCGGCTGCTGCTCGGCCTCCGACTTGGCTTGGAAGCTGCTCCGACCTCAGGCCTGACCCGGACCTCCGCCCAGGCCCCAGGCTCCTGCTCACCGCCCAACTTCCAGTGCCGCACCAGTGGCTACTGCGTTCCCCTCACCTGGCGGTGTGATGGCGACCGGGACTGCGCGGATGGCAGCGATGAGGAGGAGTGCCGGATCCAGCCGTGTACCCAGAACGGGCAGTGCCCACTGCCCCCGGATCCCCCTTGCTTCTGTGACAGCGTCAGCGATTGCCCTGGTGGCACCGACAAGAACTTGCATAACTGCAGCCAACGGCAGCCCTGCCCGCCAGGCCAGCTGCCCTGCAGGGCAGGGGACACCTGTGTCCCACACACGTGGCGCTGCGACAGTCACCCGGACTGTCCAGACGCCAGCGACGAGCTCAACTGCGAAAGCAAGGAGACCCTTCAGGAAGGGCACACCACGACCATGGGGACCCCCGTGACCCTGGAAAGTGTGGCCTCTCTCGGGAATGCCACAGCCTCCTCCCTTGGAGCCCAGTCTGGAAACCCAAGTGCCTACGGGGTCATTGCAGCTGCTGGGTTGCTCGGTGTCAGCCTGGCCGCCGTCACCCTCCTGGTTGTGTTCCAGCTCCGAGCCCAAGGGTCCCTGCGGCCGCTGGGCCTGCTGGTGGCCATGAAGGAGTCCCTGGTGTTGTCAGAACGGAAGAGCTCGGTGCTCTGA

XM_004865393.1 Coding sequence

LOC101714714 c-C motif chemokine 25-like

Length: 276 bp    Location: 975662..978600   Strand: +
>XM_004865393.1
ATGAACCCGTGGCTCCTCACCTGCCTGGTGGCTTCCTTCGTGGGAGCCTGGGTCCCTGCTGTCCACACCCAAGGTGTGGTGGAGGACTGCTGCCTGGCCTACCACCCCCACCTCAGGTTGCCTGTGCTCCTGCGCACCAGGAATTTCTGGTGGCAGGAGGTGAGCGGAAGTTGCAATCTGCCAGCTGTGATATTCTATTTCCCCCAGCTAGGCAGGACAGTGTGTGGGAACCCTCAGGACAGGGTGGTGAGGAAGGCCATGAAGATCTTGAGTGCT

XM_004865296.1 Coding sequence

Znf699 zinc finger protein 699, transcript variant X1

Length: 1950 bp    Location: 73479..61897   Strand: -
>XM_004865296.1
ATGCATCCTGTTCTCACTTTGCAGAAAGGGAAAGCACCTCTGCTTTGGGGCCAGGGGACGAGAATCTCCACGTCGCCGTCGCTGCGCGGGTCCCAGGATTTCTGCGTGCTGGGTGAGCTCGGTCCCCGCCTCGCCTCTCCCGGTGACATGGGGGAAGAAAGAAGAAATGCTGAGTTACAGAAAAATATGATACAGGATTCACTGACCTTTGAAGATTTGGCTGTGGACTTTAGCCCTGAGGAATGGGCTTTGTTGGATCTTGCTCAGAGAAAACTCTACAGAGATGTGATGCTGGAAACCTTCCGGAACCTGGCTTCCCTAGGTTTTAAGATTCTACTTAAAACTAATGAATCAGTTGTTCTGCCTGATAATAATTTAGAAAAAGTATCTAATGAACAAAAAGTCATAAGATTCAATAGAAATGGTTCTTGGTTCTCCATTTTACATGCAAACTGGGAACACTATGGTATTGATGAGAAGAACAAAAGCCATGGGAGACTTTTGAGTCACATGGTGGAGAACGTCTATGAATGTAATGAAGAAAATCAAAGTGAACAAATTCCAAATCTTAATGTGCTCAAGAGAACTACTGAAGTAAACTCCTATGAATGTCATGAGTGTGGAAAAGCCTTCCTGTGCCATTCATCCCTTAAGAATCACATCAGATCTCATACCAGAAGCAAACCCTACCAGTGTCAGGAATGTGGGAAAACCTTCCATTTTCTTGCTTATTTTAAAAAGCATATGAAGACTCCTACTGAAGAGAAGCCCTATGAATGTAAGGAGTGTGCCATACTCTTCAGTTGTTCCTCATTCTTTAGGGCACATATGAAAATTCACAGTGGAAAAGTAAACTATGAATGTAAGGAATGTGGGAAAACTTTCAGTACTTCTTCTTATCTCACTGAACATAAAAGAATTCATAGTGGAGATAAGCCTTGTGAATGTGATGAGTGTGGGAAGGCCTTTAGTTGTCCTTCATCACTCTCCCAACACAAAAGAATTCATAGTGGGGATAAGCCGTATGAATGCAAGGAATGTGGGAAGGCCTTTAGTTCTTCCTCTCACCTCATAACACATATCAGAATTCACACTGGAGAGAAGCCTTACGAATGCAAAGAGTGTGGGAAGGCCTTCAGTGAGTCCTCAAAACTCAGTCGACATATGAGAGCACATACTGGAGAGAAACCATATAAATGTAAGGACTGTGGGAAAACCTACAATTGCCCCTCCTCCTTGAGCATCCATATGAGGAAACACACTGGAGAGAAACCCTATGAATGTCTGGAATGTGGAAAAGCCTTCTATCTTCCCACTTCCCTGTATACACATGTGAAAAATCAGAGTAGAGAGAAACCATATGAGTGTAAACAATGTGGGAAGGCCTTCAGTTGTCCCTCATCCTTTAAAGCACATGTGAGAGATCATGCCCGAGAGATACAATATCAGTGTAAGGAGTGTGGGAAGGTCTTCAGTCGTTCCTCATCCCTCACCGAACACTTGAGAACTCACAGTGGAGAGAAGCCTTATCAGTGTAAGGAATGTGGGAAAGCCTTTATTAGTTCCTCCCAGCTTACAGTTCACAGAAGAACTCACACTGGAGAGAAACCTTATGAATGTAAGAATTGTGAGAAATCCTTTATGTATTTCTCAGCCTTCAGCTTCCATATGAGAATGCACACAGGGGAAAAACCATATGAGTGCAAGGAATGTGGGAAGGCTTTTCGACATTCCTCATACCTAACCATCCATGCAAGAATGCACACTGGAGAAAAACCCTTTGAATGTCTGGAATGTGGGAAAGCCTTCAGGTGTCCTTCATCTTTTCAAAGACACGTGAAAAGCCACACAGGAGAGAAACCATATGAATGTAAGGAATGTGGGAAAGCCTTTATTTGTGCAGCCTACCTTCGAAGACATGTGAAAATCCACAATAGAGGAAAAATATGA

XM_004865639.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X8

High confidence: 4 potential gene matches
Length: 1665 bp    Location: 3810479..3805151   Strand: -
>XM_004865639.1
ATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGGTCCAGGTACGGAAGTATGGGGCACAGGAGAAACTGTTCATCTCTCCCGGGCTCCTCCCTGCCAAACCTGGGCTCCCCAAGGCAGAGCACACTGACACTCCTGAGGTGGACAGCGGAAACTCCACAGCTGGCAAAGCCAAGGCTAAACCTGCAGGGTCTCAGGTTTGGGGAGCTGGGGTGGGCCGGAGAAAGGTATACCCCAAGGGTGTTTGGGTTCCCAAGCCCGGGGCCAGCTGTTGGAAGGGCTCTGCCCCCTCAGGGTCCCGTTGAGAAGAACAAGGACCTGGTGTTGGACCTGGGCCACCTCAATGACTCCTACAACTTCAGTTTCCACGTGGTGATTGGCTCCAGGGCCGAGGAAGGCCAGTACAACCTCAACTTCCACAACTGCTACAACCTGATGCCTGGCCAGGAACGCCCCTTCGACCTCACAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTGCGGGTGCAGAGGCCCTGGAGGAAGGCGGGACAGGGGTACAGCTCAGGGGCCCCCACCCACCGCACCCCGCTCTCCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTGAGGGCCCCGCCCCCGGACGAGGCTCCTCCCAGGGCACTGGGGCGGTCAGTGCTGACCGCACCGTGTGTCCTCTGCCTGTGCCAGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGACTTTCCGCCCCGGGACTGTCTGCCCTGTCTGCCCCGGCCCCTCCGTCCTCCGTGACCCCAGCCCCCTCTGTGCGCCCTCCCCAGTGTTGGTGAACCTGGCCAAGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATGTCTACTTCACACGCATCATCGCCATCCTGCTGCGCGTGGCTGTGCCCTTCCAGTGGCAATGGCTGTACCAGCTCTTAGTGGAGGGCTCCACGCTCGCCTTCTTTGTGCTCACGGGCTACAAGTTCCAGCCCACCAGGGACAACCCGTACCTGCAGCTGCCCCAGGAGGACGAGGAGGACGTACAGATGGAGCAAGTGATGACGGACTCTGGGTTCCGGGAAGGCCTCTCCAAAGTCAACAAAACAGCAAGCGGACGAGAGCAGTTGTGA

XM_004865757.1 Coding sequence

Fsd1 fibronectin type III and SPRY domain containing 1, transcript variant X4

High confidence: 3 potential gene matches
Length: 1491 bp    Location: 5359737..5347666   Strand: -
>XM_004865757.1
ATGGAAGACCACAGGGAGGCTCTGCGGAAGATCATCACCACCCTGGCTGTGAAGAATGAAGAGATTCAGAGCTTTATCTACTCCCTTAAGCAGATGCTACTGAATGTGGAGGCGAACTCCACCAAGGTGCAGGAAGACCTAGAGGAGGAGTTCCAGTCCCTCCTGTCCATGCTGGAGGAGCTCAAGGAGGGCATGCTCATGAAGATAAAGCAGGACCGTGCCAGCCGCACCTACGAGCTACAGAACCAGCTGTCTGCCTGCACCCGGGCCCTGGAGAGTTCGGAGGAGTTGCTGGAGATGGCCAATCACACCCTGCAGGCTGCTGACAGCGAGGACTTCCTCCAGGCTGCCAAGCAAATCAAAGATAGTGTAACAATGGCTCCTGCCTTCCGGCTGTCACTGAAAGCGAAGGTCAGCGACAACATGAGTCACCTCATGGTGGACTTTGCTCAAGAACGTCAGATGCTGCAGGGCCTTACGTTTCTGCCTGTGCCCAGCACCCCCATGATCGACCTAGCCGAGTCCCTAGTGGCAGATAACTGCGTGACCCTGGTGTGGCGCATGCCGGACGAGGACAGCAAGATCGACCACTATGTGCTGGAGTACCGGAGGACCAACTTTGAGGGACCCCCACGCCTCAAGGAGGACCAGCCCTGGATGGTGGTGGAGGGCATCCGGCACACGGAGTACACCTTGACAGGTCTCAAGTTTGACATGAAGTACATGAACTTCCGGGTGAAGGCTTGTAACAAGGCAGTTGCAGGGGAGTTCTCCGAGCCAGTGACCCTGGAGACACCAGCGTTCATGTTCCGCCTGGATGCGTCCACATCTCACCAGAACCTGCGGGTAGACGACCTTGCCGTGGAGTGGGACGCTATGGGCGGGAAGGTGCAGGACATCAAGGCTCGAGAGAAAGATGGCAAGGGGCGGACGGCATCTCCTGTCAACTCCCCAGCCAGAGGTACTCCATCCCCCAAGAGGATGTCCTCAGGTCGTGGGGGTCGGGACCGGTTCACAGCTGAGTCCTACACAGTACTGGGGGACACCCTGATTGATGGCGGGGACCACTACTGGGAGGTGCGCTATGAGCCGGACAGCAAGGCCTTTGGCGTAGGTGTGGCCTACCGCAGCCTGGGCCGCTTTGAGCAGCTGGGCAAGACCTCGGCTTCGTGGTGCCTGCACGTGAACAACTGGCTGCAGGTCAGCTTCACAGCCAAGCACGCCAACAAGGTCAAGGTGCTGGACGCCCCCGTGCCCGACTGCCTGGGTGTGCACTGTGACTTCCACCAAGGCCTCCTGTCCTTTTACAATGCCCGCACTAAACAGCTGCTGCACACATTCAAAGCCAAGTTCACGCAGCCACTGCTGCCGGCCTTCACGGTCTGGTGTGGCAGCTTCCATGTGACGACAGGCCTGCAGGTCCCCAGCTCCGTACGCTGCCTGCAGAAGCGGGGAAGTGCCACTAGCAGCTCCAATACCAGCCTCAGCTAG

XM_004865754.1 Coding sequence

Fsd1 fibronectin type III and SPRY domain containing 1, transcript variant X1

Length: 1593 bp    Location: 5359737..5347666   Strand: -
>XM_004865754.1
ATGGAAGACCACAGGGAGGCTCTGCGGAAGATCATCACCACCCTGGCTGTGAAGAATGAAGAGATTCAGAGCTTTATCTACTCCCTTAAGCAGATGCTACTGAATGTGGAGGCGAACTCCACCAAGGTGCAGGAAGACCTAGAGGAGGAGTTCCAGTCCCTCCTGTCCATGCTGGAGGAGCTCAAGGAGGGCATGCTCATGAAGATAAAGCAGGACCGTGCCAGCCGCACCTACGAGCTACAGAACCAGCTGTCTGCCTGCACCCGGGCCCTGGAGAGTTCGGAGGAGTTGCTGGAGATGGCCAATCACACCCTGCAGGCTGCTGACAGCGAGGACTTCCTCCAGGCTGCCAAGCAAATCAAAGATAGTGTAACAATGGCTCCTGCCTTCCGGCTGTCACTGAAAGCGAAGGTCAGCGACAACATGAGTCACCTCATGGTGGACTTTGCTCAAGAACGTCAGATGCTGCAGGGCCTTACGTTTCTGCCTGTGCCCAGCACCCCCATGATCGACCTAGCCGAGTCCCTAGTGGCAGATAACTGCGTGACCCTGGTGTGGCGCATGCCGGACGAGGACAGCAAGATCGACCACTATGTGCTGGAGTACCGGAGGACCAACTTTGAGGGACCCCCACGCCTCAAGGAGGACCAGCCCTGGATGGTGGTGGAGGGCATCCGGCACACGGAGTACACCTTGACAGGTCTCAAGTTTGACATGAAGTACATGAACTTCCGGGTGAAGGCTTGTAACAAGGCAGTTGCAGGGGAGTTCTCCGAGCCAGTGACCCTGGAGACACCAGTGCCTGTCTTGGTCTGTCTGGGTCACTGTCTGCCTGTCTCTGTCTTTTTGTGTCTCTCTGGGTTTTCCCATCTCTGTACCTCCCTCGTCTGCCCGGCCCCAGCGTTCATGTTCCGCCTGGATGCGTCCACATCTCACCAGAACCTGCGGGTAGACGACCTTGCCGTGGAGTGGGACGCTATGGGCGGGAAGGTGCAGGACATCAAGGCTCGAGAGAAAGATGGCAAGGGGCGGACGGCATCTCCTGTCAACTCCCCAGCCAGAGGTACTCCATCCCCCAAGAGGATGTCCTCAGGTCGTGGGGGTCGGGACCGGTTCACAGCTGAGTCCTACACAGTACTGGGGGACACCCTGATTGATGGCGGGGACCACTACTGGGAGGTGCGCTATGAGCCGGACAGCAAGGCCTTTGGCGTAGGTGTGGCCTACCGCAGCCTGGGCCGCTTTGAGCAGCTGGGCAAGACCTCGGCTTCGTGGTGCCTGCACGTGAACAACTGGCTGCAGGTCAGCTTCACAGCCAAGCACGCCAACAAGGTCAAGGTGCTGGACGCCCCCGTGCCCGACTGCCTGGGTGTGCACTGTGACTTCCACCAAGGCCTCCTGTCCTTTTACAATGCCCGCACTAAACAGCTGCTGCACACATTCAAAGCCAAGTTCACGCAGCCACTGCTGCCGGCCTTCACGGTCTGGTGTGGCAGCTTCCATGTGACGACAGGCCTGCAGGTCCCCAGCTCCGTACGCTGCCTGCAGAAGCGGGGAAGTGCCACTAGCAGCTCCAATACCAGCCTCAGCTAG

XM_004865765.1 Coding sequence

Sirt6 sirtuin 6, transcript variant X1

Length: 1053 bp    Location: 5442014..5449549   Strand: +
>XM_004865765.1
ATGTCGGTGAACTACGCGGCGGGGCTGTCGCCGTATGCGGATAAGGGCAAGTGTGGCCTCCCCGAGATTTTTGACCCCCCGAAGGAGTTGGAGCTGAAGGTGTGGGAGCTGGCCAGGCTGGTGTGGCAGTCCTCCAATGTGGTGTTCCACACAGGCGCTGGCATCAGTACTTCCTCAGGCATCCCTGACTTCAGGGGCCCGCACGGTGTGTGGACCATGGAGGAGCGGGGTCTGGCGCCCAAGTTCGACACGACCTTTGAGAGCGCGCGGCCCACGCGCACACACATGGCGCTGGTGCAGCTGGAGCGCGTGGGGCTGCTGCACTTCCTCGTCAGCCAGAACGTGGACGGGCTGCATGTGCGCTCCGGCTTCCCCAGGGACAAACTGGCAGAGCTGCATGGGAACATGTTCGTAGAAGAATGTGCCAAGTGTAAGACGCAGTACGTCCGGGACACGGTCGTGGGCACCATGGGCCTCAAGGCCACCGGGAGGTTCTGCACAGTGGCCAAGGCGCGGGGACTGCGGGCTTGCCGGGGGGAGCTGAGAGACACCATCCTGGACTGGGAAGATGCCCTGCCTGAGCGGGATCTGGCTCTCGCCGACGAGGCCAGCAGGAACGCGGACCTGTCCATCACCCTGGGGACCTCCCTGCAGATCCGGCCCAGCGGGAACCTGCCCCTGGCCACCAAACGCCGGGGCGGCCGCCTGGTCATTGTGAACCTGCAGCCCACCAAGCACGACCGCCAGGCTGACTTGCGCATCCACGGCTACGTGGACGATGTGATGGCTGGGCTCATGCGACACCTGGGGCTGGACATCCCCGCCTGGCACGGGCCCCGAGTGCTGGAAAGGGCCCTTCCCCCACTGCCCCGGCCTCCCGCACCCAAGCTGGAGCAGAAGGATGACAAGGGTGAGGACTCTACAGCCCAGCTCAATGGCTCTGCACCCACCCAGCCCAAGCCAGAGCCCAGCAGCCCCAAACTGGAGCGGCCCGAGAGCCTGGCCCCTTGCAGGCCCCCCAAGAGGCTGAAGGCTGAGGCAGTGCCCAGCTGA

XM_004865767.1 Coding sequence

Sirt6 sirtuin 6, transcript variant X3

Length: 972 bp    Location: 5442014..5449549   Strand: +
>XM_004865767.1
ATGTCGGTGAACTACGCGGCGGGGCTGTCGCCGTATGCGGATAAGGGCAAGTGTGGCCTCCCCGAGATTTTTGACCCCCCGAAGGAGTTGGAGCTGAAGGTGTGGGAGCTGGCCAGGCTGGTGTGGCAGTCCTCCAATGTGGTGTTCCACACAGGCGCTGGCATCAGTACTTCCTCAGGCATCCCTGACTTCAGGGGCCCGCACGGTGTGTGGACCATGGAGGAGCGGGGTCTGGCGCCCAAGTTCGACACGACCTTTGAGAGCGCGCGGCCCACGCGCACACACATGGCGCTGGTGCAGCTGGAGCGCGTGGGGCTGCTGCACTTCCTCGTCAGCCAGAACGTGGACGGGCTGCATGTGCGCTCCGGCTTCCCCAGGGACAAACTGGCAGAGCTGCATGGGAACATGTTCGTAGAAGAATGTGCCAAGTGTAAGACGCAGTACGTCCGGGACACGGTCGTGGGCACCATGGGCCTCAAGGCCACCGGGAGGTTCTGCACAGTGGCCAAGGCGCGGGGACTGCGGGCTTGCCGGAACGCGGACCTGTCCATCACCCTGGGGACCTCCCTGCAGATCCGGCCCAGCGGGAACCTGCCCCTGGCCACCAAACGCCGGGGCGGCCGCCTGGTCATTGTGAACCTGCAGCCCACCAAGCACGACCGCCAGGCTGACTTGCGCATCCACGGCTACGTGGACGATGTGATGGCTGGGCTCATGCGACACCTGGGGCTGGACATCCCCGCCTGGCACGGGCCCCGAGTGCTGGAAAGGGCCCTTCCCCCACTGCCCCGGCCTCCCGCACCCAAGCTGGAGCAGAAGGATGACAAGGGTGAGGACTCTACAGCCCAGCTCAATGGCTCTGCACCCACCCAGCCCAAGCCAGAGCCCAGCAGCCCCAAACTGGAGCGGCCCGAGAGCCTGGCCCCTTGCAGGCCCCCCAAGAGGCTGAAGGCTGAGGCAGTGCCCAGCTGA

XM_004866063.1 Coding sequence

Gtf2f1 general transcription factor IIF, polypeptide 1, 74kDa

High confidence: 4 potential gene matches
Length: 1656 bp    Location: 3521650..3512993   Strand: -
>XM_004866063.1
ATGGCGACCCTAGTGAGTATGAATGAGGCGGGCCCGAATCGAGGGTCGCGCGGCTTCCCGGCGGCCCCTCCTCACGCACCTTCCCATCTTCTCTCTTCGCAGGGCCCCGGCAGCCAGAATGTTACCGAGTATGTCGTTCGAGTTCCCAAGAACACAACCAAAAAATACAATATAATGGCTTTCAATGCAGCCGATAAAGTGAACTTTGCTACATGGAATCAGGCCCGGCTAGAGCGGGATTTGAGCAACAAGAAGATTTACCAGGAGGAGGAGATGCCCGAGTCTGGAGCAGGCAGCGAGTTCAACCGGAAGCTCCGGGAGGAGGCCCGCCGCAAGAAGTACGGCATCATCCTCAAGGAGTTCCGGCCTGAGGACCAGCCCTGGCTGCTCCGCGTCAATGGAAAATCAGGCAGGAAGTTCAAGGGCATCAAGAAGGGAGGCGTGACGGAGAACACGTCCTACTACATCTTTACCCAGTGCCCTGACGGGGCCTTCGAGGCCTTCCCCGTGCACAACTGGTACAACTTCACGCCACTGGCCCGGCACCGCACGCTCACCGCTGAGGAGGCCGAAGAGGAATGGGAGAGGAGGAACAAGGTCCTGAACCACTTCAGCATCATGCAGCAACGGCGGCTCAAGGACCAGGGCCAGGACGAGGATGAGGAGGAAAAGGAGAAACGCAGCCGTGAGAAGGCCAGCGGGCTGCGCATCCACGACCTGGAGGACGACCTGGAGATGTCCTCAGACGACAGTGAGGGCAGCGGCGAAGATGGCAGCAGAGCCCCCAAGACCAAGAAGAAGGCGCCGCTGACCAAGGCAGGCAGGAAGAAGAAGAAGAAGAAGAAGGGCTCAGACGATGAGGCCTTTGAGGACAGCGACGACGGGGACTTTGAGGGCCAGGAAGTCGACTACATGTCTGACGGCTCCAGCAGCTCCCAGGACGAGCCAGAGAGCAGCAAGCCCAAAGTGCAGCAGCAGGAGGAGGGGCCCAAGGGTGTGGACGAGCAGAGCGAGAGCAGTGAGGAGAGCGAGGAGGAGAAGCCGGCCGCCACCGAGGAGGACAAGGAGGAGGAGGAAGAGAAGAAGGTGGCCACCCCGCAGGAGAAGAAGCGCCGGAAAGACAGCAGCGACGAGTCTGACAGCTCTGAGGAGAGTGACATCGACAGCGAAGCCTCCTCGGCCCTCTTCATGGCGAAGAAGAAGACACCCCCCAAGCGGGAGCGGAAGCCCTCAGGAGGCAGCTCAAGGGGAAACAGCCGCCCCGGCTCGCCCAGCGCAGAGGGTGGCAGCACTTCTTCCACCCTGCGGGCTGCTGCCACCAAACTGGAGCAAGGGAAGCGGACAAGTGAGACACCTGCCGCCAAGCGGTTGCGGCTGGACACTGGGCCGCAGAGCCTGTCCGGGAAGTCCACCCCACAGCCGCCGTCTGGAAAGTGCACGCCCAGCAGCGGCGATGTGCAGGTGACCGAGGATGCCGTGCGGCGCTACCTGACGCGGAAGCCCATGACCACCAAGGACCTGCTGAAGAAGTTCCAGACCAAGAAGACGGGGCTGAGCAGCGAGCAGACGGTGAACGTGCTGGCCCAGATCCTGAAGCGCCTCAACCCCGAGCGCAAGATGATCAATGACAAGATGCACTTCTCTCTCAAGGAGTGA

XM_004866028.1 Coding sequence

Shc2 SHC (Src homology 2 domain containing) transforming protein 2

High confidence: 4 potential gene matches
Length: 1746 bp    Location: 7978031..7995756   Strand: +
>XM_004866028.1
ATGACGCAGGGTCCGGGCGGGCGGGCGCCCCCCGCGGGCCCCGAGCCCGAGGCGCCCACCACCTTCTGCGCGCTGCTGCCGCGCATGCCGCAGTGGAAGTTCGCGGCACCCGCCGGCTTCTTGGGCCGCGGGCCAGCTGCGGGGGCGACGCGGACGGCTGGGGCCACGGGGGCCGAGGGCGCGGCGGGCACGGGCGACCCCCGGACGGAGCACGCAGGCCCCGCGCTGGCCGCCGTGCTAGGCGCCTGCGAGCCGCGCTGCGCCGCGCCCTGCCCGCTGCCTGCGCTCAGCCGCTGCCGGGCCTCGGGGGCGCGCGGGCCGCGGGGCGCGCGGGGTTTGGCCGGGCCCCCAGACGCCTTGGCCGACGAGTGGGAGCGCAAGAGCGGCTTCATCCACAAGCCCGCGCACGGCTGGCTGCACCCCGATGCCAGGGTGCTGGGGCCCGGGGTCTCCTACATCGTCCGGTACATGGGCTGCATTGAGGTGCTCAGATCCATGCGCTCCCTGGACTTCAGCACTCGGACCCAGGTGACCAGGGAGGCCATCAATCGGCTCCACGAGGCCGTGCCAGGCGTCAGGGGCTCCTGGAAGAAGAAGGCGCCCAACAAGGCGCTGGCCTCTATCCTGGGCAAAAGCAACCTGCGCTTCGCGGGCATGAGCATTTCCGTGAATATTTCTATCGATGGCCTCAACCTCTTGGTGCCCGCCACGCGTCAGGTCATCGCCAGCCATCACATGCAGTCCATCTCCTTTGCGTCGGGCGGTGACACGGACATGACGGATTACGTGGCCTATGTCGCCAAGGACCCCATCAACCAGAGAGCCTGTCACATCCTGGAGTGCTGCGAGGGCCTGGCGCAGAGTGTCATCAGCACCGTGGGCCAAGCCTTCGAGTTGCGCTTCAAGCAGTACCTGCACAGCCCCCCCAAGGCAGTCGTGCCTCCCGAAAGGCTGACTGGGCTGGAGGAGTCGGCCTGGGGGGACGAGGAGGAGGTCGAAGGACACAACTACTACAACAGCATCCCGGGGAAGGAGCCGCCGCCTGGCGGGCTGGTGGACTCCAGGCTGGCCATCACGCAGCCCTGCGGCCTTGCAGCCCTTGGCCAGGGAGCATCTCCCTTTCGAAGAGACGCCCGCAGCCTGCAGTGGGACCAGAGCTCTTCTGGCTCAGCCCCGCCGGGGGATGGCTATGTGCAGGCGGATGCTCGGGGGCCTCGGGACTATGAGGAGCACCTGTACGTCAACACGCAGGGTCTGGATGCCCCGGAGCCTGAAGACCTGGTGCCTCCGCAGCCTGAGGAGAGCCCCAAGAAGGACCTGTTCGACATGCGACCCTTCGAGGACGCCCTGAGGCTGCATGAGTGTGCTGCAGGCATAGCAGAGGACCAGTGGCCCAGTCCTCCCACCCGTCGGGCTCCCGTCGCCCCCACTGAAGAGCAGCTGCGGCAGGAACCCTGGTACCATGGCCGCATGAGCCGCAGGGCCGCCGAGAGGCTGCTGCGAGCTGATGGGGACTTCCTGGTACGAGATAGCGTCACCAACCCCGGGCAGTACGTCCTCACAGGCATGCACGCCGGACAGCCCAAGCACCTGCTGCTGGTGGACCCCGAGGGTGTGGTGCGAACGAAGGATGTGCTGTTCGAGAGCATCAGCCACCTCATCGATTACCACCTGCAGAACGGGCAGCCCATCGTGGCTGCTGAGAGCGAGCTGCACCTGCGTGGCGTGGTTGCGCGGGAGCACTGA

XM_004865986.1 Coding sequence

Tmem259 transmembrane protein 259

High confidence: 4 potential gene matches
Length: 1863 bp    Location: 7606271..7614575   Strand: +
>XM_004865986.1
ATGTCGGAGCACGAGACGCCCGCGGCCCCGGAACCCGGGCCCAACGGCGGCGGCGGCGGCGGCGGCGGCCCGGCCCCCGCGCGCGGCCCGCGCACCCCCAATTTGAACCCCAACCCCCTCATCAACGTGCGTGACCGGCTCTTCCACGCGCTCTTCTTCAAGATGGCTGTCACCTACTCACGGCTCTTCCCGCCCGCCTTCCGCCGCCTCTTCGAGTTCTTCGTGTTGCTCAAGGCACTGTTTGTGCTGTTCGTGCTCGCCTACATCCACATCGTCTTCTCACGCTCCCCTGTCAACTGCCTGGAGCACGTGCGAGACAAGTGGCCACGCGAGGGCGTGCTGCGCGTGGAGGTGCGGCACAACTCCAGCCGCGCGCCCGTCTTCCTGCAGTTCTGCGACAGTGGCGCCCAAGGCAGCTTCCCTGGCCTGGCCATGGAGCCGGGTGGCTTGGAGCTGGAGGAGGAGGAGGAGCTGACCATGGAGATGTTTGGGAACAGCTCAGTCAAGTTTGAGCTGGACATAGAGCCCAAGGTGTTCAAGCCGCCCACTGGCACTGAGGCCCTGAATGACAGCCAGGAGTTCCCCTTCCCTGAGACGCCCAACAAAGTGTGGCCGCAGGACGAGTACATTGTGGAGTACTCGCTGGAGTATGGCTTCCTGCGGCTGTCGCAGGCCGCGCGGCAGCGCCTCAGAATCCCTGTCATGGTGGTCACCCTGGACCCCACACAGGACCAGTGCTTCGGAGACCGCTTCAGCCGCCTGCTGCTGGACGAGTTCCTGGGCTATGATGACATCCTCATGTCCAGCGTGAAGGGCCTGGCAGAGAACGAGGAGAACAAGGGGTTCCTACGGAATGTGGTCTCGGGGGAGCACTACCGCTTCGTCAGCATGTGGATGGCGCGCACGTCCTACCTGGCTGCCTTCATCATCATGGTCATCTTTGCCCTCAGCGTGTCCATGCTGCTGCGCTACTCACACCACCAGATCTTTGTCTTCATCGTGGACCTGCTGCAGATGCTGGAGATGAACATGGCCATCGCCTTCCCTGCAGCGCCCCTGCTGACCGTCATCCTGGCCCTCGTGGGGATGGAGGCCATCATGTCTGAGTTCTTCAACGACACCACCACAGCCTTCTACATCATCCTGATCGTGTGGCTGGCCGACCAGTACGACGCCATCTGCTGCCACACGAACACCAGCAAGCGGCACTGGCTAAGGTTCTTCTACTTGTACCACTTCGCCTTCTACGCCTACCACTATCGCTTCAATGGGCAATACAGCAGCCTGGCCCTGGTCACCTCCTGGCTTTTCATCCAGCATTCCATGATCTACTTCTTCCACCACTACGAGCTGCCCGCCATCCTGCACCAGATCCGCATCCAGGAGATGCTGCTGCAGACCCCGCCACTGGGCCCCAGGACCCCCACGGTGCTACCGGATGACCTGAACAACAACTCCGGCACCCCGGCCATCGCACCCGACCCTGCTGGCCAGCCCCTCGCCCTAGGTCCTGGTTCAGCTGGAGCCGGCGGGGTGCCTGGGCCTGGGCCCGCGGTGCCCAACACCCTAGGGGCTGTGGCTGCCTCAGTGGCTGCCGCGGCCGGGGGTGACCTGGGCTGGATGGCTGAGACAGCCGCCATCATCACTGATGCCTCCTTCCTGTCTAGCCTGGGCGCCTCGCTCTTGGAGCGGAGGCCCGCCGGACCCCTGAACCCCAGTGGGGGCCTTCCCCACACCCCTCAGGACAGTGTCCCCCAGAGCGACTCCTTGGCACCCGACACAGCCTTCCTAGTAGCCACCGGGACTGGGCCGGGCACTGCACCCAGGACCCCAGCTGACTCGCCCTCCGAGGTCTGGTCCTGA

XM_004865299.1 Coding sequence

Znf699 zinc finger protein 699, transcript variant X4

Length: 1803 bp    Location: 73545..61897   Strand: -
>XM_004865299.1
ATGGGGGAAGAAAGAAGAAATGCTGAGTTACAGAAAAATATGATACAGGATTCACTGACCTTTGAAGATTTGGCTGTGGACTTTAGCCCTGAGGAATGGGCTTTGTTGGATCTTGCTCAGAGAAAACTCTACAGAGATGTGATGCTGGAAACCTTCCGGAACCTGGCTTCCCTAGGTTTTAAGATTCTACTTAAAACTAATGAATCAGTTGTTCTGCCTGATAATAATTTAGAAAAAGTATCTAATGAACAAAAAGTCATAAGATTCAATAGAAATGGTTCTTGGTTCTCCATTTTACATGCAAACTGGGAACACTATGGTATTGATGAGAAGAACAAAAGCCATGGGAGACTTTTGAGTCACATGGTGGAGAACGTCTATGAATGTAATGAAGAAAATCAAAGTGAACAAATTCCAAATCTTAATGTGCTCAAGAGAACTACTGAAGTAAACTCCTATGAATGTCATGAGTGTGGAAAAGCCTTCCTGTGCCATTCATCCCTTAAGAATCACATCAGATCTCATACCAGAAGCAAACCCTACCAGTGTCAGGAATGTGGGAAAACCTTCCATTTTCTTGCTTATTTTAAAAAGCATATGAAGACTCCTACTGAAGAGAAGCCCTATGAATGTAAGGAGTGTGCCATACTCTTCAGTTGTTCCTCATTCTTTAGGGCACATATGAAAATTCACAGTGGAAAAGTAAACTATGAATGTAAGGAATGTGGGAAAACTTTCAGTACTTCTTCTTATCTCACTGAACATAAAAGAATTCATAGTGGAGATAAGCCTTGTGAATGTGATGAGTGTGGGAAGGCCTTTAGTTGTCCTTCATCACTCTCCCAACACAAAAGAATTCATAGTGGGGATAAGCCGTATGAATGCAAGGAATGTGGGAAGGCCTTTAGTTCTTCCTCTCACCTCATAACACATATCAGAATTCACACTGGAGAGAAGCCTTACGAATGCAAAGAGTGTGGGAAGGCCTTCAGTGAGTCCTCAAAACTCAGTCGACATATGAGAGCACATACTGGAGAGAAACCATATAAATGTAAGGACTGTGGGAAAACCTACAATTGCCCCTCCTCCTTGAGCATCCATATGAGGAAACACACTGGAGAGAAACCCTATGAATGTCTGGAATGTGGAAAAGCCTTCTATCTTCCCACTTCCCTGTATACACATGTGAAAAATCAGAGTAGAGAGAAACCATATGAGTGTAAACAATGTGGGAAGGCCTTCAGTTGTCCCTCATCCTTTAAAGCACATGTGAGAGATCATGCCCGAGAGATACAATATCAGTGTAAGGAGTGTGGGAAGGTCTTCAGTCGTTCCTCATCCCTCACCGAACACTTGAGAACTCACAGTGGAGAGAAGCCTTATCAGTGTAAGGAATGTGGGAAAGCCTTTATTAGTTCCTCCCAGCTTACAGTTCACAGAAGAACTCACACTGGAGAGAAACCTTATGAATGTAAGAATTGTGAGAAATCCTTTATGTATTTCTCAGCCTTCAGCTTCCATATGAGAATGCACACAGGGGAAAAACCATATGAGTGCAAGGAATGTGGGAAGGCTTTTCGACATTCCTCATACCTAACCATCCATGCAAGAATGCACACTGGAGAAAAACCCTTTGAATGTCTGGAATGTGGGAAAGCCTTCAGGTGTCCTTCATCTTTTCAAAGACACGTGAAAAGCCACACAGGAGAGAAACCATATGAATGTAAGGAATGTGGGAAAGCCTTTATTTGTGCAGCCTACCTTCGAAGACATGTGAAAATCCACAATAGAGGAAAAATATGA

XM_004865303.1 Coding sequence

Znf317 zinc finger protein 317, transcript variant X4

Length: 1803 bp    Location: 172602..153899   Strand: -
>XM_004865303.1
ATGGCAGCTCCTGGGCTGTCTCCCACCTGTGCTGTGTCCACCCAGGACCCTGCCTGTCTCCAAGAGTCAGAATTCCCTCTTTCTTCAACTCACCATTCCTGTTCCCAGGACTTAAACCTGTTTGTGTGGCATGGTCTGGAGCCTCTCCCAGGAGCCAGAGATTCTAATCAGGAATCTGTGACTTTCCAGGACGTGGCTGTGGACTTCACTGAGAAGGAGTGGCCCCTCCTGGATCCCTCTCAGCGGAAACTGTACAGAGACGTGATGCTGGAGAACTACAGCAACCTGACCTCCCTGGGGTATCAGGTTGGAAAACCCAGCCTCATCTCTCACTTGGAGCAAGAAGAGGAGCCCAGGATGGAGGAGAGGGGGACTCAGCAAGGGGCTTGTCCAGATTGGGAAACTCCATCTAAAACCAAGTGGTCGATTCTCATGGAAGATATATTTGGGAAGGAAACATCTGGTGGTGTGACCATGGCACAGGACAGAGCTCGCCTTGGGGAGAAGTCGGCCGAATATGAGCGCTTGTTTGACGTCTTCAGCATGGGTGCTCACCTTTCGCAGCAGCTGGGAAGGCAAGCAGGCAAGAGGCCCTTTCCCCGCCACAGCTACGGCGTGGCCTTCAAAGCCCGGGCGCCCCTCTCGCAGCGCGGGGCCGCCTACGACGGGCGGAAGATGCACGAGTGCCACCAGTGCCAGAAAGCCTTCACCACCAGCGCCTCCCTCACGCGGCACCGGAGGATCCACACCGGGGAGAAGCCCTACGCGTGCCGGGACTGCGGCAAGGCCTTCAACGACCCGTCGGCCCTCCGGAGCCACGCGCGGACCCACCTCAAGGAGAAGCCCTTCGACTGCAGCCAGTGTGGCAGCGCCTTCCGCACGCTGTCGGCCCTGAAGATCCACACGCGGGTGCACACCGGCGAGCGGCCCTACAAGTGCGACGAGTGCGGCAAGGCCTACGGCCGGAGCTGCCACCTGATAGCGCACAAGCGCACGCACACCGGGGAGCGGCCCTACGAGTGCCAGGACTGCGGCAAGGCCTTCCAGCACCCCTCGCACCTGAAGGAGCACGTGCGCAACCACACCGGGGAGAAGCCCTACGCCTGCGCGTTGTGCGGCAAGGCCTTCCGCTGGAAGTCCAACTTCAACCTGCACAAGAAGAACCACGCCGTGCAGAAGACCTACGCCTGCAAGGAGTGCGGCAAGGCCTTCGGGGACCTGGTGTCGCGCCGGAAGCACACGCGGACTCACCTGGTGAGGAAGCCCGTGGAGTGCCGCCAGTGCGGGAAGGCCTTCCGCAACCAGTCCATCCTGAAGACCCACATGAACTCGCACACCGGCGAGAAGCCCTACGCCTGCGACCTGTGCGGCAAGGCCTTCAGCGCCAGCTCCAACCTCACCGCGCACCGGAAGATCCACACGCAGGAGCGGCGCTATGAGTGTGCGGCCTGCGGCAAGGTCTTCGGCGACTACCTGTCCCGCAGGAGGCACATGAGCGTGCACCTGGTGAAGAAGCGCGTGGAGTGCCGGCAGTGCGGCAAGGCCTTCCGCAACCAGTCCACGCTCAAGACGCACATGCGGAGCCACACGGGGGAGAAGCCCTACGAGTGTGACCACTGTGGCAAGGCCTTCAGCATCGGCTCCAACCTCAACGTGCACCGGCGGATCCACACGGGCGAGAAGCCCTACGAGTGCCTGGCCTGTGGGAAGGCCTTCAGCGACCACTCCTCCCTGCGCAGTCACGTGAAAACCCACCGCGGGGAGAAGCTCTTCACCTCCTCCGTGTGGAGGAGGCTGCAGTGA

XM_004865773.1 Coding sequence

Zbtb7a zinc finger and BTB domain containing 7A, transcript variant X3

High confidence: 4 potential gene matches
Length: 1791 bp    Location: 5529351..5544209   Strand: +
>XM_004865773.1
ATGGCCGGCGGCGTGGACGGCCCCATCGGGATCCCGTTCCCCGACCACAGCAGTGATATTCTGAGTGGGCTGAACGAGCAGCGGACGCAGGGGCTGCTCTGCGACGTGGTGATCCTGGTGGAGGGCCGCGAGTTCCCCACACACCGCTCGGTGCTGGCCGCCTGCAGCCAGTACTTCAAGAAACTGTTCACGTCGGGCGCCGTGGTGGACCAGCAGAACGTGTACGAGATCGACTTCGTGAGCGCCGAAGCACTCACCGCACTCATGGACTTCGCCTATACCGCCACGCTTACGGTGAGCACGGCTAATGTGGGCGACATCCTCAGTGCCGCTCGGCTGCTTGAGATCCCGGCCGTGAGTCACGTGTGCGCCGACCTCCTGGACCGGCAGATCCTGGCGGCCGATGCAGGTGGCGACTCGGGCCAGCTCGACCTTGTGGACCAGGCGGACCAGCGCAACCTGCTGCGCGCCAAGGAGTACCTGGAGTTCTTCCAGAGCAACCCCATGAATAGCCTGCCCCCCACCGCCGCCGCCAACTTCCCCTGGTCCGCCTTTGGGGCATCCGATGACGACCTAGATGCCACCAAAGAGGCCGTGGCGGCTGCTGTGGCCGCTGTGGCTGCGGGCGACTGCAACGGCTTGGACTTCTACGGGCCAGGCCCCCCAGCGGAGCGAGCCCCTGTGGGCGATGGAGACGAAGGAGACAGCAACCCAGGTCTGTGGCCGGAGCAGGATGAGGATGCCCCGACCACTGCTGGCGGTCTCTTCCAGCCACCCGTGGCCCCGCCGGCCGCCACGCAGAATGGCCACTATGGCCGTGCGGGCGAAGAGGAAGCGGCCTCGCTGTCAGAGGCAGCACCCGAGCCCGGGGACTCACCAGGCTTCCTGTCGGGCGCGGCGGAGGGTGAGGATGGGGATGCGGGCGACGTGGACGGACTGGCGGCCAGCACGCTGCTGCAGCAGATGATGTCGTCTGTGGGCCGGGCGGGGGCACTGGCGGGCGGGGACAGCGACGAGGAGTCTCGGGCCGACGACAAGGGCGTCATGGACTACTACCTGAAGTACTTCAGCGGCGCTCACGAGGGGGACGTGTACCCGGCGTGGTCGCAGAAGGGGGAGAAGAAGATCCGAGCCAAGGCCTTCCAGAAGTGCCCCATCTGTGAGAAGGTCATCCAGGGTGCCGGCAAGCTGCCGCGCCACATCCGCACGCACACAGGAGAGAAGCCGTACGAGTGCAACATCTGCAAGGTCCGCTTCACCAGGCAGGACAAGCTGAAGGTGCACATGCGGAAGCACACAGGTGAGAAGCCCTACCTGTGCCAGCAGTGCGGTGCCGCCTTCGCGCACAACTACGACCTGAAGAACCACATGCGCGTGCACACGGGCCTGAGGCCCTACCAGTGCGACAGCTGCTGCAAGACCTTCGTGCGCTCCGACCACCTGCACAGGCACCTGAAGAAGGACGGTTGCAACGGGGTCCCTTCGCGCCGAGGCCGCAAGCCCCGTGTCCGGGGAGGGGCTCCCGACCCCACGCTGGGGACCGGCGTGCCACCCCCAGGAGCCCCCAGCTCCGCGCCCCCTGGCTCCCCTGACACCGCCACCGCTGCCGCCACCACCACCCGGCGCAATGGCCAGGAGAAGCACTTTAAGGACCAAGAGGAGGACGAGGAGGCCACCAGCCCCGACGGCTCCTCGGGCCGGTTGAATGTAGCGGGCGCCAGCGGTGGAGATGACAGCGGAGGTGGCCCCGGGGCCACTGCCGACGGTAACTTCACAGCCGGACTCGCCTAA

XM_004865679.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 2958 bp    Location: 4494775..4516793   Strand: +
>XM_004865679.1
ATGGCCAAGCCATGGCGGCGAGCACAGGCTACGTGCGCCTGTGGGCCGCGGCACGGTGCTGGGCACTGCGGCGGCCTCTCTTGGTGCCGCCGGGGGGCGGCTCCCGACTGCAACTGGAGTGTGGTTACTGAGAGGCCGGCGGGCCTGCGACGCCATACCTCCTTGGGCGCTTTGGGCCACTGGCCGGCCACCGCAGGCCAGTGGCGAGGGATTTGGGAGGCGAATAGCCGCGGCGGCGGGGGGGCGTTCTCCGGAGGCGGGGATGCCTCCGAGGGAGGCGCGGAGGAAGGAGCCGGGGGCGTAGGGGGCGGCACAGGCAGCGGGGAAGGCCCCGTCGTCACGGCGCTCACGCCCATGACGATCCCGGACGTGTTCCCGCACCTCCCGCTTATCGCCATCACCCGCAACCCGGTGTTCCCGCGCTTTATCAAGATTGTCGAGGTTAAAAATAAGAAGTTGGTTGAGCTGCTAAGAAGGAAGGTTCGACTTGCCCAGCCCTATGTCGGCGTCTTTCTAAAGAGAGATGACAACAATGAGTCTGATGTGGTCGAAAGCCTGGATGAGATCTATCACACGGGGACGTTTGCCCAGATCCATGAGATGCAGGACCTGGGGGACAAGCTGCGCATGATTGTCACAGGACATAGAAGGATCCATATCAACCGACAGCTGGAAGTGGAGCCTGAGGAGGCTGAGCTGGAGAACAGACAGAAGCCCCGCAGGAAGGCCAAGCGGGGGAAGAAGGAGGCGGAGGACGAGCTGAGCCCCAGCACTCCGAGGGAGGTGGGGCAGGAGCCGGCCACTGAGGCCGCCGGGGAGGTGCTCATGGTAGAGGTCGAGAATGTGGTCCACGAAGACTTTCAGGTCACTGAAGAAGTGAAAGCCCTGACCGCAGAGATCGTGAAGACCATCCGGGACATCATCGCCTTGAACCCGCTGTACAGAGAGTCGGTGTTGCAGATGATGCAGGCTGGCCAGCGGGTGGTGGACAACCCCATCTATCTGAGCGACATGGGCGCCGCACTCACCGGGGCTGAGTCCCACGAGCTGCAGGACGTCCTAGAGGAGGCCAACATCCCCAAGCGGCTGTACAAGGCACTGTCCTTGCTGAAGAAGGAGTTCGAGCTCAGCAAGCTACAACAGCGCCTGGGCAGGGAGGTGGAGGAGAAGATCAAGCAGACGCATCGCAAGTACCTGCTGCAGGAGCAGCTGAAGATCATCAAAAAGGAGCTGGGCCTGGAGAAGGACGACAAGGACGCCATTGAGGAGAAGTTCCGTGAGCGGCTTCGGGAGCTGGTGGTGCCCAAGCATGTCATGGATGTAGTGGACGAGGAGCTGAGCAAGCTGGGCCTGCTGGACAACCACTCCTCGGAGTTCAATGTCACCCGCAACTACCTGGACTGGCTCACATCTGTCCCGTGGGGCAGGCACAGTGATGAGAATCTGGACCTGAGCCGGGCCCAGGCGGTCCTGGAGGAGGACCACTACGGCATGGAGGACGTCAAGAGGCGCATCCTGGAGTTCATCGCCGTCAGCCAGCTCCGCCGCTCCACCCAGGGCAAGATCCTCTGCTTCTACGGCCCTCCTGGTGTAGGCAAGACCAGCATTGCGCGCTCCATTGCCCGCGCCCTCAACCGCGAGTACTTCCGCTTCAGTGTGGGGGGCATGACTGACGTGGCTGAGATCAAGGGGCACAGGCGGACCTACGTGGGTGCCATGCCCGGGAAGATCATCCAGTGCCTGAAGAAGACGAAGACTGAGAACCCCCTGGTGCTGATAGATGAGGTGGACAAGATTGGCCGTGGCTACCAGGGGGACCCGTCATCGGCACTGCTGGAGCTGCTGGACCCTGAGCAGAATGCCAACTTCCTGGACCACTACCTGGATGTGCCTGTGGACCTGTCCAAGGTGTTGTTCATCTGCACGGCCAACGTCACTGACACCATCCCCGAGCCACTGCGCGACCGCATGGAGATGATCAACGTGTCCGGCTATGTGGCCCAGGAGAAGCTGGCCATAGCCGAGCGGTACCTGGTGCCCCAGGCACGGGCCCTGTGCGGCCTGGATGAGAGCAGGGCCAGGCTGTCGGCGCCCGTGCTGACGCTGCTCATCAAGCAGTACTGCCGCGAGAGTGGAGTGCGCAACCTGCAGAAGCAGGTGGAGAAGGTGCTTCGAAAGGCGGCCTACAAGATCGTGAGCGGTGAGGCCGAGACGGTGGAGGTGACCCCTGAAAACCTGCAGGACTTCGTGGGCAAGCCGGTGTTCACAGTGGAGCGCATGTACGACGCCACGCCGCCCGGCGTGGTCATGGGCCTGGCCTGGACCGCCTTGGGAGGCTCCACATTGTTTGTTGAGACATCCCTGCGGCGGCCGAGGGACAGGGACAGCAAGGAGAACAAGGACGGCTCACTGGAGGTGACCGGCCAGCTGGGGGATGTGATGAAGGAGAGCGCGCGCATCGCCTACACCTTCGCCAGGGCCTTCCTGCTGCAGCGCGACCCCAGCAACGACTACCTGGTGACCTCACACATCCACCTGCACGTACCAGAGGGCGCCACTCCCAAGGACGGGCCCAGTGCTGGCTGTACCATTGTCACGGCCCTGCTGTCCCTAGCCCTGGACCAGCCTGTGCAGCAGGACCTGGCCATGACAGGCGAGGTGTCCCTCACGGGCAAGATCCTGCCGGTGGGAGGCATCAAGGAGAAGACGATTGCGGTGAGGGTTCCCTGCCACTGCTCCCGTCCTGGGGGTGCCATGGTGACAAGCGAGCCGGGTGCTGTCCCGGCTGCCCCCACCCAGTTCCTATCACCCCACAAGTGCCCACTTGCCTGGGGGGGCCCATATGGGGAGGGCTGCACGGGGTTTTTGGGCAGGGACCCTGAGGCCTCCCCTTGCACTGTAAATGGGGGGTGTTCATGGGGCCAGTGCTTCCTGTCTCTGGAGCTGCCCAGTGCTTGA

XM_004865631.1 Coding sequence

C3 complement component 3

High confidence: 4 potential gene matches
Length: 5010 bp    Location: 3798025..3773816   Strand: -
>XM_004865631.1
ATGGGACCTGCCTCAGGTCCCAGCCTGCTGCTGCTGCTGGCCAGCCTCCCCCTGGCCCTGGGAGACCCTATGTACTCGATCATCACCCCAAACATCCTGAGGCTGGAGAACGAGGAGACCATAGTGTTAGAGGCCCACGAAGTGCAAGGCAACGTTCCGGTCACAGTCACTGTCCACGACTTCCCGGCCAAGAAGCAAGTGCTGTCCAGTGAGAAGACTGTGCTGACCAGTGCCACGGGACACTTGGGCACCGTCACCATCAAGATCCCGTCCAGCAAGGAGTTCCGGTCGGATAAGGGGCACAAGTTCGTGATCGTGCAGGCGGCCTTCGGGGGCACGCAGCTGGAGAAGGTAGTGCTGGTCAGCCTGCAGAGCGGGTACCTCTTCATCCAGACGGACAAGACCATCTACACGCCGGGCTCCACGGTCCTCTATCGGATCTTCACCGTGGACCACGATCTGCTGCCCGTGGGCCGGACTGTCATTGTCATCATCGAGACCCCCGATGGCATCCCTATAAAGCGGGACACCCTGTCTTCCCACAACCAGTATGGCATCTTGCCCTTGTCTTGGAACATCCCGGAGCTGGTCAACATGGGGCAGTGGAAGATCCAGGCCTTCTACGAGCACTCGCCCAAGCAGGTCTTCTCTGCGCAGTTTGAGGTGAAGGAGTATGTGCTGCCCAGCTTTGAGGTCGTGGTGGAGCCTGGAGAGAAATTCTACTACATCGATGACCCCAGGGGCTTGGAGGTCAACATCATGGCTAGGTTCCTGTATGGGAAGAACGTGGACGGAACGGCCTTCGTCATCTTTGGGATCCAGGACGGTGACCAGAGGATCTCCCTGGCGCAGTCCCTCACCCGTGTCGTGATAGAGGACGGCAGCGGGGAGGCCGTGCTGAGCAGGCAGGTGCTGCTGGACGGGGTGCAGCCCTCCAACGCCGCGGCCCTGGTGGGGAAGTCCCTGTACGTGTCGGTCACTGTCATCCTACACTCAGGCAGCGACATGGTGGAGGCTGAGCGCAGCGGGATCCCCATCGTGACCTCCCCCTACCAGATCCACTTCACCAAGACGCCCAAGTACTTCAAGCCGGCCATGCCCTTCGACCTCATGGTGTTCGTGACAAACCCCGATGGCTCCCCGGCCCCCCATGTCCCTGTGGTGATCCAGGGAACCAATGTGCAGTCCCTCACCCAAGACGACGGTGTGGCCAAGCTGAGCATCAACACGCCCAACAACCGGCAGCCCCTGAGCATCACGGTGCGTACAAAGAAGGAGGGCATCCTCGAGGCCCGGCAGGCCACCAACACCATGCAGGCCCTGCCCTACAGCACCATGCACAACTCCAACAACTACCTGCACCTCTCCATGCCGCGCTCCGAGCTCAAGCCTGGCGAGACGATCAATGTCAACTTCCACCTGCGGGCAGACGCCACCCAGGAGGCCAAGATCCGCTACTACACCTACCTGGTGATGAATAAGGGGAAGCTGCTGAAGGCAGGCCGGCAGGCTCGAGAACCCGGCCAGGACCTGGTGGTGCTGCCCCTGACCATCACGAAGGATTTCATCCCGTCCTTCCGCCTGGTGGCTTATTACACGCTCGTGGGCGCCAGCGGCCAGAGAGAGGTGGTGGCCGACTCCGTGTGGGTGGACGTCAAGGACTCTTGTGTGGGCACGCTGGTCGTCAAGGGCGGCGGTGGGAAGGACGGGAAGGAGAAGAGTCAGCACCTGCCTGGGCAGCAGATGACCCTCAGGATAGAGGGCAACCAGGGGGCCCGCGTGGGGCTGGTGGCCGTGGACAAGGGCGTGTTTGTGCTGAACAAGAAGAACAAACTGACTCAGAGTAAGATCTGGGACGTGGTGGAGAAGGCGGACATCGGCTGCACCCCGGGCAGCGGGAAGGACTACGCGGGCGTCTTCGCGGACGCCGGGCTATCCCTGAAGACCAGCAAGGGCCTGCAGACGGCCCAGCGGGGAGACCCCGAGTGCGCCAGGCCCGCCGCGCGCCGCCGCCGCTCCGTGCAGCTCATGGAGAGGAGGAGGGACAAAGCCGGCCAGTACCAGAACAAGGAGCTGCGCAAGTGCTGCGAGGACGGCATGCGCGAGAACCCCATGCAGTTCTCCTGCCAACGCCGCGCGCGCTACGTGGACGTGAGCGCGGGCCTGCGCGAGGCGTGCGTGAAGGCCTTCCTGGACTGCTGCACCTACCTGGCCGAGCTGCGCCGGCAGCGCGCGCGCGACCGCAAGCTGGGCTTGGCGCGGAGCGACCTGGATGAGGACATTATCCCAGAAGAAGACATCATTTCTAGAAGTCAGTTTCCAGAGAGCTGGCTCTGGGCCATAGAGGAGCTGAAGGATCCAGAGAAGAATGGGATCTCCACGAAGACCATGAACATCTTTCTGAAAGACAGCATCACTACTTGGGAGATTCTGGCCGTGAGCTTGTCAGACAAGAAAGGTATCTGCGTAGCCGACCCCTACGAGGTCACTGTGGTGCAGGATTTCTTCATCGACCTGCGGCTGCCCTACTCCGTGGTGCGCAACGAGCAGGTGGAGATCCGCGCCGTGCTCTACAATTACCGCGAGGACCAGAGTCTCAAGGTGAGAGTGGAGCTGCTCCACAACCCGGCCTTCTGCAGCTTGGCCACCGCCAAGAAGCGGCACTACCAGACTGTGACGATCCCGCCCAAGTCCTCTCTGCCGGTGCCCTACGTCATCGTGCCCTTGAAGACCGGCCTGCAGGAGGTGGAGGTCAAGGCCGCCGTCTACAACCACTTCATCAGCGACGGTGTGAAGAAGACCCTCAAGGTCGTGCCGGAAGGAATCAGAGTCAACAAAACAGTGGCCGTTCGCACTCTGGACCCAGAGCACCTGGGCCAAGATGGAGTGCAGAGAGAGGAAGTTCCACCTGCAGACCTCAGCGACCAGGTCCCAGACACTGACTCTGAAACCAGGATTCTCCTCCAAGGGACCCCAGTGGCTCAGATGACCGAGGACGCCGTGGACGGGGAGCGGCTGAAGCACCTGATCGTGACCCCCTCGGGCTGCGGGGAACAGAACATGATCGGCATGACGCCCACGGTGATCGCAGTGCATTACCTGGACCAAACGGAGCAGTGGGAGAAGTTCGGCTTGGAGAAGCGACAGGCGGCCCTGGACCTCATCAAAAAGGGGTACACCCAGCAGCTGGCTTTCAGACAGCCCAGCTCGGCCTACGCAGCCTTCCTGAACCGGAACCCCAGCACTTGGCTGACAGCCTATGTGGTGAAGGTCTTCTCTCTGGCGGTCAACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCTGTGAAATGGCTCATTCTGGAGAAGCAGAAGCCTGATGGAGTCTTCCAGGAGGACGGGCCCGTGATACACCAAGAAATGATTGGCGGCTTCCGGAACACCCAGGAGGCTGAAGTGTCCCTCACCGCCTTCGTGCTCATCGCGCTACAGGAGGCTAAAGAGATCTGCGAAGGGCAGGTCAACAGCCTACCAAACAGCATCAATAAAGCCGGAGATTACATTGCATCCAATTACGCAAACCTGCAGAGACCATACACTGTGGCCATTGCTGGATATGCCCTGGCCCAGCTGGACAAGCTGGGCGGCCCCCTCCTGGTTAAATTTAGGAGTGCGGCCACAGAGAAGAACCGCTGGGAGGAGGCTGGTCAGAAGCTGTACAGTGTGGAAGCCACGTCCTACGCCCTCCTGGCCCTGCTGCTGCTGAGAGACTTTGACTCTGTGCCTCCCGTTGCGCGCTGGCTCAATGAGCAGAGATATTATGGCGGCGGCTATGGCTCCACCCAGGCCACCTTCATGGTGTTCCAAGCCTTGGCCCAATACCAAACAGACATTCCTGACCACAAGGACCTGAACATGGAGGTGGCCCTGCAGCTGCCCAGCCGCAGCTCCCTGGTCAAGCATCGCCTCCTCTGGGACATAGGCGGCCTCCTCCGGTCAGAAGAGACCAAGCAAAACGAGGGTTTCACATTAACAGCTAAAGGGAAAGGTCAAGGCACGTTGTCGGTGGTGACGATGTACCACGCCAAAGTCAAAGGCAAAGTCACCTGCAAGAAGTTTGACCTCAGGGTCACAGTCAGTCCAGCCCCTGATACAGTCAAGAAGCCTCAGGATGCCAAGAGCACCATGATCCTTGGGATCTGCGCTAAGTACCTAGGAGACCAGGATGCCACAATGTCCATCCTGGACATAGCCATGATGACCGGCTTCGTTCCTGACACAGATGACCTCAAGCTGCTGTCCACCGGCGTGGACAGATACATCTCCAAGTATGAGCTGGACAAAGCCTTCGCCAACAAGAACACCCTCATCATCTACCTGGACAAGCTCTCGCACTCCGAGGAAGAATGTCTGTCCTTCAAAATCCACCAGTTCTTCAATGTGGGGCTCATCCAGCCTGGCTCTGTCAAAGTCTACTCCTACTACAACCTCGATGAGACCTGCACCCGGTTCTACCACCCGGAGAAGGAGGACGGGATGCTGAGCAAGCTGTGCCACAAGGACTTGTGCCGCTGCGCAGAGGAAAACTGCTTCATGCACCAGGCGGATGAGAAGGTCACCCTGGATGAGCGCCTAGAAAAAGCCTGCGAGCCAGGGGTGGACTACGTGTACAAAACCAAGCTGGTCAAGATGGAGCTGTCCGACGATTTCGACGAATACATAATGACGATTGAACAGGTCATCAAGTCAGGCTCCGATGAGGTGCAGGCTGGGCAGGAGCGCAGGTTCATCAGCCACGTCAAGTGCAGAGACGCCCTGCGCCTGAAGGACGGGAAGCACTACCTCATGTGGGGCGTCTCCTCCGACCTGTGGGGAGAGAAACCCAACATCAGTTACATCATCGGGAAGGATACCTGGGTGGAGCTGTGGCCCGAGGCGGAAGAATGCCAAGACGAGGAGAACCAGAAGCAGTGCCAGGAGCTGGGCGCCTTCACGGAGAGCATGGTGGTCTTTGGATGCCCCAACTGA

XM_004866073.1 Coding sequence

Dapk3 death-associated protein kinase 3

High confidence: 4 potential gene matches
Length: 1455 bp    Location: 5616839..5626293   Strand: +
>XM_004866073.1
ATGGGCATTGGCCTGGCACATGGTGGCCCCCCAGCCATCGTCCTGAACCCCAACACAGACAGACTCTTCCCAGCAGGAGTCCAGAGCTATGAGGACAGTTTGTTCCTGAGACAGGCTCTCTCACTCCCCTCCCCTCCGCTTTGTCCCCTCAGTGGCCAGTTCGCCATCGTGAGGAAGTGCCGGCAGAAAGGCACAGGCAAGGGGTACGCTGCCAAGTTCATCAAGAAGCGGCGGCTGTCATCCAGCCGGCGTGGGGTGAGCCGGGAGGAGATCGAGCGCGAGGTGAGCATCCTGCGGGAGATCCGGCACCCCAACATCATCACACTGCACGATGTCTTTGAGAACAAGACAGACGTGGTGCTCATCCTTGAGCTGGTCTCGGGCGGCGAGCTCTTTGACTTTCTGGCTGAGAAGGAGTCGCTGACCGAGGATGAGGCCACGCAGTTCCTCAAGCAGATTCTGGACGGAGTCCACTACCTGCACTCCAAGCGCATCGCCCACTTCGACCTCAAGCCAGAGAACATCATGCTTCTGGACAAGAATGTGCCCAGCCCACGCATCAAGCTCATCGACTTTGGCATCGCCCACAAGATTGAGGCGGGCAATGAGTTCAAGAACATCTTCGGCACCCCCGAGTTTGTGGCTCCTGAGATCGTCAACTATGAGCCACTGGGCCTGGAGGCGGACATGTGGAGCATCGGTGTCATCACCTACATCCTTCTCAGCGGGGCGTCCCCGTTCCTGGGCGAGACCAAGCAGGAGACGCTGACTAACATCTCGGCTGTGAACTACGACTTCGATGAGGAGTACTTCAGCAGCACCAGCGAGCTGGCCAAGGACTTCATCCGGCGCCTGCTGGTCAAGGACCCCAAGAGGAGAATGACCATCGCCCAGAGCCTGGAGCATTCCTGGATCAAGGCCATCCGGCGGCGGAACGTGCGCAGCGAGGACAGCGGGCGGAAGCCGGAGCGGCGGCGCCTGAAGACCACGCGGCTGAAGGAGTACACCATCAAGTCGCATTCCAGCATGCCGCCCAACAACAGCTACGCCAGCTTTGAGCGCTTCTCCCGCGTGCTGGAGGAGGTGGCGGCGGCTGAGGAGGGCCTGCGCGAGCTGGAGCGCAGTCGGCGGCTGTGCCGCGAGGATGTGGAGGCGCTGGCAGCCATCTACGAGGAGAAGGAGGCCTGGTACACGGAGGAGCGCGACAGCATCGGCCAGGACCTGCGGCGGCTGCGTCAGGAGCTGCACAAGACCGAGGCTCTGCAGCGGCAGGCGCAGGAGGAAGCCAAGGGCACACTGCTGGGTGCCAGCGGGCTCAAGCGCCGCTTCAGCCGTCTAGAGAACCGCTACGAGGCGCTGGCCAAGCAGGTGGCGTCGGAGATGCGCTTTGTGCAGGAGCTGGTGCGGGCGCTGGAGCAGGAGCGGCTGCAGGGTGGGGAGTGCGGCCTGCGCTAG

XM_004865802.1 Coding sequence

Nfic nuclear factor I/C (CCAAT-binding transcription factor), transcript variant X4

Length: 1563 bp    Location: 5946462..5897009   Strand: -
>XM_004865802.1
ATGGATGAGTTCCACCCGTTCATCGAGGCGCTGCTGCCGCATGTGCGCGCCTTCGCCTACACCTGGTTCAACCTGCAGGCGCGGAAGCGTAAGTACTTCAAGAAGCATGAGAAGCGGATGTCCAAGGACGAGGAGCGGGCCGTGAAGGACGAGCTGCTGGGCGAGAAGGCCGAGGTGAAGCAGAAGTGGGCGTCGCGGCTGCTGGCCAAGCTGCGCAAGGACATCCGGCCCGAGTGCCGCGAGGACTTCGTGCTGGCCATCACGGGCAAGAAGGCGCCGGGCTGCGTGCTGTCCAACCCCGACCAGAAGGGCAAGATGCGGCGCATCGACTGCCTGCGCCAGGCCGACAAGGTGTGGCGCCTCGACCTGGTCATGGTCATCCTGTTCAAGGGCATCCCGCTCGAGAGCACGGACGGCGAGCGGCTGGTGAAGGCTGCGCAGTGCGGCCACCCGGTGCTCTGCGTGCAGCCGCACCACATCGGCGTGGCCGTCAAGGAGCTGGACCTCTACCTGGCCTACTTCGTGCGCGAGCGAGATGCCGAGCAGAGCAGCAGTCCCCGGGCGGGGATGGGCTCGGAGCAGGAAGACAGCAAGCCCATCACGCTGGACACAACTGACTTCCAGGAGAGCTTTGTCACCTCCGGCGTGTTCAGTGTCACCGAACTCATCCAAGTGTCTCGGACACCGGTGGTGACCGGAACAGGTCCCAACTTCTCTCTGGGAGAGCTGCAGGGGCACTTGGCCTACGACCTGAATCCAGCCAGTACCGGCATGAGAAGAACGCTCCCCAGCACCTCTTCCAGCGGGAGCAAGAGGCACAAATCGGGCTCCATGGAGGAAGACGTGGACACGAGCCCTGGCGGAGACTACTACACTTCTCCCAGTTCTCCCACGAGTAGCAGCCGCAACTGGACGGAGGACATGGAAGGAGGCATCTCCTCCCCAGTGAAGAAGACGGAGATGGACAAGTCCCCATTCAACAGCCCATCCCCCCAGGACTCGCCCCGCCTCTCCAGCTTCACCCAGCACCACCGGCCTGTCATCGCAGTGCACAGCGGGATCACCCGGAGTCCCCACCCGCCCTCCGCCCTGCACTTCCCCACGACCTCCATCCTGCCCCAGACGGCCTCCACCTACTTCCCGCACACAGCCATCCGCTACCCACCCCACCTCAACCCCCAGGACCCACTCAAAGATCTCGTCTCGCTGGCCTGCGACCCGGCCAGCCAGCAGCCCGGACCGTTAAACGGAAGTGGCCAGCTCAAAATGTCCAGTTACTGCGTCCCCACCTCGATGCTGGCCCCTCCGCCCCTGGCGCTGTCCCCGGCTACCAAACCCACTGCCACCTCCCAGCGACGAGCCACACCGCAGATCTCGCCCACCTACGCTCCGCCCGACACGCCCCCTGCAAACCGTTCCTTTGTGGGATTAGGACCAAGGGATCCTGCGGGCATTTATCAGGCACAGGTAGGGGCCAAGAGGCCGGCTGGCGGGGGTGGGGGGCAGGGCAGAGGGGCCAGCCTGGGGGGCCGAGTCACAGCCCATGCCCAGGGCTTCCCCTAG

XM_004865803.1 Coding sequence

Nfic nuclear factor I/C (CCAAT-binding transcription factor), transcript variant X5

Length: 1512 bp    Location: 5940011..5897009   Strand: -
>XM_004865803.1
ATGTATTCGTCCCCGCTGTGTCTGACCCAGGATGAGTTCCACCCGTTCATCGAGGCGCTGCTGCCGCATGTGCGCGCCTTCGCCTACACCTGGTTCAACCTGCAGGCGCGGAAGCGTAAGTACTTCAAGAAGCATGAGAAGCGGATGTCCAAGGACGAGGAGCGGGCCGTGAAGGACGAGCTGCTGGGCGAGAAGGCCGAGGTGAAGCAGAAGTGGGCGTCGCGGCTGCTGGCCAAGCTGCGCAAGGACATCCGGCCCGAGTGCCGCGAGGACTTCGTGCTGGCCATCACGGGCAAGAAGGCGCCGGGCTGCGTGCTGTCCAACCCCGACCAGAAGGGCAAGATGCGGCGCATCGACTGCCTGCGCCAGGCCGACAAGGTGTGGCGCCTCGACCTGGTCATGGTCATCCTGTTCAAGGGCATCCCGCTCGAGAGCACGGACGGCGAGCGGCTGGTGAAGGCTGCGCAGTGCGGCCACCCGGTGCTCTGCGTGCAGCCGCACCACATCGGCGTGGCCGTCAAGGAGCTGGACCTCTACCTGGCCTACTTCGTGCGCGAGCGAGATGCCGAGCAGAGCAGCAGTCCCCGGGCGGGGATGGGCTCGGAGCAGGAAGACAGCAAGCCCATCACGCTGGACACAACTGACTTCCAGGAGAGCTTTGTCACCTCCGGCGTGTTCAGTGTCACCGAACTCATCCAAGTGTCTCGGACACCGGTGGTGACCGGAACAGGTCCCAACTTCTCTCTGGGAGAGCTGCAGGGGCACTTGGCCTACGACCTGAATCCAGCCAGTACCGGCATGAGAAGAACGCTCCCCAGCACCTCTTCCAGCGGGAGCAAGAGGCACAAATCGGGCTCCATGGAGGAAGACGTGGACACGAGCCCTGGCGGAGACTACTACACTTCTCCCAGTTCTCCCACGAGTAGCAGCCGCAACTGGACGGAGGACATGGAAGGAGGCATCTCCTCCCCAGTGAAGAAGACGGAGATGGACAAGTCCCCATTCAACAGCCCATCCCCCCAGGACTCGCCCCGCCTCTCCAGCTTCACCCAGCACCACCGGCCTGTCATCGCAGTGCACAGCGGGATCACCCGGAGTCCCCACCCGCCCTCCGCCCTGCACTTCCCCACGACCTCCATCCTGCCCCAGACGGCCTCCACCTACTTCCCGCACACAGCCATCCGCTACCCACCCCACCTCAACCCCCAGGACCCACTCAAAGATCTCGTCTCGCTGGCCTGCGACCCGGCCAGCCAGCAGCCCGGACCGTTAAACGGAAGTGGCCAGCTCAAAATGTCCAGTTACTGCGTCCCCACCTCGATGCTGGCCCCTCCGCCCCTGGCGCTGTCCCCGGCTACCAAACCCACTGCCACCTCCCAGCGACGAGCCACACCGCAGATCTCGCCCACCTACGCTCCGCCCGACACGCCCCCTGCAAACCGTTCCTTTGTGGGATTAGGACCAAGGGATCCTGCGGGCATTTATCAGGCACAGTCCTGGTACCTGGGGTAG

XM_004865390.1 Coding sequence

Timm44 translocase of inner mitochondrial membrane 44 homolog (yeast), transcript variant X2

High confidence: 4 potential gene matches
Length: 1359 bp    Location: 901862..888983   Strand: -
>XM_004865390.1
ATGGCGGGGGTGGCCTTGCGCGGCGGCTGGTGCCGCTGTCCGCGGAGATGCCTTGGGAGTGGAGTCCAGTTACTTTCCAGCCACAGCCTACCCCATGGCTCAGCCTATCAGATACACCGGCCAGGCGGTGAGCTGCTATTGCCCAGATCATATTCTTCCGGAAACAGAAAAGGCTTTCTGTCCGGCTTGCTCGACAACATCAAACAAGAATTAGCCAAAAACAAGGAGATGAAAGAAAGTATTAAAAAATTCCGAGAGGAGGCCAAGAAGCTGGAAGAGTCGGACGCACTCCAGGAAGCCCGAAGGAAATACAAAACCATCGAGTCGGAGACTGCGCGCACCAGTGAGGCCATCAGGAGGAAGCTGGGGGAGCTGACAGGGACGGTGAAGGAGAGTCTCGACGGAGTCGGTAAGAGCGACCTCGGCCGGAAGATCAAGGAAGGGGTGGAGGAGGCTGCCAGGACGGCCAAGCACTCGGCCGAGTCCGTGTCCAAGGGCGGGGAGAGGCTGGGCCGGACAGCGGCCTTCAAAGCCATCTCCCAGGGCGTGGAGTCTGTGAAGAAGGAGATCCATGAGAGTGCGCTGGGCCAGGCGGGGCCCTACCGAAGGCCCGCGCGGCTCAGGAAAAGGACCGAGTTCGAGGGAGAGAAGTTCCAAGAAGAGAAAGTGTTCGAGCCCAACGAGGAGGCCCTGGGGGTTGTGCTGCACAAGGACTCCAAGTGGTACCAGCAGTGGAAGGACTTCCGGGACAGCAACGTGGTGTTCAACCGCTTCTTCGAGATGAAGATGAAGTATGATGAGAGTGACAATGTGCTCATCCGGGCGTCCCGGGCCCTGACGGACAAGGTCACCAACGTGCTGGGGGGCCTGTTCTCCAAGACGGAAATGTCAGAGGTGCTCACGGAGATCCTTCGAGTGGACCCGGCCTTCGACAAGGACCGGTTTCTGAAGCAGTGCGAGAGTGACATCATCCCCAATATCCTGGAGGCCATGATTTCTGGAGAGCTCGACATTCTCAAAGACTGGTGCTATGAAGCTACCTACAGCCAGCTGGCCCACCCGATCCAGCAGGCCAAGGCCCTGGGCCTCCAGTTCCACTCCCGCATCCTCGACATTGACAACATCGACCTGGCCATGGGGAAGATGATGGAGCAGGGGCCAGTGCTGATCATCACCTTCCAGGCCCAGCTGGTGATGGTGATCCGGAACCCCAAGGGCGAGGTGGTCGAGGGCGACCCGGACAAGGTGCTGCGCATGGTGTACGTGTGGGCGCTGTGCCGTGACCAGGAAGAGCTGAACCCCTACGCAGCCTGGCGCCTCCTGGACATCTCCGCCTCCAGCACGGAGCAGATCCTCTGA

XM_004865337.1 Coding sequence

Mcoln1 mucolipin 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1746 bp    Location: 634378..643406   Strand: +
>XM_004865337.1
ATGGCAGCCCCTGGGGGCCGGCGTGGCTCAGAGACGGAGCGCCTCCTGACCCCCAGCCTTGGGTATGGGACCCAGGCGGGGGCGCCGCTGGCCCCTCCGACGCCTCCAGAAGAGGAAGACCTTCGCCGCCGGCTCAAGTACTTTTTTATGAGTCCCTGTGACAAGTTCCGGGCCAAGGGCCGCAAGCCATGCAAGCTGATGCTGCAGGTGGTCAAGATCCTGGTGGTCACTGTGCAGCTCATCCTGTTCGGGCTCAGCAACCAGCTGGCGGTGACCTTCCGGGAAGAGAACACCATTGCCTTCCGCCACCTCTTCCTGCTGGGCTACTCGGATGGGGCGGATGACACCTTGGCAGCCTACACGCGGGAGGAGCTGTACCAGGCCATCTTCTACGCTGTGGACCAGTACCTGACGCTGCCGGAGGTGTCGCTGGGCCGCTATGCCTACGTCCGGGGTGGAGGTGGCCCATGGGCCAACGGCTCGGCCCTGGCTCTCTGCCAGCGGTACTACCACCGCGGCCACGTGGACCCGGCCAATGACACCTTTGACATTGACCCTACAGTTGTCACTGACTGTATCCAGGTGGATCCCCCAGAGAGACCCCCTGTACCCCCAAGCGATGCTCTCACCCTCTTAGAGGACGGCAGCTCCAGTTACAAGAACCTGACGCTCAAATTCCACAAGCTGATCAACGTCACCATCCACTTCCAGCTGAAGACCATCAACCTGCAGAGCCTGGTCAACAACGAGATCCCCGACTGCTACACCTTCACCGTCCTGATCATGTTTGACAACACAGCACACAGCGGGCGGATCCCCATCCGCCTGGAGACCCAGGCCCACATCCAGGAGTGTAAGCACACCAGCATCTCCAGGCACGAAGACAACAGTTTCCGGCTGCTGTTCGATGTGGTGGTCATCCTCACCTGCTCGCTGTCTTTCCTGCTGTGCGCCCGCTCGCTGCTCCGTGGCTTCCTGCTGCAGAAGGAGTTCGTGGGGTTCGTGTGGCAGCAGCGGGGACGCGTGATCAGCCTGTGGGAGCGGCTGGAGTTCGTCAATGGCTGGTACATCCTGCTGGTCACCAGCGACGTGCTCACCATCTCTGGTACCGTCATGAAGATCGGCATCGAGGCCAAGAATCTGGCCAGCTACGACGTCTGCAGCATTCTCCTGGGCACCTCCACGCTGCTGGTCTGGGTGGGCGTCATCCGCTACCTGACCTTCTTCCACAAGTACAACATTCTCATCGCCACGCTGCGGGTGGCACTGCCCAGCGTGATGCGCTTCTGCTGCTGTGTGGCTGTCATCTACCTGGGCTACTGCTTCTGCGGCTGGATCGTGTTGGGGCCCTACCACGTGAAGTTCCGCTCGCTGTCTATGGTGTCCGAGTGCCTCTTCTCACTCATCAATGGGGACGACATGTTCGTGACGTTCGCGGCCATGCAGGCTCAGCAGGGCCGCAGCAGCCTGGTGTGGCTCTTCTCCCAGCTCTACCTCTACTCCTTCATCAGCCTCTTCATCTACATGGTGCTCAGCCTCTTCATCGCGCTCATCACTGGCGCCTACGACACCATCAAGCACCCTGACGGTGCAGGCGCAGAGAAGAGTGAGCTCCAGGCTTACATTGCACAGTGTCAGGACAGCCCCACCTCCGGCAAGTTCCGCCGTGGGAGCGGCTCAGCCTGCAGCTTGCTGTGCTGCTGCGGAAGGGAGGCCTCGGAGGACCATTCGCTGCTGGTGAATTGA

XM_004865300.1 Coding sequence

Znf317 zinc finger protein 317, transcript variant X1

Length: 1830 bp    Location: 161226..153899   Strand: -
>XM_004865300.1
ATGTGCACACTCACAGTCGGTGGGGGGGCAACTGTTTCTCATGGCTCTTCTTCTCTAGCTGTGTCCACCCAGGACCCTGCCTGTCTCCAAGAGTCAGAATTCCCTCTTTCTTCAACTCACCATTCCTGTTCCCAGGACTTAAACCTGTTTGTGTGGCATGGTCTGGAGCCTCTCCCAGGAGCCAGAGATTCTAATCAGGAATCTGTGACTTTCCAGGACGTGGCTGTGGACTTCACTGAGAAGGAGTGGCCCCTCCTGGATCCCTCTCAGCGGAAACTGTACAGAGACGTGATGCTGGAGAACTACAGCAACCTGACCTCCCTGGGGTATCAGGTTGGAAAACCCAGCCTCATCTCTCACTTGGAGCAAGAAGAGGAGCCCAGGATGGAGGAGAGGGGGACTCAGCAAGGGGCTTGTCCAGATTGGGAAACTCCATCTAAAACCAAGTGGTCGATTCTCATGGAAGATATATTTGGGAAGGAAACATCTGGTGGTGTGACCATGGCACAGGACAGAGCTCGCCTTGGGGAGAAGTCGGCCGAATATGAGCGCTTGTTTGACGTCTTCAGCATGGGTGCTCACCTTTCGCAGCAGCTGGGAAGGCAAGCAGGCAAGAGGCCCTTTCCCCGCCACAGCTACGGCGTGGCCTTCAAAGCCCGGGCGCCCCTCTCGCAGCGCGGGGCCGCCTACGACGGGCGGAAGATGCACGAGTGCCACCAGTGCCAGAAAGCCTTCACCACCAGCGCCTCCCTCACGCGGCACCGGAGGATCCACACCGGGGAGAAGCCCTACGCGTGCCGGGACTGCGGCAAGGCCTTCAACGACCCGTCGGCCCTCCGGAGCCACGCGCGGACCCACCTCAAGGAGAAGCCCTTCGACTGCAGCCAGTGTGGCAGCGCCTTCCGCACGCTGTCGGCCCTGAAGATCCACACGCGGGTGCACACCGGCGAGCGGCCCTACAAGTGCGACGAGTGCGGCAAGGCCTACGGCCGGAGCTGCCACCTGATAGCGCACAAGCGCACGCACACCGGGGAGCGGCCCTACGAGTGCCAGGACTGCGGCAAGGCCTTCCAGCACCCCTCGCACCTGAAGGAGCACGTGCGCAACCACACCGGGGAGAAGCCCTACGCCTGCGCGTTGTGCGGCAAGGCCTTCCGCTGGAAGTCCAACTTCAACCTGCACAAGAAGAACCACGCCGTGCAGAAGACCTACGCCTGCAAGGAGTGCGGCAAGGCCTTCGGGGACCTGGTGTCGCGCCGGAAGCACACGCGGACTCACCTGGTGAGGAAGCCCGTGGAGTGCCGCCAGTGCGGGAAGGCCTTCCGCAACCAGTCCATCCTGAAGACCCACATGAACTCGCACACCGGCGAGAAGCCCTACGCCTGCGACCTGTGCGGCAAGGCCTTCAGCGCCAGCTCCAACCTCACCGCGCACCGGAAGATCCACACGCAGGAGCGGCGCTATGAGTGTGCGGCCTGCGGCAAGGTCTTCGGCGACTACCTGTCCCGCAGGAGGCACATGAGCGTGCACCTGGTGAAGAAGCGCGTGGAGTGCCGGCAGTGCGGCAAGGCCTTCCGCAACCAGTCCACGCTCAAGACGCACATGCGGAGCCACACGGGGGAGAAGCCCTACGAGTGTGACCACTGTGGCAAGGCCTTCAGCATCGGCTCCAACCTCAACGTGCACCGGCGGATCCACACGGGCGAGAAGCCCTACGAGTGCCTGGCCTGTGGGAAGGCCTTCAGCGACCACTCCTCCCTGCGCAGTCACGTGAAAACCCACCGCGGGGAGAAGCTCTTCACCTCCTCCGTGTGGAGGAGGCTGCAGTGA

XM_004865313.1 Coding sequence

LOC101720271 WAS protein family homolog 1-like, transcript variant X5

Length: 1464 bp    Location: 249068..269341   Strand: +
>XM_004865313.1
ATGGCCATGGTGAGGACCCAGCACTCCTTGGCCGGCCAGACCTACGCTGTCCCTCTCATCCAGCCAGACCTGCGGCGAGAGGAAGCCATGCAGCAGGTGGCTGATGCCCTGCAGTACCTGCAGAAGGTCTCAGGAGACATCTTCAGCAGGATCTCCCAGCGCGTGGAGCTGAGCCGCAGCCAGCTGCAGGTCGTTGGGGAGAGGATCTCCTTGGCCCAGGCCAAGATTGAGAAGATCAAGGGCAGCAAGAAGGCCATCAAGGTGTTCTCCAGCGCCAAGTATCCGGCTCCTGAGCGCCTGCAGGAGTACAGCTCCATCTTCGCCGGTGCGCAGGACCCAGGCCTACAGCGACGGCCACGCCATCGCATCCAGAGCAAGCACCGGCCGCTGGATGAGCGGGCCCTACAGGAGAAGCTGAAGTATTTCCCCGTGTGTGTGAGCACCAAGCCGGAGCCCGAGGATGAGACCGAGGAGGGGCTCGGGGGTCTCCCCAGCAACATCAGCTCTGTCAGCTCCCTGCTGCTGTTCAACACCACAGAGAACCTGTACAAGAAGTACGTCTTCCTGGACCCCCTGGCGGGGGCTGTCACAAAAACCCACCTGACGCTGGGGACAGAAACGGAGGAGAAGCTGTTTGATGCCCCTCTGTCCATCAGCAAGCGAGAGCAGCTGGAGCAGCAGGTTCCAGAGAACTACTTCTATGTCCCAGACCTGGGCCAGGTGCCCGAGATCGATGTGCCATCCTACCTGCCGGACCTGCCCGGCATCGCCGATGACCTCATGTACAGCGCTGACCTGGGCCCAGGCATCGCCCCCTCTGCCCCTGGCACCATCCCTGAGCTGCCCACCTTCCAGACAGAGGTGGCGGAGCCCTGCAGGCCAGACCTAGAGGGCGGGGGTCTCACAGCACCTCCGCCGCCTCCGCCGCCTCCGCCACCGCCGCCAGCGCCTGCAGTGCCAGCCAGCGTACCCCCAGGCCTGCCCCCCCAGAGTGCAGCCTTGACCATCCCAGGACCCCCAGAAGACCCCAGCAGCACCCCTCCTTCAGCAGCACTCCAGGGGGCTCCCAAGGAGGTGGTGCTCCCCTCCAGTGGCCGGGCCACCCTGCTGGAGTCCATCCGCCAAGCTGGGGGCATCGGCAAGGCCAAGCTGCGCAGCGTCAAAGAGCGCAAGCTGGAGAAGAAGAAGCAGAAGGAGCAGGAGCAAGTGAGAGCCACGAGCCAGGGCGGGGACCTGATGTCGGATCTCTTTAACAAGCTGGTCATGAGGCGCAAAGCAGGCCCCGGGAGAGGAGGACGAGGACGACTGGGAGTCCTAGGGGCCCGGCGCCCGAGCCCTCCCACACCCCTGAGCCCTGGCTCTGGCTGTGCAGCAGGAACCAGCAGGGAGCTGGGGCTTCCCGGTGCCGTGCCTGGGCCTTGCCTGAGTGGTGCCGCCCCACCACAGCGCCGCTGTCCTCACTAA

XM_004865311.1 Coding sequence

LOC101720271 WAS protein family homolog 1-like, transcript variant X3

Length: 1725 bp    Location: 261848..269341   Strand: +
>XM_004865311.1
ATGGCCATGGTGAGGACCCAGCACTCCTTGGCCGGCCAGACCTACGCTGTCCCTCTCATCCAGCCAGACCTGCGGCGAGAGGAAGCCATGCAGCAGGTGGCTGATGCCCTGCAGTACCTGCAGAAGGTCTCAGGAGACATCTTCAGCAGGATCTCCCAGCGCGTGGAGCTGAGCCGCAGCCAGCTGCAGGTCGTTGGGGAGAGGATCTCCTTGGCCCAGGCCAAGATTGAGAAGATCAAGGGCAGCAAGAAGGCCATCAAGGTGTTCTCCAGCGCCAAGTATCCGGCTCCTGAGCGCCTGCAGGAGTACAGCTCCATCTTCGCCGGTGCGCAGGACCCAGGCCTACAGCGACGGCCACGCCATCGCATCCAGAGCAAGCACCGGCCGCTGGATGAGCGGGCCCTACAGGAGAAGCTGAAGTATTTCCCCGTGTGTGTGAGCACCAAGCCGGAGCCCGAGGATGAGACCGAGGAGGGGCTCGGGGGTCTCCCCAGCAACATCAGCTCTGTCAGCTCCCTGCTGCTGTTCAACACCACAGAGAACCTGTACAAGAAGTACGTCTTCCTGGACCCCCTGGCGGGGGCTGTCACAAAAACCCACCTGACGCTGGGGACAGAAACGGAGGAGAAGCTGTTTGATGCCCCTCTGTCCATCAGCAAGCGAGAGCAGCTGGAGCAGCAGGTTCCAGAGAACTACTTCTATGTCCCAGACCTGGGCCAGGTGCCCGAGATCGATGTGCCATCCTACCTGCCGGACCTGCCCGGCATCGCCGATGACCTCATGTACAGCGCTGACCTGGGCCCAGGCATCGCCCCCTCTGCCCCTGGCACCATCCCTGAGCTGCCCACCTTCCAGACAGAGGTGGCGGAGCCCTGCAGGCCAGACCTAGAGGGCGGGGGTCTCACAGCACCTCCGCCGCCTCCGCCGCCTCCGCCACCGCCGCCAGCGCCTGCAGTGCCAGCCAGCGTACCCCCAGGCCTGCCCCCCCAGAGTGCAGCCTTGACCATCCCAGGACCCCCAGAAGACCCCAGCAGCACCCCTCCTTCAGCAGCACTCCAGGGGGCTCCCAAGGAGGTGGTGCTCCCCTCCAGTGGCCGGGCCACCCTGCTGGAGTCCATCCGCCAAGCTGGGGGCATCGGCAAGGCCAAGCTGCGCAGCGTCAAAGAGCGCAAGCTGGAGAAGAAGAAGCAGAAGGAGCAGGAGCAAGTGAGAGCCACGAGCCAGGGCGGGGACCTGATGTCGGATCTCTTTAACAAGCTGGTCATGAGGCGCAAAGGTACGAGGGGACACGCAGCTCCCTGGGGGACCTGGGGTATTCTGCACATCCTGTCTCCAGGAGCGGGCAAACCTGTGCCCAACCAACCCCACTTAACAGCCCTTCCCTCCCAGGCATCTCTGGGAAAGGACCAGGGACAGCAGCCAGCGAGGGCCCGGGAGGAGCCTTCGCCCGCATGTCAGACTCCATCCCGCCTCTGCCGCCCCCACAGCAGGCCCCGGGAGAGGAGGACGAGGACGACTGGGAGTCCTAGGGGCCCGGCGCCCGAGCCCTCCCACACCCCTGAGCCCTGGCTCTGGCTGTGCAGCAGGAACCAGCAGGGAGCTGGGGCTTCCCGGTGCCGTGCCTGGGCCTTGCCTGAGTGGTGCCGCCCCACCACAGCGCCGCTGTCCTCACTAAAGAGGTTGGAGAGGAAATCACTGATGCACCAGGAATCAATAAAGAGGTGA

XM_004865319.1 Coding sequence

Pex11g peroxisomal biogenesis factor 11 gamma, transcript variant X1

High confidence: 4 potential gene matches
Length: 726 bp    Location: 612087..606360   Strand: -
>XM_004865319.1
ATGGCGGTAGTGAGCAACCTGGCTTCGGCGCTGGAGTCATACAGGGGTCGGGACCGCCTGATCCGAATGCTGGGGTACTGCTGCCAGCTGGTTGGTGGGGTCCTGCTCCAACAAGGTCCTGCCAGGTCGGAGGTGGGGACGCGCCTGCTGGTGGTGTCGGCCCAGCTGAGCCACTGCAGGACTGTCCTTCGACTCTTTGATGACCTGGCCATGTTTCTGTACACAAAGCAGTATGGCCTGGGGACAGAGGAGGAGGACGCCTTGGTGCGCTGCCTGTCGGTGCTGGGCAACATGGCCGACCAGCTCTACTACCCCTGTGAGCACATCGCCTGGGCCGCCGACGCCCAGGTCCTGCACGTGGACTCTACCCGGTGGTGGACGCTGAGCACAGCTCTCTGGGGCCTCTCCTTGCTCCTGGGGGCGGCCAGGTCCCTGTGGATGGTGCTGAAGCTGAGGCAGAGGCTACAAGGCCCCACAGCTGCCTTCACCAGCCGGCTGCCCCGGAGCAAGCGGAGGGCCATGGAGGCGCAGATTCGGTCGGAGGTGCTGACGCTGCTCAGCAACCTGGCTGACCTGGCCAACGCTGTGCACTGGCTGCCCCCGGGCATGCTGTGGGCCGGCTGCTTCCCCCCGTGGCTGGTGGGCCTCATGGGCACCATCTCCTCCCTGCTCAGCCTCTACCAGGTGGCCCAGGTCGGTGGCCAGGCCAAGGCTGACAGCTCCTGA

XM_004866040.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1494 bp    Location: 620181..625233   Strand: +
>XM_004866040.1
ATGGCCGCGAGCCCCCTCCCGCCGTGCCCGGCGTCCCGGATGGACTTTCTCAAGGCCTGGCGTTTCGCGCTGGGCCCGGACCCGCGGCTGCACCAGGGCACCCAGCGCTCCACGACGCACCGGGACTTCCCCTCCCACGGCCCCAACGCGCGAGCACAGCGGGTCCCGCAACTGCCGAGCGCTCAGCTCTTCCAGCAGGACCCTGGAGGGTCGGCCGAGGAGCGCGTGTCGGAGGCGCGCCGCGCGTTCACGCCGCCAGCGAAGGCCGAGGGCCCGCAGGGACGCAAGGCCGCCACGCGCCACCGCAGCCTGAGCTTGTACGCGGGCGCGCGGGCTGGGCCCGGCATCTCCAGCACGCGCGCCGCCTACCGCTGGCCCGAGGTGCAGGCGCGCGCCGGGGAGCGGATCGGAGGCGCGCGCCTCATCTTTGACCTGGACTCGGTGCCGCCTGGCGACAAGGACAAGCTGCGCGTGCCCCCCACCGCGTACCGCACGTTCTTTCCGCCCCACGACGCGAGCCCGCAGCCCCGCGCGCACTGCTGCCATCTGGGGGGTGCCAATACCCTCAGGTGGGACTACAAGGGACAGAAAGAGAACTCCTACAAGAGACAATTCCAGGCCCTGCTGGGCCCACCTGCCTCTATGTGTAAGAGGGCGACTTTCTCTGTGCCCCTAGGAGATTGCCAGACTGGGTATGGCCCAGTGTACTCAGAGCTGAAACAGACCCATGCACCCCAAGGCCTGCCCCCGGACAGGTATGACAAGGCCCAGGCAGCCGCTCACATCCACTGTGTCAGTATCCCACCTGGAGACAGCCTCTTCCACGGCAGCACTACGGTGACCGACCACTTCTATGCGTGGGACCCAGAGCCTTTCCTTCTTCACCATGATCAGACTCCAGAATCGCACATCCTGAAAGGAAACTGGTGTCCTGGCCCCGGAAGCCTTACAACCTCCATGCAGGATTTCTATGGCCAGCCACCGCCTCCGACCCAGCCAACCAGACGCCACATGACCCATGAGAAATGGCAGGGTCACGTGACCCTGGGAGAGCCAAAGCTGCTGGGACACGTCTTCCAAAGCACCATGCACTCAGCCTACTGTGCCCGGGACGGAGGGAAGCCACCGAAGGCACTCAGCCTCCACTTCACAGGGACCGACCTGCCTCAGGGCAGCGGCGAATTCGACTTTTCAACCACTAACCAGACGATGCTGAAGCCGCACGGAACAGCCGGAGCGCGCAAGACTCCAGAGTTGCCGCGGAGGTGTAAGTACATCCACCTGGAGTTCCCGCTGGGGAGACAGCGCTTCTTCTCCACCCACTACAAGGAGGAGTTTCCCTGCAGGTACCAGGGCCCCGCAGTACTGAGACTAAGCAACGCCCAGGAGAGCTACGTGCCGCTGGGCATGCCTCGCCATCGGGGCTGCCCGAGAGGGGCGATAGACCCTCAGGCTTCCCAGCTCCCTTTGTACCCTTGCTCCAGCCAGCAATAA

XM_004865322.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X1

Length: 4770 bp    Location: 643471..664665   Strand: +
>XM_004865322.1
ATGCAGAGGCCAGGGAGGGGACCGCCTACTGGAAGGGGCCATCCCTGCGGGGGCCCGCACGAGGGCTGCTGGTTGCGGGTGTCAGGACCGCTACCCTTTGGCTCTGGGGTGGGGTCGGACGGGCGGGGCGTCTGGGCGACCCTGTGTGTAGGTGAAGGGTGCCTAAGATCAGGGACTCGCCTCATCCCTTGGCCCCGGCCGGAATGTCGGTTTGCTCCACGCCTCTCGCTTTCGCAGCTGGCCAACCTACCCAGCGCTAATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTAAGAAGTGGGGTTGTGCAAAAGACTACAACTGCCGGCGTGCCCAGCCCGTACCGTCGGAATCTCGCGAGAACAGGGGTGTCTCCTGTTCTGGCCGAACTATATTTCCCGGCGTGCAGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGCCCGGCCACTGACCACTAACCATCACCCACTAATGCCCGGAGGCCCCAGGTACGTCCACCCTTGGGGGTGGGGACCCGGGAGGCTCTTCGGGCACCTCATCCCCTGCCCCGTCCCCACAGGCTCCGTGTGGCATTACGTCCGGGCCAGTGCCTCCTACTGCCCCTACCTGCCCCCACTGTGCGACCCCAAGGACGGGCACCTGCTGGTGGATGGGTGCTACGTTAACAACGTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865330.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X9

Length: 4050 bp    Location: 643471..664665   Strand: +
>XM_004865330.1
ATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGGCTCTCTCTGGCGATATGTGCGTGCCAGCATGACGCTCTCGGGCTACCTGCCCCCTCTGTGTGACCCGAAGGATGGGCACCTGCTCATGGATGGCGGCTACATCAACAATCTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865339.1 Coding sequence

Camsap3 calmodulin regulated spectrin-associated protein family, member 3, transcript variant X1

Length: 3846 bp    Location: 688966..703497   Strand: +
>XM_004865339.1
ATGGTGGAGGCGGCGCCCGCGGGGCCCGGGCCGCTGCGGAGGACCTTCCTGGTGCCCGAGATCAAGTCGCTGGACCAGTACGACTTCTCGCGGGCCAAGGCGGCGGCGAGCCTGGCGTGGGTGCTGCGGGCCGCGTTCGGGGGCGCAGAGCACGTGCCCCCGGAGCTGTGGGAGCCCTTCTACACTGACCAGTACGCACAGGAGCACGTGAAGCCCCCGGTCACCCGCCTGCTGCTCTCCGCTGAGCTCTACTGCCGGGCCTGGCGCCAGGCACTGCCGCAGCTTGAGGCCCCTCCCAACCCCTCCGCGCTGCTGGCCCTGCTGTCTCGGAGGGGCACGGTGCCCTCGCTACCCGATCGCCCTGTGCGCGAGGCCGACCTGAGACAACAGCCCATTCTCATGGGAGCCCACTTGGCCGTCATCGATGCCCTCATGGTGGCCTTCGCCTTTGAGTGGACAAAGACGCTGCCGGGTCCCTTGGCTCTGCCCAACTTGGAGCACAAGTTGCTTTTCTGGGTGGAAACGAACGTCCGGGGGCTGCAGGAGAAGACAGAGCAGGAAGCTGCACAGCGGGTGTCTCCCGCCGCCCCTGCCGACGGGGCGGCCCCTGCGCAGCCTTCGTGTCCCACACGCTGGTACTGGAAGCTGGTTCCTCACGCAATTGCCTTCTGTTTGAAGGAGTCGGGGAGCAAACCCCCCATGATCCGCTACCGCAAGGACCGGGCTACGGCCCGCCGCGCCCCCTGCTTCCCATCCGTGACCACCGTCCAGGATCTGGCCAGTGGAGCTGCGCTGGCCGCCACCATCCACTGCTATTGTCCTCAGCTCTTACGTCTTGAGGAGGTTTGCCTCAAGGACCCCATGTCCGTGGCCGACAGCCTGTACAACCTCCAGCTGGTGCAGGATTTCTGCGCCTCTCGCCTTCCCCGTGGCTGCCCGCTGTCCCTCGAGGACTTGCTTTATGTCCCTCCGCCGCTCAAGGTCAACCTGGTGGTGCTGCTGGCTGAGATGTTCATGTGCTTCGAGGTGCTGAAACCCGACTTCGTGCAGGCCAAGGACTTACCGGATGGGCACGCCGCCTCCCCCCGGGGCACCGAGGCCTCCCCGTCCCAGAACAACAGCGGCAGCAGTTCCCCTGTCTTCAACTTCCGGCACCCGCTCCTGTCCCCTGGCGGCTCCCAGTCCCCGCTTCGGGGATCGACAGGCTCCCTGAAGTCCTCCCCGTCCATGTCTCACATGGAGGCCCTGGGCAAGGCCTGGAATCGGCAGCTCAGCCGGCCCCTCTCCCAGGCTGTGTCGTTCAGCACCCCCTTTGGCCTGGACAGCGACGTGGATGTCGTCATGGGAGACCCCGTTCTGCTGCGCTCCGTCAGCTCAGACAGTCTGGGCCCCCCGCGGCCTGTGCCGGCGGCTCGGACCCCCGTCCAGCCGACCCCGGAGCCTGGCGATCTGCCCACCATCGAGGAAGCCCTGCAGATCATCCACAGTGCCGAGCCCCGGCTGCTCCCGGATGGCGCCGCGGATGGCAGCTTCTACCTCCACTCCCCCGAGGGCCCCTCGAAACCGCCGCTGTCCTCCTCCTACCCACCTATGGGGGCCTCGAAACTACTGTCTGATGGGCTTCCCAAAGCGCCTGTTTATGTGTCCCACCCCGAGGTCCCCTCAAAATCATCCCCTTGCCCAGCAGGGGAGGAATTGAAGCCACCAGCCCCAGCTGAGGGGTCCCCGAAGGCAGTGGCTTTGTCCCCTGCAGCCACCAACTCAGAAGTAAAGATGACCAGTTTCGCCGAGCGCAAGAAACAGCTCGTGAAGGCCGAGGTGGAGGTTGGAGTAGCATCCCCCACGGCTACTCCAGTAGCACCCGAGGCCCTGAGCTCAGAGATGAGCGAACTAGGAGCTCGGCTGGAGGAGAAACGCCGGGCCATAGAGGCCCAGAAGCGTCGCATCGAAGCCATCTTTGCCAAACACCGCCAGCGTCTGGGCAAGAACGCTTTCCTGCAGGTGCAGCCGCGGGAGGCAGCGGGGGAGGCGGAGGCGGAGCCGGGGCCGGGCTCAGCCCCTGCAGGGGAGCGGCCGGCAGGCGAGGGCCAGGGCGAGCCCTCCTCGCGGCCCAAGTCAGTGACCTTCTCTGCCGAGCTGGGCCCGGTGCCCCCCGAGGGGCTCGGGGACTACAACCGAGCAGTCAGCAAGCTGAGTGCCGCACTGAGCTCGCTGCAGCGGGACATGCAGAGGCTCACGGACCAGCAGCAGCGCCTTCTGGCCCCGCCGGAAGCCTCCGGACCTGCCCCACCACCCGCTGCCTGGGTCATCCCCGGTCCCATGGCCGGGCCCAAAGCCGTGTCCCCCAGCCCTGCCCGGCGAGCCCCAGCCCCCCGGCGCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCCCCAACCCGACATCTCGAAGCCCGAAACACGCACGGCCGGCAGAGCTGCGCCTGGCCCCCCTGACCAGGGTGCTCACGCCCCCCAACGATGTAGACAGTCTCCCCCACCTGCGCAAGTTCTCGCCGAGCCAGGTTCCTGTGCAGACGCGCTCCTCCATCCTCCTGTCGGAGGGGACGCCGCCCGAGGAGCCCACACCCCGGCCCGGCCTCATTGAGATCCCCTTGGCCAGCCTGGGCGAGCCTGCTGCAGAGGATGAGAGAGACGGGAGCCCTCCCGGGGCTGAGGATTCCTTAGAGGAGGAGGCCTTGTCCGAGGGAGAGCCCCGGACTGGGCTCGGATTCTTCTTTAAGGACGAAGACAAGCCCGAGGATGAGATGGCCCAGAAGCGGGCCAGTCTGCTGGAGCGGCAGCAGCGGCGGGCAGAGGAGGCCCGGAAGCGTCGGCAGTGGCAGGAGGCCGAGAAGGAGCAGCGGAGAGAGGAGCCTGTGAGGCTGGTGCACGAGGAGCCCACCGCAGCACCCCCAGCCCCCGCGTCAGCTCCCCTGGCGGTGGCCCCAGCCCCTGCCACTCGGGTCCCTGCTGAGGAGGAGGGGGGGCCCCGGCGAGGGGAGTTCACGCGGCTCGAGTACGAGCGCCGGGCCCAGCTGAAGCTCATGGACGACCTGGATAAGGTGCTGCGGCCCCGGGCCCCGGGGGCCGGGGGCCCAGGTCGGGGCGGGCGGAGGGGCCCCCGGCCTCGCTCTGGCTGCTGCGACGACTCGGCTCTGGCCCGAAGCCCTGCGCGTGGCCTGCTGGGCTCACGGCTCAGCAAGGTCTACTCCCAGTCCACCCTGTCTCTGTCCACCGTGGCCAACGAGCTGCCCAACAACCTCGGCGTGAAGAGGCCCACGTCTCGGGCCCCCTCCCCGTCGGGCCTCATGTCCCCGAGCCGCCTGCCGGGCAGCCGAGAGCAAGACTGGGAGAACGGCAGCAACGCCTCCTCGCCGGCCTCGGTGCCCGAGTACACAGGTCCGAGACTGTACAAGGAGCCCAGTGCGAAGTCCAACAAGTTCATCATCCACAACGCCCTGTCACACTGCTGCCTGGCGGGCAAGGTGAATGAGCCGCAGAAGAACCGCGTCCTGGAGGAGATCGAAAAGAGCAAGGCCAACCACTTCCTGATCCTCTTCCGGGACTCCAGCTGCCAGTTCCGGGCACTTTACACATTGTCAGGGGAGACGGAGGAGCTGTCCAGGCTGGCGGGCTACGGCCCGCGGACTGTCACCCCCACCATGGTCGAAGGCATCTACAAGTACAACTCGGACCGCAAGCGCTTCACCCAGATCCCGGCCAAAACCATGTCCATGAGCGTCGATGCCTTCACCATCCAGGGACACCTCTGGCAGAGCAGGAAGCCCACCACTCCCAAGAAGGGGGGCGGCACCCCCAAATAG

XM_004865340.1 Coding sequence

Camsap3 calmodulin regulated spectrin-associated protein family, member 3, transcript variant X2

Length: 3813 bp    Location: 688966..703497   Strand: +
>XM_004865340.1
ATGGTGGAGGCGGCGCCCGCGGGGCCCGGGCCGCTGCGGAGGACCTTCCTGGTGCCCGAGATCAAGTCGCTGGACCAGTACGACTTCTCGCGGGCCAAGGCGGCGGCGAGCCTGGCGTGGGTGCTGCGGGCCGCGTTCGGGGGCGCAGAGCACGTGCCCCCGGAGCTGTGGGAGCCCTTCTACACTGACCAGTACGCACAGGAGCACGTGAAGCCCCCGGTCACCCGCCTGCTGCTCTCCGCTGAGCTCTACTGCCGGGCCTGGCGCCAGGCACTGCCGCAGCTTGAGGCCCCTCCCAACCCCTCCGCGCTGCTGGCCCTGCTGTCTCGGAGGGGCACGGTGCCCTCGCTACCCGATCGCCCTGTGCGCGAGGCCGACCTGAGACAACAGCCCATTCTCATGGGAGCCCACTTGGCCGTCATCGATGCCCTCATGGTGGCCTTCGCCTTTGAGTGGACAAAGACGCTGCCGGGTCCCTTGGCTCTGCCCAACTTGGAGCACAAGTTGCTTTTCTGGGTGGAAACGAACGTCCGGGGGCTGCAGGAGAAGACAGAGCAGGAAGCTGCACAGCGGGTGTCTCCCGCCGCCCCTGCCGACGGGGCGGCCCCTGCGCAGCCTTCGCACGCAATTGCCTTCTGTTTGAAGGAGTCGGGGAGCAAACCCCCCATGATCCGCTACCGCAAGGACCGGGCTACGGCCCGCCGCGCCCCCTGCTTCCCATCCGTGACCACCGTCCAGGATCTGGCCAGTGGAGCTGCGCTGGCCGCCACCATCCACTGCTATTGTCCTCAGCTCTTACGTCTTGAGGAGGTTTGCCTCAAGGACCCCATGTCCGTGGCCGACAGCCTGTACAACCTCCAGCTGGTGCAGGATTTCTGCGCCTCTCGCCTTCCCCGTGGCTGCCCGCTGTCCCTCGAGGACTTGCTTTATGTCCCTCCGCCGCTCAAGGTCAACCTGGTGGTGCTGCTGGCTGAGATGTTCATGTGCTTCGAGGTGCTGAAACCCGACTTCGTGCAGGCCAAGGACTTACCGGATGGGCACGCCGCCTCCCCCCGGGGCACCGAGGCCTCCCCGTCCCAGAACAACAGCGGCAGCAGTTCCCCTGTCTTCAACTTCCGGCACCCGCTCCTGTCCCCTGGCGGCTCCCAGTCCCCGCTTCGGGGATCGACAGGCTCCCTGAAGTCCTCCCCGTCCATGTCTCACATGGAGGCCCTGGGCAAGGCCTGGAATCGGCAGCTCAGCCGGCCCCTCTCCCAGGCTGTGTCGTTCAGCACCCCCTTTGGCCTGGACAGCGACGTGGATGTCGTCATGGGAGACCCCGTTCTGCTGCGCTCCGTCAGCTCAGACAGTCTGGGCCCCCCGCGGCCTGTGCCGGCGGCTCGGACCCCCGTCCAGCCGACCCCGGAGCCTGGCGATCTGCCCACCATCGAGGAAGCCCTGCAGATCATCCACAGTGCCGAGCCCCGGCTGCTCCCGGATGGCGCCGCGGATGGCAGCTTCTACCTCCACTCCCCCGAGGGCCCCTCGAAACCGCCGCTGTCCTCCTCCTACCCACCTATGGGGGCCTCGAAACTACTGTCTGATGGGCTTCCCAAAGCGCCTGTTTATGTGTCCCACCCCGAGGTCCCCTCAAAATCATCCCCTTGCCCAGCAGGGGAGGAATTGAAGCCACCAGCCCCAGCTGAGGGGTCCCCGAAGGCAGTGGCTTTGTCCCCTGCAGCCACCAACTCAGAAGTAAAGATGACCAGTTTCGCCGAGCGCAAGAAACAGCTCGTGAAGGCCGAGGTGGAGGTTGGAGTAGCATCCCCCACGGCTACTCCAGTAGCACCCGAGGCCCTGAGCTCAGAGATGAGCGAACTAGGAGCTCGGCTGGAGGAGAAACGCCGGGCCATAGAGGCCCAGAAGCGTCGCATCGAAGCCATCTTTGCCAAACACCGCCAGCGTCTGGGCAAGAACGCTTTCCTGCAGGTGCAGCCGCGGGAGGCAGCGGGGGAGGCGGAGGCGGAGCCGGGGCCGGGCTCAGCCCCTGCAGGGGAGCGGCCGGCAGGCGAGGGCCAGGGCGAGCCCTCCTCGCGGCCCAAGTCAGTGACCTTCTCTGCCGAGCTGGGCCCGGTGCCCCCCGAGGGGCTCGGGGACTACAACCGAGCAGTCAGCAAGCTGAGTGCCGCACTGAGCTCGCTGCAGCGGGACATGCAGAGGCTCACGGACCAGCAGCAGCGCCTTCTGGCCCCGCCGGAAGCCTCCGGACCTGCCCCACCACCCGCTGCCTGGGTCATCCCCGGTCCCATGGCCGGGCCCAAAGCCGTGTCCCCCAGCCCTGCCCGGCGAGCCCCAGCCCCCCGGCGCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCCCCAACCCGACATCTCGAAGCCCGAAACACGCACGGCCGGCAGAGCTGCGCCTGGCCCCCCTGACCAGGGTGCTCACGCCCCCCAACGATGTAGACAGTCTCCCCCACCTGCGCAAGTTCTCGCCGAGCCAGGTTCCTGTGCAGACGCGCTCCTCCATCCTCCTGTCGGAGGGGACGCCGCCCGAGGAGCCCACACCCCGGCCCGGCCTCATTGAGATCCCCTTGGCCAGCCTGGGCGAGCCTGCTGCAGAGGATGAGAGAGACGGGAGCCCTCCCGGGGCTGAGGATTCCTTAGAGGAGGAGGCCTTGTCCGAGGGAGAGCCCCGGACTGGGCTCGGATTCTTCTTTAAGGACGAAGACAAGCCCGAGGATGAGATGGCCCAGAAGCGGGCCAGTCTGCTGGAGCGGCAGCAGCGGCGGGCAGAGGAGGCCCGGAAGCGTCGGCAGTGGCAGGAGGCCGAGAAGGAGCAGCGGAGAGAGGAGCCTGTGAGGCTGGTGCACGAGGAGCCCACCGCAGCACCCCCAGCCCCCGCGTCAGCTCCCCTGGCGGTGGCCCCAGCCCCTGCCACTCGGGTCCCTGCTGAGGAGGAGGGGGGGCCCCGGCGAGGGGAGTTCACGCGGCTCGAGTACGAGCGCCGGGCCCAGCTGAAGCTCATGGACGACCTGGATAAGGTGCTGCGGCCCCGGGCCCCGGGGGCCGGGGGCCCAGGTCGGGGCGGGCGGAGGGGCCCCCGGCCTCGCTCTGGCTGCTGCGACGACTCGGCTCTGGCCCGAAGCCCTGCGCGTGGCCTGCTGGGCTCACGGCTCAGCAAGGTCTACTCCCAGTCCACCCTGTCTCTGTCCACCGTGGCCAACGAGCTGCCCAACAACCTCGGCGTGAAGAGGCCCACGTCTCGGGCCCCCTCCCCGTCGGGCCTCATGTCCCCGAGCCGCCTGCCGGGCAGCCGAGAGCAAGACTGGGAGAACGGCAGCAACGCCTCCTCGCCGGCCTCGGTGCCCGAGTACACAGGTCCGAGACTGTACAAGGAGCCCAGTGCGAAGTCCAACAAGTTCATCATCCACAACGCCCTGTCACACTGCTGCCTGGCGGGCAAGGTGAATGAGCCGCAGAAGAACCGCGTCCTGGAGGAGATCGAAAAGAGCAAGGCCAACCACTTCCTGATCCTCTTCCGGGACTCCAGCTGCCAGTTCCGGGCACTTTACACATTGTCAGGGGAGACGGAGGAGCTGTCCAGGCTGGCGGGCTACGGCCCGCGGACTGTCACCCCCACCATGGTCGAAGGCATCTACAAGTACAACTCGGACCGCAAGCGCTTCACCCAGATCCCGGCCAAAACCATGTCCATGAGCGTCGATGCCTTCACCATCCAGGGACACCTCTGGCAGAGCAGGAAGCCCACCACTCCCAAGAAGGGGGGCGGCACCCCCAAATAG

XM_004865342.1 Coding sequence

Camsap3 calmodulin regulated spectrin-associated protein family, member 3, transcript variant X4

High confidence: 4 potential gene matches
Length: 3765 bp    Location: 688966..703497   Strand: +
>XM_004865342.1
ATGGTGGAGGCGGCGCCCGCGGGGCCCGGGCCGCTGCGGAGGACCTTCCTGGTGCCCGAGATCAAGTCGCTGGACCAGTACGACTTCTCGCGGGCCAAGGCGGCGGCGAGCCTGGCGTGGGTGCTGCGGGCCGCGTTCGGGGGCGCAGAGCACGTGCCCCCGGAGCTGTGGGAGCCCTTCTACACTGACCAGTACGCACAGGAGCACGTGAAGCCCCCGGTCACCCGCCTGCTGCTCTCCGCTGAGCTCTACTGCCGGGCCTGGCGCCAGGCACTGCCGCAGCTTGAGGCCCCTCCCAACCCCTCCGCGCTGCTGGCCCTGCTGTCTCGGAGGGGCACGGTGCCCTCGCTACCCGATCGCCCTGTGCGCGAGGCCGACCTGAGACAACAGCCCATTCTCATGGGAGCCCACTTGGCCGTCATCGATGCCCTCATGGTGGCCTTCGCCTTTGAGTGGACAAAGACGCTGCCGGGTCCCTTGGCTCTGCCCAACTTGGAGCACAAGTTGCTTTTCTGGGTGGAAACGAACGTCCGGGGGCTGCAGGAGAAGACAGAGCAGGAAGCTGCACAGCGGGTGTCTCCCGCCGCCCCTGCCGACGGGGCGGCCCCTGCGCAGCCTTCGATCCGCTACCGCAAGGACCGGGCTACGGCCCGCCGCGCCCCCTGCTTCCCATCCGTGACCACCGTCCAGGATCTGGCCAGTGGAGCTGCGCTGGCCGCCACCATCCACTGCTATTGTCCTCAGCTCTTACGTCTTGAGGAGGTTTGCCTCAAGGACCCCATGTCCGTGGCCGACAGCCTGTACAACCTCCAGCTGGTGCAGGATTTCTGCGCCTCTCGCCTTCCCCGTGGCTGCCCGCTGTCCCTCGAGGACTTGCTTTATGTCCCTCCGCCGCTCAAGGTCAACCTGGTGGTGCTGCTGGCTGAGATGTTCATGTGCTTCGAGGTGCTGAAACCCGACTTCGTGCAGGCCAAGGACTTACCGGATGGGCACGCCGCCTCCCCCCGGGGCACCGAGGCCTCCCCGTCCCAGAACAACAGCGGCAGCAGTTCCCCTGTCTTCAACTTCCGGCACCCGCTCCTGTCCCCTGGCGGCTCCCAGTCCCCGCTTCGGGGATCGACAGGCTCCCTGAAGTCCTCCCCGTCCATGTCTCACATGGAGGCCCTGGGCAAGGCCTGGAATCGGCAGCTCAGCCGGCCCCTCTCCCAGGCTGTGTCGTTCAGCACCCCCTTTGGCCTGGACAGCGACGTGGATGTCGTCATGGGAGACCCCGTTCTGCTGCGCTCCGTCAGCTCAGACAGTCTGGGCCCCCCGCGGCCTGTGCCGGCGGCTCGGACCCCCGTCCAGCCGACCCCGGAGCCTGGCGATCTGCCCACCATCGAGGAAGCCCTGCAGATCATCCACAGTGCCGAGCCCCGGCTGCTCCCGGATGGCGCCGCGGATGGCAGCTTCTACCTCCACTCCCCCGAGGGCCCCTCGAAACCGCCGCTGTCCTCCTCCTACCCACCTATGGGGGCCTCGAAACTACTGTCTGATGGGCTTCCCAAAGCGCCTGTTTATGTGTCCCACCCCGAGGTCCCCTCAAAATCATCCCCTTGCCCAGCAGGGGAGGAATTGAAGCCACCAGCCCCAGCTGAGGGGTCCCCGAAGGCAGTGGCTTTGTCCCCTGCAGCCACCAACTCAGAAGTAAAGATGACCAGTTTCGCCGAGCGCAAGAAACAGCTCGTGAAGGCCGAGGTGGAGGTTGGAGTAGCATCCCCCACGGCTACTCCAGTAGCACCCGAGGCCCTGAGCTCAGAGATGAGCGAACTAGGAGCTCGGCTGGAGGAGAAACGCCGGGCCATAGAGGCCCAGAAGCGTCGCATCGAAGCCATCTTTGCCAAACACCGCCAGCGTCTGGGCAAGAACGCTTTCCTGCAGGTGCAGCCGCGGGAGGCAGCGGGGGAGGCGGAGGCGGAGCCGGGGCCGGGCTCAGCCCCTGCAGGGGAGCGGCCGGCAGGCGAGGGCCAGGGCGAGCCCTCCTCGCGGCCCAAGTCAGTGACCTTCTCTGCCGAGCTGGGCCCGGTGCCCCCCGAGGGGCTCGGGGACTACAACCGAGCAGTCAGCAAGCTGAGTGCCGCACTGAGCTCGCTGCAGCGGGACATGCAGAGGCTCACGGACCAGCAGCAGCGCCTTCTGGCCCCGCCGGAAGCCTCCGGACCTGCCCCACCACCCGCTGCCTGGGTCATCCCCGGTCCCATGGCCGGGCCCAAAGCCGTGTCCCCCAGCCCTGCCCGGCGAGCCCCAGCCCCCCGGCGCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCCCCAACCCGACATCTCGAAGCCCGAAACACGCACGGCCGGCAGAGCTGCGCCTGGCCCCCCTGACCAGGGTGCTCACGCCCCCCAACGATGTAGACAGTCTCCCCCACCTGCGCAAGTTCTCGCCGAGCCAGGTTCCTGTGCAGACGCGCTCCTCCATCCTCCTGTCGGAGGGGACGCCGCCCGAGGAGCCCACACCCCGGCCCGGCCTCATTGAGATCCCCTTGGCCAGCCTGGGCGAGCCTGCTGCAGAGGATGAGAGAGACGGGAGCCCTCCCGGGGCTGAGGATTCCTTAGAGGAGGAGGCCTTGTCCGAGGGAGAGCCCCGGACTGGGCTCGGATTCTTCTTTAAGGACGAAGACAAGCCCGAGGATGAGATGGCCCAGAAGCGGGCCAGTCTGCTGGAGCGGCAGCAGCGGCGGGCAGAGGAGGCCCGGAAGCGTCGGCAGTGGCAGGAGGCCGAGAAGGAGCAGCGGAGAGAGGAGCCTGTGAGGCTGGTGCACGAGGAGCCCACCGCAGCACCCCCAGCCCCCGCGTCAGCTCCCCTGGCGGTGGCCCCAGCCCCTGCCACTCGGGTCCCTGCTGAGGAGGAGGGGGGGCCCCGGCGAGGGGAGTTCACGCGGCTCGAGTACGAGCGCCGGGCCCAGCTGAAGCTCATGGACGACCTGGATAAGGTGCTGCGGCCCCGGGCCCCGGGGGCCGGGGGCCCAGGTCGGGGCGGGCGGAGGGGCCCCCGGCCTCGCTCTGGCTGCTGCGACGACTCGGCTCTGGCCCGAAGCCCTGCGCGTGGCCTGCTGGGCTCACGGCTCAGCAAGGTCTACTCCCAGTCCACCCTGTCTCTGTCCACCGTGGCCAACGAGCTGCCCAACAACCTCGGCGTGAAGAGGCCCACGTCTCGGGCCCCCTCCCCGTCGGGCCTCATGTCCCCGAGCCGCCTGCCGGGCAGCCGAGAGCAAGACTGGGAGAACGGCAGCAACGCCTCCTCGCCGGCCTCGGTGCCCGAGTACACAGGTCCGAGACTGTACAAGGAGCCCAGTGCGAAGTCCAACAAGTTCATCATCCACAACGCCCTGTCACACTGCTGCCTGGCGGGCAAGGTGAATGAGCCGCAGAAGAACCGCGTCCTGGAGGAGATCGAAAAGAGCAAGGCCAACCACTTCCTGATCCTCTTCCGGGACTCCAGCTGCCAGTTCCGGGCACTTTACACATTGTCAGGGGAGACGGAGGAGCTGTCCAGGCTGGCGGGCTACGGCCCGCGGACTGTCACCCCCACCATGGTCGAAGGCATCTACAAGTACAACTCGGACCGCAAGCGCTTCACCCAGATCCCGGCCAAAACCATGTCCATGAGCGTCGATGCCTTCACCATCCAGGGACACCTCTGGCAGAGCAGGAAGCCCACCACTCCCAAGAAGGGGGGCGGCACCCCCAAATAG

XM_004865389.1 Coding sequence

Timm44 translocase of inner mitochondrial membrane 44 homolog (yeast), transcript variant X1

Length: 1431 bp    Location: 901864..889428   Strand: -
>XM_004865389.1
ATGGCGGGGGTGGCCTTGCGCGGCGGCTGGTGCCGCTGTCCGCGGAGATGCCTTGGGAGTGGAGTCCAGTTACTTTCCAGCCACAGCCTACCCCATGGCTCAGCCTATCAGATACACCGGCCAGGCGGTGAGCTGCTATTGCCCAGATCATATTCTTCCGGAAACAGAAAAGGCTTTCTGTCCGGCTTGCTCGACAACATCAAACAAGAATTAGCCAAAAACAAGGAGATGAAAGAAAGTATTAAAAAATTCCGAGAGGAGGCCAAGAAGCTGGAAGAGTCGGACGCACTCCAGGAAGCCCGAAGGAAATACAAAACCATCGAGTCGGAGACTGCGCGCACCAGTGAGGCCATCAGGAGGAAGCTGGGGGAGCTGACAGGGACGGTGAAGGAGAGTCTCGACGGAGTCGGTAAGAGCGACCTCGGCCGGAAGATCAAGGAAGGGGTGGAGGAGGCTGCCAGGACGGCCAAGCACTCGGCCGAGTCCGTGTCCAAGGGCGGGGAGAGGCTGGGCCGGACAGCGGCCTTCAAAGCCATCTCCCAGGGCGTGGAGTCTGTGAAGAAGGAGATCCATGAGAGTGCGCTGGGCCAGGCGGGGCCCTACCGAAGGCCCGCGCGGCTCAGGAAAAGGACCGAGTTCGAGGGAGAGAAGTTCCAAGAAGAGAAAGTGTTCGAGCCCAACGAGGAGGCCCTGGGGGTTGTGCTGCACAAGGACTCCAAGTGGTACCAGCAGTGGAAGGACTTCCGGGACAGCAACGTGGTGTTCAACCGCTTCTTCGAGATGAAGATGAAGTATGATGAGAGTGACAATGTGCTCATCCGGGCGTCCCGGGCCCTGACGGACAAGGTCACCAACGTGCTGGGGGGCCTGTTCTCCAAGACGGAAATGTCAGAGGTGCTCACGGAGATCCTTCGAGTGGACCCGGCCTTCGACAAGGACCGGTTTCTGAAGCAGTGCGAGAGTGACATCATCCCCAATATCCTGGAGGCCATGATTTCTGGAGAGCTCGACATTCTCAAAGACTGGTGCTATGAAGCTACCTACAGCCAGCTGGCCCACCCGATCCAGCAGGCCAAGGCCCTGGGCCTCCAGTTCCACTCCCGCATCCTCGACATTGACAACATCGACCTGGCCATGGGGAAGATGATGGAGCAGGGGCCAGTGCTGATCATCACCTTCCAGGCCCAGCTGGTGATGGTGATCCGGAACCCCAAGGGCGAGGTGGTCGAGGGCGACCCGGTGAGCAGAGCAGTGGGCCGGGACACGGCCTGTGGGCCACCAGGCATGGATGCCAGCTCCTGGCCAGATGGTTCTGGGGCCTTGGGGTGGAGAGCCACCATCCTGAGTAGTGACCCTGGGGGAACTCTGCCTAGCACCCGGGCTGCTCAGTCCCTCCCAGAGCATCAGTGTCCACCCCTGCATCCGTCTTGA

XM_004865395.1 Coding sequence

Cers4 ceramide synthase 4, transcript variant X2

High confidence: 3 potential gene matches
Length: 1182 bp    Location: 1074925..1092497   Strand: +
>XM_004865395.1
ATGCTGTCAGCCCTGAACAACTTGGTGTGGCACGAGAGGATCTGGCTACCACCCAGCAAGACATGGACAGACATGGAAGACCAGGACGGCATGGTCCTGGCCCACCCCCGGGACATACTAGTGGCCCTGCCCCTGATACTGATGCTGGTGACAGCACGCCTCGCCTTCGACAGATTCATAGGCATGCCCGCGTCCCGCTGGCTGGGCATGCGGGATCCCACCAGGAAGCAGGTGAAGCCCAACCCCACGCTGGAGAAATACTTCCTCCAGAAAGGACAGAAACCCGAAGAGGCCCAAGTGGCCCTCCTGGCTGCCCAGTGTGGCCTCACGCTGCAACAGACTCAACACTGGTTCCGGAGACGCCGGAACCAGGATCGGCCCCACATGTCCAAGAAGTTCTGTGAGGCCAGCTGGAGGTTTCTCTTCTACCTCAGCACCTCCATTAGTGGCATCTTGGTCCTGTACCCTGAGCCGTGGCTGTGGGACGTGGCAGAGTCCTGGAGAAATTACCCAAGCCAGCACCTGAAACCAGCCCTGTCCTGGTGGTACCTCACGGAGCTGAGTTACTACAGCTCGCTGCTCCTCAGGCTGCCCTTCGACGTCAAGCGCAAGGATTTCAAGGAGCAGGTGATGCACCATTTCGTGGCTGTCTTCCTGATCTTCTTCTCCTACGGCGCGAACCTGGTGCGCATCGGGTCTCTGGTCTTGCTGCTGCACGACTTCGGCGACTGCCTGCTGGAGGCCTGCAAGGTGCTCAACTACATGCGCCTCTCGCTAACGTGCGACATCTTGTTCTTCATCTTCGCCTCGGTCTTCTTCTACACCCGCCTCATCCTGATGCCCACCACGATCATCTACTCTGTGTACTATGACTCCATGAAGCAGTTCACCCCCTTCTTTGGCTACTACTTCTTCCTCACCCTTCTGGTGTCACTCAACATGCTGCACGTGTACTGGTTCAGCCTCATCCTGCGCATGCTCTACAACTACCTGGTGAAGGGTCAGATGACAAAGGACATTCGCAGTGATAGCGAAGAGTCCAGCTCCAGCACTGACGAGGCAGCGCCTGGGCATCCCCAGCTGAAGAATGGGATGGCTTGCAGGCCTGGGCCGGCCCTGGCTGGCAGCCGCCGGAGCCGGGCAAAAGGGCAGCTGGCCAATGGGCACACAGCCGCCACTTAG

XM_004865401.1 Coding sequence

Kank3 KN motif and ankyrin repeat domains 3, transcript variant X3

Length: 2559 bp    Location: 1125738..1117071   Strand: -
>XM_004865401.1
ATGGCTGGGCAGCAGGACGGACAGGGACCCTGCCGTCACCTCTCTGAGGTCTTTTGCAGGGTGAGTATAGCGGCTACTTCAGGAAACATGGCCAAGTTCGCCCTGAACCAGAATCTGCCTGATTTGGGCGGCCCTCGCCTGTGCCCCGGCCCGATCGGGGGCGCGCGGAGCCTGAGCTCGCCTTACTCCGTGGAGACGCCCTACGGCTTCCACCTGGACCTGGACTTCCTCAAGTACGTGGAGGAGCTGGAGCGCGGTGGGCCCGCCGCCCGCAGAGCCCCCGGACCCCCGACCGCGCGCCGCACCCGCGCGCCCCGCCCGGGCCTCGAGGGCGCTCGCAGCCCAGGCGCCTGGGCATCCAGTGAGTCCCTGGCCAGCGATGACGGCGGAACTCCGGGCGCGCTCTCCCCCGGGGCGCTCCCGGGGCTCCAGTTGCCACCGCTGTCGCCACGCGCACTCGTGCGCAATGTGCGCGTGGAGAACACGCTGCTGGAGACGAGCCGTCGGCTGGAGCTGGCACAGGCGCAGGAGCGCGCGCTCAGCCCTGCCCGCGTGGAGCCGCGCAGTCCACGGGGGTCCGGCCGCAACAGCCCCGCCCCCGCCTCGCCCGGCCCAGCGCAGCTGCAGCTGGTGCGCGAGCAGATGGCCGCGGCGCTGCGGCGCCTGCGCGAGCTCGAGGACCAGGCGCGCGCGCTGCCCGAGCTGCAGGAGCAGGTGCGCGTACTGCGCGCTGAGAAGGCGTGGCTGCTGGCCGGGCGCGCGCTGGCGGAGCCCGACGGGGAGGCCGAGGCGCGCCCGGACAAGCTCGCCCAGCTGCGGCGGCTCACCGAGCGCTTGGCCACCTCCACCTCGGAGCGCGGCGTCCGCTGCAAGGCCAGCCCCCGCGCTGAAGGCCCAGATGGGCCGGCTGCAGCGCGCAGCGAGGGCGCACGCCAGGTCCTCGAGGGGGCAGCCGGGACTCCTGGGACCCCCGACGACGGGTCGCCCCAGACCCGGGAGGTGGGCATCGAGGTTGTGCTCGAGACCCGAGAGGCGGGTGCCCAGGCAGCGCCGGAAACCCGGGAGGCCGGCGTGGAGGCGGCCCCTGAGACCGTGGAGGCGGACGCGTGGGTGAGCGAGGCGCTGCTCGGGGTGCCCGCCGCTGCCGAGCGCGAGCTGGAGCTGCTTCGCGCCGGCCTGGAGCACCAGCGCGGGGTGAGCGAGCTGCTGCGCGGGCGGCTGCGGGAGCTGGGGGAGGCCCGCAAGGCTGCCCAGGACGAGGCCAGGGAGCCCAGGGCCCCGCCGTGCAGTGCCGCCACTCAGACCCCTTGGGGCTGTGCGGAGAAGACCACGCAGACTGAGCTCCCTGCGGAGGCCCCTCCTGGGGACAGGGCCGTGGCCCCGGCGGGCACCCTCAAGTCCATCATGAAGAAGAGAAACGGCACCGCTGGCGCCCAGCCCAGCCCGGGACCCAAGAGCCTGCAGTTTGTCGGAGTCATCAACGCAGAGTATGAGAGCTCGTCCAGCGAGGACGACAGCGACAGCAACGACAGCCAAGACGGCGCCCCGAAGCGTCCGAGGAGCAGCTCTTCCGGCTCCGGGGACGACAGCGGCGGGGACGTCGGGGACCCGGAGGCAAAGGCGGAAGCAGAGCCTCAGCCCGGGACCCAGGGGAGGTACGAGCTGAGCCCGCGGTTGCGCGAGGCGTGCGCCGCGCTGCTGAGACAGCTGAGCCGGCCCCGCGGAATGGCCCGCGACAGCAACGCGGCGCGCCTGGTGGCCCAGGAGTGGTTCCGGGTGTCCAGCCAGCGGCGCTCCCAGGCCGAGCTGGTGGCGGGGGTGCTGCGTGGGTTGGCGCGCCTGGGACCCCCGCTGCTGACGCACGTGGTGAACCTGGCGGATGACAACGGGAACACGGCCCTGCACTACAGTGTGTCCCATGGGAACCTGGGCATCTCGAGCCTGCTGCTGGACACGGGGGTCTGTGAGGTCAGCTGCCAGAACCGCGCCGGCTACTCAGCACTCATGCTGGCTGCACTCACGTCTGTGGGGCTGGAGGACATGGTTGTGGTCCGGAGGCTCTTTAGAATGGGTGATGTCAACGCGAAGGCCAGCCAGACTGGACAAACGGCCCTCATGCTGGCCATCAGCCACGGCCGGGAGGATATGGTAATGGCCCTGCTGGAGTGCGGGGCTGATGTGAATGCACAAGACTCGGAAGGGGCCACGGCGCTCATGTGTGCCAGCGAGTATGGACGCCTGGACACCGTCCGGTTGCTGCTGGCCCAGCCAGGCTGTGACCCTGCCATCCTGGACAATGTGAGCCAGGACCCTGGGGCTGGTGTAGGGGAGGGGGTGCCCATGCTGTTCAGAGACCTGATGCCTGCCATTCCTCAGGAGGGCACCAGTGCCCTGGCCATCGCCTTAGAGGCGGAGCAGGACGAAGTGGCCGGTCTGCTGCATGCCCACCTGAGCTCCAACCAGCCTGGTTCCCAGAGCCAGTCACCCTCAGACTCTCCTGCAGCCACACCCGGTGAAGGAGGGTGCAGTGACATCAGACAGGACCCCCAGCCTCAGTGA

XM_004865399.1 Coding sequence

Kank3 KN motif and ankyrin repeat domains 3, transcript variant X1

Length: 2637 bp    Location: 1125738..1117071   Strand: -
>XM_004865399.1
ATGGCTGGGCAGCAGGACGGACAGGGACCCTGCCGTCACCTCTCTGAGGTCTTTTGCAGGGTGAGTATAGCGGCTACTTCAGGAAACATGGCCAAGTTCGCCCTGAACCAGAATCTGCCTGATTTGGGCGGCCCTCGCCTGTGCCCCGGCCCGATCGGGGGCGCGCGGAGCCTGAGCTCGCCTTACTCCGTGGAGACGCCCTACGGCTTCCACCTGGACCTGGACTTCCTCAAGTACGTGGAGGAGCTGGAGCGCGGTGGGCCCGCCGCCCGCAGAGCCCCCGGACCCCCGACCGCGCGCCGCACCCGCGCGCCCCGCCCGGGCCTCGAGGGCGCTCGCAGCCCAGGCGCCTGGGCATCCAGTGAGTCCCTGGCCAGCGATGACGGCGGAACTCCGGGCGCGCTCTCCCCCGGGGCGCTCCCGGGGCTCCAGTTGCCACCGCTGTCGCCACGCGCACTCGTGCGCAATGTGCGCGTGGAGAACACGCTGCTGGAGACGAGCCGTCGGCTGGAGCTGGCACAGGCGCAGGAGCGCGCGCTCAGCCCTGCCCGCGTGGAGCCGCGCAGTCCACGGGGGTCCGGCCGCAACAGCCCCGCCCCCGCCTCGCCCGGCCCAGCGCAGCTGCAGCTGGTGCGCGAGCAGATGGCCGCGGCGCTGCGGCGCCTGCGCGAGCTCGAGGACCAGGCGCGCGCGCTGCCCGAGCTGCAGGAGCAGGTGCGCGTACTGCGCGCTGAGAAGGCGTGGCTGCTGGCCGGGCGCGCGCTGGCGGAGCCCGACGGGGAGGCCGAGGCGCGCCCGGACAAGCTCGCCCAGCTGCGGCGGCTCACCGAGCGCTTGGCCACCTCCACCTCGGAGCGCGGCGTCCGCTGCAAGGCCAGCCCCCGCGCTGAAGGCCCAGATGGGCCGGCTGCAGCGCGCAGCGAGGGCGCACGCCAGGTCCTCGAGGGGGCAGCCGGGACTCCTGGGACCCCCGACGACGGGTCGCCCCAGACCCGGGAGGTGGGCATCGAGGTTGTGCTCGAGACCCGAGAGGCGGGTGCCCAGGCAGCGCCGGAAACCCGGGAGGCCGGCGTGGAGGCGGCCCCTGAGACCGTGGAGGCGGACGCGTGGGTGAGCGAGGCGCTGCTCGGGGTGCCCGCCGCTGCCGAGCGCGAGCTGGAGCTGCTTCGCGCCGGCCTGGAGCACCAGCGCGGGGTGAGCGAGCTGCTGCGCGGGCGGCTGCGGGAGCTGGGGGAGGCCCGCAAGGCTGCCCAGGACGAGGCCAGGGAGCCCAGGGCCCCGCCGTGCAGTGCCGCCACTCAGACCCCTTGGGGCTGTGCGGAGAAGACCACGCAGACTGAGCTCCCTGCGGAGGCCCCTCCTGGGGACAGGGCCGTGGCCCCGGCGGGCACCCTCAAGTCCATCATGAAGAAGAGAAACGGCACCGCTGGCGCCCAGCCCAGCCCGGGACCCAAGAGCCTGCAGTTTGTCGGAGTCATCAACGCAGAGTATGAGAGCTCGTCCAGCGAGGACGACAGCGACAGCAACGACAGCCAAGACGGCGCCCCGAAGCGTCCGAGGAGCAGCTCTTCCGGCTCCGGGGACGACAGCGGCGGGGACGTCGGGGACCCGGAGGCAAAGGCGGAAGCAGAGCCTCAGCCCGGGACCCAGGGGAGGCAAGAGGCGCCCGTGGTCGGGAGTGGGGGCGGCTGGGTGTCTCGGGGTCCCCCTGAGGCTCGCCTGGCTCCTCTCAGGTACGAGCTGAGCCCGCGGTTGCGCGAGGCGTGCGCCGCGCTGCTGAGACAGCTGAGCCGGCCCCGCGGAATGGCCCGCGACAGCAACGCGGCGCGCCTGGTGGCCCAGGAGTGGTTCCGGGTGTCCAGCCAGCGGCGCTCCCAGGCCGAGCTGGTGGCGGGGGTGCTGCGTGGGTTGGCGCGCCTGGGACCCCCGCTGCTGACGCACGTGGTGAACCTGGCGGATGACAACGGGAACACGGCCCTGCACTACAGTGTGTCCCATGGGAACCTGGGCATCTCGAGCCTGCTGCTGGACACGGGGGTCTGTGAGGTCAGCTGCCAGAACCGCGCCGGCTACTCAGCACTCATGCTGGCTGCACTCACGTCTGTGGGGCTGGAGGACATGGTTGTGGTCCGGAGGCTCTTTAGAATGGGTGATGTCAACGCGAAGGCCAGCCAGACTGGACAAACGGCCCTCATGCTGGCCATCAGCCACGGCCGGGAGGATATGGTAATGGCCCTGCTGGAGTGCGGGGCTGATGTGAATGCACAAGACTCGGAAGGGGCCACGGCGCTCATGTGTGCCAGCGAGTATGGACGCCTGGACACCGTCCGGTTGCTGCTGGCCCAGCCAGGCTGTGACCCTGCCATCCTGGACAATGTGAGCCAGGACCCTGGGGCTGGTGTAGGGGAGGGGGTGCCCATGCTGTTCAGAGACCTGATGCCTGCCATTCCTCAGGAGGGCACCAGTGCCCTGGCCATCGCCTTAGAGGCGGAGCAGGACGAAGTGGCCGGTCTGCTGCATGCCCACCTGAGCTCCAACCAGCCTGGTTCCCAGAGCCAGTCACCCTCAGACTCTCCTGCAGCCACACCCGGTGAAGGAGGGTGCAGTGACATCAGACAGGACCCCCAGCCTCAGTGA

XM_004866046.1 Coding sequence

Pram1 PML-RARA regulated adaptor molecule 1

High confidence: 1 potential gene match
Length: 1752 bp    Location: 1258890..1251170   Strand: -
>XM_004866046.1
ATGGAGAGCCACCAGGACTTCCGGAGCCTCCAAGCCAAGTTCCAGGCCTCTCGGGCAGAGTCCAGTGAACTCCCCCCAAAACCCCCAAAGCCGGAAGTTAACAAACTTCTGAAGAAGCTCCCGCAGCTGGAGCCGAGCGAGCAGCCGAAGCAGCTCCCACAGCCTCAGTTTGCCAGTCTGCCCCAGAAGCTCTCCCAGCCCGAGTTCACTGATCCCCCCCAAAAGCCATCCAAACCTGAGTTCGGTGATCTCTCCAAGAAGCGTCCTCAGCTTGAGGCCAGTCCCTTTCCCAGGAAGCACCCCCAGCCTGAGGTCAGGAACCCTGCCAGGTCCCCCTCAGAGCCCAAACCCAATGTGGTCCCCAAGAAATTCCAGCAGCTGGAGTCCAGCGAGGGCCCCCCAAGGTCCTTGCTGACCGGGCTCGGTACCTTGCCCAAGAAGCCCCCGCAGCCTGAGTTCAGTGTATACCCCAGGAAGCCCCCGAAGCTCCCAGTCAGTGGCCTCCCTGGGAAGTCCTCACCGCAGCCCGAGTTCAGTGAGGTCCCCCAAGTGTCCCCCTCAAAGCCTGGGTCCACTGAGCCCTGTCCCCTCTCCCCAAAGCCTGACTTCGGCACCTTTCCCAGGAAGCCCCTGCGGCCTCAGCCAGGCTTCAGTGCGTTTCCCAAGAAGGCCCTGAAGCTGGAGTTTGGTGACCTCACTAGGACGTCCTCAGAGCCGGAAGTCAGCGTGCTTCCCAAGAGGTCACAGCGGCCTGAGTTCAAGGCCCTTTCCAAAAAGCCCCCGCAGCCTGAGCTGGGTGGCCTCCCCAGAACATCCTCCGTGCCCGAGTTCAGTGTGCTCCCCAGGAAGTTCTCCCAGCCTGAGTGCAGGGGGCCACCCCGCAAGTTCTCCCAGCCAGAGCCCCATGCTCTGCCCAAGCAGCCTGAGCTTTTCCCAGGTCTCCCTAGAAAGAGCCCACTTCCGGGCTCGGTGTCTGAGAGCTCAGTGCCAGCAGCTGTCGTGGGCTCTGGGCAGCTTGGAGCTGCTAGGGCGCCCCGCTGGAAGTCTGAAGACCTCCAAGGCCGCCAGCCACCCCCTCGGAGGCCTCTGCCCCCAGCCAGCAGCCTGGGGCCCCCTCCAGCCAAGCCCCCGCTTCCCCCAGGCCCCCTGGATGTCCAGAGCTTTTGGAGGCTCCCGGCAGCAGGCACAGGCGTGCGGAGGACTCGCTCTTCTGCCGGGATGTACTTCCAGGCCCTCCAGGCTCGACAGGCTGAACCATTCCCACAGGACCCGGACGAGATCTACGAGATGTGTGACGAAGGGGAGCCCACGGAGGACCCCAGCCCTAGACCCAGGGCCAGAGATGAAGTGTGGTCTACTCAGCAAGACACCAGGAAGCCACCACAAGATCCAGAACTCAGGAAGGAGAACAGCCCCCAGCCACAGCAGGTGCCATCCACGGACCCAAAGGTGCTGAAGCAGATGAGGAAGGCGGAGAAGGCAGAGAGGGAGTTCCGGAAGAAGTTCAAGTTTGAGGGGGAGATTGTGATTCACACGAGGATGATGATCGACCCCAACGCCAAGACCCGTCGTGGGGGTGGCAAGCACCTGGGGATCCGGCGCGGAGAGATCCTGGAGGTCATTGAGTTCACCAACAAGGATGAGATGCTATGCCGGGACCCCAAGGGCAAGTATGGCTATGTGCCCAGGACAGCGCTCCTTCCCCTGGAAACGGAGGTGTATGACGACGTTGACGTCGGCATCTGGGGATAA

XM_004865416.1 Coding sequence

Znf414 zinc finger protein 414, transcript variant X3

Length: 1194 bp    Location: 1264665..1261428   Strand: -
>XM_004865416.1
ATGGAGGAGGAGGAACCCTCGCAGCCCAGTCCGGACATGCTGGCCCCTGCAGAGCCCAGCTCCAATGAGACCGAAAAGGAGGTGTTGTCTCCGGTTGTGGCTGCTTTTGCCACCTCCATGGAGGAGGAGCTTGGCCCTGACCGAGCAGCCACACCCCCGGTGTGGGAATGTGGAGGGCCTGGAGGGACACAGCAGGGTGCCTCCCAGGCCTCAGACAGCTGCCAGCCTGACCCAGAAGCCAGCCCCGCCCCGCCCAGCACAGTCTCCGGAACCAGTGAGGACCTGCGCCCTCCCAAACGACGCCCACCGCCAGGGACGCAAATACCCTGCTCCAGCCCTGGCTGCTTCCTCAGTTTCCCCAGTGTTCGTGACCTGGCGCAGCATCTCCGTACCCACTGCCCGCCCACCCAGTCCTTAGAAGGTAAGCTCTTCCGCTGCTCCGCCCTGAGCTGCACAGAGAGCTTCCCCAGCATGCAGGAGCTGGTGGCCCATGGCAAGCTGCATTACAAGCCCAATCGCTACTTCAAGTGTGAGAACTGCCTCCTGCGCTTCCGCACGCACCGCTCGCTCTTCAAGCACCTGCATGTTTGCGCAGAGCATGCTCAGAGCCCGGCCGCGCCGCCGCCCCCCGCCCTGGACAAGGAGCCCCCAGCACCTGAGCGCCCCTCGGAGTCTGACCCCGCGTCGGCGGCCGGCCTGCCGTTCCCGCTGCTCGAGCCCTTCACAACCCCCTCCTCTGTACCCACTGGGTCCTTCCTACCCTACTTGAACCCCGCGCCCTTTGGCCTAAGTCCCCCACGCCTGCGCCCCTTCCTGGCCACCGCTCCCGGGCCACCAGCCTCCAGCGCCGCTGTCTGGAAAAAGAGCCAAGGTGCTGGCGGCAGCCCCCGAAGACCGCAGGGCGGCTCCGATGCGCCCTCAGCGCACGCGGCCCCGAGCCGCATCGTGTGGGAGCACACGCGCGGCCGCTACTCGTGCATGCAGTGCGCCTTCTCCACGGCCTCGCGGCCCGCCATGACCCTGCACCTACAGGACCACCGCCCCGGCGCCCCCGCAGCCCTGCCGCCCGGGCCGCCGCGCCCCGACGCCCCGGCGGCGCCCCCTGCTCTGCCCCACCCGGACCCCACCCCGCTTGCGCCTAAGGTGTCGCAGCTGATGTCCGAGGGGGAGCGTCCGGTTTTCTCACTGCTTTGA

XM_004865397.1 Coding sequence

Ndufa7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa

High confidence: 3 potential gene matches
Length: 342 bp    Location: 1116044..1109495   Strand: -
>XM_004865397.1
ATGGCGTCCGCTACTCGCGTTGTCCAGAAGCTGCGGAACTGGGCTTCCGGGCAAGATCTGCAGGCGAAGCTGCAGCTGCGCTACCAGGAGATCGCCAAGCGGACCCAGCCTCCTCCCAAGCTCCCTGTGGGCCCCAGCCACAAGCTGTCCAGCAATTACTACTGCACACGCGATGGCCGCCGGGAAGCAGTGCCCCCCTCAGTCATCATGTCATCGCAGAAGGTGCTGGCGTCAGGCAAGACAGCAGACAGCTCAGTCGTGGCGGCCCCTGAGAAGAAGGCTGTGACTCCCGGTCCTCCCCTGAAGAAGTGGGAGCTGTCTCAGGACCAGCCGTACCTGTGA

XM_004865513.1 Coding sequence

Ap1m2 adaptor-related protein complex 1, mu 2 subunit, transcript variant X4

High confidence: 4 potential gene matches
Length: 1272 bp    Location: 2647569..2638515   Strand: -
>XM_004865513.1
ATGTCCGCCTCGGCCGTGTTCATCCTAGACATCAAGGGCAAGCCCCTGATCAGCCGAAACTACAAGGGTGATGTGGCCATGAGCGAGATCGACCACTTCATGCCTCTGCTCATGCAGCGTGAGGAGGAGGGCGCGCTGGCCCCACTGCTGAGCCACGGCCGTGTACACTTCCTGTGGATCAAACACAGCAACCTGTACTTGGTGGCCACCACGCTGAAGAACGCCAACGCCTCTCTGGTCTACTCCTTCCTCTACAAGACGGTGGAGGTCTTCTGTGAGTACTTCAAGGAGCTGGAGGAGGAGAGCATCCGTGACAACTTTGTCATCGTGTACGAGCTGCTGGACGAGCTCATGGACTTCGGCTTCCCACAGACTACGGATAGCAAGATCCTGCAGGAGTACATCACACAACAGGGCAACAAGCTGGAGACGGGCAAGTCTCGGGTGCCGCCCACTGTCACCAACGCAGTGTCTTGGCGCTCAGAGGGCCTCAAGTACAAGAAGAACGAGGTCTTCATCGACGTCATAGAGTCTGTCAACCTGCTGGTCAATGCCAACGGCAGTGTCCTGCTCAGTGAGATCGTGGGCAGCATCAAACTTAAGGTGTTTCTGTCCGGGATGCCAGAGCTGCGGCTGGGCCTCAACGACCGCGTGCTCTTTGAGCTCACTGGCCGCAGCAAGAACAAGTCCGTGGAGCTGGAGGACGTCAAGTTCCACCAGTGCGTGCGGCTGTCACGCTTCGACAACGACCGCACCATCTCCTTCATCCCGCCCGATGGCGACTTTGAGCTCATGTCCTACCGGCTCAGCACACAGGTCAAGCCGCTCATCTGGATTGAGTCTATCATCGAGAAGTTCTCCCACAGCCGAGTGGAGATCATGGTCAAGGCTAAGGGGCAGTTTAAGAAGCAGTCTGTGGCCAATGGTGTGGAGATTTCCGTGCCTGTCCCCAGTGATGCTGATTCCCCTCGTTTCAAGACCAGTGTGGGGAGTGCCAAGTATGTGCCAGAGAAGAATGTCGTTATCTGGAGTATTAAATCCTTCCCGGGGGGCAAGGAGTACCTGATGCGGGCCCACTTTGGCCTCCCCAGCGTGGAGAAGGAGGAGGTGGATGGCCGGCCCCCCATCGGGGTCAAGTTTGAGATCCCCTACTTCACCGTTTCCGGCATCCAGGTCCGATACATGAAGATCATTGAGAAGAGTGGTTACCAGGCCCTGCCCTGGGTTCGCTACATCACCCAGAGTGGAGATTATCAACTTCGGACCAGCTAG

XM_004865728.1 Coding sequence

Tnfaip8l1 tumor necrosis factor, alpha-induced protein 8-like 1, transcript variant X2

Length: 561 bp    Location: 5130080..5129128   Strand: -
>XM_004865728.1
ATGGACCCCTTCAGCACCAAGAGCCTGGCACTGCAGGCGCAGAAGAAGGTCCTGAGCAAGATGCCCTGCAAGGCCGTGGTGGCGGCCCTGGTGGACGACACGAGCAGCGAGGTCCTGGACGAGCTGTACCGCGCCACCAAGGAGTTTACGCGCAGCCGGCGCGCTGCGCAGCAGCTGCTCAAAGACCTGGTGAAGGTGGCAGTGAAGGTGGCCGTGCTGCTGCGCGCTGGGCAGCTGGGCGCCGAGGAGCTGGCGCGGCTGCGGCGCTTCCGGCAGCGGGCGCGGGGCCTGGCCATGACGGCCGTGAGCTTCCGCCAGGTGGCCTTCACCTTCGACCGCCGAGTGCTGGCCGCGGGGCTGCTCGAGTGCCGCGACCTGCTGCACCAGGCGGCCGGGCCGCACCTCACCGCCAAGTCCCACGCGCGCATCTCCCGTGTCTTCGGCCACCTGGCGAACGGCGACTTCCTGGCTGCGCTGTACGGCCCAGCCGAGCCCTACCGCTCGCACCTGGACAAGATCTGCGAGGGTCTGGGCCGGATGCTGGAGGGCGGAACCATCTGA

XM_004866042.1 Coding sequence

LOC101700634 CD209 antigen-like protein E-like

Length: 696 bp    Location: 805604..799782   Strand: -
>XM_004866042.1
ATGGCTCTGAGACTCTTCTGTACCACGTTCTTCAACCTCAATGCACTCATCCTGCAGATTGGAAGTCCCTGGTCAGTCACTGGCTGCCAGAAGTTGGCATGGTGTCAGGACAAAGGTCTCATCTCCCTGGTCCTGCAGCTGCTTGCCCTCATTCTCTTCGCTGGGCTCCTGGTGGCCATCCTTGCCCAAGTCTCCAAGGTCCCCAGCAGTGAGGAGAGGAAGAAGGAGAAGTCAAACCAGGAGAAAATGTATCAGGAACTGAACCAGCTGAAGACTGGATTTGACTGTCTGTGCCGTCCCTGCCCCTGGGACTGGACATTCTTCCAAAGAAAGTGCTACTTCTTCTCCAGGTCCCAACGGGACTGGCGTGACTCCATCACCACTTGCCAGGAAGTGGGGGCTCAACTCGTCATTGTGGAAAATGCTGAAGAGCAGAGCTTCCTGCAGCAGACTTCGAAGAGTAAAGGCTACGCCTGGATGGGACTCTCAGACCTGAACAAGGAATCCGAGTGGCACTGGGTGGATGGTTCACCTCTGTCGCTCAGCCTTGTTCGGTACTGGAACAAAGGGCAGCCCAACAACTATGAGGAACAAGACTGTGTGGAATTTTGAGATGATGGCTGGAATGATGCCAAGTGTGATCTCCAGAAATTCTGGATCTGCAAAAAGCCCGGCACTTCATGCTCCACTGAGTGA

XM_004865507.1 Coding sequence

Cdkn2d cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4), transcript variant X1

Length: 576 bp    Location: 2636532..2634351   Strand: -
>XM_004865507.1
ATGATGCTGGAGGAGGTCCGCGCCGGCGACCGGCTGAGTGGGGCCGCGGCCCGGGGAGACGTGCAGGAGGTGCGCCGCCTGCTGTACCGCGAGCTCGTGCACCCGGACGCCCTCAACCGCTTCGGCAAGACGGCGCTGCAGGTGATGATGTTTGGCAGCCTCACCATCGCCCAGGAGCTGCTGAAACAGGGTGCCAGCCCCAATATCCAGGATGCCTCTGGCACCAGTCCGGTCCACGATGCAGCCCGAACTGGATTCCTGGACACCCTGAAGGTCCTCGTGGAATACGGCGCTGATGTCAACATGCCCGATGGCACTGGGTCACTGCCCATCCACCTGGCGGTGCGTGAGGGCCACGCCTCGGTGGTCAGCTTCCTGGCTCCGGAGTCTGATCTCCATCACAGGGACGCCGCGGGGCTCACACCTCTGGAGCTGGCACGGCAGAGGGGGGCTCAGGACCTCTTGGACATCCTGCAGGGGCACAAGAGAAGAGCTCTGCTAGGCGACAGACACCTGAACGGTTCAGTTTCTTCTGCACCCCAGGGGTGCAGACATGACCCAAGGGCAGAGCGTTAA

XM_004866037.1 Coding sequence

LOC101696965 olfactory receptor 7E24-like

Length: 1110 bp    Location: 40170..33471   Strand: -
>XM_004866037.1
ATGCAGCCAGAAAATATCTCCAACACTACAAAATTTATTCTCCTGGAATTGTCAGATGACCCACACTTGCAGCCCCTTCCTTTTTGGACTGTTCCTGTCCATGAACCTGGTCACAAGGCTCGGGAACCTGCTCCTCATCCTGGCCATCAGCTGTGTCTCCCACCTCCGTGTTTAAACAATTCAGATGCACAAATTCTAACACATGTCTCAGAATTCTATCTGCTGGGATTCACAGAAGATCCCAACTTGCAACCAATTCTTGTTGGGCTGTTCCTGTCCATGTACCTGGTCACAGTGCTTGGGAACCTGCTCATCATCCTGGCCGTCTGCTGTGACTCCCACCTCCACACCCCCATGTACTTCTTCCTCTCCAACCTGTCCTTGGCTGACATCTGTTTCACCTCCACCACGGTCCCAAAGATGATTGTGGACATCCAGAGCGAGAGCAGAGTCATCTCCTCTATGGGCTGCCTCACACAGATGTCTGTGTTTCTCATTTTTGCTTGTATGGATGACATGCTTCTAAGTGTGATGGCCTATGACAGGTTTGTGGCCGTCTGCCACCCTCTGCATTACCAGGTCATCATCAACCCTCACTTCTGTGTCTTCTTAGTGCTAGTGTCATTTTTAATCAGTCTTTTGGACTCACTGCTGTACAACTTACTTATCTCACAACTGACATCCTTGAAGGGTATGCAAATTGCCAGTTTCTTCTGTGACCCTTCTCAGCTTCTTAATCTTGCCTGTTCTGATACTTTTATCAATAACATCATCATGTATTTTATTCTTGCTGTCTTTGGATTTCTTCCTATCTCGGGGATCTTTTTCTCTTACTATAAAATTACTTCCTCCATTCTGAGGGTTCCCTCCTCGGGTGGGAAGTATAAGGCCTTCTCCACCTGTGGGTCTCACCTTTCAGTAGTTTGTCTGTTTTATGGCACAAGCCTTGGAGTGTACCTCGACTCAGCTCTATCACATTCTCCCAGAAACAGTGCAGTGGCTTCATTGATGTACACTGTGGTCACTCCTATGCTGAATCCCTTCATCTACAGCCTGAGGAACAGGGATATTAAAGATGCCTTGAGGAGGCTCCACAGCAGAATAGTCTAA

XM_004866036.1 Coding sequence

LOC101696598 olfactory receptor 18-like

Length: 912 bp    Location: 28923..24272   Strand: -
>XM_004866036.1
ATGACACTAGGTGCCATATCTGGTCCCCTACCTCCTGTTCTCTGGAAATACATCCTGCTCTACTTTCCAGCTGCCAAGAACAAGCAGCTTTGTTGCACCATACCTATCTGCCATGCTGTTGCTGCTTTGGAGTCAGATGATCTAGACTTGCAGCCCATCCTCTTTGGACTGTTCCTGTCCATGTACCTGGTCACATTGCTTGGGAACCTGCTCATCATCCTGGCCATCATCTCGGACGCCCACCTCCACATCCCCATGTATTTCTTCCTCTCCAACTTGTCCTTTGCTGACATCTTTCTCATCTCCACCACAGTCCCAAAGTTGATTACTGTGATGGCCTATGACCGCTTTGTGGCCGTCTGCTGCCCCCTGCGTTATTCAGTCATCGCGGACCCTTGTGTCTGTGTTCTCTTAATCTTGATGGCTTTATTCGTTAATCTTTTGGTCTCGCGTTTGCACAATATTATTGTCTTAGAATTTAAATACTTTAGGAAAGTGGAAATTGCTAATTTCTCCTGTGACCCTTCTCAACTTCTTCGTCTTTCCTGTTCTGATATATTTACTGATAATACAGTCATGTATTTTGTTTTTGTCATCTCTGGATTTCTTCCTGTCACAGGAATATTTTTCTCTTACTATAAAATTGTGTCTTCCATTCTGAGAATCCCAGCATCAGATGGGAAGTATAAGGCCTTCTCCACCTGTGGGTCTCATCTCTCTGTTGTTTGCTTATATTATGGCACAGGCTTTGGAGTGTATCTTGGTTCAGCTCTATTACATTCTCCCAGAAACAGTGCAGTGGCCTCACTGATGTACACTGTGGTCACCCCTATGCTGAATCCCTTCATCTATGCCCTGAGGAATAGGGACATTACACGTGCCCTGAGGAGGCTTCACATAGGAGAAAAGAAC

XM_004865298.1 Coding sequence

Znf699 zinc finger protein 699, transcript variant X3

Length: 1803 bp    Location: 73545..61897   Strand: -
>XM_004865298.1
ATGGGGGAAGAAAGAAGAAATGCTGAGTTACAGAAAAATATGATACAGGATTCACTGACCTTTGAAGATTTGGCTGTGGACTTTAGCCCTGAGGAATGGGCTTTGTTGGATCTTGCTCAGAGAAAACTCTACAGAGATGTGATGCTGGAAACCTTCCGGAACCTGGCTTCCCTAGGTTTTAAGATTCTACTTAAAACTAATGAATCAGTTGTTCTGCCTGATAATAATTTAGAAAAAGTATCTAATGAACAAAAAGTCATAAGATTCAATAGAAATGGTTCTTGGTTCTCCATTTTACATGCAAACTGGGAACACTATGGTATTGATGAGAAGAACAAAAGCCATGGGAGACTTTTGAGTCACATGGTGGAGAACGTCTATGAATGTAATGAAGAAAATCAAAGTGAACAAATTCCAAATCTTAATGTGCTCAAGAGAACTACTGAAGTAAACTCCTATGAATGTCATGAGTGTGGAAAAGCCTTCCTGTGCCATTCATCCCTTAAGAATCACATCAGATCTCATACCAGAAGCAAACCCTACCAGTGTCAGGAATGTGGGAAAACCTTCCATTTTCTTGCTTATTTTAAAAAGCATATGAAGACTCCTACTGAAGAGAAGCCCTATGAATGTAAGGAGTGTGCCATACTCTTCAGTTGTTCCTCATTCTTTAGGGCACATATGAAAATTCACAGTGGAAAAGTAAACTATGAATGTAAGGAATGTGGGAAAACTTTCAGTACTTCTTCTTATCTCACTGAACATAAAAGAATTCATAGTGGAGATAAGCCTTGTGAATGTGATGAGTGTGGGAAGGCCTTTAGTTGTCCTTCATCACTCTCCCAACACAAAAGAATTCATAGTGGGGATAAGCCGTATGAATGCAAGGAATGTGGGAAGGCCTTTAGTTCTTCCTCTCACCTCATAACACATATCAGAATTCACACTGGAGAGAAGCCTTACGAATGCAAAGAGTGTGGGAAGGCCTTCAGTGAGTCCTCAAAACTCAGTCGACATATGAGAGCACATACTGGAGAGAAACCATATAAATGTAAGGACTGTGGGAAAACCTACAATTGCCCCTCCTCCTTGAGCATCCATATGAGGAAACACACTGGAGAGAAACCCTATGAATGTCTGGAATGTGGAAAAGCCTTCTATCTTCCCACTTCCCTGTATACACATGTGAAAAATCAGAGTAGAGAGAAACCATATGAGTGTAAACAATGTGGGAAGGCCTTCAGTTGTCCCTCATCCTTTAAAGCACATGTGAGAGATCATGCCCGAGAGATACAATATCAGTGTAAGGAGTGTGGGAAGGTCTTCAGTCGTTCCTCATCCCTCACCGAACACTTGAGAACTCACAGTGGAGAGAAGCCTTATCAGTGTAAGGAATGTGGGAAAGCCTTTATTAGTTCCTCCCAGCTTACAGTTCACAGAAGAACTCACACTGGAGAGAAACCTTATGAATGTAAGAATTGTGAGAAATCCTTTATGTATTTCTCAGCCTTCAGCTTCCATATGAGAATGCACACAGGGGAAAAACCATATGAGTGCAAGGAATGTGGGAAGGCTTTTCGACATTCCTCATACCTAACCATCCATGCAAGAATGCACACTGGAGAAAAACCCTTTGAATGTCTGGAATGTGGGAAAGCCTTCAGGTGTCCTTCATCTTTTCAAAGACACGTGAAAAGCCACACAGGAGAGAAACCATATGAATGTAAGGAATGTGGGAAAGCCTTTATTTGTGCAGCCTACCTTCGAAGACATGTGAAAATCCACAATAGAGGAAAAATATGA

XM_004865297.1 Coding sequence

Znf699 zinc finger protein 699, transcript variant X2

Length: 1920 bp    Location: 73479..61897   Strand: -
>XM_004865297.1
ATGCATCCTGTTCTCACTTTGCAGAAAGGGAAAGCACCTCTGCTTTGGGGCCAGGGGACGAGAATCTCCACGTCGCCGTCGCTGCGCGGGTCCCAGGATTTCTGCGTGCTGGGTGACATGGGGGAAGAAAGAAGAAATGCTGAGTTACAGAAAAATATGATACAGGATTCACTGACCTTTGAAGATTTGGCTGTGGACTTTAGCCCTGAGGAATGGGCTTTGTTGGATCTTGCTCAGAGAAAACTCTACAGAGATGTGATGCTGGAAACCTTCCGGAACCTGGCTTCCCTAGGTTTTAAGATTCTACTTAAAACTAATGAATCAGTTGTTCTGCCTGATAATAATTTAGAAAAAGTATCTAATGAACAAAAAGTCATAAGATTCAATAGAAATGGTTCTTGGTTCTCCATTTTACATGCAAACTGGGAACACTATGGTATTGATGAGAAGAACAAAAGCCATGGGAGACTTTTGAGTCACATGGTGGAGAACGTCTATGAATGTAATGAAGAAAATCAAAGTGAACAAATTCCAAATCTTAATGTGCTCAAGAGAACTACTGAAGTAAACTCCTATGAATGTCATGAGTGTGGAAAAGCCTTCCTGTGCCATTCATCCCTTAAGAATCACATCAGATCTCATACCAGAAGCAAACCCTACCAGTGTCAGGAATGTGGGAAAACCTTCCATTTTCTTGCTTATTTTAAAAAGCATATGAAGACTCCTACTGAAGAGAAGCCCTATGAATGTAAGGAGTGTGCCATACTCTTCAGTTGTTCCTCATTCTTTAGGGCACATATGAAAATTCACAGTGGAAAAGTAAACTATGAATGTAAGGAATGTGGGAAAACTTTCAGTACTTCTTCTTATCTCACTGAACATAAAAGAATTCATAGTGGAGATAAGCCTTGTGAATGTGATGAGTGTGGGAAGGCCTTTAGTTGTCCTTCATCACTCTCCCAACACAAAAGAATTCATAGTGGGGATAAGCCGTATGAATGCAAGGAATGTGGGAAGGCCTTTAGTTCTTCCTCTCACCTCATAACACATATCAGAATTCACACTGGAGAGAAGCCTTACGAATGCAAAGAGTGTGGGAAGGCCTTCAGTGAGTCCTCAAAACTCAGTCGACATATGAGAGCACATACTGGAGAGAAACCATATAAATGTAAGGACTGTGGGAAAACCTACAATTGCCCCTCCTCCTTGAGCATCCATATGAGGAAACACACTGGAGAGAAACCCTATGAATGTCTGGAATGTGGAAAAGCCTTCTATCTTCCCACTTCCCTGTATACACATGTGAAAAATCAGAGTAGAGAGAAACCATATGAGTGTAAACAATGTGGGAAGGCCTTCAGTTGTCCCTCATCCTTTAAAGCACATGTGAGAGATCATGCCCGAGAGATACAATATCAGTGTAAGGAGTGTGGGAAGGTCTTCAGTCGTTCCTCATCCCTCACCGAACACTTGAGAACTCACAGTGGAGAGAAGCCTTATCAGTGTAAGGAATGTGGGAAAGCCTTTATTAGTTCCTCCCAGCTTACAGTTCACAGAAGAACTCACACTGGAGAGAAACCTTATGAATGTAAGAATTGTGAGAAATCCTTTATGTATTTCTCAGCCTTCAGCTTCCATATGAGAATGCACACAGGGGAAAAACCATATGAGTGCAAGGAATGTGGGAAGGCTTTTCGACATTCCTCATACCTAACCATCCATGCAAGAATGCACACTGGAGAAAAACCCTTTGAATGTCTGGAATGTGGGAAAGCCTTCAGGTGTCCTTCATCTTTTCAAAGACACGTGAAAAGCCACACAGGAGAGAAACCATATGAATGTAAGGAATGTGGGAAAGCCTTTATTTGTGCAGCCTACCTTCGAAGACATGTGAAAATCCACAATAGAGGAAAAATATGA

XM_004865304.1 Coding sequence

Znf317 zinc finger protein 317, transcript variant X5

Length: 1803 bp    Location: 172602..153899   Strand: -
>XM_004865304.1
ATGGCAGCTCCTGGGCTGTCTCCCACCTGTGCTGTGTCCACCCAGGACCCTGCCTGTCTCCAAGAGTCAGAATTCCCTCTTTCTTCAACTCACCATTCCTGTTCCCAGGACTTAAACCTGTTTGTGTGGCATGGTCTGGAGCCTCTCCCAGGAGCCAGAGATTCTAATCAGGAATCTGTGACTTTCCAGGACGTGGCTGTGGACTTCACTGAGAAGGAGTGGCCCCTCCTGGATCCCTCTCAGCGGAAACTGTACAGAGACGTGATGCTGGAGAACTACAGCAACCTGACCTCCCTGGGGTATCAGGTTGGAAAACCCAGCCTCATCTCTCACTTGGAGCAAGAAGAGGAGCCCAGGATGGAGGAGAGGGGGACTCAGCAAGGGGCTTGTCCAGATTGGGAAACTCCATCTAAAACCAAGTGGTCGATTCTCATGGAAGATATATTTGGGAAGGAAACATCTGGTGGTGTGACCATGGCACAGGACAGAGCTCGCCTTGGGGAGAAGTCGGCCGAATATGAGCGCTTGTTTGACGTCTTCAGCATGGGTGCTCACCTTTCGCAGCAGCTGGGAAGGCAAGCAGGCAAGAGGCCCTTTCCCCGCCACAGCTACGGCGTGGCCTTCAAAGCCCGGGCGCCCCTCTCGCAGCGCGGGGCCGCCTACGACGGGCGGAAGATGCACGAGTGCCACCAGTGCCAGAAAGCCTTCACCACCAGCGCCTCCCTCACGCGGCACCGGAGGATCCACACCGGGGAGAAGCCCTACGCGTGCCGGGACTGCGGCAAGGCCTTCAACGACCCGTCGGCCCTCCGGAGCCACGCGCGGACCCACCTCAAGGAGAAGCCCTTCGACTGCAGCCAGTGTGGCAGCGCCTTCCGCACGCTGTCGGCCCTGAAGATCCACACGCGGGTGCACACCGGCGAGCGGCCCTACAAGTGCGACGAGTGCGGCAAGGCCTACGGCCGGAGCTGCCACCTGATAGCGCACAAGCGCACGCACACCGGGGAGCGGCCCTACGAGTGCCAGGACTGCGGCAAGGCCTTCCAGCACCCCTCGCACCTGAAGGAGCACGTGCGCAACCACACCGGGGAGAAGCCCTACGCCTGCGCGTTGTGCGGCAAGGCCTTCCGCTGGAAGTCCAACTTCAACCTGCACAAGAAGAACCACGCCGTGCAGAAGACCTACGCCTGCAAGGAGTGCGGCAAGGCCTTCGGGGACCTGGTGTCGCGCCGGAAGCACACGCGGACTCACCTGGTGAGGAAGCCCGTGGAGTGCCGCCAGTGCGGGAAGGCCTTCCGCAACCAGTCCATCCTGAAGACCCACATGAACTCGCACACCGGCGAGAAGCCCTACGCCTGCGACCTGTGCGGCAAGGCCTTCAGCGCCAGCTCCAACCTCACCGCGCACCGGAAGATCCACACGCAGGAGCGGCGCTATGAGTGTGCGGCCTGCGGCAAGGTCTTCGGCGACTACCTGTCCCGCAGGAGGCACATGAGCGTGCACCTGGTGAAGAAGCGCGTGGAGTGCCGGCAGTGCGGCAAGGCCTTCCGCAACCAGTCCACGCTCAAGACGCACATGCGGAGCCACACGGGGGAGAAGCCCTACGAGTGTGACCACTGTGGCAAGGCCTTCAGCATCGGCTCCAACCTCAACGTGCACCGGCGGATCCACACGGGCGAGAAGCCCTACGAGTGCCTGGCCTGTGGGAAGGCCTTCAGCGACCACTCCTCCCTGCGCAGTCACGTGAAAACCCACCGCGGGGAGAAGCTCTTCACCTCCTCCGTGTGGAGGAGGCTGCAGTGA

XM_004865305.1 Coding sequence

Znf317 zinc finger protein 317, transcript variant X6

Length: 1797 bp    Location: 172602..153899   Strand: -
>XM_004865305.1
ATGGCAGCTCCTGGGCTGTCTCCCACCTGTGCTGTGTCCACCCAGGACCCTGCCTGTCTCCAAGAGTCAGAATTCCCTCTTTCTTCAACTCACCATTCCTGTTCCCAGGACTTAAACCTGTTTGTGTGGCATGGTCTGGAGCCTCTCCCAGGAGCCAGAGATTCTAATCAGGAATCTGTGACTTTCCAGGACGTGGCTGTGGACTTCACTGAGAAGGAGTGGCCCCTCCTGGATCCCTCTCAGCGGAAACTGTACAGAGACGTGATGCTGGAGAACTACAGCAACCTGACCTCCCTGGGGTATCAGGTTGGAAAACCCAGCCTCATCTCTCACTTGGAGCAAGAAGAGGAGCCCAGGATGGAGGAGAGGGGGACTCAGCAAGGGGCTTGTCCAGATTGGGAAACTCCATCTAAAACCAAGTGGTCGATTCTCATGGAAGATATATTTGGGAAGGAAACATCTGGTGGTGTGACCATGGACAGAGCTCGCCTTGGGGAGAAGTCGGCCGAATATGAGCGCTTGTTTGACGTCTTCAGCATGGGTGCTCACCTTTCGCAGCAGCTGGGAAGGCAAGCAGGCAAGAGGCCCTTTCCCCGCCACAGCTACGGCGTGGCCTTCAAAGCCCGGGCGCCCCTCTCGCAGCGCGGGGCCGCCTACGACGGGCGGAAGATGCACGAGTGCCACCAGTGCCAGAAAGCCTTCACCACCAGCGCCTCCCTCACGCGGCACCGGAGGATCCACACCGGGGAGAAGCCCTACGCGTGCCGGGACTGCGGCAAGGCCTTCAACGACCCGTCGGCCCTCCGGAGCCACGCGCGGACCCACCTCAAGGAGAAGCCCTTCGACTGCAGCCAGTGTGGCAGCGCCTTCCGCACGCTGTCGGCCCTGAAGATCCACACGCGGGTGCACACCGGCGAGCGGCCCTACAAGTGCGACGAGTGCGGCAAGGCCTACGGCCGGAGCTGCCACCTGATAGCGCACAAGCGCACGCACACCGGGGAGCGGCCCTACGAGTGCCAGGACTGCGGCAAGGCCTTCCAGCACCCCTCGCACCTGAAGGAGCACGTGCGCAACCACACCGGGGAGAAGCCCTACGCCTGCGCGTTGTGCGGCAAGGCCTTCCGCTGGAAGTCCAACTTCAACCTGCACAAGAAGAACCACGCCGTGCAGAAGACCTACGCCTGCAAGGAGTGCGGCAAGGCCTTCGGGGACCTGGTGTCGCGCCGGAAGCACACGCGGACTCACCTGGTGAGGAAGCCCGTGGAGTGCCGCCAGTGCGGGAAGGCCTTCCGCAACCAGTCCATCCTGAAGACCCACATGAACTCGCACACCGGCGAGAAGCCCTACGCCTGCGACCTGTGCGGCAAGGCCTTCAGCGCCAGCTCCAACCTCACCGCGCACCGGAAGATCCACACGCAGGAGCGGCGCTATGAGTGTGCGGCCTGCGGCAAGGTCTTCGGCGACTACCTGTCCCGCAGGAGGCACATGAGCGTGCACCTGGTGAAGAAGCGCGTGGAGTGCCGGCAGTGCGGCAAGGCCTTCCGCAACCAGTCCACGCTCAAGACGCACATGCGGAGCCACACGGGGGAGAAGCCCTACGAGTGTGACCACTGTGGCAAGGCCTTCAGCATCGGCTCCAACCTCAACGTGCACCGGCGGATCCACACGGGCGAGAAGCCCTACGAGTGCCTGGCCTGTGGGAAGGCCTTCAGCGACCACTCCTCCCTGCGCAGTCACGTGAAAACCCACCGCGGGGAGAAGCTCTTCACCTCCTCCGTGTGGAGGAGGCTGCAGTGA

XM_004865302.1 Coding sequence

Znf317 zinc finger protein 317, transcript variant X3

Length: 1803 bp    Location: 172602..153899   Strand: -
>XM_004865302.1
ATGGCAGCTCCTGGGCTGTCTCCCACCTGTGCTGTGTCCACCCAGGACCCTGCCTGTCTCCAAGAGTCAGAATTCCCTCTTTCTTCAACTCACCATTCCTGTTCCCAGGACTTAAACCTGTTTGTGTGGCATGGTCTGGAGCCTCTCCCAGGAGCCAGAGATTCTAATCAGGAATCTGTGACTTTCCAGGACGTGGCTGTGGACTTCACTGAGAAGGAGTGGCCCCTCCTGGATCCCTCTCAGCGGAAACTGTACAGAGACGTGATGCTGGAGAACTACAGCAACCTGACCTCCCTGGGGTATCAGGTTGGAAAACCCAGCCTCATCTCTCACTTGGAGCAAGAAGAGGAGCCCAGGATGGAGGAGAGGGGGACTCAGCAAGGGGCTTGTCCAGATTGGGAAACTCCATCTAAAACCAAGTGGTCGATTCTCATGGAAGATATATTTGGGAAGGAAACATCTGGTGGTGTGACCATGGCACAGGACAGAGCTCGCCTTGGGGAGAAGTCGGCCGAATATGAGCGCTTGTTTGACGTCTTCAGCATGGGTGCTCACCTTTCGCAGCAGCTGGGAAGGCAAGCAGGCAAGAGGCCCTTTCCCCGCCACAGCTACGGCGTGGCCTTCAAAGCCCGGGCGCCCCTCTCGCAGCGCGGGGCCGCCTACGACGGGCGGAAGATGCACGAGTGCCACCAGTGCCAGAAAGCCTTCACCACCAGCGCCTCCCTCACGCGGCACCGGAGGATCCACACCGGGGAGAAGCCCTACGCGTGCCGGGACTGCGGCAAGGCCTTCAACGACCCGTCGGCCCTCCGGAGCCACGCGCGGACCCACCTCAAGGAGAAGCCCTTCGACTGCAGCCAGTGTGGCAGCGCCTTCCGCACGCTGTCGGCCCTGAAGATCCACACGCGGGTGCACACCGGCGAGCGGCCCTACAAGTGCGACGAGTGCGGCAAGGCCTACGGCCGGAGCTGCCACCTGATAGCGCACAAGCGCACGCACACCGGGGAGCGGCCCTACGAGTGCCAGGACTGCGGCAAGGCCTTCCAGCACCCCTCGCACCTGAAGGAGCACGTGCGCAACCACACCGGGGAGAAGCCCTACGCCTGCGCGTTGTGCGGCAAGGCCTTCCGCTGGAAGTCCAACTTCAACCTGCACAAGAAGAACCACGCCGTGCAGAAGACCTACGCCTGCAAGGAGTGCGGCAAGGCCTTCGGGGACCTGGTGTCGCGCCGGAAGCACACGCGGACTCACCTGGTGAGGAAGCCCGTGGAGTGCCGCCAGTGCGGGAAGGCCTTCCGCAACCAGTCCATCCTGAAGACCCACATGAACTCGCACACCGGCGAGAAGCCCTACGCCTGCGACCTGTGCGGCAAGGCCTTCAGCGCCAGCTCCAACCTCACCGCGCACCGGAAGATCCACACGCAGGAGCGGCGCTATGAGTGTGCGGCCTGCGGCAAGGTCTTCGGCGACTACCTGTCCCGCAGGAGGCACATGAGCGTGCACCTGGTGAAGAAGCGCGTGGAGTGCCGGCAGTGCGGCAAGGCCTTCCGCAACCAGTCCACGCTCAAGACGCACATGCGGAGCCACACGGGGGAGAAGCCCTACGAGTGTGACCACTGTGGCAAGGCCTTCAGCATCGGCTCCAACCTCAACGTGCACCGGCGGATCCACACGGGCGAGAAGCCCTACGAGTGCCTGGCCTGTGGGAAGGCCTTCAGCGACCACTCCTCCCTGCGCAGTCACGTGAAAACCCACCGCGGGGAGAAGCTCTTCACCTCCTCCGTGTGGAGGAGGCTGCAGTGA

XM_004865301.1 Coding sequence

Znf317 zinc finger protein 317, transcript variant X2

Length: 1812 bp    Location: 161226..153899   Strand: -
>XM_004865301.1
ATGTGCACACTCACAGTCGGTGGGGGGGCAACTGTTTCTCATGGCTCTTCTTCTCTAGCTGTGTCCACCCAGGACCCTGCCTGTCTCCAAGAGTCAGAATTCCCTCTTTCTTCAACTCACCATTCCTGTTCCCAGGACTTAAACCTGTTTGTGTGGCATGGTCTGGAGCCTCTCCCAGGAGCCAGAGATTCTAATCAGGACGTGGCTGTGGACTTCACTGAGAAGGAGTGGCCCCTCCTGGATCCCTCTCAGCGGAAACTGTACAGAGACGTGATGCTGGAGAACTACAGCAACCTGACCTCCCTGGGGTATCAGGTTGGAAAACCCAGCCTCATCTCTCACTTGGAGCAAGAAGAGGAGCCCAGGATGGAGGAGAGGGGGACTCAGCAAGGGGCTTGTCCAGATTGGGAAACTCCATCTAAAACCAAGTGGTCGATTCTCATGGAAGATATATTTGGGAAGGAAACATCTGGTGGTGTGACCATGGCACAGGACAGAGCTCGCCTTGGGGAGAAGTCGGCCGAATATGAGCGCTTGTTTGACGTCTTCAGCATGGGTGCTCACCTTTCGCAGCAGCTGGGAAGGCAAGCAGGCAAGAGGCCCTTTCCCCGCCACAGCTACGGCGTGGCCTTCAAAGCCCGGGCGCCCCTCTCGCAGCGCGGGGCCGCCTACGACGGGCGGAAGATGCACGAGTGCCACCAGTGCCAGAAAGCCTTCACCACCAGCGCCTCCCTCACGCGGCACCGGAGGATCCACACCGGGGAGAAGCCCTACGCGTGCCGGGACTGCGGCAAGGCCTTCAACGACCCGTCGGCCCTCCGGAGCCACGCGCGGACCCACCTCAAGGAGAAGCCCTTCGACTGCAGCCAGTGTGGCAGCGCCTTCCGCACGCTGTCGGCCCTGAAGATCCACACGCGGGTGCACACCGGCGAGCGGCCCTACAAGTGCGACGAGTGCGGCAAGGCCTACGGCCGGAGCTGCCACCTGATAGCGCACAAGCGCACGCACACCGGGGAGCGGCCCTACGAGTGCCAGGACTGCGGCAAGGCCTTCCAGCACCCCTCGCACCTGAAGGAGCACGTGCGCAACCACACCGGGGAGAAGCCCTACGCCTGCGCGTTGTGCGGCAAGGCCTTCCGCTGGAAGTCCAACTTCAACCTGCACAAGAAGAACCACGCCGTGCAGAAGACCTACGCCTGCAAGGAGTGCGGCAAGGCCTTCGGGGACCTGGTGTCGCGCCGGAAGCACACGCGGACTCACCTGGTGAGGAAGCCCGTGGAGTGCCGCCAGTGCGGGAAGGCCTTCCGCAACCAGTCCATCCTGAAGACCCACATGAACTCGCACACCGGCGAGAAGCCCTACGCCTGCGACCTGTGCGGCAAGGCCTTCAGCGCCAGCTCCAACCTCACCGCGCACCGGAAGATCCACACGCAGGAGCGGCGCTATGAGTGTGCGGCCTGCGGCAAGGTCTTCGGCGACTACCTGTCCCGCAGGAGGCACATGAGCGTGCACCTGGTGAAGAAGCGCGTGGAGTGCCGGCAGTGCGGCAAGGCCTTCCGCAACCAGTCCACGCTCAAGACGCACATGCGGAGCCACACGGGGGAGAAGCCCTACGAGTGTGACCACTGTGGCAAGGCCTTCAGCATCGGCTCCAACCTCAACGTGCACCGGCGGATCCACACGGGCGAGAAGCCCTACGAGTGCCTGGCCTGTGGGAAGGCCTTCAGCGACCACTCCTCCCTGCGCAGTCACGTGAAAACCCACCGCGGGGAGAAGCTCTTCACCTCCTCCGTGTGGAGGAGGCTGCAGTGA

XM_004865306.1 Coding sequence

Znf317 zinc finger protein 317, transcript variant X7

Length: 1446 bp    Location: 160441..153899   Strand: -
>XM_004865306.1
ATGGAGGAGAGGGGGACTCAGCAAGGGGCTTGTCCAGATTGGGAAACTCCATCTAAAACCAAGTGGTCGATTCTCATGGAAGATATATTTGGGAAGGAAACATCTGGTGGTGTGACCATGGCACAGGACAGAGCTCGCCTTGGGGAGAAGTCGGCCGAATATGAGCGCTTGTTTGACGTCTTCAGCATGGGTGCTCACCTTTCGCAGCAGCTGGGAAGGCAAGCAGGCAAGAGGCCCTTTCCCCGCCACAGCTACGGCGTGGCCTTCAAAGCCCGGGCGCCCCTCTCGCAGCGCGGGGCCGCCTACGACGGGCGGAAGATGCACGAGTGCCACCAGTGCCAGAAAGCCTTCACCACCAGCGCCTCCCTCACGCGGCACCGGAGGATCCACACCGGGGAGAAGCCCTACGCGTGCCGGGACTGCGGCAAGGCCTTCAACGACCCGTCGGCCCTCCGGAGCCACGCGCGGACCCACCTCAAGGAGAAGCCCTTCGACTGCAGCCAGTGTGGCAGCGCCTTCCGCACGCTGTCGGCCCTGAAGATCCACACGCGGGTGCACACCGGCGAGCGGCCCTACAAGTGCGACGAGTGCGGCAAGGCCTACGGCCGGAGCTGCCACCTGATAGCGCACAAGCGCACGCACACCGGGGAGCGGCCCTACGAGTGCCAGGACTGCGGCAAGGCCTTCCAGCACCCCTCGCACCTGAAGGAGCACGTGCGCAACCACACCGGGGAGAAGCCCTACGCCTGCGCGTTGTGCGGCAAGGCCTTCCGCTGGAAGTCCAACTTCAACCTGCACAAGAAGAACCACGCCGTGCAGAAGACCTACGCCTGCAAGGAGTGCGGCAAGGCCTTCGGGGACCTGGTGTCGCGCCGGAAGCACACGCGGACTCACCTGGTGAGGAAGCCCGTGGAGTGCCGCCAGTGCGGGAAGGCCTTCCGCAACCAGTCCATCCTGAAGACCCACATGAACTCGCACACCGGCGAGAAGCCCTACGCCTGCGACCTGTGCGGCAAGGCCTTCAGCGCCAGCTCCAACCTCACCGCGCACCGGAAGATCCACACGCAGGAGCGGCGCTATGAGTGTGCGGCCTGCGGCAAGGTCTTCGGCGACTACCTGTCCCGCAGGAGGCACATGAGCGTGCACCTGGTGAAGAAGCGCGTGGAGTGCCGGCAGTGCGGCAAGGCCTTCCGCAACCAGTCCACGCTCAAGACGCACATGCGGAGCCACACGGGGGAGAAGCCCTACGAGTGTGACCACTGTGGCAAGGCCTTCAGCATCGGCTCCAACCTCAACGTGCACCGGCGGATCCACACGGGCGAGAAGCCCTACGAGTGCCTGGCCTGTGGGAAGGCCTTCAGCGACCACTCCTCCCTGCGCAGTCACGTGAAAACCCACCGCGGGGAGAAGCTCTTCACCTCCTCCGTGTGGAGGAGGCTGCAGTGA

XM_004865307.1 Coding sequence

Znf317 zinc finger protein 317, transcript variant X8

Length: 1446 bp    Location: 160420..153899   Strand: -
>XM_004865307.1
ATGGAGGAGAGGGGGACTCAGCAAGGGGCTTGTCCAGATTGGGAAACTCCATCTAAAACCAAGTGGTCGATTCTCATGGAAGATATATTTGGGAAGGAAACATCTGGTGGTGTGACCATGGCACAGGACAGAGCTCGCCTTGGGGAGAAGTCGGCCGAATATGAGCGCTTGTTTGACGTCTTCAGCATGGGTGCTCACCTTTCGCAGCAGCTGGGAAGGCAAGCAGGCAAGAGGCCCTTTCCCCGCCACAGCTACGGCGTGGCCTTCAAAGCCCGGGCGCCCCTCTCGCAGCGCGGGGCCGCCTACGACGGGCGGAAGATGCACGAGTGCCACCAGTGCCAGAAAGCCTTCACCACCAGCGCCTCCCTCACGCGGCACCGGAGGATCCACACCGGGGAGAAGCCCTACGCGTGCCGGGACTGCGGCAAGGCCTTCAACGACCCGTCGGCCCTCCGGAGCCACGCGCGGACCCACCTCAAGGAGAAGCCCTTCGACTGCAGCCAGTGTGGCAGCGCCTTCCGCACGCTGTCGGCCCTGAAGATCCACACGCGGGTGCACACCGGCGAGCGGCCCTACAAGTGCGACGAGTGCGGCAAGGCCTACGGCCGGAGCTGCCACCTGATAGCGCACAAGCGCACGCACACCGGGGAGCGGCCCTACGAGTGCCAGGACTGCGGCAAGGCCTTCCAGCACCCCTCGCACCTGAAGGAGCACGTGCGCAACCACACCGGGGAGAAGCCCTACGCCTGCGCGTTGTGCGGCAAGGCCTTCCGCTGGAAGTCCAACTTCAACCTGCACAAGAAGAACCACGCCGTGCAGAAGACCTACGCCTGCAAGGAGTGCGGCAAGGCCTTCGGGGACCTGGTGTCGCGCCGGAAGCACACGCGGACTCACCTGGTGAGGAAGCCCGTGGAGTGCCGCCAGTGCGGGAAGGCCTTCCGCAACCAGTCCATCCTGAAGACCCACATGAACTCGCACACCGGCGAGAAGCCCTACGCCTGCGACCTGTGCGGCAAGGCCTTCAGCGCCAGCTCCAACCTCACCGCGCACCGGAAGATCCACACGCAGGAGCGGCGCTATGAGTGTGCGGCCTGCGGCAAGGTCTTCGGCGACTACCTGTCCCGCAGGAGGCACATGAGCGTGCACCTGGTGAAGAAGCGCGTGGAGTGCCGGCAGTGCGGCAAGGCCTTCCGCAACCAGTCCACGCTCAAGACGCACATGCGGAGCCACACGGGGGAGAAGCCCTACGAGTGTGACCACTGTGGCAAGGCCTTCAGCATCGGCTCCAACCTCAACGTGCACCGGCGGATCCACACGGGCGAGAAGCCCTACGAGTGCCTGGCCTGTGGGAAGGCCTTCAGCGACCACTCCTCCCTGCGCAGTCACGTGAAAACCCACCGCGGGGAGAAGCTCTTCACCTCCTCCGTGTGGAGGAGGCTGCAGTGA

XM_004865308.1 Coding sequence

LOC101719927 olfactory receptor 7G2-like

Length: 948 bp    Location: 232984..234457   Strand: +
>XM_004865308.1
ATGAAATTGAAAAACAGAACAACACTCTCAGAATTTCTCCTCCTGGGACTGTCAGATGACCCACAGCTCCAGCCCCTCATCTTTTGCCTGTTCCTGTCCATGTACCTGGTCACCATCCTGGGAAATCTGCTCATCATCCTGGCTGTAAGGGCTGACTCCCATCTCCACACACCCATGTTCTTCTTTCTTTCCAATCTGTCCCTTAATGACATCTGTTTAAGCACTACCACAATTCCAAAGCTGCTGGTGAGCATCCAAACAGAGGATCAGAGCATCACCTATACAGGCTGCCTCACTCAGTGCACCTTTTTCTTGATTTTTGCTGGTTTAGAAAATTGTCTCCTCGCAGTGATGGCCTATGACCGTTATGTGGCCATTTGTCACCCGCTAAGGTACCAGATCATCCTGACCTCTGACTTCTGTGTCTTGCTAGTTCTTTTCTCCCTGATCCTTAGCACTGGGCATGCCCTGCTCCACACTCTGATGGCACTGCAGCTTTCCTTCTGTACAAAAGTGGAAATCCCTCACTTCTTCTGTGAACTTGTCCAGATCATCAAGCTTGCCTGCTCTGATACCTTTATCAATACCCTTCAGATATATTCAGCAGCAGTCATAATCTTTGGTGTTCCTATTGCTGGAATTATTTTCTCTTATACTAAAATTGTCTCCTCTGTTTACAGAATGGCCTCAGTGGGGGGAAGGTATAAAGCTTTCTCCACCTGTGGGTCTCACCTCTCTGTTGTTTTCTTATTCTATGGGACAGGCTTTGGTGTCCACTTGAGTCCTGCTGTTACCGAATCTTTCACCAAGAATGCTGTGGCTTCAGTAATGTACGTTGTGATCCCTCAAATGATGAACCCCTTTATCTACAGTTTGAGGAACAGAGAAATGAAGATAGCTCTGAGATATCTCATTACTGGGAAGCCTTTTATATTCTTGTGTTGTTAG

XM_004865309.1 Coding sequence

LOC101720271 WAS protein family homolog 1-like, transcript variant X1

Length: 1725 bp    Location: 249066..269341   Strand: +
>XM_004865309.1
ATGGCCATGGTGAGGACCCAGCACTCCTTGGCCGGCCAGACCTACGCTGTCCCTCTCATCCAGCCAGACCTGCGGCGAGAGGAAGCCATGCAGCAGGTGGCTGATGCCCTGCAGTACCTGCAGAAGGTCTCAGGAGACATCTTCAGCAGGATCTCCCAGCGCGTGGAGCTGAGCCGCAGCCAGCTGCAGGTCGTTGGGGAGAGGATCTCCTTGGCCCAGGCCAAGATTGAGAAGATCAAGGGCAGCAAGAAGGCCATCAAGGTGTTCTCCAGCGCCAAGTATCCGGCTCCTGAGCGCCTGCAGGAGTACAGCTCCATCTTCGCCGGTGCGCAGGACCCAGGCCTACAGCGACGGCCACGCCATCGCATCCAGAGCAAGCACCGGCCGCTGGATGAGCGGGCCCTACAGGAGAAGCTGAAGTATTTCCCCGTGTGTGTGAGCACCAAGCCGGAGCCCGAGGATGAGACCGAGGAGGGGCTCGGGGGTCTCCCCAGCAACATCAGCTCTGTCAGCTCCCTGCTGCTGTTCAACACCACAGAGAACCTGTACAAGAAGTACGTCTTCCTGGACCCCCTGGCGGGGGCTGTCACAAAAACCCACCTGACGCTGGGGACAGAAACGGAGGAGAAGCTGTTTGATGCCCCTCTGTCCATCAGCAAGCGAGAGCAGCTGGAGCAGCAGGTTCCAGAGAACTACTTCTATGTCCCAGACCTGGGCCAGGTGCCCGAGATCGATGTGCCATCCTACCTGCCGGACCTGCCCGGCATCGCCGATGACCTCATGTACAGCGCTGACCTGGGCCCAGGCATCGCCCCCTCTGCCCCTGGCACCATCCCTGAGCTGCCCACCTTCCAGACAGAGGTGGCGGAGCCCTGCAGGCCAGACCTAGAGGGCGGGGGTCTCACAGCACCTCCGCCGCCTCCGCCGCCTCCGCCACCGCCGCCAGCGCCTGCAGTGCCAGCCAGCGTACCCCCAGGCCTGCCCCCCCAGAGTGCAGCCTTGACCATCCCAGGACCCCCAGAAGACCCCAGCAGCACCCCTCCTTCAGCAGCACTCCAGGGGGCTCCCAAGGAGGTGGTGCTCCCCTCCAGTGGCCGGGCCACCCTGCTGGAGTCCATCCGCCAAGCTGGGGGCATCGGCAAGGCCAAGCTGCGCAGCGTCAAAGAGCGCAAGCTGGAGAAGAAGAAGCAGAAGGAGCAGGAGCAAGTGAGAGCCACGAGCCAGGGCGGGGACCTGATGTCGGATCTCTTTAACAAGCTGGTCATGAGGCGCAAAGGTACGAGGGGACACGCAGCTCCCTGGGGGACCTGGGGTATTCTGCACATCCTGTCTCCAGGAGCGGGCAAACCTGTGCCCAACCAACCCCACTTAACAGCCCTTCCCTCCCAGGCATCTCTGGGAAAGGACCAGGGACAGCAGCCAGCGAGGGCCCGGGAGGAGCCTTCGCCCGCATGTCAGACTCCATCCCGCCTCTGCCGCCCCCACAGCAGGCCCCGGGAGAGGAGGACGAGGACGACTGGGAGTCCTAGGGGCCCGGCGCCCGAGCCCTCCCACACCCCTGAGCCCTGGCTCTGGCTGTGCAGCAGGAACCAGCAGGGAGCTGGGGCTTCCCGGTGCCGTGCCTGGGCCTTGCCTGAGTGGTGCCGCCCCACCACAGCGCCGCTGTCCTCACTAAAGAGGTTGGAGAGGAAATCACTGATGCACCAGGAATCAATAAAGAGGTGA

XM_004865312.1 Coding sequence

LOC101720271 WAS protein family homolog 1-like, transcript variant X4

Length: 1701 bp    Location: 249066..269341   Strand: +
>XM_004865312.1
ATGGCCATGGTGAGGACCCAGCACTCCTTGGCCGGCCAGACCTACGCTGTCCCTCTCATCCAGCCAGACCTGCGGCGAGAGGAAGCCATGCAGCAGGTGGCTGATGCCCTGCAGTACCTGCAGAAGGTCTCAGGAGACATCTTCAGCAGGATCTCCCAGCGCGTGGAGCTGAGCCGCAGCCAGCTGCAGGTCGTTGGGGAGAGGATCTCCTTGGCCCAGGCCAAGATTGAGAAGATCAAGGGCAGCAAGAAGGCCATCAAGGTGTTCTCCAGCGCCAAGTATCCGGCTCCTGAGCGCCTGCAGGAGTACAGCTCCATCTTCGCCGGTGCGCAGGACCCAGGCCTACAGCGACGGCCACGCCATCGCATCCAGAGCAAGCACCGGCCGCTGGATGAGCGGGCCCTACAGGAGAAGCTGAAGTATTTCCCCGTGTGTGTGAGCACCAAGCCGGAGCCCGAGGATGAGACCGAGGAGGGGCTCGGGGGTCTCCCCAGCAACATCAGCTCTGTCAGCTCCCTGCTGCTGTTCAACACCACAGAGAACCTGTACAAGAAGTACGTCTTCCTGGACCCCCTGGCGGGGGCTGTCACAAAAACCCACCTGACGCTGGGGACAGAAACGGAGGAGAAGCTGTTTGATGCCCCTCTGTCCATCAGCAAGCGAGAGCAGCTGGAGCAGCAGGTTCCAGAGAACTACTTCTATGTCCCAGACCTGGGCCAGGTGCCCGAGATCGATGTGCCATCCTACCTGCCGGACCTGCCCGGCATCGCCGATGACCTCATGTACAGCGCTGACCTGGGCCCAGGCATCGCCCCCTCTGCCCCTGGCACCATCCCTGAGCTGCCCACCTTCCAGACAGAGGTGGCGGAGCCCTGCAGGCCAGCACCTCCGCCGCCTCCGCCGCCTCCGCCACCGCCGCCAGCGCCTGCAGTGCCAGCCAGCGTACCCCCAGGCCTGCCCCCCCAGAGTGCAGCCTTGACCATCCCAGGACCCCCAGAAGACCCCAGCAGCACCCCTCCTTCAGCAGCACTCCAGGGGGCTCCCAAGGAGGTGGTGCTCCCCTCCAGTGGCCGGGCCACCCTGCTGGAGTCCATCCGCCAAGCTGGGGGCATCGGCAAGGCCAAGCTGCGCAGCGTCAAAGAGCGCAAGCTGGAGAAGAAGAAGCAGAAGGAGCAGGAGCAAGTGAGAGCCACGAGCCAGGGCGGGGACCTGATGTCGGATCTCTTTAACAAGCTGGTCATGAGGCGCAAAGGTACGAGGGGACACGCAGCTCCCTGGGGGACCTGGGGTATTCTGCACATCCTGTCTCCAGGAGCGGGCAAACCTGTGCCCAACCAACCCCACTTAACAGCCCTTCCCTCCCAGGCATCTCTGGGAAAGGACCAGGGACAGCAGCCAGCGAGGGCCCGGGAGGAGCCTTCGCCCGCATGTCAGACTCCATCCCGCCTCTGCCGCCCCCACAGCAGGCCCCGGGAGAGGAGGACGAGGACGACTGGGAGTCCTAGGGGCCCGGCGCCCGAGCCCTCCCACACCCCTGAGCCCTGGCTCTGGCTGTGCAGCAGGAACCAGCAGGGAGCTGGGGCTTCCCGGTGCCGTGCCTGGGCCTTGCCTGAGTGGTGCCGCCCCACCACAGCGCCGCTGTCCTCACTAAAGAGGTTGGAGAGGAAATCACTGATGCACCAGGAATCAATAAAGAGGTGA

XM_004865314.1 Coding sequence

LOC101720271 WAS protein family homolog 1-like, transcript variant X6

Length: 1416 bp    Location: 249068..269212   Strand: +
>XM_004865314.1
ATGGCCATGGTGAGGACCCAGCACTCCTTGGCCGGCCAGACCTACGCTGTCCCTCTCATCCAGCCAGACCTGCGGCGAGAGGAAGCCATGCAGCAGGTGGCTGATGCCCTGCAGTACCTGCAGAAGGTCTCAGGAGACATCTTCAGCAGGATCTCCCAGCGCGTGGAGCTGAGCCGCAGCCAGCTGCAGGTCGTTGGGGAGAGGATCTCCTTGGCCCAGGCCAAGATTGAGAAGATCAAGGGCAGCAAGAAGGCCATCAAGGTGTTCTCCAGCGCCAAGTATCCGGCTCCTGAGCGCCTGCAGGAGTACAGCTCCATCTTCGCCGGTGCGCAGGACCCAGGCCTACAGCGACGGCCACGCCATCGCATCCAGAGCAAGCACCGGCCGCTGGATGAGCGGGCCCTACAGGAGAAGCTGAAGTATTTCCCCGTGTGTGTGAGCACCAAGCCGGAGCCCGAGGATGAGACCGAGGAGGGGCTCGGGGGTCTCCCCAGCAACATCAGCTCTGTCAGCTCCCTGCTGCTGTTCAACACCACAGAGAACCTGTACAAGAAGTACGTCTTCCTGGACCCCCTGGCGGGGGCTGTCACAAAAACCCACCTGACGCTGGGGACAGAAACGGAGGAGAAGCTGTTTGATGCCCCTCTGTCCATCAGCAAGCGAGAGCAGCTGGAGCAGCAGGTTCCAGAGAACTACTTCTATGTCCCAGACCTGGGCCAGGTGCCCGAGATCGATGTGCCATCCTACCTGCCGGACCTGCCCGGCATCGCCGATGACCTCATGTACAGCGCTGACCTGGGCCCAGGCATCGCCCCCTCTGCCCCTGGCACCATCCCTGAGCTGCCCACCTTCCAGACAGAGGTGGCGGAGCCCTGCAGGCCAGACCTAGAGGGCGGGGGTCTCACAGCACCTCCGCCGCCTCCGCCGCCTCCGCCACCGCCGCCAGCGCCTGCAGTGCCAGCCAGCGTACCCCCAGGCCTGCCCCCCCAGAGTGCAGCCTTGACCATCCCAGGACCCCCAGAAGACCCCAGCAGCACCCCTCCTTCAGCAGCACTCCAGGGGGCTCCCAAGGAGGTGGTGCTCCCCTCCAGTGGCCGGGCCACCCTGCTGGAGTCCATCCGCCAAGCTGGGGGCATCGGCAAGGCCAAGCTGCGCAGCGTCAAAGAGCGCAAGCTGGAGAAGAAGAAGCAGAAGGAGCAGGAGCAAGTGAGAGCCACGAGCCAGGGCGGGGACCTGATGTCGGATCTCTTTAACAAGCTGGTCATGAGGCGCAAAGGCATCTCTGGGAAAGGACCAGGGACAGCAGCCAGCGAGGGCCCGGGAGGAGCCTTCGCCCGCATGTCAGACTCCATCCCGCCTCTGCCGCCCCCACAGCAGGCCCCGGGAGAGGAGGACGAGGACGACTGGGAGTCCTAG

XM_004865310.1 Coding sequence

LOC101720271 WAS protein family homolog 1-like, transcript variant X2

Length: 1725 bp    Location: 261811..269341   Strand: +
>XM_004865310.1
ATGGCCATGGTGAGGACCCAGCACTCCTTGGCCGGCCAGACCTACGCTGTCCCTCTCATCCAGCCAGACCTGCGGCGAGAGGAAGCCATGCAGCAGGTGGCTGATGCCCTGCAGTACCTGCAGAAGGTCTCAGGAGACATCTTCAGCAGGATCTCCCAGCGCGTGGAGCTGAGCCGCAGCCAGCTGCAGGTCGTTGGGGAGAGGATCTCCTTGGCCCAGGCCAAGATTGAGAAGATCAAGGGCAGCAAGAAGGCCATCAAGGTGTTCTCCAGCGCCAAGTATCCGGCTCCTGAGCGCCTGCAGGAGTACAGCTCCATCTTCGCCGGTGCGCAGGACCCAGGCCTACAGCGACGGCCACGCCATCGCATCCAGAGCAAGCACCGGCCGCTGGATGAGCGGGCCCTACAGGAGAAGCTGAAGTATTTCCCCGTGTGTGTGAGCACCAAGCCGGAGCCCGAGGATGAGACCGAGGAGGGGCTCGGGGGTCTCCCCAGCAACATCAGCTCTGTCAGCTCCCTGCTGCTGTTCAACACCACAGAGAACCTGTACAAGAAGTACGTCTTCCTGGACCCCCTGGCGGGGGCTGTCACAAAAACCCACCTGACGCTGGGGACAGAAACGGAGGAGAAGCTGTTTGATGCCCCTCTGTCCATCAGCAAGCGAGAGCAGCTGGAGCAGCAGGTTCCAGAGAACTACTTCTATGTCCCAGACCTGGGCCAGGTGCCCGAGATCGATGTGCCATCCTACCTGCCGGACCTGCCCGGCATCGCCGATGACCTCATGTACAGCGCTGACCTGGGCCCAGGCATCGCCCCCTCTGCCCCTGGCACCATCCCTGAGCTGCCCACCTTCCAGACAGAGGTGGCGGAGCCCTGCAGGCCAGACCTAGAGGGCGGGGGTCTCACAGCACCTCCGCCGCCTCCGCCGCCTCCGCCACCGCCGCCAGCGCCTGCAGTGCCAGCCAGCGTACCCCCAGGCCTGCCCCCCCAGAGTGCAGCCTTGACCATCCCAGGACCCCCAGAAGACCCCAGCAGCACCCCTCCTTCAGCAGCACTCCAGGGGGCTCCCAAGGAGGTGGTGCTCCCCTCCAGTGGCCGGGCCACCCTGCTGGAGTCCATCCGCCAAGCTGGGGGCATCGGCAAGGCCAAGCTGCGCAGCGTCAAAGAGCGCAAGCTGGAGAAGAAGAAGCAGAAGGAGCAGGAGCAAGTGAGAGCCACGAGCCAGGGCGGGGACCTGATGTCGGATCTCTTTAACAAGCTGGTCATGAGGCGCAAAGGTACGAGGGGACACGCAGCTCCCTGGGGGACCTGGGGTATTCTGCACATCCTGTCTCCAGGAGCGGGCAAACCTGTGCCCAACCAACCCCACTTAACAGCCCTTCCCTCCCAGGCATCTCTGGGAAAGGACCAGGGACAGCAGCCAGCGAGGGCCCGGGAGGAGCCTTCGCCCGCATGTCAGACTCCATCCCGCCTCTGCCGCCCCCACAGCAGGCCCCGGGAGAGGAGGACGAGGACGACTGGGAGTCCTAGGGGCCCGGCGCCCGAGCCCTCCCACACCCCTGAGCCCTGGCTCTGGCTGTGCAGCAGGAACCAGCAGGGAGCTGGGGCTTCCCGGTGCCGTGCCTGGGCCTTGCCTGAGTGGTGCCGCCCCACCACAGCGCCGCTGTCCTCACTAAAGAGGTTGGAGAGGAAATCACTGATGCACCAGGAATCAATAAAGAGGTGA

XM_004865315.1 Coding sequence

Ddx11 DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11

High confidence: 1 potential gene match
Length: 2847 bp    Location: 300091..269438   Strand: -
>XM_004865315.1
ATGGCTGATAAAACCCAGGAAGTCGGTGGCATCCATTTCCCTTTTCCCTTCCCACCCTACTCCATCCAGAAGGACTTCATGGCAGAACTGTACCAGGTGTTGGAGGCTGGCAAGATTGGGATATTCGAGAGTCCCACTGGCACGGGAAAGTCCTTAAGTCTCATCTGCGGGGCCCTGTCCTGGCTCCGTGACTTTGAGCAGAAGAAACAGCAAGAAGAGGTGCGCTGTCTCCTTGATCCTGGAGCCGGCCCCTTGCCTGAGGGGAGGGACCTGCGCCCCGAAGCCTCTTCTTCCTGCCACGCATCCCCTACCACCTCAAGGCCTGCAGGAGAGCCAGACTGGGTCACCCAGTTCGTGCAGAGGAAGGAAGAGAGGGACCTGGCGGAGCGAGTGAAGGATGAGCAGATCAGGAGGAGGAAACGAGAGGAACGGCTGCAGCAGACCCGCCACAGTGCTCAGCTCAAGTATGCAGCCCGGGGCCGGAGGCAGGAGGAAGAGGAGACCGAGGCGCTCCTCCGCCTCAGCAGGGAGATGCTGGCTGAGGGAGCAGGGGCGGAGCAGCTGGAGCAGCTGGAACCTGGGGAGGAAGAGCTGGTGCTTGCGGAGTACACCAGTGATGAGGAGCGGAGGGCAGCCAGTGGGGTGGATGAGGATGAGGAAGACCTGGAGGAGGAACACGTCACCAAGATTTACTACTGCAGCCGGACACACTCTCAGCTGGCCCAGTTTGTGCAGGAAGTTCGGAAGAGCCCCTTTGGCAAGGAAATCCGGCTGGTGTCTCTCGGCTCCCGGCAGAACCTCTGTGTGAATGAAGACGTGAGGAGCCTGGGTTCTGTGCAGCTCATCAACGACCGCTGCGTGGAGATACAGAGAAGCCAACACAAGAGTAAGAGCAGAGCTGAGGAGGAGAAGCCAAAGAGACGGCGACAAGAGGCCCGGGCTGCCTGCCCCTTCTACAACCACGAGCAGATGCAGCTGCTCCGCGACGAGATCCTGGTGGAGGTGAGGGATGTGGAGCAGCTGGTGGCCCTTGGGAAGGAGGCCCGGGCCTGCCCCTACTACGGGAGCCGACTCGCCATCGCTGCAGCCCAGCTGGTGGTGCTGCCCTACCCGATGCTGCTGCACGTGGCCACGAGGCAGGCTGCGGGCATCCGGCTGCAGGGCCAGGTCGTCATCATTGACGAGGCACACAACCTGATTGACACCATCACGGGCATCCACAGCGTGGAGGTCACCGGGTCCCAGCTCTGCCAGGCCCATTCCCAGTTGCTGCAGTACACAGAGCGGTACAGGAAGCGTCTGAAGGCCAAGAACCTGATGTACATCAAACAGATCCTGTATTTGCTGGAGAAGTTTGTGGCTGTGCTGGGAGGGGACATCAGGCAGAACCCCAACACACGGAGCCTCTCGCAGACAGGGACGGAGCTGAAGACCATCAACGACTTCCTCTTTGAGAGCCAGGTGGACAACATCAACCTGTTCAAGGTGCAGCGGTACTGTGAGAAGAGCAAGGTCAGCCGGAAGCTCTGTGGCTTCACGGAACGCTATGGCGCTGTCCTCCCGCCGCCCCAGCAGCAGTCCAGACTGGCTGGGCTCCAGCACTTCCTGCAGAGCCTGCAGCCCAGCACGACAGAGGCTCCTGCTGCCCCCTTGGAGGAGGCTGAGCCCGGAGCTGTACGTGCTGCATCCCCGCTGATGCATATCGAAGGCTTCCTCTCAGCACTCACCACCGCCAACCAGGACGGCAGGGTCATCCTGAGCCGCCAAGGCAGCCTCAGTCAGAGCAGCCTCAAATTCTTGCTCCTGAACCCAGCCGTGCACTTTGCCCAGGTGGTGAAGGAGTGCCGGGCGGTGGTCATCGCAGGTGGTACCATGCAGCCGGTGTCTGACTTCCGGGAGCAGCTGCTGGCCTGCGCCGGGGTGGAAGCAGAGCGCGTGGTGGAGTTTTCCTGCGGTCACGTGATCCCGCCAGACAACATCCTGCCCCTCGTCCTCTGCAGCGGGCCCACCAACCAGCAGCTGGAATTCACCTACCAGAAGAGAGAGGTGCCTGCTATGATGGACGAGGCGGGCCGCATTCTCTGCAACCTGTGCAACGTGGTCCCCGGAGGACTGGTCTGCTTCTTCCCTTCCTATGAGTACCAGCACCAGGTCCTTGCCCACTGGGGCAAGAGTGGCCTGCTGACTCGCCTGGCTGTCAGGAAGAAGATCTTCCAAGAGCCCAAGAGAGCCGGCCAGGTGGAGCAGGTGCTGGCGGCGTACGCCAGGTGCATTGAGAGCTGTGCCCGGGCGAGCGGCCCTGGGACCGGGGCCCTGCTCCTCGCTGTGGTCGGAGGGAAGATGAGTGAAGGGATCAACTTCTCTGACGACCTGGGCCGGTGCGTGGTGATGGTGGGCATGCCCTACCCCAGCATCAGGGCTCCCGAGCTGCAGGAGAAGATGGCCTACTTGGACCAGCCCTGGCACCCCTGGGCAGGTGCCCCCCGGGAAGGCCCTAGTGGAGAATCTGTGCATGAAGGCTGTCAACCAGTCCGTAGGCAGGGCCATCCGGCACCAGAGGGACTTTGCCAGCATCGTGCTCCTGGACCAGCGGTACGCCCGGCCCCCCGTCCTGGCAAAGCTGCCCGCCTGGATCCGAGATCGTGTGGAAGTCAAAGCCACCTTCGGCGCTGCATTTGCTGCGCTGCGGAAGTTTCACCGGGAGAAGGTGGGGCCCTCCTGATGGCGGCCACATCGCTACCTGCCCCGGTCCCTGCCGTGCCTGAGAAAGTGGCTCCACACCGGCCCCCCAGAGCCGGCAAGTGCCAGGGTCCAGGGGTCCCAGTGAACCCAGCAGGAGCCGATTGA

XM_004865317.1 Coding sequence

Insr insulin receptor, transcript variant X2

High confidence: 4 potential gene matches
Length: 4110 bp    Location: 485841..345135   Strand: -
>XM_004865317.1
ATGGGCGCCTGGGGCGCGCGGGGGGCGGCGACCGCGCCGCTGCTGGTGGCCGCGGCCGCGCTGCTGGTGGGCGTCACGGGCCACCTGTACCCGGGAGAGGTGTGTCCGGGCATGGACATCCGGAACAACCTCACCAGGCTGCACAGGCTGGAGAACTGCTCCATCATCGAGGGACATTTGCAGATCCTCTTGATGTTCAAGACGAAGCCAGAAGACTTCCGAGACCTCAGTTTCCCCAAACTGGTCATGATCACCGATTACTTGCTGCTCTTCCGGGTATATGGCCTTGAGAGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGTGGCTCCCGCCTCTTCTTCAACTACGCGCTGGTCATCTTCGAGATGGTCCATCTGAAGGAGCTGGGGCTCTACAGCCTCATGAACATCACGCGGGGCTCCGTGCGCATCGAGAAGAACAATGAGCTCTGCTACTTGGCCACCATCGACTGGTCCCGCATCCTGGATTCTGTGGAGGACAACTACATCGTGCTGAACAAAGATGACAATGAGGAGTGTGGAGACATCTGCCCAGGCACCACGAAGGGCAAGACCAACTGTCCCGCCACTGTCATCAACGGGCAATTCATAGAGCGGTGCTGGACTCACAGTCACTGTCAGAAAGTCTGCCCGACCATGTGCAAGTCCCACGGCTGTACCACCGAAGGCCTCTGCTGTCACAGCGAATGCTTGGGCAACTGCTCCGAGCCTGATGACCCCACCAAGTGTGTGGCTTGCCGAAACTTCTACCTGGATGGCAGGTGCGTGGCGTCCTGCCCGCCTCCCTACTACCACTTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGAGCTGCACAATAAATGCAAGAACTCTCGCAGGCAAGGTTGCCACCAGTACGTCATTCACAATGACAGGTGCATCCCTGAGTGTCCCTCTGGGTACACGATGAATTCCAGCAACTTGATGTGCACCCCGTGCCTGGGCCCCTGCCCCAAGGTCTGTCACCTCCTGGAAGGCGAGAAAACCATTGACTCCGTCACGTCGGCGCAGGAGCTTCGAGGCTGCACTGTGATCAACGGGAGCCTCATCATCAACATCCGGGGAGGCAACAACCTGGCAGCAGAACTGGAGGCTAACCTCGGCCTCATTGAGGAGATTTCAGGGTATCTAAAAATCCGCCGATCCTATGCTCTTGTATCACTTTCCTTCTTCCGGAAGTTACGCTTGATTCGAGGGGAAACCTTGGAAATCGGGAACTACTCTTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTGTGGGACTGGAGCAAACACAACCTCACCATCACTCAGGGGAAACTCTTCTTCCATTATAATCCCAAACTCTGCCTGTCAGAAATCCACAAGATGGAAGAAGTTTCGGGAACCAAGGGGCGCCAGGAGAGGAACGACATTGCCCTGAAGACGAACGGGGACCAGGCATCTTGTGAAAATGAATTACTTAAATTTTCATCCATTCGGACAAGTTCTGACAAGATCTTGCTGAGATGGGAGCCCTACTGGCCCCCCGACTTCAGGGACCTCTTAGGATTCATGCTCTTCTACAAAGAGGCCCCTTATCAGAACGTGACCGAGTTTGACGGGCAGGATGCGTGTGGCTCCAACAGCTGGACCGTGGTGGACATCGACCCGCCCTTGAGATCCAATGACCCCAAGTTGCAGAACCACCCTGGGTGGCTGATGAGAGGTCTCAAGCCCTGGACCCAGTACGCCATCTTTGTCAAGACCTTGGTCACCTTTTCTGACGAGCGCCGGACGTATGGGGCCAAGAGCGACATCCTCTACGTGCAGACGGATGCCACCAACCCGTCTGTCCCGCTGGACCCCATCTCCGTGTCGAATTCTTCATCCCAGATAATTTTGAAGTGGAAGCCTCCCTCGGACCCCAACGGCAACATCACGCACTACCTGGTTTACTGGCAGAGGCAGGAGGAAGACAGTGAGCTGTACGAGTTGGATTATTGCCTCAAAGGGCTGAAGCTGCCCTCCCGGGCGTGGTCCCCGCCCTTCGAGTCTGAGGATGCCCAGAAACACAACCAGAGCGAGTACGAGGAGTCGGCGGGCGAGTGCTGCTCCTGCCCCAAGACCGACTCTCAGATCCTCAAGGAGCTGGAGGAGTCTTCGTTCCGGAAGACCTTCGAGGATTACCTGCACAACGTGGTCTTCGTGCCCAGGCCCTCGCGGAAGCGCAGGTCCCTGGGTGAGGTGAATGTGACCACAGCGGTGCCCTTGGTACCGGGTTTCCCCACCCTCTCCTCCGTCAGCGTGCCCACCAACGCGGAGGAGCACAGGCCCTTCGAGAAGGTGGTGAACAAGGAGTCCCTGGTCATCTCTGGCCTGCGACACTTCACCGGCTATCGGATTGAGCTGCAGGCCTGCAACCAGGATGCTCCGGAGGAGAGGTGCAGCGTGGCTGCCTATGTCAGCGCCAGGACCATGCCCGAAGCCAAGGCGGATGACATCGTCGGCCCTGTGACGCACGAAATCTTTGATAACAACGCTGTTCACTTGATGTGGCAAGAACCAAAGGAACCCAATGGCCTGATCGTGCTGTATGAAGTGAGTTATCGGCGGTACGGGGAAGAGGAGCTGCACCTGTGTGTCTCCCGGAAGCACTACGCCCTGGAGAAGGGGTGCAGACTGCGGGGGCTGCAGCCAGGCAACTACAGCGTGCGGATCCGGGCCACCTCCCTGGCGGGGAACGGCTCCTGGACGGAAGCCACCTATTTCTACGTGACAAATTATTCAGATGTCTCATCAAACATTGCAAAGATGATCATTGGTCCCCTCATTTTCGTCTTTCTCTTCAGTATTGTGATTGGGAGTATTTATCTATTCCTGAGGAAGAGACAGCCGGATGGGCCAATGGGACCGCTGTACGCCTCCTCGAACCCTGAGTACCTCAGCGCCAGTGACGTATTTCCCTGTTCTGTGTATGTGCCGGACGAGTGGGAGGTCCCTCGAGAGAAGATCACCCTCCTGAGAGAGCTGGGGCAGGGCTCCTTTGGCATGGTATACGAGGGAAATGCCAAGGACATCGTCAAGGGTGAGGCAGAGACTCGAGTGGCGGTGAAGACGGTCAATGAAGCAGCCAGTCTCCGAGAGAGGATCGAATTCCTCAACGAGGCCTCCGTCATGAAAGGCTTCACATGTCATCACGTGGTTCGCCTCCTGGGAGTGGTGTCCAAGGGCCAGCCAACGCTGGTGGTGATGGAGTTGATGGCCCATGGAGACTTGAAGAGCTACCTCCGCTCCTTGCGGCCAGAGTCTGAGAATAACCCCGGCCGCCCTCCCCCTACTCTACAAGAGATGATTCAGATGGCGGCGGAGATTGCCGATGGGATGGCGTACCTGAATGCCAAGAAGTTTGTGCACCGAGACCTGGCAGCTCGAAACTGCATGGTTGCCCATGATTTTACTGTCAAAATCGGAGACTTTGGAATGACCAGGGACATCTACGAAACGGATTACTACCGGAAAGGGGGCAAAGGTCTGCTCCCTGTGCGGTGGATGGCACCGGAGTCCCTGAAAGATGGGGTCTTCACCACTTCCTCCGACATGTGGTCCTTTGGTGTAGTCCTTTGGGAAATCACCAGCTTGGCAGAACAGCCTTACCAAGGGCTGTCTAATGAACAGGTGTTGAAATTTGTCATGGATGGAGGGTATCTGGACCAGCCTGACAATTGTCCAGAGAGAGTCACTGACCTGATGCGCATGTGCTGGCAGTTCAACCCCAAGATGCGGCCGACCTTCTTGGAGATCGTCAGCCTGCTGAAGGATGACCTTCATCCCAGCTTCCCAGAAGTCTCCTTCTTCCACAGCGAGGAGAACAAGGCCCCTGAGAGTGAGGAGTTGGAGATGGAGTTCGAGGACATGGAGAATGTCCCCTTGGATCGGTCCTCACACTGTCAGAGGGAGGAGGCCGGGGGCCGGGAGGGAGGGTCCTCGCTGGGCATCAAGCGGAACTATGAAGAGCACATCCCGTACACCCACATGAACGGGGGCAAGAAGAACGGGCGGATCCTGCCCCTGCCCCGGTCCAGCCCTTCCTAA

XM_004865316.1 Coding sequence

Insr insulin receptor, transcript variant X1

Length: 4146 bp    Location: 485841..345135   Strand: -
>XM_004865316.1
ATGGGCGCCTGGGGCGCGCGGGGGGCGGCGACCGCGCCGCTGCTGGTGGCCGCGGCCGCGCTGCTGGTGGGCGTCACGGGCCACCTGTACCCGGGAGAGGTGTGTCCGGGCATGGACATCCGGAACAACCTCACCAGGCTGCACAGGCTGGAGAACTGCTCCATCATCGAGGGACATTTGCAGATCCTCTTGATGTTCAAGACGAAGCCAGAAGACTTCCGAGACCTCAGTTTCCCCAAACTGGTCATGATCACCGATTACTTGCTGCTCTTCCGGGTATATGGCCTTGAGAGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGTGGCTCCCGCCTCTTCTTCAACTACGCGCTGGTCATCTTCGAGATGGTCCATCTGAAGGAGCTGGGGCTCTACAGCCTCATGAACATCACGCGGGGCTCCGTGCGCATCGAGAAGAACAATGAGCTCTGCTACTTGGCCACCATCGACTGGTCCCGCATCCTGGATTCTGTGGAGGACAACTACATCGTGCTGAACAAAGATGACAATGAGGAGTGTGGAGACATCTGCCCAGGCACCACGAAGGGCAAGACCAACTGTCCCGCCACTGTCATCAACGGGCAATTCATAGAGCGGTGCTGGACTCACAGTCACTGTCAGAAAGTCTGCCCGACCATGTGCAAGTCCCACGGCTGTACCACCGAAGGCCTCTGCTGTCACAGCGAATGCTTGGGCAACTGCTCCGAGCCTGATGACCCCACCAAGTGTGTGGCTTGCCGAAACTTCTACCTGGATGGCAGGTGCGTGGCGTCCTGCCCGCCTCCCTACTACCACTTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGAGCTGCACAATAAATGCAAGAACTCTCGCAGGCAAGGTTGCCACCAGTACGTCATTCACAATGACAGGTGCATCCCTGAGTGTCCCTCTGGGTACACGATGAATTCCAGCAACTTGATGTGCACCCCGTGCCTGGGCCCCTGCCCCAAGGTCTGTCACCTCCTGGAAGGCGAGAAAACCATTGACTCCGTCACGTCGGCGCAGGAGCTTCGAGGCTGCACTGTGATCAACGGGAGCCTCATCATCAACATCCGGGGAGGCAACAACCTGGCAGCAGAACTGGAGGCTAACCTCGGCCTCATTGAGGAGATTTCAGGGTATCTAAAAATCCGCCGATCCTATGCTCTTGTATCACTTTCCTTCTTCCGGAAGTTACGCTTGATTCGAGGGGAAACCTTGGAAATCGGGAACTACTCTTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTGTGGGACTGGAGCAAACACAACCTCACCATCACTCAGGGGAAACTCTTCTTCCATTATAATCCCAAACTCTGCCTGTCAGAAATCCACAAGATGGAAGAAGTTTCGGGAACCAAGGGGCGCCAGGAGAGGAACGACATTGCCCTGAAGACGAACGGGGACCAGGCATCTTGTGAAAATGAATTACTTAAATTTTCATCCATTCGGACAAGTTCTGACAAGATCTTGCTGAGATGGGAGCCCTACTGGCCCCCCGACTTCAGGGACCTCTTAGGATTCATGCTCTTCTACAAAGAGGCCCCTTATCAGAACGTGACCGAGTTTGACGGGCAGGATGCGTGTGGCTCCAACAGCTGGACCGTGGTGGACATCGACCCGCCCTTGAGATCCAATGACCCCAAGTTGCAGAACCACCCTGGGTGGCTGATGAGAGGTCTCAAGCCCTGGACCCAGTACGCCATCTTTGTCAAGACCTTGGTCACCTTTTCTGACGAGCGCCGGACGTATGGGGCCAAGAGCGACATCCTCTACGTGCAGACGGATGCCACCAACCCGTCTGTCCCGCTGGACCCCATCTCCGTGTCGAATTCTTCATCCCAGATAATTTTGAAGTGGAAGCCTCCCTCGGACCCCAACGGCAACATCACGCACTACCTGGTTTACTGGCAGAGGCAGGAGGAAGACAGTGAGCTGTACGAGTTGGATTATTGCCTCAAAGGGCTGAAGCTGCCCTCCCGGGCGTGGTCCCCGCCCTTCGAGTCTGAGGATGCCCAGAAACACAACCAGAGCGAGTACGAGGAGTCGGCGGGCGAGTGCTGCTCCTGCCCCAAGACCGACTCTCAGATCCTCAAGGAGCTGGAGGAGTCTTCGTTCCGGAAGACCTTCGAGGATTACCTGCACAACGTGGTCTTCGTGCCCAGAAATCCCTCTGCAGGCAGTGGTGCCCAGGACCCTAGGCCCTCGCGGAAGCGCAGGTCCCTGGGTGAGGTGAATGTGACCACAGCGGTGCCCTTGGTACCGGGTTTCCCCACCCTCTCCTCCGTCAGCGTGCCCACCAACGCGGAGGAGCACAGGCCCTTCGAGAAGGTGGTGAACAAGGAGTCCCTGGTCATCTCTGGCCTGCGACACTTCACCGGCTATCGGATTGAGCTGCAGGCCTGCAACCAGGATGCTCCGGAGGAGAGGTGCAGCGTGGCTGCCTATGTCAGCGCCAGGACCATGCCCGAAGCCAAGGCGGATGACATCGTCGGCCCTGTGACGCACGAAATCTTTGATAACAACGCTGTTCACTTGATGTGGCAAGAACCAAAGGAACCCAATGGCCTGATCGTGCTGTATGAAGTGAGTTATCGGCGGTACGGGGAAGAGGAGCTGCACCTGTGTGTCTCCCGGAAGCACTACGCCCTGGAGAAGGGGTGCAGACTGCGGGGGCTGCAGCCAGGCAACTACAGCGTGCGGATCCGGGCCACCTCCCTGGCGGGGAACGGCTCCTGGACGGAAGCCACCTATTTCTACGTGACAAATTATTCAGATGTCTCATCAAACATTGCAAAGATGATCATTGGTCCCCTCATTTTCGTCTTTCTCTTCAGTATTGTGATTGGGAGTATTTATCTATTCCTGAGGAAGAGACAGCCGGATGGGCCAATGGGACCGCTGTACGCCTCCTCGAACCCTGAGTACCTCAGCGCCAGTGACGTATTTCCCTGTTCTGTGTATGTGCCGGACGAGTGGGAGGTCCCTCGAGAGAAGATCACCCTCCTGAGAGAGCTGGGGCAGGGCTCCTTTGGCATGGTATACGAGGGAAATGCCAAGGACATCGTCAAGGGTGAGGCAGAGACTCGAGTGGCGGTGAAGACGGTCAATGAAGCAGCCAGTCTCCGAGAGAGGATCGAATTCCTCAACGAGGCCTCCGTCATGAAAGGCTTCACATGTCATCACGTGGTTCGCCTCCTGGGAGTGGTGTCCAAGGGCCAGCCAACGCTGGTGGTGATGGAGTTGATGGCCCATGGAGACTTGAAGAGCTACCTCCGCTCCTTGCGGCCAGAGTCTGAGAATAACCCCGGCCGCCCTCCCCCTACTCTACAAGAGATGATTCAGATGGCGGCGGAGATTGCCGATGGGATGGCGTACCTGAATGCCAAGAAGTTTGTGCACCGAGACCTGGCAGCTCGAAACTGCATGGTTGCCCATGATTTTACTGTCAAAATCGGAGACTTTGGAATGACCAGGGACATCTACGAAACGGATTACTACCGGAAAGGGGGCAAAGGTCTGCTCCCTGTGCGGTGGATGGCACCGGAGTCCCTGAAAGATGGGGTCTTCACCACTTCCTCCGACATGTGGTCCTTTGGTGTAGTCCTTTGGGAAATCACCAGCTTGGCAGAACAGCCTTACCAAGGGCTGTCTAATGAACAGGTGTTGAAATTTGTCATGGATGGAGGGTATCTGGACCAGCCTGACAATTGTCCAGAGAGAGTCACTGACCTGATGCGCATGTGCTGGCAGTTCAACCCCAAGATGCGGCCGACCTTCTTGGAGATCGTCAGCCTGCTGAAGGATGACCTTCATCCCAGCTTCCCAGAAGTCTCCTTCTTCCACAGCGAGGAGAACAAGGCCCCTGAGAGTGAGGAGTTGGAGATGGAGTTCGAGGACATGGAGAATGTCCCCTTGGATCGGTCCTCACACTGTCAGAGGGAGGAGGCCGGGGGCCGGGAGGGAGGGTCCTCGCTGGGCATCAAGCGGAACTATGAAGAGCACATCCCGTACACCCACATGAACGGGGGCAAGAAGAACGGGCGGATCCTGCCCCTGCCCCGGTCCAGCCCTTCCTAA

XR_206107.1 Non-coding sequence

LOC101722755 PREDICTED: Heterocephalus glaber uncharacterized LOC101722755 (LOC101722755), misc_RNA.

Length: 1604 bp     
>XR_206107.1
GGCCCTTCCACCGCACCCTTCCTGCCTTTGAGCCAACTGATCATGGACTGGAACCTGTAGAAATCTGATCCTCCAGACCTTCAGGCTCCGTCCGACGCTGGATCCTGCGCACACGGGTGACCATTTCGGCATCCTCCTCCTCGCATGGCCGCTGGGACTCTTCCGGTTTGATCCCGACAGCCTGCCTCACAAATCCCGTCTCTAAGCACGCACGTTTTCTGTCGAATCTGTTCCTCTGGAGAACCCTAACTCATACAGATGTTCGTGTATGTGTGCGTATTTGCTCAGTTTCAGGTGCAAAAGACTGGACAGATGCTTCATGAAAAAGGGACAGATGGATAGATGTTGAGCAACAGCCATCCTCAGGAAAATGGAATGGAGAACCATCACGTGATACCTCCACACACCCACCAGAATGGCTGAAGCCAACAGTTCTGACAGCTCCAAGTGTTGGCAGAATTACAGAGCAATGGGAACTTTGTTGTTGCTGGTGAGAGGTTAGGTGGGCCAGTCACTTAGGAAAAGTTATGAGGGGAGCCTGCTGGGGTAAAAATGATAACATGTTGCTATTCTGTGTTTGGTGAGGTGTTGGTCACGTATCTGTCCAGGCTTGTGCAGTGCCTCCCTGTGCCTCTGTGTTGTATTGTGTGTAAGTTATGTGTCGATGAAAACATGCACTCAGGTGGTGACAGAGCCACACCCAGGCTTGCTGGGAGCCACCTACTCCATCGGTGTTATTACCATCGACACTTTAAAATGTTCACCCTCCACCTCTGTGGCAGGCACCATTACTCTGCTGTGGTGGAAAGAAAAACGCCCTGCCCCATCCCAGGAATGTTTAAATCTGGACCCTTTTGTAGCAACGGGGCCCGGAGGGTGTGATGAGGAATTCCCAGCAGGGCACGTGAGCCTGGGTGGCCACAGTCCTCATGGAGCCCCTGGCAAGAGAGGACAGCAGGAGCCAGGCGAGGCGCGAAGGCCAGGCTGATGGGTGCTGGCGGAGGGGCCCAGGGGGGAACGTGGGGTCCACGTGCTCGGGTAGACCTGGGGCTGTGCGGGGCCTGCGGGGAGATGGGGCGGTGGGGCTCTGCACGGGCAGACGCACCTGCGCCCCCTTGTGTCTGACGGGTGCGGGGCGGATGCAGATGGTTACTGAGATCTACGGAGGGAGGCACCTGAATCCTGCACCCATGTCTGTGTCCGTGTGCTGGCTTCCATCACCACAGCTCTCTCAGCTGTCTGCACCACTACGCATCTTCCCTTCTGTCTGTCTATGTGTCTGTCTGTCTGTCTGGCATCCCTCTATCATCTATTACCCATCTATCATCTATCTACCTACCTACTATCAATCCTATGATTCTATGTATGTATTTATGTACCTAATGATTCTGTCTAATCTGTGATTCTATTTAGCTACACATATATCTGATCTGTGGTTCTATTTATCTCATGTATGTATGTATTTATGTATGTATCCATCCGTCCGTCCGTCTGTCCGTCTGTCCATCTGTCTGTCCGTTGGTCTGCCTATTCTATGGTTCCATTTATCTATGTATCCATCCATCCACCTCTGCATATCTAGGTGTCTGTGAATGTGTGAATGA

XM_004865318.1 Coding sequence

Arhgef18 Rho/Rac guanine nucleotide exchange factor (GEF) 18

High confidence: 3 potential gene matches
Length: 4101 bp    Location: 543572..604996   Strand: +
>XM_004865318.1
ATGCAGGACCAGCAGGAAGATGATTTTGCAGAGCAGCTCAGTGAGAGCACGGAGGACCTCAGCCTGGATTTAGGGGCCCTGCAGGGCAGCGAGTATCTCCAGGACCTCGGCCTAGCAGCCCCTTCCCCCAGCCCGGCCGGTGGGGCCTCCGGCAGCAGCCCCTTGAAGACAGAAGCTGAGAGGGACTCGCCCTTCTCGAGCTCCGCAGGGGCCCAGACTCTGGTTCGGAGACGCAGCTGGGAGAGGTCACGGAGCTGCTCAGAGGACTGGCAGAGGCTCAGCTTTGACCCCCTGCCTGTGGAGGAGAGCCCCTGCCTCCCCCGGACACTGGCTAGTCTGGCTCTCAACCTGTCCGGGGAAGGGTTGAAGACTTGGACCCAAGGCTGTCTGTCTGGAGGCGGGACTGCAGCCGAGCACCCTGGCAAGGACTGTGCTAGCCTCGAGAAGAGAGCAAGGTCAAGGTCGGTGCCCCTGGCCTTCGAGGAGACCGCCTCCCTGGACCTCACGCTGAGCTCAGAAGCGGCACCTGCACGAGGCCTCAAACCCCAGGAGCTGGAGAGCCTAGAAAAGGACCATGTGGAGCCCGAGCACGTGCTGATGGTTCAGCAGGTGCTTCAGGAACTTCGCCAGTACCACGGGGCGCGGCAGAGGGCTCGCCTGGCCGCTAGCCCCGGAGTGCCCCACGCCAGCCTCACGTGGCTCAGATTCCTGTCGGAGAGCGAGGACGGGGCGGTCAAGAGCGAGAAGAGCGTCAAGAGCACCAGGGTGAAGCGACGTCTGAGCTCCCTCCGCAGCCGGGTCACCAGGCAGAAGGAGAAGGGGAAGAGCGCAGTGCAGCTGAAGGCTCGGGACAGCAGGGAGAGGTGGGAGTGTGTCAGCGGGCACCGGCTGGTGCGGGGGACCTCCACGGGCCACTCCAGCTGCCCGCTGTGTAGCAGGCCGCTCCTGAGCCCCGCCTCGATGAAGGAGCCCCTGCCTCGGGGCTCCCTCCTGTCTGATGGCAGCCCGGCCCCGTCCAGGAATGTCAGCAGCATGATGGTCTCTCAGAAAGGGGGTCCCCAGCCAACACCCAGCCCTGCCGGAACCGGAGCCGGGGTGCGACTCGGACCTGTCACAGGAGAGATGGATGAAGCCGATTCTGCATTTTCAAAATCCAAGCAGGCGGCTGACGACTCCCTCTCCCTCACACCCTCCAACGCCGAGCCCATCTTCGTAGAAGATCCCTACACTGCCTCACTGAGGAGCGAGATCGAAGCAGATGCCCACGAGTTCGAGGCCGAGTCCTGGAGCCTGGCCGTGGACCTGGCATACGCCCGGAAGCAGAAGCGAGAGGTGGTGAAGAGACAGGATGTGCTCTATGAGCTGATGCAGACAGAGGCACACCATGTGCGCACGCTGAAGATCATGCTGAAGGTCTACTCCAGGGCGATGCAGGAGGAGCTGCAGTTCAGCAGCAAGGCCGTCAGCCGTCTCTTCCCATGCGTGGACGACCTGCTGGACATGCATGGCCACTTCCTGGCCCGTCTCAAGGAGCGCCGCCAGGAGGGGCTGGAGGAGGGCAGCGAGCAGAACTACGTCATCCAGAAGATCGGGGACCTGCTGGTCCAGCAGTTTTCAGGTGAAAACGGGGAGAGGATGAAAGAGAAATACGGTGTGTTTTGTAGTGGCCATAACGAGGCAGTCAGTCATTACAAGTTACTGCTGCAGCAAAACAAGAAATTTCACAACTTGATCAAGAAAATCGGCAACTTTTCCATCGTGAGGCGGCTGGGCGTGCAGGAGTGCATTCTCCTCATCACTCAGCGCATAACCAAGTACCCCGTGCTGGTGGAGCGCATCATCCAGAACACGGCAGCTGGCACTGAGGACTACGAAGATCTGACCCAGGCCCTGAACCTCATCCGAGACATCATCTCACAAGTGGATGCCAAGGTCAGCGAGTGGGAGAAGGGCCAGCGCCTCAGGGAGATCGCAGGCAAAATGGACCTGAAGTCCTCCAGCAAACTCAAAAATGGGCTCACTTTCCGCAAGGAGGACATGCTCCAGCGGCAGCTCCACCTGGAGGGCACACTGTGCTGGAAGACCACATCAGGGCGCTTGAAAGATGTCCTCGCCGTCCTGTTGACTGATGTGCTGCTGCTGCTGCAGGAAAAGGATCAGAAATACGTCTTCGCTTCCGTGGACTCAAAGCCGCCCGTCATCTCCCTGCAAAAGCTCATTGTGCGTGAAGTGGCCAACGAGGAGAAGGCCATGTTTCTGATCAGCGCCTCCCTGCAAGGGCCCGAGATGTACGAGATCTACACGAGCTCTAAGGAGGACAGGAACGCCTGGATGGCCCACATCCGCCGCGCTGTGGAGAGCTGTCCCGATGAGGAAGAGGGGCCCTTCAGCCAGACCGAGGAGGAGAGGAAGATGGTCGAAGCCCGAGCCATGAAACTCAAGGACTTCCATGTGCGCCTGAGCCTGAAGGACCAGCTGATCGCGCAGAGCCTCCTGGAGAAGCAGCAGATCTACCTGGAGATGGCCCAGATGAGTGGGCTGGACGACCCTGGGCCAGCGCGAGGCCTGTTCCGAGGAGGCGACCCCTTGGAAATCCTGCAGGGGGAGCAGATCCTCAGGGCCGCCATGAACGAGATTGAGGGCATCCACAGCCTGATCTGCAGGCGGCTGGGCAGCACCAACTGCCAGGAGGAAGAAGGAGGTAGCTCCATGGGCCTGCCTCGGAGGGCTGAGACCTTCGGGGGCTACGACAGCACGGGCAGCCCCGGCAGGAACGGCAGCTTTAAGAAGGTCTACAGCAACGACCCCAGGCCCCGGGACTGGCAGGGCCCTGCCAGCAGCAGCCTCGACTCGAAGCTCAGGGACGGCGACATCCCGGGTGGCGGCGAGGAATCCCCACAGGCGGTGGAGGCGCCAGGGACAGATGCTGGCCCTCGACTGCCCACCATCTTGGAGTCGGAGCTTCTCCAGCGGATTCAGACCCTGGCTCAGCTGCTGCTCAGCCTCCAGGCGGCCATCGCCCAGCAGGACAGCCTTGTGGAAATGCAGCGGGCTGCCATCCAGGAGCGCGAGAAGCAGTTCCGGTTGCAGTCGACACGCGGGAACCTGCTGCTGGAGCAGGAGCGGCAACGCAACTTCGAGAAGCAGCGCGAGGAGCGGGCGGGTGTGGAGAAGCTGCAGAGCCAGCTGCGGCAGGAGCAGCAGCGCTGGGAGCGCGAGTGTGCGCGGCAGCGACTGGAGCTGGAGCTCGCGGGCGCGCGGCTGCAGGAGCGCGAGGGCGAGGCACGGCAGCTGCGCGAGCGGCTGGAGCAGGAGCGCGCGGAGCTGGAGTGCCAGCGCCAGGCCTACCAGCACGACCTGGAGCGGCTGCGCGAGGCCCAGCGTGCCGTGGAGCGCGAGCGTGAGCGCCTGGAGCTGCTGCGCAGGCTCAAGAAGCAGAACACGGTCTCCGGGGCACTGCCGCCCGAGTCGCTGGCGGAGGCCCAGCCTCCGAGTCACCCTCCCAGCTTTAACGGGGAAGGGGTCGAGGGGCCCTTGGCAATGGCCAAAGCCCAGGGCACCCGGATGTCTGGTGCGGGGCTGGAGTTCGTGGAGCAGCCCGAGGTGGTCCGATGGGACAGCGCCCCTGCCGAGAGCCGGCCTGCCAAGAGCGAAGTGCCCATCCAGCTGCTCAGCGCCACCAACCAGATCCAGAGGCAGGCGGCTGTGCAGCAGCAGATCCCCACCAAGCTGGCCGCCTCCACCAAGGGCGGCAAGGACAAGGGCGGCAAGAGTCGGGCCTCCCAGCGCTGGGAGAGCTCAGGATCCTTCGACCTGAAGCAGCAGCTGCTGCTTAACAAGTTCATGGGCAAGGACGACTCCGCCTCCAAGAACCGCCGGTCGGCAAGCCCCGTCCTGCCCGGCAGCCACAGCTCGGCGCCCGCCCCAGACCCCTGCTTCCTAGCGCCCAGCCCGGCGCCGGCGGATGGACCCCCCGAGGCCTTCTCCTTCAAGCCCGGGGCCGCCGCCTCCCCGCGTGTGCCCCCGTCGCCCTCACCACTGCCTGCCACGCCGCTCGGCCCCAGGGAGGAAGCCGGCAAGGAAGACGTCATCTTCTTCTGA

XM_004865320.1 Coding sequence

Pex11g peroxisomal biogenesis factor 11 gamma, transcript variant X2

Length: 543 bp    Location: 612087..606360   Strand: -
>XM_004865320.1
ATGGCGGTAGTGAGCAACCTGGCTTCGGCGCTGGAGTCATACAGGGGTCGGGACCGCCTGATCCGAATGCTGGGGTACTGCTGCCAGCTGGTTGGTGGGGTCCTGCTCCAACAAGGTCCTGCCAGGTCGGAGGTGGGGACGCGCCTGCTGGTGGTGTCGGCCCAGCTGAGCCACTGCAGGACTGTCCTTCGACTCTTTGATGACCTGGCCATGTTTCTGTACACAAAGCAGTATGGCCTGGGGACAGAGGAGGAGGACGCCTTGGTGCGCTGCCTGTCGGTGCTGGGCAACATGGCCGACCAGCTCTACTACCCCTGTGAGCACATCGCCTGGGCCGCCGACGCCCAGGTCCTGCACGTGGACTCTACCCGGTGGTGGACGCTGAGCACAGCTCTCTGGGGCCTCTCCTTGCTCCTGGGGGCGGCCAGGTCCCTGTGGATGGTGCTGAAGCTGAGGCAGAGGCTACAAGGCCCCACAGCTGCCTTCACCAGCCTCTACCAGGTGGCCCAGGTCGGTGGCCAGGCCAAGGCTGACAGCTCCTGA

XM_004865321.1 Coding sequence

Znf358 zinc finger protein 358

Length: 1839 bp    Location: 629755..632799   Strand: +
>XM_004865321.1
ATGCGGGGTCGGGGGTCTCCTGACCCCCCAGGACCCCAGGAAAGGCCTCAGCCATTGTTCCCTTCCCTCGAAAGTCTGGAGGTCCTGGCCTCTGGAAGCCTCTCCCTCGACTCCGGAAGGGTCCCAGGGATTTCTTCTCCCTCCTTCCAGCTGCGAAATGGGAAAGGAGGCAGCCGCAGCCTCTGGGATCCTGTCCCAGAAACGACCGGCAGTTCCACAGCCGGGATGCGGCGCTCTGTCCTGGTCAGGAACCCGGGCCACAAGGGCGTGAGGCCCACCTATGAAGAAATCGACTCGGACTCGGAAGACCTGGACCCCAAACACGAAGATCTGGACCCAGTTTCTGAAGACCCAGAGCCGGATCCAGAAGACCTCAACACTGCCCCGGAAGACGTGGACCCCGGCTATGAAGACCTGGACCCCACCTCTGAGGAGCCCCAAGATCTGGACCCCATGTCTTCAAGTTTCGATCTCGATCCAGACGTCATTGGCCCTGTACCCCTGGTCCTCGACCCCGACAGCGAAGCCCTCAGTCCTGCCGCGGCAGACGTGGACCCGCTCTCCTCCAGCATCACTGCCGCCCCCGAGGTCCTGGCCTCCAGCCCTGCGGTGCTCCCCGCCCCAGCCAGCCCGCCCCGGCCCTTCTCCTGCCCCGATTGCGGCCGCGCCTTCCGCCGCAGCTCGGGGCTGAGCCAGCACCGCCGCACCCACAGCGGCGAGAAGCCGTACCGCTGCCCCGACTGCGGCAAGTCCTTCAGCCACGGCGCCACGCTGGCGCAGCACCGCGGCATCCACACCGGTGCGCGCCCCTACCAGTGCGCGGCCTGTGGCAAGGCCTTCGGCTGGCGCTCCACGCTGCTCAAGCACCGCAGCAGCCACAGCGGGGAGAAGCCGCACCACTGCCCGGTGTGCGGCAAGGCCTTTGGCCACGGCTCGCTGCTGGCACAGCACCTGCGCACGCATGGGGGCCCGCGGCCTCACAAGTGCCCGGTGTGTGCCAAAGGCTTCGGTCAGGGCTCGGCGCTGCTCAAGCACCTGCGCACGCACACGGGCGAGCGGCCATACCCGTGCCCGCAGTGCGGGAAGGCCTTTGGGCAGAGCTCGGCGCTGCTGCAACACCAGCGCACGCACACGGCCGAGCGCCCCTACCGCTGTCCGCACTGCGGCAAGGCCTTCGGGCAGAGCTCCAACTTGCAGCACCACCTGCGCATCCACACGGGCGAGCGGCCCTACGCCTGTCCGCACTGCTCCAAGGCCTTCGGGCAGAGCTCGGCGCTGCTGCAGCACCTCCACGTGCATTCCGGCGAGCGCCCCTACCGCTGCCAGCTCTGCGGCAAGGCGTTCGGCCAGGCCTCCAGCCTCACCAAGCACAAGCGGGTGCACGAAGGCGCCGCCGCCGCAGCCGCCGCCGCCGCCGGCTTGGGGCTCGGGCCTGGCCTGAGCTCTGCACCCGTCACGAGGCCGGGAAAGGTCTCCTTCCTGGGTCCCGAGGCTGTCTCTGTGCTGGGCTCTGGCCTGGGCCTTAGCCCAGGCCCCAGCTCTGGCTGCGGCCCGGACCCTGGGTCCCTTTCCAATCCCAGCCCCAAGCCCCTCTCTGGCTCCGGATCCTCCCCCAGCCCCGATCCTGTTGAATCTTCTGACCCTAAGCCTGGTCACAATGCTGACCCCGACCTTGTGCTCAGCCCTGACCGTGAATCTGATACCAGCCCTGACCCCCACCCTGAGTCCCAGCCTGACCCCTGCTCTCCCACCCGAGACACTGTCAGCCCAGCCTTCCCTGCTGGTGAGAGTCTGGAGCGGGTTGAGGAGCAAGGGGCACTGCTGGGGCCTGATGGCTGA

XM_004865338.1 Coding sequence

Mcoln1 mucolipin 1, transcript variant X2

Length: 1686 bp    Location: 634378..643406   Strand: +
>XM_004865338.1
ATGGCAGCCCCTGGGGGCCGGCGTGGCTCAGAGACGGAGCGCCTCCTGACCCCCAGCCTTGGGTATGGGACCCAGGCGGGGGCGCCGCTGGCCCCTCCGACGCCTCCAGAAGAGGAAGACCTTCGCCGCCGGCTCAAGTACTTTTTTATGAGTCCCTGTGACAAGTTCCGGGCCAAGGGCCGCAAGCCATGCAAGCTGATGCTGCAGGTGGTCAAGATCCTGGTGGTCACTGTGCAGCTCATCCTGTTCGGGCTCAGCAACCAGCTGGCGGTGACCTTCCGGGAAGAGAACACCATTGCCTTCCGCCACCTCTTCCTGCTGGGCTACTCGGATGGGGCGGATGACACCTTGGCAGCCTACACGCGGGAGGAGCTGTACCAGGCCATCTTCTACGCTGTGGACCAGTACCTGACGCTGCCGGAGGTGTCGCTGGGCCGCTATGCCTACGTCCGGGGTGGAGGTGGCCCATGGGCCAACGGCTCGGCCCTGGCTCTCTGCCAGCGGTACTACCACCGCGGCCACGTGGACCCGGCCAATGACACCTTTGACATTGACCCTACAGTTGTCACTGACTGTATCCAGGTGGATCCCCCAGAGAGACCCCCTGTACCCCCAAGCGATGCTCTCACCCTCTTAGAGGACGGCAGCTCCAGTTACAAGAACCTGACGCTCAAATTCCACAAGCTGATCAACGTCACCATCCACTTCCAGCTGAAGACCATCAACCTGCAGAGCCTGGTCAACAACGAGATCCCCGACTGCTACACCTTCACCGTCCTGATCATGTTTGACAACACAGCACACAGCGGGCGGATCCCCATCCGCCTGGAGACCCAGGCCCACATCCAGGAGTGTAAGCACACCAGCATCTCCAGGCACGAAGACAACAGTTTCCGGCTGCTGTTCGATGTGGTGGTCATCCTCACCTGCTCGCTGTCTTTCCTGCTGTGCGCCCGCTCGCTGCTCCGTGGCTTCCTGCTGCAGAAGGAGTTCGTGGGGTTCGTGTGGCAGCAGCGGGGACGCGTGATCAGCCTGTGGGAGCGGCTGGAGTTCGTCAATGGCTGGTACATCCTGCTGGTCACCAGCGACGTGCTCACCATCTCTGGTACCGTCATGAAGATCGGCATCGAGGCCAAGAATCTGGCCAGCTACGACGTCTGCAGCATTCTCCTGGGCACCTCCACGCTGCTGGTCTGGGTGGGCGTCATCCGCTACCTGACCTTCTTCCACAAGTACAACATTCTCATCGCCACGCTGCGGGTGGCACTGCCCAGCGTGATGCGCTTCTGCTGCTGTGTGGCTGTCATCTACCTGGGCTACTGCTTCTGCGGCTGGATCGTGTTGGGGCCCTACCACGTGAAGTTCCGCTCGCTGTCTATGGTGTCCGAGTGCCTCTTCTCACTCATCAATGGGGACGACATGTTCGTGACGTTCGCGGCCATGCAGGCTCAGCAGGGCCGCAGCAGCCTGGTGTGGCTCTTCTCCCAGCTCTACCTCTACTCCTTCATCAGCCTCTTCATCTACATGGTGCTCAGCCTCTTCATCGCGCTCATCACTGGCGCCTACGACACCATCAAGCACCCTGACGGTGCAGGCGCAGAGAAGAGTGAGCTCCAGGCTTACATTGCACAGTGTCAGGACAGCCCCACCTCCGGGAGGCCTCGGAGGACCATTCGCTGCTGGTGA

XM_004865325.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X4

Length: 4650 bp    Location: 643471..664665   Strand: +
>XM_004865325.1
ATGCAGAGGCCAGGGAGGGGACCGCCTACTGGAAGGGGCCATCCCTGCGGGGGCCCGCACGAGGGCTGCTGGTTGCGGGTGTCAGGACCGCTACCCTTTGGCTCTGGGGTGGGGTCGGACGGGCGGGGCGTCTGGGCGACCCTGTGTGTAGGTGAAGGGTGCCTAAGATCAGGGACTCGCCTCATCCCTTGGCCCCGGCCGGAATGTCGGTTTGCTCCACGCCTCTCGCTTTCGCAGCTGGCCAACCTACCCAGCGCTAATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTAAGAAGTGGGGTTGTGCAAAAGACTACAACTGCCGGCGTGCCCAGCCCGTACCGTCGGAATCTCGCGAGAACAGGGGTGTCTCCTGTTCTGGCCGAACTATATTTCCCGGCGTGCAGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGGCTCCGTGTGGCATTACGTCCGGGCCAGTGCCTCCTACTGCCCCTACCTGCCCCCACTGTGCGACCCCAAGGACGGGCACCTGCTGGTGGATGGGTGCTACGTTAACAACGTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865324.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X3

Length: 4650 bp    Location: 643471..664665   Strand: +
>XM_004865324.1
ATGCAGAGGCCAGGGAGGGGACCGCCTACTGGAAGGGGCCATCCCTGCGGGGGCCCGCACGAGGGCTGCTGGTTGCGGGTGTCAGGACCGCTACCCTTTGGCTCTGGGGTGGGGTCGGACGGGCGGGGCGTCTGGGCGACCCTGTGTGTAGGTGAAGGGTGCCTAAGATCAGGGACTCGCCTCATCCCTTGGCCCCGGCCGGAATGTCGGTTTGCTCCACGCCTCTCGCTTTCGCAGCTGGCCAACCTACCCAGCGCTAATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTAAGAAGTGGGGTTGTGCAAAAGACTACAACTGCCGGCGTGCCCAGCCCGTACCGTCGGAATCTCGCGAGAACAGGGGTGTCTCCTGTTCTGGCCGAACTATATTTCCCGGCGTGCAGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGGCTCTCTCTGGCGATATGTGCGTGCCAGCATGACGCTCTCGGGCTACCTGCCCCCTCTGTGTGACCCGAAGGATGGGCACCTGCTCATGGATGGCGGCTACATCAACAATCTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865323.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X2

Length: 4767 bp    Location: 643471..664665   Strand: +
>XM_004865323.1
ATGCAGAGGCCAGGGAGGGGACCGCCTACTGGAAGGGGCCATCCCTGCGGGGGCCCGCACGAGGGCTGCTGGTTGCGGGTGTCAGGACCGCTACCCTTTGGCTCTGGGGTGGGGTCGGACGGGCGGGGCGTCTGGGCGACCCTGTGTGTAGGTGAAGGGTGCCTAAGATCAGGGACTCGCCTCATCCCTTGGCCCCGGCCGGAATGTCGGTTTGCTCCACGCCTCTCGCTTTCGCAGCTGGCCAACCTACCCAGCGCTAATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTAAGAAGTGGGGTTGTGCAAAAGACTACAACTGCCGGCGTGCCCAGCCCGTACCGTCGGAATCTCGCGAGAACAGGGGTGTCTCCTGTTCTGGCCGAACTATATTTCCCGGCGTGCAGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGCCCGGCCACTGACCACTAACCATCACCCACTAATGCCCGGAGGCCCCAGGTACGTCCACCCTTGGGGGTGGGGACCCGGGAGGCTCTTCGGGCACCTCATCCCCTGCCCCGTCCCCACAGGCTCCGTGTGGCATTACGTCCGGGCCAGTGCCTCCTACTGCCCCTACCTGCCCCCACTGTGCGACCCCAAGGACGGGCACCTGCTGGTGGATGGGTGCTACGTTAACAACGTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865326.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X5

Length: 4647 bp    Location: 643471..664665   Strand: +
>XM_004865326.1
ATGCAGAGGCCAGGGAGGGGACCGCCTACTGGAAGGGGCCATCCCTGCGGGGGCCCGCACGAGGGCTGCTGGTTGCGGGTGTCAGGACCGCTACCCTTTGGCTCTGGGGTGGGGTCGGACGGGCGGGGCGTCTGGGCGACCCTGTGTGTAGGTGAAGGGTGCCTAAGATCAGGGACTCGCCTCATCCCTTGGCCCCGGCCGGAATGTCGGTTTGCTCCACGCCTCTCGCTTTCGCAGCTGGCCAACCTACCCAGCGCTAATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTAAGAAGTGGGGTTGTGCAAAAGACTACAACTGCCGGCGTGCCCAGCCCGTACCGTCGGAATCTCGCGAGAACAGGGGTGTCTCCTGTTCTGGCCGAACTATATTTCCCGGCGTGCAGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGGCTCTCTCTGGCGATATGTGCGTGCCAGCATGACGCTCTCGGGCTACCTGCCCCCTCTGTGTGACCCGAAGGATGGGCACCTGCTCATGGATGGCGGCTACATCAACAATCTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865327.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X6

Length: 4392 bp    Location: 643471..664665   Strand: +
>XM_004865327.1
ATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGCCCGGCCACTGACCACTAACCATCACCCACTAATGCCCGGAGGCCCCAGGTACGTCCACCCTTGGGGGTGGGGACCCGGGAGGCTCTTCGGGCACCTCATCCCCTGCCCCGTCCCCACAGGCTCCGTGTGGCATTACGTCCGGGCCAGTGCCTCCTACTGCCCCTACCTGCCCCCACTGTGCGACCCCAAGGACGGGCACCTGCTGGTGGATGGGTGCTACGTTAACAACGTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865328.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X7

Length: 4191 bp    Location: 643471..664665   Strand: +
>XM_004865328.1
ATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGGCTCTCTCTGGCGATATGTGCGTGCCAGCATGACGCTCTCGGGCTACCTGCCCCCTCTGTGTGACCCGAAGGATGGGCACCTGCTCATGGATGGCGGCTACATCAACAATCTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865329.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X8

Length: 4170 bp    Location: 643471..664665   Strand: +
>XM_004865329.1
ATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGCCCGGCCACTGACCACTAACCATCACCCACTAATGCCCGGAGGCCCCAGGTACGTCCACCCTTGGGGGTGGGGACCCGGGAGGCTCTTCGGGCACCTCATCCCCTGCCCCGTCCCCACAGGCTCCGTGTGGCATTACGTCCGGGCCAGTGCCTCCTACTGCCCCTACCTGCCCCCACTGTGCGACCCCAAGGACGGGCACCTGCTGGTGGATGGGTGCTACGTTAACAACGTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865331.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X10

Length: 4047 bp    Location: 643471..664665   Strand: +
>XM_004865331.1
ATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGGCTCTCTCTGGCGATATGTGCGTGCCAGCATGACGCTCTCGGGCTACCTGCCCCCTCTGTGTGACCCGAAGGATGGGCACCTGCTCATGGATGGCGGCTACATCAACAATCTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865335.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X14

Length: 3969 bp    Location: 643471..664665   Strand: +
>XM_004865335.1
ATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGGCTCTCTCTGGCGATATGTGCGTGCCAGCATGACGCTCTCGGGCTACCTGCCCCCTCTGTGTGACCCGAAGGATGGGCACCTGCTCATGGATGGCGGCTACATCAACAATCTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865332.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X11

Length: 4035 bp    Location: 643471..664665   Strand: +
>XM_004865332.1
ATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGGCTCTCTCTGGCGATATGTGCGTGCCAGCATGACGCTCTCGGGCTACCTGCCCCCTCTGTGTGACCCGAAGGATGGGCACCTGCTCATGGATGGCGGCTACATCAACAATCTGCCAGCGGACATTGCGCGCAGCATGGGTGCCAAAACGGTCATCGCCATTGATGTGGGAAGCCAGGATGAGACAGACCTCAGCACCTACGGAGACAGCCTGTCAGGCTGGTGGCTGCTGTGGAAGCGGCTGAACCCCTGGGCGCACAAGGTGAAGGTTCCCGACATGGCCGAGATCCAGTCCCGCCTGGCGTACGTGTCCTGTGTGCGGCAGCTGGAGGTCGTGAAATCCAGCTCGTACTGCGAGTACCTGCGCCCATCCATCGACTGCTTCAAGACCATGGACTTTGGGAAGTTCGACCAGATCTATGATGTGGGCTACCAGTATGGGAAAGCAGTGTTTGGAGGCTGGAGCCGGGGCGACGTCATTGAGAAAATGCTCACGGACCGGAGGTCCACAGACCTCAATGAGAGCCGCCGCGCGGATGTACTAGCCTTCCCCAGCTCCGGCTTCACCGACTTGGCGGAGATTGTGTCCCGGATTGAGCCCCCCACAAGCTACATCTCTGATGGCTGTGCTGATGGGGAGGAGTCAGATTGCCTGACAGAGTATGAGGAGGACATGGGACCAGACTGCTCGAGGGACGAAGGGGGCTCCCCCGAGGGTGCCAGCCCCAGCACTGCCTCGGAGGTGGAGGAGGAGAAGTCTGTGCTCCGGCAGCGGCGCTTTGTGCCCCAGGAGCCTGCTGGCTTAGGCACACAAGCCTGA

XM_004865334.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X13

Length: 3987 bp    Location: 643471..662321   Strand: +
>XM_004865334.1
ATGCAGAGGCCAGGGAGGGGACCGCCTACTGGAAGGGGCCATCCCTGCGGGGGCCCGCACGAGGGCTGCTGGTTGCGGGTGTCAGGACCGCTACCCTTTGGCTCTGGGGTGGGGTCGGACGGGCGGGGCGTCTGGGCGACCCTGTGTGTAGGTGAAGGGTGCCTAAGATCAGGGACTCGCCTCATCCCTTGGCCCCGGCCGGAATGTCGGTTTGCTCCACGCCTCTCGCTTTCGCAGCTGGCCAACCTACCCAGCGCTAATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTAAGAAGTGGGGTTGTGCAAAAGACTACAACTGCCGGCGTGCCCAGCCCGTACCGTCGGAATCTCGCGAGAACAGGGGTGTCTCCTGTTCTGGCCGAACTATATTTCCCGGCGTGCAGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGCCCGGCCACTGACCACTAACCATCACCCACTAATGCCCGGAGGCCCCAGGCTCCGTGTGGCATTACGTCCGGGCCAGTGCCTCCTACTGCCCCTACCTGCCCCCACTGTGCGACCCCAAGGACGGGCACCTGCTGGTGGATGGGTGCTACGTTAA

XM_004865336.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X15

High confidence: 4 potential gene matches
Length: 3945 bp    Location: 643471..661018   Strand: +
>XM_004865336.1
ATGCAGAGGCCAGGGAGGGGACCGCCTACTGGAAGGGGCCATCCCTGCGGGGGCCCGCACGAGGGCTGCTGGTTGCGGGTGTCAGGACCGCTACCCTTTGGCTCTGGGGTGGGGTCGGACGGGCGGGGCGTCTGGGCGACCCTGTGTGTAGGTGAAGGGTGCCTAAGATCAGGGACTCGCCTCATCCCTTGGCCCCGGCCGGAATGTCGGTTTGCTCCACGCCTCTCGCTTTCGCAGCTGGCCAACCTACCCAGCGCTAATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTAAGAAGTGGGGTTGTGCAAAAGACTACAACTGCCGGCGTGCCCAGCCCGTACCGTCGGAATCTCGCGAGAACAGGGGTGTCTCCTGTTCTGGCCGAACTATATTTCCCGGCGTGCAGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGCCCGGCCACTGACCACTAACCATCACCCACTAATGCCCGGAGGCCCCAGGCTCTCTCTGGCGATATGTGCGTGCCAGCATGACGCTCTCGGGCTACCTGCCCCCTCTGTGTGA

XM_004865346.1 Coding sequence

Xab2 XPA binding protein 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 2568 bp    Location: 712005..704405   Strand: -
>XM_004865346.1
ATGGTGGTGATGGCGCGCGTTTCTCGGCCCGAGCGGCCGGACCTTGTCTTTGAGGAAGAGGACCTTCCTTATGAGGAGGAAATCATGCGGAACCAGTTCTCAGTTAAATGCTGGCTCCGCTACATCGAGTTCAAACAGGGGGCTCCAAAGCCTAGGCTCAATCAGCTGTACGAGCGGGCACTCAAGCTGCTGCCCTGTAGCTACAAACTCTGGTACCGCTACCTAAAGGCACGCCGGGCACAGGTGAAGCATCGCTGCGTGACGGACCCCGCCTACGAAGATGTCAACAACTGCCATGAGAGAGCCTTTGTGTTCATGCACAAGATGCCCCGTCTGTGGCTAGATTATTGCCAGTTCCTGATGGACCAAGGACGGGTCACACATACTCGCCGCACCTTCGACCGGGCACTCCGGGCATTGCCCATCACACAGCACTCTCGCATCTGGCCCCTGTACCTGCGCTTCCTGCGTTCCCACCCACTGCCGGAGACAGCGGTGCGGGGCTACCGGCGCTTCCTCAAGCTGAGTCCCGAGAGTGCCGAGGAGTACATTGAGTACCTCAAGTCCAGCGACCGGCTGGATGAGGCGGCGCAGCGCCTGGCCACTGTGGTAAACGACGAGCGCTTTGTGTCTAAGGCCGGCAAGTCCAACTACCAGCTGTGGCACGAGCTATGCGACCTCATCTCCCAGAACCCGGACAAGGTGCAGTCCCTCAACGTGGATGCCATCATCCGAGGCGGCCTCACTCGCTTCACCGACCAGCTGGGCAAGCTCTGGTGCTCGCTGGCTGACTACTACATCCGCAGCGGCCACTTTGAGAAGGCCCGGGATGTGTACGAGGAGGCTGTCCGCACCGTGATGACAGTCCGCGACTTCACGCAGGTGTTTGACAGCTACGCGCAGTTCGAGGAGAGCATGATCGCGGCCAAGATGGAGACCACCTCGGAGCTGGGGCGCGAGGAGGAGGACGACGTGGACCTGGAGCTGCGGCTGGCCCGATTCGAGCACCTCATCAGCCGGCGGCCGCTGCTGCTCAACAGCGTCCTGCTGCGCCAGAACCCGCACCACGTGCACGAGTGGCACAAGCGCGTGGCCCTGCACCAGGGCCGCCCCCGGGAGATCATCAACACGTACACGGAGGCCGTGCAGACCGTGGACCCCTTCAAGGCCACCGGCAAACCCCACACCCTGTGGGTGGCGTTTGCCAAGTTTTACGAGGACAACGGGCAGCTGGACGATGCCCGCGTCATCCTGGAGAAGGCCACCAAGGTGAACTTCAAGCAGGTGGACGACCTGGCCAGCGTGTGGTGCCAGTGTGGGGAGCTGGAGCTGCGGCACGAGAACTACGATGAGGCCTTGCGGCTGCTGCGGAAGGCCACGGCACTGCCCGCCCGCCGGGCCGAGTACTTCGACGGCTCAGAGCCCGTGCAGAACCGCGTGTACAAGTCGCTGAAGGTGTGGTCCATGCTTGCCGACCTGGAGGAGAGCTTGGGCACCTTCCAGTCCACCAAGGCCGTGTACGACCGCATCCTGGACCTGCGCATCGCCACGCCCCAGATCATCATCAACTACGCCATGTTCCTGGAGGAGCACAAGTACTTCGAGGAGAGCTTCAAGGCCTACGAGCGCGGCATCTCGCTGTTCAAATGGCCCAACGTGTCAGACATCTGGAGCACCTACCTGACCAAGTTCATCGCCCGCTATGGAGGCCGGAAGCTGGAGCGAGCGCGGGACCTATTTGAGCAGGCGCTGGACGGCTGCCCTCCCAAATACGCCAAAACCCTGTACCTGCTGTACGCGCAGCTGGAGGAGGAGTGGGGCCTGGCCCGGCACGCCATGGCCGTGTACGACCGGGCCACCAGGGCCGTGGAGCCCGCCCAGCAGTATGACATGTTCAACATCTACATCAAGCGGGCCGCCGAGATCTACGGCGTCACCCACACCCGGGGCATCTACCAGAAGGCCATCGAGGTGCTGTCAGATGAGCACGCGCGTGAGATGTGCCTGCGCTTTGCGGACATGGAGTGCAAGCTCGGAGAGATCGACCGTGCCCGGGCTATCTACAGCTTCTGCTCTCAGATCTGCGACCCTCGGACGACAGGGGCATTCTGGCAGACGTGGAAGGACTTCGAGGTGCGGCATGGCAACGAGGACACCATCCGGGAGATGCTGCGCATCCGCCGAAGCGTGCAGGCTACCTACAACACGCAGGTCAACTTCATGGCCTCCCAGATGCTCAAGGTGTCGGGCAGCGCCACGGGCACCGTGTCCGACCTGGCCCCAGGGCAGAGCGGCATGGATGACATGAAGCTGCTGGAGCAGCGGGCAGAGCAGCTGGCTGCCGAGGCCGAGCGGGACCAGCCCCCTCGGGCCCAGAGCAAGATCCTGTTTGTGAGGAGTGACGCGTCCCGGGAGGAGCTGGCGGAGCTGGCCCAGCAGGCCAACCCCGACGAGATCCAGCTGGGGGAGGACGAGGACGAGGACGAGATGGACCTGGAGCCCAACGAGGTCCGGCTGGAGCAGCAGAGCGTGCCGGCTGCCGTGTTCGGGAGCCTGAAGGAGGACTGA

XM_004865333.1 Coding sequence

Pnpla6 patatin-like phospholipase domain containing 6, transcript variant X12

Length: 3987 bp    Location: 643471..660857   Strand: +
>XM_004865333.1
ATGCAGAGGCCAGGGAGGGGACCGCCTACTGGAAGGGGCCATCCCTGCGGGGGCCCGCACGAGGGCTGCTGGTTGCGGGTGTCAGGACCGCTACCCTTTGGCTCTGGGGTGGGGTCGGACGGGCGGGGCGTCTGGGCGACCCTGTGTGTAGGTGAAGGGTGCCTAAGATCAGGGACTCGCCTCATCCCTTGGCCCCGGCCGGAATGTCGGTTTGCTCCACGCCTCTCGCTTTCGCAGCTGGCCAACCTACCCAGCGCTAATGGAGAAGCCCACGCCGCAGGACTGCGGGCTATCAGACCCGCTGCCCGGCTCGAAGCAACCGATGGAGGCCCCGCTGCAAACTGGGATGGTAAGAAGTGGGGTTGTGCAAAAGACTACAACTGCCGGCGTGCCCAGCCCGTACCGTCGGAATCTCGCGAGAACAGGGGTGTCTCCTGTTCTGGCCGAACTATATTTCCCGGCGTGCAGCGCGGGCCGACAAGTCGCTGGGAAGAGTCCGTTCGCCCGTCCCCCCACCCCGGGAGAGAATGGAGCCGTCCCATTCTGCAGATGGGGACACCGAGTCATGAGATGAATGCGACCTTCTCGGGGGCGGAAGTGATGATCCCGGGACCCCAGGACGTCTTGGCCCCCGAGGAGGGCTCGGCGGGACGGATGTGCGGTTCGCAGCCAGTGCCGTTCGTCCCGCAGGTGCTGGGCGTGATGATAGGGGCCGGAGTGGCGGTTGTGGTGACCGCCGTGTTCATCCTTCTGCTGGTGCGGAGGCTACGAGTGGCAAAAGCCCCAGCCCCGGATGGCCCCCGGTATCGGTTCCGGAAGAGGGACAAAGTGCTTTTCTATGGCCGGAAGATTATGCGGAAGGTGTCACAATCCACTTCCTCCCTGGTGGACGCCTCCGTCTCCACCACTTCCCGGCCACGCATGAAGAAGAAACTTAAGATGCTGAACATTGCCAAGAAGATCCTGCGCATCCAGAAGGAGACCCCAACACTGCAGCGGAAGGAGCCCCCACCCTCAGTGCTGGAGGCGGACCTGACAGAGGGTGACCTGGCCAACTCCCACCTGCCCTCTGAGGTGCTCTATATGCTCAAGAATGTCCGGGTGCTGGGCCACTTTGAGAAGCCGCTCTTCCTGGAGCTTTGCCGGCACATGGTCTTCCAGCGACTCAGCCAGGGCGACTACGTCTTCCGCCCGGGGCAGCCAGACGCCAGCATCTATGTGGTGCAGGACGGGTTGCTGGAGCTCTGCCTGCCGGGGCCTGACGGGAAGGAGTGTGTTGTGAAGGAAGTGGTCCCTGGGGACAGCGTCAACAGTCTCCTGAGCATTCTGGACGTCATCACGGGCCACCAGCATCCCCCACGGACAGTGTCAGCCCGGGCAGCCCGGGACTCCACGGTGCTGCGGCTTCCCGTGGAGGCCTTCTCGGCAGTCTTCACCAAGTACCCGGAGAGCTTGGTGCGGGTGGTGCAGATCATAATGGTGAGGCTGCAGAGAGTCACCTTCCTGGCCCTTCACAACTACCTGGGTCTGACCAACGAGCTCTTCAGCCACGAAATCCAGCCCCTTCGCCTGTTCCCCAGCCCTGGCCTCCCATCCCGGACCAGCCCCGTGCGAGGCTCCAAGCGGGTGGTCAGCACCTTGGCCACTGAGGAGCTGAGGGAGGCTCCAGGCCGGCCGCCTGACCCCACCGGGGCCCCGCTGCCTATACCTGCAGGGGACCCCATAAAGCCCACCTCCCTGGAAGCCCCCACAGCCCCTCTGCTGAGCCGCTGCATCTCCATGCCGGTGGACATCGCAGGCTTGCAGGGTGGCCCCCGCTCGGACTTCGACATGGCCTACGAGCGTGGCCGGATCTCCATGTCCCTGCAAGAGGAGGCTTCCGGGGGACCCCAGGTGGCCCCTGCTCGGACCCCCACCCAGGAGCCCCGGGAGCAGCCAGCAGGTGCCTGTGAGTACAGTTACTGCGAAGACGAGTCGGCCACTGGGGGCTGCTGCACCTTCGGGCCCTACCAGGGCCGCCAGACCAGCAGCATCTTTGAGGCAGCCAAGCGGGAGCTGGCCAAGCTGATGCGGATCGAGGATCCCTCTCTGCTCAACAGCCGAGTCTTGCTGCACCACGCCAAAGCTGGCACCATCATTGCCCGCCAGGGAGACCAGGACGTGAGCCTGCACTTCGTGCTCTGGGGCTGCCTGCACGTGTACCAGCGCATGATCGACAAGGCGGAGGAAGTGTGCCTGTTCGTGGCGCAGCCCGGGGAGCTGGTGGGACAGCTGGCGGTGCTCACCGGGGAGCCCCTCATCTTCACCCTGCGTGCACAGCGTGACTGCACCTTCCTGCGGATCTCTAAGTCCGACTTCTATGAGATCATGCGCGCGCAGCCCAGTGTGGTCCTGAGTGCTGCGCACACGGTGGCCGCCAGGATGTCGTCCTTCGTGCGCCAGATGGACTTCGCCATCGATTGGACCGCAGTGGAGGCCGGACGCGCCCTGTACAGGCAGGGCGACCGCTCCGACTGCACCTACATTGTGCTCAACGGGCGGCTGCGCAGCGTCATCCAGCGGGGCAGCGGCAAGAAGGAGCTGGTGGGGGAGTATGGCCGCGGGGACCTCATTGGAGTGGTGGAGGCACTGACCCGGCAGCCGCGAGCCACGACGGTGCACGCGGTGAGAGACACAGAGCTGGCCAAACTCCCCGAGGGCACTTTGGGCCACATCAAACGGCGCTACCCGCAGGTCGTGACCCGCCTCATTCACCTCCTGAGCCAGAAAATCCTGGGGAATTTGCAGCAGCTGCAAGGACCTTTCCCGGCAGGCTCGGGGCTGGGCGTCCCGCCCCCCTCGGAGCTCACCAACCCCGCCAGCAACCTGTCCACAGTGGCGGTCCTGCCGGTGTGTGCGGAGGTGCCCATGATGGCCTTCATGCTGGAGCTGCAGCACGCGCTGCAAGCCATCGGCCCCACGCTGCTCCTCAACAGCGACATCATCCGGGCACGCCTAGGGGCTTCAGCACTGGACAGCATCCAGGAGTTCCGGCTGTCAGGGTGGCTGGCCCAGCAGGAGGACACGCACCGCATCGTGCTCTACCAGACAGACGCGTCGCTCACGCCCTGGACCGTGCGCTGCCTGCGCCAGGCTGACTGCATCCTCATCGTGGGCCTAGGCGACCAGGAGCCCACTCTTGGCCAGCTGGAGCAGATGCTGGAGAACACGGCTGTGCGTGCCCTCAAGCAGCTCGTCCTGCTGCACCGGGAGGAGGGCCCCGGCCCCGCACGCACCGTGGAGTGGCTCAACATGCGCAGCTGGTGCTCGGGGCACTTACACCTGCGTTGCCCCCGACGCCTCTTCTCCCGCCGCAGCCCCGCCAAGCTGCACGAACTCTATGAGAAAGTCTTCTCCAGGCGGGCGGACCGGCACAGTGACTTCTCGCGCTTGGCGCGGGTGCTCACAGGAAACACTATTGCCCTGGTGCTGGGCGGGGGCGGGGCCAGGGGGTGCTCGCACATCGGGGTGCTGAAGGCCTTGGAGGAGGCAGGAGTGCCTGTCGACCTGGTGGGCGGCACATCCATAGGTTCCTTCATCGGGGCTCTGTACGCAGAAGAGCGCAGCGCCAGCCGCACCAAGCAACGGGCCCGGGAATGGGCCAAGAGCATGACTTCCGTACTGGAGCCTGTGTTGGATCTCACATACCCAGTCACCTCCATGTTCACGGGCTCGGCCTTTAACCGCAGCATCCACCGTGTCTTCCAGGATAAGCAGATTGAGGACCTGTGGCTGCCATACTTCAACGTGACCACAGACATCACTGCCTCAGCCATGCGTGTCCACAAAGATGCCCGGCCACTGACCACTAACCATCACCCACTAATGCCCGGAGGCCCCAGGCTCCGTGTGGCATTACGTCCGGGCCAGTGCCTCCTACTGCCCCTACCTGCCCCCACTGTGCGACCCCAAGGACGGGCACCTGCTGGTGGATGGGTGCTACGTTAA

XM_004865341.1 Coding sequence

Camsap3 calmodulin regulated spectrin-associated protein family, member 3, transcript variant X3

Length: 3798 bp    Location: 688966..703497   Strand: +
>XM_004865341.1
ATGGTGGAGGCGGCGCCCGCGGGGCCCGGGCCGCTGCGGAGGACCTTCCTGGTGCCCGAGATCAAGTCGCTGGACCAGTACGACTTCTCGCGGGCCAAGGCGGCGGCGAGCCTGGCGTGGGTGCTGCGGGCCGCGTTCGGGGGCGCAGAGCACGTGCCCCCGGAGCTGTGGGAGCCCTTCTACACTGACCAGTACGCACAGGAGCACGTGAAGCCCCCGGTCACCCGCCTGCTGCTCTCCGCTGAGCTCTACTGCCGGGCCTGGCGCCAGGCACTGCCGCAGCTTGAGGCCCCTCCCAACCCCTCCGCGCTGCTGGCCCTGCTGTCTCGGAGGGGCACGGTGCCCTCGCTACCCGATCGCCCTGTGCGCGAGGCCGACCTGAGACAACAGCCCATTCTCATGGGAGCCCACTTGGCCGTCATCGATGCCCTCATGGTGGCCTTCGCCTTTGAGTGGACAAAGACGCTGCCGGGTCCCTTGGCTCTGCCCAACTTGGAGCACAAGTTGCTTTTCTGGGTGGAAACGAACGTCCGGGGGCTGCAGGAGAAGACAGAGCAGGAAGCTGCACAGCGGGTGTCTCCCGCCGCCCCTGCCGACGGGGCGGCCCCTGCGCAGCCTTCGTGTCCCACACGCTGGTACTGGAAGCTGGTTCCTATCCGCTACCGCAAGGACCGGGCTACGGCCCGCCGCGCCCCCTGCTTCCCATCCGTGACCACCGTCCAGGATCTGGCCAGTGGAGCTGCGCTGGCCGCCACCATCCACTGCTATTGTCCTCAGCTCTTACGTCTTGAGGAGGTTTGCCTCAAGGACCCCATGTCCGTGGCCGACAGCCTGTACAACCTCCAGCTGGTGCAGGATTTCTGCGCCTCTCGCCTTCCCCGTGGCTGCCCGCTGTCCCTCGAGGACTTGCTTTATGTCCCTCCGCCGCTCAAGGTCAACCTGGTGGTGCTGCTGGCTGAGATGTTCATGTGCTTCGAGGTGCTGAAACCCGACTTCGTGCAGGCCAAGGACTTACCGGATGGGCACGCCGCCTCCCCCCGGGGCACCGAGGCCTCCCCGTCCCAGAACAACAGCGGCAGCAGTTCCCCTGTCTTCAACTTCCGGCACCCGCTCCTGTCCCCTGGCGGCTCCCAGTCCCCGCTTCGGGGATCGACAGGCTCCCTGAAGTCCTCCCCGTCCATGTCTCACATGGAGGCCCTGGGCAAGGCCTGGAATCGGCAGCTCAGCCGGCCCCTCTCCCAGGCTGTGTCGTTCAGCACCCCCTTTGGCCTGGACAGCGACGTGGATGTCGTCATGGGAGACCCCGTTCTGCTGCGCTCCGTCAGCTCAGACAGTCTGGGCCCCCCGCGGCCTGTGCCGGCGGCTCGGACCCCCGTCCAGCCGACCCCGGAGCCTGGCGATCTGCCCACCATCGAGGAAGCCCTGCAGATCATCCACAGTGCCGAGCCCCGGCTGCTCCCGGATGGCGCCGCGGATGGCAGCTTCTACCTCCACTCCCCCGAGGGCCCCTCGAAACCGCCGCTGTCCTCCTCCTACCCACCTATGGGGGCCTCGAAACTACTGTCTGATGGGCTTCCCAAAGCGCCTGTTTATGTGTCCCACCCCGAGGTCCCCTCAAAATCATCCCCTTGCCCAGCAGGGGAGGAATTGAAGCCACCAGCCCCAGCTGAGGGGTCCCCGAAGGCAGTGGCTTTGTCCCCTGCAGCCACCAACTCAGAAGTAAAGATGACCAGTTTCGCCGAGCGCAAGAAACAGCTCGTGAAGGCCGAGGTGGAGGTTGGAGTAGCATCCCCCACGGCTACTCCAGTAGCACCCGAGGCCCTGAGCTCAGAGATGAGCGAACTAGGAGCTCGGCTGGAGGAGAAACGCCGGGCCATAGAGGCCCAGAAGCGTCGCATCGAAGCCATCTTTGCCAAACACCGCCAGCGTCTGGGCAAGAACGCTTTCCTGCAGGTGCAGCCGCGGGAGGCAGCGGGGGAGGCGGAGGCGGAGCCGGGGCCGGGCTCAGCCCCTGCAGGGGAGCGGCCGGCAGGCGAGGGCCAGGGCGAGCCCTCCTCGCGGCCCAAGTCAGTGACCTTCTCTGCCGAGCTGGGCCCGGTGCCCCCCGAGGGGCTCGGGGACTACAACCGAGCAGTCAGCAAGCTGAGTGCCGCACTGAGCTCGCTGCAGCGGGACATGCAGAGGCTCACGGACCAGCAGCAGCGCCTTCTGGCCCCGCCGGAAGCCTCCGGACCTGCCCCACCACCCGCTGCCTGGGTCATCCCCGGTCCCATGGCCGGGCCCAAAGCCGTGTCCCCCAGCCCTGCCCGGCGAGCCCCAGCCCCCCGGCGCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCCCCAACCCGACATCTCGAAGCCCGAAACACGCACGGCCGGCAGAGCTGCGCCTGGCCCCCCTGACCAGGGTGCTCACGCCCCCCAACGATGTAGACAGTCTCCCCCACCTGCGCAAGTTCTCGCCGAGCCAGGTTCCTGTGCAGACGCGCTCCTCCATCCTCCTGTCGGAGGGGACGCCGCCCGAGGAGCCCACACCCCGGCCCGGCCTCATTGAGATCCCCTTGGCCAGCCTGGGCGAGCCTGCTGCAGAGGATGAGAGAGACGGGAGCCCTCCCGGGGCTGAGGATTCCTTAGAGGAGGAGGCCTTGTCCGAGGGAGAGCCCCGGACTGGGCTCGGATTCTTCTTTAAGGACGAAGACAAGCCCGAGGATGAGATGGCCCAGAAGCGGGCCAGTCTGCTGGAGCGGCAGCAGCGGCGGGCAGAGGAGGCCCGGAAGCGTCGGCAGTGGCAGGAGGCCGAGAAGGAGCAGCGGAGAGAGGAGCCTGTGAGGCTGGTGCACGAGGAGCCCACCGCAGCACCCCCAGCCCCCGCGTCAGCTCCCCTGGCGGTGGCCCCAGCCCCTGCCACTCGGGTCCCTGCTGAGGAGGAGGGGGGGCCCCGGCGAGGGGAGTTCACGCGGCTCGAGTACGAGCGCCGGGCCCAGCTGAAGCTCATGGACGACCTGGATAAGGTGCTGCGGCCCCGGGCCCCGGGGGCCGGGGGCCCAGGTCGGGGCGGGCGGAGGGGCCCCCGGCCTCGCTCTGGCTGCTGCGACGACTCGGCTCTGGCCCGAAGCCCTGCGCGTGGCCTGCTGGGCTCACGGCTCAGCAAGGTCTACTCCCAGTCCACCCTGTCTCTGTCCACCGTGGCCAACGAGCTGCCCAACAACCTCGGCGTGAAGAGGCCCACGTCTCGGGCCCCCTCCCCGTCGGGCCTCATGTCCCCGAGCCGCCTGCCGGGCAGCCGAGAGCAAGACTGGGAGAACGGCAGCAACGCCTCCTCGCCGGCCTCGGTGCCCGAGTACACAGGTCCGAGACTGTACAAGGAGCCCAGTGCGAAGTCCAACAAGTTCATCATCCACAACGCCCTGTCACACTGCTGCCTGGCGGGCAAGGTGAATGAGCCGCAGAAGAACCGCGTCCTGGAGGAGATCGAAAAGAGCAAGGCCAACCACTTCCTGATCCTCTTCCGGGACTCCAGCTGCCAGTTCCGGGCACTTTACACATTGTCAGGGGAGACGGAGGAGCTGTCCAGGCTGGCGGGCTACGGCCCGCGGACTGTCACCCCCACCATGGTCGAAGGCATCTACAAGTACAACTCGGACCGCAAGCGCTTCACCCAGATCCCGGCCAAAACCATGTCCATGAGCGTCGATGCCTTCACCATCCAGGGACACCTCTGGCAGAGCAGGAAGCCCACCACTCCCAAGAAGGGGGGCGGCACCCCCAAATAG

XM_004865343.1 Coding sequence

Camsap3 calmodulin regulated spectrin-associated protein family, member 3, transcript variant X5

Length: 3774 bp    Location: 688966..703497   Strand: +
>XM_004865343.1
ATGGTGGAGGCGGCGCCCGCGGGGCCCGGGCCGCTGCGGAGGACCTTCCTGGTGCCCGAGATCAAGTCGCTGGACCAGTACGACTTCTCGCGGGCCAAGGCGGCGGCGAGCCTGGCGTGGGTGCTGCGGGCCGCGTTCGGGGGCGCAGAGCACGTGCCCCCGGAGCTGTGGGAGCCCTTCTACACTGACCAGTACGCACAGGAGCACGTGAAGCCCCCGGTCACCCGCCTGCTGCTCTCCGCTGAGCTCTACTGCCGGGCCTGGCGCCAGGCACTGCCGCAGCTTGAGGCCCCTCCCAACCCCTCCGCGCTGCTGGCCCTGCTGTCTCGGAGGGGCACGGTGCCCTCGCTACCCGATCGCCCTGTGCGCGAGGCCGACCTGAGACAACAGCCCATTCTCATGGGAGCCCACTTGGCCGTCATCGATGCCCTCATGGTGGCCTTCGCCTTTGAGTGGACAAAGACGCTGCCGGGTCCCTTGGCTCTGCCCAACTTGGAGCACAAGTTGCTTTTCTGGGTGGAAACGAACGTCCGGGGGCTGCAGGAGAAGACAGAGCAGGAAGCTGCACAGCGGGTGTCTCCCGCCGCCCCTGCCGACGGGGCGGCCCCTGCGCAGCCTTCGATCCGCTACCGCAAGGACCGGGCTACGGCCCGCCGCGCCCCCTGCTTCCCATCCGTGACCACCGTCCAGGATCTGGCCAGTGGAGCTGCGCTGGCCGCCACCATCCACTGCTATTGTCCTCAGCTCTTACGTCTTGAGGAGGTTTGCCTCAAGGACCCCATGTCCGTGGCCGACAGCCTGTACAACCTCCAGCTGGTGCAGGATTTCTGCGCCTCTCGCCTTCCCCGTGGCTGCCCGCTGTCCCTCGAGGACTTGCTTTATGTCCCTCCGCCGCTCAAGGTCAACCTGGTGGTGCTGCTGGCTGAGATGTTCATGTGCTTCGAGGTGCTGAAACCCGACTTCGTGCAGGCCAAGGACTTACCGGATGGGCACGCCGCCTCCCCCCGGGGCACCGAGGCCTCCCCGTCCCAGAACAACAGCGGCAGCAGTTCCCCTGTCTTCAACTTCCGGCACCCGCTCCTGTCCCCTGGCGGCTCCCAGTCCCCGCTTCGGGGATCGACAGGCTCCCTGAAGTCCTCCCCGTCCATGTCTCACATGGAGGCCCTGGGCAAGGCCTGGAATCGGCAGCTCAGCCGGCCCCTCTCCCAGGCTGTGTCGTTCAGCACCCCCTTTGGCCTGGACAGCGACGTGGATGTCGTCATGGGAGACCCCGTTCTGCTGCGCTCCGTCAGCTCAGACAGTCTGGGCCCCCCGCGGCCTGTGCCGGCGGCTCGGACCCCCGTCCAGCCGACCCCGGAGCCTGGCGATCTGCCCACCATCGAGGAAGCCCTGCAGATCATCCACAGTGCCGAGCCCCGGCTGCTCCCGGATGGCGCCGCGGATGGCAGCTTCTACCTCCACTCCCCCGAGGGCCCCTCGAAACCGCCGCTGTCCTCCTCCTACCCACCTATGGGGGCCTCGAAACTACTGTCTGATGGGCTTCCCAAAGCGCCTGTTTATGTGTCCCACCCCGAGGTCCCCTCAAAATCATCCCCTTGCCCAGCAGGGGAGGAATTGAAGCCACCAGCCCCAGCTGAGGGGTCCCCGAAGGCAGTGGCTTTGTCCCCTGCAGCCACCAACTCAGAAGTAAAGATGACCAGTTTCGCCGAGCGCAAGAAACAGCTCGTGAAGGCCGAGGTGGAGGTTGGAGTAGCATCCCCCACGGCTACTCCAGTAGCACCCGAGGCCCTGAGCTCAGAGATGAGCGAACTAGGAGCTCGGCTGGAGGAGAAACGCCGGGCCATAGAGGCCCAGAAGCGTCGCATCGAAGCCATCTTTGCCAAACACCGCCAGCGTCTGGGCAAGAACGCTTTCCTGCAGGTGCAGCCGCGGGAGGCAGCGGGGGAGGCGGAGGCGGAGCCGGGGCCGGGCTCAGCCCCTGCAGGGGAGCGGCCGGCAGGCGAGGGCCAGGGCGAGCCCTCCTCGCGGCCCAAGTCAGTGACCTTCTCTGCCGAGCTGGGCCCGGTGCCCCCCGAGGGGCTCGGGGACTACAACCGAGCAGTCAGCAAGCTGAGTGCCGCACTGAGCTCGCTGCAGCGGGACATGCAGAGGCTCACGGACCAGCAGCAGCGCCTTCTGGCCCCGCCGGAAGCCTCCGGACCTGCCCCACCACCCGCTGCCTGGGTCATCCCCGGTCCCATGGCCGGGCCCAAAGCCGTGTCCCCCAGCCCTGCCCGGCGAGCCCCAGCCCCCCGGCGCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCCCCAACCCGACATCTCGAAGCCCGAAACACGCACGGCCGGCAGAGCTGCGCCTGGCCCCCCTGACCAGGGTGCTCACGCCCCCCAACGATGTAGACAGTCTCCCCCACCTGCGCAAGTTCTCGCCGAGCCAGGTTCCTGTGCAGACGCGCTCCTCCATCCTCCTGTCGGAGGGGACGCCGCCCGAGGAGCCCACACCCCGGCCCGGCCTCATTGAGATCCCCTTGGCCAGCCTGGGCGAGCCTGCTGCAGAGGATGAGAGAGACGGGAGCCCTCCCGGGGCTGAGGATTCCTTAGAGGAGGAGGCCTTGTCCGAGGGAGAGCCCCGGACTGGGCTCGGATTCTTCTTTAAGGACGAAGACAAGCCCGAGGATGAGATGGCCCAGAAGCGGGCCAGTCTGCTGGAGCGGCAGCAGCGGCGGGCAGAGGAGGCCCGGAAGCGTCGGCAGTGGCAGGAGGCCGAGAAGGAGCAGCGGAGAGAGGAGCCTGTGAGGTGCGGCGGGGTCCAGCCCGGGGAAGCCTGGTCTTCACCCCCAGCCCCCGCGTCAGCTCCCCTGGCGGTGGCCCCAGCCCCTGCCACTCGGGTCCCTGCTGAGGAGGAGGGGGGGCCCCGGCGAGGGGAGTTCACGCGGCTCGAGTACGAGCGCCGGGCCCAGCTGAAGCTCATGGACGACCTGGATAAGGTGCTGCGGCCCCGGGCCCCGGGGGCCGGGGGCCCAGGTCGGGGCGGGCGGAGGGGCCCCCGGCCTCGCTCTGGCTGCTGCGACGACTCGGCTCTGGCCCGAAGCCCTGCGCGTGGCCTGCTGGGCTCACGGCTCAGCAAGGTCTACTCCCAGTCCACCCTGTCTCTGTCCACCGTGGCCAACGAGCTGCCCAACAACCTCGGCGTGAAGAGGCCCACGTCTCGGGCCCCCTCCCCGTCGGGCCTCATGTCCCCGAGCCGCCTGCCGGGCAGCCGAGAGCAAGACTGGGAGAACGGCAGCAACGCCTCCTCGCCGGCCTCGGTGCCCGAGTACACAGGTCCGAGACTGTACAAGGAGCCCAGTGCGAAGTCCAACAAGTTCATCATCCACAACGCCCTGTCACACTGCTGCCTGGCGGGCAAGGTGAATGAGCCGCAGAAGAACCGCGTCCTGGAGGAGATCGAAAAGAGCAAGGCCAACCACTTCCTGATCCTCTTCCGGGACTCCAGCTGCCAGTTCCGGGCACTTTACACATTGTCAGGGGAGACGGAGGAGCTGTCCAGGCTGGCGGGCTACGGCCCGCGGACTGTCACCCCCACCATGGTCGAAGGCATCTACAAGTACAACTCGGACCGCAAGCGCTTCACCCAGATCCCGGCCAAAACCATGTCCATGAGCGTCGATGCCTTCACCATCCAGGGACACCTCTGGCAGAGCAGGAAGCCCACCACTCCCAAGAAGGGGGGCGGCACCCCCAAATAG

XM_004865344.1 Coding sequence

Camsap3 calmodulin regulated spectrin-associated protein family, member 3, transcript variant X6

Length: 3387 bp    Location: 694704..703497   Strand: +
>XM_004865344.1
ATGCCCTCATGGTGGCCTTCGCCTTTGAGTGGACAAAGACGCTGCCGGGTCCCTTGGCTCTGCCCAACTTGGAGCACAAGTTGCTTTTCTGGGTGGAAACGAACGTCCGGGGGCTGCAGGAGAAGACAGAGCAGGAAGCTGCACAGCGGGTGTCTCCCGCCGCCCCTGCCGACGGGGCGGCCCCTGCGCAGCCTTCGTGTCCCACACGCTGGTACTGGAAGCTGGTTCCTCTCCTGTCTGCAGATCCGCTACCGCAAGGACCGGGCTACGGCCCGCCGCGCCCCCTGCTTCCCATCCGTGACCACCGTCCAGGATCTGGCCAGTGGAGCTGCGCTGGCCGCCACCATCCACTGCTATTGTCCTCAGCTCTTACGTCTTGAGGAGGTTTGCCTCAAGGACCCCATGTCCGTGGCCGACAGCCTGTACAACCTCCAGCTGGTGCAGGATTTCTGCGCCTCTCGCCTTCCCCGTGGCTGCCCGCTGTCCCTCGAGGACTTGCTTTATGTCCCTCCGCCGCTCAAGGTCAACCTGGTGGTGCTGCTGGCTGAGATGTTCATGTGCTTCGAGGTGCTGAAACCCGACTTCGTGCAGGCCAAGGACTTACCGGATGGGCACGCCGCCTCCCCCCGGGGCACCGAGGCCTCCCCGTCCCAGAACAACAGCGGCAGCAGTTCCCCTGTCTTCAACTTCCGGCACCCGCTCCTGTCCCCTGGCGGCTCCCAGTCCCCGCTTCGGGGATCGACAGGCTCCCTGAAGTCCTCCCCGTCCATGTCTCACATGGAGGCCCTGGGCAAGGCCTGGAATCGGCAGCTCAGCCGGCCCCTCTCCCAGGCTGTGTCGTTCAGCACCCCCTTTGGCCTGGACAGCGACGTGGATGTCGTCATGGGAGACCCCGTTCTGCTGCGCTCCGTCAGCTCAGACAGTCTGGGCCCCCCGCGGCCTGTGCCGGCGGCTCGGACCCCCGTCCAGCCGACCCCGGAGCCTGGCGATCTGCCCACCATCGAGGAAGCCCTGCAGATCATCCACAGTGCCGAGCCCCGGCTGCTCCCGGATGGCGCCGCGGATGGCAGCTTCTACCTCCACTCCCCCGAGGGCCCCTCGAAACCGCCGCTGTCCTCCTCCTACCCACCTATGGGGGCCTCGAAACTACTGTCTGATGGGCTTCCCAAAGCGCCTGTTTATGTGTCCCACCCCGAGGTCCCCTCAAAATCATCCCCTTGCCCAGCAGGGGAGGAATTGAAGCCACCAGCCCCAGCTGAGGGGTCCCCGAAGGCAGTGGCTTTGTCCCCTGCAGCCACCAACTCAGAAGTAAAGATGACCAGTTTCGCCGAGCGCAAGAAACAGCTCGTGAAGGCCGAGGTGGAGGTTGGAGTAGCATCCCCCACGGCTACTCCAGTAGCACCCGAGGCCCTGAGCTCAGAGATGAGCGAACTAGGAGCTCGGCTGGAGGAGAAACGCCGGGCCATAGAGGCCCAGAAGCGTCGCATCGAAGCCATCTTTGCCAAACACCGCCAGCGTCTGGGCAAGAACGCTTTCCTGCAGGTGCAGCCGCGGGAGGCAGCGGGGGAGGCGGAGGCGGAGCCGGGGCCGGGCTCAGCCCCTGCAGGGGAGCGGCCGGCAGGCGAGGGCCAGGGCGAGCCCTCCTCGCGGCCCAAGTCAGTGACCTTCTCTGCCGAGCTGGGCCCGGTGCCCCCCGAGGGGCTCGGGGACTACAACCGAGCAGTCAGCAAGCTGAGTGCCGCACTGAGCTCGCTGCAGCGGGACATGCAGAGGCTCACGGACCAGCAGCAGCGCCTTCTGGCCCCGCCGGAAGCCTCCGGACCTGCCCCACCACCCGCTGCCTGGGTCATCCCCGGTCCCATGGCCGGGCCCAAAGCCGTGTCCCCCAGCCCTGCCCGGCGAGCCCCAGCCCCCCGGCGCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCCCCAACCCGACATCTCGAAGCCCGAAACACGCACGGCCGGCAGAGCTGCGCCTGGCCCCCCTGACCAGGGTGCTCACGCCCCCCAACGATGTAGACAGTCTCCCCCACCTGCGCAAGTTCTCGCCGAGCCAGGTTCCTGTGCAGACGCGCTCCTCCATCCTCCTGTCGGAGGGGACGCCGCCCGAGGAGCCCACACCCCGGCCCGGCCTCATTGAGATCCCCTTGGCCAGCCTGGGCGAGCCTGCTGCAGAGGATGAGAGAGACGGGAGCCCTCCCGGGGCTGAGGATTCCTTAGAGGAGGAGGCCTTGTCCGAGGGAGAGCCCCGGACTGGGCTCGGATTCTTCTTTAAGGACGAAGACAAGCCCGAGGATGAGATGGCCCAGAAGCGGGCCAGTCTGCTGGAGCGGCAGCAGCGGCGGGCAGAGGAGGCCCGGAAGCGTCGGCAGTGGCAGGAGGCCGAGAAGGAGCAGCGGAGAGAGGAGCCTGTGAGGCTGGTGCACGAGGAGCCCACCGCAGCACCCCCAGCCCCCGCGTCAGCTCCCCTGGCGGTGGCCCCAGCCCCTGCCACTCGGGTCCCTGCTGAGGAGGAGGGGGGGCCCCGGCGAGGGGAGTTCACGCGGCTCGAGTACGAGCGCCGGGCCCAGCTGAAGCTCATGGACGACCTGGATAAGGTGCTGCGGCCCCGGGCCCCGGGGGCCGGGGGCCCAGGTCGGGGCGGGCGGAGGGGCCCCCGGCCTCGCTCTGGCTGCTGCGACGACTCGGCTCTGGCCCGAAGCCCTGCGCGTGGCCTGCTGGGCTCACGGCTCAGCAAGGTCTACTCCCAGTCCACCCTGTCTCTGTCCACCGTGGCCAACGAGCTGCCCAACAACCTCGGCGTGAAGAGGCCCACGTCTCGGGCCCCCTCCCCGTCGGGCCTCATGTCCCCGAGCCGCCTGCCGGGCAGCCGAGAGCAAGACTGGGAGAACGGCAGCAACGCCTCCTCGCCGGCCTCGGTGCCCGAGTACACAGGTCCGAGACTGTACAAGGAGCCCAGTGCGAAGTCCAACAAGTTCATCATCCACAACGCCCTGTCACACTGCTGCCTGGCGGGCAAGGTGAATGAGCCGCAGAAGAACCGCGTCCTGGAGGAGATCGAAAAGAGCAAGGCCAACCACTTCCTGATCCTCTTCCGGGACTCCAGCTGCCAGTTCCGGGCACTTTACACATTGTCAGGGGAGACGGAGGAGCTGTCCAGGCTGGCGGGCTACGGCCCGCGGACTGTCACCCCCACCATGGTCGAAGGCATCTACAAGTACAACTCGGACCGCAAGCGCTTCACCCAGATCCCGGCCAAAACCATGTCCATGAGCGTCGATGCCTTCACCATCCAGGGACACCTCTGGCAGAGCAGGAAGCCCACCACTCCCAAGAAGGGGGGCGGCACCCCCAAATAG

XM_004865345.1 Coding sequence

Xab2 XPA binding protein 2, transcript variant X1

Length: 2844 bp    Location: 712005..704405   Strand: -
>XM_004865345.1
ATGGTGGTGATGGCGCGCGTTTCTCGGCCCGAGCGGCCGGACCTTGTCTTTGAGGAAGAGGACCTTCCTTATGAGGAGGAAATCATGCGGAACCAGTTCTCAGTTAAATGCTGGCTCCGCTACATCGAGTTCAAACAGGGGGCTCCAAAGCCTAGGCTCAATCAGCTGTACGAGCGGGCACTCAAGCTGCTGCCCTGTAGCTACAAACTCTGGTACCGCTACCTAAAGGCACGCCGGGCACAGGTGAAGCATCGCTGCGTGACGGACCCCGCCTACGAAGATGTCAACAACTGCCATGAGAGAGCCTTTGTGTTCATGCACAAGATGCCCCGTCTGTGGCTAGATTATTGCCAGTTCCTGATGGACCAAGGACGGGTCACACATACTCGCCGCACCTTCGACCGGGCACTCCGGGCATTGCCCATCACACAGCACTCTCGCATCTGGCCCCTGTACCTGCGCTTCCTGCGTTCCCACCCACTGCCGGAGACAGCGGTGCGGGGCTACCGGCGCTTCCTCAAGCTGAGTCCCGAGAGTGCCGAGGAGTACATTGAGTACCTCAAGTCCAGCGACCGGCTGGATGAGGCGGCGCAGCGCCTGGCCACTGTGGTAAACGACGAGCGCTTTGTGTCTAAGGCCGGCAAGTCCAACTACCAGCTGTGGCACGAGCTATGCGACCTCATCTCCCAGAACCCGGACAAGGTGCAGTCCCTCAACGTGGATGCCATCATCCGAGGCGGCCTCACTCGCTTCACCGACCAGCTGGGCAAGCTCTGGTGCTCGCTGGCTGACTACTACATCCGCAGCGGCCACTTTGAGAAGGCCCGGGATGTGTACGAGGAGGCTGTCCGCACCGTGATGACAGTCCGCGACTTCACGCAGGTGTTTGACAGCTACGCGCAGTTCGAGGAGAGCATGATCGCGGCCAAGATGGAGACCACCTCGGAGCTGGGGCGCGAGGAGGAGGGTGAGAGGGCTGGGGAGGGCAGGGGCGCCCGAGGCGGGGAGCGAGGTGCAGAGGAAGGTGGGGTTGGCGACCCGAAGGAGCCGGGACTGAAGCCGGGAGCTGGGAGCCGGGAGCCGGGAGCCCGTGCGGGAGGGAGGATGCAGGGGCGGGGCCGGGGCCAGGTCGGGCGTGGTCAGCCCGAGTCTGAGGCCCCAGCACTGGCTGGGAGCCCAGGAGGCGACAGGACAGAGGCGGCCACTCCTGTCTGGCCCTCACAAGCACACCCCTGGCCCCCAGACGACGTGGACCTGGAGCTGCGGCTGGCCCGATTCGAGCACCTCATCAGCCGGCGGCCGCTGCTGCTCAACAGCGTCCTGCTGCGCCAGAACCCGCACCACGTGCACGAGTGGCACAAGCGCGTGGCCCTGCACCAGGGCCGCCCCCGGGAGATCATCAACACGTACACGGAGGCCGTGCAGACCGTGGACCCCTTCAAGGCCACCGGCAAACCCCACACCCTGTGGGTGGCGTTTGCCAAGTTTTACGAGGACAACGGGCAGCTGGACGATGCCCGCGTCATCCTGGAGAAGGCCACCAAGGTGAACTTCAAGCAGGTGGACGACCTGGCCAGCGTGTGGTGCCAGTGTGGGGAGCTGGAGCTGCGGCACGAGAACTACGATGAGGCCTTGCGGCTGCTGCGGAAGGCCACGGCACTGCCCGCCCGCCGGGCCGAGTACTTCGACGGCTCAGAGCCCGTGCAGAACCGCGTGTACAAGTCGCTGAAGGTGTGGTCCATGCTTGCCGACCTGGAGGAGAGCTTGGGCACCTTCCAGTCCACCAAGGCCGTGTACGACCGCATCCTGGACCTGCGCATCGCCACGCCCCAGATCATCATCAACTACGCCATGTTCCTGGAGGAGCACAAGTACTTCGAGGAGAGCTTCAAGGCCTACGAGCGCGGCATCTCGCTGTTCAAATGGCCCAACGTGTCAGACATCTGGAGCACCTACCTGACCAAGTTCATCGCCCGCTATGGAGGCCGGAAGCTGGAGCGAGCGCGGGACCTATTTGAGCAGGCGCTGGACGGCTGCCCTCCCAAATACGCCAAAACCCTGTACCTGCTGTACGCGCAGCTGGAGGAGGAGTGGGGCCTGGCCCGGCACGCCATGGCCGTGTACGACCGGGCCACCAGGGCCGTGGAGCCCGCCCAGCAGTATGACATGTTCAACATCTACATCAAGCGGGCCGCCGAGATCTACGGCGTCACCCACACCCGGGGCATCTACCAGAAGGCCATCGAGGTGCTGTCAGATGAGCACGCGCGTGAGATGTGCCTGCGCTTTGCGGACATGGAGTGCAAGCTCGGAGAGATCGACCGTGCCCGGGCTATCTACAGCTTCTGCTCTCAGATCTGCGACCCTCGGACGACAGGGGCATTCTGGCAGACGTGGAAGGACTTCGAGGTGCGGCATGGCAACGAGGACACCATCCGGGAGATGCTGCGCATCCGCCGAAGCGTGCAGGCTACCTACAACACGCAGGTCAACTTCATGGCCTCCCAGATGCTCAAGGTGTCGGGCAGCGCCACGGGCACCGTGTCCGACCTGGCCCCAGGGCAGAGCGGCATGGATGACATGAAGCTGCTGGAGCAGCGGGCAGAGCAGCTGGCTGCCGAGGCCGAGCGGGACCAGCCCCCTCGGGCCCAGAGCAAGATCCTGTTTGTGAGGAGTGACGCGTCCCGGGAGGAGCTGGCGGAGCTGGCCCAGCAGGCCAACCCCGACGAGATCCAGCTGGGGGAGGACGAGGACGAGGACGAGATGGACCTGGAGCCCAACGAGGTCCGGCTGGAGCAGCAGAGCGTGCCGGCTGCCGTGTTCGGGAGCCTGAAGGAGGACTGA

XM_004865347.1 Coding sequence

Pcp2 Purkinje cell protein 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 363 bp    Location: 715025..713799   Strand: -
>XM_004865347.1
ATGGCAGGCTCGCCAGACCAGGAGGGCTTCTTCAACCTGCTGAGCCACGTGCAGGGTGACCGGATGGAGGAGCAGCGCTGCTCGCTGCAGGCCGGGCCAGGACAGACCCCCGAGAGCCAGGATGGCCCAGCGCCCGAGATGGACAATCTCATGGACATGCTGGCCAGCACCCAGGGCCGCCGCATGGATGACCAGCGTGTGACAGTCAGCACCCTGCCTGGCTTCCAGCCCATTGGCCCCAAGGACGGGGTGCAGAAACGAGCTGGGACCCTCAGCCCTCAGCCCCTGCTCACCCCCCAGGATCCCGCTTCACTCGGCTTCCGCAGGAACAGCAGCCCCCAACCCCAGACACAAGCCCCCTGA

XM_004865348.1 Coding sequence

Pcp2 Purkinje cell protein 2, transcript variant X2

Length: 300 bp    Location: 714991..713799   Strand: -
>XM_004865348.1
ATGGAGGAGCAGCGCTGCTCGCTGCAGGCCGGGCCAGGACAGACCCCCGAGAGCCAGGATGGCCCAGCGCCCGAGATGGACAATCTCATGGACATGCTGGCCAGCACCCAGGGCCGCCGCATGGATGACCAGCGTGTGACAGTCAGCACCCTGCCTGGCTTCCAGCCCATTGGCCCCAAGGACGGGGTGCAGAAACGAGCTGGGACCCTCAGCCCTCAGCCCCTGCTCACCCCCCAGGATCCCGCTTCACTCGGCTTCCGCAGGAACAGCAGCCCCCAACCCCAGACACAAGCCCCCTGA

XM_004865351.1 Coding sequence

Stxbp2 syntaxin binding protein 2, transcript variant X1

Length: 2145 bp    Location: 718756..725063   Strand: +
>XM_004865351.1
ATGACGCGTGGCCACGCCCCCACCTTGGGACAGACCCGGAAGCGTCGGAGGCGCTCCTCGGGGAAGATGGCGCCCTCGGGGCTGAAAGCGGTAGTGGGAGAAAAGATTCTGAGCGGAGTCATCCGAAGCGTCAAGAAGGATGGGGAATGGAAGGTGCTCATTATGGACCACCCAAGCATGCGTATCTTGTCATCCTGCTGCAAAATGTCAGACATCCTGGCCGAGGGCATCACCATTGTCGAAGACATCAACAAACGACGAGAACCTATCCCCAGCCTGGAGGCCATTTATTTGCTGAGTCCCACAGAGAAGTCCATTCAGGCCCTGATCGCAGACTTCCGGGGGACCCCGACCTTTACCTACAAAGCAGCGCACGTCTTCTTCACCGACACCTGCCCTGAGGCTCTGTTCAGTGAGCTGGGCCGATCTCGCCTGGCAAAGGTGGTGAAGACGCTGAAAGAGATCCACCTTGCCTTCCTTCCCTACGAGGCCCAGGTGTTCTCCCTGGATACCCCGCACAGCACCTACAACCTCTACTGCCCCTTCCGGGCAGGGGAGCGGGCACAGCAGCTTGAGGTGCTGGCTCAGCAGATCGCCACACTGTGCGCCACGCTGCAGGAGTACCCGGCCATCCGCTACCGCAAGGGCCCAGAGGACACGGCCCAGCTGGCCCACGCCGTCTTGGCCAAGCTGAACGCCTTCAAGGCAGACAATCCCAGTCTGGGCGAGGGCCCTGAGAAAACCCGCTCACAGCTGCTGATCGTGGACCGGGCGGCAGACCCCGTGTCGCCGCTGCTGCACGAGCTCACTTTCCAGGCCATGGCCTATGACCTCCTGGACATTGAGCAGGACACGTACAGGTACGAGACCACGGGGCTGAGTGAGGCGCGGGAGAAGGCCGTGCTGCTGGACGAGGATGACGAGCTGTGGGTGGAGCTTCGGCACATGCACATCGCCGATGTTTCCAAGAGGGTCACGGAGCTTCTGAAGTCCTTCTGTGAGAGCAAGAGGATGACCACCGACAAGGCCAACATCAAAGACCTGTCCCACATCCTGAAAAAGATGCCGCAGTACCAGAAGGAGCTGAACAAGTATTCCACACACCTGCATTTAGCTGAAGACTGCATGAAGCACTTCAAGGGCTCTGTGGAGAAGCTGTGTAGCGTGGAGCAGGACCTGGCTATGGGCTCGGACGCAGAGGGCGAGAAGATCAAGGACGCCATGAAGCTGATCGTCCCAGTGCTGCTGGACGCCACAGTGCCGCCCTATGACAAGATCCGGGTCCTGCTGCTCTACATCCTTCTGCGGAACGGTGTGAGCGAGGAGAACCTGGCCAAGCTGATCCAGCACGCCAACGTGCAGGCCTACAGCAGCCTCATCCGCAACCTGGAGCAGCTGGGGACCGCCGTGACCAGCCCCGGGGGCTCGGGCGCCGCCAGCCGGCTGGAGCGCAGGGAGCGAACCGAGCCCACCTATCAGCTGTCCCGCTGGACTCCGGTCATCAAGGACATCATGGAGGTACCTGGGGCTGAGCCCCCACCCCAGCGCTCCCTGCAGGGCCTGGCACCCTCTCGGCTTCTCCTCCCACGGACCTTGGATTCCTGGACTCGGTTGCCCCAGGGGGCAGGAGGCCTAGATGCTGACCCTGTCCTGAGGCCCTCTGCTCCCCAGGACGCCGTGCAGGACCGGCTGGACCGCAAGCTGTGGCCCTTCGTGTCCGACCCCGCCCCCACGCCCAGCTCCCAGGCAGCTGTCAGGTGGGGGCCCGGGACGCTCCGACTCCCAGCCAGGCCTGTGTGGGGTCGTGTGTCTCTGCCCGGCCTGACCGTGACCCCCGCTTCACCCCTTTCCTCCCCAAAGCGCCCGTTTTGGCCACTGGCACAAGAACAAGGTGGGCGTGGAGGCTCGGGCGGGGCCCAGGCTCATGGTGTACATGGTGGGCGGCGTGGCCATGTCGGAGATGAGGGCCGCCTACGAGGTGACCAGGGCCACCGAGGGCAAGTGGGAGGTGTTCATCGGCTCCTCACACATCCTTACCCCGACCCGCTTCCTGGACGACCTCAAGACGTTGGACCAGAAGCTGGAAGACATTCCCCTGCCCTGACCTGTCCCTGCCCTCTGCCCCGGGCCCCTGCAGAGAAATAA

XM_004865353.1 Coding sequence

Stxbp2 syntaxin binding protein 2, transcript variant X3

Length: 1992 bp    Location: 718756..725063   Strand: +
>XM_004865353.1
ATGACGCGTGGCCACGCCCCCACCTTGGGACAGACCCGGAAGCGTCGGAGGCGCTCCTCGGGGAAGATGGCGCCCTCGGGGCTGAAAGCGGTAGTGGGAGAAAAGATTCTGAGCGGAGTCATCCGAAGCGTCAAGAAGGATGGGGAATGGAAGGTGCTCATTATGGACCACCCAAGCATGCGTATCTTGTCATCCTGCTGCAAAATGTCAGACATCCTGGCCGAGGGCATCACCATTGTCGAAGACATCAACAAACGACGAGAACCTATCCCCAGCCTGGAGGCCATTTATTTGCTGAGTCCCACAGAGAAGTCCATTCAGGCCCTGATCGCAGACTTCCGGGGGACCCCGACCTTTACCTACAAAGCAGCGCACGTCTTCTTCACCGACACCTGCCCTGAGGCTCTGTTCAGTGAGCTGGGCCGATCTCGCCTGGCAAAGGTGGTGAAGACGCTGAAAGAGATCCACCTTGCCTTCCTTCCCTACGAGGCCCAGGTGTTCTCCCTGGATACCCCGCACAGCACCTACAACCTCTACTGCCCCTTCCGGGCAGGGGAGCGGGCACAGCAGCTTGAGGTGCTGGCTCAGCAGATCGCCACACTGTGCGCCACGCTGCAGGAGTACCCGGCCATCCGCTACCGCAAGGGCCCAGAGGACACGGCCCAGCTGGCCCACGCCGTCTTGGCCAAGCTGAACGCCTTCAAGGCAGACAATCCCAGTCTGGGCGAGGGCCCTGAGAAAACCCGCTCACAGCTGCTGATCGTGGACCGGGCGGCAGACCCCGTGTCGCCGCTGCTGCACGAGCTCACTTTCCAGGCCATGGCCTATGACCTCCTGGACATTGAGCAGGACACGTACAGGTACGAGACCACGGGGCTGAGTGAGGCGCGGGAGAAGGCCGTGCTGCTGGACGAGGATGACGAGCTGTGGGTGGAGCTTCGGCACATGCACATCGCCGATGTTTCCAAGAGGGTCACGGAGCTTCTGAAGTCCTTCTGTGAGAGCAAGAGGATGACCACCGACAAGGCCAACATCAAAGACCTGTCCCACATCCTGAAAAAGATGCCGCAGTACCAGAAGGAGCTGAACAAGTATTCCACACACCTGCATTTAGCTGAAGACTGCATGAAGCACTTCAAGGGCTCTGTGGAGAAGCTGTGTAGCGTGGAGCAGGACCTGGCTATGGGCTCGGACGCAGAGGGCGAGAAGATCAAGGACGCCATGAAGCTGATCGTCCCAGTGCTGCTGGACGCCACAGTGCCGCCCTATGACAAGATCCGGGTCCTGCTGCTCTACATCCTTCTGCGGAACGGTGTGAGCGAGGAGAACCTGGCCAAGCTGATCCAGCACGCCAACGTGCAGGCCTACAGCAGCCTCATCCGCAACCTGGAGCAGCTGGGGACCGCCGTGACCAGCCCCGGGGGCTCGGGCGCCGCCAGCCGGCTGGAGCGCAGGGAGCGAACCGAGCCCACCTATCAGCTGTCCCGCTGGACTCCGGTCATCAAGGACATCATGGAGGACGCCGTGCAGGACCGGCTGGACCGCAAGCTGTGGCCCTTCGTGTCCGACCCCGCCCCCACGCCCAGCTCCCAGGCAGCTGTCAGGTGGGGGCCCGGGACGCTCCGACTCCCAGCCAGGCCTGTGTGGGGTCGTGTGTCTCTGCCCGGCCTGACCGTGACCCCCGCTTCACCCCTTTCCTCCCCAAAGCGCCCGTTTTGGCCACTGGCACAAGAACAAGGTGGGCGTGGAGGCTCGGGCGGGGCCCAGGCTCATGGTGTACATGGTGGGCGGCGTGGCCATGTCGGAGATGAGGGCCGCCTACGAGGTGACCAGGGCCACCGAGGGCAAGTGGGAGGTGTTCATCGGCTCCTCACACATCCTTACCCCGACCCGCTTCCTGGACGACCTCAAGACGTTGGACCAGAAGCTGGAAGACATTCCCCTGCCCTGACCTGTCCCTGCCCTCTGCCCCGGGCCCCTGCAGAGAAATAA

XM_004865355.1 Coding sequence

Stxbp2 syntaxin binding protein 2, transcript variant X5

Length: 1881 bp    Location: 718756..725057   Strand: +
>XM_004865355.1
ATGACGCGTGGCCACGCCCCCACCTTGGGACAGACCCGGAAGCGTCGGAGGCGCTCCTCGGGGAAGATGGCGCCCTCGGGGCTGAAAGCGGTAGTGGGAGAAAAGATTCTGAGCGGAGTCATCCGAAGCGTCAAGAAGGATGGGGAATGGAAGGTGCTCATTATGGACCACCCAAGCATGCGTATCTTGTCATCCTGCTGCAAAATGTCAGACATCCTGGCCGAGGGCATCACCATTGTCGAAGACATCAACAAACGACGAGAACCTATCCCCAGCCTGGAGGCCATTTATTTGCTGAGTCCCACAGAGAAGGGTCAGACGTGGAGCCTGCTCTGCACTCCACAGTCCATTCAGGCCCTGATCGCAGACTTCCGGGGGACCCCGACCTTTACCTACAAAGCAGCGCACGTCTTCTTCACCGACACCTGCCCTGAGGCTCTGTTCAGTGAGCTGGGCCGATCTCGCCTGGCAAAGGTGGTGAAGACGCTGAAAGAGATCCACCTTGCCTTCCTTCCCTACGAGGCCCAGGTGTTCTCCCTGGATACCCCGCACAGCACCTACAACCTCTACTGCCCCTTCCGGGCAGGGGAGCGGGCACAGCAGCTTGAGGTGCTGGCTCAGCAGATCGCCACACTGTGCGCCACGCTGCAGGAGTACCCGGCCATCCGCTACCGCAAGGGCCCAGAGGACACGGCCCAGCTGGCCCACGCCGTCTTGGCCAAGCTGAACGCCTTCAAGGCAGACAATCCCAGTCTGGGCGAGGGCCCTGAGAAAACCCGCTCACAGCTGCTGATCGTGGACCGGGCGGCAGACCCCGTGTCGCCGCTGCTGCACGAGCTCACTTTCCAGGCCATGGCCTATGACCTCCTGGACATTGAGCAGGACACGTACAGGTACGAGACCACGGGGCTGAGTGAGGCGCGGGAGAAGGCCGTGCTGCTGGACGAGGATGACGAGCTGTGGGTGGAGCTTCGGCACATGCACATCGCCGATGTTTCCAAGAGGGTCACGGAGCTTCTGAAGTCCTTCTGTGAGAGCAAGAGGATGACCACCGACAAGGCCAACATCAAAGACCTGTCCCACATCCTGAAAAAGATGCCGCAGTACCAGAAGGAGCTGAACAAGTATTCCACACACCTGCATTTAGCTGAAGACTGCATGAAGCACTTCAAGGGCTCTGTGGAGAAGCTGTGTAGCGTGGAGCAGGACCTGGCTATGGGCTCGGACGCAGAGGGCGAGAAGATCAAGGACGCCATGAAGCTGATCGTCCCAGTGCTGCTGGACGCCACAGTGCCGCCCTATGACAAGATCCGGGTCCTGCTGCTCTACATCCTTCTGCGGAACGGTGTGAGCGAGGAGAACCTGGCCAAGCTGATCCAGCACGCCAACGTGCAGGCCTACAGCAGCCTCATCCGCAACCTGGAGCAGCTGGGGACCGCCGTGACCAGCCCCGGGGGCTCGGGCGCCGCCAGCCGGCTGGAGCGCAGGGAGCGAACCGAGCCCACCTATCAGCTGTCCCGCTGGACTCCGGTCATCAAGGACATCATGGAGGACGCCGTGCAGGACCGGCTGGACCGCAAGCTGTGGCCCTTCGTGTCCGACCCCGCCCCCACGCCCAGCTCCCAGGCAGCTGTCAGCGCCCGTTTTGGCCACTGGCACAAGAACAAGGTGGGCGTGGAGGCTCGGGCGGGGCCCAGGCTCATGGTGTACATGGTGGGCGGCGTGGCCATGTCGGAGATGAGGGCCGCCTACGAGGTGACCAGGGCCACCGAGGGCAAGTGGGAGGTGTTCATCGGCTCCTCACACATCCTTACCCCGACCCGCTTCCTGGACGACCTCAAGACGTTGGACCAGAAGCTGGAAGACATTCCCCTGCCCTGA

XM_004865354.1 Coding sequence

Stxbp2 syntaxin binding protein 2, transcript variant X4

Length: 1977 bp    Location: 718756..725057   Strand: +
>XM_004865354.1
ATGACGCGTGGCCACGCCCCCACCTTGGGACAGACCCGGAAGCGTCGGAGGCGCTCCTCGGGGAAGATGGCGCCCTCGGGGCTGAAAGCGGTAGTGGGAGAAAAGATTCTGAGCGGAGTCATCCGAAGCGTCAAGAAGGATGGGGAATGGAAGGTGCTCATTATGGACCACCCAAGCATGCGTATCTTGTCATCCTGCTGCAAAATGTCAGACATCCTGGCCGAGGGCATCACCATTGTCGAAGACATCAACAAACGACGAGAACCTATCCCCAGCCTGGAGGCCATTTATTTGCTGAGTCCCACAGAGAAGTCCATTCAGGCCCTGATCGCAGACTTCCGGGGGACCCCGACCTTTACCTACAAAGCAGCGCACGTCTTCTTCACCGACACCTGCCCTGAGGCTCTGTTCAGTGAGCTGGGCCGATCTCGCCTGGCAAAGGTGGTGAAGACGCTGAAAGAGATCCACCTTGCCTTCCTTCCCTACGAGGCCCAGGTGTTCTCCCTGGATACCCCGCACAGCACCTACAACCTCTACTGCCCCTTCCGGGCAGGGGAGCGGGCACAGCAGCTTGAGGTGCTGGCTCAGCAGATCGCCACACTGTGCGCCACGCTGCAGGAGTACCCGGCCATCCGCTACCGCAAGGGCCCAGAGGACACGGCCCAGCTGGCCCACGCCGTCTTGGCCAAGCTGAACGCCTTCAAGGCAGACAATCCCAGTCTGGGCGAGGGCCCTGAGAAAACCCGCTCACAGCTGCTGATCGTGGACCGGGCGGCAGACCCCGTGTCGCCGCTGCTGCACGAGCTCACTTTCCAGGCCATGGCCTATGACCTCCTGGACATTGAGCAGGACACGTACAGGTACGAGACCACGGGGCTGAGTGAGGCGCGGGAGAAGGCCGTGCTGCTGGACGAGGATGACGAGCTGTGGGTGGAGCTTCGGCACATGCACATCGCCGATGTTTCCAAGAGGGTCACGGAGCTTCTGAAGTCCTTCTGTGAGAGCAAGAGGATGACCACCGACAAGGCCAACATCAAAGACCTGTCCCACATCCTGAAAAAGATGCCGCAGTACCAGAAGGAGCTGAACAAGTATTCCACACACCTGCATTTAGCTGAAGACTGCATGAAGCACTTCAAGGGCTCTGTGGAGAAGCTGTGTAGCGTGGAGCAGGACCTGGCTATGGGCTCGGACGCAGAGGGCGAGAAGATCAAGGACGCCATGAAGCTGATCGTCCCAGTGCTGCTGGACGCCACAGTGCCGCCCTATGACAAGATCCGGGTCCTGCTGCTCTACATCCTTCTGCGGAACGGTGTGAGCGAGGAGAACCTGGCCAAGCTGATCCAGCACGCCAACGTGCAGGCCTACAGCAGCCTCATCCGCAACCTGGAGCAGCTGGGGACCGCCGTGACCAGCCCCGGGGGCTCGGGCGCCGCCAGCCGGCTGGAGCGCAGGGAGCGAACCGAGCCCACCTATCAGCTGTCCCGCTGGACTCCGGTCATCAAGGACATCATGGAGGTACCTGGGGCTGAGCCCCCACCCCAGCGCTCCCTGCAGGGCCTGGCACCCTCTCGGCTTCTCCTCCCACGGACCTTGGATTCCTGGACTCGGTTGCCCCAGGGGGCAGGAGGCCTAGATGCTGACCCTGTCCTGAGGCCCTCTGCTCCCCAGGACGCCGTGCAGGACCGGCTGGACCGCAAGCTGTGGCCCTTCGTGTCCGACCCCGCCCCCACGCCCAGCTCCCAGGCAGCTGTCAGGTGGGGGCCCGGGACGCTCCGACTCCCAGCCAGGCCTGTGTGGGGTCGTGTGTCTCTGCCCGGCCTGACCGTGACCCCCGCTTCACCCCTTTCCTCCCCAAAGCGCCCGTTTTGGCCACTGGCACAAGAACAAGGCTCCTCACACATCCTTACCCCGACCCGCTTCCTGGACGACCTCAAGACGTTGGACCAGAAGCTGGAAGACATTCCCCTGCCCTGA

XM_004865618.1 Coding sequence

Alkbh7 alkB, alkylation repair homolog 7 (E. coli), transcript variant X2

Length: 483 bp    Location: 3507657..3509314   Strand: +
>XM_004865618.1
ATGGCCGGGAGTGGGCAGCTGGCTTTGCGGACGCTGTCAGGGTCAGGCTGGGTGCGGGGCTCCAGCTCTGCGTTGCTGAACCGCCTGAAGGATGTGGCCGTGGTGCATCCCGGCTTCCTGAGCAAGGACGAGGAGGAGACGCTGAGCCGCGAGCTGGAACCCCAGCTGCGGCGTCGCCGCTACGAATACGATCACTGGGATGCGTTCTGCGGAGCCACCATCGCCGGCCTGTCCCTACTGTCACCAAGTGTCATGCGGTTGGTGCACACCCAGGAGCCAGGGCAGTGGCTGGAACTCTTACTGGAGCCTGGCTCCCTCTATATCCTAAGGGACTCAGCCCGCTATGATTTCTCCCATGAGATCCTCCGAGGCGAAGAATCCTTTTTTGGGGAGCGTCAGGTTCCCCGGGGCCGACGCATCTCTGTGATCTGCCGCTCTGTCCCTGAGGGGATGGGGCCAGGACAGCTGTCCCCAGCCTGCTGA

XM_004865352.1 Coding sequence

Stxbp2 syntaxin binding protein 2, transcript variant X2

Length: 2001 bp    Location: 718756..725057   Strand: +
>XM_004865352.1
ATGACGCGTGGCCACGCCCCCACCTTGGGACAGACCCGGAAGCGTCGGAGGCGCTCCTCGGGGAAGATGGCGCCCTCGGGGCTGAAAGCGGTAGTGGGAGAAAAGATTCTGAGCGGAGTCATCCGAAGCGTCAAGAAGGATGGGGAATGGAAGGTGCTCATTATGGACCACCCAAGCATGCGTATCTTGTCATCCTGCTGCAAAATGTCAGACATCCTGGCCGAGGGCATCACCATTGTCGAAGACATCAACAAACGACGAGAACCTATCCCCAGCCTGGAGGCCATTTATTTGCTGAGTCCCACAGAGAAGTCCATTCAGGCCCTGATCGCAGACTTCCGGGGGACCCCGACCTTTACCTACAAAGCAGCGCACGTCTTCTTCACCGACACCTGCCCTGAGGCTCTGTTCAGTGAGCTGGGCCGATCTCGCCTGGCAAAGGTGGTGAAGACGCTGAAAGAGATCCACCTTGCCTTCCTTCCCTACGAGGCCCAGGTGTTCTCCCTGGATACCCCGCACAGCACCTACAACCTCTACTGCCCCTTCCGGGCAGGGGAGCGGGCACAGCAGCTTGAGGTGCTGGCTCAGCAGATCGCCACACTGTGCGCCACGCTGCAGGAGTACCCGGCCATCCGCTACCGCAAGGGCCCAGAGGACACGGCCCAGCTGGCCCACGCCGTCTTGGCCAAGCTGAACGCCTTCAAGGCAGACAATCCCAGTCTGGGCGAGGGCCCTGAGAAAACCCGCTCACAGCTGCTGATCGTGGACCGGGCGGCAGACCCCGTGTCGCCGCTGCTGCACGAGCTCACTTTCCAGGCCATGGCCTATGACCTCCTGGACATTGAGCAGGACACGTACAGGTACGAGACCACGGGGCTGAGTGAGGCGCGGGAGAAGGCCGTGCTGCTGGACGAGGATGACGAGCTGTGGGTGGAGCTTCGGCACATGCACATCGCCGATGTTTCCAAGAGGGTCACGGAGCTTCTGAAGTCCTTCTGTGAGAGCAAGAGGATGACCACCGACAAGGCCAACATCAAAGACCTGTCCCACATCCTGAAAAAGATGCCGCAGTACCAGAAGGAGCTGAACAAGTATTCCACACACCTGCATTTAGCTGAAGACTGCATGAAGCACTTCAAGGGCTCTGTGGAGAAGCTGTGTAGCGTGGAGCAGGACCTGGCTATGGGCTCGGACGCAGAGGGCGAGAAGATCAAGGACGCCATGAAGCTGATCGTCCCAGTGCTGCTGGACGCCACAGTGCCGCCCTATGACAAGATCCGGGTCCTGCTGCTCTACATCCTTCTGCGGAACGGTGTGAGCGAGGAGAACCTGGCCAAGCTGATCCAGCACGCCAACGTGCAGGCCTACAGCAGCCTCATCCGCAACCTGGAGCAGCTGGGGACCGCCGTGACCAGCCCCGGGGGCTCGGGCGCCGCCAGCCGGCTGGAGCGCAGGGAGCGAACCGAGCCCACCTATCAGCTGTCCCGCTGGACTCCGGTCATCAAGGACATCATGGAGGTACCTGGGGCTGAGCCCCCACCCCAGCGCTCCCTGCAGGGCCTGGCACCCTCTCGGCTTCTCCTCCCACGGACCTTGGATTCCTGGACTCGGTTGCCCCAGGGGGCAGGAGGCCTAGATGCTGACCCTGTCCTGAGGCCCTCTGCTCCCCAGGACGCCGTGCAGGACCGGCTGGACCGCAAGCTGTGGCCCTTCGTGTCCGACCCCGCCCCCACGCCCAGCTCCCAGGCAGCTGTCAGCGCCCGTTTTGGCCACTGGCACAAGAACAAGGTGGGCGTGGAGGCTCGGGCGGGGCCCAGGCTCATGGTGTACATGGTGGGCGGCGTGGCCATGTCGGAGATGAGGGCCGCCTACGAGGTGACCAGGGCCACCGAGGGCAAGTGGGAGGTGTTCATCGGCTCCTCACACATCCTTACCCCGACCCGCTTCCTGGACGACCTCAAGACGTTGGACCAGAAGCTGGAAGACATTCCCCTGCCCTGA

XM_004865357.1 Coding sequence

Stxbp2 syntaxin binding protein 2, transcript variant X7

High confidence: 4 potential gene matches
Length: 1839 bp    Location: 718756..725057   Strand: +
>XM_004865357.1
ATGACGCGTGGCCACGCCCCCACCTTGGGACAGACCCGGAAGCGTCGGAGGCGCTCCTCGGGGAAGATGGCGCCCTCGGGGCTGAAAGCGGTAGTGGGAGAAAAGATTCTGAGCGGAGTCATCCGAAGCGTCAAGAAGGATGGGGAATGGAAGGTGCTCATTATGGACCACCCAAGCATGCGTATCTTGTCATCCTGCTGCAAAATGTCAGACATCCTGGCCGAGGGCATCACCATTGTCGAAGACATCAACAAACGACGAGAACCTATCCCCAGCCTGGAGGCCATTTATTTGCTGAGTCCCACAGAGAAGGCCCTGATCGCAGACTTCCGGGGGACCCCGACCTTTACCTACAAAGCAGCGCACGTCTTCTTCACCGACACCTGCCCTGAGGCTCTGTTCAGTGAGCTGGGCCGATCTCGCCTGGCAAAGGTGGTGAAGACGCTGAAAGAGATCCACCTTGCCTTCCTTCCCTACGAGGCCCAGGTGTTCTCCCTGGATACCCCGCACAGCACCTACAACCTCTACTGCCCCTTCCGGGCAGGGGAGCGGGCACAGCAGCTTGAGGTGCTGGCTCAGCAGATCGCCACACTGTGCGCCACGCTGCAGGAGTACCCGGCCATCCGCTACCGCAAGGGCCCAGAGGACACGGCCCAGCTGGCCCACGCCGTCTTGGCCAAGCTGAACGCCTTCAAGGCAGACAATCCCAGTCTGGGCGAGGGCCCTGAGAAAACCCGCTCACAGCTGCTGATCGTGGACCGGGCGGCAGACCCCGTGTCGCCGCTGCTGCACGAGCTCACTTTCCAGGCCATGGCCTATGACCTCCTGGACATTGAGCAGGACACGTACAGGTACGAGACCACGGGGCTGAGTGAGGCGCGGGAGAAGGCCGTGCTGCTGGACGAGGATGACGAGCTGTGGGTGGAGCTTCGGCACATGCACATCGCCGATGTTTCCAAGAGGGTCACGGAGCTTCTGAAGTCCTTCTGTGAGAGCAAGAGGATGACCACCGACAAGGCCAACATCAAAGACCTGTCCCACATCCTGAAAAAGATGCCGCAGTACCAGAAGGAGCTGAACAAGTATTCCACACACCTGCATTTAGCTGAAGACTGCATGAAGCACTTCAAGGGCTCTGTGGAGAAGCTGTGTAGCGTGGAGCAGGACCTGGCTATGGGCTCGGACGCAGAGGGCGAGAAGATCAAGGACGCCATGAAGCTGATCGTCCCAGTGCTGCTGGACGCCACAGTGCCGCCCTATGACAAGATCCGGGTCCTGCTGCTCTACATCCTTCTGCGGAACGGTGTGAGCGAGGAGAACCTGGCCAAGCTGATCCAGCACGCCAACGTGCAGGCCTACAGCAGCCTCATCCGCAACCTGGAGCAGCTGGGGACCGCCGTGACCAGCCCCGGGGGCTCGGGCGCCGCCAGCCGGCTGGAGCGCAGGGAGCGAACCGAGCCCACCTATCAGCTGTCCCGCTGGACTCCGGTCATCAAGGACATCATGGAGGACGCCGTGCAGGACCGGCTGGACCGCAAGCTGTGGCCCTTCGTGTCCGACCCCGCCCCCACGCCCAGCTCCCAGGCAGCTGTCAGCGCCCGTTTTGGCCACTGGCACAAGAACAAGGTGGGCGTGGAGGCTCGGGCGGGGCCCAGGCTCATGGTGTACATGGTGGGCGGCGTGGCCATGTCGGAGATGAGGGCCGCCTACGAGGTGACCAGGGCCACCGAGGGCAAGTGGGAGGTGTTCATCGGCTCCTCACACATCCTTACCCCGACCCGCTTCCTGGACGACCTCAAGACGTTGGACCAGAAGCTGGAAGACATTCCCCTGCCCTGA

XM_004865358.1 Coding sequence

Retn resistin

High confidence: 4 potential gene matches
Length: 330 bp    Location: 735549..737166   Strand: +
>XM_004865358.1
ATGAAGGCTGTCTCCCTCCTCCTCCTCGCCCTGGGGCTGCTGGTGTCCCGAGGGTCACTGTGTTCCATGGACGAAGCCATCGATCGGAAGATCAAAGAGCAAACCAGCTCCCTAATTTTAGAGGCTCTCGAGAAGGCAGACCTGGACTGCAGAAGCGTCACCTCCACGGGGGACCTGGCCACCTGTCCCGCAGGCTTCGCGGTCACCAGCTGCGCCTGTGGCATGGGCTGTGGCTCCTGGGACGTGCGCGCCCAGACCACGTGTCACTGCCAGTGCGCCCGCATGGACTGGACCGCAGTGCGCTGCTGCCGCCTGCAGATGGCCTCCTGA

XM_004866041.1 Coding sequence

LOC101699916 chromosome unknown open reading frame, human C19orf59

Length: 705 bp    Location: 739897..742752   Strand: +
>XM_004866041.1
ATGGGGGCCAGACTTCTGTCCCACATGTGGCCCCAGGTTTCCCCATCTGCCCAACACTTCCGGTGGGTGGGGTGGGTGGACACAGGCCCGCCCCACAGCAACTTCAAGATCGACAGGACACAAGCAGAGGTCAGGATGCAGGGAGCGGCGGCAGCCTTCAAAGAGAAGCGACAGGGCAACACAGGTGACAGCAGAGGTGCCTGTGACCCCGACTACGAGAACATCAGCCTGACCTTCAGAGAACGGGCCCAGCCTAAGGGCGGTCACCCAGGACCCCTGACACCAGCTCCCGCCCAGCCCAGGCCACCCTTGTACAGCGCCCAGGTCCCCACCTGGCTGCAGAGGTCCATCATGAGCCTGTTTGTGCTCCTCGGGTTGATGTTCCTGTTCTGCATCATCCTCTCCGCCCTGGTCTTGGTGAAGAACTTCGAGATGTCCAGGGAGATGCAGGGTTTGAAAAGGGAGCTTTCCAACATCTCAAGCTCGGTGTTGGAGTGCCAGGAAGAGCAAAGGAAGGGCTGGAGCAAGGTCTGGGAGGACATCGAGGAGGTCACCAAGCATATCGGCAAAGTCAGGAACCAGGTTGAAGCCGGGAACCAGAACCTGAAGACGGTGCCAGCAGAAGTAACACAAATCAGGACAAACATACAGAAAATCCTTGAGGCGCTGGAGAGGAAGACAAATATACCGCCACCGTCCAAATAG

XM_004865362.1 Coding sequence

Fcer2 Fc fragment of IgE, low affinity II, receptor for (CD23), transcript variant X4

Length: 873 bp    Location: 754268..745089   Strand: -
>XM_004865362.1
ATGGCCGAAAATCAGTACTCGGACTGGGACACCTTGAGGAATTTTAAACAGCTGGAAGTCACTGCCGCCCAGAACGTCTCTCGATTCTCCAAAGAACTGCAGAGGCACCAGAGTGAGCAGATGGCCCAGAGGTCCCAGGCGGCACTGATGTCACAGACCGTCCAAGAGCTCCGAGCCCAGCAGCAGCAGATGAAATCCCAGGGTGAGCGCCTGGTGGGAGACAGTGGCCCGCGGCCACAGGCCCGCTTCTCACACCCGTCAGACTCCGAGCTCTCCTGGAACCTGGACAGACTTCAGGAGGACATGAGCAGCATCAAGTCGCAAAACTTGAACGAGAGGCGCTCGGCCTTGGATTCGATGGGAAGACTGAAGGAGGAGGTGGCGAAGCTGTGGATGGAGATACAGGTGTCCAAGGGCTCTGAGTGCAGCACATGCCCCAAGCAGTGGGTCAACTTCCAGCAGAAGTGCTACTACTTCGGTGAGGGCCCCAAGCAGTGGGTCCAGGCCCGGTTCACCTGCAATGACCTGGAAGGCCGGCTGGTCAGCATCCACAGCCAGGAGGAGCAGGACTTCCTCACCAAACACGCCAACAAGGAGGGCTCCTGGATTGGCCTTCGTGACCTGGACATAGAGGGGGAGTTTACCTGGATGGATGGGAGCCCCCTGGACTACAGCAACTGGCAGTCAGGGGAGCCCAACAACGCCCAGGGTGAGGACTGCGTGGTGATGCAGGGCTCGGGGCAGTGGAATGACGCTTTCTGCCGCACCTGGTTGGACGCCTGGGTGTGCGAGCAGCTGGCCACATGCGGGCCACCCACCCCCTCGGACTCCACAGATGACTCACCGGGCTCTGGCTCCACACACAGCCCCTGA

XM_004865363.1 Coding sequence

Trappc5 trafficking protein particle complex 5

High confidence: 4 potential gene matches
Length: 567 bp    Location: 743350..744986   Strand: +
>XM_004865363.1
ATGGAGGCGCGCTTCACGCGCGGGAAGTCGGCCCTGCTGGAGCGCGCGCTGGCACGGCCGCGCACCGAGGTGAGCCTGAGCGCCTTCGCGCTGCTCTTCTCCGAGCTGGTGCAGCACTGTCAGAGCCGCGTCTTCTCGGTGGCCGAGCTGCAGGCTCGCCTGGCCGCGCTGGGCCGCCAGGTGGGCGCTCGCGTGCTGGATGCGCTGGTCGCGCGCGAGAAGGGTGCTCGGCGCGAGACCAAGGTTCTGGGCGCGCTGCTGTTCGTCAAGGGCGCAGTGTGGAAGGCGCTTTTCGGCAAGGAGGCCGACAAGCTGGAGCAGGCCAACGACGACGCCCGCACTTTCTACATTATCGAGCGGGAGCCGCTTATTAACACCTACATCTCCGTGCCGAAGGAGAACAGCACGCTCAACTGCGCCAGCTTCACAGCGGGCATCGTGGAGGCCGTGCTCACGCACAGCGGCTTTCCCGCCAAGGTCACGGCACACTGGCACAAGGGCACCACCCTCATGATCAAGTTCGAGGAGGCTGTCATCGCCAGAGACCGGGCCCTGGAGGGCCGCTGA

XM_004865361.1 Coding sequence

Fcer2 Fc fragment of IgE, low affinity II, receptor for (CD23), transcript variant X3

Length: 912 bp    Location: 754268..745089   Strand: -
>XM_004865361.1
ATGGCCGAAAATCAGTACTCGGCGCTCTGGGCCGGGCTGCTGACCCTGCTTCTCCTGTGGCACTGGGACACCTTGAGGAATTTTAAACAGCTGGAAGTCACTGCCGCCCAGAACGTCTCTCGATTCTCCAAAGAACTGCAGAGGCACCAGAGTGAGCAGATGGCCCAGAGGTCCCAGGCGGCACTGATGTCACAGACCGTCCAAGAGCTCCGAGCCCAGCAGCAGCAGATGAAATCCCAGGGTGAGCGCCTGGTGGGAGACAGTGGCCCGCGGCCACAGGCCCGCTTCTCACACCCGTCAGACTCCGAGCTCTCCTGGAACCTGGACAGACTTCAGGAGGACATGAGCAGCATCAAGTCGCAAAACTTGAACGAGAGGCGCTCGGCCTTGGATTCGATGGGAAGACTGAAGGAGGAGGTGGCGAAGCTGTGGATGGAGATACAGGTGTCCAAGGGCTCTGAGTGCAGCACATGCCCCAAGCAGTGGGTCAACTTCCAGCAGAAGTGCTACTACTTCGGTGAGGGCCCCAAGCAGTGGGTCCAGGCCCGGTTCACCTGCAATGACCTGGAAGGCCGGCTGGTCAGCATCCACAGCCAGGAGGAGCAGGACTTCCTCACCAAACACGCCAACAAGGAGGGCTCCTGGATTGGCCTTCGTGACCTGGACATAGAGGGGGAGTTTACCTGGATGGATGGGAGCCCCCTGGACTACAGCAACTGGCAGTCAGGGGAGCCCAACAACGCCCAGGGTGAGGACTGCGTGGTGATGCAGGGCTCGGGGCAGTGGAATGACGCTTTCTGCCGCACCTGGTTGGACGCCTGGGTGTGCGAGCAGCTGGCCACATGCGGGCCACCCACCCCCTCGGACTCCACAGATGACTCACCGGGCTCTGGCTCCACACACAGCCCCTGA

XM_004865359.1 Coding sequence

Fcer2 Fc fragment of IgE, low affinity II, receptor for (CD23), transcript variant X1

Length: 987 bp    Location: 754268..745089   Strand: -
>XM_004865359.1
ATGGCCGAAAATCAGTACTCGGAGTTCTTCGAGTTTCCCAGGAAGAGGCGCTGCCGGCGGGGGCTGCAGCTGGCGCTGCTGGGGCTGCTGACCGCGGCGCTCTGGGCCGGGCTGCTGACCCTGCTTCTCCTGTGGCACTGGGACACCTTGAGGAATTTTAAACAGCTGGAAGTCACTGCCGCCCAGAACGTCTCTCGATTCTCCAAAGAACTGCAGAGGCACCAGAGTGAGCAGATGGCCCAGAGGTCCCAGGCGGCACTGATGTCACAGACCGTCCAAGAGCTCCGAGCCCAGCAGCAGCAGATGAAATCCCAGGGTGAGCGCCTGGTGGGAGACAGTGGCCCGCGGCCACAGGCCCGCTTCTCACACCCGTCAGACTCCGAGCTCTCCTGGAACCTGGACAGACTTCAGGAGGACATGAGCAGCATCAAGTCGCAAAACTTGAACGAGAGGCGCTCGGCCTTGGATTCGATGGGAAGACTGAAGGAGGAGGTGGCGAAGCTGTGGATGGAGATACAGGTGTCCAAGGGCTCTGAGTGCAGCACATGCCCCAAGCAGTGGGTCAACTTCCAGCAGAAGTGCTACTACTTCGGTGAGGGCCCCAAGCAGTGGGTCCAGGCCCGGTTCACCTGCAATGACCTGGAAGGCCGGCTGGTCAGCATCCACAGCCAGGAGGAGCAGGACTTCCTCACCAAACACGCCAACAAGGAGGGCTCCTGGATTGGCCTTCGTGACCTGGACATAGAGGGGGAGTTTACCTGGATGGATGGGAGCCCCCTGGACTACAGCAACTGGCAGTCAGGGGAGCCCAACAACGCCCAGGGTGAGGACTGCGTGGTGATGCAGGGCTCGGGGCAGTGGAATGACGCTTTCTGCCGCACCTGGTTGGACGCCTGGGTGTGCGAGCAGCTGGCCACATGCGGGCCACCCACCCCCTCGGACTCCACAGATGACTCACCGGGCTCTGGCTCCACACACAGCCCCTGA

XM_004865360.1 Coding sequence

Fcer2 Fc fragment of IgE, low affinity II, receptor for (CD23), transcript variant X2

Length: 924 bp    Location: 753898..745089   Strand: -
>XM_004865360.1
ATGAGCCCCCCGAGCCAGGAGTTCTTCGAGTTTCCCAGGAAGAGGCGCTGCCGGCGGGGGCTGCAGCTGGCGCTGCTGGGGCTGCTGACCGCGGCGCTCTGGGCCGGGCTGCTGACCCTGCTTCTCCTGTGGCACTGGGACACCTTGAGGAATTTTAAACAGCTGGAAGTCACTGCCGCCCAGAACGTCTCTCGATTCTCCAAAGAACTGCAGAGGCACCAGAGTGAGCAGATGGCCCAGAGGTCCCAGGCGGCACTGATGTCACAGACCGTCCAAGAGCTCCGAGCCCAGCAGCAGCAGATGAAATCCCAGGACTCCGAGCTCTCCTGGAACCTGGACAGACTTCAGGAGGACATGAGCAGCATCAAGTCGCAAAACTTGAACGAGAGGCGCTCGGCCTTGGATTCGATGGGAAGACTGAAGGAGGAGGTGGCGAAGCTGTGGATGGAGATACAGGTGTCCAAGGGCTCTGAGTGCAGCACATGCCCCAAGCAGTGGGTCAACTTCCAGCAGAAGTGCTACTACTTCGGTGAGGGCCCCAAGCAGTGGGTCCAGGCCCGGTTCACCTGCAATGACCTGGAAGGCCGGCTGGTCAGCATCCACAGCCAGGAGGAGCAGGACTTCCTCACCAAACACGCCAACAAGGAGGGCTCCTGGATTGGCCTTCGTGACCTGGACATAGAGGGGGAGTTTACCTGGATGGATGGGAGCCCCCTGGACTACAGCAACTGGCAGTCAGGGGAGCCCAACAACGCCCAGGGTGAGGACTGCGTGGTGATGCAGGGCTCGGGGCAGTGGAATGACGCTTTCTGCCGCACCTGGTTGGACGCCTGGGTGTGCGAGCAGCTGGCCACATGCGGGCCACCCACCCCCTCGGACTCCACAGATGACTCACCGGGCTCTGGCTCCACACACAGCCCCTGA

XM_004865365.1 Coding sequence

Clec4g C-type lectin domain family 4, member G, transcript variant X2

Length: 885 bp    Location: 778489..775122   Strand: -
>XM_004865365.1
ATGGACACTGTCAGATACAGCCAGTGGGAGAGCAGCCCTGAGGAAGTCCCCGGAGGAGGGCCCTGGGGACGCTGGGAGTACTTCCGGCCAAGAGTTTGCCTCCTAGCTCTGGCTGTCCTGGCGGTCACAGTGCTGTGGGCTCTCATTCTGAGCATCCTCTTGTCCAAAGCCTCCACCGACCGCGGAGCGCTGCTTGACCGCCAGGACCTGCTGAGGACAAACGCTTCGGAGCAGACGGTGGTGCTGGGTGCCTTGAAGCGGGAGGTCGGAGCCTGCAGGAGCTGCTGCAACGCCACGAAGGCGACGCTGCTGGAGGCTGTGGCGGACCTGCGGAAGGCAGAGGCGACGCTGCTGGAGCAGAAAAGCGCCCTGGAACAACTGCGCCAGCGCGTGACCCAGGACTTGGCCACAGCGGGCCGGGACCGCGAGAACATCCGTAACGAGCTGTTCCGGGAGCTGGAGAACGCCAGGCTCCAGAACAGCTCCTGCGAGCAGTGTCCCACCTCGTGGCTGCCCTTCCGGGGCTCCTGCTACTATTTCTCGGAGCCACAAGCTACTTGGCCGGAGGCGGAGCGCAACTGCTTGGGCAACGACGCGCACCTGGTGATCATCGGCGACCTGGACGAGCAGGGCTTCGTGACTCGGCACACGCGAGACCGCGGCTACTGGCTGGGCCTGAGGGGTGTGCGCAGCGCGGGCCGGATCCAGAGCTACCAGTGGGTGGACGGAGTCTCGCTGGGCTTCAGCCACTGGAATTTGGGGGAGCCCAATGACTCTCGGGGGCAAGAGGACTGCGTCATGCTGCTTCACACGGGGCTGTGGAACGACGCGCCTTGCAGCAGCGAGCTGGACGGCTGGATCTGCGAGAAGCGGCGCCGCTGCTGA

XM_004865364.1 Coding sequence

Clec4g C-type lectin domain family 4, member G, transcript variant X1

High confidence: 4 potential gene matches
Length: 918 bp    Location: 778489..775122   Strand: -
>XM_004865364.1
ATGGACACTGTCAGATACAGCCAGTGGGAGAGCAGCCCTGAGGAAGTCCCCGGAGGAGGGCTCGGGCCACCGGTCACCTGTGTTCTCCTAGGGCCCTGGGGACGCTGGGAGTACTTCCGGCCAAGAGTTTGCCTCCTAGCTCTGGCTGTCCTGGCGGTCACAGTGCTGTGGGCTCTCATTCTGAGCATCCTCTTGTCCAAAGCCTCCACCGACCGCGGAGCGCTGCTTGACCGCCAGGACCTGCTGAGGACAAACGCTTCGGAGCAGACGGTGGTGCTGGGTGCCTTGAAGCGGGAGGTCGGAGCCTGCAGGAGCTGCTGCAACGCCACGAAGGCGACGCTGCTGGAGGCTGTGGCGGACCTGCGGAAGGCAGAGGCGACGCTGCTGGAGCAGAAAAGCGCCCTGGAACAACTGCGCCAGCGCGTGACCCAGGACTTGGCCACAGCGGGCCGGGACCGCGAGAACATCCGTAACGAGCTGTTCCGGGAGCTGGAGAACGCCAGGCTCCAGAACAGCTCCTGCGAGCAGTGTCCCACCTCGTGGCTGCCCTTCCGGGGCTCCTGCTACTATTTCTCGGAGCCACAAGCTACTTGGCCGGAGGCGGAGCGCAACTGCTTGGGCAACGACGCGCACCTGGTGATCATCGGCGACCTGGACGAGCAGGGCTTCGTGACTCGGCACACGCGAGACCGCGGCTACTGGCTGGGCCTGAGGGGTGTGCGCAGCGCGGGCCGGATCCAGAGCTACCAGTGGGTGGACGGAGTCTCGCTGGGCTTCAGCCACTGGAATTTGGGGGAGCCCAATGACTCTCGGGGGCAAGAGGACTGCGTCATGCTGCTTCACACGGGGCTGTGGAACGACGCGCCTTGCAGCAGCGAGCTGGACGGCTGGATCTGCGAGAAGCGGCGCCGCTGCTGA

XM_004865369.1 Coding sequence

Clec4g C-type lectin domain family 4, member G, transcript variant X6

Length: 783 bp    Location: 778489..775528   Strand: -
>XM_004865369.1
ATGGACACTGTCAGATACAGCCAGTGGGAGAGCAGCCCTGAGGAAGTCCCCGGAGGAGGGCTCGGGCCACCGGTCACCTGTGTTCTCCTAGGGCCCTGGGGACGCTGGGAGTACTTCCGGCCAAGAGTTTGCCTCCTAGCTCTGGCTGTCCTGGCGGTCACAGTGCTGTGGGCTCTCATTCTGAGCATCCTCTTGTCCAAAGCCTCCACCGACCGCGGAGCGCTGCTTGACCGCCAGGACCTGCTGAGGACAAACGCTTCGGAGCAGACGGTGGTGCTGGGTGCCTTGAAGCGGGAGGTCGGAGCCTGCAGGAGCTGCTGCAACGCCACGAAGGCGACGCTGCTGGAGGCTGTGGCGGACCTGCGGAAGGCAGAGGCGACGCTGCTGGAGCAGAAAAGCGCCCTGGAACAACTGCGCCAGCGCGTGACCCAGGACTTGGCCACAGCGGGCCGGGACCGCGAGAACATCCGTAACGAGCTGTTCCGGGAGCTGGAGAACGCCAGGCTCCAGAACAGCTCCTGCGAGCAGTGTCCCACCTCGTGGCTGCCCTTCCGGGGCTCCTGCTACTATTTCTCGGAGCCACAAGCTACTTGGCCGGAGGCGGAGCGCAACTGCTTGGGCAACGACGCGCACCTGGTGATCATCGGCGACCTGGACGAGCAGGGCTTCGTGACTCGGCACACGCGAGACCGCGGCTACTGGCTGGGCCTGAGGGGTGTGCGCAGCGCGGGCCGGATCCAGAGCTACCAGTGGGTGGACGGAGTCTCGCTGGGCTTCAGATGA

XM_004865368.1 Coding sequence

Clec4g C-type lectin domain family 4, member G, transcript variant X5

Length: 819 bp    Location: 778489..775528   Strand: -
>XM_004865368.1
ATGGACACTGTCAGATACAGCCAGTGGGAGAGCAGCCCTGAGGAAGTCCCCGGAGGAGGGCTCGGGCCACCGGTCACCTGTGTTCTCCTAGGGCCCTGGGGACGCTGGGAGTACTTCCGGCCAAGAGTTTGCCTCCTAGCTCTGGCTGTCCTGGCGGTCACAGTGCTGTGGGCTCTCATTCTGAGCATCCTCTTGTCCAAAGCCTCCACCGACCGCGGAGCGCTGCTTGACCGCCAGGACCTGCTGAGGACAAACGCTTCGGAGCAGACGGTGGTGCTGGGTGCCTTGAAGCGGGAGGTCGGAGCCTGCAGGAGCTGCTGCAACGCCACGAAGGCGACGCTGCTGGAGGCTGTGGCGGACCTGCGGAAGGCAGAGGCGACGCTGCTGGAGCAGAAAAGCGCCCTGGAACAACTGCGCCAGCGCGTGACCCAGGACTTGGCCACAGCGGGCCGGGACCGCGAGAACATCCGTAACGAGCTGTTCCGGGAGCTGGAGAACGCCAGGCTCCAGAACAGCTCCTGCGAGCAGTGTCCCACCTCGTGGCTGCCCTTCCGGGGCTCCTGCTACTATTTCTCGGAGCCACAAGCTACTTGGCCGGAGGCGGAGCGCAACTGCTTGGGCAACGACGCGCACCTGGTGATCATCGGCGACCTGGACGAGCAGGGCTTCGTGACTCGGCACACGCGAGACCGCGGCTACTGGCTGGGCCTGAGGGGTGTGCGCAGCGCGGGCCGGATCCAGAGCTACCAGTGGGTGGACGGAGTCTCGCTGGGCTTCAGCTCAGTCTTGGAAGCAGCCTGTGTGTCCATCAACAGATGA

XM_004865367.1 Coding sequence

Clec4g C-type lectin domain family 4, member G, transcript variant X4

Length: 822 bp    Location: 778489..775528   Strand: -
>XM_004865367.1
ATGGACACTGTCAGATACAGCCAGTGGGAGAGCAGCCCTGAGGAAGTCCCCGGAGGAGGGCTCGGGCCACCGGTCACCTGTGTTCTCCTAGGGCCCTGGGGACGCTGGGAGTACTTCCGGCCAAGAGTTTGCCTCCTAGCTCTGGCTGTCCTGGCGGTCACAGTGCTGTGGGCTCTCATTCTGAGCATCCTCTTGTCCAAAGCCTCCACCGACCGCGGAGCGCTGCTTGACCGCCAGGACCTGCTGAGGACAAACGCTTCGGAGCAGACGGTGGTGCTGGGTGCCTTGAAGCGGGAGGTCGGAGCCTGCAGGAGCTGCTGCAACGCCACGAAGGCGACGCTGCTGGAGGCTGTGGCGGACCTGCGGAAGGCAGAGGCGACGCTGCTGGAGCAGAAAAGCGCCCTGGAACAACTGCGCCAGCGCGTGACCCAGGACTTGGCCACAGCGGGCCGGGACCGCGAGAACATCCGTAACGAGCTGTTCCGGGAGCTGGAGAACGCCAGGCTCCAGAACAGCTCCTGCGAGCAGTGTCCCACCTCGTGGCTGCCCTTCCGGGGCTCCTGCTACTATTTCTCGGAGCCACAAGCTACTTGGCCGGAGGCGGAGCGCAACTGCTTGGGCAACGACGCGCACCTGGTGATCATCGGCGACCTGGACGAGCAGGGCTTCGTGACTCGGCACACGCGAGACCGCGGCTACTGGCTGGGCCTGAGGGGTGTGCGCAGCGCGGGCCGGATCCAGAGCTACCAGTGGGTGGACGGAGTCTCGCTGGGCTTCAGTAGCTCAGTCTTGGAAGCAGCCTGTGTGTCCATCAACAGATGA

XM_004866043.1 Coding sequence

LOC101700988 translation initiation factor IF-2-like

Length: 660 bp    Location: 821347..822196   Strand: +
>XM_004866043.1
ATGGACATCTCAGGCTGTCTCGTTATTGGAGAGAAAGCCCGGCCCTGGGCGGGGCTTAGTGCCAAACGCTTGGCCGCCTGTGCCTACGGTTCCTCAGGGCCGCAGCCTTCCCTCAGAAACACACCCTCGGGGTGGGCGGAGCCAGAGTGTCCGGGGGCGGTGAATTGGCTGACGGGACTTCGGGGGCGGGGCAGCGGCTCCTGTCAGCGGGTGAAATGGCAGCGGTGGACCCGGCGGCGGCCGCGGTCCCGGGGGGCGGCTGAGGGGGCCGGGCCGGGGCTGCTGGGCGAGCGGCGCGGCAGGGATCTGGCGACGCGACCTGGGACGGCGAGGCTCTGCACGGCGATGGCGGCACGCTTGGCTCAGGTAAGGCGGCACGGCCCGGGCCTCCAGGATGGACGCCTGTTGAGGCCGGCGGCTCCGCGCTGCGGCCCGCGGGGATCGGCCAGACCGCGACTCGGGCCGCCTCGCCCCGGAGCCCGCCCTGGAGCCTCGGCACCCTCAGCCCCGGCCCGGGCTCCTCGGGCCCGGGCCCCCGCCCACCCTCCTCCCAGATCCCTCCGGGCTCTCCCGGGGCGCCCCGCAGTGCCCCCTCCCCCACGCTACCCTCTCCCTGGAAGGCCCCGCACCCCCGGGACCCCCGCTCATTCCTCACACTGA

XM_004865373.1 Coding sequence

Evi5l ecotropic viral integration site 5-like, transcript variant X4

Length: 2433 bp    Location: 821833..847975   Strand: +
>XM_004865373.1
ATGAGCCTGCCCGCCATGGCGAGCCCCACTCTGAGCCCTGACTCCTCGTCCCAGGAGGCCCTGTCGGCCCCCACCTGCTCCCCGACCTCCGACTCCGAGAACCTCAGCCCCGATGAGCTGGAGCTATTGGCCAAGCTGGAGGAACAGAACCGGCTGCTGGAAGCCGACTCCAAGTCCATGCGCTCCATGAATGGCTCACGGCGGAACAGCGGCTCCTCGCTGGTGTCCAGCTCCTCCGCCTCGTCCAACCTGAGCCACCTGGAGGAGGACACGTGGATCCTGTGGGGCCGCATCGCTAACGAGTGGGAGGAGTGGCGGCGGCGGAAGGAGAAGCTGCTCAAGGAGCTGATCCGCAAGGGCATCCCGCACCACTTCCGGGCCATCGTGTGGCAGCTCCTATGCAGCGCCACGGATATGCCAGTCAAGAACCAGTACTCGGAGCTGCTCAAGATGTCCTCGCCGTGTGAGAAGCTGATCCGCAGGGACATCGCCCGCACTTACCCGGAGCACGAGTTCTTCAAGGGCCAGGACAGCCTGGGCCAGGAGGTCCTCTTCAACGTCATGAAGGCCTACTCCCTGGTGGACCGGGAGGTGGGCTACTGCCAGGGCAGCGCCTTCATCGTGGGCCTGCTCCTCATGCAGATGCCCGAGGAGGAGGCCTTCTGCGTGTTCGTGCGGCTGATGCAGGAGTACCGGCTGCGGGAGCTCTTCAAGCCCAGCATGGCCGAGCTGGGGCTCTGCATCTACCAGTTTGAGTACATGCTACAGGAGCAGCTTCCAGAGCTGAACACCCACTTCCGCTCGCAGAGCTTCCACACGTCCATGTACGCCTCGTCCTGGTTCCTCACTCTCTTCCTCACTACCTTCCCCCTGCCCGTGGCCACCCGAGTCTTCGACATCTTCATGTACGAGGGGCTGGAGATCGTGTTCCGGGTGGGCCTGGCCCTGCTGCAGGTGAACCAGGCGGAGCTCATGCAGCTGGACATGGAGGGCATGTCGCAGTACTTCCAGAGGGTGATCCCCCACCAGTTCGACAGCTGCCCGGACAAGCTGGTGCTCAAGGCCTACCAGGTCAAGTACAACCCCAAGAAGATGAAGAGGCTGGAGAAGGAGTACGCGGCCATGAAGAGCAAGGAGATGGAGGAGCAGATCGAGATCAAAAGGCTTCGGACTGAGAACCGGCTCCTGAAACAGCGGATTGAGACCCTGGAGAAGGAGAGCGCTGCTCTGGCTGATAGGTTAATCCAGGGCCAGGTGACACGGGCGCAGGAGGCAGAGGAGAACTACGTCATCAAGCGGGAGCTGGCTGTGGTGCGGCAGCAGTGCAGCTCGGCTGCCGAGGACCTGCAGAGGGCACAGAGCACTATCCGCCAGCTGCAGGAGCAGCAGGAGAATCCACGCCTCACTGAGGACTTCGTGGCCCACCTGGAGACAGAGCTGGAGCAGTCAAGGCTTCGGGAGACAGAGACGCTGGGGGCCCTGCGGGAGATGCAGGACAAGGTTCTGGACATGGAAAAGAGGAACAGCTCGCTCCCGGACGAGAACAACGTGGCGCGGCTGCAGGAGGAGCTGAAGGCGCTCAAGGTGCGGGAGGGCGAGGCTGTGGCCTCTGCCCGGGAGCAGAAACTCCAGCTGCAGGAGCTGTCGGACGCCTGGCAGGCCCACCTGTCCCGCGGCGGCCGCTGGAAGGAGTCTCCGCGGAAGCTGGTGCTGGGCGAGCTGCAGGACGAGCTCATGAGCGTGCGTCTGCGCGAGGCCCAGGCGCTGGCCGAGGGCCGCGAGCTGCGGCAGCGCGTGGTGGAGCTCGAGACGCAGGACCACATCCACCGCAACCTGCTGAACCGCGTGGAGGCGGAGCGCGCGGCGCTGCAGGAGAAGCTACAGTACCTGGCGGCGCAGAACAAGGGGCTGCAGACGCAACTCAGCGAGAGCCGCCGCAAGCAGGCGGAGGCCGAGTGCAAGAGCAAGGAGGAGGTGATGGCCGTGCGCCTGCGGGAGGCGGACAGCATGGCCGCGGTGGCCGAGATGCGGCAGCGCATCGCGGAGCTGGAGATCCAGAGGGAGGAGGGCCGCATCCAGGGCCAGCTGAACCACTCCGACTCCTCGCAGTACATCCGAGAGCTCAAGGACCAGATCGAGGAGCTGAAGGCAGAGGTGCGGCTGCTGAAGGGCCCGCCGCCCTTCGAGGACCCGCTGGCTTTCGATGGGCTGAGCCTGACGGGGCACCTGGATGAGGACTCGCTGCCGTCGTCCGACGAGGAGCTGCTGGGAGTGGGCGTGGGCGCGGCCCTGCAGGATGCGCTGTACCCCCTGTCCCCGCGCGACGCGCGCTTCTTCCGCCGCCTAGAGAGGCCGGCCAAGGACAGCGAGGGCAGCTCGGACAGTGATGCCGAGGAGCTGGCGGCGCCCTACAGCCAGGGCCTGGACAACTGA

XM_004865375.1 Coding sequence

Evi5l ecotropic viral integration site 5-like, transcript variant X6

High confidence: 3 potential gene matches
Length: 2433 bp    Location: 821888..847975   Strand: +
>XM_004865375.1
ATGAGCCTGCCCGCCATGGCGAGCCCCACTCTGAGCCCTGACTCCTCGTCCCAGGAGGCCCTGTCGGCCCCCACCTGCTCCCCGACCTCCGACTCCGAGAACCTCAGCCCCGATGAGCTGGAGCTATTGGCCAAGCTGGAGGAACAGAACCGGCTGCTGGAAGCCGACTCCAAGTCCATGCGCTCCATGAATGGCTCACGGCGGAACAGCGGCTCCTCGCTGGTGTCCAGCTCCTCCGCCTCGTCCAACCTGAGCCACCTGGAGGAGGACACGTGGATCCTGTGGGGCCGCATCGCTAACGAGTGGGAGGAGTGGCGGCGGCGGAAGGAGAAGCTGCTCAAGGAGCTGATCCGCAAGGGCATCCCGCACCACTTCCGGGCCATCGTGTGGCAGCTCCTATGCAGCGCCACGGATATGCCAGTCAAGAACCAGTACTCGGAGCTGCTCAAGATGTCCTCGCCGTGTGAGAAGCTGATCCGCAGGGACATCGCCCGCACTTACCCGGAGCACGAGTTCTTCAAGGGCCAGGACAGCCTGGGCCAGGAGGTCCTCTTCAACGTCATGAAGGCCTACTCCCTGGTGGACCGGGAGGTGGGCTACTGCCAGGGCAGCGCCTTCATCGTGGGCCTGCTCCTCATGCAGATGCCCGAGGAGGAGGCCTTCTGCGTGTTCGTGCGGCTGATGCAGGAGTACCGGCTGCGGGAGCTCTTCAAGCCCAGCATGGCCGAGCTGGGGCTCTGCATCTACCAGTTTGAGTACATGCTACAGGAGCAGCTTCCAGAGCTGAACACCCACTTCCGCTCGCAGAGCTTCCACACGTCCATGTACGCCTCGTCCTGGTTCCTCACTCTCTTCCTCACTACCTTCCCCCTGCCCGTGGCCACCCGAGTCTTCGACATCTTCATGTACGAGGGGCTGGAGATCGTGTTCCGGGTGGGCCTGGCCCTGCTGCAGGTGAACCAGGCGGAGCTCATGCAGCTGGACATGGAGGGCATGTCGCAGTACTTCCAGAGGGTGATCCCCCACCAGTTCGACAGCTGCCCGGACAAGCTGGTGCTCAAGGCCTACCAGGTCAAGTACAACCCCAAGAAGATGAAGAGGCTGGAGAAGGAGTACGCGGCCATGAAGAGCAAGGAGATGGAGGAGCAGATCGAGATCAAAAGGCTTCGGACTGAGAACCGGCTCCTGAAACAGCGGATTGAGACCCTGGAGAAGGAGAGCGCTGCTCTGGCTGATAGGTTAATCCAGGGCCAGGTGACACGGGCGCAGGAGGCAGAGGAGAACTACGTCATCAAGCGGGAGCTGGCTGTGGTGCGGCAGCAGTGCAGCTCGGCTGCCGAGGACCTGCAGAGGGCACAGAGCACTATCCGCCAGCTGCAGGAGCAGCAGGAGAATCCACGCCTCACTGAGGACTTCGTGGCCCACCTGGAGACAGAGCTGGAGCAGTCAAGGCTTCGGGAGACAGAGACGCTGGGGGCCCTGCGGGAGATGCAGGACAAGGTTCTGGACATGGAAAAGAGGAACAGCTCGCTCCCGGACGAGAACAACGTGGCGCGGCTGCAGGAGGAGCTGAAGGCGCTCAAGGTGCGGGAGGGCGAGGCTGTGGCCTCTGCCCGGGAGCAGAAACTCCAGCTGCAGGAGCTGTCGGACGCCTGGCAGGCCCACCTGTCCCGCGGCGGCCGCTGGAAGGAGTCTCCGCGGAAGCTGGTGCTGGGCGAGCTGCAGGACGAGCTCATGAGCGTGCGTCTGCGCGAGGCCCAGGCGCTGGCCGAGGGCCGCGAGCTGCGGCAGCGCGTGGTGGAGCTCGAGACGCAGGACCACATCCACCGCAACCTGCTGAACCGCGTGGAGGCGGAGCGCGCGGCGCTGCAGGAGAAGCTACAGTACCTGGCGGCGCAGAACAAGGGGCTGCAGACGCAACTCAGCGAGAGCCGCCGCAAGCAGGCGGAGGCCGAGTGCAAGAGCAAGGAGGAGGTGATGGCCGTGCGCCTGCGGGAGGCGGACAGCATGGCCGCGGTGGCCGAGATGCGGCAGCGCATCGCGGAGCTGGAGATCCAGAGGGAGGAGGGCCGCATCCAGGGCCAGCTGAACCACTCCGACTCCTCGCAGTACATCCGAGAGCTCAAGGACCAGATCGAGGAGCTGAAGGCAGAGGTGCGGCTGCTGAAGGGCCCGCCGCCCTTCGAGGACCCGCTGGCTTTCGATGGGCTGAGCCTGACGGGGCACCTGGATGAGGACTCGCTGCCGTCGTCCGACGAGGAGCTGCTGGGAGTGGGCGTGGGCGCGGCCCTGCAGGATGCGCTGTACCCCCTGTCCCCGCGCGACGCGCGCTTCTTCCGCCGCCTAGAGAGGCCGGCCAAGGACAGCGAGGGCAGCTCGGACAGTGATGCCGAGGAGCTGGCGGCGCCCTACAGCCAGGGCCTGGACAACTGA

XM_004865376.1 Coding sequence

Evi5l ecotropic viral integration site 5-like, transcript variant X7

Length: 1332 bp    Location: 828375..838424   Strand: +
>XM_004865376.1
ATGTTCTGTCCCTGTGGATTTGGCGATCCTGGATATTTTATCTACAGAGCTGTGACCCAGCCCCGCTCGCAGCTGATGAGCCTGCCCGCCATGGCGAGCCCCACTCTGAGCCCTGACTCCTCGTCCCAGGAGGCCCTGTCGGCCCCCACCTGCTCCCCGACCTCCGACTCCGAGAACCTCAGCCCCGATGAGCTGGAGCTATTGGCCAAGCTGGAGGAACAGAACCGGCTGCTGGAAGCCGACTCCAAGTCCATGCGCTCCATGAATGGCTCACGGCGGAACAGCGGCTCCTCGCTGGTGTCCAGCTCCTCCGCCTCGTCCAACCTGAGCCACCTGGAGGAGGACACGTGGATCCTGTGGGGCCGCATCGCTAACGAGTGGGAGGAGTGGCGGCGGCGGAAGGAGAAGCTGCTCAAGGAGCTGATCCGCAAGGGCATCCCGCACCACTTCCGGGCCATCGTGTGGCAGCTCCTATGCAGCGCCACGGATATGCCAGTCAAGAACCAGTACTCGGAGCTGCTCAAGATGTCCTCGCCGTGTGAGAAGCTGATCCGCAGGGACATCGCCCGCACTTACCCGGAGCACGAGTTCTTCAAGGGCCAGGACAGCCTGGGCCAGGAGGTCCTCTTCAACGTCATGAAGGCCTACTCCCTGGTGGACCGGGAGGTGGGCTACTGCCAGGGCAGCGCCTTCATCGTGGGCCTGCTCCTCATGCAGATGCCCGAGGAGGAGGCCTTCTGCGTGTTCGTGCGGCTGATGCAGGAGTACCGGCTGCGGGAGCTCTTCAAGCCCAGCATGGCCGAGCTGGGGCTCTGCATCTACCAGTTTGAGTACATGCTACAGGAGCAGCTTCCAGAGCTGAACACCCACTTCCGCTCGCAGAGCTTCCACACGTCCATGTACGCCTCGTCCTGGTTCCTCACTCTCTTCCTCACTACCTTCCCCCTGCCCGTGGCCACCCGAGTCTTCGACATCTTCATGTACGAGGGGCTGGAGATCGTGTTCCGGGTGGGCCTGGCCCTGCTGCAGGTGAACCAGGCGGAGCTCATGCAGCTGGACATGGAGGGCATGTCGCAGTACTTCCAGAGGGTGATCCCCCACCAGTTCGACAGCTGCCCGGACAAGCTGGTGCTCAAGGCCTACCAGGTCAAGTACAACCCCAAGAAGATGAAGAGGCTGGAGAAGGAGTACGCGGCCATGAAGAGCAAGGAGATGGAGGAGCAGATCGAGATCAAAGCCCCGCCGGCACGTTGTCCGGCCTGGCGACGCAGCAGTAAACAAGACAGCCCCGGTCCTGCCCTCGCGGGTCCCAGGGCCGTGGGGAGACACTGA

XM_004865372.1 Coding sequence

Evi5l ecotropic viral integration site 5-like, transcript variant X3

Length: 2475 bp    Location: 828380..847975   Strand: +
>XM_004865372.1
ATGTTCTGTCCCTGTGGATTTGGCGATCCTGGATATTTTATCTACAGAGCTGTGACCCAGCCCCGCTCGCAGCTGATGAGCCTGCCCGCCATGGCGAGCCCCACTCTGAGCCCTGACTCCTCGTCCCAGGAGGCCCTGTCGGCCCCCACCTGCTCCCCGACCTCCGACTCCGAGAACCTCAGCCCCGATGAGCTGGAGCTATTGGCCAAGCTGGAGGAACAGAACCGGCTGCTGGAAGCCGACTCCAAGTCCATGCGCTCCATGAATGGCTCACGGCGGAACAGCGGCTCCTCGCTGGTGTCCAGCTCCTCCGCCTCGTCCAACCTGAGCCACCTGGAGGAGGACACGTGGATCCTGTGGGGCCGCATCGCTAACGAGTGGGAGGAGTGGCGGCGGCGGAAGGAGAAGCTGCTCAAGGAGCTGATCCGCAAGGGCATCCCGCACCACTTCCGGGCCATCGTGTGGCAGCTCCTATGCAGCGCCACGGATATGCCAGTCAAGAACCAGTACTCGGAGCTGCTCAAGATGTCCTCGCCGTGTGAGAAGCTGATCCGCAGGGACATCGCCCGCACTTACCCGGAGCACGAGTTCTTCAAGGGCCAGGACAGCCTGGGCCAGGAGGTCCTCTTCAACGTCATGAAGGCCTACTCCCTGGTGGACCGGGAGGTGGGCTACTGCCAGGGCAGCGCCTTCATCGTGGGCCTGCTCCTCATGCAGATGCCCGAGGAGGAGGCCTTCTGCGTGTTCGTGCGGCTGATGCAGGAGTACCGGCTGCGGGAGCTCTTCAAGCCCAGCATGGCCGAGCTGGGGCTCTGCATCTACCAGTTTGAGTACATGCTACAGGAGCAGCTTCCAGAGCTGAACACCCACTTCCGCTCGCAGAGCTTCCACACGTCCATGTACGCCTCGTCCTGGTTCCTCACTCTCTTCCTCACTACCTTCCCCCTGCCCGTGGCCACCCGAGTCTTCGACATCTTCATGTACGAGGGGCTGGAGATCGTGTTCCGGGTGGGCCTGGCCCTGCTGCAGGTGAACCAGGCGGAGCTCATGCAGCTGGACATGGAGGGCATGTCGCAGTACTTCCAGAGGGTGATCCCCCACCAGTTCGACAGCTGCCCGGACAAGCTGGTGCTCAAGGCCTACCAGGTCAAGTACAACCCCAAGAAGATGAAGAGGCTGGAGAAGGAGTACGCGGCCATGAAGAGCAAGGAGATGGAGGAGCAGATCGAGATCAAAAGGCTTCGGACTGAGAACCGGCTCCTGAAACAGCGGATTGAGACCCTGGAGAAGGGCCAGGTGACACGGGCGCAGGAGGCAGAGGAGAACTACGTCATCAAGCGGGAGCTGGCTGTGGTGCGGCAGCAGTGCAGCTCGGCTGCCGAGGACCTGCAGAGGGCACAGAGCACTATCCGCCAGCTGCAGGAGCAGCAGGAGAATCCACGCCTCACTGAGGACTTCGTGGCCCACCTGGAGACAGAGCTGGAGCAGTCAAGGCTTCGGGAGACAGAGACGCTGGGGGCCCTGCGGGAGATGCAGGACAAGGTTCTGGACATGGAAAAGAGGAACAGCTCGCTCCCGGACGAGAACAACGTGGCGCGGCTGCAGGAGGAGCTGAAGGCGCTCAAGGTGCGGGAGGGCGAGGCTGTGGCCTCTGCCCGGGAGCAGAAACTCCAGCTGCAGGAGCTGTCGGACGCCTGGCAGGCCCACCTGTCCCGCGGCGGCCGCTGGAAGGAGTCTCCGCGGAAGCTGGTGCTGGGCGAGCTGCAGGACGAGCTCATGAGCGTGCGTCTGCGCGAGGCCCAGGCGCTGGCCGAGGGCCGCGAGCTGCGGCAGCGCGTGGTGGAGCTCGAGACGCAGGACCACATCCACCGCAACCTGCTGAACCGCGTGGAGGCGGAGCGCGCGGCGCTGCAGGAGAAGCTACAGTACCTGGCGGCGCAGAACAAGGGGCTGCAGACGCAACTCAGCGAGAGCCGCCGCAAGCAGGCGGAGGCCGAGTGCAAGAGCAAGGAGGAGGTGATGGCCGTGCGCCTGCGGGAGGCGGACAGCATGGCCGCGGTGGCCGAGATGCGGCAGCGCATCGCGGAGCTGGAGATCCAGAGGGAGGAGGGCCGCATCCAGGGCCAGCTGAACCACTCCGACTCCTCGCAGTACATCCGAGAGCTCAAGGACCAGATCGAGGAGCTGAAGGCAGAGGTGCGGCTGCTGAAGGGCCCGCCGCCCTTCGAGGACCCGCTGGCTTTCGATGGGCTGAGCCTGACGGGGCACCTGGATGAGGACTCGCTGCCGTCGTCCGACGAGGAGCTGCTGGGAGTGGGCGTGGGCGCGGCCCTGCAGGATGCGCTGTACCCCCTGTCCCCGCGCGACGCGCGCTTCTTCCGCCGCCTAGAGAGGCCGGCCAAGGACAGCGAGGGCAGCTCGGACAGTGATGCCGAGGAGCTGGCGGCGCCCTACAGCCAGGGCCTGGACAACTGA

XR_206111.1 Non-coding sequence

Evi5l PREDICTED: Heterocephalus glaber ecotropic viral integration site 5-like (Evi5l), transcript variant X8, misc_RNA.

Length: 3869 bp     
>XR_206111.1
AGTGTGACTGGGAAGGAGGGGACACCCAGGCCTGGCGTGAAGTAGTGTGAAGTAGGCGGCCGGCTTTCCGGCTTTCCTTTCCGAAGTACAAAGGCAGCGGGCTCCTGCCCCGCCCACAGCCCCTGCAGGGCGGGTTCCTCCCGCGCCTTCTGAAGCCCCACCCACCCCTGCTTCCACGCAGGGCTCTCTGCCAGCCCGCTTAATTTACATAATCCGTATAATGCACGACGCCCCCAGTGTACGATTCAGTGAACTTTAGCGCGCAGGCAATAGTGTGCAACCATGACCATTATCTAATTCCAGAACATTTCCGTCACCCCAAAGGGAAACACTGTACGGATGAAACTCACTCCCCGTTCCCTTCTTACCCCAGCTCCTGCAAGCACTAATCAATGTTCTGTCCCTGTGGATTTGGCGATCCTGGATATTTTATCTACAGAGCTGTGACCCAGCCCCGCTCGCAGCTGATGAGCCTGCCCGCCATGGCGAGCCCCACTCTGAGCCCTGACTCCTCGTCCCAGGAGGCCCTGTCGGCCCCCACCTGCTCCCCGACCTCCGACTCCGAGAACCTCAGCCCCGATGAGCTGGAGCTATTGGCCAAGCTGGAGGAACAGAACCGGCTGCTGGAAGCCGACTCCAAGTCCATGCGCTCCATGAATGGCTCACGGCGGAACAGCGGCTCCTCGCTGGTGTCCAGCTCCTCCGCCTCGTCCAACCTGAGCCACCTGGAGGAGGACACGTGGATCCTGTGGGGCCGCATCGCTAACGAGTGGGAGGAGTGGCGGCGGCGGAAGGAGAAGCTGCTCAAGGAGCTGATCCGCAAGGGCATCCCGCACCACTTCCGGGCCATCGTGTGGCAGCTCCTATGCAGCGCCACGGATATGCCAGTCAAGAACCAGTACTCGGAGCTGCTCAAGATGTCCTCGCCGTGTGAGAAGCTGATCCGCAGGGACATCGCCCGCACTTACCCGGAGCACGAGTTCTTCAAGGGCCAGGACAGCCTGGGCCAGGAGGTCCTCTTCAACGTCATGAAGGCCTACTCCCTGGTGGACCGGGAGGTGGGCTACTGCCAGGGCAGCGCCTTCATCGTGGGCCTGCTCCTCATGCAGATGCCCGAGGAGGAGGCCTTCTGCGTGTTCGTGCGGCTGATGCAGGAGTACCGGCTGCGGGAGCTCTTCAAGCCCAGCATGGCCGAGCTGGGGCTCTGCATCTACCAGTTTGAGTACATGCTACAGGAGCAGCTTCCAGAGCTGAACACCCACTTCCGCTCGCAGAGCTTCCACACGTCCATGTACGCCTCGTCCTGGTTCCTCACTCTCTTCCTCACTACCTTCCCCCTGCCCGTGGCCACCCGAGTCTTCGACATCTTCATGTACGAGGGGCTGGAGATCGTGTTCCGGGTGGGCCTGGCCCTGCTGCAGGTGAACCAGGCGGAGCTCATGCAGCTGGACATGGAGGGCATGTCGCAGTACTTCCAGAGGGTGATCCCCCACCAGTTCGACAGCTGCCCGGACAAGCTGGTGCTCAAGGCCTACCAGGTCAAGTACAACCCCAAGAAGATGAAGAGGCTGGAGAAGGAGTACGCGGCCATGAAGAGCAAGGAGATGGAGGAGCAGATCGAGATCAAAAGGCTTCGGACTGAGAACCGGCTCCTGAAACAGCGGATTGAGACCCTGGAGAAGGAGAGCGCTGCTCTGGCTGATAGGTTAATCCAGGGCCAGGTGACACGGGCGCAGGAGGCAGAGGAGAACTACGTCATCAAGCGGGAGCTGGCTGTGGTGCGGCAGCAGTGCAGCTCGGCTGCCGAGGACCTGCAGAGGGCACAGAGCACTATCCGCCAGCTGCAGGAGCAGCAGGAGAATCCACGCCTCACTGAGGACTTCGTGGCCCACCTGGAGACAGAGCTGGAGCAGTCAAGGCTTCGGGAGACAGAGACGCTGGGGGCCCTGCGGGAGATGCAGGACAAGGTTCTGGACATGGAAAAGAGGAACAGCTCGCTCCCGGACGAGAACAACGTGGCGCGGCTGCAGGAGGAGCTGAAGGCGCTCAAGGTGCGGGAGGGCGAGGCTGTGGCCTCTGCCCGGGAGCAGAAACTCCAGCTGCAGGAGCTGTCGGACGCCTGGCAGGCCCACCTGTCCCGCGGCGGCCGCTGGAAGGAGTCTCCGCGGAAGCTGGTGCTGGGCGAGCTGCAGGACGAGCTCATGAGCGTGCGTCTGCGCGAGGCCCAGGCGCTGGCCGAGGGCCGCGAGCTGCGGCAGCGCGTGGTGGAGCTCGAGACGCAGGACCACATCCACCGCAACCTGCTGAACCGCGTGGAGGCGGAGCGCGCGGCGCTGCAGGAGAAGCTACAGTACCTGGCGGCGCAGAACAAGGGGCTGCAGACGCAACTCAGCGAGAGCCGCCGCAAGCAGGCGGAGGCCGAGTGCAAGAGCAAGGAGGAGGTGATGGCCGTGCGCCTGCGGGAGGCGGACAGCATGGCCGCGGTGGCCGAGATGCGGCAGCGCATCGCGGAGCTGGAGATCCAGAGGGAGGAGGGCCGCATCCAGGGCCAGCTGAACCACTCCGACTCCTCGCAGTACATCCGAGAGCTCAAGGACCAGATCGAGGAGCTGAAGGCAGAGGTGCGGCTGCTGAAGGGCCCGCCGCCCTTCGAGGACCCGCTGGCTTTCGATGGGCTGAGCCTGACGGGGCACCTGGATGAGGACTCGCTGCCGTCGTCCGACGAGGAGCTGCTGGGAGTGGGCGTGGGCGCGGCCCTGCAGGATGCGCTGTACCCCCTGTCCCCGCGCGACGCGCGCTTCTTCCGCCGCCTAGAGAGGCCGGCCAAGGACAGCGAGGGCAGCTCGGACAGTGATGCCGAGGAGCTGGCGGCGCCCTACAGCCAGGGCCTGGACAACTGAGGCCGAGGCCCGCGCCGGGAGCCAGCTGCTCCCTGGGCCGCATTTAATGAACTCGACCTGGCCAGCGAGCTGCTGCAGACGTAGCGAGCAGAGGGCGGCCCTGCGGGGAAGGGCCCAGGAGCTAGAGGAGGCCCCAAGGAAGGAGAGGCAGCTCTGGGCCGGACATTAGCACCCCAGGACTCCAATGGACACAGTGACCCTGGACCAGCTGGCCCCTGGCCACCGGGGACAGACGGCTGAGCTGGGCTTCACTGCCGGTGCGGTCATCCTGGCCCCTGCAGCAGAAACCAAAGTCCCTCCTGCCTGTGCAGGGCCGGCCACCTGGGTGTGGGTGGCCAGGGAAACAGCTCAGACCTGGGCCGTGTCTCCTTGCTTCTCCGGGGCCAGAGCAGCTGCAAGGGATGAAGAAACCCATCTCCCCGGCGCCCACCTCTTCCTCTGGGAGACCCGCATCCTGGCTAGCGACCTAAAGGGTCCCCTCCCCTGGGGGCCACAGCCTCCGTCCGTCCACCCCTTCCTTTTCCCCTGCCCAGGGTGAGCGCTCCAGCACAGCCACCTCCCCTCGCCTCGGGTGGTGGCCCGGGGCCTCTACCAAGTCAGAGCTGAGCACCGTGCCAAAGCCCAGCAGTGTCCCCAGGCCCTGTCCTCCTTCCTCCCCAGAGGCCTCCTGACCCTCGGCCGACCCTCTCGGTGCTCCTGGAGCCTCGAGTAGAGTAGCATCAGAAGCAATCTCCCAGTGCGTCCTGGAGGGGCCCCCTGCTCTGCTCGGTCCCCCTTCCTGGTTGCCTACTCTTCAGTGTTACAAAGCCTGGGGACCAGGTGGGCACCTGCGGGGCTCTCCCAGTGTGCCCCCCTCACTGCCCACCACCATTTTGCACACTGCCTGTTCACACTTCCACACGTCGCCCAGGCGGGAAAGATGGAAAATAAAGTTATTTACACAGTCACAGACAAGGGCGCTGAGTGGGG

XM_004865616.1 Coding sequence

LOC101720872 persephin-like

Length: 480 bp    Location: 3510200..3509407   Strand: -
>XM_004865616.1
ATGGCCACAGGGAGAGTCCTGTTGGCTTCACTGCTGCTCCTGTCGCTGCAGCTGGGCCTCGGCTGGGGCCCTGATGCCCGAGGTGCTCCGTTGGTGGAGGGAGAGTTCTTGCCTGAGCACATAGCAGAGGGCAGGGGGAACTGGAGGCCACCACTGGGCACCCGCCACCCTCGTGCCCGCCTGCGCAGAGCCCCTGGCAGCCCATGCCAGCTGTGGAGCCTGACCCTGCCCGTGGCAGAGCTGGGCCTGGGCTACGCTTCAGATGAGAAAGTCACTTTCCGCTACTGCGCCGGCAGCTGCCCCCGAGGTGCCCGCACCCAGCACGGCCTGACACTGGCCCGGTTGCGGGGCCAGGGCCAAGCCCACGGTGGACCCTGCTGCCGGCCCACCCGCTACGCCGACGTGGCCTTCCTGGATGACCGTCACCGCTGGCAGCGGCTGCCCCAGCTCTCGGCTGCTGCCTGTGGCTGTGGTGGCTGA

XM_004865370.1 Coding sequence

Evi5l ecotropic viral integration site 5-like, transcript variant X1

Length: 2508 bp    Location: 828403..847975   Strand: +
>XM_004865370.1
ATGTTCTGTCCCTGTGGATTTGGCGATCCTGGATATTTTATCTACAGAGCTGTGACCCAGCCCCGCTCGCAGCTGATGAGCCTGCCCGCCATGGCGAGCCCCACTCTGAGCCCTGACTCCTCGTCCCAGGAGGCCCTGTCGGCCCCCACCTGCTCCCCGACCTCCGACTCCGAGAACCTCAGCCCCGATGAGCTGGAGCTATTGGCCAAGCTGGAGGAACAGAACCGGCTGCTGGAAGCCGACTCCAAGTCCATGCGCTCCATGAATGGCTCACGGCGGAACAGCGGCTCCTCGCTGGTGTCCAGCTCCTCCGCCTCGTCCAACCTGAGCCACCTGGAGGAGGACACGTGGATCCTGTGGGGCCGCATCGCTAACGAGTGGGAGGAGTGGCGGCGGCGGAAGGAGAAGCTGCTCAAGGAGCTGATCCGCAAGGGCATCCCGCACCACTTCCGGGCCATCGTGTGGCAGCTCCTATGCAGCGCCACGGATATGCCAGTCAAGAACCAGTACTCGGAGCTGCTCAAGATGTCCTCGCCGTGTGAGAAGCTGATCCGCAGGGACATCGCCCGCACTTACCCGGAGCACGAGTTCTTCAAGGGCCAGGACAGCCTGGGCCAGGAGGTCCTCTTCAACGTCATGAAGGCCTACTCCCTGGTGGACCGGGAGGTGGGCTACTGCCAGGGCAGCGCCTTCATCGTGGGCCTGCTCCTCATGCAGATGCCCGAGGAGGAGGCCTTCTGCGTGTTCGTGCGGCTGATGCAGGAGTACCGGCTGCGGGAGCTCTTCAAGCCCAGCATGGCCGAGCTGGGGCTCTGCATCTACCAGTTTGAGTACATGCTACAGGAGCAGCTTCCAGAGCTGAACACCCACTTCCGCTCGCAGAGCTTCCACACGTCCATGTACGCCTCGTCCTGGTTCCTCACTCTCTTCCTCACTACCTTCCCCCTGCCCGTGGCCACCCGAGTCTTCGACATCTTCATGTACGAGGGGCTGGAGATCGTGTTCCGGGTGGGCCTGGCCCTGCTGCAGGTGAACCAGGCGGAGCTCATGCAGCTGGACATGGAGGGCATGTCGCAGTACTTCCAGAGGGTGATCCCCCACCAGTTCGACAGCTGCCCGGACAAGCTGGTGCTCAAGGCCTACCAGGTCAAGTACAACCCCAAGAAGATGAAGAGGCTGGAGAAGGAGTACGCGGCCATGAAGAGCAAGGAGATGGAGGAGCAGATCGAGATCAAAAGGCTTCGGACTGAGAACCGGCTCCTGAAACAGCGGATTGAGACCCTGGAGAAGGAGAGCGCTGCTCTGGCTGATAGGTTAATCCAGGGCCAGGTGACACGGGCGCAGGAGGCAGAGGAGAACTACGTCATCAAGCGGGAGCTGGCTGTGGTGCGGCAGCAGTGCAGCTCGGCTGCCGAGGACCTGCAGAGGGCACAGAGCACTATCCGCCAGCTGCAGGAGCAGCAGGAGAATCCACGCCTCACTGAGGACTTCGTGGCCCACCTGGAGACAGAGCTGGAGCAGTCAAGGCTTCGGGAGACAGAGACGCTGGGGGCCCTGCGGGAGATGCAGGACAAGGTTCTGGACATGGAAAAGAGGAACAGCTCGCTCCCGGACGAGAACAACGTGGCGCGGCTGCAGGAGGAGCTGAAGGCGCTCAAGGTGCGGGAGGGCGAGGCTGTGGCCTCTGCCCGGGAGCAGAAACTCCAGCTGCAGGAGCTGTCGGACGCCTGGCAGGCCCACCTGTCCCGCGGCGGCCGCTGGAAGGAGTCTCCGCGGAAGCTGGTGCTGGGCGAGCTGCAGGACGAGCTCATGAGCGTGCGTCTGCGCGAGGCCCAGGCGCTGGCCGAGGGCCGCGAGCTGCGGCAGCGCGTGGTGGAGCTCGAGACGCAGGACCACATCCACCGCAACCTGCTGAACCGCGTGGAGGCGGAGCGCGCGGCGCTGCAGGAGAAGCTACAGTACCTGGCGGCGCAGAACAAGGGGCTGCAGACGCAACTCAGCGAGAGCCGCCGCAAGCAGGCGGAGGCCGAGTGCAAGAGCAAGGAGGAGGTGATGGCCGTGCGCCTGCGGGAGGCGGACAGCATGGCCGCGGTGGCCGAGATGCGGCAGCGCATCGCGGAGCTGGAGATCCAGAGGGAGGAGGGCCGCATCCAGGGCCAGCTGAACCACTCCGACTCCTCGCAGTACATCCGAGAGCTCAAGGACCAGATCGAGGAGCTGAAGGCAGAGGTGCGGCTGCTGAAGGGCCCGCCGCCCTTCGAGGACCCGCTGGCTTTCGATGGGCTGAGCCTGACGGGGCACCTGGATGAGGACTCGCTGCCGTCGTCCGACGAGGAGCTGCTGGGAGTGGGCGTGGGCGCGGCCCTGCAGGATGCGCTGTACCCCCTGTCCCCGCGCGACGCGCGCTTCTTCCGCCGCCTAGAGAGGCCGGCCAAGGACAGCGAGGGCAGCTCGGACAGTGATGCCGAGGAGCTGGCGGCGCCCTACAGCCAGGGCCTGGACAACTGA

XM_004865374.1 Coding sequence

Evi5l ecotropic viral integration site 5-like, transcript variant X5

Length: 2433 bp    Location: 831077..847975   Strand: +
>XM_004865374.1
ATGAGCCTGCCCGCCATGGCGAGCCCCACTCTGAGCCCTGACTCCTCGTCCCAGGAGGCCCTGTCGGCCCCCACCTGCTCCCCGACCTCCGACTCCGAGAACCTCAGCCCCGATGAGCTGGAGCTATTGGCCAAGCTGGAGGAACAGAACCGGCTGCTGGAAGCCGACTCCAAGTCCATGCGCTCCATGAATGGCTCACGGCGGAACAGCGGCTCCTCGCTGGTGTCCAGCTCCTCCGCCTCGTCCAACCTGAGCCACCTGGAGGAGGACACGTGGATCCTGTGGGGCCGCATCGCTAACGAGTGGGAGGAGTGGCGGCGGCGGAAGGAGAAGCTGCTCAAGGAGCTGATCCGCAAGGGCATCCCGCACCACTTCCGGGCCATCGTGTGGCAGCTCCTATGCAGCGCCACGGATATGCCAGTCAAGAACCAGTACTCGGAGCTGCTCAAGATGTCCTCGCCGTGTGAGAAGCTGATCCGCAGGGACATCGCCCGCACTTACCCGGAGCACGAGTTCTTCAAGGGCCAGGACAGCCTGGGCCAGGAGGTCCTCTTCAACGTCATGAAGGCCTACTCCCTGGTGGACCGGGAGGTGGGCTACTGCCAGGGCAGCGCCTTCATCGTGGGCCTGCTCCTCATGCAGATGCCCGAGGAGGAGGCCTTCTGCGTGTTCGTGCGGCTGATGCAGGAGTACCGGCTGCGGGAGCTCTTCAAGCCCAGCATGGCCGAGCTGGGGCTCTGCATCTACCAGTTTGAGTACATGCTACAGGAGCAGCTTCCAGAGCTGAACACCCACTTCCGCTCGCAGAGCTTCCACACGTCCATGTACGCCTCGTCCTGGTTCCTCACTCTCTTCCTCACTACCTTCCCCCTGCCCGTGGCCACCCGAGTCTTCGACATCTTCATGTACGAGGGGCTGGAGATCGTGTTCCGGGTGGGCCTGGCCCTGCTGCAGGTGAACCAGGCGGAGCTCATGCAGCTGGACATGGAGGGCATGTCGCAGTACTTCCAGAGGGTGATCCCCCACCAGTTCGACAGCTGCCCGGACAAGCTGGTGCTCAAGGCCTACCAGGTCAAGTACAACCCCAAGAAGATGAAGAGGCTGGAGAAGGAGTACGCGGCCATGAAGAGCAAGGAGATGGAGGAGCAGATCGAGATCAAAAGGCTTCGGACTGAGAACCGGCTCCTGAAACAGCGGATTGAGACCCTGGAGAAGGAGAGCGCTGCTCTGGCTGATAGGTTAATCCAGGGCCAGGTGACACGGGCGCAGGAGGCAGAGGAGAACTACGTCATCAAGCGGGAGCTGGCTGTGGTGCGGCAGCAGTGCAGCTCGGCTGCCGAGGACCTGCAGAGGGCACAGAGCACTATCCGCCAGCTGCAGGAGCAGCAGGAGAATCCACGCCTCACTGAGGACTTCGTGGCCCACCTGGAGACAGAGCTGGAGCAGTCAAGGCTTCGGGAGACAGAGACGCTGGGGGCCCTGCGGGAGATGCAGGACAAGGTTCTGGACATGGAAAAGAGGAACAGCTCGCTCCCGGACGAGAACAACGTGGCGCGGCTGCAGGAGGAGCTGAAGGCGCTCAAGGTGCGGGAGGGCGAGGCTGTGGCCTCTGCCCGGGAGCAGAAACTCCAGCTGCAGGAGCTGTCGGACGCCTGGCAGGCCCACCTGTCCCGCGGCGGCCGCTGGAAGGAGTCTCCGCGGAAGCTGGTGCTGGGCGAGCTGCAGGACGAGCTCATGAGCGTGCGTCTGCGCGAGGCCCAGGCGCTGGCCGAGGGCCGCGAGCTGCGGCAGCGCGTGGTGGAGCTCGAGACGCAGGACCACATCCACCGCAACCTGCTGAACCGCGTGGAGGCGGAGCGCGCGGCGCTGCAGGAGAAGCTACAGTACCTGGCGGCGCAGAACAAGGGGCTGCAGACGCAACTCAGCGAGAGCCGCCGCAAGCAGGCGGAGGCCGAGTGCAAGAGCAAGGAGGAGGTGATGGCCGTGCGCCTGCGGGAGGCGGACAGCATGGCCGCGGTGGCCGAGATGCGGCAGCGCATCGCGGAGCTGGAGATCCAGAGGGAGGAGGGCCGCATCCAGGGCCAGCTGAACCACTCCGACTCCTCGCAGTACATCCGAGAGCTCAAGGACCAGATCGAGGAGCTGAAGGCAGAGGTGCGGCTGCTGAAGGGCCCGCCGCCCTTCGAGGACCCGCTGGCTTTCGATGGGCTGAGCCTGACGGGGCACCTGGATGAGGACTCGCTGCCGTCGTCCGACGAGGAGCTGCTGGGAGTGGGCGTGGGCGCGGCCCTGCAGGATGCGCTGTACCCCCTGTCCCCGCGCGACGCGCGCTTCTTCCGCCGCCTAGAGAGGCCGGCCAAGGACAGCGAGGGCAGCTCGGACAGTGATGCCGAGGAGCTGGCGGCGCCCTACAGCCAGGGCCTGGACAACTGA

XM_004865377.1 Coding sequence

LOC101709597 basic proline-rich protein-like

Length: 3516 bp    Location: 856207..850093   Strand: -
>XM_004865377.1
ATGCCTGCCTTCCCCAAATGTTTAAATAAAACTGTTCTTAGTGCTAGGTCCAGGGTACATATTCTCAGCGCTCTCTGTCCCTGTTTCTGGAAGTTGCTGGGCTGTGTCCCAGGACCTGGTCCCTGGCTAACACTTATAAGGCTCAGTAAACCTTTTCATTTCAGATGTCCCTTGGCCTCCAGTGGCGGTGTGATTCCCCCGGTGCTGCAGTCCCCTGTAAGATCCTCACTTGGGTTCCAGCACAGGTGCGGGATGGACAAGAGGGACAAGGCAAAGGCGGGGGCCGCGGCGCGGGCGCCGGCTTCTCGCCCTCCCGGCCACTCCACCCCAAGGCCCCCAGGGTCTCCTCGACCCCCTCCTCCAGTAACCGCCGCGGCCCTTCGAGTTCTGGGAGCAGCGGGAGCTACGGGGCGGAGACCCCTGGCCGAGCGAGGTGGGGGCGGCGGCGGAGCCGAGGCTGCTGCCCGAGGGGGAACAACGCGGAGCGCTGGTACAGGTCCCCGGAGCCCAGCTTCCAGGCCCCCAGCGGCTGGGAGAGGGGAGCGCCCCCCTGCCAAGACCCCGGGCCAGGTCTCTGTCACCAGCCAGGCGCGCGCCAGTGGGACCAGCAGGTCAGGCCCTGTTGGTCAGAAGGGACTCCAGGCCCCCGCTGAGGAGCCTGTGGCCAGAGGAAAAGCTCCAGAGGCTCCCAGAAAGAGTGCCGTGAGCTCTGGAGTGCGAAGAGACTCTGCAGGGCCCGCCTCGGGGGCCCCCTCTGCTGCCGCCGCCCGTCGGACCAGGGCCATAGGCGCAGAGGTGGGATTCCCACGACCAGCCCCGAGTACCCGGCAGCGGCCCCCGACCGAGGTGCCCCGGAGATCAGGGAGCAGTGCCACCGAGCGCAGCAGTGCCGCAGACTCGAGTCCCACAGGCCGGAGGCCGCCCAGCGTCGGTGGGGCTCTTCAGAAAGCGGCCTCGCGTCCCCCCGGCTCCAGCGCTACTCCTCTGCCCTCTCCAGCCCGCTCTGGGGCTGTGCTTCGTGCAACACCCCGCTCTCCTGCGCAGACGTCGAAGCCCAAGTCCAAAGTGCTCCAGGCTCTGCGGTCCGCACCTCCAAGGAAAGAGGCAGCCTTAGCTCAGGGCCCGCCTACTTCTTTGGCCACGGCCCCTCCACCTGGTCCCCCTACGCAGCAGGCCTGGTCTCCCCAAGTCTCTGGGGCCCCCCTGCTGGCCGCACTCCCTCCCTCTCCACCGGCCACGCCCCCTCCACCCGCCTCGCTTCACCTGCAGGCCCCGCCCTCCCTGCAGGCCCTGCCCTCCCTGCAGGCCCCGCCCCCTCCGCGAGTCCCTTCCCCTCCCCTGGCTCTGCAGAACCTCCCCTCCCCACCGGCCACGCCCCCTTTGCAAGCTCCACCCACACAGCTGGGCAGGTCCTTTTCGGAAGAGGCATCCCTCCCTCCGCTGTCTAAGGCTGCACCCTCTCCAACACTTTCACCCCCGCTGCAGAACGTCCTCCTCACCCAGGCTTCTTCGGCTTTGCCACCTCTTCCGACTCCCTTGACCACACCTTTTTCGTCCACTCTACCTTTACCCTCGTCCTCTATACAGATCCCTCTTTCTCCACCAATTTCTCCGCTGAATCCGCCGTCTCCTCTGTCCACGCCCACTCCACCGGCTTTTCCCACTCTGGCCACGCCTTCTCCCCTTGCCAGTCCCGCCCTGTCTCTGCCCCCTCTTCAGACCATGGCCTCTAAAAGGCCTACGCCTCCATCGCCAGACCCTCCTCCTCTGGGGACATCCCCTGTGAAGGGTCCTCTGGCCGCTCCCTCTCCTCCAGCCTCTCCCCCTCTGCATGCCCCGCCCCCTTCACTGGCCCCGCCCCCTCTGTGTGCCCCACCCTCTCTGACCTCGCCACCCATACAGGTCCCACCTGCTCTGGTCTCACCTCTGCTGCAGGCCACGCCTTCTTTCCGGCCCACGCCCCCTGTGCAAACCCAAGCTCCTCTGACCTCGCCCCCTCTACAGGGCTATCCTCCCCCTACCACGGACCCTTTGCCCCTTCTCTCTCCCCCTGCCTCTCCCCCTCTACAGGCTCTTCTCTCTCCTCCCGCCTCACCACCTCAGCAAGCCTCTCAGTCTCCCTGTGCCTCACCTCCCCGGTCTCCTTTGGGTACCCATCCTCCACAGGCCCCGGCTTCTCTAGACTGGCACCCGGCCTCTCCCCTGGCTACGCCTCCTCCACAGGTTTCGCCTCTGGCCTTGCCTTCCCTACAGGCCCCTCCCTCACCCCAGGCCACTTCCCCCATGCAGGCCCCGCCTTCACCGGCCTTATCCCTTCGGCGGGATCCTCCCTCTCCCATGATCACGCCCCCTCCACCGACCCTACTTCCTTTGCAGGCCCCGCCCTCCCCTCTGCCCCCGCCCCATACGCAGGCCCCGCCCTCCCCGCGCCTGCAGTCCCCGCCCCTTCACCTGACCACGCCCTCTAGGCAGGTCCCATCTTTGGTCTTGCCCCCTCTGAAGGCACCTCCCTCTTCCCTGGCCACGCCACACACACAGGCCCCGCCCTCCCCGCTCATGGAGGCCCCTCCCCTTCCCCTGGCCACGCCCTCTAGGCAGGTCCCATCTTTGGTCTTGCCCCCTCTGCAGGCACCTCTCTCTCCCCTGGCCTCGCCCCTCCTGCAGGCCCCTCCCTCTCCCCCTGCCTCTCCTACTCCACACGCTCCACGCCGTCCCCCGACCCCTGGTCCAGATGCCTCCATTTCTGGCCCGCGGTTGACACTAGCGCTGGCCCCGGCTCCGCCGCCACCACCCTCGCGCAGCCCGTCCAGCACGCTGAGTGGCCCGGACCTGGCTGGCCACAGCAGCAGCGCGACGAGCACACCCGAGGAGCTGCGCGGTTACGACAGCGGGCCCGAAGGCGGCGCCGCAGCCTCCTCGCCGGCCGACGCGGAGCTCGCTGCCTGCCACCCAGCTGCCTGGAGTCGAGGCCCTGCTCCGCCGCTGGCTGTCCGCGGCGCTCCAGGAGCTCCGCTCTCCTGGCCTCCGGCAGCGGGACCCGGCTCTGCAGACGGGCTGTGCACCATCTACGAGGCTGAAGGGCCTGAGCCGGCGACCCCCACCCCGGGCGCGCTGGATCCGGGGCTCGGGTCGGGCGCCGGGGGTGAGAAGGCCGCAGCGGGCGCGGGGCCGGGTCAGTCTTCGCGGAGCCCGAAGCCGGCGCGCCTGGGCGAGCTGCCGCTGGGGGCGCTGCAGGCAAGCGTCGTGCAGCACCTGCTGAGCCGGACGCTGCTGCTAGCGGCTGCCGAGGGCGCCGCGGGAGGCAGTGGCGGTGGGCCAGGCGGCTCGGGTGGTGTTGGGGTCTCGGGGGGCGCCCGGGCTCCGCTCAGCGATGCCGAACTGGGCCGCTGGGCCGAACTGCTATCTCCTCTGGATGAGTCCCGAGCTAGCATCACCTCGGTCACCAGCTTCTCCCCGGACGACGTGGCTTCCCCTCAGGGTGACTGGACCGTTGTGGAAGTGGAGACTTTCCATTGA

XM_004865378.1 Coding sequence

Lrrc8e leucine rich repeat containing 8 family, member E

High confidence: 4 potential gene matches
Length: 2388 bp    Location: 860744..868595   Strand: +
>XM_004865378.1
ATGATCCCAGTGGCCGAGTTCAAGCAATTCACGGAACAGCAGCCTGCGTTCAAGGTGCTCAAACCCTGGTGGGATGTGCTCGCTGAGTATCTCACGGTGGCTATGCTCATGATCGGAGTCTTTGGCTGCACCCTGCAGGTGACGCAGGACAAGATTATCTGCCTGCCCAGTCATGAACCCCGGGAGAACTTCTCAGAGGCCCCTTGCCAGCAGCTCTTGCCTCAGGGGGTCTCCGAGCACATGGAGGGCCTCCGGGAGCTGAGTGGCCTCAAGAACAACTTGGACCTGCAGCAGTACAGCTTCATTAACCAGCTGTGCTATGAGACAGCCCTGCACTGGTATGCCAAATACTTCCCCTACCTGGTTGTCATCCACACACTCATCTTCATGGTCTGCACCAGCTTCTGGTTCAAGTTCCCCGGCACCAGCTCCAAGATCGAACATTTCATCTCCATCCTGGGCAAGTGTTTCGATTCCCCATGGACCACCCGGGCCTTGTCTCAGGTCTCCGGGGAGAACCAAAAAGGCGCAGCTGCCTCACGGGCCACAGCCATCACAGTGGCTGCAGCAGGGACCGGGTCCGGGAAGGCAGGTGAGGGCGAGAAGGAGAAAGTGCTAGCAGAACCGGAGAAGGTGGTGACCGAGCCTCCAGCTGTCACCCTGCTGGACAAGAAGGAGGGCGAGCAGGCCAAAGCCCTGTTTGAGAAGGTCAAGAAGTTCCGCGTGCATGTGGAAGAGGGGGACATCCTCTACACCATGTACATCCGGCAGACAGTGCTCAAAGTCTGCAAGTTCCTGGCCATCCTGGTCTACAACCTGGTCTACGTGGAGAAGATCAGCTTCCTGGTAGCTTGCAAGGTGGGGACCTCAGAGGTCACCGGATATGCTAGTTTCTGCTGTAACCACACCAAGGCGCACCTCTTCTCCAAGCTGGCCTTCTGCTACATCTCCTTCGTGTGCGTCTATGGGATCACCTGCCTGTACACACTCTACTGGCTCTTCCACCGGCCTCTCAAGGAGTACTCTTTCCGATCCGTGCGAGAGGAGACAGGCATGAATGACATCCCCGACGTCAGGAATGACTTCGCCTTCATGCTGCACCTCATTGACGAGTATGACTCGCTCTACTCCAAGCGCTTCGCTGTCTTCCTCTCCGAGGTCAGTGAAAGCCGCCTGAAGCAGCTCAACCTCAACCATGAGTGGACGCCGGAGAAACTGAGGCAGAAGCTGCAGCGAAACTCAAGGGGCCGGCTGGAGCTGGCTCTCTGCATGCTCCCTGGACTGCCTGACACCATCTTCGAGCTCAGCGAGGTGGAGGCACTCAGGCTGGAGGCCATCTGCGATATCGCCTTCCCGCCGGGGCTGTCACAGCTCACAAACCTTCAGGAGCTCAGCTTGTTGCATTCACCTGCCAGGGTGCCTTTCTCTTCCCAGATCTTCCTTCGGGACCGCCTGAAGGTGATCCGGGTCAAATGTGAGGAGCTCCGAGAGGTGCCCCTCTGGGTGTTCGGGCTTCGTGCCCTGGAGGAGCTGCACCTGGAGGGGCTTTTTCCTCCAGAGCTGGCTCGGGCGGCTTCTCTCGAGAGTCTCCGGGAGCTGAAGCAGCTCAAAGTGTTGTCCTTGCGCAGCAATGCCGGGAAGGTGCCAGCGAGCGTGACTGACGTGGCTGGGCACCTGCAGCGGCTCAGCCTGCACAATGACGGGGCGCGCCTGCTGGCCCTCAACAGCCTCAAGAAACTGGCAGTCCTTCGGGAGCTGGAGCTGGTGGCCTGCGGGCTGGAGCGCATCCCCCATGCCATCTTCAGTCTAGGCGCACTACAGGAACTTGACCTCAAAGACAACCACCTCCGGTCCATTGAAGAGATCCTCAGCTTCCAGCACTGCCGGAAGCTGGTCACGCTCAGGCTGTGGCACAACCAGATCGCCTATGTCCCAGAGCATGTACGGAAGCTCAGGGGCCTTGAGCAGCTCTACCTGAGCCACAACAAGCTGGAGACCCTGCCCAGCCAGCTCGGCCTGTGCTCCAGCCTCCGTCTGCTGGACGTATCCCACAACGGGCTACACTCCCTGCCACCCGAGGTGGGCCTCCTCCAGAACCTGCAGCACCTGGCTCTCTCCTACAATGCTCTCGAAGCCTTGCCAGATGAGTTGTTCTTCTGCCGCAAGCTGCGGACATTGCTTCTGGGCTACAACCACCTGGGCTACCTCTCTCCCCATGTGGCAGCCCTCACAGCCCTTAGTCGCCTGGAGCTCAAGGGCAACCGGTTAGAGGTGCTGCCGGAAGAACTGGGCAACTGCACAGGACTGAAGAAGGCGGGGCTGGTGGTGGAGGACACCCTTTACCAGGGGCTGCCCACTGAGGTTCGAGCAAAGATGGAGGAGGAATGA

XM_004865381.1 Coding sequence

Map2k7 mitogen-activated protein kinase kinase 7, transcript variant X2

Length: 1326 bp    Location: 869431..878215   Strand: +
>XM_004865381.1
ATGGCGGCGTCCTCCCTGGAGCAAAAGCTGTCCCGCCTGGAAGCAAAGCTGAAGCAGGAGAACCGTGAGGCCCGGCGGAGGATCGACCTCAACCTGGATATCAGCCCCCAGCGGCCCAGGCCCATTATTGTGATCACTCTAAGCCCTGCTCCTGCCCCGTCCCAGCGAGCAGCCCTGCAGCTCCCGCTGGCCAATGATGGGGGCAGCCGCTCACCGTCCTCAGAGAGCTCACCGCAGCACCCCACGCCCCCCGCCCGGCCCCGCCACATGCTGGGGCTCCCGTCCACCTTGTTCACGCCCCGCAGCATGGAGAGCATTGAGATCGACCAGAAGCTGCAGGAGATTATGAAGCAGACGGGCTACCTGACCATCGGGGGCCAGCGCTACCAGGCAGAGATCAATGACCTGGAGAACCTGGGTGAGATGGGCAGCGGCACCTGCGGCCAGGTGTGGAAGATGCGCTTCCGGAAGACGGGCCACGTCATCGCCGTCAAGCAAATGCGGCGCTCTGGGAACAAGGAGGAGAACAAGCGCATCCTCATGGACCTGGATGTGGTGCTCAAGAGCCACGACTGCCCGTACATCGTGCAGTGCTTCGGCACCTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCATGGGCACCTGCGCCGAGAAGCTGAAGAAGCGGATGCAGGGGCCCATCCCTGAGCGAATCCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGAAGCACGGCGTCATCCACCGCGATGTCAAGCCCTCCAACATCCTCCTGGACGAGCGGGGCCAGATCAAGCTCTGCGACTTCGGCATCAGTGGCCGCCTGGTGGACTCTAAGGCCAAGACGAGGAGTGCCGGCTGTGCGGCCTACATGGCGCCTGAGCGCATAGACCCCCCAGACCCCACCAAGCCCGACTATGACATCCGGGCCGACGTGTGGAGCCTGGGCATCTCGTTGGTGGAGCTGGCAACAGGACAGTTTCCCTATAAGAACTGCAAGACAGACTTCGAGGTCCTCACCAAAGTCCTCCAGGAAGAGCCCCCACTCCTGCCTGGTCACATGGGCTTCTCAGGGGACTTCCAGTCCTTCGTAAGAGACTGCCTTACTAAAGATCACAGGAAGAGACCAAAGTATAATAAGCTACTTCCCCCCTCGGGCCCACAGGAACACAGCTTCATCAAGCGCTACGAGATGCTGGAAGTGGACGTGGCGTCCTGGTTCAAGGACGTCATGGCGAAGACCGAGTCACCGAGGACTAGCGGAGTGCTGAGCCAGCCCCACCTGCCCTTCTTCAGGTAG

XM_004865382.1 Coding sequence

Map2k7 mitogen-activated protein kinase kinase 7, transcript variant X3

Length: 1308 bp    Location: 869433..878215   Strand: +
>XM_004865382.1
ATGGCGGCGTCCTCCCTGGAGCAAAAGCTGTCCCGCCTGGAAGCAAAGCTGAAGCAGGAGAACCGTGAGGCCCGGCGGAGGATCGACCTCAACCTGGATATCAGCCCCCAGCGGCCCAGGCCCATTATTGTGATCACTCTAAGCCCTGCTCCTGCCCCGTCCCAGCGAGCAGCCCTGCAGCTCCCGCTGGCCAATGATGGGGGCAGCCGCTCACCGTCCTCAGAGAGCTCACCGCAGCACCCCACGCCCCCCGCCCGGCCCCGCCACATGCTGGGGCTCCCGTCCACCTTGTTCACGCCCCGCAGCATGGAGAGCATTGAGATCGACCAGAAGCTGCAGGAGATTATGAAGCAGACGGGCTACCTGACCATCGGGGGCCAGCGCTACCAGGCAGAGATCAATGACCTGGAGAACCTGGGTGAGATGGGCAGCGGCACCTGCGGCCAGGTGTGGAAGATGCGCTTCCGGAAGACGGGCCACGTCATCGCCGTCAAGCAAATGCGGCGCTCTGGGAACAAGGAGGAGAACAAGCGCATCCTCATGGACCTGGATGTGGTGCTCAAGAGCCACGACTGCCCGTACATCGTGCAGTGCTTCGGCACCTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCATGGGCACCTGCGCCGAGAAGCTGAAGAAGCGGATGCAGGGGCCCATCCCTGAGCGAATCCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGAAGCACGGCGTCATCCACCGCGATGTCAAGCCCTCCAACATCCTCCTGGACGAGCGGGGCCAGATCAAGCTCTGCGACTTCGGCATCAGTGGCCGCCTGGTGGACTCTAAGGCCAAGACGAGGAGTGCCGGCTGTGCGGCCTACATGGCGCCTGAGCGCATAGACCCCCCAGACCCCACCAAGCCCGACTATGACATCCGGGCCGACGTGTGGAGCCTGGGCATCTCGTTGGTGGAGCTGGCAACAGGACAGTTTCCCTATAAGAACTGCAAGACAGACTTCGAGGTCCTCACCAAAGTCCTCCAGGAAGAGCCCCCACTCCTGCCTGGTCACATGGGCTTCTCAGGGGACTTCCAGTCCTTCGTAAGAGACTGCCTTACTAAAGATCACAGGAAGAGACCAAAGTATAATAAGCTACTTGAACACAGCTTCATCAAGCGCTACGAGATGCTGGAAGTGGACGTGGCGTCCTGGTTCAAGGACGTCATGGCGAAGACCGAGTCACCGAGGACTAGCGGAGTGCTGAGCCAGCCCCACCTGCCCTTCTTCAGGTAG

XM_004865383.1 Coding sequence

Map2k7 mitogen-activated protein kinase kinase 7, transcript variant X4

High confidence: 4 potential gene matches
Length: 1260 bp    Location: 869435..878215   Strand: +
>XM_004865383.1
ATGGCGGCGTCCTCCCTGGAGCAAAAGCTGTCCCGCCTGGAAGCAAAGCTGAAGCAGGAGAACCGTGAGGCCCGGCGGAGGATCGACCTCAACCTGGATATCAGCCCCCAGCGGCCCAGGCCCACCCTGCAGCTCCCGCTGGCCAATGATGGGGGCAGCCGCTCACCGTCCTCAGAGAGCTCACCGCAGCACCCCACGCCCCCCGCCCGGCCCCGCCACATGCTGGGGCTCCCGTCCACCTTGTTCACGCCCCGCAGCATGGAGAGCATTGAGATCGACCAGAAGCTGCAGGAGATTATGAAGCAGACGGGCTACCTGACCATCGGGGGCCAGCGCTACCAGGCAGAGATCAATGACCTGGAGAACCTGGGTGAGATGGGCAGCGGCACCTGCGGCCAGGTGTGGAAGATGCGCTTCCGGAAGACGGGCCACGTCATCGCCGTCAAGCAAATGCGGCGCTCTGGGAACAAGGAGGAGAACAAGCGCATCCTCATGGACCTGGATGTGGTGCTCAAGAGCCACGACTGCCCGTACATCGTGCAGTGCTTCGGCACCTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCATGGGCACCTGCGCCGAGAAGCTGAAGAAGCGGATGCAGGGGCCCATCCCTGAGCGAATCCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGAAGCACGGCGTCATCCACCGCGATGTCAAGCCCTCCAACATCCTCCTGGACGAGCGGGGCCAGATCAAGCTCTGCGACTTCGGCATCAGTGGCCGCCTGGTGGACTCTAAGGCCAAGACGAGGAGTGCCGGCTGTGCGGCCTACATGGCGCCTGAGCGCATAGACCCCCCAGACCCCACCAAGCCCGACTATGACATCCGGGCCGACGTGTGGAGCCTGGGCATCTCGTTGGTGGAGCTGGCAACAGGACAGTTTCCCTATAAGAACTGCAAGACAGACTTCGAGGTCCTCACCAAAGTCCTCCAGGAAGAGCCCCCACTCCTGCCTGGTCACATGGGCTTCTCAGGGGACTTCCAGTCCTTCGTAAGAGACTGCCTTACTAAAGATCACAGGAAGAGACCAAAGTATAATAAGCTACTTGAACACAGCTTCATCAAGCGCTACGAGATGCTGGAAGTGGACGTGGCGTCCTGGTTCAAGGACGTCATGGCGAAGACCGAGTCACCGAGGACTAGCGGAGTGCTGAGCCAGCCCCACCTGCCCTTCTTCAGGTAG

XM_004865384.1 Coding sequence

Map2k7 mitogen-activated protein kinase kinase 7, transcript variant X5

Length: 1257 bp    Location: 869837..878215   Strand: +
>XM_004865384.1
ATGACCCTGTGGCCTCATGCTGACAGGAGGGAGACTGCACCTCCCCCATATCCAGTTATTGTGATCACTCTAAGCCCTGCTCCTGCCCCGTCCCAGCGAGCAGCCCTGCAGCTCCCGCTGGCCAATGATGGGGGCAGCCGCTCACCGTCCTCAGAGAGCTCACCGCAGCACCCCACGCCCCCCGCCCGGCCCCGCCACATGCTGGGGCTCCCGTCCACCTTGTTCACGCCCCGCAGCATGGAGAGCATTGAGATCGACCAGAAGCTGCAGGAGATTATGAAGCAGACGGGCTACCTGACCATCGGGGGCCAGCGCTACCAGGCAGAGATCAATGACCTGGAGAACCTGGGTGAGATGGGCAGCGGCACCTGCGGCCAGGTGTGGAAGATGCGCTTCCGGAAGACGGGCCACGTCATCGCCGTCAAGCAAATGCGGCGCTCTGGGAACAAGGAGGAGAACAAGCGCATCCTCATGGACCTGGATGTGGTGCTCAAGAGCCACGACTGCCCGTACATCGTGCAGTGCTTCGGCACCTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCATGGGCACCTGCGCCGAGAAGCTGAAGAAGCGGATGCAGGGGCCCATCCCTGAGCGAATCCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGAAGCACGGCGTCATCCACCGCGATGTCAAGCCCTCCAACATCCTCCTGGACGAGCGGGGCCAGATCAAGCTCTGCGACTTCGGCATCAGTGGCCGCCTGGTGGACTCTAAGGCCAAGACGAGGAGTGCCGGCTGTGCGGCCTACATGGCGCCTGAGCGCATAGACCCCCCAGACCCCACCAAGCCCGACTATGACATCCGGGCCGACGTGTGGAGCCTGGGCATCTCGTTGGTGGAGCTGGCAACAGGACAGTTTCCCTATAAGAACTGCAAGACAGACTTCGAGGTCCTCACCAAAGTCCTCCAGGAAGAGCCCCCACTCCTGCCTGGTCACATGGGCTTCTCAGGGGACTTCCAGTCCTTCGTAAGAGACTGCCTTACTAAAGATCACAGGAAGAGACCAAAGTATAATAAGCTACTTCCCCCCTCGGGCCCACAGGAACACAGCTTCATCAAGCGCTACGAGATGCTGGAAGTGGACGTGGCGTCCTGGTTCAAGGACGTCATGGCGAAGACCGAGTCACCGAGGACTAGCGGAGTGCTGAGCCAGCCCCACCTGCCCTTCTTCAGGTAG

XM_004865379.1 Coding sequence

Tgfbr3l transforming growth factor, beta receptor III-like

Length: 867 bp    Location: 878638..882170   Strand: +
>XM_004865379.1
ATGCTGGGTGCCGTGTTCCTGCTGCTCCTGCTGCCTGGGACCTCCGCCCTGCCCGATGGGCCCCTTGCGACCCCCTTCCCCGGGGCACCTGGGCCCTGGCTTCGTAGACCCCTGTTTCGGCTGGAGCTGTCGGACGCGGAGGACGCCTTCCCGCGCCGTGGGGGGCCGCTGGAGGTGCCCGCGGACAGCCGGGTGTTCGTGCAGGTGGCCCTGGCCCGGCCCTCCCCGCGCTGGGGCCTGGCCCTGCACCGCTGCTCTGTGACACCGTCCTCGCGCCCGGCGCCCGGGCCTGCCCTGGTGCTGCTGCGCGGAGGCTGCCCCGCTGACGCCTCGGTCACCTTCCCGCCACCGCCGCCAACCCCGGACGCCGCCCGCCCCGCGCGCTTCAGCTTCCGCCTGCGCCCGGTCTTCAACGCATCGGTGCAGTTCCTGCATTGCCAGCTGAGCCGCTGCCGACGCCCACCTGGAGCCCGCCGGAGGCCCCCGCCCCTGACCCCGCCGCCGCCGTCGCGGTGTTCGCCTCCGGCCCAGGCGAGCGCGGGCAGCGGCAACGGGGAGAGCCTCTGCGCCGACAGCCCCCACCTGCACACGCTGACGCAGCCCATCGTGGTCACGGTGCCGCAGCCGCCCCCCAGGCCACCCAAGAGCCTCCCCGGCAAGGGATTGCGCCCCGAGCAGCCCGCGCCCGCGCCCGCTCCCGCGGCCCTGGAGCCCGCACCCGTAGTGGCGCTGGTGCTGGCGGCCTTCTTGCTGGGTGCTGCGCTGGCCACCGGGCTCGGCCTTGTGTGCGCGCACTCAGCGCCCCCGCCCTCCAGCCGGCCGGCCAAGACCTCGTCCAGCGGCCCCCAGACTCGCAGACCCCATTGA

XM_004865386.1 Coding sequence

Snapc2 small nuclear RNA activating complex, polypeptide 2, 45kDa, transcript variant X2

Length: 1047 bp    Location: 882823..885866   Strand: +
>XM_004865386.1
ATGAAGCCACCGCAGCGGCGGCGGTCGGCTCCCGCCCGCTATCTGGGCGAGGTGACCGGCCCTGTGCCCTGGAGCCTTCGCGAGAAGCGCCAACTACTGCGACTACTGCAGGCGCGGCGGGACCAGCCGGAGCCAGACGCCGCTGAGCTGGCCAGGGAGCTGTGGAGCCGGAGCGAGGCGGAGATCCGCGACTTCCTCCAGCACCTCAAAGGCCGAGCGGTCCGAGAGGCCGTTCAGAGGGTGCATCCTGCTGGCCCTCTGGGTCCAAGGCGCCGACAGGCGCAGATCCTGGCCCCCATAGAGGTGTGGACGGATCTAGCTGAGAAGATAACAGGCCCGCTGGAGGACGCCCTGACGGCGGCCTTCTCCCAGGTTTTCACCATTGCAGCCACAGAACCCCTCAGCCTCCTGCACTCCACGCCCCCGAAGCCTACGAAAGCCCGTGGAAAGCCACTGCTCCTCAGCGCCATCAGAAGGCAGGAGGATCGCAGCCCTGTGGCCTCTGGTCCTGCCCTCGAGGCCCCTGGCCCCGCCCCCGTGGCCTCTGGTCCCGCCCCTGGTGTGCCTGACCTTGCCTCTGGCCCCACCCCTGAGGCACCTGCTGAGTCCCTGGCGGGCCCCTCCCCTGAAGACCTCACCTTTGACTTCGAGAAGATCTACAGGTACCTGTCTTTCTCCTCCCGGAGTGGCCACGGCCCAGAGCTCTCAGCAGCGGAGTCAGCTGTGGTCCTTGACCTGCTCCTGTCACTTCCCAAGGAGCTGCCTCACCTGCCCTGCACGGCCTTGGTGGAGCACATGACCAAAACCTATGCCCACCTGACGGCCCCAGAGCCCAGCCCCTCGGGTGGGAGCCCTGGGCCTGGAGCTGAGGATGGGAGGACTGGTTCCAGGGTGCTGGGAGAGCCTGGCTGGGTCCCGCCCAGAGTCCCTGAGCAGAATGGGGCCAGCAAACTGAGATCAGCCTGGCGAGCAGCCGGCGTCTGCCCTCTGAACCCGTTTCTGGTGCCCCTGGAGCTCCTGGGCCAGGAGGCCACCCTGGCAAGGTGA

XM_004865387.1 Coding sequence

Snapc2 small nuclear RNA activating complex, polypeptide 2, 45kDa, transcript variant X3

Length: 981 bp    Location: 883669..885866   Strand: +
>XM_004865387.1
ATGAGAGGAAATGGGCGGAGTGGAAACGAACAGATCCGCGACTTCCTCCAGCACCTCAAAGGCCGAGCGGTCCGAGAGGCCGTTCAGAGGGTGCATCCTGCTGGCCCTCTGGGTCCAAGGCGCCGACAGGCGCAGATCCTGGCCCCCATAGAGGTGTGGACGGATCTAGCTGAGAAGATAACAGGCCCGCTGGAGGACGCCCTGACGGCGGCCTTCTCCCAGGTTTTCACCATTGCAGCCACAGAACCCCTCAGCCTCCTGCACTCCACGCCCCCGAAGCCTACGAAAGCCCGTGGAAAGCCACTGCTCCTCAGCGCCATCAGAAGGCAGGAGGATCGCAGCCCTGTGGCCTCTGGTCCTGCCCTCGAGGCCCCTGGCCCCGCCCCCGTGGCCTCTGGTCCCGCCCCTGGTGTGCCTGACCTTGTCCCTGGCCCGGAGCCTATTATTTCTGGCCCTGCCCCTGTGGCCTCTGGTTCTGCCCTTTGTCTCTCTGGCCCCGCCCCCAAGGCCTCTGGCCCCACCCCTGAGGCACCTGCTGAGTCCCTGGCGGGCCCCTCCCCTGAAGACCTCACCTTTGACTTCGAGAAGATCTACAGGTACCTGTCTTTCTCCTCCCGGAGTGGCCACGGCCCAGAGCTCTCAGCAGCGGAGTCAGCTGTGGTCCTTGACCTGCTCCTGTCACTTCCCAAGGAGCTGCCTCACCTGCCCTGCACGGCCTTGGTGGAGCACATGACCAAAACCTATGCCCACCTGACGGCCCCAGAGCCCAGCCCCTCGGGTGGGAGCCCTGGGCCTGGAGCTGAGGATGGGAGGACTGGTTCCAGGGTGCTGGGAGAGCCTGGCTGGGTCCCGCCCAGAGTCCCTGAGCAGAATGGGGCCAGCAAACTGAGATCAGCCTGGCGAGCAGCCGGCGTCTGCCCTCTGAACCCGTTTCTGGTGCCCCTGGAGCTCCTGGGCCAGGAGGCCACCCTGGCAAGGTGA

XM_004865392.1 Coding sequence

Elavl1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R), transcript variant X2

High confidence: 3 potential gene matches
Length: 891 bp    Location: 948826..913963   Strand: -
>XM_004865392.1
ATGTCTAATGGTTATGAAGACCACATGGCTGAAGACTGCAGGGATGACATTGGGAGAACGAATCTAATTGTCAACTACCTCCCTCAGAACATGACGCAGGATGAGCTACGCAGTCTGTTCAGCAGCATTGGTGAAGTCGAGTCGGCAAAGCTAATCCGGGATAAAGTAGCAGGACACAGCTTGGGCTATGGCTTCGTGAACTATGTGACTGCAAAGGATGCAGAGAGAGCGATCAACACACTTAACGGCCTGAGGCTCCAGTCCAAAACCATTAAGGTGTCGTATGCACGCCCAAGCTCAGAAGTCATCAAAGACGCCAACTTGTACATCAGTGGGCTCCCGAGGACCATGACCCAGAAGGACGTGGAGGACATGTTCTCTCGGTTCGGGCGCATCATCAACTCCCGGGTCCTTGTGGATCAGACCACAGGTTCCTCCGAGCCCATCACAGTGAAGTTCGCAGCCAACCCCAACCAGAACAAAAACGTGGCGCTCCTTTCGCAGCTGTACCACTCGCCTGCGCGGCGCTTCGGAGGCCCCGTGCACCACCAGGCGCAGAGGTTCAGGTTCTCCCCCATGGGTGTAGATCACATGAGTGGGCTTTCTGGTGTCAATGTCCCAGGAAACGCGTCTTCAGGCTGGTGCATCTTCATCTACAACCTCGGGCAAGATGCTGACGAGGGGATCCTCTGGCAGATGTTTGGCCCCTTTGGCGCTGTCACCAATGTGAAAGTGATTCGTGATTTCAACACCAACAAGTGCAAAGGGTTTGGTTTTGTGACCATGACAAACTATGAAGAAGCCGCAATGGCCATAGCAAGTCTGAATGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAA

XM_004865391.1 Coding sequence

Elavl1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R), transcript variant X1

Length: 981 bp    Location: 948819..913963   Strand: -
>XM_004865391.1
ATGTCTAATGGTTATGAAGACCACATGGCTGAAGACTGCAGGGATGACATTGGGAGAACGAATCTAATTGTCAACTACCTCCCTCAGAACATGACGCAGGATGAGCTACGCAGTCTGTTCAGCAGCATTGGTGAAGTCGAGTCGGCAAAGCTAATCCGGGATAAAGTAGCAGGACACAGCTTGGGCTATGGCTTCGTGAACTATGTGACTGCAAAGGATGCAGAGAGAGCGATCAACACACTTAACGGCCTGAGGCTCCAGTCCAAAACCATTAAGGTGTCGTATGCACGCCCAAGCTCAGAAGTCATCAAAGACGCCAACTTGTACATCAGTGGGCTCCCGAGGACCATGACCCAGAAGGACGTGGAGGACATGTTCTCTCGGTTCGGGCGCATCATCAACTCCCGGGTCCTTGTGGATCAGACCACAGGTTTGTCCAGAGGGGTTGCGTTTATCCGGTTTGACAAACGGTCAGAAGCAGAAGAGGCAATTACCAGTTTCAATGGTCATAAACCCCCAGGTTCCTCCGAGCCCATCACAGTGAAGTTCGCAGCCAACCCCAACCAGAACAAAAACGTGGCGCTCCTTTCGCAGCTGTACCACTCGCCTGCGCGGCGCTTCGGAGGCCCCGTGCACCACCAGGCGCAGAGGTTCAGGTTCTCCCCCATGGGTGTAGATCACATGAGTGGGCTTTCTGGTGTCAATGTCCCAGGAAACGCGTCTTCAGGCTGGTGCATCTTCATCTACAACCTCGGGCAAGATGCTGACGAGGGGATCCTCTGGCAGATGTTTGGCCCCTTTGGCGCTGTCACCAATGTGAAAGTGATTCGTGATTTCAACACCAACAAGTGCAAAGGGTTTGGTTTTGTGACCATGACAAACTATGAAGAAGCCGCAATGGCCATAGCAAGTCTGAATGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAA

XM_004865394.1 Coding sequence

Cers4 ceramide synthase 4, transcript variant X1

Length: 1182 bp    Location: 1074925..1092497   Strand: +
>XM_004865394.1
ATGCTGTCAGCCCTGAACAACTTGGTGTGGCACGAGAGGATCTGGCTACCACCCAGCAAGACATGGACAGACATGGAAGACCAGGACGGCATGGTCCTGGCCCACCCCCGGGACATACTAGTGGCCCTGCCCCTGATACTGATGCTGGTGACAGCACGCCTCGCCTTCGACAGATTCATAGGCATGCCCGCGTCCCGCTGGCTGGGCATGCGGGATCCCACCAGGAAGCAGGTGAAGCCCAACCCCACGCTGGAGAAATACTTCCTCCAGAAAGGACAGAAACCCGAAGAGGCCCAAGTGGCCCTCCTGGCTGCCCAGTGTGGCCTCACGCTGCAACAGACTCAACACTGGTTCCGGAGACGCCGGAACCAGGATCGGCCCCACATGTCCAAGAAGTTCTGTGAGGCCAGCTGGAGGTTTCTCTTCTACCTCAGCACCTCCATTAGTGGCATCTTGGTCCTGTACCCTGAGCCGTGGCTGTGGGACGTGGCAGAGTCCTGGAGAAATTACCCAAGCCAGCACCTGAAACCAGCCCTGTCCTGGTGGTACCTCACGGAGCTGAGTTACTACAGCTCGCTGCTCCTCAGGCTGCCCTTCGACGTCAAGCGCAAGGATTTCAAGGAGCAGGTGATGCACCATTTCGTGGCTGTCTTCCTGATCTTCTTCTCCTACGGCGCGAACCTGGTGCGCATCGGGTCTCTGGTCTTGCTGCTGCACGACTTCGGCGACTGCCTGCTGGAGGCCTGCAAGGTGCTCAACTACATGCGCCTCTCGCTAACGTGCGACATCTTGTTCTTCATCTTCGCCTCGGTCTTCTTCTACACCCGCCTCATCCTGATGCCCACCACGATCATCTACTCTGTGTACTATGACTCCATGAAGCAGTTCACCCCCTTCTTTGGCTACTACTTCTTCCTCACCCTTCTGGTGTCACTCAACATGCTGCACGTGTACTGGTTCAGCCTCATCCTGCGCATGCTCTACAACTACCTGGTGAAGGGTCAGATGACAAAGGACATTCGCAGTGATAGCGAAGAGTCCAGCTCCAGCACTGACGAGGCAGCGCCTGGGCATCCCCAGCTGAAGAATGGGATGGCTTGCAGGCCTGGGCCGGCCCTGGCTGGCAGCCGCCGGAGCCGGGCAAAAGGGCAGCTGGCCAATGGGCACACAGCCGCCACTTAG

XM_004865398.1 Coding sequence

Rps28 ribosomal protein S28

Length: 210 bp    Location: 1116098..1116908   Strand: +
>XM_004865398.1
ATGGACACGAGTCGCGTGCAGCCTATTAAGCTTGCTAGGGTCACCAAAGTGCTAGGCAGGACCGGCTCGCAGGGACAGTGCACACAGGTGCGCGTGGAATTCATGGACGACACGAGCCGCTCCATCATCCGCAACGTGAAAGGCCCCGTGCGCGAGGGCGACGTGCTCACCCTGTTAGAATCAGAGCGGGAAGCCCGGAGGTTACGCTGA

XM_004865403.1 Coding sequence

Kank3 KN motif and ankyrin repeat domains 3, transcript variant X5

Length: 2550 bp    Location: 1129851..1117071   Strand: -
>XM_004865403.1
ATGGCCAAGTTCGCCCTGAACCAGAATCTGCCTGATTTGGGCGGCCCTCGCCTGTGCCCCGGCCCGATCGGGGGCGCGCGGAGCCTGAGCTCGCCTTACTCCGTGGAGACGCCCTACGGCTTCCACCTGGACCTGGACTTCCTCAAGTACGTGGAGGAGCTGGAGCGCGGTGGGCCCGCCGCCCGCAGAGCCCCCGGACCCCCGACCGCGCGCCGCACCCGCGCGCCCCGCCCGGGCCTCGAGGGCGCTCGCAGCCCAGGCGCCTGGGCATCCAGTGAGTCCCTGGCCAGCGATGACGGCGGAACTCCGGGCGCGCTCTCCCCCGGGGCGCTCCCGGGGCTCCAGTTGCCACCGCTGTCGCCACGCGCACTCGTGCGCAATGTGCGCGTGGAGAACACGCTGCTGGAGACGAGCCGTCGGCTGGAGCTGGCACAGGCGCAGGAGCGCGCGCTCAGCCCTGCCCGCGTGGAGCCGCGCAGTCCACGGGGGTCCGGCCGCAACAGCCCCGCCCCCGCCTCGCCCGGCCCAGCGCAGCTGCAGCTGGTGCGCGAGCAGATGGCCGCGGCGCTGCGGCGCCTGCGCGAGCTCGAGGACCAGGCGCGCGCGCTGCCCGAGCTGCAGGAGCAGGTGCGCGTACTGCGCGCTGAGAAGGCGTGGCTGCTGGCCGGGCGCGCGCTGGCGGAGCCCGACGGGGAGGCCGAGGCGCGCCCGGACAAGCTCGCCCAGCTGCGGCGGCTCACCGAGCGCTTGGCCACCTCCACCTCGGAGCGCGGCGTCCGCTGCAAGGCCAGCCCCCGCGCTGAAGGCCCAGATGGGCCGGCTGCAGCGCGCAGCGAGGGCGCACGCCAGGTCCTCGAGGGGGCAGCCGGGACTCCTGGGACCCCCGACGACGGGTCGCCCCAGACCCGGGAGGTGGGCATCGAGGTTGTGCTCGAGACCCGAGAGGCGGGTGCCCAGGCAGCGCCGGAAACCCGGGAGGCCGGCGTGGAGGCGGCCCCTGAGACCGTGGAGGCGGACGCGTGGGTGAGCGAGGCGCTGCTCGGGGTGCCCGCCGCTGCCGAGCGCGAGCTGGAGCTGCTTCGCGCCGGCCTGGAGCACCAGCGCGGGGTGAGCGAGCTGCTGCGCGGGCGGCTGCGGGAGCTGGGGGAGGCCCGCAAGGCTGCCCAGGACGAGGCCAGGGAGCCCAGGGCCCCGCCGTGCAGTGCCGCCACTCAGACCCCTTGGGGCTGTGCGGAGAAGACCACGCAGACTGAGCTCCCTGCGGAGGCCCCTCCTGGGGACAGGGCCGTGGCCCCGGCGGGCACCCTCAAGTCCATCATGAAGAAGAGAAACGGCACCGCTGGCGCCCAGCCCAGCCCGGGACCCAAGAGCCTGCAGTTTGTCGGAGTCATCAACGCAGAGTATGAGAGCTCGTCCAGCGAGGACGACAGCGACAGCAACGACAGCCAAGACGGCGCCCCGAAGCGTCCGAGGAGCAGCTCTTCCGGCTCCGGGGACGACAGCGGCGGGGACGTCGGGGACCCGGAGGCAAAGGCGGAAGCAGAGCCTCAGCCCGGGACCCAGGGGAGGCAAGAGGCGCCCGTGGTCGGGAGTGGGGGCGGCTGGGTGTCTCGGGGTCCCCCTGAGGCTCGCCTGGCTCCTCTCAGGTACGAGCTGAGCCCGCGGTTGCGCGAGGCGTGCGCCGCGCTGCTGAGACAGCTGAGCCGGCCCCGCGGAATGGCCCGCGACAGCAACGCGGCGCGCCTGGTGGCCCAGGAGTGGTTCCGGGTGTCCAGCCAGCGGCGCTCCCAGGCCGAGCTGGTGGCGGGGGTGCTGCGTGGGTTGGCGCGCCTGGGACCCCCGCTGCTGACGCACGTGGTGAACCTGGCGGATGACAACGGGAACACGGCCCTGCACTACAGTGTGTCCCATGGGAACCTGGGCATCTCGAGCCTGCTGCTGGACACGGGGGTCTGTGAGGTCAGCTGCCAGAACCGCGCCGGCTACTCAGCACTCATGCTGGCTGCACTCACGTCTGTGGGGCTGGAGGACATGGTTGTGGTCCGGAGGCTCTTTAGAATGGGTGATGTCAACGCGAAGGCCAGCCAGACTGGACAAACGGCCCTCATGCTGGCCATCAGCCACGGCCGGGAGGATATGGTAATGGCCCTGCTGGAGTGCGGGGCTGATGTGAATGCACAAGACTCGGAAGGGGCCACGGCGCTCATGTGTGCCAGCGAGTATGGACGCCTGGACACCGTCCGGTTGCTGCTGGCCCAGCCAGGCTGTGACCCTGCCATCCTGGACAATGTGAGCCAGGACCCTGGGGCTGGTGTAGGGGAGGGGGTGCCCATGCTGTTCAGAGACCTGATGCCTGCCATTCCTCAGGAGGGCACCAGTGCCCTGGCCATCGCCTTAGAGGCGGAGCAGGACGAAGTGGCCGGTCTGCTGCATGCCCACCTGAGCTCCAACCAGCCTGGTTCCCAGAGCCAGTCACCCTCAGACTCTCCTGCAGCCACACCCGGTGAAGGAGGGTGCAGTGACATCAGACAGGACCCCCAGCCTCAGTGA

XM_004865402.1 Coding sequence

Kank3 KN motif and ankyrin repeat domains 3, transcript variant X4

Length: 2550 bp    Location: 1129431..1117071   Strand: -
>XM_004865402.1
ATGGCCAAGTTCGCCCTGAACCAGAATCTGCCTGATTTGGGCGGCCCTCGCCTGTGCCCCGGCCCGATCGGGGGCGCGCGGAGCCTGAGCTCGCCTTACTCCGTGGAGACGCCCTACGGCTTCCACCTGGACCTGGACTTCCTCAAGTACGTGGAGGAGCTGGAGCGCGGTGGGCCCGCCGCCCGCAGAGCCCCCGGACCCCCGACCGCGCGCCGCACCCGCGCGCCCCGCCCGGGCCTCGAGGGCGCTCGCAGCCCAGGCGCCTGGGCATCCAGTGAGTCCCTGGCCAGCGATGACGGCGGAACTCCGGGCGCGCTCTCCCCCGGGGCGCTCCCGGGGCTCCAGTTGCCACCGCTGTCGCCACGCGCACTCGTGCGCAATGTGCGCGTGGAGAACACGCTGCTGGAGACGAGCCGTCGGCTGGAGCTGGCACAGGCGCAGGAGCGCGCGCTCAGCCCTGCCCGCGTGGAGCCGCGCAGTCCACGGGGGTCCGGCCGCAACAGCCCCGCCCCCGCCTCGCCCGGCCCAGCGCAGCTGCAGCTGGTGCGCGAGCAGATGGCCGCGGCGCTGCGGCGCCTGCGCGAGCTCGAGGACCAGGCGCGCGCGCTGCCCGAGCTGCAGGAGCAGGTGCGCGTACTGCGCGCTGAGAAGGCGTGGCTGCTGGCCGGGCGCGCGCTGGCGGAGCCCGACGGGGAGGCCGAGGCGCGCCCGGACAAGCTCGCCCAGCTGCGGCGGCTCACCGAGCGCTTGGCCACCTCCACCTCGGAGCGCGGCGTCCGCTGCAAGGCCAGCCCCCGCGCTGAAGGCCCAGATGGGCCGGCTGCAGCGCGCAGCGAGGGCGCACGCCAGGTCCTCGAGGGGGCAGCCGGGACTCCTGGGACCCCCGACGACGGGTCGCCCCAGACCCGGGAGGTGGGCATCGAGGTTGTGCTCGAGACCCGAGAGGCGGGTGCCCAGGCAGCGCCGGAAACCCGGGAGGCCGGCGTGGAGGCGGCCCCTGAGACCGTGGAGGCGGACGCGTGGGTGAGCGAGGCGCTGCTCGGGGTGCCCGCCGCTGCCGAGCGCGAGCTGGAGCTGCTTCGCGCCGGCCTGGAGCACCAGCGCGGGGTGAGCGAGCTGCTGCGCGGGCGGCTGCGGGAGCTGGGGGAGGCCCGCAAGGCTGCCCAGGACGAGGCCAGGGAGCCCAGGGCCCCGCCGTGCAGTGCCGCCACTCAGACCCCTTGGGGCTGTGCGGAGAAGACCACGCAGACTGAGCTCCCTGCGGAGGCCCCTCCTGGGGACAGGGCCGTGGCCCCGGCGGGCACCCTCAAGTCCATCATGAAGAAGAGAAACGGCACCGCTGGCGCCCAGCCCAGCCCGGGACCCAAGAGCCTGCAGTTTGTCGGAGTCATCAACGCAGAGTATGAGAGCTCGTCCAGCGAGGACGACAGCGACAGCAACGACAGCCAAGACGGCGCCCCGAAGCGTCCGAGGAGCAGCTCTTCCGGCTCCGGGGACGACAGCGGCGGGGACGTCGGGGACCCGGAGGCAAAGGCGGAAGCAGAGCCTCAGCCCGGGACCCAGGGGAGGCAAGAGGCGCCCGTGGTCGGGAGTGGGGGCGGCTGGGTGTCTCGGGGTCCCCCTGAGGCTCGCCTGGCTCCTCTCAGGTACGAGCTGAGCCCGCGGTTGCGCGAGGCGTGCGCCGCGCTGCTGAGACAGCTGAGCCGGCCCCGCGGAATGGCCCGCGACAGCAACGCGGCGCGCCTGGTGGCCCAGGAGTGGTTCCGGGTGTCCAGCCAGCGGCGCTCCCAGGCCGAGCTGGTGGCGGGGGTGCTGCGTGGGTTGGCGCGCCTGGGACCCCCGCTGCTGACGCACGTGGTGAACCTGGCGGATGACAACGGGAACACGGCCCTGCACTACAGTGTGTCCCATGGGAACCTGGGCATCTCGAGCCTGCTGCTGGACACGGGGGTCTGTGAGGTCAGCTGCCAGAACCGCGCCGGCTACTCAGCACTCATGCTGGCTGCACTCACGTCTGTGGGGCTGGAGGACATGGTTGTGGTCCGGAGGCTCTTTAGAATGGGTGATGTCAACGCGAAGGCCAGCCAGACTGGACAAACGGCCCTCATGCTGGCCATCAGCCACGGCCGGGAGGATATGGTAATGGCCCTGCTGGAGTGCGGGGCTGATGTGAATGCACAAGACTCGGAAGGGGCCACGGCGCTCATGTGTGCCAGCGAGTATGGACGCCTGGACACCGTCCGGTTGCTGCTGGCCCAGCCAGGCTGTGACCCTGCCATCCTGGACAATGTGAGCCAGGACCCTGGGGCTGGTGTAGGGGAGGGGGTGCCCATGCTGTTCAGAGACCTGATGCCTGCCATTCCTCAGGAGGGCACCAGTGCCCTGGCCATCGCCTTAGAGGCGGAGCAGGACGAAGTGGCCGGTCTGCTGCATGCCCACCTGAGCTCCAACCAGCCTGGTTCCCAGAGCCAGTCACCCTCAGACTCTCCTGCAGCCACACCCGGTGAAGGAGGGTGCAGTGACATCAGACAGGACCCCCAGCCTCAGTGA

XM_004865404.1 Coding sequence

Kank3 KN motif and ankyrin repeat domains 3, transcript variant X6

High confidence: 4 potential gene matches
Length: 2481 bp    Location: 1125738..1117071   Strand: -
>XM_004865404.1
ATGGCTGGGCAGCAGGACGGACAGGGACCCTGCCGTCACCTCTCTGAGGTCTTTTGCAGGGTGAGTATAGCGGCTACTTCAGGAAACATGGCCAAGTTCGCCCTGAACCAGAATCTGCCTGATTTGGGCGGCCCTCGCCTGTGCCCCGGCCCGATCGGGGGCGCGCGGAGCCTGAGCTCGCCTTACTCCGTGGAGACGCCCTACGGCTTCCACCTGGACCTGGACTTCCTCAAGTACGTGGAGGAGCTGGAGCGCGGTGGGCCCGCCGCCCGCAGAGCCCCCGGACCCCCGACCGCGCGCCGCACCCGCGCGCCCCGCCCGGGCCTCGAGGGCGCTCGCAGCCCAGGCGCCTGGGCATCCAGTGAGTCCCTGGCCAGCGATGACGGCGGAACTCCGGGCGCGCTCTCCCCCGGGGCGCTCCCGGGGCTCCAGTTGCCACCGCTGTCGCCACGCGCACTCGTGCGCAATGTGCGCGTGGAGAACACGCTGCTGGAGACGAGCCGTCGGCTGGAGCTGGCACAGGCGCAGGAGCGCGCGCTCAGCCCTGCCCGCGTGGAGCCGCGCAGTCCACGGGGGTCCGGCCGCAACAGCCCCGCCCCCGCCTCGCCCGGCCCAGCGCAGCTGCAGCTGGTGCGCGAGCAGATGGCCGCGGCGCTGCGGCGCCTGCGCGAGCTCGAGGACCAGGCGCGCGCGCTGCCCGAGCTGCAGGAGCAGGTGCGCGTACTGCGCGCTGAGAAGGCGTGGCTGCTGGCCGGGCGCGCGCTGGCGGAGCCCGACGGGGAGGCCGAGGCGCGCCCGGACAAGCTCGCCCAGCTGCGGCGGCTCACCGAGCGCTTGGCCACCTCCACCTCGGAGCGCGGCGTCCGCTGCAAGGCCAGCCCCCGCGCTGAAGGCCCAGATGGGCCGGCTGCAGCGCGCAGCGAGGGCGCACGCCAGGTCCTCGAGGGGGCAGCCGGGACTCCTGGGACCCCCGACGACGGGTCGCCCCAGACCCGGGAGGTGGGCATCGAGGTTGTGCTCGAGACCCGAGAGGCGGGTGCCCAGGCAGCGCCGGAAACCCGGGAGGCCGGCGTGGAGGCGGCCCCTGAGACCGTGGAGGCGGACGCGTGGGTGAGCGAGGCGCTGCTCGGGGTGCCCGCCGCTGCCGAGCGCGAGCTGGAGCTGCTTCGCGCCGGCCTGGAGCACCAGCGCGGGGTGAGCGAGCTGCTGCGCGGGCGGCTGCGGGAGCTGGGGGAGGCCCGCAAGGCTGCCCAGGACGAGGCCAGGGAGCCCAGGGCCCCGCCGTGCAGTGCCGCCACTCAGACCCCTTGGGGCTGTGCGGAGAAGACCACGCAGACTGAGCTCCCTGCGGAGGCCCCTCCTGGGGACAGGGCCGTGGCCCCGGCGGGCACCCTCAAGTCCATCATGAAGAAGAGAAACGGCACCGCTGGCGCCCAGCCCAGCCCGGGACCCAAGAGCCTGCAGTTTGTCGGAGTCATCAACGCAGAGTATGAGAGCTCGTCCAGCGAGGACGACAGCGACAGCAACGACAGCCAAGACGGCGCCCCGAAGCGTCCGAGGAGCAGCTCTTCCGGCTCCGGGGACGACAGCGGCGGGGACGTCGGGGACCCGGAGGCAAAGGCGGAAGCAGAGCCTCAGCCCGGGACCCAGGGGAGGTACGAGCTGAGCCCGCGGTTGCGCGAGGCGTGCGCCGCGCTGCTGAGACAGCTGAGCCGGCCCCGCGGAATGGCCCGCGACAGCAACGCGGCGCGCCTGGTGGCCCAGGAGTGGTTCCGGGTGTCCAGCCAGCGGCGCTCCCAGGCCGAGCTGGTGGCGGGGGTGCTGCGTGGGTTGGCGCGCCTGGGACCCCCGCTGCTGACGCACGTGGTGAACCTGGCGGATGACAACGGGAACACGGCCCTGCACTACAGTGTGTCCCATGGGAACCTGGGCATCTCGAGCCTGCTGCTGGACACGGGGGTCTGTGAGGTCAGCTGCCAGAACCGCGCCGGCTACTCAGCACTCATGCTGGCTGCACTCACGTCTGTGGGGCTGGAGGACATGGTTGTGGTCCGGAGGCTCTTTAGAATGGGTGATGTCAACGCGAAGGCCAGCCAGACTGGACAAACGGCCCTCATGCTGGCCATCAGCCACGGCCGGGAGGATATGGTAATGGCCCTGCTGGAGTGCGGGGCTGATGTGAATGCACAAGACTCGGAAGGGGCCACGGCGCTCATGTGTGCCAGCGAGTATGGACGCCTGGACACCGTCCGGTTGCTGCTGGCCCAGCCAGGCTGTGACCCTGCCATCCTGGACAATGAGGGCACCAGTGCCCTGGCCATCGCCTTAGAGGCGGAGCAGGACGAAGTGGCCGGTCTGCTGCATGCCCACCTGAGCTCCAACCAGCCTGGTTCCCAGAGCCAGTCACCCTCAGACTCTCCTGCAGCCACACCCGGTGAAGGAGGGTGCAGTGACATCAGACAGGACCCCCAGCCTCAGTGA

XM_004865400.1 Coding sequence

Kank3 KN motif and ankyrin repeat domains 3, transcript variant X2

Length: 2559 bp    Location: 1125738..1117071   Strand: -
>XM_004865400.1
ATGGCTGGGCAGCAGGACGGACAGGGACCCTGCCGTCACCTCTCTGAGGTCTTTTGCAGGGTGAGTATAGCGGCTACTTCAGGAAACATGGCCAAGTTCGCCCTGAACCAGAATCTGCCTGATTTGGGCGGCCCTCGCCTGTGCCCCGGCCCGATCGGGGGCGCGCGGAGCCTGAGCTCGCCTTACTCCGTGGAGACGCCCTACGGCTTCCACCTGGACCTGGACTTCCTCAAGTACGTGGAGGAGCTGGAGCGCGGTGGGCCCGCCGCCCGCAGAGCCCCCGGACCCCCGACCGCGCGCCGCACCCGCGCGCCCCGCCCGGGCCTCGAGGGCGCTCGCAGCCCAGGCGCCTGGGCATCCAGTGAGTCCCTGGCCAGCGATGACGGCGGAACTCCGGGCGCGCTCTCCCCCGGGGCGCTCCCGGGGCTCCAGTTGCCACCGCTGTCGCCACGCGCACTCGTGCGCAATGTGCGCGTGGAGAACACGCTGCTGGAGACGAGCCGTCGGCTGGAGCTGGCACAGGCGCAGGAGCGCGCGCTCAGCCCTGCCCGCGTGGAGCCGCGCAGTCCACGGGGGTCCGGCCGCAACAGCCCCGCCCCCGCCTCGCCCGGCCCAGCGCAGCTGCAGCTGGTGCGCGAGCAGATGGCCGCGGCGCTGCGGCGCCTGCGCGAGCTCGAGGACCAGGCGCGCGCGCTGCCCGAGCTGCAGGAGCAGGTGCGCGTACTGCGCGCTGAGAAGGCGTGGCTGCTGGCCGGGCGCGCGCTGGCGGAGCCCGACGGGGAGGCCGAGGCGCGCCCGGACAAGCTCGCCCAGCTGCGGCGGCTCACCGAGCGCTTGGCCACCTCCACCTCGGAGCGCGGCGTCCGCTGCAAGGCCAGCCCCCGCGCTGAAGGCCCAGATGGGCCGGCTGCAGCGCGCAGCGAGGGCGCACGCCAGGTCCTCGAGGGGGCAGCCGGGACTCCTGGGACCCCCGACGACGGGTCGCCCCAGACCCGGGAGGTGGGCATCGAGGTTGTGCTCGAGACCCGAGAGGCGGGTGCCCAGGCAGCGCCGGAAACCCGGGAGGCCGGCGTGGAGGCGGCCCCTGAGACCGTGGAGGCGGACGCGTGGGTGAGCGAGGCGCTGCTCGGGGTGCCCGCCGCTGCCGAGCGCGAGCTGGAGCTGCTTCGCGCCGGCCTGGAGCACCAGCGCGGGGTGAGCGAGCTGCTGCGCGGGCGGCTGCGGGAGCTGGGGGAGGCCCGCAAGGCTGCCCAGGACGAGGCCAGGGAGCCCAGGGCCCCGCCGTGCAGTGCCGCCACTCAGACCCCTTGGGGCTGTGCGGAGAAGACCACGCAGACTGAGCTCCCTGCGGAGGCCCCTCCTGGGGACAGGGCCGTGGCCCCGGCGGGCACCCTCAAGTCCATCATGAAGAAGAGAAACGGCACCGCTGGCGCCCAGCCCAGCCCGGGACCCAAGAGCCTGCAGTTTGTCGGAGTCATCAACGCAGAGTATGAGAGCTCGTCCAGCGAGGACGACAGCGACAGCAACGACAGCCAAGACGGCGCCCCGAAGCGTCCGAGGAGCAGCTCTTCCGGCTCCGGGGACGACAGCGGCGGGGACGTCGGGGACCCGGAGGCAAAGGCGGAAGCAGAGCCTCAGCCCGGGACCCAGGGGAGGCAAGAGGCGCCCGTGGTCGGGAGTGGGGGCGGCTGGGTGTCTCGGGGTCCCCCTGAGGCTCGCCTGGCTCCTCTCAGGTACGAGCTGAGCCCGCGGTTGCGCGAGGCGTGCGCCGCGCTGCTGAGACAGCTGAGCCGGCCCCGCGGAATGGCCCGCGACAGCAACGCGGCGCGCCTGGTGGCCCAGGAGTGGTTCCGGGTGTCCAGCCAGCGGCGCTCCCAGGCCGAGCTGGTGGCGGGGGTGCTGCGTGGGTTGGCGCGCCTGGGACCCCCGCTGCTGACGCACGTGGTGAACCTGGCGGATGACAACGGGAACACGGCCCTGCACTACAGTGTGTCCCATGGGAACCTGGGCATCTCGAGCCTGCTGCTGGACACGGGGGTCTGTGAGGTCAGCTGCCAGAACCGCGCCGGCTACTCAGCACTCATGCTGGCTGCACTCACGTCTGTGGGGCTGGAGGACATGGTTGTGGTCCGGAGGCTCTTTAGAATGGGTGATGTCAACGCGAAGGCCAGCCAGACTGGACAAACGGCCCTCATGCTGGCCATCAGCCACGGCCGGGAGGATATGGTAATGGCCCTGCTGGAGTGCGGGGCTGATGTGAATGCACAAGACTCGGAAGGGGCCACGGCGCTCATGTGTGCCAGCGAGTATGGACGCCTGGACACCGTCCGGTTGCTGCTGGCCCAGCCAGGCTGTGACCCTGCCATCCTGGACAATGAGGGCACCAGTGCCCTGGCCATCGCCTTAGAGGCGGAGCAGGACGAAGTGGCCGGTCTGCTGCATGCCCACCTGAGCTCCAACCAGCCTGGTTCCCAGAGCCAGTCACCCTCAGACTCTCCTGCAGCCACACCCGGTGAAGGAGGGTGCAGTGACATCAGACAGGACCCCCAGCCTCAGTGA

XM_004865405.1 Coding sequence

Kank3 KN motif and ankyrin repeat domains 3, transcript variant X7

Length: 2115 bp    Location: 1125738..1118165   Strand: -
>XM_004865405.1
ATGGCTGGGCAGCAGGACGGACAGGGACCCTGCCGTCACCTCTCTGAGGTCTTTTGCAGGGTGAGTATAGCGGCTACTTCAGGAAACATGGCCAAGTTCGCCCTGAACCAGAATCTGCCTGATTTGGGCGGCCCTCGCCTGTGCCCCGGCCCGATCGGGGGCGCGCGGAGCCTGAGCTCGCCTTACTCCGTGGAGACGCCCTACGGCTTCCACCTGGACCTGGACTTCCTCAAGTACGTGGAGGAGCTGGAGCGCGGTGGGCCCGCCGCCCGCAGAGCCCCCGGACCCCCGACCGCGCGCCGCACCCGCGCGCCCCGCCCGGGCCTCGAGGGCGCTCGCAGCCCAGGCGCCTGGGCATCCAGTGAGTCCCTGGCCAGCGATGACGGCGGAACTCCGGGCGCGCTCTCCCCCGGGGCGCTCCCGGGGCTCCAGTTGCCACCGCTGTCGCCACGCGCACTCGTGCGCAATGTGCGCGTGGAGAACACGCTGCTGGAGACGAGCCGTCGGCTGGAGCTGGCACAGGCGCAGGAGCGCGCGCTCAGCCCTGCCCGCGTGGAGCCGCGCAGTCCACGGGGGTCCGGCCGCAACAGCCCCGCCCCCGCCTCGCCCGGCCCAGCGCAGCTGCAGCTGGTGCGCGAGCAGATGGCCGCGGCGCTGCGGCGCCTGCGCGAGCTCGAGGACCAGGCGCGCGCGCTGCCCGAGCTGCAGGAGCAGGTGCGCGTACTGCGCGCTGAGAAGGCGTGGCTGCTGGCCGGGCGCGCGCTGGCGGAGCCCGACGGGGAGGCCGAGGCGCGCCCGGACAAGCTCGCCCAGCTGCGGCGGCTCACCGAGCGCTTGGCCACCTCCACCTCGGAGCGCGGCGTCCGCTGCAAGGCCAGCCCCCGCGCTGAAGGCCCAGATGGGCCGGCTGCAGCGCGCAGCGAGGGCGCACGCCAGGTCCTCGAGGGGGCAGCCGGGACTCCTGGGACCCCCGACGACGGGTCGCCCCAGACCCGGGAGGTGGGCATCGAGGTTGTGCTCGAGACCCGAGAGGCGGGTGCCCAGGCAGCGCCGGAAACCCGGGAGGCCGGCGTGGAGGCGGCCCCTGAGACCGTGGAGGCGGACGCGTGGGTGAGCGAGGCGCTGCTCGGGGTGCCCGCCGCTGCCGAGCGCGAGCTGGAGCTGCTTCGCGCCGGCCTGGAGCACCAGCGCGGGGTGAGCGAGCTGCTGCGCGGGCGGCTGCGGGAGCTGGGGGAGGCCCGCAAGGCTGCCCAGGACGAGGCCAGGGAGCCCAGGGCCCCGCCGTGCAGTGCCGCCACTCAGACCCCTTGGGGCTGTGCGGAGAAGACCACGCAGACTGAGCTCCCTGCGGAGGCCCCTCCTGGGGACAGGGCCGTGGCCCCGGCGGGCACCCTCAAGTCCATCATGAAGAAGAGAAACGGCACCGCTGGCGCCCAGCCCAGCCCGGGACCCAAGAGCCTGCAGTTTGTCGGAGTCATCAACGCAGAGTATGAGAGCTCGTCCAGCGAGGACGACAGCGACAGCAACGACAGCCAAGACGGCGCCCCGAAGCGTCCGAGGAGCAGCTCTTCCGGCTCCGGGGACGACAGCGGCGGGGACGTCGGGGACCCGGAGGCAAAGGCGGAAGCAGAGCCTCAGCCCGGGACCCAGGGGAGGCAAGAGGCGCCCGTGGTCGGGAGTGGGGGCGGCTGGGTGTCTCGGGGTCCCCCTGAGGCTCGCCTGGCTCCTCTCAGGTACGAGCTGAGCCCGCGGTTGCGCGAGGCGTGCGCCGCGCTGCTGAGACAGCTGAGCCGGCCCCGCGGAATGGCCCGCGACAGCAACGCGGCGCGCCTGGTGGCCCAGGAGTGGTTCCGGGTGTCCAGCCAGCGGCGCTCCCAGGCCGAGCTGGTGGCGGGGGTGCTGCGTGGGTTGGCGCGCCTGGGACCCCCGCTGCTGACGCACGTGGTGAACCTGGCGGATGACAACGGGAACACGGCCCTGCACTACAGTGTGTCCCATGGGAACCTGGGCATCTCGAGCCTGCTGCTGGACACGGACTGGACAAACGGCCCTCATGCTGGCCATCAGCCACGGCCGGGAGGATATGGTAATGGCCCTGCTGGAGTGCGGGGCTGA

XM_004865407.1 Coding sequence

Angptl4 angiopoietin-like 4, transcript variant X2

Length: 1122 bp    Location: 1152776..1158861   Strand: +
>XM_004865407.1
ATGCGCTGCGCCCCGACGGCCAGCGCGGCCCTGGTGCTGTGCGCCGCCACCGCCGGGCTGCTGAGCGCCCAGGGCCGGCCTGCGACCCCCGAGCCGCCGCGCCCCGCTTCCTGGGACGAGGTGAACGTCCTGGCTCACGGGCTGCTGCAGCTCGGCCACGGGCTGCGCGAACACGTGGAGCGCACTCGCGGGCAGCTAGGCGCCCTGGAGCGGCGCCTGGCCGAATGCGGAGCCACGTGCCGGGGACCCGGGGAGCCCCCCGCGCCCTCCAGGGCCCCCGACAGCGCGGGCGCCGGCGGCCAGGAGGCGCTCGAGACCCTCCGCGACCTGCAGATGCAGCTCAAGGCTCAGAACGGCAGGATCGAGCAGCTGGTCCAGAAGGTGGCCGGGCAGCAGCGACACCTGGAGAAGCAGCGCCTGAGAATCCAGAATCTGCAGAGCCAGGTTGACCTCCTGGCTCCCCCGCACCTCGGCAGTGGGGTGTCGCAGCCTGACCGAAGAAAGAGGCTCCCCAAGATGGCCCAGCTTGGTGGCCTGGCTCCCAATGCTACCCGCCTGCACAATGGAGGCTGGACAGTGATTCAGAGGCGCCAGGACGGCTCCGTGGACTTCAATCAGCCCTGGGAAGCCTACAAGGCGGGCTTCGGGGACCCCCAAGGCGAGTTCTGGCTGGGCCTGGAGAAAATGCACCGCCTTGCGGGGGGCCGCGGCAGCCGCCTGGCCGTGCAGCTCCGGGACTGGGAGGGCTACGCCCAGTCGCTGCAGTTCCCGGTCCGCCTGGGCGGCGAGGACACGGACTACAGCCTGCAGCTCACGGCGCCCGTGGCCAGTGAGCTGGGCGCCGCCTCCACCGCGCCCAGCGGCCTCTCCCTACCCTTCTCCACGTGGGACCACGACCACGGCCTGCGCAGTGACCTCAAGTGTGCCAAGAGCCTCTCGGGTGGCTGGTGGTTTGGCACCTGTGGCCACTCCAACCTCAACGGCCAGTACTTCCGCTCTGTTCCCCGGCAGCGGCAGCAGCGGAAGAAGGGGATCTTCTGGAAGACCTGGCGGGGGCGCTACTACCCCCTGCAGTCCACTACCATGCTGATGCAGCCCTCAGAGGATGCCGCGGCCTCCTAG

XM_004865406.1 Coding sequence

Angptl4 angiopoietin-like 4, transcript variant X1

High confidence: 4 potential gene matches
Length: 1236 bp    Location: 1152778..1158861   Strand: +
>XM_004865406.1
ATGCGCTGCGCCCCGACGGCCAGCGCGGCCCTGGTGCTGTGCGCCGCCACCGCCGGGCTGCTGAGCGCCCAGGGCCGGCCTGCGACCCCCGAGCCGCCGCGCCCCGCTTCCTGGGACGAGGTGAACGTCCTGGCTCACGGGCTGCTGCAGCTCGGCCACGGGCTGCGCGAACACGTGGAGCGCACTCGCGGGCAGCTAGGCGCCCTGGAGCGGCGCCTGGCCGAATGCGGAGCCACGTGCCGGGGACCCGGGGAGCCCCCCGCGCCCTCCAGGGCCCCCGACAGCGCGGGCGCCGGCGGCCAGGAGGCGCTCGAGACCCTCCGCGACCTGCAGATGCAGCTCAAGGCTCAGAACGGCAGGATCGAGCAGCTGGTCCAGAAGGTGGCCGGGCAGCAGCGACACCTGGAGAAGCAGCGCCTGAGAATCCAGAATCTGCAGAGCCAGGTTGACCTCCTGGCTCCCCCGCACCTCGGCAGTGGGGTGTCGCAGCCTGACCGAAGAAAGAGGCTCCCCAAGATGGCCCAGCTTGGTGGCCTGGCTCCCAATGCTACCCGCCTGCACAGGCTGCCCCAGGACTGCCAGGAGCTCTTTGAGGAGGGCGAGCGGCAGAGTGGCCTGTTCCAGATCCAGCCTCAGGGGTCCCCACCGTTCCTGGTCACCTGCCAGATGGCCTCAGATGGAGGCTGGACAGTGATTCAGAGGCGCCAGGACGGCTCCGTGGACTTCAATCAGCCCTGGGAAGCCTACAAGGCGGGCTTCGGGGACCCCCAAGGCGAGTTCTGGCTGGGCCTGGAGAAAATGCACCGCCTTGCGGGGGGCCGCGGCAGCCGCCTGGCCGTGCAGCTCCGGGACTGGGAGGGCTACGCCCAGTCGCTGCAGTTCCCGGTCCGCCTGGGCGGCGAGGACACGGACTACAGCCTGCAGCTCACGGCGCCCGTGGCCAGTGAGCTGGGCGCCGCCTCCACCGCGCCCAGCGGCCTCTCCCTACCCTTCTCCACGTGGGACCACGACCACGGCCTGCGCAGTGACCTCAAGTGTGCCAAGAGCCTCTCGGGTGGCTGGTGGTTTGGCACCTGTGGCCACTCCAACCTCAACGGCCAGTACTTCCGCTCTGTTCCCCGGCAGCGGCAGCAGCGGAAGAAGGGGATCTTCTGGAAGACCTGGCGGGGGCGCTACTACCCCCTGCAGTCCACTACCATGCTGATGCAGCCCTCAGAGGATGCCGCGGCCTCCTAG

XM_004865408.1 Coding sequence

Angptl4 angiopoietin-like 4, transcript variant X3

Length: 1023 bp    Location: 1152784..1158861   Strand: +
>XM_004865408.1
ATGCGCTGCGCCCCGACGGCCAGCGCGGCCCTGGTGCTGTGCGCCGCCACCGCCGGGCTGCTGAGCGCCCAGGGCCGGCCTGCGACCCCCGAGCCGCCGCGCCCCGCTTCCTGGGACGAGATGCAGCTCAAGGCTCAGAACGGCAGGATCGAGCAGCTGGTCCAGAAGGTGGCCGGGCAGCAGCGACACCTGGAGAAGCAGCGCCTGAGAATCCAGAATCTGCAGAGCCAGGTTGACCTCCTGGCTCCCCCGCACCTCGGCAGTGGGGTGTCGCAGCCTGACCGAAGAAAGAGGCTCCCCAAGATGGCCCAGCTTGGTGGCCTGGCTCCCAATGCTACCCGCCTGCACAGGCTGCCCCAGGACTGCCAGGAGCTCTTTGAGGAGGGCGAGCGGCAGAGTGGCCTGTTCCAGATCCAGCCTCAGGGGTCCCCACCGTTCCTGGTCACCTGCCAGATGGCCTCAGATGGAGGCTGGACAGTGATTCAGAGGCGCCAGGACGGCTCCGTGGACTTCAATCAGCCCTGGGAAGCCTACAAGGCGGGCTTCGGGGACCCCCAAGGCGAGTTCTGGCTGGGCCTGGAGAAAATGCACCGCCTTGCGGGGGGCCGCGGCAGCCGCCTGGCCGTGCAGCTCCGGGACTGGGAGGGCTACGCCCAGTCGCTGCAGTTCCCGGTCCGCCTGGGCGGCGAGGACACGGACTACAGCCTGCAGCTCACGGCGCCCGTGGCCAGTGAGCTGGGCGCCGCCTCCACCGCGCCCAGCGGCCTCTCCCTACCCTTCTCCACGTGGGACCACGACCACGGCCTGCGCAGTGACCTCAAGTGTGCCAAGAGCCTCTCGGGTGGCTGGTGGTTTGGCACCTGTGGCCACTCCAACCTCAACGGCCAGTACTTCCGCTCTGTTCCCCGGCAGCGGCAGCAGCGGAAGAAGGGGATCTTCTGGAAGACCTGGCGGGGGCGCTACTACCCCCTGCAGTCCACTACCATGCTGATGCAGCCCTCAGAGGATGCCGCGGCCTCCTAG

XM_004865410.1 Coding sequence

March2 membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase, transcript variant X1

Length: 816 bp    Location: 1182357..1197327   Strand: +
>XM_004865410.1
ATGGTTAGGGCCGGAGGACGCAGGCTCCTGGGACCATGGGCCTTGGGCCCTGAGGACACAGGGTTCCCTGTGGCCATGACGACAGGCGACTGCTGCCACCTCCCAGGCTCCCTGTGCGACTGCTCAGGCAGCCCTGCTTTCTCCAAGGTCGTGGAGGCCACGGGCCTGGGGCCTCCGCAGTACGTGGCACAGGTAACTTCGAGGGACGGCCGGCTCCTCTCCACAGTCATCCGGGCCTTGGACACGCCGGGCGACTGTCCCTTCTGCCGGATCTGTCACGAGGGGGCCAATGGGGAGAGTCTGCTATCTCCGTGTGGCTGTACTGGCACGCTGGGTGCTGTGCACAAGAGCTGCCTGGAGAAGTGGCTGTCCTCGTCCAACACCAGCTACTGCGAGCTGTGCCATACGGAGTTTGCAGTGGAAAAGCGGCCCCGGCCTCTCACAGAGTGGCTGCGGGACCCAGGGCCACGCACGGAGAAGCGGACGCTGTGCTGCGACATGGTGTGCTTCCTGTTCATCACACCGCTGGCTGCTGTCTCGGGCTGGCTGTGCCTGCGTGGGGCCCAGGACCACCTTCGGCTGCACAGCCGGCTGGAGGCCGTGGGGCTGATTGCACTCACCATTGCCCTCTTCACCATCTACGTCCTCTGGACGCTGGTCTCTTTCCGGTACCACTGCCAGCTGTACTCTGAATGGAGAAGGACGAACCAGAAAGTCCGCCTGAAGATCCGGGCTGCTGATGGCTCCGAGGACACCCAGCACTCCCCGCTGGCAGCTGGACTCCTGAAAAAGGTGGCAGAGGAGACGCCTGTGTGA

XM_004865411.1 Coding sequence

March2 membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase, transcript variant X2

Length: 741 bp    Location: 1182609..1197323   Strand: +
>XM_004865411.1
ATGACGACAGGCGACTGCTGCCACCTCCCAGGCTCCCTGTGCGACTGCTCAGGCAGCCCTGCTTTCTCCAAGGTCGTGGAGGCCACGGGCCTGGGGCCTCCGCAGTACGTGGCACAGGTAACTTCGAGGGACGGCCGGCTCCTCTCCACAGTCATCCGGGCCTTGGACACGCCGGGCGACTGTCCCTTCTGCCGGATCTGTCACGAGGGGGCCAATGGGGAGAGTCTGCTATCTCCGTGTGGCTGTACTGGCACGCTGGGTGCTGTGCACAAGAGCTGCCTGGAGAAGTGGCTGTCCTCGTCCAACACCAGCTACTGCGAGCTGTGCCATACGGAGTTTGCAGTGGAAAAGCGGCCCCGGCCTCTCACAGAGTGGCTGCGGGACCCAGGGCCACGCACGGAGAAGCGGACGCTGTGCTGCGACATGGTGTGCTTCCTGTTCATCACACCGCTGGCTGCTGTCTCGGGCTGGCTGTGCCTGCGTGGGGCCCAGGACCACCTTCGGCTGCACAGCCGGCTGGAGGCCGTGGGGCTGATTGCACTCACCATTGCCCTCTTCACCATCTACGTCCTCTGGACGCTGGTCTCTTTCCGGTACCACTGCCAGCTGTACTCTGAATGGAGAAGGACGAACCAGAAAGTCCGCCTGAAGATCCGGGCTGCTGATGGCTCCGAGGACACCCAGCACTCCCCGCTGGCAGCTGGACTCCTGAAAAAGGTGGCAGAGGAGACGCCTGTGTGA

XM_004865414.1 Coding sequence

Znf414 zinc finger protein 414, transcript variant X1

Length: 1263 bp    Location: 1264665..1261428   Strand: -
>XM_004865414.1
ATGGAGGAGGAGGAACCCTCGCAGCCCAGTCCGGACATGCTGGCCCCTGCAGAGCCCAGCTCCAATGAGACCGAAAAGGAGGTGTTGTCTCCGGTTGTGGCTGCTTTTGCCACCTCCATGGAGGAGGAGCTTGGCCCTGACCGAGCAGCCACACCCCCGGTGTGGGAATGTGGAGGGCCTGGAGGGACACAGCAGGGTGCCTCCCAGGCCTCAGACAGCTGCCAGCCTGACCCAGAAGCCAGCCCCGCCCCGCCCAGCACAGTCTCCGGAACCAGTGAGGACCTGCGCCCTCCCAAACGACGCCCACCGCCAGGGACGCAAATACCCTGCTCCAGCCCTGGCTGCTTCCTCAGTTTCCCCAGTGTTCGTGACCTGGCGCAGCATCTCCGTACCCACTGCCCGCCCACCCAGTCCTTAGAAGGTAAGCTCTTCCGCTGCTCCGCCCTGAGCTGCACAGAGAGCTTCCCCAGCATGCAGGAGCTGGTGGCCCATGGCAAGCTGCATTACAAGCCCAATCGCTACTTCAAGTGTGAGAACTGCCTCCTGCGCTTCCGCACGCACCGCTCGCTCTTCAAGCACCTGCATGTTTGCGCAGAGCATGCTCAGAGCCCGGCCGCGCCGCCGCCCCCCGCCCTGGACAAGGAGCCCCCAGCACCTGAGCGCCCCTCGGAGTCTGACCCCGCGTCGGCGGCCGGCCTGCCGTTCCCGCTGCTCGAGCCCTTCACAACCCCCTCCTCTGTACCCACTGGGTCCTTCCTACCCTACTTGAACCCCGCGCCCTTTGGCCTAAGTCCCCCACGCCTGCGCCCCTTCCTGGCCACCGCTCCCGGGCCACCAGCCTCCAGCGCCGCTGTCTGGAAAAAGAGCCAAGGTGCTGGCGGCAGCCCCCGAAGACCGCAGGGCGGCTCCGATGCGCCCTCAGCGCACGCGGCCCCGAGCCGCATCGTGTGGGAGCACACGCGCGGCCGCTACTCGTGCATGCAGTGCGCCTTCTCCACGGCCTCGCGGCCCGCCATGACCCTGCACCTACAGGACCACCGCCCCGGCGCCCCCGCAGCCCTGCCGCCCGGGCCGCCGCGCCCCGACGCCCCGGCGGGTAAGGCCGAGGGACGCGCACGGGGAGAGGGCGGGGAGCCGGAGGCCAGGGGCGGGGCCGACGCTCCAGCGCCCCCTGCTCTGCCCCACCCGGACCCCACCCCGCTTGCGCCTAAGGTGTCGCAGCTGATGTCCGAGGGGGAGCGTCCGGTTTTCTCACTGCTTTGA

XM_004865415.1 Coding sequence

Znf414 zinc finger protein 414, transcript variant X2

Length: 1227 bp    Location: 1264665..1261428   Strand: -
>XM_004865415.1
ATGCTGGCCCCTGCAGAGCCCAGCTCCAATGAGACCGAAAAGGAGGTGTTGTCTCCGGTTGTGGCTGCTTTTGCCACCTCCATGGAGGAGGAGCTTGGCCCTGACCGAGCAGCCACACCCCCGGTGTGGGAATGTGGAGGGCCTGGAGGGACACAGCAGGGTGCCTCCCAGGCCTCAGACAGCTGCCAGCCTGACCCAGAAGCCAGCCCCGCCCCGCCCAGCACAGTCTCCGGAACCAGTGAGGACCTGCGCCCTCCCAAACGACGCCCACCGCCAGGGACGCAAATACCCTGCTCCAGCCCTGGCTGCTTCCTCAGTTTCCCCAGTGTTCGTGACCTGGCGCAGCATCTCCGTACCCACTGCCCGCCCACCCAGTCCTTAGAAGGTAAGCTCTTCCGCTGCTCCGCCCTGAGCTGCACAGAGAGCTTCCCCAGCATGCAGGAGCTGGTGGCCCATGGCAAGCTGCATTACAAGCCCAATCGCTACTTCAAGTGTGAGAACTGCCTCCTGCGCTTCCGCACGCACCGCTCGCTCTTCAAGCACCTGCATGTTTGCGCAGAGCATGCTCAGAGCCCGGCCGCGCCGCCGCCCCCCGCCCTGGACAAGGAGCCCCCAGCACCTGAGCGCCCCTCGGAGTCTGACCCCGCGTCGGCGGCCGGCCTGCCGTTCCCGCTGCTCGAGCCCTTCACAACCCCCTCCTCTGTACCCACTGGGTCCTTCCTACCCTACTTGAACCCCGCGCCCTTTGGCCTAAGTCCCCCACGCCTGCGCCCCTTCCTGGCCACCGCTCCCGGGCCACCAGCCTCCAGCGCCGCTGTCTGGAAAAAGAGCCAAGGTGCTGGCGGCAGCCCCCGAAGACCGCAGGGCGGCTCCGATGCGCCCTCAGCGCACGCGGCCCCGAGCCGCATCGTGTGGGAGCACACGCGCGGCCGCTACTCGTGCATGCAGTGCGCCTTCTCCACGGCCTCGCGGCCCGCCATGACCCTGCACCTACAGGACCACCGCCCCGGCGCCCCCGCAGCCCTGCCGCCCGGGCCGCCGCGCCCCGACGCCCCGGCGGGTAAGGCCGAGGGACGCGCACGGGGAGAGGGCGGGGAGCCGGAGGCCAGGGGCGGGGCCGACGCTCCAGCGCCCCCTGCTCTGCCCCACCCGGACCCCACCCCGCTTGCGCCTAAGGTGTCGCAGCTGATGTCCGAGGGGGAGCGTCCGGTTTTCTCACTGCTTTGA

XM_004865417.1 Coding sequence

Myo1f myosin IF

High confidence: 4 potential gene matches
Length: 3297 bp    Location: 1307446..1269610   Strand: -
>XM_004865417.1
ATGGGCAGCAAGGAGCGCTTCCACTGGCAAAGCCATAACGTGAAGCAGAGCGGTGTGGACGACATGGTGCTCCTGCCCCAGATCACCGAGGACGCCATCGTGAGCAACCTCCGCAAGCGCTTCATGGACGACTACATCTTTACCTACATCGGCTCGGTGCTCATCTCTGTAAATCCTTTCAAGCAGATGCCCTACTTTACTGACCGTGAGATCGACCTCTACCAGGGTGCGGCACAGTATGAGAACCCTCCACACATCTATGCCCTCACGGACAACATGTACCGGAACATGCTCATCGACTGTGAGAACCAGTGTGTCATCATCAGTGGAGAGAGTGGAGCTGGCAAGACAGTGGCTGCCAAGTACATCATGGGCTACATCTCCAAGGTGTCTGGCGGGGGAGAGAAGGTCCAGCATGTCAAGGACATCATCTTGCAGTCAAACCCACTGCTGGAGGCCTTTGGCAACGCCAAGACTGTGCGCAACAACAATTCCAGCCGTTTTGGCAAGTACTTTGAGATCCAGTTCAGCCGAGGCGGGGAGCCAGACGGGGGCAAGATCTCCAATTTCTTGCTGGAAAAGTCGCGCGTGGTCATGCAGAATGAGGACGAGAGGAATTTTCACATCTATTATCAGCTGCTGGAAGGGGCCTCCCAGGAGCAGCGCCAGAACCTGGGGCTCATGACGCCCGACTACTATTACTACCTCAACCAGTCGGACACCTACAAGGTGGACGGCACCGACGACCAGCGAGACTTCAATGAGACCCTGAGCGCCATGCAAGTCATTGGGATTCCACCCAGCATCCAGCAGCTGGTCCTGCAGCTCGTGGCCGGGATATTACACCTGGGCAACATCAGCTTCTGCGAAGAGGGAAATTACGCCCGGGTGGAGAGCACAGACCTCCTGGCTTTTCCTGCCTACCTGCTGGGCATCAACAGCGGCCGGCTGCAGGAGAAGCTGACCAGCCGCAAGATGGACAGCCGCTGGGGCGGACGCAGTGAGTCCATCGACGTGACCCTCAATGTGGAGCAGGCCGCGTACACCCGCGACGCCCTGGCCAAGGGGCTCTATGCCCGCCTCTTCGACTTCCTGGTGGAGGCCATCAACCGCGCAATGCAGAAGCCCCAGGAAGAGTACAGCATCGGAGTGCTTGACATCTACGGCTTTGAGATCTTCCAGAAAAACGGCTTTGAGCAATTCTGCATCAACTTCGTCAATGAAAAGCTGCAGCAGATCTTCATCGAGCTCACTCTGAAGGCCGAGCAGGAGGAGTACGTACAGGAGGGCATCCGCTGGACCCCCATCGAGTACTTCAACAACAAAGTCGTCTGCGACCTCATCGAAAACAAGCTGAGCCCCCCGGGCATCATGAGCGTGCTGGACGACGTGTGCGCCACCATGCACGCCACGGGCGGCGGCGCGGACCAGACGCTACTGCAGAAACTGCAGGCGGCAGTGGGCACCCACGAGCACTTCAACAGCTGGAGCTCCGGCTTCGTCATCCACCACTATGCGGGCAAAGTCTCCTACGACATCAGCGGCTTCTGCGAGAGGAACCGAGATGTCCTCTTCTCCGATCTCATAGAGCTGATGCAGACCAGTGAGCAGGCCTTCCTCCGGATGCTCTTTCCCGAGAAGCTGGACATGGACAAGAAGGGCCGGCCCAGCACCGCAGGCTCCAAGATCAAGAAACAAGCCAACGACCTGGTGGCCACGCTGAAGAGGTGCACGCCCCACTACATCCGCTGCATCAAGCCTAACGAGACCAAGAGGCCCCGGGACTGGGAGGAGAGCAGGGTCAAGCACCAGGTGGAGTACCTGGGCCTGCGGGAGAACATCCGCGTGCGCAGGGCCGGCTTCGCCTACCGCCGCCAGTTCTCCAAGTTCCTGCAGAGGTACGCCATCCTGACTCCCGAGACCTGGCCGAGGTGGCGCCGGGACGAACGGCAGGGCGTCCAGCACCTGCTCCGGGCGGTGAACATGGACCCAGACCAGTACCAGATGGGGGCCACCAAGGTCTTCGTCAAGAACCCCGAATCGCTCTTCCTCCTGGAGGAGATGCGAGAGCGGAAGTTCGATGGCTTTGCCCGCACCATCCAGAAGGCGTGGAGGCGCCACGTGGCAGTGCGCAAGTACGAGGAAATGCGAGAGGAAGCTTCCAACATCCTGCTCAACAAGAAGGAGCGGAGGCGGAACAGCATCAACCGAAACTTCGTGGGCGACTACCTGGGGCTGGAGGAGCGGCCGGAGCTGCGTCAGTTCCTGGGCAAGAGGGAGCGGGTGGACTTTGCCGACTCGGTCACCAAGTATGACCGCCGCTTCAAGCCCATCAAGCGGGACTTGATCCTGACACCCAAGTGCGTGTATGTGATCGGGCGAGAGAAGGTGAAGAAGGGCCCGGAGAAAGGCCAGGTGCGTGAAATCTTGAAGAAGAAGCTGGAGCTGCAGACCTTGCGAGGAGTGTCCCTCAGCACGAGACAGGACGACTTCTTCATCCTCCAAGAGGCTGCCGCCGACAGCTTCCTGGAGAGCATCTTCAAGACCGAGTTCGTCAGCCTCCTGTGCAAGCGCTTCGAGGAGGCTGCGCAGAGGCCCCTACCCCTCAACTTCAGCGACACACTACAGTTCCGCGTGAAGAAGGAGGGCTGGGGCGGAGGCGGCACCCGCAGCGTCACCTTCGCTCGCGGCTCCGGCGACCTGGCCGTGCTCAAAGCGGGCGGCCGGGGCCTCACGGTCAGCGTGGGCGACGGGCTGCCCAAGAGCTCCAAGCCCACGCGGAAGGGAATGGCCCAGGGGAGGCACCGAAGGCCAGCCCAGGCCCCGACACGGGCGGCCCCCGGGCCCCCCAGAGCTCTAGACCGAAATGGGGTACCCCCCTTGGCCCGAGGAGGTCCCCTGGCCCTGGATATCACACCTGGAAGGAACTCCCAGCAGCCCCCCCGGGGTCCTCCAGCTTCCACCCTGGGGGCCAGAAGACGTTCCAGGGCACACCCGCCCTCAGAGCACAACACAGAATTCCTCAACGTGCCTGACCAGGGAGTGGCGGGCATGCAGAGGAAGCGCAGCATAGGACAGAGACCTGTGCCTGGCGTGGGCCGACCCAAGCCACAGCCGCGGGTACATGGCCCGAGGTGCCGGGCGCTGTACCAATACATAGGTCAAGACGTGGATGAGCTGAGCTTCAACATAAACGAGGTCATCGAGATCCTCATGGAAGACCCCTCGGGCTGGTGGAAGGGCCGGCTGCATGGCCAGGAGGGCCTCTTCCCGGGAAACTACGTGGAGAAGATCTGA

XM_004865420.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X3

Length: 3969 bp    Location: 1327359..1308920   Strand: -
>XM_004865420.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGGTGAGAGGCCGCGCCCCGCCCTGGGCCATGGCCACGCTCCTCGCGTACTCGTGCTGGCTCCGCCCCCGCTCCTGGGCCGCACACCGCATGTTCATTCCCTGGGGCCGCATCCCGGAGGGAGGGGCAGGGCCACTGAGCTCCCCACACTGCGGAGCCGGACTCGCCCGTCTCCCGACTCTCTTCCCACAGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGTCAGTCCTCAGACCGCGCCCAGGAGAGCGCGACCCGACCCCAGCTGTCCCCCCATCTGGCTCCCGTCTCCACCGCCCCTTCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGTGAGTGGGGAGCTCCGGGGTCCGTGGCAGGCAGCCGGGGGAGCTTCCAGAAGCAAGTGGGTTTGCCTGGCATCCTGGGGTCCCCTTTTCCCCCGTAAATCGGGTTGCTGGGGCCATGGCTCAGTGGTGCCTTGCCGGGACACTGGGACCCCCTCCCCCGCCCGGCCCCTGTGCGATCGCTCCGGCCTCACTTCCCCAGAGAGCACGCAGGGAGGTCAGGTCGGGCAGCCTGGCCCGGGGTCTGATGGGCCCGGGCCCCCAGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865429.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X12

High confidence: 3 potential gene matches
Length: 3312 bp    Location: 1326275..1308920   Strand: -
>XM_004865429.1
ATGGCTTCCGCCTGCCAGCTCCTCCGCTGGGCCCTCGCCCTGGGGCTGGGCCTCACCTTCAAGGTCACACATGCCTTCCGGTCTCAAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGTCAGTGTAAATACGGGGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865425.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X8

Length: 3660 bp    Location: 1326275..1308920   Strand: -
>XM_004865425.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGTGAGTGGGGAGCTCCGGGGTCCGTGGCAGGCAGCCGGGGGAGCTTCCAGAAGCAAGTGGGTTTGCCTGGCATCCTGGGGTCCCCTTTTCCCCCGTAAATCGGGTTGCTGGGGCCATGGCTCAGTGGTGCCTTGCCGGGACACTGGGACCCCCTCCCCCGCCCGGCCCCTGTGCGATCGCTCCGGCCTCACTTCCCCAGAGAGCACGCAGGGAGGTCAGGTCGGGCAGCCTGGCCCGGGGTCTGATGGGCCCGGGCCCCCAGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865427.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X10

Length: 3483 bp    Location: 1326275..1308920   Strand: -
>XM_004865427.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGTCAGTCCTCAGACCGCGCCCAGGAGAGCGCGACCCGACCCCAGCTGTCCCCCCATCTGGCTCCCGTCTCCACCGCCCCTTCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865423.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X6

Length: 3780 bp    Location: 1326275..1308920   Strand: -
>XM_004865423.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGTCAGTCCTCAGACCGCGCCCAGGAGAGCGCGACCCGACCCCAGCTGTCCCCCCATCTGGCTCCCGTCTCCACCGCCCCTTCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGTGAGTGGGGAGCTCCGGGGTCCGTGGCAGGCAGCCGGGGGAGCTTCCAGAAGCAAGTGGGTTTGCCTGGCATCCTGGGGTCCCCTTTTCCCCCGTAAATCGGGTTGCTGGGGCCATGGCTCAGTGGTGCCTTGCCGGGACACTGGGACCCCCTCCCCCGCCCGGCCCCTGTGCGATCGCTCCGGCCTCACTTCCCCAGAGAGCACGCAGGGAGGTCAGGTCGGGCAGCCTGGCCCGGGGTCTGATGGGCCCGGGCCCCCAGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865418.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X1

Length: 3969 bp    Location: 1326275..1308920   Strand: -
>XM_004865418.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGGTGAGAGGCCGCGCCCCGCCCTGGGCCATGGCCACGCTCCTCGCGTACTCGTGCTGGCTCCGCCCCCGCTCCTGGGCCGCACACCGCATGTTCATTCCCTGGGGCCGCATCCCGGAGGGAGGGGCAGGGCCACTGAGCTCCCCACACTGCGGAGCCGGACTCGCCCGTCTCCCGACTCTCTTCCCACAGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGTCAGTCCTCAGACCGCGCCCAGGAGAGCGCGACCCGACCCCAGCTGTCCCCCCATCTGGCTCCCGTCTCCACCGCCCCTTCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGTGAGTGGGGAGCTCCGGGGTCCGTGGCAGGCAGCCGGGGGAGCTTCCAGAAGCAAGTGGGTTTGCCTGGCATCCTGGGGTCCCCTTTTCCCCCGTAAATCGGGTTGCTGGGGCCATGGCTCAGTGGTGCCTTGCCGGGACACTGGGACCCCCTCCCCCGCCCGGCCCCTGTGCGATCGCTCCGGCCTCACTTCCCCAGAGAGCACGCAGGGAGGTCAGGTCGGGCAGCCTGGCCCGGGGTCTGATGGGCCCGGGCCCCCAGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865428.1 Coding sequence

Adamts10 ADAM metallopeptidase with thrombospondin type 1 motif, 10, transcript variant X11

Length: 3450 bp    Location: 1326275..1308920   Strand: -
>XM_004865428.1
ATGCCTTCCGGTCTCAAGGTAGGAGCCAGGGGTCCAAGGATGGCGTCGGGGAGGGAGCAGGAATTGAGGAGGCCAGTTGGGTGCCAAAGGAAAGAGTCACCAGTGGGCCAGTATGGGGGGCACGGGGGGCAGGGCTGGGTGGGACCTCAAGGCATAGGTTGGCATCACCAGGACACAGGGCTCAGGCAGAGCCAGCGCCGCCCCAGGCCTTGCTTCTCACCCGCAGATGAGTTCCTGTCCAGTCTGGAGAGCTATGAGATCGCCTTCCCCACCCGCGTGGACCACAACGGGGCCCTGCTGGCCTTCTCGCCTCCCACCCTCCGGAGGCAGCGCCGGGGCACGCCCACCACGGCCGAGTCCCGCCTCTTTTACAAAGTGGCTGCGCCCAGCACCCACTTCCTGTTGAACCTGACCCGCAGCCCCCGGCTCCTGGCCGGCCACGTCTCCGTGGAGTACTGGACACGTGAGGGCCTGGCCTGGCAGAGGGCCGCCCGGGCCCATTGCCTCTACGCTGGGCACCTGCGGGGCCAGGCCGGCAGCTCCCACGTGGCCATCAGCACCTGCGGCGGCCTGCACGGCCTGATTGTGGCCGACCAGGAAGAGTACTTGATCGAGCCCCTGCACGGTGGGCCCAAGGGCCCCCGCAGCCCAGAGGAGGGCGGCCCGCATGTGGTCTACAAGCGCTCCTCTCTGCGCCACCCCCACCTGGACACGGCCTGCGGGGTGCGAGACGAGAAGCCCTGGAAGGGCCGGCCGTGGTGGCTGCGCACCCTGAAGCCGCCGCCCGCCAGGCCACTGGGGAATGAGTCGGAGAGGAGCCAGCTGGGCCTGAAGCGCTCCGTCAGCCGAGAGCGCTACGTGGAGACCCTGGTGGTGGCAGACAAGATGATGGTGGCCTACCACGGGCGCCGAGACGTAGAACAGTACGTGCTGGCCATCATGAACATTGTTGCCAAACTTTTCCAGGACTCAAGTCTGGGAAACATCGTTAACATCCTGGTGACCCGGCTCATCCTGCTCACGGAGGACCAGCCCACCCTGGAGATCACTCACCATGCGGGCAAGTCCCTGGACAGCTTCTGTAAGTGGCAGAAATCCATCGTGAACCACAGCGGGCACGGGAACGCCATTCCGGAGAACGGCGTGGCCAACCACGACACGGCAGTGCTCATTACACGCTATGATATTTGCATCTATAAGAACAAGCCCTGCGGCACTCTAGGCCTGGCCCCTGTGGGCGGGATGTGTGAGCGCGAGAGAAGCTGCAGCATCAACGAAGACATCGGCCTGGCCACGGCCTTCACCATCGCCCATGAGATCGGGCACACGTTCGGCATGAACCACGACGGCGTGGGGAACAGCTGTGGGGCCCGCGGCCAGGACCCAGCCAAGCTGATGGCCGCCCACATCACCATGAAAACCAACCCATTTGTGTGGTCGTCCTGCAGCCGCGACTACATCACCAGCTTCCTGGACTCGGGCCTGGGGCTCTGCCTGAACAACCGGCCCCCGAGGCAGGACTTCGTGTACCCAACGGTGGCGCCTGGCCAGGCCTACGACGCAGATGAGCAGTGTCGCTTCCAACATGGAGTCAAATCGCGTCAGTGTAAATACGGGGAGGTCTGCAGCGAGCTCTGGTGCCTGAGCAAGAGCAACCGGTGCATCACCAACAGCATCCCGGCCGCAGAGGGTACGCTGTGCCAGACGCACACCATCGACAAGGGGTGGTGCTACAAGCGGGTTTGTGTCCCCTTCGGCTCGCGGCCGGAAGGCGTGGACGGCTCCTGGGGCCCGTGGACCCCATGGGGCGACTGCAGCAGGACGTGCGGCGGCGGCGTGTCCTCCTCCAGTCGCCACTGCGACAGCCCCAGGCCAACTATCGGGGGCAAGTACTGTCTGGGGGAGAGACGACGACACCGGTCCTGCAACACCGAGGACTGTCTCCCGGGCTCCCAGGACTTCAGGGAGATGCAGTGCTCCGAATTCAACAGCGTCCCTTTCCGTGGCAAGTTCTACTCGTGGAAGGCATACCGAGGGGGGGGCGTGAAGGCCTGCTCGCTCACCTGCCTGGCTGAGGGCTTCAACTTCTACACCGAGAGGGCGGCAGCCGTGGTGGACGGGACGCCCTGCCGCCCAGACACAGTGGACATCTGCGTCAGCGGCGAGTGCAAGCACGTGGGCTGTGACCGGGTCCTGGGCTCCGACCTGCGGGAGGACAAGTGCCGAGTGTGCGGCGGTGATGGCAGCGCCTGCGAAACCATCGAAGGGGTCTTCAGCCCGGCCCTGGCTGGGCCTGGCTATGAGGACGTCGTGTGGATCCCCAAAGGCTCCGTCCACATTTTCATCCAGGACCTGAACCTGTCCCTCAGTCACCTAGCCCTGAAGGGGGACCAGGAGTCCCTGCTGCTGGAGGGACTGCCCGGGACCCCCCAGCCTCACCGCCTGCCGCTGGCGGGGACCACCTTCCACCTGCGACAGGGGCCAGACCAGACCCAGAGTCTAGAAGCCCTGGGACCCATTAATGCGTCTCTCGTCGTCATGGTGCTGGCCCGGACAGAGCTGCCTGCCCTCCGCTATCGATTCAATGCGCCCATCTCTAGGGACACGCTGCCCCCGTACTCCTGGCACTACACGCCCTGGACCAAGTGCTCGGCTCAGTGTGCCGGGGGCAGCCAGGTGCAGGTGGTGGAGTGCCGCAATCAGCTGGACAGCTCAGCCGTGGCACCCCACCACTGCAGCGCCCACAGCAAACTGCCCAAGAGGCAGCGCGCCTGCAACACGGAGCCTTGCCCGCCGGACTGGGTCGTAGGAAACTGGTCGCGCTGCAGCCGCAGCTGTGACGCCGGGGTTCGCAGCCGCTCGGTCGTGTGCCAGCGCCGCGTGTCGGCGGCCGAGGAGAAGGCGCTGGACGACAGTGCGTGCCCACAGCCTCGCCCGCCAGTGCTGGAGGCCTGCCATGGGCCCACCTGCCCGCCCGAGTGGGCCGCCCTGGACTGGTCTGAGTGCACCCCCAGCTGCGGGCCAGGCCTCCGCCACCGCGTGGTCCTGTGCCAGAGTGCCGATCACCGGGCCACCCTGCCCGCCGCGCACTGCCCGCCTGCCGCCAAGCCTCCGGCCACCATGCGCTGCAACCTGCGCCGCTGCCCTCCCGCCCGCTGGGTGGCCAGTGAGTGGGGCGAGTGCTCCGTGCAGTGCGGCCTGGGCCAGCAGCAGCGCTCCGTGCACTGCACCAGCCACACCGGGCAGCCGTCGCGCGAGTGCACCGAGACCCTGCGGCCGCCCGCCATGCAGCAGTGCGAGGCCAAGTGTGACAGCGCGCCGCCCGGGGATGGCCCCGAAGAATGCAAGGATGTGAACAAGGTCGCCTACTGCCCCCTGGTGCTCAAATTTCAGTTCTGCAGCCGATCCTACTTCCGCCAGATGTGCTGCAAAACCTGCCAGGGCCGCTAG

XM_004865430.1 Coding sequence

Actl9 actin-like 9

High confidence: 1 potential gene match
Length: 1215 bp    Location: 1381065..1379733   Strand: -
>XM_004865430.1
ATGGATGTGAATGGTCCCGAGCCTCCAGGGCCCCTGCCCTCCCCACAGGCGCCTGGGCTCGACCCGCACCCCCGCAGGCTGCCCCCGAGGACTGCCGCCGTGGTGATCGACATGGGCACGGGAACCTGCAAGATGGGCTTCGCCGGGCAGGCCCAACCCGCCTGCACCGTGGCCACGGTCCTGGGCTGCGGGCCCAGGAGCCCGGCCGGCCCCCGGCAGCCGGCGCTGGAGACACTCTTTGGCGAGGCGGCCCGCGCGCGCCCGGAGCTGCGGCTGCTGCAGCCGGTGCGCGCCGGCATCGTGCAGGACTGGGAGGCAGCCGAGCTGCTCTGGCGCCACGTGCTGGAGCACGACCTGCGCGTGGATCCCCGCGACCGCCCGCTGCTGTTCTCCGACCCGCCCTTCAGCCCGGCCACCAACCGCGAGCAGCTGGCCGAGACGGCCTTCGAGGCGCTGCGCTGCCCGGCCGCCTTCGTGGCCTCGCAGGCCGTGCTGTCCGTCTACGCCCACGGGCGGGTCAGCGGGCTCGTGGTGGACGCCGGCCACGGCGTCAGCTGCGCGGCGCCGGTCTTCCAAGGCCACACCCTGCCCCACGCCGTGGAGCGCCTGGACCTGGCTGGCAGCCACCTGACCGCCTTCCTGGCCGAGGCGCTTCGGAGCGCGGGCTGGGCGCTCGGGCCACGCGACCTGGACGCCGTGGAGCGCATCAAGCGCCGCCACTGCTACGTAGCCCCCGACTTCCTGGAGCTGCAGGCCCGGCCCGACGCGCAGAGCCGGCTCTCCGTGCAGCTGCCCGACGGGCGCGCGCTCACGCTGGGCGAGGAGCTGTTCCAGGGCCCGGAGCTGCTCTTCCGCCCCCCGCAGGCCCCGGGGCTGCCGCCCGCCGGCCTCCCCGCCCTGGCCGCGCGCAGCCTGCGCAAGCTGCCCCCGGAGGCGCGGGCGCCCGTGGCCCAGCGCGTGCTGCTCTGCGGGGGCTCCTCGCTCCTCGCGGGTTTCGAGGGCCGCTTCAGGACCGAGCTGCTGCGCTCGCTGCCCCCGGACGTGGAGGCGGAGACGGAGGCGTGCGCTGCAGTGGTGGCCGCCCCTGGCAGGGGCCTGTCGGTGTGGATCGGGGGCTCCGTCCTGGCCTCGCTGAGCGCCTTCCAGTCCTGCTGGGTCCTGCGGGAGCAGTACGAGGAGCAGGGGCCGCACGTGGTGTACAGCAAGTGCTACTGA

XM_004866047.1 Coding sequence

LOC101703117 putative methyl-CpG-binding domain protein 3-like 5-like

Length: 591 bp    Location: 1439960..1439370   Strand: -
>XM_004866047.1
ATGCTACCCCCAGGTTTGCAGAAGAAACAAGTCCGAAAGTTCAGAGCTACCAGGCCCTTTACCATCCCCATGAGACTGACCAGCTGCATCTTACCCAGGCCTGTGACGCTCATCACCGCCCACCCTGGCAATGAGGTCAGGTGCGGGCCCCACGAGGAGAAGCTGAAGAAGCCCCAGCAGCTGTGTACAAGCTGGAGGCTGCAGGCACTCAAGCACCAAGGCAGCGAAGAAGAAGGTTTAAGCCAATTGGATTTCACAAACGCCTTCCCAGCCATGACTTCAGGAAGCCGAGGAGGATCCTGGGGCCAGGCTGCTGCTGAGAGCTCGCAGCCCGCCCCTGGCCTGTCTCCCTTCTGGAAAGAGATGATCCCGGAAGCTTTTCACCTTGTCCCTCCCCCTTCCAGCCAGCAGGTCACTTCCGCAGACATCCAGAGACAGGCTCGGAAAGTGAAGAGGGCCAGGGAGAGACTGGCCGAGGCCTTGAGGGCAGACAGCCTGGCCAGGGAGGCAGAGAGGCTGAGCAGCCAGGAGGAAAGGGCTGAAACCCAGGTGGAAACAGGAGCAGGAGCTGCTGGAGACTCGGAGATGTGA

XM_004865443.1 Coding sequence

Znf558 zinc finger protein 558, transcript variant X3

Length: 1209 bp    Location: 1496659..1479282   Strand: -
>XM_004865443.1
ATGGCAGCTGCTGTCCTGCCCCCAACTTGTGCTCAGTCCTGCATATACCCAGCCTCTCCTCAGAAAGGACGAACGGGGAAGGAAAGGCTGGTCAGTGAGTTCCTGACATGCTGGTTGCAGGACCTGGTGACCTTTGAGGATGTGGCTGTGGACTTCACCCAGGAAGAGTGGGCATTGCTGGACACATCCCAACGATCCCTGTACAGGGAGGTGATGCTGGAGAACTGCAGGAACCTGGCCTCGCTCGGGTGTCATGTTGGTAAACCCAGTCTGATCTCCCAGCTGGAGCAAGAAGATAAAGTGATAATAGAGGAAAGAAGAAATCTCCCAAGGACCTGTCCAGATTTGGAGACTGTACTCAAAGCCAAATGGCTAACTCCTAAGAAAGATGCTTTTAGAAGAGAACAAGTAAAAGGTGTAAAAACGGAGAGAAGTCGTCATGGAGTGAAAATCAATGAATGTAATCAGTGTTTTAAGGTATTCAGCACAAAGTCTAATCTTACTCAACACAAGAGAATTCATACTGGAGAAAAGCCCTATGACTGTAATCAGTGTGGGAAATCCTTCAGCAGTAGATCTTACCTTACTATTCACAGGAGAATCCATAATGGGGAGAAACCCTATGAATGCAATCACTGTGGCAAAGCCTTTAGTGATCCCTCATCCCTCAGACTGCACGTGAGAATTCATACCGGAGAAAAACCCTATGAATGTAACCAGTGTTTTCACGTCTTCCGCACTAGCTGTAACCTCAAGAGCCACAAGAGAATCCATACAGGGGAGAATCACCATGAATGCAATCAGTGTGGAAAGGCCTTCAGCACAAGGTCATCTCTGACTGGACACAATAGCATTCATACAGGAGAGAAACCTTATGAGTGCCACGATTGTGGGAAAGCCTTCAGGAAGAGCTCCTATCTGACACAGCACGTGAGAACTCACACAGGTGAAAAACCCTATGAGTGCAATGAGTGTGGCAAGTCCTTTAGCAGTAGCTTTTCTCTAACAGTGCATAAGAGAATACATACTGGAGAGAAACCCTATGAATGTAGTGACTGTGGGAAAGCCTTTAATAATCTTTCAGCTGTTAAGAAGCACTTAAGAACTCACACTGGAGAAAAACCCTATGAATGTAACCATTGTGGAAAATCTTTCACTAGTAACTCTTACCTTTCTGTGCACAAGAGAATACATAACAGGTGGATATGA

XM_004865442.1 Coding sequence

Znf558 zinc finger protein 558, transcript variant X2

Length: 1209 bp    Location: 1496659..1479282   Strand: -
>XM_004865442.1
ATGGCAGCTGCTGTCCTGCCCCCAACTTGTGCTCAGTCCTGCATATACCCAGCCTCTCCTCAGAAAGGACGAACGGGGAAGGAAAGGCTGGTCAGTGAGTTCCTGACATGCTGGTTGCAGGACCTGGTGACCTTTGAGGATGTGGCTGTGGACTTCACCCAGGAAGAGTGGGCATTGCTGGACACATCCCAACGATCCCTGTACAGGGAGGTGATGCTGGAGAACTGCAGGAACCTGGCCTCGCTCGGGTGTCATGTTGGTAAACCCAGTCTGATCTCCCAGCTGGAGCAAGAAGATAAAGTGATAATAGAGGAAAGAAGAAATCTCCCAAGGACCTGTCCAGATTTGGAGACTGTACTCAAAGCCAAATGGCTAACTCCTAAGAAAGATGCTTTTAGAAGAGAACAAGTAAAAGGTGTAAAAACGGAGAGAAGTCGTCATGGAGTGAAAATCAATGAATGTAATCAGTGTTTTAAGGTATTCAGCACAAAGTCTAATCTTACTCAACACAAGAGAATTCATACTGGAGAAAAGCCCTATGACTGTAATCAGTGTGGGAAATCCTTCAGCAGTAGATCTTACCTTACTATTCACAGGAGAATCCATAATGGGGAGAAACCCTATGAATGCAATCACTGTGGCAAAGCCTTTAGTGATCCCTCATCCCTCAGACTGCACGTGAGAATTCATACCGGAGAAAAACCCTATGAATGTAACCAGTGTTTTCACGTCTTCCGCACTAGCTGTAACCTCAAGAGCCACAAGAGAATCCATACAGGGGAGAATCACCATGAATGCAATCAGTGTGGAAAGGCCTTCAGCACAAGGTCATCTCTGACTGGACACAATAGCATTCATACAGGAGAGAAACCTTATGAGTGCCACGATTGTGGGAAAGCCTTCAGGAAGAGCTCCTATCTGACACAGCACGTGAGAACTCACACAGGTGAAAAACCCTATGAGTGCAATGAGTGTGGCAAGTCCTTTAGCAGTAGCTTTTCTCTAACAGTGCATAAGAGAATACATACTGGAGAGAAACCCTATGAATGTAGTGACTGTGGGAAAGCCTTTAATAATCTTTCAGCTGTTAAGAAGCACTTAAGAACTCACACTGGAGAAAAACCCTATGAATGTAACCATTGTGGAAAATCTTTCACTAGTAACTCTTACCTTTCTGTGCACAAGAGAATACATAACAGGTGGATATGA

XM_004865441.1 Coding sequence

Znf558 zinc finger protein 558, transcript variant X1

Length: 1209 bp    Location: 1491471..1479282   Strand: -
>XM_004865441.1
ATGGCAGCTGCTGTCCTGCCCCCAACTTGTGCTCAGTCCTGCATATACCCAGCCTCTCCTCAGAAAGGACGAACGGGGAAGGAAAGGCTGGTCAGTGAGTTCCTGACATGCTGGTTGCAGGACCTGGTGACCTTTGAGGATGTGGCTGTGGACTTCACCCAGGAAGAGTGGGCATTGCTGGACACATCCCAACGATCCCTGTACAGGGAGGTGATGCTGGAGAACTGCAGGAACCTGGCCTCGCTCGGGTGTCATGTTGGTAAACCCAGTCTGATCTCCCAGCTGGAGCAAGAAGATAAAGTGATAATAGAGGAAAGAAGAAATCTCCCAAGGACCTGTCCAGATTTGGAGACTGTACTCAAAGCCAAATGGCTAACTCCTAAGAAAGATGCTTTTAGAAGAGAACAAGTAAAAGGTGTAAAAACGGAGAGAAGTCGTCATGGAGTGAAAATCAATGAATGTAATCAGTGTTTTAAGGTATTCAGCACAAAGTCTAATCTTACTCAACACAAGAGAATTCATACTGGAGAAAAGCCCTATGACTGTAATCAGTGTGGGAAATCCTTCAGCAGTAGATCTTACCTTACTATTCACAGGAGAATCCATAATGGGGAGAAACCCTATGAATGCAATCACTGTGGCAAAGCCTTTAGTGATCCCTCATCCCTCAGACTGCACGTGAGAATTCATACCGGAGAAAAACCCTATGAATGTAACCAGTGTTTTCACGTCTTCCGCACTAGCTGTAACCTCAAGAGCCACAAGAGAATCCATACAGGGGAGAATCACCATGAATGCAATCAGTGTGGAAAGGCCTTCAGCACAAGGTCATCTCTGACTGGACACAATAGCATTCATACAGGAGAGAAACCTTATGAGTGCCACGATTGTGGGAAAGCCTTCAGGAAGAGCTCCTATCTGACACAGCACGTGAGAACTCACACAGGTGAAAAACCCTATGAGTGCAATGAGTGTGGCAAGTCCTTTAGCAGTAGCTTTTCTCTAACAGTGCATAAGAGAATACATACTGGAGAGAAACCCTATGAATGTAGTGACTGTGGGAAAGCCTTTAATAATCTTTCAGCTGTTAAGAAGCACTTAAGAACTCACACTGGAGAAAAACCCTATGAATGTAACCATTGTGGAAAATCTTTCACTAGTAACTCTTACCTTTCTGTGCACAAGAGAATACATAACAGGTGGATATGA

XM_004865444.1 Coding sequence

Znf558 zinc finger protein 558, transcript variant X4

Length: 996 bp    Location: 1487846..1479282   Strand: -
>XM_004865444.1
ATGCTGGAGAACTGCAGGAACCTGGCCTCGCTCGGGTGTCATGTTGGTAAACCCAGTCTGATCTCCCAGCTGGAGCAAGAAGATAAAGTGATAATAGAGGAAAGAAGAAATCTCCCAAGGACCTGTCCAGATTTGGAGACTGTACTCAAAGCCAAATGGCTAACTCCTAAGAAAGATGCTTTTAGAAGAGAACAAGTAAAAGGTGTAAAAACGGAGAGAAGTCGTCATGGAGTGAAAATCAATGAATGTAATCAGTGTTTTAAGGTATTCAGCACAAAGTCTAATCTTACTCAACACAAGAGAATTCATACTGGAGAAAAGCCCTATGACTGTAATCAGTGTGGGAAATCCTTCAGCAGTAGATCTTACCTTACTATTCACAGGAGAATCCATAATGGGGAGAAACCCTATGAATGCAATCACTGTGGCAAAGCCTTTAGTGATCCCTCATCCCTCAGACTGCACGTGAGAATTCATACCGGAGAAAAACCCTATGAATGTAACCAGTGTTTTCACGTCTTCCGCACTAGCTGTAACCTCAAGAGCCACAAGAGAATCCATACAGGGGAGAATCACCATGAATGCAATCAGTGTGGAAAGGCCTTCAGCACAAGGTCATCTCTGACTGGACACAATAGCATTCATACAGGAGAGAAACCTTATGAGTGCCACGATTGTGGGAAAGCCTTCAGGAAGAGCTCCTATCTGACACAGCACGTGAGAACTCACACAGGTGAAAAACCCTATGAGTGCAATGAGTGTGGCAAGTCCTTTAGCAGTAGCTTTTCTCTAACAGTGCATAAGAGAATACATACTGGAGAGAAACCCTATGAATGTAGTGACTGTGGGAAAGCCTTTAATAATCTTTCAGCTGTTAAGAAGCACTTAAGAACTCACACTGGAGAAAAACCCTATGAATGTAACCATTGTGGAAAATCTTTCACTAGTAACTCTTACCTTTCTGTGCACAAGAGAATACATAACAGGTGGATATGA

XM_004865445.1 Coding sequence

Znf558 zinc finger protein 558, transcript variant X5

Length: 327 bp    Location: 1491471..1487001   Strand: -
>XM_004865445.1
ATGGCAGCTGCTGTCCTGCCCCCAACTTGTGCTCAGTCCTGCATATACCCAGCCTCTCCTCAGAAAGGACGAACGGGGAAGGAAAGGCTGGTCAGTGAGTTCCTGACATGCTGGTTGCAGGACCTGGTGACCTTTGAGGATGTGGCTGTGGACTTCACCCAGGAAGAGTGGGCATTGCTGGACACATCCCAACGATCCCTGTACAGGGAGGTGATGCTGGAGAACTGCAGGAACCTGGCCTCGCTCGTTGTACTAAAACCGTCTTCTCAAGATGCCGACACCGTGCTATCTGGACTTTGCAGAAACCAGAATCATGAGCCAAAATAA

XM_004865446.1 Coding sequence

Znf558 zinc finger protein 558, transcript variant X6

Length: 273 bp    Location: 1491471..1487001   Strand: -
>XM_004865446.1
ATGGCAGCTGCTGTCCTGCCCCCAACTTGTGCTCAGTCCTGCATATACCCAGCCTCTCCTCAGAAAGGACGAACGGGGAAGGAAAGGCTGGTCAGTGAGTTCCTGACATGCTGGTTGCAGGACCTGGTGACCTTTGAGGATGTGGCTGTGGACTTCACCCAGGAAGAGTGGGCATTGCTGGACACATCCCAACGATCCCTGTACAGGGAGGTGATGCTGGAGAACTGCAGGAACCTGGCCTCGCTCGGTCAGGCCCAGTGGGAGATGATTTGA

XM_004866050.1 Coding sequence

LOC101704534 mucin-5B-like

Length: 603 bp    Location: 1579630..1574036   Strand: -
>XM_004866050.1
ATGGCCCCGACATGGGTCTCCTCGACAGCTCTGCCCAGCCTGGGCATCTCGGCCACCACGGCCTCGGGAGCCACCACCTGGCCGGCCACACCTCCTGTTCCCGGCTCCTTGCCCTCAGTGAGCAGCCCTGTGTCCAGCACAGCCTCCGAGCCATTCTTTGCCCCCAGCACTGCGACTGTGCAGCAGAGCACCTCTGCCAGCCCCCCACCAATCACCAGGGCCACCGACTCCCCTCCCAGTGACTCATCCACCGCGTGGACACGTAGCCTATCCTCCACACTCGCTTCCACCAGGCAAAGTTTCCAATCCACAGGAACCAAAAGCATTGCGGAGCTCAACTCATGGCTACCCAGTGAAGCTGCACGTGGAAGCACCATGCAACCCATCGAGGGACCTCTGGCACCTACAGAGCCTGCTAGTCCCAAAGTATCCCCTCTCTTGCCCTCCTCTCCTTCAACTTCCACATCCCCTCTTCTCATCCCCTACTTCCTCACTCTCTTTCCCCTCTTCTTCCTGAACCATTTTCTGAATCCCTCTTCAGTAGCAGCCATCTCTGTCCATGCTACTTTACCCTTTTCTGGAGGAAGTGTCCCACTCACTTGA

XM_004866051.1 Coding sequence

LOC101704897 mucin-5AC-like

Length: 729 bp    Location: 1582790..1579645   Strand: -
>XM_004866051.1
ATGGTCACTAGCAAGCCTGGCCCAGCCGCAAATGTCACGGTGGCCACTGGCTCAGGCCCTGAGTCTCACCCGGGACCCAACCAGTCCACCACTACAGAGCCCATGCTCACCAGAGCCACCAGCGCCAGGACGGCTTCTACCCCGTCTGGGCCAGAACCCACAGCAGTGACCAGCGAGGCCCAAATGGCCCCGACTCGGGTCTCCACGACTGCTCTACCCAGCCTGGGCATCTCTGCCACCATAAACACGGGAGCCACCAGCTCCCTCACAACCCCTGCTGCTCCCAGCTCCGTGCCCTCAATGAGTGGGCGCTTAGCCAGCGGAAACACCAAGCCATCCTCTGCACCAAGCACTGCGCCTGTGCAGCACAGAAGCTTTGCCCGCACCCTCAATACCACGAGGACAATCAAATCCCCTTCCAGTGACTCATCCACTGTGTGGAGACATAGCCTCTCTGCTCCCGCTGCCACCAGCGAAAGTCTCCAATCCATGGGTAAGTCGCCCACCGCTACGCCAGGAAAAACATCCTGGACCGTGACCACCTGGACAGGCAGCATGGGGGACAGCATGCCTCCCCTTGATGCCAGCTCTGTGGGGCCCACAGCCCAGCCAGCAAAGCCTGACTCCTCCTCAGAGAAACCACGTCCACCACTCCAGAGCCCACACAAACCAGAGCCACCAGGGCCAGGACGGCTTCCTCCCCGTCCGGGCCAGAACCCGCAGCAGTGA

XM_004865438.1 Coding sequence

LOC101697450 zinc finger protein 699-like

Length: 690 bp    Location: 1707270..1698996   Strand: -
>XM_004865438.1
ATGCGGCAGCCATGTCACCTCGCGTCTCTAAGCGCGTCTGAAGTAAATTTTTCCCTTAGTTTGTCCTGGCCCCGCCCCATCCATTTTCCAGGCCCTGGAGGCGGAGGGCTGGGCTTACGGAAAGGGAAACCATCTCTGCTTTGGGGCCAGGGGCCGAGAATCTCCACGTCGCCGTCGCTGCGCGGGTCCCAGGATTTCTGCGTGCTGGGAAACATGGACAAAGCAAGAAGAGCTGCTGGGTTACAGAAAAATATGATACAGGACTTACTGACCTTTGAAGATGTGGCTGTATACTTTACCAAGGAGGAGTGGGCTTTGCTGGATCTTATTCAGAAGAACCTCTACAGAGATGTGATGCTGGAAACCTTCCAGAACTTGGTCTCACTAGGGTACCAAGTATCCATACCCCATCTGATCTCCCAGTGGGAACAAGAGGAAGACCTGCTGAAGGTAAAGGGAGGACTTATCCAGGGCATTTGTATGAAAGAACACCAGGAAGTTTCAGGTTTTGAGACTCAACTCAATACTAATGAATTAGTTGCTTTTCAAGATATTGATGGAGAAAAAACATCCAGAGAACAGAAAATAAGAGTCAAAAGAACTGGTTCCTGTTCCTTTATTTTACATGAAAATTGGGAATCCCATGGTGTTGATGAGCAGAACAAAAGCCATGAGAGACATTTGAGGTGA

XM_004865432.1 Coding sequence

Znf177 zinc finger protein 177, transcript variant X1

Length: 1401 bp    Location: 1711063..1721102   Strand: +
>XM_004865432.1
ATGGCTACAGGATTGCTGACAGCCCAGTCCCAGAACTCAGTGACCTTCCAGGAAGTGGCAGTGGACTTTTCCCATGAGGAATGGGCATTGCTGAACCCTGCTCAAAAAAGTCTATACAGAGATGTGACACTGGAGAACTTTAAGAACCTGGCCTCAGTGGCAGGTTACCAGGTCTGCAAACACAGTCTGACCTCCAAGGTGGAACAGGGAGAGCTGAGGACAGAGGAGAGAGAAGTTCTTCAAAGCGCCTGTGCAGGCTGGCAAGCTCAACTTAAATCAAAAGATGCAATTCCTATGCAGAATGTTCCTAGGGATACATCCAGTGGCATAAGGATGGTACGAACTCAACCTGGCACGAAACCTGTAGAAAGCAATCATTGTGAAAAATTCTTCAGAAAGAACCTTCATTTTTTTTATACCAGGCATTTCAAGGAAGAAAAGTCCTGTAGGTATATAGAATATGGCAAAGTCTTCAGACATTCTTCGGCTCCTAGGAGTCATGTGAAAAAAGCTTTCAGTGGGGAGTCAACCCTTATGAAACATTTAAGAATTCTCACAGGAGAGTGTGCTCATGAGTGTAATCAGTGTGGTATATCCCTCACTCTACATCCTTCCTTCTCAGCATATGGACAAATACATGCTGGAGAGAAACTCTGTAAATGCACTGACTATGGAAAAACATCTTCATTTAATGTTCACAAAAACATACAAACCATGGAGGAGGGCTTGGGACGTAATGAATGTGGGAAAGCTTTCACTGGCCCTGTATCCCTTCAGAAATATGTCAGAACTCACACTGGAGAGAAGTTCTATGAGTGCAGTGACTGTGGAAAAGTCTTCATTTTTCAGTCTTCCCTTAAGAAACACATGAGGTCCCACACTGGTGAGAAACCCTATGAATGTAATCATTGTGGGAAATCCTTCAGCCAGAGCTCTCATCTCAATGTGCACAGAAGAACTCACACTGGAGAGAAACCCTACCAATGTAAGGAATGTGGGAAGGCCTTCACTGTTCCTTCATCCCTTCAGAAACACGTGAGGACCCACACAGGAGAGAAACCCTATGAGTGCAGTGACTGTGGGAAAGCCTTCATTGATCAGTCATCCCTTAAGAAACACACACGATCTCACACTGGAGAAAAACCTTACAAGTGCAATCAATGTGGAAAATCCTTCAGCACAGGCTCTTACCTGATTGTGCACAAAAGAACTCACACTGGAGAGAAAACCTATGAGTGTAAAGAATGTGGAAAGGCGTTTAGAAATTCCTCTTGCCTGAGGGTACATGTGAGAACACACACTGGAGAGAAGCCCTATAAATGTATTGAGTGTGGAAAAGCTTTCAGCACAAGTACTAACCTTATAATGCACAAACGAATGCATACTGGACAGAAGGTATGA

XM_004865434.1 Coding sequence

Znf177 zinc finger protein 177, transcript variant X3

Length: 1401 bp    Location: 1711063..1721102   Strand: +
>XM_004865434.1
ATGGCTACAGGATTGCTGACAGCCCAGTCCCAGAACTCAGTGACCTTCCAGGAAGTGGCAGTGGACTTTTCCCATGAGGAATGGGCATTGCTGAACCCTGCTCAAAAAAGTCTATACAGAGATGTGACACTGGAGAACTTTAAGAACCTGGCCTCAGTGGCAGGTTACCAGGTCTGCAAACACAGTCTGACCTCCAAGGTGGAACAGGGAGAGCTGAGGACAGAGGAGAGAGAAGTTCTTCAAAGCGCCTGTGCAGGCTGGCAAGCTCAACTTAAATCAAAAGATGCAATTCCTATGCAGAATGTTCCTAGGGATACATCCAGTGGCATAAGGATGGTACGAACTCAACCTGGCACGAAACCTGTAGAAAGCAATCATTGTGAAAAATTCTTCAGAAAGAACCTTCATTTTTTTTATACCAGGCATTTCAAGGAAGAAAAGTCCTGTAGGTATATAGAATATGGCAAAGTCTTCAGACATTCTTCGGCTCCTAGGAGTCATGTGAAAAAAGCTTTCAGTGGGGAGTCAACCCTTATGAAACATTTAAGAATTCTCACAGGAGAGTGTGCTCATGAGTGTAATCAGTGTGGTATATCCCTCACTCTACATCCTTCCTTCTCAGCATATGGACAAATACATGCTGGAGAGAAACTCTGTAAATGCACTGACTATGGAAAAACATCTTCATTTAATGTTCACAAAAACATACAAACCATGGAGGAGGGCTTGGGACGTAATGAATGTGGGAAAGCTTTCACTGGCCCTGTATCCCTTCAGAAATATGTCAGAACTCACACTGGAGAGAAGTTCTATGAGTGCAGTGACTGTGGAAAAGTCTTCATTTTTCAGTCTTCCCTTAAGAAACACATGAGGTCCCACACTGGTGAGAAACCCTATGAATGTAATCATTGTGGGAAATCCTTCAGCCAGAGCTCTCATCTCAATGTGCACAGAAGAACTCACACTGGAGAGAAACCCTACCAATGTAAGGAATGTGGGAAGGCCTTCACTGTTCCTTCATCCCTTCAGAAACACGTGAGGACCCACACAGGAGAGAAACCCTATGAGTGCAGTGACTGTGGGAAAGCCTTCATTGATCAGTCATCCCTTAAGAAACACACACGATCTCACACTGGAGAAAAACCTTACAAGTGCAATCAATGTGGAAAATCCTTCAGCACAGGCTCTTACCTGATTGTGCACAAAAGAACTCACACTGGAGAGAAAACCTATGAGTGTAAAGAATGTGGAAAGGCGTTTAGAAATTCCTCTTGCCTGAGGGTACATGTGAGAACACACACTGGAGAGAAGCCCTATAAATGTATTGAGTGTGGAAAAGCTTTCAGCACAAGTACTAACCTTATAATGCACAAACGAATGCATACTGGACAGAAGGTATGA

XM_004865433.1 Coding sequence

Znf177 zinc finger protein 177, transcript variant X2

Length: 1401 bp    Location: 1711063..1721102   Strand: +
>XM_004865433.1
ATGGCTACAGGATTGCTGACAGCCCAGTCCCAGAACTCAGTGACCTTCCAGGAAGTGGCAGTGGACTTTTCCCATGAGGAATGGGCATTGCTGAACCCTGCTCAAAAAAGTCTATACAGAGATGTGACACTGGAGAACTTTAAGAACCTGGCCTCAGTGGCAGGTTACCAGGTCTGCAAACACAGTCTGACCTCCAAGGTGGAACAGGGAGAGCTGAGGACAGAGGAGAGAGAAGTTCTTCAAAGCGCCTGTGCAGGCTGGCAAGCTCAACTTAAATCAAAAGATGCAATTCCTATGCAGAATGTTCCTAGGGATACATCCAGTGGCATAAGGATGGTACGAACTCAACCTGGCACGAAACCTGTAGAAAGCAATCATTGTGAAAAATTCTTCAGAAAGAACCTTCATTTTTTTTATACCAGGCATTTCAAGGAAGAAAAGTCCTGTAGGTATATAGAATATGGCAAAGTCTTCAGACATTCTTCGGCTCCTAGGAGTCATGTGAAAAAAGCTTTCAGTGGGGAGTCAACCCTTATGAAACATTTAAGAATTCTCACAGGAGAGTGTGCTCATGAGTGTAATCAGTGTGGTATATCCCTCACTCTACATCCTTCCTTCTCAGCATATGGACAAATACATGCTGGAGAGAAACTCTGTAAATGCACTGACTATGGAAAAACATCTTCATTTAATGTTCACAAAAACATACAAACCATGGAGGAGGGCTTGGGACGTAATGAATGTGGGAAAGCTTTCACTGGCCCTGTATCCCTTCAGAAATATGTCAGAACTCACACTGGAGAGAAGTTCTATGAGTGCAGTGACTGTGGAAAAGTCTTCATTTTTCAGTCTTCCCTTAAGAAACACATGAGGTCCCACACTGGTGAGAAACCCTATGAATGTAATCATTGTGGGAAATCCTTCAGCCAGAGCTCTCATCTCAATGTGCACAGAAGAACTCACACTGGAGAGAAACCCTACCAATGTAAGGAATGTGGGAAGGCCTTCACTGTTCCTTCATCCCTTCAGAAACACGTGAGGACCCACACAGGAGAGAAACCCTATGAGTGCAGTGACTGTGGGAAAGCCTTCATTGATCAGTCATCCCTTAAGAAACACACACGATCTCACACTGGAGAAAAACCTTACAAGTGCAATCAATGTGGAAAATCCTTCAGCACAGGCTCTTACCTGATTGTGCACAAAAGAACTCACACTGGAGAGAAAACCTATGAGTGTAAAGAATGTGGAAAGGCGTTTAGAAATTCCTCTTGCCTGAGGGTACATGTGAGAACACACACTGGAGAGAAGCCCTATAAATGTATTGAGTGTGGAAAAGCTTTCAGCACAAGTACTAACCTTATAATGCACAAACGAATGCATACTGGACAGAAGGTATGA

XM_004865436.1 Coding sequence

Znf177 zinc finger protein 177, transcript variant X5

Length: 1401 bp    Location: 1711066..1721102   Strand: +
>XM_004865436.1
ATGGCTACAGGATTGCTGACAGCCCAGTCCCAGAACTCAGTGACCTTCCAGGAAGTGGCAGTGGACTTTTCCCATGAGGAATGGGCATTGCTGAACCCTGCTCAAAAAAGTCTATACAGAGATGTGACACTGGAGAACTTTAAGAACCTGGCCTCAGTGGCAGGTTACCAGGTCTGCAAACACAGTCTGACCTCCAAGGTGGAACAGGGAGAGCTGAGGACAGAGGAGAGAGAAGTTCTTCAAAGCGCCTGTGCAGGCTGGCAAGCTCAACTTAAATCAAAAGATGCAATTCCTATGCAGAATGTTCCTAGGGATACATCCAGTGGCATAAGGATGGTACGAACTCAACCTGGCACGAAACCTGTAGAAAGCAATCATTGTGAAAAATTCTTCAGAAAGAACCTTCATTTTTTTTATACCAGGCATTTCAAGGAAGAAAAGTCCTGTAGGTATATAGAATATGGCAAAGTCTTCAGACATTCTTCGGCTCCTAGGAGTCATGTGAAAAAAGCTTTCAGTGGGGAGTCAACCCTTATGAAACATTTAAGAATTCTCACAGGAGAGTGTGCTCATGAGTGTAATCAGTGTGGTATATCCCTCACTCTACATCCTTCCTTCTCAGCATATGGACAAATACATGCTGGAGAGAAACTCTGTAAATGCACTGACTATGGAAAAACATCTTCATTTAATGTTCACAAAAACATACAAACCATGGAGGAGGGCTTGGGACGTAATGAATGTGGGAAAGCTTTCACTGGCCCTGTATCCCTTCAGAAATATGTCAGAACTCACACTGGAGAGAAGTTCTATGAGTGCAGTGACTGTGGAAAAGTCTTCATTTTTCAGTCTTCCCTTAAGAAACACATGAGGTCCCACACTGGTGAGAAACCCTATGAATGTAATCATTGTGGGAAATCCTTCAGCCAGAGCTCTCATCTCAATGTGCACAGAAGAACTCACACTGGAGAGAAACCCTACCAATGTAAGGAATGTGGGAAGGCCTTCACTGTTCCTTCATCCCTTCAGAAACACGTGAGGACCCACACAGGAGAGAAACCCTATGAGTGCAGTGACTGTGGGAAAGCCTTCATTGATCAGTCATCCCTTAAGAAACACACACGATCTCACACTGGAGAAAAACCTTACAAGTGCAATCAATGTGGAAAATCCTTCAGCACAGGCTCTTACCTGATTGTGCACAAAAGAACTCACACTGGAGAGAAAACCTATGAGTGTAAAGAATGTGGAAAGGCGTTTAGAAATTCCTCTTGCCTGAGGGTACATGTGAGAACACACACTGGAGAGAAGCCCTATAAATGTATTGAGTGTGGAAAAGCTTTCAGCACAAGTACTAACCTTATAATGCACAAACGAATGCATACTGGACAGAAGGTATGA

XM_004865431.1 Coding sequence

LOC101725999 zinc finger protein 426-like

Length: 510 bp    Location: 1792528..1772553   Strand: -
>XM_004865431.1
ATGTTTCCCTGTCAGTCTTACAGGATGGAAGTCATTGATTTGTCCCATGCTTTATTTTCTAGTGGCCCAGTCTGTTTTCACGAAGAACAGAAAAAAGCAGAAAGCATGGTGGCTGACTGTTTTCCAAGTTATAAGGGCTCGCTGACCTTTGAGGATGTGGCTGTGGACTTCACTCCGGAGGAGTGGGCTTTACTGAACCCAATTGAGAGAAACTTATACAGAAAGGTGATGTTGGAGAACTACCAGAACCTGGTCTCAGTAGGATGTCAGCTCATCAAACCCAGCCTGATCTCTTGTTTGGAGGCAGAAGAAGAGTTAAGGACAGTGGAAAGAGGTGTTCTTCAAGAATGGGCACTGCGACTTCACACCAAAGAGACAGCACTTCAACGGGATATTTTTTGGTTAAAAACATCAAAAGAGATACAACCGGTAAGACTCACAAGAGATACTTCTAATTTTTCACATTCAGAGAGGATTGGGGGTTTTATGATAGAAATAAGAGACATTTGA

XM_004866053.1 Coding sequence

LOC101706350 zinc finger protein 26-like

Length: 2943 bp    Location: 1809460..1801117   Strand: -
>XM_004866053.1
ATGGAAAGATGTGTATGTGACATGAATGTGGACTTCTGGTCAGCCCTGGGTTGTCATGTCTTCTCTTTTCCAGGAAGTCTACTTTCTGGGGACTCAGTCTGCAGTCATGAAGAAGAGATAGAGACAGAAAGGACAGTGGCTGACTCCCTGAGACATTACCAAGATTCAGGGACCTTTGAAGATGTGGCTGTTGATGGCCCCCAGGTGGAAAAACCTTTAATGAACCCAACACGGAGAAGCATACATAGTGATGGGATGGTGAAGAACTACCAGAACGTGGCAACAGTAGGATGTCAGACGCCCATCAAACTCAGCCCTATGGCTTGCTTGAAAGAAGAATTGCTGACTGGGCAGAAGGAACTTCTTCAAGATTTGGAAATGCAGTTACAAACCAAAGATTCAGCAATTCAGCAGGATTTTTTGACTGAACATACTTCTGGTGGGATACAACTGGACTCAGTGACCTTTGAGGATGTGGCTGTGGACTTCACCAAAGAGGAGTGGACTTCATTGGACCCAACTCAGAGAAACCTTTACAAAGATGTGATGCTGGAGAACTACCAGAACCTGTCTACAGTAGGACGTCAGCTGTTGAAACCCAGCCTCATCTCTTGGTTGGAGGAAGAAGTAGAATTGACCATTGTGGAGCGAGGCTTTTTCCAAGAATGGGAAATGCACCTGAAAACCAAAGGTCCAGCCCTTGAGAAGGATATTTTCTGGTCAGATATATCAAACGAGATACAACAGGTAAGAGTCACTGGGATGGGCCGGGGATTTAGCTCAGCAGGAAATGACAATGAAGGGGAGCTCTGTGACCCTAAGCAATCTGGAAAAGTCTTCAGTGAATATACAGACCTTCAGGTACACGTGAGTACTCCGAATACAGAGGACTCTTCAGAGTGTAATCAATATGAAAAGGACTTTCTTCCGCTGCTGGAAAAAACCTCTCCTGAAGAGAAGTTTTCTCTTTTGAACCAGTGTGCAGAGCCTTCTACCCTGGCTCTAGATACTTTCCACAGAACTTCTACTCACGACAAATCCTTTGAGGGCAGTGAGTCTGGGAAAGCTTTTGTTAATCAGTCACAGCTTCAGGGCCATATGAAAACTCACAGTGGAGAAAACCTCTCTGAATTGGAGCAGTGTGGGAAAGCTTTTAGTCTCTCCACAAACAGTGATGGGTATGCTCAAATGTCCACTGAGAAAAATTTCTATGAATGTAAGAAATGTGGGAAATTCTTCACACACCCGGCTTACCTTAATATTCATATGCAGAACCACCCTGTTGAAAAACCATATAAATGTCAGGAATGTGGGAAAGCCTTCACACAGCGCTCCAGCTTAATTGTACATCTACGACAGCACACTCGAGAGAAGTCTTATGAGTGCAAGGAATGTGGGAAAGCCTTCATTCAACCATCACGCCTTACTGAACATATGAGATGTCACACAGGAGAGAAACCCTTTCAGTGTGATCATTGTGGGAATGCCTTTGCTTCTTCCTCTTATCTTACTACACATCTGAGAACCCACACTGGAGAGAAGCCCTTTGAGTGTAATACTCACTTTCGAATTCACACTGGAATAAAACCCTATAAATGTAACTTCTGTGGGAAGGACTTCACTGCTCGATCAGGCCTTACTAAGCATGTACTCATTCACAATGGTGAGAAACCCTATGACTGTAAGGAGTGTGGGAAAGCATTTAGTACATCCTCAGCGCTTGTTGAACATATAAGAATTCATACAGGGGAGAAGCCCTTTGAATGTTACAAATGTGGTAAAGCCTTGGCTTATTCCTCATCTCTTGTTGCACATTTGCGATCTCACACTGGAGAGAAGCCCTTTCAGTGTAACCTGTGTGAGAAAGCATTTTCCCGATCCTCCTACCTTCGCATTCACATGCGAACTCACACTGGTGAGAAACCCTATGAATGTACAGAATGTGGGAAAACCTTCCCTGAGCGCTCATGTCTCACTAAGCATGTAAGGACACATACTGGGGAGAGGCCATATGAATGTAAGGAGTGTGGGAAAGGTTTCACTAGCTTTGCTCAACTTACAGTACACATAAAAACTCACAGTAGTGAGAGGCCCTTCAAATGTAAGCTATGCACAAAGTCTTTCAGAAATTCTTCATCCCTTGAGACCCACTTTCGAATTCACACTGGAGTAAAACCTTATAAATGTACTTATTGTGGGAAAGACTTTACTGCACGCTCAGGCCTTACTATACATTTACGAAATCACACTGGTGAGAAGTCCTATGCATGTCAGGAATGTGGGAAAGCCTTCACTACTTCCTCAGGCCTTATTGCACATGTACGAAGTCACAAGGGTGAGAAACCCTTTGAATGTGACCACTGTGGGAAAGCCTTTGCGTCTTCCTCATATCTTAATGTACATCTGAAGATTCACACTGGAGAGAAACCTTTTCAGTGCACAGTGTGTGGAAAGACATTTACCTGTTCTTCTTACCTTCCCGTTCACATGCGAACACATACTGGGGAGAAGCCCTTTCAGTGTATGATATGTGGGAAATCATTTTTATGGTCCTCTTACCTTCGTGTTCACATGCGAATTCACACTGGAGAGAAGCCCTATGTATGTAAGTACTGTGGAAAAGCCTTTACTGAGCACTCAGGCCTTAATAAACATTTACGAAAACACACCGGAGAGGCACCATATGGAGAGACACCCACACCACTCAGAGAGACACCCACAGTGTTTGGAGAGTCACCTGTACCTTTTGGAGAGACACCTGGACCTGCGTCTTTTGGAGAGACACCTGCACCATTTCGAGTAACACCATATGAGTACAAGGAATGTGAGGAAACCTTAAATAGTCTCGATGCTAACATAAACCCTTCTGACATTAATGAACATGAAAACTCTGGAGAGAAATGCTTTGTAAGGAATTCAGAAAATGTTTTGGGAAGTCCTTAA

XM_004865450.1 Coding sequence

LOC101701349 zinc finger protein 426-like, transcript variant X3

Length: 1590 bp    Location: 1904223..1861096   Strand: -
>XM_004865450.1
ATGGTAGCTGACTGGCTGACAGATTATCAGGAGTCAGTGAGCTTTGATGATGTGGCTGTGGACTTCACCCAGGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAACCTATATGGTGATGTGATGCTGGAGAACTACCAGAACCTGGCCACAGTAGGATGTCAGATCATCAAGCCCAGTCTGATCTCTTGGTTGGAACAAGAAGGAGAGTTAAGGACAGGTCAGAGAAGAGTTCTCCAAGAATGGGAAATGCAACTTAAAACCAAATGCTCGGCACTTCAGCAGGAAATTTTAAGGAGTAACCTGTCCAATGATATACGAATGCAACAGGCAGGAATCCACAATGGAGGAGGACTCTATGACTGGAAGCAATGTGAAGAATTCTTCAGTGAACACACATGCGGTAAGACCCACATGAAAACTCAAAGTATAGGAGACACTTATGATTGTGATCAGCGTGGAAAAGATTTCCTTACTGTTCAACAAGAAACCTCTACTAGAGAGAAACTTTCTGCATTTAATCGGAGTGGAGAAATCTTCTGCATGTCACCTAATGTTTACCAGAGACAGTTGTTTACTAGCACACAAGAGAAATCCTTTGAATGCAGTGACTGTGGGAAATCCTTTGTTAATCAGTCACACCTTCAAGCACATTGGGAAATTCACAGTGGAGACAAACTCTGTGAATGGAAGGAATATGGGGGTTTTATAAACTCTGCAAGCCTTCCTGTGCTTATAGAAACACTCAATGCAAGAAAACCTTACAAATGTAAGGAATGTGGGAAAGGCTATAGATATCCTGCATATCTAAATATTCACATGCGAACTCACACTGGAGAGAAACCCTATGAATGTAAGGAATGTGGAAAAGCCTTCAATTACTCTAATTCATTTCAAATACATGGAAGAACTCACACTGGAGAGAAACCCTATATATGCAAGCTATGTGGAAAAGCTTTCACTCAGTACTCGGGCCTTAGTATACATCTACGATCTCACAGTGGAGACAAGCCCTATGAATGTAAGGAATGTGGGAAAGCATTCCTTACATCCTCACGTCTTATTCAACATATAAGGATTCACACAGGAGAGAAGCCTTTTGTATGTGTCCAATGTGGGAAAGCCTTTGCTATTTCTTCAAATCTTAGTGGACATCTAAGAACTCACACTGAGGAGAAGGCCTGTGAGTGTAAGGTATGTGGGAAAGTATTTGGGTATCCCTCATGTCTTAATAATCACATGCGAACTCACAGTGCCCCCAAATCCTACACATGTAAGGAATGTGGGAAGGCTTTTAACTATTCTACCCATCTTAAAATTCACATGCGAATCCACACTGGAGAAAAACCCTATGAGTGTAAACAGTGTGGGAAAGCCTTTAGTCATTCCAGTTCATTTCATATACATGAAAGAACTCACACTGGAGAGAAGCCCTTTGAATGTAAGGAATGTGGGAAAACTTTCATATGTTCCAGTTCCTTTAGAATTCATGAAAGAACTCACACTGAAGAGAAACCCTATAAATGTCAGCAATGTGGGAAAGCCTACAGTCATCCTCGTTCGCTTCGAAGACATGGAAAGACTCATTAG

XM_004865449.1 Coding sequence

LOC101701349 zinc finger protein 426-like, transcript variant X2

Length: 1590 bp    Location: 1882704..1861096   Strand: -
>XM_004865449.1
ATGGTAGCTGACTGGCTGACAGATTATCAGGAGTCAGTGAGCTTTGATGATGTGGCTGTGGACTTCACCCAGGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAACCTATATGGTGATGTGATGCTGGAGAACTACCAGAACCTGGCCACAGTAGGATGTCAGATCATCAAGCCCAGTCTGATCTCTTGGTTGGAACAAGAAGGAGAGTTAAGGACAGGTCAGAGAAGAGTTCTCCAAGAATGGGAAATGCAACTTAAAACCAAATGCTCGGCACTTCAGCAGGAAATTTTAAGGAGTAACCTGTCCAATGATATACGAATGCAACAGGCAGGAATCCACAATGGAGGAGGACTCTATGACTGGAAGCAATGTGAAGAATTCTTCAGTGAACACACATGCGGTAAGACCCACATGAAAACTCAAAGTATAGGAGACACTTATGATTGTGATCAGCGTGGAAAAGATTTCCTTACTGTTCAACAAGAAACCTCTACTAGAGAGAAACTTTCTGCATTTAATCGGAGTGGAGAAATCTTCTGCATGTCACCTAATGTTTACCAGAGACAGTTGTTTACTAGCACACAAGAGAAATCCTTTGAATGCAGTGACTGTGGGAAATCCTTTGTTAATCAGTCACACCTTCAAGCACATTGGGAAATTCACAGTGGAGACAAACTCTGTGAATGGAAGGAATATGGGGGTTTTATAAACTCTGCAAGCCTTCCTGTGCTTATAGAAACACTCAATGCAAGAAAACCTTACAAATGTAAGGAATGTGGGAAAGGCTATAGATATCCTGCATATCTAAATATTCACATGCGAACTCACACTGGAGAGAAACCCTATGAATGTAAGGAATGTGGAAAAGCCTTCAATTACTCTAATTCATTTCAAATACATGGAAGAACTCACACTGGAGAGAAACCCTATATATGCAAGCTATGTGGAAAAGCTTTCACTCAGTACTCGGGCCTTAGTATACATCTACGATCTCACAGTGGAGACAAGCCCTATGAATGTAAGGAATGTGGGAAAGCATTCCTTACATCCTCACGTCTTATTCAACATATAAGGATTCACACAGGAGAGAAGCCTTTTGTATGTGTCCAATGTGGGAAAGCCTTTGCTATTTCTTCAAATCTTAGTGGACATCTAAGAACTCACACTGAGGAGAAGGCCTGTGAGTGTAAGGTATGTGGGAAAGTATTTGGGTATCCCTCATGTCTTAATAATCACATGCGAACTCACAGTGCCCCCAAATCCTACACATGTAAGGAATGTGGGAAGGCTTTTAACTATTCTACCCATCTTAAAATTCACATGCGAATCCACACTGGAGAAAAACCCTATGAGTGTAAACAGTGTGGGAAAGCCTTTAGTCATTCCAGTTCATTTCATATACATGAAAGAACTCACACTGGAGAGAAGCCCTTTGAATGTAAGGAATGTGGGAAAACTTTCATATGTTCCAGTTCCTTTAGAATTCATGAAAGAACTCACACTGAAGAGAAACCCTATAAATGTCAGCAATGTGGGAAAGCCTACAGTCATCCTCGTTCGCTTCGAAGACATGGAAAGACTCATTAG

XM_004865451.1 Coding sequence

LOC101701349 zinc finger protein 426-like, transcript variant X4

Length: 1590 bp    Location: 1882378..1861096   Strand: -
>XM_004865451.1
ATGGTAGCTGACTGGCTGACAGATTATCAGGAGTCAGTGAGCTTTGATGATGTGGCTGTGGACTTCACCCAGGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAACCTATATGGTGATGTGATGCTGGAGAACTACCAGAACCTGGCCACAGTAGGATGTCAGATCATCAAGCCCAGTCTGATCTCTTGGTTGGAACAAGAAGGAGAGTTAAGGACAGGTCAGAGAAGAGTTCTCCAAGAATGGGAAATGCAACTTAAAACCAAATGCTCGGCACTTCAGCAGGAAATTTTAAGGAGTAACCTGTCCAATGATATACGAATGCAACAGGCAGGAATCCACAATGGAGGAGGACTCTATGACTGGAAGCAATGTGAAGAATTCTTCAGTGAACACACATGCGGTAAGACCCACATGAAAACTCAAAGTATAGGAGACACTTATGATTGTGATCAGCGTGGAAAAGATTTCCTTACTGTTCAACAAGAAACCTCTACTAGAGAGAAACTTTCTGCATTTAATCGGAGTGGAGAAATCTTCTGCATGTCACCTAATGTTTACCAGAGACAGTTGTTTACTAGCACACAAGAGAAATCCTTTGAATGCAGTGACTGTGGGAAATCCTTTGTTAATCAGTCACACCTTCAAGCACATTGGGAAATTCACAGTGGAGACAAACTCTGTGAATGGAAGGAATATGGGGGTTTTATAAACTCTGCAAGCCTTCCTGTGCTTATAGAAACACTCAATGCAAGAAAACCTTACAAATGTAAGGAATGTGGGAAAGGCTATAGATATCCTGCATATCTAAATATTCACATGCGAACTCACACTGGAGAGAAACCCTATGAATGTAAGGAATGTGGAAAAGCCTTCAATTACTCTAATTCATTTCAAATACATGGAAGAACTCACACTGGAGAGAAACCCTATATATGCAAGCTATGTGGAAAAGCTTTCACTCAGTACTCGGGCCTTAGTATACATCTACGATCTCACAGTGGAGACAAGCCCTATGAATGTAAGGAATGTGGGAAAGCATTCCTTACATCCTCACGTCTTATTCAACATATAAGGATTCACACAGGAGAGAAGCCTTTTGTATGTGTCCAATGTGGGAAAGCCTTTGCTATTTCTTCAAATCTTAGTGGACATCTAAGAACTCACACTGAGGAGAAGGCCTGTGAGTGTAAGGTATGTGGGAAAGTATTTGGGTATCCCTCATGTCTTAATAATCACATGCGAACTCACAGTGCCCCCAAATCCTACACATGTAAGGAATGTGGGAAGGCTTTTAACTATTCTACCCATCTTAAAATTCACATGCGAATCCACACTGGAGAAAAACCCTATGAGTGTAAACAGTGTGGGAAAGCCTTTAGTCATTCCAGTTCATTTCATATACATGAAAGAACTCACACTGGAGAGAAGCCCTTTGAATGTAAGGAATGTGGGAAAACTTTCATATGTTCCAGTTCCTTTAGAATTCATGAAAGAACTCACACTGAAGAGAAACCCTATAAATGTCAGCAATGTGGGAAAGCCTACAGTCATCCTCGTTCGCTTCGAAGACATGGAAAGACTCATTAG

XM_004865452.1 Coding sequence

LOC101701349 zinc finger protein 426-like, transcript variant X5

Length: 486 bp    Location: 1879978..1861096   Strand: -
>XM_004865452.1
ATGGAACCAGTTAGCCTTCAGGAAGAAAAGGCACCCGCAGAAAGGATGGTAGCTGACTGGCTGACAGATTATCAGGAGTCAGTGAGCTTTGATGATGTGGCTGTGGACTTCACCCAGGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAACCTATATGGTGATGTGATGCTGGAGAACTACCAGAACCTGGCCACAGTAGGATGTCAGATCATCAAGCCCAGTCTGATCTCTTGGTTGGAACAAGAAGGAGAGTTAAGGACAGGTCAGAGAAGAGTTCTCCAAGAATGGGAAATGCAACTTAAAACCAAATGCTCGGCACTTCAGCAGGAAATTTTAAGGAGTAACCTGTCCAATGATATACGAATGCAACAGGCAGGAATCCACAATGGAGGAGGACTCTATGACTGGAAGCAATGTGAAGAATTCTTCAGTGAACACACATGCGGTATTCCAGAGACTGAAAAAGGAGGATCTAGAGTTTGA

XM_004865448.1 Coding sequence

LOC101701349 zinc finger protein 426-like, transcript variant X1

Length: 1635 bp    Location: 1879978..1861096   Strand: -
>XM_004865448.1
ATGGAACCAGTTAGCCTTCAGGAAGAAAAGGCACCCGCAGAAAGGATGGTAGCTGACTGGCTGACAGATTATCAGGAGTCAGTGAGCTTTGATGATGTGGCTGTGGACTTCACCCAGGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAACCTATATGGTGATGTGATGCTGGAGAACTACCAGAACCTGGCCACAGTAGGATGTCAGATCATCAAGCCCAGTCTGATCTCTTGGTTGGAACAAGAAGGAGAGTTAAGGACAGGTCAGAGAAGAGTTCTCCAAGAATGGGAAATGCAACTTAAAACCAAATGCTCGGCACTTCAGCAGGAAATTTTAAGGAGTAACCTGTCCAATGATATACGAATGCAACAGGCAGGAATCCACAATGGAGGAGGACTCTATGACTGGAAGCAATGTGAAGAATTCTTCAGTGAACACACATGCGGTAAGACCCACATGAAAACTCAAAGTATAGGAGACACTTATGATTGTGATCAGCGTGGAAAAGATTTCCTTACTGTTCAACAAGAAACCTCTACTAGAGAGAAACTTTCTGCATTTAATCGGAGTGGAGAAATCTTCTGCATGTCACCTAATGTTTACCAGAGACAGTTGTTTACTAGCACACAAGAGAAATCCTTTGAATGCAGTGACTGTGGGAAATCCTTTGTTAATCAGTCACACCTTCAAGCACATTGGGAAATTCACAGTGGAGACAAACTCTGTGAATGGAAGGAATATGGGGGTTTTATAAACTCTGCAAGCCTTCCTGTGCTTATAGAAACACTCAATGCAAGAAAACCTTACAAATGTAAGGAATGTGGGAAAGGCTATAGATATCCTGCATATCTAAATATTCACATGCGAACTCACACTGGAGAGAAACCCTATGAATGTAAGGAATGTGGAAAAGCCTTCAATTACTCTAATTCATTTCAAATACATGGAAGAACTCACACTGGAGAGAAACCCTATATATGCAAGCTATGTGGAAAAGCTTTCACTCAGTACTCGGGCCTTAGTATACATCTACGATCTCACAGTGGAGACAAGCCCTATGAATGTAAGGAATGTGGGAAAGCATTCCTTACATCCTCACGTCTTATTCAACATATAAGGATTCACACAGGAGAGAAGCCTTTTGTATGTGTCCAATGTGGGAAAGCCTTTGCTATTTCTTCAAATCTTAGTGGACATCTAAGAACTCACACTGAGGAGAAGGCCTGTGAGTGTAAGGTATGTGGGAAAGTATTTGGGTATCCCTCATGTCTTAATAATCACATGCGAACTCACAGTGCCCCCAAATCCTACACATGTAAGGAATGTGGGAAGGCTTTTAACTATTCTACCCATCTTAAAATTCACATGCGAATCCACACTGGAGAAAAACCCTATGAGTGTAAACAGTGTGGGAAAGCCTTTAGTCATTCCAGTTCATTTCATATACATGAAAGAACTCACACTGGAGAGAAGCCCTTTGAATGTAAGGAATGTGGGAAAACTTTCATATGTTCCAGTTCCTTTAGAATTCATGAAAGAACTCACACTGAAGAGAAACCCTATAAATGTCAGCAATGTGGGAAAGCCTACAGTCATCCTCGTTCGCTTCGAAGACATGGAAAGACTCATTAG

XM_004865447.1 Coding sequence

LOC101700986 AP-3 complex subunit sigma-1-like

Length: 165 bp    Location: 1866727..1866518   Strand: -
>XM_004865447.1
ATGATCAAGGCGATCCTCATCTTCAACAACCACAGGAAGCCGTGGCTCTTTAAGTTCTACCAGCCTTACAGTGAGGGTACACAACAAATCATCAGGGAGACTTTCCATTTGGTATCTAAGAGAGATGAAAATGTTTGTAATTTCCTAGAAGGAGGATTTTGGTAA

XM_004865457.1 Coding sequence

Znf778 zinc finger protein 778, transcript variant X1

Length: 474 bp    Location: 2027757..2045143   Strand: +
>XM_004865457.1
ATGTTCAAACCCCGCAGGCTCCACGCACGGCCGGAAGCGGAAATGACGCCAACGGGTCCCCTCCGTTGTCCTTCTTGCCGCTGGTGGCTCGGTGCTGTGTCGAGGTGCCTTCCTCATGGAGCTCTTCTTTCTAGGGACCCAGTCTCCTTTTTTGAAGAAAAGATAAAGGAAGAGAGGATGGTGGCTGACTGCCTGACAAACTGCTATCAGGACTCGGTGACCTTTGAGGATGTGGCCTTGGACTTCACCCAGGAGGAGTGGGTTTTACTGGATCAAAGTCACAGAGACCTTTACAGAGAGGTGATGTTGGAGAACTATGAGAACCTGACCTCCATGGGTAAGAACGCCGTCGTGTCTTTCGGCCTCCTAGGGAGGAGATGGAGGCTGTGCACTTCCTGTGTCACAGCCTGGGTGATGTGGACTCTGTGTCCCCTGGGAAATGAGAGGGACATAGCCTCTGTCCCTGGATGGTAG

XM_004865454.1 Coding sequence

LOC101702633 zinc finger protein 561-like, transcript variant X2

Length: 993 bp    Location: 1915997..1908048   Strand: -
>XM_004865454.1
ATGGATCTTCAAATGTTCAATGGAGAAAACCCCTACAAATTGGAGGAATATGAAAAGGGCTTTCAGTATTTTCCATGCCTTACTAATCCCATGGAAACCCACACTGAAGCAACACTGTGTGAATGTGAGGAATGTTGGAGAGCATTTGCCTTTTCCTCACACCTAAGTCAATATGTAACAATTTCTTCTGGAGAGAAATCCCAAAAATGTAAGGAATGTGGGAAGTGCTTTGCTACTTTTACTCAACTTTCTGCACATATGGAAGTTCATACTGGAGAAAAGCCCTTCCAGTGTAAAGAGTGTGGAAAGTGCTTTACAAATAACACATACCTTAACGATCACAGGAAAATTCACACTGGAATAAAATCATACAAATGTGTGGAATGTGGGAAAGCCTTCTTGAGGTGGTCAGGCCTGACTGAACACTTACGAGGAGTTCACAGTGGAGAGAAGCCCTTTGTGTGTAAGGAATGTGGGAAAGCCTTCTCGAGGTCCACTCAGCTTAATGAACATATCAGGACACACACTGGAGTCAAACCCTACGAATGTAAGGACTGTGGGAAAGCCTTCACTCAGTACTCAGGCCTTGCTACCCACGTGCGCATTCACAGTGGAGAGAAGCCCTTTCAGTGTAACCAGTGTGGGAAAGCCTTCACTAGGACCTCAGGCCTCATTCACCATGTAAGAACACACACAGGTGAGAAGCCTTTTGAATGTGTCCATTGTGGGAAAACCTTTATTACTGCCTCCCACCGTACTAAACATATGAAAATTCACAGTGGAGAAAAGCCCTTTGTGTGCAATATTTGTGGGAAGGCGTTTGTATATTCCACATCCCTTAACATTCACATGCGAACGCATACTGGAGAGAAACCTTACATCTGTAAGGAATGTGGGAAAGCGTTTGCTGTTTCCTCACGCTTAAGCAAACATGCAAGTGTTCACCATGGGGAGAAGGCCTATAAATGTGAGGGTATCAGTGTTACTATTTAG

XM_004865453.1 Coding sequence

LOC101702633 zinc finger protein 561-like, transcript variant X1

Length: 993 bp    Location: 1915206..1908048   Strand: -
>XM_004865453.1
ATGGATCTTCAAATGTTCAATGGAGAAAACCCCTACAAATTGGAGGAATATGAAAAGGGCTTTCAGTATTTTCCATGCCTTACTAATCCCATGGAAACCCACACTGAAGCAACACTGTGTGAATGTGAGGAATGTTGGAGAGCATTTGCCTTTTCCTCACACCTAAGTCAATATGTAACAATTTCTTCTGGAGAGAAATCCCAAAAATGTAAGGAATGTGGGAAGTGCTTTGCTACTTTTACTCAACTTTCTGCACATATGGAAGTTCATACTGGAGAAAAGCCCTTCCAGTGTAAAGAGTGTGGAAAGTGCTTTACAAATAACACATACCTTAACGATCACAGGAAAATTCACACTGGAATAAAATCATACAAATGTGTGGAATGTGGGAAAGCCTTCTTGAGGTGGTCAGGCCTGACTGAACACTTACGAGGAGTTCACAGTGGAGAGAAGCCCTTTGTGTGTAAGGAATGTGGGAAAGCCTTCTCGAGGTCCACTCAGCTTAATGAACATATCAGGACACACACTGGAGTCAAACCCTACGAATGTAAGGACTGTGGGAAAGCCTTCACTCAGTACTCAGGCCTTGCTACCCACGTGCGCATTCACAGTGGAGAGAAGCCCTTTCAGTGTAACCAGTGTGGGAAAGCCTTCACTAGGACCTCAGGCCTCATTCACCATGTAAGAACACACACAGGTGAGAAGCCTTTTGAATGTGTCCATTGTGGGAAAACCTTTATTACTGCCTCCCACCGTACTAAACATATGAAAATTCACAGTGGAGAAAAGCCCTTTGTGTGCAATATTTGTGGGAAGGCGTTTGTATATTCCACATCCCTTAACATTCACATGCGAACGCATACTGGAGAGAAACCTTACATCTGTAAGGAATGTGGGAAAGCGTTTGCTGTTTCCTCACGCTTAAGCAAACATGCAAGTGTTCACCATGGGGAGAAGGCCTATAAATGTGAGGGTATCAGTGTTACTATTTAG

XM_004865463.1 Coding sequence

Znf426 zinc finger protein 426, transcript variant X3

Length: 1884 bp    Location: 1989308..1958631   Strand: -
>XM_004865463.1
ATGAAGAGGAATGGAGATTGCCTCTCTCTGCTTGGAGTCATAAGCTGCCCAGAAGTGGCCAGAGGGACTGTTTCAGGGACATTCCAGCCCCACAGGATGGCAGCCACTGATTTGTCGGAAGGCCTTCTCTACACAGAACCAATCTGCTTTTATGAAGACGAAACAAAGGTAGAAAGTGTGGTGGCTGACTACCAGGCAGATTGTTACCAGGATTCCGTGACCTTTGATGATGTGGCTCTGGAGTTCACCCAAGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAATCTGTACAGAGAGGTGATGCTAGAAAACTACGAGAACCTGTCTTCAGTAGGATACCAGTTCTTCATCCCTAGTCTGATCTCCTGGTTAAAACAAGAAGAATTAAACACAGCAGAAAATGGAGTTCTTCAACAGTTGGAGCTACAACCAGTAACCAAAGGATCAGAATTTGAGGATTATTTTAGGGAGGAAACTTCCAAAGAGATGGAAATGGTGAGAAGCCACAATGGAGAGGAGCTCTACGACTATAAGCCATATGGAGAAGTCTTCAGTGAACAGTTTTTCCTTAATACACACATGAGAACACAAAACCAAGAATATTCTTCGGGATATATTTGGTGTGGAGAAGACATCCTTACTCTGCACCAGAAAACCTCTACTGGACAGAACTTTTCCGAGATTGATCAGTATGGAAACATTTTCAATCTAACTCCAAATATTGCATACCAGACGACGTGCATGAGAAACAAACCCTTTGAGTGCAGGGATTGTGGGAATGCCTTTTTTAATCCATCATACCTTCAGATGGATATGAGAACTCAAAATGAAGGAGACCCCTATGAATGGAAGAAATATGAGAGTGGATATATTCACCCCATGAGCCTTGCTATGCATCTTCAAATTTTCAATGGAAGAAATCCCTACAAAATGGAGGAATTTGGAAAGAGCTTTCAGTATTTTCCATGCCTTACTAATCCCATGGAAACCCACACTGAAGAAACACTCTGTGAATGCAAGGAATGTTGGAAAGCATTCACAGTTTCCTCCCACCTAAATCAATATGTAACAGTTCATTCTAGAGAGAAAAACAAAAAATGTAAGGAATGTGGGAAGTGCTTTGCTACTTTTTCTCAACTGTCTGCACATATAAAAACTCACAGTGATGAAAAGCCCTTTCAATGTAAGGAGTGTGGAAAGTGCTTTAAAAATAACACATACCTTAACGATCACATGAGAATTCACACTGGAATAAAATCATACAAATGTGTGGAATGTGGGAAAGCCTTCCTGAGGTGGTCAGGCCTGACTGAACACTTACGAGTTCACACTGGAGAGAAGCCTTATGAATGTAAGGAATGTGGAAAAGCCTTCTCGAGGTCCACTCAGCTTACTGAACATATAAGAACACACACTGGAGTCAAACCCTACGAATGTAAGGACTGTGGGAAAGCCTTCACTCAGTACTCAGGCCTTGCTACCCACGTGCGCATTCACAGTGGAGAGAAGCCCTTTCAGTGTAACCAGTGTGGGAAAGCCTTCACTAGGACCTCAGGCCTCATTCACCATGTAAGAACACACACAGGCGAGAAGCCTTTTGAATGTGTCCATTGTGGGAAAACCTTTATTACTTCTTCCCACCGTACTAAACATTTGAAAATTCACAGTGGAGAAAAGCCTTTTGTGTGTAATATTTGTGGGAAGGCGTTTGTATATTCCACATCCCTTAACATTCACATGCGAACGCATACTGGAGAGAAACCTTACATCTGTAAGGAATGTGGGAAAGCGTTTGCTGTTTCCTCACGCTTAAGCAAACATGCAAGAGTTCACCATGGGGAGAAGGCCTATAAATGTGGGGGTATCAGTGTTACTATTTAG

XM_004865461.1 Coding sequence

Znf426 zinc finger protein 426, transcript variant X1

Length: 1884 bp    Location: 1989308..1958631   Strand: -
>XM_004865461.1
ATGAAGAGGAATGGAGATTGCCTCTCTCTGCTTGGAGTCATAAGCTGCCCAGAAGTGGCCAGAGGGACTGTTTCAGGGACATTCCAGCCCCACAGGATGGCAGCCACTGATTTGTCGGAAGGCCTTCTCTACACAGAACCAATCTGCTTTTATGAAGACGAAACAAAGGTAGAAAGTGTGGTGGCTGACTACCAGGCAGATTGTTACCAGGATTCCGTGACCTTTGATGATGTGGCTCTGGAGTTCACCCAAGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAATCTGTACAGAGAGGTGATGCTAGAAAACTACGAGAACCTGTCTTCAGTAGGATACCAGTTCTTCATCCCTAGTCTGATCTCCTGGTTAAAACAAGAAGAATTAAACACAGCAGAAAATGGAGTTCTTCAACAGTTGGAGCTACAACCAGTAACCAAAGGATCAGAATTTGAGGATTATTTTAGGGAGGAAACTTCCAAAGAGATGGAAATGGTGAGAAGCCACAATGGAGAGGAGCTCTACGACTATAAGCCATATGGAGAAGTCTTCAGTGAACAGTTTTTCCTTAATACACACATGAGAACACAAAACCAAGAATATTCTTCGGGATATATTTGGTGTGGAGAAGACATCCTTACTCTGCACCAGAAAACCTCTACTGGACAGAACTTTTCCGAGATTGATCAGTATGGAAACATTTTCAATCTAACTCCAAATATTGCATACCAGACGACGTGCATGAGAAACAAACCCTTTGAGTGCAGGGATTGTGGGAATGCCTTTTTTAATCCATCATACCTTCAGATGGATATGAGAACTCAAAATGAAGGAGACCCCTATGAATGGAAGAAATATGAGAGTGGATATATTCACCCCATGAGCCTTGCTATGCATCTTCAAATTTTCAATGGAAGAAATCCCTACAAAATGGAGGAATTTGGAAAGAGCTTTCAGTATTTTCCATGCCTTACTAATCCCATGGAAACCCACACTGAAGAAACACTCTGTGAATGCAAGGAATGTTGGAAAGCATTCACAGTTTCCTCCCACCTAAATCAATATGTAACAGTTCATTCTAGAGAGAAAAACAAAAAATGTAAGGAATGTGGGAAGTGCTTTGCTACTTTTTCTCAACTGTCTGCACATATAAAAACTCACAGTGATGAAAAGCCCTTTCAATGTAAGGAGTGTGGAAAGTGCTTTAAAAATAACACATACCTTAACGATCACATGAGAATTCACACTGGAATAAAATCATACAAATGTGTGGAATGTGGGAAAGCCTTCCTGAGGTGGTCAGGCCTGACTGAACACTTACGAGTTCACACTGGAGAGAAGCCTTATGAATGTAAGGAATGTGGAAAAGCCTTCTCGAGGTCCACTCAGCTTACTGAACATATAAGAACACACACTGGAGTCAAACCCTACGAATGTAAGGACTGTGGGAAAGCCTTCACTCAGTACTCAGGCCTTGCTACCCACGTGCGCATTCACAGTGGAGAGAAGCCCTTTCAGTGTAACCAGTGTGGGAAAGCCTTCACTAGGACCTCAGGCCTCATTCACCATGTAAGAACACACACAGGCGAGAAGCCTTTTGAATGTGTCCATTGTGGGAAAACCTTTATTACTTCTTCCCACCGTACTAAACATTTGAAAATTCACAGTGGAGAAAAGCCTTTTGTGTGTAATATTTGTGGGAAGGCGTTTGTATATTCCACATCCCTTAACATTCACATGCGAACGCATACTGGAGAGAAACCTTACATCTGTAAGGAATGTGGGAAAGCGTTTGCTGTTTCCTCACGCTTAAGCAAACATGCAAGAGTTCACCATGGGGAGAAGGCCTATAAATGTGGGGGTATCAGTGTTACTATTTAG

XM_004865456.1 Coding sequence

LOC101703942 zinc finger protein 91-like

Length: 2649 bp    Location: 2045609..2078124   Strand: +
>XM_004865456.1
ATGCATCTTTTCCCGTGTGCAGGGTGTGAGCTCATCAAACCCAGTCTGATCTCCTGGTTGGAACATGGAGAGGATTGGAGGACAGAGCAGAGAGGAGATCCCCGAGAATGGGAATTGCAACTTAGCACCAAGGAGGCAGCATTTCAGCAGGATTTTTTGAGGGGACAGACTTCAAATGGGATACCAACAGCAGGAAGCCAAAGTGCAGGGGAACTCTGTGACTATACGCAGTGTGGAGAAATCTTCAGTGAACACTCATATTTCAAGACACACATGAAAACTCAAAATATATGGAATGCAGGAAATTTTACCCACTCCGAGGGTCATGCTGTGCCTGTTCAAATGCACACCATAAAACACTATGCATGTAAGACTTGTGGAAAAGCCTTTGGGCGTTCTTCAAACCTTAATAGGCACATGCGAACCCATACTGGGGAGAAACCCTACGAATGTAAGGAATGTAGGAAGCCCTTCACGACTTACTCGAGGCTAGTGGAACATTTCAGAACTCATACTGGAGAGAAACCCTATAAATGTAAGGATTGTGGAAAAGCCTTCACTAAGCGCTCAGGCCTTATTACACATGTACCAACACATGCTTCCGAGAAACCCTATGAGTGTAAACAGTGTGGGAAAGCCTTCGCTTCATCCCCACGCCTTTCTCAACATGTGAGAACCCACAGTGGAGAGAGACCCTACACGTGTAAGGAATGTGGGAGAGCTTTCCTTACTTCCTCCTACCTGCGTAATCATGTAAGAAGAACTCACAGTGGAGAGAGACCCTATATATGTGGGGAATGTGGAAAAGCCTTCCATTCTTCCTCATACCTACGGAGACATGTAAAAACCCACAGTGGAGAGAGACCCTTCACATGTAAGGAATGTGGAAGAGCTTTCCTTACTTCCTCCTACCTCCATAACCACGTGAGAAAAACTCACAGTGGAGAAGTACCGTACATATGTGGCGAATGTGGGAAGGTCTTCCATGCATCCTCATACCTACGTAGACATGTAAGAACTCACAGTGGAGAGAGACCCTATATATGTAAGGAATGTGGGAAAGCCTTCCTCAATGTCTCCTATCTGCGTAAACATCTAACCATTCATACTGGAGAGAAACCTTATGAATGTCAGGAATGTGGGAAGGCCTATAATAGGTGTAATCTGCTCAATGAACACTTAAAAACTCACACAGTGGAAAAGCCCTTTGATTGTCATGTATGTGGAAAATCCTTTCAGTATTTCTCATACCTTACTAAGCATGTTCGTATTCACACTGGAATAAAGCCCTATAAATGTAAGTACTGTGGGAAAGCCTTTACCACCTCCTCAAGCCGAACTGAACATGTCAGGAGTCATACTGGGGAGAGGCCCTATGAATGTAGGGAATGTGGGAAAACCTTCACTTCGTCCTCAAACCTAATTCACCATGTAAAAATTCACACCCGAGAGAAGCCCTATAAGTCCTACGAATGTAAGGTTTGTGGGAAAGTCTTTGGATACTCCTCAAATCTTAATAGCCACATGCGAACCCACACTGGGGAGAAACCCTATGAATGTAAGGTTTGTGGGAAAGTCTTTGGATATTCCTCAAATCTTAATAGCCACATGCGAACCCACACTGGCGAGAAACTGTATGAATGTAAGGAATGCAAGAAGTCCTTCACTACTTCTTCAAGCCTAACAGAACATTTTAGAATTCATACTGGAGAGAAACCCCATAAATGTAAGGAATGTGGAAAAGCCTTCACAAAGCGCTCAGGCCTTGCTACACATGTACGAACACACACTGCAGAGAAACCCTATGTATGCAAGGCATGTGGCAAATCCTTCAGCATTTCTTCAAACCTAACCGAACACTTCAGAATTCATACTGGAGAGAAACCCTACCAGTGTGAGGAATGTGGGAAAGCCTTCCATGCTGCTTCCTACCTTCATAAACATGAAAGGATTCACACTGGAGAGAAAACCTATGAATGTGAGGAGTGTGGGAAAGCTTTCCACACTTCCTCCAATCTACGGAAACATATACGAACTCACACCGGAGAACGGCCCTATGAATGTAAGGAATGTGGGAAATCCTTCACTACATCTTCATGTCTGATTGTTCATATAAGAACTCACACAGGAGAGAAACCCTACCAATGTAAGGAATGTGGAAAAGCCTACAAAAGGTGTTACCTGCTGACTGAACATGTGAAAACTCACACAGGGGAAAAGCCCTTTGAATGTAATGTATGTGGAAAGTTCTTTAGAAATTCTTCATGCCTTAATAAGCACATTCGTATCCATACTGGAATAAAACCCTATAAGTGTCAGTACTGTGGGAAAGCCTTCACCACTTCTTCAAGCCTGGCTGAACACATCAGAACTCACACAGGGGAGAAGCCCTATGAATGTAGCGAATGTGGGAAAGCCTTCACAACATCCTCGAACCGATATCACCATGCAAGAACTCATGCTAGGGAGAAGCCCCATAAATATCAGGAATGTGGGAAAGCCTACAATAGGTTTTACCTACTAAGTGATCATTTAATGACTCACACTGGACAGAAACCCTTTGAATGGGAACAATGTCAGAAACCCTTTAGGAATTCCTCACATGTTAATTGTCACACTGGAATTTACCCTGGTGAGAATCTTAATTAA

XM_004865455.1 Coding sequence

LOC101703224 zinc finger protein 426-like

Length: 345 bp    Location: 2058212..2073864   Strand: +
>XM_004865455.1
ATGGACCTGGCGGTTGCAGCGCGTTCAGGAGCTCTTCTTTCTAGGGACCCAGTCTTCCTTCTTGAAGAAAAGATAAAGGAAGAAAGGATGGTGGCCGACTGCCTGACAAACTGCTATCAGGACTCGGTGACCTTTGAGGATGTGGCCTTGGACTTCACCCAGGAGGAGTGGGTTTTACTGGATCAAAGTCACAGAGACCTTTACAGAGAGGTGATGTTGGAGAACTATGAGAACCTGACCTCCATGGGATGTGAGCTTGTCAAACCCAGTCTGATCTCCAGGTTGGAAAACAAAGAGGATTGGAGGACAGAGCAGAGAGGAGATCCCCGAGGTGAGTATTTGTGA

XM_004865462.1 Coding sequence

Znf426 zinc finger protein 426, transcript variant X2

Length: 1884 bp    Location: 1989308..1958631   Strand: -
>XM_004865462.1
ATGAAGAGGAATGGAGATTGCCTCTCTCTGCTTGGAGTCATAAGCTGCCCAGAAGTGGCCAGAGGGACTGTTTCAGGGACATTCCAGCCCCACAGGATGGCAGCCACTGATTTGTCGGAAGGCCTTCTCTACACAGAACCAATCTGCTTTTATGAAGACGAAACAAAGGTAGAAAGTGTGGTGGCTGACTACCAGGCAGATTGTTACCAGGATTCCGTGACCTTTGATGATGTGGCTCTGGAGTTCACCCAAGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAATCTGTACAGAGAGGTGATGCTAGAAAACTACGAGAACCTGTCTTCAGTAGGATACCAGTTCTTCATCCCTAGTCTGATCTCCTGGTTAAAACAAGAAGAATTAAACACAGCAGAAAATGGAGTTCTTCAACAGTTGGAGCTACAACCAGTAACCAAAGGATCAGAATTTGAGGATTATTTTAGGGAGGAAACTTCCAAAGAGATGGAAATGGTGAGAAGCCACAATGGAGAGGAGCTCTACGACTATAAGCCATATGGAGAAGTCTTCAGTGAACAGTTTTTCCTTAATACACACATGAGAACACAAAACCAAGAATATTCTTCGGGATATATTTGGTGTGGAGAAGACATCCTTACTCTGCACCAGAAAACCTCTACTGGACAGAACTTTTCCGAGATTGATCAGTATGGAAACATTTTCAATCTAACTCCAAATATTGCATACCAGACGACGTGCATGAGAAACAAACCCTTTGAGTGCAGGGATTGTGGGAATGCCTTTTTTAATCCATCATACCTTCAGATGGATATGAGAACTCAAAATGAAGGAGACCCCTATGAATGGAAGAAATATGAGAGTGGATATATTCACCCCATGAGCCTTGCTATGCATCTTCAAATTTTCAATGGAAGAAATCCCTACAAAATGGAGGAATTTGGAAAGAGCTTTCAGTATTTTCCATGCCTTACTAATCCCATGGAAACCCACACTGAAGAAACACTCTGTGAATGCAAGGAATGTTGGAAAGCATTCACAGTTTCCTCCCACCTAAATCAATATGTAACAGTTCATTCTAGAGAGAAAAACAAAAAATGTAAGGAATGTGGGAAGTGCTTTGCTACTTTTTCTCAACTGTCTGCACATATAAAAACTCACAGTGATGAAAAGCCCTTTCAATGTAAGGAGTGTGGAAAGTGCTTTAAAAATAACACATACCTTAACGATCACATGAGAATTCACACTGGAATAAAATCATACAAATGTGTGGAATGTGGGAAAGCCTTCCTGAGGTGGTCAGGCCTGACTGAACACTTACGAGTTCACACTGGAGAGAAGCCTTATGAATGTAAGGAATGTGGAAAAGCCTTCTCGAGGTCCACTCAGCTTACTGAACATATAAGAACACACACTGGAGTCAAACCCTACGAATGTAAGGACTGTGGGAAAGCCTTCACTCAGTACTCAGGCCTTGCTACCCACGTGCGCATTCACAGTGGAGAGAAGCCCTTTCAGTGTAACCAGTGTGGGAAAGCCTTCACTAGGACCTCAGGCCTCATTCACCATGTAAGAACACACACAGGCGAGAAGCCTTTTGAATGTGTCCATTGTGGGAAAACCTTTATTACTTCTTCCCACCGTACTAAACATTTGAAAATTCACAGTGGAGAAAAGCCTTTTGTGTGTAATATTTGTGGGAAGGCGTTTGTATATTCCACATCCCTTAACATTCACATGCGAACGCATACTGGAGAGAAACCTTACATCTGTAAGGAATGTGGGAAAGCGTTTGCTGTTTCCTCACGCTTAAGCAAACATGCAAGAGTTCACCATGGGGAGAAGGCCTATAAATGTGGGGGTATCAGTGTTACTATTTAG

XM_004865465.1 Coding sequence

Znf426 zinc finger protein 426, transcript variant X5

Length: 1806 bp    Location: 1964661..1958631   Strand: -
>XM_004865465.1
ATGGAAATCTTCCACCAACTAGACACATTTTGTTCTAGACATACTTGTCTCCAGAGCTTCTTAAAGGAAGTAAACCTCATGCAAGGACTGAGTCCCCAGTTGAATTTCCCCATAGAATGGAGCCTTATGCTGGATTCCGTGACCTTTGATGATGTGGCTCTGGAGTTCACCCAAGAGGAGTGGACTTTACTGGACCCAACTCAGAGAAATCTGTACAGAGAGGTGATGCTAGAAAACTACGAGAACCTGTCTTCAGTAGGATACCAGTTCTTCATCCCTAGTCTGATCTCCTGGTTAAAACAAGAAGAATTAAACACAGCAGAAAATGGAGTTCTTCAACAGTTGGAGCTACAACCAGTAACCAAAGGATCAGAATTTGAGGATTATTTTAGGGAGGAAACTTCCAAAGAGATGGAAATGGTGAGAAGCCACAATGGAGAGGAGCTCTACGACTATAAGCCATATGGAGAAGTCTTCAGTGAACAGTTTTTCCTTAATACACACATGAGAACACAAAACCAAGAATATTCTTCGGGATATATTTGGTGTGGAGAAGACATCCTTACTCTGCACCAGAAAACCTCTACTGGACAGAACTTTTCCGAGATTGATCAGTATGGAAACATTTTCAATCTAACTCCAAATATTGCATACCAGACGACGTGCATGAGAAACAAACCCTTTGAGTGCAGGGATTGTGGGAATGCCTTTTTTAATCCATCATACCTTCAGATGGATATGAGAACTCAAAATGAAGGAGACCCCTATGAATGGAAGAAATATGAGAGTGGATATATTCACCCCATGAGCCTTGCTATGCATCTTCAAATTTTCAATGGAAGAAATCCCTACAAAATGGAGGAATTTGGAAAGAGCTTTCAGTATTTTCCATGCCTTACTAATCCCATGGAAACCCACACTGAAGAAACACTCTGTGAATGCAAGGAATGTTGGAAAGCATTCACAGTTTCCTCCCACCTAAATCAATATGTAACAGTTCATTCTAGAGAGAAAAACAAAAAATGTAAGGAATGTGGGAAGTGCTTTGCTACTTTTTCTCAACTGTCTGCACATATAAAAACTCACAGTGATGAAAAGCCCTTTCAATGTAAGGAGTGTGGAAAGTGCTTTAAAAATAACACATACCTTAACGATCACATGAGAATTCACACTGGAATAAAATCATACAAATGTGTGGAATGTGGGAAAGCCTTCCTGAGGTGGTCAGGCCTGACTGAACACTTACGAGTTCACACTGGAGAGAAGCCTTATGAATGTAAGGAATGTGGAAAAGCCTTCTCGAGGTCCACTCAGCTTACTGAACATATAAGAACACACACTGGAGTCAAACCCTACGAATGTAAGGACTGTGGGAAAGCCTTCACTCAGTACTCAGGCCTTGCTACCCACGTGCGCATTCACAGTGGAGAGAAGCCCTTTCAGTGTAACCAGTGTGGGAAAGCCTTCACTAGGACCTCAGGCCTCATTCACCATGTAAGAACACACACAGGCGAGAAGCCTTTTGAATGTGTCCATTGTGGGAAAACCTTTATTACTTCTTCCCACCGTACTAAACATTTGAAAATTCACAGTGGAGAAAAGCCTTTTGTGTGTAATATTTGTGGGAAGGCGTTTGTATATTCCACATCCCTTAACATTCACATGCGAACGCATACTGGAGAGAAACCTTACATCTGTAAGGAATGTGGGAAAGCGTTTGCTGTTTCCTCACGCTTAAGCAAACATGCAAGAGTTCACCATGGGGAGAAGGCCTATAAATGTGGGGGTATCAGTGTTACTATTTAG

XM_004865459.1 Coding sequence

LOC101705261 zinc finger protein 778-like, transcript variant X1

Length: 330 bp    Location: 2004951..2015672   Strand: +
>XM_004865459.1
ATGAGCATTGGGTCTCTTTCTAGGGACCCAGTCTGCCTTCATGAAGAAAACGCAGAGACATCAAGGATGCTGACTAACCGCATGAGAAATTGTTACCAGGACTCGGTGACCTTTGAGGATGTGGCCTTGGACTTCACCCAGGAGGAGTGGGTTTTACTGGATCAAAGTCACAGAGACCTTTACAGAGAGGTGATGTTGGAGAACTATGAGAACCTGACCTCCATGGGATCATCCATGTGCAGGTGGTGCTCTCCTCCTGAGCCTCTTCTGTCAGCGCCCCTTTCCTTGTGCACAGGACGTCAGCTCCCCAACCCCAGCCTGATCTCTTAG

XM_004865460.1 Coding sequence

LOC101705261 zinc finger protein 778-like, transcript variant X2

Length: 306 bp    Location: 2004951..2015672   Strand: +
>XM_004865460.1
ATGAGCATTGGGTCTCTTTCTAGGGACCCAGTCTGCCTTCATGAAGAAAACGCAGAGACATCAAGGATGCTGACTAACCGCATGAGAAATTGTTACCAGGACTCGGTGACCTTTGAGGATGTGGCCTTGGACTTCACCCAGGAGGAGTGGGTTTTACTGGATCAAAGTCACAGAGACCTTTACAGAGAGGTGATGTTGGAGAACTATGAGAACCTGACCTCCATGGGTGGTGCTCTCCTCCTGAGCCTCTTCTGTCAGCGCCCCTTTCCTTGTGCACAGGACGTCAGCTCCCCAACCCCAGCCTGA

XM_004865458.1 Coding sequence

Znf778 zinc finger protein 778, transcript variant X2

Length: 384 bp    Location: 2027757..2045444   Strand: +
>XM_004865458.1
ATGTTCAAACCCCGCAGGCTCCACGCACGGCCGGAAGCGGAAATGACGCCAACGGGTCCCCTCCGTTGTCCTTCTTGCCGCTGGTGGCTCGGTGCTGTGTCGAGGTGCCTTCCTCATGGAGCTCTTCTTTCTAGGGACCCAGTCTCCTTTTTTGAAGAAAAGATAAAGGAAGAGAGGATGGTGGCTGACTGCCTGACAAACTGCTATCAGGACTCGGTGACCTTTGAGGATGTGGCCTTGGACTTCACCCAGGAGGAGTGGGTTTTACTGGATCAAAGTCACAGAGACCTTTACAGAGAGGTGATGTTGGAGAACTATGAGAACCTGACCTCCATGGGACACAGATGGTGGGTAACAAACTGTGGAAAGCAAAACCATGGATGA

XM_004865467.1 Coding sequence

Fbxl12 F-box and leucine-rich repeat protein 12

High confidence: 4 potential gene matches
Length: 981 bp    Location: 2105724..2100171   Strand: -
>XM_004865467.1
ATGGCGGCTTTGGCGGACCTGCCGGACTCGGTCCTCCTGGAGATCTTCTCCTACCTCCCGGTCCGGGACCGGATCCGCATCTCCAGGGTCTGTCACCACTGGAAGCGCCTGGTGGACGACCGGTGGCTGTGGCGACACGTGGACCTGACGCTCTACACGATGCGGCCCAAAGTCATGTGGCACCTCCTCCGCCGCTACATGGCCTCCCGGCTCCACTCCCTTCGGATGGGCGGATACCTCTTCTCGGGCTCCCAGGCACCCCAGCTGTCTCCTGCATTGCTGAGGGCCCTGGGTGACAAGTGCCCCAACCTGAAGCGCCTGTGCCTGCACGTGGCGGACTTGAGCTCGGTGCCCATCACCAGCCTGCCGAGCACGCTGCAGACCCTGGAGCTGCACAGCTGCGAGATCTCCATGGCCTGGCTACTGCGTGAGCAGGACCCCCGTGTCCTGCCACTGCTTGAGTGCCTGGTGCTGGACCGCGTGCCCGCCTTCCGAGACGAGCACCTGCAGGGCCTGCCGCGCTTCCGAGCCCTGCGGTCGCTGGTGCTGGGTGGCACCTACCGCGTCACCGAGACGGGCCTGGATGCCAGCCTGCAGGAACTGAGCTACCTGCAGAGGCTGGAGGTGCTGGGCTGCACTCTGCCAGCCGATAGCACCCTGCGGGCCATCAGCCGCCATCTCCGGGGTGTGCGCAAGGTCCGGCTCACGGTGGGCGGCCTCTCGCCACAGGGGCTGGCCCTGCTGGAGGGGATGCCTGCGCTGGAGAGCCTGTGCCTGCAGGGGCCCCTCATCACCCCAGAGATGCCCACCCCGACCCAGATCATCTCCTCCTGCCTCACCATGCCCAAGCTTCGCGTGCTCGAGCTGCAGGGGCTGGGGTGGGAGGGCCAGGAGGCTGAGCAGATCCTGTGCCGGGGGCTGCCCCACTGCGTGGTCATCGTCAGGCCCTCCCCCAAAGAGTCCATGGACTGGTGGATGTGA

XM_004866055.1 Coding sequence

LOC101707089 intraflagellar transport protein 20 homolog

Length: 402 bp    Location: 2106984..2109078   Strand: +
>XM_004866055.1
ATGGCAATTTGTGAGCTACACAAACCTGGAAGGGAAACAGCTACGGCCAAAGACATCCTGGGTGAAGCCAGGTTGAATTTTGATGAGCTGAATAAGCTACAGGTGTTGGACCCAGAGGTTACTCAGCCGACCACAGAGCTCAAGGAAGAGTGCAAGGACTTTGTGGACAAAAGTGGACAGTTTCAGAAAATAGTTGGTGGTCTAACTGAGCTTGTTGACCAACTTGCAAAAGAAGCAGAAAATGAGATGAAGGGGAAAAAAAGAAAGAAAGAAAATGAGATGAAGGGCCATTGGTGCTCGGAACTTGCTCAGATCTATAGCAAAGCAGAGAGAAGCCCAACAACAGCAACTTCAAGCACTAATAGCAGAAAAGAAAATACAGCTAGAAAGGTATTGAGTTGA

XM_004865473.1 Coding sequence

Olfm2 olfactomedin 2, transcript variant X2

Length: 1437 bp    Location: 2183799..2135246   Strand: -
>XM_004865473.1
ATGTCGGTTCCGCTGCTGAAGATCGGGGCTGTGCTGAGCACCATGGCCATGGTCACCAACTGGATGTCGCAGACGCTACCCTCGCTCGTGGGGCTCAACGGCACCGTGTCCCGCGCGGGCTCCTCCGAGAAAATCACTCTCTTCCAGAGCCCCGAGGAGGGCTGGCAGCTGTACACCTCGGCCCAGGCCCCTGACGGCAAATGCGTGTGCACCGCCGTGATCCCGGCACAGAGCACCTGTTCCCGGGACGGCCGGAGCCGGGAACTGCGGCAGCTGATGGAGAAGGTCCAGAACGTGTCCCAGTCCATGGAAGTCCTCGAGCTACGGACCTACCGTGACCTGCAGTACGTGCGCAGCATGGAGACCCTCATGCGCAGCCTGGACGCCAGGCTCCGGGCAGCCGATGGCTCCCTCTCGGCCAAGAGCTTCCAGGAGCTGAAGGACAGGATGACGGAGCTGCTGCCCCTGAGCTCGGTGCTGGAACAGTACAAGACCGACACACGGACCATCGTGCGGCTTCGGGAGGAGGTGCGGAACCTCTCAGGCAGCCTTGCCACCATCCAGGAGGAGATGGGTGCCTTCGGCTATGAGGACCTGCAGCAGCGCGTCATGGCCCTGGAGGCCCGGCTCCACGCCTGCGCCCAGAAGCTGGGATGTGGCAAGCTGACCGGGGTCAGCAACCCCATCACCATCCGGGCCATGGGGTCCCGCTTCGGCTCCTGGATGACCGACACGATGGCCCCCAGTGCGGACAGCCGGGTCTGGTACATGGATGGCTACTACAAGGGCCGGCGGGTCCTGGAGTTCCGCACCCTGGGCGATTTCATCAAAGGCCAGAACTTTATCCAGCACCTGCTGCCACAGCCCTGGGCAGGCACGGGCCACGTGGTGTACAACGGCTCGCTGTTCTACAACAAGTACCAGAGCAATGTGGTGGTCAAGTACCACTTCCGCTCCCGCTCGGTGCTGGTGCAGCGGAGCCTTCCGGGCGCCGGCTACAACAACACCTTCCCCTACTCCTGGGGCGGCTTCTCCGACATGGACTTCATGGTAGACGAGAGTGGGCTCTGGGCCGTCTACACCACCAACCAGAACGCGGGCAACATCGTGGTCAGCCGGCTGGACCCGCACTCCCTGGAGGTCATGAGGTCCTGGGACACCGGGTACCCCAAGCGCAGTGCAGGTGAGGCCTTCATGATCTGCGGTGTCCTCTATGTCACCAACTCCCACCTGGCGGGGGCCAAGGTCTACTTCGCCTACTTCACCAACACGTCCAGCTACGAGTACACGGACGTGCCCTTCCACAACCAGTACTCACACATCTCCATGCTGGATTACAACCCCCGCGAGCGGGCCCTGTACACCTGGAACAACGGCCACCAGGTGCTGTACAATGTCACCCTCTTCCACGTCATCAGCACCGCAGGGGACCCCTAG

XM_004865483.1 Coding sequence

LOC101712710 sphingosine 1-phosphate receptor 2-like, transcript variant X2

Length: 1059 bp    Location: 2397428..2390742   Strand: -
>XM_004865483.1
ATGGGCGCTTTCTACTCTGAGTACCTCAATTCCAACAAGGTCAAGGAGCACTACAATTACACCAAGGAGACTCTGGACATGCAGGAGACGCCATCCCGCCAGGTGGCCTCGGCCTTCATCATCATCCTGTGCTGTGCCATCGTGGTGGAAAACCTGCTGGTGCTCATCGCCGTGGGCCGTAACAGCAAGTTCCACTCGGCCATGTACTTGTTCCTGGGCAACCTGGCCGCATCCGACCTCCTGGCGGGCATGGCCTTCATTGCCAACACCTTGCTGTCGGGCTCCGTCACCCTGGGGCTGACGCCAGTGCAGTGGTTTGCCCGTGAGGGCTCGGCCTTCATCACCCTGTCCGCCTCTGTCTTCAGCCTTCTGGCCATCGCCATCGAGCGGCACGTGGCCATCGCTAAGGTCAAGCTGTATGGCAGTGACAAGAGCTGCCGTATGCTGCTGCTCATTGGGGCCTCATGGGTCATCTCGCTGGTCCTCGGCGGCCTCCCCATCCTGGGCTGGAACTGCCTGGGCCACCTGGACACCTGCTCTACTGTCCTGCCTCTCTACGCCAAGCAGTATGTGCTATGCGTGGTAACCATCTTTTCTGTCATCCTGTTGGCCATTGTCGCCCTGTACATCCGCATCTACTGCGTGGTCCGCTCGAGCCACGCAGATCTGGCTGGCCCGCAGACGCTGGCTCTGCTCAAGACTGTCACCATCGTGCTGGGCGTCTTCATCGTCTGCTGGCTGCCCGCCTTTAGCATCCTGCTCTTAGACTACGCCTGTCCCGTCCGGTCCTGCCCCATTCTCTACAAAGCCCACTACTTCTTTGCCTTTGCCACCCTTAACTCGCTGCTGAACCCTGTCATCTACACATGGCGGAGCCGAGACCTGCGGCGGGAGGTGCTGCGGCCACTGCAGTGCTGGCAGCGGGCGGCCAGGGGCCCAGGACGGCGGGACAGGACCCCAGGCCACCGCCTTCTGCCCCTTCGCAACTCCAGCTCGCTGGAGAGGGGCACGAACATGCCCACATCGCCCACGTTTCTGGAGGGCAACACAGTGGTCTGA

XM_004865475.1 Coding sequence

Col5a3 collagen, type V, alpha 3

High confidence: 4 potential gene matches
Length: 5250 bp    Location: 2252660..2216185   Strand: -
>XM_004865475.1
ATGAGGAGCCGCCCGGGCCTGCGCCAGCCGCGGGCCGGCCTCTGCCTGCTCCTGGCCGCCCTGCAGCTTCTGCCCGCCACGCAGGCCGGGGACCCTGTGGATGTCCTCAAGGTCCTGGGTGTGCGTGGGGACCAGGCGGGGGTCCCCCAGGGGCCTGGCTTGTGCCCCCAGCGGGCTCCCGAGGGTGACCGGGCATTCAGAGTGGGCAAGGCCAGCACACCCAGTGTCCCCACGAGGGAGCTCTTTCCTGATGGGCACTTTCCCGTGAACTTCTCGGTGCTGGTCACTCTACGGGCCCAGGTGGCCAACCAGTCTGTCCTCCTCTCTGTCTATGACGAGAAGGGCACCCGGCAGCTGGGCCTGGCGCTAGGGCCCACGCCGGGGCTCCTCGGCCACACCTTCAGTCCCCTTCCCCAGCAGGCCAACCTGGCGGATGGCAGGTGGCATCGCCTGGCCGTCAGTGTAGATGGTGACATGGTGACACTGGTGGCTGACTGTGAGGCTCAGCCTCCTCTGTTCAGCCGAGGACCTTGGTCCATCAGCACCTCTGGCCTCACTGTGCTGGGGACCCAGGATATCGAAGAGGAGACTTTTGAGGGAGATGTCCAGGAGCTGCTGATCAGCCCAGACCCTCAGGCCGCCTTCCAGGCCTGTGACCAGTACCTGCCTGGCTGTGACAGCCCAGGTCCCACGGCCACAGGGCACCCCCAGGGTGACCCAGAGACCCCTCCTCCTCGACGAAAGGGCAAGGGAAAAGGAAAGAAAAAAGGGCAGGGTCGAAAGGGGAAAGGCAGGAAGAAGAAGAACAAGGAAAACCTGAGTCCCAGTCCCCCTCCTGGGTCCCCAGAGAGCCAGGCTGCCACTGACGTCCCCCAGCCCGAGTCACCTGTTCCAAACTCTCCTGCGACTCCCACGCCTGTGGTCCTCACCTCTGCTGTCACCCTTGGCCACAACGTCACCGTCCTAGAGGGGGAACTGGAGCCTGAAGGTGGAACCCAGCTCAGAACCCCAGACGTGGAGGCAGCCGGAGAGGAGGAAGAAGGAAGGGGCTCCACCATGGGCCCAAAATTCCGGGCAGCAGAACAGCCTTTTCAGACTGAGTTCCAGATCTTCCCTGGTGCCGGAGAGAGGGGAGAGAAGGGAGCAAAGGGTGAACCTGCTGTCATTGAACAGGGGCAGAAATTTGAGGGACCTCCAGGAGCCCCAGGACCCCAGGGGGTAGCTGGTCCCTCAGGCCCCTCTGGGCCCCCGGGATTCCCCGGGGACCGTGGTCCACCGGGCCCCGCTGGCCTCCCAGGAATCCCCGGCATGGATGGAGTCCGGGGTCCCCCGGGCACAGTGATCATGATGCCGTTCCAGTTCGCAGGCGGCTCCATGAAGGGGCCCCCAGTGTCCTTCCAGCAGGCCCAGGCCCAGGCTGTGCTGCAGCAGACCCAGCTGTCCATGAAAGGCCCCCCTGGCCCAGTGGGGTTCACAGGACGCCCAGGGCCTGTGGGTCTCCCAGGATACCCAGGACTGAAAGGTGAACCAGGGGAAACAGGGCCACAGGGTCCCCGAGGGCTGCAGGGACCTCCTGGGCCCCCTGGCAGAGAGGGCAAGCGGGGCCGCTCCGGAGCAGATGGGGCGCGGGGCATGCCGGGAGACACAGGGCCCAAGGGCGACCGGGGCTTTGACGGCCTCCCGGGGGTGCCCGGAGAGAAGGGACAGAGGGGTGACTTTGGCCTCGTGGGCCAACCAGGCCCCCCGGGAGAGGATGGCCGCAAAGGAGTAGAGGGGCCACCGGGGCCCACTGGCCAGGCTGGGGAGCCGGGCCCTCGAGGTCTGATTGGCCCCCGAGGCTCCCCTGGCCCCTTGGGACGCCTGGGTGTCACCGGAAGTGATGGAGCTCCTGGTGCCAAAGGCAATGTGGGTCCGCCTGGAGATCCAGGGCCACCCGGACAGCAGGGAAACCACGGGGCCCAGGGAATTCCTGGCCCCCAGGGACCCATCGGCAACCCGGGGGTGAAGGGTCCCCCCGGAAACCCAGGCATCCCAGGTTCCCCAGGAGCTGATGGCCCTCTGGGTCACCCAGGCCAGGAGGGTCCCACAGGAGAGAAAGGGGCCCAGGGACCACCAGGCTCGGCAGGGCCTCCAGGCTACCCTGGACCCCGGGGCGTGAAGGGTACCTCAGGCAATCGAGGCCTCCAAGGAGAAAAAGGAGAGAGGGGAGAGGACGGCTTCCCTGGCTTCAAGGGCGACGTGGGCCCCAAAGGCGATTGGGGACAACCAGGACCCCCTGGCCCCCGAGGAGAGGAGGGTCCTGAGGGGCTGAAGGGGCCGGAGGGGCTGGCGGGCGAGGAGGGGCCCCTGGGCACAGCTGGGGAGAAGGGCAATCTTGGTGTGCCCGGTCTCCCAGGATACCCAGGACGTCCAGGACCTAAGGGATCTATTGGATTTCCCGGGCCCTTGGGACCATTAGGAGAGAAGGGAAAGCGGGGCAAGGCAGGCCAGCAGGGGCAGGAAGGAGAGAGAGGACCACCTGGCTCTCGTGGAGAGAGAGGGCAGCCAGGGGCAACAGGACAGCCAGGCCCCAAGGGTGATGTGGGCCAGGACGGGTCCCCAGGAATCCCTGGAGAAAAGGGCCTCCCTGGACTGCAGGGTCCCCTAGGATTCCCTGGGCCGAAGGGCCCCCCTGGTCCCCAGGGAAAAGAGGGGGCACCAGGGCACCCTGGACAGAGAGGAGAATTGGGCTTCCAAGGTCAGACGGGCCCACCTGGACCAGCAGGTGTCTTGGGTCCTCAGGGAAAGATAGGGGATGCTGGACCCCTGGGTGAGAGGGGCCACCCCGGCCCCCCTGGGCCTCCTGGTGAACATGGGCTCCCGGGCCCGGAAGGCGGAGAAGGAGCCAAGGGGGAGCCAGGACCCTTAGGACCCACTGGGAAGGAGGGGCCGCCTGGACTGAGAGGCCCCACTGGGCCCAAAGGAGGCCCTGGGGACCCCGGACCCCCTGGATTGAAGGGCGACAAAGGTCCCCCTGGTCCTGTTGGGGCCAATGGCTCCCCTGGCGAGCGGGGTCCCCTGGGCCCATCAGGCGGCATTGGGCTCCCTGGCCAAAGTGGTAGCCAAGGCCCGGCGGGTCCTGCGGGTGAGAAGGGGTCCCCGGGAGAACGTGGCGCACCGGGCCCCACTGGAAAGGATGGGGTCCTGGGGCCCCCTGGGCTTCAGGGACCCCCTGGAGCTGCTGGGCCTGTGGGCGAAGAGGGTGACAAGGGGGAAGTGGGTGCCCCCGGCCACAAGGGCAGCAGAGGCAACAAGGGAGATGCGGGTCCACCTGGACCGACAGGCATAAGGGGTCCCTCAGGACACCCAGGAACCCCGGGAGCTGATGGAGCTCAGGGACGCCGGGGACCCCCAGGCCTCTTTGGGCAGAAAGGAGATGATGGAGTCCGAGGCTTCACGGGGGTGAACGGGCCCCCTGGCCCTCAAGGATTGCCAGGCCCTCCCGGAGAAAAGGGGGAGGTTGGAGACGTGGGGTCTATGGGTCCCCATGGAGCCCCAGGCCCTCGAGGTCCCCATGGCCCCAGTGGATCAGAGGGTCCACCAGGGCTTCCTGGGGGTGTTGGTCAGCCAGGCGCCGTGGGTGAGAAGGGTGAGCCAGGTGATGCTGGGGACCCTGGACCCCCAGGACCCCCAGGAATTCATGGGCCCAAAGGTGAAGTTGGTGAAAAGGGAGACTCAGGCCCATCTGGGGCTGCTGGACCCCCAGGCAAGAAAGGTCCTCCTGGAGAGGATGGACCCAAAGGGAACATGGGCCCTACAGGGATGGCTGGAGATCTAGGACCCCCAGGAGACCCTGGGCCGGTGGTGAGTGGAACAGATGGCTCTCCGGGGGCAAAGGGAGACCCTGGTGATGTTGGGGCCCCGGGGCCGCCTGGTGCTTCTGGGGAACCTGGCACCCCGGGACCCCCTGGAAAGAGGGGTCCCTCAGGCCGCCTGGGTCAAGAAGGCAGAGAAGGGGCCAAAGGTGCCAAGGGTGAGCCGGGTCCTGATGGGCCCCCAGGGAGGACAGGCCCCGTGGGGGCGCAAGGGCCCCCTGGACGTGCAGGGCCCGAGGGCCTTCAGGGGATCCCCGGCCCTGTGGGAGAGCCAGGCCTTCTGGGACCCCCGGGCCTGATGGGCCCTCCAGGCCCCCTGGGCCCCCCTGGCCTCCCAGGGCTGAAGGGAGACGCTGGCCCAAAGGGGGAGAAGGGCCATATCGGACTGCAAGGCCTCATCGGTCCCCCTGGGGAGGCCGGCGAGAAGGGGGACCGGGGCCTTTCAGGTGTGCCGGGCTCCCATGGCCTCCAGGGAGACCCTGGTTCCCCTGGTCCTAAGGGCTCTGTGGGCCACCCTGGGGCCCCTGGCGTGGTGGGCCCTGTGGGACTGAAAGGCTCCAAAGGGTCCCCGGGCTCCCTTGGTCCTCCTGGCGACACTGGGCCCCCAGGTCCTCCCGGCCCCCCGGGACCCCCGGGCGAGTTCCCGGGGCTGCGCAGCCGCAGACGCCGCCGCCGCGCAGTCCCCGAGGGCGGCCTGGAGGAGGTTCTGGCCTCGCTGGCGTCGCTGAGCGCAGAGCTGGAGCAGCTGCAGCGACCTCCGGGCACCGCCGAGCGCCCGGGCCTCGTGTGCCACGAGCTGCAGCGAAATCATCCGCACCTGCCCGACGGCGATTACTGGATCGACCCCAACCAGGGCTGTGCGCGGGATGCGCTCAGGGTTTTCTGCAACTTCACGGCAGGAGGCCAGACCTGCCTGTACCCCGACAAGAGATTTGAGACGGTGAAGCTGGCCTCCTGGTCCAAGGAGAAGCCCGGAAGCTGGTACAGCACCTTTCGGCGGGGGAAGAAGTTCTTCTACGTGGATGCCGACGGGGCCCCAGTGAACGTGGTTCAGCTGAACTTCCTGAAACTGCTGAGTGCCACGGCCGAGCAGCGCTTCACCTTCTCCTGCCAGAACTCAGCCGCGTGGCTGGATGAAGCTGCAGGCAACCACGGCCGCTCCGTCCGCTTCCTGGGGACCAATGGCGAGGAGGTGTCTGTCAACCAGACAGTGGCGGCCACCGTTGAGGTCCCCTACGATGGCTGTCGGTTTCGAAAGGGACAGGCGAAGACTGTCCTGCAACTTCGCTCTTCCTGGCCGGGCTTTCTGCCCCTGCTGGATGTGGCAGCCATGGACTTCGGCCAGGCAAACCAGAAGTTTGGGTTTGAACTGGGCCCTGTCTGCTTCAGCAGCTGA

XM_004865476.1 Coding sequence

Rdh8 retinol dehydrogenase 8 (all-trans)

High confidence: 4 potential gene matches
Length: 939 bp    Location: 2254589..2258778   Strand: +
>XM_004865476.1
ATGGCCTCCTCGCCCCGGACCGTGCTGATCTCGGGCTGTTCCTCTGGCCTCGGCCTGGAGCTCGCTGTGCAGCTGGCTTGGGACCCCAGGAAGCGCTACCAGGTGGTGGCCACTATGAGGGACCTGGGAAAAAAGGAGATGCTGGAGGTGGCTGCAGGAGAGACCCTGGGGAAGACACTCACTGTGGCCCAGCTGGACGTGTGTGATGATGCGTCTGTGGCCCAGTGTCTGAGCCACATCGAGGGCGGGGATGTGGATGTGCTGGTGAATAATGCTGGCATGGGCCTGGTGGGGCCCCTGGAGGGGCTCAGCATCACCACCATGCAGAGCGTCTTTGACACCAACTTCTTCGGGGCTGTGCGTCTCGTCAAAGCAGTGCTTCCAGGCATGAAGAGGAGGAGAAAGGGCCACATCGTGGTGGTTAGCAGTGTCATGGGACTGCAAGGTGTCATGTTTAACGATGTCTATGCAGCCTCCAAGTTTGCTCTGGAGGGGTTCTTTGAGAGCCTGGCCATCCAGCTGCTTCAGTTCAACATCTTCATCTCCCTGGTGGAGCCAGGCCCGGTGGCCACTGACTTCGAGGGGAAGCTGCTGGCTCAGGTGTCCAAGGCTGAGTTCCCGGGCACTGACCCTGAGACCCTGGGCTACTTCCAAGACCTCTACCTCCCAGTCTCTTCTCAGCTCTCCTGCTCCGTGGGACAGAGCCCAAAGGATGTGGCAAAGGCCATTGTCAAGATCATCAGTGCCACCCAGCCACCCCTACGCAGACAGACCAACACCCGCTACGTCCCACTGATGGTGCTCAAAGACCTGGACCCCTCTGGTCGCCTGTACGTGCGAATTGCCCACCATCTGCTCTTCCGCTGGCCTCGAATCCTGCACTTCAGCCTTCACTGCCTGGCCTGTGGCTGCCACCCAAACCGAGTGTGGCCTCGATGA

XM_004865478.1 Coding sequence

LOC101711279 chromosome unknown open reading frame, human C19orf66

Length: 879 bp    Location: 2287275..2292275   Strand: +
>XM_004865478.1
ATGTCTCAGGAAGGCGTGGAGCTGGAGAAGAGCGTCCGGCGCCTGCGGGAGAAGTTTCACGGAAAGGTGTCCCCCAAGAAGGCGGGGGCTCTGATGAGGAAATTCGCCAGCGACCACACCGGGGTGGGGCGCTCCATCGTGTACGGGGTCAAGCAGAAAGACGGACAGGGCCTCAGTAGCGGCCTAGATGCCCAGGACCCCCCAGAGGACATGAAGCAGGACCAGGACATCCAGGCTGTGGCAACCTCGCTCCTGCCGCTGACGGAAGCCAACCTGCGCATGTTCCAGCGTGCCCAGGATGACCTCATCCCCGCTGTGGACCGGCAGTTCGCCTGCTCCAGCTGTGACCACGTGTGGTGGCGCCGAGTGCCCCAGCGGAAGGAGGTGTCCCGATGTCGCAAATGCCGGAAGCGCTACGAGCCAGTACCAGCCGACAAGATGTGGGGCCTGGCTGAGTTCCACTGCCCGAAGTGTCGGCACAATTTCCGGGGCTGGGCACAGATGGGGTCCCAGTCCCCCTGCTACGGGTGTGGCTTCCCCGTGTTTCCGACACGGATCCTCCCTCCGCGCTGGGACCTGAACATGGATCGGCGCAGTACGCACACCCATTCCTGCTCGGCTGCAGACTGCTACAATAGGCGAGAGCCCCACGTGCCCGGGACTTCCTGCGCTCACCCCAAGAGCCGCAAGCAGAACCACCTGCCCAAGGTCCTGCACCCCAGCAACCCCCACATCAGCAGCGGCTCTACCGTGGCCACCTGCCTGAGCCAGGCTGGGCTGCTAGAGGACCTGGACAACCTCATCCTGGAGGACCTGAAGGAAGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGCCGGGCCCCGGGAGTGA

XM_004865480.1 Coding sequence

Ppan peter pan homolog (Drosophila)

High confidence: 3 potential gene matches
Length: 2400 bp    Location: 2301432..2308027   Strand: +
>XM_004865480.1
ATGGGGCAGTCTGGAAGGTCCCGGCACCAGAAGCGTGCGCGCGCCCAAGCAAAGCTCTCCAACCTCGAGGCCTATGCCACGCAGCCGCACTCTTTCGTCTTCACTAGGGGCCGCACGGGGCGCAGCGTCCGGCAGCTCAGCCTGGATGTGCGGAGGGTCATGGAGCCGCTCACCGCCACCCGCCTGCAGGTTCGCAAGAAGAACACACTGAAGGACTGTGTGGCCGTGGCCGGGCCCCTGGGAGTCACGCATTTCCTGATCCTGAGCAAAACTGACAGCAGTATCTACTTGAAGCTCATGCGCCTTCCGGGAGGCCCCACCTTGACCTTCCAGATCAATAAGTACACACTTGTGCGCGATGTGGTCTCCTCGCTGCGACGGCACCGCATGCACGAGCAGCAGTTCACCCACCCGCCTCTGCTCGTGCTCAACAGCTTCGGCCCCCACGGCATGCATGTGAAGCTCATGGCCACCATGTTCCAGAACCTGTTCCCCTCCATCAACGTGCACAAGGTGAACCTGAACACCATCAGGCGCTGCCTCCTCATTAACTACAACCCCGACTCGAAGGAGCTAGACTTCCGCCATTACAGCATCAAGGTTGTCCCCGTGGGTGCCAGCCGGGGCATGAAGAAGCTGCTGCAGGAGAAGTTCCCCAACATGAGCCGCCTACAGGACATCAGCGAGCTGCTGGCCACGGGCGCTGGGCTGTCGGACAGCGAGGCAGAGCCCGATGGTGAGCACAATATTACAGAGCTGCCGCAGGCTGTGGCAGGGCGCGGCAACATGCGGGCCCAGCAGAGTGCCGTGCGGCTCACAGAGATCGGTCCGAGGATGACGCTGCAGCTCATCAAGATCCAGGAGGGTGTCGGCGAGGGCAGCGTGCTCTTCCACAGTTTTGTGCACAAGACAGAGGAGGAGCTCCAGGCCATGCTGGCGGCCAAGGAGGAGAAGCTGCAGCTCAAGGCACAGAGGCAGGAGCAGCAGGCCCAGAACGTGCAGCGCAAGCTTGAGCAGCGTGCGGCCCACAAGAAGAAGAGCCTGGCAGGCATGAAGAGACCACGGGCTGGGGCTGATGGGGACAGCGACGCTGAGGACCCAGGAGTACCCCTAGAGGCAGAGGGGCCTAGCCGCCGGTGGCAGGAGGAGGAGGAGGAAGAGGATGAAGCCGAGTACTTCCGCCAGGCTGTGGGCGAGGAGCCTGATGAGGACATGTTCCCCAGGGCCAAGCGGAGACGGCTCGCTGGGCCCCCAGGCAAGAAGCAGGTGAAGGAGCCGAGGCCTCGAGGCCGGGGTGCCAGGCCCTGTAACTTCTCGGCAGCCGCCAACCACGTGCTCAGCAGCTACCAGGAAAACTTCCTGTGCCCCGTCCTGATAGCCGAGTTCCTGGTGGCCGTGGCTGGCAATGGCCTGGCCCTGTACCGCTTCTGCACCCAGGAGCCGTGGCCCTGGAACCCAGCTGTGGTCTTCTCGGCACAGCTGGCAGTCAGCAACCTGCTCTATGCACTGACGCTTCCCGCACTGGTTGCCTACCTCTACCCGCCCAAGAACTGGGCCTATGGTGCGGTGGCCTGCCGCCTGGAGCGCTTCCTCTTCACCTGCAACCTGCTGGGCGGCATCATTTTCCTCACCTGCATCAGCCTTAACCGCTACCTGGGCGTCGCCCACCCCTTCTTCGCACGCAGCCACCTGCAGCCCAAGCACGCCTGGGCCACCAGTGTTGCTGGCTGGGGCCTGGCTGCCCTGCTGGCCGCCCCCACACTCGGCTTCTCGGGCCTCAAGGAGCCGGTGGTGGTGGGCGAGTGCAGCGTGGCCAGGCCTGAGGCCTGCACTGAGTGCCTGGGGACAGCCGACAGCCACCAGCTCGGGGGCTACAGAGCCTACAGCCTGGCGCTGGCGGGGCTGGGTGGGGCGCTGCCACTGCTGCTCTCACTGGCAGCCTACAGTGCCCTGGGCCAGGCTGTGTTGCGCAGCTCTGGACTGAGGGCAGCTGAGCAGCTGCGCGTGGTGGTGCTGGTGGCCAGCGGAGTGGCCCTGTATGCTGTCTCCTATGTGCCCTACCACGTCACACACGTGCTCAACGTGGACGCCCGACGGCGCTGGCTAGCACACTGCCCAGACTTCACCAGCGAGGCACAGGCCAAGCGGGCACTGGAGCTCGGGCCCTTCCTGGGCTACCAGGTGACGCGCGGCCTTGTGCCCCTGGCCATCTGCATCCACCCACTGCTCTACATGGCTGTGGCACCCAGCTTGGGCTGCTGCATGGGGCACAGGGGTCCCGAGGACAGGAGCCTCGGCCACCAGGACCTGCCTCTCTCCACCAGTGCCACCGCCACAGCCTCAGCGCCCCAGTGCCTGGCCCATCTCCAGCCCAGTTCCTCACAAGGCACTGGGAGGTGA

XM_004865484.1 Coding sequence

Icam1 intercellular adhesion molecule 1

High confidence: 4 potential gene matches
Length: 1635 bp    Location: 2432613..2450740   Strand: +
>XM_004865484.1
ATGGTTGCGCTGCCCGTGCTGCTCGCCCTGCTGGGCACCGTCCTCCCAGCAGTGGCCGGTGACCTGGAGGTGTCTGCATCTCCCCGGGAAGCCACGCTGGCTCAGGGAGGCTCCATCCAGGTGAACTGCAGTTTCTTGGTCTGTGACCGGAAGGATTCTGAGCTGGGCCTGGAGACTGACTTCTCCAAAGTCTTAGTGGACTACGGGACCAACTGGAGGCTGTTCAATCTGAGCGGTGTTGACAAAGACAGCAGTCCGATCTGCTACCTGAGCTGTGGCCCCGGGCACCAGGGGACCGCTAGGGTCTCCCTCACCGTGTATGTGTTTCCGGAGGAGGTGGAGCTGAGCCCCCTGCCACCCTGGCAGCCCTCGGGCCAGGACCTCACCCTGCGCTGCCTCGTGGTGGGTGGGGCGCCCCGGAACAGGCTCACCGCGGTGCTGCTCCGGAACGAGGAGGAGCTGAGCCGGCAGCCGGTGATCAGGGAGCCCACGGAAGTCATGGCCACCGTGCCAGTGGGCAGAGGCGACCACGGTGCCAACTTCTCATGCCGCACGGAGCTGGACCTGCAAGCCGAGGGTCTGGGGCTGTTCCTGAACAAGTCAGCCACCAGACAGCTTCGGACATTCGTCCTGCCAGCAACTCCCCCGGCATTTGACACCCCCCGGGTCCTGGAGGCCGGCACGTGGCAGCCCGTCACCTGCTCTCTGGATGGGCTGTTTCCTGCCTTGGAGGCCCAGGTCCACCTGGCGCTGGGGGACCGGAGGCTGAGCGCCACAGTCACGTACGGCAAAGACTCCCTGTCCGCCACGGCCTCGCTGGAAGTGACGGCGCAGGAGGAGGGCGACCAGCGGCTGGTGTGTGCAGTCCTGCTGGGGAACCGGAGTCTGGAGTCCTGGAGGAACCTGACCGTCTACAGCTTTCCAGAACCCATCCTGATGCTGAGCGCGACCGAGGCCTCTGAAGGGGACCTGGTGATGGTGCAGTGCGAGGCTCACCCTGGAGCCATGGTGACGCTGAGTGGCGCCCCAGCCCAGCCACTGCCCCAGAAGTCCCAGTTGCTGCTGAACGCCAGCGCTGCGGATAACGGCCGCCGCTTCTCCTGCTCTGTGGCTCTGGAAGTGGCCGGGCAGGTGCTGTACAAGAACCGGACCCAGGAGCTCACCGTCCTGTATGGCCCCAGATTAGACGAGAGCGATTGCCCGGGGAACTGGACCTGGCCAGAGGGGTCCGAGCAGACCCTGAGGTGTCAGGCCTGGGGGAACCCGTCCCCCCAGCTCCAGTGTCACCGCAAGGGTGACAACACTTCGCTGCCCATCGGGCACCTGAGGCCTGTCAAGCGGGAGCTTGAGGGAACCTACGTGTGCCGTGCTGTGAGCTGGCGCGGGGAGGCCAGCCGGGAGGTGCTGGTGACAGTTCTCTACAAGCCGAGAAACATGGTCATCATCGTTGTGCTGTTGGCCATAGCAGCCATCGTGAGCTCTGTGGCCTTAACCATGTACTTCTATAACCGACAGCGGAAAATCAGGAAGTACAAGCTCCAAAAGGCAGCCGAAGAAGCCTTGAATCTAAACGGCCTGGGTGAGCCTGCCCCAGCCCACCCAGAGCTGGCCTCCTCCCAGACGCAGCAGTGCTGA

XM_004866056.1 Coding sequence

Icam4 intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)

High confidence: 4 potential gene matches
Length: 807 bp    Location: 2452151..2454863   Strand: +
>XM_004866056.1
ATGGGGTCTCTGCTTCTCCTGTCGCTGCCCTTTTTGCTAGTGACCGCCTACCCTGTAGGTGGGAGCGCGTGGAGGCGCCAGGGTAAGATGTCGCAAAGCCTCAGCCCCAGCTCTCCCGCTCCCTTGAGAGCCTCAGTGCCGTTCTTGGTGCGTCTAAACCCGGAGCTGGTGGCAGTGGCCCCCGGGCACTCGGTGTGGCTGAACTGCAGCACTAGCTGCCCCCTGCCGGCGAACTCCAGCCTTTTCACTCAGCTGCGGCACCGCCACACGGTCACCGGGCCGGGCTGGGTATCCTACGAGCTGGTGAATGTGACGGCCTGGAGCTCCATTGTGCGCTGCTTCGTCACCTGCGCGGGAGAAACGCGCCAGGCCACCGCCAGGATCAGCGCTTACAAGCGCCCGCGCAGTGTGACTCTGGAGCCACCCGTCCTCGCGGGCGGCCGGTACACTCTGCGCTGCCACGTGACGCACGTGTTCCCCGTGGGCTTCCTGGTGGTGACCCTGAGGCACGGCAGCCGGATCATCTATTTTGAAAGCCTGGAGCGCTTCAAAGACCTAGATCCGGCCAATGTGACGCTGACCTACACGTTTCGCGCCAGGACCAGCGACCTCCGGCAGCCCGTGACCTGCCACGCGCGCCTCACTCTCGACGGCCTGGTGGTGCGCAGCAGCTCGGCGCCCGTCATCTTGACAGCCCTGGGTGAGGCACTCTGTGACCCTGGGAACTTGTTACCAACGTTTAAACCAATCCCCTGGCGCAACTCTGCCTCCCCCACACTCCACCCGCCGCGCCGCGCAGTCCTCTAG

XM_004865486.1 Coding sequence

Zglp1 zinc finger, GATA-like protein 1

High confidence: 4 potential gene matches
Length: 807 bp    Location: 2468552..2463419   Strand: -
>XM_004865486.1
ATGGAGGCTGATCCTGCCCAGGACCTGCTGCGGGAGCTGCTGGCGCCGTCCTGTCTGGACTCCGAGCCATCCCCGGGACCCTCGGCCCAGCGGCAGCTGCGGCCCCTGCGATGCCCCAGAGCCGGTGGCCGGTCCCTCTGGCCTGTGTGTCAGGACTCGGTCACCATCCTGCGCCTTCTCCAAGAAACTGAAGAGGGCCAGGCCCGGGCGCCCACACCAGCCACCCAGGCCCTGGGGACCTGCTGGGAGCCAGGGGCCCGCAGGGTGTCAGGCCCCCTGACCATGGCCAGGAGCTCCAAGAACAAGCAGACCCCAGGAAGCCACAAGCGTCGCAGCAGGGACCCCCCTGGGGCACCTGCAGCACTCCCTCAGAGAAGGCCCCGAAAGCAGCCGAAGCCTCGCCAAGGAGCCAAGCAGGTGGACCCTGGGTTCAAGGGGGTGACTCTGAAGTTCCAGATTAAGGCGGACTCCAGCCTGCAGATCTCACCCACCTACAGCCTAGCCAGCAGCAGCCAGACTGAGGGAGCTGCCTCAACCCCCACCAGGGCTGCTGAGCCCAACTCCAGAGGCGGGGAGGCCCTAGGGCCTCGGTGCTGTGCTTCCTGCAGGACCCACAGGACGCCTCTCTGGAGAGATGCTGAAGACGGGACCCCTCTCTGTAACGCCTGTGGTATCAGGTACAAGAAATATGGTACCCGCTGCTCCAGTTGCTGGCTGGTGCCCCGGAAGACTGTCCAGCCCAAGAAGCTGTGTGGCAGATGTGGGGTATCCATGGGCCCCCTCGAGGGCCCACCTCAGGCAGTGTAA

XM_004866057.1 Coding sequence

Icam3 intercellular adhesion molecule 3

Length: 1302 bp    Location: 2492326..2487063   Strand: -
>XM_004866057.1
ATGACACCTGCCAGGCAGCTGTGGGGAGCCTGTGCGACCCTGTGGGTCTTCATGCTGCTGCTGTGCTGTCTGCTTCCCCAAGGTGCCCAAGAGCAGATGTTCCCACTGTGGCTGGAGCCCCCGGCTGCCGTGCTTGCTGCTGGTGGCTCTGTCTTGGTCAACTGTAGCACTGAGTGCCCCAGCCCCTCAAACCTCATTCTGGAAACGTCCCTGCCGAAGCAGCTGAATGGCAGCAGCCCAGGCTGGGCAACTTTCTGGCTCAGCAATTTGACTGAGGACACCAGGATCATGTGCTCCGTGCTGTGTGGTGGCTCGCAGGTGACAGCTTCCTCCAACATCACCATATACCGTTTTCCGGAGGAGGTGGAGCTGAGCCCCCTGCCACCCTGGCAGCCCTGGGGCCAGGACCTCACCCTGCGCTGCCTCGTGGTGGGTGGGGCGCCCCGGAACAGGCTCACCGCGGTGCTGCTCCGGAACGAGGAGGAGCTGAGCCGGCAGCCGGTGATCGGGGAGCCCACGGAAGTCACGGCCACCGTGCCAGTGGGCAAAGGCGACCACGGCGCCAACTTCTTGTGCCGCACGGAGCTGGACCTGCAAGCCGAGGGTCTGGGGCTGTTCCTGAACAAGTCAGCCGCCAGACAGCTTCGGACATTCGGTGAGGCGCTGGGGAAGTGGGCTCAGAGGGAGGGGCTCCTGGGGAAGAGGGGTCCTTGGAAGGAGGTGACCCTTGCTAAAATCCAGGTCACCTTAGGGTCCCAGCCCTGTGTGCGAGGCCAGGCTGGACTACACAGCGAGACTCTGTCTCAAAAAACCACAAAGACTGATCAGGCCAAATGTCCCCTGCATATGGAGTGGAGAGACAGCACTACTCAAGTAGTGCAGTGCGTGGCCAGCGGCAATCCAGCCTCGAGGCTGTTTCCAAGGAGGCTTCGGGCATAAGGGCTTGCGGTAACATCGGTATCCTACTCCGTGTCAAGTTACACCAAAGTCTGTTATCACTGCCAGGAGGCCAGACCTCGGGGCAAGAACCCAGAGGGGCCGCGGCGCTGGTGTAGAAAGCCCATGAGGGTCCGGGCACGAATATTTACTCCCAGCTTTCTCTGCGCAGGTCGAGACCACTCGGTCACCATTGGCGTAACGGTGTTAACCGTCCTGGGCGTGGTCATTATCTCAGGGGCTTTACTATATGTGTTCGGGATGCAGAAACGGTGTGGCATCTACCACGTGAAGCAGCAAAGCAACTCGGTGCCCCTCACGGCAATACAGTCTGAAGACACACCGGGGGAAGAGGCGTCGTCCTGA

XM_004865491.1 Coding sequence

Tyk2 tyrosine kinase 2, transcript variant X2

Length: 3564 bp    Location: 2518767..2499929   Strand: -
>XM_004865491.1
ATGCCCCTGTGTCATCGAGGAGGCTCTGAGAAGGGCAGCCAGCCTGCCAGGGATGAAGTGCAGCCCTTGGCCACCACGGGAGGCCTGCAGGTCCTTCTGCACTGGGCTGGCTCCAGTGGTGGGCAGCCCTGGGTCACCTTCGGTGAGGTCTCGCTGACGGCTGAGGAGATCTGCATCCGGGTCGCACACAGAATCGGCATCACACCAGCCTGCTTTAATCTCTTTGCTCTCTTTGATGCTGAGGCCCAAGTGTGGCTGCCCCCAAACCACATTCTGGAAGTTTCTGCAGACACAAGACAGACGCTGTATTTCCGCATGAGGTTTTACTTCCGGAACTGGCATGGCATGAATCCGCAGGAGCCACCTGTGTACCGCTGTGGACTCCCAGGGGCTGAGGCATCCTCAGAACAAGCAGAACAAGGGGTACAAGTCTTAGATCCAGCCTCTTTTGAGTACCTCTTTGAGCAGGGCAAGTATGAGTTTGTGAATGATGTGGTGTCGCTGCGGGAGCTGTCAAGTGAGGAGGAGATCCACCACTTTAAGAATGAGAGTCTAGGCATGGCCTTTCTGCACCTCTGCCACCTCGCTCTCTGCCGCAGTGTCCCCCTGGAGGAGGTGGCCAAGGAGATCAGCTTCACGCGCTGCATCCCGCGCTCCTTCCGGCAGCAGATCCGCCAGTACAATATGCTGACCCGGCTGCGCCTTCGGAGTGTCTTCCGACGCTTCCTGCATGCCTTCCAGCCAAACCACCTGTCCCAGCAGGTTGTCATGGTCAAGTACCTTGCCACCCTGGAGCATCTGGCACCCCGCTTTGGTGCCGAATGCATCCCTGTGCATCACCTGGAGCTCCTATTCCAGGCCGACAGGGAGCCCTGCTATATCCGGGACAGTGGGCAGCCCCCAGAAGCTGACCCCATGTCGGCCCCTGGACCCCCCACCCATGAGGTGCTGGTCACGGGTACCAGGGGCATCCAGTGGCGCCCGGTACAGCCAGAGGTGAGCAGGAGTTCCAGTGCCAATGGCAGTGACAGCTGGAATCCGAAAGCCAGGCTGCCTGGGAAAAAGGCCAGTGCCCATGAGGAGGCAGGCAAGCAGCCAGTGGACAAGCCACAGGAGCCCTCTTGGACCTACTTCTGTGACTTCCAGGACATCACCCATGTGGTCCTGAAGGAATGTCGCATCAGCATCCACCGGCAGGACAATAAGTGCCTGGAGCTGAGCCTGTCCTCCCCGGCTGCTGCCCTGTCCTTTGCGGCGCTGGTGGACGGCTACTTCCGCCTGACTACCGACTCCAGCCACTACCTGTGCCATGAGGTGGCTCCTCCGAGGCTGGTCCTGAGCATCCAGGACGGCATCCACGGACCCCTGCTGGAGCCGTTTGTGCGGGCCAAGCTGCAGCTGGAAGAGGGCGTCTACCTCATCCACTGGAGCACCAGCCACCTTGAGCGCCTCATCCTCACGGTGGGCCAGCGTGACCCGACCCCTGGCGGCAGTGGTGTGCAGAGTGTGCGCCTCCGCAAGTTCCCCATTGAGCGGCAAGCCGGGGGCTTTGTGCTGGAGGGCTGGGGCCGCTCCTTCGCCAGCGTGCGGGACCTGCGGATGGCCCTGCAGGGCTGCTCTCTGCGGGCTGGGGACGACTGCTTCTCCCTGCGCCAGTGCTGCCTGCCCCAGCCAGGAGAGATCTCCAACCTCATCATCATTCGGGGGCCTCGGGCCAGCACCCGGCAGCTCAACCTCAGCCAGCTCAGCTTCCACAGGGTACAGCAGGATGACATCACCCAGCTGTCACACTTGGGCCAGGGCACAAGGACCAACGTGTATGAGGGTCTGCTGCGAGTGGGGACGCCCGAGGAGGACAAAGAGGACAGCATGGGCCCTGTGGAGCCCAGTGGGGGCTGTGGGCAGGAGCTGCGTGTGGTGCTGAAGGTGCTGGACCCAGGTCACCACGACATCACGCTGGCCTTCTACGAGACAGCCAGCCTCATGAGCCAGGTGTCCCATGCACACCTGGCCTTCCTGCATGGCGTATGCGTGCGCGGCTCCGAGAACGTCATGGTGACGGAGTTCGTGGAGCATGGGCCCCTGGACGTGTGGCTGCGGCGGGAGCGGGGCTGTGTGCCCCTGGCCTGGAAGCTGGTGGTGGCCCAGCAGCTGGCCAGTGCCCTCAGCTACCTGGAGGACAAGAACCTGGTGCACGGGAATGTGTGTGGCCGGAACATCCTCCTGGCCCGGCTGGGGCTGGCAGATGGCACCAGCCCATTCATCAAGCTCAGCGACCCAGGCGTGGGGCTGGCCGCCCTCTCCAGGGAGGAGCGGGTGGAACGCATCCCCTGGACTGCGCCCGAGTCCCTGCTTGCTGGGGCCAGCAGCCTGAGCACAACCACAGACAAGTGGGGCTTCGGTGCCACCCTGCTGGAGATCTGCTTCAACGGCGAGGTGCCCCTGCAGGGCCACACCCCCTCCGAGAAAGAGCGCTTCTACCAGAAGCAGCATCAGCTGCCCAAGCCTTTGTGCCCAGAGCTGGCCTCAATCACCAGCCAGTGCCTGAGCTACGAGCAGGCCCAGCGGCCATCCTTCCGCACCATCCTGCGCGACCTCACTCGGCTGCAGCCCCACAGTCTAGTAGATGTCTCAGCTCTGAACCCCGACTCACCTGCGTCAGACCCCACCGTTTTTCATAAGCGCTATTTGAGAAAGATCCGAGATTTGGGAGAGGGTCACTTTGGCAAGGTCAGCCTGTACTGCTACGACCCAAACAACGATGGCACTGGCGAGATGGTGGCAGTGAAATCCCTCAAGGCGGGCGGCGGGCCCCAGCTCAGCTCGGGCTGGAGGCGGGAGATCGACATCCTTCGCACTCTGTACCACGAGCACATTGTCAAGTACAAGGGCTGCTGTGAGGACCAAGGAGAGAAGTCGGTGCAGCTCGTCATGGAGTACGTGCCGCTGGGCAGCCTCCGGGACTACCTGCCCCGGCACAGCGTCGGCCTTGCCCAGCTGCTGCTGTTCGCCCAGCAGATCTGCGAGGGCATGGCCTACCTGCATGGGCAGCACTACATCCACAGAGACCTGGCGGCGCGCAACGTGCTGCTGGACAACGACAGGCTGGTGAAGATCGGGGATTTTGGCCTTGCCAAGGCCGTGCCTGAAGGCCACGAGTACTACCGCGTGCGCGAGGACGGGGACAGTCCCGTGTTCTGGTACGCCCCCGAGTGCCTCCAGGAGTGTAAGTTTTACTACGCGTCGGACGTCTGGTCCTTCGGGGTCACACTCTATGAGCTGCTGACGCACTGTGACTCCAGCCAGAGCCCCCCCTCGAAATTCATGGAGCTCATAGGCATCACCCAGGGCCAGATGACTGTGCTGAGGCTCACAGAGTTGCTGGCGCGAGGGGAGAGGCTGCCGTGGCCAGACAGATGTCCCCGGGAGATCTACCTCCTCATGAAGAACTGCTGGGAGGCCGAGGCCTCGTTCCGTCCCACCTTCCAGAACCTTGTCCCCATCCTCAAGTCGGAGCAAGAGAAATACCAAGGCCAGGCCCCCTCGTTGTTCAGTGTGTGCTGA

XM_004865492.1 Coding sequence

Tyk2 tyrosine kinase 2, transcript variant X3

Length: 3045 bp    Location: 2518767..2502679   Strand: -
>XM_004865492.1
ATGCCCCTGTGTCATCGAGGAGGCTCTGAGAAGGGCAGCCAGCCTGCCAGGGATGAAGTGCAGCCCTTGGCCACCACGGGAGGCCTGCAGGTCCTTCTGCACTGGGCTGGCTCCAGTGGTGGGCAGCCCTGGGTCACCTTCGGTGAGGTCTCGCTGACGGCTGAGGAGATCTGCATCCGGGTCGCACACAGAATCGGCATCACACCAGCCTGCTTTAATCTCTTTGCTCTCTTTGATGCTGAGGCCCAAGTGTGGCTGCCCCCAAACCACATTCTGGAAGTTTCTGCAGACACAAGACAGACGCTGTATTTCCGCATGAGGTTTTACTTCCGGAACTGGCATGGCATGAATCCGCAGGAGCCACCTGTGTACCGCTGTGGACTCCCAGGGGCTGAGGCATCCTCAGAACAAGCAGAACAAGGGGTACAAGTCTTAGATCCAGCCTCTTTTGAGTACCTCTTTGAGCAGGGCAAGTATGAGTTTGTGAATGATGTGGTGTCGCTGCGGGAGCTGTCAAGTGAGGAGGAGATCCACCACTTTAAGAATGAGAGTCTAGGCATGGCCTTTCTGCACCTCTGCCACCTCGCTCTCTGCCGCAGTGTCCCCCTGGAGGAGGTGGCCAAGGAGATCAGCTTCACGCGCTGCATCCCGCGCTCCTTCCGGCAGCAGATCCGCCAGTACAATATGCTGACCCGGCTGCGCCTTCGGAGTGTCTTCCGACGCTTCCTGCATGCCTTCCAGCCAAACCACCTGTCCCAGCAGGTTGTCATGGTCAAGTACCTTGCCACCCTGGAGCATCTGGCACCCCGCTTTGGTGCCGAATGCATCCCTGTGCATCACCTGGAGCTCCTATTCCAGGCCGACAGGGAGCCCTGCTATATCCGGGACAGTGGGCAGCCCCCAGAAGCTGACCCCATGTCGGCCCCTGGACCCCCCACCCATGAGGTGCTGGTCACGGGTACCAGGGGCATCCAGTGGCGCCCGGTACAGCCAGAGAGTTCCAGTGCCAATGGCAGTGACAGCTGGAATCCGAAAGCCAGGCTGCCTGGGAAAAAGGCCAGTGCCCATGAGGAGGCAGGCAAGCAGCCAGTGGACAAGCCACAGGAGCCCTCTTGGACCTACTTCTGTGACTTCCAGGACATCACCCATGTGGTCCTGAAGGAATGTCGCATCAGCATCCACCGGCAGGACAATAAGTGCCTGGAGCTGAGCCTGTCCTCCCCGGCTGCTGCCCTGTCCTTTGCGGCGCTGGTGGACGGCTACTTCCGCCTGACTACCGACTCCAGCCACTACCTGTGCCATGAGGTGGCTCCTCCGAGGCTGGTCCTGAGCATCCAGGACGGCATCCACGGACCCCTGCTGGAGCCGTTTGTGCGGGCCAAGCTGCAGCTGGAAGAGGGCGTCTACCTCATCCACTGGAGCACCAGCCACCTTGAGCGCCTCATCCTCACGGTGGGCCAGCGTGACCCGACCCCTGGCGGCAGTGGTGTGCAGAGTGTGCGCCTCCGCAAGTTCCCCATTGAGCGGCAAGCCGGGGGCTTTGTGCTGGAGGGCTGGGGCCGCTCCTTCGCCAGCGTGCGGGACCTGCGGATGGCCCTGCAGGGCTGCTCTCTGCGGGCTGGGGACGACTGCTTCTCCCTGCGCCAGTGCTGCCTGCCCCAGCCAGGAGAGATCTCCAACCTCATCATCATTCGGGGGCCTCGGGCCAGCACCCGGCAGCTCAACCTCAGCCAGCTCAGCTTCCACAGGGTACAGCAGGATGACATCACCCAGCTGTCACACTTGGGCCAGGGCACAAGGACCAACGTGTATGAGGGTCTGCTGCGAGTGGGGACGCCCGAGGAGGACAAAGAGGACAGCATGGGCCCTGTGGAGCCCAGTGGGGGCTGTGGGCAGGAGCTGCGTGTGGTGCTGAAGGTGCTGGACCCAGGTCACCACGACATCACGCTGGCCTTCTACGAGACAGCCAGCCTCATGAGCCAGGTGTCCCATGCACACCTGGCCTTCCTGCATGGCGTATGCGTGCGCGGCTCCGAGAACGTCATGGTGACGGAGTTCGTGGAGCATGGGCCCCTGGACGTGTGGCTGCGGCGGGAGCGGGGCTGTGTGCCCCTGGCCTGGAAGCTGGTGGTGGCCCAGCAGCTGGCCAGTGCCCTCAGCTACCTGGAGGACAAGAACCTGGTGCACGGGAATGTGTGTGGCCGGAACATCCTCCTGGCCCGGCTGGGGCTGGCAGATGGCACCAGCCCATTCATCAAGCTCAGCGACCCAGGCGTGGGGCTGGCCGCCCTCTCCAGGGAGGAGCGGGTGGAACGCATCCCCTGGACTGCGCCCGAGTCCCTGCTTGCTGGGGCCAGCAGCCTGAGCACAACCACAGACAAGTGGGGCTTCGGTGCCACCCTGCTGGAGATCTGCTTCAACGGCGAGGTGCCCCTGCAGGGCCACACCCCCTCCGAGAAAGAGCGCTTCTACCAGAAGCAGCATCAGCTGCCCAAGCCTTTGTGCCCAGAGCTGGCCTCAATCACCAGCCAGTGCCTGAGCTACGAGCAGGCCCAGCGGCCATCCTTCCGCACCATCCTGCGCGACCTCACTCGGCTGCAGCCCCACAGTCTAGTAGATGTCTCAGCTCTGAACCCCGACTCACCTGCGTCAGACCCCACCGTTTTTCATAAGCGCTATTTGAGAAAGATCCGAGATTTGGGAGAGGGTCACTTTGGCAAGGTCAGCCTGTACTGCTACGACCCAAACAACGATGGCACTGGCGAGATGGTGGCAGTGAAATCCCTCAAGGCGGGCGGCGGGCCCCAGCTCAGCTCGGGCTGGAGGCGGGAGATCGACATCCTTCGCACTCTGTACCACGAGCACATTGTCAAGTACAAGGGCTGCTGTGAGGACCAAGGAGAGAAGTCGGTGCAGCTCGTCATGGAGTACGTGCCGCTGGGCAGCCTCCGGGACTACCTGCCCCGGCACAGCGTCGGCCTTGCCCAGCTGCTGCTGTTCGCCCAGCAGATCTGCGAGGTGGCCGGGTCTGCAGGTTTCACCTGA

XM_004865494.1 Coding sequence

Cdc37 cell division cycle 37, transcript variant X2

High confidence: 4 potential gene matches
Length: 1137 bp    Location: 2533418..2523761   Strand: -
>XM_004865494.1
ATGGTGGATTACAGCGTGTGGGACCACATCGAGGTGTCTGACGATGAGGACGAGACGCACCCCAACATCGACACGGCCAGCCTCTTCCGCTGGCGGCACCAGGCCCGCGTGGAGCGCATGGAGCAGTTCCAGAAGGAGAAGGAGGAGCTGGACAGGGGCTGCCGCGAGTGCAAGCGCAAGGTGGCTGAGTGCCAGCGCAAGCTGAAGGACCTGGAGGTGGCCGAGGGCGGCCAGGCAGAGCGGGAGCGGCTGCAGGCCGAGGCGCAGCAGCTTCGCAAGGAGGAACGGAGCTGGGAGCAGAAGCTGGAGGAGATCCGCAAGAAGGAGAAGAGCATGCCCTGGAACGTGGACACGCTCAGCAAGGACGGCTTCAGCAAGAGCATGGTCAATACCAAGCCTGAGAAGGCGGAGGAGGAGTCGGAGGAGGTCAGGGAGCAGAAACATAAAACCTTTGTGGAGAAGTATGAGAAGCAGATCAAGCACTTCGGGATGCTCCGCCGCTGGGATGACAGCCAGAAGTACCTGTCTGACAACGTGTACCTGGTGTGTGAGGAGACCGCCAACTACCTGGTGATCTGGTGCATCGACTTGGAGGTGGAGGAGAAATGTGCGCTCATGGAGCAGGTGGCCCACCAGACCATCGTCATGCAGTTCATTCTGGAGCTGGCCAAGAGCCTCAAGGTGGACCCCCGTGCCTGCTTCCGGCAGTTCTTCACGAAGATTAAGACGGCTGACCGCCAGTACATGGAGGGCTTCAACGACGAATTGGACGCCTTCAAGGAGCGCGTGCGTGGCCGTGCCAAGCTTCGCATTGAGAAGGCCATGAAGGAGTATGAGGAAGAGGAGCGCAAGAAGCGGCTGGGCCCTGGTGGCCTGGACCCAGTTGAGGTCTACGAGTCCCTGCCCGAGGAGCTGCAGAAGTGCTTCGATGTGAAGGACGTGCAGATGCTGCAGGACGCCATCAGTAAGATGGACCCCGCCGATGCTAAGTACCACATGCAGCGGTGCATCGACTCGGGGCTCTGGGTCCCCAACTCCAAGGCCAGCGAGCCCAAGGAGGGGGAGGAGGCGGGCCCCGGGGATCCATTGCTGGAAGCTGCAACCAAGCCAGGCGATGAGGAGGATGGCAGTGCCTGA

XM_004865497.1 Coding sequence

Pde4a phosphodiesterase 4A, cAMP-specific, transcript variant X3

Length: 2478 bp    Location: 2540249..2574706   Strand: +
>XM_004865497.1
ATGAAGAGGAGTCCCAGTTTCCTGTCTGTGGCCAGGATCCTAACGAGAGGCCCCAGGAGACTCTGGAGGCCCCGCCCCAACATGCTGGGGGCAGACTCCCATCGCCCTAGCCGCTGTCTCTCATCCCGTCCCCGCCTGGGCTGGGCCCATCCTGAGCCCTTGGACCCTTGTGTCCCTCTGGCACCACGGCCCACCACACTGCCACTGCTGATCCCGCCGCGGATTTCCATCACCAGGGCAGAGGCCCACAGCTTCGAGGCGGAAAATGGGCCGACGCCATCCCCCGGCCGCAGCCCCCTGGACTCGCAGGCGAGCCCAGGCCTTGTGCTGCATGCTGGAGCAGCCACCAGCCAGCGCCGGGAGTCCTTTCTCTACCGCTCCGACAGCGACTATGACATGTCACCCAAGACCATGTCCCGCAACTCCTCGGTCGCCAGCGAGGCGCATGCGGAGGACCTCATTGTAACGCCCTTTGCCCAGGTGCTGGCCAGTCTCCGAAGTGTCCGAAGCAACTTCTCACTCCTGACCAATGTGCCCATTCCTAGCCACAAGCGGTCCCCGCTGGGAGGCCCCACCCCCGTCTGCAAGGCCACACTATCAGAGGAGACATGTCAGCAGCTGGCCCGGGAGACTTTGGAGGAGCTGGACTGGTGCCTGGAGCAGCTGGAGACCATGCAGACCTACCGCTCTGTCAGCGAGATGGCCTCGCATAAGTTCAAGAGGATGCTGAACCGCGAGCTCACACACCTGTCAGAAATGAGCAGGTCGGGAAACCAGGTCTCAGAGTACATTTCCACGACATTCCTGGACAAACAGAATGAAGTGGAGATCCCATCACCCACGATGAAAGATCGAGAGCCCCAGGAAGCGCTGCGACAGAGACCCTCCCAGCAGCTCCCGCCCCCGGTGCCACACCTGCAGCCCATGTCGCAGATCACCGGGGTGAAGAGGCTGTCACACAACAGCAGCCTGAACAACACCAGCATCCCCCGCTTTGGGGTGAAGACGGATCAGGAGGAGCTCCTGGCCCAAGAACTGGAGAACTTAAGCAAGTGGGGCCTGAACATCTTTTGCGTGTCCGATTATGCTGGAGGTCGCTCGCTGAGCTGTATCATGTACACGATATTCCAGGAGCGGGACTTGTTGAAGAAATTCCGAATCCCCTTGGACACGATGGTGACATACATGCGGACGCTGGAAGACCACTACCACGCCGATGTGGCCTACCACAACAGCCTGCACGCCGCCGACGTGTTGCAGTCCACCCACGTGCTGCTGGCCACGCCTGCCCTGGACGCGGTGTTCACAGACCTGGAGATTCTCGCAGCCCTCTTCGCAGCTGCCATTCATGATGTGGACCACCCTGGGGTCTCCAACCAGTTCCTCATCAACACAAACTCAGAGCTGGCGCTCATGTATAACGATGAGTCGGTGCTAGAGAACCACCACTTGGCTGTGGGCTTCAAGCTGCTCCAGGAAGAGAACTGTGACATCTTCCAGAACCTCGGCAAGCGCCAGCGGCAGAGCCTGCGCAAGATGGTCATCGACATGGTGCTGGCCACGGACATGTCCAAGCACATGACCCTCCTAGCTGATCTGAAGACCATGGTGGAAACTAAGAAAGTGACAAGCTCCGGAGTTCTCTTGCTGGACAACTACGCCGACCGCATCCAGGTCCTTCGGAACATGGTGCACTGCGCAGACCTCAGCAACCCCACCAAGCCACTGGAGCTGTACCGCCAGTGGACAGACCGCATCATGGCCGAGTTCTTCCAGCAGGGGGACCGAGAACGTGATCGGGGCATGGAGATCAGTCCCATGTGTGACAAGCACACAGCCTCCGTGGAGAAGTCGCAGGTGGGTTTCATCGACTACATCGTGCACCCGCTGTGGGAGACATGGGCAGACCTGGTGCACCCAGATGCGCAGGACATCCTGGACACGCTGGAAGACAACCGGGACTGGTACTACAGCGCCATCCGGCAGAGCCCATCGCCGCCGCCCGAGGAGGAGCCCGGTGAACCAGGCCACCCCGCCCCACCCGATAAGTTCCAGTTTGAGCTGACGCTGGAGGAGGAAGAGGAAGAGGAGGCAGCGCCAGCCCAGGATTTGTTGGAAGCTCGGGGATCATCCACGTCCGAGGAGCCAGCCAAGATCAAGGGCCAGGAGGCTGAGACAGGGCATTTGTCGCGGGGTTTGGGCTTGACGTGTGTTGCCCCTGCAGCGCAGGAGTCCATGGACGCGGGAAGCTGCGACCTGACCCTTGAAAGCCCCCTTCTGCCTGCCTTGAGGACCCAGTTCACGCCAGAGGAATCCCCGGGGCTCCTGGGCCTCCCCTCCACGGCGGCCGAGGTGGGGGCCCGAAGAGACCATCAGGCTGCCGAGAGGGCTTGCCGCGCATGTGCAGGGACGTCCGAGGAGGACCCAGCCTTGCTCCCGGTTCCGGGTGGGTGGGAGCCAGGTGTGGACCCTCCCTGA

XM_004865499.1 Coding sequence

Pde4a phosphodiesterase 4A, cAMP-specific, transcript variant X5

High confidence: 4 potential gene matches
Length: 2361 bp    Location: 2553535..2574706   Strand: +
>XM_004865499.1
ATGCGCCCCAGCGCTACCCCCCGGGCCCGACCCCGGCCCCCTGCCCTGGTCCTGACCCCGGGACCAGAGTCCCCGACCTTCTTCTCCTTCAGCGGTGAAGACTCTCGTCGACACAGGCCGGGCAGATCTGTCAGCTTCGAGGCGGAAAATGGGCCGACGCCATCCCCCGGCCGCAGCCCCCTGGACTCGCAGGCGAGCCCAGGCCTTGTGCTGCATGCTGGAGCAGCCACCAGCCAGCGCCGGGAGTCCTTTCTCTACCGCTCCGACAGCGACTATGACATGTCACCCAAGACCATGTCCCGCAACTCCTCGGTCGCCAGCGAGGCGCATGCGGAGGACCTCATTGTAACGCCCTTTGCCCAGGTGCTGGCCAGTCTCCGAAGTGTCCGAAGCAACTTCTCACTCCTGACCAATGTGCCCATTCCTAGCCACAAGCGGTCCCCGCTGGGAGGCCCCACCCCCGTCTGCAAGGCCACACTATCAGAGGAGACATGTCAGCAGCTGGCCCGGGAGACTTTGGAGGAGCTGGACTGGTGCCTGGAGCAGCTGGAGACCATGCAGACCTACCGCTCTGTCAGCGAGATGGCCTCGCATAAGTTCAAGAGGATGCTGAACCGCGAGCTCACACACCTGTCAGAAATGAGCAGGTCGGGAAACCAGGTCTCAGAGTACATTTCCACGACATTCCTGGACAAACAGAATGAAGTGGAGATCCCATCACCCACGATGAAAGATCGAGAGCCCCAGGAAGCGCTGCGACAGAGACCCTCCCAGCAGCTCCCGCCCCCGGTGCCACACCTGCAGCCCATGTCGCAGATCACCGGGGTGAAGAGGCTGTCACACAACAGCAGCCTGAACAACACCAGCATCCCCCGCTTTGGGGTGAAGACGGATCAGGAGGAGCTCCTGGCCCAAGAACTGGAGAACTTAAGCAAGTGGGGCCTGAACATCTTTTGCGTGTCCGATTATGCTGGAGGTCGCTCGCTGAGCTGTATCATGTACACGATATTCCAGGAGCGGGACTTGTTGAAGAAATTCCGAATCCCCTTGGACACGATGGTGACATACATGCGGACGCTGGAAGACCACTACCACGCCGATGTGGCCTACCACAACAGCCTGCACGCCGCCGACGTGTTGCAGTCCACCCACGTGCTGCTGGCCACGCCTGCCCTGGACGCGGTGTTCACAGACCTGGAGATTCTCGCAGCCCTCTTCGCAGCTGCCATTCATGATGTGGACCACCCTGGGGTCTCCAACCAGTTCCTCATCAACACAAACTCAGAGCTGGCGCTCATGTATAACGATGAGTCGGTGCTAGAGAACCACCACTTGGCTGTGGGCTTCAAGCTGCTCCAGGAAGAGAACTGTGACATCTTCCAGAACCTCGGCAAGCGCCAGCGGCAGAGCCTGCGCAAGATGGTCATCGACATGGTGCTGGCCACGGACATGTCCAAGCACATGACCCTCCTAGCTGATCTGAAGACCATGGTGGAAACTAAGAAAGTGACAAGCTCCGGAGTTCTCTTGCTGGACAACTACGCCGACCGCATCCAGGTCCTTCGGAACATGGTGCACTGCGCAGACCTCAGCAACCCCACCAAGCCACTGGAGCTGTACCGCCAGTGGACAGACCGCATCATGGCCGAGTTCTTCCAGCAGGGGGACCGAGAACGTGATCGGGGCATGGAGATCAGTCCCATGTGTGACAAGCACACAGCCTCCGTGGAGAAGTCGCAGGTGGGTTTCATCGACTACATCGTGCACCCGCTGTGGGAGACATGGGCAGACCTGGTGCACCCAGATGCGCAGGACATCCTGGACACGCTGGAAGACAACCGGGACTGGTACTACAGCGCCATCCGGCAGAGCCCATCGCCGCCGCCCGAGGAGGAGCCCGGTGAACCAGGCCACCCCGCCCCACCCGATAAGTTCCAGTTTGAGCTGACGCTGGAGGAGGAAGAGGAAGAGGAGGCAGCGCCAGCCCAGGATTTGTTGGAAGCTCGGGGATCATCCACGTCCGAGGAGCCAGCCAAGATCAAGGGCCAGGAGGCTGAGACAGGGCATTTGTCGCGGGGTTTGGGCTTGACGTGTGTTGCCCCTGCAGCGCAGGAGTCCATGGACGCGGGAAGCTGCGACCTGACCCTTGAAAGCCCCCTTCTGCCTGCCTTGAGGACCCAGTTCACGCCAGAGGAATCCCCGGGGCTCCTGGGCCTCCCCTCCACGGCGGCCGAGGTGGGGGCCCGAAGAGACCATCAGGCTGCCGAGAGGGCTTGCCGCGCATGTGCAGGGACGTCCGAGGAGGACCCAGCCTTGCTCCCGGTTCCGGGTGGGTGGGAGCCAGGTGTGGACCCTCCCTGA

XM_004865498.1 Coding sequence

Pde4a phosphodiesterase 4A, cAMP-specific, transcript variant X4

Length: 1830 bp    Location: 2563526..2574706   Strand: +
>XM_004865498.1
ATGCCCCTGGTCGATTTCTTCTGCGAGACCTGCTCCAAGCCGTGGCTGGTGGGCTGGTGGGACCAGTTCAAGAGGATGCTGAACCGCGAGCTCACACACCTGTCAGAAATGAGCAGGTCGGGAAACCAGGTCTCAGAGTACATTTCCACGACATTCCTGGACAAACAGAATGAAGTGGAGATCCCATCACCCACGATGAAAGATCGAGAGCCCCAGGAAGCGCTGCGACAGAGACCCTCCCAGCAGCTCCCGCCCCCGGTGCCACACCTGCAGCCCATGTCGCAGATCACCGGGGTGAAGAGGCTGTCACACAACAGCAGCCTGAACAACACCAGCATCCCCCGCTTTGGGGTGAAGACGGATCAGGAGGAGCTCCTGGCCCAAGAACTGGAGAACTTAAGCAAGTGGGGCCTGAACATCTTTTGCGTGTCCGATTATGCTGGAGGTCGCTCGCTGAGCTGTATCATGTACACGATATTCCAGGAGCGGGACTTGTTGAAGAAATTCCGAATCCCCTTGGACACGATGGTGACATACATGCGGACGCTGGAAGACCACTACCACGCCGATGTGGCCTACCACAACAGCCTGCACGCCGCCGACGTGTTGCAGTCCACCCACGTGCTGCTGGCCACGCCTGCCCTGGACGCGGTGTTCACAGACCTGGAGATTCTCGCAGCCCTCTTCGCAGCTGCCATTCATGATGTGGACCACCCTGGGGTCTCCAACCAGTTCCTCATCAACACAAACTCAGAGCTGGCGCTCATGTATAACGATGAGTCGGTGCTAGAGAACCACCACTTGGCTGTGGGCTTCAAGCTGCTCCAGGAAGAGAACTGTGACATCTTCCAGAACCTCGGCAAGCGCCAGCGGCAGAGCCTGCGCAAGATGGTCATCGACATGGTGCTGGCCACGGACATGTCCAAGCACATGACCCTCCTAGCTGATCTGAAGACCATGGTGGAAACTAAGAAAGTGACAAGCTCCGGAGTTCTCTTGCTGGACAACTACGCCGACCGCATCCAGGTCCTTCGGAACATGGTGCACTGCGCAGACCTCAGCAACCCCACCAAGCCACTGGAGCTGTACCGCCAGTGGACAGACCGCATCATGGCCGAGTTCTTCCAGCAGGGGGACCGAGAACGTGATCGGGGCATGGAGATCAGTCCCATGTGTGACAAGCACACAGCCTCCGTGGAGAAGTCGCAGGTGGGTTTCATCGACTACATCGTGCACCCGCTGTGGGAGACATGGGCAGACCTGGTGCACCCAGATGCGCAGGACATCCTGGACACGCTGGAAGACAACCGGGACTGGTACTACAGCGCCATCCGGCAGAGCCCATCGCCGCCGCCCGAGGAGGAGCCCGGTGAACCAGGCCACCCCGCCCCACCCGATAAGTTCCAGTTTGAGCTGACGCTGGAGGAGGAAGAGGAAGAGGAGGCAGCGCCAGCCCAGGATTTGTTGGAAGCTCGGGGATCATCCACGTCCGAGGAGCCAGCCAAGATCAAGGGCCAGGAGGCTGAGACAGGGCATTTGTCGCGGGGTTTGGGCTTGACGTGTGTTGCCCCTGCAGCGCAGGAGTCCATGGACGCGGGAAGCTGCGACCTGACCCTTGAAAGCCCCCTTCTGCCTGCCTTGAGGACCCAGTTCACGCCAGAGGAATCCCCGGGGCTCCTGGGCCTCCCCTCCACGGCGGCCGAGGTGGGGGCCCGAAGAGACCATCAGGCTGCCGAGAGGGCTTGCCGCGCATGTGCAGGGACGTCCGAGGAGGACCCAGCCTTGCTCCCGGTTCCGGGTGGGTGGGAGCCAGGTGTGGACCCTCCCTGA

XM_004865502.1 Coding sequence

Keap1 kelch-like ECH-associated protein 1, transcript variant X2

Length: 1887 bp    Location: 2595015..2580812   Strand: -
>XM_004865502.1
ATGCAGCCGGAACCCAGGCCTAGCAGGGCCAGGGCCCGAAGCCGATTTCTGCCCCTGCATTCTGAGTGCCCCGAGGGGGCCGGGGACACGGTGATGTACGCGTCCACCGAGTGCAAGGCCGAGGTGACCCCGTCCCAGGATGGCAACCGAACCTTCAGCTACACGCTGGAGGACCACACCAAGCAGGCCTTTGGCATCATGAACGAACTGCGGCTCAGCCAGCAGCTGTGCGATGTCACCCTGCAGGTGAAATACGAGGACATCCCCACGGCGCAGTTCATGGCGCACAAGGTGGTACTGGCCTCGTCCAGCCCTGTGTTCAAGGCCATGTTCACCACGGGGCTGCGCGAGCAGGGCATGGAGGTGGTATCCATCGAAGGGATCCACCCACGGGTCATGGAGCGGCTCATTGAGTTCGCCTACACCGCGTCCATCTCCATGGGTGAGAAGTGCGTGCTGCATGTAATGAATGGCGCCGTCATGTACCAGATCGACAGCGTCGTGCGCGCCTGCAGTGACTTCCTGGTGCAGCAGCTCGACCCCAGCAACGCCATCGGCATCGCCAACTTCGCCGAGCAGATTGGCTGCACCGAGCTGCACCAGCGGGCGCGGGAGTACATCTACATGCACTTCGGGGAGCGCCCTCTGCAGGTGGCCAAGCAGGAGGAGTTCTTCAACCTGTCGCACTGCCAGCTGGCGACGCTGATCAGCCGGGACGACCTGAACGTGCGCTGCGAGTCCGAGGTGTTCCACGCATGCATCAACTGGGTCAAGTACGACTGTGAGCAGCGACGTTTCTATGTGCAGGCGCTGCTGCGCGCAGTGCGCTGTCACGCGCTCACCCCGCACTTCCTGCAGATGCAGCTGCAGAAGTGCGAGATCCTGCAGAGCGACTCGCGCTGCAAGGACTACTTGGTGCAGATCTTCCAGGAGCTCACGCTGCACAAGCCCACTCCGGCCATGCCCTGCCGGGCGCCCAAGGTGGGCCGCCTCATCTACACGGCCGGCGGCTACTTCCGCCAGTCGCTCAGCTATCTGGAGGCCTACAACCCGAGTGATGGCACCTGGCTACGCCTGGCTGACCTGCAGGTGCCCCGCAGTGGGCTGGCAGGCTGCGTGGTGGGGGGGCTGCTTTACGCCGTGGGTGGCCGCAACAACTCCCCCGACGGGAACACCGACTCCAATGCCTTGGACTGCTACAACCCCATGACCAATCAGTGGTCGCCCTGCGCCCCCATGAGTGTGCCCCGCAACCGCATCGGCGTGGGCGTCATTGACGGCCACATCTACGCCGTGGGGGGCTCGCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCCGAGCGGGATGAGTGGCACTTGGTGTCCCCGATGCTGACCCGGAGGATCGGTGTGGGCGTGGCTGTCCTCAATCGCCTGCTGTACGCTGTCGGGGGCTTCGATGGGACGAACCGCCTCAACTCGGCTGAGTGCTACTACCCGGAGCGCAATGAGTGGCGCCTGATCACCCCCATGAACACCATCCGCAGCGGGGCAGGAGTCTGTGTGCTGCACAACTGTATCTATGCTGCGGGCGGCTATGACGGTCAGGACCAGCTCAACAGCATGGAGCGCTATGATGTGGAGATGGAGACCTGGACGTTTGTGGCCCCCATGAAGCATCGGCGAAGCGCCCTGGGGATTACTGTGCACCAGGGGAGAATCTATGTCCTTGGAGGCTATGACGGTCACACGTTCCTGGACAGCGTGGAGTGCTACGACCCAGACACAGACACCTGGAGCGAGGTGACCCGCATGACATCCGGCCGGAGTGGGGTGGGCGTCGCCGTCACCATGGAGCCCTGCCGGAAGCACATCGACCAGCAGAACTGTACCTGTTGA

XM_004865501.1 Coding sequence

Keap1 kelch-like ECH-associated protein 1, transcript variant X1

Length: 1887 bp    Location: 2589638..2580812   Strand: -
>XM_004865501.1
ATGCAGCCGGAACCCAGGCCTAGCAGGGCCAGGGCCCGAAGCCGATTTCTGCCCCTGCATTCTGAGTGCCCCGAGGGGGCCGGGGACACGGTGATGTACGCGTCCACCGAGTGCAAGGCCGAGGTGACCCCGTCCCAGGATGGCAACCGAACCTTCAGCTACACGCTGGAGGACCACACCAAGCAGGCCTTTGGCATCATGAACGAACTGCGGCTCAGCCAGCAGCTGTGCGATGTCACCCTGCAGGTGAAATACGAGGACATCCCCACGGCGCAGTTCATGGCGCACAAGGTGGTACTGGCCTCGTCCAGCCCTGTGTTCAAGGCCATGTTCACCACGGGGCTGCGCGAGCAGGGCATGGAGGTGGTATCCATCGAAGGGATCCACCCACGGGTCATGGAGCGGCTCATTGAGTTCGCCTACACCGCGTCCATCTCCATGGGTGAGAAGTGCGTGCTGCATGTAATGAATGGCGCCGTCATGTACCAGATCGACAGCGTCGTGCGCGCCTGCAGTGACTTCCTGGTGCAGCAGCTCGACCCCAGCAACGCCATCGGCATCGCCAACTTCGCCGAGCAGATTGGCTGCACCGAGCTGCACCAGCGGGCGCGGGAGTACATCTACATGCACTTCGGGGAGCGCCCTCTGCAGGTGGCCAAGCAGGAGGAGTTCTTCAACCTGTCGCACTGCCAGCTGGCGACGCTGATCAGCCGGGACGACCTGAACGTGCGCTGCGAGTCCGAGGTGTTCCACGCATGCATCAACTGGGTCAAGTACGACTGTGAGCAGCGACGTTTCTATGTGCAGGCGCTGCTGCGCGCAGTGCGCTGTCACGCGCTCACCCCGCACTTCCTGCAGATGCAGCTGCAGAAGTGCGAGATCCTGCAGAGCGACTCGCGCTGCAAGGACTACTTGGTGCAGATCTTCCAGGAGCTCACGCTGCACAAGCCCACTCCGGCCATGCCCTGCCGGGCGCCCAAGGTGGGCCGCCTCATCTACACGGCCGGCGGCTACTTCCGCCAGTCGCTCAGCTATCTGGAGGCCTACAACCCGAGTGATGGCACCTGGCTACGCCTGGCTGACCTGCAGGTGCCCCGCAGTGGGCTGGCAGGCTGCGTGGTGGGGGGGCTGCTTTACGCCGTGGGTGGCCGCAACAACTCCCCCGACGGGAACACCGACTCCAATGCCTTGGACTGCTACAACCCCATGACCAATCAGTGGTCGCCCTGCGCCCCCATGAGTGTGCCCCGCAACCGCATCGGCGTGGGCGTCATTGACGGCCACATCTACGCCGTGGGGGGCTCGCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCCGAGCGGGATGAGTGGCACTTGGTGTCCCCGATGCTGACCCGGAGGATCGGTGTGGGCGTGGCTGTCCTCAATCGCCTGCTGTACGCTGTCGGGGGCTTCGATGGGACGAACCGCCTCAACTCGGCTGAGTGCTACTACCCGGAGCGCAATGAGTGGCGCCTGATCACCCCCATGAACACCATCCGCAGCGGGGCAGGAGTCTGTGTGCTGCACAACTGTATCTATGCTGCGGGCGGCTATGACGGTCAGGACCAGCTCAACAGCATGGAGCGCTATGATGTGGAGATGGAGACCTGGACGTTTGTGGCCCCCATGAAGCATCGGCGAAGCGCCCTGGGGATTACTGTGCACCAGGGGAGAATCTATGTCCTTGGAGGCTATGACGGTCACACGTTCCTGGACAGCGTGGAGTGCTACGACCCAGACACAGACACCTGGAGCGAGGTGACCCGCATGACATCCGGCCGGAGTGGGGTGGGCGTCGCCGTCACCATGGAGCCCTGCCGGAAGCACATCGACCAGCAGAACTGTACCTGTTGA

XM_004865500.1 Coding sequence

LOC101718426 sphingosine 1-phosphate receptor 5-like

Length: 1197 bp    Location: 2601943..2592475   Strand: -
>XM_004865500.1
ATGGATCCAGGGCTGTTGCGGCCGGCGCCGGTGAGCGAAGTCCTGGTGCTGCACTACAACTACACGGGCAAGCTGCGCGGGGCGCGCTACCAGCCGGGCGCGGGGCTGCGCACCGACGCCGCAGTGTGCCTGGCCGTGTGCGCTTTTATCGTGCTGGAGAACCTGGCTGTGCTTGTCGTGCTCGCGCGCCATCCGCGCTTCCACGCGCCCATGTTCCTGCTGCTGGGCAGCCTCACGCTATCTGACCTGCTGGCCGGCGCCGCCTACGCCACCAACATCCTCCTGTCCGGGCCGCTCACGCTGCGACTGTCGCCGGCGCTCTGGTTCGCACGCGAGGGCGGCGTCTTCGTGGCGCTCGCCGCGTCCGTGCTGAGCCTCCTGGCCATCGCGCTCGAGCGCCACCTCACCATGGCGCGCCGGGGACCCGCGCCCGCCGCCAGCCGAGGGCGCACGGTGGCGCTGGCGGCCGCCGCCTGGGGAGTGTCCCTGGTACTGGGGCTGCTGCCCGCGCTGGGCTGGAACTGTCTGGGCCGCCTGGAAGCCTGCTCCACCGTGCTGCCGCTCTACGCTAAGGCCTACGTGCTCTTCTGCGTGCTGGCCTTCTTGGGGACCCTGGGCGCCATCTGTGCGCTCTACGCCCGCATCTACTGCCAGGTGCGCGCCAACGCGCGGCGCCTGCGCTCAAGACCCGGGGCCACCAGGGCTGGCGCCACCAGCGCGCGTCGCACCCCGCGCTCCCTGGCGCTGCTCCGCACGCTCAGCGTGGTGCTCCTGGCCTTCGTCGCCTGCTGGGGACCCCTGTTCCTGCTGCTCCTGCTCGACGTGGCGTGTCCCGCGAGGGCCTGCCCTGTACTCCTCCAAGCCGACCCCTTCCTGGGGCTGGCCATGGCCAACTCGCTGCTCAACCCCATCATCTACACCCTCACCAACCGCGACCTGCGCCACGCGCTCCTGCGCCTGCTCTGCTGCGGCCGCCGTCCCTGCGGCCCACGCCCTGACGGCTCCCAGCCCTCGGGGAGCAAGGCTGGGGCCTCGGGGGCCCTGAGACGCTGTCTGCCCCCTGGCCTGGACCTCAGCTCCAGCCGCTCCGAGCGCTCTTCGCGCCCGGGCGACGCGGTGGACACCAGTGGCTCCATAGGCAGCCCTGGTGCAGCTATGACTGGCCGGACCCTGGTACCCGGCTCCACTGCGGACTGA

XM_004865506.1 Coding sequence

Atg4d autophagy related 4D, cysteine peptidase, transcript variant X2

Length: 1188 bp    Location: 2618378..2624756   Strand: +
>XM_004865506.1
ATGGTTAAAAGCCGGACCAGCTTTAGCAAGATCTCCAGCATCTACCTCTGTGGCCGCCGCTACCGCTTTGAGGGTGAAGGTGACATCCAACGTTTCCAGCGGGACTTTGTGTCTCGCCTGTGGCTGACCTACCGCCGTGACTTCCCACCCCTGGCTGGGGGTTCCCTGACCTCAGACTGTGGCTGGGGATGCATGCTGCGCAGTGGTCAGATGATGCTGGCTCAGGGATTGCTGCTGCATTTCCTGCCCCGAGACTGGATGTGGATCGAGGGTCCAGGCCTGGCCCACCCTGAGCTACCTGGCTCGGCCTCCTCTAGCCAGGGCCGAGGCCCTGCCCGATGGATGCCCCCGAGCTGCCCCTGGGGTGCCCTTGAGCGGGAACAGGAGCTGCGGCACCGGCAGATCGTGTCTTGGTTCGCTGACCACCCCCGAGCACCCCTGGGCCTCCACCGGCTGGTGGAACTGGGGCAGAGCTCGGGCAAGAAGGCGGGTGACTGGTACGGTCCATCGCTGGTGGCGCACATCCTCAGGAAGGCTGTGGAGAGCAGCTCGGAGCTCACCCACCTGGCTGTGTATGTTTCTCAGGACTGCACAGTGTACAAGGCAGATGTGGCCCATCTGGTGGCCAGCCCAGACCCCGCTGCTGAGTGGAAGTCTGTGGTTATTCTGGTGCCTGTGCGCCTGGGCGGCGAGACCCTGAACCCTGTGTATGTGCCTGGCGTGAAGGAGCTCCTGAGGTCTGAACTGTGCCTGGGCATCATGGGGGGCAAACCGAGGCACTCACTCTACTTCATTGGCTACCAGGATGACTTCCTGCTCTACCTGGACCCGCACTACTGCCAGCCCACTGTAGATGTCAGCCAGGCTGACTTCTCCCTGGAGTCTTTCCACTGCACCTCACCCCGCAAGATGGCCTTCGCCAAGATGGACCCAAGCTGCACTGTGGGGTTCTATGCAGGAAACAGGAAGGAGTTGGAGACACTCTGCTCTGAGCTGACCAGGATCCTCAGCTCCTCTTCAGCCACAGAGCGCTACCCCATGTTCACCCTGGTGGAGGGCCACGCTCAGGACCACAGCCTGGATGACCTGTGCTCCCAGCTCTCCCAGACCACAACGCTGCGGCTCCCTCGCACCGGGCGCCTCCTCAAGGCCAAACGGCCGAGCTCAGAGGACTTTGTGTTTTTATAA

XM_004865509.1 Coding sequence

Cdkn2d cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4), transcript variant X3

High confidence: 3 potential gene matches
Length: 501 bp    Location: 2636532..2634650   Strand: -
>XM_004865509.1
ATGATGCTGGAGGAGGTCCGCGCCGGCGACCGGCTGAGTGGGGCCGCGGCCCGGGGAGACGTGCAGGAGGTGCGCCGCCTGCTGTACCGCGAGCTCGTGCACCCGGACGCCCTCAACCGCTTCGGCAAGACGGCGCTGCAGGTGATGATGTTTGGCAGCCTCACCATCGCCCAGGAGCTGCTGAAACAGGGTGCCAGCCCCAATATCCAGGATGCCTCTGGCACCAGTCCGGTCCACGATGCAGCCCGAACTGGATTCCTGGACACCCTGAAGGTCCTCGTGGAATACGGCGCTGATGTCAACATGCCCGATGGCACTGGGTCACTGCCCATCCACCTGGCGGTGCGTGAGGGCCACGCCTCGGTGGTCAGCTTCCTGGCTCCGGAGTCTGATCTCCATCACAGGGACGCCGCGGGGCTCACACCTCTGGAGCTGGCACGGCAGAGGGGGGCTCAGGACCTCTTGGACATCCTGCAGGGGCACAAGGTGATCCCACTGTGA

XM_004865512.1 Coding sequence

Ap1m2 adaptor-related protein complex 1, mu 2 subunit, transcript variant X3

Length: 1278 bp    Location: 2647569..2638515   Strand: -
>XM_004865512.1
ATGTCCGCCTCGGCCGTGTTCATCCTAGACATCAAGGGCAAGCCCCTGATCAGCCGAAACTACAAGGGTGATGTGGCCATGAGCGAGATCGACCACTTCATGCCTCTGCTCATGCAGCGTGAGGAGGAGGGCGCGCTGGCCCCACTGCTGAGCCACGGCCGTGTACACTTCCTGTGGATCAAACACAGCAACCTGTACTTGGTGGCCACCACGCTGAAGAACGCCAACGCCTCTCTGGTCTACTCCTTCCTCTACAAGACGGTGGAGGTCTTCTGTGAGTACTTCAAGGAGCTGGAGGAGGAGAGCATCCGTGACAACTTTGTCATCGTGTACGAGCTGCTGGACGAGCTCATGGACTTCGGCTTCCCACAGACTACGGATAGCAAGATCCTGCAGGAGTACATCACACAACAGGGCAACAAGCTGGAGACGGGCAAGTCTCGGGTGCCGCCCACTGTCACCAACGCAGTGTCTTGGCGCTCAGAGGGCCTCAAGTACAAGAAGAACGAGGTCTTCATCGACGTCATAGAGTCTGTCAACCTGCTGGTCAATGCCAACGGCAGTGTCCTGCTCAGTGAGATCGTGGGCAGCATCAAACTTAAGGTGTTTCTGTCCGGGATGCCAGAGCTGCGGCTGGGCCTCAACGACCGCGTGCTCTTTGAGCTCACTGGCCTTTCAGGCAGCAAGAACAAGTCCGTGGAGCTGGAGGACGTCAAGTTCCACCAGTGCGTGCGGCTGTCACGCTTCGACAACGACCGCACCATCTCCTTCATCCCGCCCGATGGCGACTTTGAGCTCATGTCCTACCGGCTCAGCACACAGGTCAAGCCGCTCATCTGGATTGAGTCTATCATCGAGAAGTTCTCCCACAGCCGAGTGGAGATCATGGTCAAGGCTAAGGGGCAGTTTAAGAAGCAGTCTGTGGCCAATGGTGTGGAGATTTCCGTGCCTGTCCCCAGTGATGCTGATTCCCCTCGTTTCAAGACCAGTGTGGGGAGTGCCAAGTATGTGCCAGAGAAGAATGTCGTTATCTGGAGTATTAAATCCTTCCCGGGGGGCAAGGAGTACCTGATGCGGGCCCACTTTGGCCTCCCCAGCGTGGAGAAGGAGGAGGTGGATGGCCGGCCCCCCATCGGGGTCAAGTTTGAGATCCCCTACTTCACCGTTTCCGGCATCCAGGTCCGATACATGAAGATCATTGAGAAGAGTGGTTACCAGGCCCTGCCCTGGGTTCGCTACATCACCCAGAGTGGAGATTATCAACTTCGGACCAGCTAG

XM_004865510.1 Coding sequence

Ap1m2 adaptor-related protein complex 1, mu 2 subunit, transcript variant X1

Length: 1437 bp    Location: 2647569..2639316   Strand: -
>XM_004865510.1
ATGTCCGCCTCGGCCGTGTTCATCCTAGACATCAAGGGCAAGCCCCTGATCAGCCGAAACTACAAGGGTGATGTGGCCATGAGCGAGATCGACCACTTCATGCCTCTGCTCATGCAGCGTGAGGAGGAGGGCGCGCTGGCCCCACTGCTGAGCCACGGCCGTGTACACTTCCTGTGGATCAAACACAGCAACCTGTACTTGGTGGCCACCACGCTGAAGAACGCCAACGCCTCTCTGGTCTACTCCTTCCTCTACAAGACGGTGGAGGTCTTCTGTGAGTACTTCAAGGAGCTGGAGGAGGAGAGCATCCGTGACAACTTTGTCATCGTGTACGAGCTGCTGGACGAGCTCATGGACTTCGGCTTCCCACAGACTACGGATAGCAAGATCCTGCAGGAGTACATCACACAACAGGGCAACAAGCTGGAGACGGGCAAGTCTCGGGTGCCGCCCACTGTCACCAACGCAGTGTCTTGGCGCTCAGAGGGCCTCAAGTACAAGAAGAACGAGGTCTTCATCGACGTCATAGAGTCTGTCAACCTGCTGGTCAATGCCAACGGCAGTGTCCTGCTCAGTGAGATCGTGGGCAGCATCAAACTTAAGGTGTTTCTGTCCGGGATGCCAGAGCTGCGGCTGGGCCTCAACGACCGCGTGCTCTTTGAGCTCACTGGCCTTTCAGGCAGCAAGAACAAGTCCGTGGAGCTGGAGGACGTCAAGTTCCACCAGTGCGTGCGGCTGTCACGCTTCGACAACGACCGCACCATCTCCTTCATCCCGCCCGATGGCGACTTTGAGCTCATGTCCTACCGGCTCAGCACACAGGTCAAGCCGCTCATCTGGATTGAGTCTATCATCGAGAAGTTCTCCCACAGCCGAGTGGAGATCATGGTCAAGGCTAAGGGGCAGTTTAAGAAGCAGTCTGTGGCCAATGGTGTGGAGATTTCCGTGCCTGTCCCCAGTGATGCTGATTCCCCTCGTTTCAAGACCAGTGTGGGGAGTGCCAAGTATGTGCCAGAGAAGAATGTCGTTATCTGGAGTATTAAATCCTTCCCGGGGGGCAAGGAGTACCTGATGCGGGCCCACTTTGGCCTCCCCAGCGTGGAGAAGGAGGAGGTGGATGGCCGGCCCCCCATCGGGGTCAAGTTTGAGATCCCCTACTTCACCGTTTCCGGCATCCAGGTCCGATACATGAAGATCATTGAGAAGAGTGGTTACCAGGCCCTGCCCTGGGTTCGCTACATCACCCAGAGTGGAGGTCAGGGGCCTGGCTCCCTGGGACACAAGGGCGGGGAGGTGGATCGGTGGGGACTCAGCTCTGACCACGTTGTGGTCAGGACAGCTCAGAAACTGTCCCTGTCATATGTCCTGGACCCCAGTTTGCACGTCTTTAAAGTGGGGTTCATGATGATCTCCAGGGTACCCCTAAGGCTTGGATAA

XM_004865517.1 Coding sequence

Slc44a2 solute carrier family 44, member 2, transcript variant X4

Length: 2136 bp    Location: 2655133..2676942   Strand: +
>XM_004865517.1
ATGGAGGAAGATCGGAAGGAGGCAGCCTACGGAACCCCGCAGAAGTATGACCCCACCTTCAAGGGACCTATTTACAACAGGGGCTGCACAGACGTCATTTGCTGTGTCCTCTTCTTCCTGGCCATCGTGGGCTATGTGGCTGTGGGCCTTATCGCCTGGACCCACGGGGACCCTCGAAAAGTGATCTACCCCACTGACAGCCGAGGCGAGTTCTGTGGCCAGAAAGGCACCAAGAATGCGAACAAACCCTTCCTGTTCTATTTCAACATTGTGAAGTGTGCCAGCCCCCTGGTCCTGCTGGAATTCCAATGCCCCACACCCCAGATCTGCGTGGAGAAGTGTCCTGACCGCTACCTCACCCTCCTGAATGCCAGGAACACTCCAGAGTTTGCATACTACAAGCAGTTCTGTGTCCCTGACTTCCAGAGTGATAAAAAGCAGAGTGTGGCTGAGGTGCTTCGGGATGGCCAATGCCCTGCTGTCCTCATCCCCAGCAAACCCTTGGCCCAGCGATGCTTCCCGGCCATCCACGCCCACAAGGGGGTCATCATGGTGGGCAATGCAACAACCTATGAGGACGGGCATGGCTCTCGGAAGAACATCACGGAGCTGGTGGAGGGCGCCAAGCAGGCGAACGGTATCCTGGAGGCCCGGCAGCTGGCCATGCGGATATTTGAAGACTACACCGTGTCCTGGTACTGGATTGTCATAGGCCTGGTCATCGCCATGGCGCTTAGCCTCCTGTTCATCATCCTGCTCCGCTTCCTGGCCGGCATCATGGTCTGGGTTATGATCGTCATGGTGATCCTGGTGCTGGGCTACGGGATATTTCACTGCTACATGGAGTATGCCCGGCTGCGTGGGGAGGCCGGCTCAGACATCTCGCTGGTGGACCTGGGCTTCCAGACTGACTTCCGGGTGTACCTCCACTTACGCCAGACCTGGATGGCTTTCATGATCATTCTGAGCATCCTGGAAGTCATTATCATCCTGCTGCTCATATTTCTCCGGAAGAGAATTCTCATCGCCATTGCACTCATCAAAGAAGCAAGCAGGGCTGTGGGATACGTCATGTGCTCCATGCTGTACCCGCTGGTCACTTTCTTCCTGCTGTGTCTCTGCATCGCATACTGGGCCAGCACTGCTGTCTTCCTGTCTACTTCCAATGAAGCTGTCTATAAGATTTTGGATGATCCCTCCTGCTCATTTACCGGCAAAACCTGCAACCCTGAGACCTTCTTCAACTCCACTGAATCCCGCTCGTGCCCCAAAGCCAGCTGTCAGTTTGCCTTCTATGGTGGGGAGTCTGGCTACCACCGAGCACTGCTGGGGCTGCAGATCTTCAATGTCTTCATGTTCTTCTGGCTGGCCAACTTCGTGCTGGCACTGGGACAGGTCACGCTGGCTGGGGCCTTTGCCTCCTACTACTGGGCCCTGCGCAAGCCAGACGACATGCCCGCCTTCCCGCTCTTCTCTGCTTTTGGCCGAGCGCTCAGGTACCACACAGGCTCCTTGGCCTTTGGCTCCCTCATCCTCGCCATTGTACAGATTATCCGAGTGATACTCGAGTATTTGGATCAGCGCCTAAAAGCTGCGGAAAACAAATTTGCCAAATTTCTCATGACCTGTCTCAAGTGTTGCTTCTGGTGCCTGGAGAAGTTCATAAAGTTCCTCAACAGGAATGCTTACATCATGATCGCCATCTACGGCACCAACTTCTGCACCTCTGCCAGAAATGCTTTCTTCCTGCTCATGAGAAACATCATCAGGGTTGCTGTCTTGGACAAAGTTACCGACTTCCTCTTCCTGCTGGGCAAACTCCTGATTGTGGGCAGTGTGGGAATCCTGGCTTTCTTCTTTTTCACCCATCGCATCAGAATCGTGCAAGACACAGCGCCACCTCTCAACTATTACTGGGTTCCTATACTGACAGTTATTGTCGGCTCCTACCTAATCGCCCATGGTTTCTTCAGCGTCTATGGCATGTGTGTGGATACACTGTTCCTCTGCTTCTGTGAGGATCTTGAGCGGAATGACGGCTCTCAGGAGCGACCCTACTTCATGTCGCCCGAGCTGAGAGACATCCTGTTAAAGGGGAGTGCGGAGGAGGGCAAGCGGGCGGAAGTCGAGGAGTAG

XM_004865519.1 Coding sequence

Slc44a2 solute carrier family 44, member 2, transcript variant X6

High confidence: 4 potential gene matches
Length: 2124 bp    Location: 2664169..2677120   Strand: +
>XM_004865519.1
ATGGGGGGCGATCGGCCACATTACTATGGCAAGCACGGAACCCCGCAGAAGTATGACCCCACCTTCAAGGGACCTATTTACAACAGGGGCTGCACAGACGTCATTTGCTGTGTCCTCTTCTTCCTGGCCATCGTGGGCTATGTGGCTGTGGGCCTTATCGCCTGGACCCACGGGGACCCTCGAAAAGTGATCTACCCCACTGACAGCCGAGGCGAGTTCTGTGGCCAGAAAGGCACCAAGAATGCGAACAAACCCTTCCTGTTCTATTTCAACATTGTGAAGTGTGCCAGCCCCCTGGTCCTGCTGGAATTCCAATGCCCCACACCCCAGATCTGCGTGGAGAAGTGTCCTGACCGCTACCTCACCCTCCTGAATGCCAGGAACACTCCAGAGTTTGCATACTACAAGCAGTTCTGTGTCCCTGACTTCCAGAGTGATAAAAAGAGTGTGGCTGAGGTGCTTCGGGATGGCCAATGCCCTGCTGTCCTCATCCCCAGCAAACCCTTGGCCCAGCGATGCTTCCCGGCCATCCACGCCCACAAGGGGGTCATCATGGTGGGCAATGCAACAACCTATGAGGACGGGCATGGCTCTCGGAAGAACATCACGGAGCTGGTGGAGGGCGCCAAGCAGGCGAACGGTATCCTGGAGGCCCGGCAGCTGGCCATGCGGATATTTGAAGACTACACCGTGTCCTGGTACTGGATTGTCATAGGCCTGGTCATCGCCATGGCGCTTAGCCTCCTGTTCATCATCCTGCTCCGCTTCCTGGCCGGCATCATGGTCTGGGTTATGATCGTCATGGTGATCCTGGTGCTGGGCTACGGGATATTTCACTGCTACATGGAGTATGCCCGGCTGCGTGGGGAGGCCGGCTCAGACATCTCGCTGGTGGACCTGGGCTTCCAGACTGACTTCCGGGTGTACCTCCACTTACGCCAGACCTGGATGGCTTTCATGATCATTCTGAGCATCCTGGAAGTCATTATCATCCTGCTGCTCATATTTCTCCGGAAGAGAATTCTCATCGCCATTGCACTCATCAAAGAAGCAAGCAGGGCTGTGGGATACGTCATGTGCTCCATGCTGTACCCGCTGGTCACTTTCTTCCTGCTGTGTCTCTGCATCGCATACTGGGCCAGCACTGCTGTCTTCCTGTCTACTTCCAATGAAGCTGTCTATAAGATTTTGGATGATCCCTCCTGCTCATTTACCGGCAAAACCTGCAACCCTGAGACCTTCTTCAACTCCACTGAATCCCGCTCGTGCCCCAAAGCCAGCTGTCAGTTTGCCTTCTATGGTGGGGAGTCTGGCTACCACCGAGCACTGCTGGGGCTGCAGATCTTCAATGTCTTCATGTTCTTCTGGCTGGCCAACTTCGTGCTGGCACTGGGACAGGTCACGCTGGCTGGGGCCTTTGCCTCCTACTACTGGGCCCTGCGCAAGCCAGACGACATGCCCGCCTTCCCGCTCTTCTCTGCTTTTGGCCGAGCGCTCAGGTACCACACAGGCTCCTTGGCCTTTGGCTCCCTCATCCTCGCCATTGTACAGATTATCCGAGTGATACTCGAGTATTTGGATCAGCGCCTAAAAGCTGCGGAAAACAAATTTGCCAAATTTCTCATGACCTGTCTCAAGTGTTGCTTCTGGTGCCTGGAGAAGTTCATAAAGTTCCTCAACAGGAATGCTTACATCATGATCGCCATCTACGGCACCAACTTCTGCACCTCTGCCAGAAATGCTTTCTTCCTGCTCATGAGAAACATCATCAGGGTTGCTGTCTTGGACAAAGTTACCGACTTCCTCTTCCTGCTGGGCAAACTCCTGATTGTGGGCAGTGTGGGAATCCTGGCTTTCTTCTTTTTCACCCATCGCATCAGAATCGTGCAAGACACAGCGCCACCTCTCAACTATTACTGGGTTCCTATACTGACAGTTATTGTCGGCTCCTACCTAATCGCCCATGGTTTCTTCAGCGTCTATGGCATGTGTGTGGATACACTGTTCCTCTGCTTCTTGGAGGATTTGGAGCGGAATGATGGCTCTGTTGAGAGGCCTTACTTCATGTCTTCCACCCTCAAGAAGCTCTTGAACAAGACCAACAAGAAGCAGGTGGAGTCCTAA

XM_004865515.1 Coding sequence

Slc44a2 solute carrier family 44, member 2, transcript variant X2

Length: 2142 bp    Location: 2664169..2677032   Strand: +
>XM_004865515.1
ATGGGGGGCGATCGGCCACATTACTATGGCAAGCACGGAACCCCGCAGAAGTATGACCCCACCTTCAAGGGACCTATTTACAACAGGGGCTGCACAGACGTCATTTGCTGTGTCCTCTTCTTCCTGGCCATCGTGGGCTATGTGGCTGTGGGCCTTATCGCCTGGACCCACGGGGACCCTCGAAAAGTGATCTACCCCACTGACAGCCGAGGCGAGTTCTGTGGCCAGAAAGGCACCAAGAATGCGAACAAACCCTTCCTGTTCTATTTCAACATTGTGAAGTGTGCCAGCCCCCTGGTCCTGCTGGAATTCCAATGCCCCACACCCCAGATCTGCGTGGAGAAGTGTCCTGACCGCTACCTCACCCTCCTGAATGCCAGGAACACTCCAGAGTTTGCATACTACAAGCAGTTCTGTGTCCCTGACTTCCAGAGTGATAAAAAGCAGAGTGTGGCTGAGGTGCTTCGGGATGGCCAATGCCCTGCTGTCCTCATCCCCAGCAAACCCTTGGCCCAGCGATGCTTCCCGGCCATCCACGCCCACAAGGGGGTCATCATGGTGGGCAATGCAACAACCTATGAGGACGGGCATGGCTCTCGGAAGAACATCACGGAGCTGGTGGAGGGCGCCAAGCAGGCGAACGGTATCCTGGAGGCCCGGCAGCTGGCCATGCGGATATTTGAAGACTACACCGTGTCCTGGTACTGGATTGTCATAGGCCTGGTCATCGCCATGGCGCTTAGCCTCCTGTTCATCATCCTGCTCCGCTTCCTGGCCGGCATCATGGTCTGGGTTATGATCGTCATGGTGATCCTGGTGCTGGGCTACGGGATATTTCACTGCTACATGGAGTATGCCCGGCTGCGTGGGGAGGCCGGCTCAGACATCTCGCTGGTGGACCTGGGCTTCCAGACTGACTTCCGGGTGTACCTCCACTTACGCCAGACCTGGATGGCTTTCATGATCATTCTGAGCATCCTGGAAGTCATTATCATCCTGCTGCTCATATTTCTCCGGAAGAGAATTCTCATCGCCATTGCACTCATCAAAGAAGCAAGCAGGGCTGTGGGATACGTCATGTGCTCCATGCTGTACCCGCTGGTCACTTTCTTCCTGCTGTGTCTCTGCATCGCATACTGGGCCAGCACTGCTGTCTTCCTGTCTACTTCCAATGAAGCTGTCTATAAGATTTTGGATGATCCCTCCTGCTCATTTACCGGCAAAACCTGCAACCCTGAGACCTTCTTCAACTCCACTGAATCCCGCTCGTGCCCCAAAGCCAGCTGTCAGTTTGCCTTCTATGGTGGGGAGTCTGGCTACCACCGAGCACTGCTGGGGCTGCAGATCTTCAATGTCTTCATGTTCTTCTGGCTGGCCAACTTCGTGCTGGCACTGGGACAGGTCACGCTGGCTGGGGCCTTTGCCTCCTACTACTGGGCCCTGCGCAAGCCAGACGACATGCCCGCCTTCCCGCTCTTCTCTGCTTTTGGCCGAGCGCTCAGGTACCACACAGGCTCCTTGGCCTTTGGCTCCCTCATCCTCGCCATTGTACAGATTATCCGAGTGATACTCGAGTATTTGGATCAGCGCCTAAAAGCTGCGGAAAACAAATTTGCCAAATTTCTCATGACCTGTCTCAAGTGTTGCTTCTGGTGCCTGGAGAAGTTCATAAAGTTCCTCAACAGGAATGCTTACATCATGATCGCCATCTACGGCACCAACTTCTGCACCTCTGCCAGAAATGCTTTCTTCCTGCTCATGAGAAACATCATCAGGGTTGCTGTCTTGGACAAAGTTACCGACTTCCTCTTCCTGCTGGGCAAACTCCTGATTGTGGGCAGTGTGGGAATCCTGGCTTTCTTCTTTTTCACCCATCGCATCAGAATCGTGCAAGACACAGCGCCACCTCTCAACTATTACTGGGTTCCTATACTGACAGTTATTGTCGGCTCCTACCTAATCGCCCATGGTTTCTTCAGCGTCTATGGCATGTGTGTGGATACACTGTTCCTCTGCTTCTGTGAGGATCTTGAGCGGAATGACGGCTCTCAGGAGCGACCCTACTTCATGTCGCCCGAGCTGAGAGACATCCTGTTAAAGGGGAGTGCGGAGGAGGGCAAGCGGGCGGAAGTCGAGGAGTAG

XM_004865514.1 Coding sequence

Slc44a2 solute carrier family 44, member 2, transcript variant X1

Length: 2142 bp    Location: 2664169..2676942   Strand: +
>XM_004865514.1
ATGGGGGGCGATCGGCCACATTACTATGGCAAGCACGGAACCCCGCAGAAGTATGACCCCACCTTCAAGGGACCTATTTACAACAGGGGCTGCACAGACGTCATTTGCTGTGTCCTCTTCTTCCTGGCCATCGTGGGCTATGTGGCTGTGGGCCTTATCGCCTGGACCCACGGGGACCCTCGAAAAGTGATCTACCCCACTGACAGCCGAGGCGAGTTCTGTGGCCAGAAAGGCACCAAGAATGCGAACAAACCCTTCCTGTTCTATTTCAACATTGTGAAGTGTGCCAGCCCCCTGGTCCTGCTGGAATTCCAATGCCCCACACCCCAGATCTGCGTGGAGAAGTGTCCTGACCGCTACCTCACCCTCCTGAATGCCAGGAACACTCCAGAGTTTGCATACTACAAGCAGTTCTGTGTCCCTGACTTCCAGAGTGATAAAAAGCAGAGTGTGGCTGAGGTGCTTCGGGATGGCCAATGCCCTGCTGTCCTCATCCCCAGCAAACCCTTGGCCCAGCGATGCTTCCCGGCCATCCACGCCCACAAGGGGGTCATCATGGTGGGCAATGCAACAACCTATGAGGACGGGCATGGCTCTCGGAAGAACATCACGGAGCTGGTGGAGGGCGCCAAGCAGGCGAACGGTATCCTGGAGGCCCGGCAGCTGGCCATGCGGATATTTGAAGACTACACCGTGTCCTGGTACTGGATTGTCATAGGCCTGGTCATCGCCATGGCGCTTAGCCTCCTGTTCATCATCCTGCTCCGCTTCCTGGCCGGCATCATGGTCTGGGTTATGATCGTCATGGTGATCCTGGTGCTGGGCTACGGGATATTTCACTGCTACATGGAGTATGCCCGGCTGCGTGGGGAGGCCGGCTCAGACATCTCGCTGGTGGACCTGGGCTTCCAGACTGACTTCCGGGTGTACCTCCACTTACGCCAGACCTGGATGGCTTTCATGATCATTCTGAGCATCCTGGAAGTCATTATCATCCTGCTGCTCATATTTCTCCGGAAGAGAATTCTCATCGCCATTGCACTCATCAAAGAAGCAAGCAGGGCTGTGGGATACGTCATGTGCTCCATGCTGTACCCGCTGGTCACTTTCTTCCTGCTGTGTCTCTGCATCGCATACTGGGCCAGCACTGCTGTCTTCCTGTCTACTTCCAATGAAGCTGTCTATAAGATTTTGGATGATCCCTCCTGCTCATTTACCGGCAAAACCTGCAACCCTGAGACCTTCTTCAACTCCACTGAATCCCGCTCGTGCCCCAAAGCCAGCTGTCAGTTTGCCTTCTATGGTGGGGAGTCTGGCTACCACCGAGCACTGCTGGGGCTGCAGATCTTCAATGTCTTCATGTTCTTCTGGCTGGCCAACTTCGTGCTGGCACTGGGACAGGTCACGCTGGCTGGGGCCTTTGCCTCCTACTACTGGGCCCTGCGCAAGCCAGACGACATGCCCGCCTTCCCGCTCTTCTCTGCTTTTGGCCGAGCGCTCAGGTACCACACAGGCTCCTTGGCCTTTGGCTCCCTCATCCTCGCCATTGTACAGATTATCCGAGTGATACTCGAGTATTTGGATCAGCGCCTAAAAGCTGCGGAAAACAAATTTGCCAAATTTCTCATGACCTGTCTCAAGTGTTGCTTCTGGTGCCTGGAGAAGTTCATAAAGTTCCTCAACAGGAATGCTTACATCATGATCGCCATCTACGGCACCAACTTCTGCACCTCTGCCAGAAATGCTTTCTTCCTGCTCATGAGAAACATCATCAGGGTTGCTGTCTTGGACAAAGTTACCGACTTCCTCTTCCTGCTGGGCAAACTCCTGATTGTGGGCAGTGTGGGAATCCTGGCTTTCTTCTTTTTCACCCATCGCATCAGAATCGTGCAAGACACAGCGCCACCTCTCAACTATTACTGGGTTCCTATACTGACAGTTATTGTCGGCTCCTACCTAATCGCCCATGGTTTCTTCAGCGTCTATGGCATGTGTGTGGATACACTGTTCCTCTGCTTCTGTGAGGATCTTGAGCGGAATGACGGCTCTCAGGAGCGACCCTACTTCATGTCGCCCGAGCTGAGAGACATCCTGTTAAAGGGGAGTGCGGAGGAGGGCAAGCGGGCGGAAGTCGAGGAGTAG

XM_004865516.1 Coding sequence

Slc44a2 solute carrier family 44, member 2, transcript variant X3

Length: 2139 bp    Location: 2664169..2676942   Strand: +
>XM_004865516.1
ATGGGGGGCGATCGGCCACATTACTATGGCAAGCACGGAACCCCGCAGAAGTATGACCCCACCTTCAAGGGACCTATTTACAACAGGGGCTGCACAGACGTCATTTGCTGTGTCCTCTTCTTCCTGGCCATCGTGGGCTATGTGGCTGTGGGCCTTATCGCCTGGACCCACGGGGACCCTCGAAAAGTGATCTACCCCACTGACAGCCGAGGCGAGTTCTGTGGCCAGAAAGGCACCAAGAATGCGAACAAACCCTTCCTGTTCTATTTCAACATTGTGAAGTGTGCCAGCCCCCTGGTCCTGCTGGAATTCCAATGCCCCACACCCCAGATCTGCGTGGAGAAGTGTCCTGACCGCTACCTCACCCTCCTGAATGCCAGGAACACTCCAGAGTTTGCATACTACAAGCAGTTCTGTGTCCCTGACTTCCAGAGTGATAAAAAGAGTGTGGCTGAGGTGCTTCGGGATGGCCAATGCCCTGCTGTCCTCATCCCCAGCAAACCCTTGGCCCAGCGATGCTTCCCGGCCATCCACGCCCACAAGGGGGTCATCATGGTGGGCAATGCAACAACCTATGAGGACGGGCATGGCTCTCGGAAGAACATCACGGAGCTGGTGGAGGGCGCCAAGCAGGCGAACGGTATCCTGGAGGCCCGGCAGCTGGCCATGCGGATATTTGAAGACTACACCGTGTCCTGGTACTGGATTGTCATAGGCCTGGTCATCGCCATGGCGCTTAGCCTCCTGTTCATCATCCTGCTCCGCTTCCTGGCCGGCATCATGGTCTGGGTTATGATCGTCATGGTGATCCTGGTGCTGGGCTACGGGATATTTCACTGCTACATGGAGTATGCCCGGCTGCGTGGGGAGGCCGGCTCAGACATCTCGCTGGTGGACCTGGGCTTCCAGACTGACTTCCGGGTGTACCTCCACTTACGCCAGACCTGGATGGCTTTCATGATCATTCTGAGCATCCTGGAAGTCATTATCATCCTGCTGCTCATATTTCTCCGGAAGAGAATTCTCATCGCCATTGCACTCATCAAAGAAGCAAGCAGGGCTGTGGGATACGTCATGTGCTCCATGCTGTACCCGCTGGTCACTTTCTTCCTGCTGTGTCTCTGCATCGCATACTGGGCCAGCACTGCTGTCTTCCTGTCTACTTCCAATGAAGCTGTCTATAAGATTTTGGATGATCCCTCCTGCTCATTTACCGGCAAAACCTGCAACCCTGAGACCTTCTTCAACTCCACTGAATCCCGCTCGTGCCCCAAAGCCAGCTGTCAGTTTGCCTTCTATGGTGGGGAGTCTGGCTACCACCGAGCACTGCTGGGGCTGCAGATCTTCAATGTCTTCATGTTCTTCTGGCTGGCCAACTTCGTGCTGGCACTGGGACAGGTCACGCTGGCTGGGGCCTTTGCCTCCTACTACTGGGCCCTGCGCAAGCCAGACGACATGCCCGCCTTCCCGCTCTTCTCTGCTTTTGGCCGAGCGCTCAGGTACCACACAGGCTCCTTGGCCTTTGGCTCCCTCATCCTCGCCATTGTACAGATTATCCGAGTGATACTCGAGTATTTGGATCAGCGCCTAAAAGCTGCGGAAAACAAATTTGCCAAATTTCTCATGACCTGTCTCAAGTGTTGCTTCTGGTGCCTGGAGAAGTTCATAAAGTTCCTCAACAGGAATGCTTACATCATGATCGCCATCTACGGCACCAACTTCTGCACCTCTGCCAGAAATGCTTTCTTCCTGCTCATGAGAAACATCATCAGGGTTGCTGTCTTGGACAAAGTTACCGACTTCCTCTTCCTGCTGGGCAAACTCCTGATTGTGGGCAGTGTGGGAATCCTGGCTTTCTTCTTTTTCACCCATCGCATCAGAATCGTGCAAGACACAGCGCCACCTCTCAACTATTACTGGGTTCCTATACTGACAGTTATTGTCGGCTCCTACCTAATCGCCCATGGTTTCTTCAGCGTCTATGGCATGTGTGTGGATACACTGTTCCTCTGCTTCTGTGAGGATCTTGAGCGGAATGACGGCTCTCAGGAGCGACCCTACTTCATGTCGCCCGAGCTGAGAGACATCCTGTTAAAGGGGAGTGCGGAGGAGGGCAAGCGGGCGGAAGTCGAGGAGTAG

XM_004865524.1 Coding sequence

Ilf3 interleukin enhancer binding factor 3, 90kDa, transcript variant X5

Length: 2610 bp    Location: 2683870..2713179   Strand: +
>XM_004865524.1
ATGGCATTGTACCATCACCACTTCACCACGAGAGGAAGAAGGCGTCCAATGCGGATTTTTGTGAATGATGATCGCCACGTGATGGCAAAGCATTCTTCGGTGTATCCAACACAAGAGGAACTGGAGGCAGTGCAGAACATGGTATCCCACACCGAGAGGGCTCTCAAAGCTGTGTCTGACTGGATCGACGAGCAAGAAAAAGGCAACAGCGAGCAGGCCGAGTCTGACAACATGGATGTGCCCGCGGATGATGAGAGCAAAGAAGGGGCCGGGGAACAGAAGGCAGAACACATGACCAGGACCCTGCGGGGCGTGATGCGGGTTGGCCTGGTGGCAAAGGGCCTTCTGCTGAAGGGGGACTTGGATCTAGAGCTGGTGCTGCTATGTAAGGAGAAGCCCACAACTGCCCTCCTGGACAAGGTGGCTGACAACCTGGCCATCCAGCTTGCTGCTGTAACAGAAGACAAGTACGAAATACTCCAGTCTGTGGATGATGCTGCAATTGTGATAAAAAATACAAAAGAGCCCCCGCTGTCTCTGACCATTCACCTAACATCCCCCGTTGTCAGAGAAGAGATGGAGAAGGTGCTAGCTGGAGAAACGCTATCAGTCAACGACCCCCCGGACGTTCTGGACAGGCAGAAATGCCTTGCTGCCTTGGCGTCCCTCCGACACGCCAAGTGGTTCCAGGCCAGGGCCAACGGGCTGAAGTCCTGTGTCATTGTTATCCGGGTCCTGAGGGACCTGTGTACCCGTGTGCCCACCTGGGGTCCCCTCAGAGGATGGCCCCTGGAGCTCCTGTGTGAGAAGTCCATCGGCACAGCCAACAGGCCGATGGGCGCTGGCGAGGCCCTGCGGAGAGTGCTGGAGTGCCTGGCGTCCGGCATCGTGATGCCAGATGGTTCTGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCATGCACTGCGGCTCGCTGCCTTTGGCCAGCTCCACAAAGTCCTGGGCATGGACCCCCTGCCTTCCAAGATGCCCAAGAAACCAAAGAACGAGAATCCAGTGGACTACATCGTTCAAATCCCTCCCAGCACCACCTATGCCATTACCCCCATGAAACGCCCAATGGAGGAGGACGGTGAAGAAAAGTCCCCCAGCAAGAAGAAGAAGAAGATTCAAAAGAAAGAGGAGAAGGCTGAGCCTCCCCAGGCCATGAATGCACTGATGCGTTTGAACCAGCTGAAGCCGGGGCTGCAGTATAAGCTGGTCTCCCAGACAGGCCCTGTGCACGCCCCCATCTTCACCATGTCTGTGGAAGTGGATGGCAGCTCATTTGAGGCCTCAGGGCCCTCCAAGAAGACCGCCAAGCTGCACGTGGCTGTTAAGGTGTTACAGGACATGGGCTTGCCGACAGGTGCTGAAGGCAGGGATTCCAGCAAGGGGGAGGACTCTGCTGAGGAAACGGAGGCAAAGCCTGCTGTGGCGGTCCCGCCCCCCGTGGTAGAAGCTGTGTCGACCCCCAGCGCCACCTTCTCCTCGGATGCCACCACTGAGAACGTAAAACAGCAGGGGCCGATCCTGACTAAGCATGGCAAGAACCCGGTTATGGAACTGAATGAGAAGAGGCGAGGCCTCAAGTACGAGCTCATCTCTGAGACCGGAGGCAGCCATGACAAGCGCTTCGTCATGGAGGTCGAGGTTGACGGACAGAAGTTCCAAGGTGCTGGTTCAAACAAGAAAGTAGCAAAGGCATATGCTGCTCTTGCTGCACTTGAAAAGCTTTTCCCTGATGCCCCTCTTGCCCTCGATGCCAACAAAAAGAAGAGAGCACCAGTTCCTGTCCGAGGCGGACCAAAATTTGCTGCCAAGCCCCACAACCCGGGCTTCGGGATGGGCGGCCCCATGCACAATGAGGCGCCCCCGCCCCCCAACCTCCGAGGGCGGGGGCGAGGTGGCAGCATCCGAGGGCGAGGCCGGGGCCGAGGATTTGGGGGCGCCAACCACGGAGGCTACATGAATTCTGGCGCCGGGTACGGAAGTTATGGGTACGGCGGCAGCTCTGCGACTGCAGGCTATAGTCAGTTCTACAGCAACGGAGGGCATTCTGGGAATGCTGGTGGTGGCGGCGGCGGGGGCGGTGGTGGCTCTTCCGGCTATGGCTCCTACTACCAAGGGGACAACTACAACTCACCGGTACCCCCAAAACACACTGGGAAGAAGCCGCCACATGGGGCCCAGCAGAAGCCATCTTACGGCTCAGGCTACCAGTCCCACCAGGGTCAGCAGCAGTCCTACAACCAGAGCCAGTACGGCAACTATGGCCCACCACAGGGCAAGCAGAAGGGCTACAACCACGGGCAAGGCAACTACTCCTACTCAAACTCGTACAGCTCGCCGGGAGGCGGGGGCGGCTCAGACTACAGCTACGAGAGCAAATTCAGAGGCTACTCTTCACAGTCGAACTACAACTCCCCGGGCTCTGGCCAGAACTACAGCGGCCCTCCCGGCTCCTACCAGTCCTCACAGGGTGGGTATAGCAGGAACGCAGACCACAGCATGAACTACCAGTACAGATAA

XM_004865526.1 Coding sequence

Ilf3 interleukin enhancer binding factor 3, 90kDa, transcript variant X7

Length: 2148 bp    Location: 2683871..2710107   Strand: +
>XM_004865526.1
ATGGCATTGTACCATCACCACTTCACCACGAGAGGAAGAAGGCGTCCAATGCGGATTTTTGTGAATGATGATCGCCACGTGATGGCAAAGCATTCTTCGGTGTATCCAACACAAGAGGAACTGGAGGCAGTGCAGAACATGGTATCCCACACCGAGAGGGCTCTCAAAGCTGTGTCTGACTGGATCGACGAGCAAGAAAAAGGCAACAGCGAGCAGGCCGAGTCTGACAACATGGATGTGCCCGCGGATGATGAGAGCAAAGAAGGGGCCGGGGAACAGAAGGCAGAACACATGACCAGGACCCTGCGGGGCGTGATGCGGGTTGGCCTGGTGGCAAAGGGCCTTCTGCTGAAGGGGGACTTGGATCTAGAGCTGGTGCTGCTATGTAAGGAGAAGCCCACAACTGCCCTCCTGGACAAGGTGGCTGACAACCTGGCCATCCAGCTTGCTGCTGTAACAGAAGACAAGTACGAAATACTCCAGTCTGTGGATGATGCTGCAATTGTGATAAAAAATACAAAAGAGCCCCCGCTGTCTCTGACCATTCACCTAACATCCCCCGTTGTCAGAGAAGAGATGGAGAAGGTGCTAGCTGGAGAAACGCTATCAGTCAACGACCCCCCGGACGTTCTGGACAGGCAGAAATGCCTTGCTGCCTTGGCGTCCCTCCGACACGCCAAGTGGTTCCAGGCCAGGGCCAACGGGCTGAAGTCCTGTGTCATTGTTATCCGGGTCCTGAGGGACCTGTGTACCCGTGTGCCCACCTGGGGTCCCCTCAGAGGATGGCCCCTGGAGCTCCTGTGTGAGAAGTCCATCGGCACAGCCAACAGGCCGATGGGCGCTGGCGAGGCCCTGCGGAGAGTGCTGGAGTGCCTGGCGTCCGGCATCGTGATGCCAGATGGTTCTGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCATGCACTGCGGCTCGCTGCCTTTGGCCAGCTCCACAAAGTCCTGGGCATGGACCCCCTGCCTTCCAAGATGCCCAAGAAACCAAAGAACGAGAATCCAGTGGACTACATCGTTCAAATCCCTCCCAGCACCACCTATGCCATTACCCCCATGAAACGCCCAATGGAGGAGGACGGTGAAGAAAAGTCCCCCAGCAAGAAGAAGAAGAAGATTCAAAAGAAAGAGGAGAAGGCTGAGCCTCCCCAGGCCATGAATGCACTGATGCGTTTGAACCAGCTGAAGCCGGGGCTGCAGTATAAGCTGGTCTCCCAGACAGGCCCTGTGCACGCCCCCATCTTCACCATGTCTGTGGAAGTGGATGGCAGCTCATTTGAGGCCTCAGGGCCCTCCAAGAAGACCGCCAAGCTGCACGTGGCTGTTAAGGTGTTACAGGACATGGGCTTGCCGACAGGTGCTGAAGGCAGGGATTCCAGCAAGGGGGAGGACTCTGCTGAGGAAACGGAGGCAAAGCCTGCTGTGGCGGTCCCGCCCCCCGTGGTAGAAGCTGTGTCGACCCCCAGCGCCACCTTCTCCTCGGATGCCACCACTGAGCAGGGGCCGATCCTGACTAAGCATGGCAAGAACCCGGTTATGGAACTGAATGAGAAGAGGCGAGGCCTCAAGTACGAGCTCATCTCTGAGACCGGAGGCAGCCATGACAAGCGCTTCGTCATGGAGGTCGAGGTTGACGGACAGAAGTTCCAAGGTGCTGGTTCAAACAAGAAAGTAGCAAAGGCATATGCTGCTCTTGCTGCACTTGAAAAGCTTTTCCCTGATGCCCCTCTTGCCCTCGATGCCAACAAAAAGAAGAGAGCACCAGTTCCTGTCCGAGGCGGACCAAAATTTGCTGCCAAGCCCCACAACCCGGGCTTCGGGATGGGCGGCCCCATGCACAATGAGGCGCCCCCGCCCCCCAACCTCCGAGGGCGGGGGCGAGGTGGCAGCATCCGAGGGCGAGGCCGGGGCCGAGGATTTGGGGGCGCCAACCACGGAGGCTACATGAATTCTGGCGCCGGGTACGGAAGTTATGGGTACGGCGGCAGCTCTGCGACTGCAGGCTATAGTGACTTTTTCACAGACTGCTACGGCTATCATGATTTTGGGTCTTCCTAG

XM_004865522.1 Coding sequence

Ilf3 interleukin enhancer binding factor 3, 90kDa, transcript variant X3

Length: 2727 bp    Location: 2683870..2713179   Strand: +
>XM_004865522.1
ATGGCATTGTACCATCACCACTTCACCACGAGAGGAAGAAGGCGTCCAATGCGGATTTTTGTGAATGATGATCGCCACGTGATGGCAAAGCATTCTTCGGTGTATCCAACACAAGAGGAACTGGAGGCAGTGCAGAACATGGTATCCCACACCGAGAGGGCTCTCAAAGCTGTGTCTGACTGGATCGACGAGCAAGAAAAAGGCAACAGCGAGCAGGCCGAGTCTGACAACATGGATGTGCCCGCGGATGATGAGAGCAAAGAAGGGGCCGGGGAACAGAAGGCAGAACACATGACCAGGACCCTGCGGGGCGTGATGCGGGTTGGCCTGGTGGCAAAGGGCCTTCTGCTGAAGGGGGACTTGGATCTAGAGCTGGTGCTGCTATGTAAGGAGAAGCCCACAACTGCCCTCCTGGACAAGGTGGCTGACAACCTGGCCATCCAGCTTGCTGCTGTAACAGAAGACAAGTACGAAATACTCCAGTCTGTGGATGATGCTGCAATTGTGATAAAAAATACAAAAGAGCCCCCGCTGTCTCTGACCATTCACCTAACATCCCCCGTTGTCAGAGAAGAGATGGAGAAGGTGCTAGCTGGAGAAACGCTATCAGTCAACGACCCCCCGGACGTTCTGGACAGGCAGAAATGCCTTGCTGCCTTGGCGTCCCTCCGACACGCCAAGTGGTTCCAGGCCAGGGCCAACGGGCTGAAGTCCTGTGTCATTGTTATCCGGGTCCTGAGGGACCTGTGTACCCGTGTGCCCACCTGGGGTCCCCTCAGAGGATGGCCCCTGGAGCTCCTGTGTGAGAAGTCCATCGGCACAGCCAACAGGCCGATGGGCGCTGGCGAGGCCCTGCGGAGAGTGCTGGAGTGCCTGGCGTCCGGCATCGTGATGCCAGATGGTTCTGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCATGCACTGCGGCTCGCTGCCTTTGGCCAGCTCCACAAAGTCCTGGGCATGGACCCCCTGCCTTCCAAGATGCCCAAGAAACCAAAGAACGAGAATCCAGTGGACTACATCGTTCAAATCCCTCCCAGCACCACCTATGCCATTACCCCCATGAAACGCCCAATGGAGGAGGACGGTGAAGAAAAGTCCCCCAGCAAGAAGAAGAAGAAGATTCAAAAGAAAGAGGAGAAGGCTGAGCCTCCCCAGGCCATGAATGCACTGATGCGTTTGAACCAGCTGAAGCCGGGGCTGCAGTATAAGCTGGTCTCCCAGACAGGCCCTGTGCACGCCCCCATCTTCACCATGTCTGTGGAAGTGGATGGCAGCTCATTTGAGGCCTCAGGGCCCTCCAAGAAGACCGCCAAGCTGCACGTGGCTGTTAAGGTGTTACAGGACATGGGCTTGCCGACAGGTGCTGAAGGCAGGGATTCCAGCAAGGGGGAGGACTCTGCTGAGGAAACGGAGGCAAAGCCTGCTGTGGCGGTCCCGCCCCCCGTGGTAGAAGCTGTGTCGACCCCCAGCGCCACCTTCTCCTCGGATGCCACCACTGAGCAGGGGCCGATCCTGACTAAGCATGGCAAGAACCCGGTTATGGAACTGAATGAGAAGAGGCGAGGCCTCAAGTACGAGCTCATCTCTGAGACCGGAGGCAGCCATGACAAGCGCTTCGTCATGGAGGTCGAGGTTGACGGACAGAAGTTCCAAGGTGCTGGTTCAAACAAGAAAGTAGCAAAGGCATATGCTGCTCTTGCTGCACTTGAAAAGCTTTTCCCTGATGCCCCTCTTGCCCTCGATGCCAACAAAAAGAAGAGAGCACCAGTTCCTGTCCGAGGCGGACCAAAATTTGCTGCCAAGCCCCACAACCCGGGCTTCGGGATGGGCGGCCCCATGCACAATGAGGCGCCCCCGCCCCCCAACCTCCGAGGGCGGGGGCGAGGTGGCAGCATCCGAGGGCGAGGCCGGGGCCGAGGATTTGGGGGCGCCAACCACGGAGGCTACATGAATTCTGGCGCCGGGTACGGAAGTTATGGGTACGGCGGCAGCTCTGCGACTGCAGGCTATAGTCAGTTCTACAGCAACGGAGGGCATTCTGGGAATGCTGGTGGTGGCGGCGGCGGGGGCGGTGGTGGCTCTTCCGGCTATGGCTCCTACTACCAAGGGGACAACTACAACTCACCGGTACCCCCAAAACACACTGGGAAGAAGCCGCCACATGGGGCCCAGCAGAAGCCATCTTACGGCTCAGGCTACCAGTCCCACCAGGGTCAGCAGCAGTCCTACAACCAGAGCCAGTACGGCAACTATGGCCCACCACAGGGCAAGCAGAAGGGCTACAACCACGGGCAAGGCAACTACTCCTACTCAAACTCGTACAGCTCGCCGGGAGGCGGGGGCGGCTCAGACTACAGCTACGAGAGCAAATTCAACTACAGTGGTAGTGGAGGCCGAAGCGGTGGGAACAGCTACGGCTCAGGCGGGTCATCCTACAACCCAGGGTCCCACGGGGGCTACGGCGGAGGTTCTGGGGGCGGCTCCTCATACCAAGGCAAACAAGGAGGCTACTCTTCACAGTCGAACTACAACTCCCCGGGCTCTGGCCAGAACTACAGCGGCCCTCCCGGCTCCTACCAGTCCTCACAGGGTGGGTATAGCAGGAACGCAGACCACAGCATGAACTACCAGTACAGATAA

XM_004865525.1 Coding sequence

Ilf3 interleukin enhancer binding factor 3, 90kDa, transcript variant X6

Length: 2160 bp    Location: 2683870..2710108   Strand: +
>XM_004865525.1
ATGGCATTGTACCATCACCACTTCACCACGAGAGGAAGAAGGCGTCCAATGCGGATTTTTGTGAATGATGATCGCCACGTGATGGCAAAGCATTCTTCGGTGTATCCAACACAAGAGGAACTGGAGGCAGTGCAGAACATGGTATCCCACACCGAGAGGGCTCTCAAAGCTGTGTCTGACTGGATCGACGAGCAAGAAAAAGGCAACAGCGAGCAGGCCGAGTCTGACAACATGGATGTGCCCGCGGATGATGAGAGCAAAGAAGGGGCCGGGGAACAGAAGGCAGAACACATGACCAGGACCCTGCGGGGCGTGATGCGGGTTGGCCTGGTGGCAAAGGGCCTTCTGCTGAAGGGGGACTTGGATCTAGAGCTGGTGCTGCTATGTAAGGAGAAGCCCACAACTGCCCTCCTGGACAAGGTGGCTGACAACCTGGCCATCCAGCTTGCTGCTGTAACAGAAGACAAGTACGAAATACTCCAGTCTGTGGATGATGCTGCAATTGTGATAAAAAATACAAAAGAGCCCCCGCTGTCTCTGACCATTCACCTAACATCCCCCGTTGTCAGAGAAGAGATGGAGAAGGTGCTAGCTGGAGAAACGCTATCAGTCAACGACCCCCCGGACGTTCTGGACAGGCAGAAATGCCTTGCTGCCTTGGCGTCCCTCCGACACGCCAAGTGGTTCCAGGCCAGGGCCAACGGGCTGAAGTCCTGTGTCATTGTTATCCGGGTCCTGAGGGACCTGTGTACCCGTGTGCCCACCTGGGGTCCCCTCAGAGGATGGCCCCTGGAGCTCCTGTGTGAGAAGTCCATCGGCACAGCCAACAGGCCGATGGGCGCTGGCGAGGCCCTGCGGAGAGTGCTGGAGTGCCTGGCGTCCGGCATCGTGATGCCAGATGGTTCTGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCATGCACTGCGGCTCGCTGCCTTTGGCCAGCTCCACAAAGTCCTGGGCATGGACCCCCTGCCTTCCAAGATGCCCAAGAAACCAAAGAACGAGAATCCAGTGGACTACATCGTTCAAATCCCTCCCAGCACCACCTATGCCATTACCCCCATGAAACGCCCAATGGAGGAGGACGGTGAAGAAAAGTCCCCCAGCAAGAAGAAGAAGAAGATTCAAAAGAAAGAGGAGAAGGCTGAGCCTCCCCAGGCCATGAATGCACTGATGCGTTTGAACCAGCTGAAGCCGGGGCTGCAGTATAAGCTGGTCTCCCAGACAGGCCCTGTGCACGCCCCCATCTTCACCATGTCTGTGGAAGTGGATGGCAGCTCATTTGAGGCCTCAGGGCCCTCCAAGAAGACCGCCAAGCTGCACGTGGCTGTTAAGGTGTTACAGGACATGGGCTTGCCGACAGGTGCTGAAGGCAGGGATTCCAGCAAGGGGGAGGACTCTGCTGAGGAAACGGAGGCAAAGCCTGCTGTGGCGGTCCCGCCCCCCGTGGTAGAAGCTGTGTCGACCCCCAGCGCCACCTTCTCCTCGGATGCCACCACTGAGAACGTAAAACAGCAGGGGCCGATCCTGACTAAGCATGGCAAGAACCCGGTTATGGAACTGAATGAGAAGAGGCGAGGCCTCAAGTACGAGCTCATCTCTGAGACCGGAGGCAGCCATGACAAGCGCTTCGTCATGGAGGTCGAGGTTGACGGACAGAAGTTCCAAGGTGCTGGTTCAAACAAGAAAGTAGCAAAGGCATATGCTGCTCTTGCTGCACTTGAAAAGCTTTTCCCTGATGCCCCTCTTGCCCTCGATGCCAACAAAAAGAAGAGAGCACCAGTTCCTGTCCGAGGCGGACCAAAATTTGCTGCCAAGCCCCACAACCCGGGCTTCGGGATGGGCGGCCCCATGCACAATGAGGCGCCCCCGCCCCCCAACCTCCGAGGGCGGGGGCGAGGTGGCAGCATCCGAGGGCGAGGCCGGGGCCGAGGATTTGGGGGCGCCAACCACGGAGGCTACATGAATTCTGGCGCCGGGTACGGAAGTTATGGGTACGGCGGCAGCTCTGCGACTGCAGGCTATAGTGACTTTTTCACAGACTGCTACGGCTATCATGATTTTGGGTCTTCCTAG

XM_004865521.1 Coding sequence

Ilf3 interleukin enhancer binding factor 3, 90kDa, transcript variant X2

Length: 2739 bp    Location: 2695554..2713179   Strand: +
>XM_004865521.1
ATGGCATTGTACCATCACCACTTCACCACGAGAGGAAGAAGGCGTCCAATGCGGATTTTTGTGAATGATGATCGCCACGTGATGGCAAAGCATTCTTCGGTGTATCCAACACAAGAGGAACTGGAGGCAGTGCAGAACATGGTATCCCACACCGAGAGGGCTCTCAAAGCTGTGTCTGACTGGATCGACGAGCAAGAAAAAGGCAACAGCGAGCAGGCCGAGTCTGACAACATGGATGTGCCCGCGGATGATGAGAGCAAAGAAGGGGCCGGGGAACAGAAGGCAGAACACATGACCAGGACCCTGCGGGGCGTGATGCGGGTTGGCCTGGTGGCAAAGGGCCTTCTGCTGAAGGGGGACTTGGATCTAGAGCTGGTGCTGCTATGTAAGGAGAAGCCCACAACTGCCCTCCTGGACAAGGTGGCTGACAACCTGGCCATCCAGCTTGCTGCTGTAACAGAAGACAAGTACGAAATACTCCAGTCTGTGGATGATGCTGCAATTGTGATAAAAAATACAAAAGAGCCCCCGCTGTCTCTGACCATTCACCTAACATCCCCCGTTGTCAGAGAAGAGATGGAGAAGGTGCTAGCTGGAGAAACGCTATCAGTCAACGACCCCCCGGACGTTCTGGACAGGCAGAAATGCCTTGCTGCCTTGGCGTCCCTCCGACACGCCAAGTGGTTCCAGGCCAGGGCCAACGGGCTGAAGTCCTGTGTCATTGTTATCCGGGTCCTGAGGGACCTGTGTACCCGTGTGCCCACCTGGGGTCCCCTCAGAGGATGGCCCCTGGAGCTCCTGTGTGAGAAGTCCATCGGCACAGCCAACAGGCCGATGGGCGCTGGCGAGGCCCTGCGGAGAGTGCTGGAGTGCCTGGCGTCCGGCATCGTGATGCCAGATGGTTCTGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCATGCACTGCGGCTCGCTGCCTTTGGCCAGCTCCACAAAGTCCTGGGCATGGACCCCCTGCCTTCCAAGATGCCCAAGAAACCAAAGAACGAGAATCCAGTGGACTACATCGTTCAAATCCCTCCCAGCACCACCTATGCCATTACCCCCATGAAACGCCCAATGGAGGAGGACGGTGAAGAAAAGTCCCCCAGCAAGAAGAAGAAGAAGATTCAAAAGAAAGAGGAGAAGGCTGAGCCTCCCCAGGCCATGAATGCACTGATGCGTTTGAACCAGCTGAAGCCGGGGCTGCAGTATAAGCTGGTCTCCCAGACAGGCCCTGTGCACGCCCCCATCTTCACCATGTCTGTGGAAGTGGATGGCAGCTCATTTGAGGCCTCAGGGCCCTCCAAGAAGACCGCCAAGCTGCACGTGGCTGTTAAGGTGTTACAGGACATGGGCTTGCCGACAGGTGCTGAAGGCAGGGATTCCAGCAAGGGGGAGGACTCTGCTGAGGAAACGGAGGCAAAGCCTGCTGTGGCGGTCCCGCCCCCCGTGGTAGAAGCTGTGTCGACCCCCAGCGCCACCTTCTCCTCGGATGCCACCACTGAGAACGTAAAACAGCAGGGGCCGATCCTGACTAAGCATGGCAAGAACCCGGTTATGGAACTGAATGAGAAGAGGCGAGGCCTCAAGTACGAGCTCATCTCTGAGACCGGAGGCAGCCATGACAAGCGCTTCGTCATGGAGGTCGAGGTTGACGGACAGAAGTTCCAAGGTGCTGGTTCAAACAAGAAAGTAGCAAAGGCATATGCTGCTCTTGCTGCACTTGAAAAGCTTTTCCCTGATGCCCCTCTTGCCCTCGATGCCAACAAAAAGAAGAGAGCACCAGTTCCTGTCCGAGGCGGACCAAAATTTGCTGCCAAGCCCCACAACCCGGGCTTCGGGATGGGCGGCCCCATGCACAATGAGGCGCCCCCGCCCCCCAACCTCCGAGGGCGGGGGCGAGGTGGCAGCATCCGAGGGCGAGGCCGGGGCCGAGGATTTGGGGGCGCCAACCACGGAGGCTACATGAATTCTGGCGCCGGGTACGGAAGTTATGGGTACGGCGGCAGCTCTGCGACTGCAGGCTATAGTCAGTTCTACAGCAACGGAGGGCATTCTGGGAATGCTGGTGGTGGCGGCGGCGGGGGCGGTGGTGGCTCTTCCGGCTATGGCTCCTACTACCAAGGGGACAACTACAACTCACCGGTACCCCCAAAACACACTGGGAAGAAGCCGCCACATGGGGCCCAGCAGAAGCCATCTTACGGCTCAGGCTACCAGTCCCACCAGGGTCAGCAGCAGTCCTACAACCAGAGCCAGTACGGCAACTATGGCCCACCACAGGGCAAGCAGAAGGGCTACAACCACGGGCAAGGCAACTACTCCTACTCAAACTCGTACAGCTCGCCGGGAGGCGGGGGCGGCTCAGACTACAGCTACGAGAGCAAATTCAACTACAGTGGTAGTGGAGGCCGAAGCGGTGGGAACAGCTACGGCTCAGGCGGGTCATCCTACAACCCAGGGTCCCACGGGGGCTACGGCGGAGGTTCTGGGGGCGGCTCCTCATACCAAGGCAAACAAGGAGGCTACTCTTCACAGTCGAACTACAACTCCCCGGGCTCTGGCCAGAACTACAGCGGCCCTCCCGGCTCCTACCAGTCCTCACAGGGTGGGTATAGCAGGAACGCAGACCACAGCATGAACTACCAGTACAGATAA

XM_004865529.1 Coding sequence

Qtrt1 queuine tRNA-ribosyltransferase 1, transcript variant X3

Length: 1449 bp    Location: 2719813..2724520   Strand: +
>XM_004865529.1
ATGGCGGCAGGGGCTGCTGTGCCGACTTCTCTGGAGTCCGCCCCGCGGATCATGCGGCTGGTCGCCGAGTGCAGTCGCTCCAGGGCCCGCGCGGGCGAACTGCGGCTGCCGCATGGACCGGTGGCCACTCCCGTGTTCATGCCAGTGGGCACGCAGGCCACCATGAAGGGGATCACAACCGAGCAGCTGGACGCCCTGGGCTGCCGCATCTGTTTGGGAAACACCTACCACCTGGGGCTTAGGCCGGGCCCTGAGCTGATCCAGAAAGCCAACGGTCTCCATGGCTTCATGAACTGGCCTCACAACCTGCTGACGGACAGTGGCGGCTTCCAGATGGTGTCCCTGGTGGCTCTGTCTGAGGTGACGGAGGAGGGTGTCCGATTCCGGTCCCCTTACGATGGTGAAGAGACCCTTCTGAGCCCGGAGAGGTCCGTGGAGATCCAGAACTCCCTGGGCTCAGACATCATCATGCAGCTGGATGACGTGGTCAGCAGCACTGTGACTGGCCCGCGTGTGGAAGAGGCCATGCACAGGTCCGTCCGCTGGCTGGACAGGTGCATTGCAGCCCATCGGCAGCCCGACAAGCAGAACCTCTTCGCCATCATCCAGGGCGGGCTAGATGCGGACCTCCGGGCCACTTGCCTTGAAGGTGGGACCATCTGTGACCTAGAGATGACCAAGAGGGATGTGCCAGGCTTCGCCATCGGTGGCCTGAGCGGTGGTGAGAGCAAGGTGCAGTTCTGGAAGATGGTGGCGCTCAGCACGTCTAAGCTGCCGAAGGACAAGCCCCGCTACCTGATGGGGGTCGGGTATGTTGAGGGAAGAAGACCCTGCTTATGGGGAGCAGATTTCTGGGCACCCCTTACCCTGCATGGGGGTGTGTATGGGGGGCAAGGACACAGCCTTGCTGTAGGGGAACCGAGGAGGACACGGCTGTCTCAAGGTTGCCAGGGAGGGCACCTAGGAAGCCCACCCCAGAGCTTCAGCCTCTCTGCTGCCCTCCCCCACACCTGTACCCCCAGCTATGCCACTGATCTGGTGGTCTGCGTGGCTCTTGGATGCGACATGTTCGACTGTGTGTACCCCACACGAACTGCGCGTTTTGGCTCTGCCCTGGTGCCTACTGGGCAGCTGCAGTTGAAGAAAAAGCAGTATGAGAAGGACTTTGGCCCCATAGACCCAGAGTGCTCCTGCCCCACTTGCAAGAGGCACAGCAGGGCCTTCCTGCACACCCTGCTGCACAGCGACAACACGGCCGCCTTGCACCACCTCACTGTGCATAACATTGCCTACCAGCTGCAGCTGATGAGCGCCATCCGAGCCAGCATCGTGGAGAAGCGCTTCCCTGACTTCGTGTGCAGCTTCATGAACACCATGTATGGGGACCAGACCCTCTGTCCCCCTTGGGCCACCGAAGCCCTGGCCTCTGTGGGCATCACACTGAGCTGA

XM_004865530.1 Coding sequence

Qtrt1 queuine tRNA-ribosyltransferase 1, transcript variant X4

Length: 1305 bp    Location: 2719813..2724520   Strand: +
>XM_004865530.1
ATGGCGGCAGGGGCTGCTGTGCCGACTTCTCTGGAGTCCGCCCCGCGGATCATGCGGCTGGTCGCCGAGTGCAGTCGCTCCAGGGCCCGCGCGGGCGAACTGCGGCTGCCGCATGGACCGGTGGCCACTCCCGTGTTCATGCCAGTGGGCACGCAGGCCACCATGAAGGGGATCACAACCGAGCAGCTGGACGCCCTGGGCTGCCGCATCTGTTTGGGAAACACCTACCACCTGGGGCTTAGGCCGGGCCCTGAGCTGATCCAGAAAGCCAACGGTCTCCATGGCTTCATGAACTGGCCTCACAACCTGCTGACGGACAGTGGCGGCTTCCAGATGGTGTCCCTGGTGGCTCTGTCTGAGGTGACGGAGGAGGGTGTCCGATTCCGGTCCCCTTACGATGGTGAAGAGACCCTTCTGAGCCCGGAGAGGTCCGTGGAGATCCAGAACTCCCTGGGCTCAGACATCATCATGCAGCTGGATGACGTGGTCAGCAGCACTGTGACTGGCCCGCGTGTGGAAGAGGCCATGCACAGGTCCGTCCGCTGGCTGGACAGGTGCATTGCAGCCCATCGGCAGCCCGACAAGCAGAACCTCTTCGCCATCATCCAGGGCGGGCTAGATGCGGACCTCCGGGCCACTTGCCTTGAAGGTGGGACCATCTGTGACCTAGAGATGACCAAGAGGGATGTGCCAGGCTTCGCCATCGGTGGCCTGAGCGGTGGTGAGAGCAAGGTGCAGTTCTGGAAGATGGTGGCGCTCAGCACGTCTAAGCTGCCGAAGGACAAGCCCCGCTACCTGATGGGGGTCGGCTATGCCACTGATCTGGTGGTCTGCGTGGCTCTTGGATGCGACATGTTCGACTGTGTGTACCCCACACGAACTGCGCGTTTTGGCTCTGCCCTGGTGCCTACTGGGCAGCTGCAGTTGAAGAAAAAGCAGTATGAGAAGGACTTTGGCCCCATAGACCCAGAGTGCTCCTGCCCCACTTGCAAGAGGCACAGCAGGGCCTTCCTGCACACCCTGCTGCACAGCGACAACACGGCCGCCTTGCACCACCTCACTGTGCATAACATTGCCTACCAGGTGGGCAGGTACAGGTCGGGGGGGAGGTCCCCGGCGCCTGGCACCAATGCTGACCTTGGGCCCCTGCAGCTGCAGCTGATGAGCGCCATCCGAGCCAGCATCGTGGAGAAGCGCTTCCCTGACTTCGTGTGCAGCTTCATGAACACCATGTATGGGGACCAGACCCTCTGTCCCCCTTGGGCCACCGAAGCCCTGGCCTCTGTGGGCATCACACTGAGCTGA

XM_004865528.1 Coding sequence

Qtrt1 queuine tRNA-ribosyltransferase 1, transcript variant X2

Length: 1497 bp    Location: 2719813..2724520   Strand: +
>XM_004865528.1
ATGGCGGCAGGGGCTGCTGTGCCGACTTCTCTGGAGTCCGCCCCGCGGATCATGCGGCTGGTCGCCGAGTGCAGTCGCTCCAGGGCCCGCGCGGGCGAACTGCGGCTGCCGCATGGACCGGTGGCCACTCCCGTGTTCATGCCAGTGGGCACGCAGGCCACCATGAAGGGGATCACAACCGAGCAGCTGGACGCCCTGGGCTGCCGCATCTGTTTGGGAAACACCTACCACCTGGGGCTTAGGCCGGGCCCTGAGCTGATCCAGAAAGCCAACGGTCTCCATGGCTTCATGAACTGGCCTCACAACCTGCTGACGGACAGTGGCGGCTTCCAGATGGTGTCCCTGGTGGCTCTGTCTGAGGTGACGGAGGAGGGTGTCCGATTCCGGTCCCCTTACGATGGTGAAGAGACCCTTCTGAGCCCGGAGAGGTCCGTGGAGATCCAGAACTCCCTGGGCTCAGACATCATCATGCAGCTGGATGACGTGGTCAGCAGCACTGTGACTGGCCCGCGTGTGGAAGAGGCCATGCACAGGTCCGTCCGCTGGCTGGACAGGTGCATTGCAGCCCATCGGCAGCCCGACAAGCAGAACCTCTTCGCCATCATCCAGGGCGGGCTAGATGCGGACCTCCGGGCCACTTGCCTTGAAGAGATGACCAAGAGGGATGTGCCAGGCTTCGCCATCGGTGGCCTGAGCGGTGGTGAGAGCAAGGTGCAGTTCTGGAAGATGGTGGCGCTCAGCACGTCTAAGCTGCCGAAGGACAAGCCCCGCTACCTGATGGGGGTCGGGTATGTTGAGGGAAGAAGACCCTGCTTATGGGGAGCAGATTTCTGGGCACCCCTTACCCTGCATGGGGGTGTGTATGGGGGGCAAGGACACAGCCTTGCTGTAGGGGAACCGAGGAGGACACGGCTGTCTCAAGGTTGCCAGGGAGGGCACCTAGGAAGCCCACCCCAGAGCTTCAGCCTCTCTGCTGCCCTCCCCCACACCTGTACCCCCAGCTATGCCACTGATCTGGTGGTCTGCGTGGCTCTTGGATGCGACATGTTCGACTGTGTGTACCCCACACGAACTGCGCGTTTTGGCTCTGCCCTGGTGCCTACTGGGCAGCTGCAGTTGAAGAAAAAGCAGTATGAGAAGGACTTTGGCCCCATAGACCCAGAGTGCTCCTGCCCCACTTGCAAGAGGCACAGCAGGGCCTTCCTGCACACCCTGCTGCACAGCGACAACACGGCCGCCTTGCACCACCTCACTGTGCATAACATTGCCTACCAGGTGGGCAGGTACAGGTCGGGGGGGAGGTCCCCGGCGCCTGGCACCAATGCTGACCTTGGGCCCCTGCAGCTGCAGCTGATGAGCGCCATCCGAGCCAGCATCGTGGAGAAGCGCTTCCCTGACTTCGTGTGCAGCTTCATGAACACCATGTATGGGGACCAGACCCTCTGTCCCCCTTGGGCCACCGAAGCCCTGGCCTCTGTGGGCATCACACTGAGCTGA

XM_004865531.1 Coding sequence

Qtrt1 queuine tRNA-ribosyltransferase 1, transcript variant X5

High confidence: 4 potential gene matches
Length: 1215 bp    Location: 2719814..2724520   Strand: +
>XM_004865531.1
ATGGCGGCAGGGGCTGCTGTGCCGACTTCTCTGGAGTCCGCCCCGCGGATCATGCGGCTGGTCGCCGAGTGCAGTCGCTCCAGGGCCCGCGCGGGCGAACTGCGGCTGCCGCATGGACCGGTGGCCACTCCCGTGTTCATGCCAGTGGGCACGCAGGCCACCATGAAGGGGATCACAACCGAGCAGCTGGACGCCCTGGGCTGCCGCATCTGTTTGGGAAACACCTACCACCTGGGGCTTAGGCCGGGCCCTGAGCTGATCCAGAAAGCCAACGGTCTCCATGGCTTCATGAACTGGCCTCACAACCTGCTGACGGACAGTGGCGGCTTCCAGATGGTGTCCCTGGTGGCTCTGTCTGAGGTGACGGAGGAGGGTGTCCGATTCCGGTCCCCTTACGATGGTGAAGAGACCCTTCTGAGCCCGGAGAGGTCCGTGGAGATCCAGAACTCCCTGGGCTCAGACATCATCATGCAGCTGGATGACGTGGTCAGCAGCACTGTGACTGGCCCGCGTGTGGAAGAGGCCATGCACAGGTCCGTCCGCTGGCTGGACAGGTGCATTGCAGCCCATCGGCAGCCCGACAAGCAGAACCTCTTCGCCATCATCCAGGGCGGGCTAGATGCGGACCTCCGGGCCACTTGCCTTGAAGAGATGACCAAGAGGGATGTGCCAGGCTTCGCCATCGGTGGCCTGAGCGGTGGTGAGAGCAAGGTGCAGTTCTGGAAGATGGTGGCGCTCAGCACGTCTAAGCTGCCGAAGGACAAGCCCCGCTACCTGATGGGGGTCGGCTATGCCACTGATCTGGTGGTCTGCGTGGCTCTTGGATGCGACATGTTCGACTGTGTGTACCCCACACGAACTGCGCGTTTTGGCTCTGCCCTGGTGCCTACTGGGCAGCTGCAGTTGAAGAAAAAGCAGTATGAGAAGGACTTTGGCCCCATAGACCCAGAGTGCTCCTGCCCCACTTGCAAGAGGCACAGCAGGGCCTTCCTGCACACCCTGCTGCACAGCGACAACACGGCCGCCTTGCACCACCTCACTGTGCATAACATTGCCTACCAGCTGCAGCTGATGAGCGCCATCCGAGCCAGCATCGTGGAGAAGCGCTTCCCTGACTTCGTGTGCAGCTTCATGAACACCATGTATGGGGACCAGACCCTCTGTCCCCCTTGGGCCACCGAAGCCCTGGCCTCTGTGGGCATCACACTGAGCTGA

XM_004865538.1 Coding sequence

Dnm2 dynamin 2, transcript variant X7

Length: 2577 bp    Location: 2727111..2805248   Strand: +
>XM_004865538.1
ATGGGCAACCGCGGGATGGAAGAGCTGATTCCGCTGGTCAACAAGCTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCCGTGGTGGGCGGCCAGAGCGCCGGCAAGAGCTCGGTGCTCGAGAATTTCGTGGGCCGGGACTTCCTTCCCCGAGGTTCAGGAATTGTCACCAGGCGGCCTCTCATTCTGCAGCTCATCTTCTCAAAAACAGAATATGCCGAGTTTCTGCACTGCAAGTCCAAAAAGTTTACAGACTTTGATGAAGTCCGGCAGGAGATCGAAGCGGAGACAGACCGAGTCACGGGGACCAACAAAGGCATCTCCCCAGTGCCCATCAACCTGCGGGTCTACTCGCCACATGTGCTGAACTTGACCCTCATTGACCTCCCGGGCATCACCAAGGTGCCCGTGGGGGACCAGCCCCCAGACATCGAGTACCAGATCAAGGACATGATCCTGCAGTTCATCAGCCGGGAGAGCAGCCTGATCCTGGCTGTGACGCCCGCCAACATGGACTTGGCCAACTCCGACGCCCTCAAGCTGGCCAAGGAGGTCGACCCCCAAGGCCTGCGGACCATCGGCGTCATCACCAAGCTCGACCTGATGGACGAGGGCACCGATGCCAGGGACGTCCTGGAGAACAAGCTGCTGCCCTTGCGGAGAGGCTATATCGGCGTGGTGAACCGCAGTCAGAAGGACATTGAGGGGAAGAAGGACATCCGTGCGGCGCTGGCGGCCGAGAGGAAGTTCTTCCTCTCCCACCCTGCGTACCGGCACATGGCCGACCGCATGGGCACCCCACATTTGCAGAAGACCCTGAATCAGCAACTGACCAACCACATCCGGGAGTCATTGCCCAACCTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAGTACAAGAACTTCCGGCCCGACGACCCCACGCGCAAAACCAAAGCCCTGCTGCAGATGGTCCAGCAATTTGGGGTAGACTTTGAGAAGAGGATTGAGGGCTCTGGAGACCAAGTGGACACGCTGGAGCTCTCGGGGGGCGCCCGTATCAACCGCATCTTCCACGAGCGCTTTCCCTTCGAGCTGGTGAAGATGGAGTTTGATGAGAAGGACTTAAGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGAGTCAGGACTGGGCTTTTCACCCCGGACTTGGCGTTCGAGGCCATTGTGAAAAAGCAGGTGGTGAAGCTGAAAGAGCCCTGTCTGAAATGTGTGGACCTGGTTATCCAGGAGCTAATCAATACAGTTAGGCAGTGTACCAGTAAGCTCTGCTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACATACATCCGGGAGCGAGAGGGGAGGACCAAGGACCAGATTCTTCTTCTGATCGACATCGAGCAGTCCTACATCAACACAAACCACGAAGATTTCATTGGATTTGCCAACGCCCAGCAGAGGAGCACGCAGCTGAATAAGAAGAGAGCCATCCCCAACCAGGGGGAGATCTTGGTGATCCGAAGGGGCTGGCTGACCATCAACAACATCAGCCTCATGAAGGGCGGCTCCAAGGAATACTGGTTTGTGCTCACGGCCGAGTCGCTGTCCTGGTACAAGGATGAAGAGGAGAAAGAGAAGAAGTACATGCTGCCCCTGGACAACCTCAAGATCCGGGACGTCGAGAAGGGCTTCATGTCCAACAAGCATGTGTTCGCTATCTTCAATACAGAGCAGAGGAACGTCTACAAGGACCTGCGGCAGATCGAGCTGGCCTGTGACTCCCAGGAGGACGTGGACAGCTGGAAAGCGTCATTCCTGCGCGCCGGCGTCTACCCTGAGAAGGACCAGGCGGAGAACGAGGACGTGGGGCAGGACACCTTCTCCATGGACCCACAGCTGGAGCGGCAGGTGGAGACCATCCGCAACCTGGTGGACTCATACGTGGCCATCATTAACAAGTCCATCCGCGACCTCATGCCAAAGACCATCATGCACCTCATGATCAACAACACCAAGGCCTTCATCCACCATGAGCTGCTGGCCTACCTGTACTCGTCGGCTGACCAGAGCAGCCTCATGGAGGAGTCGGCTGACCAGGCACAGCGGCGGGATGACATGCTGCGCATGTATCACGCGCTCAAGGAGGCGCTCACCATCATCGGTGACATCAGCACCAGCACTGTGTCCACGCCCGTGCCCCCGCCTGTCGACGACACCTGGCTACAGACCACTGCCAGCCACAGCCCCACCCCACAGCGTCGACCTCTGTCCAGTGTGCACCCGCCTGGCCGGCCACCAGCAGTGCGGGGCCCCACTCCTGGGCCCCCCCTGATTCCCATGCCCGTGGGGGCTGCAGCCTCCTTCTCGGCGCCCCCCATCCCGTCCCGGCCTGGACCCCAAGTGTTTGCCAACAATGACCCCTTCTCAGCCCCGCCGCAGATCCCATCTCGGCCAGTGCGGGTACCTCCTGGCATCCCCCCAGGAGTCCCCAGGCGACCACCTCCATCGGCTCCTGCCCGACCTTTCTTCTGA

XM_004865534.1 Coding sequence

Dnm2 dynamin 2, transcript variant X3

Length: 2604 bp    Location: 2727111..2804576   Strand: +
>XM_004865534.1
ATGGGCAACCGCGGGATGGAAGAGCTGATTCCGCTGGTCAACAAGCTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCCGTGGTGGGCGGCCAGAGCGCCGGCAAGAGCTCGGTGCTCGAGAATTTCGTGGGCCGGGACTTCCTTCCCCGAGGTTCAGGAATTGTCACCAGGCGGCCTCTCATTCTGCAGCTCATCTTCTCAAAAACAGAATATGCCGAGTTTCTGCACTGCAAGTCCAAAAAGTTTACAGACTTTGATGAAGTCCGGCAGGAGATCGAAGCGGAGACAGACCGAGTCACGGGGACCAACAAAGGCATCTCCCCAGTGCCCATCAACCTGCGGGTCTACTCGCCACATGTGCTGAACTTGACCCTCATTGACCTCCCGGGCATCACCAAGGTGCCCGTGGGGGACCAGCCCCCAGACATCGAGTACCAGATCAAGGACATGATCCTGCAGTTCATCAGCCGGGAGAGCAGCCTGATCCTGGCTGTGACGCCCGCCAACATGGACTTGGCCAACTCCGACGCCCTCAAGCTGGCCAAGGAGGTCGACCCCCAAGGCCTGCGGACCATCGGCGTCATCACCAAGCTCGACCTGATGGACGAGGGCACCGATGCCAGGGACGTCCTGGAGAACAAGCTGCTGCCCTTGCGGAGAGGCTATATCGGCGTGGTGAACCGCAGTCAGAAGGACATTGAGGGGAAGAAGGACATCCGTGCGGCGCTGGCGGCCGAGAGGAAGTTCTTCCTCTCCCACCCTGCGTACCGGCACATGGCCGACCGCATGGGCACCCCACATTTGCAGAAGACCCTGAATCAGCAACTGACCAACCACATCCGGGAGTCATTGCCCAACCTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAGTACAAGAACTTCCGGCCCGACGACCCCACGCGCAAAACCAAAGCCCTGCTGCAGATGGTCCAGCAATTTGGGGTAGACTTTGAGAAGAGGATTGAGGGCTCTGGAGACCAAGTGGACACGCTGGAGCTCTCGGGGGGCGCCCGTATCAACCGCATCTTCCACGAGCGCTTTCCCTTCGAGCTGGTGAAGATGGAGTTTGATGAGAAGGACTTAAGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGAGTCAGGACTGGGCTTTTCACCCCGGACTTGGCGTTCGAGGCCATTGTGAAAAAGCAGGTGGTGAAGCTGAAAGAGCCCTGTCTGAAATGTGTGGACCTGGTTATCCAGGAGCTAATCAATACAGTTAGGCAGTGTACCAGTAAGCTCTGCTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACATACATCCGGGAGCGAGAGGGGAGGACCAAGGACCAGATTCTTCTTCTGATCGACATCGAGCAGTCCTACATCAACACAAACCACGAAGATTTCATTGGATTTGCCAACGCCCAGCAGAGGAGCACGCAGCTGAATAAGAAGAGAGCCATCCCCAACCAGGGGGAGATCTTGGTGATCCGAAGGGGCTGGCTGACCATCAACAACATCAGCCTCATGAAGGGCGGCTCCAAGGAATACTGGTTTGTGCTCACGGCCGAGTCGCTGTCCTGGTACAAGGATGAAGAGGAGAAAGAGAAGAAGTACATGCTGCCCCTGGACAACCTCAAGATCCGGGACGTCGAGAAGGGCTTCATGTCCAACAAGCATGTGTTCGCTATCTTCAATACAGAGCAGAGGAACGTCTACAAGGACCTGCGGCAGATCGAGCTGGCCTGTGACTCCCAGGAGGACGTGGACAGCTGGAAAGCGTCATTCCTGCGCGCCGGCGTCTACCCTGAGAAGGACCAGGCGGAGAACGAGGACGTGGGGCAGGACACCTTCTCCATGGACCCACAGCTGGAGCGGCAGGTGGAGACCATCCGCAACCTGGTGGACTCATACGTGGCCATCATTAACAAGTCCATCCGCGACCTCATGCCAAAGACCATCATGCACCTCATGATCAACAACACCAAGGCCTTCATCCACCATGAGCTGCTGGCCTACCTGTACTCGTCGGCTGACCAGAGCAGCCTCATGGAGGAGTCGGCTGACCAGGCACAGCGGCGGGATGACATGCTGCGCATGTATCACGCGCTCAAGGAGGCGCTCACCATCATCGGTGACATCAGCACCAGCACTGTGTCCACGCCCGTGCCCCCGCCTGTCGACGACACCTGGCTACAGACCACTGCCAGCCACAGCCCCACCCCACAGCGTCGACCTCTGTCCAGTGTGCACCCGCCTGGCCGGCCACCAGCAGTGCGGGGCCCCACTCCTGGGCCCCCCCTGATTCCCATGCCCGTGGGGGCTGCAGCCTCCTTCTCGGCGCCCCCCATCCCGTCCCGGCCTGGACCCCAAGTGTTTGCCAACAATGACCCCTTCTCAGCCCCGCCGCAGATCCCATCTCGGCCAGTGCGGGTACCTCCTGGCATCCCCCCAGGAGTCCCCAGAAGACCCCCTGCCGCGCCCAGCCGGCCCACCATTATCCGGCCCACCGAGCCCTCGCTGCTCGACTAG

XM_004865536.1 Coding sequence

Dnm2 dynamin 2, transcript variant X5

Length: 2595 bp    Location: 2727111..2804576   Strand: +
>XM_004865536.1
ATGGGCAACCGCGGGATGGAAGAGCTGATTCCGCTGGTCAACAAGCTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCCGTGGTGGGCGGCCAGAGCGCCGGCAAGAGCTCGGTGCTCGAGAATTTCGTGGGCCGGGACTTCCTTCCCCGAGGTTCAGGAATTGTCACCAGGCGGCCTCTCATTCTGCAGCTCATCTTCTCAAAAACAGAATATGCCGAGTTTCTGCACTGCAAGTCCAAAAAGTTTACAGACTTTGATGAAGTCCGGCAGGAGATCGAAGCGGAGACAGACCGAGTCACGGGGACCAACAAAGGCATCTCCCCAGTGCCCATCAACCTGCGGGTCTACTCGCCACATGTGCTGAACTTGACCCTCATTGACCTCCCGGGCATCACCAAGGTGCCCGTGGGGGACCAGCCCCCAGACATCGAGTACCAGATCAAGGACATGATCCTGCAGTTCATCAGCCGGGAGAGCAGCCTGATCCTGGCTGTGACGCCCGCCAACATGGACTTGGCCAACTCCGACGCCCTCAAGCTGGCCAAGGAGGTCGACCCCCAAGGCCTGCGGACCATCGGCGTCATCACCAAGCTCGACCTGATGGACGAGGGCACCGATGCCAGGGACGTCCTGGAGAACAAGCTGCTGCCCTTGCGGAGAGGCTATATCGGCGTGGTGAACCGCAGTCAGAAGGACATTGAGGGGAAGAAGGACATCCGTGCGGCGCTGGCGGCCGAGAGGAAGTTCTTCCTCTCCCACCCTGCGTACCGGCACATGGCCGACCGCATGGGCACCCCACATTTGCAGAAGACCCTGAATCAGCAACTGACCAACCACATCCGGGAGTCATTGCCCAACCTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAGTACAAGAACTTCCGGCCCGACGACCCCACGCGCAAAACCAAAGCCCTGCTGCAGATGGTCCAGCAATTTGGGGTAGACTTTGAGAAGAGGATTGAGGGCTCTGGAGACCAAGTGGACACGCTGGAGCTCTCGGGGGGCGCCCGTATCAACCGCATCTTCCACGAGCGCTTTCCCTTCGAGCTGGTGAAGATGGAGTTTGATGAGAAGGACTTAAGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGAGTCAGGACTGGGCTTTTCACCCCGGACTTGGCGTTCGAGGCCATTGTGAAAAAGCAGGTGGTGAAGCTGAAAGAGCCCTGTCTGAAATGTGTGGACCTGGTTATCCAGGAGCTAATCAATACAGTTAGGCAGTGTACCAGTAAGCTCTGCTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACATACATCCGGGAGCGAGAGGGGAGGACCAAGGACCAGATTCTTCTTCTGATCGACATCGAGCAGTCCTACATCAACACAAACCACGAAGATTTCATTGGATTTGCCAACGCCCAGCAGAGGAGCACGCAGCTGAATAAGAAGAGAGCCATCCCCAACCAGGTGATCCGAAGGGGCTGGCTGACCATCAACAACATCAGCCTCATGAAGGGCGGCTCCAAGGAATACTGGTTTGTGCTCACGGCCGAGTCGCTGTCCTGGTACAAGGATGAAGAGGAGAAAGAGAAGAAGTACATGCTGCCCCTGGACAACCTCAAGATCCGGGACGTCGAGAAGGGCTTCATGTCCAACAAGCATGTGTTCGCTATCTTCAATACAGAGCAGAGGAACGTCTACAAGGACCTGCGGCAGATCGAGCTGGCCTGTGACTCCCAGGAGGACGTGGACAGCTGGAAAGCGTCATTCCTGCGCGCCGGCGTCTACCCTGAGAAGGACCAGGCGGAGAACGAGGACGTGGGGCAGGACACCTTCTCCATGGACCCACAGCTGGAGCGGCAGGTGGAGACCATCCGCAACCTGGTGGACTCATACGTGGCCATCATTAACAAGTCCATCCGCGACCTCATGCCAAAGACCATCATGCACCTCATGATCAACAACACCAAGGCCTTCATCCACCATGAGCTGCTGGCCTACCTGTACTCGTCGGCTGACCAGAGCAGCCTCATGGAGGAGTCGGCTGACCAGGCACAGCGGCGGGATGACATGCTGCGCATGTATCACGCGCTCAAGGAGGCGCTCACCATCATCGGTGACATCAGCACCAGCACTGTGTCCACGCCCGTGCCCCCGCCTGTCGACGACACCTGGCTACAGACCACTGCCAGCCACAGCCCCACCCCACAGCGTCGACCTCTGTCCAGTGTGCACCCGCCTGGCCGGCCACCAGCAGTGCGGGGCCCCACTCCTGGGCCCCCCCTGATTCCCATGCCCGTGGGGGCTGCAGCCTCCTTCTCGGCGCCCCCCATCCCGTCCCGGCCTGGACCCCAAGTGTTTGCCAACAATGACCCCTTCTCAGCCCCGCCGCAGATCCCATCTCGGCCAGTGCGGGTACCTCCTGGCATCCCCCCAGGAGTCCCCAGCAGAAGACCCCCTGCCGCGCCCAGCCGGCCCACCATTATCCGGCCCACCGAGCCCTCGCTGCTCGACTAG

XM_004865533.1 Coding sequence

Dnm2 dynamin 2, transcript variant X2

Length: 2607 bp    Location: 2727111..2804576   Strand: +
>XM_004865533.1
ATGGGCAACCGCGGGATGGAAGAGCTGATTCCGCTGGTCAACAAGCTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCCGTGGTGGGCGGCCAGAGCGCCGGCAAGAGCTCGGTGCTCGAGAATTTCGTGGGCCGGGACTTCCTTCCCCGAGGTTCAGGAATTGTCACCAGGCGGCCTCTCATTCTGCAGCTCATCTTCTCAAAAACAGAATATGCCGAGTTTCTGCACTGCAAGTCCAAAAAGTTTACAGACTTTGATGAAGTCCGGCAGGAGATCGAAGCGGAGACAGACCGAGTCACGGGGACCAACAAAGGCATCTCCCCAGTGCCCATCAACCTGCGGGTCTACTCGCCACATGTGCTGAACTTGACCCTCATTGACCTCCCGGGCATCACCAAGGTGCCCGTGGGGGACCAGCCCCCAGACATCGAGTACCAGATCAAGGACATGATCCTGCAGTTCATCAGCCGGGAGAGCAGCCTGATCCTGGCTGTGACGCCCGCCAACATGGACTTGGCCAACTCCGACGCCCTCAAGCTGGCCAAGGAGGTCGACCCCCAAGGCCTGCGGACCATCGGCGTCATCACCAAGCTCGACCTGATGGACGAGGGCACCGATGCCAGGGACGTCCTGGAGAACAAGCTGCTGCCCTTGCGGAGAGGCTATATCGGCGTGGTGAACCGCAGTCAGAAGGACATTGAGGGGAAGAAGGACATCCGTGCGGCGCTGGCGGCCGAGAGGAAGTTCTTCCTCTCCCACCCTGCGTACCGGCACATGGCCGACCGCATGGGCACCCCACATTTGCAGAAGACCCTGAATCAGCAACTGACCAACCACATCCGGGAGTCATTGCCCAACCTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAGTACAAGAACTTCCGGCCCGACGACCCCACGCGCAAAACCAAAGCCCTGCTGCAGATGGTCCAGCAATTTGGGGTAGACTTTGAGAAGAGGATTGAGGGCTCTGGAGACCAAGTGGACACGCTGGAGCTCTCGGGGGGCGCCCGTATCAACCGCATCTTCCACGAGCGCTTTCCCTTCGAGCTGGTGAAGATGGAGTTTGATGAGAAGGACTTAAGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGAGTCAGGACGGGGCTCTTCACCCCGGACATGGCCTTTGAAGCCATTGTGAAAAAACAGATTGTAAAACTCAAAGAGCCAAGCCTCAAGTGTGTTGACCTCGTGGTCTCAGAGCTGGCCACGGTCATTAAAAAGTGTGCCGAGAAGCTCTGCTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACATACATCCGGGAGCGAGAGGGGAGGACCAAGGACCAGATTCTTCTTCTGATCGACATCGAGCAGTCCTACATCAACACAAACCACGAAGATTTCATTGGATTTGCCAACGCCCAGCAGAGGAGCACGCAGCTGAATAAGAAGAGAGCCATCCCCAACCAGGGGGAGATCTTGGTGATCCGAAGGGGCTGGCTGACCATCAACAACATCAGCCTCATGAAGGGCGGCTCCAAGGAATACTGGTTTGTGCTCACGGCCGAGTCGCTGTCCTGGTACAAGGATGAAGAGGAGAAAGAGAAGAAGTACATGCTGCCCCTGGACAACCTCAAGATCCGGGACGTCGAGAAGGGCTTCATGTCCAACAAGCATGTGTTCGCTATCTTCAATACAGAGCAGAGGAACGTCTACAAGGACCTGCGGCAGATCGAGCTGGCCTGTGACTCCCAGGAGGACGTGGACAGCTGGAAAGCGTCATTCCTGCGCGCCGGCGTCTACCCTGAGAAGGACCAGGCGGAGAACGAGGACGTGGGGCAGGACACCTTCTCCATGGACCCACAGCTGGAGCGGCAGGTGGAGACCATCCGCAACCTGGTGGACTCATACGTGGCCATCATTAACAAGTCCATCCGCGACCTCATGCCAAAGACCATCATGCACCTCATGATCAACAACACCAAGGCCTTCATCCACCATGAGCTGCTGGCCTACCTGTACTCGTCGGCTGACCAGAGCAGCCTCATGGAGGAGTCGGCTGACCAGGCACAGCGGCGGGATGACATGCTGCGCATGTATCACGCGCTCAAGGAGGCGCTCACCATCATCGGTGACATCAGCACCAGCACTGTGTCCACGCCCGTGCCCCCGCCTGTCGACGACACCTGGCTACAGACCACTGCCAGCCACAGCCCCACCCCACAGCGTCGACCTCTGTCCAGTGTGCACCCGCCTGGCCGGCCACCAGCAGTGCGGGGCCCCACTCCTGGGCCCCCCCTGATTCCCATGCCCGTGGGGGCTGCAGCCTCCTTCTCGGCGCCCCCCATCCCGTCCCGGCCTGGACCCCAAGTGTTTGCCAACAATGACCCCTTCTCAGCCCCGCCGCAGATCCCATCTCGGCCAGTGCGGGTACCTCCTGGCATCCCCCCAGGAGTCCCCAGCAGAAGACCCCCTGCCGCGCCCAGCCGGCCCACCATTATCCGGCCCACCGAGCCCTCGCTGCTCGACTAG

XM_004865535.1 Coding sequence

Dnm2 dynamin 2, transcript variant X4

High confidence: 4 potential gene matches
Length: 2604 bp    Location: 2727111..2804576   Strand: +
>XM_004865535.1
ATGGGCAACCGCGGGATGGAAGAGCTGATTCCGCTGGTCAACAAGCTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCCGTGGTGGGCGGCCAGAGCGCCGGCAAGAGCTCGGTGCTCGAGAATTTCGTGGGCCGGGACTTCCTTCCCCGAGGTTCAGGAATTGTCACCAGGCGGCCTCTCATTCTGCAGCTCATCTTCTCAAAAACAGAATATGCCGAGTTTCTGCACTGCAAGTCCAAAAAGTTTACAGACTTTGATGAAGTCCGGCAGGAGATCGAAGCGGAGACAGACCGAGTCACGGGGACCAACAAAGGCATCTCCCCAGTGCCCATCAACCTGCGGGTCTACTCGCCACATGTGCTGAACTTGACCCTCATTGACCTCCCGGGCATCACCAAGGTGCCCGTGGGGGACCAGCCCCCAGACATCGAGTACCAGATCAAGGACATGATCCTGCAGTTCATCAGCCGGGAGAGCAGCCTGATCCTGGCTGTGACGCCCGCCAACATGGACTTGGCCAACTCCGACGCCCTCAAGCTGGCCAAGGAGGTCGACCCCCAAGGCCTGCGGACCATCGGCGTCATCACCAAGCTCGACCTGATGGACGAGGGCACCGATGCCAGGGACGTCCTGGAGAACAAGCTGCTGCCCTTGCGGAGAGGCTATATCGGCGTGGTGAACCGCAGTCAGAAGGACATTGAGGGGAAGAAGGACATCCGTGCGGCGCTGGCGGCCGAGAGGAAGTTCTTCCTCTCCCACCCTGCGTACCGGCACATGGCCGACCGCATGGGCACCCCACATTTGCAGAAGACCCTGAATCAGCAACTGACCAACCACATCCGGGAGTCATTGCCCAACCTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAGTACAAGAACTTCCGGCCCGACGACCCCACGCGCAAAACCAAAGCCCTGCTGCAGATGGTCCAGCAATTTGGGGTAGACTTTGAGAAGAGGATTGAGGGCTCTGGAGACCAAGTGGACACGCTGGAGCTCTCGGGGGGCGCCCGTATCAACCGCATCTTCCACGAGCGCTTTCCCTTCGAGCTGGTGAAGATGGAGTTTGATGAGAAGGACTTAAGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGAGTCAGGACGGGGCTCTTCACCCCGGACATGGCCTTTGAAGCCATTGTGAAAAAACAGATTGTAAAACTCAAAGAGCCAAGCCTCAAGTGTGTTGACCTCGTGGTCTCAGAGCTGGCCACGGTCATTAAAAAGTGTGCCGAGAAGCTCTGCTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACATACATCCGGGAGCGAGAGGGGAGGACCAAGGACCAGATTCTTCTTCTGATCGACATCGAGCAGTCCTACATCAACACAAACCACGAAGATTTCATTGGATTTGCCAACGCCCAGCAGAGGAGCACGCAGCTGAATAAGAAGAGAGCCATCCCCAACCAGGGGGAGATCTTGGTGATCCGAAGGGGCTGGCTGACCATCAACAACATCAGCCTCATGAAGGGCGGCTCCAAGGAATACTGGTTTGTGCTCACGGCCGAGTCGCTGTCCTGGTACAAGGATGAAGAGGAGAAAGAGAAGAAGTACATGCTGCCCCTGGACAACCTCAAGATCCGGGACGTCGAGAAGGGCTTCATGTCCAACAAGCATGTGTTCGCTATCTTCAATACAGAGCAGAGGAACGTCTACAAGGACCTGCGGCAGATCGAGCTGGCCTGTGACTCCCAGGAGGACGTGGACAGCTGGAAAGCGTCATTCCTGCGCGCCGGCGTCTACCCTGAGAAGGACCAGGCGGAGAACGAGGACGTGGGGCAGGACACCTTCTCCATGGACCCACAGCTGGAGCGGCAGGTGGAGACCATCCGCAACCTGGTGGACTCATACGTGGCCATCATTAACAAGTCCATCCGCGACCTCATGCCAAAGACCATCATGCACCTCATGATCAACAACACCAAGGCCTTCATCCACCATGAGCTGCTGGCCTACCTGTACTCGTCGGCTGACCAGAGCAGCCTCATGGAGGAGTCGGCTGACCAGGCACAGCGGCGGGATGACATGCTGCGCATGTATCACGCGCTCAAGGAGGCGCTCACCATCATCGGTGACATCAGCACCAGCACTGTGTCCACGCCCGTGCCCCCGCCTGTCGACGACACCTGGCTACAGACCACTGCCAGCCACAGCCCCACCCCACAGCGTCGACCTCTGTCCAGTGTGCACCCGCCTGGCCGGCCACCAGCAGTGCGGGGCCCCACTCCTGGGCCCCCCCTGATTCCCATGCCCGTGGGGGCTGCAGCCTCCTTCTCGGCGCCCCCCATCCCGTCCCGGCCTGGACCCCAAGTGTTTGCCAACAATGACCCCTTCTCAGCCCCGCCGCAGATCCCATCTCGGCCAGTGCGGGTACCTCCTGGCATCCCCCCAGGAGTCCCCAGAAGACCCCCTGCCGCGCCCAGCCGGCCCACCATTATCCGGCCCACCGAGCCCTCGCTGCTCGACTAG

XM_004865537.1 Coding sequence

Dnm2 dynamin 2, transcript variant X6

Length: 2595 bp    Location: 2727111..2804576   Strand: +
>XM_004865537.1
ATGGGCAACCGCGGGATGGAAGAGCTGATTCCGCTGGTCAACAAGCTGCAGGACGCCTTCAGCTCCATCGGCCAGAGCTGCCACCTGGACCTGCCGCAGATCGCCGTGGTGGGCGGCCAGAGCGCCGGCAAGAGCTCGGTGCTCGAGAATTTCGTGGGCCGGGACTTCCTTCCCCGAGGTTCAGGAATTGTCACCAGGCGGCCTCTCATTCTGCAGCTCATCTTCTCAAAAACAGAATATGCCGAGTTTCTGCACTGCAAGTCCAAAAAGTTTACAGACTTTGATGAAGTCCGGCAGGAGATCGAAGCGGAGACAGACCGAGTCACGGGGACCAACAAAGGCATCTCCCCAGTGCCCATCAACCTGCGGGTCTACTCGCCACATGTGCTGAACTTGACCCTCATTGACCTCCCGGGCATCACCAAGGTGCCCGTGGGGGACCAGCCCCCAGACATCGAGTACCAGATCAAGGACATGATCCTGCAGTTCATCAGCCGGGAGAGCAGCCTGATCCTGGCTGTGACGCCCGCCAACATGGACTTGGCCAACTCCGACGCCCTCAAGCTGGCCAAGGAGGTCGACCCCCAAGGCCTGCGGACCATCGGCGTCATCACCAAGCTCGACCTGATGGACGAGGGCACCGATGCCAGGGACGTCCTGGAGAACAAGCTGCTGCCCTTGCGGAGAGGCTATATCGGCGTGGTGAACCGCAGTCAGAAGGACATTGAGGGGAAGAAGGACATCCGTGCGGCGCTGGCGGCCGAGAGGAAGTTCTTCCTCTCCCACCCTGCGTACCGGCACATGGCCGACCGCATGGGCACCCCACATTTGCAGAAGACCCTGAATCAGCAACTGACCAACCACATCCGGGAGTCATTGCCCAACCTGCGCAGCAAGCTGCAGAGCCAGCTGCTGTCCCTGGAGAAGGAGGTGGAGGAGTACAAGAACTTCCGGCCCGACGACCCCACGCGCAAAACCAAAGCCCTGCTGCAGATGGTCCAGCAATTTGGGGTAGACTTTGAGAAGAGGATTGAGGGCTCTGGAGACCAAGTGGACACGCTGGAGCTCTCGGGGGGCGCCCGTATCAACCGCATCTTCCACGAGCGCTTTCCCTTCGAGCTGGTGAAGATGGAGTTTGATGAGAAGGACTTAAGACGGGAGATCAGCTATGCCATTAAGAACATCCATGGAGTCAGGACGGGGCTCTTCACCCCGGACATGGCCTTTGAAGCCATTGTGAAAAAACAGATTGTAAAACTCAAAGAGCCAAGCCTCAAGTGTGTTGACCTCGTGGTCTCAGAGCTGGCCACGGTCATTAAAAAGTGTGCCGAGAAGCTCTGCTCCTACCCCCGGTTGCGAGAGGAGACAGAGCGAATCGTCACCACATACATCCGGGAGCGAGAGGGGAGGACCAAGGACCAGATTCTTCTTCTGATCGACATCGAGCAGTCCTACATCAACACAAACCACGAAGATTTCATTGGATTTGCCAACGCCCAGCAGAGGAGCACGCAGCTGAATAAGAAGAGAGCCATCCCCAACCAGGTGATCCGAAGGGGCTGGCTGACCATCAACAACATCAGCCTCATGAAGGGCGGCTCCAAGGAATACTGGTTTGTGCTCACGGCCGAGTCGCTGTCCTGGTACAAGGATGAAGAGGAGAAAGAGAAGAAGTACATGCTGCCCCTGGACAACCTCAAGATCCGGGACGTCGAGAAGGGCTTCATGTCCAACAAGCATGTGTTCGCTATCTTCAATACAGAGCAGAGGAACGTCTACAAGGACCTGCGGCAGATCGAGCTGGCCTGTGACTCCCAGGAGGACGTGGACAGCTGGAAAGCGTCATTCCTGCGCGCCGGCGTCTACCCTGAGAAGGACCAGGCGGAGAACGAGGACGTGGGGCAGGACACCTTCTCCATGGACCCACAGCTGGAGCGGCAGGTGGAGACCATCCGCAACCTGGTGGACTCATACGTGGCCATCATTAACAAGTCCATCCGCGACCTCATGCCAAAGACCATCATGCACCTCATGATCAACAACACCAAGGCCTTCATCCACCATGAGCTGCTGGCCTACCTGTACTCGTCGGCTGACCAGAGCAGCCTCATGGAGGAGTCGGCTGACCAGGCACAGCGGCGGGATGACATGCTGCGCATGTATCACGCGCTCAAGGAGGCGCTCACCATCATCGGTGACATCAGCACCAGCACTGTGTCCACGCCCGTGCCCCCGCCTGTCGACGACACCTGGCTACAGACCACTGCCAGCCACAGCCCCACCCCACAGCGTCGACCTCTGTCCAGTGTGCACCCGCCTGGCCGGCCACCAGCAGTGCGGGGCCCCACTCCTGGGCCCCCCCTGATTCCCATGCCCGTGGGGGCTGCAGCCTCCTTCTCGGCGCCCCCCATCCCGTCCCGGCCTGGACCCCAAGTGTTTGCCAACAATGACCCCTTCTCAGCCCCGCCGCAGATCCCATCTCGGCCAGTGCGGGTACCTCCTGGCATCCCCCCAGGAGTCCCCAGCAGAAGACCCCCTGCCGCGCCCAGCCGGCCCACCATTATCCGGCCCACCGAGCCCTCGCTGCTCGACTAG

XM_004865541.1 Coding sequence

Tmed1 transmembrane emp24 protein transport domain containing 1

High confidence: 4 potential gene matches
Length: 681 bp    Location: 2808249..2805489   Strand: -
>XM_004865541.1
ATGGCGGCCCGCATGGCCCTAGCCCTGGCCCTATGGGTACTGTTGCCGCCAGCAGAGGTAGGAGGGGGAGGGCCCCCTCCGATCCAGGACGGCGAGTTCACGTTTCTGTTGCCCGCGGGGAGGAAGCAATGTTTCTACCAGTCCGCGCCTGCCAACGCAAGCCTCGAGGCCGAGTACCAGGTGATAGGAGGTGCCGGGCTGGACGTGGATTTCACACTGGAGAGCCCTCAGGGTGTGCTGTTGGTCAGTGAGGCCCGCAAGGCGGATGGGGTGCACACGGTGGAGCCTACAGAGGCCGGCGACTACAGGCTGTGCTTTGACAACTCCTTCAGCACCATCTCCGAGAAGCTGGTGTTCTTCGAGCTCATCTTTGACAGCCTCCAAGATGATGAGGAGGTGGAGGGCTGGGCAGAGGCTGTGGAACCTGAGGAGATGCTGGATGTCAAAATGGAGGACATCAAGGAATCCATTGAGACCATGAGGACCCGGCTGGAGCGCAGCATCCAGGTGCTCACACTGCTGCGAGCCCTGGAGGCACGTGACCGCAACCTGCAGGAGGGCAACCTGGAGCGGGTCAACTTTTGGTCCGCTGTCAACGTGGCCGTGCTGCTGCTGGTGGCCGTGCTGCAGGTCTGCACACTCAAGCGCTTCTTCCAGGACAAGCACCCCATGCCCACGTAG

XM_004865539.1 Coding sequence

LOC101698453 chromosome unknown open reading frame, human C19orf38, transcript variant X1

Length: 687 bp    Location: 2809294..2831578   Strand: +
>XM_004865539.1
ATGCCCTGGGCTGTCCTGCTCCTTGCAGCTGGCTCGTTGGCCATCCCAGCACCATCCATCTTCCTGGTACCCCCCTATCCAAGCAGCCAGGAGGACCCCATCCACATCTCGTGCATGGCGCCCATGGCTTTCCTGGGGGCGAACTTCACGCTGTACCGAGGGGGACACGTGGTGCAACTGCTGCAGGCCCCCGAGGACCAGGCTGGGGTCACGTTCAATGTGAGTGCCAGCATGGGCAGCGAGGTTCCCGGTGGGCAGTTCCGCTGCCAGTACAGCGTGATGGGCGAGCACAGCCAACAGCAGCTGTCGGACCTCAGCCAGCCAGTGCAGGTCTCCTTCCCAGTGCCCACTTGGATCCTGGCGCTCTCCCTCAGCCTGGCCGGAGCGTTCCTCCTCCTTGCTGTGCTGGTGGTCTTTGCTGTGGTGGCCAGGAAAGTTAAAGTCAAAAATTTACAGAAGAAACGAGAACGGGAATCGTGCTGGGCACAGGTTAACTACGCCAACACAGACATGTCCTTCGACAACTCCCTGTTTGCCATCTCCAAGGCAAAGAGGACGCCTTTGAAGGAAGACCCAGTGGCCACCCTGGATGCCTGCCCTGGCAGTGCTGGACCCCGGCAGAGGCCAACCTCCACGTCCTCCTCACCAGAGGCCCCTGAGTTCAGCACTTTCCGGGCCTGCCAGTGA

XM_004865540.1 Coding sequence

LOC101698453 chromosome unknown open reading frame, human C19orf38, transcript variant X2

Length: 681 bp    Location: 2817660..2831578   Strand: +
>XM_004865540.1
ATGCCCTGGGCTGTCCTGCTCCTTGCAGCTGGCTCGTTGGCCATCCCAGCACCATCCATCTTCCTGGTACCCCCCTATCCAAGCAGCCAGGAGGACCCCATCCACATCTCGTGCATGGCGCCCATGGCTTTCCTGGGGGCGAACTTCACGCTGTACCGAGGGGGACACGTGGTGCAACTGCTGCAGGCCCCCGAGGACCAGGCTGGGGTCACGTTCAATGTGAGTGCCAGCATGGGCAGCGAGGTTCCCGGTGGGCAGTTCCGCTGCCAGTACAGCGTGATGGGCGAGCACAGCCAACAGCAGCTGTCGGACCTCAGCCAGCCAGTGCAGGTCTCCTTCCCAGTGCCCACTTGGATCCTGGCGCTCTCCCTCAGCCTGGCCGGAGCGTTCCTCCTCCTTGCTGTGCTGGTGGTCTTTGCTGTGGTGGCCAGGAAAGTTAAAGTCAAAAATTTACAGAAGAAACGAGAACGGGAATCGTGCTGGGCACAGGTTAACTACGCCAACACAGACATGTCCTTCGACAACTCCCTGTTTGCCATCTCCAAGAGGACGCCTTTGAAGGAAGACCCAGTGGCCACCCTGGATGCCTGCCCTGGCAGTGCTGGACCCCGGCAGAGGCCAACCTCCACGTCCTCCTCACCAGAGGCCCCTGAGTTCAGCACTTTCCGGGCCTGCCAGTGA

XM_004866058.1 Coding sequence

Carm1 coactivator-associated arginine methyltransferase 1

High confidence: 4 potential gene matches
Length: 1809 bp    Location: 2833011..2872281   Strand: +
>XM_004866058.1
GCGGCGGTGGGGCCGGGCACAGGGGGCGCGGGCGCGGCGGGCCCGGGCGTTGCGGGGCCCTGCGGGGTGGTGTCCGTGTTCCCGGGCACCCGCCTCCTCACCATCGGCGACGCGAACGGCGAGATCCAGCGGCACGCGGAGCAGCAGGCGCTGCGCCTCGAGGTGCGCGCCGGCCCGGACGCGGCGGGCATCGCCATGTACAGCAATGAAGATGTGTGTGTGTTCAAGTGTTCTGTGTCCCGAGAGACAGAGTGCAGCCGCGTGGGCAAGCAGTCCTTCATCATCACGCTGGGCTGCAACAGCGTCCTCATCCAGTTCGCCACTCCCAATGATTTCTGTTCTTTCTACAACATCCTGAAGACGTGCCGGGGCCACACCCTGGAGCGGTCGGTGTTCAGTGAGCGCACAGAGGAGTCCTCGGCTGTGCAGTACTTCCAGTTTTACGGCTACCTGTCCCAGCAGCAGAACATGATGCAGGACTATGTGCGGACGGGGACCTACCAGCGTGCCATCCTGCAGAACCACACCGACTTCAAGGACAAAATCGTGCTTGATGTTGGCTGTGGCTCTGGGATCCTGTCGTTTTTTGCCGCCCAGGCTGGAGCCAGGAAAATCTATGCAGTGGAGGCCAGCACCATGGCCCAGCATGCCGAGGTCCTGGTGAAGAGCAACAACCTGACGGACCGCATCGTGGTCATCCCCGGCAAGGTGGAGGAGATCTCGCTCCCCGAGCAGGTGGACATCATCATCTCGGAGCCTATGGGCTACATGCTCTTCAATGAGCGCATGCTCGAGAGCTACCTCCATGCCAAGAAGTACCTGAAGCCCAGTGGAAACATGTTCCCTACAATTGGTGACGTCCACCTGGCACCCTTCACAGATGAACAGCTCTACATGGAGCAGTTCACCAAGGCCAACTTCTGGTACCAGCCGTCCTTCCATGGGGTGGACCTGTCGGCTCTCCGGGGCGCCGCCGTGGACGAGTATTTCCGGCAGCCTGTGGTGGACACATTTGACATCCGGATCCTGATGGCCAAGTCTGTCAAGTATACAGTGAACTTCTTAGAAGCCAAAGAAGGAGATTTGCACAGGATAGAAATCCCATTCAAATTCCACATGCTGCACTCGGGGCTGGTCCATGGCCTGGCTTTCTGGTTTGACGTCGCTTTCATCGGCTCCATAATGACTGTGTGGCTGTCCACGGCCCCCACGGAACCCTTGACCCACTGGTACCAGGTACGGTGTCTCTTCCAGTCACCACTCTTCGCCAAGGCCGGGGACACGCTCTCAGGGACATGTCTGCTCATTGCCAACAAGAGACAGAGCTACGACATCAGTATTGTGGCCCAGGTGGACCAGACAGGCTCCAAGTCCAGTAACCTGCTGGACCTGAAGAACCCCTTCTTCAGGTACACAGGCACAACACCCTCACCCCCGCCTGGCTCACACTACACGTCACCCTCGGAGAACATGTGGAACACAGGCAGCACCTACAACCTCAGCAGCGGCATGGCTGTGGCTGGGATGCCGACAGCCTACGACCTGAGCAGTGTTATTGCTGGCGGCTCCAGCGTGGGTCACAACAACCTGATTCCTTTAGCCAACACAGGGATTGTCAATCACACCCACTCGCGGATGGGCTCCATAATGAGCACGGGCATTGTCCAAGGCTCCTCAGGTGCCCAGGGTGGCGGCGGTGGCTCCAGCGCCCACTACGCGGTCAACAACCAGTTCACCATGGGTGGCCCGGCCATCTCCATGGCGTCACCCATGTCCATCCCGACCAACACCATGCACTATGGGAGCTAG

XM_004865543.1 Coding sequence

Yipf2 Yip1 domain family, member 2, transcript variant X2

Length: 939 bp    Location: 2875503..2871556   Strand: -
>XM_004865543.1
ATGGCAGCGGCTGACGATCTGGCCTTCCACGAATTCGAGGAAGCCACCAATCTTCTGGCTGAGACCCCAGATGCTGCTACCACCAGCAGAAGTGATCAGCTGACCTCCCTGGGCCACGTGGCTGTGGCAGCGGGCACTGGTAGCAGCTATGGAGCTGAGGACGAGGTGGAGAGCGACAAGACAGCGCTGCTGCAGGCGGAGAAGCCACAGCCTGGGTTCTGGACCTTCAGCTACTATCAGAGTTTCTTTGACGTGGACACCTCCCAGGTCCTGGATCGGATCAAAGGTGCACTGCTGCCCCGGCCTGGCCACAACTTTGTACGGCACCATTTGCGGAATCGTCCCGATCTGTATGGTCCCTTCTGGATCTGCGCCACCCTGGCCTTCGTCCTGGCTGTCACCGGCAACCTGACACTGGTGCTGGCCCAGAGGAGGGACCCCTCCATCCACTACAGCCCCCAATTCCACAAGGTGACCATGGCAGGGATCACCATCTATTGTTATGCATGGCTGGTGCCGCTGGTGCTGTGGGGCTTCCTGCGGTGGCGCCAGGGTGTGCAGGAGCGCGTGGATCCCTACAGCTTCCTGGAGACCGTGTGCGTGTACGGCTACTCACTCTTTATCTTCATCCCCATGGTGGTCCTATGGCTCATCCCTGTGCCGTGGCTGCAGTGGCTCTTTGGGGCGCTGGCCCTGGCCCTGTCCACGGCCGGGTTGGTGCTCACCCTCTGGCCCGTCATCCGCGAGGACACCAGGCTGGTGGCCGTGGCCCTGCTGTCCACTGTGGTGCTGCTCCACGCCCTCCTGGCCATGGGCTGTAAGCTCTATTTCTTCCAGCCGCTGCCTCTGGAGCAGGTGGCACCTCCAGCCCAAGTGACATCTTTAGCCCTGCACACACAGCTGCCTCCCACCCTGGCCCGGTCTATGGGCACCTCGTAG

XM_004865544.1 Coding sequence

Yipf2 Yip1 domain family, member 2, transcript variant X3

Length: 891 bp    Location: 2875503..2871556   Strand: -
>XM_004865544.1
ATGGCAGCGGCTGACGATCTGGCCTTCCACGAATTCGAGGAAGCCACCAATCTTCTGGCTGAGACCCCAGATGCTGCTACCACCAGCAGAAGTGATCAGCTGACCTCCCTGGGCCACGTGGCTGTGGCAGCGGGCACTGGTAGCAGCTATGGAGCTGAGGACGAGGTGGAGAGCGACAAGACAGCGCTGCTGCAGGCGGAGAAGCCACAGCCTGGGTTCTGGACCTTCAGCTACTATCAGAGTTTCTTTGACGTGGACACCTCCCAGGTCCTGGATCGGATCAAAGGTGCACTGCTGCCCCGGCCTGGCCACAACTTTGTACGGCACCATTTGCGGAATCGTCCCGATCTGTATGGTCCCTTCTGGATCTGCGCCACCCTGGCCTTCGTCCTGGCTGTCACCGGCAACCTGACACTGGTGCTGGCCCAGAGGAGGGACCCCTCCATCCACTACAGCCCCCAATTCCACAAGGTGACCATGGCAGGGATCACCATCTATTGTTATGCATGGCTGGTGCCGCTGGTGCTGTGGGGCTTCCTGCGGTGGCGCCAGGGTGTGCAGGAGCGCGTGGATCCCTACAGCTTCCTGGAGACCGTGTGCGTGTACGGCTACTCACTCTTTATCTTCATCCCCATGGTGGTCCTATGGCTCATCCCTGTGCCGTGGCTGCAGTGGCTCTTTGGGGCGCTGGCCCTGGCCCTGTCCACGGCCGGGTTGGTGCTCACCCTCTGGCCCGTCATCCGCGAGGACACCAGGCTGGTGGCCGTGGCCCTGCTGTCCACTGTGGTGCTGCTCCACGCCCTCCTGGCCATGGGCTGTAAGATATCTCTGCTCAGCTCTATTTCTTCCAGCCGCTGCCTCTGGAGCAGGTGGCACCTCCAGCCCAAGTGA

XM_004865542.1 Coding sequence

Yipf2 Yip1 domain family, member 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 1026 bp    Location: 2875503..2871556   Strand: -
>XM_004865542.1
ATGGCAGCGGCTGACGATCTGGCCTTCCACGAATTCGAGGAAGCCACCAATCTTCTGGCTGAGACCCCAGATGCTGCTACCACCAGCAGAAGTGATCAGCTGACCTCCCTGGGCCACGTGGCTGTGGCAGCGGGCACTGGTAGCAGCTATGGAGCTGAGGACGAGGTGGAGAGCGACAAGACAGCGCTGCTGCAGGCGGAGAAGCCACAGCCTGGGTTCTGGACCTTCAGCTACTATCAGAGTTTCTTTGACGTGGACACCTCCCAGGTCCTGGATCGGATCAAAGGTGCACTGCTGCCCCGGCCTGGCCACAACTTTGTACGGCACCATTTGCGGAATCGTCCCGATCTGTATGGTCCCTTCTGGATCTGCGCCACCCTGGCCTTCGTCCTGGCTGTCACCGGCAACCTGACACTGGTGCTGGCCCAGAGGAGGGACCCCTCCATCCACTACAGCCCCCAATTCCACAAGGTGACCATGGCAGGGATCACCATCTATTGTTATGCATGGCTGGTGCCGCTGGTGCTGTGGGGCTTCCTGCGGTGGCGCCAGGGTGTGCAGGAGCGCGTGGATCCCTACAGCTTCCTGGAGACCGTGTGCGTGTACGGCTACTCACTCTTTATCTTCATCCCCATGGTGGTCCTATGGCTCATCCCTGTGCCGTGGCTGCAGTGGCTCTTTGGGGCGCTGGCCCTGGCCCTGTCCACGGCCGGGTTGGTGCTCACCCTCTGGCCCGTCATCCGCGAGGACACCAGGCTGGTGGCCGTGGCCCTGCTGTCCACTGTGGTGCTGCTCCACGCCCTCCTGGCCATGGGCTGTAAGGTACAGGTCGGGATCGGGGTGGCCCCAGGCTGGGCCGTGGGTCGGGCTGGGCTGGCTGTTACACTGACCTCAGATATCTCTGCTCAGCTCTATTTCTTCCAGCCGCTGCCTCTGGAGCAGGTGGCACCTCCAGCCCAAGTGACATCTTTAGCCCTGCACACACAGCTGCCTCCCACCCTGGCCCGGTCTATGGGCACCTCGTAG

XM_004865549.1 Coding sequence

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4, transcript variant X4

Length: 4956 bp    Location: 2893096..2985968   Strand: +
>XM_004865549.1
ATGTCCACTCCAGACCCACCCCTGGGCGGAACTCCTCGGCCAGGCCCTTCCCCAGGCCCAGGCCCCTCACCTGGAGCCATGCTGGGCCCTAGCCCTGGCCCCTCACCGGGCTCAGCTCACAGCATGATGGGGCCTAGCCCCGGGCCTCCCTCAGCAGGACACCCCATCTCCACGCAGGGGCCTGGAGGGTACCCTCAGGACAACATGCACCAGATGCACAAGCCCATGGAGTCCCTGCATGAGAAGAGCATGTCGGAGGACCCACGCTACAACCAGATGAAGGGCATGGGGATGCGCTCGGGTGGCCACGCAGGCATGGGCCCCCCACCCAGCCCCATGGACCAGCACTCCCAAGGTTACCCCTCGCCCCTGGGCGGCTCCGAGCATGCCTCCAGTCCTGTTCCAGCCAGCGGCCCATCTTCGGGCCCCCAGATGTCGTCTGGGCCAGGAGGGGCCCCGCTGGACGGCACTGACCCCCAGGCCTTGGGGCAGCAGAGCCGGGGCCCCACCCCATTCAACCAGAACCAGCTGCACCAGCTTCGGGCACAGATCATGGCCTACAAGATGCTGGCCAGGGGACAGCCCCTGCCTGACCACCTGCAGATGGCCGTGCAGGGAAAGCGGCCCATGCCTGGGATGCAGCAGCAGATGCCCACGCTACCTCCGCCCTCTGTGTCTGCCACAGGGCCTGGGCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCGGGACCAGCACCTCCAAATTATAGCAGGCCTCATGGTATGGTAGGGCCCAACATGCCTCCCCCAGGACCCTCAGGTGTGCCCCCCGGGATGCCCGGCCAGCCCCCTGGAGGGCCTCCCAAGCCCTGGCCTGAAGGCCCCATGGTGAACGCTGCTGCTCCCACGAGCACCCCTCAGAAGCTGATCCCCCCACAGCCGACGGGCCGTCCTTCGCCCGCACCCCCTGCCGTCCCACCCGCTGCCTCGCCTGTGATGCCGCCCCAGACCCAGTCCCCGGGGCAGCCGGCCCAGCCTGCGCCCTTGGTGCCACTGCACCAGAAGCAGAGCCGCATCACTCCCATCCAGAAGCCCCGGGGCCTGGACCCCGTGGAGATCCTGCAGGAGCGCGAGTACAGGCTGCAGGCTCGCATCGCACACCGCATTCAGGAACTTGAAAATCTCCCCGGCTCCCTGGCTGGGGATCTGCGAACCAAAGCAACCATCGAGCTCAAGGCCCTCCGGCTGCTGAACTTCCAGCGGCAGCTGCGCCAGGAGGTGGTAGTGTGCATGCGCAGGGACACGGCCCTGGAGACAGCCCTCAATGCCAAGGCCTACAAGCGCAGCAAGCGGCAGTCCCTGCGTGAGGCCCGAATCACCGAGAAGCTGGAGAAGCAGCAGAAGATCGAGCAGGAGCGAAAGCGGCGCCAGAAGCACCAGGAATACCTCAATAGCATTCTTCAGCACGCCAAGGATTTCAAGGAATACCACAGATCCGTTACGGGAAAAATCCAGAAGCTGACCAAGGCGGTGGCCACGTACCATGCCAACACGGAGCGGGAGCAGAAGAAAGAAAACGAGCGCATCGAGAAGGAGAGGATGCGGAGGCTCATGGCGGAAGATGAAGAGGGTTACCGCAAGCTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACAGACGAGTATGTGGCCAACCTCACGGAGCTGGTGCGGCAGCACAAGGCCGCCCAGGTCGCCAAGGAGAAAAAGAAGAAGAAGAAGAAGAAGAAGGCAGAAAACGCTGAAGGACAGACGCCCGCGATCGGACCCGATGGCGAGCCTCTGGATGAGACCAGCCAGATGAGTGACCTCCCTGTGAAGGTGATCCACGTGGAGAGTGGCAAGATCCTCACAGGCACAGACGCCCCCAAAGCTGGGCAACTGGAGGCCTGGCTTGAGATGAACCCGGGGTATGAGGTGGCGCCGAGGTCTGATAGTGAAGAGAGCGGCTCAGAAGAAGAAGAGGAGGAGGAGGAGGAAGAGCAGCCACAGCCAGCACAGCCTCCCACCCTGCCTGTGGAGGAGAAGAAGAAGATCCCAGACCCTGACAGCGACGATGTCTCTGAGGTGGACGCACGGCACATCATTGAGAATGCCAAGCAAGACGTTGATGATGAGTATGGCGTGTCCCAGGCCCTTGCTCGCGGCCTGCAGTCCTACTATGCTGTGGCCCACGCTGTCACCGAGAGAGTGGACAAGCAGTCAGCACTCATGGTCAACGGCGTCCTCAAGCAGTACCAGATCAAAGGCTTGGAGTGGCTGGTGTCCCTGTACAACAACAACCTGAACGGCATCCTGGCTGACGAGATGGGCCTGGGGAAGACCATCCAGACCATCGCGCTCATCACATACCTCATGGAGCACAAGCGCATCAACGGGCCCTTCCTCATCATCGTGCCTCTCTCGACGCTGTCGAACTGGGCATACGAATTTGACAAGTGGGCCCCTTCCGTGGTGAAGGTGTCCTACAAGGGCTCTCCAGCAGCAAGACGAGCTTTCGTCCCCCAGCTCCGCAGTGGCAAGTTTAACGTCTTGCTGACGACCTACGAATACATCATCAAAGACAAGCACATCCTCGCCAAGATCCGCTGGAAGTACATGATCGTGGACGAGGGCCACCGCATGAAAAACCACCACTGCAAGCTGACGCAGGTGCTCAACACGCACTACGTGGCCCCACGTCGGCTGCTGCTCACGGGCACACCACTGCAGAACAAGCTGCCGGAGCTCTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTCAAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCACCCTTTGCCATGACAGGGGAGAAGGTGGACCTGAACGAAGAGGAAACCATCCTCATCATCCGTCGTTTGCACAAAGTGCTGCGGCCCTTCCTGCTCCGGCGGCTCAAGAAGGAAGTCGAGGCCCAGCTGCCTGAGAAGGTGGAGTATGTCATCAAGTGCGACATGTCTGCGCTCCAGCGCGTGCTCTACCGGCACATGCAGGCCAAGGGGGTGCTGCTCACTGACGGCTCTGAGAAGGACAAGAAGGGCAAAGGTGGCACCAAGACCCTGATGAACACCATCATGCAGCTAAGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATTGAGGAGTCCTTCTCTGAACACTTGGGCTTCACCGGCGGCATCGTGCAAGGGCTGGACCTGTATCGAGCCTCAGGCAAATTTGAGCTTCTCGATAGAATCCTCCCCAAACTTCGTGCCACCAACCACAAAGTGCTACTGTTCTGCCAGATGACCTCCCTCATGACGATCATGGAAGATTACTTTGCGTATCGCGGCTTTAAATACCTCAGGCTGGACGGAACCACAAAGGCGGAGGACCGGGGCATGCTGCTCAAGACCTTCAACGAGCCCGGCTCCGAGTACTTCATCTTCCTGCTCAGCACCCGCGCTGGTGGGCTGGGCCTCAACCTGCAGTCAGCAGACACTGTGATCATCTTCGACAGCGACTGGAACCCTCACCAGGACCTGCAAGCGCAAGACCGGGCACACCGCATTGGGCAGCAGAACGAGGTGCGCGTGCTCCGCCTCTGCACCGTGAACAGTGTGGAGGAGAAGATCCTGGCGGCTGCCAAGTACAAGCTCAACGTGGACCAGAAAGTGATCCAGGCGGGCATGTTTGACCAGAAGTCGTCCAGCCACGAGCGGCGCGCCTTCCTGCAGGCCATCCTGGAGCACGAGGAGCAGGACGAGAGCAGACACTGCAGCACGGGCAGCGGCAGTGCCAGCTTCGCCCACACGGCCCCTCCGCCAGCGGGCGTCACCCCCGACTTGGAGGAGCCACCTCTAAAGGAGGAAGACGAGGTGCCTGATGATGAGACGGTCAACCAGATGATTGCCCGGCACGAGGAGGAGTTCGACTTGTTCATGCGCATGGACCTGGACCGCCGGCGTGAAGAGGCTCGCAACCCCAAACGGAAGCCTCGTCTCATGGAGGAGGACGAGCTCCCATCCTGGATCATCAAGGATGATGCGGAGGTGGAGCGGCTGACGTGTGAGGAGGAGGAGGAGAAAATGTTTGGGCGTGGCTCCCGCCACCGCAAGGAGGTGGACTACAGCGACTCGCTGACAGAGAAGCAGTGGCTCAAGGCCATCGAGGAGGGCACGTTGGAGGAGATCGAAGAGGAGGTCCGGCAGAAGAAATCCTCGCGAAAGCGCAAGCGGGACAGCGATGCCGGCTCCTCGACACCGACCACCAGCACCCGCAGCCGCGACAAGGACGACGAGAGCAAGAAGCAGAAGAAGCGTGGACGGCCGCCCGCTGAGAAGCTCTCCCCAAACCCGCCCAACCTCACCAAGAAGATGAAGAAGATCGTGGACGCCGTGATCAAGTACAAGGACAGTAGCAGTGGACGGCAGCTCAGTGAGGTATTCATCCAGTTGCCCTCCCGCAAGGAGCTGCCTGAGTACTACGAGCTCATCCGCAAGCCTGTGGACTTCAAGAAGATCAAGGAGCGCATCCGCAACCACAAGTACCGTAGCCTCAACGACCTCGAAAAGGACGTGATGCTGCTCTGCCAGAACGCGCAGACCTTCAACCTGGAGGGCTCGCTGATCTACGAGGACTCCATCGTGCTGCAGTCGGTCTTCACCAGTGTCCGGCAGAAGATCGAGAAGGAGGAGGACAGTGAGGGCGAAGAGAGCGAGGAGGAGGAGGAAGCCGAGGAGGAGGGCTCGGAGTCCGAGTCCCGCTCTGTCAAGGTGAAGATTAAGCTGGGCCGCAAGGAGAAGGCCCAGGACCGGCTCAAGGGCAGCCGCCGCAGGCCCAGCCGAGGGTCCCGGGCCAAGCCGGTCGTGAGCGACGACGACAGTGAGGAGGAGCAGGAGGAGGACCGCTCAGGAAGTGGCAGCGAGGAGGACTGA

XM_004865550.1 Coding sequence

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4, transcript variant X5

Length: 4857 bp    Location: 2893096..2985968   Strand: +
>XM_004865550.1
ATGTCCACTCCAGACCCACCCCTGGGCGGAACTCCTCGGCCAGGCCCTTCCCCAGGCCCAGGCCCCTCACCTGGAGCCATGCTGGGCCCTAGCCCTGGCCCCTCACCGGGCTCAGCTCACAGCATGATGGGGCCTAGCCCCGGGCCTCCCTCAGCAGGACACCCCATCTCCACGCAGGGGCCTGGAGGGTACCCTCAGGACAACATGCACCAGATGCACAAGCCCATGGAGTCCCTGCATGAGAAGAGCATGTCGGAGGACCCACGCTACAACCAGATGAAGGGCATGGGGATGCGCTCGGGTGGCCACGCAGGCATGGGCCCCCCACCCAGCCCCATGGACCAGCACTCCCAAGGTTACCCCTCGCCCCTGGGCGGCTCCGAGCATGCCTCCAGTCCTGTTCCAGCCAGCGGCCCATCTTCGGGCCCCCAGATGTCGTCTGGGCCAGGAGGGGCCCCGCTGGACGGCACTGACCCCCAGGCCTTGGGGCAGCAGAGCCGGGGCCCCACCCCATTCAACCAGAACCAGCTGCACCAGCTTCGGGCACAGATCATGGCCTACAAGATGCTGGCCAGGGGACAGCCCCTGCCTGACCACCTGCAGATGGCCGTGCAGGGAAAGCGGCCCATGCCTGGGATGCAGCAGCAGATGCCCACGCTACCTCCGCCCTCTGTGTCTGCCACAGGGCCTGGGCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCGGGACCAGCACCTCCAAATTATAGCAGGCCTCATGGTATGGTAGGGCCCAACATGCCTCCCCCAGGACCCTCAGGTGTGCCCCCCGGGATGCCCGGCCAGCCCCCTGGAGGGCCTCCCAAGCCCTGGCCTGAAGGCCCCATGGTGAACGCTGCTGCTCCCACGAGCACCCCTCAGAAGCTGATCCCCCCACAGCCGACGGGCCGTCCTTCGCCCGCACCCCCTGCCGTCCCACCCGCTGCCTCGCCTGTGATGCCGCCCCAGACCCAGTCCCCGGGGCAGCCGGCCCAGCCTGCGCCCTTGGTGCCACTGCACCAGAAGCAGAGCCGCATCACTCCCATCCAGAAGCCCCGGGGCCTGGACCCCGTGGAGATCCTGCAGGAGCGCGAGTACAGGCTGCAGGCTCGCATCGCACACCGCATTCAGGAACTTGAAAATCTCCCCGGCTCCCTGGCTGGGGATCTGCGAACCAAAGCAACCATCGAGCTCAAGGCCCTCCGGCTGCTGAACTTCCAGCGGCAGCTGCGCCAGGAGGTGGTAGTGTGCATGCGCAGGGACACGGCCCTGGAGACAGCCCTCAATGCCAAGGCCTACAAGCGCAGCAAGCGGCAGTCCCTGCGTGAGGCCCGAATCACCGAGAAGCTGGAGAAGCAGCAGAAGATCGAGCAGGAGCGAAAGCGGCGCCAGAAGCACCAGGAATACCTCAATAGCATTCTTCAGCACGCCAAGGATTTCAAGGAATACCACAGATCCGTTACGGGAAAAATCCAGAAGCTGACCAAGGCGGTGGCCACGTACCATGCCAACACGGAGCGGGAGCAGAAGAAAGAAAACGAGCGCATCGAGAAGGAGAGGATGCGGAGGCTCATGGCGGAAGATGAAGAGGGTTACCGCAAGCTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACAGACGAGTATGTGGCCAACCTCACGGAGCTGGTGCGGCAGCACAAGGCCGCCCAGGTCGCCAAGGAGAAAAAGAAGAAGAAGAAGAAGAAGAAGGCAGAAAACGCTGAAGGACAGACGCCCGCGATCGGACCCGATGGCGAGCCTCTGGATGAGACCAGCCAGATGAGTGACCTCCCTGTGAAGGTGATCCACGTGGAGAGTGGCAAGATCCTCACAGGCACAGACGCCCCCAAAGCTGGGCAACTGGAGGCCTGGCTTGAGATGAACCCGGGGTATGAGGTGGCGCCGAGGTCTGATAGTGAAGAGAGCGGCTCAGAAGAAGAAGAGGAGGAGGAGGAGGAAGAGCAGCCACAGCCAGCACAGCCTCCCACCCTGCCTGTGGAGGAGAAGAAGAAGATCCCAGACCCTGACAGCGACGATGTCTCTGAGGTGGACGCACGGCACATCATTGAGAATGCCAAGCAAGACGTTGATGATGAGTATGGCGTGTCCCAGGCCCTTGCTCGCGGCCTGCAGTCCTACTATGCTGTGGCCCACGCTGTCACCGAGAGAGTGGACAAGCAGTCAGCACTCATGGTCAACGGCGTCCTCAAGCAGTACCAGATCAAAGGCTTGGAGTGGCTGGTGTCCCTGTACAACAACAACCTGAACGGCATCCTGGCTGACGAGATGGGCCTGGGGAAGACCATCCAGACCATCGCGCTCATCACATACCTCATGGAGCACAAGCGCATCAACGGGCCCTTCCTCATCATCGTGCCTCTCTCGACGCTGTCGAACTGGGCATACGAATTTGACAAGTGGGCCCCTTCCGTGGTGAAGGTGTCCTACAAGGGCTCTCCAGCAGCAAGACGAGCTTTCGTCCCCCAGCTCCGCAGTGGCAAGTTTAACGTCTTGCTGACGACCTACGAATACATCATCAAAGACAAGCACATCCTCGCCAAGATCCGCTGGAAGTACATGATCGTGGACGAGGGCCACCGCATGAAAAACCACCACTGCAAGCTGACGCAGGTGCTCAACACGCACTACGTGGCCCCACGTCGGCTGCTGCTCACGGGCACACCACTGCAGAACAAGCTGCCGGAGCTCTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTCAAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCACCCTTTGCCATGACAGGGGAGAAGGTGGACCTGAACGAAGAGGAAACCATCCTCATCATCCGTCGTTTGCACAAAGTGCTGCGGCCCTTCCTGCTCCGGCGGCTCAAGAAGGAAGTCGAGGCCCAGCTGCCTGAGAAGGTGGAGTATGTCATCAAGTGCGACATGTCTGCGCTCCAGCGCGTGCTCTACCGGCACATGCAGGCCAAGGGGGTGCTGCTCACTGACGGCTCTGAGAAGGACAAGAAGGGCAAAGGTGGCACCAAGACCCTGATGAACACCATCATGCAGCTAAGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATTGAGGAGTCCTTCTCTGAACACTTGGGCTTCACCGGCGGCATCGTGCAAGGGCTGGACCTGTATCGAGCCTCAGGCAAATTTGAGCTTCTCGATAGAATCCTCCCCAAACTTCGTGCCACCAACCACAAAGTGCTACTGTTCTGCCAGATGACCTCCCTCATGACGATCATGGAAGATTACTTTGCGTATCGCGGCTTTAAATACCTCAGGCTGGACGGAACCACAAAGGCGGAGGACCGGGGCATGCTGCTCAAGACCTTCAACGAGCCCGGCTCCGAGTACTTCATCTTCCTGCTCAGCACCCGCGCTGGTGGGCTGGGCCTCAACCTGCAGTCAGCAGACACTGTGATCATCTTCGACAGCGACTGGAACCCTCACCAGGACCTGCAAGCGCAAGACCGGGCACACCGCATTGGGCAGCAGAACGAGGTGCGCGTGCTCCGCCTCTGCACCGTGAACAGTGTGGAGGAGAAGATCCTGGCGGCTGCCAAGTACAAGCTCAACGTGGACCAGAAAGTGATCCAGGCGGGCATGTTTGACCAGAAGTCGTCCAGCCACGAGCGGCGCGCCTTCCTGCAGGCCATCCTGGAGCACGAGGAGCAGGACGAGGAGGAAGACGAGGTGCCTGATGATGAGACGGTCAACCAGATGATTGCCCGGCACGAGGAGGAGTTCGACTTGTTCATGCGCATGGACCTGGACCGCCGGCGTGAAGAGGCTCGCAACCCCAAACGGAAGCCTCGTCTCATGGAGGAGGACGAGCTCCCATCCTGGATCATCAAGGATGATGCGGAGGTGGAGCGGCTGACGTGTGAGGAGGAGGAGGAGAAAATGTTTGGGCGTGGCTCCCGCCACCGCAAGGAGGTGGACTACAGCGACTCGCTGACAGAGAAGCAGTGGCTCAAGGCCATCGAGGAGGGCACGTTGGAGGAGATCGAAGAGGAGGTCCGGCAGAAGAAATCCTCGCGAAAGCGCAAGCGGGACAGCGATGCCGGCTCCTCGACACCGACCACCAGCACCCGCAGCCGCGACAAGGACGACGAGAGCAAGAAGCAGAAGAAGCGTGGACGGCCGCCCGCTGAGAAGCTCTCCCCAAACCCGCCCAACCTCACCAAGAAGATGAAGAAGATCGTGGACGCCGTGATCAAGTACAAGGACAGTAGCAGTGGACGGCAGCTCAGTGAGGTATTCATCCAGTTGCCCTCCCGCAAGGAGCTGCCTGAGTACTACGAGCTCATCCGCAAGCCTGTGGACTTCAAGAAGATCAAGGAGCGCATCCGCAACCACAAGTACCGTAGCCTCAACGACCTCGAAAAGGACGTGATGCTGCTCTGCCAGAACGCGCAGACCTTCAACCTGGAGGGCTCGCTGATCTACGAGGACTCCATCGTGCTGCAGTCGGTCTTCACCAGTGTCCGGCAGAAGATCGAGAAGGAGGAGGACAGTGAGGGCGAAGAGAGCGAGGAGGAGGAGGAAGCCGAGGAGGAGGGCTCGGAGTCCGAGTCCCGCTCTGTCAAGGTGAAGATTAAGCTGGGCCGCAAGGAGAAGGCCCAGGACCGGCTCAAGGGCAGCCGCCGCAGGCCCAGCCGAGGGTCCCGGGCCAAGCCGGTCGTGAGCGACGACGACAGTGAGGAGGAGCAGGAGGAGGACCGCTCAGGAAGTGGCAGCGAGGAGGACTGA

XM_004865551.1 Coding sequence

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4, transcript variant X6

Length: 4854 bp    Location: 2893096..2985968   Strand: +
>XM_004865551.1
ATGTCCACTCCAGACCCACCCCTGGGCGGAACTCCTCGGCCAGGCCCTTCCCCAGGCCCAGGCCCCTCACCTGGAGCCATGCTGGGCCCTAGCCCTGGCCCCTCACCGGGCTCAGCTCACAGCATGATGGGGCCTAGCCCCGGGCCTCCCTCAGCAGGACACCCCATCTCCACGCAGGGGCCTGGAGGGTACCCTCAGGACAACATGCACCAGATGCACAAGCCCATGGAGTCCCTGCATGAGAAGAGCATGTCGGAGGACCCACGCTACAACCAGATGAAGGGCATGGGGATGCGCTCGGGTGGCCACGCAGGCATGGGCCCCCCACCCAGCCCCATGGACCAGCACTCCCAAGGTTACCCCTCGCCCCTGGGCGGCTCCGAGCATGCCTCCAGTCCTGTTCCAGCCAGCGGCCCATCTTCGGGCCCCCAGATGTCGTCTGGGCCAGGAGGGGCCCCGCTGGACGGCACTGACCCCCAGGCCTTGGGGCAGCAGAGCCGGGGCCCCACCCCATTCAACCAGAACCAGCTGCACCAGCTTCGGGCACAGATCATGGCCTACAAGATGCTGGCCAGGGGACAGCCCCTGCCTGACCACCTGCAGATGGCCGTGCAGGGAAAGCGGCCCATGCCTGGGATGCAGCAGCAGATGCCCACGCTACCTCCGCCCTCTGTGTCTGCCACAGGGCCTGGGCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCGGGACCAGCACCTCCAAATTATAGCAGGCCTCATGGTATGGTAGGGCCCAACATGCCTCCCCCAGGACCCTCAGGTGTGCCCCCCGGGATGCCCGGCCAGCCCCCTGGAGGGCCTCCCAAGCCCTGGCCTGAAGGCCCCATGGTGAACGCTGCTGCTCCCACGAGCACCCCTCAGAAGCTGATCCCCCCACAGCCGACGGGCCGTCCTTCGCCCGCACCCCCTGCCGTCCCACCCGCTGCCTCGCCTGTGATGCCGCCCCAGACCCAGTCCCCGGGGCAGCCGGCCCAGCCTGCGCCCTTGGTGCCACTGCACCAGAAGCAGAGCCGCATCACTCCCATCCAGAAGCCCCGGGGCCTGGACCCCGTGGAGATCCTGCAGGAGCGCGAGTACAGGCTGCAGGCTCGCATCGCACACCGCATTCAGGAACTTGAAAATCTCCCCGGCTCCCTGGCTGGGGATCTGCGAACCAAAGCAACCATCGAGCTCAAGGCCCTCCGGCTGCTGAACTTCCAGCGGCAGCTGCGCCAGGAGGTGGTAGTGTGCATGCGCAGGGACACGGCCCTGGAGACAGCCCTCAATGCCAAGGCCTACAAGCGCAGCAAGCGGCAGTCCCTGCGTGAGGCCCGAATCACCGAGAAGCTGGAGAAGCAGCAGAAGATCGAGCAGGAGCGAAAGCGGCGCCAGAAGCACCAGGAATACCTCAATAGCATTCTTCAGCACGCCAAGGATTTCAAGGAATACCACAGATCCGTTACGGGAAAAATCCAGAAGCTGACCAAGGCGGTGGCCACGTACCATGCCAACACGGAGCGGGAGCAGAAGAAAGAAAACGAGCGCATCGAGAAGGAGAGGATGCGGAGGCTCATGGCGGAAGATGAAGAGGGTTACCGCAAGCTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACAGACGAGTATGTGGCCAACCTCACGGAGCTGGTGCGGCAGCACAAGGCCGCCCAGGTCGCCAAGGAGAAAAAGAAGAAGAAGAAGAAGAAGAAGGCAGAAAACGCTGAAGGACAGACGCCCGCGATCGGACCCGATGGCGAGCCTCTGGATGAGACCAGCCAGATGAGTGACCTCCCTGTGAAGGTGATCCACGTGGAGAGTGGCAAGATCCTCACAGGCACAGACGCCCCCAAAGCTGGGCAACTGGAGGCCTGGCTTGAGATGAACCCGGGGTATGAGGTGGCGCCGAGGTCTGATAGTGAAGAGAGCGGCTCAGAAGAAGAAGAGGAGGAGGAGGAGGAAGAGCAGCCACAGCCAGCACAGCCTCCCACCCTGCCTGTGGAGGAGAAGAAGAAGATCCCAGACCCTGACAGCGACGATGTCTCTGAGGTGGACGCACGGCACATCATTGAGAATGCCAAGCAAGACGTTGATGATGAGTATGGCGTGTCCCAGGCCCTTGCTCGCGGCCTGCAGTCCTACTATGCTGTGGCCCACGCTGTCACCGAGAGAGTGGACAAGCAGTCAGCACTCATGGTCAACGGCGTCCTCAAGCAGTACCAGATCAAAGGCTTGGAGTGGCTGGTGTCCCTGTACAACAACAACCTGAACGGCATCCTGGCTGACGAGATGGGCCTGGGGAAGACCATCCAGACCATCGCGCTCATCACATACCTCATGGAGCACAAGCGCATCAACGGGCCCTTCCTCATCATCGTGCCTCTCTCGACGCTGTCGAACTGGGCATACGAATTTGACAAGTGGGCCCCTTCCGTGGTGAAGGTGTCCTACAAGGGCTCTCCAGCAGCAAGACGAGCTTTCGTCCCCCAGCTCCGCAGTGGCAAGTTTAACGTCTTGCTGACGACCTACGAATACATCATCAAAGACAAGCACATCCTCGCCAAGATCCGCTGGAAGTACATGATCGTGGACGAGGGCCACCGCATGAAAAACCACCACTGCAAGCTGACGCAGGTGCTCAACACGCACTACGTGGCCCCACGTCGGCTGCTGCTCACGGGCACACCACTGCAGAACAAGCTGCCGGAGCTCTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTCAAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCACCCTTTGCCATGACAGGGGAGAAGGTGGACCTGAACGAAGAGGAAACCATCCTCATCATCCGTCGTTTGCACAAAGTGCTGCGGCCCTTCCTGCTCCGGCGGCTCAAGAAGGAAGTCGAGGCCCAGCTGCCTGAGAAGGTGGAGTATGTCATCAAGTGCGACATGTCTGCGCTCCAGCGCGTGCTCTACCGGCACATGCAGGCCAAGGGGGTGCTGCTCACTGACGGCTCTGAGAAGGACAAGAAGGGCAAAGGTGGCACCAAGACCCTGATGAACACCATCATGCAGCTAAGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATTGAGGAGTCCTTCTCTGAACACTTGGGCTTCACCGGCGGCATCGTGCAAGGGCTGGACCTGTATCGAGCCTCAGGCAAATTTGAGCTTCTCGATAGAATCCTCCCCAAACTTCGTGCCACCAACCACAAAGTGCTACTGTTCTGCCAGATGACCTCCCTCATGACGATCATGGAAGATTACTTTGCGTATCGCGGCTTTAAATACCTCAGGCTGGACGGAACCACAAAGGCGGAGGACCGGGGCATGCTGCTCAAGACCTTCAACGAGCCCGGCTCCGAGTACTTCATCTTCCTGCTCAGCACCCGCGCTGGTGGGCTGGGCCTCAACCTGCAGTCAGCAGACACTGTGATCATCTTCGACAGCGACTGGAACCCTCACCAGGACCTGCAAGCGCAAGACCGGGCACACCGCATTGGGCAGCAGAACGAGGTGCGCGTGCTCCGCCTCTGCACCGTGAACAGTGTGGAGGAGAAGATCCTGGCGGCTGCCAAGTACAAGCTCAACGTGGACCAGAAAGTGATCCAGGCGGGCATGTTTGACCAGAAGTCGTCCAGCCACGAGCGGCGCGCCTTCCTGCAGGCCATCCTGGAGCACGAGGAGCAGGACGAGGAGGAAGACGAGGTGCCTGATGATGAGACGGTCAACCAGATGATTGCCCGGCACGAGGAGGAGTTCGACTTGTTCATGCGCATGGACCTGGACCGCCGGCGTGAAGAGGCTCGCAACCCCAAACGGAAGCCTCGTCTCATGGAGGAGGACGAGCTCCCATCCTGGATCATCAAGGATGATGCGGAGGTGGAGCGGCTGACGTGTGAGGAGGAGGAGGAGAAAATGTTTGGGCGTGGCTCCCGCCACCGCAAGGAGGTGGACTACAGCGACTCGCTGACAGAGAAGCAGTGGCTCAAGGCCATCGAGGAGGGCACGTTGGAGGAGATCGAAGAGGAGGTCCGGCAGAAGAAATCCTCGCGAAAGCGCAAGCGGGACAGCGATGCCGGCTCCTCGACACCGACCACCAGCACCCGCAGCCGCGACAAGGACGACGAGAGCAAGAAGCAGAAGAAGCGTGGACGGCCGCCCGCTGAGAAGCTCTCCCCAAACCCGCCCAACCTCACCAAGAAGATGAAGAAGATCGTGGACGCCGTGATCAAGTACAAGGACAGCAGTGGACGGCAGCTCAGTGAGGTATTCATCCAGTTGCCCTCCCGCAAGGAGCTGCCTGAGTACTACGAGCTCATCCGCAAGCCTGTGGACTTCAAGAAGATCAAGGAGCGCATCCGCAACCACAAGTACCGTAGCCTCAACGACCTCGAAAAGGACGTGATGCTGCTCTGCCAGAACGCGCAGACCTTCAACCTGGAGGGCTCGCTGATCTACGAGGACTCCATCGTGCTGCAGTCGGTCTTCACCAGTGTCCGGCAGAAGATCGAGAAGGAGGAGGACAGTGAGGGCGAAGAGAGCGAGGAGGAGGAGGAAGCCGAGGAGGAGGGCTCGGAGTCCGAGTCCCGCTCTGTCAAGGTGAAGATTAAGCTGGGCCGCAAGGAGAAGGCCCAGGACCGGCTCAAGGGCAGCCGCCGCAGGCCCAGCCGAGGGTCCCGGGCCAAGCCGGTCGTGAGCGACGACGACAGTGAGGAGGAGCAGGAGGAGGACCGCTCAGGAAGTGGCAGCGAGGAGGACTGA

XM_004865552.1 Coding sequence

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4, transcript variant X7

Length: 4866 bp    Location: 2893096..2985968   Strand: +
>XM_004865552.1
ATGTCCACTCCAGACCCACCCCTGGGCGGAACTCCTCGGCCAGGCCCTTCCCCAGGCCCAGGCCCCTCACCTGGAGCCATGCTGGGCCCTAGCCCTGGCCCCTCACCGGGCTCAGCTCACAGCATGATGGGGCCTAGCCCCGGGCCTCCCTCAGCAGGACACCCCATCTCCACGCAGGGGCCTGGAGGGTACCCTCAGGACAACATGCACCAGATGCACAAGCCCATGGAGTCCCTGCATGAGAAGAGCATGTCGGAGGACCCACGCTACAACCAGATGAAGGGCATGGGGATGCGCTCGGGTGGCCACGCAGGCATGGGCCCCCCACCCAGCCCCATGGACCAGCACTCCCAAGGTTACCCCTCGCCCCTGGGCGGCTCCGAGCATGCCTCCAGTCCTGTTCCAGCCAGCGGCCCATCTTCGGGCCCCCAGATGTCGTCTGGGCCAGGAGGGGCCCCGCTGGACGGCACTGACCCCCAGGCCTTGGGGCAGCAGAGCCGGGGCCCCACCCCATTCAACCAGAACCAGCTGCACCAGCTTCGGGCACAGATCATGGCCTACAAGATGCTGGCCAGGGGACAGCCCCTGCCTGACCACCTGCAGATGGCCGTGCAGGGAAAGCGGCCCATGCCTGGGATGCAGCAGCAGATGCCCACGCTACCTCCGCCCTCTGTGTCTGCCACAGGGCCTGGGCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCGGGACCAGCACCTCCAAATTATAGCAGGCCTCATGGTATGGTAGGGCCCAACATGCCTCCCCCAGGACCCTCAGGTGTGCCCCCCGGGATGCCCGGCCAGCCCCCTGGAGGGCCTCCCAAGCCCTGGCCTGAAGGCCCCATGGTGAACGCTGCTGCTCCCACGAGCACCCCTCAGAAGCTGATCCCCCCACAGCCGACGGGCCGTCCTTCGCCCGCACCCCCTGCCGTCCCACCCGCTGCCTCGCCTGTGATGCCGCCCCAGACCCAGTCCCCGGGGCAGCCGGCCCAGCCTGCGCCCTTGGTGCCACTGCACCAGAAGCAGAGCCGCATCACTCCCATCCAGAAGCCCCGGGGCCTGGACCCCGTGGAGATCCTGCAGGAGCGCGAGTACAGGCTGCAGGCTCGCATCGCACACCGCATTCAGGAACTTGAAAATCTCCCCGGCTCCCTGGCTGGGGATCTGCGAACCAAAGCAACCATCGAGCTCAAGGCCCTCCGGCTGCTGAACTTCCAGCGGCAGCTGCGCCAGGAGGTGGTAGTGTGCATGCGCAGGGACACGGCCCTGGAGACAGCCCTCAATGCCAAGGCCTACAAGCGCAGCAAGCGGCAGTCCCTGCGTGAGGCCCGAATCACCGAGAAGCTGGAGAAGCAGCAGAAGATCGAGCAGGAGCGAAAGCGGCGCCAGAAGCACCAGGAATACCTCAATAGCATTCTTCAGCACGCCAAGGATTTCAAGGAATACCACAGATCCGTTACGGGAAAAATCCAGAAGCTGACCAAGGCGGTGGCCACGTACCATGCCAACACGGAGCGGGAGCAGAAGAAAGAAAACGAGCGCATCGAGAAGGAGAGGATGCGGAGGCTCATGGCGGAAGATGAAGAGGGTTACCGCAAGCTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACAGACGAGTATGTGGCCAACCTCACGGAGCTGGTGCGGCAGCACAAGGCCGCCCAGGTCGCCAAGGAGAAAAAGAAGAAGAAGAAGAAGAAGAAGGCAGAAAACGCTGAAGGACAGACGCCCGCGATCGGACCCGATGGCGAGCCTCTGGATGAGACCAGCCAGATGAGTGACCTCCCTGTGAAGGTGATCCACGTGGAGAGTGGCAAGATCCTCACAGGCACAGACGCCCCCAAAGCTGGGCAACTGGAGGCCTGGCTTGAGATGAACCCGGGGTATGAGGTGGCGCCGAGGTCTGATAGTGAAGAGAGCGGCTCAGAAGAAGAAGAGGAGGAGGAGGAGGAAGAGCAGCCACAGCCAGCACAGCCTCCCACCCTGCCTGTGGAGGAGAAGAAGAAGATCCCAGACCCTGACAGCGACGATGTCTCTGAGGTGGACGCACGGCACATCATTGAGAATGCCAAGCAAGACGTTGATGATGAGTATGGCGTGTCCCAGGCCCTTGCTCGCGGCCTGCAGTCCTACTATGCTGTGGCCCACGCTGTCACCGAGAGAGTGGACAAGCAGTCAGCACTCATGGTCAACGGCGTCCTCAAGCAGTACCAGATCAAAGGCTTGGAGTGGCTGGTGTCCCTGTACAACAACAACCTGAACGGCATCCTGGCTGACGAGATGGGCCTGGGGAAGACCATCCAGACCATCGCGCTCATCACATACCTCATGGAGCACAAGCGCATCAACGGGCCCTTCCTCATCATCGTGCCTCTCTCGACGCTGTCGAACTGGGCATACGAATTTGACAAGTGGGCCCCTTCCGTGGTGAAGGTGTCCTACAAGGGCTCTCCAGCAGCAAGACGAGCTTTCGTCCCCCAGCTCCGCAGTGGCAAGTTTAACGTCTTGCTGACGACCTACGAATACATCATCAAAGACAAGCACATCCTCGCCAAGATCCGCTGGAAGTACATGATCGTGGACGAGGGCCACCGCATGAAAAACCACCACTGCAAGCTGACGCAGGTGCTCAACACGCACTACGTGGCCCCACGTCGGCTGCTGCTCACGGGCACACCACTGCAGAACAAGCTGCCGGAGCTCTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTCAAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCACCCTTTGCCATGACAGGGGAGAAGGTGGACCTGAACGAAGAGGAAACCATCCTCATCATCCGTCGTTTGCACAAAGTGCTGCGGCCCTTCCTGCTCCGGCGGCTCAAGAAGGAAGTCGAGGCCCAGCTGCCTGAGAAGGTGGAGTATGTCATCAAGTGCGACATGTCTGCGCTCCAGCGCGTGCTCTACCGGCACATGCAGGCCAAGGGGGTGCTGCTCACTGACGGCTCTGAGAAGGACAAGAAGGGCAAAGGTGGCACCAAGACCCTGATGAACACCATCATGCAGCTAAGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATTGAGGAGTCCTTCTCTGAACACTTGGGCTTCACCGGCGGCATCGTGCAAGGGCTGGACCTGTATCGAGCCTCAGGCAAATTTGAGCTTCTCGATAGAATCCTCCCCAAACTTCGTGCCACCAACCACAAAGTGCTACTGTTCTGCCAGATGACCTCCCTCATGACGATCATGGAAGATTACTTTGCGTATCGCGGCTTTAAATACCTCAGGCTGGACGGAACCACAAAGGCGGAGGACCGGGGCATGCTGCTCAAGACCTTCAACGAGCCCGGCTCCGAGTACTTCATCTTCCTGCTCAGCACCCGCGCTGGTGGGCTGGGCCTCAACCTGCAGTCAGCAGACACTGTGATCATCTTCGACAGCGACTGGAACCCTCACCAGGACCTGCAAGCGCAAGACCGGGCACACCGCATTGGGCAGCAGAACGAGGTGCGCGTGCTCCGCCTCTGCACCGTGAACAGTGTGGAGGAGAAGATCCTGGCGGCTGCCAAGTACAAGCTCAACGTGGACCAGAAAGTGATCCAGGCGGGCATGTTTGACCAGAAGTCGTCCAGCCACGAGCGGCGCGCCTTCCTGCAGGCCATCCTGGAGCACGAGGAGCAGGACGAGGAGGAAGACGAGGTGCCTGATGATGAGACGGTCAACCAGATGATTGCCCGGCACGAGGAGGAGTTCGACTTGTTCATGCGCATGGACCTGGACCGCCGGCGTGAAGAGGCTCGCAACCCCAAACGGAAGCCTCGTCTCATGGAGGAGGACGAGCTCCCATCCTGGATCATCAAGGATGATGCGGAGGTGGAGCGGCTGACGTGTGAGGAGGAGGAGGAGAAAATGTTTGGGCGTGGCTCCCGCCACCGCAAGGAGGTGGACTACAGCGACTCGCTGACAGAGAAGCAGTGGCTCAAGACCCTGAAGGCCATCGAGGAGGGCACGTTGGAGGAGATCGAAGAGGAGGTCCGGCAGAAGAAATCCTCGCGAAAGCGCAAGCGGGACAGCGATGCCGGCTCCTCGACACCGACCACCAGCACCCGCAGCCGCGACAAGGACGACGAGAGCAAGAAGCAGAAGAAGCGTGGACGGCCGCCCGCTGAGAAGCTCTCCCCAAACCCGCCCAACCTCACCAAGAAGATGAAGAAGATCGTGGACGCCGTGATCAAGTACAAGGACAGTAGCAGTGGACGGCAGCTCAGTGAGGTATTCATCCAGTTGCCCTCCCGCAAGGAGCTGCCTGAGTACTACGAGCTCATCCGCAAGCCTGTGGACTTCAAGAAGATCAAGGAGCGCATCCGCAACCACAAGTACCGTAGCCTCAACGACCTCGAAAAGGACGTGATGCTGCTCTGCCAGAACGCGCAGACCTTCAACCTGGAGGGCTCGCTGATCTACGAGGACTCCATCGTGCTGCAGTCGGTCTTCACCAGTGTCCGGCAGAAGATCGAGAAGGAGGAGGACAGTGAGGGCGAAGAGAGCGAGGAGGAGGAGGAAGCCGAGGAGGAGGGCTCGGAGTCCGAGTCCCGCTCTGTCAAGGTGAAGATTAAGCTGGGCCGCAAGGAGAAGGCCCAGGACCGGCTCAAGGGCAGCCGCCGCAGGCCCAGCCGAGGGTCCCGGGCCAAGCCGGTCGTGAGCGACGACGACAGTGAGGAGGAGCAGGAGGAGGACCGCTCAGGAAGTGGCAGCGAGGAGGACTGA

XM_004865554.1 Coding sequence

Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4, transcript variant X9

Length: 4758 bp    Location: 2893096..2985968   Strand: +
>XM_004865554.1
ATGTCCACTCCAGACCCACCCCTGGGCGGAACTCCTCGGCCAGGCCCTTCCCCAGGCCCAGGCCCCTCACCTGGAGCCATGCTGGGCCCTAGCCCTGGCCCCTCACCGGGCTCAGCTCACAGCATGATGGGGCCTAGCCCCGGGCCTCCCTCAGCAGGACACCCCATCTCCACGCAGGGGCCTGGAGGGTACCCTCAGGACAACATGCACCAGATGCACAAGCCCATGGAGTCCCTGCATGAGAAGAGCATGTCGGAGGACCCACGCTACAACCAGATGAAGGGCATGGGGATGCGCTCGGGTGGCCACGCAGGCATGGGCCCCCCACCCAGCCCCATGGACCAGCACTCCCAAGGTTACCCCTCGCCCCTGGGCGGCTCCGAGCATGCCTCCAGTCCTGTTCCAGCCAGCGGCCCATCTTCGGGCCCCCAGATGTCGTCTGGGCCAGGAGGGGCCCCGCTGGACGGCACTGACCCCCAGGCCTTGGGGCAGCAGAGCCGGGGCCCCACCCCATTCAACCAGAACCAGCTGCACCAGCTTCGGGCACAGATCATGGCCTACAAGATGCTGGCCAGGGGACAGCCCCTGCCTGACCACCTGCAGATGGCCGTGCAGGGAAAGCGGCCCATGCCTGGGATGCAGCAGCAGATGCCCACGCTACCTCCGCCCTCTGTGTCTGCCACAGGGCCTGGGCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCTGGCCCGGGACCAGCACCTCCAAATTATAGCAGGCCTCATGGCCCCATGGTGAACGCTGCTGCTCCCACGAGCACCCCTCAGAAGCTGATCCCCCCACAGCCGACGGGCCGTCCTTCGCCCGCACCCCCTGCCGTCCCACCCGCTGCCTCGCCTGTGATGCCGCCCCAGACCCAGTCCCCGGGGCAGCCGGCCCAGCCTGCGCCCTTGGTGCCACTGCACCAGAAGCAGAGCCGCATCACTCCCATCCAGAAGCCCCGGGGCCTGGACCCCGTGGAGATCCTGCAGGAGCGCGAGTACAGGCTGCAGGCTCGCATCGCACACCGCATTCAGGAACTTGAAAATCTCCCCGGCTCCCTGGCTGGGGATCTGCGAACCAAAGCAACCATCGAGCTCAAGGCCCTCCGGCTGCTGAACTTCCAGCGGCAGCTGCGCCAGGAGGTGGTAGTGTGCATGCGCAGGGACACGGCCCTGGAGACAGCCCTCAATGCCAAGGCCTACAAGCGCAGCAAGCGGCAGTCCCTGCGTGAGGCCCGAATCACCGAGAAGCTGGAGAAGCAGCAGAAGATCGAGCAGGAGCGAAAGCGGCGCCAGAAGCACCAGGAATACCTCAATAGCATTCTTCAGCACGCCAAGGATTTCAAGGAATACCACAGATCCGTTACGGGAAAAATCCAGAAGCTGACCAAGGCGGTGGCCACGTACCATGCCAACACGGAGCGGGAGCAGAAGAAAGAAAACGAGCGCATCGAGAAGGAGAGGATGCGGAGGCTCATGGCGGAAGATGAAGAGGGTTACCGCAAGCTCATCGACCAGAAGAAGGACAAGCGCCTGGCCTACCTCCTGCAGCAGACAGACGAGTATGTGGCCAACCTCACGGAGCTGGTGCGGCAGCACAAGGCCGCCCAGGTCGCCAAGGAGAAAAAGAAGAAGAAGAAGAAGAAGAAGGCAGAAAACGCTGAAGGACAGACGCCCGCGATCGGACCCGATGGCGAGCCTCTGGATGAGACCAGCCAGATGAGTGACCTCCCTGTGAAGGTGATCCACGTGGAGAGTGGCAAGATCCTCACAGGCACAGACGCCCCCAAAGCTGGGCAACTGGAGGCCTGGCTTGAGATGAACCCGGGGTATGAGGTGGCGCCGAGGTCTGATAGTGAAGAGAGCGGCTCAGAAGAAGAAGAGGAGGAGGAGGAGGAAGAGCAGCCACAGCCAGCACAGCCTCCCACCCTGCCTGTGGAGGAGAAGAAGAAGATCCCAGACCCTGACAGCGACGATGTCTCTGAGGTGGACGCACGGCACATCATTGAGAATGCCAAGCAAGACGTTGATGATGAGTATGGCGTGTCCCAGGCCCTTGCTCGCGGCCTGCAGTCCTACTATGCTGTGGCCCACGCTGTCACCGAGAGAGTGGACAAGCAGTCAGCACTCATGGTCAACGGCGTCCTCAAGCAGTACCAGATCAAAGGCTTGGAGTGGCTGGTGTCCCTGTACAACAACAACCTGAACGGCATCCTGGCTGACGAGATGGGCCTGGGGAAGACCATCCAGACCATCGCGCTCATCACATACCTCATGGAGCACAAGCGCATCAACGGGCCCTTCCTCATCATCGTGCCTCTCTCGACGCTGTCGAACTGGGCATACGAATTTGACAAGTGGGCCCCTTCCGTGGTGAAGGTGTCCTACAAGGGCTCTCCAGCAGCAAGACGAGCTTTCGTCCCCCAGCTCCGCAGTGGCAAGTTTAACGTCTTGCTGACGACCTACGAATACATCATCAAAGACAAGCACATCCTCGCCAAGATCCGCTGGAAGTACATGATCGTGGACGAGGGCCACCGCATGAAAAACCACCACTGCAAGCTGACGCAGGTGCTCAACACGCACTACGTGGCCCCACGTCGGCTGCTGCTCACGGGCACACCACTGCAGAACAAGCTGCCGGAGCTCTGGGCGCTGCTCAACTTCCTGCTGCCCACCATCTTCAAGAGCTGCAGCACCTTTGAGCAGTGGTTCAACGCACCCTTTGCCATGACAGGGGAGAAGGTGGACCTGAACGAAGAGGAAACCATCCTCATCATCCGTCGTTTGCACAAAGTGCTGCGGCCCTTCCTGCTCCGGCGGCTCAAGAAGGAAGTCGAGGCCCAGCTGCCTGAGAAGGTGGAGTATGTCATCAAGTGCGACATGTCTGCGCTCCAGCGCGTGCTCTACCGGCACATGCAGGCCAAGGGGGTGCTGCTCACTGACGGCTCTGAGAAGGACAAGAAGGGCAAAGGTGGCACCAAGACCCTGATGAACACCATCATGCAGCTAAGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATTGAGGAGTCCTTCTCTGAACACTTGGGCTTCACCGGCGGCATCGTGCAAGGGCTGGACCTGTATCGAGCCTCAGGCAAATTTGAGCTTCTCGATAGAATCCTCCCCAAACTTCGTGCCACCAACCACAAAGTGCTACTGTTCTGCCAGATGACCTCCCTCATGACGATCATGGAAGATTACTTTGCGTATCGCGGCTTTAAATACCTCAGGCTGGACGGAACCACAAAGGCGGAGGACCGGGGCATGCTGCTCAAGACCTTCAACGAGCCCGGCTCCGAGTACTTCATCTTCCTGCTCAGCACCCGCGCTGGTGGGCTGGGCCTCAACCTGCAGTCAGCAGACACTGTGATCATCTTCGACAGCGACTGGAACCCTCACCAGGACCTGCAAGCGCAAGACCGGGCACACCGCATTGGGCAGCAGAACGAGGTGCGCGTGCTCCGCCTCTGCACCGTGAACAGTGTGGAGGAGAAGATCCTGGCGGCTGCCAAGTACAAGCTCAACGTGGACCAGAAAGTGATCCAGGCGGGCATGTTTGACCAGAAGTCGTCCAGCCACGAGCGGCGCGCCTTCCTGCAGGCCATCCTGGAGCACGAGGAGCAGGACGAGGAGGAAGACGAGGTGCCTGATGATGAGACGGTCAACCAGATGATTGCCCGGCACGAGGAGGAGTTCGACTTGTTCATGCGCATGGACCTGGACCGCCGGCGTGAAGAGGCTCGCAACCCCAAACGGAAGCCTCGTCTCATGGAGGAGGACGAGCTCCCATCCTGGATCATCAAGGATGATGCGGAGGTGGAGCGGCTGACGTGTGAGGAGGAGGAGGAGAAAATGTTTGGGCGTGGCTCCCGCCACCGCAAGGAGGTGGACTACAGCGACTCGCTGACAGAGAAGCAGTGGCTCAAGGCCATCGAGGAGGGCACGTTGGAGGAGATCGAAGAGGAGGTCCGGCAGAAGAAATCCTCGCGAAAGCGCAAGCGGGACAGCGATGCCGGCTCCTCGACACCGACCACCAGCACCCGCAGCCGCGACAAGGACGACGAGAGCAAGAAGCAGAAGAAGCGTGGACGGCCGCCCGCTGAGAAGCTCTCCCCAAACCCGCCCAACCTCACCAAGAAGATGAAGAAGATCGTGGACGCCGTGATCAAGTACAAGGACAGTAGCAGTGGACGGCAGCTCAGTGAGGTATTCATCCAGTTGCCCTCCCGCAAGGAGCTGCCTGAGTACTACGAGCTCATCCGCAAGCCTGTGGACTTCAAGAAGATCAAGGAGCGCATCCGCAACCACAAGTACCGTAGCCTCAACGACCTCGAAAAGGACGTGATGCTGCTCTGCCAGAACGCGCAGACCTTCAACCTGGAGGGCTCGCTGATCTACGAGGACTCCATCGTGCTGCAGTCGGTCTTCACCAGTGTCCGGCAGAAGATCGAGAAGGAGGAGGACAGTGAGGGCGAAGAGAGCGAGGAGGAGGAGGAAGCCGAGGAGGAGGGCTCGGAGTCCGAGTCCCGCTCTGTCAAGGTGAAGATTAAGCTGGGCCGCAAGGAGAAGGCCCAGGACCGGCTCAAGGGCAGCCGCCGCAGGCCCAGCCGAGGGTCCCGGGCCAAGCCGGTCGTGAGCGACGACGACAGTGAGGAGGAGCAGGAGGAGGACCGCTCAGGAAGTGGCAGCGAGGAGGACTGA

XM_004865557.1 Coding sequence

Ldlr low density lipoprotein receptor, transcript variant X2

Length: 2424 bp    Location: 2998440..3020149   Strand: +
>XM_004865557.1
ATGCAGTGCGCGCCGAGGATGAGGACGGCGGGCCCGGTGCTGCGCTACGGTGCGCTGCTGCTGTGCCTGGCGGCGGGGGCTGCAGAAGACAAGTGTGCAAGAAATGAATTCCAGTGCTGGGATGGGAAGTGCATCTCCTACACGTGGGTGTGTGATGGCAGGGCGGAGTGCCAGGACGGCTCTGACGAGTCCCAGGAAACGTGCATGGCTGCCACCTGCAAGCCGGGTGACTTCAGCTGTGGGGGCCGCCTGAACCGCTGCATCCCCAGCTCCTGGAGGTGTGACGGCCATGAGGACTGTAACAACGGCGCCGATGAGCAAGGCTGTCCCACCAGGACGTGTCCCGAGGACGAGTTCCACTGCCAGGATGGCCGCTGCATCTCGCAGCAGTTCCTCTGCGATGGTGACCGTGACTGCCTAGACGGTTCAGACGAGGTCACCTGCTCAGTGACCACCTGCGGCCCTGCCAACTTCCAGTGCAACTCCTCAGCCTGCATCCCCCAGCTGTGGGCCTGCGACGGCGACTCCGACTGCAGTGACGGCTCTGACGAGTGGCCACAGCGCTGCGAGGGCCGGGACACGTCGGCTGCCCAGGGGGCCAATGGCCCCTGCTCCTCCCTGGAGTTCCACTGCCGCAGCGGCGAGTGCATCCACAGCAGCTGGCACTGTGACGGTGCCCACGACTGCAAGGACAAGTCTGACGAGGAGGACTGCGTGGTGGCCACCTGCCGCCCCGATGAGTTCCAGTGTGCTGACGGCACCTGTATCCACGGCAGCCGGCAGTGTGACCAAGAGCACGACTGCAGGGACCAGAGCGACGAAGTCGGCTGCATCAACGTGACACTCTGCGAGGGTCCCAACAAGTTTAAGTGCCACAGCGGCGAGTGCATCACACTGGACAAAGTGTGCAACGCAGCCAGGGACTGTCGCGACTGGTCGGACGAGCCCCTCAAGGAGTGTGGGACCAACGAATGCTTGGACAACAATGGGGGCTGTTCCCATATCTGCAAGGACCTCAAGATCGGCTACCAGTGCTTATGCCCCAGTGGGTTCCACCTGGCGGACCAGTGGCAGTGCAAAGACATTGATGAGTGTCAGGAGCCTGACACCTGCAGCCAGCTGTGTGTGAACCTGGAGGGGAGCTACAAGTGTGAGTGTGAGGATGGCTTCCAGATGGACCCCAGCACGAAGACCTGCAAAGCCGTCGGCTCAGTCGCCTACCTGTTCTTCACCAACCGCCACGAGGTGCGGAAGATGACCCCAGACCGCAGCCAGTATGCCAGCCTCCTCTCCAACCTGAAGTATGCGGTGGCCCTGGACGCGGAGGTGGCCAGCAGCCGGCTCTATTGGTCAGACCTGTCCCACAGGAAGATCTATAGCACCCGGATCAGCGCAGCCCCGGGCTCTGCCCACGACACTGTCATTGACGGGGATCTCCAGGCCCCCGACGGGCTGGCCGTGGACTGGGTCCACCGTAACATCTACTGGACCGACTCTGTCCCCGGTACGGTGTCTGTGGCCGACACCAGGGGCGTGAAGAGGAGGACTTTGTTCCAGAGGAAAGGTTCCAAGCCCAGGGGCATCGTGGTGGACCCTGTGCACGGCTTCATGTACTGGACAGACTGGGGAACCCCCGCCAAGATCGAGAAAGGGGGCCTGAACGGCGTGGACATGTACTCGCTGGTGACAGAAGACATCGAGTGGCCCAATGGCATCACACTGGATCTCTCCAGCAGCCGCCTCTACTGGGTTGACTCCAAACTCCACTCCATCTTCAGTATCAATGTCAATGGTAGAAACAGGAAGACCATCTTGGAGGATGAAAAGCAGCTGGCCCACCCCTTCTCCTTGGCCATCTTTGAGGACAAAATATTTTGGACGGATATCATAAATGAAGCCATTTTCAGTGTCAACCGCCTCACGGGTTTGGATGTTCATTTAGTGGCTGAAAACCTGTCATCACCTGAAGACATTGTCCTGTTTCACAATGTCACACAACCGAAAGGGGTGAACTGGTGTGAGAGGACAGCCCTCCCCAACGGTGGCTGCCAGTACTTGTGTCTGCCTGCCCCACAGATCAACTCCCATTCCCCCAAGTTCACTTGTGTGTGCCCGGATGGTATGGTGCTAGCCAAGGACATGAGGAGCTGTCTCACAGTCGTGGGCAACGCCGCTGGCAGAGGGGAAAAGCCTCACAGCGTGGGGGCTCTGACCATCGTCCTTCCCATCGGGCTGGTCGCTCTCCTCTGCCTTGGTGCCTTTCTGCTGTGGAAGAACTGGCGGCTCAAGAACATCAACAGCATCAACTTTGACAACCCCGTATACCAGAAGACCACAGAAGACGAGGTGCACATCTGCCGCAGCCAGGACGGCTACATCTACCCCTCGAGGCAGAGGGTCAGCCTGGAGGATGACGTGGTGTGA

XM_004865558.1 Coding sequence

Ldlr low density lipoprotein receptor, transcript variant X3

Length: 2442 bp    Location: 2998440..3020149   Strand: +
>XM_004865558.1
ATGCAGTGCGCGCCGAGGATGAGGACGGCGGGCCCGGTGCTGCGCTACGGTGCGCTGCTGCTGTGCCTGGCGGCGGGGGCTGCAGAAGACAAGTGTGCAAGAAATGAATTCCAGTGCTGGGATGGGAAGTGCATCTCCTACACGTGGGTGTGTGATGGCAGGGCGGAGTGCCAGGACGGCTCTGACGAGTCCCAGGAAACGTGCATGGCTGCCACCTGCAAGCCGGGTGACTTCAGCTGTGGGGGCCGCCTGAACCGCTGCATCCCCAGCTCCTGGAGGTGTGACGGCCATGAGGACTGTAACAACGGCGCCGATGAGCAAGGCTGTCCCACCAGGACGTGTCCCGAGGACGAGTTCCACTGCCAGGATGGCCGCTGCATCTCGCAGCAGTTCCTCTGCGATGGTGACCGTGACTGCCTAGACGGTTCAGACGAGGTCACCTGCTCAGTGACCACCTGCGGCCCTGCCAACTTCCAGTGCAACTCCTCAGCCTGCATCCCCCAGCTGTGGGCCTGCGACGGCGACTCCGACTGCAGTGACGGCTCTGACGAGTGGCCACAGCGCTGCGAGGGCCGGGACACGTCGGCTGCCCAGGGGGCCAATGGCCCCTGCTCCTCCCTGGAGTTCCACTGCCGCAGCGGCGAGTGCATCCACAGCAGCTGGCACTGTGACGGTGCCCACGACTGCAAGGACAAGTCTGACGAGGAGGACTGCGTGGTGGCCACCTGCCGCCCCGATGAGTTCCAGTGTGCTGACGGCACCTGTATCCACGGCAGCCGGCAGTGTGACCAAGAGCACGACTGCAGGGACCAGAGCGACGAAGTCGGCTGCATCAACGTGACACTCTGCGAGGGTCCCAACAAGTTTAAGTGCCACAGCGGCGAGTGCATCACACTGGACAAAGTGTGCAACGCAGCCAGGGACTGTCGCGACTGGTCGGACGAGCCCCTCAAGGAGTGTGGGACCAACGAATGCTTGGACAACAATGGGGGCTGTTCCCATATCTGCAAGGACCTCAAGATCGGCTACCAGTGCTTATGCCCCAGTGGGTTCCACCTGGCGGACCAGTGGCAGTGCAAAGACATTGATGAGTGTCAGGAGCCTGACACCTGCAGCCAGCTGTGTGTGAACCTGGAGGGGAGCTACAAGTGTGAGTGTGAGGATGGCTTCCAGATGGACCCCAGCACGAAGACCTGCAAAGCCGTCGGCTCAGTCGCCTACCTGTTCTTCACCAACCGCCACGAGGTGCGGAAGATGACCCCAGACCGCAGCCAGTATGCCAGCCTCCTCTCCAACCTGAAGTATGCGGTGGCCCTGGACGCGGAGGTGGCCAGCAGCCGGCTCTATTGGTCAGACCTGTCCCACAGGAAGATCTATAGCACCCGGATCAGCGCAGCCCCGGGCTCTGCCCACGACACTGTCATTGACGGGGATCTCCAGGCCCCCGACGGGCTGGCCGTGGACTGGGTCCACCGTAACATCTACTGGACCGACTCTGTCCCCGGTACGGTGTCTGTGGCCGACACCAGGGGCGTGAAGAGGAGGACTTTGTTCCAGAGGAAAGGTTCCAAGCCCAGGGGCATCGTGGTGGACCCTGTGCACGGCTTCATGTACTGGACAGACTGGGGAACCCCCGCCAAGATCGAGAAAGGGGGCCTGAACGGCGTGGACATGTACTCGCTGGTGACAGAAGACATCGAGTGGCCCAATGGCATCACACTGGATCTCTCCAGCAGCCGCCTCTACTGGGTTGACTCCAAACTCCACTCCATCTTCAGTATCAATGTCAATGGTAGAAACAGGAAGACCATCTTGGAGGATGAAAAGCAGCTGGCCCACCCCTTCTCCTTGGCCATCTTTGAGGACAAAATATTTTGGACGGATATCATAAATGAAGCCATTTTCAGTGTCAACCGCCTCACGGGTTTGGATGTTCATTTAGTGGCTGAAAACCTGTCATCACCTGAAGACATTGTCCTGTTTCACAATGTCACACAACCGAAAGAGGCTGAGCCTTCTGTGACAACTCCAGTGCACCCTACCGCCAGGCCAGAAGCCAGCAGCACAGCTGTGAGGCCAAAGCACGCAGACCAGTGGCCCGCTCCCAGCACATCTGGGCGGCCTGTGGCCACCTCCGGGCTCACCACGGCGGCGTCGGTGACCATGTCCCACCAAGTCGTGGGCAACGCCGCTGGCAGAGGGGAAAAGCCTCACAGCGTGGGGGCTCTGACCATCGTCCTTCCCATCGGGCTGGTCGCTCTCCTCTGCCTTGGTGCCTTTCTGCTGTGGAAGAACTGGCGGCTCAAGAACATCAACAGCATCAACTTTGACAACCCCGTATACCAGAAGACCACAGAAGACGAGGTGCACATCTGCCGCAGCCAGGACGGCTACATCTACCCCTCGAGGCAGAGGGTCAGCCTGGAGGATGACGTGGTGTGA

XM_004865565.1 Coding sequence

Kank2 KN motif and ankyrin repeat domains 2, transcript variant X6

Length: 2550 bp    Location: 3062055..3041307   Strand: -
>XM_004865565.1
ATGGCCCAGGTCCTGCACGTGCCAGCCCCATTCCCAGGGACCCCCGGCCCCACCTCACCGCCTGCCTTCCCACCCAAGGAGCCCGACCCTCCTTACTCTGTGGAGACACCCTACGGCTACCACCTGGACCTGGACTTCCTCAAGTATGTAGACGACATTGAGAAGGGCCACACACTGCGGCGGGTGGCCGTGCAGCGCCGTCCCCGCCTGGGCTCCCTGCCCCGAGGGCCAGGCTCCTGGTGGACGTCCACGGAGTCGCTGTGCTCCAATGCAAGCGGGGACAGCCGCCACTCGGCCTACTCCTACTGCGGCCGAGGCTTCTACCCGCAGTATGGCGCCCTGGAGACAGGCGGCACTGGTGGCTTCAACCCCCGAGTGGAGCGGACGCTGCTGGACGCCCGGCGCCGCCTCGAGGACCAGGCAGCCGCACCCTCGGGCCTGGGCTCCCTGACGCCCAGCGCCGCCGGCTCCACCAGCTCCCTGGTGGGTGTGGGGCTGCCGCCCCCTCTAACGCCACGTGGCTCGGGACTGTCCACGCCAGTGCCGCCCAGCGCCGGGCACCTGGCACATGTGCGGGAGCAGATGGCAGGCGCCCTGCGGAAGCTGCGGCAGCTGGAGGAGCAGGTGAAGCTGATCCCAGTGCTCCAGGTGAAGCTGTCCGTGCTCCAGGAGGAGAAGCGGCAGCTCGCCGTGCAGCTCAAGAGCCAGAAGTTCCTGGGCCACCCCGCCGGCGCGTGGGCCCGCAGCGAGCTCTGCCTGGACCTCCCTGAGCCCCTCGAAGACCCTTCGGCACTTGACGCCCGCAGTGTGGGCACCTGGGTTCGAGAACGGGACTTGGGCTTGCCTGACGGGGAGGCGGCGCTCGCTGCCAAGGTCGCCGTGTTGGAGACGCAGCTCAAGAAGGCACTGCAGGACCTGCAGGCGGCCCAGGCCCGGCAGGCCGAGCCCCAGCCCCAGGCCTGGCCGCCACCCGACACTCCGGTCCGCGTGGACACCATCCGAGTGGTGGAGGGGCCTCGGGAGGTGGAGGTGGCAGCCAGCACCACCACCGGGGCCCCTGCCCAGCGAGCCCAGAGCCTGGAGCCCTACGGGACAGGCCTGAGGGCCTTGGTGACATCGGGGGAGCCTGAGAGCCCCGCCATGTTCTGCAGCCACGAGGTAGTGGAGACCATGTGCCCAGTGCCCACTGTGCCCGCCAGCAACATCCACGTAGTCAAGAAAATCAGCATCACAGAGCGGAGCTGTGAGGTGGCCACAGGGTCGGCATCAGAGGAGAACACAGGCCGGGTGGCTGCCGCTGACCCTGCCCACGGGGAGCCCCCCAGCCAGGTGTCGTGGGCGTCGGGGGACCCGGGGGGAGCAGGAGGGCCCCAGGTGGGAATGCGGTCCATCATGAAGAGGAAGGAGGAGCCCGCAGACCCGGCAGCGCAGGGGAGGAGCCTGCAGTTCGTGGGAGTCAATGGCGGGTACGAGTCCTCCTCCGAAGGCTCCAGCACAGCCGAGAACTTCTCCGACAATGACAGCACAGAGAATGAGGCTCCGGAGCCGGAAGAGAGGCTTCCAAGTGTGGCCGGAGCCCCACAGTGCAGGCCCCCAGGGACCACTGCAGTGGCGCCCCAGACCAGCCTGCCGGGGTGCCAGCTATCTCGGGAGGCTCAGCATGCGCCCCTGGCTGAGGAGGCAGCGGGCACCAACTCTGAGGACGAGATCCGGATGGAGCTGAGCCCTGACCTCATCTCGGCCTGCCTGGCGCTGGAGAAATACCTGGGCAACGCCAACGCGCTTACCGAGCGGGAGCTGAAAGTGGCCTACACCACCGTGCTGCAGGAGTGGTTGCGCCTGGCCTGCCGCAGCGACGCCCACCCTGAGCTGGTGCGGCGCCACCTGGTCACCTTCCGGGCCATGTCAGCCCGGCTGCTGGACTATGTGGTCAACATCGCCGACAGCAACGGCAACACCGCGCTACACTACTCTGTGTCCCATGCCAACTTCCCCGTGGTACGACAGCTGCTGGACAGCGGCCTCTGCCAGGTGGACAAACAGAACCGTGCCGGCTACAGCCCCATCATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCAAGACTGTCGTTCAGCTCTTCCGCCTTGGAGATGTCAATGCCAAAGCCAGCCAGGCGGGGCAGACGGCCCTGATGCTGGCGGTCAGCCACGGCCGGGTGGACGTGGTCAAAGCCCTGCTGGCCTGCGAGGCGGACGTCAACATCCAAGACGACGACGGCTCCACAGCCCTCATGTGCGCCTGCGAGCACGGCCACAAGGAGATTGCGGGGCTGCTGCTGGCCGTGCCCAGCTGCGACATCTCGCTCACGGACCGTGTGAGTCCCCACACCCACCCCAGGGAGGGCGGGACTCAGCCGGGCAGGCAGGCGCATAGCAACAGCTGTTCTGCAGGACGGGAGCACCGCACTCATGGTGGCACTGGACGTGGGGCAGAGCGAGATCGCGTCCATGCTGTACTCGCGGATGAACATCAAGTGCTCGTTCGCCCCGATGTCAGATGA

XM_004865566.1 Coding sequence

Kank2 KN motif and ankyrin repeat domains 2, transcript variant X7

High confidence: 4 potential gene matches
Length: 2508 bp    Location: 3062053..3041307   Strand: -
>XM_004865566.1
ATGGCCCAGGTCCTGCACGTGCCAGCCCCATTCCCAGGGACCCCCGGCCCCACCTCACCGCCTGCCTTCCCACCCAAGGAGCCCGACCCTCCTTACTCTGTGGAGACACCCTACGGCTACCACCTGGACCTGGACTTCCTCAAGTATGTAGACGACATTGAGAAGGGCCACACACTGCGGCGGGTGGCCGTGCAGCGCCGTCCCCGCCTGGGCTCCCTGCCCCGAGGGCCAGGCTCCTGGTGGACGTCCACGGAGTCGCTGTGCTCCAATGCAAGCGGGGACAGCCGCCACTCGGCCTACTCCTACTGCGGCCGAGGCTTCTACCCGCAGTATGGCGCCCTGGAGACAGGCGGCACTGGTGGCTTCAACCCCCGAGTGGAGCGGACGCTGCTGGACGCCCGGCGCCGCCTCGAGGACCAGGCAGCCGCACCCTCGGGCCTGGGCTCCCTGACGCCCAGCGCCGCCGGCTCCACCAGCTCCCTGGTGGGTGTGGGGCTGCCGCCCCCTCTAACGCCACGTGGCTCGGGACTGTCCACGCCAGTGCCGCCCAGCGCCGGGCACCTGGCACATGTGCGGGAGCAGATGGCAGGCGCCCTGCGGAAGCTGCGGCAGCTGGAGGAGCAGGTGAAGCTGATCCCAGTGCTCCAGGTGAAGCTGTCCGTGCTCCAGGAGGAGAAGCGGCAGCTCGCCGTGCAGCTCAAGAGCCAGAAGTTCCTGGGCCACCCCGCCGGCGCGTGGGCCCGCAGCGAGCTCTGCCTGGACCTCCCTGAGCCCCTCGAAGACCCTTCGGCACTTGACGCCCGCAGTGTGGGCACCTGGGTTCGAGAACGGGACTTGGGCTTGCCTGACGGGGAGGCGGCGCTCGCTGCCAAGGTCGCCGTGTTGGAGACGCAGCTCAAGAAGGCACTGCAGGACCTGCAGGCGGCCCAGGCCCGGCAGGCCGAGCCCCAGCCCCAGGCCTGGCCGCCACCCGACACTCCGGTCCGCGTGGACACCATCCGAGTGGTGGAGGGGCCTCGGGAGGTGGAGGTGGCAGCCAGCACCACCACCGGGGCCCCTGCCCAGCGAGCCCAGAGCCTGGAGCCCTACGGGACAGGCCTGAGGGCCTTGGTGACATCGGGGGAGCCTGAGAGCCCCGCCATGTTCTGCAGCCACGAGGTAGTGGAGACCATGTGCCCAGTGCCCACTGTGCCCGCCAGCAACATCCACGTAGTCAAGAAAATCAGCATCACAGAGCGGAGCTGTGAGGTGGCCACAGGGTCGGCATCAGAGGAGAACACAGGCCGGGTGGCTGCCGCTGACCCTGCCCACGGGGAGCCCCCCAGCCAGGTGTCGTGGGCGTCGGGGGACCCGGGGGGAGCAGGAGGGCCCCAGGTGGGAATGCGGTCCATCATGAAGAGGAAGGAGGAGCCCGCAGACCCGGCAGCGCAGGGGAGGAGCCTGCAGTTCGTGGGAGTCAATGGCGGGTACGAGTCCTCCTCCGAAGGCTCCAGCACAGCCGAGAACTTCTCCGACAATGACAGCACAGAGAATGAGGCTCCGGAGCCGGAAGAGAGGCTTCCAAGTGTGGCCGGAGCCCCACAGTGCAGGCCCCCAGGGACCACTGCAGTGGCGCCCCAGACCAGCCTGCCGGGGTGCCAGCTATCTCGGGAGGCTCAGCATGCGCCCCTGGCTGAGGAGGCAGCGGGCACCAACTCTGAGGACGAGATCCGGATGGAGCTGAGCCCTGACCTCATCTCGGCCTGCCTGGCGCTGGAGAAATACCTGGGCAACGCCAACGCGCTTACCGAGCGGGAGCTGAAAGTGGCCTACACCACCGTGCTGCAGGAGTGGTTGCGCCTGGCCTGCCGCAGCGACGCCCACCCTGAGCTGGTGCGGCGCCACCTGGTCACCTTCCGGGCCATGTCAGCCCGGCTGCTGGACTATGTGGTCAACATCGCCGACAGCAACGGCAACACCGCGCTACACTACTCTGTGTCCCATGCCAACTTCCCCGTGGTACGACAGCTGCTGGACAGCGGCCTCTGCCAGGTGGACAAACAGAACCGTGCCGGCTACAGCCCCATCATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCAAGACTGTCGTTCAGCTCTTCCGCCTTGGAGATGTCAATGCCAAAGCCAGCCAGGCGGGGCAGACGGCCCTGATGCTGGCGGTCAGCCACGGCCGGGTGGACGTGGTCAAAGCCCTGCTGGCCTGCGAGGCGGACGTCAACATCCAAGACGACGACGGCTCCACAGCCCTCATGTGCGCCTGCGAGCACGGCCACAAGGAGATTGCGGGGCTGCTGCTGGCCGTGCCCAGCTGCGACATCTCGCTCACGGACCGTGACGGGAGCACCGCACTCATGGTGGCACTGGACGTGGGGCAGAGCGAGATCGCGTCCATGCTGTACTCGCGGATGAACATCAAGTGCTCGTTCGCCCCGATGTCAGATGATGAGAGTCCCGCGTCGTCCTCGGTCGAAGAATGA

XM_004865561.1 Coding sequence

Kank2 KN motif and ankyrin repeat domains 2, transcript variant X2

Length: 2736 bp    Location: 3062057..3041978   Strand: -
>XM_004865561.1
ATGGCCCAGGTCCTGCACGTGCCAGCCCCATTCCCAGGGACCCCCGGCCCCACCTCACCGCCTGCCTTCCCACCCAAGGAGCCCGACCCTCCTTACTCTGTGGAGACACCCTACGGCTACCACCTGGACCTGGACTTCCTCAAGTATGTAGACGACATTGAGAAGGGCCACACACTGCGGCGGGTGGCCGTGCAGCGCCGTCCCCGCCTGGGCTCCCTGCCCCGAGGGCCAGGCTCCTGGTGGACGTCCACGGAGTCGCTGTGCTCCAATGCAAGCGGGGACAGCCGCCACTCGGCCTACTCCTACTGCGGCCGAGGCTTCTACCCGCAGTATGGCGCCCTGGAGACAGGCGGCACTGGTGGCTTCAACCCCCGAGTGGAGCGGACGCTGCTGGACGCCCGGCGCCGCCTCGAGGACCAGGCAGCCGCACCCTCGGGCCTGGGCTCCCTGACGCCCAGCGCCGCCGGCTCCACCAGCTCCCTGGTGGGTGTGGGGCTGCCGCCCCCTCTAACGCCACGTGGCTCGGGACTGTCCACGCCAGTGCCGCCCAGCGCCGGGCACCTGGCACATGTGCGGGAGCAGATGGCAGGCGCCCTGCGGAAGCTGCGGCAGCTGGAGGAGCAGGTGAAGCTGATCCCAGTGCTCCAGGTGAAGCTGTCCGTGCTCCAGGAGGAGAAGCGGCAGCTCGCCGTGCAGCTCAAGAGCCAGAAGTTCCTGGGCCACCCCGCCGGCGCGTGGGCCCGCAGCGAGCTCTGCCTGGACCTCCCTGAGCCCCTCGAAGACCCTTCGGCACTTGACGCCCGCAGTGTGGGCACCTGGGTTCGAGAACGGGACTTGGGCTTGCCTGACGGGGAGGCGGCGCTCGCTGCCAAGGTCGCCGTGTTGGAGACGCAGCTCAAGAAGGCACTGCAGGACCTGCAGGCGGCCCAGGCCCGGCAGGCCGAGCCCCAGCCCCAGGCCTGGCCGCCACCCGACACTCCGGTCCGCGTGGACACCATCCGAGTGGTGGAGGGGCCTCGGGAGGTGGAGGTGGCAGCCAGCACCACCACCGGGGCCCCTGCCCAGCGAGCCCAGAGCCTGGAGCCCTACGGGACAGGCCTGAGGGCCTTGGTGACATCGGGGGAGCCTGAGAGCCCCGCCATGTTCTGCAGCCACGAGGTAGTGGAGACCATGTGCCCAGTGCCCACTGTGCCCGCCAGCAACATCCACGTAGTCAAGAAAATCAGCATCACAGAGCGGAGCTGTGAGGTGGCCACAGGGTCGGCATCAGAGGAGAACACAGGCCGGGTGGCTGCCGCTGACCCTGCCCACGGGGAGCCCCCCAGCCAGGTGTCGTGGGCGTCGGGGGACCCGGGGGGAGCAGGAGGGCCCCAGGTGGGAATGCGGTCCATCATGAAGAGGAAGGAGGAGCCCGCAGACCCGGCAGCGCAGGGGAGGAGCCTGCAGTTCGTGGGAGTCAATGGCGGGTACGAGTCCTCCTCCGAAGGCTCCAGCACAGCCGAGAACTTCTCCGACAATGACAGCACAGAGAATGAGGCTCCGGAGCCGGAAGAGAGGCTTCCAAGTGTGGCCGGAGCCCCACAGTGCAGGCCCCCAGGGACCACTGCAGTGGCGCCCCAGACCAGCCTGCCGGGGTGCCAGCTATCTCGGGAGGCTCAGCATGCGCCCCTGGCTGAGGAGGCAGCGGGCACCAACTCTGAGGACGAGATCCGGATGGAGCTGAGCCCTGACCTCATCTCGGCCTGCCTGGCGCTGGAGAAATACCTGGGCAACGCCAACGCGCTTACCGAGCGGGAGCTGAAAGTGGCCTACACCACCGTGCTGCAGGAGTGGTTGCGCCTGGCCTGCCGCAGCGACGCCCACCCTGAGCTGGTGCGGCGCCACCTGGTCACCTTCCGGGCCATGTCAGCCCGGCTGCTGGACTATGTGGTCAACATCGCCGACAGCAACGGCAACACCGCGCTACACTACTCTGTGTCCCATGCCAACTTCCCCGTGGTACGACAGCTGCTGGACAGCGGCCTCTGCCAGGTGGACAAACAGAACCGTGCCGGCTACAGCCCCATCATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCAAGACTGTCGTTCAGCTCTTCCGCCTTGGAGATGTCAATGCCAAAGCCAGCCAGGCGGGGCAGACGGCCCTGATGCTGGCGGTCAGCCACGGCCGGGTGGACGTGGTCAAAGCCCTGCTGGCCTGCGAGGCGGACGTCAACATCCAAGACGACGACGGCTCCACAGCCCTCATGTGCGCCTGCGAGCACGGCCACAAGGAGATTGCGGGGCTGCTGCTGGCCGTGCCCAGCTGCGACATCTCGCTCACGGACCGTGTGAGTCCCCACACCCACCCCAGGGAGGGCGGGACTCAGCCGGGCAGGCAGGCGCATAGCAACAGCTGTTCTGCAGGACGGGAGCACCGCACTCATGGTGGCACTGGACGTGGGGCAGAGCGAGATCGCGTCCATGCTGTACTCGCGGATGAACATCAAGTGCTCGGTGAGCCCGGGGCAGCCGGGCTGGGAGGGCTGGTGCCTGCCTGGGCGTCCTGGGGCTGTGGGAAGAGGTTCAGCCACAGGGTCGCAGTATTCGCACCCAGGTCTATGTGGCTGCAAACGTGTGCTCCGAGTCACGGTTCACTGGTGCTGGAAATGCGGAAGTTACTGCACATGCAGAGGGGTCCCATCCTGCTAAAGCCCGCGTAA

XM_004865564.1 Coding sequence

Kank2 KN motif and ankyrin repeat domains 2, transcript variant X5

Length: 2649 bp    Location: 3062056..3041978   Strand: -
>XM_004865564.1
ATGGCCCAGGTCCTGCACGTGCCAGCCCCATTCCCAGGGACCCCCGGCCCCACCTCACCGCCTGCCTTCCCACCCAAGGAGCCCGACCCTCCTTACTCTGTGGAGACACCCTACGGCTACCACCTGGACCTGGACTTCCTCAAGTATGTAGACGACATTGAGAAGGGCCACACACTGCGGCGGGTGGCCGTGCAGCGCCGTCCCCGCCTGGGCTCCCTGCCCCGAGGGCCAGGCTCCTGGTGGACGTCCACGGAGTCGCTGTGCTCCAATGCAAGCGGGGACAGCCGCCACTCGGCCTACTCCTACTGCGGCCGAGGCTTCTACCCGCAGTATGGCGCCCTGGAGACAGGCGGCACTGGTGGCTTCAACCCCCGAGTGGAGCGGACGCTGCTGGACGCCCGGCGCCGCCTCGAGGACCAGGCAGCCGCACCCTCGGGCCTGGGCTCCCTGACGCCCAGCGCCGCCGGCTCCACCAGCTCCCTGGTGGGTGTGGGGCTGCCGCCCCCTCTAACGCCACGTGGCTCGGGACTGTCCACGCCAGTGCCGCCCAGCGCCGGGCACCTGGCACATGTGCGGGAGCAGATGGCAGGCGCCCTGCGGAAGCTGCGGCAGCTGGAGGAGCAGGTGAAGCTGATCCCAGTGCTCCAGGTGAAGCTGTCCGTGCTCCAGGAGGAGAAGCGGCAGCTCGCCGTGCAGCTCAAGAGCCAGAAGTTCCTGGGCCACCCCGCCGGCGCGTGGGCCCGCAGCGAGCTCTGCCTGGACCTCCCTGAGCCCCTCGAAGACCCTTCGGCACTTGACGCCCGCAGTGTGGGCACCTGGGTTCGAGAACGGGACTTGGGCTTGCCTGACGGGGAGGCGGCGCTCGCTGCCAAGGTCGCCGTGTTGGAGACGCAGCTCAAGAAGGCACTGCAGGACCTGCAGGCGGCCCAGGCCCGGCAGGCCGAGCCCCAGCCCCAGGCCTGGCCGCCACCCGACACTCCGGTCCGCGTGGACACCATCCGAGTGGTGGAGGGGCCTCGGGAGGTGGAGGTGGCAGCCAGCACCACCACCGGGGCCCCTGCCCAGCGAGCCCAGAGCCTGGAGCCCTACGGGACAGGCCTGAGGGCCTTGGTGACATCGGGGGAGCCTGAGAGCCCCGCCATGTTCTGCAGCCACGAGGTAGTGGAGACCATGTGCCCAGTGCCCACTGTGCCCGCCAGCAACATCCACGTAGTCAAGAAAATCAGCATCACAGAGCGGAGCTGTGAGGTGGCCACAGGGTCGGCATCAGAGGAGAACACAGGCCGGGTGGCTGCCGCTGACCCTGCCCACGGGGAGCCCCCCAGCCAGGTGTCGTGGGCGTCGGGGGACCCGGGGGGAGCAGGAGGGCCCCAGGTGGGAATGCGGTCCATCATGAAGAGGAAGGAGGAGCCCGCAGACCCGGCAGCGCAGGGGAGGAGCCTGCAGTTCGTGGGAGTCAATGGCGGGTACGAGTCCTCCTCCGAAGGCTCCAGCACAGCCGAGAACTTCTCCGACAATGACAGCACAGAGAATGAGGCTCCGGAGCCGGAAGAGAGGCTTCCAAGTGTGGCCGGAGCCCCACAGTGCAGGCCCCCAGGGACCACTGCAGTGGCGCCCCAGACCAGCCTGCCGGGGTGCCAGCTATCTCGGGAGGCTCAGCATGCGCCCCTGGCTGAGGAGGCAGCGGGCACCAACTCTGAGGACGAGATCCGGATGGAGCTGAGCCCTGACCTCATCTCGGCCTGCCTGGCGCTGGAGAAATACCTGGGCAACGCCAACGCGCTTACCGAGCGGGAGCTGAAAGTGGCCTACACCACCGTGCTGCAGGAGTGGTTGCGCCTGGCCTGCCGCAGCGACGCCCACCCTGAGCTGGTGCGGCGCCACCTGGTCACCTTCCGGGCCATGTCAGCCCGGCTGCTGGACTATGTGGTCAACATCGCCGACAGCAACGGCAACACCGCGCTACACTACTCTGTGTCCCATGCCAACTTCCCCGTGGTACGACAGCTGCTGGACAGCGGCCTCTGCCAGGTGGACAAACAGAACCGTGCCGGCTACAGCCCCATCATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCAAGACTGTCGTTCAGCTCTTCCGCCTTGGAGATGTCAATGCCAAAGCCAGCCAGGCGGGGCAGACGGCCCTGATGCTGGCGGTCAGCCACGGCCGGGTGGACGTGGTCAAAGCCCTGCTGGCCTGCGAGGCGGACGTCAACATCCAAGACGACGACGGCTCCACAGCCCTCATGTGCGCCTGCGAGCACGGCCACAAGGAGATTGCGGGGCTGCTGCTGGCCGTGCCCAGCTGCGACATCTCGCTCACGGACCGTGACGGGAGCACCGCACTCATGGTGGCACTGGACGTGGGGCAGAGCGAGATCGCGTCCATGCTGTACTCGCGGATGAACATCAAGTGCTCGGTGAGCCCGGGGCAGCCGGGCTGGGAGGGCTGGTGCCTGCCTGGGCGTCCTGGGGCTGTGGGAAGAGGTTCAGCCACAGGGTCGCAGTATTCGCACCCAGGTCTATGTGGCTGCAAACGTGTGCTCCGAGTCACGGTTCACTGGTGCTGGAAATGCGGAAGTTACTGCACATGCAGAGGGGTCCCATCCTGCTAA

XM_004865560.1 Coding sequence

Kank2 KN motif and ankyrin repeat domains 2, transcript variant X1

Length: 2736 bp    Location: 3062057..3043305   Strand: -
>XM_004865560.1
ATGGCCCAGGTCCTGCACGTGCCAGCCCCATTCCCAGGGACCCCCGGCCCCACCTCACCGCCTGCCTTCCCACCCAAGGAGCCCGACCCTCCTTACTCTGTGGAGACACCCTACGGCTACCACCTGGACCTGGACTTCCTCAAGTATGTAGACGACATTGAGAAGGGCCACACACTGCGGCGGGTGGCCGTGCAGCGCCGTCCCCGCCTGGGCTCCCTGCCCCGAGGGCCAGGCTCCTGGTGGACGTCCACGGAGTCGCTGTGCTCCAATGCAAGCGGGGACAGCCGCCACTCGGCCTACTCCTACTGCGGCCGAGGCTTCTACCCGCAGTATGGCGCCCTGGAGACAGGCGGCACTGGTGGCTTCAACCCCCGAGTGGAGCGGACGCTGCTGGACGCCCGGCGCCGCCTCGAGGACCAGGCAGCCGCACCCTCGGGCCTGGGCTCCCTGACGCCCAGCGCCGCCGGCTCCACCAGCTCCCTGGTGGGTGTGGGGCTGCCGCCCCCTCTAACGCCACGTGGCTCGGGACTGTCCACGCCAGTGCCGCCCAGCGCCGGGCACCTGGCACATGTGCGGGAGCAGATGGCAGGCGCCCTGCGGAAGCTGCGGCAGCTGGAGGAGCAGGTGAAGCTGATCCCAGTGCTCCAGGTGAAGCTGTCCGTGCTCCAGGAGGAGAAGCGGCAGCTCGCCGTGCAGCTCAAGAGCCAGAAGTTCCTGGGCCACCCCGCCGGCGCGTGGGCCCGCAGCGAGCTCTGCCTGGACCTCCCTGAGCCCCTCGAAGACCCTTCGGCACTTGACGCCCGCAGTGTGGGCACCTGGGTTCGAGAACGGGACTTGGGCTTGCCTGACGGGGAGGCGGCGCTCGCTGCCAAGGTCGCCGTGTTGGAGACGCAGCTCAAGAAGGCACTGCAGGACCTGCAGGCGGCCCAGGCCCGGCAGGCCGAGCCCCAGCCCCAGGCCTGGCCGCCACCCGACACTCCGGTCCGCGTGGACACCATCCGAGTGGTGGAGGGGCCTCGGGAGGTGGAGGTGGCAGCCAGCACCACCACCGGGGCCCCTGCCCAGCGAGCCCAGAGCCTGGAGCCCTACGGGACAGGCCTGAGGGCCTTGGTGACATCGGGGGAGCCTGAGAGCCCCGCCATGTTCTGCAGCCACGAGGTAGTGGAGACCATGTGCCCAGTGCCCACTGTGCCCGCCAGCAACATCCACGTAGTCAAGAAAATCAGCATCACAGAGCGGAGCTGTGAGGTGGCCACAGGGTCGGCATCAGAGGAGAACACAGGCCGGGTGGCTGCCGCTGACCCTGCCCACGGGGAGCCCCCCAGCCAGGTGTCGTGGGCGTCGGGGGACCCGGGGGGAGCAGGAGGGCCCCAGGTGGGAATGCGGTCCATCATGAAGAGGAAGGAGGAGCCCGCAGACCCGGCAGCGCAGGGGAGGAGCCTGCAGTTCGTGGGAGTCAATGGCGGGTACGAGTCCTCCTCCGAAGGCTCCAGCACAGCCGAGAACTTCTCCGACAATGACAGCACAGAGAATGAGGCTCCGGAGCCGGAAGAGAGGCTTCCAAGTGTGGCCGGAGCCCCACAGTGCAGGCCCCCAGGGACCACTGCAGTGGCGCCCCAGACCAGCCTGCCGGGGTGCCAGCTATCTCGGGAGGCTCAGCATGCGCCCCTGGCTGAGGAGGCAGCGGGCACCAACTCTGAGGACGAGATCCGGATGGAGCTGAGCCCTGACCTCATCTCGGCCTGCCTGGCGCTGGAGAAATACCTGGGCAACGCCAACGCGCTTACCGAGCGGGAGCTGAAAGTGGCCTACACCACCGTGCTGCAGGAGTGGTTGCGCCTGGCCTGCCGCAGCGACGCCCACCCTGAGCTGGTGCGGCGCCACCTGGTCACCTTCCGGGCCATGTCAGCCCGGCTGCTGGACTATGTGGTCAACATCGCCGACAGCAACGGCAACACCGCGCTACACTACTCTGTGTCCCATGCCAACTTCCCCGTGGTACGACAGCTGCTGGACAGCGGCCTCTGCCAGGTGGACAAACAGAACCGTGCCGGCTACAGCCCCATCATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCAAGACTGTCGTTCAGCTCTTCCGCCTTGGAGATGTCAATGCCAAAGCCAGCCAGGCGGGGCAGACGGCCCTGATGCTGGCGGTCAGCCACGGCCGGGTGGACGTGGTCAAAGCCCTGCTGGCCTGCGAGGCGGACGTCAACATCCAAGACGACGACGGCTCCACAGCCCTCATGTGCGCCTGCGAGCACGGCCACAAGGAGATTGCGGGGCTGCTGCTGGCCGTGCCCAGCTGCGACATCTCGCTCACGGACCGTGTGAGTCCCCACACCCACCCCAGGGAGGGCGGGACTCAGCCGGGCAGGCAGGCGCATAGCAACAGCTGTTCTGCAGGACGGGAGCACCGCACTCATGGTGGCACTGGACGTGGGGCAGAGCGAGATCGCGTCCATGCTGTACTCGCGGATGAACATCAAGTGCTCGGTGAGCCCGGGGCAGCCGGGCTGGGAGGGCTGGTGCCTGCCTGGGCGTCCTGGGGCTGTGGGAAGAGGTTCAGCCACAGGGTCGCAGTATTCGCACCCAGGTCTATGTGGCTGCAAACGTGTGCTCCGAGTCACGGTTCACTGGTGCTGGAAATGCGGAAGTTACTGCACATGCAGAGGGGTCCCATCCTGCTAAAGCCCGCGTAA

XM_004865563.1 Coding sequence

Kank2 KN motif and ankyrin repeat domains 2, transcript variant X4

Length: 2649 bp    Location: 3062056..3043305   Strand: -
>XM_004865563.1
ATGGCCCAGGTCCTGCACGTGCCAGCCCCATTCCCAGGGACCCCCGGCCCCACCTCACCGCCTGCCTTCCCACCCAAGGAGCCCGACCCTCCTTACTCTGTGGAGACACCCTACGGCTACCACCTGGACCTGGACTTCCTCAAGTATGTAGACGACATTGAGAAGGGCCACACACTGCGGCGGGTGGCCGTGCAGCGCCGTCCCCGCCTGGGCTCCCTGCCCCGAGGGCCAGGCTCCTGGTGGACGTCCACGGAGTCGCTGTGCTCCAATGCAAGCGGGGACAGCCGCCACTCGGCCTACTCCTACTGCGGCCGAGGCTTCTACCCGCAGTATGGCGCCCTGGAGACAGGCGGCACTGGTGGCTTCAACCCCCGAGTGGAGCGGACGCTGCTGGACGCCCGGCGCCGCCTCGAGGACCAGGCAGCCGCACCCTCGGGCCTGGGCTCCCTGACGCCCAGCGCCGCCGGCTCCACCAGCTCCCTGGTGGGTGTGGGGCTGCCGCCCCCTCTAACGCCACGTGGCTCGGGACTGTCCACGCCAGTGCCGCCCAGCGCCGGGCACCTGGCACATGTGCGGGAGCAGATGGCAGGCGCCCTGCGGAAGCTGCGGCAGCTGGAGGAGCAGGTGAAGCTGATCCCAGTGCTCCAGGTGAAGCTGTCCGTGCTCCAGGAGGAGAAGCGGCAGCTCGCCGTGCAGCTCAAGAGCCAGAAGTTCCTGGGCCACCCCGCCGGCGCGTGGGCCCGCAGCGAGCTCTGCCTGGACCTCCCTGAGCCCCTCGAAGACCCTTCGGCACTTGACGCCCGCAGTGTGGGCACCTGGGTTCGAGAACGGGACTTGGGCTTGCCTGACGGGGAGGCGGCGCTCGCTGCCAAGGTCGCCGTGTTGGAGACGCAGCTCAAGAAGGCACTGCAGGACCTGCAGGCGGCCCAGGCCCGGCAGGCCGAGCCCCAGCCCCAGGCCTGGCCGCCACCCGACACTCCGGTCCGCGTGGACACCATCCGAGTGGTGGAGGGGCCTCGGGAGGTGGAGGTGGCAGCCAGCACCACCACCGGGGCCCCTGCCCAGCGAGCCCAGAGCCTGGAGCCCTACGGGACAGGCCTGAGGGCCTTGGTGACATCGGGGGAGCCTGAGAGCCCCGCCATGTTCTGCAGCCACGAGGTAGTGGAGACCATGTGCCCAGTGCCCACTGTGCCCGCCAGCAACATCCACGTAGTCAAGAAAATCAGCATCACAGAGCGGAGCTGTGAGGTGGCCACAGGGTCGGCATCAGAGGAGAACACAGGCCGGGTGGCTGCCGCTGACCCTGCCCACGGGGAGCCCCCCAGCCAGGTGTCGTGGGCGTCGGGGGACCCGGGGGGAGCAGGAGGGCCCCAGGTGGGAATGCGGTCCATCATGAAGAGGAAGGAGGAGCCCGCAGACCCGGCAGCGCAGGGGAGGAGCCTGCAGTTCGTGGGAGTCAATGGCGGGTACGAGTCCTCCTCCGAAGGCTCCAGCACAGCCGAGAACTTCTCCGACAATGACAGCACAGAGAATGAGGCTCCGGAGCCGGAAGAGAGGCTTCCAAGTGTGGCCGGAGCCCCACAGTGCAGGCCCCCAGGGACCACTGCAGTGGCGCCCCAGACCAGCCTGCCGGGGTGCCAGCTATCTCGGGAGGCTCAGCATGCGCCCCTGGCTGAGGAGGCAGCGGGCACCAACTCTGAGGACGAGATCCGGATGGAGCTGAGCCCTGACCTCATCTCGGCCTGCCTGGCGCTGGAGAAATACCTGGGCAACGCCAACGCGCTTACCGAGCGGGAGCTGAAAGTGGCCTACACCACCGTGCTGCAGGAGTGGTTGCGCCTGGCCTGCCGCAGCGACGCCCACCCTGAGCTGGTGCGGCGCCACCTGGTCACCTTCCGGGCCATGTCAGCCCGGCTGCTGGACTATGTGGTCAACATCGCCGACAGCAACGGCAACACCGCGCTACACTACTCTGTGTCCCATGCCAACTTCCCCGTGGTACGACAGCTGCTGGACAGCGGCCTCTGCCAGGTGGACAAACAGAACCGTGCCGGCTACAGCCCCATCATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCAAGACTGTCGTTCAGCTCTTCCGCCTTGGAGATGTCAATGCCAAAGCCAGCCAGGCGGGGCAGACGGCCCTGATGCTGGCGGTCAGCCACGGCCGGGTGGACGTGGTCAAAGCCCTGCTGGCCTGCGAGGCGGACGTCAACATCCAAGACGACGACGGCTCCACAGCCCTCATGTGCGCCTGCGAGCACGGCCACAAGGAGATTGCGGGGCTGCTGCTGGCCGTGCCCAGCTGCGACATCTCGCTCACGGACCGTGACGGGAGCACCGCACTCATGGTGGCACTGGACGTGGGGCAGAGCGAGATCGCGTCCATGCTGTACTCGCGGATGAACATCAAGTGCTCGGTGAGCCCGGGGCAGCCGGGCTGGGAGGGCTGGTGCCTGCCTGGGCGTCCTGGGGCTGTGGGAAGAGGTTCAGCCACAGGGTCGCAGTATTCGCACCCAGGTCTATGTGGCTGCAAACGTGTGCTCCGAGTCACGGTTCACTGGTGCTGGAAATGCGGAAGTTACTGCACATGCAGAGGGGTCCCATCCTGCTAA

XM_004865562.1 Coding sequence

Kank2 KN motif and ankyrin repeat domains 2, transcript variant X3

Length: 2736 bp    Location: 3062043..3043305   Strand: -
>XM_004865562.1
ATGGCCCAGGTCCTGCACGTGCCAGCCCCATTCCCAGGGACCCCCGGCCCCACCTCACCGCCTGCCTTCCCACCCAAGGAGCCCGACCCTCCTTACTCTGTGGAGACACCCTACGGCTACCACCTGGACCTGGACTTCCTCAAGTATGTAGACGACATTGAGAAGGGCCACACACTGCGGCGGGTGGCCGTGCAGCGCCGTCCCCGCCTGGGCTCCCTGCCCCGAGGGCCAGGCTCCTGGTGGACGTCCACGGAGTCGCTGTGCTCCAATGCAAGCGGGGACAGCCGCCACTCGGCCTACTCCTACTGCGGCCGAGGCTTCTACCCGCAGTATGGCGCCCTGGAGACAGGCGGCACTGGTGGCTTCAACCCCCGAGTGGAGCGGACGCTGCTGGACGCCCGGCGCCGCCTCGAGGACCAGGCAGCCGCACCCTCGGGCCTGGGCTCCCTGACGCCCAGCGCCGCCGGCTCCACCAGCTCCCTGGTGGGTGTGGGGCTGCCGCCCCCTCTAACGCCACGTGGCTCGGGACTGTCCACGCCAGTGCCGCCCAGCGCCGGGCACCTGGCACATGTGCGGGAGCAGATGGCAGGCGCCCTGCGGAAGCTGCGGCAGCTGGAGGAGCAGGTGAAGCTGATCCCAGTGCTCCAGGTGAAGCTGTCCGTGCTCCAGGAGGAGAAGCGGCAGCTCGCCGTGCAGCTCAAGAGCCAGAAGTTCCTGGGCCACCCCGCCGGCGCGTGGGCCCGCAGCGAGCTCTGCCTGGACCTCCCTGAGCCCCTCGAAGACCCTTCGGCACTTGACGCCCGCAGTGTGGGCACCTGGGTTCGAGAACGGGACTTGGGCTTGCCTGACGGGGAGGCGGCGCTCGCTGCCAAGGTCGCCGTGTTGGAGACGCAGCTCAAGAAGGCACTGCAGGACCTGCAGGCGGCCCAGGCCCGGCAGGCCGAGCCCCAGCCCCAGGCCTGGCCGCCACCCGACACTCCGGTCCGCGTGGACACCATCCGAGTGGTGGAGGGGCCTCGGGAGGTGGAGGTGGCAGCCAGCACCACCACCGGGGCCCCTGCCCAGCGAGCCCAGAGCCTGGAGCCCTACGGGACAGGCCTGAGGGCCTTGGTGACATCGGGGGAGCCTGAGAGCCCCGCCATGTTCTGCAGCCACGAGGTAGTGGAGACCATGTGCCCAGTGCCCACTGTGCCCGCCAGCAACATCCACGTAGTCAAGAAAATCAGCATCACAGAGCGGAGCTGTGAGGTGGCCACAGGGTCGGCATCAGAGGAGAACACAGGCCGGGTGGCTGCCGCTGACCCTGCCCACGGGGAGCCCCCCAGCCAGGTGTCGTGGGCGTCGGGGGACCCGGGGGGAGCAGGAGGGCCCCAGGTGGGAATGCGGTCCATCATGAAGAGGAAGGAGGAGCCCGCAGACCCGGCAGCGCAGGGGAGGAGCCTGCAGTTCGTGGGAGTCAATGGCGGGTACGAGTCCTCCTCCGAAGGCTCCAGCACAGCCGAGAACTTCTCCGACAATGACAGCACAGAGAATGAGGCTCCGGAGCCGGAAGAGAGGCTTCCAAGTGTGGCCGGAGCCCCACAGTGCAGGCCCCCAGGGACCACTGCAGTGGCGCCCCAGACCAGCCTGCCGGGGTGCCAGCTATCTCGGGAGGCTCAGCATGCGCCCCTGGCTGAGGAGGCAGCGGGCACCAACTCTGAGGACGAGATCCGGATGGAGCTGAGCCCTGACCTCATCTCGGCCTGCCTGGCGCTGGAGAAATACCTGGGCAACGCCAACGCGCTTACCGAGCGGGAGCTGAAAGTGGCCTACACCACCGTGCTGCAGGAGTGGTTGCGCCTGGCCTGCCGCAGCGACGCCCACCCTGAGCTGGTGCGGCGCCACCTGGTCACCTTCCGGGCCATGTCAGCCCGGCTGCTGGACTATGTGGTCAACATCGCCGACAGCAACGGCAACACCGCGCTACACTACTCTGTGTCCCATGCCAACTTCCCCGTGGTACGACAGCTGCTGGACAGCGGCCTCTGCCAGGTGGACAAACAGAACCGTGCCGGCTACAGCCCCATCATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCAAGACTGTCGTTCAGCTCTTCCGCCTTGGAGATGTCAATGCCAAAGCCAGCCAGGCGGGGCAGACGGCCCTGATGCTGGCGGTCAGCCACGGCCGGGTGGACGTGGTCAAAGCCCTGCTGGCCTGCGAGGCGGACGTCAACATCCAAGACGACGACGGCTCCACAGCCCTCATGTGCGCCTGCGAGCACGGCCACAAGGAGATTGCGGGGCTGCTGCTGGCCGTGCCCAGCTGCGACATCTCGCTCACGGACCGTGTGAGTCCCCACACCCACCCCAGGGAGGGCGGGACTCAGCCGGGCAGGCAGGCGCATAGCAACAGCTGTTCTGCAGGACGGGAGCACCGCACTCATGGTGGCACTGGACGTGGGGCAGAGCGAGATCGCGTCCATGCTGTACTCGCGGATGAACATCAAGTGCTCGGTGAGCCCGGGGCAGCCGGGCTGGGAGGGCTGGTGCCTGCCTGGGCGTCCTGGGGCTGTGGGAAGAGGTTCAGCCACAGGGTCGCAGTATTCGCACCCAGGTCTATGTGGCTGCAAACGTGTGCTCCGAGTCACGGTTCACTGGTGCTGGAAATGCGGAAGTTACTGCACATGCAGAGGGGTCCCATCCTGCTAAAGCCCGCGTAA

XM_004865567.1 Coding sequence

LOC101706461 chromosome unknown open reading frame, human C19orf80, transcript variant X1

Length: 846 bp    Location: 3092696..3094919   Strand: +
>XM_004865567.1
ATGCCTATGCTCACTCTGTGCCTCCTGTGGGTCCTGAGCACAACAGCCTGGCCTGCCCCAGTGGCCCCCATTGGTGACCCAGAGCCGGCACAGCATGAAGAGCTGACCTTGCTCTTCCACGGAGCCCTACAGTTGGCTCAGGCCCTCAACAGTGTATACAAGGCCACCGAGGCACGGCTGATGGAGGCCAGGCATAGCCTGGGCCTCTATGGCCACGCACTACAGCTCCTGGGATTACAAGTCAGCCAAGGCCAGGATGCAACTCAGGAACTCCGCACGAACTTGTTGGGAATACAGATGGATGAAGACACTCTGCAGCTGCAAGCGAAGGCCACGGCCCAGGAGTTGGCGGAGGTGGCCCAGGCCCAGCAGGTGCTTCAGGACAGTGTGCAGCGCCTGGACGGCCAGCTGAGGGGTGCCTGGCTGGGCCGTGCCCACCATGAACTTGAGACCTTAAAGGTTCATGCTGACAAGCAGAGCCACCTCATGTGGGTCCTCACGGGCCACATGCAGCGACAGAGGCGAGAGATGGCAGAGCAGCAGCAATGGCTGCAGCAGATTGAGGAGCGAGTTGAGTGTTCCTCCCCAGGCTGCACACAGCGGCACTCCCAGCCTGAGCACGTCTACGTGGACCAGAGGACCAGTCGTGCAGCAAGAGATGTGTCCAAGGGACATCTCCACGTGCCATGCGGCCCTGCGAAGGTGGAGCTGCCTGTCTGCTGGGGTCGGCCAGGGCGCTCTGGTTCCGGGCACAGGGCAGAGGCGGCAGCCGGCGGGGCACAGGCAAAGGATGCAGCCCCGAGAGCAGGGAGGAGGAAGGATGTATATTCCTTCTCGCCTCATTAA

XM_004865568.1 Coding sequence

LOC101706461 chromosome unknown open reading frame, human C19orf80, transcript variant X2

Length: 597 bp    Location: 3092696..3094919   Strand: +
>XM_004865568.1
ATGCCTATGCTCACTCTGTGCCTCCTGTGGGTCCTGAGCACAACAGCCTGGCCTGCCCCAGTGGCCCCCATTGGTGACCCAGAGCCGGCACAGCATGAAGAGCTGACCTTGCTCTTCCACGGAGCCCTACAGTTGGCTCAGGCCCTCAACAGTGTATACAAGGCCACCGAGGCACGGCTGATGGAGGCCAGGCATAGCCTGGGCCTCTATGGCCACGCACTACAGCTCCTGGGATTACAAGTCAGCCAAGGCCAGGATGCAACTCAGGAACTCCGCACGAACTTGTTGGGAATACAGATGGATGAAGACACTCTGCAGCTGCAAGCGAAGGCCACGGCCCAGGAGTTGGCGGAGGTGGCCCAGGCCCAGCAGGTGCTTCAGGACAGTGTGCAGCGCCTGGACGGCCAGCTGAGGGGTGCCTGGCTGGGCCGTGCCCACCATGAACTTGAGACCTTAAAGGTTCATGCTGACAAGCAGAGCCACCTCATGTGGGTCCTCACGGGCCACATGCAGCGACAGAGGCGAGAGATGGCAGAGCAGCAGCAATGGCTGCAGCAGATTGAGGAGCGGCTGCACACAGCGGCACTCCCAGCCTGA

XM_004866059.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 810 bp    Location: 3124987..3144286   Strand: +
>XM_004866059.1
ATGGCGGAGCCGCAGGCGCACAGGCCCTACTCCTTGAGGAGGTTGCTGTCACTCCTCAACAGCCTGGTGGCTGCATCCGGTGTGATCCTCATTGGCCTGGGCGTTGGTATCAAGTATGGAGAGGCTGCCCTGACCAGGGTCCTGGGGCCGGCATCCACATATCACCTGCACATCAGCCACCTGTGCCTGGGCTTGGGCTGCCTCGCAGTACTGCTGGCCCTGGTTGGGTGGTGCATCGCGAAGAAAGAAAGCCGAGGTAGCCTCTTGTTTTTCCTCGTGACCATGGCTGTCATTCTCGTGGTGGAGATCACGGTGGCCTCGGTGGTCCTAGCTTTCTTCCCGGTGGTTCGCAATATGGGGCTGGAGCACAACATCGTCACCCTGAGGAGGGGCTACAGAGGCTACACACGAGCTGAGCTGGATGATTTCTCTGCACAGTGGAACTCAGTCATGGAGAAGCTAAAGTGCTCTGGGGTGAACAACTACACAGATTTTCCCAGCTCTTCCTTCTCGATGGTGACAGGCCACTCCTACCCCAGGGGCTGCTGTAAATCCCTGGGTGCTATGGCCTGCGATGGGCACAACGTGTCATCCAGTGTCATTCACCAGGCGGGCTGCTTCCACAGGCTCCTGAAAATCACCAAGACACAGAGCTACACCCTGAACTGGGTCTCCTTGGGGATGGCATTGATGCAGAATGCAGAGGCCCTCAGAGGGGACTTCTCCGTCAGCATGAATGTCACAGCCCTGGACCCAAGGATGCCACAGCTCCGGAAACGGACACCGGATCCTCCAGCTGAAGAAGCCTGA

XM_004865573.1 Coding sequence

Rab3d RAB3D, member RAS oncogene family, transcript variant X3

High confidence: 4 potential gene matches
Length: 660 bp    Location: 3149519..3144915   Strand: -
>XM_004865573.1
ATGGCATCAGCCGGAGACCCCACTGCGGGCCCTCGGGATGCCGCTGACCAGAATTTCGACTACATGTTCAAGCTCCTGCTGATTGGCAACAGCAGCGTGGGCAAGACATCTTTCCTCTTCCGATACGCTGACGACTCCTTCACCCCCGCCTTTGTCAGCACTGTGGGCATCGACTTCAAGGTCAAGACCGTCTACCGCCACGACAAGAGGATCAAGCTGCAGATCTGGGACACGGCAGGCCAGGAGCGCTACAGGACCATCACCACAGCCTACTACCGCGGAGCCATGGGCTTCCTGCTCATGTATGACATCTCCAACCAGGAGTCCTTTGCCGCCGTGCAGGACTGGGCCACACAGATCAAGACCTACTCCTGGGACAATGCTCAGGTCATCCTGGTGGGAAACAAATGTGACCTGGAGGACGAGCGGGTTGTGCCTACGGAGGACGGCTGGAGACTCGCCAATGACCTTGGGTTCGAGTTCTTTGAGGCCAGTGCCAAGGAGAACATCAACGTGAAGCAGGTGTTTGAGCGCCTGGTGGATGTCATCTGCGAGAAGATGAACGAATCCTTGGAAGCCAGCTCCAGCCCAGGCAGCAATGGGAAAGGCCCAGCCCTAGGGGACCCTGTGCCACCCCAGCCCAGCAGCTGTGGCTGTTAG

XM_004865572.1 Coding sequence

Rab3d RAB3D, member RAS oncogene family, transcript variant X2

Length: 660 bp    Location: 3149519..3144915   Strand: -
>XM_004865572.1
ATGGCATCAGCCGGAGACCCCACTGCGGGCCCTCGGGATGCCGCTGACCAGAATTTCGACTACATGTTCAAGCTCCTGCTGATTGGCAACAGCAGCGTGGGCAAGACATCTTTCCTCTTCCGATACGCTGACGACTCCTTCACCCCCGCCTTTGTCAGCACTGTGGGCATCGACTTCAAGGTCAAGACCGTCTACCGCCACGACAAGAGGATCAAGCTGCAGATCTGGGACACGGCAGGCCAGGAGCGCTACAGGACCATCACCACAGCCTACTACCGCGGAGCCATGGGCTTCCTGCTCATGTATGACATCTCCAACCAGGAGTCCTTTGCCGCCGTGCAGGACTGGGCCACACAGATCAAGACCTACTCCTGGGACAATGCTCAGGTCATCCTGGTGGGAAACAAATGTGACCTGGAGGACGAGCGGGTTGTGCCTACGGAGGACGGCTGGAGACTCGCCAATGACCTTGGGTTCGAGTTCTTTGAGGCCAGTGCCAAGGAGAACATCAACGTGAAGCAGGTGTTTGAGCGCCTGGTGGATGTCATCTGCGAGAAGATGAACGAATCCTTGGAAGCCAGCTCCAGCCCAGGCAGCAATGGGAAAGGCCCAGCCCTAGGGGACCCTGTGCCACCCCAGCCCAGCAGCTGTGGCTGTTAG

XM_004865637.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X6

Length: 1902 bp    Location: 3812114..3805151   Strand: -
>XM_004865637.1
ATGGCAGAGAGCGAGAGGAGGGGGCTCGGCTGCTGGAACCCCATAGAGTTAGGGCAGCGGCTTCTTCTGCTGCTGTTGGTGGGCAGCTGTTCGGGGCGTATCCACCGACTGGCGCTGACGGGGGAGAAGCGAGCAGACATCCAACTCAATAGCTTCGGCTTCTACATCAATGGTTCCCTGGAAGTGGAGTTGAGCCTCTTGCGGCTGAGCCCCCAGGAGACAGAAGAGAAGTCGCCGTTGGTGGGGTTCAGCCTGAGCAGGGTTCGATCTGGCAGCATCCGATCCTACTCAGTAAGTGGGGGAGTGAGGAAGTACTGTGGGGGTACTGGGTGGGGCTGTCTCCTGTCTCTGGAGCCTGAAGACCCCTGCTCTTTCCCAGAAGTGGGGGCAGGAACAGATCCTGAGGGAAGGAGGGAGGCAGGGTGGGGCTGGGACCACAGGAAGCCGGAACCCAGGTTCCCTCTGCCCACTCCCAGGCCCAGGATTCCCATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGGTCCAGGTACGGAAGTATGGGGCACAGGAGAAACTGTTCATCTCTCCCGGGCTCCTCCCTGCCAAACCTGGGCTCCCCAAGGCAGAGCACACTGACACTCCTGAGGTGGACAGCGGAAACTCCACAGCTGGCAAAGCCAAGGCTAAACCTGCAGGGTCTCAGGTTTGGGGAGCTGGGGTGGGCCGGAGAAAGGTATACCCCAAGGGTGTTTGGGTTCCCAAGCCCGGGGCCAGCTGTTGGAAGGGCTCTGCCCCCTCAGGGTCCCGTTGAGAAGAACAAGGACCTGGTGTTGGACCTGGGCCACCTCAATGACTCCTACAACTTCAGTTTCCACGTGGTGATTGGCTCCAGGGCCGAGGAAGGCCAGTACAACCTCAACTTCCACAACTGCTACAACCTGATGCCTGGCCAGGAACGCCCCTTCGACCTCACAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGTGTTGGTGAACCTGGCCAAGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATGTCTACTTCACACGCATCATCGCCATCCTGCTGCGCGTGGCTGTGCCCTTCCAGTGGCAATGGCTGTACCAGCTCTTAGTGGAGGGCTCCACGCTCGCCTTCTTTGTGCTCACGGGCTACAAGTTCCAGCCCACCAGGGACAACCCGTACCTGCAGCTGCCCCAGGAGGACGAGGAGGACGTACAGATGGAGCAAGTGATGACGGACTCTGGGTTCCGGGAAGGCCTCTCCAAAGTCAACAAAACAGCAAGCGGACGAGAGCAGTTGTGA

XM_004865571.1 Coding sequence

Rab3d RAB3D, member RAS oncogene family, transcript variant X1

Length: 867 bp    Location: 3149519..3144915   Strand: -
>XM_004865571.1
ATGGACCATATGGTGATGGGGGAGGAGGCTGAGCGCCCCTGCACCCCTGGGGGGCCCCAGAGCAGTGAACGGGGACAGATCGCGCCCGCAGGACCCTGGCAGCCTGGCCTGCGTGAGGAGGGTCGGCAGAGGGTCGGACCGGAGGAGGGGGCGCTGCGACCCGAAGAGGGCTTCTGTCTTCCCCAGCTCCCCGAGGTCCCTGGCAAGATGGCATCAGCCGGAGACCCCACTGCGGGCCCTCGGGATGCCGCTGACCAGAATTTCGACTACATGTTCAAGCTCCTGCTGATTGGCAACAGCAGCGTGGGCAAGACATCTTTCCTCTTCCGATACGCTGACGACTCCTTCACCCCCGCCTTTGTCAGCACTGTGGGCATCGACTTCAAGGTCAAGACCGTCTACCGCCACGACAAGAGGATCAAGCTGCAGATCTGGGACACGGCAGGCCAGGAGCGCTACAGGACCATCACCACAGCCTACTACCGCGGAGCCATGGGCTTCCTGCTCATGTATGACATCTCCAACCAGGAGTCCTTTGCCGCCGTGCAGGACTGGGCCACACAGATCAAGACCTACTCCTGGGACAATGCTCAGGTCATCCTGGTGGGAAACAAATGTGACCTGGAGGACGAGCGGGTTGTGCCTACGGAGGACGGCTGGAGACTCGCCAATGACCTTGGGTTCGAGTTCTTTGAGGCCAGTGCCAAGGAGAACATCAACGTGAAGCAGGTGTTTGAGCGCCTGGTGGATGTCATCTGCGAGAAGATGAACGAATCCTTGGAAGCCAGCTCCAGCCCAGGCAGCAATGGGAAAGGCCCAGCCCTAGGGGACCCTGTGCCACCCCAGCCCAGCAGCTGTGGCTGTTAG

XM_004865576.1 Coding sequence

Tmem205 transmembrane protein 205, transcript variant X2

High confidence: 4 potential gene matches
Length: 570 bp    Location: 3152635..3150777   Strand: -
>XM_004865576.1
ATGGAGGAAGGCAGAGACCCAGGAGGCCTGGTGAAGGTGGTCCATCTGCTGGTCCTGTCTGGTGCCTGGGGCATGCAAATGTGGGTGACCTTCGCCTCAGGCTTCCTGCTTTTCCGAAACCTTCCCCGGCACACCTTCGGCCTAGTGCAAAGCAAACTCTTCCCTTTCTACTTCCACATCTCTATGGCCTGTGCCTTTAGCAACCTCTGCATCGCAGTTTCCCAGTGTGCCTGGGTTCAGCTTACATTCTGGGAGGCCAGCCAGTGCTGCCTCCTGCTTCTGAGCCTCGTGCTGACTGCCATCAACGCCCGCTGGCTAGAGCCTCGCACCACGGCTGCTATGTGGGCTCTGCAGAGTGTGGAGAAGGAACGGGGTCTGGGTGGGGAGGTGCCAGGCAGCCTCCAGGGCCCCGACCCCTACCGCCAGCTGCGGGACAAGGACCCGAAGTACAGTGCTCTCCGCCAGAACTTCTTCCACTACCATGGCCTCTCCTCAATCTGCAACCTGGGCTGTGTCCTGAGCAATGGTCTCTGCCTCGCCGGCCTGGCCCTGGGCCTCCGAAGCCTCTAG

XM_004865575.1 Coding sequence

Tmem205 transmembrane protein 205, transcript variant X1

Length: 570 bp    Location: 3152613..3150777   Strand: -
>XM_004865575.1
ATGGAGGAAGGCAGAGACCCAGGAGGCCTGGTGAAGGTGGTCCATCTGCTGGTCCTGTCTGGTGCCTGGGGCATGCAAATGTGGGTGACCTTCGCCTCAGGCTTCCTGCTTTTCCGAAACCTTCCCCGGCACACCTTCGGCCTAGTGCAAAGCAAACTCTTCCCTTTCTACTTCCACATCTCTATGGCCTGTGCCTTTAGCAACCTCTGCATCGCAGTTTCCCAGTGTGCCTGGGTTCAGCTTACATTCTGGGAGGCCAGCCAGTGCTGCCTCCTGCTTCTGAGCCTCGTGCTGACTGCCATCAACGCCCGCTGGCTAGAGCCTCGCACCACGGCTGCTATGTGGGCTCTGCAGAGTGTGGAGAAGGAACGGGGTCTGGGTGGGGAGGTGCCAGGCAGCCTCCAGGGCCCCGACCCCTACCGCCAGCTGCGGGACAAGGACCCGAAGTACAGTGCTCTCCGCCAGAACTTCTTCCACTACCATGGCCTCTCCTCAATCTGCAACCTGGGCTGTGTCCTGAGCAATGGTCTCTGCCTCGCCGGCCTGGCCCTGGGCCTCCGAAGCCTCTAG

XM_004865578.1 Coding sequence

LOC101709474 lipid phosphate phosphatase-related protein type 2-like, transcript variant X2

Length: 1290 bp    Location: 3159228..3168024   Strand: +
>XM_004865578.1
ATGGCGGGAGGGAGACCGCACCTGAAAAGGAGCTTCTCCATCATTCCCTGCTTTGTCTTTGTGGAGGGCTTCTTCTGCTATGACAGTACCTATGCCAAGCCTTACCCAGGGCCTGAGGCCAGCAGCCGAGCACCTCCTGCCCTCATCTATGCCCTGGTCACTGCTGGGCCCACCCTCACGATCCTGCTGGGTGAGTTGGCGCGGGCCTTCTTTCCCACACCACCCTCAGCCAGCCCTGTCGTTGGGGAGAGCACCATTGTATCAGGGGCCTGCTGTCGCTTCAGCCCCCCGCTGCGGAGGCTGGTCCGCTTCCTGGGAGTGTACTCCTTCGGCCTCTTCACCACGACCATCTTTGCCAACGCGGGACAGGTGGTGACTGGCAACCCCACGCCACACTTTCTGTCCGTGTGCCGCCCCAACTACACGGCCCTGGGCTGCCCTCCGCCCTCTCCTGACCGGCCAGGGCCGGACCGCTTTGTCACCGACCAGGGCGCCTGCGCGGGGAGCCCCAGCCTGGTGGCCGCCGCACGCCGCGCCTTCCCCTGCAAGGACGCGGCCCTCTGCGCCTACGCGGTCACCTACACGGCGATGTACGTGACCCTAGTGTTCCGCGTGAAGGGCTCCCGCCTGGTTAAGCCCTCCCTCTGCCTGGCCCTGCTGTGCCCTGCCTTCCTGGTGGGCGTGGTCCGCGTGGCTGAGTACCGCAACCACTGGTCTGACGTGCTGGCCGGCTTCCTAACCGGGGCGGCCATCGCCACCTTTCTGGTCACCTGTGTCGTCCACAATTTCCAGAGCCGGCCACCCTCTGGCCGAAGGCCCTCCCCCTGGGAGGACCTGGGCCCCACACCCACCATGGAGAGCCCCCTCGAAAAGTTAAGTGTGGCCCAGGAACCGGAGGCCTGCAGGCCGCATTCGACACCGGCGCGGCTCACCCCATCCAAGCCGCAGAACTGCGCCCGCCGTGGCCACCTGATGCCCAGCTGCGTGTCCTCCAGGGCCCCAGCCATGTGTTCGTCGCCCCGTGTGCCCCGCCCTCGATTGAGGTCTGAGCCAACGCCCCTGCCCCTGCCCCTGCCCCTGCCCGCGCCGGCGCCAACCCCCAGCCAGGGGCCCTCGCCCTCCTCCCCTGGACCTGGGGGGCCGGGCGGGGGCGGGGGGCGTGGCCGGAAGCTGCTGCTGCCCACGCCCCTGCTGCGGGACCTGTACACCCTGAGTGGACTCTATCCCTCCCCCTTCCACCGGGACAACTTCAGCCCTTACCTGTTTGCCAGCCGCGACCACCTGCTGTGA

XM_004865577.1 Coding sequence

LOC101709474 lipid phosphate phosphatase-related protein type 2-like, transcript variant X1

Length: 1365 bp    Location: 3159231..3168024   Strand: +
>XM_004865577.1
ATGGCGGGAGGGAGACCGCACCTGAAAAGGAGCTTCTCCATCATTCCCTGCTTTGTCTTTGTGGAGTCTGTTCTTCTGGGCATTGTGGTCCTGCTTGCTTACCGCCTGGAGTTCACAGACACCTTCCCGGTGCACACCCAGGGCTTCTTCTGCTATGACAGTACCTATGCCAAGCCTTACCCAGGGCCTGAGGCCAGCAGCCGAGCACCTCCTGCCCTCATCTATGCCCTGGTCACTGCTGGGCCCACCCTCACGATCCTGCTGGGTGAGTTGGCGCGGGCCTTCTTTCCCACACCACCCTCAGCCAGCCCTGTCGTTGGGGAGAGCACCATTGTATCAGGGGCCTGCTGTCGCTTCAGCCCCCCGCTGCGGAGGCTGGTCCGCTTCCTGGGAGTGTACTCCTTCGGCCTCTTCACCACGACCATCTTTGCCAACGCGGGACAGGTGGTGACTGGCAACCCCACGCCACACTTTCTGTCCGTGTGCCGCCCCAACTACACGGCCCTGGGCTGCCCTCCGCCCTCTCCTGACCGGCCAGGGCCGGACCGCTTTGTCACCGACCAGGGCGCCTGCGCGGGGAGCCCCAGCCTGGTGGCCGCCGCACGCCGCGCCTTCCCCTGCAAGGACGCGGCCCTCTGCGCCTACGCGGTCACCTACACGGCGATGTACGTGACCCTAGTGTTCCGCGTGAAGGGCTCCCGCCTGGTTAAGCCCTCCCTCTGCCTGGCCCTGCTGTGCCCTGCCTTCCTGGTGGGCGTGGTCCGCGTGGCTGAGTACCGCAACCACTGGTCTGACGTGCTGGCCGGCTTCCTAACCGGGGCGGCCATCGCCACCTTTCTGGTCACCTGTGTCGTCCACAATTTCCAGAGCCGGCCACCCTCTGGCCGAAGGCCCTCCCCCTGGGAGGACCTGGGCCCCACACCCACCATGGAGAGCCCCCTCGAAAAGTTAAGTGTGGCCCAGGAACCGGAGGCCTGCAGGCCGCATTCGACACCGGCGCGGCTCACCCCATCCAAGCCGCAGAACTGCGCCCGCCGTGGCCACCTGATGCCCAGCTGCGTGTCCTCCAGGGCCCCAGCCATGTGTTCGTCGCCCCGTGTGCCCCGCCCTCGATTGAGGTCTGAGCCAACGCCCCTGCCCCTGCCCCTGCCCCTGCCCGCGCCGGCGCCAACCCCCAGCCAGGGGCCCTCGCCCTCCTCCCCTGGACCTGGGGGGCCGGGCGGGGGCGGGGGGCGTGGCCGGAAGCTGCTGCTGCCCACGCCCCTGCTGCGGGACCTGTACACCCTGAGTGGACTCTATCCCTCCCCCTTCCACCGGGACAACTTCAGCCCTTACCTGTTTGCCAGCCGCGACCACCTGCTGTGA

XM_004865579.1 Coding sequence

LOC101709474 lipid phosphate phosphatase-related protein type 2-like, transcript variant X3

Length: 1032 bp    Location: 3159237..3166822   Strand: +
>XM_004865579.1
ATGGCGGGAGGGAGACCGCACCTGAAAAGGAGCTTCTCCATCATTCCCTGCTTTGTCTTTGTGGAGTCTGTTCTTCTGGGCATTGTGGTCCTGCTTGCTTACCGCCTGGAGTTCACAGACACCTTCCCGGTGCACACCCAGGGCTTCTTCTGCTATGACAGTACCTATGCCAAGCCTTACCCAGGGCCTGAGGCCAGCAGCCGAGCACCTCCTGCCCTCATCTATGCCCTGGTCACTGCTGGGCCCACCCTCACGATCCTGCTGGGTGAGTTGGCGCGGGCCTTCTTTCCCACACCACCCTCAGCCAGCCCTGTCGTTGGGGAGAGCACCATTGTATCAGGGGCCTGCTGTCGCTTCAGCCCCCCGCTGCGGAGGCTGGTCCGCTTCCTGGGAGTGTACTCCTTCGGCCTCTTCACCACGACCATCTTTGCCAACGCGGGACAGGTGGTGACTGGCAACCCCACGCCACACTTTCTGTCCGTGTGCCGCCCCAACTACACGGCCCTGGGCTGCCCTCCGCCCTCTCCTGACCGGCCAGGGCCGGACCGCTTTGTCACCGACCAGGGCGCCTGCGCGGGGAGCCCCAGCCTGGTGGCCGCCGCACGCCGCGCCTTCCCCTGCAAGGACGCGGCCCTCTGCGCCTACGCGGTCACCTACACGGCGATGTACGTGACCCTAGTGTTCCGCGTGAAGGGCTCCCGCCTGGTTAAGCCCTCCCTCTGCCTGGCCCTGCTGTGCCCTGCCTTCCTGGTGGGCGTGGTCCGCGTGGCTGAGTACCGCAACCACTGGTCTGACGTGCTGGCCGGCTTCCTAACCGGGGCGGCCATCGCCACCTTTCTGGTCACCTGTGTCGTCCACAATTTCCAGAGCCGGCCACCCTCTGGCCGAAGGCCCTCCCCCTGGGAGGACCTGGGCCCCACACCCACCATGGAGAGCCCCCTCGAAAAGAACCGGAGGCCTGCAGGCCGCATTCGACACCGGCGCGGCTCACCCCATCCAAGCCGCAGAACTGCGCCCGCCGTGGCCACCTGA

XM_004865584.1 Coding sequence

Epor erythropoietin receptor, transcript variant X4

High confidence: 4 potential gene matches
Length: 1530 bp    Location: 3187231..3181957   Strand: -
>XM_004865584.1
ATGGACCACCTCGGGGCGCCCCTCTGGCCCCGAGTTGGCCCCCTCTGTCTCCTGCTGGCTGGGGCAGCCTGGGCGCCCCTACCCAACTCTCCAGACCCCAAATTTGAGAGCAAAGCGGCCCTGCTGGTGGCCCGAGGGCCCCAAGAGCTTCTCTGCTTCACGGAGCGGCTGGAGGACTTGGTGTGTTTCTGGGAGGAAGAAGCAAGCTCCGGGGTCACCTCCAGCAACTATACCTTCTCCTACCAGCTCGAGGGCGAGCCTCGGAAGCCCTGTCACCTGCACCAGGCGCCCACCACCCTGGGTGCCGTGCGCTTCTGGTGTTCGCTGCCCACGGCCGACACGTCGAGTTTCGTGCCCCTGGAGCTGCGCGTCACGGAGGCCTCCTCCGGCTCCCCGCGTTATCACCGGGTCATCCACATCAACGAAGTGGTGCTCCTGGACGCCCCCACGGGGCTGCAGGCACGGCGGGCGGAGGAGAGCGGCCAAGTGATGCTTCGCTGGCTGCCGCCGCCTGGGGCACCCATGACAACCCACATCCGCTACGAGGTGGACGTCTCTGCGGGCAGCAGTGCAGGGGGAGCGCAGAGAGTGGAGATCCTGGAGGGCCGCACTGAGTGCGTGCTCAGCAACCTGCGTGGCGCCACGCGCTACACCTTTGCGGTTCGAGCGCGTATGGCCGAGCCCAGCTTCAGCGGCTTCTGGAGCGCCTGGTCTGAGCCTGCGTCGCTGCTGACGGCTAGCGACCTGGACCCCCTCATCCTGACGCTGTCCCTCATCCTCGTGCTCATCGTGCTGCTGCTGGCCGTGCTTGCCCTGCTGTCCCACCGCCGGACTCTGAAGCAGAAGATCTGGCCTGGAATCCCAAGCCCCGAGAGTGAGTTTGAAGGCCTCTTCACTACCCATAAGGGTAACTTCCAGCTCTGGCTGTCACAGCATGACAGCTGTCTGTGGTGGAACCCCTGCACCCCCTTTCCGGAGGAACCGCCCACCCGCCTGGAAGTCCTCTCCGAGCGCTGCTGGGGGGTGCCCCAGGTAGTTGAGCCGGGGGCAGATGATGTGGGGCCCCTGCTGCAGCTGGTGGGCCGTGAGCATGCCCAGGACTCCTACCTGGTGCTGGACAAGTGGCTGTTGCCCCAGAGCCCGCACGGCAAGGGCCTCCCAGGGCCTGGAGGCTGCACTGACATTGTGGCTGTGGACAAAGACTCCGAAGCGTCTTCCTGCTCATCTGCTTTGGCCTTGAAGCCCGAGCCGGAGGAGGCCCTGGCAACCAGCTTTGAATACACCATTCTGGACCCCAGCTCCCAGCTCTTGCGCCCACGGGTGCTGTGTCCCGAGCTGCCCCCCACCCCACCCCACCTGAAGTACCTGTACCTCGTGGTGTCTGACTCTGGGATCTCAACTGATTACAGCTCAGGGGGCTCCCAGGGAGCCCAGGGGGTCCCATCCGATGACACCTACTCGAACTCCTATGAGAACAGCCTTGTCCCTACCCCTGGGCCCCTCACCCCCAGCTACGTGGCCTGCTCGTAG

XM_004865580.1 Coding sequence

Swsap1 SWIM-type zinc finger 7 associated protein 1

High confidence: 4 potential gene matches
Length: 753 bp    Location: 3179016..3180834   Strand: +
>XM_004865580.1
ATGGCGGAGACACTGAGGCAAGTGCTAAACCGGGGTACCGCTGCCGGGACTGGAGAGGCGAACACGGCTGAGGCCGGACCGCCTTTGTTGTTACTAGGCGCTCCAGGTTCTGGAAAAACAACGCTGCTATTTGCGGCGGCCCTGGAAGCAGCAGGAGAGGGCCGAGGTCCTGTTCTCTTCATAACTCGGAGGCCTCTTCAAAGCCTGCCCCGTGGTATTGCACGGACACTCGACCCTTTGCGGCTCCAGAAGATTCGCTTCCAGTACCCACCCTCAACGAGAGAGCTGCTTCGGGTCCTATGCTCTGCCCATGAGGTCATGGGGCCGGTGCCCTCCCTTCTGCTGCTCGACTGCCTGGAGGAGTACCTAGCGGAAGACCCTGGATGCCAGGAGGCCACCTACCTGGCCGCCTTGCTTCTGGATACAGCTGCCCACTTCAGCCACCGAGCTGGTCCCAGCCGGCCCTGCGGGCTCATGGTGGCCCTGCAGACCCAGGAGCAAGCAGACAGCGGGGAGGCCCTGCAGCGGGCTTTGGTGCAGCGGTATTTCCCTGCGCAGTGCTGGCTGCAGGCAGACGCAGCAGGCCCGGGAGAGCATGGGTTCCAAGTCTGCCTGGAGCCAGGCGGCCCGGGCCCCAGGGAAGAGTGGCGGGTGACTTTCCAACCGGATGGAGAGATGACAATCACCCCCTGGCTTACCCACACGAAGGAGCCCAGCCAAGACAAGAGTTCAAGCTCTAGGGGTCAGCTCTGA

XM_004865582.1 Coding sequence

Epor erythropoietin receptor, transcript variant X2

Length: 1623 bp    Location: 3187231..3181957   Strand: -
>XM_004865582.1
ATGGACCACCTCGGGGCGCCCCTCTGGCCCCGAGTTGGCCCCCTCTGTCTCCTGCTGGCTGGGGCAGCCTGGGCGCCCCTACCCAACTCTCCAGACCCCAAATTTGAGAGCAAAGCGGCCCTGCTGGTGGCCCGAGGGCCCCAAGAGCTTCTCTGCTTCACGGAGCGGCTGGAGGACTTGGTGTGTTTCTGGGAGGAAGAAGCAAGCTCCGGGGTCACCTCCAGCAACTATACCTTCTCCTACCAGCTCGAGGGCGAGCCTCGGAAGCCCTGTCACCTGCACCAGGCGCCCACCACCCTGGGTGCCGTGCGCTTCTGGTGTTCGCTGCCCACGGCCGACACGTCGAGTTTCGTGCCCCTGGAGCTGCGCGTCACGGAGGCCTCCTCCGGCTCCCCGCGTTATCACCGGGTCATCCACATCAACGAAGTGGTGCTCCTGGACGCCCCCACGGGGCTGCAGGCACGGCGGGCGGAGGAGAGCGGCCAAGTGATGCTTCGCTGGCTGCCGCCGCCTGGGGCACCCATGACAACCCACATCCGCTACGAGGTGGACGTCTCTGCGGGCAGCAGTGCAGGGGGAGCGCAGAGAGTGGAGATCCTGGAGGGCCGCACTGAGTGCGTGCTCAGCAACCTGCGTGGCGCCACGCGCTACACCTTTGCGGTTCGAGCGCGTATGGCCGAGCCCAGCTTCAGCGGCTTCTGGAGCGCCTGGTCTGAGCCTGCGTCGCTGCTGACGGCTAGCGACCTGGACCCCCTCATCCTGACGCTGTCCCTCATCCTCGTGCTCATCGTGCTGCTGCTGGCCGTGCTTGCCCTGCTGTCCCACCGCCGGACTCTGAAGCAGAAGATCTGGCCTGGAATCCCAAGCCCCGAGAGTGAGTTTGAAGGCCTCTTCACTACCCATAAGGGTAACTTCCAGGTAGGTGGCTTGGCTGTCCCTGGGGGGCTGGGCCTGTCCTGCTTCTGGCAGCGGAAGCCCAGGGCTGTGAGCAGGCTGCCACTGTTCCCCCAGCTCTGGCTGTCACAGCATGACAGCTGTCTGTGGTGGAACCCCTGCACCCCCTTTCCGGAGGAACCGCCCACCCGCCTGGAAGTCCTCTCCGAGCGCTGCTGGGGGGTGCCCCAGGTAGTTGAGCCGGGGGCAGATGATGTGGGGCCCCTGCTGCAGCTGGTGGGCCGTGAGCATGCCCAGGACTCCTACCTGGTGCTGGACAAGTGGCTGTTGCCCCAGAGCCCGCACGGCAAGGGCCTCCCAGGGCCTGGAGGCTGCACTGACATTGTGGCTGTGGACAAAGACTCCGAAGCGTCTTCCTGCTCATCTGCTTTGGCCTTGAAGCCCGAGCCGGAGGAGGCCCTGGCAACCAGCTTTGAATACACCATTCTGGACCCCAGCTCCCAGCTCTTGCGCCCACGGGTGCTGTGTCCCGAGCTGCCCCCCACCCCACCCCACCTGAAGTACCTGTACCTCGTGGTGTCTGACTCTGGGATCTCAACTGATTACAGCTCAGGGGGCTCCCAGGGAGCCCAGGGGGTCCCATCCGATGACACCTACTCGAACTCCTATGAGAACAGCCTTGTCCCTACCCCTGGGCCCCTCACCCCCAGCTACGTGGCCTGCTCGTAG

XM_004865583.1 Coding sequence

Epor erythropoietin receptor, transcript variant X3

Length: 1572 bp    Location: 3187231..3181957   Strand: -
>XM_004865583.1
ATGGACCACCTCGGGGCGCCCCTCTGGCCCCGAGTTGGCCCCCTCTGTCTCCTGCTGGCTGGGGCAGCCTGGGCGCCCCTACCCAACTCTCCAGACCCCAAATTTGAGAGCAAAGCGGCCCTGCTGGTGGCCCGAGGGCCCCAAGAGCTTCTCTGCTTCACGGAGCGGCTGGAGGACTTGGTGTGTTTCTGGGAGGAAGAAGCAAGCTCCGGGGTCACCTCCAGCAACTATACCTTCTCCTACCAGCTCGAGGGCGAGCCTCGGAAGCCCTGTCACCTGCACCAGGCGCCCACCACCCTGGGTGCCGTGCGCTTCTGGTGTTCGCTGCCCACGGCCGACACGTCGAGTTTCGTGCCCCTGGAGCTGCGCGTCACGGAGGCCTCCTCCGGCTCCCCGCGTTATCACCGGGTCATCCACATCAACGAAGTGGTGCTCCTGGACGCCCCCACGGGGCTGCAGGCACGGCGGGCGGAGGAGAGCGGCCAAGTGATGCTTCGCTGGCTGCCGCCGCCTGGGGCACCCATGACAACCCACATCCGCTACGAGGTGGACGTCTCTGCGGGCAGCAGTGCAGGGGGAGCGCAGAGAAGGCGTGCCTCTGGACGCCCCTCCCCTCGGCCCCGCCCCCAGGTGGAGATCCTGGAGGGCCGCACTGAGTGCGTGCTCAGCAACCTGCGTGGCGCCACGCGCTACACCTTTGCGGTTCGAGCGCGTATGGCCGAGCCCAGCTTCAGCGGCTTCTGGAGCGCCTGGTCTGAGCCTGCGTCGCTGCTGACGGCTAGCGACCTGGACCCCCTCATCCTGACGCTGTCCCTCATCCTCGTGCTCATCGTGCTGCTGCTGGCCGTGCTTGCCCTGCTGTCCCACCGCCGGACTCTGAAGCAGAAGATCTGGCCTGGAATCCCAAGCCCCGAGAGTGAGTTTGAAGGCCTCTTCACTACCCATAAGGGTAACTTCCAGCTCTGGCTGTCACAGCATGACAGCTGTCTGTGGTGGAACCCCTGCACCCCCTTTCCGGAGGAACCGCCCACCCGCCTGGAAGTCCTCTCCGAGCGCTGCTGGGGGGTGCCCCAGGTAGTTGAGCCGGGGGCAGATGATGTGGGGCCCCTGCTGCAGCTGGTGGGCCGTGAGCATGCCCAGGACTCCTACCTGGTGCTGGACAAGTGGCTGTTGCCCCAGAGCCCGCACGGCAAGGGCCTCCCAGGGCCTGGAGGCTGCACTGACATTGTGGCTGTGGACAAAGACTCCGAAGCGTCTTCCTGCTCATCTGCTTTGGCCTTGAAGCCCGAGCCGGAGGAGGCCCTGGCAACCAGCTTTGAATACACCATTCTGGACCCCAGCTCCCAGCTCTTGCGCCCACGGGTGCTGTGTCCCGAGCTGCCCCCCACCCCACCCCACCTGAAGTACCTGTACCTCGTGGTGTCTGACTCTGGGATCTCAACTGATTACAGCTCAGGGGGCTCCCAGGGAGCCCAGGGGGTCCCATCCGATGACACCTACTCGAACTCCTATGAGAACAGCCTTGTCCCTACCCCTGGGCCCCTCACCCCCAGCTACGTGGCCTGCTCGTAG

XM_004865585.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 3 potential gene matches
Length: 2115 bp    Location: 3207604..3192681   Strand: -
>XM_004865585.1
ATGGAGCGCTCGGCGGGCAAGGAGTTGGCCCTGGCTCCGCTGCAGGACTGGGGCGAGGAGAGCGAGGACGGCGTGGTGTTCAGCGTGACTCTGCGGCGGCAGCAGCACAGCCTGCGCTCAGGCCCGGGGGAGGGGCCTGCGCGCAGCCAGAGCCTGCCCCCCGCGGCCCACAGCTTCCTCCACTACCGCACCAGCAAGGTGCGGGCGCTCAGGGCTGCGCGGCTGGAGCGACTGGTCGGCGAGCTGGTGTACGGAGACCGCGAGCAGGATCCCGGCTTCGTGCCTGCTTTCCTGGCCACCCACCAGGCCTTCGCGCCCACCGCCCGTGTCCTGCGTTTCCTACTGCCGCCGCCGCCGCCGCCGCTGCCTCCAGGGATACCGAGCAAGACCACAGGTGGCCCAGAGCTGAGCTTGAACGAGAATCTGAGCGCTGTGGTGTCCGTGCTGGGCTCCTGGCTCCGCGATCACCCCCAGGATTTCCGAGACCCCCCTGCCTACTCCGACCTGGGCAGTGTCCGAGTCTTTCTGGGCTGGGCTGCTCCAGAGGGTGCGGAGGCCCAGGAAGCAGAGAAGCTCTTGCAAGAGTTCTTGGAGGAGGCTGATAGAGAGCAAGAAGAGGAGCAGCCCGTGCTGTGGGCAGGACCTCCCAGGGCGGCCCAGCCCCCCAGACCGGACTCCCCGGAAGAGGAGGAAGGTCCTGAGCTCCTGGACTTCAGCGTGGAAGAGGTGGCGGAGCAGCTGACCCTCTTGGACGCGAAGCTCTTCTTGCGCGTGCGGACCTGCGAGTGCCTGGGCTCCGTGTGGTCACAGCGAGACCGGCAGGGGGCCTCAGGCGTCGCCCCCACTGTGCGCGCCACGGTGGCCCAGTTCAACGCGGTGACCGGCTGCGTGCTGGGCTCGGTGCTCGGGGCACCTGGGCTGGCAGCCCCGCAGAGGGCGCAGCGCATCGAGAAGTGGATTCGGATCGCGCAGTGCTGCCGGGAGCTGCGGAACTTCTCTTCCCTGCGGGCCATCCTGTCCGCGCTACAGTCCAACCCCATCTACAGGCTTAAGCGCAGCTGGGGGGCCGTGAACCGGGAACCACTATCCACTTTCAGGAAACTTTCACAGATTTTCTCCGACGAGAACAACCACCTCAATAGCAGAGAGATTCTTTCCCAGGAGGAGGCCACTGAGGGGTCCNCAGAGGAGGACGGCCCCCCAGGATGCCTGCCCCCACTGAGTAAACTGCCCTCAGGTCTCGTCCCCTACCTTGGCACCTTCCTCACCGACCTGGTTATGCTGGACACAGCGCTGCCGGATGTGTTGAAGGGGGATCTCATCAATTTTGAGAAGCGGAGGAAGGAGTGGGAGATCCTGGCCCGAATCCAGCAGCTTCAGCGGCGTTGTCGGAGCTACAGCCTGTGCCCCCACCCACCCATCCTGGCCGCCCTGCAAGCCCAGCGCCAGCTCAGCGAGGAACAGAGCTACCGAGTCTCCCGTGTCATCGAACCCCCGGCCGCCTCCTGTCCCAGCTCCCCCAGCATCCGGCGCCGCATCAGTCTCACCAAGCGGCTCAGTGCGAAGCTGTCCCGGGAGAAGAGCGCGCCCCCTGGTGGGAGTCCCGGGGAGCCCTCGTCGCCTACCTCCAGTCTGTCCCCAGGGTCGCCCCCCTCCAGTCCCAGAGCCAAGGACCCTCCTGCCGCTGGAAGTCCCCCTGCCTCTCCAGGGCTCCAGGGCCCCTGCACCAAGCTGCCCCTGAGCCTGGACCTGCCCGGCTCCCAGGCCCCAGCATTGCCCCCAAGCAGCCCACGAGTCCCCCTCGGGCAGCAGAGCTCAGAGGCCCGAGTCATCCGCGTGAGCATCGACAATGATCATGGGAACCTGTACCGGAGCATCTTGCTCTCCAGCCAGGACAAAGCTCCGGGTGTGATCCAGCGCGCCTTGGAGAAGCACCATGTGCCCCAGCCTCAGGGTTGTGCCTACCAGCTCTTCCAGGTCCTCCCTGGGGACAGGGAGCTCCTGATTCCAGACAACGCCAACGTCTTCTATGCAATGAGTCCGGCCGCCCCTGGAGACTTCGTGCTACGGCGGAAGGACAGGGCTCGGTCTGTGGCCTTTGTCTCCCCAACCTGA

XM_004865597.1 Coding sequence

Ccdc151 coiled-coil domain containing 151, transcript variant X8

High confidence: 4 potential gene matches
Length: 1797 bp    Location: 3219048..3207935   Strand: -
>XM_004865597.1
ATGACGTCTCTCCTATGCAGGGCGGCCTCTGCCAACGCCGTGCCTTCTCAAGATCAGGCTTTGATGCCCTCTTCCAAAGCCAAGGGCAGTAAGGCTCCGGCCAAGCAGGGCCACCCCCGAGGCAAGGGCTCGGTGGGGGCACAGGCCTGGGCCCCAGTCCATTCCAAGGCGGGACTCCGCCGCCACTGTCCAGTGAAGACCGCTGTGCACACACAGGTGGTTGAGTTACAAAGGAAGATCCAACTGCTGGAGGGTGACCGGAAGGCCTTCTACGAGAGCTCCCAGTGGAACATTAAGAAGAACCAGGAGACCATCAGGCAGCTCCGGGAGGAGACCAAGGCTCTCCAGGGGCAGCTGGCGGTCCTGCTACAGGGAGACAAGAACATGGTGCAGGCAGTAATTCAAGAGTGGAAGGAAGAGAAGCCGTACCTGAAGAACAGGATGGCCCAGGCCCTGGAGCACCTGGACCACCAGCTGAGCGGGAAGGTGAAGCAGCTGAATGCCCTGCGACACCAGGTGGTGCTGCGACAGAGGCGGCTGGATGAGCTGCAGCTGCAGGAGGGCCTGCGCCAGCTGGAGATGGCCGAGGTGCAGGACAGCAACACCGAGATGGCCAAGACCATGCGGAACCTGGAGAACCGGCTGGAGAAGGCCCGCATGAAGGCAGAGGAGGCTGGGCACATCGCTGGTGTGTACCTGCAGCTCAAGGCCTATCTCCAGGAGGAGGCCCTCGCTCTGGGGAACCAGCTGGACGCCATGGAGGCCACGGTGGCGAAGACTAAGCAGGAAGTGCAGGAACTGCACGTGGTGAACCAAGAGGCCCTCCATGCCCGGGACATTGCCAAGAACCAGCTGCAGTATCTGGAGGAGAAGGTGATCCGAGAGCGCAAGAAGCGGGAGCTGCACATATCTGACTGCAAGAAGCGCGCAGAGGAGAAAAAACTCCAGAACGAGTGCATGGAGCGCAAGACCCAGCGGGATCACCTGCTGCTGCAGTCGGAGGACACAATCCAAGACCACCAGCACGCCAAGGAGGAGGAGCTGCGGCAGCGCTGGAGCATGTACCAGATGGAGGTGACCTTCAGCAAGGTCAAGGACGCCACCGGCGCGGCTGAAACACACTCGGTGGTGCGAAGGTTCCTGGCCCAGGGCTACACCTTCGCGCAGCTGGAGGCCCTCAAGAAGGAGAACGAGCAGACGCTGGTGAAGCTCAAGGAGGAGAAGCAGCAGCTGCAGCGGGAGCTCGAAGACCTCAAATACTCCGGGGAGGCCACGCGGGTGAGCCAACAGAAGCTGCAAGCAGAGTTGCAGGAGAGCCTCAAGATGGAGGAGCAGCGACGCACTAAGGCCCAGGAACAGCTAGACCGCACCACGCGAACCATGCAGGTGGTTAAGGAGAGCCTGGAGCATCTGGCCAGCAAGTTGAAAGTCGTCACTGTGGAGGACGACCCCTTCTCCGGAAAGGCGCTAGACCCCGCCGCAGGTGACTATTTGCCCAACCTGCTGGGCCTGGTGGAGAAGAAGCTGCTGAAACTGCAGGCCCAGCTCGAGAGCCACGACGTGCAGGAGATGCTGCGACACATCACCAGCCGGGAGTTCCTGGTCACCTTAGAAGAAAAGCTGCCCCGGTACAACACTCGCATCCCCCTGCCCCCGGCCAGCTCCAAGGACAAGTTCTTCGACGAAGAGGAGAGTGAGGAAGACGACGACGCGGTGAACCGGGCCTCCTTAAAGATGCGTTCCCAGAAACTCATCGAAACGCGCAGCAAGAAGCGAGGTCGTGAGCGGAGGACCTAG

XM_004865596.1 Coding sequence

Ccdc151 coiled-coil domain containing 151, transcript variant X7

Length: 1803 bp    Location: 3219048..3207935   Strand: -
>XM_004865596.1
ATGACGTCTCTCCTATGCAGGGCGGCCTCTGCCAACGCCGTGCCTTCTCAAGATCAGGCTTTGATGCCCTCTTCCAAAGCCAAGGGCAGTAAGGCTCCGGCCAAGCAGGGCCACCCCCGAGGCAAGGGCTCGGTGGGGGCACAGGCCTGGGCCCCAGTCCATTCCAAGGCGGGACTCCGCCGCCACTGTCCAGTGAAGACCGCTGTGCACACACAGGTGGTTGAGTTACAAAGGAAGATCCAACTGCTGGAGGGTGACCGGAAGGCCTTCTACGAGAGCTCCCAGTGGAACATTAAGAAGAACCAGGAGACCATCAGGCAGCTCCGGGAGGAGACCAAGGCTCTCCAGGGGCAGCTGGCGGTCCTGCTACAGGGAGACAAGAACATGGTGCAGGCAGTAATTCAAGAGTGGAAGGAAGAGAAGCCGTACCTGAAGAACAGGATGGCCCAGCAGGCCCTGGAGCACCTGGACCACCAGCTGAGCGGGAAGGTGAAGCAGCTGAATGCCCTGCGACACCAGGTGGTGCTGCGACAGAGGCGGCTGGATGAGCTGCAGCTGCAGGAGGGCCTGCGCCAGCTGGAGATGGCCGAGGTGCAGGACAGCAACACCGAGATGGCCAAGACCATGCGGAACCTGGAGAACCGGCTGGAGAAGGCCCGCATGAAGGCAGAGGAGGCTGGGCACATCGCTGGTGTGTACCTGCAGCTCAAGGCCTATCTCCAGGAGGAGGCCCTCGCTCTGGGGAACCAGCTGGACGCCATGGAGGCCACGGTGGCGAAGACTAAGCAGGAAGTGCAGGAACTGCACGTGGTGAACCAAGAGGCCCTCCATGCCCGGGACATTGCCAAGAACCAGCTGCAGTATCTGGAGGAGAAGGTGATCCGAGAGCGCAAGAAGCGGGAGCTGCACATATCTGACTGCAAGAAGCGCGCAGAGGAGAAAAAACTCCAGAACGAGTGCATGGAGCGCAAGCAGACCCAGCGGGATCACCTGCTGCTGCAGTCGGAGGACACAATCCAAGACCACCAGCACGCCAAGGAGGAGGAGCTGCGGCAGCGCTGGAGCATGTACCAGATGGAGGTGACCTTCAGCAAGGTCAAGGACGCCACCGGCGCGGCTGAAACACACTCGGTGGTGCGAAGGTTCCTGGCCCAGGGCTACACCTTCGCGCAGCTGGAGGCCCTCAAGAAGGAGAACGAGCAGACGCTGGTGAAGCTCAAGGAGGAGAAGCAGCAGCTGCAGCGGGAGCTCGAAGACCTCAAATACTCCGGGGAGGCCACGCGGGTGAGCCAACAGAAGCTGCAAGCAGAGTTGCAGGAGAGCCTCAAGATGGAGGAGCAGCGACGCACTAAGGCCCAGGAACAGCTAGACCGCACCACGCGAACCATGCAGGTGGTTAAGGAGAGCCTGGAGCATCTGGCCAGCAAGTTGAAAGTCGTCACTGTGGAGGACGACCCCTTCTCCGGAAAGGCGCTAGACCCCGCCGCAGGTGACTATTTGCCCAACCTGCTGGGCCTGGTGGAGAAGAAGCTGCTGAAACTGCAGGCCCAGCTCGAGAGCCACGACGTGCAGGAGATGCTGCGACACATCACCAGCCGGGAGTTCCTGGTCACCTTAGAAGAAAAGCTGCCCCGGTACAACACTCGCATCCCCCTGCCCCCGGCCAGCTCCAAGGACAAGTTCTTCGACGAAGAGGAGAGTGAGGAAGACGACGACGCGGTGAACCGGGCCTCCTTAAAGATGCGTTCCCAGAAACTCATCGAAACGCGCAGCAAGAAGCGAGGTCGTGAGCGGAGGACCTAG

XM_004865592.1 Coding sequence

Ccdc151 coiled-coil domain containing 151, transcript variant X3

Length: 1881 bp    Location: 3219048..3208168   Strand: -
>XM_004865592.1
ATGACGTCTCTCCTATGCAGGGCGGCCTCTGCCAACGCCGTGCCTTCTCAAGATCAGGCTTTGATGCCCTCTTCCAAAGCCAAGGGCAGTAAGGCTCCGGCCAAGCAGGGCCACCCCCGAGGCAAGGGCTCGGTGGGGGCACAGGCCTGGGCCCCAGTCCATTCCAAGGCGGGACTCCGCCGCCACTGTCCAGTGAAGACCGCTGTGCACACACAGGTGGTTGAGTTACAAAGGAAGATCCAACTGCTGGAGGGTGACCGGAAGGCCTTCTACGAGAGCTCCCAGTGGAACATTAAGAAGAACCAGGAGACCATCAGGCAGCTCCGGGAGGAGACCAAGGCTCTCCAGGGGCAGCTGGCGGTCCTGCTACAGGGAGACAAGAACATGGTGCAGGCAGTAATTCAAGAGTGGAAGGAAGAGAAGCCGTACCTGAAGAACAGGATGGCCCAGCAGGCCCTGGAGCACCTGGACCACCAGCTGAGCGGGAAGGTGAAGCAGCTGAATGCCCTGCGACACCAGGTGGTGCTGCGACAGAGGCGGCTGGATGAGCTGCAGCTGCAGGAGGGCCTGCGCCAGCTGGAGATGGCCGAGACCATGCGGAACCTGGAGAACCGGCTGGAGAAGGCCCGCATGAAGGCAGAGGAGGCTGGGCACATCGCTGGTGTGTACCTGCAGCTCAAGGCCTATCTCCAGGTACCGGGAGAGGAGGCCTGGGAGGCGGAGGCCAGGCCACTGGGGCAGCAGTCACAGCCAGCCCACACCCCGCCCCAGGAGGAGGCCCTCGCTCTGGGGAACCAGCTGGACGCCATGGAGGCCACGGTGGCGAAGACTAAGCAGGAAGTGCAGGAACTGCACGTGGTGAACCAAGAGGCCCTCCATGCCCGGGACATTGCCAAGAACCAGCTGCAGTATCTGGAGGAGAAGGTGATCCGAGAGCGCAAGAAGCGGGAGCTGCACATATCTGACTGCAAGAAGCGCGCAGAGGAGAAAAAACTCCAGAACGAGTGCATGGAGCGCAAGACCCAGCGGGATCACCTGCTGCTGCAGTCGGAGGACACAATCCAAGACCACCAGCACGCCAAGGAGGAGGAGCTGCGGCAGCGCTGGAGCATGTACCAGATGGAGGTGACCTTCAGCAAGGTCAAGGACGCCACCGGCGCGGCTGAAACACACTCGGTGGTGCGAAGGTTCCTGGCCCAGGGCTACACCTTCGCGCAGCTGGAGGCCCTCAAGAAGGAGAACGAGCAGACGCTGGTGAAGCTCAAGGAGGAGAAGCAGCAGCTGCAGCGGGAGCTCGAAGACCTCAAATACTCCGGGGAGGCCACGCGGGTGAGCCAACAGAAGCTGCAAGCAGAGTTGCAGGAGAGCCTCAAGATGGAGGAGCAGCGACGCACTAAGGCCCAGGAACAGCTAGACCGCACCACGCGAACCATGCAGGTGGTTAAGGAGAGCCTGGAGCATCTGGCCAGCAAGTTGAAAGTCGTCACTGTGCCGCAGGAGGACGACCCCTTCTCCGGAAAGGCGCTAGACCCCGCCGCAGGTGACTATTTGCCCAACCTGCTGGGCCTGGTGGAGAAGAAGCTGCTGAAACTGCAGGCCCAGCTCGAGAGCCACGACGTGCAGGAGATGCTGCGACACATCACCAGCCGGGAGTTCCTGGTCACCTTAGAAGAAAAGCTGCCCCGGTACAACACTCGCATCCCCCTGCCCCCGGCCAGCTCCAAGGACAAGTTCTTCGGTCAGTGCCGGGCTTGGAAGGGAGGGAGGAGGTCCGTGCGCAGGCCCGGGCCCCAGGTGGAGCTGGGCGGGTTGGTGAAGGCCCGGGAGGGCGCCCCGGAGAACTGGATCAGTTCGGCTCCCCGCAGACGAAGAGGAGAGTGA

XM_004865594.1 Coding sequence

Ccdc151 coiled-coil domain containing 151, transcript variant X5

Length: 1833 bp    Location: 3219048..3208168   Strand: -
>XM_004865594.1
ATGACGTCTCTCCTATGCAGGGCGGCCTCTGCCAACGCCGTGCCTTCTCAAGATCAGGCTTTGATGCCCTCTTCCAAAGCCAAGGGCAGTAAGGCTCCGGCCAAGCAGGGCCACCCCCGAGGCAAGGGCTCGGTGGGGGCACAGGCCTGGGCCCCAGTCCATTCCAAGGCGGGACTCCGCCGCCACTGTCCAGTGAAGACCGCTGTGCACACACAGGTGGTTGAGTTACAAAGGAAGATCCAACTGCTGGAGGGTGACCGGAAGGCCTTCTACGAGAGCTCCCAGTGGAACATTAAGAAGAACCAGGAGACCATCAGGCAGCTCCGGGAGGAGACCAAGGCTCTCCAGGGGCAGCTGGCGGTCCTGCTACAGGGAGACAAGAACATGGTGCAGGCAGTAATTCAAGAGTGGAAGGAAGAGAAGCCGTACCTGAAGAACAGGATGGCCCAGCAGGCCCTGGAGCACCTGGACCACCAGCTGAGCGGGAAGGTGAAGCAGCTGAATGCCCTGCGACACCAGGTGGTGCTGCGACAGAGGCGGCTGGATGAGCTGCAGCTGCAGGAGGGCCTGCGCCAGCTGGAGATGGCCGAGGTGCAGGACAGCAACACCGAGATGGCCAAGACCATGCGGAACCTGGAGAACCGGCTGGAGAAGGCCCGCATGAAGGCAGAGGAGGCTGGGCACATCGCTGGTGTGTACCTGCAGCTCAAGGCCTATCTCCAGGAGGAGGCCCTCGCTCTGGGGAACCAGCTGGACGCCATGGAGGCCACGGTGGCGAAGACTAAGCAGGAAGTGCAGGAACTGCACGTGGTGAACCAAGAGGCCCTCCATGCCCGGGACATTGCCAAGAACCAGCTGCAGTATCTGGAGGAGAAGGTGATCCGAGAGCGCAAGAAGCGGGAGCTGCACATATCTGACTGCAAGAAGCGCGCAGAGGAGAAAAAACTCCAGAACGAGTGCATGGAGCGCAAGACCCAGCGGGATCACCTGCTGCTGCAGTCGGAGGACACAATCCAAGACCACCAGCACGCCAAGGAGGAGGAGCTGCGGCAGCGCTGGAGCATGTACCAGATGGAGGTGACCTTCAGCAAGGTCAAGGACGCCACCGGCGCGGCTGAAACACACTCGGTGGTGCGAAGGTTCCTGGCCCAGGGCTACACCTTCGCGCAGCTGGAGGCCCTCAAGAAGGAGAACGAGCAGACGCTGGTGAAGCTCAAGGAGGAGAAGCAGCAGCTGCAGCGGGAGCTCGAAGACCTCAAATACTCCGGGGAGGCCACGCGGGTGAGCCAACAGAAGCTGCAAGCAGAGTTGCAGGAGAGCCTCAAGATGGAGGAGCAGCGACGCACTAAGGCCCAGGAACAGCTAGACCGCACCACGCGAACCATGCAGGTGGTTAAGGAGAGCCTGGAGCATCTGGCCAGCAAGTTGAAAGTCGTCACTGTGCCGCAGGAGGACGACCCCTTCTCCGGAAAGGCGCTAGACCCCGCCGCAGGTGACTATTTGCCCAACCTGCTGGGCCTGGTGGAGAAGAAGCTGCTGAAACTGCAGGCCCAGCTCGAGAGCCACGACGTGCAGGAGATGCTGCGACACATCACCAGCCGGGAGTTCCTGGTCACCTTAGAAGAAAAGCTGCCCCGGTACAACACTCGCATCCCCCTGCCCCCGGCCAGCTCCAAGGACAAGTTCTTCGGTCAGTGCCGGGCTTGGAAGGGAGGGAGGAGGTCCGTGCGCAGGCCCGGGCCCCAGGTGGAGCTGGGCGGGTTGGTGAAGGCCCGGGAGGGCGCCCCGGAGAACTGGATCAGTTCGGCTCCCCGCAGACGAAGAGGAGAGTGA

XM_004865590.1 Coding sequence

Ccdc151 coiled-coil domain containing 151, transcript variant X1

Length: 1911 bp    Location: 3219048..3208168   Strand: -
>XM_004865590.1
ATGACGTCTCTCCTATGCAGGGCGGCCTCTGCCAACGCCGTGCCTTCTCAAGATCAGGCTTTGATGCCCTCTTCCAAAGCCAAGGGCAGTAAGGCTCCGGCCAAGCAGGGCCACCCCCGAGGCAAGGGCTCGGTGGGGGCACAGGCCTGGGCCCCAGTCCATTCCAAGGCGGGACTCCGCCGCCACTGTCCAGTGAAGACCGCTGTGCACACACAGGTGGTTGAGTTACAAAGGAAGATCCAACTGCTGGAGGGTGACCGGAAGGCCTTCTACGAGAGCTCCCAGTGGAACATTAAGAAGAACCAGGAGACCATCAGGCAGCTCCGGGAGGAGACCAAGGCTCTCCAGGGGCAGCTGGCGGTCCTGCTACAGGGAGACAAGAACATGGTGCAGGCAGTAATTCAAGAGTGGAAGGAAGAGAAGCCGTACCTGAAGAACAGGATGGCCCAGCAGGCCCTGGAGCACCTGGACCACCAGCTGAGCGGGAAGGTGAAGCAGCTGAATGCCCTGCGACACCAGGTGGTGCTGCGACAGAGGCGGCTGGATGAGCTGCAGCTGCAGGAGGGCCTGCGCCAGCTGGAGATGGCCGAGGTGCAGGACAGCAACACCGAGATGGCCAAGACCATGCGGAACCTGGAGAACCGGCTGGAGAAGGCCCGCATGAAGGCAGAGGAGGCTGGGCACATCGCTGGTGTGTACCTGCAGCTCAAGGCCTATCTCCAGGTACCGGGAGAGGAGGCCTGGGAGGCGGAGGCCAGGCCACTGGGGCAGCAGTCACAGCCAGCCCACACCCCGCCCCAGGAGGAGGCCCTCGCTCTGGGGAACCAGCTGGACGCCATGGAGGCCACGGTGGCGAAGACTAAGCAGGAAGTGCAGGAACTGCACGTGGTGAACCAAGAGGCCCTCCATGCCCGGGACATTGCCAAGAACCAGCTGCAGTATCTGGAGGAGAAGGTGATCCGAGAGCGCAAGAAGCGGGAGCTGCACATATCTGACTGCAAGAAGCGCGCAGAGGAGAAAAAACTCCAGAACGAGTGCATGGAGCGCAAGACCCAGCGGGATCACCTGCTGCTGCAGTCGGAGGACACAATCCAAGACCACCAGCACGCCAAGGAGGAGGAGCTGCGGCAGCGCTGGAGCATGTACCAGATGGAGGTGACCTTCAGCAAGGTCAAGGACGCCACCGGCGCGGCTGAAACACACTCGGTGGTGCGAAGGTTCCTGGCCCAGGGCTACACCTTCGCGCAGCTGGAGGCCCTCAAGAAGGAGAACGAGCAGACGCTGGTGAAGCTCAAGGAGGAGAAGCAGCAGCTGCAGCGGGAGCTCGAAGACCTCAAATACTCCGGGGAGGCCACGCGGGTGAGCCAACAGAAGCTGCAAGCAGAGTTGCAGGAGAGCCTCAAGATGGAGGAGCAGCGACGCACTAAGGCCCAGGAACAGCTAGACCGCACCACGCGAACCATGCAGGTGGTTAAGGAGAGCCTGGAGCATCTGGCCAGCAAGTTGAAAGTCGTCACTGTGCCGCAGGAGGACGACCCCTTCTCCGGAAAGGCGCTAGACCCCGCCGCAGGTGACTATTTGCCCAACCTGCTGGGCCTGGTGGAGAAGAAGCTGCTGAAACTGCAGGCCCAGCTCGAGAGCCACGACGTGCAGGAGATGCTGCGACACATCACCAGCCGGGAGTTCCTGGTCACCTTAGAAGAAAAGCTGCCCCGGTACAACACTCGCATCCCCCTGCCCCCGGCCAGCTCCAAGGACAAGTTCTTCGGTCAGTGCCGGGCTTGGAAGGGAGGGAGGAGGTCCGTGCGCAGGCCCGGGCCCCAGGTGGAGCTGGGCGGGTTGGTGAAGGCCCGGGAGGGCGCCCCGGAGAACTGGATCAGTTCGGCTCCCCGCAGACGAAGAGGAGAGTGA

XM_004865588.1 Coding sequence

Prkcsh protein kinase C substrate 80K-H, transcript variant X3

Length: 1602 bp    Location: 3219218..3227369   Strand: +
>XM_004865588.1
ATGTTGCTGTTGATGCTGCTGATGCTGCCCCTCTGCTGGTCCGTGGAGGTCAAGAGGCCCCGGGGCGTCTCCCTCACTAACCATCACTTCTATGACAAATCCAAGCCTTTCACCTGCCTGGACGGCTCGGCCACAATCCCTTTTGATCAAGTCAACGATGACTACTGTGATTGCAAGGATGGTTCAGATGAGCCGGGCACAGCCGCCTGTCCTAATGGCAACTTCCACTGCACCAACACGGGCTACAAGCCCCTGTATATCCCCTCCAGCCGCGTCAATGATGGCATCTGTGACTGCTGCGATGGGACCGATGAGTACAACAGTGGCACTGTCTGCGAGAACACCTGCAAAGAGAAGGGCCTCAAAGAGAGAGAGTCCCTGCAGCAGATGGCAGAGGTCACCCGCGAGGGGTTCCGCCTGAAGAAGATCCTCGTTGAGGACTGGAAGAAGGCCCGGGAGGAGAAGCAGAAAAAGCTCACCGAGCTACAGGCTGGAAAGAAGTCTCTGGAAGACCAGGTGGAGGCCCTGCGGGCTTTGAAGGAAGAGGCTGAGAAGCCGGAGAAGGAGGCCAAGGAGCAGCACCAGAGGCTGTGGGAAGAGCAGCAGGCCGCTGTCAAGGCCCAGCGCGAGCAGGAGCAGGCGGCTGATGCCTTCCGGGAGCTGGATGACAACATGGACGGGGTGGTCTCGGTGGCCGAGCTGCAGACCCATCCAGAGCTGGACACAGATGGCGATGGGACTGTGTCTGAAGGGGAGGCCCAGGCCCTGCTCGGCGGGGACACACAGACGGATGCCAGCTCCTTCTACGACCGAGTCTGGGCCAGCATCAGGGACAAGTACCGGTCCGAGGCACTCCCTGCCGACCTCCCAGCACCTCTGGCCCCGGAGGTGATGGAGTCCAAGGAGGAGCAGCCCTCGGTGCCGACCCATCCCACGGAGTACGAGGAAGAGGAGGAGGAGGAAACCGAGGAAGAAGAGGAGGATGAAGAGCAGGATTCTGAGGTGCCTGGGGAGCAGCCCAAGGAGGCCCCGTCCCCACTGGAGCCCTCCCAGCCGCCCAGCCCCAGCGAGGAGGACAAGATGCCACCCTATGATGAGCAGACACAGGCCTTCATTGATGCTGCCCAGGAGGCCCGCAGCAAGTTCGAGGAGGCTGAGCGGTCCCTGAAGGACATGGAGGAGTCCATCAGGAACCTGGAGCAGGAGATTTCCTTCGACTTTGGCCCCCAAGGGGAGTTCGCCTACCTGTACAGCCAGTGCTACGAGCTCAGCACCAATGAATACATCTACCGGCTCTGCCCCTTTAAACTCGTCTCCCAGAAACCGAAGCTGGGCGGCTCCCCCACCAACCTCGGCACGTGGGGCTCGTGGGCCGGGCCCGAGCACGACAGATTCAGCGCCATGAAGTACGAGCAGGGGACCGGCTGCTGGCAGGGCCCCAACCGCTCCACCACCGTGCGCCTGCTGTGCGGGAAGGAGACCGCGGTCACCAGCACCACCGAGCCCAGCCGATGCGAGTACCTCATGGAGCTCTCCACGCCGGCCGCCTGCCCGGAGCCGCCCCCTGAGCTCCCGGTGGACAGCGACCACGATGAGCTGTAG

XM_004865587.1 Coding sequence

Prkcsh protein kinase C substrate 80K-H, transcript variant X2

Length: 1602 bp    Location: 3219235..3227369   Strand: +
>XM_004865587.1
ATGTTGCTGTTGATGCTGCTGATGCTGCCCCTCTGCTGGTCCGTGGAGGTCAAGAGGCCCCGGGGCGTCTCCCTCACTAACCATCACTTCTATGACAAATCCAAGCCTTTCACCTGCCTGGACGGCTCGGCCACAATCCCTTTTGATCAAGTCAACGATGACTACTGTGATTGCAAGGATGGTTCAGATGAGCCGGGCACAGCCGCCTGTCCTAATGGCAACTTCCACTGCACCAACACGGGCTACAAGCCCCTGTATATCCCCTCCAGCCGCGTCAATGATGGCATCTGTGACTGCTGCGATGGGACCGATGAGTACAACAGTGGCACTGTCTGCGAGAACACCTGCAAAGAGAAGGGCCTCAAAGAGAGAGAGTCCCTGCAGCAGATGGCAGAGGTCACCCGCGAGGGGTTCCGCCTGAAGAAGATCCTCGTTGAGGACTGGAAGAAGGCCCGGGAGGAGAAGCAGAAAAAGCTCACCGAGCTACAGGCTGGAAAGAAGTCTCTGGAAGACCAGGTGGAGGCCCTGCGGGCTTTGAAGGAAGAGGCTGAGAAGCCGGAGAAGGAGGCCAAGGAGCAGCACCAGAGGCTGTGGGAAGAGCAGCAGGCCGCTGTCAAGGCCCAGCGCGAGCAGGAGCAGGCGGCTGATGCCTTCCGGGAGCTGGATGACAACATGGACGGGGTGGTCTCGGTGGCCGAGCTGCAGACCCATCCAGAGCTGGACACAGATGGCGATGGGACTGTGTCTGAAGGGGAGGCCCAGGCCCTGCTCGGCGGGGACACACAGACGGATGCCAGCTCCTTCTACGACCGAGTCTGGGCCAGCATCAGGGACAAGTACCGGTCCGAGGCACTCCCTGCCGACCTCCCAGCACCTCTGGCCCCGGAGGTGATGGAGTCCAAGGAGGAGCAGCCCTCGGTGCCGACCCATCCCACGGAGTACGAGGAAGAGGAGGAGGAGGAAACCGAGGAAGAAGAGGAGGATGAAGAGCAGGATTCTGAGGTGCCTGGGGAGCAGCCCAAGGAGGCCCCGTCCCCACTGGAGCCCTCCCAGCCGCCCAGCCCCAGCGAGGAGGACAAGATGCCACCCTATGATGAGCAGACACAGGCCTTCATTGATGCTGCCCAGGAGGCCCGCAGCAAGTTCGAGGAGGCTGAGCGGTCCCTGAAGGACATGGAGGAGTCCATCAGGAACCTGGAGCAGGAGATTTCCTTCGACTTTGGCCCCCAAGGGGAGTTCGCCTACCTGTACAGCCAGTGCTACGAGCTCAGCACCAATGAATACATCTACCGGCTCTGCCCCTTTAAACTCGTCTCCCAGAAACCGAAGCTGGGCGGCTCCCCCACCAACCTCGGCACGTGGGGCTCGTGGGCCGGGCCCGAGCACGACAGATTCAGCGCCATGAAGTACGAGCAGGGGACCGGCTGCTGGCAGGGCCCCAACCGCTCCACCACCGTGCGCCTGCTGTGCGGGAAGGAGACCGCGGTCACCAGCACCACCGAGCCCAGCCGATGCGAGTACCTCATGGAGCTCTCCACGCCGGCCGCCTGCCCGGAGCCGCCCCCTGAGCTCCCGGTGGACAGCGACCACGATGAGCTGTAG

XM_004865599.1 Coding sequence

Elavl3 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C), transcript variant X2

High confidence: 4 potential gene matches
Length: 1083 bp    Location: 3248476..3229283   Strand: -
>XM_004865599.1
ATGGTCACTCAGATACTGGGGGCCATGGAGTCTCAGGTGGGGGGGGGCCCGGCCGGCCCGGCCCTGCCCAACGGGCCACTCCTGGGTACCAACGGAGCGACTGATGACAGCAAGACCAACCTCATCGTCAACTACCTGCCCCAGAACATGACCCAGGATGAGTTCAAGAGTCTGTTCGGCAGCATCGGGGACATTGAGTCCTGCAAACTGGTTCGGGACAAGATCACAGGGCAAAGCCTGGGCTACGGGTTTGTGAACTATTCTGACCCCAACGACGCAGACAAAGCCATAAACACCCTCAACGGCCTCAAACTCCAGACCAAGACCATCAAGGTGTCCTACGCCAGGCCTAGCTCTGCGTCCATCCGGGACGCTAACCTCTACGTCAGTGGGCTCCCCAAGACCATGAGCCAGAAAGAAATGGAGCAGCTCTTCTCGCAATACGGCCGCATCATCACCTCGCGCATCCTGGTGGACCAGGTCACAGGCGTCTCTCGGGGTGTGGGATTCATTCGCTTTGACAAGAGGATCGAGGCGGAGGAGGCCATCAAAGGACTGAACGGGCAGAAGCCGCTGGGCGCGGCCGAGCCTATCACGGTGAAGTTCGCCAACAACCCGAGTCAGAAGACGGGGCAGGCACTGCTCACCCACCTCTACCAGTCCTCGGCCCGGCGCTACGCAGGCCCCCTGCACCACCAGACACAGCGCTTCCGGCTGGACAACCTGCTCAACATGGCCTACGGAGTCAAGAGGTTCTCTCCGATCGCCATCGACGGCATGAGTGGCCTGGCTGGCGTGGGGCTGTCAGGGGGCGCGGCGGGTGCCGGCTGGTGCATCTTCGTGTACAACCTGTCGCCCGAGGCAGACGAGAGCGTGCTGTGGCAGCTGTTCGGGCCCTTTGGCGCGGTCACCAATGTCAAGGTCATCCGCGATTTCACCACCAACAAGTGCAAGGGCTTTGGCTTTGTCACCATGACAAACTACGACGAGGCGGCCATGGCCATCGCCAGCCTCAACGGCTACCGCCTGGGCGAGCGCGTGCTGCAGGTGTCGTTCAAGACCAGCAAACAGCACAAGGCCTGA

XM_004865598.1 Coding sequence

Elavl3 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C), transcript variant X1

Length: 1104 bp    Location: 3248476..3229283   Strand: -
>XM_004865598.1
ATGGTCACTCAGATACTGGGGGCCATGGAGTCTCAGGTGGGGGGGGGCCCGGCCGGCCCGGCCCTGCCCAACGGGCCACTCCTGGGTACCAACGGAGCGACTGATGACAGCAAGACCAACCTCATCGTCAACTACCTGCCCCAGAACATGACCCAGGATGAGTTCAAGAGTCTGTTCGGCAGCATCGGGGACATTGAGTCCTGCAAACTGGTTCGGGACAAGATCACAGGGCAAAGCCTGGGCTACGGGTTTGTGAACTATTCTGACCCCAACGACGCAGACAAAGCCATAAACACCCTCAACGGCCTCAAACTCCAGACCAAGACCATCAAGGTGTCCTACGCCAGGCCTAGCTCTGCGTCCATCCGGGACGCTAACCTCTACGTCAGTGGGCTCCCCAAGACCATGAGCCAGAAAGAAATGGAGCAGCTCTTCTCGCAATACGGCCGCATCATCACCTCGCGCATCCTGGTGGACCAGGTCACAGGCGTCTCTCGGGGTGTGGGATTCATTCGCTTTGACAAGAGGATCGAGGCGGAGGAGGCCATCAAAGGACTGAACGGGCAGAAGCCGCTGGGCGCGGCCGAGCCTATCACGGTGAAGTTCGCCAACAACCCGAGTCAGAAGACGGGGCAGGCACTGCTCACCCACCTCTACCAGTCCTCGGCCCGGCGCTACGCAGGCCCCCTGCACCACCAGACACAGCGCTTCCGGCTGGACAACCTGCTCAACATGGCCTACGGAGTCAAGAGTCCCCTGTCGCTCATCGCCAGGTTCTCTCCGATCGCCATCGACGGCATGAGTGGCCTGGCTGGCGTGGGGCTGTCAGGGGGCGCGGCGGGTGCCGGCTGGTGCATCTTCGTGTACAACCTGTCGCCCGAGGCAGACGAGAGCGTGCTGTGGCAGCTGTTCGGGCCCTTTGGCGCGGTCACCAATGTCAAGGTCATCCGCGATTTCACCACCAACAAGTGCAAGGGCTTTGGCTTTGTCACCATGACAAACTACGACGAGGCGGCCATGGCCATCGCCAGCCTCAACGGCTACCGCCTGGGCGAGCGCGTGCTGCAGGTGTCGTTCAAGACCAGCAAACAGCACAAGGCCTGA

XM_004865603.1 Coding sequence

Ecsit ECSIT signalling integrator, transcript variant X3

High confidence: 4 potential gene matches
Length: 1275 bp    Location: 3276254..3264054   Strand: -
>XM_004865603.1
ATGAGCCGTGTCCGAGCTGTGCTGCTGGTCCGAAGCCTTGCCAGGGGCCACGCTGCCCTCCTAGGAGCCCCCTTTTCCCAGGTGCCCCATCTGGCCCCCCGGAGTCTCCATTGCAACTCCGCCCACCGCACCTCCGAGAAGTCCGTGGTCCCTCATCCGCCTGAGCCTGGGAAGAAGCCTGTGAAGGTCCCCGTGCCCTACGAGGACCTGTTCCAGTTGGCACCAGGTGGGACCCGGGACAAGGCCAGCTTCATGAAGGCCCTGCAGAGCTTTGGGCAGCACAATGTGCGCAAGCGCGGCCATGTGGACTTCATCTACTTCGCGCTGCAAAAGATGCCCGAGTATGGCGTGGAGCGCGACCTGGCTGCCTACAACCTCCTGCTGGACGTCTTTCCCAAGGAGGTCTTCCGGCCACGCAACTTCATCCACACCCTCTTCTTCCACTACCTGCTGCAGCAGGATTGCGGCGTGGCGGTGCTGCACCAGATGGAGAGCAACGGAGTGATGCCCAACAAGGAGACAGAGTTCCTGCTGTTGCAGATCTTCGGCCGCCAAAGCTACCCTATGCTCAAGTACATGCGCATGCACCTGTGGTTCACGCGCTTCCTGAACATCAACCCCTTCCCGGTGCCCCGCGATCTACCCCAGGACGCCGTGGAGCTGGCCACACTTGGCCTGCAGCACATGGAGCCGGACCTCAGCGCCAGGGTCACCGTGTACCAGAGGCCTCTGCCCGATGACAAGACAGATCCAGGGGATCCCACCAAGCCTCACATCGTGGGAATCCAGAGTCCTGATCAACAGGAAGCCCTGGCCCGCCACAACCCAGCCCGGCCTCTCTTTGTGGAGGGACCCTTCTCCCTGTGGCTGCGCAACAAGTGTGTCTATTACCATATCCTCAGGGCTGACCTGCTGCCCCCTGAAGAGCAGGAAGTGGAGGAGATCCCGGAGGAGTGGAACCTCTACTACCCGATGAAGCTGGACCTGGACTATGCAAGGAGTGGTTGGGATGACTATGAGTTTGACATCGATGAAGTGGAGGAAGGCCCAGTCCTCGCCATGTGTGTGGCAGGTGCCCATGACCAGGAGACGCTAGCCAAGTGGATCCAAGGCCTGCAGGAGACCAACCCAGCCCTGGCCCGCATCCCCGTGGTCTTCCGGCTGGCTGCGTCCACTGGGGAGCTCCTGACGGCCTCAGGACCAGAGGATCTACGCCAGTCCCAGCGTGAGGAAGACGATGACCACCTGCAGCGACAGCAGCAGGGCCAGAGCTGA

XM_004865602.1 Coding sequence

Ecsit ECSIT signalling integrator, transcript variant X2

Length: 1275 bp    Location: 3276254..3264054   Strand: -
>XM_004865602.1
ATGAGCCGTGTCCGAGCTGTGCTGCTGGTCCGAAGCCTTGCCAGGGGCCACGCTGCCCTCCTAGGAGCCCCCTTTTCCCAGGTGCCCCATCTGGCCCCCCGGAGTCTCCATTGCAACTCCGCCCACCGCACCTCCGAGAAGTCCGTGGTCCCTCATCCGCCTGAGCCTGGGAAGAAGCCTGTGAAGGTCCCCGTGCCCTACGAGGACCTGTTCCAGTTGGCACCAGGTGGGACCCGGGACAAGGCCAGCTTCATGAAGGCCCTGCAGAGCTTTGGGCAGCACAATGTGCGCAAGCGCGGCCATGTGGACTTCATCTACTTCGCGCTGCAAAAGATGCCCGAGTATGGCGTGGAGCGCGACCTGGCTGCCTACAACCTCCTGCTGGACGTCTTTCCCAAGGAGGTCTTCCGGCCACGCAACTTCATCCACACCCTCTTCTTCCACTACCTGCTGCAGCAGGATTGCGGCGTGGCGGTGCTGCACCAGATGGAGAGCAACGGAGTGATGCCCAACAAGGAGACAGAGTTCCTGCTGTTGCAGATCTTCGGCCGCCAAAGCTACCCTATGCTCAAGTACATGCGCATGCACCTGTGGTTCACGCGCTTCCTGAACATCAACCCCTTCCCGGTGCCCCGCGATCTACCCCAGGACGCCGTGGAGCTGGCCACACTTGGCCTGCAGCACATGGAGCCGGACCTCAGCGCCAGGGTCACCGTGTACCAGAGGCCTCTGCCCGATGACAAGACAGATCCAGGGGATCCCACCAAGCCTCACATCGTGGGAATCCAGAGTCCTGATCAACAGGAAGCCCTGGCCCGCCACAACCCAGCCCGGCCTCTCTTTGTGGAGGGACCCTTCTCCCTGTGGCTGCGCAACAAGTGTGTCTATTACCATATCCTCAGGGCTGACCTGCTGCCCCCTGAAGAGCAGGAAGTGGAGGAGATCCCGGAGGAGTGGAACCTCTACTACCCGATGAAGCTGGACCTGGACTATGCAAGGAGTGGTTGGGATGACTATGAGTTTGACATCGATGAAGTGGAGGAAGGCCCAGTCCTCGCCATGTGTGTGGCAGGTGCCCATGACCAGGAGACGCTAGCCAAGTGGATCCAAGGCCTGCAGGAGACCAACCCAGCCCTGGCCCGCATCCCCGTGGTCTTCCGGCTGGCTGCGTCCACTGGGGAGCTCCTGACGGCCTCAGGACCAGAGGATCTACGCCAGTCCCAGCGTGAGGAAGACGATGACCACCTGCAGCGACAGCAGCAGGGCCAGAGCTGA

XM_004865605.1 Coding sequence

Cnn1 calponin 1, basic, smooth muscle, transcript variant X2

High confidence: 4 potential gene matches
Length: 894 bp    Location: 3283357..3289777   Strand: +
>XM_004865605.1
ATGTCCTCTGCCCACTTCAACCGGGGCCCCGCCTACGGGCTGTCAGCCGAGGTCAAGAACAAGCTGGCCCAGAAGTATGATCACCAGCGGGAGCAGGAGCTGCGAGAGTGGATCGAGGGGGTGACCGGGCGCCGCATCGGCAACAACTTCATGGACGGCCTCAAGGACGGCATCATCCTGTGCGAATTCATCAATAAGCTCCAGCCAGGCTCAGTGAAGAAGGTGAATGAGTCGACCCAAAATTGGCACCAGCTGGAGAACATCGGCAATTTCATCAAGGCCATTACTAAGTATGGGGTGAAGCCTCACGACATCTTCGAGGCCAACGACCTGTTTGAGAACACCAATCATACCCAGGTGCAGTCCACGCTCCTGGCCCTAGCCAGCATGGCCAAGACGAAAGGCAACAAGGTGAATGTTGGGGTGAAGTATGCAGAGAAGCAGGAGCGGAAATTTGAGCCAGAGAAGCTGAGAGAAGGGCGGAACATCATCGGGCTACAGATGGGCACCAACAAGTTTGCCAGCCAGCAGGGCATGACAGCCTATGGCACCCGGCGCCACCTCTATGACCCCAAGCTGGGCACAGACCAGCCGCTGGACCAGGCCACCATCAGCCTGCAGATGGGCACCAACAAGGGGGCCAGCCAGGCTGGCATGACGGCACCTGGGACCAAGCGGCAGATCTTCGAGCCGGGCCTGGGCATGGAGCACTGCGACATGGTCAATGTCAGCCTGCAGATGGGCAGCAACAAGGGTGCCTCGCAGCGGGGCATGACGGTGTACGGGCTGCCACGCCAGGTCTACGACCCCAAGTACTGCCTGACGCCCGAGTACCCAGAGCTGGGCGAGCCGGTGCACAACCACCACCCGCACAACTACTACAACTCTGCCTAG

XM_004865489.1 Coding sequence

Raver1 ribonucleoprotein, PTB-binding 1

High confidence: 4 potential gene matches
Length: 2271 bp    Location: 2487020..2474217   Strand: -
>XM_004865489.1
ATGCCGCTCCGCCCCAGCTCGCTGGTCCCAGAAGGCGCCGGGTTTCCCAAGATGGCGGCCGATGTGTCCGTTACTCATCGGCCCCAGTTGAGCCCGGAGCCTGGGGCCGAGGCTGAAGCCACCGAGACCGCAGAGCGCCGGACGCCCGAAGAGCTGCCGCCGCTAGATCCGGAAGAGATCCGGAAACGCCTGGAACACACCGAACGACAGTTTCGTAACCGCCGCAAGATACTGATTCGGGGCCTCCCAGGGGACGTGACCAACCAGGAAGTACACGACCTACTCAGTGACTATGAGCTCAAGTACTGTTTTGTGGACAAGTACAAAGGGACAGCTTTCGTGACCCTGCTGAATGGGGAGCAGGCCGAGGCAGCCATCAACGCCTTCCACCAGAGCCACCTGCGGGATCGCGAGCTGTCAGTGCAGCTGCAGCCCACGGATGCGCTGCTGTGTGTGGCCAACCTGCCCCCAAGCCTCACGCAGGCTCAGTTTGAAGAGCTAGTTCGGCCCTTTGGCAGCCTGGAGCGCTGCTTCCTAGTCTACAGTGAGCACACCGGCCAATCCAAGGGCTATGGCTTCGCTGAATACATGAAAAAGGACTCGGCTGCCCGTGCCAAGTCGGACCTGCTGGGCAAGCCACTGGGCCCGCGTACACTGTACGTGCACTGGACAGATGCGGGCCAGCTTACGCCGGCCCTGCTGCATTCGCGCTGCCTCTGTGTGGACCGCCTCCCCCCCGGCTTCAGTGACGTGGACACCCTGCGCCAGGCGCTGTCAGCCGTGCACTCGCCCACCTTTTGCCAGCTGGCTTGCGGCCAGGACGGGCAGCTGAAGGGCTTCGCAGTGCTGGAGTACGAGACTGCTGAGATGGCTGAGGCGGCACAGCAGCGGGCTGACGGCCTGGCCCTGGGGGACAGCCACCTCCGTGTGTCCTTCTGCGCCCCCGGGCCCCCTGGCCGCAGCATGCTGGCTGCGCTCATTGCTGCCCAGGCCACGGCCCTCAACCGTGGCAAGGGGCTCCTGCCTGAGCCTAACATTCTGCAACTGCTCAACAACCTGGGCCCATCCGCCTCCCTGCAGCTGCTCCTCAACCCTCTGCTCCACAGCAGTGTGGGAGGCAAGCAGGGCCTCCTGGGTGCCCCCCCAGCCATGCCACTGCTCAGCGGGCCAGCCCTGTCCACAGCGTTGCTGCAGCTCGCCCTGCAGGCCCAGAGCCATAAGAAGCCTGGGATCCTGGGAGACTCGCCCCTGGGCCCCCTCCAGGCTGGGCCCCAGCCAGCCAACCCCCTCCTCGGGGACCTGTCAGCAGGGGGGACCCTCGCCCCAGAGCTGCCACCTCGGCGAGGAAAGCCACCACCCCTGCTGCCACCTCTGCTGGGCCCCTCTGGGGGTGACCGGGAGCCCATGGGCCTGGGTCCCACAGCAGCCCAGCTCACCCCACCCCCTGCCCCTGTGGGGATCCGAGGCCCAGGTCTGAGGGGCCTGCAGAAGGACAGTGGGCCCCTCCCCACACCCACCGGGGTCTCACTGCTGGGGGAACCCCCCAAGGACTACCGGATCCCCCTGAATCCCTACCTAAACCTGCACAGCCTGCTCCCAGCTACCAACCTGGCTGGCAAGGAAGCCCGGGGCTGGGGGTGTGCCACGAGAGGCCGCCACCAGGCCGAGGGGGCCCTGCCCAACCCCCCAGCCCCAGGTGGAGGCTCTGGCACAGGTGGCAGTGGCAGCAAAGCCTTCCCACTTAAGTCCCGCCTCCTCAGCCCCCTTGCTGGTTCCCGCCTGCCCCCCGAGCCCGGGCTGCCCGACAGCTACGGCTTTGACTACCCCTCGGACGTGGGACCTCGGCGGCTCTTCTCCCACCCCCGGGAGCCAGCCCTAGGGCCTCACGGACCCAGTCGACACAAGATGTCCCCTCCACCCAGTGGCTTCAGCGAGCGGAGTGGAGGAGGCGGGCCTCTCTCTCACTTCTACTCGGGCTCACCCACCTCCTACTTCACCAGTGGCCTGCAGGCTGGCCTCAAGCAGAGTCACCTCAACAAAGCAGTTGGCTCCTCCCCACTGGGCTCCAGTGAGGGGCTCCTGGGCCTTAGCCCAGGGCCCAATGGCCACAGCCACCTGCTGAAGACCCCCCTGGGTGGCCAGAAACGAAGCTTTGCCCACCTGCTGCCCTCACCTGAGCCCAGCCCGGAGGGCAGCTACGTGGGCCAGCACTCCCAGGGCCTTGGCGGCCACTACGCAGACTCCTACCTGAAGCGGAAGAGGATTTTTTAA

XM_004865604.1 Coding sequence

Cnn1 calponin 1, basic, smooth muscle, transcript variant X1

Length: 894 bp    Location: 3283816..3289777   Strand: +
>XM_004865604.1
ATGTCCTCTGCCCACTTCAACCGGGGCCCCGCCTACGGGCTGTCAGCCGAGGTCAAGAACAAGCTGGCCCAGAAGTATGATCACCAGCGGGAGCAGGAGCTGCGAGAGTGGATCGAGGGGGTGACCGGGCGCCGCATCGGCAACAACTTCATGGACGGCCTCAAGGACGGCATCATCCTGTGCGAATTCATCAATAAGCTCCAGCCAGGCTCAGTGAAGAAGGTGAATGAGTCGACCCAAAATTGGCACCAGCTGGAGAACATCGGCAATTTCATCAAGGCCATTACTAAGTATGGGGTGAAGCCTCACGACATCTTCGAGGCCAACGACCTGTTTGAGAACACCAATCATACCCAGGTGCAGTCCACGCTCCTGGCCCTAGCCAGCATGGCCAAGACGAAAGGCAACAAGGTGAATGTTGGGGTGAAGTATGCAGAGAAGCAGGAGCGGAAATTTGAGCCAGAGAAGCTGAGAGAAGGGCGGAACATCATCGGGCTACAGATGGGCACCAACAAGTTTGCCAGCCAGCAGGGCATGACAGCCTATGGCACCCGGCGCCACCTCTATGACCCCAAGCTGGGCACAGACCAGCCGCTGGACCAGGCCACCATCAGCCTGCAGATGGGCACCAACAAGGGGGCCAGCCAGGCTGGCATGACGGCACCTGGGACCAAGCGGCAGATCTTCGAGCCGGGCCTGGGCATGGAGCACTGCGACATGGTCAATGTCAGCCTGCAGATGGGCAGCAACAAGGGTGCCTCGCAGCGGGGCATGACGGTGTACGGGCTGCCACGCCAGGTCTACGACCCCAAGTACTGCCTGACGCCCGAGTACCCAGAGCTGGGCGAGCCGGTGCACAACCACCACCCGCACAACTACTACAACTCTGCCTAG

XM_004865609.1 Coding sequence

LOC101718093 tartrate-resistant acid phosphatase type 5-like, transcript variant X2

Length: 984 bp    Location: 3305923..3309978   Strand: +
>XM_004865609.1
ATGACTGCATGGATGGTGCTGCTGGCCCTGCAGGCCTCGCTGCTGTTCCCCCTGGCCAGCTGCACGGCTCCCAAAGCCACCCTGCGCTTTGTGGCTGTGGGTGACTGGGGCGGGGTCCCCAATGCTCCGTTCCACACGGCCCGGGAAATGGCCAATGCGAAGGAGATCACCAAAGCCGTGCAGATGATGGGAGCCGACTTCATCCTGTCCTTGGGGGACAACTTCTACTTTACAGGCGTCCGCGATGTCAATGACAAGAGGTTCCAGGAGACCTTTGAGAACGTGTTCTCTGACCGCTCCCTGCGCAACGTGCCCTGGTACGTGCTGGCGGGGAACCACGACCACCTGGGGAATGTCTCAGCACAGATCGCCTACTCCAAGATCTCCAAGCGATGGAACTTCCCCAGCCCCTTCTACCGCCTGCACTTCAAGATCCCACAGAACAACGTGACTGTGGCCATCTTCATGCTGGACACGGTGACTCTGTGTGGCAACTCTGATGACTTCCTGAGCCAGCAGCCCGAGAGGCCTCGAGACCCGGCAGTGGCCCGCACCCAGCTGTCCTGGCTCAAGAAGCAGCTGGCGGCGGCCAAGGAAGACTACGTGCTGGTGGCTGGCCACTACCCTGTGTGGTCCATCGCTGAGCACGGGCCCACCCGCTGCTTGGTCAAGCACCTGCGCCCCCTGTTGGCCACCTACATGGTCACTGCCTACCTGTGTGGCCATGACCACAACCTGCAGTACCTTCAAGATGAGAATGGCATTGGCTTTGTGCTGAGTGGGGCCGGGAACTTCATGGACCCCTCCGTTCGGCACCAGCGAAAAGTCCCCAGTGGATACCTTCGGTTCCACTACGGCTCCGAGGACTCACTGGGCGGCTTTGCCTATGTGGAGATAGGGACCAAAGAAATGACTGTCACCTACATGGAAGCCTCGGGCAAGTCCCTCTTCAAGACCAGCCTGCCTCGACGGTCCAGGCCCTGA

XM_004865479.1 Coding sequence

Eif3g eukaryotic translation initiation factor 3, subunit G

High confidence: 4 potential gene matches
Length: 963 bp    Location: 2311866..2308087   Strand: -
>XM_004865479.1
ATGCCGACCGGAGACTTTGATTCGAAGCCCAGCTGGGCCGACCAAGTGGAAGAGGAGGGCGAGGACGACAAGTGTGTCACCAGCGAGCTCCTCAAGGGGATCCCCCTGGCCACTGGCGACACCAGCCCAGAGCCTGAGCTCCTGCCTGGAGCCCCACTGCCGCCTCCCAAAGAGGTCATCAACGGAAACACAAAGACGGTGACAGAATACAAGATAGATGAGGATGGCAAAAAGTTTAAGATTGTCCGAACCTTCAGGATCGAGACCCGGAAGGCCTCGAAGGCTGTTGCAAGGAGGAAGAACTGGAAGAAGTTCGGGAACTCAGAGTTTGACCCACCAGGGCCCAACGTGGCCACCACCACAGTCAGCGACGATGTCTCCATGACATTCATCACCAGCAAGGAGGACCTGAACTGCCAGGAGGAGGAGGACCCGATGAACAAGCTCAAGGGCCAGAAGATCGTGTCATGCCGCATCTGCAAGGGTGACCACTGGACCACGCGCTGCCCCTACAAGGACACGCTGGGGCCCATGCAGAAGGAGCTGGCTGAGCAGCTGGGCCTGTCCACCGGCGAGAAGGAGAAGCTGCCAGGAGAGCTGGAGCCAGTACAGGCAGCGCAGAGCAAGACGGGGAAGTACGTGCCGCCCAGCCTGCGGGACGGGGCCAGCCGCCGCGGGGAGTCCATGCAGCCTAACCGCAGAGCTGACGACAATGCCACCATCCGAGTCACCAACCTGTCCGAGGACACGCGGGAGACCGACCTGCAGGAGCTCTTCCGGCCCTTTGGGTCCATCTCGCGCATCTACCTGGCCAAGGACAAGACCACGGGGCAGTCCAAGGGCTTCGCGTTCATCAGCTTCCACCGCCGGGAGGACGCTGGACGTGCCATTGCCGGGGTGTCCGGCTTCGGCTATGACCACCTCATCCTCAACGTGGAGTGGGCCAAGCCATCGACCAACTGA

XM_004865634.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X3

Length: 2073 bp    Location: 3812126..3805151   Strand: -
>XM_004865634.1
ATGGCAGAGAGCGAGAGGAGGGGGCTCGGCTGCTGGAACCCCATAGAGTTAGGGCAGCGGCTTCTTCTGCTGCTGTTGGTGGGCAGCTGTTCGGGGCGTATCCACCGACTGGCGCTGACGGGGGAGAAGCGAGCAGACATCCAACTCAATAGCTTCGGCTTCTACATCAATGGTTCCCTGGAAGTGGAGTTGAGCCTCTTGCGGCTGAGCCCCCAGGAGACAGAAGAGAAGTCGCCGTTGGTGGGGTTCAGCCTGAGCAGGGTTCGATCTGGCAGCATCCGATCCTACTCAGCCCAGGATTCCCATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGGTCCAGGTACGGAAGTATGGGGCACAGGAGAAACTGTTCATCTCTCCCGGGCTCCTCCCTGCCAAACCTGGGCTCCCCAAGGCAGAGCACACTGACACTCCTGAGGTGGACAGCGGTGAGTCCGGTGGGCAGCATGGGGATGGGCAGGGGTCCCCTGCATGTCTCTGCTTTTGTCTGTCATCCCTCGATCTCTTAAAATCATCCACCTGTCTCTCGCAGGAAACTCCACAGCTGGCAAAGCCAAGGCTAAACCTGCAGGGTCTCAGGTTTGGGGAGCTGGGGTGGGCCGGAGAAAGGTATACCCCAAGGGTGTTTGGGTTCCCAAGCCCGGGGCCAGCTGTTGGAAGGGCTCTGCCCCCTCAGGGTCCCGTTGAGAAGAACAAGGACCTGGTGTTGGACCTGGGCCACCTCAATGACTCCTACAACTTCAGTTTCCACGTGGTGATTGGCTCCAGGGCCGAGGAAGGCCAGTACAACCTCAACTTCCACAACTGCTACAACCTGATGCCTGGCCAGGAACGCCCCTTCGACCTCACAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTGCGGGTGCAGAGGCCCTGGAGGAAGGCGGGACAGGGGTACAGCTCAGGGGCCCCCACCCACCGCACCCCGCTCTCCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTGAGGGCCCCGCCCCCGGACGAGGCTCCTCCCAGGGCACTGGGGCGGTCAGTGCTGACCGCACCGTGTGTCCTCTGCCTGTGCCAGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGACTTTCCGCCCCGGGACTGTCTGCCCTGTCTGCCCCGGCCCCTCCGTCCTCCGTGACCCCAGCCCCCTCTGTGCGCCCTCCCCAGTGTTGGTGAACCTGGCCAAGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATGTCTACTTCACACGCATCATCGCCATCCTGCTGCGCGTGGCTGTGCCCTTCCAGTGGCAATGGCTGTACCAGCTCTTAGTGGAGGGCTCCACGCTCGCCTTCTTTGTGCTCACGGGCTACAAGTTCCAGCCCACCAGGGACAACCCGTACCTGCAGCTGCCCCAGGAGGACGAGGAGGACGTACAGATGGAGCAAGTGATGACGGACTCTGGGTTCCGGGAAGGCCTCTCCAAAGTCAACAAAACAGCAAGCGGACGAGAGCAGTTGTGA

XM_004865608.1 Coding sequence

LOC101718093 tartrate-resistant acid phosphatase type 5-like, transcript variant X1

Length: 984 bp    Location: 3306581..3309978   Strand: +
>XM_004865608.1
ATGACTGCATGGATGGTGCTGCTGGCCCTGCAGGCCTCGCTGCTGTTCCCCCTGGCCAGCTGCACGGCTCCCAAAGCCACCCTGCGCTTTGTGGCTGTGGGTGACTGGGGCGGGGTCCCCAATGCTCCGTTCCACACGGCCCGGGAAATGGCCAATGCGAAGGAGATCACCAAAGCCGTGCAGATGATGGGAGCCGACTTCATCCTGTCCTTGGGGGACAACTTCTACTTTACAGGCGTCCGCGATGTCAATGACAAGAGGTTCCAGGAGACCTTTGAGAACGTGTTCTCTGACCGCTCCCTGCGCAACGTGCCCTGGTACGTGCTGGCGGGGAACCACGACCACCTGGGGAATGTCTCAGCACAGATCGCCTACTCCAAGATCTCCAAGCGATGGAACTTCCCCAGCCCCTTCTACCGCCTGCACTTCAAGATCCCACAGAACAACGTGACTGTGGCCATCTTCATGCTGGACACGGTGACTCTGTGTGGCAACTCTGATGACTTCCTGAGCCAGCAGCCCGAGAGGCCTCGAGACCCGGCAGTGGCCCGCACCCAGCTGTCCTGGCTCAAGAAGCAGCTGGCGGCGGCCAAGGAAGACTACGTGCTGGTGGCTGGCCACTACCCTGTGTGGTCCATCGCTGAGCACGGGCCCACCCGCTGCTTGGTCAAGCACCTGCGCCCCCTGTTGGCCACCTACATGGTCACTGCCTACCTGTGTGGCCATGACCACAACCTGCAGTACCTTCAAGATGAGAATGGCATTGGCTTTGTGCTGAGTGGGGCCGGGAACTTCATGGACCCCTCCGTTCGGCACCAGCGAAAAGTCCCCAGTGGATACCTTCGGTTCCACTACGGCTCCGAGGACTCACTGGGCGGCTTTGCCTATGTGGAGATAGGGACCAAAGAAATGACTGTCACCTACATGGAAGCCTCGGGCAAGTCCCTCTTCAAGACCAGCCTGCCTCGACGGTCCAGGCCCTGA

XM_004865611.1 Coding sequence

LOC101718093 tartrate-resistant acid phosphatase type 5-like, transcript variant X4

Length: 984 bp    Location: 3307471..3309978   Strand: +
>XM_004865611.1
ATGACTGCATGGATGGTGCTGCTGGCCCTGCAGGCCTCGCTGCTGTTCCCCCTGGCCAGCTGCACGGCTCCCAAAGCCACCCTGCGCTTTGTGGCTGTGGGTGACTGGGGCGGGGTCCCCAATGCTCCGTTCCACACGGCCCGGGAAATGGCCAATGCGAAGGAGATCACCAAAGCCGTGCAGATGATGGGAGCCGACTTCATCCTGTCCTTGGGGGACAACTTCTACTTTACAGGCGTCCGCGATGTCAATGACAAGAGGTTCCAGGAGACCTTTGAGAACGTGTTCTCTGACCGCTCCCTGCGCAACGTGCCCTGGTACGTGCTGGCGGGGAACCACGACCACCTGGGGAATGTCTCAGCACAGATCGCCTACTCCAAGATCTCCAAGCGATGGAACTTCCCCAGCCCCTTCTACCGCCTGCACTTCAAGATCCCACAGAACAACGTGACTGTGGCCATCTTCATGCTGGACACGGTGACTCTGTGTGGCAACTCTGATGACTTCCTGAGCCAGCAGCCCGAGAGGCCTCGAGACCCGGCAGTGGCCCGCACCCAGCTGTCCTGGCTCAAGAAGCAGCTGGCGGCGGCCAAGGAAGACTACGTGCTGGTGGCTGGCCACTACCCTGTGTGGTCCATCGCTGAGCACGGGCCCACCCGCTGCTTGGTCAAGCACCTGCGCCCCCTGTTGGCCACCTACATGGTCACTGCCTACCTGTGTGGCCATGACCACAACCTGCAGTACCTTCAAGATGAGAATGGCATTGGCTTTGTGCTGAGTGGGGCCGGGAACTTCATGGACCCCTCCGTTCGGCACCAGCGAAAAGTCCCCAGTGGATACCTTCGGTTCCACTACGGCTCCGAGGACTCACTGGGCGGCTTTGCCTATGTGGAGATAGGGACCAAAGAAATGACTGTCACCTACATGGAAGCCTCGGGCAAGTCCCTCTTCAAGACCAGCCTGCCTCGACGGTCCAGGCCCTGA

XM_004866060.1 Coding sequence

LOC101709250 uncharacterized LOC101709250

Length: 2394 bp    Location: 3319002..3334910   Strand: +
>XM_004866060.1
ATGGCCCCTCCCTGTACAAAAGCCACTGGTAAGGTGACCAGTAAGCGGCCCCGTCGGGTGATCGACCTGGAAACGAAATTAAAACTGATTCAGGACTACGAGGGTGGGAAACCAGTGATGGTCATTGCCCGCCAGTCAGGCATGTCCCATTCCACCATCGCCACCATCCTGAAGAACAGGAACAAGGTGACAGAAGCCCTAAGAGGCTCCGCGTCCCTGAAGGCCACGAGGCTGACAAAGGTTCGAGAGGGCCCCATTTCGGACATGGAGAAGCTGCTGATGACCTGGATCGAGGACCAGACCCGGCAGTGCGTCCCCCTCAGTACCATGATGATCACAGCCAAAGCCAAGAGTCTGTTTGCAATGCTGAAGGAAAAGGCTGGGCCCGGCTACAATGTGGAGTTCAGTGCCAGCTCTGGGTGGTTGAAGCGATTCAAGAACCGCTATTCATTACATGATGTCAAAGTGGGCACTGATGTCCCCAAGGAGCGTGTGCCCGGCATCTGGAAGAAGACGCTTCGGAGGTTTGTGCATGACTTCAGAGGGCTGGCAGCGGAGGAGGAGGCGGCAGCACAGGTCAACAAGGCTGTGGCCGAAGTGACTAGCAACTTTCCCCTGGGGGCAGATGAGGATGACATCAAGGAACTGTTGGAGGTGGCGCCCAAGGGCCTGGCCCATGAGGAGTTGCTGGGACAGGGACACAAGGCCAAAGAAGAGGCCAGAGAAGTGGAAAGCATGGGAGAGGACAGAGAAGCAGCCCCAAGAAAGTTCACAGTAACGGGCCTAGCAGAGGCTTTCTCGGACCTCAACCAGCTCCTTAAGAAGTTTCAGAGCATGGACCCCAACCCTCAGAGGTTCTCGGCAGTGGAGAGGGGCGTCCGGGGTGCACTTTCTGCTTACGAGCAGATCTATGATGCTAAAAGGAAGCAAAAAAGAAGAGGCGCCATTCAGAAAGGAGTGGCATCTGTGGGCGAGCCCCAGGGAGGTCCCTCAGGAGCCATCCCAGAAGGCGGCATTATCATCATCGCCGATGACGGCACCATGCATGTCATCGCCCCTGAGGGCCTTGCCATGGGACACAGCGGGCTACACAGTAGTGATCACTGTCATCAGGTCTCTCCCGTCCAACGCCGCTTCAGGTCTGTTGGCCTCAGCACCCGTCCCTGTATGACCTGCAGTGACCGTAGGAGTCGTAGGGAGGACGCCAGGACGCCCCGGAAGCCGGAAATGGATTCCGTGACCTTTGATGATGTGGTTGTGAATTTCACCCTGGACGAGTGGGACCTGCTGGATTATTCCCAGAGGGAACTCTACCGAGATGTTGTGGGGGAAATCTTTATGAGCTTGGCTTTTATAGGGGAAAAATGGAACCAGAACATCGAAGATTGGTACAGAAATCAAGGGAGAAATTTAAGCAGTCACATTGTAGAAAGCCACTGTGAAAGTGATGAAGGCGGTCAGTGTGGAGAAACCTTCACCGAGATTCTAGATCAGAATTGGGACCAGAAAACCCTTCCTGAAGTGAAATCCCAAGAATGCCGTGTGTGTGGAGTAGTCTTCTTGCCTCTTTCATCCCCATCTGAACCCATCGCATCTCCCATGGGTCAGGGATTAAATGAGTATCAGGAATTGGAAGGGAAACCACATACATGTAGACAGTGTGAGAAAGCCTTAGGCTGTTACTGCCCTTTCCAGATTGATGATAGGAGTCATACTGGAGAGAAATCCCACGAATGTCAAGGACACGAGGAAGCCTTCATTTCTGTCACCAGCCTGGAAGGATATGTGATAACACATGCTGGAGGTGGACCACATAAGTGTTCTGTGTGTGGGAAAGGCTTGCAGTATCCAAGTTCACTTAGGATCCACGAAAGGATTCACACTGGAGAGAAGCCCTTTGAGTGTAACCAGTGTGGGAAAGCCTTCAGTTGTTTAGGTTCAGTTCGAAGACACCAAAGAACGCACACTGGAGAGAAACCCTATACATGTAAAGAGTGTGGAAAAGCCTTCAGTTCTCTCTCAGGCCTTCAGGGACACACAATGCGGCACACTGGAGGTGGTCCTCATAAATGTAAGGAATGTGGGAAGGTCTTTAACTCCCCCAGTGCACTGAAAAAACATGAAAGAACTCACACAGGAGAGAAGCCATATCCATGTAAGCATTGTGGGAAAGGCTTCATCTGCTCCACTTCAGTTCGAAAACATGAAAGAACTCACACAGGGGAGAAACCCTATGAATGTAAGCAGTGTGGGAAAGCCTACATTTCTCTTTCGGGCCTGCAAGGACACATGATAAGGCACACGGGAGATGGGCCCTATAAGTGTAAATTTTGTAGGAAGGCCTTTGGCTCTCCCAGTGCAGTTCTGAGGCATGAAAGTGCTCATGTTGTGTAG

XM_004865612.1 Coding sequence

LOC101719474 zinc finger protein 709-like

Length: 1728 bp    Location: 3346235..3366116   Strand: +
>XM_004865612.1
ATGGACTCCGTGGCCTTTGAGGATGTGGCTGTGAACTTCACCAAAGAGGAGTGGGCTTTGCTGGATCTTTCCCAGAAGGCACTCTACAGAGATGTGATGCAGGAAACCTTCATTAACTTGGCTTCTATAGGGGAAAATTGGAATGACCACAACAGTGAAGATAAGCAGAAAAACCAGGGGAGAAATCTAAGAGGTCATATGGTAGAGAGACTTTGTGAAAAGAAAGAAGGTCAATTTAGGGAAACCATCAGCCAGGTTCCAGATCTTAAACGGAACAAGAAAGCTCTTCCTGGAGTAAAACCCTATGAGTGTAGTGTGTGTGGAAAAGTCTATATGTGTCACTCATCTCTTAATAGGCATATGAAGACTCACACTGGAGAGAAGCCCTATAAATGTAAGGAATGTGGGAAAGCTTTCAGTTGGCCCAGTTCTTTCCAGATCCATGAAAGAACTCACACTGGAGAGAAACCATATGAATGTAAGGAGTGTGGCAAAGCCTTCATTTATCACACAACCTTTCGAGGACACATGAGAATGCACACAGGAGAGAAACCATATAAATGTAAAGAATGTGGGAAAACCTTCAGTCATCCGAGTTCATTTCGAAACCATGAAAGAACTCACTCTGGAGAGAAACCCTATGAATGTAAACAATGTGGAAAAGCCTTTAGATATTACCAAACTTTTCAAATACATGAAAGGACTCACACTGGAGAAAAACCCTATCAGTGTAAGCAGTGTGGTAAAGCTCTCAGTTGTCCCACATCTTTTCGAAGTCATGAAAGAATTCATACTGGTGAAAAACCTTATAAATGTAGAAAATGTGGCAAAGCCTTCAGTTTTCCCAGTTCTTTTCGAAAGCACGAAAGAATTCATACTGGGGAGAAACCTTACGATTGCAAGGAATGTGGGAAAGCATTCATTTCTCTTCCAAGCTACAGAAGACACATGATTATGCATACTGGAAATGGGCCTTATAAGTGTAAAGAATGTGGCAAAGCCTTTGATTGTCCCAGTTCGTTTCAGATTCATGAGAGAACTCACACTGGAGAGAAGCCCTATGAATGTAAGCAATGTGGGAAAGCTTTCAGTTGTTCCAGCTCTTTTCGAATGCATGAAAGGACTCACACTGGTGAGAAACCTCATGAATGTAAACAATGTGGTAAGGCCTTCAGTTGTTCCAGTTCTGTTAGAATCCATGAAAGGACTCACACTGGAGAGAAGCCTTATGAGTGTAAACAGTGTGGGAAAGCCTTCAGTTGTTCCAGCTCTTTTCGAATGCATGAAAGAATTCACACTGGAGAGAAACCCTATGAATGTAAACAGTGTGGGAAAGCCTTCAGTTTTTCCAGTTCATTTCGAATGCATGAAAGAACGCACACTGGAGAGAAACCTTATGAATGTNNNCAGTGTGGGAAAGCCTTCAGTTGTTCCAGTTCCATTCGGATACATGAAAGGACTCACACTGGAGAGAAGCCCTATGAATGTAAGCAGTGTGGGAAGGCCTTCAGCTGCTCCAGTTCTGTTCGAATGCATGAGAGAACTCACACTGGAGTGAAACCCTATGAATGTCAGCAATGTCATAAAGCCTTTAGTTGCTCCCGTTCATTTCGGATCCATGAAAGAACTCACACTGGAGAAAAACCCTATGAATGTCAACAATGTGGTAAAGCATTCAAGTGTTCACGTTCCTTTCGAATACATGGAAGAACTCATAATGGACAGTAG

XM_004865617.1 Coding sequence

Alkbh7 alkB, alkylation repair homolog 7 (E. coli), transcript variant X1

High confidence: 4 potential gene matches
Length: 657 bp    Location: 3507657..3509314   Strand: +
>XM_004865617.1
ATGGCCGGGAGTGGGCAGCTGGCTTTGCGGACGCTGTCAGGGTCAGGCTGGGTGCGGGGCTCCAGCTCTGCGTTGCTGAACCGCCTGAAGGATGTGGCCGTGGTGCATCCCGGCTTCCTGAGCAAGGACGAGGAGGAGACGCTGAGCCGCGAGCTGGAACCCCAGCTGCGGCGTCGCCGCTACGAATACGATCACTGGGATGCGGCCATCCACGGCTTTCGGGAGACGGAGAAGTCCCGCTGGTCAGAGGCCGGCCACACCATCCTGCAGCGCGTGCAGGCGGCCGCCTTCCGCCCTGGCCAAACTCTGCTGTCCCCAATCCACGTACTGGACCTGGAGCCTCGGGGCTACATCAAGCCCCACGTGGACAGTGTCAAGTTCTGCGGAGCCACCATCGCCGGCCTGTCCCTACTGTCACCAAGTGTCATGCGGTTGGTGCACACCCAGGAGCCAGGGCAGTGGCTGGAACTCTTACTGGAGCCTGGCTCCCTCTATATCCTAAGGGACTCAGCCCGCTATGATTTCTCCCATGAGATCCTCCGAGGCGAAGAATCCTTTTTTGGGGAGCGTCAGGTTCCCCGGGGCCGACGCATCTCTGTGATCTGCCGCTCTGTCCCTGAGGGGATGGGGCCAGGACAGCTGTCCCCAGCCTGCTGA

XM_004865613.1 Coding sequence

LOC101719819 zinc finger protein 709-like

Length: 1875 bp    Location: 3370930..3384727   Strand: +
>XM_004865613.1
ATGGACTTGGTGACCTTTGAGGATGTGGCTGTGAGCTTCACCCAGGAAGAGTGGGCTTTGCTGGATCCTTTTCAGAAGAATCTATACAGAGATGTGATGCGGGAAACTCTCAGTAATCTGGCCTTTGTAGGACTAAAATGGGAAGACCAGAACATTGAAGAACTGTACCAAAATCCTGGCAAAAACCTAAGAAGACATGTTGTAGAGAGACTCTGGGAAGGGGTCAAAGGTGCTCAACGTAGAGAAACCTGCAGCCAGATTCCAGATCTCAGGCTCAGGAAGAAAACTCCTGCTGTAAAATCCTATGACTACAGTGTATGTGGAGAAGTCTGCATTGGTCATTCATCCCTTAATAGGCACACGAGAGCTCACACTGAACACAAAACATGTGAACATAAAGATGGAAAGAAAACATATCAAGATAAGCAATGTGGAAATGCCTTCAGTTTTCACGATTCCTTTAAAAAATCTGAAAGAACTTGTTCTGAAGAGAAATCCTATCAATGTAAGGAATGTGGAAAATTCTATACTTCTGTATCAAACTTTCAAAGACATGTGGAAAGGCACAGTGAAGATGGACCTTATAAATGTAAGGCATGTGGCAAAGCCTTTTATTCTTCCAATTCTTTTCTAGTACATGAAAGAATTCACACTAGAAAGAAACCCTACCAGTGCAAACAGTGTGGTAAAAGTCTAAGTACTTCCAAAGCCTTTCAGATACATAAAAGAACCCATACTGGAGAGAAACCTCATGAATGTGAGGAATGTGGAAAAGCTTTCAACTGTCCTAGTACTTTTCAAAGACATAAAAGAACTCATAGTGGAGAAAAACCCTATGAGTGTAAAAAATGTGGTAAGGCCTTTGGTCGTTTCAGTTCTTTTCGAATACATGAAAGAATGCATACTAGGACAAATGCATACTATGAATGTGAGGTATGTGGAAAAGCCTTCATTTCTCTCTCACCTTTTCAAAGGCATATGATAACACATACTGGAGAAGGACCTCACAAATGTAAGGAATGTGGAAAAATATTCATTAGTTCTAGTGCATTTCAAATACATGAACGACTACACACTGGAGAGAAGCCCTTTGAATGTAAACAGTGTGGGAAAACCTTAAGTAGTGCCAGTTCCTTTCAAATACATGAAAGGACTCACACTGGAGAGAAGCCATATGAATGTAAGGAGTGTGGGAAAACCTTCAGTTGTCCCAGCTCCTTTCAAAGACATGAAAAGACTCACTCTGGGGAGAAGCCATATGAGTGTAAGCAGTGTGATAAGGCCTTTAGTCGTTCTTGCTACCTTCAGATGCATGAAAGGTCTCATACTGGAGAGAAGCCCTACACTGGAGAGAAGCCCTATCAGTGTAAACAGTGTGGTAAAGCATTTCGCGGTTCCAGTTCCTTTCAAGTTCATAAAAGAACTCATACTGGAGAAAAACCCTACGAATGTAAAGAATGTGGGAAAGTCTTCAGTTGTCCAAGTTCATTTAAAAGGCACCAGAAGATTCACACTGGAGAGAAACCCTATGAGTGTACACAATGTGGTAAAGCCTTTGGGCGTTACAGTTCCCTTCAGATACATGAAAGAAATCACACTGGAGAGAAACCGTATGAATGTCAAGAATGTGGAAAGGTCTTCAGGAGTTCTAGTTCCTTTCAAATACATAAAAGAACTCACACTGGGGAGAAACCCTATGTATGTCAAGAATGTGGGAGAGCCTTTAGTTGTCCCAGTACCCTTCAAAAACATGAAAGGACTCACACTGGAGAAAAACCCTATCCATGTACAAAGTGTGGGAAAGCTTTCAGTCGATCCAGTAACTTTCGAACACACCAAAGATCCCATTGTGAAGGGAAAACTGCACAAATATAA

XM_004866062.1 Coding sequence

LOC101709945 hepatoma-derived growth factor-related protein 3-like

Length: 687 bp    Location: 3467368..3457381   Strand: -
>XM_004866062.1
ATGGCACGTCCGCGACCCCGCGAGTACAAGGCGGGCGACTTGGTCTTCGTCAAGGTGAAGGGCTACCCACACTGGCCGGCGCGGACTGATGAACTCCCAGAGGGAGCTGTGACGCCTCCAGCAAACAAGTATCCTATCTTCTTTTTTGGCACCCATGAAACTGCATTTCTGGATCCCATAGATCTTTTTCCATATAAGGACTACAAAGACAAGTTTGTAAAGTCAAACAAACGGAAAGGATTTAATGAAGGATTGTGGGAAATAGAAAATAACCAAGGAGTAAAGTTTACTAGTTACCAGGCAATTCAACAGCAGAGCTCTTCAGAAACTGAGGGAGAAGGTGGAAATACTACAGATGCAAGCAGTGAGGAAGAAGGTGACAGGGTAGAAGAAGATGGAAAAGGCAAAAGAAAGAATGAAAAAGGAAGCTCAAAACTGAAAAAGTCATATACTTCAAAGAAATCCTCTAAACAATCCCGGAAATCTCCAGGTGATGAAGATGATAAAGACTGCAGAGAAGAGGAAAACAAAAGCAGCTCTGAAGGTGGAGATCCTGGCAATGACACAAGAAACACAGCTTCAGACCTGCAGAAAACCAGCGAAGGACCTAGCTACCACAATGAATGCTGCATATTTCAAGAAACCACAAGAAGTTTAAATGCCTCCATGCTGCTCATCCCTGGGTGA

XM_004865615.1 Coding sequence

Clpp ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)

High confidence: 4 potential gene matches
Length: 819 bp    Location: 3499154..3505769   Strand: +
>XM_004865615.1
ATGTGGCCCCGAATGTTAGTAGGGGAGGTCTGGGAGGCGGCAGGCAAGTGCTCGGTGCTGGGGCCTCGCCTCGCCGCTCGCGTCGCGCCGCAGCGGACACTCAGGAGCGGCCTGACCCTGCGGCGGAGCCTGCACGCGACGGCGGTCCGGGCCCTCCCGCTCATTCCCATCGTGGTAGAGCAGACGGGTCGCGGCGAACGCGCCTATGACATCTATTCGCGGCTGCTGCGGGAGCGCATCGTGTGCGTCATGGGCCCGATTGATGACACCGTTGCCAGCCTGGTCATCGCACAACTGCTGTTCCTGCAGTCTGAGAGCAACAAGAAACCCATCCACATGTACATCAACAGCCCTGGTGGTGTGGTGACTGCCGGCCTGGCCATCTATGACACAATGCAGTACATCCTGAACCCCATCTGCACGTGGTGTGTGGGTCAGGCCGCCAGCATGGGGTCCTTGCTTCTCGCCGCCGGCAGCCCTGGCATGCGCCACTCACTCCCCAACTCCCGAATCATGATTCACCAGCCCTCTGGGGGCGCCCGGGGCCAAGCCACAGACATCGCCATCCAGGCAGAGGAGATCATGAAGCTGAAAAAGCAGCTGTACAACATCTACGCCAAGCACACCAAGCAGAGCCTGCAGGTGATCGAGTCAGCCATGGAGAGGGACCGCTACATGAGCCCCATGGAGGCCCAGGAGTTTGGCATCCTGGACAAGGTCCTGGTCCACCCGCCCCAGGATGGCGAGGATGAGCCGGAGCTGGTACAGAAGGAACCCACGGTGGCACCAGCAGACCCTCCTGCCCCGACCAGTACCTGA

XM_004865619.1 Coding sequence

Khsrp KH-type splicing regulatory protein

High confidence: 4 potential gene matches
Length: 2247 bp    Location: 3545978..3535302   Strand: -
>XM_004865619.1
ATGTCGGACTACAGCACAGGAGGACCCCCTCCCGGGCCGCCGCCCCCCGCCGGCGGGGGTGGGGGAGCCGGGGGCGCCGGGGGAGGCCCTCCGCCGGGCCCGCCGGGCGCAGGGGACCGGGGTGGCGGCGGCCCGGGTGGCGGCGGCCCGGGTGGAGGGTCTGCCGGGGGCCCCTCGCAGCCGCCCGGCGGAGGAGGCCCGGGCACCCGCAAGGACGCCTTTGCCGACGCTGTGCAGCGGGCCCGCCAGATCGCAGCCAAAATTGGAGGCGATGCTGCCACAACCGTGAATAACAGCACTCCTGATTTTGGTTTTGGGGGCCAAAAGAGACAGTTGGAAGATGGAGATCAGCCAGAGAGCAAGAAACTGGCTTCCCAGGGAGACTCGATTGGTTCTCAGCTTGGACCCATCCACCCTCCACCACGGACTTCAGTGACAGAAGAATACAGGGTCCCGGACGGCATGGTTGGCCTGATCATTGGTAGAGGTGGTGAACAAATTAACAAAATCCAACAGGACTCAGGTTGTAAAGTACAGATCTCTCCAGACAGCGGTGGGCTGCCTGAGCGCAGCGTGTCCCTGACCGGAGCCCCAGAGTCTGTCCAGAAAGCAAAGATGATGCTGGATGACATTGTGTCTCGGGGTCGTGGGGGACCCCCAGGCCAGTTCCATGACAGTGCCAATGGGGGTCAGAATGGCACTGTGCAGGAGGAGATTATGATCCCTGCGGGCAAGGCTGGCCTGGTCATTGGCAAAGGCGGGGAGACGATTAAACAGCTGCAGGAACGCGCCGGGGTGAAGATGATCCTAATTCAGGACGGATCCCAGAACACGAATGTGGACAAGCCTCTGCGGATCATCGGGGACCCTTACAAAGTGCAGCAAGCCTGCGAGATGGTGATGGACATCCTCCGTGAACGTGACCAGGGTGGCTTTGGGGACCGGAATGAGTACGGATCTCGGATTGGCGGGGGCATTGATGTCCCGGTGCCCAGGCATTCTGTCGGGGTGGTCATTGGCCGGAGCGGTGAAATGATCAAGAAGATCCAGAATGATGCCGGGGTGCGGATTCAGTTCAAGCAAGATGATGGGACAGGACCGGAGAAGATTGCTCACATCATGGGCCCCCCAGACAGGTGTGAGCATGCAGCCCGGATTATCAACGACCTCCTCCAGAGCCTCAGGAGTGGTCCCCCAGGCCCTCCAGGAGGTCCCGGCATGCCCCCAGGAGGCCGGGGCCGGGGCCGGGGCCAAGGTAGCTGGGGCCCCCCTGGCGGGGAGATGACCTTCTCCATCCCCACCCACAAGTGCGGGCTGGTCATCGGCCGAGGGGGTGAGAATGTGAAAGCCATAAACCAGCAGACAGGCGCCTTTGTAGAGATTTCCCGGCAGCTGCCGCCCAACGGGGACCCCAACTTCAAACTGTTCATCATCCGGGGCTCGCCCCAGCAGATTGACCACGCCAAGCAGCTCATCGAGGAGAAGATCGAGGGTCCCCTGTGCCCTGTCGGACCAGGCCCAGGGGGACCAGGCCCTGCGGGTCCCATGGGGCCCTTCAACCCTGGGCCTTTCAATCAGGGGCCTCCAGGGGCTCCCCCCCATGCCGCTGGACCCCCTCCTCACCAGTACCCGCCTCAGGGCTGGGGCAATACCTATCCCCAGTGGCAACCACCTGCTCCTCATGACCCAAGTAAAGCCGCCGCTGCAGCCGCAGACCCTAATGCCGCCTGGGCTGCCTACTACTCCCACTACTACCAGCAGCCCCCAGGCCCCGTGCCGGGACCTGCTCCGGCCCCCGCAGCCCCGCCCACCCAAGGGGAGCCGCCACAGCCACCGCCCACCGGGCAGTCCGACTACACCAAGGCCTGGGAGGAGTACTACAAGAAGATCGGCCAGCAGCCCCAGCAGCCCGGCGCGCCCCCTCAGCAGGACTACACGAAGGCCTGGGAGGAGTACTACAAGAAGCAAGCCCAAGTGGCCACTGGAGGGGGTCCGGGAGCACCCCCAGGCTCCCAGCCGGACTACAGCGCCGCCTGGGCTGAGTATTACAGACAGCAGGCCGCTTACTACGGACAGACTCCCGGTCCCGGGGGCCCCCAGCCGCCTCCCACCCAGCAGGGACAGCAGCAGGCAAGTGGGAATTGCCACCCTCCTCCTCCTCCTTTCTCCTTCCAACCCCCGGCCACCGTCCATCCTGCCTTAGTGGGTAGCGCCGGCAATCCCTTCCCCTGCGGGGTGTGCCCTTGA

XM_004866064.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1140 bp    Location: 3553785..3547275   Strand: -
>XM_004866064.1
ATGGCTGTTGGTACTGAAGACTCCAATGACTCTGGCTCCAGGCTCCAGACCCTGATTCACAGGGTCAAGGCCTGGCCCCTCAAAGCCCCTCTGCGCCTCTTGCCCCACCTCCACCCTCACCCCCACCCCGGTCCCAGGGCTTCCGGCCTGGGCCGCAGGGGAGGGATTCCCGCCACGCAGCTAGGACAAAAGGCCCAGGGTGGCCAAGGACAGGCACGGGCTGGGTCTTCCCTGCAGGTGCTGGACACGGGAGAGCAGCTGATGGTCCCTGTGGAGGTCCTGGAGATACAGAACAACGGGCCCCTGTGGAAGTTTCTGCTGTCGGGCGCCGTAGCCGGGGCCGTGTCCTGCACGGGAACGGCGCCTCTGGACGCCAAGGTGTACATGCAGGTCTACTCCTCCAAGAACAACCTTATGAACCTGCTCGGAGGGCTCAGGAGCATGGTCCAGGAGGGGGGCATCCTCTCCCTGTGGGGGGGCAATGGCATCAACGTGCTCAAGATCGCCCCGGAGTACGCCAGCAAGTTCTCGGTCTTTGAGCAGGGCAAGGGTTACTTCTGTGAAGAACATGGGTCCCCAGCCTTCCAGGAGCGGCTGCTGGCTGGCTCCCTGGCCATGACCATCTCTCAGACTCTCATCGACCCCACGGAGGTGCTCAAGACCAGGCTGACCCTGAGCCAGAAAGGCCAGTACCTGGGGCTGCTGNNCATTGAAGAAGAGATCATGAGGTGGGAGGGTGCCCGAGCCCTTTACCGAGGCTACCTGCCCAACATGCTCAGCATCATTCCCTATGCCTGCGCTGACCTAGCGGTCTATGAGATGCTACAGTGTTTATGGCTGAAGTCAGTCAGGGATATGGAGGACCCCAGCAGCCTGGTCAGTCTGTTCTCCGTGACACTGTCCACAACCTGTGGATAGATGGCCAGTTATCCACTGACTTTGGTGTCCACCCGGATGCAGGCACAAGACATCGTGGAGGGCTCCAAGTCCACCATGAGTGGAGTCTTTTGGCAGATCCTGGCTGAACAGGGCTGGCAGGGGCTTTATCGAGGCATTATTCCCAGGTTACTGAAGGTGTTGCCAGCGGGTGGCATCAGCTGTGTGGTGTATGAAGCCATGAAGAAAATGCTGGGCGTGTAG

XM_004865621.1 Coding sequence

LOC101722518 protein crumbs homolog 3-like, transcript variant X1

Length: 1113 bp    Location: 3571185..3578146   Strand: +
>XM_004865621.1
ATGTGTCGAGGTGCAGAGTCCAAGGGAGAATGTGACCCGGCAGCAGGCAGGGAAGCGCTTGCTGTCTCCTGGCAGACATGGTCCACCACCAGGGTGCCAGTGTGGCCAGCCAGCCTGCAGGCCCGGCTCCTCGGCCACCTGCTTTTCGATCCCATTAGGCCAGACCCGGGTGGACAGGGGGAAGGGAACGGAGACAGAGGTTCTGGATTCCAGCCACAGGAACGAAAATTCTCGCTTTTCCCAGACGAACGGAAGAACCCTGAGCCGACTAAACCCTTCATCTGCCCGTCCGCGCGCGGTCAGACTCTCCACTCGGTGACAGAAACTCAAGATCGAGAGCCAGTGCTCTGGCGTCTGTCCCTTTGGCCCTCCCGCGCGCCTCCTTTCTGTCTCACCCGGGGTAGGAAACGGTCCTCGGGACAGGATCGTGTTCCTTTCACCCTTTATTCAGATGCAGCCGTCAGGGCTCATTTGGTTCCAGCCCAGCCTTTGTCCAGACAGGTGTTTGTGAACAGGGATGTTTTCAAGCTGGTGTCCTATACCCAGGAAAGTGTTATACAGGTACTGCATAGGTGCGCCAGCGGCGCGGCCCCGCCCCTATGGCCCCGCCCACCACCAGCTCAGGTGCACAAGCCGGAAGTGCGTTCCCCTCCCAGGTGCCGGGTCGCAGGTGGCCCCGGCCCAAGATGCAGTAGAAGCGGCGCGCCCTGGAAGCTCGGTCCCTGGCGTCACCAACCCAACTTCCAGCCCATGGCGACCCCAGGCCTGGGGCTGCTCTGGGTACTTGGCCTGGCGCTGCTGCCCACCCGCTGGGGCCGAGCCTGGGGGGAAAACTCAACATCAACACCGGCCTCTTTGACGCAGGAGCCCAATGACTTCAGCTCCAATGGGGGCCTGTCTCAGGAGGGCCTTACTGCTATCATTGTGGTCTTCTCCATCCTTGGGGCTCTGGTCGTGGTGTCGGGGCTGGTGTTCATGGTACAGAAACTTCGGGAGAAGCGGCAGACGGAGGGCACCTACCGGCCCAGCAATGAGGAGCAGTTCTCCCACGCAGCCGAGGCCCGGGCCCCCCAGGACTCCAAGGAGACGGTTCGGGGCTGCCTGCCCATCTAG

XM_004865623.1 Coding sequence

LOC101722518 protein crumbs homolog 3-like, transcript variant X3

Length: 1056 bp    Location: 3571185..3578146   Strand: +
>XM_004865623.1
ATGTGTCGAGGTGCAGAGTCCAAGGGAGAATGTGACCCGGCAGCAGGCAGGGAAGCGCTTGCTGTCTCCTGGCAGACATGGTCCACCACCAGGGTGCCAGTGTGGCCAGCCAGCCTGCAGGCCCGGCTCCTCGGCCACCTGCTTTTCGATCCCATTAGGCCAGACCCGGGTGGACAGGGGGAAGGGAACGGAGACAGAGGTTCTGGATTCCAGCCACAGGAACGAAAATTCTCGCTTTTCCCAGACGAACGGAAGAACCCTGAGCCGACTAAACCCTTCATCTGCCCGTCCGCGCGCGGTCAGACTCTCCACTCGGTGACAGAAACTCAAGATCGAGAGCCAGTGCTCTGGCGTCTGTCCCTTTGGCCCTCCCGCGCGCCTCCTTTCTGTCTCACCCGGGGTAGGAAACGGTCCTCGGGACAGGATCGTGTTCCTTTCACCCTTTATTCAGATGCAGCCGTCAGGGCTCATTTGGTTCCAGCCCAGCCTTTGTCCAGACAGGTGTTTGTGAACAGGTGCGCCAGCGGCGCGGCCCCGCCCCTATGGCCCCGCCCACCACCAGCTCAGGTGCACAAGCCGGAAGTGCGTTCCCCTCCCAGGTGCCGGGTCGCAGGTGGCCCCGGCCCAAGATGCAGTAGAAGCGGCGCGCCCTGGAAGCTCGGTCCCTGGCGTCACCAACCCAACTTCCAGCCCATGGCGACCCCAGGCCTGGGGCTGCTCTGGGTACTTGGCCTGGCGCTGCTGCCCACCCGCTGGGGCCGAGCCTGGGGGGAAAACTCAACATCAACACCGGCCTCTTTGACGCAGGAGCCCAATGACTTCAGCTCCAATGGGGGCCTGTCTCAGGAGGGCCTTACTGCTATCATTGTGGTCTTCTCCATCCTTGGGGCTCTGGTCGTGGTGTCGGGGCTGGTGTTCATGGTACAGAAACTTCGGGAGAAGCGGCAGACGGAGGGCACCTACCGGCCCAGCAATGAGGAGCAGTTCTCCCACGCAGCCGAGGCCCGGGCCCCCCAGGACTCCAAGGAGACGGTTCGGGGCTGCCTGCCCATCTAG

XM_004865622.1 Coding sequence

LOC101722518 protein crumbs homolog 3-like, transcript variant X2

Length: 1104 bp    Location: 3571185..3578146   Strand: +
>XM_004865622.1
ATGTGTCGAGGTGCAGAGTCCAAGGGAGAATGTGACCCGGCAGCAGGCAGGGAAGCGCTTGCTGTCTCCTGGCAGACATGGTCCACCACCAGGGTGCCAGTGTGGCCAGCCAGCCTGCAGGCCCGGCTCCTCGGCCACCTGCTTTTCGATCCCATTAGGCCAGACCCGGGTGGACAGGGGGAAGGGAACGGAGACAGAGGTTCTGGATTCCAGCCACAGGAACGAAAATTCTCGCTTTTCCCAGACGAACGGAAGAACCCTGAGCCGACTAAACCCTTCATCTGCCCGTCCGCGCGCGGTCAGACTCTCCACTCGGTGACAGAAACTCAAGATCGAGAGCCAGTGCTCTGGCGTCTGTCCCTTTGGCCCTCCCGCGCGCCTCCTTTCTGTCTCACCCGGGGGTCCTCGGGACAGGATCGTGTTCCTTTCACCCTTTATTCAGATGCAGCCGTCAGGGCTCATTTGGTTCCAGCCCAGCCTTTGTCCAGACAGGTGTTTGTGAACAGGGATGTTTTCAAGCTGGTGTCCTATACCCAGGAAAGTGTTATACAGGTACTGCATAGGTGCGCCAGCGGCGCGGCCCCGCCCCTATGGCCCCGCCCACCACCAGCTCAGGTGCACAAGCCGGAAGTGCGTTCCCCTCCCAGGTGCCGGGTCGCAGGTGGCCCCGGCCCAAGATGCAGTAGAAGCGGCGCGCCCTGGAAGCTCGGTCCCTGGCGTCACCAACCCAACTTCCAGCCCATGGCGACCCCAGGCCTGGGGCTGCTCTGGGTACTTGGCCTGGCGCTGCTGCCCACCCGCTGGGGCCGAGCCTGGGGGGAAAACTCAACATCAACACCGGCCTCTTTGACGCAGGAGCCCAATGACTTCAGCTCCAATGGGGGCCTGTCTCAGGAGGGCCTTACTGCTATCATTGTGGTCTTCTCCATCCTTGGGGCTCTGGTCGTGGTGTCGGGGCTGGTGTTCATGGTACAGAAACTTCGGGAGAAGCGGCAGACGGAGGGCACCTACCGGCCCAGCAATGAGGAGCAGTTCTCCCACGCAGCCGAGGCCCGGGCCCCCCAGGACTCCAAGGAGACGGTTCGGGGCTGCCTGCCCATCTAG

XM_004865624.1 Coding sequence

LOC101722518 protein crumbs homolog 3-like, transcript variant X4

Length: 585 bp    Location: 3573716..3578146   Strand: +
>XM_004865624.1
ATGTTTTCAAGCTGGTGTCCTATACCCAGGAAAGTGTTATACAGGTGCGCCAGCGGCGCGGCCCCGCCCCTATGGCCCCGCCCACCACCAGCTCAGGTGCACAAGCCGGAAGTGCGTTCCCCTCCCAGGTGCCGGGTCGCAGGTGGCCCCGGCCCAAGATGCAGTAGAAGCGGCGCGCCCTGGAAGCTCGGTCCCTGGCGTCACCAACCCAACTTCCAGCCCATGGCGACCCCAGGCCTGGGGCTGCTCTGGGTACTTGGCCTGGCGCTGCTGCCCACCCGCTGGGGCCGAGCCTGGGGGGAAAACTCAACATCAACACCGGCCTCTTTGACGCAGGAGCCCAATGACTTCAGCTCCAATGGGGGCCTGTCTCAGGAGGGCCTTACTGCTATCATTGTGGTCTTCTCCATCCTTGGGGCTCTGGTCGTGGTGTCGGGGCTGGTGTTCATGGTACAGAAACTTCGGGAGAAGCGGCAGACGGAGGGCACCTACCGGCCCAGCAATGAGGAGCAGTTCTCCCACGCAGCCGAGGCCCGGGCCCCCCAGGACTCCAAGGAGACGGTTCGGGGCTGCCTGCCCATCTAG

XM_004865628.1 Coding sequence

Tubb4a tubulin, beta 4A class IVa

High confidence: 4 potential gene matches
Length: 1338 bp    Location: 3594316..3587985   Strand: -
>XM_004865628.1
ATGCGGGAGATCGTGCACCTGCAGGCCGGCCAGTGCGGCAACCAGATCGGGGCCAAGTTTTGGGAGGTGATCAGCGACGAACATGGCATCGACCCCACTGGCACGTACCACGGGGACAGCGACCTGCAACTGGAGAGGATCAATGTCTACTACAACGAGGCCACCGGAGGGAATTACGTCCCCCGCGCGGTCCTGGTGGACCTGGAGCCCGGCACCATGGACTCCGTCCGCTCAGGCCCCTTCGGCCAGATCTTCCGGCCTGACAACTTTGTGTTTGGCCAGTCGGGAGCTGGCAACAACTGGGCAAAGGGCCACTACACAGAGGGCGCAGAGCTGGTGGATGCTGTCCTGGACGTGGTGCGGAAGGAGGCCGAGAGCTGCGACTGTCTGCAGGGCTTCCAGCTCACGCATTCGCTGGGGGGCGGCACGGGCTCGGGCATGGGCACCCTGCTCATCAGCAAGATCCGCGAGGAGTTCCCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCACCCAAGGTGTCGGACACCGTGGTGGAGCCCTACAACGCCACCCTGTCCGTGCACCAGCTGGTGGAGAACACGGATGAGACCTACTGCATCGACAACGAGGCGCTGTATGACATCTGCTTCCGCACCCTCAAGCTGACCACCCCCACCTACGGGGACCTCAACCACCTGGTGTCGGCCACCATGAGCGGCGTCACCACCTGCCTGCGCTTCCCAGGCCAGCTGAACGCAGACCTGCGCAAGTTGGCCGTGAACATGGTGCCCTTCCCGCGCCTGCACTTCTTCATGCCGGGCTTCGCGCCCCTCACCAGCCGGGGCAGCCAGCAGTACCGCGCCCTGACAGTGCCCGAGCTCACCCAGCAGATGTTCGACGCCAAGAACATGATGGCCGCCTGCGACCCGCGCCATGGCCGCTACCTGACCGTGGCCGCCGTGTTCCGGGGCCGCATGTCCATGAAGGAGGTGGACGAGCAGATGCTGAGTGTGCAGAGCAAGAACAGCAGCTACTTCGTGGAGTGGATCCCCAACAACGTGAAGACGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGGCTGCGACCTTCATCGGCAACAGCACAGCCATCCAGGAGCTGTTCAAGCGCATCTCGGAGCAGTTCACGGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCCGAGTACCAGCAGTACCAGGATGCCACGGCCGAGGAGGGTGAATTCGAGGAGGAGGCGGAGGAGGAGGAGGTCGCCTAG

XM_004866065.1 Coding sequence

Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9

High confidence: 3 potential gene matches
Length: 753 bp    Location: 3615927..3623349   Strand: +
>XM_004866065.1
ATGAGCTCGCGCCCTGACTTCTCCGCGGATCCCGAGGCCCCGTGGACGTCCGCGCCGCTCTCCCCGGCCTGCCGCCTGCTCCGCTGGGGCCTGGGCGCCGCGGCGCTGCTGGTGGCTGTGGCCGGGGGCGCAGCGATCGGCACCTGGGTGGTGGCTCCCTACCTCGCCGCGCCGGGCGCCAGCCCCGCGCCCAGCCGGGGGCTCCACCGGAGCTCCGCGTCGAGTGTCCAGCCGGGACCCACGGAGGAGCCGGAACTGACAGCCAGGTTGTTGGCCCGAAACGTGACCCTGGGAAATGGGACCCTGAGCTGGTACAGCCATCAAGGGATAGCAGGTGTGCACCTGTCCCCGGGCCTGACCTACGATGAACACAGGCAGGAGCTGGTGGTGGCGAAGGCTGGACACTATCAAGTCTGTTTACACCTGGAACTGAGCCACGTGTTGCCGACCTCCAGGGACTCCGGCAAGGTCTCTCTGGCCCTACACCTGGAGCCGCCACAAGCTGAGGCCACCGCCCACCCTCTGGCCGTGGACCTTTCGCCCTACTCCTCACTCCCAGTCCAGGGTTCCCGCTGCCAGCCGCTGCAGATGGCCGACCTTCAGCGACTCAGTGTCCACCTCAGCGTCTACCTGCCCACCGGGGGCAGCAAGCACCAGGCCTGGCAGCTGGCCCAGCCCGCCACCCAACCCGCCACCAAGTTAGAACTCTTTCGACTGAGTGCCGACGTCCCAGACAGACGCCTGTCCACGTGA

XM_004865629.1 Coding sequence

Tnfsf14 tumor necrosis factor (ligand) superfamily, member 14, transcript variant X1

High confidence: 4 potential gene matches
Length: 726 bp    Location: 3769010..3764210   Strand: -
>XM_004865629.1
ATGGAGGAGCAGGTCGTGGGGCCCTCGGTGTTTGTGGTGGACGGACAGACAGACATCCCGTTCAGGAGGCTGGGCCCGAGCCACCGGAGACAGTGCTGCAGCCCGGCCCGGGTGGGCCTGGGGGTCCTGCTGCTGCTCCTGGGGGCCACGCTGGCCGCGCAGGGCTGGTTCCTGCTGCAGCTGTACTGGCGTCTAGAGGAGGTGGTCACCCGCCTGCCGGACCAAGACGCAGGGCCCCGGGAGAAGTTGATACAAGAGTGGAGATCCCAACAGACCAACCCAGCAGCGCACCTTACAGGGGCCAACTCCAGCTTGACCAGCCGTGGCGGCCCGCTGCTGTGGGAGTCACAGTTGGGCCTGGCGTTCCTAAGAGGCCTCAGCTACCGCAATGGGGCCCTGGTGACCACCAAGGCTGGCTACTATTACATCTACTCTAAAGTGCAGCTGGGCGGCATGGGCTGTCCCCAGGGCCTGGCCAGTGGCTTCCCCATCACCCACGGGCTGTACAAGCGCACGCCCCGGTACCCTGAGGAGCTGGAGCTGCTGGTGAGCCGACGGTCGCCCTGTGGGCGGGCAAACAACTCCCGAGTCTGGTGGGACAGCAGCTTCCTGGGCGGCGTGGTGCACCTGGAGGCCGGGGAGGAGGTGGTCGTCCGGGTGCCCGATGAGCGTCTGATCCGCCTGCGTGATGGCACTCGGTCCTACTTTGGAGCTTTCATGGTGTGA

XM_004865632.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X1

Length: 2154 bp    Location: 3812129..3805151   Strand: -
>XM_004865632.1
ATGGCAGAGAGCGAGAGGAGGGGGCTCGGCTGCTGGAACCCCATAGAGTTAGGGCAGCGGCTTCTTCTGCTGCTGTTGGTGGGCAGCTGTTCGGGGCGTATCCACCGACTGGCGCTGACGGGGGAGAAGCGAGCAGACATCCAACTCAATAGCTTCGGCTTCTACATCAATGGTTCCCTGGAAGTGGAGTTGAGCCTCTTGCGGCTGAGCCCCCAGGAGACAGAAGAGAAGTCGCCGTTGGTGGGGTTCAGCCTGAGCAGGGTTCGATCTGGCAGCATCCGATCCTACTCAGTAAGTGGGGGAGTGAGGAAGTACTGTGGGGGTACTGGGTGGGGCTGTCTCCTGTCTCTGGAGCCTGAAGACCCCTGCTCTTTCCCAGAAGTGGGGGCAGGAACAGATCCTGAGGGAAGGAGGGAGGCAGGGTGGGGCTGGGACCACAGGAAGCCGGAACCCAGGTTCCCTCTGCCCACTCCCAGGCCCAGGATTCCCATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGGTCCAGGTACGGAAGTATGGGGCACAGGAGAAACTGTTCATCTCTCCCGGGCTCCTCCCTGCCAAACCTGGGCTCCCCAAGGCAGAGCACACTGACACTCCTGAGGTGGACAGCGGAAACTCCACAGCTGGCAAAGCCAAGGCTAAACCTGCAGGGTCTCAGGTTTGGGGAGCTGGGGTGGGCCGGAGAAAGGTATACCCCAAGGGTGTTTGGGTTCCCAAGCCCGGGGCCAGCTGTTGGAAGGGCTCTGCCCCCTCAGGGTCCCGTTGAGAAGAACAAGGACCTGGTGTTGGACCTGGGCCACCTCAATGACTCCTACAACTTCAGTTTCCACGTGGTGATTGGCTCCAGGGCCGAGGAAGGCCAGTACAACCTCAACTTCCACAACTGCTACAACCTGATGCCTGGCCAGGAACGCCCCTTCGACCTCACAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTGCGGGTGCAGAGGCCCTGGAGGAAGGCGGGACAGGGGTACAGCTCAGGGGCCCCCACCCACCGCACCCCGCTCTCCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTGAGGGCCCCGCCCCCGGACGAGGCTCCTCCCAGGGCACTGGGGCGGTCAGTGCTGACCGCACCGTGTGTCCTCTGCCTGTGCCAGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGACTTTCCGCCCCGGGACTGTCTGCCCTGTCTGCCCCGGCCCCTCCGTCCTCCGTGACCCCAGCCCCCTCTGTGCGCCCTCCCCAGTGTTGGTGAACCTGGCCAAGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATGTCTACTTCACACGCATCATCGCCATCCTGCTGCGCGTGGCTGTGCCCTTCCAGTGGCAATGGCTGTACCAGCTCTTAGTGGAGGGCTCCACGCTCGCCTTCTTTGTGCTCACGGGCTACAAGTTCCAGCCCACCAGGGACAACCCGTACCTGCAGCTGCCCCAGGAGGACGAGGAGGACGTACAGATGGAGCAAGTGATGACGGACTCTGGGTTCCGGGAAGGCCTCTCCAAAGTCAACAAAACAGCAAGCGGACGAGAGCAGTTGTGA

XM_004865701.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X8

Length: 5733 bp    Location: 4688566..4764185   Strand: +
>XM_004865701.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCAAGCCGTCAGCCCCCCCTCAAGACGTTAAGTGTACCAGCATGCGCTCCACGGCCATTCTGGTAAGTTGGCGCCCGCCACCGCCGGACACGCACAACGGGGCCCTAGTGGGCTACAGCGTCCGCTACCGACCGCTGGGCTCAGACGACCCGGAACCCAAGGAGGTGAATGGCATCCCCCCGACCACCACTCAGATCCTCCTGGAAGCCCTGGAGAAGTGGACTGAATACCGTATCACTGCCATCGCACACACAGAGGTGGGGCCAGGGCCCGAGAGCTCGCCCGTGGTCATCCGCACCGAGGAGGACGTGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTGGCGCTCGCCCGCGCCCGGCCGGCACCACGGTCAGATCCGCGGCTACCAGGTCCACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGATGTGATGCTGGCCGATGCCCAGGAAATGGTCATCACAAACCTCGAGCCTGAGACCGCGTACTCCATCACAGTAGCTGCCTATACTATGAAAGGCGACGGCGCTCGCAGCAAACCCAAGGTGGTGGTGACCAAGGGAGCAGTGCTGGGCCGCCCCACCCTCACGGTGCAGCAGACCTCAGAGGGCAGCCTCCTGGCGCGCTGGGAGCCGCCGCCCGGCGTCCCTGCCGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTCGGCCGCGAGGACGCAATGCCACTGGCCACACTGGAGTTCCCGGCCTCCAAGGACCACTACACAGCAGCAGGCGTGCACAAGGGGGCCACCTATGTGTTCCGGCTGGCAGCGCGCAGCCGAGGCGGCCTGGGCGAGGAGGCGGCCCAGGTCCTGAGCATCCCCGAGGATACGCCCCGTGGCCATCCACAGATCCTGGAGGCAGCCGGCAACGCCTCGGCCGGCACCGTCCTGCTCCGCTGGCTGCCACCTGTGCCTGCTGAGCGCAACGGGGCCATCGTCAAGTACACGGTGGCCGTGCGGGAGGCCGGCACCTTGGGGCCTCCCCGAGAGACAGAGCTGCCCGCGGCGGTGGAGCCTGGGGCTGAGAATGCGCTCACGCTTCGGGGCCTCAAGCCTGACACGGCCTATGACCTGCAAGTGCGAGCCCACACACGCCGGGGCCCCGGCCCCTACAGCCCCCCTGTCCGCTACCGCACGTTCCTGCGGGACCAAGTCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865641.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X10

Length: 1629 bp    Location: 3812113..3805151   Strand: -
>XM_004865641.1
ATGGCAGAGAGCGAGAGGAGGGGGCTCGGCTGCTGGAACCCCATAGAGTTAGGGCAGCGGCTTCTTCTGCTGCTGTTGGTGGGCAGCTGTTCGGGGCGTATCCACCGACTGGCGCTGACGGGGGAGAAGCGAGCAGACATCCAACTCAATAGCTTCGGCTTCTACATCAATGGTTCCCTGGAAGTGGAGTTGAGCCTCTTGCGGCTGAGCCCCCAGGAGACAGAAGAGAAGTCGCCGTTGGTGGGGTTCAGCCTGAGCAGGGTTCGATCTGGCAGCATCCGATCCTACTCAGCCCAGGATTCCCATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGGTCCAGGTACGGAAGTATGGGGCACAGGAGAAACTGTTCATCTCTCCCGGGCTCCTCCCTGCCAAACCTGGGCTCCCCAAGGCAGAGCACACTGACACTCCTGAGGTGGACAGCGGTGAGTCCGGAAACTCCACAGCTGGCAAAGCCAAGGCTAAACCTGCAGGGTCTCAGGGTCCCGTTGAGAAGAACAAGGACCTGGTGTTGGACCTGGGCCACCTCAATGACTCCTACAACTTCAGTTTCCACGTGGTGATTGGCTCCAGGGCCGAGGAAGGCCAGTACAACCTCAACTTCCACAACTGCTACAACCTGATGCCTGGCCAGGAACGCCCCTTCGACCTCACAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGTGTTGGTGAACCTGGCCAAGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATGTCTACTTCACACGCATCATCGCCATCCTGCTGCGCGTGGCTGTGCCCTTCCAGTGGCAATGGCTGTACCAGCTCTTAGTGGAGGGCTCCACGCTCGCCTTCTTTGTGCTCACGGGCTACAAGTTCCAGCCCACCAGGGACAACCCGTACCTGCAGCTGCCCCAGGAGGACGAGGAGGACGTACAGATGGAGCAAGTGATGACGGACTCTGGGTTCCGGGAAGGCCTCTCCAAAGTCAACAAAACAGCAAGCGGACGAGAGCAGTTGTGA

XM_004865633.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X2

Length: 2082 bp    Location: 3811803..3805151   Strand: -
>XM_004865633.1
ATGAAGGACTGCAGATCGAGAAGAGTAACTACTCGGGGTGGTTACCCAGGGGAGAAGCGAGCAGACATCCAACTCAATAGCTTCGGCTTCTACATCAATGGTTCCCTGGAAGTGGAGTTGAGCCTCTTGCGGCTGAGCCCCCAGGAGACAGAAGAGAAGTCGCCGTTGGTGGGGTTCAGCCTGAGCAGGGTTCGATCTGGCAGCATCCGATCCTACTCAGTAAGTGGGGGAGTGAGGAAGTACTGTGGGGGTACTGGGTGGGGCTGTCTCCTGTCTCTGGAGCCTGAAGACCCCTGCTCTTTCCCAGAAGTGGGGGCAGGAACAGATCCTGAGGGAAGGAGGGAGGCAGGGTGGGGCTGGGACCACAGGAAGCCGGAACCCAGGTTCCCTCTGCCCACTCCCAGGCCCAGGATTCCCATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGGTCCAGGTACGGAAGTATGGGGCACAGGAGAAACTGTTCATCTCTCCCGGGCTCCTCCCTGCCAAACCTGGGCTCCCCAAGGCAGAGCACACTGACACTCCTGAGGTGGACAGCGGAAACTCCACAGCTGGCAAAGCCAAGGCTAAACCTGCAGGGTCTCAGGTTTGGGGAGCTGGGGTGGGCCGGAGAAAGGTATACCCCAAGGGTGTTTGGGTTCCCAAGCCCGGGGCCAGCTGTTGGAAGGGCTCTGCCCCCTCAGGGTCCCGTTGAGAAGAACAAGGACCTGGTGTTGGACCTGGGCCACCTCAATGACTCCTACAACTTCAGTTTCCACGTGGTGATTGGCTCCAGGGCCGAGGAAGGCCAGTACAACCTCAACTTCCACAACTGCTACAACCTGATGCCTGGCCAGGAACGCCCCTTCGACCTCACAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTGCGGGTGCAGAGGCCCTGGAGGAAGGCGGGACAGGGGTACAGCTCAGGGGCCCCCACCCACCGCACCCCGCTCTCCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTGAGGGCCCCGCCCCCGGACGAGGCTCCTCCCAGGGCACTGGGGCGGTCAGTGCTGACCGCACCGTGTGTCCTCTGCCTGTGCCAGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGACTTTCCGCCCCGGGACTGTCTGCCCTGTCTGCCCCGGCCCCTCCGTCCTCCGTGACCCCAGCCCCCTCTGTGCGCCCTCCCCAGTGTTGGTGAACCTGGCCAAGCTGAAGCTGTTCCGACATTACTACGTCATGGTCATCTGCTATGTCTACTTCACACGCATCATCGCCATCCTGCTGCGCGTGGCTGTGCCCTTCCAGTGGCAATGGCTGTACCAGCTCTTAGTGGAGGGCTCCACGCTCGCCTTCTTTGTGCTCACGGGCTACAAGTTCCAGCCCACCAGGGACAACCCGTACCTGCAGCTGCCCCAGGAGGACGAGGAGGACGTACAGATGGAGCAAGTGATGACGGACTCTGGGTTCCGGGAAGGCCTCTCCAAAGTCAACAAAACAGCAAGCGGACGAGAGCAGTTGTGA

XM_004865640.1 Coding sequence

Gpr108 G protein-coupled receptor 108, transcript variant X9

Length: 1626 bp    Location: 3812391..3806196   Strand: -
>XM_004865640.1
ATGGCAGAGAGCGAGAGGAGGGGGCTCGGCTGCTGGAACCCCATAGAGTTAGGGCAGCGGCTTCTTCTGCTGCTGTTGGTGGGCAGCTGTTCGGGGCGTATCCACCGACTGGCGCTGACGGGGGAGAAGCGAGCAGACATCCAACTCAATAGCTTCGGCTTCTACATCAATGGTTCCCTGGAAGTGGAGTTGAGCCTCTTGCGGCTGAGCCCCCAGGAGACAGAAGAGAAGTCGCCGTTGGTGGGGTTCAGCCTGAGCAGGGTTCGATCTGGCAGCATCCGATCCTACTCAGTAAGTGGGGGAGTGAGGAAGTACTGTGGGGGTACTGGGTGGGGCTGTCTCCTGTCTCTGGAGCCTGAAGACCCCTGCTCTTTCCCAGAAGTGGGGGCAGGAACAGATCCTGAGGGAAGGAGGGAGGCAGGGTGGGGCTGGGACCACAGGAAGCCGGAACCCAGGTTCCCTCTGCCCACTCCCAGGCCCAGGATTCCCATGAATGCCTACTCCAGAGAAACAGTAGCAATCTCGTGGTTCTGTTCCTCATCAACACCAAGGATCTGCAGGTCCAGGTACGGAAGTATGGGGCACAGGAGAAACTGTTCATCTCTCCCGGGCTCCTCCCTGCCAAACCTGGGCTCCCCAAGGCAGAGCACACTGACACTCCTGAGGTGGACAGCGGAAACTCCACAGCTGGCAAAGCCAAGGCTAAACCTGCAGGGTCTCAGGTTTGGGGAGCTGGGGTGGGCCGGAGAAAGGTATACCCCAAGGGTGTTTGGGTTCCCAAGCCCGGGGCCAGCTGTTGGAAGGGCTCTGCCCCCTCAGGGTCCCGTTGAGAAGAACAAGGACCTGGTGTTGGACCTGGGCCACCTCAATGACTCCTACAACTTCAGTTTCCACGTGGTGATTGGCTCCAGGGCCGAGGAAGGCCAGTACAACCTCAACTTCCACAACTGCTACAACCTGATGCCTGGCCAGGAACGCCCCTTCGACCTCACAGTATTCATCCGGGAGAAGAACCCCGAGGGCTACTTATCTGCAGCGGAAATTCCCCTCTTCAAGCTCTACCTGATCATGTCCGCCTGCTTCCTGGCCTCCGGCATCTTCTGGGTGAACGTGCTCTGCAGGAACACGTACAACGTCTTCAAGATCCACTGGCTCATGGCGGCCCTGGCGTTCACCAAGAGCATCTCACTCCTCTTCCACAGTATCAACTACTACTTCATCAACAGCCAGGGCCACCCCATCGAAGGCCTCGCTGTGGTGCACTACGTCACGCACCTGCTGAAGGGCGCCCTCCTCTTCATCACCATCGCCTTGATCGGCTCCGGCTGGGCCTTCGTCAAGTACGTCCTGTCCGACAAGGAGAAGAAGATTTTCGGGATTGTGATTCCCCTGCAGGTCCTGGCCAACGTGGCCTACATCATCATTGAGTCCCGAGAAGCGGGCGCCAGCGACTATGGGCTTTGGAAGGAGATCCTGTTCCTGGTGGACCTCATCTGCTGTGGCGCCATCCTCTTCCCAGTTGTCTGGTCCATCCGACATCTCCAGGACGCCTCTGGCACAGATGGGAAGGACTTTCCGCCCCGGGACTGTCTGCCCTGTCTGCCCCGGCCCCTCCGTCCTCCGTGA

XM_004865644.1 Coding sequence

Trip10 thyroid hormone receptor interactor 10, transcript variant X2

Length: 1809 bp    Location: 3814153..3824279   Strand: +
>XM_004865644.1
ATGGATTGGGGCACCGAGTTGTGGGATCAGTTTGAGGTGCTGGAGCGCCATACGCAATGGGGGCTGGACCTGTTGGACAGATACGTGAAGTTCGTGAAAGAGCGCACGGAGGTCGAACAGGCCTATGCGAAGCAGCTGCGGAGCCTGGTGAAAAAATACCTGCCCAAGAGACCGACCAAAGATGACCCCGAATCCAAGTTCAGCCAGCAGCAGTCCTTCGTGCAACTCCTGCAGGAGGTGAATGATTTCGCTGGCCAGAGGGAGCTGGTAGCCGAAAACCTCAGCGTGCGCGTGTGTCTCGAGCTGGCCAAGTACTCGCAGGAGATGAAGCAGGAGAGGAAGATGCACTTCCAGGAAGGGCGGCGTGCCCAGCAGCAGCTGGAGAATGGCTTCAAACAGCTGGAGAGTAGTAAGCGTAAATTTGAGCGAGACTGCAGGGAAGCTGAGAAGGCCACCCAGACCGCTGAGCGGCTGGACCAGGATATCAATGCCACCAAGGCTGACGTGGAGAAGGCCAAGCAGCAAGCACACCTCCGGAGTCACATGGCAGAAGAAAGCAAGAACGAGTATGCAGCCCAGCTACAGCGTTTTAACCGAGACCAGGCCCACTTCTATTTTTCACAGATGCCCCAAATATTTGATAAACTTCAGGACATGGATGAACGCCGGACCACCCGCCTAGGGACTGGGTATGGGCTCCTGTCGGGGGCCGAGCTGCAGGTGGTACCCATCATTGCCAAGTGCTTGGAGGGCATGAAGGTGGCTGCGGATGCCGTGGATGCAAAAAACGACTCCCAGGTCCTCATTGAGCTGCACAAGTCAGGCTTTGCCCGCCCCAGTGATGTGGAATTCGAAGACTTCAGCCAGCCCATGAACCGCGCCCCCTCGGACAGCAGCCTGGGCACCCCATCCGACGGCCGCCCAGAGGTCCGGGGCACGGGCCGCAGCCGTGCCAAGCGCTGGCCCTTCAGCAAGAAGAACAAGCCGCGCCCCCCATCCCTCTCCCCCCTGGGGGGTCCCCCGTCCTCGGTATTGCCTAATGGGCCCCCATCCCCCCGCTCCGGCCTCGACCCCTTGGCCATACTGAGTGAGATCAGTAAGTCGGTCAAACCCCGGCTAGCGTCCTTCCGCAGCCTCCGAGGCGGCCGAGGGGCAGTGGTGACGGAAGATTTTAGCCATCTGCCCCCAGAGCAGCAGAGAAAGCGGCTTCAGCAGCAGTTAGAAGAACGGAATCGTGAGCTCCAGAAGGAGGTGGATCAGAGGGAAGCCTTAAAGAAGATGAAGGATGTGTATGAGAAGACGCCTCAGATGGGGGACCCGGCCAGCTTGGAGCCCCAGATCACAGAGACCCTGCGCAATATCGAGCGGCTGAAGTTGGAAGTACAGAAGTATGAGGCTTGGCTGGCTGAAGCCGAGAGCCGGGTCTTGAGCAACAGAGGGGACAGCCTGAACCGGCACACCCGGCCTCCCGACCCCCCGGCCAGTGCCCCGCCGGACAGCAGCAGCAACAGCAATAGTGGGTCACAGGAGAACAAGGAGAGCTCTGAAGAGCCCCCCTCAGAAGACGGACAGGACACTCCCATCTACACAGAGTTTGATGAAGATTTTGAGGAGCCCACGTCCCCCATAGGCCAGTGTGTAGCCATCTACCACTTTGAAGGGTCCAGCGAGGGCACCATCTCCATGGCCGAGGGTGAAGACCTCAGTCTGATGGAGGAAGACAAAGGCGATGGCTGGACCCGGGTTCGGCGGAAACAGGGAGGGGAGGGCTATGTGCCCACCTCCTACCTTCGGGTCATGCTCAACTGA

XM_004865645.1 Coding sequence

Trip10 thyroid hormone receptor interactor 10, transcript variant X3

Length: 1644 bp    Location: 3814153..3824279   Strand: +
>XM_004865645.1
ATGGATTGGGGCACCGAGTTGTGGGATCAGTTTGAGGTGCTGGAGCGCCATACGCAATGGGGGCTGGACCTGTTGGACAGATACGTGAAGTTCGTGAAAGAGCGCACGGAGGTCGAACAGGCCTATGCGAAGCAGCTGCGGAGCCTGGTGAAAAAATACCTGCCCAAGAGACCGACCAAAGATGACCCCGAATCCAAGTTCAGCCAGCAGCAGTCCTTCGTGCAACTCCTGCAGGAGGTGAATGATTTCGCTGGCCAGAGGGAGCTGGTAGCCGAAAACCTCAGCGTGCGCGTGTGTCTCGAGCTGGCCAAGTACTCGCAGGAGATGAAGCAGGAGAGGAAGATGCACTTCCAGGAAGGGCGGCGTGCCCAGCAGCAGCTGGAGAATGGCTTCAAACAGCTGGAGAGTAGTAAGCGTAAATTTGAGCGAGACTGCAGGGAAGCTGAGAAGGCCACCCAGACCGCTGAGCGGCTGGACCAGGATATCAATGCCACCAAGGCTGACGTGGAGAAGGCCAAGCAGCAAGCACACCTCCGGAGTCACATGGCAGAAGAAAGCAAGAACGAGTATGCAGCCCAGCTACAGCGTTTTAACCGAGACCAGGCCCACTTCTATTTTTCACAGATGCCCCAAATATTTGATAAACTTCAGGACATGGATGAACGCCGGACCACCCGCCTAGGGACTGGGTATGGGCTCCTGTCGGGGGCCGAGCTGCAGGTGGTACCCATCATTGCCAAGTGCTTGGAGGGCATGAAGGTGGCTGCGGATGCCGTGGATGCAAAAAACGACTCCCAGGTCCTCATTGAGCTGCACAAGTCAGGCTTTGCCCGCCCCAGTGATGTGGAATTCGAAGACTTCAGCCAGCCCATGAACCGCGCCCCCTCGGACAGCAGCCTGGGCACCCCATCCGACGGCCGCCCAGAGGTCCGGGGCACGGGCCGCAGCCGTGCCAAGCGCTGGCCCTTCAGCAAGAAGAACAAGGCAGTGGTGACGGAAGATTTTAGCCATCTGCCCCCAGAGCAGCAGAGAAAGCGGCTTCAGCAGCAGTTAGAAGAACGGAATCGTGAGCTCCAGAAGGAGGTGGATCAGAGGGAAGCCTTAAAGAAGATGAAGGATGTGTATGAGAAGACGCCTCAGATGGGGGACCCGGCCAGCTTGGAGCCCCAGATCACAGAGACCCTGCGCAATATCGAGCGGCTGAAGTTGGAAGTACAGAAGTATGAGGCTTGGCTGGCTGAAGCCGAGAGCCGGGTCTTGAGCAACAGAGGGGACAGCCTGAACCGGCACACCCGGCCTCCCGACCCCCCGGCCAGTGCCCCGCCGGACAGCAGCAGCAACAGCAATAGTGGGTCACAGGAGAACAAGGAGAGCAGCTCTGAAGAGCCCCCCTCAGAAGACGGACAGGACACTCCCATCTACACAGAGTTTGATGAAGATTTTGAGGAGCCCACGTCCCCCATAGGCCAGTGTGTAGCCATCTACCACTTTGAAGGGTCCAGCGAGGGCACCATCTCCATGGCCGAGGGTGAAGACCTCAGTCTGATGGAGGAAGACAAAGGCGATGGCTGGACCCGGGTTCGGCGGAAACAGGGAGGGGAGGGCTATGTGCCCACCTCCTACCTTCGGGTCATGCTCAACTGA

XM_004865647.1 Coding sequence

Sh2d3a SH2 domain containing 3A

Length: 1731 bp    Location: 3836049..3824638   Strand: -
>XM_004865647.1
ATGCAGGTGCCACAGGATGGAGAAGACCTCTCCCACCAACCCTGGTACCATGGCACCCTGTCCCGCCAGAAGGCTGAAGCTCTTCTTCTCCAAGATGGTGACTTCCTGGTTCGCACCTCTGGATCCCGTGGGGACCACCCTGTGATCTCATGCCGCTGGCAGGGGTCTGCTCTACATTTTGAGGTATTCCGTGTGGCCCTGCGTCCCCGACCAGGCCGGCCTGAGGCCCTCTTTCAACTGGAAGATGAGAGATTCACAAGCATGCCAGCGCTGGTGCACAGTTACGTGACCGGCCAGCGCCCACTGTCCCAAGCCACAGGGGCTGTGGCCTCCAGGCCTGTGGTCCGGCAGAGGCCTCTGCGGCGCAGCTTCAGTGAAGATACCCTTATGGGCAACCCAGCTCGGGCTGAGTCCTTCAGGGCTAGGAAGTGGAGCAACAGCCAACCTGCAGACTTGGATCATACGGGCCAGGCCACAGAAGCCCACTCCGGACCAGGAGCCTGCACCACACCCGAATCTGCCCTGCTCCGGATGGGCAGTGACCCCGTGTTGCCGAATGTCCCAGCTCCCTTGGGGACCGTTGCTGACAGCCTCAGAGCTTCTGATGGGCAGCTTCACGCCAAGGCACCAACCAAGCCCCCCCGGACACCCTCACTGATGCTTCCAGATGCCCCTGGACTCCCCTCAACGTACTGTGAGCTGGTTCCCCGAGTGCCCAGCGCCCAGGGAACACACCCTGGCCACAGCTGTTCAGAGCCTGAGGCCCCGTGGTGGGAGGCTGAAGAGGAGGAAGAGGAGGAGGACAGGTGTTTCGCAAGACCACAGGGCGAGGTCTCTTTCTGCCCTCCTGGCAACCCCTCCAGCCTGTTGGGCCCCCAGAATCGGCCCCTGGACCCCAAAGTACTGCATGTTCTCCGAGGCTTGTTCCTGGAGCACCACGCGGACAGCACGGCCCTCCACCTGCTGTTGGTGGATTGCCAGGCCGCAGGCCTCCTGGGAGTGACCAAGGCTCAGCAAGCGGCCATGGGGGTCCGCTCTGGCCTGGAGCTGCTCAGCCTTCCCCATGGGCATCGTTTGAGGTTGGAACTGCTGGAGAGGCTGGAGACCCTGGAGCTGGCAGGGGCGCTGGCTGTCTTGGGGTGCACGGGACCGCTGGAGGAGCGCGCGGCCGCACTGAGGGGCCTCGTGGAGCTGGCCCTGGCGCTGCGGCCCGGGGCGGCAGGGGACCTGGCCGGGCTGGCCGCGGTCATGGGCGCCCTCCTCCTGCCCCAGGTGTCGCGGTTGGAGTGCACCTGGCGCCAGCTCCGACAGAGACACACAGAGGCTGCGCTGGCCTTCGAGCAGGAGCTGAAGCCGCTGATGCGAGCTCTGGATGAGGGCTCAGGCCCCAGCGAGCCTGGCGAGGTGGCGCTGCCGCACGTGGCACCCGCTGTGCGCCTGCTGGAGGGCGAGGATCTCGAGGGGCCGCTGGAAGAGAGCGGCGAGCGGCTGCTGCGCACCCTGCAGGGGGCGCGTCAAATGGTGCGCAACGCCCCCAAGTTCCGCCTGGCGGCTGCTCGGCGCCTACAAGGATTCAGGCCTAATCCGGAGCTGAGGGAGGCACTGACCACCGGCTTCCTACAGAGGCTGCTCTGGGGAAGCCGAGGCGCCAGGGCACCGAGAGCTGACCGCCTGCAGAAGTTCCAGCGTGTCCTCAGCATCCTGTCCCAGTGCCTGGAGCCTGGCCACTAA

XM_004865648.1 Coding sequence

Vav1 vav 1 guanine nucleotide exchange factor, transcript variant X1

Length: 2538 bp    Location: 3838706..3896696   Strand: +
>XM_004865648.1
ATGGAGCTGTGGCGACAGTGTACCCACTGGCTCATCCAGTGCCGGGTGCTGCCGCCCAGCCACCGCGTCACCTGGGAGGGCGCTCAGGTCTGCGAGCTGGCGCAGGCCCTCAGGGATGGCGTCCTCCTGTGTCAGCTGCTCAACAACCTCCTGCCCCATGCCGTCAACCTGCGTGAGGTCAACCTGCGTCCACAGATGTCCCAGTTTCTGTGCCTTAAGAACATCCGAACCTTCCTGTCCACTTGCTGTGAGAAGTTTGGCCTCAAGCGCAGTGAGCTCTTCGAGGCTTTTGACCTCTTCGATGTGCAAGATTTTGGAAAGGTCATCTACACGCTGTCCGCTCTGTCCTGGACCCCGATCGCCCAGAACAAGGGGATCATGCCCTTCCCCACGGATGAGGACGGCGTGGGTGATGACGACATCTACAGCGGCCTGTCGGATCAGATCGACGACACCGTGGAGGAGGACGAGGACCTGTACGACTGCGTGGAGAACGAGGAGGCCGAGGGCGACGAGATCTATGAGGACCTCATGCGCACAGAACCGGTGCCCATGCCGCCCAAGATGACGGAGTACGAGAAGCGCGGCTGCTGCTTGCGCGAGATCCAGCAGACCGAGGACAAGTACACGGACACGCTGGGCTCCATCCAGCAGCACTTTATGAAGCCCCTACAGCGGTTTCTCAAGCCCCAGGACATGGAGATAATCTTCATCAACATGGAGGACCTGCTCCGCGTTCACACCCACTTCCTGAAGGAGATGAAGGAGGCGCTCACAACCCCGGGGGCTCCCACCCTGTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTTGTCTACGGCCGCTACTGCAGCCAGGTGGAGTCGGCCAGCAAACACCTGGACCAGGTGGCCACGGCCCGAGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGCGAGCCAACAACGGCAGGTTCACCTTGCGGGACCTGCTGATGGTCCCCATGCAGAGAGTGCTCAAATATCACCTCCTTCTCCAGGAGCTGGTGAAGCACACCCAGGACGCCATGGAGAAGGAGAACCTGCGGCTGGCCCTGGACGCCATGAGGGACCTGGCGCAGTGTGTAAACGAGGTCAAGAGGGACAACGAGACGCTGCGGCAGATCACCAACTTCCAGCTGTCCATTGAGAACCTGGACCGATCGCTGGCCAACTACGGCCGGCCCAAGATTGACGGGGAGCTCAAGATCACCTCGGTGGAGAGGCGGTCCAAGATGGACAGGTACGCCTTCCTGCTGGACAAAGCGCTGCTCATCTGCAAGCGGCGGGGCGACTCCTATGACCTCAAGGACTTTGTGAGCCTGCACAACTTCCAGGTTCGCGACGACTCCTCCGGAGAGCGAGACCACAAGAAGTGGAGCCACATGTTTCTCCTGATCGAGGACCAGGGTGCCCAGGGCTACGAGCTGTTCTTCAAGACCCGCGAGCTGAAGAAGAAGTGGATGGAGCAATTCGAGATGGCCCTCTCCAATATCTACCCGGAGAATGCCACTGCCAATGGCCATGACTTCCAGATGTTTTCCTTTGAGGAGACCACGTCCTGCAAAGCTTGCCAGATGCTTCTCAGAGGGACCTTCTACCAGGGCTACCGCTGTCACCGGTGCCGGGCGCCTGCGCACAAGGAGTGTCTGGGGAGGGTGACTCCGTGCGGCCGGCACGGGCCAGATTTTGCAGGGACCATGAAGAAGGACAAGCAGCACCGCAGGGCTCAGGAGAAAAAACGCAACGAGTTGGGTCTGCCTAAGATGGAAGTGTTTCAGGAATACTATGGCCTTCCTCCTCCACCTGGAGCCTTCGGACCTTTCCTACGGCTCAACCTTGGGGACATCGTGGAGCTCACAAAAGCTGAGGCTGAACAGAACTGGTGGGAGGGTAGAAACACGTGTACCAATGAAGTTGGCTGGTTTCCCTGTAACCGGGTAAAGCCCTATGTCCACGGACCTCCTCAGGACCTGTCGGTTCACCTGTGGTACGCAGGCCCCATGGAGCGCGCAGGAGCTGAGAGCATCCTCACCAACCGCTCGGACGGGACCTTCTTGGTGCGGCAGAGGGTGAAGGACGCGGCAGAATTCGCCATCAGCATTAAGTTTAACGTCGAGGTCAAGCATATTAAAATCACGACATCAGAAGGACTGTACCGGATCACAGAGAAGAAGGCTTTCCGGGGGCTTTTGGAGCTGGTAGAATTTTACCAGCAGAACTCCCTGAAGGATTGCTTCAAGTCTCTGGACACCACCTTGCAGTTCCCCTACAAGGAGCCCGAGAGAAGAGCCATCAGCAAGCCACCAGCTGGGAGCGCCAAGTACTTTGGCACAGCCAAAGCCCGCTACGACTTCTGTGCCAGGGACCGATCAGAGCTGTCTCTTAAGGAGGGCGACATCATCAAGATCCTCAGCAAAAAGGGGCAACAAGGCTGGTGGCGAGGGGAGATCTATGGCCGGATTGGCTGGTTCCCTTCAAACTACGTGGAAGAAGATTATTCCGAATACTGTTGA

XM_004865652.1 Coding sequence

Vav1 vav 1 guanine nucleotide exchange factor, transcript variant X5

High confidence: 4 potential gene matches
Length: 2421 bp    Location: 3838706..3896696   Strand: +
>XM_004865652.1
ATGGAGCTGTGGCGACAGTGTACCCACTGGCTCATCCAGTGCCGGGTGCTGCCGCCCAGCCACCGCGTCACCTGGGAGGGCGCTCAGGTCTGCGAGCTGGCGCAGGCCCTCAGGGATGGCGTCCTCCTGTGTCAGCTGCTCAACAACCTCCTGCCCCATGCCGTCAACCTGCGTGAGGTCAACCTGCGTCCACAGATGTCCCAGTTTCTGTGCCTTAAGAACATCCGAACCTTCCTGTCCACTTGCTGTGAGAAGTTTGGCCTCAAGCGCAGTGAGCTCTTCGAGGCTTTTGACCTCTTCGATGTGCAAGATTTTGGAAAGGTCATCTACACGCTGTCCGCTCTGTCCTGGACCCCGATCGCCCAGAACAAGGGGATCATGCCCTTCCCCACGGATGAGGACGGCGTGGGTGATGACGACATCTACAGCGGCCTGTCGGATCAGATCGACGACACCGTGGAGGAGGACGAGGACCTGTACGACTGCGTGGAGAACGAGGAGGCCGAGGGCGACGAGATCTATGAGGACCTCATGCGCACAGAACCGGTGCCCATGCCGCCCAAGATGACGGAGTACGAGAAGCGCGGCTGCTGCTTGCGCGAGATCCAGCAGACCGAGGACAAGTACACGGACACGCTGGGCTCCATCCAGCAGCACTTTATGAAGCCCCTACAGCGGTTTCTCAAGCCCCAGGACATGGAGATAATCTTCATCAACATGGAGGACCTGCTCCGCGTTCACACCCACTTCCTGAAGGAGATGAAGGAGGCGCTCACAACCCCGGGGGCTCCCACCCTGTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTTGTCTACGGCCGCTACTGCAGCCAGGTGGAGTCGGCCAGCAAACACCTGGACCAGGTGGCCACGGCCCGAGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGCGAGCCAACAACGGCAGGTTCACCTTGCGGGACCTGCTGATGGTCCCCATGCAGAGAGTGCTCAAATATCACCTCCTTCTCCAGGAGCTGGTGAAGCACACCCAGGACGCCATGGAGAAGGAGAACCTGCGGCTGGCCCTGGACGCCATGAGGGACCTGGCGCAGTGTGTAAACGAGGTCAAGAGGGACAACGAGACGCTGCGGCAGATCACCAACTTCCAGCTGTCCATTGAGAACCTGGACCGATCGCTGGCCAACTACGGCCGGCCCAAGATTGACGGGGAGCTCAAGATCACCTCGGTGGAGAGGCGGTCCAAGATGGACAGGTACGCCTTCCTGCTGGACAAAGCGCTGCTCATCTGCAAGCGGCGGGGCGACTCCTATGACCTCAAGGACTTTGTGAGCCTGCACAACTTCCAGGTTCGCGACGACTCCTCCGGAGAGCGAGACCACAAGAAGTGGAGCCACATGTTTCTCCTGATCGAGGACCAGGGTGCCCAGGGCTACGAGCTGTTCTTCAAGACCCGCGAGCTGAAGAAGAAGTGGATGGAGCAATTCGAGATGGCCCTCTCCAATATCTACCCGGAGAATGCCACTGCCAATGGCCATGACTTCCAGATGTTTTCCTTTGAGGAGACCACGTCCTGCAAAGCTTGCCAGATGCTTCTCAGAGGGACCTTCTACCAGGGCTACCGCTGTCACCGGTGCCGGGCGCCTGCGCACAAGGAGTGTCTGGGGAGGGTGACTCCGTGCGGCCGGCACGGGCCAGATTTTGCAGGGACCATGAAGAAGGACAAGCAGCACCGCAGGGCTCAGGAGAAAAAACGCAACGAGTTGGGTCTGCCTAAGATGGAAGTGTTTCAGGAATACTATGGCCTTCCTCCTCCACCTGGAGCCTTCGGACCTTTCCTACGGCTCAACCTTGGGGACATCGTGGAGCTCACAAAAGCTGAGGCTGAACAGAACTGGTGGGAGGGTAGAAACACGTGTACCAATGAAGTTGGCTGGTTTCCCTGTAACCGGGTAAAGCCCTATGTCCACGGACCTCCTCAGGACCTGTCGGTTCACCTGTGGTTTAACGTCGAGGTCAAGCATATTAAAATCACGACATCAGAAGGACTGTACCGGATCACAGAGAAGAAGGCTTTCCGGGGGCTTTTGGAGCTGGTAGAATTTTACCAGCAGAACTCCCTGAAGGATTGCTTCAAGTCTCTGGACACCACCTTGCAGTTCCCCTACAAGGAGCCCGAGAGAAGAGCCATCAGCAAGCCACCAGCTGGGAGCGCCAAGTACTTTGGCACAGCCAAAGCCCGCTACGACTTCTGTGCCAGGGACCGATCAGAGCTGTCTCTTAAGGAGGGCGACATCATCAAGATCCTCAGCAAAAAGGGGCAACAAGGCTGGTGGCGAGGGGAGATCTATGGCCGGATTGGCTGGTTCCCTTCAAACTACGTGGAAGAAGATTATTCCGAATACTGTTGA

XM_004865650.1 Coding sequence

Vav1 vav 1 guanine nucleotide exchange factor, transcript variant X3

Length: 2472 bp    Location: 3838706..3896696   Strand: +
>XM_004865650.1
ATGGAGCTGTGGCGACAGTGTACCCACTGGCTCATCCAGTGCCGGGTGCTGCCGCCCAGCCACCGCGTCACCTGGGAGGGCGCTCAGGTCTGCGAGCTGGCGCAGGCCCTCAGGGATGGCGTCCTCCTGTGTCAGCTGCTCAACAACCTCCTGCCCCATGCCGTCAACCTGCGTGAGGTCAACCTGCGTCCACAGATGTCCCAGTTTCTGTGCCTTAAGAACATCCGAACCTTCCTGTCCACTTGCTGTGAGAAGTTTGGCCTCAAGCGCAGTGAGCTCTTCGAGGCTTTTGACCTCTTCGATGTGCAAGATTTTGGAAAGGTCATCTACACGCTGTCCGCTCTGTCCTGGACCCCGATCGCCCAGAACAAGGGGATCATGCCCTTCCCCACGGATGAGGACGGCGTGGGTGATGACGACATCTACAGCGGCCTGTCGGATCAGATCGACGACACCGTGGAGGAGGACGAGGACCTGTACGACTGCGTGGAGAACGAGGAGGCCGAGGGCGACGAGATCTATGAGGACCTCATGCGCACAGAACCGGTGCCCATGCCGCCCAAGATGACGGAGTACGAGAAGCGCGGCTGCTGCTTGCGCGAGATCCAGCAGACCGAGGACAAGTACACGGACACGCTGGGCTCCATCCAGCAGCACTTTATGAAGCCCCTACAGCGGTTTCTCAAGCCCCAGGACATGGAGATAATCTTCATCAACATGGAGGACCTGCTCCGCGTTCACACCCACTTCCTGAAGGAGATGAAGGAGGCGCTCACAACCCCGGGGGCTCCCACCCTGTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTTGTCTACGGCCGCTACTGCAGCCAGGTGGAGTCGGCCAGCAAACACCTGGACCAGGTGGCCACGGCCCGAGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGCGAGCCAACAACGGCAGGTTCACCTTGCGGGACCTGCTGATGGTCCCCATGCAGAGAGTGCTCAAATATCACCTCCTTCTCCAGGAGCTGGTGAAGCACACCCAGGACGCCATGGAGAAGGAGAACCTGCGGCTGGCCCTGGACGCCATGAGGGACCTGGCGCAGTGTGTAAACGAGGTCAAGAGGGACAACGAGACGCTGCGGCAGATCACCAACTTCCAGCTGTCCATTGAGAACCTGGACCGATCGCTGGCCAACTACGGCCGGCCCAAGATTGACGGGGAGCTCAAGATCACCTCGGTGGAGAGGCGGTCCAAGATGGACAGGTACGCCTTCCTGCTGGACAAAGCGCTGCTCATCTGCAAGCGGCGGGGCGACTCCTATGACCTCAAGGACTTTGTGAGCCTGCACAACTTCCAGGTTCGCGACGACTCCTCCGGAGAGCGAGACCACAAGAAGTGGAGCCACATGTTTCTCCTGATCGAGGACCAGGGTGCCCAGGGCTACGAGCTGTTCTTCAAGACCCGCGAGCTGAAGAAGAAGTGGATGGAGCAATTCGAGATGGCCCTCTCCAATATCTACCCGGAGAATGCCACTGCCAATGGCCATGACTTCCAGATGTTTTCCTTTGAGGAGACCACGTCCTGCAAAGCTTGCCAGATGCTTCTCAGAGGGACCTTCTACCAGGGCTACCGCTGTCACCGGTGCCGGGCGCCTGCGCACAAGGAGTGTCTGGGGAGGGTGACTCCGTGCGGCCGGCACGGGCCAGATTTTGCAGGGACCATGAAGAAGGACAAGCAGCACCGCAGGGCTCAGGAGAAAAAACGCAACGAGTTGGGTCTGCCTAAGATGGAAGTGTTTCAGGAATACTATGGCCTTCCTCCTCCACCTGGAGCCTTCGGACCTTTCCTACGGCTCAACCTTGGGGACATCGTGGAGCTCACAAAAGCTGAGGCTGAACAGAACTGGTGGGAGGGACCTCCTCAGGACCTGTCGGTTCACCTGTGGTACGCAGGCCCCATGGAGCGCGCAGGAGCTGAGAGCATCCTCACCAACCGCTCGGACGGGACCTTCTTGGTGCGGCAGAGGGTGAAGGACGCGGCAGAATTCGCCATCAGCATTAAGTTTAACGTCGAGGTCAAGCATATTAAAATCACGACATCAGAAGGACTGTACCGGATCACAGAGAAGAAGGCTTTCCGGGGGCTTTTGGAGCTGGTAGAATTTTACCAGCAGAACTCCCTGAAGGATTGCTTCAAGTCTCTGGACACCACCTTGCAGTTCCCCTACAAGGAGCCCGAGAGAAGAGCCATCAGCAAGCCACCAGCTGGGAGCGCCAAGTACTTTGGCACAGCCAAAGCCCGCTACGACTTCTGTGCCAGGGACCGATCAGAGCTGTCTCTTAAGGAGGGCGACATCATCAAGATCCTCAGCAAAAAGGGGCAACAAGGCTGGTGGCGAGGGGAGATCTATGGCCGGATTGGCTGGTTCCCTTCAAACTACGTGGAAGAAGATTATTCCGAATACTGTTGA

XM_004865651.1 Coding sequence

Vav1 vav 1 guanine nucleotide exchange factor, transcript variant X4

Length: 2442 bp    Location: 3838706..3896696   Strand: +
>XM_004865651.1
ATGGAGCTGTGGCGACAGTGTACCCACTGGCTCATCCAGTGCCGGGTGCTGCCGCCCAGCCACCGCGTCACCTGGGAGGGCGCTCAGGTCTGCGAGCTGGCGCAGGCCCTCAGGGATGGCGTCCTCCTGTGTCAGCTGCTCAACAACCTCCTGCCCCATGCCGTCAACCTGCGTGAGGTCAACCTGCGTCCACAGATGTCCCAGTTTCTGTGCCTTAAGAACATCCGAACCTTCCTGTCCACTTGCTGTGAGAAGTTTGGCCTCAAGCGCAGTGAGCTCTTCGAGGCTTTTGACCTCTTCGATGTGCAAGATTTTGGAAAGGTCATCTACACGCTGTCCGCTCTGTCCTGGACCCCGATCGCCCAGAACAAGGGGATCATGCCCTTCCCCACGGATGAGGACGGCGTGGGTGATGACGACATCTACAGCGGCCTGTCGGATCAGATCGACGACACCGTGGAGGAGGACGAGGACCTGTACGACTGCGTGGAGAACGAGGAGGCCGAGGGCGACGAGATCTATGAGGACCTCATGCGCACAGAACCGGTGCCCATGCCGCACTTTATGAAGCCCCTACAGCGGTTTCTCAAGCCCCAGGACATGGAGATAATCTTCATCAACATGGAGGACCTGCTCCGCGTTCACACCCACTTCCTGAAGGAGATGAAGGAGGCGCTCACAACCCCGGGGGCTCCCACCCTGTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTTGTCTACGGCCGCTACTGCAGCCAGGTGGAGTCGGCCAGCAAACACCTGGACCAGGTGGCCACGGCCCGAGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGCGAGCCAACAACGGCAGGTTCACCTTGCGGGACCTGCTGATGGTCCCCATGCAGAGAGTGCTCAAATATCACCTCCTTCTCCAGGAGCTGGTGAAGCACACCCAGGACGCCATGGAGAAGGAGAACCTGCGGCTGGCCCTGGACGCCATGAGGGACCTGGCGCAGTGTGTAAACGAGGTCAAGAGGGACAACGAGACGCTGCGGCAGATCACCAACTTCCAGCTGTCCATTGAGAACCTGGACCGATCGCTGGCCAACTACGGCCGGCCCAAGATTGACGGGGAGCTCAAGATCACCTCGGTGGAGAGGCGGTCCAAGATGGACAGGTACGCCTTCCTGCTGGACAAAGCGCTGCTCATCTGCAAGCGGCGGGGCGACTCCTATGACCTCAAGGACTTTGTGAGCCTGCACAACTTCCAGGTTCGCGACGACTCCTCCGGAGAGCGAGACCACAAGAAGTGGAGCCACATGTTTCTCCTGATCGAGGACCAGGGTGCCCAGGGCTACGAGCTGTTCTTCAAGACCCGCGAGCTGAAGAAGAAGTGGATGGAGCAATTCGAGATGGCCCTCTCCAATATCTACCCGGAGAATGCCACTGCCAATGGCCATGACTTCCAGATGTTTTCCTTTGAGGAGACCACGTCCTGCAAAGCTTGCCAGATGCTTCTCAGAGGGACCTTCTACCAGGGCTACCGCTGTCACCGGTGCCGGGCGCCTGCGCACAAGGAGTGTCTGGGGAGGGTGACTCCGTGCGGCCGGCACGGGCCAGATTTTGCAGGGACCATGAAGAAGGACAAGCAGCACCGCAGGGCTCAGGAGAAAAAACGCAACGAGTTGGGTCTGCCTAAGATGGAAGTGTTTCAGGAATACTATGGCCTTCCTCCTCCACCTGGAGCCTTCGGACCTTTCCTACGGCTCAACCTTGGGGACATCGTGGAGCTCACAAAAGCTGAGGCTGAACAGAACTGGTGGGAGGGTAGAAACACGTGTACCAATGAAGTTGGCTGGTTTCCCTGTAACCGGGTAAAGCCCTATGTCCACGGACCTCCTCAGGACCTGTCGGTTCACCTGTGGTACGCAGGCCCCATGGAGCGCGCAGGAGCTGAGAGCATCCTCACCAACCGCTCGGACGGGACCTTCTTGGTGCGGCAGAGGGTGAAGGACGCGGCAGAATTCGCCATCAGCATTAAGTTTAACGTCGAGGTCAAGCATATTAAAATCACGACATCAGAAGGACTGTACCGGATCACAGAGAAGAAGGCTTTCCGGGGGCTTTTGGAGCTGGTAGAATTTTACCAGCAGAACTCCCTGAAGGATTGCTTCAAGTCTCTGGACACCACCTTGCAGTTCCCCTACAAGGAGCCCGAGAGAAGAGCCATCAGCAAGCCACCAGCTGGGAGCGCCAAGTACTTTGGCACAGCCAAAGCCCGCTACGACTTCTGTGCCAGGGACCGATCAGAGCTGTCTCTTAAGGAGGGCGACATCATCAAGATCCTCAGCAAAAAGGGGCAACAAGGCTGGTGGCGAGGGGAGATCTATGGCCGGATTGGCTGGTTCCCTTCAAACTACGTGGAAGAAGATTATTCCGAATACTGTTGA

XM_004865649.1 Coding sequence

Vav1 vav 1 guanine nucleotide exchange factor, transcript variant X2

Length: 2490 bp    Location: 3838706..3896696   Strand: +
>XM_004865649.1
ATGGAGCTGTGGCGACAGTGTACCCACTGGCTCATCCAGTGCCGGGTGCTGCCGCCCAGCCACCGCGTCACCTGGGAGGGCGCTCAGCTGCTCAACAACCTCCTGCCCCATGCCGTCAACCTGCGTGAGGTCAACCTGCGTCCACAGATGTCCCAGTTTCTGTGCCTTAAGAACATCCGAACCTTCCTGTCCACTTGCTGTGAGAAGTTTGGCCTCAAGCGCAGTGAGCTCTTCGAGGCTTTTGACCTCTTCGATGTGCAAGATTTTGGAAAGGTCATCTACACGCTGTCCGCTCTGTCCTGGACCCCGATCGCCCAGAACAAGGGGATCATGCCCTTCCCCACGGATGAGGACGGCGTGGGTGATGACGACATCTACAGCGGCCTGTCGGATCAGATCGACGACACCGTGGAGGAGGACGAGGACCTGTACGACTGCGTGGAGAACGAGGAGGCCGAGGGCGACGAGATCTATGAGGACCTCATGCGCACAGAACCGGTGCCCATGCCGCCCAAGATGACGGAGTACGAGAAGCGCGGCTGCTGCTTGCGCGAGATCCAGCAGACCGAGGACAAGTACACGGACACGCTGGGCTCCATCCAGCAGCACTTTATGAAGCCCCTACAGCGGTTTCTCAAGCCCCAGGACATGGAGATAATCTTCATCAACATGGAGGACCTGCTCCGCGTTCACACCCACTTCCTGAAGGAGATGAAGGAGGCGCTCACAACCCCGGGGGCTCCCACCCTGTACCAGGTCTTCATCAAATACAAGGAGAGGTTCCTTGTCTACGGCCGCTACTGCAGCCAGGTGGAGTCGGCCAGCAAACACCTGGACCAGGTGGCCACGGCCCGAGAGGACGTGCAGATGAAGCTGGAGGAATGTTCTCAGCGAGCCAACAACGGCAGGTTCACCTTGCGGGACCTGCTGATGGTCCCCATGCAGAGAGTGCTCAAATATCACCTCCTTCTCCAGGAGCTGGTGAAGCACACCCAGGACGCCATGGAGAAGGAGAACCTGCGGCTGGCCCTGGACGCCATGAGGGACCTGGCGCAGTGTGTAAACGAGGTCAAGAGGGACAACGAGACGCTGCGGCAGATCACCAACTTCCAGCTGTCCATTGAGAACCTGGACCGATCGCTGGCCAACTACGGCCGGCCCAAGATTGACGGGGAGCTCAAGATCACCTCGGTGGAGAGGCGGTCCAAGATGGACAGGTACGCCTTCCTGCTGGACAAAGCGCTGCTCATCTGCAAGCGGCGGGGCGACTCCTATGACCTCAAGGACTTTGTGAGCCTGCACAACTTCCAGGTTCGCGACGACTCCTCCGGAGAGCGAGACCACAAGAAGTGGAGCCACATGTTTCTCCTGATCGAGGACCAGGGTGCCCAGGGCTACGAGCTGTTCTTCAAGACCCGCGAGCTGAAGAAGAAGTGGATGGAGCAATTCGAGATGGCCCTCTCCAATATCTACCCGGAGAATGCCACTGCCAATGGCCATGACTTCCAGATGTTTTCCTTTGAGGAGACCACGTCCTGCAAAGCTTGCCAGATGCTTCTCAGAGGGACCTTCTACCAGGGCTACCGCTGTCACCGGTGCCGGGCGCCTGCGCACAAGGAGTGTCTGGGGAGGGTGACTCCGTGCGGCCGGCACGGGCCAGATTTTGCAGGGACCATGAAGAAGGACAAGCAGCACCGCAGGGCTCAGGAGAAAAAACGCAACGAGTTGGGTCTGCCTAAGATGGAAGTGTTTCAGGAATACTATGGCCTTCCTCCTCCACCTGGAGCCTTCGGACCTTTCCTACGGCTCAACCTTGGGGACATCGTGGAGCTCACAAAAGCTGAGGCTGAACAGAACTGGTGGGAGGGTAGAAACACGTGTACCAATGAAGTTGGCTGGTTTCCCTGTAACCGGGTAAAGCCCTATGTCCACGGACCTCCTCAGGACCTGTCGGTTCACCTGTGGTACGCAGGCCCCATGGAGCGCGCAGGAGCTGAGAGCATCCTCACCAACCGCTCGGACGGGACCTTCTTGGTGCGGCAGAGGGTGAAGGACGCGGCAGAATTCGCCATCAGCATTAAGTTTAACGTCGAGGTCAAGCATATTAAAATCACGACATCAGAAGGACTGTACCGGATCACAGAGAAGAAGGCTTTCCGGGGGCTTTTGGAGCTGGTAGAATTTTACCAGCAGAACTCCCTGAAGGATTGCTTCAAGTCTCTGGACACCACCTTGCAGTTCCCCTACAAGGAGCCCGAGAGAAGAGCCATCAGCAAGCCACCAGCTGGGAGCGCCAAGTACTTTGGCACAGCCAAAGCCCGCTACGACTTCTGTGCCAGGGACCGATCAGAGCTGTCTCTTAAGGAGGGCGACATCATCAAGATCCTCAGCAAAAAGGGGCAACAAGGCTGGTGGCGAGGGGAGATCTATGGCCGGATTGGCTGGTTCCCTTCAAACTACGTGGAAGAAGATTATTCCGAATACTGTTGA

XM_004865653.1 Coding sequence

Emr1 egf-like module containing, mucin-like, hormone receptor-like 1

Length: 2736 bp    Location: 3930483..3981895   Strand: +
>XM_004865653.1
ATGCGGGGCTCCAGCCTGCTGCTTTTCTGGGTGTGTTGTCGTGTATACAGCTGGGAAACTACAACCACATCGGACAAGAATGAGTGCTTAGACACCACCACGTGCCCGGCGTTTGCCACCTGCACCAACACCGTGGGAAGCTACTACTGCACTTGCAAACAAGGCTTTCTGGCCACCAACGGACAGAGTCACTTCAGCAGCCCGAGAGTACGCTGTGAAGATGTCGACGAGTGCTCCCAAGGCCCCTCACCCTGCGGGCCTCACTCCATCTGCACAAACCTGCCAGGGAGGTACCAGTGCAGCTGTCTCCCTGGCTTCTCTTCTCCCACTGGAGATGGCTGGAGGCCGGGACGGCCAGGACGCTTCTCCTGCACAGACATCGACGAGTGCCTCTCCGGAGGGATCTGCCCTGAGCACGCTGACTGCGTCAATGCCCTGGGAAGCTACAGCTGCAGCTGCCATTCTGGGTTCTTCCTTTTGGGCTCTACTTGTGAAGATGTGAACGAATGTGCTGATACCAGAGCTTGCCCGGAGCATGCAACATGCTACAATGCTATTGGAAATTACTTTTGTATGTGCAATGCAGGATATGAATCCAGCAGCGGGCACCCCAATTTCCAGGGCCAAGAAGCATCATGTGAAGATATCGATGAGTGTGTAGAATCGTGCCCCATCAATTCAGCCTGCACCAACACCCTTGGGGGCTTCTTTTGCACCTGCCACCCTGGCTTCACACCTAGCAATGGACAACTGAATTTCACAGGCCAAGAGGTGGAATGCGAAGATACGGATGAATGCTCCCAGGATCTATCACTGTGCGGACCACACTCTGTTTGCACCAATGTTCCGGGCTCCTACAGCTGTGGCTGTTTGCCAGGCTTCCGGCGCAATCCAGAAGGCTCTAAGGCACATGGCAACTTCAGCTGCAGAAGGGTTCCATTCAAATGTAAGGAAGATATGGTTCCCCACAATGAACAGGTCCAACAGTGCCAAGAAGGGTCATCAATGGACCCTAAATATGTCTCCTTCTGTGCCCTCATGAATGCCACCTTCAGGGTCCTGGATGATGCCTGTGAAAACAAAACCGCCGTTGTGTCCCTGAAGAGCAAGGTGGAGAGCTTTGCCTCTGTGCTTGAACAAACATCCACATGGACCAAATTCAGCAAGGAGGAGAAGTCCACCCTGGCCACGGTCCTACTGCAGAGTGTGGAAAGCAGCACGTTAGCTGCTTTACTGAAGTCTTCAGAGAATGCCAGCCAGACTATTCAGACAGAGCACTTAGATATTGAGAGCAAAGTAATCAATGAAGAATGCAATGAGGAGAATGTGTCCTTTCTCTTGAAAGCCAAAGGGGATGAGGTGACTGTTGAGTGTTCCATCATTGAAGAATCTGAAAGCACAGGGACCGTTGGAGTGGCTTTTGTCTCCTTTGCAAACATGGAATCTGTTTTAGATGAACGCTTCTTCAGAGACCCCCAAGCCGGCTGGGGCACCATGGAGAGGAAATTGCGCATGAATTCTCGAGTCGTCGGGGGCATCATGACTGGGGAAAAGAAAGACAACTTCACAGAGCCCATTGTCTACACCCTAGAGAACATTCAGCCCAAGCAGAAGTTGGAGAAGGCCATCTGTGTTTCTTGGAGCACAGACACTGAGGATGGGAGGTGGACACCATCCGGTTGTGTGACCCTGGAAGTTTCGGAGACACATACCAAGTGCAGCTGTCACCATGTGGCGAACTTGGCAGTCATCATGGCTTCTGGGGAGCTCACGATGGAGTTCTCCTTGTACGTCATCAGCCACGTGGGCATGATCGTCTCCCTGGCGTGCCTCGTCTTGGCCATGGCCACCTTCCTACTGTGTCGCGCCATTCGAAACCACAACACCTACCTCCACCTGCACCTGTGTGTGTGTCTCTTCCTGGCTAAGTTTCTCTTCCTCACCGGTATAGACAAGACCAACAGCCAGATGGGCTGTGCCGTCATCGCTGGGCTCCTGCACTACCTCTTCCTCGCCTGCTTCTTCTGGATGCTGGTGGAGGCCGTGATGCTCTTCCTGACGGTCCGGAACCTGAAGGTGGTGAATTACTTCAGCTCTCGCAACATCAAGATGCTGCATCTCTGTGCCTTTGGCTATGGGCTCCCAGGGCTGCTGGTGGTCATCTCTGCCAGTGCGCAGCCTCGGGGCTATGGGATGCATAACCGCTGCTGGCTGAACACGGAGACAGGGTTTATATGGAGCTTCCTGGGGCCGGTTTGCACGATCATAATGATCAACTCCATCCTCCTGAGTTGGACATTGTGGATCCTGAGGCAGAAGCTTTGCAGCGTCAATGCCGAAGTCTCAACACTCAAAGACAGCAGGTTGCTGACCTTCAAGGCCTTTGCCCAGCTCTTCATCCTGGGCTGCACCTGGGTGTTGGGCATCTTTCAGATCGGCCCCATGGCAGGCATCATGGCATACCTGTTCACCATCATCAACAGCCTGCAAGGGGCCTTCATCTTCCTCATCCATTGCCTGCTCAACCGCCAGGTATGAGAAGAATACAGGAGATGGCTCACCAGGAAAACCACACCCGGTTCCCAGTCCCAGACCTCAGGGGTGCTGCTGTCCTCCACACCCTCCTCTTCCAAGATGGCAAAGGACTGTGTGTCTTCCACAGACTGTGCTCCGAAGGAATGCTTGTCATGCGGCAACACTCCACACGGCCAAGTCTCCTGGGAGACATCGACTTAA

XM_004865655.1 Coding sequence

Mllt1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1662 bp    Location: 4055371..4110246   Strand: +
>XM_004865655.1
ATGGACAATCAGTGCACCGTGCAGGTCAAGTTAGAGCTGGGACACCGCGCCCAGCTGCGCAAGAAGCCCACCACGGAGGGCTTCACCCACGACTGGATGGTGTTTGTCCGAGGCCCTGAGCAGTGCGAGATCCAGCACTTTGTGGAGAAGGTGATCTTCCGGCTGCACGACAGCTTCCCCAAGCCCAAGCGTGTGTGCAAGGAGCCCCCCTACAAAGTGGAGGAGTCGGGTTATGCTGGCTTCATCATGCCCATTGAGGTGTACTTCAAAAACAAGGAGGAGCCAAGGAAGGTTTGCTTCACCTACGACCTGTTCCTGAACCTGGAGGGCAACCCGCCCGTGAACCACCTGCGTTGTGAGAAGCTCACCTTCAACAATCCTACCACCGAGTTCCGCTACAAGCTGCTCATGGCTGGCGGGGTCATGGTAATGCCCGAAGGAGCAGAAACGGTGTCCAGGCCCAGTCCCGACTACCCCATGTTACCCACAATTCCACTCTCTGCCTTCTCTGACCCCAAGAAGACCAAACCATCCCACGGCTCCAAGGATGCCAACAAGGAGAGCAGCAAGGCCTCCAAGCAGCACAAGGTGACCAAGGAGCACCGAGAGCGGCCCCGCAAGGACTCGGAGAGCAAGAGCTCCTCCAAGGAGCTGGAGCGTGAGCAGGCCAAGAGCTCCAAGGACGCCACTCGCAAGCTGGGAGAGGGCCGGCTGCCCAAGGAGGAGAAGGCCCCACCACCCAAGGCTGCGTTCAAGGAGCCCAAGATGGCCCTGAAGGAGACCAAGCTGGAAGGCATGTCCCCCAAGGGGGCACCCCAGCCCCCGGCCCTGGCCAAGGCTTCCAGCAAGCGGCCACCCCCTGCGGACTCGCCAAAGCCCAGCGCCAAAAAGCAGAAGAAGAGCAGCTCAAAGGGGTCCCGGAGCGCCCCTGGCACCTCGCCTCGCACCTCATCTTCCTCCTTCCCTGACAAGAAGCTGGCCAAGGACAAAAGCGGCCCCCGAGTGGAGAAGGTGAAGACGGAGAGCGAGCCCAGGGAGGCCCGGAAGGCCCTGGAGGTGGAGGGCTCCAACTCGGAGGATGAGGCCTCCTTCAAGTCCGAGTCAAGCCCATCCAACTCAAGCTCCAGCCCTGACTCCAGCTCTGACTCAGATTTTGAGCCTTCTCAGAACCACAGCCAAGGACCCCTGCGCTCCATGGTGGAGGACCTGCAGTCCGAGGAGTCGGATGAGGACGACTCTTCATCGGGTGAGGAGGCCACTGTCAAGGTGAACCCAGGCCGGGATTCCAGGTTGAGCTTCAGCGACAGCGAGAGTGACAACAGCGCCGACTCCTGCCTGCCTGGCCGTGAGCCCCCACCCCCCCAGAAGCCGCCCCCGCCCAACAGCAAGGCGTCAGGCCGGAGGAGCCCCGAGCCCTGCAGCAAGCCCGAGAAGATTCTCAAGAAGGGTGCCTATGACAAGGCCTACACAGATGAGCTGGTGGAGCTGCACCGGAGGCTGATGGCTCTGCGGGAGCGCAACGTGCTGCAGCAGATCGTGAACCTGATCGAGGAGACTGGCCACTTCAATGTCACCAACACCACCTTTGACTTTGACCTCTTCTCCCTGGACGAGAGCACCGTGCGCAAGTTGCAGAGCTACCTGGAGGCCGTGGCCACATGA

XM_004865674.1 Coding sequence

Dus3l dihydrouridine synthase 3-like (S. cerevisiae), transcript variant X1

Length: 2013 bp    Location: 4431167..4437365   Strand: +
>XM_004865674.1
ATGGCGGAGGGAGCGGTGGAGGCTCCAGCCGAGAGTGGTGGTGACGGGGACTCAGGAGTGAGCGCGTCGGAACGGGGAGTAGCGCCCATTAAGCCTCAATACCTCACCACCAAGGAAGGCTTCCACAGGTTCCTGGAAGCCAAAGGGCAGGAGAAGCTCCCCCAGGAATCTAAGTCAGGAAACCCTGGTGGCAGTGATGTGTCTGAGCCTGAGGCCAAGAGGATCCGATTGGAGAATGGGCAGACAGAGGAGGCAGCAGAGCCTGGGGAACAGCGCCAGGCACAGAAGAGGGCACGGGGCCAGAACAAGGTCCGGCCCCACATGAAGCCCACACACTATGACAAGAACCGGCTGTGCCCTTCCCTAGTCCAGGAGTCACCTGGCCAGTGTTTCTTTGGGGACCGCTGCCGCTTCCTGCATGATGTGGGCCGCTATCTGGAGAGCAAGCCGCCCGACCTAGGCCCCCACTGTGTGCTGTTTGAGACCTTTGGCAGGTGCCCCTATGGGGTGACCTGCCGCTTTGCTGGCGCCCACTTGGGGCCCGAGGGTCAGAACCTGGTGCGTGAGGAGCTGCTGGCTTATGGGGCCCACCCACCGCCCCTGCGCAATGGCCTGGACAAGGCCCTGCAGCAACAGCTGCGCAAGCGCCAGGTCCGCTTTGAACGCGCTGAACAGGCCCTGCAAGGGCTCAGCCAGGGCCCTGCGCCAGCTGCAGCTGTTGCCAAGCTCACAACCCCTGAGGGTGACCCGGGGCAGAACCACTGTGCCACCCAGCAGGACCCCATGGGGCTGGGGGCCAGCACTCCTCCTGGCAGCCCTGTGCAGACCTGCGGGCCCTTGACAGACGAGGACACCGTCAGGCTGCGGCCCTGTGAGAAGAAGCGGCTGGACATCGGTGGCAAACTGTACCTGGCCCCGCTCACGACGTGCGGGAATCTACCCTTCCGGCGGATCTGTAAGCGCTTCGGGGCGGACGTGACATGCGGCGAGATGGCCATGTGCACCAACCTGCTGCAGGGCCAAATGTCGGAGTGGGCCCTGCTCAAACGCCACCCATGCGAGGACATCTTCGGGGTCCAGCTGGCAGGCGCCTTCCCAGACACCATGACCAAGTGCGCGGAGCTGCTGAGCCGTACTGTCGAGGTGGACTTCGTGGACATTAATGTCGGCTGCCCTATCGACCTTGTGTACAAGAAGGGTGGGGGCTGCGCCCTCATGAACCGCCCTGCCAAGTTCCAGCAGATCGTTCGCGGCATGAGTCAGGTATGCAGGACGTCCCCACCTTCCCCAGCCCTGCCTTGGCCCAACCACCCCCAGACCATACTGCCCCTGCCGCAGGTGCTGGACATGCCACTGACTGTGAAGATCCGCACAGGCGTCCAGGAGCGCGTGAACTTGGCACACCGCCTGCTGCCCGAGCTGCGGGACTGGGGCGCTGCCCTCGTAACGCTCCACGGCCGCTCCCGGGAGCAGCGCTACACGAAGCTGGCCGACTGGCAGTACATTCAGCAGTGCGTGGAGGTGGCCAGCCCCATGCCGCTCTTCGGGAATGGGGACATCTTATCCTATGAGGATGCCAACCGTGCCAAGCAGACTGGAGTCGCCGGGATCATGATTGCCCGGGGTGCCCTGCTGAAGCCCTGGCTGTTCACGGAGATCAAGGAGCAGAGGCACTGGGACATCTCATCCTCCGAGCGCCTGGACATCCTGCGGGACTTCACGCACTATGGCCTGGAGCACTGGGGCTCTGATACGCAGGGCGTGGAGAAGACAAGGCGCTTCCTGCTGGAGTGGCTGTCCTTCCTGTGCAGGTATGTGCCTGTGGGTCTGCTGGAGCTACTCCCGCAGCACATTAATGAGCGGCCGCCCTACTACCTGGGCCGCGACTACCTGGAGACCCTCATGGCCAGCCAGCAGGCAGCTGACTGGATCCGCATCAGTGAGATGCTGCTGGGCCCCGTGCCGCCCAACTTCGCCTTCCTGCCCAAGCACAAGGCCAATGCCTACAAGTAG

XM_004865665.1 Coding sequence

Ranbp3 RAN binding protein 3, transcript variant X1

Length: 1773 bp    Location: 4258591..4310236   Strand: +
>XM_004865665.1
ATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCATTGCTCCGCCCGTCTTTGTGTTTCAGAAGGATAAAGGACAAAAGTCATCTGCAGAGCAAAAAGACTTGTCGGATTCGGGAGAGGAGCCTCAGGGGGAGGCTGAGGCCCCCCACCATGGCACGGGTCACCCCGAGTCAGCTGGCCAGCGTGCCCTAGAACCTCCTGCCCCTGATAGCACTTCGGCCAGCACTCCTCCACCTCCCGCTCCTGAAGCCCAGCCTCCTTTTCCTCGAAAACTGTCAGGGAGGTCAGCGGGAGGCTCCAGCCCCGAAGCAGGAGAAGATTCCGACCGAGAAGATGGAAATGTCTGTCCTCCTGTTAAACGAGAAAGAACGTCCTCTTTAACCCAGCTCCCACCTTCACAGTCAGAGGAAAAGAGCAGCGGGTTCCGGTTGAAGCCACCAACACTGATCCATGGCCAGGCACCCAGCGCAGGTCTGCCAAGCCAGAAGCCCAAGGAGCAGCAGCGCAGCGTGCTTCGCCCGGCCGTGCTGCAGGCCCCCCAGCCCAAGGCACTGGCACAGACCGGGGCTGAGGCCTGGCCGGACACTCTCCTTCCTCCCACAGTCCCCAGCAGCGGCACCAACGGCGTCAGTATCCCAACAGACTGCACGGGGGTCGCGACATTATCATCACCAGAAAACCCTGCTCGGCGAAGTCCCTCTGAGGCTGCTGGCGAGCCGCTCACCCTTGAGAAGACAGAGCCTTGGCGAAACGAGTGTAGGGAAGCCTCGGAGGAGAGCTGTGAGAGGAAGGAGGGGGCCGCTCGGCAGGCGTTTGTGTTCGGGCAGAACTTGAGGGACCGGGTGAAGCTAATGAATGAAAACACTGACACCGTTGATATGGAGAATGCAGGACATCCCAGCTCTGAAATGCCAACTGCAACCAACTATTTCCTCCAGTACATCAGCTCCAGTGCAGAGAACTCAACCAACAGTGCCGACACCTCCAGCAACAAGTTCGTGTTTGGCCAGAATATGAGCGAACGCGTGCTGAGTCCCCCCAAATTGAACGAGGTCAGCTCAGATGCCAACCGGGAAAACACAGCCACCGAGTCTGGGTCTGAGTCCTCTTCCCAGGAGGCCACCCCCGAGAAAGAGTCCCTGGCCGAGTCGGCGGCCGCCTATACCAAGGCCACGGCGCGGAAGTGTCTGCTGGAGAAGGTGGAGGTCATCACCGGCGAGGAGGCAGAGAGCAACGTGCTGCAGATCCAGTGTAAGCTGTTTGTTTTTGACAAGACCTCACAGTCATGGGTGGAGCGAGGCCGGGGGCTGCTCAGACTCAACGACATGGCATCGACCGACGATGGGACGTTACAGTCCCGACTAGTGATGCGGACCCAGGGGAGCCTTCGGCTGATCCTCAACACCAAGCTGTGGGCCCAGATGCAGATCGACAAGGCCAGTGAGAAGAGCATCCGTATCACGGCCATGGACACTGAGGACCAGGGTGTGAAGGTCTTCCTGATCTCGGTGAGCCCACGCAGCTCCCAGACCCAGGCCCAGACCAGAAGGGAGGCCACACTCTGTGTGGCACTAGCCAGATGGGGCTCCTCGGTACATGGGGGCTGTGCCGTGAGCCGACTCACGCTCTGGAGGTGGGGTGGGCTCTGGTCCAGGGCACTCAGCTCTTGGGGCAGGAGAGCGGGAGAGGGGAGGACTGTCACCAGAGCGCCTAAGCAGGGCATGGAAGGGAGGCAGGCAGGTGTCCCCACTGCCATATCCCCACAAGACCTCTAG

XM_004865666.1 Coding sequence

Ranbp3 RAN binding protein 3, transcript variant X2

Length: 1734 bp    Location: 4258591..4310236   Strand: +
>XM_004865666.1
ATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCATTGCTCCGCCCGTCTTTGTGTTTCAGAAGGATAAAGGACAAAAGTCATCTGCAGAGCAAAAAGACTTGTCGGATTCGGGAGAGGAGCCTCAGGGGGAGGCTGAGGCCCCCCACCATGGCACGGGTCACCCCGAGTCAGCTGGCCAGCGTGCCCTAGAACCTCCTGCCCCTGATAGCACTTCGGCCAGCACTCCTCCACCTCCCGCTCCTGAAGCCCAGCCTCCTTTTCCTCGAAAACTGTCAGGGAGGTCAGCGGGAGGCTCCAGCCCCGAAGCAGGAGAAGATTCCGACCGAGAAGATGGAAATGTCTGTCCTCCTGTTAAACGAGAAAGAACGTCCTCTTTAACCCAGCTCCCACCTTCACAGTCAGAGGAAAAGAGCAGCGGGTTCCGGTTGAAGCCACCAACACTGATCCATGGCCAGGCACCCAGCGCAGGTCTGCCAAGCCAGAAGCCCAAGGAGCAGCAGCGCAGCGTGCTTCGCCCGGCCGTGCTGCAGGCCCCCCAGCCCAAGGCACTGGCACAGACCGTCCCCAGCAGCGGCACCAACGGCGTCAGTATCCCAACAGACTGCACGGGGGTCGCGACATTATCATCACCAGAAAACCCTGCTCGGCGAAGTCCCTCTGAGGCTGCTGGCGAGCCGCTCACCCTTGAGAAGACAGAGCCTTGGCGAAACGAGTGTAGGGAAGCCTCGGAGGAGAGCTGTGAGAGGAAGGAGGGGGCCGCTCGGCAGGCGTTTGTGTTCGGGCAGAACTTGAGGGACCGGGTGAAGCTAATGAATGAAAACACTGACACCGTTGATATGGAGAATGCAGGACATCCCAGCTCTGAAATGCCAACTGCAACCAACTATTTCCTCCAGTACATCAGCTCCAGTGCAGAGAACTCAACCAACAGTGCCGACACCTCCAGCAACAAGTTCGTGTTTGGCCAGAATATGAGCGAACGCGTGCTGAGTCCCCCCAAATTGAACGAGGTCAGCTCAGATGCCAACCGGGAAAACACAGCCACCGAGTCTGGGTCTGAGTCCTCTTCCCAGGAGGCCACCCCCGAGAAAGAGTCCCTGGCCGAGTCGGCGGCCGCCTATACCAAGGCCACGGCGCGGAAGTGTCTGCTGGAGAAGGTGGAGGTCATCACCGGCGAGGAGGCAGAGAGCAACGTGCTGCAGATCCAGTGTAAGCTGTTTGTTTTTGACAAGACCTCACAGTCATGGGTGGAGCGAGGCCGGGGGCTGCTCAGACTCAACGACATGGCATCGACCGACGATGGGACGTTACAGTCCCGACTAGTGATGCGGACCCAGGGGAGCCTTCGGCTGATCCTCAACACCAAGCTGTGGGCCCAGATGCAGATCGACAAGGCCAGTGAGAAGAGCATCCGTATCACGGCCATGGACACTGAGGACCAGGGTGTGAAGGTCTTCCTGATCTCGGTGAGCCCACGCAGCTCCCAGACCCAGGCCCAGACCAGAAGGGAGGCCACACTCTGTGTGGCACTAGCCAGATGGGGCTCCTCGGTACATGGGGGCTGTGCCGTGAGCCGACTCACGCTCTGGAGGTGGGGTGGGCTCTGGTCCAGGGCACTCAGCTCTTGGGGCAGGAGAGCGGGAGAGGGGAGGACTGTCACCAGAGCGCCTAAGCAGGGCATGGAAGGGAGGCAGGCAGGTGTCCCCACTGCCATATCCCCACAAGACCTCTAG

XM_004865670.1 Coding sequence

Ranbp3 RAN binding protein 3, transcript variant X6

Length: 1572 bp    Location: 4258591..4310236   Strand: +
>XM_004865670.1
ATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCATTGCTCCGCCCGTCTTTGTGTTTCAGAAGGATAAAGGACAAAAGAGGTCAGCGGGAGGCTCCAGCCCCGAAGCAGGAGAAGATTCCGACCGAGAAGATGGAAATGTCTGTCCTCCTGTTAAACGAGAAAGAACGTCCTCTTTAACCCAGCTCCCACCTTCACAGTCAGAGGAAAAGAGCAGCGGGTTCCGGTTGAAGCCACCAACACTGATCCATGGCCAGGCACCCAGCGCAGGTCTGCCAAGCCAGAAGCCCAAGGAGCAGCAGCGCAGCGTGCTTCGCCCGGCCGTGCTGCAGGCCCCCCAGCCCAAGGCACTGGCACAGACCGGGGCTGAGGCCTGGCCGGACACTCTCCTTCCTCCCACAGTCCCCAGCAGCGGCACCAACGGCGTCAGTATCCCAACAGACTGCACGGGGGTCGCGACATTATCATCACCAGAAAACCCTGCTCGGCGAAGTCCCTCTGAGGCTGCTGGCGAGCCGCTCACCCTTGAGAAGACAGAGCCTTGGCGAAACGAGTGTAGGGAAGCCTCGGAGGAGAGCTGTGAGAGGAAGGAGGGGGCCGCTCGGCAGGCGTTTGTGTTCGGGCAGAACTTGAGGGACCGGGTGAAGCTAATGAATGAAAACACTGACACCGTTGATATGGAGAATGCAGGACATCCCAGCTCTGAAATGCCAACTGCAACCAACTATTTCCTCCAGTACATCAGCTCCAGTGCAGAGAACTCAACCAACAGTGCCGACACCTCCAGCAACAAGTTCGTGTTTGGCCAGAATATGAGCGAACGCGTGCTGAGTCCCCCCAAATTGAACGAGGTCAGCTCAGATGCCAACCGGGAAAACACAGCCACCGAGTCTGGGTCTGAGTCCTCTTCCCAGGAGGCCACCCCCGAGAAAGAGTCCCTGGCCGAGTCGGCGGCCGCCTATACCAAGGCCACGGCGCGGAAGTGTCTGCTGGAGAAGGTGGAGGTCATCACCGGCGAGGAGGCAGAGAGCAACGTGCTGCAGATCCAGTGTAAGCTGTTTGTTTTTGACAAGACCTCACAGTCATGGGTGGAGCGAGGCCGGGGGCTGCTCAGACTCAACGACATGGCATCGACCGACGATGGGACGTTACAGTCCCGACTAGTGATGCGGACCCAGGGGAGCCTTCGGCTGATCCTCAACACCAAGCTGTGGGCCCAGATGCAGATCGACAAGGCCAGTGAGAAGAGCATCCGTATCACGGCCATGGACACTGAGGACCAGGGTGTGAAGGTCTTCCTGATCTCGGTGAGCCCACGCAGCTCCCAGACCCAGGCCCAGACCAGAAGGGAGGCCACACTCTGTGTGGCACTAGCCAGATGGGGCTCCTCGGTACATGGGGGCTGTGCCGTGAGCCGACTCACGCTCTGGAGGTGGGGTGGGCTCTGGTCCAGGGCACTCAGCTCTTGGGGCAGGAGAGCGGGAGAGGGGAGGACTGTCACCAGAGCGCCTAAGCAGGGCATGGAAGGGAGGCAGGCAGGTGTCCCCACTGCCATATCCCCACAAGACCTCTAG

XM_004865667.1 Coding sequence

Ranbp3 RAN binding protein 3, transcript variant X3

Length: 1728 bp    Location: 4258592..4311005   Strand: +
>XM_004865667.1
ATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCATTGCTCCGCCCGTCTTTGTGTTTCAGAAGGATAAAGGACAAAAGTCATCTGCAGAGCAAAAAGACTTGTCGGATTCGGGAGAGGAGCCTCAGGGGGAGGCTGAGGCCCCCCACCATGGCACGGGTCACCCCGAGTCAGCTGGCCAGCGTGCCCTAGAACCTCCTGCCCCTGATAGCACTTCGGCCAGCACTCCTCCACCTCCCGCTCCTGAAGCCCAGCCTCCTTTTCCTCGAAAACTGTCAGGGAGGTCAGCGGGAGGCTCCAGCCCCGAAGCAGGAGAAGATTCCGACCGAGAAGATGGAAATGTCTGTCCTCCTGTTAAACGAGAAAGAACGTCCTCTTTAACCCAGCTCCCACCTTCACAGTCAGAGGAAAAGAGCAGCGGGTTCCGGTTGAAGCCACCAACACTGATCCATGGCCAGGCACCCAGCGCAGGTCTGCCAAGCCAGAAGCCCAAGGAGCAGCAGCGCAGCGTGCTTCGCCCGGCCGTGCTGCAGGCCCCCCAGCCCAAGGCACTGGCACAGACCGGGGCTGAGGCCTGGCCGGACACTCTCCTTCCTCCCACAGTCCCCAGCAGCGGCACCAACGGCGTCAGTATCCCAACAGACTGCACGGGGGTCGCGACATTATCATCACCAGAAAACCCTGCTCGGCGAAGTCCCTCTGAGGCTGCTGGCGAGCCGCTCACCCTTGAGAAGACAGAGCCTTGGCGAAACGAGTGTAGGGAAGCCTCGGAGGAGAGCTGTGAGAGGAAGGAGGGGGCCGCTCGGCAGGCGTTTGTGTTCGGGCAGAACTTGAGGGACCGGGTGAAGCTAATGAATGAAAACACTGACACCGTTGATATGGAGAATGCAGGACATCCCAGCTCTGAAATGCCAACTGCAACCAACTATTTCCTCCAGTACATCAGCTCCAGTGCAGAGAACTCAACCAACAGTGCCGACACCTCCAGCAACAAGTTCGTGTTTGGCCAGAATATGAGCGAACGCGTGCTGAGTCCCCCCAAATTGAACGAGGTCAGCTCAGATGCCAACCGGGAAAACACAGCCACCGAGTCTGGGTCTGAGTCCTCTTCCCAGGAGGCCACCCCCGAGAAAGAGTCCCTGGCCGAGTCGGCGGCCGCCTATACCAAGGCCACGGCGCGGAAGTGTCTGCTGGAGAAGGTGGAGGTCATCACCGGCGAGGAGGCAGAGAGCAACGTGCTGCAGATCCAGTGTAAGCTGTTTGTTTTTGACAAGACCTCACAGTCATGGGTGGAGCGAGGCCGGGGGCTGCTCAGACTCAACGACATGGCATCGACCGACGATGGGACGTTACAGTCCCGACTAGTGATGCGGACCCAGGGGAGCCTTCGGCTGATCCTCAACACCAAGCTGTGGGCCCAGATGCAGATCGACAAGGCCAGTGAGAAGAGCATCCGTATCACGGCCATGGACACTGAGGACCAGGGTGTGAAGGTCTTCCTGATCTCGGCCAGCTCCAAGGACACGGGCCAGCTGTATGCAGCCCTGCACCACCGAATCCTGGCCCTGCGCAGCCGCGTGGAGCAGGAGCAAGAGGCCCAGGCCCCCGCCCCTGAGCCCAGAGCCCCATCCAATGAAGACGACAGCGACGACGACCTGCTGGCCCCCTCGGGAGCCCCTGGAGCAGGTGCCAGTGAGGAGGGGGACGGGCAGGTGCCTGGGAGCACATAG

XM_004865668.1 Coding sequence

Ranbp3 RAN binding protein 3, transcript variant X4

Length: 1689 bp    Location: 4258592..4311005   Strand: +
>XM_004865668.1
ATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCATTGCTCCGCCCGTCTTTGTGTTTCAGAAGGATAAAGGACAAAAGTCATCTGCAGAGCAAAAAGACTTGTCGGATTCGGGAGAGGAGCCTCAGGGGGAGGCTGAGGCCCCCCACCATGGCACGGGTCACCCCGAGTCAGCTGGCCAGCGTGCCCTAGAACCTCCTGCCCCTGATAGCACTTCGGCCAGCACTCCTCCACCTCCCGCTCCTGAAGCCCAGCCTCCTTTTCCTCGAAAACTGTCAGGGAGGTCAGCGGGAGGCTCCAGCCCCGAAGCAGGAGAAGATTCCGACCGAGAAGATGGAAATGTCTGTCCTCCTGTTAAACGAGAAAGAACGTCCTCTTTAACCCAGCTCCCACCTTCACAGTCAGAGGAAAAGAGCAGCGGGTTCCGGTTGAAGCCACCAACACTGATCCATGGCCAGGCACCCAGCGCAGGTCTGCCAAGCCAGAAGCCCAAGGAGCAGCAGCGCAGCGTGCTTCGCCCGGCCGTGCTGCAGGCCCCCCAGCCCAAGGCACTGGCACAGACCGTCCCCAGCAGCGGCACCAACGGCGTCAGTATCCCAACAGACTGCACGGGGGTCGCGACATTATCATCACCAGAAAACCCTGCTCGGCGAAGTCCCTCTGAGGCTGCTGGCGAGCCGCTCACCCTTGAGAAGACAGAGCCTTGGCGAAACGAGTGTAGGGAAGCCTCGGAGGAGAGCTGTGAGAGGAAGGAGGGGGCCGCTCGGCAGGCGTTTGTGTTCGGGCAGAACTTGAGGGACCGGGTGAAGCTAATGAATGAAAACACTGACACCGTTGATATGGAGAATGCAGGACATCCCAGCTCTGAAATGCCAACTGCAACCAACTATTTCCTCCAGTACATCAGCTCCAGTGCAGAGAACTCAACCAACAGTGCCGACACCTCCAGCAACAAGTTCGTGTTTGGCCAGAATATGAGCGAACGCGTGCTGAGTCCCCCCAAATTGAACGAGGTCAGCTCAGATGCCAACCGGGAAAACACAGCCACCGAGTCTGGGTCTGAGTCCTCTTCCCAGGAGGCCACCCCCGAGAAAGAGTCCCTGGCCGAGTCGGCGGCCGCCTATACCAAGGCCACGGCGCGGAAGTGTCTGCTGGAGAAGGTGGAGGTCATCACCGGCGAGGAGGCAGAGAGCAACGTGCTGCAGATCCAGTGTAAGCTGTTTGTTTTTGACAAGACCTCACAGTCATGGGTGGAGCGAGGCCGGGGGCTGCTCAGACTCAACGACATGGCATCGACCGACGATGGGACGTTACAGTCCCGACTAGTGATGCGGACCCAGGGGAGCCTTCGGCTGATCCTCAACACCAAGCTGTGGGCCCAGATGCAGATCGACAAGGCCAGTGAGAAGAGCATCCGTATCACGGCCATGGACACTGAGGACCAGGGTGTGAAGGTCTTCCTGATCTCGGCCAGCTCCAAGGACACGGGCCAGCTGTATGCAGCCCTGCACCACCGAATCCTGGCCCTGCGCAGCCGCGTGGAGCAGGAGCAAGAGGCCCAGGCCCCCGCCCCTGAGCCCAGAGCCCCATCCAATGAAGACGACAGCGACGACGACCTGCTGGCCCCCTCGGGAGCCCCTGGAGCAGGTGCCAGTGAGGAGGGGGACGGGCAGGTGCCTGGGAGCACATAG

XM_004865669.1 Coding sequence

Ranbp3 RAN binding protein 3, transcript variant X5

High confidence: 4 potential gene matches
Length: 1686 bp    Location: 4258592..4311005   Strand: +
>XM_004865669.1
ATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCATTGCTCCGCCCGTCTTTGTGTTTCAGAAGGATAAAGGACAAAAGTCATCTGCAGAGCAAAAAGACTTGTCGGATTCGGGAGAGGAGCCTCAGGGGGAGGCTGAGGCCCCCCACCATGGCACGGGTCACCCCGAGTCAGCTGGCCAGCGTGCCCTAGAACCTCCTGCCCCTGATAGCACTTCGGCCAGCACTCCTCCACCTCCCGCTCCTGAAGCCCAGCCTCCTTTTCCTCGAAAACTGTCAGGGAGGTCAGCGGGAGGCTCCAGCCCCGAAGCAGGAGAAGATTCCGACCGAGAAGATGGAAATGTCTGTCCTCCTGTTAAACGAGAAAGAACGTCCTCTTTAACCCAGCTCCCACCTTCACAGTCAGAGGAAAAGAGCAGCGGGTTCCGGTTGAAGCCACCAACACTGATCCATGGCCAGGCACCCAGCGCAGGTCTGCCAAGCCAGAAGCCCAAGGAGCAGCAGCGCAGCGTGCTTCGCCCGGCCGTGCTGCAGGCCCCCCAGCCCAAGGCACTGGCACAGACCGTCCCCAGCAGCGGCACCAACGGCGTCAGTATCCCAACAGACTGCACGGGGGTCGCGACATTATCATCACCAGAAAACCCTGCTCGGCGAAGTCCCTCTGAGGCTGCTGGCGAGCCGCTCACCCTTGAGACAGAGCCTTGGCGAAACGAGTGTAGGGAAGCCTCGGAGGAGAGCTGTGAGAGGAAGGAGGGGGCCGCTCGGCAGGCGTTTGTGTTCGGGCAGAACTTGAGGGACCGGGTGAAGCTAATGAATGAAAACACTGACACCGTTGATATGGAGAATGCAGGACATCCCAGCTCTGAAATGCCAACTGCAACCAACTATTTCCTCCAGTACATCAGCTCCAGTGCAGAGAACTCAACCAACAGTGCCGACACCTCCAGCAACAAGTTCGTGTTTGGCCAGAATATGAGCGAACGCGTGCTGAGTCCCCCCAAATTGAACGAGGTCAGCTCAGATGCCAACCGGGAAAACACAGCCACCGAGTCTGGGTCTGAGTCCTCTTCCCAGGAGGCCACCCCCGAGAAAGAGTCCCTGGCCGAGTCGGCGGCCGCCTATACCAAGGCCACGGCGCGGAAGTGTCTGCTGGAGAAGGTGGAGGTCATCACCGGCGAGGAGGCAGAGAGCAACGTGCTGCAGATCCAGTGTAAGCTGTTTGTTTTTGACAAGACCTCACAGTCATGGGTGGAGCGAGGCCGGGGGCTGCTCAGACTCAACGACATGGCATCGACCGACGATGGGACGTTACAGTCCCGACTAGTGATGCGGACCCAGGGGAGCCTTCGGCTGATCCTCAACACCAAGCTGTGGGCCCAGATGCAGATCGACAAGGCCAGTGAGAAGAGCATCCGTATCACGGCCATGGACACTGAGGACCAGGGTGTGAAGGTCTTCCTGATCTCGGCCAGCTCCAAGGACACGGGCCAGCTGTATGCAGCCCTGCACCACCGAATCCTGGCCCTGCGCAGCCGCGTGGAGCAGGAGCAAGAGGCCCAGGCCCCCGCCCCTGAGCCCAGAGCCCCATCCAATGAAGACGACAGCGACGACGACCTGCTGGCCCCCTCGGGAGCCCCTGGAGCAGGTGCCAGTGAGGAGGGGGACGGGCAGGTGCCTGGGAGCACATAG

XM_004865675.1 Coding sequence

Dus3l dihydrouridine synthase 3-like (S. cerevisiae), transcript variant X2

High confidence: 4 potential gene matches
Length: 1938 bp    Location: 4431167..4437365   Strand: +
>XM_004865675.1
ATGGCGGAGGGAGCGGTGGAGGCTCCAGCCGAGAGTGGTGGTGACGGGGACTCAGGAGTGAGCGCGTCGGAACGGGGAGTAGCGCCCATTAAGCCTCAATACCTCACCACCAAGGAAGGCTTCCACAGGTTCCTGGAAGCCAAAGGGCAGGAGAAGCTCCCCCAGGAATCTAAGTCAGGAAACCCTGGTGGCAGTGATGTGTCTGAGCCTGAGGCCAAGAGGATCCGATTGGAGAATGGGCAGACAGAGGAGGCAGCAGAGCCTGGGGAACAGCGCCAGGCACAGAAGAGGGCACGGGGCCAGAACAAGGTCCGGCCCCACATGAAGCCCACACACTATGACAAGAACCGGCTGTGCCCTTCCCTAGTCCAGGAGTCACCTGGCCAGTGTTTCTTTGGGGACCGCTGCCGCTTCCTGCATGATGTGGGCCGCTATCTGGAGAGCAAGCCGCCCGACCTAGGCCCCCACTGTGTGCTGTTTGAGACCTTTGGCAGGTGCCCCTATGGGGTGACCTGCCGCTTTGCTGGCGCCCACTTGGGGCCCGAGGGTCAGAACCTGGTGCGTGAGGAGCTGCTGGCTTATGGGGCCCACCCACCGCCCCTGCGCAATGGCCTGGACAAGGCCCTGCAGCAACAGCTGCGCAAGCGCCAGGTCCGCTTTGAACGCGCTGAACAGGCCCTGCAAGGGCTCAGCCAGGGCCCTGCGCCAGCTGCAGCTGTTGCCAAGCTCACAACCCCTGAGGGTGACCCGGGGCAGAACCACTGTGCCACCCAGCAGGACCCCATGGGGCTGGGGGCCAGCACTCCTCCTGGCAGCCCTGTGCAGACCTGCGGGCCCTTGACAGACGAGGACACCGTCAGGCTGCGGCCCTGTGAGAAGAAGCGGCTGGACATCGGTGGCAAACTGTACCTGGCCCCGCTCACGACGTGCGGGAATCTACCCTTCCGGCGGATCTGTAAGCGCTTCGGGGCGGACGTGACATGCGGCGAGATGGCCATGTGCACCAACCTGCTGCAGGGCCAAATGTCGGAGTGGGCCCTGCTCAAACGCCACCCATGCGAGGACATCTTCGGGGTCCAGCTGGCAGGCGCCTTCCCAGACACCATGACCAAGTGCGCGGAGCTGCTGAGCCGTACTGTCGAGGTGGACTTCGTGGACATTAATGTCGGCTGCCCTATCGACCTTGTGTACAAGAAGGGTGGGGGCTGCGCCCTCATGAACCGCCCTGCCAAGTTCCAGCAGATCGTTCGCGGCATGAGTCAGGTGCTGGACATGCCACTGACTGTGAAGATCCGCACAGGCGTCCAGGAGCGCGTGAACTTGGCACACCGCCTGCTGCCCGAGCTGCGGGACTGGGGCGCTGCCCTCGTAACGCTCCACGGCCGCTCCCGGGAGCAGCGCTACACGAAGCTGGCCGACTGGCAGTACATTCAGCAGTGCGTGGAGGTGGCCAGCCCCATGCCGCTCTTCGGGAATGGGGACATCTTATCCTATGAGGATGCCAACCGTGCCAAGCAGACTGGAGTCGCCGGGATCATGATTGCCCGGGGTGCCCTGCTGAAGCCCTGGCTGTTCACGGAGATCAAGGAGCAGAGGCACTGGGACATCTCATCCTCCGAGCGCCTGGACATCCTGCGGGACTTCACGCACTATGGCCTGGAGCACTGGGGCTCTGATACGCAGGGCGTGGAGAAGACAAGGCGCTTCCTGCTGGAGTGGCTGTCCTTCCTGTGCAGGTATGTGCCTGTGGGTCTGCTGGAGCTACTCCCGCAGCACATTAATGAGCGGCCGCCCTACTACCTGGGCCGCGACTACCTGGAGACCCTCATGGCCAGCCAGCAGGCAGCTGACTGGATCCGCATCAGTGAGATGCTGCTGGGCCCCGTGCCGCCCAACTTCGCCTTCCTGCCCAAGCACAAGGCCAATGCCTACAAGTAG

XM_004865671.1 Coding sequence

Ranbp3 RAN binding protein 3, transcript variant X7

Length: 1488 bp    Location: 4258592..4311005   Strand: +
>XM_004865671.1
ATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCATTGCTCCGCCCGTCTTTGTGTTTCAGAAGGATAAAGGACAAAAGAGGTCAGCGGGAGGCTCCAGCCCCGAAGCAGGAGAAGATTCCGACCGAGAAGATGGAAATGTCTGTCCTCCTGTTAAACGAGAAAGAACGTCCTCTTTAACCCAGCTCCCACCTTCACAGTCAGAGGAAAAGAGCAGCGGGTTCCGGTTGAAGCCACCAACACTGATCCATGGCCAGGCACCCAGCGCAGGTCTGCCAAGCCAGAAGCCCAAGGAGCAGCAGCGCAGCGTGCTTCGCCCGGCCGTGCTGCAGGCCCCCCAGCCCAAGGCACTGGCACAGACCGTCCCCAGCAGCGGCACCAACGGCGTCAGTATCCCAACAGACTGCACGGGGGTCGCGACATTATCATCACCAGAAAACCCTGCTCGGCGAAGTCCCTCTGAGGCTGCTGGCGAGCCGCTCACCCTTGAGAAGACAGAGCCTTGGCGAAACGAGTGTAGGGAAGCCTCGGAGGAGAGCTGTGAGAGGAAGGAGGGGGCCGCTCGGCAGGCGTTTGTGTTCGGGCAGAACTTGAGGGACCGGGTGAAGCTAATGAATGAAAACACTGACACCGTTGATATGGAGAATGCAGGACATCCCAGCTCTGAAATGCCAACTGCAACCAACTATTTCCTCCAGTACATCAGCTCCAGTGCAGAGAACTCAACCAACAGTGCCGACACCTCCAGCAACAAGTTCGTGTTTGGCCAGAATATGAGCGAACGCGTGCTGAGTCCCCCCAAATTGAACGAGGTCAGCTCAGATGCCAACCGGGAAAACACAGCCACCGAGTCTGGGTCTGAGTCCTCTTCCCAGGAGGCCACCCCCGAGAAAGAGTCCCTGGCCGAGTCGGCGGCCGCCTATACCAAGGCCACGGCGCGGAAGTGTCTGCTGGAGAAGGTGGAGGTCATCACCGGCGAGGAGGCAGAGAGCAACGTGCTGCAGATCCAGTGTAAGCTGTTTGTTTTTGACAAGACCTCACAGTCATGGGTGGAGCGAGGCCGGGGGCTGCTCAGACTCAACGACATGGCATCGACCGACGATGGGACGTTACAGTCCCGACTAGTGATGCGGACCCAGGGGAGCCTTCGGCTGATCCTCAACACCAAGCTGTGGGCCCAGATGCAGATCGACAAGGCCAGTGAGAAGAGCATCCGTATCACGGCCATGGACACTGAGGACCAGGGTGTGAAGGTCTTCCTGATCTCGGCCAGCTCCAAGGACACGGGCCAGCTGTATGCAGCCCTGCACCACCGAATCCTGGCCCTGCGCAGCCGCGTGGAGCAGGAGCAAGAGGCCCAGGCCCCCGCCCCTGAGCCCAGAGCCCCATCCAATGAAGACGACAGCGACGACGACCTGCTGGCCCCCTCGGGAGCCCCTGGAGCAGGTGCCAGTGAGGAGGGGGACGGGCAGGTGCCTGGGAGCACATAG

XM_004865664.1 Coding sequence

Caps calcyphosine, transcript variant X2

Length: 609 bp    Location: 4313305..4311803   Strand: -
>XM_004865664.1
ATGTGGGACCAGGGAGCAGACGCAGGCCAGCTGGACAGCATGGACGCCGTGGACGCCACCATGGAGAAGCTGCGGGCGCAGTGTCTGGCGCGGGGGCCCTCAGGCATCCAGAGCCTGGCCAGGTTCTTCCGCCGCCTGGACCGGGATGGGAGCCGGTCCCTGGACGCAGTGGAGCTGCAGCGGGGCCTGGCTGAGCTGGGGCTGGTTCTGGAGCTGGCAGAGGCGGAGGCCATGTGCAGGCGCTGGGACCTTGATGGCAGTGGGACGCTGGACCTGCAGGAGTTTCTGCGGGCACTGCGGCCCCCCATGTCCCAGGCCCGGGAGGCCATCATTGCGGCCGCCTTTGCCAAGCTGGACCGCAGCGGGGACAGCGTGGTGACTGTGGACGACCTCCGTGGGGTGTACAGCGGCCGCAGCCACCCCAAGGTGTGCAGTGGGGAGTGGACAGAGGAGGAGGTGCTGCAGCGCTTCCTCGACAACTTTGACGCCCGTGACAAAGATGGGCAGGTCACCCTGGAGGAGTTCCAGGACTACTACAGCGGGCTCAGTGCCTCCGTGGACACAGACGAGGAGTTCGTGGCCATGGTGACCAGCGCCTGGCAGCTCTGA

XM_004865660.1 Coding sequence

Ndufa11 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa, transcript variant X2

Length: 426 bp    Location: 4319665..4328267   Strand: +
>XM_004865660.1
ATGGCGAAGAGGCTGCTCCATCAGTACACAGACATCCCAGACGGCACCGACTGCCACCGCAAGGCCTACGCTAGCACCGCTATCAGTACCACCGTCGGCCTGATCTGGTCTGGCTACAGCCTCACACACAGGGCCCCAGGCTCCATCCTCGAAGGCGTGGCCAGGGCCGGAAGGTACACATTTACCGCAGCCGCCATTGGGGCCATATTCGGCCTGACCTCCTGTATCAGTGCCCAGATCCGAGAAAAGCCCGACGACCCCCTGAACTACTTCCTCGGAGGCTGTGCCGGAGGCCTGACCCTGGGAGCACGCATGCACAACTATGGGATCGCCGCGGGCGGCTGCTTGTACATGGGCGTGATGGCCAGCCTCGTCAAGATGGGCCAGCTGGAGGGATGGGATCTGTTTCCAAGCACCAAGGTGTAG

XM_004865672.1 Coding sequence

LOC101708404 alpha-(1,3)-fucosyltransferase-like

Length: 1113 bp    Location: 4343761..4345173   Strand: +
>XM_004865672.1
ATGGAGCGGCTCCAGTGTCCCGGGCGGCACTGTCTCTCCGGGCTGCTCTTACAGCTGCTCCTGGCTGTCTGCTTCTTCTCTTACCTGCGAGTGTCACAGGACCATCCCACAGGGTCCCCTAGACCAGGGCCCAGTGCCACGGATCCTGTCCCCACAGCTCCCTGTGGGTCTGCAGGGCTGGCGTCCCCCACACAGCCCACCGGGCCCCGGGCCCTGCTCATCCTGCTGTGGACGTGGCCATTCAACAGCCCGGTGTCTCTGTCCCGCTGCTCGGACATACGGCCGGGCACAGCCCACTGCCACATAACCGCCAACCGCAGCGTGTACCCCGGGGCAGACGCGGTCATCGTACACCACCGGGAGGTCAGCTACGGGCCCAAGACAAAGCTCCCACCCTCACCTCGGCCACCAGGCCAGCGCTGGGTGTGGTTCAGCATGGAGTCGCCCAGCCACTGCAGCCAGCTGCGGGCCCTGGATGGCTACTTCAACCTCACCATGTCCTACCGCAGCGACTCAGACATCTTCACGCCCTACGGCTGGCTGGAGCCCCGGGAAGGCCACCCCACTGCCCTGCCAGTCAACCTCTCGGCCAAGACCCGGCTGGTGGCCTGGGCTGTGTCCAACTGGAAAGAGAACTCAGCCAGGGTGCGGTACTACAACCAGCTGCGGGCGCACCTCCGGGTGGACGTGTACGGCTCGCGCCACCTGCCGCTGCCCCACAAGGCCATGCAGGAGCACCTGGCCCGGTACAAGTTCTACCTGGCCTTTGAGAACTCGCAGCACCCCGACTACATCACGGAGAAGCTCTGGAAGAACGCACTGCAGGCGCCCGCTGTGCCCGTGGTCCTGGGCCCCAGCCGGAGCAACTATGAGCGCTTCCTGCCGCCCGACGCCTTCATCCACGTCGACGACTTCCCGAGCCCCCAGGCCCTGGCGCAGCACCTGCTGGCACTGGACAAGGACGATGCCCGCTACCTGAGCTACTTCCGCTGGCGGGAGACGCTACGGGTGGGCACCAGTAGCTGGGCCCTGGCTTTCTGCAAGGCCTGCTGGCGGCTGCAGGAGGGGCCCAGGTACCAGACGGTGGGCAGCATTGCTGCCTGGTTCACATGA

XM_004866067.1 Coding sequence

Fut5 fucosyltransferase 5 (alpha (1,3) fucosyltransferase)

Length: 1113 bp    Location: 4396323..4397435   Strand: +
>XM_004866067.1
ATGGAGCGGCTCCAGTGTCCCAGGCGGCACTGTCTCTCCGGGCTGCTCTTACAGCTGCTCCTGGCTGTCTGCTTCTTCTCTTACCTGCGAGTGTCACAGGACCATCCCACAGGGTCCCCTAGACCAGGGCCCAGTGCCACGGATCCTGTCCCCACAGCTCCCTGTGGGTCTGCAGGGCTGGCGTCCCCCACACAGCCCACCGGGCCCCGGGCCCTGCTCATCCTGCTGTGGACGTGGCCATTCAACAGCCCGGTGTCTCTGTCCCGCTGCTCGGACATACGGCCGGGCACAGCCCACTGCCACATAACCGCCAACCGCAGCGTGTACCCCGGGGCAGACGCGGTCATCGTACACCACCGGGAGGTCAGCTACGGGCCCAAGACAAAGCTCCCACCCTCACCTCGGCCACCAGGCCAGCGCTGGGTGTGGTTCAGCATGGAGTCGCCCAGCCACTGCAGCCAGCTGCGGGCCCTGGATGGCTACTTCAACCTCACCATGTCCTACCGCAGCGACTCGGACATCTTCACGCCCTACGGCTGGCTGGAGCCCCGGGAAGGCCACCCCACTGCCCTGCCAGTCAACCTCTCGGCCAAGACCCGGCTGGTGGCCTGGGCTGTGTCCAACTGGAAAGAGAACTCAGCCAGGGTGCGGTACTACAACCAGCTGCGGGCGCACCTCCGGGTGGACGTGTACGGCTCGCATCACCTGCCGCTGCCCCACAAGGCCATGCAGGAGCACCTGGCCCGGTACAAGTTCTACCTGGCCTTTGAGAACTCGCAGCACCCCGACTACATCACGGAGAAGCTCTGGAAGAACGCACTGCAGGCGCCCGCTGTGCCCGTGGTCCTGGGCCCCAGCCGGAGCAACTATGAGCGCTTCCTGCCGCCCGACGCCTTCATCCACGTCGACGACTTCCCGAGCCCCCAGGCCCTGGCGCAGCACCTGCTGGCACTGGACAAGGACGATGCCCGCTACCTGAGCTACTTCCGCTGGCGGGAGACGCTACGGGTGGGCACCAGTAGCTGGGCCCTGGCTTTCTGCAAGGCCTGCTGGCGGCTGCAGGAGGGGCCCAGGTACCAGACGGTGGGCAGCATTGCTGCCTGGTTCACATGA

XM_004865673.1 Coding sequence

Nrtn neurturin

High confidence: 4 potential gene matches
Length: 594 bp    Location: 4412972..4400399   Strand: -
>XM_004865673.1
ATGCAGCGCTGGAAGGCGGCAGCCCTGGCTTCCGTGCTCTGTAGCTCCGTGCTGTCCATCTGGATCTGCCGCGAGGGTCTGCTGCTCAGCCACCGCCTGGGACCCGCGCTGGCCCCGCTGCGCCGCCCCCCTCGCACCCTGGACGCCCGCATCGCCCGCCTGGCCCAGTACCGAGCGCTGTTGCAGGGTGCACCGGACGCCGTGGAGCTGCGCGAGCTGACGCCCTGGGCCGACCGCGCCCCAGATCCGCGCCGTCGAGCGGGGTCCAGGCTGCGGCGCGCGCGTGCGCGGTCGGGGTCACGGCCTTGCGGCCTGCGAGAGCTGGAGGTGCGCGTGAGCGAGCTGGGCCTGGGCTACGCCTCAGATGAGACGGTACTGTTCCGCTACTGCGCAGGCGCCTGCCAGGCGTCCTCGCGCGTCTACGACTTGGGGCTACGGCGCCTGCGCCAGCAGCGGCGCTTGCGGCGGGATTTGGTGCGTGCGCAGCCCTGCTGCCGCCCGACGGCCTATGAAGACGAGGTGTCTTTCATGGATGTGCACAGCCGGTACCACACAGTGCAAGAGCTATCGGCGCGCGAGTGCGCCTGCGTGTGA

XM_004866068.1 Coding sequence

Prr22 proline rich 22

High confidence: 4 potential gene matches
Length: 1332 bp    Location: 4437410..4439736   Strand: +
>XM_004866068.1
ATGGCAGCCTCCCCTCCCACCTCCACTCCTGGTGCCAGGCCGGGCCCCTGCCCACCCATGCAGCACCCCGAACCCTTCTCCACACCCGTAGCTTCTCAGGAAGGCTTCAGTGTCCAGGGCCTGGAGAGCATGGAGGGCCCAGGCGGCCGTCCTGTGTTCACAGGCACCGACCCTCTGCCCGCCATGGCCTCTGCGAACCCGCTGTATCAACCCCCAAACCCAGAGAAAGACGTGTTTCCGGGTCCACCAGCAGGCTTCCAGATGGCCCCCTGTGGGTGTTTCTTCGACCCCCGCGTCTTCCGCATTGAGTGGGCTGCCACCTGCTTCGGCCAGGACTTGTACAAGCTGGCGGTGGCCAGGGGCCCCACCTCGCCAGACAGCTACCTCCTGGAGCCCCAGTACTATGCCAAGGCCCCAGTACCGCCCCTGTACCCCCACTACCAGCCTGGGGGGCCCACATATCTTGTGCCCTGCTTCCCGCCCGAGGGGCCCAGCCATGAGTCCCTGGGCTTCATGAGGGATGGGGGACCCCCTGGCTTTGTGGAGTTGCCTCCACTGCTGCTCAAGGAAGGCCGGGCCCCTCTGCCACCCCCCAAAGACAGCAAGCTGTCCCCACTGCTCCTCATGCTACCTGCCGAGGCCTCGCTGCCTGCTGAGGCCCCGCTGCCTCCTGATGCCTATGGCCACTTCCAAGGCCACCGAGGCTGGGTCCCTGGGCCTGAGGTAGCCAGGTCGCCCGCTGAGCCCTTGGCCTTTCCCACCAAGGAACTGCAGGGTGGCAATGGAGCTGAGCTGGGCCTGTCCCACCCCCCGGGCCCCAGTGAGCCCAAAGCCCAGGAGGCCACCCAACTGGGGACAGGCAAGGCCCAGGTGCACGAGGTGGCCCGGACCTTGGCACTGCCAGACAAGGTGCTTCTGGAAGACGCCATGAAGCTCTTCAATTGTCTGCCCAGCCGTGCCAAACCCGAAGCCACAGAGTGCAGGGTCCCCGGGCCAGCCCTCCCCGACAGTGGCAGCGGCCGGGACAACTCGCCCAGTGACATCCGCTCACTGCACCTCCCCGAGGAGCTGCTGTCGTTTGACTACAGTGTCCCTGAGATCCTGGACATGGTGTCCAACGTGGACTATCTGTTCAACAACTTCAAGGTGCTGGATGAGGGGCCACCGCCCTGCCCCAGGACCCCCGGAGCTGACCCCGCTGTCCCTGTCCCTCAGGCCAGCATACGGAGAAAGAAGCAGGGCACCACCTCCACCAGGAAGGGCAAGGCGGGGGCCAAGGGCAAGCAGGCTGCTGCAGGGGCCCGGCAGGACCTGGGCGCTGCCCCCCATTAA

XM_004866069.1 Coding sequence

Catsperd catsper channel auxiliary subunit delta

High confidence: 3 potential gene matches
Length: 2418 bp    Location: 4494225..4440758   Strand: -
>XM_004866069.1
ATGCCCAGATTGTGCGGCAACTGCGGGTGCCGGTTGAGTGCCCTTGTTGGCTCCGGAGAACCCAACACAGATGCTGATGTCTATATTGATAGCGGTGGCGGCGACCCTGCGGCTCTGGCCGCTGATACCAGTAAATGTGTTCGCAAAGTGAGAACAGGAAAAGTGTTTAATGGTGGACAGCAAGTTCATGGGGGTGTCCTGTATTTTCCATCTACAACGACATGCCTGATTAAACATCCATGTGAGAAAACCACAGCACTATATTTAGGACGGCAGGTTTTTTTCACAAGAGATAACTTTGAGTATAGTCTCCTTCCACTCACCATCCCGACATCAATAATGGTTGGCCGGCCAGAAGTGACCTCCGCACATTTTGCTGGCTCACACCTGCTGTTAGTAGTGAATCAGAGAGTCTACATGTACAATTACAAAGCTGGCCTCTGGAACACATCCGAGGGTATACAACACCCTGTTTCACATGTTTCTGGTGATAATTGTTGTTTTGTTGGAAATACCTTTTGCCTGGAGATAAGTAACTCAGTTTTTGCATATTTGCATGGAGAGCAGATATCTCAAGCCAATATCTATTTCTCAAATAATGGAGGATTCAGTTTTCAAAAGTTTACCTATGAAAGACAGGCTGAATTGGTTGGGTCTTTAGGGGGAATCTTCTTCCTTCACGCCTTGTCACAGGTTGGGCTGCTTGTCATTAATAACAGGAAGGGTATGTTCGCCTACTCTGACCACCCCCTCAACCGGAGTCTGGGGCTGGCCTTCGACTACAATGAGACACTCGAGGTCCTCATACCACCAGGCCAGAGAGGCTTACTGATCCTCTGGAGCCAAAACAACCTCTTCTTGTCCCTCAATGCAGGTCAGATCGTGGAAACCATCCAGGTTCAAAAAGGAGGCCAGACTTTGCACCCTTCTATCTTTGGCGCCAATATCACCATCCACACCATTGCTGCCTATGAGAATGGCCTGGCGGTGTTGACCCGAGAGGATCATTTGTATTACGGAAGTCTGGGAGTCCTGTCTGGTTCTAGTTCCATAATCAAATTTCCAGACCAACAAGTGTGGTCCCAGGGGGCAGCCCTGATGTTCCTGAACCCAGGGAAGCTTCAGATCCTGACCCCACTTCCTGATGCTGCATCCCCTGTGTACGACTTCCAGAAGTGTGTGGTGAACATTCAGGCAACTCTCATGGATCCTGACCTCCATGTTGAAAAGTGCAAAATAGAACTGATGTATGGAAACTTCGAAGGGAAAATGTACACCATGGATATGAACAGCCAGCTGGAAGTGACAGCTGTCCTGATCCCCCGGCCAGACGCATCCCTAATTCCCCAGGTGATGGTGAGCAACCCCTACTCCCTGGGGCTGAAGACCAGCATCTATGAGTCTGACAACACCTACGAAGGGAATGTCCTGTACAAACTGTACATCAGACTCAAGCAGCAGCACCACTGGGGCTGGTTCGACCCCAACTTCACCTCCAGCATAAAGAGACCCACCATGTCTACCCTCACTGTGGACATCGCCAACAAGGAGATCTCGTGTGTGGATTTGAAGCCCCTGACGGCGCTTATTTCCATTGGTTGTGACCGGGAAAAGAAGCTTATCGTGCAAAACAAGATCTCTGCCTGCTCTGCGGGTGTCCTCGACCCTCGAGTGCTGCAGGACAACTACACCTACGTCATCAAGAAGGGATCCTATGACCTCGGCCCTGGCAGGGAGTCGGCCAAAGGAGACCTGCTGGTGTCCTACCCATTCAAGGACTTCGGCTGCCCCGGCCTTGTCTACTACGAGACCCCCTGGAAGCCAGTGATCGAGCTGTGGCACGGGAACGAGTTCGCGGAGCTGGTGGAGGCCGAGTTCGTGCTGCGCGAGGTGCACGGGCTCCGCACCTTCTCCTACGCGCTCACCGCGAAGGACGCCGGCTGCCGCTCGCAGCCGCAGAACTGGAGCTCGGTGCTGCAGTCCGCGCTCGGGTCCGGACGCGCCCCCTGGAGCAGAGAGAGCTACGTGAGCTGCCACAGTCCCAGTTCCCAAACCCCCCTGAGGTGGCCAGACGTCCAGTATCAGATCCTAGGGGGCCGGACAGACAACAGGGTCATTTTCAAACAATGGAATGGAATCTACGTTTTCCACCTTTCCGTCTTGGATCCGTACTACAGCTACTGCCGCCTGGAGACCACCTTCAGCATCTATGTGTACGGCGCCTACCCACTGTCCCTCTTTGCGCCCGGAGTCACCATTGTCCTGCTGGTGGCCAGCATGCTGCTGGCCATGTGGCTGGCCCACATCCTCCCCAAGCTGCTGTGTGCCCACGGCGGCCTCAAGATCAAGGAGGCCTACAGGGAGCTGCGCCGGAGATGCCACGGGCTCTGCCACTGTTGCCGTGGCCGGCAGCACTGA

XM_004865677.1 Coding sequence

Rpl36 ribosomal protein L36, transcript variant X1

Length: 318 bp    Location: 4513805..4512260   Strand: -
>XM_004865677.1
ATGGCTCTACGCTACCCCATGGCCGTGGGCCTCAATAAGGGCCACAAGGTGACCAAGAACGTGAGCAAACCGAGGCACAGCCGCCGCCGCGGGCGCCTCACCAAGCACACCAAGTTTGTGCGGGACATGATCCGGGAGGTGTGTGGCTTTGCCCCCTATGAGCGGCGTGCCATGGAACTGCTCAAGGTCTCCAAGGACAAACGGGCCCTCAAGTTCATCAAGAAAAGGGTGGGAACACACATCCGAGCCAAGAGGAAGCGCGAGGAGCTGAGCAATGTGCTGGCCGCCATGAGGAAAGCAGCTGCCAAGAAGGACTGA

XM_004865678.1 Coding sequence

Rpl36 ribosomal protein L36, transcript variant X2

Length: 318 bp    Location: 4513712..4512260   Strand: -
>XM_004865678.1
ATGGCTCTACGCTACCCCATGGCCGTGGGCCTCAATAAGGGCCACAAGGTGACCAAGAACGTGAGCAAACCGAGGCACAGCCGCCGCCGCGGGCGCCTCACCAAGCACACCAAGTTTGTGCGGGACATGATCCGGGAGGTGTGTGGCTTTGCCCCCTATGAGCGGCGTGCCATGGAACTGCTCAAGGTCTCCAAGGACAAACGGGCCCTCAAGTTCATCAAGAAAAGGGTGGGAACACACATCCGAGCCAAGAGGAAGCGCGAGGAGCTGAGCAATGTGCTGGCCGCCATGAGGAAAGCAGCTGCCAAGAAGGACTGA

XM_004865692.1 Coding sequence

Safb scaffold attachment factor B, transcript variant X7

High confidence: 4 potential gene matches
Length: 3003 bp    Location: 4557795..4526708   Strand: -
>XM_004865692.1
ATGGCGCCGCCTAAGAGGAAAACGCACTCGCTTCCTCCCGCCCCGCTTTGCGGCCGCGCATGCGTACCACCCTCACGAGCGTTCTCAGCCTCAGGCAAGCTCGCTCACCGACCAACCTCATGTCCCTCGCCACAACGCGCAGGCGCCGCCACTGCAGCACGCATGCGTCGAGATCGTCCGCGGCGGGAGGCCCAGAAGGAGAAACGCGCCTGCGCACATCTCCCCGGGGTTCTCACCACGCATGTGCAGATGAGACTTGGAGCGTCGGTCTCGCGCCGGATGCGCCTGCGTAGAAGCGAGGCGCGCCGGGCGGCTGGAGCGGTTTCCTCGCAGGCGGCGCCATTTTGTGCTAGAAGCCGAGAAAAAACCGGCCCGGTTCTGTGTGAAGGGGGCGACGGAACCAGGGTCCCTGGAATGGCGGAGACTCTGTCGGGTTTAGGAGATTCGGGTGCGGCGAGCGCAGCTGCTCTGAGTTCCGCCTCGTCGGAAACCGGGACGCGGCGCCTCAGCGACCTGCGGGTGATCGACCTGCGGGCGGAACTGAGGAAACGGAATCTGGATTCCAGTGGTAACAAGAGCGTTTTGATGGAGCGGCTGAAAAAGGCAATTGAAGATGAAGGTGGTAACCCTGATGAAATTGAAGTTACGTCTGAAGGAAACAAGAAAACATCCAAGAGATCCAGTAAAGGGCGGAAACCCGAAGAAGAGGGTGTGGAGGATAACGGGCTGGAGGAGAATTCTGGGGATGGACAGGTAGATGACAAAGAAACTATAAACAATTTAGATACTTCATCATCTGACTTCACTATATTACAGGAGATTGAAGAGCCATCTCTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGTTCTGTCGAAGATGACTCGGACTCTAAAAGGCTTTCCCGAGAGGAGAAGGGTCGTAGCAGTTGTAGTAGAAATTTCTGGGTTAGTGGACTTTCTTCTACGACCAGAGCTACAGATTTGAAGACTCTTTTCAGCAAGTATGGGAAGGTGGTGGGCGCCAAGGTTGTGACAAATGCCCGGAGTCCTGGAGCTCGCTGTTACGGCTTTGTCACCATGTCCACAGCCGAAGAAGCAACGAAATGCATCAACCACCTGCACAAGACGGAGCTGCATGGAAAGATGATCTCTGTGGAAAAAGCGAAAAATGAACCAGCCAGCAAGAAAACCTCTGAAAAGAGGGACAGCGAGGGCAAGAAGGAGAAGTCAAGCACTAGTGACAGATCCGCGAACCTCAAGAGGGACGATAAATCTGACAGAAAAGACGACAGCAAAAAGGGTGAAGATGCAAGTGGAGAAAAGAGTAAAGACCCGGATGAGAAGCTGGGCTCCTCGGAGCGATCTCGAGCCACAAAGTCAGGAAGTCGAGGCACTGAGCGGATTGTGGTGATGGACAAATCGAAGGGTGTGCCTGTTATCAGTGTGAAGACATCTGGATCCAAAGAGAGAGCCTCCAAAAGCCAGGATCGCAAATCAGCCAGCAGAGAGAAGCGGTCCGTTGTATCCTTTGATAAGGTCAAAGAGCCTCGGAAGTCAAGAGACTCGGAGTCCCATACAGAAGTACGGGAGCGCAGTGAGCGGGAGCAGCGCCTGCAGGCACAGTGGGAGCGTGAGGAGCGGGAACGGCTGGAGATTGCCCGCGAGCGGCTGGCCTTCCACCGGCACCGGCTGGAGCGCGAGCGCATGGAGCGGGAGCGGCTGGAGCGCGAGCGCATGCACGTGGAGCAGGAGCGCAGGCGTGAGCAGGAGCGCATCCACCGCGAGCGCGAAGAGCTGCGGCGCCAGCAGGAGCTGCGCTATGAGCAGGAGCGGCGGCCGGCTGTGCGGCGGCCCTACGACCTGGACAGCCGGGACGATGCCTACTGGCCAGAGGCCAAGCGGGCCGCTCTGGACGAGCGCTACCACTCGGACTTCAGCCGCCAGGACCGCTTCCATGACTTTGACCACAGGGACCGGGGCCGCTACCCCAACCACTCTGTGGACAGGAGAGAAGGTTCAAGGTCAATGATGGGAGAACGAGAAGGGCAGCATTACCCCGAGCGCCATGGAGGACCAGAGCGCCACAGCCGGGACTCACGCGACAGCTGGGGCTATGGCTCGGACAAGAGGATGAGCGAAGGTCGGGGGCTGCCCCCTCCCCCCAGGGACAGGCGAGACTGGGGGGAACATGGCCGAAGACTAGAGGACGACCGGGCATGGCAGGGCGCTGCCGACGGGGGCATGATAGACCGGGACCACAAGAGGTGGCAGGGTGGAGAGAGGAGTATGTCCGGCCACTCGGGGCCTGGCCACATGATGAACCGGGGCGGCATGTCAGGGCGCGGCAGCTTTGCTCCGGGTGGGGCGTCCCGGGGCCACGTGATCCCCCGTGGAGGGATGCAGGGCGGCTTCCGGGGACAGAGCCGGGGGAGCAGACCCAGCGACACCCGCTTCACTCGCCGCTACTGA

XM_004865691.1 Coding sequence

Safb scaffold attachment factor B, transcript variant X6

Length: 3204 bp    Location: 4557795..4526708   Strand: -
>XM_004865691.1
ATGGCGCCGCCTAAGAGGAAAACGCACTCGCTTCCTCCCGCCCCGCTTTGCGGCCGCGCATGCGTACCACCCTCACGAGCGTTCTCAGCCTCAGGCAAGCTCGCTCACCGACCAACCTCATGTCCCTCGCCACAACGCGCAGGCGCCGCCACTGCAGCACGCATGCGTCGAGATCGTCCGCGGCGGGAGGCCCAGAAGGAGAAACGCGCCTGCGCACATCTCCCCGGGGTTCTCACCACGCATGTGCAGATGAGACTTGGAGCGTCGGTCTCGCGCCGGATGCGCCTGCGTAGAAGCGAGGCGCGCCGGGCGGCTGGAGCGGTTTCCTCGCAGGCGGCGCCATTTTGTGCTAGAAGCCGAGAAAAAACCGGCCCGGTTCTGTGTGAAGGGGGCGACGGAACCAGGGTCCCTGGAATGGCGGAGACTCTGTCGGGTTTAGGAGATTCGGGTGCGGCGAGCGCAGCTGCTCTGAGTTCCGCCTCGTCGGAAACCGGGACGCGGCGCCTCAGCGACCTGCGGGTGATCGACCTGCGGGCGGAACTGAGGAAACGGAATCTGGATTCCAGTGGTAACAAGAGCGTTTTGATGGAGCGGCTGAAAAAGGCAATTGAAGATGAAGGTGGTAACCCTGATGAAATTGAAGTTACGTCTGAAGGAAACAAGAAAACATCCAAGAGATCCAGTAAAGGGCGGAAACCCGAAGAAGAGGGTGTGGAGGATAACGGGCTGGAGGAGAATTCTGGGGATGGACAGGAGGATGTTGAGACCAGTTTGGAGAACTTGCAGGACATCGACATGATGGATATCAGTGTGTTGGATGAAGCAGAAATTGATAATGGAAGCGTTGCTGACTGTGTGGAGGAGGAGGATGCTGACAACCTTCCAGAGTCCCTGTCTGACAGTAGAGAGCTAGTTGAGGGTGAAATGAAAGACCTCCCAGAGCAGCTTCAAGAACATGCTGTAGATGACAAAGAAACTATAAACAATTTAGATACTTCATCATCTGACTTCACTATATTACAGGAGATTGAAGAGCCATCTCTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGTTCTGTCGAAGATGACTCGGACTCTAAAAGGCTTTCCCGAGAGGAGAAGGGTCGTAGCAGTTGTAGTAGAAATTTCTGGGTTAGTGGACTTTCTTCTACGACCAGAGCTACAGATTTGAAGACTCTTTTCAGCAAGTATGGGAAGGTGGTGGGCGCCAAGGTTGTGACAAATGCCCGGAGTCCTGGAGCTCGCTGTTACGGCTTTGTCACCATGTCCACAGCCGAAGAAGCAACGAAATGCATCAACCACCTGCACAAGACGGAGCTGCATGGAAAGATGATCTCTGTGGAAAAAGCGAAAAATGAACCAGCCAGCAAGAAAACCTCTGAAAAGAGGGACAGCGAGGGCAAGAAGGAGAAGTCAAGCACTAGTGACAGATCCGCGAACCTCAAGAGGGACGATAAATCTGACAGAAAAGACGACAGCAAAAAGGGTGAAGATGCAAGTGGAGAAAAGAGTAAAGACCCGGATGAGAAGCTGGGCTCCTCGGAGCGATCTCGAGCCACAAAGTCAGGAAGTCGAGGCACTGAGCGGATTGTGGTGATGGACAAATCGAAGGGTGTGCCTGTTATCAGTGTGAAGACATCTGGATCCAAAGAGAGAGCCTCCAAAAGCCAGGATCGCAAATCAGCCAGCAGAGAGAAGCGGTCCGTTGTATCCTTTGATAAGGTCAAAGAGCCTCGGAAGTCAAGAGACTCGGAGTCCCATACAGAAGTACGGGAGCGCAGTGAGCGGGAGCAGCGCCTGCAGGCACAGTGGGAGCGTGAGGAGCGGGAACGGCTGGAGATTGCCCGCGAGCGGCTGGCCTTCCACCGGCACCGGCTGGAGCGCGAGCGCATGGAGCGGGAGCGGCTGGAGCGCGAGCGCATGCACGTGGAGCAGGAGCGCAGGCGTGAGCAGGAGCGCATCCACCGCGAGCGCGAAGAGCTGCGGCGCCAGCAGGAGCTGCGCTATGAGCAGGAGCGGCGGCCGGCTGTGCGGCGGCCCTACGACCTGGACAGCCGGGACGATGCCTACTGGCCAGAGGCCAAGCGGGCCGCTCTGGACGAGCGCTACCACTCGGACTTCAGCCGCCAGGACCGCTTCCATGACTTTGACCACAGGGACCGGGGCCGCTACCCCAACCACTCTGTGGACAGGAGAGAAGGTTCAAGGTCAATGATGGGAGAACGAGAAGGGCAGCATTACCCCGAGCGCCATGGAGGACCAGAGCGCCACAGCCGGGACTCACGCGACAGCTGGGGCTATGGCTCGGACAAGAGGATGAGCGAAGGTCGGGGGCTGCCCCCTCCCCCCAGGCGAGACTGGGGGGAACATGGCCGAAGACTAGAGGACGACCGGGCATGGCAGGGCGCTGCCGACGGGGGCATGATAGACCGGGACCACAAGAGGTGGCAGGGTGGAGAGAGGAGTATGTCCGGCCACTCGGGGCCTGGCCACATGATGAACCGGGGCGGCATGTCAGGGCGCGGCAGCTTTGCTCCGGGTGGGGCGTCCCGGGGCCACGTGATCCCCCGTGGAGGGATGCAGGGCGGCTTCCGGGGACAGAGCCGGGGGAGCAGACCCAGCGACACCCGCTTCACTCGCCGCTACTGA

XM_004865690.1 Coding sequence

Safb scaffold attachment factor B, transcript variant X5

Length: 3210 bp    Location: 4557795..4526708   Strand: -
>XM_004865690.1
ATGGCGCCGCCTAAGAGGAAAACGCACTCGCTTCCTCCCGCCCCGCTTTGCGGCCGCGCATGCGTACCACCCTCACGAGCGTTCTCAGCCTCAGGCAAGCTCGCTCACCGACCAACCTCATGTCCCTCGCCACAACGCGCAGGCGCCGCCACTGCAGCACGCATGCGTCGAGATCGTCCGCGGCGGGAGGCCCAGAAGGAGAAACGCGCCTGCGCACATCTCCCCGGGGTTCTCACCACGCATGTGCAGATGAGACTTGGAGCGTCGGTCTCGCGCCGGATGCGCCTGCGTAGAAGCGAGGCGCGCCGGGCGGCTGGAGCGGTTTCCTCGCAGGCGGCGCCATTTTGTGCTAGAAGCCGAGAAAAAACCGGCCCGGTTCTGTGTGAAGGGGGCGACGGAACCAGGGTCCCTGGAATGGCGGAGACTCTGTCGGGTTTAGGAGATTCGGGTGCGGCGAGCGCAGCTGCTCTGAGTTCCGCCTCGTCGGAAACCGGGACGCGGCGCCTCAGCGACCTGCGGGTGATCGACCTGCGGGCGGAACTGAGGAAACGGAATCTGGATTCCAGTGGTAACAAGAGCGTTTTGATGGAGCGGCTGAAAAAGGCAATTGAAGATGAAGGTGGTAACCCTGATGAAATTGAAGTTACGTCTGAAGGAAACAAGAAAACATCCAAGAGATCCAGTAAAGGGCGGAAACCCGAAGAAGAGGGTGTGGAGGATAACGGGCTGGAGGAGAATTCTGGGGATGGACAGGAGGATGTTGAGACCAGTTTGGAGAACTTGCAGGACATCGACATGATGGATATCAGTGTGTTGGATGAAGCAGAAATTGATAATGGAAGCGTTGCTGACTGTGTGGAGGAGGAGGATGCTGACAACCTTCCAGAGTCCCTGTCTGACAGTAGAGAGCTAGTTGAGGGTGAAATGAAAGACCTCCCAGAGCAGCTTCAAGAACATGCTGTAGATGACAAAGAAACTATAAACAATTTAGATACTTCATCATCTGACTTCACTATATTACAGGAGATTGAAGAGCCATCTCTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGTTCTGTCGAAGATGACTCGGACTCTAAAAGGCTTTCCCGAGAGGAGAAGGGTCGTAGCAGTTGTAGTAGAAATTTCTGGGTTAGTGGACTTTCTTCTACGACCAGAGCTACAGATTTGAAGACTCTTTTCAGCAAGTATGGGAAGGTGGTGGGCGCCAAGGTTGTGACAAATGCCCGGAGTCCTGGAGCTCGCTGTTACGGCTTTGTCACCATGTCCACAGCCGAAGAAGCAACGAAATGCATCAACCACCTGCACAAGACGGAGCTGCATGGAAAGATGATCTCTGTGGAAAAAGCGAAAAATGAACCAGCCAGCAAGAAAACCTCTGAAAAGAGGGACAGCGAGGGCAAGAAGGAGAAGTCAAGCACTAGTGACAGATCCGCGAACCTCAAGAGGGACGATAAATCTGACAGAAAAGACGACAGCAAAAAGGGTGAAGATGCAAGTGGAGAAAAGAGTAAAGACCCGGATGAGAAGCTGGGCTCCTCGGAGCGATCTCGAGCCACAAAGTCAGGAAGTCGAGGCACTGAGCGGATTGTGGTGATGGACAAATCGAAGGGTGTGCCTGTTATCAGTGTGAAGACATCTGGATCCAAAGAGAGAGCCTCCAAAAGCCAGGATCGCAAATCAGCCAGCAGAGAGAAGCGGTCCGTTGTATCCTTTGATAAGGTCAAAGAGCCTCGGAAGTCAAGAGACTCGGAGTCCCATACAGAAGTACGGGAGCGCAGTGAGCGGGAGCAGCGCCTGCAGGCACAGTGGGAGCGTGAGGAGCGGGAACGGCTGGAGATTGCCCGCGAGCGGCTGGCCTTCCACCGGCACCGGCTGGAGCGCGAGCGCATGGAGCGGGAGCGGCTGGAGCGCGAGCGCATGCACGTGGAGCAGGAGCGCAGGCGTGAGCAGGAGCGCATCCACCGCGAGCGCGAAGAGCTGCGGCGCCAGCAGGAGCTGCGCTATGAGCAGGAGCGGCGGCCGGCTGTGCGGCGGCCCTACGACCTGGACAGCCGGGACGATGCCTACTGGCCAGAGGCCAAGCGGGCCGCTCTGGACGAGCGCTACCACTCGGACTTCAGCCGCCAGGACCGCTTCCATGACTTTGACCACAGGGACCGGGGCCGCTACCCCAACCACTCTGTGGACAGGAGAGAAGGTTCAAGGTCAATGATGGGAGAACGAGAAGGGCAGCATTACCCCGAGCGCCATGGAGGACCAGAGCGCCACAGCCGGGACTCACGCGACAGCTGGGGCTATGGCTCGGACAAGAGGATGAGCGAAGGTCGGGGGCTGCCCCCTCCCCCCAGGGACAGGCGAGACTGGGGGGAACATGGCCGAAGACTAGAGGACGACCGGGCATGGCAGGGCGCTGCCGACGGGGGCATGATAGACCGGGACCACAAGAGGTGGCAGGGTGGAGAGAGGAGTATGTCCGGCCACTCGGGGCCTGGCCACATGATGAACCGGGGCGGCATGTCAGGGCGCGGCAGCTTTGCTCCGGGTGGGGCGTCCCGGGGCCACGTGATCCCCCGTGGAGGGATGCAGGGCGGCTTCCGGGGACAGAGCCGGGGGAGCAGACCCAGCGACACCCGCTTCACTCGCCGCTACTGA

XM_004865689.1 Coding sequence

Safb scaffold attachment factor B, transcript variant X4

Length: 3207 bp    Location: 4557795..4526708   Strand: -
>XM_004865689.1
ATGGCGCCGCCTAAGAGGAAAACGCACTCGCTTCCTCCCGCCCCGCTTTGCGGCCGCGCATGCGTACCACCCTCACGAGCGTTCTCAGCCTCAGGCAAGCTCGCTCACCGACCAACCTCATGTCCCTCGCCACAACGCGCAGGCGCCGCCACTGCAGCACGCATGCGTCGAGATCGTCCGCGGCGGGAGGCCCAGAAGGAGAAACGCGCCTGCGCACATCTCCCCGGGGTTCTCACCACGCATGTGCAGATGAGACTTGGAGCGTCGGTCTCGCGCCGGATGCGCCTGCGTAGAAGCGAGGCGCGCCGGGCGGCTGGAGCGGTTTCCTCGCAGGCGGCGCCATTTTGTGCTAGAAGCCGAGAAAAAACCGGCCCGGTTCTGTGTGAAGGGGGCGACGGAACCAGGGTCCCTGGAATGGCGGAGACTCTGTCGGGTTTAGGAGATTCGGGTGCGGCGAGCGCAGCTGCTCTGAGTTCCGCCTCGTCGGAAACCGGGACGCGGCGCCTCAGCGACCTGCGGGTGATCGACCTGCGGGCGGAACTGAGGAAACGGAATCTGGATTCCAGTGGTAACAAGAGCGTTTTGATGGAGCGGCTGAAAAAGGCAATTGAAGATGAAGGTGGTAACCCTGATGAAATTGAAGTTACGTCTGAAGGAAACAAGAAAACATCCAAGAGATCCAGTAAAGGGCGGAAACCCGAAGAAGAGGGTGTGGAGGATAACGGGCTGGAGGAGAATTCTGGGGATGGACAGGAGGATGTTGAGACCAGTTTGGAGAACTTGCAGGACATCGACATGATGGATATCAGTGTGTTGGATGAAGCAGAAATTGATAATGGAAGCGTTGCTGACTGTGTGGAGGAGGAGGATGCTGACAACCTTCCAGAGTCCCTGTCTGACAGTAGAGAGCTAGTTGAGGGTGAAATGAAAGACCTCCCAGAGCAGCTTCAAGAACATGCTGTAGATGACAAAGAAACTATAAACAATTTAGATACTTCATCATCTGACTTCACTATATTACAGGAGATTGAAGAGCCATCTCTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGTTCTGTCGAAGATGACTCGGACTCTAAAAGGCTTTCCCGAGAGGAGAAGGGTCGTAGCAGTTGTAGTAGAAATTTCTGGGTTAGTGGACTTTCTTCTACGACCAGAGCTACAGATTTGAAGACTCTTTTCAGCAAGTATGGGAAGGTGGTGGGCGCCAAGGTTGTGACAAATGCCCGGAGTCCTGGAGCTCGCTGTTACGGCTTTGTCACCATGTCCACAGCCGAAGAAGCAACGAAATGCATCAACCACCTGCACAAGACGGAGCTGCATGGAAAGATGATCTCTGTGGAAAAAGCGAAAAATGAACCAGCCAGCAAGAAAACCTCTGAAAAGAGGGACAGCGAGGGCAAGAAGGAGAAGTCAAGCACTAGTGACAGATCCGCGAACCTCAAGAGGGACGATAAATCTGACAGAAAAGACGACAGCAAAAAGGGTGAAGATGCAAGTGGAGAAAAGAGTAAAGACCCGGATGAGAAGCTGGGCTCCTCGGAGCGATCTCGAGCCACAAAGTCAGGAAGTCGAGGCACTGAGCGGATTGTGGTGATGGACAAATCGAAGGGTGTGCCTGTTATCAGTGTGAAGACATCTGGATCCAAAGAGAGAGCCTCCAAAAGCCAGGATCGCAAATCAGCCAGCAGAGAGAAGCGGTCCGTTGTATCCTTTGATAAGGTCAAAGAGCCTCGGAAGTCAAGAGACTCGGAGTCCCGTAGGGAGCGGGAGCGCAGTGAGCGGGAGCAGCGCCTGCAGGCACAGTGGGAGCGTGAGGAGCGGGAACGGCTGGAGATTGCCCGCGAGCGGCTGGCCTTCCACCGGCACCGGCTGGAGCGCGAGCGCATGGAGCGGGAGCGGCTGGAGCGCGAGCGCATGCACGTGGAGCAGGAGCGCAGGCGTGAGCAGGAGCGCATCCACCGCGAGCGCGAAGAGCTGCGGCGCCAGCAGGAGCTGCGCTATGAGCAGGAGCGGCGGCCGGCTGTGCGGCGGCCCTACGACCTGGACAGCCGGGACGATGCCTACTGGCCAGAGGCCAAGCGGGCCGCTCTGGACGAGCGCTACCACTCGGACTTCAGCCGCCAGGACCGCTTCCATGACTTTGACCACAGGGACCGGGGCCGCTACCCCAACCACTCTGTGGACAGGAGAGAAGGTTCAAGGTCAATGATGGGAGAACGAGAAGGGCAGCATTACCCCGAGCGCCATGGAGGACCAGAGCGCCACAGCCGGGACTCACGCGACAGCTGGGGCTATGGCTCGGACAAGAGGATGAGCGAAGGTCGGGGGCTGCCCCCTCCCCCCAGGGACAGGCGAGACTGGGGGGAACATGGCCGAAGACTAGAGGACGACCGGGCATGGCAGGGCGCTGCCGACGGGGGCATGATAGACCGGGACCACAAGAGGTGGCAGGGTGGAGAGAGGAGTATGTCCGGCCACTCGGGGCCTGGCCACATGATGAACCGGGGCGGCATGTCAGGGCGCGGCAGCTTTGCTCCGGGTGGGGCGTCCCGGGGCCACGTGATCCCCCGTGGAGGGATGCAGGGCGGCTTCCGGGGACAGAGCCGGGGGAGCAGACCCAGCGACACCCGCTTCACTCGCCGCTACTGA

XM_004865687.1 Coding sequence

Safb scaffold attachment factor B, transcript variant X2

Length: 3204 bp    Location: 4557795..4526708   Strand: -
>XM_004865687.1
ATGGCGCCGCCTAAGAGGAAAACGCACTCGCTTCCTCCCGCCCCGCTTTGCGGCCGCGCATGCGTACCACCCTCACGAGCGTTCTCAGCCTCAGGCAAGCTCGCTCACCGACCAACCTCATGTCCCTCGCCACAACGCGCAGGCGCCGCCACTGCAGCACGCATGCGTCGAGATCGTCCGCGGCGGGAGGCCCAGAAGGAGAAACGCGCCTGCGCACATCTCCCCGGGGTTCTCACCACGCATGTGCAGATGAGACTTGGAGCGTCGGTCTCGCGCCGGATGCGCCTGCGTAGAAGCGAGGCGCGCCGGGCGGCTGGAGCGGTTTCCTCGCAGGCGGCGCCATTTTGTGCTAGAAGCCGAGAAAAAACCGGCCCGGTTCTGTGTGAAGGGGGCGACGGAACCAGGGTCCCTGGAATGGCGGAGACTCTGTCGGGTTTAGGAGATTCGGGTGCGGCGAGCGCAGCTGCTCTGAGTTCCGCCTCGTCGGAAACCGGGACGCGGCGCCTCAGCGACCTGCGGGTGATCGACCTGCGGGCGGAACTGAGGAAACGGAATCTGGATTCCAGTGGTAACAAGAGCGTTTTGATGGAGCGGCTGAAAAAGGCAATTGAAGATGAAGGTGGTAACCCTGATGAAATTGAAGTTACGTCTGAAGGAAACAAGAAAACATCCAAGAGATCCAGTAAAGGGCGGAAACCCGAAGAAGAGGGTGTGGAGGATAACGGGCTGGAGGAGAATTCTGGGGATGGACAGGAGGATGTTGAGACCAGTTTGGAGAACTTGCAGGACATCGACATGATGGATATCAGTGTGTTGGATGAAGCAGAAATTGATAATGGAAGCGTTGCTGACTGTGTGGAGGAGGAGGATGCTGACAACCTTCCAGAGTCCCTGTCTGACAGTAGAGAGCTAGTTGAGGGTGAAATGAAAGACCTCCCAGAGCAGCTTCAAGAACATGCTGTAGATGACAAAGAAACTATAAACAATTTAGATACTTCATCATCTGACTTCACTATATTACAGGAGATTGAAGAGCCATCTCTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGTTCTGTCGAAGATGACTCGGACTCTAAAAGGCTTTCCCGAGAGGAGAAGGGTCGTAGCAGTTGTAGTAGAAATTTCTGGGTTAGTGGACTTTCTTCTACGACCAGAGCTACAGATTTGAAGACTCTTTTCAGCAAGTATGGGAAGGTGGTGGGCGCCAAGGTTGTGACAAATGCCCGGAGTCCTGGAGCTCGCTGTTACGGCTTTGTCACCATGTCCACAGCCGAAGAAGCAACGAAATGCATCAACCACCTGCACAAGACGGAGCTGCATGGAAAGATGATCTCTGTGGAAAAAGCGAAAAATGAACCAGCCAGCAAGAAAACCTCTGAAAAGAGGGACAGCGAGGGCAAGAAGGAGAAGTCAAGCACTAGTGACAGATCCGCGAACCTCAAGAGGGACGATAAATCTGACAGAAAAGACGACAGCAAAAAGGGTGAAGATGCAAGTGGAGAAAAGAGTAAAGACCCGGATGAGAAGCTGGGCTCCTCGGAGCGATCTCGAGCCACAAAGTCAGGAAGTCGAGGCACTGAGCGGATTGTGGTGATGGACAAATCGAAGGGTGTGCCTGTTATCAGTGTGAAGACATCTGGATCCAAAGAGAGAGCCTCCAAAAGCCAGGATCGCAAATCAGCCAGCAGAGAGAAGCGGTCCGTTGTATCCTTTGATAAGGTCAAAGAGCCTCGGAAGTCAAGAGACTCGGAGTCCCGTAGGGAGCGGGAGCGCAGTGAGCGGGAGCAGCGCCTGCAGGCACAGTGGGAGCGTGAGGAGCGGGAACGGCTGGAGATTGCCCGCGAGCGGCTGGCCTTCCACCGGCACCGGCTGGAGCGCGAGCGCATGGAGCGGGAGCGGCTGGAGCGCGAGCGCATGCACGTGGAGCAGGAGCGCAGGCGTGAGCAGGAGCGCATCCACCGCGAGCGCGAAGAGCTGCGGCGCCAGCAGGAGCTGCGCTATGAGCAGGAGCGGCGGCCGGCTGTGCGGCGGCCCTACGACCTGGACAGCCGGAGGGACGATGCCTACTGGCCAGAGGCCAAGCGGGCCGCTCTGGACGAGCGCTACCACTCGGACTTCAGCCGCCAGGACCGCTTCCATGACTTTGACCACAGGGACCGGGGCCGCTACCCCAACCACTCTGTGGACAGGAGAGAAGGTTCAAGGTCAATGATGGGAGAACGAGAAGGGCAGCATTACCCCGAGCGCCATGGAGGACCAGAGCGCCACAGCCGGGACTCACGCGACAGCTGGGGCTATGGCTCGGACAAGAGGATGAGCGAAGGTCGGGGGCTGCCCCCTCCCCCCAGGCGAGACTGGGGGGAACATGGCCGAAGACTAGAGGACGACCGGGCATGGCAGGGCGCTGCCGACGGGGGCATGATAGACCGGGACCACAAGAGGTGGCAGGGTGGAGAGAGGAGTATGTCCGGCCACTCGGGGCCTGGCCACATGATGAACCGGGGCGGCATGTCAGGGCGCGGCAGCTTTGCTCCGGGTGGGGCGTCCCGGGGCCACGTGATCCCCCGTGGAGGGATGCAGGGCGGCTTCCGGGGACAGAGCCGGGGGAGCAGACCCAGCGACACCCGCTTCACTCGCCGCTACTGA

XM_004865686.1 Coding sequence

Safb scaffold attachment factor B, transcript variant X1

Length: 3210 bp    Location: 4557795..4526708   Strand: -
>XM_004865686.1
ATGGCGCCGCCTAAGAGGAAAACGCACTCGCTTCCTCCCGCCCCGCTTTGCGGCCGCGCATGCGTACCACCCTCACGAGCGTTCTCAGCCTCAGGCAAGCTCGCTCACCGACCAACCTCATGTCCCTCGCCACAACGCGCAGGCGCCGCCACTGCAGCACGCATGCGTCGAGATCGTCCGCGGCGGGAGGCCCAGAAGGAGAAACGCGCCTGCGCACATCTCCCCGGGGTTCTCACCACGCATGTGCAGATGAGACTTGGAGCGTCGGTCTCGCGCCGGATGCGCCTGCGTAGAAGCGAGGCGCGCCGGGCGGCTGGAGCGGTTTCCTCGCAGGCGGCGCCATTTTGTGCTAGAAGCCGAGAAAAAACCGGCCCGGTTCTGTGTGAAGGGGGCGACGGAACCAGGGTCCCTGGAATGGCGGAGACTCTGTCGGGTTTAGGAGATTCGGGTGCGGCGAGCGCAGCTGCTCTGAGTTCCGCCTCGTCGGAAACCGGGACGCGGCGCCTCAGCGACCTGCGGGTGATCGACCTGCGGGCGGAACTGAGGAAACGGAATCTGGATTCCAGTGGTAACAAGAGCGTTTTGATGGAGCGGCTGAAAAAGGCAATTGAAGATGAAGGTGGTAACCCTGATGAAATTGAAGTTACGTCTGAAGGAAACAAGAAAACATCCAAGAGATCCAGTAAAGGGCGGAAACCCGAAGAAGAGGGTGTGGAGGATAACGGGCTGGAGGAGAATTCTGGGGATGGACAGGAGGATGTTGAGACCAGTTTGGAGAACTTGCAGGACATCGACATGATGGATATCAGTGTGTTGGATGAAGCAGAAATTGATAATGGAAGCGTTGCTGACTGTGTGGAGGAGGAGGATGCTGACAACCTTCCAGAGTCCCTGTCTGACAGTAGAGAGCTAGTTGAGGGTGAAATGAAAGACCTCCCAGAGCAGCTTCAAGAACATGCTGTAGATGACAAAGAAACTATAAACAATTTAGATACTTCATCATCTGACTTCACTATATTACAGGAGATTGAAGAGCCATCTCTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGTTCTGTCGAAGATGACTCGGACTCTAAAAGGCTTTCCCGAGAGGAGAAGGGTCGTAGCAGTTGTAGTAGAAATTTCTGGGTTAGTGGACTTTCTTCTACGACCAGAGCTACAGATTTGAAGACTCTTTTCAGCAAGTATGGGAAGGTGGTGGGCGCCAAGGTTGTGACAAATGCCCGGAGTCCTGGAGCTCGCTGTTACGGCTTTGTCACCATGTCCACAGCCGAAGAAGCAACGAAATGCATCAACCACCTGCACAAGACGGAGCTGCATGGAAAGATGATCTCTGTGGAAAAAGCGAAAAATGAACCAGCCAGCAAGAAAACCTCTGAAAAGAGGGACAGCGAGGGCAAGAAGGAGAAGTCAAGCACTAGTGACAGATCCGCGAACCTCAAGAGGGACGATAAATCTGACAGAAAAGACGACAGCAAAAAGGGTGAAGATGCAAGTGGAGAAAAGAGTAAAGACCCGGATGAGAAGCTGGGCTCCTCGGAGCGATCTCGAGCCACAAAGTCAGGAAGTCGAGGCACTGAGCGGATTGTGGTGATGGACAAATCGAAGGGTGTGCCTGTTATCAGTGTGAAGACATCTGGATCCAAAGAGAGAGCCTCCAAAAGCCAGGATCGCAAATCAGCCAGCAGAGAGAAGCGGTCCGTTGTATCCTTTGATAAGGTCAAAGAGCCTCGGAAGTCAAGAGACTCGGAGTCCCGTAGGGAGCGGGAGCGCAGTGAGCGGGAGCAGCGCCTGCAGGCACAGTGGGAGCGTGAGGAGCGGGAACGGCTGGAGATTGCCCGCGAGCGGCTGGCCTTCCACCGGCACCGGCTGGAGCGCGAGCGCATGGAGCGGGAGCGGCTGGAGCGCGAGCGCATGCACGTGGAGCAGGAGCGCAGGCGTGAGCAGGAGCGCATCCACCGCGAGCGCGAAGAGCTGCGGCGCCAGCAGGAGCTGCGCTATGAGCAGGAGCGGCGGCCGGCTGTGCGGCGGCCCTACGACCTGGACAGCCGGAGGGACGATGCCTACTGGCCAGAGGCCAAGCGGGCCGCTCTGGACGAGCGCTACCACTCGGACTTCAGCCGCCAGGACCGCTTCCATGACTTTGACCACAGGGACCGGGGCCGCTACCCCAACCACTCTGTGGACAGGAGAGAAGGTTCAAGGTCAATGATGGGAGAACGAGAAGGGCAGCATTACCCCGAGCGCCATGGAGGACCAGAGCGCCACAGCCGGGACTCACGCGACAGCTGGGGCTATGGCTCGGACAAGAGGATGAGCGAAGGTCGGGGGCTGCCCCCTCCCCCCAGGGACAGGCGAGACTGGGGGGAACATGGCCGAAGACTAGAGGACGACCGGGCATGGCAGGGCGCTGCCGACGGGGGCATGATAGACCGGGACCACAAGAGGTGGCAGGGTGGAGAGAGGAGTATGTCCGGCCACTCGGGGCCTGGCCACATGATGAACCGGGGCGGCATGTCAGGGCGCGGCAGCTTTGCTCCGGGTGGGGCGTCCCGGGGCCACGTGATCCCCCGTGGAGGGATGCAGGGCGGCTTCCGGGGACAGAGCCGGGGGAGCAGACCCAGCGACACCCGCTTCACTCGCCGCTACTGA

XM_004865688.1 Coding sequence

Safb scaffold attachment factor B, transcript variant X3

Length: 3234 bp    Location: 4557795..4526708   Strand: -
>XM_004865688.1
ATGGCGCCGCCTAAGAGGAAAACGCACTCGCTTCCTCCCGCCCCGCTTTGCGGCCGCGCATGCGTACCACCCTCACGAGCGTTCTCAGCCTCAGGCAAGCTCGCTCACCGACCAACCTCATGTCCCTCGCCACAACGCGCAGGCGCCGCCACTGCAGCACGCATGCGTCGAGATCGTCCGCGGCGGGAGGCCCAGAAGGAGAAACGCGCCTGCGCACATCTCCCCGGGGTTCTCACCACGCATGTGCAGATGAGACTTGGAGCGTCGGTCTCGCGCCGGATGCGCCTGCGTAGAAGCGAGGCGCGCCGGGCGGCTGGAGCGGTTTCCTCGCAGGCGGCGCCATTTTGTGCTAGAAGCCGAGAAAAAACCGGCCCGGTTCTGTGTGAAGGGGGCGACGGAACCAGGGTCCCTGGAATGGCGGAGACTCTGTCGGGTTTAGGAGATTCGGGTGCGGCGAGCGCAGCTGCTCTGAGTTCCGCCTCGTCGGAAACCGGGACGCGGCGCCTCAGCGACCTGCGGGTGATCGACCTGCGGGCGGAACTGAGGAAACGGAATCTGGATTCCAGTGGTAACAAGAGCGTTTTGATGGAGCGGCTGAAAAAGGCAATTGAAGATGAAGGTGGTAACCCTGATGAAATTGAAGTTACGTCTGAAGGAAACAAGAAAACATCCAAGAGATCCAGTAAAGGGCGGAAACCCGAAGAAGAGGGTGTGGAGGATAACGGGCTGGAGGAGAATTCTGGGGATGGACAGGAGGATGTTGAGACCAGTTTGGAGAACTTGCAGGACATCGACATGATGGATATCAGTGTGTTGGATGAAGCAGAAATTGATAATGGAAGCGTTGCTGACTGTGTGGAGGAGGAGGATGCTGACAACCTTCCAGAGTCCCTGTCTGACAGTAGAGAGCTAGTTGAGGGTGAAATGAAAGACCTCCCAGAGCAGCTTCAAGAACATGCTGTAGATGACAAAGAAACTATAAACAATTTAGATACTTCATCATCTGACTTCACTATATTACAGGAGATTGAAGAGCCATCTCTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGTTCTGTCGAAGATGACTCGGACTCTAAAAGGCTTTCCCGAGAGGAGAAGGGTCGTAGCAGTTGTAGTAGAAATTTCTGGGTTAGTGGACTTTCTTCTACGACCAGAGCTACAGATTTGAAGACTCTTTTCAGCAAGTATGGGAAGGTGGTGGGCGCCAAGGTTGTGACAAATGCCCGGAGTCCTGGAGCTCGCTGTTACGGCTTTGTCACCATGTCCACAGCCGAAGAAGCAACGAAATGCATCAACCACCTGCACAAGACGGAGCTGCATGGAAAGATGATCTCTGTGGAAAAAGCGAAAAATGAACCAGCCAGCAAGAAAACCTCTGAAAAGAGGGACAGCGAGGGCAAGAAGGAGAAGTCAAGCACTAGTGACAGGTACTTCTTTCCCGGTGAGAGGCCTTTATCCGCGAACCTCAAGAGGGACGATAAATCTGACAGAAAAGACGACAGCAAAAAGGGTGAAGATGCAAGTGGAGAAAAGAGTAAAGACCCGGATGAGAAGCTGGGCTCCTCGGAGCGATCTCGAGCCACAAAGTCAGGAAGTCGAGGCACTGAGCGGATTGTGGTGATGGACAAATCGAAGGGTGTGCCTGTTATCAGTGTGAAGACATCTGGATCCAAAGAGAGAGCCTCCAAAAGCCAGGATCGCAAATCAGCCAGCAGAGAGAAGCGGTCCGTTGTATCCTTTGATAAGGTCAAAGAGCCTCGGAAGTCAAGAGACTCGGAGTCCCGTAGGGAGCGGGAGCGCAGTGAGCGGGAGCAGCGCCTGCAGGCACAGTGGGAGCGTGAGGAGCGGGAACGGCTGGAGATTGCCCGCGAGCGGCTGGCCTTCCACCGGCACCGGCTGGAGCGCGAGCGCATGGAGCGGGAGCGGCTGGAGCGCGAGCGCATGCACGTGGAGCAGGAGCGCAGGCGTGAGCAGGAGCGCATCCACCGCGAGCGCGAAGAGCTGCGGCGCCAGCAGGAGCTGCGCTATGAGCAGGAGCGGCGGCCGGCTGTGCGGCGGCCCTACGACCTGGACAGCCGGGACGATGCCTACTGGCCAGAGGCCAAGCGGGCCGCTCTGGACGAGCGCTACCACTCGGACTTCAGCCGCCAGGACCGCTTCCATGACTTTGACCACAGGGACCGGGGCCGCTACCCCAACCACTCTGTGGACAGGAGAGAAGGTTCAAGGTCAATGATGGGAGAACGAGAAGGGCAGCATTACCCCGAGCGCCATGGAGGACCAGAGCGCCACAGCCGGGACTCACGCGACAGCTGGGGCTATGGCTCGGACAAGAGGATGAGCGAAGGTCGGGGGCTGCCCCCTCCCCCCAGGGACAGGCGAGACTGGGGGGAACATGGCCGAAGACTAGAGGACGACCGGGCATGGCAGGGCGCTGCCGACGGGGGCATGATAGACCGGGACCACAAGAGGTGGCAGGGTGGAGAGAGGAGTATGTCCGGCCACTCGGGGCCTGGCCACATGATGAACCGGGGCGGCATGTCAGGGCGCGGCAGCTTTGCTCCGGGTGGGGCGTCCCGGGGCCACGTGATCCCCCGTGGAGGGATGCAGGGCGGCTTCCGGGGACAGAGCCGGGGGAGCAGACCCAGCGACACCCGCTTCACTCGCCGCTACTGA

XM_004865681.1 Coding sequence

Safb2 scaffold attachment factor B2, transcript variant X1

Length: 3087 bp    Location: 4557701..4586300   Strand: +
>XM_004865681.1
ATGGCGGAACCTCTGGCAGGGTCGGGTGACTCGGGCTCTGGCACGGTTGCTCTGGGTTCGGGCCCCTCGGAGACTGGGACGCGGCGGCTCAGTGAGTTGCGAGTGATCGACCTGCGGGCGGAGCTGAAGAAGCGGAATTTGGACACCGGTGGCAACAAGAGTGTCCTGATGGAGCGGCTCAAGAAGGCGGTTAAGGAAGAAGGGCAAGATCCGGATGAAATTGGCATTGAGTTGGAAACCACTAGCAAGAAGACAGCAAAGAGATGTGCTAAAGGGCAAAAGATGGAGGATGAAGGCACAGAAGACAACGGCCTGGAAGAAGATTCTCGAGACGGGCAGGAGGATGTGGACGTGAGCCTGGAGAACCTGCAGGGCATGGGCGTGGTGGGCATGAGCGTGTTAGACGAGGCTGAGGACAGCAGTGCTCCGGACTTCGGGGAGGACGGCGGCGGTGACGACAGCATTCTCGGTCCCTTGTGTGACAGTAAAGAGTACGTGGCTGCACAGCTGGGACAGCTTCCAGCTCGGCTCTCGGAACACGCTGTGGATGGGGAAGACTTTGAGAACCCTTTGGAAGCTTCATCACTGAACTCCAAAGTAACTCCGGATATTGAAGAACCTCTCTTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGCTCCTTTAAGGAAGAAAAAGATATAAAGCCAGTCATTAAAGATGAAAAAGGCCGTGTCAGCAGCAGCTCTGGGCGGAACCTGTGGGTCAGCGGACTGTCTTCTACCACGCGTGCCACCGACCTCAAGAACCTGTTCAGCAAATACGGGAAGGTTGTCGGGGCCAAAGTGGTGACCAATGCCCGCAGTCCTGGGGCCCGGTGCTATGGGTTTGTCACCATGTCGACATCTGAGGAGGCGACCAAGTGCATCAGCCACCTGCACAGAACTGAGCTGCATGGAAGGATGATCTCGGTGGAGAAGGCCAAAAACGAACCTGCTGGGAAGAAACTGTTGGACAGAAAAGAGTGTGAGGTGAAGAAGGAAAAGTTATCCAGTGCTGACAGACATCACCCTGTGGAGGTCAAAATTGAAAAAACTGTAATCAAGAAGGAAGAGAAGACTGAAAAAAAGGAGGAGAAGAGGCCGGAAGATATTAAAATGGAAGAAAAAGACCAAGACGAGCTGAAACCAGGGCCTGCAAACCGGTCCAGAGTCACTAAGTCAGGAAGCAGAGGGACAGAGCGGACGGTGGTGATGGACAAGTCCAAGGGTGAGCCCGTCATCAGTGTCAAGACCACCAGCAGGTCCAAGGAGAGGAGCTCCAAGAGCCAGGATCGCAAATCGGAAAGCAAGGAGAAGAGAGACATCTTGTCATTTGACAAAATCAAAGAGCAGAGGGAGCGAGAGCGGCAGCGGCAGCGGGAGCGGGAGATCCGGGAGACAGAGCGGCGGCGGGAGCGCGAGCAGCGGGAGCGGGAGCAGCGCCTGGAGGCCTTCCATGAACGCAAGGAGAAGGCGCGGCTGCAGCGGGAGCGGGTGCAGCTCGAGTGCCAGCGGCAGCGGCTGGAGCGCGAGCGGCTAGAGCGGGAGCGGCTGGAGCGAGAGCGCATGCGTGTGGAGCGAGAGCGCAGGAAGGAGCAGGAGCGCATCCACCGGGAGCGCGAGGAGCTGCGGCGCCAGCAGGAGCAGCTGCGCTATGAGCAGGAGCGGCGGCCTGCACTGAGGCGGCCCTACGACCTGGACAGGCGAGACGACGCTTACTGGCCGGAAGGAAAGCGAGTGGCCCTGGAGGACAGGTACCGCGCTGACTTCCCCCGGCCTGATCACCGCTTCCACGACTTTGACCACCGAGACCGGGGCCAGTACCAGGACCACAGTGCCGACAGGCTGCTCATTCTGGGGCTTCGCTGTGAGCAGGAACAAGTGTCCCATCTGGGACCCTGGTGTGGCCTGCAGGAGCGTCGGAGCCGCGGCTGTGGCTCCAGTGAGCTCTGTTCCTTTTGCAGGAGGGAAGGGTCCAGGCCAGGAATGGGCGAGCGGGACGGGCAGCACTACTCTGATGACCGCCACGGCCACGGCCACGGCGGCCCCCCTGAGCACCACAGCCGGGACTCCCGCGATGGCTGGGGAGGCTATGCTTCCGACAAGAGGCTGAGTGAAGGCCGAGGGCTGCCCCCACCCCCCAGGGGTGGCCGGGACTGGGCGGAGCACAACCCGCGGCTGGAGGAGCACCCCGTCCGTGCCTGGCAGGGCACCGTGGACGCGGGCGCGGTGGGCCGGGAGCACTCGCGCTGGCCAGGTACGGTGGCCTGCGGAGGCCGCGCCCCGGGCAGGGGACTGGGCAGGGCTTTGCAAGCCGCTTCTCTTGCAGGTGCCGAGCGGGGCCTATCTGGGCCCTCGGGGCCAGGGCACGCAGCGAGTCGGGGCGGCCTGGCGGGGCGCGGCGGCTTCGCACAGGGCGCACACTCCCAGGGTCACGCGGTGCCGGGCGGCAGCCTGGAGGGCGGCGGAGTGACCAGCCAGGACCGCGGCAGCAGGGTCCCGCACCCCTACCCGCACTTCACCCGCCGCTACTAG

XM_004865682.1 Coding sequence

Safb2 scaffold attachment factor B2, transcript variant X2

Length: 3015 bp    Location: 4557701..4586300   Strand: +
>XM_004865682.1
ATGGCGGAACCTCTGGCAGGGTCGGGTGACTCGGGCTCTGGCACGGTTGCTCTGGGTTCGGGCCCCTCGGAGACTGGGACGCGGCGGCTCAGTGAGTTGCGAGTGATCGACCTGCGGGCGGAGCTGAAGAAGCGGAATTTGGACACCGGTGGCAACAAGAGTGTCCTGATGGAGCGGCTCAAGAAGGCGGTTAAGGAAGAAGGGCAAGATCCGGATGAAATTGGCATTGAGTTGGAAACCACTAGCAAGAAGACAGCAAAGAGATGTGCTAAAGGGCAAAAGATGGAGGATGAAGGCACAGAAGACAACGGCCTGGAAGAAGATTCTCGAGACGGGCAGGAGGATGTGGACGTGAGCCTGGAGAACCTGCAGGGCATGGGCGTGGTGGGCATGAGCGTGTTAGACGAGGCTGAGGACAGCAGTGCTCCGGACTTCGGGGAGGACGGCGGCGGTGACGACAGCATTCTCGGTCCCTTGTGTGACAGTAAAGAGTACGTGGCTGCACAGCTGGGACAGCTTCCAGCTCGGCTCTCGGAACACGCTGTGGATGGGGAAGACTTTGAGAACCCTTTGGAAGCTTCATCACTGAACTCCAAAGTAACTCCGGATATTGAAGAACCTCTCTTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGCTCCTTTAAGGAAGAAAAAGATATAAAGCCAGTCATTAAAGATGAAAAAGGCCGTGTCAGCAGCAGCTCTGGGCGGAACCTGTGGGTCAGCGGACTGTCTTCTACCACGCGTGCCACCGACCTCAAGAACCTGTTCAGCAAATACGGGAAGGTTGTCGGGGCCAAAGTGGTGACCAATGCCCGCAGTCCTGGGGCCCGGTGCTATGGGTTTGTCACCATGTCGACATCTGAGGAGGCGACCAAGTGCATCAGCCACCTGCACAGAACTGAGCTGCATGGAAGGATGATCTCGGTGGAGAAGGCCAAAAACGAACCTGCTGGGAAGAAACTGTTGGACAGAAAAGAGTGTGAGGTGAAGAAGGAAAAGTTATCCAGTGCTGACAGACATCACCCTGTGGAGGTCAAAATTGAAAAAACTGTAATCAAGAAGGAAGAGAAGACTGAAAAAAAGGAGGAGAAGAGGCCGGAAGATATTAAAATGGAAGAAAAAGACCAAGACGAGCTGAAACCAGGGCCTGCAAACCGGTCCAGAGTCACTAAGTCAGGAAGCAGAGGGACAGAGCGGACGGTGGTGATGGACAAGTCCAAGGGTGAGCCCGTCATCAGTGTCAAGACCACCAGCAGGTCCAAGGAGAGGAGCTCCAAGAGCCAGGATCGCAAATCGGAAAGCAAGGAGAAGAGAGACATCTTGTCATTTGACAAAATCAAAGAGCAGAGGGAGCGAGAGCGGCAGCGGCAGCGGGAGCGGGAGATCCGGGAGACAGAGCGGCGGCGGGAGCGCGAGCAGCGGGAGCGGGAGCAGCGCCTGGAGGCCTTCCATGAACGCAAGGAGAAGGCGCGGCTGCAGCGGGAGCGGGTGCAGCTCGAGTGCCAGCGGCAGCGGCTGGAGCGCGAGCGGCTAGAGCGGGAGCGGCTGGAGCGAGAGCGCATGCGTGTGGAGCGAGAGCGCAGGAAGGAGCAGGAGCGCATCCACCGGGAGCGCGAGGAGCTGCGGCGCCAGCAGGAGCAGCTGCGCTATGAGCAGGAGCGGCGGCCTGCACTGAGGCGGCCCTACGACCTGGACAGGCGAGACGACGCTTACTGGCCGGAAGGAAAGCGAGTGGCCCTGGAGGACAGGTACCGCGCTGACTTCCCCCGGCCTGATCACCGCTTCCACGACTTTGACCACCGAGACCGGGGCCAGTACCAGGACCACAGTGCCGACAGGCTGCTCATTCTGGGGCTTCGCTGTGAGCAGGAACAAGTGTCCCATCTGGGACCCTGGTGTGGCCTGCAGGAGCGTCGGAGCCGCGGCTGTGGCTCCAGTGAGCTCTGTTCCTTTTGCAGGAGGGAAGGGTCCAGGCCAGGAATGGGCGAGCGGGACGGGCAGCACTACTCTGATGACCGCCACGGCCACGGCCACGGCGGCCCCCCTGAGCACCACAGCCGGGACTCCCGCGATGGCTGGGGAGGCTATGCTTCCGACAAGAGGCTGAGTGAAGGCCGAGGGCTGCCCCCACCCCCCAGGGGTGGCCGGGACTGGGCGGAGCACAACCCGCGGCTGGAGGAGCACCCCGTCCGTGCCTGGCAGGGCACCGTGGACGCGGGCGCGGTGGGCCGGGAGCACTCGCGCTGGCCAGGTGCCGAGCGGGGCCTATCTGGGCCCTCGGGGCCAGGGCACGCAGCGAGTCGGGGCGGCCTGGCGGGGCGCGGCGGCTTCGCACAGGGCGCACACTCCCAGGGTCACGCGGTGCCGGGCGGCAGCCTGGAGGGCGGCGGAGTGACCAGCCAGGACCGCGGCAGCAGGGTCCCGCACCCCTACCCGCACTTCACCCGCCGCTACTAG

XM_004865683.1 Coding sequence

Safb2 scaffold attachment factor B2, transcript variant X3

Length: 2967 bp    Location: 4557701..4586300   Strand: +
>XM_004865683.1
ATGGCGGAACCTCTGGCAGGGTCGGGTGACTCGGGCTCTGGCACGGTTGCTCTGGGTTCGGGCCCCTCGGAGACTGGGACGCGGCGGCTCAGTGAGTTGCGAGTGATCGACCTGCGGGCGGAGCTGAAGAAGCGGAATTTGGACACCGGTGGCAACAAGAGTGTCCTGATGGAGCGGCTCAAGAAGGCGGTTAAGGAAGAAGGGCAAGATCCGGATGAAATTGGCATTGAGTTGGAAACCACTAGCAAGAAGACAGCAAAGAGATGTGCTAAAGGGCAAAAGATGGAGGATGAAGGCACAGAAGACAACGGCCTGGAAGAAGATTCTCGAGACGGGCAGGAGGATGTGGACGTGAGCCTGGAGAACCTGCAGGGCATGGGCGTGGTGGGCATGAGCGTGTTAGACGAGGCTGAGGACAGCAGTGCTCCGGACTTCGGGGAGGACGGCGGCGGTGACGACAGCATTCTCGGTCCCTTGTGTGACAGTAAAGAGTACGTGGCTGCACAGCTGGGACAGCTTCCAGCTCGGCTCTCGGAACACGCTGTGGATGGGGAAGACTTTGAGAACCCTTTGGAAGCTTCATCACTGAACTCCAAAGTAACTCCGGATATTGAAGAACCTCTCTTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGCTCCTTTAAGGAAGAAAAAGATATAAAGCCAGTCATTAAAGATGAAAAAGGCCGTGTCAGCAGCAGCTCTGGGCGGAACCTGTGGGTCAGCGGACTGTCTTCTACCACGCGTGCCACCGACCTCAAGAACCTGTTCAGCAAATACGGGAAGGTTGTCGGGGCCAAAGTGGTGACCAATGCCCGCAGTCCTGGGGCCCGGTGCTATGGGTTTGTCACCATGTCGACATCTGAGGAGGCGACCAAGTGCATCAGCCACCTGCACAGAACTGAGCTGCATGGAAGGATGATCTCGGTGGAGAAGGCCAAAAACGAACCTGCTGGGAAGAAACTGTTGGACAGAAAAGAGTGTGAGGTGAAGAAGGAAAAGTTATCCAGTGCTGACAGACATCACCCTGTGGAGGTCAAAATTGAAAAAACTGTAATCAAGAAGGAAGAGAAGACTGAAAAAAAGGAGGAGAAGAGGCCGGAAGATATTAAAATGGAAGAAAAAGACCAAGACGAGCTGAAACCAGGGCCTGCAAACCGGTCCAGAGTCACTAAGTCAGGAAGCAGAGGGACAGAGCGGACGGTGGTGATGGACAAGTCCAAGGGTGAGCCCGTCATCAGTGTCAAGACCACCAGCAGGTCCAAGGAGAGGAGCTCCAAGAGCCAGGATCGCAAATCGGAAAGCAAGGAGAAGAGAGACATCTTGTCATTTGACAAAATCAAAGAGCAGAGGGAGCGAGAGCGGCAGCGGCAGCGGGAGCGGGAGATCCGGGAGACAGAGCGGCGGCGGGAGCGCGAGCAGCGGGAGCGGGAGCAGCGCCTGGAGGCCTTCCATGAACGCAAGGAGAAGGCGCGGCTGCAGCGGGAGCGGGTGCAGCTCGAGTGCCAGCGGCAGCGGCTGGAGCGCGAGCGGCTAGAGCGGGAGCGGCTGGAGCGAGAGCGCATGCGTGTGGAGCGAGAGCGCAGGAAGGAGCAGGAGCGCATCCACCGGGAGCGCGAGGAGCTGCGGCGCCAGCAGGAGCAGCTGCGCTATGAGCAGGAGCGGCGGCCTGCACTGAGGCGGCCCTACGACCTGGACAGGCGAGACGACGCTTACTGGCCGGAAGGAAAGCGAGTGGCCCTGGAGGACAGGTACCGCGCTGACTTCCCCCGGCCTGATCACCGCTTCCACGACTTTGACCACCGAGACCGGGGCCAGTACCAGGACCACAGTGCCGACAGGAGGGAAGGGTCCAGGCCAGGAATGGGCGAGCGGGACGGGCAGCACTACTCTGATGACCGCCACGGCCACGGCCACGGCGGCCCCCCTGAGCACCACAGCCGGGACTCCCGCGATGGCTGGGGAGGCTATGCTTCCGACAAGAGGCTGAGTGAAGGCCGAGGGCTGCCCCCACCCCCCAGGGGTGGCCGGGACTGGGCGGAGCACAACCCGCGGCTGGAGGAGCACCCCGTCCGTGCCTGGCAGGGCACCGTGGACGCGGGCGCGGTGGGCCGGGAGCACTCGCGCTGGCCAGGTACGGTGGCCTGCGGAGGCCGCGCCCCGGGCAGGGGACTGGGCAGGGCTTTGCAAGCCGCTTCTCTTGCAGGTGCCGAGCGGGGCCTATCTGGGCCCTCGGGGCCAGGGCACGCAGCGAGTCGGGGCGGCCTGGCGGGGCGCGGCGGCTTCGCACAGGGCGCACACTCCCAGGGTCACGCGGTGCCGGGCGGCAGCCTGGAGGGCGGCGGAGTGACCAGCCAGGACCGCGGCAGCAGGGTCCCGCACCCCTACCCGCACTTCACCCGCCGCTACTAG

XM_004865684.1 Coding sequence

Safb2 scaffold attachment factor B2, transcript variant X4

Length: 2895 bp    Location: 4557701..4586300   Strand: +
>XM_004865684.1
ATGGCGGAACCTCTGGCAGGGTCGGGTGACTCGGGCTCTGGCACGGTTGCTCTGGGTTCGGGCCCCTCGGAGACTGGGACGCGGCGGCTCAGTGAGTTGCGAGTGATCGACCTGCGGGCGGAGCTGAAGAAGCGGAATTTGGACACCGGTGGCAACAAGAGTGTCCTGATGGAGCGGCTCAAGAAGGCGGTTAAGGAAGAAGGGCAAGATCCGGATGAAATTGGCATTGAGTTGGAAACCACTAGCAAGAAGACAGCAAAGAGATGTGCTAAAGGGCAAAAGATGGAGGATGAAGGCACAGAAGACAACGGCCTGGAAGAAGATTCTCGAGACGGGCAGGAGGATGTGGACGTGAGCCTGGAGAACCTGCAGGGCATGGGCGTGGTGGGCATGAGCGTGTTAGACGAGGCTGAGGACAGCAGTGCTCCGGACTTCGGGGAGGACGGCGGCGGTGACGACAGCATTCTCGGTCCCTTGTGTGACAGTAAAGAGTACGTGGCTGCACAGCTGGGACAGCTTCCAGCTCGGCTCTCGGAACACGCTGTGGATGGGGAAGACTTTGAGAACCCTTTGGAAGCTTCATCACTGAACTCCAAAGTAACTCCGGATATTGAAGAACCTCTCTTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGCTCCTTTAAGGAAGAAAAAGATATAAAGCCAGTCATTAAAGATGAAAAAGGCCGTGTCAGCAGCAGCTCTGGGCGGAACCTGTGGGTCAGCGGACTGTCTTCTACCACGCGTGCCACCGACCTCAAGAACCTGTTCAGCAAATACGGGAAGGTTGTCGGGGCCAAAGTGGTGACCAATGCCCGCAGTCCTGGGGCCCGGTGCTATGGGTTTGTCACCATGTCGACATCTGAGGAGGCGACCAAGTGCATCAGCCACCTGCACAGAACTGAGCTGCATGGAAGGATGATCTCGGTGGAGAAGGCCAAAAACGAACCTGCTGGGAAGAAACTGTTGGACAGAAAAGAGTGTGAGGTGAAGAAGGAAAAGTTATCCAGTGCTGACAGACATCACCCTGTGGAGGTCAAAATTGAAAAAACTGTAATCAAGAAGGAAGAGAAGACTGAAAAAAAGGAGGAGAAGAGGCCGGAAGATATTAAAATGGAAGAAAAAGACCAAGACGAGCTGAAACCAGGGCCTGCAAACCGGTCCAGAGTCACTAAGTCAGGAAGCAGAGGGACAGAGCGGACGGTGGTGATGGACAAGTCCAAGGGTGAGCCCGTCATCAGTGTCAAGACCACCAGCAGGTCCAAGGAGAGGAGCTCCAAGAGCCAGGATCGCAAATCGGAAAGCAAGGAGAAGAGAGACATCTTGTCATTTGACAAAATCAAAGAGCAGAGGGAGCGAGAGCGGCAGCGGCAGCGGGAGCGGGAGATCCGGGAGACAGAGCGGCGGCGGGAGCGCGAGCAGCGGGAGCGGGAGCAGCGCCTGGAGGCCTTCCATGAACGCAAGGAGAAGGCGCGGCTGCAGCGGGAGCGGGTGCAGCTCGAGTGCCAGCGGCAGCGGCTGGAGCGCGAGCGGCTAGAGCGGGAGCGGCTGGAGCGAGAGCGCATGCGTGTGGAGCGAGAGCGCAGGAAGGAGCAGGAGCGCATCCACCGGGAGCGCGAGGAGCTGCGGCGCCAGCAGGAGCAGCTGCGCTATGAGCAGGAGCGGCGGCCTGCACTGAGGCGGCCCTACGACCTGGACAGGCGAGACGACGCTTACTGGCCGGAAGGAAAGCGAGTGGCCCTGGAGGACAGGTACCGCGCTGACTTCCCCCGGCCTGATCACCGCTTCCACGACTTTGACCACCGAGACCGGGGCCAGTACCAGGACCACAGTGCCGACAGGAGGGAAGGGTCCAGGCCAGGAATGGGCGAGCGGGACGGGCAGCACTACTCTGATGACCGCCACGGCCACGGCCACGGCGGCCCCCCTGAGCACCACAGCCGGGACTCCCGCGATGGCTGGGGAGGCTATGCTTCCGACAAGAGGCTGAGTGAAGGCCGAGGGCTGCCCCCACCCCCCAGGGGTGGCCGGGACTGGGCGGAGCACAACCCGCGGCTGGAGGAGCACCCCGTCCGTGCCTGGCAGGGCACCGTGGACGCGGGCGCGGTGGGCCGGGAGCACTCGCGCTGGCCAGGTGCCGAGCGGGGCCTATCTGGGCCCTCGGGGCCAGGGCACGCAGCGAGTCGGGGCGGCCTGGCGGGGCGCGGCGGCTTCGCACAGGGCGCACACTCCCAGGGTCACGCGGTGCCGGGCGGCAGCCTGGAGGGCGGCGGAGTGACCAGCCAGGACCGCGGCAGCAGGGTCCCGCACCCCTACCCGCACTTCACCCGCCGCTACTAG

XM_004865685.1 Coding sequence

Safb2 scaffold attachment factor B2, transcript variant X5

High confidence: 4 potential gene matches
Length: 2868 bp    Location: 4557701..4586300   Strand: +
>XM_004865685.1
ATGGCGGAACCTCTGGCAGGGTCGGGTGACTCGGGCTCTGGCACGGTTGCTCTGGGTTCGGGCCCCTCGGAGACTGGGACGCGGCGGCTCAGTGAGTTGCGAGTGATCGACCTGCGGGCGGAGCTGAAGAAGCGGAATTTGGACACCGGTGGCAACAAGAGTGTCCTGATGGAGCGGCTCAAGAAGGCGGTTAAGGAAGAAGGGCAAGATCCGGATGAAATTGGCATTGAGTTGGAAACCACTAGCAAGAAGACAGCAAAGAGATGTGCTAAAGGGCAAAAGATGGAGGATGAAGGCACAGAAGACAACGGCCTGGAAGAAGATTCTCGAGACGGGCAGGAGGATGTGGACGTGAGCCTGGAGAACCTGCAGGGCATGGGCGTGGTGGGCATGAGCGTGTTAGACGAGGCTGAGGACAGCAGTGCTCCGGACTTCGGGGAGGACGGCGGCGGTGACGACAGCATTCTCGGTCCCTTGTGTGACAGTAAAGAGTACGTGGCTGCACAGCTGGGACAGCTTCCAGCTCGGCTCTCGGAACACGCTGTGGATGGGGAAGACTTTGAGAACCCTTTGGAAGCTTCATCACTGAACTCCAAAGTAACTCCGGATATTGAAGAACCTCTCTTGGAGCCAGAAAATGAGAAAATACTCGACATTTTGGGGGAAACTTGTAAATCTGAGCCAGTAAAAGAAGAAGGTTCCGAGCTGGAGCAGCCATTTGCACAGGATACAAGTAGCGTGGGGCCAGACAGGAAGCTGGCGGAGGAAGAGGACCTTTTTGGCAGCGCCCACCCGGAAGAGGAAGAGGAGGAAGAGCAGGAGGAAGAGGAAGAAGAGGAGGAGGAGGAGGGAGATTTAGATTTGGCCAGCGAGTCAACGCGCGCTCAGTGGAGCGAGGCAGACACCCTGTTAGCGGTAGTGAAAAGGGAGCCCGTGGAGCAGACAGGCGAAGGCGCGAGGACGGACTGTGAGCCTGTAGGGCTAGAGAAGCCAGTTGAGCAGAGTAGCGCGGCCTCCGAGCTGCCGGAGGCCTCTAGCCAGGAGCTGGCAGAAGCGCCCACGGAAGCCCCGAGCCCGGAGCCCCGAGATAGCAAGGAAGACGTGAAGAAGTTTGAGTTTGACGCTTGTAATGAAGTCCCTCCGGCTCCTAAAGAGTCCTCAACCAGTGAGGGCGCTGATCAGAAAATGAGCTCCTTTAAGGAAGAAAAAGATATAAAGCCAGTCATTAAAGATGAAAAAGGCCGTGTCAGCAGCAGCTCTGGGCGGAACCTGTGGGTCAGCGGACTGTCTTCTACCACGCGTGCCACCGACCTCAAGAACCTGTTCAGCAAATACGGGAAGGTTGTCGGGGCCAAAGTGGTGACCAATGCCCGCAGTCCTGGGGCCCGGTGCTATGGGTTTGTCACCATGTCGACATCTGAGGAGGCGACCAAGTGCATCAGCCACCTGCACAGAACTGAGCTGCATGGAAGGATGATCTCGGTGGAGAAGGCCAAAAACGAACCTGCTGGGAAGAAACTGTTGGACAGAAAAGAGTGTGAGGTGAAGAAGGAAAAGTTATCCAGTGCTGACAGACATCACCCTGTGGAGAAGGAAGAGAAGACTGAAAAAAAGGAGGAGAAGAGGCCGGAAGATATTAAAATGGAAGAAAAAGACCAAGACGAGCTGAAACCAGGGCCTGCAAACCGGTCCAGAGTCACTAAGTCAGGAAGCAGAGGGACAGAGCGGACGGTGGTGATGGACAAGTCCAAGGGTGAGCCCGTCATCAGTGTCAAGACCACCAGCAGGTCCAAGGAGAGGAGCTCCAAGAGCCAGGATCGCAAATCGGAAAGCAAGGAGAAGAGAGACATCTTGTCATTTGACAAAATCAAAGAGCAGAGGGAGCGAGAGCGGCAGCGGCAGCGGGAGCGGGAGATCCGGGAGACAGAGCGGCGGCGGGAGCGCGAGCAGCGGGAGCGGGAGCAGCGCCTGGAGGCCTTCCATGAACGCAAGGAGAAGGCGCGGCTGCAGCGGGAGCGGGTGCAGCTCGAGTGCCAGCGGCAGCGGCTGGAGCGCGAGCGGCTAGAGCGGGAGCGGCTGGAGCGAGAGCGCATGCGTGTGGAGCGAGAGCGCAGGAAGGAGCAGGAGCGCATCCACCGGGAGCGCGAGGAGCTGCGGCGCCAGCAGGAGCAGCTGCGCTATGAGCAGGAGCGGCGGCCTGCACTGAGGCGGCCCTACGACCTGGACAGGCGAGACGACGCTTACTGGCCGGAAGGAAAGCGAGTGGCCCTGGAGGACAGGTACCGCGCTGACTTCCCCCGGCCTGATCACCGCTTCCACGACTTTGACCACCGAGACCGGGGCCAGTACCAGGACCACAGTGCCGACAGGAGGGAAGGGTCCAGGCCAGGAATGGGCGAGCGGGACGGGCAGCACTACTCTGATGACCGCCACGGCCACGGCCACGGCGGCCCCCCTGAGCACCACAGCCGGGACTCCCGCGATGGCTGGGGAGGCTATGCTTCCGACAAGAGGCTGAGTGAAGGCCGAGGGCTGCCCCCACCCCCCAGGGGTGGCCGGGACTGGGCGGAGCACAACCCGCGGCTGGAGGAGCACCCCGTCCGTGCCTGGCAGGGCACCGTGGACGCGGGCGCGGTGGGCCGGGAGCACTCGCGCTGGCCAGGTGCCGAGCGGGGCCTATCTGGGCCCTCGGGGCCAGGGCACGCAGCGAGTCGGGGCGGCCTGGCGGGGCGCGGCGGCTTCGCACAGGGCGCACACTCCCAGGGTCACGCGGTGCCGGGCGGCAGCCTGGAGGGCGGCGGAGTGACCAGCCAGGACCGCGGCAGCAGGGTCCCGCACCCCTACCCGCACTTCACCCGCCGCTACTAG

XM_004865712.1 Coding sequence

Uhrf1 ubiquitin-like with PHD and ring finger domains 1, transcript variant X3

High confidence: 3 potential gene matches
Length: 2370 bp    Location: 4929077..4898841   Strand: -
>XM_004865712.1
ATGTGGGTCCAGGTGCGGACCATGGATGGCAAGGAGACTCACACCGTGGACTCGCTGTCCAGGCTGACCAAGGTAGAAGAACTGAGGCGGAAGATTCAGGAGCTATTTCACGTGGAACCCGGTTTGCAGAGGCTCTTTTACAGGGGCAAGCAGATGGAGGACGGCCACACGCTGTTTGATTATGATGTGCGCCTCAATGACACCATCCAGCTGCTGGTGCGCCAGAGCTTGGTGCTCCCATCCAGCCAGGAGAGGGACTCAGAGCTCTCAGACACGGACTCGGGCTGCTGCCTGGGCCAGAGTGAGTCGGACAAGTCATCCACACATGGCGAGGGGGCTGCCGACGCAGATAGCAAGGCTGGCCTGGCAGACAAGGATGTGGCTGAGACTGAGCAGGGGCTCTATAAGGTGAACGAGTACGTGGACGCACGGGACACAAACATGGGTGCGTGGTTCGAGGCGCAGGTGGTTGGGGTGCTTCGGAAGGTGAGGATGGCTGAGGACAAGCCCTGCAGCTCCACCACCAGCCCAACACCCGAGGAGAATGTCATCTACCGCGTGAAATACGATGACTACCCCGAGAACGGCGTGGTCACCATGCAGTCCCACAATGTGCGTGCACGGGCCCGCACCATCCTCAAGTGGCACGAGCTGGAGGTGGGCCAGGTGGTCATGCTCAACTACAACTCCGACCACCCCAGGGAGCGCGGCTTCTGGTACGACGCCGAGATCTGCAGGAAGCGTGAGACGCGCACGGGGCGGGAGCTCTACGCGAACATCAGGCTCGGGGACCATTCCCTCCACAACTGTCGCATCGTCTTCATGGACGAGGTATTCAAGATTGAGCGCCCAGGCGAGGCCCCCCCCGTGGTTGAGAACCCCATGAGACGCAAGAGTGGCCCGAGCTGCAAGTACTGCAAGGACGACCCCAACAAGCTGTGCCGCATATGCGCCTGCCACCGGTGCGGGGGCCGGGAGGCACCCGACAAGCAGCTGATGTGTGACGAGTGCGACATGGCGTACCACCTGTACTGCCTGGACCCGCCGCTCAGCAGTGTGCCGCCGCCCGAGGAGGACTGGTACTGCCCCGATTGCCGGAACGAGCCCAGCGAGGTGGTGCTGGCTGGGCAAAGGCTGCGAGAGAGCAAGAAGAAGGCGAAGATGGCGTCGGCCACGTCATCCTCTCAGCGGGACTGGGGAAAGGGCATGGCGTGCGTGGGGCGCACGAAGGAGTGCACTATTGTCCCGTCCAACCACTATGGACCCATCCCAGGCATCCCTGTGGGGACCATGTGGCGGTTCCGCGTGCAGGTCAGTGAGTCCGGTGTCCATCGGCCTCACGTTGCAGGCATCCATGGGCGGAGCAATGATGGGGCCTACTCCTTGGTCCTGGCTGGGGGCTATGAGGACGATGAGGACAATGGGAATTCTTTCACCTACACAGGTAGTGGTGGCCGAGATCTTTCTGGCAACAAGCGGACTGCTGGGCAGTCATCTGACCAGAAACTCACCAATACCAACAGGGCGCTGGCTCTCAACTGCTACGCCCCCATCAACGACAAGAAGGGCGCAGAGTCCAAGGAATGGCGCTCGGGGAAGCCAGTGCGGGTCGTGCGAAACATGAAGGGCGGCAAGCACAGCAAGTACGCACCTGCGGAGGGCAACCGCTATGATGGGATCTATAAGGTCGTGAAGTACTGGCCTGAGAAGGGCAAGTCTGGCTTTCTCGTGTGGCGCTACCTCCTGCGCAGGGATGACGTGGAACCTGGGCCCTGGACCAAGGAAGGGAAGGACCGCACCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAGGGTTACTTGGAAGCCCTGGCCAACCGGGACAAGGAGAACAAGAGGGCGGCCGAGGAGCAGGAAGACCTGTCGCCCTCCAAGAAGGGCAAGTGGAAGCGGAAGTCAGCAGGTGCATGTCTCGCCCGCCAGAGTGGGTCTCAGCCTCAGACCACCAAGAAGACCAAGCTGGAGCCCTACAGACTCACGGCTGAGCAGAGCAACCTCATCAAGGCGGATGAGAGCAACACGAAGCTGTGGACCGAGGTCCTCACGGCGCTCAGAGAAGGCTTGTCTGTTGGGGGTCCTTTCCAGGTGTTCCTGAGCAAGGTGGAGGAGACGTTCCAGTGCATCTGCTGCCAGGAGCTGGTGTTCCAGCCTGTCACCACTGTGTGCCAGCACAACGTGTGCAAGGACTGCCTGGACAGGTCATTCCGTGCCCAGGTCTTCAGCTGCCCGGCCTGCCGCTATGACCTGGGCCGTGGCTACGCCATGCAGGTGAACACGGCACTCCAGACCATCCTCAGCCATTTCTTTCCCGGCTATGGCAGCGGCCGGTGA

XM_004865693.1 Coding sequence

LOC101715435 zinc/RING finger protein 4-like

Length: 1080 bp    Location: 4634020..4635330   Strand: +
>XM_004865693.1
ATGTGGCGGGCGTGGTTGGCCTGCGCGGCGCTCACCGCCGGGCTGGCGCTATCCCTGCTGCTGTCCCCGTCGTGGGCCGTGGTGCGGGCCGTGCTGGACGGCAACGCCAGCTCGGTGGACTTCGCGGCCCTGCCGGCGCTGTTCGGGGTCCCCCTGTCCCCCAAGGGCATGCGGGGCTACCTGACAGAGGCCAGGCCAGCCAACGCGTGCCAGCCCATCCAGGGCCCGCGGGCCAGGGGCAAAGGCTCGCTGGGCGCCATCGCGCTCATCCAGCGCTACGACTGCACCTTCGAGCTGAAGGTGCTGCACGCGCAGCGCGCCGGCTTCGAGGCGGCCATCGTGCACAACGTGCGCTCCGAAGAGCTGGTGCGCATGGCGCCGGGCTTCGAGGACCTGTGGCGCCAGATCGCCATCCCCGCCGTGTTCGTGGGCGAGGCCGCCTCCCGAGACCTGCGCGTCCTGCTGCGCTGCGACCCGGCTGCCCACGTGCTGCTGCTGCCCGAGGCCGCGCTGCGCCAAGTCCCGCTCTGCCGCCCCGCGCTGGCCCCGGCCTGGACGCTGGGCCGTGGCCTGGCCTCGGTGGCCGTCGCCCTCCTGGTCCTGCCGCGCCTGGGGCCCTGGGCGCGCGCCTGGTGGGGCCGGGCGCCGTCGGTGAAGACGCAGACGCGGCAGAAGGCGGAGGTGAGGGTCTACGCCCGCCGCAGCGACCTGTGCGCCATCTGCCTGGACGAGTACGAGGACGGGGATCAGCTCAAGATCCTGCCCTGCGCCCACGCCTACCACTGCGCCTGCCTCGACCCCTGGCTGGCCCAGGGCACCCGCCGCGGTTGTCCCCTGTGCAAGCGGCCGGTGGCCAGCTCCGAGGACGGCTCCGACTCGGCCACGGAGAGCCAGGCCGACGAGGGCCCGCGCGCCCCGATCTGGGCCGTCCAGGAGGGGCTACGACCCCCGGCGCCCAGGCTGCTGGTCAGGACCTCCCTGCGTCGCTCCTACAGCTTCATGTCCCCTCCGGGACCCGGGGACCCTCCTGGTGTCCATGCCTGCCGGCGGGAGGGGACCCAGGGCACAGAGGGGCACTGA

XM_004865698.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X5

Length: 5847 bp    Location: 4688564..4764185   Strand: +
>XM_004865698.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGAAACCTTTGAAAGCACTCCAATCCGAGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGAGCTTCGAGAAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCAAGCCGTCAGCCCCCCCTCAAGACGTTAAGTGTACCAGCATGCGCTCCACGGCCATTCTGGTAAGTTGGCGCCCGCCACCGCCGGACACGCACAACGGGGCCCTAGTGGGCTACAGCGTCCGCTACCGACCGCTGGGCTCAGACGACCCGGAACCCAAGGAGGTGAATGGCATCCCCCCGACCACCACTCAGATCCTCCTGGAAGCCCTGGAGAAGTGGACTGAATACCGTATCACTGCCATCGCACACACAGAGGTGGGGCCAGGGCCCGAGAGCTCGCCCGTGGTCATCCGCACCGAGGAGGACGTGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTGGCGCTCGCCCGCGCCCGGCCGGCACCACGGTCAGATCCGCGGCTACCAGGTCCACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGATGTGATGCTGGCCGATGCCCAGTGGGAGATGGACGACACTGCCGAATATGAAATGGTCATCACAAACCTCGAGCCTGAGACCGCGTACTCCATCACAGTAGCTGCCTATACTATGAAAGGCGACGGCGCTCGCAGCAAACCCAAGGTGGTGGTGACCAAGGGAGCAGTGCTGGGCCGCCCCACCCTCACGGTGCAGCAGACCTCAGAGGGCAGCCTCCTGGCGCGCTGGGAGCCGCCGCCCGGCGTCCCTGCCGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTCGGCCGCGAGGACGCAATGCCACTGGCCACACTGGAGTTCCCGGCCTCCAAGGACCACTACACAGCAGCAGGCGTGCACAAGGGGGCCACCTATGTGTTCCGGCTGGCAGCGCGCAGCCGAGGCGGCCTGGGCGAGGAGGCGGCCCAGGTCCTGAGCATCCCCGAGGATACGCCCCGTGGCCATCCACAGATCCTGGAGGCAGCCGGCAACGCCTCGGCCGGCACCGTCCTGCTCCGCTGGCTGCCACCTGTGCCTGCTGAGCGCAACGGGGCCATCGTCAAGTACACGGTGGCCGTGCGGGAGGCCGGCACCTTGGGGCCTCCCCGAGAGACAGAGCTGCCCGCGGCGGTGGAGCCTGGGGCTGAGAATGCGCTCACGCTTCGGGGCCTCAAGCCTGACACGGCCTATGACCTGCAAGTGCGAGCCCACACACGCCGGGGCCCCGGCCCCTACAGCCCCCCTGTCCGCTACCGCACGTTCCTGCGGGACCAAGTCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGACCCGGGCCTCAGCAGCCCCCTCAGGGAGCCGGGGTTTCACTCGGAAAGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865694.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X1

Length: 5820 bp    Location: 4688565..4764185   Strand: +
>XM_004865694.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGAGCTTCGAGAAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCAAGCCGTCAGCCCCCCCTCAAGACGTTAAGTGTACCAGCATGCGCTCCACGGCCATTCTGGTAAGTTGGCGCCCGCCACCGCCGGACACGCACAACGGGGCCCTAGTGGGCTACAGCGTCCGCTACCGACCGCTGGGCTCAGACGACCCGGAACCCAAGGAGGTGAATGGCATCCCCCCGACCACCACTCAGATCCTCCTGGAAGCCCTGGAGAAGTGGACTGAATACCGTATCACTGCCATCGCACACACAGAGGTGGGGCCAGGGCCCGAGAGCTCGCCCGTGGTCATCCGCACCGAGGAGGACGTGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTGGCGCTCGCCCGCGCCCGGCCGGCACCACGGTCAGATCCGCGGCTACCAGGTCCACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGATGTGATGCTGGCCGATGCCCAGTGGGAGATGGACGACACTGCCGAATATGAAATGGTCATCACAAACCTCGAGCCTGAGACCGCGTACTCCATCACAGTAGCTGCCTATACTATGAAAGGCGACGGCGCTCGCAGCAAACCCAAGGTGGTGGTGACCAAGGGAGCAGTGCTGGGCCGCCCCACCCTCACGGTGCAGCAGACCTCAGAGGGCAGCCTCCTGGCGCGCTGGGAGCCGCCGCCCGGCGTCCCTGCCGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTCGGCCGCGAGGACGCAATGCCACTGGCCACACTGGAGTTCCCGGCCTCCAAGGACCACTACACAGCAGCAGGCGTGCACAAGGGGGCCACCTATGTGTTCCGGCTGGCAGCGCGCAGCCGAGGCGGCCTGGGCGAGGAGGCGGCCCAGGTCCTGAGCATCCCCGAGGATACGCCCCGTGGCCATCCACAGATCCTGGAGGCAGCCGGCAACGCCTCGGCCGGCACCGTCCTGCTCCGCTGGCTGCCACCTGTGCCTGCTGAGCGCAACGGGGCCATCGTCAAGTACACGGTGGCCGTGCGGGAGGCCGGCACCTTGGGGCCTCCCCGAGAGACAGAGCTGCCCGCGGCGGTGGAGCCTGGGGCTGAGAATGCGCTCACGCTTCGGGGCCTCAAGCCTGACACGGCCTATGACCTGCAAGTGCGAGCCCACACACGCCGGGGCCCCGGCCCCTACAGCCCCCCTGTCCGCTACCGCACGTTCCTGCGGGACCAAGTCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGACCCGGGCCTCAGCAGCCCCCTCAGGGAGCCGGGGTTTCACTCGGAAAGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865700.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X7

High confidence: 4 potential gene matches
Length: 5772 bp    Location: 4688565..4764185   Strand: +
>XM_004865700.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGAGCTTCGAGAAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCAAGCCGTCAGCCCCCCCTCAAGACGTTAAGTGTACCAGCATGCGCTCCACGGCCATTCTGGTAAGTTGGCGCCCGCCACCGCCGGACACGCACAACGGGGCCCTAGTGGGCTACAGCGTCCGCTACCGACCGCTGGGCTCAGACGACCCGGAACCCAAGGAGGTGAATGGCATCCCCCCGACCACCACTCAGATCCTCCTGGAAGCCCTGGAGAAGTGGACTGAATACCGTATCACTGCCATCGCACACACAGAGGTGGGGCCAGGGCCCGAGAGCTCGCCCGTGGTCATCCGCACCGAGGAGGACGTGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTGGCGCTCGCCCGCGCCCGGCCGGCACCACGGTCAGATCCGCGGCTACCAGGTCCACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGATGTGATGCTGGCCGATGCCCAGTGGGAGATGGACGACACTGCCGAATATGAAATGGTCATCACAAACCTCGAGCCTGAGACCGCGTACTCCATCACAGTAGCTGCCTATACTATGAAAGGCGACGGCGCTCGCAGCAAACCCAAGGTGGTGGTGACCAAGGGAGCAGTGCTGGGCCGCCCCACCCTCACGGTGCAGCAGACCTCAGAGGGCAGCCTCCTGGCGCGCTGGGAGCCGCCGCCCGGCGTCCCTGCCGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTCGGCCGCGAGGACGCAATGCCACTGGCCACACTGGAGTTCCCGGCCTCCAAGGACCACTACACAGCAGCAGGCGTGCACAAGGGGGCCACCTATGTGTTCCGGCTGGCAGCGCGCAGCCGAGGCGGCCTGGGCGAGGAGGCGGCCCAGGTCCTGAGCATCCCCGAGGATACGCCCCGTGGCCATCCACAGATCCTGGAGGCAGCCGGCAACGCCTCGGCCGGCACCGTCCTGCTCCGCTGGCTGCCACCTGTGCCTGCTGAGCGCAACGGGGCCATCGTCAAGTACACGGTGGCCGTGCGGGAGGCCGGCACCTTGGGGCCTCCCCGAGAGACAGAGCTGCCCGCGGCGGTGGAGCCTGGGGCTGAGAATGCGCTCACGCTTCGGGGCCTCAAGCCTGACACGGCCTATGACCTGCAAGTGCGAGCCCACACACGCCGGGGCCCCGGCCCCTACAGCCCCCCTGTCCGCTACCGCACGTTCCTGCGGGACCAAGTCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865697.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X4

Length: 5793 bp    Location: 4688565..4764185   Strand: +
>XM_004865697.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGAGCTTCGAGAAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCAAGCCGTCAGCCCCCCCTCAAGACGTTAAGTGTACCAGCATGCGCTCCACGGCCATTCTGGTAAGTTGGCGCCCGCCACCGCCGGACACGCACAACGGGGCCCTAGTGGGCTACAGCGTCCGCTACCGACCGCTGGGCTCAGACGACCCGGAACCCAAGGAGGTGAATGGCATCCCCCCGACCACCACTCAGATCCTCCTGGAAGCCCTGGAGAAGTGGACTGAATACCGTATCACTGCCATCGCACACACAGAGGTGGGGCCAGGGCCCGAGAGCTCGCCCGTGGTCATCCGCACCGAGGAGGACGTGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTGGCGCTCGCCCGCGCCCGGCCGGCACCACGGTCAGATCCGCGGCTACCAGGTCCACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGATGTGATGCTGGCCGATGCCCAGGAAATGGTCATCACAAACCTCGAGCCTGAGACCGCGTACTCCATCACAGTAGCTGCCTATACTATGAAAGGCGACGGCGCTCGCAGCAAACCCAAGGTGGTGGTGACCAAGGGAGCAGTGCTGGGCCGCCCCACCCTCACGGTGCAGCAGACCTCAGAGGGCAGCCTCCTGGCGCGCTGGGAGCCGCCGCCCGGCGTCCCTGCCGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTCGGCCGCGAGGACGCAATGCCACTGGCCACACTGGAGTTCCCGGCCTCCAAGGACCACTACACAGCAGCAGGCGTGCACAAGGGGGCCACCTATGTGTTCCGGCTGGCAGCGCGCAGCCGAGGCGGCCTGGGCGAGGAGGCGGCCCAGGTCCTGAGCATCCCCGAGGATACGCCCCGTGGCCATCCACAGATCCTGGAGGCAGCCGGCAACGCCTCGGCCGGCACCGTCCTGCTCCGCTGGCTGCCACCTGTGCCTGCTGAGCGCAACGGGGCCATCGTCAAGTACACGGTGGCCGTGCGGGAGGCCGGCACCTTGGGGCCTCCCCGAGAGACAGAGCTGCCCGCGGCGGTGGAGCCTGGGGCTGAGAATGCGCTCACGCTTCGGGGCCTCAAGCCTGACACGGCCTATGACCTGCAAGTGCGAGCCCACACACGCCGGGGCCCCGGCCCCTACAGCCCCCCTGTCCGCTACCGCACGTTCCTGCGGGACCAAGTCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGACCCGGGCCTCAGCAGCCCCCTCAGGGAGCCGGGGTTTCACTCGGAAAGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865696.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X3

Length: 5808 bp    Location: 4688565..4764185   Strand: +
>XM_004865696.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCAAGCCGTCAGCCCCCCCTCAAGACGTTAAGTGTACCAGCATGCGCTCCACGGCCATTCTGGTAAGTTGGCGCCCGCCACCGCCGGACACGCACAACGGGGCCCTAGTGGGCTACAGCGTCCGCTACCGACCGCTGGGCTCAGACGACCCGGAACCCAAGGAGGTGAATGGCATCCCCCCGACCACCACTCAGATCCTCCTGGAAGCCCTGGAGAAGTGGACTGAATACCGTATCACTGCCATCGCACACACAGAGGTGGGGCCAGGGCCCGAGAGCTCGCCCGTGGTCATCCGCACCGAGGAGGACGTGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTGGCGCTCGCCCGCGCCCGGCCGGCACCACGGTCAGATCCGCGGCTACCAGGTCCACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGATGTGATGCTGGCCGATGCCCAGTGGGAGATGGACGACACTGCCGAATATGAAATGGTCATCACAAACCTCGAGCCTGAGACCGCGTACTCCATCACAGTAGCTGCCTATACTATGAAAGGCGACGGCGCTCGCAGCAAACCCAAGGTGGTGGTGACCAAGGGAGCAGTGCTGGGCCGCCCCACCCTCACGGTGCAGCAGACCTCAGAGGGCAGCCTCCTGGCGCGCTGGGAGCCGCCGCCCGGCGTCCCTGCCGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTCGGCCGCGAGGACGCAATGCCACTGGCCACACTGGAGTTCCCGGCCTCCAAGGACCACTACACAGCAGCAGGCGTGCACAAGGGGGCCACCTATGTGTTCCGGCTGGCAGCGCGCAGCCGAGGCGGCCTGGGCGAGGAGGCGGCCCAGGTCCTGAGCATCCCCGAGGATACGCCCCGTGGCCATCCACAGATCCTGGAGGCAGCCGGCAACGCCTCGGCCGGCACCGTCCTGCTCCGCTGGCTGCCACCTGTGCCTGCTGAGCGCAACGGGGCCATCGTCAAGTACACGGTGGCCGTGCGGGAGGCCGGCACCTTGGGGCCTCCCCGAGAGACAGAGCTGCCCGCGGCGGTGGAGCCTGGGGCTGAGAATGCGCTCACGCTTCGGGGCCTCAAGCCTGACACGGCCTATGACCTGCAAGTGCGAGCCCACACACGCCGGGGCCCCGGCCCCTACAGCCCCCCTGTCCGCTACCGCACGTTCCTGCGGGACCAAGTCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGACCCGGGCCTCAGCAGCCCCCTCAGGGAGCCGGGGTTTCACTCGGAAAGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865699.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X6

Length: 5781 bp    Location: 4688565..4764185   Strand: +
>XM_004865699.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCAAGCCGTCAGCCCCCCCTCAAGACGTTAAGTGTACCAGCATGCGCTCCACGGCCATTCTGGTAAGTTGGCGCCCGCCACCGCCGGACACGCACAACGGGGCCCTAGTGGGCTACAGCGTCCGCTACCGACCGCTGGGCTCAGACGACCCGGAACCCAAGGAGGTGAATGGCATCCCCCCGACCACCACTCAGATCCTCCTGGAAGCCCTGGAGAAGTGGACTGAATACCGTATCACTGCCATCGCACACACAGAGGTGGGGCCAGGGCCCGAGAGCTCGCCCGTGGTCATCCGCACCGAGGAGGACGTGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTGGCGCTCGCCCGCGCCCGGCCGGCACCACGGTCAGATCCGCGGCTACCAGGTCCACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGATGTGATGCTGGCCGATGCCCAGGAAATGGTCATCACAAACCTCGAGCCTGAGACCGCGTACTCCATCACAGTAGCTGCCTATACTATGAAAGGCGACGGCGCTCGCAGCAAACCCAAGGTGGTGGTGACCAAGGGAGCAGTGCTGGGCCGCCCCACCCTCACGGTGCAGCAGACCTCAGAGGGCAGCCTCCTGGCGCGCTGGGAGCCGCCGCCCGGCGTCCCTGCCGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTCGGCCGCGAGGACGCAATGCCACTGGCCACACTGGAGTTCCCGGCCTCCAAGGACCACTACACAGCAGCAGGCGTGCACAAGGGGGCCACCTATGTGTTCCGGCTGGCAGCGCGCAGCCGAGGCGGCCTGGGCGAGGAGGCGGCCCAGGTCCTGAGCATCCCCGAGGATACGCCCCGTGGCCATCCACAGATCCTGGAGGCAGCCGGCAACGCCTCGGCCGGCACCGTCCTGCTCCGCTGGCTGCCACCTGTGCCTGCTGAGCGCAACGGGGCCATCGTCAAGTACACGGTGGCCGTGCGGGAGGCCGGCACCTTGGGGCCTCCCCGAGAGACAGAGCTGCCCGCGGCGGTGGAGCCTGGGGCTGAGAATGCGCTCACGCTTCGGGGCCTCAAGCCTGACACGGCCTATGACCTGCAAGTGCGAGCCCACACACGCCGGGGCCCCGGCCCCTACAGCCCCCCTGTCCGCTACCGCACGTTCCTGCGGGACCAAGTCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGACCCGGGCCTCAGCAGCCCCCTCAGGGAGCCGGGGTTTCACTCGGAAAGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865703.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X10

Length: 4515 bp    Location: 4688570..4764184   Strand: +
>XM_004865703.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGAGCTTCGAGAAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCATCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865695.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X2

Length: 5820 bp    Location: 4711709..4764185   Strand: +
>XM_004865695.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGAGCTTCGAGAAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCAAGCCGTCAGCCCCCCCTCAAGACGTTAAGTGTACCAGCATGCGCTCCACGGCCATTCTGGTAAGTTGGCGCCCGCCACCGCCGGACACGCACAACGGGGCCCTAGTGGGCTACAGCGTCCGCTACCGACCGCTGGGCTCAGACGACCCGGAACCCAAGGAGGTGAATGGCATCCCCCCGACCACCACTCAGATCCTCCTGGAAGCCCTGGAGAAGTGGACTGAATACCGTATCACTGCCATCGCACACACAGAGGTGGGGCCAGGGCCCGAGAGCTCGCCCGTGGTCATCCGCACCGAGGAGGACGTGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTGGCGCTCGCCCGCGCCCGGCCGGCACCACGGTCAGATCCGCGGCTACCAGGTCCACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGATGTGATGCTGGCCGATGCCCAGTGGGAGATGGACGACACTGCCGAATATGAAATGGTCATCACAAACCTCGAGCCTGAGACCGCGTACTCCATCACAGTAGCTGCCTATACTATGAAAGGCGACGGCGCTCGCAGCAAACCCAAGGTGGTGGTGACCAAGGGAGCAGTGCTGGGCCGCCCCACCCTCACGGTGCAGCAGACCTCAGAGGGCAGCCTCCTGGCGCGCTGGGAGCCGCCGCCCGGCGTCCCTGCCGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTCGGCCGCGAGGACGCAATGCCACTGGCCACACTGGAGTTCCCGGCCTCCAAGGACCACTACACAGCAGCAGGCGTGCACAAGGGGGCCACCTATGTGTTCCGGCTGGCAGCGCGCAGCCGAGGCGGCCTGGGCGAGGAGGCGGCCCAGGTCCTGAGCATCCCCGAGGATACGCCCCGTGGCCATCCACAGATCCTGGAGGCAGCCGGCAACGCCTCGGCCGGCACCGTCCTGCTCCGCTGGCTGCCACCTGTGCCTGCTGAGCGCAACGGGGCCATCGTCAAGTACACGGTGGCCGTGCGGGAGGCCGGCACCTTGGGGCCTCCCCGAGAGACAGAGCTGCCCGCGGCGGTGGAGCCTGGGGCTGAGAATGCGCTCACGCTTCGGGGCCTCAAGCCTGACACGGCCTATGACCTGCAAGTGCGAGCCCACACACGCCGGGGCCCCGGCCCCTACAGCCCCCCTGTCCGCTACCGCACGTTCCTGCGGGACCAAGTCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGACCCGGGCCTCAGCAGCCCCCTCAGGGAGCCGGGGTTTCACTCGGAAAGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGCCGCGTCAAGACCTGCAACCCGCCCGATGCCGGCCCCGTCGTGGTCCACTGCAGCGCCGGCGTGGGCCGCACCGGCTGCTTCATCGTCATCGACGCCATGCTGGAGCGCGTGCGGCCCGAGAAGACGGTGGACGTGTACGGCCACGTGACGCTCATGCGCTCTCAGCGCAACTACATGGTGCAGACCGAGGACCAGTACAGCTTCATCCATGAGGCGCTGCTCGAGGCCGTGGGCTGCGGCAGCACCGAGGTCCCCGCGCGCAGCCTCTACTCGTACATCCAAAAGCTGGCGCAGGCCGAGCCTGGGGAGCACGTCACCGGCATGGAGCTGGAGTTCAAGCGGCTGGCCAACTCCAAGGCACACACGTCGCGGTTCATCAGCGCCAATTTGCCCTGCAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTACGAGAGCACCCGTGTGTGCCTGCAGCCCATCCGTGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATCGACGGCTACAGGCAGCAGAAGGCCTACATCGCCACACAGGGGCCGCTGGCGGAGACCACGGAGGACTTCTGGCGCATGCTGTGGGAAAACAACTCCACCATTGTGGTGATGCTGACCAAGCTTCGGGAGATGGGCCGGGAAAAATGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTGGACCCGATGGCGGAGTACAACATGCCGCAGTACATCCTCCGCGAGTTCAAGGTCACGGACGCCCGGGACGGCCAGTCTCGCACCGTGCGGCAGTTCCAGTTCACGGACTGGCCAGAGCAGGGCGTGCCCAAGTCGGGCGAGGGCTTCATCGACTTCATCGGCCAGGTGCACAAGACCAAGGAGCAGTTCGGCCAGGACGGCCCCATCTCCGTGCACTGCAGCGCTGGCGTGGGCAGGACAGGCGTGTTTATCACGCTGAGCATCGTGCTGGAGCGCATGCGCTACGAGGGCGTGGTGGACATCTTCCAGACCGTGAAGATGCTGCGCACCCAGCGGCCGGCCATGGTGCAGACGGAGGATGAGTACCAGTTCTGCTACCAGGCATCGCTGGAGTACCTCGGCAGCTTTGACCACTATGCAACATAA

XM_004865704.1 Coding sequence

Ptprs protein tyrosine phosphatase, receptor type, S, transcript variant X11

Length: 4503 bp    Location: 4716249..4764184   Strand: +
>XM_004865704.1
ATGGCACCCGCCTGGGGTCCCAGTGTGTCTGTGGTGGGTCCCGTGGGCCTCGTCCTGGTCCTGCTGGTTGGAGGCTGTGCTGCAGAAGAGCCCCCCAGGTTCATCAGAGAACCCAAGGACCAGATCGGCGTGTCGGGTGGCGTGGCCTCCTTCGTGTGCCAGGCCACGGGTGACCCCAGGCCCCGGGTGACCTGGAATAAGAAAGGCAAGAAGGTGAACTCTCAGCGCTTCGAGACGATCGAGTTTGACGAGAGCTCTGGGGCCGTGCTGAGGATCCAGCCCCTGCGGACGCCCCGGGACGAGAACGTGTACGAGTGCGTGGCACAGAACTCGGCGGGGGAGATCACGGTCCACGCCAAGCTCACAGTCCTCCGAGAGGACCAGCTGCCCCCCGGTTTCCCCAACATCGACATGGGCCCCCAGTTGAAGGTGGTGGAGCGAACGCGCACGGCCACCATGCTGTGTGCGGCCAGCGGCAACCCTGACCCTGAGATCACGTGGTTCAAAGACTTCCTGCCTGTGGACCCCAATGCCAGCAATGGCCGCATCAAGCAGCTGCGATCTGGGGCCCTGCAGATCGAGAGCAGCGAGGAGACGGATCAGGGCAAATACGAGTGCGTGGCCACCAACAGTGCCGGTGTCCGGTACTCCTCACCCGCCAACCTCTACGTTCGAGTCCGCCGCGTGGCCCCCCGCTTCTCCATTCTCCCCATGAGCCACGAGATCATGCCGGGGGGCAACGTCAACATCACCTGCGTGGCCGTAGGCTCGCCCATGCCCTACGTCAAGTGGATGCAGGGTGCCGAGGACCTCACCCCCGAGGACGACATGCCCGTGGGCCGCAACGTGCTGGAGCTCACGGATGTCAAGGACTCAGCCAACTACACGTGCGTGGCCATGTCCAGCCTGGGTGTCATTGAGGCAGTGGCTCAGATCACCGTGAAATCTCTGCCCAAAGCCCCTGGGACGCCTGTGGTGACCGAGAACACTGCCACCAGCATCACCATCACGTGGGACTCCGGCAACCCAGACCCAGTGTCCTACTATGTCATCGAGTACAAGTCGAAGAGCCAGGACGGGCCGTACCAGATCAAGGAGGACATTACCACCACGCGCTACAGCATCGGCGGACTCAGCCCCAACTCGGAGTATGAGATCTGGGTGTCGGCCGTGAACTCCATCGGCCAGGGGCCCCCCAGCGAGTCAGTGGTGACACGCACCGGTGAGCAGGCTCCGGCCAGCGCCCCTCGCAATGTGCAGGCCCGCATGCTCAGTGCCTCCACCATGATCGTGCAGTGGGAAGAGCCCGTGGAGCCCAACGGGCTGATCCGAGGCTACCGCGTCTACTACACCATGGAGCCCGAGCACCCCGTGGGCAACTGGCAGAAGCACAACGTGGATGACAGCCTGCTGACCACTGTGGGCAGCCTGCTGGAGGACGAGACCTACACCGTGCGTGTCCTGGCCTTCACGTCTGTGGGCGACGGGCCGCTCTCAGACCCCATCCAGGTCAAGACGCAGCAAGGAGTGCCCGGCCAGCCCATGAACTTGCGGGCAGAGGCCAAGTCTGAGACCAGCATCGGGCTGTCGTGGAGTCCACCGAGGCAGGAGAGCATCATCAAGTACGAGCTGCTCTTCCGCGAAGGCGACCGAGGCCGAGAGGTGGGCAGGACGTTTGACCCAACGACGGCCTTCGTGGTGGACGACCTCAAGCCCAACACAGAGTATGCCTTCCGCCTGGCAGCGCGCTCCCCGCAAGGCCTGGGTGCCTTCACCGCACCCGTGCGGCAGCGCACGCTGCAGTCCATCTCCCCCAAGAACTTCAAGGTGAAAATGATTATGAAGACCTCGGTGCTGCTCAGCTGGGAGTTTCCCGATAACTACAACTCGCCCACGCCCTACAAGATCCAGTACAATGGGCTGACCCTGGACGTGGACGGCCGCACCACCAAGAAGCTCATCACGCACCTCAGGCCCCACACCTTCTACAACTTCGTGCTGACCAACCGCGGCAGCAGCCTAGGTGGTCTGCAGCAGACGGTCACTGCCTGGACGGCCTTCAACATGCTCAGCGGCAAGCCTGGTGTCTCCCCCAAGCCTGACCCCGACGGCTACATCGTGGTGTACCTGCCCGACGGCCAGAGCCCCGTGCCTGTGCAGAACTACTTCATTGTGATGGTGCCGCTGCGCAAGTCTCGAGGAGGCCAGTTCCTCACCCCGCTGGGCAGCCCCGAGGACATGGATCTGGAAGAGCTCATCCAGGACATCTCGCGGCTCCAGAGGCGGAGCCTGCGGCATTCGCGCCAGCTGGAGGTACCCCGGCCCTACATCGCTGCCCGCTTCTCAGTGCTACCCCAAATCTTCCATCCTGGGGACCAGAAGCAATACGGTGGCTTTGACAACCGGGGCCTGGAGCCTGGCCACCGATATGTTCTCTTTGTACTTGCTGCGCTGCAGAAGAGTGAGCCCACATTTGCGGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGACAACCCTGACCCCCAACCCATCGTGGACGGCGAGGAGGGGCTCATCTGGGTGATCGGGCCGGTGCTGGCTGTGGTCTTCATCATCTGCATCGTCATTGCCATCCTGCTGTACAAGAACAAACCTGACAGCAAACGCAAGGACTCAGAGCCCCGCACCAAATGCCTGCTGAACAACGCCGACCTTGCACCCCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAGGCATGCTCAGCCACCCGCCCATCCCCATCGCGGACATGGCGGAGCACACAGAGCGCCTCAAAGCCAACGACAGCCTCAAGCTGTCCCAGGAGTATGAGTCCATCGATCCCGGGCAGCAGTTCACGTGGGAGCATTCCAACCTGGAGGTGAACAAGCCCAAAAATCGCTATGCCAACGTCATCGCCTACGACCACTCACGCGTCATCCTCCAGCCCATCGAAGGCATCATGGGCAGCGATTACATCAATGCCAACTACGTGGACGGCTACCGGCGGCAGAATGCGTACATTGCCACGCAGGGGCCCCTGCCCGAGACTTTCGGGGACTTCTGGCGGATGGTGTGGGAGCAGCGCTCGGCCACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGGATCAAATGTGACCAGTACTGGCCCAACCGGGGCACAGAGACCTACGGCTTCATCCAGGTCACCCTGCTGGACACCATCGAGCTGGCCACCTTCTGCGTGAGGACCTTCTCCTTGCACAAGAACGGCTCCAGTGAGAAGCGCGAGGTCCGCCAGTTCCAGTTCACAGCGTGGCCGGATCACGGGGTTCCCGAGTACCCAACACCTTTCCTGGCCTTCCTGCGC