Details from NCBI annotation

Gene Name Heterocephalus glaber isolate NMR 29 unplaced genomic scaffold, HetGla_female_1.0 scaffold00037, whole genome shotgun sequence

Genome Location

Related Sequences

XM_004851793.1 Coding sequence

LOC101717318 cytochrome c oxidase subunit 6A1, mitochondrial-like

Length: 411 bp    Location: 17397604..17481618   Strand: +
>XM_004851793.1
ATGGCTATCTGGTCGGGGCCGATCCAGGCAGAGAAACAGCAATTGAAAGGCTTGGAGGCCAAATTGTTCCTCCAAAATGGTGGCTGCAGCCACAGCTGCATCCCTGGGGTTTCTCAGCTGCTAGGCCGGTCCTGCACGCAGGTGGGGCGGCTTATGTCAAGTGGTGCCCACGGCGAGCAGGGCTCAGCTTGCATGTGGAAGGCCCTCACCTATTTCGTGGTGCTCCCCGGGGTGGGAGTGAGCATGCTGAATGTTTTCCTGAAATCATGCCACGGAGAGGAGAGACCTGAGTTCATCGCCTACCCCTACCTCCCCATCAGGACCCAGCCCTTTCCATGGGGAGATGGTGACCATGCTCTATTCCATAACCCTCATGTGAATCTGCCTCCAACTGGCTATGCAGATGAATAA

XM_004851581.1 Coding sequence

Bdnf brain-derived neurotrophic factor, transcript variant X1

High confidence: 4 potential gene matches
Length: 786 bp    Location: 17330379..17281908   Strand: -
>XM_004851581.1
ATGTTCCACCAGGTGAGAAGAGGGATGACCATCCTTTTCCTTACTATGGTTATTTCGTACTTCGGTTGCATGAAGGCCGCCCCCATGAAAGAAGCCAGTGTCCGAGGCCCAGGCAGCTTGGCCTACCCCGGAGTGCGGACCCACGGGGCCCTGGACAGCGTGACCGGGCCCAAGGTGGGTGCGCGGGGCCTGGCGGCGTCTTCATCGTCTTCGTCGCTGGCTGACACTTTTGAGCACGTGATCGAGGAGCTGCTGGAGGAGGACCAGAAAGTCAGGCCCCATGAAGAGAATGCGAAGGACGCGGACTTGTACACGTCCCGGGTGATGCTGAGCAGCCAGGTGCCTTTGGAGCCGCCCCTCCTCTTTCTGCTCGAGGAATACAAAAATTACCTGGACGCTGCCAACATGTCCATGCGGGTCCGGCGCCACTCCGACCCGGCCCGCCGTGGGGAGCTGAGCGTGTGCGACAGCATCAGTGAGTGGGTCACCGCCGCGGATAAAAAGACTGCAGTGGACATGTCTGGCGGGACGGTCACCGTCCTGGAGAAGGTCCCCGTGTCCAAAGGCCAACTGAAGCAGTACTTCTACGAGACCAAGTGCAACCCCATGGGCTACACCAAGGAGGGCTGCAGAGGCATAGACAAGAGGCACTGGAACTCGCAGTGCCGAACTACCCAGTCCTACGTGCGGGCCCTCACCATGGATAGCAAAAAGAGAATTGGCTGGCGGTTCATAAGGATAGACACTTCCTGTGTATGTACACTGACCATTAAGAGAGGAAGATAG

XM_004851578.1 Coding sequence

Lin7c lin-7 homolog C (C. elegans), transcript variant X1

High confidence: 4 potential gene matches
Length: 594 bp    Location: 17167073..17162041   Strand: -
>XM_004851578.1
ATGGCGGCGCTGGGAGAACCTGTACGGCTGGAGAGGGATATCTGCAGAGCGATCGAGCTGCTGGAGAAGCTGCAGCGGAGTGGGGAGGTGCCACCACAGAAGCTGCAGGCGCTGCAGAGAGTCCTCCAGAGCGAGTTCTGCACGGCCGTGCGGGAGGTGTACGAGCACGTCTATGAGACAGTGGACATCAGCAGCAGTCCTGAAGTGAGGGCCAATGCAACCGCAAAGGCCACTGTGGCTGCGTTTGCAGCCAGCGAGGGACATTCTCATCCCCGCGTGGTGGAGCTGCCGAAGACGGAAGAGGGCCTCGGCTTCAATATCATGGGGGGCAAGGAGCAGAACTCTCCCATCTACATATCTCGGATAATTCCCGGCGGGATTGCAGACAGACACGGGGGCCTCAAGCGCGGAGACCAGCTCCTTTCTGTGAATGGAGTGAGCGTGGAGGGTGAGCACCATGAGAAGGCCGTGGAGCTGCTGAAGGCCGCGCAGGGCAAGGTGAAGCTGGTGGTGCGCTACACGCCCAAGGTGCTGGAGGAGATGGAGTCACGCTTCGAGAAGATGCGCTCGGCCAAGCGCAGGCAGCAGACCTAG

XM_004851584.1 Coding sequence

Kif18a kinesin family member 18A, transcript variant X2

High confidence: 4 potential gene matches
Length: 2688 bp    Location: 17622294..17565263   Strand: -
>XM_004851584.1
ATGTCTGTCCCTAAGGAAGATCTGTGGCACCACATGAGAGTAGCCGTCCGCGTGCGCCCTGAAAGCACAAAGGAGAAAGCGACAGGGCTCCATAAGGTGGTCCAAGTTGTGGATGAGCACATACTAGTTTTTGACCCCAAACAAGAAGAAGTCAGTTTTTTCCCTAAAAAGAAAAGTACAAATTTTGATGTTTCAAAGAGACAAAATAAAGATCTTAAATTTGTATTTGATACTGTTTTTGATGAAACTTCAACTCAATTGGAAGTTTTTGAACATACCACCAAGCCAGTTCTTCGTAGTTTTTTGAATGGTTATAATTGCACAGTGCTTGCATATGGTGCCACGGGAGCTGGGAAAACCCACACAATGCTAGGATCAGCTGCAGAACCTGGAGTAATGTACCTAACAATGTTAGACCTCTACAAGTCCATGGATGAGATTAAAGAAGAGAAAATATGTAGCACTGCAGTTTCTTACCTGGAGGTATATAATGAGCAGATTCGTGACCTCTTAGTAGATTCTGGGCCGCTTGCTGTCCGCGAGGATGCTCAGAAAGGAGTGGTTGTTCAGGGTCTGTCTTTGCACCAGCCCAGATCCTCAGAAGAAATCTTACAGTTACTGGATAATGGGAACAAAAACAGGACACAGCACCCCACTGACGCAAACGCAGCCTCCTCTCGTTCTCATGCTGTTTTCCAGATCTATTTGCGACAGCAAGACAAAACAGCGAGCATCAACCAGAATGTACGCATTGCCAAGATGTCACTTATCGACCTGGCGGGGTCCGAGCGGGCCAGTTCCACCAGCACCACAGGGGCCCGGTTCGTGGAGGGCACGAACATCAACAGGTCCCTGCTCGCCCTGGGAAACGTCATCAACGCCCTGGCAGATGGAAAGAAAAAGAATCAGCATGTTCCTTACAGAAATAGTAAGCTCACTCGCTTGTTAAAGGATTCTCTTGGAGGAAACTGTCAGACTATAATGATAGCTGCTGTTAGTCCTTCCTCTTTATCCTACGATGACACGTATAACACCCTTAAGTATGCTAACCGTGCAAAGGACATTAAATCTTCTCTGAAGAGCAACGTTTTTAATCTCAACAATCACATATCTCAGTATGTAAAGATCTGTAATGAGCAGAAGGCAGAGATTTTAATGTTAAAGGAAAAATTAAAAGCCTATGAAGAACAGACAGCCTGCACTGCTAAAAGTGATGAAGCAAAGTTAATGATTCCAAACCCTCAGGAAAAAGAAATCGAAAGATTTCAAGAGATTCTTAACTGCTTGTTCCAGAATCGAGAAGAAATCAGGCAAGAATATCTGAAGTTGGAAATGTTACTTAAAGAAAATGAACTTAAATCATTTTATCAACAGCAATGCCATAAGCAAATAGAAATGATGTGTTCTGAAGACAAAGTAGAAAAGGCCACCTGCAAACGAGATCATAGACTTGCGATGCTGAAAACTCGTCGCTGCTACCTGGAGAAAAAGAGAGAGGAGGAGTTGAAGCAATTCGATGAAAATACCAATTGGCTTTATCATGTGGAAAATGAGATGAGGCTCTTGGGCCAAAATGGTCATATTCCAAAGGAACTCAGTAAAGATCTTCGTTTTCACCATTTACACCTCCAGAATGAAGATTTGAAAGCACAAATTAGACATATGATAGATCTCGCTTGCCTTCAAGAGCAGCAGCACAGGCAGACTGAGGTAGTTCTGAATGCTTTACTTCCAACCCTAAGAAGACAGTATTGCACACTGAAAGAAGCTGGCTTGTCAAATGCTTCTTTTGAGTCTGACTTCAAAGAAATTGAACATTTGGTGGAGAGGAAAAAAGTGGTGGTTTGGGCAGATCAGACTACTGAACCCCCAAATCAAAAGGATCTACCAGGAATTTCTGTTCTGATGACCTTTCCACAGCTTGCACCTGTTCAGTCTATTCCTTGTTGCACATCTTCAGGTGACCCGAATCTGTTTAAAATTCCTCTGCACAAAAGAACTCGGAGAAAACTGATGCCTTCTCCCCTGACAGTAAAACATCCCGAGAAGCCAACGCTGGCTGAAAGTGTCCCGCTCAATGACTCTCTCACCAGAGAACTTCAGCCCCTTTTGTACACCCCCGAGAACTGCAGAAAACCTGTCCCATGTGCGTCCCCACGGCCCTGGGTAAGGCCGCCCTCGCACCCTGCAGGCATCCAGGCCTTGGGCCCCTGTGGAAACAGTGGTGACTCACTGCAAATGCTGGGCAGGGTCGACAGCCCTGCTGTCTGCAGGGCAGCACATGGACGGAGCGCCACAGAGCCCCTCACTGCGTGTGAAGACACCAGGGCCCTGAAGCGAAAGTTACCCGAACAGGACTCGCTCCTGACCAAAAACAGTTTAGAAAGGCTTGGCCCTTCTTCGCTCTCAGGCACGCACCCAGTGCCTGTGTCGAGCACGATGCCATCCTACATGGCGATGACCGCTGCCGCTAAGAAGAAACGGAAACTGGCGAGCTCTACATCAAGTAATCCGTTAACTGCTGAAGAAAATCATGGATTTGCCAAACGTGTTCGACAAGAGAATTCAAGCAATAACCTCTTACAAGAAAACAGACCAGCCATAGCGCAGAATAAAACCATCCATAAAATAAACTCAAACATGGTTAGAAAATTTGGAAGAAACATTTCAAAAGGAAATCTAAGATAA

XM_004851495.1 Coding sequence

Pik3c2a phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha, transcript variant X2

High confidence: 4 potential gene matches
Length: 5055 bp    Location: 8777795..8701642   Strand: -
>XM_004851495.1
ATGGCTCAGATATCAAGCAACAATGGATTTAAACAGTGTTCATCTTCCCATCTGGATCCAACAAGAACAAAAGAAGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCAAAACTGCAGAAGGATAGACAAGTGACTGACAGTCAAAGAAGCTTTGAGTGGTCAAGCAGCACCAGACAAAAAGCACAAGTTTTAAACAAACAGGATTATGATCTTATGGTGTTTCCTGAATCAGAGTCCCACCAGAGAGCAGTTGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTTGAGAGACTATTATTGGATGATGGTTTTGAGACTAGAAGAACACCTGTGTTGCCCGTTACTCCTGTTCTGAGCCCTTCATTTTCAGCACAGCTCTATCTTAGACCTACTATTCAGAGAGGACCATGGCTACCTGGATTATCTGGGCCTTCCACTTACACTTCTATTTATCCCTCAACTTACAGTAAACAGGCTGCATTCCAGAATGGCTTCAATCCAAGGATGCCTACTTTTCCATCTACTGAACCTATATATTTAAGACTTCCCGGACAGACTCCATATTTTTCGTATCCTTTGACACCTACCACCCCCTTTCATCCACAAGGAAGCTTACCAATCTATGGTCCAGTAGTCAGTCCTGACATGGCAAAACTATTTGACAAAATAGCCAGTACATCCGAATTTTTAAAAAATGGCAAAGCAAGGACTGATTTGGAGATAACAAATTCAAAAGCTACTGTCAACAATCTACAGGTATCTCCAGAGACTGAGGATATTAGTAAATTTGACTGGCTAGACTTGGATCCTCTAAGTAAGCCGAAGGTGGACAATGTGGAAGTACTAGACCAGGAAGAATACAAACATGTTCCAAGTTTGCTAGCAGAGGATCCTTGGGATGCTGTTCTTCTAGAAGTGAGATCACCTGCAAGTGGTCACCTCGAAAGAAAGATGAATGGAAAATCTTTTTCTGGGGCAACTGTAACAAGAAGCCAGTCTTTAAATATTCGAACAACTCACCTTACGGAAGTCCAGGGCCAAATACCTCAGAAAGACTCACCTGGGACCAATAGTTTGCCAACTGGAAGTTCTCTTCTACAACAAATTGAAGTACAGAATGAGGAGATGACAGCTTTTTGTCAATCCATTGCAAAATTGAAGAACAAATTTCCATACTTCAATCATTGCACAAATCCAGGCTATTTGTTAAGTCCAGTCACAGTGCAAAGAAATGTATGTGGAGAAAATGCTAGTGTGAAGGTCTCCATTGAAATTGAAGGATTTCAACTACCTGTTACTTTCACATGTGATGTGAGTTCCACAGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTTCATGATGACTTGAATCAAGTAGATGTTGGCAGCTATGTCCTGAAAGTTTGTGGTCAAGAGGAGGTGCTGCAGAACAACCATTGCCTTGGAAGTCATGAACATATTCAAAACTGTCGAAAATGGGACACAGAGATTAAATTACAACTCTTGACCTTCAGTGCAATGTGCCAGAATCTAGCCAGAACAGCAGAAGATGATGAAACACCCGTGGATTTAAACAAATACCTGTATCAAATAGAAAAACCTTATAAAGAAGTCATGACAAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAAGTGGAACTGGCTCTTCAAATTGAAAACCAGTACCGAGCTGTAGATCAAGTAATTAAAGCTGTAAGAAAAATCTGTAGTGCTTTAGATGGTGTAGAGACTCCTGCCATTACAGAATCAATAAAGAAGCTAAAGAGAGCAGTTAACCTTCCAAGGAGTAAAAGTGCTGATGTGACTTCACTATCTGGAGGAGATACTAGCAAAAGCTCAACTGGAGGCTCCCTGAATCTTGAAAATCCTGTTCAAGTGAGCATGGACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTTCATGCAAATTCTGTTAGGAGTCCTGAAGACTGTACTCACAGTAGGAACATCAAGGAAGCGTGGACCACCGCAGACCAGCTCCAGTTTACTATTTTTGCTGTACATGGAATTTCAAGTAACTGGATATCAAATTATGAGAAATACTACTTGATATGTTCCCTATCACACAATGGAAAGGATCTTTTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAGAAATTTCTTCTATCTTATTAAATGGGATGAACTAATTATTTTTCCCATCCAGATATCACAATTGCCATTAGAATCACTTCTTCATCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAGCAGAGGAAGGGCCCAGAAGCTTTGGGCAGAGTTTCTTTGCCTCTTTTTGACTTTAAACGGTTTTTAACGTGTGGAACTAAACTTCTATATCTTTGGACCTCTTCGCATACAAATCCTAGTCCTGGAACAATCCCCAAAAAAGGATGTGTCATGGAAAGAATAGTACTACAGGTTGATTTTCCTTCTCCTACGTTTGATATTATTTACACAACTCCTCAAGTTGACAGAGGCATTATACAGCAATACAACTTAGAAACACTGGAAAATGATATAAAAGAAAAACTTCTTGATATTCTTCACAGAGACTCATCACTTGGGCTTTCTAAAGAAGATAAAGCCTTTCTGTGGGAGAAACGGTATTACTGCTTCAAACACCCAAATTGTCTTCCTAAAATACTAGCAAGTGCCCCAAACTGGAAATGGGTTAATCTTGCCAAAACCTACTCATTGCTTTACCAGTGGCCTCCATTGTATCCACTGGCTGCATTGGAGCTTCTTGATTCAAAATTTGCTGATCAGGAAGTGAGAACCCTAGCTATGACCTGGATTGAGGCCATTAGTGATGATGAGCTGACAGATCTCCTTCCACAGTTCGTGCAAGCTTTGAAATACGAAATTTACTTGAATAGTTCATTAGTGCACTTCCTTCTGTCCCGGGCATTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGATACCCAGTTTGGTACCCGATATGAACATGTGTTGGGTGCTCTCCTCTCAATAGGAGGGAAAAGACTCAGAGAAGAACTTTCTAAGCAGACGAAATTTGTACAACTACTAGGTGGAGTAGCAGAAAAAGTAAAGCAGGCTAGTGGATCAGCCAGACAGGTTGTCCTCCAAAGGAGTATGGAAAGAGTACAGTCCTTTTTCTTGAGAAATAGATGCCGTCTCCCTCTCAAGCCAAGTCTGGTGGCAAAAGAGTTAAATATTAAGTCATGTTCCTTCTTCAGTTCTAATGCCGTGCCCCTAAAAGTCACCATGGTGAATGCTGATCCAATGGGGGAAGAAATTAATGTCATGTTTAAGGTTGGTGAAGATCTTAGGCAAGATATGTTGGCTTTACAGATGATAAAGATCATGGATAAGATCTGGCTTAAAGAAGGCCTTGACTTGAGGATGGTAATTTTCAGATGTCTCTCAACTGGCAGAGATCGAGGCATGGTGGAGCTAGTTCCTGCTTCAGATACCCTCAGGAAAATCCAAGTGGAATATGGTGTGACTGGATCCTTTAAAGATAAACCACTTGCTGAGTGGCTAAGGAAATATAATCCCTCTGAAGAAGAATATGAAAAGGCTTCTGAGAATTTTATCTATTCTTGTGCTGGATGCTGTGTAGCCACCTATGTTTTAGGCATTTGTGATCGACACAATGACAATATAATGCTTCGAAGTACAGGACACATGTTCCACATTGACTTTGGAAAGTTTTTGGGCCATGCACAGATGTTTGGTAGCTTTAAAAGGGATCGGGCTCCGTTTGTGCTTACCTCTGATATGGCATATGTCATTAATGGGGGAGAAAAGCCTACCATTCGTTTCCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTACAACTTGATAAGAAAGCAAGCAAACCTCTTTCTTAACCTCCTTTCACTGATGATTCCTTCAGGCTTACCAGAACTTACAAGTATTCAAGACTTGAAATATGTTAGAGATGCACTGCAACCCCAGACTACGGATGCAGAAGCTACAATTTTCTTCACTAGGCTGATTGAGTCCAGTTTGGGAAGCATTGCTACAAAGTTTAACTTTTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGTCTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCCAAAACATACTCCTTTAGACAAGATGGTCGAATCAAGGAAGTGTCTGTTTTCACATACCATAAGAAATACAACCCAGACAAACATTATATATATGTGGTGCGAATTTTGAGAGAAGGACAATTTGAACCATCATTTGTGTTCCGGACATTTGATGAATTTCAAGAACTTCATAACAAGCTCAGCATTATTTTTCCACTTTGGAAATTACCTGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCAGCCAAAAGAAAAATTGAGTTAAACAGTTATTTACAGAGTCTGATGAGAGCTTCAACAGATGTAGCAGAGTGTGATCTTGTTTGTACTTTTTTCCACCCTTTACTTCGTGATGAAAAAGCTGAAGGAATAACTAGGTCTGCAGGTGCAGGTCCCTTCAGTCCTACTGCAGGCCAAGTAGGAGGAGCAGTGAAGTTATCTATCTCTTACCGCAATGGTACTCTCTTCATCATGGTGATGCACATCAAGGATCTTGTCACTGAAGATGGGGCTGACCCAAACCCATATGTCAAAACATACCTACTTCCAGATACCCACAAAACATCCAAGCGTAAAACAAAAATTTCACGAAAAACTAGGAATCCAACATTCAATGAAATGCTTGTGTACAGTGGATATAGCCAAGAAACTCTAAGACAAAGGGAACTTCAGCTTAGCGTACTCAGCGCAGAATCTCTGCGAGAGAACTTTTTCTTGGGTGGAATAACCCTGCCTTTGAAGGATTTCAACTTGAGCAAAGAGACAGTTAAGTGGTATCAGCTTACTGCCGCAACGTACTTGTAA

XM_004851397.1 Coding sequence

Nrip3 nuclear receptor interacting protein 3

High confidence: 4 potential gene matches
Length: 723 bp    Location: 1134000..1112369   Strand: -
>XM_004851397.1
ATGTTTTACTCAGGCCTCCTCACCGAGGGCAGCCGCAAGGAGACCGACATGAGAGAGGCGGCGTCGCTGCGGCAGCAGCGCCGGATGAAGCAAGCGGTGCAGTTCATCCACAAGGACTCCGCCGACCTGCTGCCCCTGGACGGCCTCAAGAAGCTGGGCTCGTCTAAGGACACGCAACCTCATAACATTCTGCAGAGGCGCCTCATGGAAACCAACCTGTCTAAGCTCCGAAGCAGTCGTGTTCCTTGGGCCTCCAAGACCAACAAACTCAACCAGGCTAAGTCTGAAGGACTAAAGAAGTCTGAGGATGATGACATGATTTTGGTTTCTTGCCAGTGTGCTGGAAAGGATGTGAAAGCCTTGGTTGACACAGGCTGTCAATATAATCTCATATCCTCAGCCTGTGTGGACAGATTGGGACTCAAGGAGCTTGTTAAATCTCACAAGTATGAAGGAGAAAAGTTTTCTCTGCCCCGGCATCTTAAGGTAGTGGGTCAGATTGAGCATCTAGTGATCACCCTGGGCTCCTTCCGCCTGGACTGTCCAGCAGCTGTGGTTGAGGACAATGAGAAAAACTTGTCTCTTGGTCTCCAGACTCTCCGATCCCTGAAGTGTATCATAAACTTGGATAAGCACCGACTGATCATGGGGAAGACTGATAAGGAAGAGATCCCTTTTGTGGAGACCGTTTCTTTGAATGAAGACAACACTTCAGAAGCATAA

XM_004851389.1 Coding sequence

Akip1 A kinase (PRKA) interacting protein 1, transcript variant X4

Length: 552 bp    Location: 1061124..1069051   Strand: +
>XM_004851389.1
ATGGAGAACTGTTTGGCAGCAGCGGCGCTGAACGGGTTGGACCGACGTTCCCTGCAGCGCTCGGCCAGGCTGGGCCAAGAAGTGCTGGAGCGGGCCAGGCGGAGGGCAGTGGACTGGCATTTACAGGAGCGCCCCACGGGCAGCATGGGAGTCCTTTCCCGGGAGGGGCCCTGCCGAGAAGGACGGCGGGCAGCCGACCCCCGGCGCTTTCTCCCCACAGAGAAATATTATTCATCAGTGCCTGAGGAAGGAGGGGCAACCCATGTCTATCGGTATCACAGAGGGAAGTCTCAGCAGCACGTGTGCTCCAACACAGGGTATGGTCAGAGAATAGACAGAGAGAAGACATTCCTGGATCAGGGAGGCATCTACCGAACATCAGAGCCCGATTCAGAGACGTCCCAGCCCGCCGAGAACATCTCCAAGGACCTCTACATAGAAGTATACCCAGGGACCTATTCTGTCACCGTGGCCTCAAATGCCTTGACCAAGAAGACTCACGTGGTAGCAGTTGATTCAGGACAAAGTGTGGACTTGGTATTCCCTGTATGA

XM_004851388.1 Coding sequence

Akip1 A kinase (PRKA) interacting protein 1, transcript variant X3

Length: 552 bp    Location: 1061124..1069051   Strand: +
>XM_004851388.1
ATGGAGAACTGTTTGGCAGCAGCGGCGCTGAACGGGTTGGACCGACGTTCCCTGCAGCGCTCGGCCAGGCTGGGCCAAGAAGTGCTGGAGCGGGCCAGGCGGAGGGCAGTGGACTGGCATTTACAGGAGCGCCCCACGGGCAGCATGGGAGTCCTTTCCCGGGAGGGGCCCTGCCGAGAAGGACGGCGGGCAGCCGACCCCCGGCGCTTTCTCCCCACAGAGAGAGAAGAAAGACACCTGACCCTTAATGCTTCCTTCAGAATAATGGCTGAATTCATGGACTATACTTCAAGTCAGTGTGGGAAATATTATTCATCAGTGCCTGAGGAAGGAGGGGCAACCCATGTCTATCGGTATCACAGAGGGAAGTCTCAGCAGCACGTGTGCTCCAACACAGGGTATGGTCAGGCCGAGAACATCTCCAAGGACCTCTACATAGAAGTATACCCAGGGACCTATTCTGTCACCGTGGCCTCAAATGCCTTGACCAAGAAGACTCACGTGGTAGCAGTTGATTCAGGACAAAGTGTGGACTTGGTATTCCCTGTATGA

XM_004851701.1 Coding sequence

Sct secretin, transcript variant X2

High confidence: 4 potential gene matches
Length: 381 bp    Location: 21840894..21843341   Strand: +
>XM_004851701.1
ATGGCCCCTTGCCGGCCACTGCTGCTGCTGCTGCTGCTGCTCGGGGACCCTGCTGCACACCCCGCACCGCCCAGGGCCGCACGACACTCGGACGGGACGTTCACCAGTGAGCTCAGCCGCCTGCGGGACAGTGCCCAGCTGCAGCGCCTGCTGCAGGGCCTGGTGGGCAAGCGCAGCGAGCAGGTTGCAGAGAACAGCGCCACCGGGTCCAAGCCTGTAGACGGCCAGCTGTGCCTGCTGTGGTCAGATGTGCCCACCCTGCAGGCCTGGACGCCCCTGGGGCACCCCATGGGCCTCTCCCCATCTCCCTGGCTGCCTCCTGGCCCCAGGCCCGGAGCCAAGATTTCAGACCCTGCAGGAGATATCCGGAGTCCTCGATGA

XM_004851449.1 Coding sequence

Arntl aryl hydrocarbon receptor nuclear translocator-like, transcript variant X4

High confidence: 4 potential gene matches
Length: 1878 bp    Location: 5295143..5391645   Strand: +
>XM_004851449.1
ATGGCAGACCAGAGAATGGACATTTCCTCCACGATCAGTGACTTCATGTCCTCCGGCCCCACTGACCTGCTCTCCAGCTCCCTGGGCGCCGGCAGCGTGGATTGCAACCGCAAGCGGAAGGGCAGCTCCACCGACTACCAAGAAAGCATGGACACAGACAAAGATGACCCTCATGGAAGGTTGGAATACACAGAACACCAAGGAAGGATAAAAAATGCAAGGGAAGCTCACAGTCAGATTGAAAAGCGGCGCAGGGATAAGATGAACAGTTTTATTGATGAGCTGGCTTCTTTGGTACCAACATGCAACGCGATGTCCAGGAAGTTAGATAAACTCACCGTGTTAAGAATGGCTGTTCAGCACATGAAAACATTAAGAGGTGCCACTAACCCGTACACAGAAGCAAACTACAAGCCAACTTTTCTATCAGACGATGAATTGAAACACCTCATTCTCAGGGCAGCAGATGGATTTTTGTTTGTCGTAGGATGTGACCGAGGGAAGATACTCTTTGTCTCAGAGTCTGTCTTCAAGATCCTCAACTACAGCCAGAATGATCTGATTGGTCAGAGTTTGTTTGATTACCTGCATCCTAAAGATATCGCCAAAGTCAAGGAGCAGCTCTCCTCCTCCGACACCGCACCCCGGGAGCGGCTCATAGATGCAAAAACTGGACTTCCAGTTAAAACAGATATAACCCCTGGGCCGTCTCGATTATGTTCTGGAGCACGACGTTCTTTCTTCTGTAGGATGAAGTGTAACAGGCCTTCAGTAAAGGTGGAAGACAAGGACTTCCCCTCCACCTGCTCAAAGAAAAAAGATCGAAAAAGCTTCTGCACAATCCACAGCACAGGCTATTTGAAAAGCTGGCCCCCCACAAAGATGGGGCTGGATGAAGACAATGAACCAGACAATGAGGGGTGTAACCTCAGCTGCCTTGTTGCCATTGGACGGCTGCATTCTCACGTGGTTCCACAACCAGTGAACGGGGAAATCAGGGTGAAAGCTATGGAATATGTTTCTCGGCACGCAATAGATGGGAAGTTTGTTTTTGTAGACCAGAGGGCAACAGCTATTTTGGCATATTTACCACAAGAACTTCTAGGCACATCATGTTATGAATATTTTCATCAAGATGACATAGGACATCTTGCAGAATGTCACAGGCAAGTTCTACAGACAAGAGAAAAGATTACAACTAATTGCTATAAGTTTAAAATCAAAGATGGTTCTTTCATCACACTACGAAGTCGATGGTTCAGTTTCATGAACCCTTGGACCAAGGAAGTAGAATACATTGTCTCAACCAACACTGTTGTTTTAGCCAACGTCCTGGAAGGCGGGGACCCAACCTTCCCGCAGCTCACAGCATCCCCCCACAGCATGGACAGCATGCTGCCCTCTGGAGAAGGTGGCCCAAAGAGGACCCATCCCACTGTTCCAGGGATTCCAGGGGGAACCAGGGCTGGGGCAGGAAAAATAGGTCGAATGATTGCTGAGGAAATCATGGAAATCCACAGGATAAGAGGGTCGTCGCCTTCCAGCTGTGGTTCTAGCCCACTGAACATCACAAGTACGCCTCCCCCTGATGCCTCCTCTCCAGGAGGCAAGAAGATTTTAAATGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTACCAGGGCAGGCACAGGAGAATCCAGGCTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGCATAGACATGATAGATAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAAGCGGCAATGGCTGTCATCATGAGCCTCCTGGAAGCAGATGCTGGGCTGGGTGGCCCTGTTGACTTTAGCGACTTACCATGGCCGCTGTAG

XM_004851379.1 Coding sequence

Lmo1 LIM domain only 1 (rhombotin 1), transcript variant X2

Length: 438 bp    Location: 419417..393044   Strand: -
>XM_004851379.1
ATGCTCTCCGTCCAGCCCAAAGGGAAGCAGAAGGGATGTGCAGGCTGTAACCGCAAGATCAAGGACCGCTACCTGCTGAAGGCGCTGGACAAGTACTGGCACGAGGACTGCCTCAAATGTGCCTGCTGTGACTGCCGCCTGGGTGAGGTGGGCTCCACCCTCTACACCAAGGCCAACCTCATCCTGTGCCGGCGTGACTACCTGAGGCTCTTTGGCACCACCGGAAACTGTGCTGCCTGCAGCAAGCTGATCCCAGCCTTCGAGATGGTGATGCGGGCCCGGGACAATGTGTATCACCTCGACTGCTTCGCCTGCCAGCTCTGCAACCAGAGATTTTGCGTGGGAGACAAATTCTTCCTGAAGAACAACATGATCTTGTGTCAGATGGACTATGAGGAGGGGCAGCTGAACGGCACCTTTGAATCCCAGGTTCAGTAA

XM_004851378.1 Coding sequence

Lmo1 LIM domain only 1 (rhombotin 1), transcript variant X1

High confidence: 4 potential gene matches
Length: 471 bp    Location: 427114..393044   Strand: -
>XM_004851378.1
ATGATGGTGCTGGACAAGGAGGACGGTGTGCCGATGCTCTCCGTCCAGCCCAAAGGGAAGCAGAAGGGATGTGCAGGCTGTAACCGCAAGATCAAGGACCGCTACCTGCTGAAGGCGCTGGACAAGTACTGGCACGAGGACTGCCTCAAATGTGCCTGCTGTGACTGCCGCCTGGGTGAGGTGGGCTCCACCCTCTACACCAAGGCCAACCTCATCCTGTGCCGGCGTGACTACCTGAGGCTCTTTGGCACCACCGGAAACTGTGCTGCCTGCAGCAAGCTGATCCCAGCCTTCGAGATGGTGATGCGGGCCCGGGACAATGTGTATCACCTCGACTGCTTCGCCTGCCAGCTCTGCAACCAGAGATTTTGCGTGGGAGACAAATTCTTCCTGAAGAACAACATGATCTTGTGTCAGATGGACTATGAGGAGGGGCAGCTGAACGGCACCTTTGAATCCCAGGTTCAGTAA

XM_004851796.1 Coding sequence

LOC101719390 uncharacterized LOC101719390

Length: 591 bp    Location: 21004899..21019831   Strand: +
>XM_004851796.1
ATGGGCAGCAAGATGGCGCCCGCTAGCAGGGTTGTCCAGGTCACCAAGCCACATCCACCGTTAACAAGGTTCCCTGACAGAAGAGACAATCCTAAACCGTGTATCAGAAGCTTTGAGATCCCACCTCCCTCTTCTGTAATTTCACAGCCTTCTCCGGGAAGTAAATCACCGGAGTTGCTGATGCATCCGGGTCCACCAGACACTGCAGAAATACTAAAAACGCTGCCTCAGAAGTGCAGAAGGAAACTTATATCTCAAGAGGAAGTGGAGTTTATCCAAAGTGGAGGCCAGAATCATGACCGTGGCTGCTTTTCTGAGGTCGTCGTCTTCATAGCCCTAGTGAGACAGCTTCGATTATACCACGGTGTATTCCGTGTGTTTCCTATAGGGGAGGACTGGATCTACGCGGCCCACGCTCAAGTCACAGGCCGCTGGGCGTCCCTGAAGATCCAGCGTCTGTGCTCACAACGGCCTCTTCTCATTGTGTGCCACACGGTCCCTTGTGCTTGGCTCGTGAGGACCAAAGAGAAAAAATCCTGTGAGCGGAGCAAGCTGTACACCTGCTTCAAGCGTGCGGCGCCCTCCCTGTGA

XM_004851800.1 Coding sequence

LOC101720790 mucin-2-like

Length: 8403 bp    Location: 21522535..21493234   Strand: -
>XM_004851800.1
ATGGGGCTGCCACTGGCCCGCCTGGTGGCTGCCTGCCTGGCCCTGGCCTCGGCTGGGGGCTTGGAGCTCCAGAGAGTGGGCCAGGCCCGAAGCCACAGCCACAACGTCTGCAGCACCTGGGGCAGCTTCCACTACAAGACCTTCGACGGCGACATCTTTCGCTTCCCCGGCCTCTGCGACTACAACTTCGCCTCTGACTGCCGGGACTCCTACAAGGAGTTTGCCGTGCACCTGAAGCGGGGCCTGGGCCAGGGCGGCGGCCCCCCCCAGGTGGAGTCTGTGCTGCTGACCGTCAAGGATGACACCATCTACCTCACCCGGCAGCTGGCGGTGGTGAACGGGGCCATGGTCAGCACCCCGCACTACAGCTCGGGGCTGCTCATCGTGAAGAGCGACACGTACACCAAGGTCTACTCCCGAGCTGGCCTCTCGCTCATGTGGAACCGCGAGGATGCGCTTATGCTGGAGCTGGACAGCAGGTTCCAGAACCACACCTGCGGGCTGTGCGGTGACTACAACGGGCAGCAGACCTACTCAGAGTTCCTGTCGGAAGGCGTAAGCTTCAGTGCCATTGAGTTTGGGAACATGCAGAAGGTCAACAAGCCCGAGGTGGTGTGCAAGGACCCTGAGGAGGCAGCCATGCCTGCGTCCTGCTCCGAGCACCGCTCTGAGTGTGAGAGGCTGCTGACGGCCACGGCCTTCGAGGACTGCCAGGCCCGCCTGCCGCTGGAGCTGTACGTGCAGGCCTGTGTGCGTGACCGGTGCCAGTGCCCGCTCGGTGACAGCTGCGTGTGCAGCACCGTGGCTGAGTTCTCCCGCCAGTGCTCGCATGCTGGCGGCCGGCCTGGAAACTGGAGGACAGCCTCGCTCTGTGCCAAGAGCTGCCCCGGCAACATGGTGTACCTGGAGAGCAGCTCCCCCTGCATGGACAGCTGCTCCCACCCGGAGGGCAGCAGCCTGTGCGAAGAGCACCCCATAGACGGCTGCTTCTGCCCTGAAGGCACCGTGTATGACGACATCACGGGCAGTGGCTGCATCCCTGTCAGCCGGTGCCACTGCAAGCTCCACAGCCACCTGTATACACCGGGACAGGAGGTCACCAACGACTGCGAGCAGTGCGTCTGCAACGCCGGCCGCTGGGTGTGCAAGGACCTGCCGTGTCCCGGGACCTGTGCCCTGGAGGGCGGCTCCCACATCACCACCTTCGATGGGAAGACGTTCACCTTCCACGGGGACTGCTACTACGTCCTGACCAAGGGCGACCACGACTCCTACACCCTGCTGGGCGAGCTGGCCCCGTGCGGAGCCACGGACACGCAGACCTGCCTGAAGACTGTGGTGCTGCTGGCCGACAGCAGGAAGAACGTGGTAGTCTTCAAATCGGACGGCAGCGTGCTGCTGAATGAGCTGCAGGTGACCCTGCCCCATGTGGCCGCCAGCTTCTCCGTCTTCCGGCCATCCTCCTACCACATCGTGGTGAACACGGTCTTCGGGCTGCGGCTGCAAGTCCAGCTGGTGCCCGTCATGCAGCTCTTCGTGACACTGGCCCCGTCGGCCCAGGGGCAGGTGCAGGGCCTCTGTGGGGACTTCAACGGCCTGGAAAGCGATGACCTCAAGACATCGGGCGGGCTGGTGGAGGCCACAGGCGCCAGCTTTGCCAACTCCTGGAAGGCGCAGTCTGGCTGCCATGACAGGCTGGACTGGCTGGATGACCCCTGCTCCCTCAACATCGAGAGCGCCAACTACGCGGAGCACTGGTGCTCCCTCCTGAAGAAGACCGAGACCCCCTTTGGCAGGTGCCACCTGGAGGTGGACCCCACTGACTATTACAAGAGGTGCAAGTACGACACCTGCAACTGCCAGAACAACGAGGACTGCCTGTGTGCGGCTCTGTCTTCCTACGCTCGCGCCTGCGCTGCCAAGGGCGTCATGCTGTGGGGCTGGCGGGAGCGCGTCTGCAACAAGGACGTGGACGCCTGCCCCAGCTCGCAGATATTCCTGTACAACCTGACCACCTGCCAGCAGACCTGCCGCTCACTGTCTGAGGGGAACGCCCACTGCCTGCAGGGCTTTGCGCCCCTGGATGGTTGCGGCTGCCCAGACCACACCTTCCTGGACCAGAAGGGTCGCTGTGTGACCCAGGCCAAATGCTCCTGCTACCACCATGGGCTCTACTTGGAGGCAGGGGATGTGATTCTGAGACAGAACGAGCGCTGCATTTGCCAGGACGGGAGGCTGAGCTGCAGGCCTGTCCAGCTGATCGGGCACAGCTGCAGGGCCCCAAAGATCGTGGCAGACTGCAACAATGTCACATCCCTGGCCACTCAGGAGGCCCGCCCCATCAGCTGCCAGACGCTGGTAGCTGGCTATTACCACACGGGGTGTGTCAGTGGCTGCGTGTGCCCTGATGGGCTGCTGGACGATGGCCGTGGTGGCTGCGTGGTGGAGGAGGAGTGTCCGTGTGTTCACAACAAGGCCCTCTACCTCCCTGGAAGCAAGATCAAGTTGGACTGCAGCACCTGCACCTGCCAGAGGGGACGCTGGGAGTGCACGAAGTCCGTGTGCCACGGCACCTGCTCCATCTACGGCAGTGGCCACTACGTTACCTTTGACGGGAGGCACTATGACTTTGACGGACACTGCTCCTACGTGGCTGTTCAGGACTACTGTGGCCAGAACTCCACGGGCTCCTTCAGCATCATCACCGAGAATGTCCCCTGTGGCACCACTGGCGTCACCTGCTCCAAGGCCATCAAAATCTTCTTAGGGAGGACGGAGCTGAAGCTGGAGGACAAGCACAGTGAGGTGATCCAGCTGGAGGAGGGCCACTACACGGCCTACACCACGCGGGAGGTGGGCCAGTACCTGGTGGTGGAGGCCAGCATGGGCATCATCGTGATCTGGGACAAGAAGACCACCGTGTTCATCAAGCTGGCTCCCTCCTACAAGGGCTCCGTGTGTGGGCTGTGTGGGAACTTTGATGACCGTACCTCCAATGACTTCACCACACGGGACCACATAGTGGAGAACTGCGAGCTGGACTTCGGGAACAGCTGGAAGGAGGCCTCCACCTGCCCGGATGTGACCACCACCCCAGACCCCTGCACCCTAAACCCACACCGCCGCTCCTGGGCTGAGAAGCAGTGCAGCATCATCAAGAGCAGGGTGTTTGCCACCTGCCACAGCAAGGTGGACCCCAAAGTCTTCTACGAGGCCTGTGTGCATGACTCCTGCTCTTGTGACTCCGGCGGGGACTGCGAGTGCTTCTGCTCCGCTGTGGCCTCCTATGCCCAGGAGTGCACCAAGGAGGAAGCCTGCGTGTTCTGGAGGACGCCCGATCTGTGCCCCATATTCTGTGACTACTACAACCCCCCCGACGAGTGCGAGTGGCACTATGAGCCATGCGGTGACCGCAGCTTCCAGACTTGCAGGGCCATCAACGGAATCCATTCCAACATCTCTGTGTCCTACTTGGAGGGCTGCTACCCCCGGTGCCCTGAGGACAGGCCCATCTACGATGAGGACCAGAAGAGGTGTATCACTGGGGACAAATGTGGCTGCTATGTCGAGGGCACCCACTATCCACCAGGAGCATCGATTCCCACCCAGGAGATCTGCGAGTCTTGTGTGTGCACTGACTCCTCCCATGTGAGCTGCGGGTGGGATGAAGGGAAGGTTTTCAACTCTACCCAGGATGGTCTCTTCTGTTACGAAGAGACCTGTGGCCCCAATGGGACAGTGTACCAGAACTTCACCATCTGTGCATCCACCACACTAACGCCATCCACCCTGGCGACTTCCACCTCAGTCCCCACCACCACAACCACCCACCTCACCACCACCACCAGCATCACCACCTCCATGACCTCCAGGACAGTGCTGAGTGTGACCCCAGACCCGTGCTGCTTCTGGTCAGACTGGATCAACGAGGACCACCCGAGCAGCGGCAGTGATGGTGGTGACCATGAGACTTTTGACAGTGTCTGCGTGGCTCCTGAGAACATTGAGTGCAGGTCGGCCACCGAGCCTCACCTTAGCTGGGAGGTGCTGGGCCAGAAAGTCCAGTGTAATGTCACCAGTGGGTTCTTTTGTAAGAACGAAGATCAGTTTGAAAACGGACCATTCGAACTGTGTTATGACTATGAGATACGAGTTAATTGTTGCCTGCCAATGGAGTACTGTATCACGTCCAGCTCACCCACCTCTCCACCAACTACCACGCCAACCACAACGTCATCAACCACACCAGCGCCACCGACCACCATGCCAACCACGCCATCGACCACCACACCAACTACGCCGTCCACCACCACGCCAAACACACCATCGACCACCAGGCCAACTACATCACTGACCACCACACCAGTCACGCTGTTGACCACCACACCAACCACGCGATCGACCACCACACCAACCACGCCACTGACCACCACACCAACCACACCATCATCAACCACACCAACGCCACTGACCACCACGCCAACCACGCCGTCGACCACCATGCCAACTACATCACTGACCACCACACCGATCACGCTGCTGAACATCACACCGACCACGCCGTCGACCACCACACCAACTATGCCATCAACCACCACGCCAACTATGCCGTCAACCACCACGCCAACCACGCTGTCGACCACCATGCCAACCACACCACCGACAACCACGCCAACCATGCCATCGACCACCACACCAACCACAACCACGCCATCGACCACCACTCCAACCATGCCATCGACCACCATGCCAACCATGCCGTCAACCACCACACCAACCACGCCACTCACCACCACACCAACTATATCACTGACCACCACACTGACCACACCAACCACATCATTGACTACTACGAATACTATGCCCTCCCCCACCACACCAACAACACCATCAACCACCACAGCAGTTGTGCCACCAACTACTACATCAACCAGTCTGATAACCACCACACCTACCACACCAACTATACCTACCACTTCACCAACCACCACACCTACCCCTCCAACAACCACCAAAACTATCTCTCCATCAACCACTACACCTACCACCTCACCAATGACCACACCTACTACTCACTGTATATATTGCGAATGGACTGGCTGGGTGGATTCTGGTAAACCCGAATTTGTGAAGCCAGGGGGAGATTTTGAAAGGATTGAAAACATCTGTGGATATTTTGGGAGAGCTACTAACATCTCCTGCAGAGCTGTAGAGTATCCTAATACTCCAATTGAAGACCTTGGACAGGTTGTGACATGTGATACCTCCGATGGGCTGGTGTGCAGAAACGAAGACCAAAAGCCAGGTGGAGTCATTCCTCAGCCATTCTGCATCAATTATGAGATCAACGTTGAGTGCTGTTGGCCATGCAACTTAACAACTGTCCCCACCAGCCCTACCACCATTATCTCGACCACCACACTGGAGACCTCGACTACAACACCCACCACCACAGTAACCCCAACAGCCACAGCCCCCACCACAACCACAGAGACCACAACACCTGTCACCAAAACCACACCCACCACCACAACCACAGAAATGACAACCACCACACCAGAGACTCCAACCATTTCCTCTGCCACCACAACCACAGAGACCACAACCCCCACCCCCATATCCACCACTACATTTACCCCAACCACTACAACCCCAGAGACGGTGACCCCAACCCCAGTGTCCACCACCACAGGGACCCCCACCACCACACTCAACACAACCATGAGGACCACAACTCCTACATCTGCCTCTGCCACCCCCACACCTCCTCCTGTGCCAACAACCACTGCGGTCACCTCCACCCAGACCAGTTTCTCTTCGACTGAGCCGACCACACTGGAGACCACACCAATCAAGTCTTCCAGCCTTGGTTGGGAGACTGGTGCCTCCACTGCTGTCTACTGCTGCTATTTGAATGGCACCTACTATGACCCAGGTGATCTGGTGTACAATGGGACCCATGGGAACACCTGCTATTATGTAAACTGCTCCCTGGACTGCACCCTCCAGTTCTTCAACTGGTCCTGCCCATCCACACCCTCCCCAACACCCTCGACGCTCTCCACACCAGTGTCCAGCAAACCAGTCACTGCCAATCCTTCCGGGTGCCTAGACTTCATTCCTCCAAGAGAGGAGAATGAGAGCTGGTGGCTGTGTAACTGCACAATGGCCATCTGCAAGCATGACAATGTGGTGGAGATCGTGGAGGTGGAATGCAAGCCGCCGCCCATGCCCACCTGCTCCAACGGCCTCAAGCCCGTGCAAGTCATGGACCCAGACGGCTGCTGCTGGCACTGGGAGTGTGACTGCTATTGCACGGGCTGGGGGGACCCGCACTTCGTCACCTTCGACGGGCTCTACTACAGCTACCAGGGCAACTGCACCTACGTGCTCGTGGAGGAGATCACCTCCACAGTGGACAGCTTCGGTGTCTATATCGACAACTACCACTGCGATGTCAATGACAAGGTGTCCTGCCCCCGCACGATCATCGTGCGCCACGAGACCCAGGAGGTGCTGATCAAAACTCTGCAGATGACGCCCATCAAGGTGCAGGTGCAGGTCAACAAGCAGGTGGTGGCCCTGCCCTACAGGAAGTACGGGCTGAAGGTGTACGAGTCGGGCATCAACTTCGTGGTGGACATCCCCGAGCTCGGAGCCCTCATCTCCTACAACGGCCTGTCCTTCTCCATCAGGCTGCCCTTCCAGCGCTTTGGCAACAACACCAAGGGCCAGTGCGGCACCTGCACCAACAGCACTGCAGACGACTGCGTGCTGCCCGGCGGGGAGGTCACCTCCAACTGCGAGCTGGCCGCTGACCAGTGGGTGGTGAACGACCCCTCCAAGCCACTCTGTGCCCACACTGACTTCACCACCCAGCGCCCAGCTGTCACACCGACTTTGCTCGAGAACTGCACCTCATCTCGCATCTGCAACCTCATCAAGGACAGCTTGTTTGCCCAGTGCCACCCCTGGGTGCCCCCCCAGCACTACTACGAGGCCTGCGTGTTCGACAGCTGCTTTGTGCCAGACTCGGGCATGGAGTGCGCCAGTGTGCAGGCCTACGCAGCCCTCTGCTCCCAGCAGGGTGTCTGTGTGGACTGGCGGGGACACACTGACAAGGCCTGTGCTGTCACGTGCCCAGCTCACAGGCGGTACCAGGCCTGCGGGCCCACAGAGGAGCCCACCTGCCAGTCAAGCTCCCCACAGAATTCCTCGATCCTGGTGGAAGGCTGCTTCTGTCCTGAAGGCACCACGAACTATGCCCCTGGCTATGACATCTGTGTGAAGATGTGCGGCTGTGTGGGACCAGACAATGTGCCCAGAGAGTTTGGGGAGCGCTTTGTCTTCGACTGCAAGGACTGTGTCTGCCTGGAGGGCGGCAGTGGCATTGCCTGCCAGCCCAAGAAGTGCAGCCAGGAGGCCCAGCCCACGTGCGAGGCAGAGGGCACCTACCTGGTCACCGAGGTCAACCCGGCCGACACCTGCTGCAACGTCTCCTCGTGCAAGTGCAACACCAGCCTGTGCAAAAAGGAACCCCCTTCGTGCTCTCTGGGCTTTGAGCTGAAGAGCAACATGGTGCCCGGGCAGTGCTGCCCGGTCTACTCCTGCGAGCCCAAGCAGGTGTGCGTGCACAAGAATGCAGAGTACCAACCCGGATCCCCAGTGTACTCCTCCAAGTGCCAGAACTGCATGTGCACCCAGGAAGTCAACAGCAGCACCCAGCTCAACATCATCGCCTGCACCCATGTGCCCTGCAATGTCTCCTGCGACCCGGGCTTTGAGCCTGTGGAGGCCCCCGGTGAGTGCTGCAGGAAGTGTCAGCAGACCCACTGCGTCATCAGCTTGCCAAGTGGCCAGCCCGTCATCCTGAAGCCTGGGGCCATAGAGAGGAACTCCGACAACAACTGCACCTTCTTCAGCTGTGTGAAGATCCACAACCAGCTCATCTCCTCCGTCTCCAACATCACCTGCCCGGACTTTGACCCCAGGAGCTGCGTCCCGGGCTCCATCACACTCATGCCCAACGGGTGCTGCAGGAAATGCATCCTTCTAAATGAGACCAGGGTGCCCTGCTCCACCATCCCGGTTGTCAAGGAAATTTCATACGCTGGCTGTGCCAAGAATGTCAGCACCAACTACTGCTCCGGGTCCTGTGGGACGTTCGCCATGTACTCGGCCAGCGCGCAGGCCCTGGATCACCTCTGCTCCTGCTGCAAGGAGGAGACGACCGTCCAGCGCCAGGTGGCCCTGGACTGTCCCAACGGAGGCTCGCTGAACCACACCTACACGCACATCGAGAGCTGCCTGTGCCAGGAAAGCGTGTGTGGGCTCCCGCAGGCCCAGCAGGCCCAGCAGGCCCGTGTGCGGCGGGCCAGCCCCCAGCTTCTGGACAGGGCATGA

XM_004851802.1 Coding sequence

LOC101721498 translation initiation factor IF-2-like

Length: 687 bp    Location: 22071118..22058050   Strand: -
>XM_004851802.1
ATGACGGTGGCACAACTGCTGCAACAGGGAAATAACACATCTGAGTCTCAGAACAACCTCAAAGCTGTCAGGGTCGGGGCCGAGACCACTTCGTGTCGCAAGGTCGCGCGCTCAGGGCTCGGATTCCCCGCTGCGCCCGCCCCTTCCGCCCAGGGCCCGTCCTTTCCCGGTCATCCCAGCCCCTTCCCGGCCAGGCTCCGCCCTCCACCCCACCCCACGCCAGCCTGTCACTCAGCAGTCACTCGGTCACTTGGGGAAAAGCGGGCGCCAAGGGCAGAGTGGGCTGGGTTGCCGCCAGTTGCCCTGTCCCAGTGTCCCCCGCCCCCGACTGTCCCAGCCCACGCCCTGAACCCTCCGGATGACGCTCGCCCAGCTCTTGGCGGCCATTGGGACCCCTACTCCACTTCTCTGCACATCTCGCGAGCCTCGGATGGCGCCCGAGAGCCCAGGACCGGCCACGCGCGGACCTGCGCCGCCACCTGGTGGCCGCCGGCGCAAACGGCACCCAGGATGCTCAGAAGAACATTCGCACGACTGGAGCCAGGGAGATGCAGATGCAGCACCAAGTCCCAGAGGGAACACTATGGGCCAAACGGCAGTGTGCATGGCAGGATGGTGTACATGGCTCAACCCAAGGCCTCTCAGGAATACGTCAAAAAGCCCCAAGAGAAGTTTACAGCAATCTGA

XM_004851798.1 Coding sequence

Muc5b mucin 5B, oligomeric mucus/gel-forming

Length: 9435 bp    Location: 21425755..21398648   Strand: -
>XM_004851798.1
ATGGGCACCAGGAGCAGGAGCTGGGCGCTGGCCTGGGCCCTCGTGGCCCTGCTCGTGGTGCGGCTGGCAGAGACCCAGACGCCGGCAGAGCTGAGCCTGGGGAACACAGAGCCCACCTCGGTGGACAGCGCCTATCCCACGGCCTCGCCTGCCCGGCGCCTGACCTTCATCCCACCCCTCGCCGTCTTCCCCAGTGTGAGCCCCCTGAACCCCGCGCACACGGGGCGCGTCTGCAGCACCTGGGGCGACTTCCACTACAAGACCTTCGATGGTGCTGTCTTCCGCTTCCCCGGCCTCTGCAACTACGTGTTCTCCTCGCACTGCGGCGCCGCCTACGAGGACTTCAACGTGCAGCTGCGCCGGGGCCTCGCAGGCTCCAGGCCCACCATCACCCACGTCGTGCTCAAGGCACAGGGGCTGGTGCTGGAGCTATCCAACGGCTCCGTCCTGGTCGACGGGCAGCGGGAGGACCTGCCCTACAGCCGTGCTGGGCTCCTGGTGGAGCAGAGCAGTGACTACGTGAAGGTCAATGTCCGGCTGGTCCTAACCTTCCTGTGGAACGGAGAGGACAGTGCTCTGCTGGAGCTGGACCCCAAGTTTGCCAACCAGACCTGCGGGCTATGCGGAGACTTCAACGGGCTCCCCGATGTCGGCGAGTTCTATGTGCACAACGCCAGGCTGAGCCCTCTTCAGTTCGGGAACCTGCAGAAGCTAGACGGTCCCACGGAGCAGTGCCAGGACCCGCTGCCCTCACCACCCGACAACTGCACGGATGGGGGGGACTTCTGCCGCCGCATCCTGTTTGGCCCGGCCTTCACTGAGTGCAATGGGCTGGTGGATGCCAGTGTGTACGCGGCTGCCTGTGCCCAGGACCTGTGCCGCTGCCCCACGTGCCCCTGTGCCACCTTTGCCGAGTACTCCCGTCAGTGCGCCCATGGGGGGGGCCAGCCGCAGAACTGGAGGGGCCCCGACCTTTGCCCCCCGACGTGCGCGCCCGGCATGCAGCACCAGGAGTGCGGCTCGCCCTGCACCGACACCTGCTCCAACCCCCAGCGCTCCCAGCTGTGCGAGGACCACTGTGTGGATGGCTGCTTCTGCCCCCCAGGCACGGTGCTGGACGACATCACGCACGCCGGCTGTGTGCCGCTGCCTCAGTGCCCCTGCACGCATGCCGGCCGCACCTTTGCCCCTGGGACCTCCTTCACCACCAGCTGCAGCTCCTGCACCTGCTCTGAGGGGCTGTGGCAGTGCCAGGAGCAGCCGTGCCCAGGCACCTGCTCCGTGCGAGGTGGGTCCCACATCTCCACCTATGATGAGAAGCTCTACGATGTGCACGGCGACTGCAGCTACGTCCTGTCCAAGAGATGCACGGACAGCACCTTCACGGTGCTGGCTGAGCTGCGGAAGTGCGGCCTGACAGACACTGAGAACTGCCTCAAAGCAGTGACGCTCAGCCTCAATGACGGGAACACGGCCATCCGCGTCCAGGCCAGTGGCGCTGTGTTCATGAACTCCATCTACACCCGGCTGCCCGTGTCGGCAGCCAACATCACCGTCTTCAAGCCCTCATCCTTCTTCATCCTGGTGGAGACAGGGCTAGGCCTGCAGCTGCAGGTGCAGCTAGTGCCCCTCATGCAGGTGCACATTGCCCTGGACCCCTTGCACCACGGCCAGATGTGTGGCCTGTGTGGGAACTTCAACCAGAACCAGGCTGATGACTTCACGGCCCTGAGCGGGGTGGTGGAGGGCACCGGCGCTGCCTTCGCCAACACCTGGAAGACCCAGGCCTCCTGCCCCAACGCCAAGAACAGCTTCGAGGACCCGTGCTCACTCAGCGTGGAGAACGAGAACTACGCCCAGCACTGGTGCGCCCTGCTGATGGACCCTGCCGGAGTCTTCTCTGCCTGCCACTCCTCCGTGAACCCTGAGCCCTTCCACTCGAACTGCATGTTCGACACCTGCAACTGCGAGCGGAGCGAGGACTGCCTGTGCGCGGCGCTGTCCTCCTACGTGCACGCCTGCGCCGCCAAGGGCGTGCTGCTCCGCGGCTGGCGGGACGGCGTCTGCACCAAGTACATGAGCAGCTGCCCCAAGTCCCAGAGCTACGCATACGTGCTGGACGCCTGCCAGCCCACCTGCCGCGGCCTGAGCGAGGCCGATGTCACCTGCGGCGTGTCCTTCGTGCCCGTGGACGGCTGCGCCTGCCCGGCAGGCACCTTCCTGGATGAGGCGGGCACGTGCGTGCCGGCCCACGAGTGCCCCTGCTACTTGCGTGGCAGCGTGGTGGCGCCTGGGGAGGTGGTGCAGGATGACGGTGTGGTCTGCTCGTGTGCGAGCGGGAAGCTAAGCTGCCTGGGAGCCCTGCTGCAGAGCAGCCCAGGTTGTGCGGCGCCCATGGTGTACCTGGACTGCAGCAATGCCTCGGCCGGCACCCCTGGGGCCGAGTGCCTCCGAAGCTGCCACACGCTGGACGTGGAATGCTTCAGCACACACTGCATCTCGGGCTGCGTGTGCCCCCCGGGGCTGGTGTCCGACGGGCGTGGGGGCTGCGTGGCCGCGGAGGACTGTCCCTGCATGCACAACGAGGCCAGCTACCGGCCCGGGGAGACCATCCGCGTCGGCTGCAATACCTGCACCTGCAGGAACCGGCGCTGGGAGTGCAGCAGCCGGCCCTGCCTGGGCACCTGTGTGGCCTACGGGGACGGCCACTTCATCACCTTCGACGGCGAGCGCTACAGCTTCGGAGGCAGCTGCGAGTACACGCTGGCCCAGGACTACTGCAGGGGCAACGGCAGCGCCAAGGGGACCTTCCGCATCGTCACCGAGAACGTCCCCTGCGGAACCACGGGGACCACCTGCTCCAAGGCCATCAAGATCTTCGTGGAGAGCTATGAGCTGATCCTCCATGAAGGGGGCTTCAAGGTGGTGGAAAGGGGGCAGAGCAGCGACCTGCCCTACAAGGTCCGCTACATGGGCATCTTCTTGGTCATTGAGACCCGCAGCGGGATGGCTGTGTCCTGGGACCGGAAGACCAGTGTGTTCATCCGCCTGCCACAGAGTTACAAGGGCAGGGTCTGTGGCCTGTGTGGGAACTTCGATGACAATGCCATCAACGACCTGACCACGCGCAGCCAGGCCGTGGTGAGCGACGCGCTGGAGTTCGGAAACAGCTGGAAGTTCTCGCCCACCTGCCCAGATGCCAGGGCACCCCAGGACCCCTGCACGGCCAACCCATACCGCAAGGGCTGGGCCCAGAGGCAGTGCAGCATCATCAACAGCGCCACCTTCGCCGCCTGCCGCTCCCAGGTCGACTCCACCAAGTACTACGAGGCCTGTGTGCGTGATGCGTGCGCCTGTGACTCGGGGGGCGACTGCGAGTGCTTCTGCACTGCTGTGGCCGCCTACGCCCAGGCCTGCCACGACGTGGGCGTGTGCGTGTCCTGGAGGACGCCCGACATCTGCCCGCTGTTCTGCGACTACTACAACCCCACTGGGGAGTGCGAGTGGCACTACCAGCCCTGTGGGGCGCCCTGCCTGCGCACCTGCCGGAACCCCAGTGGCCGCTGCCTGGTTGACCTGCCGGGGCTTGAAGGCTGCTACCCTAAGTGCCCGCCTAGCCAACCCTTCTTCAGTGAGGACCAGATGCAGTGTGTGGCCCAGTGCGGCTGCTACAGTGAGGATGGAAAGTACTACGACATCGAAGCACAGGTCCCCACGGCTGAGAACTGCCAGCGCTGCCGCTGCACCCCAGATGGCCTCCAGTGCACTCACAGCCTCGAGGCCTGCACGTGCACCTATGAGGACCGGACCTACAGCTACGGAGACCTCGTCTACAACACCACTGATGGCCTTGGCGCCTGCTTAACGGCTATCTGTGGAGACAACGGGACCCTTATCCGCAGGGTGGTGGAGTGTCCCGGAACCCCGTCTACCACACCATTCACCTTCACCACCACCTCCAACGTCCTCCCCACCACAGGCTCCGTGCCCACCGCCTCTACCGTGTGTGTCCGAAAGGTCTGCCGCTGGTCCCCCTGGCTCGATGGGGACCACCCAGAGCCCGGCATGGGAGGTGGGGACTTCGAGATGCTCACCAGACTGAGGGAGCAGGGGTACCCACTGTGCCTGGCACCTGCTGCCATCGAGTGCCGTGCGGAGCAGTTCCCAGGGTCACCCCTGCAAGAGCTGGGCCAGAAGGTGGACTGTGATCCAGCCAAGGGTCTGATCTGCCTCAACAGTGAGCAGAGCCCCCCACTCTGCCACAACTACCAGCTGCGGGTCCTGTGCTGTGATCCTGTGCCCTGCAGCTCCTCCCCAGCTCCCCCTACCTCCACAACAACACTCACCACTCCCTGGGCCCTGTCCAGCCCCACCCTGACCTCATCCAGCAGAGGGATCACCACATCCACGGCACTCAGCTCTCTGTTGACCACAGAGCTTACCCTACAGACCAGGTCCCGCTCATCAGCCACACCCAAAACTGACTGGGTCAGTAGCACCCTTGCCCCCAGTACCTCTACCTGCCGGCCCCAATGCCAGTGGACAGAGTGGTTCGACGTGGACTACCCCAAATCTGAGAGGGCCGGGGGAGACATGGAGACCTACGAAAGGATCAGAGCTGCGGGGGGAGCCCTCTGCCCACAGCCTGAGGACATCGAGTGCCGGGCCCAGAACTACCCCTCAAAGACCCCCGAGGAGCTAGGACAGCACGTGCACTGCAACCTCAGCTTCGGCCTCGTGTGCCACAACCAGGAACAGGAGGGAGTGTTCCACATGTGCTACAACTACAGGATCCGCGTTCTGTGCTGTGATGACATCAGCCACTGCAAGAGCCTGCGCACCAACACCCCAATGGCCACCACACTGATTACGGCCAGTAACACACAGGGGACAGCTACCACCACAGTGAGCACGGCCACCACACCACTGACCACCACACAGGAGACAGCCACCACCACACTGAGGCCAGCCACCACACCACTGAGCACCACACAGAAGACAGCCACCACCACACAGAGCACAGCCACCACACCACTGAGCACCACACAGGAGACAGCTACCACCACACTGAGCACCACACAGGAGACGGCTACCACCACAGTGAGCACCACACAGGAGACGGCCACCACGACACTGAGCACCACACAGGAGACGGCCACCACCACACTGAGAATGGTCACAACCACGCCACTGAGCACCACACAGAAGACAGCAACCACCACAGTGAGCACGGCCACCACCACACCATTGAACACCACACAGGAGACGGTCACCACCACACTGAGCACAGCCACAACACCACTGAGCACCACAGAGGAGATAGCCACCACCAGAGTGAGCACAGCCACCACCACACCACTGAGCACCACACAGGAGACGGCCACCACCACACTGAGAACGGCCACCAGCAAACTACTGAGCACCACACAGAAGCCGGCCACCACCACAGTGAGAACAGCCACCACCACACCACTGAGCACCACACAGGAGACAGTCACCACCACAACACCACTGAGCACCACACAGGAGACGGCCACCACCACACTGAGCACGGCCACCACCACACCACTGAGCACCACACAGAAGACAGCAACCACTACAGTGAGCACGACCACCACCACACCATTGAACACCACACAGGAGACAGCCACCACCACACTGAGCTCGCCCACCACCACAGCACTGAGCACCACACAGAAGACAGCAACCACTACAGTGAGAACGGCCACCAGCACACCACTGAGCACCACACAGGAGACGGCCACCACCACACTGAGGACAGCCACCACACCACTGAGCACCACACAGGAGACAGCCACCACCCCACTGAGCACGGCCACCACCACACCACTGAGCACCACACAGAAGACAGCCACCACCACATTAAGCACGGCCACCAGCACGCCATTGAACACCACACAGGAGACGGCTACCACCACACTGAGAACGGCCACCACCACACCACTGAGCACCACAGAGGAGACGGCCACCACCACACTGAGCACGGCCACCACTCCCCTGACTGCCAGCATTGTCCCCACACAACCTCTGGTCACCAGCCTGGTGCAAACGACCACCACACACCGGCCATCCACCCCCTACACCGAGGTCAGCACACGCAGGATGCAGACATCTCTAGGCACCACAACCGAGGCCACTACCAGGCAGGGCACGACCGGCTGCCAGCCCAAGTGCCAGTGGACAGAGTGGTTTGATGTGGACTTCCCCACGTCGGGGGTCCCAGGTGGGGATGTGGAGACCTACGACAACATCAGGGCCGCAGGGGGCAAGATGTGCCTAGCACCTGAGAAGATTGAGTGTCGGGCGGAGAACTACCCAGAGGTAAGCATCGACCAGATTGGGCAGGTGGTGGTCTGCAGCCTGCAGACTGGGCTGGTGTGCCGCAATGAGGACCAGACAGGCATGTTCACTATGTGCTTCAACTACAACGTGCGTGTGCTCTGCTGCGACCGTAGCCACTGCCCCACCATGCCGTCTCCCACCTTCACACTGTGGCCTAGTCTCTACACCCAGACCCTGACCACCTTGGCCACCAGCAGGTGGACGGGGACAGGCTTCTCCACAGAGACCAGCACCTGGAGAAGTGCCAGCCTCCCCATCACCTCCGAGAGTCCCTCTGTGCCTCCCGCCTCCACCAGCAGCCTTCCACACACCTCCGCGCCATGGACGCCGTGGCCCCTGAGCAGCAGCGCTTCCTCAGCGGTGCCTGTGACTTCCCACCCTCTCAGTACTCTAGGCACCACCCCAGTGCTGACCACCACGGCAGGCCCTCCGCCAGCCACCGGCTCCTTCAGGCCCCCTGCCTCCACCCCAGGCACCGTCCCTACCTCCGGGGTCCCCACCAGCAGCCTGCTGACCTCCAGTGTGTCTGCTGGTCCTTCCTCGAGCCTCACCACACTCGGGCCCACTGCGTCCTCCACGCAGCTCTGCTTCTGCTGGGCGTTTGGACAGCTGTTTTCACCCGGGGACGTCATCTATAATAAGACTGACAGAGCTGGATGCCACTTCTCCGCCATCTGCAACCAACACTGTGACATCGACCGCTTCCAGGGCACCTGCCCCACGTCCCAGCCTCCGATGCCCTCCACCTCTGTGGCGTCCCCCTCCCCACTCCCTGGCTGTGACAACGCTGTCCCTCCCCGACAGGTGAATGAATCCTGGACGCTGGACAACTGCACAGTGGCCAGGTGCGAGGGTGACAACCACGTGGTCCTGCTGCCACCAGAGCCCGTGGCCAACGTGAGCTGTGTGAACAAGCACCTGCCCATCAGAGTGTGGCACGAGCACCAGCCCTGCCATTCCCACTACGAGTGCGAGTGCTCCTGCAGCGGGTGGGGGCATTCGCACTACTCCACGTTCGACGGCACGACCTACTCCTTCCCGGGCAACTGCACCTACATCCTCGTGAAGGAGATCCACCCGCGCCACGGGAACCTGAGCATCCTCTTGCACAGCCACTACTGCGCCACTGGCCCTGGCGCCAGCTGCCCCCGCGCCCTCCAAGTGCTGTACCTGTCCATGGACATCATCCTCACCACTGCCGATGTGGGGGGTGTGGAGCAGAGCCTGGTCCTGTTCAATGGAGTGCGAGTGAGCGGGCCCCTCAGCAAGGATGGGGTGAGCTTGTCCGTGACCGCGGCCACCAACATGCACATCGACATCCCGGCCATCGGCGTGAGCATCTCCTTTAGCGGGAGGGTCTTCCAGGTCCGGCTGTCCTACAGCCACTTCAGCCACAACACAGAGGGCCAGTGCGGCACCTGCACCAACAGCCAGAGTGATGACTGCCGGCGGCCAGACGGCACCATGGCCCCCACCTGCAAGGACATGGCTCCGACCTGGCTGGTGCCTGGCAGCAGTGGAGGGGGCTGCAGGCCACCAACCAGCCCACCCCCCAGCGCCAGCCCCCTGCCCCCGGTGCCCAGCATTTCCACGGCCACCACCTCCACCCCGTGCGCCCCGGGGCCCCTCTGCAAGCTGCTACTGAGCTCGGTCTTCGCCGAGTGCCACGCTTTGGTCCCGCCAGACTCCTTCTTCAGCAGCTGCATCAGCGACCACTGCCAGGCGGGTGACCGGGAGGTGCCTTGCCAGAGCCTGGCAGCCTATGCGGCGCTCTGCCGAGCCCGGGGAGTGTGCATAGACTGGCGCAACGCCACCAGCGGGCTGTGTGAGCTTTCCTGCCCAGCCTCCAAGGTGTACAAGCCCTGCGGCCCCATGCATTCAGTCTCCTGTGACTCCAGGAACCAGAGCCCCCTGGATAATGGGCTGGCCCTGGCCGAGGGCTGCTTCTGCCCTGGGGACCAGCTCCTCTTCAGCTCACACATGGACATCTGCGTGCCAGAATGCCCTTGTGTGGGGCCAGATGGACTCCCCAAGTTTGTGAGTGGCACTGCCCACCCTGCTTGGGCTGAGGGGGAAGTGGAGAGGCCCGGCCAGCGGTGGGTCAGTGACTGCCAGGCCTGTGTGTGCGACATGGCCTCGGTGTCCGTGCAGTGCTCGCCCGTGCAGTGCAAGGCCCAGGGCCCTGCCCCACCATGCGAGCAGCACGGCTTTGTGTTAGTGACCAGGCCGCAGGCTCACAGCCCCTGCTGCCCCGAGACGCTGTGTGTCTGCAACGTGAGCACCTGCCTCCAGGCCCCACCCACATGTCCCCCGGGCCAGGAGCTGATCCCGGAGGAAGGCCACTGCTGCCCCACCTTCCGATGCCAGCCCAGACTCTGCGAGTACAACGGCACCATCTATGGGGTTGGTGCAACCTTCCCAGCGCTCTCTCCCTGCCACACGTGCACCTGCCTCTCCGGGCCCAGCCAGGAGCCGGTCGTGCAGTGTGAAGAGCGCACCTGCAGCCCCTGCCCCCAGGGCTTCGTGCACTCCAGGGTGTCTGGGCAGTGCTGTGGGAACTGCGTGCAGGCTGCCTGCTTCACTCCAGAGGGCCAGATAGTGCAGCCCAACGAGACCTGGGTCGACAACCATGTGAACAACTGCACCAAGTACCTCTGCGAGGCCCAGAGCGGGGTGCCTGTGCTGACGCCACAGCCCGTGTCTTGCCAGGACGTGTCCCTCTGCAGGGGCATCCTCAGGAGAACTGGCTGCTGCTACACCTGTGAGACAGAAGAGGATGCATGTCAGGTCCACGCCAACGTGACTGTCCTGCGGCACCAGGGCTGCGAGGCTGTGGTCACTGTCACCTTTTGCGAAGGCTCCTGCCCTGGAGTGTCCAAGTACTCCATGGAGGCCCAGACTGTGCAGCACCAGTGCAGCTGCTGCCAGGAGAGCAGCACCCACCAGCAGGCCGTGACCTTGCAGTGTCCGGACGGCACGGCCATCTGGCACACCTATACCCAGGTGGACGCATGCAGCTGCACCACAGCCTGCAGGCCCTGGCCCATGAGCCCCAGGGGCGCCTCCGTCTAG

XM_004851799.1 Coding sequence

Muc5ac mucin 5AC, oligomeric mucus/gel-forming

Length: 8364 bp    Location: 21461108..21439034   Strand: -
>XM_004851799.1
ATGGGCGCCGGCCCGGGGATGCTGGCCCTGCTCTGGGCCCTGGCCTGTGCCCAGCACTCAGGCTGGGCTCAGGAGGACGCCGCAAAACTCAGCCATGAGATCTCCCCCGACCTCTCTTCCCAGCGAGGGCATAGCGGCCACTCACTCCTTGGGGTGACTGTCATCCCCCCTCTGATGGCCGTCCCTGTACTACGAGCCCTGAACCCCGCGCACACGGGGCGCGTCTGCAGCACCTGGGGCGACTTCCACTACAAGACCTTCGATGGCGCTGTCTTCCGCTTCCCCGGCCTCTGCAACTACGTGTTCTCCTCGCACTGCGGTGCCGTCTACGAGGACTTCAACGTGCAGCTGCGCCGGGGCCTTGCATCCAATACCACGGCGCCAAGCAGGATCATCATGAGGCTCAGCGGCCTGGTCGTTGAGCTGACCAGGGACTCTGTCCGGGTCAACGGCCACCTGGTCCAGCTGCCCTTCAGCCAGGCCGGGGTCCTCATAGAGCGCAGCAGTGGCCACCTGAAGGTGGTGGCCAAGCTGGGCCTGGTGTTCACATGGAACCTGGATGACAGCCTCACGCTGGAGCTGGACACCAAATATGCCAACAAGACCTGCGGGCTCTGTGGAGACTTCAATGGCGTCGCTGAGGCTGGCGAGTTCCTGTCCCACAACGCCAGGCTGACTGCTCTGGAGTTCGGGAACCTGCAGAAGATGGATGGCCCCACGGAGCAGTGCCAGGACCCCAGGCCCACACCCCAGAACTGCTCCACCAGCCCCGGCATCTGTGAGGAGTTGCTGAGCAGCCAGCCCTTTGCGGGCTGTGCAGTCTTGGTGGACGTCAGCAGCTACTTGGAGGCCTGCCAGCAGGACGTCTGCCACTGCGAGCACCCTCACCTTCCCAGCTGCCTCTGCCACACCCTCGCCGAGCTCTCCCGGCAGTGTGCCCACGCTGGCGGGCAGCCCCAGGACTGGCGGGGTCCCGACCTCTGCCCCCCGACGTGCGCGCCCGGCATGCAGCACCAGGAGTGCGGCTCGCCCTGCACCGACACCTGCTCCAACCCCCAGCGCTCCCAGCTGTGTGAGGACCACTGCGTGGCTGGCTGCTTCTGCCCGGAGGGGACGGTGCTGGATGATGTCCACCACTCTGGCTGTGTCCCCGTGTCCCAGTGTGCCTGCATGTACAACGGGACGCCCTACGCGCCGGGGGCCAGCTACTCCAGGGACTGCACCGACTCCTGCGTTGGAGGTCACTGGAGCTGCCGGGAGCTGCCATGCCCGGGCACCTGCTCCGTGCTGGGCGGTGCCCACTTCTCCACGTTCGACGAGAGGCAGTACACAGTGCATGGCGACTGCAGCTATGTGCTGACCAAGCCCTGCCATGGCAGTGCCTTCGCTGTGCTGGCCGAGCTGCGCCGGTGTGGGCTGACCGACAGTGAGTCCTGCCTGAAGAGCGTGACACTGAGCCTGGGCGGGGGACAGACGGTGGTGGTGGTGAAGGCCGGCGAGGCGGTGTTTGTGAATCAGCTCTACACCCAGCTGCCAGTCTCCGCAGCCAATGTCACCATCCTGAAACCCTCTACTTTCTTCATCATTGTGGAGACCCAGCTGGGGCTGCAGCTGCGTGTCCAGCTGGTGCCCACGATGCAGCTGTTCGTGCGGTTGGCCCCCGAGCTCCGGGGACAGACCTGCGGTCTCTGTGGGAACTTCAACCAGAACCAGGCCGACGACTTCCGGACCATCAGCGGGGTGGTGGAGGGCACCAGTGCTGCCTTCGCCAACACCTGGAAGACCCAGGCCTCCTGCCCCAACGCCAAGACCATCTTCGAGGACCCCTGCTCGCTTAGCGTGGAGAATGAGAAGTACGCCCAGCACTGGTGCTCGCTGCTGACAGACGCTGATGGCCCCTTCGCCCAGTGCCACGCCACCGTGAGCCCCAGCTCCTACCACTCGAACTGCATGTTCGACACGTGCAACTGCGAGCGCAGCGAGGACTGCCTGTGCGCGGCGCTGTCCTCCTACGTGCAGGCCTGCGCCGCCAAGGGCGTGCTGCTCCGCGGCTGGCGGGACGGCGTCTGCACAAAGCCCACGACCACCTGCCCCAAGTCGATGGCCTACCAGGAGCACCTCGGCACCTGCCAGCCCACCTGCCGCGGCCTGAGCGAGGCCGATGTCACCTGCGGCGTGTCCTTCGTGCCCGTGGACGGCTGCGCCTGCCCGGCAGGCACCTTCCTGGATGAGGCGGGCGCGTGCGTGCCGGCCCACGAGTGCCCCTGCTACCACAGGGGTGCCATGGTCCCCAACGGTGAATCTGTGCATGACAGTGGGGCTGTCTGCACCTGCACACGGGGCGCACTGACCTGCATCGGGGGCCCTGTGCCCAGCCCAGTGTGTGATGCTCCCATGGTGTACTTTGACTGCCGCAACGCCACGCTGGGGGCTGCTGGGGCCGGCTGCCAGAAGAGCTGCCACACCCTGGACATGGCCTGCTACAGCACCCAGTGCATCCCAGGCTGCGTGTGCCCCAACGGGCTGGTGGCCGACGGCGACAGAGGCTGTGTTGCCGAGGAGGACTGTCCCTGTGTGCACAACGAGGCCAGCTACCGGCCCGGGGAGACCATCCTTGAGGGCTGCAACACCTGCACCTGTGAGAACCGGATGTGGCGGTGCACGGACGAGCCCTGTCTGGCCACCTGTGCAGTCTACGGGGACGGCCACTTCCTCACCTTCGACGGGCAGCGCTATACCTTCAGCGGGGCCTGCGAGTACACGCTGGTGCAGGACCAGGGTGGCGAGAACGGCAGTGCCCCGGAAGCCTTCCACGTGGTCACCGAGAATGTCCCCTGTGGCACCACGGGGACCACCTGCTCCAAGGACATCAAGATTTTCCTGGGGAGCTACGAGCTGAAGCTGAGCAGCGGGAAGGTGGAGGTGGTCCAGATGGGCGCCGGGCAGGAGCCGCCCTACACCGTGCGCCAGATGGGCATCTACCTGGTAGTGGACACCGATGCTGGCCTTGTGCTGCTCTGGGACCGGAAAACTACTCTCTTCCTCAGGCTCAGCCCTGAGTTCAAGGGCAGGGTCTGCGGCCTGTGCGGGAACTTTGACGACAATGCCATCAACGACCTGACCACGCGCAGCCAGGCTGTGGTGAGCGATGCGCTGGAGTTTGGGAACAGCTGGAAGTTCTCGCCCACCTGCCCGGACGCTCAGGCACCCCGGGACCCCTGCACGGCCAACCCATACCGCAAGGGCTGGGCCCAGAGGCAGTGCAGCATCATCAACAGCGCCACCTTTGCCGCCTGCCACACCCACGTGGAGCCAGCCAAGTACTATGAGGCCTGTGTGAGCGACGCGTGTGCCTGTGACTTGGGGGGCGACTGCGAGTGCTTCTGCACTGCTGTGGCCGCCTACGCCCAGGCCTGCCACGAGGCAAGGGTGTGCGTGTCCTGGAGGACGCCCGACATCTGCCCGCTGTTCTGCGACTACTACAACCCCTCCGGGGAGTGCGAGTGGCACTACCAGCCCTGCGGGGCGCCCTGCCTGCGCACCTGCCGGAACCCCAGCGGCCGCTGCTTGCAGGACCTTCGTGGCCTGGAAGGCTGCTACCCCAAGTGCCCCCCGGGGGCCCCCATCTTCGACGAGGACACGATGCAGTGTGTGGCCGAGTGCCTACTCCCCACCCCGGCGCCACGCTGCCACATCCGCGGGAAGTCGTACCGGGTGGGCACGACGGTGCCCTCTGGGGAGAACTGCCACTCCTGCGTCTGCACTGAGAGCGGTGTGCACTGCACCTATGACACCAAGGCCTGCTTCTGCACCTATGACGGCCGGCGCTTCGGGCCAGGGGCTGAGCTCTATCACACGACGGATGGCATGGGTGGCTGCCTCTCTGCAAGCTGCGGGGTCAATGGCACCATCGAGAGGAGGGTCTACCCCTGTGGCTCCAGCAGCACCGCCCCGCCCACCACCTTCGCCTTCTCCACACCCCGCCTCCCTCTGCCCACAGCCGAGAGCTCGACGCATGCCCCTGGCACATGGCCCCGCCCCACCAGTAGCATGGCACATCCAAGCCCCCAGAGCAGCACCAAGTCCTCTGCCACCCACACATCCTCTGGGGAGACGTGGGCCGTGGCCTCCACTGCCTGTGGGGAGGAGTGCGTGTGGTCCCCGTGGCTGGACGTCAGCCGCCCAGGAAGCGGCATCGACAGCGGGGACTTTGACACACTGGAGAACCTCCGTGCCCATGGACACCGGCTGTGCCACGCGCCCAGGGAGGTGCAGTGCAGGGCAGAGGACGTCCCTGATGTGCCCCTTGGTGTCCTGGGGCAGCGTGTGGAGTGCAGCTCCACTGTGGGGCTGACCTGCCACAACCGGGACCAGGTGTCCGGGCTCTGCGACAACTACCAGGTCCGGGTCCTGTGCTGCCGCCCTGTGCCCTGCTCCATCTCATCTGGCCCCACAGCCTCCTCCTCGGCTCACATCACACCTAAGGGCCCAGACACCATCCTCATGGCCAGCACTGCACCTGCCCCAGGGAGTCCCACACCAGACAGAGCCACGCTCCTGACCTCCAGCCCGAAAGTGGAGCCAACCGCCTTGTCCTGTCTAAGACATCAGTGCAACTGGACTGGCTGGCTCGACGGCAGCTACCCTGCTCCTGGCAGAGACAGCGGGGACTTTGACACCTTGGTTGAACTGCGGGAGCGAGGATACAAGTTCTGTGACCGGCCCCGGAATGTGGAGTGCCGGGCCCAGTTCTTCCCCCACACACCACTGGCTGAGCTGGGGCAGCAGGTGACCTGCAACACTGAAGTGGGGCTCCTGTGCCTGAACCGGGAGCAGCTGCCACCGATCTGCTACAACTACCAGATCCGCATAGAGTGCTGTGAGGTGGTGCACAGCTGCACGACGGCCAGCACAGCTGTGACCGTGACCACAGAGGAGGGCAGGACCACCCGGACCCGGGGCTCAGTGTCCACCAGGGGAACCAGCTCAGGCCCCACAACCACAAGAGGTACCAGCTCAACACCCACAACCACAAGCACCAGCTCAACACCCACAGCCACAAAAGGCACCAGCTCAACACCCACAACCACTACAGGCACCAGCTCAACACCTAGAACCACAACAGGCAACAGCTCAACCCCCAGAACCACAACAGGCACCAGCTCAACACCCACCGACACAACAGGCACCAGCTCCACCTCCACCTCCACCAGGAGCATCAGTTCCACCGTCATGCACACAGCCAGCTCAATCTCCACTCCGAAACTCAGCTCCCCCTCCATCCACAGCACCACCTCTACACCCGCACCCCACACCAGGGCCACCTCTGTCTCTGGGTCCAGCCCCAGCTTCTCGTCCTCAGCCTCTATCTCATTAACCGGGGCCAGAAACTGCCGGCCCCAGTGCACCTGGACCCCCTGGTTTGACGTGGACTCTCCCAAGCCCGGGTCCCGTGGTGGGGACCTGGAGACCTATAACCACATCCTCCAGAGGGGACACAGCATCTGCCACCGGCCTGAGGAGGTCACAAGGCTGCAGTGCCGAGCTCAGAGCCACCCCGAGGTCCCCATCGCCACCCTGGGCCAGGTGGTGCAGTGCAACCGTCACGTGGGCCTGGTGTGCCGGAACCGTGACCAGCAGGGGCCCGTGGGTCTGTGCCTGGACTATGAGGTGCGTGTGCTCTGCTGCCATGTGCCCGATGGCTGCCCCGCCAGCACAGTGACCCCCCCGGTGACCTCCAGCCCAGAGACCTTTTCTTCAAGCGTGTCCTCCATGACGTCCTCCAGCTCTGCGGTCTCCTCACCCCTCAACTGTTTCTGCCTTGTGTCTGGCCAGCTGTATTCTGCAGGGGCGGTCATATACCACCAGGTGGACCTTGACGGCCACTGTTACCACGCACTGTGCAGCCGGGACTGCCATGTGGTCAGGGGTGTGGGCCGCACCTGCCCGACCCTCACCACAACCCCCACACCAGCTCTGCCTGTGTCCCCGACCACCTCCTCAAACACCTGCCTGAATGTGGTCCCCCAAAGAAAGAAAGGTGAGACCTGGGCGATGCCCAATTGCTCCCAAGCCACCTGTGAGGGTGACAACATCGTCTCCCTGAGCCCACGCCTGTGCCCGGAGCTGACGCCACCATTCTGTGCCAACGGCTACCCGGCCCTGAAGGTGGCCAATGCCGACGGCTGCTGCCAGCACTACCAGTGCCAGTGCGTGTGCAGCGGCTGGGGTGATCCGCACTACATCACGTTCGATGGCACCTACTACACCTTCCTGGACGCCTGCACCTATGTGCTGGTGCAGCAGATCGTACCGGTGTTCGGCCACTTCCGTGTGCTGGTGGACAATGATTTCTGCGATGTGGAGGAGAGGGTGTCCTGTCCACAGTCCATCATTGTCGAGTACCATGAGGACCGGGTGGTGCTGACCCGCAGGCTGGTCGGGGGGGCCATGACCAACCAGATCATCTTCAACGGCGAGGTGGTCAGCCCTGGCTTCCAGGAGAATGGCATCGCCGTGTCCCGTGTGGGCATCAAGATGTACGTGACCATCCGCGAGCTGGGCGTGCAGGTCATGTTCTCGGGGCTCATCTTCTCCGTGGAGGTGCCCTTCAGCACGTTTGCAAACAACACTGAGGGCCAGTGCGGCACCTGCACCAATGACCAGAAGGACGAGTGCCGGATGCCCGGGGGTGCAGTGGCCACCTCCTGCTCGGAGATGTCCAAACACTGGCGGGTGGACACCCCCGGCCAGCCCTTCTGCCGAGGGCCACCCCCCACACCCACCTCTGCGGTGCCCGAGTCCCCGGCACCCACCTCTGGGGTGCCCGAGTCCCCAACACGCCCCCGGCACACCCTGTGCCCGTCATCGCCCATCTGTGAGCTGATCCTGAGCGAGGTCTTTGAGCTCTGCCACTCTGTGATTGAGCCGCTGCCATTCTTCGAGGGCTGCGTCTTTGACCACTGCCATGAGACGAAGCCAGAGGTGGTGTGCTCTGGCCTGGAGCTGTATGCCTCGCTGTGTGCGGCCCAGGGCGTGTGCGTGGACTGGAGGGCTCGGACCAACAACTCGTGCCCCTTCCCCTGCCCTTCGGACAAGGTGTACCAGCCCTGCGGCCTGTCGGACCCACCCTACTGCTATAGGAGCAACGCCAGCTCTCCGGCCCTCCCTGAGGCTGGCCGCATCACAGAAGGCTGCTTCTGTCCAGATAACCTGAAGCTGTTCAGCGACAGCGCCCTCGTCTGTGTGCCCAAAGACTGCCCCAGCTGCCCCGGGCCCCATGGGGAGCCGATTCAGCCGGGCCAGATCGTCAGCAAGGACTGCCAGGAATGTGTCTGCGACCCGCTCACAAAGTCCATGACCTGCCAACAGAAGGCCTGCCCCCTGCCACCTGCCTGCCACACTCCTGGCTTCGTGTCAGTGTCCACTCTCCCCAGGGCTGGCCAGTGCTGTCCCCAGTACAGCTGCGTGTGCAACTCCACCTACTGCCCCAAGCCCCAGGACTGCCCCAAGGGCTCCCGCCCGATCCTGACCCACGAGGAGGGAGCCTGCTGCCAGAGCCAGAAATGCAGTGAGTACTGGACCGCATGCAGCGTCAATGGGACCCTCTACCAGCCTGGCGCCGTGGTCTCCTCCAGCCTGTGCCAGACGTGCCGCTGTGAGGTGCCCAGCAGCCCCAATTTAGACGGCTTCATGGTCAGCTGCAAGACCCAGATCTGCAACACCGACTGCCCCATGGGCTTTGAGTACCAGCCCCGCGCTGGGCAGTGCTGCGGTGAGTGTGCTCAGAAGGCCTGTGTCGTCGAAGGGTCACCCTGCAGTGCGGCCCCCTTCCAGCCTGGCGAGTCCTGGTCCGACCCCGGGAACCCCTGCGTGCACCATGAGTGTGAGGCCTCTGGAGAGCAGCTGGAGGTGGTGACAGTGAAGAGGGAGTGTCCCCCTCTGAGCTGCCCTCGGGCCCAGGCCCAGCTGAGCCAGGATGGCTGCTGCCTCCTCTGTCCACTGGTGCCAACAGCGCCCCAGGAATGGCCCTGCACCCTGCACCACCGCGAGCAGGTCCTCCAGCGCGAGAACTGCAGCTCTACCACGCCCGTGCGCCTCTCCTACTGTGAGGGCAACTGCGGAGAGAGCACCTCCAGGTACTCCCTGGGGGCCGACACCGCGGAGCACAAGTGCAGCTGCTGCCAGGAGCGGCGGACCTCGAGGAAGACAGTGATGCTGAGCTGTGCGGACGGCTCCAGCCGGGCCTTCAGCTACACCCAGGTGGAGGAGTGTGGCTGCCAGGGCCTGCAGTGCCAGGCGCCCGCGTCATGGGAGGCGGAGTCCGGGGAGAGCCAGGAGCAGGGGCCCAGGCCTCCTCAGTGA

XM_004851803.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 2562 bp    Location: 22149760..22144255   Strand: -
>XM_004851803.1
ATGGACAAGGCCAGTGTCTCCTGCTCCAGCTTGGAGCCCCGTGCGGCCGCCGCCCGGGAGCTGCTCTTGGCTGCACTGCAGTACCTAAGCCAAGACCAGGTGAAGCGCTTCCTCCTCAAGCTGCGGGACGCGCCCNGTGGACGGCTGGAGCACGCGGTCGCCGTGGACCTTGCGGACCAGCTGACCCACTTCTACGGGCCAGAGCCCGCGCTGGACGTGACCCGCAGGACCCTGAAGAGGGCTGACGTGCACGACGTGGCGGCTCGGCTCAAGGCGCAACGGCTGCAACGGCTCGGCCCCAGCTCCGCGGCGCTGCTCACCGTGTCGGAGTTTCAGAAGAAATACCGCGAGCGCGTGCTGCAGCAGCACGCCGAGGTGAAGGAGCGCTTCACCAAGCTGCTCATCGCGCCCGAGAGCGCGGCCCCCGGGGAGAAGGAGGTGGCGCTGGGGCCTGCGGAGAAGCCCAAGCCGGGGCGTGCGTGGCGCTCGGACACACGCACCTTCAGCCGGCTGCTCAGCAGCGACGCCGAGGGCCCTCGGCCGCCGACAGTGCTGCTGCAGGGCCCGGCGGGCATCGGCAAGACCATGGCGGCCAAAAAGATCCTGTACGACTGGGCAGCGGAGAAGCTGTACCGCGGCCAGGTAGACTTCGCCTTCTTCCTGCAGTGCCGCGAGCTGCTGGAGTGGCCCGGCGCGCGCAGCCTGGCCGACCTCATCCTGGACCAGTGCCCGGACCGCGGGGCGCCGTTGTCGCGGATGCTGGCTCAGCCGCAGCGGTTGCTCTTCATCCTGGACGGCGCCGCTNNCGAGGCCGCGCCCTGCACGGATTCCTTCGAGGCTGCTAGCGGTGCGCGGGTGCTGGGCGGGCTGCTGCGCAAGGCGCTGCTGCCCTCAGCCCGCCTGCTGGTGACCACGCGCGCCACCGCCTCCGGAAAGCTGCATTTCGGCCTGTGCNGCGCCGAAGTGCGCGGCTTTTCCGCCAGAGACAAGAAGAAATACTTCCACAAGTTCTTCCGGGAGGAGCGCAGGGCCGAGCGTGCCTACCGCTTCGTAAAGGAGAACGAGACGCTGTTCGCCCTGTGCTTCGTGCCAGCCGTTTGCTGGATCGTGTGCACCGTACTGCGCCGGCAGCTGGAGCTGGGCCAAGACCTGTCACGCACCTCCAAGACCACCACGTCTGTGTACCTGGTCTTCCTCGCCAGCGCGCTGAGCTCCGTGGGCGCCGAGGGGCCCGGTGTGCGGGCGAAGCTGCCCAAGCTACGCCGCCTGGCCCGGGAAGGCGTCCTGGGGCACAAGGCGCAGTTTTCCGAAGGGGATCTGGAGCGCCTGGAGCTTCGGGGCTCCGTCGTCCAGCACTTTCTTATCAAGAAGGAGCTGCCGAGCGTGCTGGAGACTGAGGTGATCTACCAGTTCATCAACCAGAGCTTCCAGGAGTTCTTTGCCGCGCTGTCCTACCTGCTGGAGGACGTGGGGGCACCCGGGGTCTCCACAGGCGGCCTGGAGACGCTGCTGTGCCTGGGCTCCGAGGGGCGCAGCCACCTCATGCTCACCACACGCTTCTTCTTTGGGCTTCTGAACATGGAGCGTGTGCAGGACGTCGAGCGCCACTTCGGCTGCGTGGTCCCAGCCCATGTGAAGCAGGATGCCCTACGATGGGTGCAGGGGCAGAGCCACCTCAGGGTGGCGTCAGAGGGAACAGACGGGACCAAAGGGCTCAAAGACACGGAGGAGCCAGAGGAGAAGGAAGAAGAGGAAGAGCCCAACTTCCCTCTGGAGCTGCTGTACTGTTTGTACGAGACCCAGGATGAGGCTTTTATGTACCAGGCCCTGAGCAGTCTCCCTGAGCTAATGCTGGAGCGTGTGTGCTTTCATCGCATGGACCTGGATGTCCTGAGCTACTGCATGCGGTGCTGTCCCGCTGGACAGGTGCTGTGGCTGGTCAGCTGCAGCCTGATGGCTGGACAGGAAAAGAAAAGGAAGAGGAGCCTGGTGAAACGGCTCAAGGGCAGTTCTCAAGCTGCCATGAAGCAGCTCCGGGTCTCCCCATTGCATCCACTCTTTNGGGCCATGACTGACCTTCGGTGTGGCCTGAGCAGCCTGACGATGTCCCGCTGCAAACTCCCTGACAGGATCTACCGAGACCTCTCTATGGCCCTGAGGGCAGCCCCTGCCCTGACCGAGCTGGGCCTCCTCCACTGCAGGCTCAGAGAAGCTGGTCTGCGTGTGCTGAATGAGGGCCTGGCCTGGCCCCAGTGCCGGGTACAGACACTCAGGGTGCTGCTGCTGAAGCCTCTGGAAGCCTTCCAGTGTCTGGTAGCCCTGCCCTGGCAGAGCCCTACCCTCACCACCCCGGACCTCAGCGGCTGTTACCTGCCTGACCCCATGGTGACCTACTTGTGTGCAGCCCGGCAGCACCCAGGATGCAGCCTGCAAACCCTCAGTCTGGCCCCTGTGGAGCTGAGTGAGCCATCGGTGCAGGAGCTGCGGGCCATGAAGATACCAAAGCCCAGGCTGGCCAGCATCCGCCTTGGTCCTCCCGAGGGAGTCGTCAGTGCCCTCTGA

XM_004851789.1 Coding sequence

LOC101713834 protein FAM204A-like

Length: 831 bp    Location: 13422379..13485751   Strand: +
>XM_004851789.1
ATGGCGACGGAGGCCCGCGAACCGGGGCTCCGCAGAGGGCGGGGCAGAGCCCCCCAATCCCTGGTCGCCCGGGCCGCGGAGCCGGGAGGAGGAGCCTTCGCCCGACCCCGAGAGAGGCTGCGGCCTGGCCATGTCACAAACTTTGATCATAACTTACAGGAAAATAAAGAGCCTGGAAACATTAAAGACACAGAAATCTCAGATTTGTCAGCAGATGGACCAAAAATCAAAACAGAGGCCAAGGCAAATGCATATGAAGAGTGCCCTTCTGAAATTCCCTTAAATACATGGAACAAATTTCAAGAATTGCATAAGAAACATTCTGAACAGAGAACTTTGGCCTCAAGGTTCAGAGTGAGAAAGAGAAAATGCTCCAGAAGAGGTAAATTGAAGAATGAAAAGGAATCTCATAGTGAGCAGTCCTTAAATGAAACCCAGTGGAAGGAGCTTACTCCCTACTTCGGAGCTAATGATAAATTTGAAGGCCCTGTTAAAAAGAAAAAGGTTGAAAAGCCTGGCCTTGAAAAGAGGACAGACCAGGCTGTGGAGGAGAGGGATGTTGAGAAGGGTGAGGAACTCAGCAACCAGCTAGCTACTCGAGAGCTTGGTGTAAAAATTGCCAAAGCAATCGCCTGTCAGAAGTTTGTAAAAGCCAAAAAGGAGGCTGAAAACTCACAGGCTGCTCGAAAAAAGAAGAAACTCGCATGGGGGTTTGAAGCAAAGAAGAGGTGGGAAACCAAAAGCAGCATGGGGTATATGCAACTGGGGAGAATTCTTCAAGACACATGTAGACCTGTAAGCTTAATTTACAGACAAGATTTTTCTGCTTAG

XM_004851790.1 Coding sequence

LOC101714521 uncharacterized LOC101714521

Length: 699 bp    Location: 13760347..13754234   Strand: -
>XM_004851790.1
ATGGTGACAGAGGTTCAACCTCTACCATGTGGACAGCTAGTTTTTCCAGCATCATTTGTTAAAGAGTCTATCTTTTCTCCAGAAAAGAGATTTGTCCCTTTGTCACAGAACAGAGATACAGAGGACAAGGAAGAGGCCAGCGGGCGTCCTGTGGTCTTCAGAGGAGAGGAACCGGAAGCAGGCAATGCTGGCATCCTGACGCCCCCATGCCACGCTGGGACACAGGGGGCGGCGCAGCTTCCAAGCTTGGGGAGCAGGGAGAGGCGGGGCCGCGAGGGGAACAGTGAGCATTGTGACGGGGCCACAGGAGCTGGGGTCCAGGGGTCCCCCTTGCGGGCCGCGGGAGGCGCCAGGGGCGCGGGCTCTGGACACGTGAGTGCCGCGCGTCCAGGACGAGGAGCCCGCCCAGGTCTACCCCGTGAGTGTGCCAGCCCCGCTCCTGCCTGGGCTGCGGAGAGGAGTTCGGGGTCTTCGGGTTCCAGCAGTGATAAAAGGGCTGATTTAGAACCGAGAGAAGGACCAAGACATCCACACCCTTCAGAAATCACTGCCAGACAGTCTGCAGATGAGCACATTGTTTACATGCGCAAGGTGAGGAAAGAGCAGAGGAAATTAAGTAAGCAGTTTATGAGACCGGCTCCCATCCCAGAACCTGGCCTCCTGGTGGTATTAATTTATATTTCTTATAAGGAGGTATAA

XM_004851792.1 Coding sequence

Ccdc34 coiled-coil domain containing 34

High confidence: 3 potential gene matches
Length: 1170 bp    Location: 17106791..17093528   Strand: -
>XM_004851792.1
ATGGCAACGCGGCCTACGGCGACCCGGATTGGCCAGGGGCGGCGCGCGCGGGGCCTGCCGGGAAGGCGCATGGCCGCTGCCGTGGCTGTCGGTTTGAACGCGGGCGCGATGCAGGAGGCCGAGCGGTGCTGGGCGGCGTCGCCCCCTCGGCGCTCCCGGTCCTCCGCCGCCCCCGGCCCCGGCCCGTCCTCCTCGGGCGCCATCCTCGGCCTCAGGTCGGGCGAACAGGCCGCGGCGGAGGGCTCGCTGTCGCCGGCCCCGAGCTGCAGCGGCTCCACTCTGTCGCTGCTGTCCCCGCTCGGCCGGCCCGGCTTCCCGTTCGACGACGGCGACGACGAGGGCGCCGGGGACGAGGATGGAGAGGCCCCCGGCTTCGAGACCCGGAGGACCGGCCCCGGAGCAGCCGCGGCTCCGGGCCACGACAGCGAGGTGGAGCCGGGAGAGGCGCGCGAGGAGCAGGTGGAGCGCGGGGCCTGGAGCCTGACCCCTTGGGAGCTGTGGTTCGTGGGCAAAGAGCAGGAGGAGCGCGAGAGGCTGCAGCAGAAGGCGCTGGAGGAATTGAGTCAACAGATGGAAAGAAGAAAAGAAATGGAAGCGCGCGAGAAGAGGAAAGTGATTGCGGAGGAGAAGCACCGGGAGTGGGTGGAGAGGAAGAGGCGCCAGGAAAGGAAAGAAAGAGAACAAAAAATCAATAAAGAAATGGAGGAAAAAGCAGCAAAGGAACTGGAGAAAGAACATTTGCAAGAAAAAGCAAAAGAAAAATATCAAGAATGGTTAAAGAAGAAGAATGCTGAAGAGTGCGAGAAGAAGAAGAAAGAAAAGGAAAAAGAAAAGCAACGGCAAGCTGAATTACAGGAGAAAAGGGAAATAGCCGAGAGAAAGTTTAAGGAATGGTTGGAAAATGCAAAAAACAAGCCCCGCTGCACTGCAAAGAGCTACGGCTTCGCCAATGGGAGGCTCACAGGTTTTTACAGTGGAAATTCCTACCCGGAGCCAGCCTTTTATAACCCCATTCCCTGGAAGCCGATCCTTGCGCCCCCGCCCCAGGAAGCCTGGGGCCTCTCCGGGAGGAAGAGCCGGAGGCCGGCGTCGTCATCCTTGTCCGCACGGGCAGCTCGTGGGGCCACGAGCAGCCTTTGCCTCGGGACTGCGTGCAGAGCCCAGAGATAG

XM_004851780.1 Coding sequence

LOC101709167 serum amyloid A-3 protein-like

Length: 552 bp    Location: 9718794..9715921   Strand: -
>XM_004851780.1
ATGGCCAGTAGCCAGGATGGGATGCCCTTGGAAGGCAACTCCTCTCCTCCCTCCACAGTGAGGGACACAATGAATTCCACTGTTGAAAGTGCTCTTGGGGCTGGATATGGCCTGGAATCAACAGTAAGGGAAATCGAGACAAAAAGGAAAGGGATATTTCTTTATTTCTCTGGCCTTTGTCAAAGCCTGCAGTCTTTGGAGTCCGTTGTAGAAAATCGTTTATTCCCCTGTTTTGCCGAGGCATGGTCGTCTTCAACATTCTCTTTTTCCCCAGGGACTAGAGACATGTGGCGAGCCTACCGGGACATGAGAGAAGCCAATTACAAAAATTCAGACAAATACTTCCATGCCCGGGGGAACTACGATGCTGCCAAACGGGGACCTGGCGGTGCCTGGGCTGCTAAAGTGATCAGTGACACCAGGGAAGGTATTCAGAGATTAACAGGCCATGGAGCAGAAGACTCGAGGGCTGACCAGTTTGCCAATGAATGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGGCCTGCAGGTCTGCCTAGCAAGTACTGA

XM_004851784.1 Coding sequence

LOC101711316 mas-related G-protein coupled receptor member A-like

Length: 993 bp    Location: 10274160..10273168   Strand: -
>XM_004851784.1
ATGGATTCAAACACATCAGCTTGGGTGACAGAAGTCACAACAACGAAAAGAAAAGGTGAAACTGCTCCTGGAACTTTCAACGAAAAGGACCTGATCCCGAACCTGGTGATCCTCATCTCTGGCCTGGTTGGACTCGCAGGAAATTCGGTCGTGCTCTGGCTCCTGGGTTTCCGCATGCGCAGGAACGCCTTCTCCATCTACATCCTCAACCTGGCTGCAGCAGATCTCCTCTTCCTCTGCTGCCACATTATAGATTCCCTGCTGGTGGTCGTCAGATATTTCCATCCCCACGTTTTCTTCCTCCCCTGCTATAAGACCGTCATGATGTTTCCCTACATCACGGGCCTGAGCGTGCTGAGCGCCATCAGCACCGAGCGCTGCCTGTCCTTCCTGTGTCCCATCTGGTACCGCTTCCGCCGCCCCAAACACACCTCAGTCACCGTGTGTGTCCTGCTCTGGGCTACGTCTCTGCTGATGTGCATTCTGAACAAGTCTTACTGTGGTTTGCTGGATGTCAACGAAAAGACTGCCGAGTGTCTGGCAGCTAATTTTTCCACTGCCACATGTCTGGGTGTTTTAGTCCTGATTCTCTCTGGGTCCAGCCTGGCCATGCTGGTCGGATTCCTGTGGGGCGGCGGCAGGCAGATGCGGCTGACCAGGCTGTATGTGACCATCCTGCTCACCGTGCTGGTCTTCCTCCTCTGTGGCCTGCCCTTGGGCGTCTACTGGTTCGTGTTAATCTGGATTCACGATGACTTTAGTGATACTTTGCAATACGGTCTTTACCTGGCCTCAGTTGTCCTGTCCTCTGTGAACAGCTGTGCCAACCCCCTCATTTACTTCTTTGTTGGCACCTTCAGGCAGCAGCCGGGGAGGCAGACGTTGAAGCTACTTCTGCAGAGGGCTCTGCAGGACAGCCCTGAGGAGGATGGATGTGGAAGCCGAGTTCCTCAGGGAACCCTGGAGATGTCAGTAAGCAGAGAAGAGCAGTGA

XM_004851777.1 Coding sequence

LOC101705174 uncharacterized LOC101705174

Length: 753 bp    Location: 4962310..5007253   Strand: +
>XM_004851777.1
ATGGCACAGACCACGGGGTCCCCAAATGGGCAGCACAGGGGACTCTCCCGGGAGCTGCAGTCTCCTCCTCCGCTCTTCCAGCTCCACACTCAGTACATCCTGGTCCCTGGAGGCAGCAGCTACTTTCCCAGCCTTTCAGGTGACCCCGAGGTGCGGCTGCGTCTGAGAAGAGGTGTTGCCCAGGACCGAGCCGAGTGGGCGCCCCTCTGCGGGGGACAGAGGACGATGGAGTGTTCGCTTCTGGCTGGAGAGAAGGAAGACTGGAAGGTCTTCCGCTTAGAGGCAGCGCTTCCCTCTCCTGGCTCATCAAGCAACGCGATTACAGCGTCTCGGTTAGAGATCACTGGATGCCTCAGTTTCCCTACTGTGCAAAGGGCACTTCTCAGCCAGCGATGCCCTGGAGGAGCGAGAAGGTGCAAAAGTCTGGTCAAGGTGGATCCAGCCACCTCCAGAGGAAAGGGGCGGGGTGCTGATAACCGCGGAGGCGCGAGCTCCAGGTCCTGGTCGGAGACTCCCGAGTCCCTCCTGGCATTGGCTCGCGGAGGAGCTCAGAGTTGGACCCGGGACGTCAGCGACGCGAGCGAGAGGCAGGCGGGGCGCGGGGAGGCTGGGAGGGGCGAGTGTCGGCGCCGCGCCTCCAGGGCTCCTGGCCGCAGCTCTGGGCGCTGGGGGCGGGAAGGGGTGGAGCCACGCGGGGAGGAGCAAAACCCGGAGGCCTCGGGCACGGGGGCAGAGCCAGAGCAGCGGGAGCCC

XM_004851775.1 Coding sequence

Swap70 SWAP switching B-cell complex 70kDa subunit

High confidence: 4 potential gene matches
Length: 1614 bp    Location: 1794450..1887925   Strand: +
>XM_004851775.1
ATGGGGGGCTTGAAGGACGAGCTGCTTAAGGCCATTTGGCACGCCTTCACTGCGTTGGACCTGGACCACAGCGGCAAGGTGTCCAAGTCGCAGCTCAAGGTGCTTTCCCATAACCTGTGCACGGTGTTGAAGGTTCCACATGACCCTGTTGCCCTTGAAGAGCACTTCAGGGATGACGATGAAGGGCCTGTCTCCAATCAGGGCTACATGCCGTATTTAAACAAGTTCATTTTGGAGAAGGTTCAAGACAACTTTGACAAGATTGAATTCAATAGGATGTGTTGGACCCTCTGTGTCAAAAAAAACCTCACAAAGAGTCCCCTGCTCATTGTAGAAGAAGATGCATTTAAAATATGGGTTATTTTCAACTTTTTATCTGAGGACAAGTATCCATTAATTATTGTGCCAGAAGAGGTAAGGTGTGGCTTTGGGCAGTTCTTTTACCTGGTCATCTTGGCAATAAATAGAACTGGCCTGGAGGTATTAGTGCTGATTAATGGTTATATGATGAAAAAAGGCCATCGACGGAAAAACTGGACTGAACGCTGGTTTGTCCTAAAGCCCAACGTAATTTCTTACTATGTGAGTGAGGATCTGAAAGACAGGAAAGGGGACATTGTCTTGGACGGGAACTGCTGTGTGGAGTCTCTGCCTGACAAAGATGGAAAGAAATGCCTTTTTCTAATAAAATGTTTTGATAAGACCTTTGAAATTAGTGCTTCAGATAAGAAGAAGAAACAAGAATGGATTCAGGCCATTCATTCCACCGTCCATCTGTTGAGGCTGGGCAGTCCTCCACCACACAAAGAAGCCCGCCAGCGCCGGAAAGAGCTCCGGAAGAAGCTGCTGGCAGAGCAGGAGGAGCTGGAGCGGCAGATGAAGGAGCTGCAGGCCGCCAACGAAAACAAGCAGCAAGAGCTGGAGACTGTGAGGAAGAAACTGGAGGAAGCAGCATCCCGTGCAGCAGAAGAGGAGAAGAAACGCCTGCAGACGCAAGTAGAGCTGCAGGCCAGGTTCAGCTCGGAGCTGGAGCGAGAGAAGCTGATCAGACAGCAGATGGAGGAGCAGGTTGCACAGAAGTCCTCTGAACTGGAGCAGTACCTGCAGCGTGTGCATGAGCTGGAGGACATGTACCTAAATCTGCAAGAGGCCCTTGAGGATGAGCGCCAGGCCCGGCAGGATGAAGAGACGGTGCGCAAGCTGCAGGCCAGGTTGCTGGAGGAAGAGTCTTCTAAGAGGGCGGAGCTGGAGAAGTGGCACCTGGAGCAGCAGCAGGCCATTGCCACCACGGAGGCGGAGAAGCAGGAGCTGGAGCACCAGCGCACTGAGAAGGAGCAGGCGCTGCAGGAGGCCATGGCACAGCTGGCGCAGCTGGAGCTCGAGCGCAAGCAGGCGCTGGAGCAGTATGAGGGCGTTAAGAAGAAACTGGAGATGGCAGCTAATACAACAAAGAGCTGGAAGGACAAAGTGGCGCATCATGAAGGATTAATTCGATTGATAGAACCAGGTGCAAAGAACCCTCACCTCATCACTAACTGGGGACCTGCAGCCTTCACCCAGGCTGAGCTGGAGGAGAGAAAGAAGAACTGGAAAGGGAAAAAGACCACGGAGTGA

XM_004851779.1 Coding sequence

LOC101708786 translation initiation factor IF-2-like

Length: 1173 bp    Location: 9355995..9360009   Strand: +
>XM_004851779.1
ATGGCAGCCCAGCCCTCCACGAATGCTGAGGCTCTGGGCCTGGAGAGCAGCCGCATGCTGTGCCAAGCTGGACAAAGGCCTGGGGGCTGGACTTGGGCCACTTCCAGAGCCCAGCGGGACCAGACCGAAGGCCTGCAAGTGCCAGGTGGATCCAACAGTGCCCAGTTTGGAAGTAGAGGGGCGTGTGTGACGCCCTTCTCACCTCTGTGTGACCCGGGGGCGCCGGCCCAGACGCGTCTCGGAGCCCCCACCCGCCGAGTGGCGCTCCCGGAGGGCGGAGCGTCGGCGGGTCCCCCCCGAGCAGCAGGAGCAGGCGGGGCTGGCGCCCCCAGCGCCGGGGTGGAGCGAGGCCGGGTTCGGCGCCGGGCAGCGAGGGGGGCGCGGAAGCAGGGCTTTTTAGGACCCAGCGCGGCGCCTCCCTCCGGGGGCGAGTGCGGCTGCGCGCGCCGTGTGCCCGTGTCCGGAGAGCCGCGGGCTGGACGCGGACCGCGCGGGCGAGGAGCGAGCAGCGGCGACAGCAGTCCGGGCCGCAGCAGCGTTGCGGGGCACCAGCCCCGCGCCTCGCCTCCCCGGCCCCGCCGGCCTCCGCGCCGCGCCCGGACCCGCCACCCCCGCCTCCCGGGCCCGACCACCGCAGCCCTCCTCGCCTCGGCCGGGAGCGCCACCCGCCTCCCAGAAGCAGGAGCGGAGCACGGTGCGGAGAGGCTCCGGAACCAGTGCCCGCCGGCCCCGCAGAGCGAGCCCGCGGGGAGAGCCCGCGCCCGGCCCAGCGCCGCCCGCAGCCGCCGGGAGCTGTCCCTTCAGCACCGCCGCGGAAGCCGAGTCCGAGCGCAATCAGCAGAGCCCCCCTTCCAGCCCGGGCGCACCTGCGCGGCGCTTCGCGGCAGCCCCGCAGGGCAGCACCCGGGCCCCTGCCCAGGGGACCCGCCATCTCCGGCGGGAGGCGGGGAGAAGGAACGAGGAGGGCGGGCGGGCTGGCTCGCCGCCGCCGAGGGGAGCAGGCAGCCAGGCCAGGAGAGAGGAAGGGGGCCGGAGCCCGCCCTGCACCCGCGCTGCAACCCGGCCACGCAGGGAGGAAGCAGCCGGCGTCCATCTCCCCCGCGCCGAGAGAGCGCTGTGGCGACCACCGCAAGCCAAGTGCAAATCCCGGGCCCCCTCCCCTCGCCCTGCTGA

XM_004851771.1 Coding sequence

LOC101700925 olfactory receptor 502-like

Length: 945 bp    Location: 114196..115140   Strand: +
>XM_004851771.1
ATGGATATGCTAATTGTTGGAAACCACACTGAGGTGACAGAGTTCATTTTATTGGGCTTGACAGATGATCCAATCCTTCGAGTCATCCTCTTCCTGATCATCCTGTGCATCTACCTGGTGACCGTATCTGGTAATCTCAGCATAATCATTCTTATCAGACTCTCCTTTCAGCTCCACCATCCCATGTACCTTTTTCTTAGCAATCTGGCCTTTGCTGACATAGGCTTTTCGTTTTCTGTCACACCCAATATGCTTATAAACTTCCTGGTGGAAAAAAATACCATCTCTTACCTTGGATGTGGCATCCAGCTTGGCTCAGCTGTGTTCTTCGGGACAGCTGATTGCTTCCTTCTGGCTGCCATGGCATATGATCGCTTTGTGGCAATCTGTGACCCACTGCTTTACTCAACCAAAATGTCCACACAAGTCTGTGTCCAGTTACTTGTGGTGACTTACATAGGTGGTTTTATTAATGCTTCCTCCTTTACTCTTTCCTTCTTTTCTTTACTCTTTTGTGGACCCAATCAAGTCAATCATTTTTTCTGTGATTTTACTCCTTTAGTTAAGCTCTCTTGTTCTGATGTCAGCATCCCTGCAATTGTTCCCTCATTTTCAGCAGGTTCCATCATGGTGTTCACAGTGTTTGTCATAGTCATATCCTACATCTACATCCTCATCACCATCCTGAAGATGCGCTCCACTGAGGGGCGTCACAAAGCCTTCTCCACCTGCACCTCCCACCTCACCGCAGTGACTCTCTACTTTGGAACCATTTTCTTCATTTATGTGATGCCCAAGTCCATCTATTCCACTGACCAGAACAAAGTGATATCTGTGTTCTACACGGTGGTGATCCCCATGCTGAACCCTCTCATCTACAGTCTCAGGAACAAGGAGATTAAGGGGGCTCTGAAGAGAGAGTTTTGTGGGAAAACATTTTCTTAG

XM_004851772.1 Coding sequence

LOC101701638 olfactory receptor 10A3-like

Length: 945 bp    Location: 149433..148489   Strand: -
>XM_004851772.1
ATGAGCAGGCAAAATCACAGCAGTGTGGCCGAATTCATCTTCTTGGGCTTTTCCAGCTTTCCTGAGCTCCAAGAGCAGATCTTTGGGGTTTTCTTGGTTATTTACCTGGTGACACTGATGGGAAATGCCATTATCATAGTGGTCATCTTCCTGGACCAGAGCCTCCACTCCCCCATGTACCTCTTCCTGCAGAACTTATCTGTGGTGGAAGTGAGTTTCAGTGCAGCCATCATGCCTGAAATGCTAGTGGTCCTGTCCTCTAAGAAAACAACAATTCCTTTTGTTGGCTGTTTTGCACAGATGTATTTCATTCTTCTTTTTGGTGCGACTGAGTGTTTTCTCCTGGGGGCAATGGCTTATGACCGATTTGCTGCAATCTGCCATCCTCTGACCTACCCAACCATTATGAACAAAAGTGTTCTTGTGAAGTTAATACTTTTCTCATGGGTCTCAGGGGTTATGGTGGCCACTGTGCAGACAACATGGGTATTTAGTTTTCCTTTCTGTGGCCCCAGTGAGATTAATCATCTCTTTTGTGAGACTCCCCCAGGGCTGGAGCTTGTTTGTGCAGACACCTTCCTGTTTGAAATCTATGCCTTCACAGGCACCATTTTGATTGTCATGGTTCCTTTCTTGCTGATACTCCTGTCTTACATTCGAATTCTCTTTGCCATCCTGAAGATGCCATCAACCACTGGGAGGCAAAAGGCCTTTTCCACCTGTGCCTCTCATCTCACATCAGTCACTCTCTTCTATGGCACAGCCTGTGTGACTTATTTACAACCCAAAGCCAGCTACTCACCGGAGACCAAGAAACTGATGTCACTGGCTTACACACTGCTTACCCCTCTGCTGAATCCACTTATCTATAGTTTGCGCAACAATGAGATGAAACGGTCTTTGATGAAATTATGGCAAAGGAAACAGGTTTTACACATAGACTGA

XM_004851773.1 Coding sequence

LOC101701979 olfactory receptor 10A3-like

Length: 948 bp    Location: 160891..159944   Strand: -
>XM_004851773.1
ATGAGCAGGCAAAATCAAAGCTGCGTGGCCGAATTCATCCTCTTGGGCTTTTCCAAAAACTTTCCTGAGCTCCAAGAGCAGATCTTTGGGGTTTTCTTGGTTATTTACCTGGTGACACTGATGGGAAATGCCATTATCATAGTGGTCATCTTCCTGGACCAGAGCCTCCACTCCCCCATGTACCTCTTCCTGCAGAACTTATCTGTGGTGGAAGTGAGTTTCAGTGCAGCCATCATGCCTGAAATGCTAGTGGTCCTGTCCTCTAAGAAAACAACAATTCCTTTTGTTGGCTGTTTTGCACAGATGTATTTCATTCTTCTTTTTGGTGCGACTGAGTGTTTTCTCCTGGGGGCAATGGCTTATGACCGATTTGCTGCAATCTGCCATCCTCTGACCTACCCAACCATTATGAACAAAAGTGTTCTTGTGAAGTTAATACTTTTCTCATGGGTCTCAGGGGTTATGGTGGCCACTGTGCAGACAACATGGGTATTTAGTTTTCCTTTCTGTGGCCCCAGTGAGATTAATCATCTCTTTTGTGAGACTCCCCCAGGGCTGGAGCTTGTTTGTGCAGACACCTTCCTGTTTGAAATCTATGCCTTCACAGGCACCATTTTGATTGTCATGGTTCCTTTCTTGCTGATACTCCTGTCTTACATTCGAATTCTCTTTGCCATCCTGAAGATGCCATCAACCACTGGGAGGCAAAAGGCCTTTTCCACCTGTGCCTCTCATCTCACATCAGTCACTCTCTTCTATGGCACAGCCTGTGTGACTTATTTACAACCCAAAGCCAGCTACTCACCGGAGACCAAGAAACTGATGTCACTGGCTTACACACTGCTTACCCCTCTGCTGAATCCACTTATCTACAGTTTGCGCAACAATGAGATGAAAAGGGCTTTAATGAAATTATGGCGAAGAAAACTGGTTTTACACACAAACTGA

XM_004851760.1 Coding sequence

LOC101696752 cytochrome c oxidase subunit 8B, mitochondrial-like

Length: 213 bp    Location: 22186571..22187754   Strand: +
>XM_004851760.1
ATGCTGAGGTTGGCCTCCACCACGCAGCTGCTCCAAGCCCCCCTGAGGTGCTGGGTGCTTCCCAAGGCCCACGTCTCTGCCAAGCCAGCCAGAACCCCCACCTCCCCTATGGAGCAGGCAGTGGGGATCTCAGCCATATTCATCAGCTTCCTGGTTCCTGCGAGCTGGGTCTTGACCCACCTGGAGGGCTACAAGAAGAGCTCCGTAGCATGA

XM_004851707.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X1

Length: 5295 bp    Location: 21880598..21854194   Strand: -
>XM_004851707.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAAGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGCACTGAGGAGCTGTCTGCAGACCCACCTTCTCCTCTGAGGGCCAAGAGGAGGACTCTGTCCCGCTCAGCCCTGCAGTCTCACCAGCCCGTGGCCAGGCCCGTCTCCGTGGGGCTCTCAGGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGTGAGTACATGCTTCCAGGGACTACTGGTTGTTGGGGGTCGCTGTGGGCTGGGGCCGGGAAGCAGCCACCCCACAAGCTACTTTTCCTTGGATCCACCCTGGGTCTGGCTCCTTGGCCTGTGGTCCCTGGGCTGGGACACTTTCCTGGGATTTTCCAGCCAGCAGGCAGCATTCTGGCCAGGGCCAGGCCTAGGCCACTGACCTTCCTGTCTGTCGGACCCTCAGGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTGCTTCTGGAGCCCGGGTTCCCTGGCATGGATCCCTCTCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGGTAGGCTGTGGGGGGGTTATGCCTGTGCATGCTGCAGATCTGAGGCCGGGAGCATCGTGTGCACGGCCCAGCAGCGCTACCCATTTTGGGAGGGTGCACTGGGGCCCAGCCAGCAGCAGTGGCCTGAGGTCCACCCATCTTCTTGCGCCCATTAAAAAGACTGAGGTGACCGAGAGGGTGTTTAGGGTTGCCCGGTCCACACCCAGCTGA

XM_004851708.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X2

Length: 5295 bp    Location: 21880290..21854194   Strand: -
>XM_004851708.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAAGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGCACTGAGGAGCTGTCTGCAGACCCACCTTCTCCTCTGAGGGCCAAGAGGAGGACTCTGTCCCGCTCAGCCCTGCAGTCTCACCAGCCCGTGGCCAGGCCCGTCTCCGTGGGGCTCTCAGGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGTGAGTACATGCTTCCAGGGACTACTGGTTGTTGGGGGTCGCTGTGGGCTGGGGCCGGGAAGCAGCCACCCCACAAGCTACTTTTCCTTGGATCCACCCTGGGTCTGGCTCCTTGGCCTGTGGTCCCTGGGCTGGGACACTTTCCTGGGATTTTCCAGCCAGCAGGCAGCATTCTGGCCAGGGCCAGGCCTAGGCCACTGACCTTCCTGTCTGTCGGACCCTCAGGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTGCTTCTGGAGCCCGGGTTCCCTGGCATGGATCCCTCTCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGGTAGGCTGTGGGGGGGTTATGCCTGTGCATGCTGCAGATCTGAGGCCGGGAGCATCGTGTGCACGGCCCAGCAGCGCTACCCATTTTGGGAGGGTGCACTGGGGCCCAGCCAGCAGCAGTGGCCTGAGGTCCACCCATCTTCTTGCGCCCATTAAAAAGACTGAGGTGACCGAGAGGGTGTTTAGGGTTGCCCGGTCCACACCCAGCTGA

XM_004851751.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X4

Length: 2190 bp    Location: 22142601..22136826   Strand: -
>XM_004851751.1
ATGGAGGACGCCCAGCCGGACCCCACCGTGTTTGCCTCCCACTCTCTGCCCAGGGACCCCCGCCTGTTGGCCACTGTGACCAACGTGTACCTGGGCACACGTGTGTACCATGACACACTGCACGTGAGCGGCGTGTACAACGGGGCCCGGGGCAGCACACACCGGGCGGTCCTGCCCAGCCCCCTTAACGTGCGGCTGGAGGCCCCCGCGGGGAAAGGAGCCCAGCTGACCCAGACCTTTGCTCTGGACACCAACACAGGCTCCTTCCTGCACACCCTGGAGGGCCCCAGCTTCCGGGCCTCCCAGCGCATCTATGCCCACCGCGTGCTGCCCCATGTCCTGGCCTTCAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGGTACCTGTGGGGCCTCACGCTCACCCCGGAGCAGCCAGGGGGCCCCCGGCAGGAGGTGCACATGCTGTGGACGCCAGTGCCCCCTGCCCTGACCCTTGGCGAAGGCGAAGAGACTAGGACCTGGGACTTCCTGACCGTGGTGGGTGGCAGCCGGGTGGAGGCCCAGGCCTGCCTCAACGAGGCCTTACAGCTGCAGGCCACGGGCTCTCTGTACGCCATCCACATGCAGGCTTGGGCCCAGTTCTGGACGGGCTGCAGTCTGGATGTGGCAGGGCCCCTGGCTCTGTGCCAGGCTGTCCGTAGCTCTTTTTACTACCTGTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACCATGCCACCCAGGACCTGCAATTCTTCCGAGAAGCTGGTGGCTGGGACGTGGTCAGCGCTGTGGCTGAGTTTTGGTGCAGCCGGGTGGAGTGGAACCCCAAGGAGAAGAAATTCGACCTGAGAGGTGCGGGTCTGGGCAGGCGGGCAGGCCGGCAGGAGTGTGGATGTTCCTGGGCTGCCCATGCTGACTGCTGCACAATGTGCTGCGGTGGACTTATGTGCCCAGGAGTTATGCCCCCTGATGAGTACCATGCAGGAGTCGACAACTCTGTGTACACCAATGTCCTGGTCCAGAACAGCCTGCACTTTGCGGCTGCCCTGGCACGGGACCTGGGTCAGCCTTTCCCTGACAAGTGGCTGGTGGTGGCTGATGGGATCGAGGTGCCCTTTGATCCCGAGCAGAACTTCCACCCTGAGTTTGATGGGTACAAGCCTGAGCATGTTTGCTGTGGGCTGGATGGAGCTGAAGGACCCGTCACGGGCACAGAGTCTTCTGGACAGGAACATCACCAATGTCACCGAGCCCTTCAAGGTCAGCCTGTTAGCACCCTTGACCCACAGGCTGACCCCACCGGCCTCCACTCCCGCCCATGTGGTCACAGCCCGAGTTCCTCTTGCCCTTGGCAAGGCAGCCGCAGGAGGCTAGTGTGCTGGGCCTGCCACAACCACCCTCTGCAGGTGTGGACAGAGAATGCAGACGGGTCCGGGGCCGTGAACTTCCTGACAGGCATGGGAGGCTTCCTGCAGGCAGTGCTATTTGGATGTACAGGCTTCAGGGTCACCTGCAGAGGTGTGACCTTTGATCCTCTGTGCCTGACGGACATCTCCAGAGTGTGTGTGTCTGGCATCTTCTACCGGGGGAACAGGCTCAACTTTACCTTCTGCAAGGACTCAGTGATGGTTGAGGTCACAGCCCAGGCATGGCCTGGGGCTCCTCAGTTGGAGGCTGAGCTGTGGCCATCAGGAGCTCAGCTCCCCCTGCTGCTGGGGCACAAGGTTTCATTTCCTTGTTCAGCTGGCCGGATACAAAGATCACTCCCATAG

XM_004851700.1 Coding sequence

Sct secretin, transcript variant X1

Length: 381 bp    Location: 21840894..21843341   Strand: +
>XM_004851700.1
ATGGCCCCTTGCCGGCCACTGCTGCTGCTGCTGCTGCTGCTCGGGGACCCTGCTGCACACCCCGCACCGCCCAGGGCCGCACGACACTCGGACGGGACGTTCACCAGTGAGCTCAGCCGCCTGCGGGACAGTGCCCAGCTGCAGCGCCTGCTGCAGGGCCTGGTGGGCAAGCGCAGCGAGCAGGTTGCAGAGAACAGCGCCACCGGGTCCAAGCCTGTAGACGGCCAGCTGTGCCTGCTGTGGTCAGATGTGCCCACCCTGCAGGCCTGGACGCCCCTGGGGCACCCCATGGGCCTCTCCCCATCTCCCTGGCTGCCTCCTGGCCCCAGGCCCGGAGCCAAGATTTCAGACCCTGCAGGAGATATCCGGAGTCCTCGATGA

XM_004851722.1 Coding sequence

Hras v-Ha-ras Harvey rat sarcoma viral oncogene homolog

High confidence: 4 potential gene matches
Length: 570 bp    Location: 21910881..21913414   Strand: +
>XM_004851722.1
ATGACGGAGTACAAGCTTGTAGTGGTGGGCGCAGGAGGTGTGGGAAAGAGCGCCCTGACCATCCAGTTGATCCAGAACCACTTTGTGGACGAGTATGATCCCACCATAGAGGACTCATACCGGAAGCAGGTGGTCATCGATGGGGAGACGTGCCTGCTGGACATCCTGGACACAGCCGGCCAGGAGGAGTATAGTGCCATGCGGGACCAGTACATGCGCACTGGGGAGGGCTTCCTCTGTGTGTTTGCCATCAATAACACCAAGTCTTTTGAGGACATCCATCAATACAGGGAGCAGATCAAGCGGGTAAAGGACTCAGATGATGTGCCCATGGTGCTGGTGGGGAATAAGTGTGACCTGGCTGCGCGCACTGTGGAATCTCGGCAGGCCCAGGACCTTGCCCGAAGTTACAGCATTCCCTACATTGAGACATCCGCCAAGACCCGGCAGGGTGTAGAAGATGCCTTCTATACACTGGTGCGTGAGATCCGACAGCACAAGTTGCGGAAGCTGAACCCACCAGATGAGAGTGGGCCGGGCTGTATGAGCTGCAAGTGTGTGCTGTCCTGA

XM_004851721.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1998 bp    Location: 21909833..21896813   Strand: -
>XM_004851721.1
ATGACGCCCGGACCGGCGGCCAGAAGAACAACCCGGAGTGGAGAGCTCTCTCAGCAGAGGGACCCAGGGCTGGAACACCTGGGCCAAAGCCTGCAGCTGGGCAGACCCCTCACCTGGACCATCACAAGGAGCTCTGGGCCAGGCACCTGCCCCATCTCCTCTGTAACCACTCCCTTTGCGTGCAGCTACCCCTGGGCACGTGACCTCGCCAGGAGCCTAACCCAGCCCTGTCTCCCAGGTGTCACCTGTGGATATGCTGCCCCCACGCCCGGATGTTTGACCCACAGCAGAAGGCAGCTGCCAACAGCAGGTTGTATGTGGATGGACCCAGCCGGGGATGGATGCCCGAGGCCTCGGCCATACTCAGCCAGTGTCCGGGTGCGGGAGATGAGCAGGCAGGGCCTGCACAATCCATCCCCGCAGAGCAAGGGCCCAGAGAAACACCAGGCCGGCCACAAGGAGCAGCGTATGGAAGAGCCCTTGTCCCCTACCCACTTGCAGCCCCTGGCTCAGGTGGACGACCTCCGAAGTGTGCGGGTGCTGGAGGTGTGTGTGGACACCCGCGAGCACAGCCTGGGGAGCTTCGGGATGCACCTGCCCAACCTGAGCCAGCTGAAGTTGACTGGCAGTCGCCTGGGCTCCCTCAGAGACCTAGGTACCTCTCTCGGCCACCTGCAGGTGCTATGGCTGGCTCGATGTGGCCTTGCTGACCTGGATGGCATCAGCTCCTTCCCGGCACTGCAGGAGCTCTACGTCTCCTACAATAACATCTCAGACCTGAGCCCACTATGCCTACTCGACCAGCTGAAGGTGCTGGACCTCGAGGGCAACAGCGTGGAGGACCTGGAGCAGGTGCGCTACCTGCAGCTGTGCCCGAGGTTGACCACACTCACTCTGGAGGGCAACTTGGTATGCCTGCAGCCAGCCGCCGGCCCAGCTAACAAGGCCCCTGGGTGCTACAACTACAGGGCAGAAGTGAGGAAGCTCGTGCCCCAGCTGTGCATCCTGGACGAGGTGCCCACCACATGTGCTGATCTGCCTGCCCCCCGGGAGATGGGCCAGGACTGGCTCATGGTGAAAGAGGCCATCAAGGAAGGCAGCATGCTGGGCAGTGTCCTCCCCTCACTGGACCAAACCCACGGAGCCACCCTGCAGAAACGTGACCCAGCACTAAGCCTGCCCGAGACTCCGCCCTGGGTCTTGTCCCTGCTGGGACCCCTGACTGAAGGGCTGCTCCCTGAGGACCCAGCCCTTGAAGACCACGCCAGCAACCTCACCTATGGTGCTGGTCAGGTCCTCTGCGGGAACCTCACCAAAGGCCTGTGGGAACGCAGGCACCAGTTCCAGGCCCGAGTCACACCGGAGCAGCTATCCCCAACCAGACCAGGTCTGGCTGCCAGCCCCTCCACCCCACAACCTGACTCTACAGATAGCCATGGTCTCCTGGTGCTGGCTGGGCTTCCGGCCTGGAGGGAGCTTGACCTGTGGCCACTGGGGTCCCAGCAGGAAGGGGCTGCAGCTCCCCAGGACCCTCGGAGAGCCCCTGAACACCAAGAGGACCAGACTGGGCCCAGGCCTTCCCCAGGCCTGGCCTCAGAGCCTTCCAAGACACTAGGCTGTCATCTGACCCCTTCTCCTCCCAAGAACCCAATGCCACCTGACCCGGCCAGCAGCTCCCCCCGAGGCTCTGCTGACCTGCAGGTCAGAGGACGGAGGCTCAGAGCCCTGGGCAGCCTGGGGCCTGGCCTGGGTAAGGGGTTGGCCTCAGTGACCACCCTGAGAGCCCTGGAGGGCGCCNTCAGGTCCCACCCTCAAGCCCAGTGACATCCTGAGCCAAAGCCAGCCCTGGATCCAGCAGCCAGACCCCCAGCCCTCTGCTGCTTGTGGTACCTGAGCCCTGCACCCCAGTCCATCCTCACCTTTGGTGCAAAGCCCACCACTGCCAGGCTTGCTTGGATGGTGCCCAGTGGGCACCCCTGGGGTCCTGGGAGCCCCTGA

XM_004851711.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X5

Length: 5229 bp    Location: 21880598..21853707   Strand: -
>XM_004851711.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAAGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGCACTGAGGAGCTGTCTGCAGACCCACCTTCTCCTCTGAGGGCCAAGAGGAGGACTCTGTCCCGCTCAGCCCTGCAGTCTCACCAGCCCGTGGCCAGGCCCGTCTCCGTGGGGCTCTCAGGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGTGAGTACATGCTTCCAGGGACTACTGGTTGTTGGGGGTCGCTGTGGGCTGGGGCCGGGAAGCAGCCACCCCACAAGCTACTTTTCCTTGGATCCACCCTGGGTCTGGCTCCTTGGCCTGTGGTCCCTGGGCTGGGACACTTTCCTGGGATTTTCCAGCCAGCAGGCAGCATTCTGGCCAGGGCCAGGCCTAGGCCACTGACCTTCCTGTCTGTCGGACCCTCAGGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTGCTTCTGGAGCCCGGGTTCCCTGGCATGGATCCCTCTCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGATCTGCCACAGCAGGAGTGGCGAGATCAACCCTGTGAAGGTGGCCAACCTGGTGAAGGCCTACGTGGACAAGTACAGGCACATGCGCCGGCACCGGAAGGCGGAGGCCTCTGAGGAACCACCTGCCCCAGGGGCCGAGGCCTGA

XM_004851709.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X3

Length: 5292 bp    Location: 21880598..21854193   Strand: -
>XM_004851709.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGCACTGAGGAGCTGTCTGCAGACCCACCTTCTCCTCTGAGGGCCAAGAGGAGGACTCTGTCCCGCTCAGCCCTGCAGTCTCACCAGCCCGTGGCCAGGCCCGTCTCCGTGGGGCTCTCAGGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGTGAGTACATGCTTCCAGGGACTACTGGTTGTTGGGGGTCGCTGTGGGCTGGGGCCGGGAAGCAGCCACCCCACAAGCTACTTTTCCTTGGATCCACCCTGGGTCTGGCTCCTTGGCCTGTGGTCCCTGGGCTGGGACACTTTCCTGGGATTTTCCAGCCAGCAGGCAGCATTCTGGCCAGGGCCAGGCCTAGGCCACTGACCTTCCTGTCTGTCGGACCCTCAGGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTGCTTCTGGAGCCCGGGTTCCCTGGCATGGATCCCTCTCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGGTAGGCTGTGGGGGGGTTATGCCTGTGCATGCTGCAGATCTGAGGCCGGGAGCATCGTGTGCACGGCCCAGCAGCGCTACCCATTTTGGGAGGGTGCACTGGGGCCCAGCCAGCAGCAGTGGCCTGAGGTCCACCCATCTTCTTGCGCCCATTAAAAAGACTGAGGTGACCGAGAGGGTGTTTAGGGTTGCCCGGTCCACACCCAGCTGA

XM_004851706.1 Coding sequence

Irf7 interferon regulatory factor 7, transcript variant X2

Length: 1290 bp    Location: 21850243..21853193   Strand: +
>XM_004851706.1
ATGGCCGCGGCCCCTGAGAGGGCAGCGCAGCGCGTGCGCTTCGGAGAGTGGCTTCTGGGCGAGGTCAGCAGCGGCCGCTACGAGGGGCTGCGGTGGCTGAACGAGGCGCGCACTGTCTTCCGCGTGCCCTGGAAGCACTTCGCCCGCAAGGACCTGGGCGAGGCCGATGCACGCATCTTCAAGGCCTGGGCAGTGGCCCGAGGGAGGTGGCCACCCAGCAGCAGTGGGGGTGGCCCACCGCACCCCGAGGCTGAGGCTGCCGAACGAGCGAGCTGGAAAACCAACTTCCGCTGTGCGTTGCACAGCACGCAGCGCTTCGTGATGCTGTGGGACAACTCAGGGGACCCGGTTGACCCACACAAGGTGTATGCGCTCAGCCTGGAGAAGGGGTGCAGAGGCCCAGCCATGAACCAGGAGGAGGAAGAGGCCCTCAGAACTGCCTTGCCCACACAGGTTCTGCAGCAGAGTTTCCTGGGGGACCCCCTGCTGGAAGCTGCACTGGTAGTAGCAGATCCGATCACCCTGCCACAGGCTCCTGGCACAGTGCAGCCTGAGCCGCCACCTGCAGGATGGGCAGTGGAGCCTGTGCCCTGCCCTAGGCCTCAGGCCCCAGCCCTGGCAGCAGAGTCCAGCTCAGGGGTCCTGGATGTGACCATCATGTACAAAGGGCGCACGGTGCTGCAGGCAGTGGTGGGGCACCCCAGCTGTGTGTTCCTGTACAGCCCCCCAGGCCCAGGCTGCCAGGCCCTACAGCCCCAGCAGGTAGTCTTCCCCAGCCCTGCCGAGCTGCCAGACCAGAAGCAACTGCGCTACACGGAGCAGCTGCTGCAGCACGTGGCCCCTGGGCTGCAGCTGGAGCTGTGTGGTGTGACACTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGTTGGGCAGCCCGCTGGGTTCCGCCAGCCCCTGCACCCCAGCCCGGCTGCTGGAGCGCAACTGCAACACCCCCATCTTCGACTTCAGCACCTTCTTCCGAGAGCTGGGGGAGTTCCGGGCCAGGCGGCGCCAAGGCTCACCCTACTACACCATCTACCTGGGCTTCGGGCAGGACCTGTCGGCCGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAGGTGGAGCTGAGACTGTGCCGGCTGCACCTGGAGCTTGTGCAGCGTGAGGGTACGTCCTCCCTGGACAGCAGCAGCCTGGGACTGTGCCTGTCGAGCACCAGCAGCCTCTACGACGACATCGAGCACTTCCTTATGGAGCTGGAGCAGCCAGCTTAG

XM_004851710.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X4

Length: 5253 bp    Location: 21880598..21854193   Strand: -
>XM_004851710.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAAGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGCACTGAGGAGCTGTCTGCAGACCCACCTTCTCCTCTGAGGGCCAAGAGGAGGACTCTGTCCCGCTCAGCCCTGCAGTCTCACCAGCCCGTGGCCAGGCCCGTCTCCGTGGGGCTCTCAGGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGTGAGTACATGCTTCCAGGGACTACTGGTTGTTGGGGGTCGCTGTGGGCTGGGGCCGGGAAGCAGCCACCCCACAAGCTACTTTTCCTTGGATCCACCCTGGGTCTGGCTCCTTGGCCTGTGGTCCCTGGGCTGGGACACTTTCCTGGGATTTTCCAGCCAGCAGGCAGCATTCTGGCCAGGGCCAGGCCTAGGCCACTGACCTTCCTGTCTGTCGGACCCTCAGGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGGTAGGCTGTGGGGGGGTTATGCCTGTGCATGCTGCAGATCTGAGGCCGGGAGCATCGTGTGCACGGCCCAGCAGCGCTACCCATTTTGGGAGGGTGCACTGGGGCCCAGCCAGCAGCAGTGGCCTGAGGTCCACCCATCTTCTTGCGCCCATTAAAAAGACTGAGGTGACCGAGAGGGTGTTTAGGGTTGCCCGGTCCACACCCAGCTGA

XM_004851712.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X6

Length: 5175 bp    Location: 21880598..21854194   Strand: -
>XM_004851712.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAAGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGTGAGTACATGCTTCCAGGGACTACTGGTTGTTGGGGGTCGCTGTGGGCTGGGGCCGGGAAGCAGCCACCCCACAAGCTACTTTTCCTTGGATCCACCCTGGGTCTGGCTCCTTGGCCTGTGGTCCCTGGGCTGGGACACTTTCCTGGGATTTTCCAGCCAGCAGGCAGCATTCTGGCCAGGGCCAGGCCTAGGCCACTGACCTTCCTGTCTGTCGGACCCTCAGGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTGCTTCTGGAGCCCGGGTTCCCTGGCATGGATCCCTCTCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGGTAGGCTGTGGGGGGGTTATGCCTGTGCATGCTGCAGATCTGAGGCCGGGAGCATCGTGTGCACGGCCCAGCAGCGCTACCCATTTTGGGAGGGTGCACTGGGGCCCAGCCAGCAGCAGTGGCCTGAGGTCCACCCATCTTCTTGCGCCCATTAAAAAGACTGAGGTGACCGAGAGGGTGTTTAGGGTTGCCCGGTCCACACCCAGCTGA

XM_004851703.1 Coding sequence

Cdhr5 cadherin-related family member 5, transcript variant X2

Length: 2355 bp    Location: 21843506..21849832   Strand: +
>XM_004851703.1
ATGACACCCACATCCCCCCCTGGTGGTGGCCTGGCCTGGCCGCCCTGCGGGAGCCCCCTGGGTGGAGCTGTCAGCAGGGCCATAAAGCAGGGCGGCGCCTGGCAGGGCAAAGGTCGGTCGCGGAGACGGGGAAGGCCTAGCCCTGGACCGCAGACTGCCAGACCCTTCCGGCAGGTGACAGCCACTAAGATGGGGGCCAGGGCCCCACTGTGGGCCTCCCTGCTTCTGCTCCTCGCACTGCCAGGCCAACCCCCGGGGGCAGCAGCCCAGGGCCAGGTCTGCTCGGTGGACAGGACCTTTGTCAGCGTCGAGGAGAACAGCAGTGTTGCTGAGCCCCTGGTGAATATCTCCATCCCGGACGGCCAGCATGTCACCCTGGGGCCTTCGTCCAGCCCCTCCGCCTTCCGGATCCTGGTAGACCAGCTGTTCCTCAACGTGACCCCTGATTACGAGGACAGCACAATGCTGGAGGCTCACCTGGAATGCAGGAGGGGCAGCTCTGTGGTGACGCAGCTGGTGGTGCTGGTGTCCGTGCTGGATGTCAACGACAATGCCCCAGAATTCCCCTTTGAGACCAAGGAGCAGAACGTGTCGGAGGACACCAGAGTGGGCTCCATAGTCATCCCTGAGGACCAACTGAAGGCCTCCGACAAGGACTCGGAGGACGTCTTGTTCTACACCCTCCAGGAAGTGACCCCGAATGCCAGAAGCTTCTTCTCCCTGGTGAGCGCGAACCGCCCTGCCCTGCGGCTGGACCAGGCCCTGGACTTCTACAAGTGGCAGGACATGACTTTGCAGCTGCTGGTCCGGGACACTCAGGAGGAGACGGAGGTGCCCAGCCACAGGGCCACGGCCACCCTGGTCCTGCATGTGCTGCCCGCTGACCTGAGGCCCCCCTGGTTCCTGCCCTGCTCCTACTCAGACGGCTACGTCTGCATCCAGGCCCAGTACCATGGGGCTGTCCCCAAGGGACACACACTGCCATCCCCTCTCATCCTGCATCCCGGGCCCATCTATGCCGTGGATGGGGACCAGGGCATTGACGCGCGCATCATCTACAGCATTGTGGGGGGGAATACAGACAACACTTTTGCCGTTGACAAGGACTCTGGCAACCTCACCATGGCCAAGAGCATCCCCAGCCCCACGACCTTCATCTTGCTGATCAGGGCAGACCAGGCTGACCTGGCCCGATACTCGGTGACCCAGGCCACTGTGGAGGCCCGCTCTGCCACCGGGAACCCACCCCGCTTTCCCCAGAGCCTGTACCGGGGCATCGTGCCGCCCGGCTCTGAGGCCGGTGTGACTGTCCGGGACGCAGCCTCCCCGACCCAGCCTCTGAGGATCCAGGCTCAGGACCCTGACTTCCTGGGCCTCAACTCGGCTGTCACTTACCGAATCACCAACTGCTCTGAGTTCCGGATGGACGGGGAGACCATGCTGACCACTCTGGCGCTGGAGCATGAGGGAGTCTTCTACGCAGAGGTGGAGGCCACAAACACAGCGACCAACGACACAGCCACTGCTGTTGCTGAGATTTGGGTTTCAGAGCAGAAGCCCCCCACCATAGGCACATCGCTGAGGCCGGCTGCCTCAACCACACCTGGGGGGCTCCCCGGTGTGGGAGCCAGCACCATCCTCTGGCCAGGCACGCCTGGTGGGGTCTCAGCTCCGACCCCGAAGCCAGGGACCTCTCGGCCAACGACCCCTGGGTCCAGCGGGAGCTCCTCAGCCTCAGGGACACCAGGAGTCGGCAGCACTGGTGAAGACGAGCCAGGCCGCCCAGAGGAGCTGCGCTTTTCCACGGTGGACATGGCGGTCCTGGGAGGGGTGCTGAGTGCACTGCTGCTGCTGGCCCTCACTGTCCTGGCTGTGCTCCTCTATAAGCACTATGGGCACCGACTGAGCTGCTGTTCTGGGAAAGCTGCGGAGCCCCAGCCCCACGTCTTTGACAACCAGGCCTTCCGGGGTGACCATGGGGCCACCGAGACATCTGTCCCCAGCCCCGAGCCGGGCCCCACGCCTGCGGAGATGCCACCTGCAGCCCTGGACCCTGAGCCCCTGAGCCCCGCACCCCCCAACCCTGAGCCCCTCGCCCCCGAGCCCCCAGTGGCCACTGGAGCCGGGGACAGCCCCTCGGCCGTGAGGTCCATCTTGACCAAGGAGCGGCGGCCTGGGGGTGGCTACAAGGCCGTGTGGTTTGGCGGGGACATCGGGGCAGCGGCTGACGTCGTGGTCCTCAGCGCGCCTGAGGCTGGCCGGGATGGCGAGGGCGACTCTGAGGGCAGCAGCGAGGAGGACGGGGGCCGGGACGGGGGTCCCCGCGACGCATCGGGCAGCTCCACCCGCATCTAG

XM_004851689.1 Coding sequence

Taldo1 transaldolase 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1014 bp    Location: 21766027..21758827   Strand: -
>XM_004851689.1
ATGTCGGGGTCCCCGGTGAAGCGCCAGAGGATGGAGTCCGCGCTGGACCAGCTCAAGCAGTTCACCACAGTGGTGGCCGACACGGGCGACTTCCAAGCCATCGAGGAGTACAAGCCCCAGGACGCCACCACCAACCCATCCCTGATCCTGGCTGCGGCACAGATGCCTGCCTACCAAGGGCTAGTGGACGAGGCTATTGCCTACGGCAAGAAGCTAGGCGGGTCACAAGAGGACCAAATTAAAAATGCTATTGATAAACTTTTCGTGTTGTTTGGAGCAGAAATACTGAAGAAGATTCCAGGCCGTGTATCCACAGAAGTAGATGCGAGGCTCTCCTTTGACAAGGATGCCATGGTGGCCCGAGCCAGGCACTTCATTGAACTGTACCAGGAGGCTGGAATCAGCAAGGACAGAGTTCTCATCAAGCTGTCATCCACCTGGGAGGGAATCCAGGCTGGAAGGGAGCTGGAGGAGCAGCACGGCATCCACTGCAACATGACGCTGCTCTTCTCCTTCGCCCAGGCCGTGGCCTGTGCTGAGGCGGGCGTGACACTCATCTCCCCCTTTGTGGGGCGCATCCTGGACTGGCATGTGGCGAACACGGACAAGAAATCCTATGAGCCACTGGAGGACCCTGGGGTCAAGAGTGTCACCAAAATCTACAACTACTACAAGAAGTTTGGTTACCATACCATCGTCATGGGCGCCTCCTTCCGCAACACGGCTGAGATCAAGGCCCTGGCCGGCTGCGATCTCCTCACCATCTCGCCCAAGCTGCTGGGCGAGCTGCTCAAAGACAGCAGCAAGCTGGTGCCCATGCTCTCAGCCAAGGCGGCCCAGGCCAGTGACTTGGAGAAGATGCACCTGGACGAGAAGTCTTTCCGCTGGCTGCACAACGAGGACCAGATGGCTGTGGAGAAGCTGTCTGAGGGGATCCGGAAGTTTGCTGCTGATGCTGTGAAGCTGGAGCGGATGCTGACGGAACAAATGTTCAGCACGGAGAATGGGAAATAG

XM_004851696.1 Coding sequence

Tmem80 transmembrane protein 80

High confidence: 3 potential gene matches
Length: 432 bp    Location: 21799101..21792828   Strand: -
>XM_004851696.1
ATGGCGGCCGCACGGCCGGGGAGAGGCTCCTCCTCGGTGCTCTCCTCAGTTCCTCTTCAGATGCTGTTTCATCTCAGCGGGATATACTGCGCCCTGTATTTTCTGGCCACACTCCTGATGATCGTATATAAAAGCCGGGTTTTCAGCTGTCCTCACAGCTACCTGGGCCTCGACCTGATGCTGCTGTCTCTGATGGGGCCTCTGGAAGCAGCGAGGCTGCACCTGGGCATGAAGGGCAACCTGACAGAAGCTGAGGTGCCACTGGCTGCCAGCGTGGCCCTCACAGTGGGCATCGGGCTACTTTCTGTCTACTTCCTTCTCTGGCAGACCATGGTGCTGTGGGCAGACTGGGTTCTCAGCACCACACTCCTGGCACTGCATGGCCTGGAAGCCGCCCTGCAGGTGGTGGTAATCACAGCCTTTGTCAGATAA

XM_004851682.1 Coding sequence

Slc25a22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22, transcript variant X2

Length: 972 bp    Location: 21712300..21717724   Strand: +
>XM_004851682.1
ATGGCTGATAAACAGATCAGCCTGCCAGCCAAGCTCATCAATGGTGGCATTGCTGGACTAATCGGGGTCACCTGCGTGTTCCCCATCGACCTGGCCAAGACGAGGCTGCAGAACCAGCAGAATGGCCAGCGCATGTACTCCAGCATGTCTGACTGCCTAATCAAGACCATCCGCTCGGAGGGCTACTTCGGCATGTATCGAGGAGCTGCTGTGAACCTGACCTTGGTCACCCCAGAGAAAGCCATCAAGCTGGCAGCTAATGACTTCTTCCGGCATCAGCTTTCGAAGGACGGGCAGAAGCTGACCCTGCCTAAAGAGATGCTGGCAGGCTGTGGGGCTGGCACCTGCCAAGTGATTGTCACCACCCCCATGGAGATGCTGAAGATCCAGCTCCAGGATGCAGGCCGAGTTGCTGCCCAGAAGAAGATTCTGGCTGCCCAGGCCCAGCTCTCGCCCCAGGCGGGGGCCCCACCTTCTGTGGAGGCTCCTGCTGCACCCCGGCCCACGGCCACTCAGCTGACTCGAGACCTACTGCGGAGCCGTGGCATCGCTGGTCTCTACAAGGGACTGGGGGCCACGCTACTCAGGGATGTCCCCTTCTCCATCGTCTACTTCCCCCTGTTTGCCAACCTGGACCAGCTGGGCCGCCCGGCATCTGAGGAGAAGTCGCCCTTCTACATATCCTTCCTGGCTGGCTGTGTAGCTGGAAGTACAGCCGCTGTGGCTGTCAACCCCTGTGATGTGGTGAAGACCCGGCTGCAGTCACTGCAGCGGTGTGTCAATGAAGACACTTACTCTGGGTTTCTGGACTGTGCCAGGAAGATCTGGCGCCACGAGGGCCCCTCCGCCTTCCTGAAGGGTGCTTACTGCCGCGCACTGGTCATCGCTCCACTGTTCGGCATCGCACAGGTGGTCTACTTCCTGGGCATTGCCGAGTCCCTGCTGGGGCTACTGCAGGACCCCCAGGCCTGA

XM_004851683.1 Coding sequence

Slc25a22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22, transcript variant X3

Length: 972 bp    Location: 21712300..21717724   Strand: +
>XM_004851683.1
ATGGCTGATAAACAGATCAGCCTGCCAGCCAAGCTCATCAATGGTGGCATTGCTGGACTAATCGGGGTCACCTGCGTGTTCCCCATCGACCTGGCCAAGACGAGGCTGCAGAACCAGCAGAATGGCCAGCGCATGTACTCCAGCATGTCTGACTGCCTAATCAAGACCATCCGCTCGGAGGGCTACTTCGGCATGTATCGAGGAGCTGCTGTGAACCTGACCTTGGTCACCCCAGAGAAAGCCATCAAGCTGGCAGCTAATGACTTCTTCCGGCATCAGCTTTCGAAGGACGGGCAGAAGCTGACCCTGCCTAAAGAGATGCTGGCAGGCTGTGGGGCTGGCACCTGCCAAGTGATTGTCACCACCCCCATGGAGATGCTGAAGATCCAGCTCCAGGATGCAGGCCGAGTTGCTGCCCAGAAGAAGATTCTGGCTGCCCAGGCCCAGCTCTCGCCCCAGGCGGGGGCCCCACCTTCTGTGGAGGCTCCTGCTGCACCCCGGCCCACGGCCACTCAGCTGACTCGAGACCTACTGCGGAGCCGTGGCATCGCTGGTCTCTACAAGGGACTGGGGGCCACGCTACTCAGGGATGTCCCCTTCTCCATCGTCTACTTCCCCCTGTTTGCCAACCTGGACCAGCTGGGCCGCCCGGCATCTGAGGAGAAGTCGCCCTTCTACATATCCTTCCTGGCTGGCTGTGTAGCTGGAAGTACAGCCGCTGTGGCTGTCAACCCCTGTGATGTGGTGAAGACCCGGCTGCAGTCACTGCAGCGGTGTGTCAATGAAGACACTTACTCTGGGTTTCTGGACTGTGCCAGGAAGATCTGGCGCCACGAGGGCCCCTCCGCCTTCCTGAAGGGTGCTTACTGCCGCGCACTGGTCATCGCTCCACTGTTCGGCATCGCACAGGTGGTCTACTTCCTGGGCATTGCCGAGTCCCTGCTGGGGCTACTGCAGGACCCCCAGGCCTGA

XM_004851685.1 Coding sequence

Slc25a22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22, transcript variant X5

Length: 840 bp    Location: 21712300..21717724   Strand: +
>XM_004851685.1
ATGTACTCCAGCATGTCTGACTGCCTAATCAAGACCATCCGCTCGGAGGGCTACTTCGGCATGTATCGAGGAGCTGCTGTGAACCTGACCTTGGTCACCCCAGAGAAAGCCATCAAGCTGGCAGCTAATGACTTCTTCCGGCATCAGCTTTCGAAGGACGGGCAGAAGCTGACCCTGCCTAAAGAGATGCTGGCAGGCTGTGGGGCTGGCACCTGCCAAGTGATTGTCACCACCCCCATGGAGATGCTGAAGATCCAGCTCCAGGATGCAGGCCGAGTTGCTGCCCAGAAGAAGATTCTGGCTGCCCAGGCCCAGCTCTCGCCCCAGGCGGGGGCCCCACCTTCTGTGGAGGCTCCTGCTGCACCCCGGCCCACGGCCACTCAGCTGACTCGAGACCTACTGCGGAGCCGTGGCATCGCTGGTCTCTACAAGGGACTGGGGGCCACGCTACTCAGGGATGTCCCCTTCTCCATCGTCTACTTCCCCCTGTTTGCCAACCTGGACCAGCTGGGCCGCCCGGCATCTGAGGAGAAGTCGCCCTTCTACATATCCTTCCTGGCTGGCTGTGTAGCTGGAAGTACAGCCGCTGTGGCTGTCAACCCCTGTGATGTGGTGAAGACCCGGCTGCAGTCACTGCAGCGGTGTGTCAATGAAGACACTTACTCTGGGTTTCTGGACTGTGCCAGGAAGATCTGGCGCCACGAGGGCCCCTCCGCCTTCCTGAAGGGTGCTTACTGCCGCGCACTGGTCATCGCTCCACTGTTCGGCATCGCACAGGTGGTCTACTTCCTGGGCATTGCCGAGTCCCTGCTGGGGCTACTGCAGGACCCCCAGGCCTGA

XM_004851686.1 Coding sequence

Cend1 cell cycle exit and neuronal differentiation 1, transcript variant X1

Length: 453 bp    Location: 21718028..21720907   Strand: +
>XM_004851686.1
ATGGAGTCCAGGGCAAAGTCGGCCAGCAGTCCCAAGCCAGACACCAAGGTGCCTCAGGCCACCACTGAGGCCAAGGCCGCTCCAGCTGCTGATGGAAAAGCCCTCTTGACCAAGACCGGGAAGAAGGAGGCCCAAGCCGAGAAGCAGGAGCAGCCGGCAGCCCCTGCTTCTGCCAAGAAGGCCCCAGCCAAGGCTGATCCTGTCCTTCTCAACAACCACAGCAACCTGAAGCCGGCCTCCACAGCTCCTGCTGTCCCTAGCAGTCCTGATGCAACCCCAGAGCCCAAGGGTCCTGGGGATGGGGCGGAGGAGGACGAGTCCACCACCAGGGGCTCAGGGGGCCAAGATCCTTGGCCCTGTGAGAACTTCACACCCCTGCTGGTGGTTGGGGGGGTGGCTGTGGCAGCAGTGGCCCTAATTCTTGGTGTGGCCTTCCTGGCCCGGAAAAAATGA

XM_004851688.1 Coding sequence

Taldo1 transaldolase 1, transcript variant X1

Length: 1038 bp    Location: 21766027..21758827   Strand: -
>XM_004851688.1
ATGTCGGGGTCCCCGGTGAAGCGCCAGAGGATGGAGTCCGCGCTGGACCAGCTCAAGCAGTTCACCACAGTGGTGGCCGACACGGGCGACTTCCAAGCCATCGAGGAGTACAAGCCCCAGGACGCCACCACCAACCCATCCCTGATCCTGGCTGCGGCACAGATGCCTGCCTACCAAGGGCTAGTGGACGAGGCTATTGCCTACGGCAAGAAGCTAGGCGGGTCACAAGAGGACCAAATTAAAAATGCTATTGATAAACTTTTCGTGTTGTTTGGAGCAGAAATACTGAAGAAGATTCCAGGCCGTGTATCCACAGAAGTAGATGCGAGGCTCTCCTTTGACAAGGATGCCATGGTGGCCCGAGCCAGGCACTTCATTGAACTGTACCAGGAGGCTGGAATCAGCAAGGACAGAGTTCTCATCAAGCTGTCATCCACCTGGGAGGGAATCCAGGCTGGAAGGGAGCTGGAGGAGCAGCACGGCATCCACTGCAACATGACGCTGCTCTTCTCCTTCGCCCAGGCCGTGGCCTGTGCTGAGGCGGGCGTGACACTCATCTCCCCCTTTGTGGGGCGCATCCTGGACTGGCATGTGGCGAACACGGACAAGAAATCCTATGAGCCACTGGAGGACCCTGGGGTCAAGAGTGTCACCAAAATCTACAACTACTACAAGAAGTTTGGTTACCATACCATCGTCATGGGCGCCTCCTTCCGCAACACGGCTGAGATCAAGGCCCTGGCCGGCTGCGATCTCCTCACCATCTCGCCCAAGCTGCTGGGCGAGCTGCTCAAAGACAGCAGCAAGCTGGTGCCCATGCTCTCAGCCAAGGCGGCCCAGGCCAGTGACTTGGAGAAGATGCACCTGGACGAGAAGTCTTTCCGCTGGCTGCACAACGAGGACCAGATGGCTGTGGAGAAGCTGTCTGAGGGGATCCGGAAGTTTGCTGCTGATGCTGTGAAGCTGGAGCGGATGCTGACGGTGAGTTCCTTGCGGGTGGCCTTGGGCACACACACCATAGCCTTGGCGGGCTGGTGA

XM_004851678.1 Coding sequence

Rplp2 ribosomal protein, large, P2, transcript variant X2

Length: 609 bp    Location: 21701358..21698821   Strand: -
>XM_004851678.1
ATGAGCAACGTCCATTTGGAACGGCTTTTCACTTTTGCCGCGCGACTTCCCGACTGGGGAACCGGACCACGGCTCTACTCCCGTCGTCATTGGCTGAGCGCTCCGTTGCGTCATTTGTGGGAGCCCTCGCGCAGCGCCGCACACGCCCGGAGGCTTTTGGGTAACGGTTTACCCCCGCCCCTTCTGCCGGCCTCTTCCTTTTGCTTCCCGACGTCGCAGAGGTCGCACGCGAGAGGCCTCTCTGCCGCCACCGCCGCCGACATGCGGTACGTCGCCTCCTACTTGCTAGCCGCCCTCGGAGGAAACCCCTCCCCCAGCGCCAAGGACATCAGGAAGATCCTGGACAGTGTGGGCATCGAGGCAGACGATGACCGGCTTAATAAGGTCATCAGTGAGCTGAATGGGAAAAACATTGAAGATGTCATTGCCCAGGGCATTGGCAAGCTTGCCAGTGTGCCGGCTGGTGGGGCTGTGGCTGTATCTGTTGCCCCTGGCTCTGCAGCTCCTGCTGCTGGTTCTGCCCCTGCTGCAGCAGAGGAGAAGAAAGAAGAGAAGAAGGAGGAGTCCGAGGAATCTGATGATGACATGGGATTTGGCCTGTTTGACTAA

XM_004851674.1 Coding sequence

Pnpla2 patatin-like phospholipase domain containing 2, transcript variant X3

Length: 1479 bp    Location: 21697013..21692017   Strand: -
>XM_004851674.1
ATGTTCCCCCGGGAGACGAAGTGGAACATCTCGTTCGCGGGCTGCGGCTTCCTCGGCGTTTACCACATCGGCGTGGCTTCCTGCCTCCGCGAGCACGCGCCCTTCCTGGTGGCCAACGCCACGCACATCTATGGCGCCTCGGCTGGCGCCCTTACGGCCACGGCGCTGGTCACCGGGGCCTGCCTGGGCGAGGCAGGTGCCAATATCATTGAAGTGTCCAAGGAGGCCCGAAAGAGGTTCCTAGGCCCCCTGCACCCCTCCTTCAACCTGGTGAAGACTATCCGGGGCTGCCTACTGAAGACCCTGCCTGATGATTGCCACGAACGCGCCAGTGGGCGCCTGGGCATCTCCCTGACTCGGGTATCGGATGGCGAGAATGTCATCATCTCCCATTTCAACTCCAAGGATGAGCTCATCCAGGCCAATGTCTGCAGCACCTTCATCCCTGTGTACTGTGGCCTCATCCCTCCCTGCCTCCAAGGGGTGCGCTATGTGGACGGCGGCATTTCAGACAACTTGCCACTCTATGAGCTTAAGAACACCATCACTGTGTCCCCGTTCTCGGGCGAGAGTGACATCTGTCCCCAGGACAGCTCCACCAACATCCATGAACTGCGGGTCACCAACACCAGCATCCAGTTCAACCTGCGCAACCTCTACCGCCTCTCCAAGGCCCTCTTCCCCCCAGAGCCCATGGTGCTTAGAGAGATGTGCAAGCAGGGCTACAGGGACAGCCTGCGCTTCCTGAGGCGGAACGGCCTCCTGAACCGGCCCAACCCCCTGCTGGCGCTGCCCGCCACCCGAGGACGTGGGGAGGAAGACAGGGAGGAGGCCAGCGGGGGCGTAGAGAGCAGCGGCACTGAGGAGCGACTGCTGCCACCCGGTGAAGACCACATCCTGGAGCATCTGCCCTCGCGGCTCAATGAGGCCCTGCTGGAGGCTTGCGTGGAGCCCAGGGACTTGATGACCACACTGTCCAACATGCTGCCTGTGCGGCTGGCCACAGCCATGATGCTGCCCTACACTCTGCCGCTGGAGAGTGCGGTGTCTTTCACCATCCGCCTGCTGGAGTGGTTGCCTGATGTGCCCGAGGACATCCGGTGGATGAAGGAACAGACGGGGAGCATCTGCCAGTATCTGGTGATGCGCACCAAGAGGAAGCTGGGCAGTCACCTGCCCTCCAGGCTGTCTGAGCCCACTGAGCTTCGTCGAGCTCGGTCATTACCCTCGGTGCCGCTGTCCTGCGCTAGCTACTGGGAGGCACTGCCCAGCTGGGTGCGCAGCAACCTCTCCTTGGGTGATGCGCTGGCCAAGTGGGAGGACTGCCAGCGCCAGCTGCTGCTGGGTCTCTTCTGCACCAACGTGGCCTTCCCACCGGATGCCCTGCACATGCGCCTGCCCGCGGACCCGAAGCCTGCGGACCCCAGGGCTCTTGACCCCAGGCTCCCCCAGCACCCACCAGGCCTGCCCCCATGCTGA

XM_004851673.1 Coding sequence

Pnpla2 patatin-like phospholipase domain containing 2, transcript variant X2

Length: 1479 bp    Location: 21697012..21692017   Strand: -
>XM_004851673.1
ATGTTCCCCCGGGAGACGAAGTGGAACATCTCGTTCGCGGGCTGCGGCTTCCTCGGCGTTTACCACATCGGCGTGGCTTCCTGCCTCCGCGAGCACGCGCCCTTCCTGGTGGCCAACGCCACGCACATCTATGGCGCCTCGGCTGGCGCCCTTACGGCCACGGCGCTGGTCACCGGGGCCTGCCTGGGCGAGGCAGGTGCCAATATCATTGAAGTGTCCAAGGAGGCCCGAAAGAGGTTCCTAGGCCCCCTGCACCCCTCCTTCAACCTGGTGAAGACTATCCGGGGCTGCCTACTGAAGACCCTGCCTGATGATTGCCACGAACGCGCCAGTGGGCGCCTGGGCATCTCCCTGACTCGGGTATCGGATGGCGAGAATGTCATCATCTCCCATTTCAACTCCAAGGATGAGCTCATCCAGGCCAATGTCTGCAGCACCTTCATCCCTGTGTACTGTGGCCTCATCCCTCCCTGCCTCCAAGGGGTGCGCTATGTGGACGGCGGCATTTCAGACAACTTGCCACTCTATGAGCTTAAGAACACCATCACTGTGTCCCCGTTCTCGGGCGAGAGTGACATCTGTCCCCAGGACAGCTCCACCAACATCCATGAACTGCGGGTCACCAACACCAGCATCCAGTTCAACCTGCGCAACCTCTACCGCCTCTCCAAGGCCCTCTTCCCCCCAGAGCCCATGGTGCTTAGAGAGATGTGCAAGCAGGGCTACAGGGACAGCCTGCGCTTCCTGAGGCGGAACGGCCTCCTGAACCGGCCCAACCCCCTGCTGGCGCTGCCCGCCACCCGAGGACGTGGGGAGGAAGACAGGGAGGAGGCCAGCGGGGGCGTAGAGAGCAGCGGCACTGAGGAGCGACTGCTGCCACCCGGTGAAGACCACATCCTGGAGCATCTGCCCTCGCGGCTCAATGAGGCCCTGCTGGAGGCTTGCGTGGAGCCCAGGGACTTGATGACCACACTGTCCAACATGCTGCCTGTGCGGCTGGCCACAGCCATGATGCTGCCCTACACTCTGCCGCTGGAGAGTGCGGTGTCTTTCACCATCCGCCTGCTGGAGTGGTTGCCTGATGTGCCCGAGGACATCCGGTGGATGAAGGAACAGACGGGGAGCATCTGCCAGTATCTGGTGATGCGCACCAAGAGGAAGCTGGGCAGTCACCTGCCCTCCAGGCTGTCTGAGCCCACTGAGCTTCGTCGAGCTCGGTCATTACCCTCGGTGCCGCTGTCCTGCGCTAGCTACTGGGAGGCACTGCCCAGCTGGGTGCGCAGCAACCTCTCCTTGGGTGATGCGCTGGCCAAGTGGGAGGACTGCCAGCGCCAGCTGCTGCTGGGTCTCTTCTGCACCAACGTGGCCTTCCCACCGGATGCCCTGCACATGCGCCTGCCCGCGGACCCGAAGCCTGCGGACCCCAGGGCTCTTGACCCCAGGCTCCCCCAGCACCCACCAGGCCTGCCCCCATGCTGA

XM_004851644.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X3

Length: 1236 bp    Location: 21669710..21666622   Strand: -
>XM_004851644.1
ATGACAGGCAGGGTGGCGTGCTGGCTGCTCAGAGGGGCCGAGACGCCAGGGAAGGCACCCATGGCCAAGCTGCCTTGGGCCGGGGTTGGTCCCCAGTGCTCTGTGGGCTTGTGCCAACCTGGCTGTGCACAGAACATGGGGTGGGCTCCCAGGCGACCAGCAAGCCTGCGACAGCCGCCACGTCCTGCCTCTGGCCAGGCCGTGTCCCGAATGCCGAGGGGCATGGCAGCTGCTCCTCCAGGGTACCTCACCCTGTCCCCATCCCTGTCCCCCACTGGTGCTGCCGTCCAGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851672.1 Coding sequence

Pnpla2 patatin-like phospholipase domain containing 2, transcript variant X1

Length: 1479 bp    Location: 21697009..21692017   Strand: -
>XM_004851672.1
ATGTTCCCCCGGGAGACGAAGTGGAACATCTCGTTCGCGGGCTGCGGCTTCCTCGGCGTTTACCACATCGGCGTGGCTTCCTGCCTCCGCGAGCACGCGCCCTTCCTGGTGGCCAACGCCACGCACATCTATGGCGCCTCGGCTGGCGCCCTTACGGCCACGGCGCTGGTCACCGGGGCCTGCCTGGGCGAGGCAGGTGCCAATATCATTGAAGTGTCCAAGGAGGCCCGAAAGAGGTTCCTAGGCCCCCTGCACCCCTCCTTCAACCTGGTGAAGACTATCCGGGGCTGCCTACTGAAGACCCTGCCTGATGATTGCCACGAACGCGCCAGTGGGCGCCTGGGCATCTCCCTGACTCGGGTATCGGATGGCGAGAATGTCATCATCTCCCATTTCAACTCCAAGGATGAGCTCATCCAGGCCAATGTCTGCAGCACCTTCATCCCTGTGTACTGTGGCCTCATCCCTCCCTGCCTCCAAGGGGTGCGCTATGTGGACGGCGGCATTTCAGACAACTTGCCACTCTATGAGCTTAAGAACACCATCACTGTGTCCCCGTTCTCGGGCGAGAGTGACATCTGTCCCCAGGACAGCTCCACCAACATCCATGAACTGCGGGTCACCAACACCAGCATCCAGTTCAACCTGCGCAACCTCTACCGCCTCTCCAAGGCCCTCTTCCCCCCAGAGCCCATGGTGCTTAGAGAGATGTGCAAGCAGGGCTACAGGGACAGCCTGCGCTTCCTGAGGCGGAACGGCCTCCTGAACCGGCCCAACCCCCTGCTGGCGCTGCCCGCCACCCGAGGACGTGGGGAGGAAGACAGGGAGGAGGCCAGCGGGGGCGTAGAGAGCAGCGGCACTGAGGAGCGACTGCTGCCACCCGGTGAAGACCACATCCTGGAGCATCTGCCCTCGCGGCTCAATGAGGCCCTGCTGGAGGCTTGCGTGGAGCCCAGGGACTTGATGACCACACTGTCCAACATGCTGCCTGTGCGGCTGGCCACAGCCATGATGCTGCCCTACACTCTGCCGCTGGAGAGTGCGGTGTCTTTCACCATCCGCCTGCTGGAGTGGTTGCCTGATGTGCCCGAGGACATCCGGTGGATGAAGGAACAGACGGGGAGCATCTGCCAGTATCTGGTGATGCGCACCAAGAGGAAGCTGGGCAGTCACCTGCCCTCCAGGCTGTCTGAGCCCACTGAGCTTCGTCGAGCTCGGTCATTACCCTCGGTGCCGCTGTCCTGCGCTAGCTACTGGGAGGCACTGCCCAGCTGGGTGCGCAGCAACCTCTCCTTGGGTGATGCGCTGGCCAAGTGGGAGGACTGCCAGCGCCAGCTGCTGCTGGGTCTCTTCTGCACCAACGTGGCCTTCCCACCGGATGCCCTGCACATGCGCCTGCCCGCGGACCCGAAGCCTGCGGACCCCAGGGCTCTTGACCCCAGGCTCCCCCAGCACCCACCAGGCCTGCCCCCATGCTGA

XM_004851665.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X9

Length: 1359 bp    Location: 21689582..21687037   Strand: -
>XM_004851665.1
ATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGGTGGGACCCCACTGCCTCTGCCTGCCCAGAGTCCCGCCCTCTCCGAGCCTCGGACCCCGCCTGCGGATCTTCTCAGCAGGGCGCCAAGGCTCAGGTGCCTCGTGCGCTCCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGTGCGCGGGAGGCCCGGCCGCTCCCCTCCCAGCCCAGCCCCGGGCCCAGTCCTCTGCACTCGTCACACCCCCATCCCCAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGTGCGCTCAGGCCCGGCCCGGAGGGGCTCCCGGATGCGGATGCTCTCGGCCTCCGCCCCACGCTGCTGGGAGCAAGGCCTTCCTGGGTCTGCCCTCTTCTGGGCTGAGGGAGCGGGGCCCACCTTCCCCCATCCTCCCTAA

XM_004851663.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X7

Length: 1473 bp    Location: 21690235..21686956   Strand: -
>XM_004851663.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGTGAGCCCCGGGCTCGGGACCCAGCCACCAGGGCTGGCCCAGCGCTCACCTGCTCTCTGCCTGGTCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGGTGGGACCCCACTGCCTCTGCCTGCCCAGAGTCCCGCCCTCTCCGAGCCTCGGACCCCGCCTGCGGATCTTCTCAGCAGGGCGCCAAGGCTCAGGTGCCTCGTGCGCTCCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGTGCGCTCAGGCCCGGCCCGGAGGGGCTCCCGGATGCGGATGCTCTCGGCCTCCGCCCCACGCTGCTGGGAGCAAGGCCTTCCTGGGTCTGCCCTCTTCTGGGCTGAGGGAGCGGGGCCCACCTTCCCCCATCCTCCCTAAACCCCGTCGGAGCTCAACTGCACACCCTCCCCAGGGAGCTGAACACACGGCTGCGGGACGAGAGGGACGCCTGTGA

XM_004851657.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X1

Length: 1644 bp    Location: 21690235..21687037   Strand: -
>XM_004851657.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGTGAGCCCCGGGCTCGGGACCCAGCCACCAGGGCTGGCCCAGCGCTCACCTGCTCTCTGCCTGGTCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGGTGGGACCCCACTGCCTCTGCCTGCCCAGAGTCCCGCCCTCTCCGAGCCTCGGACCCCGCCTGCGGATCTTCTCAGCAGGGCGCCAAGGCTCAGGTGCCTCGTGCGCTCCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGTGCGCGGGAGGCCCGGCCGCTCCCCTCCCAGCCCAGCCCCGGGCCCAGTCCTCTGCACTCGTCACACCCCCATCCCCAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGTGCGCTCAGGCCCGGCCCGGAGGGGCTCCCGGATGCGGATGCTCTCGGCCTCCGCCCCACGCTGCTGGGAGCAAGGCCTTCCTGGGTCTGCCCTCTTCTGGGCTGAGGGAGCGGGGCCCACCTTCCCCCATCCTCCCTAA

XM_004851651.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X10

Length: 1074 bp    Location: 21675978..21666622   Strand: -
>XM_004851651.1
ATGGCGCGCGGGTGCCTGCAGGGCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTTTTCTGGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851650.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X9

Length: 1074 bp    Location: 21673622..21666622   Strand: -
>XM_004851650.1
ATGGCGCGCGGGTGCCTGCAGGGCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTTTTCTGGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851642.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X1

Length: 1302 bp    Location: 21669720..21666622   Strand: -
>XM_004851642.1
ATGACAGGCAGGGTGGCGTGCTGGCTGCTCAGAGGGGCCGAGACGCCAGGGAAGGCACCCATGGCCAAGCTGCCTTGGGCCGGGGTTGGTCCCCAGTGCTCTGTGGGCTTGTGCCAACCTGGCTGTGCACAGAACATGGGGTGGGCTCCCAGGCGACCAGCAAGCCTGCGACAGCCGCCACGTCCTGCCTCTGGCCAGGCCGTGTCCCGAATGCCGAGGGGCATGGCAGCTGCTCCTCCAGGGTACCTCACCCTGTCCCCATCCCTGTCCCCCACTGGTGCTGCCGTCCAGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851645.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X4

Length: 1224 bp    Location: 21669711..21666622   Strand: -
>XM_004851645.1
ATGACAGGCAGGGTGGCGTGCTGGCTGCTCAGAGGGGCCGAGACGCCAGGGAAGGCACCCATGGCCAAGCTGCCTTGGGCCGGGGTTGGTCCCCAGTGCTCTGTGGGCTTGTGCCAACCTGGCTGTGCACAGAACATGGGGTGGGCTCCCAGGCGACCAGCAAGCCTGCGACAGCCGCCACGTCCTGCCTCTGGCCAGGCCGTGTCCCGAATGCCGAGGGGCATGGCAGCTGCTCCTCCAGGGTACCTCACCCTGTCCCCATCCCTGTCCCCCACTGGTGCTGCCGTCCAGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851635.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X4

Length: 1554 bp    Location: 21639001..21664947   Strand: +
>XM_004851635.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAATCCCTGCAGGTGCGGCTGGAACTGGCCAAGGAGCTGGGCGTCGGGGTCTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTCTAGGCTGTGCCCCCAAGCGGATGTGGACTATTCGCAGCCGTGCAATGGCCATGTGAAATACAGACCTCATTCTTTGTTCTGTGATGTCTGCTGTGGCCCTGGGAATCCACGCTCATGTAGGGAGTGCCAGCCCTGCTGCTGGGCCCTCACTGCCACCTGCCACTGGCCAGGGGACAGCCCGGCCCAGGTCCCTCACCCGGTTCAGAGGTTGGGCTCAATCCCAGACTCCTCCGCACCTGGGCTGCAGGAGCCACCCCATACCCTGACCCCACCCCCAGGGCCCGGACCCTGCCCAGCTCTGCTCAGTGTCCAGTGGAGGACCCCCCGGCCGTGCTTGGGATGGGCATCATAA

XM_004851638.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X7

Length: 1248 bp    Location: 21634518..21664636   Strand: +
>XM_004851638.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAAGAGCCGCGGCGGGAGGCACCTGGTCTTCTACCCAACTCTGAAGTCCCTGCAGGTGCGGCTGGAACTGGCCAAGGAGCTGGGCGTCGGGGTCTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTCTAG

XM_004851633.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X2

Length: 1554 bp    Location: 21634497..21664947   Strand: +
>XM_004851633.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAATCCCTGCAGGTGCGGCTGGAACTGGCCAAGGAGCTGGGCGTCGGGGTCTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTCTAGGCTGTGCCCCCAAGCGGATGTGGACTATTCGCAGCCGTGCAATGGCCATGTGAAATACAGACCTCATTCTTTGTTCTGTGATGTCTGCTGTGGCCCTGGGAATCCACGCTCATGTAGGGAGTGCCAGCCCTGCTGCTGGGCCCTCACTGCCACCTGCCACTGGCCAGGGGACAGCCCGGCCCAGGTCCCTCACCCGGTTCAGAGGTTGGGCTCAATCCCAGACTCCTCCGCACCTGGGCTGCAGGAGCCACCCCATACCCTGACCCCACCCCCAGGGCCCGGACCCTGCCCAGCTCTGCTCAGTGTCCAGTGGAGGACCCCCCGGCCGTGCTTGGGATGGGCATCATAA

XM_004851618.1 Coding sequence

Mob2 MOB kinase activator 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 705 bp    Location: 21230888..21290479   Strand: +
>XM_004851618.1
ATGGACTGGCTCATCGGGAAGTCAAAAGCAAAGCCCAATGGTAAGAAGCCTGCTTCGGAGGAGAAGAAGATGTACCTGGAGCCAGAGCATACTAAATCCAGGATCACCGATTTTGAGTTCAAGGAGCTGGTGGTGCTGCCCCGGGAGATCGACCTCAATGAGTGGCTGGCCAGTAACACAACAACATTTTTCCACCACATCAACCTGCAATATAGCACAATTTCAGAATTTTGCACAGGAGAGACATGTCAGACGATGGCGGTGTGCAACACACAGTACTACTGGTATGACGAGCGGGGAAAGAAGGTCAAGTGCACAGCCCCTCAGTACGTCGACTTCGTCATGAGCTCCGTGCAGAAGCTGGTGACCGACGAAGACATGTTCCCCACAAAATACGGCAGAGAATTCCCCAGCTCCTTCGAGGCCCTGGTGAAGAAGATCTGCAAGTACCTGTTCCACGTGCTGGGCCACATCTACTGGGCCCACTTCAAGGAGACACTGGCCCTGGAGCTGCACGGACACTTGAACACACTGTACATCCACTTCATCCTCTTCACCAGGGAGTTCAGCCTGCTCGACCCCAAAGAGACCGCCATCATGGACGACCTCACCGAGGTGCTGTGCTGCAGCCCTGGTGGGGGCGGGGACGGGGACGGGGCCAGTGGCGGGGCCTCAGGGGCACAGAACCACGTGAAGGAGAGATGA

XM_004851632.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X1

Length: 1554 bp    Location: 21634518..21664947   Strand: +
>XM_004851632.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAATCCCTGCAGGTGCGGCTGGAACTGGCCAAGGAGCTGGGCGTCGGGGTCTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTCTAGGCTGTGCCCCCAAGCGGATGTGGACTATTCGCAGCCGTGCAATGGCCATGTGAAATACAGACCTCATTCTTTGTTCTGTGATGTCTGCTGTGGCCCTGGGAATCCACGCTCATGTAGGGAGTGCCAGCCCTGCTGCTGGGCCCTCACTGCCACCTGCCACTGGCCAGGGGACAGCCCGGCCCAGGTCCCTCACCCGGTTCAGAGGTTGGGCTCAATCCCAGACTCCTCCGCACCTGGGCTGCAGGAGCCACCCCATACCCTGACCCCACCCCCAGGGCCCGGACCCTGCCCAGCTCTGCTCAGTGTCCAGTGGAGGACCCCCCGGCCGTGCTTGGGATGGGCATCATAA

XM_004851634.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X3

Length: 1554 bp    Location: 21638986..21664947   Strand: +
>XM_004851634.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAATCCCTGCAGGTGCGGCTGGAACTGGCCAAGGAGCTGGGCGTCGGGGTCTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTCTAGGCTGTGCCCCCAAGCGGATGTGGACTATTCGCAGCCGTGCAATGGCCATGTGAAATACAGACCTCATTCTTTGTTCTGTGATGTCTGCTGTGGCCCTGGGAATCCACGCTCATGTAGGGAGTGCCAGCCCTGCTGCTGGGCCCTCACTGCCACCTGCCACTGGCCAGGGGACAGCCCGGCCCAGGTCCCTCACCCGGTTCAGAGGTTGGGCTCAATCCCAGACTCCTCCGCACCTGGGCTGCAGGAGCCACCCCATACCCTGACCCCACCCCCAGGGCCCGGACCCTGCCCAGCTCTGCTCAGTGTCCAGTGGAGGACCCCCCGGCCGTGCTTGGGATGGGCATCATAA

XM_004851624.1 Coding sequence

Brsk2 BR serine/threonine kinase 2, transcript variant X5

Length: 2028 bp    Location: 21334038..21296120   Strand: -
>XM_004851624.1
ATGACATCGACGGGGAAGGACGGCGGCGGGGCGCAGCACGCGCAGTATGTGGGGCCCTACCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGCCTCGTGAAGCTGGGCATCCACTGTGTCACGTGCCAGAAAGTCGCCATCAAGATCGTCAACCGAGAGAAGCTCAGCGAGTCTGTGCTGATGAAGGTGGAGCGGGAGATTGCCATCCTGAAGCTCATTGAGCACCCACACGTCCTGAAGCTGCATGACGTCTATGAGAACAAAAAATATTTGTACCTGGTGCTGGAGCACGTGTCCGGCGGGGAGCTGTTCGACTACCTGGTGAAGAAGGGGCGGCTAACGCCCAAGGAGGCCCGGAAGTTCTTCCGGCAAATCATCTCGGCGCTGGATTTCTGCCACAGCCACTCCATATGCCACAGGGACCTGAAGCCTGAGAACCTGCTGCTGGATGAAAAGAACAACATTCGAATCGCAGACTTCGGCATGGCATCCCTACAGGTCGGCGACAGCCTGCTGGAGACCAGCTGCGGATCCCCTCACTACGCATGCCCGGAGGTGATCCGGGGGGAGAAGTATGACGGGCGCAAGGCGGACGTGTGGAGCTGCGGTGTGATCCTGTTCGCCCTGCTGGTGGGGGCACTGCCCTTCGATGATGACAACCTGCGGCAGCTGCTGGAGAAGGTCAAGCGGGGTGTGTTCCACATGCCGCACTTCATCCCGCCCGACTGCCAGAGCCTGCTGCGCGGCATGATTGAAGTGGACGCGGCTCGGCGCCTCACGCTAGAGCACATTCAGAAACACATATGGTATATAGGGGGCAAAAACGAGCCAGAGCCAGAGCAGCCCATCCCGCGCAAGGTGCAGATCCGTTCGCTGCCCAGCCTAGAGGACATTGACCCTGATGTGCTGGACAGCATGCACTCGCTGGGCTGCTTCCGGGACCGCAACAAGCTGCTACAGGACCTGCTGTCCGAGGAGGAGAACCAGGAGAAGATGATATACTTCCTCCTCCTGGACCGGAAAGAGAGGTACCCCAGCCACGAAGATGAGGACCTGCCGCCCAGGAACGAGATAGACCCTCCCCGGAAGCGCGTGGACTCTCCAATGCTGAACCGGCATGGCAAGCGGCGGCCGGAACGCAAGTCCATGGAGGTGCTCAGTGTGACAGATGGTGGCTCCCCGGTGCCCGCAAGGCGAGCCATCGAGATGGCCCAGCACAGTCAGAGTAAAGCAGTGTTCAGTAAAAGCCTGGATATCGCTGAAGCCCATCCCCAATTCAGCACAGAAGACAGGTCTCGGTCCATCAGCGGTGCCTCCTCGGGCCTCTCCACAAGCCCCCTCAGCAGCCCGCGGGTGACCCCTCACCCCTCACCGAGGGGCAGTCCCCTCCCCACCCCCAAGGGGACGCCCGTCCACACGCCAAAGGAGAGTCCAGCCGGCACGCCCAACCCCACGCCGCCATCCAGCCCCAGTGTCGGAGGGGTGCCTTGGCGCACGCGGCTCAGCTCTATCAAGAACAGCTTCCTGGGCTCGCCTCGCTTCCACCGCCGGAAGCTGCAAGTTCCGACACCCGAGGAGATGTCCAACCTGACCCCCGAGTCCTCCCCAGAGCTGGCCAAGAAGTCCTGGTTCGGGAACTTCATTAACCTGGAGAAGGAGGAGCAGATCTTTGTGGTCATCAAGGATAAGCCCCTGAGCTCCATCAAGGCCGACATTGTGCACGCCTTCCTGTCGATCCCCAGCCTCAGTCACAGCGTCATCTCCCAGACCAGCTTCCGGGCCGAGTACAAGGCCACGGGCGGCCCGGCCGTGTTCCAGAAGCCCGTCAAGTTCCAGGTGGACATCACGTACACGGAGGGCGGCGAGGCGCAGAAGGAGAATGGCATCTACTCTGTCACCTTCACCCTGCTCTCAGGCCCCAGCCGCCGCTTCAAGAGGGTGGTGGAGACCATCCAGGCCCAGCTGCTGAGTCCCCACGACCAGCCGCCAGCCCAGCACTTGTCAGGAATTATCCCGAAAAGCTAA

XM_004851627.1 Coding sequence

Tollip toll interacting protein

High confidence: 4 potential gene matches
Length: 825 bp    Location: 21365680..21388366   Strand: +
>XM_004851627.1
ATGGCGACCACTGTCAGCACGCAACGCGGCCCGGTGTACATTGGCGAGCTGCCACAGGATTTCCTCCGCATCACCCCCACACAGCAGCAGCAGCAGGTCCAGCTGGATGCCCAGGCGGCACAGCAGCTGCAGTATGGAGGCTCAGTGGGCACTGTGGGCCGCCTCAGCATCACTGTGGTACAGGCAAAGCTGGCAAAGAACTATGGCATGACACGCATGGACCCCTACTGCCGCTTGCGATTGGGCTATGCTGTGTATGAGACTCCCACAGCTCACAACGGTGCCAAGAACCCTCGCTGGAACAAAGTCATCCAATGCACAGTGCCCCCGGGTGTGGACTCGTTCTACCTGGAGATCTTCGATGAGCGAGCCTTCTCCATGGACGACCGAATCGCCTGGACTCACATCACAATCCCCGAGTCCCTGAAACAGGGCCAGGTGGAAGACGAGTGGTACAGCCTGAGCGGGAGGCAGGGTGACGACAAGGAGGGCATGATCAACCTGGTCATGTCCTACACGTCTCTGCCTGCCGCCATGATGATGCCGCCCCAGCCCGTGGTCCTGATGCCAACTGTGTACCAGCAGGGCATTGGCTACGTGCCCATTGCAGGGATGCCTGCCGTCTGCAGCCCTGGCATGGTGCCTGTGGCAATGCCCCCACCAGCTGTGACCACACAGCCCCGCTGTACGGAGGAGGACCTGAAGGCCATCCAGGACATGTTCCCCAACATGGACAAGGAGGTGATCCGCTCCGTGCTGGAAGCCCAGAGAGGGAACAGGGATGCCGCCATCAACTCCCTGCTGCAAATGGGCGAAGAGTCCTAG

XM_004851619.1 Coding sequence

Mob2 MOB kinase activator 2, transcript variant X4

Length: 636 bp    Location: 21240337..21290479   Strand: +
>XM_004851619.1
ATGTACCTGGAGCCAGAGCATACTAAATCCAGGATCACCGATTTTGAGTTCAAGGAGCTGGTGGTGCTGCCCCGGGAGATCGACCTCAATGAGTGGCTGGCCAGTAACACAACAACATTTTTCCACCACATCAACCTGCAATATAGCACAATTTCAGAATTTTGCACAGGAGAGACATGTCAGACGATGGCGGTGTGCAACACACAGTACTACTGGTATGACGAGCGGGGAAAGAAGGTCAAGTGCACAGCCCCTCAGTACGTCGACTTCGTCATGAGCTCCGTGCAGAAGCTGGTGACCGACGAAGACATGTTCCCCACAAAATACGGCAGAGAATTCCCCAGCTCCTTCGAGGCCCTGGTGAAGAAGATCTGCAAGTACCTGTTCCACGTGCTGGGCCACATCTACTGGGCCCACTTCAAGGAGACACTGGCCCTGGAGCTGCACGGACACTTGAACACACTGTACATCCACTTCATCCTCTTCACCAGGGAGTTCAGCCTGCTCGACCCCAAAGAGACCGCCATCATGGACGACCTCACCGAGGTGCTGTGCTGCAGCCCTGGTGGGGGCGGGGACGGGGACGGGGCCAGTGGCGGGGCCTCAGGGGCACAGAACCACGTGAAGGAGAGATGA

XM_004851616.1 Coding sequence

Mob2 MOB kinase activator 2, transcript variant X1

Length: 822 bp    Location: 21239363..21290479   Strand: +
>XM_004851616.1
ATGATGATGGTTTGCAGCCTTCCTTTTGGCTGGCAGCATCTTCTCAAGGGAGCAGCAAGAGAGTTTACCATCTGCTGTCCACACATCCTTGCACTGGACTGCTGTTTCCCTGGACTCTTCTTCGAACTTCTCAGGAAGTCAAAAGCAAAGCCCAATGGTAAGAAGCCTGCTTCGGAGGAGAAGAAGATGTACCTGGAGCCAGAGCATACTAAATCCAGGATCACCGATTTTGAGTTCAAGGAGCTGGTGGTGCTGCCCCGGGAGATCGACCTCAATGAGTGGCTGGCCAGTAACACAACAACATTTTTCCACCACATCAACCTGCAATATAGCACAATTTCAGAATTTTGCACAGGAGAGACATGTCAGACGATGGCGGTGTGCAACACACAGTACTACTGGTATGACGAGCGGGGAAAGAAGGTCAAGTGCACAGCCCCTCAGTACGTCGACTTCGTCATGAGCTCCGTGCAGAAGCTGGTGACCGACGAAGACATGTTCCCCACAAAATACGGCAGAGAATTCCCCAGCTCCTTCGAGGCCCTGGTGAAGAAGATCTGCAAGTACCTGTTCCACGTGCTGGGCCACATCTACTGGGCCCACTTCAAGGAGACACTGGCCCTGGAGCTGCACGGACACTTGAACACACTGTACATCCACTTCATCCTCTTCACCAGGGAGTTCAGCCTGCTCGACCCCAAAGAGACCGCCATCATGGACGACCTCACCGAGGTGCTGTGCTGCAGCCCTGGTGGGGGCGGGGACGGGGACGGGGCCAGTGGCGGGGCCTCAGGGGCACAGAACCACGTGAAGGAGAGATGA

XM_004851617.1 Coding sequence

Mob2 MOB kinase activator 2, transcript variant X2

Length: 798 bp    Location: 21274436..21290479   Strand: +
>XM_004851617.1
ATGCTCGGGGATCACTGTGGTCTCCCTGCAGACAGAGCTCTGCTCAGCCAGCCTCCCAAAACTGGATTCTGCTGCAAAATGGTGCTTCAGGCAGTCAGCAAAGTACTCAGGAAGTCAAAAGCAAAGCCCAATGGTAAGAAGCCTGCTTCGGAGGAGAAGAAGATGTACCTGGAGCCAGAGCATACTAAATCCAGGATCACCGATTTTGAGTTCAAGGAGCTGGTGGTGCTGCCCCGGGAGATCGACCTCAATGAGTGGCTGGCCAGTAACACAACAACATTTTTCCACCACATCAACCTGCAATATAGCACAATTTCAGAATTTTGCACAGGAGAGACATGTCAGACGATGGCGGTGTGCAACACACAGTACTACTGGTATGACGAGCGGGGAAAGAAGGTCAAGTGCACAGCCCCTCAGTACGTCGACTTCGTCATGAGCTCCGTGCAGAAGCTGGTGACCGACGAAGACATGTTCCCCACAAAATACGGCAGAGAATTCCCCAGCTCCTTCGAGGCCCTGGTGAAGAAGATCTGCAAGTACCTGTTCCACGTGCTGGGCCACATCTACTGGGCCCACTTCAAGGAGACACTGGCCCTGGAGCTGCACGGACACTTGAACACACTGTACATCCACTTCATCCTCTTCACCAGGGAGTTCAGCCTGCTCGACCCCAAAGAGACCGCCATCATGGACGACCTCACCGAGGTGCTGTGCTGCAGCCCTGGTGGGGGCGGGGACGGGGACGGGGCCAGTGGCGGGGCCTCAGGGGCACAGAACCACGTGAAGGAGAGATGA

XM_004851620.1 Coding sequence

Brsk2 BR serine/threonine kinase 2, transcript variant X1

Length: 2199 bp    Location: 21334038..21296120   Strand: -
>XM_004851620.1
ATGACATCGACGGGGAAGGACGGCGGCGGGGCGCAGCACGCGCAGTATGTGGGGCCCTACCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGCCTCGTGAAGCTGGGCATCCACTGTGTCACGTGCCAGAAAGTCGCCATCAAGATCGTCAACCGAGAGAAGCTCAGCGAGTCTGTGCTGATGAAGGTGGAGCGGGAGATTGCCATCCTGAAGCTCATTGAGCACCCACACGTCCTGAAGCTGCATGACGTCTATGAGAACAAAAAATATTTGTACCTGGTGCTGGAGCACGTGTCCGGCGGGGAGCTGTTCGACTACCTGGTGAAGAAGGGGCGGCTAACGCCCAAGGAGGCCCGGAAGTTCTTCCGGCAAATCATCTCGGCGCTGGATTTCTGCCACAGCCACTCCATATGCCACAGGGACCTGAAGCCTGAGAACCTGCTGCTGGATGAAAAGAACAACATTCGAATCGCAGACTTCGGCATGGCATCCCTACAGGTCGGCGACAGCCTGCTGGAGACCAGCTGCGGATCCCCTCACTACGCATGCCCGGAGGTGATCCGGGGGGAGAAGTATGACGGGCGCAAGGCGGACGTGTGGAGCTGCGGTGTGATCCTGTTCGCCCTGCTGGTGGGGGCACTGCCCTTCGATGATGACAACCTGCGGCAGCTGCTGGAGAAGGTCAAGCGGGGTGTGTTCCACATGCCGCACTTCATCCCGCCCGACTGCCAGAGCCTGCTGCGCGGCATGATTGAAGTGGACGCGGCTCGGCGCCTCACGCTAGAGCACATTCAGAAACACATATGGTATATAGGGGGCAAAAACGAGCCAGAGCCAGAGCAGCCCATCCCGCGCAAGGTGCAGATCCGTTCGCTGCCCAGCCTAGAGGACATTGACCCTGATGTGCTGGACAGCATGCACTCGCTGGGCTGCTTCCGGGACCGCAACAAGCTGCTACAGGACCTGCTGTCCGAGGAGGAGAACCAGGAGAAGATGATATACTTCCTCCTCCTGGACCGGAAAGAGAGGTACCCCAGCCACGAAGATGAGGACCTGCCGCCCAGGAACGAGATAGACCCTCCCCGGAAGCGCGTGGACTCTCCAATGCTGAACCGGCATGGCAAGCGGCGGCCGGAACGCAAGTCCATGGAGGTGCTCAGTGTGACAGATGGTGGCTCCCCGGTGCCCGCAAGGCGAGCCATCGAGATGGCCCAGCACAGTCAGAGGTCTCGGTCCATCAGCGGTGCCTCCTCGGGCCTCTCCACAAGCCCCCTCAGCAGCCCGCGGGTGACCCCTCACCCCTCACCGAGGGGCAGTCCCCTCCCCACCCCCAAGGGGACGCCCGTCCACACGCCAAAGGAGAGTCCAGCCGGCACGCCCAACCCCACGCCGCCATCCAGCCCCAGTGTCGGAGGGGTGCCTTGGCGCACGCGGCTCAGCTCTATCAAGAACAGCTTCCTGGGCTCGCCTCGCTTCCACCGCCGGAAGCTGCAAGTTCCGACACCCGAGGAGATGTCCAACCTGACCCCCGAGTCCTCCCCAGAGCTGGCCAAGAAGTCCTGGTTCGGGAACTTCATTAACCTGGAGAAGGAGGAGCAGATCTTTGTGGTCATCAAGGATAAGCCCCTGAGCTCCATCAAGGCCGACATTGTGCACGCCTTCCTGTCGATCCCCAGCCTCAGTCACAGCGTCATCTCCCAGACCAGCTTCCGGGCCGAGTACAAGGCCACGGGCGGCCCGGCCGTGTTCCAGAAGCCCGTCAAGTTCCAGGTGGACATCACGTACACGGAGGGCGGCGAGGCGCAGAAGGAGAATGGCATCTACTCTGTCACCTTCACCCTGCTCTCAGGCCCCAGCCGCCGCTTCAAGAGGGTGGTGGAGACCATCCAGGCCCAGCTGCTGAGTCCCCACGACCAGCCGCCAGCCCAGCACTTGTCAGACACCACTAACTGTATGGGAATGATGACGGGGCGGCTTTCCAAATGTGGCAGCCCATTGAGTAACTTCTTTGACGTAATTAAACAACTTTTTTCAGACGAGAAGAACGGGCAGGCGGGCCCGGCCCCCAGCGCACCCGCCAGGCGGAGTGCCCACGGCCCCCTCGGTGACCCTGCGGCCACTGGCCCTCGAGGGGACGCCGAGTTCCCGACGGGCAAGGACACGGCCGCGGCCGCCGCGAGCAGCCTTACACACTAG

XM_004851622.1 Coding sequence

Brsk2 BR serine/threonine kinase 2, transcript variant X3

Length: 2094 bp    Location: 21334038..21296120   Strand: -
>XM_004851622.1
ATGACATCGACGGGGAAGGACGGCGGCGGGGCGCAGCACGCGCAGTATGTGGGGCCCTACCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGCCTCGTGAAGCTGGGCATCCACTGTGTCACGTGCCAGAAAGTCGCCATCAAGATCGTCAACCGAGAGAAGCTCAGCGAGTCTGTGCTGATGAAGGTGGAGCGGGAGATTGCCATCCTGAAGCTCATTGAGCACCCACACGTCCTGAAGCTGCATGACGTCTATGAGAACAAAAAATATTTGTACCTGGTGCTGGAGCACGTGTCCGGCGGGGAGCTGTTCGACTACCTGGTGAAGAAGGGGCGGCTAACGCCCAAGGAGGCCCGGAAGTTCTTCCGGCAAATCATCTCGGCGCTGGATTTCTGCCACAGCCACTCCATATGCCACAGGGACCTGAAGCCTGAGAACCTGCTGCTGGATGAAAAGAACAACATTCGAATCGCAGACTTCGGCATGGCATCCCTACAGGTCGGCGACAGCCTGCTGGAGACCAGCTGCGGATCCCCTCACTACGCATGCCCGGAGGTGATCCGGGGGGAGAAGTATGACGGGCGCAAGGCGGACGTGTGGAGCTGCGGTGTGATCCTGTTCGCCCTGCTGGTGGGGGCACTGCCCTTCGATGATGACAACCTGCGGCAGCTGCTGGAGAAGGTCAAGCGGGGTGTGTTCCACATGCCGCACTTCATCCCGCCCGACTGCCAGAGCCTGCTGCGCGGCATGATTGAAGTGGACGCGGCTCGGCGCCTCACGCTAGAGCACATTCAGAAACACATATGGTATATAGGGGGCAAAAACGAGCCAGAGCCAGAGCAGCCCATCCCGCGCAAGGTGCAGATCCGTTCGCTGCCCAGCCTAGAGGACATTGACCCTGATGTGCTGGACAGCATGCACTCGCTGGGCTGCTTCCGGGACCGCAACAAGCTGCTACAGGACCTGCTGTCCGAGGAGGAGAACCAGGAGAAGATGATATACTTCCTCCTCCTGGACCGGAAAGAGAGGTACCCCAGCCACGAAGATGAGGACCTGCCGCCCAGGAACGAGATAGACCCTCCCCGGAAGCGCGTGGACTCTCCAATGCTGAACCGGCATGGCAAGCGGCGGCCGGAACGCAAGTCCATGGAGGTGCTCAGTGTGACAGATGGTGGCTCCCCGGTGCCCGCAAGGCGAGCCATCGAGATGGCCCAGCACAGTCAGAGTAAAGCAGTGTTCAGTAAAAGCCTGGATATCGCTGAAGCCCATCCCCAATTCAGCACAGAAGACAGGTCTCGGTCCATCAGCGGTGCCTCCTCGGGCCTCTCCACAAGCCCCCTCAGCAGCCCGCGGGTGACCCCTCACCCCTCACCGAGGGGCAGTCCCCTCCCCACCCCCAAGGGGACGCCCGTCCACACGCCAAAGGAGAGTCCAGCCGGCACGCCCAACCCCACGCCGCCATCCAGCCCCAGTGTCGGAGGGGTGCCTTGGCGCACGCGGCTCAGCTCTATCAAGAACAGCTTCCTGGGCTCGCCTCGCTTCCACCGCCGGAAGCTGCAAGTTCCGACACCCGAGGAGATGTCCAACCTGACCCCCGAGTCCTCCCCAGAGCTGGCCAAGAAGTCCTGGTTCGGGAACTTCATTAACCTGGAGAAGGAGGAGCAGATCTTTGTGGTCATCAAGGATAAGCCCCTGAGCTCCATCAAGGCCGACATTGTGCACGCCTTCCTGTCGATCCCCAGCCTCAGTCACAGCGTCATCTCCCAGACCAGCTTCCGGGCCGAGTACAAGGCCACGGGCGGCCCGGCCGTGTTCCAGAAGCCCGTCAAGTTCCAGGTGGACATCACGTACACGGAGGGCGGCGAGGCGCAGAAGGAGAATGGCATCTACTCTGTCACCTTCACCCTGCTCTCAGGCCCCAGCCGCCGCTTCAAGAGGGTGGTGGAGACCATCCAGGCCCAGCTGCTGAGTCCCCACGACCAGCCGCCAGCCCAGCACTTGTCAGAACCGCCCCCGCCAGCGCCAGGACTGAGCTGGGGCGCTGGGCTTAAGGGCCAGAAGGTGGCCACCAGCTACGAGAGTAGCCTGTGA

XM_004851614.1 Coding sequence

Eif3m eukaryotic translation initiation factor 3, subunit M

High confidence: 4 potential gene matches
Length: 1125 bp    Location: 21041272..21057451   Strand: +
>XM_004851614.1
ATGAGTGTCCCGGCCTTCATCGACATCAGCGAGGAGGACCAGGCTGCAGAGCTGCGTGCATACCTGAAGTCCAAAGGAGCTGAGATCTCAGAAGAGAACTCAGATGGTGGGCTCCATGTGGACTTAGCTCAGATTATTGAAGCCTGCGATGTGTGCCTGAAGGAAGACGATAAAGATGTGGAAAGTGTGATGAACAGTGTGGTCTCCCTGCTGTTGATCCTCGAACCAGACAAGCAGGAGGCGCTGATTGAAAGCCTGTGTGAGAAGCTGGTCAAGTTCCGGGAAGGCGAGCGCCCGTCTCTGAGACTGCAGCTGCTCAGCAACCTTTTCCACGGGATGGATAAGAACACCCCAGTGAGGTACGTGGTGTACTGCAGCCTCGTTAGAGTGGCGGCGTCCTGCGGGGCCATCCAGTACGTCCCCACAGAGCTGGACCAGGTGAGAAAGTGGATTTCTGACTGGAATCTCACCACTGAGAAGAAACATACGCTTTTAAGACTACTTTATGAGGCCCTCGTGGATTGTAAGAAAAGTGATGCTGCTTCAAAAGTTATGGTGGAATTGCTTGGAAGTTACACGGAGGACAATGCTTCCCAGGCGCGAGTCGATGCCCACAGGTGCATTGTACGAGCATTGAAAGATCCAAATGCGTTTCTTTTTGACCATCTTCTTACTTTAAAGCCAGTCAAGTTTCTGGAAGGCGAGCTTATTCATGATCTTTTAACCATTTTTGTGAGTGCTAAATTGGCATCATATGTCAAGTTTTATCAGAATAACAAAGACTTCATTGATTCCCTTGGCCTGTTACACGAGCAGAATATGGCGAAAATGAGACTGCTCACTTTTATGGGGATGGCAGTGGAGAACAAAGAGATTTCCTTTGATACAATGCAGCAGGAACTTCAGATTGGAGCTGATGATGTAGAAGCTTTTGTTATTGATGCGGTAAGAACTAAAATGGTCTACTGCAAAATTGATCAGACCCAGAGAAAAGTAGTTGTCAGTCATAGCACACACCGGACATTTGGAAAACAGCAGTGGCAGCAACTGTATGACACGCTTAATGCCTGGAAACAAAACCTGAACAAAGTGAAAAACAGCCTTTTGAGTCTTTCTGATACCTGA

XM_004851607.1 Coding sequence

Pax6 paired box 6, transcript variant X6

Length: 1293 bp    Location: 20554651..20539773   Strand: -
>XM_004851607.1
ATGCAGAACAGTCACAGTGGTGTGAATCAGCTCGGAGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATCGTAGAGCTAGCGCACAGCGGGGCCCGGCCTTGCGACATCTCCCGAATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACCGGCTCCATCCGACCCAGGGCCATCGGGGGCAGTAAACCCAGAGTGGCAACTCCGGAAGTTGTGAGCAAAATTGCCCAGTACAAGCGGGAGTGCCCGTCCATCTTTGCCTGGGAAATCCGAGACAGATTGCTGTCTGAGGGGGTCTGCACCAACGACAACATACCAAGTGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGCTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGGTGGTATCCGGGCACTTCCGTGCCAGGCCAGCCCACACAAGATGGGTGCCAGCAGCAGGAAGGAGCGGGGGAGAACACCAACTCCATCAGCTCCAACGGGGAGGACTCGGACGAGGCGCAGATGCGGCTGCAGCTGAAGCGGAAGCTGCAGCGGAACAGGACCTCCTTCACTCAGGAGCAGATCGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCACTATCCAGATGTGTTCGCCCGGGAAAGACTAGCAGCCAAGATAGACCTACCTGAAGCGAGAATACAGGTCTGGTTTTCCAACAGAAGGGCCAAGTGGAGACGAGAGGAGAAGCTGAGGAACCAGCGGAGACAGGCCAGCAACACCCCCAGCCACATCCCCATCAGCAGCAGCTTCAGCACGAGCGTGTACCAGCCCATCCCGCAGCCCACCACCCCGGGTAACGGCGCGCACACCTGCACGCGCTCCCGACCCCTGGCCCGGCCTGGCCTGGCCTGGCCGCGCTGCTCACCCGGGCTGGGCCTCTCTCTCTGCAGTGTCCTCCTTCACGTCTGGCTCCATGCTGGGCCGGACAGACACGGCCCTCACCAACACATACAGCGCGCTGCCACCCATGCCCAGCTTCACCATGGCCAACAGCCTGCCTATGCAGGTAAGCGGGCGCTGCCTGCCAGGCCGCAGAAAGAGGCAGCAGGGGCTGCACCCTCGGGTCTGTGTCTCCATGGTGACCGGCTCGGCCTGTCCAGCCCTATAGAGAGGAGCAGGACATGGTCACTGGGAATGCAGCGAGTTCACTGCTGCTCAGTTGGCAGCTGA

XM_004851603.1 Coding sequence

Pax6 paired box 6, transcript variant X2

Length: 1335 bp    Location: 20554653..20539772   Strand: -
>XM_004851603.1
ATGCAGAACAGTCACAGTGGTGTGAATCAGCTCGGAGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATCGTAGAGCTAGCGCACAGCGGGGCCCGGCCTTGCGACATCTCCCGAATTCTGCAGACCCATGCAGATGCAAAAGTCCAAGTGCTGGACAATCAAAACGTGTCCAACGGCTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACCGGCTCCATCCGACCCAGGGCCATCGGGGGCAGTAAACCCAGAGTGGCAACTCCGGAAGTTGTGAGCAAAATTGCCCAGTACAAGCGGGAGTGCCCGTCCATCTTTGCCTGGGAAATCCGAGACAGATTGCTGTCTGAGGGGGTCTGCACCAACGACAACATACCAAGTGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGCTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGGTGGTATCCGGGCACTTCCGTGCCAGGCCAGCCCACACAAGATGGGTGCCAGCAGCAGGAAGGAGCGGGGGAGAACACCAACTCCATCAGCTCCAACGGGGAGGACTCGGACGAGGCGCAGATGCGGCTGCAGCTGAAGCGGAAGCTGCAGCGGAACAGGACCTCCTTCACTCAGGAGCAGATCGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCACTATCCAGATGTGTTCGCCCGGGAAAGACTAGCAGCCAAGATAGACCTACCTGAAGCGAGAATACAGGTCTGGTTTTCCAACAGAAGGGCCAAGTGGAGACGAGAGGAGAAGCTGAGGAACCAGCGGAGACAGGCCAGCAACACCCCCAGCCACATCCCCATCAGCAGCAGCTTCAGCACGAGCGTGTACCAGCCCATCCCGCAGCCCACCACCCCGGGTAACGGCGCGCACACCTGCACGCGCTCCCGACCCCTGGCCCGGCCTGGCCTGGCCTGGCCGCGCTGCTCACCCGGGCTGGGCCTCTCTCTCTGCAGTGTCCTCCTTCACGTCTGGCTCCATGCTGGGCCGGACAGACACGGCCCTCACCAACACATACAGCGCGCTGCCACCCATGCCCAGCTTCACCATGGCCAACAGCCTGCCTATGCAGGTAAGCGGGCGCTGCCTGCCAGGCCGCAGAAAGAGGCAGCAGGGGCTGCACCCTCGGGTCTGTGTCTCCATGGTGACCGGCTCGGCCTGTCCAGCCCTATAGAGAGGAGCAGGACATGGTCACTGGGAATGCAGCGAGTTCACTGCTGCTCAGTTGGCAGCTGA

XM_004851600.1 Coding sequence

Elp4 elongator acetyltransferase complex subunit 4, transcript variant X3

Length: 1194 bp    Location: 20343802..20494190   Strand: +
>XM_004851600.1
ATGGCGGCAGCGGCTAAGGCAACCTGCGGTGCTGGCGCCGGGAGTCCTGGGTCTGTGGCGGCGGCGGCCGACAGAAGCAGTGCCACCAGCTTCCAGAGGAGGGGTCCCAGGGCCGGCGGTGCCGATGGCAGAGGCCCTCGCCTGGTGTCCATTGCGGGCACGCGGCCGTCGGTGCGGAATGGACAGCTGCTGGTTTCCACCGGGCTCCCGGCCCTGGACCAGCTCTTAGGTGGAGGTTTAGCCGTTGGAACAGTTCTTTTGATTGAGGAGGATAAATACGATATTTACTCACCGCTGCTCTTCAAGCATTTCCTGGCCGAGGGCATTGTCAGTGGGCACACTTTGTTGGTTGCATCCGCTAAAGAGCGCCCTGCTGGCATTTTACAGGAACTTCCTGCACCATTACTTGATGATAGTTATAAAAGAGAACTTGAGGAAGATGAATGTAATCATAAAACACCAGAATCTAATGTGAAGATGAAAATAGCTTGGCGGTACCAGTTATTACCCAAGATAGAGCAGGTTGGGCCAGTGGCGTCTTCAAGATTTGGTCATTATTATGACACATCCAAAAAGATCCCCCAAGAACTGCTTGAGACTGCAAAATGGCATGAGTTCTTCCTTCCAGAAAAGTCATCTTCACCCCTCAGCACAGAACCCTGCCACTTGACCCATGGCTACATGAAGCTCCTTGAGTTTATCAAGAACATCATTTCTGAGGAAGGCTTTGATGGATCCAATCCCCAGAAAACGCAGAAGAGTATTTTAAGAATAGGAATCCAGAACCTCGGCTCACCCTTATGGGGAGATGACGTGTGCTGCACAGAAACCTGCGGCGACAGGCACAGCCTCACCACGTTCCTCTATGTTCTCCGCGGCCTCATGCGGGCCTCACTCTCGGTCTGCACCATCACGATGCCAACACACCTGATCCAGAATAAATCAGTAACTGCTCGTGTTATACATTTGTCAGATACAGTAGTGGGCCTGGAATCGTTTATTGGTTTGGAGAGAGAAGCCAATCCTCTCTATAAGGATTATCACGGTTTGATTCATATTCGGCAGATTCCTCGGCTTAATAACTTGATTTGCGATGAATCAGATGTCAAAGACTTAGCTTTTAAGTTAAAAAGGAAGCTATTTGCCATTGAGGAGGGTAAGGACCTGGAGAACCAGGTCTCCTGTTCTCTCTAG

XM_004851591.1 Coding sequence

Arl14ep ADP-ribosylation factor-like 14 effector protein, transcript variant X4

Length: 780 bp    Location: 19394800..19405418   Strand: +
>XM_004851591.1
ATGGATCCGTGCTCGGTTGGAGTGCAGCTTCGCACCACAAACGAGTGCCACAAAACCTACTACACTAGGCACACAGGCTTCAAGACTTTGCAGGAGTTGTCGTCCAATGATATGCTTTTACTTCAGCTCCGCACCGGCATGACGCTGTCTGGGAACAATACCATTTGCTTCCATCATGTAAAAATTTACATCGACCGGTTTGAGGATTTGCAGAAGTCATGTTGCGACCCATTTAACATACATAAAAAGCTGGCCAAAAAGAACCTGCATGTCATTGACTTGGACGATGCCACTTTTCTGAGTGCAAAATTCGGAAGGCAGCTGGTGCCTGGTTGGAAGCTCTGTCCGAAGTGCACACAGATCATCAATGGAAGTGTGGATGTGGATTCTGAGGACCGCCAGAGAAGAAAGCCTGAGTCTGATGGAAGAACTGCTAAAGCTCTGCGGTCTCTCCAGTTTACAAACCCAGGAAAGCAGACCGAATTTGCTCCGGAAACTGGAAAAAGGGAGAAGAGAAGGCTCACGAAAAACACACCCGGTGGTTCAGACAGACAAGTCATACCAGCCAAGAGCAAGGTCTACGACAGCCAGGGCCTGCTCATCTTCAGCGGGATGGACCTGTGTGACTGCCTGGACGAGGACTGCTTGGGCTGTTTCTACGCCTGCCCTGCCTGCGGGTCCGCCAAATGTGGAGCCGAGTGCCGCTGCGACCGAAAGTGGCTGTACGAGCAAATCGAGATCGAAGGGGGAGAGATCATTCACAACAAACACGCTGGGTAG

XM_004851594.1 Coding sequence

Mpped2 metallophosphoesterase domain containing 2

High confidence: 4 potential gene matches
Length: 885 bp    Location: 19615946..19470458   Strand: -
>XM_004851594.1
ATGGCACATGGGATCGCTTCCCAAGGCAAAGTGACCATCACCGTGGACGAGTACAGCTCCAACCCCACCCAGGCCTTCACCCATTACAATATTAACCAGAGCCGCTTCCAGCCGCCCCATGTACATATGGTCGACCCCATCCCATATGACACTCCAAAACCAGCTGGCCACACGCGATTTGTCTGCATCTCAGACACACACTCCAGAACAGATGCTCTCCAGATGCCTTACGGGGACATCCTCCTCCACACGGGCGATTTCACCGAGCTGGGACTGCCCTCAGAGGTTAAGAAGTTTAATGACTGGTTAGGAAACCTGCCATATGAATATAAAATAGTGATTGCTGGGAATCATGAACTGACATTCGATAAGGAATTCATGGCAGACCTTGTTAAACAGGACTACTACCGTTTCCCCTCTGTGTCCAAATTGAAACCAGAGGACTTTGACAATGTTCAGTCCCTCCTGACGAACAGTATTTACTTGCAAGATTCGGAGGTCACAGTGAAGGGGTTCAGGATATACGGTGCACCTTGGACCCCGTGGTTTAACGGATGGGGCTTTAACCTCCCGCGCGGCCAGTCCCTGCTGGACAAGTGGAACCTGGTTCCCGAGGGCATCGACATCCTCATGACCCATGGACCTCCGCTGGGTTTTCGAGACTGGGTGCCCAAGGAGCTGCAGAGGGTGGGCTGCGTGGAGCTCCTCAACACTGTGCAGAGGCGGGTCCGGCCCAAGCTCCACGTGTTCGGTGGGATTCATGAAGGTTATGGCATCATGACCGACGGCTACACGACCTACATCAACGCCTCCACGTGTACGGTCAGCTTCCAGCCGACCAACCCTCCGATCATCTTCGACCTTCCCAACCCACAGGGCTCCTGA

XM_004851595.1 Coding sequence

Immp1l IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae), transcript variant X1

Length: 663 bp    Location: 20343664..20285362   Strand: -
>XM_004851595.1
ATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAACGTATGAAGCCTGCGGTGACAGTGAGCACTGCGAGTGTGGACCCAGTCTGCCCTCGGCGATGACCCGCAAGACTTCAGGCAGTGGGACGCTGTGTCTGGGCCCCTGGGGGCCCGGCTGCGGTGCTGCGCACACCTCGTGTGGCCAGTGTGGAGCCGACGCGGGCTGCGCTGTGGTGCACCGAGCTAGGCACAGGGAGCTACGTCGGCCAAGCACAGCTGCTTTTCCCAGCCCGGGCAGACACGGATCTTCCCGCCTGGAGGACAGTCCTGGGCAGAGGCTGGAGAGGGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGA

XM_004851592.1 Coding sequence

Arl14ep ADP-ribosylation factor-like 14 effector protein, transcript variant X5

Length: 780 bp    Location: 19394464..19405418   Strand: +
>XM_004851592.1
ATGGATCCGTGCTCGGTTGGAGTGCAGCTTCGCACCACAAACGAGTGCCACAAAACCTACTACACTAGGCACACAGGCTTCAAGACTTTGCAGGAGTTGTCGTCCAATGATATGCTTTTACTTCAGCTCCGCACCGGCATGACGCTGTCTGGGAACAATACCATTTGCTTCCATCATGTAAAAATTTACATCGACCGGTTTGAGGATTTGCAGAAGTCATGTTGCGACCCATTTAACATACATAAAAAGCTGGCCAAAAAGAACCTGCATGTCATTGACTTGGACGATGCCACTTTTCTGAGTGCAAAATTCGGAAGGCAGCTGGTGCCTGGTTGGAAGCTCTGTCCGAAGTGCACACAGATCATCAATGGAAGTGTGGATGTGGATTCTGAGGACCGCCAGAGAAGAAAGCCTGAGTCTGATGGAAGAACTGCTAAAGCTCTGCGGTCTCTCCAGTTTACAAACCCAGGAAAGCAGACCGAATTTGCTCCGGAAACTGGAAAAAGGGAGAAGAGAAGGCTCACGAAAAACACACCCGGTGGTTCAGACAGACAAGTCATACCAGCCAAGAGCAAGGTCTACGACAGCCAGGGCCTGCTCATCTTCAGCGGGATGGACCTGTGTGACTGCCTGGACGAGGACTGCTTGGGCTGTTTCTACGCCTGCCCTGCCTGCGGGTCCGCCAAATGTGGAGCCGAGTGCCGCTGCGACCGAAAGTGGCTGTACGAGCAAATCGAGATCGAAGGGGGAGAGATCATTCACAACAAACACGCTGGGTAG

XM_004851582.1 Coding sequence

Bdnf brain-derived neurotrophic factor, transcript variant X2

Length: 762 bp    Location: 17329416..17281908   Strand: -
>XM_004851582.1
ATGACCATCCTTTTCCTTACTATGGTTATTTCGTACTTCGGTTGCATGAAGGCCGCCCCCATGAAAGAAGCCAGTGTCCGAGGCCCAGGCAGCTTGGCCTACCCCGGAGTGCGGACCCACGGGGCCCTGGACAGCGTGACCGGGCCCAAGGTGGGTGCGCGGGGCCTGGCGGCGTCTTCATCGTCTTCGTCGCTGGCTGACACTTTTGAGCACGTGATCGAGGAGCTGCTGGAGGAGGACCAGAAAGTCAGGCCCCATGAAGAGAATGCGAAGGACGCGGACTTGTACACGTCCCGGGTGATGCTGAGCAGCCAGGTGCCTTTGGAGCCGCCCCTCCTCTTTCTGCTCGAGGAATACAAAAATTACCTGGACGCTGCCAACATGTCCATGCGGGTCCGGCGCCACTCCGACCCGGCCCGCCGTGGGGAGCTGAGCGTGTGCGACAGCATCAGTGAGTGGGTCACCGCCGCGGATAAAAAGACTGCAGTGGACATGTCTGGCGGGACGGTCACCGTCCTGGAGAAGGTCCCCGTGTCCAAAGGCCAACTGAAGCAGTACTTCTACGAGACCAAGTGCAACCCCATGGGCTACACCAAGGAGGGCTGCAGAGGCATAGACAAGAGGCACTGGAACTCGCAGTGCCGAACTACCCAGTCCTACGTGCGGGCCCTCACCATGGATAGCAAAAAGAGAATTGGCTGGCGGTTCATAAGGATAGACACTTCCTGTGTATGTACACTGACCATTAAGAGAGGAAGATAG

XM_004851583.1 Coding sequence

Kif18a kinesin family member 18A, transcript variant X1

Length: 2688 bp    Location: 17621561..17565263   Strand: -
>XM_004851583.1
ATGTCTGTCCCTAAGGAAGATCTGTGGCACCACATGAGAGTAGCCGTCCGCGTGCGCCCTGAAAGCACAAAGGAGAAAGCGACAGGGCTCCATAAGGTGGTCCAAGTTGTGGATGAGCACATACTAGTTTTTGACCCCAAACAAGAAGAAGTCAGTTTTTTCCCTAAAAAGAAAAGTACAAATTTTGATGTTTCAAAGAGACAAAATAAAGATCTTAAATTTGTATTTGATACTGTTTTTGATGAAACTTCAACTCAATTGGAAGTTTTTGAACATACCACCAAGCCAGTTCTTCGTAGTTTTTTGAATGGTTATAATTGCACAGTGCTTGCATATGGTGCCACGGGAGCTGGGAAAACCCACACAATGCTAGGATCAGCTGCAGAACCTGGAGTAATGTACCTAACAATGTTAGACCTCTACAAGTCCATGGATGAGATTAAAGAAGAGAAAATATGTAGCACTGCAGTTTCTTACCTGGAGGTATATAATGAGCAGATTCGTGACCTCTTAGTAGATTCTGGGCCGCTTGCTGTCCGCGAGGATGCTCAGAAAGGAGTGGTTGTTCAGGGTCTGTCTTTGCACCAGCCCAGATCCTCAGAAGAAATCTTACAGTTACTGGATAATGGGAACAAAAACAGGACACAGCACCCCACTGACGCAAACGCAGCCTCCTCTCGTTCTCATGCTGTTTTCCAGATCTATTTGCGACAGCAAGACAAAACAGCGAGCATCAACCAGAATGTACGCATTGCCAAGATGTCACTTATCGACCTGGCGGGGTCCGAGCGGGCCAGTTCCACCAGCACCACAGGGGCCCGGTTCGTGGAGGGCACGAACATCAACAGGTCCCTGCTCGCCCTGGGAAACGTCATCAACGCCCTGGCAGATGGAAAGAAAAAGAATCAGCATGTTCCTTACAGAAATAGTAAGCTCACTCGCTTGTTAAAGGATTCTCTTGGAGGAAACTGTCAGACTATAATGATAGCTGCTGTTAGTCCTTCCTCTTTATCCTACGATGACACGTATAACACCCTTAAGTATGCTAACCGTGCAAAGGACATTAAATCTTCTCTGAAGAGCAACGTTTTTAATCTCAACAATCACATATCTCAGTATGTAAAGATCTGTAATGAGCAGAAGGCAGAGATTTTAATGTTAAAGGAAAAATTAAAAGCCTATGAAGAACAGACAGCCTGCACTGCTAAAAGTGATGAAGCAAAGTTAATGATTCCAAACCCTCAGGAAAAAGAAATCGAAAGATTTCAAGAGATTCTTAACTGCTTGTTCCAGAATCGAGAAGAAATCAGGCAAGAATATCTGAAGTTGGAAATGTTACTTAAAGAAAATGAACTTAAATCATTTTATCAACAGCAATGCCATAAGCAAATAGAAATGATGTGTTCTGAAGACAAAGTAGAAAAGGCCACCTGCAAACGAGATCATAGACTTGCGATGCTGAAAACTCGTCGCTGCTACCTGGAGAAAAAGAGAGAGGAGGAGTTGAAGCAATTCGATGAAAATACCAATTGGCTTTATCATGTGGAAAATGAGATGAGGCTCTTGGGCCAAAATGGTCATATTCCAAAGGAACTCAGTAAAGATCTTCGTTTTCACCATTTACACCTCCAGAATGAAGATTTGAAAGCACAAATTAGACATATGATAGATCTCGCTTGCCTTCAAGAGCAGCAGCACAGGCAGACTGAGGTAGTTCTGAATGCTTTACTTCCAACCCTAAGAAGACAGTATTGCACACTGAAAGAAGCTGGCTTGTCAAATGCTTCTTTTGAGTCTGACTTCAAAGAAATTGAACATTTGGTGGAGAGGAAAAAAGTGGTGGTTTGGGCAGATCAGACTACTGAACCCCCAAATCAAAAGGATCTACCAGGAATTTCTGTTCTGATGACCTTTCCACAGCTTGCACCTGTTCAGTCTATTCCTTGTTGCACATCTTCAGGTGACCCGAATCTGTTTAAAATTCCTCTGCACAAAAGAACTCGGAGAAAACTGATGCCTTCTCCCCTGACAGTAAAACATCCCGAGAAGCCAACGCTGGCTGAAAGTGTCCCGCTCAATGACTCTCTCACCAGAGAACTTCAGCCCCTTTTGTACACCCCCGAGAACTGCAGAAAACCTGTCCCATGTGCGTCCCCACGGCCCTGGGTAAGGCCGCCCTCGCACCCTGCAGGCATCCAGGCCTTGGGCCCCTGTGGAAACAGTGGTGACTCACTGCAAATGCTGGGCAGGGTCGACAGCCCTGCTGTCTGCAGGGCAGCACATGGACGGAGCGCCACAGAGCCCCTCACTGCGTGTGAAGACACCAGGGCCCTGAAGCGAAAGTTACCCGAACAGGACTCGCTCCTGACCAAAAACAGTTTAGAAAGGCTTGGCCCTTCTTCGCTCTCAGGCACGCACCCAGTGCCTGTGTCGAGCACGATGCCATCCTACATGGCGATGACCGCTGCCGCTAAGAAGAAACGGAAACTGGCGAGCTCTACATCAAGTAATCCGTTAACTGCTGAAGAAAATCATGGATTTGCCAAACGTGTTCGACAAGAGAATTCAAGCAATAACCTCTTACAAGAAAACAGACCAGCCATAGCGCAGAATAAAACCATCCATAAAATAAACTCAAACATGGTTAGAAAATTTGGAAGAAACATTTCAAAAGGAAATCTAAGATAA

XM_004851585.1 Coding sequence

Mettl15 methyltransferase like 15, transcript variant X1

Length: 1218 bp    Location: 17624565..17786813   Strand: +
>XM_004851585.1
ATGCTTCGATACCCATATTTATGTAGATGTATATATAAAGAGTGTTTTTCATACTGGTTGGAATCTGGCATACTTAATTTAGATGCCTGGCAAAAAAAATTACATACTACAACAGGAAGATGGAATGAGTATAAAACCCAAGCGCAAGCAGGTCAAACTGGAGCCCAGGAATCGCACACATCTCCAAATAGAGATTCTGACACCGTGGCTGAATTGCATATTCCGGTGATGGTGAATGAAGTCGTTCGTTGTTTGGCACCACAAAAAGGGCAGGTTTTTCTAGATATGACATTCGGTTCAGGAGGACACACAAAAGCCCTTCTCCAGGAGGAGCCGGATATTACTCTGTACGCCTTAGACAGAGACCCGACAGCTTGTGCGCTAGCCGAGCAGCTTTCAGAGCTATATCCGAAACAGATCCGAGCTCTGCTAGGCCCGTTCAGCCAGGCCGAAGCCGTACTCCTGGAGGCTGGGGTGCAGCCGGGGACTTTGGATGGGGCTCTGTTGGATCTCGGGTGCTCCTCCATGCAACTTGACACTCCTGAAAGAGGTTTTTCCCTTCGGAAGGACGGTCCCTTGGACATGAGGATGGATGGTGGCAGGTATCCCGACATGCCCACCGCGGCTGACGTTGTGAACGCCTTAGACCGACAGGCGCTCGCATCCATCCTGAGAAGATACGGGGAAGAGAAACACGCCAGGAAAATCGCGTCAGCAATCGTTCAGGCACGGAGCACATACCCCATCACCAGAACCCAGCAGCTTGCCAGCATTGTAGCAGGTGCATTTCCTCCTTCTGCTATTTATGCACGGAAAGACTTGCTACAACGATCGACCCATATTGCTACCAAGACTTTCCAAGCTCTTCGTATATTTGTGAACAATGAGCTCAATGAACTCTACACAGGACTTAGGACAGCTCAGAAATTTCTGAGACCTGGTGGTCGCCTTGTTGCTATCTCCTTTCACTCATTAGAGGATCGCATCGTCAAGAGATTTTTGCTTGGGATAAGCATGATGGAAAAGTTTAACCAAAGTGTCAGACAGAAGATGGTGCAAACCTGGGGTTCAGATCATGAAAACAAAGGAGGAATTGCTGTAAAAGCTCCTTTAATGTGGGAAATGATACACAAGAAGGTACTTACCCCCAAAGATCAGGACATACACGATAACCCCAGAGCACGGTCAGCCAAGCTGAGAGCAGCTATCAAATTGTGA

XM_004851587.1 Coding sequence

Kcna4 potassium voltage-gated channel, shaker-related subfamily, member 4

Length: 1998 bp    Location: 19161647..19155793   Strand: -
>XM_004851587.1
ATGGAGGTCGCCATGGTGAGTGCGGAGAGCTCAGGGTGCAACAGTCATCTGCCTTATGGGTATGCGGCCCAGGCCCGGGCCCGGGAGCGTGAGCGGCTGGCCCACTCCAGGGCCGCTGCCGCTGCAGCCGTGGCGGCAGCCACCGCGGCTGTGGAAGGCAGCGGGGGCTCCGGAGGGGGGCCCCCCCACCACCACCAGGCCCGCGCGGCCTGCACCCCCCGTGACCCCCAGGGCATTCGCGGCAGTCGGAGGAGGCGGGGGCGACAGCGGCCTGAGAAGAAGAAAGCCCACCACAGGCAGAGCAGCTTCCCTCACTGCTCGGATCTCATGCCCAGCGGCTCTGAGGAGAAGATCCTGAGGGAGCTGAGCGAGGAGGAGGAGGAGGAGGAGGAGGAGGACGAGGAGGAGGAGGAGGAGGAGGGGGAGGGGGAGGAGGAGGCCAGGTTCTACTACAGCGAGCAGGACCGAGGTGACCAGTGCTCCTACACAGACCTGCTGCCCCAGGACGAAGGCGGCGGAGGCGGGTACAGCTCCGTGCGCTACAGTGACTGCTGCGAACGTGTGGTGATCAACGTGTCCGGCCTGCGCTTCGAGACCCAGATGAAAACCCTGGCCCAGTTTCCAGAGACTCTGCTGGGAGACCCTGAGAAGAGGACTCAGTACTTTGACCCTCTGCGCAATGAGTATTTTTTTGACAGGAACAGGCCCAGCTTTGATGCCATCTTGTACTATTACCAGTCGGGAGGACGCCTGAAGAGGCCCGTCAACGTCCCCTTCGACATTTTCACTGAGGAGGTGAAGTTTTACCAGCTGGGCGAGGAGGCCCTGCTCAAGTTCCGGGAGGACGAGGGGTTCGTGAGGGAGGAGGAGGACAGGGTCCTGCCTGAGAGTGAGTTCAAAAAGCAGATCTGGCTGCTCTTCGAGTATCCAGAGAGCTCCAGTCCCGCCAGGGGCATCGCCATTGTGTCCGTCCTGGTCATCTTGATTTCCATCGTCATCTTCTGCCTGGAGACCTTGCCCGAGTTCAGGGACGACAGGGACCTGGTCATGGCACTGAGCACCGGCGCTGGCGGGCACGGTGGGTTGTTGAATGACACCTTGGCACCCCGTCTGGAGAACTTGGGGCACACGATCTTCAACGACCCCTTCTTCATCGTGGAGACCGTGTGCATCGTGTGGTTTTCCTTTGAGTTCGTGGTCCGCTGCTTTGCCTGTCCCAGCCAAGCCCTCTTCTTCAAAAACATCATGAACATCATTGACATTGTCTCCATCTTGCCTTACTTCATCACCCTGGGCACGGATCTGGCCCAGCAGCAGGAGGGCAGCAACGGGCAGCAGCAGCAGGCCATGTCCTTCGCCATCCTCAGGATCATCCGCCTGGTCCGTGTGTTCCGGATCTTCAAGCTCTCCAGGCACTCCAAGGGCCTGCAGATCCTGGGCCACACCCTCCGAGCCAGCATGCGTGAGCTGGGGCTGCTCATCTTCTTCCTCTTCATCGGGGTCATCCTCTTCTCCAGTGCCGTGTACTTTGCAGAGGCGGATGAGCCCACCACCCATTTCCAAAGCATTCCCGACGCGTTCTGGTGGGCCGTGGTCACCATGACAACTGTGGGCTACGGGGACATGAAGCCCATCACCGTGGGGGGCAAGATTGTGGGGTCCCTGTGTGCCATCGCGGGTGTCTTAACCATCGCTTTGCCAGTACCAGTGATCGTCTCCAACTTCAACTATTTCTACCACAGAGAGACTGAAAACGAGGAGCAGACGCAGCTCACACAGAACGTTGTCAGCTGCCCGTACCTCCCTTCCAATTTGCTGAAGAAATTTCGGAGCTCCACTTCTTCCTCCCTGGGGGACAAATCAGAGTATCTAGAGATGGAGGAAGGAGTGAAGGAGTCCTTGTGTGCGAAGGAGGAGAAGTGCCAGGGAAGGGGGGAGGAGAACGAGACAGAGAAAAACAACTGTTCCAACGCGAAGGCTGTGGAGACCGATGTGTGA

XM_004851575.1 Coding sequence

Slc5a12 solute carrier family 5 (sodium/glucose cotransporter), member 12, transcript variant X2

Length: 1857 bp    Location: 16667969..16612086   Strand: -
>XM_004851575.1
ATGGAGGTGAAGAGCTTCGCAGCTTGGGACTATGTTGTATTCGCAGCCCTTTTTGTCATTTCCTCTGGAATTGGGGTGTTCTTTGCCATTAAGGAGAGGAAAAAGGCAACATCTAAGCAGTTCCTGGTAGGGGGCAGGGAAATGTCCTTCGGGCCTGTCGCCTTGTCCCTGACAGCCAGCTTCATGTCAGCAGTCACTGTCTTGGGGACCCCTTCCGAGGTCTACCGCTTCGGGGCCTCCTTCATCCTCTTCTTCATTGCGTACACATTGGTTATCATCTTCACATCGGAGCTCTTTCTCCCTGTGTTCTACAGATCTGGCATCACCAGCACCTATGAGTACCTACAGCTACGCTTCAACAAAGCAGTTCGCTACACAGCGACCCTCATCTATATTGTGCAGACGATTCTTTACACGGGAGTGGTGGTGTATGCACCGGCCCTCGCACTCAATCAAGTGACTGGCTTTGACCTGTGGGGTTCTGTGTTTGCCACGGGGATCGTGTGCACTTTCTACTGCACCCTGGGAGGATTAAAAGCAGTGGTGTGGACAGATGCCTTTCAGATGATGGTCATGATTGTGGGCTTCTTAACAGTTCTCATTCAAGGATCCATTAAAGCTGGTGGATTCCACAATGTGTTAGAGCAAGCAGCAAATGGATCCCGACTACATATAGTTGATTTCGATGTAGATCCTCTCCGGAGGCATACTTTTTGGACCATCTCTGTTGGAGGAACTTTTACATGGCTTGGCATCTATGGAGTTAATCAATCAACCATCCAGAGGTGCATCTCTTGCAAAACAGAAAAGCATGCTAAGCTCGCCTTGTACTTTAACCTGCTGGGCCTCTGGATCATTCTGCTGTGTGCAGTCTTCTCTGGGTTAATCATGTATTCCCACTTCAAAGACTGCGACCCTTGGACTTCCGGCATGATCTCCGCACCAGACCAGCTGATACCATATTTTATCATGGAGATATTTGACACAATGCCAGGACTTCCAGGACTTTTTGTAGCCTGTGCTTTTAGTGGAACTCTGAGCACCGTGGCCGCCAGCATCAATGCCTTAGCGACTGTGACCTTTGAGGACTTTGTCAAGAGCTGCTTTCCGCGCCTTTCAGACAAGATGAGCACCTGGACCAGTAAAGGCTTATGTCTCCTGTTCGGCATTCTGTGCACCTCCATGGCCGTGGCAGCCTCCCTCCTAGGGGGTGTCGTACAGGTAAAATGGGAGCGAAAAGTCACAGGGTCACACGTCGTTTTCCTCCCTCTCGTCTCATCGCCTGTCTCTCTTTCCCTCATCAAGGGCGCACTGGGTGGCCTCCTCACCGGAATCACACTGTCCTTCTGGGTGGCCATAGGGGCCTTTGTTTACCCTGCGCCAGACTCCAAGACTCGGCCTCTGCCTTTATCGACAGAGCAGTGTGTCCCGACAAACATGACCACATCAGCACCTGCGGTGCTAGCCAGCAGGCCCGAGCTGGCTGACACCTGGTACTCGCTCTCCTACCTGTACTACAGCGCAGTGGGCTGTGTTGGGTGCATTCTTGCTGGACTGCTCATCAGCTTCGTGACAGGTCTCCAGACAGGTGAAGATATCAACCCACTCTTAATTAGACCAGTGTGCAATTTATTTTGCTTTTGGTCTGAGAAATACAAAACTCTGTGCTGGTGTGGAGTGCAGCACGACTGCTGGCCCGAGCAGGATAACTGTGAGAATGGCAGTACCTGGAAACATGGGGCAGAATCTGTGCTCCACAATGGACTCAGGGGAGAAAGCCTGGCCCATGCACCAGGGTACAATCCCAAGGACAAAAGCTACGACCATACGGCGCTGGAGAAGATAACCCATTTCTAG

XM_004851566.1 Coding sequence

Gas2 growth arrest-specific 2, transcript variant X1

Length: 996 bp    Location: 13618237..13741604   Strand: +
>XM_004851566.1
ATGTGCACTGCTCTGAGCCCAAAGGTACGCAGTGGGCCTGGTCTGTCTGATATGCATCAGTACAGCCAGTGGCTGGCCAGCAGACACGAAGCTAATTTGCTACCGATGAAAGAAGATCTGGCCCTGTGGTTAACCAATCTATTAGGGAAGGAGATTACAGCAGAAACTTTCATGGAGAAATTGGACAATGGCGCTTTGCTCTGTCAGCTCGCGGCAACTGTGCAGGACAAGTTCAGAGAGACCATGGACGCTCACAAGCCCACAAAGAGTCTGCCACTGAAGAAGATTCCATGCAAAGCCAGTGCGCCCTCAGGCTCCTTTTTTGCCCGAGATAATACAGCGAATTTCTTATCCTGGTGTCGAGATTTAGGGGTGGATGAAACATGTTTATTTGAATCTGAAGGTTTGGTCCTCCACAAGCAACCAAGAGAAGTGTGTCTCTGTTTGCTGGAACTTGGCCGGATTGCAGCCAGGTACGGTGTGGAGCCTCCCGGGTTGATAAAATTGGAAAAAGAAATCGAACAGGAAGAAACACTTTCTGCTCCTTCTCCTTCTCCTTCTCCTTCATCAAAGTCTTCTGGAAAAAAGAGCACAGGAAACTTACTGGACGATGCCGTGAAACAAATTTCTGAAGACCCTCCTTGCAAGTGTCCCAGCAAGTTCTGCGTGGAGCGGCTCTCCCAAGGAAGATACCGAGTGGGAGAAAAGATCCTCTTCATTAGGGGTCTTCATGGTTGTAACTATGTCTCCACAGCCAAAGTAAAGCAGACATTGAAGATGCTGCACAACAAACATGTCATGGTGCGTGTGGGAGGAGGATGGGAAACTTTTGCTGGGTATTTGTTGAAACATGACCCCTGCCGAATGCTGCAGATCTCCCGTGTGGATGGCAAAACATCCCCCATCCAAAGCAAATCTCCAACTCTTAAGGACATGAATCCAGATAATTACTTGGTGGTCTCTGCCAATTATAAGGCTAAGAAGGAGATTAAATGA

XM_004851568.1 Coding sequence

Gas2 growth arrest-specific 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 942 bp    Location: 13618237..13741604   Strand: +
>XM_004851568.1
ATGTGCACTGCTCTGAGCCCAAAGGTACGCAGTGGGCCTGGTCTGTCTGATATGCATCAGTACAGCCAGTGGCTGGCCAGCAGACACGAAGCTAATTTGCTACCGATGAAAGAAGATCTGGCCCTGTGGTTAACCAATCTATTAGGGAAGGAGATTACAGCAGAAACTTTCATGGAGAAATTGGACAATGGCGCTTTGCTCTGTCAGCTCGCGGCAACTGTGCAGGACAAGTTCAGAGAGACCATGGACGCTCACAAGCCCACAAAGAGTCTGCCACTGAAGAAGATTCCATGCAAAGCCAGTGCGCCCTCAGGCTCCTTTTTTGCCCGAGATAATACAGCGAATTTCTTATCCTGGTGTCGAGATTTAGGGGTGGATGAAACATGTTTATTTGAATCTGAAGGTTTGGTCCTCCACAAGCAACCAAGAGAAGTGTGTCTCTGTTTGCTGGAACTTGGCCGGATTGCAGCCAGGTACGGTGTGGAGCCTCCCGGGTTGATAAAATTGGAAAAAGAAATCGAACAGGAAGAAACACTTTCTGCTCCTTCTCCTTCTCCTTCTCCTTCATCAAAGTCTTCTGGAAAAAAGAGCACAGGAAACTTACTGGACGATGCCGTGAAACAAATTTCTGAAGACCCTCCTTGCAAGTGTCCCAGCAAGTTCTGCGTGGAGCGGCTCTCCCAAGGAAGATACCGAGTGGGAGAAAAGATCCTCTTCATTAGGATGCTGCACAACAAACATGTCATGGTGCGTGTGGGAGGAGGATGGGAAACTTTTGCTGGGTATTTGTTGAAACATGACCCCTGCCGAATGCTGCAGATCTCCCGTGTGGATGGCAAAACATCCCCCATCCAAAGCAAATCTCCAACTCTTAAGGACATGAATCCAGATAATTACTTGGTGGTCTCTGCCAATTATAAGGCTAAGAAGGAGATTAAATGA

XM_004851569.1 Coding sequence

Svip small VCP/p97-interacting protein

Length: 234 bp    Location: 13751725..13744230   Strand: -
>XM_004851569.1
ATGGGGCTGTGCTTCCCATGCCCCACTGAGCCAGAGCCGGGGTCGCCGAGCCCGGAAGAGAAAAGAGCAAAGCTTGCAGAGGCTGCAGAGAGAAGACAGAAGGAGGCTGCATCTCGGGGGGTTTTAGATGTTCGCTCTGTGGAAGAAAAAAGAAAGAAAAAGGAAAAACTAGAAAAACACATTGCCACATCTGGGCCTCCACCAGCAGGTGGACTTAGATGGACAGTTTCATAA

XM_004851565.1 Coding sequence

Slc17a6 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6, transcript variant X2

Length: 1599 bp    Location: 13334764..13375740   Strand: +
>XM_004851565.1
ATGGAGTCCGTAAAACAAAGGATTTTGGCCCCAGGGAAAGAAGGGCTAAAGAATTTTGCTGGAAAATCCCTCGGCCAGATCTACAGGGTGCTGGAGAAGAAGCAGGAGGCCGGCGAGACCATCGAGCTGACCGAGGATGGGAAGCCCCTGGAGGTGCCCGAGAGGAAGGCGCCGCTGTGCGACTGCACGTGCTTCGGCCTGCCGCGCCGCTACATCATCGCCATCATGAGCGGCCTGGGCTTCTGCATCTCCTTCGGCATCCGCTGCAACCTGGGCGTGGCCATCGTGGACATGGTCAACAACAGCACCGTCCACCGCGCGGGCAAAGTCATCAAGGAGAAAGCCAAGTTCAACTGGGACCCGGAGACCGTGGGGATGATCCACGGCTCGTTCTTCTGGGGTTACATCATCACCCAGATTCCGGGCGGATACATCGCGTCGCGCCTGGCGGCCAACAGGGTGTTTGGAGCCGCCATACTTCTAACCTCTACCCTAAACATGCTAATCCCATCAGCAGCCAGAGTGCATTACGGATGCGTCATCTTTGTTAGAATCCTGCAGGGACTTGTTGAGGGTGTCACCTACCCAGCATGCCACGGGATCTGGAGCAAATGGGCCCCTCCCCTGGAGAGGAGCAGGCTGGCGACCACCTCGTTCTGTGGTTCCTATGCTGGGGCTGTGATTGCCATGCCTTTAGCTGGCATTCTTGTACAGTACACCGGGTGGTCTTCCGTGTTTTACGTCTATGGAAGTTTTGGAATGGTCTGGTACATGTTTTGGCTTTTGGTGTCTTATGAGAGCCCTGCAAAGCACCCTACTATTACAGACGAAGAACGTAGGTACATAGAAGAAAGCATTGGAGAGAGTGCGAATCTGTTAGGGGCAATGGAAGTTGGCATGCTGTCTGCCGTGCCCCACTTAGTCATGACAATCATTGTACCTATTGGAGGACAAATTGCAGATTTTCTAAGAAGCAAGCAAATCCTTTCAACGACCACAGTGAGGAAGATCATGAATTGTGGTGGTTTTGGGATGGAAGCTACATTGCTGCTGGTGGTTGGTTATTCTCATACTAGAGGGGTCGCCATCTCCTTCTTGGTACTTGCAGTGGGATTCAGCGGATTTGCCATATCTGGCTTCAACGTTAACCACTTGGATATCGCTCCACGGTATGCCAGTATCTTAATGGGCATTTCAAACGGCGTTGGCACACTGTCGGGAATGGTTTGCCCTATCATTGTTGGTGCAATGACAAAGAATAAGTCACGCGAAGAGTGGCAGTATGTCTTCCTGATTGCTGCCCTCGTCCACTATGGAGGAGTTATCTTTTATGCAATATTTGCCTCCGGAGAGAAGCAGCCCTGGGCAGATCCTGAGGAAACAAGTGAAGAAAAATGTGGATTTATCCATGAAGATGAACTCAATGAAGAAACGGGGGACATTACTCAGAATTATATAAATTATGGTACCACTAAATCTTATGGTGCCACAACACAGGCCAATGGGGGTTGGCCTAATGGCTGGGAAAAGAAAGAGGAATTTGTACAAGAAGCAGTACAAGACTCGTATACCTATAAGGACCGAGATGATTATTCATAA

XM_004851556.1 Coding sequence

Htatip2 HIV-1 Tat interactive protein 2, 30kDa, transcript variant X2

High confidence: 4 potential gene matches
Length: 792 bp    Location: 11650808..11667338   Strand: +
>XM_004851556.1
ATGTCGCGGGGAGAGCGCCCCGCAGTGTGCGCGCCGGTGTGCGGCCAGGTGCGGGCGCCCAGCATGGCCGAGACCCAGGCGCTGCCGAAGCTTCGGGAAGACTTCCGGATGCAGAAGAAATCTGTCTTTATTCTGGGCGCCAGCGGGGAAACGGGCAGAGTGCTCTTAAAAGAAATCCTGGAACAGAACCTGTTTTCCAAAGTCACGCTCATAGGCCGGAGGAAGCTCACCTTCGAGGAGGAAGCATACAAAAACGTGAATCAAGAAGTGGTGGACTTTGAAAAGCTGGATGACTATGCATCTGCCTTCCAAGGTCATGATGTTGGATTTTGTTGCCTGGGCACCACCAAAGCAAAAGCTGGCGCGGAAGGATTTGTTCGTGTTGACCGAGATTACGTGCTGAAGTCAGCAGAGCTGGCAAAAACTGCAGGCTGCAAACATTTCAACTTGCTGTCCTCTCGAGGAGCCGATAAGTCAAGCAAATTTTTGTATTTACAAGTTAAGGGAGAAGTAGAAGCCAGGGTTGAAGAATTAAAATTTGATCGTTACTCAGTATTTCGGCCTGGAGTCCTGCTGTGCGACAGGCAAGAATCTCGCCCAGGTGAATGGCTGGCTAGGAAATTCTTTGGCTCCTTACCAAACTCTTGGGCCAGTGGCCTCTCTGTACCCATGGTGACTCTGGTGAGAGCAATGCTGAACAACTTGGTGAGACCAGGTGACCAGCAGATGGAAGTCCTGGAAAGCAAGGCCATCCACAGCCTGGGGAAAGCTGACAGCTCTCTCAAGCTGTGA

XM_004851465.1 Coding sequence

Rras2 related RAS viral (r-ras) oncogene homolog 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 594 bp    Location: 6207378..6180822   Strand: -
>XM_004851465.1
ATGAATCAACTTCATATGTCATGGACACTCTTGAAGTCCACGTATGACCCTTACTCATTCCCCTTAAAGGCTGTTTACCATTCTGTGTCCTATTTTGTAACAGATTATGATCCAACCATTGAAGATTCCTATACAAAGCAATGTGTGATAGATGACAGAGCAGCCCGGCTAGATATTTTGGATACAGCTGGACAAGAAGAGTTTGGAGCCATGAGAGAACAGTATATGAGGACTGGTGAAGGCTTCTTGTTGGTCTTTTCAGTCACAGATAGAGGCAGTTTTGAAGAAATCTATAAGTTTCAAAGACAGATTCTTAGAGTAAAGGATCGCGATGAGTTTCCAATGATTTTAATTGGTAATAAAGCGGACCTGGATCATCAAAGGCAGGTGACACAGGAGGAAGGACAACAGTTAGCACGGCAACTTAAGGTAACATACATGGAGGCATCAGCAAAGATTAGGATGAATGTAGATCAAGCTTTCCATGAACTTGTTCGGGTTATAAGGAAATTTCAAGAGCAAGAATGTCCTCCTTCACCAGAACCAACACGGAAAGAGAAAGACAAGAAAGGCTGCCATTGTGTCATTTTCTAA

XM_004851562.1 Coding sequence

Nell1 NEL-like 1 (chicken), transcript variant X4

High confidence: 4 potential gene matches
Length: 2292 bp    Location: 11921659..12734831   Strand: +
>XM_004851562.1
ATGCCGGTGGACGTGATTTTAGTTTTGGGGTTCTGTGTGTGCGCCGCCAGGACAGTGGTGGGCTTGGGGCTGGACCCTGACCTTCAGATGGATATTATCACAGAACTTGACCTTGTCAACACCACCCTCGGAGTCACTCAGGTGCCTGGACTGCACAATGGCAGCAAAGCATTTTTATTTCAAGACACAGAAAGAGAGATCCATGGAGCTCCTCATGTGAGTGAGAAGTTAATCCAGTTGTTCCGGAATAAGAGTGAATTCACCTTTTTGGCCACTGTGCAGCAGAAGCCATCGACTTCTGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAGCTGGAGAGCAGTGGCCTGAGGGATGAGATTCGATATCGCTACATGCATAAGGGGAAGCCCAGGACAGAGGCATTTCCCTACCAGATGGCAGACGGGCAGTGGCACAAGGTCGCTCTGTCAGTTAGTGCCTCTCACCTCTTGCTCCATGTGGACTGCAATCGGATTTATGAGCGCGTGATAGATCCTCCAGAGACCAGTCTTCCCCCAGGAAGCAACTTATGGCTTGGTCAGCGCAACCAGAAGCATGGCTTATTCAAAGGGATCATCCAAGATGGGAAGGTCATCTTTATGCCGAATGGATACATAACCCAGTGTCCAAACCTAAATCGCACTTGCCCTACCTGCAGTGATTTCTTAAGCCTGGTGCAAGGAATAATGGATTTACAAGAGCTTTTGGCCAAGATGACTGCAAAACTAAATTATGCAGAGACAAGACTTAGTCAATTGGAAAACTGTCATTGTGAGAAGACCTGTCAAGTGAGTGGGTTGCTCTATCGGGACCAAGACTCTTGGGTTGATGGTGACCATTGCAGGAATTGCACATGCAAAAGTGGCGTTGTGGAGTGCCGGCGGATGTCCTGTGCCCCTCTCAGTTGTTCCCCAGACTCCCTCCCTGTGCACATCTCTGGCCAGTGCTGTAAGGCCTGCCGACCAAAATGTATCTATGGAGGAAAAGTTCTTGCAGAGGGCCAGCGGATTCTCTCCAAGAGCTGTCGGGAATGCCGAGGTGGAGTTTTAGTAAAAATCACAGAAACATGTCCTCCTTTGAACTGCTCAGAAAAGGATCACATTCTTCCAGAGAATCAGTGCTGCCGGGTCTGTAGAGGTCATAACTTTTGTGTTGAAGCACCTAAATGTGGTGAAAACTCAGAGTGCAAAAACTGGAATACGAAAGCGACTTGCGAGTGCAAGAATGGTTACATCTCTGTCCAGGGAGACTCCGCCTACTGTGAAGATATTGATGAATGTGCAGCTAAGATGCATTACTGTCATGCGAATACTGTGTGTGTCAACCTGCCAGGGTTATATCGCTGTGACTGTGTCCCAGGCTACATTCGTGTAGATGACTTCTCTTGTACAGAGCACGATGAATGTGGCAGTGGGCAGCACAACTGCGACCAGAATGCCATCTGCACCAACACCGTCCAGGGACACAGCTGCACCTGCAAACCGGGCTACGTGGGCAACGGGACCATCTGCAGAGCATTCTGTGAAGAGGGCTGCAGACACGGTGGGACGTGCGTGGCTCCCAACAAATGTGCCTGTCCGTCTGGATTCACAGGAAGCCGTTGCGAGAAAGACATTGATGAATGTGCCTTAAGAACTCACACCTGTTGGAATGACTCTGCCTGCATCAATTTGGCAGGGGGCTTTGACTGCCTCTGCCCCTCTGGGCCCTCCTGTTCTGGTGACTGTCCCCACGAGGGAGGACTGAAGCACAACGGACAGGTGTGGACCCTGAAAGAAGACAGGTGTTCTGTCTGTTCCTGCAAGGATGGGAAGATATTCTGTCGCCGGACAGCTTGCGACTGCCTGAATCCAAGTGCGGACCTTTTTTGTTGCCCAGAGTGTGACACCAGGGTCACAAGTCAGTGTTTAGATCAAAATGGACACAAACTCTATCGAAGTGGCGACAACTGGACCCACAGCTGCCAGCAGTGTCGGTGTCTGGAAGGAGAGGTAGATTGCTGGCCACTCACCTGCCCCAGTTTGAGCTGCGAGTACACAGCTCTCTTGGAAGGGGACTGTTGTCCCCGCTGTATCAGTGACCCCTGCCTGGCTGATAACATCACCTATGACATCAGAAAAACTTGTCTGGACAGCTCTGGCATTTCAAGGCTGAGCGGAGCACTGTGGACAATGGCTGGATCTCCCTGCACAACCTGTAAATGCAAGAATGGGAGAGTCTGCTGTTCTGTGGATTTGGAGTGTCTTCAGAATAACTGA

XM_004851560.1 Coding sequence

Nell1 NEL-like 1 (chicken), transcript variant X2

Length: 2433 bp    Location: 11921659..12734831   Strand: +
>XM_004851560.1
ATGCCGGTGGACGTGATTTTAGTTTTGGGGTTCTGTGTGTGCGCCGCCAGGACAGTGGTGGGCTTGGGGCTGGACCCTGACCTTCAGATGGATATTATCACAGAACTTGACCTTGTCAACACCACCCTCGGAGTCACTCAGGTGCCTGGACTGCACAATGGCAGCAAAGCATTTTTATTTCAAGACACAGAAAGAGAGATCCATGGAGCTCCTCATGTGAGTGAGAAGTTAATCCAGTTGTTCCGGAATAAGAGTGAATTCACCTTTTTGGCCACTGTGCAGCAGAAGCCATCGACTTCTGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAGCTGGAGAGCAGTGGCCTGAGGGATGAGATTCGATATCGCTACATGCATAAGGGGAAGCCCAGGACAGAGGCATTTCCCTACCAGATGGCAGACGGGCAGTGGCACAAGGTCGCTCTGTCAGTTAGTGCCTCTCACCTCTTGCTCCATGTGGACTGCAATCGGATTTATGAGCGCGTGATAGATCCTCCAGAGACCAGTCTTCCCCCAGGAAGCAACTTATGGCTTGGTCAGCGCAACCAGAAGCATGGCTTATTCAAAGGGATCATCCAAGATGGGAAGGTCATCTTTATGCCGAATGGATACATAACCCAGTGTCCAAACCTAAATCGCACTTGCCCTACCTGCAGTGATTTCTTAAGCCTGGTGCAAGGAATAATGGATTTACAAGAGCTTTTGGCCAAGATGACTGCAAAACTAAATTATGCAGAGACAAGACTTAGTCAATTGGAAAACTGTCATTGTGAGAAGACCTGTCAAGTGAGTGGGTTGCTCTATCGGGACCAAGACTCTTGGGTTGATGGTGACCATTGCAGGAATTGCACATGCAAAAGTGGCGTTGTGGAGTGCCGGCGGATGTCCTGTGCCCCTCTCAGTTGTTCCCCAGACTCCCTCCCTGTGCACATCTCTGGCCAGTGCTGTAAGGCCTGCCGACCAAAATGTATCTATGGAGGAAAAGTTCTTGCAGAGGGCCAGCGGATTCTCTCCAAGAGCTGTCGGGAATGCCGAGGTGGAGTTTTAGTAAAAATCACAGAAACATGTCCTCCTTTGAACTGCTCAGAAAAGGATCACATTCTTCCAGAGAATCAGTGCTGCCGGGTCTGTAGAGGTCATAACTTTTGTGTTGAAGCACCTAAATGTGGTGAAAACTCAGAGTGCAAAAACTGGAATACGAAAGCGACTTGCGAGTGCAAGAATGGTTACATCTCTGTCCAGGGAGACTCCGCCTACTGTGAAGATATTGATGAATGTGCAGCTAAGATGCATTACTGTCATGCGAATACTGTGTGTGTCAACCTGCCAGGGTTATATCGCTGTGACTGTGTCCCAGGCTACATTCGTGTAGATGACTTCTCTTGTACAGAGCACGATGAATGTGGCAGTGGGCAGCACAACTGCGACCAGAATGCCATCTGCACCAACACCGTCCAGGGACACAGCTGCACCTGCAAACCGGGCTACGTGGGCAACGGGACCATCTGCAGAGCATTCTGTGAAGAGGGCTGCAGACACGGTGGGACGTGCGTGGCTCCCAACAAATGTGCCTGTCCGTCTGGATTCACAGGAAGCCGTTGCGAGAAAGATATTGATGAATGTACAGAGGGCATCGTTGAGTGCCACAGCCATTCCCGCTGCGTTAACCTGCCAGGGTGGTACCACTGTGAGTGCAGAAGCGGTTTCCATGACGATGGGTCCTATTCACATTCCGGGGAGTCCTGTATTGACATTGATGAATGTGCCTTAAGAACTCACACCTGTTGGAATGACTCTGCCTGCATCAATTTGGCAGGGGGCTTTGACTGCCTCTGCCCCTCTGGGCCCTCCTGTTCTGGTGACTGTCCCCACGAGGGAGGACTGAAGCACAACGGACAGGTGTGGACCCTGAAAGAAGACAGGTGTTCTGTCTGTTCCTGCAAGGATGGGAAGATATTCTGTCGCCGGACAGCTTGCGACTGCCTGAATCCAAGTGCGGACCTTTTTTGTTGCCCAGAGTGTGACACCAGGGTCACAAGTCAGTGTTTAGATCAAAATGGACACAAACTCTATCGAAGTGGCGACAACTGGACCCACAGCTGCCAGCAGTGTCGGTGTCTGGAAGGAGAGGTAGATTGCTGGCCACTCACCTGCCCCAGTTTGAGCTGCGAGTACACAGCTCTCTTGGAAGGGGACTGTTGTCCCCGCTGTATCAGTGACCCCTGCCTGGCTGATAACATCACCTATGACATCAGAAAAACTTGTCTGGACAGCTCTGGCATTTCAAGGCTGAGCGGAGCACTGTGGACAATGGCTGGATCTCCCTGCACAACCTGTAAATGCAAGAATGGGAGAGTCTGCTGTTCTGTGGATTTGGAGTGTCTTCAGAATAACTGA

XM_004851547.1 Coding sequence

Csrp3 cysteine and glycine-rich protein 3 (cardiac LIM protein), transcript variant X1

Length: 621 bp    Location: 10631490..10613233   Strand: -
>XM_004851547.1
ATGCCAAACTGGGGTGGAGGAGCAAAATGTGGAGCCTGTGAAAAGACTGTCTACCACGCGGAAGAAATCCAGTGCAATGGCAGGAGTTTCCACAAGACCTGCTTCCACTGCATGGCCTGCAGGAAGGCTCTGGACAGCACTACAGTCGCAGCTCACGAGTCAGAGATCTACTGTAAGGTCTGCTACGGGCGCAGGTACGGCCCCAAGGGGATCGGGTACGGACAAGGCGCCGGCTGTCTCAGCACGGACACAGGCGAGCACCTCGGGCTGCAGTTCCAACAGTCCCCGAAGCAGGCACGATCAGCCACCACCAGCAACCCCTCCAAGTTCACTTCGAAGTTTGGTGAGTCAGAGAAGTGCCCTCGATGTGGAAAGTCAGTCTATGCTGCTGAGAAGATCATGGGAGGTGGCAAGCCTTGGCACAAGACCTGCTTCCGCTGCGCCATGTGTGGGAAGAGCCTAGAGTCCACGAACGTCACTGACAAAGACGGGGAACTTTATTGCAAAGGTGAGTGGTTCTGGAGACCTTCCAGAGACTTGATTTCCCAAGGAGGGTCCTTGGGGGAAAGTGTGTTCCTGCCTAGAGGCCTACCTGTGTCAACTATGGAGAGGATCACCTGA

XM_004851550.1 Coding sequence

Nav2 neuron navigator 2, transcript variant X1

Length: 7467 bp    Location: 11056923..11417291   Strand: +
>XM_004851550.1
ATGCCGGCCATCCTGGTAGCCTCCAAGATGAAGTCGGGACTGCCCAAACCCGTGCACAGCGCCGCGCCCATCCTGCACGTGCCCCCGGCCCGGGCTGGCCCCCAACCCTGCTACCTTAAACTGGGGAGCAAGGTGGAGGTGAGCAAGACCGCCTACCCGAGCCTGATCCCCCTGAAATCGCAGGGGCTGCAAGACCCGGCGGGGGAGGTTCTTCCGCTGCGGAACAGCGGCTCAGTGGAAAACGGGTTCGATACCCAGATCTACACGGACTGGGCCAATCACTATCTAGCCAAATCTGGCCACAAACGTCTCATCAAGGATCTCCAGCAAGATGTGACCGACGGCGTCCTCCTGGCCCAGATCATCCAGGTCGTGGCAAATGAAAAGATTGAAGACATCAATGGCTGCCCAAAGAACAGATCGCAAATGATTGAAAATATAGATGCCTGCTTGAATTTCCTGGCAGCTAAGGGAATAAACATCCAGGGGCTGTCTGCAGAAGAAATCAGGAATGGAAACCTCAAGGCCATCCTAGGCCTCTTCTTCAGCCTCTCTCGATACAAGCAGCAGCAACAGCAACCCCAGAAGCAGCACCTCTCCTCCCCCGTGCCACCTTCTGGGTGTCCTGTGGCCGGGGCCCCCTCCCAGTGCCAGGCTGGCACCACTCAGCAACAGGTGCCGGCCACCGCCCAAGCCCTGTGCCAGCCTCACCAGCCAGCGCTACTCCAGCCGTCCAAAGCACAAGCTGAAATGCAGTCCAGTGTATCACCCAAGGACTCATCTCAAAGCAAAATCATCCGCTTCACCCTGGGTCAGAAAAAGATCTCTAGACTTCCAGGTCCTACCGTAAGGGTATCCACTGCAGGCAGCGAGGCCAAAACACGTGGAGGGTCAGCCACTGCTAACAACCGGCGCAGCCAGAGCTTTAACAACTATGACAAGTCCAAGCCAGTCACCTCACCACCCCCACCCCCAGCACCAAGTAGCCACGAAAAAGAACCACTGAGGAGCTCGGCCTCCGCCCACCCCGGCATGAGCGAAAATGCAGCTGCTCCCTCGGACACCAGCAGCCCCGCCGTGCCCACTAACTGCAGCGCCTCCTCCGCCATCCCGCAGCCCTCGGCCGCCAAGCCCTGGCGCAGCAAGTCCCTCAGCGTGAAGCACAGCGCCGCGGCCAGCGCCAGGCCGCCCGCGCCCGAGGCCCCCAGGCCCGCGCCCGAAGCCATGAAGCCAGCGCCCAACAATCAGAAGTCCATGCTGGAAAAGCTGAAACTCTTCAACAGCAAAGGGGGCTCCAAGGCGGGCGAGGGCCCGGGCTCCCGAGACGCGAGCTGTGAGCGGCTGGAGATCCTGCCGAGCTGCGAGGAGAACGAGGAGCTGGAGCCCGCGGGCCGCACGCTGTCCAGCGCGGGCCCCGCCTCCAGCAGCCCCAAGATCGCGCTCAAGGGCATCGCCCAGCGGACTTTCAGCCGGGCCCTGACCAACAAGAAGAGCTCCCCTAAAGGCAACGAGAAAGAGAAGGAAAAACAGCAGCGGGAGAAAGAGAAGGAGAAAGGCAAGGACCTCACCAAGAGAGCTTCGGTGACGGAAAGACCGGACCTCAAGGAGGAGCCCAGGGACGAGCCCAGTGGCGCAGCCGTGACCGAGATGCCAAAAAAGTCCTCCAAGATCGCCAGCTTCATCCCCAAGGGCGGGAAGCTGAGCAGTGCCAAGAAGGAGGCCGCCGCCCCTTCCCACAGCGGCATCCCCAAACCAGGGCCGAAGAGCACGCCCGGCAAGTCCCCGAGTGCCCCCGCGCTGCCCAAGGATGGGGAGCGGAGCCGCGGCGCCAAGCCGGGCTCGGGGCTCCCCCCGCAGAAGCCCCCGCTCGATGGCCGCCACTCCAGCTCCTCCTCCAGCCTGGCGTCCTCGGAGGGAAAAGCCCCGGGCGGGGCCACTCTGAACCACAGCATCAGCAGCCAGACCGTGAGTGGGTCCGTGGGGAGCACCCAGAGCACGGGAAGCAATACTGTCAGTGTTCAGCTACCTCAGCCTCAGCAGCAATACAGCCATCCCAACACTGCCACGGTCGCACCCTTCCTGTACAGGTCCCAGACGGACACTGAGGGGAATGTCACTGCCGAGTCCAGCCCCACAGGGATGAGCACGGAGCCCGGCCACTATACCAAGAGTGGACAGCCTGCCCTGGAGGAGTGCACGGGGGAAGACCCCGAGGCTCGGCGGCTGCGGACAGTGAAGAACATCGCTGATCTGCGGCAGAATTTGGAGGAGACCATGTCCAGTTTACGGGGAACTCAGGTGACACACAGCACATTGGAAACCACGTTTGACACCAATGTCACTACGGAGATAAGTGGCCGCAGCATCCTCAGTTTGACAGGGAGACCCACGCCTCTGTCCTGGCGACTCGGCCAGTCCAGCCCCCGGCTCCAGGCAGGAGATGCCCCCTCCATGGGCAATGGGTACCCACCTCGAGCCAACGCCAGCCGGTTCATCAGCACCGAGTCGGGCCGCTACGTGTACTCGGCACCTCTGCGAAGGCAGCTGGCCTCCCGGGGCAGCAGTGTCTGCCATGTGGACATCTCAGACAAAGCAGGGGACGAGGTGGACCTGGAAGGCATCAGCGTGGACGCCCCTGGCTACATGAGCGACGGGGATGTTCTGAGCAAGAACATCCGGAGCGACGACATCACAAGCGGGTACATGACCGATGGTGGACTGGGCCTCTACACGCGTCGCCTGAACCGGCTCCCCGACGGGATGGCGGTGGTGCGGGAGACCCTGCAGCGAAATACCTCCCTGGGCCTTGGTGACGCCGACAGCTGGGACGACAGCAGCTCCGTCAGCAGCGGCATCAGCGACACCATAGACAACCTCAGCACAGATGACATCAATACCAGCTCCTCCATCAGCTCCTACGCCAACACGCCGGCCTCCTCCCGGAAGAACTTGGATGTGCAGACTGATGCTGAGAAGCACTCGCAGGTGGAGAGGAATTCCCTGTGGTCTGGCGATGATGTCAAGAAATCCGACGGAGGGTCAGACAGCGGCATAAAGATGGAGCCAGGGGCCAAGTGGAGGCGGAACCCCTCTGATGTGTCGGATGAGTCAGACAAGAGCACATCAGGCAAGAAGCATCCGGTCATCTCGCAGACAGGCTCATGGCGGCGGGGCATGACGGCACAAGTGGGCATCACTGTGCCTCGGACGAAGCCATCCGCCCCAGCAAGTGCGCTGAAGACCCCAGGAACGGGAAAAACAGATGATGCAAAGGTGTCTGAGAAGGGAAGGCTTTCGCCCAAAGCCTCCCAGGTGAAGCGGTCCCCATCTGATGCAGGCCGCAGCAGCGGTGACGAATCCAAAAAGCCCCTACCCAGCAGCTCCAGGACACCCACCGCCAATGCCAACAGCTTTGGGTTCAAGAAGCAGAGTGGCTCAGTGGCCGGGCTGGCCATGATTACAGCCAGCGGGGCCACTGTCACTAGCAGATCAGCCACACTGGGCAAGATCCCAAAGTCATCCGCGCTCGTGGGCAGGTCCAGTGGTCGGAAGACAAGCATGGATGGGACTCAGAATCAGGACGATGGCTATCTGTCTCTCAGCTCCCGGACAAACTTGCAGTACCGGAGTCTGCCGAGGCCCAGTAAGTCCAACAGCAGAAACGGGGCTGGGAACAGGTCTAGCACCAGCAGCATCGATTCCAACATCAGCAGCAAGTCAGCGGGCCTGCCCGTGCCCAAGCTGCGGGAGCCTTCAAAAACAGCCCTGGGCAGCTCTCTGCCAGGCCTGGTCAACCAGACTGATAAGGAGAAGGGTATCTCCTCGGACAATGAGAGTGTGGCTTCCTGTAACTCCGTGAAAGTGAACCCAGCTGCCCAGCCTGTGTCGAGCTCAGCCCAAGCAGCCCTGCAGCCTGGGGCCAAGTACCCAGATGTGGCCTCTCCCACCCTCCGCAGACTCTTTGGTGGGAAGCCTACCAAGCAAGTGCCCATCGCCACCGCTGAAAACATGAAAAATTCGGTGGTCATCTCCAACCCTCATGCCACCATGACCCAGCAAGGTAACTTAGACTCCCCCTCAGGTAGTGGCATCCTGAGCAGTGGGAGCAGCAGCCCTCTCTACAGTAAGAACGTGGACCTCAACCAGTCTCCTCTAGCCTCCAGCCCCAGCTCGGCCCACTCGGGCCCTTCCAACAGCCTCACGTGGGGCACCACAGCCAGCAGCTCCTCGGCGGTCAGCAAGGACGGCCTGGGCTTCCAGTCAGTCAGCAGCCTGCACACCAGCTGCGAGTCCATTGACATCTCCCTTGGTAGCGGAGGGGGGCTGAGCCACAACTCCTCCACTGGCCTCCTCAGCTCCTCCAAGGATGACTCCCTGCCGCCCTTTGTGCGAACCAACAGTGTGAAGACCACACTGTCGGAAAGCCCTCTCTCTTCCCCTGCTGCTAGCCCTAAGTTCTGCAGAAGTACTCTGCCCAGGAAACAGGACAGTGACCCGCACCTTGATAGGAACACTTTGCCTAAGAAAGGACTCAGGTACCCCCCCACCTCCCAGCTGCGCACGCAGGAAGACGCAAAAGAATGGTTAAGGTCCCACTCTGCTGGAGGTCTCCAGGACACCGCTGCCAATTCCCCCTTTTCCTCCGGCTCCAGTGTAACCTCTCCCTCTGGAACAAGATTCAACTTCTCCCAGCTTGCGAGTCCCACCACTGTCACCCAGATGAGCTTGTCCAACCCCACCATGCTGCGGACCCACAGCCTGTCCAATGCGGATGGGCAGTACGACCCATACACCGACAGCCGCTTCCGGAACAGCTCCATGTCCCTGGATGAGAAGAGCAGAACCGTGAGCCGGTCGGGCTCCTTCCGGGATGGCTTTGAAGAAGAATTATGGGAGAAAATTTCTGTGGGCTGCTTTGTCAGCCCCCTTCATAACTTTACTCCTTCCGCCAAGCCTGTCCTGCACTCTGCAACTCACCTTTTATTTTTTCTTTTAACAGTTCATGGATCCTCACTCTCCCTGGTTTCCAGCACATCCTCCATTTATTCTACACCAGAAGAAAAGTGCCAGTCGGAGATCCGCAAGCTGAGGCGGGAACTGGATGCCTCCCAGGAGAAGGTCTCAGCGTTGACCACCCAGCTGACAGCAAACGCCCACCTCGTGGCAGCCTTTGAGCAGAGTCTCGGAAACATGACCATCAGGCTCCAGAGTCTGACCATGACAGCCGAGCAGAAGGATTCAGAACTGAACGAGTTAAGAAAAACCATCGAGCTGCTAAAGAAACAGAACGCAGCTGCCCAGGCTGCCATTAATGGAGTAATTAACACTCCTGAGCTCAACTGCAAAGGAAATGGCGCCTCGCAGGCCGCAGACCTCCGCATCCGTAGACAGCACTCCTCCGACAGTGTCTCCAGCATCAACAGCGCCACCAGCCACTCTAGTGTGGGCAGCAACATCGAGAGCGACTCCAAGAAGAAGAAGAGGAAGAACTGGGTTAATGAGTTACGCAGCTCCTTCAAGCAAGCTTTTGGAAAGAAGAAGTCCCCTAAGTCGGCATCCTCTCATTCGGACATTGAGGAGATGACGGATTCTTCTTTGCCTTCCTCACCAAAGTTACCACACAACGGCTCCACAGGATCCACCCCATTGCTGAGGAATTCTCACTCCAACTCTCTAATCTCAGAGTGCATGGATAGTGAAGCTGAGACGGTCATGCAGCTCCGGAACGAGCTGAGAGACAAGGAGATGAAGCTGACAGACATCCGCCTGGAAGCCCTCAGCTCTGCCCACCAGCTCGACCAGCTCCGGGATGCCATGAATAGGATGCAGAGTGAAATCGAGAAGCTCAAAGCTGAGAATGACCGGCTGAAGTTGGAGTCTCAGGGCAGCGGCTGCAGCCGGGCACCCTCCCAGGCATCCATCTCCGTGTCCCCTCGCCAGTCGCTGGGCCTCTCCCAGCACAGCCTGAACCTCACCGAGTCGACCAGCCTGGACATGTTGCTGGATGACACTGGTGAATGCTCGGCTCGGAAGGAAGGAGGCAGGCATGTTAAGATAGTTGTCAGCTTTCAGGAGGAAATGAAGTGGAAGGAGGATTCCAGGCCACACCTCTTTCTGATCGGCTGCATTGGTGTTAGTGGCAAGACCAAGTGGGATGTGCTGGACGGGGTGGTTAGACGGCTCTTCAAAGAGTACATCATCCACGTGGACCCCGTGAGCCAGCTGGGGCTGAATTCAGACAGTGTCCTCGGCTACAGCATTGGGGAAATCAAGCGAAGCAACGGTTCTGAGACCCCCGAGCTCCTCCCCTGCGGCTACCTGGTGGGCGAGAACACTACCGTCTCCGTGAGCGTCAGAGGGCTCGCGGAAAACAGCCTGGACTCGCTGGTGTTCGAGTCCTTGATCCCCAAGCCCATCCTGCAGCGCTACGTGTCCCTGCTGGTAGAGCACCGGCGGATCATCCTCTCTGGCCCCAGCGGCACAGGCAAAACCTACCTGGCCAACCGGCTGTCAGAGTACGTGGTGCTTCGAGAGGGACGGGAGCTGACAGATGGGGTTATCGCCACCTTCAACGTGGACCATAAATCCAGCAAGGAACTGCGCCAGTACCTGTCCAACCTTGCCGACCAGTGCAACAGCGAGAACAATGCGGTGGACATGCCCCTCGTCATCATCCTGGACAACCTGCACCACGTCAGCTCCCTGGGCGAGATCTTCAACGGGCTGCTCAACTGCAAGTACCATAAATGCCCTTACATCATTGGCACAATGAACCAGGCTACCTCTTCTACTCCCAACCTGCAGCTGCATCATAACTTCAGGTGGGTGCTCTGTGCCAACCACACAGAGCCAGTGAAGGGTTTCCTCGGCCGCTTCCTGAGGAGGAAGCTCATGGAGACGGAGATCAGTGGGCGGGTGCGGAATGTGGAGCTGGTCAAGATCATCGACTGGATCCCCAAGGTCTGGCATCACCTCAACCGCTTCCTGGAGGCTCACAGCTCCTCTGACGTCACCATCGGCCCCCGGCTCTTCCTGTCATGCCCCATCGACGTGGATGGCTCAAGAGTGTGGTTCACTGACTTGTGGAACTACTCCATCATCCCCTACCTCCTAGAAGCCGTCAGAGAAGGACTCCAGCTGTATGGACGGCGCGCGCCCTGGGAGGATCCTGCCAAGTGGGTGATGGACACCTACCCGTGGGCAGCCAGCCCCCAGCAGCACGAGTGGCCTCCCCTGCTGCAGCTACGACCTGAGGATGTTGGCTTCGATGGCTACGCCGTGCCGCGGGAGGGATCCTCCAGCAAACAAGTGCCCCCCAGCGACGCTGAAGGAGACCCGCTGATGAACATGCTGATGCGGCTGCAGGAAGCAGCCAACTACTCCAGCCCCCAGAGCTACGACAGCGACTCCAACAGCAACAGCCACCATGACGACATCCTAGACTCGTCCTTGGAGTCCACTCTGTGA

XM_004851548.1 Coding sequence

Csrp3 cysteine and glycine-rich protein 3 (cardiac LIM protein), transcript variant X2

High confidence: 4 potential gene matches
Length: 585 bp    Location: 10631490..10611804   Strand: -
>XM_004851548.1
ATGCCAAACTGGGGTGGAGGAGCAAAATGTGGAGCCTGTGAAAAGACTGTCTACCACGCGGAAGAAATCCAGTGCAATGGCAGGAGTTTCCACAAGACCTGCTTCCACTGCATGGCCTGCAGGAAGGCTCTGGACAGCACTACAGTCGCAGCTCACGAGTCAGAGATCTACTGTAAGGTCTGCTACGGGCGCAGGTACGGCCCCAAGGGGATCGGGTACGGACAAGGCGCCGGCTGTCTCAGCACGGACACAGGCGAGCACCTCGGGCTGCAGTTCCAACAGTCCCCGAAGCAGGCACGATCAGCCACCACCAGCAACCCCTCCAAGTTCACTTCGAAGTTTGGTGAGTCAGAGAAGTGCCCTCGATGTGGAAAGTCAGTCTATGCTGCTGAGAAGATCATGGGAGGTGGCAAGCCTTGGCACAAGACCTGCTTCCGCTGCGCCATGTGTGGGAAGAGCCTAGAGTCCACGAACGTCACTGACAAAGACGGGGAACTTTATTGCAAAGTTTGTTATGCCAAAAATTTTGGCCCTACAGGCATTGGGTTTGGGGGCCTTACACACCAAGTGGAAAAGAAAGAGTGA

XM_004851551.1 Coding sequence

Nav2 neuron navigator 2, transcript variant X2

Length: 7284 bp    Location: 11056923..11417291   Strand: +
>XM_004851551.1
ATGCCGGCCATCCTGGTAGCCTCCAAGATGAAGTCGGGACTGCCCAAACCCGTGCACAGCGCCGCGCCCATCCTGCACGTGCCCCCGGCCCGGGCTGGCCCCCAACCCTGCTACCTTAAACTGGGGAGCAAGGTGGAGGTGAGCAAGACCGCCTACCCGAGCCTGATCCCCCTGAAATCGCAGGGGCTGCAAGACCCGGCGGGGGAGGTTCTTCCGCTGCGGAACAGCGGCTCAGTGGAAAACGGGTTCGATACCCAGATCTACACGGACTGGGCCAATCACTATCTAGCCAAATCTGGCCACAAACGTCTCATCAAGGATCTCCAGCAAGATGTGACCGACGGCGTCCTCCTGGCCCAGATCATCCAGGTCGTGGCAAATGAAAAGATTGAAGACATCAATGGCTGCCCAAAGAACAGATCGCAAATGATTGAAAATATAGATGCCTGCTTGAATTTCCTGGCAGCTAAGGGAATAAACATCCAGGGGCTGTCTGCAGAAGAAATCAGGAATGGAAACCTCAAGGCCATCCTAGGCCTCTTCTTCAGCCTCTCTCGATACAAGCAGCAGCAACAGCAACCCCAGAAGCAGCACCTCTCCTCCCCCGTGCCACCTTCTGGGTGTCCTGTGGCCGGGGCCCCCTCCCAGTGCCAGGCTGGCACCACTCAGCAACAGGTGCCGGCCACCGCCCAAGCCCTGTGCCAGCCTCACCAGCCAGCGCTACTCCAGCCGTCCAAAGCACAAGCTGAAATGCAGTCCAGACTTCCAGGTCCTACCGTAAGGGTATCCACTGCAGGCAGCGAGGCCAAAACACGTGGAGGGTCAGCCACTGCTAACAACCGGCGCAGCCAGAGCTTTAACAACTATGACAAGTCCAAGCCAGTCACCTCACCACCCCCACCCCCAGCACCAAGTAGCCACGAAAAAGAACCACTGAGGAGCTCGGCCTCCGCCCACCCCGGCATGAGCGAAAATGCAGCTGCTCCCTCGGACACCAGCAGCCCCGCCGTGCCCACTAACTGCAGCGCCTCCTCCGCCATCCCGCAGCCCTCGGCCGCCAAGCCCTGGCGCAGCAAGTCCCTCAGCGTGAAGCACAGCGCCGCGGCCAGCGCCAGGCCGCCCGCGCCCGAGGCCCCCAGGCCCGCGCCCGAAGCCATGAAGCCAGCGCCCAACAATCAGAAGTCCATGCTGGAAAAGCTGAAACTCTTCAACAGCAAAGGGGGCTCCAAGGCGGGCGAGGGCCCGGGCTCCCGAGACGCGAGCTGTGAGCGGCTGGAGATCCTGCCGAGCTGCGAGGAGAACGAGGAGCTGGAGCCCGCGGGCCGCACGCTGTCCAGCGCGGGCCCCGCCTCCAGCAGCCCCAAGATCGCGCTCAAGGGCATCGCCCAGCGGACTTTCAGCCGGGCCCTGACCAACAAGAAGAGCTCCCCTAAAGGCAACGAGAAAGAGAAGGAAAAACAGCAGCGGGAGAAAGAGAAGGAGAAAGGCAAGGACCTCACCAAGAGAGCTTCGGTGACGGAAAGACCGGACCTCAAGGAGGAGCCCAGGGACGAGCCCAGTGGCGCAGCCGTGACCGAGATGCCAAAAAAGTCCTCCAAGATCGCCAGCTTCATCCCCAAGGGCGGGAAGCTGAGCAGTGCCAAGAAGGAGGCCGCCGCCCCTTCCCACAGCGGCATCCCCAAACCAGGGCCGAAGAGCACGCCCGGCAAGTCCCCGAGTGCCCCCGCGCTGCCCAAGGATGGGGAGCGGAGCCGCGGCGCCAAGCCGGGCTCGGGGCTCCCCCCGCAGAAGCCCCCGCTCGATGGCCGCCACTCCAGCTCCTCCTCCAGCCTGGCGTCCTCGGAGGGAAAAGCCCCGGGCGGGGCCACTCTGAACCACAGCATCAGCAGCCAGACCGTGAGTGGGTCCGTGGGGAGCACCCAGAGCACGGGAAGCAATACTGTCAGTGTTCAGCTACCTCAGCCTCAGCAGCAATACAGCCATCCCAACACTGCCACGGTCGCACCCTTCCTGTACAGGTCCCAGACGGACACTGAGGGGAATGTCACTGCCGAGTCCAGCCCCACAGGGATGAGCACGGAGCCCGGCCACTATACCAAGAGTGGACAGCCTGCCCTGGAGGAGTGCACGGGGGAAGACCCCGAGGCTCGGCGGCTGCGGACAGTGAAGAACATCGCTGATCTGCGGCAGAATTTGGAGGAGACCATGTCCAGTTTACGGGGAACTCAGGTGACACACAGCACATTGGAAACCACGTTTGACACCAATGTCACTACGGAGATAAGTGGCCGCAGCATCCTCAGTTTGACAGGGAGACCCACGCCTCTGTCCTGGCGACTCGGCCAGTCCAGCCCCCGGCTCCAGGCAGGAGATGCCCCCTCCATGGGCAATGGGTACCCACCTCGAGCCAACGCCAGCCGGTTCATCAGCACCGAGTCGGGCCGCTACGTGTACTCGGCACCTCTGCGAAGGCAGCTGGCCTCCCGGGGCAGCAGTGTCTGCCATGTGGACATCTCAGACAAAGCAGGGGACGAGGTGGACCTGGAAGGCATCAGCGTGGACGCCCCTGGCTACATGAGCGACGGGGATGTTCTGAGCAAGAACATCCGGAGCGACGACATCACAAGCGGGTACATGACCGATGGTGGACTGGGCCTCTACACGCGTCGCCTGAACCGGCTCCCCGACGGGATGGCGGTGGTGCGGGAGACCCTGCAGCGAAATACCTCCCTGGGCCTTGGTGACGCCGACAGCTGGGACGACAGCAGCTCCGTCAGCAGCGGCATCAGCGACACCATAGACAACCTCAGCACAGATGACATCAATACCAGCTCCTCCATCAGCTCCTACGCCAACACGCCGGCCTCCTCCCGGAAGAACTTGGATGTGCAGACTGATGCTGAGAAGCACTCGCAGGTGGAGAGGAATTCCCTGTGGTCTGGCGATGATGTCAAGAAATCCGACGGAGGGTCAGACAGCGGCATAAAGATGGAGCCAGGGGCCAAGTGGAGGCGGAACCCCTCTGATGTGTCGGATGAGTCAGACAAGAGCACATCAGGCAAGAAGCATCCGGTCATCTCGCAGACAGGCTCATGGCGGCGGGGCATGACGGCACAAGTGGGCATCACTGTGCCTCGGACGAAGCCATCCGCCCCAGCAAGTGCGCTGAAGACCCCAGGAACGGGAAAAACAGATGATGCAAAGGTGTCTGAGAAGGGAAGGCTTTCGCCCAAAGCCTCCCAGGTGAAGCGGTCCCCATCTGATGCAGGCCGCAGCAGCGGTGACGAATCCAAAAAGCCCCTACCCAGCAGCTCCAGGACACCCACCGCCAATGCCAACAGCTTTGGGTTCAAGAAGCAGAGTGGCTCAGTGGCCGGGCTGGCCATGATTACAGCCAGCGGGGCCACTGTCACTAGCAGATCAGCCACACTGGGCAAGATCCCAAAGTCATCCGCGCTCGTGGGCAGGTCCAGTGGTCGGAAGACAAGCATGGATGGGACTCAGAATCAGGACGATGGCTATCTGTCTCTCAGCTCCCGGACAAACTTGCAGTACCGGAGTCTGCCGAGGCCCAGTAAGTCCAACAGCAGAAACGGGGCTGGGAACAGGTCTAGCACCAGCAGCATCGATTCCAACATCAGCAGCAAGTCAGCGGGCCTGCCCGTGCCCAAGCTGCGGGAGCCTTCAAAAACAGCCCTGGGCAGCTCTCTGCCAGGCCTGGTCAACCAGACTGATAAGGAGAAGGGTATCTCCTCGGACAATGAGAGTGTGGCTTCCTGTAACTCCGTGAAAGTGAACCCAGCTGCCCAGCCTGTGTCGAGCTCAGCCCAAGCAGCCCTGCAGCCTGGGGCCAAGTACCCAGATGTGGCCTCTCCCACCCTCCGCAGACTCTTTGGTGGGAAGCCTACCAAGCAAGTGCCCATCGCCACCGCTGAAAACATGAAAAATTCGGTGGTCATCTCCAACCCTCATGCCACCATGACCCAGCAAGGTAACTTAGACTCCCCCTCAGGTAGTGGCATCCTGAGCAGTGGGAGCAGCAGCCCTCTCTACAGTAAGAACGTGGACCTCAACCAGTCTCCTCTAGCCTCCAGCCCCAGCTCGGCCCACTCGGGCCCTTCCAACAGCCTCACGTGGGGCACCACAGCCAGCAGCTCCTCGGCGGTCAGCAAGGACGGCCTGGGCTTCCAGTCAGTCAGCAGCCTGCACACCAGCTGCGAGTCCATTGACATCTCCCTTGGTAGCGGAGGGGGGCTGAGCCACAACTCCTCCACTGGCCTCCTCAGCTCCTCCAAGGATGACTCCCTGCCGCCCTTTGTGCGAACCAACAGTGTGAAGACCACACTGTCGGAAAGCCCTCTCTCTTCCCCTGCTGCTAGCCCTAAGTTCTGCAGAAGTACTCTGCCCAGGAAACAGGACAGTGACCCGCACCTTGATAGGAACACTTTGCCTAAGAAAGGACTCAGGTACCCCCCCACCTCCCAGCTGCGCACGCAGGAAGACGCAAAAGAATGGTTAAGGTCCCACTCTGCTGGAGGTCTCCAGGACACCGCTGCCAATTCCCCCTTTTCCTCCGGCTCCAGTGTAACCTCTCCCTCTGGAACAAGATTCAACTTCTCCCAGCTTGCGAGTCCCACCACTGTCACCCAGATGAGCTTGTCCAACCCCACCATGCTGCGGACCCACAGCCTGTCCAATGCGGATGGGCAGTACGACCCATACACCGACAGCCGCTTCCGGAACAGCTCCATGTCCCTGGATGAGAAGAGCAGAACCGTGAGCCGGTCGGGCTCCTTCCGGGATGGCTTTGAAGAAGTTCATGGATCCTCACTCTCCCTGGTTTCCAGCACATCCTCCATTTATTCTACACCAGAAGAAAAGTGCCAGTCGGAGATCCGCAAGCTGAGGCGGGAACTGGATGCCTCCCAGGAGAAGGTCTCAGCGTTGACCACCCAGCTGACAGCAAACGCCCACCTCGTGGCAGCCTTTGAGCAGAGTCTCGGAAACATGACCATCAGGCTCCAGAGTCTGACCATGACAGCCGAGCAGAAGGATTCAGAACTGAACGAGTTAAGAAAAACCATCGAGCTGCTAAAGAAACAGAACGCAGCTGCCCAGGCTGCCATTAATGGAGTAATTAACACTCCTGAGCTCAACTGCAAAGGAAATGGCGCCTCGCAGGCCGCAGACCTCCGCATCCGTAGACAGCACTCCTCCGACAGTGTCTCCAGCATCAACAGCGCCACCAGCCACTCTAGTGTGGGCAGCAACATCGAGAGCGACTCCAAGAAGAAGAAGAGGAAGAACTGGGTTAATGAGTTACGCAGCTCCTTCAAGCAAGCTTTTGGAAAGAAGAAGTCCCCTAAGTCGGCATCCTCTCATTCGGACATTGAGGAGATGACGGATTCTTCTTTGCCTTCCTCACCAAAGTTACCACACAACGGCTCCACAGGATCCACCCCATTGCTGAGGAATTCTCACTCCAACTCTCTAATCTCAGAGTGCATGGATAGTGAAGCTGAGACGGTCATGCAGCTCCGGAACGAGCTGAGAGACAAGGAGATGAAGCTGACAGACATCCGCCTGGAAGCCCTCAGCTCTGCCCACCAGCTCGACCAGCTCCGGGATGCCATGAATAGGATGCAGAGTGAAATCGAGAAGCTCAAAGCTGAGAATGACCGGCTGAAGTTGGAGTCTCAGGGCAGCGGCTGCAGCCGGGCACCCTCCCAGGCATCCATCTCCGTGTCCCCTCGCCAGTCGCTGGGCCTCTCCCAGCACAGCCTGAACCTCACCGAGTCGACCAGCCTGGACATGTTGCTGGATGACACTGGTGAATGCTCGGCTCGGAAGGAAGGAGGCAGGCATGTTAAGATAGTTGTCAGCTTTCAGGAGGAAATGAAGTGGAAGGAGGATTCCAGGCCACACCTCTTTCTGATCGGCTGCATTGGTGTTAGTGGCAAGACCAAGTGGGATGTGCTGGACGGGGTGGTTAGACGGCTCTTCAAAGAGTACATCATCCACGTGGACCCCGTGAGCCAGCTGGGGCTGAATTCAGACAGTGTCCTCGGCTACAGCATTGGGGAAATCAAGCGAAGCAACGGTTCTGAGACCCCCGAGCTCCTCCCCTGCGGCTACCTGGTGGGCGAGAACACTACCGTCTCCGTGAGCGTCAGAGGGCTCGCGGAAAACAGCCTGGACTCGCTGGTGTTCGAGTCCTTGATCCCCAAGCCCATCCTGCAGCGCTACGTGTCCCTGCTGGTAGAGCACCGGCGGATCATCCTCTCTGGCCCCAGCGGCACAGGCAAAACCTACCTGGCCAACCGGCTGTCAGAGTACGTGGTGCTTCGAGAGGGACGGGAGCTGACAGATGGGGTTATCGCCACCTTCAACGTGGACCATAAATCCAGCAAGGAACTGCGCCAGTACCTGTCCAACCTTGCCGACCAGTGCAACAGCGAGAACAATGCGGTGGACATGCCCCTCGTCATCATCCTGGACAACCTGCACCACGTCAGCTCCCTGGGCGAGATCTTCAACGGGCTGCTCAACTGCAAGTACCATAAATGCCCTTACATCATTGGCACAATGAACCAGGCTACCTCTTCTACTCCCAACCTGCAGCTGCATCATAACTTCAGGTGGGTGCTCTGTGCCAACCACACAGAGCCAGTGAAGGGTTTCCTCGGCCGCTTCCTGAGGAGGAAGCTCATGGAGACGGAGATCAGTGGGCGGGTGCGGAATGTGGAGCTGGTCAAGATCATCGACTGGATCCCCAAGGTCTGGCATCACCTCAACCGCTTCCTGGAGGCTCACAGCTCCTCTGACGTCACCATCGGCCCCCGGCTCTTCCTGTCATGCCCCATCGACGTGGATGGCTCAAGAGTGTGGTTCACTGACTTGTGGAACTACTCCATCATCCCCTACCTCCTAGAAGCCGTCAGAGAAGGACTCCAGCTGTATGGACGGCGCGCGCCCTGGGAGGATCCTGCCAAGTGGGTGATGGACACCTACCCGTGGGCAGCCAGCCCCCAGCAGCACGAGTGGCCTCCCCTGCTGCAGCTACGACCTGAGGATGTTGGCTTCGATGGCTACGCCGTGCCGCGGGAGGGATCCTCCAGCAAACAAGTGCCCCCCAGCGACGCTGAAGGAGACCCGCTGATGAACATGCTGATGCGGCTGCAGGAAGCAGCCAACTACTCCAGCCCCCAGAGCTACGACAGCGACTCCAACAGCAACAGCCACCATGACGACATCCTAGACTCGTCCTTGGAGTCCACTCTGTGA

XM_004851552.1 Coding sequence

Nav2 neuron navigator 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 7275 bp    Location: 11056923..11417291   Strand: +
>XM_004851552.1
ATGCCGGCCATCCTGGTAGCCTCCAAGATGAAGTCGGGACTGCCCAAACCCGTGCACAGCGCCGCGCCCATCCTGCACGTGCCCCCGGCCCGGGCTGGCCCCCAACCCTGCTACCTTAAACTGGGGAGCAAGGTGGAGGTGAGCAAGACCGCCTACCCGAGCCTGATCCCCCTGAAATCGCAGGGGCTGCAAGACCCGGCGGGGGAGGTTCTTCCGCTGCGGAACAGCGGCTCAGTGGAAAACGGGTTCGATACCCAGATCTACACGGACTGGGCCAATCACTATCTAGCCAAATCTGGCCACAAACGTCTCATCAAGGATCTCCAGCAAGATGTGACCGACGGCGTCCTCCTGGCCCAGATCATCCAGGTCGTGGCAAATGAAAAGATTGAAGACATCAATGGCTGCCCAAAGAACAGATCGCAAATGATTGAAAATATAGATGCCTGCTTGAATTTCCTGGCAGCTAAGGGAATAAACATCCAGGGGCTGTCTGCAGAAGAAATCAGGAATGGAAACCTCAAGGCCATCCTAGGCCTCTTCTTCAGCCTCTCTCGATACAAGCAGCAGCAACAGCAACCCCAGAAGCAGCACCTCTCCTCCCCCGTGCCACCTTCTGGGTGTCCTGTGGCCGGGGCCCCCTCCCAGTGCCAGGCTGGCACCACTCAGCAACAGGTGCCGGCCACCGCCCAAGCCCTGTGCCAGCCTCACCAGCCAGCGCTACTCCAGCCGTCCAAAGCACAAGCTGAAATGCAGTCCAGACTTCCAGGTCCTACCGTAAGGGTATCCACTGCAGGCAGCGAGGCCAAAACACGTGGAGGGTCAGCCACTGCTAACAACCGGCGCAGCCAGAGCTTTAACAACTATGACAAGTCCAAGCCAGTCACCTCACCACCCCCACCCCCAGCACCAAGTAGCCACGAAAAAGAACCACTGAGGAGCTCGGCCTCCGCCCACCCCGGCATGAGCGAAAATGCAGCTGCTCCCTCGGACACCAGCAGCCCCGCCGTGCCCACTAACTGCAGCGCCTCCTCCGCCATCCCGCAGCCCTCGGCCGCCAAGCCCTGGCGCAGCAAGTCCCTCAGCGTGAAGCACAGCGCCGCGGCCAGCGCCAGGCCGCCCGCGCCCGAGGCCCCCAGGCCCGCGCCCGAAGCCATGAAGCCAGCGCCCAACAATCAGAAGTCCATGCTGGAAAAGCTGAAACTCTTCAACAGCAAAGGGGGCTCCAAGGCGGGCGAGGGCCCGGGCTCCCGAGACGCGAGCTGTGAGCGGCTGGAGATCCTGCCGAGCTGCGAGGAGAACGAGGAGCTGGAGCCCGCGGGCCGCACGCTGTCCAGCGCGGGCCCCGCCTCCAGCAGCCCCAAGATCGCGCTCAAGGGCATCGCCCAGCGGACTTTCAGCCGGGCCCTGACCAACAAGAAGAGCTCCCCTAAAGGCAACGAGAAAGAGAAGGAAAAACAGCAGCGGGAGAAAGAGAAGGAGAAAGGCAAGGACCTCACCAAGAGAGCTTCGGTGACGGAAAGACCGGACCTCAAGGAGGAGCCCAGGGACGAGCCCAGTGGCGCAGCCGTGACCGAGATGCCAAAAAAGTCCTCCAAGATCGCCAGCTTCATCCCCAAGGGCGGGAAGCTGAGCAGTGCCAAGAAGGAGGCCGCCGCCCCTTCCCACAGCGGCATCCCCAAACCAGGGCCGAAGAGCACGCCCGGCAAGTCCCCGAGTGCCCCCGCGCTGCCCAAGGATGGGGAGCGGAGCCGCGGCGCCAAGCCGGGCTCGGGGCTCCCCCCGCAGAAGCCCCCGCTCGATGGCCGCCACTCCAGCTCCTCCTCCAGCCTGGCGTCCTCGGAGGGAAAAGCCCCGGGCGGGGCCACTCTGAACCACAGCATCAGCAGCCAGACCGTGAGTGGGTCCGTGGGGAGCACCCAGAGCACGGGAAGCAATACTGTCAGTGTTCAGCTACCTCAGCCTCAGCAGCAATACAGCCATCCCAACACTGCCACGGTCGCACCCTTCCTGTACAGGTCCCAGACGGACACTGAGGGGAATGTCACTGCCGAGTCCAGCCCCACAGGGATGAGCACGGAGCCCGGCCACTATACCAAGAGTGGACAGCCTGCCCTGGAGGAGTGCACGGGGGAAGACCCCGAGGCTCGGCGGCTGCGGACAGTGAAGAACATCGCTGATCTGCGGCAGAATTTGGAGGAGACCATGTCCAGTTTACGGGGAACTCAGGTGACACACAGCACATTGGAAACCACGTTTGACACCAATGTCACTACGGAGATAAGTGGCCGCAGCATCCTCAGTTTGACAGGGAGACCCACGCCTCTGTCCTGGCGACTCGGCCAGTCCAGCCCCCGGCTCCAGGCAGGAGATGCCCCCTCCATGGGCAATGGGTACCCACCTCGAGCCAACGCCAGCCGGTTCATCAGCACCGAGTCGGGCCGCTACGTGTACTCGGCACCTCTGCGAAGGCAGCTGGCCTCCCGGGGCAGCAGTGTCTGCCATGTGGACATCTCAGACAAAGCAGGGGACGAGGTGGACCTGGAAGGCATCAGCGTGGACGCCCCTGGCTACATGAGCGACGGGGATGTTCTGAGCAAGAACATCCGGAGCGACGACATCACAAGCGGGTACATGACCGATGGTGGACTGGGCCTCTACACGCGTCGCCTGAACCGGCTCCCCGACGGGATGGCGGTGGTGCGGGAGACCCTGCAGCGAAATACCTCCCTGGGCCTTGGTGACGCCGACAGCTGGGACGACAGCAGCTCCGTCAGCAGCGGCATCAGCGACACCATAGACAACCTCAGCACAGATGACATCAATACCAGCTCCTCCATCAGCTCCTACGCCAACACGCCGGCCTCCTCCCGGAAGAACTTGGATGTGCAGACTGATGCTGAGAAGCACTCGCAGGTGGAGAGGAATTCCCTGTGGTCTGGCGATGATGTCAAGAAATCCGACGGAGGGTCAGACAGCGGCATAAAGATGGAGCCAGGGGCCAAGTGGAGGCGGAACCCCTCTGATGTGTCGGATGAGTCAGACAAGAGCACATCAGGCAAGAAGCATCCGGTCATCTCGCAGACAGGCTCATGGCGGCGGGGCATGACGGCACAAGTGGGCATCACTGTGCCTCGGACGAAGCCATCCGCCCCAGCAAGTGCGCTGAAGACCCCAGGAACGGGAAAAACAGATGATGCAAAGGTGTCTGAGAAGGGAAGGCTTTCGCCCAAAGCCTCCCAGGTGAAGCGGTCCCCATCTGATGCAGGCCGCAGCAGCGGTGACGAATCCAAAAAGCCCCTACCCAGCAGCTCCAGGACACCCACCGCCAATGCCAACAGCTTTGGGTTCAAGAAGCAGAGTGGCTCAGTGGCCGGGCTGGCCATGATTACAGCCAGCGGGGCCACTGTCACTAGCAGATCAGCCACACTGGGCAAGATCCCAAAGTCATCCGCGCTCGTGGGCAGGTCCAGTGGTCGGAAGACAAGCATGGATGGGACTCAGAATCAGGACGATGGCTATCTGTCTCTCAGCTCCCGGACAAACTTGCAGTACCGGAGTCTGCCGAGGCCCAGTAAGTCCAACAGCAGAAACGGGGCTGGGAACAGGTCTAGCACCAGCAGCATCGATTCCAACATCAGCAGCAAGTCAGCGGGCCTGCCCGTGCCCAAGCTGCGGGAGCCTTCAAAAACAGCCCTGGGCAGCTCTCTGCCAGGCCTGGTCAACCAGACTGATAAGGAGAAGGGTATCTCCTCGGACAATGAGAGTGTGGCTTCCTGTAACTCCGTGAAAGTGAACCCAGCTGCCCAGCCTGTGTCGAGCTCAGCCCAAGCAGCCCTGCAGCCTGGGGCCAAGTACCCAGATGTGGCCTCTCCCACCCTCCGCAGACTCTTTGGTGGGAAGCCTACCAAGCAAGTGCCCATCGCCACCGCTGAAAACATGAAAAATTCGGTGGTCATCTCCAACCCTCATGCCACCATGACCCAGCAAGGTAACTTAGACTCCCCCTCAGGTAGTGGCATCCTGAGCAGTGGGAGCAGCAGCCCTCTCTACAGTAAGAACGTGGACCTCAACCAGTCTCCTCTAGCCTCCAGCCCCAGCTCGGCCCACTCGGGCCCTTCCAACAGCCTCACGTGGGGCACCACAGCCAGCAGCTCCTCGGCGGTCAGCAAGGACGGCCTGGGCTTCCAGTCAGTCAGCAGCCTGCACACCAGCTGCGAGTCCATTGACATCTCCCTTGGTAGCGGAGGGGGGCTGAGCCACAACTCCTCCACTGGCCTCCTCAGCTCCTCCAAGGATGACTCCCTGCCGCCCTTTGTGCGAACCAACAGTGTGAAGACCACACTGTCGGAAAGCCCTCTCTCTTCCCCTGCTGCTAGCCCTAAGTTCTGCAGAAGTACTCTGCCCAGGAAACAGGACAGTGACCCGCACCTTGATAGGAACACTTTGCCTAAGAAAGGACTCAGGTACCCCCCCACCTCCCAGCTGCGCACGCAGGAAGACGCAAAAGAATGGTTAAGGTCCCACTCTGCTGGAGGTCTCCAGGACACCGCTGCCAATTCCCCCTTTTCCTCCGGCTCCAGTGTAACCTCTCCCTCTGGAACAAGATTCAACTTCTCCCAGCTTGCGAGTCCCACCACTGTCACCCAGATGAGCTTGTCCAACCCCACCATGCTGCGGACCCACAGCCTGTCCAATGCGGATGGGCAGTACGACCCATACACCGACAGCCGCTTCCGGAACAGCTCCATGTCCCTGGATGAGAAGAGCAGAACCGTGAGCCGGTCGGGCTCCTTCCGGGATGGCTTTGAAGAAGTTCATGGATCCTCACTCTCCCTGGTTTCCAGCACATCCTCCATTTATTCTACACCAGAAGAAAAGTGCCAGTCGGAGATCCGCAAGCTGAGGCGGGAACTGGATGCCTCCCAGGAGAAGGTCTCAGCGTTGACCACCCAGCTGACAGCAAACGCCCACCTCGTGGCAGCCTTTGAGCAGAGTCTCGGAAACATGACCATCAGGCTCCAGAGTCTGACCATGACAGCCGAGCAGAAGGATTCAGAACTGAACGAGTTAAGAAAAACCATCGAGCTGCTAAAGAAACAGAACGCAGCTGCCCAGGCTGCCATTAATGGAGTAATTAACACTCCTGAGCTCAACTGCAAAGGAAATGGCGCCTCGCAGGCCGCAGACCTCCGCATCCGTAGACAGCACTCCTCCGACAGTGTCTCCAGCATCAACAGCGCCACCAGCCACTCTAGTGTGGGCAGCAACATCGAGAGCGACTCCAAGAAGAAGAAGAGGAAGAACTGGTTACGCAGCTCCTTCAAGCAAGCTTTTGGAAAGAAGAAGTCCCCTAAGTCGGCATCCTCTCATTCGGACATTGAGGAGATGACGGATTCTTCTTTGCCTTCCTCACCAAAGTTACCACACAACGGCTCCACAGGATCCACCCCATTGCTGAGGAATTCTCACTCCAACTCTCTAATCTCAGAGTGCATGGATAGTGAAGCTGAGACGGTCATGCAGCTCCGGAACGAGCTGAGAGACAAGGAGATGAAGCTGACAGACATCCGCCTGGAAGCCCTCAGCTCTGCCCACCAGCTCGACCAGCTCCGGGATGCCATGAATAGGATGCAGAGTGAAATCGAGAAGCTCAAAGCTGAGAATGACCGGCTGAAGTTGGAGTCTCAGGGCAGCGGCTGCAGCCGGGCACCCTCCCAGGCATCCATCTCCGTGTCCCCTCGCCAGTCGCTGGGCCTCTCCCAGCACAGCCTGAACCTCACCGAGTCGACCAGCCTGGACATGTTGCTGGATGACACTGGTGAATGCTCGGCTCGGAAGGAAGGAGGCAGGCATGTTAAGATAGTTGTCAGCTTTCAGGAGGAAATGAAGTGGAAGGAGGATTCCAGGCCACACCTCTTTCTGATCGGCTGCATTGGTGTTAGTGGCAAGACCAAGTGGGATGTGCTGGACGGGGTGGTTAGACGGCTCTTCAAAGAGTACATCATCCACGTGGACCCCGTGAGCCAGCTGGGGCTGAATTCAGACAGTGTCCTCGGCTACAGCATTGGGGAAATCAAGCGAAGCAACGGTTCTGAGACCCCCGAGCTCCTCCCCTGCGGCTACCTGGTGGGCGAGAACACTACCGTCTCCGTGAGCGTCAGAGGGCTCGCGGAAAACAGCCTGGACTCGCTGGTGTTCGAGTCCTTGATCCCCAAGCCCATCCTGCAGCGCTACGTGTCCCTGCTGGTAGAGCACCGGCGGATCATCCTCTCTGGCCCCAGCGGCACAGGCAAAACCTACCTGGCCAACCGGCTGTCAGAGTACGTGGTGCTTCGAGAGGGACGGGAGCTGACAGATGGGGTTATCGCCACCTTCAACGTGGACCATAAATCCAGCAAGGAACTGCGCCAGTACCTGTCCAACCTTGCCGACCAGTGCAACAGCGAGAACAATGCGGTGGACATGCCCCTCGTCATCATCCTGGACAACCTGCACCACGTCAGCTCCCTGGGCGAGATCTTCAACGGGCTGCTCAACTGCAAGTACCATAAATGCCCTTACATCATTGGCACAATGAACCAGGCTACCTCTTCTACTCCCAACCTGCAGCTGCATCATAACTTCAGGTGGGTGCTCTGTGCCAACCACACAGAGCCAGTGAAGGGTTTCCTCGGCCGCTTCCTGAGGAGGAAGCTCATGGAGACGGAGATCAGTGGGCGGGTGCGGAATGTGGAGCTGGTCAAGATCATCGACTGGATCCCCAAGGTCTGGCATCACCTCAACCGCTTCCTGGAGGCTCACAGCTCCTCTGACGTCACCATCGGCCCCCGGCTCTTCCTGTCATGCCCCATCGACGTGGATGGCTCAAGAGTGTGGTTCACTGACTTGTGGAACTACTCCATCATCCCCTACCTCCTAGAAGCCGTCAGAGAAGGACTCCAGCTGTATGGACGGCGCGCGCCCTGGGAGGATCCTGCCAAGTGGGTGATGGACACCTACCCGTGGGCAGCCAGCCCCCAGCAGCACGAGTGGCCTCCCCTGCTGCAGCTACGACCTGAGGATGTTGGCTTCGATGGCTACGCCGTGCCGCGGGAGGGATCCTCCAGCAAACAAGTGCCCCCCAGCGACGCTGAAGGAGACCCGCTGATGAACATGCTGATGCGGCTGCAGGAAGCAGCCAACTACTCCAGCCCCCAGAGCTACGACAGCGACTCCAACAGCAACAGCCACCATGACGACATCCTAGACTCGTCCTTGGAGTCCACTCTGTGA

XM_004851553.1 Coding sequence

Nav2 neuron navigator 2, transcript variant X4

Length: 5631 bp    Location: 11261611..11417291   Strand: +
>XM_004851553.1
ATGCCAAAAAAGTCCTCCAAGATCGCCAGCTTCATCCCCAAGGGCGGGAAGCTGAGCAGTGCCAAGAAGGAGGCCGCCGCCCCTTCCCACAGCGGCATCCCCAAACCAGGGCCGAAGAGCACGCCCGGCAAGTCCCCGAGTGCCCCCGCGCTGCCCAAGGATGGGGAGCGGAGCCGCGGCGCCAAGCCGGGCTCGGGGCTCCCCCCGCAGAAGCCCCCGCTCGATGGCCGCCACTCCAGCTCCTCCTCCAGCCTGGCGTCCTCGGAGGGAAAAGCCCCGGGCGGGGCCACTCTGAACCACAGCATCAGCAGCCAGACCGTGAGTGGGTCCGTGGGGAGCACCCAGAGCACGGGAAGCAATACTGTCAGTGTTCAGCTACCTCAGCCTCAGCAGCAATACAGCCATCCCAACACTGCCACGGTCGCACCCTTCCTGTACAGGTCCCAGACGGACACTGAGGGGAATGTCACTGCCGAGTCCAGCCCCACAGGGATGAGCACGGAGCCCGGCCACTATACCAAGAGTGGACAGCCTGCCCTGGAGGAGTGCACGGGGGAAGACCCCGAGGCTCGGCGGCTGCGGACAGTGAAGAACATCGCTGATCTGCGGCAGAATTTGGAGGAGACCATGTCCAGTTTACGGGGAACTCAGGTGACACACAGCACATTGGAAACCACGTTTGACACCAATGTCACTACGGAGATAAGTGGCCGCAGCATCCTCAGTTTGACAGGGAGACCCACGCCTCTGTCCTGGCGACTCGGCCAGTCCAGCCCCCGGCTCCAGGCAGGAGATGCCCCCTCCATGGGCAATGGGTACCCACCTCGAGCCAACGCCAGCCGGTTCATCAGCACCGAGTCGGGCCGCTACGTGTACTCGGCACCTCTGCGAAGGCAGCTGGCCTCCCGGGGCAGCAGTGTCTGCCATGTGGACATCTCAGACAAAGCAGGGGACGAGGTGGACCTGGAAGGCATCAGCGTGGACGCCCCTGGCTACATGAGCGACGGGGATGTTCTGAGCAAGAACATCCGGAGCGACGACATCACAAGCGGGTACATGACCGATGGTGGACTGGGCCTCTACACGCGTCGCCTGAACCGGCTCCCCGACGGGATGGCGGTGGTGCGGGAGACCCTGCAGCGAAATACCTCCCTGGGCCTTGGTGACGCCGACAGCTGGGACGACAGCAGCTCCGTCAGCAGCGGCATCAGCGACACCATAGACAACCTCAGCACAGATGACATCAATACCAGCTCCTCCATCAGCTCCTACGCCAACACGCCGGCCTCCTCCCGGAAGAACTTGGATGTGCAGACTGATGCTGAGAAGCACTCGCAGGTGGAGAGGAATTCCCTGTGGTCTGGCGATGATGTCAAGAAATCCGACGGAGGGTCAGACAGCGGCATAAAGATGGAGCCAGGGGCCAAGTGGAGGCGGAACCCCTCTGATGTGTCGGATGAGTCAGACAAGAGCACATCAGGCAAGAAGCATCCGGTCATCTCGCAGACAGGCTCATGGCGGCGGGGCATGACGGCACAAGTGGGCATCACTGTGCCTCGGACGAAGCCATCCGCCCCAGCAAGTGCGCTGAAGACCCCAGGAACGGGAAAAACAGATGATGCAAAGGTGTCTGAGAAGGGAAGGCTTTCGCCCAAAGCCTCCCAGGTGAAGCGGTCCCCATCTGATGCAGGCCGCAGCAGCGGTGACGAATCCAAAAAGCCCCTACCCAGCAGCTCCAGGACACCCACCGCCAATGCCAACAGCTTTGGGTTCAAGAAGCAGAGTGGCTCAGTGGCCGGGCTGGCCATGATTACAGCCAGCGGGGCCACTGTCACTAGCAGATCAGCCACACTGGGCAAGATCCCAAAGTCATCCGCGCTCGTGGGCAGGTCCAGTGGTCGGAAGACAAGCATGGATGGGACTCAGAATCAGGACGATGGCTATCTGTCTCTCAGCTCCCGGACAAACTTGCAGTACCGGAGTCTGCCGAGGCCCAGTAAGTCCAACAGCAGAAACGGGGCTGGGAACAGGTCTAGCACCAGCAGCATCGATTCCAACATCAGCAGCAAGTCAGCGGGCCTGCCCGTGCCCAAGCTGCGGGAGCCTTCAAAAACAGCCCTGGGCAGCTCTCTGCCAGGCCTGGTCAACCAGACTGATAAGGAGAAGGGTATCTCCTCGGACAATGAGAGTGTGGCTTCCTGTAACTCCGTGAAAGTGAACCCAGCTGCCCAGCCTGTGTCGAGCTCAGCCCAAGCAGCCCTGCAGCCTGGGGCCAAGTACCCAGATGTGGCCTCTCCCACCCTCCGCAGACTCTTTGGTGGGAAGCCTACCAAGCAAGTGCCCATCGCCACCGCTGAAAACATGAAAAATTCGGTGGTCATCTCCAACCCTCATGCCACCATGACCCAGCAAGGTAACTTAGACTCCCCCTCAGGTAGTGGCATCCTGAGCAGTGGGAGCAGCAGCCCTCTCTACAGTAAGAACGTGGACCTCAACCAGTCTCCTCTAGCCTCCAGCCCCAGCTCGGCCCACTCGGGCCCTTCCAACAGCCTCACGTGGGGCACCACAGCCAGCAGCTCCTCGGCGGTCAGCAAGGACGGCCTGGGCTTCCAGTCAGTCAGCAGCCTGCACACCAGCTGCGAGTCCATTGACATCTCCCTTGGTAGCGGAGGGGGGCTGAGCCACAACTCCTCCACTGGCCTCCTCAGCTCCTCCAAGGATGACTCCCTGCCGCCCTTTGTGCGAACCAACAGTGTGAAGACCACACTGTCGGAAAGTGACCCGCACCTTGATAGGAACACTTTGCCTAAGAAAGGACTCAGGTACCCCCCCACCTCCCAGCTGCGCACGCAGGAAGACGCAAAAGAATGGTTAAGGTCCCACTCTGCTGGAGGTCTCCAGGACACCGCTGCCAATTCCCCCTTTTCCTCCGGCTCCAGTGTAACCTCTCCCTCTGGAACAAGATTCAACTTCTCCCAGCTTGCGAGTCCCACCACTGTCACCCAGATGAGCTTGTCCAACCCCACCATGCTGCGGACCCACAGCCTGTCCAATGCGGATGGGCAGTACGACCCATACACCGACAGCCGCTTCCGGAACAGCTCCATGTCCCTGGATGAGAAGAGCAGAACCGTGAGCCGGTCGGGCTCCTTCCGGGATGGCTTTGAAGAAGTTCATGGATCCTCACTCTCCCTGGTTTCCAGCACATCCTCCATTTATTCTACACCAGAAGAAAAGTGCCAGTCGGAGATCCGCAAGCTGAGGCGGGAACTGGATGCCTCCCAGGAGAAGGTCTCAGCGTTGACCACCCAGCTGACAGCAAACGCCCACCTCGTGGCAGCCTTTGAGCAGAGTCTCGGAAACATGACCATCAGGCTCCAGAGTCTGACCATGACAGCCGAGCAGAAGGATTCAGAACTGAACGAGTTAAGAAAAACCATCGAGCTGCTAAAGAAACAGAACGCAGCTGCCCAGGCTGCCATTAATGGAGTAATTAACACTCCTGAGCTCAACTGCAAAGGAAATGGCGCCTCGCAGGCCGCAGACCTCCGCATCCGTAGACAGCACTCCTCCGACAGTGTCTCCAGCATCAACAGCGCCACCAGCCACTCTAGTGTGGGCAGCAACATCGAGAGCGACTCCAAGAAGAAGAAGAGGAAGAACTGGTTACGCAGCTCCTTCAAGCAAGCTTTTGGAAAGAAGAAGTCCCCTAAGTCGGCATCCTCTCATTCGGACATTGAGGAGATGACGGATTCTTCTTTGCCTTCCTCACCAAAGTTACCACACAACGGCTCCACAGGATCCACCCCATTGCTGAGGAATTCTCACTCCAACTCTCTAATCTCAGAGTGCATGGATAGTGAAGCTGAGACGGTCATGCAGCTCCGGAACGAGCTGAGAGACAAGGAGATGAAGCTGACAGACATCCGCCTGGAAGCCCTCAGCTCTGCCCACCAGCTCGACCAGCTCCGGGATGCCATGAATAGGATGCAGAGTGAAATCGAGAAGCTCAAAGCTGAGAATGACCGGCTGAAGTTGGAGTCTCAGGGCAGCGGCTGCAGCCGGGCACCCTCCCAGGCATCCATCTCCGTGTCCCCTCGCCAGTCGCTGGGCCTCTCCCAGCACAGCCTGAACCTCACCGAGTCGACCAGCCTGGACATGTTGCTGGATGACACTGGTGAATGCTCGGCTCGGAAGGAAGGAGGCAGGCATGTTAAGATAGTTGTCAGCTTTCAGGAGGAAATGAAGTGGAAGGAGGATTCCAGGCCACACCTCTTTCTGATCGGCTGCATTGGTGTTAGTGGCAAGACCAAGTGGGATGTGCTGGACGGGGTGGTTAGACGGCTCTTCAAAGAGTACATCATCCACGTGGACCCCGTGAGCCAGCTGGGGCTGAATTCAGACAGTGTCCTCGGCTACAGCATTGGGGAAATCAAGCGAAGCAACGGTTCTGAGACCCCCGAGCTCCTCCCCTGCGGCTACCTGGTGGGCGAGAACACTACCGTCTCCGTGAGCGTCAGAGGGCTCGCGGAAAACAGCCTGGACTCGCTGGTGTTCGAGTCCTTGATCCCCAAGCCCATCCTGCAGCGCTACGTGTCCCTGCTGGTAGAGCACCGGCGGATCATCCTCTCTGGCCCCAGCGGCACAGGCAAAACCTACCTGGCCAACCGGCTGTCAGAGTACGTGGTGCTTCGAGAGGGACGGGAGCTGACAGATGGGGTTATCGCCACCTTCAACGTGGACCATAAATCCAGCAAGGAACTGCGCCAGTACCTGTCCAACCTTGCCGACCAGTGCAACAGCGAGAACAATGCGGTGGACATGCCCCTCGTCATCATCCTGGACAACCTGCACCACGTCAGCTCCCTGGGCGAGATCTTCAACGGGCTGCTCAACTGCAAGTACCATAAATGCCCTTACATCATTGGCACAATGAACCAGGCTACCTCTTCTACTCCCAACCTGCAGCTGCATCATAACTTCAGGTGGGTGCTCTGTGCCAACCACACAGAGCCAGTGAAGGGTTTCCTCGGCCGCTTCCTGAGGAGGAAGCTCATGGAGACGGAGATCAGTGGGCGGGTGCGGAATGTGGAGCTGGTCAAGATCATCGACTGGATCCCCAAGGTCTGGCATCACCTCAACCGCTTCCTGGAGGCTCACAGCTCCTCTGACGTCACCATCGGCCCCCGGCTCTTCCTGTCATGCCCCATCGACGTGGATGGCTCAAGAGTGTGGTTCACTGACTTGTGGAACTACTCCATCATCCCCTACCTCCTAGAAGCCGTCAGAGAAGGACTCCAGCTGTATGGACGGCGCGCGCCCTGGGAGGATCCTGCCAAGTGGGTGATGGACACCTACCCGTGGGCAGCCAGCCCCCAGCAGCACGAGTGGCCTCCCCTGCTGCAGCTACGACCTGAGGATGTTGGCTTCGATGGCTACGCCGTGCCGCGGGAGGGATCCTCCAGCAAACAAGTGCCCCCCAGCGACGCTGAAGGAGACCCGCTGATGAACATGCTGATGCGGCTGCAGGAAGCAGCCAACTACTCCAGCCCCCAGAGCTACGACAGCGACTCCAACAGCAACAGCCACCATGACGACATCCTAGACTCGTCCTTGGAGTCCACTCTGTGA

XM_004851539.1 Coding sequence

Ptpn5 protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched), transcript variant X2

Length: 1887 bp    Location: 10179869..10147840   Strand: -
>XM_004851539.1
ATGAGCAGGGCCTGGGGTCACGGGCCGCGTGTCCCACCTTCCGCAGGTCTTCCCCAGCCGATAGTGATGGAGGCGCTGGACAAGGCCAAAGGGCACCCTGACACACAGAGAGAGATGCCACCGCCCTCTCCACCCTCAGAGCCTGCTCAGAAACCGCCACCTCAAGGCGCTGGGAGCCACTCCCTCACTGTCAGGAGCAGCCTGTGCCTGTTCGCTGCCTCACAGTTCCTGCTTGCCTGCGGGGTGCTCTGGTTCAGCGGCTATGGCCACATCTGGTTGCAGAATGCCACAGACCTCCTCTGCACCTCGCTCACACTCCTGACACAGCTGGGACCCACGGCTTCGCTGGGCACCAGAACCTGGGGCATCCCCAGTCTGCTGCTGGTCTCTCTGTCTGTGGGCCTGGTCCTGGTCACCACCACCTTGCTGTGGCACGTCCTGAAGCCCCCCCCAGAGGCACCCAGCCTGCTGCCCCCAGAGGACAGGCGCCAGTCGGTGAGCCGCCAGCCCTCCTTCACCTACTCGGAGTGGATGGAGGACAAGGTGGAGGATGACTTCCTGGACCTGGACCCTGTGCCCGAGACGCCTGTGTTTGACTGCGTGATGGACATCAAGCCTGAGGCTGACCCCACCTCGCTGACCGTCAAGTCCATGGGTCTGCAGGAGAGGCGGGGCTCCAATGTCTCCCTGACCCTTGACATGTGCACCCCGGGCTGCAATGAGGAGGGCTTTGGCTACCTCGTGTCACCTCGCGAGGAGCTGGCCCACGAGTACCTGCTCAGCGCCTCCCGCGTCCTTCGAGCTGAGGAACTGCACGAAAAGGCCCTGGACCCCTTCCTGCTGCAGGCCGAGTTCTTTGAAATCCCCATGAACTTCGTGGATCCGAAAGAGTATGACATCCCTGGGCTGGTTCGGAAGAACCGGTACAGAACCATCCTTCCCAATCCCCACAGCAGAGTGTGTCTGACCTCACCAGACCCCGAGGACCCTCTGAGTAGCTACATCAACGCCAACTACATCCGGGGCTACCGTGGGGAGGAGAAGGTGTACATCGCCACGCAGGGACCCATTGTCAGCACGGTGGCTGACTTCTGGCGCATGGTGTGGCAGGAGCACACGCCCATCATCGTCATGATCACCAACATCGAGGAGATGAACGAGAAATGCACCGAGTACTGGCCGGAGGAGCAGGTGGTGTACGACGGCGTGGAAATCACCGTGCAGAAGGTCATTCACACCGAGGATTACCGGCTGCGGCTCATCTCCCTCAGGAGTGGGACTGAAAAACGGGGCCTGAAGCACTACTGGTTCACATCCTGGCCCGACCAGAAGACCCCAGACCGGGCACCCCCCCTCCTCCACCTGGTGCGGGAGGTGGAGGAGGCAGCCCAGCAGGAGGGGCCCCGCTGCGCCCCCATCATCGTGCACTGCAGCGCAGGGATTGGGAGGACCGGCTGCTTCATTGCCACCAGCATCTGCTGCCAGCAGCTGCGGCACGAGGGCGTGGTGGACATCCTGAAGACCACGTGCCAGCTCCGGCAGGACAGGTCAGCCCACGGTGGGGGTGGCAGCAGGGGGTCTGACGAGTGCACGGGTGAGGGGCAGACGTGGTGGTTCGCGAAGGGCCAGGGTCCAGACAGTTCCTCTTCCGGAAGGAGAGGGGAGACGGAGCTGGTGGGCAGAGGGCCAGAGGGCAGAGGCTGGCCAGGGTTGTCTCAACGTTGCACAAGGACAAGGCCCCCAGCGTCTCTCCGGGGTGACTGGTACTCTTGGGTGTGGGGCCCCTCCTGCAACCCACCCCCACTGTGCATCTCTGCTGGGCAGGGGTGGCATGATCCAGACATGCGAGCAGTACCAGTTTGTGCACCACGTCATGAGCCTCTATGA

XM_004851540.1 Coding sequence

Ptpn5 protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched), transcript variant X3

Length: 1866 bp    Location: 10192096..10147840   Strand: -
>XM_004851540.1
ATGTGCTGCAGTGAGAGGCTGTCGGGTCTTCCCCAGCCGATAGTGATGGAGGCGCTGGACAAGGCCAAAGGGCACCCTGACACACAGAGAGAGATGCCACCGCCCTCTCCACCCTCAGAGCCTGCTCAGAAACCGCCACCTCAAGGCGCTGGGAGCCACTCCCTCACTGTCAGGAGCAGCCTGTGCCTGTTCGCTGCCTCACAGTTCCTGCTTGCCTGCGGGGTGCTCTGGTTCAGCGGCTATGGCCACATCTGGTTGCAGAATGCCACAGACCTCCTCTGCACCTCGCTCACACTCCTGACACAGCTGGGACCCACGGCTTCGCTGGGCACCAGAACCTGGGGCATCCCCAGTCTGCTGCTGGTCTCTCTGTCTGTGGGCCTGGTCCTGGTCACCACCACCTTGCTGTGGCACGTCCTGAAGCCCCCCCCAGAGGCACCCAGCCTGCTGCCCCCAGAGGACAGGCGCCAGTCGGTGAGCCGCCAGCCCTCCTTCACCTACTCGGAGTGGATGGAGGACAAGGTGGAGGATGACTTCCTGGACCTGGACCCTGTGCCCGAGACGCCTGTGTTTGACTGCGTGATGGACATCAAGCCTGAGGCTGACCCCACCTCGCTGACCGTCAAGTCCATGGGTCTGCAGGAGAGGCGGGGCTCCAATGTCTCCCTGACCCTTGACATGTGCACCCCGGGCTGCAATGAGGAGGGCTTTGGCTACCTCGTGTCACCTCGCGAGGAGCTGGCCCACGAGTACCTGCTCAGCGCCTCCCGCGTCCTTCGAGCTGAGGAACTGCACGAAAAGGCCCTGGACCCCTTCCTGCTGCAGGCCGAGTTCTTTGAAATCCCCATGAACTTCGTGGATCCGAAAGAGTATGACATCCCTGGGCTGGTTCGGAAGAACCGGTACAGAACCATCCTTCCCAATCCCCACAGCAGAGTGTGTCTGACCTCACCAGACCCCGAGGACCCTCTGAGTAGCTACATCAACGCCAACTACATCCGGGGCTACCGTGGGGAGGAGAAGGTGTACATCGCCACGCAGGGACCCATTGTCAGCACGGTGGCTGACTTCTGGCGCATGGTGTGGCAGGAGCACACGCCCATCATCGTCATGATCACCAACATCGAGGAGATGAACGAGAAATGCACCGAGTACTGGCCGGAGGAGCAGGTGGTGTACGACGGCGTGGAAATCACCGTGCAGAAGGTCATTCACACCGAGGATTACCGGCTGCGGCTCATCTCCCTCAGGAGTGGGACTGAAAAACGGGGCCTGAAGCACTACTGGTTCACATCCTGGCCCGACCAGAAGACCCCAGACCGGGCACCCCCCCTCCTCCACCTGGTGCGGGAGGTGGAGGAGGCAGCCCAGCAGGAGGGGCCCCGCTGCGCCCCCATCATCGTGCACTGCAGCGCAGGGATTGGGAGGACCGGCTGCTTCATTGCCACCAGCATCTGCTGCCAGCAGCTGCGGCACGAGGGCGTGGTGGACATCCTGAAGACCACGTGCCAGCTCCGGCAGGACAGGTCAGCCCACGGTGGGGGTGGCAGCAGGGGGTCTGACGAGTGCACGGGTGAGGGGCAGACGTGGTGGTTCGCGAAGGGCCAGGGTCCAGACAGTTCCTCTTCCGGAAGGAGAGGGGAGACGGAGCTGGTGGGCAGAGGGCCAGAGGGCAGAGGCTGGCCAGGGTTGTCTCAACGTTGCACAAGGACAAGGCCCCCAGCGTCTCTCCGGGGTGACTGGTACTCTTGGGTGTGGGGCCCCTCCTGCAACCCACCCCCACTGTGCATCTCTGCTGGGCAGGGGTGGCATGATCCAGACATGCGAGCAGTACCAGTTTGTGCACCACGTCATGAGCCTCTATGA

XM_004851523.1 Coding sequence

Saa4 serum amyloid A4, constitutive, transcript variant X4

Length: 360 bp    Location: 9745282..9737499   Strand: -
>XM_004851523.1
ATGAGGCTCTGCATTGGCATTGTCCTCTGCTCCTTGGTCCTGGGAGTCAGCAGTGATGGCTGGTACTCCTTCTTCAAGGAGGCTGCCCAAGGGTCTTGGGACATGTGGAGAGCCTACTGGAACTTGCAAGTAGCCAGTTACCCAAATTCAGAGAGATACTTCCATGCGCGGGGGAACTATGATGCTGCCCAAAGGGGACCTGGTGGGGTCTGGGCTGCGAAAGTGCTCAGGCTCCCAGGGTTGGGGTGGTCTGCAGAGCCAGAGCAGGACTTGCAGGGACATGTCTTCTCTCACCCCCAAAGAAAAACAATGCCGGGAAGTACCTTCAGGGCATCTCAAACCGGTTTTATTATGGAATGA

XM_004851524.1 Coding sequence

LOC101713351 serum amyloid A-3 protein-like

Length: 432 bp    Location: 9753349..9754313   Strand: +
>XM_004851524.1
TATCATGAACCCAGCGAGACAAAAAGGAAAGGGATATTTCTTTATTTCTCTGGCCTTTGTCAAAGCCTGAAGTCTTTGGAGTCCGTTGTAGAAAATCGTTTATTCCCCTGTTTTGCCGAGGCATGGTCGTCTTCAACATTCTCTTTTTCCCCAGGGACTAGAGACATGTGGCGAGCCTACCGGGACATGAGAGAAGCCAATTACAAAAATTCAGACAAATACTTCCATGCCCGGGGGAACTACGATGCTGCCAAACGGGGACCTGGCGGTGCCTGGGCTGCTAAAGTGATCAGTGACACCAGGGAAGGTATTCAGAGATTAACGGGCCATGGAGCAGAAGACTCGAGGGCTGACCAGTTTGCCAATGAATGGGGCCGGAGTGGCAAAGACCCCAACCACTTCCGGCCTGCAGGTCTGCCTAGCAAGTACTGA

XM_004851401.1 Coding sequence

LOC101701729 SPRY domain-containing protein 7-like, transcript variant X1

Length: 585 bp    Location: 1568939..1568284   Strand: -
>XM_004851401.1
ATGGGAGCTTCAGTGTTATGCTGCCTGCGATGCTGCAGGGATGGCAGGACCGGCCACATTCCTCAGGAGATGCCAGCCATGCAGCTGGACACGCAGCACATGGCAACAGATGTTGTCATTGTAAAAAACAGAAGAAGAATATGTGGAACAGGAGGTTGTTTAGCCAATGCACCTTTGCATCAAAACAAAAGCTATTTTGCATTCAAAATCCAATCCACAGGAATCTGGGGTATTGGTGTTGCAACTCAGGTTAACCTCAATCAGATTCCTCTTGGCCAAGACATGCATAGTCTTGTGATGAGAAACGATGGAGCCCTGTATCACAACAACGAAGAGAAAAATAGGCTACTAGCGAATAGCCTTCCACAGGAGGGAGATATGGCGGGTATTACACATGACCATGTAGAATTAAATGTATATTTGAATGGAAAAAACATGCATTGTCCACCATCAGGCATACGAGGGACAGTGTATCCAGTTGTTTATGTTGATGACAGCGCAATTTTGGATTGCCAGTTCAGTGAATTTTATCATACTCCTCCACCTGGTTTTGAAAAAATACTATTTGAACAGCAGATCTTTTGA

XM_004851494.1 Coding sequence

Pik3c2a phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha, transcript variant X1

Length: 5055 bp    Location: 8834853..8701642   Strand: -
>XM_004851494.1
ATGGCTCAGATATCAAGCAACAATGGATTTAAACAGTGTTCATCTTCCCATCTGGATCCAACAAGAACAAAAGAAGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCAAAACTGCAGAAGGATAGACAAGTGACTGACAGTCAAAGAAGCTTTGAGTGGTCAAGCAGCACCAGACAAAAAGCACAAGTTTTAAACAAACAGGATTATGATCTTATGGTGTTTCCTGAATCAGAGTCCCACCAGAGAGCAGTTGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTTGAGAGACTATTATTGGATGATGGTTTTGAGACTAGAAGAACACCTGTGTTGCCCGTTACTCCTGTTCTGAGCCCTTCATTTTCAGCACAGCTCTATCTTAGACCTACTATTCAGAGAGGACCATGGCTACCTGGATTATCTGGGCCTTCCACTTACACTTCTATTTATCCCTCAACTTACAGTAAACAGGCTGCATTCCAGAATGGCTTCAATCCAAGGATGCCTACTTTTCCATCTACTGAACCTATATATTTAAGACTTCCCGGACAGACTCCATATTTTTCGTATCCTTTGACACCTACCACCCCCTTTCATCCACAAGGAAGCTTACCAATCTATGGTCCAGTAGTCAGTCCTGACATGGCAAAACTATTTGACAAAATAGCCAGTACATCCGAATTTTTAAAAAATGGCAAAGCAAGGACTGATTTGGAGATAACAAATTCAAAAGCTACTGTCAACAATCTACAGGTATCTCCAGAGACTGAGGATATTAGTAAATTTGACTGGCTAGACTTGGATCCTCTAAGTAAGCCGAAGGTGGACAATGTGGAAGTACTAGACCAGGAAGAATACAAACATGTTCCAAGTTTGCTAGCAGAGGATCCTTGGGATGCTGTTCTTCTAGAAGTGAGATCACCTGCAAGTGGTCACCTCGAAAGAAAGATGAATGGAAAATCTTTTTCTGGGGCAACTGTAACAAGAAGCCAGTCTTTAAATATTCGAACAACTCACCTTACGGAAGTCCAGGGCCAAATACCTCAGAAAGACTCACCTGGGACCAATAGTTTGCCAACTGGAAGTTCTCTTCTACAACAAATTGAAGTACAGAATGAGGAGATGACAGCTTTTTGTCAATCCATTGCAAAATTGAAGAACAAATTTCCATACTTCAATCATTGCACAAATCCAGGCTATTTGTTAAGTCCAGTCACAGTGCAAAGAAATGTATGTGGAGAAAATGCTAGTGTGAAGGTCTCCATTGAAATTGAAGGATTTCAACTACCTGTTACTTTCACATGTGATGTGAGTTCCACAGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTTCATGATGACTTGAATCAAGTAGATGTTGGCAGCTATGTCCTGAAAGTTTGTGGTCAAGAGGAGGTGCTGCAGAACAACCATTGCCTTGGAAGTCATGAACATATTCAAAACTGTCGAAAATGGGACACAGAGATTAAATTACAACTCTTGACCTTCAGTGCAATGTGCCAGAATCTAGCCAGAACAGCAGAAGATGATGAAACACCCGTGGATTTAAACAAATACCTGTATCAAATAGAAAAACCTTATAAAGAAGTCATGACAAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAAGTGGAACTGGCTCTTCAAATTGAAAACCAGTACCGAGCTGTAGATCAAGTAATTAAAGCTGTAAGAAAAATCTGTAGTGCTTTAGATGGTGTAGAGACTCCTGCCATTACAGAATCAATAAAGAAGCTAAAGAGAGCAGTTAACCTTCCAAGGAGTAAAAGTGCTGATGTGACTTCACTATCTGGAGGAGATACTAGCAAAAGCTCAACTGGAGGCTCCCTGAATCTTGAAAATCCTGTTCAAGTGAGCATGGACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTTCATGCAAATTCTGTTAGGAGTCCTGAAGACTGTACTCACAGTAGGAACATCAAGGAAGCGTGGACCACCGCAGACCAGCTCCAGTTTACTATTTTTGCTGTACATGGAATTTCAAGTAACTGGATATCAAATTATGAGAAATACTACTTGATATGTTCCCTATCACACAATGGAAAGGATCTTTTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAGAAATTTCTTCTATCTTATTAAATGGGATGAACTAATTATTTTTCCCATCCAGATATCACAATTGCCATTAGAATCACTTCTTCATCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAGCAGAGGAAGGGCCCAGAAGCTTTGGGCAGAGTTTCTTTGCCTCTTTTTGACTTTAAACGGTTTTTAACGTGTGGAACTAAACTTCTATATCTTTGGACCTCTTCGCATACAAATCCTAGTCCTGGAACAATCCCCAAAAAAGGATGTGTCATGGAAAGAATAGTACTACAGGTTGATTTTCCTTCTCCTACGTTTGATATTATTTACACAACTCCTCAAGTTGACAGAGGCATTATACAGCAATACAACTTAGAAACACTGGAAAATGATATAAAAGAAAAACTTCTTGATATTCTTCACAGAGACTCATCACTTGGGCTTTCTAAAGAAGATAAAGCCTTTCTGTGGGAGAAACGGTATTACTGCTTCAAACACCCAAATTGTCTTCCTAAAATACTAGCAAGTGCCCCAAACTGGAAATGGGTTAATCTTGCCAAAACCTACTCATTGCTTTACCAGTGGCCTCCATTGTATCCACTGGCTGCATTGGAGCTTCTTGATTCAAAATTTGCTGATCAGGAAGTGAGAACCCTAGCTATGACCTGGATTGAGGCCATTAGTGATGATGAGCTGACAGATCTCCTTCCACAGTTCGTGCAAGCTTTGAAATACGAAATTTACTTGAATAGTTCATTAGTGCACTTCCTTCTGTCCCGGGCATTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGATACCCAGTTTGGTACCCGATATGAACATGTGTTGGGTGCTCTCCTCTCAATAGGAGGGAAAAGACTCAGAGAAGAACTTTCTAAGCAGACGAAATTTGTACAACTACTAGGTGGAGTAGCAGAAAAAGTAAAGCAGGCTAGTGGATCAGCCAGACAGGTTGTCCTCCAAAGGAGTATGGAAAGAGTACAGTCCTTTTTCTTGAGAAATAGATGCCGTCTCCCTCTCAAGCCAAGTCTGGTGGCAAAAGAGTTAAATATTAAGTCATGTTCCTTCTTCAGTTCTAATGCCGTGCCCCTAAAAGTCACCATGGTGAATGCTGATCCAATGGGGGAAGAAATTAATGTCATGTTTAAGGTTGGTGAAGATCTTAGGCAAGATATGTTGGCTTTACAGATGATAAAGATCATGGATAAGATCTGGCTTAAAGAAGGCCTTGACTTGAGGATGGTAATTTTCAGATGTCTCTCAACTGGCAGAGATCGAGGCATGGTGGAGCTAGTTCCTGCTTCAGATACCCTCAGGAAAATCCAAGTGGAATATGGTGTGACTGGATCCTTTAAAGATAAACCACTTGCTGAGTGGCTAAGGAAATATAATCCCTCTGAAGAAGAATATGAAAAGGCTTCTGAGAATTTTATCTATTCTTGTGCTGGATGCTGTGTAGCCACCTATGTTTTAGGCATTTGTGATCGACACAATGACAATATAATGCTTCGAAGTACAGGACACATGTTCCACATTGACTTTGGAAAGTTTTTGGGCCATGCACAGATGTTTGGTAGCTTTAAAAGGGATCGGGCTCCGTTTGTGCTTACCTCTGATATGGCATATGTCATTAATGGGGGAGAAAAGCCTACCATTCGTTTCCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTACAACTTGATAAGAAAGCAAGCAAACCTCTTTCTTAACCTCCTTTCACTGATGATTCCTTCAGGCTTACCAGAACTTACAAGTATTCAAGACTTGAAATATGTTAGAGATGCACTGCAACCCCAGACTACGGATGCAGAAGCTACAATTTTCTTCACTAGGCTGATTGAGTCCAGTTTGGGAAGCATTGCTACAAAGTTTAACTTTTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGTCTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCCAAAACATACTCCTTTAGACAAGATGGTCGAATCAAGGAAGTGTCTGTTTTCACATACCATAAGAAATACAACCCAGACAAACATTATATATATGTGGTGCGAATTTTGAGAGAAGGACAATTTGAACCATCATTTGTGTTCCGGACATTTGATGAATTTCAAGAACTTCATAACAAGCTCAGCATTATTTTTCCACTTTGGAAATTACCTGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCAGCCAAAAGAAAAATTGAGTTAAACAGTTATTTACAGAGTCTGATGAGAGCTTCAACAGATGTAGCAGAGTGTGATCTTGTTTGTACTTTTTTCCACCCTTTACTTCGTGATGAAAAAGCTGAAGGAATAACTAGGTCTGCAGGTGCAGGTCCCTTCAGTCCTACTGCAGGCCAAGTAGGAGGAGCAGTGAAGTTATCTATCTCTTACCGCAATGGTACTCTCTTCATCATGGTGATGCACATCAAGGATCTTGTCACTGAAGATGGGGCTGACCCAAACCCATATGTCAAAACATACCTACTTCCAGATACCCACAAAACATCCAAGCGTAAAACAAAAATTTCACGAAAAACTAGGAATCCAACATTCAATGAAATGCTTGTGTACAGTGGATATAGCCAAGAAACTCTAAGACAAAGGGAACTTCAGCTTAGCGTACTCAGCGCAGAATCTCTGCGAGAGAACTTTTTCTTGGGTGGAATAACCCTGCCTTTGAAGGATTTCAACTTGAGCAAAGAGACAGTTAAGTGGTATCAGCTTACTGCCGCAACGTACTTGTAA

XM_004851488.1 Coding sequence

LOC101699574 chromosome unknown open reading frame, human C11orf58, transcript variant X3

Length: 471 bp    Location: 8386113..8407967   Strand: +
>XM_004851488.1
ATGGGTGCAGGAAAGAAAGAACACACTGGTCGTCTTGTTATAGGAGATCACAAATCAACATCACATTTCCGAACAGGGGAAGAAGACAAGAAAATTAATGAAGAACTGGAGTCTCAATATCAGCAAAGTATGGACAGTAAATTATCAGGAAGATATCGACGACATTGTGGACTTGGCTTCAGTGAGGTAGAAGATCATGATGGAGAAGGTGATGTGGCTGCAGATGATGATGATGATGATGATGATTCACCTGATCCTGAAAGTCCAGATGATTCTGAAAGTGACTCAGAGTCAGAAAAAGAAGAATCTGCTGAAGAACTCCAAGCTACTGAGCACCCTGATGAAGTGGAAGATCCCAAAAACAAAAAAGATGCAAAAGCTTTTCTCCCACTGGAAGAAGGAAAGGCAAGACCTCTCAGCCATCCCATAACCTCTTCTGCCACGGATGACACAGCACAGAAGTCCCAATAG

XM_004851486.1 Coding sequence

LOC101699574 chromosome unknown open reading frame, human C11orf58, transcript variant X1

Length: 603 bp    Location: 8386113..8407967   Strand: +
>XM_004851486.1
ATGAGCGCTGCCAGGGAGTCTCACCCGCACGGGGTGAAGCGTTCAGCTTCCCCAGACGACGATCTTGGATCTAGCAATTGGGAGGCAGCAGACTTGGGCAGTGAAGAGAGAAAACAAAAGTTCCTCAGACTTATGGGTGCAGGAAAGAAAGAACACACTGGTCGTCTTGTTATAGGAGATCACAAATCAACATCACATTTCCGAACAGGGGAAGAAGACAAGAAAATTAATGAAGAACTGGAGTCTCAATATCAGCAAAGTATGGACAGTAAATTATCAGGAAGATATCGACGACATTGTGGACTTGGCTTCAGTGAGGTAGAAGATCATGATGGAGAAGGTGATGTGGCTGCAGATGATGATGATGATGATGATGATTCACCTGATCCTGAAAGTCCAGATGATTCTGAAAGTGACTCAGAGTCAGAAAAAGAAGAATCTGCTGAAGAACTCCAAGCTACTGAGCACCCTGATGAAGTGGAAGATCCCAAAAACAAAAAAGATGCAAAAGCTTTTCTCCCACTGGAAGAAGGAAAGGCAAGACCTCTCAGCCATCCCATAACCTCTTCTGCCACGGATGACACAGCACAGAAGTCCCAATAG

XM_004851481.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X5

Length: 2532 bp    Location: 8070351..7683495   Strand: -
>XM_004851481.1
ATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGAAAGGTCATGTCTCTCACCCACAAATTAACCCAAGGCTAAAGGGCATAAGTGACCGTTTTGGCAGGAATTTGGACACCTTTGAACATGGTGGTGGCCACTCTTACAACCACCAACAGATTGAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGGTAAATGGAAAAGTCAACACCAGGAAGAGACTTATGAATTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAAGTAAAGCAATGAATGGCTCTGCAGCTAAACTACAGCAGTATTATTGTTGGCCAACAGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851483.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X7

Length: 2508 bp    Location: 8047808..7683495   Strand: -
>XM_004851483.1
ATGCCCTCGAGTTCTGAAGTTCTGGCTGATGTGGTAAGAGAAAGCCGGATTGAAGAGTGGAAGAGCAGCCACTTCATAAGAATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGAAAGGTCATGTCTCTCACCCACAAATTAACCCAAGGCTAAAGGGCATAAGTGACCGTTTTGGCAGGAATTTGGACACCTTTGAACATGGTGGTGGCCACTCTTACAACCACCAACAGATTGAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851485.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X9

Length: 2448 bp    Location: 8047808..7683495   Strand: -
>XM_004851485.1
ATGCCCTCGAGTTCTGAAGTTCTGGCTGATGTGGTAAGAGAAAGCCGGATTGAAGAGTGGAAGAGCAGCCACTTCATAAGAATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAAGTAAAGCAATGAATGGCTCTGCAGCTAAACTACAGCAGTATTATTGTTGGCCAACAGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851477.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X1

Length: 2610 bp    Location: 8047808..7683495   Strand: -
>XM_004851477.1
ATGCCCTCGAGTTCTGAAGTTCTGGCTGATGTGGTAAGAGAAAGCCGGATTGAAGAGTGGAAGAGCAGCCACTTCATAAGAATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGAAAGGTCATGTCTCTCACCCACAAATTAACCCAAGGCTAAAGGGCATAAGTGACCGTTTTGGCAGGAATTTGGACACCTTTGAACATGGTGGTGGCCACTCTTACAACCACCAACAGATTGAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGGTAAATGGAAAAGTCAACACCAGGAAGAGACTTATGAATTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAAGTAAAGCAATGAATGGCTCTGCAGCTAAACTACAGCAGTATTATTGTTGGCCAACAGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851473.1 Coding sequence

Calca calcitonin-related polypeptide alpha, transcript variant X2

Length: 384 bp    Location: 6769230..6764302   Strand: -
>XM_004851473.1
ATGGGCTTCCAGAAGTTCTCCCCATTCCTGGCTCTCAGCATCTTAGTTCTGTACCTCTCAAGCAACCTGCATGCAGTGCCATTCAGGCAGGACTTGGAGAGCAGCCCAGTCCTGGTCGAGCTAGGTGAAGAGGAAGCGCGCCTCCTGCTGGCAGCACTGGTGCAGGACTACCTGCAGATGAAGGCCAGTGAGCTGGAGCAGGACCAGGAGACAGAGGGCTCCAGCGTCACTGCCCAGAAGAGAGCCTGCAACACCGCCACCTGTGTGACCCATCGACTGGCAGGCTTGCTGAGCAGGTCAGGGGGTGTGGTGAAGGACAACTTCGTAGCCACTGATGTGGGTTCCAAAGCCTTCGGCCGGCGCCGCAGGGACCTTGTGGCTTGA

XM_004851466.1 Coding sequence

Copb1 coatomer protein complex, subunit beta 1, transcript variant X1

Length: 2862 bp    Location: 6376605..6335063   Strand: -
>XM_004851466.1
ATGACGGCAGCTGAGAACGTGTGCTATACGTTAATTAACGTGCCAATGGATTCAGAACCACCGTCTGAAATTAGCTTAAAAAATGACCTAGAAAAAGGAGATGTGAAATCAAAGACTGAAGCTTTGAAGAAAGTAATCATTATGATCCTGAATGGTGAAAAGCTTCCTGGACTTCTGATGACCATCATTCGTTTTGTGCTACCTCTTCAGGATCACACCATCAAAAAATTGCTTCTGGTATTTTGGGAAATTGTTCCTAAAACAACTCCAGATGGGAGACTTTTACATGAAATGATTCTTGTGTGTGATGCTTACAGAAAGGATCTTCAGCATCCTAATGAATTTATTCGAGGATCTACTCTTCGTTTTCTTTGCAAATTGAAAGAAGCAGAATTGCTAGAACCTTTAATGCCAGCTATCCGCGCTTGCTTGGAACATCGACACAGCTATGTTAGAAGAAATGCTGTTTTAGCCATCTATACTATCTATAGAAATTTCGAACATCTTATACCTGATGCTCCTGAGCTGATACATGATTTTCTGGTGAATGAGAAGGATGCAAGTTGCAAAAGGAATGCATTTATGATGCTAATCCATGCAGATCAGGATCGTGCTTTGGATTACCTGAGTACTTGTATTGATCAAGTTCAAACCTTTGGAGACATTCTGCAGTTGGTTATTGTTGAACTAATTTATAAAGTCTGTCATGCTAATCCTTCAGAAAGGGCTCGTTTCATTCGCTGCATCTATAACTTACTGCAGTCATCTAGCCCAGCTGTGAAATATGAAGCTGCTGGGACATTAGTAACACTTTCAAGTGCACCGACTGCAATCAAGGCTGCTGCTCAGTGTTACATTGATTTAATCATAAAGGAAAGTGACAATAATGTAAAGCTCATAGTTCTGGATCGATTGGTAGAATTAAAAGAACATCCTCCTCATGAACGAGTCCTCCAGGATCTGGTAATGGACATCCTAAGAGTATTGAGTACACCAGACTTAGAAGTACGCAAGAAAACTCTGCAGTTAGCACTGGATCTTGTCTCTTCTAGGAATGTTGAAGAGCTGGTTATTGTCTTGAAGAAGGAAGTGATTAAAACAAATAATGTGTCTGAGCATGAAGACACTGACAAATACAGACAACTCCTTGTACGAACATTACATTCCTGTTCTGTCCGGTTTCCAGATATGGCTGGAAATGTTATTCCTGTGTTAATGGAGTTTCTCAGTGACAGTAACGAAGCGGCAGCTGCTGATGTCTTGGAATTTGTTCGAGAAGCCATTCAGCGCTTTGATAACCTGAGAATGCTGATTGTTGAGAAGATGCTTGAAGTCTTTCATGCTATTAAATCTGTCAAGATCTATCGCGGAGCATTATGGATCCTGGGAGAATACTGTAGTACCAAGGAAGACATTCAGAGTGTGATGACTGAAGTCCGCAGGTCGCTGGGGGAGATCCCAATTGTGGAGTCAGAAATAAAGAAAGAAGCTGGTGATTTAAAACCTGAAGAGGAAATAACTGTGGGGCCGGTTCAGAAATTGGTTACTGAAATGGGTACCTATGCAACTCAGAGTGCCCTCAGCAGTTCTAGACCCACCAAGAAGGAGGAAGACAGACCTCCCCTGAGAGGATTTCTTCTGGATGGAGATTTTTTTGTTGCTGCTTCTCTTGCCACAACTCTGACCAAGATTGCATTGCGCTATGTAGCTTTGGTTCAGGAGAAGAAAAAGCAAAATTCTTTTGTTGCTGAGGCTATGTTGCTCATGGCAACTGTCCTTCATTTGGGAAAATCTTCTCTTCCTAAGAAGCCAATTACAGATGATGATGTAGACCGAATTTCCCTGTGCCTCAAGGTCTTGTCCGAATGTTCGCCTTTAATGAATGACATTTTCAATAAGGAATGCAGACAGTCTCTTTCTCAAATGTTATCTGCCAAACTTGAAGAAGAGAAACTATCCCAAAAGAAAGAATCTGAAAAGAGGAATGTGACAGTACAGCCTGATGACCCCATTTCCTTCATGCAACTAACTGCTAAGAATGAAATGAACTGCAAGGAAGATCAGTTTCAGCTGAGTTTGTTGGCAGCAATGGGTAACACTCAGAGGAAAGAGGCAGCAGATCCCCTAGCGTCTAAACTTAACAAGGTCACCCAGTTGACCGGTTTCTCAGATCCTGTGTATGCAGAAGCTTACGTTCATGTCAACCAATATGATATTGTCCTGGACGTACTTGTTGTGAACCAAACCAGTGATACTTTGCAGAACTGCACATTGGAGTTAGCTACTCTAGGGGATCTGAAACTTGTGGAAAAGCCATCTCCTTTGACTCTTGCTCCTCATGATTTTGCAAATATTAAAGCTAATGTCAAAGTAGCATCAACAGAAAATGGAATAATTTTTGGTAATATAGTTTATGATGTCTCTGGAGCAGCAAGTGACAGAAATTGTGTGGTCCTCAGTGATATCCACATTGACATTATGGACTATATCCAGCCTGCAACCTGCACTGATGCTGAATTCCGTCAGATGTGGGCTGAATTTGAATGGGAAAACAAAGTGACAGTTAACACCAATATGGTTGATTTAAATGACTATTTACAGCACATATTAAAGTCAACCAACATGAAGTGCCTCACTCCAGAGAAGGCCCTTTCTGGTTACTGTGGCTTCATGGCAGCCAACCTTTATGCTCGTTCTATATTTGGAGAAGATGCACTTGCAAATGTCAGCATTGAAAAGCCAATTCACCAAGGGCCAGATGCTGCTGTTACTGGCCATATAAGAATTCGTGCAAAGAGTCAGGGAATGGCCTTAAGTCTTGGAGATAAAATCAACTTGTCTCAGAAGAAAACTAGTATATAA

XM_004851460.1 Coding sequence

Pth parathyroid hormone

High confidence: 4 potential gene matches
Length: 348 bp    Location: 5490641..5490173   Strand: -
>XM_004851460.1
ATGATGTCTGCAAAAGCCATGGCTAAAGTCATGATTGTCATGCTTGCGATTTGTTTTCTTACAAAAGCAGATGGGAAACCTATTAAGAAGAGATCTGTGAGTGAGATACAGCTTATGCACAACATGAGCAAACATCTGGCCACCAAGGCGAGGCTGGAATGGCTGCTCAAGAAGCTACAAGAGGCACACAATTTTATTAGCCTTGGAAGCTCACTCACTAACAAAGAAGGTGGTTCTCAGAGGTCCTTCAAGAAGGAAGACAATGTCCTTGTTGACAACTATCAAAAAAGTCTTGGAGAAGCAGACAAAGCTGATGTGGATGTATTAATTAAAGCTAAATCCCAGTGA

XM_004851453.1 Coding sequence

Btbd10 BTB (POZ) domain containing 10, transcript variant X1

Length: 1452 bp    Location: 5437612..5392428   Strand: -
>XM_004851453.1
ATGCCCAAGGATGCTGACCTGGCTTTCAGTGCTGCATTGTGTGAAAGAACAGAATCCCTTTATACTCTGATTTCAAAATTTTTTTCTTGTTTTTGCGTGTCTACCTTCGCATATACTAAAGGAAGTACTTCCTCACGTGTTGCTAAAGGAGGAGTAGACCACACCAAAATGAGTCTACAAGGTGCTAGTGGGGGCCAGGAGAGATCAAGAGACAGACGAAGGTCAAGTGACAGATCACGGGATTCATCTCATGAAAGAACAGAGTCTCAACTCACTCCTTGTATTAGAAATGTTACTTCTCCAACACGGCAGCACCATGTTGAAAGAGAAAAAGATCATAGTTCCTCTCGCCCAAGCAGTCCTCGTCCTCAAAAAGCATCTCCAAATGGTTCAGTTAGCAGTGCTGGGAACAGCAGCAGAAATAGTAGTCAGTCAAGTTCAGATGGTAGCTGTAAGACAACTGGGGAGATGGTATTTGTATATGAAAATGCAAAAGAAGGAGCTCGAAATGTAAGAACGTCAGAACGAGTGACATTAATAGTGGATAACACTAGATTTGTTGTAGACCCATCTATTTTTACTGCACAGCCAAATACAATGTTGGGCAGGATGTTTGGATCTGGCCGAGAACATAACTTTACACGTCCCAATGAGAAGGGAGAGTATGAGGTGGCAGAAGGGATTGGTTCCACTGTATTTCGAGCTATCCTGGATTACTATAAGACAGGAATAATTCGTTGTCCTGATGGCATATCTATTCCTGAGCTGAGAGAAGCATGCGATTATCTCTGTATTTCTTTTGAATATAGTACTATTAAATGTAGAGATCTCAGTGCCCTGATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCTAGTGCCCAGAGTGGGGAACGAGAATGTCATATAGTGGTGCTTACAGATGATGACGTGGTTGACTGGGATGAAGAGTATCCACCACAGATGGGAGAAGAATATTCACAAATTATTTATAGCACAAAATTATATAGATTTTTCAAGTATATTGAAAACAGAGATGTGGCCAAATCAGTCTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGTTATCCTACGTACAAAGAAAAAGTAAAGAAAAGGCCTGGGGGCCGCCCAGAAGTCATTTACAACTATGTTCAAAGACCCTTTATTCGAATGTCCTGGGAAAAGGAAGAAGGAAAGAGTCGGCATGTAGACTTCCAGTGTGTAAAAAGTAAATCTATCACCAACCTGGCAGCAGCTGCTGCAGACATTCCCCAGGACCAGCTGGTAGTCATGCACCCAACTCCACAGGTGGATGAGCTGGATATCCTCCCCATTCACCCCCCTTCTGGCAACAGTGACCTCGATCCTGACGCACAGAATCCAATGCTGTGA

XM_004851448.1 Coding sequence

Arntl aryl hydrocarbon receptor nuclear translocator-like, transcript variant X3

Length: 1881 bp    Location: 5317631..5391645   Strand: +
>XM_004851448.1
ATGGCAGACCAGAGAATGGACATTTCCTCCACGATCAGTGACTTCATGTCCTCCGGCCCCACTGACCTGCTCTCCAGCTCCCTGGGCGCCGGCAGCGTGGATTGCAACCGCAAGCGGAAGGGCAGCTCCACCGACTACCAAGAAAGCATGGACACAGACAAAGATGACCCTCATGGAAGGTTGGAATACACAGAACACCAAGGAAGGATAAAAAATGCAAGGGAAGCTCACAGTCAGATTGAAAAGCGGCGCAGGGATAAGATGAACAGTTTTATTGATGAGCTGGCTTCTTTGGTACCAACATGCAACGCGATGTCCAGGAAGTTAGATAAACTCACCGTGTTAAGAATGGCTGTTCAGCACATGAAAACATTAAGAGGTGCCACTAACCCGTACACAGAAGCAAACTACAAGCCAACTTTTCTATCAGACGATGAATTGAAACACCTCATTCTCAGGGCAGCAGATGGATTTTTGTTTGTCGTAGGATGTGACCGAGGGAAGATACTCTTTGTCTCAGAGTCTGTCTTCAAGATCCTCAACTACAGCCAGAATGATCTGATTGGTCAGAGTTTGTTTGATTACCTGCATCCTAAAGATATCGCCAAAGTCAAGGAGCAGCTCTCCTCCTCCGACACCGCACCCCGGGAGCGGCTCATAGATGCAAAAACTGGACTTCCAGTTAAAACAGATATAACCCCTGGGCCGTCTCGATTATGTTCTGGAGCACGACGTTCTTTCTTCTGTAGGATGAAGTGTAACAGGCCTTCAGTAAAGGTGGAAGACAAGGACTTCCCCTCCACCTGCTCAAAGAAAAAAGCAGATCGAAAAAGCTTCTGCACAATCCACAGCACAGGCTATTTGAAAAGCTGGCCCCCCACAAAGATGGGGCTGGATGAAGACAATGAACCAGACAATGAGGGGTGTAACCTCAGCTGCCTTGTTGCCATTGGACGGCTGCATTCTCACGTGGTTCCACAACCAGTGAACGGGGAAATCAGGGTGAAAGCTATGGAATATGTTTCTCGGCACGCAATAGATGGGAAGTTTGTTTTTGTAGACCAGAGGGCAACAGCTATTTTGGCATATTTACCACAAGAACTTCTAGGCACATCATGTTATGAATATTTTCATCAAGATGACATAGGACATCTTGCAGAATGTCACAGGCAAGTTCTACAGACAAGAGAAAAGATTACAACTAATTGCTATAAGTTTAAAATCAAAGATGGTTCTTTCATCACACTACGAAGTCGATGGTTCAGTTTCATGAACCCTTGGACCAAGGAAGTAGAATACATTGTCTCAACCAACACTGTTGTTTTAGCCAACGTCCTGGAAGGCGGGGACCCAACCTTCCCGCAGCTCACAGCATCCCCCCACAGCATGGACAGCATGCTGCCCTCTGGAGAAGGTGGCCCAAAGAGGACCCATCCCACTGTTCCAGGGATTCCAGGGGGAACCAGGGCTGGGGCAGGAAAAATAGGTCGAATGATTGCTGAGGAAATCATGGAAATCCACAGGATAAGAGGGTCGTCGCCTTCCAGCTGTGGTTCTAGCCCACTGAACATCACAAGTACGCCTCCCCCTGATGCCTCCTCTCCAGGAGGCAAGAAGATTTTAAATGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTACCAGGGCAGGCACAGGAGAATCCAGGCTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGCATAGACATGATAGATAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAAGCGGCAATGGCTGTCATCATGAGCCTCCTGGAAGCAGATGCTGGGCTGGGTGGCCCTGTTGACTTTAGCGACTTACCATGGCCGCTGTAG

XM_004851437.1 Coding sequence

Parva parvin, alpha, transcript variant X1

Length: 1242 bp    Location: 4390255..4544550   Strand: +
>XM_004851437.1
ATGCCTGGAATAATTCCGCTTCCGTTTGGAAAGCCGCAGCCTCAGTCCCGCCGCGTCCGCCCAGCCCCAGCCCCAGCTCCAGCTCCGCGTCCAGCTCGGCCCGCGGCCTCCGGCTCCGGCGCCATGGCCACCTCCCCGCAGAAGTCGCCTTCGGTCCCCAAGTCTCCCACCCCCAAGTCGCCCCCGTCCCGCAAGAAAGATGACTCTTTCTTGGGGAAACTCGGGGGAACCCTGGCCCGGAGGAAGAAAGCCAAGGAAGTCTCAGAGCTTCAGGAGGAGGGCATGAATGCCATCAACCTGCCCCTCAGCCCCATCCCCTTCGAGCTGGACCCTGAGGACACCATGCTGGAGGAGAATGAAGTGCGGACGATGGTAGATCCAAACTCACGCAGCGACCCCAAACTCCAAGAACTGATGAAGGTATTAATTGACTGGATCAATGATGTGCTGGTTGGAGAGAGAATCATTGTGAAAGACCTGGCTGAAGATTTATACGATGGACAAGTCCTGCAGAAGCTCTTCGAGAAACTTGAGAGCGAGAAGCTAAATGTCGCTGAGGTCACCCAGTCAGAGATTGCTCAGAAGCAAAAACTGCAGACTGTCCTGGAGAAAATCAATGAAACCCTGAAACTTCCTCCCAGGAGCATCAAGTGGAATGTGGACTCTGTTCACGCCAAAAGCCTGGTGGCCATCTTGCATCTGCTGGTAGCTCTGTCTCAGTATTTCCGGGCACCAATCCGACTCCCAGACCATGTTTCCATCCAAGTGGTTGTGGTCCAGAAACGAGAAGGAATCCTCCAGTCTCGGCAAATCCAAGAGGAAATAACTGGTAACACAGAGGCTCTTTCCGGAAGGCATGAACGCGATGCCTTCGACACCTTGTTTGACCACGCACCAGACAAACTCAACGTAGTAAAAAAGACGCTCATCACATTTGTGAACAAGCACCTGAATAAACTGAACCTGGAGGTCACGGAACTGGAAACCCAGTTTGCAGATGGCGTGTACCTGGTGCTGCTCATGGGGCTCCTGGAGGGCTACTTCGTGCCGCTGCACAGCTTCTTCCTGACTCCAGACAGCTTTGAGCAGAAGGTCTTGAACATCACCTTTGCCTTTGAGCTCATGCAAGATGGAGGGTTGGAAAAGCCAAAACCACGGCCAGAAGATATTGTCAACTGCGACCTGAAGTCCACACTGCGAGTGCTGTACAACCTCTTCACCAAGTACCGGAACGTGGAGTGA

XM_004851433.1 Coding sequence

Mical2 microtubule associated monooxygenase, calponin and LIM domain containing 2, transcript variant X3

Length: 3300 bp    Location: 4167503..4300527   Strand: +
>XM_004851433.1
ATGGGCGAGAATGAGGATGAGAAGCAGGCCCAGGCGGGGCAGGTTTTTGAGAACTTTGTCCAGGCTTCCACGTGCAAAGGCACCCTCCAGGCCTTCAACATCCTCACGCGCCACCTGGACCTAGACCCTCTGGACCACAGGAACTTCTACTCCAAGCTCAAGTCCAAGGTGACCACCTGGAAGGCCAAAGCCCTGTGGTACAAACTGGACAAGCGTGGCTCCCACAAAGAGTACAAGCGAGGGAAGGCGTGCATGAACACCAAGTGTCTCATTGTTGGCGGAGGACCCTGTGGCTTGCGCACTGCCATTGAACTCGCCTACCTGGGAGCCAAAGTGATCGTGGTAGAGAAAAGGGACACCTTCTCCCGGAACAATGTGCTGCACCTCTGGCCTTACACCATCCATGACCTGCGGGGCCTGGGAGCCAAGAAGTTCTATGGGAAGTTCTGCGCTGGCTCCATCGACCACATCAGTATTCGTCAACTGCAGCTCATCCTATTCAAGGTGGCCCTGATGTTGGGAGTTGAAATCCATGTGAATGTGGAGTTTGTGAAGGTTCTCGAACCTCCTGAAGATCAAGAAAATCAAAAAATTGGCTGGAGAGCAGAACTCCTCCCCGCAGACCACCCCCTGTCAGAGTTTGAGTTTGATGTCATCATTGGTGCTGATGGCCGCAGGAACACCCTGGAAGGGTTCAGGAGGAAGGAATTCCGCGGGAAGCTGGCCATCGCCATCACCGCCAACTTCATCAACAGGAACAGCACGGCTGAGGCCAAGGTGGAAGAGATTAGCGGGGTGGCCTTCATCTTCAATCAGAAATTCTTTCAGGACCTGAAGGAGGAAACAGGGATTGATCTAGAGAACATTGTTTACTACAAGGACTGCACCCACTATTTTGTCATGACTGCCAAGAAGCAGAGCCTGCTCGACAAAGGTGTCATCATCAATGACTACATCGACACGGAGATGCTGCTGTGTGCTGAGAACGTGAACCAGGACAACCTGCTGTCCTATGCCCGGGAAGCTGCAGACTTCGCCACCAACTACCAGCTGCCATCCTTAGACTTTGCTATGAACCACTACGGGCAGCCCGACGTGGCCATGTTTGATTTCACCTCCATGTATGCCTCAGAGAATGCTGCCCTGGTGCGCGAACGGCAGGGACACCCGCTGCTCGTGGCCCTTGTGGGCGACAGCTTGCTTGAGCCATTTTGGCCCATGGGTACAGGCTGTGCCCGTGGCTTCCTGGCGGCCTTTGACACAGCGTGGATGGTGAAGAGCTGGGACCAGGGGACTCCTGCCCTGGAAGTGCTGGCCGAAAGAGAAAGTCTTTACCGGCTGTTGCCTCAGACAACCCCGGAGAACATCAACAAGAACTTTGAGCAGTACACGCTGGACCCAGGGACGCGGTACCCAAACCTCAACTCACACTGTGTCCGGCCCCATCAGGTGAAGCATCTGTACATCACCAAGGAGCTGGACCACTACCCTCTTGAGAGACTCAACTCAATGAGGAGATCCGTCAACCTCTCCAGGCGGGAGTCAGATATCCGGCCCAGCAAGCTCTTAACCTGGTGCCAGCAGCAGACCAAGGGCTACCAGCATGTCAATGTCACTGACCTGACCACATCCTGGCGTAGCGGCCTGGCCCTCTGTGCCATCATCCACCACTTCCGGCCGGAGCTGATCAACTTTGACTCTTTGAATGAAGATGATGCTGTAAAGAACAACCAGCTGGCATTTGATGTGGCCGAACATGAGTTTGGGATCCCTCCGGTGACCACAGGCAAAGAGATGGCATCAGCCCAGGAGCCTGACAAGCTCAGCATGGTCATGTACCTCTCCAAGTTCTATGAGCTCTTCCGGGGCGCCCCGCTGCGGCCTGTGGATTCTTGGCGCAAAAGCTATGGAGAAAATGCCGACCTCAGTTTTTCCAAATCCTCCATTTCTAATAACTATCTCAACCTCACACTTCCCAGGAAAAGGACCCCTCGGGGAGATGCCCAAACGGAAGAGAACGACGTGAACAAGCGGAGGCGGAAAGGCTTCATCACCGTGGACCAGGATTGTGTGCGCAGGCTGCCAACCTTCTCCAGCCATAGTTTGGGTTCCTCTCAAGAGTGCGGCAACAGTAAGGAAGCAGGAAATCAGAACAAAGTCAAGTCCATGGCGAGTCAGCTGCTGGCCAAGTTTGAGGAGAGCACACGGAACCCCTCAGTCCTGAGGCAGGAGCGCCGTGTCTCAGGGATAGGTAACCCCGTCCTGTGCTCTTCCGCTGACCCTCCTGTAGACTCGCACTGCCCCACGCCGAAGGAGCCCACTCCCAGCCCACCGCCTCCTCTGAAAAGGCAGGTGCTCAGGGAGCTCAAGCAGGTGTCTCCTGGTGGCGAGTGTCCAAGCCGGCCCTGGAGAGCCAGGGCCAAGTCTGACCTGCAGCTCAGTGGCCCAGAAAACCTTGCCTCCCTGCCTCCCGCTTGCCAGGGGGCCCTGGCCCTCTCGGGGGTACTGCGGCGGCTACAGCAAGTGGAGGAAAAGATTCTCCAGAAGAGGTCTCAGAACTTGGCCAACAGGGAATTTCACCAAAAGAACATTAAAGAGAAAGCGGCTCACCTCGCCTCCATGTTTGGACACGGGGATTTCCCACAGAATAAACTACTCTCTAAAGGCCTGTCTCATACTCATCCTCCATCTTCTTCCTCTTGCCTTCCGTCTCCTGATCCAGCTGCTACTTCTACTCCATCAACTGTTGACTCTGCTTCTCCTGCCAGAAAGCTGACAGTAGGGAAAGTGTCCAGCGGAATAGGGGCTGCGGCTGAAGTCCTGGTCAATCTGTACTTGAATGATCACAGACCTAAGGCCCAGGCCACCTCTCCAGACCTGGAATCTATGCGGAAGACAATTCCCCTGAACCTGGGCGGCAGTGACACCTGCTACTTCTGTAAGAAGCGTGTGTATGTGATGGAGCGGCTGAGTGCTGAGGGCCACTTCTTCCACCGAGAGTGCTTCCGCTGCAGCATCTGTGCCACTACCTTGCGCCTGGCCACCTACGCCTTTGACTGTGAAGAAGGCAAGTTTTACTGCAAGCCTCATTTTATTCACTGTAAAACCAACAGCAAACAACGGAAGAGATGGACAGAGTTGAAGCAAGAAAGAGAGGAGGAGAGGACGTGGCAAGAGCCAGAAGCCCCTCGGCGAGATGCTGCCACGGAAAGCTCTTGCGCAGTGGCTGCCATCAGCACAGCAGAAGGCAGCCCTCCAGTTCATTTCAGCCTTCCAGTACTACACCCACTCCTTGGCTGA

XM_004851430.1 Coding sequence

LOC101712505 cellular nucleic acid-binding protein-like

Length: 510 bp    Location: 4244980..4245489   Strand: +
>XM_004851430.1
ATGAGTGGTAAAGAATGCTTCAAGTGTGGACGCTCTGGACACTGGGCCCGGGAATGCCCTAAAGGAGGAGCTCGAGGGAGAAGACCTAGAAGCCGTGGCAGAGGTCCGCAGTGCAGTTCCACCGCCCAACCTGACATCTGTTACTGCTGTGGTGTAGCTGGTCACCATGCCAAGAATTGTAACCTTCAGGACATCTGCTACAACTGCAGGAAAAGTGGCCACATCGCCAAAGACTGTCCTGAGCCTAAACAAGAGAAAGACCAATGCTGTTACACCTGCGGCAGACCAGGCCATCTGGCTCGTGATTGTGACCGTCGGGAAGGGCAGAAATGCTACTTTTGCGGCGAAATTGGGCATATCCAGAAAGACTGCTCCCAAATCAAGTGCTGCCGGTGTAGTGAGACGGGCCACATGGCCATGAACTGCAACAAGGCGAGCGAAGTCAACTACTACCACTGTGGAGAGTATGGACATCTAGCCCGAGAATGCCCCGTTGAGGCCACAGCTTAG

XM_004851419.1 Coding sequence

Rnf141 ring finger protein 141, transcript variant X1

Length: 693 bp    Location: 2611857..2589806   Strand: -
>XM_004851419.1
ATGGGACAGCAAATTTCGGATCAGACACAGCTGGTTATTAACAAGTTACCAGAAAAAGTAGCAAAACATGTCACACTGGTTCGAGAAAGTAGCTCCTTAACTTACGAAGAATTTCTTGGGAGAGTAGCCGAACTCAATGATGTAACTGCTAAAGTGGCTGCTGGCCAGGAAAAACATCTTCTCTTTGAGGTACAACCTGGTTCTGATTCCTCTGCCTTTTGGAAAGTGGTTGTACGGGTGGTCTGTACCAAGATTAACAAAAGCAGTGGCATTGTAGAAGCATCACGGATCATGAATTTGTACCAGTTCATTCAGCTTTATAAAGATATCACAAGTCAAGCAGCAGGAGTATTGGCTCAGAGCTCCACCTCTGACGAACCTGATGAAAACTCATCCTCTGTAACATCTTGTCAGACTAGCTTTTGGATGGGAAGGGTGAAGCAGCTGACCGATGAGGAGGAGTGTTGTATCTGCATGGATGGACGAGCTGACCTCATCCTGCCTTGTGCTCACAGCTTTTGCCAGAAGTGTATTGATAAATGGAGTGATCGACACAGGAATTGCCCTATTTGTCGCCTACAGATGACTGGAGCAAATGAATCTTGGGTAGTGTCAGATGCACCCACAGAAGATGACATGGCTAACTATATTCTTAACATGGCTGATGAGGCAGGCCAGCCCCACAGGCCATGA

XM_004851420.1 Coding sequence

Rnf141 ring finger protein 141, transcript variant X2

High confidence: 4 potential gene matches
Length: 693 bp    Location: 2611646..2589806   Strand: -
>XM_004851420.1
ATGGGACAGCAAATTTCGGATCAGACACAGCTGGTTATTAACAAGTTACCAGAAAAAGTAGCAAAACATGTCACACTGGTTCGAGAAAGTAGCTCCTTAACTTACGAAGAATTTCTTGGGAGAGTAGCCGAACTCAATGATGTAACTGCTAAAGTGGCTGCTGGCCAGGAAAAACATCTTCTCTTTGAGGTACAACCTGGTTCTGATTCCTCTGCCTTTTGGAAAGTGGTTGTACGGGTGGTCTGTACCAAGATTAACAAAAGCAGTGGCATTGTAGAAGCATCACGGATCATGAATTTGTACCAGTTCATTCAGCTTTATAAAGATATCACAAGTCAAGCAGCAGGAGTATTGGCTCAGAGCTCCACCTCTGACGAACCTGATGAAAACTCATCCTCTGTAACATCTTGTCAGACTAGCTTTTGGATGGGAAGGGTGAAGCAGCTGACCGATGAGGAGGAGTGTTGTATCTGCATGGATGGACGAGCTGACCTCATCCTGCCTTGTGCTCACAGCTTTTGCCAGAAGTGTATTGATAAATGGAGTGATCGACACAGGAATTGCCCTATTTGTCGCCTACAGATGACTGGAGCAAATGAATCTTGGGTAGTGTCAGATGCACCCACAGAAGATGACATGGCTAACTATATTCTTAACATGGCTGATGAGGCAGGCCAGCCCCACAGGCCATGA

XM_004851422.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 2697 bp    Location: 2729474..2653923   Strand: -
>XM_004851422.1
ATGGGAAGGAATTTGACTTGTCCTTTTGGCGTCTTCCCAGCCTGCGGAGCCGAGGCCTCTTGGNAGGCTGACGCAGCGGAGGTTCCAGGCACACGCGGCCACTCGNGCCAGGAGGTTGCCATGCCCCACATTCCCGAGGACGAGGAGCCCCCCGGAGAGCCACAGGCAGCCCAGAGCCCCACCAGCCAAGACGCTCCCTTGGCAGGAATATTCCACGGTCCACCTGCAATCGTCCTGACCGGGGATGCCAGTTCACCAGGAGAGGCCGACAGGTCCCTGGCCAACAGAGATCACAGTCCCCACAGGAGGCTTTCTCACCGACACCTGAAGGTCTCCACTGCACCCCTGACATCTGTGGACCCTGCGGGGCACATCATTGACCTGGTAAATGACCGGTTGCCTGACATCAGCATCTCAGAGGAGGACAAGAAGAAAAACCTGGCTCTCTTGGAAGAAGCCAAGTCGGTGAGTGAGCGATTCCTGACCCGGCGTGGGAGGAAGTCCAGGAGCAGCCCTGGAGACTCCCCATCAGCTGTCCCCCTGAGCCTCAGCCCCGGAGCCTCTCCTGTGCCCTCTAGGAGCAGCTCACTGACAGTCCCCACCCCGCCAGGTTTGGATGTGTGCAGCGGCCCACAGTCCCCTCAGCCAGGATCACCACCACAGCAGAAGCGGGATGAGGCAGACATCTCCTCACCTCACCTTGGCGAGCCTAATGTCCCCAAAGGGTTAGCTGACCGGAAGCAGCATGACCAAAGGAAAGTGTCTCAGGGCAGGATGGCTCTTCAATCTCCCCCTGTTGAGAAGTCCAAAGAGCTTGCAATAGAACAAAAGGAAAACTTCGATCCCCTCCAGCACCCTGAGACCACACCCAAGGGCCCAGTTTCTGGCACAAACAGCATTGGGAAAATGGCCCTGAACAGCCCCCCGCCTGTCTCAGCTGAGAGTGAGCCGGGGAGGCAGCTCCCAAAGATGGCCAGGGAAGGCAACCCTCTGCTGAGAAGTCCAGCCCAGGGTTTGGGAGGAGTGGTCTCACCAGGCACCCAGAGAAAAGGCTCCACTGGAGACCCCCCAGCATCCAAGGTTGGCCCCAAAGTCGAACTGCAGCCCCCTGAGTCCCGGCCACCCCTGATGCGGGGGGTCTCCTGGGACAGTGGCCCCGAAGAGCTGGGTCCCCCGTTGCAGAAAGTGCTTGCTAAGCTGCCAGTGGCAGAGGAGGAGAAGTGCTTCCCAGGCAAAGCGAGTGGCAAGCTGGCCAAGGTGCCAGGGCTTAAAGACTTCCAGATACAAGTGCAGCCCGTGCGGATGCAGAAACTGACCAAGCTACGTGAGGAGCACATCCTAATGAGAAACCAGAACCTGGTGGGCCTGAAGCTTCCTGAACTGAGCGAAGCAGCAGAGCAGGAGAAAGGGGTCCCTTCAGAACTCTCCCCAGCTACTGAGGAAGAAGAATCAAAGAGTGGCTTGGATGTCATGCCCAGTATTTCTGATGTGCTGCTGCGAAAGCTGCGGGTCCACAAGTCTCTCCCAGGAAGTGCACCTCCACTCACTGAAAAGGAAGTTGAGAACGTGTTTGTACAACTGTCCTTGGCCTTTAGAAATGACAGCTATACCCTGGAATCTAGAATTAACCAGGCTGAAAGAGAACGCAACCTGACTGAGGAGAACACTGAGAAGGAACTGGAAAACTTCAAAGCTTCCATTACGTCTTCAGCGTCGCTCTGGAACCACTGTGAGCACCGTGAGACCTACCAGAAGCTGCTGGAGGACATTGCAGTCTTGCATCGCCTGGCCGCCCGCCTCTCCAGCCGTGCTGAGGTGGTTGGGGCCGTCCGCCAGGAAAAGCGTATGTCAAAAGCAACAGAAGTGATGATGCAGTATGTGGAGAATCTGAAGAGGACGTATGAGAAGGACCACGCAGAGCTCATGGAGTTTAAGAAACTTGCAAATCAGAATTCAAGCCGCAGTTGTGGCCCCTCTGAAGATGGGGTCCCTCGCACGGCGCGGTCCATGTCCCTCACGATGGGAAAGAACATGCCCCGCCGGAGGGTCAGTGTTGCTGTGGTCCCCAAGTTTAATGCCCTGAACCTGCCTGGCCAGTCTCCCAGCTCATCACCCATCCCCTCCCTATCAGTTCTGTCAGAATCACCCAACGGGAAAGGCAACCTATCTGTCACCTCAGCACTGCCCGCACTTTTGGAAAATGGAAAGACCAGTGGGGAGTCAGACTGTGAAGGCCCAGCTCCCGTGCGGCCTCCAGTTTCCCTGGAGGTCAGCCAAGAGACCAAGGCCAGGATGGAGGAAGAAGCCTACAATAAGGGATATCAGGAAGGTTTAAAAAAGACCAAAGAACTTCAAGACTTGAAGGAGGAGGAAGAAGAACAGAAGAGTGAAAGTCTTGAGGAACATGAAGAGGTAGAAGAAACTGAGGAAGAGGAAAAGGACCAGAGAAACAGCAAACTTGAACAATTGGTCCATTTCTTACAAGTCATGTATCCTAAACTCTGTCGGCACTGGCAAGTGATCTGGATGATGGCTGCAGTGATGCTGATCTTGACTATCGTGCTGGGGCTCTATAATTCCTATAAGTCTTGTGTGGAGCAGTCTGATGGGCCCCTTGGAAGATCCACTTGCTCCACAACCCAGAGGGACTCCTGGTGGAGCTCAGGACTCCAGCATGAGCAGCCTACAGAGCAATAG

XM_004851415.1 Coding sequence

Ampd3 adenosine monophosphate deaminase 3, transcript variant X3

Length: 2124 bp    Location: 2558992..2586275   Strand: +
>XM_004851415.1
ATGTCTGTGAGAAGGAGAAGTCTTTGGACACCAGCTGCCAGAAAGAAAAGTTTCAAGATGATCCGATCCCAGTCCTTGTCCCTGCAAATGCCGACGCAGCAAGACTGGAAGGGTACCCCAGCGTCCAGCCCAACCATGTCTCCCGTGACCCCTGTGGTCTATGGAGCCACCTCCCAGCCCACACCTGCACCCTATGCCATGCCCGAGTACCAGCGGGTCACCATCAGCGGAGATTACTGTGCTGGGATCACTGTAGAGGACTATGAGCAGGCTGCCAAGAGCCTAGCCAAGGCCCTGATGATCCGGGAGAAGTATGCACGGCTCGCCTACCACCGCTTTCCACGGACCACGGCCCAGTACCTAGGTCATGGGGTGGCTAATGCTGCACTTCTGGACGAGGGTTTCCCGGACTTCCACCCTCCCCCACTGCCCCAGGAGGACCCTTACTGCCTGGAGGATGCACCCCCCAACCTGGGGTACCTGGTCTGCATGCGGGGGGGCATCCTCTTTGTGTATGACAACAAGCAGATGCTGGAGCGCCAGGAGCCCCACAGCCTGCCCTACCCTGACCTGGAGACCTACACAGTGGACATGAGCCACATCCTGGCCCTCATCACCGATGGCCCCACGAAAACCTATTGTCACCGGAGACTGAATTTTCTGGAATCCAAGTTCAGCCTTCATGAGATGTTAAATGAAATGTCTGAGTTCAAAGAGCTGAAGAGTAACCCCCACCGAGACTTCTATAACGTGAGAAAGGTGGACACGCACATCCATGCAGCGGCCTGCATGAACCAGAAGCACTTGCTGCGTTTCATCAAGCACACATACCAGACGGAGCCCGACAGAACTGTGGCCGAGAAGCTGGGCCAGAAGGTCACCCTGAGGCAGGTGTTCGACAGCCTTCACATGGACCCCTATGATCTCACCGTGGATTCGCTGGATGTCCATGCAGGCCGGCAGACATTCCATCGCTTTGACAAGTTCAACTCCAAATACAACCCTGTGGGGGCCAGTGAGCTCCGTGACCTGTATTTGAAAACTGAAAACTACCTGGGAGGAGAGTACTTTGCTCGGATGGTGAAGGAGGTGGCCCGGGAGCTGGAGGAGAGCAAGTACCAGTACTCAGAGCCGAGGCTCTCCATCTATGGCCGCAGCCCACAGGAGTGGCAAAACCTGGCCCGCTGGTTCATCCAGCACAAGGTCTACTCACCCAACATGCGCTGGATCATCCAGGTGCCCCGGATCTATGACATATTTAGGTCAAAGAAGCTGCTGCCAAGCTTTGGGAAGATGCTGGAGAACATCTTCCTGCCCCTTTTTAAGGCCACAATCAACCCCCAAGATCACCGGGAGCTTCACCTCTTCCTCAAATATGTGACAGGGTTTGACAGTGTGGATGATGAGTCCAAACACAGTGACCACATGTTCTCAGAGAAGAGCCCCAGCCCAGACATCTGGACCAGTGAGCAGAATCCGCCCTACAGCTACTACCTGTACTACATGTATGCCAACATCATGGTGCTCAACAATCTTCGGCGAGAACGGGGCCTGAGCACGTTCCTGTTCCGGCCTCACTGTGGGGAGGCCGGCTCCATCACCCATCTGGTGTCTGCCTTTCTCACTGCCGACAACATTTCCCATGGGCTGCTCCTCAAGAAGAGTCCAGTGCTGCAGTACCTCTACTACCTTGCCCAGATCCCCATTGCCATGTCTCCTCTTAGCAACAACAGCCTTTTCCTGGAATATTCCAAGAACCCCCTGCGGGAATTCCTGCACAAGGGGTTGCATGTCTCCCTCTCCACCGATGACCCTATGCAGTTCCACTACACGAAGGAGGCACTCATGGAGGAATACGCCATCGCTGCACAAGTGTGGAAGCTGAGCACGTGTGACCTGTGTGAGATCGCCAGGAACAGTGTGCTGCAGAGCGGCCTCTCACATCAGGAAAAGCAGAAGTTTCTAGGACAGAATTACTGTAAAGAAGGACCTGAGGGAAACGATATTCGAAAGACAAATGTTGCACAGATCCGGATGGCATTCCGATATGAGACTCTATGCAATGAGCTCAGCTTCCTGTCTGATGCCATGAAATCAGAAGAGATCACAGCCCTGAACAACTAG

XM_004851416.1 Coding sequence

Ampd3 adenosine monophosphate deaminase 3, transcript variant X4

Length: 2067 bp    Location: 2560355..2586275   Strand: +
>XM_004851416.1
ATGATCCGATCCCAGTCCTTGTCCCTGCAAATGCCGACGCAGCAAGACTGGAAGGGTACCCCAGCGTCCAGCCCAACCATGTCTCCCGTGACCCCTGTGGTCTATGGAGCCACCTCCCAGCCCACACCTGCACCCTATGCCATGCCCGAGTACCAGCGGGTCACCATCAGCGGAGATTACTGTGCTGGGATCACTGTAGAGGACTATGAGCAGGCTGCCAAGAGCCTAGCCAAGGCCCTGATGATCCGGGAGAAGTATGCACGGCTCGCCTACCACCGCTTTCCACGGACCACGGCCCAGTACCTAGGTCATGGGGTGGCTAATGCTGCACTTCTGGACGAGGGTTTCCCGGACTTCCACCCTCCCCCACTGCCCCAGGAGGACCCTTACTGCCTGGAGGATGCACCCCCCAACCTGGGGTACCTGGTCTGCATGCGGGGGGGCATCCTCTTTGTGTATGACAACAAGCAGATGCTGGAGCGCCAGGAGCCCCACAGCCTGCCCTACCCTGACCTGGAGACCTACACAGTGGACATGAGCCACATCCTGGCCCTCATCACCGATGGCCCCACGAAAACCTATTGTCACCGGAGACTGAATTTTCTGGAATCCAAGTTCAGCCTTCATGAGATGTTAAATGAAATGTCTGAGTTCAAAGAGCTGAAGAGTAACCCCCACCGAGACTTCTATAACGTGAGAAAGGTGGACACGCACATCCATGCAGCGGCCTGCATGAACCAGAAGCACTTGCTGCGTTTCATCAAGCACACATACCAGACGGAGCCCGACAGAACTGTGGCCGAGAAGCTGGGCCAGAAGGTCACCCTGAGGCAGGTGTTCGACAGCCTTCACATGGACCCCTATGATCTCACCGTGGATTCGCTGGATGTCCATGCAGGCCGGCAGACATTCCATCGCTTTGACAAGTTCAACTCCAAATACAACCCTGTGGGGGCCAGTGAGCTCCGTGACCTGTATTTGAAAACTGAAAACTACCTGGGAGGAGAGTACTTTGCTCGGATGGTGAAGGAGGTGGCCCGGGAGCTGGAGGAGAGCAAGTACCAGTACTCAGAGCCGAGGCTCTCCATCTATGGCCGCAGCCCACAGGAGTGGCAAAACCTGGCCCGCTGGTTCATCCAGCACAAGGTCTACTCACCCAACATGCGCTGGATCATCCAGGTGCCCCGGATCTATGACATATTTAGGTCAAAGAAGCTGCTGCCAAGCTTTGGGAAGATGCTGGAGAACATCTTCCTGCCCCTTTTTAAGGCCACAATCAACCCCCAAGATCACCGGGAGCTTCACCTCTTCCTCAAATATGTGACAGGGTTTGACAGTGTGGATGATGAGTCCAAACACAGTGACCACATGTTCTCAGAGAAGAGCCCCAGCCCAGACATCTGGACCAGTGAGCAGAATCCGCCCTACAGCTACTACCTGTACTACATGTATGCCAACATCATGGTGCTCAACAATCTTCGGCGAGAACGGGGCCTGAGCACGTTCCTGTTCCGGCCTCACTGTGGGGAGGCCGGCTCCATCACCCATCTGGTGTCTGCCTTTCTCACTGCCGACAACATTTCCCATGGGCTGCTCCTCAAGAAGAGTCCAGTGCTGCAGTACCTCTACTACCTTGCCCAGATCCCCATTGCCATGTCTCCTCTTAGCAACAACAGCCTTTTCCTGGAATATTCCAAGAACCCCCTGCGGGAATTCCTGCACAAGGGGTTGCATGTCTCCCTCTCCACCGATGACCCTATGCAGTTCCACTACACGAAGGAGGCACTCATGGAGGAATACGCCATCGCTGCACAAGTGTGGAAGCTGAGCACGTGTGACCTGTGTGAGATCGCCAGGAACAGTGTGCTGCAGAGCGGCCTCTCACATCAGGAAAAGCAGAAGTTTCTAGGACAGAATTACTGTAAAGAAGGACCTGAGGGAAACGATATTCGAAAGACAAATGTTGCACAGATCCGGATGGCATTCCGATATGAGACTCTATGCAATGAGCTCAGCTTCCTGTCTGATGCCATGAAATCAGAAGAGATCACAGCCCTGAACAACTAG

XM_004851411.1 Coding sequence

Sbf2 SET binding factor 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 5547 bp    Location: 2383924..1907643   Strand: -
>XM_004851411.1
ATGGCCCGGCTGGCTGACTATTTCATTGTGGTAGGCTACGACCACGAGAAGCCAGGTAAGGGAGAAGGTCTGGGGAAAATAATCCAGAGATTTCCACAGAAGGACTGGGATGATACACCTTTTCCACAGGGGATTGAATTGTTTTGTCAGCCTGCTGGATGGCAGCTGTCCAGAGAGAGGAAGCAGCCGACATTCTTCGTGGTCGTACTAACAGATATTGACTCTGATAGACATTACTGCTCATGCTTAACCTTCTATGAGGCGGAGATCAATCTTCAGGGGACAAAGAAGGAAGAGATTGAAGGTGAAGAGGAAGTGTCTGATTTAATTCAGCCTGCAGAAGTGTTTGCTCCCAAAAGCCTGGTGTTGGTATCCAGATTAGATTATCCAGAAGTTTTTAGGGCTTGCCTGGGTCTGATCTATACTGTGTATGTGGACAGTCTGAATGTCTCCTTGGAAAGCCTCATTGCAAACCTTTGTGCCTGCCTTGTCCCAGCAGCTGGAGGGTCCCAGAAGCTGTTTTCCTTGGGTGCAGGAGATAGACAATTGATTCAGACTCCTTTACATGATAGTCTTCCTGTCACAGGCACTAGTGTGGCTCTCCTGTTCCAGCAGTTGGGAATTCAGAATGTCCTCAGCCTCTTTTGTGCAGTCCTTACAGAAAATAAGGTTCTCTTCCATTCTGCAAGTTTCCAGAGACTTAGTGATGCCTGTAGAGCCCTGGAATCTTTAATGTTTCCTCTTAAATATAGCTATCCTTATATTCCTATTCTCCCAGCTCAGCTACTAGAAGTTCTAAGTTCTCCAACACCTTTCATTATTGGAGTACATTCTATCTTTAAAACTGATGTCCATGAACTTTTAGATGTAATCATAGCAGATTTGGATGGAGGCACTATTAAAATTCCTGAATGTATTCACCTCTCTTCCCTCCCAGAACCACTTCTACATCAGACTCAAGCAGCTCTTTCCCTGATTTTACACCCAGATTTGGAAGTAGCAGATCATGCTTTTCCTCCTCCACGAACAGCTTTATCTCATTCAAAAATGCTGGATAAAGAAGTCCGAGCAGTTTTCCTTAGATTGTTTGCACAGCTTTTCCAAGGATATAGATCCTGCCTACAACTTATAAGAATTCATGCAGAGCCAGTAATACATTTTCACAAAACAGCTTTCTTGGGGCAGCGTGGTTTGATTGAGAATGATTTCCTCACTAAAGTACTCAATGGAATGGCATTTGCAGGATTTGTTTCAGAAAGAGGTCCTCCCTATAGAACCTGTGATCTCTTTGATGAGTTGGTAGCTTTTGAAGTAGAGAGAATTAAAGTTGAAGAAAATAATCCATTGAAGATGATAAAGCACATCAGAGAACTTGCTGAGCAACTATTCAAAAATGAGAATCCAAACCCTCATATGGCATTCCAGAAAGTTCCACGCCCAACAGAAGGATCACACTTGCGTGTTCACATTCTTCCTTTCCCAAAGATTAATGAAGCCCTGGTTCAGGAATTAATACAGGAAAATCTTGCTAAGAATCAGAATGCACCTCCTGCTACACGAATGGAAAAGAAATGTGTTGTGCCAGCAGGTCCACCTGTTGTTTCAATAATGGATAAAGTGACGACAGTTTTCAATAGTGCACAGAGACTGGAAGTTGTTAGAAACTGTATCTCATTCATATTTGAGAACAAAACTTTGGAGACTGAAAAGACCCTTCCTGCTGCCCTGAGGGCCCTTAAAGGAAAGGCAGCAAGACAGTGTCTCACAGATGAACTGGGTTTGCATGTCCAGCAAAACCGAGCGATATTGGACCATCAACAATTTGATTACATAATAAGGATGATGAATTGTACTCTACAGGATTGTTCAAGTTTAGAAGAGTATAACATTGCTGCAGCATTACTCCCTTTGACTAGTGCTTTCTATAGGAAACTTGCTCCTGGAGTCAGCCAGTTTGCTTACACCTGTGTACAGGACCACCCCATTTGGACAAATCAGCAGTTTTGGGAGACAACTTTTTACAATGCAGTGCAGGAACAAGTCCGCTCCCTGTATCTTTCAACAAAGGAAGACAATCACACCCCACACCTGAAGCAAAAGGATAAGCTTCCTGATGACCAGTATCAGGAAAAGACAGCCATGGACCTGGCAGCTGAGCAGCTGCGCCTTTGGCCCACTCTGAGCAAATCAACTCAGCAAGAATTAGTGCAACGTGAAGAAAGCACTGTCTTCAGTCAGGCCATTCACTTTGCAAATCTCATGGTCAACCTACTGGTTCCACTAGACACAAGTAAAAACAAGCTCCTGAGAGCATCAGCACCAGGTGACTGGGAGAGTGGAAGCAACAGCATTGTCACAAACAGTATTGCCGGAAGTGTAGCTGAGAGCTATGATACAGAGAGTGGGTTTGAAGATTCAGAGAACAATGACATTGCTAATTCTATCGTACGGTTCATTACCCGATTTATTGACAAGGTTTGTACAGAAAGTGGAGTTACTCAGGATCACATCAAGAGCCTTCATTGTATGATACCAGGAATTGTAGCTATGCACATTGAGACCCTAGAAGCAGTGCATCGTGAGAGTAGAAGACTTCCACCTATACAGAAGCCCAAGATTCTAAGACCTGCTTTGCTGCCAGGAGAAGAAATTGTATGTGAAGGTCTTCGAGTCCTGCTTGATCCTGATGGCAGAGAAGAAGCCACTGGAGGCCTTCTTGGAGGCCCTCAGCTCCTGCCAGCAGAAGGAGCTTTGTTCCTCACCACATACAGAATTCTGTTCAGAGGGACACCTCATGACCAGCTAGTTGGTGAACAGACAGTTGTGAGGAGCTTCCCCATTGCCTCCATCACCAAGGAGAAGAAGATCACAATGCAGAACCAGCTACAACAGAACATGCAAGAAGGATTGCAGATTACATCAGCATCTTTTCAGTTGATTAAAGTAGCTTTTGATGAGGAAGTCAGTCCAGAAGTAGTAGAGATCTTTAAGAAACAGCTAATGAAGTTCCGTTATCCTCAGTCCATTTTCAGCACCTTCGCTTTTGCTGCTGGACAAACCACCCCACAAATAATTTTACCCAAACAAAAGGAAAAGAATACTTCCTTTCGTACCTTTTCAAAAACAATTGTGAAAGGTGCCAAAAGGGCAGGGAAAATGACAATTGGCCGACAGTATTTATTGAAGAGGAAGACAGGAACAATTGTGGAAGAGAGAGTAAATCGTCCTGGATGGAATGAAGACGATGACATATCAGTTTCAGATGATAGTGAACTCCCCACAAGTACCCTGAAGCCCTCAGAGAAGTCTACAATGGAACAGTTAGTGGAAAAGGCTTGTTTCAGAGACTATCAGCGGTTAGGTTTGGGAACCATAAGTGGCACCTCATCCCGTTCAAAACCAGAGTATTTCCGAATCACTGCCTCCAACAGGATGTATTCTCTGTGCCGAAGCTATCCTGGCCTTTTAGTCATACCTCAAGCTGTTCAGGACAGTAGTTTACCAAGAGTAGCCCGCTGCTATCGACACAATCGCTTGCCTGTTGTATGTTGGAAGAACTCAAGAAGTGGTACTCTGCTCCTTCGATCTGGAGGATTCCATGGGAAAGGAGTTGTTGCTCTTTTTAAATCTCAGAACTCCCCTCAGGCAGCTCCTACCTCCTCTTTAGAATCTTCCAGTACCATAGAACAAGAAAAGTACTTGCAAGCCTTACTGAATGCAGTTTCTGTCCATCAGAAACTCAGAAGCAACAACACCCTTACTGTCAGGCCAGCACTTGCTCTGTCTCCAGGTGTATGGGCAAGTCTTCGCTCCAGCACTCGCTTGATCAGCTCTCCAACATCCTTCATTGATGTTGGCGCCCGGCTGGCAGGCAAGGATCACTCGACCCCCTTCAGTAATAGCACCTACCTACAAAACCAGCTCTTGAAACGCCAAGCAGCCCTTTATATATTTGGTGAAAAGTCACAACTAAGGAGCTTCAAGGTAGAATTTGCTTTAAATTGTGAGTTTGTTCCTGTAGAATTTCATGAAATCCGACAAGTGAAAGCCAGTTTTAAAAAGCTGATGAGGGCTTGTATCCCAAGCACCATTCCTACTGACTCAGAAGTGACCTTCCTGAAGGCCCTGGGAGACTCTGAGTGGCTCCCACAGATTCATAGGATAATGCAGCTGGCTGTGGTGGTAGCAGAAGTACTCGAGAATGGCTCCTCAGTCTTGATCTGTTTGGAAGAAGGCTGGGATATCACTGCACAAGTGACCTCCCTGGTACAGTTACTCAGTGATCCCTTTTATAGGACACTTGAAGGTTTCAGAATGTTGGTTGAAAAAGAGTGGCTCTCTTTTGGTCATAAATTCAGTCAGAGGAGCAGCTTGACCCTCAACTCTCAGGGTAGTGGTTTTGCTCCAGTCTTCCTGCAATTCTTAGACTGTGTACACCAGGTTCACAACCAGTATCCTACTGAGTTTGAATTCAATCTCTATTACTTAAAGTTCTTGGCCTTCCACTATGTATCTAATCGCTTTAAAACTTTTCTCCTGGATTCAGACTATGAAAGATTAGAACACGGAACTTTATTTGATGATAAAGGAGACAAGCATGCCAAGAAAGGAATTTGTATTTGGGAGTGTATTGATAAAACACATAAGAGGAGTCCCATTTTCTTTAATTATTTATATTCACCAGTGGAAATAGAGGCCCTGAAGCCCAATGTAAACATCTCCAGCCTCAAGAAGTGGGATTACTACATAGAGGAAACCCTGTCTTCAGGGCCTTCATATGACTGGATGATGCTAACTCCCAAGCACTTCCCCTCTGAAGAGTCTGATCTGGCTGGAGGAGCTGGCCCCCAGAGCCAGAGAAAGACAGTGTGGCCGTGCTATGATGATGTCAGCTGTACTCAGCCCGATGCTCTCACCAGCCTTTTCAATGAAATTGAAAAATTGGAGCATAAATTGAACCAAACTCCTGAGAAGTGGCAGCAGCTGTGGGAAAAGGTAACCATGGACCTTAAGGAAGAGCAAAGAGCAGACCATGTCCAGAGACATCCTTCAGGATCCCCAGGAATTGTGTCTACCAACCTACCTTCCTATCAGAAGAGGCCTACACTGCACCTGCCAGACAGCAGCATGAGCGAGGAACAGAACGCCAGCATCTCACCATCTAATGGAGTGGAGCGAAGGGCAGCCACACTCTACAGTCAGTACACATCCAGGAATGATGAGAACAGGTCCTTTGAGGGAACACTTTACAAAAGAGGGGCTCTGCTGAAAGGCTGGAAACCCCGTTGGTTTGTACTGGATGTAACAAAACATCAGCTGCGATACTATGACTCTGGTGAAGACACAAGCTGCAAAGGCCACATTGATCTGGCTGAAGTAGAAATGGTCATCCCTGCTGGCCCCAGCCTGGGCGCTCCAAAGCACACAAATGACAAGGCTTTCTTTGATCTCAAGACGAGTAAACGTGTATATAACTTCTGTGCCCAAGATGGGCAGAGTGCCCAGCAGTGGATGGACAGAATCCAGAGCTGTATCTCTGATGCCTGA

XM_004851410.1 Coding sequence

Sbf2 SET binding factor 2, transcript variant X2

Length: 5622 bp    Location: 2383924..1907643   Strand: -
>XM_004851410.1
ATGGCCCGGCTGGCTGACTATTTCATTGTGGTAGGCTACGACCACGAGAAGCCAGGTAAGGGTTCAGGAGAAGGTCTGGGGAAAATAATCCAGAGATTTCCACAGAAGGACTGGGATGATACACCTTTTCCACAGGGGATTGAATTGTTTTGTCAGCCTGCTGGATGGCAGCTGTCCAGAGAGAGGAAGCAGCCGACATTCTTCGTGGTCGTACTAACAGATATTGACTCTGATAGACATTACTGCTCATGCTTAACCTTCTATGAGGCGGAGATCAATCTTCAGGGGACAAAGAAGGAAGAGATTGAAGGTGAAGAGGAAGTGTCTGATTTAATTCAGCCTGCAGAAGTGTTTGCTCCCAAAAGCCTGGTGTTGGTATCCAGATTAGATTATCCAGAAGTTTTTAGGGCTTGCCTGGGTCTGATCTATACTGTGTATGTGGACAGTCTGAATGTCTCCTTGGAAAGCCTCATTGCAAACCTTTGTGCCTGCCTTGTCCCAGCAGCTGGAGGGTCCCAGAAGCTGTTTTCCTTGGGTGCAGGAGATAGACAATTGATTCAGACTCCTTTACATGATAGTCTTCCTGTCACAGGCACTAGTGTGGCTCTCCTGTTCCAGCAGTTGGGAATTCAGAATGTCCTCAGCCTCTTTTGTGCAGTCCTTACAGAAAATAAGGTTCTCTTCCATTCTGCAAGTTTCCAGAGACTTAGTGATGCCTGTAGAGCCCTGGAATCTTTAATGTTTCCTCTTAAATATAGCTATCCTTATATTCCTATTCTCCCAGCTCAGCTACTAGAAGTTCTAAGTTCTCCAACACCTTTCATTATTGGAGTACATTCTATCTTTAAAACTGATGTCCATGAACTTTTAGATGTAATCATAGCAGATTTGGATGGAGGCACTATTAAAATTCCTGAATGTATTCACCTCTCTTCCCTCCCAGAACCACTTCTACATCAGACTCAAGCAGCTCTTTCCCTGATTTTACACCCAGATTTGGAAGTAGCAGATCATGCTTTTCCTCCTCCACGAACAGCTTTATCTCATTCAAAAATGCTGGATAAAGAAGTCCGAGCAGTTTTCCTTAGATTGTTTGCACAGCTTTTCCAAGGATATAGATCCTGCCTACAACTTATAAGAATTCATGCAGAGCCAGTAATACATTTTCACAAAACAGCTTTCTTGGGGCAGCGTGGTTTGATTGAGAATGATTTCCTCACTAAAGTACTCAATGGAATGGCATTTGCAGGATTTGTTTCAGAAAGAGGTCCTCCCTATAGAACCTGTGATCTCTTTGATGAGTTGGTAGCTTTTGAAGTAGAGAGAATTAAAGTTGAAGAAAATAATCCATTGAAGATGATAAAGCACATCAGAGAACTTGCTGAGCAACTATTCAAAAATGAGAATCCAAACCCTCATATGGCATTCCAGAAAGTTCCACGCCCAACAGAAGGATCACACTTGCGTGTTCACATTCTTCCTTTCCCAAAGATTAATGAAGCCCTGGTTCAGGAATTAATACAGGAAAATCTTGCTAAGAATCAGAATGCACCTCCTGCTACACGAATGGAAAAGAAATGTGTTGTGCCAGCAGGTCCACCTGTTGTTTCAATAATGGATAAAGTGACGACAGTTTTCAATAGTGCACAGAGACTGGAAGTTGTTAGAAACTGTATCTCATTCATATTTGAGAACAAAACTTTGGAGACTGAAAAGACCCTTCCTGCTGCCCTGAGGGCCCTTAAAGGAAAGGCAGCAAGACAGTGTCTCACAGATGAACTGGGTTTGCATGTCCAGCAAAACCGAGCGATATTGGACCATCAACAATTTGATTACATAATAAGGATGATGAATTGTACTCTACAGGATTGTTCAAGTTTAGAAGAGTATAACATTGCTGCAGCATTACTCCCTTTGACTAGTGCTTTCTATAGGAAACTTGCTCCTGGAGTCAGCCAGTTTGCTTACACCTGTGTACAGGACCACCCCATTTGGACAAATCAGCAGTTTTGGGAGACAACTTTTTACAATGCAGTGCAGGAACAAGTCCGCTCCCTGTATCTTTCAACAAAGGAAGACAATCACACCCCACACCTGAAGCAAAAGCTTCCTGATGACCAGTATCAGGAAAAGACAGCCATGGACCTGGCAGCTGAGCAGCTGCGCCTTTGGCCCACTCTGAGCAAATCAACTCAGCAAGAATTAGTGCAACGTGAAGAAAGCACTGTCTTCAGTCAGGCCATTCACTTTGCAAATCTCATGGTCAACCTACTGGTTCCACTAGACACAAGTAAAAACAAGCTCCTGAGAGCATCAGCACCAGGTGACTGGGAGAGTGGAAGCAACAGCATTGTCACAAACAGTATTGCCGGAAGTGTAGCTGAGAGCTATGATACAGAGAGTGGGTTTGAAGATTCAGAGAACAATGACATTGCTAATTCTATCGTACGGTTCATTACCCGATTTATTGACAAGGTTTGTACAGAAAGTGGAGTTACTCAGGATCACATCAAGAGCCTTCATTGTATGATACCAGGAATTGTAGCTATGCACATTGAGACCCTAGAAGCAGTGCATCGTGAGAGTAGAAGACTTCCACCTATACAGAAGCCCAAGATTCTAAGACCTGCTTTGCTGCCAGGAGAAGAAATTGTATGTGAAGGTCTTCGAGTCCTGCTTGATCCTGATGGCAGAGAAGAAGCCACTGGAGGCCTTCTTGGAGGCCCTCAGCTCCTGCCAGCAGAAGGAGCTTTGTTCCTCACCACATACAGAATTCTGTTCAGAGGGACACCTCATGACCAGCTAGTTGGTGAACAGACAGTTGTGAGGAGCTTCCCCATTGCCTCCATCACCAAGGAGAAGAAGATCACAATGCAGAACCAGCTACAACAGAACATGCAAGAAGGATTGCAGATTACATCAGCATCTTTTCAGTTGATTAAAGTAGCTTTTGATGAGGAAGTCAGTCCAGAAGTAGTAGAGATCTTTAAGAAACAGCTAATGAAGTTCCGTTATCCTCAGTCCATTTTCAGCACCTTCGCTTTTGCTGCTGGACAAACCACCCCACAAATAATTTTACCCAAACAAAAGGAAAAGAATACTTCCTTTCGTACCTTTTCAAAAACAATTGTGAAAGGTGCCAAAAGGGCAGGGAAAATGACAATTGGCCGACAGTATTTATTGAAGAGGAAGACAGGAACAATTGTGGAAGAGAGAGTAAATCGTCCTGGATGGAATGAAGACGATGACATATCAGTTTCAGATGATAGTGAACTCCCCACAAGTACCCTGAAGCCCTCAGAGAAGTCTACAATGGAACAGTTAGTGGAAAAGGCTTGTTTCAGAGACTATCAGCGGTTAGGTTTGGGAACCATAAGTGGCACCTCATCCCGTTCAAAACCAGAGTATTTCCGAATCACTGCCTCCAACAGGATGTATTCTCTGTGCCGAAGCTATCCTGGCCTTTTAGTCATACCTCAAGCTGTTCAGGACAGTAGTTTACCAAGAGTAGCCCGCTGCTATCGACACAATCGCTTGCCTGTTGTATGTTGGAAGAACTCAAGAAGTGGTACTCTGCTCCTTCGATCTGGAGGATTCCATGGGAAAGGAGTTGTTGCTCTTTTTAAATCTCAGAACTCCCCTCAGGCAGCTCCTACCTCCTCTTTAGAATCTTCCAGTACCATAGAACAAGAAAAGTACTTGCAAGCCTTACTGAATGCAGTTTCTGTCCATCAGAAACTCAGAAGCAACAACACCCTTACTGTCAGGCCAGCACTTGCTCTGTCTCCAGCTCATGGCTTCAGAGATAAATGTTTTACTCAGTCAAATCCCAAATCTTCAGCTAAGGGAAGAATCCATAATCAAGGTGTATGGGCAAGTCTTCGCTCCAGCACTCGCTTGATCAGCTCTCCAACATCCTTCATTGATGTTGGCGCCCGGCTGGCAGGCAAGGATCACTCGACCCCCTTCAGTAATAGCACCTACCTACAAAACCAGCTCTTGAAACGCCAAGCAGCCCTTTATATATTTGGTGAAAAGTCACAACTAAGGAGCTTCAAGGTAGAATTTGCTTTAAATTGTGAGTTTGTTCCTGTAGAATTTCATGAAATCCGACAAGTGAAAGCCAGTTTTAAAAAGCTGATGAGGGCTTGTATCCCAAGCACCATTCCTACTGACTCAGAAGTGACCTTCCTGAAGGCCCTGGGAGACTCTGAGTGGCTCCCACAGATTCATAGGATAATGCAGCTGGCTGTGGTGGTAGCAGAAGTACTCGAGAATGGCTCCTCAGTCTTGATCTGTTTGGAAGAAGGCTGGGATATCACTGCACAAGTGACCTCCCTGGTACAGTTACTCAGTGATCCCTTTTATAGGACACTTGAAGGTTTCAGAATGTTGGTTGAAAAAGAGTGGCTCTCTTTTGGTCATAAATTCAGTCAGAGGAGCAGCTTGACCCTCAACTCTCAGGGTAGTGGTTTTGCTCCAGTCTTCCTGCAATTCTTAGACTGTGTACACCAGGTTCACAACCAGTATCCTACTGAGTTTGAATTCAATCTCTATTACTTAAAGTTCTTGGCCTTCCACTATGTATCTAATCGCTTTAAAACTTTTCTCCTGGATTCAGACTATGAAAGATTAGAACACGGAACTTTATTTGATGATAAAGGAGACAAGCATGCCAAGAAAGGAATTTGTATTTGGGAGTGTATTGATAAAACACATAAGAGGAGTCCCATTTTCTTTAATTATTTATATTCACCAGTGGAAATAGAGGCCCTGAAGCCCAATGTAAACATCTCCAGCCTCAAGAAGTGGGATTACTACATAGAGGAAACCCTGTCTTCAGGGCCTTCATATGACTGGATGATGCTAACTCCCAAGCACTTCCCCTCTGAAGAGTCTGATCTGGCTGGAGGAGCTGGCCCCCAGAGCCAGAGAAAGACAGTGTGGCCGTGCTATGATGATGTCAGCTGTACTCAGCCCGATGCTCTCACCAGCCTTTTCAATGAAATTGAAAAATTGGAGCATAAATTGAACCAAACTCCTGAGAAGTGGCAGCAGCTGTGGGAAAAGGTAACCATGGACCTTAAGGAAGAGCAAAGAGCAGACCATGTCCAGAGACATCCTTCAGGATCCCCAGGAATTGTGTCTACCAACCTACCTTCCTATCAGAAGAGGCCTACACTGCACCTGCCAGACAGCAGCATGAGCGAGGAACAGAACGCCAGCATCTCACCATCTAATGGAGTGGAGCGAAGGGCAGCCACACTCTACAGTCAGTACACATCCAGGAATGATGAGAACAGGTCCTTTGAGGGAACACTTTACAAAAGAGGGGCTCTGCTGAAAGGCTGGAAACCCCGTTGGTTTGTACTGGATGTAACAAAACATCAGCTGCGATACTATGACTCTGGTGAAGACACAAGCTGCAAAGGCCACATTGATCTGGCTGAAGTAGAAATGGTCATCCCTGCTGGCCCCAGCCTGGGCGCTCCAAAGCACACAAATGACAAGGCTTTCTTTGATCTCAAGACGAGTAAACGTGTATATAACTTCTGTGCCCAAGATGGGCAGAGTGCCCAGCAGTGGATGGACAGAATCCAGAGCTGTATCTCTGATGCCTGA

XM_004851409.1 Coding sequence

Sbf2 SET binding factor 2, transcript variant X1

Length: 5598 bp    Location: 2358867..1907643   Strand: -
>XM_004851409.1
ATGAACTCAAAGTCAGGAGAAGGTCTGGGGAAAATAATCCAGAGATTTCCACAGAAGGACTGGGATGATACACCTTTTCCACAGGGGATTGAATTGTTTTGTCAGCCTGCTGGATGGCAGCTGTCCAGAGAGAGGAAGCAGCCGACATTCTTCGTGGTCGTACTAACAGATATTGACTCTGATAGACATTACTGCTCATGCTTAACCTTCTATGAGGCGGAGATCAATCTTCAGGGGACAAAGAAGGAAGAGATTGAAGGTGAAGAGGAAGTGTCTGATTTAATTCAGCCTGCAGAAGTGTTTGCTCCCAAAAGCCTGGTGTTGGTATCCAGATTAGATTATCCAGAAGTTTTTAGGGCTTGCCTGGGTCTGATCTATACTGTGTATGTGGACAGTCTGAATGTCTCCTTGGAAAGCCTCATTGCAAACCTTTGTGCCTGCCTTGTCCCAGCAGCTGGAGGGTCCCAGAAGCTGTTTTCCTTGGGTGCAGGAGATAGACAATTGATTCAGACTCCTTTACATGATAGTCTTCCTGTCACAGGCACTAGTGTGGCTCTCCTGTTCCAGCAGTTGGGAATTCAGAATGTCCTCAGCCTCTTTTGTGCAGTCCTTACAGAAAATAAGGTTCTCTTCCATTCTGCAAGTTTCCAGAGACTTAGTGATGCCTGTAGAGCCCTGGAATCTTTAATGTTTCCTCTTAAATATAGCTATCCTTATATTCCTATTCTCCCAGCTCAGCTACTAGAAGTTCTAAGTTCTCCAACACCTTTCATTATTGGAGTACATTCTATCTTTAAAACTGATGTCCATGAACTTTTAGATGTAATCATAGCAGATTTGGATGGAGGCACTATTAAAATTCCTGAATGTATTCACCTCTCTTCCCTCCCAGAACCACTTCTACATCAGACTCAAGCAGCTCTTTCCCTGATTTTACACCCAGATTTGGAAGTAGCAGATCATGCTTTTCCTCCTCCACGAACAGCTTTATCTCATTCAAAAATGCTGGATAAAGAAGTCCGAGCAGTTTTCCTTAGATTGTTTGCACAGCTTTTCCAAGGATATAGATCCTGCCTACAACTTATAAGAATTCATGCAGAGCCAGTAATACATTTTCACAAAACAGCTTTCTTGGGGCAGCGTGGTTTGATTGAGAATGATTTCCTCACTAAAGTACTCAATGGAATGGCATTTGCAGGATTTGTTTCAGAAAGAGGTCCTCCCTATAGAACCTGTGATCTCTTTGATGAGTTGGTAGCTTTTGAAGTAGAGAGAATTAAAGTTGAAGAAAATAATCCATTGAAGATGATAAAGCACATCAGAGAACTTGCTGAGCAACTATTCAAAAATGAGAATCCAAACCCTCATATGGCATTCCAGAAAGTTCCACGCCCAACAGAAGGATCACACTTGCGTGTTCACATTCTTCCTTTCCCAAAGATTAATGAAGCCCTGGTTCAGGAATTAATACAGGAAAATCTTGCTAAGAATCAGAATGCACCTCCTGCTACACGAATGGAAAAGAAATGTGTTGTGCCAGCAGGTCCACCTGTTGTTTCAATAATGGATAAAGTGACGACAGTTTTCAATAGTGCACAGAGACTGGAAGTTGTTAGAAACTGTATCTCATTCATATTTGAGAACAAAACTTTGGAGACTGAAAAGACCCTTCCTGCTGCCCTGAGGGCCCTTAAAGGAAAGGCAGCAAGACAGTGTCTCACAGATGAACTGGGTTTGCATGTCCAGCAAAACCGAGCGATATTGGACCATCAACAATTTGATTACATAATAAGGATGATGAATTGTACTCTACAGGATTGTTCAAGTTTAGAAGAGTATAACATTGCTGCAGCATTACTCCCTTTGACTAGTGCTTTCTATAGGAAACTTGCTCCTGGAGTCAGCCAGTTTGCTTACACCTGTGTACAGGACCACCCCATTTGGACAAATCAGCAGTTTTGGGAGACAACTTTTTACAATGCAGTGCAGGAACAAGTCCGCTCCCTGTATCTTTCAACAAAGGAAGACAATCACACCCCACACCTGAAGCAAAAGGATAAGCTTCCTGATGACCAGTATCAGGAAAAGACAGCCATGGACCTGGCAGCTGAGCAGCTGCGCCTTTGGCCCACTCTGAGCAAATCAACTCAGCAAGAATTAGTGCAACGTGAAGAAAGCACTGTCTTCAGTCAGGCCATTCACTTTGCAAATCTCATGGTCAACCTACTGGTTCCACTAGACACAAGTAAAAACAAGCTCCTGAGAGCATCAGCACCAGGTGACTGGGAGAGTGGAAGCAACAGCATTGTCACAAACAGTATTGCCGGAAGTGTAGCTGAGAGCTATGATACAGAGAGTGGGTTTGAAGATTCAGAGAACAATGACATTGCTAATTCTATCGTACGGTTCATTACCCGATTTATTGACAAGGTTTGTACAGAAAGTGGAGTTACTCAGGATCACATCAAGAGCCTTCATTGTATGATACCAGGAATTGTAGCTATGCACATTGAGACCCTAGAAGCAGTGCATCGTGAGAGTAGAAGACTTCCACCTATACAGAAGCCCAAGATTCTAAGACCTGCTTTGCTGCCAGGAGAAGAAATTGTATGTGAAGGTCTTCGAGTCCTGCTTGATCCTGATGGCAGAGAAGAAGCCACTGGAGGCCTTCTTGGAGGCCCTCAGCTCCTGCCAGCAGAAGGAGCTTTGTTCCTCACCACATACAGAATTCTGTTCAGAGGGACACCTCATGACCAGCTAGTTGGTGAACAGACAGTTGTGAGGAGCTTCCCCATTGCCTCCATCACCAAGGAGAAGAAGATCACAATGCAGAACCAGCTACAACAGAACATGCAAGAAGGATTGCAGATTACATCAGCATCTTTTCAGTTGATTAAAGTAGCTTTTGATGAGGAAGTCAGTCCAGAAGTAGTAGAGATCTTTAAGAAACAGCTAATGAAGTTCCGTTATCCTCAGTCCATTTTCAGCACCTTCGCTTTTGCTGCTGGACAAACCACCCCACAAATAATTTTACCCAAACAAAAGGAAAAGAATACTTCCTTTCGTACCTTTTCAAAAACAATTGTGAAAGGTGCCAAAAGGGCAGGGAAAATGACAATTGGCCGACAGTATTTATTGAAGAGGAAGACAGGAACAATTGTGGAAGAGAGAGTAAATCGTCCTGGATGGAATGAAGACGATGACATATCAGTTTCAGATGATAGTGAACTCCCCACAAGTACCCTGAAGCCCTCAGAGAAGTCTACAATGGAACAGTTAGTGGAAAAGGCTTGTTTCAGAGACTATCAGCGGTTAGGTTTGGGAACCATAAGTGGCACCTCATCCCGTTCAAAACCAGAGTATTTCCGAATCACTGCCTCCAACAGGATGTATTCTCTGTGCCGAAGCTATCCTGGCCTTTTAGTCATACCTCAAGCTGTTCAGGACAGTAGTTTACCAAGAGTAGCCCGCTGCTATCGACACAATCGCTTGCCTGTTGTATGTTGGAAGAACTCAAGAAGTGGTACTCTGCTCCTTCGATCTGGAGGATTCCATGGGAAAGGAGTTGTTGCTCTTTTTAAATCTCAGAACTCCCCTCAGGCAGCTCCTACCTCCTCTTTAGAATCTTCCAGTACCATAGAACAAGAAAAGTACTTGCAAGCCTTACTGAATGCAGTTTCTGTCCATCAGAAACTCAGAAGCAACAACACCCTTACTGTCAGGCCAGCACTTGCTCTGTCTCCAGGGACTGAAAGGAGGACTTCAAGAATGTCCACTGTGCTTAAGCAGGTAGTGCCAGGACATTTGGATGTAAACCCATCCAATAGCTTTGCTCGAGGAGGTGTATGGGCAAGTCTTCGCTCCAGCACTCGCTTGATCAGCTCTCCAACATCCTTCATTGATGTTGGCGCCCGGCTGGCAGGCAAGGATCACTCGACCCCCTTCAGTAATAGCACCTACCTACAAAACCAGCTCTTGAAACGCCAAGCAGCCCTTTATATATTTGGTGAAAAGTCACAACTAAGGAGCTTCAAGGTAGAATTTGCTTTAAATTGTGAGTTTGTTCCTGTAGAATTTCATGAAATCCGACAAGTGAAAGCCAGTTTTAAAAAGCTGATGAGGGCTTGTATCCCAAGCACCATTCCTACTGACTCAGAAGTGACCTTCCTGAAGGCCCTGGGAGACTCTGAGTGGCTCCCACAGATTCATAGGATAATGCAGCTGGCTGTGGTGGTAGCAGAAGTACTCGAGAATGGCTCCTCAGTCTTGATCTGTTTGGAAGAAGGCTGGGATATCACTGCACAAGTGACCTCCCTGGTACAGTTACTCAGTGATCCCTTTTATAGGACACTTGAAGGTTTCAGAATGTTGGTTGAAAAAGAGTGGCTCTCTTTTGGTCATAAATTCAGTCAGAGGAGCAGCTTGACCCTCAACTCTCAGGGTAGTGGTTTTGCTCCAGTCTTCCTGCAATTCTTAGACTGTGTACACCAGGTTCACAACCAGTATCCTACTGAGTTTGAATTCAATCTCTATTACTTAAAGTTCTTGGCCTTCCACTATGTATCTAATCGCTTTAAAACTTTTCTCCTGGATTCAGACTATGAAAGATTAGAACACGGAACTTTATTTGATGATAAAGGAGACAAGCATGCCAAGAAAGGAATTTGTATTTGGGAGTGTATTGATAAAACACATAAGAGGAGTCCCATTTTCTTTAATTATTTATATTCACCAGTGGAAATAGAGGCCCTGAAGCCCAATGTAAACATCTCCAGCCTCAAGAAGTGGGATTACTACATAGAGGAAACCCTGTCTTCAGGGCCTTCATATGACTGGATGATGCTAACTCCCAAGCACTTCCCCTCTGAAGAGTCTGATCTGGCTGGAGGAGCTGGCCCCCAGAGCCAGAGAAAGACAGTGTGGCCGTGCTATGATGATGTCAGCTGTACTCAGCCCGATGCTCTCACCAGCCTTTTCAATGAAATTGAAAAATTGGAGCATAAATTGAACCAAACTCCTGAGAAGTGGCAGCAGCTGTGGGAAAAGGTAACCATGGACCTTAAGGAAGAGCAAAGAGCAGACCATGTCCAGAGACATCCTTCAGGATCCCCAGGAATTGTGTCTACCAACCTACCTTCCTATCAGAAGAGGCCTACACTGCACCTGCCAGACAGCAGCATGAGCGAGGAACAGAACGCCAGCATCTCACCATCTAATGGAGTGGAGCGAAGGGCAGCCACACTCTACAGTCAGTACACATCCAGGAATGATGAGAACAGGTCCTTTGAGGGAACACTTTACAAAAGAGGGGCTCTGCTGAAAGGCTGGAAACCCCGTTGGTTTGTACTGGATGTAACAAAACATCAGCTGCGATACTATGACTCTGGTGAAGACACAAGCTGCAAAGGCCACATTGATCTGGCTGAAGTAGAAATGGTCATCCCTGCTGGCCCCAGCCTGGGCGCTCCAAAGCACACAAATGACAAGGCTTTCTTTGATCTCAAGACGAGTAAACGTGTATATAACTTCTGTGCCCAAGATGGGCAGAGTGCCCAGCAGTGGATGGACAGAATCCAGAGCTGTATCTCTGATGCCTGA

XM_004851407.1 Coding sequence

Znf143 zinc finger protein 143, transcript variant X4

Length: 1917 bp    Location: 1604200..1662595   Strand: +
>XM_004851407.1
ATGTTGTTAGCCCAAATAAATCGGGATTCCCAAGGAATGACCGAGTTCCCTGGAGGAGGGATGGAGGCGCAGCATGTCACCCTGTGCCTCACAGAGGCAGTGACTGTGGCAGATGGTGACAACTTAGAAAACATGGAAGGTGTAAGCTTACAAGCAGTGACACTTGCAGACGGCTCTACCGCTTACATACAGCACAACTCGAAAGATGGAAAACTTATTGATGGGCAGGTCATTCAGTTGGAAGATGGTTCTGCTGCATATGTTCAACACGTACCCATACCTAAAAGTAGGGACAGTTTGCGTCTAGAGGATGGTCAAGCGGTGCAGTTGGAAGATGGGACCACAGCGTTTATTCACCACACCTCCAAAGATAGTTACGACCAGAGTGCACTACAGGCAGTTCAGCTGGAAGATGGTACCACGGCCTACATCCACCATGCAGTGCAAGTCCCGCAGTCTGACACCATCCTGGCAATTCAGGCTGATGGGACAGTGGCAGGGCTGCATACCGGGGATGCCACCATTGACCCTGACACCATCAGTGCTTTGGAACAGTATGCAGCAAAGGTGTCCATTGATGGAAGTGAAAGTGTAACGGGTACTGGAATGATTGGAGAAAATGAGCAAGAGAAAAAAATGCAGATTGTCCTACAAGGACATGCGACGAGAGTAACTGCTAAATCTCAACAGAGTGGAGAGAAGGCATTCCGATGTGAATATGATGGATGTGGAAAATTATATACAACAGCTCACCATCTAAAGGTCCATGAGAGGTCACACACGGGAGACCGGCCTTATCAGTGTGAGCATGCGGGCTGTGGGAAAGCATTCGCAACAGGTTATGGATTAAAAAGTCATTTCAGAACTCATACAGGAGAAAAGCCATATCGGTGTTCAGAAGATAACTGTACTAAATCTTTCAAAACTTCAGGAGACCTACAGAAACATATTAGAACTCATACAGGAGAAAGACCTTTTAAGTGTCCCTTTGAAGGCTGTGGTCGGTCCTTTACAACATCAAATATCAGAAAAGTACACGTTAGGACACACACAGGAGAAAGACCTTATTACTGCACAGAACCAGGATGTGGGAGGGCATTTGCCAGTGCAACCAACTATAAAAACCATGTGAGGATACACACAGGGGAAAAGCCATATGTCTGTACAGTTCCTGGGTGTGACAAAAGGTTTACAGAATATTCCAGTTTATACAAACACCATGTCGTTCACACTCACTCCAAACCATACAACTGTAACCATTGTGGGAAGACATACAAGCAGATCTCCACGCTGGCCATGCACAAGCGGTCGGCCCACAATGACACTGAGCCCATCGAGGAGGAGCAAGAAGCCTTCTTTGAGCCTCCCCCAGGTCAAGGTGATGATGTTCTTAAAGGGTCCCAGATCACATATGTTACAGGTGTAGAAGCAGATGATGTTGTGTCTACACAGGTAGCCACAGTAACCCAGTCTGGGTTGAGTCAACAGGTTACACTCATATCACAAGATGGGACTCAGCATGTGAACATATCTCAAGCTGACATGCAGGCCATTGGCAATACCATCACAATGGTAACACAGGATGGCACGCCCATCACAGTCCCTGCTCATGACGCAGTCATCTCCTCAGCAGGAACACATTCTGTTGCTATGGTCACTGCGGAGGGTACAGAAGGGCAGCAGGTTGCAATTGTGGCTCAGGACCTAGCAGCGTTCCACACGGCCTCCTCAGAGATGGGGCACCAGCAGCACCACAGCCATCACTTAGTCACCACAGAAACCAGACCTCTGACCTTAGTGGCAACCTCCAATGGCACCCAGATTGCAGTTCAGCTTGGAGAACAGCCATCTCTGGAAGAAGCCATCAGAATAGCATCTAGGATCCAACAAGGAGAAACACCAGGGTTGGATGATTAA

XM_004851402.1 Coding sequence

LOC101701729 SPRY domain-containing protein 7-like, transcript variant X2

Length: 468 bp    Location: 1568939..1568284   Strand: -
>XM_004851402.1
ATGGGAGCTTCAGTGTTATGCTGCCTGCGATGCTGCAGGGATGGCAGGACCGGCCACATTCCTCAGGAGATGCCAGCCATGCAGCTGGACACGCAGCACATGGGAATCTGGGGTATTGGTGTTGCAACTCAGGTTAACCTCAATCAGATTCCTCTTGGCCAAGACATGCATAGTCTTGTGATGAGAAACGATGGAGCCCTGTATCACAACAACGAAGAGAAAAATAGGCTACTAGCGAATAGCCTTCCACAGGAGGGAGATATGGCGGGTATTACACATGACCATGTAGAATTAAATGTATATTTGAATGGAAAAAACATGCATTGTCCACCATCAGGCATACGAGGGACAGTGTATCCAGTTGTTTATGTTGATGACAGCGCAATTTTGGATTGCCAGTTCAGTGAATTTTATCATACTCCTCCACCTGGTTTTGAAAAAATACTATTTGAACAGCAGATCTTTTGA

XM_004851405.1 Coding sequence

Znf143 zinc finger protein 143, transcript variant X2

Length: 1920 bp    Location: 1604780..1662595   Strand: +
>XM_004851405.1
ATGTTGTTAGCCCAAATAAATCGGGATTCCCAAGGAATGACCGAGTTCCCTGGAGGAGGGATGGAGGCGCAGCATGTCACCCTGTGCCTCACAGAGGCAGTGACTGTGGCAGATGGTGACAACTTAGAAAACATGGAAGGTGTAAGCTTACAAGCAGTGACACTTGCAGACGGCTCTACCGCTTACATACAGCACAACTCGAAAGATGGAAAACTTATTGATGGGCAGGTCATTCAGTTGGAAGATGGTTCTGCTGCATATGTTCAACACGTACCCATACCTAAAAGTACAGGGGACAGTTTGCGTCTAGAGGATGGTCAAGCGGTGCAGTTGGAAGATGGGACCACAGCGTTTATTCACCACACCTCCAAAGATAGTTACGACCAGAGTGCACTACAGGCAGTTCAGCTGGAAGATGGTACCACGGCCTACATCCACCATGCAGTGCAAGTCCCGCAGTCTGACACCATCCTGGCAATTCAGGCTGATGGGACAGTGGCAGGGCTGCATACCGGGGATGCCACCATTGACCCTGACACCATCAGTGCTTTGGAACAGTATGCAGCAAAGGTGTCCATTGATGGAAGTGAAAGTGTAACGGGTACTGGAATGATTGGAGAAAATGAGCAAGAGAAAAAAATGCAGATTGTCCTACAAGGACATGCGACGAGAGTAACTGCTAAATCTCAACAGAGTGGAGAGAAGGCATTCCGATGTGAATATGATGGATGTGGAAAATTATATACAACAGCTCACCATCTAAAGGTCCATGAGAGGTCACACACGGGAGACCGGCCTTATCAGTGTGAGCATGCGGGCTGTGGGAAAGCATTCGCAACAGGTTATGGATTAAAAAGTCATTTCAGAACTCATACAGGAGAAAAGCCATATCGGTGTTCAGAAGATAACTGTACTAAATCTTTCAAAACTTCAGGAGACCTACAGAAACATATTAGAACTCATACAGGAGAAAGACCTTTTAAGTGTCCCTTTGAAGGCTGTGGTCGGTCCTTTACAACATCAAATATCAGAAAAGTACACGTTAGGACACACACAGGAGAAAGACCTTATTACTGCACAGAACCAGGATGTGGGAGGGCATTTGCCAGTGCAACCAACTATAAAAACCATGTGAGGATACACACAGGGGAAAAGCCATATGTCTGTACAGTTCCTGGGTGTGACAAAAGGTTTACAGAATATTCCAGTTTATACAAACACCATGTCGTTCACACTCACTCCAAACCATACAACTGTAACCATTGTGGGAAGACATACAAGCAGATCTCCACGCTGGCCATGCACAAGCGGTCGGCCCACAATGACACTGAGCCCATCGAGGAGGAGCAAGAAGCCTTCTTTGAGCCTCCCCCAGGTCAAGGTGATGATGTTCTTAAAGGGTCCCAGATCACATATGTTACAGGTGTAGAAGCAGATGATGTTGTGTCTACACAGGTAGCCACAGTAACCCAGTCTGGGTTGAGTCAACAGGTTACACTCATATCACAAGATGGGACTCAGCATGTGAACATATCTCAAGCTGACATGCAGGCCATTGGCAATACCATCACAATGGTAACACAGGATGGCACGCCCATCACAGTCCCTGCTCATGACGCAGTCATCTCCTCAGCAGGAACACATTCTGTTGCTATGGTCACTGCGGAGGGTACAGAAGGGCAGCAGGTTGCAATTGTGGCTCAGGACCTAGCAGCGTTCCACACGGCCTCCTCAGAGATGGGGCACCAGCAGCACCACAGCCATCACTTAGTCACCACAGAAACCAGACCTCTGACCTTAGTGGCAACCTCCAATGGCACCCAGATTGCAGTTCAGCTTGGAGAACAGCCATCTCTGGAAGAAGCCATCAGAATAGCATCTAGGATCCAACAAGGAGAAACACCAGGGTTGGATGATTAA

XM_004851406.1 Coding sequence

Znf143 zinc finger protein 143, transcript variant X3

Length: 1920 bp    Location: 1606649..1662595   Strand: +
>XM_004851406.1
ATGTTGTTAGCCCAAATAAATCGGGATTCCCAAGGAATGACCGAGTTCCCTGGAGGAGGGATGGAGGCGCAGCATGTCACCCTGTGCCTCACAGAGGCAGTGACTGTGGCAGATGGTGACAACTTAGAAAACATGGAAGGTGTAAGCTTACAAGCAGTGACACTTGCAGACGGCTCTACCGCTTACATACAGCACAACTCGAAAGATGGAAAACTTATTGATGGGCAGGTCATTCAGTTGGAAGATGGTTCTGCTGCATATGTTCAACACGTACCCATACCTAAAAGTACAGGGGACAGTTTGCGTCTAGAGGATGGTCAAGCGGTGCAGTTGGAAGATGGGACCACAGCGTTTATTCACCACACCTCCAAAGATAGTTACGACCAGAGTGCACTACAGGCAGTTCAGCTGGAAGATGGTACCACGGCCTACATCCACCATGCAGTGCAAGTCCCGCAGTCTGACACCATCCTGGCAATTCAGGCTGATGGGACAGTGGCAGGGCTGCATACCGGGGATGCCACCATTGACCCTGACACCATCAGTGCTTTGGAACAGTATGCAGCAAAGGTGTCCATTGATGGAAGTGAAAGTGTAACGGGTACTGGAATGATTGGAGAAAATGAGCAAGAGAAAAAAATGCAGATTGTCCTACAAGGACATGCGACGAGAGTAACTGCTAAATCTCAACAGAGTGGAGAGAAGGCATTCCGATGTGAATATGATGGATGTGGAAAATTATATACAACAGCTCACCATCTAAAGGTCCATGAGAGGTCACACACGGGAGACCGGCCTTATCAGTGTGAGCATGCGGGCTGTGGGAAAGCATTCGCAACAGGTTATGGATTAAAAAGTCATTTCAGAACTCATACAGGAGAAAAGCCATATCGGTGTTCAGAAGATAACTGTACTAAATCTTTCAAAACTTCAGGAGACCTACAGAAACATATTAGAACTCATACAGGAGAAAGACCTTTTAAGTGTCCCTTTGAAGGCTGTGGTCGGTCCTTTACAACATCAAATATCAGAAAAGTACACGTTAGGACACACACAGGAGAAAGACCTTATTACTGCACAGAACCAGGATGTGGGAGGGCATTTGCCAGTGCAACCAACTATAAAAACCATGTGAGGATACACACAGGGGAAAAGCCATATGTCTGTACAGTTCCTGGGTGTGACAAAAGGTTTACAGAATATTCCAGTTTATACAAACACCATGTCGTTCACACTCACTCCAAACCATACAACTGTAACCATTGTGGGAAGACATACAAGCAGATCTCCACGCTGGCCATGCACAAGCGGTCGGCCCACAATGACACTGAGCCCATCGAGGAGGAGCAAGAAGCCTTCTTTGAGCCTCCCCCAGGTCAAGGTGATGATGTTCTTAAAGGGTCCCAGATCACATATGTTACAGGTGTAGAAGCAGATGATGTTGTGTCTACACAGGTAGCCACAGTAACCCAGTCTGGGTTGAGTCAACAGGTTACACTCATATCACAAGATGGGACTCAGCATGTGAACATATCTCAAGCTGACATGCAGGCCATTGGCAATACCATCACAATGGTAACACAGGATGGCACGCCCATCACAGTCCCTGCTCATGACGCAGTCATCTCCTCAGCAGGAACACATTCTGTTGCTATGGTCACTGCGGAGGGTACAGAAGGGCAGCAGGTTGCAATTGTGGCTCAGGACCTAGCAGCGTTCCACACGGCCTCCTCAGAGATGGGGCACCAGCAGCACCACAGCCATCACTTAGTCACCACAGAAACCAGACCTCTGACCTTAGTGGCAACCTCCAATGGCACCCAGATTGCAGTTCAGCTTGGAGAACAGCCATCTCTGGAAGAAGCCATCAGAATAGCATCTAGGATCCAACAAGGAGAAACACCAGGGTTGGATGATTAA

XM_004851404.1 Coding sequence

Znf143 zinc finger protein 143, transcript variant X1

Length: 1920 bp    Location: 1604200..1662595   Strand: +
>XM_004851404.1
ATGTTGTTAGCCCAAATAAATCGGGATTCCCAAGGAATGACCGAGTTCCCTGGAGGAGGGATGGAGGCGCAGCATGTCACCCTGTGCCTCACAGAGGCAGTGACTGTGGCAGATGGTGACAACTTAGAAAACATGGAAGGTGTAAGCTTACAAGCAGTGACACTTGCAGACGGCTCTACCGCTTACATACAGCACAACTCGAAAGATGGAAAACTTATTGATGGGCAGGTCATTCAGTTGGAAGATGGTTCTGCTGCATATGTTCAACACGTACCCATACCTAAAAGTACAGGGGACAGTTTGCGTCTAGAGGATGGTCAAGCGGTGCAGTTGGAAGATGGGACCACAGCGTTTATTCACCACACCTCCAAAGATAGTTACGACCAGAGTGCACTACAGGCAGTTCAGCTGGAAGATGGTACCACGGCCTACATCCACCATGCAGTGCAAGTCCCGCAGTCTGACACCATCCTGGCAATTCAGGCTGATGGGACAGTGGCAGGGCTGCATACCGGGGATGCCACCATTGACCCTGACACCATCAGTGCTTTGGAACAGTATGCAGCAAAGGTGTCCATTGATGGAAGTGAAAGTGTAACGGGTACTGGAATGATTGGAGAAAATGAGCAAGAGAAAAAAATGCAGATTGTCCTACAAGGACATGCGACGAGAGTAACTGCTAAATCTCAACAGAGTGGAGAGAAGGCATTCCGATGTGAATATGATGGATGTGGAAAATTATATACAACAGCTCACCATCTAAAGGTCCATGAGAGGTCACACACGGGAGACCGGCCTTATCAGTGTGAGCATGCGGGCTGTGGGAAAGCATTCGCAACAGGTTATGGATTAAAAAGTCATTTCAGAACTCATACAGGAGAAAAGCCATATCGGTGTTCAGAAGATAACTGTACTAAATCTTTCAAAACTTCAGGAGACCTACAGAAACATATTAGAACTCATACAGGAGAAAGACCTTTTAAGTGTCCCTTTGAAGGCTGTGGTCGGTCCTTTACAACATCAAATATCAGAAAAGTACACGTTAGGACACACACAGGAGAAAGACCTTATTACTGCACAGAACCAGGATGTGGGAGGGCATTTGCCAGTGCAACCAACTATAAAAACCATGTGAGGATACACACAGGGGAAAAGCCATATGTCTGTACAGTTCCTGGGTGTGACAAAAGGTTTACAGAATATTCCAGTTTATACAAACACCATGTCGTTCACACTCACTCCAAACCATACAACTGTAACCATTGTGGGAAGACATACAAGCAGATCTCCACGCTGGCCATGCACAAGCGGTCGGCCCACAATGACACTGAGCCCATCGAGGAGGAGCAAGAAGCCTTCTTTGAGCCTCCCCCAGGTCAAGGTGATGATGTTCTTAAAGGGTCCCAGATCACATATGTTACAGGTGTAGAAGCAGATGATGTTGTGTCTACACAGGTAGCCACAGTAACCCAGTCTGGGTTGAGTCAACAGGTTACACTCATATCACAAGATGGGACTCAGCATGTGAACATATCTCAAGCTGACATGCAGGCCATTGGCAATACCATCACAATGGTAACACAGGATGGCACGCCCATCACAGTCCCTGCTCATGACGCAGTCATCTCCTCAGCAGGAACACATTCTGTTGCTATGGTCACTGCGGAGGGTACAGAAGGGCAGCAGGTTGCAATTGTGGCTCAGGACCTAGCAGCGTTCCACACGGCCTCCTCAGAGATGGGGCACCAGCAGCACCACAGCCATCACTTAGTCACCACAGAAACCAGACCTCTGACCTTAGTGGCAACCTCCAATGGCACCCAGATTGCAGTTCAGCTTGGAGAACAGCCATCTCTGGAAGAAGCCATCAGAATAGCATCTAGGATCCAACAAGGAGAAACACCAGGGTTGGATGATTAA

XM_004851393.1 Coding sequence

LOC101697000 chromosome unknown open reading frame, human C11orf16, transcript variant X3

Length: 1425 bp    Location: 1079094..1069196   Strand: -
>XM_004851393.1
ATGCCTTTGCCGAAGTACTGCAGCGTGGCCACAACCCTGCAGGCCCCTGGCTGGGGCTGTGCTGCCCTACTGGGGGACCTCTCCTTCGCCTGCCCCTTTGCTCACAGAGCACCTGGGCTCCCCAGGCTCCATGTTCTCACCAGGAATTCTTCGAATCACCCATCTCTCCACATTGCTGACCCAGCCTGGCAGGGCCCGGGCTGGCTGGGAAGAGTTAGAGATCCTGCTAACACCTGGGTCCTGGCAAGGAGGGAACCAGATGGCTTTTATTACCGGGCTCAGATAAAGGCTGCTCCAGAGCTGGAGAGTCAGAGGGTCCTGCTTGTGGAATTTGAGTCTCCCCTTTTCACAGGCCCCAAGCTGCCAGCCCAGAGGCAGAGTGTGGTCTCAGAAGAAGATGTTATTCAGCTCTCACCATTTGTGGAATATTCACTGCGACCTGGGGACAAGGTGCTGGCAGCATGGGAACCAGGCCGACAGCGGTATGGTCCTGGCATTGTTCTCTTGGGCTCAGAGATTCGAGACAATCAGCCAGCATCAAAGGAGGAGGAAATTACTGTTCACTTCTGGAATGGCAAGACAGCTCAGGTGCCTCTAGGTGGGGTCAGGTGGGTGCCCCCCACTGTCTGGAAGAAGGCCATGGAGAGGCTGAGTAAGCCTCGCACCAGTGAGGACCCCAGTGCCCTCCTCTGTGCCCCTTGCTGCTCTCCGCTGGGGACAGTCACTGGAGGCATCACCAACAGGCTTCCTCCGGACACTGCATTCCTGTGCCCTCCCTGCCATCCCCAGGCCTGCTGCCAGCCGCTGTGCCAGGGCTACTGCTGTCCCCTGATGAGCCCCACCTGGTGGCCTCTCACTGGGACCTCAGATATCACGGCCAGAGAACTCCCGGTGTCAGAGCTGAAGCCCGCAGCACAGCTTTTGCCCCTAGAAGGTCCTAAAGAGGAGGCAGGGGCAGTGCGTGCATCCCTTGCTGTTTCTTCCTCTTCCTCCTCCTCCTCTTGTGAAGAAGATTTGGAGGAGAACCTGGAAATGGGCCTTCCCCAGACACTGATGGTGAACAGCGCAGTCAACACTGACCCCATCCTCCCCAAGAGGCCTTTGGCGCAGAGCGGCCCCCGCCAGCCGGAGTGGAGGTATTGGAAGAGGAACGGACAGGAGCCCCGTCCTGGAAAGCCAGGAATAAAATGTCGCAGCATCCAGAAAGATGACAACAAACAAGAGAAAGTACAAACTGCAGTAGTGGGGACTACCAAGAAGCTAGCCCTGAAAGCAACCATGATGCCACTGCAGACCCTGCCAGAGGGAGCTGAATACAGAAAACTGGGTCCAGGTATCATAAGGCATCAGCAGGACAAAAATCTGCCCAACAGGAAAAGCCCTAAGGATCTAGGAAATGAAAGGATAACAATAGTAAATATTTGA

XM_004851394.1 Coding sequence

Ascl3 achaete-scute complex homolog 3 (Drosophila)

High confidence: 4 potential gene matches
Length: 546 bp    Location: 1082248..1081694   Strand: -
>XM_004851394.1
ATGATGGACAATAGAAGCCACTCTAATCCTCCAGACACATTTCCTGTCTTCTCTGATTCTGCCCACTTGCCACTACCCAGGTCCTTCTATCTGGACCCCATGGTCACTTTCCACTTGTACCCTGAGGCCCAGGTGCCATCTGCTTACTCTGAAGAGCTGCCATTGTTGCCTTTTCCCAGTGACTCCCTGATCATGGAAAATTATGGTGAACCCTACCCCTTCCCTTTCCCAATGCCTTACCCAAATTTCAGAAGATGCGAATACTCCTATGGGCCAGCCTTCATCAGGAAACGGAATGAGCGGGAAAGGCAGAGAGTAAAGTGTGTCAACGAAGGCTATGCCCAGCTCCGACATCATCTGCCAGAGGAGTATTTGGAGAAGCGACTCAGCAAAGTGGAAACTCTCCGAGCTGCAATCAAATACATTAACTACCTGCAATCTCTTCTGTACCCTGATAAGGCTGAGACCAAGAATAACCCTGGGAAAGACTCTTCCCTAATGGCAACTTCCAGCTGCCATGCTGACCCTATTTTTAGAATTGTTTGA

XM_004851383.1 Coding sequence

Rpl27a ribosomal protein L27a

High confidence: 2 potential gene matches
Length: 447 bp    Location: 833502..836185   Strand: +
>XM_004851383.1
ATGCCATCCAGACTGAGGAAGACCCGGAAACTTAGGGGCCACGTGAGCCACGGCCACGGCCGCATCGGCAAGCACCGGAAGCACCCAGGAGGCCGGGGTAATGCTGGTGGCATGCATCACCACAGGATCAACTTCGACAAATATCACCCAGGTTACTTTGGGAAGGTTGGTATGAGGCATTACCACTTAAAGAGAAACCAGAGCTTCTGCCCAACTGTCAACCTTGATAAATTGTGGACATTGGTCAGTGAGCAGACACGAGTAAATGCTGCCAAAAACAAGACTGGAGTAGCTCCCATCATTGATGTAGTGCGATCGGGCTACTACAAAGTTCTTGGGAAAGGAAAGCTCCCAAAGCAGCCTGTCATCGTGAAGGCCAAATTCTTCAGCAGAAGAGCTGAGGAGAAGATTAAGGGTGTTGGGGGGGCCTGTGTCCTGGTGGCTTGA

XM_004851380.1 Coding sequence

Stk33 serine/threonine kinase 33, transcript variant X1

Length: 1545 bp    Location: 761582..540756   Strand: -
>XM_004851380.1
ATGGCTGACAGCAGTTTAAATAAAAACTCCACAAATTGCCCCAGTAGTTCTCAGAAAGATGGACTTTATTGTGATGCAAGCATTTCTCCAGTTTTGGTGGTGGAAATGTCACAGACATCAAGTACTGATAGTACAGAATTTTTATTTCCGCCAGATAGAAAAAAAGAAAAAATTACCAGCAGAGATGTTTCTGGGAATGATTTGCTATTAGGAACCTCAATCATAGAGAGAAAAACATCTCACCAGCAGTGGGGTCGAAGCAATGTTATGGAAGGAAAAGTTCCTCACATAAGGATGGAGAGTGGAGCAGCTATTGAGGAATTCTATACTTTTGGAAGAACGCTGGGACAAGGAAGTTTTGGAATGGTCTTTGAAGCTATAGACAAGGAAACAGACACTAAGTGGGCAATTAAAAAAGTAAATAAAGAAAAGGCTGGAAGTTCTGCTGTGAAGTTACTTGAACGGGAGGTGAACATCCTAAAAAGTGTAAAACATGAGCACATCATACATTTGGAACAAATATTTGAGACGCCTAAGAAAATGTACCTTGTGATGGAACTTTGTGAGGATGGAGAACTCAAAGAAATTTTGGATAGGAAAAGGCATTTCTCAGAGAATGAGACGAGGTGGATCATTCAAAGTCTTGCATCAGCTATTGTATATCTTCACAATAAGGATATAGTACATAGAGATCTAAAACTGGAAAACATAATGGTTAAAAGCAGCTTTATTGATGCAAACAATGAAATGAACTTAAATATAAAGGTGACTGATTTTGGCTTAGCAGTGCAGAAGCATGGTAGGAGTGAAGCCATGCTGCAGGCCACCTGTGGGACTCCTATCTATATGGCACCTGAAGTTATCAATGCCCACGACTACAGCCAGCAATGTGACATTTGGAGCGTAGGTGTCATAATGTACATTTTATTATGTGGAGAACCACCCTTTTTGGCAAACTCAGAAGAGAAGCTTTTTGAGTTAATAAGAAAGGGAGAACTACATTTTGAGGATCCAATCTGGAATTCCATAAGTGATAGTGCTAAAAGTGTTTTGAAACAGCTTTTGAAAGTAGATCCTGCTCACAGAATCACAGCTAAGGAACTACTAGATAACCAGTGGTTAACAGGCAATACACTTTCTTCAGTGAGACCAACAAATGTATTAGAAATGATGAAAGAATGGAAAAATAACCCAGAAAGTGACGAGGAAAACAAGAAAGAGGAGAAGAATAATCAGTTCCGTCAAGAAAAGTTGGAATATCACCAGCAACGCAGAAATGTCCCTGCTGTCAATGACACTTCAGGTGAAAAGGAGGAAAACCCAGCAAAACAACCCACTGCTTATGAAAAGAAATTGCCTGCAACCAGTAAGAAGGCAGATACAAATGACTTTGACACGTGCTGTTCAAGTTCCACATCTAGCAAACTCCTTCCACCTGCACTCAAGGGAGAAGTACAGAAAAGTTCTGTGACTCCAAGCCAAGGAGGAGCAACCAAATCCACTGCTAAATCCACTGCCCTGTTTCGAAGCAAAAAAACCCCCTAA

XM_004851385.1 Coding sequence

St5 suppression of tumorigenicity 5, transcript variant X2

Length: 2154 bp    Location: 953429..842702   Strand: -
>XM_004851385.1
ATGACCATGACTGCCAACAAGAATTCCAGCATCACTCACAGAGCCGGAGGCACTAAGACACCTCGGGAGACTCTGAGCAGAAAATCCTTTGAGTTTGAGGATGCATCCAGTCTCCAGTCCCTGTACCCCTCTTCTCCCACTGAGAATGGTACTGAGAGCCAGCCTAAGTTTGGATCCAAAAGCACTTTAGAAGAGAATGCCTATGAAGATATTGTGGGAGAGCTGCCCAAGGAGAATCCATATGAGGATGTGGACTTAAAGAGCCGAAGAGCCGGACGAAAACCTCAGCAACTGTCTGAGAACTCCTTGGACTCTTTGCACAGGATGTGGAGTCCTCAGGACAGGAAGTACAACAACCCACCCATGCAGCTTTCCCTGAAACCCAGCAGCCAGTCCCTGCGCAGTGGGAACTGGTCAGAAAGGAAGAGCCACCGGCTGCCACGTTTGCCCAAGCGGCACAGCCACGATGACATGCTGCTGCTGGCTCAGCTGAGCCTGCCATCTTCACCCTCCAGCCTCAACGAGGACAGCCTCAGCACCGCCAGTGAGCTGCTGTCCAGCCGCCGGGCCCGCCGCGTCCCCAAGCTTGTCCAAAGAATTAACTCCATCTACAATGCCAAGAGGGGAAAGAAGAGATTAAAAAAGCTGTCTATGTCCAGCCTTGAGACAGCATCACTGAGAGATGAGAACAGTGAGAGTGAGAGCGACTCTGATGACAGGTTCAAAGCTCACACGCAGCGCCTGGTCCACATCCAGTCAATGCTGAAACGCGCACCCAGCTACCGGACGCTGGAGCTGGAGCTGCTTGAGTGGCAGGAGCGGGAGCTTTTCGAGTACTTTGTGGTAGTGTCCCTCAAGAAGAAGCCGTCCCGCAACACTTACCTCCCTGAGGTCTCCTACCAGTTCCCCAAGCTGGACCGACCCACCAAGCAGATGCGCGAGGCAGAGGAAAGGCTCAAAGCCATTCCTCAGTTTTGCTTTCCAGATGCCAAGGATTGGTTCCCTGTGTCAGAGTATAGCAGTGAGACCTTTTCTTTCATGCTGACGGGGGAAGATGGCAGCAGACGCTTTGGCTATTGCCGGCGCTTACTGCCGAGTGGGAAGGGACCTCGGTTGCCAGAGGTATACTGTGTCATCAGCCGCCTTGGCTGCTTCGGCTTGTTTTCCAAGGTCCTCGACGAGGTGGAGCGCCGGCGTGGGATCTCCGCGGCATTGGTCTACCCCTTCATGAGGAGTCTCATGGAGTCGCCCTTCCCAGCCCCGGGGAAGACGATCAAAGTGAAGACATTCTTGCCAGGTGCTGGCAATGAGGTGTTAGAGCTGCGTCGGCCCATGGACTCCCGGCTGGAGCATGTGGACTTTGAGTGCCTTTTTACCTGCCTCAGTGTGCGCCAGCTCATCCGAATCTTTGCCTCACTGCTGCTGGAACGTCGGGTCATTTTTGTAGCAGATAAGCTCAGTACTCTGTCCAGCTGTTCCCATGCCGTGGTGGCCTTGCTCTACCCCTTCTCCTGGCAGCACACCTTCATTCCTGTCCTCCCGGCCTCCATGATTGACATCGTGTGTTGTCCCACTCCTTTCCTGGTCGGCCTGCTCTCCAGCTCCCTCCCCAAACTGAAGGAGCTTCCTGTGGAGGAGGCGCTGATGGTGAACCTGGGATCTGACCGATTCATCCGACAGATGGATGATGAGGACACCTTGTTACCTAGGAAGTTACAAGCAGCTCTGGAGCAGGCTCTAGAGAGGAAGAATGAACTGATCTCCCAGGATTCTGACAGTGACTCCGATGATGAATGTAATACCCTCAATGGGCTGGTGTCAGAGGTGTTTATTCGGTTCTTTGTGGAGACCGTTGGGCACTACTCCCTCTTCCTGACCCAGAGTGACAAGGGGGAGAGGGCCTTTCAGCGAGAGGCCTTCCGCAAGTCTGTGGCCTCTAAAAGCATCCGCCGTTTCCTTGAAGTTTTTATGGAGTCTCAGATGTTTGCTGGCTTCATCCAAGACAGGGAGCTAAGAAAGTGTCGGGCAAAGGGCCTCTTTGAGCAGCGAGTGGAACAGTATTTAGAGGAGCTCCCTGACACTGAGCAGAGTGGAATGAATAAATTTCTCCGAGGCTTAGGCAACAAAATGAAGTTCCTCCACAAGAAGAATTAA

XM_004851375.1 Coding sequence

Ric3 resistance to inhibitors of cholinesterase 3 homolog (C. elegans), transcript variant X1

Length: 1101 bp    Location: 338544..296627   Strand: -
>XM_004851375.1
ATGGCTTACTCCACTGTGCAGAGGGTGGCCCTCGCCTCGGGGCTCGTCCTGGCGTTGTCCCTGCTGCTGCCCAAAGCCTTCCTGTCCCGCTGGAAGCAGCCGCCGCCGCCGTCGGCACTCGAAGGAAAATTGGGCCGATTACCCCCTATAATGCATCATCAACCAGCTCCCTCAGATGGCCAGACTCCTGGGGGTCGTTTCCAGAGGTCTCACCTCGCAGAGGCATTTGCAAAAGCTAAAGGATCAGGTGGAGGCGCTGGAGGAGGTAGTGGAAGAGGCCTGATGGGGCAAATTATTCCAATCTATGGTTTTGGGATTTTTCTATATATATTATACATTCTATTTAAGCTCTCAAAGGGGAAAACTGCAGAGGATCTGAAATGCTCTACTGCCACACCTGGAAACACCCACAGGAAAATTACCAATTTTGAACTTGCTCAACTGCAAGAAAAACTAAAAGAGACAGAGGAAGCCATGGAAAAATTAATCAACAGAGTGGGACCGAATGGTGAGAGCAGAGCACAGACTGTGACTTCTGACCAAGAAAAACGATTGCTGCATCAGCTCCGAGAAATCACCAGGGTTATGAAAGAAGGAAAGTTCATTGACAGGTCTACTCCTGAGAAGGAAGCTGAGGAAGCCCCTTACATGGAGGATTGGGAAGGTTACCCTGAAGAAACTTACCCAATTTATGACCTTTCAGACTGTATCAAGCATAGGCAAGAAACAATCCTGGTGGATTACCCTGATCCAAAAGAGCCCTCTGCTGAAGAAATAGCTGAAAGAATGGGAGAGCTGGAAGAAGAATCAGACCATTTGGGCTGGGAACGTCTGCCCACTGACTCTAGAGTCCAGGAAGATAATTCTGTTGCCTTGTGTGACCCAAAGCCAGAAACATGTTCCTGCTGTTTTCATCAAGATGATCCTGTTGTCTTGGCAGAGAATGCTGGATTCAGTGCAGATAGCTACACTGATGAACAAGAGGAAACCACCAAAGAATACCGGACCCAAGACTTTAGAGATGAAGGGTTGGGCATCAGCCCTGATAAAACATGTATAGGTGGCATGCTGAGGAAGCGTAACTCCCAGGGTTTAGAGTAA

XM_004851377.1 Coding sequence

Ric3 resistance to inhibitors of cholinesterase 3 homolog (C. elegans), transcript variant X3

Length: 951 bp    Location: 326461..296627   Strand: -
>XM_004851377.1
ATGCATCATCAACCAGCTCCCTCAGATGGCCAGACTCCTGGGGGTCGTTTCCAGAGGTCTCACCTCGCAGAGGCATTTGCAAAAGCTAAAGGATCAGGTGGAGGCGCTGGAGGAGGTAGTGGAAGAGGCCTGATGGGGCAAATTATTCCAATCTATGGTTTTGGGATTTTTCTATATATATTATACATTCTATTTAAGCTCTCAAAGGGGAAAACTGCAGAGGATCTGAAATGCTCTACTGCCACACCTGGAAACACCCACAGGAAAATTACCAATTTTGAACTTGCTCAACTGCAAGAAAAACTAAAAGAGACAGAGGAAGCCATGGAAAAATTAATCAACAGAGTGGGACCGAATGGTGAGAGCAGAGCACAGACTGTGACTTCTGACCAAGAAAAACGATTGCTGCATCAGCTCCGAGAAATCACCAGGGTTATGAAAGAAGGAAAGTTCATTGACAGGTCTACTCCTGAGAAGGAAGCTGAGGAAGCCCCTTACATGGAGGATTGGGAAGGTTACCCTGAAGAAACTTACCCAATTTATGACCTTTCAGACTGTATCAAGCATAGGCAAGAAACAATCCTGGTGGATTACCCTGATCCAAAAGAGCCCTCTGCTGAAGAAATAGCTGAAAGAATGGGAGAGCTGGAAGAAGAATCAGACCATTTGGGCTGGGAACGTCTGCCCACTGACTCTAGAGTCCAGGAAGATAATTCTGTTGCCTTGTGTGACCCAAAGCCAGAAACATGTTCCTGCTGTTTTCATCAAGATGATCCTGTTGTCTTGGCAGAGAATGCTGGATTCAGTGCAGATAGCTACACTGATGAACAAGAGGAAACCACCAAAGAATACCGGACCCAAGACTTTAGAGATGAAGGGTTGGGCATCAGCCCTGATAAAACATGTATAGGTGGCATGCTGAGGAAGCGTAACTCCCAGGGTTTAGAGTAA

XM_004851372.1 Coding sequence

Tub tubby homolog (mouse), transcript variant X6

Length: 1602 bp    Location: 268837..293806   Strand: +
>XM_004851372.1
ATGACTTCCAAACCGCATTCCGACTGGATTCCCTACAGTGTCTTAGATGATGAGGGCAGCAACCTGAGGCAACAGAAGCTTGACCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAAAAACGCCAGGAGTCCCTGATGGTGCAGGCCAATCCCGAAGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAGCAGGCCCCTCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGTTCAAGAGGCCGACTCACTCGCCAGTGTGCAGCTGGGAGCTGCCCGCCCAACAACACCAACCTCAGCCAAGAGAACCAAGGCAGCAGCTTCAGCAGGGGGCCAGGGTGGGGCCTCTAGGAAGGAGAAGAAGGGAAGGCACAAAGGCACCGGCGGGCCAGCAGCACCGGCAGAAGACAAGTCTGAGGCCCAAGGCCCAGTGCAGATCCTGACTGTGGGCCAGTCGGACCACGACACAGGAGAGACAGCAGCCAGTGGGGGCGCACGGCCCAGCGGGCAGGACCTCCGTGCCACGATGCAGAGGAAGGGAATCTCCAGCAGCATGAGCTTTGACGAGGAAGAGGAGGATGAGGATGAGAACAGCTCTAGCTCCTCCCAGCTAAACAGCAACACCCGCCCCAGCTCCGCCACTAGCAGGAAGTCCATCAGGGAGGCAGCCTCAGCGCCCAGCCCAACAGCCCCAGAGCCGAAGGTGGGTGTTGAGGTCCAGGACCTTGAGGAATTTGCACTCCGGCCGGCCCCCCAGGGCATTACCATCAAATGCCGAATCACCCGGGACAAGAAGGGGATGGACCGGGGCATGTACCCCACCTACTTCCTGCACCTGGACCGTGAGGACGGGAAGAAGGTGTTCCTCCTGGCCGGAAGGAAGAGAAAGAAGAGTAAAACGTCCAATTACCTCATCTCTGTGGACCCAACGGACCTGTCTCGAGGAGCAGACAGTTACATCGGGAAACTGCGGTCCAATCTGATGGGCACCAAGTTCACCGTTTATGACAATGGAGTCAACCCTCAGAAGGCGTCATCCTCTACTTTGGAAAGTGGGACCTTGCGCCAGGAGCTGGCAGCTGTGTGCTATGAGACAAACGTCTTAGGCTTCAAGGGGCCTCGGAAGATGAGTGTGATTGTCCCTGGCATGAACATGGTTCATGAGAGAGTCTCTATCCGTCCCCGAAACGAACATGAGACACTGCTAGCCCGATGGCAGAATAAGAACACAGAGAGTATCATCGAGCTGCAAAACAAGACCCCCGTCTGGAATGACGACACACAGTCCTACGTACTCAACTTCCACGGGCGCGTCACACAGGCCTCTGTGAAGAACTTCCAGATCATCCATGGCAATGACCGAGACACTCCACCCCTCTCCTCTGTTCTCCTGTGCCTCCCTCCCCCTGTCAAGGTCCAGGCAGAGCTGGAAATGAGGCTGAGGTCTAGAGTTTCCTACAGAACAATTCAGAATGGCTTAGAAGGGGGAGCCCAACTCTGGCCTCTTCATTCCTGCATTTGGGTGACAGAGGGGACTTGGTCAGGATGGGTAACCTTTTTCTTGCTGAGAACGCATATTTAG

XM_004851368.1 Coding sequence

Tub tubby homolog (mouse), transcript variant X2

Length: 1725 bp    Location: 222907..293806   Strand: +
>XM_004851368.1
ATGCCTGCTGACCAGCCTTCTGCAAAGGGAGGCACTCCCTGGCCCATGGGATCTCAGCATTCAAAGCAGCACAGGAAAGCTGGGCCCCTGAAACGAGGCCACCGAAGAGATCGGAGCTCAAGCAGGAGGAAGTACTGGAAGGAAGGAAGGGAGATCGCTGGTGTCTTAGATGATGAGGGCAGCAACCTGAGGCAACAGAAGCTTGACCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAAAAACGCCAGGAGTCCCTGATGGTGCAGGCCAATCCCGAAGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAGCAGGCCCCTCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGTTCAAGAGGCCGACTCACTCGCCAGTGTGCAGCTGGGAGCTGCCCGCCCAACAACACCAACCTCAGCCAAGAGAACCAAGGCAGCAGCTTCAGCAGGGGGCCAGGGTGGGGCCTCTAGGAAGGAGAAGAAGGGAAGGCACAAAGGCACCGGCGGGCCAGCAGCACCGGCAGAAGACAAGTCTGAGGCCCAAGGCCCAGTGCAGATCCTGACTGTGGGCCAGTCGGACCACGACACAGGAGAGACAGCAGCCAGTGGGGGCGCACGGCCCAGCGGGCAGGACCTCCGTGCCACGATGCAGAGGAAGGGAATCTCCAGCAGCATGAGCTTTGACGAGGAAGAGGAGGATGAGGATGAGAACAGCTCTAGCTCCTCCCAGCTAAACAGCAACACCCGCCCCAGCTCCGCCACTAGCAGGAAGTCCATCAGGGAGGCAGCCTCAGCGCCCAGCCCAACAGCCCCAGAGCCGAAGGTGGGTGTTGAGGTCCAGGACCTTGAGGAATTTGCACTCCGGCCGGCCCCCCAGGGCATTACCATCAAATGCCGAATCACCCGGGACAAGAAGGGGATGGACCGGGGCATGTACCCCACCTACTTCCTGCACCTGGACCGTGAGGACGGGAAGAAGGTGTTCCTCCTGGCCGGAAGGAAGAGAAAGAAGAGTAAAACGTCCAATTACCTCATCTCTGTGGACCCAACGGACCTGTCTCGAGGAGCAGACAGTTACATCGGGAAACTGCGGTCCAATCTGATGGGCACCAAGTTCACCGTTTATGACAATGGAGTCAACCCTCAGAAGGCGTCATCCTCTACTTTGGAAAGTGGGACCTTGCGCCAGGAGCTGGCAGCTGTGTGCTATGAGACAAACGTCTTAGGCTTCAAGGGGCCTCGGAAGATGAGTGTGATTGTCCCTGGCATGAACATGGTTCATGAGAGAGTCTCTATCCGTCCCCGAAACGAACATGAGACACTGCTAGCCCGATGGCAGAATAAGAACACAGAGAGTATCATCGAGCTGCAAAACAAGACCCCCGTCTGGAATGACGACACACAGTCCTACGTACTCAACTTCCACGGGCGCGTCACACAGGCCTCTGTGAAGAACTTCCAGATCATCCATGGCAATGACCGAGACACTCCACCCCTCTCCTCTGTTCTCCTGTGCCTCCCTCCCCCTGTCAAGGTCCAGGCAGAGCTGGAAATGAGGCTGAGGTCTAGAGTTTCCTACAGAACAATTCAGAATGGCTTAGAAGGGGGAGCCCAACTCTGGCCTCTTCATTCCTGCATTTGGGTGACAGAGGGGACTTGGTCAGGATGGGTAACCTTTTTCTTGCTGAGAACGCATATTTAG

XR_205542.1 Non-coding sequence

LOC101702555 PREDICTED: Heterocephalus glaber uncharacterized LOC101702555 (LOC101702555), misc_RNA.

Length: 198 bp     
>XR_205542.1
TGCTTTGATGTTTATATTTGCTACCAAAATATCTAAGCCAGAGTCAGCTGGCAACTCCGGCAGGGATCATCTAGGTTTGATATCCAATTTCCAGTCTGATGGATGAGCCAACTGGAAGAATAACTCCAGCTATCGACATGGTGACACCCTGGGATGCTTTTTCAGAGATCCAACAGTAAAAGAATGGGAAAAAATAAG

XM_004851557.1 Coding sequence

Prmt3 protein arginine methyltransferase 3

High confidence: 4 potential gene matches
Length: 1593 bp    Location: 11669839..11797133   Strand: +
>XM_004851557.1
ATGTGCTCGTTGGCGCCGGGCGCTGTTGGTGGCCGGGGCGCCGTGGAGGAGGAGGATGACCTGCCGGAACTGTCGGACAGCGGGGACGACGCCGCTTGGGAGGACGACGACGAGGCCGACCCGCCCCACGACGGGCAGCAGACCCCCTGCCTGTTCTGTAACAGGTTATTCACATCTGCTGAAGAGACATTTTCACACTGTAAGTCAGAGCATCAATTTAATATTGATAGCATGGTCCATAAACATGGACTTGAATTTTATGGATACATTAAACTAATAAATTTTATTAGACTTAAGCATCCTACAGTTGAGTATATGAATTCCATATACAACCCAGTGCCTTGGGAGAAAGAAGAGTATTTGAAGCCGGTGTTAGAAGATGACCTTTTACTTCAGTTTGATGTAGAAGATCTTTATGAACCAGTGTCAGTCCCATTCTCATACCCCAATGGGCTCAGTGAAAATACTTCTGTTGTTGAAAGATTGAAGCATATGGAAGCCAGGGCACTGTCTGCTGAAGCTGCGTTAGCCGGAGCACGCGAGGAGCTGCAGAGAATGAGACAATTTGCTCAGGATTTTGTGATGAATGCAGATGTCAGAACCTGCTCGTCATCTACTGCCATTGCAGACCTGCAGGAGGATGAGGATGGCGTTTATTTCAGCTCATACGGGCATTATGGGATACATGAAGAGATGCTGAAGGACAAAGTACGGACAGAAAGCTACAGAGATTTCATATACCAAAACCCACATATCTTCAAAGACAAGGTAGTTTTGGATGTTGGGTGTGGAACTGGAATTCTCTCTATGTTTGCTGCTAAAGCTGGGGCAAGAAAAGTTCTTGGAGTTGATCAGTCCGAAATACTTTACCAGGCAATGGACATCATAAGACTAAACAAACTTGAAGATACTATTGTACTAATTAAAGGAAAGATTGAAGAAGTTCATCTTCCTGTAGAAAAAGTGGACGTTATTGTATCTGAGTGGATGGGATATTTTCTTCTTTTTGAATCTATGTTAGATTCTGTCCTTTATGCAAAGAACAAGTACTTGGCAAAAGGAGGATCAGTCTACCCTGACATTTGCACTATCAGCCTCGTAGCAGTGAGCGATGTGAGTAGACATGCAGATAGAATTGCTTTCTGGGACGATGTCTATGGCTTCAACATGTCCTGCATGAAGAAAGCAGTTATTCCAGAAGCAGTCGTGGAAGTTTTAGATCCAAAGACTCTTATCTCAGACTCTTGTGGTATAAAGCATATAGATTGCCATACAACATCTATCTCAGATTTGGAGTTTTCTTCAGATTTTTCCCTGAAAATCACAAAGACATCCATGTGCACGGCAATTGCTGGCTACTTTGATATATATTTTGAGAAGAATTGCCACAAGAGGGTCGTGTTCTCTACGGGACCCCAGAGTACCAAAACACACTGGAAACAAACAGTATTTCTACTAGAAAAGCCATTTTCAGTAAAAGCAGGTGACTCTTTAAAGGGGAAAGTCACAGTTCACAAGAATAAGAAAGATCCTCGTTCTCTCATCGTGACCCTCACCGTGAACAGTTCCACACAGACTTACGGTCTCCAGTGA

XM_004851668.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X12

High confidence: 3 potential gene matches
Length: 1191 bp    Location: 21689582..21686826   Strand: -
>XM_004851668.1
ATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGGAGCTGAACACACGGCTGCGGGACGAGAGGGACGCCTGTGAGGCCGGGCTGCTGGGCACCAGCCACAGGAAGGCCCTGGACACCGCGGGCCTGCCGGGACCCGCCTGCTGCTGCTGGGCTCGGCCACCCCGACGCGGCTCTGGCCACCTGCCCAGTGCCCGGTGA

XM_004851574.1 Coding sequence

Slc5a12 solute carrier family 5 (sodium/glucose cotransporter), member 12, transcript variant X1

High confidence: 4 potential gene matches
Length: 1860 bp    Location: 16667969..16612086   Strand: -
>XM_004851574.1
ATGGAGGTGAAGAGCTTCGCAGCTTGGGACTATGTTGTATTCGCAGCCCTTTTTGTCATTTCCTCTGGAATTGGGGTGTTCTTTGCCATTAAGGAGAGGAAAAAGGCAACATCTAAGCAGTTCCTGGTAGGGGGCAGGGAAATGTCCTTCGGGCCTGTCGCCTTGTCCCTGACAGCCAGCTTCATGTCAGCAGTCACTGTCTTGGGGACCCCTTCCGAGGTCTACCGCTTCGGGGCCTCCTTCATCCTCTTCTTCATTGCGTACACATTGGTTATCATCTTCACATCGGAGCTCTTTCTCCCTGTGTTCTACAGATCTGGCATCACCAGCACCTATGAGTACCTACAGCTACGCTTCAACAAAGCAGTTCGCTACACAGCGACCCTCATCTATATTGTGCAGACGATTCTTTACACGGGAGTGGTGGTGTATGCACCGGCCCTCGCACTCAATCAAGTGACTGGCTTTGACCTGTGGGGTTCTGTGTTTGCCACGGGGATCGTGTGCACTTTCTACTGCACCCTGGGAGGATTAAAAGCAGTGGTGTGGACAGATGCCTTTCAGATGATGGTCATGATTGTGGGCTTCTTAACAGTTCTCATTCAAGGATCCATTAAAGCTGGTGGATTCCACAATGTGTTAGAGCAAGCAGCAAATGGATCCCGACTACATATAGTTGATTTCGATGTAGATCCTCTCCGGAGGCATACTTTTTGGACCATCTCTGTTGGAGGAACTTTTACATGGCTTGGCATCTATGGAGTTAATCAATCAACCATCCAGAGGTGCATCTCTTGCAAAACAGAAAAGCATGCTAAGCTCGCCTTGTACTTTAACCTGCTGGGCCTCTGGATCATTCTGCTGTGTGCAGTCTTCTCTGGGTTAATCATGTATTCCCACTTCAAAGACTGCGACCCTTGGACTTCCGGCATGATCTCCGCACCAGACCAGCTGATACCATATTTTATCATGGAGATATTTGACACAATGCCAGGACTTCCAGGACTTTTTGTAGCCTGTGCTTTTAGTGGAACTCTGAGCACCGTGGCCGCCAGCATCAATGCCTTAGCGACTGTGACCTTTGAGGACTTTGTCAAGAGCTGCTTTCCGCGCCTTTCAGACAAGATGAGCACCTGGACCAGTAAAGGCTTATGTCTCCTGTTCGGCATTCTGTGCACCTCCATGGCCGTGGCAGCCTCCCTCCTAGGGGGTGTCGTACAGGCTTCCCTCAGCATCCACGGCATGTGTGGGGGACCGATGCTGGGCTTGTTCTCCCTGGGACTCGTGTTCCCGTTTGTGAACTGGAAGGGCGCACTGGGTGGCCTCCTCACCGGAATCACACTGTCCTTCTGGGTGGCCATAGGGGCCTTTGTTTACCCTGCGCCAGACTCCAAGACTCGGCCTCTGCCTTTATCGACAGAGCAGTGTGTCCCGACAAACATGACCACATCAGCACCTGCGGTGCTAGCCAGCAGGCCCGAGCTGGCTGACACCTGGTACTCGCTCTCCTACCTGTACTACAGCGCAGTGGGCTGTGTTGGGTGCATTCTTGCTGGACTGCTCATCAGCTTCGTGACAGGTCTCCAGACAGGTGAAGATATCAACCCACTCTTAATTAGACCAGTGTGCAATTTATTTTGCTTTTGGTCTGAGAAATACAAAACTCTGTGCTGGTGTGGAGTGCAGCACGACTGCTGGCCCGAGCAGGATAACTGTGAGAATGGCAGTACCTGGAAACATGGGGCAGAATCTGTGCTCCACAATGGACTCAGGGGAGAAAGCCTGGCCCATGCACCAGGGTACAATCCCAAGGACAAAAGCTACGACCATACGGCGCTGGAGAAGATAACCCATTTCTAG

XM_004851444.1 Coding sequence

Tead1 TEA domain family member 1 (SV40 transcriptional enhancer factor), transcript variant X6

High confidence: 4 potential gene matches
Length: 1311 bp    Location: 4760320..4928301   Strand: +
>XM_004851444.1
ATGGAAAGGATGAGTGACTCTACAGATAAGCCGATTGACAATGACGCGGAAGGGGTCTGGAGCCCCGACATTGAGCAGAGCTTTCAGGAGGCCCTGGCTATCTATCCGCCATGTGGGCGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAATGAATTGATAGCCAGATACATCAAACTCAGGACAGGGAAGACGAGGACCAGAAAGCAGGTGTCTAGTCATATACAGGTCTTAGCAAGAAAGAAAGTTCGAGAAATTCAAGCCGCCATTAAGGTGTCTAGTCACATTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGTAACAAGCATGGATCAGACTGCAAAGGACAAGGCCCTGCAGCACATGGCCGCCATGTCGTCAGCCCAAATCGTCTCTGCCACTGCCATTCACAACAAGCTGGGGCTGCCTGGGATCCCACGCCCCACCTTCCCAGGGGCGCCGGGGTTTTGGCCTGGAATGATACAAACAGGGCAGCCAGGATCCTCACAAGATGTCAAGCCCTTTGTGCAGCAGGCCTACCCCATCCAGCCCGCGGTCACGGCCCCCATTCCAGGGTTTGAGCCTCCGTCCGCCCCAGCTCCCTCTGTCCCTGCCTGGCAGGGCCGCTCCATTGGCACAACCAAGCTTCGCCTGGTGGAATTCTCAGCTTTCCTCGAACAGCAGCGAGACCCAGACTCGTACAACAAACACCTCTTCGTGCACATCGGGCATGCCAACCATTCTTACAGTGACCCATTGCTCGAATCAGTGGATATACGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTATTTGGAAAGGGCCCTCAAAATGCCTTCTTCCTTGTAAAATTCTGGGCCGACTTAAACTGCAATATTCAAGATGATGCTGGGGCTTTTTATGGTGTAACCAGTCAGTATGAAAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTGTGCTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACAGAGTATGCAAGGTTCGAGAATGGCCGATTTGTATACCGAATAAACCGCTCCCCGATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACAAGAAACTCTCCTCTGCATGGCCTGTGTATTTGAAGTTTCAAATAGTGAACATGGAGCACAACATCATATTTACAGGCTTGTAAAGGACTGA

XM_004851769.1 Coding sequence

LOC101700184 olfactory receptor 10Z1-like

Length: 942 bp    Location: 54910..55851   Strand: +
>XM_004851769.1
ATGGAAAACCACACCACAGAGCGTGCATTCCTTCTATGGGGATTTTCCAGTTTCCCAGAACTACAGAACCTACTCTTTGTGGTGATTTTCTCTTCCCATGTGACAATCCTACTTGCAAATGTGTCCATAATGGTAGCCATCAAGCTCAATCACAACCTGCACACCCCAATGTATTTTTTCCTCTTTGGCCTCTCCCTTTCTGAAACCTGTACCACTATGGTTATCATTCCCCGCATGTTAGTGGACTTGCTGTCAGATAGCAAGACTATTTCTCTTCCTGAGTGTGCCACGCAGATGTTTTTCTTCTTTGGTTTGGGAGGAAATAACTGCTTCATTTTAGCCGCCATGTCCTATGACCGATACATTGCCATCCACAACCCACTGCATTATCCCATGCTGATGACCAAAAAGATCTGCTTTCAGCTTATAATGGCTTCTTGTATAGTTGGGTTCCTGGTTTCACTATCCATTGTCATCATTATATTCACCTTCTCTTTTTGTGACTCTTACACTGTCCAGCATTTCTTCTGTGACATCTTGCCTGTGGCCAACCTTGCTTGTGATTATACATCCTTCCATGAAATGGCTATTTTTATGCTCTGTGCCTTTGTGTTAGTGGGCAGCTTTATTTTAATTGTAATTTCATATGTCTTCATTTTGTCTTTAGTTGTGAAGATGCCTTCTGCAAAGGGGAGGTATAAGGCCTTCTCCACCTGCTCCTCCCACCTCACTGTGGTGTGTATACACTATGGATTCGCTTGTTATATCTATTTGAGACCCAAGAGCAGTGACTCCTTCCGTGAAGACATGCTGATGGCTGTGACATACACAGTGCTGACCCCTCTGCTTAACCCCATTGTTTACAGCCTACGGAACAAAGAGATGCAAGTGGCCCTATGGAAAGTACTAGAGAATGGCCATAGGTTTATTTCTAGGTGGTAA

XM_004851371.1 Coding sequence

Tub tubby homolog (mouse), transcript variant X5

Length: 1626 bp    Location: 206059..293806   Strand: +
>XM_004851371.1
ATGGGCTCGGGTCCCCGCAGCCCGCGCGCCCTCGCCATTGGCACAGCCGGTGGGGGTCACCCCCGGGGGGGTCGAATGGTACAGTCCAGACCCGCAGCCAGCGAGGAGTCGCTGAGCCGGGCGCAGCCGCCGCCGCCCTCAGAGCGGGACCCGAGTCCGGAGGCGGCGATGGAAGGAGTCAGCAGCCACCGGACCCTGTCCTACAGCCGCTGGAGCTACGACAGTGTCTTAGATGATGAGGGCAGCAACCTGAGGCAACAGAAGCTTGACCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAAAAACGCCAGGAGTCCCTGATGGTGCAGGCCAATCCCGAAGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAGCAGGCCCCTCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGTTCAAGAGGCCGACTCACTCGCCAGTGTGCAGCTGGGAGCTGCCCGCCCAACAACACCAACCTCAGCCAAGAGAACCAAGGCAGCAGCTTCAGCAGGGGGCCAGGGTGGGGCCTCTAGGAAGGAGAAGAAGGGAAGGCACAAAGGAATCTCCAGCAGCATGAGCTTTGACGAGGAAGAGGAGGATGAGGATGAGAACAGCTCTAGCTCCTCCCAGCTAAACAGCAACACCCGCCCCAGCTCCGCCACTAGCAGGAAGTCCATCAGGGAGGCAGCCTCAGCGCCCAGCCCAACAGCCCCAGAGCCGAAGGTGGGTGTTGAGGTCCAGGACCTTGAGGAATTTGCACTCCGGCCGGCCCCCCAGGGCATTACCATCAAATGCCGAATCACCCGGGACAAGAAGGGGATGGACCGGGGCATGTACCCCACCTACTTCCTGCACCTGGACCGTGAGGACGGGAAGAAGGTGTTCCTCCTGGCCGGAAGGAAGAGAAAGAAGAGTAAAACGTCCAATTACCTCATCTCTGTGGACCCAACGGACCTGTCTCGAGGAGCAGACAGTTACATCGGGAAACTGCGGTCCAATCTGATGGGCACCAAGTTCACCGTTTATGACAATGGAGTCAACCCTCAGAAGGCGTCATCCTCTACTTTGGAAAGTGGGACCTTGCGCCAGGAGCTGGCAGCTGTGTGCTATGAGACAAACGTCTTAGGCTTCAAGGGGCCTCGGAAGATGAGTGTGATTGTCCCTGGCATGAACATGGTTCATGAGAGAGTCTCTATCCGTCCCCGAAACGAACATGAGACACTGCTAGCCCGATGGCAGAATAAGAACACAGAGAGTATCATCGAGCTGCAAAACAAGACCCCCGTCTGGAATGACGACACACAGTCCTACGTACTCAACTTCCACGGGCGCGTCACACAGGCCTCTGTGAAGAACTTCCAGATCATCCATGGCAATGACCGAGACACTCCACCCCTCTCCTCTGTTCTCCTGTGCCTCCCTCCCCCTGTCAAGGTCCAGGCAGAGCTGGAAATGAGGCTGAGGTCTAGAGTTTCCTACAGAACAATTCAGAATGGCTTAGAAGGGGGAGCCCAACTCTGGCCTCTTCATTCCTGCATTTGGGTGACAGAGGGGACTTGGTCAGGATGGGTAACCTTTTTCTTGCTGAGAACGCATATTTAG

XM_004851373.1 Coding sequence

Tub tubby homolog (mouse), transcript variant X7

High confidence: 4 potential gene matches
Length: 1515 bp    Location: 268838..293356   Strand: +
>XM_004851373.1
ATGACTTCCAAACCGCATTCCGACTGGATTCCCTACAGTGTCTTAGATGATGAGGGCAGCAACCTGAGGCAACAGAAGCTTGACCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAAAAACGCCAGGAGTCCCTGATGGTGCAGGCCAATCCCGAAGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAGCAGGCCCCTCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGTTCAAGAGGCCGACTCACTCGCCAGTGTGCAGCTGGGAGCTGCCCGCCCAACAACACCAACCTCAGCCAAGAGAACCAAGGCAGCAGCTTCAGCAGGGGGCCAGGGTGGGGCCTCTAGGAAGGAGAAGAAGGGAAGGCACAAAGGCACCGGCGGGCCAGCAGCACCGGCAGAAGACAAGTCTGAGGCCCAAGGCCCAGTGCAGATCCTGACTGTGGGCCAGTCGGACCACGACACAGGAGAGACAGCAGCCAGTGGGGGCGCACGGCCCAGCGGGCAGGACCTCCGTGCCACGATGCAGAGGAAGGGAATCTCCAGCAGCATGAGCTTTGACGAGGAAGAGGAGGATGAGGATGAGAACAGCTCTAGCTCCTCCCAGCTAAACAGCAACACCCGCCCCAGCTCCGCCACTAGCAGGAAGTCCATCAGGGAGGCAGCCTCAGCGCCCAGCCCAACAGCCCCAGAGCCGAAGGTGGGTGTTGAGGTCCAGGACCTTGAGGAATTTGCACTCCGGCCGGCCCCCCAGGGCATTACCATCAAATGCCGAATCACCCGGGACAAGAAGGGGATGGACCGGGGCATGTACCCCACCTACTTCCTGCACCTGGACCGTGAGGACGGGAAGAAGGTGTTCCTCCTGGCCGGAAGGAAGAGAAAGAAGAGTAAAACGTCCAATTACCTCATCTCTGTGGACCCAACGGACCTGTCTCGAGGAGCAGACAGTTACATCGGGAAACTGCGGTCCAATCTGATGGGCACCAAGTTCACCGTTTATGACAATGGAGTCAACCCTCAGAAGGCGTCATCCTCTACTTTGGAAAGTGGGACCTTGCGCCAGGAGCTGGCAGCTGTGTGCTATGAGACAAACGTCTTAGGCTTCAAGGGGCCTCGGAAGATGAGTGTGATTGTCCCTGGCATGAACATGGTTCATGAGAGAGTCTCTATCCGTCCCCGAAACGAACATGAGACACTGCTAGCCCGATGGCAGAATAAGAACACAGAGAGTATCATCGAGCTGCAAAACAAGACCCCCGTCTGGAATGACGACACACAGTCCTACGTACTCAACTTCCACGGGCGCGTCACACAGGCCTCTGTGAAGAACTTCCAGATCATCCATGGCAATGACCCGGACTACATCGTCATGCAGTTTGGCCGGGTAGCGGAGGATGTGTTCACCATGGATTACAACTACCCGCTGTGTGCACTGCAGGCCTTTGCCATTGCACTGTCCAGCTTCGACAGCAAGCTGGCCTGCGAATAG

XM_004851376.1 Coding sequence

Ric3 resistance to inhibitors of cholinesterase 3 homolog (C. elegans), transcript variant X2

High confidence: 4 potential gene matches
Length: 1098 bp    Location: 338544..296627   Strand: -
>XM_004851376.1
ATGGCTTACTCCACTGTGCAGAGGGTGGCCCTCGCCTCGGGGCTCGTCCTGGCGTTGTCCCTGCTGCTGCCCAAAGCCTTCCTGTCCCGCTGGAAGCAGCCGCCGCCGCCGTCGGCACTCGAAGGAAAATTGGGCCGATTACCCCCTATAATGCATCATCAACCAGCTCCCTCAGATGGCCAGACTCCTGGGGGTCGTTTCCAGAGGTCTCACCTCGCAGAGGCATTTGCAAAAGCTAAAGGATCAGGTGGAGGCGCTGGAGGAGGTAGTGGAAGAGGCCTGATGGGGCAAATTATTCCAATCTATGGTTTTGGGATTTTTCTATATATATTATACATTCTATTTAAGCTCTCAAAGGGGAAAACTGCAGAGGATCTGAAATGCTCTACTGCCACACCTGGAAACACCCACAGGAAAATTACCAATTTTGAACTTGCTCAACTGCAAGAAAAACTAAAAGAGACAGAGGAAGCCATGGAAAAATTAATCAACAGAGTGGGACCGAATGGTGAGAGAGCACAGACTGTGACTTCTGACCAAGAAAAACGATTGCTGCATCAGCTCCGAGAAATCACCAGGGTTATGAAAGAAGGAAAGTTCATTGACAGGTCTACTCCTGAGAAGGAAGCTGAGGAAGCCCCTTACATGGAGGATTGGGAAGGTTACCCTGAAGAAACTTACCCAATTTATGACCTTTCAGACTGTATCAAGCATAGGCAAGAAACAATCCTGGTGGATTACCCTGATCCAAAAGAGCCCTCTGCTGAAGAAATAGCTGAAAGAATGGGAGAGCTGGAAGAAGAATCAGACCATTTGGGCTGGGAACGTCTGCCCACTGACTCTAGAGTCCAGGAAGATAATTCTGTTGCCTTGTGTGACCCAAAGCCAGAAACATGTTCCTGCTGTTTTCATCAAGATGATCCTGTTGTCTTGGCAGAGAATGCTGGATTCAGTGCAGATAGCTACACTGATGAACAAGAGGAAACCACCAAAGAATACCGGACCCAAGACTTTAGAGATGAAGGGTTGGGCATCAGCCCTGATAAAACATGTATAGGTGGCATGCTGAGGAAGCGTAACTCCCAGGGTTTAGAGTAA

XM_004851384.1 Coding sequence

St5 suppression of tumorigenicity 5, transcript variant X1

High confidence: 4 potential gene matches
Length: 3414 bp    Location: 953429..842702   Strand: -
>XM_004851384.1
ATGACCATGACTGCCAACAAGAATTCCAGCATCACTCACAGAGCCGGAGGCACTAAGACACCTCGGGAGACTCTGAGCAGGTCTCAGTCAGTCTCTCCACCTCCAGTTCTGTCCCCACCGAGGAGTCCCATCTACCCCCTCAGTGATAGTGAAGCCTCAGCCTGCAGGTACCCCAGCCACTCCAGCTCTCGAGTGCTCCTCAAGGACTGGCGTCCCCGTGACCTTTCACCCCAGAATCCTCAAGATCTCTCCCTAGATTCTTCACCACCCATCTGTTCCCTCAAGGCCACCAGCTTTGGTTATTTGGACAGAAGCCCTTCAGTGTGCAAGAGAGAGGACCAGAAGGAGAATGTCCAGGTTGCAGCTCAGGATGTAGAGGAAGTAGCTGCTTGCCTCCCTGTTGCCCAGAGCACCCCATTCCTAGGGCCGGCAGCTGGCCTGCGGAGTGTTTTGTTGACCCGCTCTGGTGCCCGTGCCCACAACCTGGGCATCCGAGAGAAGATTTCAGCATGGGAAGGTCGCCGAGAGACTTTGCCCAAGATGAGCTTGTGTGGAGAGAAGCGGGAGGGCTCTGGGGTCGAGCATCCAGTCAGTGAGGGCTGCCCGAGTGTGGGCTGTCCCAGCGTGGTGCCATCCCCCTGCAGCTCAGACAAGACCTTTGATTTCAAGGGCCTCCGGAGGATGAGCAGGACCTTCTCTGAGTGTTCCTACCCTGAGACCGAGGAGGAGGGAGAGACACTTTCTGTCCGGGACTCTTTCTACTGGCTGGAGAAGCGGCCAGGCCGGAGTGAGCCCAGTGCCTTCCTCAGGGGGCATGGCAGCAGGAAAGAGAGCTCAGCAGTGCTGAGCCGGATCCAGAAAATTGAACAGGTCCTGAAGGAGCAGCCAGGTGGGGGCCTCCCCCAGCTCCCCAGTAGCTGCTACAGTGTAGACCATGGGAGAAGGAAGACTGCAGTCTTGGGCACCTTGGAGGAGCCAGCAGGGAGCATGGGTGTGAGCGCTGGCAGCCGGGCAGTAGGAGTGGCTGGACGTGGGGGGGAGGCGGGCCTGCCCCTGGAGAGGGAAGGCAGTGGTTCCAGCAAGCCAGGGCCCCCTGGAAACAGTCCTAGCTCCCAGCTGGTGCCATCAAAGAGCTCCCCTGATCCTGCTGTGAATCCTGTCCCCAAACCCAAGCGCACCTTTGAATATGAGGCTGACAAGAACCCCAAGAGTAAGCCAAGCAATGGTCTACCTCCTTCGCCCATACCTGCTGCTCCACCCCCTTTGCCCTCCACTCCAGCCCCACCAGTCACCCGGAGACTCAAGAAGGACATACGTGGTCACCGCAAGTCCCAGAGCAGAAAATCCTTTGAGTTTGAGGATGCATCCAGTCTCCAGTCCCTGTACCCCTCTTCTCCCACTGAGAATGGTACTGAGAGCCAGCCTAAGTTTGGATCCAAAAGCACTTTAGAAGAGAATGCCTATGAAGATATTGTGGGAGAGCTGCCCAAGGAGAATCCATATGAGGATGTGGACTTAAAGAGCCGAAGAGCCGGACGAAAACCTCAGCAACTGTCTGAGAACTCCTTGGACTCTTTGCACAGGATGTGGAGTCCTCAGGACAGGAAGTACAACAACCCACCCATGCAGCTTTCCCTGAAACCCAGCAGCCAGTCCCTGCGCAGTGGGAACTGGTCAGAAAGGAAGAGCCACCGGCTGCCACGTTTGCCCAAGCGGCACAGCCACGATGACATGCTGCTGCTGGCTCAGCTGAGCCTGCCATCTTCACCCTCCAGCCTCAACGAGGACAGCCTCAGCACCGCCAGTGAGCTGCTGTCCAGCCGCCGGGCCCGCCGCGTCCCCAAGCTTGTCCAAAGAATTAACTCCATCTACAATGCCAAGAGGGGAAAGAAGAGATTAAAAAAGCTGTCTATGTCCAGCCTTGAGACAGCATCACTGAGAGATGAGAACAGTGAGAGTGAGAGCGACTCTGATGACAGGTTCAAAGCTCACACGCAGCGCCTGGTCCACATCCAGTCAATGCTGAAACGCGCACCCAGCTACCGGACGCTGGAGCTGGAGCTGCTTGAGTGGCAGGAGCGGGAGCTTTTCGAGTACTTTGTGGTAGTGTCCCTCAAGAAGAAGCCGTCCCGCAACACTTACCTCCCTGAGGTCTCCTACCAGTTCCCCAAGCTGGACCGACCCACCAAGCAGATGCGCGAGGCAGAGGAAAGGCTCAAAGCCATTCCTCAGTTTTGCTTTCCAGATGCCAAGGATTGGTTCCCTGTGTCAGAGTATAGCAGTGAGACCTTTTCTTTCATGCTGACGGGGGAAGATGGCAGCAGACGCTTTGGCTATTGCCGGCGCTTACTGCCGAGTGGGAAGGGACCTCGGTTGCCAGAGGTATACTGTGTCATCAGCCGCCTTGGCTGCTTCGGCTTGTTTTCCAAGGTCCTCGACGAGGTGGAGCGCCGGCGTGGGATCTCCGCGGCATTGGTCTACCCCTTCATGAGGAGTCTCATGGAGTCGCCCTTCCCAGCCCCGGGGAAGACGATCAAAGTGAAGACATTCTTGCCAGGTGCTGGCAATGAGGTGTTAGAGCTGCGTCGGCCCATGGACTCCCGGCTGGAGCATGTGGACTTTGAGTGCCTTTTTACCTGCCTCAGTGTGCGCCAGCTCATCCGAATCTTTGCCTCACTGCTGCTGGAACGTCGGGTCATTTTTGTAGCAGATAAGCTCAGTACTCTGTCCAGCTGTTCCCATGCCGTGGTGGCCTTGCTCTACCCCTTCTCCTGGCAGCACACCTTCATTCCTGTCCTCCCGGCCTCCATGATTGACATCGTGTGTTGTCCCACTCCTTTCCTGGTCGGCCTGCTCTCCAGCTCCCTCCCCAAACTGAAGGAGCTTCCTGTGGAGGAGGCGCTGATGGTGAACCTGGGATCTGACCGATTCATCCGACAGATGGATGATGAGGACACCTTGTTACCTAGGAAGTTACAAGCAGCTCTGGAGCAGGCTCTAGAGAGGAAGAATGAACTGATCTCCCAGGATTCTGACAGTGACTCCGATGATGAATGTAATACCCTCAATGGGCTGGTGTCAGAGGTGTTTATTCGGTTCTTTGTGGAGACCGTTGGGCACTACTCCCTCTTCCTGACCCAGAGTGACAAGGGGGAGAGGGCCTTTCAGCGAGAGGCCTTCCGCAAGTCTGTGGCCTCTAAAAGCATCCGCCGTTTCCTTGAAGTTTTTATGGAGTCTCAGATGTTTGCTGGCTTCATCCAAGACAGGGAGCTAAGAAAGTGTCGGGCAAAGGGCCTCTTTGAGCAGCGAGTGGAACAGTATTTAGAGGAGCTCCCTGACACTGAGCAGAGTGGAATGAATAAATTTCTCCGAGGCTTAGGCAACAAAATGAAGTTCCTCCACAAGAAGAATTAA

XM_004851387.1 Coding sequence

Akip1 A kinase (PRKA) interacting protein 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 633 bp    Location: 1061053..1069051   Strand: +
>XM_004851387.1
ATGGAGAACTGTTTGGCAGCAGCGGCGCTGAACGGGTTGGACCGACGTTCCCTGCAGCGCTCGGCCAGGCTGGGCCAAGAAGTGCTGGAGCGGGCCAGGCGGAGGGCAGTGGACTGGCATTTACAGGAGCGCCCCACGGGCAGCATGGGAGTCCTTTCCCGGGAGGGGCCCTGCCGAGAAGGACGGCGGGCAGCCGACCCCCGGCGCTTTCTCCCCACAGAGAGAGAAGAAAGACACCTGACCCTTAATGCTTCCTTCAGAATAATGGCTGAATTCATGGACTATACTTCAAGTCAGTGTGGGAAATATTATTCATCAGTGCCTGAGGAAGGAGGGGCAACCCATGTCTATCGGTATCACAGAGGGAAGTCTCAGCAGCACGTGTGCTCCAACACAGGGTATGGTCAGAGAATAGACAGAGAGAAGACATTCCTGGATCAGGGAGGCATCTACCGAACATCAGAGCCCGATTCAGAGACGTCCCAGCCCGCCGAGAACATCTCCAAGGACCTCTACATAGAAGTATACCCAGGGACCTATTCTGTCACCGTGGCCTCAAATGCCTTGACCAAGAAGACTCACGTGGTAGCAGTTGATTCAGGACAAAGTGTGGACTTGGTATTCCCTGTATGA

XM_004851386.1 Coding sequence

Akip1 A kinase (PRKA) interacting protein 1, transcript variant X1

Length: 633 bp    Location: 1061124..1069051   Strand: +
>XM_004851386.1
ATGGAGAACTGTTTGGCAGCAGCGGCGCTGAACGGGTTGGACCGACGTTCCCTGCAGCGCTCGGCCAGGCTGGGCCAAGAAGTGCTGGAGCGGGCCAGGCGGAGGGCAGTGGACTGGCATTTACAGGAGCGCCCCACGGGCAGCATGGGAGTCCTTTCCCGGGAGGGGCCCTGCCGAGAAGGACGGCGGGCAGCCGACCCCCGGCGCTTTCTCCCCACAGAGAGAGAAGAAAGACACCTGACCCTTAATGCTTCCTTCAGAATAATGGCTGAATTCATGGACTATACTTCAAGTCAGTGTGGGAAATATTATTCATCAGTGCCTGAGGAAGGAGGGGCAACCCATGTCTATCGGTATCACAGAGGGAAGTCTCAGCAGCACGTGTGCTCCAACACAGGGTATGGTCAGAGAATAGACAGAGAGAAGACATTCCTGGATCAGGGAGGCATCTACCGAACATCAGAGCCCGATTCAGAGACGTCCCAGCCCGCCGAGAACATCTCCAAGGACCTCTACATAGAAGTATACCCAGGGACCTATTCTGTCACCGTGGCCTCAAATGCCTTGACCAAGAAGACTCACGTGGTAGCAGTTGATTCAGGACAAAGTGTGGACTTGGTATTCCCTGTATGA

XM_004851390.1 Coding sequence

Akip1 A kinase (PRKA) interacting protein 1, transcript variant X5

Length: 471 bp    Location: 1061124..1069051   Strand: +
>XM_004851390.1
ATGGAGAACTGTTTGGCAGCAGCGGCGCTGAACGGGTTGGACCGACGTTCCCTGCAGCGCTCGGCCAGGCTGGGCCAAGAAGTGCTGGAGCGGGCCAGGCGGAGGGCAGTGGACTGGCATTTACAGGAGCGCCCCACGGGCAGCATGGGAGTCCTTTCCCGGGAGGGGCCCTGCCGAGAAGGACGGCGGGCAGCCGACCCCCGGCGCTTTCTCCCCACAGAGAAATATTATTCATCAGTGCCTGAGGAAGGAGGGGCAACCCATGTCTATCGGTATCACAGAGGGAAGTCTCAGCAGCACGTGTGCTCCAACACAGGGTATGGTCAGGCCGAGAACATCTCCAAGGACCTCTACATAGAAGTATACCCAGGGACCTATTCTGTCACCGTGGCCTCAAATGCCTTGACCAAGAAGACTCACGTGGTAGCAGTTGATTCAGGACAAAGTGTGGACTTGGTATTCCCTGTATGA

XM_004851774.1 Coding sequence

Dennd5a DENN/MADD domain containing 5A

High confidence: 4 potential gene matches
Length: 3879 bp    Location: 1382084..1279200   Strand: -
>XM_004851774.1
ATGAGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGAGGTGGCTCGGCGCCCAGTCGCTTCGCCGACTACTTTGTCATCTGCGGGCTGGACACCGAGACTGGGCTGGAGCCGGACGAGCTGTCGGCATTATGCCAGTACATTCAGGCTTCTAAAGCCAGAGATGGTGCCAGCCCTTTCATTTCGAGTACAACTGAAGGAGAAAATTTTGAGCAGACACCATTGAGACGAACATTCAAGTCTAAGGTCCTTGCCCGCTATCCTGAGAATGTAGAATGGAATCCGTTTGACCAGGATGCAGTGGGAATGCTATGCATGCCCAAAGGGCTGGCATTCAAGACCCAGGCTGATCCTAGGGAGCCCCAGTTCCATGCCTTTATTATCACAAGGGAGGATGGCTCTCGGACATTTGGGTTTGCCCTCACATTTTATGAAGAGGTGACTAGCAAGCAGATCTGCAGTGCAATGCAGACCCTCTATCACATGCACAATGCTGAATATGATGTCCTTCATGCCGCCCTTACTGATGGCCAGGACCAGAGTGGCATGGAAGATGGTGAAGGCACTCCTGGGACCAAGCTGCAGCGCTTCAACTCATATGACATCAGCCGGGACACTCTCTACGTCTCTAAGTGCATCTGCCTCATCACACCCATGTCCTTCATGAAGGCTTGTCGGAGTGTGCTGGAGCAGCTCCACCAGGCTGTCACTTCACCTCAGCCCCCGCCTCTACCCCTTGAGAGCTACATATACAACGTACTTTATGAGGTGCCACTTCCACCTCCTGGTCGGTCCTTGAAGTTTTCTGGGGTCTATGGGCCGATAATCTGCCAGAGACCAAGTACCAATGAGCTTCCCCTATTTGACTTTCCTGTCAGAGAGGTCTTTGAACTACTTGGTGTGGAGAATGTGTTTCAGCTTTTCACCTGTGCCCTTCTGGAGTTTCAAATCCTGCTCTACTCACAGCATTACCAGAGACTGATGACTGTGGCGGAGACGATTACAGCTCTCATGTTTCCTTTCCAGTGGCAACATGTCTATGTCCCTATTCTCCCGGCTTCTCTCCTGCACTTCTTAGATGCGCCTGTTCCCTACCTGATGGGCTTGCACTCCAATGGACTGGATGACCGGTCAAAGCTGGAGCTGCCTCAAGAGGCTAACCTCTGCTTTGTGGATGTTGACAACCACTTCATTGAACTGCCAGAGGATCTGCCTCAGTTTCCCAACAAATTGGAATTTGTCCAGGAAGTCTCTGAGATTCTCATGGCATTTGGCATTCCCCCTGAAGGAAACCTTCACTGCAGTGAGAGTGCCTCCAAGCTGAAGAGGCTCCGGGTTTCTGAGCTCGTCTCTGACAAGAGGAATGGGAACATTGCCAGCTCTCCTTTGCATTCCTATGAACTCCTCAAGGAGAATGAAACTATTGCCCGGCTCCAAGCCTTGGTCAAGAGGACTGGGGTGAGCTTGGAAAAGTTGGAAGTACGTGAAGACCCCAGTAGCAATAAGGATCTCAAAGTTCAGTGCGATGAAGAAGAACTCAGGATTTACCAGCTAAACATTCAGATCCGGGAAGTTTTTGCAAATCGTTTTACTCAGATGTTTGCAGATTATGAAGTGTTTGTAATTCAGCCAAGCCAGGATAAGGAATCCTGGTTCACCAATAGGGAGCAGATGCAAAATTTTGATAAAGCATCTTTTCTGTCAGATCAGCCTGAGCCCTACCTGCCCTTCCTCTCAAGATTCCTGGAGACCCAGATGTTTGCTTCTTTCATTGATAACAAAATTATGTGCCATGATGATGATGATAAAGACCCTGTACTCCGGGTATTTGATTCCCGAGTAGACAAGATCAGACTGTTGAATGTTCGGACACCTACTCTCCGCACCTCCATGTACCAGAAGTGTACCACTGTAGATGAAGCAGAGAAAGCAATTGAGCTACGCCTGGCAAAAATTGACCATACTGCAATTCACCCACATTTACTTGACATGAAGATTGGACAAGGGAAGTATGAGCCAGGCTTTTTCCCTAAACTCCAATCTGATGTACTTTCTACTGGGCCAGCCAGCAACAAGTGGACGAAAAGGAATGCCCCTGCCCAGTGGAGGCGGAAAGACCGACAGAAGCAGCATACAGAACACCTACGTTTAGATAATGACCAGAGGGAGAAGTACATCCAGGAAGCCAGGAATATGGGCAGCACCATCCGCCAGCCCAAACTGTCCAACCTCTCTCCGTCAGTGATTGCTCAGACCAACTGGAAGTTTGTAGAGGGCCTGCTGAAGGAATGCCGCAACAAGACCAAGAGGATGCTAGTGGAGAAGATGGGCCGTGAGGCTGTGGAGCTAGGGCATGGGGAAGTGAACATCACTGGCGTGGAAGAGAACACCTTGATTGCCAGCCTCTGTGACCTCCTGGAAAGGATCTGGAGTCATGGGCTTCAAGTGAAACAGGGGAAATCAGCCTTATGGTCTCACCTGTTACATTATCAGGAAAACCGGCAGAAAAAACTCCCATCAGGAAGCCTCAGTAGCTCAGGAATACTTCTTGATTCAGAACGGAGGAAGTCTGATGCCAGCTCAGTCATGTCTCCCCTGAGGATCTCCTTGATTCAAGATATGAGGCATATCCAGAACATTGGGGAAATTAAGACTGATGTGGGCAAGGCCAGAGCATGGGTGCGACTGTCCATGGAGAAAAAATTACTTTCCAGACACCTGAAGCAGCTTCTGTCAGACCATGAGCTCACCAAAAAGTTGTACAAGCGCTATGCCTTCCTGCGCTGTGATGATGAGAAGGAGCAATTCCTCTATCACCTGCTCTCTTTTAATGCCGTTGATTACTTCTGCTTCACCAATGTCTTCACAACGATCTTGATCCCATACCATATTCTCATCGTACCAAGCAAGAAGCTGGGGGGCTCCATGTTCACGGCCAACCCATGGATCTGTATCTCGGGAGAGCTCGGTGAAACACAGATCCTGCAGATTCCCAGGAACGTGCTAGAGATGACCTTTGAGTGCCAGAACTTGGGGAAGCTTACTACTGTCCAGATTGGCCATGATAACTCTGGGCTGTATGCCAAATGGCTGGTGGAGTATGTGATGGTCAGGAATGAGATCACAGGACATACCTATAAGTTCCCATGTGGCCGGTGGTTGGGGAAGGGCATGGATGATGGCAGCCTGGAGCGGGTTCTAGTTGGGGAGCTGCTCATATGCCTGCCTGAGGTGGATGAGAGGCCATGCCGGACCCCGCCACTGCAGCAGTCCCCCAGCGTCATCCGGAGGCTTGTTACTATCTCACCCAACAACAAGCCAAAGCTGAACACTGGGCAGATCCAGGAGTCCATTGGGGAGGCAGTCAATGGCATTGTGAAGCACTTCCATAAGCCTGAGAAAGAGCGAGGCAGTCTGACGCTGTTGCTTTGTGGAGAGTGTGGGCTTGTCTCAGCACTGGAACAGGCTTTCCAGCATGGATTTAAATCACCCCGGCTCTTCAAAAATGTTTTCATTTGGGATTTCTTGGAAAAAGCACAAACCTATTATGAGACATTGGAGCAGAATGAAGTAGTCCCTGAGGAAAACTGGCATACAAGAGCCCGGAACTTCTGCCGATTTGTCACTGCAATCAATAACACTCCTCGGAACATCGGCAAGGACGGCAAGTTTCAGATGCTGGTGTGCTTGGGAGCCAGAGATCACCTGTTGCACCATTGGATAGCCCTGCTGGCCGACTGTCCCATCACCGCACATATGTATGAGGATGTGGCGCTCATCAAAGACCACACACTTGTCAATTCCTTGATCCGTGTACTGCAGACACTGCAGGAGTTCAACATCACGCTAGAGACTTCCCTCATCAAGGGTATCGACATCTGA

XM_004851399.1 Coding sequence

Tmem41b transmembrane protein 41B, transcript variant X1

Length: 876 bp    Location: 1450946..1418701   Strand: -
>XM_004851399.1
ATGGCGAAAGGCAGAGTCGCCGAGCGATCGCCGGCGGGCACGTTCCACACGAACCCTGTGAACGACGGGACGGCGGGGACTCGGGGGCCCGCGGCGCCGAGTAGCGGAGACCACCTGAAGGAAAAAGCCTGGGCAGAAGCTGGGTCAGCAAGAATGTCACTGCTTATATTGGTGTCCATTTTCCTGTCTGCAGCTTTTGTTATGTTTTTGGTATATAAAAATTTTCCTCAGCTTAGTGAAGAAGAAAGAATGAATATGAAGGTTCCCAGAGATATGGATGATGCCAAGGCGCTAGGAAAAGTTTTATCCAAATATAAGGACACCTTTTATGTACAAGTACTTGTAGCTTATTTTGCTACATATATTTTCTTGCAGACATTTGCTATTCCAGGCTCAATATTTCTCAGTATACTCTCAGGGTTCCTTTATCCCTTTCCACTAGCCTTGTTTCTTGTTTGTTTGTGTTCCGGACTTGGTGCCTCATTCTGCTATATGCTCTCCTATTTAGTTGGGAGACCAGTTGTATACAAATACCTAACAGAGAAAGCAGTAAAGTGGTCACAGCAGGTTGAACGTCATAGAGAACATCTCATTAACTACATTATATTTCTGAGAATAACACCATTTCTCCCTAATTGGTTTATTAATATTACATCTCCTGTGATAAACGTGCCATTGAAAGTTTTTTTTATCGGCACTTTTCTCGGTGTTGCACCTCCTTCTTTTGTAGCAATTAAAGCAGGAACAACATTGTACCAGCTTACAACAGCAGGAGAAGCTGTTTCCTGGAACTCAGTGTTTATTCTGATGATTTTAGCTGTTTTTTCTATTCTTCCAGCCATCTTCCAAAAAAAGCTAAAGCAGAAATTTGAGTGA

XM_004851412.1 Coding sequence

Adm adrenomedullin

High confidence: 4 potential gene matches
Length: 549 bp    Location: 2402182..2404343   Strand: +
>XM_004851412.1
ATGAAGCTGGTTTCGGTGGCCCTGGTGTTGCTGGGCGCTGTGGCCTTCCTGGACGCTGACGCAGCGCCGCTCGACCGAGCGCCTGAGCTCCTAAAGAAATGGAATAAATGGGCTGTCAGTCGTGAGAAGAGAGAACTGCCAGTGACCGACAGCAACCCCATTGGGCTCGCAGACGCGGAGGCCGGGTCTACCCAGACAGACCTTGGGCCTCAGGACTTAAAGAGTGGCTCCGGCAGGCCCCAGCCCAGTGGTCGGGAGGCCAGCCTCACCCGAGTCAAGCGCCACCGCCAGAGCCTCCGAAGCTTTGGCTGCCGCTTCGGGACGTGCACGGTCCAGAAGCTGGCGCACCAGATCTACAAATTCACAGACAAGGACAAGGACGGCTTCGCCCCTCAAAGCAAGATCAGCCCCCACGGCTATGGGCGCCGGCGGCGTCGTTCCCTGCCAGAAGCCGGACAGGACCGGACTCTGGTGTCTTCCGAGCGACAGGCGCTCGCGGCTCGCGACACCAGGGTGCACCAACTGTTCGCCACCCTCCCGAGGATTTAG

XM_004851414.1 Coding sequence

Ampd3 adenosine monophosphate deaminase 3, transcript variant X2

Length: 2304 bp    Location: 2542016..2586275   Strand: +
>XM_004851414.1
ATGCCGCGCCAGTTCCCCAAGCTGAGCATCTCAGAGGTGGATGAGCAAGTCCGGCTCCTGGCTGAGAAGGTGTTTGCTAAGGTGCTGCGAGAAGAGGACAGTAAAGATGCTCTGTCCCTCTTCACCGTCCCCGAGGACTGTCCCATCGGGCAGAAGGAAGCCAAGGAGAGGGAGCTGCAGAAGGAGCTGGCAGAGCAGAAGTCTGTGGAGACTGCGAAAAGAAAGAAAAGTTTCAAGATGATCCGATCCCAGTCCTTGTCCCTGCAAATGCCGACGCAGCAAGACTGGAAGGGTACCCCAGCGTCCAGCCCAACCATGTCTCCCGTGACCCCTGTGGTCTATGGAGCCACCTCCCAGCCCACACCTGCACCCTATGCCATGCCCGAGTACCAGCGGGTCACCATCAGCGGAGATTACTGTGCTGGGATCACTGTAGAGGACTATGAGCAGGCTGCCAAGAGCCTAGCCAAGGCCCTGATGATCCGGGAGAAGTATGCACGGCTCGCCTACCACCGCTTTCCACGGACCACGGCCCAGTACCTAGGTCATGGGGTGGCTAATGCTGCACTTCTGGACGAGGGTTTCCCGGACTTCCACCCTCCCCCACTGCCCCAGGAGGACCCTTACTGCCTGGAGGATGCACCCCCCAACCTGGGGTACCTGGTCTGCATGCGGGGGGGCATCCTCTTTGTGTATGACAACAAGCAGATGCTGGAGCGCCAGGAGCCCCACAGCCTGCCCTACCCTGACCTGGAGACCTACACAGTGGACATGAGCCACATCCTGGCCCTCATCACCGATGGCCCCACGAAAACCTATTGTCACCGGAGACTGAATTTTCTGGAATCCAAGTTCAGCCTTCATGAGATGTTAAATGAAATGTCTGAGTTCAAAGAGCTGAAGAGTAACCCCCACCGAGACTTCTATAACGTGAGAAAGGTGGACACGCACATCCATGCAGCGGCCTGCATGAACCAGAAGCACTTGCTGCGTTTCATCAAGCACACATACCAGACGGAGCCCGACAGAACTGTGGCCGAGAAGCTGGGCCAGAAGGTCACCCTGAGGCAGGTGTTCGACAGCCTTCACATGGACCCCTATGATCTCACCGTGGATTCGCTGGATGTCCATGCAGGCCGGCAGACATTCCATCGCTTTGACAAGTTCAACTCCAAATACAACCCTGTGGGGGCCAGTGAGCTCCGTGACCTGTATTTGAAAACTGAAAACTACCTGGGAGGAGAGTACTTTGCTCGGATGGTGAAGGAGGTGGCCCGGGAGCTGGAGGAGAGCAAGTACCAGTACTCAGAGCCGAGGCTCTCCATCTATGGCCGCAGCCCACAGGAGTGGCAAAACCTGGCCCGCTGGTTCATCCAGCACAAGGTCTACTCACCCAACATGCGCTGGATCATCCAGGTGCCCCGGATCTATGACATATTTAGGTCAAAGAAGCTGCTGCCAAGCTTTGGGAAGATGCTGGAGAACATCTTCCTGCCCCTTTTTAAGGCCACAATCAACCCCCAAGATCACCGGGAGCTTCACCTCTTCCTCAAATATGTGACAGGGTTTGACAGTGTGGATGATGAGTCCAAACACAGTGACCACATGTTCTCAGAGAAGAGCCCCAGCCCAGACATCTGGACCAGTGAGCAGAATCCGCCCTACAGCTACTACCTGTACTACATGTATGCCAACATCATGGTGCTCAACAATCTTCGGCGAGAACGGGGCCTGAGCACGTTCCTGTTCCGGCCTCACTGTGGGGAGGCCGGCTCCATCACCCATCTGGTGTCTGCCTTTCTCACTGCCGACAACATTTCCCATGGGCTGCTCCTCAAGAAGAGTCCAGTGCTGCAGTACCTCTACTACCTTGCCCAGATCCCCATTGCCATGTCTCCTCTTAGCAACAACAGCCTTTTCCTGGAATATTCCAAGAACCCCCTGCGGGAATTCCTGCACAAGGGGTTGCATGTCTCCCTCTCCACCGATGACCCTATGCAGTTCCACTACACGAAGGAGGCACTCATGGAGGAATACGCCATCGCTGCACAAGTGTGGAAGCTGAGCACGTGTGACCTGTGTGAGATCGCCAGGAACAGTGTGCTGCAGAGCGGCCTCTCACATCAGGAAAAGCAGAAGTTTCTAGGACAGAATTACTGTAAAGAAGGACCTGAGGGAAACGATATTCGAAAGACAAATGTTGCACAGATCCGGATGGCATTCCGATATGAGACTCTATGCAATGAGCTCAGCTTCCTGTCTGATGCCATGAAATCAGAAGAGATCACAGCCCTGAACAACTAG

XM_004851425.1 Coding sequence

Zbed5 zinc finger, BED-type containing 5, transcript variant X2

Length: 2007 bp    Location: 2931211..2926122   Strand: -
>XM_004851425.1
ATGTTTTGTACCACAAACTCATTGCCCATGGATCTTTTGCTGAAGCAAGGAAGTCTTAAACAAGAAGTAGAATCTTTTTGTTACCAAATTGTATCTGAATCAAATGATCAAAAAGTTGGAATATTACAAAGTGAAGATGAACAGTTGCAGCCTTCAGTTTCTAAAAAATCAGAAAGTGAGCTTTCCAGGGTCAAATTTATGTCTGGTTCCAATAAAATGACTACATTTAGTAAGAAACCAAAAAGGAGAAAATATGATGAAAGTTATTTATCTTTTGGATTTACTTATTTTGGAAATAGAGATGCACCTCATGCTCAGTGTGTATTATGTAAGAAAATCTTATCAAATAGCTCTTTAGCCCCAAGTAAGCTACGAAGACATTTGGAAACTAAACATGCTGCATATAAAGACAAAGACATTAGCTTTTTCAAGCAGCATCTTGATTCACCTGAAAATAATAAACCCCCAACACCTAAAATTGTCAACACAGATAACGAAAGTGCTACAGAGGCATCATACAATGTAAGTTACCATATAGCCCTGAGTGGAGAGGCTCATACTATTGGAGAATTGCTTATCAAACCTTGTGCAAAAGATGTAGTGATGCGGATGTTTGATGAACAGTATAGTAAGAAGATAGATGCAGTACAACTATCAAACAGTACCGTTGCACGTCGAATTAAGGATCTAGCTGCTGACATTGAAGAAGAGCTTGTTTGTAGACTAAAAATTTGTGATGGGTTTTCACTACAACTAGATGAATCAGCTGATGTTTCAGGACTTGCTGTGCTGCTTGTGTTTATTCGTTATAGGTTTAATAAATCTATTGAGGAAGACCTACTCTTATGTGAATCTTTGCAAAGTAATGCTACAGGTGAAGAAATATTCAATTGCATCAACAGTTTTATGCAGAAACATGAAATTGAATGGGAAAAATGTGTTGATGTTTGTAGTGATGCTTCTAGGGCAACATATGGGAAAATTGCCGAGGCTGTCACCTTGATAAAATATGTGGCTCCCGAAAGCACCAGCAGTCACTGCCTATTATATCGACATGCACTAGCAGTTAAAATAATGCCTACATCTCTTAAAAATGTGTTAGATCAAGCAGTACAAATCATCAATTACATTAAAGCTCGACCACATCAATCCAGACTACTAAAAATTTTATGTGAAGAAATGGGTGCTCAACACACGGCACTTCTTCTGAATACAGAGGTAAGGTGGCTTTCCCGAGGTAAAGTTCTTGTAAGACTTTTTGAACTTCGGCGTGAATTATTGGTTTTTATGGATTCTGCTTTTCGACTATCTGATTGTTTAACAAATTCATCTTGGCTGCTAAGACTTGCATATCTTGCAGATATTTTTACTAAATTAAATGAGGTTAATCTGTCAATGCAAGGGAAAAATGTAACAGTTTTTACAGTGTTTGATAAAATGTCATCATTGTTAAGAAAATTGGAATTTTGGGCCTCATCTGTAGAAGAAGAAAACTTTGATTGTTTTCCTACACTCAGTGACTTTTTGACTGAAATTAATTCTACAGTTGATAAAGATATTTGCAGTGCCATTGTGCAGCACCTAAGGGGTTTGCGTGCTACCCTTCTAAAATACTTTCCTGTAACAAATGACAGTAATGTGTGGGTTAGAAATCCATTTACAGTAACTGTTAAACCATCCTCATTAGTAGCACGGGATTATGAAAGCCTGATTGATTTAACATCTGATTCTCAAGTGAAACAAAATTTCAGTGAACTTTCACTAAATGATTTTTGGAGTAGCCTAATTCAAGAATACCCAAGCATAGCAAGACGTGCAGTTCGTGTGCTTCTTCCTTTTGCTACAATGCACTTGTGTGAAACAGGATTTTCATATTATGCTGCAACAAAAACAAAATATAGAAAAAGACTTGATGCTGCACCTCATATGCGGATCCGTCTTAGTAACATTACACCTAATATTAAACGGATATGCGATAAAAAGACACAAAAACATTGTTCTCATTAA

XM_004851429.1 Coding sequence

Dkk3 dickkopf WNT signaling pathway inhibitor 3

High confidence: 4 potential gene matches
Length: 1047 bp    Location: 4085745..4042459   Strand: -
>XM_004851429.1
ATGCCGCGGCTCGGACGCACCCTGTTGTGCCTGCTGCTGGCCGCGGCGGTCCCCACGGCCCCCGCGCCGGCTCCGACAGCGACGTCGGCTCCCGCCGAGCCGGGCCCGGCTCTCAGCTACCCGCAGGAGGAGGCCACCCTCAACGAGATGTTCCGCGAGGTGGAGGAGCTGATGGAGGACACGCAGCACAAGCTGCAAAGCGCGGTAGAGGAGATGGAGGCAGAAGAAGCTGCTGCTAAATCGTCATCAGCAGTGAACTTGGCAAGCTTACCTACCATCTATCACAATGAGACCAACACAGATACCAAGGTGGGAAATAATACCATCCACGTGCACCGAGAAATTCATAAGATAACCAACAACCAGACTGGACAGACGGTCTTTGCAGAGACGGTCATTACGTCTGTGGGAGATGAAGAAGGCCAAAGGAGCCCTGAGTGCATCATCGACGAGGACTGCGGCCTCTCCAAATACTGCCAGTTCGCCAGCTTCCAGTACACCTGCCAGCCGTGTCGGGACCAGCAGGCGCTCTGCACCCGGAACAGTGAGTGCTGTGGAGACCAGCTGTGTGTCTGGGGTCACTGCACCAAAAAGGCCACCAGAGGTGGCAACGGGACCATCTGTGACAACCAGAGGGATTGCCAGCCTGGGCTGTGCTGCGCCTTCCAGAGAGGCCTGCTGTTCCCCGTGTGTACTCCGCTGCCCGTGGAGGGTGAGCTCTGCCATGACCCTTCCAGCCGGCTGCTGGACCTCATCACCTGGGAGCTGGAGCCTGACGGGGCTTTGGACCGGTGTCCATGTGCCAGTGGCCTCCTCTGCCAGCCCCACAGCCAGAGCCTGGTGTACGTGTGCAAGCCAGCTTTCGACGGCAGCCGCGACCCCAACGGGGAGAGCCTGTTGCCCAGGGAGGCCCTCAATGAGGATGAAGACGGTGGCTTCATGGAGGAGGTGCGCCAGGAGCTGGAGGACCTGGAGCGGAGCCTGACCCAAGAGAGGGTGCTTGGGGAGCCCACTGCCACCGAGCTTCTAGGGGGAGAGGAGATCTAG

XM_004851434.1 Coding sequence

Mical2 microtubule associated monooxygenase, calponin and LIM domain containing 2, transcript variant X4

High confidence: 4 potential gene matches
Length: 3300 bp    Location: 4167503..4300527   Strand: +
>XM_004851434.1
ATGGGCGAGAATGAGGATGAGAAGCAGGCCCAGGCGGGGCAGGTTTTTGAGAACTTTGTCCAGGCTTCCACGTGCAAAGGCACCCTCCAGGCCTTCAACATCCTCACGCGCCACCTGGACCTAGACCCTCTGGACCACAGGAACTTCTACTCCAAGCTCAAGTCCAAGGTGACCACCTGGAAGGCCAAAGCCCTGTGGTACAAACTGGACAAGCGTGGCTCCCACAAAGAGTACAAGCGAGGGAAGGCGTGCATGAACACCAAGTGTCTCATTGTTGGCGGAGGACCCTGTGGCTTGCGCACTGCCATTGAACTCGCCTACCTGGGAGCCAAAGTGATCGTGGTAGAGAAAAGGGACACCTTCTCCCGGAACAATGTGCTGCACCTCTGGCCTTACACCATCCATGACCTGCGGGGCCTGGGAGCCAAGAAGTTCTATGGGAAGTTCTGCGCTGGCTCCATCGACCACATCAGTATTCGTCAACTGCAGCTCATCCTATTCAAGGTGGCCCTGATGTTGGGAGTTGAAATCCATGTGAATGTGGAGTTTGTGAAGGTTCTCGAACCTCCTGAAGATCAAGAAAATCAAAAAATTGGCTGGAGAGCAGAACTCCTCCCCGCAGACCACCCCCTGTCAGAGTTTGAGTTTGATGTCATCATTGGTGCTGATGGCCGCAGGAACACCCTGGAAGGGTTCAGGAGGAAGGAATTCCGCGGGAAGCTGGCCATCGCCATCACCGCCAACTTCATCAACAGGAACAGCACGGCTGAGGCCAAGGTGGAAGAGATTAGCGGGGTGGCCTTCATCTTCAATCAGAAATTCTTTCAGGACCTGAAGGAGGAAACAGGGATTGATCTAGAGAACATTGTTTACTACAAGGACTGCACCCACTATTTTGTCATGACTGCCAAGAAGCAGAGCCTGCTCGACAAAGGTGTCATCATCAATGACTACATCGACACGGAGATGCTGCTGTGTGCTGAGAACGTGAACCAGGACAACCTGCTGTCCTATGCCCGGGAAGCTGCAGACTTCGCCACCAACTACCAGCTGCCATCCTTAGACTTTGCTATGAACCACTACGGGCAGCCCGACGTGGCCATGTTTGATTTCACCTCCATGTATGCCTCAGAGAATGCTGCCCTGGTGCGCGAACGGCAGGGACACCCGCTGCTCGTGGCCCTTGTGGGCGACAGCTTGCTTGAGCCATTTTGGCCCATGGGTACAGGCTGTGCCCGTGGCTTCCTGGCGGCCTTTGACACAGCGTGGATGGTGAAGAGCTGGGACCAGGGGACTCCTGCCCTGGAAGTGCTGGCCGAAAGAGAAAGTCTTTACCGGCTGTTGCCTCAGACAACCCCGGAGAACATCAACAAGAACTTTGAGCAGTACACGCTGGACCCAGGGACGCGGTACCCAAACCTCAACTCACACTGTGTCCGGCCCCATCAGGTGAAGCATCTGTACATCACCAAGGAGCTGGACCACTACCCTCTTGAGAGACTCAACTCAATGAGGAGATCCGTCAACCTCTCCAGGCGGGAGTCAGATATCCGGCCCAGCAAGCTCTTAACCTGGTGCCAGCAGCAGACCAAGGGCTACCAGCATGTCAATGTCACTGACCTGACCACATCCTGGCGTAGCGGCCTGGCCCTCTGTGCCATCATCCACCACTTCCGGCCGGAGCTGATCAACTTTGACTCTTTGAATGAAGATGATGCTGTAAAGAACAACCAGCTGGCATTTGATGTGGCCGAACATGAGTTTGGGATCCCTCCGGTGACCACAGGCAAAGAGATGGCATCAGCCCAGGAGCCTGACAAGCTCAGCATGGTCATGTACCTCTCCAAGTTCTATGAGCTCTTCCGGGGCGCCCCGCTGCGGCCTGTGGATTCTTGGCGCAAAAGCTATGGAGAAAATGCCGACCTCAGTTTTTCCAAATCCTCCATTTCTAATAACTATCTCAACCTCACACTTCCCAGGAAAAGGACCCCTCGGGGAGATGCCCAAACGGAAGAGAACGACGTGAACAAGCGGAGGCGGAAAGGCTTCATCACCGTGGACCAGGATTGTGTGCGCAGGCTGCCAACCTTCTCCAGCCATAGTTTGGGTTCCTCTCAAGAGTGCGGCAACAGTAAGGAAGCAGGAAATCAGAACAAAGTCAAGTCCATGGCGAGTCAGCTGCTGGCCAAGTTTGAGGAGAGCACACGGAACCCCTCAGTCCTGAGGCAGGAGCGCCGTGTCTCAGGGATAGGTAACCCCGTCCTGTGCTCTTCCGCTGACCCTCCTGTAGACTCGCACTGCCCCACGCCGAAGGAGCCCACTCCCAGCCCACCGCCTCCTCTGAAAAGGCAGGTGCTCAGGGAGCTCAAGCAGGTGTCTCCTGGTGGCGAGTGTCCAAGCCGGCCCTGGAGAGCCAGGGCCAAGTCTGACCTGCAGCTCAGTGGCCCAGAAAACCTTGCCTCCCTGCCTCCCGCTTGCCAGGGGGCCCTGGCCCTCTCGGGGGTACTGCGGCGGCTACAGCAAGTGGAGGAAAAGATTCTCCAGAAGAGGTCTCAGAACTTGGCCAACAGGGAATTTCACCAAAAGAACATTAAAGAGAAAGCGGCTCACCTCGCCTCCATGTTTGGACACGGGGATTTCCCACAGAATAAACTACTCTCTAAAGGCCTGTCTCATACTCATCCTCCATCTTCTTCCTCTTGCCTTCCGTCTCCTGATCCAGCTGCTACTTCTACTCCATCAACTGTTGACTCTGCTTCTCCTGCCAGAAAGCTGACAGTAGGGAAAGTGTCCAGCGGAATAGGGGCTGCGGCTGAAGTCCTGGTCAATCTGTACTTGAATGATCACAGACCTAAGGCCCAGGCCACCTCTCCAGACCTGGAATCTATGCGGAAGACAATTCCCCTGAACCTGGGCGGCAGTGACACCTGCTACTTCTGTAAGAAGCGTGTGTATGTGATGGAGCGGCTGAGTGCTGAGGGCCACTTCTTCCACCGAGAGTGCTTCCGCTGCAGCATCTGTGCCACTACCTTGCGCCTGGCCACCTACGCCTTTGACTGTGAAGAAGGCAAGTTTTACTGCAAGCCTCATTTTATTCACTGTAAAACCAACAGCAAACAACGGAAGAGATGGACAGAGTTGAAGCAAGAAAGAGAGGAGGAGAGGACGTGGCAAGAGCCAGAAGCCCCTCGGCGAGATGCTGCCACGGAAAGCTCTTGCGCAGTGGCTGCCATCAGCACAGCAGAAGGCAGCCCTCCAGTTCATTTCAGCCTTCCAGTACTACACCCACTCCTTGGCTGA

XM_004851440.1 Coding sequence

Tead1 TEA domain family member 1 (SV40 transcriptional enhancer factor), transcript variant X2

Length: 1524 bp    Location: 4695581..4928301   Strand: +
>XM_004851440.1
ATGGAAACTGACCCCAGTGAGCACTGGAAACTTAAGAGACAGATGATGTTCCAGGAACTGGGAATGAAAAAAAGACAGAGTTTAAAAACAGTGCGTTGGAGGGAGCCCAGGTCCTGGGACAGAAAGGCTTATTTTCTTGAAAAGGCTCCAGGCTTCGGCTTGGAAAATCCAACCGCCAAAATTGAGCCCAGCAGCTGGAGCGGCAGCGAGAGCCCTGCCGAAAACATGGAAAGGATGAGTGACTCTACAGATAAGCCGATTGACAATGACGCGGAAGGGGTCTGGAGCCCCGACATTGAGCAGAGCTTTCAGGAGGCCCTGGCTATCTATCCGCCATGTGGGCGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAATGAATTGATAGCCAGATACATCAAACTCAGGACAGGGAAGACGAGGACCAGAAAGCAGGTGTCTAGTCATATACAGGTCTTAGCAAGAAAGAAAGTTCGAGAAATTCAAGCCGCCATTAAGGTGTCTAGTCACATTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGATCAGACTGCAAAGGACAAGGCCCTGCAGCACATGGCCGCCATGTCGTCAGCCCAAATCGTCTCTGCCACTGCCATTCACAACAAGCTGGGGCTGCCTGGGATCCCACGCCCCACCTTCCCAGGGGCGCCGGGGTTTTGGCCTGGAATGATACAAACAGGGCAGCCAGGATCCTCACAAGATGTCAAGCCCTTTGTGCAGCAGGCCTACCCCATCCAGCCCGCGGTCACGGCCCCCATTCCAGGGTTTGAGCCTCCGTCCGCCCCAGCTCCCTCTGTCCCTGCCTGGCAGGGCCGCTCCATTGGCACAACCAAGCTTCGCCTGGTGGAATTCTCAGCTTTCCTCGAACAGCAGCGAGACCCAGACTCGTACAACAAACACCTCTTCGTGCACATCGGGCATGCCAACCATTCTTACAGTGACCCATTGCTCGAATCAGTGGATATACGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTATTTGGAAAGGGCCCTCAAAATGCCTTCTTCCTTGTAAAATTCTGGGCCGACTTAAACTGCAATATTCAAGATGATGCTGGGGCTTTTTATGGTGTAACCAGTCAGTATGAAAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTGTGCTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACAGAGTATGCAAGGTTCGAGAATGGCCGATTTGTATACCGAATAAACCGCTCCCCGATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACAAGAAACTCTCCTCTGCATGGCCTGTGTATTTGAAGTTTCAAATAGTGAACATGGAGCACAACATCATATTTACAGGCTTGTAAAGGACTGA

XM_004851445.1 Coding sequence

Rassf10 Ras association (RalGDS/AF-6) domain family (N-terminal) member 10

High confidence: 2 potential gene matches
Length: 1506 bp    Location: 5007258..5011963   Strand: +
>XM_004851445.1
ATGGATCCCTCGGAGAAGAAGATCTCCGTGTGGATCTGTCAGCAGGAGAAGCTGGTGTCCGGCCTCTCCCGCCGCACCACTTGCTCGGACGTGGTGCGCGTGCTCTTGGAGGACGGCTGCCGGCGGCGCCGGGGTCAGCGGGGGGGCCAGCGCCGGGGGAGGGCCGGTGACCCGCCCGACCAGGGAGAATTGCCCGAATCCCTGGAAGAAAACGACGAGGAGGATGACGAGGCGCTGCCCCAGGGCATGCTGTGTGGGCCCCCGCAGTGCTATTGCATCGTGGAGAAGTGGCGCGGCTTTGAGCGCATCCTGCCCAACAAGACGCGCATCTTGCGCCTCTGGGCCGCCTGGGGCGACGAGCAAGAGAACGTGCGCTTCGTGCTGGTGCGCAGCGAGGCGTCCTTGCCCAACGCGGGCCCGCGCAGTGCCGAGGCGCGGGTGGTGCTCAGCCGGGAGCGCCCCTGCTTGGTCCGCGGAGCCCCTGTTCGGCCCAGCCTGGCCATGACCCAGGAGAAACAGCGGCGGGTGGTGCGCAAGGCCTTCCGCAAGCTGGCTAAGCTCAACCGGCGGCGCCAGCTGCAGCCGCCGTCACCCTGTTCGTCCACGTCGTCGTCCACCGCCTCGTCCTACTCCCCGCCGCCGCGCGCCCCTGAAAGTGCGTCGGTGGAGCGCATGGAGACGCTGGTGCACCTGGTGCTGTCGCAGGACCACACCATCCGCCAGCAGGTGCAGCGGCTCCGGGAGCTGGACCGCGAGATCGACCGCTACGAAGCCAAGGTGCACTTGGACCGCATGCGGCGGCACGGGGTTAACTACGTGCAGGACACTTACTTGGTGGGGGTGGACGTTGAGCTGGACGGGCCCACCCCGGGAGAGGAGCCGGGGAAGGAGGCGGCGGCAGCTGCGCCCCTGGACAGTGAGGCGCAGGCGGCGGCGCTGGAAGAGTTGGCCCGGCGCTGCGACGACCTGCTGCAGCTGCAGGAGCAGCGAGCCCAGCAGGAGGAGGTGCTGGAGCGCCTCTCGACCGAGATCCAGGAGGAGCTGAACCAGAGGTGGATGGAGCGGCGCAAGGAGGAGCTGGCGGCGCGCGAGGAGCCCCCGGAGCCTGACGGCGGCCCGGACGGCGAGCTGCTGCTGGAGCAGGAGCGGGTCAGGACCCAGCTCAGCACCAGCCTTTACATCGGGCTGCGGCTCAACACGGACCTGGAGACCGTCAAGGCGGACTTGGATTACAGCCAGCAGCAGCGGGACAGCAAGGAGCGTGAGCTGCAGGGCCTCCTCCGGACTCTGCACAATTTGGAACCGACGGTGGGGCGGGATGGGGCTCCCAGCCCCGGCCCACCCGCGCGGGAACCCCGGCCTAAAGCCTGTGCCGAGGTGTGGGTGGACCAGGCCCGCGGACTGGCCAAGAGCTGTCCTGGCAACGACGAGGACTCGGACACGGGGCTGAGCTCCATGCACAGCCAGGACTCGGACTCCGTGCCGGTGTGCGAGTCCCTCGTGTAG

XM_004851447.1 Coding sequence

Arntl aryl hydrocarbon receptor nuclear translocator-like, transcript variant X2

Length: 1881 bp    Location: 5295143..5391645   Strand: +
>XM_004851447.1
ATGGCAGACCAGAGAATGGACATTTCCTCCACGATCAGTGACTTCATGTCCTCCGGCCCCACTGACCTGCTCTCCAGCTCCCTGGGCGCCGGCAGCGTGGATTGCAACCGCAAGCGGAAGGGCAGCTCCACCGACTACCAAGAAAGCATGGACACAGACAAAGATGACCCTCATGGAAGGTTGGAATACACAGAACACCAAGGAAGGATAAAAAATGCAAGGGAAGCTCACAGTCAGATTGAAAAGCGGCGCAGGGATAAGATGAACAGTTTTATTGATGAGCTGGCTTCTTTGGTACCAACATGCAACGCGATGTCCAGGAAGTTAGATAAACTCACCGTGTTAAGAATGGCTGTTCAGCACATGAAAACATTAAGAGGTGCCACTAACCCGTACACAGAAGCAAACTACAAGCCAACTTTTCTATCAGACGATGAATTGAAACACCTCATTCTCAGGGCAGCAGATGGATTTTTGTTTGTCGTAGGATGTGACCGAGGGAAGATACTCTTTGTCTCAGAGTCTGTCTTCAAGATCCTCAACTACAGCCAGAATGATCTGATTGGTCAGAGTTTGTTTGATTACCTGCATCCTAAAGATATCGCCAAAGTCAAGGAGCAGCTCTCCTCCTCCGACACCGCACCCCGGGAGCGGCTCATAGATGCAAAAACTGGACTTCCAGTTAAAACAGATATAACCCCTGGGCCGTCTCGATTATGTTCTGGAGCACGACGTTCTTTCTTCTGTAGGATGAAGTGTAACAGGCCTTCAGTAAAGGTGGAAGACAAGGACTTCCCCTCCACCTGCTCAAAGAAAAAAGCAGATCGAAAAAGCTTCTGCACAATCCACAGCACAGGCTATTTGAAAAGCTGGCCCCCCACAAAGATGGGGCTGGATGAAGACAATGAACCAGACAATGAGGGGTGTAACCTCAGCTGCCTTGTTGCCATTGGACGGCTGCATTCTCACGTGGTTCCACAACCAGTGAACGGGGAAATCAGGGTGAAAGCTATGGAATATGTTTCTCGGCACGCAATAGATGGGAAGTTTGTTTTTGTAGACCAGAGGGCAACAGCTATTTTGGCATATTTACCACAAGAACTTCTAGGCACATCATGTTATGAATATTTTCATCAAGATGACATAGGACATCTTGCAGAATGTCACAGGCAAGTTCTACAGACAAGAGAAAAGATTACAACTAATTGCTATAAGTTTAAAATCAAAGATGGTTCTTTCATCACACTACGAAGTCGATGGTTCAGTTTCATGAACCCTTGGACCAAGGAAGTAGAATACATTGTCTCAACCAACACTGTTGTTTTAGCCAACGTCCTGGAAGGCGGGGACCCAACCTTCCCGCAGCTCACAGCATCCCCCCACAGCATGGACAGCATGCTGCCCTCTGGAGAAGGTGGCCCAAAGAGGACCCATCCCACTGTTCCAGGGATTCCAGGGGGAACCAGGGCTGGGGCAGGAAAAATAGGTCGAATGATTGCTGAGGAAATCATGGAAATCCACAGGATAAGAGGGTCGTCGCCTTCCAGCTGTGGTTCTAGCCCACTGAACATCACAAGTACGCCTCCCCCTGATGCCTCCTCTCCAGGAGGCAAGAAGATTTTAAATGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTACCAGGGCAGGCACAGGAGAATCCAGGCTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGCATAGACATGATAGATAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAAGCGGCAATGGCTGTCATCATGAGCCTCCTGGAAGCAGATGCTGGGCTGGGTGGCCCTGTTGACTTTAGCGACTTACCATGGCCGCTGTAG

XM_004851450.1 Coding sequence

Arntl aryl hydrocarbon receptor nuclear translocator-like, transcript variant X5

Length: 1842 bp    Location: 5295143..5391645   Strand: +
>XM_004851450.1
ATGGCAGACCAGAGAATGGACATTTCCTCCACGATCAGTGACTTCATGTCCTCCGGCCCCACTGACCTGCTCTCCAGCTCCCTGGGCGCCGGCAGCGTGGATTGCAACCGCAAGCGGAAGGGCAGCTCCACCGACTACCAGTTGGAATACACAGAACACCAAGGAAGGATAAAAAATGCAAGGGAAGCTCACAGTCAGATTGAAAAGCGGCGCAGGGATAAGATGAACAGTTTTATTGATGAGCTGGCTTCTTTGGTACCAACATGCAACGCGATGTCCAGGAAGTTAGATAAACTCACCGTGTTAAGAATGGCTGTTCAGCACATGAAAACATTAAGAGGTGCCACTAACCCGTACACAGAAGCAAACTACAAGCCAACTTTTCTATCAGACGATGAATTGAAACACCTCATTCTCAGGGCAGCAGATGGATTTTTGTTTGTCGTAGGATGTGACCGAGGGAAGATACTCTTTGTCTCAGAGTCTGTCTTCAAGATCCTCAACTACAGCCAGAATGATCTGATTGGTCAGAGTTTGTTTGATTACCTGCATCCTAAAGATATCGCCAAAGTCAAGGAGCAGCTCTCCTCCTCCGACACCGCACCCCGGGAGCGGCTCATAGATGCAAAAACTGGACTTCCAGTTAAAACAGATATAACCCCTGGGCCGTCTCGATTATGTTCTGGAGCACGACGTTCTTTCTTCTGTAGGATGAAGTGTAACAGGCCTTCAGTAAAGGTGGAAGACAAGGACTTCCCCTCCACCTGCTCAAAGAAAAAAGCAGATCGAAAAAGCTTCTGCACAATCCACAGCACAGGCTATTTGAAAAGCTGGCCCCCCACAAAGATGGGGCTGGATGAAGACAATGAACCAGACAATGAGGGGTGTAACCTCAGCTGCCTTGTTGCCATTGGACGGCTGCATTCTCACGTGGTTCCACAACCAGTGAACGGGGAAATCAGGGTGAAAGCTATGGAATATGTTTCTCGGCACGCAATAGATGGGAAGTTTGTTTTTGTAGACCAGAGGGCAACAGCTATTTTGGCATATTTACCACAAGAACTTCTAGGCACATCATGTTATGAATATTTTCATCAAGATGACATAGGACATCTTGCAGAATGTCACAGGCAAGTTCTACAGACAAGAGAAAAGATTACAACTAATTGCTATAAGTTTAAAATCAAAGATGGTTCTTTCATCACACTACGAAGTCGATGGTTCAGTTTCATGAACCCTTGGACCAAGGAAGTAGAATACATTGTCTCAACCAACACTGTTGTTTTAGCCAACGTCCTGGAAGGCGGGGACCCAACCTTCCCGCAGCTCACAGCATCCCCCCACAGCATGGACAGCATGCTGCCCTCTGGAGAAGGTGGCCCAAAGAGGACCCATCCCACTGTTCCAGGGATTCCAGGGGGAACCAGGGCTGGGGCAGGAAAAATAGGTCGAATGATTGCTGAGGAAATCATGGAAATCCACAGGATAAGAGGGTCGTCGCCTTCCAGCTGTGGTTCTAGCCCACTGAACATCACAAGTACGCCTCCCCCTGATGCCTCCTCTCCAGGAGGCAAGAAGATTTTAAATGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTACCAGGGCAGGCACAGGAGAATCCAGGCTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGCATAGACATGATAGATAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAAGCGGCAATGGCTGTCATCATGAGCCTCCTGGAAGCAGATGCTGGGCTGGGTGGCCCTGTTGACTTTAGCGACTTACCATGGCCGCTGTAG

XM_004851458.1 Coding sequence

Btbd10 BTB (POZ) domain containing 10, transcript variant X6

Length: 1284 bp    Location: 5462202..5392428   Strand: -
>XM_004851458.1
ATGAGTCTACAAGGTGCTAGTGGGGGCCAGGAGAGATCAAGAGACAGACGAAGGTCAAGTGACAGATCACGGGATTCATCTCATGAAAGAACAGAGTCTCAACTCACTCCTTGTATTAGAAATGTTACTTCTCCAACACGGCAGCACCATGTTGAAAGAGAAAAAGATCATAGTTCCTCTCGCCCAAGCAGTCCTCGTCCTCAAAAAGCATCTCCAAATGGTTCAGTTAGCAGTGCTGGGAACAGCAGCAGAAATAGTAGTCAGTCAAGTTCAGATGGTAGCTGTAAGACAACTGGGGAGATGGTATTTGTATATGAAAATGCAAAAGAAGGAGCTCGAAATGTAAGAACGTCAGAACGAGTGACATTAATAGTGGATAACACTAGATTTGTTGTAGACCCATCTATTTTTACTGCACAGCCAAATACAATGTTGGGCAGGATGTTTGGATCTGGCCGAGAACATAACTTTACACGTCCCAATGAGAAGGGAGAGTATGAGGTGGCAGAAGGGATTGGTTCCACTGTATTTCGAGCTATCCTGGATTACTATAAGACAGGAATAATTCGTTGTCCTGATGGCATATCTATTCCTGAGCTGAGAGAAGCATGCGATTATCTCTGTATTTCTTTTGAATATAGTACTATTAAATGTAGAGATCTCAGTGCCCTGATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCTAGTGCCCAGAGTGGGGAACGAGAATGTCATATAGTGGTGCTTACAGATGATGACGTGGTTGACTGGGATGAAGAGTATCCACCACAGATGGGAGAAGAATATTCACAAATTATTTATAGCACAAAATTATATAGATTTTTCAAGTATATTGAAAACAGAGATGTGGCCAAATCAGTCTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGTTATCCTACGTACAAAGAAAAAGTAAAGAAAAGGCCTGGGGGCCGCCCAGAAGTCATTTACAACTATGTTCAAAGACCCTTTATTCGAATGTCCTGGGAAAAGGAAGAAGGAAAGAGTCGGCATGTAGACTTCCAGTGTGTAAAAAGTAAATCTATCACCAACCTGGCAGCAGCTGCTGCAGACATTCCCCAGGACCAGCTGGTAGTCATGCACCCAACTCCACAGGTGGATGAGCTGGATATCCTCCCCATTCACCCCCCTTCTGGCAACAGTGACCTCGATCCTGACGCACAGAATCCAATGCTGTGA

XM_004851457.1 Coding sequence

Btbd10 BTB (POZ) domain containing 10, transcript variant X5

Length: 1335 bp    Location: 5437855..5392428   Strand: -
>XM_004851457.1
ATGGACAGTACTTCCTCACGTGTTGCTAAAGGAGGAGTAGACCACACCAAAATGAGTCTACAAGGTGCTAGTGGGGGCCAGGAGAGATCAAGAGACAGACGAAGGTCAAGTGACAGATCACGGGATTCATCTCATGAAAGAACAGAGTCTCAACTCACTCCTTGTATTAGAAATGTTACTTCTCCAACACGGCAGCACCATGTTGAAAGAGAAAAAGATCATAGTTCCTCTCGCCCAAGCAGTCCTCGTCCTCAAAAAGCATCTCCAAATGGTTCAGTTAGCAGTGCTGGGAACAGCAGCAGAAATAGTAGTCAGTCAAGTTCAGATGGTAGCTGTAAGACAACTGGGGAGATGGTATTTGTATATGAAAATGCAAAAGAAGGAGCTCGAAATGTAAGAACGTCAGAACGAGTGACATTAATAGTGGATAACACTAGATTTGTTGTAGACCCATCTATTTTTACTGCACAGCCAAATACAATGTTGGGCAGGATGTTTGGATCTGGCCGAGAACATAACTTTACACGTCCCAATGAGAAGGGAGAGTATGAGGTGGCAGAAGGGATTGGTTCCACTGTATTTCGAGCTATCCTGGATTACTATAAGACAGGAATAATTCGTTGTCCTGATGGCATATCTATTCCTGAGCTGAGAGAAGCATGCGATTATCTCTGTATTTCTTTTGAATATAGTACTATTAAATGTAGAGATCTCAGTGCCCTGATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCTAGTGCCCAGAGTGGGGAACGAGAATGTCATATAGTGGTGCTTACAGATGATGACGTGGTTGACTGGGATGAAGAGTATCCACCACAGATGGGAGAAGAATATTCACAAATTATTTATAGCACAAAATTATATAGATTTTTCAAGTATATTGAAAACAGAGATGTGGCCAAATCAGTCTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGTTATCCTACGTACAAAGAAAAAGTAAAGAAAAGGCCTGGGGGCCGCCCAGAAGTCATTTACAACTATGTTCAAAGACCCTTTATTCGAATGTCCTGGGAAAAGGAAGAAGGAAAGAGTCGGCATGTAGACTTCCAGTGTGTAAAAAGTAAATCTATCACCAACCTGGCAGCAGCTGCTGCAGACATTCCCCAGGACCAGCTGGTAGTCATGCACCCAACTCCACAGGTGGATGAGCTGGATATCCTCCCCATTCACCCCCCTTCTGGCAACAGTGACCTCGATCCTGACGCACAGAATCCAATGCTGTGA

XM_004851464.1 Coding sequence

Rras2 related RAS viral (r-ras) oncogene homolog 2, transcript variant X1

Length: 615 bp    Location: 6244692..6180822   Strand: -
>XM_004851464.1
ATGGCTGCGGCCGGCTGGCGGGACGGCTCCGGCCAGGAGAAGTACCGGCTCGTGGTGGTCGGCGGGGGCGGCGTGGGCAAGTCGGCGCTCACCATCCAGTTCATCCAGTCCTATTTTGTAACAGATTATGATCCAACCATTGAAGATTCCTATACAAAGCAATGTGTGATAGATGACAGAGCAGCCCGGCTAGATATTTTGGATACAGCTGGACAAGAAGAGTTTGGAGCCATGAGAGAACAGTATATGAGGACTGGTGAAGGCTTCTTGTTGGTCTTTTCAGTCACAGATAGAGGCAGTTTTGAAGAAATCTATAAGTTTCAAAGACAGATTCTTAGAGTAAAGGATCGCGATGAGTTTCCAATGATTTTAATTGGTAATAAAGCGGACCTGGATCATCAAAGGCAGGTGACACAGGAGGAAGGACAACAGTTAGCACGGCAACTTAAGGTAACATACATGGAGGCATCAGCAAAGATTAGGATGAATGTAGATCAAGCTTTCCATGAACTTGTTCGGGTTATAAGGAAATTTCAAGAGCAAGAATGTCCTCCTTCACCAGAACCAACACGGAAAGAGAAAGACAAGAAAGGCTGCCATTGTGTCATTTTCTAA

XM_004851469.1 Coding sequence

Psma1 proteasome (prosome, macropain) subunit, alpha type, 1

High confidence: 3 potential gene matches
Length: 792 bp    Location: 6392379..6380057   Strand: -
>XM_004851469.1
ATGTTTCGCAACCAGTATGACAATGATGTCACTGTTTGGAGCCCTCAGGGCAGGATTCATCAAATTGAATATGCAATGGAAGCTGTTAAACAAGGTTCTGCCACAGTTGGTCTGAAATCAAAAACTCATGCAGTGTTGGTTGCATTGAAGAGGGCACAGTCAGAGCTTGCTGCTCACCAGAAAAAAATTCTGCATGTTGACAACCATATTGGTATCTCTATTGCCGGACTTACTGCTGATGCTAGACTCTTATGTAATTTTATGCGACAGGAGTGTTTGGATTCCAGATTCGTATTTGACAGACCACTTCCTGTGTCTCGTCTTGTATCTCTAATTGGAAGCAAGACCCAGATACCAACACAGCGGTATGGCCGGAGACCATATGGTGTTGGGTTGCTTATTGCGGGTTACGATGATATGGGTCCTCATATTTTCCAGACCTGTCCATCTGCTAACTATTTTGACTGCAGAGCTATGTCTATTGGAGCCCGTTCTCAGTCAGCTCGTACTTACTTGGAGAGACATATGTCTGAATTTATGGAGTGCAATTTAAATGAACTGGTTAAGCATGGGCTGCGTGCCTTACGAGAGACACTTCCTGCAGAGCAAGACCTGACTACCAAGAATGTTTCCATTGGAATTGTTGGTAAAGACTTGGAATTCACAATCTATGATGATGATGATGTGTCTCCATTCCTGGAAGGTCTTGAAGAAAGACCACAGAGAAAGGCACAGCCTGCACAACCTGCTGATGAACCTGCAGAAAAAGCTGATGAACCAATGGAACATTAA

XM_004851474.1 Coding sequence

Calcb calcitonin-related polypeptide beta, transcript variant X1

Length: 384 bp    Location: 6851772..6856239   Strand: +
>XM_004851474.1
ATGGGCTTCCGGAAATTCTCCCGCATCCTGGCTTTCAGCATCTTGGTCCTGTGCCAGGCCGGCAGCCTCCGGGCAGCATCTTCCAGGCAGGACTTGGAGAGCAGCCCAGTCCTGGTCGCGCTAGGTGAAGAGGAAGCGCGCCTCCTGCTGGCAGCACTGGTGCAGGACTACCTGCAGATGAAGGCCAGTGAGCTGGAGCAGGAGCAGGAGACAGAGGGCTCCAGTGTCACTGCCCAGAAGAGAGCCTGCAACACCGCCACCTGTGTGACCCAACGGCTGGCAGGCTTGCTGAGCAGATCAGGGGGTGTGGTGAAGGACAACTTCGTGCCCACCAATGTAGGCTCCAAAGCCTTTGGCCGGCGCCGCAGGGACCTTCAGGCCTGA

XM_004851475.1 Coding sequence

Calcb calcitonin-related polypeptide beta, transcript variant X2

High confidence: 4 potential gene matches
Length: 384 bp    Location: 6851772..6855951   Strand: +
>XM_004851475.1
ATGGGCTTCCGGAAATTCTCCCGCATCCTGGCTTTCAGCATCTTGGTCCTGTGCCAGGCCGGCAGCCTCCGGGCAGCATCTTCCAGGCAGGACTTGGAGAGCAGCCCAGTCCTGGTCGCGCTAGGTGAAGAGGAAGCGCGCCTCCTGCTGGCAGCACTGGTGCAGGACTACCTGCAGATGAAGGCCAGTGAGCTGGAGCAGGAGCAGGAGACAGAGGGCTCCAGTGTCACTGCCCAGAAGAGAGCCTGCAACACCGCCACCTGTGTGACCCAACGGCTGGCAGGCTTGCTGAGCAGATCAGGGGGTGTGGTGAAGGACAACTTCGTGCCCACCAATGTAGGCTCCAAAGCCTTTGGCCGGCGCCGCAGGGACCTTCAGGCCTGA

XM_004851480.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X4

Length: 2532 bp    Location: 8301784..7683495   Strand: -
>XM_004851480.1
ATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGAAAGGTCATGTCTCTCACCCACAAATTAACCCAAGGCTAAAGGGCATAAGTGACCGTTTTGGCAGGAATTTGGACACCTTTGAACATGGTGGTGGCCACTCTTACAACCACCAACAGATTGAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGGTAAATGGAAAAGTCAACACCAGGAAGAGACTTATGAATTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAAGTAAAGCAATGAATGGCTCTGCAGCTAAACTACAGCAGTATTATTGTTGGCCAACAGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851487.1 Coding sequence

LOC101699574 chromosome unknown open reading frame, human C11orf58, transcript variant X2

Length: 552 bp    Location: 8386113..8403721   Strand: +
>XM_004851487.1
ATGAGCGCTGCCAGGGAGTCTCACCCGCACGGGGTGAAGCGTTCAGCTTCCCCAGACGACGATCTTGGATCTAGCAATTGGGAGGCAGCAGACTTGGGCAGTGAAGAGAGAAAACAAAAGTTCCTCAGACTTATGGGTGCAGGAAAGAAAGAACACACTGGTCGTCTTGTTATAGGAGATCACAAATCAACATCACATTTCCGAACAGGGGAAGAAGACAAGAAAATTAATGAAGAACTGGAGTCTCAATATCAGCAAAGTATGGACAGTAAATTATCAGGAAGATATCGACGACATTGTGGACTTGGCTTCAGTGAGGTAGAAGATCATGATGGAGAAGGTGATGTGGCTGCAGATGATGATGATGATGATGATGATTCACCTGATCCTGAAAGTCCAGATGATTCTGAAAGTGACTCAGAGTCAGAAAAAGAAGAATCTGCTGAAGAACTCCAAGCTACTGAGCACCCTGATGAAGTGGAAGATCCCAAAAACAAAAAAGATGCAAAAGGCAACTATAAAATGATGTTTGTTAAATCCAGTGGTTCATAA

XM_004851489.1 Coding sequence

Plekha7 pleckstrin homology domain containing, family A member 7, transcript variant X1

Length: 3762 bp    Location: 8654973..8421178   Strand: -
>XM_004851489.1
ATGATCCGCTCAGGTGGGCTCCAGACCCGCGCGCGGTGGGGGTCCCGGTGGGGAGGGGCGCGCCGCGGCGGTGTCGAAAGTTTCACCGACTTCTCTCGCCTTCCCGCAGACCTGCCCCGCGGCTGGGAGGAGGGCTTCACGGAGGAGGGCGCCAGCTACTTCATCGACCATAACCAGCAGACCACAGCATTCAGGCATCCTGTGACTGGGCAATTTTCTCCAGAAAATAGCGAATTCATTCTTCAAGAAGAACAAAACCTACACATGTCAAAGCAAGAGAAAAACCAAAGACCATCCAGCATGGTCAGCGAATCGTCCACAGCTGGGACCACGTCCACCCTGGAGGCCAAGCCTGGACCCAAGATCATCAAGTCCAGCAATAAAGTCCATAGCTTTGGGAAGAGGGATCAAGCCATTCGGAGGAACCCCAATGTTCCGGTGGTGGTGAGGGGCTGGCTGCACAAGCAGGATAGTTCTGGGATGAGACTGTGGAAGAGGAGGTGGTTTGTGCTTGCTGATTACTGCTTGTTTTACTATAAAGACAGCCGAGAAGAAGTGGTCCTGGGAAGCATCCCTCTGCCCAGCTATGTGATCTCACCTGTGGCCCCTGAGGATCGCATAAGTCGCAAGTACTCTTTTAAGGCTGTGCACATGGGGATGCGAGCACTCATCTACAACAGCTCCATGGCAGGCTCCCAGGCTGAGCAGTCGGGCATGAGAACTTACTACTTCAGTGCCGATACCCTGGAAGACATGAATGCTTGGGTGAGGGCCATGAACCAGGCTGCACAGGTGCTGTCTCGATCATCACTGAAGAGGGATTTGGAGAAAGTGGAGCGGCAGGCAGTACCTCAGGCCAACCACACAGAGTCTTGTCGAGCGTGTGGCCATGTGAGACCTGGACACTCAAGGAATTGTCCTCATCACAGCCATGATGACTCTTTTGGCTTTGAGAAGCGGGAGCAGGAAGAAGAGCAGTACCATTCCCAGAGGGACCCACTGGAGGGCAAGCGGGAAAGGAGCAAGACCAGGTCCCCGTACTCGCCCACCGAGGAGGATACCTTGTTTATAGATTTACCCAGTGGCCCAAGAGGCCAGCAGGCCCAGCCCCAGCGCTCCGAGAAGAATGGCATGTTGCCCTCCTCCTGTGGCCCTGAAGAGCAGAATGGTACTGGAGGGTACCCTTGGCCCTTACCCCTCAGGGCCACCGCAGAGAAGCACAGCCAGAGGAAGAGCAGCCTGGCCCAGGCAGAGCACTGGGCAAAGGCCCTGAAGACAGACAGCAAGAGCCTTCCTTCAGAGCAGACACTTTCTCGCCAGGGTCCTAGCCAGCTCCTGTCCTTCCCAGAAAACTACCAGACCCTTCCCAAGAGCACCCGGCACCCCTCGGGGGACTCCTCACCCCCTCTGCGGAACCTGCCCAGTGACTACAAGTATGCACAGGACCGTGCTAGCCACCTGAAGATGTCGAGTGAGGAGCGCCGGGCACACCGGGATGGCACCGTATGGCAGCTGTATGAGTGGCAGCAGCGCCAGCAGTTCCGGCATGGCAGTCCCACGGCACCCATGTGTGCTGGCTCCCCGGAGTTTGCAGACCAGGGCAGGAGCAGGAGCATGCTGGAGGTTCCCCGCTCCATCTCTGTGCCTCCATCACCCTTGGACATACCTCCCCCGGGGCCCCCAAGGGTCTTCCTGCACAGGCGGCCACACACACCAGCAGAGCGTGTCACTGTAAAGCCACCAGACCAGAGGAGGAGTTTGGACATCTCGCTGGGGAGCTCTCCCAGGAAGGCACGGGGCCATGCCATCAAGAACTCCTCGCACATGGACCGACGCTCCATGCCCTCCATGGGTTACATGACCCACACTGTCAGTGCTCCCAGTTTGCATGGAAAATCGGCTGATGACACCTATCTTCAGCTGAAGAAAGACTTGGAATATCTGGATCTAAAGATGACAGGCCGGGACCTTCTCAAGGATCGAAGCCTGAAGCCTGTGAAGATTGCTGAGAGTGACATTGACGTCAAACTGAGCATCTTTTGTGAACAAGACAGGATCCTCCAGGACCTGGAAGATAAGATTCGAGCCCTCAAGGAGAACAAAGATCAGCTAGAATCCGTGCTAGAGGTGTTACACAGACAGATGGAGCAGTACCGAGACCAGCCGCAGCACCTGGAGAAGATTACCTACCAGCAGAGGTTGCTGCAGGAGGACCTGGTCCACATCCGAGCTGAGCTCTCCAGAGAATCCACCGAGATGGAAAATGCCTGGAATGAGTACCTGAAGTTGGAGAGCGATGTGGAGCAGCTGAAGCAGACCCTGCAGGAACAACAGAGACGAGCCTTTTTTTTCCAGGAGAAATCGCAGATACAGAAGGACCTGTGGAGGATTGAAGATGTCCTTGCAGGTCTGAGTGCTAATAAAGAGAACTACAGAATCCTGGTGGAATCGGTCAGAAATCCTGAGAGAAAAACGGTGCCTTTGTTCCCTCACCCGCCTGTGCCTTCACCCTTGACCTTGGAGAGCAAGTCCCCCCTGCAGCCCAGCCCTCCTGCCAGCCCAGTGCGGACCCCTCTGGAAGTTCGGCTGTTCCCACAGCTGCAGACCTATGTGCCCTACCGACCTCACCCACCCCAGCTGAGGAAAGTGACATCTCCCCTTCAGTCACCAACTAAGACAAAACCCAAAGTGGAAGATGAGGCACCTCCTAGGCCCCCGCTTCCCGAACTCTACAGCCCAGAGGACCAGCCACCTGCTGTGCCCCCTCTACCAAGGGAGGCCACCATCATCCGGCACACTTCTGTGAGGGGCCTCAAGCGGCAGTCGGACGAGAGGAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGACTCGAAGGTGGAGCTCCGGTCATCTGTTAGTGAGCCCGAGCTGGCCACCATCACTGGGCACCTGGCTCAGCCCTCCCTGGGACTCGTGGGTCCTGAGAGCAGGTACCAGACACTTCCTGGCCGAGGGCTCTCGGGGTCCATGTCCAGGCTCCAGCAGTCATCCACCATTGCGCCCTACGCCACGCTCCGGAGGGGTCTAAATGCGGAAAGCGGCAAGATGACCTTCCCTAGACCCAAGAGTGCCTTGGAGCGTCTGTACTCAGGGGACCACCAGCAAGGCAAGATGAGTGCTGAGGAGCAGCTGGAGCGCATGAAGCGGCACCAGAAGGCCCTAGTCCGAGAGCGCAAGAGAACACTGAGCCAAGCAGAGAGGACAGGCCCGGCCTCAGCGAGCTATCTTGGCCAGCTGCTCCCTGGGGACCTGGGCTCATGGAAGCGAGAGCAGGACTTTGACCTGCAATTGCTGGAGCGGGCCATGCAAGGGGAAAGGAAGGACAAGGAGGAGAATGGCTGGTTGAAAGTGCAGGCCATGCCTGTCACGGAGGTGGACCTGGAACCACAAGACTATGACCTGGACATCAGCAGAGAGCTGTCCAAACCAGAGAAAGTCTCCATCCCTGAGCGCTATGTGGAGATGGATCCCGAAGAGCCACCTAGCCTCGAAGAGCTGCAGGCACGTTACCGCAAAGCTGAGAAGATCCGCAACATCCTCACCCGGTCAAGCATGTGTAACCTCCAGCCCTCAGCAGCCCAGGACCGAAACAGCCTGGTGGACTTGGACTCCCAGCTGCAGGAGCAGGAGCGCATCATCAATATTTCCTATGCCCTGGCCTCTGAAGCCTCCCAGCGCAGCAAGCAGGTGGCAGCCCAGGCAGTGACAGACCTGTGA

XM_004851492.1 Coding sequence

Plekha7 pleckstrin homology domain containing, family A member 7, transcript variant X4

Length: 3666 bp    Location: 8654977..8421179   Strand: -
>XM_004851492.1
ATGATCCGCTCAGACCTGCCCCGCGGCTGGGAGGAGGGCTTCACGGAGGAGGGCGCCAGCTACTTCATCGACCATAACCAGCAGACCACAGCATTCAGGCATCCTGTGACTGGGCAATTTTCTCCAGAAAATAGCGAATTCATTCTTCAAGAAGAACAAAACCTACACATGTCAAAGCAAGAGAAAAACCAAAGACCATCCAGCATGGTCAGCGAATCGTCCACAGCTGGGACCACGTCCACCCTGGAGGCCAAGCCTGGACCCAAGATCATCAAGTCCAGCAATAAAGTCCATAGCTTTGGGAAGAGGGATCAAGCCATTCGGAGGAACCCCAATGTTCCGGTGGTGGTGAGGGGCTGGCTGCACAAGCAGGATAGTTCTGGGATGAGACTGTGGAAGAGGAGGTGGTTTGTGCTTGCTGATTACTGCTTGTTTTACTATAAAGACAGCCGAGAAGAAGTGGTCCTGGGAAGCATCCCTCTGCCCAGCTATGTGATCTCACCTGTGGCCCCTGAGGATCGCATAAGTCGCAAGTACTCTTTTAAGGCTGTGCACATGGGGATGCGAGCACTCATCTACAACAGCTCCATGGCAGGCTCCCAGGCTGAGCAGTCGGGCATGAGAACTTACTACTTCAGTGCCGATACCCTGGAAGACATGAATGCTTGGGTGAGGGCCATGAACCAGGCTGCACAGGTGCTGTCTCGATCATCACTGAAGAGGGATTTGGAGAAAGTGGAGCGGCAGGCAGTACCTCAGGCCAACCACACAGAGTCTTGTCGAGCGTGTGGCCATGTGAGACCTGGACACTCAAGGAATTGTCCTCATCACAGCCATGATGACTCTTTTGGCTTTGAGAAGCGGGAGCAGGAAGAAGAGCAGTACCATTCCCAGAGGGACCCACTGGAGGGCAAGCGGGAAAGGAGCAAGACCAGGTCCCCGTACTCGCCCACCGAGGAGGATACCTTGTTTATAGATTTACCCAGTGGCCCAAGAGGCCAGCAGGCCCAGCCCCAGCGCTCCGAGAAGAATGGCATGTTGCCCTCCTCCTGTGGCCCTGAAGAGCAGAATGGTACTGGAGGGTACCCTTGGCCCTTACCCCTCAGGGCCACCGCAGAGAAGCACAGCCAGAGGAAGAGCAGCCTGGCCCAGGCAGAGCACTGGGCAAAGGCCCTGAAGACAGACAGCAAGAGCCTTCCTTCAGAGCAGACACTTTCTCGCCAGGGTCCTAGCCAGCTCCTGTCCTTCCCAGAAAACTACCAGACCCTTCCCAAGAGCACCCGGCACCCCTCGGGGGACTCCTCACCCCCTCTGCGGAACCTGCCCAGTGACTACAAGTATGCACAGGACCGTGCTAGCCACCTGAAGATGTCGAGTGAGGAGCGCCGGGCACACCGGGATGGCACCGTATGGCAGCTGTATGAGTGGCAGCAGCGCCAGCAGTTCCGGCATGGCAGTCCCACGGCACCCATGTGTGCTGGCTCCCCGGAGTTTGCAGACCAGGGCAGGAGCAGGAGCATGCTGGAGGTTCCCCGCTCCATCTCTGTGCCTCCATCACCCTTGGACATACCTCCCCCGGGGCCCCCAAGGGTCTTCCTGCACAGGCGGCCACACACACCAGCAGAGCGTGTCACTGTAAAGCCACCAGACCAGAGGAGGAGTTTGGACATCTCGCTGGGGAGCTCTCCCAGGAAGGCACGGGGCCATGCCATCAAGAACTCCTCGCACATGGACCGACGCTCCATGCCCTCCATGGGTTACATGACCCACACTGTCAGTGCTCCCAGTTTGCATGGAAAATCGGCTGATGACACCTATCTTCAGCTGAAGAAAGACTTGGAATATCTGGATCTAAAGATGACAGGCCGGGACCTTCTCAAGGATCGAAGCCTGAAGCCTGTGAAGATTGCTGAGAGTGACATTGACGTCAAACTGAGCATCTTTTGTGAACAAGACAGGATCCTCCAGGACCTGGAAGATAAGATTCGAGCCCTCAAGGAGAACAAAGATCAGCTAGAATCCGTGCTAGAGGTGTTACACAGACAGATGGAGCAGTACCGAGACCAGCCGCAGCACCTGGAGAAGATTACCTACCAGCAGAGGTTGCTGCAGGAGGACCTGGTCCACATCCGAGCTGAGCTCTCCAGAGAATCCACCGAGATGGAAAATGCCTGGAATGAGTACCTGAAGTTGGAGAGCGATGTGGAGCAGCTGAAGCAGACCCTGCAGGAACAACAGAGACGAGCCTTTTTTTTCCAGGAGAAATCGCAGATACAGAAGGACCTGTGGAGGATTGAAGATGTCCTTGCAGGTCTGAGTGCTAATAAAGAGAACTACAGAATCCTGGTGGAATCGGTCAGAAATCCTGAGAGAAAAACGGTGCCTTTGTTCCCTCACCCGCCTGTGCCTTCACCCTTGACCTTGGAGAGCAAGTCCCCCCTGCAGCCCAGCCCTCCTGCCAGCCCAGTGCGGACCCCTCTGGAAGTTCGGCTGTTCCCACAGCTGCAGACCTATGTGCCCTACCGACCTCACCCACCCCAGCTGAGGAAAGTGACATCTCCCCTTCAGTCACCAACTAAGACAAAACCCAAAGTGGAAGATGAGGCACCTCCTAGGCCCCCGCTTCCCGAACTCTACAGCCCAGAGGACCAGCCACCTGCTGTGCCCCCTCTACCAAGGGAGGCCACCATCATCCGGCACACTTCTGTGAGGGGCCTCAAGCGGCAGTCGGACGAGAGGAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGACTCGAAGGTGGAGCTCCGGTCATCTGTTAGTGAGCCCGAGCTGGCCACCATCACTGGGCACCTGGCTCAGCCCTCCCTGGGACTCGTGGGTCCTGAGAGCAGGTACCAGACACTTCCTGGCCGAGGGCTCTCGGGGTCCATGTCCAGGCTCCAGCAGTCATCCACCATTGCGCCCTACGCCACGCTCCGGAGGGGTCTAAATGCGGAAAGCGGCAAGATGACCTTCCCTAGACCCAAGAGTGCCTTGGAGCGTCTGTACTCAGGGGACCACCAGCAAGGCAAGATGAGTGCTGAGGAGCAGCTGGAGCGCATGAAGCGGCACCAGAAGGCCCTAGTCCGAGAGCGCAAGAGAACACTGAGCCAAGCAGAGAGGACAGGCCCGGCCTCAGCGAGCTATCTTGGCCAGCTGCTCCCTGGGGACCTGGGCTCATGGAAGCGAGAGCAGGACTTTGACCTGCAATTGCTGGAGCGGGCCATGCAAGGGGAAAGGAAGGACAAGGAGGAGAATGGCTGGTTGAAAGTGCAGGCCATGCCTGTCACGGAGGTGGACCTGGAACCACAAGACTATGACCTGGACATCAGCAGAGAGCTGTCCAAACCAGAGAAAGTCTCCATCCCTGAGCGCTATGTGGAGATGGATCCCGAAGAGCCACCTAGCCTCGAAGAGCTGCAGGCACGTTACCGCAAAGCTGAGAAGATCCGCAACATCCTCACCCGGTCAAGCATGTGTAACCTCCAGCCCTCAGCAGCCCAGGACCGAAACAGCCTGGTGGACTTGGACTCCCAGCTGCAGGAGCAGGAGCGCATCATCAATATTTCCTATGCCCTGGCCTCTGAAGCCTCCCAGCGCAGCAAGCAGGTGGCAGCCCAGGCAGTGACAGACCTGTGA

XM_004851491.1 Coding sequence

Plekha7 pleckstrin homology domain containing, family A member 7, transcript variant X3

High confidence: 3 potential gene matches
Length: 3366 bp    Location: 8654983..8429106   Strand: -
>XM_004851491.1
ATGGCGGCGGCGGCGGTCGGGCGGGACACTTTACCTGAGGACTGGTCCTACGGCGTGTGCCGCGACGGCCGTGTCTTCTTCATCAACGACCAGCTCTGCCGCACAACCTGGCTGCACCCGCGCACCGGCGAGCCCGTCAACTCGGGCCACATGATCCGCTCAGACCTGCCCCGCGGCTGGGAGGAGGGCTTCACGGAGGAGGGCGCCAGCTACTTCATCGACCATAACCAGCAGACCACAGCATTCAGGCATCCTGTGACTGGGCAATTTTCTCCAGAAAATAGCGAATTCATTCTTCAAGAAGAACAAAACCTACACATGTCAAAGCAAGAGAAAAACCAAAGACCATCCAGCATGGTCAGCGAATCGTCCACAGCTGGGACCACGTCCACCCTGGAGGCCAAGCCTGGACCCAAGATCATCAAGTCCAGCAATAAAGTCCATAGCTTTGGGAAGAGGGATCAAGCCATTCGGAGGAACCCCAATGTTCCGGTGGTGGTGAGGGGCTGGCTGCACAAGCAGGATAGTTCTGGGATGAGACTGTGGAAGAGGAGGTGGTTTGTGCTTGCTGATTACTGCTTGTTTTACTATAAAGACAGCCGAGAAGAAGTGGTCCTGGGAAGCATCCCTCTGCCCAGCTATGTGATCTCACCTGTGGCCCCTGAGGATCGCATAAGTCGCAAGTACTCTTTTAAGGCTGTGCACATGGGGATGCGAGCACTCATCTACAACAGCTCCATGGCAGGCTCCCAGGCTGAGCAGTCGGGCATGAGAACTTACTACTTCAGTGCCGATACCCTGGAAGACATGAATGCTTGGGTGAGGGCCATGAACCAGGCTGCACAGGTGCTGTCTCGATCATCACTGAAGAGGGATTTGGAGAAAGTGGAGCGGCAGGCAGTACCTCAGGCCAACCACACAGAGTCTTGTCGAGCGTGTGGCCATGTGAGACCTGGACACTCAAGGAATTGTCCTCATCACAGCCATGATGACTCTTTTGGCTTTGAGAAGCGGGAGCAGGAAGAAGAGCAGTACCATTCCCAGAGGGACCCACTGGAGGGCAAGCGGGAAAGGAGCAAGACCAGGTCCCCGTACTCGCCCACCGAGGAGGATACCTTGTTTATAGATTTACCCAGTGGCCCAAGAGGCCAGCAGGCCCAGCCCCAGCGCTCCGAGAAGAATGGCATGTTGCCCTCCTCCTGTGGCCCTGAAGAGCAGAATGGTACTGGAGGGTACCCTTGGCCCTTACCCCTCAGGGCCACCGCAGAGAAGCACAGCCAGAGGAAGAGCAGCCTGGCCCAGGCAGAGCACTGGGCAAAGGCCCTGAAGACAGACAGCAAGAGCCTTCCTTCAGAGCAGACACTTTCTCGCCAGGGTCCTAGCCAGCTCCTGTCCTTCCCAGAAAACTACCAGACCCTTCCCAAGAGCACCCGGCACCCCTCGGGGGACTCCTCACCCCCTCTGCGGAACCTGCCCAGTGACTACAAGTATGCACAGGACCGTGCTAGCCACCTGAAGATGTCGAGTGAGGAGCGCCGGGCACACCGGGATGGCACCGTATGGCAGCTGTATGAGTGGCAGCAGCGCCAGCAGTTCCGGCATGGCAGTCCCACGGCACCCATGTGTGCTGGCTCCCCGGAGTTTGCAGACCAGGGCAGGAGCAGGAGCATGCTGGAGGTTCCCCGCTCCATCTCTGTGCCTCCATCACCCTTGGACATACCTCCCCCGGGGCCCCCAAGGGTCTTCCTGCACAGGCGGCCACACACACCAGCAGAGCGTGTCACTGTAAAGCCACCAGACCAGAGGAGGAGTTTGGACATCTCGCTGGGGAGCTCTCCCAGGAAGGCACGGGGCCATGCCATCAAGAACTCCTCGCACATGGACCGACGCTCCATGCCCTCCATGGGTTACATGACCCACACTGTCAGTGCTCCCAGTTTGCATGGAAAATCGGCTGATGACACCTATCTTCAGCTGAAGAAAGACTTGGAATATCTGGATCTAAAGATGACAGGCCGGGACCTTCTCAAGGATCGAAGCCTGAAGCCTGTGAAGATTGCTGAGAGTGACATTGACGTCAAACTGAGCATCTTTTGTGAACAAGACAGGATCCTCCAGGACCTGGAAGATAAGATTCGAGCCCTCAAGGAGAACAAAGATCAGCTAGAATCCGTGCTAGAGGTGTTACACAGACAGATGGAGCAGTACCGAGACCAGCCGCAGCACCTGGAGAAGATTACCTACCAGCAGAGGTTGCTGCAGGAGGACCTGGTCCACATCCGAGCTGAGCTCTCCAGAGAATCCACCGAGATGGAAAATGCCTGGAATGAGTACCTGAAGTTGGAGAGCGATGTGGAGCAGCTGAAGCAGACCCTGCAGGAACAACAGAGACGAGCCTTTTTTTTCCAGGAGAAATCGCAGATACAGAAGGACCTGTGGAGGATTGAAGATGTCCTTGCAGGTCTGAGTGCTAATAAAGAGAACTACAGAATCCTGGTGGAATCGGTCAGAAATCCTGAGAGAAAAACGGTGCCTTTGTTCCCTCACCCGCCTGTGCCTTCACCCTTGACCTTGGAGAGCAAGTCCCCCCTGCAGCCCAGCCCTCCTGCCAGCCCAGTGCGGACCCCTCTGGAAGTTCGGCTGTTCCCACAGCTGCAGACCTATGTGCCCTACCGACCTCACCCACCCCAGCTGAGGAAAGTGACATCTCCCCTTCAGTCACCAACTAAGACAAAACCCAAAGTGGAAGATGAGGCACCTCCTAGGCCCCCGCTTCCCGAACTCTACAGCCCAGAGGACCAGCCACCTGCTGTGCCCCCTCTACCAAGGGAGGCCACCATCATCCGGCACACTTCTGTGAGGGGCCTCAAGCGGCAGTCGGACGAGAGGAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGACTCGAAGGTGGAGCTCCGGTCATCTGTTAGTGAGCCCGAGCTGGCCACCATCACTGGGCACCTGGCTCAGCCCTCCCTGGGACTCGTGGGTCCTGAGAGCAGGTACCAGACACTTCCTGGCCGAGGGCTCTCGGGGTCCATGTCCAGGCTCCAGCAGTCATCCACCATTGCGCCCTACGCCACGCTCCGGAGGGGTCTAAATGCGGAAAGCGGCAAGATGACCTTCCCTAGACCCAAGAGTGCCTTGGAGCGTCTGTACTCAGGGGACCACCAGCAAGGCAAGATGAGTGCTGAGGAGCAGCTGGAGCGCATGAAGCGGCACCAGAAGGCCCTAGTCCGAGAGCGCAAGAGAACACTGAGCCAAGCAGAGAGGACAGGCCCGGCCTCAGCGAGCTATCTTGGCCAGCTGCTCCCTGGGGACCTGGGCTCAGTATGTTAG

XM_004851496.1 Coding sequence

Nucb2 nucleobindin 2, transcript variant X1

Length: 1263 bp    Location: 8907480..8943838   Strand: +
>XM_004851496.1
ATGAGGTGGAGGACCATTCCACTATGCTATTGTTTTCTCTTGGTCACATGTCTACTTGCTGCTCTTCAAGCTGTGCCTATAGACATCGACAAGACAAAAGTACAAAATACTGAACCTGTGGAAAGTGCAAAGATAGAACCACCAGATACTGGACTTTATTATGATGAATATCTCAAGCAAGTTATTGATGTGCTGGAAACAGATAAACATTTCAGAGAAAAGCTTCAGAAAGCAGACATAGAGGAAATAAAGAGTGGGAAGCTAAGCAAAGAGCTGGACTTGGTAAGTCACCACGTGAGGACAAAACTTGACGAACTGAAAAGGCAAGAAGTAGGAAGGTTAAGAATGCTAATTAAAGCTAAACTGGATTCCTTTCAAGATATGGGCATGGACCACCAAGCTCTTCTAAAACAATTTGATCACCTAAATCATATGAATCCTGACAAGTTTGAATCCACAGATTTAGATATGCTAATCAAAGCGGCAACAAAAGATTTGGAACAGTATGACAAGACTAGACATGAAGAATTTAAAAAATATGAAATGATGAAGGAACATGAACGGAGAGAATATTTAAAAACACTAGATGAAGAAAAGAGAAAAGAAGAAGAATCTAAATTTGAAGAAATGAAGAGGAAGCATGAAAACCATCCCAAAGTTAATCATCCAGGAAGCAAAGATCAACTAAAAGAGGTATGGGAAGAGACTGATGGATTGGACCCTAATGACTTTGACCCCAAGACATTTTTCAAATTACATGATGTCAATAGCGATGGATTCCTGGATGAACAAGAATTAGAAGCCCTGTTTACTAAGGAGTTGGAGAAAGTGTATGATGCCCAAAATGAGGAGGATGATATGGTGGAAATGGAGGAAGAAAGGCTTAGAATGAGGGAGCATGTAATGAATGAGGTTGATACAAACAAAGACCGGTTGGTGACTCTGGAAGAATTTTTGAAAGCTACAGAAAAAAAGGAATTCTTGGAGCCAGATAGCTGGGAGACACTGGATCAGCAACAACTCTTCACGGAGGAAGAACTAAAAGAATATGAAAATATTATTGCTTTCCAAGAAAATGAGCTTAAGAAGAAGGCAGATGAGCTTCAGAAACAGAAAGAAGAGCTACAGCGTCAGCATGACCAGCTGGAGGCTCAGAAGCAGGAATATCATCAGGCTGTACAGCAAATGGAACAAAGAAAGTTACAACAAGGAATCGCTCCATCAGGTCCAACTGGAGAACAGAAGCTTGAGCCCCATGTTTAA

XM_004851497.1 Coding sequence

Nucb2 nucleobindin 2, transcript variant X2

Length: 1263 bp    Location: 8907480..8943838   Strand: +
>XM_004851497.1
ATGAGGTGGAGGACCATTCCACTATGCTATTGTTTTCTCTTGGTCACATGTCTACTTGCTGCTCTTCAAGCTGTGCCTATAGACATCGACAAGACAAAAGTACAAAATACTGAACCTGTGGAAAGTGCAAAGATAGAACCACCAGATACTGGACTTTATTATGATGAATATCTCAAGCAAGTTATTGATGTGCTGGAAACAGATAAACATTTCAGAGAAAAGCTTCAGAAAGCAGACATAGAGGAAATAAAGAGTGGGAAGCTAAGCAAAGAGCTGGACTTGGTAAGTCACCACGTGAGGACAAAACTTGACGAACTGAAAAGGCAAGAAGTAGGAAGGTTAAGAATGCTAATTAAAGCTAAACTGGATTCCTTTCAAGATATGGGCATGGACCACCAAGCTCTTCTAAAACAATTTGATCACCTAAATCATATGAATCCTGACAAGTTTGAATCCACAGATTTAGATATGCTAATCAAAGCGGCAACAAAAGATTTGGAACAGTATGACAAGACTAGACATGAAGAATTTAAAAAATATGAAATGATGAAGGAACATGAACGGAGAGAATATTTAAAAACACTAGATGAAGAAAAGAGAAAAGAAGAAGAATCTAAATTTGAAGAAATGAAGAGGAAGCATGAAAACCATCCCAAAGTTAATCATCCAGGAAGCAAAGATCAACTAAAAGAGGTATGGGAAGAGACTGATGGATTGGACCCTAATGACTTTGACCCCAAGACATTTTTCAAATTACATGATGTCAATAGCGATGGATTCCTGGATGAACAAGAATTAGAAGCCCTGTTTACTAAGGAGTTGGAGAAAGTGTATGATGCCCAAAATGAGGAGGATGATATGGTGGAAATGGAGGAAGAAAGGCTTAGAATGAGGGAGCATGTAATGAATGAGGTTGATACAAACAAAGACCGGTTGGTGACTCTGGAAGAATTTTTGAAAGCTACAGAAAAAAAGGAATTCTTGGAGCCAGATAGCTGGGAGACACTGGATCAGCAACAACTCTTCACGGAGGAAGAACTAAAAGAATATGAAAATATTATTGCTTTCCAAGAAAATGAGCTTAAGAAGAAGGCAGATGAGCTTCAGAAACAGAAAGAAGAGCTACAGCGTCAGCATGACCAGCTGGAGGCTCAGAAGCAGGAATATCATCAGGCTGTACAGCAAATGGAACAAAGAAAGTTACAACAAGGAATCGCTCCATCAGGTCCAACTGGAGAACAGAAGCTTGAGCCCCATGTTTAA

XM_004851500.1 Coding sequence

LOC101704464 natural cytotoxicity triggering receptor 3 ligand 1-like

Length: 432 bp    Location: 8958045..8962489   Strand: +
>XM_004851500.1
ATGCCAGGAAGGCCTCAGATAGCACCACTGAATGGCAATGTCACAATCTCCTGCAAAGTCCCCGGCTGCCCCAGGCTGGACACCAGGATTATGGGCGTTACCTGGTATCGGAAGGATCCTGTGTCTGAAGCAGAGGTCAAGGTGTTTGAGCTTTATGGAGACTGGCAAAAGGCATTCCGACCTGGGGCCCTGGTGTCTCCACAGAGGCTGAAGAGGGGTGACGCCTCACTCCAGCTGCCTGGGGTTGGGCTGGGGGATGCAGGAGAATACCGGTGTGAGCTGACGGTCACCCCTCAGAAGGCAGAAGGAAGGGTCTTGCTGAAAGTTCTCGGTGAGTGCCTGAGGGCAGTGCCGTGCAGTTGCCATGGTGCTGGTCCTGGGGTGGGGATGCAGTTGGGCCATGTGGGGCAGAGGGTTAGTGTGTGGGTCTAA

XM_004851501.1 Coding sequence

Ncr3lg1 natural killer cell cytotoxicity receptor 3 ligand 1

Length: 972 bp    Location: 8990575..9005236   Strand: +
>XM_004851501.1
ATGAGGAACCCTTCTGCCAGCGCCCTCGAGTTTTTCTGCCCACTCTGTCCTCACGTGGTCGCGCCGGCCTCTCAGGAGCTTCTGGGTTGGGAGCTTCCGGAAAACCAGAGGCCCCGCAACGGCAGATGCATGTCCGAGGGGCCCAAAGCCCTCCTCCGGGTGGTGGTGCCGCTGCTTCTCGTGGGGTGCCTGGCGGACGCAGGTTTTCTGGAAGTGGTGATGCCAGGAAAGCCTCAGATAGCACCACTGAATGGCAATGTCACAATCTCCTGCAAAGTCCCCGGCTGCCCCAGGCTGGACACCAGGATTATGGGAGTTACCTGGTATCGGAAGGATCCTGTGTCTGAAGCAGAGGTCAAGGTGTTTGAGCTTTATGGAGACTGGCAAAAGGCATTCCGACCTGGGGCCCTGGTGTCTCCACAGAGGCTGAAGAGGGGTGACGCCTCACTCCAGCTGCCTGGGGTTGGGCTGGGGGATGCAGGAGAATACCGGTGTGAGCTGACGGTCACCCCTCAGAAGGCAGAAGGAAGGGTCTTGCTGAAAGTTCTCGCTAAGCCAGACAGCACAGTGAAGGAAACCATGGTGAAAAGTAATGACAGACAGCTCGTGTGTCAGTCAAGTGGATTCTTCCCAGAAGCCATAAACATAACATGGGAGGAGTGGACCCAGAAGGTTTCCCAGGACCAAAGGATTTCCAAGGACATCTTTACTGGTCCCACCATCAAGAATGAGGATGGTACATTTAATATCACCAGCTACTTGAAACTCAATGCCTCTCTGGAAGACAGTGGCACCATCTACCAGTGTGTGGTGGGGCACACATCCTTGAACGCCCCCCAGAGGCTGAACTTCACACTGCCTGTGAGAGAAGCTGAGAAGATACCTCTATATTTAGTCCATATTGGACTCATTATTATTGGGTGTTTTGCTGGATTGATTTTAATAATGTGTTATTTATTTTGGAGAAGGTAA

XM_004851504.1 Coding sequence

Abcc8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8, transcript variant X2

Length: 4773 bp    Location: 9092356..9018616   Strand: -
>XM_004851504.1
ATGCCCCTGGCCTTCTGCGGCAGCGAGAACCGCTCGGCCGCCTACCGGGTGGACCAGGGCGTCCTCAACAACGGCTGCTTCGTGGACGCGCTCAACGTGGTGCCGCACGTCCTCCTGCTCTTCATCACCTTCCCCATCCTTTTCATTGGGTGGGGCAGCCAGAGCTCCAAGGTGCACATCCACCACAGCACATGGCTCCACTTCCCTGGCCACAATCTTCGCTGGATCCTGACCTTCATGCTGCTCTTCGTCCTGGTGTGTGAGATAGCCGAGGGCATCCTGTCTGATGGGGTGACCGAATCCCGCCATCTGCACCTGTACATGCCAGCCGGGATGGCGTTCATGGCTGCCGTCACCTCTGTGGTCTACTATCACAACATCGAGACCTCCAACTTCCCCAAGCTGCTGATCGCCCTGCTCATCTACTGGATCTTGGCCTTCATCACCAAGACCATCAAGTTTGTCAAGTTTTACCACCATGCCATCAGCTTCTCGCAGCTGCGCTTCTGCCTCACAGGCCTGCTGGTGGTCCTGTACGGGATGCTGCTCCTCGTGGAGGTCAATGTCATCAGGGTGAGGAGGTACATCTTCTTCAAGACACCGAGGGAGGTGAAGCCCCCCGAGGACCTGCAGGACCTGGGCGTGCGCTTTCTGCAGCCCTTCGTGAACCTACTGTCCAAGGGCACCTACTGGTGGATGAACACCTTCATCAAGACGGCCCACAAGAAGCCCATTGACCTGCGAGCCATCGGGAAGCTACCCATTGCCATGAGGGCCCTCACCAACTACCGGCGGCTCTGTGAGGCCTTTGATGCCCAGGCGCGGAAGGACACGCAGAGCATGCAGGGTGCCAGGGCCATCTGGCGGGCACTGTGCCATGCCTTCGGGAGACCCCTGGTCCTCAGCAGCACGTTCCGCATCTTGGCCGACTTGCTGGGCTTTGCCGGGCCACTGTGCATCTTCGGGATCGTGGACCATCTTGGGAAGGAAAACCGAGTCTTCCAGCCCAAGACCCAGTTTCTCGGTATTTACTTTGTCTCATCCCAAGAGTTCCTTGCTAATGCCTACGTCTTGGCCGTGCTTCTATTCCTTGCCCTCCTACTACAGAGGACTTTTCTGCAAGCCTCCTACTATGTCGCCATTGAAACTGGAATTAACTTGAGAGGAGCAATACAGACCAAGATTTACAATAAAATTATGCACCTGTCCACCTCCAACCTGTCCATGGGGGAAATGACTGCCGGCCAGATCTGCAACCTGGTGGCCATCGATACCAACCAGCTCATGTGGTTTTTCTTCTTGTGCCCAAACCTCTGGGCTATGCCAGTGCAGATCATCGTGGGCGTGATCCTCCTCTACTACATCCTTGGGGTCAGCGCCTTAATTGGAGCAGCTGTCATCATTCTACTAGCCCCAGTTCAGTACTTTGTGGCCACCAAGCTGTCCCAGGCCCAGCGGAGCACGCTGGAATATTCTAACGAGAGGCTGAAGCAGACCAATGAGATGCTGCGTGGTATCAAGCTGCTCAAGCTGTATGCCTGGGAGAACATTTTCTGCTCGCGGGTGGAGGTGACCCGCAGGAAAGAGATGACTAGCCTCCGGGCCTTCGCCGTCTACACCTCTATCTCCATTTTCATGAACACAGCCATCCCCATTGCAGCTGTCCTCATCACCTTCGTGGGCCACGTCAGCTTCTTCAAAGAGTCTGACTTCTCGCCCTCAGTGGCCTTTGCCTCCCTCTCCCTCTTCCATATCCTGGTCACTCCGCTGTTCCTGCTGTCCAGCGTGGTCCGGTCTACAGTCAAAGCTCTGGTGAGCGTGCAAAAGCTGAGCGAGTTCCTGTCCAGTGCAGAGATCCGCGAGGAGCAGTGTGCTCCCCTCGAGCCTGTGCCCGGAGGCCAGGCCAGCAAGTACCAGGCAGTGCCCCTCAAGGTTGTGAACCGCAAGCGTCCGGCCCGGGAGGACTGTCGGGACCTCATGGGCCCACTACAGAGGCTGACCCCCAGTGCAGACAGGGAGGCTGAAAACTGCTGTGTCCAGATCATCGGAGGCTTCTTCACCTGGACCCCTGACGGAATCCCCACACTGTCCAACATCACCATCCGAATCCCCCGAGGCCAGCTGACCATGATAGTGGGGCAGGTGGGCTGCGGCAAGTCCTCGCTCCTCCTGGCCACTCTGGGGGAGATGCAGAAGATCTCAGGAGCTGTCTTCTGGAACAGCAGCCTTCCTGATGGCGAGACAGGAGAGGACCCCAGATGGTCTTTCCTCCCCTGCAGCAGCCCAGAGCGGGAGACAGCGTCTGACTCCGACATCAGGAAGAGAGGCCCAGTGGCCTACGCTTCCCAGAAACCATGGCTGCTGAACGCCACTGTGGAGGAGAATATCACCTTTGAGAGTCCCTTCAACAAACAACGGTACAAGATGGTCATCGAAGCGTGTTCCCTGCAGCCAGACGTCGACATCCTGCCCCACGGAGACCAGACCCAGATTGGGGAACGGGGCATCAACCTGTCGGGTGGTCAGCGCCAGAGAATCAGTGTGGCCCGCGCCCTCTACCAGCACACCAATGTCGTCTTCTTGGATGATCCTTTCTCAGCTCTGGATGTCCACCTGAGTGACCACTTGATGCAGGCCGGGATCCTTGAGCTGCTCCGGGATGACAAGAGGACAGTGGTCCTGGTGACCCACAAGCTACAATACTTGCCTCATGCAGACTGGATCATCGCTATGAAGGATGGCACTATCCAGAGGGAGGGTACACTCAAGGACTTCCAGAGGTCTGAGTGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGGCAGGACCAGGAGCTGGAGAAGGAGACAGTCATGGAGAGAAAAGTCACAGAGCCACACCAGGGCCTGGCCCGTGCCATGTCCTCAAGGGATGGCCTTCTGCAGGATGAAGATGAGGAGGAAGAGGAGGTGGCCGAGAGCGAGGAAGACGACAACCTGTCCTCCCTGCTGCACCAGCGAGCCAAGATCCCATGGCGAGCCTGTGCCAAGTACCTGTCCTCGGCTGGCATCCTGCTCCTGTCGCTGCTTGTCTTCTCCCAGCTGCTCAAGCACATGGTCTTGGTGGCCATCGACTACTGGCTGGCCAAGTGGACCGACAGCGCCCTGACCCTGAGCCCCGCGACCAGGAACTGCTCCCTCAGCCAGGAGTGCTCCCTGGACCAGACCATCTATGCCATGGTCTTTACCGTGCTCTGTAGCCTGGGCATCGTGCTGTGCCTGGTCACCTCTGTCACCGTGGAGTGGACAGGACTAAAGGTGGCCAAGAGTCTGCACCGCAGCCTGCTGAACCGCATCATCCTAGCCCCCATGAGGTTTTTTGAGACCACGCCCCTTGGGAGCATCCTGAACAGATTTTCATCTGACTGTAACACCATTGACCAGCACATCCCATCCACGCTGGAATGCCTGAGCCGCTCCACCCTGCTCTGCGTCTCAGCCCTGGCCGTCATCTCCTATGTCACACCTGTGTTCCTTGTGGCCCTCTTGCCCCTGGCCATCGCGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCATCCAGGGACCTGCAGCAGCTGGATGACACTACGCAGCTGCCGCTGCTCTCACACTTTGCTGAAACTGTGGAGGGCCTCACCACCATCCGGGCCTTCAGATACGAGGCCCGCTTCCAGCAGAAGCTCCTTGAATACACCGACTCCAACAACATCGCCTCCCTCTTCCTCACAGCAGCCAACAGATGGCTGGAAGTCCGCATGGAGTACATCGGCGCCTGTGTGGTGCTCATTGCGGCTGCCACCTCCATCTCCAACTCCCTGCACAGGGAGCTCTCAGCCGGCCTGGTGGGCCTGGGCCTCACCTATGCCCTCATGATCTCTAACTACCTCAACTGGATGGTGAGGAACCTGGCGGACATGGAGATCCAGCTGGGCGCCGTGAAGCGCATCCACGGGCTTCTGAAGACCGAGGCAGAGAGCTACGAGGGGCTGCTGGCCCCATCACTGATCCCTAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCAGTGCTCAAACACGTCAACGCCCTCATCTCGCCGGGACAGAAGATCGGGATCTGCGGCCGCACGGGCAGCGGGAAGTCCTCCTTTTCCCTGGCCTTCTTCCGCATGGTGGACATGTTCGAGGGCCGCATCATCATCGATGGCATTGACATCGCCAGACTGCCACTGCACACCCTGCGCTCGCGCCTGTCCATCATCCTGCAGGACCCTGTCCTCTTCAGTGGCACCATCCGGTTTAACCTGGACCCAGAGAAGAAGTGCTCGGACAGCACACTGTGGGAGGCCCTGGAGATCGCCCAGCTGAAGCTGGTGGTGAAGGCTCTGCCCGGAGGCCTCGACGCCATCATCACAGAGGGCGGGGAGAACTTCAGCCAGGGCCAGAGGCAGCTCTTCTGCCTGGCTCGGGCCTTTGTGAGAAAGACCAGCATCTTCATCATGGACGAGGCCACAGCTTCCATCGACATGGCCACGGAGAACATCCTCCAGAAGGTGGTGATGACAGCCTTCGCAGACCGCACTGTGGTCACCATTGCGCATCGTGTGCACACCATCCTCAGCGCAGACATGGTGATGGTCCTGAAGCGGGGCGCCATCCTAGAGCTGGACAAGCCAGAGAACCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTTGTCCGAGCAGACAAGTGA

XM_004851507.1 Coding sequence

Abcc8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8, transcript variant X5

High confidence: 4 potential gene matches
Length: 4641 bp    Location: 9091035..9018616   Strand: -
>XM_004851507.1
ATGTTCACTTCATTTGTACCAGCCTCAGGGATCCTCATGCGCGGGTGCAGGAATCCATGCTCTCTGCACCCCCACCACGGACCCAGTGCCCAAGCACAGGGGAGAGTGAGGTCTGTCCATGCAGCCTCCTGCAGGTGGGCCAGGCCCCTACCCTTACCGACTCTCCCTGCAGGGTGGGGCAGCCAGAGCTCCAAGGTGCACATCCACCACAGCACATGGCTCCACTTCCCTGGCCACAATCTTCGCTGGATCCTGACCTTCATGCTGCTCTTCGTCCTGGTGTGTGAGATAGCCGAGGGCATCCTGTCTGATGGGGTGACCGAATCCCGCCATCTGCACCTGTACATGCCAGCCGGGATGGCGTTCATGGCTGCCGTCACCTCTGTGGTCTACTATCACAACATCGAGACCTCCAACTTCCCCAAGCTGCTGATCGCCCTGCTCATCTACTGGATCTTGGCCTTCATCACCAAGACCATCAAGTTTGTCAAGTTTTACCACCATGCCATCAGCTTCTCGCAGCTGCGCTTCTGCCTCACAGGCCTGCTGGTGGTCCTGTACGGGATGCTGCTCCTCGTGGAGGTCAATGTCATCAGGGTGAGGAGGTACATCTTCTTCAAGACACCGAGGGAGGTGAAGCCCCCCGAGGACCTGCAGGACCTGGGCGTGCGCTTTCTGCAGCCCTTCGTGAACCTACTGTCCAAGGGCACCTACTGGTGGATGAACACCTTCATCAAGACGGCCCACAAGAAGCCCATTGACCTGCGAGCCATCGGGAAGCTACCCATTGCCATGAGGGCCCTCACCAACTACCGGCGGCTCTGTGAGGCCTTTGATGCCCAGGCGCGGAAGGACACGCAGAGCATGCAGGGTGCCAGGGCCATCTGGCGGGCACTGTGCCATGCCTTCGGGAGACCCCTGGTCCTCAGCAGCACGTTCCGCATCTTGGCCGACTTGCTGGGCTTTGCCGGGCCACTGTGCATCTTCGGGATCGTGGACCATCTTGGGAAGGAAAACCGAGTCTTCCAGCCCAAGACCCAGTTTCTCGGTATTTACTTTGTCTCATCCCAAGAGTTCCTTGCTAATGCCTACGTCTTGGCCGTGCTTCTATTCCTTGCCCTCCTACTACAGAGGACTTTTCTGCAAGCCTCCTACTATGTCGCCATTGAAACTGGAATTAACTTGAGAGGAGCAATACAGACCAAGATTTACAATAAAATTATGCACCTGTCCACCTCCAACCTGTCCATGGGGGAAATGACTGCCGGCCAGATCTGCAACCTGGTGGCCATCGATACCAACCAGCTCATGTGGTTTTTCTTCTTGTGCCCAAACCTCTGGGCTATGCCAGTGCAGGAATATTCTAACGAGAGGCTGAAGCAGACCAATGAGATGCTGCGTGGTATCAAGCTGCTCAAGCTGTATGCCTGGGAGAACATTTTCTGCTCGCGGGTGGAGGTGACCCGCAGGAAAGAGATGACTAGCCTCCGGGCCTTCGCCGTCTACACCTCTATCTCCATTTTCATGAACACAGCCATCCCCATTGCAGCTGTCCTCATCACCTTCGTGGGCCACGTCAGCTTCTTCAAAGAGTCTGACTTCTCGCCCTCAGTGGCCTTTGCCTCCCTCTCCCTCTTCCATATCCTGGTCACTCCGCTGTTCCTGCTGTCCAGCGTGGTCCGGTCTACAGTCAAAGCTCTGGTGAGCGTGCAAAAGCTGAGCGAGTTCCTGTCCAGTGCAGAGATCCGCGAGGAGCAGTGTGCTCCCCTCGAGCCTGTGCCCGGAGGCCAGGCCAGCAAGTACCAGGCAGTGCCCCTCAAGGTTGTGAACCGCAAGCGTCCGGCCCGGGAGGACTGTCGGGACCTCATGGGCCCACTACAGAGGCTGACCCCCAGTGCAGACAGGGAGGCTGAAAACTGCTGTGTCCAGATCATCGGAGGCTTCTTCACCTGGACCCCTGACGGAATCCCCACACTGTCCAACATCACCATCCGAATCCCCCGAGGCCAGCTGACCATGATAGTGGGGCAGGTGGGCTGCGGCAAGTCCTCGCTCCTCCTGGCCACTCTGGGGGAGATGCAGAAGATCTCAGGAGCTGTCTTCTGGAACAGCAGCCTTCCTGATGGCGAGACAGGAGAGGACCCCAGCAGCCCAGAGCGGGAGACAGCGTCTGACTCCGACATCAGGAAGAGAGGCCCAGTGGCCTACGCTTCCCAGAAACCATGGCTGCTGAACGCCACTGTGGAGGAGAATATCACCTTTGAGAGTCCCTTCAACAAACAACGGTACAAGATGGTCATCGAAGCGTGTTCCCTGCAGCCAGACGTCGACATCCTGCCCCACGGAGACCAGACCCAGATTGGGGAACGGGGCATCAACCTGTCGGGTGGTCAGCGCCAGAGAATCAGTGTGGCCCGCGCCCTCTACCAGCACACCAATGTCGTCTTCTTGGATGATCCTTTCTCAGCTCTGGATGTCCACCTGAGTGACCACTTGATGCAGGCCGGGATCCTTGAGCTGCTCCGGGATGACAAGAGGACAGTGGTCCTGGTGACCCACAAGCTACAATACTTGCCTCATGCAGACTGGATCATCGCTATGAAGGATGGCACTATCCAGAGGGAGGGTACACTCAAGGACTTCCAGAGGTCTGAGTGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGGCAGGACCAGGAGCTGGAGAAGGAGACAGTCATGGAGAGAAAAGTCACAGAGCCACACCAGGGCCTGGCCCGTGCCATGTCCTCAAGGGATGGCCTTCTGCAGGATGAAGATGAGGAGGAAGAGGAGGTGGCCGAGAGCGAGGAAGACGACAACCTGTCCTCCCTGCTGCACCAGCGAGCCAAGATCCCATGGCGAGCCTGTGCCAAGTACCTGTCCTCGGCTGGCATCCTGCTCCTGTCGCTGCTTGTCTTCTCCCAGCTGCTCAAGCACATGGTCTTGGTGGCCATCGACTACTGGCTGGCCAAGTGGACCGACAGCGCCCTGACCCTGAGCCCCGCGACCAGGAACTGCTCCCTCAGCCAGGAGTGCTCCCTGGACCAGACCATCTATGCCATGGTCTTTACCGTGCTCTGTAGCCTGGGCATCGTGCTGTGCCTGGTCACCTCTGTCACCGTGGAGTGGACAGGACTAAAGGTGGCCAAGAGTCTGCACCGCAGCCTGCTGAACCGCATCATCCTAGCCCCCATGAGGTTTTTTGAGACCACGCCCCTTGGGAGCATCCTGAACAGATTTTCATCTGACTGTAACACCATTGACCAGCACATCCCATCCACGCTGGAATGCCTGAGCCGCTCCACCCTGCTCTGCGTCTCAGCCCTGGCCGTCATCTCCTATGTCACACCTGTGTTCCTTGTGGCCCTCTTGCCCCTGGCCATCGCGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCATCCAGGGACCTGCAGCAGCTGGATGACACTACGCAGCTGCCGCTGCTCTCACACTTTGCTGAAACTGTGGAGGGCCTCACCACCATCCGGGCCTTCAGATACGAGGCCCGCTTCCAGCAGAAGCTCCTTGAATACACCGACTCCAACAACATCGCCTCCCTCTTCCTCACAGCAGCCAACAGATGGCTGGAAGTCCGCATGGAGTACATCGGCGCCTGTGTGGTGCTCATTGCGGCTGCCACCTCCATCTCCAACTCCCTGCACAGGGAGCTCTCAGCCGGCCTGGTGGGCCTGGGCCTCACCTATGCCCTCATGATCTCTAACTACCTCAACTGGATGGTGAGGAACCTGGCGGACATGGAGATCCAGCTGGGCGCCGTGAAGCGCATCCACGGGCTTCTGAAGACCGAGGCAGAGAGCTACGAGGGGCTGCTGGCCCCATCACTGATCCCTAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCAGTGCTCAAACACGTCAACGCCCTCATCTCGCCGGGACAGAAGATCGGGATCTGCGGCCGCACGGGCAGCGGGAAGTCCTCCTTTTCCCTGGCCTTCTTCCGCATGGTGGACATGTTCGAGGGCCGCATCATCATCGATGGCATTGACATCGCCAGACTGCCACTGCACACCCTGCGCTCGCGCCTGTCCATCATCCTGCAGGACCCTGTCCTCTTCAGTGGCACCATCCGGTTTAACCTGGACCCAGAGAAGAAGTGCTCGGACAGCACACTGTGGGAGGCCCTGGAGATCGCCCAGCTGAAGCTGGTGGTGAAGGCTCTGCCCGGAGGCCTCGACGCCATCATCACAGAGGGCGGGGAGAACTTCAGCCAGGGCCAGAGGCAGCTCTTCTGCCTGGCTCGGGCCTTTGTGAGAAAGACCAGCATCTTCATCATGGACGAGGCCACAGCTTCCATCGACATGGCCACGGAGAACATCCTCCAGAAGGTGGTGATGACAGCCTTCGCAGACCGCACTGTGGTCACCATTGCGCATCGTGTGCACACCATCCTCAGCGCAGACATGGTGATGGTCCTGAAGCGGGGCGCCATCCTAGAGCTGGACAAGCCAGAGAACCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTTGTCCGAGCAGACAAGTGA

XM_004851503.1 Coding sequence

Abcc8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8, transcript variant X1

Length: 4773 bp    Location: 9091035..9018616   Strand: -
>XM_004851503.1
ATGTTCACTTCATTTGTACCAGCCTCAGGGATCCTCATGCGCGGGTGCAGGAATCCATGCTCTCTGCACCCCCACCACGGACCCAGTGCCCAAGCACAGGGGAGAGTGAGGTCTGTCCATGCAGCCTCCTGCAGGTGGGCCAGGCCCCTACCCTTACCGACTCTCCCTGCAGGGTGGGGCAGCCAGAGCTCCAAGGTGCACATCCACCACAGCACATGGCTCCACTTCCCTGGCCACAATCTTCGCTGGATCCTGACCTTCATGCTGCTCTTCGTCCTGGTGTGTGAGATAGCCGAGGGCATCCTGTCTGATGGGGTGACCGAATCCCGCCATCTGCACCTGTACATGCCAGCCGGGATGGCGTTCATGGCTGCCGTCACCTCTGTGGTCTACTATCACAACATCGAGACCTCCAACTTCCCCAAGCTGCTGATCGCCCTGCTCATCTACTGGATCTTGGCCTTCATCACCAAGACCATCAAGTTTGTCAAGTTTTACCACCATGCCATCAGCTTCTCGCAGCTGCGCTTCTGCCTCACAGGCCTGCTGGTGGTCCTGTACGGGATGCTGCTCCTCGTGGAGGTCAATGTCATCAGGGTGAGGAGGTACATCTTCTTCAAGACACCGAGGGAGGTGAAGCCCCCCGAGGACCTGCAGGACCTGGGCGTGCGCTTTCTGCAGCCCTTCGTGAACCTACTGTCCAAGGGCACCTACTGGTGGATGAACACCTTCATCAAGACGGCCCACAAGAAGCCCATTGACCTGCGAGCCATCGGGAAGCTACCCATTGCCATGAGGGCCCTCACCAACTACCGGCGGCTCTGTGAGGCCTTTGATGCCCAGGCGCGGAAGGACACGCAGAGCATGCAGGGTGCCAGGGCCATCTGGCGGGCACTGTGCCATGCCTTCGGGAGACCCCTGGTCCTCAGCAGCACGTTCCGCATCTTGGCCGACTTGCTGGGCTTTGCCGGGCCACTGTGCATCTTCGGGATCGTGGACCATCTTGGGAAGGAAAACCGAGTCTTCCAGCCCAAGACCCAGTTTCTCGGTATTTACTTTGTCTCATCCCAAGAGTTCCTTGCTAATGCCTACGTCTTGGCCGTGCTTCTATTCCTTGCCCTCCTACTACAGAGGACTTTTCTGCAAGCCTCCTACTATGTCGCCATTGAAACTGGAATTAACTTGAGAGGAGCAATACAGACCAAGATTTACAATAAAATTATGCACCTGTCCACCTCCAACCTGTCCATGGGGGAAATGACTGCCGGCCAGATCTGCAACCTGGTGGCCATCGATACCAACCAGCTCATGTGGTTTTTCTTCTTGTGCCCAAACCTCTGGGCTATGCCAGTGCAGATCATCGTGGGCGTGATCCTCCTCTACTACATCCTTGGGGTCAGCGCCTTAATTGGAGCAGCTGTCATCATTCTACTAGCCCCAGTTCAGTACTTTGTGGCCACCAAGCTGTCCCAGGCCCAGCGGAGCACGCTGGAATATTCTAACGAGAGGCTGAAGCAGACCAATGAGATGCTGCGTGGTATCAAGCTGCTCAAGCTGTATGCCTGGGAGAACATTTTCTGCTCGCGGGTGGAGGTGACCCGCAGGAAAGAGATGACTAGCCTCCGGGCCTTCGCCGTCTACACCTCTATCTCCATTTTCATGAACACAGCCATCCCCATTGCAGCTGTCCTCATCACCTTCGTGGGCCACGTCAGCTTCTTCAAAGAGTCTGACTTCTCGCCCTCAGTGGCCTTTGCCTCCCTCTCCCTCTTCCATATCCTGGTCACTCCGCTGTTCCTGCTGTCCAGCGTGGTCCGGTCTACAGTCAAAGCTCTGGTGAGCGTGCAAAAGCTGAGCGAGTTCCTGTCCAGTGCAGAGATCCGCGAGGAGCAGTGTGCTCCCCTCGAGCCTGTGCCCGGAGGCCAGGCCAGCAAGTACCAGGCAGTGCCCCTCAAGGTTGTGAACCGCAAGCGTCCGGCCCGGGAGGACTGTCGGGACCTCATGGGCCCACTACAGAGGCTGACCCCCAGTGCAGACAGGGAGGCTGAAAACTGCTGTGTCCAGATCATCGGAGGCTTCTTCACCTGGACCCCTGACGGAATCCCCACACTGTCCAACATCACCATCCGAATCCCCCGAGGCCAGCTGACCATGATAGTGGGGCAGGTGGGCTGCGGCAAGTCCTCGCTCCTCCTGGCCACTCTGGGGGAGATGCAGAAGATCTCAGGAGCTGTCTTCTGGAACAGCCTTCCTGATGGCGAGACAGGAGAGGACCCCAGCAGCCCAGAGCGGGAGACAGCGTCTGACTCCGACATCAGGAAGAGAGGCCCAGTGGCCTACGCTTCCCAGAAACCATGGCTGCTGAACGCCACTGTGGAGGAGAATATCACCTTTGAGAGTCCCTTCAACAAACAACGGTACAAGATGGTCATCGAAGCGTGTTCCCTGCAGCCAGACGTCGACATCCTGCCCCACGGAGACCAGACCCAGATTGGGGAACGGGGCATCAACCTGTCGGGTGGTCAGCGCCAGAGAATCAGTGTGGCCCGCGCCCTCTACCAGCACACCAATGTCGTCTTCTTGGATGATCCTTTCTCAGCTCTGGATGTCCACCTGAGTGACCACTTGATGCAGGCCGGGATCCTTGAGCTGCTCCGGGATGACAAGAGGACAGTGGTCCTGGTGACCCACAAGCTACAATACTTGCCTCATGCAGACTGGATCATCGCTATGAAGGATGGCACTATCCAGAGGGAGGGTACACTCAAGGACTTCCAGAGGTCTGAGTGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGGCAGGACCAGGAGCTGGAGAAGGAGACAGTCATGGAGAGAAAAGTCACAGAGCCACACCAGGGCCTGGCCCGTGCCATGTCCTCAAGGGATGGCCTTCTGCAGGATGAAGATGAGGAGGAAGAGGAGGTGGCCGAGAGCGAGGAAGACGACAACCTGTCCTCCCTGCTGCACCAGCGAGCCAAGATCCCATGGCGAGCCTGTGCCAAGTACCTGTCCTCGGCTGGCATCCTGCTCCTGTCGCTGCTTGTCTTCTCCCAGCTGCTCAAGCACATGGTCTTGGTGGCCATCGACTACTGGCTGGCCAAGTGGACCGACAGCGCCCTGACCCTGAGCCCCGCGACCAGGAACTGCTCCCTCAGCCAGGAGTGCTCCCTGGACCAGACCATCTATGCCATGGTCTTTACCGTGCTCTGTAGCCTGGGCATCGTGCTGTGCCTGGTCACCTCTGTCACCGTGGAGTGGACAGGACTAAAGGTGGCCAAGAGTCTGCACCGCAGCCTGCTGAACCGCATCATCCTAGCCCCCATGAGGTTTTTTGAGACCACGCCCCTTGGGAGCATCCTGAACAGATTTTCATCTGACTGTAACACCATTGACCAGCACATCCCATCCACGCTGGAATGCCTGAGCCGCTCCACCCTGCTCTGCGTCTCAGCCCTGGCCGTCATCTCCTATGTCACACCTGTGTTCCTTGTGGCCCTCTTGCCCCTGGCCATCGCGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCATCCAGGGACCTGCAGCAGCTGGATGACACTACGCAGCTGCCGCTGCTCTCACACTTTGCTGAAACTGTGGAGGGCCTCACCACCATCCGGGCCTTCAGATACGAGGCCCGCTTCCAGCAGAAGCTCCTTGAATACACCGACTCCAACAACATCGCCTCCCTCTTCCTCACAGCAGCCAACAGATGGCTGGAAGTCCGCATGGAGTACATCGGCGCCTGTGTGGTGCTCATTGCGGCTGCCACCTCCATCTCCAACTCCCTGCACAGGGAGCTCTCAGCCGGCCTGGTGGGCCTGGGCCTCACCTATGCCCTCATGATCTCTAACTACCTCAACTGGATGGTGAGGAACCTGGCGGACATGGAGATCCAGCTGGGCGCCGTGAAGCGCATCCACGGGCTTCTGAAGACCGAGGCAGAGAGCTACGAGGGGCTGCTGGCCCCATCACTGATCCCTAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCAGTGCTCAAACACGTCAACGCCCTCATCTCGCCGGGACAGAAGATCGGGATCTGCGGCCGCACGGGCAGCGGGAAGTCCTCCTTTTCCCTGGCCTTCTTCCGCATGGTGGACATGTTCGAGGGCCGCATCATCATCGATGGCATTGACATCGCCAGACTGCCACTGCACACCCTGCGCTCGCGCCTGTCCATCATCCTGCAGGACCCTGTCCTCTTCAGTGGCACCATCCGGTTTAACCTGGACCCAGAGAAGAAGTGCTCGGACAGCACACTGTGGGAGGCCCTGGAGATCGCCCAGCTGAAGCTGGTGGTGAAGGCTCTGCCCGGAGGCCTCGACGCCATCATCACAGAGGGCGGGGAGAACTTCAGCCAGGGCCAGAGGCAGCTCTTCTGCCTGGCTCGGGCCTTTGTGAGAAAGACCAGCATCTTCATCATGGACGAGGCCACAGCTTCCATCGACATGGCCACGGAGAACATCCTCCAGAAGGTGGTGATGACAGCCTTCGCAGACCGCACTGTGGTCACCATTGCGCATCGTGTGCACACCATCCTCAGCGCAGACATGGTGATGGTCCTGAAGCGGGGCGCCATCCTAGAGCTGGACAAGCCAGAGAACCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTTGTCCGAGCAGACAAGTGA

XM_004851509.1 Coding sequence

Myod1 myogenic differentiation 1

High confidence: 4 potential gene matches
Length: 957 bp    Location: 9345613..9347326   Strand: +
>XM_004851509.1
ATGGAGTTACTGTCGCCGCCGCTCAGAGACGTAGACTTGACGGGCCCGGACGGCTCTCTCTGCTCCTTTGTCACAGCCGATGACTTCTATGACGACCCATGTTTCGACTCCCCGGATCTGCGCTTTTTCGAGGACCTGGACCCACGCCTGGTGCACGTGGGCGCGCTCCTGAAGCCCGAGGAGCATTCGCACTTCCCGGCAGCTGTGCACCCAGCCTCGGGTGCGCGCGAGGACGAGCATGTGCGCGCACCCAGCGGGCACCACCAGGCCGGCCGCTGCCTCCTGTGGGCCTGCAAAGCTTGCAAGCGCAAGACCACTAACGCAGACCGCCGCAAGGCTGCCACCATGCGCGAGCGCCGCCGCCTGAGCAAAGTCAACGAGGCTTTCGAGACGCTCAAGCGCTGCACGTCCAGCAACCCGAACCAGCGGCTGCCCAAGGTGGAGATCCTGCGCAACGCCATCCGCTACATCGAGGGCCTGCAGGCTCTGCTGCGCGACCAGGACGCCGCGCCCCCTGGCGCCGCCGCCTTCTACGCGCCGGGCCCGCTGCCCCCAGGCCGCGGGGGCGAGCACTACAGTGGCGACTCGGACGCGTCCAGCCCGCGCTCCAACTGCTCCGACGGCATGATGGACTACAGCGGCCCCCCGAGTGGCGCCCGGCGGCGGAACTGCTACGACGGCGCCTGCTACAGCGAGGCGCCCAGCGAGCCCAGGCCTGGGAAGGGGGCGGCGGTGTCGAGCCTCGACTGCCTGTCCAGCATTGTCCAGCGGATCTCCACGGAGAGCCCCGCCGCGCCCGCGCTCCTGCAGGCCGACGCTCCGCCAGAGTCGCCTCCGCGCCAGCAAGAAGCGGCCGCCCCCAGCGAGGGCGAGCTGGGCGCCCCCACCCCTTCCCCGGACGCCACCTCGCAGGGTCCCTCGGGCGCGAACCCCAACCCCATCTACCAGGTGCTTTGA

XR_205536.1 Non-coding sequence

Sergef PREDICTED: Heterocephalus glaber secretion regulating guanine nucleotide exchange factor (Sergef), transcript variant X8, misc_RNA.

Length: 3984 bp     
>XR_205536.1
CACCGGCGAGCTCGCCGGCATGGAGCCCGAGCCTAGCGCCTCCGAGGCCACCCCTGCGGGTGCCGCGCTCTTCGCCTGGGGTGCAAATAGCTATGGGCAACTTGGCCTTGGCCATAAGGAAGATGTGCTTTTGCCCCAGCAACTGACTGACTTCTGTAAACCTGAGTGTGTCAGGAAGATCACAGGAGGAGGGGGACATTCTACAGTTGTCACAGATGGAGGAAGCCTTTTTGTTTGTGGCTTGAACAAAGATGGGCAGTTGGGGCTTGGTCACACAGAGGATGTTCTGTGTTTTACCATCTGCAAATCTCTTGGTGGCTGTCGCATCCAACAGGTAGCCTGTGGCTGGGATTTTACCATTATGCTCACAGAAAATGGTCAAGTTCTATCATGTGGATCAAACTCCTTCGGCCAGTTAGGTGTTCTTCATGGACCTCGAAGATGTGTGGTTCCCCAGGCCATTGAGCTTCTGACAGAGAAGGTTATTTGTGTTGCTGCTGGACTGAGGCATGCATTAGCTGCTACAGTGAGTGGCATTGTGTTCCAGTGGGGGACTGGTTTGGCATCATCTGGACGACGGTTATGTCCCGGGCAGACTCTCCCATTATTTTTGACAGCAAAGGAACCAAGCAGAGTGACAGGTCTAGAGAATTGTAAAGCAATATGTGTTCTTGCTGGCTCAGCCCACTCAGCTTTATTAACAGACGCAGGAGAACTATATGTTTGGGGCGGTAACAAGCACGGACAACTAACTACCCAGGCTGCTTTCCTTCCTGTGCCCCACAAAATAGAAGTGCACTGTTTTCAGAGTGAAAAGGTCACTGCCGCCTGGAGTGGGTGGACCCACCTGGTTGCTCAGACAGAAACTGGCAAGGTGTTTACTTGGGGCCGAGCAGACTATGGTCAACTAGGGAGGAAGCTGGAGACTCAAGAAGACTGGAAACTAGAAAACCAGGATTCATCGAGACCACCGAACAGCACACCTTCACCTCTGCATTGCCTGATGGGAGCCACGGAGATCTCTTGTGGCTCAGAGCATAATTTGGCAGTAATTGGTGGGGCGTGTTATTCCTGGGGCTGGAACGAGCATGGCATGTGTGGGGATGGCACTGAAGCCAATGTCTGGGCCCCGAGGCCTGTGCAAGTCCTGCAGTCGGCACCAGGACTCCTCGTGGGCTGTGGGGCCGGCCACTCCCTGGCCCTCTGTCAGCTGCCAGCACAACCTGCTGTGGGCAAGGATCTCATCACTTACCCTCCCTCAAATGCCACTGAGGACACCAAATCTCAGGAAGCACTGGACAAAGAGAAATTGGAAGAAAAGACAGAAATTTCAACCCAAAGCCAACCTGACAAATCCAGAAGTGATAGAGAACCTTTAATAAAGTAGTTTTCCCTGAGACTCGCTGTGTTGGGCTGTGAGGTTGGCCTGAGCCAACAAACCAGAATGGTGGGCAACTGCTTGCCCCGTATCTAGGCTCAAGGAGACATCCTTTCTACTCAGCAGCAGAGCACAGATGGTCCACACATGGAAGAATGAATGGCTCTGGGCAGTAGGAGACCCCATAGACTACTCTGTCACCTCTGGTTCATCCATTCCACCCTTCTTGACAGCAGCATCAGAAGAAAGGCTTTCCCCAAGTCACCTCACTAGCTGGCTCTGGTGAGTGTCCCGGAAGCCCTTGCCACATGGTGAGTAAGGAGTATTGACAAGTGTCTCCCAGATTTTTTTCTGAGTTAGTTGATTGGTATTGGGTCATTCTTAGACTTTGTAAATGTCCAAGCCTCCGTTCCTAATAGACCATGATCTCTTTGAGTCACAGGACCAAGGTCTCAGTCAATTCTAGAACTCTTCATCAAGGATTACTCCTGGTACAAAAGTGACCAATACAAGTAAATGAATGAATTCATCTGTATACCTGTAGGGTCACCATGAAGTGGAGAGGTTAAATCAGTGGCCTCTGTGACACCCTCATCCTTACTCATCTTCTGTTTTGTCCCACTTACCAATATTTGAGAGTTACGCTGTGGATATCATAGCCATTTGACAGTCAGTGGCACTGTCACCCACCTGGTTAGCTAATGGGCCATAGGAGCGAACTTAAAAAATTGTTTTTTATGATCAACTAAGTAAATTAGGCTTCATATTTCTCCTTCATGAAAAGGAAGAAAGTGGACAGAAGAGAGGAGCACCCTCCCGCGTGTGCTCATAGGCCTTTGGCCTGGCCCTTGGAGTGATTGTTGAAGGACCAGCATGTCCTAGATGTTGGTGAGATGTTTCCGTCTTGCCTGCCACGCTTACTCTCCCCTTCTGATTACAAGTACCCCACCTGCCCCTCCCCACCCCCGGCCCAATGAGTCGAGGGCCATCCGACCAAGCTTAGATGAAATGGTGCATAGGAATCCAGGCCTGTGTGAAGTGACTTAGCGATCAACTGAAGTTAGTGGGGAAGTGCCAGAGGGGTGTTAGAGGGAAAGTGCTCCAGGTCCGGGAGCACAGAGGGAGGTGGGCGTGAGGAGAGCAGAGGCTATGGTCGTAGGGTGAAGGGGCACTTAAGCGGGAGACAGAGGTGGGCCAGCTGTGTGGGGTGGGGAGGGTGAAGTGGCCCCTTCTGTCTTACCCATGGTACTTCATGAAGAGGGCATGAGCCAGGTTGTGAGGGACTGGGACTTAGGACCAACAACTCTACTATTCCCATCAACTCTGCCTCTAAGGGCCAGCCCCAGGAAACCCTCAGTCACTGTGAGACAGTTTAACCCGAGCTCTGGAGTCTAAGACTACTGGAGTTAAAATCTTGACTTCATTCATTGGCTGTGTGGTTTTGGGCCAGTTACAGTATTTTAGCTCTCTTTCCTCTAAAATGGGGCTATTGAATTGTGGTGAGCTACCATGAGACACCATTTGTAAGATATCCCCCACATAGTACATGCTCACTGTATGTTAATTCCCTTTTCCCATTAGCTCCCATGTCGCTGAAAACCAGATGCCAGATGGCTTTCCGTCGTTCACCAGAGGCTCTTCTTTGCCAGGACACCCTGGGTAGCATAAACATTACTGTCCCTGCAGCAGCCAAGGCTGCTTAGCTCACACATCCTGAGACTCAGAGATGGTTGTTACAGCCCGGAAGCCATACAACCTTGGGTAGAGGCTCCTCCAACCCCAATCCCTTGGTCCTTGGACTTCACAGGACAGGAAGTTAAGGCAAATGCTTAGAGGGAATGAAAAACTGGTAGATGAAAATTCAGCGCCCCCCTCAAGCCTCCCACCCATAGGATCACTGACTCAGGACATGCTGGGAGGTATAAGGGAACTGAAATCAGGAAAATTGACACGCACTTGTTTTTGACCCTGGGCAGATCACTCCCCTCCCAGGCCTCATTTCCTCATCTGTAAAATGCTAAGATTTACTACAGTGACCTTCAGGTACTCTCTACTTGATTATTCCTGGAACTTCTGATGGAGAAGAAAAGGGTTGGCTCCTCCACTCTCCCCCTCCACCAAAACCAAGTGAAAACCTGAGCAAATCAAGAGCCCTAGGAGAGGACTGTACTTCTGAGATGCCTCCAGGCTGAGAGAGGGGTACTCAGTGAGGTGATCTACCAGGCTGGGCCTGCAAGAGTACAGCTGGCTGGGGGACCCAGACCTGGCAGGTAGACCTCTGGCTCCATCAGCTTCAACAGTGGCCCTAGCAGGGAGGTAGGATGGTAGGGGGACTGGATGCTCTGACCAGATTCAAAGCGGCATCAGTGCGGCCTGATGCGCAGAGAAGTGTCCATGTCAGGTGGACCCCAGAGGCCGTGCTGGTCTTACATCGGATCTTTGGACACCCTGTGCCTTCTGAGAGCTGCCTCCCTCCCCGAGTCCTACAGCATGTGGGACCCAAGGGGCCGTCCTGCCCAAGCAGCCTGGACCAGCCAGCTTCCTCCTTAGGGCTGGCCATCCCCCATCAGGTTGGCAGGAGCAGGAGCCATGGCTAGGGCTTACCC

XM_004851511.1 Coding sequence

Sergef secretion regulating guanine nucleotide exchange factor, transcript variant X1

Length: 1368 bp    Location: 9624582..9400183   Strand: -
>XM_004851511.1
ATGGAGCCCGAGCCTAGCGCCTCCGAGGCCACCCCTGCGGGTGCCGCGCTCTTCGCCTGGGGTGCAAATAGCTATGGGCAACTTGGCCTTGGCCATAAGGAAGATGTGCTTTTGCCCCAGCAACTGACTGACTTCTGTAAACCTGAGTGTGTCAGGAAGATCACAGGAGGAGGGGGACATTCTACAGTTGTCACAGATGGAGGAAGCCTTTTTGTTTGTGGCTTGAACAAAGATGGGCAGTTGGGGCTTGGTCACACAGAGGATGTTCTGTGTTTTACCATCTGCAAATCTCTTGGTGGCTGTCGCATCCAACAGGTAGCCTGTGGCTGGGATTTTACCATTATGCTCACAGAAAATGGTCAAGTTCTATCATGTGGATCAAACTCCTTCGGCCAGTTAGGTGTTCTTCATGGACCTCGAAGATGTGTGGTTCCCCAGGCCATTGAGCTTCTGACAGAGAAGGTTATTTGTGTTGCTGCTGGACTGAGGCATGCATTAGCTGCTACAGTGAGTGGCATTGTGTTCCAGTGGGGGACTGGTTTGGCATCATCTGGACGACGGTTATGTCCCGGGCAGACTCTCCCATTATTTTTGACAGCAAAGGAACCAAGCAGAGTGACAGGTCTAGAGAATTGTAAAGCAATATGTGTTCTTGCTGGCTCAGCCCACTCAGCTTTATTAACAGACGCAGGAGAACTATATGTTTGGGGCGGTAACAAGCACGGACAACTAACTACCCAGGCTGCTTTCCTTCCTGTGCCCCACAAAATAGAAGTGCACTGTTTTCAGAGTGAAAAGGTCACTGCCGCCTGGAGTGGGTGGACCCACCTGGTTGCTCAGACAGAAACTGGCAAGGTGTTTACTTGGGGCCGAGCAGACTATGGTCAACTAGGGAGGAAGCTGGAGACTCAAGAAGACTGGAAACTAGAAAACCAGGATTCATCGAGACCACCGAACAGCACACCTTCACCTCTGCATTGCCTGATGGGAGCCACGGAGATCTCTTGTGGCTCAGAGCATAATTTGGCAGTAATTGGTGGGGCGTGTTATTCCTGGGGCTGGAACGAGCATGGCATGTGTGGGGATGGCACTGAAGCCAATGTCTGGGCCCCGAGGCCTGTGCAAGTCCTGCAGTCGGCACCAGGACTCCTCGTGGGCTGTGGGGCCGGCCACTCCCTGGCCCTCTGTCAGCTGCCAGCACAACCTGCTGTGGGCAAGGATCTCATCACTTACCCTCCCTCAAATGCCACTGAGGACACCAAATCTCAGGAAGCACTGGACAAAGAGAAATTGGAAGAAAAGACAGAAATTTCAACCCAAAGCCAACCTGACAAATCCAGAAGTGATAGAGAACCTTTAATAAAGTAG

XM_004851512.1 Coding sequence

Sergef secretion regulating guanine nucleotide exchange factor, transcript variant X2

Length: 1344 bp    Location: 9622680..9400183   Strand: -
>XM_004851512.1
ATGCAAAAAGCTCTGAACACCCGAAACTTACTGGATGGTGCAAATAGCTATGGGCAACTTGGCCTTGGCCATAAGGAAGATGTGCTTTTGCCCCAGCAACTGACTGACTTCTGTAAACCTGAGTGTGTCAGGAAGATCACAGGAGGAGGGGGACATTCTACAGTTGTCACAGATGGAGGAAGCCTTTTTGTTTGTGGCTTGAACAAAGATGGGCAGTTGGGGCTTGGTCACACAGAGGATGTTCTGTGTTTTACCATCTGCAAATCTCTTGGTGGCTGTCGCATCCAACAGGTAGCCTGTGGCTGGGATTTTACCATTATGCTCACAGAAAATGGTCAAGTTCTATCATGTGGATCAAACTCCTTCGGCCAGTTAGGTGTTCTTCATGGACCTCGAAGATGTGTGGTTCCCCAGGCCATTGAGCTTCTGACAGAGAAGGTTATTTGTGTTGCTGCTGGACTGAGGCATGCATTAGCTGCTACAGTGAGTGGCATTGTGTTCCAGTGGGGGACTGGTTTGGCATCATCTGGACGACGGTTATGTCCCGGGCAGACTCTCCCATTATTTTTGACAGCAAAGGAACCAAGCAGAGTGACAGGTCTAGAGAATTGTAAAGCAATATGTGTTCTTGCTGGCTCAGCCCACTCAGCTTTATTAACAGACGCAGGAGAACTATATGTTTGGGGCGGTAACAAGCACGGACAACTAACTACCCAGGCTGCTTTCCTTCCTGTGCCCCACAAAATAGAAGTGCACTGTTTTCAGAGTGAAAAGGTCACTGCCGCCTGGAGTGGGTGGACCCACCTGGTTGCTCAGACAGAAACTGGCAAGGTGTTTACTTGGGGCCGAGCAGACTATGGTCAACTAGGGAGGAAGCTGGAGACTCAAGAAGACTGGAAACTAGAAAACCAGGATTCATCGAGACCACCGAACAGCACACCTTCACCTCTGCATTGCCTGATGGGAGCCACGGAGATCTCTTGTGGCTCAGAGCATAATTTGGCAGTAATTGGTGGGGCGTGTTATTCCTGGGGCTGGAACGAGCATGGCATGTGTGGGGATGGCACTGAAGCCAATGTCTGGGCCCCGAGGCCTGTGCAAGTCCTGCAGTCGGCACCAGGACTCCTCGTGGGCTGTGGGGCCGGCCACTCCCTGGCCCTCTGTCAGCTGCCAGCACAACCTGCTGTGGGCAAGGATCTCATCACTTACCCTCCCTCAAATGCCACTGAGGACACCAAATCTCAGGAAGCACTGGACAAAGAGAAATTGGAAGAAAAGACAGAAATTTCAACCCAAAGCCAACCTGACAAATCCAGAAGTGATAGAGAACCTTTAATAAAGTAG

XM_004851518.1 Coding sequence

Saal1 serum amyloid A-like 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1422 bp    Location: 9712569..9688413   Strand: -
>XM_004851518.1
ATGGACCGTAACCCGTCGCCGCCGACCCCGAGTCGGGAGGATGAGGATACGGAGGTGGCCGGGGGAGACTGCATCGGGAGCACGGTCTACAGCAAGCACTGGCTCTTCGGTGTCCTCAGCGGGCTCATCCAGATTGTTACACCTGAAAACACCAAATCCAACTCAGATGATGAGGAGCAGGTGATGGAGCTTGATGAAGAAATGGAGAATGAAATTTGCAAAGTATGGGATATGTCAATGGATCAGGATGTGGCTTTATTTCTCCAAGAATTTAATGCTCCTGACATATTTATGGGAGTACTGGCCAAATCTAAGTGTCCTCGATTAAGAGAAATCTGTGTGGGAATTTTAGGTAATATGGCCTGTTTCCAGGAGATATGTGTGTCCCTCAGCAATGATAAAAATCTTGGGCAAGTGTTATTGCACTGTTTATATGATTCAGATCCACCTACTCTGCTGGAGACAAGCAGGTTGTTGCTTACTTGCCTTTCCCAGACAGAAGTGGCCAGTGTCTGGGTGGAAAGGACCCGGGAATATCCAGCTATTTATGATAGCATTTGTTTCATCATGTCAAGTTCAACAAATGTTGACTTGCTGGTGAAGGTAGGGGAGGTTGTGGATAAGCTCTTTGATTTGGATGAGAAACTAATGTTGGAATGGATTAGAAATGGGGCTGCTCCACCTCTGGACCAACCTAAGGAAGATTCTGAAGAGCAGCCTGTGTTTAAGATTGTGCCCTGTGTACTTGAAGCTGCCAAACAAGTACGTTCTGAAAACCCAGAAGGGCTTGATGTTTACATGCATATCTTACAGCTGCTTACCACAGTGGATGACGGAATTCAAGCAATTGTACAGTGTCCTGATACTTGGAAAGACACTTGGAATTTACTTTTTGACCTGGTCTGCCATGAATTCTGCCAATCTGATGACCCGCCCATCATCCTCCAAGAACAGAAAACGGTGTTGGCCTCTGTGTTTTCAGTGTTGTCGGCCATGTATGCTTCACAGGCTGAACAGGAATATCTAAAAGTAGAAAAAGTAGATCTTCCTCTAATTGACAGTCTGATTCGGGTGTTAGAAAATGTGGAACATTGTCAGAAGAAGCCAGAGAACTCAACAGAGTCTAACACAGAAGAAACTCAAAAGTCTGATTTAACCCAAGAGGACTTCCACTTGAAAATTTTAAAGGATATTTCATGTGAATTTCTTTCTAATATTTTGCAGGCATTAACAAAGGAAACTGTGGCTCAGGGACTAAAGGAAGGCCAGTTAAGCAAACAGAAATGTTCCTGTGCATTTCAAAATCTCCTTCCTTTCTATAACCCTGTGGTGGAAGACTTTATTAAAATCCTGCATGAAGTGGATAAGGCCTTTGCTGATGACCTGGAGGAAAGCTTCCCGAGTTTGAAGGTTCAGACTTAA

XR_205538.1 Non-coding sequence

Saal1 PREDICTED: Heterocephalus glaber serum amyloid A-like 1 (Saal1), transcript variant X5, misc_RNA.

Length: 1619 bp     
>XR_205538.1
CGGCGCAGCTCGGGAGCGTTGGGAGCGCGAGGTCATGGACCGTAACCCGTCGCCGCCGACCCCGAGTCGGGAGGATGAGGATACGGAGGTGGCCGGGGGAGACTGCATCGGGAGCACGGTCTACAGCAAGCACTGGCTCTTCGGTGTCCTCAGCGGGCTCATCCAGATTGTTACACCTGAAAACACCAAATCCAACTCAGATGATGAGGAGCAGGTGATGGAGCTTGATGAAGAAATGGAGAATGAAATTTGCAAAGTATGGGATATGTCAATGGATCAGGATGTGGCTTTATTTCTCCAAGAATTTAATGCTCCTGACATATTTATGGGAGTACTGGCCAAATCTAAGTGTCCTCGATTAAGAGAAATCTGTGTGGGAATTTTAGGTAATATGGCCTGTTTCCAGGAGATATGTGTGTCCCTCAGCAATGATAAAAATCTTGGGCAAGTGTTATTGCACTGTTTATATGATTCAGATCCACCTACTCTGCTGGAGACAAGCAGGTTGTTGCTTACTTGCCTTTCCCAGACAGAAGTGGCCAGTGTCTGGGTGGAAAGGACCCGGGAATATCCAGCTATTTATGATAGCATTTGTTTCATCATGTCAAGTTCAACAAATGTTGACTTGCTGGTGAAGGTAGGGGAGGTTGTGGATAAGCTCTTTGATTTGGATGAGAAACTAATGTTGGAATGGATTAGAAATGGGGCTGCTCCACCTCTGGACCAACCTAAGGAAGATTCTGAAGAGCAGCCTGTGTTTAAGATTGTGCCCTGTGTACTTGAAGCTGCCAAACAAGTACGTTCTGAAAACCCAGAAGGGCTTGATGTTTACATGCATATCTTACAGCTGCTTACCACAGTGGATGACGGAATTCAAGCAATTGTACAGTGTCCTGATACTTGGAAAGACACTTGGAATTTACTTTTTGACCTGGTCTGCCATGAATTCTGCCAATCTGATGACCCGCCCATCATCCTCCAAGAACAGAAAACGGTGTTGGCCTCTGTGTTTTCAGTGTTGTCGGCCATGTATGCTTCACAGGCTGAACAGGAATATCTAAAAGTAGAAAAAGTAGATCTTCCTCTAATTGACAGTCTGATTCGGGTGTTAGAAAATGTGGAACATTGTCAGAAGAAGCCAGAGAACTCAACAGAGTCTAACACAGAAGAAACTCAAAAGTCTGATTTAACCCAAGAGGACTTCCACTTGAAAATTTTAAAGGATATTTCATGTGAATTTCTTTCTAATATTTTGCAGGCATTAACAAAGGAAACTGTGGCTCAGGGACTAAAGGAAGGCCAGTTAAGCAAACAGAAATGTTCCTGTGCATTTCAAAATCTCCTTCCTTTCTATAACCCTGTGGTGGAAGACTTTATTAAAATCCTGCATGAAGTGGATAAGGCCTTTGCTGATGACCTGGAGGAAAGCTTCCCGAGTTTGAAGGTTCAGACTTAACATCTGAGTTGGAATTTCTTCTGACCAAGAAGTAAACTGCTTTTGTAGAAGTTGAAATTGGATGCTGCGTATTGAATCCAGGACCTTGCACATTCCAGTATTTTTCTTTTTGCTGATAATGTGAGATCTGGTCTAAGAGCTATTATTAAAAATAATGTATTTA

XM_004851519.1 Coding sequence

Saal1 serum amyloid A-like 1, transcript variant X3

Length: 1203 bp    Location: 9712569..9693846   Strand: -
>XM_004851519.1
ATGGACCGTAACCCGTCGCCGCCGACCCCGAGTCGGGAGGATGAGGATACGGAGGTGGCCGGGGGAGACTGCATCGGGAGCACGGTCTACAGCAAGCACTGGCTCTTCGGTGTCCTCAGCGGGCTCATCCAGATTGTTACACCTGAAAACACCAAATCCAACTCAGATGATGAGGAGCAGGTGATGGAGCTTGATGAAGAAATGGAGAATGAAATTTGCAAAGTATGGGATATGTCAATGGATCAGGATGTGGCTTTATTTCTCCAAGAATTTAATGCTCCTGACATATTTATGGGAGTACTGGCCAAATCTAAGTGTCCTCGATTAAGAGAAATCTGTGTGGGAATTTTAGGTAATATGGCCTGTTTCCAGGAGATATGTGTGTCCCTCAGCAATGATAAAAATCTTGGGTTGTTGCTTACTTGCCTTTCCCAGACAGAAGTGGCCAGTGTCTGGGTGGAAAGGACCCGGGAATATCCAGCTATTTATGATAGCATTTGTTTCATCATGTCAAGTTCAACAAATGTTGACTTGCTGGTGAAGGTAGGGGAGGTTGTGGATAAGCTCTTTGATTTGGATGAGAAACTAATGTTGGAATGGATTAGAAATGGGGCTGCTCCACCTCTGGACCAACCTAAGGAAGATTCTGAAGAGCAGCCTGTGTTTAAGATTGTGCCCTGTGTACTTGAAGCTGCCAAACAAGTACGTTCTGAAAACCCAGAAGGGCTTGATGTTTACATGCATATCTTACAGCTGCTTACCACAGTGGATGACGGAATTCAAGCAATTGTACAGTGTCCTGATACTTGGAAAGACACTTGGAATTTACTTTTTGACCTGGTCTGCCATGAATTCTGCCAATCTGATGACCCGCCCATCATCCTCCAAGAACAGAAAACGGTGTTGGCCTCTGTGTTTTCAGTGTTGTCGGCCATGTATGCTTCACAGGCTGAACAGGAATATCTAAAAGTAGAAAAAGATCTTCCTCTAATTGACAGTCTGATTCGGGTGTTAGAAAATGTGGAACATTGTCAGAAGAAGCCAGAGAACTCAACAGAGTCTAACACAGAAGAAACTCAAAAGTCTGATTTAACCCAAGAGGACTTCCACTTGAAAATTTTAAAGGATATTTCATGTGAATTTCTTTCTAATATTTTGCAGGCATTAACAAAGGTAGGAAAGAAGTATTGGTGGTTTCTTTAG

XM_004851521.1 Coding sequence

Saa4 serum amyloid A4, constitutive, transcript variant X2

Length: 393 bp    Location: 9745279..9737130   Strand: -
>XM_004851521.1
ATGAGGCTCTGCATTGGCATTGTCCTCTGCTCCTTGGTCCTGGGAGTCAGCAGTGATGGCTGGTACTCCTTCTTCAAGGAGGCTGCCCAAGGGTCTTGGGACATGTGGAGAGCCTACTGGAACTTGCAAGTAGCCAGTTACCCAAATTCAGAGAGATACTTCCATGCGCGGGGGAACTATGATGCTGCCCAAAGGGGACCTGGTGGGGTCTGGGCTGCGAAAGTGCTCAGCAATGCCGGGAAGTACCTTCAGGGCATCTCAAACCGGTTTTATTATGGAATGAGCAACTATGGATCAGAAAACATTGAGTCCAACCAGAAAGCTGAGGAATGGGGCCGATATGGCAAAGACCCCAATCACTTCAGACCACCTGGCCTGCCTGAGAAGTACTGA

XR_205539.1 Non-coding sequence

LOC101713126 PREDICTED: Heterocephalus glaber uncharacterized LOC101713126 (LOC101713126), misc_RNA.

Length: 3876 bp     
>XR_205539.1
CCCATCCTATCCTCTGGTGCATACAAGGAGAGGACTGAGGATGGGGCTGGGAGAGAAAGCAGTGCTGTCCACCATGGGGAGTATAGGGTCGGTGGAGATAGGTGATCCTTTCATATGGACTGGAGGTGCCGAGAAGAAAAAAGATGCATTCTCAGGCCCCAGCCGAGGGCACATCGAGCTGCCCAAACGGGATTTCAGAAGGATGGTGCAGTTCATGCCGGCAGTTGCGGGGTGGCGGTAGAGTGTGCCCAGAAAGAAGATGGGGGCTACCTCTCACTCATCTCTGCCTCCTGGGCAGGAAGAGAAGAAGCCCCCAGCCGTTCAGCCTGAAGCAACCCCAAACTGGGGTCAAGGTAAAAGCTGGGCCAGGTTCTCCGTTTCTGAGGAGGCAGATGTGAACCGACCTCAGGAGCAACAGTGCCCACCAGCTCTGCAGAGACTCCATGTCGGCAGGGAATATCAGCAGCAGTTAGGAGCGCATCGAATGAGGCTCCCTGCTTCATCTAGAACTTTTGTGAGTAATGCATTTGAGACCAAGGAGCGGACATTAGGACGGCAGCCCTTTCATCACTATTAAGCACCATGAGGAAGACTCTGACGTGATGAAATGGCACAAGTCCTCCAACTACAAAATTAACCTCCAACTATAAAATTAACGGGTGCTGCCCGTTTGCTCCTTGGAGCCAGTCTTCCCTTCCTCCCTTTGCTTTCTGCTTTAGGAGGTTGACCTGCACAGACTACATTGACCATGCCTTTGCCCCTGACTTCTGGTTTGAGGTCATGAGGTCATGAGGGTGGGACCACCATGATGGCATTAGTGGCTTTACAAGGAGAGCAAAGAAGACCTGAGCTAGCATGCTTGCTCTGTCTCACCATGTGATGTCATCTGCCATGCTATAATGCAACGAGGAGACTCTCACAAGATACCAGCATCCTGTTCTGGACTTTCTAGTCCAGAAATTAACCTCTGTTCTCTTATAGCAACAGAAAATAGGCTAAGCCTTAGGTAGTTCCACAGAATCTGGAATTTCCTGCCTCACCAAAGATGTGCAAGCTTTCTAAAGCCATAAGTCAATTATCCAAGGCTAATTATAGTAAGTGAACAGATTCCGTGTCCTACGAGAAACATTTCCTATACATTAAGTACATGCTATGAGGCATGTGGTGGCCACATGCTTCGAGGCCAACTGACACATTCCTAGGAGAGTCTTTTTAAATTTGTGATGAATATCAAAAGGTTATTATTCCTTCTCAGCAAATATAATGGGAGAACCTGTATAGGTTTAAATTTAAGAAGCATATTTTGTCATTTCTAAGACACACATTTATTGATTATTGTTGGGGTCCCCTCGGTGGGAGACTGGAACCTGAAGACAGTATCAGACAAAACCTATTAAATGAAGGGCACGGGGGACCACAACTCTTGGAGTTAAGGTGAGGTTTACTGATAATATCCTTCTCTTATACATTTTTCTGTAGGATACATCAATCATTAACAGTTTACAATGCTAGTCAACTAACCACCAGTTATATCTATGAGTACATAAAACATCTACAGAGCCATCTATGCTCCTTTAATCTTAGTGCATCTTATCTAAATCATCCTGGCTACTTAAAGCTTCTAAAAAGTTAGCTATTCTTATCTAGTCCTATACCAAGCAAATATTTGAGAGTCTTAAGGGACCACAGTGGAATGAACACTGTGAGACCGACAAACAGCCTTCTGAAGTTATCTTTAATTTCTCTATCTGGGCCTGCCACAGACATCAGGACAATCTGTCTTCCCAAGGCTGTCCGAGGGCCTGAGAACTTCTCATATCCTCCATAGGTTATAATCTTCTTAAATTAGGATATGTTCTTTTTTTTTTTTTGGTACCGGGGATTGAACTCGGGTCCTTGTGCTTACGCAGCAGGCGGCAAAACCACTGAGCTAAATCCCCGGCCCCAATTAGGGTATGTCTTAAATTCTTGTATAATAACCAGCTAGAATTCAGAAAATTTTTGTCAATGCTTTAGGAATACTCAAATAAATTTGTTTTCCTTTTTGTGTATGCAGAAGAGTAATGTAAGATAAAATCTGTGTCAAAGTAAGACTAAAAGAACTTTTTCATTAAATGATAGACTCTAAGTGATAACAAAGCATTATGTCTTAGTTTAATCGGCAAGATGTTTTTCTTGGTAGTATATAAATAATAGTGCATTTTTCAGTCTATTGTATCTTGGATTCAAAGAAATGGTATGTCTCAGAGACTGTTTTCCATGAACTTGCCTAATAGAAACACAATCAATACAATATTTTGGAAATTCAAAATACCTATTCCTTTCTCCCAGGCTTTTGATCAGATACTATTATGACTAGTGGTTTATTTATACTTGGAGTTCATAATTTTCATTTTTATGAGAGAATGTACAAAGTGTTGCTAGAGAAAATAGAATTTTCTATAACAAAGTAAAATTGTGTGATTTTGGCTGGCATTTCAACATAGATTTGAGGATAGACTTAGAGTCATCTCAAAATGACTCATTACCACTTTCTGTAGGCCAGGACTTGTCTCACACTTCCATACTTTGTACAACTAAACCCTCCTCCCAGATCTGTTGGCTTTTAAAGAGCACGTCTACTTCATTCACTCATTTTAGCACGTATTTATTGAGCATCTATCTAAACTGGGAGCTATAGTAGGGATTGTGGATACAAAGATGACGTATAAGTTAAGATAGGCATGATTTTCACCTTTAGCTTCTTAAATGCTTGCTCTACAGATAAATAAATAAGCAAATGTACGGAAGTGTGCTGAGCCCTAGGAGCAGTCACATACAACAATAGCAGGTACCTCTTGCCTCCCTCAGGTACCCTGTCCTCCATCTCCAATGTTCTGCTTCCCTGGCCCCATGCTTTTCACCTTTATTTCTTTCTCAGAGAAAGAGCTGTTTCTACTCCCTTTGGGGTTAACCTGCCACCTATAGGCTTATCCCACTTCCTCTGGCTTCCACTTGCCTTTGATGCAGCAGTTAGCTTTAGAATCTCCCTCTTCATTAATGCCTTCCTGCTACTTGAAATTCAATTGACCTACTTTGAAAAGAAAACTTCGGCTTTACTAAATAATGCATTCATTCATATTTAATTGTACTATAGCGGCATAACTCAGTTCCTCTCTAGAACAGGAAGTAGAATTTTATCTGAACTAAAAGACAGTGAGAATAACATTAAGGAAAATTAATGTGAGAGGTATTCTTAGGGAAAATGAGCAGACTAATTAAAAATTGAGTCTGGGTAGGCGCTGATATTGTTAAGAAGTAGAGTCCAAGATGGCAGTTTCTAGGCTAGGACTTGTGGGATTAGGCTTCTGAAAGCAATGTGCCTTCTAAATATGGAAAGAGGTTGCTGGGAGACAAGATCTGGAGCCAGAGAGTTGACAGGTGGCAAATGATTGGGCAGAGTGGAGTCTGTACACAGAGAAGCCTGAGAACAGCAATAAAATAACCAGAAAGCCTGGGTATGACAGAAAAAAGAAGTGAGGGATAGGGAGGGATGTCTGATCTGTGTTATGAAAAAGATTCGTGGGAGGGTGTCCAGGACTATGTCAGAACCACAACTATAGTCATTAAGGAATCCAGCATGGTGGTCAATGCTTTCCCAACATAGGCTTACTCAGGAGGAACTGAGTCTCCTAAGGGCTGTGGTGGGGTCATGTGAGGGGCATGCATAAAATGGTGGCTAAACTTGCTTGTCGACTTGATTGAATTGAGAAACACCTAGGAAATGAGTACAACACGCTTCTGGTATACTGTGTGCTGGTTGTAAGACCTAGGGCCTTACCAAACGCTCTGAGGAGCTGAAGTGGAGCACACCCGGGGATCCCAGCGTTGCCTCCA

XM_004851520.1 Coding sequence

Saa4 serum amyloid A4, constitutive, transcript variant X1

Length: 393 bp    Location: 9745275..9737130   Strand: -
>XM_004851520.1
ATGAGGCTCTGCATTGGCATTGTCCTCTGCTCCTTGGTCCTGGGAGTCAGCAGTGATGGCTGGTACTCCTTCTTCAAGGAGGCTGCCCAAGGGTCTTGGGACATGTGGAGAGCCTACTGGAACTTGCAAGTAGCCAGTTACCCAAATTCAGAGAGATACTTCCATGCGCGGGGGAACTATGATGCTGCCCAAAGGGGACCTGGTGGGGTCTGGGCTGCGAAAGTGCTCAGCAATGCCGGGAAGTACCTTCAGGGCATCTCAAACCGGTTTTATTATGGAATGAGCAACTATGGATCAGAAAACATTGAGTCCAACCAGAAAGCTGAGGAATGGGGCCGATATGGCAAAGACCCCAATCACTTCAGACCACCTGGCCTGCCTGAGAAGTACTGA

XM_004851530.1 Coding sequence

Hps5 Hermansky-Pudlak syndrome 5, transcript variant X3

Length: 2964 bp    Location: 9808079..9769593   Strand: -
>XM_004851530.1
ATGACTTTTGTGCCCACGATCCCAGAGTCTTACAGCCATGTTCTCGCGGAGCTTGAGTCCCTGGACCCGTTACTTTCAGCTCTGCGGCTGGACTCCAGTCGTCTAAAGTGCACCAGCATAGCTGTGTCTCGGAAATGGCTGGCCTTGGGCAGCTCGGGAGGAGGAGTCAATCTCATTCAGAAAGAAGGCTGGAAGCACAGGCTTTTTCTCTCGCACCGGGAAGGTTCAATTTCTCAGGTTGCCTGTTGTTCACATGATGACGATTATGTTGCTGTAGCTACCAGTCAAGGTCTTGTAGTTGTTTGGGAATTAAATCAAGAGCATCGTGGGAAACCAGAACGAATTTATGTGTCTTCAGAACACAAAGGCCGAAAAGTTACAGCTCTCTGTTGGGATACAGCTGTTCTTAGAATCTTTGTAGGTGACCATGTGGGGAAAGTTTCTGCCATCAAACTCCACACTTCTAAACAAGCAAAGGCAGCTTCTGTCTTTGTGATGTTTCCTGTTCAGACAATAACAACAGTCGACTCCTGTGTTGTCCAGCTAGATTATTTGGATGGAAGGCTCCTTGTATCTTCCCTTACTCGAGCCTTCTTGTGTGACACTGAGAGAGAGAAGTTTTGGAAAATTGGAAACAAGGAAAGAAATGGAGAATATGGAGCTTGTTTCTTCCCTGGAAGGTGTTCTGGGGGCCAGCAACCTCTAATATATTGTGCTCGTCCTGGCTCCAGGATGTGGGAAGTGAGCTTTGATGGGGAAGTTAGAAGTACACATCAGTTCAAGAAACTCCTCTCGTTGCCACCTCTTCCTGTGATTACTCCAAGATCTGAACCTCAGTATGATCATACAGTGGGATCCTCCCAGTCTTTGTCTTTCCCCAGACTCTTGCATCTTAGTGAGCATTGTGTGCTGACTTGGACAGAAAAAGGAATTTATATTTTTATTCCTCAGAATGTTCAAGTTCTTCTTTGGAGTGAAGTCAAAGATATTCAGGATGTGGCTGTCTACAAGAATGAGCTGTTCTGTTTGCACCTGAACGGGAAAGTCTCACATCTTTCTCTGCTGTCTGTGGAGCGCTGTGTGGAACGTCTGCTAAGGAGAGGTCTGTGGGTTCTGGCTGCTCGCACATGCTATCTGTTCCAAAATTCCATTGTTGCCAGCAAGGCAAGAAAAACTTTGACTATAGATAAATTGGAGCACTTGAAGTCTCAGCTGGATCTTGAAACTTATAGTGATCTCATTCCTCAACTGGATGAATTGATATTGAAATTTGAACCTTTGGATTCAGCTTGCAGCAGTAGAAGAAGCTCTATTTCATCACATGAGAGTTTCAGCATCTTGGACTCTGGTATTTATCGTATCATTAGTAGTAGAAGAGGCAGTCAGTCAGATGAAGATTCTTGCTCCCTTCACAGCCAAACCTTCTCGGAAGATGAGAGACTTAAAGAATTCACCTCACATCCAGAAGAGGACCAGCCAGACAATGTTTCTCATGTTCCAGTGACGTTTGAGACAGATAAGAATGAAACTTTTCTCCCCTTCGGCATTCCATTACCATTTCGTTCTCCATCTCCTCTTGTATCTCTTCAGGCTGTCAAAGACAGTGTTTCTAGCTTTGTGCGTAAAACTACTGAGAAGATTGGTACCCTTCACACAAGTCCTGAGCTAAAAGTGAGACCAGAACCCAGGGATGAAGATCAGTCTTGCGAAGAGGAAGTGAGTTCAGTTACATGCCCACAGGAAGAAGTCACTGAGGAGAAAAAAGAAGTAATTAGTCAACCCCCAAAAGAAGACAGGTTCCAAGAGCTCACAGCAGCAACAGCAGAAGCAATGACCAAGCTACTGGACCCTTTGGTTTTGTTTGAACCCCAGTCTCTGAGAGTGGTTTTACAAGAGTGGCTTTCACACTTAGAAAGGACATTTGCCATGAGAGACTCTCCAGGCACTTCAGATACTGGCAACTCACTTGTGAAACTGAACCAAGATGAGTCAAAAAAGAGAATAGTGGGTGAAGATAATGAAGGAGAAAAAAGGGACTCTTTAGACAATGAAGAAACTGTTGACCCAACAGCGTGTGAATCCATAAATAGTCCAAGGGAGCCCTCGGATGATGACCTTTTCCAAGTGTGTTCCCCATGCGCCATACCAACCAGTCTTCAGAAGGACCTGGCTGAGTTGACAGCATTGTGTTTGGAATTGAACGTTTTGAATTCTGCTATCAAAAGCACGGATGGACATGCAGACCATACTTTGCAACAGTGTTCACCTGAAATTCTGGCTTGTCAGTTTGTAAAGAAGTACTTTTTTCTCCTGGATTTGAAAAGAACAAAAGAGAGTATCAAGCTTAGTTATACTAGCAGCTCCCGTATTTGGGATACTTTCATTGAAGGATTGAAAGAAATGGCCAGTTCTAACCCTACTTATATGGAGATGGGAGAAGGAGACCTACCAACAAGATTAAAGTTATTGGATGACTCCATTCCTTTTGATAGTCCTTTGTTGATTGCTTATGCCACCCGGTTATATGAGAAGTTTGGAGAATCTGCCCTTCGATCCTTGATCAGGTTTTATCCATCCATTTTGCCTTCAGACATCATACAACTTTGTCGTCATCATCCAGCTCAGTTTCTGGCCTATTTAGATAGTTTGGTGAAATCAAGACCTGAAGACCAGCGGTCATCTTTCCTAGAGTCCCTTCTGCAACCAGAGTCCTTAAGATTAGATTGGCTACTTTTGGCAGTGTCCCATGATGCTCCACCAAGCACCAGTACTGTGGATGATGAAGGGTACCCCAGGCCTCATTCGCACTTGTTCTCCTGGGGTTACAGTCAACTGATCCTTTATCTAATTAAACTTCCTGCAGATTTTACAACCAAAGAGAAAATGACAGACATCTGTAAGTCTTGTGGGTTGGAGGCAGGAAGGCCTGCTGGGAGGCTGTTGTGTTCATTCAGGAATGCGTGA

XM_004851525.1 Coding sequence

Gtf2h1 general transcription factor IIH, polypeptide 1, 62kDa, transcript variant X1

Length: 1647 bp    Location: 9808171..9848173   Strand: +
>XM_004851525.1
ATGGCAACCTCATCTGAAGAAGTTTTGCTGGTTGTAAAGAAGGTGCGTCAAAAGAAACAGGACGGAGCTCTGTACCTCATGGCAGAACGAATTGCTTGGGCACCTGAAGGCAAAGATAGATTTACAATCAGCCATATGTATGCAGATATTAAATGCCAGAAAATCAGTCCGGAAGGAAAAGCTAAAATTCAGCTTCAGCTGGTCCTTCATGCAGGGGACACAACAAACTTCCATTTTTCGAATGAAAGCACAGCTGTGAAAGAGCGAGATGCAGTAAAGGACCTTCTTCAGCAGCTACTGCCCAAATTCAAGAGGAAAGCAAATAAGGAGCTGGAAGAGAAAAACAGAATGCTGCAAGAAGATCCTGTTCTGTTCCAGCTTTATAAAGACCTTGTTGTGAGTCAGGTGATCAGTGCTGAGGAATTCTGGGCCAATCGTTTAACTGTGAATACAATGGGTAGTTCTTCCACATCCAATCACAAGCAGGACGTTGGCATTTCTGCGGCATTTCTGGCTGATGTCCGGCCCCAAACAGATGGCTGTAATGGTTTGCGATATAACTTAACTTCTGATATCATTGAGTCCATATTTAGGACCTATCCAGCAGTAAAAATGAAATATGCAGAAAATGTTCCTCACAACATGACAGAAAAGGAATTCTGGACACGTTTTTTCCAGTCCCATTATTTTCATAGGGACCGGCTGAATACAGGGTCAAAGGATCTTTTTGCAGAATGTGCCAAAATAGATGAAAAAGGGTTAAAAACAATGGTTTCATTAGGAGTGAAAAACCCACTACTAGATTTGACAGCTTTGGAAGATAAACCATTAGATGAGGGCTATGGCATTTCCTCTGTGCCCTCTACTTCCAATTCTAAACCCATCAAGGAGAATAGTAACGCTGCCATCATCAAGAGGTTTAACCATCATAGTGCCATGGTCCTGGCAGCAGGTCTCAGGAAACAAGAAGCACAAAATGAACCAAATGGTGAGTCCAGCCGAATGGACGGAAGTTCTGGAGATGCAGACTGCTTTCAGCCAGCAGTCAAAAGGGCAAAGTTACAAGAGTCCATTGAATATGAAGACTTGGGAAAAAATAATTCCATAAAAACGATTGCACTAAACCTCAAGAAGTCAGATAGGTATTACCATGGTCCAACTCCAATCCAGTCAGTACAATATGCAACAAGTCAGGACATTATTAATTCTTTTCAAAGTATTAAACAAGAAATGGAAGCTTATACACCCAAGTTAACTCAGGTTCTCTCAAGTAGTGCTGCTAGTAGTACTATCGCAGCACTGTCACCTGGAGGAGCACTTATGCAGGGAGGGACACAGCAAGCCATAAACCAGATGGTGCCAAGTGATATTCAGTCTGAATTAAAACACTTGTATGTGGCTGTTGGAGAACTTCTTCGGCATTTCTGGTCCTGCTTTCCTGTCAATACACCATTCCTAGAAGAAAAGGTAGTGAAAATGAAAAGTAATTTGGAACGATTCCAAGTTACAAAGCTTTACCCATTCCAAGAAAAAATTCGGAGACAGTATTTAAGCACAAATTTGGTGAGTCATATAGAAGAGATGCTGCAGACAGCCTACAACAAGCTCCACTCGTGGCAGTCACGGCGCATGATGAAGAAGACGTGA

XM_004851532.1 Coding sequence

Ldha lactate dehydrogenase A, transcript variant X2

Length: 999 bp    Location: 9870529..9881753   Strand: +
>XM_004851532.1
ATGGCCAGCCTCAAGGATCAGCTGATCGTGAATCTCCTTAAGGAAGAGCAGGTCCCCCAGAATAAGATTACAGTTGTGGGGGTTGGTGCTGTGGGCATGGCCTGCGCCATCAGTATCTTAATGAAGGACTTGGCAGATGAACTTGCTCTTGTTGATGTCATAGAAGACAAATTGAAGGGAGAGATGATGGATCTCCAACACGGCAGCCTTTTCCTTAGAACACCAAAGATTGTCTCTAGCAAAGACTATAATGTAACTGCAAACTCTAAGCTGGTTATTATCACAGCTGGGGCACGTCAGCAAGAGGGAGAAAGCCGTCTTAATTTGGTCCAGCGTAATGTGAACATCTTTAAGTTCATCATTCCTAATGTTGTAAAGTACAGCCCAAACTGCAAGTTGCTTGTTGTTTCCAATCCAGTGGATATCTTGACCTATGTGGCTTGGAAGATAAGTGGCTTTCCCAAAAACCGTGTGATTGGCAGTGGCTGCAATCTGGATTCAGCCCGGTTCCGTTACCTGATGGGGGAAAGGCTGGGGGTTCACCCCCTGAGCTGCCATGGATGGGTCCTCGGGGAGCATGGAGACTCCAGTGTGCCTGTGTGGAGTGGAGTAAATGTTGCTGGCGTCTCCCTGAAGAATCTGCACCCCGAGTTAGGAACTGATGGGGATAAGGAGCATTGGAAAGAGGTTCACAAACAGGTGGTTGACAGTGCTTATGAAGTGATCAAACTCAAAGGCTACACATCCTGGGCCATCGGACTGTCTGTGGGAGATTTGGCAGAAAGTATAATGAAGAATCTCAGGAGAGTGCATCCAATTTCTACCATGATTAAGGGTCTCTATGGAATAAAGGATGACGTCTTCCTTAGTGTTCCTTGTGTCTTGGGACAAAATGGGATCTCAGATGTTGTCAAGGTGACCCTGACTCCTGAGGAAGAGGCCTGTCTGAAGAAGAGTGCAGATACCCTGTGGGCAATCCAGAAAGAGCTGCAGTTTTAA

XM_004851531.1 Coding sequence

Ldha lactate dehydrogenase A, transcript variant X1

High confidence: 3 potential gene matches
Length: 1086 bp    Location: 9872202..9881753   Strand: +
>XM_004851531.1
ATGAGTGCGCCCTCAGGAAGTTATACTTACACTCAAACATCAGTATTATTTTTCCATGCCAAGGTTCCTTTTGGTTCGAAGTCCAAGATGGCCAGCCTCAAGGATCAGCTGATCGTGAATCTCCTTAAGGAAGAGCAGGTCCCCCAGAATAAGATTACAGTTGTGGGGGTTGGTGCTGTGGGCATGGCCTGCGCCATCAGTATCTTAATGAAGGACTTGGCAGATGAACTTGCTCTTGTTGATGTCATAGAAGACAAATTGAAGGGAGAGATGATGGATCTCCAACACGGCAGCCTTTTCCTTAGAACACCAAAGATTGTCTCTAGCAAAGACTATAATGTAACTGCAAACTCTAAGCTGGTTATTATCACAGCTGGGGCACGTCAGCAAGAGGGAGAAAGCCGTCTTAATTTGGTCCAGCGTAATGTGAACATCTTTAAGTTCATCATTCCTAATGTTGTAAAGTACAGCCCAAACTGCAAGTTGCTTGTTGTTTCCAATCCAGTGGATATCTTGACCTATGTGGCTTGGAAGATAAGTGGCTTTCCCAAAAACCGTGTGATTGGCAGTGGCTGCAATCTGGATTCAGCCCGGTTCCGTTACCTGATGGGGGAAAGGCTGGGGGTTCACCCCCTGAGCTGCCATGGATGGGTCCTCGGGGAGCATGGAGACTCCAGTGTGCCTGTGTGGAGTGGAGTAAATGTTGCTGGCGTCTCCCTGAAGAATCTGCACCCCGAGTTAGGAACTGATGGGGATAAGGAGCATTGGAAAGAGGTTCACAAACAGGTGGTTGACAGTGCTTATGAAGTGATCAAACTCAAAGGCTACACATCCTGGGCCATCGGACTGTCTGTGGGAGATTTGGCAGAAAGTATAATGAAGAATCTCAGGAGAGTGCATCCAATTTCTACCATGATTAAGGGTCTCTATGGAATAAAGGATGACGTCTTCCTTAGTGTTCCTTGTGTCTTGGGACAAAATGGGATCTCAGATGTTGTCAAGGTGACCCTGACTCCTGAGGAAGAGGCCTGTCTGAAGAAGAGTGCAGATACCCTGTGGGCAATCCAGAAAGAGCTGCAGTTTTAA

XM_004851533.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 1 potential gene match
Length: 999 bp    Location: 9886494..9921603   Strand: +
>XM_004851533.1
ATGTCATCTCTCAAGGACCAGCTTATCGCAAATCTAGTTGCAGAAGATAAAAGCTCCCAGTGTAAGATCACCATAGCTGGAGTTGGTGCCGTAGGTATCGCTTGTGCTGTTACTATCTTACTGAAGGATTTGGTGGATGAACTTGCCCTTGTTGATGTCGCAGAGGACAAATTGAAGGGAGAAACAATGGATCTTCAGCATGGCAGTCTTTTCTTTAGTACTTCAAAGATTATCTCTGGAAAAGATTACAAGATATCTGCAAATTCCAAATTAGTTATGGTCACAGCAGGTGCAAGGCAGCAGGAGGGAGAAAGTCGCCTTGCCCTGGTCCAACATAATGTGAATATCATGAAATCCATCATCCCTCCCATAGCCCATCGTAGTCCTGACTGCACAATGCTTATTGTTTCAAATCCAGTGGATATTTTGACATATGTGGTCTGGAAGATAAGCGGCTTACCTGCCACTCCTGTAATTGGGAGTGGTTGTAATCTAGACTCTGCCCGTTTCCGTTACCTAATTGGAGAGAAGTTGGGTGTCCATCCTACAAGCTGCCATGGTTGGATTATTGGAGAACATGGTGATTCTAGTGTGGCTTTATGGAGTGGGGTGAATGTTGCTGGTGTTCCTCTAAAATCTCTGAACCCTGAATTAGGAACTGACTCAGACAAAGAACAGTGGAAAAGTGTCCATAAACAAGTTGTTGAAAGTGCCTATGAGGTCATCAAGCTGAAGGGCTCTACCTCTTGGGCTATTGGGCTGTCTGTGACAAATCTGGTCGGATCAGTTCTGAAAAATCTTAGCAAAGTACATCCAGTTTCCACTCTGGTTAAGGGCTTACATGGAATAAAGGAAGAAATCTTTCTCAGTGTCCCTTGTATCTTGGGGCAGAATGGTGTCTCAGATATCGTGAAAGTCAATTTAAACTCTCAGGAGGAAGCCCTTTTCAAGAGGAGTGCGGAGACACTCTGGAATGTCCAAAAGGACCTGAAAATTTAA

XM_004851537.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 714 bp    Location: 10120360..10124832   Strand: +
>XM_004851537.1
ATGGTGTCCCCGGTCACTGTGGTGAAGAGTGAGGGACCCAAACTAGTGCCGTTCTTCAAGGCCACCTGTGTGTATTTTGTACTCTGGCTGCCCTCCTCCAGCCCCTCGTGGGTCAGCGCCCTCATCAAGTGCCTGCCCATCTTCTGCCTGTGGCTGTTCCTGCTGGCGCATGGCCTTGGATTCCTGCAGGCCCACCCCAGCGCCACCCGCATCTTTGTGGGGCTCGTCTTCTCTGCTCTAGGTGATGCCTTCCTCATCTGGCAGGACCAGGGCTACTTCGTGCATGGTATGCTGATGTTTGCTGTGACCCACATGCTCTACGCCTCGGCCTTTGGCATGCGGCCACTGGCTGTCCGGACAGGTCTGGTGATGGGAGTGCTGTCAGGCCTGTGCTATGTCCTCCTCTACCCTGGCCTCTCAGGTGCCTTCACCTACCTGGTGGGAGTCTATGTGGTCATCATCAGCTTCATGGGCTGGCGAGCTGTGGCAGGGCTTCGGCTGGTCGGGGCAGCCTGGCGCTGGACGGAGCTGGCAGCTGGCAGTGGCGCACTGCTCTTTATCATCTCAGACCTGACCATCGGGCTCAACAAGTTCTGCTTTCCTGTGCCCTATTCCCGGGCACTCATCATGTCCACCTACTACGCTGCTCAGATGCTCATCGCCCTGTCAGCTGTTGAGAGCCGGNTAGACTATAGACTGAGCAAGGCTGGCTGA

XM_004851542.1 Coding sequence

Ptpn5 protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched), transcript variant X5

Length: 1662 bp    Location: 10182318..10147840   Strand: -
>XM_004851542.1
ATGATGCCATCCCAGTATGGGCTTGCAGTCATTTTTTGTCCTCCATGGGACTGTGAGCCCTTTGAAGGTCTTCCCCAGCCGATAGTGATGGAGGCGCTGGACAAGGCCAAAGGGCACCCTGACACACAGAGAGAGATGCCACCGCCCTCTCCACCCTCAGAGCCTGCTCAGAAACCGCCACCTCAAGGCGCTGGGAGCCACTCCCTCACTGTCAGGAGCAGCCTGTGCCTGTTCGCTGCCTCACAGTTCCTGCTTGCCTGCGGGGTGCTCTGGTTCAGCGGCTATGGCCACATCTGGTTGCAGAATGCCACAGACCTCCTCTGCACCTCGCTCACACTCCTGACACAGCTGGGACCCACGGCTTCGCTGGGCACCAGAACCTGGGGCATCCCCAGTCTGCTGCTGGTCTCTCTGTCTGTGGGCCTGGTCCTGGTCACCACCACCTTGCTGTGGCACGTCCTGAAGCCCCCCCCAGAGGCACCCAGCCTGCTGCCCCCAGAGGACAGGCGCCAGTCGGTGAGCCGCCAGCCCTCCTTCACCTACTCGGAGTGGATGGAGGACAAGGTGGAGGATGACTTCCTGGACCTGGACCCTGTGCCCGAGACGCCTGTGTTTGACTGCGTGATGGACATCAAGCCTGAGGCTGACCCCACCTCGCTGACCGTCAAGTCCATGGGTCTGCAGGAGAGGCGGGGCTCCAATGTCTCCCTGACCCTTGACATGTGCACCCCGGGCTGCAATGAGGAGGGCTTTGGCTACCTCGTGTCACCTCGCGAGGAGCTGGCCCACGAGTACCTGCTCAGCGCCTCCCGCGTCCTTCGAGCTGAGGAACTGCACGAAAAGGCCCTGGACCCCTTCCTGCTGCAGGCCGAGTTCTTTGAAATCCCCATGAACTTCGTGGATCCGAAAGAGTATGACATCCCTGGGCTGGTTCGGAAGAACCGGTACAGAACCATCCTTCCCAATCCCCACAGCAGAGTGTGTCTGACCTCACCAGACCCCGAGGACCCTCTGAGTAGCTACATCAACGCCAACTACATCCGGGGCTACCGTGGGGAGGAGAAGGTGTACATCGCCACGCAGGGACCCATTGTCAGCACGGTGGCTGACTTCTGGCGCATGGTGTGGCAGGAGCACACGCCCATCATCGTCATGATCACCAACATCGAGGAGATGAACGAGAAATGCACCGAGTACTGGCCGGAGGAGCAGGTGGTGTACGACGGCGTGGAAATCACCGTGCAGAAGGTCATTCACACCGAGGATTACCGGCTGCGGCTCATCTCCCTCAGGAGTGGGACTGAAAAACGGGGCCTGAAGCACTACTGGTTCACATCCTGGCCCGACCAGAAGACCCCAGACCGGGCACCCCCCCTCCTCCACCTGGTGCGGGAGGTGGAGGAGGCAGCCCAGCAGGAGGGGCCCCGCTGCGCCCCCATCATCGTGCACTGCAGCGCAGGGATTGGGAGGACCGGCTGCTTCATTGCCACCAGCATCTGCTGCCAGCAGCTGCGGCACGAGGGCGTGGTGGACATCCTGAAGACCACGTGCCAGCTCCGGCAGGACAGGGGTGGCATGATCCAGACATGCGAGCAGTACCAGTTTGTGCACCACGTCATGAGCCTCTATGAGAAGCAGCTGTCCCGCCAGTCCCCAGAGTGA

XM_004851786.1 Coding sequence

LOC101712746 mas-related G-protein coupled receptor member X3-like

Length: 648 bp    Location: 10431312..10431959   Strand: +
>XM_004851786.1
ATGTGCCTGTTCATGCTCAGTGCCATTAGCGTCAAGCATTGCCTTGCAGTCCTGTTCCCCATCTGGTACTGCTGTGGCCACCCAAGACACATGTCAGCTGTCACGTGTGCCCTGCTCTGGGCTCTGTCCCTACTGCTCACCATTCTTGTACACATCTCATGTAGCTCTCTGTTTGAGAACGATGAGCTATGTTTGAGAATACATTTCATCATAGCCCCATGTCTGATCCTTCCATTTGTTATTCTCTGTGGGTCCAACCTGGCCTTGCTGGTCAGGATTCTCTGTGGCTTCAGCAGGTTGCCACTGACCAGGTTGTATGTGACCATAGGGCTGTCAGTGCTGGTCTTCCTCCTCTGTGGCCTCCCTGTGGGCATCATATGGGCTCTGGCAGGCACAGTTGCTTTTTACACTCACTTTTCAACCTTTAAGGTCCTTGAAAGGGCTGCTTTTTTGCTGTCTAGTATTAACAGCAGCGCCAACCCCATCATTTACTTCTTTGTTGGCTCCTTTAGGCAGAAACAGCAACAGAGGCAGCAGCGGCAGTCCCTAAAGCTGGTTCTCCAGAAGGCCTTGGAGGATATGGCTGAGGGAGAGAAAACTGGAGAAAATCTTCCTCAGGAAAATACTGAGATGTCAGGATCTCCTTAA

XM_004851554.1 Coding sequence

Dbx1 developing brain homeobox 1

High confidence: 4 potential gene matches
Length: 1086 bp    Location: 11444150..11440470   Strand: -
>XM_004851554.1
ATGATGTTTCCTGGGCTCCTCGCGCCCCCCGCGGGGTACCCGAGCCTCCTGCGGCCCACGCCCACCTTGACGCTGCCCCGGTCCCTCCAGTCGGCGTTTTCCGGCCACTCGAGCTTCCTAGTGGAGGATCTGATCCGCATCAGCCGGCCCCCCGCCTACCTGCCCCGCAGCGGGCCGGCCGCCAGCCTGTCGCCCCCCAGGCAGGGGCCCCCCGCGGCCGCCGCCGACACCGGGGCCTCCGACCCGGGCTCCCCAGGCACCCCGGGCACCCCGGGCACGGGCAGCCGGCGCGGCAGCTCTCCTCAGACCGCCCTCTCCCGGGCCAGCGAGCCCACGTTTTTGAAGTTTGGGGTGAACGCCATCCTCTCCTCGGCGCCCAGAACAGAAACCGCCCCCGCCCTGCTCCCGAGCCTGCCTCCCAAGACGTTCGCCTTTCCCTACTTCGAAGGCTCCTTCCAGCCCTTCATCAGATCCTCGTATTTCCCAGCGTCCTCCGGCGTTGTGCCCATCCCGGGCACGTTCTCGTGGCCGCTGGCCGCCCGTGGGAAGCCACGCCGCGGGATGCTGCGCCGGGCCGTGTTCTCCGACGTGCAGCGCAAGGCGCTGGAGAAGATGTTCCAGAAGCAGAAGTACATCAGCAAGCCGGACCGCAAGAAGCTGGCAGCCAAGCTGGGCCTGAAGGACTCGCAGGTGAAAATCTGGTTCCAGAACCGGCGCATGAAGTGGCGAAACTCCAAGGAGCGCGAGCTCCTGTCCAGCGGGGGCTGCCGCGAGCAGACGCTGCCCACCAAACTCAATCCGCACCCGGACCTCAGCGACGTGGGCCAGAAGGGCCGCGCGGGCGACGAGGAAGAGGACCAGTGCCCCGGCAGCCCCCGGCCGCTCCCGCTCCCAGCCTTCGGGGCGACCCCCGAGCCCCGGCACCCGCGGGATCCCCGGCTCCCAGGGCCGCTGCCCGCCTCGCCCGCACGCTCGGGCAGCCCCGGAAAACCTTCGGACTTCTCCGACTCGGAGGACGAGGGCGAGGAGGAGGATGGCGCGGAGGAGGAGGATGAGGAGGAGGAGGAGGAAATCACCGTGTCCTAG

XM_004851555.1 Coding sequence

Htatip2 HIV-1 Tat interactive protein 2, 30kDa, transcript variant X1

Length: 828 bp    Location: 11650672..11667338   Strand: +
>XM_004851555.1
ATGCCGGGGGCTGCAGCGCTGGGCGCGGCGGCGGTCGCCGCGGTGGGCGCTCTGCTCCTCCTGCGGCCAGAAGACGCGGGGCCCGGGGCTGGCCTCAGCATGGCCGAGACCCAGGCGCTGCCGAAGCTTCGGGAAGACTTCCGGATGCAGAAGAAATCTGTCTTTATTCTGGGCGCCAGCGGGGAAACGGGCAGAGTGCTCTTAAAAGAAATCCTGGAACAGAACCTGTTTTCCAAAGTCACGCTCATAGGCCGGAGGAAGCTCACCTTCGAGGAGGAAGCATACAAAAACGTGAATCAAGAAGTGGTGGACTTTGAAAAGCTGGATGACTATGCATCTGCCTTCCAAGGTCATGATGTTGGATTTTGTTGCCTGGGCACCACCAAAGCAAAAGCTGGCGCGGAAGGATTTGTTCGTGTTGACCGAGATTACGTGCTGAAGTCAGCAGAGCTGGCAAAAACTGCAGGCTGCAAACATTTCAACTTGCTGTCCTCTCGAGGAGCCGATAAGTCAAGCAAATTTTTGTATTTACAAGTTAAGGGAGAAGTAGAAGCCAGGGTTGAAGAATTAAAATTTGATCGTTACTCAGTATTTCGGCCTGGAGTCCTGCTGTGCGACAGGCAAGAATCTCGCCCAGGTGAATGGCTGGCTAGGAAATTCTTTGGCTCCTTACCAAACTCTTGGGCCAGTGGCCTCTCTGTACCCATGGTGACTCTGGTGAGAGCAATGCTGAACAACTTGGTGAGACCAGGTGACCAGCAGATGGAAGTCCTGGAAAGCAAGGCCATCCACAGCCTGGGGAAAGCTGACAGCTCTCTCAAGCTGTGA

XM_004851559.1 Coding sequence

Nell1 NEL-like 1 (chicken), transcript variant X1

Length: 2451 bp    Location: 11921659..12734831   Strand: +
>XM_004851559.1
ATGCCGGTGGACGTGATTTTAGTTTTGGGGTTCTGTGTGTGCGCCGCCAGGACAGTGGTGGGCTTGGGGCTGGACCCTGACCTTCAGATGGATATTATCACAGAACTTGACCTTGTCAACACCACCCTCGGAGTCACTCAGGTGCCTGGACTGCACAATGGCAGCAAAGCATTTTTATTTCAAGACACAGAAAGAGAGATCCATGGAGCTCCTCATGTGAGTGAGAAGTTAATCCAGTTGTTCCGGAATAAGAGTGAATTCACCTTTTTGGCCACTGTGCAGCAGAAGCCATCGACTTCTGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAGCTGGAGAGCAGTGGCCTGAGGGATGAGATTCGATATCGCTACATGCATAAGGGGAAGCCCAGGACAGAGGCATTTCCCTACCAGATGGCAGACGGGCAGTGGCACAAGGTCGCTCTGTCAGTTAGTGCCTCTCACCTCTTGCTCCATGTGGACTGCAATCGGATTTATGAGCGCGTGATAGATCCTCCAGAGACCAGTCTTCCCCCAGGAAGCAACTTATGGCTTGGTCAGCGCAACCAGAAGCATGGCTTATTCAAAGGGATCATCCAAGATGGGAAGGTCATCTTTATGCCGAATGGATACATAACCCAGTGTCCAAACCTAAATCGCACTTGCCCTACCTGCAGTGATTTCTTAAGCCTGGTGCAAGGAATAATGGATTTACAAGAGCTTTTGGCCAAGATGACTGCAAAACTAAATTATGCAGAGACAAGACTTAGTCAATTGGAAAACTGTCATTGTGAGAAGACCTGTCAAGTGAGTGGGTTGCTCTATCGGGACCAAGACTCTTGGGTTGATGGTGACCATTGCAGGAATTGCACATGCAAAAGTGGCGTTGTGGAGTGCCGGCGGATGTCCTGTGCCCCTCTCAGTTGTTCCCCAGACTCCCTCCCTGTGCACATCTCTGGCCAGTGCTGTAAGGCCTGCCGACCAAAATGTATCTATGGAGGAAAAGTTCTTGCAGAGGGCCAGCGGATTCTCTCCAAGAGCTGTCGGGAATGCCGAGGTGGAGTTTTAGTAAAAATCACAGAAACATGTCCTCCTTTGAACTGCTCAGAAAAGGATCACATTCTTCCAGAGAATCAGTGCTGCCGGGTCTGTAGAGGTCATAACTTTTGTGTTGAAGCACCTAAATGTGGTGAAAACTCAGAGTGCAAAAACTGGAATACGAAAGCGACTTGCGAGTGCAAGAATGGTTACATCTCTGTCCAGGGAGACTCCGCCTACTGTGAAGATATTGATGAATGTGCAGCTAAGATGCATTACTGTCATGCGAATACTGTGTGTGTCAACCTGCCAGGGTTATATCGCTGTGACTGTGTCCCAGGCTACATTCGTGTAGATGACTTCTCTTGTACAGAGCACGATGAATGTGGCAGTGGGCAGCACAACTGCGACCAGAATGCCATCTGCACCAACACCGTCCAGGGACACAGCTGCACCTGCAAACCGGGCTACGTGGGCAACGGGACCATCTGCAGAGGTAGGCCTGCCCCTCCAGCATTCTGTGAAGAGGGCTGCAGACACGGTGGGACGTGCGTGGCTCCCAACAAATGTGCCTGTCCGTCTGGATTCACAGGAAGCCGTTGCGAGAAAGATATTGATGAATGTACAGAGGGCATCGTTGAGTGCCACAGCCATTCCCGCTGCGTTAACCTGCCAGGGTGGTACCACTGTGAGTGCAGAAGCGGTTTCCATGACGATGGGTCCTATTCACATTCCGGGGAGTCCTGTATTGACATTGATGAATGTGCCTTAAGAACTCACACCTGTTGGAATGACTCTGCCTGCATCAATTTGGCAGGGGGCTTTGACTGCCTCTGCCCCTCTGGGCCCTCCTGTTCTGGTGACTGTCCCCACGAGGGAGGACTGAAGCACAACGGACAGGTGTGGACCCTGAAAGAAGACAGGTGTTCTGTCTGTTCCTGCAAGGATGGGAAGATATTCTGTCGCCGGACAGCTTGCGACTGCCTGAATCCAAGTGCGGACCTTTTTTGTTGCCCAGAGTGTGACACCAGGGTCACAAGTCAGTGTTTAGATCAAAATGGACACAAACTCTATCGAAGTGGCGACAACTGGACCCACAGCTGCCAGCAGTGTCGGTGTCTGGAAGGAGAGGTAGATTGCTGGCCACTCACCTGCCCCAGTTTGAGCTGCGAGTACACAGCTCTCTTGGAAGGGGACTGTTGTCCCCGCTGTATCAGTGACCCCTGCCTGGCTGATAACATCACCTATGACATCAGAAAAACTTGTCTGGACAGCTCTGGCATTTCAAGGCTGAGCGGAGCACTGTGGACAATGGCTGGATCTCCCTGCACAACCTGTAAATGCAAGAATGGGAGAGTCTGCTGTTCTGTGGATTTGGAGTGTCTTCAGAATAACTGA

XM_004851580.1 Coding sequence

Lin7c lin-7 homolog C (C. elegans), transcript variant X3

Length: 576 bp    Location: 17167073..17160663   Strand: -
>XM_004851580.1
ATGGCGGCGCTGGGAGAACCTGTACGGCTGGAGAGGGATATCTGCAGAGCGATCGAGCTGCTGGAGAAGCTGCAGCGGAGTGGGGAGGTGCCACCACAGAAGCTGCAGGCGCTGCAGAGAGTCCTCCAGAGCGAGTTCTGCACGGCCGTGCGGGAGGTGTACGAGCACGTCTATGAGACAGTGGACATCAGCAGCAGTCCTGAAGTGAGGGCCAATGCAACCGCAAAGGCCACTGTGGCTGCGTTTGCAGCCAGCGAGGGACATTCTCATCCCCGCGTGGTGGAGCTGCCGAAGACGGAAGAGGGCCTCGGCTTCAATATCATGGGGGGCAAGGAGCAGAACTCTCCCATCTACATATCTCGGATAATTCCCGGCGGGATTGCAGACAGACACGGGGGCCTCAAGCGCGGAGACCAGCTCCTTTCTGTGAATGGAGTGATCTTCTCGCACTCGGCTCCTTCAAGCCCAAACAGGAGCCGGTTAGTTTGTGGTGGGAAACAGCAGAGTCAGAAGAAACAGCGACGCCTCCTGCCTCCCCTTCTGCATGCTCACCAGCTCAGAAAGAATGGATTTTAG

XM_004851573.1 Coding sequence

Ano3 anoctamin 3

High confidence: 4 potential gene matches
Length: 2946 bp    Location: 16340630..16605718   Strand: +
>XM_004851573.1
ATGGTGCAGCACTCGGGCTCCATCCAGTCCTTCAAGCAGCAGAAAGGAATGAACATAAGCAAAAGCGAAATAACAAAAGAAACTCCACTGAAACCGTCTCGGAGATCCCTGCCTTGCCTAACCCAGAGCTGCGCTCCTTCCTACAGCTTGAGCCAGTCTACCTCCCTCTTGCAGTCAGCCGAGAGTGAGTCGCAGGCTCCCACTTTGGCCAGCTTAATCTCTGCCGACAAAACAGAGCAAGTTAACCCCGAGGAAAATAACAAAACCTCTCTACTGAAATGTTCCTTTGCTGATCTCAGTGATTTCTGTGTGGCCCTAGGAAAAGATAAGGATTATATGGATGAATCACAACATGCTAATTATGACCGATCTTGTCTCATTGATGACTTTGTTATCAAAGATAAACCTGAATCCAAGACAAAATTGTCTAAGAATGACATGAATTACATAGCATCCAGTGGGCTTCTGTTCAAAGATGGCAAAAAGAGAATTGATTACATCTTGGTCTATAGAAAGACAAACATACAGTATGACAAGAGAAATACATTTGAGAAGAACCTCAGAGCAGAAGGGTTGATGTTGGAGAAGGAGCCGGCTATTGCAAACCCTGACATTATGTTTATTAAAATCCACATTCCGTGGGACACGCTGTGCAAGTATGCAGAGAGGCTGAACATCCGGATGCCTTTCAGGAAAAAATGCTATTATACTGACGGAAGGAACAAATCAATGGGCAGGGTACAAAATTATTTTAAAAGAATCAAAAAGTGGATGTCCCAAAATCCAATGGTTCTCGACAAGTCAGCATTTCCAGAGTTGGAGGAGTCCGATTGTTACACCGGCCCTTTCAGCAGAGCTCGGATTCACCACTTCATAATAAATAATAAGGACACCTTCTTCAGCAATGCTACCCGCAGCAGGATAGTCTACCACATGCTGGAGCGCACCAAATACGAAAATGGGATATCCAAAGTGGGTATCCGTAAACTTATAAACAATGGCTCGTATATAGCAGCATTTCCCCCACATGAGGGCGCCTACAAGAGCAGCCTGCCCATCAGAACCCACGGGCCCCAAAACAACAGGCACCTGCTGTACGAGCGCTGGGCGTGCTGGGGCATGTGGTACAAGCATCAGCCGCTGGACTTGATCAGGCTGTACTTTGGCGAGAAGATTGGGTTGTATTTTGCGTGGCTGGGCTGGTACACTGGAATGCTGATTCCCGCCGCAGTCGTTGGACTGTGTGTCTTCTTCTATGGACTGGTAACCATGAATGGAAGCCAAGTGAGCCAGGAGATCTGCAAAGCCACGGAGGTCTTCATGTGCCCTCTATGTGACAAGAATTGCTCACTGCAGAGGCTCAACGACAGCTGTATCTATGCCAAGGTGACATACTTGTTTGATAACGGAGGGACAGTCTTCTTTGCTATTTTTATGGCAATATGGGCTACTGTCTTCCTGGAGTTTTGGAAAAGGAGAAGAAGTATACTGACCTATACCTGGGACCTTATTGAATGGGAAGAAGAGGAGGAAACACTGCGTCCCCAGTTTGAAGCCAAGTATTATAAGATGGAGATAGTAAATCCCATCACAGGCAAGCCTGAGCCACACCAACCTTTCTCAGATAAAGTCACCCGTCTTCTTGTGTCTGTCTCAGGAATATTCTTCATGATTTCTTTGGTGATCACCGCGGTGTTTGCGGTGGTGGTGTACCGCCTGGTTGTCATGGAGCAGTTTGCATCCTTCAAGTGGAACTTCATCAAACAACACTGGCAGTTCGCAACATCTGCTGCTGCTGTCTGCATCAATTTCATAATCATCATGTTGCTGAATCTTGCCTATGAAAAAATTGCTTACCTCCTCACTAATTTAGAATGTCCTCGAACGGAGTCGGAATGGGAGAATAGCTTTGCCCTGAAGATGTTTCTTTTCCAGTTTGTCAATTTAAACAGCTCCATCTTCTACATTGCCTTCTTTTTGGGGAGATTTGTAGGCCACCCAGGAAAATACAATAAACTTTTTGACCGGTGGAGGCTGGAGGAATGTCACCCCAGCGGCTGCCTGATAGACCTCTGCCTGCAGATGGGAGTCATCATGTTCCTGAAGCAAATCTGGAACAACTTCATGGAGCTGGGATACCCGTTGATCCAGAACTGGTGGTCGCGACATAAAATCAAGCGTGGAGTCCAGGATGCTTCCATACCTCAGTGGGAAAACGACTGGAATCTGCAGCCCATGAATATCCATGGACTGATGGATGAGTACTTGGAGATGGTTTTGCAGTTCGGCTTTACCACCATCTTTGTGGCAGCCTTTCCGCTGGCCCCTCTTCTGGCTTTGCTAAACAACATCATCGAAATCAGGCTGGATGCGTACAAGTTTGTCACGCAGTGGCGGAGACCACTGCCGGCCCGAGCAACTGACATAGGTATCTGGCTTGGCATTCTGGAAGGAATTGGCATATTGGCTGTGATCACCAATGCATTCGTCATTGCTATTACCTCTGACTACATCCCACGTTTTGTCTATGAATACAAATACGGCCCGTGTGCAAATCGTGTAGAACAGAACGAAAATTGCTTAAAGGGATACGTCAACAACAGCCTGTCCTTCTTCAACCTGAGTGAGCTCGGCATAGGGAAATCTGGCTACTGCAGGTACCGAGACTATAGAGGCCCCCCTTGGAGTTCCAAGCCCTATGAATTCACCCTCCAATACTGGCACATCCTGGCTGCCCGGCTGGCCTTCATCATCGTGTTTGAGCACCTTGTTTTTGGGATTAAGTCTTTCATCGCGTATCTGATTCCAGATGTACCCAAAGGCCTACATGAACGAATACGGCGGGAGAAGTACTTAGTCCAAGAAATGATGTATGAGGCCGAACTGGAACATTTACAACAACAACGGAGAAAAAGTGGTCAGCCTGTTCACCATGAATGGCCTTAG

XM_004851563.1 Coding sequence

Ano5 anoctamin 5

High confidence: 4 potential gene matches
Length: 2739 bp    Location: 13220303..13295672   Strand: +
>XM_004851563.1
ATGGGCGAGCCCGGCCTCCTGGAGCTGGTGGAGGAGGAAGTGAGAAGCAACAGTCAAGACACTGGCTACACCTTCCAAATGAGTGAGAGCCTGAGTAGCAGAGAAACCAGCTTTCTCATCAATGAAGAATCAACGCCTGCAAAACGATTCAATTTGTTCCTGAGGCGGCGTCTTATGTTCCAAAAGAGCAAACAAAGCAAAGATTCTATCTTCTTCCGAGATGGGATCAGGCAAATTGATTTTGTACTTTCCTATGTTGATGACATAAAGAAAGACTCAGACATAAAGGCGGAAAGAAGAAAAGAATTTGAGCAAAATCTCAGAAAGTCAGGTCTTGAATTGGAAATCGAAGACAAAAGGGATTCCGAGGATGGAAGAACTTACTTTGTCAAGATCCACGCCCCTTGGGAGGTGCTAGCTACCTATGCTGAAGTGCTGGGGATCAAAATGCCTATTAAGGAGAGTGACATTCCCCGGACGGAGCACCTGCCCTTTAACTGCATGTTCGCGCCTGTGAAGCTCCCAGAGACCGTGAAATATCCTCGCCCTGAATATTTCACTGTCCAGTTCAACAGGCGTCGGCAGGAGCTCTTCCTCATTGACGACAAAGCCACCTTCTTTAAATCCTCATCAAGAAACAGAATTGTGTACTATATTCTTTCACGGTGTCCTTTTGGCATAGAAGATGGGAAAATAAAGTTTGGGATTGAAAGACTGCTAAATTCTAACACTTATTCATCTGCCTACCCGCTCCATGACGGCCAGTATTGGAAGCCCTCAGAAGCTCCAAATCCTGTCAATGAAAGGCACATACTTCATAAGAACTGGGCTCGGTTTTCCTATTTCTACAAGGAACAGCCTTTGGATTTGATTAGGGATTATTATGGAGAAAAAATTGCTATCTACTTTGTCTTTCTTGGTTTTTACACAGAGATGCTGTTCATTGCAGCTTTGGTTGGCTTAGCTTGCTTTATTTATGGCTTATTATCAATGGGCAGTAACCCAAGCAGCGTGGAAATCTGCGACCCCAATGTTGGTGGTCAGATGATCATGTGCCCGCTCTGTGATCAAGTGTGTGACTACTGGAGACTGAATACCACCTGTTGGGCTTCAAAGTTCTCCCATTTATTTGATAATGAGTCAACAGTGTTCTTTGCAATATTCATGGGAATTTGGGTCACGTTGTTTTTGGAGTTTTGGAAACAGCGACAAGCCAGACTGGGGTACGAGTGGGATCTGGTGGACTTCGAGGAGGAGCAGCAGCAGCACCAGCTGAGACCGGAGTTCGAAGCCATGTGCAAGCACAGGAAAATGAATGCAGTGACGAAGGAGATGGAACCTCATATGCCTCTGTTTCGTCATATTCCATGGTACTTCTTATCTGGAGCCACGGTGACACTGTGGATGGCTCTTGTGGTCACCAGCATGGTGGCTGTGATTGTGTACCGCCTGTCAGTCTTCGCTGCATTTGCGAGCTTCATGGAAAGTGAAGCATCCTTACAGGAAGTCAAGAGGTTCTTCACTCCACAGTTAGCCACGTCGCTCACTGGATCCTGCTTGAACTTCATTGTCATCTTGATCTTGAATTTCTTTTATGAAAAAATATCTGCGTGGATTACAAAAATGGAACTCCCTCGAACTTACCAGGAATATGAGAGCAGTCTTACTTTGAAAATGTTCCTGTTTCAGTTTGTGAATTTTTACTCATCCTGCTTCTACGTAGCTTTCTTTAAAGGGAAGTTTGTGGGCTACCCTGGAAAATACACATATTTGTTTAATGTGTGGAGAAGTGAAGAGTGTGATCCTGGAGGCTGTTTAGTGGAACTGACCACCCAGCTAACCATCATAATGATTGGGAAACAGATTTTCACAAACATTAAGGAAGCAATTTATCCCTTGGTTTTGAATTGGTGGAGACGTAGAAAGGCCCGGACCAACTCTGAGAAACTGTACAGTCGTTGGGAGCAGGATCATGACCTTCAGTGTTTTGGACAACTTGGGTTATTCTATGAATACTTAGAAACAGTGATCCAGTTTGGCTTTGTCACACTCTTTGTGGCCTCTTTCCCGCTGGCCCCTCTTTTCGCCCTCATAAATAACATTGTGGAGATTCGCGTGGATGCCTGGAAACTCACCACTCAGTACCGGAGACCCGTGGCCGCTAAAGCGCACAGCATCGGCGTCTGGCAGGACATCCTCGCCGGCATGGCGGTGCTTTCTGTCGCAACCAATGCTTTTATTGTTGCCTTTACATCGGACATCATCCCCCGTTTGGTTTACTACTATGCCTACTCTACAAATACCACACAGCCTTTGAGTGGCTATGTCAATAACAGTCTGTCAATATTCCTGACAGCAGATTTCCCAAACCACACTGTACCTTTGGATAAACGAGACTTCACCACTTGCAGGTACAGAGATTACAGAAATCCTCCTGGGGATGAGAATAAGTACCTTCATAATATGCAGTTTTGGCATGTCCTTGCTGCCAAGATGACATTCATCATAATTATGGAACACATTGTGTTTCTTGTCAAATTTTTGTTGGCCTGGATGATCCCTGATGTTCCGAAAGACGTTGTGGACAGAATCAAACGGGAAAAGCTAATGACTGTCAGGATTCTTCATGATTTTGAACTCAACAAACTAAAAGAGAAATTGGGACTTAATCCTAATGAATTTTCCAAGCATGTCATGATTGAGGAAAACAAAATGCAGCTGGCTAAATCCACAATTTAA

XM_004851571.1 Coding sequence

Muc15 mucin 15, cell surface associated, transcript variant X1

Length: 966 bp    Location: 16544246..16531953   Strand: -
>XM_004851571.1
ATGTGGACCTTAGCCCAAATTGTGCTGATTTCAATTTTGTTTATTTCACTACCCTTTGAGAGCCATGAGATAGAAAACCTAGGAAAAAAGACAACACAAAGAATTGCAGAAGTTTGGAAAACAAAGGAAAGAGAAGCACATGTAAATTCAAACAAGGAAAACGGAAATGTCTCCATTCCCAAGGTAACTGGTTTCCCTCCTTTGGACCCATCTAATGTAGCGACTTTCACCAACACCTTGACGACAGTCAACTTCTCCAGGGCTCCAAGATCCACAGCCAGGTTTTCCACAACCCCTCCCTTGATTCACAGCTTTGTTTCCAAACTGCCTTGGAACTCATCTCTAGCAGAGGAGAATCTGTCACCTGTCTCAGCACACCCCGATTCTACACAGGCTGTCTCATCGGAAGACTCCAGTCTGGACAATGGCACCATGTACGTTCCTGACAACAGTTCCACTGCTACAAGATTCCCGCCCCCAGTGCCCACCCCCAAATCTGTGACCCCCTTGACAGCGGAACCCACCGCATGGCCTACCACAGATGGCGACAGCTTCGCTGGCTTCACTCCCTATCAAGAAAAAACAACTCTACAGCCCACCTTCCAATTCACCAACGACTCGAAACTCTCTCCAAGTACAGCAGACCCCCCTGAAGAGAACAGAAATACCGGAGTGGTGTTTGGGGCCATTTTAGGGGCTATTCTGGGTGTGTCCCTGCTTAGTCTTGTTGGCTACTTGTTGTGTGGAAAAAGGAAAACAGATTCATTTTCCCATCGGCGACTTTACGACGACAGAAACGAACCAGTTCTGCGATTAGACAACGCCCCAGAACCATACGACATGGGCTTTGGGAGTCCGAGCTACTATAACCCATCTTTGAATGCCTCTTCAGTGCCAGAAAGCAGAGAAAGTGCAGGGGACAGCATTCCTATGGATGACATTCCGCCACTGCGCAGCGCGGTATAA

XM_004851579.1 Coding sequence

Lin7c lin-7 homolog C (C. elegans), transcript variant X2

Length: 591 bp    Location: 17167073..17159211   Strand: -
>XM_004851579.1
ATGGCGGCGCTGGGAGAACCTGTACGGCTGGAGAGGGATATCTGCAGAGCGATCGAGCTGCTGGAGAAGCTGCAGCGGAGTGGGGAGGTGCCACCACAGAAGCTGCAGGCGCTGCAGAGAGTCCTCCAGAGCGAGTTCTGCACGGCCGTGCGGGAGGTGTACGAGCACGTCTATGAGACAGTGGACATCAGCAGCAGTCCTGAAGTGAGGGCCAATGCAACCGCAAAGGCCACTGTGGCTGCGTTTGCAGCCAGCGAGGGACATTCTCATCCCCGCGTGGTGGAGCTGCCGAAGACGGAAGAGGGCCTCGGCTTCAATATCATGGGGGGCAAGGAGCAGAACTCTCCCATCTACATATCTCGGATAATTCCCGGCGGGATTGCAGACAGACACGGGGGCCTCAAGCGCGGAGACCAGCTCCTTTCTGTGAATGGAGTGATTGGCATTTTAGCATTTCCTACAAGACACGGCCGATCTGGAAAGAACCTGAGCACGACGCGGTGTAACTTTGAGAATCCCTGTTGTGAATATTTTATAATGTGGAATGATGCTGAAATATTAAGGACTTGGGTAGTTGTATTTCCTGAATAA

XM_004851586.1 Coding sequence

Mettl15 methyltransferase like 15, transcript variant X2

High confidence: 4 potential gene matches
Length: 1218 bp    Location: 17624805..17786813   Strand: +
>XM_004851586.1
ATGCTTCGATACCCATATTTATGTAGATGTATATATAAAGAGTGTTTTTCATACTGGTTGGAATCTGGCATACTTAATTTAGATGCCTGGCAAAAAAAATTACATACTACAACAGGAAGATGGAATGAGTATAAAACCCAAGCGCAAGCAGGTCAAACTGGAGCCCAGGAATCGCACACATCTCCAAATAGAGATTCTGACACCGTGGCTGAATTGCATATTCCGGTGATGGTGAATGAAGTCGTTCGTTGTTTGGCACCACAAAAAGGGCAGGTTTTTCTAGATATGACATTCGGTTCAGGAGGACACACAAAAGCCCTTCTCCAGGAGGAGCCGGATATTACTCTGTACGCCTTAGACAGAGACCCGACAGCTTGTGCGCTAGCCGAGCAGCTTTCAGAGCTATATCCGAAACAGATCCGAGCTCTGCTAGGCCCGTTCAGCCAGGCCGAAGCCGTACTCCTGGAGGCTGGGGTGCAGCCGGGGACTTTGGATGGGGCTCTGTTGGATCTCGGGTGCTCCTCCATGCAACTTGACACTCCTGAAAGAGGTTTTTCCCTTCGGAAGGACGGTCCCTTGGACATGAGGATGGATGGTGGCAGGTATCCCGACATGCCCACCGCGGCTGACGTTGTGAACGCCTTAGACCGACAGGCGCTCGCATCCATCCTGAGAAGATACGGGGAAGAGAAACACGCCAGGAAAATCGCGTCAGCAATCGTTCAGGCACGGAGCACATACCCCATCACCAGAACCCAGCAGCTTGCCAGCATTGTAGCAGGTGCATTTCCTCCTTCTGCTATTTATGCACGGAAAGACTTGCTACAACGATCGACCCATATTGCTACCAAGACTTTCCAAGCTCTTCGTATATTTGTGAACAATGAGCTCAATGAACTCTACACAGGACTTAGGACAGCTCAGAAATTTCTGAGACCTGGTGGTCGCCTTGTTGCTATCTCCTTTCACTCATTAGAGGATCGCATCGTCAAGAGATTTTTGCTTGGGATAAGCATGATGGAAAAGTTTAACCAAAGTGTCAGACAGAAGATGGTGCAAACCTGGGGTTCAGATCATGAAAACAAAGGAGGAATTGCTGTAAAAGCTCCTTTAATGTGGGAAATGATACACAAGAAGGTACTTACCCCCAAAGATCAGGACATACACGATAACCCCAGAGCACGGTCAGCCAAGCTGAGAGCAGCTATCAAATTGTGA

XM_004851794.1 Coding sequence

Fshb follicle stimulating hormone, beta polypeptide

High confidence: 4 potential gene matches
Length: 387 bp    Location: 19329374..19331267   Strand: +
>XM_004851794.1
ATGAAGTCCGTCCAGTTCTGCGCCCTTCTCTGTTGCTGGAGAGCAGCCTGCTGTGCGGGCTGTGAGCTGACCAATGTCACCATCGCCGTGGAGAAGGAACAGTGCAGGTTCTGCATCAGCATCAACACCACCTGGTGTGCGGGCTACTGCTATACCAGGGATCTGGTGTACAAGGACCCGGCCAGGCCCAACCTCCAGAAAATATGCACCTTCAAGGAGCTGGTGTATGAGACCGTGAGAGTGCCCGGCTGTGCCCACCACGCAGACTCCCTGTACACGTACCCTGTGGCCACCAAGTGTCACTGTGGCAAGTGTGACAGCGACAGCACTGACTGCACTGTTCGAGGCCTGGGGCCCAGCTACTGCTCCTTCAGTGAGATGGCGTAA

XM_004851593.1 Coding sequence

Arl14ep ADP-ribosylation factor-like 14 effector protein, transcript variant X6

High confidence: 4 potential gene matches
Length: 780 bp    Location: 19394416..19405418   Strand: +
>XM_004851593.1
ATGGATCCGTGCTCGGTTGGAGTGCAGCTTCGCACCACAAACGAGTGCCACAAAACCTACTACACTAGGCACACAGGCTTCAAGACTTTGCAGGAGTTGTCGTCCAATGATATGCTTTTACTTCAGCTCCGCACCGGCATGACGCTGTCTGGGAACAATACCATTTGCTTCCATCATGTAAAAATTTACATCGACCGGTTTGAGGATTTGCAGAAGTCATGTTGCGACCCATTTAACATACATAAAAAGCTGGCCAAAAAGAACCTGCATGTCATTGACTTGGACGATGCCACTTTTCTGAGTGCAAAATTCGGAAGGCAGCTGGTGCCTGGTTGGAAGCTCTGTCCGAAGTGCACACAGATCATCAATGGAAGTGTGGATGTGGATTCTGAGGACCGCCAGAGAAGAAAGCCTGAGTCTGATGGAAGAACTGCTAAAGCTCTGCGGTCTCTCCAGTTTACAAACCCAGGAAAGCAGACCGAATTTGCTCCGGAAACTGGAAAAAGGGAGAAGAGAAGGCTCACGAAAAACACACCCGGTGGTTCAGACAGACAAGTCATACCAGCCAAGAGCAAGGTCTACGACAGCCAGGGCCTGCTCATCTTCAGCGGGATGGACCTGTGTGACTGCCTGGACGAGGACTGCTTGGGCTGTTTCTACGCCTGCCCTGCCTGCGGGTCCGCCAAATGTGGAGCCGAGTGCCGCTGCGACCGAAAGTGGCTGTACGAGCAAATCGAGATCGAAGGGGGAGAGATCATTCACAACAAACACGCTGGGTAG

XM_004851589.1 Coding sequence

Arl14ep ADP-ribosylation factor-like 14 effector protein, transcript variant X2

Length: 780 bp    Location: 19394800..19405418   Strand: +
>XM_004851589.1
ATGGATCCGTGCTCGGTTGGAGTGCAGCTTCGCACCACAAACGAGTGCCACAAAACCTACTACACTAGGCACACAGGCTTCAAGACTTTGCAGGAGTTGTCGTCCAATGATATGCTTTTACTTCAGCTCCGCACCGGCATGACGCTGTCTGGGAACAATACCATTTGCTTCCATCATGTAAAAATTTACATCGACCGGTTTGAGGATTTGCAGAAGTCATGTTGCGACCCATTTAACATACATAAAAAGCTGGCCAAAAAGAACCTGCATGTCATTGACTTGGACGATGCCACTTTTCTGAGTGCAAAATTCGGAAGGCAGCTGGTGCCTGGTTGGAAGCTCTGTCCGAAGTGCACACAGATCATCAATGGAAGTGTGGATGTGGATTCTGAGGACCGCCAGAGAAGAAAGCCTGAGTCTGATGGAAGAACTGCTAAAGCTCTGCGGTCTCTCCAGTTTACAAACCCAGGAAAGCAGACCGAATTTGCTCCGGAAACTGGAAAAAGGGAGAAGAGAAGGCTCACGAAAAACACACCCGGTGGTTCAGACAGACAAGTCATACCAGCCAAGAGCAAGGTCTACGACAGCCAGGGCCTGCTCATCTTCAGCGGGATGGACCTGTGTGACTGCCTGGACGAGGACTGCTTGGGCTGTTTCTACGCCTGCCCTGCCTGCGGGTCCGCCAAATGTGGAGCCGAGTGCCGCTGCGACCGAAAGTGGCTGTACGAGCAAATCGAGATCGAAGGGGGAGAGATCATTCACAACAAACACGCTGGGTAG

XM_004851590.1 Coding sequence

Arl14ep ADP-ribosylation factor-like 14 effector protein, transcript variant X3

Length: 780 bp    Location: 19396678..19405418   Strand: +
>XM_004851590.1
ATGGATCCGTGCTCGGTTGGAGTGCAGCTTCGCACCACAAACGAGTGCCACAAAACCTACTACACTAGGCACACAGGCTTCAAGACTTTGCAGGAGTTGTCGTCCAATGATATGCTTTTACTTCAGCTCCGCACCGGCATGACGCTGTCTGGGAACAATACCATTTGCTTCCATCATGTAAAAATTTACATCGACCGGTTTGAGGATTTGCAGAAGTCATGTTGCGACCCATTTAACATACATAAAAAGCTGGCCAAAAAGAACCTGCATGTCATTGACTTGGACGATGCCACTTTTCTGAGTGCAAAATTCGGAAGGCAGCTGGTGCCTGGTTGGAAGCTCTGTCCGAAGTGCACACAGATCATCAATGGAAGTGTGGATGTGGATTCTGAGGACCGCCAGAGAAGAAAGCCTGAGTCTGATGGAAGAACTGCTAAAGCTCTGCGGTCTCTCCAGTTTACAAACCCAGGAAAGCAGACCGAATTTGCTCCGGAAACTGGAAAAAGGGAGAAGAGAAGGCTCACGAAAAACACACCCGGTGGTTCAGACAGACAAGTCATACCAGCCAAGAGCAAGGTCTACGACAGCCAGGGCCTGCTCATCTTCAGCGGGATGGACCTGTGTGACTGCCTGGACGAGGACTGCTTGGGCTGTTTCTACGCCTGCCCTGCCTGCGGGTCCGCCAAATGTGGAGCCGAGTGCCGCTGCGACCGAAAGTGGCTGTACGAGCAAATCGAGATCGAAGGGGGAGAGATCATTCACAACAAACACGCTGGGTAG

XM_004851608.1 Coding sequence

Pax6 paired box 6, transcript variant X7

Length: 1269 bp    Location: 20554611..20536233   Strand: -
>XM_004851608.1
ATGCAGAACAGTCACAGTGGTGTGAATCAGCTCGGAGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATCGTAGAGCTAGCGCACAGCGGGGCCCGGCCTTGCGACATCTCCCGAATTCTGCAGGTGTCCAACGGCTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACCGGCTCCATCCGACCCAGGGCCATCGGGGGCAGTAAACCCAGAGTGGCAACTCCGGAAGTTGTGAGCAAAATTGCCCAGTACAAGCGGGAGTGCCCGTCCATCTTTGCCTGGGAAATCCGAGACAGATTGCTGTCTGAGGGGGTCTGCACCAACGACAACATACCAAGTGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGCTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGGTGGTATCCGGGCACTTCCGTGCCAGGCCAGCCCACACAAGATGGGTGCCAGCAGCAGGAAGGAGCGGGGGAGAACACCAACTCCATCAGCTCCAACGGGGAGGACTCGGACGAGGCGCAGATGCGGCTGCAGCTGAAGCGGAAGCTGCAGCGGAACAGGACCTCCTTCACTCAGGAGCAGATCGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCACTATCCAGATGTGTTCGCCCGGGAAAGACTAGCAGCCAAGATAGACCTACCTGAAGCGAGAATACAGGTCTGGTTTTCCAACAGAAGGGCCAAGTGGAGACGAGAGGAGAAGCTGAGGAACCAGCGGAGACAGGCCAGCAACACCCCCAGCCACATCCCCATCAGCAGCAGCTTCAGCACGAGCGTGTACCAGCCCATCCCGCAGCCCACCACCCCGGTGTCCTCCTTCACGTCTGGCTCCATGCTGGGCCGGACAGACACGGCCCTCACCAACACATACAGCGCGCTGCCACCCATGCCCAGCTTCACCATGGCCAACAGCCTGCCTATGCAGCCCCCTGTCCCCAGCCAGACCTCCTCGTACTCCTGCATGCTGCCCACCAGCCCATCGGTGAACGGGCGGAGTTATGACACCTACACGCCCCCACACATGCAGACCCACATGAATAGCCAGCCTATGGGCACCTCGGGCACCACGTCTACAGGCCTCATTTCTCCCGGCGTGTCCGTTCCAGTCCAGGTTCCTGGAAGTGAACCTGATATGTCTCAATATTGGCCAAGATTACAGTAA

XR_205549.1 Non-coding sequence

Immp1l PREDICTED: Heterocephalus glaber IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp1l), transcript variant X7, misc_RNA.

Length: 2416 bp     
>XR_205549.1
AGCCTACCAATCGCAAGAAGTATTATTGAAAGGTGCGCACTACGTAAGGACGAAAGTCTTTTGCAGGGCGCAGGGTCCTGAAGCCATGGATGACCCATGTGTGCTTTAGATTTTTTTCTGGAAGCCCTGAAGGCACCCTTGAAAATTGAGTGTGTTGTGGAACAGACCTATGGTGAAGCGACTTCCAGTCATTTGGAAAGGATGGGATGAAAAGGAACCTTGGTGATAATTTTGATGTCTGCAAGATTTAGTACCAGTGTAATGGGATTATCGGTAACACCTTCACTGCAGAAAAAGCCACCTGGCGCTATAACTGGCAGCAACTGAGAACTAATCCTTTCCCATCTCTTGGATGTCATTCATGAAGCTCAAAGCAATTTCTACCCTGCTAACTGTGATTAATTCTATAAACAACAACAAAAAAATCAGACTGAGACCCTCTCGGACCCTGCGTGTCGTGCAGCTGGCCGCAGGGACAGCGGGCCAGGGCCACTCAGTGCCGCTCCTCCGTTGGCACTGTCGCTGTTGCCTGCCCCGCTGCTGTTCCTCTCATGCACACGGATCACAGAGCCGTTGAAGGTGGATGCCCTTGGTTTGGTACTACTGATCATGACGCTTTTTGGGATTTACCATCCGGCCAGTGGTAGCAGCGTCTTCACAAAACGATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAACGTATGAAGCCTGCGGTGACAGTGAGCACTGCGAGTGTGGACCCAGTCTGCCCTCGGCGATGACCCGCAAGACTTCAGGCAGTGGGACGCTGTGTCTGGGCCCCTGGGGGCCCGGCTGCGGTGCTGCGCACACCTCGTGTGGCCAGTGTGGAGCCGACGCGGGCTGCGCTGTGGTGCACCGAGCTAGGCACAGGGAGCTACGTCGGCCAAGCACAGCTGCTTTTCCCAGCCCGGGCAGACACGGATCTTCCCGCCTGGAGGACAGTCCTGGGCAGAGGCTGGAGAGGGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGGTACAGTTTTCTGATGAACCGTCAGCTGTACTGTCAGCTGCAGAAATAACTATGCCATCTTCAGGCCCATGGGACTTCTGGTTGCAGTACCTACACTTCATGAACACACCAGCCTTCACTTGACAGCTCACCACCAAACCTTACTGCTGTCTTCCACGCTCAGAGGCAGGTGACTGAGCAGGGATTTTTATAATAAAACTCAGATTCCTTAGTTCTCCAAACCTTCATTCTCTCTCACACTGTCTGTCACCTGTCAGCACCAAGCTGGAAAGACGTGCATGAGCACCCGCAGCAGAGCAGCCTGGGCCATGCAGCCAAGTGTGCAGCGCTAGGGAAGGCAGCTGCCTTCGCTGCCCCGCCCAGTGACAGGAAGGACAGTTTGAAGCCAGTTGCAGCAGTGGGATAATCTAGGGTCCTGTATACGTCGATGTTACCCTTAGATATCTTGGGTCAAAGGTGCAGTTACCTTCCTTGCGGACACACAGATTCATACGTTTATGTCCACACCACACACACACACACACACACACACGTTCTTGTATGTGTAAATACATAAATGTTTTGTAAAGTGTCACTCTGCACCCGAAACTTACTCATGGGGTATGAGCAAGGAGGAAGTGTTATCAATCCCAGAGAAAGGAGGAGGAGGAGGACAGGGGAATGTGGTGAGGGTACAGCATCACCTTCATTAACCATCTCCACCTCCTGTGGATTTTACAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGACAAGCATTTATTCCTCTGACCTGATGAGTCTCCTGGTCCAGTGAATTTATGACCACAGTGGAAACCATCCAGCCGTGGAAGCCCGTCACTGCTGTCCAGGCCGCCAGGCAGGGCTCCTCCCGCTGAGTCTGAGAAGACTGTCACCACCACAGAGAGCCTGGTCATACAGAACCTCGAGGTTCCCAATTACGCAACTGCAAACAAGAATTTCTACTCCACGATTCCATCTGAGCGGATGAGGGCAGAACAACCCTATAAGGAAAGCACAATGTGCCTTCCAAGTGGCTTATAACTCACTTTTTTAAAGCACTAAACTAAGAATTTACCATTAATAAAGTAAAGGGTTTCAAGGATGGCTCTGTTTATCT

XM_004851609.1 Coding sequence

Rcn1 reticulocalbin 1, EF-hand calcium binding domain

High confidence: 3 potential gene matches
Length: 984 bp    Location: 20732406..20739408   Strand: +
>XM_004851609.1
ATGGCGCGCGCGGGGCTCGGCGCGGGGCTCGGGCTGGCGCTGGCGCTGGCGCTGGCGCTGTCGCCGTCGCGGGCCAAGCCCACGCTGCGCAAGGAGCGCGTGCTGCGCCCTGACTCCGAGCTGGGCGCGCGGCCGCCCGAGGGCAACGGCAGCTTCCAGTACGACCACGAGGCCTTCCTGGGCCGCGAGGACGCGCGTGGCTTCGACCAGCTCAGCCCGGAGGAGAGCAGGGCCCGGCTGGGGAAGATTGTGGACCGAATCGACAGTGATGGAGACGGCTTCGTCACCACTGAGGAGCTCAAAGTTTGGATCAAACGGGTGCAGAAAAGATACATCTATGATAATGTCGCCAAGGTCTGGAAGGACTACGACAGAGACAAAGACAACAGGATCTCCTGGGAGGAGTATAAACAAGCCACCTACGGCTACTACCTGGGGAGCCCTGCAGAGTTCCAGGACAGCGCAGACCATCTCACCTTCAAAAAGATGCTGCCCCGGGACGAGAGAAGGTTCAAGGCCGCGGACCTGGATGGGGACCTGGCCGCCACTCGAGAGGAGTTCACCGCCTTCCTGCACCCTGAGGAGTTCGAGCACATGAAGGAGATCGTGGTTTTGGAAACGCTGGAGGACATCGACAAGAACGGGGACGGCTTTGTGGACCAGGATGAGTACATCGCGGACATGTTTTCCCACGAGGACGGTGGCCCTGAGCCAGACTGGGTCTTGTCGGAGCGAGAGCAGTTCAGTGACTTCCGAGACCTGAACAAGGACGGGAAGCTGGACCAGGACGAGATTCGGCACTGGATCCTCCCGCAGGACTACGACCACGCGCAGGCCGAGGCGCGGCACCTGGTGTACGAGTCGGACAGGAACAAGGATGAGAAGCTCACCAAGGAGGAAATCTTGGACAACTGGAACATGTTTGTGGGGAGCCAGGCCACCAACTACGGCGAGGATCTCACCAAGAGTCACGACGAGCTGTAG

XM_004851612.1 Coding sequence

Wt1 Wilms tumor 1, transcript variant X3

Length: 807 bp    Location: 20933209..20899549   Strand: -
>XM_004851612.1
ATGGGGCAGCAGGGCTCGCTGGGCGAGCAGCAGTACCCTGTGCCGCCCCCAGTCTACGGCTGCCACACGCCCACGGACAGCTGTTCCGGCAGCCAGGCGCTGCTGCTGAGGACGCCGTACAGCAGTGACAACTTATACCAGATGACCTCCCAGCTCGAATGCATGACCTGGAACCAGATGAATCTGGGGGCCACCTTGAAGGGAGTTGCTGCTGGGAGTGCCAGCTCGGTGAGATGGACGGAAGGCCACAGCAACCACAGCGCAGGGTACGAGAGCGAGAGCCACACGACGCCCATCCTATGCGGCGCCCAGTACCGGATCCACACGCACGGCGTCTTCCGGGGCATCCAGGACGTGAGGCGCGTGCCCGGTGTGACCCCCACACTGGTCCGGTCGGCCTCTGAGAGCAGTGAGAAGCGCCCCTTCATGTGCGCTTACCCAGGCTGCAACAAGAGGTACTTCAAGCTGTCCCACCTGCAGATGCACAGCCGGAAGCACACGGGTGAGAAACCGTACCAGTGTGACTTCAAGGACTGTGAGCGAAGGTTTTCGCGCTCTGACCAGCTCAAAAGGCACCAGAGGAGACACACAGGTGTGAAACCATTCCAGTGTAAAACTTGTCAGCGAAAGTTCTCCCGCTCCGACCACCTGAAGACCCACACCAGGACTCATACAGGTAAAACAAGTGAGAAGCCCTTCAGCTGCCGGTGGCCGAGCTGTCAGAAGAAGTTCGCGCGCTCCGACGAGCTCGTCCGCCACCACAACATGCACCAGAGGAACATGACCAAGCTGCAGTTGGCGCTCTGA

XM_004851628.1 Coding sequence

Ap2a2 adaptor-related protein complex 2, alpha 2 subunit, transcript variant X1

Length: 2817 bp    Location: 21616392..21568217   Strand: -
>XM_004851628.1
ATGCCGGCCGTGTCCAAGGGGGACGGGATGCGGGGCCTGGCGGTCTTCATCTCGGACATTCGCAACTGCAAAAGTAAAGAAGCAGAAATAAAGAGGATAAACAAGGAACTGGCAAATATTAGGTCAAAATTCAAAGGTGACAAGGCTCTTGATGGCTACAGTAAAAAGAAGTACGTGTGCAAGTTGCTCTTCATCTTCCTCCTGGGCCACGACATCGACTTTGGGCACATGGAGGCCGTGAACTTGCTGAGCTCCAACCGGTACACAGAGAAGCAGATTGGCTACCTCTTTATCTCCGTGTTGGTGAACTCCAACAGCGAGCTGATCCGCCTGATCAACAACGCCATCAAGAACGACCTGGCCAGCCGCAACCCCACCTTCATGGGCCTTGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGCGGAGGCCTTTGCCGGGGAGATCCCCAAGATCCTCGTTGCAGGAGACACCATGGACAGTGTGAAGCAGAGTGCGGCCCTGTGCCTCCTGCGCCTGTACAGGGCGTCCCCCGACCTCGTCCCGATGGGTGACTGGACGTCACGGGTGGTGCATCTGCTCAATGACCAGCATCTGGGCGTGGTCACTGCTGCCACCAGCCTGATCACCACGCTGGCCCAGAAGAACCCCGAGGAGTTCAAGACCTCCGTCTCCCTTGCCGTCTCCAGGCTGAGCAGAATCGTGACTTCTGCATCCACGGACCTTCAGGATTATACCTACTACTTTGTCCCAGCTCCCTGGCTGTCAGTCAAACTTCTGAGGCTGCTGCAGTGCTACCCGCCCCCAGAAGATCCTGCAGTTCGAGGCCGCCTGACCGAGTGCCTGGAGACCATCCTGAACAAGGCGCAGGAGCCGCCGAAGTCCAAAAAGGTGCAGCATTCCAATGCCAAGAATGCCGTGCTCTTCGAGGCCATCAGCCTGATCATCCACCACGACAGTGAGCCAAACTTGCTGGTGCGCGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGCGAGACCAACCTGCGCTACCTGGCACTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCACGAGGCCGTCAAGACCCACATCGACACCGTCATCAACGCCCTCAAGACGGAGCGGGATGTAAGCGTGCGGCAGCGAGCCGTGGACCTGCTGTACGCCATGTGCGACCGTAGCAATGCCCAACAGATTGTGGCTGAGATGCTGAGTTACCTCGAGACGGCTGACTACTCCATCCGTGAGGAGATTGTGCTAAAGGTGGCCATCCTGGCCGAGAAGTACGCAGTGGACTACACCTGGTATGTGGACACCATCCTGAACCTGATCCGCATCGCAGGGGACTATGTCAGTGAGGAGGTGTGGTACCGCGTCATTCAGATTGTCATCAACCGCGATGATGTGCAGGGCTATGCCGCCAAGACGGTGTTTGAGGCTCTGCAGGCTCCTGCGTGCCATGAGAACCTGGTCAAAGTGGGCGGCTACATCCTGGGGGAATTTGGAAACCTGATAGCTGGGGACCCGCGGTCCAGCCCTCTGATCCAGTTTGACCTGCTGCACTCCAAGTTCCACCTGTGCAGCGTGCCCACGCGGGCCCTGCTGCTGTCCACCTACATCAAGTTTGTGAACCTGTTCCCCGAGGTGAAGACCACCATCCAGGACGTGCTGCGCAGCGATAGCCAGCTCAAGAACGCGGATGTGGAGCTGCAGCAGCGGGCCGTGGAGTACCTGCGGCTCAGCAGCGTGGCCAGCACTGACATCCTGGCGACCGTGCTGGAAGAGATGCCACCCTTCCCGGAGCGTGAGTCCTCCATCCTGGCCAAGCTCAAGAAGAAGAAGGGGCCGAGCACAGTGACCGACCTGGAGGAGGCCAAGCGCGAGCGCAGCGTGGATGTGAACGGGGCCCCCGAGCCCGCCCCGGCCAGTGCCAGCGCTGCGTCCACGCCTTCTCCATCCGCTGACCTGCTGGGTCTGGGCGCTGCCCCCCCGGCCCCCACGGGGCCCCCGCCCTCAGCTGGGGGGCTGCTGGTGGACGTCTTCTCCGACTCAGCGTCAGCAGTCGCACCCCTGGCGCCCGGCTCTGAGGACAACTTTGCCAGGTTTGTTTGTAAAAATAATGGTGTGTTGTTTGAAAACCAGCTGCTTCAAATTGGACTTAAGTCTGAGTTTCGGCAGAATCTAGGCCGAATGTTCATATTTTATGGTAACAAGACTTCGACGCAGTTCTTAAACTTCACTCCAACGCTGATCTGTGCAGATGACCTTCAGGCTAATCTGAACCTGCAGACCAAGCCCGTGGACCCGACTGTGGATGGGGGTGCACAGGTGCAGCAGGTGGTCAACATTGAGTGCGTGTCCGACTTCACGGAGGCACCAGTCCTCAACATCCAGTTCAGGTACGGCGGCACCTTCCAGAATGTGTCCGTCAAGCTGCCCATCACACTGAACAAGTTCTTCCAGCCCACGGAGATGGCATCTCAGGACTTCTTCCAGCGCTGGAAGCAGCTGAGCAATCCTCAGCAGGAAGTGCAGAGCATCTTCAAAGCAAAGCACCCGATGGACACAGAGATCACCAAGGCCAAGATCATCGGATTTGGGTCAGCACTCCTTGAAGAAGTTGATCCTAACCCTGCAAACTTTGTGGGCGCTGGCATCATCCACACCAAAACCACCCAGATTGGATGCTTGCTGCGTTTGGAGCCGAATCTGCAAGCTCAGATGTACCGGCTCACGCTGCGCACAAGCAAGGACACTGTTTCCCAGAGGCTATGTGACTTACTGTCGGAGCAGTTTTAA

XM_004851631.1 Coding sequence

Ap2a2 adaptor-related protein complex 2, alpha 2 subunit, transcript variant X4

Length: 2589 bp    Location: 21606213..21568217   Strand: -
>XM_004851631.1
ATGGAGGCCGTGAACTTGCTGAGCTCCAACCGGTACACAGAGAAGCAGATTGGCTACCTCTTTATCTCCGTGTTGGTGAACTCCAACAGCGAGCTGATCCGCCTGATCAACAACGCCATCAAGAACGACCTGGCCAGCCGCAACCCCACCTTCATGGGCCTTGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGCGGAGGCCTTTGCCGGGGAGATCCCCAAGATCCTCGTTGCAGGAGACACCATGGACAGTGTGAAGCAGAGTGCGGCCCTGTGCCTCCTGCGCCTGTACAGGGCGTCCCCCGACCTCGTCCCGATGGGTGACTGGACGTCACGGGTGGTGCATCTGCTCAATGACCAGCATCTGGGCGTGGTCACTGCTGCCACCAGCCTGATCACCACGCTGGCCCAGAAGAACCCCGAGGAGTTCAAGACCTCCGTCTCCCTTGCCGTCTCCAGGCTGAGCAGAATCGTGACTTCTGCATCCACGGACCTTCAGGATTATACCTACTACTTTGTCCCAGCTCCCTGGCTGTCAGTCAAACTTCTGAGGCTGCTGCAGTGCTACCCGCCCCCAGAAGATCCTGCAGTTCGAGGCCGCCTGACCGAGTGCCTGGAGACCATCCTGAACAAGGCGCAGGAGCCGCCGAAGTCCAAAAAGGTGCAGCATTCCAATGCCAAGAATGCCGTGCTCTTCGAGGCCATCAGCCTGATCATCCACCACGACAGTGAGCCAAACTTGCTGGTGCGCGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGCGAGACCAACCTGCGCTACCTGGCACTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCACGAGGCCGTCAAGACCCACATCGACACCGTCATCAACGCCCTCAAGACGGAGCGGGATGTAAGCGTGCGGCAGCGAGCCGTGGACCTGCTGTACGCCATGTGCGACCGTAGCAATGCCCAACAGATTGTGGCTGAGATGCTGAGTTACCTCGAGACGGCTGACTACTCCATCCGTGAGGAGATTGTGCTAAAGGTGGCCATCCTGGCCGAGAAGTACGCAGTGGACTACACCTGGTATGTGGACACCATCCTGAACCTGATCCGCATCGCAGGGGACTATGTCAGTGAGGAGGTGTGGTACCGCGTCATTCAGATTGTCATCAACCGCGATGATGTGCAGGGCTATGCCGCCAAGACGGTGTTTGAGGCTCTGCAGGCTCCTGCGTGCCATGAGAACCTGGTCAAAGTGGGCGGCTACATCCTGGGGGAATTTGGAAACCTGATAGCTGGGGACCCGCGGTCCAGCCCTCTGATCCAGTTTGACCTGCTGCACTCCAAGTTCCACCTGTGCAGCGTGCCCACGCGGGCCCTGCTGCTGTCCACCTACATCAAGTTTGTGAACCTGTTCCCCGAGGTGAAGACCACCATCCAGGACGTGCTGCGCAGCGATAGCCAGCTCAAGAACGCGGATGTGGAGCTGCAGCAGCGGGCCGTGGAGTACCTGCGGCTCAGCAGCGTGGCCAGCACTGACATCCTGGCGACCGTGCTGGAAGAGATGCCACCCTTCCCGGAGCGTGAGTCCTCCATCCTGGCCAAGCTCAAGAAGAAGAAGGGGCCGAGCACAGTGACCGACCTGGAGGAGGCCAAGCGCGAGCGCAGCGTGGATGTGAACGGGGCCCCCGAGCCCGCCCCGGCCAGTGCCAGCGCTGCGTCCACGCCTTCTCCATCCGCTGACCTGCTGGGTCTGGGCGCTGCCCCCCCGGCCCCCACGGGGCCCCCGCCCTCAGCTGGGGGGCTGCTGGTGGACGTCTTCTCCGACTCAGCGTCAGCAGTCGCACCCCTGGCGCCCGGCTCTGAGGACAACTTTGCCAGGTTTGTTTGTAAAAATAATGGTGTGTTGTTTGAAAACCAGCTGCTTCAAATTGGACTTAAGTCTGAGTTTCGGCAGAATCTAGGCCGAATGTTCATATTTTATGGTAACAAGACTTCGACGCAGTTCTTAAACTTCACTCCAACGCTGATCTGTGCAGATGACCTTCAGGCTAATCTGAACCTGCAGACCAAGCCCGTGGACCCGACTGTGGATGGGGGTGCACAGGTGCAGCAGGTGGTCAACATTGAGTGCGTGTCCGACTTCACGGAGGCACCAGTCCTCAACATCCAGTTCAGGTACGGCGGCACCTTCCAGAATGTGTCCGTCAAGCTGCCCATCACACTGAACAAGTTCTTCCAGCCCACGGAGATGGCATCTCAGGACTTCTTCCAGCGCTGGAAGCAGCTGAGCAATCCTCAGCAGGAAGTGCAGAGCATCTTCAAAGCAAAGCACCCGATGGACACAGAGATCACCAAGGCCAAGATCATCGGATTTGGGTCAGCACTCCTTGAAGAAGTTGATCCTAACCCTGCAAACTTTGTGGGCGCTGGCATCATCCACACCAAAACCACCCAGATTGGATGCTTGCTGCGTTTGGAGCCGAATCTGCAAGCTCAGATGTACCGGCTCACGCTGCGCACAAGCAAGGACACTGTTTCCCAGAGGCTATGTGACTTACTGTCGGAGCAGTTTTAA

XM_004851647.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X6

Length: 1194 bp    Location: 21669702..21666302   Strand: -
>XM_004851647.1
ATGACAGGCAGGGTGGCGTGCTGGCTGCTCAGAGGGGCCGAGACGCCAGGGAAGGCACCCATGGCCAAGCTGCCTTGGGCCGGGGTTGGTCCCCAGTGCTCTGTGGGCTTGTGCCAACCTGGCTGTGCACAGAACATGGGGTGGGCTCCCAGGCGACCAGCAAGCCTGCGACAGCCGCCACGTCCTGCCTCTGGCCAGGCCGTGTCCCGAATGCCGAGGGGCATGGCAGCTGCTCCTCCAGGGTACCTCACCCTGTCCCCATCCCTGTCCCCCACTGGTGCTGCCGTCCAGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGATTCTGGGCCTGACCTTTGCCATGACCATGTACTGCCAAGTGGTGAAGGCAGACACCTACTGCACCTAG

XM_004851652.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X11

Length: 945 bp    Location: 21669673..21666302   Strand: -
>XM_004851652.1
ATGACAGGCAGGGTGGCGTGCTGGCTGCTCAGAGGGGCCGAGACGCCAGGGAAGGCACCCATGGCCAAGCTGCCTTGGGCCGGGGTTGGTCCCCAGTGCTCTGTGGGCTTGTGCCAACCTGGCTGTGCACAGAACATGGGGTGGGCTCCCAGGCGACCAGCAAGCCTGCGACAGCCGCCACGTCCTGCCTCTGGCCAGGCCGTGTCCCGAATGCCGAGGGGCATGGCAGCTGCTCCTCCAGGGTACCTCACCCTGTCCCCATCCCTGTCCCCCACTGGTGCTGCCGTCCAGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGATTCTGGGCCTGACCTTTGCCATGACCATGTACTGCCAAGTGGTGAAGGCAGACACCTACTGCACCTAG

XM_004851653.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X12

Length: 891 bp    Location: 21678921..21666622   Strand: -
>XM_004851653.1
ATGGCGCGCGGGTGCCTGCAGGGCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTTTTCTGGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851648.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X7

Length: 1074 bp    Location: 21678921..21666622   Strand: -
>XM_004851648.1
ATGGCGCGCGGGTGCCTGCAGGGCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTTTTCTGGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851643.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X2

Length: 1302 bp    Location: 21673525..21666622   Strand: -
>XM_004851643.1
ATGACAGGCAGGGTGGCGTGCTGGCTGCTCAGAGGGGCCGAGACGCCAGGGAAGGCACCCATGGCCAAGCTGCCTTGGGCCGGGGTTGGTCCCCAGTGCTCTGTGGGCTTGTGCCAACCTGGCTGTGCACAGAACATGGGGTGGGCTCCCAGGCGACCAGCAAGCCTGCGACAGCCGCCACGTCCTGCCTCTGGCCAGGCCGTGTCCCGAATGCCGAGGGGCATGGCAGCTGCTCCTCCAGGGTACCTCACCCTGTCCCCATCCCTGTCCCCCACTGGTGCTGCCGTCCAGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851660.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X4

Length: 1527 bp    Location: 21690235..21686956   Strand: -
>XM_004851660.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGTGAGCCCCGGGCTCGGGACCCAGCCACCAGGGCTGGCCCAGCGCTCACCTGCTCTCTGCCTGGTCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGTGCGCTCAGGCCCGGCCCGGAGGGGCTCCCGGATGCGGATGCTCTCGGCCTCCGCCCCACGCTGCTGGGAGCAAGGCCTTCCTGGGTCTGCCCTCTTCTGGGCTGAGGGAGCGGGGCCCACCTTCCCCCATCCTCCCTAAACCCCGTCGGAGCTCAACTGCACACCCTCCCCAGGGAGCTGAACACACGGCTGCGGGACGAGAGGGACGCCTGTGA

XM_004851676.1 Coding sequence

Pnpla2 patatin-like phospholipase domain containing 2, transcript variant X5

High confidence: 3 potential gene matches
Length: 1479 bp    Location: 21697009..21692017   Strand: -
>XM_004851676.1
ATGTTCCCCCGGGAGACGAAGTGGAACATCTCGTTCGCGGGCTGCGGCTTCCTCGGCGTTTACCACATCGGCGTGGCTTCCTGCCTCCGCGAGCACGCGCCCTTCCTGGTGGCCAACGCCACGCACATCTATGGCGCCTCGGCTGGCGCCCTTACGGCCACGGCGCTGGTCACCGGGGCCTGCCTGGGCGAGGCAGGTGCCAATATCATTGAAGTGTCCAAGGAGGCCCGAAAGAGGTTCCTAGGCCCCCTGCACCCCTCCTTCAACCTGGTGAAGACTATCCGGGGCTGCCTACTGAAGACCCTGCCTGATGATTGCCACGAACGCGCCAGTGGGCGCCTGGGCATCTCCCTGACTCGGGTATCGGATGGCGAGAATGTCATCATCTCCCATTTCAACTCCAAGGATGAGCTCATCCAGGCCAATGTCTGCAGCACCTTCATCCCTGTGTACTGTGGCCTCATCCCTCCCTGCCTCCAAGGGGTGCGCTATGTGGACGGCGGCATTTCAGACAACTTGCCACTCTATGAGCTTAAGAACACCATCACTGTGTCCCCGTTCTCGGGCGAGAGTGACATCTGTCCCCAGGACAGCTCCACCAACATCCATGAACTGCGGGTCACCAACACCAGCATCCAGTTCAACCTGCGCAACCTCTACCGCCTCTCCAAGGCCCTCTTCCCCCCAGAGCCCATGGTGCTTAGAGAGATGTGCAAGCAGGGCTACAGGGACAGCCTGCGCTTCCTGAGGCGGAACGGCCTCCTGAACCGGCCCAACCCCCTGCTGGCGCTGCCCGCCACCCGAGGACGTGGGGAGGAAGACAGGGAGGAGGCCAGCGGGGGCGTAGAGAGCAGCGGCACTGAGGAGCGACTGCTGCCACCCGGTGAAGACCACATCCTGGAGCATCTGCCCTCGCGGCTCAATGAGGCCCTGCTGGAGGCTTGCGTGGAGCCCAGGGACTTGATGACCACACTGTCCAACATGCTGCCTGTGCGGCTGGCCACAGCCATGATGCTGCCCTACACTCTGCCGCTGGAGAGTGCGGTGTCTTTCACCATCCGCCTGCTGGAGTGGTTGCCTGATGTGCCCGAGGACATCCGGTGGATGAAGGAACAGACGGGGAGCATCTGCCAGTATCTGGTGATGCGCACCAAGAGGAAGCTGGGCAGTCACCTGCCCTCCAGGCTGTCTGAGCCCACTGAGCTTCGTCGAGCTCGGTCATTACCCTCGGTGCCGCTGTCCTGCGCTAGCTACTGGGAGGCACTGCCCAGCTGGGTGCGCAGCAACCTCTCCTTGGGTGATGCGCTGGCCAAGTGGGAGGACTGCCAGCGCCAGCTGCTGCTGGGTCTCTTCTGCACCAACGTGGCCTTCCCACCGGATGCCCTGCACATGCGCCTGCCCGCGGACCCGAAGCCTGCGGACCCCAGGGCTCTTGACCCCAGGCTCCCCCAGCACCCACCAGGCCTGCCCCCATGCTGA

XM_004851680.1 Coding sequence

Pidd p53-induced death domain protein

Length: 2754 bp    Location: 21704845..21710285   Strand: +
>XM_004851680.1
ATGGCTGCGGTGGTGGAGGGGTTGGAGCCGGAGGAAGCGGGAGCTGCAGAAGACACGGCAGGACTTGCAGTGAAGGCTGCAGATGCCGAGCCTGGCCCGACTCCTATCTTGGCTGGGAACTGGCTGAATTTGGACCTATACCCTGGGGGTTGCCACCGGCTGCTGCACCTGTGTGCCCAGCAGCCCTCACCCCTGCTGCAGGTGGAGTTCTTGCAGCTGAGCACCCACGAGAACCCTGGGCTGCTGGAGACCACCCTAGCCCAGGTGCCCTGGAGCCAGCTGTGCCTCCGCTCCCTCGTCCTCAAAGGAGGACAAAGCCGAGGTGCCCTGGGTGCTTGCCTCCGGGGCACCCTGACCACGCTGCCCACTGCCCTAAGTGGCCTGACCCGCCTGGTCCACCTGGACCTGAGCTTCAACAGCCTGGAGACACTGCCGGCCTGTGTCCCACAGCTTCGTGGCCTGGGCACCCTGCTGTTGTCTTACAACCACCTGTCAGAGCTGCCAGAGGCCCTGGGGACCCTGCCCACCCTCAGCTTCCTTGCTGTGACGCACAACCTCCTACAGAGGCTGCCCACAGCACTGGGGGCCCTGGCCAGCCTGCAGCGCCTTGACCTCTCCGAGAATCTCCTGGACACTCTGCCTCCTGAGATCGGAGGCCTGAGCAACCTGAGTGAGCTCAATCTGGCCTCCAACCGGCTTCAAAGCCTCCCAGCTTCCCTTGTGGGATTGCAGTCCCTGCAGCTCCTTATTCTGCACAGTAACCTCCTGACCTCAGTGCCTGCTGGCTTGGCCCACCTTCCGTTGCTCACACAGCTGGATCTGAGGGACAACCAGCTCCGGAACCTGACGCCTGAGCTACTGGACGTCCCCTGTGTACGCCTGCAGGGGAACCCCCTGGGCGAAGCCTCACCAGACTTCCCAACCTCCTCAGGTAGGCTTAGGATACCCCAAGATCTGGAGATGCCTACTCTGTTCCTGACTTCAGATGTGAACAGCTTCCCTGTAACCCCACAAGGCTGCTCTGTGACGCTAGCCTGCGGTGTCCGCCTGCAGTTCCCAGCCGGGGCCACTGCAGTCCCTGTCACCATCCACTATCGGCTGTGGCTGCCAGAGCCAAGACTCGTCTCCCTGGGTCCTCACGACTCTCTGCTCAGCAGTGTCCTGGAGCTGTGGCCACACGGCGTGGCCTTCCAGCAGGATGTGAGCCTGTGGCTGCTCTTTGTCCCGCCACGGACCCGTCGTTGCCGTGAGGTGGTGGTCAGGACTCGGAGTGAGGACAGCTGGCGGGACCTGGAGACCCACCTGGAGGAAGAGGCCCCAAAGCGGCTCTGGGCTCGCTGCCAGGTACCCCACTTCTCCTGGTTCCTTGTGGTCTTACGCCCTGTGTCCAATGCCTGCTTGGTACCGCCAGAGGGGACACTGCTGTGCTCCTCGGGTCATCCGGAAGTCAAGGTCATCTTCCCTCCAGGGGCCACAGAGGAGCCTCATCATGTCTCCATGCAGGTAGTACGCATGGCTGGCCGGGAGCTGCGAGCCCTTCTGGGTGAGCCTGAGGCTGCTGTGAGCCCCCTGCTGTGCCTCACACAGCACAGCCCTGCTGGCTTCCTCTGCCCAGTCACCGTGCAGCTGCCCCTACCCCCTGGTGTCACAGGCTTCAGTCTGGACTGCTCCCGCCTGCACCTGCTGTACCGGGCCCCTCCTGCAGCCAACTGGGATGACATCACAGCCCAGGTGGCCCTGGAGCTCACACACCTGTACGCGCGCTTCCAGGTCACACGTTTCTCCTGGTACTGGCTGTGGTACACCACCAAGACCTGTGTGGAGGGCCTGGCGCGCAAGGCCTGGGAGCGGCTGCGGCTTCACCGGGTCAACCTCATCGCTCTGCAGCGCCGCCGGGACCCCGAGCAGGTGCTGTTGCAGTGCCTGCCCCGGAACAAGGTCGATGCCACCCTGCATCGGCTGCTGGAGCGCTACCGAGGCCCTGAGCCTTCTGACACTGTGGAGGTGTTTGAGGGCGAGAAGTTCTTTGCTGCCTTCGAGCGGGGCATTGAAGTGGATGCTGATCGCCCAGACTGTGTGGAGGGCCGGATCTGCTTTGTCTTCTACTCACACTTGAAAAACATGAAGGAGGTATACGTGACCACCTCCCTGGACCGGGAGACTCAGGCTGTTCGGGGCCAGGTGTCCTTCTACCGTGGCTCAGTGCCCACAGAGGTGCCACAGGAGGCCGAGGCTGCACGGCGGAGGAAGGGTGCGGACGCCCTGTGGATGGCCACCCTGCCCATCAAGCTGCCGAGATTTCGGAGGTCTGCAGGGCACGGGCAGGGGCCTGGCCTCTCCCTGGTGCCCCTCAACCTGGGTGACGCTGACACTGGCTTTCTGACTCAGAGCAACCTGCTGAGTGTGGCAGGGCGGCTGGGTCCTGACTGGCCAGCTGTGGCCCTCCACCTGGGCCTGCCGTATCATGAGCTGGAGCGCATCCGGCACAAGTTCAGGGATGACCTGGACGGGCAGATTCGCCACATGCTTTTCTCCTGGGCTGAGCGCCAGGCTGGGCAGCTTGGGGCAGTGGGGCGCCTGGTGCAGGCCCTGGAGCAGAGTGACCGGCGGGATATAGCTGATGAGGTGCGGGCAGTCTTGGAGCTTGGCCGCCACAAGTACCAGGACAGCATTCGTCGCACAGGCTTGGCACTCAAGGACCCTTCCCTGCCAGGCGCTTCCACTTAGCAGCCCCAAGAGCCTGAGCCAGCCTAG

XM_004851691.1 Coding sequence

Pddc1 Parkinson disease 7 domain containing 1, transcript variant X2

High confidence: 3 potential gene matches
Length: 660 bp    Location: 21751257..21758917   Strand: +
>XM_004851691.1
ATGGCGTCGGAGCGTCTGCCCAGCCGGCCCGCCTGCTTGCTCGTGGCCAGCGGCGCTACCGAAGGTGTGTCAGCCCAGTCCTTCCTCCACTGCTTCACACTGGCCAGTGCCACCTTCAACTTGCAGGTGGCCACCCCTGGGGGGAAGGCCATGGACTTTGTGGATGTGACTGAGAGCAATGCACGCTGGGTTCAAGACTTCCGTCTCAAGGCCTACGCCAGCCCTGCCAAGTTGGAGTCTATCGATGGTGCCCGCTACCACGCCCTCCTGATCCCCAGCTGTCCTGGTGCCCTGGCTGACCTGGCCAACAGTGGGTCCCTGGCCCGCATCCTGCAGCACTTCCGGTCTGAGAGCAAGCCTATCTGTGCCATTGGCCACGGTGTTGCCGCTCTGTGCTGTGCCACCAGCGAGGATAGGTCCTGGGTGTTCCATGGCTACAGCCTGACAGGGCCCTCTGTATACGAGCTCGTCAGGGCCCCTGGCTTCGCCCGGCTGCCACTGGTCGTGGAGGACTTCGTGAAGGACTCTGGTGCTGGCTTTAGTGCCAGCGAGCCTGATGCTGTGCACGTTGTGCTGGACCGCCACCTGGTCACCGGGCAGAATGCCAACTCCACTGTTCCTGCTGTACAGAACCTGCTGTTCCTCTGTGGCAGCCGGTGA

XM_004851698.1 Coding sequence

Deaf1 DEAF1 transcription factor, transcript variant X1

High confidence: 4 potential gene matches
Length: 1713 bp    Location: 21799400..21832266   Strand: +
>XM_004851698.1
ATGGAGGACTCGGACTCGGCCGCAAAGCAGCTGGGCCTGGCCGAAGCAGCGGCGGTAGCGGCCGCGGCCGCTGTGGCGGCGGCGGCCGCGGCGGCGGCGGCGGCCGCGGCCGCAGCAGGGGACGAGGCCGAGGAGCCGGTGCTGAGCAGAGACGAGGACTCAGAGGAAGACGCAGACTCGGAGGCGGAGCGCGAGGCGCGGCGGGTCACGGCCGTGGCGGTGATGGCGGCGGAGCCCGCGCACATGGACATGGGCGCCGAGGCCCTACCAGGGCCCGACGAGGCCGCAGCCGCCGCCGCCTTCGCAGAAGTTACCACGGTGACAGTAGCCAACGTGGGCGCCTCTGCAGACAATGTCTTCACAACCTCGGTGGCAAACGCTGCGTCCATCTCAGGACACGTCCTGTCCGGCAGGACCGCACTACAGATCGGGGACAGCCTGAACACCGAGAAGGCCACACTGATTGTCGTCCACACAGATGGGAGCATCGTGGAGACCACTGGGCTGAAGGGTCCAGCAGCTCCTCTCACCCCAGGCTCTCAGTCTCCTCCAACCCCACTGGCTCCCGGCCAGGAAAAAGGAGCTACCAAGTACAACTGGGACCCGTCAGTGTACGACAGCGAGCTGCCCGTGCGCTGTAGGAACATCAGTGGCACACTTTACAAGAGCAGGCTGGGCTCAGGGGGCCGGGGGCGCTGCATTAAGCAGGGGGAAAACTGGTACAGCCCGACGGAGTTTGAGGCCATGGCAGGAAGAGCCAGTAGCAAGGACTGGAAGAGAAGCATCCGCTATGCGGGCCGGCCGCTTCAGTGCCTCATCCAGGATGGGATCTTGAATCCCCATGCAGCCTCTTGCACCTGTGCAGCCTGCTGTGATGACATGACCCTGAGCGGCCCCATCCGGCTCTTCGTGCCCTACAAGAGGCGAAAGAAGGAGAACGAGCTGCCCACGACGCCCCTGAAGAAGGACTGTCCGAAGAACATCGCGCTGCTCCCGGCCGCCACTGCCACCACCTTCACCGTGACGCCCTCGGGGCAGATCACCACGTCTGGGGCCCTGACCTTTGACCGTGCGTCCACTGTGGAAGCCACTGCCGTAATCTCGGAGAGCCCAGCCCAGGGCGACGTCTTCACAGGAGCCACAGTGCAGGAGGCCAGCGTGCAGCCCCCGTGCCGCGTTGGCCACCCTGAGCCCCACTACCCCGGCTATCAGGACAGCTGCCAGATTGCACCCTTTCCTGAGGCCGCATTGCCGACGTCACACCCCAAGATAGTGCTCACATCCCTGCCCGCCCTGGCCATCCCACCCTCCACTCCCACCAAGCCTGTCTCCCCGGCATCTCTCAGTGGGCTGGAGATGGCAGAGCCGCGGAGCTGGCTCTACCTGGAAGAGATGGTCAATAATTTGCTTAACACGACGCAGCAGCTGAAGACGCTGTTTGAACAGGCCAAGCAGGCCAGCACCTGCCGAGAGGCCGCCGCCCAGGCCAGGACGCAGGCTGACGCAGAGCGGAAGGAGCAGTCGTGTGTGAACTGCGGCCGGGAGGCCCTGAGCGAGTGCACCGGCTGCCACAAGGTCAACTACTGCTCCACGTTCTGCCAGCGCAAGGACTGGAAAGACCATCAGCACATATGTGGCCAGTCGGCAGCTGTCACTGTCCAAGCTGACGAAGTGCACGTCACCGACAGCGTGATTGAGAAGGTCACCGTGTGA

XR_205556.1 Non-coding sequence

Eps8l2 PREDICTED: Heterocephalus glaber EPS8-like 2 (Eps8l2), transcript variant X4, misc_RNA.

Length: 2035 bp     
>XR_205556.1
CATTAGGCAAGTGCTGTACCACTGAGCTGCATCCATAGCTCTTCTTATTTTGAGACAGGGTCTGTGGAAGCTGGGACTCGAGGGCAGGGCTGCCCTGGAGTGCAGTGGCAGGGGTGGGGAGAAGCGGTCTAAAAGTTTTTTTTGAGGGCTTTATCAGTGCACAACCATGACCCCTCAAAGAATCCACTAGGGCAGAATACAGACCGCCCCCCCATGGACTCCTTAGGGTTGGCTGGGGCCCTCAGTCCCCCGGGCTGCCTCTCCTTGGGCCTGGTGGACACAGGAGTGCCGTGCCCACCTGCCTTCCCCCAGCACCTGGCCACGTTCATCATGGACAAGAGTGAGGCCATCACCTCCGTGGACGACGCCATCCGGAAGTTGGTGCAGCTGAGCTCCAAGGAGAAGGTCTGGGCCCAGGAGATGCTGCTGCAGGTCAGCGACCAGTCAGTGCGGCTGCTGGACATCGAGACGCAGGAGGAGCTGGAGAACTTCCCACTGGCCACAGTGCAGCACAGCCAGACGGTGCTCAACCAACTTCGCTACCCCTCAGTGCTGCTCCTGGTGTGCCAGGACTCCGAGCAGAACAAGCCCGACATCCATTTCTTCCACTGTGACGAGGTGGAGGCTGAGCTGGTGCAGGAGGACATCGAGAGTGCACTGGCCGACTGCCGGCTGGGGAAGAAGATGCGGCCGCAGACCCTGAAGGGACACCAGGAGAAGATCCGGCAGCGGCAGTCCATCCTGCCCCCCCTCCAGGGCCCAGCCCCCATCCCCTTCCAGGACCGGGCAGGGGACTCCCCTCATGCCAAGAACCGGGTGGGCCCCCCGGTGCCGCCCCAAGACCCAGGTAGGCCGCGGGGCTGGTCGGGTGGCTCTCGGGGCCTAGGGGCCCTCGTCACAGCTGCTCTGTCCCCAGCAGGCTTCCGTCGCCGGGAATCGCAGGATGAGGAGCCGCGGGCGGTGCTGGCCCAGAGGATAGAGAAGGAGACGCAAATCCTCAACTGCGCCTTGGACGACATCGAGTGGTTCGTGGCCCGGCTGCAGAAGGCGGCAGAGGCTTTCAAGCAGCTGAACCAGCGGAAGAAGGGGAAGAAGAAGGGCAAGAAGGGGCCCGCAGAGGGCGTCCTCACACTGCGGGCGCGGCCCCCCTCCGAGGCCGAGTTTGTCGACTGCTTCCAGAAAACCAAGCTGGCCATCAACCTGCTCGTGAGTGCGACCCTACCTGGGGCCGGCGGCGAGGGTAAAGGGTACAGGTCACCCCATCTGTCCCCCGCTCACTTGCCTTGCCCTGTCCTCGCCCCGCCAGGCAAAGCTGCAAAAGCACATCCAGAACCCCAGCGCCGCGGAGCTGGTGCACTTCCTCTTCGGCCCGCTGGACCTGGTGCCTGGGGCGGGGCGGGGCGGGGCGGGGCCCGAGGCCAGGGGATGGGAGTGGGCGGGGCCAGTTGTGGGTGGGGCCGAGGAACGGGTCTGGGTGACGGGGCAGCGCCAGGCGCGCGTCTGCGTGGCCCTGTCCCCGGCCGCCCAGGGCGTGGTCCCTGCCCCGCGCCCTCCTGCAGAGCTCGGAGCTCGCACCGGCGGCTGTGTGGGCCGCGATCTGACCCGCGCTGTGCCCCAGATCGTCAACACCTGCGGAGGCCCGGACCTCGCGCGCTCGGTCACCAGCCCTGGGCTCTCCCGCGACGCCGTGGGCTTCCTGCGCGGCCATCTGGTCCCCAAGGAGATGTCGCTGTGGGAGTCGCTGGGGGAGACCTGGACGCGGCCCCGGTCCGAGTGGCCGCGCGAGCCGCAGGTGTCCCCCTACGTGCCCCAGTTTCACAGCGGCTGGGAGCCGCCCCTGGACGTGCTGCAGGAGGCGCCCTGGGAGGTGGAGGGGCCCGCGTCGGCGCCAGAGGACCAGCCAGCCCCGGGGCGCCGACTCTCTGCGCGAAGCTCCCCAAAGAACATCCTGGGTGAGCCGACAGCCCCAGGGGATGCCCTGCCGCCAGGCAGCTCCCCCCACACTCACAGGTGTGGTGTCACACGCTTTTAATCC

XM_004851704.1 Coding sequence

Cdhr5 cadherin-related family member 5, transcript variant X3

Length: 2187 bp    Location: 21843506..21849832   Strand: +
>XM_004851704.1
ATGACACCCACATCCCCCCCTGGTGGTGGCCTGGCCTGGCCGCCCTGCGGGAGCCCCCTGGGTGGAGCTGTCAGCAGGGCCATAAAGCAGGGCGGCGCCTGGCAGGGCAAAGGTCGGTCGCGGAGACGGGGAAGGCCTAGCCCTGGACCGCAGACTGCCAGACCCTTCCGGCAGGTGACAGCCACTAAGATGGGGGCCAGGGCCCCACTGTGGGCCTCCCTGCTTCTGCTCCTCGCACTGCCAGGCCAACCCCCGGGGGCAGCAGCCCAGGGCCAGGTCTGCTCGGTGGACAGGACCTTTGTCAGCGTCGAGGAGAACAGCAGTGTTGCTGAGCCCCTGGTGAATATCTCCATCCCGGACGGCCAGCATGTCACCCTGGGGCCTTCGTCCAGCCCCTCCGCCTTCCGGATCCTGGTAGACCAGCTGTTCCTCAACGTGACCCCTGATTACGAGGACAGCACAATGCTGGAGGCTCACCTGGAATGCAGGAGGGGCAGCTCTGTGGTGACGCAGCTGGTGGTGCTGGTGTCCGTGCTGGATGTCAACGACAATGCCCCAGAATTCCCCTTTGAGACCAAGGAGCAGAACGTGTCGGAGGACACCAGAGTGGGCTCCATAGTCATCCCTGAGGACCAACTGAAGGCCTCCGACAAGGACTCGGAGGACGTCTTGTTCTACACCCTCCAGGAAGTGACCCCGAATGCCAGAAGCTTCTTCTCCCTGGTGAGCGCGAACCGCCCTGCCCTGCGGCTGGACCAGGCCCTGGACTTCTACAAGTGGCAGGACATGACTTTGCAGCTGCTGGTCCGGGACACTCAGGAGGAGACGGAGGTGCCCAGCCACAGGGCCACGGCCACCCTGGTCCTGCATGTGCTGCCCGCTGACCTGAGGCCCCCCTGGTTCCTGCCCTGCTCCTACTCAGACGGCTACGTCTGCATCCAGGCCCAGTACCATGGGGCTGTCCCCAAGGGACACACACTGCCATCCCCTCTCATCCTGCATCCCGGGCCCATCTATGCCGTGGATGGGGACCAGGGCATTGACGCGCGCATCATCTACAGCATTGTGGGGGGGAATACAGACAACACTTTTGCCGTTGACAAGGACTCTGGCAACCTCACCATGGCCAAGAGCATCCCCAGCCCCACGACCTTCATCTTGCTGATCAGGGCAGACCAGGCTGACCTGGCCCGATACTCGGTGACCCAGGCCACTGTGGAGGCCCGCTCTGCCACCGGGAACCCACCCCGCTTTCCCCAGAGCCTGTACCGGGGCATCGTGCCGCCCGGCTCTGAGGCCGGTGTGACTGTCCGGGACGCAGCCTCCCCGACCCAGCCTCTGAGGATCCAGGCTCAGGACCCTGACTTCCTGGGCCTCAACTCGGCTGTCACTTACCGAATCACCAACTGCTCTGAGTTCCGGATGGACGGGGAGACCATGCTGACCACTCTGGCGCTGGAGCATGAGGGAGTCTTCTACGCAGAGGTGGAGGCCACAAACACAGCGACCAACGACACAGCCACTGCTGTTGCTGAGATTTGGGTTTCAGAGCAGAAGCCCCCCACCATAGGGACACCAGGAGTCGGCAGCACTGGTGAAGACGAGCCAGGCCGCCCAGAGGAGCTGCGCTTTTCCACGGTGGACATGGCGGTCCTGGGAGGGGTGCTGAGTGCACTGCTGCTGCTGGCCCTCACTGTCCTGGCTGTGCTCCTCTATAAGCACTATGGGCACCGACTGAGCTGCTGTTCTGGGAAAGCTGCGGAGCCCCAGCCCCACGTCTTTGACAACCAGGCCTTCCGGGGTGACCATGGGGCCACCGAGACATCTGTCCCCAGCCCCGAGCCGGGCCCCACGCCTGCGGAGATGCCACCTGCAGCCCTGGACCCTGAGCCCCTGAGCCCCGCACCCCCCAACCCTGAGCCCCTCGCCCCCGAGCCCCCAGTGGCCACTGGAGCCGGGGACAGCCCCTCGGCCGTGAGGTCCATCTTGACCAAGGAGCGGCGGCCTGGGGGTGGCTACAAGGCCGTGTGGTTTGGCGGGGACATCGGGGCAGCGGCTGACGTCGTGGTCCTCAGCGCGCCTGAGGCTGGCCGGGATGGCGAGGGCGACTCTGAGGGCAGCAGCGAGGAGGACGGGGGCCGGGACGGGGGTCCCCGCGACGCATCGGGCAGCTCCACCCGCATCTAG

XM_004851715.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X9

High confidence: 4 potential gene matches
Length: 5001 bp    Location: 21880598..21853707   Strand: -
>XM_004851715.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGCACTGAGGAGCTGTCTGCAGACCCACCTTCTCCTCTGAGGGCCAAGAGGAGGACTCTGTCCCGCTCAGCCCTGCAGTCTCACCAGCCCGTGGCCAGGCCCGTCTCCGTGGGGCTCTCAGGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTGCTTCTGGAGCCCGGGTTCCCTGGCATGGATCCCTCTCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGATCTGCCACAGCAGGAGTGGCGAGATCAACCCTGTGAAGGTGGCCAACCTGGTGAAGGCCTACGTGGACAAGTACAGGCACATGCGCCGGCACCGGAAGGCGGAGGCCTCTGAGGAACCACCTGCCCCAGGGGCCGAGGCCTGA

XM_004851543.1 Coding sequence

Zdhhc13 zinc finger, DHHC-type containing 13, transcript variant X1

High confidence: 4 potential gene matches
Length: 1869 bp    Location: 10556773..10608086   Strand: +
>XM_004851543.1
ATGGAGGGCCCGGGGCTAGGCTCGCAGTGCAGGAATCACAGTCATGGCCCCCACCCTCCCGGATGTGGTCGGCATGGTGTCTGTGCACATGAAAGCAAAGAGCTTGCCAAGGCAAGAGAAATTCTTCCTCTTATAGAGGACTCTAGTAACTGTGACATTGTCAAAGCCACTCAATACGGGATTTTTGAACGATGTAAAGAGTTGGTAGAGGCAGGATATGACGTCAGGCAACCAGACAAAGAAAATGTGTCACTTCTTCACTGGGCTGCTATTAACAACAGGCTGGATCTTGTAAAGTTTTATATTTCAAAAGGTGCTGTTATAGATCAGTTAGGTGGAGATTTAAATTCAACTCCTCTTCACTGGGCCATACGGCAGGGGCATTTACCGATGGTCATATTGTTACTCCAGCATGGTGCGGACCCCACTCTCATTGATGGGGAGGGATTCAGCAGCATTCACCTGGCGGTATTATTTCAGCGTATGCCTATTATAGCATATCTCATCTCAAAGGGGCAGAGTGTGAATATGACAGATGTAAATGGGCAGACACCTCTCATGTTATCTGCTTCCAAAGTAATTGGACCAGAACCAACTGGATTTCTTTTAAAGTTTAACCCTTCTCTCAACGTTGGTGATAAAACACACCAAAACACTCCACTCCACTGGGCAATTACATCAGGAAATGTTAATGCAGTTGATAAACTTTTGGAAGCTGGTTCTAGCTTGGATATCCGAAATGTTAAGGGAGAAACACCTCTTGATATGGCTCTGCACAACAAAAATCAGCTCATTATTCACATGCTAAAAACAGAAGCCAAAATGAGAGCCAACCAAAAGTTCAAACTTTGGAGGTGGCTGCAGAAATGCGAGCTCTTCCTGCTGCTGATACTCTCTGTGATTACCATGTGGGCTGTTGGATACATACTGGACTTCAATTCAGATTCTTGGCTCTTAAAAGGATGTCTTCTAGTAACATTGCTTTTTCTGACATCTTTGTTTCCAAGGTTCTTGGTCGGATATAAGAACCTTGTATACATACCCACAGTCTTTCTACTAAGTTCCATATTTTGGATATTTATGACTTGGTTCATATTATATTTTCCTGATATGGCAGGCCCCCCTTTCTATTTCGTCTTCCTTTTCAGCTTAGTAGCCTTTCTCTACTTCTTCTACAAGACTTGGGCAACTGATCCTGGCTTCACTAAGACTTCTGAAGAAGAAAGGAAAGTGAATATCATCACCCTTGCAGAAACTGGCTGTCTGGATTTCAGAACATTTTGTACATCATGTCTTATAAGAAAGCCATTAAGGTCATTCCATTGCCATGTGTGCAACGCCTGCGTAGCTCGGTATGATCAGCACTGCGTGTGGACTGGACGGTGCGTAGGTTTTGGCAACCATCACTATTACATATTATTCTTGTTTTTCCTGTCTGTAGCATGTGGCTGGATTATGTGTGGATCTTTCATCTATTGGTCAAATCATTGTGCCACAACATTCCGAGAAGATGGATTATGGACCTACCTCAGTCAGATTGTGGCCTGTTCCCCTTGGGTCTTATATATCTTCATGCTAGCAACTTTTCATTTCTCATGGTCAACGTTTTTATTAATGAATCAACTCTTTCAGATTGCTTTTCTGGGCCTGACCTCCCATGAGAGAATCAGCCTGCTGAAGCAGAGCAGGCAGATGAAACAGACACTGTCCCTCAGGAAGACACCATACAACCTTGGATTCAAACAGAACCTGGCAGATTTCTTTCAGTGTGGCTGCTTTGGCTTGGTGAAGCCCTGCATGGTAGATTGGACGTCCCAGTACACCATGGTCTTTCATCCAGCCAAAGAGAAGGTTCTTCGCTCCGTATGA

XM_004851746.1 Coding sequence

LOC101722790 interferon-induced transmembrane protein 3-like

Length: 414 bp    Location: 22129636..22128398   Strand: -
>XM_004851746.1
ATGAGCCACACGGGCCCGGCCTTCTCCCACGCCAACGTCGGCCTCCCCCCAAACTATGAAAAGATCCAGGAGGAGCACGAGGTGGCCGTGCTCGGGGGCACCCATGGCCCTGTTCCCGCAGCCTCCACCGTGATCAACATCCGCAGTGACATCGCTGTACCCGACCACGTGGTCTGGTCCCTCTTCAACACGATCTTCATGAACACATGCTGCCTGGGCTTCATAGCCTTCGCCTACTCCATAAAGTCCAGGGACAGGAAGATGGTGGGCGACGTGATCGGGGCCCAGAGCTACGCCTCCACCTCCAGGTGGCTGAACATCATTGCCACAGTTGTTACCATCATCCTCACTGTTGTCTTCATCATTGTATACTCTGCGGCCATCGTGACACTCTTCCAACGCTTGTCCCAGTGA

XM_004851714.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X8

Length: 5004 bp    Location: 21880598..21853707   Strand: -
>XM_004851714.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAAGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGCACTGAGGAGCTGTCTGCAGACCCACCTTCTCCTCTGAGGGCCAAGAGGAGGACTCTGTCCCGCTCAGCCCTGCAGTCTCACCAGCCCGTGGCCAGGCCCGTCTCCGTGGGGCTCTCAGGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTGCTTCTGGAGCCCGGGTTCCCTGGCATGGATCCCTCTCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGATCTGCCACAGCAGGAGTGGCGAGATCAACCCTGTGAAGGTGGCCAACCTGGTGAAGGCCTACGTGGACAAGTACAGGCACATGCGCCGGCACCGGAAGGCGGAGGCCTCTGAGGAACCACCTGCCCCAGGGGCCGAGGCCTGA

XM_004851713.1 Coding sequence

Phrf1 PHD and ring finger domains 1, transcript variant X7

Length: 5070 bp    Location: 21880598..21854194   Strand: -
>XM_004851713.1
ATGGATGATGACAATCTGGACAAGCTCATGGCCCAAAGCCCAGAGCCAGATGGATGCCCCCGTGTTGGCGCTACAGACCTGGCCAACAGTTCTGAAGAGAGCAGCGATGGTCAAAGCGGGTATTCTGAGGATGAGACGGGCAGTGAGCACGGAGAGGACACAGACGGAGAGGACGAGGAGGGGTCATCTGAGGAGGAAGACCCAGGCGATAGATCTGGTTCTGAAGATTCTGAAGATGAAGTAGAAGCTTCAAAGGCAGCTGAGGATCCTCAGGGGAAGCTGGAAGCTGGTGGCATACTCACTTCTGATGAAGATGCAGAGAGCTGCCCAATTTGTCTCAATGTGTTCAGAGACCAGGCTGTGGGCACACCGGAGACCTGCACCCACTACTTCTGCCTGGACTGCATCGTCGAATGGTCCAAGAATGCAAACTCTTGTCCAGTTGATCGAACGATATTTAAATGTATTTGTATTCGAGCTCAGTTCGGTGGTAAAATCTTAAAGAAGATGCCAGTGGAGAACACCAGAGCCTTCGAGGAGGAGGAGGAGGAGGACCCCACCTTCTGTGAGGTGTGCAGCAGGAGTGACCATGAGGACCGCCTCCTACTCTGTGATGGCTGTGATGCAGGGTACCACATGGAGTGCCTGGACCCCCCCCTGCAGGAGGTGCCCGTGGACGAGTGGTTCTGTCCAGAGTGTGCCACGCCGGGCACTGGCCCTGCTGCTGATGTGACTCCTGTGAGTGAGGAGGAAGTCTCCCTGCTCCTGGCCAACGTGGTGCCCACCACCAGCAGGCTGCAGCCCCGCATGGGCCGGATCCGTGCCATTGCCAGGACCAGGCAAAGTGAGAGAGTGAGGGCGACAGTGAACCGGAACCGGATATCCACAGCCAGGAGGGTTCAGCATGTGCCAAGGTACCTGATGTCCTCCTTGCTGGATGAGACCATTGAAGCGGTGGCAACTGGTCTGAGCACGGCCGTGTACCGACGCCCCCTGACACCTTGGACCCCCACCAGAAGGAAAAGGAAGACAGGAAGACGGAAGAAAGCGCCAGGAAGAAAGAAAACCCAGGCAAGGTCATCTGGGAAAAGTAAGAGCATAGGTACAAGATCCAAGAAACGGCAGCATCGCACGAAGAAGAGGACAGGGAAGAAGATGAAGAGGGAAGTCACAGCTCGCTCTCGTATCGCTCGGACACTGGGCCTCCGCCGGCCAGCCCAGGGCAGCTGCATGCCCTCTGTGTGCCGGCCTGCGGACCCTTCCCTAGGACTGATGCGGGCGGATATCGGAGCAGCAGCTCTTTCGCTGTTCGGGGACCCCTACGAGCTGGACCCCTTTGACAGCACTGAGGAGCTGTCTGCAGACCCACCTTCTCCTCTGAGGGCCAAGAGGAGGACTCTGTCCCGCTCAGCCCTGCAGTCTCACCAGCCCGTGGCCAGGCCCGTCTCCGTGGGGCTCTCAGGGAGGCAGCTCCCCACTGCGGTCCCAGAGCCAGCCGTGGAGGGAGCCCCTGTCCCTGACCTGCTGGGCAGCATCCTGTCGAGCCAGAGCCTCCTGATGATGAGCAGTGCCGACATCGTCATCCACCGAGACGGCTCCCTGAGCGCCAAGCGGGCAGCTCCAGTCTCTCTTCAGCGAAAGCCAGGGCGTCTGTCCAGAAGGGAAGAAGCATCCAGGCTTGGGGATGGCCTGCAGCCTAGAGTGGCCCCCTCCGGGAGCCCAGCTGGGAGACTCAGGGAAGACCAGCTGCAGGGCCCTGGGCTGAGCTGTGGGAGCGGGCCTACTCTTCCTCGTGTCTCTGCCCTCATGGACCCCCCTATGAAGCAGGACTTGCCACCAGCACCTGGGTCTGGTCAGCCTCAGAGCCTGGCAGATGGCAGTGGGCCTGGCCCACAGCAGAGTGGTGCGCCCCAGTGTAATGGCATCAGTAGTCAGACTGTGTCTCTTGGGTCTGCCTCAGCTAAGTGCTCCAGCAGCCATTCTAACTCTCCACCTAAAAGGGCAGCCCCAGGACAGGCCCCGCAACCAGCTCCCAGGAGAGCTGACATCTCAGAGCTGCCCAGGATACCAAAGATCCGAAGGGAGGGTGGTGGCAGCAAACAGGACACAGCCCCAGCCCACAGACAGAGCATTGAGATCCCCAGCACCTGCATCAGCCGCCTGACAGGCAGGGAGGGCCCTGGGCAGCCGGGGCAAGGCCGGGCAGAGGGCGAGCCCAGCAGCAGGGGTCCCCAGGAGCCCAGCTCCCACACAGGCACCTCCCGGCCTCCCGCCCGCAGCTCTCACGGCAGCCTGGCCCCACTGGGGACTTCGAGAGGGAAGGGTATTGGGTCAACCTTTGAGAGCTTCCGGATCAACATCCCGGGAAACACAGCCCAGTGCAACCGGCTTTCTAGCCCTGGTTTCTGTAACACCTTCCGGCCTGTTGACAGCAAGGTACAGAGGAAGGAGAGCCCTTCACCCCTCTTCTCCATCAAGAAGACCAAGCAGCTCAAGAGTGAGATCTATGATCCCTTTGACCCCACAGGCTCCGACTCGAGCCCTCCCAGCAGCAGCCCCGAGAGTCTCGGGCCTGGCCTGCTGCCTTCTGAGATTACAAGAACCATCTCCATTCACAGCCCCAAGGCCCCTGCGTTTCAGGCTGTGCGCTGTGTCACCTCCTACACTGTGGAAGGCGTCTTCAGGGAGGAGCCTGAGTCCCCCGGTGAGACTGCGTCTCAAGCGTGCAAGCTCCGGGCCAAGGGGGCTGCCGAGGGCGCCTCTGCCATAGAGCGAGAGGGGCTGGGGGAGGAGCGGCCCATGGAGAGCCAGGGCCTGGCGCCCCGGGGACAGAAGCCATCCCTGCTGGACCCTTGGGACGATGAGGACGAGGCGTCCCACAGTGCTTTCTTCAGCTCTGAGGAGCGGACAGTGACCTGTGTGACTGTTGTGGAGCCAGACAGCCCACCTAGCCCAGATGCCCCGCAGGCCACCACCCACAGGATCGTGGAGCTGCGGGCCCCCTCCCGCTCCCACTCCCGCTCCAGCTCCCGGGGCAGGAAGAGAACCAAGAAGAAAAGGGCCAGGGAGCATCGGAGGTCACGCTCCGGGACACGCTCAGGCTCCAGGGACAGGGCCTCGCACTCTGTGTCGCCAGCAGTGGATGAGCACTCCAGGAGGCACCGGGCCAAGGCCAAAGGCCGGAGGTCCTCCAGTGACCGAGCCAGCAGCCAGGAGAGAGTGAAGCGGAGGAAGACCAAGGACCGGGGTAGGGATCAGAGATGGAGCTCGTGGAGCCGGGACCGGAGGAATTCCAGGTCACGCTCGGGCAGCCTGGGCAGCTCCTCCTGTGAGCGCCGTGAGAGCAGAAGGAAGAAGAGGCACCATTCAAGGTCCCGGTCTCGAGGGCGGGACTGCTCCCCCCTTAGCAGCCTGGAAAGGGCCCGGCGGCACAAGCGCCCACGGGAGAGGAGCCGTGAGCAACTGGACAAGAAGGAGAGCGTAGCCCAGCCTCGAGAGAGGAGGAAGTGGATGTCACGCTCACCCAGCTCTGAGCACAGGGCGCGGGAGCCCCAGTGGCTGAGTGCCCATGAGACGCAGCCCCTCTCCCCAGAGAAGAAGGGGACTTTGAAGGAACCCTCCCCAGTGCCCCCTTCCCAAGAGCACCCAAGGCAGGATGGAGACCACCAGGGTGGGCCGCCAGCCCTTGCAGAGATGTGCATCACACCCGAGGTGGCCCAGGCTGAGCAGGCCCTCCCGCCTACCCCCGTTCCTGTCCCCGTCCCTGCCCCTGAGGTGCTGGCCCAGTGTGCACCTGAGGACCTGGATTATGGTGACTCCGTTGAGGCGGGCCACATCTTTGAGGACCTTTCAAGTGAAGCTGTCTTCATGCAGTTGGATGACATGAGCTCACCTCCTTCCCCAGAGAGTACAGACTCCTCCCCAGAGCGGTCCCTTCCGTCAAACCCCACATTGCCTCAGACTGGCCTGCCACATGATGCCACCCTATCCACCATCCAGAGGGACATGTCGCTGATCCATGCTGAAGGCATTTCGCAGCCCCCATTCCAGCCAGAGGGTCTTCCAGGGCAGCACCCACCCAGGCAGGACATGGCAGAGATGGCTGCCACAGTTCCTGGCCCCCTGGCTGTGCTGCCCCAGGGCCTGGATGGCCCCTTGGTGAGCGGGAAGGCTCCTGAGGCAGCCAGGGCTGAGGAGGCAGGGGGACAGGCACCACTGCTGCGGTCCCGAGCCCTGGTGAAGAGGGTCACCTGGAACCTTCAGGAGGCTGAGGGCAGTGCCCTGGCCCTGAACAGGGTCCCAAGGACACCACTTCACAAGCCACAGAAGTCCTGGGAAGAAGCCTGGGACCCTGAGGACGGGACCCCTGTGGGGGCCAAGCATGCACTGTTCTCTGAGACACCACCTTCTGGCCAGGTGCTTCTGGAGCCCGGGTTCCCTGGCATGGATCCCTCTCAGGTTTACAGCCCCAACATGCTTCCTCCCCCGGCTCAGCCCCCTGGTGTCCCACCCTATGTGCTGGTCAGCCAACCTTCGGTCCAGTTCCTCCTGCAGGGCAGTGTGCCCTTGGTGAGCTGTGGACCAGCACAGAGCTTGACCCCAGCGCCCACCGTGCTGGCCACAGCCTCAGAGCCGGCCAGCCAGGCCACGACCACCGCCACCGCCACCACCAACTCAGAGGAGAAAACCACCATTCCCAGGCCGGCTGCAGAAAAGACCAAGAAGGAGGAGTACATGAAGAAGCTGCATGTGCAGGAGCGGGCAGTAGAGGAGGTGAAGCTGGCCATCAAGCCCTTCTACCAGAAGCGGGAGGTGACCAAGGAGGAGTACAAGGACATCCTGCGCAAAGCCGTGCAAAAGGTAGGCTGTGGGGGGGTTATGCCTGTGCATGCTGCAGATCTGAGGCCGGGAGCATCGTGTGCACGGCCCAGCAGCGCTACCCATTTTGGGAGGGTGCACTGGGGCCCAGCCAGCAGCAGTGGCCTGAGGTCCACCCATCTTCTTGCGCCCATTAAAAAGACTGAGGTGACCGAGAGGGTGTTTAGGGTTGCCCGGTCCACACCCAGCTGA

XM_004851717.1 Coding sequence

Rassf7 Ras association (RalGDS/AF-6) domain family (N-terminal) member 7, transcript variant X2

Length: 1191 bp    Location: 21891078..21888499   Strand: -
>XM_004851717.1
ATGGTTCTGGGGCTGTCCACCATGGAGCTGAAGGTGTGGGTGGATGGCATTCAGCGGGTGGTCTGTGGGGTCTCAGAGCAGACCACCTGCCAGGAAGTGGTCATTGCATTAGCCCAAGCCATAGGTAAGTCCCCTAGTTGCCAATGGGCACAACAGGTGGGACTGTGGTGGGGCCACCCCATTTTTTCCCCTGCTCCAGTTGACCCTGTCCCCCTGTCCCCAGGCCAGACAGGTCGCTTTGTGCTCGTGCAGCGTCTTAAGGAGAAGGAACGTCAGCTCTTGCCACAGGAGTGTCCAGTGGGTGCCCAGGCCACCTTCGGACAATTTGCCAACGATGTCCAGTTTGTCCTGAGGCGGACAGGGCCCAGCCTGGCCGAAAGGCTGTCCTCAGACAGCTGTCCACCCCTAGAACAATGCCCAGTGCGTGCCAGCCTTCCCTCAAAACCATGGGCAACTCCAGGCCATGAATCCCACAGGGCACTCACCTTTAGCCTGGGGTGTCCCAGGTTAGCCCCTAGCTCCTCACCCTCTGAGCCTCCAGCCCCTGTAGCACCCAACCTAGGCTGCTTTGAAGACCTCCAGGGCATGGAGCTCAGGGTGCAGAGGAACGCAGAGGAGCTGGGACATGAGGACTTCTGGGAGCAGGAGCTAAGGCGGGAAGAGGCCAGGGAGCGAGAAGGGCAGGCACGGCTGCAGGCACTGAGCGCAGCCACTGCAGAGCACGCTGCCCGGCTGCAGGCCCTGGATGCTCAGGCTCGCACCCTGGAGGCTGAGCTGCTGCTGGCCGCTGAGGCCCCTGGGCCCCCCTCTACCACGGCATCTGCCACTGAGCACCTGCGCCAAGACTTGGCCGTCCAGGAGCAGCAGAGCACAGAGGTGCAAAGCAGCCTGGCCCTGGTAAGCCGGGCTCTGGAGGCAGCTGAGCGCACACTGCAGGCTCAGGTACAAGAGCTGCAGGAACTGAACCGGGAGCTGCGTCAGTGCAACCTACAGCAGTTCATCCTGCAGACGGGGGCTGCGCTGCCTCCACCCCCACAGCCAGACAGGGCCCCCCCTGGCACACAGGAGAGCCTTCTGCCTTCAGCTGAAGAAGACACCTTCCAGGGAGACCCCCAGCAGCCAATCCCAGTGCCCACCCTGAGTCTGGAGGGTAGGTCTCCCCCGCTACCCTGTGGCATGGGCCCTTCCTAG

XM_004851719.1 Coding sequence

Rassf7 Ras association (RalGDS/AF-6) domain family (N-terminal) member 7, transcript variant X4

High confidence: 4 potential gene matches
Length: 1113 bp    Location: 21891077..21888499   Strand: -
>XM_004851719.1
ATGGTTCTGGGGCTGTCCACCATGGAGCTGAAGGTGTGGGTGGATGGCATTCAGCGGGTGGTCTGTGGGGTCTCAGAGCAGACCACCTGCCAGGAAGTGGTCATTGCATTAGCCCAAGCCATAGGCCAGACAGGTCGCTTTGTGCTCGTGCAGCGTCTTAAGGAGAAGGAACGTCAGCTCTTGCCACAGGAGTGTCCAGTGGGTGCCCAGGCCACCTTCGGACAATTTGCCAACGATGTCCAGTTTGTCCTGAGGCGGACAGGGCCCAGCCTGGCCGAAAGGCTGTCCTCAGACAGCTGTCCACCCCTAGAACAATGCCCAGTGCGTGCCAGCCTTCCCTCAAAACCATGGGCAACTCCAGGCCATGAATCCCACAGGGCACTCACCTTTAGCCTGGGGTGTCCCAGGTTAGCCCCTAGCTCCTCACCCTCTGAGCCTCCAGCCCCTGTAGCACCCAACCTAGGCTGCTTTGAAGACCTCCAGGGCATGGAGCTCAGGGTGCAGAGGAACGCAGAGGAGCTGGGACATGAGGACTTCTGGGAGCAGGAGCTAAGGCGGGAAGAGGCCAGGGAGCGAGAAGGGCAGGCACGGCTGCAGGCACTGAGCGCAGCCACTGCAGAGCACGCTGCCCGGCTGCAGGCCCTGGATGCTCAGGCTCGCACCCTGGAGGCTGAGCTGCTGCTGGCCGCTGAGGCCCCTGGGCCCCCCTCTACCACGGCATCTGCCACTGAGCACCTGCGCCAAGACTTGGCCGTCCAGGAGCAGCAGAGCACAGAGGTGCAAAGCAGCCTGGCCCTGGTAAGCCGGGCTCTGGAGGCAGCTGAGCGCACACTGCAGGCTCAGGTACAAGAGCTGCAGGAACTGAACCGGGAGCTGCGTCAGTGCAACCTACAGCAGTTCATCCTGCAGACGGGGGCTGCGCTGCCTCCACCCCCACAGCCAGACAGGGCCCCCCCTGGCACACAGGTCAGAGCAGTTCTGGGAGTGGCAGAAGGGTGGGGCCCCACTGCCATACAGCTGACCTTCGCTCTCCACAGGAGAGCCTTCTGCCTTCAGCTGAAGAAGACACCTTCCAGGGAGACCCCCAGCAGCCAATCCCAGTGCCCACCCTGA

XM_004851734.1 Coding sequence

Sigirr single immunoglobulin and toll-interleukin 1 receptor (TIR) domain, transcript variant X5

High confidence: 4 potential gene matches
Length: 1425 bp    Location: 22007737..22015336   Strand: +
>XM_004851734.1
ATGGCAGCAGGTGAGCGGCTGTCGCAACTCAGACCTACCGAGCCTCTGACTTGTGTAGGCACCCTGTCCAACCAGTCACAAGGACAGAGACAGGCCCTGCAGAGCCCTTGGTGGACCCGTCTGCTCTGTCAAGGAGCCCCATCGAGCAGAGGTGGCCCCAGAGTCCAGCCTGCCTTGAAGAGTCCCCAGCCAGAGTCCATGGCAGGTGTCTGTGACAGGGCCCCAGACTTCCTCTTCCCAGCTGAGGACCACGCCCTAGGACCTTCCCTGGGCAGTGCAGTTGCTCTGAATTGCACAGCTTGGGTGGTATCTGGGCTCCACTGCCCCCCACCTTCAGTCCAGTGGCTAAAAGATGGGCTTCCACTGGGCAACGTAAACCACTACCATGAGGATTCCTGGGTCAAGACCAACTTCTCAGAGGTGCTTGTGTCCAGTGTCCTGTGCATCAATGTGACCAATGCTGAGGACTATGGGACCTTCACCTGCTCTGTCCGAAACGTCAGCTCCTTCTCCTTCAGTCTTCAGAGAGCTGGCCCCGCAGGCCACGTGGCTGCGGTGCTGGCCGCCCTCCTGGTCTTGCTGGTCCTGCTGCTCGCGGGGCTGCTCTATGTGAAGTGTCGCCTCAACGTGCTGCTCTGGTACCAAGACACGCATGGGGAGGTGGAGATGAACGACGGGAAGCTCTACGACGCCTTCGTCTCCTACAGCGACTGCCCGGAAGACCGCAAATTCGTGAACTTCATCCTGAAGCCGCAGCTTGAGCGGCGTCGGGGTTACAAGCTCTTCCTGGACGACCGCGACATTCTGCCGCGCGCAGAGCCCTCGGCCGATCTCCTGGTGAACCTGAGCCGCTGCCGGCGCCTCATCGTGGTGCTTTCGGACGCCTTCCTGGGCCGGGCCTGGTGCAGCCACAGCTTCCGGGAGGGCTTGTGTCGGCTGCTGGAGCTGACGCGCAGACCCATCTTCATCACCTTTGAGGGCCCGCGGCGCGACCTGGCGCACCCTGCGCTGCACCTGCTGCGCCAGCACCGCCACCTGGTCACCCTGCTGCTCTGGAGGCCGGGCTCTGCGATGGCGTCCTCTGATTTTTGGAAAGAGCTGCAGCTTGCACTGCCGCGGAAGGTGCGGTACAGGCCAGTTGAGGGGGACCCCCAGACCCACCTTCAGGATGACAACGACCCCATGCTGATCATGCGAGGCCGTGCCGCTGAAGGCCGGGCTCTGGAGCAGGAGCTGGACCCTGATCCCGAGGGAGACCTGGGTGTACGAGGGCCTGTCTTTGGGGAGCCACCAGCCCCACCGCATGCCAGTGGGGTTTCGATGGGAGAGGGCCATAGCAGCGAGATGGACGTCTCCGACCTTGGCTCCCGAAACTACAGTGCCCGCACAGATTTCTACTGCTTGGTGTCTGAGGAAGACGTGTAG

XM_004851718.1 Coding sequence

Rassf7 Ras association (RalGDS/AF-6) domain family (N-terminal) member 7, transcript variant X3

Length: 1182 bp    Location: 21891077..21888499   Strand: -
>XM_004851718.1
ATGGTTCTGGGGCTGTCCACCATGGAGCTGAAGGTGTGGGTGGATGGCATTCAGCGGGTGGTCTGTGGGGTCTCAGAGCAGACCACCTGCCAGGAAGTGGTCATTGCATTAGCCCAAGCCATAGGTAAGTCCCCTAGTTGCCAATGGGCACAACAGGTGGGACTGTGGTGGGGCCACCCCATTTTTTCCCCTGCTCCAGTTGACCCTGTCCCCCTGTCCCCAGGCCAGACAGGTCGCTTTGTGCTCGTGCAGCGTCTTAAGGAGAAGGAACGTCAGCTCTTGCCACAGGAGTGTCCAGTGGGTGCCCAGGCCACCTTCGGACAATTTGCCAACGATGTCCAGTTTGTCCTGAGGCGGACAGGGCCCAGCCTGGCCGAAAGGCTGTCCTCAGACAGCTGTCCACCCCTAGAACAATGCCCAGTGCGTGCCAGCCTTCCCTCAAAACCATGGGCAACTCCAGGCCATGAATCCCACAGGGCACTCACCTTTAGCCTGGGGTGTCCCAGGTTAGCCCCTAGCTCCTCACCCTCTGAGCCTCCAGCCCCTGTAGCACCCAACCTAGGCTGCTTTGAAGACCTCCAGGGCATGGAGCTCAGGGTGCAGAGGAACGCAGAGGAGCTGGGACATGAGGACTTCTGGGAGCAGGAGCTAAGGCGGGAAGAGGCCAGGGAGCGAGAAGGGCAGGCACGGCTGCAGGCACTGAGCGCAGCCACTGCAGAGCACGCTGCCCGGCTGCAGGCCCTGGATGCTCAGGCTCGCACCCTGGAGGCTGAGCTGCTGCTGGCCGCTGAGGCCCCTGGGCCCCCCTCTACCACGGCATCTGCCACTGAGCACCTGCGCCAAGACTTGGCCGTCCAGGAGCAGCAGAGCACAGAGGTGCAAAGCAGCCTGGCCCTGGTAAGCCGGGCTCTGGAGGCAGCTGAGCGCACACTGCAGGCTCAGGTACAAGAGCTGCAGGAACTGAACCGGGAGCTGCGTCAGTGCAACCTACAGCAGTTCATCCTGCAGACGGGGGCTGCGCTGCCTCCACCCCCACAGCCAGACAGGGCCCCCCCTGGCACACAGGAGAGCCTTCTGCCTTCAGCTGAAGAAGACACCTTCCAGGGAGACCCCCAGCAGCCAATCCCAGTGCCCACCCTGAGTCTGGAGGTCGCCACCATGAGGCAGAGCTCCTGGAGGTAG

XM_004851716.1 Coding sequence

Rassf7 Ras association (RalGDS/AF-6) domain family (N-terminal) member 7, transcript variant X1

Length: 1212 bp    Location: 21891048..21888499   Strand: -
>XM_004851716.1
ATGGTTCTGGGGCTGTCCACCATGGAGCTGAAGGTGTGGGTGGATGGCATTCAGCGGGTGGTCTGTGGGGTCTCAGAGCAGACCACCTGCCAGGAAGTGGTCATTGCATTAGCCCAAGCCATAGGTAAGTCCCCTAGTTGCCAATGGGCACAACAGGTGGGACTGTGGTGGGGCCACCCCATTTTTTCCCCTGCTCCAGTTGACCCTGTCCCCCTGTCCCCAGGCCAGACAGGTCGCTTTGTGCTCGTGCAGCGTCTTAAGGAGAAGGAACGTCAGCTCTTGCCACAGGAGTGTCCAGTGGGTGCCCAGGCCACCTTCGGACAATTTGCCAACGATGTCCAGTTTGTCCTGAGGCGGACAGGGCCCAGCCTGGCCGAAAGGCTGTCCTCAGACAGCTGTCCACCCCTAGAACAATGCCCAGTGCGTGCCAGCCTTCCCTCAAAACCATGGGCAACTCCAGGCCATGAATCCCACAGGGCACTCACCTTTAGCCTGGGGTGTCCCAGGTTAGCCCCTAGCTCCTCACCCTCTGAGCCTCCAGCCCCTGTAGCACCCAACCTAGGCTGCTTTGAAGACCTCCAGGGCATGGAGCTCAGGGTGCAGAGGAACGCAGAGGAGCTGGGACATGAGGACTTCTGGGAGCAGGAGCTAAGGCGGGAAGAGGCCAGGGAGCGAGAAGGGCAGGCACGGCTGCAGGCACTGAGCGCAGCCACTGCAGAGCACGCTGCCCGGCTGCAGGCCCTGGATGCTCAGGCTCGCACCCTGGAGGCTGAGCTGCTGCTGGCCGCTGAGGCCCCTGGGCCCCCCTCTACCACGGCATCTGCCACTGAGCACCTGCGCCAAGACTTGGCCGTCCAGGAGCAGCAGAGCACAGAGGTGCAAAGCAGCCTGGCCCTGGTAAGCCGGGCTCTGGAGGCAGCTGAGCGCACACTGCAGGCTCAGGTACAAGAGCTGCAGGAACTGAACCGGGAGCTGCGTCAGTGCAACCTACAGCAGTTCATCCTGCAGACGGGGGCTGCGCTGCCTCCACCCCCACAGCCAGACAGGGCCCCCCCTGGCACACAGGTCAGAGCAGTTCTGGGAGTGGCAGAAGGGTGGGGCCCCACTGCCATACAGCTGACCTTCGCTCTCCACAGGAGAGCCTTCTGCCTTCAGCTGAAGAAGACACCTTCCAGGGAGACCCCCAGCAGCCAATCCCAGTGCCCACCCTGA

XM_004851726.1 Coding sequence

Ptdss2 phosphatidylserine synthase 2, transcript variant X2

Length: 1719 bp    Location: 21988617..21962718   Strand: -
>XM_004851726.1
ATGACCACCCTTTCACAGGCAATGGGCTCCTATCACAGTATCTCGGGATCGCAGCCACGAACAGCGGACACCAAGCTCCGAGAACGGTGTTCGTGTCTCTCCGGCGGCCGGGACTACGTGTGGGAGCCGACCAAAGGCAGAAAGTTTTGCGCCGGGGAGACGCCGGAAGCATACGGACGGCAGTCACCTAGCAACCAGACGGCGTCCTTCCCGGCAGGCCCTGCGCCCGGCACCCAGCGTCCCACGCGGCTCAGACGAGCACTACCAGTCCCACAATGCCCCGCAGTCCCGCCCCTCTCTGCGGAGACCCCGCGAGGCTGCGCCGCGACCCCTGCCCCGCGAGCCGCCTGCCAGTCTGTGCGGGCGGGCCGCCATGCGGAGGGCCGAGCGCAGAGCTGCTGGGGGTTTGCGGTCCGGGTCTCCGCGACCCGAGGGCCGCCGCAGCACCGAGTCCGAAGTCTACGACGACGGCACCAACACTTTCTTCTGGTGAGGGCCGGAGACGGGAGGGGGCGCCCTGCCCCAGGCGAGGGGCGAGCCCACACCTTAACTGTGCTGTTCATCCTCACCTGTGCACTGGGCTATGTGACTCTCCTGGAAGAAACACCGCAAGACACAGCCTATAACACCAAGAGAGGTATTGTGGCCAGTATTTTGGTTTTCTTATGTTTTGGAGTCACACAAGCCAAAGATGGGCCATTTTCCAGACCTCATCCAGCTTACTGGCGATTTTGGCTTTGCGTTAGTGTGGTCTACGAGCTGTTTCTCATCTTTATCCTTTTCCAGACAGTGCATGATGGCCGGCAGTTCCTAAAGTATGTGGATGCCAGGCTGGGGACACCATTGCCCGAGAGGGACTACGGAGGGAACTGCCTCATCTATGACCCAGACAACAAGACCGACCCCTTCCACAACATCTGGGACAAGCTGGACGGCTTTGTTCCTGCCCACTTTATTGGCTGGTACCTAAAGACCCTCATGATCCGGGACTGGTGGATGTGCATGATCATCAGCGTGATGTTCGAGTTCCTTGAGTACAGCCTGGAGCACCAGCTGCCCAACTTCAGCGAGTGCTGGTGGGACCATTGGCTCATGGATGTGCTGGTCTGCAACGGGCTGGGTATCTACTGCGGCATGAAGACACTGGAGTGGCTGTCTCTGAAGACGTACAAGTGGCAGGGTCTCTGGAACATCCCCACCTACAAGGGCAAGATGAAGCGCATAGCCTTCCAGTTCACGCCCTACAGCTGGGTCCGCTTCGAGTGGAAGCCAGCCTCCAGCCTGCGCCGCTGGCTGGCCGTGTGTGGCATCATCCTTGTGTTCCTGCTGGCGGAGCTGAACACCTTCTACCTGAAGTTCGTGCTGTGGATGCCCCCCGAGCACTACCTGGTCCTGCTGAGGCTGGTCTTCTTCGTGAACGTGGGCGGCGTGGCCATGCGAGAGATCTATGACTTCATGGATGATTTGAAGCCCCACAAGAAGCTGGGCCAGCAGGCCTGGCTAGTGGCAGCCATCACGGTCACTGAGCTGCTCATCGTGGTGAAGTACGACCCGCACACGCTCACCCTGTCCCTGCCCTTCTACATCTCCCAGTGCTGGACCCTCGGCTCCGTCCTGGTGCTCACCTGGACCATCTGGCGCTTCTTCCTGCGGCTCCTCGGGGTGATGGCGTCAGGGGTCCTCCAGCCCTGCACGGGAGCTGCAGTGCACAGGTGGTGA

XR_205558.1 Non-coding sequence

Ptdss2 PREDICTED: Heterocephalus glaber phosphatidylserine synthase 2 (Ptdss2), transcript variant X6, misc_RNA.

Length: 1708 bp     
>XR_205558.1
ATGACCACCCTTTCACAGGCAATGGGCTCCTATCACAGTATCTCGGGATCGCAGCCACGAACAGCGGACACCAAGCTCCGAGAACGGTGTTCGTGTCTCTCCGGCGGCCGGGACTACGTGTGGGAGCCGACCAAAGGCAGAAAGTTTTGCGCCGGGGAGACGCCGGAAGCATACGGACGGCAGTCACCTAGCAACCAGACGGCGTCCTTCCCGGCAGGCCCTGCGCCCGGCACCCAGCGTCCCACGCGGCTCAGACGAGCACTACCAGTCCCACAATGCCCCGCAGTCCCGCCCCTCTCTGCGGAGACCCCGCGAGGCTGCGCCGCGACCCCTGCCCCGCGAGCCGCCTGCCAGTCTGTGCGGGCGGGCCGCCATGCGGAGGGCCGAGCGCAGAGCTGCTGGGGGTTTGCGGTCCGGGTCTCCGCGACCCGAGGGCCGCCGCAGCACCGAGTCCGAAGTCTACGACGACGGCACCAACACTTTCTTCTGGTGAGGGCCGGAGACGGGAGGGGGCGCCCTGCCCCAGGCGAGGGGCGAGCCCACACCTTAACTGTGCTGTTCATCCTCACCTGTGCACTGGGCTATGTGACTCTCCTGGAAGAAACACCGCAAGACACAGCCTATAACACCAAGAGAGGTATTGTGGCCAGTATTTTGGTTTTCTTATGTTTTGGAGTCACACAAGCCAAAGATGGGCCATTTTCCAGACCTCATCCAGCTTACTGGCGATTTTGGCTTTGCGTTAGTGTGGTCTACGAGCTGTTTCTCATCTTTATCCTTTTCCAGGTAAGTGGCTTTTCTTGGTCAGATAAACTGGGAATAGATGACAGCAGGCTTTGCACACTTGGCCCCAGAGCACTCGCAGAAACCAGGCTGGACCCATTAGGGCCAGGATGCGGGTGCAGGTGGGACAGGCTATTGTGCCCAGACAAAGACAGGACAGTGGGCCAGGTTGGGAGTCCGGTGCATGTGAGAGCCAGCTGTTGCTGGGTGTCTGGCTCTTTGGTACTTTCTCCTACCTGGCTTCTGTTCTGCAGGAGGCCCAGTGAAGTTGGGAGCTTACCTCCTTCCGGTCGTCTTGAGCCAGGGCGTGCTACCCTAAGAGCTGGTTTGCTGAGCTGTACTCTGCTTTGCCGAAGAAACACACACCTTGGTGGTCTTGGGCCACAGAGTGCTCTCCTGAGAGACCTCAAAACCTGCTGGTCCTCAGCTGGTGGCCTCCTGAGGGCACCTTCTTTGCTGAGGTTGTGTCCCAGAAGTTTCCTTTGACTGAGGCTGGAAGGAGCTGCCGGCCTGAGCTGATGCCTGCCTGAGCGTGAAGACCGTGTCCTCCCTCACTTCAGAGGAGACAGCGGCACACCTCCAGGGTGGCCTCAGGGGTAGCAGCATGAGGCTGCCCTTGTTCACCTAGGGATCCAAGTCCTGTGTCCCCTGCCTGATCTGCTCTGCCAGCTCCCAGGGCTCAGACAGTGCATGATGGCCGGCAGTTCCTAAAGTATGTGGATGCCAGGCTGGGGACACCATTGCCCGAGAGGGACTACGGAGGGAACTGCCTCATCTATGACCCAGACAACAAGACCGACCCCTTCCACAACATCTGGGTAAGGGTGCCACAGGAGCTGTCACCCATGTGTGGGGCTCATTTGAGGGGCTTCCTGCTCTCTGTTGAGGTGGGTCACCCCAGGGGCCCCCAGCACACAAGCAAGAC

XM_004851729.1 Coding sequence

Ptdss2 phosphatidylserine synthase 2, transcript variant X5

Length: 1203 bp    Location: 21988617..21965197   Strand: -
>XM_004851729.1
ATGACCACCCTTTCACAGGCAATGGGCTCCTATCACAGTATCTCGGGATCGCAGCCACGAACAGCGGACACCAAGCTCCGAGAACGGTGTTCGTGTCTCTCCGGCGGCCGGGACTACGTGTGGGAGCCGACCAAAGGCAGAAAGTTTTGCGCCGGGGAGACGCCGGAAGCATACGGACGGCAGTCACCTAGCAACCAGACGGCGTCCTTCCCGGCAGGCCCTGCGCCCGGCACCCAGCGTCCCACGCGGCTCAGACGAGCACTACCAGTCCCACAATGCCCCGCAGTCCCGCCCCTCTCTGCGGAGACCCCGCGAGGCTGCGCCGCGACCCCTGCCCCGCGAGCCGCCTGCCAGTCTGTGCGGGCGGGCCGCCATGCGGAGGGCCGAGCGCAGAGCTGCTGGGGGTTTGCGGTCCGGGTCTCCGCGACCCGAGGGCCGCCGCAGCACCGAGTCCGAAGTCTACGACGACGGCACCAACACTTTCTTCTGGTGAGGGCCGGAGACGGGAGGGGGCGCCCTGCCCCAGGCGAGGGGCGAGCCCACACCTTAACTGTGCTGTTCATCCTCACCTGTGCACTGGGCTATGTGACTCTCCTGGAAGAAACACCGCAAGACACAGCCTATAACACCAAGAGAGGTATTGTGGCCAGTATTTTGGTTTTCTTATGTTTTGGAGTCACACAAGCCAAAGATGGGCCATTTTCCAGACCTCATCCAGCTTACTGGCGATTTTGGCTTTGCGTTAGTGTGGTCTACGAGCTGTTTCTCATCTTTATCCTTTTCCAGGTAAGTGGCTTTTCTTGGTCAGATAAACTGGGAATAGATGACAGCAGGCTTTGCACACTTGGCCCCAGAGCACTCGCAGAAACCAGGCTGGACCCATTAGGGCCAGGATGCGGGTGCAGGTGGGACAGGCTATTGTGCCCAGACAAAGACAGGACAGTGGGCCAGGTTGGGAGTCCGGTGCATGTGAGAGCCAGCTGTTGCTGGGTGTCTGGCTCTTTGGTACTTTCTCCTACCTGGCTTCTGTTCTGCAGGAGGCCCAGTGAAGTTGGGAGCTTACCTCCTTCCGGTCGTCTTGAGCCAGGGCGTGCTACCCTAAGAGCTGGTTTGCTGAGCTGTACTCTGCTTTGCCGAAGAAACACACACCTTGGTGGTCTTGGGCCACAGAGTGCTCTCCTGAGAGACCTCAAAACCTGCTGA

XM_004851728.1 Coding sequence

Ptdss2 phosphatidylserine synthase 2, transcript variant X4

Length: 1269 bp    Location: 21988617..21965320   Strand: -
>XM_004851728.1
ATGACCACCCTTTCACAGGCAATGGGCTCCTATCACAGTATCTCGGGATCGCAGCCACGAACAGCGGACACCAAGCTCCGAGAACGGTGTTCGTGTCTCTCCGGCGGCCGGGACTACGTGTGGGAGCCGACCAAAGGCAGAAAGTTTTGCGCCGGGGAGACGCCGGAAGCATACGGACGGCAGTCACCTAGCAACCAGACGGCGTCCTTCCCGGCAGGCCCTGCGCCCGGCACCCAGCGTCCCACGCGGCTCAGACGAGCACTACCAGTCCCACAATGCCCCGCAGTCCCGCCCCTCTCTGCGGAGACCCCGCGAGGCTGCGCCGCGACCCCTGCCCCGCGAGCCGCCTGCCAGTCTGTGCGGGCGGGCCGCCATGCGGAGGGCCGAGCGCAGAGCTGCTGGGGGTTTGCGGTCCGGGTCTCCGCGACCCGAGGGCCGCCGCAGCACCGAGTCCGAAGTCTACGACGACGGCACCAACACTTTCTTCTGGTGAGGGCCGGAGACGGGAGGGGGCGCCCTGCCCCAGGCGAGGGGCGAGCCCACACCTTAACTGTGCTGTTCATCCTCACCTGTGCACTGGGCTATGTGACTCTCCTGGAAGAAACACCGCAAGACACAGCCTATAACACCAAGAGAGGTATTGTGGCCAGTATTTTGGTTTTCTTATGTTTTGGAGTCACACAAGCCAAAGATGGGCCATTTTCCAGACCTCATCCAGCTTACTGGCGATTTTGGCTTTGCGTTAGTGTGGTCTACGAGCTGTTTCTCATCTTTATCCTTTTCCAGGTAAGTGGCTTTTCTTGGTCAGATAAACTGGGAATAGATGACAGCAGGCTTTGCACACTTGGCCCCAGAGCACTCGCAGAAACCAGGCTGGACCCATTAGGGCCAGGATGCGGGTGCAGGTGGGACAGGCTATTGTGCCCAGACAAAGACAGGACAGTGGGCCAGGTTGGGAGTCCGGTGCATGTGAGAGCCAGCTGTTGCTGGGTGTCTGGCTCTTTGGTACTTTCTCCTACCTGGCTTCTGTTCTGCAGGAGGCCCAGTGAAGTTGGGAGCTTACCTCCTTCCGGTCGTCTTGAGCCAGGGCGTGCTACCCTAAGAGCTGGTTTGCTGAGCTGTACTCTGCTTTGCCGAAGAAACACACACCTTGGTGGTCTTGGGCCACAGAGTGCTCTCCTGAGAGACCTCAAAACCTGCTGGTCCTCAGCTGGTGGCCTCCTGAGGGCACCTTCTTTGCTGAGGTTGTGTCCCAGAAGTTTCCTTTGA

XM_004851735.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 2346 bp    Location: 21994108..22007336   Strand: +
>XM_004851735.1
ATGCAGGGTGAAGAGAGCTTCCAGGTCCTGGCGGGGACAGAAGGGGACAGCTTCCCACTGATGGAGGTGGGCACTTGTGAGGCAGAGCCCTCTGAGCAGTGGGACTTCATCCTTGTGGCCAAGTACCACGCAGAGATGAGACTCAGGCAGGCTGAGCGGCAGAAGCAGTTCCTGGAGGAGCTCAAGAGAAGAGGCTTCCGTGTCAAGGTGAGAGAGGACCAGAGACACGTGTTCTTCGGGATCCGAGCTGACAACAGGATCTTCGACTTGTACCGCACCCTCCTCGTGGAGCCAGAGGATCCTGCCCCGAGCCTGGAGCAGGCCAGGCCGACCACTGTCCCAGCCACTACAAGAATCCGAATTGTGAACTTCGTCCTGAACAGCAAGACAGCAACTGGTGACACCTTCGAGGACTTGGTGAAAGACGGGGTCTTTGAGGCCAGGTTCCCCCTGCACAGGGGGGAGGAAGACCTGAGGGCGAAGTGGGCCCAGTGGAGAAACATGTTCCAGGAGCAGCCAATCGATGCCATCAGGGACTACTTCGGTGAGAAGGTGGCGCTGTACTTCGCCTGGCTCGGCTGGTATACCTACATGCTGGTGCCTGCTGCCGTGGTGGGCCTCATCATCTTTCTGAGTGGATTTGCTCTGTTTAACTCCAGCCAGATCAGCAAGGAGATCTGTGGGGCTGCCAACGACACCTTCATGTGTCCTATTGGTGACAGCAACAGCTACCAGCGTCTGTTAGACACCTGCACTTTCGCAAAGATCACTCACCTCTTTGACAATGAGGGGACTGTGCTGTTTGCCATCTTCATGGCTCTGTGGGCCACTGCGTTCCTGGAGTTCTGGAAGCGGCGGCGAGCCAGCGTGGTGCTGCACTGGGACCTGTACGGGTGGGACGAGGATCAGGAAGAAATGGCGCTTGAGCTCATGAACTGCCCCGACTACGAGCTCCGGCCACACCAGCACTCCTACTTGCGCAGCACCATCATCCTGGTCCTGTCTCTGCTCATGATCTGCCTCATGATTGGCATGGCGCACTTGCTGGTGGTCTACCGTGTGCTGGCTGCCGCCTTCTTCGGCAACCTGGCCTGGCCCTTCCTGGAGAACCAGACCACCAAGGCTGTGGTGGTGACCACAGCCGTGGTGGTGACCGGGGCCCTGGTGCACTACCTGACCATCGTCATCATGACTAAGGTCAACAAGCGTGTGGCCCTGAAGCTTTGCGACTTTGAGAAGCCCAGGACCTTCTCAGAGCGAGAGCGCAAGTTCACCATCAAGTTCTTCACGCTGCAGTTCTTTGCCCACTTCTCCTCCCTCATCTACGTCGCCTTCATCTTGGGCAGGATCAACGGTCACCCTGGGAAGTCCACGCGCCTGGCTGGCCTGTGGAAGCTGGAGGAGTGCCATCTCAGCGGCTGCATGATGGACCTGTTTGTGCAGATGGCCATCATCATGGTCTTGAAGCAAACGCTCAGCAACTGCATGGAGTATCTGTGCCCGTGGCTGGCCTACAGGTGGCGCATGCTGTGGGGCTGCTGGGCCGGCAACCCTGAGCTCCGGGACTGGCAGCGAAACTACCGCCTAAACCCAGTCACCACCTTCACCCTGTTCGAAGAGTTCATGGAGATGATGATCCAGTACGGGTTCACCACCATCTTCGTGGCTGCCTTCCCCTTGGCGCCTCTGCTTGCACTCTTCAGCAACATGGTGGAAATCCGCCTGGACGCCATCAAGATGGTGCAGCTGCAGCGGCGGCTGGTGCCACGCAAGGCCAAGGACATCGGGACATGGCTGCAGGTACTGGAGACCATCGGCGTGCTGGCAGTCATTGCCAATGGGATGGTCATCGCCTTCACCTCCGAGTTCATCCCACGAGTGATCTACAAGTACCGTGACAGCCCATGCCAAAAGGAGCCCCACCGAAAAGTCGACTGCCTCACTGGCTACGTCAACCACAGCCTCTCTGTCTTCCACACGAAGGACTTCCAGGACCCCAAGAAGATTCAGGGCCCCGAAAACGTGACTGTGTGCAGGTACCGGGACTACCGAGATGAGGAGTACAACCTCACTGCACAGTTCTGGTTCCTCCTGGCCATCCGCCTGGCCTTTGTCATCCTCTTTGAGCACGTCGCCTTGTGCATCAAACTCATCGCCTCGTGGTTTGTGCCCGATGTCCCCCAGTCGGTGAAAAACAAGGTTCTGGAGGAGAAGTACAAGATGCTGAGGGAGAAGCTACGGTAGGGAGGGGAGGGGCTGGGCGGGGCAGGCCTGGGCCTGTGGGAGCCCCTGAGCCACCGACCCTATCCTGCCTCTAGGTCCAGCTCCAAGAGCACAGAGGTGTAG

XM_004851731.1 Coding sequence

Sigirr single immunoglobulin and toll-interleukin 1 receptor (TIR) domain, transcript variant X2

Length: 1437 bp    Location: 22007750..22015336   Strand: +
>XM_004851731.1
ATGAGCAACCTCAGTGACCAACTCCTTCCAGCAGGAAAGAGCTGGAACCAGCAGCCTCTGACTTGTGTAGGCACCCTGTCCAACCAGTCACAAGGACAGAGACAGGCCCTGCAGAGCCCTTGGTGGACCCGTCTGCTCTGTCAAGGAGCCCCATCGAGCAGAGGTGGCCCCAGAGTCCAGCCTGCCTTGAAGAGTCCCCAGCCAGAGTCCATGGCAGGTGTCTGTGACAGGGCCCCAGACTTCCTCTTCCCAGCTGAGGACCACGCCCTAGGACCTTCCCTGGGCAGTGCAGTTGCTCTGAATTGCACAGCTTGGGTGGTATCTGGGCTCCACTGCCCCCCACCTTCAGTCCAGTGGCTAAAAGATGGGCTTCCACTGGGCAACGTAAACCACTACCATGAGGATTCCTGGGTCAAGACCAACTTCTCAGAGGTGCTTGTGTCCAGTGTCCTGTGCATCAATGTGACCAATGCTGAGGACTATGGGACCTTCACCTGCTCTGTCCGAAACGTCAGCTCCTTCTCCTTCAGTCTTCAGAGAGCTGGCCCCGCAGGCCACGTGGCTGCGGTGCTGGCCGCCCTCCTGGTCTTGCTGGTCCTGCTGCTCGCGGGGCTGCTCTATGTGAAGTGTCGCCTCAACGTGCTGCTCTGGTACCAAGACACGCATGGGGAGGTGGAGATGAACGACGGGAAGCTCTACGACGCCTTCGTCTCCTACAGCGACTGCCCGGAAGACCGCAAATTCGTGAACTTCATCCTGAAGCCGCAGCTTGAGCGGCGTCGGGGTTACAAGCTCTTCCTGGACGACCGCGACATTCTGCCGCGCGCAGAGCCCTCGGCCGATCTCCTGGTGAACCTGAGCCGCTGCCGGCGCCTCATCGTGGTGCTTTCGGACGCCTTCCTGGGCCGGGCCTGGTGCAGCCACAGCTTCCGGGAGGGCTTGTGTCGGCTGCTGGAGCTGACGCGCAGACCCATCTTCATCACCTTTGAGGGCCCGCGGCGCGACCTGGCGCACCCTGCGCTGCACCTGCTGCGCCAGCACCGCCACCTGGTCACCCTGCTGCTCTGGAGGCCGGGCTCTGCGATGGCGTCCTCTGATTTTTGGAAAGAGCTGCAGCTTGCACTGCCGCGGAAGGTGCGGTACAGGCCAGTTGAGGGGGACCCCCAGACCCACCTTCAGGATGACAACGACCCCATGCTGATCATGCGAGGCCGTGCCGCTGAAGGCCGGGCTCTGGAGCAGGAGCTGGACCCTGATCCCGAGGGAGACCTGGGTGTACGAGGGCCTGTCTTTGGGGAGCCACCAGCCCCACCGCATGCCAGTGGGGTTTCGATGGGAGAGGGCCATAGCAGCGAGATGGACGTCTCCGACCTTGGCTCCCGAAACTACAGTGCCCGCACAGATTTCTACTGCTTGGTGTCTGAGGAAGACGTGTAG

XM_004851730.1 Coding sequence

Sigirr single immunoglobulin and toll-interleukin 1 receptor (TIR) domain, transcript variant X1

Length: 1437 bp    Location: 22009799..22015336   Strand: +
>XM_004851730.1
ATGAGCAACCTCAGTGACCAACTCCTTCCAGCAGGAAAGAGCTGGAACCAGCAGCCTCTGACTTGTGTAGGCACCCTGTCCAACCAGTCACAAGGACAGAGACAGGCCCTGCAGAGCCCTTGGTGGACCCGTCTGCTCTGTCAAGGAGCCCCATCGAGCAGAGGTGGCCCCAGAGTCCAGCCTGCCTTGAAGAGTCCCCAGCCAGAGTCCATGGCAGGTGTCTGTGACAGGGCCCCAGACTTCCTCTTCCCAGCTGAGGACCACGCCCTAGGACCTTCCCTGGGCAGTGCAGTTGCTCTGAATTGCACAGCTTGGGTGGTATCTGGGCTCCACTGCCCCCCACCTTCAGTCCAGTGGCTAAAAGATGGGCTTCCACTGGGCAACGTAAACCACTACCATGAGGATTCCTGGGTCAAGACCAACTTCTCAGAGGTGCTTGTGTCCAGTGTCCTGTGCATCAATGTGACCAATGCTGAGGACTATGGGACCTTCACCTGCTCTGTCCGAAACGTCAGCTCCTTCTCCTTCAGTCTTCAGAGAGCTGGCCCCGCAGGCCACGTGGCTGCGGTGCTGGCCGCCCTCCTGGTCTTGCTGGTCCTGCTGCTCGCGGGGCTGCTCTATGTGAAGTGTCGCCTCAACGTGCTGCTCTGGTACCAAGACACGCATGGGGAGGTGGAGATGAACGACGGGAAGCTCTACGACGCCTTCGTCTCCTACAGCGACTGCCCGGAAGACCGCAAATTCGTGAACTTCATCCTGAAGCCGCAGCTTGAGCGGCGTCGGGGTTACAAGCTCTTCCTGGACGACCGCGACATTCTGCCGCGCGCAGAGCCCTCGGCCGATCTCCTGGTGAACCTGAGCCGCTGCCGGCGCCTCATCGTGGTGCTTTCGGACGCCTTCCTGGGCCGGGCCTGGTGCAGCCACAGCTTCCGGGAGGGCTTGTGTCGGCTGCTGGAGCTGACGCGCAGACCCATCTTCATCACCTTTGAGGGCCCGCGGCGCGACCTGGCGCACCCTGCGCTGCACCTGCTGCGCCAGCACCGCCACCTGGTCACCCTGCTGCTCTGGAGGCCGGGCTCTGCGATGGCGTCCTCTGATTTTTGGAAAGAGCTGCAGCTTGCACTGCCGCGGAAGGTGCGGTACAGGCCAGTTGAGGGGGACCCCCAGACCCACCTTCAGGATGACAACGACCCCATGCTGATCATGCGAGGCCGTGCCGCTGAAGGCCGGGCTCTGGAGCAGGAGCTGGACCCTGATCCCGAGGGAGACCTGGGTGTACGAGGGCCTGTCTTTGGGGAGCCACCAGCCCCACCGCATGCCAGTGGGGTTTCGATGGGAGAGGGCCATAGCAGCGAGATGGACGTCTCCGACCTTGGCTCCCGAAACTACAGTGCCCGCACAGATTTCTACTGCTTGGTGTCTGAGGAAGACGTGTAG

XM_004851732.1 Coding sequence

Sigirr single immunoglobulin and toll-interleukin 1 receptor (TIR) domain, transcript variant X3

Length: 1434 bp    Location: 22009799..22015336   Strand: +
>XM_004851732.1
ATGAGCAACCTCAGTGACCAACTCCTTCCAGCAGGAAAGAGCTGGAACCAGCCTCTGACTTGTGTAGGCACCCTGTCCAACCAGTCACAAGGACAGAGACAGGCCCTGCAGAGCCCTTGGTGGACCCGTCTGCTCTGTCAAGGAGCCCCATCGAGCAGAGGTGGCCCCAGAGTCCAGCCTGCCTTGAAGAGTCCCCAGCCAGAGTCCATGGCAGGTGTCTGTGACAGGGCCCCAGACTTCCTCTTCCCAGCTGAGGACCACGCCCTAGGACCTTCCCTGGGCAGTGCAGTTGCTCTGAATTGCACAGCTTGGGTGGTATCTGGGCTCCACTGCCCCCCACCTTCAGTCCAGTGGCTAAAAGATGGGCTTCCACTGGGCAACGTAAACCACTACCATGAGGATTCCTGGGTCAAGACCAACTTCTCAGAGGTGCTTGTGTCCAGTGTCCTGTGCATCAATGTGACCAATGCTGAGGACTATGGGACCTTCACCTGCTCTGTCCGAAACGTCAGCTCCTTCTCCTTCAGTCTTCAGAGAGCTGGCCCCGCAGGCCACGTGGCTGCGGTGCTGGCCGCCCTCCTGGTCTTGCTGGTCCTGCTGCTCGCGGGGCTGCTCTATGTGAAGTGTCGCCTCAACGTGCTGCTCTGGTACCAAGACACGCATGGGGAGGTGGAGATGAACGACGGGAAGCTCTACGACGCCTTCGTCTCCTACAGCGACTGCCCGGAAGACCGCAAATTCGTGAACTTCATCCTGAAGCCGCAGCTTGAGCGGCGTCGGGGTTACAAGCTCTTCCTGGACGACCGCGACATTCTGCCGCGCGCAGAGCCCTCGGCCGATCTCCTGGTGAACCTGAGCCGCTGCCGGCGCCTCATCGTGGTGCTTTCGGACGCCTTCCTGGGCCGGGCCTGGTGCAGCCACAGCTTCCGGGAGGGCTTGTGTCGGCTGCTGGAGCTGACGCGCAGACCCATCTTCATCACCTTTGAGGGCCCGCGGCGCGACCTGGCGCACCCTGCGCTGCACCTGCTGCGCCAGCACCGCCACCTGGTCACCCTGCTGCTCTGGAGGCCGGGCTCTGCGATGGCGTCCTCTGATTTTTGGAAAGAGCTGCAGCTTGCACTGCCGCGGAAGGTGCGGTACAGGCCAGTTGAGGGGGACCCCCAGACCCACCTTCAGGATGACAACGACCCCATGCTGATCATGCGAGGCCGTGCCGCTGAAGGCCGGGCTCTGGAGCAGGAGCTGGACCCTGATCCCGAGGGAGACCTGGGTGTACGAGGGCCTGTCTTTGGGGAGCCACCAGCCCCACCGCATGCCAGTGGGGTTTCGATGGGAGAGGGCCATAGCAGCGAGATGGACGTCTCCGACCTTGGCTCCCGAAACTACAGTGCCCGCACAGATTTCTACTGCTTGGTGTCTGAGGAAGACGTGTAG

XM_004851740.1 Coding sequence

B4galnt4 beta-1,4-N-acetyl-galactosaminyl transferase 4, transcript variant X3

Length: 3252 bp    Location: 22036561..22028504   Strand: -
>XM_004851740.1
ATGTGCACAGCTCTGTACCCTTGCACCAGCCAGTTTGGGAAGTGGGACACGCTGCCCACCCTGTCCACTCGGGGGATGTGGGAAGATCAGTGCAAGGAGTGGCCAGGTGAGGGTAGGGTGTCAGGTGCCATGAGGGAACAGACATGCGAGACACGTCAGCAGGGTCCTGGTCCAGACAGGCTCTGTGCCACACACACCTCACGTGCCCTTGCAGATGGTGAAAAGCTGGCCGATGTGACAGATGGCCGGGGTATCCAGGGGGCGCCGTCCACGCAGAGGGCAGAGGACTCCAGCGAGAGTCGTGAGGAGGAGCAGGCGTTCAAGGGGCAAGTGAACCTGCACGTGTTTGAGGACTGGTGTGGGGGCGCCGTGGGCCACCTGAGGAGGAACCTGCACTTCCCGCTGTTCCCCCACACCCGCACCACCGTGAGGAAGCTGGCCGTTTCCCCCAGATGGAGGAACTACGGACTCAGGATCTTTGGCTACATCCACCCGGCGAGAGATGGCGACGTCCAGTTCTCGGTGGCTTCAGACGACAACTCTGAGTTTTGGCTGAGCCTGGATGAGAGCCCAGCAGCCGCCCAGCTTGTGGCCTTCGTGGGCAAGACTGGCTCTGAGTGGACAGCGCCTGGTGAATTCACCAAGTTCAGCTCCCAGGTGTCCAAGCCCAAACGGCTCATGGCCTCCCGGAGGTACTACTTTGAACTGCTTCACAAGCAGGATGACCGGGGCTCAGACCATGTGGAAGTGGGTTGGCGCACATACCTGCCGGGCCTGAAGTTTGAAGTCATCAGCGCTGCTCACATCTCCCTTTACACAGATGAGTCCTCCCTGAAGATGGACCATGTGGCCCACGTGCCCCAGTCTCCAGCCAGCCATGTCAGGGGCCACCTGCCCAAGGAGGAGTCCAGCGCAGACATGCTGCGCCCAGACCCCAGGGACAGCTTCTTCCTCACACCCCGGATAGAGCCCTGGAGCCTGGAGAGCGTGCTGGAGCCCTGCGCCTACGCACCTACCTACGTTCTCAAGGACTTCCCCATCGCCAGATACCAGGGCCTGCAGTTTGTATACCTGTCCTTCGTGTATCCCAATGACTACACCCGCCTCACGCACATGGAGACGGAGAACAAGTGCTTCTACCGAGAATCTCCCCGGTACCTGGAAAGGTTCGGTTTCTACAAATACATGAAGATGGACAAGCAGGAAGGGGAGGACGGGGAGGAGGAGCAGCAGCGCCGGGCCTTCTTGTTCCTCAGCCCCGAGGACTTCCTGGACGAAGAGGACGAGGGGGAGCTGCTGGACAGCCTGGAGCCCACCGAGGTGGGCCCACCGCGGAGCGGACGCAGGCCTCCCACACCACCGCTGGCGGAGCGCGAGCCAGAGCTCTCAGCTTCCCACGGCCCTCAGTCCCGCCACTCCCGCGCGCTGCGCTGGGCCATGCGCCCCCTGTCCCTCTTCCTGGGCCACGCGCCACCCCCGCGCGCCGCTGAGAAGCCTCCTGCCAAGGTGTATGTGACGCGCGTGCGGCCCCGACCGCGGGTGTCCCCACGTGGCCCGGCCTGGCCTCCCCTGGCCGGCGTCCTCCTGCGTGCCCGCGCCGTGCCACGAGCGCAGCTGCGTGCACCTCGGCCCCGGCGCAGGTCCCGCGGGCCCCCAGGCACAGAGCCCCCCGCGCCGTCCACCCTCGGGGCCCCGCAGGCCCACGCGCCCACACCGGATGTGAACTCCTCGGCTGCCGCGCAGCCCATGACCTCCTTCCTGAGCTTGTCCCAGGTGTCCCGGCCGCAGCTGCTCGCCGAGGGCGAGGGGGAGGAGGAGGACCGGGCCCCTGGCGACGAGGTGGCCTCAGAGGACAGCGAGGAGGATGCCGCGGGCCGCGTGCCCGGGCACTGGCGAGAAGATGCTATCGACTGGCAGCGCACATTCAGCGTGGGCGCTGTGGACTTCGAGCTGCTGCGCTCAGACTGGAACGACCTGCGCTGCAACGTGTCCGGCAATCTACAGCTTCCGGAAGCCGAGGCCGTGGACGTGGCGGCCCAGTACATGGAGCGCCTCAATGCTCGCCATGGCGGGCGCTTCACGCTCCTGCGCATTGTGAACGTTGAGAAGCGCCGCGACTCGGCGCGCGGCAGCCGCTTCTTGCTGGAACTGGAGCTGCAGGAGCGCGGCGGGGGCCGCCTGCGCCTGTCAGAGTTCGTCTTTCTCCGAGTGCCGGGTGCGCACGCCCGCGGCGAGGAGGGAGGGAGCCCCGAGCCCCCTCCCGCTGCTTCCACGCGCCCAGACAGCCGCCCTGAGCTCTGCCGACCGCTGCGCCTCGCCTGGCGCCAGGACGTGGCCGTGCACTTCATCGTGCCAGTTTCTGGCGGACATGGCCTCACTGCACGCGCGCACGGGAGACTCGCGCTTCAGCGTCATCCTGGTGGACTTCGAGAGCGACGACATGGACGTGGAGCGCGCCCTGCGCCAGGCACGGCTGCCCGGGTAAGAGCCTGCAAGGACTGCGGGGTTCCCGAGCCCGCCGCCAGGCCCACGCCGGTGACCCTTCGTCCTCCGCAGGTATCAGTACCTGAGACGGACGGGGAACTTCGAGCGCTCTGCTGGGCTGCAGGCCGGAGTGGATGCTGTGCAGGACCCCAGCAGCATCGTCTTCCTCTGCGACCTGCACATCCACTTCCCACCCAGCATCCTGGACAGCATCCGCAAGCACTGCGTGGAGGGCACGCTGGCCTTCGCCCCCGTGGTCATGCGCCTGGGCTGTGGGAGTTCCCCTCGCAACCCGCAGGGCTACTGGGAAGTGAACGGCTTTGGTCTCTTCGGGATCTACAAGTCCGACTTCGACCGCGTGGGAGGCATGAACACGGAGGAGTTCCGAGACCAGTGGGGAGGCGAGGACTGGGAGCTCCTGGACAGGGTCCTGCAGGCGGGGCTGGAGGTGGAGCGACTCCGACTGCGGAACTTCTACCACTACTACCACTCCAAGCGGGGCATGTGGGGCACACGCAGCCGCAGGGGGACCCGCGAGGAGCCGGCCTGAGGCCGGGCAGCACAGCCACCACCCGTGCCTCCCCATCCGGCCTGGCCCGGCGGCCTCCCCGGAGGCCCCCTTCCCAGCCAGGCTGCCAGGCTGCCTCGGTCCTCACGCTCCGAGATGATTTCTGTGAAATTTTCAGTAGCGATGACATTGTTTCCAGGATTTCCAAGAGTTCTGTCTGTTCCGTTTTTATTCAGATTGAAATGAAATATTTTTTTTAG

XM_004851739.1 Coding sequence

B4galnt4 beta-1,4-N-acetyl-galactosaminyl transferase 4, transcript variant X2

Length: 3273 bp    Location: 22036561..22028504   Strand: -
>XM_004851739.1
ATGTGCACAGCTCTGTACCCTTGCACCAGCCAGTTTGGGAAGTGGGACACGCTGCCCACCCTGTCCACTCGGGGGATGTGGGAAGATCAGTGCAAGGAGTGGCCAGGTGAGGGTAGGGTGTCAGGTGCCATGAGGGAACAGACATGCGAGACACGTCAGCAGGGTCCTGGTCCAGACAGGCTCTGTGCCACACACACCTCACGTGCCCTTGCAGATGGTGAAAAGCTGGCCGATGTGACAGATGGCCGGGGTATCCAGGGGGCGCCGTCCACGCAGAGGGCAGAGGACTCCAGCGAGAGTCGTGAGGAGGAGCAGGCGCCTGAAGGCCAGGACGCAGATGAGCTGTTTCCTGGGGGGGCTGGGAAGCCACCCCCACTGAACCTCACCCATCAGGTGCCCAAGTGGCAGGAGAAGTTCAAGGGGCAAGTGAACCTGCACGTGTTTGAGGACTGGTGTGGGGGCGCCGTGGGCCACCTGAGGAGGAACCTGCACTTCCCGCTGTTCCCCCACACCCGCACCACCGTGAGGAAGCTGGCCGTTTCCCCCAGATGGAGGAACTACGGACTCAGGATCTTTGGCTACATCCACCCGGCGAGAGATGGCGACGTCCAGTTCTCGGTGGCTTCAGACGACAACTCTGAGTTTTGGCTGAGCCTGGATGAGAGCCCAGCAGCCGCCCAGCTTGTGGCCTTCGTGGGCAAGACTGGCTCTGAGTGGACAGCGCCTGGTGAATTCACCAAGTTCAGCTCCCAGGTGTCCAAGCCCAAACGGCTCATGGCCTCCCGGAGGTACTACTTTGAACTGCTTCACAAGCAGGATGACCGGGGCTCAGACCATGTGGAAGTGGGTTGGCGCACATACCTGCCGGGCCTGAAGTTTGAAGTCATCAGCGCTGCTCACATCTCCCTTTACACAGATGAGTCCTCCCTGAAGATGGACCATGTGGCCCACGTGCCCCAGTCTCCAGCCAGCCATGTCAGGGGCCACCTGCCCAAGGAGGAGTCCAGCGCAGACATGCTGCGCCCAGACCCCAGGGACAGCTTCTTCCTCACACCCCGGATAGAGCCCTGGAGCCTGGAGAGCGTGCTGGAGCCCTGCGCCTACGCACCTACCTACGTTCTCAAGGACTTCCCCATCGCCAGATACCAGGGCCTGCAGTTTGTATACCTGTCCTTCGTGTATCCCAATGACTACACCCGCCTCACGCACATGGAGACGGAGAACAAGTGCTTCTACCGAGAATCTCCCCGGTACCTGGAAAGGTTCGGTTTCTACAAATACATGAAGATGGACAAGCAGGAAGGGGAGGACGGGGAGGAGGAGCAGCAGCGCCGGGCCTTCTTGTTCCTCAGCCCCGAGGACTTCCTGGACGAAGAGGACGAGGGGGAGCTGCTGGACAGCCTGGAGCCCACCGAGGTGGGCCCACCGCGGAGCGGACGCAGGCCTCCCACACCACCGCTGGCGGAGCGCGAGCCAGAGCTCTCAGCTTCCCACGGCCCTCAGTCCCGCCACTCCCGCGCGCTGCGCTGGGCCATGCGCCCCCTGTCCCTCTTCCTGGGCCACGCGCCACCCCCGCGCGCCGCTGAGAAGCCTCCTGCCAAGGTGTATGTGACGCGCGTGCGGCCCCGACCGCGGGTGTCCCCACGTGGCCCGGCCTGGCCTCCCCTGGCCGGCGTCCTCCTGCGTGCCCGCGCCGTGCCACGAGCGCAGCTGCGTGCACCTCGGCCCCGGCGCAGGTCCCGCGGGCCCCCAGGCACAGAGCCCCCCGCGCCGTCCACCCTCGGGGCCCCGCAGGCCCACGCGCCCACACCGGATGTGAACTCCTCGGCTGCCGCGCAGCCCATGACCTCCTTCCTGAGCTTGTCCCAGGTGTCCCGGCCGCAGCTGCTCGCCGAGGGCGAGGGGGAGGAGGAGGACCGGGCCCCTGGCGACGAGGTGGCCTCAGAGGACAGCGAGGAGGATGCCGCGGGCCGCGTGCCCGGGCACTGGCGAGAAGATGCTATCGACTGGCAGCGCACATTCAGCGTGGGCGCTGTGGACTTCGAGCTGCTGCGCTCAGACTGGAACGACCTGCGCTGCAACGTGTCCGGCAATCTACAGCTTCCGGAAGCCGAGGCCGTGGACGTGGCGGCCCAGTACATGGAGCGCCTCAATGCTCGCCATGGCGGGCGCTTCACGCTCCTGCGCATTGTGAACGTTGAGAAGCGCCGCGACTCGGCGCGCGGCAGCCGCTTCTTGCTGGAACTGGAGCTGCAGGAGCGCGGCGGGGGCCGCCTGCGCCTGTCAGAGTTCGTCTTTCTCCGAGTGCCGGGTGCGCACGCCCGCGGCGAGGAGGGAGGGAGCCCCGAGCCCCCTCCCGCTGCTTCCACGCGCCCAGACAGCCGCCCTGAGCTCTGCCGACCGCTGCGCCTCGCCTGGCGCCAGGACGTGGCCGTGCACTTCATCGTGCCAGTTTCTGGCGGACATGGCCTCACTGCACGCGCGCACGGGAGACTCGCGCTTCAGCGTCATCCTGGTGGACTTCGAGAGCGACGACATGGACGTGGAGCGCGCCCTGCGCCAGGCACGGCTGCCCGGGTATCAGTACCTGAGACGGACGGGGAACTTCGAGCGCTCTGCTGGGCTGCAGGCCGGAGTGGATGCTGTGCAGGACCCCAGCAGCATCGTCTTCCTCTGCGACCTGCACATCCACTTCCCACCCAGCATCCTGGACAGCATCCGCAAGCACTGCGTGGAGGGCACGCTGGCCTTCGCCCCCGTGGTCATGCGCCTGGGCTGTGGGAGTTCCCCTCGCAACCCGCAGGGCTACTGGGAAGTGAACGGCTTTGGTCTCTTCGGGATCTACAAGTCCGACTTCGACCGCGTGGGAGGCATGAACACGGAGGAGTTCCGAGACCAGTGGGGAGGCGAGGACTGGGAGCTCCTGGACAGGGTCCTGCAGGCGGGGCTGGAGGTGGAGCGACTCCGACTGCGGAACTTCTACCACTACTACCACTCCAAGCGGGGCATGTGGGGCACACGCAGCCGCAGGGGGACCCGCGAGGAGCCGGCCTGAGGCCGGGCAGCACAGCCACCACCCGTGCCTCCCCATCCGGCCTGGCCCGGCGGCCTCCCCGGAGGCCCCCTTCCCAGCCAGGCTGCCAGGCTGCCTCGGTCCTCACGCTCCGAGATGATTTCTGTGAAATTTTCAGTAGCGATGACATTGTTTCCAGGATTTCCAAGAGTTCTGTCTGTTCCGTTTTTATTCAGATTGAAATGAAATATTTTTTTTAG

XM_004851743.1 Coding sequence

B4galnt4 beta-1,4-N-acetyl-galactosaminyl transferase 4, transcript variant X6

High confidence: 4 potential gene matches
Length: 3021 bp    Location: 22038913..22028649   Strand: -
>XM_004851743.1
ATGCCGTGGTTCCCGGTGAAGAAGGTCCGCAAGCGGATGAAGCTGCTGCTGCTGCTGCTGCTGCTCACCTGCGCCGCGTGGCTCACCTACGTGCACCTGAGCCTGGCGCGCCAGGGCCGCGCGATGCGACAGCGGCCGGGCCACGCGCGAGATGGTGAAAAGCTGGCCGATGTGACAGATGGCCGGGGTATCCAGGGGGCGCCGTCCACGCAGAGGGCAGAGGACTCCAGCGAGAGTCGTGAGGAGGAGCAGGCGCCTGAAGGCCAGGACGCAGATGAGCTGTTTCCTGGGGGGGCTGGGAAGCCACCCCCACTGAACCTCACCCATCAGGTGCCCAAGTGGCAGGAGAAGTTCAAGGGGCAAGTGAACCTGCACGTGTTTGAGGACTGGTGTGGGGGCGCCGTGGGCCACCTGAGGAGGAACCTGCACTTCCCGCTGTTCCCCCACACCCGCACCACCGTGAGGAAGCTGGCCGTTTCCCCCAGATGGAGGAACTACGGACTCAGGATCTTTGGCTACATCCACCCGGCGAGAGATGGCGACGTCCAGTTCTCGGTGGCTTCAGACGACAACTCTGAGTTTTGGCTGAGCCTGGATGAGAGCCCAGCAGCCGCCCAGCTTGTGGCCTTCGTGGGCAAGACTGGCTCTGAGTGGACAGCGCCTGGTGAATTCACCAAGTTCAGCTCCCAGGTGTCCAAGCCCAAACGGCTCATGGCCTCCCGGAGGTACTACTTTGAACTGCTTCACAAGCAGGATGACCGGGGCTCAGACCATGTGGAAGTGGGTTGGCGCACATACCTGCCGGGCCTGAAGTTTGAAGTCATCAGCGCTGCTCACATCTCCCTTTACACAGATGAGTCCTCCCTGAAGATGGACCATGTGGCCCACGTGCCCCAGTCTCCAGCCAGCCATGTCAGGGGCCACCTGCCCAAGGAGGAGTCCAGCGCAGACATGCTGCGCCCAGACCCCAGGGACAGCTTCTTCCTCACACCCCGGATAGAGCCCTGGAGCCTGGAGAGCGTGCTGGAGCCCTGCGCCTACGCACCTACCTACGTTCTCAAGGACTTCCCCATCGCCAGATACCAGGGCCTGCAGTTTGTATACCTGTCCTTCGTGTATCCCAATGACTACACCCGCCTCACGCACATGGAGACGGAGAACAAGTGCTTCTACCGAGAATCTCCCCGGTACCTGGAAAGGTTCGGTTTCTACAAATACATGAAGATGGACAAGCAGGAAGGGGAGGACGGGGAGGAGGAGCAGCAGCGCCGGGCCTTCTTGTTCCTCAGCCCCGAGGACTTCCTGGACGAAGAGGACGAGGGGGAGCTGCTGGACAGCCTGGAGCCCACCGAGGTGGGCCCACCGCGGAGCGGACGCAGGCCTCCCACACCACCGCTGGCGGAGCGCGAGCCAGAGCTCTCAGCTTCCCACGGCCCTCAGTCCCGCCACTCCCGCGCGCTGCGCTGGGCCATGCGCCCCCTGTCCCTCTTCCTGGGCCACGCGCCACCCCCGCGCGCCGCTGAGAAGCCTCCTGCCAAGGTGTATGTGACGCGCGTGCGGCCCCGACCGCGGGTGTCCCCACGTGGCCCGGCCTGGCCTCCCCTGGCCGGCGTCCTCCTGCGTGCCCGCGCCGTGCCACGAGCGCAGCTGCGTGCACCTCGGCCCCGGCGCAGGTCCCGCGGGCCCCCAGGCACAGAGCCCCCCGCGCCGTCCACCCTCGGGGCCCCGCAGGCCCACGCGCCCACACCGGATGTGAACTCCTCGGCTGCCGCGCAGCCCATGACCTCCTTCCTGAGCTTGTCCCAGGTGTCCCGGCCGCAGCTGCTCGCCGAGGGCGAGGGGGAGGAGGAGGACCGGGCCCCTGGCGACGAGGTGGCCTCAGAGGACAGCGAGGAGGATGCCGCGGGCCGCGTGCCCGGGCACTGGCGAGAAGATGCTATCGACTGGCAGCGCACATTCAGCGTGGGCGCTGTGGACTTCGAGCTGCTGCGCTCAGACTGGAACGACCTGCGCTGCAACGTGTCCGGCAATCTACAGCTTCCGGAAGCCGAGGCCGTGGACGTGGCGGCCCAGTACATGGAGCGCCTCAATGCTCGCCATGGCGGGCGCTTCACGCTCCTGCGCATTGTGAACGTTGAGAAGCGCCGCGACTCGGCGCGCGGCAGCCGCTTCTTGCTGGAACTGGAGCTGCAGGAGCGCGGCGGGGGCCGCCTGCGCCTGTCAGAGTTCGTCTTTCTCCGAGTGCCGGGTGCGCACGCCCGCGGCGAGGAGGGAGGGAGCCCCGAGCCCCCTCCCGCTGCTTCCACGCGCCCAGACAGCCGCCCTGAGCTCTGCCGACCGCTGCGCCTCGCCTGGCGCCAGGACGTGGCCGTGCACTTCATCGTGCCAGTTAAGAACCAGGCGCGCTGGGTGGTGCAGTTTCTGGCGGACATGGCCTCACTGCACGCGCGCACGGGAGACTCGCGCTTCAGCGTCATCCTGGTGGACTTCGAGAGCGACGACATGGACGTGGAGCGCGCCCTGCGCCAGGCACGGCTGCCCGGGTATCAGTACCTGAGACGGACGGGGAACTTCGAGCGCTCTGCTGGGCTGCAGGCCGGAGTGGATGCTGTGCAGGACCCCAGCAGCATCGTCTTCCTCTGCGACCTGCACATCCACTTCCCACCCAGCATCCTGGACAGCATCCGCAAGCACTGCGTGGAGGGCACGCTGGCCTTCGCCCCCGTGGTCATGCGCCTGGGCTGTGGGAGTTCCCCTCGCAACCCGCAGGGCTACTGGGAAGTGAACGGCTTTGGTCTCTTCGGGATCTACAAGTCCGACTTCGACCGCGTGGGAGGCATGAACACGGAGGAGTTCCGAGACCAGTGGGGAGGCGAGGACTGGGAGCTCCTGGACAGGGTCCTGCAGGCGGGGCTGGAGGTGGAGCGACTCCGACTGCGGAACTTCTACCACTACTACCACTCCAAGCGGGGCATGTGGGGCACACGCAGCCGCAGGGGGACCCGCGAGGAGCCGGCCTGA

XM_004851742.1 Coding sequence

B4galnt4 beta-1,4-N-acetyl-galactosaminyl transferase 4, transcript variant X5

Length: 3084 bp    Location: 22036561..22028649   Strand: -
>XM_004851742.1
ATGTGCACAGCTCTGTACCCTTGCACCAGCCAGTTTGGGAAGTGGGACACGCTGCCCACCCTGTCCACTCGGGGGATGTGGGAAGATCAGTGCAAGGAGTGGCCAGGTGAGGGTAGGGTGTCAGGTGCCATGAGGGAACAGACATGCGAGACACGTCAGCAGGGTCCTGGTCCAGACAGGCTCTGTGCCACACACACCTCACGTGCCCTTGCAGATGGTGAAAAGCTGGCCGATGTGACAGATGGCCGGGGTATCCAGGGGGCGCCGTCCACGCAGAGGGCAGAGGACTCCAGCGAGAGTCGTGAGGAGGAGCAGGCGCCTGAAGGCCAGGACGCAGATGAGCTGTTTCCTGGGGGGGCTGGGAAGCCACCCCCACTGAACCTCACCCATCAGGTGCCCAAGTGGCAGGAGAAGTTCAAGGGGCAAGTGAACCTGCACGTGTTTGAGGACTGGTGTGGGGGCGCCGTGGGCCACCTGAGGAGGAACCTGCACTTCCCGCTGTTCCCCCACACCCGCACCACCGTGAGGAAGCTGGCCGTTTCCCCCAGATGGAGGAACTACGGACTCAGGATCTTTGGCTACATCCACCCGGCGAGAGATGGCGACGTCCAGTTCTCGGTGGCTTCAGACGACAACTCTGAGTTTTGGCTGAGCCTGGATGAGAGCCCAGCAGCCGCCCAGCTTGTGGCCTTCGTGGGCAAGACTGGCTCTGAGTGGACAGCGCCTGGTGAATTCACCAAGTTCAGCTCCCAGGTGTCCAAGCCCAAACGGCTCATGGCCTCCCGGAGGTACTACTTTGAACTGCTTCACAAGCAGGATGACCGGGGCTCAGACCATGTGGAAGTGGGTTGGCGCACATACCTGCCGGGCCTGAAGTTTGAAGTCATCAGCGCTGCTCACATCTCCCTTTACACAGATGAGTCCTCCCTGAAGATGGACCATGTGGCCCACGTGCCCCAGTCTCCAGCCAGCCATGTCAGGGGCCACCTGCCCAAGGAGGAGTCCAGCGCAGACATGCTGCGCCCAGACCCCAGGGACAGCTTCTTCCTCACACCCCGGATAGAGCCCTGGAGCCTGGAGAGCGTGCTGGAGCCCTGCGCCTACGCACCTACCTACGTTCTCAAGGACTTCCCCATCGCCAGATACCAGGGCCTGCAGTTTGTATACCTGTCCTTCGTGTATCCCAATGACTACACCCGCCTCACGCACATGGAGACGGAGAACAAGTGCTTCTACCGAGAATCTCCCCGGTACCTGGAAAGGTTCGGTTTCTACAAATACATGAAGATGGACAAGCAGGAAGGGGAGGACGGGGAGGAGGAGCAGCAGCGCCGGGCCTTCTTGTTCCTCAGCCCCGAGGACTTCCTGGACGAAGAGGACGAGGGGGAGCTGCTGGACAGCCTGGAGCCCACCGAGGTGGGCCCACCGCGGAGCGGACGCAGGCCTCCCACACCACCGCTGGCGGAGCGCGAGCCAGAGCTCTCAGCTTCCCACGGCCCTCAGTCCCGCCACTCCCGCGCGCTGCGCTGGGCCATGCGCCCCCTGTCCCTCTTCCTGGGCCACGCGCCACCCCCGCGCGCCGCTGAGAAGCCTCCTGCCAAGGTGTATGTGACGCGCGTGCGGCCCCGACCGCGGGTGTCCCCACGTGGCCCGGCCTGGCCTCCCCTGGCCGGCGTCCTCCTGCGTGCCCGCGCCGTGCCACGAGCGCAGCTGCGTGCACCTCGGCCCCGGCGCAGGTCCCGCGGGCCCCCAGGCACAGAGCCCCCCGCGCCGTCCACCCTCGGGGCCCCGCAGGCCCACGCGCCCACACCGGATGTGAACTCCTCGGCTGCCGCGCAGCCCATGACCTCCTTCCTGAGCTTGTCCCAGGTGTCCCGGCCGCAGCTGCTCGCCGAGGGCGAGGGGGAGGAGGAGGACCGGGCCCCTGGCGACGAGGTGGCCTCAGAGGACAGCGAGGAGGATGCCGCGGGCCGCGTGCCCGGGCACTGGCGAGAAGATGCTATCGACTGGCAGCGCACATTCAGCGTGGGCGCTGTGGACTTCGAGCTGCTGCGCTCAGACTGGAACGACCTGCGCTGCAACGTGTCCGGCAATCTACAGCTTCCGGAAGCCGAGGCCGTGGACGTGGCGGCCCAGTACATGGAGCGCCTCAATGCTCGCCATGGCGGGCGCTTCACGCTCCTGCGCATTGTGAACGTTGAGAAGCGCCGCGACTCGGCGCGCGGCAGCCGCTTCTTGCTGGAACTGGAGCTGCAGGAGCGCGGCGGGGGCCGCCTGCGCCTGTCAGAGTTCGTCTTTCTCCGAGTGCCGGGTGCGCACGCCCGCGGCGAGGAGGGAGGGAGCCCCGAGCCCCCTCCCGCTGCTTCCACGCGCCCAGACAGCCGCCCTGAGCTCTGCCGACCGCTGCGCCTCGCCTGGCGCCAGGACGTGGCCGTGCACTTCATCGTGCCAGTTAAGAACCAGGCGCGCTGGGTGGTGCAGTTTCTGGCGGACATGGCCTCACTGCACGCGCGCACGGGAGACTCGCGCTTCAGCGTCATCCTGGTGGACTTCGAGAGCGACGACATGGACGTGGAGCGCGCCCTGCGCCAGGCACGGCTGCCCGGGTATCAGTACCTGAGACGGACGGGGAACTTCGAGCGCTCTGCTGGGCTGCAGGCCGGAGTGGATGCTGTGCAGGACCCCAGCAGCATCGTCTTCCTCTGCGACCTGCACATCCACTTCCCACCCAGCATCCTGGACAGCATCCGCAAGCACTGCGTGGAGGGCACGCTGGCCTTCGCCCCCGTGGTCATGCGCCTGGGCTGTGGGAGTTCCCCTCGCAACCCGCAGGGCTACTGGGAAGTGAACGGCTTTGGTCTCTTCGGGATCTACAAGTCCGACTTCGACCGCGTGGGAGGCATGAACACGGAGGAGTTCCGAGACCAGTGGGGAGGCGAGGACTGGGAGCTCCTGGACAGGGTCCTGCAGGCGGGGCTGGAGGTGGAGCGACTCCGACTGCGGAACTTCTACCACTACTACCACTCCAAGCGGGGCATGTGGGGCACACGCAGCCGCAGGGGGACCCGCGAGGAGCCGGCCTGA

XM_004851744.1 Coding sequence

LOC101722087 interferon-induced transmembrane protein 3-like

Length: 414 bp    Location: 22075942..22074711   Strand: -
>XM_004851744.1
ATGAGCCACACGGGCCCGGCCTTCTTCTCCCACGCCAACGTCGGCCTCCCCCCAAACTATGAAAAGATCCAGGAGGAGCACGAGGTGGCCGTGCTCGGGGGCACCCATGGCCCTGTTCCCGCAGCCTCCACCGTGATCAACATCCGCAGTGACATCGCTGTACCCGACCACGTGGTCTGGTCCCTCTTCAACACGATCTTCATGAACACATGCTGCCTGGGCTTCATAGCCTTCGCCTACTCCATAAAGTCCAGGGACAGGAAGATGGTGGGCGACGTGATCGGGGCCCAGAGCTACGCCTCCACTGCCAAGTGCCTGAACATCAGCGCCCTGGTCTTAAGCATCACTCTGACCATCACCGTCATCATTGTGTTTGCCTTCACCTCCGTGCATTTGTTCAAGATGATGACATGA

XM_004851745.1 Coding sequence

LOC101722444 interferon-induced transmembrane protein 3-like

Length: 357 bp    Location: 22106398..22107571   Strand: +
>XM_004851745.1
ATGATGCCCAAGGAGGAGCAAGAGGTGACCGTGCTGGGGGGACCCCACCACCCGGCTCCCATGACCTCCACCGTGATCAGCATTCCGAGGGACACCCCTGTGCGTGACCATGTGGTCTGGTCCCTGATCAACACAGTCATCCTGAATGTATGCTGCCTGGGCTTCATAGCCTTCGCCTACTCCATAAAGTCCAGGGACAGGAAGATGGTGGGCGACGTGATCGGGGCCCAGAGCTACGCCTCCACCTCCAGGTGGCTGAACATCATTGCCACAGTTGTTACCATCATCCTCACTGTTGTCTTCATCATTGTATACTCTGCGGCCATCGTGACACTCTTCCAACGCTTGTCCCAGTGA

XM_004851749.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X2

Length: 2202 bp    Location: 22142601..22136826   Strand: -
>XM_004851749.1
ATGGAGGACGCCCAGCCGGACCCCACCGTGTTTGCCTCCCACTCTCTGCCCAGGGACCCCCGCCTGTTGGCCACTGTGACCAACGTGTACCTGGGCACACGTGTGTACCATGACACACTGCACGTGAGCGGCGTGTACAACGGGGCCCGGGGCAGCACACACCGGGCGGTCCTGCCCAGCCCCCTTAACGTGCGGCTGGAGGCCCCCGCGGGGAAAGGAGCCCAGCTGACCCAGACCTTTGCTCTGGACACCAACACAGGCTCCTTCCTGCACACCCTGGAGGGCCCCAGCTTCCGGGCCTCCCAGCGCATCTATGCCCACCGCGTGCTGCCCCATGTCCTGGCCTTCAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGGTACCTGTGGGGCCTCACGCTCACCCCGGAGCAGCCAGGGGGCCCCCGGCAGGAGGTGCACATGCTGTGGACGCCAGTGCCCCCTGCCCTGACCCTTGGCGAAGGCGAAGAGACTAGGACCTGGGACTTCCTGACCGTGGTGGGTGGCAGCCGGGTGGAGGCCCAGGCCTGCCTCAACGAGGCCTTACAGCTGCAGGCCACGGGCTCTCTGTACGCCATCCACATGCAGGCTTGGGCCCAGTTCTGGACGGGCTGCAGTCTGGATGTGGCAGGGCCCCTGGCTCTGTGCCAGGCTGTCCGTAGCTCTTTTTACTACCTGTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACCATGCCACCCAGGACCTGCAATTCTTCCGAGAAGCTGGTGGCTGGGACGTGGTCAGCGCTGTGGCTGAGTTTTGGTGCAGCCGGGTGGAGTGGAACCCCAAGGAGAAGAAATTCGACCTGAGAGGTGCGGGTCTGGGCAGGCGGGCAGGCCGGCAGGAGTGTGGATGTTCCTGGGCTGCCCATGCTGACTGCTGCACAATGTGCTGCGGTGGACTTATGTGCCCAGGAGTTATGCCCCCTGATGAGTACCATGCAGGAGTCGACAACTCTGTGTACACCAATGTCCTGGTCCAGAACAGCCTGCACTTTGCGGCTGCCCTGGCACGGGACCTGGGTCAGCCTTTCCCTGACAAGTGGCTGGTGGTGGCTGATGGGATCGAGGTGCCCTTTGATCCCGAGCAGAACTTCCACCCTGAGTTTGATGGGTACAAGCCTGAGCATGTTTGCTGTGGGCTGGATGGAGCTGAAGGACCCGTCACGGGCACAGAGTCTTCTGGACAGGAACATCACCAATGTCACCGAGCCCTTCAAGGTCAGCCTGTTAGCACCCTTGACCCACAGGCTGACCCCACCGGCCTCCACTCCCGCCCATGTGGTCACAGCCCGAGTTCCTCTTGCCCTTGGCAAGGCAGCCGCAGGAGGCTAGTGTGCTGGGCCTGCCACAACCACCCTCTGCAGGTGTGGACAGAGAATGCAGACGGGTCCGGGGCCGTGAACTTCCTGACAGGCATGGGAGGCTTCCTGCAGGCAGTGCTATTTGGATGTACAGGCTTCAGCTCTCCCCACAGGGTCACCTGCAGAGGTGTGACCTTTGATCCTCTGTGCCTGACGGACATCTCCAGAGTGTGTGTGTCTGGCATCTTCTACCGGGGGAACAGGCTCAACTTTACCTTCTGCAAGGACTCAGTGATGGTTGAGGTCACAGCCCAGGCATGGCCTGGGGCTCCTCAGTTGGAGGCTGAGCTGTGGCCATCAGGAGCTCAGCTCCCCCTGCTGCTGGGGCACAAGGTTTCATTTCCTTGTTCAGCTGGCCGGATACAAAGATCACTCCCATAG

XM_004851748.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X1

Length: 2202 bp    Location: 22142601..22136826   Strand: -
>XM_004851748.1
ATGGAGGACGCCCAGCCGGACCCCACCGTGTTTGCCTCCCACTCTCTGCCCAGGGACCCCCGCCTGTTGGCCACTGTGACCAACGTGTACCTGGGCACACGTGTGTACCATGACACACTGCACGTGAGCGGCGTGTACAACGGGGCCCGGGGCAGCACACACCGGGCGGTCCTGCCCAGCCCCCTTAACGTGCGGCTGGAGGCCCCCGCGGGGAAAGGAGCCCAGCTGACCCAGACCTTTGCTCTGGACACCAACACAGGCTCCTTCCTGCACACCCTGGAGGGCCCCAGCTTCCGGGCCTCCCAGCGCATCTATGCCCACCGCGTGCTGCCCCATGTCCTGGCCTTCAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGGTACCTGTGGGGCCTCACGCTCACCCCGGAGCAGCCAGGGGGCCCCCGGCAGGAGGTGCACATGCTGTGGACGCCAGTGCCCCCTGCCCTGACCCTTGGCGAAGGCGAAGAGACTAGGACCTGGGACTTCCTGACCGTGGTGGGTGGCAGCCGGGTGGAGGCCCAGGCCTGCCTCAACGAGGCCTTACAGCTGCAGGCCACGGGCTCTCTGTACGCCATCCACATGCAGGCTTGGGCCCAGTTCTGGACGGGCTGCAGTCTGGATGTGGCAGGGCCCCTGGCTCTGTGCCAGGCTGTCCGTAGCTCTTTTTACTACCTGTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACCATGCCACCCAGGACCTGCAATTCTTCCGAGAAGCTGGTGGCTGGGACGTGGTCAGCGCTGTGGCTGAGTTTTGGTGCAGCCGGGTGGAGTGGAACCCCAAGGAGAAGAAATTCGACCTGAGAGGTGCGGGTCTGGGCAGGCGGGCAGGCCGGCAGGAGTGTGGATGTTCCTGGGCTGCCCATGCTGACTGCTGCACAATGTGCTGCGGTGGACTTATGTGCCCAGGAGTTATGCCCCCTGATGAGTACCATGCAGGAGTCGACAACTCTGTGTACACCAATGTCCTGGTCCAGAACAGCCTGCACTTTGCGGCTGCCCTGGCACGGGACCTGGGTCAGCCTTTCCCTGACAAGTGGCTGGTGGTGGCTGATGGGATCGAGGTGCCCTTTGATCCCGAGCAGAACTTCCACCCTGAGTTTGATGGGTACAAGCCTGAGCATGTTTGCTGTGGGCTGGATGGAGCTGAAGGACCCGTCACGGGCACAGAGTCTTCTGGACAGGAACATCACCAATGTCACCGAGCCCTTCAAGGTCAGCCTGTTAGCACCCTTGACCCACAGGCTGACCCCACCGGCCTCCACTCCCGCCCATGTGGTCACAGCCCGAGTTCCTCTTGCCCTTGGCAAGGCAGCCGCAGGAGGCTAGTGTGCTGGGCCTGCCACAACCACCCTCTGCAGGTGTGGACAGAGAATGCAGACGGGTCCGGGGCCGTGAACTTCCTGACAGGCATGGGAGGCTTCCTGCAGGCAGTGCTATTTGGATGTACAGGCTTCAGCTCTCCCCACAGGGTCACCTGCAGAGGTGTGACCTTTGATCCTCTGTGCCTGACGGACATCTCCAGAGTGTGTGTGTCTGGCATCTTCTACCGGGGGAACAGGCTCAACTTTACCTTCTGCAAGGACTCAGTGATGGTTGAGGTCACAGCCCAGGCATGGCCTGGGGCTCCTCAGTTGGAGGCTGAGCTGTGGCCATCAGGAGCTCAGCTCCCCCTGCTGCTGGGGCACAAGGTTTCATTTCCTTGTTCAGCTGGCCGGATACAAAGATCACTCCCATAG

XM_004851750.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X3

Length: 2190 bp    Location: 22142601..22136826   Strand: -
>XM_004851750.1
ATGGAGGACGCCCAGCCGGACCCCACCGTGTTTGCCTCCCACTCTCTGCCCAGGGACCCCCGCCTGTTGGCCACTGTGACCAACGTGTACCTGGGCACACGTGTGTACCATGACACACTGCACGTGAGCGGCGTGTACAACGGGGCCCGGGGCAGCACACACCGGGCGGTCCTGCCCAGCCCCCTTAACGTGCGGCTGGAGGCCCCCGCGGGGAAAGGAGCCCAGCTGACCCAGACCTTTGCTCTGGACACCAACACAGGCTCCTTCCTGCACACCCTGGAGGGCCCCAGCTTCCGGGCCTCCCAGCGCATCTATGCCCACCGCGTGCTGCCCCATGTCCTGGCCTTCAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGGTACCTGTGGGGCCTCACGCTCACCCCGGAGCAGCCAGGGGGCCCCCGGCAGGAGGTGCACATGCTGTGGACGCCAGTGCCCCCTGCCCTGACCCTTGGCGAAGGCGAAGAGACTAGGACCTGGGACTTCCTGACCGTGGTGGGTGGCAGCCGGGTGGAGGCCCAGGCCTGCCTCAACGAGGCCTTACAGCTGCAGGCCACGGGCTCTCTGTACGCCATCCACATGCAGGCTTGGGCCCAGTTCTGGACGGGCTGCAGTCTGGATGTGGCAGGGCCCCTGGCTCTGTGCCAGGCTGTCCGTAGCTCTTTTTACTACCTGTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACCATGCCACCCAGGACCTGCAATTCTTCCGAGAAGCTGGTGGCTGGGACGTGGTCAGCGCTGTGGCTGAGTTTTGGTGCAGCCGGGTGGAGTGGAACCCCAAGGAGAAGAAATTCGACCTGAGAGGTGCGGGTCTGGGCAGGCGGGCAGGCCGGCAGGAGTGTGGATGTTCCTGGGCTGCCCATGCTGACTGCTGCACAATGTGCTGCGGTGGACTTATGTGCCCAGGAGTTATGCCCCCTGATGAGTACCATGCAGGAGTCGACAACTCTGTGTACACCAATGTCCTGGTCCAGAACAGCCTGCACTTTGCGGCTGCCCTGGCACGGGACCTGGGTCAGCCTTTCCCTGACAAGTGGCTGGTGGTGGCTGATGGGATCGAGGTGCCCTTTGATCCCGAGCAGAACTTCCACCCTGAGTTTGATGGGTACAAGCCTGGAGAGGAGGTGAAGCAGGCTGATGTCGTGCTCCTGGGATACCCCGTCCCCTTCCCCCTGAGTCCTGATGTCCGCAGGAGAAACCTGGAGATTTACGAGGCTGTGACGTCCCCTCGGGGCCCAGCCATGACCTGGAGCATGTTTGCTGTGGGCTGGATGGAGCTGAAGGACCCGTCACGGGCACAGAGTCTTCTGGACAGGAACATCACCAATGTCACCGAGCCCTTCAAGGTGTGGACAGAGAATGCAGACGGGTCCGGGGCCGTGAACTTCCTGACAGGCATGGGAGGCTTCCTGCAGGCAGTGCTATTTGGATGTACAGGCTTCAGCTCTCCCCACAGGGTCACCTGCAGAGGTGTGACCTTTGATCCTCTGTGCCTGACGGACATCTCCAGAGTGTGTGTGTCTGGCATCTTCTACCGGGGGAACAGGCTCAACTTTACCTTCTGCAAGGACTCAGTGATGGTTGAGGTCACAGCCCAGGCATGGCCTGGGGCTCCTCAGTTGGAGGCTGAGCTGTGGCCATCAGGAGCTCAGCTCCCCCTGCTGCTGGGGCACAAGGTTTCATTTCCTTGTTCAGCTGGCCGGATACAAAGATCACTCCCATAG

XM_004851753.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X6

Length: 1962 bp    Location: 22141798..22136826   Strand: -
>XM_004851753.1
ATGCCCACCGCGTGCTGCCCCATGTCCTGGCCTTCAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGGTGAGCGGGGGCCGGGTCCTGGTGGGGTGACCCCAGAGGAAGCCATCACTGAGGCACAGCCACACCTTCACAGGTACCTGTGGGGCCTCACGCTCACCCCGGAGCAGCCAGGGGGCCCCCGGCAGGAGGTGCACATGCTGTGGACGCCAGTGCCCCCTGCCCTGACCCTTGGCGAAGGCGAAGAGACTAGGACCTGGGACTTCCTGACCGTGGTGGGTGGCAGCCGGGTGGAGGCCCAGGCCTGCCTCAACGAGGCCTTACAGCTGCAGGCCACGGGCTCTCTGTACGCCATCCACATGCAGGCTTGGGCCCAGTTCTGGACGGGCTGCAGTCTGGATGTGGCAGGGCCCCTGGCTCTGTGCCAGGCTGTCCGTAGCTCTTTTTACTACCTGTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACCATGCCACCCAGGACCTGCAATTCTTCCGAGAAGCTGGTGGCTGGGACGTGGTCAGCGCTGTGGCTGAGTTTTGGTGCAGCCGGGTGGAGTGGAACCCCAAGGAGAAGAAATTCGACCTGAGAGGTGCGGGTCTGGGCAGGCGGGCAGGCCGGCAGGAGTGTGGATGTTCCTGGGCTGCCCATGCTGACTGCTGCACAATGTGCTGCGGTGGACTTATGTGCCCAGGAGTTATGCCCCCTGATGAGTACCATGCAGGAGTCGACAACTCTGTGTACACCAATGTCCTGGTCCAGAACAGCCTGCACTTTGCGGCTGCCCTGGCACGGGACCTGGGTCAGCCTTTCCCTGACAAGTGGCTGGTGGTGGCTGATGGGATCGAGGTGCCCTTTGATCCCGAGCAGAACTTCCACCCTGAGTTTGATGGGTACAAGCCTGAGCATGTTTGCTGTGGGCTGGATGGAGCTGAAGGACCCGTCACGGGCACAGAGTCTTCTGGACAGGAACATCACCAATGTCACCGAGCCCTTCAAGGTCAGCCTGTTAGCACCCTTGACCCACAGGCTGACCCCACCGGCCTCCACTCCCGCCCATGTGGTCACAGCCCGAGTTCCTCTTGCCCTTGGCAAGGCAGCCGCAGGAGGCTAGTGTGCTGGGCCTGCCACAACCACCCTCTGCAGGTGTGGACAGAGAATGCAGACGGGTCCGGGGCCGTGAACTTCCTGACAGGCATGGGAGGCTTCCTGCAGGCAGTGCTATTTGGATGTACAGGCTTCAGCTCTCCCCACAGGGTCACCTGCAGAGGTGTGACCTTTGATCCTCTGTGCCTGACGGACATCTCCAGAGTGTGTGTGTCTGGCATCTTCTACCGGGGGAACAGGCTCAACTTTACCTTCTGCAAGGACTCAGTGATGGTTGAGGTCACAGCCCAGGCATGGCCTGGGGCTCCTCAGTTGGAGGCTGAGCTGTGGCCATCAGGAGCTCAGCTCCCCCTGCTGCTGGGGCACAAGGTTTCATTTCCTTGTTCAGCTGGCCGGATACAAAGATCACTCCCATAG

XM_004851755.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X8

Length: 1863 bp    Location: 22142601..22137767   Strand: -
>XM_004851755.1
ATGGAGGACGCCCAGCCGGACCCCACCGTGTTTGCCTCCCACTCTCTGCCCAGGGACCCCCGCCTGTTGGCCACTGTGACCAACGTGTACCTGGGCACACGTGTGTACCATGACACACTGCACGTGAGCGGCGTGTACAACGGGGCCCGGGGCAGCACACACCGGGCGGTCCTGCCCAGCCCCCTTAACGTGCGGCTGGAGGCCCCCGCGGGGAAAGGAGCCCAGCTGACCCAGACCTTTGCTCTGGACACCAACACAGGCTCCTTCCTGCACACCCTGGAGGGCCCCAGCTTCCGGGCCTCCCAGCGCATCTATGCCCACCGCGTGCTGCCCCATGTCCTGGCCTTCAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGGTACCTGTGGGGCCTCACGCTCACCCCGGAGCAGCCAGGGGGCCCCCGGCAGGAGGTGCACATGCTGTGGACGCCAGTGCCCCCTGCCCTGACCCTTGGCGAAGGCGAAGAGACTAGGACCTGGGACTTCCTGACCGTGGTGGGTGGCAGCCGGGTGGAGGCCCAGGCCTGCCTCAACGAGGCCTTACAGCTGCAGGCCACGGGCTCTCTGTACGCCATCCACATGCAGGCTTGGGCCCAGTTCTGGACGGGCTGCAGTCTGGATGTGGCAGGGCCCCTGGCTCTGTGCCAGGCTGTCCGTAGCTCTTTTTACTACCTGTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACCATGCCACCCAGGACCTGCAATTCTTCCGAGAAGCTGGTGGCTGGGACGTGGTCAGCGCTGTGGCTGAGTTTTGGTGCAGCCGGGTGGAGTGGAACCCCAAGGAGAAGAAATTCGACCTGAGAGGTGCGGGTCTGGGCAGGCGGGCAGGCCGGCAGGAGTGTGGATGTTCCTGGGCTGCCCATGCTGACTGCTGCACAATGTGCTGCGGTGGACTTATGTGCCCAGGAGTTATGCCCCCTGATGAGTACCATGCAGGAGTCGACAACTCTGTGTACACCAATGTCCTGGTCCAGAACAGCCTGCACTTTGCGGCTGCCCTGGCACGGGACCTGGGTCAGCCTTTCCCTGACAAGTGGCTGGTGGTGGCTGATGGGATCGAGGTGCCCTTTGATCCCGAGCAGAACTTCCACCCTGAGTTTGATGGGTACAAGCCTGAGCATGTTTGCTGTGGGCTGGATGGAGCTGAAGGACCCGTCACGGGCACAGAGTCTTCTGGACAGGAACATCACCAATGTCACCGAGCCCTTCAAGGTGTGGACAGAGAATGCAGACGGGTCCGGGGCCGTGAACTTCCTGACAGGCATGGGAGGCTTCCTGCAGGCAGTGCTATTTGGATGTACAGGCTTCAGGTGAGCACAGGAATATGGGGGGGACTGACCTCATCATCTCTCACACAGCTCTCCCCACAGGGTCACCTGCAGAGGTGTGACCTTTGA

XM_004851759.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X12

Length: 1710 bp    Location: 22142601..22137785   Strand: -
>XM_004851759.1
ATGGAGGACGCCCAGCCGGACCCCACCGTGTTTGCCTCCCACTCTCTGCCCAGGGACCCCCGCCTGTTGGCCACTGTGACCAACGTGTACCTGGGCACACGTGTGTACCATGACACACTGCACGTGAGCGGCGTGTACAACGGGGCCCGGGGCAGCACACACCGGGCGGTCCTGCCCAGCCCCCTTAACGTGCGGCTGGAGGCCCCCGCGGGGAAAGGAGCCCAGCTGACCCAGACCTTTGCTCTGGACACCAACACAGGCTCCTTCCTGCACACCCTGGAGGGCCCCAGCTTCCGGGCCTCCCAGCGCATCTATGCCCACCGCGTGCTGCCCCATGTCCTGGCCTTCAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGGTACCTGTGGGGCCTCACGCTCACCCCGGAGCAGCCAGGGGGCCCCCGGCAGGAGGTGCACATGCTGTGGACGCCAGTGCCCCCTGCCCTGACCCTTGGCGAAGGCGAAGAGACTAGGACCTGGGACTTCCTGACCGTGGTGGGTGGCAGCCGGGTGGAGGCCCAGGCCTGCCTCAACGAGGCCTTACAGCTGCAGGCCACGGGCTCTCTGTACGCCATCCACATGCAGGCTTGGGCCCAGTTCTGGACGGGCTGCAGTCTGGATGTGGCAGGGCCCCTGGCTCTGTGCCAGGCTGTCCGTAGCTCTTTTTACTACCTGTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACCATGCCACCCAGGACCTGCAATTCTTCCGAGAAGCTGGTGGCTGGGACGTGGTCAGCGCTGTGGCTGAGTTTTGGTGCAGCCGGGTGGAGTGGAACCCCAAGGAGAAGAAATTCGACCTGAGAGGTGCGGGTCTGGGCAGGCGGGCAGGCCGGCAGGAGTGTGGATGTTCCTGGGCTGCCCATGCTGACTGCTGCACAATGTGCTGCGGTGGACTTATGTGCCCAGGAGTTATGCCCCCTGATGAGTACCATGCAGGAGTCGACAACTCTGTGTACACCAATGTCCTGGTCCAGAACAGCCTGCACTTTGCGGCTGCCCTGGCACGGGACCTGGGTCAGCCTTTCCCTGACAAGTGGCTGGTGGTGGCTGATGGGATCGAGGTGCCCTTTGATCCCGAGCAGAACTTCCACCCTGAGTTTGATGGGTACAAGCCTGAGCATGTTTGCTGTGGGCTGGATGGAGCTGAAGGACCCGTCACGGGCACAGAGTCTTCTGGACAGGAACATCACCAATGTCACCGAGCCCTTCAAGCTCTCCCCACAGGGTCACCTGCAGAGGTGTGA

XM_004851761.1 Coding sequence

Sirt3 sirtuin 3, transcript variant X1

High confidence: 4 potential gene matches
Length: 1245 bp    Location: 22199601..22233933   Strand: +
>XM_004851761.1
ATGCCGGGAGTGCCGCGGCCGCCAGTCTCCGCGCGCGCCAGTCTCCGCGCGCGCCAGTCTTCATGGGAACTGCGCTCCTCAGCCACCGGGGCGAAATTCTCTCTCGGGCTCAGGCCGGGCTTCCGGTGCACCAGGCCGGGGGCGGGATGGGGCCTAGGAGGTCTAAGAACAGTGGGCCACGCTGACAGGCCGGGCGCAGGGGCCGGGGCGCGGCGCCACGTGGTGCTCCTGGACGCGCTTGCGCGGCTGAGTGTCATGGCGCAGTGGGGCCCCGTGGCGCGGTGGGGCCGGCGGGCTCTGTCAGCTCTCGGGCCGTGGGGCCCCGGGAGTATTACAGGTAGAAGAAGGTCCATATCTCTTTCTGTAGGTGCTTCAGGGATTTTTGGAAGCAGAGGCAACAGTGAGAAGAAGTTTTCCCTGCAGGATGTAGCTGAGCTGATTCGGACCAGAGCCTGCCAGAGAGTGGTGGTCATGGTGGGTGCTGGAATCAGCACACCCAGTGGCATTCCGGACTTCAGATCTCCAGGGAGTGGCCTCTACAGCAACCTCCAGCAGTACAACATCCCATACCCAGAGGCCATTTTTGAGCTCGAATTTTTCTCTCATAACCCCAAACCCTTTTTCACTTTGGCCAAAGAGCTGTACCCTGGGAACTATCGGCCCAATATTATTCATTACTTCTTCAGGCTGCTCCATGACAAGGGCCTGCTTCTGCGGCTCTATACCCAGAACATTGATGGACTTGAGAGAGTGTCTGGCATCCCAGTTTCAAAGCTGGTTGAAGCTCACGGAACCTTTGCCTCAGCCACCTGCACTGTCTGTCGAAGGTCCTTCCCAGAGGAGGATTTCTGGGCTGATGTGATGATGGACAGGGTGCCATGCTGCCCAGTTTGCGTTGGCATCATGAAGCCTGATATCGTGTTCTTTGGGGAACCACTGCCTGAGAGGTTCTTGCTACATGTGCTTGATTTCCCCATGGCGGATCTGCTGCTTATCCTTGGGACCTCCCTGAAGGTGGAACCTTTTGCCAGCTTGTCTGAGGCTGTAGGTGGCTCAGTGCCTCGACTGTTCATCAACCGGGACCTAGTGGGGTCCTTTGCTTGGCGTCCTCGCAGCAGAGATGTGGTCCAGCTGGGGGATGTGGTTCACAGCGTGCAAAGGCTGGTGGAGCTTCTGGGCTGGACAGAAGAGTTGCAGGATCTTATCCAGCGGGAAACTGGAAAGCTGGATGGACGAGACAAATAG

XM_004851763.1 Coding sequence

Psmd13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13, transcript variant X1

Length: 1140 bp    Location: 22199633..22188881   Strand: -
>XM_004851763.1
ATGAAGGATGTACCGGGCTTCTTACAGCAGAGCCAGAGCTCCGGGCCCGGGCAGGCCGCCGTGTGGCACCGTCTGGAAGAGCTCTACACAAAGAAGTTATGGCATCAACTGACACTTCAGGTCCTTGATTTTGTACAGGACCCATGCTTTGCCCAAGGAGATGGTCTCATTAAGCTTTATGAAAACTTCATCAGTGAATTTGAACACAGAGTGAACCCTTTGTCCCTGGTAGAAATAATTCTTCATGTGGTTAGACAGATGACTGATCCCAATGTGGCTCTTACTTTTCTGGAAAAGACTCGCGAGAAGGTGAAAAGTAGTGATGAGGCAGTGATCCTGTGTAAAACAGCAATCGGAGCTCTAAAATTAAACATCGGGGATCTACAGGTTACAAAGGAAACGATTGAAGACGTTGAAGAGATGCTCCACAACCTCCCCGGCGTGACATCGGTTCACAGTCGTTTCTATGATCTCTCCAGTAAATACTATCAAACAATTGGGAACCATGCTTCCTACTACAAAGATGCTCTGCGGTTTCTGGGCTGTGTTGACATCAAAGATCTACCAGTTTCAGAGCAGCAGGAGAGAGCCTTTACACTGGGGCTTGCAGGACTTCTCGGCGAGGGAGTTTTTAACTTTGGAGAGCTGCTCATGCACCCTGTGCTTGAGTCACTGCGGGCCACCGACCGGCAATGGCTGATTGACACCCTCTATGCCTTCAATAGTGGCGATGTGGACAGGTTCCAGACTCTGAAGACTGCCTGGGGCCACCAGCCTGACTTAGCTGCCAACGAAACCCAGCTTCTGCGGAAGATTCAGTTGTTGTGTCTAATGGAGATGACTTTCACACGACCTGCCAACCACAGACAGCTCACTTTTGAAGAAATTGCCAAAAGTGCCAAAATCACAGTGAACGAGGTAGAGCTGCTGGTGATGAAGGCACTCTCGGTGGGACTGGTGAGAGGCAGCATAGATGAGGTCGACAAGCGAGTCCACATGACCTGGGTGCAGCCCCGCGTGCTAGATTTGCAGCAGGTGAGGTGGTGGCTGGGCCCCTGGCTTACCTGTGTGGGGTTGGGGTTGTGTCTGGGTCTTGGTTTCGCATGGACCGAGGCCATCCAGGAGGAAGGGATCACCTGA

XM_004851762.1 Coding sequence

Sirt3 sirtuin 3, transcript variant X2

Length: 774 bp    Location: 22199913..22233933   Strand: +
>XM_004851762.1
ATGGTGGGTGCTGGAATCAGCACACCCAGTGGCATTCCGGACTTCAGATCTCCAGGGAGTGGCCTCTACAGCAACCTCCAGCAGTACAACATCCCATACCCAGAGGCCATTTTTGAGCTCGAATTTTTCTCTCATAACCCCAAACCCTTTTTCACTTTGGCCAAAGAGCTGTACCCTGGGAACTATCGGCCCAATATTATTCATTACTTCTTCAGGCTGCTCCATGACAAGGGCCTGCTTCTGCGGCTCTATACCCAGAACATTGATGGACTTGAGAGAGTGTCTGGCATCCCAGTTTCAAAGCTGGTTGAAGCTCACGGAACCTTTGCCTCAGCCACCTGCACTGTCTGTCGAAGGTCCTTCCCAGAGGAGGATTTCTGGGCTGATGTGATGATGGACAGGGTGCCATGCTGCCCAGTTTGCGTTGGCATCATGAAGCCTGATATCGTGTTCTTTGGGGAACCACTGCCTGAGAGGTTCTTGCTACATGTGCTTGATTTCCCCATGGCGGATCTGCTGCTTATCCTTGGGACCTCCCTGAAGGTGGAACCTTTTGCCAGCTTGTCTGAGGCTGTAGGTGGCTCAGTGCCTCGACTGTTCATCAACCGGGACCTAGTGGGGTCCTTTGCTTGGCGTCCTCGCAGCAGAGATGTGGTCCAGCTGGGGGATGTGGTTCACAGCGTGCAAAGGCTGGTGGAGCTTCTGGGCTGGACAGAAGAGTTGCAGGATCTTATCCAGCGGGAAACTGGAAAGCTGGATGGACGAGACAAATAG

XM_004851765.1 Coding sequence

Bet1l Bet1 golgi vesicular membrane trafficking protein-like

High confidence: 4 potential gene matches
Length: 336 bp    Location: 22240972..22245040   Strand: +
>XM_004851765.1
ATGGCGGGCTGGACTCGGGCTCAGAGCTCTGGTGCTGTGGAGGAGATTTTAGACCGGGAGAACAAGCGGATGACTGATAGCCTGGCCTCCAAGGTTACCAGGCTCAAATCGCTGGCCCTGGACATCGATAGGGATGCAGAAGACCAAAACCGATACCTGGACAGCATGGACTCAGATTTCACAAGCGTGACTGGCCTGCTCACGGGGAGTGTGAAGCGGTTTTCCACGATGGCACGGTCTGGGCGAGACAACCGGAAGCTTTTGTGTGGCATGGCTGTGGGCCTGCTCGTGGCCTTCTTCATCCTTTCCTACTTCTTGTCAAGGGCAAGGACATGA

XM_004851791.1 Coding sequence

Fibin fin bud initiation factor homolog (zebrafish)

High confidence: 4 potential gene matches
Length: 651 bp    Location: 16859973..16860706   Strand: +
>XM_004851791.1
ATGGCGTGGGCCACGCTGCTGTGCGTGGGGCTGCTGTGCGTGGGGCTGCTGTGCCCGCTGTGCCAGGGCTACTTCGACGGCCCCCTGTACCCAGAGATGTCCAACGGGAGCCTGCACCACTACTTCGTGCCGGACGGGGACTACGAGGAGAACGACGACCCCGAGAAGTGCCAGCTGCTGTTCCGCGTGAGCGAGCGCGGCCGCTGCGCCCAGGGCGCGGGGAGCCCGGCCGGGGACGCGCTGCGCCTGAGCCTGCGCGAGGAGTTCACGGTGCTGGGCCGCCAGGTGGAGGACTCGGGCCGCGTGCTGGAGGGGCTGGGCAAGAGCATCTCCTACGACCTGGACGGCGAGGACAGCTACGGCGCCTACCTGCGCCGCGAGTCGCGCCAGATCGGGGATGCCTACTCCAGCTCGGAGCGGTCGCTCAGCGAGCTAGAGAGCAAGTTCCAGCAGGGCCGGGAGCAGGACGGCCGGCAGGACGCCAGGCTGGCCGCCGACTTCCTGGGCATGCTGCTGCGCACGCGCGCCCTGCTGCGGGACACGCTGCGCATCTCGGCGGGGCTGCGCGACAGGTCCGAGCTGCTGGCGCTCACCCTCCGCAGCCACGGCTCCCGGCTGGGGCGCCTGCGGAGCGGCTTCCCGAGCGCCTAG

XM_004851679.1 Coding sequence

Rplp2 ribosomal protein, large, P2, transcript variant X3

High confidence: 1 potential gene match
Length: 606 bp    Location: 21701359..21698821   Strand: -
>XM_004851679.1
ATGAGCAACGTCCATTTGGAACGGCTTTTCACTTTTGCCGCGCGACTTCCCGACTGGGGAACCGGACCACGGCTCTACTCCCGTCGTCATTGGCTGAGCGCTCCGTTGCGTCATTTGTGGGAGCCCTCGCGCAGCGCCGCACACGCCCGGAGGCTTTTGGGTAACGGTTTACCCCCGCCCCTTCTGCCGGCCTCTTCCTTTTGCTTCCCGACGTCGCAGAGGTCGCACGCGAGAGGCCTCTCTGCCGCCACCGCCGCCGACATGCGGTACGTCGCCTCCTACTTGCTAGCCGCCCTCGGAGGAAACCCCTCCCCCAGCGCCAAGGACATCAGGAAGATCCTGGACAGTGTGGGCATCGAGGCAGACGATGACCGGCTTAATAAGGTCATCAGTGAGCTGAATGGGAAAAACATTGAAGATGTCATTGCCCAGGGCATTGGCAAGCTTGCCAGTGTGCCGGCTGGTGGGGCTGTGGCTGTATCTGTTGCCCCTGGCTCTGCAGCTCCTGCTGCTGGTTCTGCCCCTGCTGCAGAGGAGAAGAAAGAAGAGAAGAAGGAGGAGTCCGAGGAATCTGATGATGACATGGGATTTGGCCTGTTTGACTAA

XM_004851768.1 Coding sequence

Scgb1c1 secretoglobin, family 1C, member 1

High confidence: 4 potential gene matches
Length: 288 bp    Location: 22251269..22250131   Strand: -
>XM_004851768.1
ATGAAGGGGAGCGGCAGCCTCCTGCTAGTGACCCTCGCTGTGCTCTGTGCCTGTGGTAAGTCTGGGCCAGAGGACAACAATGAATTCTTCATGGAATTCCTCCAAACACTGCTGGTTGGAAGCCCAGAGGAGCTCTATGATGGGCCGCTTGGCAAGTACAATGTCAACCAGGGTGCCAAGGAGGCGCTGACAGAGCTCAAGTCCTGCATTGATGGTCTGCAGCCCACGCACAAGGCGGATCTGGTCGAGTTGCTGGAGCAAGTGCTGGGCAGTGAGGATGACGCCTGA

XM_004851778.1 Coding sequence

Otog otogelin

High confidence: 4 potential gene matches
Length: 8763 bp    Location: 9156158..9232484   Strand: +
>XM_004851778.1
ATGGGAGCCAGAGCGCCCGCGCTCTGCTTGCTACTCGCTAGCGTCTGGCTGCCCCGAGGTGAGCCGGCCCGGGAGTATCTTCGGGTGCAGCAGCTGAGAGCACTGAGGAGTGGGGATGATCTCCCCTCCCCAGCCACAGCCCCCACAGTGCCGGCCAGAGCACAGCCCTCACCCCAGCCAGCCCCGGAACCCAGCCACAGCTCCCCGGAGGTGACCCTTGCCATCGGGGATGCCACCACAGTGATGGGAGGCCAGGAGGCTGAAGCCCTGGACGCCTTGGCCGTGTCCTCCTGGGAAAGGTGGCTCCATCGGGCCAAGTGTGCCCCGGCTTACTTGTTCTCCTGTTTCAATGGGGGTGAGTGTGTGCACCCCACCTTCTGTGACTGTAGACGCTTCAATGCGACTGGACCACGCTGCCAGATGGTGTACAATGCCGGCCCTGAGCGGGACAGCATCTGCCGAGCGTGGGGGCAACACCATGTGGAGACATTTGACGGCCTCTACTACTACCTCTCTGGGAAGGGCAGCTACACATTGGTGGGGCGCCATGCACCTGAGGGACAGAGCTTCTCCATCCAGGTGCACAATGACCCGCAGTGTGGCTCTGCCCCCTACACCTGCTCAAGGTCGGTCAGTCTCTTCCTCGAGGGTGAGCAGGAGATCCACCTGGCCAAGGAAGTCACCCGCGGAGGTGTGAGGGTCCAGCTGCCACATGTGATGGGGGCTGTGCATCTGCAGCAGCTGGCTGGCTACGTCATCCTGCGGCGTCAGTCTGCTTTCACGCTGGCTTGGGATGGGGTCTCCGCTGTCTACATCAAGATGAGCCCAGAGTTCCTGGGCTGGACCCATGGGCTGTGCGGGAACAACAATGCCGACCCCCAGGATGACCTGGTGACTAGCTATGGGAAGCTGACAGAAGATATGGCTGAGTTTGTGCACAGCTGGCAGGAGCAGGCTCCCAACCACCCTCCAGGCACCACGACTGCCTCCCTGCCTCGCCCGCCATGCCTGCAGCAGAGCCCTGGAACCATGCAGGGTGTATATGAGCGCTGTGAGATGCTGCTGCGGTCCCCCTTTGATGCTTGCCATGCCTACGTCAGTCCTCTGCCCTTCACAGCCAGCTGTACCAGCGATCTCTGCCAATCAGGGGGTGATGAAGCTGCCTGGTGCCGGGCCCTGGCGGAGTATGCCCGGGCATGTGCCCAGGCCGGGCAGCCCCTACAGGGCTGGAGGACCCAGCTTCGACAATGCACTGTGCATTGCAAAGAGAAGGCCTTTACCTACAACGAGTGTATTGCCTGCTGCCCTGCCTCCTGCCAGTCCCGGGCCTTCTGTGTGGACAGTGAGATCGCCTGTGTGGATGGCTGCTACTGCCCCAACGGGCTGATCTTTGAGGATGGGGCCTGCGTGGCACCAGCTGACTGCCCTTGTGAGTTCCACGGGACCCTGTACCCGCCTGGCTCTGTGGTGAAGGAAGACTGCAATGCCTGCACCTGCACTGCGGGCAAGTGGGTGTGCAGCACGGCTCTCTGCCCAGCTGAGTGCTCAGTGACTGGTGACATCCATTTCACGACCTTTGACGGCCGCCGGTACACTTTCCCTGCCACTTGTCAGTACATCCTGGCCAAGAGCCGCTCCTCGGGCACCTTTACAGTGACGCTGCAGAACGCCCTGTGTGGTCTGAACCAGGATGGAGCCTGTGTCCAGTCAGTATCTGTGATTCTGCACCAGGACCCTCGGAGACAGGTCACCCTGACCCAGGCAGGGGATGTCCTCCTGTTTGACCAGTACAAGATCACCCCACCCTACACGGACGATGCCTTTGAGATTCGGAGGCTGTCCTCTGTGTTCCTTCGGGTAAAGACCAACGTGGGTGTACGGGTGCTCTATGACAGAGAGGGATTGCGGCTCTACCTACAGGTGGACCAGCGATGGGTGGAAGACACTGTGGGCCTCTGTGGCACCTTCAATGGCAACACGCAGGACGACTTCCTGTCCCCAGTTGGAGTACCTGAGAGCACCCCACAACTCTTTGGCAATTCTTGGAAAACACTGTCTGCCTGCTCCCCACTGGTCCCCGGCTCCCCACTGGACCCCTGTGATGTGCACTTGCAAGCCGCCTCCTACGCGGTGCAGGCCTGCAGTGTGCTCACTGGGGAGCTCTTTGCTCCCTGCTCTGCATACTTGAGTCCTGTGCCCTACTTCGAGCAATGCCGCCAGGACACCTGCCGCTGCGGACAGCCCTGCCTGTGCGCCACACTGGCCCACTATGCCCGCCTTTGCCGGCGCCATGGGCTCCCAGTCGACTTCCGTGCTCGCCTGCCAGCCTGCGCACTGTCCTGTGCGGCTACCAAGGAGTACAGCCCCTGTGTGGCCCTGTGTGGACAGACCTGCCAGGACCTGGCCAGCCCTGAGGCTTGTGGGGTTGATGGTGGTGCCGACTTCAGCAGGGATGAGTGTGTGGAGGGCTGTGCCTGCCCCCCGGACACCTATCTGGACACCCAAGTTGACCTCTGTGTCCCCAGGAACCAGTGCTCCTGCCACTTTCAGGGAGTGGACTATCCCCCCGGGGACAGTGACATCCCATCTCTGGGCCACTGCCACTGCAAAGATGGAGTCATGAGCTGTGACAGCAGAGTCCCAGAGGCAGCCTGCCCGGTGGGCCAGGTCTTCGTGAACTGCAGTGACCTGCACACAGACCCCGAGCTGAGCAGGGAGAGGACGTGTGAGCAGCAGCTGCTGAACCTAAGTGTGACAGCCCGAGGCCCCTGCCTGTCAGGCTGTGCCTGTCCCCAGGGCCTGCTCAGACATGGGGATGCATGTTTCCTGCCAGAGGAGTGCCCATGCACTTGGAAGGGGAAGGAGTATTTCCCTGGGGACCAGGTGACGTCACCCTGCCACACCTGCTTCTGCCAGCAGGGCTTGTTCCAGTGCACCCTGCACCCTTGTGCCTCCACCTGCACTGCCTATGGTGACCGGCATTACCGCACCTTCGATGGGCTCCCATTTGACTTCGTGGGGGCCTGCAAAGTGCACCTGGTCAAGAGCACATCGAATTTCAGCTTCTCTGTGATTGTAGAAAATGTAAACTGCTACAGCTCTGGTATCATCTGCAGGAAATTTATTTCCATCAATGTTGGGAACTCAGTCATCATCTTTGACGACGACTCGGGAAATCCTAGTCCTGAGAGCTTCCTGGACGAGAAGCAGGAGGTGCACACGTGGCAAGCAGGGTTCTTCATGCTGGTGCATTTCCCGCGGGAGCACATCACCCTCCTGTGGGATCAGAGGACCACGGTGCATGTGCAGGCTGGGCCTCAGTGGCAGGGCCAGCTGGCAGGCCTCTGTGGGAACTTTGACTTAAAAACCATCAATGAGATGCGGACCCCGGAGAACCTAGAGTTAACCAACCCGCAGGAGTTTGGCAGCAGCTGGGCTGCAGTTGAGTGCCCCGATACCCTGGACCCCCGGGACCCATGTGTCTTGAATCCTCTCCGGGAGCCATTTGCCAAGAAGGAGTGCAGCATCCTGCTCAGTGAGGTGTTTACGACTTGTCACCCTGTGGTTGACGTCACTTGGTTTTACTCAAATTGCCTCACAGACACGTGTGGGTGCAGCCGCGGGGGTGATTGCGAGTGCTTCTGCGCCAGCGTGTCTGCCTACGCCCACCAGTGCTGCCAGCACGGGGTGGCCATTGACTGGCGGACCCCCCGCCTCTGCCCTTATGACTGTGATTTCTTTAACAAAGCGCTAGGTAAGGGCCCCTACCAGCTGTCCAGTGTGGCAGCCGGCGGGGCCCTGGTGGCCATGAAGTCTGTGGGTGGTGACATAGCCCTAGTAAAGGCAGAGGAGGTGGCGCCAGGGGACATCGTGAGCTTCCTGCTGACAGCTGCTCTGTACAAGGCCACGGCCCACGACCCGGATGTGGTTTCCTTGGAGGCAGCAGACAGACCCAACTTCTTCCTCTACATCACGGCCAATGGGTCTGTGGAACTGGCTAAGTGGCAGGGCGGAGAAGCCTTCCACCACCATGCCTCCTTCTCGCTGCACCGGGGGACATGGCGGGAGGGCCTGGTGGCCCTGGAGTCCCTGGCAAAACCTGGCTCCTTCCTCTACGTGTCACGCTCTGTGCTGGCCTTGCGGCACTATGTGCATACAGAGGCGTTTCGCAGGGGCACACTCTTCCGCCTTCTGGATGCCAAGCCCTTGGGGGCTGCCTACCCCATCTGTGAATGGCGCTATGATGCCTGTGCCAGCCCCTGCTTCCAAACCTGCCGGGACCCAGGAGCAGCCAGATGCCAGGATGTGCCCAGGGTAGAAGGCTGTGTCCCTGTCTGCCCCGTCCCCAAGGTCCTGGATGAAGTCACGCAGAGATGCGTCTACTTGGAGGACTGTGTGGAGCCAGCTGTTTGGGTCCCCACAGAGGCGCTCGGCAGTGAGACCCTGCCTCCTGGACGAGTGCTGCCCACCCCCAGAGACAAGCGGCCACAGCTGCCACCGGAAACTCCCACGGCCCCCATGCTCAGGCCAGCCCTCACCCCAGCAGCCCCTCTCACTGCAGCCCTGAACCCCGTGATGGCAGCCACTGAGGGGCCAGCGCTGGCCCCAGGCCCCACCCAGCCCACCCTGCAGCAGCCACTGGGGCTCACTGCCTCTAACTTCTCTGTCCACACCACAGAGGCCCCCGCCAGCAAGGGAGAAACCGCCAGTGTCTCGGCCACCTCCCACCTCCTGGGATCCACATCCCTCCCCTTATCTCTGCAGACACCCACTTCTGGCATGGCATCAGGTGCCATGGAGACAACCAGGATGACTGTGACCTCTGCAGGGAGCCCCGAGCTCACAGTCTCCTCCCAGTCCCCCCCTGTACCACGCTTCCCACTCATGACCAAAGCTGTGACGGTCCCAGGTCATGGCTCCTTGCCTGTTAGGACGACACTCCCGCCTCCCTCCTTGCCACCAAGTCCCTCCTCTAGGCCTACGGCTCCCCCTGGGGTGACCTCCAGGCCCCCTACCTCCACAGGCTTCCCCAAGGCTTTGCTGACACCTACTGTAACTGAGGTCACAAACAAGACAAGGACCCCCCAGCCCACCCTGGCCCAGAGCAGCACTGCCCCAGCGGTGGCTAGTACAGCCACGGAACAGGGTCTTGTCAGTCCCCTTGCCACCAACGGCCCAGAGGAGGTGCTACCCACAGGGAAGGGTGAACCCGGGCATGGCCAGCCCATGGGCCTGCCAGCATCCCTACCTCCAGGCTCAGTCCCCACTGCACTGCCCCACCCAGCCCTGCACGGCACCACGGCCCCCCGGCCTCCAGCTCTGGCCCCAGAGACCACGGCTGCTGCCAGCCTGCCCACAGCTGCTCAGGGGCTGGGAGCCACAGCCTTCCTGTCTCCAGAGTCAACCCGGCCTTCCCAGCTCCTCTCTGGCCTGCCTCCTGACACCAGCTTGCCCCTGGCCAAAGTGGGCACGTCTGCCCCAGTGGCCACGCCTGGCCCCAAGGGCTCTGTCACTGTCTCTGCACATCAGGCCACATCTCTGGCAGTGGCCTTGGCTCTACCTGCTCAGACACTCAGCCCCGCACTGCCTGTCACCCTGGCTGTGGCAGCCCAAGTCCACCCATCCAGTCAGACTGCCCCTCAGACAACAAGCGTGGCTCCGGGGCTGCTTCTGGGGGCCACATTGCCAACCTCTGGAGTTGTAGCTGTGGCTGCAGGGGCGGCCCGTACTGCATCTGTTGTCCCACGAAAGAGCACCACACAGAAAATGGCCATCCTGTCCAAACACATGTCCCTGCCCACTTCTGTCTATGGCTCTGCCAAGAGTGGGCCCACTGGGCTTACACCAGCCTCAGCCCACACTCCTGCTCCCTTGGTGACTGAGGCTGGCACAGTGCCACTGGTGGCCACATCCCATGCCCCCAGCCGTGTCTCAGCCAGGACGGCCTCCCAGGAGAGCTCACTGGTTCTGCTGCCTCAGCTGGTAGAGGCCCAGGGAACCTCAGCAGGACCCCAGCTCCCAGTGGTGCCCCTGGGTGAGGCCACCACCGAGCAGTCTGGGCGCTCAGCCCCGGCCCATGGCATTGCAGCAGGTTCAGCTGAAGCCTTGGCCACCCTCGAGGCCAACACGTCTGCCACCTGTGTTCCCATTGCTGAGCAGGACTGTGTCCGCCACATCTGCATAGAAGGCCAGCTCATCCGTGTGAACCAGTCCCAGCACTGTCCTCAGGGTGCTAGACCCCCTCGCTGTGGGGTCCTGGGCCTCGCAGTGCGAGTGGGCGGGGACCACTGCTGTCCTCTCTGGGAGTGTGCCTGCCGGTGCTCAATCTTCCCTGACCTGAGCTTTGTGACCTTCGATGGGACCCACGTAGCCCTGTTCAAGGAGGCCATCTACATTCTCAGACAGAGCCCAGACGAGATGGTCACCGTCCACGTCCTGGACTGCAAAAGTGCCAACCTGGGACACTTGAACTGGCCTCCGTTCTGTCCAGTGATACTGAATGTGACTCACCTGGCCCATCAAGTCACCATCGACCGCTTCAACAGGAAGGTGATTGTGGACTCACAGGCTGTGTGGCCACCTGTGAGCAGGTATGGGTTCCAAATTGAGGACACAGGCCACATGTATGTCATCCAGACGCCCTCGAACATCCAGATCCAGTGGCTGCACAGCTCGGGACTCATGATCCTGGAGGCCAGCAAAACCAGCAAGGCCCGGGGCCATGGCCTATGTGGTATCTGTGATGGAGATGCAGCCAACGACCTCACCCTGAAAGACGGCTCTGTGGTGGGTGCAGCTGAGGACCCTGCTCCCTTTCTGGACAGCTGGCAGGTGCCCAGCTCCTTGACCTCAGTGGGCCAGACTCGTTTCCGCCCAGACAGCTGTGCTACAGCTGACTGCTCGCCCTGCCTTCGCATGGTGTCCAACCGCACCTTCAGCGCCTGCCACCGTTTTGTCTCTCCGGAGTCGTTCTGTGAGCTGTGGATCCGGGACACCAAGTACGTCCAGCAGCCCTGCGTGGCACTGACCGTGTATGTGGCCATGTGCCACAAATTCCATGTGTGCATCCAGTGGCGGCGCTCTGACTACTGCCCCTTCCTATGCTCCAGCGAGTCCACCTACCAGGCATGTGTGGCGGCCTGCGAGCCCCCCGACACCTGCCAGGATGGGATGCTGGGCCCCCTGGACCCTGAGCAGTGCCAGGTGCTGGGCGAGGGCTGTGTCTGTGCTGAGGGCACCGTCCTGCACCGGCGTTGCTCCTCGCTCTGCATCCCTGAGGACAAGTGCGCCTGCACCGACAGCATGGGGGTGCCGCGGGCCCTGGGCGAGACCTGGAACAGCTCTCTCAGTGGCTGCTGCCAGCAGCAGTGCCAAGCCCCAGACACCATCGTCCCAGTGGACCCGGACTGCCCAGGGCCCCGGCTAGAGAGCTGCCCACGCTTTGGGGAAGTGGTCCTGCTCCTTCCCACTGAGGACCCCTGCTGCCTGGGGACTGTCTGCGTGTGTAACCAGACTTTGTGTGAGGGCCTCGCCCCTACCTGCCGCCCAGGCCACAGACTCCGCACGCACTTCCGGGAAGACTCCTGCTGCCCCAGCTACAGCTGTGAATGTGACCCTGATGTGTGTGAGGCACAGCAGGTGCCCAGTTGCCGCCAGGACCAGACCCTGATTGCAGGCCGCCTGGGGGATTCGTGCTGCACCTCCTACTTCTGTGCCTGCGGCGACTGTCCAGATCCCATTCCTGAATGCCAGGAAGGGGAGGCGCTCACCGTGCACAGGAACACAACAGAGCTCTGCTGCCCGCTGTACCAGTGTGTGTGTGAGAGCTTTCGCTGTCCTCAAGTGCAGTGTGGCATGGGCACAGCCCTGGTGGAGGTGTGGAGCCCAGACCGATGCTGCCCCTACAAGTCCTGTGAGTGTGACTGCGGCACAATCCCCGTGCCCCGGTGCCATCTGTGGGAGAAATCTCAGCTGGACGAGAAGTTCATGCACAGTGAGGAGAATGTGTGTGGCTGCGCCAAGTATGAGTGTGTGAAAGCCCCTGTGTGTCTGAGCCGTGAGCTGGGGGTGCTGCAGCCAGGCCAGACGGTGGTAGAGCTCTCAGCAGATGGCGTGTGCCACACCTCCCGCTGCACGGGCCTGCTGGACCCCCTCACCAGCTTCTACCAGATCAACACCACCTCCGTGCTGTGTGACGTCCACTGTGAGGCGAACCAAGAGTATGAGCACCCCCGGGACCTGGCGGCTTGCTGTGGCTCCTGCAGGAATGTGTCCTGCCTCTTCACCTTCCCCAATGGCACCACCTCCCTGTTCTTGCCTGGGGCATCCTGGATCGCACACTGTGCCCGCCACCACTGCAGCAGCACTCCCCTGGGTGCCGTGCTTGTGCGCTCTCCCATCAGCTGCCCCCCACTCAATGAGACCGAGTGTGCCAAGGTTGGGGGCTCCGTGGTCCCTTCCTTGGAAGGATGCTGCAGGACATGTAAGGAGGATGGGCGCTCCTGCAAAAAGGTGACCATCCGCATGACCATCCGCAAGAACGACTGCAGGAGCAACACACCTGTGAACCTGGTGTCCTGTGACGGGAGGTGCCCGTCCGCCAGCATCTACAACCACAATGTCAACACCTATGCCCGCTTCTGCAAGTGCTGCCGTGAGGTGGGGCTGCACCGACGCTCCGTACAGCTCTTCTGCACCACCAACGCCACCTGGGTGCCCTATACAGTGCAGGAGCCCACTGACTGCGCCTGCCAGTGGTCCTGA

XM_004851788.1 Coding sequence

Mrgprx1 MAS-related GPR, member X1

High confidence: 3 potential gene matches
Length: 1167 bp    Location: 10511018..10492418   Strand: -
>XM_004851788.1
ATGACTGGTGAACGTATGCTAAGCCTATGTTTAGTATTACGAGAAACTTCCAAACTGCCTTCTAATTCTGTGTTCTCACAGCAACGTGTGCATGTTCCTGTTGCTGCACATCCTGAGCAGAATTTAAAGCTGCCAGTGTTTTGGACTTTCAGCCATTCTATTAGGTACACCAGTGAAGGGCTTATGAGCGTGGATCCAACCATAACATCCCAGGGGATGGACCCCACGACAGTGAATGGAACTGACGAGTCCTTAGTACAGACTTGTTATGAGACTTTGATCCCAGACTTCCTGATCATCATCATTGGCCTGGTAGGCCTGCCAGGAAATGCAGTTGTCATCTATCTCCTGGGATGTCGCATGCGCAGGAACACCATTTCAGTCTACATCCTCAACCTGGCTGCATCCGACTTCCTCGTCCTCTGCTGCCACTGTTTTGGTTCCCTGCTTATTGTCATCAGGCCCTTCCATCACCTCTATATAGGTATTAGTTTCATCCTAATCAACATAGCACTTATTCCGTACATCGCAGGTCTGAGCACACTCAGTGCCATTAGCATGGAGCGCTGCCTCTCTGTCCTGTGGCCCATCTGGTACCGCTGCCACCGTCCCAGACATATGTCAGCTATTGTGTGTACCCTACTATGGGCCCTATCCCTGCTGCTTAACATCCTGGAATGGAACTACTCTGGCTTCCTGTATGAGTTTTTTAGTAGTATTTGGTGGAAAAATTTTGATTTCATCGTAACTGCATGGCTGATTTTTTTATTTCTAACTCTATCTGGGTCCAGCCTAACCCTGGTAGTCAGAATCCTCTGTGGTTCCCGACGGATGCCGGTAACCAGGCTGTATGTGACCATCCTATTCACAGTCCTGGTCTTCCTCATCTGTGCCCTGCCCTTTGGGCTTTTCTGGTTCCTGTTACTCTGGCTTCCGATCACTCTTCCTGACTTCTCTTGCTATTTTTATATAGCTACAACTGTCCTGTCCTGTGTTAACAGCTGCGCCAACCCCATCATTTACTTCTTCATTGGCTCCTTCAGGCAGCAGCATCAGACCCTCAAGCTGGTTCTTCAGAGGGCTCTGCAGGATTCCTATCATGAGAATGAAGGTGAAGACAGACATGTCCAGGAAACCCTAGAAATGTCAGGAAGCGGAGTGGCTTAG

XM_004851727.1 Coding sequence

Ptdss2 phosphatidylserine synthase 2, transcript variant X3

High confidence: 4 potential gene matches
Length: 1404 bp    Location: 21988214..21961756   Strand: -
>XM_004851727.1
ATGCGGAGGGCCGAGCGCAGAGCTGCTGGGGGTTTGCGGTCCGGGTCTCCGCGACCCGAGGGCCGCCGCAGCACCGAGTCCGAAGTCTACGACGACGGCACCAACACTTTCTTCTGGCGAGCCCACACCTTAACTGTGCTGTTCATCCTCACCTGTGCACTGGGCTATGTGACTCTCCTGGAAGAAACACCGCAAGACACAGCCTATAACACCAAGAGAGGTATTGTGGCCAGTATTTTGGTTTTCTTATGTTTTGGAGTCACACAAGCCAAAGATGGGCCATTTTCCAGACCTCATCCAGCTTACTGGCGATTTTGGCTTTGCGTTAGTGTGGTCTACGAGCTGTTTCTCATCTTTATCCTTTTCCAGACAGTGCATGATGGCCGGCAGTTCCTAAAGTATGTGGATGCCAGGCTGGGGACACCATTGCCCGAGAGGGACTACGGAGGGAACTGCCTCATCTATGACCCAGACAACAAGACCGACCCCTTCCACAACATCTGGGACAAGCTGGACGGCTTTGTTCCTGCCCACTTTATTGGCTGGTACCTAAAGACCCTCATGATCCGGGACTGGTGGATGTGCATGATCATCAGCGTGATGTTCGAGTTCCTTGAGTACAGCCTGGAGCACCAGCTGCCCAACTTCAGCGAGTGCTGGTGGGACCATTGGCTCATGGATGTGCTGGTCTGCAACGGGCTGGGTATCTACTGCGGCATGAAGACACTGGAGTGGCTGTCTCTGAAGACGTACAAGTGGCAGGGTCTCTGGAACATCCCCACCTACAAGGGCAAGATGAAGCGCATAGCCTTCCAGTTCACGCCCTACAGCTGGGTCCGCTTCGAGTGGAAGCCAGCCTCCAGCCTGCGCCGCTGGCTGGCCGTGTGTGGCATCATCCTTGTGTTCCTGCTGGCGGAGCTGAACACCTTCTACCTGAAGTTCGTGCTGTGGATGCCCCCCGAGCACTACCTGGTCCTGCTGAGGCTGGTCTTCTTCGTGAACGTGGGCGGCGTGGCCATGCGAGAGATCTATGACTTCATGGATGATTTGAAGCCCCACAAGAAGCTGGGCCAGCAGGCCTGGCTAGTGGCAGCCATCACGGTCACTGAGCTGCTCATCGTGGTGAAGTACGACCCGCACACGCTCACCCTGTCCCTGCCCTTCTACATCTCCCAGTGCTGGACCCTCGGCTCCGTCCTGGTGCTCACCTGGACCATCTGGCGCTTCTTCCTGCGGGACATCACCTTGCGGTACAAGGAGACACAGAGGCAGAAGCAGCAGAGCGACCAGGGCAGGGCAGTCAGGAGCAGGGCAGAGCCCCCAGGGCTAGATGATGATCTGCCGGGGCCTGGGGGCCCTGTGGAGGAGGATGTCACCAAGGAGGGTGCTGCAGCTGCCTCATGA

XM_004851702.1 Coding sequence

Cdhr5 cadherin-related family member 5, transcript variant X1

High confidence: 4 potential gene matches
Length: 2505 bp    Location: 21843506..21849832   Strand: +
>XM_004851702.1
ATGACACCCACATCCCCCCCTGGTGGTGGCCTGGCCTGGCCGCCCTGCGGGAGCCCCCTGGGTGGAGCTGTCAGCAGGGCCATAAAGCAGGGCGGCGCCTGGCAGGGCAAAGGTCGGTCGCGGAGACGGGGAAGGCCTAGCCCTGGACCGCAGACTGCCAGACCCTTCCGGCAGGTGACAGCCACTAAGATGGGGGCCAGGGCCCCACTGTGGGCCTCCCTGCTTCTGCTCCTCGCACTGCCAGGCCAACCCCCGGGGGCAGCAGCCCAGGGCCAGGTCTGCTCGGTGGACAGGACCTTTGTCAGCGTCGAGGAGAACAGCAGTGTTGCTGAGCCCCTGGTGAATATCTCCATCCCGGACGGCCAGCATGTCACCCTGGGGCCTTCGTCCAGCCCCTCCGCCTTCCGGATCCTGGTAGACCAGCTGTTCCTCAACGTGACCCCTGATTACGAGGACAGCACAATGCTGGAGGCTCACCTGGAATGCAGGAGGGGCAGCTCTGTGGTGACGCAGCTGGTGGTGCTGGTGTCCGTGCTGGATGTCAACGACAATGCCCCAGAATTCCCCTTTGAGACCAAGGAGCAGAACGTGTCGGAGGACACCAGAGTGGGCTCCATAGTCATCCCTGAGGACCAACTGAAGGCCTCCGACAAGGACTCGGAGGACGTCTTGTTCTACACCCTCCAGGAAGTGACCCCGAATGCCAGAAGCTTCTTCTCCCTGGTGAGCGCGAACCGCCCTGCCCTGCGGCTGGACCAGGCCCTGGACTTCTACAAGTGGCAGGACATGACTTTGCAGCTGCTGGTCCGGGACACTCAGGAGGAGACGGAGGTGCCCAGCCACAGGGCCACGGCCACCCTGGTCCTGCATGTGCTGCCCGCTGACCTGAGGCCCCCCTGGTTCCTGCCCTGCTCCTACTCAGACGGCTACGTCTGCATCCAGGCCCAGTACCATGGGGCTGTCCCCAAGGGACACACACTGCCATCCCCTCTCATCCTGCATCCCGGGCCCATCTATGCCGTGGATGGGGACCAGGGCATTGACGCGCGCATCATCTACAGCATTGTGGGGGGGAATACAGACAACACTTTTGCCGTTGACAAGGACTCTGGCAACCTCACCATGGCCAAGAGCATCCCCAGCCCCACGACCTTCATCTTGCTGATCAGGGCAGACCAGGCTGACCTGGCCCGATACTCGGTGACCCAGGCCACTGTGGAGGCCCGCTCTGCCACCGGGAACCCACCCCGCTTTCCCCAGAGCCTGTACCGGGGCATCGTGCCGCCCGGCTCTGAGGCCGGTGTGACTGTCCGGGACGCAGCCTCCCCGACCCAGCCTCTGAGGATCCAGGCTCAGGACCCTGACTTCCTGGGCCTCAACTCGGCTGTCACTTACCGAATCACCAACTGCTCTGAGTTCCGGATGGACGGGGAGACCATGCTGACCACTCTGGCGCTGGAGCATGAGGGAGTCTTCTACGCAGAGGTGGAGGCCACAAACACAGCGACCAACGACACAGCCACTGCTGTTGCTGAGATTTGGGTTTCAGAGCAGAAGCCCCCCACCATAGGACCCCCAGAGATCCCCCCATCCCCAGAGGCTGGAAGAACAAACAAGCCCTCAACCAGCACTGCCATGGAAACCCCCAGGCCCCCCAGGACTCCCCAAGGACCCTCTTCGACCAGTCCTGGGGGGGCCACTGGCCCTCACCCATCCTCAGGCACATCGCTGAGGCCGGCTGCCTCAACCACACCTGGGGGGCTCCCCGGTGTGGGAGCCAGCACCATCCTCTGGCCAGGCACGCCTGGTGGGGTCTCAGCTCCGACCCCGAAGCCAGGGACCTCTCGGCCAACGACCCCTGGGTCCAGCGGGAGCTCCTCAGCCTCAGGGACACCAGGAGTCGGCAGCACTGGTGAAGACGAGCCAGGCCGCCCAGAGGAGCTGCGCTTTTCCACGGTGGACATGGCGGTCCTGGGAGGGGTGCTGAGTGCACTGCTGCTGCTGGCCCTCACTGTCCTGGCTGTGCTCCTCTATAAGCACTATGGGCACCGACTGAGCTGCTGTTCTGGGAAAGCTGCGGAGCCCCAGCCCCACGTCTTTGACAACCAGGCCTTCCGGGGTGACCATGGGGCCACCGAGACATCTGTCCCCAGCCCCGAGCCGGGCCCCACGCCTGCGGAGATGCCACCTGCAGCCCTGGACCCTGAGCCCCTGAGCCCCGCACCCCCCAACCCTGAGCCCCTCGCCCCCGAGCCCCCAGTGGCCACTGGAGCCGGGGACAGCCCCTCGGCCGTGAGGTCCATCTTGACCAAGGAGCGGCGGCCTGGGGGTGGCTACAAGGCCGTGTGGTTTGGCGGGGACATCGGGGCAGCGGCTGACGTCGTGGTCCTCAGCGCGCCTGAGGCTGGCCGGGATGGCGAGGGCGACTCTGAGGGCAGCAGCGAGGAGGACGGGGGCCGGGACGGGGGTCCCCGCGACGCATCGGGCAGCTCCACCCGCATCTAG

XM_004851641.1 Coding sequence

Polr2l polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa

High confidence: 2 potential gene matches
Length: 261 bp    Location: 21679071..21680977   Strand: +
>XM_004851641.1
ATGGGCGCACCCAAGGCCGGACCTGCGGCTACGCAGCGCGGCTCTCCAGTCGTCGCCATGATCATCCCGGTTCGCTGCTTCACCTGCGGGAAGATCGTCGGCAACAAGTGGGAGGCTTATTTGGGACTGCTGCAGGCCGAGTACACCGAGGGGGACGCCCTGGATGCACTAGGTCTGAAACGCTATTGCTGTCGCCGCATGCTGCTGGCACACGTGGATCTGATCGAGAAGCTGCTCAACTATGCACCCTTGGAGAAGTGA

XM_004851671.1 Coding sequence

Cd151 CD151 molecule (Raph blood group), transcript variant X3

High confidence: 3 potential gene matches
Length: 762 bp    Location: 21684265..21681741   Strand: -
>XM_004851671.1
ATGGGTGAGTTCAACGAGAAACAGACGCCTTGCGGCACAGTCTGCCTCAAGTACCTGCTGTTCACCTTCAACTGCTGCTTCTGGCTGGCTGGCCTGGCTGTCATGGCAGTGGGCATCTGGACACTGGCTCTCAAGAGTGACTACATCAGCCTGCTGGCCTCAAGCACCTACTTGGCCACGGCCTACATCCTGGTGGTGGCTGGTGTTGTCGTCATGGTGACTGGGGTCCTGGGCTGCTGTGCCACCTTCAAGGAGCGGCGGAACTTGCTGCGCTTGTACTTCATCCTGCTCCTCATCATCTTCCTGCTGGAGATCATTGCAGGGGTCCTGGCCTATGTCTACTATCAGCAGCTGAACACAGAGCTCAAAGAGAACCTAAAGGACACCATGACTAAGCGGTACCACCAGCCAGGCCATGAGGGTGTGACCAGTGCAGTGGACAAACTGCAGCAGGAGTTTCATTGCTGCGGTAGCAACAACTCTCAGGACTGGCGGGATAGTGAGTGGATCCACTCCGGCCAGGCAGGCAAACGCGTGGTCCCCGACAGCTGCTGCAAGACTGTGGTGCCTGACTGTGGGAGGCGGGATCATGCCTCCAACATCTACAAGGTGGAGGGGGGCTGTATCACCAAGCTGGAAACCTTCATCCAGGATCACCTGAGGGTCATTGGAGCTGTGGGCATTGGCATTGCCTGTGTGCAGGTCTTCGGCATGATATTTACCTGCTGCTTGTACCGGAGCCTCAAGCTGGAGCACTACTGA

XM_004851639.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X8

High confidence: 3 potential gene matches
Length: 1191 bp    Location: 21634518..21664636   Strand: +
>XM_004851639.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAAGAGCCGCGGCGGGAGGCACCTGGTCTTCTACCCAACTCTGAAGTCCCTGCAGGTGCGGCTGGAACTGGCCAAGGAGCTGGGCGTCGGGGTCTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTCTAG

XM_004851656.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X15

High confidence: 3 potential gene matches
Length: 717 bp    Location: 21678205..21666302   Strand: -
>XM_004851656.1
ATGGCGCGCGGGTGCCTGCAGGGCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTTTTCTGGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGATTCTGGGCCTGACCTTTGCCATGACCATGTACTGCCAAGTGGTGAAGGCAGACACCTACTGCACCTAG

XM_004851596.1 Coding sequence

Immp1l IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae), transcript variant X2

High confidence: 4 potential gene matches
Length: 501 bp    Location: 20343663..20285362   Strand: -
>XM_004851596.1
ATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAGGTGACATTGTGATTGCAAAAAGCCCGAGCGATCCAAAGTCAAATATTTGTAAGAGAGTAATTGGTTTGGAAGGAGACAAAGTCCTCACCACTAGCCCATCAGATTTCTTTAAAAGCCATAGTTATGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGA

XM_004851597.1 Coding sequence

Dnajc24 DnaJ (Hsp40) homolog, subfamily C, member 24

High confidence: 4 potential gene matches
Length: 447 bp    Location: 20235589..20283370   Strand: +
>XM_004851597.1
ATGGCGTTGGAACAGGGGCCAGCAAAGGATTGGTATGGCATTCTGGGGGCCGAGCCTTCTGCTAATGTGTCAGAACTGAAGCAAAAGTATCAGAAACTCATATTAATGTATCACCCTGACAAGCAGAGCACAGCTGCGTCGGCAGGGACACCAGAGGAGTGCCTGCAGAAGTTCATCGAGGTGGATCAGGCGTGGAAAATTCTGGGGAATGAAGCTGCAAGGAAAGAGTATGACCTGCAGCGGCATGAAGATGAGCTCAGAAGTATGGGACCAATAGACGCTCAAATGTATCTTGAAGAAATGTCTTGGAATGAAGGCAATCGTTCTTTCTCTCTGAGCTGCCGATGTGGTGGCAGATATGTCGTTTCTGAGCAGGAGGCAGCAGCCACCAGCCTGGTTCCGTGCGACACGTGTTCGCTGATGGTGGAGCTCCTTCGCGACAACTAG

XM_004851601.1 Coding sequence

Elp4 elongator acetyltransferase complex subunit 4, transcript variant X4

High confidence: 3 potential gene matches
Length: 1173 bp    Location: 20343802..20480433   Strand: +
>XM_004851601.1
ATGGCGGCAGCGGCTAAGGCAACCTGCGGTGCTGGCGCCGGGAGTCCTGGGTCTGTGGCGGCGGCGGCCGACAGAAGCAGTGCCACCAGCTTCCAGAGGAGGGGTCCCAGGGCCGGCGGTGCCGATGGCAGAGGCCCTCGCCTGGTGTCCATTGCGGGCACGCGGCCGTCGGTGCGGAATGGACAGCTGCTGGTTTCCACCGGGCTCCCGGCCCTGGACCAGCTCTTAGGTGGAGGTTTAGCCGTTGGAACAGTTCTTTTGATTGAGGAGGATAAATACGATATTTACTCACCGCTGCTCTTCAAGCATTTCCTGGCCGAGGGCATTGTCAGTGGGCACACTTTGTTGGTTGCATCCGCTAAAGAGCGCCCTGCTGGCATTTTACAGGAACTTCCTGCACCATTACTTGATGATAGTTATAAAAGAGAACTTGAGGAAGATGAATGTAATCATAAAACACCAGAATCTAATGTGAAGATGAAAATAGCTTGGCGGTACCAGTTATTACCCAAGATAGAGCAGGTTGGGCCAGTGGCGTCTTCAAGATTTGGTCATTATTATGACACATCCAAAAAGATCCCCCAAGAACTGCTTGAGACTGCAAAATGGCATGAGTTCTTCCTTCCAGAAAAGTCATCTTCACCCCTCAGCACAGAACCCTGCCACTTGACCCATGGCTACATGAAGCTCCTTGAGTTTATCAAGAACATCATTTCTGAGGAAGGCTTTGATGGATCCAATCCCCAGAAAACGCAGAAGAGTATTTTAAGAATAGGAATCCAGAACCTCGGCTCACCCTTATGGGGAGATGACGTGTGCTGCACAGAAACCTGCGGCGACAGGCACAGCCTCACCACGTTCCTCTATGTTCTCCGCGGCCTCATGCGGGCCTCACTCTCGGTCTGCACCATCACGATGCCAACACACCTGATCCAGAATAAATCAGTAACTGCTCGTGTTATACATTTGTCAGATACAGTAGTGGGCCTGGAATCGTTTATTGGTTTGGAGAGAGAAGCCAATCCTCTCTATAAGGATTATCACGGTTTGATTCATATTCGGCAGATTCCTCGGCTTAATAACTTGATTTGCGATGAATCAGATGTCAAAGACTTAGCTTTTAAGTTAAAAAGGAAGCTATTTGCCATTGAGGCCAAGCCCAATTTCTTCTAA

XM_004851572.1 Coding sequence

Muc15 mucin 15, cell surface associated, transcript variant X2

High confidence: 4 potential gene matches
Length: 966 bp    Location: 16544246..16531953   Strand: -
>XM_004851572.1
ATGTGGACCTTAGCCCAAATTGTGCTGATTTCAATTTTGTTTATTTCACTACCCTTTGAGAGCCATGAGATAGAAAACCTAGGAAAAAAGACAACACAAAGAATTGCAGAAGTTTGGAAAACAAAGGAAAGAGAAGCACATGTAAATTCAAACAAGGAAAACGGAAATGTCTCCATTCCCAAGGTAACTGGTTTCCCTCCTTTGGACCCATCTAATGTAGCGACTTTCACCAACACCTTGACGACAGTCAACTTCTCCAGGGCTCCAAGATCCACAGCCAGGTTTTCCACAACCCCTCCCTTGATTCACAGCTTTGTTTCCAAACTGCCTTGGAACTCATCTCTAGCAGAGGAGAATCTGTCACCTGTCTCAGCACACCCCGATTCTACACAGGCTGTCTCATCGGAAGACTCCAGTCTGGACAATGGCACCATGTACGTTCCTGACAACAGTTCCACTGCTACAAGATTCCCGCCCCCAGTGCCCACCCCCAAATCTGTGACCCCCTTGACAGCGGAACCCACCGCATGGCCTACCACAGATGGCGACAGCTTCGCTGGCTTCACTCCCTATCAAGAAAAAACAACTCTACAGCCCACCTTCCAATTCACCAACGACTCGAAACTCTCTCCAAGTACAGCAGACCCCCCTGAAGAGAACAGAAATACCGGAGTGGTGTTTGGGGCCATTTTAGGGGCTATTCTGGGTGTGTCCCTGCTTAGTCTTGTTGGCTACTTGTTGTGTGGAAAAAGGAAAACAGATTCATTTTCCCATCGGCGACTTTACGACGACAGAAACGAACCAGTTCTGCGATTAGACAACGCCCCAGAACCATACGACATGGGCTTTGGGAGTCCGAGCTACTATAACCCATCTTTGAATGCCTCTTCAGTGCCAGAAAGCAGAGAAAGTGCAGGGGACAGCATTCCTATGGATGACATTCCGCCACTGCGCAGCGCGGTATAA

XM_004851577.1 Coding sequence

Lgr4 leucine-rich repeat containing G protein-coupled receptor 4

High confidence: 4 potential gene matches
Length: 2850 bp    Location: 17147570..17111677   Strand: -
>XM_004851577.1
ATGCGCGGCCCGCGCTGCCTGCTGTGCGCCCTGGCGCTGGCGCTGCTCGGCATCGCTGGGGCCCGCGCGCCCCTGTGCCCCGCGCCCTGCGGCTGCCACGGCGACGGCGACCGGCGTGTGGACTGCGCGGGGCGCGCGCTGGCGGCCGTGCCCGCGGGACTGGGCGCGTCCACGCGGGCGCTGGACATCAGCATGAACAACATCACCCAGCTGCCGGAAGACGCATTCAAGAACTCCCCGTTCCTGGAGGAGCTACAATTGGCTGGCAACGAACTTTCTTTTATCGACCCGAAGGCCTTGTCCGGGCTGAAAGAGCTCAAAGTCCTCACCCTGCAAAACAACCAGCTGCGGACGGTGCCCAGTGAGGCCATCCGGGGCCTGAGTGCCCTGCAGTCCCTGCGACTGGATGCCAACCACATCGCGGCGGTGCCTGAGGACAGCTTCGAGGGCCTGGTGCAGCTGCGGCACTTGTGGCTGGACGACAACAGCCTGGCGGAGGTGCCGGTGCGGCCGCTCAGCAACCTGCCCACACTGCAGGCGCTCACCCTGGCGCTGAACAGGATCTCTGGCATCCCCGACTTCGCCTTCACCAACCTGTCCAGCCTGGTCGTGCTGCATCTGCACAACAACAGGATCAGAAACCTGAGTCGGCACTGTTTCCACGGCCTGGACAACCTGGAGACCTTGGACCTGAACTATAATAACTTGGAGGAATTTCCCGAGGCCATTAAAGCCCTTCCTAGCCTCAAAGAGCTCGGCTTCCACGGCAACTCTATCTCCTTCATCCCCGACGGCGCGTTCAGTGGGAACCCCCTGCTGCGGACTGTACATTTGTACGACAACCCTCTGTCTTTCGTGGGGACCGCAGCATTCCGGAATCTGTCGGATCTGCACTCCTTAGTCATCCGCGGCGCCACCATGGTGCGGAGCTTCCCCAACCTGAAGGGCACCGTGCGCCTGGAGAGCCTGACGCTGACCGGCACGAAGATCAGCAGCATCCCGCACAGCCTGTGCCAGGAGCAGCGGGCGCTGAGGACGCTGGACTTGTCTTACAACAATATAAAAGACCTTCCCAATTTTAATGGTTGCCGCGCCCTGGAGGAAATCTCACTGCAGCGCAATCAAATCTCCCAGATAAAAGAAGGTACCTTCCAAGGCCTGGTGTCCCTGCAGATTCTGGATCTGAGTAGAAACCGGATCCACGAAGTCCACAGCAGTGCTTTTGCCAAGCTTGGGGCAATCACCAATCTAGATGTGAGTTTCAACGCATTGACTTCCTTCCCCACGGAAGGCCTGAATGGGCTCAACCAGCTGAAACTGGTGGGCAACTTCGAACTGAAGGGAGCCTTGGCCGCAAAAGACTTTGTGAATCTCAGGTCCCTGTCGGTGCCCTACGCCTACCAGTGTTGCGCGTTCTGGGGCTGCGAGTCCTACGCGAGTCTCCACGCGGCCGGCGACCTGCAGGCCCACGGCGGGAGCAAGGAGCCAGGCAAGTATGCCGATGCGGGGAACCTCACGGGCAGCACTGAGCGGGAGCACGGCCAGGTCATCATCCACTGCGTGCCGGCCACAGGCGCGTTCAAGCCCTGCGAGTTCCTGCTGGGCAGCTGGATGATCCGCCTCACCGTGTGGTTCATCTTCCTGGTGGCCCTGCTCGCCAACCTGCTGGTCGTCGCGGCGACCTTTGCGTCGGGCGCGTCCCTGCCGCCGTCCAAGCTGCTGCTGGGCCTGCTGGCCGTGTCCAACCTGCTCATGGGCGTCTACACCGGCGTGCTCACGCTGCTGGACGCCGTGTCCTGGGGCCGCTTCTCGGACTTCGGCGTGTGGTGGGAGACGGGCAGCGGCTGCCGTGTGGCCGGCTTCCTGGGCGTCTTCTCCTCGGAAAGCGCCGTCTTTCTGCTGACCGTGGCGGCCGTGGAGAGGAGCTGCTCCGCGGACGCGCTGCGGGGGACCCGGAAGGGCGGCAGGCGGGGCCGCTTCCGCGTGGCGGCGGGCGGGGCCTTCCTGGGCGCGGCCGTGGCGGGCTGCGTGCCCCTGGCCCGCGGCGCGGACTTCTCGGCCTCGCCGCTGTGCTTGCCGTTCCCCAGCGGGGAGGCGCCCGCGCTGGGCCTCACCGTGACGCTGGTGCTGCTCAACTCGCTGGCCTTCCTGCTCATGGCGGTGGTCTACACCCGCCTCTACTGCTCGCTGGAGAAGGGGGCCCTGGCCGCGGGCGCGCGGGCGGGCGCTGTCAGGCACGTGGCCTGGCTCATCTTCACCAACTGCGTGCTCTTCTGCCCCGTGGCCTTCTTCTCCTTCGCGCCGCTGCTCACCGCCATCTCCGTCAGCCCCGAGATCACCAAGTCCGTCACCCTCATCTTCTTCCCGCTGCCGGCCTGCCTCAACCCGGTCCTGCACATCTTCTTCAACCCCCGCTTCCGGGAGGACTGGGCCCTGCTGCGGGGACGAGTGGCGAGGGGTGGCCAGGGCGGGCGCGGGGCCACAGGCGGCCAGGGCGGGCGCGGGGCCCGGGCCCTGTACCCCGACTGCGGCGCCTGCTCCCACCTGCAGCCCCGGCTGGCCGTGTGCGACTGCTGCGAGTCCTTCCTGCTGGCCCGGCCGCCGGCCTGCGGAGCCCTGGCCAAAGCGCACAGCTGCCCGGTGCTGGCCGCGGCCCCGTGCCGCAGGCCCGACGGCCACTGGTTCGAGTGCGGCTCGCAGTCGGTGCACTCGGACTGCGCGGACGAGGAGGACTCCTTCGTCTCCGACAGCTCGGAGCAGGTGCAGGCCTGCGGGCGCGCCTGCTTCTACCAGAGCCGGGGCTTCCCGCTGGTGCGCGACGCCTACCACCTCCCCCGGGCCAGGGAGTGA

XM_004851528.1 Coding sequence

Hps5 Hermansky-Pudlak syndrome 5, transcript variant X1

High confidence: 4 potential gene matches
Length: 3096 bp    Location: 9808079..9768638   Strand: -
>XM_004851528.1
ATGACTTTTGTGCCCACGATCCCAGAGTCTTACAGCCATGTTCTCGCGGAGCTTGAGTCCCTGGACCCGTTACTTTCAGCTCTGCGGCTGGACTCCAGTCGTCTAAAGTGCACCAGCATAGCTGTGTCTCGGAAATGGCTGGCCTTGGGCAGCTCGGGAGGAGGAGTCAATCTCATTCAGAAAGAAGGCTGGAAGCACAGGCTTTTTCTCTCGCACCGGGAAGGTTCAATTTCTCAGGTTGCCTGTTGTTCACATGATGACGATTATGTTGCTGTAGCTACCAGTCAAGGTCTTGTAGTTGTTTGGGAATTAAATCAAGAGCATCGTGGGAAACCAGAACGAATTTATGTGTCTTCAGAACACAAAGGCCGAAAAGTTACAGCTCTCTGTTGGGATACAGCTGTTCTTAGAATCTTTGTAGGTGACCATGTGGGGAAAGTTTCTGCCATCAAACTCCACACTTCTAAACAAGCAAAGGCAGCTTCTGTCTTTGTGATGTTTCCTGTTCAGACAATAACAACAGTCGACTCCTGTGTTGTCCAGCTAGATTATTTGGATGGAAGGCTCCTTGTATCTTCCCTTACTCGAGCCTTCTTGTGTGACACTGAGAGAGAGAAGTTTTGGAAAATTGGAAACAAGGAAAGAAATGGAGAATATGGAGCTTGTTTCTTCCCTGGAAGGTGTTCTGGGGGCCAGCAACCTCTAATATATTGTGCTCGTCCTGGCTCCAGGATGTGGGAAGTGAGCTTTGATGGGGAAGTTAGAAGTACACATCAGTTCAAGAAACTCCTCTCGTTGCCACCTCTTCCTGTGATTACTCCAAGATCTGAACCTCAGTATGATCATACAGTGGGATCCTCCCAGTCTTTGTCTTTCCCCAGACTCTTGCATCTTAGTGAGCATTGTGTGCTGACTTGGACAGAAAAAGGAATTTATATTTTTATTCCTCAGAATGTTCAAGTTCTTCTTTGGAGTGAAGTCAAAGATATTCAGGATGTGGCTGTCTACAAGAATGAGCTGTTCTGTTTGCACCTGAACGGGAAAGTCTCACATCTTTCTCTGCTGTCTGTGGAGCGCTGTGTGGAACGTCTGCTAAGGAGAGGTCTGTGGGTTCTGGCTGCTCGCACATGCTATCTGTTCCAAAATTCCATTGTTGCCAGCAAGGCAAGAAAAACTTTGACTATAGATAAATTGGAGCACTTGAAGTCTCAGCTGGATCTTGAAACTTATAGTGATCTCATTCCTCAACTGGATGAATTGATATTGAAATTTGAACCTTTGGATTCAGCTTGCAGCAGTAGAAGAAGCTCTATTTCATCACATGAGAGTTTCAGCATCTTGGACTCTGGTATTTATCGTATCATTAGTAGTAGAAGAGGCAGTCAGTCAGATGAAGATTCTTGCTCCCTTCACAGCCAAACCTTCTCGGAAGATGAGAGACTTAAAGAATTCACCTCACATCCAGAAGAGGACCAGCCAGACAATGTTTCTCATGTTCCAGTGACGTTTGAGACAGATAAGAATGAAACTTTTCTCCCCTTCGGCATTCCATTACCATTTCGTTCTCCATCTCCTCTTGTATCTCTTCAGGCTGTCAAAGACAGTGTTTCTAGCTTTGTGCGTAAAACTACTGAGAAGATTGGTACCCTTCACACAAGTCCTGAGCTAAAAGTGAGACCAGAACCCAGGGATGAAGATCAGTCTTGCGAAGAGGAAGTGAGTTCAGTTACATGCCCACAGGAAGAAGTCACTGAGGAGAAAAAAGAAGTAATTAGTCAACCCCCAAAAGAAGACAGGTTCCAAGAGCTCACAGCAGCAACAGCAGAAGCAATGACCAAGCTACTGGACCCTTTGGTTTTGTTTGAACCCCAGTCTCTGAGAGTGGTTTTACAAGAGTGGCTTTCACACTTAGAAAGGACATTTGCCATGAGAGACTCTCCAGGCACTTCAGATACTGGCAACTCACTTGTGAAACTGAACCAAGATGAGTCAAAAAAGAGAATAGTGGGTGAAGATAATGAAGGAGAAAAAAGGGACTCTTTAGACAATGAAGAAACTGTTGACCCAACAGCGTGTGAATCCATAAATAGTCCAAGGGAGCCCTCGGATGATGACCTTTTCCAAGTGTGTTCCCCATGCGCCATACCAACCAGTCTTCAGAAGGACCTGGCTGAGTTGACAGCATTGTGTTTGGAATTGAACGTTTTGAATTCTGCTATCAAAAGCACGGATGGACATGCAGACCATACTTTGCAACAGTGTTCACCTGAAATTCTGGCTTGTCAGTTTGTAAAGAAGTACTTTTTTCTCCTGGATTTGAAAAGAACAAAAGAGAGTATCAAGCTTAGTTATACTAGCAGCTCCCGTATTTGGGATACTTTCATTGAAGGATTGAAAGAAATGGCCAGTTCTAACCCTACTTATATGGAGATGGGAGAAGGAGACCTACCAACAAGATTAAAGTTATTGGATGACTCCATTCCTTTTGATAGTCCTTTGTTGATTGCTTATGCCACCCGGTTATATGAGAAGTTTGGAGAATCTGCCCTTCGATCCTTGATCAGGTTTTATCCATCCATTTTGCCTTCAGACATCATACAACTTTGTCGTCATCATCCAGCTCAGTTTCTGGCCTATTTAGATAGTTTGGTGAAATCAAGACCTGAAGACCAGCGGTCATCTTTCCTAGAGTCCCTTCTGCAACCAGAGTCCTTAAGATTAGATTGGCTACTTTTGGCAGTGTCCCATGATGCTCCACCAAGCACCAGTACTGTGGATGATGAAGGGTACCCCAGGCCTCATTCGCACTTGTTCTCCTGGGGTTACAGTCAACTGATCCTTTATCTAATTAAACTTCCTGCAGATTTTACAACCAAAGAGAAAATGACAGACATCTGTAAGTCTTGTGGTTTCTGGCCTGGATATCTAACTCTGTGCTGGGAGCTGGAGAGAAGAAGAGAGGCGTTTGCCAACATCGTGTATCTGAATGATATGAGCCTGATGTCAGGGGACAATGGTGCGTATGTCCCAGTGGATTACTCTTGCAGGTGGTATTTTACAAGTCTCTCTAGACTTTTTCATAAAGAAATGTGGTGA

XM_004851470.1 Coding sequence

Pde3b phosphodiesterase 3B, cGMP-inhibited

High confidence: 4 potential gene matches
Length: 2484 bp    Location: 6492626..6635952   Strand: +
>XM_004851470.1
ATGAGAAGGGACGAGCGAGACGCGAAAGTCATGAGGCACCCGCCGTCGCCGGACGGGGCCGCCTCGCCCCCCGAGAGCCTGCGCCGGAACGGCTACGTGAAGGGCTGCGTGAGCCCCCTGCGGCGGGACCCCCCGCGCGGCTTCTTCTTCCACCTCTGCCGCTTCTGCAACGTGGAGCCGCCGCCGCCCGCCTCCCGCCCGCCGCCACGGCGCGGCGCCCCCTGTGCCCGGGCGCGCGTCTCGCTGGGCGCCCTGGCCGCCTTTGTCCTCGCGCTCCTGCTGGGCGCGGGGCCCGAGCGCTGGGCGGCCGGGGCGGCGCGGCTGCGGGCGCTGCTGAGCGTGAGCTCGCTCTGCCTCAGCCCGCTCTTCAGCATCGCCTGTGCCTTCTTCTTCCTCACCTGCTTCCTGACGCGGACCAAGCAGGGCTCGGGCCTCGGCCGGAGCGGCGGCTGGTGGCTGCTGGCGCTTCCCGCCTGCTGCTACCTGGGGGACTTCCTGGCGTGGCCGTGGTGGTCGTGGGCCCCGCACGCGCCCCCGGCGGCGGTGGCGGGGCGGCTGCTGCTGGCGCTGAGCGGCGCGGGGCTGCTGGCGCTCGCGCAGCCGTCGGGGCCCAGGCTCTGCATCCCGGTGCTGCCTTTCGCCGGCGCGGTCTGGTGGGTGGCGTTCAGCGGCCTCGGGGCGCTGCCCGCCGCGCTCCGCCCGCTGCTGTCTTGCCTAGCCGGGGGCGCCGGCTGCCTGCTGGCCCTGGGGTTGGATCACTTCTTCCACATCAGGGAAGCTCCTCGTCGTCCTCAACTGTCCAGCACCGCGGAAGAAAAAGTGCCTGTGATCAGACCCCGGAGGAGGTCCAGCTGCGTGTCGCTGGGAGAAACCGCAGCCGGTTACTATGGCAGTGGGAAAATGTTCCGGAGACCTTCGTTGCCTTGCATTTCCAGGGAGCAGATGATTCTTTGGGATTGGGACTTAAAGCAGTGGTATAAGCCTCATTACCAGAATTCTGGAGGTGGAAACGGAGTTGATCTTTCAGTGCTAAATGAAGCTCGAAATATGGTGTCAGATCTTCTGGTGGACCCAAGCCTTCCCCCACAAGTCATTTCTTCCCTACGGAGTATCAGCAGCTTGATGGGTGCTTTTTCTGGTTCCTGTAGGCCAAAGATTAATCCTCTCACACCATTTCCTGGATTTTATCCCTGCTCTGAAATAGAAGATCCAGCTGAGAGAGGAGATCGAAAACTTCACAAGGGCCTAAGTAGTAGGAATAGTTTACCAGCTGCACAGCTGAGAAGGAGCTCAGGAACTTCAGGATTGTCACCTATTGATCAGTCTTCAAGGTGTGAACGTAGTAATGGCAAAAGGCCTCATCAAGAATTTGGCATTTCAAGTCAAGGATACTATCTAAATGGGCCTTTTAGTTCAAATCTTCTGACAATCCCAAAGCAAAGATCATCTTCTGTATCACTGACTCACCATGTAGGTCTGAGAAGAGCTGGTGTTTTACCCAGCCTGAGTCCTGTGAATTCTCCCAGCCATGGACTAGTGTCTGCTGGTTCTCTAACTAATCGGTCACCCATAGAATTTCCTGACACTGCTGATTTTCTTACTAAGCCAAGGGTTGTTGTACACAGATCTCTGAGCAATTTTCCCAGTACACCAGATTTTTATCAGCATCTTAGAAATTCTGATAGCAATCTGTGTAACAGCTGTGGAAACCAAATACTAAAATATATTTCAACACGTGAACCAGATGGTGCAGACCTCCACAGTGGAAAGTCAGGTGAAGAAGATAACACCATTTTTACAGAAGAGTCATTTAACTTTCTGGAAGCTCAAGAAGAGGAAGCAGAGAAGAGAGCCTATAGAAAATTAATATTGGAAGGTGATAATCACCTGTCCGAAGAGGCCCAGCAACAAAATGTTGAACAGGAAGCATCACTGGGCATGACTTTAGTAGAAGATTATAACTCACTGATAGAAAAGATGAGCAATTGGAATTTTCAAATATTTGAGCTTGTAGAAAAGATGGGAGAAAAATCAGGAAACATTCTCAGTCAGGTTATGTATACCTTATTTCAAGACACTGGTTTATTGGAAATATTTAAAATTCCCACTCAGCAGTTCCTGAACTATTTTCGTGCATTAGAAAATGGCTATCGAGATATTCCTTATCACAATCGTATACATGCCACAGATGTCCTACATGCAGTTTGGTATCTAACAACAAGGCCTATTCCTGGCTTGCAGCAGATCCATAGAGGTCATGAAACAGGAAGCGAAACAGATTCCAATGGTAGAATTAATCCTGGACGAATTGCTTATATTTCCTCAAAGAGCTGCTCTGTTCCAGATGAGAGCTATGGCTGCCTGTCTTCAAATATTCCTGCATTAGAATTGATGGCATTGTATGTGGCAGCTGCCATGCATGATTATGATCACCCAGGGAGGACAAATGCATTTCTAGTGGCCACAAATGCACCTCAGGTATGA

XM_004851438.1 Coding sequence

Parva parvin, alpha, transcript variant X2

High confidence: 4 potential gene matches
Length: 1020 bp    Location: 4390256..4544550   Strand: +
>XM_004851438.1
ATGGAGGGCAGCGGACGCACCTACGCGGGCCTGGGAGTCTCAGAGCTTCAGGAGGAGGGCATGAATGCCATCAACCTGCCCCTCAGCCCCATCCCCTTCGAGCTGGACCCTGAGGACACCATGCTGGAGGAGAATGAAGTGCGGACGATGGTAGATCCAAACTCACGCAGCGACCCCAAACTCCAAGAACTGATGAAGGTATTAATTGACTGGATCAATGATGTGCTGGTTGGAGAGAGAATCATTGTGAAAGACCTGGCTGAAGATTTATACGATGGACAAGTCCTGCAGAAGCTCTTCGAGAAACTTGAGAGCGAGAAGCTAAATGTCGCTGAGGTCACCCAGTCAGAGATTGCTCAGAAGCAAAAACTGCAGACTGTCCTGGAGAAAATCAATGAAACCCTGAAACTTCCTCCCAGGAGCATCAAGTGGAATGTGGACTCTGTTCACGCCAAAAGCCTGGTGGCCATCTTGCATCTGCTGGTAGCTCTGTCTCAGTATTTCCGGGCACCAATCCGACTCCCAGACCATGTTTCCATCCAAGTGGTTGTGGTCCAGAAACGAGAAGGAATCCTCCAGTCTCGGCAAATCCAAGAGGAAATAACTGGTAACACAGAGGCTCTTTCCGGAAGGCATGAACGCGATGCCTTCGACACCTTGTTTGACCACGCACCAGACAAACTCAACGTAGTAAAAAAGACGCTCATCACATTTGTGAACAAGCACCTGAATAAACTGAACCTGGAGGTCACGGAACTGGAAACCCAGTTTGCAGATGGCGTGTACCTGGTGCTGCTCATGGGGCTCCTGGAGGGCTACTTCGTGCCGCTGCACAGCTTCTTCCTGACTCCAGACAGCTTTGAGCAGAAGGTCTTGAACATCACCTTTGCCTTTGAGCTCATGCAAGATGGAGGGTTGGAAAAGCCAAAACCACGGCCAGAAGATATTGTCAACTGCGACCTGAAGTCCACACTGCGAGTGCTGTACAACCTCTTCACCAAGTACCGGAACGTGGAGTGA

XM_004851395.1 Coding sequence

Tmem9b TMEM9 domain family, member B

High confidence: 4 potential gene matches
Length: 726 bp    Location: 1105229..1089001   Strand: -
>XM_004851395.1
ATGCTTTTTACAGCTGACCCGGCGCGGCCTGTGACGCGAAGGCCCAGGCGGAAGTGCAGGCGGAGGATCCGAGTGGGATCCCGAGCTGGGATCAGGTCTCGGGGCTCCGGGCTGGGAGCCGGCTGGGCTCCCGCGATGGCAACCCTGTGCGAAGGCCTCCTCCGGCTTGGCTCTATGCTCAGCTTGTCTTGCCTGGCGCTCTCCGCGCTGGTGCAGCTGACAGACGCCGCCAAGAATTTTGAGGATGTCCGATGTAAATGTATCTGTCCTCCCTATAAGGAGAATCCTGGCCATATTTATAATAAGAACATATCCCAAAAAGATTGTGATTGTCTTCATGTTGTGGATCCCATGCCAGTTCGAGGGCCTGACGTAGAAGCATACTGTCTCCGCTGTGAATGCAAATATGAGGAAAGAAGCTCTGTCACAATCAAGGTTACCATTATAATTTATCTCTCTATTTTGGGTCTCCTACTTCTGTACATGGTGTATCTTACCCTGGTTGAACCTATACTGAAGAGGCGCCTCTTTGGACACTCGCAGCTGATACAGAGTGATGACGATGTTGGGGATCATCAGCCTTTTGCAAATGCTCATGATGTCCTGGCCCGCTCCCGCAGTCGACCCAATGTTCTGAACAAGGTGGAGTATGCCCAGCAGCGCTGGAAGCTTCAAGTTCAAGAGCAGCGAAAATCTGTCTTTGACCGACATGTTGTCCTCAGCTAA

XM_004851366.1 Coding sequence

Eif3f eukaryotic translation initiation factor 3, subunit F

High confidence: 4 potential gene matches
Length: 1056 bp    Location: 177535..184855   Strand: +
>XM_004851366.1
ATGGCTACGCCAGCGGCGCCCACGAGTGCTCCCCCAGCCACTCCGGCCCCAGTGCCGGACCCGGCTCCTTCGCCGACGCCGGCTCCAGCGCTGGCCGCTGCTCCAGCGCCGGCCTCGTCTTCGGATCCGGCGGTAGCGGCGGCCGCCCCAGCAGCTCCGGGCCAGACCCCAGCCTCAGCAACGACCTCAACGCAGAGCCCGGCAACCGCGCTGCAGGGTCCGGCGCTCCCGGGGCCCTTTCCCGGCGGCCGCGTGGTCAGGCTGCACCCAGTTATTTTGGCCTCCATCGTGGACAGCTATGAGCGACGCAACGAGGGTGCTGCCCGAGTTATCGGAACCTTGCTGGGAACTGTTGACAAGCACTCAGTGGAGGTCACCAACTGCTTTTCAGTGCCACACAATGAGTCAGAAGATGAGGTGGCTGTTGACATGGAATTTGCTAAGAACATGTATGAATTGCACAAAAAAGTCTCTCCAAATGAGCTCATCCTGGGCTGGTACGCCACAGGCCATGACATCACAGAGCACTCTGTGCTGATCCATGAGTACTACAGCCGGGAGGCCCCAAACCCCATTCACCTTACTGTGGACACAAGTCTCCAGAACGGCCGCATGAGCATCAAGGCCTATGTCAGCACTTTAATGGGTGTCCCAGGGAGGACCATGGGAGTGATGTTCACACCACTGACAGTGAAATATGCATATTATGACACTGAACGTATTGGAGTTGACCTAATCATGAAGACCTGTTTTAGCCCCAACCGGGTGATCGGACTCTCGAGTGACTTGCAGCAAGTTGGGGGAGCATCGGCTCGCATCCAGGATGCCCTAAGCACAGTGTTGCAATATGCAGAGGATGTACTGTCTGGAAAAGTGTCAGCTGACAATACTGTGGGCCGCTTCTTGATGAGCCTGGTTAACCAAGTACCCAAGATAGTTCCTGAGGACTTTGAGACCATGCTCAACAGCAACATCAATGACCTGCTGATGGTGACCTACCTGGCCAATCTTACACAGTCACAGATTGCCCTCAATGAGAAACTTGTAAACCTGTGA

XR_205527.1 Non-coding sequence

LOC101696749 PREDICTED: Heterocephalus glaber uncharacterized LOC101696749 (LOC101696749), misc_RNA.

Length: 185 bp     
>XR_205527.1
GGAACACTGAGCATGTGCAGAGGGGTGCCAGGAGGCCTTGGGAGACTTGGGAGCACAGGGGAGAGAAGAACATCAGCGTGAGAGTGGAGCCAATGGAAAACAGAGCTCAAGAGGCCAGAAGGAGATGGTTAACAATGACCCGGACACAAGACAAAGAACCAGGACATAGGAGGAAGAGGTACAGG

XR_205529.1 Non-coding sequence

LOC101722084 PREDICTED: Heterocephalus glaber uncharacterized LOC101722084 (LOC101722084), misc_RNA.

Length: 508 bp     
>XR_205529.1
TGGAATCTTTCCCCCAAAAGCCTGAACCAACAGTTAACTGAAATAAAGCTGAACCCCATCCCCAGCACAGGTCTCAGTGACCTGCATCAGTGAAACAGCCGGTTTGCAATGAACGGGGAAAGAGAGCAGCACACTTTCTGCAAAGTTGCAAACCACAAATAATCGAGACTTACGGGAAAAATCGGATGGAGGAATGTGATTCAAAGCATGCAACTCTGCAACCACAGCACTAACAAAGTGGTCACGATGTGAGGAGCATTCTTCTGCCAGACCCTTCCATCATCCCTTCCTGCATTGGAGCTGGCTGCTACAGACTACAAATTGGCCAGCACAGCTCAGAGCCTGGGAGCTACGCACCAGCCTGGAGGGTGTCTGCTCACACACCGTCAACACCACCACCAGCTCCTTCCCCGAGAACTTCACCACCACCACCAGCAGCTTAACTTGACTGACTGAGAGTTCCTCTTCTTCCTTTTTCCTTTTGCCCTTCTGCCTGTTCTTGTTACCA

XR_205528.1 Non-coding sequence

Mical2 PREDICTED: Heterocephalus glaber microtubule associated monooxygenase, calponin and LIM domain containing 2 (Mical2), transcript variant X6, misc_RNA.

Length: 3914 bp     
>XR_205528.1
CCGGCTAAGCCTGCGCGGGGCTGCTTTGCTCGCACGCAGTTCCGCAGGCGGCCGGCGAGTACCCCGCGCTGCGCCGGCAGCGCGAGAGCAGGCAAGCGCCGAGCCGGGCGGGTAGCCCGCGAGACTCTCGGACCATGGCACTCTGTGCAGGGCTCGTCCTGAAAGGAGAAGACTTTAGCCCTTGTGATGCCTGAAAATCACGTGAGTGGGACGCATCCCCAGTGATTCATGCTGACCCTCCTTGTCGTCTCTCCGCCGCTGCTCCACAAACCCGCTCCGCCATGGGCGAGAATGAGGATGAGAAGCAGGCCCAGGCGGGGCAGGTTTTTGAGAACTTTGTCCAGGCTTCCACGTGCAAAGGCACCCTCCAGGCCTTCAACATCCTCACGCGCCACCTGGACCTAGACCCTCTGGACCACAGGAACTTCTACTCCAAGCTCAAGTCCAAGGTGACCACCTGGAAGGCCAAAGCCCTGTGGTACAAACTGGACAAGCGTGGCTCCCACAAAGAGTACAAGCGAGGGAAGGCGTGCATGAACACCAAGTGTCTCATTGTTGGCGGAGGACCCTGTGGCTTGCGCACTGCCATTGAACTCGCCTACCTGGGAGCCAAAGTGATCGTGGTAGAGAAAAGGGACACCTTCTCCCGGAACAATGTGCTGCACCTCTGGCCTTACACCATCCATGACCTGCGGGGCCTGGGAGCCAAGAAGTTCTATGGGAAGTTCTGCGCTGGCTCCATCGACCACATCAGTATTCGTCAACTGCAGCTCATCCTATTCAAGGTGGCCCTGATGTTGGGAGTTGAAATCCATGTGAATGTGGAGTTTGTGAAGGTTCTCGAACCTCCTGAAGATCAAGAAAATCAAAAAATTGGCTGGAGAGCAGAACTCCTCCCCGCAGACCACCCCCTGTCAGAGTTTGAGTTTGATGTCATCATTGGTGCTGATGGCCGCAGGAACACCCTGGAAGGGTTCAGGAGGAAGGAATTCCGCGGGAAGCTGGCCATCGCCATCACCGCCAACTTCATCAACAGGAACAGCACGGCTGAGGCCAAGGTGGAAGAGATTAGCGGGGTGGCCTTCATCTTCAATCAGAAATTCTTTCAGGACCTGAAGGAGGAAACAGGGATTGATCTAGAGAACATTGTTTACTACAAGGACTGCACCCACTATTTTGTCATGACTGCCAAGAAGCAGAGCCTGCTCGACAAAGGTGTCATCATCAATGACTACATCGACACGGAGATGCTGCTGTGTGCTGAGAACGTGAACCAGGACAACCTGCTGTCCTATGCCCGGGAAGCTGCAGACTTCGCCACCAACTACCAGCTGCCATCCTTAGACTTTGCTATGAACCACTACGGGCAGCCCGACGTGGCCATGTTTGATTTCACCTCCATGTATGCCTCAGAGAATGCTGCCCTGGTGCGCGAACGGCAGGGACACCCGCTGCTCGTGGCCCTTGTGGGCGACAGCTTGCTTGAGCCATTTTGGCCCATGGGTACAGGCTGTGCCCGTGGCTTCCTGGCGGCCTTTGACACAGCGTGGATGGTGAAGAGCTGGGACCAGGGGACTCCTGCCCTGGAAGTGCTGGCCGAAAGAGAAAGTCTTTACCGGCTGTTGCCTCAGACAACCCCGGAGAACATCAACAAGAACTTTGAGCAGTACACGCTGGACCCAGGGACGCGGTACCCAAACCTCAACTCACACTGTGTCCGGCCCCATCAGGTGAAGCATCTGTACATCACCAAGGAGCTGGACCACTACCCTCTTGAGAGACTCAACTCAATGAGGAGATCCGTCAACCTCTCCAGGCGGGAGTCAGATATCCGGCCCAGCAAGCTCTTAACCTGGTGCCAGCAGCAGACCAAGGGCTACCAGCATGTCAATGTCACTGACCTGACCACATCCTGGCGTAGCGGCCTGGCCCTCTGTGCCATCATCCACCACTTCCGGCCGGAGCTGATCAACTTTGACTCTTTGAATGAAGATGATGCTGTAAAGAACAACCAGCTGGCATTTGATGTGGCCGAACATGAGTTTGGGATCCCTCCGGTGACCACAGGCAAAGAGATGGCATCAGCCCAGGAGCCTGACAAGCTCAGCATGGTCATGTACCTCTCCAAGTTCTATGAGCTCTTCCGGGGCGCCCCGCTGCGGCCTGTGGATTCTTGGCGCAAAAGCTATGGAGAAAATGCCGACCTCAGTTTTTCCAAATCCTCCATTTCTAATAACTATCTCAACCTCACACTTCCCAGGAAAAGGACCCCTCGGGGAGATGCCCAAACGGAAGAGAACGACGTGAACAAGCGGAGGCGGAAAGGCTTCATCACCGTGGACCAGGATTGTGTGCGCAGGCTGCCAACCTTCTCCAGCCATAGTTTGGGTTCCTCTCAAGAGTGCGGCAACAGTAAGGAAGCAGGAAATCAGAACAAAGTCAAGTCCATGGCGAGTCAGCTGCTGGCCAAGTTTGAGGAGAGCACACGGAACCCCTCAGTCCTGAGGCAGGAGCGCCGTGTCTCAGGGATAGGTAACCCCGTCCTGTGCTCTTCCGCTGACCCTCCTGTAGACTCGCACTGCCCCACGCCGAAGGAGCCCACTCCCAGCCCACCGCCTCCTCTGAAAAGGCAGGTGCTCAGGGAGCTCAAGCAGGTGTCTCCTGGTGGCGAGTGTCCAAGCCGGCCCTGGAGAGCCAGGGCCAAGTCTGACCTGCAGCTCAGTGGCCCAGAAAACCTTGCCTCCCTGCCTCCCGCTTGCCAGGGGGCCCTGGCCCTCTCGGGGGTACTGCGGCGGCTACAGCAAGTGGAGGAAAAGATTCTCCAGAAGAGGTCTCAGAACTTGGCCAACAGGGAATTTCACCAAAAGAACATTAAAGAGAAAGCGGCTCACCTCGCCTCCATGTTTGGACACGGGGATTTCCCACAGAATAAACTACTCTCTAAAGGCCTGTCTCATACTCATCCTCCATCTTCTTCCTCTTGCCTTCCGTCTCCTGATCCAGCTGCTACTTCTACTCCATCAACTGTTGACTCTGCTTCTCCTGCCAGAAAGCTGACAGTAGGGAAAGTGTCCAGCGGAATAGGGGCTGCGGCTGAAGTCCTGGTCAATCTGTACTTGAATGATCACAGACCTAAGGCCCAGGCCACCTCTCCAGACCTGGAATCTATGCGGAAGACAATTCCCCTGAACCTGGGCGGCAGTGACACCTGCTACTTCTGTAAGAAGCGTGTGTATGTGATGGAGCGGCTGAGTGCTGAGGGCCACTTCTTCCACCGAGAGTGCTTCCGCTGCAGCATCTGTGCCACTACCTTGCGCCTGGCCACCTACGCCTTTGACTGTGAAGAAGGCAAGTTTTACTGCAAGCCTCATTTTATTCACTGTAAAACCAACAGCAAACAACGGAAGAGATGGACAGAGTTGAAGCAAGAAAGAGAGGAGGAGAGGACGTGGCAAGAGCCAGAAGCCCCTCGGCGAGATGCTGCCACGGAAAGCTCTTGCGCAGTGGCTGCCATCAGCACAGCAGAAGGCAGCCCTCCAGTTCATTTCAGCCTTCCAGTACTACACCCACTCCTTGGCTGACACACTTCTGCTCCGAGGTGACTGATTTTTCTCGGCAATTTTCAGAGTGATACTAACCCTTCACCTGCTTTCTGCACCCTGCCCTCCCTGCCAGCGGTACTGGTTGTGCTAACTAATCTCCCTCCCTTTCTAGAATGTCAACCAAAGAGAGCCCTCCTCCCTCTCAGGCTCTCTTTAGCTAGCCTCCTCATCTCCTCGCCAGGCATGTCTGTGACCTTTGGTAATCATTTACAGTGCCACATGGAACCCTGTATTTTGCACACGGCAAACAATGTTTAGCTTTATTTATGGTATTTGATGCTGTAAATGAAAATAAATGTGGTTCTTTATAAA

XR_205530.1 Non-coding sequence

LOC101696633 PREDICTED: Heterocephalus glaber uncharacterized LOC101696633 (LOC101696633), misc_RNA.

Length: 454 bp     
>XR_205530.1
GCTAATGCAAAGTCTCTGGGATGTGGTGGGCAACATGAGACTCAAGAGCACCCAAAGCATCTACAGGGATTCAGCTCCACACAAGGCACTGCACTTGGTGCTTGTTTTGGGCAGTGATACCAGCAGCTGCCACTCCACCATCATCTCTGGCTACGTGGAGGAAACCAAGCTATAGGAGAAAAGAGCACGACCAACTCAGAAAGAAGCTGAGCCAATTTGAGAAGGAGGAAATGAATGGCAGGGAAAGAATATGGACTGAGAGTTGGTGCTGACAGTCAACATGCAACCACAAGGTTCACCAGGTGAATCTGAGAAGAGGAACAACTTCTAAAGATGGTACAGCAGAAAGTTAGAGGAAGTCTTGGGTTCCTAACAACTGTGGAGTGACTTGCCAATGGAGGATTCCAATTTTTCAGTTTGTTTTAAATGAGAGAGAAATAAACCTGGCCAATTT

XR_205531.1 Non-coding sequence

LOC101704218 PREDICTED: Heterocephalus glaber uncharacterized LOC101704218 (LOC101704218), misc_RNA.

Length: 3414 bp     
>XR_205531.1
TACATTTCTTTTAGGAGTTCTTAATTTTAATAAGTTGCAACTTACCAACTTTGTCTTTCATGCATCATGTTCTGGCATTGTATTTAATAACTTTGTTTGTGTTTTGGGCACTGCTGGTTATTAAACCCAGAGCCTAGGGCCAGGGATTTAGCTCAGTGGTTTCGTCGCCTGCTGCGCAAGTGCAAGGACCTGAGCTTGATCCCTGGTACCAAAAACAAAACAAAACAAAAAAACCCCAGAGCCTCGTATGTGCCATACTTTGCACTATCACTGACCTACATACCACCCTTCCCACTGTGTTTAAAAGCACATCACCAAATTCAAAGCCACCTGGATTTTCTCCTATGGTACCTTCTGGAAGTTTTATTTATCAAACTGGCGATCTGCTAGTTTCTACCCATCCTCCAGAAATTCCCATTCTGCTACGGCAACTCAGCAGCTCTTCAGCTTATTGCTTGGCATGGTTGCAGCATTATCTGTGCCTCTGAGTCTATATGTTTGAAAAGAGGGGACACCCATATTGTCTGTCTTGCCTGGCTATGGTAAAAGAGATGCTGATGTGTAAATGTGATAGAAGCCAATTAGCACGAAGGGAGAAAAAAGGATAACTAGTGCTGAGGCCAACTCTATGGCTTCTCTTCCCTGGCAGCTAAGCCAGACAGCACAGTGTTTCTGGAGAAAACCAAAGTGATAGGTAAAGACAGACACCTCGTGTGTTAGTCAAGCGGGTTCTACCCAGAAGCCATTAACATAACATGGGAGAAGTGGACCCAGAAGGTTCCCCAGTACCAAGGGATTTCCAAGGACATCTGTACTGGTCCCTCCATCAAGAATGAGGATAGTGGGCTGGGGATTTAGCTCAGTGGTTTCACCGCCTGCCGTGCAAGCGCAAGGACCCAAGTTTGATCCCCTGTACCAAAAAAATAATAATAATAATGAGGATGGTATATTTAGCATCATCAGCTGCTTGAAACTCAGTGCCTGTCTGGAAGACAGTGGCACCATCTACCAATGTGTGGTGGGGCACACATCCTTGAACGCCTCCCAGAGGCTGAACTTCACACTGCCTGTGAGAGGTAAGTGTCTTCTTATTCTTCACCTTGGTTCCTGGGCAGTATAAGGTTTTTGCTAGTGTTTGATGGGGGAAAAGAGTAAGCTTGGGCTAAGGGAACAATCTGGGATCTGGCCCAGCTCAGCCCCAGTGGCAGCAGTCTGAGTTCAGTCCCTGTGCTGGGCAAATGGTGTGGTAGGTGGAAAGGGGTGAAAATAATCATTAGATGGAAACAGGGCTACTTGTCGGCTCATGGCAACCTCAGGGTGCCTGATAGTTCATGTGGCTTGGAGTGGGAGTCCTATCCGCTGCCGGGGAAATGAGGACATACCCTGCTTGCATCCCCTGATGATGAGGGCCTATGGGAGCCAAGGACCAGCACCCCTTCTAGTCAGGTTCCAAGTCCACCATAAACTGTTGTCTGGTAGAAGCAAATCCAGGAGCTATTTATAGGCTCTGGTCCAAGACAAGGAGGCCCTACTGTTGTGATCCTACAGATGCCCACCACTCTCCACACATAGCAGACCCTTATTATAACACAACTGCTTGCAGAGCTTTCTATGCTAGGGCTTTTGGGGTTCATATCTGGGTTTCCCTGTTCATGGCTGTGGTCTTGTGCAGGAGATGACCCTGTTGGTCAAATGTATGTTCCTGAAATGAGAGAAATAAGGGAGGCAATGGCCAACCAGGTGTCCTGGCAGGTGTGGTCAGGACAAGCCAGATGGGGGTGTGGATGATCCTACAAGGAGAAAGGAATTGTTCTTGAATCAAGGGCTGGGCTATGTGTGGGTAGCGTGTGTGGGGTATGTGGGGCATGGAGAGTGCACATGGACCCCATTGAAATATGCTTTGTGTGCATGGTAGGAAGGCTTTGTCTGAGCGCTGTGGATGTAAGTGGTAAGAGATGGTGTGTTTGGGAAGTTGGGAAGACGTCTGTGGCGTGCGTATGTGGGATGTGGTGTTTAATACTGTATTTCTAGACAAGTGCTCAGTGCTCTGATGTGGGAGATGTGTGTGAAAGGAATGGTGATACTGAGACTTGTGGCTTGGGGTTGGTGGTTGGCTCTCTTGACAGGAAAATGACATGAAGCTCACACATGTTAGCAGCAGCTGTTTTGTTTGTGGTGTCTTAGGTTTCTTCTTACTGTTCTCTTTTTCTCTGCAGAAGCTGAGAAGATAGATCTCTCTTGGATTCTTATTTTTTCTTCTTTTTGACTGATTTTAATAATGCTTTTTTTCTTTTTGTATATTTGGAGAAGGTTCTATTCATATAAGCCAGTATCGAACAATGGCAGTGAAGAAGTGTCTCGAGTAGACATGGAGGCCACTCTCGAGGCCAAAGGCCCTCTGAGTTAGGCCACCCTGGGGCTTGGAGGAGCCAAAGGAAGTCGGCACATCTGTCAAACAAAGATCCCAAGAGATGAGCAATGTCCCAAATGCAATGGTTTATTGAGCATTTATCACATTCATAGCAAGACAGAAGGGATCGCACCGATGGCATCAGCTGGAAGCTGGAGGTGGTGCCGATGGTACAGAATCTTTCTTCCACCCGGCCAACATGCCATGAGGACACTGGGGGCCCGATGGCGCTGGAACTTATGGCAATCCAGAGACCAGTACAGCTAGGGAACCAAGTGGGGCACTCTGGACCAGCAGAGTGACTGTCACAGACAGTTGCAGAGCTGGAGCGGCAGTTCCACGAGGAGCCATGCTCAAGCAGAGTCCGCAAGCATTGAGCCAGAAGACTGAGCTAAAGAGCCGCTGGAGGGTTTGGCTTTCATGCAGTGGGGAGTTTGAAACAAGCAACATGTTCTAATCTTATATGTGTACAGATAACATGTGCTAATCCTATGGTGGTGAAAAAGATATTTTTCTTTATGGTAAAACTATATTTTTGAAAGGGTTCACCGGATAAGATTTTTGGCATACCGATTTCATGGTTATTGCAAGCTAGTTTAGACTCAGAAAGTAAGTTTAAAGCAGACAGAAGCATAAGATGGCTTCCGTCCTGCTCACATCAAGAAGGAACCACAGTGCCAACAGAAGACTCCAATCCTTCACGTGTCTCTAAGTCCACGTCTGTTGCTGCATAGCTTTGCAGTGCCCTCCAGTCCTGGGCAGTCCCTTGACACTGGGCTCAAACATGTGCCTTGCTTCATACAAGAAAGTGACTCCAGGCCAGTTCCCAGTTTAGGCCTCTTGTCTTCCTTTGGTGTCTTTGGTGCCTCTGACATGAGAGAAGCATGAATCCAGGCCGGCCAGGAGGAGGATGTGCAATACAAGAAGCAGAGCCACATCATCCTAGGAATTACCCCCAAGTCCTGATTGAACTCAGAACCTCAAGTTTGCCAGGCAGGTGCTGT

XR_205533.1 Non-coding sequence

Ush1c PREDICTED: Heterocephalus glaber Usher syndrome 1C (autosomal recessive, severe) (Ush1c), transcript variant X3, misc_RNA.

Length: 4392 bp     
>XR_205533.1
CCTGAAGCAATGCACACACTGGGCTCTGAGGGACTCGTAGGGACCACTGGAGCTTGTGAGGCTCCTCCAAGCACTGGCATAAGACCCTAAGAACAGGACTTATGGCCAGGCTGATAAATCAGCAGGTGCACACCAGTACAAATGAACCTTTGGTTTAAATATTTAAATACTGCCCAATCCCAGGTCTCCCTCTGCTGCTCTGGCCTCTCCTCCAAAACTCCCTAGGCCCTTCCCAGATCCAGCAACTAAGGAGGCAGTGCCTGACCCAGCAGCAGCTTTCAAAAGCCTGGTCTAGCACTCGAGTGGTCAAGGGCGGGCAATCATTTAAGCTGTCACCCCCAGCCCCAGGGAGCTCAGGTTTGGGTTGTTGCCCTGCCATGCTGTTGCCTGGGAAGGAGAGGGCTGTCCTTGCTTATCTGCCCCAAACAGGGATGTGCTTTTGTGTGGACACATCTGGCCACTGCTACTGGCACATCCTTCCTGAGCTGACCTGGTCCCTGCCTCTTTTGGCATGTTGAAAGAGGACTACTTGTTCTGTGCTATGAGACAAGACAGTTTTGTTCTGGCCGACAGCAGTTCTAGGCAGAGACCCAGGCTGGCTTTTGTCTCAAGCCATTTCTTGGATGGAGGACCCAGGCGTCAGGTGGGAAAAGGCTTTTTCTCTTTCAACGGGGCTTTGTGTTTGGAGACCATGTCTGTGATTTGGAAGAGCTCATCCTTGACAAGGAGTTTGCTGTCTGCTTTTCTGGCATTGATTTCTGAAGCCAGCATTTTGGGGAGGGGCATTTGAGAGGGACTCAGAGCTTGGGAATGGGACTTTTCTCAGGTTGTCTTGGACTTGCTTTGTCCCAGATGAGGCCAGGTAAGTGGAGAATCAGGCAAAGGGTGCAGGTTTTTGGTTGGATCTGCCATTGCCATTCTTTATCTCCAAAGCCACACATTCCTTGGAAACCTAGCTTCCAGCTGCTGCCTTGGATGCTCTGGCCCAGCTGAATGGTGTCTCACCATTTTGTTCTCTGTGTTCTTATAGCCTTTGGGTGGTTTTACCGTTATGATGGCAAATTCCCAACCATCCGGAAGAAAGGAAAAGATAAGAAGAAAGCCAAGTATAACAGCTTGCAGGAGTTGAGAAAGAATAAGAAGGAACTGGAGTTTGAGCAAAAGCTTTACAAAGAGAAAGAGGAAATGCTGGAGAAGGAAAAACAACTAAAGATCAACCGATTGGCCCAGGAGGTATCTGAGACGGAGCGGGAAGACTTTGAGGAATCCGAAAAGACCCAGTACTGGGTGGAAAGGCTCTGTCAGACTCGCCTTGAGCAGATTTCCTCTGCTGATAATGAGATTCCAGAGATGACCACAGGGCCCCCACCTCCCGCACCTTCTGTGTCTCCCCTGGCCCCACCCTTGAGACGCTTCGCAGGTGGCCTGCACCTCCACACCACTGACCTGGATGACATCCCCTTGGACATGTTCTACTATCCCCCCAAGACTCCCTCGGCCTTGCCTGTGATGCCCCACCCTCCACCCTCCAACCCCGCTTCCAAGGTCCCCGCACTCCCTGTGCTTCCTTCCTCGGGCCACGTGAGTGCGTCATCCTCACCCTGGGTACAGCGCACTCCGCCCCCCATCCCCATCCTGCCCCCTCCATCCATTCCCACCCAAGACCTCACTCCTACCCGCCCACTGCCCTCGGCACTGGAAGAGGCCCTGGGCAACCACCCATTCCGCGCTGGGGACACCGGCAATGGATCAGAGGACTGGGAGGCCAAGAACCATAGTGGGAAGCCCACCAGCTCCCCTGCCCCTGAACGGAGCTTCCCGCCCACCACAAAGACATTTTGCCCAAGTCCACAGCCTCCACGGGGCCCTGGCGTGTCCACCATCTCCAAACCTGTCATGGTCCATCAGGAGTCCAACTTCATCTACAGGCCAGCTGTGAAGTCTGAGGTCCTGCCACAGGAGATGTTGAAGAGGATGGTGGTTTATCAGACAGCATTCAGACAAGTAAAACGCTCCCCATCATGTCTGGTCCTCCCTGTCACCTGTCCACCCGCACTGTGCCTGGCTTCTTTCTCCCTGGGGGTGCCAGCTGGTTCTGAGGCTGTCCGAGCGCCATCTGCCAGAGCGCCTCAGGCCACGGCAGGCCTCTTGCTCTGGCAAGGGTTGCTCTGTGTGTGTGTGTGTGGGGGGGTGTCCTATCAGATCCTGTGCTCAAGCCGAGAAAGCAGCAGGTTCCCAGTGCTTGCTCTAAGTTGTGCAGGCAGAGGGAGTCCTCAGGGAGCCACGGAGGCCAGGATGGGCCCTGGCTCCAGCCCCAGGAAAGAAGGAAGGCATGTCCCGCACCTTCCCTGTCTGTCTCCTCCAGTCCTATCACAGCTTCGCCAAACCCCACAGCCTCAGGAGGAAGTGGCCATGTGGCTCCTCCATCTGCCCAGGCTGAAGAAGTCCTCGCTGGTGTCTGGGTGGTGTCAGGCATGCAGCCACCGAGCCTCCCCACCTCGGGACTGTGTGTCCAGAGCCAGCCACTGCATTGGCTGTTTCCCTACCATTGAAAGGCACCCCAAGATAGAGGGGTACATGGCAGGCAGCCCTGACTTCTCCAGCCCCCACAGGGGGCTCACAGGCTGAGGTGACAGGAGGGGAACGACAGGGGTCCGCAAAGGAGCTGTACCCAGCTGAGGGGCTGGAGTAACAAGCGACAGCAAGGACTCCAGAAGGCAAGTGGTGCCAAGCACTGTTTTAAATGTGCTACGTACATTAGCTTGCTTGGCCTTTACAACAACCCTGGGAGGCAGTCACTATTACTGTCCTCATTTTAAAGCTGAAAAGCAGAAGCGGAGAGCTTGGAAATGTGTCTGTCATGATGGTACACTAGATTTGAATCCAGGAGTCTCAGCTCTGCAGTCTGCTCTCAAATGCTATGTCACCTGCCTCTCAAAGGTGACAAACGGGCATCACCTCAGAGAGCCCGGTGGTTTGGGACAGCCCGAAACAGGGAGAGAAGTGCTGAAAGGAGGCGTCTTAGGGTCAAAGCCTGTTCCCCTCCCCACTGACTGGATGACCTTAGGCATGAATGTCGCCTGGCTGGGCCCAGGAGTGATGGGTGGAGCCCCCTCGTGAAGGGCCAGCCAGCTGCAATGGCTCACTGTCTCCGATTCACACAAGATGCAAGACCTGCTCTCTGCCCTATCCCTGAGAATAGATCCTCCGGGTCAAGCCCACAGTGCCCAGCTCTGCAGATGGAGCAGCCAGGGACAGGCAGGCCTCTCTGATAGGATCATGGCTGTACACCTCTGTCATGCGTGGATTTGCAGGATGTGACTTGACACCCACACCCCGACCTGGTGTAGGCCACCACCCGCATGAGGCTGAGCCCTGGAGGGGAAGGGCAGTGAGGAGGGGTGGCAGGCGGATGCCCAGGGAGCTGTCTGCTGATCTTTGACCTTTATCTTATGACCAGAGCCTGGGTGCTACACACTGGGCTTCCCCTGCAGCCTCCCTGAACCCCTGATCACAGGCTCTCAGGGATGCTTGATGTGACCCGGGGAACTTCGAGCTGAGGCTGTCACAGGGCCCTGAGCGAGCCACAGCTTTACTGTCCTCACTCAGTCTCAGTATCCTGGCCCTGCGGCCTGTGATGCCCCTCACTCTGCTCTCTGCATGTGACTCTGAGGAAGGCCAGTCTTGGCTCTGGTCCCTTCTCCCTCCTTGTTTCTAAATCTTGGGGACATTGTCCCCGTAGCAACCTCTTCAGGCCAGGGCCCCAGAGCTGCATGTCCTCTCTTCTCCCTCAGCCAAAGGACCAACCTGGGGGCCCTGATGCTCTAGAGGAACATTGCGTGAAAACAGTGCCAGGCACCAGGCAGTGCAGCCTGGACAGGGGTTGGGCACTGGATGGAGGGGCATGGCTTTCTCCCCCAGGCCTAGCATGGCTCAAGTGGGCACTTGGAGGAGGTGATGCAGGGCTGAAAGGCTGATGCTGGGGGTGACACTTTGTGGAGGGCAGGGGCCACCTGCCCAGGTTTTAGACACAGCAGTGTCCTGCAGCCACAGACATCCGCCTGCTGGGCCTTGCAGAGTACAGGGCCGAGCCCCTCCAAAAGCTTCTGCAGCTTCCCACCTGCCCCTGGGCAAGGGCTCTAGCTCCTGGGACGAGCCACCTCCCTGCCTCCTAACCCAGCCAGCCACACCTGCCCCCACCTCTGACCCATTCACCCTCTTCCTTCTCTGCTCTGGCCCGCAAGGGCCTCTGCTCTGACACCCTAAAGCCCTCCCTCTGCTTCCAGGATTTCCGGAAATATGAGGAAGGCTTTGAGCCCTACTCCATGTTCACCCCAGAGCAGATCATAGGGAAGGACGTTCGGCTCCTGCGCATCAAGAAGGTACCAGGGC

XR_205532.1 Non-coding sequence

Ush1c PREDICTED: Heterocephalus glaber Usher syndrome 1C (autosomal recessive, severe) (Ush1c), transcript variant X2, misc_RNA.

Length: 5771 bp     
>XR_205532.1
CGTATCACTGCAAAAAGTAATAAAAGGAAACAGATCAAACCCTTTCCAGGCAGTGACAACTGTGCAAATGTGAAAGAGCTGGACTCTTGCACATAAACATCACAAATGACATCACTTTCCAGTTATCACTTGAAAGTTGCCATTGGTAAAAGATAGGGCTGGTTTCCCCCTATTCATTAGTTCTGTCATTCCAGAAACAGCTGGTATTTTGTTTTTTATTTTTATTTCCAAAACAGAGAACAATTGCTCTTAGGTAGAAGCAATAGCACATCACCATCTGCCTCTCCTCTCAGCCTGGACTGAGAAGAATCCATGAATTTAAAACTGACAGCTAAAAGGACAACATAGTCATATCCTCACACTGGCTCTGGAAACCCATTATCATATTAACTAGAGCCATGGAGATGCTTTGTCTCCCAGAAGCTGGAACACTGATTCCCCACATAATGCAAGGAGGTGTCTTGGCCATGATCATCAATGCACAAACCCCCTCTTATCTGAAAAGAGAAAGATTCAGTGTCTCTATTCCTACCCTCGAAGTGAGATCCTATGGGACTCAAGGCCTCCAGTCTATGGCGCCAGTCTATGCCAAGATCTGGAGAATTCTTGGTTCTGACTAAGGCGTTTCATCCAAACTGCTTGAGTAAATCATGAAGAGCATCCTACTTGCAGGAGCCCAGTCTGACAGGGGAGGGGGATGCACACACAATTAAGTTAGTACATGGAAGCAATAGGAGATTCATAGGCAATGCTGTGGGGAAATCTTCCCCCTGTGTGTCTAGGCAGATGCTACTTTGTTGAGGATGAGACAGAAACTATGTGTTTGTTGTCAGCCTGCCCTACCCAGGAGCTTGGCTCTGAAATCTTAGCACTGATTTTTTTGAAACCAATAGGAAGGCCATTCCTATCATGGTGATCCCTGTGGGAGGCCATGCCCTCACCCTAGCAAGCTGCCACTAGGTAGAATGTTTCTGGCTCCCCTTGAGGAATTGCTGTCTGAATCTCTTAACATGATGGCAGGAGTTCACCTCTCAGCCAAGCTAAGTCTAGTGAGCAGAGTAGGCAAAAAACCAAGTAGGAGAACCATTTTCTCAAGAAGCTCATAGACTACTCAGGAAGTGGGTCCCAAAGGTGACCATTTCCAAAGCATATTAGCTGTGCATCAAGTGGGGATTGTCTTTACAGGGTAACAGACTAGAATAAGCCAGTCAGAGGTCTATAATGACCCACTATTCCTCCAGCTGTGAACAAAATGTGTGTTCGTTACTGGGAAACTCAATTCCTTATTCCTAGCCTTGGCTGCTGAGATGATTTATGAAATCCAAGGGCAGGCCCCAGGAGGGCTTGTGAGAGGGAGGGGTGAGCTCAGTAACAGGGAGTTTTCTTGTCCCAGAAAGTGCCCAGAATGTTGACTCCTTCTGTATCCCCTCTCCCGAGTGCTGTGTGTGTTGGGGGCTGACTCTGTCCCTTTTGCCCCCAGCCATGAGGGAACAGTAAAAAAAACTGGGACCTGGAAGACTAAGGTCCACATCCTGGCACCATCACTTACTAGATATCTGACATCGGTAAGGGTCTCCATCTCTCTGAGCCGTGGTCCCTTCATCAAGAAAAGGGAACAGTATCTACCTAGGGGCTAGAGTTAGTGTCAATCCCCTGGCTTGTAGAAAGCAGGCTCTGTGGGTCCAGTTCTAGTAGGATCTGTTTTCCCTTCATCAAATCGTTCTGAACTCTGTGACCAGAGCAAAGCAGCCAGGCCCTCCTCCCCACCTATGGCTCCCAGTCCTGTGGTTTCCAGCCAATCCTCAGTTGAGGGGCCCAGTTAGAGGGAACCCTTGGTTTAGACTCTCCAGGATGGAATAGCTTACACACTGGGGCAAAATCCAGTGTCCTTGGCGCTGGGCCCCAGGTCTGAGGCTGCTCCCACTTCCTCTTGCTCGGGACAGAAGATCTCTGAGGATGAAATTTGCCAGCTCGCCCAGATTTTCTCTACAATCCCCCAGGATGCATCTCTGTTATCTGAACATGATCCACCTTTCTCTTCAAATGCTGGAGAAGAAATAAATACAATGCCTTTTATTTAGACAACACTTTGAAGTTTACAAAGCCCTTTCATAGATGCTATTTCATTGGCACTGAATGAAAGCCTGTGGGGAAAGTATTTCCTCATTTAGAGTCAAGGGGAATCAGGCTCAGAGAGATGAAGGAACTTAGTTAAGGTCACACAGATGGTTACTGAACTAGTAAGCTGGTTCCCACTGGCAAAGGAATGTGTTTCCCACTCTGCAGCAGGTAGCAGTGGCTGCCCATCCTAAACCTGAGATCGGATGCCCAGTGCAGTGAGCCAGAGCTGTGGGTGGAGCTCAGCATGGTGTTGTCTGAGGACTGGATGCTGTTTGCTGTGTGGTTCTAGTATCAACACAACCTGTAACCCTTATATACACAATGCCGCCTCCACTCAGAAAGGAAAAGATAAGAAGAAAGCCAAGTATAACAGCTTGCAGGAGTTGAGAAAGAATAAGAAGGAACTGGAGTTTGAGCAAAAGCTTTACAAAGAGAAAGAGGAAATGCTGGAGAAGGAAAAACAACTAAAGATCAACCGATTGGCCCAGGAGGTATCTGAGACGGAGCGGGAAGACTTTGAGGAATCCGAAAAGACCCAGTACTGGGTGGAAAGGCTCTGTCAGACTCGCCTTGAGCAGATTTCCTCTGCTGATAATGAGATTCCAGAGATGACCACAGGGCCCCCACCTCCCGCACCTTCTGTGTCTCCCCTGGCCCCACCCTTGAGACGCTTCGCAGGTGGCCTGCACCTCCACACCACTGACCTGGATGACATCCCCTTGGACATGTTCTACTATCCCCCCAAGACTCCCTCGGCCTTGCCTGTGATGCCCCACCCTCCACCCTCCAACCCCGCTTCCAAGGTCCCCGCACTCCCTGTGCTTCCTTCCTCGGGCCACGTGAGTGCGTCATCCTCACCCTGGGTACAGCGCACTCCGCCCCCCATCCCCATCCTGCCCCCTCCATCCATTCCCACCCAAGACCTCACTCCTACCCGCCCACTGCCCTCGGCACTGGAAGAGGCCCTGGGCAACCACCCATTCCGCGCTGGGGACACCGGCAATGGATCAGAGGACTGGGAGGCCAAGAACCATAGTGGGAAGCCCACCAGCTCCCCTGCCCCTGAACGGAGCTTCCCGCCCACCACAAAGACATTTTGCCCAAGTCCACAGCCTCCACGGGGCCCTGGCGTGTCCACCATCTCCAAACCTGTCATGGTCCATCAGGAGTCCAACTTCATCTACAGGCCAGCTGTGAAGTCTGAGGTCCTGCCACAGGAGATGTTGAAGAGGATGGTGGTTTATCAGACAGCATTCAGACAAGTAAAACGCTCCCCATCATGTCTGGTCCTCCCTGTCACCTGTCCACCCGCACTGTGCCTGGCTTCTTTCTCCCTGGGGGTGCCAGCTGGTTCTGAGGCTGTCCGAGCGCCATCTGCCAGAGCGCCTCAGGCCACGGCAGGCCTCTTGCTCTGGCAAGGGTTGCTCTGTGTGTGTGTGTGTGGGGGGGTGTCCTATCAGATCCTGTGCTCAAGCCGAGAAAGCAGCAGGTTCCCAGTGCTTGCTCTAAGTTGTGCAGGCAGAGGGAGTCCTCAGGGAGCCACGGAGGCCAGGATGGGCCCTGGCTCCAGCCCCAGGAAAGAAGGAAGGCATGTCCCGCACCTTCCCTGTCTGTCTCCTCCAGTCCTATCACAGCTTCGCCAAACCCCACAGCCTCAGGAGGAAGTGGCCATGTGGCTCCTCCATCTGCCCAGGCTGAAGAAGTCCTCGCTGGTGTCTGGGTGGTGTCAGGCATGCAGCCACCGAGCCTCCCCACCTCGGGACTGTGTGTCCAGAGCCAGCCACTGCATTGGCTGTTTCCCTACCATTGAAAGGCACCCCAAGATAGAGGGGTACATGGCAGGCAGCCCTGACTTCTCCAGCCCCCACAGGGGGCTCACAGGCTGAGGTGACAGGAGGGGAACGACAGGGGTCCGCAAAGGAGCTGTACCCAGCTGAGGGGCTGGAGTAACAAGCGACAGCAAGGACTCCAGAAGGCAAGTGGTGCCAAGCACTGTTTTAAATGTGCTACGTACATTAGCTTGCTTGGCCTTTACAACAACCCTGGGAGGCAGTCACTATTACTGTCCTCATTTTAAAGCTGAAAAGCAGAAGCGGAGAGCTTGGAAATGTGTCTGTCATGATGGTACACTAGATTTGAATCCAGGAGTCTCAGCTCTGCAGTCTGCTCTCAAATGCTATGTCACCTGCCTCTCAAAGGTGACAAACGGGCATCACCTCAGAGAGCCCGGTGGTTTGGGACAGCCCGAAACAGGGAGAGAAGTGCTGAAAGGAGGCGTCTTAGGGTCAAAGCCTGTTCCCCTCCCCACTGACTGGATGACCTTAGGCATGAATGTCGCCTGGCTGGGCCCAGGAGTGATGGGTGGAGCCCCCTCGTGAAGGGCCAGCCAGCTGCAATGGCTCACTGTCTCCGATTCACACAAGATGCAAGACCTGCTCTCTGCCCTATCCCTGAGAATAGATCCTCCGGGTCAAGCCCACAGTGCCCAGCTCTGCAGATGGAGCAGCCAGGGACAGGCAGGCCTCTCTGATAGGATCATGGCTGTACACCTCTGTCATGCGTGGATTTGCAGGATGTGACTTGACACCCACACCCCGACCTGGTGTAGGCCACCACCCGCATGAGGCTGAGCCCTGGAGGGGAAGGGCAGTGAGGAGGGGTGGCAGGCGGATGCCCAGGGAGCTGTCTGCTGATCTTTGACCTTTATCTTATGACCAGAGCCTGGGTGCTACACACTGGGCTTCCCCTGCAGCCTCCCTGAACCCCTGATCACAGGCTCTCAGGGATGCTTGATGTGACCCGGGGAACTTCGAGCTGAGGCTGTCACAGGGCCCTGAGCGAGCCACAGCTTTACTGTCCTCACTCAGTCTCAGTATCCTGGCCCTGCGGCCTGTGATGCCCCTCACTCTGCTCTCTGCATGTGACTCTGAGGAAGGCCAGTCTTGGCTCTGGTCCCTTCTCCCTCCTTGTTTCTAAATCTTGGGGACATTGTCCCCGTAGCAACCTCTTCAGGCCAGGGCCCCAGAGCTGCATGTCCTCTCTTCTCCCTCAGCCAAAGGACCAACCTGGGGGCCCTGATGCTCTAGAGGAACATTGCGTGAAAACAGTGCCAGGCACCAGGCAGTGCAGCCTGGACAGGGGTTGGGCACTGGATGGAGGGGCATGGCTTTCTCCCCCAGGCCTAGCATGGCTCAAGTGGGCACTTGGAGGAGGTGATGCAGGGCTGAAAGGCTGATGCTGGGGGTGACACTTTGTGGAGGGCAGGGGCCACCTGCCCAGGTTTTAGACACAGCAGTGTCCTGCAGCCACAGACATCCGCCTGCTGGGCCTTGCAGAGTACAGGGCCGAGCCCCTCCAAAAGCTTCTGCAGCTTCCCACCTGCCCCTGGGCAAGGGCTCTAGCTCCTGGGACGAGCCACCTCCCTGCCTCCTAACCCAGCCAGCCACACCTGCCCCCACCTCTGACCCATTCACCCTCTTCCTTCTCTGCTCTGGCCCGCAAGGGCCTCTGCTCTGACACCCTAAAGCCCTCCCTCTGCTTCCAGGATTTCCGGAAATATGAGGAAGGCTTTGAGCCCTACTCCATGTTCACCCCAGAGCAGATCATAGGGAAGGACGTTCGGCTCCTGCGCATCAAGAAGGTACCAGGGC

XR_205540.1 Non-coding sequence

Zdhhc13 PREDICTED: Heterocephalus glaber zinc finger, DHHC-type containing 13 (Zdhhc13), transcript variant X5, misc_RNA.

Length: 1963 bp     
>XR_205540.1
GTGCTGCGGCCGCCACTTTCCAACGAGCGGGCGCCGCAGCCGCAGCCGCGGGTGCCCGGGGGGATGGAGGGCCCGGGGCTAGGCTCGCAGTGCAGGAATCACAGTCATGGCCCCCACCCTCCCGGATGTGGTCGGCATGGTGTCTGTGCACATGAAAGCAAAGAGCTTGCCAAGGCAAGAGAAATTCTTCCTCTTATAGAGGACTCTAGTAACTGTGACATTGTCAAAGCCACTCAATACGGGATTTTTGAACGATGTAAAGAGTTGGTAGAGGCAGGATATGACGTCAGGCAACCAGACAAAGAAAATGTGTCACTTCTTCACTGGGCTGCTATTAACAACAGGCTGGATCTTGTAAAGTTTTATATTTCAAAAGGTGCTGTTATAGATCAGTTAGGTGGAGATTTAAATTCAACTCCTCTTCACTGGGCCATACGGCAGGGGCATTTACCGATGGTCATATTGTTACTCCAGCATGGTGCGGACCCCACTCTCATTGATGGGGAGGGATTCAGCAGCATTCACCTGGCGGTATTATTTCAGCGTATGCCTATTATAGCATATCTCATCTCAAAGGGGCAGAGTGTGAATATGACAGATGTAAATGGGCAGACACCTCTCATGTTATCTGCTTCCAAAGTAATTGGACCAGAACCAACTGGATTTCTTTTAAAGTTTAACCCTTCTCTCAACGTTGGTGATAAAACACACCAAAACACTCCACTCCACTGGGCAATTACATCAGGAAATGTTAATGCAGTTGATAAACTTTTGGAAGCTGGTTCTAGCTTGGATATCCGAAATGTTAAGGGAGAAACACCTCTTGATATGGCTCTGCACAACAAAAATCAGCTCATTATTCACATGCTAAAAACAGAAGCCAAAATGAGAGCCAACCAAAAGTTCAAACTTTGGAGGTGGCTGCAGAAATGCGAGCTCTTCCTGCTGCTGATACTCTCTGTGATTACCATGTGGGCTGTTGGATACATACTGGACTTCAATTCAGATTCTTGGCTCTTAAAAGGATGTCTTCTAGTAACATTGCTTTTTCTGACATCTTTGTTTCCAAGGTTCTTGGTCGGATATAAGAACCTTGTATACATACCCACAGTCTTTCTACTAAGTTCCATATTTTGGATATTTATGACTTGGTTCATATTATATTTTCCTGATATGGCAGGCCCCCCTTTCTATTTCGTCTTCCTTTTCAGCTTAGTAGCCTTTCTCTACTTCTTCTACAAGACTTGGGCAACTGATCCTGGCTTCACTAAGACTTCTGAAGAAGAAAGGAAAGTGAATATCATCACCCTTGCAGAAACTGGCTGTCTGGATTTCAGAACATTTTGTACATCATGTCTTATAAGAAAGCCATTAAGGTCATTCCATTGCCATGTGTGCAACGCCTGCGTAGCTCGGTATGATCAGCACTGCGTGTGGACTGGACGGTGCGTAGGTTTTGGCAACCATCACTATTACATATTATTCTTGTTTTTCCTGTCTGTAGCATGTGGCTGGATTATGTGTGGATCTTTCATCTATTGGTCAAATCATTGTGCCACAACATTCCGAGAAGATGGATTATGGACCTACCTCAGTCAGATTGTGGCCTGTTCCCCTTGGGTCTTATATATCTTCATGCTAGCAACTTTTCATTTCTCATGGTCAACGTTTTTATTAATGAATCAACTCTTTCAGATTGCTTTTCTGGGCCTGACCTCCCATGAGAGAATCAGCCTGCTGAAGCAGAGCAGGCAGATGAAACAGACACTGTCCCTCAGGAAGACACCATACAAGCCTTTGACCACAAAGATGAGGAGTTTGGACGGGGCCTCTGGACAGAGTCTTGAAAGGCTTGATTGAGACATGGACTATGAATGTGTCAGGTTTTGGAGGACTAGACAGGCTGCAGTATGTAAGATGAACTGGAAGGGACTGAGCCTTGGATTCAAACAGAACCTGGCAG

XR_205535.1 Non-coding sequence

Sergef PREDICTED: Heterocephalus glaber secretion regulating guanine nucleotide exchange factor (Sergef), transcript variant X7, misc_RNA.

Length: 4285 bp     
>XR_205535.1
CACCGGCGAGCTCGCCGGCATGGAGCCCGAGCCTAGCGCCTCCGAGGCCACCCCTGCGGGTGCCGCGCTCTTCGCCTGGGGTGCAAATAGCTATGGGCAACTTGGCCTTGGCCATAAGGAAGATGTGCTTTTGCCCCAGCAACTGACTGACTTCTGTAAACCTGAGTGTGTCAGGAAGATCACAGGAGGAGGGGGACATTCTACAGTTGTCACAGATGGAGGAAGCCTTTTTGTTTGTGGCTTGAACAAAGATGGGCAGTTGGGGCTTGGTCACACAGAGGATGTTCTGTGTTTTACCATCTGCAAATCTCTTGGTGGCTGTCGCATCCAACAGGTAGCCTGTGGCTGGGATTTTACCATTATGCTCACAGAAAATGGTCAAGTTCTATCATGTGGATCAAACTCCTTCGGCCAGTTAGGTGTTCTTCATGGACCTCGAAGATGTGTGGTTCCCCAGGCCATTGAGCTTCTGACAGAGAAGGTTATTTGTGTTGCTGCTGGACTGAGGCATGCATTAGCTGCTACAGTGAGTGGCATTGTGTTCCAGTGGGGGACTGGTTTGGCATCATCTGGACGACGGTTATGTCCCGGGCAGACTCTCCCATTATTTTTGACAGCAAAGGAACCAAGCAGAGTGACAGGTCTAGAGAATTGTAAAGCAATATGTGTTCTTGCTGGCTCAGCCCACTCAGCTTTATTAACAGACGCAGGAGAACTATATGTTTGGGGCGGTAACAAGCACGGACAACTAACTACCCAGGCTGCTTTCCTTCCTGTGCCCCACAAAATAGAAGTGCACTGTTTTCAGAGTGAAAAGGTCACTGCCGCCTGGAGTGGGTGGACCCACCTGGTTGCTCAGACAGAAACTGGCAAGGTGTTTACTTGGGGCCGAGCAGACTATGGTCAACTAGGGAGGAAGCTGGAGACTCAAGAAGACTGGAAACTAGAAAACCAGGATTCATCGAGACCACCGAACAGCACACCTTCACCTCTGCATTGCCTGATGGGAGCCACGGAGATCTCTTGTGGCTCAGAGCATAATTTGGCAGTAATTGGTGGGGCGTGTTATTCCTGGGGCTGGAACGAGCATGGCATGTGTGGGGATGGCACTGAAGCCAATGTCTGGGCCCCGAGGCCTGTGCAAGTCCTGCAGTCGGCACCAGGACTCCTCGTGGGCTGTGGGGCCGGCCACTCCCTGGCCCTCTGTCAGCTGCCAGCACAACCTGCTGTGGGCAAGGATCTCATCACTTACCCTCCCTCAAATGCCACTGAGGACACCAAATCTCAGGAAGCACTGGACAAAGAGAAATTGGAAGAAAAGACAGAAATTTCAACCCAAAGCCAACCTGACAAATCCAGAAGTGATAGAGAACCTTTAATAAAGTAGTTTTCCCTGAGACTCGCTGTGTTGGGCTGTGAGGTTGGCCTGAGCCAACAAACCAGAATGGTGGGCAACTGCTTGCCCCGTATCTAGGCTCAAGGAGACATCCTTTCTACTCAGCAGGTAAGAACCAAGGGTTAGGTCTGCACCAAAGGACCTGGAAAACTAAAACTCCAGCAGGAAGGCTCCAGCCTCCCCAAACTGGTGGAGACAGAAAACCCAGCTCTAGCCCCATGGTTGTTTCAGTTCTGCAGCCTTTGGTTTGCAAAACAGAGGGTTCTGGCAGCCTCAAGCCTATCCTGAGGTTTTATTCCCAGGACCCAGAGCATGCGGCATGCCTGTTCAGGGATAGTGAGCTACTCTGCCTGGGAACTTAAGGGAGGAAGGAAGCCAGGAAGACCGCTGGTGACTAGGCCCACAGGAGAAGACTGTGCAGTGGGGGTGTGAGGGAGTGAAATGAATAAGTGGAGGGAAACAAGACTGCTGGGAAGAGAACCCTGGGGCACATAAAGGAATTTAGAACCAGTGAAGCTCTTGGGAAGGCTTAAGTCTCCATCCAAGCCGGACAGGGTGGCGGAGCCAGACTGTGTAACCGTAATAGCCAAGTGATACAGTTTCTGAGTTTGGGTCTGTGATAACTAGGCTCCAGTGGCTTTAGGAAGTTACAGAATCCTCAGACATCCAAGCTGAAGAACATTTCATCTCCATCTAGCCTAGTGGCTTTCTCCTGCATTCTTCAGAGCCCGGGAGCCTATGGAGGATCAGTAGCCTTCTTATAGAGTGTGGGGGAAAGACTGAGGAGCAAAGGACTGGATTGCCCAACTCCACTTTATTCAGAGCAGCTTCAATTTTCTCCATATATTATATATTGGGCTTGTCAAATGGACAAGGTGAGAAAGTTTTGAAAATTACTGATCTTTTCCAACATTTTCATTGTTCATATGAAGAGGCCATCTCAAGGGCATATAACTCTTGGTCCAGGGTCATGACTAAAAGTGACCCAGCATGCCCCTGAGCTAGATAATGGTGGGATAAGAGTAACCCTGGGGCTAGAAGGGGATTCAGCTTAAGAGAATCTGGCAAAGGACAATTCTGAGTTCCCCAGGTCAGAGCCTAGAGACCACTCACAGCCATAGGCAGATCTTGAACACCAGTGTGTGGAGTCCTGCTCCCAGTATTGCATCCTAGAAATATGGTGGCCATAACCAGCAAAGTCCTTGGTCCCTCACCTCCAAGAACCAACTCGAGCCAGTGCAGCCTGTGCACTCAGAGCTGGTATTGCCAAAGTGACCAGGCCCATTGAGATAGAACATGTGGATAGCCCAGAGATGATCCATATTGGAGCAAGCCCAAGGTTACTGGCTACCACCCACGCTCCTACAGGCTGTGTTCTGCATCCAACAGGCCAGAAAGCAATTCCAATGGGACAGCACTCAGGCCCATACCTCATAGGCAAGTTTTTGCTCACAGGGAACCAGCACAATCTCTCCCACAAGATTGCAGTGCAGAGCTCCCTCTTACCTCTTCCAGTACCTGCTGGAAGAAATCAAAACTCCCAAGTTCTCTGCTGCTGAATCCTAATACTTCTTCCAAGACCACCTTAAGGGCATCAGAAAGAAGGGCTCCTTTCCAGCTGAAACAAGATCAGGTGGTGCATCAGCCCTAAGCCCTTTGATCTAGAACCTCATTCTCTTGGAACTGAATCAGATTCTTCTTGAAGCAGCAGAGCACAGATGGTCCACACATGGAAGAATGAATGGCTCTGGGCAGTAGGAGACCCCATAGACTACTCTGTCACCTCTGGTTCATCCATTCCACCCTTCTTGACAGCAGCATCAGAAGAAAGGCTTTCCCCAAGTCACCTCACTAGCTGGCTCTGCTCCCATGTCGCTGAAAACCAGATGCCAGATGGCTTTCCGTCGTTCACCAGAGGCTCTTCTTTGCCAGGACACCCTGGGTAGCATAAACATTACTGTCCCTGCAGCAGCCAAGGCTGCTTAGCTCACACATCCTGAGACTCAGAGATGGTTGTTACAGCCCGGAAGCCATACAACCTTGGGTAGAGGCTCCTCCAACCCCAATCCCTTGGTCCTTGGACTTCACAGGACAGGAAGTTAAGGCAAATGCTTAGAGGGAATGAAAAACTGGTAGATGAAAATTCAGCGCCCCCCTCAAGCCTCCCACCCATAGGATCACTGACTCAGGACATGCTGGGAGGTATAAGGGAACTGAAATCAGGAAAATTGACACGCACTTGTTTTTGACCCTGGGCAGATCACTCCCCTCCCAGGCCTCATTTCCTCATCTGTAAAATGCTAAGATTTACTACAGTGACCTTCAGGTACTCTCTACTTGATTATTCCTGGAACTTCTGATGGAGAAGAAAAGGGTTGGCTCCTCCACTCTCCCCCTCCACCAAAACCAAGTGAAAACCTGAGCAAATCAAGAGCCCTAGGAGAGGACTGTACTTCTGAGATGCCTCCAGGCTGAGAGAGGGGTACTCAGTGAGGTGATCTACCAGGCTGGGCCTGCAAGAGTACAGCTGGCTGGGGGACCCAGACCTGGCAGGTAGACCTCTGGCTCCATCAGCTTCAACAGTGGCCCTAGCAGGGAGGTAGGATGGTAGGGGGACTGGATGCTCTGACCAGATTCAAAGCGGCATCAGTGCGGCCTGATGCGCAGAGAAGTGTCCATGTCAGGTGGACCCCAGAGGCCGTGCTGGTCTTACATCGGATCTTTGGACACCCTGTGCCTTCTGAGAGCTGCCTCCCTCCCCGAGTCCTACAGCATGTGGGACCCAAGGGGCCGTCCTGCCCAAGCAGCCTGGACCAGCCAGCTTCCTCCTTAGGGCTGGCCATCCCCCATCAGGTTGGCAGGAGCAGGAGCCATGGCTAGGGCTTACCC

XR_205534.1 Non-coding sequence

Sergef PREDICTED: Heterocephalus glaber secretion regulating guanine nucleotide exchange factor (Sergef), transcript variant X6, misc_RNA.

Length: 4314 bp     
>XR_205534.1
CACCGGCGAGCTCGCCGGCATGGAGCCCGAGCCTAGCGCCTCCGAGGCCACCCCTGCGGGTGCCGCGCTCTTCGCCTGGGGTGCAAATAGCTATGGGCAACTTGGCCTTGGCCATAAGGAAGATGTGCTTTTGCCCCAGCAACTGACTGACTTCTGTAAACCTGAGTGTGTCAGGAAGATCACAGGAGGAGGGGGACATTCTACAGTTGTCACAGATGGAGGAAGCCTTTTTGTTTGTGGCTTGAACAAAGATGGGCAGTTGGGGCTTGGTCACACAGAGGATGTTCTGTGTTTTACCATCTGCAAATCTCTTGGTGGCTGTCGCATCCAACAGGTAGCCTGTGGCTGGGATTTTACCATTATGCTCACAGAAAATGGTCAAGTTCTATCATGTGGATCAAACTCCTTCGGCCAGTTAGGTGTTCTTCATGGACCTCGAAGATGTGTGGTTCCCCAGGCCATTGAGCTTCTGACAGAGAAGGTTATTTGTGTTGCTGCTGGACTGAGGCATGCATTAGCTGCTACAGTGAGTGGCATTGTGTTCCAGTGGGGGACTGGTTTGGCATCATCTGGACGACGGTTATGTCCCGGGCAGACTCTCCCATTATTTTTGACAGCAAAGGAACCAAGCAGAGTGACAGGTCTAGAGAATTGTAAAGCAATATGTGTTCTTGCTGGCTCAGCCCACTCAGCTTTATTAACAGACGCAGGAGAACTATATGTTTGGGGCGGTAACAAGCACGGACAACTAACTACCCAGGCTGCTTTCCTTCCTGTGCCCCACAAAATAGAAGTGCACTGTTTTCAGAGTGAAAAGGTCACTGCCGCCTGGAGTGGGTGGACCCACCTGGTTGCTCAGACAGAAACTGGCAAGGTGTTTACTTGGGGCCGAGCAGACTATGGTCAACTAGGGAGGAAGCTGGAGACTCAAGAAGACTGGAAACTAGAAAACCAGGATTCATCGAGACCACCGAACAGCACACCTTCACCTCTGCATTGCCTGATGGGAGCCACGGAGATCTCTTGTGGCTCAGAGCATAATTTGGCAGTAATTGGTGGGGCGTGTTATTCCTGGGGCTGGAACGAGCATGGCATGTGTGGGGATGGCACTGAAGCCAATGTCTGGGCCCCGAGGCCTGTGCAAGTCCTGCAGTCGGCACCAGGACTCCTCGTGGGCTGTGGGGCCGGCCACTCCCTGGCCCTCTGTCAGCTGCCAGCACAACCTGCTGTGGGCAAGGATCTCATCACTTACCCTCCCTCAAATGCCACTGAGGACACCAAATCTCAGGAAGCACTGGACAAAGAGAAATTGGAAGAAAAGACAGAAATTTCAACCCAAAGCCAACCTGACAAATCCAGAAGTGATAGAGAACCTTTAATAAAGTAGTTTTCCCTGAGACTCGCTGTGTTGGGCTGTGAGGTTGGCCTGAGCCAACAAACCAGAATGGTGGGCAACTGCTTGCCCCGTATCTAGGCTCAAGGAGACATCCTTTCTACTCAGCAGGTAAGAACCAAGGGTTAGGTCTGCACCAAAGGACCTGGAAAACTAAAACTCCAGCAGGAAGGCTCCAGCCTCCCCAAACTGGTGGAGACAGAAAACCCAGCTCTAGCCCCATGGTTGTTTCAGTTCTGCAGCCTTTGGTTTGCAAAACAGAGGGTTCTGGCAGCCTCAAGCCTATCCTGAGGTTTTATTCCCAGGACCCAGAGCATGCGGCATGCCTGTTCAGGGATAGTGAGCTACTCTGCCTGGGAACTTAAGGGAGGAAGGAAGCCAGGAAGACCGCTGGTGACTAGGCCCACAGGAGAAGACTGTGCAGTGGGGGTGTGAGGGAGTGAAATGAATAAGTGGAGGGAAACAAGACTGCTGGGAAGAGAACCCTGGGGCACATAAAGGAATTTAGAACCAGTGAAGCTCTTGGGAAGGCTTAAGTCTCCATCCAAGCCGGACAGGGTGGCGGAGCCAGACTGTGTAACCGTAATAGCCAAGTGATACAGTTTCTGAGTTTGGGTCTGTGATAACTAGGCTCCAGTGGCTTTAGGAAGTTACAGAATCCTCAGACATCCAAGCTGAAGAACATTTCATCTCCATCTAGCCTAGTGGCTTTCTCCTGCATTCTTCAGAGCCCGGGAGCCTATGGAGGATCAGTAGCCTTCTTATAGAGTGTGGGGGAAAGACTGAGGAGCAAAGGACTGGATTGCCCAACTCCACTTTATTCAGAGCAGCTTCAATTTTCTCCATATATTATATATTGGGCTTGTCAAATGGACAAGGTGAGAAAGTTTTGAAAATTACTGATCTTTTCCAACATTTTCATTGTTCATATGAAGAGGCCATCTCAAGGGCATATAACTCTTGGTCCAGGGTCATGACTAAAAGTGACCCAGCATGCCCCTGAGCTAGATAATGGTGGGATAAGAGTAACCCTGGGGCTAGAAGGGGATTCAGCTTAAGAGAATCTGGCAAAGGACAATTCTGAGTTCCCCAGGTCAGAGCCTAGAGACCACTCACAGCCATAGGCAGATCTTGAACACCAGTGTGTGGAGTCCTGCTCCCAGTATTGCATCCTAGAAATATGGTGGCCATAACCAGCAAAGTCCTTGGTCCCTCACCTCCAAGAACCAACTCGAGCCAGTGCAGCCTGTGCACTCAGAGCTGGTATTGCCAAAGTGACCAGGCCCATTGAGATAGAACATGTGGATAGCCCAGAGATGATCCATATTGGAGCAAGCCCAAGGTTACTGGCTACCACCCACGCTCCTACAGGCTGTGTTCTGCATCCAACAGGCCAGAAAGCAATTCCAATGGGACAGCACTCAGGCCCATACCTCATAGGCAAGTTTTTGCTCACAGGGAACCAGCACAATCTCTCCCACAAGATTGCAGTGCAGAGCTCCCTCTTACCTCTTCCAGTACCTGCTGGAAGAAATCAAAACTCCCAAGTTCTCTGCTGCTGAATCCTAATACTTCTTCCAAGACCACCTTAAGGGCATCAGAAAGAAGGGCTCCTTTCCAGCTGAAACAAGATCAGGTGGTGCATCAGCCCTAAGCCCTTTGATCTAGAACCTCATTCTCTTGGAACTGAATCAGATTCTTCTTGAAGCAGCAGAGCACAGATGGTCCACACATGGAAGAATGAATGGCTCTGGGCAGTAGGAGACCCCATAGACTACTCTGTCACCTCTGGTTCATCCATTCCACCCTTCTTGACAGCAGCATCAGAAGAAAGGCTTTCCCCAAGTCACCTCACTAGCTGGCTCTGGTGAGTGTCCCGGAAGCCCTTGCCACATGCTCCCATGTCGCTGAAAACCAGATGCCAGATGGCTTTCCGTCGTTCACCAGAGGCTCTTCTTTGCCAGGACACCCTGGGTAGCATAAACATTACTGTCCCTGCAGCAGCCAAGGCTGCTTAGCTCACACATCCTGAGACTCAGAGATGGTTGTTACAGCCCGGAAGCCATACAACCTTGGGTAGAGGCTCCTCCAACCCCAATCCCTTGGTCCTTGGACTTCACAGGACAGGAAGTTAAGGCAAATGCTTAGAGGGAATGAAAAACTGGTAGATGAAAATTCAGCGCCCCCCTCAAGCCTCCCACCCATAGGATCACTGACTCAGGACATGCTGGGAGGTATAAGGGAACTGAAATCAGGAAAATTGACACGCACTTGTTTTTGACCCTGGGCAGATCACTCCCCTCCCAGGCCTCATTTCCTCATCTGTAAAATGCTAAGATTTACTACAGTGACCTTCAGGTACTCTCTACTTGATTATTCCTGGAACTTCTGATGGAGAAGAAAAGGGTTGGCTCCTCCACTCTCCCCCTCCACCAAAACCAAGTGAAAACCTGAGCAAATCAAGAGCCCTAGGAGAGGACTGTACTTCTGAGATGCCTCCAGGCTGAGAGAGGGGTACTCAGTGAGGTGATCTACCAGGCTGGGCCTGCAAGAGTACAGCTGGCTGGGGGACCCAGACCTGGCAGGTAGACCTCTGGCTCCATCAGCTTCAACAGTGGCCCTAGCAGGGAGGTAGGATGGTAGGGGGACTGGATGCTCTGACCAGATTCAAAGCGGCATCAGTGCGGCCTGATGCGCAGAGAAGTGTCCATGTCAGGTGGACCCCAGAGGCCGTGCTGGTCTTACATCGGATCTTTGGACACCCTGTGCCTTCTGAGAGCTGCCTCCCTCCCCGAGTCCTACAGCATGTGGGACCCAAGGGGCCGTCCTGCCCAAGCAGCCTGGACCAGCCAGCTTCCTCCTTAGGGCTGGCCATCCCCCATCAGGTTGGCAGGAGCAGGAGCCATGGCTAGGGCTTACCC

XR_205537.1 Non-coding sequence

Saal1 PREDICTED: Heterocephalus glaber serum amyloid A-like 1 (Saal1), transcript variant X4, misc_RNA.

Length: 2271 bp     
>XR_205537.1
CGGCGCAGCTCGGGAGCGTTGGGAGCGCGAGGTCATGGACCGTAACCCGTCGCCGCCGACCCCGAGTCGGGAGGATGAGGATACGGAGGTGGCCGGGGGAGACTGCATCGGGAGCACGGTCTACAGCAAGCACTGGCTCTTCGGTGTCCTCAGCGGGCTCATCCAGATTGTTACACCTGAAAACACCAAATCCAACTCAGATGATGAGGAGCAGGTGATGGAGCTTGATGAAGAAATGGAGAATGAAATTTGCAAAGTATGGGATATGTCAATGGATCAGGATGTGGCTTTATTTCTCCAAGAATTTAATGCTCCTGACATATTTATGGGAGTACTGGCCAAATCTAAGTGTCCTCGATTAAGAGAAATCTGTGTGGGAATTTTAGGTAATATGGCCTGTTTCCAGGAGATATGTGTGTCCCTCAGCAATGATAAAAATCTTGGGCAAGTGTTATTGCACTGTTTATATGATTCAGATCCACCTACTCTGCTGGAGACAAGCAGGTTGTTGCTTACTTGCCTTTCCCAGACAGAAGTGGCCAGTGTCTGGGTGGAAAGGACCCGGGAATATCCAGCTATTTATGATAGCATTTGTTTCATCATGTCAAGTTCAACAAATGTTGACTTGCTGGTGAAGGTAGGGGAGGTTGTGGATAAGCTCTTTGATTTGGATGAGAAACTAATGTTGGAATGGATTAGAAATGGGGCTGCTCCACCTCTGGACCAACCTAAGGAAGATTCTGAAGAGCAGCCTGTGTTTAAGATTGTGCCCTGTGTACTTGAAGCTGCCAAACAAGTACGTTCTGAAAACCCAGAAGGGCTTGATGTTTACATGCATATCTTACAGCTGCTTACCACAGTGGATGACGGAATTCAAGCAATTGTACAGTGTCCTGATACTTGGAAAGACACTTGGAATTTACTTTTTGACCTGGTCTGCCATGAATTCTGCCAATCTGATGACCCGCCCATCATCCTCCAAGAACAGAAAACGGTGTTGGCCTCTGTGTTTTCAGTGTTGTCGGCCATGTATGCTTCACAGGCTGAACAGGAATATCTAAAAGTAGAAAAAGTAGATCTTCCTCTAATTGACAGTCTGATTCGGGTGTTAGAAAATGTGGAACATTGTCAGAAGAAGCCAGAGAACTCAACAGAGTCTAACACAGAAGAAACTCAAAAGTCTGATTTAACCCAAGAGGACTTCCACTTGAAAATTTTAAAGGATATTTCATGTGAATTTCTTTCTAATATTTTGCAGGCATTAACAAAGGAAACTGTGGCTCAGGGACTAAAGGAAGGCCAGTTAAGCAAACAGAAATGTTCCTGTGCATTTCAAAATCTCCTTCCTTTCTATAACCCTGTGGTGGAAGACTTTATTAAAATCCTGCATGAAGTGGATAAGGCCTTTGCTGATGACCTGGAGGAAAGCTTCCCGAGTTTGAAGGTTCAGACTTAACATCTGAGTTGGAATTTCTTCTGACCAAGAAGTAAACTGCTTTTGTAGAAGTTGAAATTGCCTCTGTAGGAGGGAAATGCAAAAAAGATGGGAGGCACGAATGACTTTTGGCTAGCCAATCCATGGTGTTGCCACAAGACGCAAATATGTCTTAGCCATTTTGTGAGTGTAATTTTTGTTGATTCCTTTCCAGGTTATTAGTAACCACTCAAAAGCAGTTATCACTGTTCAGTTACCCTTGTTACATTTCAGGCGTCTTCTGTGTTGTACATGTGAAGGTAGAGATGTTGACATTTTTATGAAAGGGCATTAGTGGAATTCTCTATTTTCAGCATAATTCTAATAGTTGAATTTCAGAAAATGATTTGCTTGAGCAAATTGAAATTTTTAAGATTAAGATTGAGAAGTTTAGTGACTTCTAATTGCTTACAAATTGTGCTGTACACAATTTCCCCCTTATAATGCTTCGTCATTCTTTATAATGCTTTCCAATGAAATGTAATCAGATAACCTATGAAATCAGGTGCATCTAGGAAAGCATCTAGTTGCATTATTTCAGATACTAAAAGTGAAATTTCTAATAGAGTTAAAGAAAATATCAGTTGTGAATAACAAAGCCAGCTTTGTAAACCCTTCCAAATTACTTCAGAATCTTTTTGGATTTAAAAGGCAAATGACATAAATTTGAATTTCTGGACTAAGCTCTCAGAAATTACATTTTTTGGAGTTTAAGAAGGAGACGTGTTCCCTTGCTTTTTTTAAATTTTTGGTACCGGGGATCGAACTCAGGATCTTGCGCTTCTGAGGCAGGCGCA

XR_205541.1 Non-coding sequence

LOC101723009 PREDICTED: Heterocephalus glaber uncharacterized LOC101723009 (LOC101723009), misc_RNA.

Length: 564 bp     
>XR_205541.1
AGGCAGCCTTCACTCCGATCGTTTCTGCCCAACATCCTGGTCACTACAGGAGATGCATTTTGACAATGCCAGCACTTTTTGGAATGCGCCCCCTGAGCCTGGGGCTGATCATCTTGTCTTCCCGCTCAGGACTCTGGGAGGTGGTCAGCTCTTCTTTGCTGGCAGTGTCTCTTGCCTTATTGTGGGCAGCTGTGGAAGAGGCACCCAGACAAAAAAACCCCGAGAGATGTTGGGGCAGGGGCTGCACGGGGCAGAAGAAGGTGGTGGGATCCACCTGCAGCTCTGGCTAGCTTGAAATTGGTTCCTCTCACCATTTGTTTACCAGTCTCTGCACAGAGAGAACAAGAGAAATGGAGACTGAAATGAAGCCAAGCCGCTCCCTGATGGCCTGGTGTTGCCACCTAAATGAGGACTTGAAGTTCCTAGAGGCTGGGCAGCAGACCAAAGCCCTCACTTACAGCACCCCCAAGGACAGTGTGCCTCCATGTCCATGGGCTCCACCTTTGAGGATTCAATCAACTGCAGATGGAAAATATTTGGAAAAAAAATGAGTTGCATCTACAA

XR_205543.1 Non-coding sequence

Lin7c PREDICTED: Heterocephalus glaber lin-7 homolog C (C. elegans) (Lin7c), transcript variant X4, misc_RNA.

Length: 784 bp     
>XR_205543.1
GCCGCGGCCGCTCTGTCGTCATTTCCGGTGTGCCTCTGTCGCGGAAGGAGAAGATGGCGGCGCTGGGAGAACCTGTACGGCTGGAGAGGGATATCTGCAGAGCGATCGAGCTGCTGGAGAAGCTGCAGCGGAGTGGGGAGGTGCCACCACAGAAGCTGCAGGCGCTGCAGAGAGTCCTCCAGAGCGAGTTCTGCACGGCCGTGCGGGAGGTGTACGAGCACGTCTATGAGACAGTGGACATCAGCAGCAGTCCTGAAGTGAGGGCCAATGCAACCGCAAAGGCCACTGTGGCTGCGTTTGCAGCCAGCGAGGGACATTCTCATCCCCGCGTGGTGGAGCTGCCGAAGACGGAAGAGGGCCTCGGCTTCAATATCATGGGGGGCAAGGAGCAGAACTCTCCCATCTACATATCTCGGATAATTCCCGGCGGGATTGCAGACAGACACGGGGGCCTCAAGCGCGGAGACCAGCTCCTTTCTGTGAATGGAGTGAGCGTGGAGGGTGAGCACCATGAGAAGGCCGTGGAGCTGCTGAAGGCCGCGCAGGGCAAGGTGAAGCTGGTGGTGCGCTACACGCCCAAGGTGCTGGAGGAGATGGAGTCACGCTTCGAGAAGATGCGCTCGGCCAAGCGCAGGCAGCAGACCTAGCACGGCCGCCTGCAGACGCCTGTCTTCACATCAGTGCGGTTCCTGGGATGCACACACTGTTCGCTGACACGAAAAGTCAGAGATCTTCTCGCACTCGGCTCCTTCAAGCCCAAACAGGAGCCGGTTAGTTTGTGGTG

XR_205544.1 Non-coding sequence

LOC101706264 PREDICTED: Heterocephalus glaber uncharacterized LOC101706264 (LOC101706264), misc_RNA.

Length: 558 bp     
>XR_205544.1
ATATCCTGTGAGCACCTGGATTGTTAAAATCTGTGTGCCGATGAAAGAAGTGACCCCTGCCACCCTGTGCTGCAGATGGGCTTTGTTGGTGCCAGGACAGAGCTGAGAAGTGCCCCTTTGCCTTCCTGCCCTGACAGATGTGGAAGGGTGCTCATCACAGGATTCTTGACTCTTTCCCAGCCCCTATTAGGAATGGAGGAATCCTTCCAGAAACACCAGGGTATGTAACTGTCGGTGCAGGAAGGACTCCAAGTTTCCACCCAGACCCCGTCTGTGACTTGGTGTCCATCTCTTGAAGAACACCCTTTTGTACCATCCAAAGGATTATAACAGGACAACAAATTCTTAGTTAATCCCTATCGTCTGACCTGGGCAAAATATGTGTTTTGGATAGTGACTGAGGATGGAAAAGCATAGACACTGAGCTGAAAAAGAAAAACAACCCACTGCTGTTTTATTTCTCTCTCACCTTGTCTTCATGATGCATGGTGGTGTAATCAAAGTTGGCTGTATTTGTTTCTTTTTAAGTACTGTACTTGAGTAAAAGCACCAATAAAT

XR_205547.1 Non-coding sequence

Immp1l PREDICTED: Heterocephalus glaber IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp1l), transcript variant X5, misc_RNA.

Length: 2427 bp     
>XR_205547.1
CAATCGCAAGAAGTATTATTGAAAGGTGCGCACTACGTAAGGACGAAAGTCTTTTGCAGGGCGCAGGTGAGAGCCGCCCCTGGAGTCTGGGCTGAGCTGGGCCTTCCGGGGTCCTTTCGGGCTGGAGGGTCCTGAAGCCATGGATGACCCATGTGTGCTTTAGATTTTTTTCTGGAAGCCCTGAAGGCACCCTTGAAAATTGAGTGTGTTGTGGAACAGACCTATGGTGAAGCGACTTCCAGTCATTTGGAAAGGATGGGATGAAAAGGAACCTTGGTGATAATTTTGATGTCTGCAAGATTTAGTACCAGTGTAATGGGATTATCGGTAACACCTTCACTGCAGAAAAAGCCACCTGGCGCTATAACTGGCAGCAACTGAGAACTAATCCTTTCCCATCTCTTGGATGTCATTCATGAAGCTCAAAGCAATTTCTACCCTGCTAACTGTGATTAATTCTATAAACAACAACAAAAAAATCAGACTGAGACCCTCTCGGACCCTGCGTGTCGTGCAGCTGGCCGCAGGGACAGCGGGCCAGGGCCACTCAGTGCCGCTCCTCCGTTGGCACTGTCGCTGTTGCCTGCCCCGCTGCTGTTCCTCTCATGCACACGGATCACAGAGCCGTTGAAGGTGGATGCCCTTGGTTTGGTGGTAGCAGCGTCTTCACAAAACGATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAACGTATGAAGCCTGCGGTGACAGTGAGCACTGCGAGTGTGGACCCAGTCTGCCCTCGGCGATGACCCGCAAGACTTCAGGCAGTGGGACGCTGTGTCTGGGCCCCTGGGGGCCCGGCTGCGGTGCTGCGCACACCTCGTGTGGCCAGTGTGGAGCCGACGCGGGCTGCGCTGTGGTGCACCGAGCTAGGCACAGGGAGCTACGTCGGCCAAGCACAGCTGCTTTTCCCAGCCCGGGCAGACACGGATCTTCCCGCCTGGAGGACAGTCCTGGGCAGAGGCTGGAGAGGGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGGTACAGTTTTCTGATGAACCGTCAGCTGTACTGTCAGCTGCAGAAATAACTATGCCATCTTCAGGCCCATGGGACTTCTGGTTGCAGTACCTACACTTCATGAACACACCAGCCTTCACTTGACAGCTCACCACCAAACCTTACTGCTGTCTTCCACGCTCAGAGGCAGGTGACTGAGCAGGGATTTTTATAATAAAACTCAGATTCCTTAGTTCTCCAAACCTTCATTCTCTCTCACACTGTCTGTCACCTGTCAGCACCAAGCTGGAAAGACGTGCATGAGCACCCGCAGCAGAGCAGCCTGGGCCATGCAGCCAAGTGTGCAGCGCTAGGGAAGGCAGCTGCCTTCGCTGCCCCGCCCAGTGACAGGAAGGACAGTTTGAAGCCAGTTGCAGCAGTGGGATAATCTAGGGTCCTGTATACGTCGATGTTACCCTTAGATATCTTGGGTCAAAGGTGCAGTTACCTTCCTTGCGGACACACAGATTCATACGTTTATGTCCACACCACACACACACACACACACACACACGTTCTTGTATGTGTAAATACATAAATGTTTTGTAAAGTGTCACTCTGCACCCGAAACTTACTCATGGGGTATGAGCAAGGAGGAAGTGTTATCAATCCCAGAGAAAGGAGGAGGAGGAGGACAGGGGAATGTGGTGAGGGTACAGCATCACCTTCATTAACCATCTCCACCTCCTGTGGATTTTACAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGACAAGCATTTATTCCTCTGACCTGATGAGTCTCCTGGTCCAGTGAATTTATGACCACAGTGGAAACCATCCAGCCGTGGAAGCCCGTCACTGCTGTCCAGGCCGCCAGGCAGGGCTCCTCCCGCTGAGTCTGAGAAGACTGTCACCACCACAGAGAGCCTGGTCATACAGAACCTCGAGGTTCCCAATTACGCAACTGCAAACAAGAATTTCTACTCCACGATTCCATCTGAGCGGATGAGGGCAGAACAACCCTATAAGGAAAGCACAATGTGCCTTCCAAGTGGCTTATAACTCACTTTTTTAAAGCACTAAACTAAGAATTTACCATTAATAAAGTAAAGGGTTTCAAGGATGGCTCTGTTTATCT

XR_205546.1 Non-coding sequence

Immp1l PREDICTED: Heterocephalus glaber IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp1l), transcript variant X4, misc_RNA.

Length: 2449 bp     
>XR_205546.1
ATCGCAAGAAGTATTATTGAAAGGTGCGCACTACGTAAGGACGAAAGTCTTTTGCAGGGCGCAGGTGAGAGCCGCCCCTGGAGTCTGGGCTGAGCTGGGCCTTCCGGGGTCCTTTCGGGCTGGAGGGTCCTGAAGCCATGGATGACCCATGTGTGCTTTAGATTTTTTTCTGGAAGCCCTGAAGGCACCCTTGAAAATTGAGTGTGTTGTGGAACAGACCTATGGTGAAGCGACTTCCAGTCATTTGGAAAGGATGGGATGAAAAGGAACCTTGGTGATAATTTTGATGTCTGCAAGATTTAGTACCAGTGTAATGGGATTATCGGTAACACCTTCACTGCAGAAAAAGCCACCTGGCGCTATAACTGGCAGCAACTGAGAACTAATCCTTTCCCATCTCTTGGATGTCATTCATGAAGCTCAAAGCAATTTCTACCCTGCTAACTGTGATTAATTCTATAAACAACAACAAAAAAATCAGACTGAGACCCTCTCGGACCCTGCGTGTCGTGCAGCTGGCCGCAGGGACAGCGGGCCAGGGCCACTCAGTGCCGCTCCTCCGTTGGCACTGTCGCTGTTGCCTGCCCCGCTGCTGTTCCTCTCATGCACACGGATCACAGAGCCGTTGAAGTACTACTGATCATGACGCTTTTTGGGATTTACCATCCGGCCAGTGGTAGCAGCGTCTTCACAAAACGATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAACGTATGAAGCCTGCGGTGACAGTGAGCACTGCGAGTGTGGACCCAGTCTGCCCTCGGCGATGACCCGCAAGACTTCAGGCAGTGGGACGCTGTGTCTGGGCCCCTGGGGGCCCGGCTGCGGTGCTGCGCACACCTCGTGTGGCCAGTGTGGAGCCGACGCGGGCTGCGCTGTGGTGCACCGAGCTAGGCACAGGGAGCTACGTCGGCCAAGCACAGCTGCTTTTCCCAGCCCGGGCAGACACGGATCTTCCCGCCTGGAGGACAGTCCTGGGCAGAGGCTGGAGAGGGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGGTACAGTTTTCTGATGAACCGTCAGCTGTACTGTCAGCTGCAGAAATAACTATGCCATCTTCAGGCCCATGGGACTTCTGGTTGCAGTACCTACACTTCATGAACACACCAGCCTTCACTTGACAGCTCACCACCAAACCTTACTGCTGTCTTCCACGCTCAGAGGCAGGTGACTGAGCAGGGATTTTTATAATAAAACTCAGATTCCTTAGTTCTCCAAACCTTCATTCTCTCTCACACTGTCTGTCACCTGTCAGCACCAAGCTGGAAAGACGTGCATGAGCACCCGCAGCAGAGCAGCCTGGGCCATGCAGCCAAGTGTGCAGCGCTAGGGAAGGCAGCTGCCTTCGCTGCCCCGCCCAGTGACAGGAAGGACAGTTTGAAGCCAGTTGCAGCAGTGGGATAATCTAGGGTCCTGTATACGTCGATGTTACCCTTAGATATCTTGGGTCAAAGGTGCAGTTACCTTCCTTGCGGACACACAGATTCATACGTTTATGTCCACACCACACACACACACACACACACACACGTTCTTGTATGTGTAAATACATAAATGTTTTGTAAAGTGTCACTCTGCACCCGAAACTTACTCATGGGGTATGAGCAAGGAGGAAGTGTTATCAATCCCAGAGAAAGGAGGAGGAGGAGGACAGGGGAATGTGGTGAGGGTACAGCATCACCTTCATTAACCATCTCCACCTCCTGTGGATTTTACAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGACAAGCATTTATTCCTCTGACCTGATGAGTCTCCTGGTCCAGTGAATTTATGACCACAGTGGAAACCATCCAGCCGTGGAAGCCCGTCACTGCTGTCCAGGCCGCCAGGCAGGGCTCCTCCCGCTGAGTCTGAGAAGACTGTCACCACCACAGAGAGCCTGGTCATACAGAACCTCGAGGTTCCCAATTACGCAACTGCAAACAAGAATTTCTACTCCACGATTCCATCTGAGCGGATGAGGGCAGAACAACCCTATAAGGAAAGCACAATGTGCCTTCCAAGTGGCTTATAACTCACTTTTTTAAAGCACTAAACTAAGAATTTACCATTAATAAAGTAAAGGGTTTCAAGGATGGCTCTGTTTATCT

XR_205545.1 Non-coding sequence

Immp1l PREDICTED: Heterocephalus glaber IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp1l), transcript variant X3, misc_RNA.

Length: 2468 bp     
>XR_205545.1
ATCGCAAGAAGTATTATTGAAAGGTGCGCACTACGTAAGGACGAAAGTCTTTTGCAGGGCGCAGGTGAGAGCCGCCCCTGGAGTCTGGGCTGAGCTGGGCCTTCCGGGGTCCTTTCGGGCTGGAGGGTCCTGAAGCCATGGATGACCCATGTGTGCTTTAGATTTTTTTCTGGAAGCCCTGAAGGCACCCTTGAAAATTGAGTGTGTTGTGGAACAGACCTATGGTGAAGCGACTTCCAGTCATTTGGAAAGGATGGGATGAAAAGGAACCTTGGTGATAATTTTGATGTCTGCAAGATTTAGTACCAGTGTAATGGGATTATCGGTAACACCTTCACTGCAGAAAAAGCCACCTGGCGCTATAACTGGCAGCAACTGAGAACTAATCCTTTCCCATCTCTTGGATGTCATTCATGAAGCTCAAAGCAATTTCTACCCTGCTAACTGTGATTAATTCTATAAACAACAACAAAAAAATCAGACTGAGACCCTCTCGGACCCTGCGTGTCGTGCAGCTGGCCGCAGGGACAGCGGGCCAGGGCCACTCAGTGCCGCTCCTCCGTTGGCACTGTCGCTGTTGCCTGCCCCGCTGCTGTTCCTCTCATGCACACGGATCACAGAGCCGTTGAAGGTGGATGCCCTTGGTTTGGTACTACTGATCATGACGCTTTTTGGGATTTACCATCCGGCCAGTGGTAGCAGCGTCTTCACAAAACGATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAACGTATGAAGCCTGCGGTGACAGTGAGCACTGCGAGTGTGGACCCAGTCTGCCCTCGGCGATGACCCGCAAGACTTCAGGCAGTGGGACGCTGTGTCTGGGCCCCTGGGGGCCCGGCTGCGGTGCTGCGCACACCTCGTGTGGCCAGTGTGGAGCCGACGCGGGCTGCGCTGTGGTGCACCGAGCTAGGCACAGGGAGCTACGTCGGCCAAGCACAGCTGCTTTTCCCAGCCCGGGCAGACACGGATCTTCCCGCCTGGAGGACAGTCCTGGGCAGAGGCTGGAGAGGGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGGTACAGTTTTCTGATGAACCGTCAGCTGTACTGTCAGCTGCAGAAATAACTATGCCATCTTCAGGCCCATGGGACTTCTGGTTGCAGTACCTACACTTCATGAACACACCAGCCTTCACTTGACAGCTCACCACCAAACCTTACTGCTGTCTTCCACGCTCAGAGGCAGGTGACTGAGCAGGGATTTTTATAATAAAACTCAGATTCCTTAGTTCTCCAAACCTTCATTCTCTCTCACACTGTCTGTCACCTGTCAGCACCAAGCTGGAAAGACGTGCATGAGCACCCGCAGCAGAGCAGCCTGGGCCATGCAGCCAAGTGTGCAGCGCTAGGGAAGGCAGCTGCCTTCGCTGCCCCGCCCAGTGACAGGAAGGACAGTTTGAAGCCAGTTGCAGCAGTGGGATAATCTAGGGTCCTGTATACGTCGATGTTACCCTTAGATATCTTGGGTCAAAGGTGCAGTTACCTTCCTTGCGGACACACAGATTCATACGTTTATGTCCACACCACACACACACACACACACACACACGTTCTTGTATGTGTAAATACATAAATGTTTTGTAAAGTGTCACTCTGCACCCGAAACTTACTCATGGGGTATGAGCAAGGAGGAAGTGTTATCAATCCCAGAGAAAGGAGGAGGAGGAGGACAGGGGAATGTGGTGAGGGTACAGCATCACCTTCATTAACCATCTCCACCTCCTGTGGATTTTACAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGACAAGCATTTATTCCTCTGACCTGATGAGTCTCCTGGTCCAGTGAATTTATGACCACAGTGGAAACCATCCAGCCGTGGAAGCCCGTCACTGCTGTCCAGGCCGCCAGGCAGGGCTCCTCCCGCTGAGTCTGAGAAGACTGTCACCACCACAGAGAGCCTGGTCATACAGAACCTCGAGGTTCCCAATTACGCAACTGCAAACAAGAATTTCTACTCCACGATTCCATCTGAGCGGATGAGGGCAGAACAACCCTATAAGGAAAGCACAATGTGCCTTCCAAGTGGCTTATAACTCACTTTTTTAAAGCACTAAACTAAGAATTTACCATTAATAAAGTAAAGGGTTTCAAGGATGGCTCTGTTTATCT

XR_205550.1 Non-coding sequence

Immp1l PREDICTED: Heterocephalus glaber IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp1l), transcript variant X8, misc_RNA.

Length: 1996 bp     
>XR_205550.1
GCAAGAAGTATTATTGAAAGGTGCGCACTACGTAAGGACGAAAGTCTTTTGCAGGGCGCAGGTGAGAGCCGCCCCTGGAGTCTGGGCTGAGCTGGGCCTTCCGGGGTCCTTTCGGGCTGGAGGGTCCTGAAGCCATGGATGACCCATGTGTGCTTTAGATTTTTTTCTGGAAGCCCTGAAGGCACCCTTGAAAATTGAGTGTGTTGTGGAACAGACCTATGTGGTAGCAGCGTCTTCACAAAACGATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAACGTATGAAGCCTGCGGTGACAGTGAGCACTGCGAGTGTGGACCCAGTCTGCCCTCGGCGATGACCCGCAAGACTTCAGGCAGTGGGACGCTGTGTCTGGGCCCCTGGGGGCCCGGCTGCGGTGCTGCGCACACCTCGTGTGGCCAGTGTGGAGCCGACGCGGGCTGCGCTGTGGTGCACCGAGCTAGGCACAGGGAGCTACGTCGGCCAAGCACAGCTGCTTTTCCCAGCCCGGGCAGACACGGATCTTCCCGCCTGGAGGACAGTCCTGGGCAGAGGCTGGAGAGGGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGGTACAGTTTTCTGATGAACCGTCAGCTGTACTGTCAGCTGCAGAAATAACTATGCCATCTTCAGGCCCATGGGACTTCTGGTTGCAGTACCTACACTTCATGAACACACCAGCCTTCACTTGACAGCTCACCACCAAACCTTACTGCTGTCTTCCACGCTCAGAGGCAGGTGACTGAGCAGGGATTTTTATAATAAAACTCAGATTCCTTAGTTCTCCAAACCTTCATTCTCTCTCACACTGTCTGTCACCTGTCAGCACCAAGCTGGAAAGACGTGCATGAGCACCCGCAGCAGAGCAGCCTGGGCCATGCAGCCAAGTGTGCAGCGCTAGGGAAGGCAGCTGCCTTCGCTGCCCCGCCCAGTGACAGGAAGGACAGTTTGAAGCCAGTTGCAGCAGTGGGATAATCTAGGGTCCTGTATACGTCGATGTTACCCTTAGATATCTTGGGTCAAAGGTGCAGTTACCTTCCTTGCGGACACACAGATTCATACGTTTATGTCCACACCACACACACACACACACACACACACGTTCTTGTATGTGTAAATACATAAATGTTTTGTAAAGTGTCACTCTGCACCCGAAACTTACTCATGGGGTATGAGCAAGGAGGAAGTGTTATCAATCCCAGAGAAAGGAGGAGGAGGAGGACAGGGGAATGTGGTGAGGGTACAGCATCACCTTCATTAACCATCTCCACCTCCTGTGGATTTTACAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGACAAGCATTTATTCCTCTGACCTGATGAGTCTCCTGGTCCAGTGAATTTATGACCACAGTGGAAACCATCCAGCCGTGGAAGCCCGTCACTGCTGTCCAGGCCGCCAGGCAGGGCTCCTCCCGCTGAGTCTGAGAAGACTGTCACCACCACAGAGAGCCTGGTCATACAGAACCTCGAGGTTCCCAATTACGCAACTGCAAACAAGAATTTCTACTCCACGATTCCATCTGAGCGGATGAGGGCAGAACAACCCTATAAGGAAAGCACAATGTGCCTTCCAAGTGGCTTATAACTCACTTTTTTAAAGCACTAAACTAAGAATTTACCATTAATAAAGTAAAGGGTTTCAAGGATGGCTCTGTTTATCT

XR_205548.1 Non-coding sequence

Immp1l PREDICTED: Heterocephalus glaber IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp1l), transcript variant X6, misc_RNA.

Length: 2039 bp     
>XR_205548.1
GCAAGAAGTATTATTGAAAGGTGCGCACTACGTAAGGACGAAAGTCTTTTGCAGGGCGCAGGTGAGAGCCGCCCCTGGAGTCTGGGCTGAGCTGGGCCTTCCGGGGTCCTTTCGGGCTGGAGGGTCCTGAAGCCATGGATGACCCATGTGTGCTTTAGATTTTTTTCTGGAAGCCCTGAAGGCACCCTTGAAAATTGAGTGTGTTGTGGAACAGACCTATGTACTACTGATCATGACGCTTTTTGGGATTTACCATCCGGCCAGTGGTAGCAGCGTCTTCACAAAACGATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAACGTATGAAGCCTGCGGTGACAGTGAGCACTGCGAGTGTGGACCCAGTCTGCCCTCGGCGATGACCCGCAAGACTTCAGGCAGTGGGACGCTGTGTCTGGGCCCCTGGGGGCCCGGCTGCGGTGCTGCGCACACCTCGTGTGGCCAGTGTGGAGCCGACGCGGGCTGCGCTGTGGTGCACCGAGCTAGGCACAGGGAGCTACGTCGGCCAAGCACAGCTGCTTTTCCCAGCCCGGGCAGACACGGATCTTCCCGCCTGGAGGACAGTCCTGGGCAGAGGCTGGAGAGGGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGGTACAGTTTTCTGATGAACCGTCAGCTGTACTGTCAGCTGCAGAAATAACTATGCCATCTTCAGGCCCATGGGACTTCTGGTTGCAGTACCTACACTTCATGAACACACCAGCCTTCACTTGACAGCTCACCACCAAACCTTACTGCTGTCTTCCACGCTCAGAGGCAGGTGACTGAGCAGGGATTTTTATAATAAAACTCAGATTCCTTAGTTCTCCAAACCTTCATTCTCTCTCACACTGTCTGTCACCTGTCAGCACCAAGCTGGAAAGACGTGCATGAGCACCCGCAGCAGAGCAGCCTGGGCCATGCAGCCAAGTGTGCAGCGCTAGGGAAGGCAGCTGCCTTCGCTGCCCCGCCCAGTGACAGGAAGGACAGTTTGAAGCCAGTTGCAGCAGTGGGATAATCTAGGGTCCTGTATACGTCGATGTTACCCTTAGATATCTTGGGTCAAAGGTGCAGTTACCTTCCTTGCGGACACACAGATTCATACGTTTATGTCCACACCACACACACACACACACACACACACGTTCTTGTATGTGTAAATACATAAATGTTTTGTAAAGTGTCACTCTGCACCCGAAACTTACTCATGGGGTATGAGCAAGGAGGAAGTGTTATCAATCCCAGAGAAAGGAGGAGGAGGAGGACAGGGGAATGTGGTGAGGGTACAGCATCACCTTCATTAACCATCTCCACCTCCTGTGGATTTTACAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGACAAGCATTTATTCCTCTGACCTGATGAGTCTCCTGGTCCAGTGAATTTATGACCACAGTGGAAACCATCCAGCCGTGGAAGCCCGTCACTGCTGTCCAGGCCGCCAGGCAGGGCTCCTCCCGCTGAGTCTGAGAAGACTGTCACCACCACAGAGAGCCTGGTCATACAGAACCTCGAGGTTCCCAATTACGCAACTGCAAACAAGAATTTCTACTCCACGATTCCATCTGAGCGGATGAGGGCAGAACAACCCTATAAGGAAAGCACAATGTGCCTTCCAAGTGGCTTATAACTCACTTTTTTAAAGCACTAAACTAAGAATTTACCATTAATAAAGTAAAGGGTTTCAAGGATGGCTCTGTTTATCT

XR_205551.1 Non-coding sequence

Immp1l PREDICTED: Heterocephalus glaber IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp1l), transcript variant X9, misc_RNA.

Length: 2303 bp     
>XR_205551.1
GCAAGAAGTATTATTGAAAGGTGCGCACTACGTAAGGACGAAAGTCTTTTGCAGGGCGCAGGTGAGAGCCGCCCCTGGAGTCTGGGCTGAGCTGGGCCTTCCGGGGTCCTTTCGGGCTGGAGGGTCCTGAAGCCATGGATGACCCATGTGTGCTTTAGATTTTTTTCTGGAAGCCCTGAAGGCACCCTTGAAAATTGAGTGTGTTGTGGAACAGACCTATGGTGAAGCGACTTCCAGTCATTTGGAAAGGATGGGATGAAAAGGAACCTTGGTGATAATTTTGATGTCTGCAAGATTTAGTACCAGTGTAATGGGATTATCGGTAACACCTTCACTGCAGAAAAAGCCACCTGGCGCTATAACTGGCAGCAACTGAGAACTAATCCTTTCCCATCTCTTGGATGTCATTCATGAAGCTCAAAGCAATTTCTACCCTGCTAACTGTGATTAATTCTATAAACAACAACAAAAAAATCAGACTGAGACCCTCTCGGACCCTGCGTGTCGTGCAGCTGGCCGCAGGGACAGCGGGCCAGGGCCACTCAGTGCCGCTCCTCCGTTGGCACTGTCGCTGTTGCCTGCCCCGCTGCTGTTCCTCTCATGCACACGGATCACAGAGCCGTTGAAGGTGGATGCCCTTGGTTTGGTACTACTGATCATGACGCTTTTTGGGATTTACCATCCGGCCAGTGGTAGCAGCGTCTTCACAAAACGATGCTTCGAGGAGCTCTGGGGAAGACCTTTCGGCTTGCTGGCTACACCATTCAGTACGGCTGCATAGCGCATTGCGCTTTTGAGTACGTCGGTGGGGTTGTGATGTGTTCCGGACCATCAATGGAGCCTACCATTCAAAACTCAGATATTGTCTTTGCAGAAAATCTCAGCCGACATTTTCATGGCATCCAAAGAGGTGACATTGTGATTGCAAAAAGCCCGAGCGATCCAAAGTCAAATATTTGTAAGAGAGTAATTGGTTTGGAAGGAGACAAAGTCCTCACCACTAGCCCATCAGATTTCTTTAAAAGCCATAGTTATGTGCCCACGGGCCATGTCTGGTTAGAAGGTGACAATCTACAGAACTCCACAGATTCCAGGTTCTATGGCCCCATCCCGTATGGACTCATAAGAGGACGCATCTTCTTTAAGGTACAGTTTTCTGATGAACCGTCAGCTGTACTGTCAGCTGCAGAAATAACTATGCCATCTTCAGGCCCATGGGACTTCTGGTTGCAGTACCTACACTTCATGAACACACCAGCCTTCACTTGACAGCTCACCACCAAACCTTACTGCTGTCTTCCACGCTCAGAGGCAGGTGACTGAGCAGGGATTTTTATAATAAAACTCAGATTCCTTAGTTCTCCAAACCTTCATTCTCTCTCACACTGTCTGTCACCTGTCAGCACCAAGCTGGAAAGACGTGCATGAGCACCCGCAGCAGAGCAGCCTGGGCCATGCAGCCAAGTGTGCAGCGCTAGGGAAGGCAGCTGCCTTCGCTGCCCCGCCCAGTGACAGGAAGGACAGTTTGAAGCCAGTTGCAGCAGTGGGATAATCTAGGGTCCTGTATACGTCGATGTTACCCTTAGATATCTTGGGTCAAAGGTGCAGTTACCTTCCTTGCGGACACACAGATTCATACGTTTATGTCCACACCACACACACACACACACACACACACGTTCTTGTATGTGTAAATACATAAATGTTTTGTAAAGTGTCACTCTGCACCCGAAACTTACTCATGGGGTATGAGCAAGGAGGAAGTGTTATCAATCCCAGAGAAAGGAGGAGGAGGAGGACAGGGGAATGTGGTGAGGGTACAGCATCACCTTCATTAACCATCTCCACCTCCTGTGGATTTTACAGATCTGGCCTCTGAGTGACTTTGGATTTCTACGTGACAGCCCCAATGGCCACCGGTTTTCTGACAACTGACAAGCATTTATTCCTCTGACCTGATGAGTCTCCTGGTCCAGTGAATTTATGACCACAGTGGAAACCATCCAGCCGTGGAAGCCCGTCACTGCTGTCCAGGCCGCCAGGCAGGGCTCCTCCCGCTGAGTCTGAGAAGACTGTCACCACCACAGAGAGCCTGGTCATACAGAACCTCGAGGTTCCCAATTACGCAACTGCAAACAAGAATTTCTACTCCACGATTCCATCTGAGCGGATGAGGGCAGAACAACCCTATAAGGAAAGCACAATGTGCCTTCCAAGTGGCTTATAACTCACTTTTTTAAAGCACTAAACTAAGAATTTACCATTAATAAAGTAAAGGGTTTCAAGGATGGCTCTGTTTATCT

XR_205552.1 Non-coding sequence

Dusp8 PREDICTED: Heterocephalus glaber dual specificity phosphatase 8 (Dusp8), transcript variant X2, misc_RNA.

Length: 3708 bp     
>XR_205552.1
CGGCGCAGGTCCCGGGTGCGCGCCCGCGGCGAGCGGCGGCCAGGTCGGGCACCATGCGCTAGGTGCTGCCAGCACCGCAAGGCCACACCCTCCTCACCGCGAGGTCACTGCCTGCTGCCCACCGCCCCACCATGGCCGGGGACCGGCTCCCGAGGAAGGTGATGGACGCCAGGAAGCTGGCCAGCCTGCTGCGGGGCGGGCCTGGGGGGCCCCTGGTCATCGACAGCCGCTCCTTTGTGGAGTACAACAGCTGGCACGTGCTCAGCTCCGTCAACATCTGCTGTTCCAAGCTGGTGAAGCGGCGGCTGCAGCAGGGCAAGGTGACCATTGCCGAGCTCATCCAGCCTGCCACTCGCAGCCAGGTGGAGGCTGCAGAACCACAGGACGTAGTGGTGTATGACCAGAGCACCCGGGATGCCAGTGTGCTGGCCGCAGACAGCTTCCTGTCCATCCTGCTCAGCAAGCTGGACGGCTGCTTCGACAGCGTGGCCATCCTCACGGGGGGCTTCGCCACCTTCTCCTCCTGCTTCCCTAGCCTCTGCGAGGGCAAACCTGCCACCCTGCCACCCATGAGCCTCTCCCAGCCCTGCCTGCCTGTGCCCAGCGTGGGCCTGACCCGCATACTGCCTCACCTCTACCTGGGCTCCCAGAAGGATGTCCTCAACAAGGATCTGATGACCCAAAATGGAATAAGCTACGTCCTCAACGCCAGCAATTCCTGCCCCAAGCCGGACTTCATCTGCGAGAGCCGCTTCATGCGCATTCCCATCAACGACAACTACTGTGAAAAACTGCTGCCCTGGCTGGACAAGTCCGTGGAGTTCATCGATAAAGCCAAGCTGTCCAGCTGCCAGGTCATCGTCCACTGTCTGGCCGGCATCTCCCGCTCTGCAACCATTGCCATAGCCTACATCATGAAGACCATGGGCATGTCCTCCGACGACGCCTACAGGTTTGTGAAGGACCGGCGGCCGTCCATCTCGCCCAATTTCAACTTCCTGGGCCAGCTGCTGGAGTACGAGCGGAGCCTGCAACTGCTGGCCGCCCTGCAGGGCGACACCCCCCACCCGGGGACCCCCGAGCCCCTCCCGGGCCCCGCAGCAGGGGTCCTGCTGCCAAGGCTGCCACCACCACCTACCTCAGAGAGTGCTGCCACCGGGGGCGCGGCAGCCACCGCAGCCAGGGAGAGTGGCACCTGGGAGGCCCCGGCCGCCACCCCGGCCACTAGCGCACTGCAGCAGGGCCTGCGCGGCCTGCACCTGTCCTCCGACCGCCTGCAGGACACCAACCGCCTCAAGCGCTCCTTCTCCCTGGACATCAAGTCGGCCTACGCCCCGAGCCAGCGGCCTGAGCGTCCGGGGCCGCCTGCCCCCGGGGAGGCAGCCAAGCTGTGCAAGTTGCACAGCCCCTCAGGGGTCCTGCTGGGCCTCCCCTCACCGGCCTCTGACAGCCCAGACTCCACTGCAGAGACGCGCCCTCGGCCCCGTCGGCGGCACCGGCCGCCCGCCAGCTCCCCAGCCCGCTCCCCGGGGGCACACGGCCTCGGCCTGAACTTCGGCGATACGGGGCGCCAGACTCCAAGGCACGGACTCTCTGCCCTGTCTGCACCCGCACTGCCCGGCCCGGGTCAGCCCGCCAGCCCGGGGGCCTGGGCGCCGCCGCTCGACTCCCCGGGGACACCCTCCCCCGACGCACCCTGGTGCTTCAGCCCCGAGGGTGCACAGGGGGCCTTCAGCCTGGCAGGCGCGCCCGGGCCCGGCGGCAGGGGCGACGGCTGGCCCGAGGAGCCCGCCCCAGACTCGCAGTTCAAGAGGCGCAGCTGCCAGATGGAGTTCGAGGAGGGCATGGCCGAGGGCCACGCGCGTGGCGAGGAGCTGACAGCCCTGGGCAAGCAGGCCAGCTTCTCGGGCAGCGTGGAGGTCATCCAGGTCTCCTGACCGCGGCGCAGGCCCACCATAGACCTAGACTGCATAGGCTGCAGAGGAAGGGAAACGACTCTACTGCGATTTTTACCGAGAACAATAGGAGGCTGACATCCGTCCCTGTCACGAGCGGCGGGCCAGGCCTGGGACCTCCCTGCGCCCTCCTCCCCCCGAAACACTGCTGATGTTGCAAAGAGGCTGCCCGGCTTTCGTGCACTTTTTACGTAAGAAAAAGGGGAAAAAGCAAAAAAAAAAAAATCTTCTTTGCCGCAAACTGAGCCGCAGAAGCTCCTCCCCCGCCCGCCTGGCCTCCTTCCCTCCCCGGGCTCTGCACCAAAGCCGTAGGTGGGGAGGGGGGCTGCAGGAGCAGGGCCCTGCCAGCTCCGGGGCCAGCTCTCAGTGGCATGGGGACCCTGCTGCCTGTCGGCAGGGCTGCCCCTGCCCGGTGTCGGCCAGCACTGGCTCCTGAGTCAGAGGAGGTGGACCCCCAGGGCAAGGATGGACAGAAGCGACCCTCCCCCTCGGGCCCAGGTCCAGAGAGGCCCTGCAGAGGCAGCCGCTCCCCTCTTCTCTCCTTTAGGGGTCTCCCCAGGGCAGCCTGCAGGGACAGAGCCTGGCCTGGGGGCTGCCCCGATCAGACAGGAGCCCTGGCCCAGATCCAATCCTGAGGCCTGTGCCGAGCTGCTGTATTCAGGGCTGGGGTCCATGGCTCTGGGAAAGCCCCCACGGGAGCAGGCCCTGGAGAAGTCCCCCTTGTCTGCCTGGCCCCGGGGGACCTCTCAGGAGAGAACCCCCTGTGCACCCCGTTCCTTTCCTGGCACTCTCCCCACATCTTGGGGCGAGGTCCAGACCCCACCCTCCAGAGGCTTTTTGGCCAGGAGGGTCAGCCTGGAGGTGGGGCAGGAGGAAGCCCAGCCACCACACCCCACAGCCTCTCAGGTCACTGGGGCCTGAGGCTTTGGGGGCAAGGCCTGCCCCTCGTGTCCTGGAGTCCGAGGGTTGCCTGTCACCCCGGGAAGAGGCGAAGGGCTTGGCAGGAGTGCCCAGCCCGCCCCAGCCCCGCCACTGTGTTCTGTTTGTTCTTTTGTCCCCGCCCTGTGTTCCGTCATCCCTCTGAGCAAAGTCCTGTTCCGGCTCCCTCTGTCCCCCACGCCCTGTCCCCAAGAAAATAAGCTATCATTGTTGTATTTGCAATCTATGGATTAGAGGTTTAAGTATTTATTATTATTGGTTAATTATTATTATTAATTATGTAAATTTGCCTTCTGTCTGATGCTTTGAGTTTCTGAGGTGACCCTGGAGGGGTCACTGGTGGATGCACTGTCCTGTTGCCCGCCCCTCTGCTGTCCGGGAGACAGTGGTGTGGGGTCACTGGTTGGGCCCCGGAACTCTGGGCGGGTCTCGGCCCCTGCCCTCCCCTGGCGGGGGGGTGTGCGGGCCCCTGGAGCCTCAGTCTGTCTTTGTTCCCGCTCCCCTGACACTGTTTCCCCAGAGTGAACAGCTGGAATGGGGAGAAGGCCTCCATGTGCCAGGAAGGCAGGGCACCAGGGCCCTCAAGTCTCCAGCCTTACCTGGCATTGGGCATCACCCAGAACAGACCTGGCCCCTCCTATTATTTGCTGGAAAGTCCAGCAGAGGAGGGCGCCACCCCCCCAGACCCCCAGTCCCTGGGACCGGGGTGTCCGACTGCCCCCCACGGGAACCCTGCCCCTGCGGGTCACACTTTCCCGTTCCCTCCTTTTGTATTTGGAAATCATATGTTGTAATAAATCCCAACACAGGTGTT

XR_205553.1 Non-coding sequence

LOC101721011 PREDICTED: Heterocephalus glaber uncharacterized LOC101721011 (LOC101721011), misc_RNA.

Length: 402 bp     
>XR_205553.1
GGAGGGGTGCGCGCGTGCGCAGCGCAAGGGCGAGCCCGTCTGGTTCTCAAGCTGCCGGACCTCCCGCCCGCTCCCCAGGCCAGGGAAAGCTGAGGCCCGAGAGGTCTGCGGAGGAGGAGAATGGGCCAGGCCTGACAACATGGCTGGAATCCACACACGCAGCAGCAGCTGCCCCTCAGCTTCCTGGCAGGGACAAGGCAGACCATGGGGATGCAACGGGCTAAACAGAGACCCTGGTGCTCCTATCCGCAGCATAGACCAGCGGTGCTGCTGCCACCCAACTCACCCAGAGGTTCTCATGTAATTGGACATGTGGGCCAGCTTGTTGGCATGTGTGGGTTGTTTTCTGGCTTTTTGTTTGCTTCTCTACTGGGGATTAAACGTGGGGCTTAGTACCTACTA

XR_205555.1 Non-coding sequence

Chid1 PREDICTED: Heterocephalus glaber chitinase domain containing 1 (Chid1), transcript variant X11, misc_RNA.

Length: 1590 bp     
>XR_205555.1
GCATCTTCCGGTCGGCGCTAGGGGGCCGACTGGCCTCGGGCGTGAAGGTGAGCCTCGGGCGGCTGCCCTGCCCCGCCTCCTCGTGCTGCCTGGGCTTCCCCTCCTTGAGGTTCTATATTGAAGCCCAGAGAGGTCGAGGGACCGCAGGCTGGTGACCGAAATGGACCTTGCGCCACCCCATAGCTGTCCTGTTTCCACTGCGCTGTGAAATTGGTGTAGTGCCGTGGCTGTGCGCCCCAGTGGTGAGCAGGCTGCCTGCTGGGTCAGTCTCCTCATCCTTGAATGGGCCATCTGGCCCTGGGGGCTGACCCTGTTGTGACTGCCCACCATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGGCTGGGGGACACTTGGCTGAGCAGAATGTGGCCCCATGCACCTGGCCAGGCATCGTGGGCACCTTGGCGGTTGGCTGCTCCCACGCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAATCCCTGCAGGTGCGGCTGGAACTGGCCAAGGAGCTGGGCGTCGGGGTCTCCATCTGGGAGCTGGGCC

XR_205554.1 Non-coding sequence

Chid1 PREDICTED: Heterocephalus glaber chitinase domain containing 1 (Chid1), transcript variant X10, misc_RNA.

Length: 1566 bp     
>XR_205554.1
GCATCTTCCGGTCGGCGCTAGGGGGCCGACTGGCCTCGGGCGTGAAGGTGAGCCTCGGGCGGCTGCCCTGCCCCGCCTCCTCGTGCTGCCTGGGCTTCCCCTCCTTGAGGTTCTATATTGAAGCCCAGAGAGGTCGAGGGACCGCAGGCTGGTGACCGAAATGGACCTTGCGCCACCCCATAGCTGTCCTGTTTCCACTGCGCTGTGAAATTGGTGTAGTGCCGTGGCTGTGCGCCCCAGTGGTGAGCAGGCTGCCTGCTGGGTCAGTCTCCTCATCCTTGAATGGGCCATCTGGCCCTGGGGGCTGACCCTGTTGTGACTGCCCACCATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGGCTGGGGGACACTTGGCTGAGCAGAATGTGGCCCCATGCACCTGGCCAGGCATCGTGGGCACCTTGGCGGTTGGCTGCTCCCACGCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAAGAGCCGCGGCGGGAGGCACCTGGTCTTCTACCCAACTCTGAAG

XR_205557.1 Non-coding sequence

LOC101713709 PREDICTED: Heterocephalus glaber uncharacterized LOC101713709 (LOC101713709), misc_RNA.

Length: 818 bp     
>XR_205557.1
CGGGGGTGCGAAGGTGGCCGCGGTTGCCGCAGAAGTTGGTCCGAGAACCCGCGACGGCCCGCGCCGGGGTCGCAGGGCCCTCAGGACCGCCTCCTCGAGGTCACCGCGCCCAGGGAAGCCTGTGGCAGGCACAGGTGTTGTGATCTTCTGCTAACAGGACCCACCTCCTGAGGGCCACCTTGGGACTCCCGACAGGAAGACAGCGGCCGCTTTACCTCTTCTCCATTTCTGCCACTTCCATGAGGCGGTCAGGACAGTGGGCCTGTTGGTGGGGTCCAGGAAAGACCCCACTCAGAGTCCTCCGTGGAAGTGTGGACTAGGAGTGTGCCTAGAACAGCTCCTGGCAGGGCGAAACACCCTAGGCAGCCCCTGTCCCGGCTGGGCGGGGGCAGGGCCCTGTAGTGGGAGTGCAGGCATCCTAGAGGGACCCTTTGTGGTCACCACAGCAGGCTCTGCAGGTGAGGGGAGGCTGTGTAGCCTTGGGGCTGAGGACCTGCAGAGCTTACTCCCTGCAGCTGCGTTCTGTGGGTGACTCTCAATGAACCGGGGTTCTCACTTCAGTGCTGGGCATGAGCAGGAACGGTGAGAGCAGGACAGGCTCCAGCATGGTCCACAGCACAGCCCGACCTCATCCTCTTCCTGGACTGCCCAGTGGGGAGGCAGTGGCTACCGTGGGATCCCTTCGCAGCATTGCCTGGGAAGATGACCTGCCCTGCAGGGCGCCGTGGGATCTCAGCACCTCCACACTTCCCACAGCTCACACCATTGTCTTCAAAGCAAAATTTAAAACTCAAAAGTAAACTTTTCAGCAACTAGAA

XM_004851549.1 Coding sequence

E2f8 E2F transcription factor 8

High confidence: 4 potential gene matches
Length: 2610 bp    Location: 10668429..10653098   Strand: -
>XM_004851549.1
ATGGAGAACGAAAAGGAAAATCTTTTTATTGAGCCACACAAAAGGGGACTGATGAAGTCACCTCTGAAGGAGTCCACCAAGGAGAATGTAGCACCGGCTGACCTGTCCTCGCCTAACCTGGGCCCTTTGACCACGCCCACCAAGCCCAAGGAAGCCTCCCAGGGAGAACCGTGGACACCGACAGCCAACCTGAAAATGCTTATCAGTGCAGTGAGCCCGGAGATCCGAAGCAGAGATCAGAAAAGAGGGCTGTTTGACCTCCAAAGGGGATTACCTGAGGCTAAAGACTGTTTACATGAACACTTATCTGGAGACGAATATGAGAAGTCTCAACCAAGTCGAAAAGAGAAAAGTTTAGGATTGTTGTGTCATAAGTTCTTAGCTCGATATCCTAAGTATCCCAACCCTGCTGTGAATAATGACATCTGTCTTGACGAAGTTGCAGAAGAGCTCAATGTTGAACGTCGACGGATTTATGATATCGTGAATGTCCTAGAGAGTTTACACATGGTGAGCCGACTCGCCAAAAACAGGTACACTTGGCACGGACGACACAATCTCAACAAAATCCTTGGGACTCTAAAGAGCGTTGGGGAGGAGAATAAGTACGCCGAGCAGATTATGATGATCAAAAAGAAAGACTACGAACAAGAGTTTGACTTCATTAAGAGTTACAGTATAGAAGATCACATCATCAAATCAAACACTGGCCAGAATGGACATACAGAGATGTGTTTTGTTGAACTCCCTGGAGTGGAATTTCGGGCAGCTTCTGTAAACAGCCGCAAAGACAAGTCCTTAAGAGTAATGAGCCAGAAATTTGTGATGCTGTTTTTGGTGTCAACGCCTCAGATAGTCAGCCTAGAAATTGCTGCCAAGATTTTAATTGGGGAGGACCATGTGGAAGACCTGGATAAAAGCAAGTTTAAAACAAAAATTAGGAGGCTGTATGATATAGCTAATGTTCTAAGTAGCCTGGATCTTATCAAGAAAGTTCATGTTACGGAGGAAAGAGGTCGAAAACCAGCTTTTAAATGGACAGGCCCAGAAATCAGTCCAAATACCAGTGGCTCCAGCCCGGTCATTCCTTCCGCCACCTCTGATTTGGAAGTGAGGCCATCTGCAAAAGAGAACTGTGCCAAAAACCTCTTTTCCACGCATGGGAAACCAAACTTCACACGACATCCATCTCTTATCAAACTGGTAAAGAGTATAGAGAGCGATCGGAGAAAGATCAATTCTGCTCCCAGTAGCCCTGTCAAGAACAACAAAGCTGAGAGTTCTCAGAATTCTCCACCCTTCCCAAATAAAATGGCTCAGCTTGCGGCTATTTGCAAAATGCAGTTAGAAGAACAATCCAGTGAACCCAGAAAGAAAGTGAAAGTACAGCTAACAAGACCCAGGCACTACAAACCAGTGGCCCCTCTGGATGCATCAGCAAATGCTGAGCTGGAGCTGACAACACCATCCCTCATCCAGCCCCTGGGGGTGGTCCCCCTGGTCCCCAGCCCCTTGTCACCCGCAGTGCCCGTGATCCTACCTCAGGCCCCCTCTGGCCCATCCTATGCCATCTACCTGCAACCTGCCCAAGCCCAAACAATGGCATCACCCCAAGGCCTGAGCCCAGCAGTCTGCCCCACCTACTGCTCTCCAGTTGCTGGAGCAAAAGACTCCACAGATGCCACCACCAAGAAGGCCACCAATGATGCCACGAAGTCCAGTTTCTCCTCCAGATCTGGAAGCTTACTGCCAGCACCAGAGAGACAAGGTGCAAACAGCCAAACCAGGGAGGCACCTGCAGAAAGGGGCTCCAAGAGGTCCAGCTTCTTTGAGGACTGTGTTTCTAAAAAGAAATATAAAGAGGACCTAAAAGGACTTGACAGTGTGGCCACAACCTTGTTCCCATCGGGATACCTAATCCCTCTCACCCAGTGCTCATCCTTGGGGGCAGAATCCATTTTGTCTAATAAAGAAAGCTCAGGTACACTTTCCCCGAACCACAGGCTCTACAGCTCCCCGATCGCAGGTGTTATTCCAGTGACATCCTCTGAACTCAGTGCTGTGAATTTTCCCTCTTTTCATGTGACGCCTCTGAAGCTAATGGTCTCACCAACTTCTGTGGCAGCTGTACCTGGTGGGAATAGCCCAGCCCTTGCCTCGAGCCACCCCATTGCCATTCAGAACCCAAGCTCAGCCATTGTAAACTTCACCCTCCAGCACTTGGGACTCATCTCCCCCAGTGTGCAGGTGTCTGCCAGCCCTGGGCCTGGGACGGGAACCATTCCGATGTCCCCGAGAATAGAAGCAATTAGTATCGTACCAGAAAATGCAGGCTCTCAGCAAGGAAGGGCCACCAGCTCTGACTCACCAGTCCCAGGCCAGAGCCAACCAAATGGACAATCAGTCACTGTGACAGGGACACAACAGCCTGTTCCTGTGACACCCAAAGGGTCACAATTAGTGGCCGAAAGTTTCTTCCGTACCCCAGGGGGACCAACCAAGCCAACTGGCTTCTCCTGCATGGATTTCGATGGTGCTAATAAAACCTCCTTTGGGACACTCTTTGTCCCACAGCGAAAACTGGAAGTTTCAACAGAGGATGTCCACTAA

XM_004851534.1 Coding sequence

Uevld UEV and lactate/malate dehyrogenase domains, transcript variant X1

High confidence: 4 potential gene matches
Length: 1413 bp    Location: 10020747..9981502   Strand: -
>XM_004851534.1
ATGGAGTTCGACTGCGAGGCCGTGAGACAGCTCCTTGGCAAGTACAAGTTCAGGGATCTGACTGTGGAAGAACTAAAGAATGTAAATATGTTTTTCCCACATTTCAGATATTCCATGGATACCTACGTTTTTAAAGATAGTTCCCAGAAGGACCTGCTGAATTTTACTGGCACTCTTCCTGTGATGTATCAGGGTCACCAGTATAACATACCAGTTCGTTTCTGGATTTTGGATTCTCATCCTTTTGCTCCTCCCATTTGCTTCCTGAAGCCAACAACAAATATGGCAATCTCAGTTGGAAAACATGTGGATGCTCAAGGCAGAATATACTTGCCCTATCTCCAAAACTGGAGCCATCCTAAATCTGTCATTGTTGGATTAATTAAAGAAATGATTACCAAGTTTCAAGAGGAACTTCCCCTATATTCTCTGCCATCATCTGATGAAGCTCAGCAGGTAGACTTGCTGGCCTATATTGCAAAAATTACTGAAGGTGTCTCAGATATAAATTCAAAGAGTTGGACAAGTCATGAGAACAAAATAGCCAATAAAATTACTGTGGTTGGAGGTGGAGAGTTGGGTATTGCCTGCACATTAGCAATTTCAGCAAAGGGCATTGCAGATAAGCTGGTCCTTCTGGACTTCTCAGAAGGGACTAAAGGAGGCACAATGGACCTTGATATCTTCAGCCTGCCTAATGTGGAGATCAGCAAAGATTTGTCTGCCTCTGCTCATTCCAAGGTGGTGATCTTCACAGTCAACTCTCTCGGTAATGCTGAGTCCTACCTTGATGTGGTGCAGAGCAACGTGGATATGTTTCGAACCCTCGTCCCTGCTCTTGCACATTACAGTCAACATGGCGTCCTGATCGTTGCGTCTCAGCCAGTGGAAATCATGACTTATGTGACATGGAAACTGAGTACATTTCCTGCAAATCAAGTGATTGGAATTGGATGTAATCTGGACTCACAGAGATTACAATATATTATCACAAACATTTTGAAGGCACAGACTTCCGGCAAAGAAGTATGGGTTATTGGTGAGCAAGGAGAAGACAAAGTGCCCACATGGGGTGGACAAGAAGTAATAAATCACAGCTCTCGGGTACAGCTGTCCAACAGAGCCGTGGAACTGTTAAGGGTAAAAGGTCAGAGATCCTGGTCTGTGGGACTGTCAGTAGCTGACCTGGTTGACAGTGTCATAAACAATAAGAAGAAAGTGCATTCCGTATCCACTTTAGCAACGGGATATTATGATATAAATAGTGAAGTGTTTTTAAGTTTGCCTTGCATCCTCGGAACCAGTGGGGTATCTGAAGTCATCAAAACTGACGAGAAAGAAGTTACAGTGACTGAGAAACTCCAGAGCAGTGCATCCTCAATCCATGATCTCCAACAACAGTTAAAACTTTGA

XM_004851417.1 Coding sequence

Ampd3 adenosine monophosphate deaminase 3, transcript variant X5

Length: 1896 bp    Location: 2542896..2586275   Strand: +
>XM_004851417.1
ATGAGCAAGTCCGGCTCCTGGCTGAGAAGGTGTTTGCTAAGGTGCTGCGAGAAGAGGACAGTAAAGATGCTCTGTCCCTCTTCACCGTCCCCGAGGACTGTCCCATCGGGCAGAAGGAAGCCAAGGAGAGGGAGCTGCAGAAGGAGCTGGCAGAGCAGAAGTCTGTGGAGACTGCGAAAAGACTTCCACCCTCCCCCACTGCCCCAGGAGGACCCTTACTGCCTGGAGGATGCACCCCCCAACCTGGGGTACCTGGTCTGCATGCGGGGGGGCATCCTCTTTGTGTATGACAACAAGCAGATGCTGGAGCGCCAGGAGCCCCACAGCCTGCCCTACCCTGACCTGGAGACCTACACAGTGGACATGAGCCACATCCTGGCCCTCATCACCGATGGCCCCACGAAAACCTATTGTCACCGGAGACTGAATTTTCTGGAATCCAAGTTCAGCCTTCATGAGATGTTAAATGAAATGTCTGAGTTCAAAGAGCTGAAGAGTAACCCCCACCGAGACTTCTATAACGTGAGAAAGGTGGACACGCACATCCATGCAGCGGCCTGCATGAACCAGAAGCACTTGCTGCGTTTCATCAAGCACACATACCAGACGGAGCCCGACAGAACTGTGGCCGAGAAGCTGGGCCAGAAGGTCACCCTGAGGCAGGTGTTCGACAGCCTTCACATGGACCCCTATGATCTCACCGTGGATTCGCTGGATGTCCATGCAGGCCGGCAGACATTCCATCGCTTTGACAAGTTCAACTCCAAATACAACCCTGTGGGGGCCAGTGAGCTCCGTGACCTGTATTTGAAAACTGAAAACTACCTGGGAGGAGAGTACTTTGCTCGGATGGTGAAGGAGGTGGCCCGGGAGCTGGAGGAGAGCAAGTACCAGTACTCAGAGCCGAGGCTCTCCATCTATGGCCGCAGCCCACAGGAGTGGCAAAACCTGGCCCGCTGGTTCATCCAGCACAAGGTCTACTCACCCAACATGCGCTGGATCATCCAGGTGCCCCGGATCTATGACATATTTAGGTCAAAGAAGCTGCTGCCAAGCTTTGGGAAGATGCTGGAGAACATCTTCCTGCCCCTTTTTAAGGCCACAATCAACCCCCAAGATCACCGGGAGCTTCACCTCTTCCTCAAATATGTGACAGGGTTTGACAGTGTGGATGATGAGTCCAAACACAGTGACCACATGTTCTCAGAGAAGAGCCCCAGCCCAGACATCTGGACCAGTGAGCAGAATCCGCCCTACAGCTACTACCTGTACTACATGTATGCCAACATCATGGTGCTCAACAATCTTCGGCGAGAACGGGGCCTGAGCACGTTCCTGTTCCGGCCTCACTGTGGGGAGGCCGGCTCCATCACCCATCTGGTGTCTGCCTTTCTCACTGCCGACAACATTTCCCATGGGCTGCTCCTCAAGAAGAGTCCAGTGCTGCAGTACCTCTACTACCTTGCCCAGATCCCCATTGCCATGTCTCCTCTTAGCAACAACAGCCTTTTCCTGGAATATTCCAAGAACCCCCTGCGGGAATTCCTGCACAAGGGGTTGCATGTCTCCCTCTCCACCGATGACCCTATGCAGTTCCACTACACGAAGGAGGCACTCATGGAGGAATACGCCATCGCTGCACAAGTGTGGAAGCTGAGCACGTGTGACCTGTGTGAGATCGCCAGGAACAGTGTGCTGCAGAGCGGCCTCTCACATCAGGAAAAGCAGAAGTTTCTAGGACAGAATTACTGTAAAGAAGGACCTGAGGGAAACGATATTCGAAAGACAAATGTTGCACAGATCCGGATGGCATTCCGATATGAGACTCTATGCAATGAGCTCAGCTTCCTGTCTGATGCCATGAAATCAGAAGAGATCACAGCCCTGAACAACTAG

XM_004851770.1 Coding sequence

LOC101700561 olfactory receptor 1030-like

Length: 939 bp    Location: 65773..66711   Strand: +
>XM_004851770.1
ATGGCAAGAGGCAACGGTACCACGGTGACAGAATTTGTCCTCATGGGATTCACAGACCATCCTGAGCTTCAGCTGCCCCTCTTTCTGGTGTTTCTGGTAATCTATCTCATCACCTTGGTGGGAAATGTTGGTATGATCCTGCTCATCAAGGCAGATTCACGGCTCCATACCCCCATGTACTATTTCCTCAGTCACCTGGCATTCATTGATCTTTGTTACTCATCTTCCATTGGGCCCAAGATGCTGCAAAATTTATTGGTGAAGAAAAAAACCATCTCCTTTTCAGGCTGTTTTGCTCAGCTGTACTTCTCCAGTGCTTTCGCCACTACTGAGTGCTTCCTCTTGGCCACAATGGCCTATGACCGATACATGGCCATCTGTAACCCCTTGATTTACACAGCCATCATGACCCAGCGTGTCTGCAAAGAGTTGGTGGTTGGAGTCTACACCTACGGCTTCCTGAACTCCGTGATACAGACAATACTGACTTTCCAGTTGTCTTTCTGTGACTCCAACGTAATCCACCACTTCTACTGTGCTGACCCTCCTCTCCTTGCCCTCTCCTGCTCTGACACCCACAACAAAGAGAAGCAGCTCTTGATCTTCTCTGTGGTGAATCTCACAGGGTCCCTCCTGACTGTCCTCGGCTCCTACATCTGCATCCTCTTTTCTATTATAAAAATTCAGTCTTCTGAAGGCAAGTGCAAAGCATTTTCCACCTGTGCCTCCCACCTCACTGTGGTCACCATCTTCTACGGAACACTGTTTTTCATGTACCTGCAGCAACCTAAAGCCGAGAATTCATGGACATACAACAAAGTGGTCTCTGTGTTTTATAGTCTTGTTATCCCAATGCTTAACCCTCTGATCTACAGCCTGAGAAACACAGAAGTAAAGGACACCCTGAAAAAAATGCTAGAGGGCAAAGAGTCACAGTGA

XM_004851365.1 Coding sequence

LOC101719498 olfactory receptor 491-like

Length: 942 bp    Location: 127833..135960   Strand: +
>XM_004851365.1
ATGGCTTTTATGGAGGTTGGAAACTATACCACCGTGACAGAGTTCATCATTTTGGGGTTAACACAGGATCCTACACTTTGTGTTATTTTCTTTGTAATATTTCTAGGAATATATATTGTTACCTTAGTAGGCAATATCAGCATAATCACCTTAATAAGAAGCTGTTCTCAACTCCATACCCCCATGTATCTGTTCCTCAGCCATCTGGCTTTTGTGGACATTGGGTATTCCACATCAGTCACACCTGTAATGCTCATGGGATTCCTTGGCTATGGAACAGCCCTCCCTGTGGCTGGCTGTGAAGCCCAACTGTGTTCTGTGGTGACATTTGGGACTGCTGAATGTTTCCTGCTGGCTGCCATGGCCTATGATCGCTATGTGGCCATCTGCTCACCCCTGCTCTACTCCACCCACATGTCCCCTGGAGTCTGCACCCTCTTAGTGGGGGCTTCCTATCTGGGTGGTTGTGTGAATGCTTGGACATTTACTAGTTGTTTATTGAGTCTGTCTTTCTGTGGACCAAATAAGATAGACCACTTTTTCTGTGACTTCTCTCCTTTGTTGAAACTTTCCTGCTCAGATATCTCTGTTATTGAAATTATTCCTTCCATCTCTTCTGGCTCCATCATTATGGTCACGGTGTTTGTCATTGTTCTCTCTTACATGTACATCCTCATTACCATTCTGAAGATGCACTCCACTGAAGGGCGTCACAAAGCCTTCTCTACCTGCACCTCCCACCTCACTGCAGTGACTCTCTATTATGGAACTATTACCTTCATTTATGTGCTGCCCAAGTCCAGCTATTCAACTAACCAGAATAGAGTGGTGTCTCTGTTCTACACAGTGGTGATCCCCATGCTGAACCCCCTCATCTACAGTCTGAGGAACAGAGACGTAAAGGAGGCCCTGTGGAAAACAGTCATCAAAGTGTATTCTTAG

XM_004921114.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1746 bp    Location: 177029..172727   Strand: -
>XM_004921114.1
ATGATTCATATACACGTAGTTATTAATGTTAAGTTGTGCTATGAAAAAGGAACAATTCGCAGAGGAAAAGGGGGAGTTGGAAGTGGGGGGTTCAGAGTAGCTTGCATTGAGAATGTGATGTTTGAGTGGAGCTTGGAGGATTCAAGCCTGAGTTTGGTTAAATCTGTGGAAAGACCAATTCCCACTCCTGACTGTTCTCTTGAGCCCTGGGAGTATTGGCTGAGAACTTGGCACGAGGCAGTTTTGGCAAAGGAGGAGAGAAAGAGAAATATATGGAGGCATGTGTACTGCCTAGATGAAAGGCAAGACAGGGAAGTCAGCAGCAGCTACAACCCACTGCTCCCGGTGGCCAGGCCCCGCTCAGGGAGCACAGGATCACCTGCCTACTATGACCTGGAACAGAACCTGGACTCTGTGGTGATGGAGGAGTTATTTGATCCAGAGGAAAATCCCTCCCCAGCTCCATCCTTAGTGGTGCTTCAGGAGTCTGCTGGCACCGGGAAGATAACCCTGACCAGGAAAATGGTGCTGGACTGGGCCACCACTATCCAGTACCCAGGCCAGTTTGATTATGTTTTTTTTGTGAGGTGCAGAGAAGTAATAATGCTGCCTGAGTGCAGCCTGAACCAGCTCCTGTTCTGGTATTGTGAGGACAATCAAGCCCCTATCACAGAGATTCTGAAGCAGCCAGAGAGACTGCTGTCCATCCTGGATAGCTTTGATGAGCTACAGAGGCCCTTTGAATGAGAGCTGAAGAATCGTCGCTCAAGTCCCATGGAGAATGTGCTGCACATTTTAATTAGGAGAAAGTCACTTCCCACTTGCTCCTTTCTCCTCACTACATGGCCCTCTGTTTTGCAGAATCTGGAGTCCATACTGGGTGGTGAATAGTGCCAGGTCCATGTCTTAGGCTTCTCCAAAGAGGAGAAGNNGTATTTCAGCTTCTACTTTATGGATAAGGAGAAAATCAGAAATGCCTTTGACTTTGTACAAAAAAATGATGTTCTCTACAAAGCATGTCAGATTCCAGGCATTTGCTGGGTGATCTGCTCCTGGCTAAAAGGGCAGATGGAAAAAGGCCAGGTATCCTGTGAGACACCCAGCAATAGCACCAACAAATTCACTGCCNNTGTCTCCACTTTCCTGCCCACTGATGACAATGGAGGCTGTTTGGAGCTTACCCAGCACAGGGTCTTAAGGGGCCTGTGTTCCTTGGCAGCTGAGGGGATCCAGAACCAGAGGTCCCTATTTGAAGAAGCTAACCTCAGGAGGCACAATTTAGATGACCCTAGACTTGCTGTTTTCCTGAGCAGAAACGATTACCAAGAGGGACTCGACATCAAGAAGCTCTACAGCTTTTTGCACATTAGCTTACAGGAGATTTTTCGTGCCATGTCCTACCTAATGAAGGAGGACCAGAGCCAGCTCAGAGAGGAGTCCCATAGAGAAGTGGACAGGTTGCTGGAGGTGAAGGAGCAGGAAAAGAATGAAGAGATGACCCTCAATGTGCAGGTTTTGTTCAATGTATTGAAAAGAGAGAGTTCCTTGAACTTGGAGCTCAAGTTATGCTTCAAAATTGCTCCTTCAGTAATAGAAGGTCTGATACATTTTAAAGAACAAATGGAATATATAAAGCACAACAGGACCTGGGGTCTGGAATTTTCGTTGTGTGATACTAAAGTAAAGAATTTTACAAAGGGTGTTCAGATAAATGACATCTCATTCAAACAAAAGGAAATTACATAG

XM_004851374.1 Coding sequence

Tub tubby homolog (mouse), transcript variant X8

Length: 1251 bp    Location: 205747..286529   Strand: +
>XM_004851374.1
ATGGGCTCGGGTCCCCGCAGCCCGCGCGCCCTCGCCATTGGCACAGCCGGTGGGGGTCACCCCCGGGGGGGTCGAATGGTACAGTCCAGACCCGCAGCCAGCGAGGAGTCGCTGAGCCGGGCGCAGCCGCCGCCGCCCTCAGAGCGGGACCCGAGTCCGGAGGCGGCGATGGAAGGAGTCAGCAGCCACCGGACCCTGTCCTACAGCCGCTGGAGCTACGACAGTGTCTTAGATGATGAGGGCAGCAACCTGAGGCAACAGAAGCTTGACCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAAAAACGCCAGGAGTCCCTGATGGTGCAGGCCAATCCCGAAGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAGCAGGCCCCTCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGTTCAAGAGGCCGACTCACTCGCCAGTGTGCAGCTGGGAGCTGCCCGCCCAACAACACCAACCTCAGCCAAGAGAACCAAGGCAGCAGCTTCAGCAGGGGGCCAGGGTGGGGCCTCTAGGAAGGAGAAGAAGGGAAGGCACAAAGGCACCGGCGGGCCAGCAGCACCGGCAGAAGACAAGTCTGAGGCCCAAGGCCCAGTGCAGATCCTGACTGTGGGCCAGTCGGACCACGACACAGGAGAGACAGCAGCCAGTGGGGGCGCACGGCCCAGCGGGCAGGACCTCCGTGCCACGATGCAGAGGAAGGGAATCTCCAGCAGCATGAGCTTTGACGAGGAAGAGGAGGATGAGGATGAGAACAGCTCTAGCTCCTCCCAGCTAAACAGCAACACCCGCCCCAGCTCCGCCACTAGCAGGAAGTCCATCAGGCAGGAGGCAGTGCTGGCCCTTAAGGTCCCTGGGCCTCAGGCTCCCACTCGCCCTCCTGGCAGGAGGCAGCCTCAGCGCCCAGCCCAACAGCCCCAGAGCCGAAGGTGGGTGTTGAGGTCCAGGACCTTGAGGAATTTGCACTCCGGCCGGCCCCCCAGGGCATTACCATCAAATGCCGAATCACCCGGGACAAGAAGGGGATGGACCGGGGCATGTACCCCACCTACTTCCTGCACCTGGACCGTGAGGACGGGAAGAAGGTGTTCCTCCTGGCCGGAAGGAAGAGAAAGAAGAGTAAAACGTCCAATTACCTCATCTCTGTGGACCCAACGGACCTGTCTCGAGGAGCAGACAGTTACATCGGGAAACTGCGGTCCAATCTGA

XM_004851367.1 Coding sequence

Tub tubby homolog (mouse), transcript variant X1

Length: 1788 bp    Location: 206059..293806   Strand: +
>XM_004851367.1
ATGGGCTCGGGTCCCCGCAGCCCGCGCGCCCTCGCCATTGGCACAGCCGGTGGGGGTCACCCCCGGGGGGGTCGAATGGTACAGTCCAGACCCGCAGCCAGCGAGGAGTCGCTGAGCCGGGCGCAGCCGCCGCCGCCCTCAGAGCGGGACCCGAGTCCGGAGGCGGCGATGGAAGGAGTCAGCAGCCACCGGACCCTGTCCTACAGCCGCTGGAGCTACGACAGTGTCTTAGATGATGAGGGCAGCAACCTGAGGCAACAGAAGCTTGACCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAAAAACGCCAGGAGTCCCTGATGGTGCAGGCCAATCCCGAAGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAGCAGGCCCCTCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGTTCAAGAGGCCGACTCACTCGCCAGTGTGCAGCTGGGAGCTGCCCGCCCAACAACACCAACCTCAGCCAAGAGAACCAAGGCAGCAGCTTCAGCAGGGGGCCAGGGTGGGGCCTCTAGGAAGGAGAAGAAGGGAAGGCACAAAGGCACCGGCGGGCCAGCAGCACCGGCAGAAGACAAGTCTGAGGCCCAAGGCCCAGTGCAGATCCTGACTGTGGGCCAGTCGGACCACGACACAGGAGAGACAGCAGCCAGTGGGGGCGCACGGCCCAGCGGGCAGGACCTCCGTGCCACGATGCAGAGGAAGGGAATCTCCAGCAGCATGAGCTTTGACGAGGAAGAGGAGGATGAGGATGAGAACAGCTCTAGCTCCTCCCAGCTAAACAGCAACACCCGCCCCAGCTCCGCCACTAGCAGGAAGTCCATCAGGGAGGCAGCCTCAGCGCCCAGCCCAACAGCCCCAGAGCCGAAGGTGGGTGTTGAGGTCCAGGACCTTGAGGAATTTGCACTCCGGCCGGCCCCCCAGGGCATTACCATCAAATGCCGAATCACCCGGGACAAGAAGGGGATGGACCGGGGCATGTACCCCACCTACTTCCTGCACCTGGACCGTGAGGACGGGAAGAAGGTGTTCCTCCTGGCCGGAAGGAAGAGAAAGAAGAGTAAAACGTCCAATTACCTCATCTCTGTGGACCCAACGGACCTGTCTCGAGGAGCAGACAGTTACATCGGGAAACTGCGGTCCAATCTGATGGGCACCAAGTTCACCGTTTATGACAATGGAGTCAACCCTCAGAAGGCGTCATCCTCTACTTTGGAAAGTGGGACCTTGCGCCAGGAGCTGGCAGCTGTGTGCTATGAGACAAACGTCTTAGGCTTCAAGGGGCCTCGGAAGATGAGTGTGATTGTCCCTGGCATGAACATGGTTCATGAGAGAGTCTCTATCCGTCCCCGAAACGAACATGAGACACTGCTAGCCCGATGGCAGAATAAGAACACAGAGAGTATCATCGAGCTGCAAAACAAGACCCCCGTCTGGAATGACGACACACAGTCCTACGTACTCAACTTCCACGGGCGCGTCACACAGGCCTCTGTGAAGAACTTCCAGATCATCCATGGCAATGACCGAGACACTCCACCCCTCTCCTCTGTTCTCCTGTGCCTCCCTCCCCCTGTCAAGGTCCAGGCAGAGCTGGAAATGAGGCTGAGGTCTAGAGTTTCCTACAGAACAATTCAGAATGGCTTAGAAGGGGGAGCCCAACTCTGGCCTCTTCATTCCTGCATTTGGGTGACAGAGGGGACTTGGTCAGGATGGGTAACCTTTTTCTTGCTGAGAACGCATATTTAG

XM_004851370.1 Coding sequence

Tub tubby homolog (mouse), transcript variant X4

Length: 1644 bp    Location: 206059..293806   Strand: +
>XM_004851370.1
ATGGGCTCGGGTCCCCGCAGCCCGCGCGCCCTCGCCATTGGCACAGCCGGTGGGGGTCACCCCCGGGGGGGTCGAATGGTACAGTCCAGACCCGCAGCCAGCGAGGAGTCGCTGAGCCGGGCGCAGCCGCCGCCGCCCTCAGAGCGGGACCCGAGTCCGGAGGCGGCGATGGAAGGAGTCAGCAGCCACCGGACCCTGTCCTACAGCCGCTGGAGCTACGACAGTGTCTTAGATGATGAGGGCAGCAACCTGAGGCAACAGAAGCTTGACCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAAAAACGCCAGGAGTCCCTGATGGTGCAGGCCAATCCCGAAGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAGCAGGCCCCTCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGGCACCGGCGGGCCAGCAGCACCGGCAGAAGACAAGTCTGAGGCCCAAGGCCCAGTGCAGATCCTGACTGTGGGCCAGTCGGACCACGACACAGGAGAGACAGCAGCCAGTGGGGGCGCACGGCCCAGCGGGCAGGACCTCCGTGCCACGATGCAGAGGAAGGGAATCTCCAGCAGCATGAGCTTTGACGAGGAAGAGGAGGATGAGGATGAGAACAGCTCTAGCTCCTCCCAGCTAAACAGCAACACCCGCCCCAGCTCCGCCACTAGCAGGAAGTCCATCAGGGAGGCAGCCTCAGCGCCCAGCCCAACAGCCCCAGAGCCGAAGGTGGGTGTTGAGGTCCAGGACCTTGAGGAATTTGCACTCCGGCCGGCCCCCCAGGGCATTACCATCAAATGCCGAATCACCCGGGACAAGAAGGGGATGGACCGGGGCATGTACCCCACCTACTTCCTGCACCTGGACCGTGAGGACGGGAAGAAGGTGTTCCTCCTGGCCGGAAGGAAGAGAAAGAAGAGTAAAACGTCCAATTACCTCATCTCTGTGGACCCAACGGACCTGTCTCGAGGAGCAGACAGTTACATCGGGAAACTGCGGTCCAATCTGATGGGCACCAAGTTCACCGTTTATGACAATGGAGTCAACCCTCAGAAGGCGTCATCCTCTACTTTGGAAAGTGGGACCTTGCGCCAGGAGCTGGCAGCTGTGTGCTATGAGACAAACGTCTTAGGCTTCAAGGGGCCTCGGAAGATGAGTGTGATTGTCCCTGGCATGAACATGGTTCATGAGAGAGTCTCTATCCGTCCCCGAAACGAACATGAGACACTGCTAGCCCGATGGCAGAATAAGAACACAGAGAGTATCATCGAGCTGCAAAACAAGACCCCCGTCTGGAATGACGACACACAGTCCTACGTACTCAACTTCCACGGGCGCGTCACACAGGCCTCTGTGAAGAACTTCCAGATCATCCATGGCAATGACCGAGACACTCCACCCCTCTCCTCTGTTCTCCTGTGCCTCCCTCCCCCTGTCAAGGTCCAGGCAGAGCTGGAAATGAGGCTGAGGTCTAGAGTTTCCTACAGAACAATTCAGAATGGCTTAGAAGGGGGAGCCCAACTCTGGCCTCTTCATTCCTGCATTTGGGTGACAGAGGGGACTTGGTCAGGATGGGTAACCTTTTTCTTGCTGAGAACGCATATTTAG

XM_004851369.1 Coding sequence

Tub tubby homolog (mouse), transcript variant X3

Length: 1701 bp    Location: 206059..293356   Strand: +
>XM_004851369.1
ATGGGCTCGGGTCCCCGCAGCCCGCGCGCCCTCGCCATTGGCACAGCCGGTGGGGGTCACCCCCGGGGGGGTCGAATGGTACAGTCCAGACCCGCAGCCAGCGAGGAGTCGCTGAGCCGGGCGCAGCCGCCGCCGCCCTCAGAGCGGGACCCGAGTCCGGAGGCGGCGATGGAAGGAGTCAGCAGCCACCGGACCCTGTCCTACAGCCGCTGGAGCTACGACAGTGTCTTAGATGATGAGGGCAGCAACCTGAGGCAACAGAAGCTTGACCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAAAAACGCCAGGAGTCCCTGATGGTGCAGGCCAATCCCGAAGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAGCAGGCCCCTCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGTTCAAGAGGCCGACTCACTCGCCAGTGTGCAGCTGGGAGCTGCCCGCCCAACAACACCAACCTCAGCCAAGAGAACCAAGGCAGCAGCTTCAGCAGGGGGCCAGGGTGGGGCCTCTAGGAAGGAGAAGAAGGGAAGGCACAAAGGCACCGGCGGGCCAGCAGCACCGGCAGAAGACAAGTCTGAGGCCCAAGGCCCAGTGCAGATCCTGACTGTGGGCCAGTCGGACCACGACACAGGAGAGACAGCAGCCAGTGGGGGCGCACGGCCCAGCGGGCAGGACCTCCGTGCCACGATGCAGAGGAAGGGAATCTCCAGCAGCATGAGCTTTGACGAGGAAGAGGAGGATGAGGATGAGAACAGCTCTAGCTCCTCCCAGCTAAACAGCAACACCCGCCCCAGCTCCGCCACTAGCAGGAAGTCCATCAGGGAGGCAGCCTCAGCGCCCAGCCCAACAGCCCCAGAGCCGAAGGTGGGTGTTGAGGTCCAGGACCTTGAGGAATTTGCACTCCGGCCGGCCCCCCAGGGCATTACCATCAAATGCCGAATCACCCGGGACAAGAAGGGGATGGACCGGGGCATGTACCCCACCTACTTCCTGCACCTGGACCGTGAGGACGGGAAGAAGGTGTTCCTCCTGGCCGGAAGGAAGAGAAAGAAGAGTAAAACGTCCAATTACCTCATCTCTGTGGACCCAACGGACCTGTCTCGAGGAGCAGACAGTTACATCGGGAAACTGCGGTCCAATCTGATGGGCACCAAGTTCACCGTTTATGACAATGGAGTCAACCCTCAGAAGGCGTCATCCTCTACTTTGGAAAGTGGGACCTTGCGCCAGGAGCTGGCAGCTGTGTGCTATGAGACAAACGTCTTAGGCTTCAAGGGGCCTCGGAAGATGAGTGTGATTGTCCCTGGCATGAACATGGTTCATGAGAGAGTCTCTATCCGTCCCCGAAACGAACATGAGACACTGCTAGCCCGATGGCAGAATAAGAACACAGAGAGTATCATCGAGCTGCAAAACAAGACCCCCGTCTGGAATGACGACACACAGTCCTACGTACTCAACTTCCACGGGCGCGTCACACAGGCCTCTGTGAAGAACTTCCAGATCATCCATGGCAATGACCCGGACTACATCGTCATGCAGTTTGGCCGGGTAGCGGAGGATGTGTTCACCATGGATTACAACTACCCGCTGTGTGCACTGCAGGCCTTTGCCATTGCACTGTCCAGCTTCGACAGCAAGCTGGCCTGCGAATAG

XM_004851381.1 Coding sequence

Stk33 serine/threonine kinase 33, transcript variant X2

High confidence: 4 potential gene matches
Length: 1545 bp    Location: 761277..540756   Strand: -
>XM_004851381.1
ATGGCTGACAGCAGTTTAAATAAAAACTCCACAAATTGCCCCAGTAGTTCTCAGAAAGATGGACTTTATTGTGATGCAAGCATTTCTCCAGTTTTGGTGGTGGAAATGTCACAGACATCAAGTACTGATAGTACAGAATTTTTATTTCCGCCAGATAGAAAAAAAGAAAAAATTACCAGCAGAGATGTTTCTGGGAATGATTTGCTATTAGGAACCTCAATCATAGAGAGAAAAACATCTCACCAGCAGTGGGGTCGAAGCAATGTTATGGAAGGAAAAGTTCCTCACATAAGGATGGAGAGTGGAGCAGCTATTGAGGAATTCTATACTTTTGGAAGAACGCTGGGACAAGGAAGTTTTGGAATGGTCTTTGAAGCTATAGACAAGGAAACAGACACTAAGTGGGCAATTAAAAAAGTAAATAAAGAAAAGGCTGGAAGTTCTGCTGTGAAGTTACTTGAACGGGAGGTGAACATCCTAAAAAGTGTAAAACATGAGCACATCATACATTTGGAACAAATATTTGAGACGCCTAAGAAAATGTACCTTGTGATGGAACTTTGTGAGGATGGAGAACTCAAAGAAATTTTGGATAGGAAAAGGCATTTCTCAGAGAATGAGACGAGGTGGATCATTCAAAGTCTTGCATCAGCTATTGTATATCTTCACAATAAGGATATAGTACATAGAGATCTAAAACTGGAAAACATAATGGTTAAAAGCAGCTTTATTGATGCAAACAATGAAATGAACTTAAATATAAAGGTGACTGATTTTGGCTTAGCAGTGCAGAAGCATGGTAGGAGTGAAGCCATGCTGCAGGCCACCTGTGGGACTCCTATCTATATGGCACCTGAAGTTATCAATGCCCACGACTACAGCCAGCAATGTGACATTTGGAGCGTAGGTGTCATAATGTACATTTTATTATGTGGAGAACCACCCTTTTTGGCAAACTCAGAAGAGAAGCTTTTTGAGTTAATAAGAAAGGGAGAACTACATTTTGAGGATCCAATCTGGAATTCCATAAGTGATAGTGCTAAAAGTGTTTTGAAACAGCTTTTGAAAGTAGATCCTGCTCACAGAATCACAGCTAAGGAACTACTAGATAACCAGTGGTTAACAGGCAATACACTTTCTTCAGTGAGACCAACAAATGTATTAGAAATGATGAAAGAATGGAAAAATAACCCAGAAAGTGACGAGGAAAACAAGAAAGAGGAGAAGAATAATCAGTTCCGTCAAGAAAAGTTGGAATATCACCAGCAACGCAGAAATGTCCCTGCTGTCAATGACACTTCAGGTGAAAAGGAGGAAAACCCAGCAAAACAACCCACTGCTTATGAAAAGAAATTGCCTGCAACCAGTAAGAAGGCAGATACAAATGACTTTGACACGTGCTGTTCAAGTTCCACATCTAGCAAACTCCTTCCACCTGCACTCAAGGGAGAAGTACAGAAAAGTTCTGTGACTCCAAGCCAAGGAGGAGCAACCAAATCCACTGCTAAATCCACTGCCCTGTTTCGAAGCAAAAAAACCCCCTAA

XM_004851382.1 Coding sequence

Trim66 tripartite motif containing 66

High confidence: 4 potential gene matches
Length: 3729 bp    Location: 815741..773332   Strand: -
>XM_004851382.1
ATGGCCAGGAACTGCTCTGAGTGCAAGGAGAAGAGGGCAGCACACATCCTCTGCACCTACTGCAATCGCTGGCTGTGCAGCTCCTGCACAGAGGAGCACCGGCATGGCCCCGCCCCAGGGGGCTCACTCTTTCCCCGCTCCCAGAAGGGATCTCCAGGAGTGAATGGTGGTTCTGGAGACTTTGCCTTGTACTGTCCTCGACATACACAGGAAGTACTTAAATTGTTCTGCGAGACCTGCGATGTACTCACGTGCCATAGCTGCCTAATGGTGGAACACAAAGAACACAGGTGCAGACATGTTGAAGAAGTTCTACAAAACCAGAGAATGCTTTTAGAAAGTGTGACTACACAGGTGGCACATAAGAAATCCAGTCTACAGACATCTGCAAAGCAAATTGAAGACAGGATTTTTGAAGTGAAGCATCAGCATCGGAAGGTGGAAAACCAGATCAAAATGGCCAAGATGGTTCTGATGAATGAGCTGAACAAACAAGCCAATGGACTCATAGAGGAGTTGGAGAGCATTACTAATGAGAGAAAGCGGAAGCTGGAACAGCAGCTACAGAGCATCATGGTTCTCAACCGTCAGTTTGAGCATGTGCAGAATTTCATCAACTGGGCTGTCTGCAGCAAAACCAGTGTCCCTTTCCTTTTCAGCAAAGAACTGATTGTGTTTCAGATGCAGCGCTTGCTGGAGACAAGTTGTAACACAGATCCTGGCTCCCCTTGGAATATCAGATTCACCTGGGAGCCTAACTTCTGGACCAAGCAGCTGGCTTCCCTTGGATGCATAACTACTGAAGGTGGACAACTGTCCCGGATAGATACTCCCGCTTATGGAGGCTTACAGGGGCCATCATCCTTTTATCAAAGTCACCAGTCCCCAGTGGCTCAGCAAGAGGCCCTTAGCCACCCCTCACACAAGTTCCAGCCTCCAGCACTGTGCTCCTCATCTGTGTGCTGTTCCCACTGCTCCCCAGTCTCGCCCTCGCTCAAAGGCCAGGTCCCCCCACCCAGCGTACATCCAGCCCACAGCTTTAGGCAGCCCTCTGAGATGGTGTCCCAGCATCTGGGGTCTCTGCAGTGCTCCACCCTGCTGCCCAGGGAGAAAGATGTGACCTGCAATCCTCACCCGCCAAAGCTGCTACAGCCCTGGCTGGAAACTCAGCCCCCAGTGGAGCAGGAGAGCACATCCCAGCAGCCCAGGCAGCAACTGACTTCCCAGCCTGTGTGCATCGTCCCCCCACAGGATGTTCAGCAAGGAGCCCATGCCCAGCCCACCTTGCAGACACCCTCTATCCAAGTCCAGTTCGGCCACCACCAGAAGCTGAAGCTCAGTCACTTTCACCAGCAGCCACCGCAGCAGCTGCCCCCTCCGCCCCCTCCCCTGCCTCCGCCCCCACAGCAGGCTCCCCCAACTCTGCCTCCACCCCAGCAGCTGGCTTCCAGTCAGCACGAGAACCCCCCTGGGCCTGCCTGTTCTCAGAACGTGGACATAATGCACCACAAGTTTGAGCTGGAAGAGATGCAGAAGGACTTGGAGCTCCTCCTTCAGGCCCAGCAGCCCAGCCTGCAGCTGAGTCAGACCAAATCTCCTCAGCATCTTCAGCAAACGATTGTGGGGCAGATCAACTACATTGTGAGGCAGCCAGCACCTGTCCAGCCCCAGAGCCAGGAGGACGCCCTCCAGGTTACAGATGAGCCTCCAGCATCGGAGGGCCCAAAGCCAGCTCTCCCTCCTGACAAGAACACTGCTGCTGCCTTGCCCCAGACCTCTGGGGAAGAAACTCCTCACAGTGTCCCTCCAGTGGACAGTAGTGTCCAGCACTCCTCTCCAAATGTGGTGAGAAAGCATTCCACCTCAGTGAGCATCATGGGCTTTTCCAACTCTCTGGAGATGGAGTTGTCATCTACCAGGCTGGCGAGGACCCTAGAGCCACAGATCCAGAGCGTGAGCAGTCTGACCGCTGGCGCTCAGCAGGCAGTACCGGGTCTGCTGAGTGGCTCCCCACATACTGTGTCCAGCCGGACGAGTGTTCAAACTCACACCATGCCCAGCCTGACAACCAGTCACCTACAGGCCATGCCAAGCCTTGTACGTGGCTCATTCCAGTCCATACCCAACCTGATAAGTGATTCCTCCCAAGCCATCACAACCTTAGCAAGTGATCACTCTCAGGCTGGGCCCAGCCTGGCATCTGGTCACATGCAGGCTGTGCCAAGTCTGACGACTTGTCCTCTGCAGAGCGTACCCCCAGTTTCTGACATGCAGCTGGAAACTGGGCCCAGTTCTAGTCCTGGCTGTAGCAGAAATGCAGAGAGCCTGTGCCCTAAGGATGGGACTGATTCCTCCCTGGAGAATGCCCTGTGTAAGGTGGAAAGTGAGGATTCCACTCGCTTCACTGACTCAGTGGGACCAGGCCCCACAGCCCCTGGTCTGGATGCTCCCAAGGACTTGGCTATTCCCTCGGAACTGGAGGAACCAATTAACCTCTCCGTGAAAAAACCTCCACTGGCACCAGTGGTCAGCATACCTATAGCTCTGCAGCAGTATCGGAACCCAAAAGAGTATGAGAATTTTGATCAAGGAGTCCTAGAACCGGATACAAAGGAAAACCAGAGCACCAGGACCTTCAATAGTGAGCCCAAGATCCCCTATGTGCGACTGGAACGACTCAAGATCTGTGCTGCCTCCTCGGGAGAGATGCCTGTGTTCAAACTGAAGCCCCAGAAGAATGATCAGGATGGGAGCTTCTTGCTGGTCATTGAGTGTGGCACTGAGTCCTCCACCATGACCATTAAGGTCAGCCAGGATAACATGCCTGATGCCATCCAGGCCCCAGGTCTGGGCGGAAGAAAGGTCACTGTCACTTCTCTGGCTGGGCAGCGGCCCCCAGAAGTGGAAGGCGCATCTCCTGAAGAAAATAGGCTCATTCCTCGGACTCCTGTAACCAAGAAGGGCCCCCCAGTCCCAATAGAGAATGAGGACTTCTGTGCTGTGTGCCTCAATGGGGGGGAGCTGCTGTGCTGTGATCGCTGCCCCAAAGTGTTCCACCTCTCCTGCCATGTGCCAGCCCTGCTCAGCTTCCCAGGCGGAGAGTGGGTGTGTACCCTGTGCCGAAGCCTGACGCAGCCTGAGATGGAGTACGACTGTGAGAATGCCCGCTACAACCAGCCTGGACTGCGGACACCTCCTGGCCTGAGCATATGTGACCAGAAGAAGTGTGAGAAGCTGGTACTGTCCTTGTGCTGCAATGGCCTCAGCCTGCCCTTCCACGAACCTGTCAGCCCTCTGGCCCGACATTATTACCAGATTATCAAGAGGCCCATGGACCTGTCAATCATCCGGAGGAAGCTGCAGAAGAAGGACCCAGCTCACTATACCACCCCAGAGGAGGTGGTGTCAGATGTGCGCCTCATGTTCTGGAACTGTGCTAAGTTCAATTATCCTGACTCAGAGGTTGCAGAGGCTGGCCGCTGCCTGGAGGTGTTCTTTGAGGGCTGGTTGAAGGAGATCTACCCAGAGAAACAGTTTGCCCAGCCAAGACTGGAGGACTCAGACTCCGAGGAGGTGTCTAATGAGAGTGGATGTTCCACCCCTCAGGGCTTCCCATGGCCCCCCTACATGCAGGAAGGCATCCAGCCCAAGAGGCGGCGACGGCACATGGAAAATGAAAAAGCAAAGAGAATGTCTTTCCGCTTGGCAAACAGCATCTCACAGGTGTGA

XM_004851391.1 Coding sequence

LOC101697000 chromosome unknown open reading frame, human C11orf16, transcript variant X1

Length: 1473 bp    Location: 1079094..1069112   Strand: -
>XM_004851391.1
ATGCCTTTGCCGAAGTACTGCAGCGTGGCCACAACCCTGCAGGCCCCTGGCTGGGGCTGTGCTGCCCTACTGGGGGACCTCTCCTTCGCCTGCCCCTTTGCTCACAGAGCACCTGGGCTCCCCAGGCTCCATGTTCTCACCAGGAATTCTTCGAATCACCCATCTCTCCACATTGCTGACCCAGCCTGGCAGGGCCCGGGCTGGCTGGGAAGAGTTAGAGATCCTGCTAACACCTGGGTCCTGGCAAGGAGGGAACCAGATGGCTTTTATTACCGGGCTCAGATAAAGGCTGCTCCAGAGCTGGAGAGTCAGAGGGTCCTGCTTGTGGAATTTGAGTCTCCCCTTTTCACAGGCCCCAAGCTGCCAGCCCAGAGGCAGAGTGTGGTCTCAGAAGAAGATGTTATTCAGCTCTCACCATTTGTGGAATATTCACTGCGACCTGGGGACAAGGTGCTGGCAGCATGGGAACCAGGCCGACAGCGGTATGGTCCTGGCATTGTTCTCTTGGGCTCAGAGATTCGAGACAATCAGCCAGCATCAAAGGAGGAGGAAATTACTGTTCACTTCTGGAATGGCAAGACAGCTCAGGTGCCTCTAGGTGGGGTCAGGTGGGTGCCCCCCACTGTCTGGAAGAAGGCCATGGAGAGGCTGAGTAAGCCTCGCACCAGTGAGGACCCCAGTGCCCTCCTCTGTGCCCCTTGCTGCTCTCCGCTGGGGACAGTCACTGGAGGCATCACCAACAGGCTTCCTCCGGACACTGCATTCCTGTGCCCTCCCTGCCATCCCCAGGCCTGCTGCCAGCCGCTGTGCCAGGGCTACTGCTGTCCCCTGATGAGCCCCACCTGGTGGCCTCTCACTGGGACCTCAGATATCACGGCCAGAGAACTCCCGGTGTCAGAGCTGAAGCCCGCAGCACAGCTTTTGCCCCTAGAAGGTCCTAAAGAGGAGGCAGGGGCAGTGCGTGCATCCCTTGCTGTTTCTTCCTCTTCCTCCTCCTCCTCTTGTGAAGAAGATTTGGAGGAGAACCTGGAAATGGGCCTTCCCCAGACACTGATGGTGAACAGCGCAGTCAACACTGACCCCATCCTCCCCAAGAGGCCTTTGGCGCAGAGCGGCCCCCGCCAGCCGGAGTGGAGGTATTGGAAGAGGAACGGACAGGAGCCCCGTCCTGGAAAGCCAGGAATAAAATGTCGCAGCATCCAGAAAGATGACAACAAACAAGAGAAAGTACAAACTGCAGTAGTGGGGACTACCAAGAAGCTAGCCCTGAAAGCAACCATGATGCCACTGCAGACCCTGCCAGAGGGAGCTGAATACAGAAAACTGGGTCCAGGTATCATAAGGCATCAGCAGGACAAAAATCTGCCCAACAGGAAAAGCCCTAAGGATCTAGATGAGCAGGAGGAAGGCAGCTGCAGGAGCTGGTGGCCCTGTCCCGGCAGTCCTTGCCAAGGGCCTGGTGAGACCACTTGA

XM_004851392.1 Coding sequence

LOC101697000 chromosome unknown open reading frame, human C11orf16, transcript variant X2

Length: 1473 bp    Location: 1079018..1069112   Strand: -
>XM_004851392.1
ATGCCTTTGCCGAAGTACTGCAGCGTGGCCACAACCCTGCAGGCCCCTGGCTGGGGCTGTGCTGCCCTACTGGGGGACCTCTCCTTCGCCTGCCCCTTTGCTCACAGAGCACCTGGGCTCCCCAGGCTCCATGTTCTCACCAGGAATTCTTCGAATCACCCATCTCTCCACATTGCTGACCCAGCCTGGCAGGGCCCGGGCTGGCTGGGAAGAGTTAGAGATCCTGCTAACACCTGGGTCCTGGCAAGGAGGGAACCAGATGGCTTTTATTACCGGGCTCAGATAAAGGCTGCTCCAGAGCTGGAGAGTCAGAGGGTCCTGCTTGTGGAATTTGAGTCTCCCCTTTTCACAGGCCCCAAGCTGCCAGCCCAGAGGCAGAGTGTGGTCTCAGAAGAAGATGTTATTCAGCTCTCACCATTTGTGGAATATTCACTGCGACCTGGGGACAAGGTGCTGGCAGCATGGGAACCAGGCCGACAGCGGTATGGTCCTGGCATTGTTCTCTTGGGCTCAGAGATTCGAGACAATCAGCCAGCATCAAAGGAGGAGGAAATTACTGTTCACTTCTGGAATGGCAAGACAGCTCAGGTGCCTCTAGGTGGGGTCAGGTGGGTGCCCCCCACTGTCTGGAAGAAGGCCATGGAGAGGCTGAGTAAGCCTCGCACCAGTGAGGACCCCAGTGCCCTCCTCTGTGCCCCTTGCTGCTCTCCGCTGGGGACAGTCACTGGAGGCATCACCAACAGGCTTCCTCCGGACACTGCATTCCTGTGCCCTCCCTGCCATCCCCAGGCCTGCTGCCAGCCGCTGTGCCAGGGCTACTGCTGTCCCCTGATGAGCCCCACCTGGTGGCCTCTCACTGGGACCTCAGATATCACGGCCAGAGAACTCCCGGTGTCAGAGCTGAAGCCCGCAGCACAGCTTTTGCCCCTAGAAGGTCCTAAAGAGGAGGCAGGGGCAGTGCGTGCATCCCTTGCTGTTTCTTCCTCTTCCTCCTCCTCCTCTTGTGAAGAAGATTTGGAGGAGAACCTGGAAATGGGCCTTCCCCAGACACTGATGGTGAACAGCGCAGTCAACACTGACCCCATCCTCCCCAAGAGGCCTTTGGCGCAGAGCGGCCCCCGCCAGCCGGAGTGGAGGTATTGGAAGAGGAACGGACAGGAGCCCCGTCCTGGAAAGCCAGGAATAAAATGTCGCAGCATCCAGAAAGATGACAACAAACAAGAGAAAGTACAAACTGCAGTAGTGGGGACTACCAAGAAGCTAGCCCTGAAAGCAACCATGATGCCACTGCAGACCCTGCCAGAGGGAGCTGAATACAGAAAACTGGGTCCAGGTATCATAAGGCATCAGCAGGACAAAAATCTGCCCAACAGGAAAAGCCCTAAGGATCTAGATGAGCAGGAGGAAGGCAGCTGCAGGAGCTGGTGGCCCTGTCCCGGCAGTCCTTGCCAAGGGCCTGGTGAGACCACTTGA

XM_004851396.1 Coding sequence

Scube2 signal peptide, CUB domain, EGF-like 2

Length: 2925 bp    Location: 1241774..1151636   Strand: -
>XM_004851396.1
ATGGGGGTCCCGGGCCGCAGACGTCCCGGAGCGGCCCGGGCGCTGCTGCTGCTTCTGCCGCTGCTGCTGGCGGCCGCCGTCCCGCCTGGCCCGGGCAGCGCCACCGGGCCGCCTGAGGACATAGACGAGTGTGCCCAAGGACTAGATGACTGCCATGCTGATGCCCTGTGCCAGAATACACCCACCTCCTACAAGTGCTCCTGCAAGCCTGGCTACCAAGGGGAAGGCAGGCAGTGCGAGGACATTGATGAATGTGAAAATGAACTCAATGGAGGCTGTGTCCATGACTGTTTGAATATTCCAGGCAATTATCGCTGCACTTGTTTTGATGGCTTCATGTTGGCCCATGATGGTCATAATTGTCTTGATGTGGATGAGTGCGTGGAGAACAATGGCGGCTGCCAGCACACCTGTGTCAACGTCCTGGGGAGCTACGAGTGCCGCTGCAAGGAGGGCTTTTTCCTGAGTGACAACCAGCACACGTGTATTCACCGCTCAGAAGAGGGCCTGAGTTGCATGAATAAGGATCACGGCTGTAGTCACATCTGCAAGGAGGCCCCGAGGGGCAGCGTGGCCTGCGAGTGTAGACCTGGTTTTGAGCTGGCCAAGAACCAGAGAGACTGCATCTTGACCTGTAACCATGGAAACGGTGGGTGTCAGCACTCCTGTGAAGACACAGCTGAAGGCCCAGAGTGTAGCTGCCACCCGCAGTACAAGTTGCACATGGATGGGAGGAGCTGCTTTGAGCAAGAGGACACTGCCCTGGAGGTGACAGAGAGCAATGCCACATCAGTGGTGGATGGGGATAAGCGGGTGAAACGGAGGTTGCTCATGGAAACGTGTGCCGTCAACAATGGAGGTTGTGACCGCACCTGTAAGGACACCTCAACAGGCGTTCACTGCAGCTGTCCGGTCGGATTCATTCTCCAGCTGGATGGAAAGACGTGTAAAGATATTGATGAGTGTCAGACCCAAAATGGAGGTTGTGACCACTTCTGCAAAAACACCGTGGGCAGTTTTGACTGTAGCTGCAAAAAAGGATTCAAATTATTAACTGATGAGAAGTCTTGCCAAGATGTGGACGAGTGCTCTTTGGATAGGACCTGTGACCACAGCTGCCTCAACCACCCTGGCACATTTGCTTGTGCTTGCAATACAGGGTACACCCTCTATGGCTTCACCCACTGTGGAGACACCAACGAGTGCAGTGACAACAATGGCGGCTGTCAGCAGGTCTGTGTCAACACAGTGGGTGGCTACGAGTGCCAGTGCCATCCTGGGTACAAACTCCACTGGAACAAAAAGGATTGTGTAGAAGTGAAGGGGTTCCCACCCACTAGTGTGTTGCCCTACGTGTCCCTGCTTTGCAGTAAGAGTGGTGGAGGAGACAAGTGTTTCCTAAGATGTCATGCTGGCATTCGCCTCTCTTCAGGACTGCAAGAGGCCTACTCTGTCACCTGCGGCTCTTCTTCTCCTCTCAGAAGCAAACAGCAAAAATCCAATGACTCTGCTTTTGGGGATGTTGCCACCATCAGGACAAGTATAACCTTGAAGCTAAATGAAGGCAAGTGTAGTTTGAAAAAGGCTGAACTGTTTTCCGAGGGTCTTCAACCAGCACTACCAGAGAAGCACAGCTCAGTAAAAGAGAGCTTCCGCTATGCAAACCTTACATGCAGCTCCAGCAAGCAAGTCCCGGGAGCCCCTGGCCGACCAAGCGCCCCCAAGGAAATGTTTCTCACTGTTGAGTTTGAGCGTGAAACTTACCAAAAGGAGGTGACAGCTTCTTGTGATCTGAGCTGCATCACAAAGCGCACGGAGAAGCGGCTTCGGAAGGCGCTCCGCACGCTCAGGAAAGCTGCCCACAGGGAGCAGTTCCACCTTCAGCTCTCGGGCATGGACCTTGATGTGGCTAAAAAGTCTCCCAGAGCATCCGAGCAGCGGGCAGAGGCCTGTGGAGTGGGCCAGGGGCATGTAGAAAACCAGTGTGGTCTGTGCCAACCTGGTGAATTTTCTGTGGATGGCTTTGCACCTTGCCAGCTCTGTGCCCTGGGCACATTCCAGCCGGAAGCAGGCCGTACTTCCTGCTTCCCTTGTGGAGGAGGCCTCCCCACCAAACATCTGAGAGCTACTTCCTTCCAGGACTGTGAAACCAGAGTTCAGTGTTCACCTGGACATTTCTACAACACCACCACTCATCGGTGTATCCGCTGCCCAGCGGGGACATACCAGCCCGAATTTGGAAAAAATAACTGTGTTTCCTGCCCAGGAAATACTACGACTGACTTTGATGGCTCCACAAACATAACCCAGTGTAAAAACAGAAGATGTGGAGGGGAGCTAGGTGATTTCACAGGATACATTGAATCCCCAAACTACCCAGGCAACTACCCAGCCAACACTGAGTGCACGTGGACCATCAACCCACCCCCTAAGAGACGCATCTTGATTGTGGTCCCTGAGATCTTCCTGCCCATAGAGGATGACTGTGGAGACTACCTGGTGATGCGGAAAACTTCTTCCTCCAATTCTGTGACAACATATGAAACCTGCCAGACCTACGAACGCCCCATCGCCTTCACCTCCAGGTCAAAGAAGCTGTGGATTCAGTTTAAGTCCAACGAAGGGAACAGCGCCAAAGGGTTCCAGGTTCCGTATGTGACATACGATGAGGAAACAATTTTCACAAAGCTAATTAACCTACTGCCTAACACTGGCAAAATGTCAGAATGTTTAAATATTTTGGCCTGGTAACAAGAATTCTGTTCTCTTTAGGATAAGAAACTGATCAAGGCTCTGTTTGATGTCCTGGCCCACCCCCAGAACTATTTCAAGTACACAGCCCAGGAGTCCCGAGAGATGTTTCCAAGATCCTTCATCCGGTTGCTACGCTCCAAAGTGTCCAGATTTTTGAGGCCTTACAAATGA

XM_004851398.1 Coding sequence

LOC101700068 mitochondrial import inner membrane translocase subunit Tim8 A-like

Length: 294 bp    Location: 1350110..1349578   Strand: -
>XM_004851398.1
ATGGATTCCTCCTCTTCGTCTTCCGCGGCGGGTCTGGGCGTAGTGGACCCACAGTTGCAGCATTTCATCGAGGTGGAGACTCAGAAGCAGCGTTTCCAGCAGCTGGTGCACCAGATGACTGAACTTTGTTGGGAGAAGTGTATGGACAAGCCAGGGCCAAAGTTGGACAGTCGGGCTGAGGCCTGTTTTGTGAACTGCGTTGAGCGCTTCATCGATACAAGCCAGTTCATCTTGAATCGACTGGAACAGACCCAGAAGTCCAAGCCAGTCTTCTCAGAAAACCTTTCTGACTGA

XM_004851400.1 Coding sequence

Tmem41b transmembrane protein 41B, transcript variant X2

High confidence: 4 potential gene matches
Length: 876 bp    Location: 1450940..1418701   Strand: -
>XM_004851400.1
ATGGCGAAAGGCAGAGTCGCCGAGCGATCGCCGGCGGGCACGTTCCACACGAACCCTGTGAACGACGGGACGGCGGGGACTCGGGGGCCCGCGGCGCCGAGTAGCGGAGACCACCTGAAGGAAAAAGCCTGGGCAGAAGCTGGGTCAGCAAGAATGTCACTGCTTATATTGGTGTCCATTTTCCTGTCTGCAGCTTTTGTTATGTTTTTGGTATATAAAAATTTTCCTCAGCTTAGTGAAGAAGAAAGAATGAATATGAAGGTTCCCAGAGATATGGATGATGCCAAGGCGCTAGGAAAAGTTTTATCCAAATATAAGGACACCTTTTATGTACAAGTACTTGTAGCTTATTTTGCTACATATATTTTCTTGCAGACATTTGCTATTCCAGGCTCAATATTTCTCAGTATACTCTCAGGGTTCCTTTATCCCTTTCCACTAGCCTTGTTTCTTGTTTGTTTGTGTTCCGGACTTGGTGCCTCATTCTGCTATATGCTCTCCTATTTAGTTGGGAGACCAGTTGTATACAAATACCTAACAGAGAAAGCAGTAAAGTGGTCACAGCAGGTTGAACGTCATAGAGAACATCTCATTAACTACATTATATTTCTGAGAATAACACCATTTCTCCCTAATTGGTTTATTAATATTACATCTCCTGTGATAAACGTGCCATTGAAAGTTTTTTTTATCGGCACTTTTCTCGGTGTTGCACCTCCTTCTTTTGTAGCAATTAAAGCAGGAACAACATTGTACCAGCTTACAACAGCAGGAGAAGCTGTTTCCTGGAACTCAGTGTTTATTCTGATGATTTTAGCTGTTTTTTCTATTCTTCCAGCCATCTTCCAAAAAAAGCTAAAGCAGAAATTTGAGTGA

XM_004851403.1 Coding sequence

Ipo7 importin 7

High confidence: 4 potential gene matches
Length: 3117 bp    Location: 1519937..1593023   Strand: +
>XM_004851403.1
ATGGACCCCAACACCATTATCGAGGCCCTGCGGGGCACCATGGACCCAGCCCTGCGCGAGGCCGCGGAGCGCCAGCTCAATGAAGCACACAAGTCTCTGAATTTTGTTTCAACACTGCTCCAGATTACTATGTCAGAACAACTGGATTTACCTGTGAGACAGGCAGGTGTTATCTATTTGAAAAATATGATAACACAGTATTGGCCTGATCGGGAAACAGCACCAGGGGATATATCTCCTTATACTATACCAGAGGAAGATCGACATTGCATTCGAGAAAATATTGTAGAAGCCATTATCCACTCTCCTGAGCTCATCAGGGTACAGCTTACTACATGTATTCATCACATCATCAAGCATGATTATCCGAGCCGCTGGACTGCCATTGTGGACAAGATTGGCTTTTATCTCCAGTCTGATAACAGTGCTTGTTGGCTAGGAATTCTCCTATGTCTTTACCAGCTTGTGAAAAATTATGAGTATAAGAAACCAGAAGAGCGGAGTCCTTTGGTAGCGGCAATGCAACATTTTCTGCCAGTTCTAAAGGATCGTTTTATCCAGCTTCTTTCGGATCAGTCTGATCAGTCTGTTCTCATCCAGAAACAAATATTCAAGATCTTCTATGCTCTTGTTCAGTATACATTACCACTGGAGCTGATAAATCAACAGAACCTGACAGAATGGGTAGAAATTTTGAAGACTGTTGTGAATAGGGATGTTCCTAATGAAACACTTCAAGTTGAAGAAGATGATAGACCTGAATTACCATGGTGGAAGTGTAAGAAGTGGGCTTTACATATTTTAGCCAGGCTTTTTGAAAGATATGGAAGCCCTGGCAATGTTTCCAAGGAGTATAATGAATTTGCTGAAGTATTTCTGAAGGCATTTGCTGTTGGTGTCCAACAAGTTTTATTGAAGGTGTTATATCAGTATAAGGAGAAGCAATATATGGCTCCTCGAGTTTTACAGCAAACATTAAATTACATTAATCAAGGAGTTTCCCATGCCCTTACTTGGAAGAATCTGAAGCCTCACATACAAGGCATTATCCAAGATGTTATTTTTCCATTGATGTGCTATACAGATGCTGATGAGGAACTTTGGCAAGAAGACCCTTATGAATATATACGCATGAAGTTTGATGTCTTTGAAGATTTCATTTCTCCAACCACTGCTGCCCAGACACTTTTGTTTACAGCCTGTAGTAAGAGGAAAGAGGTATTGCAGAAGACTATGGGATTTTGTTACCAGATTCTTACAGAACCAAATGCTGATCCTCGAAAAAAAGATGGAGCCTTGCATATGATTGGCTCTTTAGCTGAAATACTTCTGAAGAAAAAGATCTACAAAGATCAGATGGAATACATGTTGCAGAATCATGTGTTTCCTCTGTTCAGCAGTGAACTAGGCTACATGAGAGCAAGGGCTTGCTGGGTACTTCACTATTTTTGTGAAGTGAAGTTCAAAAGTGATCAGAACCTACAAACAGCATTAGAGCTGACAAGAAGATGTCTGATTGATGATAGAGAAATGCCTGTTAAAGTGGAAGCGGCCATTGCACTCCAGGTGTTGATCAGCAATCAAGAAAAAGCTAAAGAATATATCACACCATTTATCAGACCTGTAATGCAGGCTCTTCTTCATATTATAAGAGAAACAGAAAATGATGATCTTACCAATGTAATTCAGAAAATGATCTGTGAATATAGTGAAGAGGTTACTCCTATTGCAGTAGAAATGACACAACATTTGGCAATGACATTTAACCAAGTAATTCAGACTGGGCCAGATGAAGAAGGAAGTGATGACAAAGCGGTTACGGCCATGGGAATTCTTAATACAATTGACACGCTTCTTAGTGTAGTTGAAGATCATAAAGAGATAACCCAGCAGCTTGAGGGAATCTGCTTACAAGTCATTGGCACTGTCTTACAACAGCATGTCTTAGAATTCTATGAGGAGATCTTTTCATTGGCACATAGTTTGACATGTCAACAAGTGTCTCCACAGATGTGGCAGCTACTGCCCCTTGTATTTGAGGTCTTTCAGCAAGATGGCTTTGATTACTTTACAGATATGATGCCTCTTCTGCATAATTATGTAACAGTTGACACAGACACACTTCTATCCGATACCAAGTATCTTGAAATGATATACAGTATGTGCAAAAAGGTTCTTACAGGAGTTGCCGGGGAAGATGCAGAGTGTCATGCTGCAAAATTGTTAGAGGTCATCATTCTACAGTGCAAAGGACGTGGCATCGACCAGTGCATTCCCTTGTTCGTGGAAGCAGCTTTAGAGAGACTGACAAGAGAGGTTAAGACAAGTGAACTTCGAACGATGTGCCTGCAAGTTGCAATTGCAGCTTTGTATTATAACCCACACCTGCTACTCAATACCTTAGAAAATCTTCGCTTCCCTAATAATGTTGAACCAGTTACAAATCATTTTATTACACAGTGGCTTAATGATGTTGACTGTTTCTTGGGGCTTCATGACAGAAAAATGTGTGTTCTGGGTCTCTGTGCTCTTATTGATATGGAACAAATACCACAAGTTTTAAATCAGGTTTCTGGACAGATTTTGCCAGCTTTTATTCTTTTGTTTAATGGATTAAAAAGAGCATATGCCTGCCATGCAGAACATGAGAATGACAGTGATGATGACGATGAAGCTGAGGATGACGATGAAACTGAGGAACTGGGGAGTGATGAAGATGATATTGATGAAGATGGGCAAGAATATTTGGAGATTTTGGCTAAGCAAGCAGGTGAAGATGTAGATGATGAAGCTTGGGAAGAAGATGATGCTGAGGAAACTGCTCTGGAAGGCTATTCCACAATCATTGATGATGAAGACAACCCTGTTGATGAGTATCAGATATTTAAAGCCATCTTTCAAACTATTCAAAATCGTAATCCTGTGTGGTATCAGGCTCTGACTCATGGTCTTAATGAAGAACAAAGAAAACAGTTACAGGACATAGCAACTCTGGCTGATCAAAGAAGAGCAGCTCATGAATCCAAAATGATTGAGAAGCATGGAGGATACAAATTCAGCGCTCCAGTTGTGCCAAGTTCTTTCAATTTTGGAGGCCCAGCACCAGGGATGAATTGA

XM_004851408.1 Coding sequence

Wee1 WEE1 homolog (S. pombe)

High confidence: 4 potential gene matches
Length: 1908 bp    Location: 1687146..1701785   Strand: +
>XM_004851408.1
ATGAGCTTTCTCAGCCGGCAGCAGCCGCCGCCTTCCCGCCGCGCCGGGGCCGCCTGCAGCTTGCGGCAGAAGCTGATCTTCTCGCCGTGCAGCGACTGTGAGGAAGAGGAGGAGGAGGAAGAGGAGGAGGAGGGCAGCGGCCACAGCACCGGCGAGGACTCGGCCTTCCAGGAGCCGGACTCACCGCTGCCTCCGGCGCGGAGCTCCGCGGAGCCCGGGCCCGAGCGCCGCCGCTCGCCCGGCCCGGCGCCCGGCAGCCCCCGGGAGCTGGAGGAGGACATGCTGCTGGAGGGCGCCAGCCCGGGCGCCGACGCGGATGCGGCGGGCGGCGGCGCCGAGGGCGACTCGTGGGAGGAGGAGGGCTTCGGCTCGTCCTCGCCGGTCAAGTCGCCGGCGGCCGCCTACTTCCTGGGCAGCGCCTTTTCTCCAGTGCGCTGCAGCGGGCGGGCGGGCGAGGGGCCCTGCTCGCCGCGGCCGGAGCAGCCGGGCACCCCGCCTCACAAGACCTTCCGCAAGCTGCGGCTCTTCGACACCCCGCATACGCCCAAGAGTTTGCTTTCCAAAGCTCGAGGAATTGATTCCAGATCTGTTAAACTCCGGGGTTCTCTTTTCATGGACACAGAAAAATCAGGAAAAAGAGAGTATGGCATACGACAGACTCCTCAAGTGAATATCAATCCTTTTACCCCGGATTCTGTGTTACTTCATTCCTCAGGACAGTGTCGTGGAAGAAAGAGAGCGTATTGGAATGATTCCTGTGAAGACATGGAAGTCAGTGATTATGAATTTGAAGATGAAACAAGACCTGCTAAAAGAATTACAATTACTGAAAGCAATATGAAGTCACGGTATACAACAGAATTTCATGAACTGGAGAAAATTGGCTCTGGAGAATTTGGTTCTGTATTTAAGTGTGTGAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTGGCTGGTTCTGTTGATGAGCAGAATGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTGGACAGCATTCTCATGTGGTTCGATATTTCTCTGCCTGGGCAGAAGATGATCATATGCTTATACAGAATGAGTATTGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAAAACTACAGAATCATGAGTTACTTTAAAGAAGTAGAATTGAAGGATCTCCTTCTGCAAGTTGGCCGAGGTTTAAGATATATTCATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTAATATTTTCATATCTCGAACTTCAATCCCGAATGCTGCCTCTGAAGAAGGAGATGAGGATGACTGGGTATCCAACAGAGTTATATTTAAAATAGGTGATCTTGGGCATGTAACAAGAATCTCTAGTCCACAAGTTGAAGAAGGTGATAGTCGTTTTCTTGCAAATGAAGTTTTACAGGAGAATTACACCCACCTACCGAAAGCGGATATTTTTGCCCTTGCCCTCACAGTTGTTTGTGCTGCTGGTGCTGAACCTCTTCCCAGAAATGGAGACCAATGGCATGAAATCAGACAGGGTAGATTACCTCGGATTCCACAAGTGCTTTCCCAGGAATTTACAGAGTTGCTAAAAGTTATGATTCATCCAGATCCAGAGAGGAGACCTTCAGCAAAGGCACTGGTAAAGCATTCAGTATTGTTGTCTGCATCTAGAAAGAGTGCAGAACAATTACGAATAGAATTGAATGCTGAAAAGTTCAAAAATTCACTTTTGCAGAAAGAACTCAAGAAGGCTCAGATGGCCAAAGCTGCAGCTGAGGAAAGAGCACTCTTCACTGACAGGATGGCCACTAGATCTACCACCCAGAGTAATAGAACCTCTCGACTTATTGGAAAGAAAATGAACCGCTCTGTCAGCCTTACTATATACTGA

XM_004851413.1 Coding sequence

Ampd3 adenosine monophosphate deaminase 3, transcript variant X1

High confidence: 4 potential gene matches
Length: 2331 bp    Location: 2542902..2586275   Strand: +
>XM_004851413.1
ATGGCCCTGTCCTCGGAGCCCGCCGAGATGCCGCGCCAGTTCCCCAAGCTGAGCATCTCAGAGGTGGATGAGCAAGTCCGGCTCCTGGCTGAGAAGGTGTTTGCTAAGGTGCTGCGAGAAGAGGACAGTAAAGATGCTCTGTCCCTCTTCACCGTCCCCGAGGACTGTCCCATCGGGCAGAAGGAAGCCAAGGAGAGGGAGCTGCAGAAGGAGCTGGCAGAGCAGAAGTCTGTGGAGACTGCGAAAAGAAAGAAAAGTTTCAAGATGATCCGATCCCAGTCCTTGTCCCTGCAAATGCCGACGCAGCAAGACTGGAAGGGTACCCCAGCGTCCAGCCCAACCATGTCTCCCGTGACCCCTGTGGTCTATGGAGCCACCTCCCAGCCCACACCTGCACCCTATGCCATGCCCGAGTACCAGCGGGTCACCATCAGCGGAGATTACTGTGCTGGGATCACTGTAGAGGACTATGAGCAGGCTGCCAAGAGCCTAGCCAAGGCCCTGATGATCCGGGAGAAGTATGCACGGCTCGCCTACCACCGCTTTCCACGGACCACGGCCCAGTACCTAGGTCATGGGGTGGCTAATGCTGCACTTCTGGACGAGGGTTTCCCGGACTTCCACCCTCCCCCACTGCCCCAGGAGGACCCTTACTGCCTGGAGGATGCACCCCCCAACCTGGGGTACCTGGTCTGCATGCGGGGGGGCATCCTCTTTGTGTATGACAACAAGCAGATGCTGGAGCGCCAGGAGCCCCACAGCCTGCCCTACCCTGACCTGGAGACCTACACAGTGGACATGAGCCACATCCTGGCCCTCATCACCGATGGCCCCACGAAAACCTATTGTCACCGGAGACTGAATTTTCTGGAATCCAAGTTCAGCCTTCATGAGATGTTAAATGAAATGTCTGAGTTCAAAGAGCTGAAGAGTAACCCCCACCGAGACTTCTATAACGTGAGAAAGGTGGACACGCACATCCATGCAGCGGCCTGCATGAACCAGAAGCACTTGCTGCGTTTCATCAAGCACACATACCAGACGGAGCCCGACAGAACTGTGGCCGAGAAGCTGGGCCAGAAGGTCACCCTGAGGCAGGTGTTCGACAGCCTTCACATGGACCCCTATGATCTCACCGTGGATTCGCTGGATGTCCATGCAGGCCGGCAGACATTCCATCGCTTTGACAAGTTCAACTCCAAATACAACCCTGTGGGGGCCAGTGAGCTCCGTGACCTGTATTTGAAAACTGAAAACTACCTGGGAGGAGAGTACTTTGCTCGGATGGTGAAGGAGGTGGCCCGGGAGCTGGAGGAGAGCAAGTACCAGTACTCAGAGCCGAGGCTCTCCATCTATGGCCGCAGCCCACAGGAGTGGCAAAACCTGGCCCGCTGGTTCATCCAGCACAAGGTCTACTCACCCAACATGCGCTGGATCATCCAGGTGCCCCGGATCTATGACATATTTAGGTCAAAGAAGCTGCTGCCAAGCTTTGGGAAGATGCTGGAGAACATCTTCCTGCCCCTTTTTAAGGCCACAATCAACCCCCAAGATCACCGGGAGCTTCACCTCTTCCTCAAATATGTGACAGGGTTTGACAGTGTGGATGATGAGTCCAAACACAGTGACCACATGTTCTCAGAGAAGAGCCCCAGCCCAGACATCTGGACCAGTGAGCAGAATCCGCCCTACAGCTACTACCTGTACTACATGTATGCCAACATCATGGTGCTCAACAATCTTCGGCGAGAACGGGGCCTGAGCACGTTCCTGTTCCGGCCTCACTGTGGGGAGGCCGGCTCCATCACCCATCTGGTGTCTGCCTTTCTCACTGCCGACAACATTTCCCATGGGCTGCTCCTCAAGAAGAGTCCAGTGCTGCAGTACCTCTACTACCTTGCCCAGATCCCCATTGCCATGTCTCCTCTTAGCAACAACAGCCTTTTCCTGGAATATTCCAAGAACCCCCTGCGGGAATTCCTGCACAAGGGGTTGCATGTCTCCCTCTCCACCGATGACCCTATGCAGTTCCACTACACGAAGGAGGCACTCATGGAGGAATACGCCATCGCTGCACAAGTGTGGAAGCTGAGCACGTGTGACCTGTGTGAGATCGCCAGGAACAGTGTGCTGCAGAGCGGCCTCTCACATCAGGAAAAGCAGAAGTTTCTAGGACAGAATTACTGTAAAGAAGGACCTGAGGGAAACGATATTCGAAAGACAAATGTTGCACAGATCCGGATGGCATTCCGATATGAGACTCTATGCAATGAGCTCAGCTTCCTGTCTGATGCCATGAAATCAGAAGAGATCACAGCCCTGAACAACTAG

XM_004851418.1 Coding sequence

Ampd3 adenosine monophosphate deaminase 3, transcript variant X6

Length: 1827 bp    Location: 2562509..2586275   Strand: +
>XM_004851418.1
ATGATCCGGGAGAAGTATGCACGGCTCGCCTACCACCGCTTTCCACGGACCACGGCCCAGTACCTAGGTCATGGGGTGGCTAATGCTGCACTTCTGGACGAGGGTTTCCCGGACTTCCACCCTCCCCCACTGCCCCAGGAGGACCCTTACTGCCTGGAGGATGCACCCCCCAACCTGGGGTACCTGGTCTGCATGCGGGGGGGCATCCTCTTTGTGTATGACAACAAGCAGATGCTGGAGCGCCAGGAGCCCCACAGCCTGCCCTACCCTGACCTGGAGACCTACACAGTGGACATGAGCCACATCCTGGCCCTCATCACCGATGGCCCCACGAAAACCTATTGTCACCGGAGACTGAATTTTCTGGAATCCAAGTTCAGCCTTCATGAGATGTTAAATGAAATGTCTGAGTTCAAAGAGCTGAAGAGTAACCCCCACCGAGACTTCTATAACGTGAGAAAGGTGGACACGCACATCCATGCAGCGGCCTGCATGAACCAGAAGCACTTGCTGCGTTTCATCAAGCACACATACCAGACGGAGCCCGACAGAACTGTGGCCGAGAAGCTGGGCCAGAAGGTCACCCTGAGGCAGGTGTTCGACAGCCTTCACATGGACCCCTATGATCTCACCGTGGATTCGCTGGATGTCCATGCAGGCCGGCAGACATTCCATCGCTTTGACAAGTTCAACTCCAAATACAACCCTGTGGGGGCCAGTGAGCTCCGTGACCTGTATTTGAAAACTGAAAACTACCTGGGAGGAGAGTACTTTGCTCGGATGGTGAAGGAGGTGGCCCGGGAGCTGGAGGAGAGCAAGTACCAGTACTCAGAGCCGAGGCTCTCCATCTATGGCCGCAGCCCACAGGAGTGGCAAAACCTGGCCCGCTGGTTCATCCAGCACAAGGTCTACTCACCCAACATGCGCTGGATCATCCAGGTGCCCCGGATCTATGACATATTTAGGTCAAAGAAGCTGCTGCCAAGCTTTGGGAAGATGCTGGAGAACATCTTCCTGCCCCTTTTTAAGGCCACAATCAACCCCCAAGATCACCGGGAGCTTCACCTCTTCCTCAAATATGTGACAGGGTTTGACAGTGTGGATGATGAGTCCAAACACAGTGACCACATGTTCTCAGAGAAGAGCCCCAGCCCAGACATCTGGACCAGTGAGCAGAATCCGCCCTACAGCTACTACCTGTACTACATGTATGCCAACATCATGGTGCTCAACAATCTTCGGCGAGAACGGGGCCTGAGCACGTTCCTGTTCCGGCCTCACTGTGGGGAGGCCGGCTCCATCACCCATCTGGTGTCTGCCTTTCTCACTGCCGACAACATTTCCCATGGGCTGCTCCTCAAGAAGAGTCCAGTGCTGCAGTACCTCTACTACCTTGCCCAGATCCCCATTGCCATGTCTCCTCTTAGCAACAACAGCCTTTTCCTGGAATATTCCAAGAACCCCCTGCGGGAATTCCTGCACAAGGGGTTGCATGTCTCCCTCTCCACCGATGACCCTATGCAGTTCCACTACACGAAGGAGGCACTCATGGAGGAATACGCCATCGCTGCACAAGTGTGGAAGCTGAGCACGTGTGACCTGTGTGAGATCGCCAGGAACAGTGTGCTGCAGAGCGGCCTCTCACATCAGGAAAAGCAGAAGTTTCTAGGACAGAATTACTGTAAAGAAGGACCTGAGGGAAACGATATTCGAAAGACAAATGTTGCACAGATCCGGATGGCATTCCGATATGAGACTCTATGCAATGAGCTCAGCTTCCTGTCTGATGCCATGAAATCAGAAGAGATCACAGCCCTGAACAACTAG

XM_004851421.1 Coding sequence

Lyve1 lymphatic vessel endothelial hyaluronan receptor 1

High confidence: 4 potential gene matches
Length: 963 bp    Location: 2648382..2635441   Strand: -
>XM_004851421.1
ATGACCAAGTGCGGCAGCCTGGTGTTGCTTCTTGCCACCATATGGACCACAGGACTTCTGGTCCAAGGTTCTGTCCAAGTAAAAGAGCTTTTTGCAACGTCATGCAGAATTATGGGAGTTGCCCTTGTGAACAAAAAGGTAGACCCACAGCTGAATTTCACAGAAGCCCAGGTGGCCTGCAAGCTTCTTGGACTAACTTTGGCCAGCAAAGCCCAAGTCGAAGCAGCACTGCTGTCTGGTTTTGAAACTTGCAGTTATGGATGGGTTGCAGAACAATACCCTGTCATCCCTCGGATTAACCAGAACCCCAAGTGTGGGAAGAATGGGAAAGGCATCCTGATTTGGAAAGCTAGAGCTCACCAAAAGTTCAGGGCCTATTGTCACAACTCATCTGATATTTGGGTTAACTCATGCGTTCCAGAAATTATCACTACCTCTGATCCCCTATTAGACTTTGAAACTGAAACCTACACTACAGACTTTACTGTCAGCGACAGCACCTACTCAGCATCAGCCCCATACTCTACGACCCTTGTTCCTTCTACCACTCCTGCTCCGGCTGCCACTTCTTCTTCACGGAGGAAAAAACTGATCTGCATCACAGAAGTTTTTACGGAAACTAGCTCCATGCCTACAGAAACGGATTCATCTGTTGAAAGTGGAGCAGGGTTCAAGAATGAAGCTGCTGGGTTTGGAGGTGTCCCCACGGCTCTGCTAGTGCTCGCTCTGCTGTTCTTCGGTGCTGCAGCTGGTCTGGCAGTCTGCTACGTCAAAAGGTATGTGAAGGCCTTCCCTTTTACAAACAAGAATCAGCAGAAGGAAATGATTGAAACCAAAGTAGTAAAGGAAGAGAAGGCAGAAGAAGGCAATCCTAATGAAGAATCAAAGAAAACTGACAAAAACCCAGAAGAGCCCAAGAGTCCACCCAAAACTACAGTACGATGCCTGGAAGCTGAAGTTTAG

XM_004851423.1 Coding sequence

Ctr9 Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)

High confidence: 4 potential gene matches
Length: 3540 bp    Location: 2823559..2851742   Strand: +
>XM_004851423.1
ATGTCTCGGGGCTCCATCGAGATTCCCCTCCGGGACACTGACGAGGTCATTGAACTTGACTTCGATCAGTTACCGGAGGGGGATGAAGTTATCAGTATTCTGAAGCAGGAACATACACAACTGCACATATGGATTGCTTTGGCGCTGGAATACTACAAGCAAGGAAAAACAGAAGAGTTTGTAAAGTTGTTGGAAGCGGCACGTATAGATGGCAATTTGGATTACAGAGACCATGAAAAAGACCAGATGACTTGCTTGGATACATTGGCAGCCTATTATGTACAACAGGCTCGGAAAGAAAAGAATAAGGACAATAAGAAGGATCTTATTACACAGGCAACCTTGTTGTATACAATGGCTGATAAAATTATTATGTATGATCAGAACCATTTACTGGGAAGAGCCTGCTTCTGCTTACTTGAAGGTGACAAAATGGATCAAGCTGATGCACAGTTTCATTTTGTACTCAACCAGTCTCCAAATAATATTCCAGCCCTTCTTGGTAAAGCTTGTATTTCATTCAACAAGAAGGATTACCGAGGAGCTCTTGCTTACTATAAAAAAGCATTGCGTACTAACCCAGGATGTCCAGCTGAAGTTCGTCTAGGAATGGGCCATTGCTTTGTGAAACTTAACAAGCTAGAGAAAGCTCGTCTGGCATTCAGCAGAGCCCTGGAACTTAACTCCAAATGTGTAGGAGCATTGGTTGGACTGGCTGTCTTAGAACTCAACAATAAAGAGGCTGATTCCATCAAAAATGGTGTCCAGCTCCTTTCCAGAGCATATACTATTGATCCCAGTAACCCTATGGTATTGAACCACTTGGCAAATCACTTTTTCTTCAAAAAGGACTACAGTAAAGTGCAGCACCTGGCTCTCCACGCCTTCCATAACACCGAAGTGGAGGCTATGCAGGCCGAGAGCTGCTACCAGCTGGCTAGGTCATTCCATGTTCAGGAAGATTATGACCAAGCTTTTCAGTACTACTATCAGGCCACACAGTTTGCCTCATCCTCTTTTGTGCTCCCGTTTTTTGGTTTGGGACAAATGTATATTTATAGAGGTGACAAAGAGAATGCATCTCAGTGCTTTGAAAAAGTTTTGAAAGCTTATCCTAACAATTATGAAACGATGAAAATTCTTGGCTCTCTTTATGCTGCATCAGAAGATCAAGAAAAAAGAGATATTGCCAAGGGCCATTTGAAGAAGGTCACAGAACAGTATCCTGATGATGTTGAGGCTTGGATTGAATTGGCACAAATCTTAGAACAGACTGATATACAGGGTGCCCTTTCAGCCTATGGAACAGCAACACGAATCCTTCAAGAGAAAGTGCAGGCTGATGTCCCCCCTGAGATCCTGAATAATGTTGGTGCCCTCCATTTTAGACTTGGGAACCTAGGAGAGGCGAAGAAATATTTTTTGGCATCATTAGATCGTGCAAAGGCAGAAGCTGAACATGATGAACATTACTATAACGCCATTTCTGTTACTACATCATACAATTTAGCCAGGCTGTATGAGGCAATGTGTGAATTCCATGAAGCAGAAAAACTGTATAAAAACATCTTACGAGAACATCCCAACTATGTTGACTGCTATTTGCGTCTAGGAGCCATGGCCAGAGATAAAGGAAATTTTTATGAGGCTTCAGATTGGTTTAAGGAAGCTCTTCAGATTAATCAGGATCATCCAGATGCTTGGTCTTTGATTGGTAATCTTCATTTGGCAAAACAAGAATGGGGTCCAGGCCAGAAGAAATTTGAGAGGATATTGAAGCAGCCGTCCACACAGAGTGACACTTACTCCATGCTAGCCCTTGGCAATGTGTGGCTCCAAACTTTGCATCAGCCCACTCGAGACCGAGAAAAGGAAAAGCGTCATCAAGATCGTGCTCTGGCCATCTACAAACAAGTTCTCAGAAATGATGCGAAGAATCTGTATGCTGCTAATGGCATAGGAGCTGTTTTGGCCCACAAAGGATATTTCCGTGAAGCTCGTGATGTATTTGCCCAAGTGAGAGAAGCAACAGCAGATATAAGTGATGTGTGGTTGAACTTAGCACACATCTACGTGGAGCAAAAGCAGTATATCAGTGCTGTTCAGATGTATGAAAACTGCCTCAGAAAATTCTATAAGCACCAAAATACTGAAGTTGTGCTCTATTTGGCCCGGGCCCTCTTCAAGTGTGGCAAATTACAGGAATGCAAGCAGACTTTGCTGAAGGCTAGACATGTTGCACCCAGTGATACAGTTCTTATGTTTAATGTGGCCTTGGTCTTGCAAAGATTAGCTACCTCTGTCCTAAAAGATGAGAAAAGTAATCTGAAGGAAGTGCTTAATGCTGTGAAAGAACTGGAGCTTGCACATAGATCCTTCAGCTACTTGAGTAAAGTGGGAGATAAAATGAGATTTGATTTGGCCCTTGCTGCTACAGAAGCCAGGCAATGCTCTGACTTACTGAGCCAGGCCCAGTACCATGTGGCCCGGGCGCGAAAACAGGATGAAGAAGAACGGGAGTTGCGGGCCAAACAAGAGCAAGAAAAGGAGCTATTAAGGCAGAAACTTCTTAAGGAACAGGAAGAGAAACGTCTCAGAGAAAAGGAAGAGCAAAAGAAACTTTTGGAACAGCGAGCCCAGTATGTGGAAAAGACCAAAAACATTCTTATGTTTACTGGAGAGACAGAAGCAACAAAAGAGAAGAAAAGAGGTGGTGGGCGGCGCTCTAAGAAAGGAGGTGAGTTTGATGAATTTGTCAACGATGACACTGATGATGACCTACCGATATCTAAAAAGAAGAAGAGGAGAAAAGGCAGCGGTAGTGAGCCAGAAGGCGAGGATGAGGAGGGTGGTGAGAGAAGGAAGAAGAAGAGGAGAAGACCTCCGAAGGGAGAAGAAGGATCTGATGATGATGAAGCAGAAAATGGCCCCAAATTGAAGAAGCGCCGTCTACCAAGAACAGAGAAGAAAAAGGCTCCCAAGCCTGAACGTCTGCCTCCTTCAATGAAGGGAAAAATAAAATCCAAAGCCATAATATCATCAAGTGATGATTCTTCAGATGAGGATAAACTGAAAATTGCTGATGAAGGACATCCCAGGCACAGCAACAGCAACAGCAACAGCGACTCAGAGGAGGACGAACGGCCCAAGAGACGCTCCTCGTCGGAGAGCGACTCTGATGAGAACCAGAACAGGTCTGGCAGCGAGGCCGGCAGTCCCCTGAGGGCCCGCAGACAGCAGTCCGAGGAGGATTCCGACAGCGACCAGGACCAGCCCTCCCAAAAGAGGAGGACCTCGGGCTCCGAGCAGTCCGACAATGAGTCTGTACAGTCAGGGAGAAGCCCCTCCGCGGCTTCGGAGAACGACTCTCGTCCGGTGTCTCCAAGTGCAGAGTCGGATCGTGAATCGGAGCGAGGCTCTGACAACGAGGGTTCCGGCCAAGGCTCTGGAAATGAGTCGGAACCGGAGGGATCCAACAACGAAGGCTCTGAGCGAGGCTCAGATCGCGGCTCAGATCGTGGCTCAGACGACAGCGACTAG

XM_004851776.1 Coding sequence

Eif4g2 eukaryotic translation initiation factor 4 gamma, 2

High confidence: 3 potential gene matches
Length: 3525 bp    Location: 2878041..2866789   Strand: -
>XM_004851776.1
ATGGCGGCCGCAAGCGGAGCCGGGCGGGGCGACCCTGTTTCAGCGTTTCTTCTACATTTCGGCGCCTGGAAATTTTGGCATATGCCCTCTTCCCGTTGCAGACAGACTGGAAGGAGAGCTGAGTCCTGGGCCCGGCTACCGCCGGATCGTGGCGGGGCCACGGAGCCCCGGTGCGATGTCGCCCAGCGGGCGAGCGAGACGGAGGCGCGCGCTGGAGCGGCGGGGTCGCGGGCAGGGCCCGGCCGTTGGCGCGGGACCGGCGAGGCGCTGGCTTCCCGGGCTCCGGCTGCCAGCGGGGAGGAGGTGTGCCGGCCTGCGGCGGGGCTGTTGAGAGGGGGCCGAACGGGGTGCGGCCCTTTGTCGCCTGAGCGGCGGCGAGGCGGCCATCCCCGGGGACCTGTGGGCGGCGGTGGCCCGAGGCGCCTTCCTGTCGGAGAACAAAGGGCCAGGCTGCGCCGGCGGGACGGCCCCGCACCTCGGCCTGGGCACCCGCGGCCTCGCTTCCCTAACTTGAGTCCCTGGGAGGATCCGCCGCTCCTTTGTTCCGGCGAAGAGCCGGGCGCAGGTTTCTGCAGCCATGTTGCGGCCGGGCGGCCCCACGCCCTCGGCGGGAGCAGGACGGGAGGAACCGCGGCCGGGCCACACGGTGACCGCGACGGGCGCTGCCACACGTGCCGGCCGGGGAGTCTAATACTGTGCTCTGTCTCTTTTCTAGGTTTTTCATTTCTGCCATCCCCTCCCCTTCCCACCCCATCCATTAATATTATTCTTTTGAAGATTCTTCGTTGTCAAGCCGCCAAAGTGGAGAGTGCGATCGCAGAAGGGGGTGCTTCTCGTTTCAGTGCTTCTTCGGGCGGAGGAGGAAGTAGGGGTGCACCTCAGCACTATCCCAAGACTGCTGGCAACAGCGAGTTCCTGGGGAAAACCCCAGGGCAAAACGCTCAGAAATGGATTCCTGCACGAAGCACTAGACGAGATGACAACTCCGCAGCAAACAACTCCGCAAATGAAAAAGAACGACATGATGCAATCTTCAGGAAAGTAAGAGGCATATTAAATAAGCTTACTCCTGAGAAGTTTGACAAGCTATGCCTTGAGCTCCTCAATGTGGGTGTAGAGTCTAAACTCATCCTTAAAGGGGTCATACTGCTGATTGTGGACAAAGCCCTAGAAGAGCCAAAGTATAGCTCACTGTATGCTCAGCTATGTCTGCGATTGGCAGAAGATGCACCAAACTTTGATGGCCCAGCAGCAGAGGGTCAACCAGGACAGAAGCAAAGCACAACATTCAGACGCCTCCTAATTTCCAAATTACAAGATGAATTTGAAAACCGAACCAGAAATGTTGATGTCTATGATAAACGTGAAAATCCCCTTCTCCCCGAGGAGGAGGAACAGAGAGCCATTGCTAAGATCAAGATGTTGGGGAACATCAAATTCATTGGAGAACTTGGCAAGCTTGATCTTATTCATGAATCTATCCTTCATAAGTGCATCAAAACACTTTTGGAAAAGAAGAAGAGAGTCCAACTCAAGGATATGGGAGAGGATTTGGAGTGCCTCTGTCAGATAATGAGGACAGTGGGACCTAGATTGGACCATGAACGAGCCAAGTCCTTAATGGATCAGTACTTTGCCAGAATGTGTTCCTTGATGTTAAGTAAGGAATTGCCAGCAAGGATTCGTTTCCTGCTGCAGGATACCGTAGAGTTGCGAGAGCACCATTGGGTTCCTCGCAAGGCTTTTCTTGACAATGGACCAAAGACGATCAATCAAATCCGTCAAGATGCAGTAAAAGATCTAGGAGTGTTTATTCCTGCTCCTATGGCTCAAGGGATGAGAAGTGACTTCTTTCTGGAGGGACCGTTCATGCCACCCAGGATGAAAATGGATAGGGACCCACTTGGAGGACTTGCTGACATGTTTGGACAAATGCCAGGTAGCGGGATTGGTACTGGTCCAGGAGTTATCCAGGATAGATTTTCACCCACCATGGGACGTCATCGGTCAAATCAACTCTTTAATGGCCATGGGGGACACATCATGCCTCCCACACAGTCACAGTTTGGAGAGATGGGAGGCAAGTTTATGAAAAGCCAGGGGCTAAGCCAGCTCTACCATAACCAGAGTCAGGGACTCTTATCCCAGCTGCAAGGACAGTCGAAGGATATGCCACCTCGGTTTTCTAAGAAAGGACAGCTTAATGCAGATGAGATTAGCTTGAGGCCTGCTCAGTCGTTCCTGATGAATAAAAATCAAGTGCCAAAGCTCCAGCCCCAGATAACTATGATTCCTCCTAGTGCACAACCACCACGCACTCAAACACCACCTCTGGGACAGACACCTCAGCTTGGTCTCAAAACTAATCCACCACTTATCCAGGAAAAGCCTGCCAAGACCAGCAAAAAGCCACCGCCATCAAAGGAAGAACTACTTAAATTAACTGAAACTGTTGTGACTGAGTATCTGAATAGTGGAAATGCAAATGAGGCTGTCAATAGTGTAAGAGAAATGAGAGCTCCTAAACATTTTCTTCCTGAGATGTTAAGCAAAGTAATCATCCTGTCACTAGACAGAAGTGATGAAGATAAAGAAAAAGCAAGTTCTTTGATCAGTTTACTCAAACAGGAAGGGATTGCCACAAGTGACAACTTCATGCAGGCTTTCCTGAATGTATTGGACCAGTGCCCCAAACTGGAGGTTGACATCCCTTTGGTGAAATCATACTTAGCACAGTTTGCAGCTCGTGCCATCATTTCAGAGCTGGTGAGCATTTCCGAACTAGCTCAACCATTGGAAAGTGGTACCCATTTTCCTCTCTTCTTACTGTGTCTTCAGCAGTTAGCTAAATTACAAGATCGAGAATGGCTAACAGAGCTTTTCCAACAAAGCAAGGTCAATATGCAGAAAATGCTTCCAGAAATTGATCAGAATAAGGATCGTATGTTGGAGATTTTGGAAGGAAAGGGACTGAGTTTCTTATTCCCACTCCTCAAATTGGAGAAGGAACTATTGAAGCAAATAAAGTTGGACCCATCCCCTCAAACCATATATAAATGGATAAAAGATAACATATCTCCCAAACTTCATGTAGATAAAGGATTTGTGAACATCTTAATGACTAGCTTCTTACAGTATATTTCTAGTGAAGTAAGCCCACCCAGCGATGAAGTGGATTCTTCCTCTGCTCCTTCCAAAGAACAGTTAGAGCAGGAAAAACAACTGCTACTTTCTTTCAAGCCAGTGATGCAGAAATTCCTTCATGATCATGTTGATCTACAGGTCAGTGCCCTGTATGCTCTGCAGGTGCACTGTTATAATAGCAACTTCCCAAAAGGCATGTTACTCCGCTTTTTTGTTCACTTCTATGACATGGAAATTATTGAAGAGGAAGCTTTCTTGGCTTGGAAAGAAGATATAACCCAAGAGTTTCCAGGAAAAGGCAAGGCTTTGTTCCAGGTGAATCAGTGGCTGACTTGGCTAGAAACTGCTGAAGAAGAAGAATCAGAGGAAGAAGCTGACTAA

XM_004851424.1 Coding sequence

Zbed5 zinc finger, BED-type containing 5, transcript variant X1

Length: 2007 bp    Location: 2929741..2926122   Strand: -
>XM_004851424.1
ATGTTTTGTACCACAAACTCATTGCCCATGGATCTTTTGCTGAAGCAAGGAAGTCTTAAACAAGAAGTAGAATCTTTTTGTTACCAAATTGTATCTGAATCAAATGATCAAAAAGTTGGAATATTACAAAGTGAAGATGAACAGTTGCAGCCTTCAGTTTCTAAAAAATCAGAAAGTGAGCTTTCCAGGGTCAAATTTATGTCTGGTTCCAATAAAATGACTACATTTAGTAAGAAACCAAAAAGGAGAAAATATGATGAAAGTTATTTATCTTTTGGATTTACTTATTTTGGAAATAGAGATGCACCTCATGCTCAGTGTGTATTATGTAAGAAAATCTTATCAAATAGCTCTTTAGCCCCAAGTAAGCTACGAAGACATTTGGAAACTAAACATGCTGCATATAAAGACAAAGACATTAGCTTTTTCAAGCAGCATCTTGATTCACCTGAAAATAATAAACCCCCAACACCTAAAATTGTCAACACAGATAACGAAAGTGCTACAGAGGCATCATACAATGTAAGTTACCATATAGCCCTGAGTGGAGAGGCTCATACTATTGGAGAATTGCTTATCAAACCTTGTGCAAAAGATGTAGTGATGCGGATGTTTGATGAACAGTATAGTAAGAAGATAGATGCAGTACAACTATCAAACAGTACCGTTGCACGTCGAATTAAGGATCTAGCTGCTGACATTGAAGAAGAGCTTGTTTGTAGACTAAAAATTTGTGATGGGTTTTCACTACAACTAGATGAATCAGCTGATGTTTCAGGACTTGCTGTGCTGCTTGTGTTTATTCGTTATAGGTTTAATAAATCTATTGAGGAAGACCTACTCTTATGTGAATCTTTGCAAAGTAATGCTACAGGTGAAGAAATATTCAATTGCATCAACAGTTTTATGCAGAAACATGAAATTGAATGGGAAAAATGTGTTGATGTTTGTAGTGATGCTTCTAGGGCAACATATGGGAAAATTGCCGAGGCTGTCACCTTGATAAAATATGTGGCTCCCGAAAGCACCAGCAGTCACTGCCTATTATATCGACATGCACTAGCAGTTAAAATAATGCCTACATCTCTTAAAAATGTGTTAGATCAAGCAGTACAAATCATCAATTACATTAAAGCTCGACCACATCAATCCAGACTACTAAAAATTTTATGTGAAGAAATGGGTGCTCAACACACGGCACTTCTTCTGAATACAGAGGTAAGGTGGCTTTCCCGAGGTAAAGTTCTTGTAAGACTTTTTGAACTTCGGCGTGAATTATTGGTTTTTATGGATTCTGCTTTTCGACTATCTGATTGTTTAACAAATTCATCTTGGCTGCTAAGACTTGCATATCTTGCAGATATTTTTACTAAATTAAATGAGGTTAATCTGTCAATGCAAGGGAAAAATGTAACAGTTTTTACAGTGTTTGATAAAATGTCATCATTGTTAAGAAAATTGGAATTTTGGGCCTCATCTGTAGAAGAAGAAAACTTTGATTGTTTTCCTACACTCAGTGACTTTTTGACTGAAATTAATTCTACAGTTGATAAAGATATTTGCAGTGCCATTGTGCAGCACCTAAGGGGTTTGCGTGCTACCCTTCTAAAATACTTTCCTGTAACAAATGACAGTAATGTGTGGGTTAGAAATCCATTTACAGTAACTGTTAAACCATCCTCATTAGTAGCACGGGATTATGAAAGCCTGATTGATTTAACATCTGATTCTCAAGTGAAACAAAATTTCAGTGAACTTTCACTAAATGATTTTTGGAGTAGCCTAATTCAAGAATACCCAAGCATAGCAAGACGTGCAGTTCGTGTGCTTCTTCCTTTTGCTACAATGCACTTGTGTGAAACAGGATTTTCATATTATGCTGCAACAAAAACAAAATATAGAAAAAGACTTGATGCTGCACCTCATATGCGGATCCGTCTTAGTAACATTACACCTAATATTAAACGGATATGCGATAAAAAGACACAAAAACATTGTTCTCATTAA

XM_004851426.1 Coding sequence

Galnt18 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18

High confidence: 4 potential gene matches
Length: 1824 bp    Location: 3667943..3328377   Strand: -
>XM_004851426.1
ATGGTGTGCACCAGGAAGACCAAAACTTTGGTGTCCACTTGCGTGATCCTGAGCGGCATGACCAACATCATATGCCTGCTCTACGTGGGCTGGGTCACCAACTACATCGCCAGCGTGTATGTGCGGGGGCAGGAACCGGCGCCGGACAAGAAGCTGGAGGAAGACAAAGGGGATACTCTGAAGATTATTGAGCGGCTGGACCACCTGGAGAATGTCATCAAGCAGCACATCCAAGAGGCCCCTGCCAAGCCTGAGGAGGCAGAGGCTGAGCCCTTCACAGACTCCTCACTGTTCGCACACTGGGGCCAGGAGCTCAGCCCTGAAGGCCGGCGCGTGGCCCTGAAGCAGTTCCAGTACTACGGCTACAATGCCTACCTCAGCGACCGCCTGCCCCTCAACAGGCCCCTACCGGACCTCAGACCCAGTGGGTGCCGAAACCTGTCGTTCCCCAACAGCTTGCCGGAGGTGAGCATTGTGTTCATTTTTGTCAACGAGGCTCTCTCAGTGCTGCTGCGCTCCATCCACTCCGCCATCGAGCGCACACCCTCACACCTGCTCAAGGAGATCATCCTGGTGGACGACAACAGCAGCAATGAGGAGCTGAAGGAGAAGCTGACGGAGTACGTGGACAAGGTGAACAGCCAGAAGCCAGGCTTCATCAAGGTCGTGCGCCACAACAAGCAGGAAGGCCTCATCCGCTCCAGGGTCAGCGGCTGGCGGGCAGCCACTGCCCCTGTGGTGGCGCTCTTTGATGCCCATGTGGAGTTCAATGTGGGCTGGGCTGAACCAGTACTCACCCGAATAAAGGAGAATCGGAAGCGGATCATCTCACCATCCTTTGATAACATTAAATATGACAACTTTGAGATAGAAGAGTACCCACTGGCTGCCCAGGGCTTTGACTGGGAGCTGTGGTGCCGCTACTTAAATCCTCCCAAGGCCTGGTGGAAGCTGGAGAACTCCACTGCCCCAATCAGGAGCCCCGCCCTCATTGGCTGCTTCATTGTGGACCGCCAGTATTTCCAGGAGATCGGCCTGCTGGACGAAGGCATGGAGGTCTATGGAGGCGAGAATGTCGAGCTCGGGATCAGGGTATGGCAGTGTGGTGGCAGCGTGGAGGTCCTGCCCTGTTCGCGGATCGCCCACATCGAGCGAGCCCACAAGCCCTACACTGAGGACCTCACTGCGCATGTCCGCAGGAATGCCCTCAGGGTGGCTGAAGTCTGGATGGATGAATTTAAAAGTCATGTCTACATGGCCTGGAACATACCCCAAGAGGACTCAGGAATTGACATCGGGGACATCACTGCAAGAAAAGCTCTGAGGAAGCAGCTTCAATGCAAAACCTTCCGATGGTACCTGGTCAGCGTGTATCCAGAGATGAGGATGTATTCTGACATCATTGCCTACGGGGTGCTGCAGAATTCCCTGAAGACAGATTTGTGTCTTGACCAGGGGCCAGACACAGAGAATGTCCCCATCATGTACATCTGCCACGGCATGACGCCCCAGAACGTGTACTATACAAGCAGTCAGCTGATCCACGTGGGTGTCCTGAGCCCCACAGTGGATGACGATGACAATCGGTGCCTGGTGGATGTGAACAGCCGGCCTCGGCTCATCGAATGCAGCTACGCCAAAACCAAGAGGATGAAGCTCCACTGGCAATTCTCTCAGGGAGGCCTCATCCAGAACCGCAAGTCCAAGCGCTGCCTGGAGCTGCAGGAGAACAGCGACACGGAGTTTGGCTTCCAGCTGGTGCTGCAGAAGTGCTCGGGCCAGCACTGGAGCATCACCAACGTCCTGAGGAGCCTGGCCTCCTGA

XM_004851427.1 Coding sequence

Usp47 ubiquitin specific peptidase 47, transcript variant X1

High confidence: 4 potential gene matches
Length: 4128 bp    Location: 3913066..4035991   Strand: +
>XM_004851427.1
ATGGTGCCCGGCGAGGAGAACCAGCTGGTCCCGAAAGAGGATGTGTTTTGGAGATGCAGACAAAATATCTTTGATGAAATGAAGAAGAAATTTTTACAGATAGAAAATGCTGCTGAAGAACCTAGAGTCTTGTGTATAATACAAGATACAACTAATTCAAAGACAGTGAATGAACGGATCACTTTAAATTTACCAGCATCTACTCCAGTCAGGAAGCTCTTTGAAGATGTAGCCAACAAAGTAGGCTACATAAATGGAACCTTTGATTTGGTGTGGGGAAATGGAATCAATACTGCTGATATGGCTCCACTGGATCATACCAGTGACAAGACTCTTCTTGATGCTAATTTTGAGCCAGGAAAGAAGAACTTTCTGCATTTGACAGATAAAGATGGTGAACAGCCACAAATACTGCTGGAGGATTCCAGTAATGTGGATGACAGTGTTCACGACAGGTTTATCGGTCCACTTCCAAGAGAAGGTTCTGTGGGCTCCACCAGTGATTATGTCAGCCAAAGTTACTCCTATTCATCTATTTTGAATAAGTCAGAAACTGGTTATGTGGGATTAGTAAACCAGGCAATGACTTGCTATTTGAATAGCCTTTTGCAAACACTTTTTATGACTCCTGAATTTAGGAATGCATTATATAAGTGGGAATTTGAAGAATCTGAAGAAGATCCAGTGACAAGTATTCCATACCAACTTCAAAGGCTTTTTGTTTTGTTACAAACCAGCAAAAAGAGAGCAATCGAAACCACAGATGTTACAAGGAGCTTTGGATGGGATAGTAGTGAGGCTTGGCAACAGCATGATGTACAAGAATTATGCCGAGTCATGTTTGATGCTTTGGAACAGAAATGGAAGCAAACAGAACAGGCTGATCTTATAAATGAATTATACCAAGGCAAGCTGAAGGACTACGTGAGATGTCTGGAGTGTGGTTATGAGGGCTGGAGGATCGACACATATCTTGATATTCCATTGGTCATCCGACCTTATGGGTCCAGCCAAGCATTTGCTAGTGTGGAAGAAGCATTGCATGCATTTATTCAGCCAGAGATCTTGGATGGCCCAAATCAGTATTTTTGTGAACGTTGTAAAAAAAAGTGTGATGCTAGAAAGGGCCTTCGGTTTTTGCATTTCCCTTATCTGCTGACCTTACAGTTGAAAAGGTTTGATTTTGATTATACAACCATGCATAGGATTAAATTGAATGATCGAATGACATTTCCAGAGGAGCTAGATATGAGTATATTTATTGATGTTGAAGATGAGAAATCTCCTCAGACTGAAAGTTGCACTGACAGTGGAGCAGAAAATGAAGGTAGCTGTCATAGTGACCAGATGAGCAATGATTTCTCTAATGACGATGGTGTGGATGAAGGAATCTGCCTTGAGAACAACAGTGGAACTGAAAAGATTTCAAAACCTGGTCTTGAAAAGAATTCCTTGATCTATGAGCTCTTCTCTGTCATGGTTCATTCAGGAAGTGCTGCTGGTGGCCACTATTATGCTTGCATAAAGTCTTTCAGTGATGAGCAGTGGTACAGCTTCAATGATCAGCATGTCAGCAGGATAACACAAGAGGACATTAAGAAAACACATGGTGGATCGTCGGGAAGCAGAGGATATTATTCCAGTGCTTTTGCCAGCTCAACAAATGCATATATGCTGATATATAGGCTGAAGGATCCAACAAGAAATGCAAAATTTCTAGAGGTGGATGAATACCCCGAACATATTAAAAGCTTGGTACAGAGAGAGAGAGAATTGGAAGAACAAGAAAAGAGGCAACGAGAAATAGAGCGTAATACATGCAAGATAAAATTATTCTGTTTGCATCCTGTGAAACAAGTAATGATGGAAAACAAATTGGAAGTTCATAAGGATAAGACATTAAAGGAAGCAGTAGAAATGGCTCATAAGATGATGGATTTAGAAGAGGTAATACCTCTGGAGTGCTCTCGCCTTGTTAAATATGATGAGTTTCATGATTACCTAGAACGATCATACGAAGGGGAAGAAGATACACCAATGGGACTTCTCCTAGGTGGGGTCAAGTCAACATATATGTTTGATCTGCTATTGGAGACAAGAAAGCCTGATCAAGTTTTCCAGTCTTACAAACCAGGAGAAGTGATGGTGAAAGTTCATGTTGTTGATCTAAAGGCGGAAACTGTAGCTGTTCCTATAACTGTTCGTGCTTACTTAAATCAAACAGTTACAGAATTCAAACAACTGATTTCAAAGGCCGTCCATTTACCTGCTGAAACCATGAGAATAGTGCTGGAACGCTGCTATAATGATTTGCGTCTCCTCAGTATGCCCAGTAAAACTCTGAAAGCTGAAGGTTTTTTTAGAAGTAACAAGGTGTTTGTTGAAAGTTCTGAGACTTTGGATTACCAGATGGCCTTTACAGACTCTCATTTATGGAAACTCCTGGATCGACATGCAAATACAATCAGGTTATTTGTTTTGCTACCTGAACAATCCCCAGGATCTTATTCCAAAAGGATGGCATACCAGAAAGCAGGAGGTGATTCTGGTAATGCGGAAGATGATTGTGAAAGAGACAAAGGACCTGTGGGGAACCTAAAGTCTGTGGAAGCTATTCTAGAAGAAAGCACGGAAAAACTCAAAAGCTTGTCATTGCAGCAACAGCAGGATGGTGATAATGGGGACAGCAGCAAAAGCACAGAGACAAGTGACTTTGAAAACATCGAATCACCTCTCAATGAGAGAGACTCTTCAGCATCAGTGGACAATAGAGAACTTGAACAGCACATTCAGACTTCTGACCCAGAAAATTTTCAGTCTGAAGAACGGTCAGACTCAGATGTGAATAATGACAGGAGTACAAGTTCAGTGGACAGCGACATTCTTAGCTCCAGTCACAGCAGTGACACTTTGTGCAATGCGGATAATGCTCACATCCCTTTGGCTAATGGACTTGAGTCTCACAGTATCACAAGTAGTAGAAGAACTAAAGCAAATGAAGGGAAAAAAGAGACGTGGGATACAGCAGAAGAAGACTCAGGCACTGATAGTGAATATGATGACAGTGGCAAAAGTAGGGGAGAAATGCAGTACATGTATTTCAAAGCAGAGCCCTATGCTGCAGATGAAGGTTCTGGGGAAGGACATAAATGGTTGATGGTGCATGTTGATAAAAGAATTACTCTGGCAGCTTTCAAACAACATTTAGAACCTTTTGTTGGAGTTTTATCCTCTCACTTCAAGGTCTTTCGAGTGTATGCCAGCAATCAAGAATTTGAGAGCGTCCGACTGAATGAGACACTTTCATCATTTTCAGATGACAATAAGATTACAATTAGACTGGGGAGAGCACTTAAAAAAGGAGAATACAGAGTTAAAGTGTACCAGCTGTTAGTCAATGAGCAAGAGCCATGCAAGTTTCTGCTTGATGCTGTGTTTGCTAAAGGAATGACTGTACGGCAATCAAAAGAGGAATTAATTCCTCAACTCAGGGAGCAGTGTGGCTTAGAGCTCAGTATTGACAGGTTTCGTCTAAGGAAAAAAACATGGAAGAATCCTGGCACTGTCTTTTTGGATTATCATATTTATGAAGAAGATATTAATATTTCCAGCAACTGGGAAGTTTTCCTTGAAGTTCTTGATGGGGTGGAGAAGATGAAGTCCATGTCACAGCTTGCTGTTTTATCACGACGGTGGAGGCCCTCAGAGATGAAGTTGGATCCCTTCCAGGAGGTTGTATTGGAGAGCAGTAGTGTTGATGAGTTGCGAGAGAAGCTTAGTGAAATCAGTGGGGTTCCTTTGGAAGATATTGAATTTGCCAAGGGTAGAGGAACTTTTCCCTGTGATATTTCTGTGCTTGATATTCATCAGGATTTGGACTGGAATCCTAAAGTTTCTACCCTGAATGTCTGGCCTCTTTATATCTGTGATGATGGTGCAGTCATATTTTATAGGGATAAAACAGAAGAAGTAATGGAGTTGACAGATGAGCAAAGAAATGAACTGATGAAAAAAGAAAGCAGTCGACTCCAGAAGACTGGACATCGTGTAACATACTCACCTCGTAAGGAGAAAGCACTAAAAATATATCTGGATGGAGCTCCAAATAAAGATCTGACACAAGACTGA

XM_004851443.1 Coding sequence

Tead1 TEA domain family member 1 (SV40 transcriptional enhancer factor), transcript variant X5

Length: 1311 bp    Location: 4694373..4928301   Strand: +
>XM_004851443.1
ATGGAAAGGATGAGTGACTCTACAGATAAGCCGATTGACAATGACGCGGAAGGGGTCTGGAGCCCCGACATTGAGCAGAGCTTTCAGGAGGCCCTGGCTATCTATCCGCCATGTGGGCGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAATGAATTGATAGCCAGATACATCAAACTCAGGACAGGGAAGACGAGGACCAGAAAGCAGGTGTCTAGTCATATACAGGTCTTAGCAAGAAAGAAAGTTCGAGAAATTCAAGCCGCCATTAAGGTGTCTAGTCACATTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGTAACAAGCATGGATCAGACTGCAAAGGACAAGGCCCTGCAGCACATGGCCGCCATGTCGTCAGCCCAAATCGTCTCTGCCACTGCCATTCACAACAAGCTGGGGCTGCCTGGGATCCCACGCCCCACCTTCCCAGGGGCGCCGGGGTTTTGGCCTGGAATGATACAAACAGGGCAGCCAGGATCCTCACAAGATGTCAAGCCCTTTGTGCAGCAGGCCTACCCCATCCAGCCCGCGGTCACGGCCCCCATTCCAGGGTTTGAGCCTCCGTCCGCCCCAGCTCCCTCTGTCCCTGCCTGGCAGGGCCGCTCCATTGGCACAACCAAGCTTCGCCTGGTGGAATTCTCAGCTTTCCTCGAACAGCAGCGAGACCCAGACTCGTACAACAAACACCTCTTCGTGCACATCGGGCATGCCAACCATTCTTACAGTGACCCATTGCTCGAATCAGTGGATATACGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTATTTGGAAAGGGCCCTCAAAATGCCTTCTTCCTTGTAAAATTCTGGGCCGACTTAAACTGCAATATTCAAGATGATGCTGGGGCTTTTTATGGTGTAACCAGTCAGTATGAAAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTGTGCTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACAGAGTATGCAAGGTTCGAGAATGGCCGATTTGTATACCGAATAAACCGCTCCCCGATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACAAGAAACTCTCCTCTGCATGGCCTGTGTATTTGAAGTTTCAAATAGTGAACATGGAGCACAACATCATATTTACAGGCTTGTAAAGGACTGA

XM_004851428.1 Coding sequence

Usp47 ubiquitin specific peptidase 47, transcript variant X2

Length: 4068 bp    Location: 3913066..4035991   Strand: +
>XM_004851428.1
ATGGTGCCCGGCGAGGAGAACCAGCTGGTCCCGAAAGAGATAGAAAATGCTGCTGAAGAACCTAGAGTCTTGTGTATAATACAAGATACAACTAATTCAAAGACAGTGAATGAACGGATCACTTTAAATTTACCAGCATCTACTCCAGTCAGGAAGCTCTTTGAAGATGTAGCCAACAAAGTAGGCTACATAAATGGAACCTTTGATTTGGTGTGGGGAAATGGAATCAATACTGCTGATATGGCTCCACTGGATCATACCAGTGACAAGACTCTTCTTGATGCTAATTTTGAGCCAGGAAAGAAGAACTTTCTGCATTTGACAGATAAAGATGGTGAACAGCCACAAATACTGCTGGAGGATTCCAGTAATGTGGATGACAGTGTTCACGACAGGTTTATCGGTCCACTTCCAAGAGAAGGTTCTGTGGGCTCCACCAGTGATTATGTCAGCCAAAGTTACTCCTATTCATCTATTTTGAATAAGTCAGAAACTGGTTATGTGGGATTAGTAAACCAGGCAATGACTTGCTATTTGAATAGCCTTTTGCAAACACTTTTTATGACTCCTGAATTTAGGAATGCATTATATAAGTGGGAATTTGAAGAATCTGAAGAAGATCCAGTGACAAGTATTCCATACCAACTTCAAAGGCTTTTTGTTTTGTTACAAACCAGCAAAAAGAGAGCAATCGAAACCACAGATGTTACAAGGAGCTTTGGATGGGATAGTAGTGAGGCTTGGCAACAGCATGATGTACAAGAATTATGCCGAGTCATGTTTGATGCTTTGGAACAGAAATGGAAGCAAACAGAACAGGCTGATCTTATAAATGAATTATACCAAGGCAAGCTGAAGGACTACGTGAGATGTCTGGAGTGTGGTTATGAGGGCTGGAGGATCGACACATATCTTGATATTCCATTGGTCATCCGACCTTATGGGTCCAGCCAAGCATTTGCTAGTGTGGAAGAAGCATTGCATGCATTTATTCAGCCAGAGATCTTGGATGGCCCAAATCAGTATTTTTGTGAACGTTGTAAAAAAAAGTGTGATGCTAGAAAGGGCCTTCGGTTTTTGCATTTCCCTTATCTGCTGACCTTACAGTTGAAAAGGTTTGATTTTGATTATACAACCATGCATAGGATTAAATTGAATGATCGAATGACATTTCCAGAGGAGCTAGATATGAGTATATTTATTGATGTTGAAGATGAGAAATCTCCTCAGACTGAAAGTTGCACTGACAGTGGAGCAGAAAATGAAGGTAGCTGTCATAGTGACCAGATGAGCAATGATTTCTCTAATGACGATGGTGTGGATGAAGGAATCTGCCTTGAGAACAACAGTGGAACTGAAAAGATTTCAAAACCTGGTCTTGAAAAGAATTCCTTGATCTATGAGCTCTTCTCTGTCATGGTTCATTCAGGAAGTGCTGCTGGTGGCCACTATTATGCTTGCATAAAGTCTTTCAGTGATGAGCAGTGGTACAGCTTCAATGATCAGCATGTCAGCAGGATAACACAAGAGGACATTAAGAAAACACATGGTGGATCGTCGGGAAGCAGAGGATATTATTCCAGTGCTTTTGCCAGCTCAACAAATGCATATATGCTGATATATAGGCTGAAGGATCCAACAAGAAATGCAAAATTTCTAGAGGTGGATGAATACCCCGAACATATTAAAAGCTTGGTACAGAGAGAGAGAGAATTGGAAGAACAAGAAAAGAGGCAACGAGAAATAGAGCGTAATACATGCAAGATAAAATTATTCTGTTTGCATCCTGTGAAACAAGTAATGATGGAAAACAAATTGGAAGTTCATAAGGATAAGACATTAAAGGAAGCAGTAGAAATGGCTCATAAGATGATGGATTTAGAAGAGGTAATACCTCTGGAGTGCTCTCGCCTTGTTAAATATGATGAGTTTCATGATTACCTAGAACGATCATACGAAGGGGAAGAAGATACACCAATGGGACTTCTCCTAGGTGGGGTCAAGTCAACATATATGTTTGATCTGCTATTGGAGACAAGAAAGCCTGATCAAGTTTTCCAGTCTTACAAACCAGGAGAAGTGATGGTGAAAGTTCATGTTGTTGATCTAAAGGCGGAAACTGTAGCTGTTCCTATAACTGTTCGTGCTTACTTAAATCAAACAGTTACAGAATTCAAACAACTGATTTCAAAGGCCGTCCATTTACCTGCTGAAACCATGAGAATAGTGCTGGAACGCTGCTATAATGATTTGCGTCTCCTCAGTATGCCCAGTAAAACTCTGAAAGCTGAAGGTTTTTTTAGAAGTAACAAGGTGTTTGTTGAAAGTTCTGAGACTTTGGATTACCAGATGGCCTTTACAGACTCTCATTTATGGAAACTCCTGGATCGACATGCAAATACAATCAGGTTATTTGTTTTGCTACCTGAACAATCCCCAGGATCTTATTCCAAAAGGATGGCATACCAGAAAGCAGGAGGTGATTCTGGTAATGCGGAAGATGATTGTGAAAGAGACAAAGGACCTGTGGGGAACCTAAAGTCTGTGGAAGCTATTCTAGAAGAAAGCACGGAAAAACTCAAAAGCTTGTCATTGCAGCAACAGCAGGATGGTGATAATGGGGACAGCAGCAAAAGCACAGAGACAAGTGACTTTGAAAACATCGAATCACCTCTCAATGAGAGAGACTCTTCAGCATCAGTGGACAATAGAGAACTTGAACAGCACATTCAGACTTCTGACCCAGAAAATTTTCAGTCTGAAGAACGGTCAGACTCAGATGTGAATAATGACAGGAGTACAAGTTCAGTGGACAGCGACATTCTTAGCTCCAGTCACAGCAGTGACACTTTGTGCAATGCGGATAATGCTCACATCCCTTTGGCTAATGGACTTGAGTCTCACAGTATCACAAGTAGTAGAAGAACTAAAGCAAATGAAGGGAAAAAAGAGACGTGGGATACAGCAGAAGAAGACTCAGGCACTGATAGTGAATATGATGACAGTGGCAAAAGTAGGGGAGAAATGCAGTACATGTATTTCAAAGCAGAGCCCTATGCTGCAGATGAAGGTTCTGGGGAAGGACATAAATGGTTGATGGTGCATGTTGATAAAAGAATTACTCTGGCAGCTTTCAAACAACATTTAGAACCTTTTGTTGGAGTTTTATCCTCTCACTTCAAGGTCTTTCGAGTGTATGCCAGCAATCAAGAATTTGAGAGCGTCCGACTGAATGAGACACTTTCATCATTTTCAGATGACAATAAGATTACAATTAGACTGGGGAGAGCACTTAAAAAAGGAGAATACAGAGTTAAAGTGTACCAGCTGTTAGTCAATGAGCAAGAGCCATGCAAGTTTCTGCTTGATGCTGTGTTTGCTAAAGGAATGACTGTACGGCAATCAAAAGAGGAATTAATTCCTCAACTCAGGGAGCAGTGTGGCTTAGAGCTCAGTATTGACAGGTTTCGTCTAAGGAAAAAAACATGGAAGAATCCTGGCACTGTCTTTTTGGATTATCATATTTATGAAGAAGATATTAATATTTCCAGCAACTGGGAAGTTTTCCTTGAAGTTCTTGATGGGGTGGAGAAGATGAAGTCCATGTCACAGCTTGCTGTTTTATCACGACGGTGGAGGCCCTCAGAGATGAAGTTGGATCCCTTCCAGGAGGTTGTATTGGAGAGCAGTAGTGTTGATGAGTTGCGAGAGAAGCTTAGTGAAATCAGTGGGGTTCCTTTGGAAGATATTGAATTTGCCAAGGGTAGAGGAACTTTTCCCTGTGATATTTCTGTGCTTGATATTCATCAGGATTTGGACTGGAATCCTAAAGTTTCTACCCTGAATGTCTGGCCTCTTTATATCTGTGATGATGGTGCAGTCATATTTTATAGGGATAAAACAGAAGAAGTAATGGAGTTGACAGATGAGCAAAGAAATGAACTGATGAAAAAAGAAAGCAGTCGACTCCAGAAGACTGGACATCGTGTAACATACTCACCTCGTAAGGAGAAAGCACTAAAAATATATCTGGATGGAGCTCCAAATAAAGATCTGACACAAGACTGA

XM_004851431.1 Coding sequence

Mical2 microtubule associated monooxygenase, calponin and LIM domain containing 2, transcript variant X1

Length: 3300 bp    Location: 4167503..4300527   Strand: +
>XM_004851431.1
ATGGGCGAGAATGAGGATGAGAAGCAGGCCCAGGCGGGGCAGGTTTTTGAGAACTTTGTCCAGGCTTCCACGTGCAAAGGCACCCTCCAGGCCTTCAACATCCTCACGCGCCACCTGGACCTAGACCCTCTGGACCACAGGAACTTCTACTCCAAGCTCAAGTCCAAGGTGACCACCTGGAAGGCCAAAGCCCTGTGGTACAAACTGGACAAGCGTGGCTCCCACAAAGAGTACAAGCGAGGGAAGGCGTGCATGAACACCAAGTGTCTCATTGTTGGCGGAGGACCCTGTGGCTTGCGCACTGCCATTGAACTCGCCTACCTGGGAGCCAAAGTGATCGTGGTAGAGAAAAGGGACACCTTCTCCCGGAACAATGTGCTGCACCTCTGGCCTTACACCATCCATGACCTGCGGGGCCTGGGAGCCAAGAAGTTCTATGGGAAGTTCTGCGCTGGCTCCATCGACCACATCAGTATTCGTCAACTGCAGCTCATCCTATTCAAGGTGGCCCTGATGTTGGGAGTTGAAATCCATGTGAATGTGGAGTTTGTGAAGGTTCTCGAACCTCCTGAAGATCAAGAAAATCAAAAAATTGGCTGGAGAGCAGAACTCCTCCCCGCAGACCACCCCCTGTCAGAGTTTGAGTTTGATGTCATCATTGGTGCTGATGGCCGCAGGAACACCCTGGAAGGGTTCAGGAGGAAGGAATTCCGCGGGAAGCTGGCCATCGCCATCACCGCCAACTTCATCAACAGGAACAGCACGGCTGAGGCCAAGGTGGAAGAGATTAGCGGGGTGGCCTTCATCTTCAATCAGAAATTCTTTCAGGACCTGAAGGAGGAAACAGGGATTGATCTAGAGAACATTGTTTACTACAAGGACTGCACCCACTATTTTGTCATGACTGCCAAGAAGCAGAGCCTGCTCGACAAAGGTGTCATCATCAATGACTACATCGACACGGAGATGCTGCTGTGTGCTGAGAACGTGAACCAGGACAACCTGCTGTCCTATGCCCGGGAAGCTGCAGACTTCGCCACCAACTACCAGCTGCCATCCTTAGACTTTGCTATGAACCACTACGGGCAGCCCGACGTGGCCATGTTTGATTTCACCTCCATGTATGCCTCAGAGAATGCTGCCCTGGTGCGCGAACGGCAGGGACACCCGCTGCTCGTGGCCCTTGTGGGCGACAGCTTGCTTGAGCCATTTTGGCCCATGGGTACAGGCTGTGCCCGTGGCTTCCTGGCGGCCTTTGACACAGCGTGGATGGTGAAGAGCTGGGACCAGGGGACTCCTGCCCTGGAAGTGCTGGCCGAAAGAGAAAGTCTTTACCGGCTGTTGCCTCAGACAACCCCGGAGAACATCAACAAGAACTTTGAGCAGTACACGCTGGACCCAGGGACGCGGTACCCAAACCTCAACTCACACTGTGTCCGGCCCCATCAGGTGAAGCATCTGTACATCACCAAGGAGCTGGACCACTACCCTCTTGAGAGACTCAACTCAATGAGGAGATCCGTCAACCTCTCCAGGCGGGAGTCAGATATCCGGCCCAGCAAGCTCTTAACCTGGTGCCAGCAGCAGACCAAGGGCTACCAGCATGTCAATGTCACTGACCTGACCACATCCTGGCGTAGCGGCCTGGCCCTCTGTGCCATCATCCACCACTTCCGGCCGGAGCTGATCAACTTTGACTCTTTGAATGAAGATGATGCTGTAAAGAACAACCAGCTGGCATTTGATGTGGCCGAACATGAGTTTGGGATCCCTCCGGTGACCACAGGCAAAGAGATGGCATCAGCCCAGGAGCCTGACAAGCTCAGCATGGTCATGTACCTCTCCAAGTTCTATGAGCTCTTCCGGGGCGCCCCGCTGCGGCCTGTGGATTCTTGGCGCAAAAGCTATGGAGAAAATGCCGACCTCAGTTTTTCCAAATCCTCCATTTCTAATAACTATCTCAACCTCACACTTCCCAGGAAAAGGACCCCTCGGGGAGATGCCCAAACGGAAGAGAACGACGTGAACAAGCGGAGGCGGAAAGGCTTCATCACCGTGGACCAGGATTGTGTGCGCAGGCTGCCAACCTTCTCCAGCCATAGTTTGGGTTCCTCTCAAGAGTGCGGCAACAGTAAGGAAGCAGGAAATCAGAACAAAGTCAAGTCCATGGCGAGTCAGCTGCTGGCCAAGTTTGAGGAGAGCACACGGAACCCCTCAGTCCTGAGGCAGGAGCGCCGTGTCTCAGGGATAGGTAACCCCGTCCTGTGCTCTTCCGCTGACCCTCCTGTAGACTCGCACTGCCCCACGCCGAAGGAGCCCACTCCCAGCCCACCGCCTCCTCTGAAAAGGCAGGTGCTCAGGGAGCTCAAGCAGGTGTCTCCTGGTGGCGAGTGTCCAAGCCGGCCCTGGAGAGCCAGGGCCAAGTCTGACCTGCAGCTCAGTGGCCCAGAAAACCTTGCCTCCCTGCCTCCCGCTTGCCAGGGGGCCCTGGCCCTCTCGGGGGTACTGCGGCGGCTACAGCAAGTGGAGGAAAAGATTCTCCAGAAGAGGTCTCAGAACTTGGCCAACAGGGAATTTCACCAAAAGAACATTAAAGAGAAAGCGGCTCACCTCGCCTCCATGTTTGGACACGGGGATTTCCCACAGAATAAACTACTCTCTAAAGGCCTGTCTCATACTCATCCTCCATCTTCTTCCTCTTGCCTTCCGTCTCCTGATCCAGCTGCTACTTCTACTCCATCAACTGTTGACTCTGCTTCTCCTGCCAGAAAGCTGACAGTAGGGAAAGTGTCCAGCGGAATAGGGGCTGCGGCTGAAGTCCTGGTCAATCTGTACTTGAATGATCACAGACCTAAGGCCCAGGCCACCTCTCCAGACCTGGAATCTATGCGGAAGACAATTCCCCTGAACCTGGGCGGCAGTGACACCTGCTACTTCTGTAAGAAGCGTGTGTATGTGATGGAGCGGCTGAGTGCTGAGGGCCACTTCTTCCACCGAGAGTGCTTCCGCTGCAGCATCTGTGCCACTACCTTGCGCCTGGCCACCTACGCCTTTGACTGTGAAGAAGGCAAGTTTTACTGCAAGCCTCATTTTATTCACTGTAAAACCAACAGCAAACAACGGAAGAGATGGACAGAGTTGAAGCAAGAAAGAGAGGAGGAGAGGACGTGGCAAGAGCCAGAAGCCCCTCGGCGAGATGCTGCCACGGAAAGCTCTTGCGCAGTGGCTGCCATCAGCACAGCAGAAGGCAGCCCTCCAGTTCATTTCAGCCTTCCAGTACTACACCCACTCCTTGGCTGA

XM_004851435.1 Coding sequence

Mical2 microtubule associated monooxygenase, calponin and LIM domain containing 2, transcript variant X5

Length: 3198 bp    Location: 4167503..4300527   Strand: +
>XM_004851435.1
ATGGGCGAGAATGAGGATGAGAAGCAGGCCCAGGCGGGGCAGGTTTTTGAGAACTTTGTCCAGGCTTCCACGTGCAAAGGCACCCTCCAGGCCTTCAACATCCTCACGCGCCACCTGGACCTAGACCCTCTGGACCACAGGAACTTCTACTCCAAGCTCAAGTCCAAGGTGACCACCTGGAAGGCCAAAGCCCTGTGGTACAAACTGGACAAGCGTGGCTCCCACAAAGAGTACAAGCGAGGGAAGGCGTGCATGAACACCAAGTGTCTCATTGTTGGCGGAGGACCCTGTGGCTTGCGCACTGCCATTGAACTCGCCTACCTGGGAGCCAAAGTGATCGTGGTAGAGAAAAGGGACACCTTCTCCCGGAACAATGTGCTGCACCTCTGGCCTTACACCATCCATGACCTGCGGGGCCTGGGAGCCAAGAAGTTCTATGGGAAGTTCTGCGCTGGCTCCATCGACCACATCAGTATTCGTCAACTGCAGCTCATCCTATTCAAGGTGGCCCTGATGTTGGGAGTTGAAATCCATGTGAATGTGGAGTTTGTGAAGGTTCTCGAACCTCCTGAAGATCAAGAAAATCAAAGGTTCAGGAGGAAGGAATTCCGCGGGAAGCTGGCCATCGCCATCACCGCCAACTTCATCAACAGGAACAGCACGGCTGAGGCCAAGGTGGAAGAGATTAGCGGGGTGGCCTTCATCTTCAATCAGAAATTCTTTCAGGACCTGAAGGAGGAAACAGGGATTGATCTAGAGAACATTGTTTACTACAAGGACTGCACCCACTATTTTGTCATGACTGCCAAGAAGCAGAGCCTGCTCGACAAAGGTGTCATCATCAATGACTACATCGACACGGAGATGCTGCTGTGTGCTGAGAACGTGAACCAGGACAACCTGCTGTCCTATGCCCGGGAAGCTGCAGACTTCGCCACCAACTACCAGCTGCCATCCTTAGACTTTGCTATGAACCACTACGGGCAGCCCGACGTGGCCATGTTTGATTTCACCTCCATGTATGCCTCAGAGAATGCTGCCCTGGTGCGCGAACGGCAGGGACACCCGCTGCTCGTGGCCCTTGTGGGCGACAGCTTGCTTGAGCCATTTTGGCCCATGGGTACAGGCTGTGCCCGTGGCTTCCTGGCGGCCTTTGACACAGCGTGGATGGTGAAGAGCTGGGACCAGGGGACTCCTGCCCTGGAAGTGCTGGCCGAAAGAGAAAGTCTTTACCGGCTGTTGCCTCAGACAACCCCGGAGAACATCAACAAGAACTTTGAGCAGTACACGCTGGACCCAGGGACGCGGTACCCAAACCTCAACTCACACTGTGTCCGGCCCCATCAGGTGAAGCATCTGTACATCACCAAGGAGCTGGACCACTACCCTCTTGAGAGACTCAACTCAATGAGGAGATCCGTCAACCTCTCCAGGCGGGAGTCAGATATCCGGCCCAGCAAGCTCTTAACCTGGTGCCAGCAGCAGACCAAGGGCTACCAGCATGTCAATGTCACTGACCTGACCACATCCTGGCGTAGCGGCCTGGCCCTCTGTGCCATCATCCACCACTTCCGGCCGGAGCTGATCAACTTTGACTCTTTGAATGAAGATGATGCTGTAAAGAACAACCAGCTGGCATTTGATGTGGCCGAACATGAGTTTGGGATCCCTCCGGTGACCACAGGCAAAGAGATGGCATCAGCCCAGGAGCCTGACAAGCTCAGCATGGTCATGTACCTCTCCAAGTTCTATGAGCTCTTCCGGGGCGCCCCGCTGCGGCCTGTGGATTCTTGGCGCAAAAGCTATGGAGAAAATGCCGACCTCAGTTTTTCCAAATCCTCCATTTCTAATAACTATCTCAACCTCACACTTCCCAGGAAAAGGACCCCTCGGGGAGATGCCCAAACGGAAGAGAACGACGTGAACAAGCGGAGGCGGAAAGGCTTCATCACCGTGGACCAGGATTGTGTGCGCAGGCTGCCAACCTTCTCCAGCCATAGTTTGGGTTCCTCTCAAGAGTGCGGCAACAGTAAGGAAGCAGGAAATCAGAACAAAGTCAAGTCCATGGCGAGTCAGCTGCTGGCCAAGTTTGAGGAGAGCACACGGAACCCCTCAGTCCTGAGGCAGGAGCGCCGTGTCTCAGGGATAGGTAACCCCGTCCTGTGCTCTTCCGCTGACCCTCCTGTAGACTCGCACTGCCCCACGCCGAAGGAGCCCACTCCCAGCCCACCGCCTCCTCTGAAAAGGCAGGTGCTCAGGGAGCTCAAGCAGGTGTCTCCTGGTGGCGAGTGTCCAAGCCGGCCCTGGAGAGCCAGGGCCAAGTCTGACCTGCAGCTCAGTGGCCCAGAAAACCTTGCCTCCCTGCCTCCCGCTTGCCAGGGGGCCCTGGCCCTCTCGGGGGTACTGCGGCGGCTACAGCAAGTGGAGGAAAAGATTCTCCAGAAGAGGTCTCAGAACTTGGCCAACAGGGAATTTCACCAAAAGAACATTAAAGAGAAAGCGGCTCACCTCGCCTCCATGTTTGGACACGGGGATTTCCCACAGAATAAACTACTCTCTAAAGGCCTGTCTCATACTCATCCTCCATCTTCTTCCTCTTGCCTTCCGTCTCCTGATCCAGCTGCTACTTCTACTCCATCAACTGTTGACTCTGCTTCTCCTGCCAGAAAGCTGACAGTAGGGAAAGTGTCCAGCGGAATAGGGGCTGCGGCTGAAGTCCTGGTCAATCTGTACTTGAATGATCACAGACCTAAGGCCCAGGCCACCTCTCCAGACCTGGAATCTATGCGGAAGACAATTCCCCTGAACCTGGGCGGCAGTGACACCTGCTACTTCTGTAAGAAGCGTGTGTATGTGATGGAGCGGCTGAGTGCTGAGGGCCACTTCTTCCACCGAGAGTGCTTCCGCTGCAGCATCTGTGCCACTACCTTGCGCCTGGCCACCTACGCCTTTGACTGTGAAGAAGGCAAGTTTTACTGCAAGCCTCATTTTATTCACTGTAAAACCAACAGCAAACAACGGAAGAGATGGACAGAGTTGAAGCAAGAAAGAGAGGAGGAGAGGACGTGGCAAGAGCCAGAAGCCCCTCGGCGAGATGCTGCCACGGAAAGCTCTTGCGCAGTGGCTGCCATCAGCACAGCAGAAGGCAGCCCTCCAGTTCATTTCAGCCTTCCAGTACTACACCCACTCCTTGGCTGA

XM_004851432.1 Coding sequence

Mical2 microtubule associated monooxygenase, calponin and LIM domain containing 2, transcript variant X2

Length: 3300 bp    Location: 4167503..4300527   Strand: +
>XM_004851432.1
ATGGGCGAGAATGAGGATGAGAAGCAGGCCCAGGCGGGGCAGGTTTTTGAGAACTTTGTCCAGGCTTCCACGTGCAAAGGCACCCTCCAGGCCTTCAACATCCTCACGCGCCACCTGGACCTAGACCCTCTGGACCACAGGAACTTCTACTCCAAGCTCAAGTCCAAGGTGACCACCTGGAAGGCCAAAGCCCTGTGGTACAAACTGGACAAGCGTGGCTCCCACAAAGAGTACAAGCGAGGGAAGGCGTGCATGAACACCAAGTGTCTCATTGTTGGCGGAGGACCCTGTGGCTTGCGCACTGCCATTGAACTCGCCTACCTGGGAGCCAAAGTGATCGTGGTAGAGAAAAGGGACACCTTCTCCCGGAACAATGTGCTGCACCTCTGGCCTTACACCATCCATGACCTGCGGGGCCTGGGAGCCAAGAAGTTCTATGGGAAGTTCTGCGCTGGCTCCATCGACCACATCAGTATTCGTCAACTGCAGCTCATCCTATTCAAGGTGGCCCTGATGTTGGGAGTTGAAATCCATGTGAATGTGGAGTTTGTGAAGGTTCTCGAACCTCCTGAAGATCAAGAAAATCAAAAAATTGGCTGGAGAGCAGAACTCCTCCCCGCAGACCACCCCCTGTCAGAGTTTGAGTTTGATGTCATCATTGGTGCTGATGGCCGCAGGAACACCCTGGAAGGGTTCAGGAGGAAGGAATTCCGCGGGAAGCTGGCCATCGCCATCACCGCCAACTTCATCAACAGGAACAGCACGGCTGAGGCCAAGGTGGAAGAGATTAGCGGGGTGGCCTTCATCTTCAATCAGAAATTCTTTCAGGACCTGAAGGAGGAAACAGGGATTGATCTAGAGAACATTGTTTACTACAAGGACTGCACCCACTATTTTGTCATGACTGCCAAGAAGCAGAGCCTGCTCGACAAAGGTGTCATCATCAATGACTACATCGACACGGAGATGCTGCTGTGTGCTGAGAACGTGAACCAGGACAACCTGCTGTCCTATGCCCGGGAAGCTGCAGACTTCGCCACCAACTACCAGCTGCCATCCTTAGACTTTGCTATGAACCACTACGGGCAGCCCGACGTGGCCATGTTTGATTTCACCTCCATGTATGCCTCAGAGAATGCTGCCCTGGTGCGCGAACGGCAGGGACACCCGCTGCTCGTGGCCCTTGTGGGCGACAGCTTGCTTGAGCCATTTTGGCCCATGGGTACAGGCTGTGCCCGTGGCTTCCTGGCGGCCTTTGACACAGCGTGGATGGTGAAGAGCTGGGACCAGGGGACTCCTGCCCTGGAAGTGCTGGCCGAAAGAGAAAGTCTTTACCGGCTGTTGCCTCAGACAACCCCGGAGAACATCAACAAGAACTTTGAGCAGTACACGCTGGACCCAGGGACGCGGTACCCAAACCTCAACTCACACTGTGTCCGGCCCCATCAGGTGAAGCATCTGTACATCACCAAGGAGCTGGACCACTACCCTCTTGAGAGACTCAACTCAATGAGGAGATCCGTCAACCTCTCCAGGCGGGAGTCAGATATCCGGCCCAGCAAGCTCTTAACCTGGTGCCAGCAGCAGACCAAGGGCTACCAGCATGTCAATGTCACTGACCTGACCACATCCTGGCGTAGCGGCCTGGCCCTCTGTGCCATCATCCACCACTTCCGGCCGGAGCTGATCAACTTTGACTCTTTGAATGAAGATGATGCTGTAAAGAACAACCAGCTGGCATTTGATGTGGCCGAACATGAGTTTGGGATCCCTCCGGTGACCACAGGCAAAGAGATGGCATCAGCCCAGGAGCCTGACAAGCTCAGCATGGTCATGTACCTCTCCAAGTTCTATGAGCTCTTCCGGGGCGCCCCGCTGCGGCCTGTGGATTCTTGGCGCAAAAGCTATGGAGAAAATGCCGACCTCAGTTTTTCCAAATCCTCCATTTCTAATAACTATCTCAACCTCACACTTCCCAGGAAAAGGACCCCTCGGGGAGATGCCCAAACGGAAGAGAACGACGTGAACAAGCGGAGGCGGAAAGGCTTCATCACCGTGGACCAGGATTGTGTGCGCAGGCTGCCAACCTTCTCCAGCCATAGTTTGGGTTCCTCTCAAGAGTGCGGCAACAGTAAGGAAGCAGGAAATCAGAACAAAGTCAAGTCCATGGCGAGTCAGCTGCTGGCCAAGTTTGAGGAGAGCACACGGAACCCCTCAGTCCTGAGGCAGGAGCGCCGTGTCTCAGGGATAGGTAACCCCGTCCTGTGCTCTTCCGCTGACCCTCCTGTAGACTCGCACTGCCCCACGCCGAAGGAGCCCACTCCCAGCCCACCGCCTCCTCTGAAAAGGCAGGTGCTCAGGGAGCTCAAGCAGGTGTCTCCTGGTGGCGAGTGTCCAAGCCGGCCCTGGAGAGCCAGGGCCAAGTCTGACCTGCAGCTCAGTGGCCCAGAAAACCTTGCCTCCCTGCCTCCCGCTTGCCAGGGGGCCCTGGCCCTCTCGGGGGTACTGCGGCGGCTACAGCAAGTGGAGGAAAAGATTCTCCAGAAGAGGTCTCAGAACTTGGCCAACAGGGAATTTCACCAAAAGAACATTAAAGAGAAAGCGGCTCACCTCGCCTCCATGTTTGGACACGGGGATTTCCCACAGAATAAACTACTCTCTAAAGGCCTGTCTCATACTCATCCTCCATCTTCTTCCTCTTGCCTTCCGTCTCCTGATCCAGCTGCTACTTCTACTCCATCAACTGTTGACTCTGCTTCTCCTGCCAGAAAGCTGACAGTAGGGAAAGTGTCCAGCGGAATAGGGGCTGCGGCTGAAGTCCTGGTCAATCTGTACTTGAATGATCACAGACCTAAGGCCCAGGCCACCTCTCCAGACCTGGAATCTATGCGGAAGACAATTCCCCTGAACCTGGGCGGCAGTGACACCTGCTACTTCTGTAAGAAGCGTGTGTATGTGATGGAGCGGCTGAGTGCTGAGGGCCACTTCTTCCACCGAGAGTGCTTCCGCTGCAGCATCTGTGCCACTACCTTGCGCCTGGCCACCTACGCCTTTGACTGTGAAGAAGGCAAGTTTTACTGCAAGCCTCATTTTATTCACTGTAAAACCAACAGCAAACAACGGAAGAGATGGACAGAGTTGAAGCAAGAAAGAGAGGAGGAGAGGACGTGGCAAGAGCCAGAAGCCCCTCGGCGAGATGCTGCCACGGAAAGCTCTTGCGCAGTGGCTGCCATCAGCACAGCAGAAGGCAGCCCTCCAGTTCATTTCAGCCTTCCAGTACTACACCCACTCCTTGGCTGA

XM_004851436.1 Coding sequence

Micalcl MICAL C-terminal like

High confidence: 4 potential gene matches
Length: 2472 bp    Location: 4307847..4378113   Strand: +
>XM_004851436.1
ATGGCCAGTGAAGCCACCTCGCCCCTGCCCTCCGAATGGACCTCGGTGAGGTTCAGCCCTGGGGAGGACACCGTCGGGCAGGACGTACTGGCTGTGTGCATCTTGGTCGACTGCGAGAACAGCAGCTCCGACACAGAGTCTGACTATGGTGACAGTGAGGGCCCCAGCACCAAGCCCTGTGAAGAGAGACCCCAGCAGCCAGAGTCGCTGCCTCTACCTAAGCCCCTCTTCCGGCACAACTCCCTGAGGGAGCCTCTGACCAGGGCAGCCTCTCCACAGGGCCCTGAGGAGCCACACGCTGGGCATGCTTTGCAACGGGCCAACAGCTTCCAGGATCCAGCTCCAAGCAAGCACCAGAACTGGAGAAAATTCCCCTCAAATCTAATACCAGCGAACAAAAGAACTTTGTCACCTTCAAAGAAACTTTCTCCTCTTCCTCTGTCTTCATCGTCTTCTCCTTCATCTTCATCTTCAGCCAGTGTCCCTGGGCATCCTCTGGACCATTCTGCTCCACCTCAGGTCTCCAGCGATCACTGCTGTCCTTCTGCCCCAATCTTTCTCAGGAGAGCTAGAACCCAAGGGGCATCCAAGGAGATGTCCCTGTACCTACCTCACAGCGAGGTGCTGGAGCGGGCAGAGTACTGCCTGGTGAGCCCTGGTGGAGACAGCCTCAAAAGCCCCGTGGAGATGGCTTCCAGGGGGTGCCAGGAAACAGGGGCTCCTCCTGAGGGTACCAGACGCCCCCACAGAGACCCTCTCCTCACTGAGGGGAAGGACAGGTCCTTGCCAAACCAAGAGCAGTGTCTCAGGGCAGAAGAGGACCCAGGAGAAGGCAGCATTGGACCCAAGAGGGGACAGGAGGGCAGGTCAGAGTTGGCCGAGAGGACGTCAGGCCTGAAGAAGTTAGTTCTCACCCAGGAGCAGAAGAACATGTTGCTGGACTGGAATGACTCCTGCCTCCACAGCGCACCCCTCCAGCTAGGGGAGCGACTTTCCCGGGAGAGTGCTAGGAACGGCAGAGCAGGCCCTGTGCTGAGCGCAGTCCACCCCTTGAGCCTCGCTCGGGGAGGGAAAGAGACACTGGCCGCCCAGACAGAGGCCCCTGAGGGGGCTGTGCAGGCGCTGGAGCAGCGGAGTGTGCCCCCGCCCAAGTCACCCCTGAGGCTCATTACAGATGCCATCCGGAAGTCCATGGAGCAGCTCTTCCACACCTCTGACGGCGGTGGGAAGAAGGTCTGGGCCAAGCCAGAGCCGGAAACTTGGCCCCCGGGCCAGCATGCGCTCCCCTCAACCAGCTCCTTCAGCCTCTGGAAAAGCGGCTCTAGCAAAAACGGGAGCCAGCAGTCCCCTGGGAGACACGCGGCCAGCAGGTCCTCCACCTTCTTCTCGCTGGGCTCTCCAGCTCGCCGGGCCGCCCAGTCCTCAGACCTTTGCCGCTCTGATCCTGACCATCGTTTGCCCAATCAGCCACCGACAATGTTCTCTACGTTCACATCGCCACCCTGCAGCAACACTGACGATGTCCCCGCACTCCTGGAAAAAGTGAGTTTGCAAGAGGCCTTGGCAAACCCTTCCAGGGCTCCCAAGAGAAGAACCTCTTTATTTTCCTCCTTCAGAACCAAAGACAAATCTTTTGAGAGTTTCCTCCAAGAATCCAAACAAAGAAAGGACATCAGGGACCTCTTCAGCAGCTCCAAGGGAAGGATGCTGTCTGGGAACAGCTGCTCATCCCGGGAGAAGCTGCGGCCGCCTTTCAGAAGCACCTCCCTGCGGTGGACTTCCGGTCACCCTCCTCCAGCGGGACATGCAGGCTCCAGGCACCACCGTGTTGGAGTGCAGGTGACAGAGGCTACCTCTTCTCTCTCTTCTATCACCTCCTCGTCTGCAGATGAAGAATTTGATCCCCAGCTTTCCCCGGGGTCACAGGAGAAGGAGACACTCAAAAGAAGAAGAAAGCTGGAAAAAGCAACAAAGCAGTTGGTTAAGCAAGAAGAGTTGAAAAGACTTCATAAAGCTCAGGCCATCCAGAGGCAGCTGGAGGAGGTGGAGGAGCGGCAGAGGGCATCAGAGATCCAGGGTGTGAGGCTGGAGAAGGCCTTGAGAGGAGAAGCAGATTCAGGGACACAGGATGAAGCCCAGCTTTTGCAGGAATGGTTTAAGCTAGTCCTGGAGAAGAATAAATTAATGCGATATGAGTCGGAGCTACTGATCATGGCCCAAGAACTAGAATTAGAAGATCATCAAAGCAGACTGGAGCAGAAATTAAGAGAGAAAATGCTCAAGGAAGAGAGTCAGAAAGATGAGAATGATCTTAATGAGGAGCAAGAAATATTCACCAAAATGATGCAAGTGATTAAACAAAGGGACGAACTCGTGGATTCCTTAGAGGAACAGCGCATCAAGGAAAAGGCTGAGGACCAGCACTTCGAAAGCTTTGTGTTCTCCAGGGGCTGTCAGCTGAGCAGGACGTGA

XM_004851439.1 Coding sequence

Tead1 TEA domain family member 1 (SV40 transcriptional enhancer factor), transcript variant X1

Length: 1536 bp    Location: 4695581..4928301   Strand: +
>XM_004851439.1
ATGGAAACTGACCCCAGTGAGCACTGGAAACTTAAGAGACAGATGATGTTCCAGGAACTGGGAATGAAAAAAAGACAGAGTTTAAAAACAGTGCGTTGGAGGGAGCCCAGGTCCTGGGACAGAAAGGCTTATTTTCTTGAAAAGGCTCCAGGCTTCGGCTTGGAAAATCCAACCGCCAAAATTGAGCCCAGCAGCTGGAGCGGCAGCGAGAGCCCTGCCGAAAACATGGAAAGGATGAGTGACTCTACAGATAAGCCGATTGACAATGACGCGGAAGGGGTCTGGAGCCCCGACATTGAGCAGAGCTTTCAGGAGGCCCTGGCTATCTATCCGCCATGTGGGCGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAATGAATTGATAGCCAGATACATCAAACTCAGGACAGGGAAGACGAGGACCAGAAAGCAGGTGTCTAGTCATATACAGGTCTTAGCAAGAAAGAAAGTTCGAGAAATTCAAGCCGCCATTAAGGTGTCTAGTCACATTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGTAACAAGCATGGATCAGACTGCAAAGGACAAGGCCCTGCAGCACATGGCCGCCATGTCGTCAGCCCAAATCGTCTCTGCCACTGCCATTCACAACAAGCTGGGGCTGCCTGGGATCCCACGCCCCACCTTCCCAGGGGCGCCGGGGTTTTGGCCTGGAATGATACAAACAGGGCAGCCAGGATCCTCACAAGATGTCAAGCCCTTTGTGCAGCAGGCCTACCCCATCCAGCCCGCGGTCACGGCCCCCATTCCAGGGTTTGAGCCTCCGTCCGCCCCAGCTCCCTCTGTCCCTGCCTGGCAGGGCCGCTCCATTGGCACAACCAAGCTTCGCCTGGTGGAATTCTCAGCTTTCCTCGAACAGCAGCGAGACCCAGACTCGTACAACAAACACCTCTTCGTGCACATCGGGCATGCCAACCATTCTTACAGTGACCCATTGCTCGAATCAGTGGATATACGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTATTTGGAAAGGGCCCTCAAAATGCCTTCTTCCTTGTAAAATTCTGGGCCGACTTAAACTGCAATATTCAAGATGATGCTGGGGCTTTTTATGGTGTAACCAGTCAGTATGAAAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTGTGCTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACAGAGTATGCAAGGTTCGAGAATGGCCGATTTGTATACCGAATAAACCGCTCCCCGATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACAAGAAACTCTCCTCTGCATGGCCTGTGTATTTGAAGTTTCAAATAGTGAACATGGAGCACAACATCATATTTACAGGCTTGTAAAGGACTGA

XM_004851441.1 Coding sequence

Tead1 TEA domain family member 1 (SV40 transcriptional enhancer factor), transcript variant X3

Length: 1473 bp    Location: 4695581..4928301   Strand: +
>XM_004851441.1
ATGGAAACTGACCCCAGTGAGCACTGGAAACTTAAGAGACAGATGATGTTCCAGGAACTGGGAATGAAAAAAAGACAGAGTTTAAAAACAGTGCGTTGGAGGGAGCCCAGGTCCTGGGACAGAAAGGCTTATTTTCTTGAAAAGGCTCCAGGCTTCGGCTTGGAAAATCCAACCGCCAAAATTGAGCCCAGCAGCTGGAGCGGCAGCGAGAGCCCTGCCGAAAACATGGAAAGGATGAGTGACTCTACAGATAAGCCGATTGACAATGACGCGGAAGGGGTCTGGAGCCCCGACATTGAGCAGAGCTTTCAGGAGGCCCTGGCTATCTATCCGCCATGTGGGCGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAATGAATTGATAGCCAGATACATCAAACTCAGGACAGGGAAGACGAGGACCAGAAAGCAGGTGTCTAGTCACATTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGTAACAAGCATGGATCAGACTGCAAAGGACAAGGCCCTGCAGCACATGGCCGCCATGTCGTCAGCCCAAATCGTCTCTGCCACTGCCATTCACAACAAGCTGGGGCTGCCTGGGATCCCACGCCCCACCTTCCCAGGGGCGCCGGGGTTTTGGCCTGGAATGATACAAACAGGGCAGCCAGGATCCTCACAAGATGTCAAGCCCTTTGTGCAGCAGGCCTACCCCATCCAGCCCGCGGTCACGGCCCCCATTCCAGGGTTTGAGCCTCCGTCCGCCCCAGCTCCCTCTGTCCCTGCCTGGCAGGGCCGCTCCATTGGCACAACCAAGCTTCGCCTGGTGGAATTCTCAGCTTTCCTCGAACAGCAGCGAGACCCAGACTCGTACAACAAACACCTCTTCGTGCACATCGGGCATGCCAACCATTCTTACAGTGACCCATTGCTCGAATCAGTGGATATACGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTATTTGGAAAGGGCCCTCAAAATGCCTTCTTCCTTGTAAAATTCTGGGCCGACTTAAACTGCAATATTCAAGATGATGCTGGGGCTTTTTATGGTGTAACCAGTCAGTATGAAAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTGTGCTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACAGAGTATGCAAGGTTCGAGAATGGCCGATTTGTATACCGAATAAACCGCTCCCCGATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACAAGAAACTCTCCTCTGCATGGCCTGTGTATTTGAAGTTTCAAATAGTGAACATGGAGCACAACATCATATTTACAGGCTTGTAAAGGACTGA

XM_004851442.1 Coding sequence

Tead1 TEA domain family member 1 (SV40 transcriptional enhancer factor), transcript variant X4

Length: 1461 bp    Location: 4695581..4928301   Strand: +
>XM_004851442.1
ATGGAAACTGACCCCAGTGAGCACTGGAAACTTAAGAGACAGATGATGTTCCAGGAACTGGGAATGAAAAAAAGACAGAGTTTAAAAACAGTGCGTTGGAGGGAGCCCAGGTCCTGGGACAGAAAGGCTTATTTTCTTGAAAAGGCTCCAGGCTTCGGCTTGGAAAATCCAACCGCCAAAATTGAGCCCAGCAGCTGGAGCGGCAGCGAGAGCCCTGCCGAAAACATGGAAAGGATGAGTGACTCTACAGATAAGCCGATTGACAATGACGCGGAAGGGGTCTGGAGCCCCGACATTGAGCAGAGCTTTCAGGAGGCCCTGGCTATCTATCCGCCATGTGGGCGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAATGAATTGATAGCCAGATACATCAAACTCAGGACAGGGAAGACGAGGACCAGAAAGCAGGTGTCTAGTCACATTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGATCAGACTGCAAAGGACAAGGCCCTGCAGCACATGGCCGCCATGTCGTCAGCCCAAATCGTCTCTGCCACTGCCATTCACAACAAGCTGGGGCTGCCTGGGATCCCACGCCCCACCTTCCCAGGGGCGCCGGGGTTTTGGCCTGGAATGATACAAACAGGGCAGCCAGGATCCTCACAAGATGTCAAGCCCTTTGTGCAGCAGGCCTACCCCATCCAGCCCGCGGTCACGGCCCCCATTCCAGGGTTTGAGCCTCCGTCCGCCCCAGCTCCCTCTGTCCCTGCCTGGCAGGGCCGCTCCATTGGCACAACCAAGCTTCGCCTGGTGGAATTCTCAGCTTTCCTCGAACAGCAGCGAGACCCAGACTCGTACAACAAACACCTCTTCGTGCACATCGGGCATGCCAACCATTCTTACAGTGACCCATTGCTCGAATCAGTGGATATACGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTATTTGGAAAGGGCCCTCAAAATGCCTTCTTCCTTGTAAAATTCTGGGCCGACTTAAACTGCAATATTCAAGATGATGCTGGGGCTTTTTATGGTGTAACCAGTCAGTATGAAAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTGTGCTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACAGAGTATGCAAGGTTCGAGAATGGCCGATTTGTATACCGAATAAACCGCTCCCCGATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACAAGAAACTCTCCTCTGCATGGCCTGTGTATTTGAAGTTTCAAATAGTGAACATGGAGCACAACATCATATTTACAGGCTTGTAAAGGACTGA

XM_004851446.1 Coding sequence

Arntl aryl hydrocarbon receptor nuclear translocator-like, transcript variant X1

Length: 1881 bp    Location: 5295143..5391645   Strand: +
>XM_004851446.1
ATGGCAGACCAGAGAATGGACATTTCCTCCACGATCAGTGACTTCATGTCCTCCGGCCCCACTGACCTGCTCTCCAGCTCCCTGGGCGCCGGCAGCGTGGATTGCAACCGCAAGCGGAAGGGCAGCTCCACCGACTACCAAGAAAGCATGGACACAGACAAAGATGACCCTCATGGAAGGTTGGAATACACAGAACACCAAGGAAGGATAAAAAATGCAAGGGAAGCTCACAGTCAGATTGAAAAGCGGCGCAGGGATAAGATGAACAGTTTTATTGATGAGCTGGCTTCTTTGGTACCAACATGCAACGCGATGTCCAGGAAGTTAGATAAACTCACCGTGTTAAGAATGGCTGTTCAGCACATGAAAACATTAAGAGGTGCCACTAACCCGTACACAGAAGCAAACTACAAGCCAACTTTTCTATCAGACGATGAATTGAAACACCTCATTCTCAGGGCAGCAGATGGATTTTTGTTTGTCGTAGGATGTGACCGAGGGAAGATACTCTTTGTCTCAGAGTCTGTCTTCAAGATCCTCAACTACAGCCAGAATGATCTGATTGGTCAGAGTTTGTTTGATTACCTGCATCCTAAAGATATCGCCAAAGTCAAGGAGCAGCTCTCCTCCTCCGACACCGCACCCCGGGAGCGGCTCATAGATGCAAAAACTGGACTTCCAGTTAAAACAGATATAACCCCTGGGCCGTCTCGATTATGTTCTGGAGCACGACGTTCTTTCTTCTGTAGGATGAAGTGTAACAGGCCTTCAGTAAAGGTGGAAGACAAGGACTTCCCCTCCACCTGCTCAAAGAAAAAAGCAGATCGAAAAAGCTTCTGCACAATCCACAGCACAGGCTATTTGAAAAGCTGGCCCCCCACAAAGATGGGGCTGGATGAAGACAATGAACCAGACAATGAGGGGTGTAACCTCAGCTGCCTTGTTGCCATTGGACGGCTGCATTCTCACGTGGTTCCACAACCAGTGAACGGGGAAATCAGGGTGAAAGCTATGGAATATGTTTCTCGGCACGCAATAGATGGGAAGTTTGTTTTTGTAGACCAGAGGGCAACAGCTATTTTGGCATATTTACCACAAGAACTTCTAGGCACATCATGTTATGAATATTTTCATCAAGATGACATAGGACATCTTGCAGAATGTCACAGGCAAGTTCTACAGACAAGAGAAAAGATTACAACTAATTGCTATAAGTTTAAAATCAAAGATGGTTCTTTCATCACACTACGAAGTCGATGGTTCAGTTTCATGAACCCTTGGACCAAGGAAGTAGAATACATTGTCTCAACCAACACTGTTGTTTTAGCCAACGTCCTGGAAGGCGGGGACCCAACCTTCCCGCAGCTCACAGCATCCCCCCACAGCATGGACAGCATGCTGCCCTCTGGAGAAGGTGGCCCAAAGAGGACCCATCCCACTGTTCCAGGGATTCCAGGGGGAACCAGGGCTGGGGCAGGAAAAATAGGTCGAATGATTGCTGAGGAAATCATGGAAATCCACAGGATAAGAGGGTCGTCGCCTTCCAGCTGTGGTTCTAGCCCACTGAACATCACAAGTACGCCTCCCCCTGATGCCTCCTCTCCAGGAGGCAAGAAGATTTTAAATGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTACCAGGGCAGGCACAGGAGAATCCAGGCTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGCATAGACATGATAGATAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAAGCGGCAATGGCTGTCATCATGAGCCTCCTGGAAGCAGATGCTGGGCTGGGTGGCCCTGTTGACTTTAGCGACTTACCATGGCCGCTGTAG

XM_004851451.1 Coding sequence

Arntl aryl hydrocarbon receptor nuclear translocator-like, transcript variant X6

Length: 1752 bp    Location: 5362749..5391645   Strand: +
>XM_004851451.1
ATGATTAATATAGAAAGCATGGACACAGACAAAGATGACCCTCATGGAAGGTTGGAATACACAGAACACCAAGGAAGGATAAAAAATGCAAGGGAAGCTCACAGTCAGATTGAAAAGCGGCGCAGGGATAAGATGAACAGTTTTATTGATGAGCTGGCTTCTTTGGTACCAACATGCAACGCGATGTCCAGGAAGTTAGATAAACTCACCGTGTTAAGAATGGCTGTTCAGCACATGAAAACATTAAGAGGTGCCACTAACCCGTACACAGAAGCAAACTACAAGCCAACTTTTCTATCAGACGATGAATTGAAACACCTCATTCTCAGGGCAGCAGATGGATTTTTGTTTGTCGTAGGATGTGACCGAGGGAAGATACTCTTTGTCTCAGAGTCTGTCTTCAAGATCCTCAACTACAGCCAGAATGATCTGATTGGTCAGAGTTTGTTTGATTACCTGCATCCTAAAGATATCGCCAAAGTCAAGGAGCAGCTCTCCTCCTCCGACACCGCACCCCGGGAGCGGCTCATAGATGCAAAAACTGGACTTCCAGTTAAAACAGATATAACCCCTGGGCCGTCTCGATTATGTTCTGGAGCACGACGTTCTTTCTTCTGTAGGATGAAGTGTAACAGGCCTTCAGTAAAGGTGGAAGACAAGGACTTCCCCTCCACCTGCTCAAAGAAAAAAGCAGATCGAAAAAGCTTCTGCACAATCCACAGCACAGGCTATTTGAAAAGCTGGCCCCCCACAAAGATGGGGCTGGATGAAGACAATGAACCAGACAATGAGGGGTGTAACCTCAGCTGCCTTGTTGCCATTGGACGGCTGCATTCTCACGTGGTTCCACAACCAGTGAACGGGGAAATCAGGGTGAAAGCTATGGAATATGTTTCTCGGCACGCAATAGATGGGAAGTTTGTTTTTGTAGACCAGAGGGCAACAGCTATTTTGGCATATTTACCACAAGAACTTCTAGGCACATCATGTTATGAATATTTTCATCAAGATGACATAGGACATCTTGCAGAATGTCACAGGCAAGTTCTACAGACAAGAGAAAAGATTACAACTAATTGCTATAAGTTTAAAATCAAAGATGGTTCTTTCATCACACTACGAAGTCGATGGTTCAGTTTCATGAACCCTTGGACCAAGGAAGTAGAATACATTGTCTCAACCAACACTGTTGTTTTAGCCAACGTCCTGGAAGGCGGGGACCCAACCTTCCCGCAGCTCACAGCATCCCCCCACAGCATGGACAGCATGCTGCCCTCTGGAGAAGGTGGCCCAAAGAGGACCCATCCCACTGTTCCAGGGATTCCAGGGGGAACCAGGGCTGGGGCAGGAAAAATAGGTCGAATGATTGCTGAGGAAATCATGGAAATCCACAGGATAAGAGGGTCGTCGCCTTCCAGCTGTGGTTCTAGCCCACTGAACATCACAAGTACGCCTCCCCCTGATGCCTCCTCTCCAGGAGGCAAGAAGATTTTAAATGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTACCAGGGCAGGCACAGGAGAATCCAGGCTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGCATAGACATGATAGATAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAAGCGGCAATGGCTGTCATCATGAGCCTCCTGGAAGCAGATGCTGGGCTGGGTGGCCCTGTTGACTTTAGCGACTTACCATGGCCGCTGTAG

XM_004851452.1 Coding sequence

Arntl aryl hydrocarbon receptor nuclear translocator-like, transcript variant X7

Length: 1749 bp    Location: 5362749..5391645   Strand: +
>XM_004851452.1
ATGATTAATATAGAAAGCATGGACACAGACAAAGATGACCCTCATGGAAGGTTGGAATACACAGAACACCAAGGAAGGATAAAAAATGCAAGGGAAGCTCACAGTCAGATTGAAAAGCGGCGCAGGGATAAGATGAACAGTTTTATTGATGAGCTGGCTTCTTTGGTACCAACATGCAACGCGATGTCCAGGAAGTTAGATAAACTCACCGTGTTAAGAATGGCTGTTCAGCACATGAAAACATTAAGAGGTGCCACTAACCCGTACACAGAAGCAAACTACAAGCCAACTTTTCTATCAGACGATGAATTGAAACACCTCATTCTCAGGGCAGCAGATGGATTTTTGTTTGTCGTAGGATGTGACCGAGGGAAGATACTCTTTGTCTCAGAGTCTGTCTTCAAGATCCTCAACTACAGCCAGAATGATCTGATTGGTCAGAGTTTGTTTGATTACCTGCATCCTAAAGATATCGCCAAAGTCAAGGAGCAGCTCTCCTCCTCCGACACCGCACCCCGGGAGCGGCTCATAGATGCAAAAACTGGACTTCCAGTTAAAACAGATATAACCCCTGGGCCGTCTCGATTATGTTCTGGAGCACGACGTTCTTTCTTCTGTAGGATGAAGTGTAACAGGCCTTCAGTAAAGGTGGAAGACAAGGACTTCCCCTCCACCTGCTCAAAGAAAAAAGATCGAAAAAGCTTCTGCACAATCCACAGCACAGGCTATTTGAAAAGCTGGCCCCCCACAAAGATGGGGCTGGATGAAGACAATGAACCAGACAATGAGGGGTGTAACCTCAGCTGCCTTGTTGCCATTGGACGGCTGCATTCTCACGTGGTTCCACAACCAGTGAACGGGGAAATCAGGGTGAAAGCTATGGAATATGTTTCTCGGCACGCAATAGATGGGAAGTTTGTTTTTGTAGACCAGAGGGCAACAGCTATTTTGGCATATTTACCACAAGAACTTCTAGGCACATCATGTTATGAATATTTTCATCAAGATGACATAGGACATCTTGCAGAATGTCACAGGCAAGTTCTACAGACAAGAGAAAAGATTACAACTAATTGCTATAAGTTTAAAATCAAAGATGGTTCTTTCATCACACTACGAAGTCGATGGTTCAGTTTCATGAACCCTTGGACCAAGGAAGTAGAATACATTGTCTCAACCAACACTGTTGTTTTAGCCAACGTCCTGGAAGGCGGGGACCCAACCTTCCCGCAGCTCACAGCATCCCCCCACAGCATGGACAGCATGCTGCCCTCTGGAGAAGGTGGCCCAAAGAGGACCCATCCCACTGTTCCAGGGATTCCAGGGGGAACCAGGGCTGGGGCAGGAAAAATAGGTCGAATGATTGCTGAGGAAATCATGGAAATCCACAGGATAAGAGGGTCGTCGCCTTCCAGCTGTGGTTCTAGCCCACTGAACATCACAAGTACGCCTCCCCCTGATGCCTCCTCTCCAGGAGGCAAGAAGATTTTAAATGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTACCAGGGCAGGCACAGGAGAATCCAGGCTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGCATAGACATGATAGATAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAAGCGGCAATGGCTGTCATCATGAGCCTCCTGGAAGCAGATGCTGGGCTGGGTGGCCCTGTTGACTTTAGCGACTTACCATGGCCGCTGTAG

XM_004851456.1 Coding sequence

Btbd10 BTB (POZ) domain containing 10, transcript variant X4

High confidence: 1 potential gene match
Length: 1428 bp    Location: 5462202..5392428   Strand: -
>XM_004851456.1
ATGGCAGGACGGCCTCATCCCTATGACAGTAACTCCAGTGATCCAGAGAATTGGGATCGGAAATTGCATAGTAGACCTCGTAAACTTTGTAAACATTCAAGTACTTCCTCACGTGTTGCTAAAGGAGGAGTAGACCACACCAAAATGAGTCTACAAGGTGCTAGTGGGGGCCAGGAGAGATCAAGAGACAGACGAAGGTCAAGTGACAGATCACGGGATTCATCTCATGAAAGAACAGAGTCTCAACTCACTCCTTGTATTAGAAATGTTACTTCTCCAACACGGCAGCACCATGTTGAAAGAGAAAAAGATCATAGTTCCTCTCGCCCAAGCAGTCCTCGTCCTCAAAAAGCATCTCCAAATGGTTCAGTTAGCAGTGCTGGGAACAGCAGCAGAAATAGTAGTCAGTCAAGTTCAGATGGTAGCTGTAAGACAACTGGGGAGATGGTATTTGTATATGAAAATGCAAAAGAAGGAGCTCGAAATGTAAGAACGTCAGAACGAGTGACATTAATAGTGGATAACACTAGATTTGTTGTAGACCCATCTATTTTTACTGCACAGCCAAATACAATGTTGGGCAGGATGTTTGGATCTGGCCGAGAACATAACTTTACACGTCCCAATGAGAAGGGAGAGTATGAGGTGGCAGAAGGGATTGGTTCCACTGTATTTCGAGCTATCCTGGATTACTATAAGACAGGAATAATTCGTTGTCCTGATGGCATATCTATTCCTGAGCTGAGAGAAGCATGCGATTATCTCTGTATTTCTTTTGAATATAGTACTATTAAATGTAGAGATCTCAGTGCCCTGATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCTAGTGCCCAGAGTGGGGAACGAGAATGTCATATAGTGGTGCTTACAGATGATGACGTGGTTGACTGGGATGAAGAGTATCCACCACAGATGGGAGAAGAATATTCACAAATTATTTATAGCACAAAATTATATAGATTTTTCAAGTATATTGAAAACAGAGATGTGGCCAAATCAGTCTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGTTATCCTACGTACAAAGAAAAAGTAAAGAAAAGGCCTGGGGGCCGCCCAGAAGTCATTTACAACTATGTTCAAAGACCCTTTATTCGAATGTCCTGGGAAAAGGAAGAAGGAAAGAGTCGGCATGTAGACTTCCAGTGTGTAAAAAGTAAATCTATCACCAACCTGGCAGCAGCTGCTGCAGACATTCCCCAGGACCAGCTGGTAGTCATGCACCCAACTCCACAGGTGGATGAGCTGGATATCCTCCCCATTCACCCCCCTTCTGGCAACAGTGACCTCGATCCTGACGCACAGAATCCAATGCTGTGA

XM_004851454.1 Coding sequence

Btbd10 BTB (POZ) domain containing 10, transcript variant X2

Length: 1428 bp    Location: 5462202..5392428   Strand: -
>XM_004851454.1
ATGGCAGGACGGCCTCATCCCTATGACAGTAACTCCAGTGATCCAGAGAATTGGGATCGGAAATTGCATAGTAGACCTCGTAAACTTTGTAAACATTCAAGTACTTCCTCACGTGTTGCTAAAGGAGGAGTAGACCACACCAAAATGAGTCTACAAGGTGCTAGTGGGGGCCAGGAGAGATCAAGAGACAGACGAAGGTCAAGTGACAGATCACGGGATTCATCTCATGAAAGAACAGAGTCTCAACTCACTCCTTGTATTAGAAATGTTACTTCTCCAACACGGCAGCACCATGTTGAAAGAGAAAAAGATCATAGTTCCTCTCGCCCAAGCAGTCCTCGTCCTCAAAAAGCATCTCCAAATGGTTCAGTTAGCAGTGCTGGGAACAGCAGCAGAAATAGTAGTCAGTCAAGTTCAGATGGTAGCTGTAAGACAACTGGGGAGATGGTATTTGTATATGAAAATGCAAAAGAAGGAGCTCGAAATGTAAGAACGTCAGAACGAGTGACATTAATAGTGGATAACACTAGATTTGTTGTAGACCCATCTATTTTTACTGCACAGCCAAATACAATGTTGGGCAGGATGTTTGGATCTGGCCGAGAACATAACTTTACACGTCCCAATGAGAAGGGAGAGTATGAGGTGGCAGAAGGGATTGGTTCCACTGTATTTCGAGCTATCCTGGATTACTATAAGACAGGAATAATTCGTTGTCCTGATGGCATATCTATTCCTGAGCTGAGAGAAGCATGCGATTATCTCTGTATTTCTTTTGAATATAGTACTATTAAATGTAGAGATCTCAGTGCCCTGATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCTAGTGCCCAGAGTGGGGAACGAGAATGTCATATAGTGGTGCTTACAGATGATGACGTGGTTGACTGGGATGAAGAGTATCCACCACAGATGGGAGAAGAATATTCACAAATTATTTATAGCACAAAATTATATAGATTTTTCAAGTATATTGAAAACAGAGATGTGGCCAAATCAGTCTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGTTATCCTACGTACAAAGAAAAAGTAAAGAAAAGGCCTGGGGGCCGCCCAGAAGTCATTTACAACTATGTTCAAAGACCCTTTATTCGAATGTCCTGGGAAAAGGAAGAAGGAAAGAGTCGGCATGTAGACTTCCAGTGTGTAAAAAGTAAATCTATCACCAACCTGGCAGCAGCTGCTGCAGACATTCCCCAGGACCAGCTGGTAGTCATGCACCCAACTCCACAGGTGGATGAGCTGGATATCCTCCCCATTCACCCCCCTTCTGGCAACAGTGACCTCGATCCTGACGCACAGAATCCAATGCTGTGA

XM_004851455.1 Coding sequence

Btbd10 BTB (POZ) domain containing 10, transcript variant X3

Length: 1428 bp    Location: 5462202..5392428   Strand: -
>XM_004851455.1
ATGGCAGGACGGCCTCATCCCTATGACAGTAACTCCAGTGATCCAGAGAATTGGGATCGGAAATTGCATAGTAGACCTCGTAAACTTTGTAAACATTCAAGTACTTCCTCACGTGTTGCTAAAGGAGGAGTAGACCACACCAAAATGAGTCTACAAGGTGCTAGTGGGGGCCAGGAGAGATCAAGAGACAGACGAAGGTCAAGTGACAGATCACGGGATTCATCTCATGAAAGAACAGAGTCTCAACTCACTCCTTGTATTAGAAATGTTACTTCTCCAACACGGCAGCACCATGTTGAAAGAGAAAAAGATCATAGTTCCTCTCGCCCAAGCAGTCCTCGTCCTCAAAAAGCATCTCCAAATGGTTCAGTTAGCAGTGCTGGGAACAGCAGCAGAAATAGTAGTCAGTCAAGTTCAGATGGTAGCTGTAAGACAACTGGGGAGATGGTATTTGTATATGAAAATGCAAAAGAAGGAGCTCGAAATGTAAGAACGTCAGAACGAGTGACATTAATAGTGGATAACACTAGATTTGTTGTAGACCCATCTATTTTTACTGCACAGCCAAATACAATGTTGGGCAGGATGTTTGGATCTGGCCGAGAACATAACTTTACACGTCCCAATGAGAAGGGAGAGTATGAGGTGGCAGAAGGGATTGGTTCCACTGTATTTCGAGCTATCCTGGATTACTATAAGACAGGAATAATTCGTTGTCCTGATGGCATATCTATTCCTGAGCTGAGAGAAGCATGCGATTATCTCTGTATTTCTTTTGAATATAGTACTATTAAATGTAGAGATCTCAGTGCCCTGATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCTAGTGCCCAGAGTGGGGAACGAGAATGTCATATAGTGGTGCTTACAGATGATGACGTGGTTGACTGGGATGAAGAGTATCCACCACAGATGGGAGAAGAATATTCACAAATTATTTATAGCACAAAATTATATAGATTTTTCAAGTATATTGAAAACAGAGATGTGGCCAAATCAGTCTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGTTATCCTACGTACAAAGAAAAAGTAAAGAAAAGGCCTGGGGGCCGCCCAGAAGTCATTTACAACTATGTTCAAAGACCCTTTATTCGAATGTCCTGGGAAAAGGAAGAAGGAAAGAGTCGGCATGTAGACTTCCAGTGTGTAAAAAGTAAATCTATCACCAACCTGGCAGCAGCTGCTGCAGACATTCCCCAGGACCAGCTGGTAGTCATGCACCCAACTCCACAGGTGGATGAGCTGGATATCCTCCCCATTCACCCCCCTTCTGGCAACAGTGACCTCGATCCTGACGCACAGAATCCAATGCTGTGA

XM_004851459.1 Coding sequence

Btbd10 BTB (POZ) domain containing 10, transcript variant X7

Length: 1284 bp    Location: 5424733..5392428   Strand: -
>XM_004851459.1
ATGAGTCTACAAGGTGCTAGTGGGGGCCAGGAGAGATCAAGAGACAGACGAAGGTCAAGTGACAGATCACGGGATTCATCTCATGAAAGAACAGAGTCTCAACTCACTCCTTGTATTAGAAATGTTACTTCTCCAACACGGCAGCACCATGTTGAAAGAGAAAAAGATCATAGTTCCTCTCGCCCAAGCAGTCCTCGTCCTCAAAAAGCATCTCCAAATGGTTCAGTTAGCAGTGCTGGGAACAGCAGCAGAAATAGTAGTCAGTCAAGTTCAGATGGTAGCTGTAAGACAACTGGGGAGATGGTATTTGTATATGAAAATGCAAAAGAAGGAGCTCGAAATGTAAGAACGTCAGAACGAGTGACATTAATAGTGGATAACACTAGATTTGTTGTAGACCCATCTATTTTTACTGCACAGCCAAATACAATGTTGGGCAGGATGTTTGGATCTGGCCGAGAACATAACTTTACACGTCCCAATGAGAAGGGAGAGTATGAGGTGGCAGAAGGGATTGGTTCCACTGTATTTCGAGCTATCCTGGATTACTATAAGACAGGAATAATTCGTTGTCCTGATGGCATATCTATTCCTGAGCTGAGAGAAGCATGCGATTATCTCTGTATTTCTTTTGAATATAGTACTATTAAATGTAGAGATCTCAGTGCCCTGATGCATGAGTTATCAAATGATGGTGCTCGTAGACAATTTGAATTTTATCTGGAAGAAATGATCCTCCCTCTCATGGTAGCTAGTGCCCAGAGTGGGGAACGAGAATGTCATATAGTGGTGCTTACAGATGATGACGTGGTTGACTGGGATGAAGAGTATCCACCACAGATGGGAGAAGAATATTCACAAATTATTTATAGCACAAAATTATATAGATTTTTCAAGTATATTGAAAACAGAGATGTGGCCAAATCAGTCTTGAAGGAGAGGGGTCTTAAGAAGATTAGATTGGGAATAGAAGGTTATCCTACGTACAAAGAAAAAGTAAAGAAAAGGCCTGGGGGCCGCCCAGAAGTCATTTACAACTATGTTCAAAGACCCTTTATTCGAATGTCCTGGGAAAAGGAAGAAGGAAAGAGTCGGCATGTAGACTTCCAGTGTGTAAAAAGTAAATCTATCACCAACCTGGCAGCAGCTGCTGCAGACATTCCCCAGGACCAGCTGGTAGTCATGCACCCAACTCCACAGGTGGATGAGCTGGATATCCTCCCCATTCACCCCCCTTCTGGCAACAGTGACCTCGATCCTGACGCACAGAATCCAATGCTGTGA

XM_004851462.1 Coding sequence

Far1 fatty acyl CoA reductase 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1548 bp    Location: 5623621..5682464   Strand: +
>XM_004851462.1
ATGGTTTCAATCCCAGAATACTATGAAGGAAAGAATGTTCTCCTGACAGGAGCTACTGGTTTTCTGGGAAAGGTGCTTCTGGAAAAGTTGCTGAGGTCTTGTCCTAAGGTGAAGTCAGTGTATGTTTTGGTGAGGCAGAAAGCTGGACTGACACCCCAGGAGCGAGTGGAAGAAGTTCTTAGTGGCAAGCTCTTTGACAGATTAAGAGATGAAAATCCAGATTTTAGAGAGAAAATTGTAGCAATCAACAGTGAACTCACCCAGCCTAAACTGGCTCTTAGTGAAGAAGATAAAGAAGTCATCATAGATTCTACCAATATTATATTCCACTGTGCAGCTACAGTACGGTTTAATGAAAATTTAAGAGACGCTGTTCAGTTAAATGTGATTGCTACACGACAGCTTATTCTCCTTGCACAACAAATGAAGAATCTGGAAGTGTTCATGCATGTCTCAACAGCATATGCCTACTGCAATCGAAAGCATATTGATGAAATAGTCTATCCACCCCCTGTAGATCCCAAGAAGCTGATTGATTCTTTAGAATGGATGGATGATGGCCTAGTAAATGATATCACACCAAAATTAATAGGAGACAGACCTAATACATACATATACACAAAAGCTTTGGCAGAATATGTTGTACAGCAAGAAGGAGCAAAGCTAAATGTGGCGATTATAAGGCCGTCAATTGTTGGTGCCAGTTGGAAAGAACCTTTTCCTGGATGGATTGATAACTTCAATGGACCAAGTGGTCTCTTTATTGCGGCAGGGAAAGGAATTCTTCGAACAATGCGTGCCTCCAACAACGCCCTTGCAGATCTCGTTCCTGTAGATGTAGTTGTCAACACAAGTCTTGCGGCAGCCTGGTATTCTGGAGTTAATAGACCAAGAAACATCATGGTGTATAATTGTACAACAGGCAGCACTAATCCTTTCCACTGGGGTGAAGTTGCGTGTTATTCAACTCATTTCTTGAGGATGAATCCTTATAACCAAGTACTCAGGCACCCCAGTCTTAAGTTCTGTTCCAACAGCCTGTTATTACATTATTGGAGGGGTGTCAGACATACAGTACCTGCACTGTTGTTCGATCTTGCTCTCAGGTTGACAGGTCAGAAGCCGCGGATGATGAGAACAATAACACGTCTTCACAAAGCTATGGTGTTTCTTGAATATTTCACAAGTAATTCTTGGGTTTGGAATACTGATAATGTCAATATGTTAATGAATCAACTAAACCCTGAAGATAAAAAGACCTTCAATATTGATGTACGACAATTACATTGGGCAGAATATATAGAAAACTACTGCATGGGAACTAAGAAATATGTTTTGAATGAAGAAATGTCTGGTCTCCCTGCAGCTAGAAAACATTTGAACAAGTTGCGGAACATACGTTACGGTTTCAATACTATCCTTGTGATCCTGATCTGGCGCATTTTTATTGCAAGGTCACAAATGGCAAGAAACATCTGGTACTTTGTGGTCAGTCTGTGTTACAAGTTTCTGTCATACTTCAGAGCATCCAGCACTATGAGATACTGA

XM_004851461.1 Coding sequence

Far1 fatty acyl CoA reductase 1, transcript variant X1

Length: 1548 bp    Location: 5623625..5682464   Strand: +
>XM_004851461.1
ATGGTTTCAATCCCAGAATACTATGAAGGAAAGAATGTTCTCCTGACAGGAGCTACTGGTTTTCTGGGAAAGGTGCTTCTGGAAAAGTTGCTGAGGTCTTGTCCTAAGGTGAAGTCAGTGTATGTTTTGGTGAGGCAGAAAGCTGGACTGACACCCCAGGAGCGAGTGGAAGAAGTTCTTAGTGGCAAGCTCTTTGACAGATTAAGAGATGAAAATCCAGATTTTAGAGAGAAAATTGTAGCAATCAACAGTGAACTCACCCAGCCTAAACTGGCTCTTAGTGAAGAAGATAAAGAAGTCATCATAGATTCTACCAATATTATATTCCACTGTGCAGCTACAGTACGGTTTAATGAAAATTTAAGAGACGCTGTTCAGTTAAATGTGATTGCTACACGACAGCTTATTCTCCTTGCACAACAAATGAAGAATCTGGAAGTGTTCATGCATGTCTCAACAGCATATGCCTACTGCAATCGAAAGCATATTGATGAAATAGTCTATCCACCCCCTGTAGATCCCAAGAAGCTGATTGATTCTTTAGAATGGATGGATGATGGCCTAGTAAATGATATCACACCAAAATTAATAGGAGACAGACCTAATACATACATATACACAAAAGCTTTGGCAGAATATGTTGTACAGCAAGAAGGAGCAAAGCTAAATGTGGCGATTATAAGGCCGTCAATTGTTGGTGCCAGTTGGAAAGAACCTTTTCCTGGATGGATTGATAACTTCAATGGACCAAGTGGTCTCTTTATTGCGGCAGGGAAAGGAATTCTTCGAACAATGCGTGCCTCCAACAACGCCCTTGCAGATCTCGTTCCTGTAGATGTAGTTGTCAACACAAGTCTTGCGGCAGCCTGGTATTCTGGAGTTAATAGACCAAGAAACATCATGGTGTATAATTGTACAACAGGCAGCACTAATCCTTTCCACTGGGGTGAAGTTGAATACCATGTAATTTCCACTTTCAAGAGGAATCCTCTCGAACAGGCCTTCAGACGGCCCAATGTAAATCTAACCTCCAATCACCTTTTATATCATTACTGGATTGCTGTAAGCCATAAGGCCCCAGCATTCCTGTATGATACCTACCTCAGGATGACTGGAAGAAGCCCAAGGATGATGAGAACAATAACACGTCTTCACAAAGCTATGGTGTTTCTTGAATATTTCACAAGTAATTCTTGGGTTTGGAATACTGATAATGTCAATATGTTAATGAATCAACTAAACCCTGAAGATAAAAAGACCTTCAATATTGATGTACGACAATTACATTGGGCAGAATATATAGAAAACTACTGCATGGGAACTAAGAAATATGTTTTGAATGAAGAAATGTCTGGTCTCCCTGCAGCTAGAAAACATTTGAACAAGTTGCGGAACATACGTTACGGTTTCAATACTATCCTTGTGATCCTGATCTGGCGCATTTTTATTGCAAGGTCACAAATGGCAAGAAACATCTGGTACTTTGTGGTCAGTCTGTGTTACAAGTTTCTGTCATACTTCAGAGCATCCAGCACTATGAGATACTGA

XM_004851463.1 Coding sequence

Spon1 spondin 1, extracellular matrix protein

High confidence: 3 potential gene matches
Length: 2412 bp    Location: 5889743..6173438   Strand: +
>XM_004851463.1
ATGAGGCTGTCCTTGGCGCCCCGGCGCCCGGCGCTGCTGGCCCTGGCGCTGCCCCTCGCCGTGGCGCTGGCCTTCTCCGACGAGACCTTGGACAAAGTGGCCAAGTCGGAGGGCTATTGCAGCCGCATCCTGCGCGCCCAGGGCACGCGGCGCGAGGGCTACACCGAGTTCAGCCTCCGCGTGGAGGGCGATCCCGAGTCCTACAAGCCGGGAAGCAGCTACCGAGTGACGCTTTCCGCTGCCCCACCTTCCTACTTCAGAGGCTTCACGTTAATTGCCCTCAAGGAGAACAGAGAGGGTGATAAGGAAGAGGACCATGCTGGTACCTTCCAGATCATAGATGAAGAAGAAACCCAATTTATGAGTAACTGCCCTGTGGCAGTCACAGAAAGCACCCCCCGGAGGAGGACACGGATCCAGGTGTTTTGGATAGCACCACCCGCAGGAACAGGCTGTGTGATTTTAAAGGCCAGCATTGTACAGAAGCGCATTATTTATTTTCAAGATGAGGGCTCTCTGACCAAGAAACTTTGTGAACAAGACTCCACATTTGATGGGGTGACTGACAAACCAATCTTAGACTGCTGCGCGTGTGGAACCGCCAAGTATAGACTCACATTTTATGGGAATTGGTCGGAGAAGACACATCCAAAGGATTACCCTCGTCGGGCCAATCATTGGTCTGCAATCATTGGTGGATCCCACTCTAAGAATTATGTGCTGTGGGAGTATGGAGGATACGCCAGTGAAGGTGTTAAACAAGTTGCCGAATTGGGCTCGCCAGTGAAAATGGAGGAAGAAATTCGACAACAGAGTGATGAGGTCCTCACTGTCATCAAAGCCAAAGCCCAGTGGCCAGCCTGGCAGCCTCTCAACGTGAGAGCAGCACCCTCAGCTGAATTTTCAGTGGACAGGACACGCCACTTAATGTCCTTCCTGACCATGATGGGCCCGAGTCCTGACTGGAACGTGGGCTTATCTGCGGAGGATCTCTGCACCAAGGAATGTGGCTGGGTCCAGAAGGTGGTGCAAGACCTGATTCCCTGGGATGCTGGCACCGACAGCGGGGTGACCTATGAGTCACCAAACAAACCCACAATTCCCCAGGAAAAAATCCGGCCCCTGACCAGTCTGGACCATCCCCAGAGTCCTTTCTACGACCCAGAGGGCGGGTCCATCACTCAAGTAGCCAGAGTTGTCATCGAGAGAATCGCCCGGAAGGGGGAACAGTGCAATATTGTGCCTGACAATGTTGATGATATTGTAGCAGACCTGGCTCCAGAAGAAAAAGATGAAGATGACACCCCTGAAACCTGCATCTACTCCAACTGGTCCCCATGGTCGGCCTGCAGCTCCTCCACCTGTGAAAAGGGCAAGAGGATGCGGCAGCGCATGCTGAAGGCACAGCTGGACCTCAGTGTCCCCTGCCCAGATACCCAGGACTTCCAGCCCTGCATGGGCCCCGGCTGCAGTGATGAAGATGGCTCCACCTGCACCATGTCCGAGTGGATCATCTGGTCGCCCTGCAGCATCTCCTGTGGCACCGGCATGCGGTCCCGGGAGAGGTATGTGAAGCAGTTCCCAGAGGACGGCTCCGTGTGCACGCTGCCCACCGAGGAAACCGAGAAGTGCACGGTCAACGAGGAGTGCTCTCCCAGCAGCTGCCTGATGACTGAGTGGGGCGAGTGGGACGAGTGCAGCGCCACCTGCGGGCTGGGCACGAGGAAGCGGCACCGCATGGTCAAAATGAGCCCGGCAGACGGCTCCATGTGCAAGGCTGAGACCTCGCAGTCGGAGAAGTGCATGATGCCCGAATGCCACACCATCCCATGCTTGCTGTCTCCATGGTCCGAGTGGAGTGACTGCAGTGTGACCTGCGGGAAGGGCGTGAGGACCCGCCAGAGGCTGCTCAAGTCTCTGGCAGAACTCGGGGACTGCAATGAGGAACTGGAGCAAGTGGAGAAGTGCATGCTGCCTGAGTGCCCCATCGACTGTGAACTCACCGAGTGGTCCCAGTGGTCAGAATGTAACAAGTCATGTGGGAAAGGCCACATGATTCGAACCCGGATGATCCAAATGGAACCTCAGTTTGGAGGTGCACACTGTCCAGAGACCGTGCAACGCAAGAAGTGCCGTATCCGGAAATGCCTTAGAAATCCATCCGTCCAGAAGCTGCGCTGGAGGGAGGCCCGAGAGAGCCGAAGGAGTGAGCAGCTGCGGGAAGAGTCTGATGGGGAGCAGTTCCCAGGCTGTAAGATGCGTCCATGGACCACCTGGTCAGAATGCACCAAACTGTGTGGAGGTGGGATTCAGGAACGCTATATGACTGTAAAGAAGCGGTTCAAAAGCTCCCAGTTTACCAGCTGCAAAGACAAGAAGGAGATCAGAGCATGCAACGTTCACCCTTGTTAG

XM_004851467.1 Coding sequence

Copb1 coatomer protein complex, subunit beta 1, transcript variant X2

Length: 2862 bp    Location: 6376605..6329554   Strand: -
>XM_004851467.1
ATGACGGCAGCTGAGAACGTGTGCTATACGTTAATTAACGTGCCAATGGATTCAGAACCACCGTCTGAAATTAGCTTAAAAAATGACCTAGAAAAAGGAGATGTGAAATCAAAGACTGAAGCTTTGAAGAAAGTAATCATTATGATCCTGAATGGTGAAAAGCTTCCTGGACTTCTGATGACCATCATTCGTTTTGTGCTACCTCTTCAGGATCACACCATCAAAAAATTGCTTCTGGTATTTTGGGAAATTGTTCCTAAAACAACTCCAGATGGGAGACTTTTACATGAAATGATTCTTGTGTGTGATGCTTACAGAAAGGATCTTCAGCATCCTAATGAATTTATTCGAGGATCTACTCTTCGTTTTCTTTGCAAATTGAAAGAAGCAGAATTGCTAGAACCTTTAATGCCAGCTATCCGCGCTTGCTTGGAACATCGACACAGCTATGTTAGAAGAAATGCTGTTTTAGCCATCTATACTATCTATAGAAATTTCGAACATCTTATACCTGATGCTCCTGAGCTGATACATGATTTTCTGGTGAATGAGAAGGATGCAAGTTGCAAAAGGAATGCATTTATGATGCTAATCCATGCAGATCAGGATCGTGCTTTGGATTACCTGAGTACTTGTATTGATCAAGTTCAAACCTTTGGAGACATTCTGCAGTTGGTTATTGTTGAACTAATTTATAAAGTCTGTCATGCTAATCCTTCAGAAAGGGCTCGTTTCATTCGCTGCATCTATAACTTACTGCAGTCATCTAGCCCAGCTGTGAAATATGAAGCTGCTGGGACATTAGTAACACTTTCAAGTGCACCGACTGCAATCAAGGCTGCTGCTCAGTGTTACATTGATTTAATCATAAAGGAAAGTGACAATAATGTAAAGCTCATAGTTCTGGATCGATTGGTAGAATTAAAAGAACATCCTCCTCATGAACGAGTCCTCCAGGATCTGGTAATGGACATCCTAAGAGTATTGAGTACACCAGACTTAGAAGTACGCAAGAAAACTCTGCAGTTAGCACTGGATCTTGTCTCTTCTAGGAATGTTGAAGAGCTGGTTATTGTCTTGAAGAAGGAAGTGATTAAAACAAATAATGTGTCTGAGCATGAAGACACTGACAAATACAGACAACTCCTTGTACGAACATTACATTCCTGTTCTGTCCGGTTTCCAGATATGGCTGGAAATGTTATTCCTGTGTTAATGGAGTTTCTCAGTGACAGTAACGAAGCGGCAGCTGCTGATGTCTTGGAATTTGTTCGAGAAGCCATTCAGCGCTTTGATAACCTGAGAATGCTGATTGTTGAGAAGATGCTTGAAGTCTTTCATGCTATTAAATCTGTCAAGATCTATCGCGGAGCATTATGGATCCTGGGAGAATACTGTAGTACCAAGGAAGACATTCAGAGTGTGATGACTGAAGTCCGCAGGTCGCTGGGGGAGATCCCAATTGTGGAGTCAGAAATAAAGAAAGAAGCTGGTGATTTAAAACCTGAAGAGGAAATAACTGTGGGGCCGGTTCAGAAATTGGTTACTGAAATGGGTACCTATGCAACTCAGAGTGCCCTCAGCAGTTCTAGACCCACCAAGAAGGAGGAAGACAGACCTCCCCTGAGAGGATTTCTTCTGGATGGAGATTTTTTTGTTGCTGCTTCTCTTGCCACAACTCTGACCAAGATTGCATTGCGCTATGTAGCTTTGGTTCAGGAGAAGAAAAAGCAAAATTCTTTTGTTGCTGAGGCTATGTTGCTCATGGCAACTGTCCTTCATTTGGGAAAATCTTCTCTTCCTAAGAAGCCAATTACAGATGATGATGTAGACCGAATTTCCCTGTGCCTCAAGGTCTTGTCCGAATGTTCGCCTTTAATGAATGACATTTTCAATAAGGAATGCAGACAGTCTCTTTCTCAAATGTTATCTGCCAAACTTGAAGAAGAGAAACTATCCCAAAAGAAAGAATCTGAAAAGAGGAATGTGACAGTACAGCCTGATGACCCCATTTCCTTCATGCAACTAACTGCTAAGAATGAAATGAACTGCAAGGAAGATCAGTTTCAGCTGAGTTTGTTGGCAGCAATGGGTAACACTCAGAGGAAAGAGGCAGCAGATCCCCTAGCGTCTAAACTTAACAAGGTCACCCAGTTGACCGGTTTCTCAGATCCTGTGTATGCAGAAGCTTACGTTCATGTCAACCAATATGATATTGTCCTGGACGTACTTGTTGTGAACCAAACCAGTGATACTTTGCAGAACTGCACATTGGAGTTAGCTACTCTAGGGGATCTGAAACTTGTGGAAAAGCCATCTCCTTTGACTCTTGCTCCTCATGATTTTGCAAATATTAAAGCTAATGTCAAAGTAGCATCAACAGAAAATGGAATAATTTTTGGTAATATAGTTTATGATGTCTCTGGAGCAGCAAGTGACAGAAATTGTGTGGTCCTCAGTGATATCCACATTGACATTATGGACTATATCCAGCCTGCAACCTGCACTGATGCTGAATTCCGTCAGATGTGGGCTGAATTTGAATGGGAAAACAAAGTGACAGTTAACACCAATATGGTTGATTTAAATGACTATTTACAGCACATATTAAAGTCAACCAACATGAAGTGCCTCACTCCAGAGAAGGCCCTTTCTGGTTACTGTGGCTTCATGGCAGCCAACCTTTATGCTCGTTCTATATTTGGAGAAGATGCACTTGCAAATGTCAGCATTGAAAAGCCAATTCACCAAGGGCCAGATGCTGCTGTTACTGGCCATATAAGAATTCGTGCAAAGAGTCAGGGAATGGCCTTAAGTCTTGGAGATAAAATCAACTTGTCTCAGAAGAAAACTAGTATATAA

XM_004851468.1 Coding sequence

Copb1 coatomer protein complex, subunit beta 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 2862 bp    Location: 6376605..6334548   Strand: -
>XM_004851468.1
ATGACGGCAGCTGAGAACGTGTGCTATACGTTAATTAACGTGCCAATGGATTCAGAACCACCGTCTGAAATTAGCTTAAAAAATGACCTAGAAAAAGGAGATGTGAAATCAAAGACTGAAGCTTTGAAGAAAGTAATCATTATGATCCTGAATGGTGAAAAGCTTCCTGGACTTCTGATGACCATCATTCGTTTTGTGCTACCTCTTCAGGATCACACCATCAAAAAATTGCTTCTGGTATTTTGGGAAATTGTTCCTAAAACAACTCCAGATGGGAGACTTTTACATGAAATGATTCTTGTGTGTGATGCTTACAGAAAGGATCTTCAGCATCCTAATGAATTTATTCGAGGATCTACTCTTCGTTTTCTTTGCAAATTGAAAGAAGCAGAATTGCTAGAACCTTTAATGCCAGCTATCCGCGCTTGCTTGGAACATCGACACAGCTATGTTAGAAGAAATGCTGTTTTAGCCATCTATACTATCTATAGAAATTTCGAACATCTTATACCTGATGCTCCTGAGCTGATACATGATTTTCTGGTGAATGAGAAGGATGCAAGTTGCAAAAGGAATGCATTTATGATGCTAATCCATGCAGATCAGGATCGTGCTTTGGATTACCTGAGTACTTGTATTGATCAAGTTCAAACCTTTGGAGACATTCTGCAGTTGGTTATTGTTGAACTAATTTATAAAGTCTGTCATGCTAATCCTTCAGAAAGGGCTCGTTTCATTCGCTGCATCTATAACTTACTGCAGTCATCTAGCCCAGCTGTGAAATATGAAGCTGCTGGGACATTAGTAACACTTTCAAGTGCACCGACTGCAATCAAGGCTGCTGCTCAGTGTTACATTGATTTAATCATAAAGGAAAGTGACAATAATGTAAAGCTCATAGTTCTGGATCGATTGGTAGAATTAAAAGAACATCCTCCTCATGAACGAGTCCTCCAGGATCTGGTAATGGACATCCTAAGAGTATTGAGTACACCAGACTTAGAAGTACGCAAGAAAACTCTGCAGTTAGCACTGGATCTTGTCTCTTCTAGGAATGTTGAAGAGCTGGTTATTGTCTTGAAGAAGGAAGTGATTAAAACAAATAATGTGTCTGAGCATGAAGACACTGACAAATACAGACAACTCCTTGTACGAACATTACATTCCTGTTCTGTCCGGTTTCCAGATATGGCTGGAAATGTTATTCCTGTGTTAATGGAGTTTCTCAGTGACAGTAACGAAGCGGCAGCTGCTGATGTCTTGGAATTTGTTCGAGAAGCCATTCAGCGCTTTGATAACCTGAGAATGCTGATTGTTGAGAAGATGCTTGAAGTCTTTCATGCTATTAAATCTGTCAAGATCTATCGCGGAGCATTATGGATCCTGGGAGAATACTGTAGTACCAAGGAAGACATTCAGAGTGTGATGACTGAAGTCCGCAGGTCGCTGGGGGAGATCCCAATTGTGGAGTCAGAAATAAAGAAAGAAGCTGGTGATTTAAAACCTGAAGAGGAAATAACTGTGGGGCCGGTTCAGAAATTGGTTACTGAAATGGGTACCTATGCAACTCAGAGTGCCCTCAGCAGTTCTAGACCCACCAAGAAGGAGGAAGACAGACCTCCCCTGAGAGGATTTCTTCTGGATGGAGATTTTTTTGTTGCTGCTTCTCTTGCCACAACTCTGACCAAGATTGCATTGCGCTATGTAGCTTTGGTTCAGGAGAAGAAAAAGCAAAATTCTTTTGTTGCTGAGGCTATGTTGCTCATGGCAACTGTCCTTCATTTGGGAAAATCTTCTCTTCCTAAGAAGCCAATTACAGATGATGATGTAGACCGAATTTCCCTGTGCCTCAAGGTCTTGTCCGAATGTTCGCCTTTAATGAATGACATTTTCAATAAGGAATGCAGACAGTCTCTTTCTCAAATGTTATCTGCCAAACTTGAAGAAGAGAAACTATCCCAAAAGAAAGAATCTGAAAAGAGGAATGTGACAGTACAGCCTGATGACCCCATTTCCTTCATGCAACTAACTGCTAAGAATGAAATGAACTGCAAGGAAGATCAGTTTCAGCTGAGTTTGTTGGCAGCAATGGGTAACACTCAGAGGAAAGAGGCAGCAGATCCCCTAGCGTCTAAACTTAACAAGGTCACCCAGTTGACCGGTTTCTCAGATCCTGTGTATGCAGAAGCTTACGTTCATGTCAACCAATATGATATTGTCCTGGACGTACTTGTTGTGAACCAAACCAGTGATACTTTGCAGAACTGCACATTGGAGTTAGCTACTCTAGGGGATCTGAAACTTGTGGAAAAGCCATCTCCTTTGACTCTTGCTCCTCATGATTTTGCAAATATTAAAGCTAATGTCAAAGTAGCATCAACAGAAAATGGAATAATTTTTGGTAATATAGTTTATGATGTCTCTGGAGCAGCAAGTGACAGAAATTGTGTGGTCCTCAGTGATATCCACATTGACATTATGGACTATATCCAGCCTGCAACCTGCACTGATGCTGAATTCCGTCAGATGTGGGCTGAATTTGAATGGGAAAACAAAGTGACAGTTAACACCAATATGGTTGATTTAAATGACTATTTACAGCACATATTAAAGTCAACCAACATGAAGTGCCTCACTCCAGAGAAGGCCCTTTCTGGTTACTGTGGCTTCATGGCAGCCAACCTTTATGCTCGTTCTATATTTGGAGAAGATGCACTTGCAAATGTCAGCATTGAAAAGCCAATTCACCAAGGGCCAGATGCTGCTGTTACTGGCCATATAAGAATTCGTGCAAAGAGTCAGGGAATGGCCTTAAGTCTTGGAGATAAAATCAACTTGTCTCAGAAGAAAACTAGTATATAA

XM_004851471.1 Coding sequence

LOC101724787 vitamin D 25-hydroxylase-like

Length: 1506 bp    Location: 6677986..6667097   Strand: -
>XM_004851471.1
ATGTGGCAGGTTCCGGGAGCCGAGGCCTGCGCTGAGGCGCTCGGCGGCGCGCTCTTCCTGCTGCTTTTCGCGCTGGCCGTCCGCCAGATGCTGAAGCAGAGGCGGCCAGTGGGCTTCCCGCCGGGGCCGCCGGGGCTGCCATTTATCGGCAACATCTTCTCCCTGGCCGCCTCCGCGGAGCTTCCGCATGTCTACATGAGAAGGCAGAGCCAGGTGTACGGCGAGATTTTCAGTTTGGATCTTGGAGGCATATCAGCAGTGGTTCTAAATGGCTATGACACAGTAAAGGAATGCCTTGTTCATCAAAGTGAAATTTTTGCAGACAGACCATGCCTTCCGTTATTCATGAAGATGACAAAAATGGGAGGCTTACTCAATTCCAGGTATGGCCGAGGATGGATTGATCACAGAAGATTGGCTGTAAACAGCTTTCGATATTTTGGATACGGCCAAAAATCTTTTGAATCTAAGATCTTAGAAGAAACCAAATTTTTCATTGATGCTATTGAAACATACAAAGGTAGACCTTTTGACTTGAAACACTTAATAACTAATGCTGTTTCAAATATAACCAATCTGATCATTTTTGGAGAAAGATTTGCTTATGAAGACACTAATTTTCAGCAAATGATTGAGTTATTTAGCGAAAATGTGGAACTAGCTACCAGTGCCTCAGTCTTCCTGTATAATGCCTTTCCATGGATTGGTATCTTGCCTTTTGGAAAACATCAGCAGCTGTTTAGAAATGCAGCTGTGGTCTACGATTTTCTCTCCAGACTAATTAAAAATGCTTCAGTCAACAGAAAGCCTCAGTTACCTCAGCATTTTGTTGATGCTTATTTAGATGAGATGGATCAAGGTAAAAATGACCCATCATCTACTTTCTCCAAAGAAAACCTAATTTTCTCCGTGGGTGAACTCATCATTGCTGGAACAGAAACTACAACCAATGTGCTACGCTGGGCAATTCTTTTCATGGCCCTTTATCCTAGCATTCAAGGACAAGTTTGGAAAGAGATTGATTTAATTATTGGCCCCAATAGACAGCCTTCTTGGGATGACAAATACAAAATGCCATATACTGAAGCAGTTTTGCATGAAGTTTTAAGATTCTGTAATATAGTTCCATTAGGAATTTTCCATGCAACCTCTAAAGATGCAGCTGTACGTGGTTATTCTATTCCAAAAGGCACAACAGTAATTACAAATCTTTATTCTGTGCACTTTGAAGAAAAGTACTGGAAAGACCCAGAAGTGTTCTGTCCTGAGCGATTTCTGGATAGCAGTGGCTATTTTGTCAAAAAGGAAGCTTTTGTTCCTTTTTCCTTAGGGAGAAGACATTGTCTTGGAGAACATCTGGCTCGGATGGAAATGTTCTTGTTTTTTACCGCATTGCTTCAGCAGTTTCATTTGCATTTCCCACATGAACTAGTTCCAAATCTGAAGCCCAGGTTAGGTATGACATTGCAGCCCCAGCCTTACCTCATCTGTGCTAAAAGGCGCTGA

XM_004851472.1 Coding sequence

Calca calcitonin-related polypeptide alpha, transcript variant X1

High confidence: 4 potential gene matches
Length: 423 bp    Location: 6769230..6766185   Strand: -
>XM_004851472.1
ATGGGCTTCCAGAAGTTCTCCCCATTCCTGGCTCTCAGCATCTTAGTTCTGTACCTCTCAAGCAACCTGCATGCAGTGCCATTCAGGCAGGACTTGGAGAGCAGCCCAGTCCTGGTCGAGCTAGGTGAAGAGGAAGCGCGCCTCCTGCTGGCAGCACTGGTGCAGGACTACCTGCAGATGAAGGCCAGTGAGCTGGAGCAGGACCAGGAGACAGAGGGCTCCAGCCTGGACAGCCCCAGATCTAAGCGATGTGGTAATCTGAGTACCTGCATGCTGGGCACCTACACACAGGACCTCAACAAGTTTCACACATTCCCCCAAACTGCAATTGGGGTTGGAGCACCTGGCAAGAAAAGGGATATGGCCAGTGACTTGGAGACAAACCACCACCCTCTTGTTGGCATGCCCCAGGATGCCAACTAA

XM_004851476.1 Coding sequence

Insc inscuteable homolog (Drosophila)

High confidence: 4 potential gene matches
Length: 1743 bp    Location: 6884824..7016335   Strand: +
>XM_004851476.1
ATGAGGAGGCCCCCAGGGAATGGAGAGGTGGCCAGTGAAGGTCCAGGCGGCTGGGGCCTATGGGGAGGAGTCCAGGGGTCCAGGAGGCTGTGCTGTGCTGGGCCTGACCACTGTGGGAAGGCCTTGTTGCACATTGGAATCAACATGATGGCCCTCCCTGGAGGCCGCCACCTGGACTCCATCCCTCTGCCTGGGCAGCGGCTGCACCTCCTGCAGGTGGACTCGGTCCAGCGCTGGATGGAGGACCTCAAGCTCATGACCGAGTGTGAGTGCATGTGTGTCCTGCAGGCGAAGCCCATCAGCCTGGAGGAGGACACGCAAGGAGATCTCATCTTGGCGGGTGGACCGGGCCCTGGAGAACCTCTGCAGCTGCTGCTCAAGCGGGGCTGGGTCATCAGCACTGAGCTGCGCAGGATCGGGCAGAAGCTGGCCCAGGAGCGCTGGGCCCGAGTGCACAGCATGAGCGTACGACTAACATGCCATGCCCGCTCCATGGTCAGCGAGTACAACGCGGCCAGCAGGAGCCCCTCGCAGGAAATGGGCCAGGTGGAGAAGCTGCTAATGGAAAAATGTTCAGAGCTCTCTGCAGTCACAGAGAGGTGCCTCCAGGTGGAGAAGGAGCATGTCCTGAAGTCGATGAAGGCCTGCGTGAGTGAGACCCTGAGCACGCTGGGCCAGCACTTCGGCCAGCTGTTGGAGCTGGCTCTGACACGGGAGGTGCAGGCACTGGTGAGAAAAATTGATGCCTCGGACAACATCTATACCATGGAGTCCACCACAGGGAACTTGTTCAGCCTGACCCAGGAGGGTGCGCCTTTGTGCCGCATCATAGCCCAGGAGGGTGGGGTCGTGGCCCTCTTCAAGGTCTGCCGGCAGGACAGTTTCCGGTGCTTGTACCCCCAGGCACTCCGAACACTGGCCTCCATCTGCTGTGTGGAAGAGGGTGTCCACCAACTGGAGAAGGTGGATGGTGTTCTGTGCTTGGCCGACATCCTGACTGACGACAGCAATTCAGAAGCCACTCGAGCTGAGGCTGCAGCTGTGGTGGCCCAGGTCACCTCTCCACATCTGTCCTTCACCCAGCATCTCAGTAGCTTCCTGGAGAGCATGGAGGAGATTGTGACAGCCCTCGTCAAGCTTTGCCAAGAGGCCTCATCTGGAGAAGTCTTCCTCCTGGCCTCTGCAGCCCTTGCCAACATCACCTTTTTTGACACAATGGCCTGTGAAATGCTTCTGCAGCTGAACGCCATCCACGTCCTCTTAGAAGCCTGCAGCGACAAGCAGAGAGTGGATACGCCTTATACCCGGGACCAGATTGTGACCATCTTGGCGAACATGTCTGTCCTGGAGCAGTGTGCCTCTGACATCATTCAGGAGAATGGGGTCCAGCTCATCATGGGCATGCTGTCTGAGAAGCCAAGGTCAGGGACCCCCGCCGAAGTGGCAGCCTGTGAGAGGGTCCAACAGAAAGCTGCAGTGACGCTGGCCCGTCTCAGCCGAGACCCAGAGGTGGCACGGGAAGCCGTACGGCTTAGCTGTGTGTCCCGTCTCATCGAGCTCTGCAGATCTCCTTCGGAAAGGAACAGCAGTGATGCTGTGCTCGTGGCCTGCCTGGCTGCTCTGCGTCGATTGGCTGGGGTCTGCCCTGAAGGCCTCCAGGACTCGGACTTCCAGCAGCTGGTCCAGCCCAGGCTTGTGGACTCCTTCTTACTCTGCAGCAACATGGAGGAGAGTTTTGTGTAG

XM_004851482.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X6

Length: 2532 bp    Location: 8296962..7683495   Strand: -
>XM_004851482.1
ATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGAAAGGTCATGTCTCTCACCCACAAATTAACCCAAGGCTAAAGGGCATAAGTGACCGTTTTGGCAGGAATTTGGACACCTTTGAACATGGTGGTGGCCACTCTTACAACCACCAACAGATTGAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGGTAAATGGAAAAGTCAACACCAGGAAGAGACTTATGAATTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAAGTAAAGCAATGAATGGCTCTGCAGCTAAACTACAGCAGTATTATTGTTGGCCAACAGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851479.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X3

Length: 2532 bp    Location: 8084639..7683495   Strand: -
>XM_004851479.1
ATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGAAAGGTCATGTCTCTCACCCACAAATTAACCCAAGGCTAAAGGGCATAAGTGACCGTTTTGGCAGGAATTTGGACACCTTTGAACATGGTGGTGGCCACTCTTACAACCACCAACAGATTGAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGGTAAATGGAAAAGTCAACACCAGGAAGAGACTTATGAATTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAAGTAAAGCAATGAATGGCTCTGCAGCTAAACTACAGCAGTATTATTGTTGGCCAACAGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851478.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X2

Length: 2568 bp    Location: 8047808..7683495   Strand: -
>XM_004851478.1
ATGCCCTCGAGTTCTGAAGTTCTGGCTGATGTGGTAAGAGAAAGCCGGATTGAAGAGTGGAAGAGCAGCCACTTCATAAGAATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGAAAGGTCATGTCTCTCACCCACAAATTAACCCAAGGCTAAAGGGCATAAGTGACCGTTTTGGCAGGAATTTGGACACCTTTGAACATGGTGGTGGCCACTCTTACAACCACCAACAGATTGAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAAGTAAAGCAATGAATGGCTCTGCAGCTAAACTACAGCAGTATTATTGTTGGCCAACAGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851484.1 Coding sequence

Sox6 SRY (sex determining region Y)-box 6, transcript variant X8

High confidence: 4 potential gene matches
Length: 2490 bp    Location: 8047808..7683495   Strand: -
>XM_004851484.1
ATGCCCTCGAGTTCTGAAGTTCTGGCTGATGTGGTAAGAGAAAGCCGGATTGAAGAGTGGAAGAGCAGCCACTTCATAAGAATGTCTTCCAAGCAAGCCACCTCTCCATTTGCCTGTGCAGCTGATGGAGAGGAAGCCATGACCCAGGATTTGACCTCAAGGGAAAAGGAAGAGGGCAATGATCAACATGTGGCCTCCCATCTGCCCCTGCACCCCATAATGCACAACAAACCTCACTCTGAGGAGCTACCAACACTTATCAGTACCGTTCAACAAGATGCTGACTGGGACAGTGTTCTGTCATCCCAGCAAAGAATGGAGTCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGAGCAGTGTTGCTTTTGGAACCCCAGAGCGCCGCCGAGGGAGCCTTGCTGATGTGGTGGATACACTGAAACAGAAGAAGCTTGAGGAGATGACTCGGACTGAACATGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACAAGTGAACTTCTTGGAGAAATTAAAGGAACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACTATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTCCTGGCAGCGCATGATGAACAGAAAAAACTGGCAGCCTCACAAATTGAGAAACAACGGCAGCAAATGGACCTTGCTCGCCAACAGCAAGAACAGATTGCAAGACAACAGCAGCAACTTCTGCAACAGCAGCACAAAATTAATCTCCTGCAGCAACAGATCCAGCAGGTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACCCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGGTGATAACTATCCTGTACAGTTCATTCCATCAACAATGGCAGCTGCTGCTGCTTCTGGACTCAGCCCTTTACAGCTCCAGCAGCTCTACGCCGCTCAGCTGGCCAACATGCAGGTGTCACCTGGAGCAAAGATGCCATCAACTCCGCAGCCTCCAAACACAGCAGGCGCCATCTCACCTACTGGGATAAAAAATGAAAAGAGAGGGACCAGCCCTGTAACTCAAGTTAAGGATGAAGCAGCAGCACAGCCGCTGAATCTCTCATCCAGACCCAAGACTGCAGAGCCTATAAAGTCCCCAACATCTCCCACCCAGAGCCTCTTCCCAGCCAGCAAAACTAGCCCTGTCAATCTGCCAAACAAAAGCAGCATCCCCAGCCCCATTGGAGGAAGCTTGGGAAGAGGATCCTCTTTAGGTAAATGGAAAAGTCAACACCAGGAAGAGACTTATGAATTAGATATCTTGTCCAGTCTCAACTCCCCTGCCCTGTTTGGGGATCAGGACACAGTGATGAAAGCCATTCAGGAGGCTCGGAAAATGCGAGAACAGATCCAGCGGGAGCAACAGCAGCAACAGCCACATGGAATTGATGGAAAACTGTCCTCCATGAATAATATGGGACTGAACAACTGCAGGAATGAAAAGGAAAGAACACGCTTTGAGAATTTGGGGCCCCAGTTAACAGGAAAGTCAAGTGAAGATGGAAAGCTGGGCCCAGGTGTCATCGACCTTACTCGGCCAGAAGATGCAGAGGGAAGTAAAGCAATGAATGGCTCTGCAGCTAAACTACAGCAGTATTATTGTTGGCCAACAGGAGGTGCCACTGTGGCTGAAGCTCGAGTCTACAGGGATGCCCGAGGCCGGGCCAGCAGTGAGCCACACATCAAGAGACCAATGAATGCATTCATGGTTTGGGCGAAGGACGAGAGGAGGAAAATCCTTCAGGCCTTCCCTGACATGCACAACTCCAACATTAGTAAAATATTAGGATCTCGCTGGAAATCCATGTCGAACCAGGAGAAGCAGCCTTATTATGAAGAGCAGGCCCGGCTAAGCAAGATCCACTTAGAGAAGTATCCAAACTATAAATACAAACCCCGGCCGAAACGCACCTGCATTGTTGATGGCAAAAAGCTCCGGATCGGGGAGTATAAGCAACTGATGCGGTCTCGGCGACAAGAAATGAGGCAGTTCTTTACTGTGGGGCAACAGCCTCAGATTCCAATCACCACAGGAACAGGTGTTGTGTATCCTGGTGCTATTACTATGGCAACTACCACACCATCACCTCAGATGACATCTGACTGCTCTAGCACCTCTGCCAGCCCGGAGCCCAGCCTCCCTGTCATCCAGAGCACTTACGGAATGAAGACAGACGGTGGAAGCCTCACTGGAACCGAAATGATGAACGGAGAGGATGAAATGGAAATGTACGACGACTATGAAGACGATCCCAAATCAGACTATAGCAGTGAAAACGAAGCCCCGGAGGCTGTTAGTGCCAACTGA

XM_004851490.1 Coding sequence

Plekha7 pleckstrin homology domain containing, family A member 7, transcript variant X2

Length: 3678 bp    Location: 8564088..8421178   Strand: -
>XM_004851490.1
ATGGAATCGCGGCGGTGCTGGCCCGAGGACGCGTGTCCCACAGCCTTAGGGGGCTGGCGGGAACCGCCGAGGGGGCCCTGCAGCCATAACCAGCAGACCACAGCATTCAGGCATCCTGTGACTGGGCAATTTTCTCCAGAAAATAGCGAATTCATTCTTCAAGAAGAACAAAACCTACACATGTCAAAGCAAGAGAAAAACCAAAGACCATCCAGCATGGTCAGCGAATCGTCCACAGCTGGGACCACGTCCACCCTGGAGGCCAAGCCTGGACCCAAGATCATCAAGTCCAGCAATAAAGTCCATAGCTTTGGGAAGAGGGATCAAGCCATTCGGAGGAACCCCAATGTTCCGGTGGTGGTGAGGGGCTGGCTGCACAAGCAGGATAGTTCTGGGATGAGACTGTGGAAGAGGAGGTGGTTTGTGCTTGCTGATTACTGCTTGTTTTACTATAAAGACAGCCGAGAAGAAGTGGTCCTGGGAAGCATCCCTCTGCCCAGCTATGTGATCTCACCTGTGGCCCCTGAGGATCGCATAAGTCGCAAGTACTCTTTTAAGGCTGTGCACATGGGGATGCGAGCACTCATCTACAACAGCTCCATGGCAGGCTCCCAGGCTGAGCAGTCGGGCATGAGAACTTACTACTTCAGTGCCGATACCCTGGAAGACATGAATGCTTGGGTGAGGGCCATGAACCAGGCTGCACAGGTGCTGTCTCGATCATCACTGAAGAGGGATTTGGAGAAAGTGGAGCGGCAGGCAGTACCTCAGGCCAACCACACAGAGTCTTGTCGAGCGTGTGGCCATGTGAGACCTGGACACTCAAGGAATTGTCCTCATCACAGCCATGATGACTCTTTTGGCTTTGAGAAGCGGGAGCAGGAAGAAGAGCAGTACCATTCCCAGAGGGACCCACTGGAGGGCAAGCGGGAAAGGAGCAAGACCAGGTCCCCGTACTCGCCCACCGAGGAGGATACCTTGTTTATAGATTTACCCAGTGGCCCAAGAGGCCAGCAGGCCCAGCCCCAGCGCTCCGAGAAGAATGGCATGTTGCCCTCCTCCTGTGGCCCTGAAGAGCAGAATGGTACTGGAGGGTACCCTTGGCCCTTACCCCTCAGGGCCACCGCAGAGAAGCACAGCCAGAGGAAGAGCAGCCTGGCCCAGGCAGAGCACTGGGCAAAGGCCCTGAAGACAGACAGCAAGAGCCTTCCTTCAGAGCAGACACTTTCTCGCCAGGGTCCTAGCCAGCTCCTGTCCTTCCCAGAAAACTACCAGACCCTTCCCAAGAGCACCCGGCACCCCTCGGGGGACTCCTCACCCCCTCTGCGGAACCTGCCCAGTGACTACAAGTATGCACAGGACCGTGCTAGCCACCTGAAGATGTCGAGTGAGGAGCGCCGGGCACACCGGGATGGCACCGTATGGCAGCTGTATGAGTGGCAGCAGCGCCAGCAGTTCCGGCATGGCAGTCCCACGGCACCCATGTGTGCTGGCTCCCCGGAGTTTGCAGACCAGGGCAGGAGCAGGAGCATGCTGGAGGTTCCCCGCTCCATCTCTGTGCCTCCATCACCCTTGGACATACCTCCCCCGGGGCCCCCAAGGGTCTTCCTGCACAGGCGGCCACACACACCAGCAGAGCGTGTCACTGTAAAGCCACCAGACCAGAGGAGGAGTTTGGACATCTCGCTGGGGAGCTCTCCCAGGAAGGCACGGGGCCATGCCATCAAGAACTCCTCGCACATGGACCGACGCTCCATGCCCTCCATGGGTTACATGACCCACACTGTCAGTGCTCCCAGTTTGCATGGAAAATCGGCTGATGACACCTATCTTCAGCTGAAGAAAGACTTGGAATATCTGGATCTAAAGATGACAGGCCGGGACCTTCTCAAGGATCGAAGCCTGAAGCCTGTGAAGATTGCTGAGAGTGACATTGACGTCAAACTGAGCATCTTTTGTGAACAAGACAGGATCCTCCAGGACCTGGAAGATAAGATTCGAGCCCTCAAGGAGAACAAAGATCAGCTAGAATCCGTGCTAGAGGTGTTACACAGACAGATGGAGCAGTACCGAGACCAGCCGCAGCACCTGGAGAAGATTACCTACCAGCAGAGGTTGCTGCAGGAGGACCTGGTCCACATCCGAGCTGAGCTCTCCAGAGAATCCACCGAGATGGAAAATGCCTGGAATGAGTACCTGAAGTTGGAGAGCGATGTGGAGCAGCTGAAGCAGACCCTGCAGGAACAACAGAGACGAGCCTTTTTTTTCCAGGAGAAATCGCAGATACAGAAGGACCTGTGGAGGATTGAAGATGTCCTTGCAGGTCTGAGTGCTAATAAAGAGAACTACAGAATCCTGGTGGAATCGGTCAGAAATCCTGAGAGAAAAACGGTGCCTTTGTTCCCTCACCCGCCTGTGCCTTCACCCTTGACCTTGGAGAGCAAGTCCCCCCTGCAGCCCAGCCCTCCTGCCAGCCCAGTGCGGACCCCTCTGGAAGTTCGGCTGTTCCCACAGCTGCAGACCTATGTGCCCTACCGACCTCACCCACCCCAGCTGAGGAAAGTGACATCTCCCCTTCAGTCACCAACTAAGACAAAACCCAAAGTGGAAGATGAGGCACCTCCTAGGCCCCCGCTTCCCGAACTCTACAGCCCAGAGGACCAGCCACCTGCTGTGCCCCCTCTACCAAGGGAGGCCACCATCATCCGGCACACTTCTGTGAGGGGCCTCAAGCGGCAGTCGGACGAGAGGAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGACTCGAAGGTGGAGCTCCGGTCATCTGTTAGTGAGCCCGAGCTGGCCACCATCACTGGGCACCTGGCTCAGCCCTCCCTGGGACTCGTGGGTCCTGAGAGCAGGTACCAGACACTTCCTGGCCGAGGGCTCTCGGGGTCCATGTCCAGGCTCCAGCAGTCATCCACCATTGCGCCCTACGCCACGCTCCGGAGGGGTCTAAATGCGGAAAGCGGCAAGATGACCTTCCCTAGACCCAAGAGTGCCTTGGAGCGTCTGTACTCAGGGGACCACCAGCAAGGCAAGATGAGTGCTGAGGAGCAGCTGGAGCGCATGAAGCGGCACCAGAAGGCCCTAGTCCGAGAGCGCAAGAGAACACTGAGCCAAGCAGAGAGGACAGGCCCGGCCTCAGCGAGCTATCTTGGCCAGCTGCTCCCTGGGGACCTGGGCTCATGGAAGCGAGAGCAGGACTTTGACCTGCAATTGCTGGAGCGGGCCATGCAAGGGGAAAGGAAGGACAAGGAGGAGAATGGCTGGTTGAAAGTGCAGGCCATGCCTGTCACGGAGGTGGACCTGGAACCACAAGACTATGACCTGGACATCAGCAGAGAGCTGTCCAAACCAGAGAAAGTCTCCATCCCTGAGCGCTATGTGGAGATGGATCCCGAAGAGCCACCTAGCCTCGAAGAGCTGCAGGCACGTTACCGCAAAGCTGAGAAGATCCGCAACATCCTCACCCGGTCAAGCATGTGTAACCTCCAGCCCTCAGCAGCCCAGGACCGAAACAGCCTGGTGGACTTGGACTCCCAGCTGCAGGAGCAGGAGCGCATCATCAATATTTCCTATGCCCTGGCCTCTGAAGCCTCCCAGCGCAGCAAGCAGGTGGCAGCCCAGGCAGTGACAGACCTGTGA

XM_004851493.1 Coding sequence

Rps13 ribosomal protein S13

High confidence: 4 potential gene matches
Length: 456 bp    Location: 8695743..8692468   Strand: -
>XM_004851493.1
ATGGGTCGCATGCATGCTCCCGGGAAAGGCCTGTCCCAGTCGGCTCTGCCGTATCGCCGCAGTGTCCCCACCTGGCTGAAGCTGACGTCTGACGACGTGAAGGAGCAGATTTACAAACTGGCCAAGAAGGGCCTCACTCCCTCACAAATCGGTGTGATCCTGAGAGACTCCCACGGTGTTGCACAAGTACGTTTTGTGACGGGTAATAAAATCTTGAGAATTCTTAAATCTAAAGGACTTGCTCCTGATCTCCCTGAGGATCTCTACCATTTAATTAAGAAAGCAGTTGCTGTTCGAAAGCATCTTGAGAGGAACAGAAAGGATAAGGATGCCAAGTTCCGTCTGATCCTGATTGAGAGCCGGATTCACCGATTGGCTCGATATTATAAGACCAAGAGGGTCCTCCCCCCCAATTGGAAATATGAATCATCCACAGCCTCTGCCCTGGTGGCATAA

XM_004851498.1 Coding sequence

Nucb2 nucleobindin 2, transcript variant X3

Length: 1263 bp    Location: 8907480..8943838   Strand: +
>XM_004851498.1
ATGAGGTGGAGGACCATTCCACTATGCTATTGTTTTCTCTTGGTCACATGTCTACTTGCTGCTCTTCAAGCTGTGCCTATAGACATCGACAAGACAAAAGTACAAAATACTGAACCTGTGGAAAGTGCAAAGATAGAACCACCAGATACTGGACTTTATTATGATGAATATCTCAAGCAAGTTATTGATGTGCTGGAAACAGATAAACATTTCAGAGAAAAGCTTCAGAAAGCAGACATAGAGGAAATAAAGAGTGGGAAGCTAAGCAAAGAGCTGGACTTGGTAAGTCACCACGTGAGGACAAAACTTGACGAACTGAAAAGGCAAGAAGTAGGAAGGTTAAGAATGCTAATTAAAGCTAAACTGGATTCCTTTCAAGATATGGGCATGGACCACCAAGCTCTTCTAAAACAATTTGATCACCTAAATCATATGAATCCTGACAAGTTTGAATCCACAGATTTAGATATGCTAATCAAAGCGGCAACAAAAGATTTGGAACAGTATGACAAGACTAGACATGAAGAATTTAAAAAATATGAAATGATGAAGGAACATGAACGGAGAGAATATTTAAAAACACTAGATGAAGAAAAGAGAAAAGAAGAAGAATCTAAATTTGAAGAAATGAAGAGGAAGCATGAAAACCATCCCAAAGTTAATCATCCAGGAAGCAAAGATCAACTAAAAGAGGTATGGGAAGAGACTGATGGATTGGACCCTAATGACTTTGACCCCAAGACATTTTTCAAATTACATGATGTCAATAGCGATGGATTCCTGGATGAACAAGAATTAGAAGCCCTGTTTACTAAGGAGTTGGAGAAAGTGTATGATGCCCAAAATGAGGAGGATGATATGGTGGAAATGGAGGAAGAAAGGCTTAGAATGAGGGAGCATGTAATGAATGAGGTTGATACAAACAAAGACCGGTTGGTGACTCTGGAAGAATTTTTGAAAGCTACAGAAAAAAAGGAATTCTTGGAGCCAGATAGCTGGGAGACACTGGATCAGCAACAACTCTTCACGGAGGAAGAACTAAAAGAATATGAAAATATTATTGCTTTCCAAGAAAATGAGCTTAAGAAGAAGGCAGATGAGCTTCAGAAACAGAAAGAAGAGCTACAGCGTCAGCATGACCAGCTGGAGGCTCAGAAGCAGGAATATCATCAGGCTGTACAGCAAATGGAACAAAGAAAGTTACAACAAGGAATCGCTCCATCAGGTCCAACTGGAGAACAGAAGCTTGAGCCCCATGTTTAA

XM_004851499.1 Coding sequence

Nucb2 nucleobindin 2, transcript variant X4

High confidence: 4 potential gene matches
Length: 1263 bp    Location: 8907480..8943838   Strand: +
>XM_004851499.1
ATGAGGTGGAGGACCATTCCACTATGCTATTGTTTTCTCTTGGTCACATGTCTACTTGCTGCTCTTCAAGCTGTGCCTATAGACATCGACAAGACAAAAGTACAAAATACTGAACCTGTGGAAAGTGCAAAGATAGAACCACCAGATACTGGACTTTATTATGATGAATATCTCAAGCAAGTTATTGATGTGCTGGAAACAGATAAACATTTCAGAGAAAAGCTTCAGAAAGCAGACATAGAGGAAATAAAGAGTGGGAAGCTAAGCAAAGAGCTGGACTTGGTAAGTCACCACGTGAGGACAAAACTTGACGAACTGAAAAGGCAAGAAGTAGGAAGGTTAAGAATGCTAATTAAAGCTAAACTGGATTCCTTTCAAGATATGGGCATGGACCACCAAGCTCTTCTAAAACAATTTGATCACCTAAATCATATGAATCCTGACAAGTTTGAATCCACAGATTTAGATATGCTAATCAAAGCGGCAACAAAAGATTTGGAACAGTATGACAAGACTAGACATGAAGAATTTAAAAAATATGAAATGATGAAGGAACATGAACGGAGAGAATATTTAAAAACACTAGATGAAGAAAAGAGAAAAGAAGAAGAATCTAAATTTGAAGAAATGAAGAGGAAGCATGAAAACCATCCCAAAGTTAATCATCCAGGAAGCAAAGATCAACTAAAAGAGGTATGGGAAGAGACTGATGGATTGGACCCTAATGACTTTGACCCCAAGACATTTTTCAAATTACATGATGTCAATAGCGATGGATTCCTGGATGAACAAGAATTAGAAGCCCTGTTTACTAAGGAGTTGGAGAAAGTGTATGATGCCCAAAATGAGGAGGATGATATGGTGGAAATGGAGGAAGAAAGGCTTAGAATGAGGGAGCATGTAATGAATGAGGTTGATACAAACAAAGACCGGTTGGTGACTCTGGAAGAATTTTTGAAAGCTACAGAAAAAAAGGAATTCTTGGAGCCAGATAGCTGGGAGACACTGGATCAGCAACAACTCTTCACGGAGGAAGAACTAAAAGAATATGAAAATATTATTGCTTTCCAAGAAAATGAGCTTAAGAAGAAGGCAGATGAGCTTCAGAAACAGAAAGAAGAGCTACAGCGTCAGCATGACCAGCTGGAGGCTCAGAAGCAGGAATATCATCAGGCTGTACAGCAAATGGAACAAAGAAAGTTACAACAAGGAATCGCTCCATCAGGTCCAACTGGAGAACAGAAGCTTGAGCCCCATGTTTAA

XM_004851502.1 Coding sequence

Kcnj11 potassium inwardly-rectifying channel, subfamily J, member 11

High confidence: 4 potential gene matches
Length: 1173 bp    Location: 9015057..9012174   Strand: -
>XM_004851502.1
ATGCTGTCCCGAAAAGGCATCATCCCTGAGGAGTACGTGCTGACTCGTCTAGCAGAGGACCCGGCCGAGCCCAGGTACCACGCCAGAGAGCGGAAGGCTCGCTTCGTGTCCAAGAAAGGCAACTGCAACGTGGCCCACAAGAACATCCGGGAGCAGGGCCGCTTCCTGCAGGACGTGTTCACCACACTGGTGGACCTCAAGTGGCCGCACACGCTGCTCATCTTCACCATGTCTTTCCTGTGCAGCTGGCTGCTCTTTGCCATGATCTGGTGGCTCATCGCCTTTGCCCATGGTGACCTGGCCCCTGGCGAGGGCACAACAGTGCCCTGTGTTACCAGCATCCACTCCTTTTCATCTGCGTTCCTTTTCTCCATCGAGGTCCAGGTAACCATTGGTTTTGGTGGGCGCATGGTGACAGAGGAGTGCCCACTGGCCATCCTGATCCTCATTGTACAGAACATTGTTGGGCTCATGATCAATGCCATCATGCTGGGCTGCATCTTCATGAAGACGGCCCAGGCACACCGGCGGGCAGAGACCCTCATCTTCAGCAAGCACGCGGTCATTGCTCTGCGCCATGGCCGCCTCTGCTTCATGCTGCGCGTGGGTGACCTCCGGAAAAGCATGATCATCAGTGCCACCATCCACATGCAAGTGGTACGAAAGACCACGAGCCCCGAGGGCGAGGTGGTGCCCCTTCACCAGGTGGACATCCCCATGGAGAACGGCGTGGGTGGAAACAGCATCTTCTTGGTGGCTCCGCTCATTATCTACCATGTCATCGATGCCAACAGCCCGCTTTACGACCTGGGACCCAGCGACCTGCACCACCACCAGGACCTTGAGATCATCGTCATCCTGGAAGGTGTGGTGGAAACCACGGGCATTACCACCCAGGCCCGAACCTCCTACCTGGCTGACGAAATCCTCTGGGGCCATCGCTTTGTCCCCATTGTGACAGAGGAGGATGGCCGCTACTCCGTGGACTATTCCAAGTTTGGCAACACCATTAAAGTGCCCACACCACTCTGCACAGCCCATCAGCTCGATGAGGACCACAGCCTGCTCGATGCCCTGACTCTCGCCTCTACCCGTGGGCCTCTGCGCAAGCGCAGTGTGCCTGTGGCCAAGACCAAACCCAAATTTAGCATCTCTCCGGATTCCCTGTCCTGA

XM_004851506.1 Coding sequence

Abcc8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8, transcript variant X4

Length: 4746 bp    Location: 9092356..9018616   Strand: -
>XM_004851506.1
ATGCCCCTGGCCTTCTGCGGCAGCGAGAACCGCTCGGCCGCCTACCGGGTGGACCAGGGCGTCCTCAACAACGGCTGCTTCGTGGACGCGCTCAACGTGGTGCCGCACGTCCTCCTGCTCTTCATCACCTTCCCCATCCTTTTCATTGGGTGGGGCAGCCAGAGCTCCAAGGTGCACATCCACCACAGCACATGGCTCCACTTCCCTGGCCACAATCTTCGCTGGATCCTGACCTTCATGCTGCTCTTCGTCCTGGTGTGTGAGATAGCCGAGGGCATCCTGTCTGATGGGGTGACCGAATCCCGCCATCTGCACCTGTACATGCCAGCCGGGATGGCGTTCATGGCTGCCGTCACCTCTGTGGTCTACTATCACAACATCGAGACCTCCAACTTCCCCAAGCTGCTGATCGCCCTGCTCATCTACTGGATCTTGGCCTTCATCACCAAGACCATCAAGTTTGTCAAGTTTTACCACCATGCCATCAGCTTCTCGCAGCTGCGCTTCTGCCTCACAGGCCTGCTGGTGGTCCTGTACGGGATGCTGCTCCTCGTGGAGGTCAATGTCATCAGGGTGAGGAGGTACATCTTCTTCAAGACACCGAGGGAGGTGAAGCCCCCCGAGGACCTGCAGGACCTGGGCGTGCGCTTTCTGCAGCCCTTCGTGAACCTACTGTCCAAGGGCACCTACTGGTGGATGAACACCTTCATCAAGACGGCCCACAAGAAGCCCATTGACCTGCGAGCCATCGGGAAGCTACCCATTGCCATGAGGGCCCTCACCAACTACCGGCGGCTCTGTGAGGCCTTTGATGCCCAGGCGCGGAAGGACACGCAGAGCATGCAGGGTGCCAGGGCCATCTGGCGGGCACTGTGCCATGCCTTCGGGAGACCCCTGGTCCTCAGCAGCACGTTCCGCATCTTGGCCGACTTGCTGGGCTTTGCCGGGCCACTGTGCATCTTCGGGATCGTGGACCATCTTGGGAAGGAAAACCGAGTCTTCCAGCCCAAGACCCAGTTTCTCGGTATTTACTTTGTCTCATCCCAAGAGTTCCTTGCTAATGCCTACGTCTTGGCCGTGCTTCTATTCCTTGCCCTCCTACTACAGAGGACTTTTCTGCAAGCCTCCTACTATGTCGCCATTGAAACTGGAATTAACTTGAGAGGAGCAATACAGACCAAGATTTACAATAAAATTATGCACCTGTCCACCTCCAACCTGTCCATGGGGGAAATGACTGCCGGCCAGATCTGCAACCTGGTGGCCATCGATACCAACCAGCTCATGTGGTTTTTCTTCTTGTGCCCAAACCTCTGGGCTATGCCAGTGCAGATCATCGTGGGCGTGATCCTCCTCTACTACATCCTTGGGGTCAGCGCCTTAATTGGAGCAGCTGTCATCATTCTACTAGCCCCAGTTCAGTACTTTGTGGCCACCAAGCTGTCCCAGGCCCAGCGGAGCACGCTGGAATATTCTAACGAGAGGCTGAAGCAGACCAATGAGATGCTGCGTGGTATCAAGCTGCTCAAGCTGTATGCCTGGGAGAACATTTTCTGCTCGCGGGTGGAGGTGACCCGCAGGAAAGAGATGACTAGCCTCCGGGCCTTCGCCGTCTACACCTCTATCTCCATTTTCATGAACACAGCCATCCCCATTGCAGCTGTCCTCATCACCTTCGTGGGCCACGTCAGCTTCTTCAAAGAGTCTGACTTCTCGCCCTCAGTGGCCTTTGCCTCCCTCTCCCTCTTCCATATCCTGGTCACTCCGCTGTTCCTGCTGTCCAGCGTGGTCCGGTCTACAGTCAAAGCTCTGGTGAGCGTGCAAAAGCTGAGCGAGTTCCTGTCCAGTGCAGAGATCCGCGAGGAGCAGTGTGCTCCCCTCGAGCCTGTGCCCGGAGGCCAGGCCAGCAAGTACCAGGCAGTGCCCCTCAAGGTTGTGAACCGCAAGCGTCCGGCCCGGGAGGACTGTCGGGACCTCATGGGCCCACTACAGAGGCTGACCCCCAGTGCAGACAGGGAGGCTGAAAACTGCTGTGTCCAGATCATCGGAGGCTTCTTCACCTGGACCCCTGACGGAATCCCCACACTGTCCAACATCACCATCCGAATCCCCCGAGGCCAGCTGACCATGATAGTGGGGCAGGTGGGCTGCGGCAAGTCCTCGCTCCTCCTGGCCACTCTGGGGGAGATGCAGAAGATCTCAGGAGCTGTCTTCTGGAACAGCCTTCCTGATGGCGAGACAGGAGAGGACCCCAGCCCAGAGCGGGAGACAGCGTCTGACTCCGACATCAGGAAGAGAGGCCCAGTGGCCTACGCTTCCCAGAAACCATGGCTGCTGAACGCCACTGTGGAGGAGAATATCACCTTTGAGAGTCCCTTCAACAAACAACGGTACAAGATGGTCATCGAAGCGTGTTCCCTGCAGCCAGACGTCGACATCCTGCCCCACGGAGACCAGACCCAGATTGGGGAACGGGGCATCAACCTGTCGGGTGGTCAGCGCCAGAGAATCAGTGTGGCCCGCGCCCTCTACCAGCACACCAATGTCGTCTTCTTGGATGATCCTTTCTCAGCTCTGGATGTCCACCTGAGTGACCACTTGATGCAGGCCGGGATCCTTGAGCTGCTCCGGGATGACAAGAGGACAGTGGTCCTGGTGACCCACAAGCTACAATACTTGCCTCATGCAGACTGGATCATCGCTATGAAGGATGGCACTATCCAGAGGGAGGGTACACTCAAGGACTTCCAGAGGTCTGAGTGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGGCAGGACCAGGAGCTGGAGAAGGAGACAGTCATGGAGAGAAAAGTCACAGAGCCACACCAGGGCCTGGCCCGTGCCATGTCCTCAAGGGATGGCCTTCTGCAGGATGAAGATGAGGAGGAAGAGGAGGTGGCCGAGAGCGAGGAAGACGACAACCTGTCCTCCCTGCTGCACCAGCGAGCCAAGATCCCATGGCGAGCCTGTGCCAAGTACCTGTCCTCGGCTGGCATCCTGCTCCTGTCGCTGCTTGTCTTCTCCCAGCTGCTCAAGCACATGGTCTTGGTGGCCATCGACTACTGGCTGGCCAAGTGGACCGACAGCGCCCTGACCCTGAGCCCCGCGACCAGGAACTGCTCCCTCAGCCAGGAGTGCTCCCTGGACCAGACCATCTATGCCATGGTCTTTACCGTGCTCTGTAGCCTGGGCATCGTGCTGTGCCTGGTCACCTCTGTCACCGTGGAGTGGACAGGACTAAAGGTGGCCAAGAGTCTGCACCGCAGCCTGCTGAACCGCATCATCCTAGCCCCCATGAGGTTTTTTGAGACCACGCCCCTTGGGAGCATCCTGAACAGATTTTCATCTGACTGTAACACCATTGACCAGCACATCCCATCCACGCTGGAATGCCTGAGCCGCTCCACCCTGCTCTGCGTCTCAGCCCTGGCCGTCATCTCCTATGTCACACCTGTGTTCCTTGTGGCCCTCTTGCCCCTGGCCATCGCGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCATCCAGGGACCTGCAGCAGCTGGATGACACTACGCAGCTGCCGCTGCTCTCACACTTTGCTGAAACTGTGGAGGGCCTCACCACCATCCGGGCCTTCAGATACGAGGCCCGCTTCCAGCAGAAGCTCCTTGAATACACCGACTCCAACAACATCGCCTCCCTCTTCCTCACAGCAGCCAACAGATGGCTGGAAGTCCGCATGGAGTACATCGGCGCCTGTGTGGTGCTCATTGCGGCTGCCACCTCCATCTCCAACTCCCTGCACAGGGAGCTCTCAGCCGGCCTGGTGGGCCTGGGCCTCACCTATGCCCTCATGATCTCTAACTACCTCAACTGGATGGTGAGGAACCTGGCGGACATGGAGATCCAGCTGGGCGCCGTGAAGCGCATCCACGGGCTTCTGAAGACCGAGGCAGAGAGCTACGAGGGGCTGCTGGCCCCATCACTGATCCCTAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCAGTGCTCAAACACGTCAACGCCCTCATCTCGCCGGGACAGAAGATCGGGATCTGCGGCCGCACGGGCAGCGGGAAGTCCTCCTTTTCCCTGGCCTTCTTCCGCATGGTGGACATGTTCGAGGGCCGCATCATCATCGATGGCATTGACATCGCCAGACTGCCACTGCACACCCTGCGCTCGCGCCTGTCCATCATCCTGCAGGACCCTGTCCTCTTCAGTGGCACCATCCGGTTTAACCTGGACCCAGAGAAGAAGTGCTCGGACAGCACACTGTGGGAGGCCCTGGAGATCGCCCAGCTGAAGCTGGTGGTGAAGGCTCTGCCCGGAGGCCTCGACGCCATCATCACAGAGGGCGGGGAGAACTTCAGCCAGGGCCAGAGGCAGCTCTTCTGCCTGGCTCGGGCCTTTGTGAGAAAGACCAGCATCTTCATCATGGACGAGGCCACAGCTTCCATCGACATGGCCACGGAGAACATCCTCCAGAAGGTGGTGATGACAGCCTTCGCAGACCGCACTGTGGTCACCATTGCGCATCGTGTGCACACCATCCTCAGCGCAGACATGGTGATGGTCCTGAAGCGGGGCGCCATCCTAGAGCTGGACAAGCCAGAGAACCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTTGTCCGAGCAGACAAGTGA

XM_004851505.1 Coding sequence

Abcc8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8, transcript variant X3

Length: 4752 bp    Location: 9092356..9018616   Strand: -
>XM_004851505.1
ATGCCCCTGGCCTTCTGCGGCAGCGAGAACCGCTCGGCCGCCTACCGGGTGGACCAGGGCGTCCTCAACAACGGCTGCTTCGTGGACGCGCTCAACGTGGTGCCGCACGTCCTCCTGCTCTTCATCACCTTCCCCATCCTTTTCATTGGGTGGGGCAGCCAGAGCTCCAAGGTGCACATCCACCACAGCACATGGCTCCACTTCCCTGGCCACAATCTTCGCTGGATCCTGACCTTCATGCTGCTCTTCGTCCTGGTGTGTGAGATAGCCGAGGGCATCCTGTCTGATGGGGTGACCGAATCCCGCCATCTGCACCTGTACATGCCAGCCGGGATGGCGTTCATGGCTGCCGTCACCTCTGTGGTCTACTATCACAACATCGAGACCTCCAACTTCCCCAAGCTGCTGATCGCCCTGCTCATCTACTGGATCTTGGCCTTCATCACCAAGACCATCAAGTTTGTCAAGTTTTACCACCATGCCATCAGCTTCTCGCAGCTGCGCTTCTGCCTCACAGGCCTGCTGGTGGTCCTGTACGGGATGCTGCTCCTCGTGGAGGTCAATGTCATCAGGGTGAGGAGGTACATCTTCTTCAAGACACCGAGGGAGGTGAAGCCCCCCGAGGACCTGCAGGACCTGGGCGTGCGCTTTCTGCAGCCCTTCGTGAACCTACTGTCCAAGGGCACCTACTGGTGGATGAACACCTTCATCAAGACGGCCCACAAGAAGCCCATTGACCTGCGAGCCATCGGGAAGCTACCCATTGCCATGAGGGCCCTCACCAACTACCGGCGGCTCTGTGAGGCCTTTGATGCCCAGGCGCGGAAGGACACGCAGAGCATGCAGGGTGCCAGGGCCATCTGGCGGGCACTGTGCCATGCCTTCGGGAGACCCCTGGTCCTCAGCAGCACGTTCCGCATCTTGGCCGACTTGCTGGGCTTTGCCGGGCCACTGTGCATCTTCGGGATCGTGGACCATCTTGGGAAGGAAAACCGAGTCTTCCAGCCCAAGACCCAGTTTCTCGGTATTTACTTTGTCTCATCCCAAGAGTTCCTTGCTAATGCCTACGTCTTGGCCGTGCTTCTATTCCTTGCCCTCCTACTACAGAGGACTTTTCTGCAAGCCTCCTACTATGTCGCCATTGAAACTGGAATTAACTTGAGAGGAGCAATACAGACCAAGATTTACAATAAAATTATGCACCTGTCCACCTCCAACCTGTCCATGGGGGAAATGACTGCCGGCCAGATCTGCAACCTGGTGGCCATCGATACCAACCAGCTCATGTGGTTTTTCTTCTTGTGCCCAAACCTCTGGGCTATGCCAGTGCAGATCATCGTGGGCGTGATCCTCCTCTACTACATCCTTGGGGTCAGCGCCTTAATTGGAGCAGCTGTCATCATTCTACTAGCCCCAGTTCAGTACTTTGTGGCCACCAAGCTGTCCCAGGCCCAGCGGAGCACGCTGGAATATTCTAACGAGAGGCTGAAGCAGACCAATGAGATGCTGCGTGGTATCAAGCTGCTCAAGCTGTATGCCTGGGAGAACATTTTCTGCTCGCGGGTGGAGGTGACCCGCAGGAAAGAGATGACTAGCCTCCGGGCCTTCGCCGTCTACACCTCTATCTCCATTTTCATGAACACAGCCATCCCCATTGCAGCTGTCCTCATCACCTTCGTGGGCCACGTCAGCTTCTTCAAAGAGTCTGACTTCTCGCCCTCAGTGGCCTTTGCCTCCCTCTCCCTCTTCCATATCCTGGTCACTCCGCTGTTCCTGCTGTCCAGCGTGGTCCGGTCTACAGTCAAAGCTCTGGTGAGCGTGCAAAAGCTGAGCGAGTTCCTGTCCAGTGCAGAGATCCGCGAGGAGCAGTGTGCTCCCCTCGAGCCTGTGCCCGGAGGCCAGGCCAGCAAGTACCAGGCAGTGCCCCTCAAGGTTGTGAACCGCAAGCGTCCGGCCCGGGAGGACTGTCGGGACCTCATGGGCCCACTACAGAGGCTGACCCCCAGTGCAGACAGGGAGGCTGAAAACTGCTGTGTCCAGATCATCGGAGGCTTCTTCACCTGGACCCCTGACGGAATCCCCACACTGTCCAACATCACCATCCGAATCCCCCGAGGCCAGCTGACCATGATAGTGGGGCAGGTGGGCTGCGGCAAGTCCTCGCTCCTCCTGGCCACTCTGGGGGAGATGCAGAAGATCTCAGGAGCTGTCTTCTGGAACAGCAGCCTTCCTGATGGCGAGACAGGAGAGGACCCCAGCAGCCCAGAGCGGGAGACAGCGTCTGACTCCGACATCAGGAAGAGAGGCCCAGTGGCCTACGCTTCCCAGAAACCATGGCTGCTGAACGCCACTGTGGAGGAGAATATCACCTTTGAGAGTCCCTTCAACAAACAACGGTACAAGATGGTCATCGAAGCGTGTTCCCTGCAGCCAGACGTCGACATCCTGCCCCACGGAGACCAGACCCAGATTGGGGAACGGGGCATCAACCTGTCGGGTGGTCAGCGCCAGAGAATCAGTGTGGCCCGCGCCCTCTACCAGCACACCAATGTCGTCTTCTTGGATGATCCTTTCTCAGCTCTGGATGTCCACCTGAGTGACCACTTGATGCAGGCCGGGATCCTTGAGCTGCTCCGGGATGACAAGAGGACAGTGGTCCTGGTGACCCACAAGCTACAATACTTGCCTCATGCAGACTGGATCATCGCTATGAAGGATGGCACTATCCAGAGGGAGGGTACACTCAAGGACTTCCAGAGGTCTGAGTGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGGCAGGACCAGGAGCTGGAGAAGGAGACAGTCATGGAGAGAAAAGTCACAGAGCCACACCAGGGCCTGGCCCGTGCCATGTCCTCAAGGGATGGCCTTCTGCAGGATGAAGATGAGGAGGAAGAGGAGGTGGCCGAGAGCGAGGAAGACGACAACCTGTCCTCCCTGCTGCACCAGCGAGCCAAGATCCCATGGCGAGCCTGTGCCAAGTACCTGTCCTCGGCTGGCATCCTGCTCCTGTCGCTGCTTGTCTTCTCCCAGCTGCTCAAGCACATGGTCTTGGTGGCCATCGACTACTGGCTGGCCAAGTGGACCGACAGCGCCCTGACCCTGAGCCCCGCGACCAGGAACTGCTCCCTCAGCCAGGAGTGCTCCCTGGACCAGACCATCTATGCCATGGTCTTTACCGTGCTCTGTAGCCTGGGCATCGTGCTGTGCCTGGTCACCTCTGTCACCGTGGAGTGGACAGGACTAAAGGTGGCCAAGAGTCTGCACCGCAGCCTGCTGAACCGCATCATCCTAGCCCCCATGAGGTTTTTTGAGACCACGCCCCTTGGGAGCATCCTGAACAGATTTTCATCTGACTGTAACACCATTGACCAGCACATCCCATCCACGCTGGAATGCCTGAGCCGCTCCACCCTGCTCTGCGTCTCAGCCCTGGCCGTCATCTCCTATGTCACACCTGTGTTCCTTGTGGCCCTCTTGCCCCTGGCCATCGCGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCATCCAGGGACCTGCAGCAGCTGGATGACACTACGCAGCTGCCGCTGCTCTCACACTTTGCTGAAACTGTGGAGGGCCTCACCACCATCCGGGCCTTCAGATACGAGGCCCGCTTCCAGCAGAAGCTCCTTGAATACACCGACTCCAACAACATCGCCTCCCTCTTCCTCACAGCAGCCAACAGATGGCTGGAAGTCCGCATGGAGTACATCGGCGCCTGTGTGGTGCTCATTGCGGCTGCCACCTCCATCTCCAACTCCCTGCACAGGGAGCTCTCAGCCGGCCTGGTGGGCCTGGGCCTCACCTATGCCCTCATGATCTCTAACTACCTCAACTGGATGGTGAGGAACCTGGCGGACATGGAGATCCAGCTGGGCGCCGTGAAGCGCATCCACGGGCTTCTGAAGACCGAGGCAGAGAGCTACGAGGGGCTGCTGGCCCCATCACTGATCCCTAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCAGTGCTCAAACACGTCAACGCCCTCATCTCGCCGGGACAGAAGATCGGGATCTGCGGCCGCACGGGCAGCGGGAAGTCCTCCTTTTCCCTGGCCTTCTTCCGCATGGTGGACATGTTCGAGGGCCGCATCATCATCGATGGCATTGACATCGCCAGACTGCCACTGCACACCCTGCGCTCGCGCCTGTCCATCATCCTGCAGGACCCTGTCCTCTTCAGTGGCACCATCCGGTTTAACCTGGACCCAGAGAAGAAGTGCTCGGACAGCACACTGTGGGAGGCCCTGGAGATCGCCCAGCTGAAGCTGGTGGTGAAGGCTCTGCCCGGAGGCCTCGACGCCATCATCACAGAGGGCGGGGAGAACTTCAGCCAGGGCCAGAGGCAGCTCTTCTGCCTGGCTCGGGCCTTTGTGAGAAAGACCAGCATCTTCATCATGGACGAGGCCACAGCTTCCATCGACATGGCCACGGAGAACATCCTCCAGAAGGTGGTGATGACAGCCTTCGCAGACCGCACTGTGGTCACCATTGCGCATCGTGTGCACACCATCCTCAGCGCAGACATGGTGATGGTCCTGAAGCGGGGCGCCATCCTAGAGCTGGACAAGCCAGAGAACCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTTGTCCGAGCAGACAAGTGA

XM_004851508.1 Coding sequence

Ush1c Usher syndrome 1C (autosomal recessive, severe), transcript variant X1

High confidence: 4 potential gene matches
Length: 1650 bp    Location: 9153602..9108320   Strand: -
>XM_004851508.1
ATGGACCGGAAGGTGGCCCGAGAATTTCGGCACAAGGTGGATTTCCTGATTGAAAATGACGCAGAGAAGGACTACCTCTATGACGTGCTGCGGATGTACCACCAAACCATGGACGTGGCTGTGCTTGTGGGAGACCTGAAGCTGGTCATCAGTGAGCCCAGCCGCCTGCCATTGTTTGATGCCATCCGGCCCCTGATCCCGCTGAAGCACCAGGTGGAATATGACCAGCTGACCCCGCGGCGCTCCAGGAAGCTGAAGGAGGTGCGTCTGGACCGTCTGCACCCCGAAGGCCTTGGCCTCAGCGTGCGGGGTGGCCTGGAGTTCGGCTGTGGACTCTTCATCTCCCACCTCATCAAAGGCGGCCAGGCAGACAGTGTCGGGCTGCAGGTAGGGGATGAGATCGTCCGGATCAACGGGTATTCCATCTCCTCCTGCACCCACGAGGAGGTCATCAACCTCATCCGGACCAAGAAGACCGTGTCCATCAAAGTGAGACACATTGGCCTGATCCCTGTGCAGAGCTCTCCTGATGAGCCCCTCAAATGGCAGTATGTGGATCAGTTTGTGTCGGAATCGGGGGGTGGACGGGGCAGCCTGGGCTCCCCCGGGAATCAGGCAAGCAAGGAGAAGAAGGTCTTCATCAGCCTGGTGGGCTCCCGGGGCCTTGGCTGCAGCATTTCCAGCGGCCCCATCCAGAAACCCGGCATCTTCATCAGCCAAGTGAAGCCCGGCTCGCTGTCTGCGGAGGTGGGGCTGGAGACAGGGGACCAGATTGTGGAAGTCAATGGCATTGATTTCTCCAACCTGGACCACAAGGAGGCCGTGAACGTGCTGAAGAGTAGCCGAAGCCTGACCATCTCCATTGTAGCCGGAGCTGGCCGGGAGCTGTTCATGACAGATCGGGAGCGGCTGGCGGAGGTGCGGCAGCGTGAGCTACAGAGACAGGAGCTGCTGATGCAGAAGCGGCTGGCCATGGAGTCCAACAAGATCCTCCAGGAGCAGCAGGACATGGAGCGGCAAAGGAGAAAGGAAATTGCCCAGAAGGCGGCAGAGGAAAACGAGAGGTACCGGAAGGAGATGGAACAGATCATGGAGGAGGAAGAGAAGTTTAAGAAGCAGTGGGAAGAAGACTGGGGCTCAAAGGAGCAGCTCCTCTTGCCCAAAACCATCACCGCTGAGGTGCATCCAGTTCCCCTTCGCAAACCAAAGTATGATCAGGGAGTGGAGCCTGAGCTCGAGCTTGAAGACCACCCGGATGGAGGCACAGAGGAGCAGGGAAAGCAGGATTTCCGGAAATATGAGGAAGGCTTTGAGCCCTACTCCATGTTCACCCCAGAGCAGATCATAGGGAAGGACGTTCGGCTCCTGCGCATCAAGAAGGAGGGCTCCTTAGACCTGGCCCTGGAAGGCGGTGTGGACTCCCCGATCGGGAAGGTGGTCGTCTCGGCTGTGTATGACGGGGGAGCGGCTGAGCGGCATGGTGGCCTTGTGAAGGGGGACGAGATCATGGCTATCAATGGCAAGATCATAACAGACTACACCCTGGCCGAGGCGGAGGCCACCCTGCAGAAGGCCTGGAATCAGGGTGGGGACTGGATCGACCTCGTGGTTGCCGTCTGTCCCCCCAAGGAGTACGATGACGAGCTGTAA

XM_004851510.1 Coding sequence

Kcnc1 potassium voltage-gated channel, Shaw-related subfamily, member 1

High confidence: 4 potential gene matches
Length: 1758 bp    Location: 9360042..9400106   Strand: +
>XM_004851510.1
ATGGGCCAAGGGGACGAGAGCGAGCGCATCGTGATCAACGTGGGCGGCACGCGCCACCAGACGTACCGCTCGACGCTGCGCACGCTGCCCGGCACGCGGCTCGCCTGGCTGGCGGAGCCCGACGCCCACAGCCACTTCGACTATGACCCTCGCGCCGACGAGTTTTTCTTCGACCGCCACCCGGGCGTCTTCGCGCACATCCTGAACTACTACCGCACGGGCAAGCTGCACTGCCCGGCCGACGTGTGCGGGCCGCTCTACGAAGAGGAGCTGGCCTTCTGGGGCATCGACGAGACGGACGTGGAGCCCTGCTGCTGGATGACTTACCGCCAGCACCGCGACGCCGAGGAGGCGCTCGACAGCTTCGGGGGCGCCCCGCTGGACAACAGCGCCGACGACGCGGACGCCGACGGCCCTGGCGACTCGGGCGACGGCGAGGACGAGCTGGAGATGACCAAGCGCCTGGCGCTGAGCGACTCCCCGGATGGCCGGCCCGGCGGCTTCTGGCGCCGCTGGCAGCCGCGCATCTGGGCGCTCTTCGAGGACCCCTACTCGTCCCGCTACGCGCGGTATGTGGCCTTTGCCTCCCTCTTCTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACGAGCGCTTCAACCCCATTGTGAACAAGACGGAGATTGAGAACGTTCGGAATGGCACGCAGGTGCGCTACTACCGGGAAGCCGAGACAGAGGCCTTCCTCACCTACATCGAGGGCGTCTGCGTGGTGTGGTTCACCTTCGAGTTCCTCATGCGTGTCGTCTTCTGCCCCAACAAGGTAGAGTTCATCAAGAACTCACTCAACATCATTGACTTTGTGGCCATCCTCCCCTTCTACTTGGAGGTAGGCCTAAGTGGCCTGTCCTCCAAGGCCGCCAAGGATGTCCTGGGCTTCCTGCGAGTCGTCCGCTTCGTGCGTATCCTGCGCATATTCAAGCTGACCCGTCACTTTGTGGGGCTGCGGGTCCTGGGCCACACGCTCCGTGCCAGCACCAATGAGTTCCTGCTGCTCATCATCTTCCTGGCCCTGGGCGTGCTCATCTTTGCCACCATGATCTACTATGCAGAGCGGATAGGGGCACAGCCCAACGACCCCAGCGCCAGTGAGCACACGCACTTTAAGAACATCCCCATCGGCTTCTGGTGGGCTGTGGTCACCATGACGACACTGGGCTATGGAGACATGTACCCGCAGACGTGGTCTGGCATGTTGGTGGGAGCACTGTGCGCGCTAGCGGGTGTGCTGACCATCGCCATGCCCGTGCCTGTCATTGTGAACAATTTTGGGATGTACTACTCCTTAGCCATGGCTAAGCAGAAACTACCAAAGAAAAAAAAGAAGCATATTCCACGGCCACCGCAGCTGGGATCTCCCAATTATTGTAAATCTGTCGTAAACTCTCCGCACCACAGTACTCAGAGTGACACATGTCCGCTGGCCCAGGAAGAAATTTTAGAAATTAACAGAGCAGATTCCAAACTGAATGGGGAGGTGGCGAAGGCCGCGCTGGCGAACGAAGACTGCCCCCACATAGACCAGGCCCTCACTCCTGATGAGGGCCTGCCCTTTACGCGCTCGGGCACCCGCGAGAGATACGGACCCTGCTTCCTCTTATCAACCGGGGAGTACGCGTGCCCACCTGGTGGAGGAATGAGAAAGGATCTTTGCAAAGAAAGCCCTGTCATTGCTAAGTATATGCCGACAGAGGCTGTGAGAGTGACTTGA

XM_004851513.1 Coding sequence

Sergef secretion regulating guanine nucleotide exchange factor, transcript variant X3

Length: 1344 bp    Location: 9624583..9400183   Strand: -
>XM_004851513.1
ATGCAAAAAGCTCTGAACACCCGAAACTTACTGGATGGTGCAAATAGCTATGGGCAACTTGGCCTTGGCCATAAGGAAGATGTGCTTTTGCCCCAGCAACTGACTGACTTCTGTAAACCTGAGTGTGTCAGGAAGATCACAGGAGGAGGGGGACATTCTACAGTTGTCACAGATGGAGGAAGCCTTTTTGTTTGTGGCTTGAACAAAGATGGGCAGTTGGGGCTTGGTCACACAGAGGATGTTCTGTGTTTTACCATCTGCAAATCTCTTGGTGGCTGTCGCATCCAACAGGTAGCCTGTGGCTGGGATTTTACCATTATGCTCACAGAAAATGGTCAAGTTCTATCATGTGGATCAAACTCCTTCGGCCAGTTAGGTGTTCTTCATGGACCTCGAAGATGTGTGGTTCCCCAGGCCATTGAGCTTCTGACAGAGAAGGTTATTTGTGTTGCTGCTGGACTGAGGCATGCATTAGCTGCTACAGTGAGTGGCATTGTGTTCCAGTGGGGGACTGGTTTGGCATCATCTGGACGACGGTTATGTCCCGGGCAGACTCTCCCATTATTTTTGACAGCAAAGGAACCAAGCAGAGTGACAGGTCTAGAGAATTGTAAAGCAATATGTGTTCTTGCTGGCTCAGCCCACTCAGCTTTATTAACAGACGCAGGAGAACTATATGTTTGGGGCGGTAACAAGCACGGACAACTAACTACCCAGGCTGCTTTCCTTCCTGTGCCCCACAAAATAGAAGTGCACTGTTTTCAGAGTGAAAAGGTCACTGCCGCCTGGAGTGGGTGGACCCACCTGGTTGCTCAGACAGAAACTGGCAAGGTGTTTACTTGGGGCCGAGCAGACTATGGTCAACTAGGGAGGAAGCTGGAGACTCAAGAAGACTGGAAACTAGAAAACCAGGATTCATCGAGACCACCGAACAGCACACCTTCACCTCTGCATTGCCTGATGGGAGCCACGGAGATCTCTTGTGGCTCAGAGCATAATTTGGCAGTAATTGGTGGGGCGTGTTATTCCTGGGGCTGGAACGAGCATGGCATGTGTGGGGATGGCACTGAAGCCAATGTCTGGGCCCCGAGGCCTGTGCAAGTCCTGCAGTCGGCACCAGGACTCCTCGTGGGCTGTGGGGCCGGCCACTCCCTGGCCCTCTGTCAGCTGCCAGCACAACCTGCTGTGGGCAAGGATCTCATCACTTACCCTCCCTCAAATGCCACTGAGGACACCAAATCTCAGGAAGCACTGGACAAAGAGAAATTGGAAGAAAAGACAGAAATTTCAACCCAAAGCCAACCTGACAAATCCAGAAGTGATAGAGAACCTTTAATAAAGTAG

XM_004851514.1 Coding sequence

Sergef secretion regulating guanine nucleotide exchange factor, transcript variant X4

Length: 1344 bp    Location: 9624493..9400183   Strand: -
>XM_004851514.1
ATGCAAAAAGCTCTGAACACCCGAAACTTACTGGATGGTGCAAATAGCTATGGGCAACTTGGCCTTGGCCATAAGGAAGATGTGCTTTTGCCCCAGCAACTGACTGACTTCTGTAAACCTGAGTGTGTCAGGAAGATCACAGGAGGAGGGGGACATTCTACAGTTGTCACAGATGGAGGAAGCCTTTTTGTTTGTGGCTTGAACAAAGATGGGCAGTTGGGGCTTGGTCACACAGAGGATGTTCTGTGTTTTACCATCTGCAAATCTCTTGGTGGCTGTCGCATCCAACAGGTAGCCTGTGGCTGGGATTTTACCATTATGCTCACAGAAAATGGTCAAGTTCTATCATGTGGATCAAACTCCTTCGGCCAGTTAGGTGTTCTTCATGGACCTCGAAGATGTGTGGTTCCCCAGGCCATTGAGCTTCTGACAGAGAAGGTTATTTGTGTTGCTGCTGGACTGAGGCATGCATTAGCTGCTACAGTGAGTGGCATTGTGTTCCAGTGGGGGACTGGTTTGGCATCATCTGGACGACGGTTATGTCCCGGGCAGACTCTCCCATTATTTTTGACAGCAAAGGAACCAAGCAGAGTGACAGGTCTAGAGAATTGTAAAGCAATATGTGTTCTTGCTGGCTCAGCCCACTCAGCTTTATTAACAGACGCAGGAGAACTATATGTTTGGGGCGGTAACAAGCACGGACAACTAACTACCCAGGCTGCTTTCCTTCCTGTGCCCCACAAAATAGAAGTGCACTGTTTTCAGAGTGAAAAGGTCACTGCCGCCTGGAGTGGGTGGACCCACCTGGTTGCTCAGACAGAAACTGGCAAGGTGTTTACTTGGGGCCGAGCAGACTATGGTCAACTAGGGAGGAAGCTGGAGACTCAAGAAGACTGGAAACTAGAAAACCAGGATTCATCGAGACCACCGAACAGCACACCTTCACCTCTGCATTGCCTGATGGGAGCCACGGAGATCTCTTGTGGCTCAGAGCATAATTTGGCAGTAATTGGTGGGGCGTGTTATTCCTGGGGCTGGAACGAGCATGGCATGTGTGGGGATGGCACTGAAGCCAATGTCTGGGCCCCGAGGCCTGTGCAAGTCCTGCAGTCGGCACCAGGACTCCTCGTGGGCTGTGGGGCCGGCCACTCCCTGGCCCTCTGTCAGCTGCCAGCACAACCTGCTGTGGGCAAGGATCTCATCACTTACCCTCCCTCAAATGCCACTGAGGACACCAAATCTCAGGAAGCACTGGACAAAGAGAAATTGGAAGAAAAGACAGAAATTTCAACCCAAAGCCAACCTGACAAATCCAGAAGTGATAGAGAACCTTTAATAAAGTAG

XM_004851515.1 Coding sequence

Sergef secretion regulating guanine nucleotide exchange factor, transcript variant X5

High confidence: 4 potential gene matches
Length: 1344 bp    Location: 9623251..9400183   Strand: -
>XM_004851515.1
ATGCAAAAAGCTCTGAACACCCGAAACTTACTGGATGGTGCAAATAGCTATGGGCAACTTGGCCTTGGCCATAAGGAAGATGTGCTTTTGCCCCAGCAACTGACTGACTTCTGTAAACCTGAGTGTGTCAGGAAGATCACAGGAGGAGGGGGACATTCTACAGTTGTCACAGATGGAGGAAGCCTTTTTGTTTGTGGCTTGAACAAAGATGGGCAGTTGGGGCTTGGTCACACAGAGGATGTTCTGTGTTTTACCATCTGCAAATCTCTTGGTGGCTGTCGCATCCAACAGGTAGCCTGTGGCTGGGATTTTACCATTATGCTCACAGAAAATGGTCAAGTTCTATCATGTGGATCAAACTCCTTCGGCCAGTTAGGTGTTCTTCATGGACCTCGAAGATGTGTGGTTCCCCAGGCCATTGAGCTTCTGACAGAGAAGGTTATTTGTGTTGCTGCTGGACTGAGGCATGCATTAGCTGCTACAGTGAGTGGCATTGTGTTCCAGTGGGGGACTGGTTTGGCATCATCTGGACGACGGTTATGTCCCGGGCAGACTCTCCCATTATTTTTGACAGCAAAGGAACCAAGCAGAGTGACAGGTCTAGAGAATTGTAAAGCAATATGTGTTCTTGCTGGCTCAGCCCACTCAGCTTTATTAACAGACGCAGGAGAACTATATGTTTGGGGCGGTAACAAGCACGGACAACTAACTACCCAGGCTGCTTTCCTTCCTGTGCCCCACAAAATAGAAGTGCACTGTTTTCAGAGTGAAAAGGTCACTGCCGCCTGGAGTGGGTGGACCCACCTGGTTGCTCAGACAGAAACTGGCAAGGTGTTTACTTGGGGCCGAGCAGACTATGGTCAACTAGGGAGGAAGCTGGAGACTCAAGAAGACTGGAAACTAGAAAACCAGGATTCATCGAGACCACCGAACAGCACACCTTCACCTCTGCATTGCCTGATGGGAGCCACGGAGATCTCTTGTGGCTCAGAGCATAATTTGGCAGTAATTGGTGGGGCGTGTTATTCCTGGGGCTGGAACGAGCATGGCATGTGTGGGGATGGCACTGAAGCCAATGTCTGGGCCCCGAGGCCTGTGCAAGTCCTGCAGTCGGCACCAGGACTCCTCGTGGGCTGTGGGGCCGGCCACTCCCTGGCCCTCTGTCAGCTGCCAGCACAACCTGCTGTGGGCAAGGATCTCATCACTTACCCTCCCTCAAATGCCACTGAGGACACCAAATCTCAGGAAGCACTGGACAAAGAGAAATTGGAAGAAAAGACAGAAATTTCAACCCAAAGCCAACCTGACAAATCCAGAAGTGATAGAGAACCTTTAATAAAGTAG

XM_004851516.1 Coding sequence

Tph1 tryptophan hydroxylase 1

High confidence: 4 potential gene matches
Length: 1335 bp    Location: 9651680..9633200   Strand: -
>XM_004851516.1
ATGATCGAAGACAATAAGGAGAACAAAGACTATTCCTTGGAAAGAGGGAGAGCAACTCTCATTTTTTCCTTGAAGAATGAAGTTGGAGGACTTCTACAGGCACTGAAAATCTTCCAGGAGAAGCATGTGAACCTGTTACATATCGAGTCCCGAAAATCGAAGAGAAGAAATTCAGAATTTGAGATTTTTGTTGACTGTGATATCGGTAGAGAACAACTGAATGATATTTTCCATCTGCTGAAGTCTCATACTAATGTTCTCTCTGTGAACTCACCAGATAATTTTACGGTGAAGGAAGATGGTATGGAAACTGTTCCTTGGTTTCCAAAGAAGATCTCTGACTTGGACTTTTGTGCTACCAGAGTTCTGATGTATGGATCTGACCTTGATGCCAATCATCCTGGCTTCAAAGACAATGTGTACCGTAAAAGACGAAAGTATTTTTCAGAGTTGGCTATGAATTATAAACACGGAGACCCCATTCCCAAGGTTGAATTCACCAAAGAAGAGATTAATACCTGGGGAACTGTTTTCCGAGAGCTCTACAAACTCTACCCAACCCATGCCTGCCGAGAGTACCTCAAAAACTTACCTTTGCTTTCTAAATATTGTGGCTATCAGGAAGATAATATTCCACAACTGGAGGATGTCTCAAACTTTTTAAAAGAGCGCACAGGGTTTTCCATCCGTCCTGTGGCTGGCTACTTATCACCAAGAGATTTCCTATCAGGTTTAGCCTTTCGAGTTTTTCACTGCACTCAGTATGTGAGACACAGTTCAGACCCTCTCTATACCCCAGAGCCAGATACCTGCCATGAACTCTTAGGTCATGTTCCACTCTTGGCTGAACCTAGTTTTGCTCAATTCTCCCAAGAAATTGGTCTGGCATCACTTGGAGCTTCAGAGGAGGCTGTTCAGAAGCTGGCAACGTGCTACTTTTTCACTGTGGAGTTTGGTTTGTGTAAGCAAGATGGGCAGCTAAGAGTCTTTGGTGCTGGCTTGCTTTCTTCTATCAGTGAGCTCAAACATGCACTTTCTGGACATGCCAAAGTAAAGCCCTTTGATCCCAAGATTACTTGCAAACAGGAATGTCTTATCACAACCTTTCAAGATGTCTATTTTGTATCTGAAAGCTTTGAAGATGCAAAGGAGAAAATGAGAGAATTTGCCAAAACAACTAAACGTCCATTTGGGGTGAAGTACAATCCATATACTCAGAGTATTCAGATCCTGAAAGACACCAAGAGCATAACCAGTGCCATGAATGAGCTGCGGCATGATCTTGATGTCGTCAGTGATGCCCTCACTAAGGTCAGCAGGCAGCTGAGTATGTGA

XM_004851517.1 Coding sequence

Saal1 serum amyloid A-like 1, transcript variant X1

Length: 1422 bp    Location: 9712569..9689406   Strand: -
>XM_004851517.1
ATGGACCGTAACCCGTCGCCGCCGACCCCGAGTCGGGAGGATGAGGATACGGAGGTGGCCGGGGGAGACTGCATCGGGAGCACGGTCTACAGCAAGCACTGGCTCTTCGGTGTCCTCAGCGGGCTCATCCAGATTGTTACACCTGAAAACACCAAATCCAACTCAGATGATGAGGAGCAGGTGATGGAGCTTGATGAAGAAATGGAGAATGAAATTTGCAAAGTATGGGATATGTCAATGGATCAGGATGTGGCTTTATTTCTCCAAGAATTTAATGCTCCTGACATATTTATGGGAGTACTGGCCAAATCTAAGTGTCCTCGATTAAGAGAAATCTGTGTGGGAATTTTAGGTAATATGGCCTGTTTCCAGGAGATATGTGTGTCCCTCAGCAATGATAAAAATCTTGGGCAAGTGTTATTGCACTGTTTATATGATTCAGATCCACCTACTCTGCTGGAGACAAGCAGGTTGTTGCTTACTTGCCTTTCCCAGACAGAAGTGGCCAGTGTCTGGGTGGAAAGGACCCGGGAATATCCAGCTATTTATGATAGCATTTGTTTCATCATGTCAAGTTCAACAAATGTTGACTTGCTGGTGAAGGTAGGGGAGGTTGTGGATAAGCTCTTTGATTTGGATGAGAAACTAATGTTGGAATGGATTAGAAATGGGGCTGCTCCACCTCTGGACCAACCTAAGGAAGATTCTGAAGAGCAGCCTGTGTTTAAGATTGTGCCCTGTGTACTTGAAGCTGCCAAACAAGTACGTTCTGAAAACCCAGAAGGGCTTGATGTTTACATGCATATCTTACAGCTGCTTACCACAGTGGATGACGGAATTCAAGCAATTGTACAGTGTCCTGATACTTGGAAAGACACTTGGAATTTACTTTTTGACCTGGTCTGCCATGAATTCTGCCAATCTGATGACCCGCCCATCATCCTCCAAGAACAGAAAACGGTGTTGGCCTCTGTGTTTTCAGTGTTGTCGGCCATGTATGCTTCACAGGCTGAACAGGAATATCTAAAAGTAGAAAAAGTAGATCTTCCTCTAATTGACAGTCTGATTCGGGTGTTAGAAAATGTGGAACATTGTCAGAAGAAGCCAGAGAACTCAACAGAGTCTAACACAGAAGAAACTCAAAAGTCTGATTTAACCCAAGAGGACTTCCACTTGAAAATTTTAAAGGATATTTCATGTGAATTTCTTTCTAATATTTTGCAGGCATTAACAAAGGAAACTGTGGCTCAGGGACTAAAGGAAGGCCAGTTAAGCAAACAGAAATGTTCCTGTGCATTTCAAAATCTCCTTCCTTTCTATAACCCTGTGGTGGAAGACTTTATTAAAATCCTGCATGAAGTGGATAAGGCCTTTGCTGATGACCTGGAGGAAAGCTTCCCGAGTTTGAAGGTTCAGACTTAA

XM_004851522.1 Coding sequence

Saa4 serum amyloid A4, constitutive, transcript variant X3

Length: 393 bp    Location: 9745101..9737130   Strand: -
>XM_004851522.1
ATGAGGCTCTGCATTGGCATTGTCCTCTGCTCCTTGGTCCTGGGAGTCAGCAGTGATGGCTGGTACTCCTTCTTCAAGGAGGCTGCCCAAGGGTCTTGGGACATGTGGAGAGCCTACTGGAACTTGCAAGTAGCCAGTTACCCAAATTCAGAGAGATACTTCCATGCGCGGGGGAACTATGATGCTGCCCAAAGGGGACCTGGTGGGGTCTGGGCTGCGAAAGTGCTCAGCAATGCCGGGAAGTACCTTCAGGGCATCTCAAACCGGTTTTATTATGGAATGAGCAACTATGGATCAGAAAACATTGAGTCCAACCAGAAAGCTGAGGAATGGGGCCGATATGGCAAAGACCCCAATCACTTCAGACCACCTGGCCTGCCTGAGAAGTACTGA

XM_004851529.1 Coding sequence

Hps5 Hermansky-Pudlak syndrome 5, transcript variant X2

Length: 3075 bp    Location: 9808079..9768638   Strand: -
>XM_004851529.1
ATGACTTTTGTGCCCACGATCCCAGAGTCTTACAGCCATGTTCTCGCGGAGCTTGAGTCCCTGGACCCGTTACTTTCAGCTCTGCGGCTGGACTCCAGTCGTCTAAAGTGCACCAGCATAGCTGTGTCTCGGAAATGGCTGGCCTTGGGCAGCTCGGGAGGAGGAGTCAATCTCATTCAGAAAGAAGGCTGGAAGCACAGGCTTTTTCTCTCGCACCGGGAAGGTTCAATTTCTCAGGTTGCCTGTTGTTCACATGATGACGATTATGTTGCTGTAGCTACCAGTCAAGGTCTTGTAGTTGTTTGGGAATTAAATCAAGAGCATCGTGGGAAACCAGAACGAATTTATGTGTCTTCAGAACACAAAGGCCGAAAAGTTACAGCTCTCTGTTGGGATACAGCTGTTCTTAGAATCTTTGTAGGTGACCATGTGGGGAAAGTTTCTGCCATCAAACTCCACACTTCTAAACAAGCAAAGGCAGCTTCTGTCTTTGTGATGTTTCCTGTTCAGACAATAACAACAGTCGACTCCTGTGTTGTCCAGCTAGATTATTTGGATGGAAGGCTCCTTGTATCTTCCCTTACTCGAGCCTTCTTGTGTGACACTGAGAGAGAGAAGTTTTGGAAAATTGGAAACAAGGAAAGAAATGGAGAATATGGAGCTTGTTTCTTCCCTGGAAGGTGTTCTGGGGGCCAGCAACCTCTAATATATTGTGCTCGTCCTGGCTCCAGGATGTGGGAAGTGAGCTTTGATGGGGAAGTTAGAAGTACACATCAGTTCAAGAAACTCCTCTCGTTGCCACCTCTTCCTGTGATTACTCCAAGATCTGAACCTCAGTATGATCATACAGTGGGATCCTCCCAGTCTTTGTCTTTCCCCAGACTCTTGCATCTTAGTGAGCATTGTGTGCTGACTTGGACAGAAAAAGGAATTTATATTTTTATTCCTCAGAATGTTCAAGTTCTTCTTTGGAGTGAAGTCAAAGATATTCAGGATGTGGCTGTCTACAAGAATGAGCTGTTCTGTTTGCACCTGAACGGGAAAGTCTCACATCTTTCTCTGCTGTCTGTGGAGCGCTGTGTGGAACGTCTGCTAAGGAGAGGTCTGTGGGTTCTGGCTGCTCGCACATGCTATCTGTTCCAAAATTCCATTGTTGCCAGCAAGGCAAGAAAAACTTTGACTATAGATAAATTGGAGCACTTGAAGTCTCAGCTGGATCTTGAAACTTATAGTGATCTCATTCCTCAACTGGATGAATTGATATTGAAATTTGAACCTTTGGATTCAGCTTGCAGCAGTAGAAGAAGCTCTATTTCATCACATGAGAGTTTCAGCATCTTGGACTCTGGTATTTATCGTATCATTAGTAGTAGAAGAGGCAGTCAGTCAGATGAAGATTCTTGCTCCCTTCACAGCCAAACCTTCTCGGAAGATGAGAGACTTAAAGAATTCACCTCACATCCAGAAGAGGACCAGCCAGTGACGTTTGAGACAGATAAGAATGAAACTTTTCTCCCCTTCGGCATTCCATTACCATTTCGTTCTCCATCTCCTCTTGTATCTCTTCAGGCTGTCAAAGACAGTGTTTCTAGCTTTGTGCGTAAAACTACTGAGAAGATTGGTACCCTTCACACAAGTCCTGAGCTAAAAGTGAGACCAGAACCCAGGGATGAAGATCAGTCTTGCGAAGAGGAAGTGAGTTCAGTTACATGCCCACAGGAAGAAGTCACTGAGGAGAAAAAAGAAGTAATTAGTCAACCCCCAAAAGAAGACAGGTTCCAAGAGCTCACAGCAGCAACAGCAGAAGCAATGACCAAGCTACTGGACCCTTTGGTTTTGTTTGAACCCCAGTCTCTGAGAGTGGTTTTACAAGAGTGGCTTTCACACTTAGAAAGGACATTTGCCATGAGAGACTCTCCAGGCACTTCAGATACTGGCAACTCACTTGTGAAACTGAACCAAGATGAGTCAAAAAAGAGAATAGTGGGTGAAGATAATGAAGGAGAAAAAAGGGACTCTTTAGACAATGAAGAAACTGTTGACCCAACAGCGTGTGAATCCATAAATAGTCCAAGGGAGCCCTCGGATGATGACCTTTTCCAAGTGTGTTCCCCATGCGCCATACCAACCAGTCTTCAGAAGGACCTGGCTGAGTTGACAGCATTGTGTTTGGAATTGAACGTTTTGAATTCTGCTATCAAAAGCACGGATGGACATGCAGACCATACTTTGCAACAGTGTTCACCTGAAATTCTGGCTTGTCAGTTTGTAAAGAAGTACTTTTTTCTCCTGGATTTGAAAAGAACAAAAGAGAGTATCAAGCTTAGTTATACTAGCAGCTCCCGTATTTGGGATACTTTCATTGAAGGATTGAAAGAAATGGCCAGTTCTAACCCTACTTATATGGAGATGGGAGAAGGAGACCTACCAACAAGATTAAAGTTATTGGATGACTCCATTCCTTTTGATAGTCCTTTGTTGATTGCTTATGCCACCCGGTTATATGAGAAGTTTGGAGAATCTGCCCTTCGATCCTTGATCAGGTTTTATCCATCCATTTTGCCTTCAGACATCATACAACTTTGTCGTCATCATCCAGCTCAGTTTCTGGCCTATTTAGATAGTTTGGTGAAATCAAGACCTGAAGACCAGCGGTCATCTTTCCTAGAGTCCCTTCTGCAACCAGAGTCCTTAAGATTAGATTGGCTACTTTTGGCAGTGTCCCATGATGCTCCACCAAGCACCAGTACTGTGGATGATGAAGGGTACCCCAGGCCTCATTCGCACTTGTTCTCCTGGGGTTACAGTCAACTGATCCTTTATCTAATTAAACTTCCTGCAGATTTTACAACCAAAGAGAAAATGACAGACATCTGTAAGTCTTGTGGTTTCTGGCCTGGATATCTAACTCTGTGCTGGGAGCTGGAGAGAAGAAGAGAGGCGTTTGCCAACATCGTGTATCTGAATGATATGAGCCTGATGTCAGGGGACAATGGTGCGTATGTCCCAGTGGATTACTCTTGCAGGTGGTATTTTACAAGTCTCTCTAGACTTTTTCATAAAGAAATGTGGTGA

XM_004851787.1 Coding sequence

LOC101713127 mas-related G-protein coupled receptor member X1-like

Length: 807 bp    Location: 10477691..10482457   Strand: +
>XM_004851787.1
ATGTCAAGGAACCCCATTTCAGTCTATATCCTCAACCTGGCTGCATCAGACTTCCTTTACCTCTGCTGCCTTCTTATATTCTACCTATGGAAACTCATTGACCACTCTGACTTCAAGTACTACATCTACATACATCCAGTGGGAATGTTGTCATACACCATGTGCCTGTTCATGCTCAGTGCCATTAGCGTCAAGCATTGCCTTGCAGTCCTGTTCCCCATCTGGTACTGCTGTGGCCACCCAAGACACATGTCAGCTGTCACGTGTGCCCTGCTCTGGGCTCTGTCCCTACTGCTCACCATTCTTGTACACATCTCATGTAGCTCTCTGTTTGAGAACGATGAGCTATGTTTGAGAATACATTTCATCATAGCCCCATGTCTGATCCTTCCATTTGTTATTCTCTGTGGGTCCAACCTGGCCTTGCTGGTCAGGATTCTCTGTGGCTTCAGCAGGTTGCCACTGACCAGGTTGTATGTGACCATAGGGCTGTCAGTGCTGGTCTTCCTCCTCTGTGGCCTCCCTGTGGGCATCATATGGGCTCTGGCAGGCACAGTTGCTTTTTACACTCACTTTTCAACCTTTAAGGTCCTTGAAAGGGCTGCTTTTTTGCTGTCTAGTATTAACAGCAGCGCCAACCCCATCATTTACTTCTTTGTTGGCTCCTTTAGGCAGAAACAGCAACAGAGGCAGCAGCGGCAGTCCCTAAAGCTGGTTCTCCAGAAGGCCTTGGAGGATATGGCTGAGGGAGAGAAAACTGGAGAAAATCTTCCCCAGGAAAATACTGAGATGTCAGGATCTCCTTAA

XM_004851526.1 Coding sequence

Gtf2h1 general transcription factor IIH, polypeptide 1, 62kDa, transcript variant X2

High confidence: 4 potential gene matches
Length: 1647 bp    Location: 9808170..9848173   Strand: +
>XM_004851526.1
ATGGCAACCTCATCTGAAGAAGTTTTGCTGGTTGTAAAGAAGGTGCGTCAAAAGAAACAGGACGGAGCTCTGTACCTCATGGCAGAACGAATTGCTTGGGCACCTGAAGGCAAAGATAGATTTACAATCAGCCATATGTATGCAGATATTAAATGCCAGAAAATCAGTCCGGAAGGAAAAGCTAAAATTCAGCTTCAGCTGGTCCTTCATGCAGGGGACACAACAAACTTCCATTTTTCGAATGAAAGCACAGCTGTGAAAGAGCGAGATGCAGTAAAGGACCTTCTTCAGCAGCTACTGCCCAAATTCAAGAGGAAAGCAAATAAGGAGCTGGAAGAGAAAAACAGAATGCTGCAAGAAGATCCTGTTCTGTTCCAGCTTTATAAAGACCTTGTTGTGAGTCAGGTGATCAGTGCTGAGGAATTCTGGGCCAATCGTTTAACTGTGAATACAATGGGTAGTTCTTCCACATCCAATCACAAGCAGGACGTTGGCATTTCTGCGGCATTTCTGGCTGATGTCCGGCCCCAAACAGATGGCTGTAATGGTTTGCGATATAACTTAACTTCTGATATCATTGAGTCCATATTTAGGACCTATCCAGCAGTAAAAATGAAATATGCAGAAAATGTTCCTCACAACATGACAGAAAAGGAATTCTGGACACGTTTTTTCCAGTCCCATTATTTTCATAGGGACCGGCTGAATACAGGGTCAAAGGATCTTTTTGCAGAATGTGCCAAAATAGATGAAAAAGGGTTAAAAACAATGGTTTCATTAGGAGTGAAAAACCCACTACTAGATTTGACAGCTTTGGAAGATAAACCATTAGATGAGGGCTATGGCATTTCCTCTGTGCCCTCTACTTCCAATTCTAAACCCATCAAGGAGAATAGTAACGCTGCCATCATCAAGAGGTTTAACCATCATAGTGCCATGGTCCTGGCAGCAGGTCTCAGGAAACAAGAAGCACAAAATGAACCAAATGGTGAGTCCAGCCGAATGGACGGAAGTTCTGGAGATGCAGACTGCTTTCAGCCAGCAGTCAAAAGGGCAAAGTTACAAGAGTCCATTGAATATGAAGACTTGGGAAAAAATAATTCCATAAAAACGATTGCACTAAACCTCAAGAAGTCAGATAGGTATTACCATGGTCCAACTCCAATCCAGTCAGTACAATATGCAACAAGTCAGGACATTATTAATTCTTTTCAAAGTATTAAACAAGAAATGGAAGCTTATACACCCAAGTTAACTCAGGTTCTCTCAAGTAGTGCTGCTAGTAGTACTATCGCAGCACTGTCACCTGGAGGAGCACTTATGCAGGGAGGGACACAGCAAGCCATAAACCAGATGGTGCCAAGTGATATTCAGTCTGAATTAAAACACTTGTATGTGGCTGTTGGAGAACTTCTTCGGCATTTCTGGTCCTGCTTTCCTGTCAATACACCATTCCTAGAAGAAAAGGTAGTGAAAATGAAAAGTAATTTGGAACGATTCCAAGTTACAAAGCTTTACCCATTCCAAGAAAAAATTCGGAGACAGTATTTAAGCACAAATTTGGTGAGTCATATAGAAGAGATGCTGCAGACAGCCTACAACAAGCTCCACTCGTGGCAGTCACGGCGCATGATGAAGAAGACGTGA

XM_004851527.1 Coding sequence

Gtf2h1 general transcription factor IIH, polypeptide 1, 62kDa, transcript variant X3

Length: 1554 bp    Location: 9808170..9848173   Strand: +
>XM_004851527.1
ATGGCAACCTCATCTGAAGAAGTTTTGCTGGTTGTAAAGAAGGTGCGTCAAAAGAAACAGGACGGAGCTCTGTACCTCATGGCAGAACGAATTGCTTGGGCACCTGAAGGCAAAGATAGATTTACAATCAGCCATATGTATGCAGATATTAAATGCCAGAAAATCAGTCCGGAAGGAAAAGCTAAAATTCAGCTTCAGCTGGTCCTTCATGCAGGGGACACAACAAACTTCCATTTTTCGAATGAAAGCACAGCTGTGAAAGAGCGAGATGCAGTAAAGGACCTTCTTCAGCAGCTACTGCCCAAATTCAAGAGGAAAGCAAATAAGGAGCTGGAAGAGAAAAACAGAATGCTGCAAGAAGATCCTGTTCTGTTCCAGCTTTATAAAGACCTTGTTGTGAGTCAGGTGATCAGTGCTGAGGAATTCTGGGCCAATCGTTTAACTGTGAATACAATGGGTAGTTCTTCCACATCCAATCACAAGCAGGACGTTGGCATTTCTGCGGCATTTCTGGCTGATGTCCGGCCCCAAACAGATGGCTGTAATGGTTTGCGATATAACTTAACTTCTGATATCATTGAGTCCATATTTAGGACCTATCCAGCAGTAAAAATGAAATATGCAGAAAATGTTCCTCACAACATGACAGAAAAGGAATTCTGGACACGTTTTTTCCAGTCCCATTATTTTCATAGGGACCGGCTGAATACAGGGTCAAAGGATCTTTTTGCAGAATGTGCCAAAATAGATGAAAAAGGGTTAAAAACAATGGTTTCATTAGGAGTGAAAAACCCACTACTAGATTTGACAGCTTTGGAAGATAAACCATTAGATGAGGGCTATGGCATTTCCTCTGTGCCCTCTACTTCCAATTCTAAACCCATCAAGGAGAATAGTAACGCTGCCATCATCAAGAGGTTTAACCATCATAGTGCCATGGTCCTGGCAGCAGGTCTCAGGAAACAAGAAGCACAAAATGAACCAAATGGTGAGTCCAGCCGAATGGACGGAAGTTCTGGAGATGCAGACTGCTTTCAGCCAGCAGTCAAAAGGGCAAAGTTACAAGAGTCCATTGAATATGAAGACTTGGGAAAAAATAATTCCATAAAAACGATTGCACTAAACCTCAAGAAGTCAGATAGGTATTACCATGGTCCAACTCCAATCCAGTCAGTACAATATGCAACAAGTCAGGACATTATTAATTCTTTTCAAAGTATTAAACAAGAAATGGAAGCTTATACACCCAAGTTAACTCAGGTTCTCTCAAGTAGTGCTGCTAGTAGTACTATCGCAGCACTGTCACCTGGAGGAGCACTTATGCAGGGAGGGACACAGCAAGCCATAAACCAGATGGTGCCAAGTGATATTCAGTCTGAATTAAAACACTTGTATGTGGCTGTTGGAGAACTTCTTCGGCATTTCTGGTCCTGCTTTCCTGTCAATACACCATTCCTAGAAGAAAAGTTGGTGAGTCATATAGAAGAGATGCTGCAGACAGCCTACAACAAGCTCCACTCGTGGCAGTCACGGCGCATGATGAAGAAGACGTGA

XM_004851536.1 Coding sequence

Tsg101 tumor susceptibility gene 101

High confidence: 4 potential gene matches
Length: 1176 bp    Location: 9977696..9934226   Strand: -
>XM_004851536.1
ATGGCGATGTCGGAGAGCCAGCTCAAGAAGATGGTGTCTAAGTACAAATACAGAGACCTAACTGTACGTGAAACTGTCAGTGTTATCACTCTGTACAAAGATCTCAAACCTGTATTGGATTCATATGTTTTTAATGATGGCAGTTCTAGGGAACTAATGAACCTCACTGGAACAATTCCTGTGCCTTACAGAGGTAATACATATAATATTCCAATATGCCTATGGCTGCTGGACACATACCCATATAACCCCCCTATCTGTTTTGTTAAGCCTACTAGTTCAATGACTATTAAAACAGGAAAGCATGTTGATGCAAATGGGAAAATATATCTTCCTTACCTGCATGAATGGAAACACCCTCAGTCAGACTTGCTGGGGCTTATTCAGGTCATGATTGTGGTGTTTGGAGATGAACCTCCAGTCTTCTCTCGTCCTACTGTTTCAGCATCCTATCCACCATACCAGGCAACAGGGCCACCAAATACCTCCTACATGCCAGGCATGCCTGGTGGAATCTCTGCATACCCACCTGGATATCCTCCTAATCCCAGTGGTTTCCCAGGCTGTCCTTACCCACCTGGTGGTCCATACCCTGCCACAACAAGCTCCCAGTACCCCTCCCAGCCTCCTGTGACCACTGTTGGTCCCAGCAGAGACGGAACCATCAGCGAGGACACCATCCGGGCCTCTCTTATTTCAGCAGTCAGTGACAAACTAAGATGGCGAATGAAGGAAGAAATGGATCGTGCCCAGGCGGAGCTTAATGCCTTAAAACGAACAGAGGAAGACCTGAAGAAAGGTCACCAGAAACTGGAAGAGATGGTCACCCGCTTAGATCAAGAAGTAGCTGAAGTTGATAAAAACATAGAACTTTTGAAAAAGAAGGATGAAGAACTCAGTTCTGCTCTGGAGAAAATGGAAAATCAATCTGAAAACAATGATATTGATGAAGTTATCATTCCCACAGCCCCACTATATAAACAGATTCTCAATCTATATGCAGAGGAAAATGCTATTGAAGACACCATCTTTTACCTGGGAGAAGCCTTGAGGCGGGGAGTCATAGACCTGGATGTCTTCCTGAAGCATGTACGTCTTCTGTCCCGTAAACAGTTCCAGCTGAGGGCACTAATGCAAAAAGCAAGAAAGACTGCCGGTCTTAGTGACCTCTACTGA

XM_004851535.1 Coding sequence

Uevld UEV and lactate/malate dehyrogenase domains, transcript variant X2

Length: 1347 bp    Location: 10020747..9981502   Strand: -
>XM_004851535.1
ATGGAGTTCGACTGCGAGGCCGTGAGACAGCTCCTTGGCAAGTACAAGTTCAGGGATCTGACTGTGGAAGAACTAAAGAATGTAAATATGTTTTTCCCACATTTCAGATATTCCATGGATACCTACGGTCACCAGTATAACATACCAGTTCGTTTCTGGATTTTGGATTCTCATCCTTTTGCTCCTCCCATTTGCTTCCTGAAGCCAACAACAAATATGGCAATCTCAGTTGGAAAACATGTGGATGCTCAAGGCAGAATATACTTGCCCTATCTCCAAAACTGGAGCCATCCTAAATCTGTCATTGTTGGATTAATTAAAGAAATGATTACCAAGTTTCAAGAGGAACTTCCCCTATATTCTCTGCCATCATCTGATGAAGCTCAGCAGGTAGACTTGCTGGCCTATATTGCAAAAATTACTGAAGGTGTCTCAGATATAAATTCAAAGAGTTGGACAAGTCATGAGAACAAAATAGCCAATAAAATTACTGTGGTTGGAGGTGGAGAGTTGGGTATTGCCTGCACATTAGCAATTTCAGCAAAGGGCATTGCAGATAAGCTGGTCCTTCTGGACTTCTCAGAAGGGACTAAAGGAGGCACAATGGACCTTGATATCTTCAGCCTGCCTAATGTGGAGATCAGCAAAGATTTGTCTGCCTCTGCTCATTCCAAGGTGGTGATCTTCACAGTCAACTCTCTCGGTAATGCTGAGTCCTACCTTGATGTGGTGCAGAGCAACGTGGATATGTTTCGAACCCTCGTCCCTGCTCTTGCACATTACAGTCAACATGGCGTCCTGATCGTTGCGTCTCAGCCAGTGGAAATCATGACTTATGTGACATGGAAACTGAGTACATTTCCTGCAAATCAAGTGATTGGAATTGGATGTAATCTGGACTCACAGAGATTACAATATATTATCACAAACATTTTGAAGGCACAGACTTCCGGCAAAGAAGTATGGGTTATTGGTGAGCAAGGAGAAGACAAAGTGCCCACATGGGGTGGACAAGAAGTAATAAATCACAGCTCTCGGGTACAGCTGTCCAACAGAGCCGTGGAACTGTTAAGGGTAAAAGGTCAGAGATCCTGGTCTGTGGGACTGTCAGTAGCTGACCTGGTTGACAGTGTCATAAACAATAAGAAGAAAGTGCATTCCGTATCCACTTTAGCAACGGGATATTATGATATAAATAGTGAAGTGTTTTTAAGTTTGCCTTGCATCCTCGGAACCAGTGGGGTATCTGAAGTCATCAAAACTGACGAGAAAGAAGTTACAGTGACTGAGAAACTCCAGAGCAGTGCATCCTCAATCCATGATCTCCAACAACAGTTAAAACTTTGA

XM_004851781.1 Coding sequence

Spty2d1 SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)

High confidence: 4 potential gene matches
Length: 1944 bp    Location: 10061901..10039919   Strand: -
>XM_004851781.1
ATGGACTTCAGGGAAATTCTCCTGATAGCTTCCAAAGGACAAGGTGTCAACACTGTCCCCAAAAGGTATAGTTTGGCAGTGGGACCTCCTAAGAAAGACCCAAAAGTTAAAGGTGTCCAATCAGCAGCTGTACAAGCTTTTCTTAGAAGAAAAGAAGAGGAGCTCAGACGAAAGGCCTTAGAAGAGAAAAGGAGAAAAGAAGAACTAGTGAAAAAACGAATTGAGCTCAAACATGACAAGAAAGCAAGAGCTATGGCCAAGAGGACAAAAGATAATTTTCATGGTTACAATGGGATTCCTATTGAGGAGAAGTCAAAGAGGAGGCAGGCGATGGAAAGCCACACCAGCCAGGGAACAGACCAAGAGTACGAGATGGAAGAAGAGGATGAATTCTTAGAATACAATCAGGTGGAGTTGGAGCAGGAGTATGAGGAAGAACAAGAACCTCCTAAAGTTGAAAGCAAACCAAAGGTCCCCCTTAAAAGTGCCCCACCACCCATGAACTTCACCGATTTACTGAGGCTGGCTGAGAAAAAGCAGTTTGAACCAGTGGAGATCAAGGTGGTGAAGAAAACAGAAGAGCGACCTATGACTGCACAAGAACTTAAGGAGCGAGAATTTCTTGAACGAAAGCATAGGAAAAGGAAACTGGAGACAGATGTGAAACTACCTCCAACTGTATCTAAAAAGGCATCCTCTCAGAAGGAAAGTGTGGGCACAAAACTTAACAAAGTTCCTGGGGACAGGCACCCTTCTTCCAAAGGAATGTCCTTTCCTCATACTGAGAAGAAATCCAGACCCAGCACAGCCAGTGAGAAACATTTAGCTTTGTCTTCATCTAAATCCGTGCCAGGAAAGAGAACCAAGGCAGGATCTGGCAACAGCTCCCAGCCCTCACTTTGTGAGGGTCATGACAGACCTGTTTTCAATGGGGCTGTGAAGCCCTACTCCAGCACCTATTCCCCAAGTGTCCCAAAGACTTCTGCTAGCGGAACTCAGAAATCTGCTGCTGAGTACAAAGCCAAAAAACTTCCTTCTTCCCATCCTAGCCATTCCAAACCTGGGCCTACTGTCACTCCCCAGAGTAAGGCTAAGAGTCCAGGTGTCAGACAGCCAGGCAGCACCTCCAGCTCAGCCCCTGGGCGGCCCAGTCTGGGGACCGCTCGGCCCACACTTAGTTCTGGCTCTGTTCCCAGGGGCCAGAATGGCAGCTCCAGCTCAGGACCCAAGCGATCAGTCAGTGGAACTAAGAAGCTGTCCAGTGACTTAAATCCCTCTGGGCGGACAGTCAGTGGTACAAGTGGTCCTGGGCGACCGGTCAGTGGCTCAGGTAATTCCAGGAGACCTGTGGGCAGCTCTGGAGGCTCTGAGCGGCCTATTAGCAGTTCACATGATCGACGACCTGTAAGTGGCGCCAGGCCCACTGGGCGGCCGGTCAGTGGTGCTGGACGATCCATAAGTGGCTCAGTACCCGCTGCACGGACTGTTAACAGTTCAGGCCCTGGGAGACCAGTGAGCAGCTCAGGACCTGGGCGAACGGTTAGCAGCCCAGGCCCCCCCATAAGGCCCAAGTGCACTGTTGTCTCGGAAACGATTTCTTCTAAGAATATTATCAGCCGGTCAGATAATGGACAGATGAATGGAATGAAGCCTCCTCTCTCGGGCTACAGATCTGCCCAAGGTCCTCAAAGGCTTTCCTTCCCTGCCAGCTACAAAAGGCAGCGAGATTACGAAGAGGAAGAAGATGATGCTGATGAGGATGAATATGACTCTGAAATGGACGATTTTATTGAAGATGAAGGAGAACCTCAGGAAGAAATATCAAAACATATTCGAGAAATTTTTGGCTATGACCGGAAAAAGTACAAAGATGAAAGTGATTATGCCTTACGTTACATGGAGAGTAGTTGGAAAGAGCAGCAGAAAGAAGAAGCAAAGAGGTAA

XM_004851782.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 4248 bp    Location: 10145478..10125665   Strand: -
>XM_004851782.1
ATGACAACCATTCACCACCAGCAGATGCCACAAGAGCACATATCCATGAAGGAACACGTGTCCACGGAGCTCTCCAGCTCCACCACCCACGTGCGGACCTTCTCCCAGACAAGCCAGATCATGGGAGGCAAGGCTTTCAGAAGAAAAGTCCTCGGGCTCCGTGGGTTCTTCAGCCCGGTGATCCGGAGTTCCAGCATCCCCGAGGGCGAGAGCGTCCCTGAGTCCGTGGAGAAACCTCCCCCGATCACGTCCGCGGAGGGGGATAAAGCCGTGTTCCGATTCCAGGTGCGGGGGAACCGCAAATCCAGTGTCTCCTGGACGAGAGAGACCGGCATCCCATCAAAAAAGTCGGCCAAGATATTCTAGGACAGCGTCAACAAGGAGCACGTGCTGAAGCTGGAACCACTGACCTCAGATGACTCCGACAACTACAAGTGCGTTGCGAGCAAGGAACATGCAGACCCCATCTATACTGCGTCCTTGCTGGTGACAGAGGGTCAAGAAAAACTAGATTTGAAGAAGATGTTAAAGAACACTTGGTCCCCTACTCCTCGCAGGGCTCTTCCTGCTGCCCCCAAGAAGAAGCGGTAAGTGACAGACGAGAAAGAGATGCTGGAGATTTCGTCCGAGGTAGCCAAGAAGGACTTTGAAAAGGTCTGCATGGAGTCCAGCTTCACTGACTTCCCCGGGCTGCTCAAGAAGCTCAAAGGAATGAAGAAAAAAGTGGAAGTGGAGGCCATCCAGATTCTGAACCCCCCAGAAGACATAGAGACCAAGATTGACACAACAGTAAACTTTGATTGCATTATGGAGCTGAAGGACCCGAATACCAAGATGATATGGGTCAAGGATACTGAGCCTCTGAGGATCCAATACTCCCGGGGCAAGTACAACTTGAAGCAGATGGGCACCAAGTACCCGCTGATCATTACCAATGTGAGCATGAGTGATGCTGGCATCTACAGCCTCTCTGTAGGTGATAAGCCAGTGACACCTGAGTCTCCCTGCCCCTCTGCCCCTCCCCTCTCTGCTGCAAATGAACTGCAGAAGTTCATGGGAGAGATGAAGCCCATGAAGATGACACAGCACCAGATGGCTGTATTTGAAATCTGCCTTTCCAAGAAAGAGCCCGATTTTGTGTGGAAGTTCCATGGGAAGGAGCTGAAGAGGGATGACCAGTATAAAATCTCAGAGTCCAAGGACGGTCTGACTCACATGCTTAAGATTAAGGATACCAGACTCAGTGACAGTGGCAAGTCCTTTGCTTGTGCAGGGGACCTGGTACAGAAAGAAGCTGAGATCCTTATTGATCGTATTCCCACCACGTTTGTGAACACACTCAAAAATGCATGTGAAAGAGAGAAGCCACACTCATGCATGGAGTGTGAACTGACATCCAAGCGTGTGACCCTGGGCTGGAAGAAAGATGGACGGCTGCTGACATGTGGCTCCAAGTACAGCATGAGCCACAAGGGCAAGCGTGCAGAGCTGGTCATTAAGGACACACAGCTCAGTGGTGGTGGCGAGTACACCGTGGTGGCCATGCAGGATGGGGACCCCNCTGAGTATGTCAGTACTGCCACCCTCACTGTGGAAGAGGGTCTGGCCACCACTTAGAGTGGGATCTCCGACGTGCACGCGGCCGAGTTGTGCGTAGTGCGGAACCGCGAGAAGGTGGAGGGCGTGTGGCTGAAGGATGGCAAGAAGAGCACAGATTTGCCTGGCGTTCAGATAGTGAAGCAGGGTGCGGTGCACAAGCTCATCTTCCCCAACGTGAGACGGGAACACGAGGGTAACCACACCCCCATTCCCTCTGGCTCCTCCCCCGTGGTTGACTCCTCCCTGCTGCCCCGCCCGCCGCTACCGATTGATCCTCCTACCATGGACCCATCCACCCTGGAGGCACTGGCGGCGCACGCTGTGACTGTGAAGGTGGGCCACACGGAGGGCCCGCATCGAGGTGACCTTCTGGGCAAGGCCGCTGCCCAAATGACGTGGTACAAGGGCAACATGGAGGTGACGGAGGAGGAACGCATGTCCATGGAGACCCTGCAAGAGCGAGTAGAGTTCCTGGAGCCCTCAGGGAATTGTGTGCACATGAAGTAGAAGGCTCCAAAGGACAGCAGCAGGCAGCTTGTGACCCATTTCATAATGGAACAGAGGGCAGCTGGCAAGAAGTCCTGGGTTAAGATAGGCGAGATGGACGGGAAAGTCACCAACGAGGTGGAAGAGGGACAGGCCTGCCAGTTCTGTATCCTGACAGTCAATTCAGAAGGTGTGAGCAACCCACTGGAGACCGACGAAGTATTGATTGCAGAAGAAAACCAGAACATCAGATCACATGTACAACGTACCTCCATGGGTGGGCACAATTCCAGGGAAATAACCCCACTTCTTTCTCCAATCCAGAAATCATCCTGGAATCCAGAGGAGTGCAATGTTACTTTAGGAGGAAAAAAAAGAATTATTGATTTAATGGGCTGTGGGTGGGGAACTGTCTACATGCTCCCCTTCCTATATCCTTTGCCCTCTCTGTTCCCCACACAAACCCCTGGTCTTGCCTCCCAGCCTCAAGTGACTGATGTGACCAAAGAATCTGTGACCATCACATGGAACGGCCCAGCCCTGGATAGGGGAGCCCCAGTGTTCAGCTAAATTGTGGAATGAAGAAAAAAAGACAGTAACCTGTGGTTGCCAATCTACAAGGACCCTGTCCAGGGCACCAAGCACACCATGGAGGGTCTCCTGGCAGACACGGAATATGAATTCCAAGTCATAGCTGTGAATGAAGCGGGCCCTGGGCATCCCAGTATACCGTCCAGTTCAGGGGTGGACAAGGATCCTATCAAACCCCCAGGTCTGGTGCAGCACCTGCATGTTTCTGATTCCTCCAAGTCAAGCATCACCCTGGGATGGTGCGAGCCTATAGAAGGAGACCCGCCCTCTGGATACATCCTTGAGATGTGGGCTGAAGACAGCAAGGAGTGCTCCAAGTGCACAAAGATCCCCATCTCAGGCACCTGCTACACAGCGGGGGGCCTCACTGAGAGGTAAGAACACTTCTTCCGTATCCGAGCTGTGGACNNAAAGCCTGTGGAGCTAGATGAGGGGGTCCGTGCCATGCCACCAACAGCTGCGCCCAAGTCTGACCTCAGTGCCCAGCGGAAGAGTCACACGGTGAAGGGCCTTCCTCCAGACACCATCTGGGTGACCAATGGTGCCGACTCCTGTCAGCGCCCAGGGTTCACCACCACCCACTATTACCTGGAAGAAGATAGCTTCACCACCAAGGGCCAGGAAACCATCACCAAGGACAGAAACTACTCCCAGTTCCTCATCAACAGCACCAAGCGCTCTGTCTCAGGGCTGTATCGAATCGTGCTCCAGAATTAATTTGAGGAGGCACACTGTGACATCCATGTATTTCCCCAGCCCCTTACAAACCTACAGCTGTTTGAGGAGGTCCCCAACACTGTGACTCTGACCTGGAACCATAGCCCTAACGTTAAGGAGGACAGTGACTCCCACTATGTCATCATGAAGCAGGACGTAAGCAGCCCCACCTCGTTCATGGCAGCTGAGCAGGTCTTCAGCAACAAGTACACGGTGACAGGGCTGCTCCCAGGCAGGAAGTACTACTTCAGAGGGGAAGCTCGGAATGAAATTGGTGACAGCAACCCACTGGACTCTAAGGACCCCTGGCTCGTCAATAAGGACCAGATGGAGGACCTGAGCATGAAGGTGAAGCCCTACCAGCAAGAGGACTGGCGCCACACACCTCGCTTCCTCACCCCGCTCAAGCCACACACGCTGCTCCTCAGCCAGGACTGCACCATGACCTGCGCCTTCCTTGGGAACTGGAGGCCCACGGTGACCCTGCAGAAGGGCGAGGTCAGCATCACGGCCAACTCCAAGCTCTGCTACAACTCCACCAGCGGCATGTGCAGCATCGTCACCCCCACCTGCGCACCAAAGGACAGTGGCCAGTACTTCGTGGTGGTGAACGAGCTAGGAAGGACTGCAGCAGCTGCTCCCGCACGGCCTACATGCCACCTTGGGACTGAGGGTCCCAGGGTCCAGTCCCAGGTCCTGTGCAGTAACTCTAAGTCCAGCAGTTTGGAATTTACCTGGACCCCAGCATCATTAACACTAATGAATATTTGCTTCGGTCTTTCAGACAAAGATGAAAAGACAATCTTAGCACCCATCACAGAGAGCCCGCAGAAGAAACCAAAGCACCTTATGTGA

XM_004851538.1 Coding sequence

Ptpn5 protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched), transcript variant X1

Length: 1908 bp    Location: 10182318..10147840   Strand: -
>XM_004851538.1
ATGATGCCATCCCAGTATGGGCTTGCAGTCATTTTTTGTCCTCCATGGGACTGTGAGCCCTTTGAAGGTCTTCCCCAGCCGATAGTGATGGAGGCGCTGGACAAGGCCAAAGGGCACCCTGACACACAGAGAGAGATGCCACCGCCCTCTCCACCCTCAGAGCCTGCTCAGAAACCGCCACCTCAAGGCGCTGGGAGCCACTCCCTCACTGTCAGGAGCAGCCTGTGCCTGTTCGCTGCCTCACAGTTCCTGCTTGCCTGCGGGGTGCTCTGGTTCAGCGGCTATGGCCACATCTGGTTGCAGAATGCCACAGACCTCCTCTGCACCTCGCTCACACTCCTGACACAGCTGGGACCCACGGCTTCGCTGGGCACCAGAACCTGGGGCATCCCCAGTCTGCTGCTGGTCTCTCTGTCTGTGGGCCTGGTCCTGGTCACCACCACCTTGCTGTGGCACGTCCTGAAGCCCCCCCCAGAGGCACCCAGCCTGCTGCCCCCAGAGGACAGGCGCCAGTCGGTGAGCCGCCAGCCCTCCTTCACCTACTCGGAGTGGATGGAGGACAAGGTGGAGGATGACTTCCTGGACCTGGACCCTGTGCCCGAGACGCCTGTGTTTGACTGCGTGATGGACATCAAGCCTGAGGCTGACCCCACCTCGCTGACCGTCAAGTCCATGGGTCTGCAGGAGAGGCGGGGCTCCAATGTCTCCCTGACCCTTGACATGTGCACCCCGGGCTGCAATGAGGAGGGCTTTGGCTACCTCGTGTCACCTCGCGAGGAGCTGGCCCACGAGTACCTGCTCAGCGCCTCCCGCGTCCTTCGAGCTGAGGAACTGCACGAAAAGGCCCTGGACCCCTTCCTGCTGCAGGCCGAGTTCTTTGAAATCCCCATGAACTTCGTGGATCCGAAAGAGTATGACATCCCTGGGCTGGTTCGGAAGAACCGGTACAGAACCATCCTTCCCAATCCCCACAGCAGAGTGTGTCTGACCTCACCAGACCCCGAGGACCCTCTGAGTAGCTACATCAACGCCAACTACATCCGGGGCTACCGTGGGGAGGAGAAGGTGTACATCGCCACGCAGGGACCCATTGTCAGCACGGTGGCTGACTTCTGGCGCATGGTGTGGCAGGAGCACACGCCCATCATCGTCATGATCACCAACATCGAGGAGATGAACGAGAAATGCACCGAGTACTGGCCGGAGGAGCAGGTGGTGTACGACGGCGTGGAAATCACCGTGCAGAAGGTCATTCACACCGAGGATTACCGGCTGCGGCTCATCTCCCTCAGGAGTGGGACTGAAAAACGGGGCCTGAAGCACTACTGGTTCACATCCTGGCCCGACCAGAAGACCCCAGACCGGGCACCCCCCCTCCTCCACCTGGTGCGGGAGGTGGAGGAGGCAGCCCAGCAGGAGGGGCCCCGCTGCGCCCCCATCATCGTGCACTGCAGCGCAGGGATTGGGAGGACCGGCTGCTTCATTGCCACCAGCATCTGCTGCCAGCAGCTGCGGCACGAGGGCGTGGTGGACATCCTGAAGACCACGTGCCAGCTCCGGCAGGACAGGTCAGCCCACGGTGGGGGTGGCAGCAGGGGGTCTGACGAGTGCACGGGTGAGGGGCAGACGTGGTGGTTCGCGAAGGGCCAGGGTCCAGACAGTTCCTCTTCCGGAAGGAGAGGGGAGACGGAGCTGGTGGGCAGAGGGCCAGAGGGCAGAGGCTGGCCAGGGTTGTCTCAACGTTGCACAAGGACAAGGCCCCCAGCGTCTCTCCGGGGTGACTGGTACTCTTGGGTGTGGGGCCCCTCCTGCAACCCACCCCCACTGTGCATCTCTGCTGGGCAGGGGTGGCATGATCCAGACATGCGAGCAGTACCAGTTTGTGCACCACGTCATGAGCCTCTATGA

XM_004851541.1 Coding sequence

Ptpn5 protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched), transcript variant X4

High confidence: 4 potential gene matches
Length: 1821 bp    Location: 10161551..10147840   Strand: -
>XM_004851541.1
ATGGAGGCGCTGGACAAGGCCAAAGGGCACCCTGACACACAGAGAGAGATGCCACCGCCCTCTCCACCCTCAGAGCCTGCTCAGAAACCGCCACCTCAAGGCGCTGGGAGCCACTCCCTCACTGTCAGGAGCAGCCTGTGCCTGTTCGCTGCCTCACAGTTCCTGCTTGCCTGCGGGGTGCTCTGGTTCAGCGGCTATGGCCACATCTGGTTGCAGAATGCCACAGACCTCCTCTGCACCTCGCTCACACTCCTGACACAGCTGGGACCCACGGCTTCGCTGGGCACCAGAACCTGGGGCATCCCCAGTCTGCTGCTGGTCTCTCTGTCTGTGGGCCTGGTCCTGGTCACCACCACCTTGCTGTGGCACGTCCTGAAGCCCCCCCCAGAGGCACCCAGCCTGCTGCCCCCAGAGGACAGGCGCCAGTCGGTGAGCCGCCAGCCCTCCTTCACCTACTCGGAGTGGATGGAGGACAAGGTGGAGGATGACTTCCTGGACCTGGACCCTGTGCCCGAGACGCCTGTGTTTGACTGCGTGATGGACATCAAGCCTGAGGCTGACCCCACCTCGCTGACCGTCAAGTCCATGGGTCTGCAGGAGAGGCGGGGCTCCAATGTCTCCCTGACCCTTGACATGTGCACCCCGGGCTGCAATGAGGAGGGCTTTGGCTACCTCGTGTCACCTCGCGAGGAGCTGGCCCACGAGTACCTGCTCAGCGCCTCCCGCGTCCTTCGAGCTGAGGAACTGCACGAAAAGGCCCTGGACCCCTTCCTGCTGCAGGCCGAGTTCTTTGAAATCCCCATGAACTTCGTGGATCCGAAAGAGTATGACATCCCTGGGCTGGTTCGGAAGAACCGGTACAGAACCATCCTTCCCAATCCCCACAGCAGAGTGTGTCTGACCTCACCAGACCCCGAGGACCCTCTGAGTAGCTACATCAACGCCAACTACATCCGGGGCTACCGTGGGGAGGAGAAGGTGTACATCGCCACGCAGGGACCCATTGTCAGCACGGTGGCTGACTTCTGGCGCATGGTGTGGCAGGAGCACACGCCCATCATCGTCATGATCACCAACATCGAGGAGATGAACGAGAAATGCACCGAGTACTGGCCGGAGGAGCAGGTGGTGTACGACGGCGTGGAAATCACCGTGCAGAAGGTCATTCACACCGAGGATTACCGGCTGCGGCTCATCTCCCTCAGGAGTGGGACTGAAAAACGGGGCCTGAAGCACTACTGGTTCACATCCTGGCCCGACCAGAAGACCCCAGACCGGGCACCCCCCCTCCTCCACCTGGTGCGGGAGGTGGAGGAGGCAGCCCAGCAGGAGGGGCCCCGCTGCGCCCCCATCATCGTGCACTGCAGCGCAGGGATTGGGAGGACCGGCTGCTTCATTGCCACCAGCATCTGCTGCCAGCAGCTGCGGCACGAGGGCGTGGTGGACATCCTGAAGACCACGTGCCAGCTCCGGCAGGACAGGTCAGCCCACGGTGGGGGTGGCAGCAGGGGGTCTGACGAGTGCACGGGTGAGGGGCAGACGTGGTGGTTCGCGAAGGGCCAGGGTCCAGACAGTTCCTCTTCCGGAAGGAGAGGGGAGACGGAGCTGGTGGGCAGAGGGCCAGAGGGCAGAGGCTGGCCAGGGTTGTCTCAACGTTGCACAAGGACAAGGCCCCCAGCGTCTCTCCGGGGTGACTGGTACTCTTGGGTGTGGGGCCCCTCCTGCAACCCACCCCCACTGTGCATCTCTGCTGGGCAGGGGTGGCATGATCCAGACATGCGAGCAGTACCAGTTTGTGCACCACGTCATGAGCCTCTATGA

XM_004851783.1 Coding sequence

LOC101710948 mas-related G-protein coupled receptor member A-like

Length: 993 bp    Location: 10237875..10236883   Strand: -
>XM_004851783.1
ATGGATTCAAACACATCAGCTTGGGTGACAGAAGTCACAACAACGAAAAGAAAAGGTGAAACTGCTCCTGGAACTTTCAACGAAAAGGACCTGATCCCGAACCTGGTGATCCTCATCTCTGGCCTGGTTGGACTCGCAGGAAATTCGGTCGTGCTCTGGCTCCTGGGTTTCCGCATGCGCAGGAACGCCTTCTCCATCTACATCCTCAACCTGGCTGCAGCAGATCTCCTCTTCCTCTGCTGCCACATTATAGATTCCCTGCTGGTGGTCGTCAGATATTTCCATCCCCACGTTTTCTTCCTCCCCTGCTATAAGACCGTCATGATGTTTCCCTACATCACGGGCTTGAGCGTGCTGAGCGCCATCAGCACCGAGCGCTGCCTGTCCTTCCTGTGTCCCATCTGGTACCGCTTCCGCCGCCCCAAACACACCTCAGTCACCGTGTGTGTCCTGCTCTGGGCTACGTCTCTGCTGATGTGCATTCTGAACAAGTCTTACTGTGGTTTGCTGGATGTCAACGAAAAGACTGCCGAGTGTCTGGCAGCTAATTTTTCCACTGCCACATGTCTGGGTGTTTTAGTCCTGATTCTCTCTGGGTCCAGCCTGGCCATGCTGGTCGGATTCCTGTGGGGCGGCGGCAGGCAGATGCGGCTGACCAGGCTGTATGTGACCATCCTGCTCACCGTGCTGGTCTTCCTCCTCTGTGGCCTGCCCTTGGGCGTCTACTGGTTCGTGTTAATCTGGATTCACGATGACTTTAGTGATACTTTGCAATACGGTCTTTACCTGGCCTCAGTTGTCCTGTCCTCTGTGAACAGCTGTGCCAACCCCCTCATTTACTTCTTTGTTGGCACCTTCAGGCAGCAGCCGGGGAGGCAGACTTTGAAGCTACTTCTGCAGAGGGCTCTGCAGGACAGCCCTGAGGAGGATGGATGTGGAAGCCGAGTTCCTCAGGGAACCCTGGAGATGTCAGTAAGCAGAGAAGAGCAGTGA

XM_004851785.1 Coding sequence

LOC101712050 mas-related G-protein coupled receptor member X1-like

Length: 1359 bp    Location: 10414075..10409875   Strand: -
>XM_004851785.1
ATGCGCATCAGTGGTCAACCATTTGTTTGTGTGCCTAGGGACACCACAGAAGAGCTTCTGAACATGAGTGCAACCACTGCCGCTGGTCACACAGAACTCACCTCGATGGATTGGAGAGCTCCAGAGGTCCAGATAACAATGCCGATGTTTGTGGGGACACTGACTGAAAGGACCAAACCTAAGGTCTGCAATGGAGACTCTCTGAACATGAATTCAACCATTCAACAGGAAATCATATCGATGGATGGGAGTGTTCTGGATTTTCCCTTTGACATGACAATGCTGATCCTGACTTGGCTGAATATTATCTTTTCTCTGGTTGGGCTGGTAGGTAATGCAGTTGTGCTCTGGCTCCTGGGCTTCTGCATGCACAGGAATGTGGTCTCCGTCTACATCCTCAACCTGGCAGGAGCTGACTTCCTCTTCCTGGGCTGCCACATTACAGGTTGTGTAAACGACCTTATCTATGCCTTCAATTTCACCTCTCTCGCTATTTACAAGTTCTTATTCCCTGTGATTATGTGCTCCTACATCACTGGCCTGAGCATGCTCAGTGCAATTAGTGCTGAGCGCTGCCTGTCTGTCCTGTGGCCCATCTGGCATAGACTCCACCGCCCAAGACACATGTCAGCTGTCATATGTGCCCTGCTCTGGGCCTTGTCCTTGCTACTGAGCATCCTGGCATATGTATACTGTTACTTATCACTTAGGTTTTCCTGTTATCCATGTCCTACAATGTCTTTCATCACTGCTGCCTGGCTGCTCTTTTTATTTGTGGTTCTGTGTGGATCCAGCCTGGCCTTGCTGGTCAGGATGCTCTGTGGCTCCACGAGGTTGCAACTAACCAGGCTGTATGTGACCATCGGGCTCACAGTGCTGGTCTTCCTCCTCTGTGGCCTCCCTGCAGGCATCCTTGTGTCTCTGTTATCCTGGTTTACAAATACCAGAGACTATTTTTATTATGCTCTCATCGCTGTGTTCATGTCTGGTATCAACAGCAGCATTAACCCCTTCATTTACTTCTTTGTTGGCTCCTTTAAGCAGAATCAGCATCAGTGGCAGCAGGGAAAGTCCCTGAAGTTGATTCTCAAGAAAGCCTTAGAAAGCATAACTGAGGTTGACAAAACACTCACGGGAAGAGCAGGCCTCAATCTGCTTCCACAGGGGGCTCTGTCGGACTCTCCTGAGGAGAATGGAGCCTTCCTCAGGGAACCCTGGACACCTGGGAAGCAGCAGGGAGCAATGATGAGGAGCCTCTTCCCGGTCACTGGATGTGGCTTTGGGAATGAACACTGCCCGGCCACACTTGATGGTTCTCTGCTCTTCTCCCAGCCTCACACTTCCAAAATACCTCAGTGA

XM_004851544.1 Coding sequence

Zdhhc13 zinc finger, DHHC-type containing 13, transcript variant X2

Length: 1818 bp    Location: 10556773..10608086   Strand: +
>XM_004851544.1
ATGGAGGGCCCGGGGCTAGGCTCGCAGTGCAGGAATCACAGTCATGGCCCCCACCCTCCCGGATGTGGTCGGCATGGTGTCTGTGCACATGAAAGCAAAGAGCTTGCCAAGGCAAGAGAAATTCTTCCTCTTATAGAGGACTCTAGTAACTGTGACATTGTCAAAGCCACTCAATACGGGATTTTTGAACGATGTAAAGAGTTGGTAGAGGCAGGATATGACGTCAGGCAACCAGACAAAGAAAATGTGTCACTTCTTCACTGGGCTGCTATTAACAACAGGCTGGATCTTGTAAAGTTTTATATTTCAAAAGGTGCTGTTATAGATCAGTTAGGTGGAGATTTAAATTCAACTCCTCTTCACTGGGCCATACGGCAGGGGCATTTACCGATGGTCATATTGTTACTCCAGCATGGTGCGGACCCCACTCTCATTGATGGGGAGGGATTCAGCAGCATTCACCTGGCGGTATTATTTCAGCGTATGCCTATTATAGCATATCTCATCTCAAAGGGGCAGAGTGTGAATATGACAGATGTAAATGGGCAGACACCTCTCATGTTATCTGCTTCCAAAGTAATTGGACCAGAACCAACTGGATTTCTTTTAAAGTTTAACCCTTCTCTCAACGTTGGTGATAAAACACACCAAAACACTCCACTCCACTGGGCAATTACATCAGGAAATGTTAATGCAGTTGATAAACTTTTGGAAGCTGGTTCTAGCTTGGATATCCGAAATGTTAAGGGAGAAACACCTCTTGATATGGCTCTGCACAACAAAAATCAGCTCATTATTCACATGCTAAAAACAGAAGCCAAAATGAGAGCCAACCAAAAGTTCAAACTTTGGAGGTGGCTGCAGAAATGCGAGCTCTTCCTGCTGCTGATACTCTCTGTGATTACCATGTGGGCTGTTGGATACATACTGGACTTCAATTCAGATTCTTGGCTCTTAAAAGGATGTCTTCTAGTAACATTGCTTTTTCTGACATCTTTGTTTCCAAGGTTCTTGGTCGGATATAAGAACCTTGTATACATACCCACAGTCTTTCTACTAAGTTCCATATTTTGGATATTTATGACTTGGTTCATATTATATTTTCCTGATATGGCAGGCCCCCCTTTCTATTTCGTCTTCCTTTTCAGCTTAGTAGCCTTTCTCTACTTCTTCTACAAGACTTGGGCAACTGATCCTGGCTTCACTAAGACTTCTGAAGAAGAAAGGAAAGTGAATATCATCACCCTTGCAGAAACTGGCTGTCTGGATTTCAGAACATTTTGTACATCATGTCTTATAAGAAAGCCATTAAGGTCATTCCATTGCCATGTGTGCAACGCCTGCGTAGCTCGGTATGATCAGCACTGCGTGTGGACTGGACGGTGCGTAGCATGTGGCTGGATTATGTGTGGATCTTTCATCTATTGGTCAAATCATTGTGCCACAACATTCCGAGAAGATGGATTATGGACCTACCTCAGTCAGATTGTGGCCTGTTCCCCTTGGGTCTTATATATCTTCATGCTAGCAACTTTTCATTTCTCATGGTCAACGTTTTTATTAATGAATCAACTCTTTCAGATTGCTTTTCTGGGCCTGACCTCCCATGAGAGAATCAGCCTGCTGAAGCAGAGCAGGCAGATGAAACAGACACTGTCCCTCAGGAAGACACCATACAACCTTGGATTCAAACAGAACCTGGCAGATTTCTTTCAGTGTGGCTGCTTTGGCTTGGTGAAGCCCTGCATGGTAGATTGGACGTCCCAGTACACCATGGTCTTTCATCCAGCCAAAGAGAAGGTTCTTCGCTCCGTATGA

XM_004851546.1 Coding sequence

Zdhhc13 zinc finger, DHHC-type containing 13, transcript variant X4

Length: 1785 bp    Location: 10556773..10608086   Strand: +
>XM_004851546.1
ATGGAGGGCCCGGGGCTAGGCTCGCAGTGCAGGAATCACAGTCATGGCCCCCACCCTCCCGGATGTGGTCGGCATGGTGTCTGTGCACATGAAAGCAAAGAGCTTGCCAAGGCAAGAGAAATTCTTCCTCTTATAGAGGACTCTAGTAACTGTGACATTGTCAAAGCCACTCAATACGGGATTTTTGAACGATGTAAAGAGTTGGTAGAGGCAGGATATGACGTCAGGCAACCAGACAAAGAAAATGTGTCACTTCTTCACTGGGCTGCTATTAACAACAGGCTGGATCTTGTAAAGTTTTATATTTCAAAAGGTGCTGTTATAGATCAGTTAGGTGGAGATTTAAATTCAACTCCTCTTCACTGGGCCATACGGCAGGGGCATTTACCGATGGTCATATTGTTACTCCAGCATGGTGCGGACCCCACTCTCATTGATGGGGAGGGATTCAGCAGCATTCACCTGGCGGTATTATTTCAGCGTATGCCTATTATAGCATATCTCATCTCAAAGGGGCAGAGTGTGAATATGACAGATGTAAATGGGCAGACACCTCTCATGTTATCTGCTTCCAAAGTAATTGGACCAGAACCAACTGGATTTCTTTTAAAGTTTAACCCTTCTCTCAACGTTGGTGATAAAACACACCAAAACACTCCACTCCACTGGGCAATTACATCAGGAAATGTTAATGCAGTTGATAAACTTTTGGAAGCTGGTTCTAGCTTGGATATCCGAAATGTTAAGGGAGAAACACCTCTTGATATGGCTCTGCACAACAAAAATCAGCTCATTATTCACATGCTAAAAACAGAAGCCAAAATGAGAGCCAACCAAAAGTTCAAACTTTGGAGGTGGCTGCAGAAATGCGAGCTCTTCCTGCTGCTGATACTCTCTGTGATTACCATGTGGGCTGTTGGATACATACTGGACTTCAATTCAGATTCTTGGCTCTTAAAAGGATGTCTTCTAGTAACATTGCTTTTTCTGACATCTTTGTTTCCAAGGTTCTTGGTCGGATATAAGAACCTTGTATACATACCCACAGTCTTTCTACTAAGTTCCATATTTTGGATATTTATGACTTGGTTCATATTATATTTTCCTGATATGGCAGGCCCCCCTTTCTATTTCGTCTTCCTTTTCAGCTTAGTAGCCTTTCTCTACTTCTTCTACAAGACTTGGGCAACTGATCCTGGCTTCACTAAGACTTCTGAAGAAGAAAGGAAAGTGAATATCATCACCCTTGCAGAAACTGGCTGTCTGGATTTCAGAACATTTTGTACATCATGTCTTATAAGAAAGCCATTAAGGTCATTCCATTGCCATGTGTGCAACGCCTGCGTAGCTCGGTATGATCAGCACTGCGTGTGGACTGGACGGTGCGTAGATTGGTCAAATCATTGTGCCACAACATTCCGAGAAGATGGATTATGGACCTACCTCAGTCAGATTGTGGCCTGTTCCCCTTGGGTCTTATATATCTTCATGCTAGCAACTTTTCATTTCTCATGGTCAACGTTTTTATTAATGAATCAACTCTTTCAGATTGCTTTTCTGGGCCTGACCTCCCATGAGAGAATCAGCCTGCTGAAGCAGAGCAGGCAGATGAAACAGACACTGTCCCTCAGGAAGACACCATACAACCTTGGATTCAAACAGAACCTGGCAGATTTCTTTCAGTGTGGCTGCTTTGGCTTGGTGAAGCCCTGCATGGTAGATTGGACGTCCCAGTACACCATGGTCTTTCATCCAGCCAAAGAGAAGGTTCTTCGCTCCGTATGA

XM_004851545.1 Coding sequence

Zdhhc13 zinc finger, DHHC-type containing 13, transcript variant X3

Length: 1797 bp    Location: 10556773..10607559   Strand: +
>XM_004851545.1
ATGGAGGGCCCGGGGCTAGGCTCGCAGTGCAGGAATCACAGTCATGGCCCCCACCCTCCCGGATGTGGTCGGCATGGTGTCTGTGCACATGAAAGCAAAGAGCTTGCCAAGGCAAGAGAAATTCTTCCTCTTATAGAGGACTCTAGTAACTGTGACATTGTCAAAGCCACTCAATACGGGATTTTTGAACGATGTAAAGAGTTGGTAGAGGCAGGATATGACGTCAGGCAACCAGACAAAGAAAATGTGTCACTTCTTCACTGGGCTGCTATTAACAACAGGCTGGATCTTGTAAAGTTTTATATTTCAAAAGGTGCTGTTATAGATCAGTTAGGTGGAGATTTAAATTCAACTCCTCTTCACTGGGCCATACGGCAGGGGCATTTACCGATGGTCATATTGTTACTCCAGCATGGTGCGGACCCCACTCTCATTGATGGGGAGGGATTCAGCAGCATTCACCTGGCGGTATTATTTCAGCGTATGCCTATTATAGCATATCTCATCTCAAAGGGGCAGAGTGTGAATATGACAGATGTAAATGGGCAGACACCTCTCATGTTATCTGCTTCCAAAGTAATTGGACCAGAACCAACTGGATTTCTTTTAAAGTTTAACCCTTCTCTCAACGTTGGTGATAAAACACACCAAAACACTCCACTCCACTGGGCAATTACATCAGGAAATGTTAATGCAGTTGATAAACTTTTGGAAGCTGGTTCTAGCTTGGATATCCGAAATGTTAAGGGAGAAACACCTCTTGATATGGCTCTGCACAACAAAAATCAGCTCATTATTCACATGCTAAAAACAGAAGCCAAAATGAGAGCCAACCAAAAGTTCAAACTTTGGAGGTGGCTGCAGAAATGCGAGCTCTTCCTGCTGCTGATACTCTCTGTGATTACCATGTGGGCTGTTGGATACATACTGGACTTCAATTCAGATTCTTGGCTCTTAAAAGGATGTCTTCTAGTAACATTGCTTTTTCTGACATCTTTGTTTCCAAGGTTCTTGGTCGGATATAAGAACCTTGTATACATACCCACAGTCTTTCTACTAAGTTCCATATTTTGGATATTTATGACTTGGTTCATATTATATTTTCCTGATATGGCAGGCCCCCCTTTCTATTTCGTCTTCCTTTTCAGCTTAGTAGCCTTTCTCTACTTCTTCTACAAGACTTGGGCAACTGATCCTGGCTTCACTAAGACTTCTGAAGAAGAAAGGAAAGTGAATATCATCACCCTTGCAGAAACTGGCTGTCTGGATTTCAGAACATTTTGTACATCATGTCTTATAAGAAAGCCATTAAGGTCATTCCATTGCCATGTGTGCAACGCCTGCGTAGCTCGGTATGATCAGCACTGCGTGTGGACTGGACGGTGCGTAGGTTTTGGCAACCATCACTATTACATATTATTCTTGTTTTTCCTGTCTGTAGCATGTGGCTGGATTATGTGTGGATCTTTCATCTATTGGTCAAATCATTGTGCCACAACATTCCGAGAAGATGGATTATGGACCTACCTCAGTCAGATTGTGGCCTGTTCCCCTTGGGTCTTATATATCTTCATGCTAGCAACTTTTCATTTCTCATGGTCAACGTTTTTATTAATGAATCAACTCTTTCAGATTGCTTTTCTGGGCCTGACCTCCCATGAGAGAATCAGCCTGCTGAAGCAGAGCAGGCAGATGAAACAGACACTGTCCCTCAGGAAGACACCATACAAGCCTTTGACCACAAAGATGAGGAGTTTGGACGGGGCCTCTGGACAGAGTCTTGAAAGGCTTGATTGA

XM_004851558.1 Coding sequence

Slc6a5 solute carrier family 6 (neurotransmitter transporter, glycine), member 5

High confidence: 4 potential gene matches
Length: 2322 bp    Location: 11853973..11910581   Strand: +
>XM_004851558.1
ATGGACTGCAGTGCCCCCAAGGACATGAACAAACAACCAGCCAGCAGCCGGGAGGCCGCGGCGCCGGGTCCCCGGGACAGCCCGTGCGCGCCCAGGACCAGCCCGGAGCAGGAGCTCCCCGCGGCCGCCGCGCCGCCGCCCCGCGTGCCCAGGTCCGCATCCACCGGCGCCCACACTTTGCAGTCCGCGGACGCGCGAGCCTGCGAGGCCGAGCGGCAGGGAGTGGGGTTTTGCAGCCTCAGCGGCCCGCGGGACTCAAGCGAAGGGCCCGGCAACGCGCTGGCCTGTAAGATCCCGGCTCTGCGCGGCCCGGAGGGGGACGCGACCGTGAGCGTGGGGAAGGGCACGCTGGAGCGCAACAACACCGCTACCGTGGGCTGGGTAAACATGAGCCAGAGCACCGTGGTGCTGGGCTCGGACGGAATCGCTTCGGTGCTGCCGGGCAGCGTGGCCTCCGCTGGCGCACAGGAGGACGAGCAAGGGGATGAGAATAAGGCTCGAGGGAACTGGTCCAGCAAACTGGACTTCATCCTGTCCATGGTGGGGTACGCAGTGGGGCTGGGCAATGTCTGGAGGTTTCCCTACCTGGCCTTCCAGAACGGGGGAGGTGCTTTCCTCATCCCTTACCTGATGATGCTGGCACTGGCTGGGTTGCCTATCTTCTTCCTAGAGGTGTCCCTGGGCCAGTTTGCCAGCCAGGGGCCAGTGTCTGTGTGGAAGGCTATCCCAGCTCTGCAAGGCTGTGGCATCGCGATGCTAATCATCTCCGTCCTAATAGCCATATACTACAATGTGATCATTTGCTACACACTTTTCTACCTGTTTGCCTCCTTTGTGTCCGTGCTGCCCTGGGGTTCTTGCAACAACCCTTGGAATACGCCAGAGTGCAAAGACAAAACCAAACTTTTATTAGACTCCTGTGTTATCAGCGACCACCCCAAAATACAGATCAAGAACTCAACATTCTGCATGGCAGCCTATCCCAACCTGACCACGGTTAACTTCACCAGCCAGGCCAACAAGACGTTCGTCAGTGGGAGTGAAGAGTACTTCAAGTACTTTGTGCTGAAGATTTCTGCTGGAATCGAGTATCCTGGTGAGATCAGGTGGCCGCTAGCCTTCTGCCTCTTCCTGGCTTGGGTGATCGTGTACGCATCCCTGGCTAAAGGAATCAAGACTTCAGGAAAAGTGGTGTACTTCACGGCCACGTTCCCTTACGTCGTGCTGGTGATCCTGCTCATCCGGGGAGTCACGCTACCGGGAGCTGGGGCTGGCATCTGGTACTTCATCACACCTAAGTGGGAGAAGCTCACGGATGCCACGGTGTGGAAAGATGCTGCCACTCAGATTTTCTTCTCTCTATCTGCTGCCTGGGGAGGTCTGATCACTCTTTCTTCTTACAACAAATTCCACAACAACTGCTACAGGGACACTCTGATTGTAACCTGCACCAACAGTGCCACGAGCATCTTTGCTGGCTTCGTCATCTTCTCCGTCATCGGCTTCATGGCCAACGAGCGAAAGGTCAACATTGAGAACGTGGCGGATCAAGGGCCAGGCATTGCATTTGTGGTTTACCCAGAAGCCTTAACCAGGCTGCCCCTCTCTCCATTCTGGGCCATTATCTTTTTCCTGATGCTCCTCACTCTTGGACTTGACACAATGTTCGCCACCATCGAGACCATAGTGACGTCCATCTCGGATGAGTTTCCAAAGTACCTCCGCACACACAAGCCCGTCTTTACGCTGGGCTGCTGCATTTGTTTCTTCATCATGGGCTTTCCCATGATCACTCAGGGTGGAATCTACATGTTCCAGCTCGTGGACACATACGCTGCCTCCTATGCCCTTGTCATCATTGCCATCTTTGAGCTTGTGGGGATCTCCTATGTGTATGGCTTGCAAAGATTCTGTGAAGACATAGAGATGATGATTGGATTCCAGCCCAACATTTTCTGGAAAATCTGCTGGGCGTTTGTAACCCCAACCATTCTAACTTTTATCCTGTGCTTCAGCTTTTACCAGTGGGAGCCCATGACCTACGGCTCCTACCACTACCCTAACTGGTCCATGGTGCTGGGATGGCTAATGCTTGCCTGCTCCGTTATCTGGATCCCAATCATGTTTGTGATAAAAATGCATCTGGCCCCTGGCAGATTTATTGAGAGGCTGAAGTTGGTGTGCTCGCCGCAGCCAGACTGGGGTCCGTTCTTAGCTCAACACCGTGGGGAGCGTTACAAGAACATGATCGACCCCCTGGGAACCTCTTCCCTGGGACTCAAACTGCCAGTCAAGGATTTGGAACTGGGCACCCAGTGCTAG

XM_004851588.1 Coding sequence

Arl14ep ADP-ribosylation factor-like 14 effector protein, transcript variant X1

Length: 780 bp    Location: 19394800..19405418   Strand: +
>XM_004851588.1
ATGGATCCGTGCTCGGTTGGAGTGCAGCTTCGCACCACAAACGAGTGCCACAAAACCTACTACACTAGGCACACAGGCTTCAAGACTTTGCAGGAGTTGTCGTCCAATGATATGCTTTTACTTCAGCTCCGCACCGGCATGACGCTGTCTGGGAACAATACCATTTGCTTCCATCATGTAAAAATTTACATCGACCGGTTTGAGGATTTGCAGAAGTCATGTTGCGACCCATTTAACATACATAAAAAGCTGGCCAAAAAGAACCTGCATGTCATTGACTTGGACGATGCCACTTTTCTGAGTGCAAAATTCGGAAGGCAGCTGGTGCCTGGTTGGAAGCTCTGTCCGAAGTGCACACAGATCATCAATGGAAGTGTGGATGTGGATTCTGAGGACCGCCAGAGAAGAAAGCCTGAGTCTGATGGAAGAACTGCTAAAGCTCTGCGGTCTCTCCAGTTTACAAACCCAGGAAAGCAGACCGAATTTGCTCCGGAAACTGGAAAAAGGGAGAAGAGAAGGCTCACGAAAAACACACCCGGTGGTTCAGACAGACAAGTCATACCAGCCAAGAGCAAGGTCTACGACAGCCAGGGCCTGCTCATCTTCAGCGGGATGGACCTGTGTGACTGCCTGGACGAGGACTGCTTGGGCTGTTTCTACGCCTGCCCTGCCTGCGGGTCCGCCAAATGTGGAGCCGAGTGCCGCTGCGACCGAAAGTGGCTGTACGAGCAAATCGAGATCGAAGGGGGAGAGATCATTCACAACAAACACGCTGGGTAG

XM_004851561.1 Coding sequence

Nell1 NEL-like 1 (chicken), transcript variant X3

Length: 2310 bp    Location: 11921659..12734831   Strand: +
>XM_004851561.1
ATGCCGGTGGACGTGATTTTAGTTTTGGGGTTCTGTGTGTGCGCCGCCAGGACAGTGGTGGGCTTGGGGCTGGACCCTGACCTTCAGATGGATATTATCACAGAACTTGACCTTGTCAACACCACCCTCGGAGTCACTCAGGTGCCTGGACTGCACAATGGCAGCAAAGCATTTTTATTTCAAGACACAGAAAGAGAGATCCATGGAGCTCCTCATGTGAGTGAGAAGTTAATCCAGTTGTTCCGGAATAAGAGTGAATTCACCTTTTTGGCCACTGTGCAGCAGAAGCCATCGACTTCTGGAGTGATACTGTCCATTCGAGAACTGGAGCACAGCTATTTTGAGCTGGAGAGCAGTGGCCTGAGGGATGAGATTCGATATCGCTACATGCATAAGGGGAAGCCCAGGACAGAGGCATTTCCCTACCAGATGGCAGACGGGCAGTGGCACAAGGTCGCTCTGTCAGTTAGTGCCTCTCACCTCTTGCTCCATGTGGACTGCAATCGGATTTATGAGCGCGTGATAGATCCTCCAGAGACCAGTCTTCCCCCAGGAAGCAACTTATGGCTTGGTCAGCGCAACCAGAAGCATGGCTTATTCAAAGGGATCATCCAAGATGGGAAGGTCATCTTTATGCCGAATGGATACATAACCCAGTGTCCAAACCTAAATCGCACTTGCCCTACCTGCAGTGATTTCTTAAGCCTGGTGCAAGGAATAATGGATTTACAAGAGCTTTTGGCCAAGATGACTGCAAAACTAAATTATGCAGAGACAAGACTTAGTCAATTGGAAAACTGTCATTGTGAGAAGACCTGTCAAGTGAGTGGGTTGCTCTATCGGGACCAAGACTCTTGGGTTGATGGTGACCATTGCAGGAATTGCACATGCAAAAGTGGCGTTGTGGAGTGCCGGCGGATGTCCTGTGCCCCTCTCAGTTGTTCCCCAGACTCCCTCCCTGTGCACATCTCTGGCCAGTGCTGTAAGGCCTGCCGACCAAAATGTATCTATGGAGGAAAAGTTCTTGCAGAGGGCCAGCGGATTCTCTCCAAGAGCTGTCGGGAATGCCGAGGTGGAGTTTTAGTAAAAATCACAGAAACATGTCCTCCTTTGAACTGCTCAGAAAAGGATCACATTCTTCCAGAGAATCAGTGCTGCCGGGTCTGTAGAGGTCATAACTTTTGTGTTGAAGCACCTAAATGTGGTGAAAACTCAGAGTGCAAAAACTGGAATACGAAAGCGACTTGCGAGTGCAAGAATGGTTACATCTCTGTCCAGGGAGACTCCGCCTACTGTGAAGATATTGATGAATGTGCAGCTAAGATGCATTACTGTCATGCGAATACTGTGTGTGTCAACCTGCCAGGGTTATATCGCTGTGACTGTGTCCCAGGCTACATTCGTGTAGATGACTTCTCTTGTACAGAGCACGATGAATGTGGCAGTGGGCAGCACAACTGCGACCAGAATGCCATCTGCACCAACACCGTCCAGGGACACAGCTGCACCTGCAAACCGGGCTACGTGGGCAACGGGACCATCTGCAGAGGTAGGCCTGCCCCTCCAGCATTCTGTGAAGAGGGCTGCAGACACGGTGGGACGTGCGTGGCTCCCAACAAATGTGCCTGTCCGTCTGGATTCACAGGAAGCCGTTGCGAGAAAGACATTGATGAATGTGCCTTAAGAACTCACACCTGTTGGAATGACTCTGCCTGCATCAATTTGGCAGGGGGCTTTGACTGCCTCTGCCCCTCTGGGCCCTCCTGTTCTGGTGACTGTCCCCACGAGGGAGGACTGAAGCACAACGGACAGGTGTGGACCCTGAAAGAAGACAGGTGTTCTGTCTGTTCCTGCAAGGATGGGAAGATATTCTGTCGCCGGACAGCTTGCGACTGCCTGAATCCAAGTGCGGACCTTTTTTGTTGCCCAGAGTGTGACACCAGGGTCACAAGTCAGTGTTTAGATCAAAATGGACACAAACTCTATCGAAGTGGCGACAACTGGACCCACAGCTGCCAGCAGTGTCGGTGTCTGGAAGGAGAGGTAGATTGCTGGCCACTCACCTGCCCCAGTTTGAGCTGCGAGTACACAGCTCTCTTGGAAGGGGACTGTTGTCCCCGCTGTATCAGTGACCCCTGCCTGGCTGATAACATCACCTATGACATCAGAAAAACTTGTCTGGACAGCTCTGGCATTTCAAGGCTGAGCGGAGCACTGTGGACAATGGCTGGATCTCCCTGCACAACCTGTAAATGCAAGAATGGGAGAGTCTGCTGTTCTGTGGATTTGGAGTGTCTTCAGAATAACTGA

XM_004851564.1 Coding sequence

Slc17a6 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6, transcript variant X1

High confidence: 4 potential gene matches
Length: 1749 bp    Location: 13334762..13375740   Strand: +
>XM_004851564.1
ATGGAGTCCGTAAAACAAAGGATTTTGGCCCCAGGGAAAGAAGGGCTAAAGAATTTTGCTGGAAAATCCCTCGGCCAGATCTACAGGGTGCTGGAGAAGAAGCAGGAGGCCGGCGAGACCATCGAGCTGACCGAGGATGGGAAGCCCCTGGAGGTGCCCGAGAGGAAGGCGCCGCTGTGCGACTGCACGTGCTTCGGCCTGCCGCGCCGCTACATCATCGCCATCATGAGCGGCCTGGGCTTCTGCATCTCCTTCGGCATCCGCTGCAACCTGGGCGTGGCCATCGTGGACATGGTCAACAACAGCACCGTCCACCGCGCGGGCAAAGTCATCAAGGAGAAAGCCAAGTTCAACTGGGACCCGGAGACCGTGGGGATGATCCACGGCTCGTTCTTCTGGGGTTACATCATCACCCAGATTCCGGGCGGATACATCGCGTCGCGCCTGGCGGCCAACAGGGTGTTTGGAGCCGCCATACTTCTAACCTCTACCCTAAACATGCTAATCCCATCAGCAGCCAGAGTGCATTACGGATGCGTCATCTTTGTTAGAATCCTGCAGGGACTTGTTGAGGGTGTCACCTACCCAGCATGCCACGGGATCTGGAGCAAATGGGCCCCTCCCCTGGAGAGGAGCAGGCTGGCGACCACCTCGTTCTGTGGTTCCTATGCTGGGGCTGTGATTGCCATGCCTTTAGCTGGCATTCTTGTACAGTACACCGGGTGGTCTTCCGTGTTTTACGTCTATGGAAGTTTTGGAATGGTCTGGTACATGTTTTGGCTTTTGGTGTCTTATGAGAGCCCTGCAAAGCACCCTACTATTACAGACGAAGAACGTAGGTACATAGAAGAAAGCATTGGAGAGAGTGCGAATCTGTTAGGGGCAATGGAAAAATTCAAGACTCCATGGAGGAAATTTTTTACGTCTATGCCAGTCTATGCAATAATTGTTGCAAACTTCTGCAGAAGCTGGACTTTTTATTTATTGCTTATCAGTCAGCCAGCATATTTTGAGGAAGTCTTTGGATTTGAAATTAGTAAGGTTGGCATGCTGTCTGCCGTGCCCCACTTAGTCATGACAATCATTGTACCTATTGGAGGACAAATTGCAGATTTTCTAAGAAGCAAGCAAATCCTTTCAACGACCACAGTGAGGAAGATCATGAATTGTGGTGGTTTTGGGATGGAAGCTACATTGCTGCTGGTGGTTGGTTATTCTCATACTAGAGGGGTCGCCATCTCCTTCTTGGTACTTGCAGTGGGATTCAGCGGATTTGCCATATCTGGCTTCAACGTTAACCACTTGGATATCGCTCCACGGTATGCCAGTATCTTAATGGGCATTTCAAACGGCGTTGGCACACTGTCGGGAATGGTTTGCCCTATCATTGTTGGTGCAATGACAAAGAATAAGTCACGCGAAGAGTGGCAGTATGTCTTCCTGATTGCTGCCCTCGTCCACTATGGAGGAGTTATCTTTTATGCAATATTTGCCTCCGGAGAGAAGCAGCCCTGGGCAGATCCTGAGGAAACAAGTGAAGAAAAATGTGGATTTATCCATGAAGATGAACTCAATGAAGAAACGGGGGACATTACTCAGAATTATATAAATTATGGTACCACTAAATCTTATGGTGCCACAACACAGGCCAATGGGGGTTGGCCTAATGGCTGGGAAAAGAAAGAGGAATTTGTACAAGAAGCAGTACAAGACTCGTATACCTATAAGGACCGAGATGATTATTCATAA

XM_004921115.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1188 bp    Location: 13586516..13584480   Strand: -
>XM_004921115.1
ATGGAGCCTCTCCTGCAGCAGCTGGAGCGCTTTTCCGAGGTCCTGTCCGTGTCTGGCACTGCCCACGTCAGCACCTGGGGCCCCGAGACGGTGCGCCGGGCCCTGGACTGGGCTCGCTACCTGCGCCACGTGGCCCGGCGCTTCGGCGGCCACGCCCGCATCCGCAGCGCGGTGGAAAGGCGGCTGCGCAGCCTTTGGGGACCGGAGGGCCGGGGCCTAACGAGCTTTCAGGCCCTCGGGCGCGGGGACGTCCAGCTGTTCCTCAGCCTGCTGCGGAACCGGGCGCTGGGCGAGGCGGCCGGCCGCGCCCTGCTCCTGCAGCTCTTGCCGGGCGCCGGCCCCCGGGACGCCGACGCGGAGGAGCTACAGGCCCGCCTGGCCCGCCTGGCCCGCTACCGCGCCGCGCTCCTGCTGCTGCGAGAGGCGGGCAGCCCGGGCGGAGAGCGCCCGGCCCTGGCCGAGGACCCCGTGCTGCTGACACAGGCGCAGCTGCTGCTCGGGCGGCTGCGGGAAGCCCGGGAGGCCGAGGCGGGGGACCCCGGCGGGTGGCTCGGCCGCGTGTGGACGCGCGCGCCGCGGGACCACTTCCTGCAGGTCGCGGCCGTGGCGCTGCTGCAGCCCCTGGAAAAGGAGCTGGGAGCGAGCGGTCCGGAGACACCTGGAGAGGAGAGTCAGCTGCTAGTCCGGTGGCTTCTGGAGCAGTCGGAGGTCCTGGCTGCCTTCTGCCGCCACCTCCCAGCCGAGCTGTTGACTTCGGTGGCGGGTCGCCATCCTGCGCTCTCTCGCGCCTACCTGGGCCTCCTGACAGACTGGGGGGCCCGGCTGCACTATGACCTTCAGAAAGGCACCTGGGTTGGAGCCGAGTCCCAAGACGTCCCTTGGGAGGAGCTGCTCCTCAAGTTTCGGAGCCTCTGGCACGCCCCTCCCCCGCTGCAGGAAGAAGTTCTGGCGGCCTTGGAGTCCAGCAGGGCGCGGGGCGGAGACTTCGAAGTCCCGGGCCTTAGCGTCTGGACGGACCTGTTGTTGGCCCTACGGAGAGGTGAACGATAAGCTTTTGGGAGGAGACAAGTTTGAGGTCCCAGCTCAAGCTCCAGTTCTCCTTGGACCATGTTCTGTTCATGTTCTATTCTACTTGAATATGTAGTTTACAAAACGAAAATTGCAGTGTTCTCTCCAACTCGCCTATAG

XM_004851567.1 Coding sequence

Gas2 growth arrest-specific 2, transcript variant X2

Length: 996 bp    Location: 13611419..13741604   Strand: +
>XM_004851567.1
ATGTGCACTGCTCTGAGCCCAAAGGTACGCAGTGGGCCTGGTCTGTCTGATATGCATCAGTACAGCCAGTGGCTGGCCAGCAGACACGAAGCTAATTTGCTACCGATGAAAGAAGATCTGGCCCTGTGGTTAACCAATCTATTAGGGAAGGAGATTACAGCAGAAACTTTCATGGAGAAATTGGACAATGGCGCTTTGCTCTGTCAGCTCGCGGCAACTGTGCAGGACAAGTTCAGAGAGACCATGGACGCTCACAAGCCCACAAAGAGTCTGCCACTGAAGAAGATTCCATGCAAAGCCAGTGCGCCCTCAGGCTCCTTTTTTGCCCGAGATAATACAGCGAATTTCTTATCCTGGTGTCGAGATTTAGGGGTGGATGAAACATGTTTATTTGAATCTGAAGGTTTGGTCCTCCACAAGCAACCAAGAGAAGTGTGTCTCTGTTTGCTGGAACTTGGCCGGATTGCAGCCAGGTACGGTGTGGAGCCTCCCGGGTTGATAAAATTGGAAAAAGAAATCGAACAGGAAGAAACACTTTCTGCTCCTTCTCCTTCTCCTTCTCCTTCATCAAAGTCTTCTGGAAAAAAGAGCACAGGAAACTTACTGGACGATGCCGTGAAACAAATTTCTGAAGACCCTCCTTGCAAGTGTCCCAGCAAGTTCTGCGTGGAGCGGCTCTCCCAAGGAAGATACCGAGTGGGAGAAAAGATCCTCTTCATTAGGGGTCTTCATGGTTGTAACTATGTCTCCACAGCCAAAGTAAAGCAGACATTGAAGATGCTGCACAACAAACATGTCATGGTGCGTGTGGGAGGAGGATGGGAAACTTTTGCTGGGTATTTGTTGAAACATGACCCCTGCCGAATGCTGCAGATCTCCCGTGTGGATGGCAAAACATCCCCCATCCAAAGCAAATCTCCAACTCTTAAGGACATGAATCCAGATAATTACTTGGTGGTCTCTGCCAATTATAAGGCTAAGAAGGAGATTAAATGA

XM_004851570.1 Coding sequence

Luzp2 leucine zipper protein 2

High confidence: 3 potential gene matches
Length: 1068 bp    Location: 14949211..15379557   Strand: +
>XM_004851570.1
ATGAGGCTGAGCCCCGCACACTACCTGCTGCCGCTGCTGCCGCTGCTGCCCGCGCTGGTGCTCGGCGCCAGACAGGACTATGAGGAGCTCCAGAAGCAGCTGAAAGAAGTCTTTAAGGAGAGAAGCACCATCCTCCGCCAGCTCACAAAGACATCCCGGGAGCTGGATGGGATTAAAGTCAACCTTCAGTCTTTAAAGAATGATGAACAGTCTGCCAGAACTGATGTTCAGAAGCTTCTAGAATTGGGCCGGAAACAAAGAGAAGAAATGAAGTCTCTCCAGGAGTCCTTGCAAAATCAACTTAAAGAGACATCTGAGAAAGCAGAGAAACACCAGGCAACTATTAATTTTTTAAAGACTGAAGTGGAAAGAAAAAGCAAAATGATTCGAGACCTTCAGAATGAGAACAAAAGCTTGAAAAACAAACTCTTATCTGGAAGCAAGCTCTGTGGGATTCATGCAGAAGAGTCAAAAAAAATCCAAGCCCAGCTGAAGGAACTTCGTTACGGGAAGAAGGATTTACTATTTAAGGCCCAACAGCTTACGGATCTGGAACAAAAATTAGCAGTAGCCAAAAATGAACTGGAAAAAGCTGCTCTTGACAGGGAGTCACAGATGAAAGCAATGAAAGAGACAGTGCAGCTCTGTCTGACCTCAGTTTTCCGAAACCAACCTCCGCCTCTGAGCCTGATCACATCCAACCCGGCCCAGGTGCCCCTTCCGCCCAGGACAATTGCAGGGAAGATCCCAGATGCAAGGACAAAGAGCCAGCCTCAGGAAAGTGCTTCAGGAAACAAGGAGACCTCTGGAATTGAGTCAACAAAAGAAGAAAATCCAAGTACCACTGTGTGTGATTCTCAAGATGAGGGAAAGACCTGTTCAATGGAGCACAAAGAAATGCCACTGCAGAATCAGAGAAATGCCGTGAGAAATGCCACTGCGGAATCAGAGCCGGTCCCACAGAAATTGCAAATGCCTCCTTGTTCTGAATGTGAGGTGAAAAAAACCCCAGAAAAACAGATAACCAGCTTTGAAGGCACAGCACCCCGAGAAGAAAAAATACTGTAA

XM_004851576.1 Coding sequence

Bbox1 butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1

High confidence: 4 potential gene matches
Length: 1188 bp    Location: 16903320..16957584   Strand: +
>XM_004851576.1
ATGGATTGTATCATCCAAAAGGCCGAAGCCCTGGACGGGGCTCATCTGCTGCAGGTCATCTGGGACGAGGGAGGGAAGTCGCTATACCCAGCTGTGTGGCTGAGGGACAACTGCCAGTGCTCCGACTGCTACTTGGATTCTGCAAAAGCCCGGAAACTTCTCCTGGAAGCTCTTGATGTGAACATCACCATTAAAGGCCTGACATTTGACAGAAAGAAGGTTTACATCACGTGGCCCCACAAGCATTACAGCGAATTTGAAGCTGACTGGCTGAAGAAAAGATGCTTTTCCCAGCAGGCCAGAGCAAAGCTGCAAAGCGAATTGTTTTGGCCAGAATGTCAGTACTGGGATGCAGAGCTCCAGCTGCCTACTCTGGATTTTGAAGAAGTTTTAAAAAATGATGAAGATACATACAAGTGGCTTTCCACCCTCAAGAAAGTAGGCATCGTGCGACTCACTGGAGCAGCTGATAAACGAGGAGAAATTGCGAAACTCGGGAAAAGGATCGGCTTCCTCTATCTCACATTTTATGGACATACTTGGCAAGTGCAAGACAAAATTGATGCCAACAACGTGGCTTACACAACTGGGAAGCTGAGCTTCCACACCGATTACCCAGCTCTCCACCATCCGCCTGGGATTCAGCTTCTGCACTGCATTAAGCAAACGGTCACCGGGGGCGACTCGGAAATTGTGGATGGATTTAACGTGTGCCGAAAGCTCAAGGAAAAGAATCCCCAGGCTTTCCAGATTCTGTCCTCTACCTTTGTGGACTTTACAGACATCGGAGTGGATTACTGTGATTTCTCTGTGCAATCTAAGCACAAAATTATCGAGTTAGATGATAATGGCCAAGTGATTCGCATCAACTTCAACAACGCAACCAGAGACACCATCTTCGATGTCTCCGTGGAGAGGGTGCAGCCTTTCTACGCCGCCCTCAGGGACTTCGTCAACCTCATGAACAGCAAAGAGCTCAAGTTCACCTTCAAGATGAACCCAGGCGACGTGATCACCTTCGACAACTGGCGCGTGCTGCACGGCCGGCGCGGCTACGCGGCGGGCACGGAGATCACGCGGCACCTGGAGGGCGCCTACGCCGACTGGGACGTGGTGCTGTCCCGCCTGCGCCTCCTGCGGCGCGGCGTGCGGCGAGGGGTCCAGGCCGCGCGCCCCGACCTGAGCTGA

XM_004851598.1 Coding sequence

Elp4 elongator acetyltransferase complex subunit 4, transcript variant X1

Length: 1281 bp    Location: 20343802..20532527   Strand: +
>XM_004851598.1
ATGGCGGCAGCGGCTAAGGCAACCTGCGGTGCTGGCGCCGGGAGTCCTGGGTCTGTGGCGGCGGCGGCCGACAGAAGCAGTGCCACCAGCTTCCAGAGGAGGGGTCCCAGGGCCGGCGGTGCCGATGGCAGAGGCCCTCGCCTGGTGTCCATTGCGGGCACGCGGCCGTCGGTGCGGAATGGACAGCTGCTGGTTTCCACCGGGCTCCCGGCCCTGGACCAGCTCTTAGGTGGAGGTTTAGCCGTTGGAACAGTTCTTTTGATTGAGGAGGATAAATACGATATTTACTCACCGCTGCTCTTCAAGCATTTCCTGGCCGAGGGCATTGTCAGTGGGCACACTTTGTTGGTTGCATCCGCTAAAGAGCGCCCTGCTGGCATTTTACAGGAACTTCCTGCACCATTACTTGATGATAGTTATAAAAGAGAACTTGAGGAAGATGAATGTAATCATAAAACACCAGAATCTAATGTGAAGATGAAAATAGCTTGGCGGTACCAGTTATTACCCAAGATAGAGGTTGGGCCAGTGGCGTCTTCAAGATTTGGTCATTATTATGACACATCCAAAAAGATCCCCCAAGAACTGCTTGAGACTGCAAAATGGCATGAGTTCTTCCTTCCAGAAAAGTCATCTTCACCCCTCAGCACAGAACCCTGCCACTTGACCCATGGCTACATGAAGCTCCTTGAGTTTATCAAGAACATCATTTCTGAGGAAGGCTTTGATGGATCCAATCCCCAGAAAACGCAGAAGAGTATTTTAAGAATAGGAATCCAGAACCTCGGCTCACCCTTATGGGGAGATGACGTGTGCTGCACAGAAACCTGCGGCGACAGGCACAGCCTCACCACGTTCCTCTATGTTCTCCGCGGCCTCATGCGGGCCTCACTCTCGGTCTGCACCATCACGATGCCAACACACCTGATCCAGAATAAATCAGTAACTGCTCGTGTTATACATTTGTCAGATACAGTAGTGGGCCTGGAATCGTTTATTGGTTTGGAGAGAGAAGCCAATCCTCTCTATAAGGATTATCACGGTTTGATTCATATTCGGCAGATTCCTCGGCTTAATAACTTGATTTGCGATGAATCAGATGTCAAAGACTTAGCTTTTAAGTTAAAAAGGAAGCTATTTGCCATTGAGCGCCTGCACTTGCCTCCAGACCTGTCAGACTCTGTGAGCCGCTGGAGCAAACAGGATGTGGCAGGATCCGCCCGGCAGCCGGGCCTGGGCTGCGGCGGGATGGCTGAGGGCGCCAGGCACCTGGACTTCTAG

XM_004851599.1 Coding sequence

Elp4 elongator acetyltransferase complex subunit 4, transcript variant X2

Length: 1236 bp    Location: 20343802..20445226   Strand: +
>XM_004851599.1
ATGGCGGCAGCGGCTAAGGCAACCTGCGGTGCTGGCGCCGGGAGTCCTGGGTCTGTGGCGGCGGCGGCCGACAGAAGCAGTGCCACCAGCTTCCAGAGGAGGGGTCCCAGGGCCGGCGGTGCCGATGGCAGAGGCCCTCGCCTGGTGTCCATTGCGGGCACGCGGCCGTCGGTGCGGAATGGACAGCTGCTGGTTTCCACCGGGCTCCCGGCCCTGGACCAGCTCTTAGGTGGAGGTTTAGCCGTTGGAACAGTTCTTTTGATTGAGGAGGATAAATACGATATTTACTCACCGCTGCTCTTCAAGCATTTCCTGGCCGAGGGCATTGTCAGTGGGCACACTTTGTTGGTTGCATCCGCTAAAGAGCGCCCTGCTGGCATTTTACAGGAACTTCCTGCACCATTACTTGATGATAGTTATAAAAGAGAACTTGAGGAAGATGAATGTAATCATAAAACACCAGAATCTAATGTGAAGATGAAAATAGCTTGGCGGTACCAGTTATTACCCAAGATAGAGCAGGTTGGGCCAGTGGCGTCTTCAAGATTTGGTCATTATTATGACACATCCAAAAAGATCCCCCAAGAACTGCTTGAGACTGCAAAATGGCATGAGTTCTTCCTTCCAGAAAAGTCATCTTCACCCCTCAGCACAGAACCCTGCCACTTGACCCATGGCTACATGAAGCTCCTTGAGTTTATCAAGAACATCATTTCTGAGGAAGGCTTTGATGGATCCAATCCCCAGAAAACGCAGAAGAGTATTTTAAGAATAGGAATCCAGAACCTCGGCTCACCCTTATGGGGAGATGACGTGTGCTGCACAGAAACCTGCGGCGACAGGCACAGCCTCACCACGTTCCTCTATGTTCTCCGCGGCCTCATGCGGGCCTCACTCTCGGTCTGCACCATCACGATGCCAACACACCTGATCCAGAATAAATCAGTAACTGCTCGTGTTATACATTTGTCAGATACAGTAGTGGGCCTGGAATCGTTTATTGGTTTGGAGAGAGAAGCCAATCCTCTCTATAAGGATTATCACGGTTTGATTCATATTCGGCAGATTCCTCGGCTTAATAACTTGATTTGCGATGAATCAGATGTCAAAGACTTAGCTTTTAAGTTAAAAAGGAAGCTATTTGCCATTGAGCGGCTGAGACTCTGTTCATTTGAGTTCAAGATTTCCCAAGCGGCATTTTGGTGCTGGGACAAACTATCTATCATGACTGCATAG

XM_004851606.1 Coding sequence

Pax6 paired box 6, transcript variant X5

High confidence: 4 potential gene matches
Length: 1311 bp    Location: 20554612..20536233   Strand: -
>XM_004851606.1
ATGCAGAACAGTCACAGTGGTGTGAATCAGCTCGGAGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATCGTAGAGCTAGCGCACAGCGGGGCCCGGCCTTGCGACATCTCCCGAATTCTGCAGACCCATGCAGATGCAAAAGTCCAAGTGCTGGACAATCAAAACGTGTCCAACGGCTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACCGGCTCCATCCGACCCAGGGCCATCGGGGGCAGTAAACCCAGAGTGGCAACTCCGGAAGTTGTGAGCAAAATTGCCCAGTACAAGCGGGAGTGCCCGTCCATCTTTGCCTGGGAAATCCGAGACAGATTGCTGTCTGAGGGGGTCTGCACCAACGACAACATACCAAGTGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGCTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGGTGGTATCCGGGCACTTCCGTGCCAGGCCAGCCCACACAAGATGGGTGCCAGCAGCAGGAAGGAGCGGGGGAGAACACCAACTCCATCAGCTCCAACGGGGAGGACTCGGACGAGGCGCAGATGCGGCTGCAGCTGAAGCGGAAGCTGCAGCGGAACAGGACCTCCTTCACTCAGGAGCAGATCGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCACTATCCAGATGTGTTCGCCCGGGAAAGACTAGCAGCCAAGATAGACCTACCTGAAGCGAGAATACAGGTCTGGTTTTCCAACAGAAGGGCCAAGTGGAGACGAGAGGAGAAGCTGAGGAACCAGCGGAGACAGGCCAGCAACACCCCCAGCCACATCCCCATCAGCAGCAGCTTCAGCACGAGCGTGTACCAGCCCATCCCGCAGCCCACCACCCCGGTGTCCTCCTTCACGTCTGGCTCCATGCTGGGCCGGACAGACACGGCCCTCACCAACACATACAGCGCGCTGCCACCCATGCCCAGCTTCACCATGGCCAACAGCCTGCCTATGCAGCCCCCTGTCCCCAGCCAGACCTCCTCGTACTCCTGCATGCTGCCCACCAGCCCATCGGTGAACGGGCGGAGTTATGACACCTACACGCCCCCACACATGCAGACCCACATGAATAGCCAGCCTATGGGCACCTCGGGCACCACGTCTACAGGCCTCATTTCTCCCGGCGTGTCCGTTCCAGTCCAGGTTCCTGGAAGTGAACCTGATATGTCTCAATATTGGCCAAGATTACAGTAA

XM_004851602.1 Coding sequence

Pax6 paired box 6, transcript variant X1

Length: 1335 bp    Location: 20554653..20539772   Strand: -
>XM_004851602.1
ATGCAGAACAGTCACAGTGGTGTGAATCAGCTCGGAGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATCGTAGAGCTAGCGCACAGCGGGGCCCGGCCTTGCGACATCTCCCGAATTCTGCAGACCCATGCAGATGCAAAAGTCCAAGTGCTGGACAATCAAAACGTGTCCAACGGCTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACCGGCTCCATCCGACCCAGGGCCATCGGGGGCAGTAAACCCAGAGTGGCAACTCCGGAAGTTGTGAGCAAAATTGCCCAGTACAAGCGGGAGTGCCCGTCCATCTTTGCCTGGGAAATCCGAGACAGATTGCTGTCTGAGGGGGTCTGCACCAACGACAACATACCAAGTGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGCTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGGTGGTATCCGGGCACTTCCGTGCCAGGCCAGCCCACACAAGATGGGTGCCAGCAGCAGGAAGGAGCGGGGGAGAACACCAACTCCATCAGCTCCAACGGGGAGGACTCGGACGAGGCGCAGATGCGGCTGCAGCTGAAGCGGAAGCTGCAGCGGAACAGGACCTCCTTCACTCAGGAGCAGATCGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCACTATCCAGATGTGTTCGCCCGGGAAAGACTAGCAGCCAAGATAGACCTACCTGAAGCGAGAATACAGGTCTGGTTTTCCAACAGAAGGGCCAAGTGGAGACGAGAGGAGAAGCTGAGGAACCAGCGGAGACAGGCCAGCAACACCCCCAGCCACATCCCCATCAGCAGCAGCTTCAGCACGAGCGTGTACCAGCCCATCCCGCAGCCCACCACCCCGGGTAACGGCGCGCACACCTGCACGCGCTCCCGACCCCTGGCCCGGCCTGGCCTGGCCTGGCCGCGCTGCTCACCCGGGCTGGGCCTCTCTCTCTGCAGTGTCCTCCTTCACGTCTGGCTCCATGCTGGGCCGGACAGACACGGCCCTCACCAACACATACAGCGCGCTGCCACCCATGCCCAGCTTCACCATGGCCAACAGCCTGCCTATGCAGGTAAGCGGGCGCTGCCTGCCAGGCCGCAGAAAGAGGCAGCAGGGGCTGCACCCTCGGGTCTGTGTCTCCATGGTGACCGGCTCGGCCTGTCCAGCCCTATAGAGAGGAGCAGGACATGGTCACTGGGAATGCAGCGAGTTCACTGCTGCTCAGTTGGCAGCTGA

XM_004851677.1 Coding sequence

Rplp2 ribosomal protein, large, P2, transcript variant X1

Length: 732 bp    Location: 21701370..21698988   Strand: -
>XM_004851677.1
ATGAGCAACGTCCATTTGGAACGGCTTTTCACTTTTGCCGCGCGACTTCCCGACTGGGGAACCGGACCACGGCTCTACTCCCGTCGTCATTGGCTGAGCGCTCCGTTGCGTCATTTGTGGGAGCCCTCGCGCAGCGCCGCACACGCCCGGAGGCTTTTGGGTAACGGTTTACCCCCGCCCCTTCTGCCGGCCTCTTCCTTTTGCTTCCCGACGTCGCAGAGGTCGCACGCGAGAGGCCTCTCTGCCGCCACCGCCGCCGACATGCGGTACGTCGCCTCCTACTTGCTAGCCGCCCTCGGAGGAAACCCCTCCCCCAGCGCCAAGGACATCAGGAAGATCCTGGACAGTGTGGGCATCGAGGCAGACGATGACCGGCTTAATAAGGTCATCAGTGAGCTGAATGGGAAAAACATTGAAGATGTCATTGCCCAGGGTGAGTTTACCTGTTTTATTTTTATGGTCCATTCTAATTCCTGCGGGTCAACCCATGGCCTGCCAGGTTTCGCTTGTGGACCACAGCACTCTAGAAGCTTGACCCCGAGGGTGAGCAAGGCCTCTTGTGGGCTTATGCTAGAGGTGCTTCTGGACACTTTGATGAATGGGTATTCAGGGCTTCTGTGTGCTCTTACTTTACCTGCCAACTCTGGCATTTTGGGCCAGGCTCTTTTTATCCCCTTGTCCTTTTTGGAGCTTTGGGCTTCTTGTAAACAATTCATTGAATGCTTTCTGTGA

XM_004851605.1 Coding sequence

Pax6 paired box 6, transcript variant X4

Length: 1335 bp    Location: 20551478..20539772   Strand: -
>XM_004851605.1
ATGCAGAACAGTCACAGTGGTGTGAATCAGCTCGGAGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATCGTAGAGCTAGCGCACAGCGGGGCCCGGCCTTGCGACATCTCCCGAATTCTGCAGACCCATGCAGATGCAAAAGTCCAAGTGCTGGACAATCAAAACGTGTCCAACGGCTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACCGGCTCCATCCGACCCAGGGCCATCGGGGGCAGTAAACCCAGAGTGGCAACTCCGGAAGTTGTGAGCAAAATTGCCCAGTACAAGCGGGAGTGCCCGTCCATCTTTGCCTGGGAAATCCGAGACAGATTGCTGTCTGAGGGGGTCTGCACCAACGACAACATACCAAGTGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGCTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGGTGGTATCCGGGCACTTCCGTGCCAGGCCAGCCCACACAAGATGGGTGCCAGCAGCAGGAAGGAGCGGGGGAGAACACCAACTCCATCAGCTCCAACGGGGAGGACTCGGACGAGGCGCAGATGCGGCTGCAGCTGAAGCGGAAGCTGCAGCGGAACAGGACCTCCTTCACTCAGGAGCAGATCGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCACTATCCAGATGTGTTCGCCCGGGAAAGACTAGCAGCCAAGATAGACCTACCTGAAGCGAGAATACAGGTCTGGTTTTCCAACAGAAGGGCCAAGTGGAGACGAGAGGAGAAGCTGAGGAACCAGCGGAGACAGGCCAGCAACACCCCCAGCCACATCCCCATCAGCAGCAGCTTCAGCACGAGCGTGTACCAGCCCATCCCGCAGCCCACCACCCCGGGTAACGGCGCGCACACCTGCACGCGCTCCCGACCCCTGGCCCGGCCTGGCCTGGCCTGGCCGCGCTGCTCACCCGGGCTGGGCCTCTCTCTCTGCAGTGTCCTCCTTCACGTCTGGCTCCATGCTGGGCCGGACAGACACGGCCCTCACCAACACATACAGCGCGCTGCCACCCATGCCCAGCTTCACCATGGCCAACAGCCTGCCTATGCAGGTAAGCGGGCGCTGCCTGCCAGGCCGCAGAAAGAGGCAGCAGGGGCTGCACCCTCGGGTCTGTGTCTCCATGGTGACCGGCTCGGCCTGTCCAGCCCTATAGAGAGGAGCAGGACATGGTCACTGGGAATGCAGCGAGTTCACTGCTGCTCAGTTGGCAGCTGA

XM_004851604.1 Coding sequence

Pax6 paired box 6, transcript variant X3

Length: 1335 bp    Location: 20551478..20539772   Strand: -
>XM_004851604.1
ATGCAGAACAGTCACAGTGGTGTGAATCAGCTCGGAGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATCGTAGAGCTAGCGCACAGCGGGGCCCGGCCTTGCGACATCTCCCGAATTCTGCAGACCCATGCAGATGCAAAAGTCCAAGTGCTGGACAATCAAAACGTGTCCAACGGCTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACCGGCTCCATCCGACCCAGGGCCATCGGGGGCAGTAAACCCAGAGTGGCAACTCCGGAAGTTGTGAGCAAAATTGCCCAGTACAAGCGGGAGTGCCCGTCCATCTTTGCCTGGGAAATCCGAGACAGATTGCTGTCTGAGGGGGTCTGCACCAACGACAACATACCAAGTGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGCTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGGTGGTATCCGGGCACTTCCGTGCCAGGCCAGCCCACACAAGATGGGTGCCAGCAGCAGGAAGGAGCGGGGGAGAACACCAACTCCATCAGCTCCAACGGGGAGGACTCGGACGAGGCGCAGATGCGGCTGCAGCTGAAGCGGAAGCTGCAGCGGAACAGGACCTCCTTCACTCAGGAGCAGATCGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCACTATCCAGATGTGTTCGCCCGGGAAAGACTAGCAGCCAAGATAGACCTACCTGAAGCGAGAATACAGGTCTGGTTTTCCAACAGAAGGGCCAAGTGGAGACGAGAGGAGAAGCTGAGGAACCAGCGGAGACAGGCCAGCAACACCCCCAGCCACATCCCCATCAGCAGCAGCTTCAGCACGAGCGTGTACCAGCCCATCCCGCAGCCCACCACCCCGGGTAACGGCGCGCACACCTGCACGCGCTCCCGACCCCTGGCCCGGCCTGGCCTGGCCTGGCCGCGCTGCTCACCCGGGCTGGGCCTCTCTCTCTGCAGTGTCCTCCTTCACGTCTGGCTCCATGCTGGGCCGGACAGACACGGCCCTCACCAACACATACAGCGCGCTGCCACCCATGCCCAGCTTCACCATGGCCAACAGCCTGCCTATGCAGGTAAGCGGGCGCTGCCTGCCAGGCCGCAGAAAGAGGCAGCAGGGGCTGCACCCTCGGGTCTGTGTCTCCATGGTGACCGGCTCGGCCTGTCCAGCCCTATAGAGAGGAGCAGGACATGGTCACTGGGAATGCAGCGAGTTCACTGCTGCTCAGTTGGCAGCTGA

XM_004851610.1 Coding sequence

Wt1 Wilms tumor 1, transcript variant X1

Length: 1344 bp    Location: 20937084..20899549   Strand: -
>XM_004851610.1
ATGGGCTCGGACGTGCGGGACCTGAACGCGCTGCTGCCCGCGGTGCCCTCGCTGGCCGGCGGGGGCGGTTGCTCGCTGCCAGTGAGCGGCGCAGCGCAGTGGGCGCCGGTGCTGGACTTCGCGCCCCCGGGCGCCCCGGCCTACGGCTCCCTGGGCGGCCCCGCGCCGCCGCCCGCGCCGCCGCCCCCTCCGCCGCCGCACTCGTTCATCAAGCAGGAGCCGAGCTGGGGCGGCGCCGAGGCGCACGAGGAACAGTGCCTGAGCGCCTTCACCGTGCACTTCTCCGGCCAGTTCACCGGCACGGCCGGGGCCTGCCGCTACGGACCCTTCGGGCCCCCGCCGCCCGGCCAGGCGTCCTCAGGCCAGGCCCGGATGTTCCCCAACGCTCCCTACCTGCCCAGCTGCCTGGAGAGCCAGCCCGCCATCCGCAACCAGGGGTACAGCACGGTCACCTTCGACGGGACGCCCAGCTACGGCCACACGGCCTCCCACCATGCCGCACAGCTGCCCAGCCATTCCTTCAAGCACGAGGACCCCATGGGGCAGCAGGGCTCGCTGGGCGAGCAGCAGTACCCTGTGCCGCCCCCAGTCTACGGCTGCCACACGCCCACGGACAGCTGTTCCGGCAGCCAGGCGCTGCTGCTGAGGACGCCGTACAGCAGTGACAACTTATACCAGATGACCTCCCAGCTCGAATGCATGACCTGGAACCAGATGAATCTGGGGGCCACCTTGAAGGGAGTTGCTGCTGGGAGTGCCAGCTCGGTGAGATGGACGGAAGGCCACAGCAACCACAGCGCAGGGTACGAGAGCGAGAGCCACACGACGCCCATCCTATGCGGCGCCCAGTACCGGATCCACACGCACGGCGTCTTCCGGGGCATCCAGGACGTGAGGCGCGTGCCCGGTGTGACCCCCACACTGGTCCGGTCGGCCTCTGAGAGCAGTGAGAAGCGCCCCTTCATGTGCGCTTACCCAGGCTGCAACAAGAGGTACTTCAAGCTGTCCCACCTGCAGATGCACAGCCGGAAGCACACGGGTGAGAAACCGTACCAGTGTGACTTCAAGGACTGTGAGCGAAGGTTTTCGCGCTCTGACCAGCTCAAAAGGCACCAGAGGAGACACACAGGTGTGAAACCATTCCAGTGTAAAACTTGTCAGCGAAAGTTCTCCCGCTCCGACCACCTGAAGACCCACACCAGGACTCATACAGGTAAAACAAGTGAGAAGCCCTTCAGCTGCCGGTGGCCGAGCTGTCAGAAGAAGTTCGCGCGCTCCGACGAGCTCGTCCGCCACCACAACATGCACCAGAGGAACATGACCAAGCTGCAGTTGGCGCTCTGA

XM_004851611.1 Coding sequence

Wt1 Wilms tumor 1, transcript variant X2

Length: 909 bp    Location: 20933944..20899549   Strand: -
>XM_004851611.1
ATGGAGAAGGGGTACAGCACGGTCACCTTCGACGGGACGCCCAGCTACGGCCACACGGCCTCCCACCATGCCGCACAGCTGCCCAGCCATTCCTTCAAGCACGAGGACCCCATGGGGCAGCAGGGCTCGCTGGGCGAGCAGCAGTACCCTGTGCCGCCCCCAGTCTACGGCTGCCACACGCCCACGGACAGCTGTTCCGGCAGCCAGGCGCTGCTGCTGAGGACGCCGTACAGCAGTGACAACTTATACCAGATGACCTCCCAGCTCGAATGCATGACCTGGAACCAGATGAATCTGGGGGCCACCTTGAAGGGAGTTGCTGCTGGGAGTGCCAGCTCGGTGAGATGGACGGAAGGCCACAGCAACCACAGCGCAGGGTACGAGAGCGAGAGCCACACGACGCCCATCCTATGCGGCGCCCAGTACCGGATCCACACGCACGGCGTCTTCCGGGGCATCCAGGACGTGAGGCGCGTGCCCGGTGTGACCCCCACACTGGTCCGGTCGGCCTCTGAGAGCAGTGAGAAGCGCCCCTTCATGTGCGCTTACCCAGGCTGCAACAAGAGGTACTTCAAGCTGTCCCACCTGCAGATGCACAGCCGGAAGCACACGGGTGAGAAACCGTACCAGTGTGACTTCAAGGACTGTGAGCGAAGGTTTTCGCGCTCTGACCAGCTCAAAAGGCACCAGAGGAGACACACAGGTGTGAAACCATTCCAGTGTAAAACTTGTCAGCGAAAGTTCTCCCGCTCCGACCACCTGAAGACCCACACCAGGACTCATACAGGTGAGAAGCCCTTCAGCTGCCGGTGGCCGAGCTGTCAGAAGAAGTTCGCGCGCTCCGACGAGCTCGTCCGCCACCACAACATGCACCAGAGGAACATGACCAAGCTGCAGTTGGCGCTCTGA

XM_004851795.1 Coding sequence

LOC101718342 uncharacterized LOC101718342

Length: 1647 bp    Location: 20953818..20937769   Strand: -
>XM_004851795.1
ATGGCGGCCCAGCCAAGGGGAAAGTCCTCCCAGTCCATCTTTGAGATGAAAACTCAATTTCGTACGCCTCAGCTGACGCCAGACGCGGAGCAGCAAGTGTTGGCCGGCTCCATGACGTCAGCGGATCAGCACTCCTTTGAAGGTGATCCCCTTACCACCCGCCGTGCGTGCTTGTGTCAGACAGGCGTCTTCCGTGTCCTGCAGACGTGGCTTCAGGCAGCGCAGCGTCCTGGCCCTGCCACAGTCATGAGTGCCGGCTTCCCCCTCACCGCCCTAGAAGACTCCAAGTCTGGAAAGGGCTCCCAGGAATGGCCCTGCAGCCCGGATCTCCACGTACTTGCCTCTGCCTACCTCCTGGACGCCGGCTCAGCCTGTGTCCAGCGTCTCCGGGAGCAGCTCACCCTGGGGGCCCTGCACTGCTCTCCTAGTCCTGAACAGGTTCTGGAGAACAACACGCTTCGGTTCACCTCTGGAGCGGCCGAGTGGTGGCTAAAGCCACTGCTGGACCAGGTGGGGTCACAGCTTGGCTGCGGTGACTTCGCTATCCCACCCGGAGAGTGGACAAACTTGAAAATCGTGATTTACGGAGAGTTCTGGGCCAACACCTGCTCCCCAGGAGGAAACGAAGGGCACCCTGCCGGCGAGGCCCGCACAGCTGCTGGTGGCCGCCAAGCGGAGTCCGGTGCTGGCCACCTGTCCCTGCTCCTTTCCCTGCTTTCTGGGCCTTGGCTGGCTCCTTCTCCTCAGAGTCAGGAGCTTCATCTCCAGCCCTGCAAGGTGGCTCAGACCGGCCTCACAGGGCGGGAGGGGAGCGCAGGGAGCCCAAGCAGCCCGAAGCTTCTCCGAGGAAGAGCTGGAGAGCGCAGGGTGGGCAAGAAGATCACCCCACTTCTCCAGAGCTGCAGCCTACCAGCCAAGGCACCTGGGCTTCCTGGGGCTCAGGAAGGGAGGTGGAGCCTGTGCTCCTCGGCAAGGGCCCAGTGGGAATTTAGGGACCCCAGGGAGAAGGTGGCACTCACTGGCGGAGGCGGTGGGGCAGAAGTGGAGGTGCCTTGGGCTCAAAGGGGAGCGACACTTCCTTGGCCCCCTCAGGGACCCCAGAAAACAAAAGACAGGGGCACCGAGGGGTCCTCAGTTGCCTCTGCTCCCCTCCTACCAATTACTAGCCACTCTCTCGGCCCTCACTCGGCAAAACCTTATTATTTGAAATGTCGAGGTAGAGACTTTGGTGTCTTCACCCTGCTCGGGGTTGCAGCCAGCCTCTCTCCTGAATACCCCGCCCCCCCCCAAAAAACCTTGCAGAGCAAAGGACAACCTGGTCCCTCCTTTGCAGCTCTACCTTTTCACAGGGTCTCCTCTCCGCTCACAGCTCATCTAGTCCTAGTTAGGAAGAAAACGAGTTTCAAGTTGAAATCAGAGGTGGGGAGGAGGGAGGGAGGGACAGGGTTTTGGGGCGTCCAGGGGACACCCTGGCTTGAGCAGGGTCCTCTGCAAGGGCCTGCGCGTCCACCCAGACTCCAGCGCGCTTCGCCCAGAGAGGAAGGAAGGAGCAAAGCTGAGCTGAGAGCGGCGGGAAGGTGGATAGAGGGACGCGCGCGGCTCCCTCCCGCCGCCAGCCTTGGCCCGCGGGGTCTTCTGCGCCTCTAA

XM_004851613.1 Coding sequence

Ccdc73 coiled-coil domain containing 73

High confidence: 4 potential gene matches
Length: 3207 bp    Location: 21144137..21057672   Strand: -
>XM_004851613.1
ATGGAGAATGATTTCAACTCCGAGTCATCACTATCTGCCTTTACTCTTCAGAGTTCTTCAGAGACAATGTTTTCCATTCAGCTGTTAGATTTCAAAACAAGTTTACTGGAGGCGTTGGAAGAATTGCGTATGAGAAGGGAAGCAGAAATTCAGTATGAAGAGCAGATTGGAAAAATTATTATGGAAACACAAGAACTTAAATGGCAAAAGGAAACTCTTCAGAATCAAAAGGAAGCATTAGTAAAGCAACATAAAGAAGCAATGGAAGTTTTTAAAAAGCAGTTGCAAATGAAGATGTATGCCTTGGAAGAAGAAAAGGGAAAATATCAGCTTGCTTCAGAAATAAAAGAAAAAGAAATAGAAGGATTGAAGGAAACATTAAAAGAGTTACAGGTTTCTAAATATTCTTTACAGAAGAAAGTAAGTGAAATGGAACAAAAGGTCCAGTTCCATCTTCTGGCTAAAGAAGATTATCATAAGCAACTGAATGAAATTGAGAAATACTATGCTACAATAACAAATCAATTTGGATTGGTAAAAGAGAATCATGTAAAGTTAGACCAAAATGTGCAAGAAGCAATACAATTAAACAAAAGACTTTCAGCTTTAAATAAAAAACAAGAATCTGAAATATGCAGCTTAAAGAAGGAATTAAAAAAAGCAGCTTCAGACTTGATTAAGTCCAAGGTCATATGTCAGTATAAGATGAAAGAAGAAAATATCAATCTAACAATTAAAGAACAAAAATTGGAAGAACTTCAAGAAAAACTCAGCATGGAATTGGAATTAAATAAGAAGATTAATGAAGAGATTATCCATATTCAAGAAGAGAAACAGGATATCTTCACTTCTTTTCAACATATGCAGCAGTTACTTCAACAACAAACTCAAGCTAATAATGAAATGGATGCAGAACTGAAAGCACTGAAAGAAAAAAATCAGACCCTTGAAAGAGATAATGAGCTGCAAAGGAAGAAGGTAAGAGAAAATAAAGAAAAGTTCCTTAATCTTCAAAATGAGCATGAGAAAGCAGTAGGAACTTGGAAGAGACATATAGGTTTATTAAACTGTAAAGTTGAAGAACTTAATAGAGAAATTAATGAGATTAAAGATGAATTTTCATCACTGAAAGAAACTCATATTAAGTTACAAGAACAACACAACAAATTCTGGAGTCAGAAAAAGCTTGAAGAAGACAAAAAATTTCAGAATGTTCCAGAAATAAATAATGAAAACCATGAAATAACTGAAAACTCAGGAAAGGCCATCATACAGAAATTTAATTCCAGGGAAGAAAATACTAAGGGTTTCTGTTCTTACACTGAATACAGAGAAAAGGACGTGATGAAAGAAAGCCTGGCTACAGAAGTCACTGTAGAAGATGTACAGCGTTTTGAGAAAAGCTTTAAGAATGAAACTGATACAAGTATACCTCAGGATAAAGGCCAATGTGGACTCTCCTTAAGCAAACCCCCCTGTCTGGGAAAAGATACAATCAGCCAACAAACTGGGAGTGTTACTGACCCCAGAAAACCTGCTGCTACAGAAACAGAAGACAGGCTGGACTTGGAAAAAGACAGTGGATGCACAGAATTTAAACCACCAAATAATCTGTGTTTAGTGGAAGGAGCTGAAGGGTCAGGCCTTCACCCTGCATGTGTACGCCTAGAGAGCAAAGATCAGAGATCCTCACCTGACAGGACTGTAAGTGAGACAGCTCACAACGGAGACCATGACAAAGATGTTTCTGAAAACAAACCATTCAGACAGCAATTCAGATCACATCTGGGGACCAAGAGGGGAATTACCAACCGAAGCAAAGCAGGTCTGGGTTCATCTCTAGATGCAAAGATGAATCCTGTTCAGTGTGAGAAATACAGTTTTCAGGATTCAAGGAATGCCAGGGTAAGTGATAAACAGTGTAAGATGGAGCACACACAACTGTTAAATAAAATCAGTGAGTATAGTATACTGCCTTTTAAGCCAACCTCAAGTTTTCCACAAGTCTGCAATGATACTCTCGAGAAACCTGAACTAACTCTTCCCCATGACGAAGTCAACCACCTCATGTCACCTGCTGCTCCTGCTGAGAATTCAAAAGCGCTTCCGGATTCAGGTAATCATATCGGTATTATGCCTATGTTGGTGACACCCAACTCCAATCCCAGGGGAAGAGCTGTAAGGAAAGACAGGAAGGACATGCAGGACAGTCCATTTAAGAGCTGTCTGGGGTGTCCAGGAAAGGGTGTGACCACTGCCCCTCTGCACCTTAACAGTGAAGACACTCGGGCTTCGGCAGACACAGATCTGGAAACTGCTCTTAGGAAAACTGCCATGGAAGTACAGTTTTACAGTGAGAGGAAGACAGATGTGAGTCAGATAACTGAAGCCACAAAACACGACCCCTTCCTTTTTGTGAACGTTAATGAAAGACAGCATACATTGTTAAATAATACAGAGAGAACAGAGTCATTAAATGACATCGTTTCAGGAAAACTGTACAGTGAAGGTCAGCAGGGAGAATCACAGTCATTCCACATAAAGCCATCTGGAAATTTAGTAAACAGAAGTGGAAGGGCATCCTTTGATCTTCCCACTTCAGATAGAAAAACTGAGAAAACGCCAGCATACATGAATTTTCTAGACCCTGGTCCTTGGTCAAAAGTAAATCAAACTGCAGGTCAAACAGTGAGCCCTGCAATGTCTAGCACTCCTCTGTTGCTGAAGGAGAGACCAGCAGGTCCATCGGAACACACAAAGACCACTTCAGTGGCTCTCTGTAAAAATGCTGGTGTGGATGATGTCAGACAGGATGCTGGGCCAGACGCCGTCCGTATCACCGGAGTTGCTGACGCTGTGAGTACCCGGAGCGTCCGTCCAGACCCCGAGAGAACGCCCAGTGAGGAGAGGAATGCAACTGCAGGGATGGGCCCTGATTCTTCTGTTCCCACAGAGCATGTGAAAGCAGAGCCTCGGGTTCCCACTGTGCTACAAAGTCATTTTCAGTCCATCGAGACTCAAGAGCCTCCGGATCTGCCTGCCACTCCTGGTGAAGACTGGCAGAGCCTTGTGATAAACCAGGTCACTGAAATTGAAAAGTACCTAAGCTTAGAAAATGACAACCAGCCTAAAGTAAGAAAAGCGGAAGAGATGCTGGGAAAAACAACGGATGAACTGACACTGACAAATGCTCCCGGTGGCGAATGA

XM_004851797.1 Coding sequence

LOC101719739 5E5 antigen-like

Length: 1038 bp    Location: 21180858..21168948   Strand: -
>XM_004851797.1
ATGGCAATGGTGACCCCAGAGGGGCGGGGAGAAAGGAGCGACCCGGGGTCCGTGGAGCCCTCTCTGAGGGACGAGTGGCGGCTGCGACGCAGGCCGAGGTCCTCGATGCGTGGACGCGCCCAGGCGGAGCGGGCCCCACAGTGGGCTCTTATAGCGATGTTCATGCAGCTGATATTAAGTAGCTTGTATGGAATCAAGTTTGATCTTCCGTATGTGGAGGTGATCATGAGCACATTCTACACCGGGGGTCTCTTGCTTTCCGTGCTCATCTGCATTCTGTTGTCTGTGACGATGTGCGCTCTATTTTTGCTGTTGAAAATCAATTGCTGCTCCTGGCTCCATCCCCCCAGCAAGTTGTACTTCATGCTCCTGCTCACGGCTGTTGTGCTTTTTCTGTGCACCTGCCCTCCTCCCGCGGAGTCCCAGGAGAGATTAGAAGACTCCTCTGTGGCCAACGCCATGCCCACTGTGCTGGTGGGGCTGCCAGCATCTTCGAGAGGGCGGGAGGCTGAGGCGGGAGGGTCGCGGGAGGGAGCGCGAGGCCTCGTCTCTACCGCCTTCGTCCCTCCGGGTTATGCTCGAGAGGCCCCGTCCGGGCCGGTGCGGGAGGCCGGCTCCCTGCAGCCCGCAGCCTCTCAGGGCGCGTGGGCCGGGAAAGCGCGCGGCGGCCGTGGGCGCGGGTCCGGGTCCGGGTCCGGGTCCCGCTCCCGCTGCACCCTCCCCTCCCTGTCAGCCCGGGCCACTGGGACCGCGCGGGCGGGCGGCGCGGGAAGGCAGGCTCCGGCGGCCCCGAACCGAGCCCTTCAACCCCGAGGGCCCGGGGCCCTGAGCCTTGCGTCGCGGGAGGAGCCGTGGGAGGGACCCGCGCGGCCGGGCAGTGGGCGCCGGGGGCCCCGCCGGGTCGGGTCGGGTCGGAGGCGCGCCGAGCGCTGCGTCGCGGCCGTGCGCTTTCCAAAGCCCGGTGTCTCCGCAGTTCTTCCGAGGAGCCCTAGTCCCTGGCCGGCAAGGGCTCGAGCTCGCATCGAAAATACATTGTAG

XM_004851615.1 Coding sequence

Dusp8 dual specificity phosphatase 8, transcript variant X1

High confidence: 4 potential gene matches
Length: 1806 bp    Location: 21203183..21215915   Strand: +
>XM_004851615.1
ATGGCCGGGGACCGGCTCCCGAGGAAGGTGATGGACGCCAGGAAGCTGGCCAGCCTGCTGCGGGGCGGGCCTGGGGGGCCCCTGGTCATCGACAGCCGCTCCTTTGTGGAGTACAACAGCTGGCACGTGCTCAGCTCCGTCAACATCTGCTGTTCCAAGCTGGTGAAGCGGCGGCTGCAGCAGGGCAAGGTGACCATTGCCGAGCTCATCCAGCCTGCCACTCGCAGCCAGGTGGAGGCTGCAGAACCACAGGACGTAGTGGTGTATGACCAGAGCACCCGGGATGCCAGTGTGCTGGCCGCAGACAGCTTCCTGTCCATCCTGCTCAGCAAGCTGGACGGCTGCTTCGACAGCGTGGCCATCCTCACGGGGGGCTTCGCCACCTTCTCCTCCTGCTTCCCTAGCCTCTGCGAGGGCAAACCTGCCACCCTGCCACCCATGAGCCTCTCCCAGCCCTGCCTGCCTGTGCCCAGCGTGGGCCTGACCCGCATACTGCCTCACCTCTACCTGGGCTCCCAGAAGGATGTCCTCAACAAGGATCTGATGACCCAAAATGGAATAAGCTACGTCCTCAACGCCAGCAATTCCTGCCCCAAGCCGGACTTCATCTGCGAGAGCCGCTTCATGCGCATTCCCATCAACGACAACTACTGTGAAAAACTGCTGCCCTGGCTGGACAAGTCCGTGGAGTTCATCGATAAAGCCAAGCTGTCCAGCTGCCAGGTCATCGTCCACTGTCTGGCCGGCATCTCCCGCTCTGCAACCATTGCCATAGCCTACATCATGAAGACCATGGGCATGTCCTCCGACGACGCCTACAGGTTTGTGAAGGACCGGCGGCCGTCCATCTCGCCCAATTTCAACTTCCTGGGCCAGCTGCTGGAGTACGAGCGGAGCCTGCAACTGCTGGCCGCCCTGCAGGGCGACACCCCCCACCCGGGGACCCCCGAGCCCCTCCCGGGCCCCGCAGCAGGGGTCCTGCTGCCAAGGCTGCCACCACCACCTACCTCAGAGAGTGCTGCCACCGGGGGCGCGGCAGCCACCGCAGCCAGGGAGAGTGGCACCTGGGAGGCCCCGGCCGCCACCCCGGCCACTAGCGCACTGCAGCAGGGCCTGCGCGGCCTGCACCTGTCCTCCGACCGCCTGCAGGACACCAACCGCCTCAAGCGCTCCTTCTCCCTGGACATCAAGTCGGCCTACGCCCCGAGCCAGCGGCCTGAGCGTCCGGGGCCGCCTGCCCCCGGGGAGGCAGCCAAGCTGTGCAAGTTGCACAGCCCCTCAGGGGTCCTGCTGGGCCTCCCCTCACCGGCCTCTGACAGCCCAGACTCCACTGCAGAGACGCGCCCTCGGCCCCGTCGGCGGCACCGGCCGCCCGCCAGCTCCCCAGCCCGCTCCCCGGGGGCACACGGCCTCGGCCTGAACTTCGGCGATACGGGGCGCCAGACTCCAAGGCACGGACTCTCTGCCCTGTCTGCACCCGCACTGCCCGGCCCGGGTCAGCCCGCCAGCCCGGGGGCCTGGGCGCCGCCGCTCGACTCCCCGGGGACACCCTCCCCCGACGCACCCTGGTGCTTCAGCCCCGAGGGTGCACAGGGGGCCTTCAGCCTGGCAGGCGCGCCCGGGCCCGGCGGCAGGGGCGACGGCTGGCCCGAGGAGCCCGCCCCAGACTCGCAGTTCAAGAGGCGCAGCTGCCAGATGGAGTTCGAGGAGGGCATGGCCGAGGGCCACGCGCGTGGCGAGGAGCTGACAGCCCTGGGCAAGCAGGCCAGCTTCTCGGGCAGCGTGGAGGTCATCCAGGTCTCCTGA

XM_004851626.1 Coding sequence

Brsk2 BR serine/threonine kinase 2, transcript variant X7

Length: 1962 bp    Location: 21334038..21296120   Strand: -
>XM_004851626.1
ATGACATCGACGGGGAAGGACGGCGGCGGGGCGCAGCACGCGCAGTATGTGGGGCCCTACCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGCCTCGTGAAGCTGGGCATCCACTGTGTCACGTGCCAGAAAGTCGCCATCAAGATCGTCAACCGAGAGAAGCTCAGCGAGTCTGTGCTGATGAAGGTGGAGCGGGAGATTGCCATCCTGAAGCTCATTGAGCACCCACACGTCCTGAAGCTGCATGACGTCTATGAGAACAAAAAATATTTGTACCTGGTGCTGGAGCACGTGTCCGGCGGGGAGCTGTTCGACTACCTGGTGAAGAAGGGGCGGCTAACGCCCAAGGAGGCCCGGAAGTTCTTCCGGCAAATCATCTCGGCGCTGGATTTCTGCCACAGCCACTCCATATGCCACAGGGACCTGAAGCCTGAGAACCTGCTGCTGGATGAAAAGAACAACATTCGAATCGCAGACTTCGGCATGGCATCCCTACAGGTCGGCGACAGCCTGCTGGAGACCAGCTGCGGATCCCCTCACTACGCATGCCCGGAGGTGATCCGGGGGGAGAAGTATGACGGGCGCAAGGCGGACGTGTGGAGCTGCGGTGTGATCCTGTTCGCCCTGCTGGTGGGGGCACTGCCCTTCGATGATGACAACCTGCGGCAGCTGCTGGAGAAGGTCAAGCGGGGTGTGTTCCACATGCCGCACTTCATCCCGCCCGACTGCCAGAGCCTGCTGCGCGGCATGATTGAAGTGGACGCGGCTCGGCGCCTCACGCTAGAGCACATTCAGAAACACATATGGTATATAGGGGGCAAAAACGAGCCAGAGCCAGAGCAGCCCATCCCGCGCAAGGTGCAGATCCGTTCGCTGCCCAGCCTAGAGGACATTGACCCTGATGTGCTGGACAGCATGCACTCGCTGGGCTGCTTCCGGGACCGCAACAAGCTGCTACAGGACCTGCTGTCCGAGGAGGAGAACCAGGAGAAGATGATATACTTCCTCCTCCTGGACCGGAAAGAGAGGTACCCCAGCCACGAAGATGAGGACCTGCCGCCCAGGAACGAGATAGACCCTCCCCGGAAGCGCGTGGACTCTCCAATGCTGAACCGGCATGGCAAGCGGCGGCCGGAACGCAAGTCCATGGAGGTGCTCAGTGTGACAGATGGTGGCTCCCCGGTGCCCGCAAGGCGAGCCATCGAGATGGCCCAGCACAGTCAGAGGTCTCGGTCCATCAGCGGTGCCTCCTCGGGCCTCTCCACAAGCCCCCTCAGCAGCCCGCGGGTGACCCCTCACCCCTCACCGAGGGGCAGTCCCCTCCCCACCCCCAAGGGGACGCCCGTCCACACGCCAAAGGAGAGTCCAGCCGGCACGCCCAACCCCACGCCGCCATCCAGCCCCAGTGTCGGAGGGGTGCCTTGGCGCACGCGGCTCAGCTCTATCAAGAACAGCTTCCTGGGCTCGCCTCGCTTCCACCGCCGGAAGCTGCAAGTTCCGACACCCGAGGAGATGTCCAACCTGACCCCCGAGTCCTCCCCAGAGCTGGCCAAGAAGTCCTGGTTCGGGAACTTCATTAACCTGGAGAAGGAGGAGCAGATCTTTGTGGTCATCAAGGATAAGCCCCTGAGCTCCATCAAGGCCGACATTGTGCACGCCTTCCTGTCGATCCCCAGCCTCAGTCACAGCGTCATCTCCCAGACCAGCTTCCGGGCCGAGTACAAGGCCACGGGCGGCCCGGCCGTGTTCCAGAAGCCCGTCAAGTTCCAGGTGGACATCACGTACACGGAGGGCGGCGAGGCGCAGAAGGAGAATGGCATCTACTCTGTCACCTTCACCCTGCTCTCAGGCCCCAGCCGCCGCTTCAAGAGGGTGGTGGAGACCATCCAGGCCCAGCTGCTGAGTCCCCACGACCAGCCGCCAGCCCAGCACTTGTCAGGAATTATCCCGAAAAGCTAA

XM_004851625.1 Coding sequence

Brsk2 BR serine/threonine kinase 2, transcript variant X6

Length: 2010 bp    Location: 21334038..21296120   Strand: -
>XM_004851625.1
ATGACATCGACGGGGAAGGACGGCGGCGGGGCGCAGCACGCGCAGTATGTGGGGCCCTACCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGCCTCGTGAAGCTGGGCATCCACTGTGTCACGTGCCAGAAAGTCGCCATCAAGATCGTCAACCGAGAGAAGCTCAGCGAGTCTGTGCTGATGAAGGTGGAGCGGGAGATTGCCATCCTGAAGCTCATTGAGCACCCACACGTCCTGAAGCTGCATGACGTCTATGAGAACAAAAAATATTTGTACCTGGTGCTGGAGCACGTGTCCGGCGGGGAGCTGTTCGACTACCTGGTGAAGAAGGGGCGGCTAACGCCCAAGGAGGCCCGGAAGTTCTTCCGGCAAATCATCTCGGCGCTGGATTTCTGCCACAGCCACTCCATATGCCACAGGGACCTGAAGCCTGAGAACCTGCTGCTGGATGAAAAGAACAACATTCGAATCGCAGACTTCGGCATGGCATCCCTACAGGTCGGCGACAGCCTGCTGGAGACCAGCTGCGGATCCCCTCACTACGCATGCCCGGAGGTGATCCGGGGGGAGAAGTATGACGGGCGCAAGGCGGACGTGTGGAGCTGCGGTGTGATCCTGTTCGCCCTGCTGGTGGGGGCACTGCCCTTCGATGATGACAACCTGCGGCAGCTGCTGGAGAAGGTCAAGCGGGGTGTGTTCCACATGCCGCACTTCATCCCGCCCGACTGCCAGAGCCTGCTGCGCGGCATGATTGAAGTGGACGCGGCTCGGCGCCTCACGCTAGAGCACATTCAGAAACACATATGGTATATAGGGGGCAAAAACGAGCCAGAGCCAGAGCAGCCCATCCCGCGCAAGGTGCAGATCCGTTCGCTGCCCAGCCTAGAGGACATTGACCCTGATGTGCTGGACAGCATGCACTCGCTGGGCTGCTTCCGGGACCGCAACAAGCTGCTACAGGACCTGCTGTCCGAGGAGGAGAACCAGGAGAAGATGATATACTTCCTCCTCCTGGACCGGAAAGAGAGGTACCCCAGCCACGAAGATGAGGACCTGCCGCCCAGGAACGAGATAGACCCTCCCCGGAAGCGCGTGGACTCTCCAATGCTGAACCGGCATGGCAAGCGGCGGCCGGAACGCAAGTCCATGGAGGTGCTCAGTGTGACAGATGGTGGCTCCCCGGTGCCCGCAAGGCGAGCCATCGAGATGGCCCAGCACAGTCAGAGGTCTCGGTCCATCAGCGGTGCCTCCTCGGGCCTCTCCACAAGCCCCCTCAGCAGCCCGCGGGTGACCCCTCACCCCTCACCGAGGGGCAGTCCCCTCCCCACCCCCAAGGGGACGCCCGTCCACACGCCAAAGGAGAGTCCAGCCGGCACGCCCAACCCCACGCCGCCATCCAGCCCCAGTGTCGGAGGGGTGCCTTGGCGCACGCGGCTCAGCTCTATCAAGAACAGCTTCCTGGGCTCGCCTCGCTTCCACCGCCGGAAGCTGCAAGTTCCGACACCCGAGGAGATGTCCAACCTGACCCCCGAGTCCTCCCCAGAGCTGGCCAAGAAGTCCTGGTTCGGGAACTTCATTAACCTGGAGAAGGAGGAGCAGATCTTTGTGGTCATCAAGGATAAGCCCCTGAGCTCCATCAAGGCCGACATTGTGCACGCCTTCCTGTCGATCCCCAGCCTCAGTCACAGCGTCATCTCCCAGACCAGCTTCCGGGCCGAGTACAAGGCCACGGGCGGCCCGGCCGTGTTCCAGAAGCCCGTCAAGTTCCAGGTGGACATCACGTACACGGAGGGCGGCGAGGCGCAGAAGGAGAATGGCATCTACTCTGTCACCTTCACCCTGCTCTCAGGCCCCAGCCGCCGCTTCAAGAGGGTGGTGGAGACCATCCAGGCCCAGCTGCTGAGTCCCCACGACCAGCCGCCAGCCCAGCACTTGTCAGACACCACTAACTGTATGGGAATGATGACGGGGCGGCTTTCCAAATGTGGAATTATCCCGAAAAGCTAA

XM_004851621.1 Coding sequence

Brsk2 BR serine/threonine kinase 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 2151 bp    Location: 21334038..21296120   Strand: -
>XM_004851621.1
ATGACATCGACGGGGAAGGACGGCGGCGGGGCGCAGCACGCGCAGTATGTGGGGCCCTACCGGCTGGAGAAGACGCTGGGCAAGGGGCAGACAGGCCTCGTGAAGCTGGGCATCCACTGTGTCACGTGCCAGAAAGTCGCCATCAAGATCGTCAACCGAGAGAAGCTCAGCGAGTCTGTGCTGATGAAGGTGGAGCGGGAGATTGCCATCCTGAAGCTCATTGAGCACCCACACGTCCTGAAGCTGCATGACGTCTATGAGAACAAAAAATATTTGTACCTGGTGCTGGAGCACGTGTCCGGCGGGGAGCTGTTCGACTACCTGGTGAAGAAGGGGCGGCTAACGCCCAAGGAGGCCCGGAAGTTCTTCCGGCAAATCATCTCGGCGCTGGATTTCTGCCACAGCCACTCCATATGCCACAGGGACCTGAAGCCTGAGAACCTGCTGCTGGATGAAAAGAACAACATTCGAATCGCAGACTTCGGCATGGCATCCCTACAGGTCGGCGACAGCCTGCTGGAGACCAGCTGCGGATCCCCTCACTACGCATGCCCGGAGGTGATCCGGGGGGAGAAGTATGACGGGCGCAAGGCGGACGTGTGGAGCTGCGGTGTGATCCTGTTCGCCCTGCTGGTGGGGGCACTGCCCTTCGATGATGACAACCTGCGGCAGCTGCTGGAGAAGGTCAAGCGGGGTGTGTTCCACATGCCGCACTTCATCCCGCCCGACTGCCAGAGCCTGCTGCGCGGCATGATTGAAGTGGACGCGGCTCGGCGCCTCACGCTAGAGCACATTCAGAAACACATATGGTATATAGGGGGCAAAAACGAGCCAGAGCCAGAGCAGCCCATCCCGCGCAAGGTGCAGATCCGTTCGCTGCCCAGCCTAGAGGACATTGACCCTGATGTGCTGGACAGCATGCACTCGCTGGGCTGCTTCCGGGACCGCAACAAGCTGCTACAGGACCTGCTGTCCGAGGAGGAGAACCAGGAGAAGATGATATACTTCCTCCTCCTGGACCGGAAAGAGAGGTACCCCAGCCACGAAGATGAGGACCTGCCGCCCAGGAACGAGATAGACCCTCCCCGGAAGCGCGTGGACTCTCCAATGCTGAACCGGCATGGCAAGCGGCGGCCGGAACGCAAGTCCATGGAGGTGCTCAGTGTGACAGATGGTGGCTCCCCGGTGCCCGCAAGGCGAGCCATCGAGATGGCCCAGCACAGTCAGAGGTCTCGGTCCATCAGCGGTGCCTCCTCGGGCCTCTCCACAAGCCCCCTCAGCAGCCCGCGGGTGACCCCTCACCCCTCACCGAGGGGCAGTCCCCTCCCCACCCCCAAGGGGACGCCCGTCCACACGCCAAAGGAGAGTCCAGCCGGCACGCCCAACCCCACGCCGCCATCCAGCCCCAGTGTCGGAGGGGTGCCTTGGCGCACGCGGCTCAGCTCTATCAAGAACAGCTTCCTGGGCTCGCCTCGCTTCCACCGCCGGAAGCTGCAAGTTCCGACACCCGAGGAGATGTCCAACCTGACCCCCGAGTCCTCCCCAGAGCTGGCCAAGAAGTCCTGGTTCGGGAACTTCATTAACCTGGAGAAGGAGGAGCAGATCTTTGTGGTCATCAAGGATAAGCCCCTGAGCTCCATCAAGGCCGACATTGTGCACGCCTTCCTGTCGATCCCCAGCCTCAGTCACAGCGTCATCTCCCAGACCAGCTTCCGGGCCGAGTACAAGGCCACGGGCGGCCCGGCCGTGTTCCAGAAGCCCGTCAAGTTCCAGGTGGACATCACGTACACGGAGGGCGGCGAGGCGCAGAAGGAGAATGGCATCTACTCTGTCACCTTCACCCTGCTCTCAGGCCCCAGCCGCCGCTTCAAGAGGGTGGTGGAGACCATCCAGGCCCAGCTGCTGAGTCCCCACGACCAGCCGCCAGCCCAGCACTTGTCAGACACCACTAACTGTATGGGAATGATGACGGGGCGGCTTTCCAAATGTGACGAGAAGAACGGGCAGGCGGGCCCGGCCCCCAGCGCACCCGCCAGGCGGAGTGCCCACGGCCCCCTCGGTGACCCTGCGGCCACTGGCCCTCGAGGGGACGCCGAGTTCCCGACGGGCAAGGACACGGCCGCGGCCGCCGCGAGCAGCCTTACACACTAG

XM_004851623.1 Coding sequence

Brsk2 BR serine/threonine kinase 2, transcript variant X4

Length: 2043 bp    Location: 21313338..21298659   Strand: -
>XM_004851623.1
ATGACGTCTATGAGAACAAAAAATATTTGTAGGTACCTGGTGCTGGAGCACGTGTCCGGCGGGGAGCTGTTCGACTACCTGGTGAAGAAGGGGCGGCTAACGCCCAAGGAGGCCCGGAAGTTCTTCCGGCAAATCATCTCGGCGCTGGATTTCTGCCACAGCCACTCCATATGCCACAGGGACCTGAAGCCTGAGAACCTGCTGCTGGATGAAAAGAACAACATTCGAATCGCAGACTTCGGCATGGCATCCCTACAGGTCGGCGACAGCCTGCTGGAGACCAGCTGCGGATCCCCTCACTACGCATGCCCGGAGGTGATCCGGGGGGAGAAGTATGACGGGCGCAAGGCGGACGTGTGGAGCTGCGGTGTGATCCTGTTCGCCCTGCTGGTGGGGGCACTGCCCTTCGATGATGACAACCTGCGGCAGCTGCTGGAGAAGGTCAAGCGGGGTGTGTTCCACATGCCGCACTTCATCCCGCCCGACTGCCAGAGCCTGCTGCGCGGCATGATTGAAGTGGACGCGGCTCGGCGCCTCACGCTAGAGCACATTCAGAAACACATATGGTATATAGGGGGCAAAAACGAGCCAGAGCCAGAGCAGCCCATCCCGCGCAAGGTGCAGATCCGTTCGCTGCCCAGCCTAGAGGACATTGACCCTGATGTGCTGGACAGCATGCACTCGCTGGGCTGCTTCCGGGACCGCAACAAGCTGCTACAGGACCTGCTGTCCGAGGAGGAGAACCAGGAGAAGATGATATACTTCCTCCTCCTGGACCGGAAAGAGAGGTACCCCAGCCACGAAGATGAGGACCTGCCGCCCAGGAACGAGATAGACCCTCCCCGGAAGCGCGTGGACTCTCCAATGCTGAACCGGCATGGCAAGCGGCGGCCGGAACGCAAGTCCATGGAGGTGCTCAGTGTGACAGATGGTGGCTCCCCGGTGCCCGCAAGGCGAGCCATCGAGATGGCCCAGCACAGTCAGAGTAAAGCAGTGTTCAGTAAAAGCCTGGATATCGCTGAAGCCCATCCCCAATTCAGCACAGAAGACAGGTCTCGGTCCATCAGCGGTGCCTCCTCGGGCCTCTCCACAAGCCCCCTCAGCAGCCCGCGGGTGACCCCTCACCCCTCACCGAGGGGCAGTCCCCTCCCCACCCCCAAGGGGACGCCCGTCCACACGCCAAAGGAGAGTCCAGCCGGCACGCCCAACCCCACGCCGCCATCCAGCCCCAGTGTCGGAGGGGTGCCTTGGCGCACGCGGCTCAGCTCTATCAAGAACAGCTTCCTGGGCTCGCCTCGCTTCCACCGCCGGAAGCTGCAAGTTCCGACACCCGAGGAGATGTCCAACCTGACCCCCGAGTCCTCCCCAGAGCTGGCCAAGAAGTCCTGGTTCGGGAACTTCATTAACCTGGAGAAGGAGGAGCAGATCTTTGTGGTCATCAAGGATAAGCCCCTGAGCTCCATCAAGGCCGACATTGTGCACGCCTTCCTGTCGATCCCCAGCCTCAGTCACAGCGTCATCTCCCAGACCAGCTTCCGGGCCGAGTACAAGGCCACGGGCGGCCCGGCCGTGTTCCAGAAGCCCGTCAAGTTCCAGGTGGACATCACGTACACGGAGGGCGGCGAGGCGCAGAAGGAGAATGGCATCTACTCTGTCACCTTCACCCTGCTCTCAGGCCCCAGCCGCCGCTTCAAGAGGGTGGTGGAGACCATCCAGGCCCAGCTGCTGAGTCCCCACGACCAGCCGCCAGCCCAGCACTTGTCAGACACCACTAACTGTATGGGAATGATGACGGGGCGGCTTTCCAAATGTGGTAAGAACCCTCCCGCCCGCTCACCTGGCACCTCGGCCGGGCACCCACTGCTCCCCCGCAGCCTACCCCGCCCCGTGGCTGTCCTGGGCGCCCCACCCTGTCCCTGCCAGGATGAGGATGGGCCCTGGGAACCACAGGCTGGGAGTGGGAGGGGTCCCAGGGGAGCGCTGGCTGCGCTCTGCAAAACGGGAGGCCCTGTGCCGAGGCGAGGCGAGGCGAGGCGAGGCTAG

XM_004851801.1 Coding sequence

Muc6 mucin 6, oligomeric mucus/gel-forming

High confidence: 4 potential gene matches
Length: 5028 bp    Location: 21549202..21566469   Strand: +
>XM_004851801.1
ATGCTTGGCCCCAGGCTGCTGCTGCTGCTGCTACCGTTCGGAGTGGCCTTGCTCAGGGGTGAACCCCCAGCTGGAAATGCCACAGGCACGGCCACCCAGGGCCACCTGCAGTCCTCCCCAGACAAGGGCTGGTGCTCCACGTGGGGCACTGGCCACTTCGCCACCTTCGACCACCATGCCTATGACTTCTCGGGGACCTGCAACTACGTCTTCGCAGCCACCTGCAAGGACGCTCTTCCTGCCTTCAGCGTGCAGCTGCGGCGAGGGCTGGACGGGGCCATCTCCCGGCTCATCGTGGAGCTGGGAGCCTCCACCGTCACCGTGGGCAACGGAGCCATCTCCATCAAGGACGTGGGGGTGGTCAGCCTGCCCTATACCAGCAACGGGCTTCAGATCGCACCCTACGGCCCCAGCGTGCGGCTGGTGGCCAAGCAGCTAGAGCTGGAGCTGGTGGTGCTGTGGGGCCCGGACCCCCACCTCATGGTCTTGGTGGAGAGGAAGTACATGGGCCAGATGTGTGGGCTGTGTGGGGACTTCGACGGGAACGTGGACAACGACTTCATAAGCGAGGATGGCAAACTCCTGGAGCCCCACAAGTTCGCCGCACTCCAGAAGCTCGATGACCCCAGTGAGATCTGCGCCTATGAGGCTGTCCCCAGGGCCCCCAGTCTGCATGTCCAGGACGCCGAGACCTGCACCCGGCTGCTCGCCCTGGTGTCCCCCGAGTGTGACGTGCCCAAGGAGTCACTGGTGCACAGCTGCCAGGTGGACATGGCGGCATGCGACCTGCCTGGACAGCCGAATTGCAGCTGTGCCACGCTGTCTGAGTTCTCGCGCCGCTGCAGCATGGCGGGCCAGCCCGTGAGCCGCTGGCGGGGCCCCAGCCTCTGCGCGCTGGGCCCGTGCCCGGCCAGCCAGGAGTACCGGGAGTGTGGAGAAGCCTGCACTGAAACCTGCTCCCACCCACAGCACAGCTGCCCCGGCTCCTGCACCTTCGGCTGCTTCTGCCCAGAGGGCACCGTGCTCAATGACCTCTCCACAAACCGCACGTGCGTGCCACTCAGCCAGTGCCCCTGCATGCTCAACGGGGCAATCTACAGCCCCGGCGAGGTCACAGCAGCCGCCTGCCGGACCTGCCAGTGCACCACAGGCCGCTGGAGGTGTATGGAGAAGCCATGCCCCGGGACCTGCTCCCTGGAAGGCGGCTCCTTCGTCACCACATTCGACACGAGGCCCTACCGCTTCCATGGCACCTGCACCTATATCCTCCTCCAGAGCCCACAGCTCCCTGACGAAGGCACTCTCATGGCCGTGTACGACAAGTCGGGCTACTCGCACTCGGAGACCTCCCTGACTGCTGTCATCTACCTGTCCCGGAAGGACAAAATTGTGATCTCAGAGGATGAGGTGCTAACCAACCACGGAGACACCAAGCGGCTGCCCTACAAGACACGTAACATCACCATCTTCAGGCAGACGTCCACCCACCTCCAGATGGCCACCACCTTCGGGCTGGAGCTCATGGTCCAGCTGCAGCCCATCTTCCAGGCATACATCACTGTCGGGCCCCAGTTCCGAGGCCAGGCCAGAGGGCTCTGTGGCAACTTCAATGGGGACACCACCGACGACTTCATGACCAGCATGGGCATCGACGAGGGCACGGCCACTCTCTTCGTGGACTCCTGGCGGGCAGGGAACTGCCCAGCTGCCCTGGAGCGTGAGACAGACCCCTGCTCCATGAGCCAGCTCAACAAGGTGTGCGCGGAGAGCCACTGCTCCGAGCTGGTGAGGAAGGGCGGCGCATTCGAGAAGTGCCACGCCACGGTGAACCCCACACCCTTCTACAAGAGGTGCGTGTACCAAGCCTGCAACTACGAGGAGACCTTCCCCCACATATGCGCTGCCCTGGGCACCTACGCGCAGGCCTGCGCCACCCAGGGTGTCCCGCTCTGGGGCTGGAGGAACAGCGTGGACAACTGCACCATCCCCTGCACTGGCAACCGCACATTCAGCTCCAACAGCCGGGCCTGTGGCCGCACGTGCCTGTCACTCTCCGACCGCGAGGCTGAGTGCCACGCCAGTGCCGTGCCGGTGGATGGCTGCAACTGTCCCGAGGGCTCCTACCTGGACCACAAGGGCGAGTGCGTGCGCAAAGCCCAGTGCCCCTGCCTGCTGGAGGGCCCCAAGTTCCTCCTGGCTGACCAGTCTGCCAAGCTCAACGGAGTCATCTGCTACTGCACCAACGGGCGGCTGAGTTGCTCTGGGCAGCCGCAGATGTCCCTGGCTTCCTGCCTGGCCCCCAAAACGTTCCAGTCCTGCGATCAGTCCGCGGAGGACAAGTTCGGGGCAGCCTGCGCACCCACCTGCCAGATGCTGGCCACGGGCACCGCCTGTGTGCCCACCAAGTGCGAGCCAGGCTGCGTCTGCGCAAAGGGGCTCTTTGAGAACCCCAGAGGGGAGTGTGTGCCCGCGGAGCAGTGCCCATGCGACTTCGCGGGGGTCTCCTACCCAGGGGGCGCCGAGCTCCACACTGACTGTAAGACCTGCACCTGCTCGCAGGGGCGCTGGGCCTGCCAGCAGGGATCCCACTGCCCCTCCACCTGCGTGCTCTACGGGGAGGGCCACGTGGTCACCTTTGACGGGCAGCGCTTCGTGTTTGATGGCAATTGCAAGTACATCCTGGCCACGGACGACTGTGGCACCAACAGTTCGCAGCCGAACTTCAAAGTCCTGACGGAGAACGTCATCTGCGGGAAGTCAGGGGCCACCTGCTCCCGCGCCATCGAGACCGTCCTGGGCGGCCTGTCCATCACGATGGCAGACAGCAGCTACACGGTGCACGGTGAGGACCCCCACGTGCACTTCCAGGTGCAGTCCAGCGCCCTGAGCCTGGTGCTGGACGCACACATCCCCGGCAGGCTCAACCTGACACTCATCTGGAACAAGCACATGAGCGTCTCCATCAAGATCCACCGCACCTCCCAGGACGCCCTCTGTGGCTTGTGTGGCAATGCCAACGGGAACATGAAGGATGACTTCGAGACGCGCAGTAGGTACGTGGCGTCCAGCGAGCTGGAGTTCGTGAACTCCTGGAAGGAGAGCCCTCTGTGCGGGGACACGCGTGCCACTGTCGAGCCCTGCAGCCTCAATGCCTTCCGCCGCTCCTGGGCCGAGCGCAAGTGCAGCATCATCAATGGCCAGACCTTTGCTGCCTGCCACAGCAAGGTGTACCACTTGCCCTACTACGAGGCTTGTGTGCGCGACACCTGCGGGTGTGACATGGGCGGAGACTGCGAGTGTCTGTGCGATGCCGTGGCTGCCTACGCCCAGGCCTGCCTGGACAAGGGCGTGTGTGTGGACTGGAGGGCCCCCGACTTCTGCCCCATCTACTGTGACTTCTACAACACGCACCCTCACGCGGGCGGCCAGGACCAGCCCACGCAGGAGGGTGACTGCCTGTGGCACTACCGACCCTGCCTCTGCCCTGGCAGCCTACAGAGCTTTGAGGGCACCAACATCGAAGGCTGCTACAACTGCTCGAAGGACAAGTACTTCGACCACAGCACGGGGACCTGCATGCCCTGCGCGCAGCCCAAGCTGCTGCCCCACCCGCTCTCGCTGCTTGCACTCTGCCCGCGGACGGCCCGAGGCCCCCACGGCCTGGCGCCGGTCCAGAGAGAGCAGCACAGGCCCCGGGGTCCCTGTGCTTTGCACCCTGCTCCCCGGCCGCCTCGGAGCAGCCCCAGCAGGAACCTTGCTGGGGTCCACTGCACCTTGCAGAGCTCCCTGCTCCCCACACCTCCCTGCCAGGGCTGCCAAGCTGGGTGGAAGGGGGACAGGAGGGATGGGGAGGGGCCGCTCCTGAACACCTCTCCTCTTGCAGCGCCACCCCCCACATCGCCACCGCTGCCACCCACCTCAGAATCCCCTCCGACCACCACGGCAGTCACCACACCTGCCACCTCTCCTCGGGTGCCTACAGTCACGGTGATGTCAACAGCCACAGGATATACAGTCACTACAGCAACGACAGAGCCCACAGCATCATCCCCCAGCCCAGCCACTACATCCACAGCTCAGTCCACAGCACGGACCACAGTGGTACCACTGACCGTGAGCACGTGGACAAGGAATCCTGGACAAGGGACAAGCACCCAAGAGAAAATGCCAGGAACAGGGCCGGTCACACTCACACAGACAACAGAACAATACACTTTGGGAGAGACCGCCCTGGCCACACAGCATACCAGGGAGAGCAGGGGCACCGCGACAGCATCAACAACGCAACACACGGAAATCACGTCAAGCACGCTGCAGACCCATTCACCCAGCCATAGCGCACGCACGCTGCCCGTGTCCCACCCTCCACAAACAACGGAACCCACCTCGGGAACGTCGCTCACGACCACCAGCACCTTTCCAACCACATCTGAACCCCAGACCCTACCTCCCAGTGTCTCTCCAACCCTCACCCACGCCACCGCCTCCCAGGTCACTGCTCTTACCACCGAGGCCCCTGTGTCTGGCCTGGTGTCCTCCACCTTGGAGACGATCTCCTCCCCACACTCTCCATCCACCAACCTCACCAGCCGGCCCACTGGGACCACGCAGCTGCCCACGTCCACATTCCCGTCCAGCCCAGCTGCTTCCCCCACAACCTCGCCCCCTACCTTGGAGGTGCTGTCCACTCTGAGCCCCTGGGTGTCCTCTCCGGTGACCTCTCCCACCAGCTCTGCAGCATCCCCAGAGCCATGCAGCGTGCGGGAGCGGGAGCAGGAGATCACCCACCAGGGCTGCACCGCCAACGTGACCCTGGCCCACTGCGAGGGTGCCTGCGCCTCCTCCTCCAGCTTCAACGTCACCACCCAGCAGCTGGATGTCCACTGTGCCTGCTGCAAGCCCCTCAGCTCCTACACACAGGAGGTCCCGCTGCCCTGTCGAGACCCCAGCATGCCCAGCCGGCTGCTCATGCTCACTGTGCGGGTGGCCCACAGCTGTGTGTGTGGGCACCAGCACTGTGGAGACTAG

XM_004851629.1 Coding sequence

Ap2a2 adaptor-related protein complex 2, alpha 2 subunit, transcript variant X2

High confidence: 4 potential gene matches
Length: 2814 bp    Location: 21616392..21568217   Strand: -
>XM_004851629.1
ATGCCGGCCGTGTCCAAGGGGGACGGGATGCGGGGCCTGGCGGTCTTCATCTCGGACATTCGCAACTGCAAAAGTAAAGAAGCAGAAATAAAGAGGATAAACAAGGAACTGGCAAATATTAGGTCAAAATTCAAAGGTGACAAGGCTCTTGATGGCTACAGTAAAAAGAAGTACGTGTGCAAGTTGCTCTTCATCTTCCTCCTGGGCCACGACATCGACTTTGGGCACATGGAGGCCGTGAACTTGCTGAGCTCCAACCGGTACACAGAGAAGCAGATTGGCTACCTCTTTATCTCCGTGTTGGTGAACTCCAACAGCGAGCTGATCCGCCTGATCAACAACGCCATCAAGAACGACCTGGCCAGCCGCAACCCCACCTTCATGGGCCTTGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGCGGAGGCCTTTGCCGGGGAGATCCCCAAGATCCTCGTTGCAGGAGACACCATGGACAGTGTGAAGCAGAGTGCGGCCCTGTGCCTCCTGCGCCTGTACAGGGCGTCCCCCGACCTCGTCCCGATGGGTGACTGGACGTCACGGGTGGTGCATCTGCTCAATGACCAGCATCTGGGCGTGGTCACTGCTGCCACCAGCCTGATCACCACGCTGGCCCAGAAGAACCCCGAGGAGTTCAAGACCTCCGTCTCCCTTGCCGTCTCCAGGCTGAGCAGAATCGTGACTTCTGCATCCACGGACCTTCAGGATTATACCTACTACTTTGTCCCAGCTCCCTGGCTGTCAGTCAAACTTCTGAGGCTGCTGCAGTGCTACCCGCCCCCAGATCCTGCAGTTCGAGGCCGCCTGACCGAGTGCCTGGAGACCATCCTGAACAAGGCGCAGGAGCCGCCGAAGTCCAAAAAGGTGCAGCATTCCAATGCCAAGAATGCCGTGCTCTTCGAGGCCATCAGCCTGATCATCCACCACGACAGTGAGCCAAACTTGCTGGTGCGCGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGCGAGACCAACCTGCGCTACCTGGCACTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCACGAGGCCGTCAAGACCCACATCGACACCGTCATCAACGCCCTCAAGACGGAGCGGGATGTAAGCGTGCGGCAGCGAGCCGTGGACCTGCTGTACGCCATGTGCGACCGTAGCAATGCCCAACAGATTGTGGCTGAGATGCTGAGTTACCTCGAGACGGCTGACTACTCCATCCGTGAGGAGATTGTGCTAAAGGTGGCCATCCTGGCCGAGAAGTACGCAGTGGACTACACCTGGTATGTGGACACCATCCTGAACCTGATCCGCATCGCAGGGGACTATGTCAGTGAGGAGGTGTGGTACCGCGTCATTCAGATTGTCATCAACCGCGATGATGTGCAGGGCTATGCCGCCAAGACGGTGTTTGAGGCTCTGCAGGCTCCTGCGTGCCATGAGAACCTGGTCAAAGTGGGCGGCTACATCCTGGGGGAATTTGGAAACCTGATAGCTGGGGACCCGCGGTCCAGCCCTCTGATCCAGTTTGACCTGCTGCACTCCAAGTTCCACCTGTGCAGCGTGCCCACGCGGGCCCTGCTGCTGTCCACCTACATCAAGTTTGTGAACCTGTTCCCCGAGGTGAAGACCACCATCCAGGACGTGCTGCGCAGCGATAGCCAGCTCAAGAACGCGGATGTGGAGCTGCAGCAGCGGGCCGTGGAGTACCTGCGGCTCAGCAGCGTGGCCAGCACTGACATCCTGGCGACCGTGCTGGAAGAGATGCCACCCTTCCCGGAGCGTGAGTCCTCCATCCTGGCCAAGCTCAAGAAGAAGAAGGGGCCGAGCACAGTGACCGACCTGGAGGAGGCCAAGCGCGAGCGCAGCGTGGATGTGAACGGGGCCCCCGAGCCCGCCCCGGCCAGTGCCAGCGCTGCGTCCACGCCTTCTCCATCCGCTGACCTGCTGGGTCTGGGCGCTGCCCCCCCGGCCCCCACGGGGCCCCCGCCCTCAGCTGGGGGGCTGCTGGTGGACGTCTTCTCCGACTCAGCGTCAGCAGTCGCACCCCTGGCGCCCGGCTCTGAGGACAACTTTGCCAGGTTTGTTTGTAAAAATAATGGTGTGTTGTTTGAAAACCAGCTGCTTCAAATTGGACTTAAGTCTGAGTTTCGGCAGAATCTAGGCCGAATGTTCATATTTTATGGTAACAAGACTTCGACGCAGTTCTTAAACTTCACTCCAACGCTGATCTGTGCAGATGACCTTCAGGCTAATCTGAACCTGCAGACCAAGCCCGTGGACCCGACTGTGGATGGGGGTGCACAGGTGCAGCAGGTGGTCAACATTGAGTGCGTGTCCGACTTCACGGAGGCACCAGTCCTCAACATCCAGTTCAGGTACGGCGGCACCTTCCAGAATGTGTCCGTCAAGCTGCCCATCACACTGAACAAGTTCTTCCAGCCCACGGAGATGGCATCTCAGGACTTCTTCCAGCGCTGGAAGCAGCTGAGCAATCCTCAGCAGGAAGTGCAGAGCATCTTCAAAGCAAAGCACCCGATGGACACAGAGATCACCAAGGCCAAGATCATCGGATTTGGGTCAGCACTCCTTGAAGAAGTTGATCCTAACCCTGCAAACTTTGTGGGCGCTGGCATCATCCACACCAAAACCACCCAGATTGGATGCTTGCTGCGTTTGGAGCCGAATCTGCAAGCTCAGATGTACCGGCTCACGCTGCGCACAAGCAAGGACACTGTTTCCCAGAGGCTATGTGACTTACTGTCGGAGCAGTTTTAA

XM_004851630.1 Coding sequence

Ap2a2 adaptor-related protein complex 2, alpha 2 subunit, transcript variant X3

Length: 2766 bp    Location: 21601245..21568217   Strand: -
>XM_004851630.1
ATGAGTGGGTTGTGTGGCAAAAGTAAAGAAGCAGAAATAAAGAGGATAAACAAGGAACTGGCAAATATTAGGTCAAAATTCAAAGGTGACAAGGCTCTTGATGGCTACAGTAAAAAGAAGTACGTGTGCAAGTTGCTCTTCATCTTCCTCCTGGGCCACGACATCGACTTTGGGCACATGGAGGCCGTGAACTTGCTGAGCTCCAACCGGTACACAGAGAAGCAGATTGGCTACCTCTTTATCTCCGTGTTGGTGAACTCCAACAGCGAGCTGATCCGCCTGATCAACAACGCCATCAAGAACGACCTGGCCAGCCGCAACCCCACCTTCATGGGCCTTGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGCGGAGGCCTTTGCCGGGGAGATCCCCAAGATCCTCGTTGCAGGAGACACCATGGACAGTGTGAAGCAGAGTGCGGCCCTGTGCCTCCTGCGCCTGTACAGGGCGTCCCCCGACCTCGTCCCGATGGGTGACTGGACGTCACGGGTGGTGCATCTGCTCAATGACCAGCATCTGGGCGTGGTCACTGCTGCCACCAGCCTGATCACCACGCTGGCCCAGAAGAACCCCGAGGAGTTCAAGACCTCCGTCTCCCTTGCCGTCTCCAGGCTGAGCAGAATCGTGACTTCTGCATCCACGGACCTTCAGGATTATACCTACTACTTTGTCCCAGCTCCCTGGCTGTCAGTCAAACTTCTGAGGCTGCTGCAGTGCTACCCGCCCCCAGAAGATCCTGCAGTTCGAGGCCGCCTGACCGAGTGCCTGGAGACCATCCTGAACAAGGCGCAGGAGCCGCCGAAGTCCAAAAAGGTGCAGCATTCCAATGCCAAGAATGCCGTGCTCTTCGAGGCCATCAGCCTGATCATCCACCACGACAGTGAGCCAAACTTGCTGGTGCGCGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGCGAGACCAACCTGCGCTACCTGGCACTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCACGAGGCCGTCAAGACCCACATCGACACCGTCATCAACGCCCTCAAGACGGAGCGGGATGTAAGCGTGCGGCAGCGAGCCGTGGACCTGCTGTACGCCATGTGCGACCGTAGCAATGCCCAACAGATTGTGGCTGAGATGCTGAGTTACCTCGAGACGGCTGACTACTCCATCCGTGAGGAGATTGTGCTAAAGGTGGCCATCCTGGCCGAGAAGTACGCAGTGGACTACACCTGGTATGTGGACACCATCCTGAACCTGATCCGCATCGCAGGGGACTATGTCAGTGAGGAGGTGTGGTACCGCGTCATTCAGATTGTCATCAACCGCGATGATGTGCAGGGCTATGCCGCCAAGACGGTGTTTGAGGCTCTGCAGGCTCCTGCGTGCCATGAGAACCTGGTCAAAGTGGGCGGCTACATCCTGGGGGAATTTGGAAACCTGATAGCTGGGGACCCGCGGTCCAGCCCTCTGATCCAGTTTGACCTGCTGCACTCCAAGTTCCACCTGTGCAGCGTGCCCACGCGGGCCCTGCTGCTGTCCACCTACATCAAGTTTGTGAACCTGTTCCCCGAGGTGAAGACCACCATCCAGGACGTGCTGCGCAGCGATAGCCAGCTCAAGAACGCGGATGTGGAGCTGCAGCAGCGGGCCGTGGAGTACCTGCGGCTCAGCAGCGTGGCCAGCACTGACATCCTGGCGACCGTGCTGGAAGAGATGCCACCCTTCCCGGAGCGTGAGTCCTCCATCCTGGCCAAGCTCAAGAAGAAGAAGGGGCCGAGCACAGTGACCGACCTGGAGGAGGCCAAGCGCGAGCGCAGCGTGGATGTGAACGGGGCCCCCGAGCCCGCCCCGGCCAGTGCCAGCGCTGCGTCCACGCCTTCTCCATCCGCTGACCTGCTGGGTCTGGGCGCTGCCCCCCCGGCCCCCACGGGGCCCCCGCCCTCAGCTGGGGGGCTGCTGGTGGACGTCTTCTCCGACTCAGCGTCAGCAGTCGCACCCCTGGCGCCCGGCTCTGAGGACAACTTTGCCAGGTTTGTTTGTAAAAATAATGGTGTGTTGTTTGAAAACCAGCTGCTTCAAATTGGACTTAAGTCTGAGTTTCGGCAGAATCTAGGCCGAATGTTCATATTTTATGGTAACAAGACTTCGACGCAGTTCTTAAACTTCACTCCAACGCTGATCTGTGCAGATGACCTTCAGGCTAATCTGAACCTGCAGACCAAGCCCGTGGACCCGACTGTGGATGGGGGTGCACAGGTGCAGCAGGTGGTCAACATTGAGTGCGTGTCCGACTTCACGGAGGCACCAGTCCTCAACATCCAGTTCAGGTACGGCGGCACCTTCCAGAATGTGTCCGTCAAGCTGCCCATCACACTGAACAAGTTCTTCCAGCCCACGGAGATGGCATCTCAGGACTTCTTCCAGCGCTGGAAGCAGCTGAGCAATCCTCAGCAGGAAGTGCAGAGCATCTTCAAAGCAAAGCACCCGATGGACACAGAGATCACCAAGGCCAAGATCATCGGATTTGGGTCAGCACTCCTTGAAGAAGTTGATCCTAACCCTGCAAACTTTGTGGGCGCTGGCATCATCCACACCAAAACCACCCAGATTGGATGCTTGCTGCGTTTGGAGCCGAATCTGCAAGCTCAGATGTACCGGCTCACGCTGCGCACAAGCAAGGACACTGTTTCCCAGAGGCTATGTGACTTACTGTCGGAGCAGTTTTAA

XM_004851636.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X5

Length: 1497 bp    Location: 21634518..21664947   Strand: +
>XM_004851636.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAATCCCTGCAGGTGCGGCTGGAACTGGCCAAGGAGCTGGGCGTCGGGGTCTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTCTAGGCTGTGCCCCCAAGCGGATGTGGACTATTCGCAGCCGTGCAATGGCCATGTGAAATACAGACCTCATTCTTTGTTCTGTGATGTCTGCTGTGGCCCTGGGAATCCACGCTCATGTAGGGAGTGCCAGCCCTGCTGCTGGGCCCTCACTGCCACCTGCCACTGGCCAGGGGACAGCCCGGCCCAGGTCCCTCACCCGGTTCAGAGGTTGGGCTCAATCCCAGACTCCTCCGCACCTGGGCTGCAGGAGCCACCCCATACCCTGACCCCACCCCCAGGGCCCGGACCCTGCCCAGCTCTGCTCAGTGTCCAGTGGAGGACCCCCCGGCCGTGCTTGGGATGGGCATCATAA

XM_004851637.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X6

Length: 1260 bp    Location: 21634518..21664431   Strand: +
>XM_004851637.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGTACATCCAGATGCTGAAGGACCACAGGCCCCGTATGGTGTGGGATGGCCAGGCTGCAGAGCACTTTTTCGAGTACAAGAAGAGCCGCGGCGGGAGGCACCTGGTCTTCTACCCAACTCTGAAGGTAGTGCCCTGCATGGTGGCCAGGGGAGGGCTGGGGATATGGTTTGGGTCAGAAGCAGCAGCCCTGCCCTATAGTGACCCTGGCCACTGTGTAGGAGTCTGTAGCTACTAG

XM_004851640.1 Coding sequence

Chid1 chitinase domain containing 1, transcript variant X9

Length: 1131 bp    Location: 21634518..21662185   Strand: +
>XM_004851640.1
ATGTGGACACCCCTTCCCACCCTCCCCATCCTCTGGCTTGCTCTGGCCTGGGGCTCAGTCAGTGCTACTTTGTCAAAGTCAGATGCCAGAAAAGCTGCCTCAAAGACACTACTGGAAAAGACACAATTTTCAGATAAGCCCGTCCAAGAGCGGGATCTGGTGGTGACAGACTTCAAAGCTGAAGATGTGGTCCTCGAGCATCGCAGCTACTGCTCCGCAAAGGCACGGGAGAGGAACTTCACTGGGGCTGTCCTGGGCTATGTCACTCCCTGGAACAGCCACGGCTATGACGTGGCCAAGGTCTTCGGGAGCAAGTTCACGCAGATCTCACCCGTCTGGCTACAGCTGAAGAGGCGTGGCCGGGAGATGTTTGAGGTCACAGGCCTCCACGATGTGGACCAAGCTGGGTCTCCCGGCTTGGGACTGCTCCAGCACGTGGCTTCTCCACCATGTCCCACAGGTTGGATGCGAGCTGTGAGGAAACACGCCAAAGGCCTGCACATAGTGCCTCGTCTTCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGCGAGGATGAGATAGAAGAGCTCAGCAAGACTGTGGTCCAGGTGGCAAAGAACCAGCACTTTGATGGCTTCGTGGTGGAGGTGTGGAGCCAGCTGCTGAGACAGAAGCACGTGGGCCTCATCCACATGCTCACTCATGTGGCAGAAGCGCTGCACCAGGCTCGGCTGCTGGCCATTCTAGTCATCCCTCCCTCTGTCACCCCAGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCAGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGTCGCAGCAGCCTGGCCCCAATGCACCGCTGTCATGGGTTCAAGCCTGTGTCCAGGTCCTGGACCCCAAGTCCAGGTGGCGGAGCAAGATTCTCCTGGGGCTGAACTTCTACGGCATGGACTATGCAGCCTCCAAGGATGCCCGTGAGCCTGTCATCGGAGCCAGGGCTGGGGGACACTTGGCTGAGCAGAATGTGGCCCCATGCACCTGGCCAGGCATCGTGGGCACCTTGGCGGTTGGCTGCTCCCACGCAGGTGAGCGCCAGATGTAG

XM_004851649.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X8

Length: 1074 bp    Location: 21678921..21666622   Strand: -
>XM_004851649.1
ATGGCGCGCGGGTGCCTGCAGGGCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTTTTCTGGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851655.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X14

Length: 882 bp    Location: 21678921..21666622   Strand: -
>XM_004851655.1
ATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851654.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X13

Length: 882 bp    Location: 21672095..21666622   Strand: -
>XM_004851654.1
ATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTGTGAGTGCTGAGGGATTTGGGGAGTTGGAGCACTGGTGGGACCCTCACCTAGAGGCAGGGCACTGGGCCTGGGCCGTCCCTGAGCCAGACCCCACCTGCCCGCAGTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851646.1 Coding sequence

Tspan4 tetraspanin 4, transcript variant X5

Length: 1197 bp    Location: 21669705..21666622   Strand: -
>XM_004851646.1
ATGACAGGCAGGGTGGCGTGCTGGCTGCTCAGAGGGGCCGAGACGCCAGGGAAGGCACCCATGGCCAAGCTGCCTTGGGCCGGGGTTGGTCCCCAGTGCTCTGTGGGCTTGTGCCAACCTGGCTGTGCACAGAACATGGGGTGGGCTCCCAGGCGACCAGCAAGCCTGCGACAGCCGCCACGTCCTGCCTCTGGCCAGGCCGTGTCCCGAATGCCGAGGGGCATGGCAGCTGCTCCTCCAGGGTACCTCACCCTGTCCCCATCCCTGTCCCCCACTGGTGCTGCCGTCCAGCTGGGAGGCTGTGGTGTCCTGGGCGTTGGGATCTGGCTGGCTGCCACACAGGGGAACTTTGCCACCCTGTCGTCCTCCTTTCCATCCCTGTCGGCTGCCAACCTGCTCATTGTCAGTGGCACCTGCGTCATGGCCATTGGCTTCGTGGGATGCATCGGGGCCCTCAAGGAGAACAAGTGCCTGCTGCTCACTTTCTTTGTGCTGCTGCTGCTGGTGCTCCTGCTGGAGGCCACCATCACCGTGTTCTTCTTTGCCTATACTGACAAGATCGATAGTTATGCTCAGGAAGACCTGAAGAAGGGCCTGCACCTGTACGGCACACCAGGCAACGTGGGGCTCACCAACGCCTGGAGCATCATCCAGACTGATGTGAGGCAGGCAGGTGCTTCGGGGCGGGGTAGCAGCTGCCCTGCTTTCTCCCACCTCAGCCAACCCTGCTCTCCCCAGTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTTGAGGTGTACAACACCACGCGTGTACCTGACTCCTGCTGTCTGGAGTTCAGTGACAGATGCGGGCTGCATGCGCCTGGCACGTGGTGGAAGGCGGTAAGTACAACCCAGAGAGGGGATTTTGTGGGGGCCAGGGTGGCCACTGACCCCACTCTCCTGCAGCCCTGCTATGAGACGGTGAAGGCCTGGCTCCAGGAGAACCTGCTGGCTGTGGGTGTCTTCGGGCTGTGCACGGCACTGGTGCAGGTGTGTGGGGCTGGGCACACACACCCTTGTGACAGGGTGGGGTTAAGCATGGGTCAGAGGAGTGAGTCCTGGACAGAGGTGGCCTCCAGTGTCTCCAGGTGCAGAGCCCCTGTGCCCTCTGGGAGCCCCGGGCTGGCTGCCTGGGGTCTCGGGACTGGGGGGGCAGCCCAGCCTTAG

XM_004851669.1 Coding sequence

Cd151 CD151 molecule (Raph blood group), transcript variant X1

Length: 969 bp    Location: 21686145..21681741   Strand: -
>XM_004851669.1
ATGGGTGAGTTCAACGAGAAACAGACGCCTTGCGGCACAGTCTGCCTCAAGTACCTGCTGTTCACCTTCAACTGCTGCTTCTGGCTGGCTGGCCTGGCTGTCATGGCAGTGGGCATCTGGACACTGGCTCTCAAGAGTGACTACATCAGCCTGCTGGCCTCAAGCACCTACTTGGCCACGGCCTACATCCTGGTGGTGGCTGGTGTTGTCGTCATGGTGACTGGGGTCCTGGGCTGCTGTGCCACCTTCAAGGAGCGGCGGAACTTGCTGCGCTTGTACTTCATCCTGCTCCTCATCATCTTCCTGCTGGAGATCATTGCAGGGGTCCTGGCCTATGTCTACTATCAGCAGCTGAACACAGAGCTCAAAGAGAACCTAAAGGACACCATGACTAAGCGGTACCACCAGCCAGGCCATGAGGGTGTGACCAGTGCAGTGGACAAACTGCAGCAGGAGTTTCATTGCTGCGGTAGCAACAACTCTCAGGACTGGCGGGATAGTGAGTGGATCCACTCCGGCCAGGCAGGCAAACGCGTGGTCCCCGACAGCTGCTGCAAGACTGTGGTGCCTGACTGTGGGAGGCGGGATCATGCCTCCAACATCTACAAGGTGGAGGTAGGTGGGCACCTGGAGCAGGGGGTGGTCCAGACCCACAGGCCGGAGCTCACTTTCTCCATCTCAACTCACCTGTCAGGGGGGCTGTATCACCAAGCTGGAAACCTTCATCCAGGATCACCTGAGGGTCATTGGAGCTGTGGGCATTGGCATTGCCTGTGTGCAGGTTTGAGCATGGGGGTGACAGTGGGGGGTGGTGGTGGCTGGCAGCCGAGGTGCCCACTCATGCCCACCTGGCTGTGCACAGGTCTTCGGCATGATATTTACCTGCTGCTTGTACCGGAGCCTCAAGCTGGAGCACTACTGAGCCCCAGCGTCTGGCCTACCTCCTGCCATGACCGACTACTGAACTGA

XM_004851670.1 Coding sequence

Cd151 CD151 molecule (Raph blood group), transcript variant X2

Length: 888 bp    Location: 21684265..21681741   Strand: -
>XM_004851670.1
ATGGGTGAGTTCAACGAGAAACAGACGCCTTGCGGCACAGTCTGCCTCAAGTACCTGCTGTTCACCTTCAACTGCTGCTTCTGGCTGGCTGGCCTGGCTGTCATGGCAGTGGGCATCTGGACACTGGCTCTCAAGAGTGACTACATCAGCCTGCTGGCCTCAAGCACCTACTTGGCCACGGCCTACATCCTGGTGGTGGCTGGTGTTGTCGTCATGGTGACTGGGGTCCTGGGCTGCTGTGCCACCTTCAAGGAGCGGCGGAACTTGCTGCGCTTGTACTTCATCCTGCTCCTCATCATCTTCCTGCTGGAGATCATTGCAGGGGTCCTGGCCTATGTCTACTATCAGCAGCTGAACACAGAGCTCAAAGAGAACCTAAAGGACACCATGACTAAGCGGTACCACCAGCCAGGCCATGAGGGTGTGACCAGTGCAGTGGACAAACTGCAGCAGGAGTTTCATTGCTGCGGTAGCAACAACTCTCAGGACTGGCGGGATAGTGAGTGGATCCACTCCGGCCAGGCAGGCAAACGCGTGGTCCCCGACAGCTGCTGCAAGACTGTGGTGCCTGACTGTGGGAGGCGGGATCATGCCTCCAACATCTACAAGGTGGAGGTAGGTGGGCACCTGGAGCAGGGGGTGGTCCAGACCCACAGGCCGGAGCTCACTTTCTCCATCTCAACTCACCTGTCAGGGGGGCTGTATCACCAAGCTGGAAACCTTCATCCAGGATCACCTGAGGGTCATTGGAGCTGTGGGCATTGGCATTGCCTGTGTGCAGGTCTTCGGCATGATATTTACCTGCTGCTTGTACCGGAGCCTCAAGCTGGAGCACTACTGAGCCCCAGCGTCTGGCCTACCTCCTGCCATGACCGACTACTGAACTGA

XM_004851662.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X6

Length: 1476 bp    Location: 21690235..21686826   Strand: -
>XM_004851662.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGTGAGCCCCGGGCTCGGGACCCAGCCACCAGGGCTGGCCCAGCGCTCACCTGCTCTCTGCCTGGTCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGGAGCTGAACACACGGCTGCGGGACGAGAGGGACGCCTGTGAGGCCGGGCTGCTGGGCACCAGCCACAGGAAGGCCCTGGACACCGCGGGCCTGCCGGGACCCGCCTGCTGCTGCTGGGCTCGGCCACCCCGACGCGGCTCTGGCCACCTGCCCAGTGCCCGGTGA

XM_004851659.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X3

Length: 1545 bp    Location: 21690235..21686956   Strand: -
>XM_004851659.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGTGAGCCCCGGGCTCGGGACCCAGCCACCAGGGCTGGCCCAGCGCTCACCTGCTCTCTGCCTGGTCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGGTGGGACCCCACTGCCTCTGCCTGCCCAGAGTCCCGCCCTCTCCGAGCCTCGGACCCCGCCTGCGGATCTTCTCAGCAGGGCGCCAAGGCTCAGGTGCCTCGTGCGCTCCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGTGCGCGGGAGGCCCGGCCGCTCCCCTCCCAGCCCAGCCCCGGGCCCAGTCCTCTGCACTCGTCACACCCCCATCCCCAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGGAGCTGAACACACGGCTGCGGGACGAGAGGGACGCCTGTGA

XM_004851664.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X8

Length: 1464 bp    Location: 21690235..21687037   Strand: -
>XM_004851664.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGGTGGGACCCCACTGCCTCTGCCTGCCCAGAGTCCCGCCCTCTCCGAGCCTCGGACCCCGCCTGCGGATCTTCTCAGCAGGGCGCCAAGGCTCAGGTGCCTCGTGCGCTCCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGTGCGCGGGAGGCCCGGCCGCTCCCCTCCCAGCCCAGCCCCGGGCCCAGTCCTCTGCACTCGTCACACCCCCATCCCCAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGTGCGCTCAGGCCCGGCCCGGAGGGGCTCCCGGATGCGGATGCTCTCGGCCTCCGCCCCACGCTGCTGGGAGCAAGGCCTTCCTGGGTCTGCCCTCTTCTGGGCTGAGGGAGCGGGGCCCACCTTCCCCCATCCTCCCTAA

XM_004851666.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X10

Length: 1284 bp    Location: 21690235..21687037   Strand: -
>XM_004851666.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGTGAGCCCCGGGCTCGGGACCCAGCCACCAGGGCTGGCCCAGCGCTCACCTGCTCTCTGCCTGGTCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGTGCGCTCAGGCCCGGCCCGGAGGGGCTCCCGGATGCGGATGCTCTCGGCCTCCGCCCCACGCTGCTGGGAGCAAGGCCTTCCTGGGTCTGCCCTCTTCTGGGCTGAGGGAGCGGGGCCCACCTTCCCCCATCCTCCCTAA

XM_004851658.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X2

Length: 1551 bp    Location: 21690235..21687037   Strand: -
>XM_004851658.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGTGAGCCCCGGGCTCGGGACCCAGCCACCAGGGCTGGCCCAGCGCTCACCTGCTCTCTGCCTGGTCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGTGTGCTGGCCGATTCCGCAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGTGCGCGGGAGGCCCGGCCGCTCCCCTCCCAGCCCAGCCCCGGGCCCAGTCCTCTGCACTCGTCACACCCCCATCCCCAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGTGCGCTCAGGCCCGGCCCGGAGGGGCTCCCGGATGCGGATGCTCTCGGCCTCCGCCCCACGCTGCTGGGAGCAAGGCCTTCCTGGGTCTGCCCTCTTCTGGGCTGAGGGAGCGGGGCCCACCTTCCCCCATCCTCCCTAA

XM_004851661.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X5

Length: 1512 bp    Location: 21689582..21687037   Strand: -
>XM_004851661.1
ATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGTGAGTGGCGTGGCAGCGGCCTGGGCCTGGGCCGATTCTCTGCCTGTGGCCTGCAGCCCTGGGCCTCACCAGGCTGGGCCAGGCCCAGCCGCCCCGGGCTATCTGCTGGGAGCGCCCGGGGCGTGATTTCCTGCAGAATTTGCATCTCGGGCAGCTTCAGCCGTGGGTGGGGCGGGCAAGGGGTCGCACACAGGCCCAGGAGGGATCGGCGCCCGGGTGGAGAGAGCCTGTCCGGCCGCGGGCCTCACCCTGTTGCCCGGTGCAGGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGGTGGGACCCCACTGCCTCTGCCTGCCCAGAGTCCCGCCCTCTCCGAGCCTCGGACCCCGCCTGCGGATCTTCTCAGCAGGGCGCCAAGGCTCAGGTGCCTCGTGCGCTCCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGCTGGAGCAGCAGCTGCAGGCTAGGGAGGCCGAGCAGCAGGAGGCACAGGCCCACCACTCGCAGCTTCGGGGCGCCTTCGAGGCGCTGCGCGCGCAGCTGGAGGGGGCGCAGAAGCAGCTCCGCCGGCTGGAGGGCGAGGCGCAGGCCCGCCGCGAGCAGATGCAAAGGTGCGCGGGAGGCCCGGCCGCTCCCCTCCCAGCCCAGCCCCGGGCCCAGTCCTCTGCACTCGTCACACCCCCATCCCCAGGGACGTGATCGTGGTCTCCAGGAACATGCAGAAGGAGAAGCTCAGCCTCCTGCGGCAGCTGGAGCTTCTCAGGTGCGCTCAGGCCCGGCCCGGAGGGGCTCCCGGATGCGGATGCTCTCGGCCTCCGCCCCACGCTGCTGGGAGCAAGGCCTTCCTGGGTCTGCCCTCTTCTGGGCTGAGGGAGCGGGGCCCACCTTCCCCCATCCTCCCTAA

XM_004851667.1 Coding sequence

Efcab4a EF-hand calcium binding domain 4A, transcript variant X11

Length: 1203 bp    Location: 21690235..21687481   Strand: -
>XM_004851667.1
ATGGCAGAGGCGTGTGACTATGGGTGGGGCTCATTGGAGGATGTGGAGGAGGCGCAGGAGGATCCGGGACTAGACTGGAGGGACAAGTCAGGGGAGGAGGTGGCACCAGTCTGCCCCTCACAAGGGCTCCTGCAATCAGCCCTGGAGACAGATGTCCCAGCTCTCGCCCTGCACTGCTTCACCCTAGGCTGCAGCTGTCCTCCAGCCCACCGTCCCCATGGCCAGCCCTGGGAAGCCCGGGGCTGTGGAGGCCCAGGAGGAGGAAGAGGGGGAGGAGCCCTCTGCAGGACATGGTGGAGCAGTGCTGCAGCAAGCCCACGAGCTCTTTTTGCTGTGCGACAAGGAGGCCAAGGGCTTCATCACCCGGCAGGACCTGCAGGTGAGCCCCGGGCTCGGGACCCAGCCACCAGGGCTGGCCCAGCGCTCACCTGCTCTCTGCCTGGTCAGGGCCTGCAGAGTGATCTGCGCCTGACCCCGGAGCAGCTGGAGGCCGTATTCGAGAGCCTGGACCAGGCCCACGCTGGCTTCCTCACTGCCCGAGAGTTCTGTCTGGGCCTGGGGAGGTTTGTGGGCCTGCAACCGGCTGGGGGAGCGACCTTCTTGCCAACTCCCGAGGAAACCTTCGAGTCGTCAGATGTGCGAGGCCCCGGGGACTCCCTGGAGGAAGAGGAAGATGAGGAGGATGTGGAGCGGTTCTGCGCCGTGCTGGAGCAGCTGGGGGTGGCCCGGGTTCTGGGCGAGCAGCGCGCCGTGAGGACGCTCTGGGCCCGGCTACAGCTCGAGCGGCCAGAGCTGCTGGGCTCCTTCGAGGACGTCCTGCTGCGTGCGTCCGCCTGCCTGGAGGCTGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGCGGCGGGAGAGTGAGCACGAGCGGGAGGTTCGCGGCCTCTATGAAGAGCTGGAGCAGAACCTGCAAGGGCCTCGACCGCGAAGGCGGAGCCAGAACCCGCCCCGCGAAGAGCCGAGGGGCCGCCTGGAGCTGGAGCTGCAGAGCCGCGAGCAGGAGCTGGAGCGCGCGGGGCTGCGGCAGCGGGAGGTGAGCGCCCCCCCCCTCCCCGCTCACCCCGGCTTCGCGTCGTCTACCCCTAGCTGCGGGGCTGGCGATGCACACGGGCCTCTCGGCAGTGTGCTGGCCGATTCCGCAGCTGGAGCAGCAGCTGCAGGCTAG

XM_004851675.1 Coding sequence

Pnpla2 patatin-like phospholipase domain containing 2, transcript variant X4

Length: 1479 bp    Location: 21697009..21692017   Strand: -
>XM_004851675.1
ATGTTCCCCCGGGAGACGAAGTGGAACATCTCGTTCGCGGGCTGCGGCTTCCTCGGCGTTTACCACATCGGCGTGGCTTCCTGCCTCCGCGAGCACGCGCCCTTCCTGGTGGCCAACGCCACGCACATCTATGGCGCCTCGGCTGGCGCCCTTACGGCCACGGCGCTGGTCACCGGGGCCTGCCTGGGCGAGGCAGGTGCCAATATCATTGAAGTGTCCAAGGAGGCCCGAAAGAGGTTCCTAGGCCCCCTGCACCCCTCCTTCAACCTGGTGAAGACTATCCGGGGCTGCCTACTGAAGACCCTGCCTGATGATTGCCACGAACGCGCCAGTGGGCGCCTGGGCATCTCCCTGACTCGGGTATCGGATGGCGAGAATGTCATCATCTCCCATTTCAACTCCAAGGATGAGCTCATCCAGGCCAATGTCTGCAGCACCTTCATCCCTGTGTACTGTGGCCTCATCCCTCCCTGCCTCCAAGGGGTGCGCTATGTGGACGGCGGCATTTCAGACAACTTGCCACTCTATGAGCTTAAGAACACCATCACTGTGTCCCCGTTCTCGGGCGAGAGTGACATCTGTCCCCAGGACAGCTCCACCAACATCCATGAACTGCGGGTCACCAACACCAGCATCCAGTTCAACCTGCGCAACCTCTACCGCCTCTCCAAGGCCCTCTTCCCCCCAGAGCCCATGGTGCTTAGAGAGATGTGCAAGCAGGGCTACAGGGACAGCCTGCGCTTCCTGAGGCGGAACGGCCTCCTGAACCGGCCCAACCCCCTGCTGGCGCTGCCCGCCACCCGAGGACGTGGGGAGGAAGACAGGGAGGAGGCCAGCGGGGGCGTAGAGAGCAGCGGCACTGAGGAGCGACTGCTGCCACCCGGTGAAGACCACATCCTGGAGCATCTGCCCTCGCGGCTCAATGAGGCCCTGCTGGAGGCTTGCGTGGAGCCCAGGGACTTGATGACCACACTGTCCAACATGCTGCCTGTGCGGCTGGCCACAGCCATGATGCTGCCCTACACTCTGCCGCTGGAGAGTGCGGTGTCTTTCACCATCCGCCTGCTGGAGTGGTTGCCTGATGTGCCCGAGGACATCCGGTGGATGAAGGAACAGACGGGGAGCATCTGCCAGTATCTGGTGATGCGCACCAAGAGGAAGCTGGGCAGTCACCTGCCCTCCAGGCTGTCTGAGCCCACTGAGCTTCGTCGAGCTCGGTCATTACCCTCGGTGCCGCTGTCCTGCGCTAGCTACTGGGAGGCACTGCCCAGCTGGGTGCGCAGCAACCTCTCCTTGGGTGATGCGCTGGCCAAGTGGGAGGACTGCCAGCGCCAGCTGCTGCTGGGTCTCTTCTGCACCAACGTGGCCTTCCCACCGGATGCCCTGCACATGCGCCTGCCCGCGGACCCGAAGCCTGCGGACCCCAGGGCTCTTGACCCCAGGCTCCCCCAGCACCCACCAGGCCTGCCCCCATGCTGA

XM_004851681.1 Coding sequence

Slc25a22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22, transcript variant X1

Length: 972 bp    Location: 21712300..21717724   Strand: +
>XM_004851681.1
ATGGCTGATAAACAGATCAGCCTGCCAGCCAAGCTCATCAATGGTGGCATTGCTGGACTAATCGGGGTCACCTGCGTGTTCCCCATCGACCTGGCCAAGACGAGGCTGCAGAACCAGCAGAATGGCCAGCGCATGTACTCCAGCATGTCTGACTGCCTAATCAAGACCATCCGCTCGGAGGGCTACTTCGGCATGTATCGAGGAGCTGCTGTGAACCTGACCTTGGTCACCCCAGAGAAAGCCATCAAGCTGGCAGCTAATGACTTCTTCCGGCATCAGCTTTCGAAGGACGGGCAGAAGCTGACCCTGCCTAAAGAGATGCTGGCAGGCTGTGGGGCTGGCACCTGCCAAGTGATTGTCACCACCCCCATGGAGATGCTGAAGATCCAGCTCCAGGATGCAGGCCGAGTTGCTGCCCAGAAGAAGATTCTGGCTGCCCAGGCCCAGCTCTCGCCCCAGGCGGGGGCCCCACCTTCTGTGGAGGCTCCTGCTGCACCCCGGCCCACGGCCACTCAGCTGACTCGAGACCTACTGCGGAGCCGTGGCATCGCTGGTCTCTACAAGGGACTGGGGGCCACGCTACTCAGGGATGTCCCCTTCTCCATCGTCTACTTCCCCCTGTTTGCCAACCTGGACCAGCTGGGCCGCCCGGCATCTGAGGAGAAGTCGCCCTTCTACATATCCTTCCTGGCTGGCTGTGTAGCTGGAAGTACAGCCGCTGTGGCTGTCAACCCCTGTGATGTGGTGAAGACCCGGCTGCAGTCACTGCAGCGGTGTGTCAATGAAGACACTTACTCTGGGTTTCTGGACTGTGCCAGGAAGATCTGGCGCCACGAGGGCCCCTCCGCCTTCCTGAAGGGTGCTTACTGCCGCGCACTGGTCATCGCTCCACTGTTCGGCATCGCACAGGTGGTCTACTTCCTGGGCATTGCCGAGTCCCTGCTGGGGCTACTGCAGGACCCCCAGGCCTGA

XM_004851684.1 Coding sequence

Slc25a22 solute carrier family 25 (mitochondrial carrier: glutamate), member 22, transcript variant X4

High confidence: 3 potential gene matches
Length: 972 bp    Location: 21712300..21717724   Strand: +
>XM_004851684.1
ATGGCTGATAAACAGATCAGCCTGCCAGCCAAGCTCATCAATGGTGGCATTGCTGGACTAATCGGGGTCACCTGCGTGTTCCCCATCGACCTGGCCAAGACGAGGCTGCAGAACCAGCAGAATGGCCAGCGCATGTACTCCAGCATGTCTGACTGCCTAATCAAGACCATCCGCTCGGAGGGCTACTTCGGCATGTATCGAGGAGCTGCTGTGAACCTGACCTTGGTCACCCCAGAGAAAGCCATCAAGCTGGCAGCTAATGACTTCTTCCGGCATCAGCTTTCGAAGGACGGGCAGAAGCTGACCCTGCCTAAAGAGATGCTGGCAGGCTGTGGGGCTGGCACCTGCCAAGTGATTGTCACCACCCCCATGGAGATGCTGAAGATCCAGCTCCAGGATGCAGGCCGAGTTGCTGCCCAGAAGAAGATTCTGGCTGCCCAGGCCCAGCTCTCGCCCCAGGCGGGGGCCCCACCTTCTGTGGAGGCTCCTGCTGCACCCCGGCCCACGGCCACTCAGCTGACTCGAGACCTACTGCGGAGCCGTGGCATCGCTGGTCTCTACAAGGGACTGGGGGCCACGCTACTCAGGGATGTCCCCTTCTCCATCGTCTACTTCCCCCTGTTTGCCAACCTGGACCAGCTGGGCCGCCCGGCATCTGAGGAGAAGTCGCCCTTCTACATATCCTTCCTGGCTGGCTGTGTAGCTGGAAGTACAGCCGCTGTGGCTGTCAACCCCTGTGATGTGGTGAAGACCCGGCTGCAGTCACTGCAGCGGTGTGTCAATGAAGACACTTACTCTGGGTTTCTGGACTGTGCCAGGAAGATCTGGCGCCACGAGGGCCCCTCCGCCTTCCTGAAGGGTGCTTACTGCCGCGCACTGGTCATCGCTCCACTGTTCGGCATCGCACAGGTGGTCTACTTCCTGGGCATTGCCGAGTCCCTGCTGGGGCTACTGCAGGACCCCCAGGCCTGA

XM_004851687.1 Coding sequence

Cend1 cell cycle exit and neuronal differentiation 1, transcript variant X2

High confidence: 3 potential gene matches
Length: 453 bp    Location: 21718169..21720907   Strand: +
>XM_004851687.1
ATGGAGTCCAGGGCAAAGTCGGCCAGCAGTCCCAAGCCAGACACCAAGGTGCCTCAGGCCACCACTGAGGCCAAGGCCGCTCCAGCTGCTGATGGAAAAGCCCTCTTGACCAAGACCGGGAAGAAGGAGGCCCAAGCCGAGAAGCAGGAGCAGCCGGCAGCCCCTGCTTCTGCCAAGAAGGCCCCAGCCAAGGCTGATCCTGTCCTTCTCAACAACCACAGCAACCTGAAGCCGGCCTCCACAGCTCCTGCTGTCCCTAGCAGTCCTGATGCAACCCCAGAGCCCAAGGGTCCTGGGGATGGGGCGGAGGAGGACGAGTCCACCACCAGGGGCTCAGGGGGCCAAGATCCTTGGCCCTGTGAGAACTTCACACCCCTGCTGGTGGTTGGGGGGGTGGCTGTGGCAGCAGTGGCCCTAATTCTTGGTGTGGCCTTCCTGGCCCGGAAAAAATGA

XM_004851690.1 Coding sequence

Pddc1 Parkinson disease 7 domain containing 1, transcript variant X1

Length: 663 bp    Location: 21751257..21758917   Strand: +
>XM_004851690.1
ATGGCGTCGGAGCGTCTGCCCAGCCGGCCCGCCTGCTTGCTCGTGGCCAGCGGCGCTACCGAAGGTGTGTCAGCCCAGTCCTTCCTCCACTGCTTCACACTGGCCAGTGCCACCTTCAACTTGCAGGTGGCCACCCCTGGGGGGAAGGCCATGGACTTTGTGGATGTGACTGAGAGCAATGCACGCTGGGTTCAAGACTTCCGTCTCAAGGCCTACGCCAGCCCTGCCAAGTTGGAGTCTATCGATGGTGCCCGCTACCACGCCCTCCTGATCCCCAGCTGTCCTGGTGCCCTGGCTGACCTGGCCAACAGTGGGTCCCTGGCCCGCATCCTGCAGCACTTCCGGTCTGAGAGCAAGCCTATCTGTGCCATTGGCCACGGTGTTGCCGCTCTGTGCTGTGCCACCAGCGAGGATAGGTCCTGGGTGTTCCATGGCTACAGCCTGACAGGGCCCTCTGTATACGAGCTCGTCAGGGCCCCTGGCTTCGCCCGGCTGCCACTGGTCGTGGAGGACTTCGTGAAGGACTCTGGTGCTGGCTTTAGTGCCAGCGAGCCTGATGCTGTGCACGTTGTGCTGGACCGCCACCTGGTCACCGGGCAGAATGCCAACTCCACTGTTCCTGCTGTACAGAACCTGCTGTTCCTCTGTGGCAGCCGGAAATAA

XM_004851692.1 Coding sequence

Pddc1 Parkinson disease 7 domain containing 1, transcript variant X3

Length: 558 bp    Location: 21751257..21755786   Strand: +
>XM_004851692.1
ATGGCGTCGGAGCGTCTGCCCAGCCGGCCCGCCTGCTTGCTCGTGGCCAGCGGCGCTACCGAAGGTGTGTCAGCCCAGTCCTTCCTCCACTGCTTCACACTGGCCAGTGCCACCTTCAACTTGCAGGTGGCCACCCCTGGGGGGAAGGCCATGGACTTTGTGGATGTGACTGAGAGCAATGCACGCTGGGTTCAAGACTTCCGTCTCAAGGCCTACGCCAGCCCTGCCAAGTTGGAGTCTATCGATGGTGCCCGCTACCACGCCCTCCTGATCCCCAGCTGTCCTGGTGCCCTGGCTGACCTGGCCAACAGTGGGTCCCTGGCCCGCATCCTGCAGCACTTCCGGTCTGAGAGCAAGCCTATCTGTGCCATTGGCCACGGTGTTGCCGCTCTGTGCTGTGCCACCAGCGAGGATAGGTCCTGGGTGTTCCATGGCTACAGCCTGACAGGGGCCCACGTCCCCACAGCCCTCTGTATACGAGCTCGTCAGGGCCCCTGGCTTCGCCCGGCTGCCACTGGTCGTGGAGGACTTCGTGAAGGACTCTGGTGCTGGCTTTAG

XM_004851694.1 Coding sequence

Eps8l2 EPS8-like 2, transcript variant X2

Length: 2145 bp    Location: 21790473..21775467   Strand: -
>XM_004851694.1
ATGAGCCAGTTGGGCCCCATGAGCTGCTGCCCGGGCTCCACTAATGGCAGCCTGGGCCGGTCAGACCGTGTGGCCAAGATCAGCGCCAAGGACCTGTTCGAGCAGAGGAAGAAGTATTCCAACTCCAACATCATCATGCACGAGACCTCTCAGTACCATGTCCAGCACCTGGCCACGTTCATCATGGACAAGAGTGAGGCCATCACCTCCGTGGACGACGCCATCCGGAAGTTGGTGCAGCTGAGCTCCAAGGAGAAGGTCTGGGCCCAGGAGATGCTGCTGCAGGTCAGCGACCAGTCAGTGCGGCTGCTGGACATCGAGACGCAGGAGGAGCTGGAGAACTTCCCACTGGCCACAGTGCAGCACAGCCAGACGGTGCTCAACCAACTTCGCTACCCCTCAGTGCTGCTCCTGGTGTGCCAGGACTCCGAGCAGAACAAGCCCGACATCCATTTCTTCCACTGTGACGAGGTGGAGGCTGAGCTGGTGCAGGAGGACATCGAGAGTGCACTGGCCGACTGCCGGCTGGGGAAGAAGATGCGGCCGCAGACCCTGAAGGGACACCAGGAGAAGATCCGGCAGCGGCAGTCCATCCTGCCCCCCCTCCAGGGCCCAGCCCCCATCCCCTTCCAGGACCGGGCAGGGGACTCCCCTCATGCCAAGAACCGGGTGGGCCCCCCGGTGCCGCCCCAAGACCCAGGCTTCCGTCGCCGGGAATCGCAGGATGAGGAGCCGCGGGCGGTGCTGGCCCAGAGGATAGAGAAGGAGACGCAAATCCTCAACTGCGCCTTGGACGACATCGAGTGGTTCGTGGCCCGGCTGCAGAAGGCGGCAGAGGCTTTCAAGCAGCTGAACCAGCGGAAGAAGGGGAAGAAGAAGGGCAAGAAGGGGCCCGCAGAGGGCGTCCTCACACTGCGGGCGCGGCCCCCCTCCGAGGCCGAGTTTGTCGACTGCTTCCAGAAAACCAAGCTGGCCATCAACCTGCTCGCAAAGCTGCAAAAGCACATCCAGAACCCCAGCGCCGCGGAGCTGGTGCACTTCCTCTTCGGCCCGCTGGACCTGATCGTCAACACCTGCGGAGGCCCGGACCTCGCGCGCTCGGTCACCAGCCCTGGGCTCTCCCGCGACGCCGTGGGCTTCCTGCGCGGCCATCTGGTCCCCAAGGAGATGTCGCTGTGGGAGTCGCTGGGGGAGACCTGGACGCGGCCCCGGTCCGAGTGGCCGCGCGAGCCGCAGGTGTCCCCCTACGTGCCCCAGTTTCACAGCGGCTGGGAGCCGCCCCTGGACGTGCTGCAGGAGGCGCCCTGGGAGGTGGAGGGGCCCGCGTCGGCGCCAGAGGACCAGCCAGCCCCGGGGCGCCGACTCTCTGCGCGAAGCTCCCCAAAGAACATCCTGGGTGAGCCGACAGCCCCAGGGGATGCCCTGCCGCCAGGCAGCTCCCCCCACACTCACAGGTACCAGCCAGCGCCAGCCATGGCCAAGTACGTGAAGGTCCTCTACGACTTCACAGCGCGCAACGCCAATGAGCTCTCGGTGCAGAAGGATGAGGTCTTAGAGGTACTGGAGGACGGGCGGCAGTGGTGGAAACTGCGCAGCCGAAGCGGCCAGGCTGGCTTCGTGCCCTGCAACATCCTGGCGGAGGCCCGGCCCGAGGAGGTCGGCGCCCCCTTAGACCAGGCCGGTCAGAGATTCTGGGGACCCGCCAGCCCGACCCACAAGCTGCCCCCCACCTTCGCGGGGAGCAAGGATGAGCTGATCCACCACATGGACGAGGTGAACGACGAGCTGATGAAGAAGATTAGCCACATCAAGGTGCAGCAGTCCCGGCCCTTCCGCGTGGAGCGCAGCCAGCCTGTGCGCCTGCCGCTCACCTTCGAGTCGGGACCCGATGAGGTCCGCGCCTGGCTGGAGGCCAAAGCCTTCAGCAGCCGCATCGTGGAGAACCTGGGCATACTGACCGGGCCTCAGCTGTTCTCACTCAACAAGGACGAGCTGAAGAAGGTGTGCGGGGAGGAGGGCGTCCGCGTGTACAGCCAGCTCACGGTGCAAAAGGCTGTCCTGGAGACACAGCAGAGCGGCTCAGAGCTGGAGGAACTCATGAGCAAGTTTCATTCCAAGAGCCAGAGGAGGGTGGAGGACAGCTAG

XM_004851693.1 Coding sequence

Eps8l2 EPS8-like 2, transcript variant X1

High confidence: 4 potential gene matches
Length: 2148 bp    Location: 21781950..21776883   Strand: -
>XM_004851693.1
ATGGACTCCTTAGGGTTGGCTGGGGCCCTCAGTCCCCCGGGCTGCCTCTCCTTGGGCCTGGTGGACACAGGAGTGCCGTGCCCACCTGCCTTCCCCCAGCACCTGGCCACGTTCATCATGGACAAGAGTGAGGCCATCACCTCCGTGGACGACGCCATCCGGAAGTTGGTGCAGCTGAGCTCCAAGGAGAAGGTCTGGGCCCAGGAGATGCTGCTGCAGGTCAGCGACCAGTCAGTGCGGCTGCTGGACATCGAGACGCAGGAGGAGCTGGAGAACTTCCCACTGGCCACAGTGCAGCACAGCCAGACGGTGCTCAACCAACTTCGCTACCCCTCAGTGCTGCTCCTGGTGTGCCAGGACTCCGAGCAGAACAAGCCCGACATCCATTTCTTCCACTGTGACGAGGTGGAGGCTGAGCTGGTGCAGGAGGACATCGAGAGTGCACTGGCCGACTGCCGGCTGGGGAAGAAGATGCGGCCGCAGACCCTGAAGGGACACCAGGAGAAGATCCGGCAGCGGCAGTCCATCCTGCCCCCCCTCCAGGGCCCAGCCCCCATCCCCTTCCAGGACCGGGCAGGGGACTCCCCTCATGCCAAGAACCGGGTGGGCCCCCCGGTGCCGCCCCAAGACCCAGGTAGGCCGCGGGGCTGGTCGGGTGGCTCTCGGGGCCTAGGGGCCCTCGTCACAGCTGCTCTGTCCCCAGCAGGCTTCCGTCGCCGGGAATCGCAGGATGAGGAGCCGCGGGCGGTGCTGGCCCAGAGGATAGAGAAGGAGACGCAAATCCTCAACTGCGCCTTGGACGACATCGAGTGGTTCGTGGCCCGGCTGCAGAAGGCGGCAGAGGCTTTCAAGCAGCTGAACCAGCGGAAGAAGGGGAAGAAGAAGGGCAAGAAGGGGCCCGCAGAGGGCGTCCTCACACTGCGGGCGCGGCCCCCCTCCGAGGCCGAGTTTGTCGACTGCTTCCAGAAAACCAAGCTGGCCATCAACCTGCTCGCAAAGCTGCAAAAGCACATCCAGAACCCCAGCGCCGCGGAGCTGGTGCACTTCCTCTTCGGCCCGCTGGACCTGGTGCCTGGGGCGGGGCGGGGCGGGGCGGGGCCCGAGGCCAGGGGATGGGAGTGGGCGGGGCCAGTTGTGGGTGGGGCCGAGGAACGGGTCTGGGTGACGGGGCAGCGCCAGGCGCGCGTCTGCGTGGCCCTGTCCCCGGCCGCCCAGGGCGTGGTCCCTGCCCCGCGCCCTCCTGCAGAGCTCGGAGCTCGCACCGGCGGCTGTGTGGGCCGCGATCTGACCCGCGCTGTGCCCCAGATCGTCAACACCTGCGGAGGCCCGGACCTCGCGCGCTCGGTCACCAGCCCTGGGCTCTCCCGCGACGCCGTGGGCTTCCTGCGCGGCCATCTGGTCCCCAAGGAGATGTCGCTGTGGGAGTCGCTGGGGGAGACCTGGACGCGGCCCCGGTCCGAGTGGCCGCGCGAGCCGCAGGTGTCCCCCTACGTGCCCCAGTTTCACAGCGGCTGGGAGCCGCCCCTGGACGTGCTGCAGGAGGCGCCCTGGGAGGTGGAGGGGCCCGCGTCGGCGCCAGAGGACCAGGTCAGAGGCCGCCAGACCCGCTTCTCCCACCCTGGCCTGGGCGTCCGGCTCCTTGTCCTAGGTGTGGGCATTTTCCAAGGCCCTAACCGGGACCCCCCCGTCATTGCCCTTCTTGCCTGGTCCCCACCCCACATCAACCCCAGGCTACCACTTTCCCCACAGCCAGCCCCGGGGCGCCGACTCTCTGCGCGAAGCTCCCCAAAGAACATCCTGGGTGAGCCGACAGCCCCAGGGGATGCCCTGCCGCCAGGCAGCTCCCCCCACACTCACAGGTACCAGCCAGCGCCAGCCATGGCCAAGTACGTGAAGGTCCTCTACGACTTCACAGCGCGCAACGCCAATGAGCTCTCGGTGCAGAAGGATGAGGTCTTAGAGGTACTGGAGGACGGGCGGCAGTGGTGGAAACTGCGCAGCCGAAGCGGCCAGGCTGGCTTCGTGCCCTGCAACATCCTGGCGGAGGCCCGGCCCGAGGAGGTCGGCGCCCCCTTAGACCAGGTGCGTGCCCTGGGTGTCAGCGCCCCGTCCTGGGATTGGAATCGGCGGCCCCCACCCCCGCCTTGA

XM_004851752.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X5

High confidence: 4 potential gene matches
Length: 2184 bp    Location: 22142601..22136826   Strand: -
>XM_004851752.1
ATGGAGGACGCCCAGCCGGACCCCACCGTGTTTGCCTCCCACTCTCTGCCCAGGGACCCCCGCCTGTTGGCCACTGTGACCAACGTGTACCTGGGCACACGTGTGTACCATGACACACTGCACGTGAGCGGCGTGTACAACGGGGCCCGGGGCAGCACACACCGGGCGGTCCTGCCCAGCCCCCTTAACGTGCGGCTGGAGGCCCCCGCGGGGAAAGGAGCCCAGCTGACCCAGACCTTTGCTCTGGACACCAACACAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGGTGAGCGGGGGCCGGGTCCTGGTGGGGTGACCCCAGAGGAAGCCATCACTGAGGCACAGCCACACCTTCACAGGTACCTGTGGGGCCTCACGCTCACCCCGGAGCAGCCAGGGGGCCCCCGGCAGGAGGTGCACATGCTGTGGACGCCAGTGCCCCCTGCCCTGACCCTTGGCGAAGGCGAAGAGACTAGGACCTGGGACTTCCTGACCGTGGTGGGTGGCAGCCGGGTGGAGGCCCAGGCCTGCCTCAACGAGGCCTTACAGCTGCAGGCCACGGGCTCTCTGTACGCCATCCACATGCAGGCTTGGGCCCAGTTCTGGACGGGCTGCAGTCTGGATGTGGCAGGGCCCCTGGCTCTGTGCCAGGCTGTCCGTAGCTCTTTTTACTACCTGTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACCATGCCACCCAGGACCTGCAATTCTTCCGAGAAGCTGGTGGCTGGGACGTGGTCAGCGCTGTGGCTGAGTTTTGGTGCAGCCGGGTGGAGTGGAACCCCAAGGAGAAGAAATTCGACCTGAGAGGTGCGGGTCTGGGCAGGCGGGCAGGCCGGCAGGAGTGTGGATGTTCCTGGGCTGCCCATGCTGACTGCTGCACAATGTGCTGCGGTGGACTTATGTGCCCAGGAGTTATGCCCCCTGATGAGTACCATGCAGGAGTCGACAACTCTGTGTACACCAATGTCCTGGTCCAGAACAGCCTGCACTTTGCGGCTGCCCTGGCACGGGACCTGGGTCAGCCTTTCCCTGACAAGTGGCTGGTGGTGGCTGATGGGATCGAGGTGCCCTTTGATCCCGAGCAGAACTTCCACCCTGAGTTTGATGGGTACAAGCCTGAGCATGTTTGCTGTGGGCTGGATGGAGCTGAAGGACCCGTCACGGGCACAGAGTCTTCTGGACAGGAACATCACCAATGTCACCGAGCCCTTCAAGGTCAGCCTGTTAGCACCCTTGACCCACAGGCTGACCCCACCGGCCTCCACTCCCGCCCATGTGGTCACAGCCCGAGTTCCTCTTGCCCTTGGCAAGGCAGCCGCAGGAGGCTAGTGTGCTGGGCCTGCCACAACCACCCTCTGCAGGTGTGGACAGAGAATGCAGACGGGTCCGGGGCCGTGAACTTCCTGACAGGCATGGGAGGCTTCCTGCAGGCAGTGCTATTTGGATGTACAGGCTTCAGCTCTCCCCACAGGGTCACCTGCAGAGGTGTGACCTTTGATCCTCTGTGCCTGACGGACATCTCCAGAGTGTGTGTGTCTGGCATCTTCTACCGGGGGAACAGGCTCAACTTTACCTTCTGCAAGGACTCAGTGATGGTTGAGGTCACAGCCCAGGCATGGCCTGGGGCTCCTCAGTTGGAGGCTGAGCTGTGGCCATCAGGAGCTCAGCTCCCCCTGCTGCTGGGGCACAAGGTTTCATTTCCTTGTTCAGCTGGCCGGATACAAAGATCACTCCCATAG

XM_004851695.1 Coding sequence

Eps8l2 EPS8-like 2, transcript variant X3

Length: 1893 bp    Location: 21781950..21777640   Strand: -
>XM_004851695.1
ATGGACTCCTTAGGGTTGGCTGGGGCCCTCAGTCCCCCGGGCTGCCTCTCCTTGGGCCTGGTGGACACAGGAGTGCCGTGCCCACCTGCCTTCCCCCAGCACCTGGCCACGTTCATCATGGACAAGAGTGAGGCCATCACCTCCGTGGACGACGCCATCCGGAAGTTGGTGCAGCTGAGCTCCAAGGAGAAGGTCTGGGCCCAGGAGATGCTGCTGCAGGTCAGCGACCAGTCAGTGCGGCTGCTGGACATCGAGACGCAGGAGGAGCTGGAGAACTTCCCACTGGCCACAGTGCAGCACAGCCAGACGGTGCTCAACCAACTTCGCTACCCCTCAGTGCTGCTCCTGGTGTGCCAGGACTCCGAGCAGAACAAGCCCGACATCCATTTCTTCCACTGTGACGAGGTGGAGGCTGAGCTGGTGCAGGAGGACATCGAGAGTGCACTGGCCGACTGCCGGCTGGGGAAGAAGATGCGGCCGCAGACCCTGAAGGGACACCAGGAGAAGATCCGGCAGCGGCAGTCCATCCTGCCCCCCCTCCAGGGCCCAGCCCCCATCCCCTTCCAGGACCGGGCAGGGGACTCCCCTCATGCCAAGAACCGGGTGGGCCCCCCGGTGCCGCCCCAAGACCCAGGTAGGCCGCGGGGCTGGTCGGGTGGCTCTCGGGGCCTAGGGGCCCTCGTCACAGCTGCTCTGTCCCCAGCAGGCTTCCGTCGCCGGGAATCGCAGGATGAGGAGCCGCGGGCGGTGCTGGCCCAGAGGATAGAGAAGGAGACGCAAATCCTCAACTGCGCCTTGGACGACATCGAGTGGTTCGTGGCCCGGCTGCAGAAGGCGGCAGAGGCTTTCAAGCAGCTGAACCAGCGGAAGAAGGGGAAGAAGAAGGGCAAGAAGGGGCCCGCAGAGGGCGTCCTCACACTGCGGGCGCGGCCCCCCTCCGAGGCCGAGTTTGTCGACTGCTTCCAGAAAACCAAGCTGGCCATCAACCTGCTCGTGAGTGCGACCCTACCTGGGGCCGGCGGCGAGGGTAAAGGGTACAGGTCACCCCATCTGTCCCCCGCTCACTTGCCTTGCCCTGTCCTCGCCCCGCCAGGCAAAGCTGCAAAAGCACATCCAGAACCCCAGCGCCGCGGAGCTGGTGCACTTCCTCTTCGGCCCGCTGGACCTGGTGCCTGGGGCGGGGCGGGGCGGGGCGGGGCCCGAGGCCAGGGGATGGGAGTGGGCGGGGCCAGTTGTGGGTGGGGCCGAGGAACGGGTCTGGGTGACGGGGCAGCGCCAGGCGCGCGTCTGCGTGGCCCTGTCCCCGGCCGCCCAGGGCGTGGTCCCTGCCCCGCGCCCTCCTGCAGAGCTCGGAGCTCGCACCGGCGGCTGTGTGGGCCGCGATCTGACCCGCGCTGTGCCCCAGATCGTCAACACCTGCGGAGGCCCGGACCTCGCGCGCTCGGTCACCAGCCCTGGGCTCTCCCGCGACGCCGTGGGCTTCCTGCGCGGCCATCTGGTCCCCAAGGAGATGTCGCTGTGGGAGTCGCTGGGGGAGACCTGGACGCGGCCCCGGTCCGAGTGGCCGCGCGAGCCGCAGGTGTCCCCCTACGTGCCCCAGTTTCACAGCGGCTGGGAGCCGCCCCTGGACGTGCTGCAGGAGGCGCCCTGGGAGGTGGAGGGGCCCGCGTCGGCGCCAGAGGACCAGGTCAGAGGCCGCCAGACCCGCTTCTCCCACCCTGGCCTGGGCGTCCGGCTCCTTGTCCTAGCCAGCCCCGGGGCGCCGACTCTCTGCGCGAAGCTCCCCAAAGAACATCCTGGGTGAGCCGACAGCCCCAGGGGATGCCCTGCCGCCAGGCAGCTCCCCCCACACTCACAGGTACCAGCCAGCGCCAGCCATGGCCAAGTACGTGA

XM_004851699.1 Coding sequence

Deaf1 DEAF1 transcription factor, transcript variant X2

Length: 1716 bp    Location: 21799400..21832266   Strand: +
>XM_004851699.1
ATGGAGGACTCGGACTCGGCCGCAAAGCAGCTGGGCCTGGCCGAAGCAGCGGCGGTAGCGGCCGCGGCCGCTGTGGCGGCGGCGGCCGCGGCGGCGGCGGCGGCCGCGGCCGCAGCAGGGGACGAGGCCGAGGAGCCGGTGCTGAGCAGAGACGAGGACTCAGAGGAAGACGCAGACTCGGAGGCGGAGCGCGAGGCGCGGCGGGTCACGGCCGTGGCGGTGATGGCGGCGGAGCCCGCGCACATGGACATGGGCGCCGAGGCCCTACCAGGGCCCGACGAGGCCGCAGCCGCCGCTCCTTCTGTTGCAGAAGTTACCACGGTGACAGTAGCCAACGTGGGCGCCTCTGCAGACAATGTCTTCACAACCTCGGTGGCAAACGCTGCGTCCATCTCAGGACACGTCCTGTCCGGCAGGACCGCACTACAGATCGGGGACAGCCTGAACACCGAGAAGGCCACACTGATTGTCGTCCACACAGATGGGAGCATCGTGGAGACCACTGGGCTGAAGGGTCCAGCAGCTCCTCTCACCCCAGGCTCTCAGTCTCCTCCAACCCCACTGGCTCCCGGCCAGGAAAAAGGAGCTACCAAGTACAACTGGGACCCGTCAGTGTACGACAGCGAGCTGCCCGTGCGCTGTAGGAACATCAGTGGCACACTTTACAAGAGCAGGCTGGGCTCAGGGGGCCGGGGGCGCTGCATTAAGCAGGGGGAAAACTGGTACAGCCCGACGGAGTTTGAGGCCATGGCAGGAAGAGCCAGTAGCAAGGACTGGAAGAGAAGCATCCGCTATGCGGGCCGGCCGCTTCAGTGCCTCATCCAGGATGGGATCTTGAATCCCCATGCAGCCTCTTGCACCTGTGCAGCCTGCTGTGATGACATGACCCTGAGCGGCCCCATCCGGCTCTTCGTGCCCTACAAGAGGCGAAAGAAGGAGAACGAGCTGCCCACGACGCCCCTGAAGAAGGACTGTCCGAAGAACATCGCGCTGCTCCCGGCCGCCACTGCCACCACCTTCACCGTGACGCCCTCGGGGCAGATCACCACGTCTGGGGCCCTGACCTTTGACCGTGCGTCCACTGTGGAAGCCACTGCCGTAATCTCGGAGAGCCCAGCCCAGGGCGACGTCTTCACAGGAGCCACAGTGCAGGAGGCCAGCGTGCAGCCCCCGTGCCGCGTTGGCCACCCTGAGCCCCACTACCCCGGCTATCAGGACAGCTGCCAGATTGCACCCTTTCCTGAGGCCGCATTGCCGACGTCACACCCCAAGATAGTGCTCACATCCCTGCCCGCCCTGGCCATCCCACCCTCCACTCCCACCAAGCCTGTCTCCCCGGCATCTCTCAGTGGGCTGGAGATGGCAGAGCCGCGGAGCTGGCTCTACCTGGAAGAGATGGTCAATAATTTGCTTAACACGACGCAGCAGCTGAAGACGCTGTTTGAACAGGCCAAGCAGGCCAGCACCTGCCGAGAGGCCGCCGCCCAGGCCAGGACGCAGGCTGACGCAGAGCGGAAGGAGCAGTCGTGTGTGAACTGCGGCCGGGAGGCCCTGAGCGAGTGCACCGGCTGCCACAAGGTCAACTACTGCTCCACGTTCTGCCAGCGCAAGGACTGGAAAGACCATCAGCACATATGTGGCCAGTCGGCAGCTGTCACTGTCCAAGCTGACGAAGTGCACGTCACCGACAGCGTGATTGAGAAGGTCACCGTGTGA

XM_004851697.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 3 potential gene matches
Length: 1203 bp    Location: 21836710..21833306   Strand: -
>XM_004851697.1
ATGGGGAACCGCAGGGCCGCGGACGCGGGCTGGCTGCTGGTGGGGCGCGGGGCCAGAGCGGGGGCTGCGGGCACAGGCGGGGGGCTAGGGGGCGCGGGCGTGGTGGCGCTGGCGGGCCCCGTGTTGCTCATTGGCGCGGTCCTGGCGGGGAACTCGCTCTTGTGCATGAGCGTGGCCTCCGAGCGCGCGCTGCAGACGCCCACCAACTACTTCATCCCGAGCCTGGCGGCCGCCGACCTCCCCCTTGCGCTGCTCGTGCTGCCGCTCTTCGTCTGTGCCGAGGTCCACGGCGGAGAGTGGCTGCTGAGCCCCGGCCTCTGCGACGAGCTCATGGCTATGGACGTCATGCTCTGCACGGCCTCGATCTTCAACCTTTGCGCCATCAGCGTCGACAGGTTCGTGGCCGTGGCCGTGACTGTGCCGCTGAGCTATGGCCGGCAGGGCCGGCGTCAGCTGCTGCTCATAGGTGCCGCCTGGCTGCTGTCCGCTGCAGTGGCCGCGCCGGGGCTGTGCGGCTTCAATGACGTGCGCGGCCGCGACCCGGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCGTCCGTGTGCTCCTTCCTCCTGCCCTGCCCGCTCATGCTTCTGCTCTCCTGGGCCACCATCCGCGGACTGCGGCGCTGGGGGGCTGCCCGGCGAACCAAGCCGCACTCGCGCGCTCCCCACCGGCCCAGCGGCCCGGGTCCGCCCCCAGCACCCTGGACCCCGAGGACTCCGCGCCCGGGCCCCTGCGCGCTGGACTGCGCACCCGCTCCCGGCCTTCCCCGGGACNCTGGAAGGCGCTATGTCGCTCCAGACCCCATCCCTTACGCGGCGCTCCCGCCGCAGGTCCGCAGGAGGCGGCGCCCCAAGATCTCCAGCTGGGAACGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCGGGGCCTTCGTGCTGTGCTGGACACCTTTCTTCGTGGTGCACATCATGCGCGCGCTGTGTCCCGGGTGCTCCGTGTCCCCGCGCCCGGTCAGCGCCGTCACCTGGCTGGGCTACGTCCACAGCGCCCTCAACTCCCCCATCGTCTACACCGTCTTCAATGCCGAGTTCCGGGCCGTCTTTCACAAAGCACTGCGCCTGTGCTGCTTATCCATCTCCCGGGGATCGGCCGGCCGGCCGGGAGGGGCCGAGCCGTCATCTGATTAA

XM_004851705.1 Coding sequence

Irf7 interferon regulatory factor 7, transcript variant X1

Length: 1293 bp    Location: 21850243..21853193   Strand: +
>XM_004851705.1
ATGGCCGCGGCCCCTGAGAGGGCAGCGCAGCGCGTGCGCTTCGGAGAGTGGCTTCTGGGCGAGGTCAGCAGCGGCCGCTACGAGGGGCTGCGGTGGCTGAACGAGGCGCGCACTGTCTTCCGCGTGCCCTGGAAGCACTTCGCCCGCAAGGACCTGGGCGAGGCCGATGCACGCATCTTCAAGGCCTGGGCAGTGGCCCGAGGGAGGTGGCCACCCAGCAGCAGTGGGGGTGGCCCACCGCACCCCGAGGCTGAGGCTGCCGAACGAGCGAGCTGGAAAACCAACTTCCGCTGTGCGTTGCACAGCACGCAGCGCTTCGTGATGCTGTGGGACAACTCAGGGGACCCGGTTGACCCACACAAGGTGTATGCGCTCAGCCTGGAGAAGGGGTGCAGAGAAGGCCCAGCCATGAACCAGGAGGAGGAAGAGGCCCTCAGAACTGCCTTGCCCACACAGGTTCTGCAGCAGAGTTTCCTGGGGGACCCCCTGCTGGAAGCTGCACTGGTAGTAGCAGATCCGATCACCCTGCCACAGGCTCCTGGCACAGTGCAGCCTGAGCCGCCACCTGCAGGATGGGCAGTGGAGCCTGTGCCCTGCCCTAGGCCTCAGGCCCCAGCCCTGGCAGCAGAGTCCAGCTCAGGGGTCCTGGATGTGACCATCATGTACAAAGGGCGCACGGTGCTGCAGGCAGTGGTGGGGCACCCCAGCTGTGTGTTCCTGTACAGCCCCCCAGGCCCAGGCTGCCAGGCCCTACAGCCCCAGCAGGTAGTCTTCCCCAGCCCTGCCGAGCTGCCAGACCAGAAGCAACTGCGCTACACGGAGCAGCTGCTGCAGCACGTGGCCCCTGGGCTGCAGCTGGAGCTGTGTGGTGTGACACTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGTTGGGCAGCCCGCTGGGTTCCGCCAGCCCCTGCACCCCAGCCCGGCTGCTGGAGCGCAACTGCAACACCCCCATCTTCGACTTCAGCACCTTCTTCCGAGAGCTGGGGGAGTTCCGGGCCAGGCGGCGCCAAGGCTCACCCTACTACACCATCTACCTGGGCTTCGGGCAGGACCTGTCGGCCGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAGGTGGAGCTGAGACTGTGCCGGCTGCACCTGGAGCTTGTGCAGCGTGAGGGTACGTCCTCCCTGGACAGCAGCAGCCTGGGACTGTGCCTGTCGAGCACCAGCAGCCTCTACGACGACATCGAGCACTTCCTTATGGAGCTGGAGCAGCCAGCTTAG

XM_004851720.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1788 bp    Location: 21893028..21896751   Strand: +
>XM_004851720.1
CCTGATGGTGCAGTGAGGTGCTGGGGCTGTAGGTTAGTGCTGGAAGCCCTGGACCCCTGGACACTACGGTTGCTTTGGGAGCAGCGAGAACTGGAGATCCAGGCTCTGCGGTGGGCTATCTGGCGGGGCCAGCATGCTCGGCAGCAGCACATCCTGCAGGAGGTGGCAGGACTCCCACCTGAGAGGTCAAGCTCCCACAGCCAGGACACATTCCTGCAGAACCAGGTCCAGAAGCTGACTGTGGAGCTGAGAGCACAGAAGGAACAAGCCCAGCTGGAGAGGGAGTGCTTAGAGGCACAGCTGGCACAGACCATGGACAAGCTGCAGCAACTGGAGGCTGAGCTGCAGGCCTTCCAGAAGTCCTGCCTCCTGCATTTAGCCCAGTCCTCCTGGCTGGGCCGCATCCTGTGGTCCCAGACAGGCAGTGTGGAGGTGATCACCACAGACACTCTAATGGAGCCTGGGGACTCCTCCGAGGGTGATCAGAAGCCCACTGCTGGGGAGGGCTTCCAGATGGAGGATGTAGATTGGAACAGCATTGCTCAGCGGTACCCCAACCTTCTCACCAGCATCCATTCCAGCTCAGAGCAAAAGCAGCCCCAGCTGCCCTCAGGGCTGGACTCACCAGGCTCAGACTCCCCCTGCCAGCTTGTGGAGAGGCAGCACAAGAGCCTGGAGTGGAGCACTCTGCCCTTGGAGGGCACTAGCAGCTCGGGCATTGCCAGCTTGGACTCCAGCAGCCGCCAGCTGGTCCTGCATCCCTGGGTGCAGAAGGTGATAGGGCACCCGCCACCGGCAGCAGACGCTGCCTCTTCTGAACAGATCGAAGTGTTGGCAAAGAGCTTCAGTGGAGACTCTGAAGATCTCCGGAAATGCGTTCCCACCAGTTCGGCCAGCTCTCCCTGGAGCCCGGGGCAGACCTCTGCCCCCCTGCGCCGGGCACACACCGAGGTGAGGGGCAGTCCAGCCAGAGCGGGTCGGGAGGGCATGAGGGCAGGGCGGAGTCTGCACAGCACCCGCTCCCGCCCTAGCCGGGCCTGTGGCAGCCTGCAAATCGTGGCTGTCAGTCACCGGGAGAAGTTCCTGGGCATCCTCAACTGCTCATCACCGGACACGGCAGACCTGGGTGGCTTGGTGCTGCGGCAGCGGGTGTGGGACTGTCTGGTGCACATGTTCCGCTTCCCCCCANGCACGATGCTGGAGCCTCGGCACCACCTCACGGTGTGGGGAGAAGGCACCGGGGGCATCCAGCAGCAGCCGCCCTTGTCCTCCGGCCAGGACCCCCTCCAATTCCACTGTGGCTGGGACTGTGTGACGCTCCTCCTGGATGCCGAGGGCCAGGTCCTCAGTGAGCACCAGGCGCCACTCCACGTGACCTCGGGTTTGAGCATCTTCGCCAACAACACCGACTGGTCCATTGACCGCTTCCCGCTCCCCAAGGCCGGAGCCGGACCCAATCCCGGGCATCTCCAGCGCAGACCTCAGCCCTCGAGCCAGGGCCGGGCGCCGAAGGCTGAGAAGCCTGTCCACCCGCGGGAGGTGCCAGCGCAGCCTGAGGGCGCCAAGCTCAAGATGTCCGAGCCCCTGCCTACCATCCCTGAGGCAGCGTGGAACCTGGAGCCTGGCGTACTGGGGAAGGAGTGCAGGGTCTGCGTGCGCCAGAGAGGTGTGGACCTGGGCTGCCCCATGGTAGCCCTGTCGGTACAGAGCACAGCAGAGAGCCGGTTCGGCTTCTGTTTCCTCTGTTGCCCACCCATCACCGCAGATGTGCACCTCTGGCAGGTGTAG

XM_004851723.1 Coding sequence

Rnh1 ribonuclease/angiogenin inhibitor 1, transcript variant X1

Length: 1371 bp    Location: 21945482..21956482   Strand: +
>XM_004851723.1
ATGAGTCTTGACATCCGCTGCGAGCAGCTGAGTGATGCCAGGTGGACAGAGCTTCTGCCCCTGATCCAGCAGCACCAAGTGGTCAGGCTGGAGGACTGTGGTCTCACGGAGGGGAGGTGCAAGGACATCGGCTCCGCTCTGCGGGCCAACTCAGCCCTGGCAGAGCTCAGCTTGCGCACCAACGCGCTGGGGGACGCCGGTGTGTGCCTGGTGCTGCAGGGCCTGCAGAGCCCCACGTGCAAGGTCCAGAGTCTCAGCTTGCAGAACTGTGGCCTGACGGAGACTGGCTGCCGTGTCCTGGCCAGTGTGCTGCGCTGTACTCCCACCCTTCGGGAGCTGTACCTCAGCGACAACCCCCTGGGGGACCCAGGCCTGCGGCTGCTCTCTGAGGGACTCCTGGACCCCCAGAGCTGCCTGGAGAAGCTGGAGCTGGAGTCCTGCAACCTCTCGGCTGCCAGTTGTGAGCCTCTGGCTGCCATGCTGAGGGCCAAACCCAACTTCAAGGAGCTGGTGGTGAGCAACAATTGCATCCAGGAGGCTGGCATCCGCATGCTGTGTGGGGGCCTGAAGGAGTCCACCTGTCTGCTAGAGACGCTCAGACTAGATAACTGCGGTGTCACATCAGCCAACTGCAAGGATCTATGTGATGTTGTAGCTGCCAAGCCCTCCCTGCAGGAGCTGGACCTGGGTGGCAACAGGCTGGGCGACGCAGGCATCGCAGCACTGTGCCCAGGGCTGCTGCACACCAGCTGCAGGCTCAGGAAGCTGTGGCTCTGGGAGTGCGACATCACTGCTGAGGGCTGCAGGGACCTGGGCCAGGTCCTCAGGGCCAAGCAGAGCCTGAAGGCGCTCAGCCTGATGCTCAACGAGCTGGGGGATGAGGGAGCCCGGCTGCTGTGTGAGGCCCTGCAGGAGCCCAGCTGTCAGCTGGAGTGTCTGTGGGTGCGGGTCTGCAGCTTCACAGCCACCTGCTGCCCCCACTTCCGTGCACTGCTGGCACAGAACAAGTTTCTCACGGAGCTGCAGCTGGGTGAGAACAGGCTGGGTGACGCTGGTGTGCAGGAGCTCTGCCAGGGCCTCAGCCAGCCGGGCTCTGTGCTCCGGGTGCTTGGGATAGGGGACTGCGACTTGAGTGACAACTGCTGCAGCAACCTGGCCTCAGTCCTGCTGGCCAGCTGTAGCCTGCGGGAACTGGATCTCAGCAACAATGGCCTGGGGGACCCAGGTGTCCTGCGGCTGGTGGAGAGCCTCCGGCAGCCAGGCTGCGTGCTGGAGTGCCTGCTCCTCTTCGATGTCTACCTGAGTGATGGGGTGAATGACCAGCTGCAGGCTCTGGAGGAGGAGAAGCCAACCCTGAGGATCATCTCCTGA

XM_004851724.1 Coding sequence

Rnh1 ribonuclease/angiogenin inhibitor 1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1371 bp    Location: 21945913..21956482   Strand: +
>XM_004851724.1
ATGAGTCTTGACATCCGCTGCGAGCAGCTGAGTGATGCCAGGTGGACAGAGCTTCTGCCCCTGATCCAGCAGCACCAAGTGGTCAGGCTGGAGGACTGTGGTCTCACGGAGGGGAGGTGCAAGGACATCGGCTCCGCTCTGCGGGCCAACTCAGCCCTGGCAGAGCTCAGCTTGCGCACCAACGCGCTGGGGGACGCCGGTGTGTGCCTGGTGCTGCAGGGCCTGCAGAGCCCCACGTGCAAGGTCCAGAGTCTCAGCTTGCAGAACTGTGGCCTGACGGAGACTGGCTGCCGTGTCCTGGCCAGTGTGCTGCGCTGTACTCCCACCCTTCGGGAGCTGTACCTCAGCGACAACCCCCTGGGGGACCCAGGCCTGCGGCTGCTCTCTGAGGGACTCCTGGACCCCCAGAGCTGCCTGGAGAAGCTGGAGCTGGAGTCCTGCAACCTCTCGGCTGCCAGTTGTGAGCCTCTGGCTGCCATGCTGAGGGCCAAACCCAACTTCAAGGAGCTGGTGGTGAGCAACAATTGCATCCAGGAGGCTGGCATCCGCATGCTGTGTGGGGGCCTGAAGGAGTCCACCTGTCTGCTAGAGACGCTCAGACTAGATAACTGCGGTGTCACATCAGCCAACTGCAAGGATCTATGTGATGTTGTAGCTGCCAAGCCCTCCCTGCAGGAGCTGGACCTGGGTGGCAACAGGCTGGGCGACGCAGGCATCGCAGCACTGTGCCCAGGGCTGCTGCACACCAGCTGCAGGCTCAGGAAGCTGTGGCTCTGGGAGTGCGACATCACTGCTGAGGGCTGCAGGGACCTGGGCCAGGTCCTCAGGGCCAAGCAGAGCCTGAAGGCGCTCAGCCTGATGCTCAACGAGCTGGGGGATGAGGGAGCCCGGCTGCTGTGTGAGGCCCTGCAGGAGCCCAGCTGTCAGCTGGAGTGTCTGTGGGTGCGGGTCTGCAGCTTCACAGCCACCTGCTGCCCCCACTTCCGTGCACTGCTGGCACAGAACAAGTTTCTCACGGAGCTGCAGCTGGGTGAGAACAGGCTGGGTGACGCTGGTGTGCAGGAGCTCTGCCAGGGCCTCAGCCAGCCGGGCTCTGTGCTCCGGGTGCTTGGGATAGGGGACTGCGACTTGAGTGACAACTGCTGCAGCAACCTGGCCTCAGTCCTGCTGGCCAGCTGTAGCCTGCGGGAACTGGATCTCAGCAACAATGGCCTGGGGGACCCAGGTGTCCTGCGGCTGGTGGAGAGCCTCCGGCAGCCAGGCTGCGTGCTGGAGTGCCTGCTCCTCTTCGATGTCTACCTGAGTGATGGGGTGAATGACCAGCTGCAGGCTCTGGAGGAGGAGAAGCCAACCCTGAGGATCATCTCCTGA

XM_004851725.1 Coding sequence

Ptdss2 phosphatidylserine synthase 2, transcript variant X1

Length: 1821 bp    Location: 21988617..21961756   Strand: -
>XM_004851725.1
ATGACCACCCTTTCACAGGCAATGGGCTCCTATCACAGTATCTCGGGATCGCAGCCACGAACAGCGGACACCAAGCTCCGAGAACGGTGTTCGTGTCTCTCCGGCGGCCGGGACTACGTGTGGGAGCCGACCAAAGGCAGAAAGTTTTGCGCCGGGGAGACGCCGGAAGCATACGGACGGCAGTCACCTAGCAACCAGACGGCGTCCTTCCCGGCAGGCCCTGCGCCCGGCACCCAGCGTCCCACGCGGCTCAGACGAGCACTACCAGTCCCACAATGCCCCGCAGTCCCGCCCCTCTCTGCGGAGACCCCGCGAGGCTGCGCCGCGACCCCTGCCCCGCGAGCCGCCTGCCAGTCTGTGCGGGCGGGCCGCCATGCGGAGGGCCGAGCGCAGAGCTGCTGGGGGTTTGCGGTCCGGGTCTCCGCGACCCGAGGGCCGCCGCAGCACCGAGTCCGAAGTCTACGACGACGGCACCAACACTTTCTTCTGGTGAGGGCCGGAGACGGGAGGGGGCGCCCTGCCCCAGGCGAGGGGCGAGCCCACACCTTAACTGTGCTGTTCATCCTCACCTGTGCACTGGGCTATGTGACTCTCCTGGAAGAAACACCGCAAGACACAGCCTATAACACCAAGAGAGGTATTGTGGCCAGTATTTTGGTTTTCTTATGTTTTGGAGTCACACAAGCCAAAGATGGGCCATTTTCCAGACCTCATCCAGCTTACTGGCGATTTTGGCTTTGCGTTAGTGTGGTCTACGAGCTGTTTCTCATCTTTATCCTTTTCCAGACAGTGCATGATGGCCGGCAGTTCCTAAAGTATGTGGATGCCAGGCTGGGGACACCATTGCCCGAGAGGGACTACGGAGGGAACTGCCTCATCTATGACCCAGACAACAAGACCGACCCCTTCCACAACATCTGGGACAAGCTGGACGGCTTTGTTCCTGCCCACTTTATTGGCTGGTACCTAAAGACCCTCATGATCCGGGACTGGTGGATGTGCATGATCATCAGCGTGATGTTCGAGTTCCTTGAGTACAGCCTGGAGCACCAGCTGCCCAACTTCAGCGAGTGCTGGTGGGACCATTGGCTCATGGATGTGCTGGTCTGCAACGGGCTGGGTATCTACTGCGGCATGAAGACACTGGAGTGGCTGTCTCTGAAGACGTACAAGTGGCAGGGTCTCTGGAACATCCCCACCTACAAGGGCAAGATGAAGCGCATAGCCTTCCAGTTCACGCCCTACAGCTGGGTCCGCTTCGAGTGGAAGCCAGCCTCCAGCCTGCGCCGCTGGCTGGCCGTGTGTGGCATCATCCTTGTGTTCCTGCTGGCGGAGCTGAACACCTTCTACCTGAAGTTCGTGCTGTGGATGCCCCCCGAGCACTACCTGGTCCTGCTGAGGCTGGTCTTCTTCGTGAACGTGGGCGGCGTGGCCATGCGAGAGATCTATGACTTCATGGATGATTTGAAGCCCCACAAGAAGCTGGGCCAGCAGGCCTGGCTAGTGGCAGCCATCACGGTCACTGAGCTGCTCATCGTGGTGAAGTACGACCCGCACACGCTCACCCTGTCCCTGCCCTTCTACATCTCCCAGTGCTGGACCCTCGGCTCCGTCCTGGTGCTCACCTGGACCATCTGGCGCTTCTTCCTGCGGGACATCACCTTGCGGTACAAGGAGACACAGAGGCAGAAGCAGCAGAGCGACCAGGGCAGGGCAGTCAGGAGCAGGGCAGAGCCCCCAGGGCTAGATGATGATCTGCCGGGGCCTGGGGGCCCTGTGGAGGAGGATGTCACCAAGGAGGGTGCTGCAGCTGCCTCATGA

XM_004851733.1 Coding sequence

Sigirr single immunoglobulin and toll-interleukin 1 receptor (TIR) domain, transcript variant X4

Length: 1428 bp    Location: 22007743..22015336   Strand: +
>XM_004851733.1
ATGGCAGCAGGTGAGCGGCTGTCGCAACTCAGACCTACCGAGCAGCCTCTGACTTGTGTAGGCACCCTGTCCAACCAGTCACAAGGACAGAGACAGGCCCTGCAGAGCCCTTGGTGGACCCGTCTGCTCTGTCAAGGAGCCCCATCGAGCAGAGGTGGCCCCAGAGTCCAGCCTGCCTTGAAGAGTCCCCAGCCAGAGTCCATGGCAGGTGTCTGTGACAGGGCCCCAGACTTCCTCTTCCCAGCTGAGGACCACGCCCTAGGACCTTCCCTGGGCAGTGCAGTTGCTCTGAATTGCACAGCTTGGGTGGTATCTGGGCTCCACTGCCCCCCACCTTCAGTCCAGTGGCTAAAAGATGGGCTTCCACTGGGCAACGTAAACCACTACCATGAGGATTCCTGGGTCAAGACCAACTTCTCAGAGGTGCTTGTGTCCAGTGTCCTGTGCATCAATGTGACCAATGCTGAGGACTATGGGACCTTCACCTGCTCTGTCCGAAACGTCAGCTCCTTCTCCTTCAGTCTTCAGAGAGCTGGCCCCGCAGGCCACGTGGCTGCGGTGCTGGCCGCCCTCCTGGTCTTGCTGGTCCTGCTGCTCGCGGGGCTGCTCTATGTGAAGTGTCGCCTCAACGTGCTGCTCTGGTACCAAGACACGCATGGGGAGGTGGAGATGAACGACGGGAAGCTCTACGACGCCTTCGTCTCCTACAGCGACTGCCCGGAAGACCGCAAATTCGTGAACTTCATCCTGAAGCCGCAGCTTGAGCGGCGTCGGGGTTACAAGCTCTTCCTGGACGACCGCGACATTCTGCCGCGCGCAGAGCCCTCGGCCGATCTCCTGGTGAACCTGAGCCGCTGCCGGCGCCTCATCGTGGTGCTTTCGGACGCCTTCCTGGGCCGGGCCTGGTGCAGCCACAGCTTCCGGGAGGGCTTGTGTCGGCTGCTGGAGCTGACGCGCAGACCCATCTTCATCACCTTTGAGGGCCCGCGGCGCGACCTGGCGCACCCTGCGCTGCACCTGCTGCGCCAGCACCGCCACCTGGTCACCCTGCTGCTCTGGAGGCCGGGCTCTGCGATGGCGTCCTCTGATTTTTGGAAAGAGCTGCAGCTTGCACTGCCGCGGAAGGTGCGGTACAGGCCAGTTGAGGGGGACCCCCAGACCCACCTTCAGGATGACAACGACCCCATGCTGATCATGCGAGGCCGTGCCGCTGAAGGCCGGGCTCTGGAGCAGGAGCTGGACCCTGATCCCGAGGGAGACCTGGGTGTACGAGGGCCTGTCTTTGGGGAGCCACCAGCCCCACCGCATGCCAGTGGGGTTTCGATGGGAGAGGGCCATAGCAGCGAGATGGACGTCTCCGACCTTGGCTCCCGAAACTACAGTGCCCGCACAGATTTCTACTGCTTGGTGTCTGAGGAAGACGTGTAG

XM_004851736.1 Coding sequence

Pkp3 plakophilin 3, transcript variant X1

Length: 2439 bp    Location: 22023966..22015858   Strand: -
>XM_004851736.1
ATGGAGCCCAGGACACCTCGGCCAGCAGCAGCGACCTCTGGGACGAGCCAAGGGCCTGGCGGGGGCTGGACCACCGGCAGGCCAGAGGCTGGCGTGTGCTCTCTGGCACTGCCCTCGGACCTGCAGCTGGATCGCAGGGGTGCCGAGGGCCCTGAGGCTGAGCGGCTTCGGGCAGCCCGCGTTCAGGAGCAGGTCCGAGCCCGCCTCCTGCAGCTGGGCCAGCAGCTGAGGCACAACGGGGCTGCCGAGCCTGAGGGTGCCACCGAGACCAGCAGAGGCTCATCCCGGGGTCAGTACCACATTCTGCAGGCCAGCTTCAGCTCCCGCTCCCAGGGCCAGAGTGGGGACAGAGTCTCAACCTTCCGGCCAGTCGCCAAGCCAGCGTACAGCCCGGCCTCTTGGTCCTCCCGCTCTGCTGTGGACCTGAGCTGTGGTCGGAGGCTGAGCTCTGCCCACAACGGAGGCAGTGCCTTCAGGGTGGTGGGGTACGGGAGCACCCAACCCACGCCAGCCATCCCCACTCGGCCTCTGTCCTTCCATGAGCGTGGCGGCGCTGGCAGCCGGGCTGAGTATGACACACTGTCGCTGCGCTCACTGAGGCTGGGCGCTGGGGGCCTGGACGATGGCTACAGTGTGGTGTCTGAGCAGCTGGAGCCGGCAGGTGGCTCCACCTACAGGGCCTTTGCCTATGAGCGTCAAGCCAGCTCCAGCTCGAGCCGGGCTGGGGGGCCGGACTGGCCAGAGGCTGCCGAGGGCCCCCCAAGCCGCACCATCCGGGCCCCCGCCATGCGGACCCTGCAGCGATTCCAGAGCAGCCACCGAAGCCGCGGGGGAACTGGGGCAGGGCCAGGCACAGGCCTGGAAACCGTGGCCAGGGCCCCATCTGTGCGCAGCCTGAGCCTCAGCCTGGCTGACTCAGGTCACTTGCCCGATGTGCGTGGGCTGGACAGCTACATCAGCCATCGCTCTCTGCAAAGACTCAGCAGTGGCTTCAATGACATCGACCTGCCCTCAGCAGTCAAGTACCTCATGGCCTCAGACCCCAACCTGCAGGTGCTGGGAGCGGCCTACATCCAGCACCGGTGCTATAGTGATGCAGGCGCCAAGAAACAGGCTCACAGCCTTCAGGCTGTGCCGAGGCTGGTGAAGCTCTTCAACCACGCCAATCAGGAGGTGCAGCGCCACGCCACGGGTGCTATGCGCAACCTCATCTATGACAACGCTGACAACAAGCTGGCCCTGGTGGAGGAGAACGGGATCTTCGAGCTTCTGCGGACACTTCGAGAGCAGGACGACGAGCTGCGGAAGAACGTCACAGGGATCCTGTGGAATCTGTCATCCAGTGACCACCTAAAGGACCGCCTGGCCCGTGACACACTGGAGCAGCTCACAGACCTGGTGCTGAGCCCCCTGTCAGGCGCAGGGGGGCCCCCCCTCATCCAGCAGAATGCCTCTGAAGCTGAGATCTTCTACAATGCCACTGGCTTCCTCAGGAACCTCAGCTCAGCCTCCCAGGCCACTCGCCAGAAGATGCGTGAGTGCCACGGGCTTGTGGATGCCCTGGTAACCTACATCAACCACGCCCTGGACGTGGGCAAGAACGAGGACAAGAGCGTGGAGAATGCTGTGTGTGTGCTGAGGAACCTGTCCTACCGCCTGTATGACGAGATGCCACCATCTGCCCTGCAGCGGCTTGAGGGCCGGGGCCGCAGGGACCTGGGTGGGGCCCCGCCCGGAGAGGCGGTGGGCTGCTTCACACCGCAGAGCCGGCGGCTGCGCGAGCTGCCTCTCACAGCCGATGCGCTCACTTTTGCCGAAGTGTCAAAGGACCCCAAGGGTCTCGAGTGGCTGTGGAGCCCACAGATCGTGGGCCTCTACAACCGGCTGCTGCAGCGCTGTGAGCTGAACCGACACACAACCGAGGCAGCGGCAGGGGCCTTGCAGAACATAACCGCAGGGGATCGCAGGTGGGCAGGTGTGCTGAGCCGCCTGGCGCTGGAGCAGGAACGGATCCTGAATCCCCTGCTGGACCGTGTCCGGACTGCTGACCACCACCAGCTGCGCTCGCTGACAGGGCTCATCCGGAATCTCTCCCGGAACGCCAGGAACAAGGACGAGATGTCCACCAAGGTAGTGAGCCACCTGATCGAGAAGCTGCCCGGCAGTGTGGGTGAGAAGTCTCCCCCGGCCGAGGTGCTGGTCAACATCATTGCTGTGCTCAACAACTTGGTGGTGGCCAGTCCCATCGCGGCCCGCGACCTGCTCTACTTTGATGGGCTCCGGAAACTCATCTTTATCAAGAAAAAGCGAGACAGCCCAGACAGCGAGAAGTCCTCCCGTGCGGCCTCCAGCCTCCTGGCCAACCTGTGGCAGTACAGCAAGCTGCACCGAGACTTCCGCGCGAAAGGTTATCGGAAAGAGGACTTCCTGGGCCCATAG

XM_004851737.1 Coding sequence

Pkp3 plakophilin 3, transcript variant X2

High confidence: 4 potential gene matches
Length: 2394 bp    Location: 22022840..22015858   Strand: -
>XM_004851737.1
ATGCAGGACAGTAACTTCCTGCTCTCGGCCCTACAGCCAGAGGCTGGCGTGTGCTCTCTGGCACTGCCCTCGGACCTGCAGCTGGATCGCAGGGGTGCCGAGGGCCCTGAGGCTGAGCGGCTTCGGGCAGCCCGCGTTCAGGAGCAGGTCCGAGCCCGCCTCCTGCAGCTGGGCCAGCAGCTGAGGCACAACGGGGCTGCCGAGCCTGAGGGTGCCACCGAGACCAGCAGAGGCTCATCCCGGGGTCAGTACCACATTCTGCAGGCCAGCTTCAGCTCCCGCTCCCAGGGCCAGAGTGGGGACAGAGTCTCAACCTTCCGGCCAGTCGCCAAGCCAGCGTACAGCCCGGCCTCTTGGTCCTCCCGCTCTGCTGTGGACCTGAGCTGTGGTCGGAGGCTGAGCTCTGCCCACAACGGAGGCAGTGCCTTCAGGGTGGTGGGGTACGGGAGCACCCAACCCACGCCAGCCATCCCCACTCGGCCTCTGTCCTTCCATGAGCGTGGCGGCGCTGGCAGCCGGGCTGAGTATGACACACTGTCGCTGCGCTCACTGAGGCTGGGCGCTGGGGGCCTGGACGATGGCTACAGTGTGGTGTCTGAGCAGCTGGAGCCGGCAGGTGGCTCCACCTACAGGGCCTTTGCCTATGAGCGTCAAGCCAGCTCCAGCTCGAGCCGGGCTGGGGGGCCGGACTGGCCAGAGGCTGCCGAGGGCCCCCCAAGCCGCACCATCCGGGCCCCCGCCATGCGGACCCTGCAGCGATTCCAGAGCAGCCACCGAAGCCGCGGGGGAACTGGGGCAGGGCCAGGCACAGGCCTGGAAACCGTGGCCAGGGCCCCATCTGTGCGCAGCCTGAGCCTCAGCCTGGCTGACTCAGGTCACTTGCCCGATGTGCGTGGGCTGGACAGCTACATCAGCCATCGCTCTCTGCAAAGACTCAGCAGTGGCTTCAATGACATCGACCTGCCCTCAGCAGTCAAGTACCTCATGGCCTCAGACCCCAACCTGCAGGTGCTGGGAGCGGCCTACATCCAGCACCGGTGCTATAGTGATGCAGGCGCCAAGAAACAGGCTCACAGCCTTCAGGCTGTGCCGAGGCTGGTGAAGCTCTTCAACCACGCCAATCAGGAGGTGCAGCGCCACGCCACGGGTGCTATGCGCAACCTCATCTATGACAACGCTGACAACAAGCTGGCCCTGGTGGAGGAGAACGGGATCTTCGAGCTTCTGCGGACACTTCGAGAGCAGGACGACGAGCTGCGGAAGAACGTCACAGGGATCCTGTGGAATCTGTCATCCAGTGACCACCTAAAGGACCGCCTGGCCCGTGACACACTGGAGCAGCTCACAGACCTGGTGCTGAGCCCCCTGTCAGGCGCAGGGGGGCCCCCCCTCATCCAGCAGAATGCCTCTGAAGCTGAGATCTTCTACAATGCCACTGGCTTCCTCAGGAACCTCAGCTCAGCCTCCCAGGCCACTCGCCAGAAGATGCGTGAGTGCCACGGGCTTGTGGATGCCCTGGTAACCTACATCAACCACGCCCTGGACGTGGGCAAGAACGAGGACAAGAGCGTGGAGAATGCTGTGTGTGTGCTGAGGAACCTGTCCTACCGCCTGTATGACGAGATGCCACCATCTGCCCTGCAGCGGCTTGAGGGCCGGGGCCGCAGGGACCTGGGTGGGGCCCCGCCCGGAGAGGCGGTGGGCTGCTTCACACCGCAGAGCCGGCGGCTGCGCGAGCTGCCTCTCACAGCCGATGCGCTCACTTTTGCCGAAGTGTCAAAGGACCCCAAGGGTCTCGAGTGGCTGTGGAGCCCACAGATCGTGGGCCTCTACAACCGGCTGCTGCAGCGCTGTGAGCTGAACCGACACACAACCGAGGCAGCGGCAGGGGCCTTGCAGAACATAACCGCAGGGGATCGCAGGTGGGCAGGTGTGCTGAGCCGCCTGGCGCTGGAGCAGGAACGGATCCTGAATCCCCTGCTGGACCGTGTCCGGACTGCTGACCACCACCAGCTGCGCTCGCTGACAGGGCTCATCCGGAATCTCTCCCGGAACGCCAGGAACAAGGACGAGATGTCCACCAAGGTAGTGAGCCACCTGATCGAGAAGCTGCCCGGCAGTGTGGGTGAGAAGTCTCCCCCGGCCGAGGTGCTGGTCAACATCATTGCTGTGCTCAACAACTTGGTGGTGGCCAGTCCCATCGCGGCCCGCGACCTGCTCTACTTTGATGGGCTCCGGAAACTCATCTTTATCAAGAAAAAGCGAGACAGCCCAGACAGCGAGAAGTCCTCCCGTGCGGCCTCCAGCCTCCTGGCCAACCTGTGGCAGTACAGCAAGCTGCACCGAGACTTCCGCGCGAAAGGTTATCGGAAAGAGGACTTCCTGGGCCCATAG

XM_004851738.1 Coding sequence

B4galnt4 beta-1,4-N-acetyl-galactosaminyl transferase 4, transcript variant X1

Length: 3285 bp    Location: 22038913..22028504   Strand: -
>XM_004851738.1
ATGCCGTGGTTCCCGGTGAAGAAGGTCCGCAAGCGGATGAAGCTGCTGCTGCTGCTGCTGCTGCTCACCTGCGCCGCGTGGCTCACCTACGTGCACCTGAGCCTGGCGCGCCAGGGCCGCGCGATGCGACAGCGGCCGGGCCACGCGCGAGATGGTGAAAAGCTGGCCGATGTGACAGATGGCCGGGGTATCCAGGGGGCGCCGTCCACGCAGAGGGCAGAGGACTCCAGCGAGAGTCGTGAGGAGGAGCAGGCGCCTGAAGGCCAGGACGCAGATGAGCTGTTTCCTGGGGGGGCTGGGAAGCCACCCCCACTGAACCTCACCCATCAGGTGCCCAAGTGGCAGGAGAAGTTCAAGGGGCAAGTGAACCTGCACGTGTTTGAGGACTGGTGTGGGGGCGCCGTGGGCCACCTGAGGAGGAACCTGCACTTCCCGCTGTTCCCCCACACCCGCACCACCGTGAGGAAGCTGGCCGTTTCCCCCAGATGGAGGAACTACGGACTCAGGATCTTTGGCTACATCCACCCGGCGAGAGATGGCGACGTCCAGTTCTCGGTGGCTTCAGACGACAACTCTGAGTTTTGGCTGAGCCTGGATGAGAGCCCAGCAGCCGCCCAGCTTGTGGCCTTCGTGGGCAAGACTGGCTCTGAGTGGACAGCGCCTGGTGAATTCACCAAGTTCAGCTCCCAGGTGTCCAAGCCCAAACGGCTCATGGCCTCCCGGAGGTACTACTTTGAACTGCTTCACAAGCAGGATGACCGGGGCTCAGACCATGTGGAAGTGGGTTGGCGCACATACCTGCCGGGCCTGAAGTTTGAAGTCATCAGCGCTGCTCACATCTCCCTTTACACAGATGAGTCCTCCCTGAAGATGGACCATGTGGCCCACGTGCCCCAGTCTCCAGCCAGCCATGTCAGGGGCCACCTGCCCAAGGAGGAGTCCAGCGCAGACATGCTGCGCCCAGACCCCAGGGACAGCTTCTTCCTCACACCCCGGATAGAGCCCTGGAGCCTGGAGAGCGTGCTGGAGCCCTGCGCCTACGCACCTACCTACGTTCTCAAGGACTTCCCCATCGCCAGATACCAGGGCCTGCAGTTTGTATACCTGTCCTTCGTGTATCCCAATGACTACACCCGCCTCACGCACATGGAGACGGAGAACAAGTGCTTCTACCGAGAATCTCCCCGGTACCTGGAAAGGTTCGGTTTCTACAAATACATGAAGATGGACAAGCAGGAAGGGGAGGACGGGGAGGAGGAGCAGCAGCGCCGGGCCTTCTTGTTCCTCAGCCCCGAGGACTTCCTGGACGAAGAGGACGAGGGGGAGCTGCTGGACAGCCTGGAGCCCACCGAGGTGGGCCCACCGCGGAGCGGACGCAGGCCTCCCACACCACCGCTGGCGGAGCGCGAGCCAGAGCTCTCAGCTTCCCACGGCCCTCAGTCCCGCCACTCCCGCGCGCTGCGCTGGGCCATGCGCCCCCTGTCCCTCTTCCTGGGCCACGCGCCACCCCCGCGCGCCGCTGAGAAGCCTCCTGCCAAGGTGTATGTGACGCGCGTGCGGCCCCGACCGCGGGTGTCCCCACGTGGCCCGGCCTGGCCTCCCCTGGCCGGCGTCCTCCTGCGTGCCCGCGCCGTGCCACGAGCGCAGCTGCGTGCACCTCGGCCCCGGCGCAGGTCCCGCGGGCCCCCAGGCACAGAGCCCCCCGCGCCGTCCACCCTCGGGGCCCCGCAGGCCCACGCGCCCACACCGGATGTGAACTCCTCGGCTGCCGCGCAGCCCATGACCTCCTTCCTGAGCTTGTCCCAGGTGTCCCGGCCGCAGCTGCTCGCCGAGGGCGAGGGGGAGGAGGAGGACCGGGCCCCTGGCGACGAGGTGGCCTCAGAGGACAGCGAGGAGGATGCCGCGGGCCGCGTGCCCGGGCACTGGCGAGAAGATGCTATCGACTGGCAGCGCACATTCAGCGTGGGCGCTGTGGACTTCGAGCTGCTGCGCTCAGACTGGAACGACCTGCGCTGCAACGTGTCCGGCAATCTACAGCTTCCGGAAGCCGAGGCCGTGGACGTGGCGGCCCAGTACATGGAGCGCCTCAATGCTCGCCATGGCGGGCGCTTCACGCTCCTGCGCATTGTGAACGTTGAGAAGCGCCGCGACTCGGCGCGCGGCAGCCGCTTCTTGCTGGAACTGGAGCTGCAGGAGCGCGGCGGGGGCCGCCTGCGCCTGTCAGAGTTCGTCTTTCTCCGAGTGCCGGGTGCGCACGCCCGCGGCGAGGAGGGAGGGAGCCCCGAGCCCCCTCCCGCTGCTTCCACGCGCCCAGACAGCCGCCCTGAGCTCTGCCGACCGCTGCGCCTCGCCTGGCGCCAGGACGTGGCCGTGCACTTCATCGTGCCAGTTTCTGGCGGACATGGCCTCACTGCACGCGCGCACGGGAGACTCGCGCTTCAGCGTCATCCTGGTGGACTTCGAGAGCGACGACATGGACGTGGAGCGCGCCCTGCGCCAGGCACGGCTGCCCGGGTAAGAGCCTGCAAGGACTGCGGGGTTCCCGAGCCCGCCGCCAGGCCCACGCCGGTGACCCTTCGTCCTCCGCAGGTATCAGTACCTGAGACGGACGGGGAACTTCGAGCGCTCTGCTGGGCTGCAGGCCGGAGTGGATGCTGTGCAGGACCCCAGCAGCATCGTCTTCCTCTGCGACCTGCACATCCACTTCCCACCCAGCATCCTGGACAGCATCCGCAAGCACTGCGTGGAGGGCACGCTGGCCTTCGCCCCCGTGGTCATGCGCCTGGGCTGTGGGAGTTCCCCTCGCAACCCGCAGGGCTACTGGGAAGTGAACGGCTTTGGTCTCTTCGGGATCTACAAGTCCGACTTCGACCGCGTGGGAGGCATGAACACGGAGGAGTTCCGAGACCAGTGGGGAGGCGAGGACTGGGAGCTCCTGGACAGGGTCCTGCAGGCGGGGCTGGAGGTGGAGCGACTCCGACTGCGGAACTTCTACCACTACTACCACTCCAAGCGGGGCATGTGGGGCACACGCAGCCGCAGGGGGACCCGCGAGGAGCCGGCCTGAGGCCGGGCAGCACAGCCACCACCCGTGCCTCCCCATCCGGCCTGGCCCGGCGGCCTCCCCGGAGGCCCCCTTCCCAGCCAGGCTGCCAGGCTGCCTCGGTCCTCACGCTCCGAGATGATTTCTGTGAAATTTTCAGTAGCGATGACATTGTTTCCAGGATTTCCAAGAGTTCTGTCTGTTCCGTTTTTATTCAGATTGAAATGAAATATTTTTTTTAG

XM_004851741.1 Coding sequence

B4galnt4 beta-1,4-N-acetyl-galactosaminyl transferase 4, transcript variant X4

Length: 3168 bp    Location: 22036561..22028649   Strand: -
>XM_004851741.1
ATGTGCACAGCTCTGTACCCTTGCACCAGCCAGTTTGGGAAGTGGGACACGCTGCCCACCCTGTCCACTCGGGGGATGTGGGAAGATCAGTGCAAGGAGTGGCCAGGTGAGGGTAGGGTGTCAGGTGCCATGAGGGAACAGACATGCGAGACACGTCAGCAGGGTCCTGGTCCAGACAGGCTCTGTGCCACACACACCTCACGTGCCCTTGCAGATGGTGAAAAGCTGGCCGATGTGACAGATGGCCGGGGTATCCAGGGGGCGCCGTCCACGCAGAGGGCAGAGGACTCCAGCGAGAGTCGTGAGGAGGAGCAGGCGCCTGAAGGCCAGGACGCAGATGAGCTGTTTCCTGGGGGGGCTGGGAAGCCACCCCCACTGAACCTCACCCATCAGGTGCCCAAGTGGCAGGAGAAGTTCAAGGGGCAAGTGAACCTGCACGTGTTTGAGGACTGGTGTGGGGGCGCCGTGGGCCACCTGAGGAGGAACCTGCACTTCCCGCTGTTCCCCCACACCCGCACCACCGTGAGGAAGCTGGCCGTTTCCCCCAGATGGAGGAACTACGGACTCAGGATCTTTGGCTACATCCACCCGGCGAGAGATGGCGACGTCCAGTTCTCGGTGGCTTCAGACGACAACTCTGAGTTTTGGCTGAGCCTGGATGAGAGCCCAGCAGCCGCCCAGCTTGTGGCCTTCGTGGGCAAGACTGGCTCTGAGTGGACAGCGCCTGGTGAATTCACCAAGTTCAGCTCCCAGGTGTCCAAGCCCAAACGGCTCATGGCCTCCCGGAGGTACTACTTTGAACTGCTTCACAAGCAGGATGACCGGGGCTCAGACCATGTGGAAGTGGGTTGGCGCACATACCTGCCGGGCCTGAAGTTTGAAGTCATCAGCGCTGCTCACATCTCCCTTTACACAGATGAGTCCTCCCTGAAGATGGACCATGTGGCCCACGTGCCCCAGTCTCCAGCCAGCCATGTCAGGGGCCACCTGCCCAAGGAGGAGTCCAGCGCAGACATGCTGCGCCCAGACCCCAGGGACAGCTTCTTCCTCACACCCCGGATAGAGCCCTGGAGCCTGGAGAGCGTGCTGGAGCCCTGCGCCTACGCACCTACCTACGTTCTCAAGGACTTCCCCATCGCCAGATACCAGGGCCTGCAGTTTGTATACCTGTCCTTCGTGTATCCCAATGACTACACCCGCCTCACGCACATGGAGACGGAGAACAAGTGCTTCTACCGAGAATCTCCCCGGTACCTGGAAAGGTTCGGTTTCTACAAATACATGAAGATGGACAAGCAGGAAGGGGAGGACGGGGAGGAGGAGCAGCAGCGCCGGGCCTTCTTGTTCCTCAGCCCCGAGGACTTCCTGGACGAAGAGGACGAGGGGGAGCTGCTGGACAGCCTGGAGCCCACCGAGGTGGGCCCACCGCGGAGCGGACGCAGGCCTCCCACACCACCGCTGGCGGAGCGCGAGCCAGAGCTCTCAGCTTCCCACGGCCCTCAGTCCCGCCACTCCCGCGCGCTGCGCTGGGCCATGCGCCCCCTGTCCCTCTTCCTGGGCCACGCGCCACCCCCGCGCGCCGCTGAGAAGCCTCCTGCCAAGGTGTATGTGACGCGCGTGCGGCCCCGACCGCGGGTGTCCCCACGTGGCCCGGCCTGGCCTCCCCTGGCCGGCGTCCTCCTGCGTGCCCGCGCCGTGCCACGAGCGCAGCTGCGTGCACCTCGGCCCCGGCGCAGGTCCCGCGGGCCCCCAGGCACAGAGCCCCCCGCGCCGTCCACCCTCGGGGCCCCGCAGGCCCACGCGCCCACACCGGATGTGAACTCCTCGGCTGCCGCGCAGCCCATGACCTCCTTCCTGAGCTTGTCCCAGGTGTCCCGGCCGCAGCTGCTCGCCGAGGGCGAGGGGGAGGAGGAGGACCGGGCCCCTGGCGACGAGGTGGCCTCAGAGGACAGCGAGGAGGATGCCGCGGGCCGCGTGCCCGGGCACTGGCGAGAAGATGCTATCGACTGGCAGCGCACATTCAGCGTGGGCGCTGTGGACTTCGAGCTGCTGCGCTCAGACTGGAACGACCTGCGCTGCAACGTGTCCGGCAATCTACAGCTTCCGGAAGCCGAGGCCGTGGACGTGGCGGCCCAGTACATGGAGCGCCTCAATGCTCGCCATGGCGGGCGCTTCACGCTCCTGCGCATTGTGAACGTTGAGAAGCGCCGCGACTCGGCGCGCGGCAGCCGCTTCTTGCTGGAACTGGAGCTGCAGGAGCGCGGCGGGGGCCGCCTGCGCCTGTCAGAGTTCGTCTTTCTCCGAGTGCCGGGTGCGCACGCCCGCGGCGAGGAGGGAGGGAGCCCCGAGCCCCCTCCCGCTGCTTCCACGCGCCCAGACAGCCGCCCTGAGCTCTGCCGACCGCTGCGCCTCGCCTGGCGCCAGGACGTGGCCGTGCACTTCATCGTGCCAGTTAAGAACCAGGCGCGCTGGGTGGTGCAGTTTCTGGCGGACATGGCCTCACTGCACGCGCGCACGGGAGACTCGCGCTTCAGCGTCATCCTGGTGGACTTCGAGAGCGACGACATGGACGTGGAGCGCGCCCTGCGCCAGGCACGGCTGCCCGGGTATCAGTACCTGAGACGGACGGGGAACTTCGAGCGCTCTGCTGGGCTGCAGGCCGGAGTGGATGCTGTGCAGGTCTGGGGGCCGGGGCTTGGGGAGCGCGATGGGGGCCACAGAGGGGCCTTCGGACGGCGTAGGCTCAGATCTTCGGCCCTCCAGGACCCCAGCAGCATCGTCTTCCTCTGCGACCTGCACATCCACTTCCCACCCAGCATCCTGGACAGCATCCGCAAGCACTGCGTGGAGGGCACGCTGGCCTTCGCCCCCGTGGTCATGCGCCTGGGCTGTGGGAGTTCCCCTCGCAACCCGCAGGGCTACTGGGAAGTGAACGGCTTTGGTCTCTTCGGGATCTACAAGTCCGACTTCGACCGCGTGGGAGGCATGAACACGGAGGAGTTCCGAGACCAGTGGGGAGGCGAGGACTGGGAGCTCCTGGACAGGGTCCTGCAGGCGGGGCTGGAGGTGGAGCGACTCCGACTGCGGAACTTCTACCACTACTACCACTCCAAGCGGGGCATGTGGGGCACACGCAGCCGCAGGGGGACCCGCGAGGAGCCGGCCTGA

XM_004851747.1 Coding sequence

Ifitm5 interferon induced transmembrane protein 5

High confidence: 4 potential gene matches
Length: 405 bp    Location: 22132436..22134165   Strand: +
>XM_004851747.1
ATGGACACGTCGTTCCCCCGTGAGGACCCTCGGGCCCCAACACTTGGCAAGGCTGGTGGTGCTGCTCCCGTGGCCCTCATGCTGGGAGCACCGAGCCCTCCACCCCGTGACCACTTGATCTGGTCCATCTTCAGCACAATCTACCTGAACCTGTGCTGCCTCGGCTTCCTGGCACTGGTGCATTCAGTCAAGGCCCGAGACCAGAAGGTGGCTGGGGACCTAGAAGCAGCACAGCGCTATGGCTCCAAAGCCAAGTGCTACAACATCCTGGCCATCATGTGGACCCTGGTCCCCCCACTACTGCTCCTGGGACTGGTGGTGACTGGAGCCCTGCACCTGTCCCGGCTGGCTAAGGACTCTGCGGCATTCTTCAGCACCAAGTTCGATGATGCAGACTATGACTAA

XM_004851754.1 Coding sequence

Athl1 ATH1, acid trehalase-like 1 (yeast), transcript variant X7

Length: 1878 bp    Location: 22142601..22136826   Strand: -
>XM_004851754.1
ATGGAGGACGCCCAGCCGGACCCCACCGTGTTTGCCTCCCACTCTCTGCCCAGGGACCCCCGCCTGTTGGCCACTGTGACCAACGTGTACCTGGGCACACGTGTGTACCATGACACACTGCACGTGAGCGGCGTGTACAACGGGGCCCGGGGCAGCACACACCGGGCGGTCCTGCCCAGCCCCCTTAACGTGCGGCTGGAGGCCCCCGCGGGGAAAGGAGCCCAGCTGACCCAGACCTTTGCTCTGGACACCAACACAGGCTCCTTCCTGCACACCCTGGAGGGCCCCAGCTTCCGGGCCTCCCAGCGCATCTATGCCCACCGCGTGCTGCCCCATGTCCTGGCCTTCAGGGTGTCCATTGCGCGGGTGGCTGTGGGGAGCAGGCCCATCAAGGTGCTGTTGCGATCAGCCTTCTCGCCGGAAAGCCCAGACCTGGACCTGCACCTGGGCCCTGAGTTCCAGGGCTTCAGCGCCTTGCCCCAGCCTGGGACCTCAGGACACGTCTCCCATGGCCTCAGCCCTGGAGGCCTCTCCAACGGAAGCCAAAGAGAGTGCTACTGGGGCCATGTCTTCTGGGACCAGGACCTCTGGATGTTCCCGAATATCCTGATGTTTCACCCAGAGGCTGCCCGGGCACTCCTGGAGTACCGTGTCCGGACGCTGGGTGGGGCCCTGGAGAATGCCCGGGCCCTGAACTACCAGGGAGCCAAGTTTGCCTGGGAGAGCGCAGCCTCGGGCCTGGAGGTCTGCCCTGAGGATATCTATGGGGCCCAGGAGATCCACATCAATGGGGCAGTGGTGCTCGCCTTCCAGCTGTATTACC