Details from NCBI annotation

Gene Name Heterocephalus glaber isolate NMR 29 unplaced genomic scaffold, HetGla_female_1.0 scaffold00017, whole genome shotgun sequence

Genome Location

Related Sequences

XM_004842871.1 Coding sequence

LOC101718980 uncharacterized LOC101718980, transcript variant X4

Length: 753 bp    Location: 12527174..12537525   Strand: +
>XM_004842871.1
ATGTGTATGGATCTAGGATTCCTAAAAGTCTCTAACGAGGGTGTAGCTCAGTGGTACAGCGCATGCTTAGCATGCACGAGGCCCCGGGTTCAATCCCTGGCACTTCCAGCGCTGGAGAGGCTTTCTTATGCCCATAGCTTTCCGTGTTTATCTTCCAGGGAACCTGTACAAGGGAGCCAGCTGAGCGAAGCCAAACCAAGCGTAGATTTGGACATGGCTGGGGAGCCCAGGCCGGGCCCTGGCCAGCCAGGACAGAAGAGGCAGCAGGACACAGCCGGCTTCCGAGGCAGCAGCAACTACCACTTGAACTATGAGCTGCACGGAGGAGATGCCCCCTGTAGGGGGTATGGACACCAGAGGATCTCCCCACTCATCAACCAGGTGCCTGGCAAGCTCCAAAGGACTTTCATGGGCCTGGGGGTCAGAAGGAGCTGCAGCCCCTACAAGGCCTCTAGGAGCAGATACCTGCACCCCGAGCAGGCCAAGCCTGTGAGGACCGAGGAGCTGCGCTCCATCCGGGGGAAGCTGAGCGAGATCAAAGCCCAGGTGGACAGGCTGTTGGAGAGTCTGGAGCACATGGACCAGCGCAGAGCCCAGGCTGCAGGTCAGGCACCAAAGGGACAAAGGACAGTGACAAGAACAGGGTCCCTGGTAGTGAGGGCTGCTCACGCCAAACTACTGAGGCCCAACAGGAGCCCAGGGGCCAGCGGGAAGGATAGCCACAGAGCAGGCGGTGCAGAACCAAGCATCTGA

XM_004842877.1 Coding sequence

Ddx19a DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A, transcript variant X2

Length: 1380 bp    Location: 12599793..12618593   Strand: +
>XM_004842877.1
ATGAGCAGTTTGCAGATCAAGGAAGAGAAGGTCAAACCAGATACCAATGGTGTTGTCAAAACCAGTCCCACTGCAGAGAAGACAGATGAGGAAGAGAAAGAGGACAGAGCTGCCCAGTCTTTACTCAACAAGCTGATCAGAAGCAACCTTGTGGATAACACGAACCAAGTGGAAGTGCTGCAGCGGGACCCCAGCTCCCCTCTCTACTCGGTGAAGTCTTTTGAAGAGCTCCACCTGAAGCCACAACTTCTCCAGGGAGTCTATGCCATGGGCTTTAATCGACCATCCAAGATACAAGAGAATGCATTACCCATGATGCTCGCTGAACCCCCACAGAACCTAATCGCCCAGTCTCAGTCGGGCACTGGAAAAACAGCTGCCTTTGTCCTGGCCATGCTCAGCCGAGTGGAACCAGCAGACAGACACCCTCAGTGTCTGTGCCTCTCCCCGACATATGAGCTGGCGCTTCAGACGGGAAAAGTGATTGAGCAGATGGGCAGATTTTATCCAGAGCTCAAGCTCGCTTATGCTGTTCGAGGCAATAAATTGGAAAGAGGTCAGAAGATCAGTGAGCAGATTGTCATCGGCACCCCCGGGACCGTCCTGGACTGGTGCTCCAAGCTCAAGTTCGTTGACCCCAAGAAGATCAAGGTGTTTGTGCTGGATGAAGCCGACGTGATGATAGCTACTCAGGGCCACCAGGATCAGAGCATCCGCATTCAGAGGATGCTGCCCAGGAACTGCCAGATGCTGCTTTTCTCTGCTACCTTCGAAGACTCTGTGTGGCAGTTTGCCCAGAAAGTGGTCCCAGACCCCAACATCATCAAACTGAAGCGCGAGGAGGAGACCCTGGACACCATCAAGCAGTATTACGTCCTGTGCAGCAACAGAGATGAGAAGTTCCAGGCTCTGTGCAACCTCTATGGGGCCATCACCATCGCTCAGGCCATGATTTTCTGCCATACCCGCAAAACAGCTAGTTGGCTGGCGGCAGAGCTCTCGAAAGAAGGCCACCAGGTGGCTCTGCTGAGTGGCGAGATGATGGTGGAGCAGAGGGCTGCAGTGATTGAGCGCTTCCGCGAGGGCAAAGAGAAGGTTCTGGTGACCACCAATGTGTGCGCCCGAGGTATTGATGTTGAGCAAGTGTCTGTGGTCATCAACTTTGATCTCCCTGTGGACAAGGACAGGAACCCGGACAACGAGACCTACCTGCACCGGATCGGGCGCACCGGCCGCTTTGGCAAGAGGGGCCTGGCCGTGAACATGGTGGACAGCAAGCACAGCATGAACATCCTCAACAGGATCCAGGAGCATTTTAATAAGAAGATAGAAAGATTGGACACAGATGATTTGGATGAGATTGAGAAAATAGCCAACTGA

XM_004842881.1 Coding sequence

Cog4 component of oligomeric golgi complex 4, transcript variant X1

High confidence: 4 potential gene matches
Length: 2355 bp    Location: 12747184..12715437   Strand: -
>XM_004842881.1
ATGGGGGACCTCGAGTCATCTCAGAAGTTATCGGGGGTCTCTCGCCCAGCAGAGGGGGTGGGAGGAGGCAGCTGCACCGAAATCTCTACCGAGCTCATTCGTTCCCTGACAGAGCTGCAGGAGCTGGAAGCTGTGTACGAACGGCTCTGCGGCGAGGAGAAAGTGGTGGAAAGAGAGCTAGATGCTCTTTTGGAACAACAAAACACCATTGAAAGTAAGATGGTCACTCTCCACCGAATGGGGCCCAATCTGCAGTTGATTGAGGGAGATGCAAAGCAGCTGGCTGGAATGATCACCTTCACCTGCAACCTAGCTGAGAATGTGTCCAGCAAAGTCCGTCAGCTTGACTTGGCCAAGAACCGTCTCTATCAGGCCATCCAAAGGGCTGATGACATCTTGGACCTGAAGTTCTGCATGGATGGGGTTCGGAGTGCGCTGAGGAGTGAAGATTATGAGCAGGCCGCAGCCCACATTCATCGCTACCTGTGCCTAGACAAGTCAGTCATCGAGCTCAGCCGACAGGGCCAGGAAGGGAGCATGATTGATGCCAACCTAAAATTGCTGCAAGAAGCTGAGCAGCGTCTCAAAGCCATTGTAGCAGAGAAGTTTGCCATCGCCACCAAGGAAGGAGATTTGCCCCAGGTGGAGCGCTTCTTCAAGATCTTCCCATTGCTGGGTTTACATGAAGAGGGATTAAGCAAGTTCTCTGAATACCTTTGTAAGCAGGTGGCCAGTAAAGCTGAGGAGAACCTCCTCCTGGTGCTGAGGTCAGACATGAGTGACAGACGAGCTGCAGTCATCTTCGCAGACACACTCACTCTCCTGTTTGAAGGGATTGCCCGCATCGTGGAGACCCACCAACCCATTGTGGAGACTTACTATGGACTGGGAAGGCTTTATACCCTGATCAAATATCTTCAGGTGGAGTGTGACAGACAGGTGGAGAAGGTGGTGGACAAGTTCACCAAGCAGAGGGACTACCAGCAGCAGTTCCGGCTTGTCCAGAATAACTTGAGAAATTCTGCACCAGAAAAAATCGAACCAAGGGAGCTGGACCCCATCCTGACTGAGGTCACCCTGATGAATGCCCGTAGTGAGCTGTACTTACGCTTCCTCAGGAAAAGGATCAGCTCAGATTTTGAGGTGGGAGACTCCATGGCCTCAGAAGAAGTAAAGCAAGAGCACCAGAAGTGCCTGGACAAACTCCTCAATAACTGCCTGTTGAGCTGTACCATGCAGGAGCTAATTGGCTACTATATTACCATGGAGGAGTACTTCATGAGGGAGACTGTCAATAAGGCTGTGGCTCTGGACACCTATGAGAAGGGCCAGTTGACGTCTAGCATGGTGGATGATGTCTTCTACATTGTGAAGAAGTGCATCGGGCGGGCTCTGTCCAGCTCCAACATTGACTGTCTCTGCGCCATGATCAACCTCGCCACCAGAGAGCTGGAGGCTGATTTCAGGGGCGTTCTGTCCAACAAGCTGAGGATGGGCTTCCCGGCCACCACCTTACAGGACATCCAGCGCGGGGTGACCAGTGCTGTGAACATCATGCACAGCAGCCTCCAGCAGGGCAAATTTGACACAAAAGGCATTGAGAGCACTGATGAGGCCAAGCTGTCCTTCCTGGTGACTCTGAACAATGTGGAAGTCTGTAGTGAAAACATCTCCACTCTGAAGAAGACTCTGGAGAGTGACTGCACCAAACTATTCAGCCAGGGCATTGGAGGGGAGCAGGCCCAAGCCAAGTTTGATAGCTGCCTTTCTGATTTGGCTGCTGTGTCCAACAAATTCCGAGACCTCCTGCAGGAAGGGCTGGCGGAGCTCAGCAGCACAGCAGTGAAGCCGCAGGTGCAGCCATGGATCAACACCTTTCTCTCCGTCTCGCACAACATAGAGGAGGAAGAATTCAATGACTATGAGGCCAATGACCCTTGGGTACAACAGTTCATCCTTAACCTGGAGCAGCAAATGTCAGAGTTCAAGGCCAGCCTGTCCCCAGTCATCTATGACAGCCTGACCAGCCTCCTGACCAGCCTTGTTGCTGTCGAATTAGAGAAAGTGGTGCTGAAATCCTCCTTCAACCGGCTGGGCGGGCTGCAGTTTGACAAGGAGCTGAGGTCGCTCATTGCCTACCTTACCACGGTGACCACCTGGACCATCCGAGACAAGTTTGCCCGGCTTTCCCAGATGGCCACAATCCTGAATCTGGAGCGGGTGACTGAGATCCTAGATTACTGGGGTGCCAACTCCGGTCCACTGACCTGGCGCCTCACCCCTGCTGAAGTACGCCAGGTGCTGGCTCTGCGCATAGATTTCCGGCATGAGGACATCAAGCGGCTGCGCCTATAG

XM_004842888.1 Coding sequence

Il34 interleukin 34, transcript variant X3

Length: 651 bp    Location: 12798140..12867591   Strand: +
>XM_004842888.1
ATGCCCCGGGGACTCGCCTGGCTGCACTATCTTGGGATCCTCCTTGGTGTGGCCTTGGGGACCGAGGGCCTGAAGGTGTGGCCTTTGACTCAGAATAAGGGGTGCACTGCCACTGGCTACCTTCGGGACAAGCTGCAGTACAAGAACCGGCTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGCGTGCCTTATGAGGGGGTGCTCAGAATCGCTAACGTCAGCAGGCTGAGGAGGGCCCGGGTGAGTGAGCAGGAGCTGCGGTACCTGTGGGTCTTGGTGAGTCTCAGCACCACCGAGTCAGTGCAGGACGTGCTGCTAGAGGGCCACCCGTCCTGGAAGTACCTGGAGGAGGTGCAGACGCTGCTGATGAACGTGTATCGGGACCTCAGGGATGTGGAGATCGGCCCCAAGGTGGAAGCCGTGTTGTCGGTCCTCAGCACCCCAGGCCTGAGCCTGAAGCTGGTGAGGCCCAAAGCCCTGATGGACAACTGCTTCCGGGTCATGGAGCTGTTGTACTGCTCTTGCTGTAAACAAAGCCCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGGCTCACAGTCCAGAGCCCTTGTTGCAATGTGCAGCCACCCACTTGTACCCTCCAACCTAG

XM_004842894.1 Coding sequence

Ftsjd1 FtsJ methyltransferase domain containing 1, transcript variant X2

Length: 2301 bp    Location: 13484046..13475816   Strand: -
>XM_004842894.1
ATGAGCAAGTGCAGAAAGTCACCAGTTCAGCAGTTAGCAAGTCTTGAGACATTCACCCCAAATGTTCTTGATGACATTTTTGAACTCTTTGCCAAGAACTTTTCTTATTGCAAGCCACTTAATAATGAGTGGCAGTTACCAGATCCCAGTGAGATTTTCATCTGTGATCACACAGAACTTAATGCATTTCTTGACTTGAAGAACTCCCTAAATGAAGTAAAAAATCTCCTAAGTGATAAGAAACTGGATGAGTGGCATGAGCACACCGCTTTTACTAATAAAGCAGGAAAAATCATTTCTCATGTGAAAAAATCTGTGAATGCTGAACTTTGTACTCAAGCGTGGTGTAAATTCCATGAGATTTTGTGTAGCTTTCCACTTATTCCACAGGAGGCTTTTCAGAATGGAAAACTGAATTCTCTTCACCTTTGTGAAGCTCCTGGAGCTTTTATAGCTAGTCTCAATCACTACTTAAAATCTCATCAGTTCCCTTGTGAGTGGAGTTGGGTAGCTAATACTCTAAATCCGTACAATGAAGCAAATGATAATCTTATGATGATCATGGATGACCGGCTCATTGCAAATACCTTGCATTGGTGGTACTTCGGTCCAGATAACACTGGTGATATCATGACCCTGGAATATCTGACTGGACTTGAGAATTTCCTAAGTGACATGGCTACCATTCACTTGATCACTGCAGATGGGAGTTTTGATTGCCAAGGAAACCCAGGTGAACAAGAAGCTTTAGTCTCTTCTTTGCATTACTGTGAAGTTGTCACTGCTCTGACTACTCTTGGAAAAGGTGGCTCTTTTGTTCTAAAGATGTTTACTTTGTTTGAACATTGTTCCATAAACCTGATGTACTTGTTAAACTGTTCCTTTGACCAAGTCCATGTTTTCAAACCTGCAACTAGCAAGGCAGGAAACTCAGAAGTCTATGTGGTATGTCTTCGGTATAAGGGAAGAGAAGCCATCCATCCTGTGTTGTCTAAGATGGTGCTGAATTTTGGGACTGAAATGACCAGAAAAGCTCTCTTTCCCCATCATGTGATTCCTGAATCTTTTCTTAAAAGACATGAAGAATGTTGTGCTTTTTTTCATAAGTATCAGTTAGAGACTATTTCTGAGAACATTCGTCTGTTTGAATGCATGGAAAAAGAGGAACAAACAAAGTTGAATAATTTAAGGGATTGTGCAGTACAATATTTTATGCAAAAATTTCAACTGAAGCCTCTTTCCAGAAATAACTGGCTAGTAAAAAAATATAACATTGGTTGTAGTACCAATACAAAGTGGTTTGGACAGAGAAACAGATATTTTAAAACCTATAATGAAAGGAAGATTCTGGAAACCTTATCATGGAAAGATAAAGTAGCTAAAGGGTACTTTAATAGTTGGGCTGAAGAACATTCTGTGCATCATCCTGGACAAAATTCTCTTTTAGAAGGGGCAGCTTCCAATCTTGAATGTGACTTCTGGCGTATTATAGAAGGAAAGAAACTGCCAAAGGTAAAGTGCTCTCCTTTCTGCGATGGTGAAATTTTAAAGGCTCTTAATGAAGCAATTGAGAAGTCCTTAGGAGAAACTTTGAATTTGGATTCCAAGTTTAGGCCACAACAGCAGTATTATTGTTCTTGTCACATTTTTTCAGAAGAACTGTTACTTTCTGAGTTGTTTAGTCTTACCCAGTGCCTTCAGGACAAGCAGATTGTAGAACCCAGCAACCAGATAAAGTGCCTATTTGTGGGTTTACCCACTCTCCATGATGTTAAAGTGCATATGCCATTGGAAGTTCAAATCCTGGAATCTGCTGAACTCATGACTTTTAGCTGTTCATTGCTTCATGATGGAGACCCAAATTACCAGCATTTGTTTTTGGACTGCTTTCTACATTCATTACAGCAGCTTCATACAGGAGATGTTATGATTTTGCCTGTACTTTCTTGTTTAACAAGATTTATGGCTGGCTTGATCTTTATACTCCACAGTTGTTTTAGATTCATCACATTTTCTTGTCCCATGTCTTCTGAGCCCCTGAGGACCTGTGCAGTCCTGCTATGTGTTGGTTATCAGAATCTTCCAAATCCAGTTTTCCAGTATCTGCAGAATATGAATGAATTATTGAGCACTTTGCTTAACTCTGATACACCCCAGCAGGTTTTACAGTTTGTGCCAATGGAGTTGCTCCTTAAAGGGGCACTACTTGATTTTTTGTGGGATTTGAATGCTGCCATTGCTAAAAGGCATTTGCATTTGATTATTCAAGGAGAGAGAGAAGAAATAAGCAACCTAAATTGA

XM_004842896.1 Coding sequence

Znf23 zinc finger protein 23, transcript variant X1

Length: 2076 bp    Location: 13642112..13633654   Strand: -
>XM_004842896.1
ATGGCAGCCAGGCTCCTCACAGCCTGGCCTCAGAAGTTGGTGACCTTTGAGGATGTGGCTGTGTACTTCACTCAGACGGAATGGGATGGCCTGTCCCCTGCACAGAGAGCCCTGTATAAGGATGTGATGCTGGAGAATTATGGACATGTGACTTCCCTAGGGTTTCCACTTCTGAAACCGGCTGTGATCTCACACCTGGAGAGAGGAGGTGAGCTGGAGGGCCTATCTCCTCTGGCCATTGTGACTGGAACAGGCCCTCAGGGCCTCTGGACTGTAGATATTGATATACAGACAAACAATAATTTGACAAAGGAAATGTATGAAGAAAAAGATAGCACATCATTTGAACTTCCGAAGGACTTTTCCCTGGAAACAGACACTTTAGAAGCCTATATGCCACAGCAACAACAGGAAGTCCACTCAGCAGGAACGTTGACAAAGGAAAACAGCAATAGCATGGATGGAACAGTGAAAGATGAAACAAGCTCCATGGAGGAGTGTTCCTTTAATAACAGTACAAACTTGTTTCAGCATCATAGTATCTCCACTGAAGAGCAGCACCCTGGTTGTATAGGACTGATGAAAGCCTTCAGCTTTGACACAGAACTTATTAAGCATGAAATAATTAATACTGTGGAAAGTACTTTGAAATGTGAAAATTTTGTGGAAACCTTCACATTTGACTCTCAACCTAGTCAGCATCTAGAAAACTATACTGTAGAGAAGCCTTACCAGTGTGTGGAATGTGGCAAAGCCTTCAGTGTTAATGCAAAATTAATTTGGCATCAAAGACTTCATAGTGGGGAGAAACCCTTCAAATGTTTGGAGTGTGGGAAATGCTTCAATTACAGTTCCCATTATATCACACATCAGACAATCCACAGTGGGGAGAAGCCCTATCAATGTAAGATTTGTGGGAAAGCCTTTAGTGTTAATGGGAGTCTTAGTAGGCATCAGAGGACCCATACAGGAGAGAAACCCTATCAGTGCCAGGAGTGTGGAACTGGCTTTGGCTGTAGTTCTGCATATATTACACACCGGAGAGTCCACACTGGAGAGAAACCTTATGAGTGCAGTGATTGTGGGAAAGCTTTCAATGTTAATGCAAAATTAATTCAACATCAGAGAATCCACACTGGAGAGAAACCTTACGTGTGCAGTGAGTGTGGGAAAGGCTTCAGGTGCAGCTCCCAGCTTAGGCAGCATCAGAGTATCCATAGTGGAGAGAAACCCTATCCATGTAAAGAGTGTGGAAAAGCCTTCAATAATAATGCAAAACTCATTCAGCATCAAAGAATCCACACAGGTGAGAAACCTTATGGGTGCAATGAATGTGGAAAAGCCTTCAGTGTCAAAGGAAAGTTAATCCAGCATCAGAGAATCCACACTGGTGAGAAACCATATGGATGTAATGAATGTGGAAAAGCCTTTAGGTGTAACTCTCAGCTTCGACAGCATCTGAGGATCCATACTGGGGAGAAGCCCTATAAGTGTGATGAGTGTGGAAAGGCTTTCAGTGTTAATGCAAAACTAATGCAACATCAGAGAATTCACACTGGGGAGAAGCCTTTTGAATGTAATGAATGTGGGAAATGCTTTACTTCTAAAAGAAATCTACTTGATCATCACCGAATCCATACTGGAGAAAAGCCTTATCAGTGCACGGAATGTGGGAAAGCTTTCAGTATCAATGCCAAGTTAACTAGACATCAACGAATACATACTGGAGAAAAACCTTTCAAGTGTATGGAATGTGAGAAAGCATTCAGCTGTAGTTCTGACTATATTGTGCACCAGAGAATTCATACTGGAGAGAAACCCTTTCAGTGTAAGGAGTGTGGAAAAGCCTTCCATGTTAATGCCCATTTAATTCGACATCAGAGAAGCCACACTGGGGAGAAACCTTTCCGATGTGTGGAGTGTGGCAAAGGTTTCAGCTTTAGTTCTGACTGTATTATACACCAGACTGTCCACACTTGGAAGAAACCTTATGTGTGTAATATCTGTGGGAAAGCCTTCAGGTTTACCTTCCAACTCGGTCAGCATCAGAGTGTCCATAATGAAGGGAAATGTTAG

XM_004842905.1 Coding sequence

Ap1g1 adaptor-related protein complex 1, gamma 1 subunit, transcript variant X1

Length: 2478 bp    Location: 14081209..13997903   Strand: -
>XM_004842905.1
ATGCCAGCCCCCATCAGATTGCGGGAGCTGATCCGGACCATCCGGACAGCCCGAACCCAAGCTGAAGAACGAGAAATGATCCAGAAAGAATGTGCTGCAATCCGGTCATCATTTAGAGAAGAAGACAATACATACCGGTGTCGGAATGTGGCAAAATTACTATATATGCACATGCTGGGGTACCCTGCTCACTTTGGACAGTTGGAGTGCCTCAAGCTTATTGCTTCTCAAAAATTTACAGACAAACGCATTGGCTATTTAGGAGCAATGCTGCTGTTAGATGAAAGACAAGATGTCCATCTTCTCATGACTAACTGTATCAAGAATGATCTTAATCATAGCACTCAGTTTGTACAGGGACTAGCTCTTTGTACCCTTGGCTGCATGGGCTCCTCAGAGATGTGCAGAGATCTTGCAGGAGAGGTGGAGAAGCTCTTGAAAACCTCCAACTCTTACTTAAGAAAAAAGGCAGCACTGTGTGCTGTTCATGTCATCAGGAAAGTTCCTGAACTTATGGAGATGTTTTTACCAGCAACAAAAAATTTATTGAATGAGAAGAATCATGGTGTCCTTCACACTTCTGTAGTCCTCCTCACAGAAATGTGTGAGCGAAGCCCAGATATGCTCGCACATTTCAGAAAGAATGAAAAGCTTGTGCCCCAATTAGTTCGTATTCTAAAGAACCTCATCATGTCCGGATATTCCCCAGAACATGATGTTTCTGGTATCAGTGACCCCTTTTTGCAGGTACGGATTTTGCGGTTATTAAGAATTTTAGGACGAAATGATGATGACTCAAGTGAAGCTATGAATGATATACTAGCACAGGTTGCCACTAATACAGAGACTAGTAAAAATGTAGGAAATGCTATTCTTTATGAAACTGTTTTGACTATCATGGATATTAAATCAGAGAGTGGACTGCGAGTTCTAGCCATAAATATCCTGGGTCGTTTCTTATTGAACAATGACAAAAATATTAGATACGTAGCTCTGACATCTTTGTTGAAGACCGTGCAGACAGATCACAATGCAGTACAGAGACACAGAAGCACAATTGTGGACTGTCTAAAAGATTTGGATGTCTCAATAAAACGGCGTGCAATGGAATTGAGTTTTGCCCTGGTAAATGGAAATAATATCCGAGGCATGATGAAGGAATTACTTTATTTTCTGGATTCATGTGAGCCAGAGTTTAAGGCAGACTGTGCATCTGGAATCTTTCTTGCTGCAGAAAAGTATGCACCTTCCAAACGGTGGCATATAGATACCATTATGCGTGTTCTGACAACAGCAGGAAGTTACGTTCGTGATGATGCAGTCCCCAATTTGATACAGTTAATAACCAATAGTGTGGAGATGCACGCTTATACTGTCCAGCGCTTGTATAAAGCAATTCTTGGTGATTATTCTCAACAACCTTTGGTACAAGTAGCTGCATGGTGTATAGGCGAATATGGTGATCTTCTTGTATCTGGACAATGTGAAGAGGAAGAACCTATTCAGGTAACAGAGGATGAAGTATTGGATATTTTAGAAAGTGTACTAATCTCTAATATGTCCACCTCTGTGACACGAGGTTATGCCCTCACTGCCATCATGAAGCTTTCAACTCGATTCACTTGTACTGTAAACCGAATTAAAAAAGTGGTTTCCATCTATGGAAGCAGCATTGATGTGGAGCTCCAGCAGAGGGCAGTAGAATATAATGCACTTTTTAAGAAATATGACCATATGAGGTCGGCCCTACTTGAGAGAATGCCTGTCATGGAAAAAGTGACCACAAATGGCCCTACTGAGATTGTGCAGACAAATGGAGAGACAGAACCAGCTCCATTAGAGACAAAACCACCACCTTCTGGGCCACAGCCCACCAGCCAGGCGAATGACTTACTGGATTTGTTGGGAGGAAATGACATAACACCTGTTATTCCAACTGCACCTACAAGCAAACCAGCATCTGCTGGTGGAGAACTTCTTGATTTGCTGGGAGACATCAGCCTTACAGGTGCTCCAACTGCTGCTCCTACCCCTGCCTCAGTCCCTCAGATATCTCAGCCCCCCTTCTTGTTGGATGGGCTTTCATCACAGCCTCTCTTCAATGACATCACTGCAGGCATCCCCTCCATCACAGCATACAGTAAGAATGGCTTGAAGATAGAATTCACCTTTGAACGGTCAAACACCAACCCCAGTGTAACAGTGATAACGATACAGGCCTCTAACAGCACAGAGCTAGACATGACGGACTTTGTATTCCAGGCTGCAGTACCAAAGACATTCCAGCTGCAGCTTCTGTCTCCTAGCAGCAGCATTGTCCCAGCATTTAATACAGGGACCATCACACAAGTCATTAAAGTTCTGAACCCACAGAAGCAACAGCTGCGAATGAGGATCAAGCTCACATATAATCACAAGGGCTCAGCAATGCAAGATCTAGCAGAGGTGAACAACTTTCCCCCTCAGTCCTGGCAATGA

XM_004843229.1 Coding sequence

LOC101722637 IST1 homolog

Length: 963 bp    Location: 14116230..14094033   Strand: -
>XM_004843229.1
ATGTTCAGCTCTGCCTTCAAAGTCGATCGCCTTCGAGTTAACTTGCAACTGGTTATCAATCGCCTAAAACTCCTAGAAAAAAAGAAAACTGAGCAGACCCAGAAAGCAAGGAAGGAGATTGCTGATTTTCTGGCCGCTGGGAAGGATGAGCGAGCACGGATCCAAGTGGAGCACATTATCCGGGAAGACTACCTCGTGGAGGCCATGGAGATCCTGGAGCTGTACTGTGACCTGCTGCTGGCTCGGATTAACTTGATTCGGGCCACAAAGGAACTAGACTCTGGTTTGGCTGAATCTGTATCTACACTTATCTGGGCAGCTCCTCGACTGCAATCAGAGGTGCCCGAGTTGAAAATCGTATCTTATCAGCTGTGTGCAAAATACAGCCAAGAATATGGTCAACTCTGTCGAACCAATGAGATTGGAACTGTGAACTCTCAGCTAATGTATAAATTAAACGTGAACACTCTACCCCAAGTTCTAATGGAACAATACTTGGTAGAAATTGCTAAGAACTATAATGTGCCCTATAAATCCAAGGCTGAAGCCCTAGAAGATCTGGTCAATATTGGATTTACCAAGGATGTCAAGAAAAATCCCCTTGGCAGAGGAGGTGGTACTGCAGTAGGAACTGGTGATCCACCTGAGGCATCGCCAATACCTACACCAGGTCCCTCACCTTTGCCATCGCCTGGTCCTTGTGTCCTGCCCCTTCCTCCTAGAAGACAGAATGATGACTATAAGAATACATTGCTTCCCTCAGTGGTTCCTAGTCCAGGACTCAACCCTCAAACTTCTCCACAGCCAGAATCAAGAGCCAAGATTGGTTTCCGTAACTCAGTGCTGCCTGATTTGCCTGATGTAAAACCTCACACAAGCCGGTCCATTGACACTTATGACTCTGAAGAGGTTGACTTTGAAGATCTTAACCGGAGACTTGAAATGCTAAAGAAAATGACCTAA

XM_004842909.1 Coding sequence

Atxn1l ataxin 1-like, transcript variant X2

Length: 2067 bp    Location: 14119440..14128670   Strand: +
>XM_004842909.1
ATGAAACCTGTTCATGAGAGGAGTCAGGAATGTCTTCCACCAAAGAAACGAGACCTCCCCGTGACCAGCGAGGATATGGGGCGGACTACCAGCTGTTCCACAAACCACACACCCTCCAGTGATGCCTCTGAATGGTCCCGAGGGGTTGTGGTGGCTGGGCAGAGCCAGGCTGGAGCCAGAGTCAGCCTGGGGGGTGATGGATCTGAAGCTATCACTGGTCTGACGGTAGACCAGTATGGCATGCTGTATAAGGTGGCTGTGCCACCTGCCACCTTCTCACCCACTGGCCTCCCATCTGTGGTGAACATGAGCCCCTTGCCCCCCACGTTTAATGTAGCGTCTTCACTGATTCAACATCCAGGAATCCACTATCCCCCAATCCACTATGCTCAGCTCCCATCCACCTCACTGCAGTTTATCGGGTCTCCTTATAGCCTTCCTTATGCTGTGCCACCTAATTTCCTACCAAGTCCCCTCCTTTCTCCTTCTGCCAATCTTGCCACTTCTCACCTTCCACACTTTGTGCCATATGCTTCACTCCTGGCAGAAGAAGCCACTCCTCCCCCCCAGCCTTCATCCCCAGCCCATTCATTTAACAAAACCCCCACTGCCGCCTCCCCGCCTGGGCAGTTGCCACATCACTCAAGTACTCAGCCACTGGACCTCGCTCCAGGCCGGTTGCCCATTTATTATCAGATGTCTAGGCTACCTGGTGGGTATACCTTGCATGAAAACCCTCCAACAGGTGCCAGCCCAGTTCTTACCCCTCAGGAGGGCCAGTCTGCTCTGGAAGCAGCTGCTGCCAATGGAGGACAGAGACAACGAGAGCGAAATTTAGTAAGACGGGAAAGTGAAGCCCTTGACTCCCTGAGCAGCAAGGGTGAAAGCCAAGGACTGGTGCCAGTGGTAGAATGTGTGGTGGATGGACAATTGTTTTCAGGTTCTCAGACTTCACGGGTAGAGGTGACGGCACCAGCACATCGAGGGACTCCAGACACCGACCTTGAGGTCCAGCGGGTAGTTGGCGCTTTAGCTTCTCAGGACTATCGTGTGGTGGCAGCTCAGAGGAAAGATGAATCCAGCCCCCTCAACCTGTCCCATCATACTCCTGACCATCAGGGTGAGGGACGAGGGTCAGCCAGGAACCCTGCAGAGGTGGCAGAGAAGAATCAGGCCCGTGGGTTCTACCCTCAATCCCATCAGGAACCAGTAAAACATAGACTTTTACCCAAAGCGATGGTTGTTGCCAATGGCAACCTGGTGCCCACTGGAACTGACCCAGGCCTGCTGCCTGTGGGCTCTGAGATCCTGGTGGCATCAAGTCTGGACATGCAGGCCAGAGCCTTCCCAGACAAGGAGCCAACGCCACCCCCTATTACCTCTTCCCACTTGCCCTCCCATTTCATGAAAGGCGCCATCATCCAGCTGGCTACAGGGGAGCTGAAGCGGGTAGAGGACCTCCAGACCCAGGATTTTGTGCGCAGTGCCGAAGTGAGCGGGGGGCTGAAGATTGACTCAAGTACGGTTGTGGACATTCAGGAGAGCCAATGGCCTGGATTTGTCATGCTGCATTTTGTGGTTGGTGAGCAGCAGAGCAAAGTGAGCATTGAGGTGCCCCCCGAGCACCCCTTCTTTGTATATGGCCAGGGTTGGTCGTCCTGCAGCCCTGGGCGGACTGCACAACTCTTCTCTCTGTCCTGCCATCGACTACAGGTGGGAGATGTCTGCATCTCTATCAGTTTACAGAGCTTGAACAGTAACTCGGTTTCTCAGGCCAGCTGTGCTCCCCCAGGCCAGTTGGGTCCCTCCCGAGAAAGGCCTGAGAGAACAGTCTTGGGACCCAGAGACCTGTGTGACAGTGAGGGGAAGAGCCAGCCCACAGGAGAGGGCTCCCATGTGGTAGAGCCCTCCCAGCCTGAGCCTGGTGCTCAGGCCTGCTGGCCAGCCCCAAACTTCCAAAGATACAGCGTGCAAGGGGAGGAGGCACGGGCTGGACTGCTCCGTCCCTCTTTCATTCCACAAGAGGTAAAGCTGTCCATTGAAGGGCGTTCAAATGCGGGAAAATGA

XM_004842915.1 Coding sequence

Dhodh dihydroorotate dehydrogenase (quinone), transcript variant X1

Length: 1224 bp    Location: 14254884..14267698   Strand: +
>XM_004842915.1
ATGGCGTGGACACATTTCAGAAAGCGGGCCCTGGATGCTGTGGTCATTCTGGGGGGTGGAGGACTTCTCTTCGGCTCCTACCTGACAGCCACTGGGGATGAGCATTTCTATGCTGAATACTTGATGCCGGCTCTGCAGGGGCTGCTGGATGAGGAGTCAGCCCACAGGCTGGCTGTGCGTGTCACCTCCCTGGGGCTCCTTCCTCGAGCCACGTTTCAGGACTCTGATGTGCTGGAAGTGAGAGTCCTGGGCCATAAGTTCCGAAACCCGGTGGGAATTGCTGCAGGATTTGACAAGCACGGGGAAGCTGTGGATGGCCTTTTTAAGCTGGGCTTTGGCTTCGTTGAGGTAGGAAGTGTGACTCCCCAGCCTCAGGAAGGAAACCTCAGACCCAGAATCTTCCGCCTCCCCGAGGACCAAGCTGTCATTAACAGGTGCGGTTTTAACAGCCAGGGGCTCCTGGCGGTGGAGCGCAGGTTACGGGCCAGGCAGCAGAAGCAGACCAGGCTCACGGCAGATGGCCTGCCGCTGGGAATAAACCTGGGGAAGAATAAAACGTCGGTGGATGCTGCTGCGGACTATGCGGAGGGGATCCGGGTGCTGGGCCCCTTGGCTGATTACCTGGTGGTGAATGTGTCCAGTCCCAACACCCCTGGGCTGCGCTCCCTGCAGGGAAAGACTGAGCTGTGCTGCCTGCTGACCAAGGTTCTACAAGAGAGGGACGCCTTGCAGAGGGCACAGAAGCCGGCGGTGCTGGTGAAGATCGCCCCCGACCTCACGGCTCAGGACAAGGAGGACATTGCCTGTGTGGTGAGAGAGCTGGGCATCGATGGATTGATTGTGACAAACACCACAGTGAGTCGCCCTGCCGGCCTTCGTGGTGTCCTGCACTCTGAGGCGGGAGGCCTGAGTGGGAAGCCTCTCCGAGATTTATCAACTCAGACCATCCGTGAGATGCAGAATCCCCATCATCGGGGTTGGCGGCGTGAGCAGCGGGCAGGACGCACTGGAGAAGATCCGGGCAGGGGCCTCCCTGGTGCAGCTGTACACGGCTCTCACCTATGGGGGGCCACCCGTGGTGGGCAGGGTCAAGCGGGAGCTGGAGGCCCTCTTAAAGTGAGTGGGGCCGTGTGGGGCTTGCAAGGGAAGTCCATCCAGAAAGACTCAAGTCAGAGGGATGCTGTTCATCTCTGTTGCTCACTCAGGAACAGAGGGTTACCCTGA

XM_004842918.1 Coding sequence

Dhodh dihydroorotate dehydrogenase (quinone), transcript variant X4

Length: 1107 bp    Location: 14254884..14267698   Strand: +
>XM_004842918.1
ATGGCGTGGACACATTTCAGAGGGCTGCTGGATGAGGAGTCAGCCCACAGGCTGGCTGTGCGTGTCACCTCCCTGGGGCTCCTTCCTCGAGCCACGTTTCAGGACTCTGATGTGCTGGAAGTGAGAGTCCTGGGCCATAAGTTCCGAAACCCGGTGGGAATTGCTGCAGGATTTGACAAGCACGGGGAAGCTGTGGATGGCCTTTTTAAGCTGGGCTTTGGCTTCGTTGAGGTAGGAAGTGTGACTCCCCAGCCTCAGGAAGGAAACCTCAGACCCAGAATCTTCCGCCTCCCCGAGGACCAAGCTGTCATTAACAGGTGCGGTTTTAACAGCCAGGGGCTCCTGGCGGTGGAGCGCAGGTTACGGGCCAGGCAGCAGAAGCAGACCAGGCTCACGGCAGATGGCCTGCCGCTGGGAATAAACCTGGGGAAGAATAAAACGTCGGTGGATGCTGCTGCGGACTATGCGGAGGGGATCCGGGTGCTGGGCCCCTTGGCTGATTACCTGGTGGTGAATGTGTCCAGTCCCAACACCCCTGGGCTGCGCTCCCTGCAGGGAAAGACTGAGCTGTGCTGCCTGCTGACCAAGGTTCTACAAGAGAGGGACGCCTTGCAGAGGGCACAGAAGCCGGCGGTGCTGGTGAAGATCGCCCCCGACCTCACGGCTCAGGACAAGGAGGACATTGCCTGTGTGGTGAGAGAGCTGGGCATCGATGGATTGATTGTGACAAACACCACAGTGAGTCGCCCTGCCGGCCTTCGTGGTGTCCTGCACTCTGAGGCGGGAGGCCTGAGTGGGAAGCCTCTCCGAGATTTATCAACTCAGACCATCCGTGAGATGCAGAATCCCCATCATCGGGGTTGGCGGCGTGAGCAGCGGGCAGGACGCACTGGAGAAGATCCGGGCAGGGGCCTCCCTGGTGCAGCTGTACACGGCTCTCACCTATGGGGGGCCACCCGTGGTGGGCAGGGTCAAGCGGGAGCTGGAGGCCCTCTTAAAGTGAGTGGGGCCGTGTGGGGCTTGCAAGGGAAGTCCATCCAGAAAGACTCAAGTCAGAGGGATGCTGTTCATCTCTGTTGCTCACTCAGGAACAGAGGGTTACCCTGA

XM_004842919.1 Coding sequence

Dhodh dihydroorotate dehydrogenase (quinone), transcript variant X5

Length: 1011 bp    Location: 14254884..14267698   Strand: +
>XM_004842919.1
ATGGCGTGGACACATTTCAGAGAAGTGAGAGTCCTGGGCCATAAGTTCCGAAACCCGGTGGGAATTGCTGCAGGATTTGACAAGCACGGGGAAGCTGTGGATGGCCTTTTTAAGCTGGGCTTTGGCTTCGTTGAGGTAGGAAGTGTGACTCCCCAGCCTCAGGAAGGAAACCTCAGACCCAGAATCTTCCGCCTCCCCGAGGACCAAGCTGTCATTAACAGGTGCGGTTTTAACAGCCAGGGGCTCCTGGCGGTGGAGCGCAGGTTACGGGCCAGGCAGCAGAAGCAGACCAGGCTCACGGCAGATGGCCTGCCGCTGGGAATAAACCTGGGGAAGAATAAAACGTCGGTGGATGCTGCTGCGGACTATGCGGAGGGGATCCGGGTGCTGGGCCCCTTGGCTGATTACCTGGTGGTGAATGTGTCCAGTCCCAACACCCCTGGGCTGCGCTCCCTGCAGGGAAAGACTGAGCTGTGCTGCCTGCTGACCAAGGTTCTACAAGAGAGGGACGCCTTGCAGAGGGCACAGAAGCCGGCGGTGCTGGTGAAGATCGCCCCCGACCTCACGGCTCAGGACAAGGAGGACATTGCCTGTGTGGTGAGAGAGCTGGGCATCGATGGATTGATTGTGACAAACACCACAGTGAGTCGCCCTGCCGGCCTTCGTGGTGTCCTGCACTCTGAGGCGGGAGGCCTGAGTGGGAAGCCTCTCCGAGATTTATCAACTCAGACCATCCGTGAGATGCAGAATCCCCATCATCGGGGTTGGCGGCGTGAGCAGCGGGCAGGACGCACTGGAGAAGATCCGGGCAGGGGCCTCCCTGGTGCAGCTGTACACGGCTCTCACCTATGGGGGGCCACCCGTGGTGGGCAGGGTCAAGCGGGAGCTGGAGGCCCTCTTAAAGTGAGTGGGGCCGTGTGGGGCTTGCAAGGGAAGTCCATCCAGAAAGACTCAAGTCAGAGGGATGCTGTTCATCTCTGTTGCTCACTCAGGAACAGAGGGTTACCCTGA

XM_004842935.1 Coding sequence

Nqo1 NAD(P)H dehydrogenase, quinone 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 828 bp    Location: 16684441..16698194   Strand: +
>XM_004842935.1
ATGGCGGTCACCAGGAAAGCACTGATCATCTTGGCTCACTCAGAGAGGACATCCTTCAACTGTGCCATGAAGGAGGCTGCCGTAGAGGTGCTGAAGAGGAAAGGATGGGAAGTGGCTGAGTCTGACCTCTATGCCATGAACTTCAATCCCATCATTTCCAGAAAGGACATCACAGGTACACTGAAGGACCCTGAGAACTTTCAGTATCCAGCCGAGACTGCTCTAGCTTATAAAGAAAGCCGCCTGAGCCCGGATATTGTGGCTGAGCAAAAGAAGGTGGAAGCTGCAGACCTTGTGATATTTCAGTTCCCACTGCAGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTCGATCGAGTGCTCATAGGAGGGTTTGCCTACACATATGGTGCCATGTATGACAAGGGGCCTTTCCAGAATAAAAAGGCTGTTCTTTCCATCACCACTGGTGGCAGTGGCTCCATGTACTCTCTCCAGGGTGTCCATGGGGACATGAACGTTATTCTCTGGCCAATTCAGAGTGGCACTCTGCATTTTTGTGGCTTCCAAGTCTTAGAACCTCAGCTGACATACAGCATTGGGCACACTCCACTGGATGTCCGAACTCAAGTCCTAGAAGGATGGAAGAAACGCCTGGAGAATATATGGGATGAAGCACCACTATATTTTCCTCCAAGCAGCCTCTTTGACCTAAATTTTCAGGCAGGATTCTTACTGAAAAAGGAGGTACAAGATGAGCAGAAAAACAAGAAATTTGGCCTTTCTGTGGGCCATCATTTGGGCAAGCCCATTCCAACTGACAACCAGATCAAAGCCAGAAAATAA

XM_004842936.1 Coding sequence

Nqo1 NAD(P)H dehydrogenase, quinone 1, transcript variant X2

Length: 726 bp    Location: 16684441..16698194   Strand: +
>XM_004842936.1
ATGGCGGTCACCAGGAAAGCACTGATCATCTTGGCTCACTCAGAGAGGACATCCTTCAACTGTGCCATGAAGGAGGCTGCCGTAGAGGTGCTGAAGAGGAAAGGATGGGAAGTGGCTGAGTCTGACCTCTATGCCATGAACTTCAATCCCATCATTTCCAGAAAGGACATCACAGGTACACTGAAGGACCCTGAGAACTTTCAGTATCCAGCCGAGACTGCTCTAGCTTATAAAGAAAGCCGCCTGAGCCCGGATATTGTGGCTGAGCAAAAGAAGGTGGAAGCTGCAGACCTTGTGATATTTCAGTTCCCACTGCAGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTCGATCGAGTGCTCATAGGAGGGTTTGCCTACACATATGGTGCCATGTATGACAAGGGGCCTTTCCAGAGTGGCACTCTGCATTTTTGTGGCTTCCAAGTCTTAGAACCTCAGCTGACATACAGCATTGGGCACACTCCACTGGATGTCCGAACTCAAGTCCTAGAAGGATGGAAGAAACGCCTGGAGAATATATGGGATGAAGCACCACTATATTTTCCTCCAAGCAGCCTCTTTGACCTAAATTTTCAGGCAGGATTCTTACTGAAAAAGGAGGTACAAGATGAGCAGAAAAACAAGAAATTTGGCCTTTCTGTGGGCCATCATTTGGGCAAGCCCATTCCAACTGACAACCAGATCAAAGCCAGAAAATAA

XM_004842942.1 Coding sequence

LOC101712938 cytochrome b5 type B-like, transcript variant X2

Length: 441 bp    Location: 16942850..16906751   Strand: -
>XM_004842942.1
ATGGCGACCGTGGAGGGTACCGGCAGCGGCGAGAAAGGACAGGGAGGCGAGACCTCAGTCACCTACTATCGGTTGGAGGAGGTGGCGAAGCACAACTCTGTGAAGGAACTATGGCTGGTGATCCACGGACGAGTCTACGATGTCACCCGCTTCCTTGACGAGCATCCTGGTGGAGAAGAGGTTCTGCTGGAACAAGCTGGTGTAGATGCAAGTGAAAGCTTTGAAGATGTAGGCCATTCCTCTGATGCCAGAGAAATGCTAAAGCAATACTACATTGGTGATATCCATCCGAATGATCTTAAATCTCAAAGTGGTAGCAAGGATCCTTCGAAAAATAAATCGTGCAAAAGTTGCTGGTCATATTGGATTTTCCCCATTGTGGGCGCTGTTCTCTTAGGTTTCCTGTATCGTTACTACACAGCGGAAAGCAAATCCTCCTAA

XM_004842941.1 Coding sequence

LOC101712938 cytochrome b5 type B-like, transcript variant X1

Length: 504 bp    Location: 16942850..16919403   Strand: -
>XM_004842941.1
ATGGCGACCGTGGAGGGTACCGGCAGCGGCGAGAAAGGACAGGGAGGCGAGACCTCAGTCACCTACTATCGGTTGGAGGAGGTGGCGAAGCACAACTCTGTGAAGGAACTATGGCTGGTGATCCACGGACGAGTCTACGATGTCACCCGCTTCCTTGACGAGCATCCTGGTGGAGAAGAGGTTCTGCTGGAACAAGCTGGTGTAGATGCAAGTGAAAGCTTTGAAGATGTAGGCCATTCCTCTGATGCCAGAGAAATGCTAAAGCAATACTACATTGGTGATATCCATCCGAATGATCTTAAATCTCAAAGTGGTAGCAAGGTAAGAAGTCATCAGTTTTTCTTGTGTGTTTCAAGCGTTATATTTGTTTACTCAAGTAGAATTGCTTTGTTAAACAGTTATCTTAAAGAGAAGTTAAAAGGTTTAAAAATGTTTACTTTTTCCCCAAGCAAAAGTCCTGGTTTTCAGGAATTTGGACTCAGTACCTCTCAGGAAAAAGAATAG

XM_004842947.1 Coding sequence

Nip7 NIP7, nucleolar pre-rRNA processing protein, transcript variant X1

High confidence: 4 potential gene matches
Length: 543 bp    Location: 17034381..17032029   Strand: -
>XM_004842947.1
ATGCGGCCTTTAACTGAAGAGGAGACCCGTGTGATGTTTGAGAAAATCGCAAAATACATCGGGGAGAACCTTCAGCTGCTGGTTGACAGGCCCGACGGTACCTACTGTTTTAGGCTGCACAACGACCGGGTGTACTACGTGAGTGAGAAGATGCTGAAGCTGGCCGCCAATATCTCCAGGGACAAGCTGGTGTCGCTGGGGACCTGCTTCGGAAAATTCACCAAGACCCACAAGTTTCGGCTGCACATTACGGCTCTGGATTACCTGGCACCTTACGCCAAGTATAAAGTGTGGATAAAGCCTGGAGCAGAGCAGTCCTTCTTGTATGGAAACCATGTATTGAAATCTGGTTTGGGCCGGATCACTGAAAGTACTTCTCAGTACCAGGGAGTGGTGGTGTACTCCATGGCAGACATCCCTTTGGGTTTTGGGGTAGCAGCAAAGTCTACACAAGACTGTAGGAAAGTAGACCCCATGGCGATTGTGGTATTTCATCAAGCAGACGTTGGGGAATACATACGGCATGAAGAGACATTGACTTAA

XM_004842960.1 Coding sequence

Chtf8 CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae), transcript variant X2

Length: 369 bp    Location: 17206003..17217296   Strand: +
>XM_004842960.1
ATGGTGCAGATTGTTATTTCCAGTGCGGGGGCTGAAGGCCTGGCAGAATGGGTGCTGATGGAGCTACAGGGGGAGATCGAGGCTCGCTACAGCACTGGATTAGCTGGAAACCTCCTGGGAGACCTACATTACACCACTGAGGGAATTCCAGTGCTGATCGTGGGGCATCATATCCTGTATGGGAAAATCATCCACCTGGAGAAGCCTTTTGCAGTTCTTATCAAACACACTCCTGGGGAACAGGACTGTGATGAGCTTGGCCACGACCCTGGCACCACCCGGTACCTGGTGACAGCACTCATCAAAGACAAGATCCTTTTCAAGACCCGCCCCAAGCCCATTATCACCAACGTCCCCAAGAAAGTATGA

XM_004842959.1 Coding sequence

Chtf8 CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae), transcript variant X1

Length: 474 bp    Location: 17215067..17217296   Strand: +
>XM_004842959.1
ATGAGAACTAGCTGTCATTTTGATATTAACTGTCATCATTATCCTGATTTTTTTCTTTTTTTCTCTACAGTCTATTTTCACTTGCTTTTTAAAGAAAGAAAGCTCATGGTGCAGATTGTTATTTCCAGTGCGGGGGCTGAAGGCCTGGCAGAATGGGTGCTGATGGAGCTACAGGGGGAGATCGAGGCTCGCTACAGCACTGGATTAGCTGGAAACCTCCTGGGAGACCTACATTACACCACTGAGGGAATTCCAGTGCTGATCGTGGGGCATCATATCCTGTATGGGAAAATCATCCACCTGGAGAAGCCTTTTGCAGTTCTTATCAAACACACTCCTGGGGAACAGGACTGTGATGAGCTTGGCCACGACCCTGGCACCACCCGGTACCTGGTGACAGCACTCATCAAAGACAAGATCCTTTTCAAGACCCGCCCCAAGCCCATTATCACCAACGTCCCCAAGAAAGTATGA

XM_004842963.1 Coding sequence

Cdh3 cadherin 3, type 1, P-cadherin (placental), transcript variant X2

Length: 2511 bp    Location: 17658616..17616302   Strand: -
>XM_004842963.1
ATGACTTTCCTCATTGGGCCTCTCGCGTCCTTCCTCCTCCTCCAGGTTTGCTGGCTGCTGGGCGCAGCCTCTCAGCCTTGCCCGGCGGGCGTTGGGGAGGCTGGAGTGACCTTGGAGGCGGGAGGCAGAGAGGTGCTGCCGGGCCAGGCGCTGGAGAAAGCTTTCACCGGCTGCCCTGGGCAAGAGTTGGCCTCGCTTGGGACTGATAACAACGACTTCACTGTGTTGAGCGGGGGAACAGTCCAGGTAAAACACCATGCCCAACTGTGTCTTCTGTCCTTGCAGGAAAAGAAAGCTTTGAAGACCTCCCCATCCAAACGCATTTTACGAAGACGCAAGAGAGAATGGGTGGTCCCGCCAATATCTGTCCTTGAGAATGGCAAGGGGCCCTTCCCCAAGAGGCTGCATCAGCTCAAATCTGATAAGGACAAAGGCACCAAGATTTTCTACAGCATCACAGGGCCTGGGGCAGACAGCCCCCCAGAGGGCATCTTTGACATCGACAAGGAGACAGGCTGGTTGCTGTTGAATAAGCCACTGGACCGGGAGAAGATCGCCAAGTATGAGCTTTTCGGTCATGCTGTGTCAGAGAACGGTGCCTCCGTGGAGGAGCCCAGGAACATCTCCATCATTGTGACGGACCAGAATGACCACAAACCCAAGTTCACCCAGGAGGTCTTCCATGGGAGTGTCCTGGAGGGGGCACGGCCTGGCACCTCTGTGATGCAGGTGACAGCCACAGATGAGGATGATGCCATTGACACCAACAATGGCGTGGTTGCTTACTCCATCCACAGCCAGGAGCCAAAGGACCCAAACGACCTCATGTTCACCGTCCACCGGAGCACTGGCAGCATCAGTGTCATCTCCAGCGGCCTGGACCGGGAGAAAGTCCCCGAGTACACGCTGACCATTCAGGCCACAGACATGGACGGGGAAGGCTCCACCACCACAGCAGTGGCCATAGTGGAAATCCTTGATGCCAATGACAATGCTCCTGTGTTTGACACCCAAAAGTATGAGGCTCGGGTGCCTGAGAATGGAGTGGGCCATGAGGTACAGAGACTGACAGTGACCGACGTGGATGCCCCCAACTCTCCAGCATGGCGTGCGGTCTACCGCATTGTGGGAGGGGACAATGGGGACCATTTTACCATCACCACCCACCCTGAGAGCAACCAAGGCATCCTGACAACCAGGAAGGGCTTGGATTTTGAGGCCCAAAACCAACACACACTTTATGTAGAAGTGACAAATGAGGCTCCCTTTGTGGTGAAGCTCCCAACCTCCACAGCCACTGTCGTGATCCATGTGGAGGATGTGAATGAGGCCCCTGTATTTGTCCCACCCTCCAAAGTCATTGAGGCCCAGGAGGGTATCTCCGTTGGGGAGGCTGTCTGCATCTACACTGCACAGGATCCCGACAAACAGGATCAGAAGATCAGCTACCACATCCTGAGAGACCCAGCTGGGTGGCTAGCAATGGACCCAGACAGTGGGCAAGTCACTGCTGCAGGCCTCCTAGACCGCGAGGATGAGCGATTTGTGAGGAACAACATCTACGAAGTCATGGTCTTGGCCACTGATAATGGGAACCCTCCCGCCACTGGCACAGGAACCCTCCTGCTAACACTTACTGACATCAACGACCACGGCCCGGTCCCTGAGCCCCATCAGATCATCATCTGCAACGAAAACCCAGTGCCCCAAGTGTTGAACATCACAGACAAGGACCTGTCCCCCAACTCCTACCCTTTCCAGGCCCAGCTCAAATTCGACTCAGACATCTACTGGATGGCAGAGGTTAATGAAAAAGGAGACACAGTGGCCTTGTCCCTGAAGAAATTCCTGAAGCAAGACGCATATGATGTACACCTTTCTCTGTCTGACCATGGCAACAATGAACAGCTGACCGTGATCAGAGCCATCGTGTGTGACTGCCACGGCCATGTGGAGTCCTGCTCCAAGCCCTGGAAGGGTGGGCTCATCTTCCCCGTCCTGGGGGCTGTCCTGGGTCTGCTGCTCCTCCTGTTGGTGCTCCTCTTGTTGGTGAGAAAGAAGCAGAAGGTCAAAGAGCCTCTTCTGCTCCCAGAAGATGACACCCGTGACAATGTCTTCTATTATGGTGAAGAGGGTGGTGGCGAAGAGGACCAGGACTATGACATTACCCAACTCCACCGGGGCTTAGAGGCCAGGCCTGAGGTGGTTCTCCGCAATGATGTGGCACCAACCTTCATCCCCACACCCATGTACCGTCCCCGGCCAGCCAACCCAGATGAAATCGGCAACTTCATCATCGAGAACCTGAAGGCGGCCAACACGGACCCCACAGCCCCACCCTACGACTCGCTGTTGGTGTTCGACTACGAAGGCAGTGGCTCTGATGCTGCCTCCCTAAGCTCCCTCACATCCTCGGCCTCGGACCAGGACCAGGACTATGACTATCTGAACGAGTGGGGCAGTCGCTTCAAGAAGCTGGCAGACATGTATGGGGGTGGGGAGGACGACTAG

XM_004842966.1 Coding sequence

Zfp90 ZFP90 zinc finger protein, transcript variant X2

Length: 1929 bp    Location: 17772274..17756517   Strand: -
>XM_004842966.1
ATGGAAACATTGATGTTGTTGAGCAAGATTGTGATCCTGCAGGAATCAGTGACATTCAAAGATGTGGCTGTGGATTTCACCCGGGAAGAATGGCATCACGTGGACTCTGCCCAGAGAAGCTTGTACAGGGATGTGATGCTGGAGAACTACAGCCACCTGGTTTCTCTTGGATATCAAGTTTCCAAACCAGAGGTGATCTTCAAATTGGAGCAAGGAGAAGAGCCATGGATATCAGAGGGAGAAATCCAAAGGCCTTTCTGTTCAGACTGGAAGACAAGGCCAGAAGCTAAATCATCAAAGCTGCAACACAGCACATCTGAAGTATCCCCTAGCACAGATGATTTCTCACATGTCACATTAGAAGATGCCTGGGATATTAGTAGCCAGCTAGAGAGGCAGCAAAAAAATTGGAGGAGATATCTGGGGCCAGAAGTATCTACACAGAAGAAAATAACCACCCCAGAGGAAAATTTTGAGCAAAATAAATTTGGTGAAAACTCTAGATTGAACATAGACTTGATTCCACAACTGAACATTCCTTCAAGAATAAGGCCTAGTGAATATGGAACACTTGGAAACAATTTGGGACATAATTCAGACTTACTTAATCAAAATAATATCCTTGCAAAAAAGAAGCCCTATAAATGTAATAAATGTAGAAAAGCCTTTATTCATAGATCATCACTTAATAAACATGAGAAAACTCATAAAGGAGAAGACACATTCCCTAATGGTACAGGTCAGGGAATTTATCCTGGCAAGAAGCACCATGAATGTACTGACTGTGGGAAAACTTTCCTCTGGAAGACACAGCTTACTGAGCATCAGAGGATTCACACTGGAGAAAAACCCTTTGAGTGCAATGTGTGTGGAAAAGCCTTCAGGCATAGCTCATCCCTAGGTCAGCATGAGAATGCTCATACAGGAGAGAAACCCTATCAGTGCAGTCTCTGTGGGAAAGCCTTCCAATGCAGCTCCTCCCTTGTCCAACACCAGAGAATTCACACTGGAGAGAAGCCCTATCGATGTAATCTTTGTGGGAGGTCCTTTAGGCATGGCACATCCCTTACTCAACATGAGGTCACACACAGTGGAGAGAAGCCCTTCCAGTGTAAGGAATGTGGGAAAGCTTTTAGTCGATGTTCTTCTCTTGTCCAACATGAGAGGACTCATACTGGAGAGAAACCTTTTGAATGTAGCATATGTGGAAGGGCTTTTGGTCAGAGCCCATCCCTTTATAAACACATGAGGATTCATAAAAGAGGAAAACCTTACCAAAGCAATAACTACAGCATAGATTTTAAGCACAGCTCTTCTCTTACTCAAGAAGAAAGTGCACTGTCTGAAGTAAAATCCTACCATTGTAATGACTGTGGGGAAGACTTCAGTCACATTACAGACTTTACTAACCATCAGAGGATTCATACTGGAGAGAATCCCTATGATTGTGAGCAGGCCTTTAGTCAACAATCTATTTCTCATCCTGGAGAGAAACCCTATCAATGTAATGTATGTGGAAAGGCTTTCAAAAGGAGTACAAGTTTCATAGAGCATCACAGAATTCATACAGGTGAGAAGCCCTATGAATGTAATGAATGTGGAGAGGCCTTCAGTCGACGCTCATCACTTACTCAACATGAGAGAACCCACACTGGAGAGAAACCCTATGAATGTATTGACTGTGGAAAAGCTTTCAGTCAGAGTTCATCCCTTATTCAGCATGAGAGAACTCACACTGGAGAGAAACCCTATGAATGTAATGAATGTGGGCGTGCATTCCGTAAGAAAACCAATCTGCATGATCATCAAAGAATTCATACTGGAGAAAAACCTTACTCTTGTAAGGATTGTGGGAAGAATTTCAGTCGAAGCTCAGCTCTTACTAAACACCAGAGAATTCATACAAGAAGTAAACTGCAGGAACCCTAA

XM_004842968.1 Coding sequence

Smpd3 sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II), transcript variant X1

Length: 1974 bp    Location: 17857799..17948468   Strand: +
>XM_004842968.1
ATGGTTTTGTACACAGCCCCCTTTCCTAATAGCTGTCTGTGCGCCCTGCACGCAGTGTCCTGGGCTCTCATCTTCCCATGTTACTGGCTGGTGGACAGGCTCACAGCCTCCTTCCTACCCACCACTTATGAGAAGCGACAGCGCGCGGACGACCCGTGCTACCTGCACCTGCTCTGCACTGCCTTCTTCACGCCCATCTACCTGGCCCTCCTCCTGGCCTCGCTGCCCTTTGCCTTTCTTGGGTTCCTCTTCTGGTCTCCCCTGCAGTCTGCCCGCCGGCCCTACATCTACTCACGGCTGGAGGACAAGAGCCCAGCCGGTGGGGCAGCCCTGCTTGGTGAATGGAAGGGTACAGGGGCTGGCAAAAGCTTCTGCTTCGCCACCGCCAATCTCTGTCTCCTCCCTGACTCACTGGCCAGGCTCAACAACGTCTTCAACACCCAAGCACGAGCCAAAGAGATCGGGCAGAGAATCCGCAATGGCGCTGCGCGTCCCCAGATCAAAATCTACATCGATTCACCCACGAACACCTCCATCAGTGCAGCTAGCTTCAGCAGCCTGGTGTCCCCACAAGGCAGTGATAGCGGGGCCAGGGCTGTCCCTGTGAGCATTAAGAGGACATCCTCTGTGGAATACAAGGGCGATGGCGGGCATCACCCCAGCGATGAGGCTGCCAATGGGTCTGCCCCTGGGGACCTGGCTGACAGTGGCAGCCTTGAGGATGCCTGCATTGTCCGCATCAGTGGCGAGGAGGGGGGGCGGCCACCTGAAGCTGAAGACCCTGCCACTGGGAACCAAGCCAGGAACGGGGCCAGCGGGGGCCCAAAGGGCCAGACACCCAACCACAATCAGCGGGATGGGGACTCTAGCAGCCTGGGCAGCCCTTCCGCCTCCAGGGAGTCCCTGGTGAAAGCTCGAGCCGGGCCGGACAGCAGTGGCAGTGGGGACCCGGGGGCCAACAACAAGCTCCTGTACAGGGCCTCGGTGGTGAAGAAGGCAGCCTCGCGCAGGAGGCGGCACCCTGATGAGGCCTTTGACCACGAGGTCTCAGCCTTCTTCCCTGCCAACCTGGACTTCCTGTGCCTGCAGGAGGTGTTTGATAAGCGGGCAGCTGCCAAGTTGAAAGAGCAGCTGCATGGCTACTTTGAGTACATCCTGTACGACGTTGGGGTCTATGGCTTCCACGGCTGCTGCAGTTTCAAGTGTCTCAACAGCGGCCTCTTCTTTGCAAGCCGCTACCCCATCATGGACGTGGCCTATCACTGTTACCCCAACGGTCGCGGCTCCGATGCCATGGCCTCTAAGGGAGCGCTGTTTCTCAAGGTGCAGGTGGGAAGCACACCTCAGGACCAAAGAATCGTTGGGTACATCGCCTGCACACATCTGCACGCCCTACCAGAGGACAGCGCCATCCGCTGTGAGCAGCTGGACCTGCTTCAGGACTGGCTGGCTGATTTCCGAAAATCTACCTCCTCCTCCAGCACAGCCAACCCCGAGGAGCTGGTGGCGTTTGACGTCATCTGCGGAGATCTGAACTTTGACAATTGCTCCTCAGATGACAAGCTGGAGCAGCAGCACTCCCTGTTTACACGTTACAAGGACCCCTGCCGCCTGGGGCCTGGGGAGGAGAAGCCGTGGGCCATCGGTACCCTGTTGGACACAAATGGCCTCTATGATGAGGATGTGTGCACCCCTGACAATCTGCAAAAGGTCCTGGAAAGCGAGGAAGGCCGCCGGGAGTACCTGGCTTTCCCCACCAGCAAGAGCCCAGGAGGTGGCCAGAAGGGGCGGAAGGACCTGCTGAAAGGCAACGGCCGTCGAATTGATTACATGCTACATGCTGAGGAGGGCCTATGCCCTGACTGGAAGGCTGAGGTGGAAGAATACAGTTTTATCACCCAGCTATCCGGCCTGACTGACCACCTCCCTGTGGCCATGCGGCTGATGGTGTCTGCAGGGGAGGAGGAGGCGTAG

XM_004842969.1 Coding sequence

Smpd3 sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II), transcript variant X2

Length: 1974 bp    Location: 17858347..17948468   Strand: +
>XM_004842969.1
ATGGTTTTGTACACAGCCCCCTTTCCTAATAGCTGTCTGTGCGCCCTGCACGCAGTGTCCTGGGCTCTCATCTTCCCATGTTACTGGCTGGTGGACAGGCTCACAGCCTCCTTCCTACCCACCACTTATGAGAAGCGACAGCGCGCGGACGACCCGTGCTACCTGCACCTGCTCTGCACTGCCTTCTTCACGCCCATCTACCTGGCCCTCCTCCTGGCCTCGCTGCCCTTTGCCTTTCTTGGGTTCCTCTTCTGGTCTCCCCTGCAGTCTGCCCGCCGGCCCTACATCTACTCACGGCTGGAGGACAAGAGCCCAGCCGGTGGGGCAGCCCTGCTTGGTGAATGGAAGGGTACAGGGGCTGGCAAAAGCTTCTGCTTCGCCACCGCCAATCTCTGTCTCCTCCCTGACTCACTGGCCAGGCTCAACAACGTCTTCAACACCCAAGCACGAGCCAAAGAGATCGGGCAGAGAATCCGCAATGGCGCTGCGCGTCCCCAGATCAAAATCTACATCGATTCACCCACGAACACCTCCATCAGTGCAGCTAGCTTCAGCAGCCTGGTGTCCCCACAAGGCAGTGATAGCGGGGCCAGGGCTGTCCCTGTGAGCATTAAGAGGACATCCTCTGTGGAATACAAGGGCGATGGCGGGCATCACCCCAGCGATGAGGCTGCCAATGGGTCTGCCCCTGGGGACCTGGCTGACAGTGGCAGCCTTGAGGATGCCTGCATTGTCCGCATCAGTGGCGAGGAGGGGGGGCGGCCACCTGAAGCTGAAGACCCTGCCACTGGGAACCAAGCCAGGAACGGGGCCAGCGGGGGCCCAAAGGGCCAGACACCCAACCACAATCAGCGGGATGGGGACTCTAGCAGCCTGGGCAGCCCTTCCGCCTCCAGGGAGTCCCTGGTGAAAGCTCGAGCCGGGCCGGACAGCAGTGGCAGTGGGGACCCGGGGGCCAACAACAAGCTCCTGTACAGGGCCTCGGTGGTGAAGAAGGCAGCCTCGCGCAGGAGGCGGCACCCTGATGAGGCCTTTGACCACGAGGTCTCAGCCTTCTTCCCTGCCAACCTGGACTTCCTGTGCCTGCAGGAGGTGTTTGATAAGCGGGCAGCTGCCAAGTTGAAAGAGCAGCTGCATGGCTACTTTGAGTACATCCTGTACGACGTTGGGGTCTATGGCTTCCACGGCTGCTGCAGTTTCAAGTGTCTCAACAGCGGCCTCTTCTTTGCAAGCCGCTACCCCATCATGGACGTGGCCTATCACTGTTACCCCAACGGTCGCGGCTCCGATGCCATGGCCTCTAAGGGAGCGCTGTTTCTCAAGGTGCAGGTGGGAAGCACACCTCAGGACCAAAGAATCGTTGGGTACATCGCCTGCACACATCTGCACGCCCTACCAGAGGACAGCGCCATCCGCTGTGAGCAGCTGGACCTGCTTCAGGACTGGCTGGCTGATTTCCGAAAATCTACCTCCTCCTCCAGCACAGCCAACCCCGAGGAGCTGGTGGCGTTTGACGTCATCTGCGGAGATCTGAACTTTGACAATTGCTCCTCAGATGACAAGCTGGAGCAGCAGCACTCCCTGTTTACACGTTACAAGGACCCCTGCCGCCTGGGGCCTGGGGAGGAGAAGCCGTGGGCCATCGGTACCCTGTTGGACACAAATGGCCTCTATGATGAGGATGTGTGCACCCCTGACAATCTGCAAAAGGTCCTGGAAAGCGAGGAAGGCCGCCGGGAGTACCTGGCTTTCCCCACCAGCAAGAGCCCAGGAGGTGGCCAGAAGGGGCGGAAGGACCTGCTGAAAGGCAACGGCCGTCGAATTGATTACATGCTACATGCTGAGGAGGGCCTATGCCCTGACTGGAAGGCTGAGGTGGAAGAATACAGTTTTATCACCCAGCTATCCGGCCTGACTGACCACCTCCCTGTGGCCATGCGGCTGATGGTGTCTGCAGGGGAGGAGGAGGCGTAG

XM_004842971.1 Coding sequence

Smpd3 sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II), transcript variant X4

High confidence: 4 potential gene matches
Length: 1974 bp    Location: 17924209..17948468   Strand: +
>XM_004842971.1
ATGGTTTTGTACACAGCCCCCTTTCCTAATAGCTGTCTGTGCGCCCTGCACGCAGTGTCCTGGGCTCTCATCTTCCCATGTTACTGGCTGGTGGACAGGCTCACAGCCTCCTTCCTACCCACCACTTATGAGAAGCGACAGCGCGCGGACGACCCGTGCTACCTGCACCTGCTCTGCACTGCCTTCTTCACGCCCATCTACCTGGCCCTCCTCCTGGCCTCGCTGCCCTTTGCCTTTCTTGGGTTCCTCTTCTGGTCTCCCCTGCAGTCTGCCCGCCGGCCCTACATCTACTCACGGCTGGAGGACAAGAGCCCAGCCGGTGGGGCAGCCCTGCTTGGTGAATGGAAGGGTACAGGGGCTGGCAAAAGCTTCTGCTTCGCCACCGCCAATCTCTGTCTCCTCCCTGACTCACTGGCCAGGCTCAACAACGTCTTCAACACCCAAGCACGAGCCAAAGAGATCGGGCAGAGAATCCGCAATGGCGCTGCGCGTCCCCAGATCAAAATCTACATCGATTCACCCACGAACACCTCCATCAGTGCAGCTAGCTTCAGCAGCCTGGTGTCCCCACAAGGCAGTGATAGCGGGGCCAGGGCTGTCCCTGTGAGCATTAAGAGGACATCCTCTGTGGAATACAAGGGCGATGGCGGGCATCACCCCAGCGATGAGGCTGCCAATGGGTCTGCCCCTGGGGACCTGGCTGACAGTGGCAGCCTTGAGGATGCCTGCATTGTCCGCATCAGTGGCGAGGAGGGGGGGCGGCCACCTGAAGCTGAAGACCCTGCCACTGGGAACCAAGCCAGGAACGGGGCCAGCGGGGGCCCAAAGGGCCAGACACCCAACCACAATCAGCGGGATGGGGACTCTAGCAGCCTGGGCAGCCCTTCCGCCTCCAGGGAGTCCCTGGTGAAAGCTCGAGCCGGGCCGGACAGCAGTGGCAGTGGGGACCCGGGGGCCAACAACAAGCTCCTGTACAGGGCCTCGGTGGTGAAGAAGGCAGCCTCGCGCAGGAGGCGGCACCCTGATGAGGCCTTTGACCACGAGGTCTCAGCCTTCTTCCCTGCCAACCTGGACTTCCTGTGCCTGCAGGAGGTGTTTGATAAGCGGGCAGCTGCCAAGTTGAAAGAGCAGCTGCATGGCTACTTTGAGTACATCCTGTACGACGTTGGGGTCTATGGCTTCCACGGCTGCTGCAGTTTCAAGTGTCTCAACAGCGGCCTCTTCTTTGCAAGCCGCTACCCCATCATGGACGTGGCCTATCACTGTTACCCCAACGGTCGCGGCTCCGATGCCATGGCCTCTAAGGGAGCGCTGTTTCTCAAGGTGCAGGTGGGAAGCACACCTCAGGACCAAAGAATCGTTGGGTACATCGCCTGCACACATCTGCACGCCCTACCAGAGGACAGCGCCATCCGCTGTGAGCAGCTGGACCTGCTTCAGGACTGGCTGGCTGATTTCCGAAAATCTACCTCCTCCTCCAGCACAGCCAACCCCGAGGAGCTGGTGGCGTTTGACGTCATCTGCGGAGATCTGAACTTTGACAATTGCTCCTCAGATGACAAGCTGGAGCAGCAGCACTCCCTGTTTACACGTTACAAGGACCCCTGCCGCCTGGGGCCTGGGGAGGAGAAGCCGTGGGCCATCGGTACCCTGTTGGACACAAATGGCCTCTATGATGAGGATGTGTGCACCCCTGACAATCTGCAAAAGGTCCTGGAAAGCGAGGAAGGCCGCCGGGAGTACCTGGCTTTCCCCACCAGCAAGAGCCCAGGAGGTGGCCAGAAGGGGCGGAAGGACCTGCTGAAAGGCAACGGCCGTCGAATTGATTACATGCTACATGCTGAGGAGGGCCTATGCCCTGACTGGAAGGCTGAGGTGGAAGAATACAGTTTTATCACCCAGCTATCCGGCCTGACTGACCACCTCCCTGTGGCCATGCGGCTGATGGTGTCTGCAGGGGAGGAGGAGGCGTAG

XM_004842972.1 Coding sequence

Prmt7 protein arginine methyltransferase 7, transcript variant X1

Length: 2079 bp    Location: 18018873..17949443   Strand: -
>XM_004842972.1
ATGAAGGTTTTCTGCGGGCAACTCAATCCAACCACAGGATCCATGGAGTGGCTGGAGGAGGATGAGCACTATGATTACCACCAGGAGATTGCCAGGTCATCTTACGCAGATATGCTGCATGACAAAGACAGGAATATAAAATATTACGAGGGTATCCGGGCTGCTGTGAGCAGGGTGAAGGATAGAGGACAGAAGGCCTTGGTTCTTGACATTGGCACTGGCACCGGACTCTTGTCAATGATGGCCGTCACAGCAGGTGCTGACTTCTGCTATGCTATTGAGGTTTTCAAGCCCATGGCTGATGCTGCTGTAAAGATCGTGGAGGAAAATGGCTTCAGTGATAAGATTAAAGTTATCAACAAGCATTCAACGGAGGTGACTGTAGGACCAGATGGTGATATGCCATGCCGTGCCAACATCCTGGTCACAGAGCTGTTTGACACAGAACTGATTGGAGAGGGAGCACTGCCCTCCTATGAACATGCACACCGGCATCTTGTGCAGGAAACTTGTGAGGCAGTGCCTCACAGGGCAACTGTCTACGCACAGCTGGTGGAATCCAAAAGGATGTGGTCATGGAACAAGCTGTTTCCTGTCCGTGTTCAGACCAGCCTCGGAGAGCAGGTCATCATCCCTCCCTCAGATCTGGAGCAGTGCCCTGGTGCACCCTCTGTCTATGACATCCAGCTGAACCAAGTGTCACCTGCTGACTTCACTGTCCTCAGTGATGTGCTACCTATGTTCAGTGTGGACTTCAGCAAGCAGGTCAGTAGCTCGGCAGCCTGCCATAGCAGGCAGTTTGAACCTTTGGCATCTGGCCGAGCTCAGGTGGTTCTCTCCTGGTGGGACATTGAAATGGATCCTGAGGGGAAGATCAAGTGTACCATGGCCCCCTTCTGGGCACACTCCGACCCACAGGGTCTCCAGTGGCGGGACCACTGGATGCAGTGTGTATACTTCCTGCCACAAGAGGAGCCCATTGTACAAGGTGTAGCCCTCTGCCTGGTAGCCCACCATGATGACTACTGTGTGTGGTACAGCCTTCAGAGGACCTGCCCTGAAGAGAATGGGAGAGTTCAACAAATGCGCCCCGTATGTGACTGCCAAGCTCACCTGCTCTGGAATCGTCCTCGGTTTGGAGAGATCAATGATCAGGGCAGAAATGATCAGTACGCCCAGGCCCTGAGGACTGTGCTGATGCCAGACAGTGTCTGTCTCTGCATCAGTGATGGCAGTCTGCTCTCCATGTTGGCCCATTACCTTGGGGCAGAGCAGGTATTTACAATCGAGAGTTCAGCAGCTTCCCATGAACTGATGAAAAAAATCTTCAAGGCTAACCACTTGGAAGATAAAATTAGTATCATTGAGAAACGGGCTGAGTTGCTAACATCTGCAGACCTGGAGGGTAAGAAGGTCTCCCTCCTCTTGGGTGAGCCCTTCTTCACCACCAGCTTGCTGCCGTGGCACAACCTGTACTTCTGGTATGTCCGGACCGCTGTGGACCAGCACCTGGGGCCTGGTGCTGTGGTGATGCCCCAGGCTGCCTCGCTGCATGCCATGGTTGTGGAGTTCAGGGACCTGTGGCGGATCCGCAGCCCCTGTGGGAACTGTGAAGGCTTCGATGTGCACATTATGGATGACATGATTAAGTCTGCCCTGGATTTCCGGGAGAGCAAGGAAGCGGAGCCACACCCACTGTGGGAGTACCCCTGCCGCAGCCTCTCTGAGCCCCAGCGGATCCTGACCTTTGATTTTCGGCAGCTGGTCCCCCAGCAGCCCTTGCGTGCTGAGGGCACCATGGAGCTGAGGAGGCTGGGGAGGAGCCATGGAGCTGTCCTGTGGATGGAATACCACCTGACGCCAGACAGCACAGTCAGCACTGGCCTCCTGGAGCCCGCAGAAGACAAGGGGGATTGTTGCTGGAACCCCCACTGCAAGCAGGCTGTGTACTTCCTCAGCCCCACACTGGATCCCAAAATGCTTCTGGGCAGTCCTCGGGCAGTGAGCTATGCTGTGGAGTTTCACCCCCATTCAGGAGATGTCACCATGCAGTTCAGGCTCGCAGACACCAGGAACTGA

XM_004842989.1 Coding sequence

Ddx28 DEAD (Asp-Glu-Ala-Asp) box polypeptide 28

High confidence: 4 potential gene matches
Length: 1614 bp    Location: 18269552..18271591   Strand: +
>XM_004842989.1
ATGGCTTTTGCACGGCAGATTCGGCTCCTCACCTCTCGGTTACTTCTGATGCACAGACGGGAGCTGGCAGTCGGCAAGCCTGAGCACCCTCTGCCAGTAGTGCGCATTCCGCGGGCCCTACAGCGGCGGCAGGAACAGTCACAAAGAAGGCGTCGGAGTCCCCGGCGACTAATGCTTGTGAAACCTGGACCATTGCTAGTCTCAGCGCGGAGGCCAGAGTTCAACCAGCCCGCACGCCTCACGCTGAGCCGTTGGGAGTGTGCGCCGCTCGCCTCGCGTGGTTGGAGGCACCGGCGCTCGCGTCAGGATCATTTTTCTATCGAGCGCGCGCAACACGAGCCGCCAGCGCTGCGGAACCTCTCTAGGTGCAGCTTCGAGGACCTAGGTCTGGTTCCCCATATACTGCATGCACTGCAGGAGGCTGTGCCCGAAGTCGTTCGCCCCACAACCGTGCAGTCAAGCACCATCCCCCCACTGCTTCGTGGCCGCCATGTCCTTTGTGCCGCGGAAACCGGCAGTGGCAAGACTCTCGGCTACCTACTACCGCTGCTTCAACGGCTCATGGGTCAGGTACTCATGGACTCCCACCGTATCCCCACTCCCCGAGGACTGGTCCTTGTGCCTTCGCGAGAGCTAGCTGAACAGATACACGCTGTGGCCCGGCCGTTGGGCAGCTCCTTGGGCCTACAGGTGCGGGAGCTAGGAGGAGGCCACGGCATGAGAAGGATCAGGGAGCAATTATCGAAACAGCCGTCAGCAGATGTGCTAGTCTCCACTCCAGGAGTTCTGTGGAAGGCCCTGAAAGGTCGTCTGGTCAGTCTGGAGCAGCTCTCATTCATGGTGTTAGATGAGGCGGATACTCTTTTGGATGAAAGCTTCCTAGAACTGGTGGACTACATCTTGGGAAAAAGCCATATAGCTGAAGGCCCAGCTGACTTAAACGACTCTTTCAATCCCAAAGCTCAGTTAGTGCTGGTGGGAGCTACCTTTCCTGAAGGTGTCGGACAGTTGCTAAGTAAAGTCACCAACCCAAACTCAGTAACCACCATCACCAGCAACAAGCTTCACTGTATCATGCCTCATGTCAGACAGACATTTATGAGGCTGAAAGGAGCAGACAAAGTGATAGAGTTGGTGCAGATCCTCAAGCAGCATGACAAAAAACACAAGACTGGACCCTCTGGAACTGTCTTAGTGTTTTGTAACAGCTCCAGCACTGTCAACTGGCTAGGATATATTTTAGATGACCACAAAATCCAACACTTAAGGCTACAGGGAGAAATGCCAGCTTCAATGAGGGCAGGTATCTTTCAGCGATTTCAGAAGGGCTCCCGAGACATACTTCTCTGCACAGATATAGCTTCTCGGGGCCTGGACAGCACCCATGTGGAACTAGTTGTCAATTATGATTTCCCCCTCACCCTGCAGGATTATATCCACAGAGCAGGGAGGGTGGGCCGTGTGGGAAGTGATGTGCCAGGCACCGTCATGAGCTTTGTGACCCATCCCTGGGACGTGAGCCTGGTACAGAAGATTGAGCTCGCAGCTCGTCGAAGGAGAACCCTTCCAGGACTAGTGTCCTCAGTGGAAGAGCCTTTGTCTCAGCAACCCTGA

XM_004843033.1 Coding sequence

Atp6v0d1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1, transcript variant X2

High confidence: 4 potential gene matches
Length: 1056 bp    Location: 18828024..18883128   Strand: +
>XM_004843033.1
ATGTCGTTCTTCCCGGAGCTATACTTCAACGTAGACAATGGCTACTTGGAGGGACTGGTGCGCGGCCTGAAGGCAGGGGTGCTCAGCCAGGCCGACTATCTCAACCTGGTGCAGTGCGAGACGCTAGAGGACTTGAAGTTGCACCTACAGAGCACAGACTACGGCAACTTCCTGGCCAACGAGGCCTCGCCTCTGACAGTGTCAGTCATCGATGACCGGCTCAAGGAAAAGATGGTGGTGGAGTTCCGCCACATGAGGAACCATGCCTATGAGCCACTTGCCAGCTTCCTGGATTTTATTACTTACAGCTACATGATTGACAATGTGATCCTGCTCATCACGGGCACGCTGCACCACCGCTCCATTGCTGAGCTCGTACCCAAGTGCCACCCACTAGGCAGCTTCGAACAGATGGAAGCCGTGAACATCGCACAGACACCTGCTGAGCTCTACAATGCCATTCTGGTGGACACGCCCCTGGCGGCTTTTTTCCAAGACTGCATCTCAGAACAGGACCTTGATGAGATGAACATTGAGATCATCCGCAACACACTCTACAAGGCCTACCTGGAGTCCTTCTACAAGTTCTGCACCTTACTGGGCGGGACCACAGCTGATGCCATGTGCCCCATCCTGGAGTTTGAAGCAGACCGTCGCGCCTTCATCATCACCATCAACTCTTTCGGCACAGAGCTGTCTAAGGAGGACCGTGCCAAGCTCTTTCCTCACTGTGGACGCCTCTACCCTGAGGGCCTGGCTCAGCTGGCTCGGGCTGATGACTATGAACAGGTCAAGAATGTGGCCGATTACTACCCGGAATACAAACTGCTTTTTGAGGGTGCAGGGAGCAATCCTGGAGACAAGACCCTGGAGGACCGATTCTTTGAGCATGAGGTGAAACTGAACAAGTTGGCATTCCTGAACCAGTTCCACTTTGGAGTCTTCTATGCCTTTGTGAAGCTTAAGGAGCAGGAGTGTCGCAATATTGTGTGGATTGCTGAGTGCATTGCCCAGCGCCATCGCGCCAAGATCGACAACTACATCCCCATCTTCTAG

XM_004843038.1 Coding sequence

Lrrc36 leucine rich repeat containing 36, transcript variant X1

High confidence: 4 potential gene matches
Length: 2271 bp    Location: 19004884..18930772   Strand: -
>XM_004843038.1
ATGGCGGAGCAATGGGATCTGGACGAGGAGGGCCGCCGCCGCCTGGGGGCGCTGACCCAGGAGCATCCGGAACTGGTGGAGTCTCTTTCATTGCAGGGATCTTATGCTGGAAAAATCCATTCTATTGGTGATGCCTTCAGAAATTTTAAAAATCTCCGATCCTTAGATTTATCAAGAAATTTGATCACTAGCCTAAAGGGCATCCAGTATTTGTGTTCACTGCAACACCTGAATTTATATTATAACAACATTCCTTCATTAGTAGAGGTATCCTGCCTACAGCCTTTGCCCTTTCTCAAAGAACTAGATTTGAGACTCAATCCTGTTGTAAGAAAAGACACAGACTATAGGCTTTTTGCTGTGTACACACTACAAACTCTGGAAAAACTGGATGATCGAACTGTACGTGACAGTGAGAGGAAAGCTGCCAAGCTCCATTTTAGTCAGTTGAGCAACAGTGAAAATTTTCTTTTAGAGGTGGAAAAAAGCTCTAGGGAGAAGATAATGAAAAACTGTGGGACAGGTGAGGGCTGTGCATCAAAAGTCAACACTGATGTTGACACCAGGCCTGAAACAGCCTCAAACAAAGGACTTTTTATACCCTTCACTAACTGGGAAAGAAAGGATTCCCTAACCAGTACTTCTGCAACCCAGGACAATGGTAAACCAGGTCAGAAATCAGACACTTTTCCCCTGGGGACACAGATGCAGGAAATGACAAGAAAGGAGATGCCAAGTGACAACCCCCAGGACAATGAATTCAAACACTACTCGCCTCGTCAGTCCACAGTCCGATCCCCAGAGAAGATGACGAGAGATGGGTACCGAGTATCTTTTTTGGATAATAAGTCTTCAGGTTCTTCTCCAGAAAAGGACTTGATACCAAAGCTCGATACTTATCATCTTACCCATGATGCCTCATTGGGTAAATGCCTGGATGTAGGTGATTCCAACCAGATCCATCCCTATCAGTTACCTTCTGGCATCAGTTTGGAAAATTATAATAGTCATAATTCTCAAATTCTATCCCTGCATGGAAATCTTGGTAAAAGGCCTCAGAGAAACAAGAACTACCAAGAATATAGCACAAAGCCTTTAAATGACATAAAGGCTACTACATCCCATTCCTGTGGAGATTTATTGACTTCTCTGTCAAACTCTGACTCCAGTACTGGAAGACTTTTGAAACTTAGTTCAGATCTGTATGCCACAACTCATTTCAACAGTGACCCTGCTCTGCTGGCCAATGTAGAACAACAGTTATCCAGCAACCTTGGTGATTTAACACCAGCACATGGTTCTTTACCAAACAACTCTGTCCTGGGAAACTCTCTTCAGACATTGCGGTTGCCTCCTGGGACTTCAGAAGACAGAGAGATTCTGACCAAGAGGTCATTAAGCCCATCGAGGAGAGGATTCAAGCGGAAGGACAATATCCTTGCCAATCTGAATCTAAAGCACGGTTTCCGAGATGGTATAGGCAGCGAGCCTCTCTGTAGTGACCTGGGCAGTTTGCATGGTTTGCCAGGAAACCACAGTCCCCCGATCTCTGCCAGAACCCCCCATGTGGCCACTGTCCTCAGACAGCTCCTGGAGCTTGTGGATAAGCACTGGAGTGACTCTGGCTCCCTGCTCCTCAACAAGAAGTTCCTCGGTCCTGCACAAGATTTGCTTCTGTCTTTGGTTGTCCCTGCTCCTCTGCAGCAGCGATGTCGCCCACATCCTGAAGACACTCCAAAAACTTTCCACAGGAGGGAGAGTGACCTGAAGGAGGCTGAGCAGCCCATCCCTAATGACATGGAAAGTTTAAAGCAAAAACTGGTCAGAGTGCTGGAGGAAAACCTCATTTTGTCAGAAAAAGTTCAGCAGTTGGAGGAAGGTGCAGCCACCTCAATTATGAGTGGGCACCAGTCCCATACTTACGATGATATTCTACACAAAAACCAACAGCTGACCATGCAGGTGGCTTGCCTGAACCAGGAGCTTGCCCAGCTGAAAAAGGTGGAGGAGACGATTGCCCTTCTTCATGAAAGTCAGAGATCCCTGGTGTTAACTAATGAGTATCTGCTGCAGCTGCTGAATAAAGAGCAAAAAGGTTATTCTGGGAAAGCACTCCTGCCCCCTGAGAAGAGTCATCATTTGGGGAGATCGTCGCCCTTTGGGAAAAGCACTCTGTCTTCCTCCTCACCAGTGGCACACGACACGGGTCAGTATCTAATACAGAGTGTCTCAGAAGCTGCCCCAGAGCCTAGTTTGTGGAGCTACCATTGA

XM_004843042.1 Coding sequence

Fhod1 formin homology 2 domain containing 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 3498 bp    Location: 19074192..19090526   Strand: +
>XM_004843042.1
ATGGCGGGCGGGGAAGACCGCGGGGACGGGGAGCCGGTATCAGTGGTGACCGTAAGGGTGCAGTACCTGGAAGACACCGACCCCTTTGCATGTGCCAACTTCCCGGAGCCCCGCCGGCCCCCGACCTGTAGCCTGGATGGAGGGCTGCCACTGAGTACGCAGATACCTGCGCTGCACCGCCTGTTGGGGGCGCCACTCAAGCTGGAGGACTGTGCCCTGCAAGTATCTCCCTCTGGATACTACGTGGATCTGGAATTGTCCTTGGAAGAGCAGCGGGAGATGCTGGAGAGCTTCTATGAAGAGATCAGCAAAGGGCGGAAGCCCACACTGATCCTGCGGACCCAGCTCTCCGTGAGGGTCAATGCTATCTTGGAAAAGTTGTATGGCTCCAGTGGTCCTGAGCTCCGGCGCTCCCTCTTCTCACTGAAGCAGATCTTCCAGGAAGACAAGGACTTGGTGCCTGAATTCGTCCACTCAGAGGGGCTGAACTGCCTGATTCGTGTGGGTGCTGCAGCTGATCACAACTACCAGAGCTACATTCTTCGAGCCCTGGGCCAGCTGATGCTTTTTGTGGACGGGATGCTGGGGGTAGTGGCCCACAATGAGACAGTACAGTGGCTGTATACACTGTGTGCGAGCCTGTCCCGCTTGGTGGTGAAGACCGCTCTGAAGCTGCTCCTGGTATTTGTGGAATACTCTGAGAGCAACGCACCACTTTTCATCCGGGCAGTGAACTCTGTGGCCAGCACCACAGGTACTCTCCCCTGGGCCAATATGATGTCCATCCTGGAGGAGAAGAATGGTGCTGACCCAGAGCTATTGGTGTACACTGTCACTCTCATCAACAAGACGCTGGGGGCACTCCCTGACCAGGACTCCTTCTACGACATGACAGATGCGCTGGAGCAGCAGGGCATGGAGGCACTGGTCCAGCGCCTCCTGGGCACTGCTGGCACTGACGTCGACCTGCGCACACAGCTTATGCTCTATGAGAGCGCCCTACGGTTGGAGGATGGAGACATGGAGGAAGCCACAGCTGCTGCAGCTGCAGGTGGCCGGCGGGAGCGAAGAAAGCCCTCTTCAGAGGAGGGCAAGAGGAGCCGCCGATCTCTGGAGGGTGGGGGCTACCTTGTGCGTGCCCCGGAACCTGGCCCCACAGGCCCCTCCTCAACGATAGGCCTCACCTCCTGTACTGACCTTGCCCCACCAAGTGCCGTCTCCAGCCCAGCGGGATTAGCCTCTGGCCCCTATACCTCGGTGAACCTCTTTCCTACCATTTCTGTGGCACCTTCCATTGACAGCTCCGGCGAAAGGAGCATCTACAAAGCCCGGTTTCTGGAGCATATGGCAGCAGCAGAAACAGAGAAGCAGGCTGCGCTGGCCCAGGGCCGGGCAGAGACACTGGCAAGGGCCACACCAGATGAGGCCGACGGACCCCCAGGCACCCAGGAACTGTGGGGCTCCCCAGAGCCAGCCCCTGCACCCAGAACACCCCAGAGCGCTGCTCCCCGAATCCTGCTTCGGGCCCAGGGGAGCCTTGAGCCAGAGACCAAGGAGCCACCAGCACCACTAAGCCCCAAGGATGAGCCCATCCAGGAGATCCCTGGACGGGTATCCAAGCTCTGCATTGGGGACCTGGACTTCTCAGATCTGGGGGAGGATGAAGACCAGGACATATTGAATGTGGAGTCAGTGGAGGCTGGAAAAGGGATCCCACTCCCACCACCTCTACTGCCTCTGCAATCTGGAGGCCCCCCACCTCCTCCACCCCCACTTCCCCCACCCATCAAAGGCCCCTGCCCACCACCTCCACCCCTGGCTGCCCCTCTTCCCCCCTCAGCACTTGATGGCCCACCCCTCCCCACCAAGAGGAAGACAGTAAAACTCTTCTGGCGGGAGCTGAAGCTAGCTGGGTGTCATACAGGCTCCAGAAGCCACTTTGGGCCCTCCCCGACCCTGTGGGCCTCCTTGGATCCTGTTTCAGTGGATACAGCAAGGCTGGAACACCTCTTTGAGTCACGAGCCAAAGATGTGCTACCTTCCAAGAAAACTGGTGAGGGCCGCCGGACAATGACCACAGTGCTGGACCCCAAGCGCAGCAATGCCATCAACATTGGCCTAACCACTTTGCCACCTGTGCATGTTATTAAGGCTGCCCTGCTCAACTTTGATGAATTTGCTGTCAGCAAGGATGGCATTGAGAAGCTACTGACCATGATGCCCACGGAGGAGGAGAAGCAGAAGATTGAGGAAGCCCAGCTAGCCAACCCTGATGTACCCCTGGGCCCAGCTGAGAATTTCCTGATGACTCTTGCCTCCACTGGGGGCCTGGCTTCCCGTTTACAACTCTGGGCCTTCAAGCTGGACTATGACAGCATGGAACGGGAAATTGCAGAGCCACTATTTGACCTAAAAGTGGGCATGGGACAGCTGGTGCAGAACACCACCTTCCGCTGCATCCTGGCTACACTGCTGGCTGTGGGCAACTTCCTCAATGGGTCCCAGAGCAGCGGCTTTGAGTTGAGCTACCTGGAGAAGGTGTCAGAGGTGAAAGACACAGTACGCCGGCAGTCACTGCTGTACCATCTCTGCTGTCTAGTACTCCAGACCCAGCCTGATTCCTCCGACCTCTACTCAGAGATTCCTGCCCTGACCCGCTGTGCCAAGGTGGACTTTGAGCAGCTGACTGAGAACCTGGGGCAGCTGGAACGCCGGAGCCGGACAGCTGAGGAAAGCCTTCGGAGCTTGGCCAAGCATGAGCTGGCCCCAGCCCTGCGTGCCCGCCTCACCCACTTCCTGGCCCAGTGTGCCCGTCGTGTTGCCATGCTCGAGGTAGTACACCGCCGTGTCTGCAACAGGTTCCATGCCTTCCTGCTCTACTTGGGCTACACTGCACAGACAGCCCGTGAAGTGCGTATCATGCAATTCTGCCACATTCTTCGGGAGTTTGCACTCGAGTATCGGACTTGTCGGGAACGGGTATTGCAGCAGCAGAAGAAGCGGGCCACCTACCGTGAACGTAACAAGACCCGGGGACGCATGATCACTGAGACAGAGAAGTTCTCAGGTGTGGCTGGAGAAGTCCCCAACAACCCATCTGTTCCAGTGGCCGTGGGGAGTGGGCCAGGCCGGGGTGATGCTGACAGTCATGCCAGTATGAAGAGTCTGCTGACCAGCAGGCCAGAGGACACTACACATGTCCGCCGTAGCAGAGGTATGGTCCAGAGCAGCTCCCCAATCATGCCCACAGCAGTGGGGCCCTCCACTACACTTCCTGATGAACCTCCAGGCTCCAGTTTACCCAGCGACACATCAGATGAGATCATGGACTTATTAGTGCAGTCAGTAACTAAGAACAGCCCTCGAGCCTTAGCTGCTCGGGAAAGGAAGCGTTCCCGTGGCAACCGCAAGTCTTTGAGACGAACGTTGAAGAGTGGGCTTGGAGATGACCTGGTGCAGGCACTAGGACTAAGCAAGACTCCTGGCCTGGAGGTATGA

XM_004843054.1 Coding sequence

Exoc3l1 exocyst complex component 3-like 1, transcript variant X1

Length: 2211 bp    Location: 19128047..19133639   Strand: +
>XM_004843054.1
ATGCAGCCCACACTTCCCTCTGGCTCTTCCTGCCAAGAGCCTGAGTGGCCAGAGCAGGAGAGGGCAGAGCAGCTGGCCAGAGGTGCAGCACTCAAGTGGGCCTCAGGCATCTTCTACCGCCCAGAGCAACTGGCCCGACTGGGCCAGTACCGCAGCCGTGAGGTGCAGCGTACCTGCTTCCTACAAGGACGCATCAAGTCAGTGGTGCAGTCATACTTGGAAGGTGTGCAAATTGGTGTGTGGCAGCTGTCCCAGGCCCTTGAGGCTGTGCAAGGAACCCATGAGGCCCTGAACCAGGCCCATGGGTTGATCCAGGGCATGGCTCAGACCTCAAAGACCCTAGAGGCCCTGCGGGAGCAGGTTACCCAACACAAGCAACTACAGGCCCTGTCTCAGTTGCTGCCCCGGCTGCAAGCAGTGCCGGCTTCAGTGACCCACACAAAGATGCTAATCGATACCCAACAACTCTTGGAGGCATATGTGAGCCTGCGGGAGCTGGAGCAGCTGCAAGAGGAGGCATGGGCATCCTTGGGGGGCCTGGAGTTGCCAGTCTTCCAGGGGCTGGGCCATCTGGCTGAGGCATTGGGCCATGCTGTGGAGGCAGCTGCAGGGGCTGCAGGCCAGCTGGCACAGGCAGATCCAGCCCTGCTGGTGGCTGCTATTCGAGTAGCAGAGATGGAAGCTAAGCGTACAACTCCACTAGGACAGGTCCCCCGAGACTGGAGGCAGCGCTGTCTGCAGGCACTACAAGCAGGCCTGGAGCAGGTCTACTTTGGAACAACTGTGCTGCCTGAGCCAGGGGCCTTAGCAGAGTGGCTGAAGGCTCTCCAGATGGCCTTGCCTGCTGAGTTGGCCACAGCTGAGGCACTGGTAGCACCCTGCTGCCCACCACACTACAATGTGGTTCAGCTATGGTCCCACACCCTGCACAGTGGTCTGCGCCGCAGCCTGCAGCAACTCCTCGCAGGACCTGAGCTGGGAGCTGCTGATGCCTTCAACTTGCTGCATTGGGCACTGCACGTGTACCTGGGGCAGGAAATGATGGGGAGCCTGGAGTTGGGGCCTGAGGCTGATGTGTCCCAGCTGGAGCCCCTCTTGACCTCAGAGAACATCGAGCAGCTGGAGGCAACATTTGTGGTCAAAGTTCAGGCAAATGTGGCCCAGTGGCTACAGAAGGCACTGGATGGGGAAGTAGCTGAGTGGGGCCGGGAGCAGGAACCCAACACAGACCCCTCTGGCTTCTACCACTCACCAATGCCAGTCATCGTACTGCAGATCCTGGCCGAGAGCATTCATGTGACCAACCTGGTCAGTGAGTCGCTGCAGAACCGAGTGTGTGGCATGGCACTGTCAGAACTGGGCACATTCCTAAGGAGCTTCAGTGATGCTCTGATCCAATTCTCCCGAGACCACCTCAGTGGGGAAGCCCTGGCCCCTCACTATGTGTCCTACCTACTGGCTGCCTTCAACCACCAATCAGCATTGAGCTCCTCGATGTCGGTCCTGCAGCTTGATGGAGTGGCTACCGGGGTCTTGGCCCCGGTGGAAGCAGGGCTGGACGAGTTGCAGAGAAGGATCTGCCGCCTGGTGCTGGAGGCCCTGCAGGTGGAGCTCCAACCCCTGTTCGCAGCTCTGCCCTCGCGCCAATGGCTGTCAAGCTCTGAGTTGCTGGACCGAGTGTGTGAGCGGACGTCGCGGTTCTGCAGGGACTTCTGGCGTGTGCGGAACCCCGCAGTTCAGGTGCTGCTGGCCGAGGCAGAGCGCACTGTGGTGGTACAGTACCTACACGCATTGATGCAGGGCCGCCTCGTGTGCTGCAGTGAGGATGAGCGGACCCAGGCGGCCGAGCGCCTGGAGCACGATGCCGCCCAATTTAAAGAGCTTTTCCTCAGTTTGGGCCTGGAGGAGAGCGCGCATTGCACGCCAGTGCTGCTCTCCGTGAGGGAACTGCTGAACCTCCGCGATCCTACGATGCTTGGTCTCGAGGTGGCAGGCCTGCAGCAACGATTTCCCGACGTGAGCGAGGATCACGTCTCTGCCCTCTTGGACCTGCGCGGGGACGTGTCCCGAGAGCAGCGCCAGGCGGCACTCAGCTCGCTGCAGGCTGGCCCACCGCCCTCACCCCCGATGGTCCGCCGCCCACTCTTCAGCCTCGTGCCGGCGCCCACGCCTTCCCTCTCCTCCTGCCTCTTCTCGGGACTCTGCTCCTGA

XM_004842629.1 Coding sequence

Spata2l spermatogenesis associated 2-like

High confidence: 4 potential gene matches
Length: 1284 bp    Location: 281227..284928   Strand: +
>XM_004842629.1
ATGGGCAGCAGTTCGCTGTCCGAAGACTACCGCCTGTGCCTAGAGCGCGAGCTGCGGCGCGGACGTGCGGGCGTGTGCGGGGACCCCTCGCTGCGCGCCGTGCTCTGGCAGATCCTGGTGGAAGATTTCGACCTGCACGGCGCGCTGCAGGACGACGCGCTGGCGCTGCTCACCGACGGGCTCTGGGGCCGCGCCGACTTGGCGCCCGCGCTGCGCGGCCTGGCGCGCGCCTTCGAGCTGCTGGAGCTGGCGGCCGTGCACCTGTACCTGCTGCCCTGGCGGAAGGAGTTCACCACCATCAAGACCTTCTCCGGGGGCTACGTGCATGTGCTGAAGGGCGTGCTCTCCGAGGAGCTCCTCATCCAGAGCTTCCAGAAGATGGGCTACGTGCGCAGGGACAACCACCGCCTGATGGTCGCCAGCCTGCCCCCTGCCTGCCAGCTGGTCCAGGTGGCCCTGGGCTGCTTCGCGCTTCGGCTGGAGTGTGAGATCTTGGGGGAGGTGCTGACCCAGCTGGGCACCAGTGTGCTGCCAGCTGAGGAGCTGCTGCGGGCGAGGCGGGCCAGCAGGGACGTGGCCTCCTGTGTGGCCTGGCTGCAGCAGCGCCTGGCCCAGGAGGAAGAGCCGCCGCCCCTGCCCCCGAGGGGCCGCCCTGCCTCCTACGGGTCGCCCCTGGACCTGTACCGGGACCTGCAGGAAGACGAGGCCTCGGAGGAGGTCAGCCTGTATGGGGAAGCGTCACCTGGCCCTGACTCGCCCCCCATGGAGCTGGCCTACCTGCCACCGCTCTGGGAACAGAGTGCCAAACTCTGGGGCAGCGGGGGCCACACCTGGGAGCCCCCGGCTGAGGAGCTGCCCCGGGCCAGCAGCCCACCCTATGGGGCTCTGGAGGAGGAGCTACAGCCCGAGCCCTCTGCCTTCTCCTTCCTCTCACTGCGCCACGAGCTGAGCCAGCCTGGGGACCTGGCCGCTCCCGAAGCCCCTAGGAGCCCAGGACGGGCCAGCCCCAGGCACAGGCGGGTGGAGGGGGCACCAGCCTCGGCCTACAGCCCTGTCCCTGAGCCCCTGGGCTACCAGGCACACAGCTGCCTGGCGCCCGGTGCCCTACCGGCCCTGTGTTGTGACACCTGCCACCAGCTGCATGCTGCCCACTGCGCTGTGCTGCCTGCCTGCCGCCAGGGGCACTCACTGCGGGCGCTGCTCAGTGATACCCAGAGGCGCCTGTGGCTGCAGCGTGCTCGGGTGGATACCCTGCTCTACAGCAGCCCTGGGGCCCAACCCTAG

XM_004843068.1 Coding sequence

LOC101723319 chromosome unknown open reading frame, human C16orf70, transcript variant X1

Length: 1269 bp    Location: 19197565..19170614   Strand: -
>XM_004843068.1
ATGCTGGATCTAGAGGTGGTGCCTGAACGCTCTCTGGGAAACGAGCAATGGGAATTTACGCTGGGAATGCCTCTGGCCCAGGCAGTGGCTATTCTTCAGAAGCATTGTCGAATCATCAAAAATGTCCAGGTTCTCTACAGTGAGCAGTCTCCTCTAAGCCATGACCTCATCCTTAACCTGACTCAGGACGGGATCAAACTACTGTTTGATGCTTTCAATCAGAGACTTAAGGTAATTGAAGTATATGACTTGACTAAAGTAAAGTTAAAATATTGTGGAGTGCACTTCAACTCTCAGGCCATAGCTCCCACCATTGAGCAGATTGACCAGTCTTTTGGCGCAACTCATCCTGGAGTGTACAACTCTGCTGAGCAGCTCTTTCACCTCAACTTCAGAGGACTGTCTTTCTCTTTTCAGTTAGACTCATGGACTGAAGCTCCCAAATATGAGCCCAATTTTGCCCATGGTCTAGCTTCTCTCCAGATACCCCATGGAGCAACTGTAAAACGAATGTACATCTATAGTGGAAACAGCCTACAAGATACCAAGGCTCCCATGATGCCCCTGAGCTGTTTCCTGGGCAATGTGTACGCTGAGAGTGTAGATGTTCTTCGTGATGGAACTGGACCCTCAGGTTTACGACTTCGCCTACTTGCTGCAGGTTGTGGACCTGGCCTATTAGCAGATGCCAAGATGCGGGTATTTGATCGTTCCGTATATTTTGGTGATTCCTGCCAAGATGTTCTTAGCATGCTTGGCTCCCCACATAAGGTCTTCTATAAGTCAGAAGACAAGATGAAAATTCATTCTCCTTCCCCTCATAAGCAAGTTCCATCCAAGTGCAATGACTACTTTTTTAACTACTTCACTCTTGGAGTGGATATCCTCTTCGATGCAAATACACACAAAGTAAAGAAGTTTGTTCTACATACCAATTATCCTGGGCATTATAACTTTAACATTTATCACCGCTGTGAGTTCAAGATCCCACTAGCCATAAAGAAAGAAAATGAAGATGGTCAGACAGAAACTTGCACAACCTATAGCAAGTGGGACAATATCCACGAGCTCTTGGGCCATCCTGTGGAGAAGCCTGTTATCCTGCACAGGTCCTCATCCCCAAACAACACCAACCCATTTGGCTCCACATTCTGCTTTGGTCTTCAGCGGATGATCTTTGAGATCATGCAGAACAACCACATTGCCTCTGTGACCCTGTATGGCCCCCCCAGGCCTGGTGCCCACCTGAGAACAGCAGAGCTCCCCTAG

XM_004843108.1 Coding sequence

LOC101705613 CKLF-like MARVEL transmembrane domain-containing protein 2-like, transcript variant X1

Length: 720 bp    Location: 19883391..19873038   Strand: -
>XM_004843108.1
ATGGCTGATAAGGGGCAACCACCTCCCCCCAAACCCAGGGAGGAAAACAAGAATGACAAAAAGGAAGGGGAACAGCTCAAGGTGCAGCCCAAGGATGAAGTGGGTACAAGGAAGGGGTTGCGCTGCTACCGATGGGAACTCAAAGACAGCAACAAAGAGTTCTGGGTCCTCGGTCACGGCCCGGTCAAGTTCCTGAGTTTGGGCTGCCTGACTGCAGCACTGTTCCTGTTCTGGTCAACCTTCAGCGTGCACCCCATCTTGATGCTCATCATCACCATGGAGATATCCATCTTCTGCTTCTTTATTGTGCTCTATACCCTTGCCCTCCAAAGATACATTTCCTTCATCATGTGGCCTGTTACTGACCTTCTCAATGACCTGTTCGTTTGTGTGTTCCTCGGAGGAAGCATATACTTTGGTGTACAGAAGCAGCAACCAGACTTGCCAGTAAACTACTTAATTGCTCTGATCCTTATGGGTATAGCTGCGTTTTCTGCTTTTCTTGATATATGTTTTCAAAGAAAACACTTCAAAGGCAAGAGAATCAAAAGGAATATACTGGACCCACCACCAAAGGCAGGTGCACCAGAGAAACCAGCAGAAGAAAAACCACCTGCCAAAGAACCAGAAAAGCCAGCCAACAAGGGCAAACCAGGAGATAAGGCAGCAGCAGACAAAGGCAAAGGAAAGGACAAAGCACCACCAAAGGGAAAGAAGTAA

XM_004843112.1 Coding sequence

Cdh5 cadherin 5, type 2 (vascular endothelium), transcript variant X2

High confidence: 4 potential gene matches
Length: 2349 bp    Location: 20068014..20031732   Strand: -
>XM_004843112.1
ATGCTGACCACTGCTTTAGGCACCTACATGGGCCTGTTGGTGGCAGCATCAGTGGCAGGCTGTGACCCTACCCAACTGGACACCCTCAGCCTCCCATGCATCCACAGGCGCCAGAAGAGAGACTGGATTTGGAACCAGATGCATGTTGATGAAGAGAAAACTGATCCTTTACCCTATTATGTGGGCAAGCTCAAGTCGAGTGTGAACCGCAAGAACGCCACGTATGTGCTCAAAGGAGAGGCCGCTAACAGCATTTTCCAGGTCAATGCAGACACAGGGGATGTGTATGCTTTTGCGAGGCTCGACCGGGAGAAGGTCTCCGAGTACTCCCTCGTTGCCCTCATTGTGGACAAAGACACTAACAAAAACCTGGAGCCTCCTTCCAACTTCACTATCAAAGTTCATGACATAAATGACAACTGGCCTGTGTTCACCCATCGGTTGTTCAATGCCTCGGTGCTCGAGATGTCACCTGGGGGGACCTCAGTCATGCGTTTAACAGCAGTGGATGCAGATGACCCCACTGTGGCAGACCACGCCACTGTTATGTACCAAATCCTGAAGGGGGGTGAGAATTTTGCCATCGACAATTCAGGATTAATTTCCACTGCAAAGCAAAACTTGGATCGAGAGGTACAGGCCAGCTATGAGATCGTGGTGGAAGCACGAGATGCCGAGGGCCTCCAAGGAGAATCAGGCACAGCCACCGTGCTGATCACTCTGCAAGATGTCAATGACAACTTCCCCATCTTCGCTCAGCCCATGTACACATTTGTGGTGCCTGAAGACATCCGCGTGGGCAGCTCTGTAGGTTCTCTTTTTGTTGAGGACCCAGATGAGCCTCAGAACCGGAAGACCAAGTTTGACATCGTGCAGGGCGAGTACAGAGACACCTTCACTATCGACACGGATCCTACCCGCAATGAGGGCATCATCAAGCCCATGAAGCCCCTGGACTATGAGCTCATCCAAAAATACTCATTCGTCGTCGAGGCCACAGACCCTACTATCAACCTTGGATACCTGAGAGGCATCACGGGCAAAAACAAAGCCCGTGTCGTCATCAATATCTTGGATGTGGATGAGCCTCCTGTCTTCCAGAAGCGCTTCTATCACTTCCTGTTGAACGAGAACCAGAAGAAAAATCTAATAGGTTCAGTGCTAGCCAAGGACCCTGACAAGGCTGGGCGTAATATTGGATACTCCATCCGCAAGACTAGTGACAAGGGCCAATTCTTCCGAATAACCAAGCAGGGTGACATTCACTGTGAGAAAGAACTGGACAGAGAAATCTACCCCTGGCACAACTTGACTGTGGAGGCCAATGAGCTAGATCCTAATGGGAACCCCACAGGCAAAGAATCTATTGTCCAGGTGCACATTGAAGTTTTGGATGAGAATGACAATGCCCCAGAGTTTGCTCAACCCTATGAGCCCAAAGTGTGTGAAAATGCAGCCCAGGGCAAGCTGGTTGTGCAGATCTCTGCAGTAGACAAGGACATAACGCCACAAAATGTCAAGTTCAAGTTTGCCCTGGGGACTGATGACAGCAACTTCACCCTCATAGACAATCACGATAACACAGCCAACATCACAGTCAAGTATGGGCCGTTTGACCGGGAGCATGCCAAGTTCTACTACCTGCCTGTGCTCATCTCGGACAACGGGTCCCCAAGCCTGACGGGTACCAGCACGCTGACCGTGGTTGTGTGCAAGTGCAACCAGCAGGGCACGTTCACCTTCTGTGAGGAGGCAGTCGCCCAGGCAGGCGTCAGCATCCAGGCACTAGTGGCCATCTTCCTCTGCATCCTCACCATCACAGTGATCACCCTGCTCTTCTTCCTGCGGAGGCGGCTGCGGAAGCAGGCCCGCGCCCACGGCAAGGGCGTGACCGAGATCCACGAGCAGCTGGTCACCTACGACGAGGAGGGCGGCGGCGAGATGGACACCACCTGCTACGACGTGTCCGTGCTCAACTCGGCGCGGTCGGGCGCGGCCAAGCCCTTGCGGTCCGTGTTGGACGCGCGGCAGCCCATCTACGCCAAGGCACAGAAGCCACCGCGGGTGGCGCCAGGGGTGATGCCCGGAGTGCACGGCGGGCCCGGGGAGATGGCCGCAATGATCGAGGTGAAGAAGGACGAGGCAGACCACGACGGCGGCGGCCCGCCCTATGATACCCTGCATATCTACGACTACGAGGGTTCTGAGTCCATCGCCGAGTCGCTCAGCTCCCTAGGCACCGATTCGACCAACTCTGACATCGATTACGACTTTCTCAACGACTGGGGGCCCAGGTTCAAGATGCTGGCCGAGCTGTACTCCAACCCCTGGGATGATCTGGTATATTAG

XR_205169.1 Non-coding sequence

Cdh8 PREDICTED: Heterocephalus glaber cadherin 8, type 2 (Cdh8), transcript variant X6, misc_RNA.

Length: 3587 bp     
>XR_205169.1
TCCAAGTGGTAGACCTGCCTCTGGGCTCTGCCCAATGAGATCCGTCAGGGGAGGCACCCGGTTCACTTTTCCACATCACTTCACAGTTACATTTGGCAGGCAGGCGGGCTCGCACGCCGGAGCGCTCAGCCCAGAATTAGCGGATTTATTTGGAATCTCCCTGCCTCCTGGAAGATCCGCCGCCGCCGCCGCCGGTTTGTGCCTAGACGGTAGCGTCAACCCACCAGCTGCACTTTGGGCTGCGGACACCTAGAGCCCAGCGCGCCCGCCCCGCGTCTCCACACTGGGATCGGCAGCTCCGAGAGGCATGCACGGAATCCGGAGGCTCCTGCCCAGCGCTCAGGGGCCGCTCAGCGCCAGGCTCCCACAAGATCCCACCCGGAGCCCCTCCAGCCATTTGTGAACCAGGAGGCGTGAAATCCGCGGGCGCGGACCCCCACGAGAGGAATTTCAATGAAAATGAAAGCCAGTGGATTGTGGTCTTAGAAAACTGCTCAGTTGATGTCTGTTTCCCGTGCTCTAAACACGTGGCAGAGCAGTAAGTAAATGCTGCACAGTGCATGATGAATTGGATGGCTGCAGACCGGAGGCAAAAAATATAATTGTCTCATTTTCGTGACGATTTGCTTAACTGCTGGGACCATGCCAGAACGGCTAGCAGAAATGCTCTTGGATCTCTGGACTCCATTAATAATATTATGGATTACTCTCCCCCCTTGCATTTACATGGCTCCAATGAATCAGTCTCAAGTTTTAATGAGTGGATCCCCTTTGGAACTAAACAGCCTGAGTGAAGAACAGCGGATTTTGAGCCGCTCCAAAAGAGGCTGGGTTTGGAATCAAATGTTTGTCCTGGAAGAATTTTCTGGACCTGAACCGATTCTTGTTGGCCGGCTACACACAGACTTGGACCCTGGAAGCAAAAAAATCAAGTATATCCTATCAGGTGATGGAGCTGGGACAATCTTTCAAATAAACGATATAACTGGAGATATCCATGCTATTAAGAGACTTGACCGAGAGGAAAAGGCTGAATACACCCTGACAGCTCAGGCAGTAGACTGGGAGACGAACAAACCTCTTGAGCCTCCTTCTGAGTTTATTATTAAAGTTCAAGACATCAACGACAATGCACCTGAGTTTCTTAATGGACCCTATCATGCTACTGTGCCAGAGATGTCCATTTTGGGTACGTCTGTCACTAATGTCACAGCTACGGATGCTGACGACCCAGTTTATGGAAACAGTGCAAAGTTGGTTTATAGTATCTTGGAAGGGCAGCCTTATTTTTCCATTGAGCCGGAAACAGCTATTATAAAAACTGCCCTTCCCAACATGGACAGAGAAGCCAAGGAAGAATACCTTGTTGTTATTCAAGCCAAAGATATGGGTGGGCACTCTGGTGGCCTCTCTGGGACCACAACCCTCACAGTGACTCTTAGTGACGTTAACGACAACCCTCCAAAGTTTGCACAGAGTCTGTATCACTTCTCAGTACCAGAAGATGTGATTCTTGGTACTGCAATAGGAAGGGTCAAGGCCAATGACCAGGATATTGGTGAAAATGCTCAGTCATCATATGACATCATTGATGGAGATGGAACAGCACTCTTTGAAATCACTTCTGATGCCCAGGCCCAGGATGGCATCATAAGACTAAGAAAGCCTCTGGACTTTGAGACCAAAAAATCCTATACGTTGAAATTAGAGGCAGCCAATGTCCACACTGACCCACGTTTCAGCAGCAGGGGACCCTTTAAAGATACAGCAACAGTAAAAATTGTTGTTGAAGATGCTGATGAGCCTCCTGTCTTCTCTTCACCAACTTACCTTCTTGAAGTTCATGAAAATGCTGCTCTGAACTCTGTCATTGGGCAAGTGACTGCTCGTGATCCTGACATCACTGCTAGTCCTATAAGGTTTTCCATCGACCGTCACACTGACCTGGAGAGACAATTCAATATTAATGCAGATGATGGAAAGTTAACACTGGCAACTCCACTTGACAGAGAATTAAGTGTGTGGCACAACATAACAATCATTGCAACTGAAATCAGGAACCACAGTCAGATATCACGAGTACCTGTTGCTATTAAAGTCCTGGATGTCAATGACAACGCCCCTGAATTCGCATCCGAATATGAGGCATTTTTATGTGAAAATGGAAAACCCGGCCAAGTCATTCAAACGGTAAGCGCCATGGACAAAGATGAACCCAAAAATGGACATTATTTCTTATACAGTCTTCTTCCTGAAATGGTCAACAATCCAAATTTCACCATCAAGAAAAATGAAGATAATTCTCTCAGCATTTTGGCAAAGCATAATGGATTCAACCGCCAGAAGCAAGAAGTCTATCTTTTACCAATCATAATCAGTGATAGTGGGAATCCTCCACTTAGCAGCACCAGCACTCTAACCATCCGGGTCTGTGGCTGCAGCAATGATGGTGTTGTCCAGTCTTGTAATGTTGAAGCTTATGTCCTTCCCATTGGACTTAGTATGGGCGCCTTAATTGCCATATTAGCGTGCATCATTTTGTTGCTAGTCATTGTGGTGCTGTTTGTAACTCTGAGGAGACACAAAAATGAACCATTGATTATCAAAGATGATGAAGATGTTCGAGAAAACATCATTCGCTATGATGACGAAGGAGGAGGGGAGGAGGACACAGAGGCTTTTGACATTGCAACTTTACAAAACCCAGATGGAATTAATGGATTTTTACCCCGTAAGGATATTAAACCAGATTTGCAGTTTATGCCAAGGCAAGGGCTTGCACCAGTTCCAAATGGTGTTGATGTCGATGAATTTATAAATGTAAGGCTGCATGAGGCAGATAATGACCCCACGGCCCCACCATATGACTCCATTCAAATTTATGGCTATGAAGGCCGAGGGTCTGTGGCTGGCTCTCTCAGCTCCTTGGAGTCCACCACATCAGACTCAGACCAGAATTTTGACTACCTCAGTGACTGGGGTCCCCGCTTTAAGAGACTGGGCGAACTCTACTCTGTTGGTGAAAGTGACAAAGAAACTTGACAGTGGATCATAAATAAGTCAATGGAACTGAGCATTCTGTAATATTCTAGGGTCACTCCCCTTAGATACAACCAATGTGGCTATTTGTTTTAGAGGCAAGTTTAGCACCGTTCATCTATAAACTCAACCACATTTTAATGTTGAACCAAAAATAATAAAAATAAAAAGTATATGTTAGGAGGTTATAAATCTTGTGGAGTGTGAATTAAGTATGTGGAGTGTCTAGAAGTTTTTGAATATTTGATATTTACCTGACTGCCACAGACAAAGATTGGGATCCTAGCTAATGCTTAGAGAAATGGTTTAAAAAAGAGGAAAAATCAAAATTAAAAGGTGCTTTCTTAGAAAAATGGACCTGCAAGGAATCTGCTGCTGTTATGTCTTCTGCAAGGATTTTTATGAATGCAAATGGGTTTTTCCCTTTCACCAATAAGGATCCCGTCACAAATGATAAAGCAATACTTGGTCTGCTGTACATTATGACTTTTTTGGAGATTTGGGAGGCCTCCTAGATTATACGATTACAGAAGAGGGTTGCTAGGAGG

XM_004843131.1 Coding sequence

Ccdc113 coiled-coil domain containing 113, transcript variant X1

High confidence: 4 potential gene matches
Length: 1134 bp    Location: 27979938..27955080   Strand: -
>XM_004843131.1
ATGACTGACGAGGACTCCGACAGTGTATACCCTGATTACCAGACAGGGGAAGAGAGGGAGCTGCCTGTTATCCAGTTGTGTGGGCTGGTGGAGGAACTCAGCTATGGAAACTCTGGTCTCAAAAGAGAGACAGAGATGTTTGAGAAATATTACGCTAAATTGGAAACCAGGGATCAGCAATCTTTACAGATATCTGATGCTAAAATATCAACAGCAGAATTCGCCCAGTTAAGAGGCCGGCGTAAGTCCAGGTCCCGCCCAGATACAGACCGTGTAATAGGTCTCACTGTGGACCAGAAACTTGAGCTTGTAAAAAAAGAGCTGGAGGACACAAAGGATGAAATAAGGCATGTGAGGGCTAATGCTGAACGAGACCTGCAGTACCATGAGGCAATCCTTGAAGAAGCTGAAATTCGATGGGCTGAAATTCAGAAAGCAGTGCATGAATTTGAAAGAGATATTCTAAAAACCATACCCAAGAAGAAAGGGAGTATCTTGGCTACTCAGAAGGTGATGAAATATATTGAAGACATGAACCACCAGAGGGATAATATGAAGGATAAATTACGTTTGAAAAATGTTTCTCTACAAGTTCAGAGGAAAAAAATGCTTTTACAATTGAGGCAGAAGGAAGAGGTAGGAGAGGCCCTCCATGAAGTTGACTTTCAGCAGCTGAACATCGAGAATGCTCAGTTCTTAGAGATGATTGAAGCAAAGAATCAAGAACTGATTCAGCTGAAGCTGGCATCTGGCAACACCCTTCAGGTCCTCAGCACCTACAAAAACAAGCTTCACCAAGCAATGGAAATGTACAACAATTTGGACAAGGAGATCTTGCTGAGAAATGAGCTGCTTGAAAAAATTCAAAGAGAAACCCTACAAGTAGAGGAGGACCGGGCCAAAGCAGAGGCTTTGAACAAGAAGTTGCACAAGCAGATGGCCGAGTTCCGGGTGCCGCCAGTGATGATGTATGTCCGGGAGAAGATCTTAAACGGCGACCTGGAGAAGACCATCAAGATGTGGGAGAGGAAAGTGGAGATTGCAGAGATGTCCTTAAAAGGCTACCGCAAGGTTTGGAATAGAATGAAAACAACCAATGAGCAGTTGCAGGCAGATTTCACCTCTGGGAAATAA

XM_004843138.1 Coding sequence

Usb1 U6 snRNA biogenesis 1, transcript variant X3

Length: 738 bp    Location: 28166043..28152265   Strand: -
>XM_004843138.1
ATGAGCGCGGCGCCCCTGGTGGGCTACAGCAGCAGCGGCTCGGAGGATGAGGCCGAGGCCGCGGTCACCGAGCAGACCAGCCCGGGGTCTGGGGGCCACTGCCGTGGCCAGAGCCCCCTTCCCAATGAGAGGTTTCCAGTACCTGACAGTGTACTGAACATGTTCCCGGGCACAGAGGAAGGACCTGAGGATGACAGTGCAAAACATGGGGGACGAGTGCGTACCTTTCCCCACGAGCGTGGCAACTGGGTCACCCATGTCTATGTACCATATGAAGCCAGGGAGGAATTCCCAGATCTTCTTGACATGCTGCTGCCCCAGGCCCAGGCCTACGTGCCCCGGCTGGTGAAGATGGAGGCGTTCCACCTCAGCCTGTCTCAGAGCGTGGTTCTGCGCCACCATTGGATCCTCCCTTTTGTGCAGGCTCTGAAAGACCGAATGGCCTCCTTTGAAAGGTTCCTCTTTACTGCCAACCAGGTAAAGATTTATACCAATCAAGAGAAGACCAGGACCTTTGTTGGGCTTGAAGTCACCTCGGGGTATGCCCAGTTCTTGGACTTAGTTTCAGAAGTGGACAGAGTCATGGAGGAATTTGACCTCACCACTTTCTACCAGGAAATCGTGGATGAGTTTGAAGACTCTGAGATGCTGTTGCGTGTGCAGGCCATGCAGGTCCGCTGCAAGTCTGGGAACAAGTTCTTCTCCATGCCTTTGAACCAGGTGCCTGGGGAGACCTGA

XM_004843147.1 Coding sequence

Kifc3 kinesin family member C3, transcript variant X2

Length: 2832 bp    Location: 28327145..28359649   Strand: +
>XM_004843147.1
ATGGTCCCCTCTCCCCGGACCCGGAACCTGGGAGCCACGCCCTCACTGCCCGGCCCGCGGAGAGTGGGCCGGGCCGGGGAGCCGCCAGAGCCCAAGATGGCTCGCCCCGCCCCAGCCCCAGCCAGCCCGGCTGCCCGCCCTTTCTCACACACCGGCTCGGGGAGGTTGAGAACTGGGCGTGGAAAAGACACAGTGGTTGGCAGTGACGAGGACTCCAGTGCCCGAATTGCAGCTCGCCCGGCCCTAGGACAGTGCCGAACCCTCAGCGGGGACTGGGCAGGCCCTGGGAGTCCCCGCAGGCTCTACCTGACCGTGCGGCAAGCCCTGCAGGACAAGGGGTGCAAGAGCAAGAGTCAGGGGACGAAAGAAGACAATCTCCCGAAGAGGCAGGCGCTGGTCCCCAGGCGGGACCGAGAGGCCCTGAAAGCTGGTGCTGCCACGAATGTAGAGAAAACAGGTGGGCGGCTCTTTGGCAAAGGGAGGTGCTCGAGCCTGCCAGGGTCGCCAGGGGCGGCCCCTGAGGTGCATAGGATGGTGGAGGCCATGTCCCAGCTTCAGAAGGAGAAAGCTCAGCTTCAGGAGGAGCTGGCAGTCCTACGGGAGAGGCTGGCCCTCCACGACAGTGACCAGCAAACCACAACCACCCAGCTGCAAAACCAGGTGGAAAATCTCAAGGAGAAGCTCGTCAGCCAGGCCCAGGAAGTGACCCGCCTGCGATCCGAGCTGGGAGGCACTGAATTGGAGAAGCAGCGCCGGGACCCACTGATGGTGGAGAATGAGCGGCTGAGGCAGGAGCTAGGGCGCTACGAGGCTGAGCTGCAGGAGCTGTGTGCCCAGCCGGCAGCCACACCCTGCTTGGGCTGCAAGCACAGCCAGGAGAGCACCCAGCTCCGCCACAAGGTATCCCAGTTGCAGCTGGAGGTGGCGGAGAACAAGGGCATGCTGTCGGAGCTGAACCTGGAGGTGCAGCAGAAGACCGACCGGCTAGCTGAGGTGGAGCTGCGGCTCAAAGACTGCCTGGCTGAGAAGGCACAGGAGGAAGAGCGGCTCAGCCGACGCCTGCGAGACAGCCATGAGACCATTGCCAGCCTGCAGGCCCAGTCTCCACCTGTCAAGTATGTCACCAAGACAGTGGAGGTGGAGTCGTCCAAGACCAAGCAGGCTCTCAGTGAGTCCCAGGCCCAGAACCAGCACCTGCAGGAGCAGGTGGCCATGCAGCGGCAGGTGCTGAAGGAGATGGAGCAGCAGCTTCACAGCTCAAATCAGCTGACCACGCAGCTCCGGGCACAGATCTCCATGTATGAGACAGAGCTGGAGCGGGCCCATGGGCAGATGCTGGAGGAGATGCAGTCCATGGAGGAGGACAAGAACCGGGCCATTGAGGAGGCCTTTGCCAGAGCCCAGGTGGAGATGAAGGCTGTTCATGAGAACCTGGCAGGTGTCCGGACAAACCTACTGATGTTGCAGCCAGCACTGCGGACCCTCACCAATGACTACAATGGGCTTAAGCGGCAGGTGCGCAACTTCCCAATGCTGCTGGATGAGGCCCTCCAGAGCGCCAAGGCTGAGATTGACCAGATCATTGAGGAGGTCAACAGCAACAACCATGACCTGCTTCGCAAGTACCGCCGGGAGCTGCAGCTGCGCAAGAAGTGCCACAACGAGCTTGTGCGGCTGAAAGGAAACATCCGGGTGATTGCTCGTGTTCGGCCCATCACCAAAGAGGACGGGGAAGGACCCGATGCGACCAATGTTGTGTCCTTTGATCCCGATGATGACGCTATCATTCACCTACTGCACAAGGGCAAGCCAGTGTCCTTTGAGCTGGATAAGGTCTTCTCCCCGCAGGCCTCACAGCAGGACGTATTTCAGGAGGTGCAGGCCTTGATCACTTCCTGCATCGATGGCTTCAATGTCTGCATCTTTGCCTATGGCCAGACGGGTGCCGGCAAGACATACACGATGGAGGGAACCCCCGAGAACCCAGGCATCAACCAACGGGCCCTGCAGCTGCTCTTCTCAGAGGTTCGGGAAAAGGCATCCGACTGGGAGTATACCATCACCGTCAGCGCTGCTGAGATCTATAATGAGATCCTCAGGGACCTGCTGGGGACAGAGCCTCAGGAGAAGCTGGAGATTCGGCTGTGCCCAGACGGCAGTGGGCAACTGTATGTGCCAGGGCTGACCCGGTTCCGGGTGCAGAGCGTGGCTGACATCAACAAGGTGTTTGAGTTCGGCTATGCGAATCGCACCACGGAGTTCACCAACTTGAACGAGCACAGTTCCCGCTCTCATGCCCTGCTCATCGTGACTGTTCAGGGCCGGGATTGCAGCACAGGCATCCGCACCATGGGGAAGCTGAACCTGGTGGATTTGGCTGGCTCAGAGCGTGTGGGCAAGTCAGGTGCTGAGGGCAGCCGTCTGCGGGAGGCACAGCACATCAACAAGTCACTGTCGGCCCTGGGGGACGTCATTGCTGCCCTGCGCTCTCGCCAGGGCCATGTGCCCTTCCGCAACTCCAAGCTCACCTACCTGCTGCAGGACTCGCTGAGTGGCGACAGCAAGACACTTATGGTGGTGCAGGTGTCTCCTGTGGAGAAGAACACCAGCGAGACGCTCTACTCCCTCAGGTTCGCTGAGAGGGTGCGCTCCGTGGAGCTGGGTCCCGGGTCCCGCCGCACAGAGCTCGGGTCCTGGTCGAGCCAGGAGCATCTGGAGTTGGAGCCAACTTGCCAGACACCACAGCCAACAGCTCGAGCGCACTCAGCCCCTGGCTCTGGGACCTCCAGCCGTCCTGGCTCTATCCGGAGGAAGCTGCAGCCGTCAGCCTGA

XM_004843148.1 Coding sequence

Kifc3 kinesin family member C3, transcript variant X3

High confidence: 4 potential gene matches
Length: 2511 bp    Location: 28327145..28359649   Strand: +
>XM_004843148.1
ATGGTCCCCTCTCCCCGGACCCGGAACCTGGGAGCCACGCCCTCACTGCCCGGCCCGCGGAGAGTGGGCCGGGCCGGGGAGCCGCCAGAGCCCAAGATGGCTCGCCCCGCCCCAGCCCCAGCCAGCCCGGCTGCCCGCCCTTTCTCACACACCGGCTCGGGGAGGTTGAGAACTGGGCGTGGAAAAGACACAGTGGTTGGCAGTGACGAGGACTCCAGTGCCCGAATTGCAGCTCGCCCGGCCCTAGGACAGTGCCGAACCCTCAGCGGGGACTGGGCAGGCCCTGGGAGTCCCCGCAGGCTCTACCTGACCGTGCGGGTGGAAAATCTCAAGGAGAAGCTCGTCAGCCAGGCCCAGGAAGTGACCCGCCTGCGATCCGAGCTGGGAGGCACTGAATTGGAGAAGCAGCGCCGGGACCCACTGATGGTGGAGAATGAGCGGCTGAGGCAGGAGCTAGGGCGCTACGAGGCTGAGCTGCAGGAGCTGTGTGCCCAGCCGGCAGCCACACCCTGCTTGGGCTGCAAGCACAGCCAGGAGAGCACCCAGCTCCGCCACAAGGTATCCCAGTTGCAGCTGGAGGTGGCGGAGAACAAGGGCATGCTGTCGGAGCTGAACCTGGAGGTGCAGCAGAAGACCGACCGGCTAGCTGAGGTGGAGCTGCGGCTCAAAGACTGCCTGGCTGAGAAGGCACAGGAGGAAGAGCGGCTCAGCCGACGCCTGCGAGACAGCCATGAGACCATTGCCAGCCTGCAGGCCCAGTCTCCACCTGTCAAGTATGTCACCAAGACAGTGGAGGTGGAGTCGTCCAAGACCAAGCAGGCTCTCAGTGAGTCCCAGGCCCAGAACCAGCACCTGCAGGAGCAGGTGGCCATGCAGCGGCAGGTGCTGAAGGAGATGGAGCAGCAGCTTCACAGCTCAAATCAGCTGACCACGCAGCTCCGGGCACAGATCTCCATGTATGAGACAGAGCTGGAGCGGGCCCATGGGCAGATGCTGGAGGAGATGCAGTCCATGGAGGAGGACAAGAACCGGGCCATTGAGGAGGCCTTTGCCAGAGCCCAGGTGGAGATGAAGGCTGTTCATGAGAACCTGGCAGGTGTCCGGACAAACCTACTGATGTTGCAGCCAGCACTGCGGACCCTCACCAATGACTACAATGGGCTTAAGCGGCAGGTGCGCAACTTCCCAATGCTGCTGGATGAGGCCCTCCAGAGCGCCAAGGCTGAGATTGACCAGATCATTGAGGAGGTCAACAGCAACAACCATGACCTGCTTCGCAAGTACCGCCGGGAGCTGCAGCTGCGCAAGAAGTGCCACAACGAGCTTGTGCGGCTGAAAGGAAACATCCGGGTGATTGCTCGTGTTCGGCCCATCACCAAAGAGGACGGGGAAGGACCCGATGCGACCAATGTTGTGTCCTTTGATCCCGATGATGACGCTATCATTCACCTACTGCACAAGGGCAAGCCAGTGTCCTTTGAGCTGGATAAGGTCTTCTCCCCGCAGGCCTCACAGCAGGACGTATTTCAGGAGGTGCAGGCCTTGATCACTTCCTGCATCGATGGCTTCAATGTCTGCATCTTTGCCTATGGCCAGACGGGTGCCGGCAAGACATACACGATGGAGGGAACCCCCGAGAACCCAGGCATCAACCAACGGGCCCTGCAGCTGCTCTTCTCAGAGGTTCGGGAAAAGGCATCCGACTGGGAGTATACCATCACCGTCAGCGCTGCTGAGATCTATAATGAGATCCTCAGGGACCTGCTGGGGACAGAGCCTCAGGAGAAGCTGGAGATTCGGCTGTGCCCAGACGGCAGTGGGCAACTGTATGTGCCAGGGCTGACCCGGTTCCGGGTGCAGAGCGTGGCTGACATCAACAAGGTGTTTGAGTTCGGCTATGCGAATCGCACCACGGAGTTCACCAACTTGAACGAGCACAGTTCCCGCTCTCATGCCCTGCTCATCGTGACTGTTCAGGGCCGGGATTGCAGCACAGGCATCCGCACCATGGGGAAGCTGAACCTGGTGGATTTGGCTGGCTCAGAGCGTGTGGGCAAGTCAGGTGCTGAGGGCAGCCGTCTGCGGGAGGCACAGCACATCAACAAGTCACTGTCGGCCCTGGGGGACGTCATTGCTGCCCTGCGCTCTCGCCAGGGCCATGTGCCCTTCCGCAACTCCAAGCTCACCTACCTGCTGCAGGACTCGCTGAGTGGCGACAGCAAGACACTTATGGTGGTGCAGGTGTCTCCTGTGGAGAAGAACACCAGCGAGACGCTCTACTCCCTCAGGTTCGCTGAGAGGGTGCGCTCCGTGGAGCTGGGTCCCGGGTCCCGCCGCACAGAGCTCGGGTCCTGGTCGAGCCAGGAGCATCTGGAGTTGGAGCCAACTTGCCAGACACCACAGCCAACAGCTCGAGCGCACTCAGCCCCTGGCTCTGGGACCTCCAGCCGTCCTGGCTCTATCCGGAGGAAGCTGCAGCCGTCAGGGAAAATGAGACCGGTGCCTGTGTAA

XR_205174.1 Non-coding sequence

Kifc3 PREDICTED: Heterocephalus glaber kinesin family member C3 (Kifc3), transcript variant X7, misc_RNA.

Length: 3527 bp     
>XR_205174.1
CCTGGGAGTCCCCGCAGGCTCTACCTGACCGTGCGGGTAAGCACTGGGCCTTCAGCAAGACAAGGCGGCAAGCCCTGCAGGACAAGGGGTGCAAGAGCAAGAGTCAGGGGACGAAAGAAGACAATCTCCCGAAGAGGCAGGCGCTGGTCCCCAGGCGGGACCGAGAGGCCCTGAAAGCTGGTGCTGCCACGAATGTAGAGAAAACAGGTGGGCGGCTCTTTGGCAAAGGGAGGTGCTCGAGCCTGCCAGGGTCGCCAGGGGCGGCCCCTGAGGTGCATAGGATGGTGGAGGCCATGTCCCAGCTTCAGAAGGAGAAAGCTCAGCTTCAGGAGGAGCTGGCAGTCCTACGGGAGAGGCTGGCCCTCCACGACAGTGACCAGCAAACCACAACCACCCAGCTGCAAAACCAGGTGGAAAATCTCAAGGAGAAGCTCGTCAGCCAGGCCCAGGAAGTGACCCGCCTGCGATCCGAGCTGGGAGGCACTGAATTGGAGAAGCAGCGCCGGGACCCACTGATGGTGGAGAATGAGCGGCTGAGGCAGGAGCTAGGGCGCTACGAGGCTGAGCTGCAGGAGCTGTGTGCCCAGCCGGCAGCCACACCCTGCTTGGGCTGCAAGCACAGCCAGGAGAGCACCCAGCTCCGCCACAAGGTATCCCAGTTGCAGCTGGAGGTGGCGGAGAACAAGGGCATGCTGTCGGAGCTGAACCTGGAGGTGCAGCAGAAGACCGACCGGCTAGCTGAGGTGGAGCTGCGGCTCAAAGACTGCCTGGCTGAGAAGGCACAGGAGGAAGAGCGGCTCAGCCGACGCCTGCGAGACAGCCATGAGACCATTGCCAGCCTGCAGGCCCAGTCTCCACCTGTCAAGTATGTCACCAAGACAGTGGAGGTGGAGTCGTCCAAGACCAAGCAGGCTCTCAGTGAGTCCCAGGCCCAGAACCAGCACCTGCAGGAGCAGGTGGCCATGCAGCGGCAGGTGCTGAAGGAGATGGAGCAGCAGCTTCACAGCTCAAATCAGCTGACCACGCAGCTCCGGGCACAGATCTCCATGTATGAGACAGAGCTGGAGCGGGCCCATGGGCAGATGCTGGAGGAGATGCAGTCCATGGAGGAGGACAAGAACCGGGCCATTGAGGAGGCCTTTGCCAGAGCCCAGGTGGAGATGAAGGCTGTTCATGAGAACCTGGCAGGTGTCCGGACAAACCTACTGATGTTGCAGCCAGCACTGCGGACCCTCACCAATGACTACAATGGGCTTAAGCGGCAGGTGCGCAACTTCCCAATGCTGCTGGATGAGGCCCTCCAGAGCGCCAAGGCTGAGATTGACCAGATCATTGAGGAGGTCAACAGCAACAACCATGACCTGCTTCGCAAGTACCGCCGGGAGCTGCAGCTGCGCAAGAAGTGCCACAACGAGCTTGTGCGGCTGAAAGGAAACATCCGGGTGATTGCTCGTGTTCGGCCCATCACCAAAGAGGACGGGGAAGGACCCGATGCGACCAATGTTGTGTCCTTTGATCCCGATGATGACGCTATCATTCACCTACTGCACAAGGGCAAGCCAGTGTCCTTTGAGCTGGATAAGGTCTTCTCCCCGCAGGCCTCACAGCAGGACGTATTTCAGGAGGTGCAGGCCTTGATCACTTCCTGCATCGATGGCTTCAATGTCTGCATCTTTGCCTATGGCCAGACGGGTGCCGGCAAGACATACACGATGGAGGGAACCCCCGAGAACCCAGGCATCAACCAACGGGCCCTGCAGCTGCTCTTCTCAGAGGTTCGGGAAAAGGCATCCGACTGGGAGTATACCATCACCGTCAGCGCTGCTGAGATCTATAATGAGATCCTCAGGGACCTGCTGGGGACAGAGCCTCAGGAGAAGCTGGAGATTCGGCTGTGCCCAGACGGCAGTGGGCAACTGTATGTGCCAGGGCTGACCCGGTTCCGGGTGCAGAGCGTGGCTGACATCAACAAGGTGTTTGAGTTCGGCTATGCGAATCGCACCACGGAGTTCACCAACTTGAACGAGCACAGTTCCCGCTCTCATGCCCTGCTCATCGTGACTGTTCAGGGCCGGGATTGCAGCACAGGCATCCGCACCATGGGGAAGCTGAACCTGGTGGATTTGGCTGGCTCAGAGCGTGTGGGCAAGTCAGGTGCTGAGGGCAGCCGTCTGCGGGAGGCACAGCACATCAACAAGTCACTGTCGGCCCTGGGGGACGTCATTGCTGCCCTGCGCTCTCGCCAGGGCCATGTGCCCTTCCGCAACTCCAAGCTCACCTACCTGCTGCAGGACTCGCTGAGTGGCGACAGCAAGACACTTATGGTGGTGCAGGTGTCTCCTGTGGAGAAGAACACCAGCGAGACGCTCTACTCCCTCAGGTTCGCTGAGAGGGTGCGCTCCGTGGAGCTGGGTCCCGGGTCCCGCCGCACAGAGCTCGGGTCCTGGTCGAGCCAGGAGCATCTGGAGTTGGAGCCAACTTGCCAGACACCACAGCCAACAGCTCGAGCGCACTCAGCCCCTGGCTCTGGGACCTCCAGCCGTCCTGGCTCTATCCGGAGGAAGCTGCAGCCGTCAGATGGGAAAACCAGGCCCCAGGAGAGAAGGCGCCAGGTCAAGATCCTTGGAGGCAGGCCATCCTGGCTCTCGCACAACACCTCCAAGGCAGGCGGCCTCTTTGCCCTGGGCCTTGATGTTGGTATTCTTGTGGGATGAGGGGCAGAAAGCTCAGGGCTCACTTCACGTGAGGAGTGAGCTTCCCTCATGCAAGGGCCTGGCCAGTCCTTAAGTCCAGAGGGTTGGGGGTGGCAGGGCCCTAGCAGGAGAGGACAAGCCCACCAGTGAGACACCTGTCACTTTGATTTCAGCCTGACGGCTGGGGCTGCAGTCTCCAGGGAAAATGAGACCGGTGCCTGTGTAAGGACAAGGATGTGCCACCCTACTGGGCCTGGAGTCGGCCTGCTCCTGCTGCAGCATCAGGGATGGAAGTGGAGGCCCTCCTGTTCTGCAGCAGAGATGAGAGACTCAGAAGGAAGTGCTGTCTTGGCTGTTGCTCTGGGTCCAAGTGGCATAGCAGGAATGGCCTATTCTGCCTGGCAGGCTCTGGGCATCAGAGCTGGTCCTCATGGGTAGGGCAGGCCTCTTGCTGGGCTGGCCCAGCTCCTTTCCTGAGCCAGAGGGCCGGCCCGGCAGCCCCCTTCTAGTGCATGGCCCAAGAGGCCTCTGGGAAGGCACAGGGGCTCCACGGTACAGGTCTGATTTAGTGGGCATCGAGGGGCATCCCACAGGGGTGTGTACAGTGGTACAGTGTACTCATAGATGTACAAAGGAGCCCGGCCACCTGCCATGGCCGGGCTATATTTATGGCTGGCAGAAAAGGCCAGTGGGCAAGGTTCTTTCCCCTCACCTGCCTGGCACCAGGTATTCTCCTTGCTCACTGGCTTCCTGACATTTTCCTCCCTCTGAAATCCTATTTAAGAACTTTTGGAATTTAGCCATTTTTATTAAAATAAAAACCTTTTTACACAA

XR_205172.1 Non-coding sequence

Kifc3 PREDICTED: Heterocephalus glaber kinesin family member C3 (Kifc3), transcript variant X5, misc_RNA.

Length: 3523 bp     
>XR_205172.1
TCAAATGCCAGACATACTCAGAGTGAACTGGACAGCCACCTCCTTTCCCTTCCTCCTTCCCATGCAAGCCCTGCAGGACAAGGGGTGCAAGAGCAAGAGTCAGGGGACGAAAGAAGACAATCTCCCGAAGAGGCAGGCGCTGGTCCCCAGGCGGGACCGAGAGGCCCTGAAAGCTGGTGCTGCCACGAATGTAGAGAAAACAGGTGGGCGGCTCTTTGGCAAAGGGAGGTGCTCGAGCCTGCCAGGGTCGCCAGGGGCGGCCCCTGAGGTGCATAGGATGGTGGAGGCCATGTCCCAGCTTCAGAAGGAGAAAGCTCAGCTTCAGGAGGAGCTGGCAGTCCTACGGGAGAGGCTGGCCCTCCACGACAGTGACCAGCAAACCACAACCACCCAGCTGCAAAACCAGGTGGAAAATCTCAAGGAGAAGCTCGTCAGCCAGGCCCAGGAAGTGACCCGCCTGCGATCCGAGCTGGGAGGCACTGAATTGGAGAAGCAGCGCCGGGACCCACTGATGGTGGAGAATGAGCGGCTGAGGCAGGAGCTAGGGCGCTACGAGGCTGAGCTGCAGGAGCTGTGTGCCCAGCCGGCAGCCACACCCTGCTTGGGCTGCAAGCACAGCCAGGAGAGCACCCAGCTCCGCCACAAGGTATCCCAGTTGCAGCTGGAGGTGGCGGAGAACAAGGGCATGCTGTCGGAGCTGAACCTGGAGGTGCAGCAGAAGACCGACCGGCTAGCTGAGGTGGAGCTGCGGCTCAAAGACTGCCTGGCTGAGAAGGCACAGGAGGAAGAGCGGCTCAGCCGACGCCTGCGAGACAGCCATGAGACCATTGCCAGCCTGCAGGCCCAGTCTCCACCTGTCAAGTATGTCACCAAGACAGTGGAGGTGGAGTCGTCCAAGACCAAGCAGGCTCTCAGTGAGTCCCAGGCCCAGAACCAGCACCTGCAGGAGCAGGTGGCCATGCAGCGGCAGGTGCTGAAGGAGATGGAGCAGCAGCTTCACAGCTCAAATCAGCTGACCACGCAGCTCCGGGCACAGATCTCCATGTATGAGACAGAGCTGGAGCGGGCCCATGGGCAGATGCTGGAGGAGATGCAGTCCATGGAGGAGGACAAGAACCGGGCCATTGAGGAGGCCTTTGCCAGAGCCCAGGTGGAGATGAAGGCTGTTCATGAGAACCTGGCAGGTGTCCGGACAAACCTACTGATGTTGCAGCCAGCACTGCGGACCCTCACCAATGACTACAATGGGCTTAAGCGGCAGGTGCGCAACTTCCCAATGCTGCTGGATGAGGCCCTCCAGAGCGCCAAGGCTGAGATTGACCAGATCATTGAGGAGGTCAACAGCAACAACCATGACCTGCTTCGCAAGTACCGCCGGGAGCTGCAGCTGCGCAAGAAGTGCCACAACGAGCTTGTGCGGCTGAAAGGAAACATCCGGGTGATTGCTCGTGTTCGGCCCATCACCAAAGAGGACGGGGAAGGACCCGATGCGACCAATGTTGTGTCCTTTGATCCCGATGATGACGCTATCATTCACCTACTGCACAAGGGCAAGCCAGTGTCCTTTGAGCTGGATAAGGTCTTCTCCCCGCAGGCCTCACAGCAGGACGTATTTCAGGAGGTGCAGGCCTTGATCACTTCCTGCATCGATGGCTTCAATGTCTGCATCTTTGCCTATGGCCAGACGGGTGCCGGCAAGACATACACGATGGAGGGAACCCCCGAGAACCCAGGCATCAACCAACGGGCCCTGCAGCTGCTCTTCTCAGAGGTTCGGGAAAAGGCATCCGACTGGGAGTATACCATCACCGTCAGCGCTGCTGAGATCTATAATGAGATCCTCAGGGACCTGCTGGGGACAGAGCCTCAGGAGAAGCTGGAGATTCGGCTGTGCCCAGACGGCAGTGGGCAACTGTATGTGCCAGGGCTGACCCGGTTCCGGGTGCAGAGCGTGGCTGACATCAACAAGGTGTTTGAGTTCGGCTATGCGAATCGCACCACGGAGTTCACCAACTTGAACGAGCACAGTTCCCGCTCTCATGCCCTGCTCATCGTGACTGTTCAGGGCCGGGATTGCAGCACAGGCATCCGCACCATGGGGAAGCTGAACCTGGTGGATTTGGCTGGCTCAGAGCGTGTGGGCAAGTCAGGTGCTGAGGGCAGCCGTCTGCGGGAGGCACAGCACATCAACAAGTCACTGTCGGCCCTGGGGGACGTCATTGCTGCCCTGCGCTCTCGCCAGGGCCATGTGCCCTTCCGCAACTCCAAGCTCACCTACCTGCTGCAGGACTCGCTGAGTGGCGACAGCAAGACACTTATGGTGGTGCAGGTGTCTCCTGTGGAGAAGAACACCAGCGAGACGCTCTACTCCCTCAGGTTCGCTGAGAGGGTGCGCTCCGTGGAGCTGGGTCCCGGGTCCCGCCGCACAGAGCTCGGGTCCTGGTCGAGCCAGGAGCATCTGGAGTTGGAGCCAACTTGCCAGACACCACAGCCAACAGCTCGAGCGCACTCAGCCCCTGGCTCTGGGACCTCCAGCCGTCCTGGCTCTATCCGGAGGAAGCTGCAGCCGTCAGATGGGAAAACCAGGCCCCAGGAGAGAAGGCGCCAGGTCAAGATCCTTGGAGGCAGGCCATCCTGGCTCTCGCACAACACCTCCAAGGCAGGCGGCCTCTTTGCCCTGGGCCTTGATGTTGGTATTCTTGTGGGATGAGGGGCAGAAAGCTCAGGGCTCACTTCACGTGAGGAGTGAGCTTCCCTCATGCAAGGGCCTGGCCAGTCCTTAAGTCCAGAGGGTTGGGGGTGGCAGGGCCCTAGCAGGAGAGGACAAGCCCACCAGTGAGACACCTGTCACTTTGATTTCAGCCTGACGGCTGGGGCTGCAGTCTCCAGGGAAAATGAGACCGGTGCCTGTGTAAGGACAAGGATGTGCCACCCTACTGGGCCTGGAGTCGGCCTGCTCCTGCTGCAGCATCAGGGATGGAAGTGGAGGCCCTCCTGTTCTGCAGCAGAGATGAGAGACTCAGAAGGAAGTGCTGTCTTGGCTGTTGCTCTGGGTCCAAGTGGCATAGCAGGAATGGCCTATTCTGCCTGGCAGGCTCTGGGCATCAGAGCTGGTCCTCATGGGTAGGGCAGGCCTCTTGCTGGGCTGGCCCAGCTCCTTTCCTGAGCCAGAGGGCCGGCCCGGCAGCCCCCTTCTAGTGCATGGCCCAAGAGGCCTCTGGGAAGGCACAGGGGCTCCACGGTACAGGTCTGATTTAGTGGGCATCGAGGGGCATCCCACAGGGGTGTGTACAGTGGTACAGTGTACTCATAGATGTACAAAGGAGCCCGGCCACCTGCCATGGCCGGGCTATATTTATGGCTGGCAGAAAAGGCCAGTGGGCAAGGTTCTTTCCCCTCACCTGCCTGGCACCAGGTATTCTCCTTGCTCACTGGCTTCCTGACATTTTCCTCCCTCTGAAATCCTATTTAAGAACTTTTGGAATTTAGCCATTTTTATTAAAATAAAAACCTTTTTACACAA

XM_004843152.1 Coding sequence

Ccdc135 coiled-coil domain containing 135, transcript variant X4

Length: 2466 bp    Location: 28401874..28386638   Strand: -
>XM_004843152.1
ATGATAGGTACCTCCAAGCCATTGCCACTGCTCCACCGACAGCTGCCATATGCCAGACCTGGACGCTGCCTTTCCAGCCAGGGGCTGCTCTGCTACCCCAGGGCCCTCAGGCCTGGCCTGCTGCATGGGCCTCCATTCCCCGGGTCTCCCTGTGCTTTGGAGGAAAGAGGCCACTCCAGGGTGCCTCTGCCTGACCCCCTCAAGCCGCCCTCGCACCTGTATTCCTCAACCACGGTGCTCAAGCACCAGAAGGGGAACTGCTTCGACTTCAGCACGCTGCTCTGTTCCATGCTGCTTGGTGCTGGCTACGATGCCTACTGCGTCAATGGGTATGGCTCCCAGGCTCTGTGCAACATGGACCTGACTCGGGAGGTCTGCCCACTCACCGTGACACCCAAAGAGACAGTCAAGAAGAAAGAGAAGGCACAGCCCAAGAAGTACACCATCAAACCGCCACGGGACCTGACCAGCAGGTTTGAGCAGGAGCAGGAGATCAAGAAGCAGAAGGAGGCCAAAGCCCAGGAGGAGAAGCGGTGGTGGGAAGAAGAAGAAGAGCACCTTCTGGAGGCAGAGAGGGCGAAGCCTGACCCCCTACATGGCCTTCGGGTGCACTGCTGGGTCCTGGTGCTGTTGGGGAAGCGAGAGGTGCCTGAGAGCTTCTTCATCGACCCTTTCACTGGCCGCAGCTACAGCATCCAGGATGATCACTTCCTGGGCATCGAGAGCCTCTGGAACCACAGGAACTATTGGATCAACATGCAGGACTGCCGGAACTGCTGCAAGGACTTGGTCTTTGACCTGGGAGACTCTGTGAGGTGGGAGTACATGCTCTTGGGGACAGATAAGCCTCATCTGTCCTTGACTGAGGAAGAGGATGAAGGGATGAATGATGACAATGACACAGAAGATCTGGACAAGGAGAACCAGGATAAGAGCTTCGATATGCCGTCCTCATGGGTGGAGCAGATCGACATCTCCCCAGAAGGTCTCTGCCAATGCGTGTTCAGTGCTTTCTCCAGAACCATCCCTGGACTCCAGGAAGCATTTGAAACCCACTGCCTGAACGGGAAGAAGGTGCTGCATTACAGGAGGGCACAGCTGGAGAAATGGGCCCCGTACCTCAACAGCAATGGCCTGGTGTGCCGCCTCACCACCTACGAAGACCTGGAGTGTACCAAGATTTTGGAGATCAAGGAGTGGTATCAGAACCGGGAGGACATGCTGGAGCTGAAGCACATAAACAACAGCACAAGCCTGCACACTGACTACTTCAGGCCGGGCCACCCCCGGGCTCTGCATGTGCACTCATACAAGTCCATGGAGCCTGAGAATGACCGTGTCATGGAGTTTTATGAAACAGCCCGTGTGGACGGCCTGATAAAATGGGAGGAGACTCCCAGGACAATGACTCAGTACTATCAAGGACGCCCAGACTTCCTCTCCTACCGCCATATCAACTTTGGGCCCAGGTTCAAGAAGCTCACTTTGACCAGCACAGAGTCGAACCCCCGGCCCATACTGAAAATCACAGAGCGGTTCTCCCGAAACCCAGCGAAGCCCGCAGATGAGGATGTGGCAGAGCGTGTGTTCTTGATCTCCGAGGAGCGCATCCAACTGCGCTACCACTGCCGTGATGACTACATCACTGCCTCCAAGCGCGAGTTCCTGCAGCGCTCTGAGGTGGACAGCAAGGGCAACAAGATCATCATGACATCAGACGTGTGCATCAGCTTTGAGGTGGAGCCCATGGAGCACACCAAGAAGCTTCTCTACCAGTACGAGACCATGATGCACCTGAAGAATGAGGAGAAGCTGTCCAAACACCAGGCCTGGGAGTCCGAGCTGGAGGTGGGGGCCCACAGGAGAGAGGGCAAAGGAAGTAATAGGGGGCATCTTAATCATACTTTGTGTCACTTCCCAACTCAGGTGCTGGAGATCCTGAAGCTTCGAGAGGAAGAGGAGGAGGCACACATACTGAACATCTCCATCTATGACACCAAGCGCAACGAAAAGAGCAAGGAGTATCGGGAGGCCATGGAGCGTGTGATGCACGAGGAGCACCTGCGGCAGGTGGAGGCCCAGCTGGACTACCTGGCTCCATTCCTGGCCCAGCTGCCCCCGGGTGAGAAGCTGACTCGTGTGCAGGCTGTGCACCTCAAGGATGCGTGCCTCGGTGACTTCAAGCAGCGGCTCATCGACAAGGCCAACCTTATCCAGGCCCGCTTCGAGAAGGAGAACCAGGAGCTGCAGAAGAAGCAGCAGTGGTACCAGGAGAACCAGGTGACCCTGACACCAGAGGATGAAGACTTGTACCTGAGTTACTGCTCTCAGGCCATGTTCCGTATCCGCATCCTGGAGCAGCGGCTCAATCGACACAAGGAGCTGGCCCCCCTGAAGTATTTGGCGTTGGAGGAAAAGCTCTACAAGGATCCACGCCTGGCAGAGTTCCTCAAAGTCTTCGCTTGA

XM_004842686.1 Coding sequence

Zc3h18 zinc finger CCCH-type containing 18, transcript variant X1

Length: 2934 bp    Location: 965937..923734   Strand: -
>XM_004842686.1
ATGGATGTGGCCGAGAGCCCTGAACGGGATCCTCACTCCCCAGAGGACGAAGAGGAGCAGCCGACACTCTCGGACGATGACATTCTGAGGGAAAGCGGATCAGATCAGGATTTAGATGGAGCTAGGGGGAGGGCTTCTGATTTGGAGGATGAGGAAAACGCAGCCCCAGTACCAGGCCAGGAGGAGGAGAACCGCTCCGATGAAGAGGACAGAGCCAGTGAACCCAAGTCCCAGGATCAGGACTCCGAGGCTCGAGAGCTGAGCAGGGATCGGACGGGCTCCCCGTGTGAAGAAGAGGGGAACGATGGCGAGGAAGACCAGACGAGTGACCTCAGGGACGAGGCCTCCTCGGTGACCAGGGAGCTGGACGAGCACGAACTGGACTATGACGAGGAGGTCCCTGAGGAGCCGGCCCCTGCCGCCCAGGAGGAGGAGGCCGAGAAGGCGGGGGCGGAGGAGGAGGAGGATAAGGAGGCCAGCGCGCCTGCCCAGGAAGGGAGGCCCACTGTCCAGAGTAGGGGAGAAAAGGAGCCCCCGGAGGCCACCAAGGAGAGGAGAAAAGAGGACGACGATGGGGAGATTGACGACGGGGAGATAGACGACGACGACTTGGAAGAAGGCGAAGTGAAGGACCCCAGTGACCGGAAGGTGAGGCCTCGCCCCACCTGCCGATTCTTCATGAAAGATGTTGTGACACCATTATCCACTCCTCCACCAATACCAAATTCCATACCACTCAGAGACCAGGTTAAAGGGAACTGTACCTGGGGGATGAACTGTAGGTTCATACACCCCGGAGTGAACGACAAGGGGAACTACTCCCTCATCACCAAAGCCGAGCCCTTCCCGCCCAACGGTGCCCCGCCACTCGGACCTCACCCCCTGATGCCTGCCAACCCGTGGGGTGGGCCAGTAGTTGATGAAATTTTGCCTCCACCCCCGCCGGAGCCCCCAACAGAGAGTGCCTGGGAACGTGGACTCCGGCATGCGAAGGAGGTTTTAAAAAAAGCAACCATTCGTAAGGAACAGGAGCCTGATTTTGAAGAGAAAAGGTTCACAGTGACCATTGGTGAAGATGAGCGAGAGTTTGACAAAGAAAATGAAGTTTTCCGGGATTGGAATTCTCGGGTCCCAAGAGATGTCAGAGATACAGCACTTGAGCCTTACGCAGATCCTTACTACGACTATGAAATAGAGCGGTTTTGGCGTGGTGGACAGTACGAGAATTTTAGGGTGCAATACACAGATGCAGAGCCGTATCATAATTACCGAGAAAGGGAGAGGGACCGAGAGCGTGAGAACAGACAGCGTGAGCGCGAGCGCGAGCGGGAGCGAGACCGAGAGCGCGAGCGGCGGCAGAGGGAGCGCGAGCGCGAGCGGGAGCGAGAGCGGGACAAGGAGCGGCAGCGGCGGAAGGAGGAGTGGGAGAGAGAGCGAGCCAAGCGCGACGAGAAGGACAGACAGCACCGGGACCGCGAGCGGGACCGCGACAAGGAGCGGGACAAGGACAAGGACAAGGACAAGCCGAAGGCCCGCTCTCCGCAGCCCCCAAGCCGTCAAGCTGAGCCACCGAAGAAGGAGGCCGCCTCAGGGCCACAGGTAAAGCGGGCCGATGAGTGGAAGGACCCATGGCGCCGATCCAAGTCTCCCAGGAAGAAACTCGGGGTGTCAGTCTCTCCTAGCCGGGCACGAAGGCGTCGAAAAACTTCTGCCTCCTCCGCCTCCGCCTCCAATTCCTCCAGGTCATCTTCTCGGTCTTCGTCCTACTCCGGCTCCGGCTCGTCACGGTCCAGGTCGAGGTCCTCATCCTACAGCTCCTACTCCAGCCGCTCTTCCAGACACAGCTCCTTCTCAGCCAGCCGGTCCAGGTCCCGGTCCTTCTCCTCGTCCCCGTCGCAGTCCCCCACACCCTCCCCACACAGACCTTCCATCAGAGCCAAGGGGGAGCTGGCGCCACCCCCCGGGAAAGCAGGAGAGAAGTCCTTGAAGAAGCCAGCCCCACCTCCAGTGCCCCTACAGGCCAGCAAGACTCCTGCCCCTGCCCCTGAGCCCACAAAGCCTGGAGACCCCCGGGAAACCAGGAGGAAGGAGCGGCAGGCCAGGACGCCCCCCCGGAGGCGAACGCTCAGCGGCAGTGGCAGTGGCAGCGGCAGCAGCTACAGTGGCTCCAGCTCCCGATCCAGGTCCCTGAGTGTGAGCAGCGTCTCCTCGGTGTCCAGCGCCACCTCGAGCAGCAGCTCGGTGCACAGCGTGGACTCGGAGGACATGTATGCGGACCTGGCCAGCCCCGTGTCCTCGGCCAGTTCCCAGTCCCCCACCCCAGCCCAGACCAAGAAGGAGCGAGGAAAATCAAAGAAAGAAGACGGCGTTAAGGAGGAAAAGCGAAAAAGGGACACCTCCACGCAGCCGCCCAAGTCCTCGAAGCCCGCGGCCAGCGGGAAGCCCTCACAGCAGCTCACAGCCCCGGCCCCCACGGCCCCTGGGCAGCCCCCCCAGGGCTCCTTCGTGGCCCACAAGGAGATCAAGCTGACGCTGCTGAACAAGGCAGCTGACAAAGGAAGTAGGAAGCGGTATGAGCCAGCGGACAAGGACCGACAAAGCCCCCCAGCCAAGCGGGCCACCCTGTCCCCAGACCGAGGTTCCCGGGACCGAAAGTCAGGCGGGAGACAGGGCTCCCCCAAGCCAGAGCGGCAGAGGAGCCAGAACTCCAAGGCCCTTGTGGCTCCCACAGACAGGAAGCGCCAGCTGTCACCCCAGTCCAAGAGCTCCAGCAAGGTGACCAGCGTGCCCGGCAAAGCTGCAGACAGCATGGCCCCGGGCACCAAGGCCGGCAAGGCCAGCACGCTGTCACGCCGGGAGGAGCTCCTGAAGCAGCTCAAGGCCGTGGAGGACGCCATCGCGCGCAAGCGAGCCAAGATCCCCGGGAAGGTGTAG

XM_004843161.1 Coding sequence

Dok4 docking protein 4, transcript variant X1

Length: 981 bp    Location: 28593903..28603872   Strand: +
>XM_004843161.1
ATGGCGACCAATTTCAATGACATCGTCAAGCAGGGCTATGTGAAGATGAAGAGCAGGAAGCTTGGGATCTACCGGAGGTGCTGGCTGGTATTCCGGAAGTCCTCCAGCAAGGGGCCCCAGCGGCTAGAGAAGTACCCGGATGAGAAGTCCGTGTGCCTCCGAGGCTGCCCCAAGGTGACTGAGATCAGCAATGTCAAGTGTGTCACGCGGCTCCCCAAGGAGACCAAGCGGCAGGCTGTGGCCATCATATTCACCGATGACTCTGCACGTACTTTCACCTGTGACTCAGAGCTGGAGGCGGAAGAGTGGTACAAGACACTGTCTGTGGAATGTCTGGGATCACGGCTCAACGACATCAGTTTGGGAGAGCCCGACCTCCTGGCACCCGGTGTGCAGTGTGAGCAGACAGATCGCTTCAATGTCTTCCTGCTGCCCTGTCCCAACCTGGACGTGTATGGCGAGTGCAAGCTGCAGATCACCCACGAGAACATCTACCTCTGGGACATACACAACCCCCGTGTCAAGCTCGTCTCGTGGCCCCTCTGCTCCTTGCGCCGCTATGGCCGGGACGCCACTCGCTTTACCTTTGAGGCAGGCCGGATGTGTGATGCTGGGGAAGGGCTCTACACCTTTCAGACACAGGAAGGGGAACAGATTTACCAGCGGGTCCACAGTGCCACCCTGGCCATCGCTGAGCAGCACAAGCGGGTCCTGCTGGAGATGGAGAAGAACGTGAGGCTGCTGAACAAGGGCACTGAGCATTACTCCTATCCCTGCACACCCACTACCATGCTACCCCGCAGTGCCTACTGGCACCACATCACAGGTTCCCAGAACATTGCTGAAGCCTCCAGCTATGCCGGAGAGGGGTATGGGGCAGCCCAGGCCAGCTCAGAAACAGATCTCCTCAACAGATTCATCCTGCTAAAGCCAAAGCCCAGCCAGGGGGACAGCAGCGAGGCCAAGACCCCTTCCCAGTGA

XM_004843159.1 Coding sequence

Polr2c polymerase (RNA) II (DNA directed) polypeptide C, 33kDa, transcript variant X1

Length: 873 bp    Location: 28606918..28604098   Strand: -
>XM_004843159.1
ATGATGAACTTAAAAAGGGACTGGGTACTAGATGCAGGGGTTGGTTGGAATTCCTCATCTCCTCATGCACTCCTTCCTGTTTCCCCACTGCCTCAGGACTGCACCTGTGAAGAGTTCTGCCCTGAGTGCTCAGTAGAGTTTACACTCGACGTGCGGTGCAACGAAGACCAGACACGGCATGTCACCTCTCGAGACCTCATTTCCAACAGTCCCCGGGTCATTCCGGTGACATCCCGGAACCGAGACAATGACCCCAATGATTATGTGGAGCAGGACGGTAAGGGGCTAGGGCAGGTGTGCAGACATCTTCCTGAGTTGTGGCTGCATAGGCCAGACACACCAGACAGCCTCGTTCTGCCGGGTCTCTGTAATGTGGCCCTAAACCCATTTTTCCCCGTGTGGTCTTCTGGAGCACTCCAGGTCGGAAGGTGGAGAACTGGGCCCCTCTTTCCCTTGACTGACTCGCACCTCTCTCTGCCTGCAGACATCCTCATTGTCAAGCTGAGAAAGGGGCAGGAGCTGAGGCTTCGAGCCTATGCCAAAAAGGGCTTTGGCAAGGAGCATGCCAAGTGGAACCCAACTGCAGGGGTGGCTTTTGAATATGATCCAGACAATGCCCTGAGGCATACTGTGTACCCCAAGCCTGAGGAATGGCCAAAGAGTGAGTACTCGGAGCTGGATGAGGATGAGTCACAGGCTCCCTATGATCCCAACGGCAAGCCAGAGAGGTTTTACTACAATGTGGAATCCTGTGGCTCTCTGCGCCCTGAAACCATTGTCCTCTCAGCCCTGTCTGGATTGAAGAAGAAGTTGAGTGATTTACAGACTCAGTTAAGCCATGAGATCCAGAGCGATGTATTAACCATAAACTAA

XM_004843167.1 Coding sequence

Ciapin1 cytokine induced apoptosis inhibitor 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 939 bp    Location: 28630761..28647194   Strand: +
>XM_004843167.1
ATGGCAGAGTTCGGGGTCTCAGCAGGCCAGCTGGTGGCAGTGATCTGGGATAAGTCAGCCCCTGTGGAAGCCCTGAAAGATCTGGTGGATAAACTGCAAGGGTTAACTGGCAGTGAGGACCGAGTATCTGTGGAAAACATCAACCAGCTGCTGCAGTCTGCCCACAAGGAATCCAGCTTCGACATTATTTTGTCGGGGGTAATCCCAGGAAGCACTACTCTGCATAGTCCTGAGGTTTTGGCAGAGATGGCCCGGATCCTTCGCCCTGGCGGGTGCCTTTTTCTGAAAGAACCAGTAGAGACAGCTGTAGCTAACAATAGCAAAGTGAAGACGGCATCTAAATTGTGTTCAGCCCTGACTCTGTCTGGTCTTGTGGAAGTGAAAGAGCTGCAGAGGGACCCCTTGAGCCCTGAGGAGATGCAGTCTGCCCAAGAACACCTGAGTTACAACAGCGACAGTCTGCTGTCTGTTCAGGTCACAGGCAAAAAGCCCAACTTTGAAGTGGGTTCTTCTAGTCAGCTCAAACTTTGCATCACCAAGAAGGTATCTCCTTCAGTGAAACCTGCTGTGGATCCTGCTGCCGCTAAGCTCTGGACCCTCTCAGCCAATGACATGGAGGATGATAGCATGGATCTCATTGACTCAGATGAGCTGCTGGATCCAGAAGATTTGAAAAAGCCTGATCCTGCTTCCCTGCGGGCTGCTTCCTGCGGAGAGGGGAAAAAGAGGAAGGCCTGCAAGAACTGCACTTGTGGCCTTGCAGAAGAACTGGAGAAGGAGAAGTCAGAGGCCCAGAAGAGCTCGCAGCCCAAGTCAGCCTGCGGAAATTGCTACTTGGGCGATGCATTCCGCTGCGCCAGCTGCCCCTACCTAGGGATGCCAGCCTTCAAGCCCGGGGAGAAGGTGCTCCTGAGCAATAGCAACCTGCACGATGCCTAG

XM_004843172.1 Coding sequence

Pllp plasmolipin, transcript variant X1

High confidence: 4 potential gene matches
Length: 549 bp    Location: 28779173..28797638   Strand: +
>XM_004843172.1
ATGGCCGAGTTCCCGTCGAAAGTGAGCACGCGGACCAGCAGCCCGGCGCCGGGTGCCGGTGCCTCGGCGTCTGTGCTGCGCCCGGACCTGGGCTTCGTGCGCTCCAGCTTCGGGGTGCTCATGCTGCTGCAGCTGGCACTGGGGCTGCTGGTGTGGGCCCTGATTGCCGACACTCCCTACCACCTGTACCCAGCCTATGGCTGGGTGATGTTCGTGGCTGTCTTCCTCTGGCTGGTGACAATCGTCTTCTTCACCATCTACCTGTTTCAGCTGCACATGAAGTTATACATGGTGCCCTGGCCCCTGGTGTTCATGATCTTTAATGTCACTGCCACTGTTCTCTACATCACTGCCTTCATCACCTGCTCTGCGGCAGTGGACCAGACGTCCCTGAAGGGCTCTCGGCCATATAACCAGCGTTCTGCTGCCTCTTTCTTCGCCTGTCTGGTGATGATCACCTACGGAGTGAGCGCATTCTTCAGCTTCCAGGCCTGGCGAGGAGAGGGCAGCAACGCAGCCACCAGTCAGATGGCTGGTGGCTACGCCTAA

XM_004843175.1 Coding sequence

Fam192a family with sequence similarity 192, member A, transcript variant X1

Length: 813 bp    Location: 28876520..28900758   Strand: +
>XM_004843175.1
ATGCTCCATCTGAATCTACTTGAACCAAGAGCAGATAGTCTTTTCATTATGGATGGAGGTGATGATGGTAACCTTGTTATCAAAAAGAGGTTTGTGTCTGAGGCAGAATTAGATGAACGGCGCAAAAGGAGACAAGAAGAATGGGAGAAAGTTCGAAAACCTGAAGATCCCAAAGAATGTCCAGAGGAGGTTTATGACCCTCGGTCTCTCTATGAAAGACTACAGGAACAGAAAGACCGGAAGCAGCAGGAGTATGAAGAGCAGTTCAAATTTAAAAACATGGTAAGAGGCTTAGATGAAGATGAGACCAACTTCCTTGATGAGGTTTCTCGGCAGCAGGAACTAATAGAAAAGCAACGAAGAGAAGAAGAACTGAAAGAACTAAAGGAATACAGAAGTAATCTCAACAAGGTTGGAATCTCTGCAGAAAACAAGAAGGAAGTGGAGAAGAAACTGCCTGTGAAACCAATAGAAACCAAGAACAAGTTCTCCCAGGCAAAGCTGTTGGCAGGAGCTGTGAAGCATAAGAGCTCAGAGAGTGGCAATAGTGTGAAAAGACTGAAACCGGACTCTGATCCAGATGACAAGAGTCAAGAGGCCCCATCCTGTGTATCGGTTGGAAGTACCTCCCTGAGTGGCCCATCCATTCACTGCCCACCCGCCGCTGTCTGCATCGGCATCCTTCCAGGCCTGGGAGCCTACTCGGGGAGCAGCGACTCTGAGTCCAGCTCAGACAGTGAAGGCACCATCAATGCCACAGGGAAGATCGTCTCCTCCATCTTCCGAACCAACACCTTCCTGGAGGCACCCTAG

XM_004843202.1 Coding sequence

Nup93 nucleoporin 93kDa, transcript variant X2

Length: 2460 bp    Location: 29267254..29153507   Strand: -
>XM_004843202.1
ATGGATACTGAGGGGTTTGGTGAGCTTCTTCAGCAAGCTGAACAGCTTGCCGCTGAGACTGAGGGCATCTCAGAGCTTCCCCATGTGGAACGGAACTTACAGGAGATCCAGCAGGCAGGCGAGCGCCTGCGTTCCCGTACCCTCACACGCACTTCCCAGGAGACAGCAGATGTCAAGGCGTCAGTTCTTCTTGGGTCTCGAGGACTTGACATATCCCACATCTCCCAGCGATTGGAGAGTCTGAGTGCGGCTACCACCTTTGAGCCTCTTGAGCCTGTGAAGGACACAGACATTCAGGGCTTCCTGAAGAATGAGAAGGACAATGCACTGCTGTCTGCCATTGAAGAGTCCCGGAAGAGGACCTTTGGCATGGCTGAGGAGTATCATCGAGAGTCAATGCTGGTCGAGTGGGAGCAAGTGAAGCAGCGGATTCTGCACACACTGCTGGCGTCAGGAGAAGATGCCCTTGACTTTACTCAAGAAATTGAGCCAAGTTACATAACTGATGTGGGCCCCCCTGGTCGAAGCGCTATGGATGCTGTTGAGATGGCCTATGCCCAGCAGATTTATATCTATAATGAGAAGATTGTCAGTGGGCAACTACAGCCTAACCTCGTGGACCTCTGTGGTACAGTTCCCCGCCTGAATGATAAGAACATTTCTGACATGTGGACCATGGTAAAACAAATGACAGATGTGTTGTTGGTACCGGCTGGTGATACCCTGAAGAGCCGAAACAGCTTGGAAGTGCGCATGGACTTTGTCAGGCAGGCCTTGGGATACCTTGAGCAGAGCTACAAGAATTACACTCTTGTGACTGTGTTTGGAAATTTACATCAGGCCCAGCTGGGTGGTGTACCCGGAACTTACCAGTTGGTTCGAAGTTTCCTGAACATTAAACTTCCGGCTCCCTTACCTGGACTTCAGGACGGAGAGGTGGAGGGCCACCCTGTCTGGGCACTAATTTATTACTGCATGCGCTGTGGAGACTTGCTTGCTGCCTCACAGGTGGTTAATCGGGCCCAGCACCAGCTGGGAGAGTTTAAGACCTGGTTCCAGGAGTACATGAACAGCAAGGACAGAAGATTGTCCCCAGCTACAGAAAACAAGCTCCGGCTGCATTACCGCAGAGCCCTCAGGAACAACACAGACCCCTACAAGCGGGCTGTATACTGTATCATTGGCAGATGCGACGTCACTGACAACCAGAGCGAAGTGGCAGACAAAACTGAGGACTACTTGTGGCTGAAGTTGAACCAAGTGTGTTTTGATGATGACGGCACCAGCTCCCCACAAGATAGGCTCAGTCTCTCTCAGTTCCAGAAACAGTTGTTGGAAGACTATGGTGAGTCCCACTTTAGGGTGCACCAGCAGCCCTTCCTCTACTTCCAAGTGCTGTTCCTGACAGCACAGTTTGAAGCCGCCATCGCTTTTCTCTTCCGCCTGGAACGGATGCGCCCCCATGCTGTCCACGTGGCCCTGGTGCTGTTTGAGCTAAAGCTGCTTTTAAAATCATCAGGGCAGAATGCTCAGCTTCTCAGCCATGAGCCTGGTGACCCTCCCTGCATGCGGCGGCTGAACTTTGTGCGACTGCTCATGCTGTATACCCGGAAATTTGAGTCCACAGATCCAAGGGATGCCCTCCAGTACTTCTACTTCCTCAGGGATGAGAAAGATAGTCAAGGAGAAAACATGTTTTTACGCTGTGTGAGTGAGCTTGTGATAGAAAGTCGAGAGTTTGATATGATTCTTGGGAAACTACAGAATGATGGAAGTAGAAAGCCTGGAGTCATAGATAAGTTCACTAGTGACACAAAGCCTATTATCAATAAAGTTGCTTCCGTGGCAGAAAATAAAGGACTGTTTGAAGAAGCAGTGAAGCTTTACGATCTTGCCAAGAATGCTGACAAAGTGCTGGAGCTGATGAACAAATTGCTGAGCCCTGTTGTTCCCCAGATCAGTGCCCCGCAATCCAATAAAGAGAGGCTTAAGAACATGGCCCTCTCCATTGCTGAACGGTACAGGGCTCAGGGTGTAAGTGCAAATAAATTTCTGGACTCTACATTCTATCTTCTGTTGGACTTGATCACCTTTTTTGACGAGTATCACAATGGTCATATTGACAGAGCCTTTGATATAATTGAGCGCTTGAAGCTGGTGCCCCTGAGTCAGGAAAGTGTGGAAGAGAGAGTGGCTGCCTTCAGAAATTTCAGTGATGAAATCAGGCACAACCTCTCACAAGTTCTTCTCGCCACCATGAACATCTTGTTCACACAGTTCAAGAGGCTCAAGGGGACAAGTCCATCCTCAGCATCCAGGCCCCAGCGAGTCATGGAGGACCGCGACTCTCAACTCCGAAGTCAAGCACGAGCCCTGATTACTTTCGCTGGAATGATACCCTACCGGACATCTGGGGACACCAATGCAAGGCTGGTGCAGATGGAAGTCCTCATGAACTAA

XM_004842702.1 Coding sequence

Ca5a carbonic anhydrase VA, mitochondrial, transcript variant X2

Length: 1206 bp    Location: 1293958..1312728   Strand: +
>XM_004842702.1
ATGGTGAAGACCAGAGCTCCCCCGAGGAGAACAGCAGCCACTCCAGGCCACGGTGAGGACCCGAGCTCCTCTGAAGATGAGAACAACCCAGTTCGCCTCAGGAAAACCAGCTGTCCAAGCTTCTCCAGGACGATCAACAGCACACGATCTTCCCCTCCAGGTCTCCTCTTATGCTGTTGGATGCAACCCTCAGGGCACCCCCGCTGGACAGGCCAGGTCTCCCTGCCAGGGGGCACCCGGCAGTCTCCCATCAACATCCGGCGGAGGGACAGCGTCTACGACCCCCAGCTGCCGCCGCTCAGGGCCTCCTACAGTGCTGCGTCCTGTCAGCACGTGTGGAACACGGGCTACCTCTGCCAGGTGGAGTTCGACGAGGCCAGCGAGGGCTCAGGGATCAGCGGGGGCCCCCTGGAGAACCACTACCGACTGAAGCAGTTCCACTTCCACTGGGGGGCTGGGGACGCACGGGGCTCCGAGCACGCCGTGGACGACCTCACCTTCCCCGCCGAGCTGCACTTAGTTCACTGGAATCCCTCGAGGTACCCGAGTTACCGGGAAGCAGTCCTGGGGGAGAAGGGCCTGGCTGTGATCGCCGTCTTTCTGCAGCCATGTGTCTGTGCCACAGCTGGGCGCCCCGCTCCAGGCCCTGCAGCAGCTGGCGGATGTCTTACCGGAGATAAAACACAAGCACACGCTTGGGGAAGGAATCGCGCCAAGGCCGCCTGCCCGAGGGGGACTGCGAGGCCCGGGAAGTTGGGCCAAGCACTCAGCTTACCTGGCACAAAGCGGTCGGGCTTTTGGAAGGTCAGCGAGGATGACAATGCTTGTCTCCAAGGCCTTGGGCAGTCAGCCGCTCTCACGTCAAGCTGCCTGATGTTGCTGGGCAGTGGTGCTGGGGACAGCGCAGTGGCTCCGTGCCCATGTTCAGAGAGTCACCTTGCGGCCCCGCGGTCCTGCGACAGGCACTCACACAGCAGAGCCGGGCCCCGAGCTCGTGTTTGTACCGCTGTGGGTAGCAGCAGATGGTGGCATAGCCCAGGTGTTGGTGGATGGGTAAAGACACCGAAACATGGCCGTCCCCATGCGGAAGGCCTCAGCCCTAAAAGGCAGGAAGTCCTGACACATGTCCCGCATGGGCAACCTTGGGGACAGGCACTGAGAGAAATGGGCCAAACACAGAAACCCGATACCACAGGGGTCCTGTGA

XM_004842701.1 Coding sequence

Ca5a carbonic anhydrase VA, mitochondrial, transcript variant X1

Length: 1206 bp    Location: 1294094..1312728   Strand: +
>XM_004842701.1
ATGGTGAAGACCAGAGCTCCCCCGAGGAGAACAGCAGCCACTCCAGGCCACGGTGAGGACCCGAGCTCCTCTGAAGATGAGAACAACCCAGTTCGCCTCAGGAAAACCAGCTGTCCAAGCTTCTCCAGGACGATCAACAGCACACGATCTTCCCCTCCAGGTCTCCTCTTATGCTGTTGGATGCAACCCTCAGGGCACCCCCGCTGGACAGGCCAGGTCTCCCTGCCAGGGGGCACCCGGCAGTCTCCCATCAACATCCGGCGGAGGGACAGCGTCTACGACCCCCAGCTGCCGCCGCTCAGGGCCTCCTACAGTGCTGCGTCCTGTCAGCACGTGTGGAACACGGGCTACCTCTGCCAGGTGGAGTTCGACGAGGCCAGCGAGGGCTCAGGGATCAGCGGGGGCCCCCTGGAGAACCACTACCGACTGAAGCAGTTCCACTTCCACTGGGGGGCTGGGGACGCACGGGGCTCCGAGCACGCCGTGGACGACCTCACCTTCCCCGCCGAGCTGCACTTAGTTCACTGGAATCCCTCGAGGTACCCGAGTTACCGGGAAGCAGTCCTGGGGGAGAAGGGCCTGGCTGTGATCGCCGTCTTTCTGCAGCCATGTGTCTGTGCCACAGCTGGGCGCCCCGCTCCAGGCCCTGCAGCAGCTGGCGGATGTCTTACCGGAGATAAAACACAAGCACACGCTTGGGGAAGGAATCGCGCCAAGGCCGCCTGCCCGAGGGGGACTGCGAGGCCCGGGAAGTTGGGCCAAGCACTCAGCTTACCTGGCACAAAGCGGTCGGGCTTTTGGAAGGTCAGCGAGGATGACAATGCTTGTCTCCAAGGCCTTGGGCAGTCAGCCGCTCTCACGTCAAGCTGCCTGATGTTGCTGGGCAGTGGTGCTGGGGACAGCGCAGTGGCTCCGTGCCCATGTTCAGAGAGTCACCTTGCGGCCCCGCGGTCCTGCGACAGGCACTCACACAGCAGAGCCGGGCCCCGAGCTCGTGTTTGTACCGCTGTGGGTAGCAGCAGATGGTGGCATAGCCCAGGTGTTGGTGGATGGGTAAAGACACCGAAACATGGCCGTCCCCATGCGGAAGGCCTCAGCCCTAAAAGGCAGGAAGTCCTGACACATGTCCCGCATGGGCAACCTTGGGGACAGGCACTGAGAGAAATGGGCCAAACACAGAAACCCGATACCACAGGGGTCCTGTGA

XM_004842707.1 Coding sequence

Ca5a carbonic anhydrase VA, mitochondrial, transcript variant X7

Length: 1044 bp    Location: 1295009..1320130   Strand: +
>XM_004842707.1
ATGGTGAAGACCAGAGCTCCCCCGAGGAGAACAGCAGCCACTCCAGGCCACGGTGAGGACCCGAGCTCCTCTGAAGATGAGAACAACCCAGTTCGCCTCAGGAAAACCAGCTGTCCAAGCTTCTCCAGGACGATCAACAGCACACGATCTTCCCCTCCAGGTCTCCTCTTATGCTGTTGGATGCAACCCTCAGGGCACCCCCGCTGGACAGGCCAGGTCTCCCTGCCAGGGGGCACCCGGCAGTCTCCCATCAACATCCGGCGGAGGGACAGCGTCTACGACCCCCAGCTGCCGCCGCTCAGGGCCTCCTACAGTGCTGCGTCCTGTCAGCACGTGTGGAACACGGGCTACCTCTGCCAGGTGGAGTTCGACGAGGCCAGCGAGGGCTCAGGGATCAGCGGGGGCCCCCTGGAGAACCACTACCGACTGAAGCAGTTCCACTTCCACTGGGGGGCTGGGGACGCACGGGGCTCCGAGCACGCCGTGGACGACCTCACCTTCCCCGCCGAGCTGCACTTAGTTCACTGGAATCCCTCGAGGTACCCGAGTTACCGGGAAGCAGTCCTGGGGGAGAAGGGCCTGGCTGTGATCGCCGTCTTTCTGCAGCTGGGCGCCCCGCTCCAGGCCCTGCAGCAGCTGGCGGATGTCTTACCGGAGATAAAACACAAGGATGCGCAGGTGGCCCTGGGCCCCTTCGACCCCTCCTGTCTGCTGCCTGCCTGCCGGGACTACTGGACCTACGCAGGCTCCCTCACCACCCCACCCCTGTCTGAGTCGGTCACCTGGATCGTCCACAAGCAGCCCATCGAGGTGGCTCCCAGCCAGCTGTCCGCGTTCCGGACGCTGCTGTTCTCCGCACCGGGCGAAGAGGAGGAGGCGATGGTGAACAACTACCGCCCGCTTCAGCCCCTGATGGACCGTGAAGTGCGCTCATCCTTCCGGGCACCGACTCAGAGTCCGCGTGAACGGCCAGAGCAGATGTGGCAAGGGCGGCGGGTGCTCCAGGCTTCCCCATCTGAGCCCCATGGCCCCCGAGCTAAGTAA

XR_205158.1 Non-coding sequence

LOC101697062 PREDICTED: Heterocephalus glaber uncharacterized LOC101697062 (LOC101697062), misc_RNA.

Length: 1226 bp     
>XR_205158.1
CAGGCGGCCGCCGTCCTGTCCCGGGGCGTTGGAGCCCGGAGCAGTCTCCGGGGGTCGGCCCGGGGCCCACGAGCCTCCCAGGGCCTGTAGGCGGGGGCCGCCGGAGAGACCTGAAGGTGCTGGGTGCCCCCGCGTTCACGCGCTCATTCATTCGCTCGCGTGGACGCCCTCTTGCGGGCGCCGGGTGTGGGCCCAGCCTCTCGCCGGACGGACGGCGGGAAGGAAACGCAGACTGAAGAGAGCTCCCGAGAGCGCGCGGAGCCGGGCCGGGGTCGGCGCTCAGCAGGAGCCGCCCAGCTTCGCGTCGCCGCTTCCTTCAGCCGTCTACTTGGGTGCAGCCCGGCCGGGCGGCGCGGGAGGGAGCTTGCCTCGGGAGGAGCGAGGAGGAGCGCGGTGCAGCTCGGTCCCCCCACCGGCAAAGGAAAGGGGAGGGGCTGGCGGCCGACCCCGCGCTCGCCGGCCCGGGCCGCTTACTTCTGAGCGAGCCTTGGTGTCCTCCCGGGCGAGGGTCGGGAGCCAGGTGCTCCACGCACGAGAATGCCGTGAGGGGCTCGGGAGATGTGTGCGACCTCGGCTTCTTGCAAGGTTGAACTGAACCGAACCGCGCGCGGGTCCGCGAGCGCCTTCTGGAGCCGCAGACCTGGACTCCAAGAACCGGAGCGACTGTTCCAGTGGGAAGGACAAAAGGACGGAATTACGCCTCCTGCCAGCTGGGATCTCAGACGTCAGCCACCATGCCAGCTCTCGCTGTCTTTTAAGGCCGTTTTCCTATTTCTTTTGGAGAGCTTCGTATGTGGATCGGATATAGCTGCTTAGTGAATTATGGGCAACTTAAAAGTGTAAACAGGACACTGTGTCTTTATTGTCAGAATGTGCTTGCCGGAAATTAAAGAGTGAATCTCACAATGCCTGCCAAGCCTTTAGTGACTCAACAAAAATGAACTGTCACAGGACGGGACAGAGAGCGCAGGTGCAAATGTAGCAAAAGGTTAACAACAGTCCGCTAAGGTTTCTCTGTCCGAAATTTTTTACAGCAAAAAGATGAGGCAAATACTATGTTATTATTATTATGATATTGTTATTGTCTTATATCATTCTGGCCCGCTGTGGTTACTACCACAGAAAAATAAGATCCACACACGACAGAGACTGGTGACTTTCAGTACTGCATTCTGACTTTATCGTAATGTTGCTTGAGCGAAAAATAAAAATTGTAATAAACAAGA

XM_004842945.1 Coding sequence

Pdf peptide deformylase (mitochondrial)

High confidence: 4 potential gene matches
Length: 843 bp    Location: 17041298..17044086   Strand: +
>XM_004842945.1
ATGACAATAAACTTGACCAGTGGTCACAACCTGGGTATGAGGCTCGAGTCCCGGAAGGCAAGTGGGAGTGCGTTTCCGGCGACCCGGCGGCTGGAGGAAGGGGCGGGACCCCGGGTTCCTCTGCGCGCCATGGCTCTGCTAGGGGTCGGGTTGCTGCAGACTCTACTGCTGCGGGCACGTGCGGGCGGTGTCCGGGCCTGCAGCTCTTCGGCTTCCGCAGACGGCCTGGAGGGCCAGGCGCGCCCGCGCTCCTACTGGTGCTACGTGAGGCGCCTGATACAGGGAGCGCCGCGGCCGCCCTACGCGCACGTGTGCCAGGTCGGAGACCCGGTGCTCCGGGTCGTGGCGGCCCCAGTGGAGCCGGCGCAGCTGGCGGGGCCGGAGCTGCAGAAGCTGGTGCAGAAGCTGGTGCAGGTGATGCGGCGGCGGCGCTGCGTGGGCCTGAGCGCGCCGCAGCTGGGGGTGCCGCTGCAGGTACTGGCCCTGGAGCTCCCCGAAGAGCTCTTCCGGGCCTGTGCGCCGCGCCTGCGCGAACTCCGCCAGATGGACCCCTTCCCGCTGCGTGTTTTCGTGAACCCCAGTTTGCGCGTGCTGGACCGAAGCCTAGTCACCTTCCCAGAGGGCTGCGAGAGCGTCGCCGGCTTCCTGGCCTACGTGCCTCGCTTCCAGGCAGTGCAGATCTCAGGGCTGAACCCAAGAGGAGAGCAGGTGGTGTGGCAGGCAAGTGGCTGGACCGCCCGCATCATCCAGCATGAGATGGACCACTTGCAGGGCTGCCTGTTCATTGACAAAATGGACAGCAGGACGTTTACAAACATCCACTGGATGGAGGTGAATGACTGA

XM_004842838.1 Coding sequence

Bcar1 breast cancer anti-estrogen resistance 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 2634 bp    Location: 11673918..11695988   Strand: +
>XM_004842838.1
ATGAACTACCTGAATGTGCTGGCCAAAGCCCTCTATGACAATGTGGCGGAGTCCCCAGATGAGCTCTCCTTTCGCAAGGGTGACATCATGACTGTGCTGGAGAGGGACACACAGGGCCTGGATGGCTGGTGGCTCTGCTCACTGCATGGGCGCCAGGGCATTGTGCCTGGGAACCGCCTCAAGATCCTGGTGGGCATGTACGACAAGAAGCCAGCAGGGCCCGGCCCTGGCCCACCTGCCACTGTAGCTCAGCCCCAGCCCCAGCCCAGCCTCCCACCTGGCCTGCATGCCACCGTGCCCCCGGCTTCCCAGTACACGCCTATGCTCCCTGCTGCATACCAGCCCCAGCCGGACAGCGTCTACCTGGTACCCACTCCCAGCAAGGCTCAGCAAGGCCTCTACCAAGCCCCGGGGTCCAGCCCGCAGTTCCAGTCGCCCCCAGCGAAGCAGACATCCACGTTCTCAAAACAGACGCCTCATCACCCATTTCCCAGCCCAGCCACAGACCTTTACCAGGTGCCCCCAGGACCTGGAAATCCTGCCCAGGACATCTACCAGGTGCCGCCTTCTGCTGGCATAGGGCACGACATCTACCAGGTGCCCCCATCCATGGACACACGCAGCTGGGAGGGGACAAAGCCACCAGCAAAGGTGGTGGTGCCCACCCGAGTGGGCCAGGGCTACGTATATGAGGCCTCCCAGCCGGAGCAGGATGAGTACGACATCCCACGACACCTGCTGGCCCCAGGCCCCCAGGATATCTATGATGTCCCCCCTGTTCGGGGGCTGCTTCCCAGCCAGTATGGCCAAGAGGTATATGATACCCCACCAATGGCTGTCAAGGGTCCCAATGGCCGAGACCCACTGTTGGACGTGTATGATGTCCCCCCCAGCGTGGAGAAGGGCCTGCCACCATCCGGTCACCATGTGGTGTACGATGTTCCCCCATCGGTGAGCAAGGATGTCCCTGATGGCCCAGTGCAGCGAGAGGAGACCTATGATGTGCCCCCTGCCTTTGCCAAGGTCAAGCCCTTTGACCCAGCCCGCCACCCGCTGATCCTCGCTGCACCCCCTCCGGATTCCCCACCAGCTGAGGACGTGTATGACGTGCCACCCCCTGCTCCTGATCTCTATGATGTGCCTCCTGGCTTGCGGCGGCCCGGCCCTGGCAGCCTGTATGATGTGCCCCGTGAGCGGGTGCTTCCTCCTGAGGTGGCAGACGGCGTGGTTGACGACGGGGTGTACGCTGTGCCCCCTCCAGCAGAGCCCGAGGCCATGCCCGTGGCTGATGGCAAGCGTCTGTCTGCCTCCAGCACGGGCAGCACGCGCAGCAGCCAGTCAGCGTCCTCCTTGGAGGCAGCTGTGTCGGGCCGGGAGCCCCTGGAGCTGGAGGTCGCTGTGGAGTCCTTGGCGAGACTGCAGCAGGGTGTGAGTGCCACCGTAGCCCACCTCCTGGACCTGGTGGGCAGTGCCAGCGGGGCTGGGGGGTGGCGTGGCACCCCCGAGCCTCAGGAGCCACCAGTCCAGGACCTGCAGGCCTCAGTGACTGCTGTCCAGAGCGCTGTCCATGAGCTGCTGGAGTTTGCCCGCAGTGCTGTGGGCAATGCCGCCCATACTTCTGACCGCACCCTGCACGCCAAGCTTGGCCGGCAGCTGCAGAAGATGGAGGACGTGTACCAGACACTGGTGGCACATGGCCAGGTCCTTGACAATGGCCGGGGAGGCCCAGGGTTCACCCTGGAAGACCTGGACCGTCTGGTGGCTTGCTCACGGGCTGTGCCCGAGGATGCCAAGCAGCTGGCCTCCTTCTTGCATGGCAATGCCTCACTGCTCTTCAGACGGACCAAGGCCCCTGCTCCTGGGCCCGAGGGGGGCGGCCCCCTGCACCCCAACCCCACTGACAAGGCCAGCAGCATCCAGTCACGGCCCCTGCCCTCCCCCCCCAAGTTCACCTCCCAGGACTCTCCAGATGGGCAGTACGAGAACAGTGAGGGGGGCTGGATGGAGGACTATGACTACGTCCACCTGCAGGGGAAGGAAGAGTTTGAGAAGACCCAAAAGGAGCTGCTGGAGAAGGGCAACATCATGCGGCAAGGGAAGGGCCAGCTGGAGCTGCAGCAGCTGAAGCAGTTTGAGCGGCTGGAGCAGGAGGTGTCACGGCCCATAGACCACGACCTGGCCAACTGGACACCAGCCCAGCCCCTGGCACCGGGCCGGCCAGGTGCCCTGGGGCCCTCGGATCGGCAGCTGCTGCTCTTCTACCTGGAGCAGTGCGAGGCCAACCTGACCATACTGACTGACGCTGTAGACGCCTTTTTCACCGCCGTGGCCACCAACCAGCCCCCCAAGATCTTCGTGGCGCACAGCAAGTTCGTCATCCTCAGTGCCCACAAGCTGGTGTTCATTGGGGATACACTGTCGCGGCAGGCCAAGGCTGCGGACGTGCGCAGCCAGGTGACCCATTACAGCAACCTGCTCTGCGACCTCTTGCGCGGCATTGTGGCCACCACCAAGGCCGCTGCCCTGCAGTACCCATCGCCCTCCGCAGCGCAAGACATGGTGGACAGGGTCAAGGAGCTGGGCCACAGCACCCAGCAGTTCCGCCGCGTCCTGGGCCAGCTGGCAGCCGCCTGA

XM_004842829.1 Coding sequence

Gabarapl2 GABA(A) receptor-associated protein-like 2

High confidence: 3 potential gene matches
Length: 525 bp    Location: 11405166..11393439   Strand: -
>XM_004842829.1
ATGAACGCCGCCGGAAGCCCCGCCCCCAATCAGTTGCTAGGCTTGGGCAGCCGGAAGTTCCGCCTGTCGTGTAGTCTCCTCTGTCGCTGCCGTCGCCGCTGTTGTTGTTGTGGTCGGTTCGCTGAACTTCGCGGCTCAGAGAGCCGGCTCGGTCCCCTCCCCGCCGCCGTCATGAAGTGGATGTTCAAGGAGGACCACTCACTGGAACACAGATGCGTAGAATCCGCGAAGATCCGAGCGAAATATCCTGATCGAGTTCCGGTGATTGTGGAAAAAGTCTCAGGCTCTCAGATTGTTGACATTGACAAACGGAAGTACTTGGTTCCATCTGACATCACTGTGGCTCAGTTCATGTGGATCATCAGGAAAAGGATCCAGCTTCCTTCTGAAAAGGCAATCTTCCTGTTTGTGGATAAGACAGTCCCACAGTCCAGCCTAACTATGGGACAGCTTTACGAGAAGGAAAAGGATGAAGATGGATTCTTATATGTGGCCTACAGCGGAGAGAACACTTTTGGCTTCTGA

XM_004842800.1 Coding sequence

Gcsh glycine cleavage system protein H (aminomethyl carrier)

High confidence: 4 potential gene matches
Length: 522 bp    Location: 6264458..6278085   Strand: +
>XM_004842800.1
ATGGCGCTGCGAGTGGCCGGGAGCATGCGCGTCGCGGCCTGCAGCCTGCGTGCAGCCTCGGTGCCCTCCGCGCCCTGCCCGATTCAGCCCTGGCGGCTGCGGGCGGGAGCCGTGCGGTCGCTGTGCACCGGGACGGCTCTGCTCAAAGCGCGTAAATTCACAGAGAAACACGAATGGATAACAACAGAAAATGGTATTGGAACAGTAGGAATCAGCAACTTTGCACAGGAAGCTTTGGGAGATGTTGTTTACTGTAGTCTGCCGGAAGTTGGGACAAAATTGAAAAAGCAAGATGAGTTTGGTGCTTTGGAAAGCGTGAAAGCTGCCAGTGAACTCTATTCTCCTCTGTCAGGAGAAGTAACTGAAATTAATGAAGCACTTGCAGAACATCCAGGGCTTGTCAACAAATCTTGTTATGAAGAGGGCTGGCTGATCAAGATGACAGTGAGTGACCCTTCAGAACTAGATGAGCTCATGAGTGAAGAAGCATATGAGAAATACGTGAAATCTATTGAGGAGTGA

XM_004843187.1 Coding sequence

Herpud1 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1176 bp    Location: 29080932..29069851   Strand: -
>XM_004843187.1
ATGGAATCTGAGCCCAACTCGGAGCCGGTCACGCTCCTAGTGAAGAGCCCCAACCAGCGTCACCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCCACCTCAAGGCCCACCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAAGATCAGAGGTTAATTTATTCTGGGAAGCTGTTGTCAGATCACCAGTGTCTCAGGGACTTGCTTCCAAAGCAGGAAAAACGACATGTTTTGCATCTGGTGTGCACTGTAAAGATTGCTTCAAAAATGCCAGAAACCAGCACAAAGGTTGCAGAATCCACAGAGCAGCCCCACGGACCTAATCAGGGACAGTATCTTGGGGATTCCTCAAGCGATGGTTTAAGGCAAAGGGAAGTTCTTCAGAACCTTTCTCCCTCTGGATGGGAGAACGTCTCAAGGCCTGAAGCTGTCCCGCAGGCATTCCAAGGTCTGGGGCCTGCTTTCTCTGGCTACACAACCTATGGGTGGCTGCAGCTCTCCTGGTTCCAGCAGATCTATGCACGACAGTACTACATGCAGTATTTAGCTGCCACTGCGACATCAGGAGCTTTTGTCCCACCACCAAGTGCCCAAGAGATACCTGTGGTCTCTACACCTGCTCCAGCCCCTATTCACAACCAGCTTCCTGCTGAAAACCAGCCAGCCAATCAAAATGCAGCACCTCAAGTGGTTGTTAATCCTGGAGCCAATCAGAATTTGCGGATGAATGCTCAAGGTGGCCCTATTGTGGAAGAAGATGATGAGATTAATCGAGATTGGTTGGACTGGACCTATTCAGCAGCTACATTTTCTGTTTTTCTCAGTATCCTCTACTTCTACTCCTCCCTGAGCAGATTCCTCATGGTCATGGGGGCCACCATTGTTATGTACCTGCACCACGTTGGGTGGTTTCCGTTTAGGCAGAGGCCTGTTCAGAACTTCCCCAATGATGTTCCTCCTCAGGAAGCCGTGAATCAGGACCTGAACAACAACTCACAGGAAGGCACTGATTCTGAAGCCGAAGACCCCAACCGCCTCCCCCCAGAGCGGGAAGTCCTGGATGCCGAGCAGACCAGCCCTTCATTTATGAGCACAGCATGGCTTGTCTTCAAGACTTTCTTTGCCTCTCTTCTTCCGGAAGGCCCTCCAGCCATAGCAAACTGA

XM_004842842.1 Coding sequence

Zfp1 ZFP1 zinc finger protein, transcript variant X2

High confidence: 4 potential gene matches
Length: 1221 bp    Location: 11827202..11794103   Strand: -
>XM_004842842.1
ATGAACAAATCCCAGGTGTCAGTTTCATTCACGGATGTGACTGTGGACTTCACCCAGGAAGAGTGGGAGCAGCTGGACCCTTCTCAGAGGATTTTATACATGGATGTGATGCTGGAGAATTACAGCAACCTACTTTCAGTGGAAGTGTGGAAGGCTGATGACCAGATGGAAAGGGAGCACAGAAATCCAGATGAGCAAGCAAGGCAGTTTACGGTCCTTAAGAACCAAACCCCATTTGAGGAGAGAGGTAATCTCTTTGGAAAAACATTTAATCTGAACACAGAATTTGTTTCTTTAAGACAAGTGCCCTATAAATATGATTTATATGAAAAAACTTTGAAGTATAATTCAGACTTACTTAATAATAATAGCTATGCAACAAAGAAAGGTGATGAATGCACTGGATTTGGAAAACCACTCCTATATCTGAAACAAGAGAAAACCCATCTTGGAGCGGAATACTCTGAATATAATAAAAGTGGGAAAGCCCTTAGCCATAAAGAAGTCATTTTTAAACATCAGAAAATTAAAAACTTGATTCAACCTTTTATTTGTAATTACTGTGACAAGGCCTTCCCCTTTAAGTCACTCCTCATCAGTCATAAGAGAATACACACTGGAGAAAAACCCTATGAATGTAATGTATGTAAGAAAACTTTCTCCCATAAGGCAAACCTCATCAAACATCAGAGAATTCACACTGGAGAGAAACCCTTTGAATGTCCTGAGTGTGGAAAAGCTTTCACTCACCAGTCAAATCTTATTGTACACCAGAGAGCACATATGGAGAAGAAGCCCTATGAGTGCGGTGACTGTGGAAAGACATTTGCTCAGAAGTTTGAACTTACTACACACCAGAGAATTCATACTGGAGAGCGACCCTATGAGTGTAATGAATGTGCAAAAACCTTCTTTAAGAAATCAAACCTCATTATACATCAGAAAATTCACACAGGAGAGAAACGCTATGAGTGTAGTGAATGTGGAAAGTCTTTTATCCAGAACTCACAACTCATCATACATATGAGAACTCATACAGGAGAGAAACCGTATGAATGTACTGAATGCGGCAAAACTTTCAGCCAGAGGTCAACTCTTCGATTACATTTGAGAATCCATACAGGAGAGAAACCATATGAGTGTACTGAATGTGGAAAGGCCTTCAGCAGGAAGTCCCGACTCAGTGTCCATCAGAGAGTTCATATAGGGGACAGACCTTGA

XM_004842804.1 Coding sequence

Cmc2 COX assembly mitochondrial protein 2 homolog (S. cerevisiae), transcript variant X2

Length: 240 bp    Location: 6331251..6369249   Strand: +
>XM_004842804.1
ATGCATCCTGACTTGTCTCTACACCTGCACACAGAAGAATGCAACATCTTGATTAACTTGCTTAAGGAATGTCACAAAAATCACAGCTTTCTGAAATTTTTTGGTCATTGCAACCATCTTGATCGGGAGATGAGAAAATGCTTGAAGAATGAGTACATGGAAAAGAGAACCAGAAGCAGGGAACGCGGGAATGACTTGCGAAAAAGACTTTTCAATCCTTCAGAGGAATCTGAAAAATAA

XM_004843127.1 Coding sequence

Ndrg4 NDRG family member 4, transcript variant X3

High confidence: 4 potential gene matches
Length: 1020 bp    Location: 27774616..27763054   Strand: -
>XM_004843127.1
ATGCCGGAGTGCTGGGATGGGGAACATGACATTGAGACGCCTTATGGGCTTCTCCACGTGGTGATCCGCGGCTCCCCCAAGGGCAACCGCCCAGCCATCTTCACCTACCATGACGTGGGCCTAAACCACAAGCTGTGTTTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACCAAGCACTTTGTGGTGTGCCACGTGGATGCCCCCGGACAGCAGGTGGGGGCGTCGCAGTTTCCTCAAGGGTACCAGTTCCCCTCCATGGAGCAGCTGGCTGCCATGCTCCCCAGCGTGGTACAGCACTTTGGGTTCAAGTACATTATTGGCATCGGAGTGGGAGCCGGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCTGACCTGGTGGAGGGGCTGGTGCTCATGAACATCGACCCCAATGGCAAAGGCTGGATTGACTGGGCTGCCACCAAGCTCTCTGGCCTGACCAGCACTTTGCCAGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTGGTGAACAACACGGAGCTGGTGCAGAGCTACCGGCAGCAGATCGGGAATGTGGTGAACCAGGCCAACCTGCAGCTCTTCTGGAACATGTACAACAGCCGAAGAGACCTGGACATTAACCGGCCTGGGACAGTGCCCAATGCCAAGACGCTCCGCTGCCCGGTGATGCTGGTGGTTGGGGACAACGCACCTGCTGAGGATGGGGTGGTTGAATGCAACTCCAAAATGGACCCAACCTCCACGACCTTCCTGAAGATGGCAGATTCCGGGGGACTCCCTCAGGTCACACAGCCGGGGAAGCTGACCGAGGCCTTCAAATACTTCCTGCAAGGCATGGGCTACATGCCCTCTGCCAGCATGACCCGCCTGGCACGCTCCCGCACCGCATCTCTTACCAGTGCCAGCTCTGTGGATGGCAGCCGCCCGCAGCCCTGCACCCACTTGGAGAGCAGCGAGGGGCTGGGCCAGGTCAACCACACCATGGAGGTGTCCTGCTGA

XM_004843080.1 Coding sequence

Rrad Ras-related associated with diabetes

High confidence: 4 potential gene matches
Length: 933 bp    Location: 19584019..19587466   Strand: +
>XM_004843080.1
ATGACCCTGAACGGCGGCGGCAGCGGGGTCGGCGGGAGCCGCGGCGCGGGCAGGGAGCGCGAGCGCCGTAGAGGCAGCACCCCCTGGGGCGCGGCGCCCACGCTGCACCGTCGCAGCATGCCAGTAGACGACCGCGACCTGCAGGCGGCGCTGGCCCCGGGCGCCAGAGCTACCAGCCTGGCCGGCTCAGGCACCGCGACCCAGGGTCCGAGGCTGGACTGGGCCGAGGGCTCCTCCGACTCTCTCACCTCAGGGGGCAGCGACTCTGATGAGAATGTATACAAGGTGCTGCTGCTGGGGGCATCTGGCGTGGGCAAGAGCGCCCTGGCACGCATCTTCGGTGGTGTAGAGGACGGCCCTGAAGCAGAGGCTGCAGGGCACACTTATGATCGCTCCATCGTGGTGGATGGAGAAGAAGCATCACTCATGGTCTATGACATTTGGGAGCAGGATGGGAGTCGATGGTTGCCTGGCCACTGCATGGCCATGGGGGATGCATATGTCATCGTGTACTCAGTAACTGACAAGGGCAGCTTTGAGAAGGCCTCAGAACTTCGGGTCCAGCTGCGGCGAGCACGGCAGACAGATGATGTCCCCATCATCCTTGTGGGCAACAAGAGTGATCTGGTGCGCTCCCGTGAAGTCTCTGTGGATGAGGGCCGGGCCTGCGCCGTGGTCTTTGACTGCAAGTTCATCGAGACATCAGCTGCATTGCACCACAATGTCCAGGCGCTGTTTGAAGGGGTCGTGCGCCAGATACGCCTGCGCAGGGACAGCAAAGAGGCCAATGCCCGGAGGCAGGCTGGTAGCCGACGGCGGGAGAGCCTTGGCAAGAAGGCAAAGCGCTTCCTGGGCCGCATCGTAGCACGAAACAGCCGCAAGATGGCTTTTCGGGCCAAGTCCAAGTCCTGCCATGACCTCTCAGTCCTTTAA

XM_004843221.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 3588 bp    Location: 5821863..5682161   Strand: -
>XM_004843221.1
ATGACCACCATGGTCGATGTGGACGCCCTTCCGGAATACGAGAAGAGTCAGATCAAGCGAGCCCTGGAGCTGGGGACGGTCATGACGGTGTTCAGCTTCCGAAAGTCCACCCCTGAGCGGAGGACAGTCCAGGTGATCATGGAAACGAGGCAGGTGGCCTGGAGCAAGACTGCGGACAAGATCGAGGGCTTCTTGGATATCATGGAAATCAAGGAAATTCGCCCAGGGAAGAACTCCAAGGACTTCGAGCGTGCAAAAGCAGTCCGCCAGAAGGAAGACTGCTGCTTCACCATCTTGTACGGCACCCATTTCGTCCTCAGCACACTCAGTTTGGCAACTGACTCCAGAGAGGATGCAATTATGTGGCTCTCAGGCCTGAAAATCTTGCACCAGGAAGTGATGAGCGCATCCACGCCCACTATCATAGAGAGTTGGCTGAGAAAACAGATTTATTCTGTAGATCAAACCAGAAGAAACAGCATCAGCCTCCGAGAGTTGAAGGCCATCCTACCCCTGGTCAACTTCAAAGTGAGCAGTGCCAAGTTCCTCAAAGATAAGCTTGTGGAAATTAGTGCACACAAAGACGAACTCAGCTTTGAGCAGTTTCATCTCTTCTATAAAAAACTTATGTTTGAGCAGCAAAAACTGATTCTTGACGAATTCAAAAAGGATTCCTCCGTGTTTATCCTGGGGAACACTGACCGACCTGATGCCTCTGCCGTTTACCTGCAGGACTTCCAGAGGTTTCTTGTACACGAGCAGCAGGAGCTTTGGGCTCAGGATGTAAACAAAGTCCGGGAGCAGATGACAAAGTTTATTGACGACACCATGAGGGAGACGGCTGAGCCCTTCTTGTTTGTGGACGAGTTCCTCATGTACCTGTTTTCCCGAGAAAACAGCATCTGGGATGGGAAGCACGATGTGGTGGACATGCAGGACATGAACAACCCCTTGTCCCATTACTGGATCTCTTCGTCCCACAACACGTACCTCACAGGTGACCAGCTGCGCAGCGAGTCGTCCACAGAAGCCTACATCCGCTGCTTGCGCATGGGCTGCCGCTGCATTGAGCTGGACTGCTGGGATGGGCCCGACGGGAAGCCCATTATCTACCACGGCTGGACGCGGACCACCAAGATCAAGTTCGATGATGTCGTGCAGGCCATCAGAGACCACGCCTTCGTCACCTCGAGCTTCCCCGTGATCCTGTCCATCGAGGAGCACTGCAGTGTGGAGCAGCAGCGGCACATGGCCAGGATGTTCAAGGAGGTGCTTGGCGAGCTGCTGCTGACCAAGCCCACGGAGGCCAGCGCCGACCAGCTGCCCTCGCCCAGCCAGCTGCGGGAGAAGATCATCATCAAGCATAAGAAGCTGGGCCCCCGAGGTGATGTCGATGTGAACGTGGAGGACAAGAAAGATGAGCACAAGCAACAGGGTGAACTGTACATGTGGGACTCCATCGACCAGAAGTGGACTCGGCACTACTGCGCCATTGCTGACGCCAAGCTGTCCTTCAGTGACGACATTGAGCAGGCCGCGGAGGAGGAACTGTCCCAGGACCTTCCACCCATGGAGCTGCATTTGAGGGAGAAATGGTTCCACAAGAAGATGGAGAAGAGGACGAACGCGGAGAAGCTGCTGCAGGAGTACTGTGCCGAGGCGGGTGCCAAGGACGGCACCTTCCTGGTGCGGGAGAGCGAGAGCCACCCCAACGCCTACACCCTGTCCTTCTGGCGGTCGGGCCGTGTGCAGCACTGCCTGATCCGCTCCACCTTGGAGAATGGCGCCATGAAGTACTACCTGACCGACAACCTCAAGTTCAGCAGCATCTACGACCTCATCCAGCACTACCGAGAGTCGCACCTGCGCTGTGCCGAGTTTGAGCTGCGGCTGACCGACCCGGTGCCGAACCCCAACCCACATGAGTCCAAGCCGTGGTACTATGACGGGCTGAGCCGTGGAGAGGCGGAGGACATGCTGATGCGGATTCCCCGAGATGGAGCCTTCCTCATCCGGAAGCGGGAAAAGAAGCATGAAGGGCTGGAGGACTCCTACGCCATCACCTTCAGGGCCAGGGGCAAGGTGAAACACTGTCGCATCAACCGGGATGGCCGTCACTTTGTGCTGGGGACATCTGCCTATTTTGAGAGCTTGGTGGAGCTTGTCAGTTACTATGAGAAACATACCCTCTACCGAAAGATGCGGCTGCGGTACCCTGTGACCCCTGAGCTCTTGGAGCGCTACAATATGGAAAGAGACATAAACTCCCTCTATGACGTCAGCAGGATGTATGTGGATCCGAGTGAGATCAACCCTTCTATGCCTCAGAGAACCGTGAAAGCTCTGTATGACTACGAAGCCAAGCACAGTGACGAGCTGAGTNNCTGCCGAGGTGCCCTCATCCACAACGTCTCCAAGGAACCCGGGGGCTGGTGGAAAGGAGACTATGGCACCCGAATCCAGCAGTACTTCCCGTCCAACTACGTGGAGGACATTTCCACGGCGGATGGGGAGGAGCTGGAGAAGCAGGAGAACAACATGAAGTACTGGGAGAAGAACCAGTCGATCGCCATTGAGCTCTCTGACCTGGTTGTCTATTGCAAACCAACCAGCAAAACCAAGGATAACTTAGAGAACCCTGACTTCCGAGAAATTCGCTCCTTTGTGGAGACAAAGGCTGACAGCATCATCAGACAGAAGCCCGAGGATCTCTTGAGGTATAACCAGAAGGGCCTGACCCGCATCTATCCGAAGGGACAGAGGGTTGACTCTTCAAACTACGATCCCTTTCGCCTGTGGCTGTGTGGTTCCCAGATGGTGGCGCTCAATTTCCAGACCGCAGACAAGTACATGCAGCTGAATCATGCATTGTTTTCACTCAATGGGCGGACGGGCTACGTTCTGCAACCAGAGATCATGCGGACAGGGAAGTATGACCCGATGCCACCAGAGTCGCAGCGGAAGATCCAGATGACTCTCACCATCAAGGTCCTAGGTGCCCGCCACCTACCCAAGCCTGGACGAAGTATTGCTTGTCCCTTTGTAGAGGTGGAAATCTGTGGGGCAGAGTATGACAACAACAAGTTCAAGACAACAGTTGTGAATGACAACGGCCTCAGCCCTGTCTGGGCTCCAACGCAGGAGAAGGTGACATTTGAAATTTATGACCCAAACCTCGCGTTTCTGCGCTTTGTAGTTTATGAGGAAGACATATTCAGCGATCCCAACTTCCTCGCTCACGCCACTTATCCCATTAAAGGGATCAAGTCAGGGTTTCGATCTGTTCCTCTCAAGAATGGGTACAGTGAGGACATCGAGCTGGCTTCCCTCCTGGTTTTCTGTGAGATGCGGCCAGTCCTGGAGAGTGAGGAAGAACTCTACTCCTCCTGTCGCCAGCTGCGGAGACGGCAAGAAGAGCTGAACAACCAACTATTTCTGTATGACACACATCAGAACCTGCGCAATGCGAACCGGGATGCCCTTGTCAAAGAGTTCAACGTCAATGAGAACCAGCTCCAGCTGTATCAGGAGAAGTGCAATCGAAGGTTGCGAGAGAAGAGAGTCAGCAACAGCAAGTTCTACTCTTAG

XM_004842944.1 Coding sequence

Terf2 telomeric repeat binding factor 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 1677 bp    Location: 16992037..17020968   Strand: +
>XM_004842944.1
ATGAGGCTCCCCTGTCCTTTCCCTCCCAGAAGCCCGCGGGCAGCTCGGAACGCGGTCTGTATCATGGCCGCGGGAGCCGGCGCGGCGGGCTCCGCTTCCGGCCCGGGCGTCGTGCGTGACCCGGCGGCGTCACAGCCGAGGAAACGGCCGAGCAGGGAGGGCGGGGAGGGAGCGCGACGGTCGGATGCGATGGCGGGAGGAGGCGGGAGCAGCGACGGCAGCGGGCGGGCTGGAGGCCGACGGGCGTCTCGGAGTAGCGGGCGGCCTCGGCGGGGACGCCACGAGTCAGGTCTGGGGGGCGCGGCGGAGCGGGGCGCGGGGGAGGCTCGGCTGGAGGAGGCGGTCAACCGCTGGGTGCTCAAGTTCTACTTCCATGAGGCGCTGCGGGCCTTTCGGAGTAGCCGGTACGCGGACTTCAGGCAGATCCGGGACATCATGCAGGCTTTGCTTGTCAGGCCCTTGGGGAAGGAGCATACGGTGTCCCGGTTGCTGCGAGTTATGCAGTGTCTGTCGCGCATTGAAGAAGGGGAAAATTTAGACTGTTCCTTTGATATGGAAGCTGAGCTCACACCATTGGAATCAGCTATGAATGTGCTGGAGATGATTAAAACGGAATTTACACTGACAGAAGCAGTGGTCGAATCCAGTAGAAAACTGGTCAAGGAAGCTGCTGTCATTATTTGTATCAAAAACAAAGAATTTGAAAAGGCTTCAAAAATTTTGAAAAAACACATGTCCAAGGACCCTTCAACTCAGAAGCTCAGAAGTGATCTCCTGAACATCATCCGAGAAAAGAACTTGGCCCACCCTGTTATCCAGAACTTCTCCTATGAGACCTTCCAGCAGAAGATGCTGCGCTTCTTGGAGAGCCACCTGGATGACACAGAGCCCTACCTCCTCACGATGGCCAAAAAGGCTTTGAAATCTGAGTCTGCTGCCACAAGTACAGTAAAGGAAGATAAGCAGCCAGCACCAGAGCCTGTGGAGAAGCCACTCAGAGAGCCTACAAGGCAGCTACAGAATACTCCAACTACCATTGGAATTAGAACTCTGAAGGCAGCTTTCAAGGCTCTGTCCGGTGCCCAGGATTCCGAGGCGGCCTTCTCAAAACTGGACCAGAAAGATCTGGTACTTCCTAATCAAGCATCCCTATCATCATCAGCCCTCAAAACCAAGAGACCCAGAAAAGATGAAAATGAAAATTCAGCCCCTGCTGAGGGTGAGGGCAGCTCAGAACTGCTGCCCAAGAACAAGCGCATGACAATAAGCAGATTGATTTTGGAGGAGGACAGCCAGAGTACTGAGCCCAACACAGGCCTCAGCTCCTCCTCGGAGGTTGCATCCAAGTCCAGTGCTCTCAGCCAACCCCACCCAGGGGAGAAGAATTCCAAAGTATCCAAAGGCAAGTGGAACAGCTCTAATGGGGTTGAAGAAAAAGAGACTTGGATGGAAGAGGACGAACTGTTTAAAGTTCAGGCAGCTGGTGAAGACAGTACAGCCAGTGTAACAAGGAAGCAGAAATGGACTGTAGAAGAAAGTGAATGGGTCAAAGCCGGAGTGCAGAAATATGGGGAAGGAAACTGGGCTGCCATTTCTAAAAATTACCCATTTGTTAACCGAACAGCTGTGATGATTAAGGATCGCTGGCGGACCATGAAAAAACTTGGCATGAACTGA

XM_004843009.1 Coding sequence

Nutf2 nuclear transport factor 2, transcript variant X3

Length: 384 bp    Location: 18525227..18504788   Strand: -
>XM_004843009.1
ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAACGACAGAAGCCAACTAGGCGCAATTTATATTGATGCATCATGCCTTACTTGGGAAGGGCAGCAGTTCCAAGGAAAAGCTGCTATTGTGGAGAAGTTGTCTAGCCTTCCTTTCCAGAAAATCCAGCACAACATCACAGCGCAGGACCATCAGCCCACACCAGATAGCTGCATCATCAGCATGGTCGTAGGCCAGCTCAAGGCCGATGAAGACCCCATCATGGGATTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGATATGTTCAGGCTTGCCCTGCACAACTTCGGCTGA

XM_004843012.1 Coding sequence

Nutf2 nuclear transport factor 2, transcript variant X6

Length: 384 bp    Location: 18525227..18504788   Strand: -
>XM_004843012.1
ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAACGACAGAAGCCAACTAGGCGCAATTTATATTGATGCATCATGCCTTACTTGGGAAGGGCAGCAGTTCCAAGGAAAAGCTGCTATTGTGGAGAAGTTGTCTAGCCTTCCTTTCCAGAAAATCCAGCACAACATCACAGCGCAGGACCATCAGCCCACACCAGATAGCTGCATCATCAGCATGGTCGTAGGCCAGCTCAAGGCCGATGAAGACCCCATCATGGGATTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGATATGTTCAGGCTTGCCCTGCACAACTTCGGCTGA

XM_004843008.1 Coding sequence

Nutf2 nuclear transport factor 2, transcript variant X2

Length: 384 bp    Location: 18524967..18504788   Strand: -
>XM_004843008.1
ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAACGACAGAAGCCAACTAGGCGCAATTTATATTGATGCATCATGCCTTACTTGGGAAGGGCAGCAGTTCCAAGGAAAAGCTGCTATTGTGGAGAAGTTGTCTAGCCTTCCTTTCCAGAAAATCCAGCACAACATCACAGCGCAGGACCATCAGCCCACACCAGATAGCTGCATCATCAGCATGGTCGTAGGCCAGCTCAAGGCCGATGAAGACCCCATCATGGGATTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGATATGTTCAGGCTTGCCCTGCACAACTTCGGCTGA

XM_004843007.1 Coding sequence

Nutf2 nuclear transport factor 2, transcript variant X1

Length: 384 bp    Location: 18524620..18504788   Strand: -
>XM_004843007.1
ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAACGACAGAAGCCAACTAGGCGCAATTTATATTGATGCATCATGCCTTACTTGGGAAGGGCAGCAGTTCCAAGGAAAAGCTGCTATTGTGGAGAAGTTGTCTAGCCTTCCTTTCCAGAAAATCCAGCACAACATCACAGCGCAGGACCATCAGCCCACACCAGATAGCTGCATCATCAGCATGGTCGTAGGCCAGCTCAAGGCCGATGAAGACCCCATCATGGGATTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGATATGTTCAGGCTTGCCCTGCACAACTTCGGCTGA

XM_004843010.1 Coding sequence

Nutf2 nuclear transport factor 2, transcript variant X4

Length: 384 bp    Location: 18515819..18504788   Strand: -
>XM_004843010.1
ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAACGACAGAAGCCAACTAGGCGCAATTTATATTGATGCATCATGCCTTACTTGGGAAGGGCAGCAGTTCCAAGGAAAAGCTGCTATTGTGGAGAAGTTGTCTAGCCTTCCTTTCCAGAAAATCCAGCACAACATCACAGCGCAGGACCATCAGCCCACACCAGATAGCTGCATCATCAGCATGGTCGTAGGCCAGCTCAAGGCCGATGAAGACCCCATCATGGGATTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGATATGTTCAGGCTTGCCCTGCACAACTTCGGCTGA

XM_004843013.1 Coding sequence

Nutf2 nuclear transport factor 2, transcript variant X7

High confidence: 3 potential gene matches
Length: 384 bp    Location: 18515439..18504788   Strand: -
>XM_004843013.1
ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAACGACAGAAGCCAACTAGGCGCAATTTATATTGATGCATCATGCCTTACTTGGGAAGGGCAGCAGTTCCAAGGAAAAGCTGCTATTGTGGAGAAGTTGTCTAGCCTTCCTTTCCAGAAAATCCAGCACAACATCACAGCGCAGGACCATCAGCCCACACCAGATAGCTGCATCATCAGCATGGTCGTAGGCCAGCTCAAGGCCGATGAAGACCCCATCATGGGATTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGATATGTTCAGGCTTGCCCTGCACAACTTCGGCTGA

XM_004843011.1 Coding sequence

Nutf2 nuclear transport factor 2, transcript variant X5

Length: 384 bp    Location: 18512354..18504788   Strand: -
>XM_004843011.1
ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAACGACAGAAGCCAACTAGGCGCAATTTATATTGATGCATCATGCCTTACTTGGGAAGGGCAGCAGTTCCAAGGAAAAGCTGCTATTGTGGAGAAGTTGTCTAGCCTTCCTTTCCAGAAAATCCAGCACAACATCACAGCGCAGGACCATCAGCCCACACCAGATAGCTGCATCATCAGCATGGTCGTAGGCCAGCTCAAGGCCGATGAAGACCCCATCATGGGATTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGATATGTTCAGGCTTGCCCTGCACAACTTCGGCTGA

XM_004843163.1 Coding sequence

Dok4 docking protein 4, transcript variant X3

High confidence: 4 potential gene matches
Length: 981 bp    Location: 28595656..28603872   Strand: +
>XM_004843163.1
ATGGCGACCAATTTCAATGACATCGTCAAGCAGGGCTATGTGAAGATGAAGAGCAGGAAGCTTGGGATCTACCGGAGGTGCTGGCTGGTATTCCGGAAGTCCTCCAGCAAGGGGCCCCAGCGGCTAGAGAAGTACCCGGATGAGAAGTCCGTGTGCCTCCGAGGCTGCCCCAAGGTGACTGAGATCAGCAATGTCAAGTGTGTCACGCGGCTCCCCAAGGAGACCAAGCGGCAGGCTGTGGCCATCATATTCACCGATGACTCTGCACGTACTTTCACCTGTGACTCAGAGCTGGAGGCGGAAGAGTGGTACAAGACACTGTCTGTGGAATGTCTGGGATCACGGCTCAACGACATCAGTTTGGGAGAGCCCGACCTCCTGGCACCCGGTGTGCAGTGTGAGCAGACAGATCGCTTCAATGTCTTCCTGCTGCCCTGTCCCAACCTGGACGTGTATGGCGAGTGCAAGCTGCAGATCACCCACGAGAACATCTACCTCTGGGACATACACAACCCCCGTGTCAAGCTCGTCTCGTGGCCCCTCTGCTCCTTGCGCCGCTATGGCCGGGACGCCACTCGCTTTACCTTTGAGGCAGGCCGGATGTGTGATGCTGGGGAAGGGCTCTACACCTTTCAGACACAGGAAGGGGAACAGATTTACCAGCGGGTCCACAGTGCCACCCTGGCCATCGCTGAGCAGCACAAGCGGGTCCTGCTGGAGATGGAGAAGAACGTGAGGCTGCTGAACAAGGGCACTGAGCATTACTCCTATCCCTGCACACCCACTACCATGCTACCCCGCAGTGCCTACTGGCACCACATCACAGGTTCCCAGAACATTGCTGAAGCCTCCAGCTATGCCGGAGAGGGGTATGGGGCAGCCCAGGCCAGCTCAGAAACAGATCTCCTCAACAGATTCATCCTGCTAAAGCCAAAGCCCAGCCAGGGGGACAGCAGCGAGGCCAAGACCCCTTCCCAGTGA

XM_004842748.1 Coding sequence

Gins2 GINS complex subunit 2 (Psf2 homolog), transcript variant X2

High confidence: 4 potential gene matches
Length: 558 bp    Location: 2116925..2109667   Strand: -
>XM_004842748.1
ATGGACGCGACCGAGGTGGAGTTCCTGGCGGAGAAGGAGCTGGTTACCATCGTCCCTAACTTCAGCCTGGATAAGATCTACCTCATCGGGGGCGACCTGGGCCCGTTCGACCCCGGCCTCCCCGTGGAAGTGCCGCTGTGGCTGGCCGTCAGCCTGAAGCAGAGGCAGAAGTGTCGCCTGCTGCCGCCGCCCTGGATGGACGTCGAAAAGTTGGAGAAGATAAGGGATCATGAACGAAAGGAAGAAACTTTTACCCCAGTGCCCAGCCCTTACTACATGGAACTCAGCAAACTCCTGCTAAATCATGCTTCAGACAACATTCCCAAAGCAGATTCGATCCGGACCCTGATCAAAGATCTGTGGGACACGCGCATGGCCAAGCTCCGTGTGTCTGCTGACAGCTTTGTGCGACAGCAGGAGGCACACGCCAAGCTGGATAACTTGACCTTGATGGAGATCAACACCAGCGGGGCCTTCCTCACAGAGGCGCTCCATCACATGTACAAGCTGCGCACCAGCCTCCAGCCTTCTGAGAGTGCCGCGTCGCAGGACTTCTAG

XM_004842638.1 Coding sequence

Rpl13 ribosomal protein L13, transcript variant X3

Length: 573 bp    Location: 341838..340686   Strand: -
>XM_004842638.1
ATGGCGCCCAGCCGGAATGGCATGATTCTGAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCTACGTGGTTCAACCAGCCGGCTCGGAAGATCCGCAGGCGCAAGGCCCGGCAGGCGAAAGCGCGCCGCATCGCCCCGCGACCCGCCTCAGGACCCATCCGGCCCATCGTGCGCTGCCCCACGGTGCGGTACCACACCAAGGTCCGAGCTGGCAGGGGCTTCAGTCTGGAGGAGCTGCGGGTGGCTGGTATTCACAAGAAGGTAGCCCGGACCATTGGCATCTCGGTGGACCCCAGGAGGCGGAACAAATCCACCGAGTCCCTGCAGGCCAATGTGCAGCGACTGAAGGAGTACCGCTCCAAACTCATCCTTTTCCCCAGGAAGCCGTCGGCCCCCAAGAAGGGAGACAGCTCTGTGAGTGCAGCGGTCTTTGCCACTGGGAGGTTACCCCCCGGGGGGGGAAACGCTTCCTGTAGCCTTAGCTCTATGAGCCATGGGCGCCATGACCAGGATGGCTTTCCAGCCCAAAGAGCATGTCCTGCCGTGAGAGGTGCGAAATCCTCCTGA

XM_004842685.1 Coding sequence

LOC101717043 cytochrome b-245 light chain-like

Length: 582 bp    Location: 911840..919362   Strand: +
>XM_004842685.1
ATGGGACAGATCGAGTGGGCTATGTGGGCCAACGAGCAGGCGCTGGCGTCCGGCCTGATCCTCATCACCGGCGGCATCGTGGCCACCACCGGACGCTTCGCCCAGTGGTACTTCGGTGCCTACTCCATTGTGGCGGGCGTGTTCGTGTGCCTGCTGGAGTACCCTCGGGGCAAGAGGAGGAAGGGCTCCACCATGGAGCGCTGTGGGCAGAAGTACATGGCGGCCGTGGTGAAGCTGTTTGGGCCCCTGACCAGGAACTACTACGTCCGGGCCACGCTGCACCTGCTGTTGGCGGTGCCCGCGGGCTTCCTGCTGGCCACCATCCTGGGAACCGTGTGCCTGGCCATCGCGAGCGGCATCTACCTGCTGGCGGCCATTCGCGGTGAGCAGTGGATGCCTATCGAGCCCAAGCCCAAGGAACGGCCACAGGTGGAAGCTATCAAGCAGCCACCCAGCAACCCCCCGCCCCGGCCTCCCGTTGAAGCCCGAAAGAAGCCCAGTGAGGAGGAGGAGGCGGAGGCGGCGGCGGCGGGTGGCGGCCCCCAGGTCAACCCCGTCCCGGTGACCGATGAGGTGGTGTAA

XM_004842783.1 Coding sequence

Hsbp1 heat shock factor binding protein 1

High confidence: 4 potential gene matches
Length: 231 bp    Location: 3690530..3686523   Strand: -
>XM_004842783.1
ATGGCCGAGACGGAACCCAAGACCATGCAGGACCTCACCTCGGTGGTGCAGACTCTGCTGCAGCAGATGCAAGATAAATTTCAGACTATGTCTGACCAGATCATTGGAAGAATTGACGATATGAGTAGTCGAATTGATGATCTGGAGAAAAACATCGCAGACCTCATGACACAGGCTGGGGTGGAGGAGCTGGACGTTGAAAACAAGATTCCTGCCACACAGAAGAGTTGA

XM_004842782.1 Coding sequence

LOC101716565 FUN14 domain-containing protein 1-like

Length: 120 bp    Location: 3659673..3659451   Strand: -
>XM_004842782.1
ATGGTGTCCCGGAAACCCCCACCCCAAGAATATGAAAGTGATGACAACTCTTACGAAGTGTTGGATTTAACAGAGTATGCAAGAAGACACCACTGGTGGAATCGAGTGCAAGAGAGTTGA

XM_004843105.1 Coding sequence

Tk2 thymidine kinase 2, mitochondrial, transcript variant X1

Length: 507 bp    Location: 19903329..19953113   Strand: +
>XM_004843105.1
ATGTACCATGATGCCTGTCGATGGGGCCTCACCCTGCAGACATACGTGCAGCTCACCATGCTGGACCAGCACACTCGTCCTCAGATGTCACCTATACGGCTGATGGAGAGGTCGATTCATAGTGCAAGATACATTTTTGTAGAAAACCTATATAGAAGTGGGAAGATGCCTGAAGTGGACTATGTGATTCTGTCTGAATGGTTTGACTGGATTGTGAAGAACATCAATGTCTCTGTTGACCTAATAGTTTATCTCCGGACCACTCCTGAGACCTGTCACCAGAGATTAAAGATGAGGTGCAGGGAAGAGGAGAAGGTCATTCCACTGGAATACCTGGAGGCCATTCACCGCCTCTATGAGCAATGGCTGGTCACAGGAAGCCTCTTCCCTGTGACGGCCCCTGTTCTGGTGATTGAGGCTGACCACAACATGGAGAAGATGTTACAAGTATTTGAACAAAACCGCACCCGAATATTAACACCAGAGAATTGGAAGCATGGCCCATAG

XM_004842747.1 Coding sequence

Gins2 GINS complex subunit 2 (Psf2 homolog), transcript variant X1

Length: 663 bp    Location: 2116925..2109667   Strand: -
>XM_004842747.1
ATGGACGCGACCGAGGTGGAGTTCCTGGCGGAGAAGGAGCTGGTTACCATCGTCCCTAACTTCAGCCTGGATAAGATCTACCTCATCGGGGTGAGCGTCTCGGGCTCCCGGAGGGCGGCGCGCGGCCCTGGGGCCGGGCTGGGGCCCCGGCGCTCGCTTCCGGTCGCTGACGCCCCGGCCTCCCCGCCCCGGCAGGGCGACCTGGGCCCGTTCGACCCCGGCCTCCCCGTGGAAGTGCCGCTGTGGCTGGCCGTCAGCCTGAAGCAGAGGCAGAAGTGTCGCCTGCTGCCGCCGCCCTGGATGGACGTCGAAAAGTTGGAGAAGATAAGGGATCATGAACGAAAGGAAGAAACTTTTACCCCAGTGCCCAGCCCTTACTACATGGAACTCAGCAAACTCCTGCTAAATCATGCTTCAGACAACATTCCCAAAGCAGATTCGATCCGGACCCTGATCAAAGATCTGTGGGACACGCGCATGGCCAAGCTCCGTGTGTCTGCTGACAGCTTTGTGCGACAGCAGGAGGCACACGCCAAGCTGGATAACTTGACCTTGATGGAGATCAACACCAGCGGGGCCTTCCTCACAGAGGCGCTCCATCACATGTACAAGCTGCGCACCAGCCTCCAGCCTTCTGAGAGTGCCGCGTCGCAGGACTTCTAG

XM_004843136.1 Coding sequence

Usb1 U6 snRNA biogenesis 1, transcript variant X1

Length: 822 bp    Location: 28166043..28152265   Strand: -
>XM_004843136.1
ATGAGCGCGGCGCCCCTGGTGGGCTACAGCAGCAGCGGCTCGGAGGATGAGGCCGAGGCCGCGGTCACCGAGCAGACCAGCCCGGGGTCTGGGGGCCACTGCCGTGGCCAGAGCCCCCTTCCCAATGAGAGGTTTCCAGTACCTGACAGTGTACTGAACATGTTCCCGGGCACAGAGGAAGGACCTGAGGATGACAGTGCAAAACATGGGGGACGAGTGCGTACCTTTCCCCACGAGCGTGGCAACTGGGTCACCCATGTCTATGTACCATATGAAGCCAGGGAGGAATTCCCAGATCTTCTTGACATGCTGCTGCCCCAGGCCCAGGCCTACGTGCCCCGGCTGGTGAAGATGGAGGCGTTCCACCTCAGCCTGTCTCAGAGCGTGGTTCTGCGCCACCATTGGATCCTCCCTTTTGTGCAGGCTCTGAAAGACCGAATGGCCTCCTTTGAAAGGTTCCTCTTTACTGCCAACCAGGTAAAGATTTATACCAATCAAGAGAAGACCAGGACCTTTGTTGGGCTTGAAGTCACCTCGGGGTATGCCCAGTTCTTGGACTTAGTTTCAGAAGTGGACAGAGTCATGGAGGAATTTGACCTCACCACTTTCTACCAGGACCCTTCATTCCACATCAGTCTGGCCTGGTGCGTGGGAGATGCATGTCTTCAGCTGGAAGGGCAGTGCCTGCAGGAATTACAGGAAATCGTGGATGAGTTTGAAGACTCTGAGATGCTGTTGCGTGTGCAGGCCATGCAGGTCCGCTGCAAGTCTGGGAACAAGTTCTTCTCCATGCCTTTGAACCAGGTGCCTGGGGAGACCTGA

XM_004843225.1 Coding sequence

LOC101717729 double homeobox protein 4-like protein 4-like

Length: 936 bp    Location: 11288275..11295665   Strand: +
>XM_004843225.1
ATGGACTTGAACAGCCCTCCAAGCATTACCACGGAACAACTGGCCCAAGAAATTGGTGTTCCAGCATCTAAAATTAAGAATTGGTTTAAAAACCACAGATGGAAGCTGTTGAGATCTAGATGCTCCTTAAGAAAAGGTCAATCCCTGAAACATGATAAGGCGAAGCCGTGGACTCAAGAATGGTTAACAAAAGCCAGCCAAGAGCTGATGGCCCTCACAACAACTCAAAAAAGGATCCTAGGTCAAGCCTTTGAGAAGAACCCATTCCCTGATCCTGCTACCAGGAAAAAACTGGCTAAACAAACGGGAATTCTGGAATCCAGAATTCTGATGTGGTTTCAGAATCAGAATTCTTTGTATTCTGAGCAGAGAAGGGAGCTGCTGAATGTCCTGGTAGAAAGCACAAATGAGAGACCAGATGTGACTCTTCAGCAGCAACACATTAACCTGTCCATGCTCCCATGTGCGGTTCACAGTTTTCCTCCCTCCAGTTCCTCCTGCAGCAAGCAAACATTTTTACCTGCTCCTCTTCCTTCCCAAGTGTTTTCTGAGCTTTGGGATCCCTTCCAGGTCTGTGTGAGCCAAGGACCAAGTGTCACAGTCAAGCAGCCCACACAGGCTATGGAGGGAGGAGAGAGCTCTGACTTCCCTCTGACTTTTATGGATCACTTGCTTAAACTGCTGACTCCAGGAGAGAACTTCTCAGACACCCAGGCTCCTTTCTGCTACCAATACCAAGAAAAATGCCAAAATGACAAAGGATACAGTGGCACAGGAGCCCTGCAGGGAAAGAACCATTCTCAGCCTCATCCTCAGCAGAAGGAGCAAGAATTTCCAGGTCTGGGTCACATTGACATATCTTACATTATGCAGTGGTGGGACAAAGGCCGCCAGGCTCTCATCACAGAATGGGAACCTCTGGAAGAGACGCCCTGA

XM_004843099.1 Coding sequence

Ca7 carbonic anhydrase VII, transcript variant X3

Length: 630 bp    Location: 19648615..19640463   Strand: -
>XM_004843099.1
ATGACTGGCTGGGGCTACGGCCAGGACGACGGTCCCTCAAATTGGCACAAGCTGTATCCCATCGCCCAGGGAGACCGTCAATCACCCATCAATATCATATCCAGCCAGGCTGTGTACTCGCCCAGCCTGCAGCCACTGGAGCTTTCCTATGAGGCCTGCACGTCCCTCAGCATCACCAACAATGGCCACTCTGTCCAAGTAGACTTCAATGACAGTGATGACCGAACTGTGGTGACTGGGGGTCCCCTGGAAGGGCCCTACCGCCTCAAGCAGTTCCACTTCCACTGGGGCAAGAAGCGTGATGTGGGCTCGGAGCACACGGTGGATGGCAAGTCATTCCCCAGCGAGCTGCATTTGGTTCACTGGAATGCCAAGAAGTACAGCACCTTTGGGGAGGCCGCCTCAGCACCTGATGGTCTGGCTGTGGTCGGTGTCTTCCTGGAGACGGGGGATGAGCACCCCAGCATGAACCGCCTGACAGATGCGCTCTACATGGTTCGGTTTAAGATGGAGAAGTTCCGGAGCCTGCTTTTCACCTCAGAGGATGATGAGAGGATCCACATGGTGAACAACTTTCGGCCACCACAACCACTGAAAGGCCGTGTGGTCAAAGCCTCCTTCCGGGCCTAA

XM_004843207.1 Coding sequence

Piezo1 piezo-type mechanosensitive ion channel component 1

High confidence: 4 potential gene matches
Length: 7596 bp    Location: 821726..871629   Strand: +
>XM_004843207.1
ATGGAGCCGCACGTGCTCGGCGCCGCGCTCTACTGGCTGCTGCTGCCTGGCTCGCTGCTGGCCGCCGCCCTGCTGCGCGTGAATGCACTCTCGCTGGTCTACCTGCTGCTCCTGCTGCTCCTGCCATGGCTACCCGGCCCCGCGAGGCACAGCGTGCGAGCAGGGCATGCGATCCGCCTCCTGCGCGCCCTGCTGAGCCTCAGCCTGCTCTTCCTGGTGGCACACTTGGCCTTTCAGATAATCCTGCACACCGTGCCCAGCCTGGACCAGCTTCTGGGGCCCAACTGTGGCCCCTGGGAGACCGTCTCTCGACACATTGGGGTCACAAGGCTGGACCTGAAGGACATCCCCAACACCATCCGCCTGGTGGCCCCTGACCTGGGCGTTCTGGTGGTGTCGTCCATCTGCCTTGGCCTGTGTGGGCGCCGAAGGAGGAGTGCTCAGGAGCCGGATGACGCCGAGAGGGACTCGGACACCAGGCCCCCAGCGGGGCTGCAGGAAGTCCCCGAGCTGGCCCCCAAGCCCAGGACATGGCTGAGTTCCCGCTTCTGGGTCACGGCGCACTGGCTGCTGGTGGCCGCGGGGCGGACCCTGGCTGTCATGCTCCTGGCGCTGGCAGGCATCGCCCACCCCTCGGCCTTCTCCAGTGTCTACCTGCTGGTCTTCCTGGGCATCTGCACCTGGTGGGCCTGCCACTTCCCCATCAGCCCTCTGGGCTTCAGTACCCTCTGTGTCGTGGTGGGCTGCTTTGGTGCCGGCCATCTCATCTGCCTCTACTGCTACCAGACACCCTTTGTCCAGGCTGCGCTCCCACCTGCCAGTGTCTGGGCCAGGGTGTTCGGTCTCAAGGACTTCATGGGCCCCACCAACTGCTCCAGCCCCCACACGCTGGTCCTCAACACCAGCCACGACTGGCCGGTGTACGTGAGCCCAGGCGTCCTGCTGCTGCTCTATTACACACTCATCTCCCTCCTGAAGCTCCGGCAGCGGAGGCCTGTGGGCCAGAGAAAGGAAGCGGCTAGGGCAGATGAGGGGCCCGAGCTGGAGCTGGACCAGCTGGAGCAGGGGCCCCGGGGCCCAGACAGGGCCACCCAGGATGGGGAGGCCACACAGCACATGATCCCCACGTTCACGGGGCCTGACACCGAGGCTGAGAACTGCATCGTGCACGACCTGACCAGCCAGAGCCCCAGCCGGCAGAGTCCCTTGAGTCCCAGGCTGGCTGAGCCAAGAGAGAATTCCCCATTTCACGGCCTGGGCCACCTCATCATGGACCAGAGCTATGTGTGTGCCCTCATTGCCATGATGGTTTGGAGCATCACCTACCACAGCTGGCTGACCTTCGTGCTGCTGCTGTGGGCCTGCCTCATCTGGACGGTGCGCAGCCGCCACCAGCTGGCCATCTTGTGTGCACCCTGCATCCTGCTGTACGGGTTGGCGCTCTGCTGCCTGCGCTATGTGTGGGCCATGGACCTGCGGCCTGAGCTGCCCACCACCCTGGGCCCCATCAGCCTGCGCCAGCTGGGGCTGGAGCACACTCGCTACCCCTGCCTGGACCTCGGCACCATGCTGCTCTACACCCTGACCTTCTGGCTGCTGCTTCGCCGCTTCGTGAAGGAGAAGCTGCTGAGGAAGACCCAGGCGCCTGCGGCGCTGCTGGAGGTGGCCGTGGCAGATGCAGAGCCCACGCACGCGCAGACGCAGACTCTACTCCGGAGCCTGGGGGAGCTGGTCACCGGCATCTATGCCAAGTACTGGATCTACGTGTGCGCCGGCATGTTCATTGTGGTCAGCTTCGCCGGCCGCCTGGTGGTCTACAAGATCGTCTACATGTTCCTCTTCCTGCTGTGCCTCACTCTCTTCCAGGTCTACTACAGCCTGTGGCGGAAGCTGCTCAAGGCCTTCTGGTGGTTTGTGGTGGCCTACACCATGCTGGTGCTCATCGCTGTCTATACCTTCCAGTTCCAAGACTTCCCTGCCTACTGGCGTAACCTCACAGGCTTCACGGATGAGCAGCTGGGGGACCTGGGCCTGGAGCAGTTCAGCGTGTCGGAGCTCTTCTCCAGCATCCTCATCCCTGGCTTCTTCCTGCTCGCCTGCATCCTGCAGCTGCACTACTTCCACCAGCCCTTCATGCAGCTCACTGACCTAGAACACGTGTCCCCGCCCAGTGCCCGGCGCCCCCGCTGGGCTCACAGGCAGGACACCGTGAGTGAGGCACCCCTGCTGCAGCAGCCCGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGCTGCACACCAGCAGGTGCCAGGCCACACAGGTCCCTGAAGGTGCAGCCAGCAAGTGGGGCCTAGTGGCCGAGCGGCTGCTGGAGCTGGCTGCCGGCTTGTCGGACGTCCTGACCCGCGTGCAGGTGTTTGTGCGCCGCCTGCTGGAGCTGCACATCTTCAAGCTGGTGGCTCTGTACACCGTCTGGGTGGCCCTGAAGGAGGTGTCAGTGATGAACCTGCTGCTGGTGGTCCTGTGGGCCTTCGCCCTGCCCTACCCGCGCTTCCGGCCCATGGCCTCCTGCCTCTCCACCGTGTGGACCTGCATCATCATTGTGTGTAAGATGCTGTACCAGCTCAAGGTCGTCAACCCGCAGGACTATGCCAGCAACTGCACTGAGCCCCTGCCCAACAGCACCAACCTCCAGGCGGCAGAGATCCGCCAGTCACTGCTGTACCGCGGCCCCGTTGACCCTGCCAACTGGTTCGGGGTGCGGAAGGGCTTCCCCAACCTGGGTTACATCCAGAACCACCTGCAGATCCTCCTACTGCTGGTGTTCGAGGCTATGGTGTATCGGCGGCAGGAGCACTACCGCCGGCAGCACCAGCGCGCTCCGCTGCCTGCCCAGGCCGTGTGTGCGGATGGCACCCGCCAGCGGCTCGACCAGGACCTGCTCAGCTGCCTCAAGTACTTCGTCAACTTTTTCTTCTACAAATTTGGGCTAGAGACCTGCTTCCTGATGGCCGTGAACGTGATTGGGCAGCGCATGGACTTCATGGTCATCCTGCACGGCTGCTGGCTGGTGGCCATCCTCACTCGCCGGCGCCGTGAGGCCATCGCCCGCCTCTGGCCCAACTACTGCCTCTTCCTCATGCTCTTCCTGCTGTACCAATACCTGCTGTGCTTGGGCATGCCCCCAGCCCTGTGCGTTGACTACCCATGGCGCTGGAGCCGGGCCATCCCCATGAACTCTGCCCTTATCAAGTGGCTCTACCTGCCGGACTTCTTCAGGGCCCCGAACTCCACCAACCTCATCAGTGACTTCCTGCTGCTGCTCTGCGCCTCCCAGCAGTGGCAGGTGTTCTCGGCCGAGCACAACGAGGAGTGGCAGTGGATGGCCGGCGTCAACACCGACGTCCTGGAGCTGCCGCGGGGCGAGCCCAACCCCGTGCCCAACTTCATCCACTGCAGGTCCTACCTGGATATGCTGAAGGTGGCTGTGTTCCGCTACCTGTTCTGGCTGGTGCTGGTGGTGGTGTTCGTCACCGGTGCCACCCGCATCAGTGTCTTCGGGCTGGGCTATCTGTTGGCCTGCTTCTACCTGCTGCTCTTCGGTACGGCGCTGCTGCAGAAGGACACGCGGGCCCGCCTTGTGCTGTGGGACTGCCTCATCCTCTACAATGTCACAGTTATCGTCTCCAAGAACATGCTCTCGCTCCTGTCCTGTGTCTTTGTGGAGCAAATGCAGACCAGCTTCTGCTGGGTCATCCAGCTCTTCAGCCTCGTGTGCACAGTCAAGGGTTACTATGATCCCAAGGCGATGGTGACCAAGGACCAGGACTGCCGGCTGCCTGTGGAGGAGGCCGGCATCATCTGGGACAGCGCCTGCTTCTTCTTTCTGCTGCTGCAGCGACGCATCTTCCTCAGCCCCTACTTCCTGCACGTTGGCGCTGAGCTGCGGGCCACAGCCCTGCAGGCCTCCAGGGGCTTCGCACTCTACAACGCGGCCAGTCTCAAGAGCATCGAAGCCCACCGCAAGGCAGAGGAGAAGTCGCTGGCACAGCTAAAGAGACAGATGATGCGAATCCGTGCCAAGCAGGAGAAGCACAGGCAGAGTCGTGCCAGCTGCAGCCACCCCCAGGCCCTGGGCCCCGAGGACCCCAACCAGGAGCCAGGCCCCAGCAGCCCGGGGGTCTCCTCCCCGCCACAAAGACAGTGGTGGCGGCCCTGGCTGGACCATGCCACAGTCATTCACTCCGGGGACTACTTCCTCTTTGAGTCTGACAGTGAAGAGGAGGAAGAAGCCATGCCCGAGGACTCCAGACCGTTGGCACAGAGCGCCTTCCAGATGGCTTACCAGGCGTGGGTGACGGATGCCCAGATGGTGCTGAGGCAGCGGCGGGAGCAGGAACGGGCGCGGGCACAGCAGGAGGGGGCAGGACAGCTGTCCGCCGGAGGAGGCCCGAGCCAGGAAGTGGAGGCAGGGGCGGCCACGGAAGATGAGGATGAGGTGGCAGGCCACAGCCACATGATGCAGCGCGTGCTGAGCACCGTGCAGTTCCTCTGGGTGCTGGGCCAGGCCTCGGTGGATGGGCTGACGAGCTGGCTGCTGACCTTCACGCGGCATCACCGCAACATGAGTGACGTGCTGCGTGCGGAGCGCTACCTGCTCACGCAGGAGCTGCTGCGGGGCGGGGAGGTGCACCGCAGCGTGCTGGACCAGCTGTATGACGATGAGGCCGCAGCCGCACTGCCGGGTTCCCCGGAGCTCGGCGACAGACCCAGCACTGTGTCCAGTGGGCTGGGGGCCGAGGAGCCCCTGAGCAGCGTGACGGATGACACCAGCAGCCCCCTGAGCACGGGCTACAACACCCAAAGCGGCAGCGAGGAGATCGTCATGGAGACTGGGGACCTCGAGGCCAAGGCATCCCTGCTCGGCTCGCAGGAGCTTCCGGCCCGGAGGAGGATGCGCACGGCCAGCGAGCTGCTGAGCCACAGGCGCCTGCACATCCAGGAGCTGGAGGACGCCGAGAACTTTGTGGCGCAGCAGGGCCGGATGCTGCGGCTTCTGCGAGCCATGTACCAGAGTGTGGCGGCCCACTCGGAGCTGCTCTGCTACTTCATCATCATCCTCAACCATGTGGCCACCGCCTCGGCCGCCTCGCTGGTGCTGCCAGTGCTTGTCTTCCTGTGGGCCATGCTGTCCATCCCCAGGCCCAGCAAGCGCTTCTGGATGACGGCCATCGTCTTCACAGAGGTCACCGTGGTCACCAAGTACCTGTTCCAGTTCGGCTTCTTCCCCTGGAACAGCCACGCGGTGCTGCGGCGCCACGAGAACAAGCCCTACTTCCCACCGCGCATCCTGGGCCTGGAGAAGACTGACGGCTACATCAAGTACGACCTGGTGCAGCTCCTGGCGCTCTTCTTCCACCGCTCCCAGTTGCTGTGCTACGGCCTCTGGGACCACGAGGAGGACCAGCTCTCCAAGGAGCAGCGAGGGACCAGTGAAGGGAAGGACCTGGGCGCTGAGGATCAGACCGAGGCAGACACAGGGCAGCAGGAGGGGCCAGGCGAGACCAGGGCCACCACCCAGGACCGTGTCCAGGAGGATGTGAGGGTCGGGTCCGGGCACGGGGCCCCAGAGGCCCAAGTGGACCTTGAGCCCCAGGACACGAGGCGCATCAGCCTGCGTTTTAGGAGGAAGAGGGAGTGTCCAGGACCCACGGGGGCAGTAGCCCACGGAGCTGGGGACAGGGAGGAAAGACAGGCAGCCGGGAGAAAGAGGCCGAGCCGTTGTCGAGAACAGATGAAGGCAGCAGGGCGCCAGCTTCAGGGCTTCTGCCTGTCGCTGGCCCAAAGCATTTACCAGCCCCTGCGGCACTTCTTCCATGATATTCTGCACACCAAGTACCGGGCGGCCACCGACGTCTACGCACTCATGTTCCTGGCTGACGTTGTCGACTTCATCATCATCATCTTTGGCTTCTGGGCCTTTGGGAAGCACTCGGCGGCCACGGACATCACATCCTCCTTGTCAGACGACCAGGTGCCGGAGGCCTTCCTGGTCATGCTGCTGATCCAGTTCGGCACCATGGTGGTGGACCGCGCCCTCTACCTGCGCAAGACCGTGGTGGGCAAGCTGGCCTTCCAGGTGGTGCTGGTGCTGGCCATCCACCTCTGGATGTTCTTCATCCTGCCAGCCGTCACTGAGAGGATGTTCAGCCAGAATGCGGTGGCCCAGCTGTGGTACTTCGTGAAGTGCATCTACTTCGCCCTGTCCGCCTACCAGATCCGCTGCGGCTACCCGACACGCATCCTCGGCAACTTCCTCACCAAGAAGTACAACCACCTGAACCTCTTCCTCTTCCAGGGGTTCCGGCTGGTGCCCTTCTTGGTGGAGCTGCGGGCCGTCATGGACTGGGTGTGGACAGACACCACCCTGTCCCTGTCCAACTGGATGTGTGTGGAGGACATCTACGCCAACATCTTCATCATCAAGTGCAGCCGCGAGACAGAGAAGAAATACCCGCAGCCCAAGGGCCAGAAGAAGAAGAAGATTGTCAAGTACGGCATGGGCGGCCTCATCATCCTCTTCCTCATTGCCATCATCTGGTTCCCGCTGCTCTTCATGTCCCTGGTGCGCTCCGTGGTTGGCGTTGTCAACCAGCCCATCGATGTCACTGTCACCCTCAAACTGGGTGGCTACGAGCCCCTGTTCACCATGAGCGCCCAGCAGCCGTCCATCGAGCCCTGCACGCCCGAGGCCTACGAGGAGCTGTCCCGGCAGTTCGACACCCACCCGCTGGCCATGCAGTTCATCAGCCAGTACAGCCCTGAGGACATCGTCACCGCGCAAATCGAGGGCAGCTCCGGGGCGCTGTGGCGCATCAGCCCCCCGAGCCGGGCGCAGATGAAGCGGGAGCTGTACAACGGCACGGCGGACATCACTCTGCGCTTCACCTGGAACTTCCAGAGGGACCTGGCCAAGGGCAGCACCGTGGAGTACACCAACGAGAAGCACACGCTGGAGCTCGCCCCCAATAGCACAGCGCGGCGGCAGCTGGCCCGCCTGCTGGAGGGCACCTCGGACCAGTCTGTCACCATCCCCCACCTCTTCCCCAAGTATATCCGCGCCCCCAATGGGCCTGAGGCCAGCCCTGTGAAGCAGCTACAGCCCAATGAGGAGGCTGACTACCTCGGCGTGCGCATCCAGCTGCGGAGGGAGCAGGTGGGCTCGGGGGCTGCGGGTTTCCTGGAGTGGTGGGTCATCGAGCTGCAGGACTGCCGCGCTAACTGCAACCTGCTGCCCATGGTCATCTTCAGCGACAAGGTCAGCCCACCCAGCCTGGGCTTCCTGGCCGGCTACGGCATCATGGGGCTGTACGTGTCCATCGTGCTGGTCATCGGCAAGTTCGTGCGCGGCTTCTTCAGCGAGATCTCGCACTCCATCATGTTCGAGGAGCTGCCCTGCGTGGACCGCATCCTCAAGCTGTGCCAGGACATCTTCCTGGTGCGGGAGACGCAGGAGCTGGGGCTAGAGGAGGAGCTGTACGCCAAGCTCATCTTCCTGTACCGCTCACCAGAGACCATGATCAAGTGGACGCGTGAGAAGGAGTAG

XM_004843224.1 Coding sequence

LOC101717394 interferon-induced transmembrane protein 1-like

Length: 333 bp    Location: 10820834..10821166   Strand: +
>XM_004843224.1
ATGACGAGGTGGCCATGCTGGGGGGACACCCATGGCCCTGTTCCCGAAACCCCCACCATGATCAACATCCACAGTGACACCATTGTACCTGACCACGTAGTCTGGTCCCTCTTCAACATGATCTTCATGAACATGCGCTGTCTGGGCTTCATAGCCTTTGCCTACTCCATAAAGTCCAGGGACAGGAAGATGGTGGGCAATGCGATCAGGGCCCAGGGCCACGCCTCCACTGTACCTGAACATCAGCACCTGGTCTTAAGCATTGCTCTGACCCTCGGCCTCATCATTATGTTTGCCTTCACCTCCATGCATTTGTTCAAGAGGATGACATGA

XM_004843241.1 Coding sequence

Cngb1 cyclic nucleotide gated channel beta 1

Length: 3861 bp    Location: 28166590..28268280   Strand: +
>XM_004843241.1
ATGTTGGGCTGGGTCCACAAGGTGCTGCCTCAGCCCCCAGGGACCCCTCAGAAGACCAAGATGCAGGAAGAAGAGGAAGCAGAAGCAGAGCCAGAGCTGGTGCTGGAGCCAGAGGCAGAACCAGAGCCTGAGCCTGAAGCAGCTCCTGAGGAGGCCAAGCCTGAGGGCGAGTCCCTGCCCCCTGAAGAACCAGCTCACGAGGAGCAAGTGGCTGCGGCTGACTCCAGCCTTCAGGAAACCCAGGAGGCTGCCCCTCCTCTGCCCACAGCCCTCCAGGCCCAGGTCACAGTGGCTCCCGATGTGTACAGCTCCAGTGGCTGGGTGCTGACCTGGCTCAGGAAGAGCATGGAGAAGGTTGTGCCGCAGCCTGCCTGGAGTGGCAGGATGGCCCAGAATGGTGTTGCTGACACAGGGGCTCCAGCTGAGGATGGAGCACAGGTCATTGGGCTCTGCAGCCCCAGGGACACAGGTTCACGTGGAGTCCAGAAGGAGAGCTTGGAGGCACTGAGGTGCTCAGTCGTGTCAGCCTCACAGTCAGCAACAGTGGCTGACTCCTTAGAGCTGACGGACGGTGGCTTCCTCATCAGTGAAGGTGGCCGGCTGGCTGCCCACTGGCCCTTCCACAGGTCTAGCCCATGGCTGCTCAGGTGGCTCAAGCAGAATCTGGAGAAAGTGCTGCCTCAGCCCCCAAAACTCCCTGAGGGTTGCAGAGCTGAGCCTGCGGATGCTGTCTTGGGCCCAGAACCTCTGGGACCGACCCTGGAGATGGAGCCCACCGAGAGACCCTCCCTGCCCAGTCCTGGCTCCCTGGAGCCTGAGGTGGAGCCGACTGCAGAGCCCCAGCCCAGCTTCCAGGCCTCCTCCCTGACACCACCCAGGGACCCTGCCAGGTTGATAGCATGGCTCCTGCACAGGCTGGAGATGGCCCTGCCGCAGCCGGTGATCCATGGGAAAACTGGGGAGCAGGTCAGTGCTGGGCCTACAATGTGCGACGTGCAGACCCTCAGCATCCTCCCCACGGAGCAGGTGGATTCTGACCTTGTCCTCGAAGAAGTTGACCCTCACTGGGAAGATGCCGAGCAGGACAGCAGCACCAGCCCACAGGGGACAGAGGCAGCTCTGGTGTTTGAGGAAGAGAATGAGGCTGTGATAGAGATGCCCAGGGAGCTGTCCCTGACTCAGGAGGAAAAAGAAGAGGAGGAGGATGTCGAGGAGGAGGAGGAGGAGGAAGAAGAGGAGGAGCAGGGGCCTGATGTGCTGCTGGATAGCTGTTTGGTGGGACGGGTGGGTGTGGACCAGAGCAACTTAAGCAAGACCCAGTGCCAGAAGGCCTCGTTGCAGGACCAGCCGCCTGGCCAGGTGGCCCCCAGGCTTGACCCCCCAAACCTGGCAGAGCACCTCCCCAACGTGCCCACCTACCGCCCCCTAGTCACTCGCATCCCTGTCCTCATCTCCCGGAGAACAGCTTTGTCCAACTCCAACTTCGCCAAGGAGACCAGGAGCTCCATCCGTCGCCTAGTGCCTGCCACGGAAGAGCACCCCGAAGTGCAGGTGGAAGACACGGATCCCGACAGCCATCCCCTCATCGAGGAGGAGAAGCCGTCCTCACCTGGGCTGCCGCCACATTCGCCTGCCAAATCCGACACACTTGCTGTCCCAGGCTCGGCCTCAGGGCCCCACAGGAAGAGGCTGCCCTCGCAGGATGATGGGGCTGAAGAGCTCAAGGCGATGTCACCAGCTGAGTCCCCAGTGGTCACCTCGTCGGATCCTACCACCCCTCAGGAATCTGATGGCCAGGACCGCGCAGCCTCCACGGCCAGCCAGAACAGTGCCATCATCAATGACCGGCTCCAGGAGCTGGTGAAACTCTTCAAGGAGCGGACGGAGAAGGTGAAGGAGAAGCTCATCGACCCTGATGTCACCTCTGACGAGGAGAGTCCCAAGCCCTCCCCAGCCAAGAAAGCCCCTGAGCCAGCCCCAGTCACGAAGCCTGCTGAGGTGGAGCCGGCAGAGGAGGAGCACTACTGCGACATGCTCTGCTGCAAGTTCAAGCGCCGGCCCTGGAAGAAGTACCAGTTCCCCCAGAGCATTGACCCCCTGACCAACCTGATGTACATCCTGTGGCTGTTCTTCGTGGTGCTGGCCTGGAACTGGAACTGCTGGCTGATTCCTGTGCGCTGGGCCTTCCCCTACCAGACGCCCAGCAACATCCACCTGTGGCTGCTGATGGACTACCTATGCGACCTCATCTACCTCCTGGACATCACCATCTTCCAGATCCGCCTGCAGTTTGTCAGAGGCGGGGACATCATTATGGACAAGAAGGACATGCGAAATAACTACCTGAAGTCTCGCCGATTTAAGATGGATGTGGTCTGCCTCCTGCCCTTGGATTTCCTCTACTTGAAATTTGGCGTGAACCCCCTCCTCCGCCTGCCCCGCTGTTTAAAGTACATGGCCTTCTTTGAGTTTAACAACCGCCTGGAAGCCATCCTCAGCAAAGCCTACGTTTACAGGGTCATCAGGACCACAGCCTACCTGCTGTACAGCCTGCACCTGAACTCGTGTCTTTACTACTGGGCATCAGCCTTTCAGGGCATTGGCTCCACTCACTGGGTTTACGATGGTGTGGGAAACAGTTACATTCGCTGCTACTACTGGGCTGTGAAGACACTCATCACCATCGGGGGGCTGCCTGACCCCCAGACGCTCTTTGAAATTGTCTTCCAGCTGCTGAACTATTTCACGGGTGTATTCGCTTTCTCTGTGATGATTGGACAGATGAGAGATGTGGTAGGGGCGGCCACTGCAGGACAAACCTACTACCGCAGCTGCATGGACAGCACAGTGAAGTACATGAACTTCTACAAGATCCCCAGGTCCGTGCAGAACCGCGTCAAGACCTGGTACGAGTACACCTGGCACTCGCAAGGCATGCTGGACGAGTCAGAGTTGATGGTGCAACTTCCAGACAAGATGCGGCTGGACCTTGCCATTGACGTGAACTACGACATTGTCAGCAAGGTGGCGCTCTTTCAGGGCTGTGACCGGCAGATGATCTTCGACATGCTGAAGCGCCTGCGCTCCGTGGTCTACCTGCCCAACGACTATGTGTGCAAGAAGGGGGAGATTGGCCGCGAGATGTACATCATCCAGGCGGGCCAGGTGCAGGTCCTGGGCGGCCCCGATGGCAAGGCGGTGCTGGTGATGCTGAAAGCCGGGTCCGTGTTCGGAGAGATAAGCCTGCTGGCCATCGGGGGCGGCAATCGGCGCACCGCCAACGTGGTGGCGCACGGCTTCACCAACCTCTTCATTCTGGATAAGAAGGACTTGAATGAAATTTTGGTGCATTATCCCGAGTCTCAGAAGTTACTCCGGAAGAAAGCCAGGCGCATGCTGAGGAACAACAACAAGCCCAAGGAGCAGAAGAGCGTGCTCATCCTGCCGCCACGGGCGGGCACCCCCAAGCTCTTCAACGCGGCCCTGGCTGCAGCAGGGAAGATGGGCAAGGGGGGCAAAGGTGGCAAGCTCGCCCACCTCCGGGCCCGACTCAAGGAACTGGCTGCACTGGAGGCAGCTGCCAGGCAGCAGCAGTTGCTGGAGCAGGCCAAGAGCGCACAGGAAGCTGCAGGGGAGAACGCCCCGGAGCAGTCCGCGCCCCAGGAGCCGCAGGAGCCCTCTGGCCCTCCAGTCCCAAGCTCTGCCCCGCTGGCCTCTGCTGAGAAGCCTGAGGACGGCGGGGAGGAGGCGGCTGGCACAGAGGAGCCCTCGGTGCGGATTCGCATGAGCCCGGGCCCGGAGTCTGGCGAGCAGACGCTGGCGGTGGAGAGGCCAGAGGAGAAGGAGGCAGCGGGGGAGTGA

XM_004843237.1 Coding sequence

LOC101702623 cocaine esterase-like

Length: 1689 bp    Location: 19576223..19567198   Strand: -
>XM_004843237.1
ATGCCCCTCCTACTCCCTGCCAGGTTCAAACTCCAGCCAGAGCCAGACCTTGCTCCCCAGCTTCCTGTTGAGGAAACACCGCTCGAGCTCTGTAGCAGAACAAAAACTGGCCTACGAGCACCCATGCAGCTTGATCAGCTTCCTTTCCAGCTGAATTCTGTGGTCTGTGGGCTCCTGCTTCTCCTCGTCTGTGGCCAGGCCCTGGACTCTGCCAGCCCCATCCGGAGCACAAACACTGGGCAGGTGCGGGGCAGCCTCGTCCACGTGAAGGGCACTGATGTGGGAGTCCACACCTTCCTGGGAATTCCATTTGCCAAGCCACCTGTAGGATCACTGCGGTTTGCAGCCCCTGAGGCCCCTGAGCCCTGGAGTGGTGTGAGGGATGGAACCTCCTACCCTGCTATGTGTCTGCAAGATGCGGACATAATGAAGATGTTTAATATGACCGCTCCTTCAGTCCCTGTAGCTGAGGACTGCCTGTACCTCAACATCTATACACCTGCCCATGTGCATGATGAATCTCGCCTGCCTGTGATGGTATGGATCCATGGTGGTGCACTAATTTTAGGCACGGCTTCCTTATATGATGGATCTAAACTGGCAGCTTCTGAGAATGTGGTGGTGGTCACTATCCAGTACCGCCTCGGTGTCCTGGGGTTCTTCAGCACTGAAGACCAGCACGCCACTGGTAACTGGGGCTTCCTGGACCAAGTGGCTGCCCTACGCTGGGTGCAAGAGAATATTGCTCACTTTGGAGGCAACCCTGACCGTGTCACCATTTTTGGGCAGTCTGCAGGTGGCGTAAGCGTATCTTCACTTGTCTTGTGCCCCATGTCTCAAGGACTCTTCCATGGTGCCATCATGGAGAGTGGGGTGGCCCTGCTGCCTGATATCATCTCTAGCTCATCTGAGAACATCTACACAATGGTGGCCAACATGTCTGGCTGTGGGCAGATTGACTCAGAAGCCATGGTGAGATGCTTACGTGGCAAGAGTGAAGAGGAGATTTTGGCTATTACAAAGGCCTTGGAGATCATCCCTGCTGTGGTGGATGGGGCCTTTCTTCCTAGGCACCCCCAGGAGCCGCTGGCCTCTGCTGACTTTCAACCTGTCCCCAGCATCATTGGGGTCAACAATGATGAGTATGGCTGGGCCTTGCCATGGTAATCTTTCGGCTCTGCTGACACCCAGAAGGAAATGAACAGAGAGACTCTGCGGACTGTTCTGCAGAGCATGTCAGCACAGATGATGTTGCCTGCTGGGTTTGGTGACCTGTTCATGGAAGAGTACATGGGGGACATTGAGGACCCCCAGGCCCTCAAAATCCAGTTCCATGAGATGAAGGCGGATTGTATATTCGTGATTCCTGCACTCCAAGTAGCACATTTTCAGCGTTCCCATGGCACTGTCTACTTCTATGAATTCCAGCATCCTCCCGACTTCCTCAAAAACATCAGGCCACCCTACACAAAGGCAGACCATGGTGATGAGGTGCCTTTTCTTTTTGCAGCCCTGGTCTCTTTGAGACCCATGGGGCCATTCATAAAGGCATCCACCTTGCCTGACTCACCAGATGCCCCACCTCCTCCCTGTTGGGTTCTAACTCTGACTGGGCAGGACTCTGATCCCAGGCTTCCTGTGGGTGAAAGGGAGTACAGCTCCAGCAGCACCAAAATACAGCCAAACTGA

XM_004843227.1 Coding sequence

LOC101719810 chymotrypsinogen 2-like

Length: 831 bp    Location: 11720914..11725567   Strand: +
>XM_004843227.1
ATGGTCTCCCTTTGGCTTCTGTCCTGCTTTGCCTTGGTAGCAGCCGCCCATGATTGTGGTAACCCTGCCATCCCACCCATGCTGAGTGGCCTGGCCAGGATCATCAATGGCACGGATGCTGTCCCTGGCTCCTGGCCCTGGCAGGTGTCCCTGCAGGATGAGAACGGCCTCCACTTCTGCGGGGGCTCCCTCATCTGCCCACACTGGGTGGTCACCGACACTCACTGCCAGGTCAGGACGTCTGACAAGGTGGTGCTTGGGGAATACGACCTGGCCTCTGATGAGGAGGACGTGTAGGTCCTGGAGATCGAAGAGGTTTTCAACCACTTAGATTTCAACTGGATTACACTCTCCCCTGACATTGCCCTGCTGAGGCTGAAAACACCTGCCCTGTTAACCCCAACCGTGTCCCCCGTGTGCCTGCCCTGTGCCTGTTGTGACTTCCCTCCTGGGACCGAGTGTGTCATCACTGGCTGGGGCATGTCCAGTGTCAACCCCCCTGTGACCCCCAGAAAGCTGCAGCAGGGGATCGTGTACCTTGTGTCCACTGAAGAATGCAAGAATTATTGGGGCAGCTCTATTACTCAGCAGCATATCTGCACCAGGGGCAGTGGCATCTCCTCCTGCATGGGTGACTCTGGTGGGCCCCTGGTGTGCCAGAAGGACAGAGCCTGGTTCCTGGTAGGCATCGTGTCTGGGGGCAGTGGCACCTGCAACACCTCCATTCCTGGTGTGTATGCTCGCGTCACTGCACTCGTGTGCTGGGTTAAGAAGATCCTGGAGGAAAACAGCGAGTTTCGTTGCCACCCCTTCTGCAGGTGTCACCAATAA

XM_004843228.1 Coding sequence

LOC101720157 serine/arginine repetitive matrix protein 3-like

Length: 567 bp    Location: 11954159..11954928   Strand: +
>XM_004843228.1
ATGGGGCGGGAAACTGGAGGTCCAAAGAGGCGCAGTCCGGAGCGGGTGCCGCGCGCCACAGGCCGCCCCCGGGCCCCGAAAACCCTAGGGGAGCCGCAGGGGCGGAGGGAGGGAGGCGGCGGGCGGGCGCGGGGAGGCGCCGGGGGAGGCCGCCCGCCCCACTGGAGCCGGCAGAGGGCTGGGGGCGCCGGGCGCGTCCCCCGCCTCAGGACGCCGCGACCATGGACGGCGGCCCGGACCCCTTCAGGCCTCGGGCGGGCTGCGGCGCTGGGCGGCCAGGCGGAGCTCCGGAAGCGGCGGTCGCGTCGCGTCGCGTCGCGATCTCGCTCCAGCCACCGCCGGCCCCGCCAGCCGCGCCGCCCAGCTCAGCCCCGGGCTGCGCTCGCCGGCGCTCCTCGCCGCCGTGGAGACAATGGAGGGCGGCAGAGCGCAGGCGCGGCTAGCACCCCCTCCCCCTTCCCTCCCCCCTGCCGGGTTAACCCCTTAGGCGCCCCGGGGTGCCTCTGGGACGGTGACGCCCGGGCGGTCCCCGCCTGCCCTCGTCTGGCTGTGAACCGGGTGGCCTGA

XM_004843230.1 Coding sequence

LOC101725119 putative upstream-binding factor 1-like protein 1-like

Length: 747 bp    Location: 14681702..14682448   Strand: +
>XM_004843230.1
ATGGAGGAATTCCAGAAGGGGAATTTAAAGAGTTTTAAAGAAAAACTGGTTCAATTCAGGAAAAACCACCCTGATCTAGTCCAGAACTCCAAAAAATCTGATGGTTCCAAGAGACACCGAAACAAAGCCCCAAAGAGTGTACAAGGAAATGTGAAAAATGAGAGGTCTCCTTCAAAAACTGATGCATTTTGCAAGAATTTTAAATTTCATAAAGAGCCCAAGAAACCCCCCATGAGTGGATATAACAAATTTCATCAAGATTCATGGTCAAGTAAGGAGCTAAAACATTTGCCCCTGAGGGAGCGAATGGTAGAGATTAGCAGACGCTGGCACCATGTGCCCCAGAACTTGAAAGAACATTATGCAAAGCAGGCTGAGGAGCTACAGAAACAGTACAGGGTGGATCTGGATCTCTGGCTCAAGGCTTTGTCACCTGAGGAATATGCTGCATACAAAAAGAAAAGCCAAGGTAAAGGGAAGAACATGACCACGGCAGGAGGCGCAAGCCCCAAGTTCAGAAAAGCAGACATGCCATCCTCACCAGCCAAGTGCCTGCCAGAAGGACTTAGAAAGGAAAAGGGGCTGGAGGCTCTAGAGACAGATTCCTTGGAGACAATCCAGAACAACTATCATCACGCACAGGGATCAAAAAGGAAAATGAAGGAAGATGGGGAAGAGGATGAAGCAAGAAACTTCTCAGATTCCAGCAGTGGAGATGAACATGAAGATGGTAGTTTATCTTCCTGA

XM_004843231.1 Coding sequence

LOC101696470 ataxin-3-like

Length: 456 bp    Location: 16414697..16416933   Strand: +
>XM_004843231.1
ATGGAGCCCATCTTCCACGAGAAACAAGAAGGATCACTTTGTGCTCAACATTGGCTAAATAATCTACTGCAAGGAGAATATTTTAGCCCTCTGGAATTATCCTCAATTGCTCATCAGCTAGATGAAGAAGAAAGGATGAGAATGGCAGAAGGAGTCACTAGTGAAGACTATCGCACATTTTTACAGCAACCTTCTGGAAACATGGATGACAGTGGCTTTTTCTCTATTCAAGTTATAAGCAATGCCTTGAAAGTTTGGGGTCTGGAACTAATCCTGTTCAATAGTCCAGAGTATCAGAGGCTCAGGATCAATCCTATAAATGAAAAATCATTTATATGCAATTATAAAGAACACTGGTTTACAGTTAGAAAATTAGGAAAACAGGTAATCAAGGTGTGGCTCAGCAGGCCGGGCCTGGCCAGAGGCCTCGGGACTCGGCTGTGGGGCGCTGTCTGA

XM_004843180.1 Coding sequence

Fam192a family with sequence similarity 192, member A, transcript variant X6

Length: 765 bp    Location: 28862294..28900758   Strand: +
>XM_004843180.1
ATGGATGGAGGTGATGATGGTAACCTTGTTATCAAAAAGAGGTTTGTGTCTGAGGCAGAATTAGATGAACGGCGCAAAAGGAGACAAGAAGAATGGGAGAAAGTTCGAAAACCTGAAGATCCCAAAGAATGTCCAGAGGAGGTTTATGACCCTCGGTCTCTCTATGAAAGACTACAGGAACAGAAAGACCGGAAGCAGCAGGAGTATGAAGAGCAGTTCAAATTTAAAAACATGGTAAGAGGCTTAGATGAAGATGAGACCAACTTCCTTGATGAGGTTTCTCGGCAGCAGGAACTAATAGAAAAGCAACGAAGAGAAGAAGAACTGAAAGAACTAAAGGAATACAGAAGTAATCTCAACAAGGTTGGAATCTCTGCAGAAAACAAGAAGGAAGTGGAGAAGAAACTGCCTGTGAAACCAATAGAAACCAAGAACAAGTTCTCCCAGGCAAAGCTGTTGGCAGGAGCTGTGAAGCATAAGAGCTCAGAGAGTGGCAATAGTGTGAAAAGACTGAAACCGGACTCTGATCCAGATGACAAGAGTCAAGAGGCCCCATCCTGTGTATCGGTTGGAAGTACCTCCCTGAGTGGCCCATCCATTCACTGCCCACCCGCCGCTGTCTGCATCGGCATCCTTCCAGGCCTGGGAGCCTACTCGGGGAGCAGCGACTCTGAGTCCAGCTCAGACAGTGAAGGCACCATCAATGCCACAGGGAAGATCGTCTCCTCCATCTTCCGAACCAACACCTTCCTGGAGGCACCCTAG

XM_004843220.1 Coding sequence

LOC101714951 uncharacterized LOC101714951

Length: 876 bp    Location: 5622052..5637699   Strand: +
>XM_004843220.1
ATGGCCGTTCCCAGGAGCACCCGCCACCCCAAAGGGCACAGAGACGCTCACTCAGGGGCTGCCCTGGGCTTTTCTGGGCCCCCTGACCTGGCTGCCCAGTTTGGTGGCGCCAAACCCGCACCTCAGGCCCGCCTGCAGGCGGCGCGCTCCTTTCCTGAACAAGGCTGCTCCTTTCCGGGAACCGCAGCCTGCGCGCGACGCCCACCCAGGGCCGCAGAGAGGTCAGCCCTGTCATCTAAGCGCCTGCGCTGGCCTCGGGTTCACTCGGGACCCACGCAGGGACGCGGGCGCCTCACTCAGCGCGAGGGCGCACGGGAGGCAGCGCACGCACGGTGCCAGCGGCTCCGAGCCTGGCCGGGCCCTGCGCGCATCGAGGCCGGTCACGGGTGGGTGCACAGGAGCGTGTGCGGGTGGACAGATGGTGACTCCAAGTATGGGGCAGATCCAGGAAGGAACAACAGGGGCCCTTCCAATGGGGCATCAGGCAGGTTGAATGCCTCCCTCTCTGCACATCCTGAGAAAGATGAGTTAATCCTTTTCGGAGGTGAATATTTCAATGGCCAAAAAACTTTTCTATGTGACGAGTGCTCCCTCTGCACTATGAGAAAGGACACCTGGACAGAAGGTGACATCTCTGGCCCATGGTGGAGGTGCTGTGCTCACCAGTTGCAACCCCTGTCTGAAGTTTGTAATGACTGTGACCTCTCAGAATATCATCACCTCCTGGGCTCCAGGTTGGCTGAAGGCCACTCACACTGCTCAGGTCTGAGGATGAAGGTGACCTCATCAGTGTCCCCTGACTGTGTTCCCGTCAGCTGCAGAAATGAGGAGGCAAGTTCAGTAAGATTTACAAGCTCATCATTTCGACGATCATGA

XM_004843222.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 5952 bp    Location: 6187851..6259382   Strand: +
>XM_004843222.1
ATGTCGAAGAGGAACACACTGGAGAGGGTGCAAGGGGGAAAGGAGCCCTTCTACATCATTGGATGCGCGGCAGGCTTGGTACTCCTGGGGCTTTCCCTGAGGCTTAGGGCTGTCATTGCTTGGCCAGAAGATGACAGCTTTTGTTCTAAGAGCCAGGTAGCCTTCAGAGAGGCTTGCTATGAACTTGTACCACTCAGACGCACCTTCCGCAATGCCCAGAGCTGGTGTGAAGGCCAAGGAGGCCATTTGGTCTTCATTCGAGATGAAAGTATGCAGCACTTTCTGCAGCAGCACCTCTCCCAGGACAGAGAGTGGTGGATTGGGCTCACAGGGACCTCAGCGCTCAATGGGACCACAAAAGGCCCCGGGACCTGGTTGGACACCTGCAATGTGAGCTTCAGCAACTGGCAGCCACGACAGGCGGGTCCCGCTGGCCACGCATGCGGCTACATCAGGAGAGGCTGCTCCGCCGAGTGGGAAGCCACAGACCGCTGCGCCCAGGCCTTCGCCTTCATCTGCCAGTTCGAGGTTGGCCAGAGCCTGGCGTGTGAAGGCCTCAATGCCACCATGCACTGTGGCTCCGGGGAGGTCATCCAGGTCCAGGACGCTATCTATGGACATCAGACCCCTCATTACTGCCGCCAGGATGCGCCGTGGGCCTCGGACCCAGAGGAGGACTGCAGTTGGGTCAGCGTCAGGGATGAGGTGGCAGGCCAGTGCCAGGGGCTGCAGNGCGGGACCTACTTTGGAGACCTATGTCCCAATTGGGGCAGCTACCTGTGGGTGCAGTGCCAGTGCCGGGAAGAGCTGTGGCTGCTGGTGTCCAACGAGAGCTTCATCTTTGACAATGTCACCATCTCTCTGACATGGCTCCTTTCTCCCTACTCTGGAAACCTGTCCTGCATCCTTAGTATGGGAGATGGCCACACCCTTGATCCCTACTACCCCTCCAGCTTGTCCAGCACCGTGAGGCACCAGTTCGTGTGCCCCGGAGAATTCACTGTGTTTGCTGAGTGCACAAGCAGTGAGTGGCATGTGACAGCTCAGAAGCAAGTGATGCTACTAGACAAGATGGAGAGGCTCAGCGTCACTGGGTGCCCCCACCTGTCCAGCTCAGAAGCTGGCCCTCTCTGCAGGGTTGTCTTTGGGGACCTTCTGTGGATTCAGGTGGAGCTTGATGCAGGAACAGGGGTGACTTACACTGTGCTCTTGGGTAACATAACCCTGGCTGAGTCCACCACCGGACTCCAGTGGGGCGCTCTGCCCTACAACCTGACCCTGGATGGAGACACTCAGGACCTGCTGGGCCCTGGGCGGCAATGCCTGGAGATCCATGCCCGAAGCAACAGCTCCAGCTCTGCGCCCTCCCAGAACCTCTCTATCCAGCTGGTGGAGCAACTGTCGGGGCTGCAGGCCTCCTGGGGTTCTACCCAAGTGGAGCTTGGACAGGACCTGTTGACCAACAACTCCGTGGCTCATGGCACCCTGGAGGGGCTGACCTTTGAGGTGACAGGACTCAATGCCAGCTTCTCCCATGAGGAAGAGAGCTTCAGGGAGCCATCTGGGACTCACCAGGTGGCACTTCCCGTTGAAGGCACCTTTCTGGTCACTGTGTTGGTGAGGAGTGCCTTCTCCAACTTGAGCTTGGAGATGGGAAGTGTCATGGTCACAGGCAAGGAGTCTCTGCTGCCAGGACCACGCGTCCAGGGCACTGCACAAGATCTCCTGCGATGCCCTTCACAAAGGAGAGACAAAGGGCATGCAGAGCTGTACGATGACCCCGGTCTGTTTGTGGATCCTTTCACTACCATCACGCTGGGCTGGCCAGAGGATGACAACTGGTCTTGGCATTACTTCCGCCTGACATTCTGGTGTCAGGCCAGCCAAGCTCTATACCTCACCAGCGAGGCCCTGTTGACAGCAAGTGCCACAGCCCACCCTGAGGACCAGAGGCACCAGGTGGCCATCAGGGACCTGCTTGTGGCTGTGGGAAGTGTACTGGATGCGTCCCTGAGCTATAGACCTGGGGAGACCAGCGCCAGACAGGCAGCCACAGTGGCCCGGCTGCTCGGGGTGGCAGAGTGCGTGCAGACCACCCTCTTGCTGGGCGCATTGCCTGGGGGACTTGCGGCCACTCTGGCCACCCCCTCCATCTCTTTGTACACAAACAGGATACTGCCTTGGAGCTGGCGAGGGACCTCCCTGCATGTTGCTGCTGCTAACTCTGCGGCCTTCACTCTGCCCACTGGCCCCCTCTGCTCCCCGGAGCACCCACAGGAGCCGGTGAACATCAGGACGATGAGCTTCCCAAAAAGCCCCTTTCCGACAGGAGGCGGCTTTGATGTCAGCAGAACTGTGGGCGGTCTGAGTCTGAGCAGCCCCAGGGCAAGGCTCATTCCCATGAAGAACCTGTCAGAGAAGGCCGAGATCCTATTGCCCCGGCCTGCAGAAGGACACACCTCACCAACCGTGTTGAACTTGACCGGGGCCAAGGTTCTTTGGGTGAATGTGACCACAAGGGCATCAGCTCTGGGGATCCGGCTGCACTGGGGACCTGGCATCCCACTCACGCTCAGCCTGGGCTATGGCTACCACCCCAACGCCACCAACCACGAGGCCCAAACCTGCCTGACACCAGCGGCTGCTCCAGATGAGCCAGCCACGTGGATCCTGGGCCCGGAAGAGCTGCCCTTCAGGGCAGGCGTCTACTACCTGAGTGTGGCCCCCGAGTCTGGCCTGGAGCCCGCCCCTGTCGAGGACCTCACCGTTAGGGTCACCACCTTCCTGCCCCACTGTGTGTTCTGGGATGAGGTCCAGGAGACTTGGGACGACTCTAGGTGCCAGGTGGGGTTGAGGACCATGCACTCAAGGATGCCCTGCCTCTGCTGCCACCTCACCTTCTTTGGAAGCACCTTCCTGGTGATGCCCAATGTGGTCGGCGTCCGCCAGGCGGCAGAGCTCTTTGCCACCTTCGAGGACAACCCCGTGGTGGTGAGCGCTGTGGGCTGCCTCTGCGTGCTCTATGTGCTGGCGCAGATCTGGGCCAGGAGGAAGGATGTGCAGGACCAGGCCAAGGTGAAGCTCACAGTGCTGGAGGACAACGATCCCTTTGCCCAGTACCACTACCTGGTAAGGGTCTACACCGGGCAGTGGCGAGGGATGGCCACCTCCTCCAAGGTGACCATCACCCTGTACGGCCGGGATGGAGAGAGCAAGCCGCACCACCTGGAGGGCCCTTTGTCCCCTGGGTTTGAGCGTGGAGGAGTGGACATCTTCCTGCTGTCCACCCTGTTCCCCCTGGGGGAACTGTGGCCCCTCCGGCTGTGGCACGACAACTCGGGAGACTGGCCGTCCTGGTTCGTGAGTCAGGTGCTGGTCCATGACCCTGCGACGGGCCAGAAGTGGTATTTCCTCTGCAACTCATGGCTGTCCATCGATGGGGGAGACTGTGTCCTCGACAAGGTGTTTCCCGTGGCTGCAGGGCAGGACAGGAAACAGCTCAGCCATCTGTTCTTTATGAAGATGTCCACAGGCTTCCAGGAAGGCCACCTCTGGTACTCCATCTTCAGCAGCTCAGCTTGGAGCCGCTTCACGCGGGTCCAGAGGGTGTCCTGCTGCTTCTCCCTGCTCCTCTGCACCATGCTGACCAGCATCATGTTCTGGGGGGTCCCCAAGGACCCCGCTGAGCAGAAGATGGACTTGGGTGACATTGAGTTCACGTGGCAGGAAGTGATGATCAGGCTGGAGAGCTCCCTGCTCATGTTCCCCATCAACCTCCTGATCGTCCAGATCTTCCAGCATGCCTGGCCTCGGGGTGCGAAGGCACAGGATGCTGGGACCCCCAGCCCAGCCCCGTCACCACAGCCCCTAGACGATGGCCTTGTGACACCTGAAGCAGACACATGGCGACTCGTCAGCTCGCTGTGCAGAGCCCTGAAGCTGCCGCCCCCGGCCTCGGGCTGGGACTCTCTGAGCTCGATGGACATCAACACGCTGCTGGCCTTGGTGGAGGACGTCATTTGCCCTCAGAACCCAGTGGACCGGGGCTGCCAGGAGGAAGCCAGGGAGAGAGAGGATCCTTTCAGCCTGGCCCTGGAGTCTGCGCCAGTGGAAGGCAGCTGGGTCAGCACCTGCCAGTATGGCACAGTGGAAACAGCTGCTGATGCCAGCAAGCACTGGATCCTCAGGCTGCCAACACAGCCTGACCCACGCCTGCTGTGGGGACTGCCGGTGTCCTTCCTCATAGGTCCCTGTGCCTTCTTCCGGGCACGAAGACACAGCAGCAGCGACGTCTACCAGCCCCCTCTCCCCGCCACCATCGAGAAGATGAAAGCCACCTGGCTGAAGAAGCAGAAGGCGTTTGCCCTCATCACGGAGACCCTGGTGTACCTGGGCTTCCTATGGATGCTGCTGCTGGTGGCCTACGGGCAGCGGNGACCAAGTGCCTACCACTTCAACAGGCACCTCGAGCGAAGCTTCACCAGAGGCTTTTCAGACGTGCTGGGCTTCCAAGAGTTCTTCGAGTGGGCCAACAGCACCCTTGTGAACAACCTGTACAGTCTGCACCGAGGCTTCCTCACGGATGGGAGCTCCAAGCTGGTTGGCAGCGCCCACATTCGCCAAGTGAGTGTCCGGGAAAGCTCCTTAGCTCCTTCCCTCTCCCCCTGCAGCTTCGGGGCTTCGCTGCACGGATACATGCCGGATGCCCGTGCGCTGTATTCCCTGGAGGAGGAAGACCGGCCGGCCTACAATGGGGAAGGCTGGAACACCTCCGCCCTCAACAGCAGCACTCGCTTTCCCCAGGCCTGGCAGTACCAAGACCAGAGCCAGCGCCAAGGCTCCCCAACATGAGGCAAGCTGGCTCTGCACCCCAGAGGAGGCTACGTGGTCCCTCTGGGGAGAGAGCGCCAGGGCGCGGTGAGAGTCCTCCACTATCTCTTTGACCACACCTGGCTGGACACCCTGAGCAGGGCCGTGTTTGTGGAGTTCACTGTCTACAATGCCAGTGTCAACCTGTTCTGAGTCGTCACCCTCACGCTGGAGACCAGTGGCCTGGGAACCTTCTTCACCCACGCGGCCCTGCACAGCCTCCGCCTGTCCCCCTTCACCGACGCCTGGCGGCCCTTTGTGTTGGCAGCTGAGCTCCTGTACTTCGCCTTCCTCCTCTACTACATGGTAGTGCAGGGCCAGCGCGTGCGGCAGCAGAAATGCGGCTATTTCTGCAGCAAGTGGAACCTGCTGGAACTGGCCATCATCCCGGCCAGCTGGAGCGCCCAGGCCGTGTTTGTGAAGAGGGCCGTCCTGGCGGAGCGCGACCTCCAGCGCTACCGGAAACACAGGGAAGCTTAAATCGACCTTGTCCCCTGTCCCCCGCCCTCCGCCGCCCTTGGAGACATCATTGCCTTCCTGATCCTCCCATCCACAGGGAAGCTTTGGCATCTGCTTAGGTTAAACCCCAAAATGAACCTGATCACATCAGCCCTACACCACGCCTGGGGTGACATTTCGGGCTTCATCATCGTCATCCTTGTCATGCTCCTGCCTTATTCCATCGCATCAAACTTGATGTTTGGTTGGAAACTCCATTCCTACAAAACCCTCTTTGATGCAGTGGAAACGATGATCNGCCTTCAGCTAGGAATCTTCAACTATGAGGAGGTCCTGGACTCCAGCCCAGTGCTTGGCTCCTTCCTCATTGGGTCGTGCGTCATTTTTATGACGTTTGTGGTTCTGAATCTGTTTATCTCTGTCATCCTGGTGGCCTTCAGCGAGGAGCAGAAACGTGCTCAGCTGTCAGAGGAAGCAGAAATTGTGGATTTGCTCCTGATGAAAATACTCAGTTTCCTGGGCATCCAGTGCAAAAGAGAGGTGCCTCAGAGTGGCCCTGAGCAGCCCTTGTTGCCCTTCACAGCTCGGTGCCCTGGGCCAGCACAAGCTTCACCTGGGATTTAA

XM_004843210.1 Coding sequence

Znf469 zinc finger protein 469

Length: 10437 bp    Location: 1054685..1043120   Strand: -
>XM_004843210.1
ATGCCGGGCGAGCAGCCCCGAGGAGCACCGCCCCCCGGCAACACCAGAGATCTGCATCCCTGCCCAGGTGCCAGGGGCCTGCGGCCCCCCTCCCAGCCGCCTCACAAGGACCAGCCTCCCAGCAGCAGGACAGCCCAGGGCACAAGGGGGGCAGGCAGCCGAGCTCTGGCCAGGGAGCCCCCCACAGCCCAGCTGGGGCAGGCCCTGGAGGTGGAGCCCCAGGCTGAGCTCCTGAGGCCCCGGCCTCTCCGTGGCCCCCTGGGGAAGGGGGGTGGCCCCGACACCCCACCTTCAAGGAGCCACCCAGGGGAACAGGGGTGGCTGGCAGGCAGGGTGGACAGCAGCCCCCCACAGCTCTATGGCCTGGGAATTGCCAGCCCAAGGGCCAAGCCCACCCTGGACAAGACCCCCAAGGGCCGGCCACTCAAGCCCCAGGACTCCCAGGCAGAAGCCTGCCGAGGGCCCAGCCTCCCTGGGGCCGACATCCTGCCCACCCTCGGAGAGCTCAGCTCAAAAAGGTGCTTCCAGGAGGCCCCCTCCAGCTTTACCTCTAGCAACCATACCTCACCAAGTGCCACCCCAGGACCCCCTCGGGCCCCGCCGAGCAGCCCCCCAACACTGGCCTCGCCCCCAGAGCTGCAGGCCAATGGGGCTAGCCCTTGGCCACCTGCTGCTGAAGACAACTTCCCAGGTGCTAATTTTGGGCGCCTCCCCTCCAAGTCGGAGCCCTTTCCTGAGGGCAGCAGGCCTGGCAGCCCCCGGGGGAGCCCCTTCCCGTACCCCCTCCGGGCACAGCCCCCTCATGAAGACCCAGTCGGACAGGCCTATGCCAGTGGAGCCCTGGCCTTTTCCCTCCACCAGCCCCCGGGAGGGTGGCCAGAGGTGACTGTGGGCACCGGCCCTGCCTACCGACTGCCCCCCATGCCCTCGCCCCTGCCCTGCTACCCCAGTCATCCAGGTGGCCTCAAGGCCCCTGGCGACTGTGCCCAGGCCCTCTCCCCACCTGGTGCTGATCCCCTGGCTCCGAGACCCTTCTCTGACAGTTTGCACAGGAGCCTGGCCGAAGTCCTCCCCGAAGGACCCCCTTCAGGCCATGAGAGGCTAGGGAGCCCCAGGGCACCCCCAAACCCTGGGTCTCAGAGGCACTTTCTAGGACAGACGTATAGAGCCAGTGGGGTGGGCAGCAGCCCAGGGCCTGGGGACGCCACGCTGGCCACCCCCAGACCCCTGCCTGCTAGGCTGCCTCAGCTGTGGGACCCCACAGCAGCCGCCTACCCTGAGCCTACCCTGTGCGCCCCGCCCACCCCTCGTGCTGCATTCTTTGATAGCCCCAGCCAGGGACTCTGCCTGCCCCAGAGTCCCACAGTGCCATGGCCCTCAGCGCTCCCCAGCCCTGGGCCAAGCCGTGGTCAGCTGGAAGTGCTGAGGCAGCTGCCATTCCCCAGGGGGACCACCGAGTGGCAGGAGGGCAGCCAGGGGGCTCTGGGTGCTGCCAGCCAGGCACCCGGCCCTGGGGAGACAGTGGTAGCCCTGAGAAGCAGCCCAGGCCAGCCAGGGAGCTCCCCGGGGCTGCTCCCCTACAGCGGGATGAAGGGCCCTGGGCCCCAGGCTCTGCTCTTCGGGGGCACCCAGCCCCAGGCGTCACCCCGAGGGGCCCCAGCCCTGCCCCCGCCCAGGGTGGTAGGGGTCTCTCCCAGCGAGTCCCCCCTGCCCTCTCCTGCCACCAACACGGCCAGCAGCAGCACCTGCTCCTCCCTGTCCCCACTGTCCAGCAGCCCGGCCAACCCCAGCTCTGAGGACAGCCAGCTCCCCGCTCCCCTGGGGCCTTCGGGCTTCTTCCTCCCGGCCCCCCGCCCTCAGGAGCCTGGGAGCCCCTTCCCGCCCCCAGAACTCCCCAACACCCGCCCAGCCCACTTCCCACTCCCCTCAGATGGGCTGGGGCCTGAGGGTGCCCTCGAGTTCCTGGGCAGCGAGGGCCGTGGGGCGGGCAGGGACAGGCTTCGGGGCTTCCCCCGGGGCCCTGCTGCCTATGCCACCCACCACTTCCCGCTGAGCAGTGCCAGCCTGGACCAGCTGGACGTGCTGCTGACCTGCAGGCAGTGCGACCGCAACTACAGCAGCCTGGCTGCCTTCCTCGAGCACCGGCAGTTCTGCAGCCTGCTGCTGGCCCGGCACGGGCCCCAGGGACACCTGGCACCCACTGCTACCCCCAAGGTGCCGGCCCCCACACACCCAGGCTTGCTGGGCCATGGCCAGACCATCCCTTTCCTGCTGGCCGGGGACCTGCAGGCAGAGAGCAAAGATGACGACGCCCTACGCACGAGCTTCCTGCCCAGCCTGGCTGCCCCACCCTTCCCGCTGCCCACCTCAGACCTGGACCTGGAAGACAATGCCAAGCTGGACAGCCTCATCACTGAGGCCCTCAATGGCATGCAGGACCCGTCGGACAGCCCCGAGATCGACAGCAGCTTCATAGACGTCTTCGCCGACGAGGACCCTCCGGGCCCCAGGGGTCCTGGCACTGGTCAGGCCCTCAACTCCCCAGCAGGTGCCACCCCGGAGTATCATGCCCAGCCCCTGCCCCCTGCTGGAGAGGCCACACCGCAGCCCCAAGGCCCCTACCTTGGGGACAGGGCCCGTCCAGCTGGGAACAGGCCCACCACCCCCTCACTGGGCCCAGCACCCACAGAGGCCACTGAGCCCAGCCTGGGGAGGCAGCCACGGAGAGGGAAGCAGCTCAAGGTGTTCTGGAAAGGGCTGGATGCAGCCCACAGCACCAAGGGACCTGGCAGGGCTCTCTGCCCGAGGCCGGGGAGGAGGGGCCACGGTACCCAGCAGCCCCCACCCTATCCCCGGGACCTTAGAACCCAGGCGAAGGGCCACATGGGTTCCCACCAGCGAGGCCCCGGGGCCCTCCTCTCTGCAGACACCGGGATCACCAAGCGCCTGAGACTGCCCCCCAGGAAGGACCCCAGGAAGCGGAGGACACAGCGGGGTGGCAGCTGGAGCAAAGAGCTCATACACAAGATTGTGCTGCAGAAGAACAGACTCCACAGACCGCGGGCACCCTCGAAGGCCCCACAAGGCAGGCCAGGGGCCAGTGACCACGCCTCCGAGTCTGAGGAGGAGAGTCCCAGGCCAGGGGCGCCTGGCCTCAGCGGCCGCTCTCACCAAGACCACCAGCAGCGGTGCCTGGGCAAGAAGATGAAGGAAGAGGGCCTGGGCCGGGGCCCCAGCAAGGCAGAGAAGCCGGGGTCTGCTGAGTCCAGGGGCTCTCCAGCCCCAGGGCAGCTGCCCAGCCCAGCCCACAGCCCGGACGGAGACCCCAGGTGTAACTCCCCGCAGGTCCCCACGGACACCACAACCCCAGGGGAAAGCCACCCGTCCCTGGGCCTCTGCCAAGCAGCCCCAAAACCCGAGGCTGCCAGCCCCACAAAGCTCAGAGAGGTGCCCACCGGGGAGAGTGGCTGCCCCAAGCCCCCCACTCCAGAGCCCCCACCGCCCGGCAGAGCTGGCACCAGCAGACACCCACCCTCGGGGAGCCACCCCAATGTGCTGCCAAGGCCAGCGGGGGGCGCTCTGCATGACAGAGAAGATGCCCCTGCTCACCAGCCCAGAGGCTTCCAGATGCCCGTTGCTAGTCCCACCAGGGCGGCCTATCCTGAGCACAGCACCCCATTTTTTAAGAACTCTGATCTTGGTTGCAAGCCTGCTCACTTTAACAGAGACTCCGTGGGGGTTCCTGCTGCCAAAAAGGGGCCCCAGCCCAGCAGCAGTGCCCCCAGTGAACTGTTCCTCAGGCCCAAGGACCCAGCGGTGGACACTCCGCCAGCCAGCAGCTGCTACCTTGGCCAGGACCATGTGGACGCCCTCAAGCCCAAACCACCAAAGAATCCGCCCTACACGGCTGAAACTGACCCAGGCAGAGCCCAGTCGCCACTGAGCTTGGAGTCCATGACCCTCTTTGCAGGGCTGCCCGAGGACGGCTTCGACCCACCACCACTCTACGACAGCCTGTCACCACACAGGGCCACCCCCGAGCCGCTGGCCTGTGCTGACCCTCTCCCAAGGAAACCTCTGATAGAGCCACTGTTCCCCCCATTTCTGCTCCTGGAGGAAGTGTCCCCAACACTGTCCAGCCAGTTTCCTGACCTCTCAGTGCCAAAGGCATTCCACAAGAAATGTCCCCATGCAGAGATGGGCTCCCCCAGCCCTGCACCTGTGCCTGGGAAGAGAAACGGACACACTGCAGCTTTTATGAGCAACCTGTCCGAGGATGAGCTGGAAATCAAAAGATTGGTCTCCGAATTAGAGAGCCAACTGCAAAGGAGGGGGGCCACCCAGGAAGCCCCCGAGGACCCCAGCGAAGCTGCACGTGCAGCCTCCCTGACGCCTGCCCGCCAGGCTGCCCTGTCCCACAGCGGTGCAGCCCACCTTCCAGGTCCTGGGGAGACACGTCCAGAGCAGGAAGACGCGGGAACAGCCATGCCCCCCAGGAAAGGGGCGCTCCAGAGCTCCCAGGGGGACCAGCCCTGCCCAGCCACATGCTGCCCAGGAAAAGCGGCCCCAAGCCCGGGCCCCCCCAGAGACCTGGCTTCTGGGGCTCCTTCTGGGCCCATGGGGTGCAGCCTTCGGGCTCTGACAGCTCAGAAGAGCCAAGGCTGCAAGGCCACAGAAGACCCTGGGGCGCCCTCGGGCGAGTGTCGGCCTGAACCCACCGAGGGACCCAAGGCCCTGCTGGAGGCTGGGGGCCTGGCAGAGCGCAGCCCAAACCGTGACCTTTTATCTCCTAGAAGTGATGAGTGGATCAGGACTCGGGCGAGCGAGGGCTCCCCGCTGCCACAGCTTCCCTGGGAGCAGAACAGAGCGCGGCCGCCAGAACCCCAAGGGGCAGAAGGGCCCTGTCCAGGCCGCACAGCACCCCCAGCGCCGGGTCAGGTGTTTCGGGGCAGTGGGGAGGCATCTCTGGGTGCCACCCCGGCCTCAGATCCCGGTCACAGCCACGCCTCCAAGGGCCCAGCTCCCAGGGAATCTGGGCCCCCTCGAGCCCTGGCAGAGGGATCTGCCCTCCAGCACCAGGAGGCTCCATCGGCCCCTGGATGCCCTGCCGGCCCAGCCTCCAGCCCCTCAGGTCCACTCCGGGTCCTGGGGACCAGAGCTGAGGACAAGGGTTGCGTCCAGCTCCTGCAGGGGCCTCTGCCTGCTGGGGCCCCAAGCCCTCGGCACAGAGCACCCCCCAGTCTAGGAGGGGACAGAGTGACAGGAGGCTCCCCTGGGCATGTGCAGGACACAGCCACCGCCACGGTGTCGGAGGCGAACGGACATCTGGGCTCCCCTGACCAGGCCAAGAAGCCCAGGGGCCAAGGCAAAGTCAGCCACTGCCTGCCTGGAGCCTGGAAGAGCCCGAGGGCACGGGGCAGTGGTGCCAAGGCCAACACCCCTCCCAGAAGGCACGGGCCAGCCAAGGCCTCAGCCAGGGCCCAGGGAGGCAGCACGGCCTTGGGCCCTCAGGAGCAGGTGCAGCCAGCCCCTAGCCCTCAGCGCCTCTTGGGAATGGCAGCCCACGCCCAACAGGGGCCTGAGGACAGGACTCCAGGGGAGGTGACCAGCCAGGTACCGCCCCCCGGGGACCTGGTCCCCTGTACAGCCGTAGTCACCCCCAGCCCCTTCGGCCTGGAGCACACACCCCAGGAAGACCCTTCCTGTATGTCTCTGGGAGGGGCCAGGTGGGTCCAGGCCCCTGCAGGTGCCAGGGCCACAGGGCCCCCTGCAGGTCCGTCTTGGAGGACAAGCCTCTGTGGGCCTGAGGACCTCCCACCTCCTGCTCTCCTGGGGGCCAGCAGCCCCGAAGACTGGCCGGGCCTCAGTGACATCCCAGCCCCCAGCCAGGGCCAGGATGGCCCCAGCAGCAGCACATTAGGAACCCTAGTGGAGTTCAGAAGAGGGCCGGGGAGCCCTCCGGCCAGTGCCACACCATCTCGTCCAGGAGCACACGTGTCCCCAAGAAGGACCATCAAGGAACACAACACAGAGACAGTCCCTACAGAATGTGGCGTGAAGGCAGTCAGGGGGCTCCGGGTGGCGGACCCCAGCATGTCCTGGGACCCCTCCTCACATCCCCCGTGCCTCACCCCCTGCCTGAGCCACGGGGGCAGCGACAGCAGCACAGCCACACCCACAGACCCCACCACAGCGGGGCCCACACAGCCGGGCCCCTCCCCCTGCCTGGAAACGGAGGCTGGGGCTGTCAGTGAGGGGCAGGAGGATGCAGGGACACGAGGACACAGGGCCCGGTGCTCCAGTGTGACAAAGCTGCCCGGAGCTGGCCAAGGCCTGACCACAGCCCACCATCCCCCAGCTGCCTCTTCCAGCAACACAGCCGGTGACTCTGGGTCCAACTCTCCCCAAAGCCACACCGGGGTCCCTCACCAGATGCCCCATGTGGACTCTCTCAGTCCCCAGGACCCCAAACAGGAACCCTATGGTTTGAAAAAGAAGCTGGAGCCCACAGAGAGAAGGAAGGGCCAAGCCCCCGCTGGGCCAGCTCTCCCCTGCGTCACCTGCGATATCTGCTCAGCCTCCTTCCGCTCGGGGCCTGGCCTGAGCCGGCACAAAGCCAGGAAGCACCGGCCAGACGGCTGTGCCGCCCTGGGGTTCAGGGCCCCTGGGAAAAGGAGCCACAGGGTGCCTGGCAAGGAGGGACCAAGTCAGGCTCTGATCCGCCCCAGCCACCCTGCAGGGCCAGCTCCCCCACAGGGCTCCACGACACCTGAGGGCACCCCGGGTCCTGAGACGGAGGAGGGGCCCGAAAGGGGCACCAAGGCACCAGCTCACCCCCTTAACCGGCAACCGCATCCCCCGGGCCTGATGGAGTCTGGGGAGGGGGCAGAGCCCAGACCACACCTGCCGGAGGCGGGCAAGCTCCACCCTAGACAAACAGAGAGAAAGGGACAGAGGCGAAGCCGAGAGCCCCAGGACTCCCGTCGTACCACAGCCCCGAAACCACAGGAGAACGTGGGAAAGACCCGAGCCAGGAGGCCCCGGGGGGAGCACACAGCGCCCGGCTCAGCCTCTGCACCCACAGGGCGGTGCCGCTCCAGGGCGTACACGGCAGCTGCCCACTGCTCAGCAGAGGGACAGCAAGGGGCAGACAGGGCGCCTGGGCCACTGGGAGACACTGCAGGCAACACCGCCACCCAGAAGTCCCCTGGTGGTCGGAGGAGCCCCACAGGGAGGGCAGAGGAGGCGTCCCCTGGAGAACTCCCGGAGGGGTGGAAGGGAGCCCTGGCAGGGGGGCTCTGGGGACCCACAGTGGCCAGGACATCTGGCAAGGACCCATCACATGCCTCTGCGGGAGAGGCTGCTGCAGACCTCGGAGGGCCCAATGGCAGCCCAGGTGACAGCGTCAAAGCAGGGACACTGGACCTTCCCGGGATGCCCAGTTCTGAAGCTGGCAGAACCAGCCTCAGCTGCCCGCAAGACCCCCCTGAAGCCCAGGGTGGGGACCCTGAAGCCCCCAGCATAGGCTGCAGGGACCCTCTGAGTGTGCTTGATGACGATGTGGCCTTTGCCCAGCTCTTCCCCCCCGGTGGCCGCTTTGCCCGGAAGAAGAACCCCCGAGTCTACCAGAAGCCCTGTGGGAGACCGCGGTGCCTGCCACCCACCCAACCACTCAGCCAGCCTGGGGGCGACCCTCTCTCCTTGGCCCGGCTGCCCACGGATCTCAGCGACTCAGGCTCCCTCTGCCTCTCCTGCGAGGACCTGCTGGGTAATGAGGCCATGGAGCTGCCCGAGGCCTGGCTGCTGGATGGGCCTCTGAGCAGCAGCACCCCGGGCCTCGGGTTATGGACCCCGGAGCCCAGAAGGGAAGCCGGCTGTGTGGACAAGGCACCCCCCTGTGGCACTACAGACGATCAGGTAGAAGCCATCCCTGAGCTGCACAGGGTGCCTGCAGCCTGGCAAGGCCTGGGGCTACGGGTGCCCCCAAAAGAGGCATCCTCTCCTCTAGGAGATGTGAGTCCAGAGCCCCCCAACCTGGAGAGAGAGGGCTATGAGGAGGGGCTGCCCAGAACTGCTGAAGACTTGGAGATGGTCGGGACCACGCTGCAGGCACAGGACCCGAGCTTCCCAAGACCCTGGGAGGACCTGGTGAGCGTCCCCAGCACCAGCGCCTTGGACGTCCAGGAGGAGGCCGCAGGGCTGTGCCAGGCTCGTGGCAGAGAGCAGCTGGTCCCTGGCAGGAGTGCTTCCTTCAAGTGCCGCGTATGCTTCCGGCGCTTCCACGGGCTGGGCGAGCTGGACCTGCACCGCTTGGCGCACAGCGCGGCCCCACCACCCACCTGCTACATGTGCGTGGAGCGCAGGTTCGGCTCGCGCCAGCTGCTGCGCGAGCACCTGCAGGAGAAGCACGTCCAGGGCCAGATGGGGCCGTGGGCCTGCGGCATGTGCCTGAAGGAGGTGCCAGACGTCTGGATGTACAACCAGCACCTGCGCGAGCACGCTGCCCTCTTCGCGCGCAGGGGGCAGGCGCGACGGGCTCTGGGCGAGCTGCCCGCGGGCTCCGGGGACGAGGGTGCCTCGGCGGAGCGAGCCACAGACCAACGGGGGGCTGGCGGGGCCGGTGGGGGGGATGGGGAGGGGGGCCCGGGGGACGGGGCCGGGCGCCCTCTCTCTGGGAGCCTCCATGGCTCCCCGACGCCGCCCAGCATGCCCGGCGGCGACAGCCCCGCCACCCCCAGCCCGAGCCGGGAGCCCCGGCCCCACGGCGAGCCCCCGCTCTGCCGCGGACCCGTGCACGCGGACTGCAAAGACCCGTCCCGCGACTGCCACCACTGCGGGAAGCGCTTCCCCAAACCCTTCAAGCTGCAGCGCCACCTGGCGGTGCACAGCCCGCAGCGCGTCTACCTGTGCCCGCGCTGCCCCCGCGTCTACGCCGCGCACCGAGAGCTGCGCGCGCACCTGGGCAGCGCGCACGGGGCGGGGCCCGAGGCGCGTGACGTGGCGCCCACGCCGCTGTTCGCCTGCGAGCGCTGCGCCGACGTCGCGCGCGTCACCCGCAGGGCCTTCGCGTGCAGCGCGTGCAACTATACCTTCGCACGCCGGGAACAGCTGGACCGGCACCGCGAGAAGCACCGGCGCGCCTGCCCGCGGCCCTGCGCGCTCCGCGGCGTGCGGCGGCCCGGGGCTCCCGAGGGCGCGCTGCCCCTCAAACGACGCAGGCTGGCGCAGGTTGGCCGGCCAGTGTCCCCGGGCAGCCCGGCCCTGCCCCGGCTCTGCCCACAGGCGGCCCCCGGCACCGCTCAGGCCCAGGAGAGGCGCGAGGATCCTGCCGGCCAGCCAGATGCACCCCCGGCCGGCCCAGACCTTCCACCCCCAGCTCTGTCTCCCCCCGCCAGTGCCCAGGCTGAAGGCAGAGAGGGGTGCGAGCTAGACCGAGCCCTGGAGAGGCTGGAAGGCGAGGCTTCGGCAGGCAGTCCTGGGCCTCGGAGACAGCAGGCTCCCCGCCTGGGCTCAGGGAAACGCGGGCCCCCCGGAGGCCGTGGCAGGTGCGCCCCGGACGGGTCCCCGGGAGAGCCCTCCCTGCTCCCCAAAGAGAAGCAGGTGTCACCCTGCCATGTGGTGCCTGAGGGGCGCACAGCGGGCCCCTCCCACGAGGACGGTGCCAAGCTGGGGGGTTGCCGGAGCGCGTCAAAGCCCAAGCCATTGGCGACCACCCCCAGCAGGGTGCCAGGGCAACCAAGGAAGCCGGCAGAGATAGGGAGCCCAGCACCCGGAGAGCTGGCCCACGGCCCTGAAGACAGGGCGAAGCCTACCACCCCCAAAGCCAGGCCGAGGCCCAGCTCCCAGGGCAGGGGCTCGGCGCGGCCTGGCACCAAGACCGCAGGGGGCAGCCAGCCCCAGCCGGCCAGTGGGCGGCTGCAGAGCGAGACTGCCACCACCCCCGCCAAGCCCCGCTGCCCAGGCCGGGGCCCCGCACCACACCCGGCCCCACCTCGAGCCCAAGGCAGCGGCTGCCAGGAAAAGGTAGAGGGCACCAAGAGGAGGAGAAACGGCCCGGGCCCGGGCCCGGCCCGGCGGCAAGGCACAGGGAGCGCAGGCAGAGCCCCCTCGGCCCCTGACAGGCCTCCCCGGGCCCCCCGGAAGCAGGCCACCCCCAGCCGGGTGCTCCCTGCCAAGCCCAGGCCCAGCACTCAGATCAGCAAGACGAGGCCACAGCCCTGGGAGACTCGGAAGGGGGACCCCGGCCCGGGCCTCCGGAGGGAGGAGCTGGGCAAGGCCTTCCCCCAGGTGAGGAGGGGCAGGTCTGTCCCCAGCACCAGGCCTGCCCAGCTCCGAGACCACCGGACCGCAGAGTCCCAGAGCGACCTCCTCAGCCAGCTCTTTGGGCAGAGACTGACCAGCTTCAAGATCCCCCTAAAGAAGGACACTTCCGAGTGA

XM_004843213.1 Coding sequence

LOC101712121 collagen alpha-1(III) chain-like

Length: 246 bp    Location: 1928918..1925739   Strand: -
>XM_004843213.1
ATGCGTGTGAGCCAGGGTCAGGCCCTGGTGGGCGGGTGCGGCTCTGAGCGGAATGAGGCGGCAGCGGGGCAGCAGGGCACGGTGGGGGGGGGGGGAGTCAAGGCAGGAGAGTTGCGCGCGGGGCCACGAGGCGAGGACGGAGCCGCAGGCCCTAAAGGACCTCCAGGGCCCACATGGCATGACTCCAAGGCAACACTCTGCAGTGCAACAGGACAGCCCCCTACCCTGTGGCCATGCAGAACATAA

XM_004843214.1 Coding sequence

LOC101712461 uncharacterized LOC101712461

Length: 603 bp    Location: 2598436..2580302   Strand: -
>XM_004843214.1
ATGCAAACCACACAGGTTCCCGGAGCGAGCGGCCCCACTCACTCGTTCGCCCGTGCAGAATTCCGCGTGCGCGGGGGGAGTTGGCCTAATGCCCCTGTGGGCTCGGCCTGCCGCCGCCGCGGGGCCTCCGACTGCGCACCCGGCCAGGTTCCGGAGAGCGGGCAGGGAGCGCGGGCCGAGGCTGCCCTCGCGCCCCTGGCTGCCGGCCTAAGGGCTCGCTCGCACGCACGCCTCCGCTCGTCACCCTCGCCTTGCCGGCGTGCGGACAGGGCCTGCGGCGGTGGGAAATCTGGGAAATCGGAGCGCAGCGCAGGACCGCGCGGGAGGCCGGCGGGACGCAGCGCGCACAGACCCCGGGCTGCCCCGACAAAGCACCGTACATGGCCTGGGCGGCTTATTCCCGACAGACGTGGATTTCCTGTTCCAAGGCTGGGCGTCCAAGCTGGGGTGCACCCGGCGGCCTGTGCTCGCTCCCCACTGCCATCTCCTCACATGGTGCGCTTGCCCTGTGACCAGTTGGGGGCATGGGCCTCTGGCCCCCTGCAGTCATCCTTTCGGTGTCCAGCACAGCAACAACCACAGACATGGCAGGAAGGCCTGTAG

XM_004843212.1 Coding sequence

LOC101711752 uncharacterized LOC101711752

Length: 2373 bp    Location: 1841925..1924739   Strand: +
>XM_004843212.1
ATGACCCGGCCTGGCCGGCGCCGCGCTGCACATGCGGCCGCCGCTCGCGCCGCCCAGGCCTCTGAGGCCACCGCCGCGTTCCGGGCGCTCGCGGGCGCTGAGGCCGCCGCGGGGGGCGAGCCGGCGCCCGGGGCGCGCGGGCTGAGCGCGGCCGACGGCTGCGTGCTGGTGTGCGCCGTGTGCCGCTGCTTCCTGGGCGAGCAGTGGGCCGCCTTCGAGCGCGCGCGCACGCCCGTGGACCAGCGCGTGTACTGGCTCAAGCGGCCGCACCAGTGCCACGCGGGCGCGGGCGCGAGGGCGCGCGGGGCCGCGGGGGCCCGCGAGTGGGACGGCGGCGACGACGCGGACGACGGCCCCGGGCCCCGCGCGCCCGACTCCGAGGACGCGCGCGACTCCGAGCTGTCGGAGCTGTCGGACCCAGAGCCCCCGTCGGAGCCGGAGCCGGAGCCGGAGCCGGAGCCGGACCCAGCCTCTCGCGACGCCGCCGCCAGCCCTGGACCCGACGCGTCTCCTGTGCCAGGACTCCCGCTGGGACGGGGCGCTGAGCCCACGGCGCGCGGGGAGGTGGAGGACAGGCTCCCCTCGAGGCTTCGCGCGGACCTGGAGCCCCAGCCTGCAGTCCGGCGCCGTCGCAAGGGGCCTGGCAGACACTGGGCCCCCGAGCCGCGGGCCAGCGTCCTGAGGGGCATTCAGGACACTTGGCAGGGCCACCCCGGCCGAGCAGCCCCTTTGGAGGGCGTGGACAGAGCCCCCTCGGGCAAGGCCGCAGGGCCCCCAGAGAGCGCGACTGAGGAAAGCGACATCAACATCACCAGCGAGGAAGAGGACCCCCAGGAGCAGCCTGCCCAGGGTCCCAGTGGCCCCAGAGAGAAGGACAGCAGTGGCCGCATCCCTCCGGCTGTCCCAGAGAGCCAGAAGGTGCCACCAGAGGGTCCCTGCTGCTACATCTGCGGGTCGGCGCTGTCCCCGGCCTCCCAGCACGAGGTCTACGTGCAGAAGCAGGAGCAGCTGCCCCAGGCGCCCTTCTTCCCCTTCCTGTGGTTGCACAGCCCGCCGCCCGGCGCCTGGCCCATCAGCGAGGCGGGCAGCACGCTTGTGTGTCCCTGCTGCTTCGAGTCCCTCCGGCAGCAGTGGCAGAGCTTCGAGTTGGCCGGGGTGCCGGTCCTGCAGCGCCTCTACGTGGTGCCCCTGAACAGCCGCGCCCCCGGCATGGCCTCCAAAGGCAGGCTGCTCCCAAGGGGCAGGGACGAAGGCCCGCCCCGGGCAGCCCTGCCTGAGGCCTGCTACCTGTGCGGCGAGGACTGCACCCCTGACGCCCGGGCCGTGCCCTCCCGCATCCTCAACGGCAGCGCGCGTGGCACCATGCACTTCCCCTTCCTCAGCCTCCTGCCCTGCCCGCCCAACGCCCAGGCCCCCAACAAGCGCTCTGAGGTCCGCAGCTGCCCCAAGTGCTTCAGCGTCCTGGAGGACGTGTGGGCCCTGTACCGGACTTGCCAGAACCAGGAGCTCATCACCTCCGTGCAGGGCTTCCTGGGTCGCTACCACCAGGCCTTCTCCGCCTCTGACCCCGCCGTCTGCGACCCGCCCGCCTCGGCGCCTGGTGCCCCAGCTTCCGTGTGCTACATCTGCGGTGTGGAGCTGGGCCCGGGCAAGGAGTTCCAGCTCAACGTGAACCCTGCCAGCCGCCTGGGCGAGAAAGAGCCCTTCTTCCCCTTCCTGACGGTGTACCCGCCTGCCCCGCGCGCCAGGCCTGCCGACGCCACCGGCCTGGTGGCCACCTGTGTGCTCTGCTACCACGACCTGCTGAGCCAGTGGCTGCAGCACGAGGCCCAGGGGTCGCACCATGCGGTCAGTGCCTGGTCCCGGCAGTACCAGGTGGACACCTTCGTGTGCTTCTTCTGCCAGCAGGAGAAGCGGCGCTGCCTGGGGCTGACCACGGTGCGGGTGGCCCGCCTGCCCCTCTTCCTGTACACCCTTCGAGCCAGCCACAGCCTGCTTGTGGACGATGGGCGGCAGCTGATCATTGGTGCCTGCCTGGAGTGTGGGACCCTGGTGTGTGCGGGCCAAGGGCTCACTCGCCCGGGGCCCATGGGGTGGAGCTCCCCGGTGGCCACAGCAAGAAAGGTCACCTCCGTCTCTCTGGAGTTATCGGCTGCCATCCCCCCTCCCGCCCAGGAGCCCGAGCCGTGGCCGGGGCCCGCTGCCACTGCCACCGACAGCCTGCCCAGGGGCTCCAGGCTCGCACCAGAGCCGCAGCCAGTGCAGAGCCAGCCGGGCCACGATGGGGCCGGACCAGACCACCCAGGCACAGGCAGGCCTGGAGGGGTCAGCGGGCTCCTGGCCGATGCCTGCCAGCTGTGCCAGCCAGGCTGA

XM_004843215.1 Coding sequence

LOC101712821 uncharacterized LOC101712821

Length: 843 bp    Location: 3037775..3024955   Strand: -
>XM_004843215.1
ATGCGTGCACAGAGCTGGGGACCAACACCCCGGCTGGAACGCCCCACCGGTGCACAGGCCCGTCGGTTGGAAATGGTGAGTCAGGTCGAGGGCGGCGGCTTCCAGAGCCGACGTCCAGCAGGCAAGTGCTCCAACCTGGTGACTAAAGAGCACATCTGCTGTAAGTGCTGTGACAAATTCATGGGCTGCCTACTTGTGCCTAGGGTGGAGGCAGTGCTGCCCTACTGGGTCTCTCTGTCTTTGAGACCCCAAAACAGGTCTGTGATGACTGATGATACTGTGCCTGGGGACGGGGGCAAGAAGTGCCTGCTGAGTGGGCACCCACAGCCTGTCCCCAGTGCCATTAGCTCTGGGGTCCACATCCTGGTTGTCTCAGACAGCACAGCAGCCACTGGCAGGGCCCGGAAGGTGGTCCAGCCCCACATCTCCACATCCACCAAGGCCTGCCTCTGCCTGTGCCATCGCTTTGGGGGCCTCTTCCTGATGCCCAGCAGCCAGGCTGTGATGCCCTACTGGGTACCCCGGGGTCTCAGGCCGCAGAAGGTGAGGAGGCTCACACAGTGGCAAGGGTGGAACAGGAAAGGGCTTGAAGAGAAGGGTGCCCAGGATGCCCCGCCGCGGAGCCGGAGAGGGTTCTGGACAGCTGTGGTGGGGCGCTCGGGGCCTCAGGCCAGGCGGCCGCCCCCCAAGACTCTCAGTCCCGGCACAGTCACTGGCAGATCTGCGACGGGCACCACCTGCTCCAGCGGCAGCAGCCGGCCCTCTACCGGGACGAGCCCCAGGCGCCCGGGAGGGCAGCCAGCCTCGGAGTGCCCCTCCTGCCCCTCAGCCTCAGCCTTCTGA

XM_004843201.1 Coding sequence

Nup93 nucleoporin 93kDa, transcript variant X1

Length: 2460 bp    Location: 29271178..29153507   Strand: -
>XM_004843201.1
ATGGATACTGAGGGGTTTGGTGAGCTTCTTCAGCAAGCTGAACAGCTTGCCGCTGAGACTGAGGGCATCTCAGAGCTTCCCCATGTGGAACGGAACTTACAGGAGATCCAGCAGGCAGGCGAGCGCCTGCGTTCCCGTACCCTCACACGCACTTCCCAGGAGACAGCAGATGTCAAGGCGTCAGTTCTTCTTGGGTCTCGAGGACTTGACATATCCCACATCTCCCAGCGATTGGAGAGTCTGAGTGCGGCTACCACCTTTGAGCCTCTTGAGCCTGTGAAGGACACAGACATTCAGGGCTTCCTGAAGAATGAGAAGGACAATGCACTGCTGTCTGCCATTGAAGAGTCCCGGAAGAGGACCTTTGGCATGGCTGAGGAGTATCATCGAGAGTCAATGCTGGTCGAGTGGGAGCAAGTGAAGCAGCGGATTCTGCACACACTGCTGGCGTCAGGAGAAGATGCCCTTGACTTTACTCAAGAAATTGAGCCAAGTTACATAACTGATGTGGGCCCCCCTGGTCGAAGCGCTATGGATGCTGTTGAGATGGCCTATGCCCAGCAGATTTATATCTATAATGAGAAGATTGTCAGTGGGCAACTACAGCCTAACCTCGTGGACCTCTGTGGTACAGTTCCCCGCCTGAATGATAAGAACATTTCTGACATGTGGACCATGGTAAAACAAATGACAGATGTGTTGTTGGTACCGGCTGGTGATACCCTGAAGAGCCGAAACAGCTTGGAAGTGCGCATGGACTTTGTCAGGCAGGCCTTGGGATACCTTGAGCAGAGCTACAAGAATTACACTCTTGTGACTGTGTTTGGAAATTTACATCAGGCCCAGCTGGGTGGTGTACCCGGAACTTACCAGTTGGTTCGAAGTTTCCTGAACATTAAACTTCCGGCTCCCTTACCTGGACTTCAGGACGGAGAGGTGGAGGGCCACCCTGTCTGGGCACTAATTTATTACTGCATGCGCTGTGGAGACTTGCTTGCTGCCTCACAGGTGGTTAATCGGGCCCAGCACCAGCTGGGAGAGTTTAAGACCTGGTTCCAGGAGTACATGAACAGCAAGGACAGAAGATTGTCCCCAGCTACAGAAAACAAGCTCCGGCTGCATTACCGCAGAGCCCTCAGGAACAACACAGACCCCTACAAGCGGGCTGTATACTGTATCATTGGCAGATGCGACGTCACTGACAACCAGAGCGAAGTGGCAGACAAAACTGAGGACTACTTGTGGCTGAAGTTGAACCAAGTGTGTTTTGATGATGACGGCACCAGCTCCCCACAAGATAGGCTCAGTCTCTCTCAGTTCCAGAAACAGTTGTTGGAAGACTATGGTGAGTCCCACTTTAGGGTGCACCAGCAGCCCTTCCTCTACTTCCAAGTGCTGTTCCTGACAGCACAGTTTGAAGCCGCCATCGCTTTTCTCTTCCGCCTGGAACGGATGCGCCCCCATGCTGTCCACGTGGCCCTGGTGCTGTTTGAGCTAAAGCTGCTTTTAAAATCATCAGGGCAGAATGCTCAGCTTCTCAGCCATGAGCCTGGTGACCCTCCCTGCATGCGGCGGCTGAACTTTGTGCGACTGCTCATGCTGTATACCCGGAAATTTGAGTCCACAGATCCAAGGGATGCCCTCCAGTACTTCTACTTCCTCAGGGATGAGAAAGATAGTCAAGGAGAAAACATGTTTTTACGCTGTGTGAGTGAGCTTGTGATAGAAAGTCGAGAGTTTGATATGATTCTTGGGAAACTACAGAATGATGGAAGTAGAAAGCCTGGAGTCATAGATAAGTTCACTAGTGACACAAAGCCTATTATCAATAAAGTTGCTTCCGTGGCAGAAAATAAAGGACTGTTTGAAGAAGCAGTGAAGCTTTACGATCTTGCCAAGAATGCTGACAAAGTGCTGGAGCTGATGAACAAATTGCTGAGCCCTGTTGTTCCCCAGATCAGTGCCCCGCAATCCAATAAAGAGAGGCTTAAGAACATGGCCCTCTCCATTGCTGAACGGTACAGGGCTCAGGGTGTAAGTGCAAATAAATTTCTGGACTCTACATTCTATCTTCTGTTGGACTTGATCACCTTTTTTGACGAGTATCACAATGGTCATATTGACAGAGCCTTTGATATAATTGAGCGCTTGAAGCTGGTGCCCCTGAGTCAGGAAAGTGTGGAAGAGAGAGTGGCTGCCTTCAGAAATTTCAGTGATGAAATCAGGCACAACCTCTCACAAGTTCTTCTCGCCACCATGAACATCTTGTTCACACAGTTCAAGAGGCTCAAGGGGACAAGTCCATCCTCAGCATCCAGGCCCCAGCGAGTCATGGAGGACCGCGACTCTCAACTCCGAAGTCAAGCACGAGCCCTGATTACTTTCGCTGGAATGATACCCTACCGGACATCTGGGGACACCAATGCAAGGCTGGTGCAGATGGAAGTCCTCATGAACTAA

XM_004843204.1 Coding sequence

Nup93 nucleoporin 93kDa, transcript variant X4

Length: 2169 bp    Location: 29198075..29153507   Strand: -
>XM_004843204.1
ATGCCCTTGACTTTACTCAAGAAATTGAGGTGCCGGACCACTGTCGGTTACCAGATGTGGGTGTGTCCCACCGCTAGCAGGCTTTGGAGCGCAATTGTTAACAAGATACAGATCCTGGGAACACCATCTACTCTGAGAAGCCCATTCCAGATTTGTCTCCAGAAGGCTGCTATTTGTCTGTGTATCTCCGGGCTCCTGCCAAGTTACATAACTGATGTGGGCCCCCCTGGTCGAAGCGCTATGGATGCTGTTGAGATGGCCTATGCCCAGCAGATTTATATCTATAATGAGAAGATTGTCAGTGGGCAACTACAGCCTAACCTCGTGGACCTCTGTGGTACAGTTCCCCGCCTGAATGATAAGAACATTTCTGACATGTGGACCATGGTAAAACAAATGACAGATGTGTTGTTGGTACCGGCTGGTGATACCCTGAAGAGCCGAAACAGCTTGGAAGTGCGCATGGACTTTGTCAGGCAGGCCTTGGGATACCTTGAGCAGAGCTACAAGAATTACACTCTTGTGACTGTGTTTGGAAATTTACATCAGGCCCAGCTGGGTGGTGTACCCGGAACTTACCAGTTGGTTCGAAGTTTCCTGAACATTAAACTTCCGGCTCCCTTACCTGGACTTCAGGACGGAGAGGTGGAGGGCCACCCTGTCTGGGCACTAATTTATTACTGCATGCGCTGTGGAGACTTGCTTGCTGCCTCACAGGTGGTTAATCGGGCCCAGCACCAGCTGGGAGAGTTTAAGACCTGGTTCCAGGAGTACATGAACAGCAAGGACAGAAGATTGTCCCCAGCTACAGAAAACAAGCTCCGGCTGCATTACCGCAGAGCCCTCAGGAACAACACAGACCCCTACAAGCGGGCTGTATACTGTATCATTGGCAGATGCGACGTCACTGACAACCAGAGCGAAGTGGCAGACAAAACTGAGGACTACTTGTGGCTGAAGTTGAACCAAGTGTGTTTTGATGATGACGGCACCAGCTCCCCACAAGATAGGCTCAGTCTCTCTCAGTTCCAGAAACAGTTGTTGGAAGACTATGGTGAGTCCCACTTTAGGGTGCACCAGCAGCCCTTCCTCTACTTCCAAGTGCTGTTCCTGACAGCACAGTTTGAAGCCGCCATCGCTTTTCTCTTCCGCCTGGAACGGATGCGCCCCCATGCTGTCCACGTGGCCCTGGTGCTGTTTGAGCTAAAGCTGCTTTTAAAATCATCAGGGCAGAATGCTCAGCTTCTCAGCCATGAGCCTGGTGACCCTCCCTGCATGCGGCGGCTGAACTTTGTGCGACTGCTCATGCTGTATACCCGGAAATTTGAGTCCACAGATCCAAGGGATGCCCTCCAGTACTTCTACTTCCTCAGGGATGAGAAAGATAGTCAAGGAGAAAACATGTTTTTACGCTGTGTGAGTGAGCTTGTGATAGAAAGTCGAGAGTTTGATATGATTCTTGGGAAACTACAGAATGATGGAAGTAGAAAGCCTGGAGTCATAGATAAGTTCACTAGTGACACAAAGCCTATTATCAATAAAGTTGCTTCCGTGGCAGAAAATAAAGGACTGTTTGAAGAAGCAGTGAAGCTTTACGATCTTGCCAAGAATGCTGACAAAGTGCTGGAGCTGATGAACAAATTGCTGAGCCCTGTTGTTCCCCAGATCAGTGCCCCGCAATCCAATAAAGAGAGGCTTAAGAACATGGCCCTCTCCATTGCTGAACGGTACAGGGCTCAGGGTGTAAGTGCAAATAAATTTCTGGACTCTACATTCTATCTTCTGTTGGACTTGATCACCTTTTTTGACGAGTATCACAATGGTCATATTGACAGAGCCTTTGATATAATTGAGCGCTTGAAGCTGGTGCCCCTGAGTCAGGAAAGTGTGGAAGAGAGAGTGGCTGCCTTCAGAAATTTCAGTGATGAAATCAGGCACAACCTCTCACAAGTTCTTCTCGCCACCATGAACATCTTGTTCACACAGTTCAAGAGGCTCAAGGGGACAAGTCCATCCTCAGCATCCAGGCCCCAGCGAGTCATGGAGGACCGCGACTCTCAACTCCGAAGTCAAGCACGAGCCCTGATTACTTTCGCTGGAATGATACCCTACCGGACATCTGGGGACACCAATGCAAGGCTGGTGCAGATGGAAGTCCTCATGAACTAA

XM_004843205.1 Coding sequence

LOC101708504 chromosome unknown open reading frame, human C16orf55

Length: 330 bp    Location: 302349..294432   Strand: -
>XM_004843205.1
ATGGAGAAGCAGTCCCAGGAGTCCAGACAGGCAGACGGAGAGGCCGGGAAGCCCTCGGACACCCTCCTCCGGGCGACGGCGACAGCTGCACACGGACAGCCCTCTGCTTCGTTGGAAGAGAAACCTGATGTGAAGCAGAAATCGACCAAGAAGAAAGGTGTCATCCCACAGATCATCGTCACTCGGGCTTCCAGCGAGACCCTGACCAGCTGCAGTTCCCTGGGGAGCGAGGAGCAGAGGACCATTCAGGAGCAGGCTGACTGGGGTTCCTACTCACGACACAGGAGCCCCAGCATGGCCGCCGCCTTCAACCCCCAGGCCAAGGAATAA

XM_004843200.1 Coding sequence

Slc12a3 solute carrier family 12 (sodium/chloride transporters), member 3, transcript variant X11

Length: 3012 bp    Location: 29132800..29097504   Strand: -
>XM_004843200.1
ATGGCAGAGCTGCCCACAGCGGAGATGCCCAGGGACCCTGCCCTGTGCAGCGGGCGCTTCACCATCAGCACACTCCTTGGGGGTGACGAGTCCCTGCCAACAGCGGCCTATGACACCAGCCACCCCAACCACCTGACCCACGGCAGCACCCTCTACATGCGCACCTTCGGGTACAACACCATCGACGTGGTGCCGGCCTACGAGCACTATGCCGACAGTGCCCTGCCCGGCGAGCCTCGGAAGATCCGGCCCACGCTGGCTGACCTGCACTCCTTCCTCAAGGAAGGGAGCCACCTGCACGCCCTGGCCTTTGACAGCCAGCCCAGCCACGAGCTGACCGATGGGCTGGTGGAGGATGAGGCGGGCACCCATGGTGAGACGAGCCCCGGGGAGCCTGTGCGCTTCGGCTGGGTGAAGGGAGTGATGATCCGCTGTATGCTCAACATTTGGGGTGTGATCCTCTACCTGCGGCTCCCCTGGATTACGGCGCAGGCGGGCATTGTCTTGACCTGGATCATCATCCTGCTCTCGGTCACGGTGACCTCCATCACTGGCCTCTCCATCTCTGCCATCTCCACCAATGGCAAGGTCAAGTCAGGTGGCACCTATTTCCTCATCTCCCGGAGCCTGGGCCCAGAGCTGGGGGGCTCCATTGGCCTCATCTTTGCCTTTGCCAACGCCGTTGGTGTATCCATGCACACCGTGGGCTTTGCAGAGACTGTTCGGGACCTGCTGCAGGAGTACGGCGTGCCCATTGTGGACCCCATCAACGACATCCGAATCATTGGCGTGGTCACCGTCACTGTGCTCCTGGGCATTTCCCTGGCTGGCATGGAGTGGGAGTCCAAGGCTCAGGTGTTGTTCTTCCTTGTCATCATGGTCTCCTTTGCCAACTACTTGGTGGGGACACTGATCCCCCCATCTGAGGACAAGGCCTCCAAGGGCTTCTTCAGCTACCGGGGAGACATTTTTGTCCAGAACTTAGTGCCTGACTGGCGGGGTATTGATGGCAGCTTCTTCGGAATGTTCTCCATCTTCTTTCCCTCTGCCACCGGCATCCTGGCAGGAGCCAACATCTCCGGGGATCTCAAGGACCCTGCCGTGGCCATCCCCAGGGGAACTCTGATGGCCATTTTCTGGACCACCATCTCCTACCTGGCCGTCTCAGCCACCATTGGCTCCTGTGTGGTCCGGGATGCCTCTGGGGACCTGAACGACACGGTGACCTCTGGCCTGGGTACTTGTGAGGGGCTGGCCTGCAACTATGGCTGGAACTTCACCAAGTGCTCCCAGCAGCACAGCTGCCGCTATGGCCTCATCAATTACTACCAGACCATGAGCATGGTGTCAGCCTTCGCACCCCTGATCACAGCCGGCATCTTCGGGGCCACCCTCTCCTCTGCCCTTGCCTGCCTCGTCTCAGCTGCCAAAGTTTTCCAGTGCCTGTGTGAGGACCAGCTGTACCCACTGATCGGCTTCTTTGGCAAAGGCTACGGCAAGAACAAGGAGCCTGTGCGCGGCTACCTGCTGGCCTATGCCATCGCCGTGGCCTTCATCATCATTGCGGAGCTCAACACCATTGCCCCAATCATCTCCAACTTCTTCCTGTGCTCCTACGCCCTCATCAACTTCAGCTGCTTCCACGCCTCCATCACCAACTCACCCGGGTGGAGGCCCTCGTTCCAGTACTACAGCAAGTGGGCGGCGCTCTTTGGGGCAGTTATCTCCGTGGTCATCATGTTCCTGCTCACCTGGTGGGCGGCCCTCATCGCCATTGGAGTCGTCCTCTTCCTCCTGCTCTACGTGATCTACAAGAAACCAGAGGTGAACTGGGGCTCCTCCGTGCAGGCTGGCTCCTACAACCTGGCCCTGAGCTACTCCATGGGCCTCATTGAGGTGGAAGACCACATCAAGAACTACCGCCCCCAGTGCCTGGTGCTCACAGGCCCCCCCAACTTCCGCCCGGCCCTTGTGGACTTTGTGGGCACCTTCACCCAGAACCTGAGCCTCATGATCTGTGGCCATGTGCTCATTGGTCCCCACAAGCAGAGGATGCCTGAGCTCCGACTCCTGGCCAATGGACACACGAAGTGGCTAAAGAAGAGGAAGGTCAAGGCCTTCTACTCAGATGTCATCGCTGAGGACCTCCGCAGTGGTGTCCAGATTCTTATGCAGGCCGTGGGTCTGGGGAGAATGAAGCCCAACATTCTTGTGGTGGGATTCAAGAAGAACTGGCAGTCTGCTCACCCGGCCACAGTGGAAGACTACATCAGCATCCTACACGATGCCTTTGATTTCAACTACGGCATGTGCATCATGAGGATGCGAGAGGGGCTCAATGTCTCCGAGGTGATGCAGGCTCACATGGACCCCGAGGCTCTGGTGTGGGAGGAGCAGGCCAGCACCATCTTCCAGTCAGAGCAGGCCAAGAAGACCATTGACATCTACTGGCTGTTTGACGATGGAGGCCTTACGCTCCTCATCCCCTACCTCCTCCACCGCAAGAAGAGATGGGCCAAATGCAAGATCCGTGTGTTCGTCGGGGGCCAGATCAACAGACTGGACCAGGAGAGAAAGGCGATCATTTCTCTGTTGAGCAAGTTTCGACTGGGATTCCATGAAGTTCACATCCTTCCTGACATCAATCAGAAGCCGAATGCTGAGCACATTAAGCGGTTTGAGGACATGATTGCACCATTCCGCCTAAATGATGGCTTCAAGGACGAGGCCACGGTCGCAGAGATGAGGCGGGACTGTCCCTGGAAGATCTCAGATGAAGAGGTCAATAAGAACAGAGTCAAGTCCCTTCGGCAGGTGAGGCTGAATGAGATTCTGCTGGATTACTCCCAGGATGCTGCCCTGGTCGTCATCACCTTGCCCATAGGGAGGAAGGGGAAGTGCCCCAGCTCCCTGTACATGGCCTGGCTGGAGACCTTGTCCCAGGACCTCAGACCTCCAGTCATCTTGATCCGAGGGAACCAGGAAAATGTGCTCACCTTTTACTGCCAGTAA

XM_004843196.1 Coding sequence

Slc12a3 solute carrier family 12 (sodium/chloride transporters), member 3, transcript variant X7

Length: 3084 bp    Location: 29132800..29098312   Strand: -
>XM_004843196.1
ATGGCAGAGCTGCCCACAGCGGAGATGCCCAGGGACCCTGCCCTGTGCAGCGGGCGCTTCACCATCAGCACACTCCTTGGGGGTGACGAGTCCCTGCCAACAGCGGCCTATGACACCAGCCACCCCAACCACCTGACCCACGGCAGCACCCTCTACATGCGCACCTTCGGGTACAACACCATCGACGTGGTGCCGGCCTACGAGCACTATGCCGACAGTGCCCTGCCCGGCGAGCCTCGGAAGATCCGGCCCACGCTGGCTGACCTGCACTCCTTCCTCAAGCAGGAAGGGAGCCACCTGCACGCCCTGGCCTTTGACAGCCAGCCCAGCCACGAGCTGACCGATGGGCTGGTGGAGGATGAGGCGGGCACCCATGGTGAGACGAGCCCCGGGGAGCCTGTGCGCTTCGGCTGGGTGAAGGGAGTGATGGAGGTCAATGCCATGCCACGACCAGCAGCAGGGACTTATGTGCTTGGCCATGGGGTGTGTGGCGTGCACACAGAGCCTCTGACCTCGCTGTCCTCCCAGATCCGCTGTATGCTCAACATTTGGGGTGTGATCCTCTACCTGCGGCTCCCCTGGATTACGGCGCAGGCGGGCATTGTCTTGACCTGGATCATCATCCTGCTCTCGGTCACGGTGACCTCCATCACTGGCCTCTCCATCTCTGCCATCTCCACCAATGGCAAGGTCAAGTCAGGTGGCACCTATTTCCTCATCTCCCGGAGCCTGGGCCCAGAGCTGGGGGGCTCCATTGGCCTCATCTTTGCCTTTGCCAACGCCGTTGGTGTATCCATGCACACCGTGGGCTTTGCAGAGACTGTTCGGGACCTGCTGCAGGAGTACGGCGTGCCCATTGTGGACCCCATCAACGACATCCGAATCATTGGCGTGGTCACCGTCACTGTGCTCCTGGGCATTTCCCTGGCTGGCATGGAGTGGGAGTCCAAGGCTCAGGTGTTGTTCTTCCTTGTCATCATGGTCTCCTTTGCCAACTACTTGGTGGGGACACTGATCCCCCCATCTGAGGACAAGGCCTCCAAGGGCTTCTTCAGCTACCGGGGAGACATTTTTGTCCAGAACTTAGTGCCTGACTGGCGGGGTATTGATGGCAGCTTCTTCGGAATGTTCTCCATCTTCTTTCCCTCTGCCACCGGCATCCTGGCAGGAGCCAACATCTCCGGGGATCTCAAGGACCCTGCCGTGGCCATCCCCAGGGGAACTCTGATGGCCATTTTCTGGACCACCATCTCCTACCTGGCCGTCTCAGCCACCATTGGCTCCTGTGTGGTCCGGGATGCCTCTGGGGACCTGAACGACACGGTGACCTCTGGCCTGGGTACTTGTGAGGGGCTGGCCTGCAACTATGGCTGGAACTTCACCAAGTGCTCCCAGCAGCACAGCTGCCGCTATGGCCTCATCAATTACTACCAGACCATGAGCATGGTGTCAGCCTTCGCACCCCTGATCACAGCCGGCATCTTCGGGGCCACCCTCTCCTCTGCCCTTGCCTGCCTCGTCTCAGCTGCCAAAGTTTTCCAGTGCCTGTGTGAGGACCAGCTGTACCCACTGATCGGCTTCTTTGGCAAAGGCTACGGCAAGAACAAGGAGCCTGTGCGCGGCTACCTGCTGGCCTATGCCATCGCCGTGGCCTTCATCATCATTGCGGAGCTCAACACCATTGCCCCAATCATCTCCAACTTCTTCCTGTGCTCCTACGCCCTCATCAACTTCAGCTGCTTCCACGCCTCCATCACCAACTCACCCGGGTGGAGGCCCTCGTTCCAGTACTACAGCAAGTGGGCGGCGCTCTTTGGGGCAGTTATCTCCGTGGTCATCATGTTCCTGCTCACCTGGTGGGCGGCCCTCATCGCCATTGGAGTCGTCCTCTTCCTCCTGCTCTACGTGATCTACAAGAAACCAGAGGTGAACTGGGGCTCCTCCGTGCAGGCTGGCTCCTACAACCTGGCCCTGAGCTACTCCATGGGCCTCATTGAGGTGGAAGACCACATCAAGAACTACCGCCCCCAGTGCCTGGTGCTCACAGGCCCCCCCAACTTCCGCCCGGCCCTTGTGGACTTTGTGGGCACCTTCACCCAGAACCTGAGCCTCATGATCTGTGGCCATGTGCTCATTGGTCCCCACAAGCAGAGGATGCCTGAGCTCCGACTCCTGGCCAATGGACACACGAAGTGGCTAAAGAAGAGGAAGGTCAAGGCCTTCTACTCAGATGTCATCGCTGAGGACCTCCGCAGTGGTGTCCAGATTCTTATGCAGGCCGTGGGTCTGGGGAGAATGAAGCCCAACATTCTTGTGGTGGGATTCAAGAAGAACTGGCAGTCTGCTCACCCGGCCACAGTGGAAGACTACATCAGCATCCTACACGATGCCTTTGATTTCAACTACGGCATGTGCATCATGAGGATGCGAGAGGGGCTCAATGTCTCCGAGGTGATGCAGGCTCACATTAATCCTGTGTTTGATCCAGCAGAGGACAGCAAGGGAGCCAGCACCGGCGGGGCCAGGCAATCTGTGTCTGGCACATTGGACCCCGAGGCTCTGGTGTGGGAGGAGCAGGCCAGCACCATCTTCCAGTCAGAGCAGGCCAAGAAGACCATTGACATCTACTGGCTGTTTGACGATGGAGGCCTTACGCTCCTCATCCCCTACCTCCTCCACCGCAAGAAGAGATGGGCCAAATGCAAGATCCGTGTGTTCGTCGGGGGCCAGATCAACAGACTGGACCAGGAGAGAAAGGCGATCATTTCTCTGTTGAGCAAGTTTCGACTGGGATTCCATGAAGTTCACATCCTTCCTGACATCAATCAGAAGCCGAATGCTGAGCACATTAAGCGGTTTGAGGACATGATTGCACCATTCCGCCTAAATGATGGCTTCAAGGACGAGGCCACGGTCGCAGAGATGAGGCGGGACTGTCCCTGGAAGATCTCAGATGAAGAGGTCAATAAGAACAGAGTCAAGTCCCTTCGGCAGGTGAGGCTGAATGAGATTCTGCTGGATTACTCCCAGGATGCTGCCCTGGTCGTCATGATGCTGGTGGTTGTCCCAAGTGAAGCTTTGTGA

XM_004843192.1 Coding sequence

Slc12a3 solute carrier family 12 (sodium/chloride transporters), member 3, transcript variant X3

Length: 3192 bp    Location: 29132800..29097504   Strand: -
>XM_004843192.1
ATGGCAGAGCTGCCCACAGCGGAGATGCCCAGGGACCCTGCCCTGTGCAGCGGGCGCTTCACCATCAGCACACTCCTTGGGGGTGACGAGTCCCTGCCAACAGCGGCCTATGACACCAGCCACCCCAACCACCTGACCCACGGCAGCACCCTCTACATGCGCACCTTCGGGTACAACACCATCGACGTGGTGCCGGCCTACGAGCACTATGCCGACAGTGCCCTGCCCGGCGAGCCTCGGAAGATCCGGCCCACGCTGGCTGACCTGCACTCCTTCCTCAAGCAGGAAGGGAGCCACCTGCACGCCCTGGCCTTTGACAGCCAGCCCAGCCACGAGCTGACCGATGGGCTGGTGGAGGATGAGGCGGGCACCCATGGTGAGACGAGCCCCGGGGAGCCTGTGCGCTTCGGCTGGGTGAAGGGAGTGATGGAGGTCAATGCCATGCCACGACCAGCAGCAGGGACTTATGTGCTTGGCCATGGGGTGTGTGGCGTGCACACAGAGCCTCTGACCTCGCTGTCCTCCCAGATCCGCTGTATGCTCAACATTTGGGGTGTGATCCTCTACCTGCGGCTCCCCTGGATTACGGCGCAGGCGGGCATTGTCTTGACCTGGATCATCATCCTGCTCTCGGTCACGGTGACCTCCATCACTGGCCTCTCCATCTCTGCCATCTCCACCAATGGCAAGGTCAAGTCAGGTGGCACCTATTTCCTCATCTCCCGGAGCCTGGGCCCAGAGCTGGGGGGCTCCATTGGCCTCATCTTTGCCTTTGCCAACGCCGTTGGTGTATCCATGCACACCGTGGGCTTTGCAGAGACTGTTCGGGACCTGCTGCAGGAGTACGGCGTGCCCATTGTGGACCCCATCAACGACATCCGAATCATTGGCGTGGTCACCGTCACTGTGCTCCTGGGCATTTCCCTGGCTGGCATGGAGTGGGAGTCCAAGGCTCAGGTGTTGTTCTTCCTTGTCATCATGGTCTCCTTTGCCAACTACTTGGTGGGGACACTGATCCCCCCATCTGAGGACAAGGCCTCCAAGGGCTTCTTCAGCTACCGGGGAGACATTTTTGTCCAGAACTTAGTGCCTGACTGGCGGGGTATTGATGGCAGCTTCTTCGGAATGTTCTCCATCTTCTTTCCCTCTGCCACCGGCATCCTGGCAGGAGCCAACATCTCCGGGGATCTCAAGGACCCTGCCGTGGCCATCCCCAGGGGAACTCTGATGGCCATTTTCTGGACCACCATCTCCTACCTGGCCGTCTCAGCCACCATTGGCTCCTGTGTGGTCCGGGATGCCTCTGGGGACCTGAACGACACGGTGACCTCTGGCCTGGGTACTTGTGAGGGGCTGGCCTGCAACTATGGCTGGAACTTCACCAAGTGCTCCCAGCAGCACAGCTGCCGCTATGGCCTCATCAATTACTACCAGACCATGAGCATGGTGTCAGCCTTCGCACCCCTGATCACAGCCGGCATCTTCGGGGCCACCCTCTCCTCTGCCCTTGCCTGCCTCGTCTCAGCTGCCAAAGTTTTCCAGTGCCTGTGTGAGGACCAGCTGTACCCACTGATCGGCTTCTTTGGCAAAGGCTACGGCAAGAACAAGGAGCCTGTGCGCGGCTACCTGCTGGCCTATGCCATCGCCGTGGCCTTCATCATCATTGCGGAGCTCAACACCATTGCCCCAATCATCTCCAACTTCTTCCTGTGCTCCTACGCCCTCATCAACTTCAGCTGCTTCCACGCCTCCATCACCAACTCACCCGGGTGGAGGCCCTCGTTCCAGTACTACAGCAAGTGGGCGGCGCTCTTTGGGGCAGTTATCTCCGTGGTCATCATGTTCCTGCTCACCTGGTGGGCGGCCCTCATCGCCATTGGAGTCGTCCTCTTCCTCCTGCTCTACGTGATCTACAAGAAACCAGAGGTGAACTGGGGCTCCTCCGTGCAGGCTGGCTCCTACAACCTGGCCCTGAGCTACTCCATGGGCCTCATTGAGGTGGAAGACCACATCAAGAACTACCGCCCCCAGTGCCTGGTGCTCACAGGCCCCCCCAACTTCCGCCCGGCCCTTGTGGACTTTGTGGGCACCTTCACCCAGAACCTGAGCCTCATGATCTGTGGCCATGTGCTCATTGGTCCCCACAAGCAGAGGATGCCTGAGCTCCGACTCCTGGCCAATGGACACACGAAGTGGCTAAAGAAGAGGAAGGTCAAGGCCTTCTACTCAGATGTCATCGCTGAGGACCTCCGCAGTGGTGTCCAGATTCTTATGCAGGCCGTGGGTCTGGGGAGAATGAAGCCCAACATTCTTGTGGTGGGATTCAAGAAGAACTGGCAGTCTGCTCACCCGGCCACAGTGGAAGACTACATCAGCATCCTACACGATGCCTTTGATTTCAACTACGGCATGTGCATCATGAGGATGCGAGAGGGGCTCAATGTCTCCGAGGTGATGCAGGCTCACATTAATCCTGTGTTTGATCCAGCAGAGGACAGCAAGGGAGCCAGCACCGGCGGGGCCAGGCAATCTGTGTCTGGCACATTGGACCCCGAGGCTCTGGTGTGGGAGGAGCAGGCCAGCACCATCTTCCAGTCAGAGCAGGCCAAGAAGACCATTGACATCTACTGGCTGTTTGACGATGGAGGCCTTACGCTCCTCATCCCCTACCTCCTCCACCGCAAGAAGAGATGGGCCAAATGCAAGATCCGTGTGTTCGTCGGGGGCCAGATCAACAGACTGGACCAGGAGAGAAAGGCGATCATTTCTCTGTTGAGCAAGTTTCGACTGGGATTCCATGAAGTTCACATCCTTCCTGACATCAATCAGAAGCCGAATGCTGAGCACATTAAGCGGTTTGAGGACATGATTGCACCATTCCGCCTAAATGATGGCTTCAAGGACGAGGCCACGGTCGCAGAGATGAGGCGGGACTGTCCCTGGAAGATCTCAGATGAAGAGGTCAATAAGAACAGAGTCAAGTCCCTTCGGCAGGTGAGGCTGAATGAGATTCTGCTGGATTACTCCCAGGATGCTGCCCTGGTCGTCATCACCTTGCCCATAGGGAGGAAGGGGAAGTGCCCCAGCTCCCTGTACATGGCCTGGCTGGAGACCTTGTCCCAGGACCTCAGACCTCCAGTCATCTTGATCCGAGGGAACCAGGAAAATGTGCTCACCTTTTACTGCCAGTAA

XM_004843191.1 Coding sequence

Slc12a3 solute carrier family 12 (sodium/chloride transporters), member 3, transcript variant X2

Length: 3237 bp    Location: 29132800..29098312   Strand: -
>XM_004843191.1
ATGGCAGAGCTGCCCACAGCGGAGATGCCCAGGGACCCTGCCCTGTGCAGCGGGCGCTTCACCATCAGCACACTCCTTGGGGGTGACGAGTCCCTGCCAACAGCGGCCTATGACACCAGCCACCCCAACCACCTGACCCACGGCAGCACCCTCTACATGCGCACCTTCGGGTACAACACCATCGACGTGGTGCCGGCCTACGAGCACTATGCCGACAGTGCCCTGCCCGGCGAGCCTCGGAAGATCCGGCCCACGCTGGCTGACCTGCACTCCTTCCTCAAGGAAGGGAGCCACCTGCACGCCCTGGCCTTTGACAGCCAGCCCAGCCACGAGCTGACCGATGGGCTGGTGGAGGATGAGGCGGGCACCCATGGTGAGACGAGCCCCGGGGAGCCTGTGCGCTTCGGCTGGGTGAAGGGAGTGATGGAGGTCAATGCCATGCCACGACCAGCAGCAGGGACTTATGTGCTTGGCCATGGGGTGTGTGGCGTGCACACAGAGCCTCTGACCTCGCTGTCCTCCCAGATCCGCTGTATGCTCAACATTTGGGGTGTGATCCTCTACCTGCGGCTCCCCTGGATTACGGCGCAGGCGGGCATTGTCTTGACCTGGATCATCATCCTGCTCTCGGTCACGGTGACCTCCATCACTGGCCTCTCCATCTCTGCCATCTCCACCAATGGCAAGGTCAAGTCAGGTGGCACCTATTTCCTCATCTCCCGGAGCCTGGGCCCAGAGCTGGGGGGCTCCATTGGCCTCATCTTTGCCTTTGCCAACGCCGTTGGTGTATCCATGCACACCGTGGGCTTTGCAGAGACTGTTCGGGACCTGCTGCAGGAGTACGGCGTGCCCATTGTGGACCCCATCAACGACATCCGAATCATTGGCGTGGTCACCGTCACTGTGCTCCTGGGCATTTCCCTGGCTGGCATGGAGTGGGAGTCCAAGGCTCAGGTGTTGTTCTTCCTTGTCATCATGGTCTCCTTTGCCAACTACTTGGTGGGGACACTGATCCCCCCATCTGAGGACAAGGCCTCCAAGGGCTTCTTCAGCTACCGGGGAGACATTTTTGTCCAGAACTTAGTGCCTGACTGGCGGGGTATTGATGGCAGCTTCTTCGGAATGTTCTCCATCTTCTTTCCCTCTGCCACCGGCATCCTGGCAGGAGCCAACATCTCCGGGGATCTCAAGGACCCTGCCGTGGCCATCCCCAGGGGAACTCTGATGGCCATTTTCTGGACCACCATCTCCTACCTGGCCGTCTCAGCCACCATTGGCTCCTGTGTGGTCCGGGATGCCTCTGGGGACCTGAACGACACGGTGACCTCTGGCCTGGGTACTTGTGAGGGGCTGGCCTGCAACTATGGCTGGAACTTCACCAAGTGCTCCCAGCAGCACAGCTGCCGCTATGGCCTCATCAATTACTACCAGACCATGAGCATGGTGTCAGCCTTCGCACCCCTGATCACAGCCGGCATCTTCGGGGCCACCCTCTCCTCTGCCCTTGCCTGCCTCGTCTCAGCTGCCAAAGTTTTCCAGTGCCTGTGTGAGGACCAGCTGTACCCACTGATCGGCTTCTTTGGCAAAGGCTACGGCAAGAACAAGGAGCCTGTGCGCGGCTACCTGCTGGCCTATGCCATCGCCGTGGCCTTCATCATCATTGCGGAGCTCAACACCATTGCCCCAATCATCTCCAACTTCTTCCTGTGCTCCTACGCCCTCATCAACTTCAGCTGCTTCCACGCCTCCATCACCAACTCACCCGGGTGGAGGCCCTCGTTCCAGTACTACAGCAAGTGGGCGGCGCTCTTTGGGGCAGTTATCTCCGTGGTCATCATGTTCCTGCTCACCTGGTGGGCGGCCCTCATCGCCATTGGAGTCGTCCTCTTCCTCCTGCTCTACGTGATCTACAAGAAACCAGAGGTGAACTGGGGCTCCTCCGTGCAGGCTGGCTCCTACAACCTGGCCCTGAGCTACTCCATGGGCCTCATTGAGGTGGAAGACCACATCAAGAACTACCGCCCCCAGTGCCTGGTGCTCACAGGCCCCCCCAACTTCCGCCCGGCCCTTGTGGACTTTGTGGGCACCTTCACCCAGAACCTGAGCCTCATGATCTGTGGCCATGTGCTCATTGGTCCCCACAAGCAGAGGATGCCTGAGCTCCGACTCCTGGCCAATGGACACACGAAGTGGCTAAAGAAGAGGAAGGTCAAGGCCTTCTACTCAGATGTCATCGCTGAGGACCTCCGCAGTGGTGTCCAGATTCTTATGCAGGCCGTGGGTCTGGGGAGAATGAAGCCCAACATTCTTGTGGTGGGATTCAAGAAGAACTGGCAGTCTGCTCACCCGGCCACAGTGGAAGACTACATCAGCATCCTACACGATGCCTTTGATTTCAACTACGGCATGTGCATCATGAGGATGCGAGAGGGGCTCAATGTCTCCGAGGTGATGCAGGCTCACATTAATCCTGTGTTTGATCCAGCAGAGGACAGCAAGGGAGCCAGCACCGGCGGGGCCAGGCAATCTGTGTCTGGCACATTGGACCCCGAGGCTCTGGTGTGGGAGGAGCAGGCCAGCACCATCTTCCAGTCAGAGCAGGCCAAGAAGACCATTGACATCTACTGGCTGTTTGACGATGGAGGCCTTACGCTCCTCATCCCCTACCTCCTCCACCGCAAGAAGAGATGGGCCAAATGCAAGATCCGTGTGTTCGTCGGGGGCCAGATCAACAGACTGGACCAGGAGAGAAAGGCGATCATTTCTCTGTTGAGCAAGTTTCGACTGGGATTCCATGAAGTTCACATCCTTCCTGACATCAATCAGAAGCCGAATGCTGAGCACATTAAGCGGTTTGAGGACATGATTGCACCATTCCGCCTAAATGATGGCTTCAAGGACGAGGCCACGGTCGCAGAGATGAGGCGGGACTGTCCCTGGAAGATCTCAGATGAAGAGGTCAATAAGAACAGAGTCAAGTCCCTTCGGCAGGTGAGGCTGAATGAGATTCTGCTGGATTACTCCCAGGATGCTGCCCTGGTCGTCATAGGTGGGACCCAGCTCACTCCAGAAGGAAATGCATTCCTGGTCATTTGGGAATTGCTCAGCCCTCTTTGGCCATCAGCCACCCCAACTGATGTTGGTGCCAAGTCTGGACAACAGGAAGAGAGGCCTCACTCAGTCCCCGTGTTCTATTGGACCCATGCTCAGTTCCAAGCTGGCCCTGGCAGGTGTTAG

XM_004843193.1 Coding sequence

Slc12a3 solute carrier family 12 (sodium/chloride transporters), member 3, transcript variant X4

Length: 3186 bp    Location: 29132800..29098312   Strand: -
>XM_004843193.1
ATGGCAGAGCTGCCCACAGCGGAGATGCCCAGGGACCCTGCCCTGTGCAGCGGGCGCTTCACCATCAGCACACTCCTTGGGGGTGACGAGTCCCTGCCAACAGCGGCCTATGACACCAGCCACCCCAACCACCTGACCCACGGCAGCACCCTCTACATGCGCACCTTCGGGTACAACACCATCGACGTGGTGCCGGCCTACGAGCACTATGCCGACAGTGCCCTGCCCGGCGAGCCTCGGAAGATCCGGCCCACGCTGGCTGACCTGCACTCCTTCCTCAAGCAGGAAGGGAGCCACCTGCACGCCCTGGCCTTTGACAGCCAGCCCAGCCACGAGCTGACCGATGGGCTGGTGGAGGATGAGGCGGGCACCCATGGTGAGACGAGCCCCGGGGAGCCTGTGCGCTTCGGCTGGGTGAAGGGAGTGATGGAGGTCAATGCCATGCCACGACCAGCAGCAGGGACTTATGTGCTTGGCCATGGGGTGTGTGGCGTGCACACAGAGCCTCTGACCTCGCTGTCCTCCCAGATCCGCTGTATGCTCAACATTTGGGGTGTGATCCTCTACCTGCGGCTCCCCTGGATTACGGCGCAGGCGGGCATTGTCTTGACCTGGATCATCATCCTGCTCTCGGTCACGGTGACCTCCATCACTGGCCTCTCCATCTCTGCCATCTCCACCAATGGCAAGGTCAAGTCAGGTGGCACCTATTTCCTCATCTCCCGGAGCCTGGGCCCAGAGCTGGGGGGCTCCATTGGCCTCATCTTTGCCTTTGCCAACGCCGTTGGTGTATCCATGCACACCGTGGGCTTTGCAGAGACTGTTCGGGACCTGCTGCAGGAGTACGGCGTGCCCATTGTGGACCCCATCAACGACATCCGAATCATTGGCGTGGTCACCGTCACTGTGCTCCTGGGCATTTCCCTGGCTGGCATGGAGTGGGAGTCCAAGGCTCAGGTGTTGTTCTTCCTTGTCATCATGGTCTCCTTTGCCAACTACTTGGTGGGGACACTGATCCCCCCATCTGAGGACAAGGCCTCCAAGGGCTTCTTCAGCTACCGGGGAGACATTTTTGTCCAGAACTTAGTGCCTGACTGGCGGGGTATTGATGGCAGCTTCTTCGGAATGTTCTCCATCTTCTTTCCCTCTGCCACCGGCATCCTGGCAGGAGCCAACATCTCCGGGGATCTCAAGGACCCTGCCGTGGCCATCCCCAGGGGAACTCTGATGGCCATTTTCTGGACCACCATCTCCTACCTGGCCGTCTCAGCCACCATTGGCTCCTGTGTGGTCCGGGATGCCTCTGGGGACCTGAACGACACGGTGACCTCTGGCCTGGGTACTTGTGAGGGGCTGGCCTGCAACTATGGCTGGAACTTCACCAAGTGCTCCCAGCAGCACAGCTGCCGCTATGGCCTCATCAATTACTACCAGACCATGAGCATGGTGTCAGCCTTCGCACCCCTGATCACAGCCGGCATCTTCGGGGCCACCCTCTCCTCTGCCCTTGCCTGCCTCGTCTCAGCTGCCAAAGTTTTCCAGTGCCTGTGTGAGGACCAGCTGTACCCACTGATCGGCTTCTTTGGCAAAGGCTACGGCAAGAACAAGGAGCCTGTGCGCGGCTACCTGCTGGCCTATGCCATCGCCGTGGCCTTCATCATCATTGCGGAGCTCAACACCATTGCCCCAATCATCTCCAACTTCTTCCTGTGCTCCTACGCCCTCATCAACTTCAGCTGCTTCCACGCCTCCATCACCAACTCACCCGTTATCTCCGTGGTCATCATGTTCCTGCTCACCTGGTGGGCGGCCCTCATCGCCATTGGAGTCGTCCTCTTCCTCCTGCTCTACGTGATCTACAAGAAACCAGAGGTGAACTGGGGCTCCTCCGTGCAGGCTGGCTCCTACAACCTGGCCCTGAGCTACTCCATGGGCCTCATTGAGGTGGAAGACCACATCAAGAACTACCGCCCCCAGTGCCTGGTGCTCACAGGCCCCCCCAACTTCCGCCCGGCCCTTGTGGACTTTGTGGGCACCTTCACCCAGAACCTGAGCCTCATGATCTGTGGCCATGTGCTCATTGGTCCCCACAAGCAGAGGATGCCTGAGCTCCGACTCCTGGCCAATGGACACACGAAGTGGCTAAAGAAGAGGAAGGTCAAGGCCTTCTACTCAGATGTCATCGCTGAGGACCTCCGCAGTGGTGTCCAGATTCTTATGCAGGCCGTGGGTCTGGGGAGAATGAAGCCCAACATTCTTGTGGTGGGATTCAAGAAGAACTGGCAGTCTGCTCACCCGGCCACAGTGGAAGACTACATCAGCATCCTACACGATGCCTTTGATTTCAACTACGGCATGTGCATCATGAGGATGCGAGAGGGGCTCAATGTCTCCGAGGTGATGCAGGCTCACATTAATCCTGTGTTTGATCCAGCAGAGGACAGCAAGGGAGCCAGCACCGGCGGGGCCAGGCAATCTGTGTCTGGCACATTGGACCCCGAGGCTCTGGTGTGGGAGGAGCAGGCCAGCACCATCTTCCAGTCAGAGCAGGCCAAGAAGACCATTGACATCTACTGGCTGTTTGACGATGGAGGCCTTACGCTCCTCATCCCCTACCTCCTCCACCGCAAGAAGAGATGGGCCAAATGCAAGATCCGTGTGTTCGTCGGGGGCCAGATCAACAGACTGGACCAGGAGAGAAAGGCGATCATTTCTCTGTTGAGCAAGTTTCGACTGGGATTCCATGAAGTTCACATCCTTCCTGACATCAATCAGAAGCCGAATGCTGAGCACATTAAGCGGTTTGAGGACATGATTGCACCATTCCGCCTAAATGATGGCTTCAAGGACGAGGCCACGGTCGCAGAGATGAGGCGGGACTGTCCCTGGAAGATCTCAGATGAAGAGGTCAATAAGAACAGAGTCAAGTCCCTTCGGCAGGTGAGGCTGAATGAGATTCTGCTGGATTACTCCCAGGATGCTGCCCTGGTCGTCATAGGTGGGACCCAGCTCACTCCAGAAGGAAATGCATTCCTGGTCATTTGGGAATTGCTCAGCCCTCTTTGGCCATCAGCCACCCCAACTGATGTTGGTGCCAAGTCTGGACAACAGGAAGAGAGGCCTCACTCAGTCCCCGTGTTCTATTGGACCCATGCTCAGTTCCAAGCTGGCCCTGGCAGGTGTTAG

XM_004843185.1 Coding sequence

Nlrc5 NLR family, CARD domain containing 5

Length: 5610 bp    Location: 29030322..28954048   Strand: -
>XM_004843185.1
ATGGATCCCGACAGCCTCCACCTGGGCAGTGAGAATCTGTGTGGCTGGCTTGTGAGGCTGCTCAGTACAAACCAGGAATGGCTGAGAGCCAAAGTGAAGTTCTTCCTCCCTGATGTGGATCTGGCCTCCAGCAATGAGGCGCTGGACCCTGAGCAGAGAGTTGTCCTGCAGCTGGGGAAGTTATACACCCAAGGGGTGGCCACCTGGCAATCGTTCATCCACTGCATGTGCATGGAGCTGGAGGTGCCTCTGGATCTGGAGGTGCCACTGCTGAGCACCTGGGGCCAGGACGACGAATTACCCAGGCTGCTGGGAACTGGAGAGGAGAGCCGACCTGGATCTCAGCTCCACCACGGCCTCAAGCGTCCCTATCAGAGCTGTGAGTCCTCACCCTGCCAGAAGCACAGCAGGAAACACCAGCTAGAGTTGGCCCAGAGTTACCTGCAGCTCCTGAGGACCTCTGCCCTGCAGCAGTATGGTGATGGACTCCCTGGACCAGGGAAGGTCTATGTCCCCCCAGTCCTGCAGTGGAGCCGGGCCACAGTGCCCTTAGACACTCGGGAGGGGGCCATTATGGGGGACCTCAAGACAGAAGATGGCAATGATGTGAGCATCCAGGACCTCTTCAACTTCAGGACTCCCAAGAGCTCTCGAGTGACAGTGCTCTTGGGGAAGGCGGGCATGGGCAAGACCACGCTGGCCAGGCGGCTCTGCCACAAGTGGGCTGATGGGCATCTGGACCACTTCCAAGCCCTGTTCCTTTTTGAATTCCGCCAGCTCAACTTGATCCCACACTTCCTGACGTTGCCTCAGCTCCTTTTTGATCTGTACGTGAGACCAGAGTCGGGCCCCGAGGCTGTCTTCCAGTACCTGCAGGAGAATGCCAGCCAAGTCCTGCTGATATTCGACGGGCTGGATGAGGCCCTCCACCTCTGTTCCAGCAAGGAGACTGCGGAGCCCAATGGCTCCGGCTCAGCCTTCACCCTCTTCTCCAGCCTCTGCCGTGGGACCCTCCTGCCGGGCTGCTGGGTGATGGCCACCTCTCGCCCAGGAAAACTCCCCGCCTGCCTGCCCACAGAAGCAGCCATGGTCCACATGTGGGGCTTTGACTGGCTACGGGTGAAGGAGTATGTGAACCACTACTTCAGTGACCAGCCATCTCAGGAGGTGGCCCTCAAAGAATTGCTGGCAAATGGATGTCTCCGGAGTATGTGTGTGGTGCCAGCACTGTGCCAGGTTGCCTGCCTCTGCTTGCACCATCTGCTCTCTGCAAGCCCCACAGGCCAGTCTGTAGCCCTCCTGCCCACTATGACCCAGCTCTACATGCAGATGCTTCTTACCCTCAGCCCCCTTCCTGCTATGTCCCTGGTAGGCCTTGGGAAGGTCGCCTTGAGTGGCCTGGAGACTGGGAAGGTCATCTTCTACATTAAAGACATCCCCCCACCCATGATGGCCTTCGGAGCTACCCACAGCCTGCTGACCTCCTTCAGCATCCACACAAGCCCTGGGCACCAGGAAACAGGCTATGCCTTTGCCCATCTCAGCCTGCAGGAGTTTTTTGCTGCCCTATACCTGATGACCAGCCCCACAGTGGACAAGGGCACACTCACCCGCCACGTCGTCCTCAATTCCCGCTGGGTGCTGCGGACCAAAGCAAGACTGGGCCTCGAAGAATACCTCTCCACCTTCCTGGCAGGCCTGGCATCTCACACCTGCCGTCCTTTCCTCAGCCACGTGGCCCAGCAGAATGAGGTCTGGGTGGCCACCAGGCAGGCTGCTGTTGTACAGCTGTTGAGGAAGTTTGCCACCCGCAAACTCACGGGACCAAAAGTGGTAGAGCTATGTCACTGTATAGCTGAGACTCAGGAGCCTGAGCTGGCCGGCCTCACTGCCCAGAGCCTCCCCGACCAACTGCTCTTCCACAATTTCCCACTGACCTACATGGACCTGGCCTCCCTGGTCAGTGTTCTGGAGCACAGGGCTGCGCCCATCCACCTGGAGTTTGAGGGCTGCCCGCTGGAGCCTCACTGCCCTGAGGCTCTGGCAGGCTGTGGGAAGGTGGAGACACTCAGCTTTAAGAGCAGAAAGTGCGGGGATACCTTTGCAGAAGCCCTCTCTAGGAGCTTGCCGACCATGGGGAGCCTGAAGAAGCTGGGGTTAGCAGGAAGTAAGATCACTGCCCGAGGCATCAGCCACCTGGTGCAGGCTTTGCCCCTCTGCCCACAGCTGGAAGAGGTCAGTTTGCAGGACAATCAGCTCAAGGACCAGGAGGTGCTGAGCATTGTGGAGCTACTGCCCAGCCTGCCACAGCTCCAGAGGCTTGACCTGAGCCACAGCAACTTCTCCATGTCGACCCTGTTCTGCTTGGTGAAAGTGGCAGTCACATGCCCTACTGTCAGGACCCTGCAAGTCAGGGAGGCAGACCTCGTCTTCTTTCTTTCCCCATCCACAGACACAGCTGCAGACCTACAAAGAGCTCCAGACCTAATGGAAAAAGACAGCCAGCGGAAAGAGTCCCAGAGCAGAATTCTGGCACTCAGGCTCCAGAGATGTCAGCTCAGGGTCCACCATGCGGAGGTCCTCGTAGGCCTGCTCCAGAAAGGCCCCTGGCTGGAGGAAGTGGACCTCTCAGGGAACCAGCTGGAAGATGAAGGCTGTCGACTCCTGGCAGAGGCTGCATCCCGTCTGCACATCACCAGGAAGCTGGACCTCAGCCACAACGAGCTCTCTGTGGACGGGGTGACCTATGTGCTACAAGCTGTGAACACATGCCAGAACCTGGCAGAGCTGCACATCAGCCTGTTGCAGAAAACGGTGGTTCTCACGTTTGCCCAAGATGCAAAGGAGGAGGAGGGGACCCAGGAGAGGGCTGCATTTCTAGACAACTTTACATCCCCAACAGCCTCTGAGCCTTACCGAGGGATCAGGCTAACACACTGTGGCTTCCGGGCCAAGCACCTAGAGAAGCTCTGTAAGGCGCTGGAAGGAAGCTGCCTCCTCCCCCATCTTGGACACCTCGACTTCTCAGGCAACGCTCTAAAGGATGAAGGGGCCATGCTGTTGGCCCAGCTGCTCCCAGGGCTGGGATCTCTTCAGTCCTTGAACCTCAGTGAGAATGGCATAGCCCTGGATGCCGTGTTCCGTCTGACCCAGTGCCTGTCCACTCTGCAATGGGTTTGCCACCTGGAAGTAAGCTTTGAGAGCCAGCACATCCTCCTGAGAGGTGACAAGAGAGGCAGGGACAAACTGGCTGGTGAATCTTTGCCAGAATTCCCAGCAGGAGCTCAACTTGCAGGTTTCCATCAGCACTGTGTCCCCAGGAGCTTCTGCCTCAAGAAGTGTCAGCTGGAGCCTCTGAGCCTCACTCACCTCTGCACAGCTCTGGAGAAGTGGTCAGGGCCACTGGAAGTCAAATTGTCCTGTGAGACCCTGAGCGACCAGAGCCTGGAGACCCTGCTGCACTGCTTGCCCCGGCTGCCTCAGCTAAGCCTGCTGCAGCTGAGCCAGACAGGACTGCCCCTGAAAAGCCCTTTCCTGCTGGCCAGCATTGTCAGCCAGTGCCCACGGGTTCAGAAGGTGGATCTCAGGTCCCTGCGCAATGCCACACTGCGATTCAGGTCCAGCGAGGAGCAGGAAGGTGTGTGCTGTGGCTCACATCCCATTGCCCGCAGGTTCACGGGCTGCAGCCTCCGCCAGGAGCATGTGGCGCCACTGTGCCGGGCACTGAGCAAGTGTGATTACCTCTGCCAGCTGGACCTAACAGCCAACCTGCTGGGTGATGACGGGCTCAGGTGCCTTCTAGACCACCTGTCACAGATGCCCATCTCTGGCTTGCTTGATCTGAGTCACAACAGCATCTCTCAGGAAGGTGTCCTGCACCTGCTGGAGACTCTGCCCTCCTGCCTGCGTGTTGAGGAGGCCTCTGTGAACCTGGGCTCCATGCAGAACTTCTGGGTTCGCTTCTCCAAGCAGGAGGAGGCTAGGATGACCCTGAGGCTGAGCGAGTGCAGCTTCGGGCCGGAGCACGTGGTCAGACTGGCCAGCAGCGTCAGCCAGGCCCTCCAGCTGACCGGGCTCACGCTGACCCGGTGTTGCTTGGACCTGAAGCAGCTGACCATCCTTCTAAGCCTGCTGAGGCGGCCATCGGGCCTCCTTGGCCTCAGGGTGGAGGAACCGTGGGTCGGTGGAGCTGGGGTGCCTACCCTGCTAGAAGTCTGTGCCCAGGCCTCAGGCAATGTCACTGTCATAAGCATCTCTGAGACCCAGCAGCAGCTCTACATCCAGCTGGAATTCCCTCGTCAGGAAGAAAACCCAGAGGTGGTGGCCCTCAGGTTGGCTCACTGTGACCTAGGGACCCACCACAGCCTTCTTGTCCGACAGCTGATGGAGACATGCCGCCGGCTGCAGCAGCTCAGCCTGTCCCAGGTAAACCTCTGCGATGCCAGCGATGCCACCTTCCTGCTGCTGCAGAGCCTCCTGCTGTCCCTCTGTGACCTGAAGACCTTCCGGCTGACCTCCAGCTGTGTGAGCACCCAGGGCCTCACTCACCTGGCGTCTGGACTGGGCCACTGCCACCACCTGGAGGAGCTGGACTTCTCCAACAATCAATTTGGTGAGCAGGCCGAAGAGATACTGATGGGGGCCCTTGAGGGGAAGTATAGGCTGAAGACACTCCACCTCAGTCACCTTCCTCTGGGCGGCCCCACACTGGCCACGCTTACTCGAGAACTAAGCCACATGAGCCTCCTGCAGCACCTCTGACCGAACAAGAACAACATTGGTAACATTAGTTGCTGTCAACTTCCTGAGGCTTTCAGAGCTGCCACCAGCTTGATGGGACTGGACCTGAGTCACGACCAAATTGGAGACACCGGTGCCCAGAACCTAGCTGCTATCCTGCTGGGGCTGCCTGGGCTCAGGAAGATAGACCTCTCAGCAAATGGCATCAGCCTGGCTGGAGGACTGCAGCTGGCGAAGTCCCTCACTCTTTGCAGACACCTGGAGGAGGTTAGGCTTGGCTGCAACGCCTTGGGGGATCCCACAGCCCTGACACTGGCTCAGGGGCTGCCCCAGCACCTAAGGGTCCTACACCTGCAGTCTAGCCGTCTGGGCCCAGAGGGGGCACTGAGCCTGGGCCGGGCCCTAGATGGATGCCCACATGTGGAAGATATCAGCTTGGCAGAGAATAAGCTGGCCAACTGGGTCCCACGTTTCTGCAAGGGGCTCCCACTGCTCAGACGGATGGACCTGGGTTCCTGTGAAATTGACAACCAGACTGCCAAAGACCTCGCTGCCAGCTTCATGCTCTGCCCAGCCCTGGAGGAAATCCTGCTGTCCTGGAATCTCCTGGGGGACGAGGCAGCTGCTGAGCTGGCCCAGGTTCTGCCACGGTTGGGCCGACTGAAGAGAGTGGACCTGGAGAAGAACTGGATCACAGCTGCTGGAGCCTGGCTCCTGGCTAAAGGGCTGGCCCAGGCATCTGGTGTCCATGTCATCCGCCTCTGGAACAACCTCATTCCCCCTGCCGTGGCCCAGCGTCTGCAGAGCCAAGAGCCCAGGCTGGACTTCGCCTTCTTTGACAACCAGCCCCAGGGCCCCCGGGATACTTGA

XM_004843168.1 Coding sequence

Ccl17 chemokine (C-C motif) ligand 17

High confidence: 4 potential gene matches
Length: 306 bp    Location: 28657470..28655801   Strand: -
>XM_004843168.1
ATGAGGTCCCTGAAGACGCTGTTCCTGGCCGCCCTGCTGCTGGGCGCCTCTCTGCAGTTCAGCCGAGCAGCTCGAGCCACCAACGTGGGGCGGGAGTGCTGCCTGGAGTACTTCAAGGGAGCCATTCCCAGCAAAAAGCTGGTGCACTGGTACAGGACCTCGTCCGAGTGTCCCAGGGACGCCATTGTGTTTGTGACTGTCAGGGCCAGGCTCATCTGCTCGGACCCTGAGAACTGGCTCGTGAAGAAGGCAGTTAGATACTTGGACAGCCTCAAGAAGTCACACAGGACCACCACCCAGGACTGA

XM_004843174.1 Coding sequence

Ccl22 chemokine (C-C motif) ligand 22

High confidence: 4 potential gene matches
Length: 282 bp    Location: 28779818..28695153   Strand: -
>XM_004843174.1
ATGGCCGGCCTACAGGCTCCACTCCTGGCCGGCCTCGTCTTCCTTTCGGTGATGCTTCAGGCAACCAACGCAGGGCCGTATGGCGCCAATGTGGAGGACAGCATCTGCTGCCGGGACTTCGTCCGCCACCCCCTGCCGCTTCGCGTGGTGAAGGACTTCTACTGGACCTCGGGCTCCTGCCGTAGGACTGGCATCGTCTTACAAACCGTCAAGGACCGGGAGATCTGTGCCAACCCCAAACTGCCCTGGGTAAAGAAGATTCTCCAGAAGCTGAGCTCATGA

XM_004842983.1 Coding sequence

LOC101726475 non-histone chromosomal protein HMG-17-like

Length: 273 bp    Location: 18141345..18142605   Strand: +
>XM_004842983.1
ATGCCCAAGAGAAAGGCTGAAGGGGATGCTAAAAGTGATAAAGCCAAGGTGAAGGACGAACCACAGAGAAGATCCGCAAGGTTGTGTGCTAAATCAGCTCCTCTAAAGCCAGAGCCCAAGCCTAAAAAGGCCCCTGCAAAGAAGGGAGAGAAGGTACCCAAAGGGAAAAAGGGAAAAGCTGATGCCGGCAAGGATGGGAATAACCCTGCAGAAAATGGAGATGCTAAAACAGACCAGGCACAAAAAGCTGAAGGTGCTGGAGATGCCAAGTGA

XM_004843153.1 Coding sequence

Ccdc135 coiled-coil domain containing 135, transcript variant X5

Length: 2439 bp    Location: 28406203..28386638   Strand: -
>XM_004843153.1
ATGGAGGTCCTGAAGGAGAAAGTGGAGGAAGAGGAGGCTGCCGAGCGGGAGGAGGCTGCTGAGCGGGCTGAAAGGGTGGAGAAAACGAGGCCAGCGGAGGTGCAGAAGGAAGAAGCCACCCTGACCCAGGAGATGCTCCGAGACCTGGGGAAGCAGCTGTTGGAGATTCAAATGCCCACACCAGCAGAGCCCCCGATCGTAACCAAGGACACCGTTGACATCTCCAACCTGCCCCTTTCCTACAAAACCAACACACTCAAGGAGGAGCACTTGCTGCAGGTGGCCAACAACTTCTCCCGCCAGTACAGCCACCTGTGCCCGGACCGCGTGCCCCTCTTCTTGCAGCCCCTGAATGAGTGTGAAGTGCCTAAGTTTGTGAGCACTACCATCCGGCCCACACTGATGCCCTACCCAGACCTTTATAACTGGGATGGCTGTGCCAACTTTGTCTCCAACTTCCTCACCAGGGTGCCTCTGCCTGACCCCCTCAAGCCGCCCTCGCACCTGTATTCCTCAACCACGGTGCTCAAGCACCAGAAGGGGAACTGCTTCGACTTCAGCACGCTGCTCTGTTCCATGCTGCTTGGTGCTGGCTACGATGCCTACTGCGTCAATGGGTATGGCTCCCAGGCTCTGTGCAACATGGACCTGACTCGGGAGGTCTGCCCACTCACCGTGACACCCAAAGAGACAGTCAAGAAGAAAGAGAAGGCACAGCCCAAGAAGTACACCATCAAACCGCCACGGGACCTGACCAGCAGGTTTGAGCAGGAGCAGGAGATCAAGAAGCAGAAGGAGGCCAAAGCCCAGGAGGAGAAGCGGTGGTGGGAAGAAGAAGAAGAGCACCTTCTGGAGGCAGAGAGGGCGAAGCCTGACCCCCTACATGGCCTTCGGGTGCACTGCTGGGTCCTGGTGCTGTTGGGGAAGCGAGAGGTGCCTGAGAGCTTCTTCATCGACCCTTTCACTGGCCGCAGCTACAGCATCCAGGATGATCACTTCCTGGGCATCGAGAGCCTCTGGAACCACAGGAACTATTGGATCAACATGCAGGACTGCCGGAACTGCTGCAAGGACTTGGTCTTTGACCTGGGAGACTCTGTGAGGTGGGAGTACATGCTCTTGGGGACAGATAAGCCTCATCTGTCCTTGACTGAGGAAGAGGATGAAGGGATGAATGATGACAATGACACAGAAGATCTGGACAAGGAGAACCAGGATAAGAGCTTCGATATGCCGTCCTCATGGGTGGAGCAGATCGACATCTCCCCAGAAGTGCACTCATACAAGTCCATGGAGCCTGAGAATGACCGTGTCATGGAGTTTTATGAAACAGCCCGTGTGGACGGCCTGATAAAATGGGAGGAGACTCCCAGGACAATGACTCAGTACTATCAAGGACGCCCAGACTTCCTCTCCTACCGCCATATCAACTTTGGGCCCAGGTTCAAGAAGCTCACTTTGACCAGCACAGAGTCGAACCCCCGGCCCATACTGAAAATCACAGAGCGGTTCTCCCGAAACCCAGCGAAGCCCGCAGATGAGGATGTGGCAGAGCGTGTGTTCTTGATCTCCGAGGAGCGCATCCAACTGCGCTACCACTGCCGTGATGACTACATCACTGCCTCCAAGCGCGAGTTCCTGCAGCGCTCTGAGGTGGACAGCAAGGGCAACAAGATCATCATGACATCAGACGTGTGCATCAGCTTTGAGGTGGAGCCCATGGAGCACACCAAGAAGCTTCTCTACCAGTACGAGACCATGATGCACCTGAAGAATGAGGAGAAGCTGTCCAAACACCAGGCCTGGGAGTCCGAGCTGGAGGTGGGGGCCCACAGGAGAGAGGGCAAAGGAAGTAATAGGGGGCATCTTAATCATACTTTGTGTCACTTCCCAACTCAGGTGCTGGAGATCCTGAAGCTTCGAGAGGAAGAGGAGGAGGCACACATACTGAACATCTCCATCTATGACACCAAGCGCAACGAAAAGAGCAAGGAGTATCGGGAGGCCATGGAGCGTGTGATGCACGAGGAGCACCTGCGGCAGGTGGAGGCCCAGCTGGACTACCTGGCTCCATTCCTGGCCCAGCTGCCCCCGGGTGAGAAGCTGACTCGTGTGCAGGCTGTGCACCTCAAGGATGCGTGCCTCGGTGACTTCAAGCAGCGGCTCATCGACAAGGCCAACCTTATCCAGGCCCGCTTCGAGAAGGAGAACCAGGAGCTGCAGAAGAAGCAGCAGTGGTACCAGGAGAACCAGGTGACCCTGACACCAGAGGATGAAGACTTGTACCTGAGTTACTGCTCTCAGGCCATGTTCCGTATCCGCATCCTGGAGCAGCGGCTCAATCGACACAAGGAGCTGGCCCCCCTGAAGTATTTGGCGTTGGAGGAAAAGCTCTACAAGGATCCACGCCTGGCAGAGTTCCTCAAAGTCTTCGCTTGA

XM_004843149.1 Coding sequence

Ccdc135 coiled-coil domain containing 135, transcript variant X1

Length: 2754 bp    Location: 28406203..28386638   Strand: -
>XM_004843149.1
ATGGAGGTCCTGAAGGAGAAAGTGGAGGAAGAGGAGGCTGCCGAGCGGGAGGAGGCTGCTGAGCGGGCTGAAAGGGTGGAGAAAACGAGGCCAGCGGAGGTGCAGAAGGAAGAAGCCACCCTGACCCAGGAGATGCTCCGAGACCTGGGGAAGCAGCTGTTGGAGATTCAAATGCCCACACCAGCAGAGCCCCCGATCGTAACCAAGGACACCGTTGACATCTCCAACCTGCCCCTTTCCTACAAAACCAACACACTCAAGGAGGAGCACTTGCTGCAGGTGGCCAACAACTTCTCCCGCCAGTACAGCCACCTGTGCCCGGACCGCGTGCCCCTCTTCTTGCAGCCCCTGAATGAGTGTGAAGTGCCTAAGTTTGTGAGCACTACCATCCGGCCCACACTGATGCCCTACCCAGACCTTTATAACTGGGATGGCTGTGCCAACTTTGTCTCCAACTTCCTCACCAGGGTGCCTCTGCCTGACCCCCTCAAGCCGCCCTCGCACCTGTATTCCTCAACCACGGTGCTCAAGCACCAGAAGGGGAACTGCTTCGACTTCAGCACGCTGCTCTGTTCCATGCTGCTTGGTGCTGGCTACGATGCCTACTGCGTCAATGGGTATGGCTCCCAGGCTCTGTGCAACATGGACCTGACTCGGGAGGTCTGCCCACTCACCGTGACACCCAAAGAGACAGTCAAGAAGAAAGAGAAGGCACAGCCCAAGAAGTACACCATCAAACCGCCACGGGACCTGACCAGCAGGTTTGAGCAGGAGCAGGAGATCAAGAAGCAGAAGGAGGCCAAAGCCCAGGAGGAGAAGCGGTGGTGGGAAGAAGAAGAAGAGCACCTTCTGGAGGCAGAGAGGGCGAAGCCTGACCCCCTACATGGCCTTCGGGTGCACTGCTGGGTCCTGGTGCTGTTGGGGAAGCGAGAGGTGCCTGAGAGCTTCTTCATCGACCCTTTCACTGGCCGCAGCTACAGCATCCAGGATGATCACTTCCTGGGCATCGAGAGCCTCTGGAACCACAGGAACTATTGGATCAACATGCAGGACTGCCGGAACTGCTGCAAGGACTTGGTCTTTGACCTGGGAGACTCTGTGAGGTGGGAGTACATGCTCTTGGGGACAGATAAGCCTCATCTGTCCTTGACTGAGGAAGAGGATGAAGGGATGAATGATGACAATGACACAGAAGATCTGGACAAGGAGAACCAGGATAAGAGCTTCGATATGCCGTCCTCATGGGTGGAGCAGATCGACATCTCCCCAGAAGGTCTCTGCCAATGCGTGTTCAGTGCTTTCTCCAGAACCATCCCTGGACTCCAGGAAGCATTTGAAACCCACTGCCTGAACGGGAAGAAGGTGCTGCATTACAGGAGGGCACAGCTGGAGAAATGGGCCCCGTACCTCAACAGCAATGGCCTGGTGTGCCGCCTCACCACCTACGAAGACCTGGAGTGTACCAAGATTTTGGAGATCAAGGAGTGGTATCAGAACCGGGAGGACATGCTGGAGCTGAAGCACATAAACAACAGCACAAGCCTGCACACTGACTACTTCAGGCCGGGCCACCCCCGGGCTCTGCATGTGCACTCATACAAGTCCATGGAGCCTGAGAATGACCGTGTCATGGAGTTTTATGAAACAGCCCGTGTGGACGGCCTGATAAAATGGGAGGAGACTCCCAGGACAATGACTCAGTACTATCAAGGACGCCCAGACTTCCTCTCCTACCGCCATATCAACTTTGGGCCCAGGTTCAAGAAGCTCACTTTGACCAGCACAGAGTCGAACCCCCGGCCCATACTGAAAATCACAGAGCGGTTCTCCCGAAACCCAGCGAAGCCCGCAGATGAGGATGTGGCAGAGCGTGTGTTCTTGATCTCCGAGGAGCGCATCCAACTGCGCTACCACTGCCGTGATGACTACATCACTGCCTCCAAGCGCGAGTTCCTGCAGCGCTCTGAGGTGGACAGCAAGGGCAACAAGATCATCATGACATCAGACGTGTGCATCAGCTTTGAGGTGGAGCCCATGGAGCACACCAAGAAGCTTCTCTACCAGTACGAGACCATGATGCACCTGAAGAATGAGGAGAAGCTGTCCAAACACCAGGCCTGGGAGTCCGAGCTGGAGGTGGGGGCCCACAGGAGAGAGGGCAAAGGAAGTAATAGGGGGCATCTTAATCATACTTTGTGTCACTTCCCAACTCAGGTGCTGGAGATCCTGAAGCTTCGAGAGGAAGAGGAGGAGGCACACATACTGAACATCTCCATCTATGACACCAAGCGCAACGAAAAGAGCAAGGAGTATCGGGAGGCCATGGAGCGTGTGATGCACGAGGAGCACCTGCGGCAGGTGGAGGCCCAGCTGGACTACCTGGCTCCATTCCTGGCCCAGCTGCCCCCGGGTGAGAAGCTGACTCGTGTGCAGGCTGTGCACCTCAAGGATGCGTGCCTCGGTGACTTCAAGCAGCGGCTCATCGACAAGGCCAACCTTATCCAGGCCCGCTTCGAGAAGGAGAACCAGGAGCTGCAGAAGAAGCAGCAGTGGTACCAGGAGAACCAGGTGACCCTGACACCAGAGGATGAAGACTTGTACCTGAGTTACTGCTCTCAGGCCATGTTCCGTATCCGCATCCTGGAGCAGCGGCTCAATCGACACAAGGAGCTGGCCCCCCTGAAGTATTTGGCGTTGGAGGAAAAGCTCTACAAGGATCCACGCCTGGCAGAGTTCCTCAAAGTCTTCGCTTGA

XM_004843139.1 Coding sequence

Usb1 U6 snRNA biogenesis 1, transcript variant X4

Length: 750 bp    Location: 28166043..28152820   Strand: -
>XM_004843139.1
ATGAGCGCGGCGCCCCTGGTGGGCTACAGCAGCAGCGGCTCGGAGGATGAGGCCGAGGCCGCGGTCACCGAGCAGACCAGCCCGGGGTCTGGGGGCCACTGCCGTGGCCAGAGCCCCCTTCCCAATGAGAGGTTTCCAGTACCTGACAGTGTACTGAACATGTTCCCGGGCACAGAGGAAGGACCTGAGGATGACAGTGCAAAACATGGGGGACGAGTGCGTACCTTTCCCCACGAGCGTGGCAACTGGGTCACCCATGTCTATGTACCATATGAAGCCAGGGAGGAATTCCCAGATCTTCTTGACATGCTGCTGCCCCAGGCCCAGGCCTACGTGCCCCGGCTGGTGAAGATGGAGGCGTTCCACCTCAGCCTGTCTCAGAGCGTGGTTCTGCGCCACCATTGGATCCTCCCTTTTGTGCAGGCTCTGAAAGACCGAATGGCCTCCTTTGAAAGGACCTTTGTTGGGCTTGAAGTCACCTCGGGGTATGCCCAGTTCTTGGACTTAGTTTCAGAAGTGGACAGAGTCATGGAGGAATTTGACCTCACCACTTTCTACCAGGACCCTTCATTCCACATCAGTCTGGCCTGGTGCGTGGGAGATGCATGTCTTCAGCTGGAAGGGCAGTGCCTGCAGGAATTACAGGAAATCGTGGATGAGTTTGAAGACTCTGAGATGCTGTTGCGTGTGCAGGCCATGCAGGTCCGCTGCAAGTCTGGGAACAAGTTCTTCTCCATGCCTTTGAAGTAA

XM_004843142.1 Coding sequence

Katnb1 katanin p80 (WD repeat containing) subunit B 1, transcript variant X1

Length: 1968 bp    Location: 28381319..28360464   Strand: -
>XM_004843142.1
ATGGCCACCCCTGTGGTCACCAAGACAGCCTGGAAGTTGCAAGAGATTGTTGCCCATGCCAGCAATGTGTCCTCGCTGGTGTTGGGCAAAGCCTCAGGACGGCTGCTGGCCACGGGTGGGGATGACTGCCGAGTCAACTTGTGGTCCATCAACAAGCCCAACTGCATCATGAGCCTGACAGGTCACACGTCCCCAGTGGAGAGTGTCCGCCTCAACACCCCGGAGGAGCTCATTGTGGCCGGCTCCCAGTCGGGCTCCATCCGAGTCTGGGACCTGGAAGCTGCCAAAATTCTTCGCACACTCATGGGACACAAAGCCAACATCTGCAGCCTGGACTTCCACCCTTATGGCGAGTTTGTGGCCTCTGGTTCCCAGGACACAAACATCAAACTCTGGGACATCAGGAGGAAGGGCTGCGTCTTCCGGTATAGGGGGCACACCCAGGCTGTGCGGTGTCTCCGCTTCAGCCCTGATGGGAAGTGGTTGGCGTCAGCCGCAGATGACCACACAGTGAAGCTCTGGGACCTGACTGCTGGCAAGATGATGTCCGAGTTCCCTGGTCACACGGGGCCTGTGAACGTGGTAGAGTTTCACCCCAACGAGTACCTCCTTGCTTCTGGCAGCTCCGACAGGACGATCCGTTTTTGGGATCTGGAGAAGTTCCAGGTGGTGAGCTGCATTGAAGGAGAGCCAGGGCCTGTCAGGAGTGTCCTCTTCAACCCAGATGGCTGCTGCCTGTACAGTGGCTGCCAGGACTCACTCCGTGTCTATGGCTGGGAGCCCGAGCGCTGCTTTGATGTGGTCCTTGTCAACTGGGGCAAGGTGGCTGACCTGGCCATCTGCAATGACCAGCTGATAGGCGTGGCCTTCTCCCAAAGCAACGTCTCCTCCTACGTGGTGGACCTGACGCGAGTCACTAGGACAGGCACAGTGGCCCAGGACCCCGTGCAAGACAGCCGGCCCCTGACGGAGCAGTCACCCAACCCCAATGCCCCACTCCGGCGCATCTACGAGCGGCCCAGCACGACCTGCAGCAAGCCCCAGAGGGTGAAGCACAACTCAGAGAGCGAGCGCCGCAGCCCCAGCAGCGATGACGACAGGGACGAACGTGAGTCCCAGGCTGAGATCCAGAATGCTGAGGACTACAATGAGATCTTCCAGCCCAAGAACAGCATCAGTAGGACGCCACCCCGAAGAAGCGAGCCCTTCCCAGCACCCCCTGAAGACGACGCAGCCACAGTGAAGGAGGCAGCAAAGCCCAGCCCAGCTATGGACGTGCAGTGCGCAATGCCAAACCTCGAGGTCCCAGTCCAGCCCCCAGTGCTGACATCCACGCCTACACCCAAGGGTGAGCCTGCCATCATCCCTGCCACTCGGAATGAGCCCATTGGCCTGAAGGTCTCTGACTTCTTGCCTGCTGTGAAGATCCCCCAGCAGGCAGAGCTGCTGGATGAAGACGCCATGTCACAGATCCGCAAAGGCCACGACACCATGTGCGTGGTGCTCACCAGCCGCCACAAGAACCTGGACACCGTGCGGGCTGTGTGGACCACAAGTGACATCAAGACATCCGTAGACTCTGCTGTGGCCATCAACGACCTATCAGTGGTGGTGGATCTCCTGAACATAGTCAACCAGAAAGCCTCCCTGTGGAAGCTGGACCTGTGCACCACCGTCCTGCCACAGATCGAGAAGCTTCTGCAGAGCAAGTATGAGAGCTATGTCCAGACAGGCTGCACTTCCCTGAAGCTGATCCTGCAGCGCTTCCTGCCCCTGATCACAGACATCCTTGCTGCCCCGCCCTCCGTGGGTGTTGATATCAGCCGTGAGGAGAGGCTTCACAAGTGCCGGCTCTGCTACAAGCAGCTCAAGAGCATCACTGGCCTTGTCAGGAGCAAGTCCAGCCTGAGTGGCCGCCACGGTAGTGCCTTCCGGGAGCTGCACCTGCTCATGGCTGCTTTGGACTGA

XM_004843130.1 Coding sequence

Gins3 GINS complex subunit 3 (Psf3 homolog)

High confidence: 4 potential gene matches
Length: 651 bp    Location: 27852980..27839655   Strand: -
>XM_004843130.1
ATGTCCGAGGCTTATTTCCGGGTGGAGTCGGGCGCGCTGGGACCTGAGGAGAACTTTCTCTCCTTGGACGACATCTTGATGTCCCACGAGAAGCTGCCAGTGCGCACGGAGACTCCCATGCCGCGCCTGAGCACCTTCTTCCCGGAATGGGGCGCCGGAGCCGGGCCGGACCACGCGCTGCCGCAGGGCTCAAAGCTTGAATTCCCCTTATGGCTGGCAAAAGGACTTTTTGACAACAAGCGGCGCATCCTTTCTGTGGAACTTCCCAAGATCTACCAAGAGGGTTGGAGGACCGTATTCAGTGCAGATGCCAATGTGGTAAACCTCCACAAAATGGGACCCCATTTCTATGGGTTTGGCTCCCAGTTGCTCCATTTTGACAGTCCGGAGAATGCGGATATATCCCAGTCTCTACTGCAGACATTTATTGGACGTTTTCGCCGGATCATGGACTCCTCTCAGAACACTTACAATGAAGACATTTCAGCCCTGGTAGCTAGGCTAGACGAGATGGAGAGGGGCTTATTTCAAACTGGGCAGAAAGGACTGAATAACTTTCAATGTTGGGAAAAGGGTCAGGCTTCTCAGATCACACCTTCCAACCTCGTTCAGAATTATAAGAAGAGAAAATTCACCGACATGGAGGACTGA

XM_004843133.1 Coding sequence

Csnk2a2 casein kinase 2, alpha prime polypeptide

High confidence: 4 potential gene matches
Length: 1053 bp    Location: 28012556..28062944   Strand: +
>XM_004843133.1
ATGCCCGGCCCGGCCGCGGGCAGTAGGGCCCGGGTCTACGCCGAAGTGAACAGCCTGAGGAGCCGCGAGTACTGGGACTATGAGTCTCACGTCCCGAGTTGGGGTAATCAAGATGATTACCAACTGGTTCGAAAACTTGGTCGGGGAAAGTATAGTGAAGTATTTGAGGCCATTAACATCACTAACAACGAGAGAGTGGTTGTAAAAATTCTCAAGCCAGTGAAGAAAAAGAAGATAAAACGAGAGGTTAAGATTCTGGAGAATCTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAACAAAAAAAGCTGCGTCTGATAGATTGGGGCTTAGCAGAGTTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCGAGGTACTTCAAGGGACCAGAGCTCCTTGTGGACTATCAGATGTATGATTACAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAAGGAACCCTTTTTCCATGGGCAGGATAATTACGACCAGCTTGTTCGCATTGCCAAGGTTCTGGGGACAGACGAGCTGTATGGCTATCTGAAGAAATATCACATAGACCTAGATCCACACTTCAACGATATCTTGGGACAGCATTCAAGGAAACGCTGGGAAAACTTCATCCATAGTGAAAACAGACACCTTGTCAGCCCTGAGGCCCTAGATCTTCTGGACAAACTTCTGCGATATGACCATCAACAGAGACTGACTGCCAAAGAGGCCATGGAACACCCATACTTCTACCCTGTGGTGAAGGAGCAGTCCCAGCCTTGCGCAGAGAATGCTGTACTTTCCAGTGGTATCACAGCGGCACGATGA

XM_004843134.1 Coding sequence

LOC101717947 chromosome unknown open reading frame, human C16orf80

Length: 582 bp    Location: 28071520..28085040   Strand: +
>XM_004843134.1
ATGTTCAAAAACACGTTCCAGAGTGGCTTCCTCTCCATCCTCTACAGCATCGGCAGCAAGCCCCTGCAGATCTGGGACAAAAAGGTGCGAAATGGCCACATCAAAAGAATCACTGATAATGACATCCAGTCCCTGGTGCTAGAAATTGAAGGGACAAATGTCAGCACTACATATATCACATGTCCTGCAGACCCTAAGAAGACATTAGGAATTAAGCTTCCTTTCCTCGTCATGATTATCAAAAACCTGAAGAAATATTTCACCTTTGAAGTACAGGTACTAGATGATAAGAATGTGCGCCGGCGGTTTCGGGCAAGCAACTATCAGAGCACCACTCGTGTCAAACCCTTCATCTGTACCATGCCCATGCGGCTGGATGATGGCTGGAACCAGATTCAGTTCAATTTATCCGACTTCACCCGGCGGGCATATGGCACAAATTACATTGAGACCCTAAGAGTACAGATCCATGCAAATTGCCGCATCCGACGGGTTTACTTCTCAGACAGACTCTACTCAGAAGATGAGCTGCCAGCAGAGTTCAAACTGTATCTCCCAGTTCAGAACAAGGCAAAGCAATAA

XM_004843125.1 Coding sequence

Ndrg4 NDRG family member 4, transcript variant X1

Length: 1176 bp    Location: 27802765..27763054   Strand: -
>XM_004843125.1
ATGAGGGTGCTGGGACACAAGATCGAGCTGCTGACAGGGCTCCTACTGCACGACGTGACCATGGCCGGGCTGCAAGAGCTGCGATTCCCAGAGGAGAAGCCCCTGCTTCGCGGCCAGGATGTTACCGAGCTGGAGAACCCTGACACCTTCCTCTCCACTGTGGACACGGACTGGAAGGAACATGACATTGAGACGCCTTATGGGCTTCTCCACGTGGTGATCCGCGGCTCCCCCAAGGGCAACCGCCCAGCCATCTTCACCTACCATGACGTGGGCCTAAACCACAAGCTGTGTTTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACCAAGCACTTTGTGGTGTGCCACGTGGATGCCCCCGGACAGCAGGTGGGGGCGTCGCAGTTTCCTCAAGGGTACCAGTTCCCCTCCATGGAGCAGCTGGCTGCCATGCTCCCCAGCGTGGTACAGCACTTTGGGTTCAAGTACATTATTGGCATCGGAGTGGGAGCCGGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCTGACCTGGTGGAGGGGCTGGTGCTCATGAACATCGACCCCAATGGCAAAGGCTGGATTGACTGGGCTGCCACCAAGCTCTCTGGCCTGACCAGCACTTTGCCAGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTGGTGAACAACACGGAGCTGGTGCAGAGCTACCGGCAGCAGATCGGGAATGTGGTGAACCAGGCCAACCTGCAGCTCTTCTGGAACATGTACAACAGCCGAAGAGACCTGGACATTAACCGGCCTGGGACAGTGCCCAATGCCAAGACGCTCCGCTGCCCGGTGATGCTGGTGGTTGGGGACAACGCACCTGCTGAGGATGGGGTGGTTGAATGCAACTCCAAAATGGACCCAACCTCCACGACCTTCCTGAAGATGGCAGATTCCGGGGGACTCCCTCAGGTCACACAGCCGGGGAAGCTGACCGAGGCCTTCAAATACTTCCTGCAAGGCATGGGCTACATGCCCTCTGCCAGCATGACCCGCCTGGCACGCTCCCGCACCGCATCTCTTACCAGTGCCAGCTCTGTGGATGGCAGCCGCCCGCAGCCCTGCACCCACTTGGAGAGCAGCGAGGGGCTGGGCCAGGTCAACCACACCATGGAGGTGTCCTGCTGA

XM_004843124.1 Coding sequence

Cnot1 CCR4-NOT transcription complex, subunit 1

High confidence: 1 potential gene match
Length: 7131 bp    Location: 27659443..27758036   Strand: +
>XM_004843124.1
ATGAATCTTGACTCGCTCTCGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAGCCAGCCAGCAGGAAATACAGCATATTGTGAATCGGCACGGTCCTGAGGCAGACAGGCATTTACTACGCTGCCTATTCTCACATGTGGATTTCAGTGGCGATGGTAAAAGCAGTGGCAAAGATTTCCATCAGACTCAGTTTCTGATTCAGGAGTGTGCGTCGCTGATTACAAAGCCAAATTTTATCTCAACGTTGTCCTATGCCATTGATAATCCATTGCACTATCAGAAGAGTTTAAAGCCTGCACCCCACTTATTTGCCCAGCTGAGTAAAGTTCTTAAGTTAAGCAAAGTACAAGAGGTAATTTTTGGTCTTGCCCTTTTGAATTCTTCCAGTTCAGATCTCAGAGGTTTTGCTGCTCAGTTTATTAAACAGAAGCTTCCGGATCTTCTGCGTTCTTACATTGACGCAGACGTCAGTGGAAATCAAGAAGGTGGCTTCCAAGATATAGCAATAGAGGTCCTACACCTCCTCCTCTCCCATCTCCTCTTTGGGCAGAAGGGAGCCTTTGGAGTTGGACAGGAACAGATAGACGCTTTTCTTAAGACGCTGCGCAGAGATTTTCCCCAAGAACGCTGTCCTGTGGTGCTTGCACCACTTTTATATCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGATTCCGGAGGGGTAGCTAAAACCATGATGGAGAGCTCTTTAGCTGATTTCATGCAAGAAGTAGGCTATGGCTTTTGTTCAAGTATCGAAGAATGTCGCAATATAATCATGCAGTTTGGCGTTCGGGAAGTTACAGCTGCCCAGGTTGCAAGGGTTTTGGGAATGATGGCTCGAACTCATTCAGGATTAACAGATGGTATTCCATTACAGAGTATCTCTGCTCCTGGCAGTGGGATCTGGAGTGATGGAAAAGATAAAAGCGATGGCGCACAGGCACACACGTGGAATGTAGAAGTCTTGATTGATGTTCTCAAAGAACTCAACCCGAGTTTGAATTTCAAGGAAGTGACTTATGAATTGGACCATCCTGGATTTCAAATTCGTGATAGTAAAGGACTTCACAATGTTGTTTATGGTATTCAAAGGGGTTTGGGTATGGAAGTGTTCCCAGTAGACTTCATCTATAGACCTTGGAAACATGCAGAAGGCCAGCTCTCCTTCATTCAACATTCCCTTATAAATCCAGAAATCTTCTGTTTTGCTGACTATCCTTGTCATACTGTTGCCACTGATATTCTGAAAGCACCACCAGAGGATGACAATCGAGAAATTGCCACATGGAAGAGCTTGGATTTAATTGAATCTCTGCTGAGGCTTGCAGAGGTTGGACAGTATGAGCAAGTCAAACAGCTCTTCAACTTCCCTATCAAACACTGTCCAGACATGCTGGTATTGGCCTTACTACAAATCAACACCTCCTGGCATACCTTGCGCCATGAACTCATTTCCACTCTGATGCCAATCTTTCTTGGAAACCATCCTAACTCTGCTATTATTTTGCACTATGCATGGCATGGGCAGGGACAGTCTCCCTCAATTCGCCAGCTTATCATGCATGCAATGGCAGAATGGTACATGAGAGGGGAGCAATATGACCAGGCCAAGTTGTCTCGAATACTTGATGTGGCTCAGGACTTGAAGGCCTTGTCAATGCTGCTAAATGGTACTCCATTTGCCTTTGTTATTGATCTTGCTGCACTTGCTTCTCGTCGTGAATACCTCAAACTTGACAAGTGGCTCACAGATAAAATTCGAGAGCATGGGGAGCCTTTTATACAAGCGTGCATGACTTTTTTAAAGAGACGATGCCCTTCTATTTTGGGTGGACTTGCCCCAGAGAAAGACCAACCCAAAAGTGCTCAGCTTCCTCCTGAAACTCTGGCAACAATGTTGGCTTGTCTACAGGCTTGTGCAGGGAGTGTTTCTCAGGAGTTATCAGAGACCATCCTCACCATGGTTGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAGCCACCGCCTGGAGTTATGCCAAAAGGACGCCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAGATTGACCCTCTTGCTGGAATGGCATCGCTTAGTATAGGTGGCTCAGCTGCCCCTCACACACAGAGCATGCAAGGTTTCCCTCCAAATTTGGGTTCTGCGTTCAGTACCCCTCAGTCACCAGCAAAAGCATTTCCACCTCTATCAACCCCAAATCAAACCACTGCATTCAGCGGTATTGGAGGACTTTCATCACAGCTTCCAGTAGGTGGTCTTGGCACAGGCAGCCTGACTGGTATAGGAACCGGGGCTCTTGGACTCCCTGCAGTGAATAGCGACCCTTTTGTACAGAGGAAACTGGGCACCTCTGGACTGAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCTTCGGACTTGTCTCAGGTGTGGCCAGAGGCAAATCAGCACTTTAGTAAAGAGATAGATGATGAAGCAAATAGCTATTTCCAGCGAATATATAATCACCCACCACATCCAACTATGTCTGTTGATGAGGTATTAGAAATGCTACAGAGATTTAAAGACTCCACTATAAAAAGGGAAAGAGAAGTATTTAACTGTATGCTAAGGAATTTGTTTGAAGAATACCGGTTTTTCCCCCAGTACCCTGATAAAGAGTTACATATAACAGCCTGCCTTTTTGGTGGCATAATTGAGAAAGGACTGGTCACTTACATGGCACTGGGTCTAGCCCTGCGATACGTCCTTGAAGCCTTACGCAAGCCTTTTGGATCCAAAATGTATTATTTCGGGATTGCTGCACTAGATAGATTTAAAAATAGATTGAAGGACTACCCCCAGTATTGTCAGCACTTGGCTTCTATCAGTCACTTTATGCAGTTTCCACATCATTTACAGGAGTATATCGAGTATGGACAGCAGTCTAGAGACCCTCCTGTGAAGATGCAGGGCTCTATCACAACTCCTGGAAGTATTGCACTGGCTCAGGCCCAGGCTCAGGCCCAGGTTCCAGCAAAAGCACCTCTTGCTGGTCAGGTTAACACTCTGGTAACCACCTCAACAACTACCACTGTTGCTAAAACGGTCACAGTCACCAGGCCAACTGGAGTCAGCTTCAAGAAAGATGTGCCACCTTCTATCAATACCACAAATATAGATACTCTACTTGTGGCCACAGATCAAACTGAGAGAATTGTGGAGCCCCCAGAAAATATCCAAGAAAAAATTGCTTTTATTTTCAACAATCTCTCACAGTCAAATATGACACAAAAGGTTGAAGAGCTGAAAGAAACTGTAAAGGAAGAGTTTATGCCTTGGGTTTCACAGTATCTAGTTATGAAGAGGGTCAGCATTGAGCCAAACTTCCACAGCCTGTATTCAAACTTCCTTGACACACTGAAGAACCCTGAATTTAACAAGATGGTTCTGAACGAGACTTACAGAAACATCAAAGTGCTCCTGACCTCTGATAAAGCTGCAGCCAATTTTTCAGATCGTTCTTTGCTGAAGAACTTGGGACATTGGCTAGGAATGATCACATTAGCTAAAAATAAACCCATCCTGCACACTGACTTGGATGTGAAGTCTTTGCTGCTAGAAGCTTATGTTAAAGGACAACAAGAGTTGCTCTATGTAGTGCCCTTTGTTGCCAAAGTCTTAGAGTCTAGTATTCGTAGTGTGGTTTTCAGGCCACCAAACCCCTGGACAATGGCAATTATGAATGTATTAGCTGAGTTGCATCAGGAACATGATTTAAAGTTAAATTTGAAGTTTGAGATCGAGGTCCTCTGTAAGAACCTTGCATTGGATATCAATGAGCTAAAACCTGGAAACCTTCTAAAGGATAAAGATCGCCTAAAGAACTTAGATGAACAACTCTCTGCACCAAAAAAAGATGTCAAGCAGCCAGAAGAACTTCCTCCCATCACAACCACAACAACTTCTACAACTCCAGCAACCAGCACTACCTGTACAGCCACGGTTCCACCACAGCCGCAGTACAGCTACCATGACATCAATGTGTATTCCCTTGCAGGCCTGGCACCACACATAACACTAAACCCAACAATTCCTTTGTTTCAGGCCCATCCTCAGTTGAAGCAATGTGTTCGTCAAGCAATTGAACGGGCTGTCCAGGAGCTGGTCCATCCTGTGGTGGATCGGTCGATTAAGATTGCTATGACTACTTGTGAACAAATAGTCAGGAAGGATTTTGCCCTGGATTCTGAGGAATCGAGAATGCGAATAGCAGCTCATCACATGATGCGTAACTTGACAGCTGGCATGGCTATGATTACCTGCAGGGAACCTTTGCTGATGAGCATCTCTACCAACCTCAAAAGCAGTTTTGCCTCAGCCCTTCGTACTGCATCCCCACAGCAAAGGGAAATGATGGATCAGGCAGCTGCTCAGTTAGCTCAGGACAATTGTGAATTAGCTTGCTGTTTTATTCAAAAGACTGCCGTAGAAAAAGCAGGCCCTGAAATGGACAAGAGATTAGCAACTGAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGACGCCGATACTGTGATCCTGTTGTATTAACATACCAAGCTGAGCGGATGCCAGAGCAAATCAGGCTGAAAGTTGGTGGTGTGGACCCAAAGCAGCTGGCTGTTTATGAAGAGTTTGCACGCAATGTGCCTGGCTTCTTGCCCACGAATGACTTAAGTCAGCCTACAGGATTTTTAGCTCAGCCCATGAAGCAAGCTTGGGCAACAGATGATGTAGCTCAGATTTATGATAAGTGCATTACAGAACTGGAGCAGCACCTACATGCCATTCCACCAACTTTAGCCATGAACCCTCAAGCTCAGGCTCTTCGAAGTCTTTTGGAAGTTGTAGTATTATCTCGAAACTCTCGGGATGCCATAGCTGCTCTTGGATTACTCCAGAAGGCAGTAGAAGGGTTATTAGATGCCACAAGTGGTGCTGATGCTGACCTACTGCTGCGCTACAGGGAGTGCCACCTCTTGGTACTAAAAGCTCTGCAAGATGGCAGGGCATATGGATCTCCATGGTGCAACAAACAGATCACAAGGTGCCTAATTGAATGTCGAGATGAATATAAATATAATGTGGAGGCTGTGGAGTTGCTAATTCGCAATCATTTGGTTAACATGCAGCAGTATGATCTTCATCTAGCTCAGTCAATGGAAAATGGTTTAAACTACATGGCTGTGGCATTTGCTATGCAGTTGGTAAAAATCCTGCTGGTGGATGAAAGGAGTGTTTCCCACGTTACTGAGGCAGATCTGTTCCACACCATTGAAACCCTCATGAGGATTAATGCTCACTCCAGAGGCAATGCTCCAGAAGGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGATTGATCGTGCTCATGGAGGCCCTAATTTTATGATGCATTCTGGGATCTCTCAAGCCTCAGAGTATGATGACCCTCCAGGCCTGAGGGAGAAGGCAGAGTATCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCAGCAGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGATGCACCAGCAAGGAATACTGAAGACTGATGACCTCATAACAAGATTCTTTCGTCTATGTACTGAAATGTGTGTTGAAATCAGTTACCGTGCTCAGGCTGAGCAGCAGCACAATCCTGCTGCTAATCCCACTATGATCCGAGCCAAGTGCTATCACAACCTGGATGCCTTTGTCCGACTCATTGCACTGCTAGTGAAGCACTCAGGGGAGGCTACCAACACTGTCACAAAGATTAATCTGCTGAACAAGGTCCTTGGTATAGTAGTGGGAGTTCTCCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGGATTTTTATCATGCTGCTCTTAGAACTCAATGCACCTGAGCATGTGTTGGAAACTATTAATTTTCAGACACTCACAGCTTTCTGCAATACATTCCACATCTTAAGGCCTACCAAAGCTCCTGGCTTTGTATATGCCTGGCTTGAACTGATCTCCCATCGGATATTTATTGCAAGAATGTTGGCACATACGCCACAGCAGAAGGGATGGCCTATGTATGCGCAGCTACTGATTGATTTATTCAAATATTTAGCGCCTTTCCTTAGAAATGTCGAACTCACCAAACCTATGCAAATCCTCTACAAGGGTACCCTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCCAGAGTTCCTTTGTGATTACCATTATGGGTTCTGTGATGTGATCCCACCTAATTGTATCCAATTAAGAAATTTGATCCTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTCACTCCTAATCTGAAGGTGGATATGTTGAGTGAAATAAACATCGCACCCCGGATTCTCACCAATTTCACTGGAGTAATGCCACCTCAATTCAAAAAGGATTTGGATTCCTATCTTAAAACTCGATCACCAGTCACTTTTCTGTCTGATCTGCGTAGCAACCTACAGGTATCCAATGAGCCTGGCAATCGCTACAACCTTCAGCTTATCAATGCACTGGTGCTCTACGTAGGAACTCAGGCCATTGCACACATCCACAACAAGGGCAGCACACCTTCCATGAGCACCATCACTCACTCGGCACACATGGACATCTTCCAGAACCTGGCTGTGGACTTGGACACTGAGGGTCGGTATCTCTTCTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTACCTTTTTGCAGAGGCCAACACTGAAGCTATCCAGGAACAGATCACAAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGCCACATCCTTGGGGTCTTCTTATTACTTTCATTGAGCTGATTAAAAATCCAGCATTTAAGTTCTGGAACCATGAGTTTGTACACTGTGCCCCAGAAATTGAAAAGTTATTCCAGTCGGTTGCACAGTGCTGCATGGGACAGAAGCAGGCACAGCAAGTAATGGAAGGGACAGGTGCCAGTTAG

XM_004843129.1 Coding sequence

Ndrg4 NDRG family member 4, transcript variant X5

Length: 1116 bp    Location: 27803292..27763054   Strand: -
>XM_004843129.1
ATGGCCGGGCTGCAAGAGCTGCGATTCCCAGAGGAGAAGCCCCTGCTTCGCGGCCAGGATGTTACCGAGCTGGAGAACCCTGACACCTTCCTCTCCACTGTGGACACGGACTGGAAGGAACATGACATTGAGACGCCTTATGGGCTTCTCCACGTGGTGATCCGCGGCTCCCCCAAGGGCAACCGCCCAGCCATCTTCACCTACCATGACGTGGGCCTAAACCACAAGCTGTGTTTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACCAAGCACTTTGTGGTGTGCCACGTGGATGCCCCCGGACAGCAGGTGGGGGCGTCGCAGTTTCCTCAAGGGTACCAGTTCCCCTCCATGGAGCAGCTGGCTGCCATGCTCCCCAGCGTGGTACAGCACTTTGGGTTCAAGTACATTATTGGCATCGGAGTGGGAGCCGGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCTGACCTGGTGGAGGGGCTGGTGCTCATGAACATCGACCCCAATGGCAAAGGCTGGATTGACTGGGCTGCCACCAAGCTCTCTGGCCTGACCAGCACTTTGCCAGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTGGTGAACAACACGGAGCTGGTGCAGAGCTACCGGCAGCAGATCGGGAATGTGGTGAACCAGGCCAACCTGCAGCTCTTCTGGAACATGTACAACAGCCGAAGAGACCTGGACATTAACCGGCCTGGGACAGTGCCCAATGCCAAGACGCTCCGCTGCCCGGTGATGCTGGTGGTTGGGGACAACGCACCTGCTGAGGATGGGGTGGTTGAATGCAACTCCAAAATGGACCCAACCTCCACGACCTTCCTGAAGATGGCAGATTCCGGGGGACTCCCTCAGGTCACACAGCCGGGGAAGCTGACCGAGGCCTTCAAATACTTCCTGCAAGGCATGGGCTACATGCCCTCTGCCAGCATGACCCGCCTGGCACGCTCCCGCACCGCATCTCTTACCAGTGCCAGCTCTGTGGATGGCAGCCGCCCGCAGCCCTGCACCCACTTGGAGAGCAGCGAGGGGCTGGGCCAGGTCAACCACACCATGGAGGTGTCCTGCTGA

XM_004843126.1 Coding sequence

Ndrg4 NDRG family member 4, transcript variant X2

Length: 1059 bp    Location: 27774616..27763054   Strand: -
>XM_004843126.1
ATGCCGGAGTGCTGGGATGGGGAACATGACATTGAGACGCCTTATGGGCTTCTCCACGTGGTGATCCGCGGCTCCCCCAAGGGCAACCGCCCAGCCATCTTCACCTACCATGACGTGGGCCTAAACCACAAGCTGTGTTTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACCAAGCACTTTGTGGTGTGCCACGTGGATGCCCCCGGACAGCAGGTGGGGGCGTCGCAGTTTCCTCAAGGGTACCAGTTCCCCTCCATGGAGCAGCTGGCTGCCATGCTCCCCAGCGTGGTACAGCACTTTGGGTTCAAGTACATTATTGGCATCGGAGTGGGAGCCGGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCTGACCTGGTGGAGGGGCTGGTGCTCATGAACATCGACCCCAATGGCAAAGGCTGGATTGACTGGGCTGCCACCAAGCTCTCTGGCCTGACCAGCACTTTGCCAGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTGGTGAACAACACGGAGCTGGTGCAGAGCTACCGGCAGCAGATCGGGAATGTGGTGAACCAGGCCAACCTGCAGCTCTTCTGGAACATGTACAACAGCCGAAGAGACCTGGACATTAACCGGCCTGGGACAGTGCCCAATGCCAAGACGCTCCGCTGCCCGGTGATGCTGGTGGTTGGGGACAACGCACCTGCTGAGGATGGGGTGGTTGAATGCAACTCCAAAATGGACCCAACCTCCACGACCTTCCTGAAGATGGCAGATTCCGGGGGACTCCCTCAGGTCACACAGCCGGGGAAGCTGACCGAGGCCTTCAAATACTTCCTGCAAGGCATGGGCTACATTGCATACTTGAAGGACCGAAGGCTGAGTGGAGGAGCAGTGCCCTCTGCCAGCATGACCCGCCTGGCACGCTCCCGCACCGCATCTCTTACCAGTGCCAGCTCTGTGGATGGCAGCCGCCCGCAGCCCTGCACCCACTTGGAGAGCAGCGAGGGGCTGGGCCAGGTCAACCACACCATGGAGGTGTCCTGCTGA

XM_004843128.1 Coding sequence

Ndrg4 NDRG family member 4, transcript variant X4

Length: 1116 bp    Location: 27803641..27763054   Strand: -
>XM_004843128.1
ATGGCCGGGCTGCAAGAGCTGCGATTCCCAGAGGAGAAGCCCCTGCTTCGCGGCCAGGATGTTACCGAGCTGGAGAACCCTGACACCTTCCTCTCCACTGTGGACACGGACTGGAAGGAACATGACATTGAGACGCCTTATGGGCTTCTCCACGTGGTGATCCGCGGCTCCCCCAAGGGCAACCGCCCAGCCATCTTCACCTACCATGACGTGGGCCTAAACCACAAGCTGTGTTTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACCAAGCACTTTGTGGTGTGCCACGTGGATGCCCCCGGACAGCAGGTGGGGGCGTCGCAGTTTCCTCAAGGGTACCAGTTCCCCTCCATGGAGCAGCTGGCTGCCATGCTCCCCAGCGTGGTACAGCACTTTGGGTTCAAGTACATTATTGGCATCGGAGTGGGAGCCGGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCTGACCTGGTGGAGGGGCTGGTGCTCATGAACATCGACCCCAATGGCAAAGGCTGGATTGACTGGGCTGCCACCAAGCTCTCTGGCCTGACCAGCACTTTGCCAGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTGGTGAACAACACGGAGCTGGTGCAGAGCTACCGGCAGCAGATCGGGAATGTGGTGAACCAGGCCAACCTGCAGCTCTTCTGGAACATGTACAACAGCCGAAGAGACCTGGACATTAACCGGCCTGGGACAGTGCCCAATGCCAAGACGCTCCGCTGCCCGGTGATGCTGGTGGTTGGGGACAACGCACCTGCTGAGGATGGGGTGGTTGAATGCAACTCCAAAATGGACCCAACCTCCACGACCTTCCTGAAGATGGCAGATTCCGGGGGACTCCCTCAGGTCACACAGCCGGGGAAGCTGACCGAGGCCTTCAAATACTTCCTGCAAGGCATGGGCTACATGCCCTCTGCCAGCATGACCCGCCTGGCACGCTCCCGCACCGCATCTCTTACCAGTGCCAGCTCTGTGGATGGCAGCCGCCCGCAGCCCTGCACCCACTTGGAGAGCAGCGAGGGGCTGGGCCAGGTCAACCACACCATGGAGGTGTCCTGCTGA

XM_004843120.1 Coding sequence

LOC101712695 aspartate aminotransferase, mitochondrial-like

Length: 1293 bp    Location: 27558005..27586260   Strand: +
>XM_004843120.1
ATGGCGCTGCTGCACTCCAGCCGCGTCCTCTCCGGGGTCGCCGCCTCCTTCCACCCAGGCCTTGCCGCTGGAGCTTCTGCCAGATTCAGCTCCTGGTGGGCCCATGTGGAAATGGGACCCCCAGATCCCATCCTAGGAGTCACTGAAGCCTACAAGAGAGACACCAACAGCAAAAAGATGAACCTGGGAGTTGGTGCCTATCGCGACGACAACGGAAAGCCCTATGTGCTCTCTAGTGTGAGGAAGGCAGAGGCCCAGATTGCTGCAAAAAATTTGGACAAGGAATACCTGCCCATTGCGGGACTGGCTGAATTTTGCAAGGCATCTGCAGAACTAGCCCTGGGTGAGAACAGCGAGGTGTTGAAAAGTGGCCGGTTTGTCACCGTGCAGACCATTTCTGGAACTGGAGCCTTAAGGATCGGAGCCAGCTTTCTGCAAAGATTTTTTAAGTTCAGCCAAAATGTTTACCTGCCCAAGCCAACCTGGGGAAATCACACACCCATCTTCAGGGATGCTGGCATGCAGCTCCAAGGCTATCGATATTATGACCCCAAGACTTGCGGTTTTGACTTCACTGGTGCCATTGAGGACATTTCAAAAATACCGGAGCAAAGCGTTATTCTCCTGCATGCCTGTGCCCACAATCCCACTGGAGTGGACCCTCGCCAAGAGCAGTGGAAGGAAATAGCATTAGTGATAAAGAAAAGGAATCTTTTTGCGTTCTTTGACATGGCCTACCAAGGCTTCGCCAGCGGTGATGGTAACAGGGATGCCTGGGCTGTGCGCCACTTCATCGAACAGGGCATTAATGTTTGCCTCTGCCAGTCATACGCCAAGAACATGGGCTTATATGGAGAGCGTGTGGGAGCCTTCACTATGATCTGCAAAGATGCAGATGAAGCCAAAAGGGTAGAGTCGCAGTTGAAGATCTTGATCCGTCCCATGTATTCCAACCCTCCTCTCAATGGGGCCCGGATTGCCTCTACCATTCTGACTTCCCCGGACTTACGAAAGCAATGGTTGCAAGAAGTGAAAGGCATGGCCGACCGCATCATTAGCATGCGCACCCAGCTGGTCTCCAACCTCAAGAAGGAAGGCTCCTCCCACAGCTGGCAGCACATCACTGACCAGATTGGAATGTTTTGTTTCACAGGCCTAAAGCCTGAGCAGGTAGAGCGGCTGACCAAGGAGTTCTCGATCTACATGACAAAGGACGGCCGCATCTCTGTGGCTGGGGTCACCTCTGGCAATGTGGGCTATCTTGCCCATGCCATTCATCAGGTCACGAAGTAA

XM_004843121.1 Coding sequence

Slc38a7 solute carrier family 38, member 7, transcript variant X1

Length: 1392 bp    Location: 27596079..27608704   Strand: +
>XM_004843121.1
ATGGCCCAGGTCAGCATCAACAGTGACTACAGCGAGTGGGGCCCCAGCACAGATGCTGGGGAGCGGGCTCGTCTGCTGCAGAGTCCCTGTGTGGACATGGTCCCCAAGAGTGAGGGTGACGCCTTTCCTGGGGGCCCTGACAGAGGCACCACTTCCACGCTTGGGGCCATCTTCATCGTCGTCAATGCCTGCCTGGGCGCAGGACTGCTCAACTTCCCAGCAGCCTTCAGCACTGCAGGGGGCGTGACAGCTGGTGTCATGCTGCAAATGGGCATGCTGGTTTTCATCATCAGTGGCCTCGTCATCCTGGCCTACTGCTCCCAGGCCAGCAATGAGAGGACCTACCAGGAGGTGGTGTGGGCCGTGTGTGGCAAGCTGACAGGTGTGCTGTGTGAGGTGGCCATCGCCACCTACACCTTCGGCACCTGCATTGCTTTCCTCATCATCATTGGCGACCAGCAAGACAAGATTATAGCGGTGATGGCAAAGGAGCCTGAGGAGGCCATCAGCAGCCCCTGGTACACAGACCGAAAGTTCACCATCAGCCTCACTGCCTTCATGTTCATCCTGCCCCTCTCCATCCCCAGGGAGATTGGCTTCCAGAAATATGCCAGCTTCCTGAGCGTCGTGGGCACCTGGTATGTCACTGCCATCGTTATCATCAAATACATCTGGCCAGATAAAGAGATGACCCCAGGGGACATCCTAACCAGGCCAGCTTCCTGGATGGCTGTGTTCAATGCCATGCCCACCATCTGCTTTGGATTTCAGTGCCACGTGAGCAGTGTGCCCGTCTTCAACAGCATGCAGCAGCCTGAGGTGAAGACCTGGGGCGGGGTGGTGACCGCTGCCATGGTCATAGCCCTGGCTGTCTACATGGGCACAGGCATCTGTGGGTTCCTGACCTTTGGAGCTGCTGTGGACCCCGACGTGCTCCTGTCCTATCCCTCAGAGGACGTAGCAGTGGCTGTGGCCCGAGCCTTCATCATCCTGAGTGTGCTCACCTCTTACCCCATCCTGCACTTCTGTGGACGGGCGGTGGTCGAAGGCCTGTGGCTGCGCTACCAGGGGATGCCAGTGGAGGAGGACGTGGGGCGGGAGCGGCGGCGACGAGTGCTGCAGACGCTGGTGTGGTTCCTGCTCACCCTGCTGCTGGCGCTCTTCATCCCTGACATCGGCAAGGTCATCGCAGTCATCGGAGGCCTGGCTGCCTGCTTCATCTTCATCTTCCCAGGGCTGTGCCTCATTCAAGCCAAACTCTCTGAGATGGAAGAGGTGAAACCAGCCAGCTGGTGGGCATTGGTCAGTTATGGAGTTCTCTTGGTCACTCTGGGAGCCTTCATCTTCGGCCAGACTACAGCCAACGCCATCTTTGTGGATCTCTTGGGATAA

XM_004843118.1 Coding sequence

Cdh8 cadherin 8, type 2, transcript variant X4

Length: 2136 bp    Location: 24348626..24733570   Strand: +
>XM_004843118.1
ATGCCAGAACGGCTAGCAGAAATGCTCTTGGATCTCTGGACTCCATTAATAATATTATGGATTACTCTCCCCCCTTGCATTTACATGGCTCCAATGAATCAGTCTCAAGTTTTAATGAGTGGATCCCCTTTGGAACTAAACAGCCTGAGTGAAGAACAGCGGATTTTGAGCCGCTCCAAAAGAGGCTGGGTTTGGAATCAAATGTTTGTCCTGGAAGAATTTTCTGGACCTGAACCGATTCTTGTTGGCCGGCTACACACAGACTTGGACCCTGGAAGCAAAAAAATCAAGTATATCCTATCAGGTGATGGAGCTGGGACAATCTTTCAAATAAACGATATAACTGGAGATATCCATGCTATTAAGAGACTTGACCGAGAGGAAAAGGCTGAATACACCCTGACAGCTCAGGCAGTAGACTGGGAGACGAACAAACCTCTTGAGCCTCCTTCTGAGTTTATTATTAAAGTTCAAGACATCAACGACAATGCACCTGAGTTTCTTAATGGACCCTATCATGCTACTGTGCCAGAGATGTCCATTTTGGGTACGTCTGTCACTAATGTCACAGCTACGGATGCTGACGACCCAGTTTATGGAAACAGTGCAAAGTTGGTTTATAGTATCTTGGAAGGGCAGCCTTATTTTTCCATTGAGCCGGAAACAGCTATTATAAAAACTGCCCTTCCCAACATGGACAGAGAAGCCAAGGAAGAATACCTTGTTGTTATTCAAGCCAAAGATATGGGTGGGCACTCTGGTGGCCTCTCTGGGACCACAACCCTCACAGTGACTCTTAGTGACGTTAACGACAACCCTCCAAAGTTTGCACAGAGTCTGTATCACTTCTCAGTACCAGAAGATGTGATTCTTGGTACTGCAATAGGAAGGGTCAAGGCCAATGACCAGGATATTGGTGAAAATGCTCAGTCATCATATGACATCATTGATGGAGATGGAACAGCACTCTTTGAAATCACTTCTGATGCCCAGGCCCAGGATGGCATCATAAGACTAAGAAAGCCTCTGGACTTTGAGACCAAAAAATCCTATACGTTGAAATTAGAGGCAGCCAATGTCCACACTGACCCACGTTTCAGCAGCAGGGGACCCTTTAAAGATACAGCAACAGTAAAAATTGTTGTTGAAGATGCTGATGAGCCTCCTGTCTTCTCTTCACCAACTTACCTTCTTGAAGTTCATGAAAATGCTGCTCTGAACTCTGTCATTGGGCAAGTGACTGCTCGTGATCCTGACATCACTGCTAGTCCTATAAGGTTTTCCATCGACCGTCACACTGACCTGGAGAGACAATTCAATATTAATGCAGATGATGGAAAGTTAACACTGGCAACTCCACTTGACAGAGAATTAAGTGTGTGGCACAACATAACAATCATTGCAACTGAAATCAGGAACCACAGTCAGATATCACGAGTACCTGTTGCTATTAAAGTCCTGGATGTCAATGACAACGCCCCTGAATTCGCATCCGAATATGAGGCATTTTTATGTGAAAATGGAAAACCCGGCCAAGTCATTCAAACGGTAAGCGCCATGGACAAAGATGAACCCAAAAATGGACATTATTTCTTATACAGTCTTCTTCCTGAAATGGTCAACAATCCAAATTTCACCATCAAGAAAAATGAAGATAATTCTCTCAGCATTTTGGCAAAGCATAATGGATTCAACCGCCAGAAGCAAGAAGTCTATCTTTTACCAATCATAATCAGTGATAGTGGGAATCCTCCACTTAGCAGCACCAGCACTCTAACCATCCGGGTCTGTGGCTGCAGCAATGATGGTGTTGTCCAGTCTTGTAATGTTGAAGCTTATGTCCTTCCCATTGGACTTAGTATGGGCGCCTTAATTGCCATATTAGCGTGCATCATTTTGTTGCTAGTCATTGTGGTGCTGTTTGTAACTCTGAGGAGACACAAAAATGAACCATTGATTATCAAAGATGATGAAGATGTTCGAGAAAACATCATTCGCTATGATGACGAAGGAGGAGGGGAGGAGGACACAGAGGCTTTTGACATTGCAACTTTACAAAACCCAGATGGAATTAATGGATTTTTACCCCATTACAGAAGAGGGTTGCTAGGAGGAATATCACAGGATGCTGCCTGA

XM_004843111.1 Coding sequence

Cdh5 cadherin 5, type 2 (vascular endothelium), transcript variant X1

Length: 2352 bp    Location: 20064198..20031732   Strand: -
>XM_004843111.1
ATGCTGACCACTGCTTTAGGCACCTACATGGGCCTGTTGGTGGCAGCATCAGTGGCAGGCTGTGACCCTACCCAACTGGACACCCTCAGCCTCCCATGCATCCACAGGCGCCAGAAGAGAGACTGGATTTGGAACCAGATGCATGTTGATGAAGAGAAAACTGATCCTTTACCCTATTATGTGGGCAAGCTCAAGTCGAGTGTGAACCGCAAGAACGCCACGTATGTGCTCAAAGGAGAGGCCGCTAACAGCATTTTCCAGGTCAATGCAGACACAGGGGATGTGTATGCTTTTGCGAGGCTCGACCGGGAGAAGGTCTCCGAGTACTCCCTCGTTGCCCTCATTGTGGACAAAGACACTAACAAAAACCTGGAGCCTCCTTCCAACTTCACTATCAAAGTTCATGACATAAATGACAACTGGCCTGTGTTCACCCATCGGTTGTTCAATGCCTCGGTGCTCGAGATGTCACCTGGGGGGACCTCAGTCATGCGTTTAACAGCAGTGGATGCAGATGACCCCACTGTGGCAGACCACGCCACTGTTATGTACCAAATCCTGAAGGGGGGTGAGAATTTTGCCATCGACAATTCAGGATTAATTTCCACTGCAAAGCAAAACTTGGATCGAGAGGTACAGGCCAGCTATGAGATCGTGGTGGAAGCACGAGATGCCGAGGGCCTCCAAGGAGAATCAGGCACAGCCACCGTGCTGATCACTCTGCAAGATGTCAATGACAACTTCCCCATCTTCGCTCAGCCAGCCATGTACACATTTGTGGTGCCTGAAGACATCCGCGTGGGCAGCTCTGTAGGTTCTCTTTTTGTTGAGGACCCAGATGAGCCTCAGAACCGGAAGACCAAGTTTGACATCGTGCAGGGCGAGTACAGAGACACCTTCACTATCGACACGGATCCTACCCGCAATGAGGGCATCATCAAGCCCATGAAGCCCCTGGACTATGAGCTCATCCAAAAATACTCATTCGTCGTCGAGGCCACAGACCCTACTATCAACCTTGGATACCTGAGAGGCATCACGGGCAAAAACAAAGCCCGTGTCGTCATCAATATCTTGGATGTGGATGAGCCTCCTGTCTTCCAGAAGCGCTTCTATCACTTCCTGTTGAACGAGAACCAGAAGAAAAATCTAATAGGTTCAGTGCTAGCCAAGGACCCTGACAAGGCTGGGCGTAATATTGGATACTCCATCCGCAAGACTAGTGACAAGGGCCAATTCTTCCGAATAACCAAGCAGGGTGACATTCACTGTGAGAAAGAACTGGACAGAGAAATCTACCCCTGGCACAACTTGACTGTGGAGGCCAATGAGCTAGATCCTAATGGGAACCCCACAGGCAAAGAATCTATTGTCCAGGTGCACATTGAAGTTTTGGATGAGAATGACAATGCCCCAGAGTTTGCTCAACCCTATGAGCCCAAAGTGTGTGAAAATGCAGCCCAGGGCAAGCTGGTTGTGCAGATCTCTGCAGTAGACAAGGACATAACGCCACAAAATGTCAAGTTCAAGTTTGCCCTGGGGACTGATGACAGCAACTTCACCCTCATAGACAATCACGATAACACAGCCAACATCACAGTCAAGTATGGGCCGTTTGACCGGGAGCATGCCAAGTTCTACTACCTGCCTGTGCTCATCTCGGACAACGGGTCCCCAAGCCTGACGGGTACCAGCACGCTGACCGTGGTTGTGTGCAAGTGCAACCAGCAGGGCACGTTCACCTTCTGTGAGGAGGCAGTCGCCCAGGCAGGCGTCAGCATCCAGGCACTAGTGGCCATCTTCCTCTGCATCCTCACCATCACAGTGATCACCCTGCTCTTCTTCCTGCGGAGGCGGCTGCGGAAGCAGGCCCGCGCCCACGGCAAGGGCGTGACCGAGATCCACGAGCAGCTGGTCACCTACGACGAGGAGGGCGGCGGCGAGATGGACACCACCTGCTACGACGTGTCCGTGCTCAACTCGGCGCGGTCGGGCGCGGCCAAGCCCTTGCGGTCCGTGTTGGACGCGCGGCAGCCCATCTACGCCAAGGCACAGAAGCCACCGCGGGTGGCGCCAGGGGTGATGCCCGGAGTGCACGGCGGGCCCGGGGAGATGGCCGCAATGATCGAGGTGAAGAAGGACGAGGCAGACCACGACGGCGGCGGCCCGCCCTATGATACCCTGCATATCTACGACTACGAGGGTTCTGAGTCCATCGCCGAGTCGCTCAGCTCCCTAGGCACCGATTCGACCAACTCTGACATCGATTACGACTTTCTCAACGACTGGGGGCCCAGGTTCAAGATGCTGGCCGAGCTGTACTCCAACCCCTGGGATGATCTGGTATATTAG

XM_004843113.1 Coding sequence

Cdh11 cadherin 11, type 2, OB-cadherin (osteoblast), transcript variant X1

Length: 2391 bp    Location: 21345400..21502249   Strand: +
>XM_004843113.1
ATGAAGGAGAACTATTGTTTACAAGCTGCCCTGGTGTGCCTGAGCATGCTGTGCCACAGCCAGGCATTTGCCCTTGAGCGACGAAGCCACCTGCATCCCTCATTCCATGGGCACCAAGAGAGAGGCAAGGAAGGGCAGGTGCTGCAGCGCTCTAAGAGAGGCTGGGTCTGGAACCAATTCTTCGTGATAGAGGAGTACACTGGGCCTGATCCTGTGCTTGTGGGCAGGCTGCATTCTGATCTTGACACTGGTGATGGGAAGATTAAATACATTCTCTCAGGTGAAGGAGCTGGAACCATTTTTGTGATTGATGACAAATCAGGGAACATTCATGCCACCAAGACGTTGGACCGGGAGGAAAAAGCCCAGTATACACTGATGGCTCAAGCGGTGGACAGGGAAACAAACCGACCACTGGAGCCAGCTTCCTCATTCATTGTCAAGGTCCAGGACATTAATGACAACCCACCGGAGTTTCTACATGAGATCTATTATGCCAACGTGCCTGAAAGGTCCAATGTGGGAACATCGGTGATCCAGGTAACAGCTTCTGATGCAGATGACCCCACCTATGGAAATAGTGCCAAGTTAGTGTACAGTATCCTTGAAGGACAACCTTACTTTTCAGTGGAGGCACAGACAGGTATCATTAGAACAGCTCTCCCCAACATGGACAGAGAAGCCAAGGAGGAATACCATGTGGTAATCCAGGCCAAGGACATGGGTGGACATATGGGTGGACTCTCAGGAACTACCAAAGTGATGATCACTCTGACCGATGTCAATGACAACCCACCAAAGTTTCCTCAGAGCGTATACCAGATGTCTGTGTCAGAAGCAGCTGTCCCTGGGGAGGAAGTAGGAAGAATGAAAGCTAAAGACCCAGACATTGGAGAAAATGGCTTAGTCACATACAATATTGTTGATGGAGATGGTATGGAACTGTTTGAAATCACAACAGACTATGAAACACAGGAGGGTGTGGTGAAGCTGAAAAAGCCTGTAGATTTTGAAACCAAAAGAGCATATAGTTTGAAAGTAGAGGCAGCCAATGTGCACTTCGACCCAAAGTTCATCAGTAATGGACCTTTCAAGGACACTGTCACAGTCAAGATCGCTGTTGAAGATGTTGACGAGCCCCCCATGTTCTTGGCTCCAAGTTATATCCATGAAGTCCAAGAAAATGCAGCCCCTGGCACTGTGGTTGGGAGAGTGCATGCCAAAGACCCTGATGCTGCCAACAGTCCAATAAGGTATTCAATTGATCGTCATACTGACCTCGACAGGTTTTTCACTATTAATCTAGAGGATGGTTTTATTAAAACCACAAAACCTCTGGATAGAGAAGAAACTGCCTGGCTCAACATCTCTGTCTTTGCAGCAGAAATCCACAACCGACATCAGGAAGCCAAAGTCCCAGTGGCCATTAGAGTGCTTGATGTCAATGATAATGCTCCCAAGTTTGCTGCCCCCTATGAAGGCTTCATCTGTGAGAGTGATCAGACCAAACCACTTTCCAACCAGCCAATTGTTACAATTAGTGCAGATGACAAGGATGACACAGCCAATGGACCAAGATTTATCTTCAGCCTACCCCCTGAAATCATTCACAATCCAAATTTCACAGTCAGAGACAACAGAGATAACACAGCAGGAGTGTATGCCCGGCGAGGAGGGTTCAGTCGGCAGAAGCAGGACTTATACCTCCTGCCCATAGTGATCAGCGATGGAGGCATTCCGCCCATGAGTAGTACCAACACCCTCACCATCAAAGTCTGCGGGTGTGACATGAATGGGGTGCTGCTCTCCTGTAATGCTGAGGCGTACATCCTGAATGCTGGTCTAAGCACAGGGGCGCTCATCGCCATCCTCGCCTGCATCGTCATTCTCCTGGTCATTGTAGTTTTGTTTGTGACCCTGAGAAGACAAAAGAAAGAACCACTCATTGTTTTTGAGGAGGAAGATGTCCGTGAGAACATCATTACCTATGATGATGAAGGGGGTGGTGAGGAAGACACAGAAGCCTTTGATATCGCCACCCTCCAGAACCCAGATGGTATCAATGGATTTATTCCCCGCAAAGACATCAAACCTGAGTACCAGTACATGCCTAGACCTGGGCTCCGGCCAGCACCCAACAGCGTGGATGTGGATGACTTCATCAACACTAGGATACAGGAGGCAGACAATGATCCCACCGCCCCTCCCTATGACTCCATCCAAATCTATGGCTACGAAGGCAGGGGCTCAGTGGCTGGGTCCCTGAGCTCCTTAGAGTCTGCAACCACAGATTCAGACTTGGACTATGACTATCTACAGAACTGGGGACCTCGTTTTAAGAAATTAGCAGACTTGTATGGTTCCAAAGACACTTTTGATGATGATTCTTAA

XM_004843115.1 Coding sequence

Cdh8 cadherin 8, type 2, transcript variant X1

Length: 2400 bp    Location: 24348626..24728222   Strand: +
>XM_004843115.1
ATGCCAGAACGGCTAGCAGAAATGCTCTTGGATCTCTGGACTCCATTAATAATATTATGGATTACTCTCCCCCCTTGCATTTACATGGCTCCAATGAATCAGTCTCAAGTTTTAATGAGTGGATCCCCTTTGGAACTAAACAGCCTGAGTGAAGAACAGCGGATTTTGAGCCGCTCCAAAAGAGGCTGGGTTTGGAATCAAATGTTTGTCCTGGAAGAATTTTCTGGACCTGAACCGATTCTTGTTGGCCGGCTACACACAGACTTGGACCCTGGAAGCAAAAAAATCAAGTATATCCTATCAGGTGATGGAGCTGGGACAATCTTTCAAATAAACGATATAACTGGAGATATCCATGCTATTAAGAGACTTGACCGAGAGGAAAAGGCTGAATACACCCTGACAGCTCAGGCAGTAGACTGGGAGACGAACAAACCTCTTGAGCCTCCTTCTGAGTTTATTATTAAAGTTCAAGACATCAACGACAATGCACCTGAGTTTCTTAATGGACCCTATCATGCTACTGTGCCAGAGATGTCCATTTTGGGTACGTCTGTCACTAATGTCACAGCTACGGATGCTGACGACCCAGTTTATGGAAACAGTGCAAAGTTGGTTTATAGTATCTTGGAAGGGCAGCCTTATTTTTCCATTGAGCCGGAAACAGCTATTATAAAAACTGCCCTTCCCAACATGGACAGAGAAGCCAAGGAAGAATACCTTGTTGTTATTCAAGCCAAAGATATGGGTGGGCACTCTGGTGGCCTCTCTGGGACCACAACCCTCACAGTGACTCTTAGTGACGTTAACGACAACCCTCCAAAGTTTGCACAGAGTCTGTATCACTTCTCAGTACCAGAAGATGTGATTCTTGGTACTGCAATAGGAAGGGTCAAGGCCAATGACCAGGATATTGGTGAAAATGCTCAGTCATCATATGACATCATTGATGGAGATGGAACAGCACTCTTTGAAATCACTTCTGATGCCCAGGCCCAGGATGGCATCATAAGACTAAGAAAGCCTCTGGACTTTGAGACCAAAAAATCCTATACGTTGAAATTAGAGGCAGCCAATGTCCACACTGACCCACGTTTCAGCAGCAGGGGACCCTTTAAAGATACAGCAACAGTAAAAATTGTTGTTGAAGATGCTGATGAGCCTCCTGTCTTCTCTTCACCAACTTACCTTCTTGAAGTTCATGAAAATGCTGCTCTGAACTCTGTCATTGGGCAAGTGACTGCTCGTGATCCTGACATCACTGCTAGTCCTATAAGGTTTTCCATCGACCGTCACACTGACCTGGAGAGACAATTCAATATTAATGCAGATGATGGAAAGTTAACACTGGCAACTCCACTTGACAGAGAATTAAGTGTGTGGCACAACATAACAATCATTGCAACTGAAATCAGGAACCACAGTCAGATATCACGAGTACCTGTTGCTATTAAAGTCCTGGATGTCAATGACAACGCCCCTGAATTCGCATCCGAATATGAGGCATTTTTATGTGAAAATGGAAAACCCGGCCAAGTCATTCAAACGGTAAGCGCCATGGACAAAGATGAACCCAAAAATGGACATTATTTCTTATACAGTCTTCTTCCTGAAATGGTCAACAATCCAAATTTCACCATCAAGAAAAATGAAGATAATTCTCTCAGCATTTTGGCAAAGCATAATGGATTCAACCGCCAGAAGCAAGAAGTCTATCTTTTACCAATCATAATCAGTGATAGTGGGAATCCTCCACTTAGCAGCACCAGCACTCTAACCATCCGGGTCTGTGGCTGCAGCAATGATGGTGTTGTCCAGTCTTGTAATGTTGAAGCTTATGTCCTTCCCATTGGACTTAGTATGGGCGCCTTAATTGCCATATTAGCGTGCATCATTTTGTTGCTAGTCATTGTGGTGCTGTTTGTAACTCTGAGGAGACACAAAAATGAACCATTGATTATCAAAGATGATGAAGATGTTCGAGAAAACATCATTCGCTATGATGACGAAGGAGGAGGGGAGGAGGACACAGAGGCTTTTGACATTGCAACTTTACAAAACCCAGATGGAATTAATGGATTTTTACCCCGTAAGGATATTAAACCAGATTTGCAGTTTATGCCAAGGCAAGGGCTTGCACCAGTTCCAAATGGTGTTGATGTCGATGAATTTATAAATGTAAGGCTGCATGAGGCAGATAATGACCCCACGGCCCCACCATATGACTCCATTCAAATTTATGGCTATGAAGGCCGAGGGTCTGTGGCTGGCTCTCTCAGCTCCTTGGAGTCCACCACATCAGACTCAGACCAGAATTTTGACTACCTCAGTGACTGGGGTCCCCGCTTTAAGAGACTGGGCGAACTCTACTCTGTTGGTGAAAGTGACAAAGAAACTTGA

XM_004843116.1 Coding sequence

Cdh8 cadherin 8, type 2, transcript variant X2

Length: 2400 bp    Location: 24350514..24728222   Strand: +
>XM_004843116.1
ATGCCAGAACGGCTAGCAGAAATGCTCTTGGATCTCTGGACTCCATTAATAATATTATGGATTACTCTCCCCCCTTGCATTTACATGGCTCCAATGAATCAGTCTCAAGTTTTAATGAGTGGATCCCCTTTGGAACTAAACAGCCTGAGTGAAGAACAGCGGATTTTGAGCCGCTCCAAAAGAGGCTGGGTTTGGAATCAAATGTTTGTCCTGGAAGAATTTTCTGGACCTGAACCGATTCTTGTTGGCCGGCTACACACAGACTTGGACCCTGGAAGCAAAAAAATCAAGTATATCCTATCAGGTGATGGAGCTGGGACAATCTTTCAAATAAACGATATAACTGGAGATATCCATGCTATTAAGAGACTTGACCGAGAGGAAAAGGCTGAATACACCCTGACAGCTCAGGCAGTAGACTGGGAGACGAACAAACCTCTTGAGCCTCCTTCTGAGTTTATTATTAAAGTTCAAGACATCAACGACAATGCACCTGAGTTTCTTAATGGACCCTATCATGCTACTGTGCCAGAGATGTCCATTTTGGGTACGTCTGTCACTAATGTCACAGCTACGGATGCTGACGACCCAGTTTATGGAAACAGTGCAAAGTTGGTTTATAGTATCTTGGAAGGGCAGCCTTATTTTTCCATTGAGCCGGAAACAGCTATTATAAAAACTGCCCTTCCCAACATGGACAGAGAAGCCAAGGAAGAATACCTTGTTGTTATTCAAGCCAAAGATATGGGTGGGCACTCTGGTGGCCTCTCTGGGACCACAACCCTCACAGTGACTCTTAGTGACGTTAACGACAACCCTCCAAAGTTTGCACAGAGTCTGTATCACTTCTCAGTACCAGAAGATGTGATTCTTGGTACTGCAATAGGAAGGGTCAAGGCCAATGACCAGGATATTGGTGAAAATGCTCAGTCATCATATGACATCATTGATGGAGATGGAACAGCACTCTTTGAAATCACTTCTGATGCCCAGGCCCAGGATGGCATCATAAGACTAAGAAAGCCTCTGGACTTTGAGACCAAAAAATCCTATACGTTGAAATTAGAGGCAGCCAATGTCCACACTGACCCACGTTTCAGCAGCAGGGGACCCTTTAAAGATACAGCAACAGTAAAAATTGTTGTTGAAGATGCTGATGAGCCTCCTGTCTTCTCTTCACCAACTTACCTTCTTGAAGTTCATGAAAATGCTGCTCTGAACTCTGTCATTGGGCAAGTGACTGCTCGTGATCCTGACATCACTGCTAGTCCTATAAGGTTTTCCATCGACCGTCACACTGACCTGGAGAGACAATTCAATATTAATGCAGATGATGGAAAGTTAACACTGGCAACTCCACTTGACAGAGAATTAAGTGTGTGGCACAACATAACAATCATTGCAACTGAAATCAGGAACCACAGTCAGATATCACGAGTACCTGTTGCTATTAAAGTCCTGGATGTCAATGACAACGCCCCTGAATTCGCATCCGAATATGAGGCATTTTTATGTGAAAATGGAAAACCCGGCCAAGTCATTCAAACGGTAAGCGCCATGGACAAAGATGAACCCAAAAATGGACATTATTTCTTATACAGTCTTCTTCCTGAAATGGTCAACAATCCAAATTTCACCATCAAGAAAAATGAAGATAATTCTCTCAGCATTTTGGCAAAGCATAATGGATTCAACCGCCAGAAGCAAGAAGTCTATCTTTTACCAATCATAATCAGTGATAGTGGGAATCCTCCACTTAGCAGCACCAGCACTCTAACCATCCGGGTCTGTGGCTGCAGCAATGATGGTGTTGTCCAGTCTTGTAATGTTGAAGCTTATGTCCTTCCCATTGGACTTAGTATGGGCGCCTTAATTGCCATATTAGCGTGCATCATTTTGTTGCTAGTCATTGTGGTGCTGTTTGTAACTCTGAGGAGACACAAAAATGAACCATTGATTATCAAAGATGATGAAGATGTTCGAGAAAACATCATTCGCTATGATGACGAAGGAGGAGGGGAGGAGGACACAGAGGCTTTTGACATTGCAACTTTACAAAACCCAGATGGAATTAATGGATTTTTACCCCGTAAGGATATTAAACCAGATTTGCAGTTTATGCCAAGGCAAGGGCTTGCACCAGTTCCAAATGGTGTTGATGTCGATGAATTTATAAATGTAAGGCTGCATGAGGCAGATAATGACCCCACGGCCCCACCATATGACTCCATTCAAATTTATGGCTATGAAGGCCGAGGGTCTGTGGCTGGCTCTCTCAGCTCCTTGGAGTCCACCACATCAGACTCAGACCAGAATTTTGACTACCTCAGTGACTGGGGTCCCCGCTTTAAGAGACTGGGCGAACTCTACTCTGTTGGTGAAAGTGACAAAGAAACTTGA

XM_004843098.1 Coding sequence

Ca7 carbonic anhydrase VII, transcript variant X2

Length: 723 bp    Location: 19648615..19640463   Strand: -
>XM_004843098.1
ATGACTGGCTGGGGCTACGGCCAGGACGACGGTCCCTCAAATTGGCACAAGCTGTATCCCATCGCCCAGGGAGACCGTCAATCACCCATCAATATCATATCCAGCCAGGCTGTGTACTCGCCCAGCCTGCAGCCACTGGAGCTTTCCTATGAGGCCTGCACGTCCCTCAGCATCACCAACAATGGCCACTCTGTCCAAGTAGACTTCAATGACAGTGATGACCGAACTGTGGTGACTGGGGGTCCCCTGGAAGGGCCCTACCGCCTCAAGCAGTTCCACTTCCACTGGGGCAAGAAGCGTGATGTGGGCTCGGAGCACACGGTGGATGGCAAGTCATTCCCCAGCGAGCTGCATTTGGTTCACTGGAATGCCAAGAAGTACAGCACCTTTGGGGAGGCCGCCTCAGCACCTGATGGTCTGGCTGTGGTCGGTGTCTTCCTGGAGGGCACCAGGGCCCAGTTTAGCTGCTTCAACCCCAAGTGCCTCCTGCCTGCCAGCCGGCACTACTGGACCTATCCAGGCTCCCTGACCACACCCCCCCTCAATGAGAGTGTCACCTGGATTGTGCTCTGTGAGCCCATCAGTATCTCTGAGAGGCAGATGGAGAAGTTCCGGAGCCTGCTTTTCACCTCAGAGGATGATGAGAGGATCCACATGGTGAACAACTTTCGGCCACCACAACCACTGAAAGGCCGTGTGGTCAAAGCCTCCTTCCGGGCCTAA

XM_004843097.1 Coding sequence

Ca7 carbonic anhydrase VII, transcript variant X1

Length: 786 bp    Location: 19648615..19640463   Strand: -
>XM_004843097.1
ATGACTGGCTGGGGCTACGGCCAGGACGACGGTCCCTCAAATTGGCACAAGCTGTATCCCATCGCCCAGGGAGACCGTCAATCACCCATCAATATCATATCCAGCCAGGCTGTGTACTCGCCCAGCCTGCAGCCACTGGAGCTTTCCTATGAGGCCTGCACGTCCCTCAGCATCACCAACAATGGCCACTCTGTCCAAGTAGACTTCAATGACAGTGATGACCGAACTGTGGTGACTGGGGGTCCCCTGGAAGGGCCCTACCGCCTCAAGCAGTTCCACTTCCACTGGGGCAAGAAGCGTGATGTGGGCTCGGAGCACACGGTGGATGGCAAGTCATTCCCCAGCGAGCTGCATTTGGTTCACTGGAATGCCAAGAAGTACAGCACCTTTGGGGAGGCCGCCTCAGCACCTGATGGTCTGGCTGTGGTCGGTGTCTTCCTGGAGACGGGGGATGAGCACCCCAGCATGAACCGCCTGACAGATGCGCTCTACATGGTTCGGTTTAAGGGCACCAGGGCCCAGTTTAGCTGCTTCAACCCCAAGTGCCTCCTGCCTGCCAGCCGGCACTACTGGACCTATCCAGGCTCCCTGACCACACCCCCCCTCAATGAGAGTGTCACCTGGATTGTGCTCTGTGAGCCCATCAGTATCTCTGAGAGGCAGATGGAGAAGTTCCGGAGCCTGCTTTTCACCTCAGAGGATGATGAGAGGATCCACATGGTGAACAACTTTCGGCCACCACAACCACTGAAAGGCCGTGTGGTCAAAGCCTCCTTCCGGGCCTAA

XM_004843096.1 Coding sequence

Nae1 NEDD8 activating enzyme E1 subunit 1, transcript variant X4

Length: 1338 bp    Location: 19659048..19687884   Strand: +
>XM_004843096.1
ATGGAGTTCTTACAGGAACTAAATAATGATGTCTCTGGAAGTTTTGTGGAAGAGAGTCCAGAAAACCTTCTAGACAATGATCCTTCATTTTTCTGTAGGTTTACTGTTGTGGTTGCAACTCAGCTTCCTGAAAGTACGTTGCTACGTTTAGCAGATGTCCTCTGGAATTCCCAAATCCCTCTTTTGATCTGTAGGACATATGGACTGGTTGGTTATATGAGGATCATTATAAAAGAACATTCAGTAATAGAATCTCATCCAGATAATACATTAGAGGATCTACGACTGGATAAGCCATTTCCTGAACTGAAAGAACATTTTCAGTCTTATGATTTAGATCATATGGAAAAAAAGGACCATAGCCATACTCCATGGATTGTGATCGTAGCTAAATATTTAGCTCAGTGGTATAGTGAAACAAATGGACGAATTCCTAAAACCTATAAAGAAAAAGAAGACTTCAGAGATTTGATTAGACAAGGGATTTTGAAGACTGAAAGTGGAACTCCAGAAGATGAAGAGAATTTTGAAGAAGCTATTAAAAATGTGAACACAGCACTAAATACAACTCAGATTCCAAGCAATATTGAAGATATATTTAATGATGATCGCTGCATAAATATTACAAAACAGACTCCACCATTTTGGATTTTGGCTCGTGCCTTAAAGGAATTTGTAGCCAAAGAAGGTCAAGGAAATTTACCAGTTCGAGGCACCATTCCTGATATGATTGCAGATTCAGGCAAATATATAAAACTCCAAAATGTTTACCGTCAAAAAGCAAAGAAAGATGCTGCTGCTGTGGGCCATCATGTTGCCAAATTGTTGCAGTCCATTGGCCAGGCACCAGAATCCATTTCAGAGAAAGAATTAAAATTACTCTGTAGCAATTCTGCATTTCTTCGAGTGGTGAGATGTCGCTCCTTAGCTGAAGAATATGGTGTGAATACAATGAACAAGGACGAAATCATTTCCCGCATGGACAATCCAGATAATGAAATAGTATTGTACTTACTGTTACGGGCTGTTGATAGATTTCATAAACAACATGGTAGATATCCAGGGGTATCTAACTATCAAGTAGAAGAAGATATAGGAAAATTGAAGTCCTGTCTCACTGGCTTCCTTCAGGAATATGGATTATCTGTAATGGTGAAAGATGATTACGTCCATGAATTTTGCCGATATGGAGCTGCTGAGCCACACACCATTGCTGCATTCTTGGGGGGAGCTGCTGCTCAAGAGGTTATTAAAATAGTCACCAAACAATTTGTAATTTTTAATAATACCTACATTTATAGTGGCATGTCACAAACTTCTGCAACTTACCAGTTGTAG

XM_004843088.1 Coding sequence

Cdh16 cadherin 16, KSP-cadherin, transcript variant X8

Length: 2619 bp    Location: 19590594..19599728   Strand: +
>XM_004843088.1
ATGGTTCCTGCCTGGCTTTGGCTGCTTTGCTTCTCTATCCCCCAGGCTTTCCCTGAGGCCCAGCCTGCAGAACTGTCTGTGGAAGTCCCTGAGAACTATGGCGGAAATTTCCCTTTGTACTTGACCAAGCTGCCGCTGCCCCATGAGAAGCCTGAAGGGCAGATTGTGCTATCAGGGGACTCAGGCATACCAGCTGAAGGTCCCTTTGCTGTGGATTCAGACTCTGGCTTCCTGGTGGTGACCAGTGCCCTGGACAGGGAGGAACAGGCAGAATACAAGCTACAGGTCACCCTGGAGACTGGAGATGGATATGTCTTGTGGGGTCCACAGCCTGTGATTGTGCATGTGAAGGATGAGAACGATCAGGTGCCCCAGTTTTCCCAGACCATTTACAGAGCTCAGCTCAGCCAGGGCACCAGGCCTGGTATCCCCTTCCTCTTCCTTGAGGCTTCAGATGGGGATGCTCCAGGCACAGCCAACTCAGATCTTCAATTCCACGTCCTGAGCCAGACCCCAGCTCAGCCTTCATCAGACATGTTCCAGCTAGAGCCTCGGCGGGGAGCTCTGGCCCTCAGCCCCGAGGGGAGCACCAGCCTAGACCGTGCCCTGGAGGGGTCCTATCAACTATTGGTACAGGTCAAGGACATGGGTGACCAGGCCATAGGCCACCAGGCTACAGCCACCATAGAGGTCTCCATAGTACAGAGTACCTGGGTACCCCTAGAGCCCATCCACCTGGCAGAGAATCTCAAAGTCCCATACCCACACCCCATTGCCCAGGTACATTGGAGTGGGGGGAATGTGCACTATCACCTGGAGAGCCAACCCCCTGGACCATTTGATGTGGACGCAGATGGGAAACTCTATGTGACCATGGAGCTGGACCGAGAAGCCCAGGCTGAGTACCTGCTCCAGGCCTGGGCTCAGAATTCCCATGGTGAGGACTACGCAAAACCCCTGGAGTTTCATGTGGTGGTGACAGATGAGAACGACAATCCACCTGTCTGCCTCCCACGTGGTTCCTCAATCAGCATCCCTGAGCTCAGCGCCCCAGGCACTGAAGTGACTCAGCTGTTGGCAGAGGATGCAGATGCCCCTGGATCTCCCAATTCCCACATTGTGTATCAGCTTCTGACCCCTGAGCCCCAGAAGGGCGCTGAAGGGAGAGCCTTTGCCCTGGACCCCACCTCAGGCAGTGTGACTCTGGGCACTGTCCCCCTCCAAGCTGGCCAGGACATCCTCCTTCAGGTGCTGGCTATTGACCTAGCAGGAGCAGAGGAAGGGCTCAGCAGCATGTGTGAGGTCGAAATCACAATCACAGACATCAATGACCATGCCCCTGAGTTCACCATCTCCCAGATTGAGCCTGTAAGCCTCCCTGAGGATGTGGAGCCCGGTACTCTGGTGGCCACACTCATGGCCACTGATGCTGACCTTGAACCTGCCTTTCGCCTCATGGAGTTTGCCATTGAGGCAGGGGATAAGGAAGGGATTTTTGGCCTGGATTGGGAGCCAGGCTCTGACCATGTCCAACTCAAACTCCGCAAGAACCTCAGCTATGAGGCAATTCCCCACCACAAGGTGGTGGTGGTAGTGCGAAATGTGGAGAAACTGGTGGGCCCAGGCCCAGGCCCTGAAGCCACAGCCACAGTGACTGTGCTGGTGGAGAGGGTGATGCTGCCCCCTAAGTTGGACCAGGAAAACTATGAAGCCAGTGTCCCAATCAGTACACCAGCCGGCTCCCACCTGCTGACCATCCAGCCCTCAGATCCCATGAACAGAACCCTCAGGTTCTCCCTGGTCAATGACTCAGAGGGCTGGCTCTGCATCAAGGAGGTCTCTGGGGAAGTACACACAGCTCAGTCCCTGCAGGGCGCCCAACCTGGGGACACATACACGGTGCTTGTGGAAGCCCAGGATGCAGATGAGCCAAGACTGAGCGCCTCTGCTGCTCTAGTGGTCCACTTCCTGAAGCCCCCTCCTGCCCCAGCTCTGACTCTGGCACCCATGCCCACCCGATTCCTCTGCACACCCCGCCAGGACTACGGTGTGGTAGTCAGTGGACTCAGTGAGGATCCCAACCTGGCCAGTGTTCCCGGTCCCTACAGCTTTGCCCTTGGCCCAAACCCTACGGTGCAGCGGGATTGGCGCCTCCAGCCTCTCAATGATTCCCATGCCTACCTCATCCTGGCCCTGCATTGGGTAGAACCAGGTGAATATGAAGTTCCTGTGGTCGTCAGCCATAATGCCCACACATGGCAGCTCCTGGTCCAAGTGATTGTGTGTCGCTGCAATGTGGAGGGGCGGTGCTTGCGCAAGGTGGGCCGCATGAAGGGAATGCCCACGAAGCTGGTAGCCGTGGGCACCCTCCTGGGCACCCTGGCAGCAATAGATGAGGTCACTATGGCCCAGAGAGATTTACTGACTTGTCTGAGGTTATACAGCCAAGAGATAGCAGAGCCCAGGTCTTTCCAGTTTAATTCCTTCCATCCAAGCTACCCTCTCTATCCCTTTTATTTCTTTAGCCCCCTAAATTCTTCCCTTGCTGGTTCTAGCACAAAGCTATGCTATGCCTTTGTCTTGGAGGCCCATGGGAATAAGTCACTGGCTCTCAGATGA

XM_004843086.1 Coding sequence

Cdh16 cadherin 16, KSP-cadherin, transcript variant X6

Length: 2649 bp    Location: 19590594..19599728   Strand: +
>XM_004843086.1
ATGGCCATGTCTCTTAGGCCCACCCTGACCATGGTTCCTGCCTGGCTTTGGCTGCTTTGCTTCTCTATCCCCCAGGCTTTCCCTGAGGCCCAGCCTGCAGAACTGTCTGTGGAAGTCCCTGAGAACTATGGCGGAAATTTCCCTTTGTACTTGACCAAGCTGCCGCTGCCCCATGAGAAGCCTGAAGGGCAGATTGTGCTATCAGGGGACTCAGGCATACCAGCTGAAGGTCCCTTTGCTGTGGATTCAGACTCTGGCTTCCTGGTGGTGACCAGTGCCCTGGACAGGGAGGAACAGGCAGAATACAAGCTACAGGTCACCCTGGAGACTGGAGATGGATATGTCTTGTGGGGTCCACAGCCTGTGATTGTGCATGTGAAGGATGAGAACGATCAGGTGCCCCAGTTTTCCCAGACCATTTACAGAGCTCAGCTCAGCCAGGGCACCAGGCCTGGTATCCCCTTCCTCTTCCTTGAGGCTTCAGATGGGGATGCTCCAGGCACAGCCAACTCAGATCTTCAATTCCACGTCCTGAGCCAGACCCCAGCTCAGCCTTCATCAGACATGTTCCAGCTAGAGCCTCGGCGGGGAGCTCTGGCCCTCAGCCCCGAGGGGAGCACCAGCCTAGACCGTGCCCTGGAGGGGTCCTATCAACTATTGGTACAGGTCAAGGACATGGGTGACCAGGCCATAGGCCACCAGGCTACAGCCACCATAGAGGTCTCCATAGTACAGAGTACCTGGGTACCCCTAGAGCCCATCCACCTGGCAGAGAATCTCAAAGTCCCATACCCACACCCCATTGCCCAGGTACATTGGAGTGGGGGGAATGTGCACTATCACCTGGAGAGCCAACCCCCTGGACCATTTGATGTGGACGCAGATGGGAAACTCTATGTGACCATGGAGCTGGACCGAGAAGCCCAGGCTGAGTACCTGCTCCAGGCCTGGGCTCAGAATTCCCATGGTGAGGACTACGCAAAACCCCTGGAGTTTCATGTGGTGGTGACAGATGAGAACGACAATCCACCTGTCTGCCTCCCACGTGGTTCCTCAATCAGCATCCCTGAGCTCAGCGCCCCAGGCACTGAAGTGACTCAGCTGTTGGCAGAGGATGCAGATGCCCCTGGATCTCCCAATTCCCACATTGTGTATCAGCTTCTGACCCCTGAGCCCCAGAAGGGCGCTGAAGGGAGAGCCTTTGCCCTGGACCCCACCTCAGGCAGTGTGACTCTGGGCACTGTCCCCCTCCAAGCTGGCCAGGACATCCTCCTTCAGGTGCTGGCTATTGACCTAGCAGGAGCAGAGGAAGGGCTCAGCAGCATGTGTGAGGTCGAAATCACAATCACAGACATCAATGACCATGCCCCTGAGTTCACCATCTCCCAGATTGAGCCTGTAAGCCTCCCTGAGGATGTGGAGCCCGGTACTCTGGTGGCCACACTCATGGCCACTGATGCTGACCTTGAACCTGCCTTTCGCCTCATGGAGTTTGCCATTGAGGCAGGGGATAAGGAAGGGATTTTTGGCCTGGATTGGGAGCCAGGCTCTGACCATGTCCAACTCAAACTCCGCAAGAACCTCAGCTATGAGGCAATTCCCCACCACAAGGTGGTGGTGGTAGTGCGAAATGTGGAGAAACTGGTGGGCCCAGGCCCAGGCCCTGAAGCCACAGCCACAGTGACTGTGCTGGTGGAGAGGGTGATGCTGCCCCCTAAGTTGGACCAGGAAAACTATGAAGCCAGTGTCCCAATCAGTACACCAGCCGGCTCCCACCTGCTGACCATCCAGCCCTCAGATCCCATGAACAGAACCCTCAGGTTCTCCCTGGTCAATGACTCAGAGGGCTGGCTCTGCATCAAGGAGGTCTCTGGGGAAGTACACACAGCTCAGTCCCTGCAGGGCGCCCAACCTGGGGACACATACACGGTGCTTGTGGAAGCCCAGGATGCAGATGAGCCAAGACTGAGCGCCTCTGCTGCTCTAGTGGTCCACTTCCTGAAGCCCCCTCCTGCCCCAGCTCTGACTCTGGCACCCATGCCCACCCGATTCCTCTGCACACCCCGCCAGGACTACGGTGTGGTAGTCAGTGGACTCAGTGAGGATCCCAACCTGGCCAGTGTTCCCGGTCCCTACAGCTTTGCCCTTGGCCCAAACCCTACGGTGCAGCGGGATTGGCGCCTCCAGCCTCTCAATGATTCCCATGCCTACCTCATCCTGGCCCTGCATTGGGTAGAACCAGGTGAATATGAAGTTCCTGTGGTCGTCAGCCATAATGCCCACACATGGCAGCTCCTGGTCCAAGTGATTGTGTGTCGCTGCAATGTGGAGGGGCGGTGCTTGCGCAAGGTGGGCCGCATGAAGGGAATGCCCACGAAGCTGGTAGCCGTGGGCACCCTCCTGGGCACCCTGGCAGCAATAGATGAGGTCACTATGGCCCAGAGAGATTTACTGACTTGTCTGAGGTTATACAGCCAAGAGATAGCAGAGCCCAGGTCTTTCCAGTTTAATTCCTTCCATCCAAGCTACCCTCTCTATCCCTTTTATTTCTTTAGCCCCCTAAATTCTTCCCTTGCTGGTTCTAGCACAAAGCTATGCTATGCCTTTGTCTTGGAGGCCCATGGGAATAAGTCACTGGCTCTCAGATGA

XM_004843087.1 Coding sequence

Cdh16 cadherin 16, KSP-cadherin, transcript variant X7

Length: 2619 bp    Location: 19590594..19599728   Strand: +
>XM_004843087.1
ATGGTTCCTGCCTGGCTTTGGCTGCTTTGCTTCTCTATCCCCCAGGCTTTCCCTGAGGCCCAGCCTGCAGAACTGTCTGTGGAAGTCCCTGAGAACTATGGCGGAAATTTCCCTTTGTACTTGACCAAGCTGCCGCTGCCCCATGAGAAGCCTGAAGGGCAGATTGTGCTATCAGGGGACTCAGGCATACCAGCTGAAGGTCCCTTTGCTGTGGATTCAGACTCTGGCTTCCTGGTGGTGACCAGTGCCCTGGACAGGGAGGAACAGGCAGAATACAAGCTACAGGTCACCCTGGAGACTGGAGATGGATATGTCTTGTGGGGTCCACAGCCTGTGATTGTGCATGTGAAGGATGAGAACGATCAGGTGCCCCAGTTTTCCCAGACCATTTACAGAGCTCAGCTCAGCCAGGGCACCAGGCCTGGTATCCCCTTCCTCTTCCTTGAGGCTTCAGATGGGGATGCTCCAGGCACAGCCAACTCAGATCTTCAATTCCACGTCCTGAGCCAGACCCCAGCTCAGCCTTCATCAGACATGTTCCAGCTAGAGCCTCGGCGGGGAGCTCTGGCCCTCAGCCCCGAGGGGAGCACCAGCCTAGACCGTGCCCTGGAGGGGTCCTATCAACTATTGGTACAGGTCAAGGACATGGGTGACCAGGCCATAGGCCACCAGGCTACAGCCACCATAGAGGTCTCCATAGTACAGAGTACCTGGGTACCCCTAGAGCCCATCCACCTGGCAGAGAATCTCAAAGTCCCATACCCACACCCCATTGCCCAGGTACATTGGAGTGGGGGGAATGTGCACTATCACCTGGAGAGCCAACCCCCTGGACCATTTGATGTGGACGCAGATGGGAAACTCTATGTGACCATGGAGCTGGACCGAGAAGCCCAGGCTGAGTACCTGCTCCAGGCCTGGGCTCAGAATTCCCATGGTGAGGACTACGCAAAACCCCTGGAGTTTCATGTGGTGGTGACAGATGAGAACGACAATCCACCTGTCTGCCTCCCACGTGGTTCCTCAATCAGCATCCCTGAGCTCAGCGCCCCAGGCACTGAAGTGACTCAGCTGTTGGCAGAGGATGCAGATGCCCCTGGATCTCCCAATTCCCACATTGTGTATCAGCTTCTGACCCCTGAGCCCCAGAAGGGCGCTGAAGGGAGAGCCTTTGCCCTGGACCCCACCTCAGGCAGTGTGACTCTGGGCACTGTCCCCCTCCAAGCTGGCCAGGACATCCTCCTTCAGGTGCTGGCTATTGACCTAGCAGGAGCAGAGGAAGGGCTCAGCAGCATGTGTGAGGTCGAAATCACAATCACAGACATCAATGACCATGCCCCTGAGTTCACCATCTCCCAGATTGAGCCTGTAAGCCTCCCTGAGGATGTGGAGCCCGGTACTCTGGTGGCCACACTCATGGCCACTGATGCTGACCTTGAACCTGCCTTTCGCCTCATGGAGTTTGCCATTGAGGCAGGGGATAAGGAAGGGATTTTTGGCCTGGATTGGGAGCCAGGCTCTGACCATGTCCAACTCAAACTCCGCAAGAACCTCAGCTATGAGGCAATTCCCCACCACAAGGTGGTGGTGGTAGTGCGAAATGTGGAGAAACTGGTGGGCCCAGGCCCAGGCCCTGAAGCCACAGCCACAGTGACTGTGCTGGTGGAGAGGGTGATGCTGCCCCCTAAGTTGGACCAGGAAAACTATGAAGCCAGTGTCCCAATCAGTACACCAGCCGGCTCCCACCTGCTGACCATCCAGCCCTCAGATCCCATGAACAGAACCCTCAGGTTCTCCCTGGTCAATGACTCAGAGGGCTGGCTCTGCATCAAGGAGGTCTCTGGGGAAGTACACACAGCTCAGTCCCTGCAGGGCGCCCAACCTGGGGACACATACACGGTGCTTGTGGAAGCCCAGGATGCAGATGAGCCAAGACTGAGCGCCTCTGCTGCTCTAGTGGTCCACTTCCTGAAGCCCCCTCCTGCCCCAGCTCTGACTCTGGCACCCATGCCCACCCGATTCCTCTGCACACCCCGCCAGGACTACGGTGTGGTAGTCAGTGGACTCAGTGAGGATCCCAACCTGGCCAGTGTTCCCGGTCCCTACAGCTTTGCCCTTGGCCCAAACCCTACGGTGCAGCGGGATTGGCGCCTCCAGCCTCTCAATGATTCCCATGCCTACCTCATCCTGGCCCTGCATTGGGTAGAACCAGGTGAATATGAAGTTCCTGTGGTCGTCAGCCATAATGCCCACACATGGCAGCTCCTGGTCCAAGTGATTGTGTGTCGCTGCAATGTGGAGGGGCGGTGCTTGCGCAAGGTGGGCCGCATGAAGGGAATGCCCACGAAGCTGGTAGCCGTGGGCACCCTCCTGGGCACCCTGGCAGCAATAGATGAGGTCACTATGGCCCAGAGAGATTTACTGACTTGTCTGAGGTTATACAGCCAAGAGATAGCAGAGCCCAGGTCTTTCCAGTTTAATTCCTTCCATCCAAGCTACCCTCTCTATCCCTTTTATTTCTTTAGCCCCCTAAATTCTTCCCTTGCTGGTTCTAGCACAAAGCTATGCTATGCCTTTGTCTTGGAGGCCCATGGGAATAAGTCACTGGCTCTCAGATGA

XM_004843090.1 Coding sequence

Cdh16 cadherin 16, KSP-cadherin, transcript variant X10

Length: 2619 bp    Location: 19590612..19599728   Strand: +
>XM_004843090.1
ATGGTTCCTGCCTGGCTTTGGCTGCTTTGCTTCTCTATCCCCCAGGCTTTCCCTGAGGCCCAGCCTGCAGAACTGTCTGTGGAAGTCCCTGAGAACTATGGCGGAAATTTCCCTTTGTACTTGACCAAGCTGCCGCTGCCCCATGAGAAGCCTGAAGGGCAGATTGTGCTATCAGGGGACTCAGGCATACCAGCTGAAGGTCCCTTTGCTGTGGATTCAGACTCTGGCTTCCTGGTGGTGACCAGTGCCCTGGACAGGGAGGAACAGGCAGAATACAAGCTACAGGTCACCCTGGAGACTGGAGATGGATATGTCTTGTGGGGTCCACAGCCTGTGATTGTGCATGTGAAGGATGAGAACGATCAGGTGCCCCAGTTTTCCCAGACCATTTACAGAGCTCAGCTCAGCCAGGGCACCAGGCCTGGTATCCCCTTCCTCTTCCTTGAGGCTTCAGATGGGGATGCTCCAGGCACAGCCAACTCAGATCTTCAATTCCACGTCCTGAGCCAGACCCCAGCTCAGCCTTCATCAGACATGTTCCAGCTAGAGCCTCGGCGGGGAGCTCTGGCCCTCAGCCCCGAGGGGAGCACCAGCCTAGACCGTGCCCTGGAGGGGTCCTATCAACTATTGGTACAGGTCAAGGACATGGGTGACCAGGCCATAGGCCACCAGGCTACAGCCACCATAGAGGTCTCCATAGTACAGAGTACCTGGGTACCCCTAGAGCCCATCCACCTGGCAGAGAATCTCAAAGTCCCATACCCACACCCCATTGCCCAGGTACATTGGAGTGGGGGGAATGTGCACTATCACCTGGAGAGCCAACCCCCTGGACCATTTGATGTGGACGCAGATGGGAAACTCTATGTGACCATGGAGCTGGACCGAGAAGCCCAGGCTGAGTACCTGCTCCAGGCCTGGGCTCAGAATTCCCATGGTGAGGACTACGCAAAACCCCTGGAGTTTCATGTGGTGGTGACAGATGAGAACGACAATCCACCTGTCTGCCTCCCACGTGGTTCCTCAATCAGCATCCCTGAGCTCAGCGCCCCAGGCACTGAAGTGACTCAGCTGTTGGCAGAGGATGCAGATGCCCCTGGATCTCCCAATTCCCACATTGTGTATCAGCTTCTGACCCCTGAGCCCCAGAAGGGCGCTGAAGGGAGAGCCTTTGCCCTGGACCCCACCTCAGGCAGTGTGACTCTGGGCACTGTCCCCCTCCAAGCTGGCCAGGACATCCTCCTTCAGGTGCTGGCTATTGACCTAGCAGGAGCAGAGGAAGGGCTCAGCAGCATGTGTGAGGTCGAAATCACAATCACAGACATCAATGACCATGCCCCTGAGTTCACCATCTCCCAGATTGAGCCTGTAAGCCTCCCTGAGGATGTGGAGCCCGGTACTCTGGTGGCCACACTCATGGCCACTGATGCTGACCTTGAACCTGCCTTTCGCCTCATGGAGTTTGCCATTGAGGCAGGGGATAAGGAAGGGATTTTTGGCCTGGATTGGGAGCCAGGCTCTGACCATGTCCAACTCAAACTCCGCAAGAACCTCAGCTATGAGGCAATTCCCCACCACAAGGTGGTGGTGGTAGTGCGAAATGTGGAGAAACTGGTGGGCCCAGGCCCAGGCCCTGAAGCCACAGCCACAGTGACTGTGCTGGTGGAGAGGGTGATGCTGCCCCCTAAGTTGGACCAGGAAAACTATGAAGCCAGTGTCCCAATCAGTACACCAGCCGGCTCCCACCTGCTGACCATCCAGCCCTCAGATCCCATGAACAGAACCCTCAGGTTCTCCCTGGTCAATGACTCAGAGGGCTGGCTCTGCATCAAGGAGGTCTCTGGGGAAGTACACACAGCTCAGTCCCTGCAGGGCGCCCAACCTGGGGACACATACACGGTGCTTGTGGAAGCCCAGGATGCAGATGAGCCAAGACTGAGCGCCTCTGCTGCTCTAGTGGTCCACTTCCTGAAGCCCCCTCCTGCCCCAGCTCTGACTCTGGCACCCATGCCCACCCGATTCCTCTGCACACCCCGCCAGGACTACGGTGTGGTAGTCAGTGGACTCAGTGAGGATCCCAACCTGGCCAGTGTTCCCGGTCCCTACAGCTTTGCCCTTGGCCCAAACCCTACGGTGCAGCGGGATTGGCGCCTCCAGCCTCTCAATGATTCCCATGCCTACCTCATCCTGGCCCTGCATTGGGTAGAACCAGGTGAATATGAAGTTCCTGTGGTCGTCAGCCATAATGCCCACACATGGCAGCTCCTGGTCCAAGTGATTGTGTGTCGCTGCAATGTGGAGGGGCGGTGCTTGCGCAAGGTGGGCCGCATGAAGGGAATGCCCACGAAGCTGGTAGCCGTGGGCACCCTCCTGGGCACCCTGGCAGCAATAGATGAGGTCACTATGGCCCAGAGAGATTTACTGACTTGTCTGAGGTTATACAGCCAAGAGATAGCAGAGCCCAGGTCTTTCCAGTTTAATTCCTTCCATCCAAGCTACCCTCTCTATCCCTTTTATTTCTTTAGCCCCCTAAATTCTTCCCTTGCTGGTTCTAGCACAAAGCTATGCTATGCCTTTGTCTTGGAGGCCCATGGGAATAAGTCACTGGCTCTCAGATGA

XM_004843083.1 Coding sequence

Cdh16 cadherin 16, KSP-cadherin, transcript variant X3

Length: 2715 bp    Location: 19590771..19599885   Strand: +
>XM_004843083.1
ATGCTCCTAGTGCTGAGCTACATGTTGAGTGCTGGAAAATGCCATGATGGTGGCAGAGCTTCTTCCCTGGGGGGACTCCGTGTCTGGAGGTTGGCAGTGGGAAGCAGGACCATTCCCGAGCCACAAGTCCTCTCTTCCAGGAGGAATCCTCCTGTCAAGTCCTCCACGACCTTGGCCAGGCCCTGCCCTTCGGTCCTTGCCTGCAGTGTAAGGCCCACCCTGACCATGGTTCCTGCCTGGCTTTGGCTGCTTTGCTTCTCTATCCCCCAGGCTTTCCCTGAGGCCCAGCCTGCAGAACTGTCTGTGGAAGTCCCTGAGAACTATGGCGGAAATTTCCCTTTGTACTTGACCAAGCTGCCGCTGCCCCATGAGAAGCCTGAAGGGCAGATTGTGCTATCAGGGGACTCAGGCATACCAGCTGAAGGTCCCTTTGCTGTGGATTCAGACTCTGGCTTCCTGGTGGTGACCAGTGCCCTGGACAGGGAGGAACAGGCAGAATACAAGCTACAGGTCACCCTGGAGACTGGAGATGGATATGTCTTGTGGGGTCCACAGCCTGTGATTGTGCATGTGAAGGATGAGAACGATCAGGTGCCCCAGTTTTCCCAGACCATTTACAGAGCTCAGCTCAGCCAGGGCACCAGGCCTGGTATCCCCTTCCTCTTCCTTGAGGCTTCAGATGGGGATGCTCCAGGCACAGCCAACTCAGATCTTCAATTCCACGTCCTGAGCCAGACCCCAGCTCAGCCTTCATCAGACATGTTCCAGCTAGAGCCTCGGCGGGGAGCTCTGGCCCTCAGCCCCGAGGGGAGCACCAGCCTAGACCGTGCCCTGGAGGGGTCCTATCAACTATTGGTACAGGTCAAGGACATGGGTGACCAGGCCATAGGCCACCAGGCTACAGCCACCATAGAGGTCTCCATAGTACAGAGTACCTGGGTACCCCTAGAGCCCATCCACCTGGCAGAGAATCTCAAAGTCCCATACCCACACCCCATTGCCCAGGTACATTGGAGTGGGGGGAATGTGCACTATCACCTGGAGAGCCAACCCCCTGGACCATTTGATGTGGACGCAGATGGGAAACTCTATGTGACCATGGAGCTGGACCGAGAAGCCCAGGCTGAGTACCTGCTCCAGGCCTGGGCTCAGAATTCCCATGGTGAGGACTACGCAAAACCCCTGGAGTTTCATGTGGTGGTGACAGATGAGAACGACAATCCACCTGTCTGCCTCCCACGTGGTTCCTCAATCAGCATCCCTGAGCTCAGCGCCCCAGGCACTGAAGTGACTCAGCTGTTGGCAGAGGATGCAGATGCCCCTGGATCTCCCAATTCCCACATTGTGTATCAGCTTCTGACCCCTGAGCCCCAGAAGGGCGCTGAAGGGAGAGCCTTTGCCCTGGACCCCACCTCAGGCAGTGTGACTCTGGGCACTGTCCCCCTCCAAGCTGGCCAGGACATCCTCCTTCAGGTGCTGGCTATTGACCTAGCAGGAGCAGAGGAAGGGCTCAGCAGCATGTGTGAGGTCGAAATCACAATCACAGACATCAATGACCATGCCCCTGAGTTCACCATCTCCCAGATTGAGCCTGTAAGCCTCCCTGAGGATGTGGAGCCCGGTACTCTGGTGGCCACACTCATGGCCACTGATGCTGACCTTGAACCTGCCTTTCGCCTCATGGAGTTTGCCATTGAGGCAGGGGATAAGGAAGGGATTTTTGGCCTGGATTGGGAGCCAGGCTCTGACCATGTCCAACTCAAACTCCGCAAGAACCTCAGCTATGAGGCAATTCCCCACCACAAGGTGGTGGTGGTAGTGCGAAATGTGGAGAAACTGGTGGGCCCAGGCCCAGGCCCTGAAGCCACAGCCACAGTGACTGTGCTGGTGGAGAGGGTGATGCTGCCCCCTAAGTTGGACCAGGAAAACTATGAAGCCAGTGTCCCAATCAGTACACCAGCCGGCTCCCACCTGCTGACCATCCAGCCCTCAGATCCCATGAACAGAACCCTCAGGTTCTCCCTGGTCAATGACTCAGAGGGCTGGCTCTGCATCAAGGAGGTCTCTGGGGAAGTACACACAGCTCAGTCCCTGCAGGGCGCCCAACCTGGGGACACATACACGGTGCTTGTGGAAGCCCAGGATGCAGATGAGCCAAGACTGAGCGCCTCTGCTGCTCTAGTGGTCCACTTCCTGAAGCCCCCTCCTGCCCCAGCTCTGACTCTGGCACCCATGCCCACCCGATTCCTCTGCACACCCCGCCAGGACTACGGTGTGGTAGTCAGTGGACTCAGTGAGGATCCCAACCTGGCCAGTGTTCCCGGTCCCTACAGCTTTGCCCTTGGCCCAAACCCTACGGTGCAGCGGGATTGGCGCCTCCAGCCTCTCAATGATTCCCATGCCTACCTCATCCTGGCCCTGCATTGGGTAGAACCAGGTGAATATGAAGTTCCTGTGGTCGTCAGCCATAATGCCCACACATGGCAGCTCCTGGTCCAAGTGATTGTGTGTCGCTGCAATGTGGAGGGGCGGTGCTTGCGCAAGGTGGGCCGCATGAAGGGAATGCCCACGAAGCTGGTAGCCGTGGGCACCCTCCTGGGCACCCTGGCAGCAATAGGCTTCTTCCTCATTCTCATCTTCACGCACTTGGCCCTGGCGAGGAAGAAGGACCTGAATCAGCCAGCAGACAGCATGCCCCTGAAGGTGGCCGTCTGA

XM_004843081.1 Coding sequence

Cdh16 cadherin 16, KSP-cadherin, transcript variant X1

Length: 2844 bp    Location: 19590771..19599728   Strand: +
>XM_004843081.1
ATGCTCCTAGTGCTGAGCTACATGTTGAGTGCTGGAAAATGCCATGATGGTGGCAGAGCTTCTTCCCTGGGGGGACTCCGTGTCTGGAGGTTGGCAGTGGGAAGCAGGACCATTCCCGAGCCACAAGTCCTCTCTTCCAGGAGGAATCCTCCTGTCAAGTCCTCCACGACCTTGGCCAGGCCCTGCCCTTCGGTCCTTGCCTGCAGTGTAAGGCCCACCCTGACCATGGTTCCTGCCTGGCTTTGGCTGCTTTGCTTCTCTATCCCCCAGGCTTTCCCTGAGGCCCAGCCTGCAGAACTGTCTGTGGAAGTCCCTGAGAACTATGGCGGAAATTTCCCTTTGTACTTGACCAAGCTGCCGCTGCCCCATGAGAAGCCTGAAGGGCAGATTGTGCTATCAGGGGACTCAGGCATACCAGCTGAAGGTCCCTTTGCTGTGGATTCAGACTCTGGCTTCCTGGTGGTGACCAGTGCCCTGGACAGGGAGGAACAGGCAGAATACAAGCTACAGGTCACCCTGGAGACTGGAGATGGATATGTCTTGTGGGGTCCACAGCCTGTGATTGTGCATGTGAAGGATGAGAACGATCAGGTGCCCCAGTTTTCCCAGACCATTTACAGAGCTCAGCTCAGCCAGGGCACCAGGCCTGGTATCCCCTTCCTCTTCCTTGAGGCTTCAGATGGGGATGCTCCAGGCACAGCCAACTCAGATCTTCAATTCCACGTCCTGAGCCAGACCCCAGCTCAGCCTTCATCAGACATGTTCCAGCTAGAGCCTCGGCGGGGAGCTCTGGCCCTCAGCCCCGAGGGGAGCACCAGCCTAGACCGTGCCCTGGAGGGGTCCTATCAACTATTGGTACAGGTCAAGGACATGGGTGACCAGGCCATAGGCCACCAGGCTACAGCCACCATAGAGGTCTCCATAGTACAGAGTACCTGGGTACCCCTAGAGCCCATCCACCTGGCAGAGAATCTCAAAGTCCCATACCCACACCCCATTGCCCAGGTACATTGGAGTGGGGGGAATGTGCACTATCACCTGGAGAGCCAACCCCCTGGACCATTTGATGTGGACGCAGATGGGAAACTCTATGTGACCATGGAGCTGGACCGAGAAGCCCAGGCTGAGTACCTGCTCCAGGCCTGGGCTCAGAATTCCCATGGTGAGGACTACGCAAAACCCCTGGAGTTTCATGTGGTGGTGACAGATGAGAACGACAATCCACCTGTCTGCCTCCCACGTGGTTCCTCAATCAGCATCCCTGAGCTCAGCGCCCCAGGCACTGAAGTGACTCAGCTGTTGGCAGAGGATGCAGATGCCCCTGGATCTCCCAATTCCCACATTGTGTATCAGCTTCTGACCCCTGAGCCCCAGAAGGGCGCTGAAGGGAGAGCCTTTGCCCTGGACCCCACCTCAGGCAGTGTGACTCTGGGCACTGTCCCCCTCCAAGCTGGCCAGGACATCCTCCTTCAGGTGCTGGCTATTGACCTAGCAGGAGCAGAGGAAGGGCTCAGCAGCATGTGTGAGGTCGAAATCACAATCACAGACATCAATGACCATGCCCCTGAGTTCACCATCTCCCAGATTGAGCCTGTAAGCCTCCCTGAGGATGTGGAGCCCGGTACTCTGGTGGCCACACTCATGGCCACTGATGCTGACCTTGAACCTGCCTTTCGCCTCATGGAGTTTGCCATTGAGGCAGGGGATAAGGAAGGGATTTTTGGCCTGGATTGGGAGCCAGGCTCTGACCATGTCCAACTCAAACTCCGCAAGAACCTCAGCTATGAGGCAATTCCCCACCACAAGGTGGTGGTGGTAGTGCGAAATGTGGAGAAACTGGTGGGCCCAGGCCCAGGCCCTGAAGCCACAGCCACAGTGACTGTGCTGGTGGAGAGGGTGATGCTGCCCCCTAAGTTGGACCAGGAAAACTATGAAGCCAGTGTCCCAATCAGTACACCAGCCGGCTCCCACCTGCTGACCATCCAGCCCTCAGATCCCATGAACAGAACCCTCAGGTTCTCCCTGGTCAATGACTCAGAGGGCTGGCTCTGCATCAAGGAGGTCTCTGGGGAAGTACACACAGCTCAGTCCCTGCAGGGCGCCCAACCTGGGGACACATACACGGTGCTTGTGGAAGCCCAGGATGCAGATGAGCCAAGACTGAGCGCCTCTGCTGCTCTAGTGGTCCACTTCCTGAAGCCCCCTCCTGCCCCAGCTCTGACTCTGGCACCCATGCCCACCCGATTCCTCTGCACACCCCGCCAGGACTACGGTGTGGTAGTCAGTGGACTCAGTGAGGATCCCAACCTGGCCAGTGTTCCCGGTCCCTACAGCTTTGCCCTTGGCCCAAACCCTACGGTGCAGCGGGATTGGCGCCTCCAGCCTCTCAATGATTCCCATGCCTACCTCATCCTGGCCCTGCATTGGGTAGAACCAGGTGAATATGAAGTTCCTGTGGTCGTCAGCCATAATGCCCACACATGGCAGCTCCTGGTCCAAGTGATTGTGTGTCGCTGCAATGTGGAGGGGCGGTGCTTGCGCAAGGTGGGCCGCATGAAGGGAATGCCCACGAAGCTGGTAGCCGTGGGCACCCTCCTGGGCACCCTGGCAGCAATAGATGAGGTCACTATGGCCCAGAGAGATTTACTGACTTGTCTGAGGTTATACAGCCAAGAGATAGCAGAGCCCAGGTCTTTCCAGTTTAATTCCTTCCATCCAAGCTACCCTCTCTATCCCTTTTATTTCTTTAGCCCCCTAAATTCTTCCCTTGCTGGTTCTAGCACAAAGCTATGCTATGCCTTTGTCTTGGAGGCCCATGGGAATAAGTCACTGGCTCTCAGATGA

XM_004843076.1 Coding sequence

Ces2 carboxylesterase 2, transcript variant X1

Length: 1680 bp    Location: 19366345..19357304   Strand: -
>XM_004843076.1
ATGAGGTTGAACCAATTTGTTGTACTGCTGGATGCCATAGCTGGGGGACTCCTGCTTCTCTTTGCCCAAGACCTGGCCCAGGACTCTGCCAGCCCCATCCGGACCACACTCACTGGGCAGGTGCGGGGCAGCCTTGTCCACGTGAAGGGCATCAATGTGGAGGTCCACTCCTTCCTGGGAATTCCCTTTGCCAAACCACCTATAGGACCACTGCGTTTTGCACCCCCTGAGGCCCCTGAACCCTGGAGTGGTGTGAGGGATGTGACTTCCCACCCTTCCAGATGTCTACAAAATACTGATAGAATGAATACATTAGTACTGAACCTCTTGAATTTGACCCAACCCACCATTCCCATGTCTGAAGATTGCCTTTACCTCAACATCTACACACCTGCCCATGCCCACGAGGGCTCTAACCTGCCTGTAATGGTAAGGATCCACGGTGGTGGACTACTTACAGGTTCAGTTTCCAAACACGACGGTTCCAGGCTGGCGGCCTTTGAGAGTGTTGTTGTGGTAGCTATCCAGTACCGCCTAGGTATTCTGGGCTTCTTCAGCACTGGAGACCACCATGCCACTGGCAACTGGGGCTACCTAGACCAAGTGGCTGCTCTACACTGGGTACAGCAGAATATCGCTCACTTTGGAGGCAACTCTGACCGCGTCACAATTTTTGGCTCATCAGCAGGTGGCATAAGTGCATCCTCCCACATCTTGGCCCCCATATCCCGAGGACTCTTCCATGGTGCCATCATGGAGAGTGGGGTGGCTTTAATGCCCATCTTCATCTCCAGCTCACCTGAAGCCATCTCCACAGTGGTGGCCAACCTGTCTGCCTGTGGGCAGGTAGACTCAGATGCCCTGGTGAGATGCCTGCGGGGCAAGAGTGAAGAGGAGATTCTGACTATAACAAAGGCCTTCAAAATCATCCCTGCTGTAGTGGATGGTGTCTTCCTGCCCAGGCACCCCAAAGAGCTGCTGGCCTCTGGTGATTTTCAACCTGTCCCCAGCATCATTGGTGTTAACAACGATGAGTATGGCTGGAACTTTCCTATGACCTCTGGAATTACTGACACCCAGAAGGAAATGGACAGAGAGACCATGAAGGCTGTTCTGCAGAGGTTGTCAGTAGAGAGGATATTGCCTGCTGAGTCTGTTGACCCTATAATAGAGGAATACGTGGGGGACAATGAAGACAGCCAGACTCTTCAAGCCCAATTCAAGGAGTTGATGGGAGATATCTCCGTAGTGATCCCTGCACTCCAAGTAGCACATTTTCAGAGTTCCCACGGCCCTGTCTACTTCTATGAGTTCCAGCATCCACTCAACTTCTTCAAGGATATCAGGCCGCCCCATGTTAAGGCTGACCATGGTGATCAGGTTTTCTTTGTCTTTGGATCCTCCTTCTGGGGTAATCAAATTGAACTCACTGAGGAAGAGGAGCTGCTGAATAGGAGGATGATGAAGTACTGGGCCAACTTTGCTCGAAATGGGAACCCCAATGGCGAGGGCCTCCCCCACTGGCCTATGTTGGACCACAAAAAGCTATACCTGAAGCTAGACATCCAACCTACTGTGGGCCATGGCCTGAAGGCCCCGAGGCTGAAGTTCTGGATGGAGACCCTGCCCCAGAAGATCTGGGCGCTAAAGAAGGCTGAAGAGGAGCATGCAGAGCTGTAG

XM_004843065.1 Coding sequence

Tradd TNFRSF1A-associated via death domain, transcript variant X3

Length: 933 bp    Location: 19162889..19165705   Strand: +
>XM_004843065.1
ATGGCAACTGGGTCAAATGGAGATGAAGAGTGGGTAGGCAGTGCATACCTGTTTTTGGAGTCCTCGGTAGACAAGGTGGTCCTGTCAGATGCCTATGCACACCCCCAGAAGAAGGTGGCAGTATACGGGGCTCTGCGGACTGCATTGGCAGAGAGTTCCGAGAGCCCGGACGCGCTACAGATACTGAAGATCCACAGCAGCGACTCGCAGCTGATCGTGCAGCTGCGTTTCTGTGGGCGCCAGTCTTGTGGTTGCTTCCTCCGCGCCTACCGCGAGGGGGCGCTGCGCGCCACGCTGCAGAGGTACTTGGCGGCGGCTTTGGACCAGCCCTCTCTGCCGCTGCAGCTGGAGCTGCTCGCCGGCGCCGAGCGACTGGACTCTTGGCTGACTAATGAGGAGCGCTGTGTGCACAGCATCTTAGCCCAGAAGCCGGACCGACTCCGGGATGAGGAACTCGCTGAGCTGGAGGATGCTCTCAGCAATCTGACGTTGGGCTCGGCGGGCCAGGGTAGTGACTCGGGGGTCACTCCAGCCCCCTCGCAGTCCCTGGGCCCTTCTCCATTGGAGGAGAAGCCGCCACCACAGGCTGGCCAGACCTTTCTGTTCCAGGGTCACCCCATAGTGAACCGACCGCTGAACCTGCAGGACCAGCAGACGTTCGCACGCTCAGTGGGCCTCAAGTGGCGCAGGGTCGGGCGTTCCTTGCAGCGCAGTTGTCGGGCACTGCGGGACCCTGCCCTCGACTCGCTAGCCTATGAGTACGAGCGCGAGGGACTGTACGAGCAGGCCTTCCAGCTGCTGCGGCGCTTCGTGCAGGCCGAGGGTCGCCGCGCTACGCTGCAGCGCCTGGTGGAGGCCCTTGAGGAGAATGAACTCACCAGTCTGGCAGAAGACCTGCTGGGCCTGGCGGATCCCAACAGTGGCCTGGCCTAG

XM_004843064.1 Coding sequence

Tradd TNFRSF1A-associated via death domain, transcript variant X2

Length: 933 bp    Location: 19155118..19165705   Strand: +
>XM_004843064.1
ATGGCAACTGGGTCAAATGGAGATGAAGAGTGGGTAGGCAGTGCATACCTGTTTTTGGAGTCCTCGGTAGACAAGGTGGTCCTGTCAGATGCCTATGCACACCCCCAGAAGAAGGTGGCAGTATACGGGGCTCTGCGGACTGCATTGGCAGAGAGTTCCGAGAGCCCGGACGCGCTACAGATACTGAAGATCCACAGCAGCGACTCGCAGCTGATCGTGCAGCTGCGTTTCTGTGGGCGCCAGTCTTGTGGTTGCTTCCTCCGCGCCTACCGCGAGGGGGCGCTGCGCGCCACGCTGCAGAGGTACTTGGCGGCGGCTTTGGACCAGCCCTCTCTGCCGCTGCAGCTGGAGCTGCTCGCCGGCGCCGAGCGACTGGACTCTTGGCTGACTAATGAGGAGCGCTGTGTGCACAGCATCTTAGCCCAGAAGCCGGACCGACTCCGGGATGAGGAACTCGCTGAGCTGGAGGATGCTCTCAGCAATCTGACGTTGGGCTCGGCGGGCCAGGGTAGTGACTCGGGGGTCACTCCAGCCCCCTCGCAGTCCCTGGGCCCTTCTCCATTGGAGGAGAAGCCGCCACCACAGGCTGGCCAGACCTTTCTGTTCCAGGGTCACCCCATAGTGAACCGACCGCTGAACCTGCAGGACCAGCAGACGTTCGCACGCTCAGTGGGCCTCAAGTGGCGCAGGGTCGGGCGTTCCTTGCAGCGCAGTTGTCGGGCACTGCGGGACCCTGCCCTCGACTCGCTAGCCTATGAGTACGAGCGCGAGGGACTGTACGAGCAGGCCTTCCAGCTGCTGCGGCGCTTCGTGCAGGCCGAGGGTCGCCGCGCTACGCTGCAGCGCCTGGTGGAGGCCCTTGAGGAGAATGAACTCACCAGTCTGGCAGAAGACCTGCTGGGCCTGGCGGATCCCAACAGTGGCCTGGCCTAG

XM_004843069.1 Coding sequence

LOC101723319 chromosome unknown open reading frame, human C16orf70, transcript variant X2

Length: 1269 bp    Location: 19197545..19170614   Strand: -
>XM_004843069.1
ATGCTGGATCTAGAGGTGGTGCCTGAACGCTCTCTGGGAAACGAGCAATGGGAATTTACGCTGGGAATGCCTCTGGCCCAGGCAGTGGCTATTCTTCAGAAGCATTGTCGAATCATCAAAAATGTCCAGGTTCTCTACAGTGAGCAGTCTCCTCTAAGCCATGACCTCATCCTTAACCTGACTCAGGACGGGATCAAACTACTGTTTGATGCTTTCAATCAGAGACTTAAGGTAATTGAAGTATATGACTTGACTAAAGTAAAGTTAAAATATTGTGGAGTGCACTTCAACTCTCAGGCCATAGCTCCCACCATTGAGCAGATTGACCAGTCTTTTGGCGCAACTCATCCTGGAGTGTACAACTCTGCTGAGCAGCTCTTTCACCTCAACTTCAGAGGACTGTCTTTCTCTTTTCAGTTAGACTCATGGACTGAAGCTCCCAAATATGAGCCCAATTTTGCCCATGGTCTAGCTTCTCTCCAGATACCCCATGGAGCAACTGTAAAACGAATGTACATCTATAGTGGAAACAGCCTACAAGATACCAAGGCTCCCATGATGCCCCTGAGCTGTTTCCTGGGCAATGTGTACGCTGAGAGTGTAGATGTTCTTCGTGATGGAACTGGACCCTCAGGTTTACGACTTCGCCTACTTGCTGCAGGTTGTGGACCTGGCCTATTAGCAGATGCCAAGATGCGGGTATTTGATCGTTCCGTATATTTTGGTGATTCCTGCCAAGATGTTCTTAGCATGCTTGGCTCCCCACATAAGGTCTTCTATAAGTCAGAAGACAAGATGAAAATTCATTCTCCTTCCCCTCATAAGCAAGTTCCATCCAAGTGCAATGACTACTTTTTTAACTACTTCACTCTTGGAGTGGATATCCTCTTCGATGCAAATACACACAAAGTAAAGAAGTTTGTTCTACATACCAATTATCCTGGGCATTATAACTTTAACATTTATCACCGCTGTGAGTTCAAGATCCCACTAGCCATAAAGAAAGAAAATGAAGATGGTCAGACAGAAACTTGCACAACCTATAGCAAGTGGGACAATATCCACGAGCTCTTGGGCCATCCTGTGGAGAAGCCTGTTATCCTGCACAGGTCCTCATCCCCAAACAACACCAACCCATTTGGCTCCACATTCTGCTTTGGTCTTCAGCGGATGATCTTTGAGATCATGCAGAACAACCACATTGCCTCTGTGACCCTGTATGGCCCCCCCAGGCCTGGTGCCCACCTGAGAACAGCAGAGCTCCCCTAG

XM_004843062.1 Coding sequence

Nol3 nucleolar protein 3 (apoptosis repressor with CARD domain)

Length: 720 bp    Location: 19145174..19141846   Strand: -
>XM_004843062.1
ATGTGCACAGTGCAGCAAGTCCAGACAATGGGTAATGTGCAAGAGCGGCCATCGGAGACTATCGACCGTGAGCGGAAACGCCTAGTAGAGATGCTGCAGGCGGACTCTGGGCTATTACTGGATGCGCTGGTGGCGCGGGGCGTGCTCAACGGGCCCGAGTATGAGGCGTTGGATGCACTGCCTGACGCCGAACGCAGGGTGCGCCGCCTGCTGCTGCTGGTGCAGAGCAAGGGCGAGGCTGCCTGTCAGGAGCTGCTGCGCTGTGCCCAACAAACCATGCGTGCGCCGGACCCTGCCTGGGACTGGCAGCACGCTACCGGGACCGCAGCTATGATCCTCCGTGCCCAGGCCACGGGACGCCTGAGACACCCAGTTCCGAGAACGCATATCCCGGGTTGCCCAGAGCTTCAGAGGATCCGGAGAAATCTAGGGGTCCAGAAAGCTCCGAAGTGGTGCAACCAGAGGCTCCAGAAGAGCCAGATCTAGAAGCTGAGGCCTTTGAAGGAGCTGAGCCAGAACAGGAAGCTGAGATGGATCCGGAACCAGAGCCAGAGCCAGAGCCAGAGACTGAACTGGAACCAGAGCCAGAGCCGGAGCCTGAGCTGGACTTCCAAGAGGGGGATGAGTCTGAAGATTCCTGAAGGCCTGAGGGCTGACCTGTCGTCCCCAGCTCAAGCCCAATCCAGACAGGACCTGGGAACCTGCTGGAGCTGCATTTGA

XM_004843063.1 Coding sequence

Tradd TNFRSF1A-associated via death domain, transcript variant X1

Length: 933 bp    Location: 19155113..19165705   Strand: +
>XM_004843063.1
ATGGCAACTGGGTCAAATGGAGATGAAGAGTGGGTAGGCAGTGCATACCTGTTTTTGGAGTCCTCGGTAGACAAGGTGGTCCTGTCAGATGCCTATGCACACCCCCAGAAGAAGGTGGCAGTATACGGGGCTCTGCGGACTGCATTGGCAGAGAGTTCCGAGAGCCCGGACGCGCTACAGATACTGAAGATCCACAGCAGCGACTCGCAGCTGATCGTGCAGCTGCGTTTCTGTGGGCGCCAGTCTTGTGGTTGCTTCCTCCGCGCCTACCGCGAGGGGGCGCTGCGCGCCACGCTGCAGAGGTACTTGGCGGCGGCTTTGGACCAGCCCTCTCTGCCGCTGCAGCTGGAGCTGCTCGCCGGCGCCGAGCGACTGGACTCTTGGCTGACTAATGAGGAGCGCTGTGTGCACAGCATCTTAGCCCAGAAGCCGGACCGACTCCGGGATGAGGAACTCGCTGAGCTGGAGGATGCTCTCAGCAATCTGACGTTGGGCTCGGCGGGCCAGGGTAGTGACTCGGGGGTCACTCCAGCCCCCTCGCAGTCCCTGGGCCCTTCTCCATTGGAGGAGAAGCCGCCACCACAGGCTGGCCAGACCTTTCTGTTCCAGGGTCACCCCATAGTGAACCGACCGCTGAACCTGCAGGACCAGCAGACGTTCGCACGCTCAGTGGGCCTCAAGTGGCGCAGGGTCGGGCGTTCCTTGCAGCGCAGTTGTCGGGCACTGCGGGACCCTGCCCTCGACTCGCTAGCCTATGAGTACGAGCGCGAGGGACTGTACGAGCAGGCCTTCCAGCTGCTGCGGCGCTTCGTGCAGGCCGAGGGTCGCCGCGCTACGCTGCAGCGCCTGGTGGAGGCCCTTGAGGAGAATGAACTCACCAGTCTGGCAGAAGACCTGCTGGGCCTGGCGGATCCCAACAGTGGCCTGGCCTAG

XM_004843056.1 Coding sequence

Kiaa0895l KIAA0895-like ortholog, transcript variant X1

Length: 1416 bp    Location: 19134052..19141462   Strand: +
>XM_004843056.1
ATGGTGCTGGACTCAGGAGCTCAGGTGTATGAGCAGGCACCTCCCAGCCCATCTGCCAGTCCCCTGTCCCTGCGCCATAGGCTGAAGTCATCCAACCGAGATGGGCCACCCCTGTACCCCTGGCCTCGATCCCTGGCTGTGCCCCTGGCTCTGGCTGTCCCTTCAGTGCTGCAGCCCCAGCCTGAGCAGCAGCCCTTTTCAAAGCTGCACTTGGGCCACCGTGGCCATATGCGTCGCAGTGAGAGCACTTACTCTGTAAATAGCACTGGTCAGCGGGGGCGTGGCACACAGGGTCATGCCCCACCTGGACAGGGACGGGACCCAGGTGGTGGCACCTTGCGATCTGCAGCTTCCCTGCCCCACATTGCTAAGACTCGAAAGAATGTAGGCAATGGTATTGGCAAGAGCCCCTGTATGTTGGTGGCCCTGAGGCCAACCAACATGGACCGTGAACGGGACAAGTTCTTCCAGTCCCATTATACCTACAATCCACAGTTTGAGTACCAGGAGCCCATGCCTACAACTGTGCTGAAGAAGTACTGTGAGGCCTCTGGACAGTTCATCCCTCAGGCAGTTGGCATCATTGAGGCTGTCCTGGAGAAATTTGGCACCTACGAACGCTTTGAGGCTGCTACCGGGGGCCAGCTGCTGACCAAGTGCCAGATTTGGTCCACTGTGCGAAAATACATGCAGAAGGAGGGCTGCGTTGGGGAGATTGTGGTGCAGCTGAGTGAGGACCTGCTGTCCCAGGCAGTAATGATGGTGGAAAACAGCCGACCCACACTGGCCATCAACTTGACGGGAGCCCGCCAGTACTGGCTGGAGGGCATGCTTCGGCATGAAATAGGCACCCACTACCTGCGTGGCGTGAATAACGCGCAGCAGCCTTGGCACAGCGCCGAGGGCCGGCTGCAGTATGGACTTCGGCCAGCCAACCCCACCGAGGAGGGCCTGGCCAGCCTGCACAGCGTGCTTTTCCGCAAGCAGCCTTTCCTGTGGCGTGCAGCCCTGCTCTACTACACCATTCATCGTGCCGCACACATGTCCTTCTGCCAGCTCTTCCAAGACCTGGCCCGCTACGTGCAGGACGCCAACGTGCGCTGGGAGTACTGCGTGCGCGCCAAGCGTGGCCAGATGGACACTTCCAAGCCAGGCTGTTTCAGCAAGGACCAGGTGTACCTGGACGGCATCGTGCGCATTCTGCGACACCGCCAGACCATCGATTTCCCACTGCTGACCTCCCTGGGCAAGGTCTCCTATGAGGATGTGGATCATTTGAGGCCCTATGGGGTACTGGATAATACCCGCGTACCCCACTTCATGCAGGACTTGGAACGCTACCAGCAGCAACTGGAACACATCATGGCCACCAACCGTCTTGATGAAGCAGAGCTGGGCCGCCTGCTGCCTGACTGA

XM_004843057.1 Coding sequence

Kiaa0895l KIAA0895-like ortholog, transcript variant X2

Length: 1416 bp    Location: 19134377..19141462   Strand: +
>XM_004843057.1
ATGGTGCTGGACTCAGGAGCTCAGGTGTATGAGCAGGCACCTCCCAGCCCATCTGCCAGTCCCCTGTCCCTGCGCCATAGGCTGAAGTCATCCAACCGAGATGGGCCACCCCTGTACCCCTGGCCTCGATCCCTGGCTGTGCCCCTGGCTCTGGCTGTCCCTTCAGTGCTGCAGCCCCAGCCTGAGCAGCAGCCCTTTTCAAAGCTGCACTTGGGCCACCGTGGCCATATGCGTCGCAGTGAGAGCACTTACTCTGTAAATAGCACTGGTCAGCGGGGGCGTGGCACACAGGGTCATGCCCCACCTGGACAGGGACGGGACCCAGGTGGTGGCACCTTGCGATCTGCAGCTTCCCTGCCCCACATTGCTAAGACTCGAAAGAATGTAGGCAATGGTATTGGCAAGAGCCCCTGTATGTTGGTGGCCCTGAGGCCAACCAACATGGACCGTGAACGGGACAAGTTCTTCCAGTCCCATTATACCTACAATCCACAGTTTGAGTACCAGGAGCCCATGCCTACAACTGTGCTGAAGAAGTACTGTGAGGCCTCTGGACAGTTCATCCCTCAGGCAGTTGGCATCATTGAGGCTGTCCTGGAGAAATTTGGCACCTACGAACGCTTTGAGGCTGCTACCGGGGGCCAGCTGCTGACCAAGTGCCAGATTTGGTCCACTGTGCGAAAATACATGCAGAAGGAGGGCTGCGTTGGGGAGATTGTGGTGCAGCTGAGTGAGGACCTGCTGTCCCAGGCAGTAATGATGGTGGAAAACAGCCGACCCACACTGGCCATCAACTTGACGGGAGCCCGCCAGTACTGGCTGGAGGGCATGCTTCGGCATGAAATAGGCACCCACTACCTGCGTGGCGTGAATAACGCGCAGCAGCCTTGGCACAGCGCCGAGGGCCGGCTGCAGTATGGACTTCGGCCAGCCAACCCCACCGAGGAGGGCCTGGCCAGCCTGCACAGCGTGCTTTTCCGCAAGCAGCCTTTCCTGTGGCGTGCAGCCCTGCTCTACTACACCATTCATCGTGCCGCACACATGTCCTTCTGCCAGCTCTTCCAAGACCTGGCCCGCTACGTGCAGGACGCCAACGTGCGCTGGGAGTACTGCGTGCGCGCCAAGCGTGGCCAGATGGACACTTCCAAGCCAGGCTGTTTCAGCAAGGACCAGGTGTACCTGGACGGCATCGTGCGCATTCTGCGACACCGCCAGACCATCGATTTCCCACTGCTGACCTCCCTGGGCAAGGTCTCCTATGAGGATGTGGATCATTTGAGGCCCTATGGGGTACTGGATAATACCCGCGTACCCCACTTCATGCAGGACTTGGAACGCTACCAGCAGCAACTGGAACACATCATGGCCACCAACCGTCTTGATGAAGCAGAGCTGGGCCGCCTGCTGCCTGACTGA

XM_004843052.1 Coding sequence

Elmo3 engulfment and cell motility 3, transcript variant X5

Length: 2163 bp    Location: 19117703..19112808   Strand: -
>XM_004843052.1
ATGGCGCCTCCACGGAACGTGGTGAAGATTGCCGTCCAGATGCGTGACGCCATCCCGCAGCTCATCCAGCTGGACCAGGCAAAGCCGCTGGCCGCTGTGCTAAAGGAGGTGTGCGACGCGTGGAGCCTGACTCACTCCGAGCACTATGCCCTGCAGTTTGCTGACGGGCACAGGAGATATATCACGGAGAATAACCGCGTGGAAATCAAGAATGGCAGCATCCTGTGTCTCAGCACTGCCCCAGACCTTGAGGCTGAGCAGCTGTTGGGTGGGCTGCAGAGTTCCAGTCGTGAAGGTCGCCGGGAAGCCCTGAGGCACCTCGTCCTGTTAGCCTCAGACATGACTTTTGCCCAGGAGGTCATCCGTCGTGATGGGCTTCAGAGACTAGGCATGATCATTGAAGATGGGGAAGACCTAGGGGAGGTGCTGGCCCTTGGATTGAGGACCTTCTTGGAGCTCATGGAGCATGGCGTGGTATCCTGGGAGACGCTCACCATCACCTTTATCAGGAAGGTGGTGTGCTATGTGAACATGAACCTGATGGATGCCTCGGTACAGCCCCTGGCCCTCCGGCTGCTGGAGAGTGTGACCTTGAGCAGCCCTGCCCTAGGCCAGGTGGTCAAGAGTGAAGTGCCACTGGATAGGCTGCTGGTGCACCTGCAGGTGATGAACCAGCAGCTGCAAACCAAGGCCATGGCATTGTTGACAGCCTTGTTGCAGGGAGCTAGCCATGCTGAACGTAAGCACATGCTTGACTACCTATGGCAAAGGAACCTTCGTCAATTCATCTACAAGGGCATCATCCATAGTGCAATGCCACTGGGTGATGAGATGGCCCATCATCTGTACGTGCTGCAGGCCCTTACACTGGGACTTTTGGAGCCTCGCATGCGGACACCAGTTGACCCCTATAGCCAGGAACAGCGAGACCAGCTGCAGGCCCTGCGCCAGGCTGCCTTTGAGCCAGAGGGAGAGTCCCTGGGCACTGGGCTGAGTGCTGACCGTCACCGTTCCCTCTGTGCCCGAGAGTTTCGAAAACTGGGCTTCTCTAACAGCAACCCAGCACAGGACCTGGAGCGTGTGCCTCCTGGCCTGCTGGCCCTGGACAACATGCTCTACTTCTCCAGACAAGCACCCAGCGCATACAGCCGGTTCGTGTTGGAGAACAGCAGCCGTGAAGACAAGCATGAGTGCCCCTTTGCCCGGAGCAGCATCCAGCTGACTTTGCTGCTGTGCGAGCTGCTCCACATTGGGGAGCCTTGCTCTGAGACAGCCCAGGACTTCTCGCCCATGTTCTTCGGCCAAGACCAGAGCTTCCATGAGCTCTTCTGTGTAGCCATCCAGCTGCTGAATAAGACCTGGAAGGAGATGAGGGCTACACAGGAGGATTTTGACAAGGTCATGCAGGTGGTGCGGGAGCAGCTGGCCCGCACACTGGCCCTGAAGCCCACTTCCCTGGAGCTCTTCCGGACCAAGGTGAATGCACTCACCTATGGGGAGGTGCTTCGGCTGCGGCAGACAGAACGGCTACACCTGGAGGGGACACTGGCCCCTCCCATACTGGAGCTTCGGGAGAAGCTGAAGCCAGAGCTCCTGAGCCTGATCCGCCAGCAGCGTTTGCTCCGCCTCTGTGAGGGGGCGCTTTTCCACAAGATCAGCAGCCGGAGACGCCAGGACAAGCTGTGGTTCTGCTGCCTGTCCCCCAACCACAAGGTGCTTCAGTATGGTGATGTAGAAGAAGGCACTGGCCCACCTACCCCAGAGAGCTTGCCTGAGCAGCTCCCTGTGGCTGACATCAGGGTGCTCCTGATGGGCAAGGACTGCCCCCATGTTAGGGAGAAGGGCTCTGGGAAGCAGAACAAGGACCTCTATGAGTTGGCTTTCTCCATCAGCTATGACCGTGGTGAGGAAGAAGCATACCTCAACTTCATTGCCCCCTCCAAACGGGATTTCTACTTATGGACAGATGGTCTGAGTGCCCTGCTGGGTAGCCCCATGGGCAGCGAGCAGACCCGGCTGGATCTAGAGCAGCTGCTGACCATGGAAACCAAGCTGCGGCTGCTGGAGCTGGAGAATGTGCCCATCCCTGACCAGCCACCACCTGTTCCCCCAACCCCCACCAACTTCAACTTCTGCTATGACTGCACCATCGCTGAACCTTGA

XM_004843050.1 Coding sequence

Elmo3 engulfment and cell motility 3, transcript variant X3

Length: 2280 bp    Location: 19117703..19112808   Strand: -
>XM_004843050.1
ATGGCGCCTCCACGGAACGTGGTGAAGATTGCCGTCCAGATGCGTGACGCCATCCCGCAGCTCATCCAGCTGGACCAGGCAAAGCCGCTGGCCGCTGTGCTAAAGGAGGTGTGCGACGCGTGGAGCCTGACTCACTCCGAGCACTATGCCCTGCAGTTTGCTGACGGGCACAGGAGATATATCACGGAGAATAACCGCGTGGAAATCAAGAATGGCAGCATCCTGTGTCTCAGCACTGCCCCAGTAATGTCTCTCTCGGCCCGCCTTCTCCTGACCACCCCTCTGCTGTGCCCCTTTCTGCCTGTGGGCCTCTGCCCCAGGTCTGGAGGCCCTGGCCCCAAGCCCAGCAGTGCGCCACCTAGTGGACACCTTCCCCCTTTCAGACCTTACCTCTGTCCAATCTCATTTTTGCTCTATTTCCACCCTGGCCAGGACCTTGAGGCTGAGCAGCTGTTGGGTGGGCTGCAGAGTTCCAGTCGTGAAGGTCGCCGGGAAGCCCTGAGGCACCTCGTCCTGTTAGCCTCAGACATGACTTTTGCCCAGGAGGTCATCCGTCGTGATGGGCTTCAGAGACTAGGCATGATCATTGAAGATGGGGAAGACCTAGGGGAGGTGCTGGCCCTTGGATTGAGGACCTTCTTGGAGCTCATGGAGCATGGCGTGGTATCCTGGGAGACGCTCACCATCACCTTTATCAGGAAGGTGGTGTGCTATGTGAACATGAACCTGATGGATGCCTCGGTACAGCCCCTGGCCCTCCGGCTGCTGGAGAGTGTGACCTTGAGCAGCCCTGCCCTAGGCCAGGTGGTCAAGAGTGAAGTGCCACTGGATAGGCTGCTGGTGCACCTGCAGGTGATGAACCAGCAGCTGCAAACCAAGGCCATGGCATTGTTGACAGCCTTGTTGCAGGGAGCTAGCCATGCTGAACGTAAGCACATGCTTGACTACCTATGGCAAAGGAACCTTCGTCAATTCATCTACAAGGGCATCATCCATAGTGCAATGCCACTGGGTGATGAGATGGCCCATCATCTGTACGTGCTGCAGGCCCTTACACTGGGACTTTTGGAGCCTCGCATGCGGACACCAGTTGACCCCTATAGCCAGGCTGTGCTTGTTCCAGAGGCTGCAGTCCTTCCTGAGCTGCCTGTGCTCCCACCCCTCCAGAACAGCAACCCAGCACAGGACCTGGAGCGTGTGCCTCCTGGCCTGCTGGCCCTGGACAACATGCTCTACTTCTCCAGACAAGCACCCAGCGCATACAGCCGGTTCGTGTTGGAGAACAGCAGCCGTGAAGACAAGCATGAGTGCCCCTTTGCCCGGAGCAGCATCCAGCTGACTTTGCTGCTGTGCGAGCTGCTCCACATTGGGGAGCCTTGCTCTGAGACAGCCCAGGACTTCTCGCCCATGTTCTTCGGCCAAGACCAGAGCTTCCATGAGCTCTTCTGTGTAGCCATCCAGCTGCTGAATAAGACCTGGAAGGAGATGAGGGCTACACAGGAGGATTTTGACAAGGTCATGCAGGTGGTGCGGGAGCAGCTGGCCCGCACACTGGCCCTGAAGCCCACTTCCCTGGAGCTCTTCCGGACCAAGGTGAATGCACTCACCTATGGGGAGGTGCTTCGGCTGCGGCAGACAGAACGGCTACACCTGGAGGGGACACTGGCCCCTCCCATACTGGAGCTTCGGGAGAAGCTGAAGCCAGAGCTCCTGAGCCTGATCCGCCAGCAGCGTTTGCTCCGCCTCTGTGAGGGGGCGCTTTTCCACAAGATCAGCAGCCGGAGACGCCAGGACAAGCTGTGGTTCTGCTGCCTGTCCCCCAACCACAAGGTGCTTCAGTATGGTGATGTAGAAGAAGGCACTGGCCCACCTACCCCAGAGAGCTTGCCTGAGCAGCTCCCTGTGGCTGACATCAGGGTGCTCCTGATGGGCAAGGACTGCCCCCATGTTAGGGAGAAGGGCTCTGGGAAGCAGAACAAGGACCTCTATGAGTTGGCTTTCTCCATCAGCTATGACCGTGGTGAGGAAGAAGCATACCTCAACTTCATTGCCCCCTCCAAACGGGATTTCTACTTATGGACAGATGGTCTGAGTGCCCTGCTGGGTAGCCCCATGGGCAGCGAGCAGACCCGGCTGGATCTAGAGCAGCTGCTGACCATGGAAACCAAGCTGCGGCTGCTGGAGCTGGAGAATGTGCCCATCCCTGACCAGCCACCACCTGTTCCCCCAACCCCCACCAACTTCAACTTCTGCTATGACTGCACCATCGCTGAACCTTGA

XM_004843049.1 Coding sequence

Elmo3 engulfment and cell motility 3, transcript variant X2

Length: 2352 bp    Location: 19117703..19112808   Strand: -
>XM_004843049.1
ATGGCGCCTCCACGGAACGTGGTGAAGATTGCCGTCCAGATGCGTGACGCCATCCCGCAGCTCATCCAGCTGGACCAGGCAAAGCCGCTGGCCGCTGTGCTAAAGGAGGTGTGCGACGCGTGGAGCCTGACTCACTCCGAGCACTATGCCCTGCAGTTTGCTGACGGGCACAGGAGATATATCACGGAGAATAACCGCGTGGAAATCAAGAATGGCAGCATCCTGTGTCTCAGCACTGCCCCAGTAATGTCTCTCTCGGCCCGCCTTCTCCTGACCACCCCTCTGCTGTGCCCCTTTCTGCCTGTGGGCCTCTGCCCCAGGTCTGGAGGCCCTGGCCCCAAGCCCAGCAGTGCGCCACCTAGTGGACACCTTCCCCCTTTCAGACCTTACCTCTGTCCAATCTCATTTTTGCTCTATTTCCACCCTGGCCAGGACCTTGAGGCTGAGCAGCTGTTGGGTGGGCTGCAGAGTTCCAGTCGTGAAGGTCGCCGGGAAGCCCTGAGGCACCTCGTCCTGTTAGCCTCAGACATGACTTTTGCCCAGGAGGTCATCCGTCGTGATGGGCTTCAGAGACTAGGCATGATCATTGAAGATGGGGAAGACCTAGGGGAGGTGCTGGCCCTTGGATTGAGGACCTTCTTGGAGCTCATGGAGCATGGCGTGGTATCCTGGGAGACGCTCACCATCACCTTTATCAGGAAGGTGGTGTGCTATGTGAACATGAACCTGATGGATGCCTCGGTACAGCCCCTGGCCCTCCGGCTGCTGGAGAGTGTGACCTTGAGCAGCCCTGCCCTAGGCCAGGTGGTCAAGAGTGAAGTGCCACTGGATAGGCTGCTGGTGCACCTGCAGGTGATGAACCAGCAGCTGCAAACCAAGGCCATGGCATTGTTGACAGCCTTGTTGCAGGGAGCTAGCCATGCTGAACGTAAGCACATGCTTGACTACCTATGGCAAAGGAACCTTCGTCAATTCATCTACAAGGGCATCATCCATAGTGCAATGCCACTGGGTGATGAGATGGCCCATCATCTGTACGTGCTGCAGGCCCTTACACTGGGACTTTTGGAGCCTCGCATGCGGACACCAGTTGACCCCTATAGCCAGGAACAGCGAGACCAGCTGCAGGCCCTGCGCCAGGCTGCCTTTGAGCCAGAGGGAGAGTCCCTGGGCACTGGGCTGAGTGCTGACCGTCACCGTTCCCTCTGTGCCCGAGAGTTTCGAAAACTGGGCTTCTCTAACAGCAACCCAGCACAGGACCTGGAGCGTGTGCCTCCTGGCCTGCTGGCCCTGGACAACATGCTCTACTTCTCCAGACAAGCACCCAGCGCATACAGCCGGTTCGTGTTGGAGAACAGCAGCCGTGAAGACAAGCATGAGTGCCCCTTTGCCCGGAGCAGCATCCAGCTGACTTTGCTGCTGTGCGAGCTGCTCCACATTGGGGAGCCTTGCTCTGAGACAGCCCAGGACTTCTCGCCCATGTTCTTCGGCCAAGACCAGAGCTTCCATGAGCTCTTCTGTGTAGCCATCCAGCTGCTGAATAAGACCTGGAAGGAGATGAGGGCTACACAGGAGGATTTTGACAAGGTCATGCAGGTGGTGCGGGAGCAGCTGGCCCGCACACTGGCCCTGAAGCCCACTTCCCTGGAGCTCTTCCGGACCAAGGTGAATGCACTCACCTATGGGGAGGTGCTTCGGCTGCGGCAGACAGAACGGCTACACCTGGAGGGGACACTGGCCCCTCCCATACTGGAGCTTCGGGAGAAGCTGAAGCCAGAGCTCCTGAGCCTGATCCGCCAGCAGCGTTTGCTCCGCCTCTGTGAGGGGGCGCTTTTCCACAAGATCAGCAGCCGGAGACGCCAGGACAAGCTGTGGTTCTGCTGCCTGTCCCCCAACCACAAGGTGCTTCAGTATGGTGATGTAGAAGAAGGCACTGGCCCACCTACCCCAGAGAGCTTGCCTGAGCAGCTCCCTGTGGCTGACATCAGGGTGCTCCTGATGGGCAAGGACTGCCCCCATGTTAGGGAGAAGGGCTCTGGGAAGCAGAACAAGGACCTCTATGAGTTGGCTTTCTCCATCAGCTATGACCGTGGTGAGGAAGAAGCATACCTCAACTTCATTGCCCCCTCCAAACGGGATTTCTACTTATGGACAGATGGTCTGAGTGCCCTGCTGGGTAGCCCCATGGGCAGCGAGCAGACCCGGCTGGATCTAGAGCAGCTGCTGACCATGGAAACCAAGCTGCGGCTGCTGGAGCTGGAGAATGTGCCCATCCCTGACCAGCCACCACCTGTTCCCCCAACCCCCACCAACTTCAACTTCTGCTATGACTGCACCATCGCTGAACCTTGA

XM_004843048.1 Coding sequence

Elmo3 engulfment and cell motility 3, transcript variant X1

Length: 2454 bp    Location: 19117703..19112808   Strand: -
>XM_004843048.1
ATGGCGCCTCCACGGAACGTGGTGAAGATTGCCGTCCAGATGCGTGACGCCATCCCGCAGCTCATCCAGCTGGACCAGGCAAAGCCGCTGGCCGCTGTGCTAAAGGAGGTGTGCGACGCGTGGAGCCTGACTCACTCCGAGCACTATGCCCTGCAGTTTGCTGACGGGCACAGGAGATATATCACGGAGAATAACCGCGTGGAAATCAAGAATGGCAGCATCCTGTGTCTCAGCACTGCCCCAGTAATGTCTCTCTCGGCCCGCCTTCTCCTGACCACCCCTCTGCTGTGCCCCTTTCTGCCTGTGGGCCTCTGCCCCAGGTCTGGAGGCCCTGGCCCCAAGCCCAGCAGTGCGCCACCTAGTGGACACCTTCCCCCTTTCAGACCTTACCTCTGTCCAATCTCATTTTTGCTCTATTTCCACCCTGGCCAGGACCTTGAGGCTGAGCAGCTGTTGGGTGGGCTGCAGAGTTCCAGTCGTGAAGGTCGCCGGGAAGCCCTGAGGCACCTCGTCCTGTTAGCCTCAGACATGACTTTTGCCCAGGAGGTCATCCGTCGTGATGGGCTTCAGAGACTAGGCATGATCATTGAAGATGGGGAAGACCTAGGGGAGGTGCTGGCCCTTGGATTGAGGACCTTCTTGGAGCTCATGGAGCATGGCGTGGTATCCTGGGAGACGCTCACCATCACCTTTATCAGGAAGGTGGTGTGCTATGTGAACATGAACCTGATGGATGCCTCGGTACAGCCCCTGGCCCTCCGGCTGCTGGAGAGTGTGACCTTGAGCAGCCCTGCCCTAGGCCAGGTGGTCAAGAGTGAAGTGCCACTGGATAGGCTGCTGGTGCACCTGCAGGTGATGAACCAGCAGCTGCAAACCAAGGCCATGGCATTGTTGACAGCCTTGTTGCAGGGAGCTAGCCATGCTGAACGTAAGCACATGCTTGACTACCTATGGCAAAGGAACCTTCGTCAATTCATCTACAAGGGCATCATCCATAGTGCAATGCCACTGGGTGATGAGATGGCCCATCATCTGTACGTGCTGCAGGCCCTTACACTGGGACTTTTGGAGCCTCGCATGCGGACACCAGTTGACCCCTATAGCCAGGAACAGCGAGACCAGCTGCAGGCCCTGCGCCAGGCTGCCTTTGAGCCAGAGGGAGAGTCCCTGGGCACTGGGCTGAGTGCTGACCGTCACCGTTCCCTCTGTGCCCGAGAGTTTCGAAAACTGGGCTTCTCTGTGAGTGACCCCTACCCAAGTCCCCACCCCAACGTCCTTCAGGCTGTGCTTGTTCCAGAGGCTGCAGTCCTTCCTGAGCTGCCTGTGCTCCCACCCCTCCAGAACAGCAACCCAGCACAGGACCTGGAGCGTGTGCCTCCTGGCCTGCTGGCCCTGGACAACATGCTCTACTTCTCCAGACAAGCACCCAGCGCATACAGCCGGTTCGTGTTGGAGAACAGCAGCCGTGAAGACAAGCATGAGTGCCCCTTTGCCCGGAGCAGCATCCAGCTGACTTTGCTGCTGTGCGAGCTGCTCCACATTGGGGAGCCTTGCTCTGAGACAGCCCAGGACTTCTCGCCCATGTTCTTCGGCCAAGACCAGAGCTTCCATGAGCTCTTCTGTGTAGCCATCCAGCTGCTGAATAAGACCTGGAAGGAGATGAGGGCTACACAGGAGGATTTTGACAAGGTCATGCAGGTGGTGCGGGAGCAGCTGGCCCGCACACTGGCCCTGAAGCCCACTTCCCTGGAGCTCTTCCGGACCAAGGTGAATGCACTCACCTATGGGGAGGTGCTTCGGCTGCGGCAGACAGAACGGCTACACCTGGAGGGGACACTGGCCCCTCCCATACTGGAGCTTCGGGAGAAGCTGAAGCCAGAGCTCCTGAGCCTGATCCGCCAGCAGCGTTTGCTCCGCCTCTGTGAGGGGGCGCTTTTCCACAAGATCAGCAGCCGGAGACGCCAGGACAAGCTGTGGTTCTGCTGCCTGTCCCCCAACCACAAGGTGCTTCAGTATGGTGATGTAGAAGAAGGCACTGGCCCACCTACCCCAGAGAGCTTGCCTGAGCAGCTCCCTGTGGCTGACATCAGGGTGCTCCTGATGGGCAAGGACTGCCCCCATGTTAGGGAGAAGGGCTCTGGGAAGCAGAACAAGGACCTCTATGAGTTGGCTTTCTCCATCAGCTATGACCGTGGTGAGGAAGAAGCATACCTCAACTTCATTGCCCCCTCCAAACGGGATTTCTACTTATGGACAGATGGTCTGAGTGCCCTGCTGGGTAGCCCCATGGGCAGCGAGCAGACCCGGCTGGATCTAGAGCAGCTGCTGACCATGGAAACCAAGCTGCGGCTGCTGGAGCTGGAGAATGTGCCCATCCCTGACCAGCCACCACCTGTTCCCCCAACCCCCACCAACTTCAACTTCTGCTATGACTGCACCATCGCTGAACCTTGA

XM_004843040.1 Coding sequence

Lrrc36 leucine rich repeat containing 36, transcript variant X3

Length: 1923 bp    Location: 18979528..18930772   Strand: -
>XM_004843040.1
ATGTTTAGACCATGGTTTTTGCCTCCAGATGATCGAACTGTACGTGACAGTGAGAGGAAAGCTGCCAAGCTCCATTTTAGTCAGTTGAGCAACAGTGAAAATTTTCTTTTAGAGGTGGAAAAAAGCTCTAGGGAGAAGATAATGAAAAACTGTGGGACAGGTGAGGGCTGTGCATCAAAAGTCAACACTGATGTTGACACCAGGCCTGAAACAGCCTCAAACAAAGGACTTTTTATACCCTTCACTAACTGGGAAAGAAAGGATTCCCTAACCAGTACTTCTGCAACCCAGGACAATGGTAAACCAGGTCAGAAATCAGACACTTTTCCCCTGGGGACACAGATGCAGGAAATGACAAGAAAGGAGATGCCAAGTGACAACCCCCAGGACAATGCAGAATTCAAACACTACTCGCCTCGTCAGTCCACAGTCCGATCCCCAGAGAAGATGACGAGAGATGGGTACCGAGTATCTTTTTTGGATAATAAGTCTTCAGGTTCTTCTCCAGAAAAGGACTTGATACCAAAGCTCGATACTTATCATCTTACCCATGATGCCTCATTGGGTAAATGCCTGGATGTAGGTGATTCCAACCAGATCCATCCCTATCAGTTACCTTCTGGCATCAGTTTGGAAAATTATAATAGTCATAATTCTCAAATTCTATCCCTGCATGGAAATCTTGGTAAAAGGCCTCAGAGAAACAAGAACTACCAAGAATATAGCACAAAGCCTTTAAATGACATAAAGGCTACTACATCCCATTCCTGTGGAGATTTATTGACTTCTCTGTCAAACTCTGACTCCAGTACTGGAAGACTTTTGAAACTTAGTTCAGATCTGTATGCCACAACTCATTTCAACAGTGACCCTGCTCTGCTGGCCAATGTAGAACAACAGTTATCCAGCAACCTTGGTGATTTAACACCAGCACATGGTTCTTTACCAAACAACTCTGTCCTGGGAAACTCTCTTCAGACATTGCGGTTGCCTCCTGGGACTTCAGAAGACAGAGAGATTCTGACCAAGAGGTCATTAAGCCCATCGAGGAGAGGATTCAAGCGGAAGGACAATATCCTTGCCAATCTGAATCTAAAGCACGGTTTCCGAGATGGTATAGGCAGCGAGGCAAGTCTTGGCCCTCTCTGTAGTGACCTGGGCAGTTTGCATGGTTTGCCAGGAAACCACAGTCCCCCGATCTCTGCCAGAACCCCCCATGTGGCCACTGTCCTCAGACAGCTCCTGGAGCTTGTGGATAAGCACTGGAGTGACTCTGGCTCCCTGCTCCTCAACAAGAAGTTCCTCGGTCCTGCACAAGATTTGCTTCTGTCTTTGGTTGTCCCTGCTCCTCTGCAGCAGCGATGTCGCCCACATCCTGAAGACACTCCAAAAACTTTCCACAGGAGGGAGAGTGACCTGAAGGAGGCTGAGCAGCCCATCCCTAATGACATGGAAAGTTTAAAGCAAAAACTGGTCAGAGTGCTGGAGGAAAACCTCATTTTGTCAGAAAAAGTTCAGCAGTTGGAGGAAGGTGCAGCCACCTCAATTATGAGTGGGCACCAGTCCCATACTTACGATGATATTCTACACAAAAACCAACAGCTGACCATGCAGGTGGCTTGCCTGAACCAGGAGCTTGCCCAGCTGAAAAAGGTGGAGGAGACGATTGCCCTTCTTCATGAAAGTCAGAGATCCCTGGTGTTAACTAATGAGTATCTGCTGCAGCTGCTGAATAAAGAGCAAAAAGGTTATTCTGGGAAAGCACTCCTGCCCCCTGAGAAGAGTCATCATTTGGGGAGATCGTCGCCCTTTGGGAAAAGCACTCTGTCTTCCTCCTCACCAGTGGCACACGACACGGGTCAGTATCTAATACAGAGTGTCTCAGAAGCTGCCCCAGAGCCTAGTTTGTGGAGCTACCATTGA

XM_004843039.1 Coding sequence

Lrrc36 leucine rich repeat containing 36, transcript variant X2

Length: 1920 bp    Location: 18979528..18930772   Strand: -
>XM_004843039.1
ATGTTTAGACCATGGTTTTTGCCTCCAGATGATCGAACTGTACGTGACAGTGAGAGGAAAGCTGCCAAGCTCCATTTTAGTCAGTTGAGCAACAGTGAAAATTTTCTTTTAGAGGTGGAAAAAAGCTCTAGGGAGAAGATAATGAAAAACTGTGGGACAGGTGAGGGCTGTGCATCAAAAGTCAACACTGATGTTGACACCAGGCCTGAAACAGCCTCAAACAAAGGACTTTTTATACCCTTCACTAACTGGGAAAGAAAGGATTCCCTAACCAGTACTTCTGCAACCCAGGACAATGGTAAACCAGGTCAGAAATCAGACACTTTTCCCCTGGGGACACAGATGCAGGAAATGACAAGAAAGGAGATGCCAAGTGACAACCCCCAGGACAATGAATTCAAACACTACTCGCCTCGTCAGTCCACAGTCCGATCCCCAGAGAAGATGACGAGAGATGGGTACCGAGTATCTTTTTTGGATAATAAGTCTTCAGGTTCTTCTCCAGAAAAGGACTTGATACCAAAGCTCGATACTTATCATCTTACCCATGATGCCTCATTGGGTAAATGCCTGGATGTAGGTGATTCCAACCAGATCCATCCCTATCAGTTACCTTCTGGCATCAGTTTGGAAAATTATAATAGTCATAATTCTCAAATTCTATCCCTGCATGGAAATCTTGGTAAAAGGCCTCAGAGAAACAAGAACTACCAAGAATATAGCACAAAGCCTTTAAATGACATAAAGGCTACTACATCCCATTCCTGTGGAGATTTATTGACTTCTCTGTCAAACTCTGACTCCAGTACTGGAAGACTTTTGAAACTTAGTTCAGATCTGTATGCCACAACTCATTTCAACAGTGACCCTGCTCTGCTGGCCAATGTAGAACAACAGTTATCCAGCAACCTTGGTGATTTAACACCAGCACATGGTTCTTTACCAAACAACTCTGTCCTGGGAAACTCTCTTCAGACATTGCGGTTGCCTCCTGGGACTTCAGAAGACAGAGAGATTCTGACCAAGAGGTCATTAAGCCCATCGAGGAGAGGATTCAAGCGGAAGGACAATATCCTTGCCAATCTGAATCTAAAGCACGGTTTCCGAGATGGTATAGGCAGCGAGGCAAGTCTTGGCCCTCTCTGTAGTGACCTGGGCAGTTTGCATGGTTTGCCAGGAAACCACAGTCCCCCGATCTCTGCCAGAACCCCCCATGTGGCCACTGTCCTCAGACAGCTCCTGGAGCTTGTGGATAAGCACTGGAGTGACTCTGGCTCCCTGCTCCTCAACAAGAAGTTCCTCGGTCCTGCACAAGATTTGCTTCTGTCTTTGGTTGTCCCTGCTCCTCTGCAGCAGCGATGTCGCCCACATCCTGAAGACACTCCAAAAACTTTCCACAGGAGGGAGAGTGACCTGAAGGAGGCTGAGCAGCCCATCCCTAATGACATGGAAAGTTTAAAGCAAAAACTGGTCAGAGTGCTGGAGGAAAACCTCATTTTGTCAGAAAAAGTTCAGCAGTTGGAGGAAGGTGCAGCCACCTCAATTATGAGTGGGCACCAGTCCCATACTTACGATGATATTCTACACAAAAACCAACAGCTGACCATGCAGGTGGCTTGCCTGAACCAGGAGCTTGCCCAGCTGAAAAAGGTGGAGGAGACGATTGCCCTTCTTCATGAAAGTCAGAGATCCCTGGTGTTAACTAATGAGTATCTGCTGCAGCTGCTGAATAAAGAGCAAAAAGGTTATTCTGGGAAAGCACTCCTGCCCCCTGAGAAGAGTCATCATTTGGGGAGATCGTCGCCCTTTGGGAAAAGCACTCTGTCTTCCTCCTCACCAGTGGCACACGACACGGGTCAGTATCTAATACAGAGTGTCTCAGAAGCTGCCCCAGAGCCTAGTTTGTGGAGCTACCATTGA

XM_004843035.1 Coding sequence

Hsd11b2 hydroxysteroid (11-beta) dehydrogenase 2, transcript variant X2

Length: 978 bp    Location: 18888996..18883355   Strand: -
>XM_004843035.1
ATGAAAACATCCAGGCAAGTTGGAGGCTGTGACACTGGTTTTGGCAAGGAGACAGCCAAGAAACTGGATGCTATGGGCTTCATGGTGCTGGCCACTGTGTTGGACCTGAATAGCCTCGGTGCCCTAGAGCTGCGTGCCTCCTGTTCCCCTCGCCTAAAGCTGCTGCAGATGGACCTGACCAAGCCAGAGGACATCAGCCATGTGCTGGAGTTCACCAAGGCCCACACCACCAGCACTGGCCTCTGGGGTCTGGTCAACAATGCAGGCTTTAACGACATAGTGGCTGATGTGGAGCTGTCTCCAATGGCCAAATTCCGCAACTGCATGGAGGTGAACTTCTTTGGTGTACTTGCGCTAACCAAGGGACTTCTGCCACTTCTGCGCCGCTCAAGGGGTCGCATTGTGACGCTGGGCAGTCCAGCAGGAGACATGCCATATCCGTGCTTGGCAGCCTACGGAACTTCCAAGGCAGCCATAGTACTACTCATGGACTTATTTGGCTCTGAACTTCTTCCCTGGGGGATCAAGGTCAGCGTCATCCAGCCTGCCTGCTTCAAGACAGAGTCAGTGATAAATGTGAACCTCTGGGAACAACGCAAAGAACTGCTGCTGGCCAACCTGCCCCAAGAGCTGCTACAGGCCTATGGTGAAGACTACATTGAGTACTCACACAAGCAATTCCTGAATTCACTCAGCAAGGCACTGCCTGACCTCAGCCCAGTTACAGATGCCATCACTGACGCGCTGCTGGCAGCTCGGCCGCGCCGCCGCTATTACCCAGGCCGCGGCATGGGGCTCATGTACTTCATTCACTACTACTTGCCAGAGAGCCTGCGGCGCCGCTTCCTGCAGACCTTTTTCATTGGTCCCCGGGTGCCCCGAGCACTGCAGCCCGGCCAGCCTGGCCTTACTCTTGCCCAGGATGCAACCCAGAACCCAAACCTGAACCCAGGCCCTTCCCCAGTGGTGGCTCGGTGA

XM_004843028.1 Coding sequence

Fam65a family with sequence similarity 65, member A, transcript variant X2

Length: 3720 bp    Location: 18782993..18773092   Strand: -
>XM_004843028.1
ATGGACGCGAAAAAGAGAGGGAGCCCCGCGCGGACTCATTCCATGATGTCCCTCTCAGTGCGGCCGCAGCGCCGCCTGCTCAGCGCCCGGGTCAGTAGGAGCCAGTCCTTCGCAGGCGTCCTCGGCAGCCACAAGCGAGGGCCCAGCTTCTTTTTAAGGAGCTTCCCAGTCTTCAGCCCACCACCACCAGGGCCCCCACGGAAGGCCCCAGGGCTCTCCCGGGTATCCAGGATGTTTGGTGTGGCCCATCCAGCCCCGAAGGTGCCGCAGCCAGAGCGGCTGGACCTGGTGTACACTGCCCTTAAACGGGGCCTGACGGCCTACTTGGAAGTGCACCAGCAGGAGCAAGAGAAGCTCCAGGGGCAGATAAAGGAATCCAAGAGGAATTCCCGGCTGGGTTTCTTGTATGACTTGGACAAGCAAGTCAAGTCCATTGAACGCTTCCTACGAAGACTGGAATTCCATGCCAGCAAGATCGATGAGCTGTACGAAGCATACTGTGTCCAGCGGCGACTACGAGATGGCGCTTACAACATGGTCCGGGCCTATAGTACAGGGTCTCAAGGGAGCCGAGAAGCCCGAGACAGCCTGGCTGAGGCCACTCGGAGTCATCGAGAGTACACAGAGAGCATGTGTCTGCTGGAGAGCGAGCTGGAGGCACAGCTGGGCGAGTTTCATGTTCGGATGAAAGGGCTGGCTGGCTTTGCCAGGCTGTGTGTGGGTGATCAGTATGAGATCTGCATGAAATATGGCCGTCAGCGCTGGAAACTACGGGGCCGCATTGAGGGTAGTGGGAAGCAGGTGTGGGACAGCGAAGAAACTGTCTTTCTTCCTCTGATCATGGAATTCCTGTCCATCAAGGTGACAGAACTGAAGGGTCTGGCCAACCATGTAGTTGTGGGCAGCGTCTCCTGTGAGACCAAGGACTTGTTCACCGCCCTGCCCCAGGTTGTGGCTGTGGATATCAATGACCTTGGCACCATCAAGCTCAGCCTGGAAGTTACATGGAGCCCCTTTGACAAGGATGACCAGCCCTCAGCCACTTCTACTGTCAACAAAGCCTCCACCGTCACTAAACGCTTCTCCACCTACAGCCAGAGCCCACCAGACACACCCTCACTTCGGGAGCAGGCCTTCTATAACATGCTAAGACGGCAGGAGGAGCTGGAGAATGGGACGGCATGGTCCCTGTCATCCGAATCTTCAGATGATTCATCCAGTCCACAGCTCTCAGGGTCTGCCCGACATTCATCAACCCCTAAGCCCCTAGTGCAGCAGCCTGAGCCCCTGCCTGTCCAAGTTGCCTTCTGCAGGACTGAGACTCCCAGCTCTGGGCCTTTGGATGAGCAGGGGACCACAGCCCCATCCCTGGCCAATGGCCATGCTCCCTACAGCCGGACTCTGAGCCACATCAGTGAGGCTAGTGTGGATGCCGCCCTGGCTGAGGCTTCAGTGGAGGCTGTGGGCTCAGAAAGCCTAGCCCAGGGTCATACCCCACCTACACGCCCAGATCCCACCCACGGGGAGTACGCTAGTCATGTTCCCCTAGATGTGGGTTGTTCTGCCACAAGCCCCACCCTCAGTGCATCCAATCCTGCCTCATGTGCACATCTGGACTCAGTTCATAAGGCCATAGATTCTGGCCCTTCTCATCTGCCAGGGCCCACCCACACTACCACAAGCTCCACCTGTAGTTCCATAAGGCCTGTCAACAGTGCTCCAAACCCCACTTCCACTACTACAGGTTCTACCCATAAGCCCATGGACTCTACCCTCACCACTACAGGCCCTCTCCCCATTAGTACAGGCCCAGCCCAGATTACCACTGTCTCTACCCACACTACTCCAAGCCTCATTCATACCACTATAAGCCCCACCCATACTACCCCAAGTGCCAACCACACTATTCCAAGCTCTGCTCACCCTGTCCCAACCCTCACCGACCCTACTACCCCAAGCCCCACCCACACTACTCCAAGCCCTACAAAAAACACAAGTCCCACCCATACTACTTCAAGCCCCACTCCTGCAACCACAAACCTCACCCACAAAGCCAAGATATCAACTCACACCACTACAAGTCCTATCCGCAATGCCATGGGCCCAGTCCAGACCACTACAAATGTAAGCCTTTTCTCTCCTCAAGACCTTCCTATACACCCTAGTCCCTCTGCAGGCCCCAGCCTCCCAGGCACAGACCCCCTACCCTGTAGCCATGCAGCCTCCCCTCCCTGTTCTCAGGCAAACCCCATAACCCCCAGCACATTGTACCCAAGTCCTGTCCCAGATCCCCTAGATCCTATTATTCAGAACCTAAGCCCTCCTCCCTCACCCTTAGTCCCTGAACCCGAGCATTCAGAACCTAGCCCGGCTATAGCTGCTCAAGTTTCAGTCACAGGGGCAGCTGGAGGGGCTGGGGACAAGAGGCTGGAGGATGCCCTGGGGGCCTTAATGGGTGCCCTGGATGACTACCGGGGCCAGTTCCCTGAGCTGCAAGGCCTGGAGCAGGAGGTGACTCGCCTGGAGAGCCTGCTTATGCAGAGACAAGGCCTGACTCGAAGCCGGGCCTCCAGTCTCAGCATCACTGTGGAGCATGCCCTGGAGAGCTTCAGCTTCCTCAATGAAGATGAAGATGAAGACCATGATGGTCCTGGGGACAGGCCCCCAAGCAGCTTGGAGGGTGGGGCTGAGGAGAGCATAGACTCACTCACTGCCCACCCCCTCAGCACGGGGTGTCCAGCTCTGGATGCTGCCTTGGTCCAGCACCTGTACCACTGCAGTCGTCTCCTGCTGAAACTGGGTACATTTGGGCCCTTGCGCTGTCAGGAGGCACGGGCCCTGGAGCAGCTACTTCGGGAAGCCCGAGTGTTTGAGGCAGTGTGTGAGCTCAGCAGGGTATGGGAGATCCCTGCCACTTCTGCCCAGGAAGTGGTGCAGTTCTCAGCCTGTAAGCCTGGGTTCCTGATCTTCTGGGACAAGTGCACAGAGGGACTCAGCCCCTTCATCTGTCCTGTGGAGCAGGTGCTCCTTACCTTCTGCACCCAGTATGGTGCCCGTCTCTCCATGCGCCAGCCAGGCTTAGCTGAGGCTGTTTGTGTGAAATTCGTGGAGGATGCCCTAGGGCAGAAGCTGCCCAGGAGGCCCCAGCCAGGTCCTGGGGAGCAGCTCACCGTCTTTCAGTTTTGGAGTTACGTGGAAGCCTTGGACAGCACCTCCATGGAGGCCTATGTGACTGAGACCGCTGAGGAGGTGTTACTGGTACGGAATTTGAACTCTGATGACCAGGCTATTGTGCTGAAGGCCCTGAGGTTGGCACCTGAAGGACGGCTTCGAAGGGATGGGCTTCGGGCCCTGAGCTCCCTGCTTGTCCATGGCAACAACAAGGTTATGGCTGCTGTCAGCACCCAGCTCCGGAGCCTGTCGCTGGGCCCTACCTTCCGGGAGAGGGCCCTCCTGTGCTTCCTGGACCAGCTCGAGGATGAGGATGTACATAATCGAGTGGCTGGCTGCCTGGCCCTGGGCTGCATCAAGGCTCCTGAAGGCATTGAGCCCCTGGTGTATCTGTGCCAAACAGACACAGAGGCTGTGAGGGAAGCTGCCCGGCAGAGCCTGCAGCAGTGTGGAGAAGAAGGACAGTCAGCCCATCGACGACTGGAGGAGTCACTGGATGCCCTGCCCCGCATATTTGGGCCTGGCAGCATGGCCAGCACAGCGTTCTAA

XM_004843032.1 Coding sequence

Atp6v0d1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1, transcript variant X1

Length: 1056 bp    Location: 18828024..18883128   Strand: +
>XM_004843032.1
ATGTCGTTCTTCCCGGAGCTATACTTCAACGTAGACAATGGCTACTTGGAGGGACTGGTGCGCGGCCTGAAGGCAGGGGTGCTCAGCCAGGCCGACTATCTCAACCTGGTGCAGTGCGAGACGCTAGAGGACTTGAAGTTGCACCTACAGAGCACAGACTACGGCAACTTCCTGGCCAACGAGGCCTCGCCTCTGACAGTGTCAGTCATCGATGACCGGCTCAAGGAAAAGATGGTGGTGGAGTTCCGCCACATGAGGAACCATGCCTATGAGCCACTTGCCAGCTTCCTGGATTTTATTACTTACAGCTACATGATTGACAATGTGATCCTGCTCATCACGGGCACGCTGCACCACCGCTCCATTGCTGAGCTCGTACCCAAGTGCCACCCACTAGGCAGCTTCGAACAGATGGAAGCCGTGAACATCGCACAGACACCTGCTGAGCTCTACAATGCCATTCTGGTGGACACGCCCCTGGCGGCTTTTTTCCAAGACTGCATCTCAGAACAGGACCTTGATGAGATGAACATTGAGATCATCCGCAACACACTCTACAAGGCCTACCTGGAGTCCTTCTACAAGTTCTGCACCTTACTGGGCGGGACCACAGCTGATGCCATGTGCCCCATCCTGGAGTTTGAAGCAGACCGTCGCGCCTTCATCATCACCATCAACTCTTTCGGCACAGAGCTGTCTAAGGAGGACCGTGCCAAGCTCTTTCCTCACTGTGGACGCCTCTACCCTGAGGGCCTGGCTCAGCTGGCTCGGGCTGATGACTATGAACAGGTCAAGAATGTGGCCGATTACTACCCGGAATACAAACTGCTTTTTGAGGGTGCAGGGAGCAATCCTGGAGACAAGACCCTGGAGGACCGATTCTTTGAGCATGAGGTGAAACTGAACAAGTTGGCATTCCTGAACCAGTTCCACTTTGGAGTCTTCTATGCCTTTGTGAAGCTTAAGGAGCAGGAGTGTCGCAATATTGTGTGGATTGCTGAGTGCATTGCCCAGCGCCATCGCGCCAAGATCGACAACTACATCCCCATCTTCTAG

XM_004843024.1 Coding sequence

Ctcf CCCTC-binding factor (zinc finger protein), transcript variant X1

Length: 2187 bp    Location: 18760190..18707808   Strand: -
>XM_004843024.1
ATGGAAGGTGAGGCTGTTGAAGCCATTGTGGAAGAGTCTGAAACTTTCATTAAAGGAAAGGAGAGAAAGACTTACCAGCGACGCCGGGAAGGAGGTCAGGAAGAAGATGCTTGCCACCTGCCCCAGAACCAGACGGATGGGGGTGAGGTGGTTCAGGATGTCAACAGCAGTGTACAGATGGTAATGATGGAACAGCTGGATCCTACCCTTCTTCAGATGAAGACTGAAGTAATGGAGGGCTCAGTGGCTCCAGAGGCAGAGGCTGCTGTGGACGATACACAGATCATAACTTTACAGGTTGTAAATATGGAAGAACAGCCTATAAACATAGGAGAGCTGCAGCTTGTTCAAGTACCTGTTCCTGTAACTGTACCTGTTGCTACCACTTCAGTAGAAGAACTTCAGGGGGCTTATGAAAATGAAGTATCTAAAGAGGGCCTTGCAGAAAGTGAACCCATGATATGTCACACCTTACCTTTGCCTGAAGGGTTTCAGGTGGTGAAAGTGGGGGCCAATGGAGAGGTGGAGACACTAGAGCAAGGGGAACTTCCACCTCAGGAAGATCCTAGCTGGCAAAAAGACCCAGACTATCAGCCACCAGCCAAAAAAACAAAGAAAACCAAAAAGAGCAAACTGCGTTACACAGAGGAGGGCAAAGATGTGGATGTGTCTGTCTATGATTTTGAGGAAGAACAGCAGGAAGGTCTGCTGTCAGAGGTTAATGCAGAAAAAGTAGTTGGTAATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGTGTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCCACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCCTCCTGAGGAATCACCTTAATACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGTGACATGGCCTTTGTGACCAGTGGAGAATTGGTGCGGCATCGTCGTTACAAACACACCCACGAGAAGCCATTTAAGTGTTCCATGTGTGATTATGCCAGTGTAGAAGTCAGCAAATTAAAACGTCACATTCGCTCTCATACTGGTGAGCGTCCGTTCCAGTGCAGTTTGTGCAGTTACGCCAGCAGGGATACATACAAGCTCAAAAGGCACATGAGAACCCATTCAGGGGAAAAACCTTATGAATGTTATATTTGTCATGCTCGGTTTACCCAGAGTGGTACCATGAAGATGCACATCTTACAGAAGCACACAGAAAATGTGGCTAAGTTTCATTGTCCCCACTGTGACACTGTCATAGCCCGAAAAAGTGATTTGGGTGTCCACTTGCGAAAGCAGCATTCCTATATTGAACAAGGCAAGAAATGCCGTTACTGCGATGCTGTATTTCATGAGCGCTATGCCCTCATCCAGCATCAGAAATCACACAAGAATGAGAAACGCTTTAAGTGTGACCAGTGTGATTATGCTTGTAGACAGGAGAGGCACATGATCATGCATAAACGTACCCACACCGGGGAGAAGCCTTATGCTTGCACCCACTGCGACAAGACCTTCCGCCAAAAACAGCTCCTCGACATGCACTTCAAGCGCTATCATGACCCCAACTTTGTTCCTGCGGCCTTTGTCTGTTCTAAGTGTGGGAAGACATTTACACGTCGGAATACCATGGCAAGACATGCTGATAATTGTGCTGGTCCAGATGGTGTAGAAGGTGAAAATGGAGGAGAAACGAAGAAGAGTAAACGTGGAAGAAAAAGAAAAATGCGCTCTAAAAAAGAAGATTCCTCTGATAGTGAAGAAAATGCTGAGCCCGATCTGGATGACAATGAGGATGAGGAGGAACCTGCAGTAGAAATTGAACCTGAACCAGAGCCTCAGCCCGTGACCCCAGCCCCACCACCTGCCAAAAAGCGGAGAGGGCGACCACCTGGCAGAACCAATCAGCCCAAACAGAACCAGCCAACAGCCATCATTCAGGTTGAAGACCAGAATACAGGTGCAATTGAGAACATTATAGTTGAAGTCAAAAAAGAGCCAGACGCTGAGCCTGTGGAGGGGGAAGAAGAAGAGGCCCAGCCAGCCACCACAGATGCCCCCAATGGGGACCTCACACCTGAGATGATCCTCAGCATGATGGACCGGTGA

XM_004843025.1 Coding sequence

Ctcf CCCTC-binding factor (zinc finger protein), transcript variant X2

Length: 2187 bp    Location: 18746379..18707808   Strand: -
>XM_004843025.1
ATGGAAGGTGAGGCTGTTGAAGCCATTGTGGAAGAGTCTGAAACTTTCATTAAAGGAAAGGAGAGAAAGACTTACCAGCGACGCCGGGAAGGAGGTCAGGAAGAAGATGCTTGCCACCTGCCCCAGAACCAGACGGATGGGGGTGAGGTGGTTCAGGATGTCAACAGCAGTGTACAGATGGTAATGATGGAACAGCTGGATCCTACCCTTCTTCAGATGAAGACTGAAGTAATGGAGGGCTCAGTGGCTCCAGAGGCAGAGGCTGCTGTGGACGATACACAGATCATAACTTTACAGGTTGTAAATATGGAAGAACAGCCTATAAACATAGGAGAGCTGCAGCTTGTTCAAGTACCTGTTCCTGTAACTGTACCTGTTGCTACCACTTCAGTAGAAGAACTTCAGGGGGCTTATGAAAATGAAGTATCTAAAGAGGGCCTTGCAGAAAGTGAACCCATGATATGTCACACCTTACCTTTGCCTGAAGGGTTTCAGGTGGTGAAAGTGGGGGCCAATGGAGAGGTGGAGACACTAGAGCAAGGGGAACTTCCACCTCAGGAAGATCCTAGCTGGCAAAAAGACCCAGACTATCAGCCACCAGCCAAAAAAACAAAGAAAACCAAAAAGAGCAAACTGCGTTACACAGAGGAGGGCAAAGATGTGGATGTGTCTGTCTATGATTTTGAGGAAGAACAGCAGGAAGGTCTGCTGTCAGAGGTTAATGCAGAAAAAGTAGTTGGTAATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGTGTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCCACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCCTCCTGAGGAATCACCTTAATACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGTGACATGGCCTTTGTGACCAGTGGAGAATTGGTGCGGCATCGTCGTTACAAACACACCCACGAGAAGCCATTTAAGTGTTCCATGTGTGATTATGCCAGTGTAGAAGTCAGCAAATTAAAACGTCACATTCGCTCTCATACTGGTGAGCGTCCGTTCCAGTGCAGTTTGTGCAGTTACGCCAGCAGGGATACATACAAGCTCAAAAGGCACATGAGAACCCATTCAGGGGAAAAACCTTATGAATGTTATATTTGTCATGCTCGGTTTACCCAGAGTGGTACCATGAAGATGCACATCTTACAGAAGCACACAGAAAATGTGGCTAAGTTTCATTGTCCCCACTGTGACACTGTCATAGCCCGAAAAAGTGATTTGGGTGTCCACTTGCGAAAGCAGCATTCCTATATTGAACAAGGCAAGAAATGCCGTTACTGCGATGCTGTATTTCATGAGCGCTATGCCCTCATCCAGCATCAGAAATCACACAAGAATGAGAAACGCTTTAAGTGTGACCAGTGTGATTATGCTTGTAGACAGGAGAGGCACATGATCATGCATAAACGTACCCACACCGGGGAGAAGCCTTATGCTTGCACCCACTGCGACAAGACCTTCCGCCAAAAACAGCTCCTCGACATGCACTTCAAGCGCTATCATGACCCCAACTTTGTTCCTGCGGCCTTTGTCTGTTCTAAGTGTGGGAAGACATTTACACGTCGGAATACCATGGCAAGACATGCTGATAATTGTGCTGGTCCAGATGGTGTAGAAGGTGAAAATGGAGGAGAAACGAAGAAGAGTAAACGTGGAAGAAAAAGAAAAATGCGCTCTAAAAAAGAAGATTCCTCTGATAGTGAAGAAAATGCTGAGCCCGATCTGGATGACAATGAGGATGAGGAGGAACCTGCAGTAGAAATTGAACCTGAACCAGAGCCTCAGCCCGTGACCCCAGCCCCACCACCTGCCAAAAAGCGGAGAGGGCGACCACCTGGCAGAACCAATCAGCCCAAACAGAACCAGCCAACAGCCATCATTCAGGTTGAAGACCAGAATACAGGTGCAATTGAGAACATTATAGTTGAAGTCAAAAAAGAGCCAGACGCTGAGCCTGTGGAGGGGGAAGAAGAAGAGGCCCAGCCAGCCACCACAGATGCCCCCAATGGGGACCTCACACCTGAGATGATCCTCAGCATGATGGACCGGTGA

XM_004843027.1 Coding sequence

Fam65a family with sequence similarity 65, member A, transcript variant X1

Length: 3708 bp    Location: 18782992..18773092   Strand: -
>XM_004843027.1
ATGGACGCGAAAAAGAGAGGGAGCCCCGCGCGGACTCATTCCATGATGTCCCTCTCAGTGCGGCCGCAGCGCCGCCTGCTCAGCGCCCGGGTCAGTAGGAGCCAGTCCTTCGCAGGCGTCCTCGGCAGCCACAAGCGAGGGCCCAGGAGCTTCCCAGTCTTCAGCCCACCACCACCAGGGCCCCCACGGAAGGCCCCAGGGCTCTCCCGGGTATCCAGGATGTTTGGTGTGGCCCATCCAGCCCCGAAGGTGCCGCAGCCAGAGCGGCTGGACCTGGTGTACACTGCCCTTAAACGGGGCCTGACGGCCTACTTGGAAGTGCACCAGCAGGAGCAAGAGAAGCTCCAGGGGCAGATAAAGGAATCCAAGAGGAATTCCCGGCTGGGTTTCTTGTATGACTTGGACAAGCAAGTCAAGTCCATTGAACGCTTCCTACGAAGACTGGAATTCCATGCCAGCAAGATCGATGAGCTGTACGAAGCATACTGTGTCCAGCGGCGACTACGAGATGGCGCTTACAACATGGTCCGGGCCTATAGTACAGGGTCTCAAGGGAGCCGAGAAGCCCGAGACAGCCTGGCTGAGGCCACTCGGAGTCATCGAGAGTACACAGAGAGCATGTGTCTGCTGGAGAGCGAGCTGGAGGCACAGCTGGGCGAGTTTCATGTTCGGATGAAAGGGCTGGCTGGCTTTGCCAGGCTGTGTGTGGGTGATCAGTATGAGATCTGCATGAAATATGGCCGTCAGCGCTGGAAACTACGGGGCCGCATTGAGGGTAGTGGGAAGCAGGTGTGGGACAGCGAAGAAACTGTCTTTCTTCCTCTGATCATGGAATTCCTGTCCATCAAGGTGACAGAACTGAAGGGTCTGGCCAACCATGTAGTTGTGGGCAGCGTCTCCTGTGAGACCAAGGACTTGTTCACCGCCCTGCCCCAGGTTGTGGCTGTGGATATCAATGACCTTGGCACCATCAAGCTCAGCCTGGAAGTTACATGGAGCCCCTTTGACAAGGATGACCAGCCCTCAGCCACTTCTACTGTCAACAAAGCCTCCACCGTCACTAAACGCTTCTCCACCTACAGCCAGAGCCCACCAGACACACCCTCACTTCGGGAGCAGGCCTTCTATAACATGCTAAGACGGCAGGAGGAGCTGGAGAATGGGACGGCATGGTCCCTGTCATCCGAATCTTCAGATGATTCATCCAGTCCACAGCTCTCAGGGTCTGCCCGACATTCATCAACCCCTAAGCCCCTAGTGCAGCAGCCTGAGCCCCTGCCTGTCCAAGTTGCCTTCTGCAGGACTGAGACTCCCAGCTCTGGGCCTTTGGATGAGCAGGGGACCACAGCCCCATCCCTGGCCAATGGCCATGCTCCCTACAGCCGGACTCTGAGCCACATCAGTGAGGCTAGTGTGGATGCCGCCCTGGCTGAGGCTTCAGTGGAGGCTGTGGGCTCAGAAAGCCTAGCCCAGGGTCATACCCCACCTACACGCCCAGATCCCACCCACGGGGAGTACGCTAGTCATGTTCCCCTAGATGTGGGTTGTTCTGCCACAAGCCCCACCCTCAGTGCATCCAATCCTGCCTCATGTGCACATCTGGACTCAGTTCATAAGGCCATAGATTCTGGCCCTTCTCATCTGCCAGGGCCCACCCACACTACCACAAGCTCCACCTGTAGTTCCATAAGGCCTGTCAACAGTGCTCCAAACCCCACTTCCACTACTACAGGTTCTACCCATAAGCCCATGGACTCTACCCTCACCACTACAGGCCCTCTCCCCATTAGTACAGGCCCAGCCCAGATTACCACTGTCTCTACCCACACTACTCCAAGCCTCATTCATACCACTATAAGCCCCACCCATACTACCCCAAGTGCCAACCACACTATTCCAAGCTCTGCTCACCCTGTCCCAACCCTCACCGACCCTACTACCCCAAGCCCCACCCACACTACTCCAAGCCCTACAAAAAACACAAGTCCCACCCATACTACTTCAAGCCCCACTCCTGCAACCACAAACCTCACCCACAAAGCCAAGATATCAACTCACACCACTACAAGTCCTATCCGCAATGCCATGGGCCCAGTCCAGACCACTACAAATGTAAGCCTTTTCTCTCCTCAAGACCTTCCTATACACCCTAGTCCCTCTGCAGGCCCCAGCCTCCCAGGCACAGACCCCCTACCCTGTAGCCATGCAGCCTCCCCTCCCTGTTCTCAGGCAAACCCCATAACCCCCAGCACATTGTACCCAAGTCCTGTCCCAGATCCCCTAGATCCTATTATTCAGAACCTAAGCCCTCCTCCCTCACCCTTAGTCCCTGAACCCGAGCATTCAGAACCTAGCCCGGCTATAGCTGCTCAAGTTTCAGTCACAGGGGCAGCTGGAGGGGCTGGGGACAAGAGGCTGGAGGATGCCCTGGGGGCCTTAATGGGTGCCCTGGATGACTACCGGGGCCAGTTCCCTGAGCTGCAAGGCCTGGAGCAGGAGGTGACTCGCCTGGAGAGCCTGCTTATGCAGAGACAAGGCCTGACTCGAAGCCGGGCCTCCAGTCTCAGCATCACTGTGGAGCATGCCCTGGAGAGCTTCAGCTTCCTCAATGAAGATGAAGATGAAGACCATGATGGTCCTGGGGACAGGCCCCCAAGCAGCTTGGAGGGTGGGGCTGAGGAGAGCATAGACTCACTCACTGCCCACCCCCTCAGCACGGGGTGTCCAGCTCTGGATGCTGCCTTGGTCCAGCACCTGTACCACTGCAGTCGTCTCCTGCTGAAACTGGGTACATTTGGGCCCTTGCGCTGTCAGGAGGCACGGGCCCTGGAGCAGCTACTTCGGGAAGCCCGAGTGTTTGAGGCAGTGTGTGAGCTCAGCAGGGTATGGGAGATCCCTGCCACTTCTGCCCAGGAAGTGGTGCAGTTCTCAGCCTGTAAGCCTGGGTTCCTGATCTTCTGGGACAAGTGCACAGAGGGACTCAGCCCCTTCATCTGTCCTGTGGAGCAGGTGCTCCTTACCTTCTGCACCCAGTATGGTGCCCGTCTCTCCATGCGCCAGCCAGGCTTAGCTGAGGCTGTTTGTGTGAAATTCGTGGAGGATGCCCTAGGGCAGAAGCTGCCCAGGAGGCCCCAGCCAGGTCCTGGGGAGCAGCTCACCGTCTTTCAGTTTTGGAGTTACGTGGAAGCCTTGGACAGCACCTCCATGGAGGCCTATGTGACTGAGACCGCTGAGGAGGTGTTACTGGTACGGAATTTGAACTCTGATGACCAGGCTATTGTGCTGAAGGCCCTGAGGTTGGCACCTGAAGGACGGCTTCGAAGGGATGGGCTTCGGGCCCTGAGCTCCCTGCTTGTCCATGGCAACAACAAGGTTATGGCTGCTGTCAGCACCCAGCTCCGGAGCCTGTCGCTGGGCCCTACCTTCCGGGAGAGGGCCCTCCTGTGCTTCCTGGACCAGCTCGAGGATGAGGATGTACATAATCGAGTGGCTGGCTGCCTGGCCCTGGGCTGCATCAAGGCTCCTGAAGGCATTGAGCCCCTGGTGTATCTGTGCCAAACAGACACAGAGGCTGTGAGGGAAGCTGCCCGGCAGAGCCTGCAGCAGTGTGGAGAAGAAGGACAGTCAGCCCATCGACGACTGGAGGAGTCACTGGATGCCCTGCCCCGCATATTTGGGCCTGGCAGCATGGCCAGCACAGCGTTCTAA

XM_004843019.1 Coding sequence

Pard6a par-6 partitioning defective 6 homolog alpha (C. elegans), transcript variant X1

Length: 1044 bp    Location: 18688703..18686921   Strand: -
>XM_004843019.1
ATGGCCAGGCCGCAGAGGACTCCGGCGCGCAGTCCTGACAGCATCGTCGAGGTGAAGAGCAAATTTGACGCCGAGTTCCGACGCTTCGCACTGCCCCGAGCTTCGGTGAGCGGCTTCCAGGAGTTCTCACGGTTGCTGCGAGCGGTGCACCAGATCCAGGGCCTGGACGTGCTGCTTGGCTACACAGATGCTCACGGCGACCTGCTGCCCCTCACCAACGATGACAGTCTGCACCGGGCGCTGGCCAGTGGTCCCTCACCGCTGCGCCTACTGGTGCAGAAGCGGGCAGAAGCAGACTCCAGAAGCCTGGCTTTTGCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGGCTCTTGCTGCGACCAGTGGCCCCACTGCGTACCCGGCCACCTCTGCTAATTGGCCTGCCCCAAGATTTTCGCCAGGTTTCCTCAGTGATAGATGTGGACCTACTACCTGAGACCCACCGACGAGTGCGGCTGCACAAGCATGGTTCAGACCGCCCCCTGGGTTTCTACATACGAGATGGGATGAGCGTCCGTGTGGCTCCCCAGGGCCTGGAGCGGGTTCCAGGCATCTTCATCTCCCGCCTGGTACGTGGGGGCCTGGCTGAGAGTACAGGGCTGCTGGCAGTCAGTGATGAGATCCTCGAGGTCAATGGCATTGAGGTGGCTGGGAAGACCTTGGATCAAGTGACGGACATGATGGTTGCCAACAGCCATAACCTCATTGTCACTGTCAAGCCTGCCAACCAGCGCAATAATGTGGTTCGAGGGGCATCTGGGCGTCTGACAGGGCCTCCCTCTGCAGGACCTGGGCCTACTGAGCCCGACAGTGATGATGATGACAGCAGTGACCTGGTCCTTGACAACCGCCAGACTCCCTGTTACAATGGGCTGTCTCAGGGTCCCCCATGCTGGGACTTGCATTCTGGGTGCCTACTTCCTGGTGCCCGCAGCTCTCTCCCCTCCCTGGATGATCAAGGACAGGCCAGCTCTGGCTGGGGGAGTGGCATACGAGGAGATGGTAGTGGCTTCAGCCTTTGA

XM_004843002.1 Coding sequence

Nrn1l neuritin 1-like

High confidence: 4 potential gene matches
Length: 495 bp    Location: 18492127..18490760   Strand: -
>XM_004843002.1
ATGCGCGGCTGCCGCTATTGCTGCTGCTGGAGGCAGCCACCCCGTGCCCTGAGGCTGTTGGTGTTGGTGCCATTTGTTCTTGTACCTCCCCTAGCAGCAGCCACAGAGGGTCCAAATCGTTGTGATACCATATACCAGGGCTTCGCAGAGTGTCTCATCCGCCTGGGGGATGGCATGGGCCACGGAGGCGAGCTGGAGACTATCTGCAGGTCCTGGAATGACTTCCATGCCTGTGCCTCTCGGGTCCTGTTGGGGTGCCCAGAGGAGGCAGCTGCTGTGTGGGAGTCACTACAGCAAGAAGCTCGTCGGGCCCCGAACCCGGATAACTTACACACTCTATGTGGTGCCCCAGTGCGTGTTCGGGAGCGTGATGCAGGCCCAGAAACCAACCAGGAGACGTTAAGGGTGACAGGGCCTGCACCTGCCCCAGCCCCCCTGCCTTCCCTGTTGGCTGCTGCTTTGGCCCTAGCTTGTCTCCTGGGGCCCCTGGCCTAG

XM_004843000.1 Coding sequence

Ctrl chymotrypsin-like

High confidence: 1 potential gene match
Length: 795 bp    Location: 18447574..18449964   Strand: +
>XM_004843000.1
ATGCTACTGCTCAGCCTAACCTTTACCTTGGTTCTCCTAGGCTCCTCCTGGGGCTGTGGCGTTCCTGCCATCAGACCAGCACTGAGCTTCAGCCAGAGGATTGTCAACGGGGAGAATGCAGCATCAGGCTCCTGGCCCTGGCAAGTGTCCCTGCAGGACAGAAACGGCTTCCACTTCTGTGGTGGTTCTCTCATCAGCACGAATTGGGTGGTCACTGCTGCCCACTGCCAAGTTAGTCCTGGCAGCCACTCTGTCGTCCTGGGCGAGTATGATCTATCATCCAACGCTGAGCCTGTGCAGGTGCGGTCCATCTCAAAGGCCATTACACACCCAAGCTGGAACCCCACCACTCTGAACAATGACCTGACGCTCCTGAAGCTTGCCTCACCAGTCCAGTATACAGCACGCATCTCACCTGTCTGCCTGGCTTCCTCAAATGAAGCACTCTATGATGGCCTCAAGTGTGTCACCACTGGCTGGGGCCGCCTCAGTGGCGTGGGCAATGTGACACCAGCACGCCTCCAACAGGCAGTTCTGCCCCTGGTCACTGTGAATCAGTGCCGACAATATTGGGGCTCACAAATCACTGCCTCCATGGTCTGTGCAGGTGCCTCAGGTGTCTCCTCATGCCAGGGTGACTCGGGAGGCCCTCTTGTCTGCCAGAAAGGGAGCACATGGGTGCTTATTGGTGTTGTCTCCTGGGGGACTGATAACTGCAATGTGCAAGCACCTGCTATCTACACTCGGGTTAGCAAGTTCAACAGCTGGATTAACCAGGTCATAGCCTCCAACTGA

XM_004842997.1 Coding sequence

Slc12a4 solute carrier family 12 (potassium/chloride transporters), member 4, transcript variant X6

Length: 3138 bp    Location: 18414602..18438279   Strand: +
>XM_004842997.1
ATGCCTCACTTCACCGTGGTGCCGGTGGACGGGCCGCGACGCGGCGACTATGACAACCTCGAGGGGCTCAGTTGGGTGGACTACGGGGAGCACGCCGAGCGGGAAGAGTTGGACGGACAGGGTAACCACAGGGAGAACAGCCCTTTTCTTTGCCCCTTGGAGGCTTCCAGAGGAAGTGACTACTATGATAGGAACCTGGCACTGTTTGAGGAGGAGCTGGACATCCGCCCAAAGGTATCATCACTTCTGGGCAAACTCGTCAGCTATACTAACCTCACCCAGGGTGCCAAGGAGCATGAAGAGGCTGAGAGTGGGGAAGGCACCCGCCGGAGAGCAGCCAAGGCACCCAGCATGGGCACCCTCATGGGGGTGTACCTGCCCTGCTTACAGAATATCTTCGGAGTCATCCTCTTCCTGAGGCTAACCTGGATGGTAGGCATGGCCGGGGTGCTGCAGGCGCTCCTCATTGTGCTCATCTGCTGCTGCTGTACTTTGCTGACAGCCATTTCCATGAGTGCCATCGCCACCAATGGTGTGGTTCCAGCTGGTGGCTCCTACTTCATGATCTCCCGCTCACTGGGACCAGAATTTGGAGGTGCTGTAGGCCTATGCTTCTACCTGGGAACAACATTTGCAGCAGCCATGTACATCCTGGGCGCCATCGAGATCTTGCTGACCTACATTGCCCCACCAGCTGCCATTTTTTACCCATTGGGTGCTCATGACACATCAAATGCCACCTTGAACAATATGCGTGTGTACGGGACCATTTTTCTGACATTTATGACCCTAGTGGTGTTTGTTGGTGTCAAGTATGTGAACAAATTCGCTTCACTCTTCCTGGCCTGTGTGATCATCTCCATCCTTTCCATCTATGCTGGAGGCATCAAGTCTATTTTTGACCCTCCTGTGTTTCCGGTATGCATGCTAGGCAACAGGACTCTGTCCCGGGACCAGTTTGATATCTGCGCCAAGACAGCTGTGGTGGACAATGAGACAGTGGCCACCCACCTGTGGAGTTTATTCTGCCACAGTCCCAACCTTACCACTGATTCCTGTGACCCCTACTTCCTGCTCAACAATGTGACTGAGATCCCTGGCATCCCTGGGGCAGCTGCTGGTGTGCTCCAGGAAAACCTGTGGAGTGCCTACCTGGAGAAGGGCGAGGTGGTGGAGAAGCATGGGCTGCCCTCCGTGGACACTCTCAGCCTGAAGGACAGTCTGCCCCAGTACGTGATGGCTGACATTGCCACATCCTTCACAGTGTTGGTTGGCATTTTCTTCCCCTCTGTAACAGGCATCATGGCTGGCTCCAATCGCTCCGGGGACCTCCGTGATGCCCAGAAGTCCATCCCGGTGGGAACCATTCTGGCCATCGTTACAACTTCACTTGTGTACTTCAGCAGTGTGGTTCTCTTTGGTGCCTGCATCGAGGGTGTGGTGCTCCGGGACAAGTATGGGGATGGTGTCAGCAGGAACCTGGTGGTGGGCACATTGGCCTGGCCTTCGCCCTGGGTCATTGTTATTGGCTCCTTCTTCTCAACATGTGGCGCTGGCCTCCAGAGCCTCACTGGGGCACCACGCCTGTTGCAGGCCATCGCCAAGGACAACATCATTCCCTTCCTCCGGGTATTTGGCCACGGAAAGGCGAATGGCGAACCAACTTGGGCACTCCTCCTGACTGCGCTCATCGCTGAGCTTGGCATCCTTATTGCTTCCCTCGACATGGTGGCCCCCATTCTATCCATGTTCTTTCTGATGTGTTACCTCTTTGTGAACCTGGCCTGTGCTGTCCAGACACTCTTGAGGACCCCCAACTGGCGGCCTCGGTTCAAATATTATCACTGGGCTGAGAAGGAGTGGGGTGATGGTATTCGAGGCCTATCCCTGAGCGCTGCCCGCTATGCACTGTTACGGCTAGAGGAGGGCCCTCCTCACACCAAGAACTGGCGGCCTCAGCTCCTGGTGCTCCTGAAGCTAGACGAGGACCTTCATGTGAAGTACCCCCGGCTCCTCACCTTTGCCTCCCAGCTTAAGGCAGGCAAGGGCCTGACAATTGTTGGCTCTGTCATCCAGGGCAGCTTCTTGGAGAGCTATGGCGAGGCCCAGGCTGCTGAGCAGACAATCAAGAACATGATGGAGATTGAGAAAGTAAAAGGCTTCTGCCAGGTAGTGGTGGCCAGCAAGGTGCGTGAGGGACTGGCTCACCTCATCCAGTCTTGCGGCCTAGGCGGCATGAGGCATAACTCCGTGGTGCTGGGCTGGCCCTATGGCTGGCGACAGAGTGAGGACCCCCGTGCCTGGAAGACCTTTATTGACACTGTGCGCTGCACCACAGCTGCCCATCTGGCCCTGCTGGTGCCCAAGAACATCGCCTTCTACCCCAGCAACCATGAGCGCTACCTGGAGGGCCACATTGATGTATGGTGGATCGTGCACGATGGTGGCATGCTCATGCTTTTGCCCTTCCTGCTCCGCCAGCATAAGGTTTGGAGGAAGTGCCGGATGCGAATCTTCACAGTGGCCCAGATGGATGACAATAGCATCCAGATGAAGAAGGATTTGGCCATCTTCCTCTACCACCTCCGCCTTGAGGCAGAGGTGGAGGTGGTGGAGATGCATAACAGCGACATATCTGCCTACACCTACGAACGCACACTGATGATGGAACAGCGGTCCCAGATGCTGCGGCAGATGCGGCTGACCAAGACTGAGCGGGAGCGAGAAGCACAACTGGTCAAGGATAGGCACTCAGCTTTGCGTCTGGAAAGCCTGTACTCAGACGAGGAAGACGAGTCTGCAGCAGGGGCTGACAAGATCCAAATGACATGGACCCGAGACAAGCACATGACTGAGCCCTGGGACCCCAGCCATGCCCCTGACAACTTCCGGGAGCTGGTGCATATTAAGCCGGACCAGTCCAATGTGCGACGCATGCACACTGCTGTAAAGCTCAATGAAGTCATTGTCACACGATCCCACGATGCCCGCCTGGTCCTACTGAACATGCCTGGCCCACCCAAAAACAGCGAGGGTGATGAGAACTACATGGAGTTCCTTGAGGTGCTGACTGAGGGCCTTGAGCGGGTGTTGTTGGTGCGTGGCGGTGGCCGTGAAGTCATCACCATCTACTCCTGA

XM_004842996.1 Coding sequence

Slc12a4 solute carrier family 12 (potassium/chloride transporters), member 4, transcript variant X5

Length: 3165 bp    Location: 18416106..18438279   Strand: +
>XM_004842996.1
ATGGGTGACACCTTGCACCCCGGACAGGGTAACCACAGGGAGAACAGCCCTTTTCTTTGCCCCTTGGAGGCTTCCAGAGGAAGTGACTACTATGATAGGAACCTGGCACTGTTTGAGGAGGAGCTGGACATCCGCCCAAAGGTATCATCACTTCTGGGCAAACTCGTCAGCTATACTAACCTCACCCAGGGTGCCAAGGAGCATGAAGAGGCTGAGAGTGGGGAAGGCACCCGCCGGAGAGCAGCCAAGGCACCCAGCATGGGCACCCTCATGGGGGTGTACCTGCCCTGCTTACAGAATATCTTCGGAGTCATCCTCTTCCTGAGGCTAACCTGGATGGTAGGCATGGCCGGGGTGCTGCAGGCGCTCCTCATTGTGCTCATCTGCTGCTGCTGTACTTTGCTGACAGCCATTTCCATGAGTGCCATCGCCACCAATGGTGTGGTTCCAGCTGGTGGCTCCTACTTCATGATCTCCCGCTCACTGGGACCAGAATTTGGAGGTGCTGTAGGCCTATGCTTCTACCTGGGAACAACATTTGCAGCAGCCATGTACATCCTGGGCGCCATCGAGATCTTGCTGACCTACATTGCCCCACCAGCTGCCATTTTTTACCCATTGGGTGCTCATGACACATCAAATGCCACCTTGAACAATATGCGTGTGTACGGGACCATTTTTCTGACATTTATGACCCTAGTGGTGTTTGTTGGTGTCAAGTATGTGAACAAATTCGCTTCACTCTTCCTGGCCTGTGTGATCATCTCCATCCTTTCCATCTATGCTGGAGGCATCAAGTCTATTTTTGACCCTCCTGTGTTTCCGGTATGCATGCTAGGCAACAGGACTCTGTCCCGGGACCAGTTTGATATCTGCGCCAAGACAGCTGTGGTGGACAATGAGACAGTGGCCACCCACCTGTGGAGTTTATTCTGCCACAGTCCCAACCTTACCACTGATTCCTGTGACCCCTACTTCCTGCTCAACAATGTGACTGAGATCCCTGGCATCCCTGGGGCAGCTGCTGGTGTGCTCCAGGAAAACCTGTGGAGTGCCTACCTGGAGAAGGGCGAGGTGGTGGAGAAGCATGGGCTGCCCTCCGTGGACACTCTCAGCCTGAAGGACAGTCTGCCCCAGTACGTGATGGCTGACATTGCCACATCCTTCACAGTGTTGGTTGGCATTTTCTTCCCCTCTGTAACAGGCATCATGGCTGGCTCCAATCGCTCCGGGGACCTCCGTGATGCCCAGAAGTCCATCCCGGTGGGAACCATTCTGGCCATCGTTACAACTTCACTTGTGTACTTCAGCAGTGTGGTTCTCTTTGGTGCCTGCATCGAGGGTGTGGTGCTCCGGGACAAGTATGGGGATGGTGTCAGCAGGAACCTGGTGGTGGGCACATTGGCCTGGCCTTCGCCCTGGGTCATTGTTATTGGCTCCTTCTTCTCAACATGTGGCGCTGGCCTCCAGAGCCTCACTGGGGCACCACGCCTGTTGCAGGCCATCGCCAAGGACAACATCATTCCCTTCCTCCGGGTATTTGGCCACGGAAAGGCGAATGGCGAACCAACTTGGGCACTCCTCCTGACTGCGCTCATCGCTGAGCTTGGCATCCTTATTGCTTCCCTCGACATGGTGGCCCCCATTCTATCCATGTTCTTTCTGATGTGTTACCTCTTTGTGAACCTGGCCTGTGCTGTCCAGACACTCTTGAGGACCCCCAACTGGCGGCCTCGGTTCAAATATTATCACTGGGCGCTGTCCTTCTTGGGCATGAGCCTCTGCCTGGCCCTTATGTTTGTCTCCTCCTGGTACTATGCCCTGGTCGCCATGCTCATTGCGGGCATGATCTACAAGTACATCGAGTACCAAGGGGCTGAGAAGGAGTGGGGTGATGGTATTCGAGGCCTATCCCTGAGCGCTGCCCGCTATGCACTGTTACGGCTAGAGGAGGGCCCTCCTCACACCAAGAACTGGCGGCCTCAGCTCCTGGTGCTCCTGAAGCTAGACGAGGACCTTCATGTGAAGTACCCCCGGCTCCTCACCTTTGCCTCCCAGCTTAAGGCAGGCAAGGGCCTGACAATTGTTGGCTCTGTCATCCAGGGCAGCTTCTTGGAGAGCTATGGCGAGGCCCAGGCTGCTGAGCAGACAATCAAGAACATGATGGAGATTGAGAAAGTAAAAGGCTTCTGCCAGGTAGTGGTGGCCAGCAAGGTGCGTGAGGGACTGGCTCACCTCATCCAGTCTTGCGGCCTAGGCGGCATGAGGCATAACTCCGTGGTGCTGGGCTGGCCCTATGGCTGGCGACAGAGTGAGGACCCCCGTGCCTGGAAGACCTTTATTGACACTGTGCGCTGCACCACAGCTGCCCATCTGGCCCTGCTGGTGCCCAAGAACATCGCCTTCTACCCCAGCAACCATGAGCGCTACCTGGAGGGCCACATTGATGTATGGTGGATCGTGCACGATGGTGGCATGCTCATGCTTTTGCCCTTCCTGCTCCGCCAGCATAAGGTTTGGAGGAAGTGCCGGATGCGAATCTTCACAGTGGCCCAGATGGATGACAATAGCATCCAGATGAAGAAGGATTTGGCCATCTTCCTCTACCACCTCCGCCTTGAGGCAGAGGTGGAGGTGGTGGAGATGCATAACAGCGACATATCTGCCTACACCTACGAACGCACACTGATGATGGAACAGCGGTCCCAGATGCTGCGGCAGATGCGGCTGACCAAGACTGAGCGGGAGCGAGAAGCACAACTGGTCAAGGATAGGCACTCAGCTTTGCGTCTGGAAAGCCTGTACTCAGACGAGGAAGACGAGTCTGCAGCAGGGGCTGACAAGATCCAAATGACATGGACCCGAGACAAGCACATGACTGAGCCCTGGGACCCCAGCCATGCCCCTGACAACTTCCGGGAGCTGGTGCATATTAAGCCGGACCAGTCCAATGTGCGACGCATGCACACTGCTGTAAAGCTCAATGAAGTCATTGTCACACGATCCCACGATGCCCGCCTGGTCCTACTGAACATGCCTGGCCCACCCAAAAACAGCGAGGGTGATGAGAACTACATGGAGTTCCTTGAGGTGCTGACTGAGGGCCTTGAGCGGGTGTTGTTGGTGCGTGGCGGTGGCCGTGAAGTCATCACCATCTACTCCTGA

XM_004842995.1 Coding sequence

Slc12a4 solute carrier family 12 (potassium/chloride transporters), member 4, transcript variant X4

Length: 3222 bp    Location: 18419165..18438279   Strand: +
>XM_004842995.1
ATGCCATCCAAAGGTTCACTGTGCCGTGTCATCTATCTGGTTCCTAAAGACACCGCACCTCTGGCGCGGGGCACACTGGGACAGGGTAACCACAGGGAGAACAGCCCTTTTCTTTGCCCCTTGGAGGCTTCCAGAGGAAGTGACTACTATGATAGGAACCTGGCACTGTTTGAGGAGGAGCTGGACATCCGCCCAAAGGTATCATCACTTCTGGGCAAACTCGTCAGCTATACTAACCTCACCCAGGGTGCCAAGGAGCATGAAGAGGCTGAGAGTGGGGAAGGCACCCGCCGGAGAGCAGCCAAGGCACCCAGCATGGGCACCCTCATGGGGGTGTACCTGCCCTGCTTACAGAATATCTTCGGAGTCATCCTCTTCCTGAGGCTAACCTGGATGGTAGGCATGGCCGGGGTGCTGCAGGCGCTCCTCATTGTGCTCATCTGCTGCTGCTGTACTTTGCTGACAGCCATTTCCATGAGTGCCATCGCCACCAATGGTGTGGTTCCAGCTGGTGGCTCCTACTTCATGATCTCCCGCTCACTGGGACCAGAATTTGGAGGTGCTGTAGGCCTATGCTTCTACCTGGGAACAACATTTGCAGCAGCCATGTACATCCTGGGCGCCATCGAGATCTTGCTGACCTACATTGCCCCACCAGCTGCCATTTTTTACCCATTGGGTGCTCATGACACATCAAATGCCACCTTGAACAATATGCGTGTGTACGGGACCATTTTTCTGACATTTATGACCCTAGTGGTGTTTGTTGGTGTCAAGTATGTGAACAAATTCGCTTCACTCTTCCTGGCCTGTGTGATCATCTCCATCCTTTCCATCTATGCTGGAGGCATCAAGTCTATTTTTGACCCTCCTGTGTTTCCGGTATGCATGCTAGGCAACAGGACTCTGTCCCGGGACCAGTTTGATATCTGCGCCAAGACAGCTGTGGTGGACAATGAGACAGTGGCCACCCACCTGTGGAGTTTATTCTGCCACAGTCCCAACCTTACCACTGATTCCTGTGACCCCTACTTCCTGCTCAACAATGTGACTGAGATCCCTGGCATCCCTGGGGCAGCTGCTGGTGTGCTCCAGGAAAACCTGTGGAGTGCCTACCTGGAGAAGGGCGAGGTGGTGGAGAAGCATGGGCTGCCCTCCGTGGACACTCTCAGCCTGAAGGACAGTCTGCCCCAGTACGTGATGGCTGACATTGCCACATCCTTCACAGTGTTGGTTGGCATTTTCTTCCCCTCTGTAACAGGCATCATGGCTGGCTCCAATCGCTCCGGGGACCTCCGTGATGCCCAGAAGTCCATCCCGGTGGGAACCATTCTGGCCATCGTTACAACTTCACTTGTGTACTTCAGCAGTGTGGTTCTCTTTGGTGCCTGCATCGAGGGTGTGGTGCTCCGGGACAAGTATGGGGATGGTGTCAGCAGGAACCTGGTGGTGGGCACATTGGCCTGGCCTTCGCCCTGGGTCATTGTTATTGGCTCCTTCTTCTCAACATGTGGCGCTGGCCTCCAGAGCCTCACTGGGGCACCACGCCTGTTGCAGGCCATCGCCAAGGACAACATCATTCCCTTCCTCCGGGTATTTGGCCACGGAAAGGCGAATGGCGAACCAACTTGGGCACTCCTCCTGACTGCGCTCATCGCTGAGCTTGGCATCCTTATTGCTTCCCTCGACATGGTGGCCCCCATTCTATCCATGTTCTTTCTGATGTGTTACCTCTTTGTGAACCTGGCCTGTGCTGTCCAGACACTCTTGAGGACCCCCAACTGGCGGCCTCGGTTCAAATATTATCACTGGGCGCTGTCCTTCTTGGGCATGAGCCTCTGCCTGGCCCTTATGTTTGTCTCCTCCTGGTACTATGCCCTGGTCGCCATGCTCATTGCGGGCATGATCTACAAGTACATCGAGTACCAAGGGGCTGAGAAGGAGTGGGGTGATGGTATTCGAGGCCTATCCCTGAGCGCTGCCCGCTATGCACTGTTACGGCTAGAGGAGGGCCCTCCTCACACCAAGAACTGGCGGCCTCAGCTCCTGGTGCTCCTGAAGCTAGACGAGGACCTTCATGTGAAGTACCCCCGGCTCCTCACCTTTGCCTCCCAGCTTAAGGCAGGCAAGGGCCTGACAATTGTTGGCTCTGTCATCCAGGGCAGCTTCTTGGAGAGCTATGGCGAGGCCCAGGCTGCTGAGCAGACAATCAAGAACATGATGGAGATTGAGAAAGTAAAAGGCTTCTGCCAGGTAGTGGTGGCCAGCAAGGTGCGTGAGGGACTGGCTCACCTCATCCAGTCTTGCGGCCTAGGCGGCATGAGGCATAACTCCGTGGTGCTGGGCTGGCCCTATGGCTGGCGACAGAGTGAGGACCCCCGTGCCTGGAAGACCTTTATTGACACTGTGCGCTGCACCACAGCTGCCCATCTGGCCCTGCTGGTGCCCAAGAACATCGCCTTCTACCCCAGCAACCATGAGCGCTACCTGGAGGGCCACATTGATGTATGGTGGATCGTGCACGATGGTGGCATGCTCATGCTTTTGCCCTTCCTGCTCCGCCAGCATAAGGTTTGGAGGAAGTGCCGGATGCGAATCTTCACAGTGGCCCAGATGGATGACAATAGCATCCAGATGAAGAAGGATTTGGCCATCTTCCTCTACCACCTCCGCCTTGAGGCAGAGGTGGAGGTGGTGGAGATGCATAACAGCGACATATCTGCCTACACCTACGAACGCACACTGATGATGGAACAGCGGTCCCAGATGCTGCGGCAGATGCGGCTGACCAAGACTGAGCGGGAGCGAGAAGCACAACTGGTCAAGGATAGGCACTCAGCTTTGCGTCTGGAAAGCCTGTACTCAGACGAGGAAGACGAGTCTGCAGCAGGGGCTGACAAGATCCAAATGACATGGACCCGAGACAAGCACATGACTGAGCCCTGGGACCCCAGCCATGCCCCTGACAACTTCCGGGAGCTGGTGCATATTAAGCCGGACCAGTCCAATGTGCGACGCATGCACACTGCTGTAAAGCTCAATGAAGTCATTGTCACACGATCCCACGATGCCCGCCTGGTCCTACTGAACATGCCTGGCCCACCCAAAAACAGCGAGGGTGATGAGAACTACATGGAGTTCCTTGAGGTGCTGACTGAGGGCCTTGAGCGGGTGTTGTTGGTGCGTGGCGGTGGCCGTGAAGTCATCACCATCTACTCCTGA

XM_004842991.1 Coding sequence

Dpep2 dipeptidase 2

Length: 468 bp    Location: 18396252..18398049   Strand: +
>XM_004842991.1
ATGCAGTCCCACAATCAAGGAGGCTCTTTCACACTACCCTCGGATGCCCCGTCTCCCATTATCCACAGCCACAAAGACCTGCCCTTGGTCCTGAGGCAATTTTACCAGGATTCACTACAGAATGTCAACCTTCGCAATTTCAGCCATGGCCAGACCAGCCTAGACAAGCTTAGAGATGGCCTCGTGGGTGCTCAGTTCTGGTCAGCCTACGTCCCATGTCAGACCCAGAACTGGGATGCTGTGCACCTCACCCTGGAGCAGATAGACCTCATCTGCCGCATGTGTGCCTCCTACTCTGAGCGGGAGCTGGTGACCTCAGCTGAAGCTCTGAACAGCACCCAGAAATTGGCCTGCCTCATTGGTGTGGAGGGTAGCCACTCGCTGGACAGTAGCCTCTCCATCCTGCATACCTTCTATGTGCTGGGAGTGCGCTACCTCATGCTTACACACACCTGCAACACACCCTGA

XM_004842987.1 Coding sequence

Dus2l dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae), transcript variant X1

Length: 1479 bp    Location: 18269506..18215919   Strand: -
>XM_004842987.1
ATGATTCTGAATAACCTTTCTCTGTGCTACCAGAACAAACTCATCTTAGCCCCTATGGTTCGGGTCGGGACTCTCCCAATGCGGCTGCTGGCCCTGGATTATGGAGCGGACATTGTTTACTGTGAGGAGCTGATTGATCTCAAGATGCTTCAGTGCAAAAGAGTTGTCAATGAGGTGCTCAGCACAGTCGACTTTGTTGCCCCTGATGATCGAGTCGTCTTCCGTACCTGTGCAAAAGAACAGAACAGGGTGGTCTTTCAGATGGGCACTTCAGATGCAGAGCGAGCCCTTGCTGTGGTCAGGCTTGTAGAAAATGATGTAGCTGGTATTGACGTCAACATGGGCTGTCCAAAAGAATATTCCACCAAGGGAGGAATGGGAGCGGCTCTGTTGTCAGACCCTGACAAGATCGAGAAGATCCTCGGCACGCTTGTCAGAGGGACACGCAGACCTGTGACCTGCAAGATTCGCATCCTGCCATCACTAGAAGATACCCTGAGCCTTGTAAAGCGGATAGAGAGGACTGGCGTTGCTGCTATTGCAGTTCATGGGAGGAAGCATGAGGAGCGGCCTCAGCACCCTGTCCACTGTGAAGTCATCAAAGCCATTGCTGGAACCCTGTCCATTCCTGTCATAGCCAATGGAGGATCTCATGACCACATACAGCAGCATTTGGACATAGAGAACTTCCGACAAGCCACAGGTGCCTCTTCAGTGATGGTGGCCCGAGCTGCCATGTGGAACCCATCTATCTTTCTCAAGGATGGGCTGCGTCCCCTGGAAGAGGTCATGCAGAAGTATATCAGATATGCAGTGCAGTATGACAACCACTACACCAACACCAAGTACTGTTTGTGTCAGATGCTACGCGAACAGTTGGAGTCGCCCCAGGGAAGGTTGCTCCATGCCGCCCAGTCTTCCCAGGAAATTTGTGAGGCCTTTGGCCTTGGTACGTTCTACAAGGAGACCACACAGGAGATAGATGCCCGGAGGGTTGAGCTCTTGGCCAAGACTCCAGAAGAGGTTGGGGAGCCAGCTGAAGATACCTCTGGTGTCATTAAGATGGCTGTCAAATTTGATCGGAGAGCATACCCACCCCAGATAACCCCGAAAATGTGCTTGCTGGAGTGGTGCCGCAGAGAGAAGTTAGCACAGCCTGTGTATGAAACGGTTCAACGACCTGTGGATCGCCTATTCTGCTCTGTTGTCACGATTGCAGAACAAAAGTACCAGTCTACCTTATGGGACAAGTCCAAGAAACTAGCGGAGCAGACTGCAGCCATCGTCTGTCTGCGGAGCCAGGGCCTCCCTGAGGGTCAGCTGGGTGAGGAGAGCCCCTCGCACAAGCGCAAGTGGGAGGCCCCTGCCCAGGACCCTGGGGGCCCCAGAACTCAGAAGCCAGTACCACCTGGAGAGCTATGCAAGAAGCCCTTTTCAACCTTGGACAATGGTGAAGAGAGCCCCCTGGAAGGCTGGTGA

XM_004842976.1 Coding sequence

Prmt7 protein arginine methyltransferase 7, transcript variant X5

Length: 1842 bp    Location: 17987109..17949443   Strand: -
>XM_004842976.1
ATGATGGCCGTCACAGCAGGTGCTGACTTCTGCTATGCTATTGAGGTTTTCAAGCCCATGGCTGATGCTGCTGTAAAGATCGTGGAGGAAAATGGCTTCAGTGATAAGATTAAAGTTATCAACAAGCATTCAACGGAGGTGACTGTAGGACCAGATGGTGATATGCCATGCCGTGCCAACATCCTGGTCACAGAGCTGTTTGACACAGAACTGATTGGAGAGGGAGCACTGCCCTCCTATGAACATGCACACCGGCATCTTGTGCAGGAAACTTGTGAGGCAGTGCCTCACAGGGCAACTGTCTACGCACAGCTGGTGGAATCCAAAAGGATGTGGTCATGGAACAAGCTGTTTCCTGTCCGTGTTCAGACCAGCCTCGGAGAGCAGGTCATCATCCCTCCCTCAGATCTGGAGCAGTGCCCTGGTGCACCCTCTGTCTATGACATCCAGCTGAACCAAGTGTCACCTGCTGACTTCACTGTCCTCAGTGATGTGCTACCTATGTTCAGTGTGGACTTCAGCAAGCAGGTCAGTAGCTCGGCAGCCTGCCATAGCAGGCAGTTTGAACCTTTGGCATCTGGCCGAGCTCAGGTGGTTCTCTCCTGGTGGGACATTGAAATGGATCCTGAGGGGAAGATCAAGTGTACCATGGCCCCCTTCTGGGCACACTCCGACCCACAGGGTCTCCAGTGGCGGGACCACTGGATGCAGTGTGTATACTTCCTGCCACAAGAGGAGCCCATTGTACAAGGTGTAGCCCTCTGCCTGGTAGCCCACCATGATGACTACTGTGTGTGGTACAGCCTTCAGAGGACCTGCCCTGAAGAGAATGGGAGAGTTCAACAAATGCGCCCCGTATGTGACTGCCAAGCTCACCTGCTCTGGAATCGTCCTCGGTTTGGAGAGATCAATGATCAGGGCAGAAATGATCAGTACGCCCAGGCCCTGAGGACTGTGCTGATGCCAGACAGTGTCTGTCTCTGCATCAGTGATGGCAGTCTGCTCTCCATGTTGGCCCATTACCTTGGGGCAGAGCAGGTATTTACAATCGAGAGTTCAGCAGCTTCCCATGAACTGATGAAAAAAATCTTCAAGGCTAACCACTTGGAAGATAAAATTAGTATCATTGAGAAACGGGCTGAGTTGCTAACATCTGCAGACCTGGAGGGTAAGAAGGTCTCCCTCCTCTTGGGTGAGCCCTTCTTCACCACCAGCTTGCTGCCGTGGCACAACCTGTACTTCTGGTATGTCCGGACCGCTGTGGACCAGCACCTGGGGCCTGGTGCTGTGGTGATGCCCCAGGCTGCCTCGCTGCATGCCATGGTTGTGGAGTTCAGGGACCTGTGGCGGATCCGCAGCCCCTGTGGGAACTGTGAAGGCTTCGATGTGCACATTATGGATGACATGATTAAGTCTGCCCTGGATTTCCGGGAGAGCAAGGAAGCGGAGCCACACCCACTGTGGGAGTACCCCTGCCGCAGCCTCTCTGAGCCCCAGCGGATCCTGACCTTTGATTTTCGGCAGCTGGTCCCCCAGCAGCCCTTGCGTGCTGAGGGCACCATGGAGCTGAGGAGGCTGGGGAGGAGCCATGGAGCTGTCCTGTGGATGGAATACCACCTGACGCCAGACAGCACAGTCAGCACTGGCCTCCTGGAGCCCGCAGAAGACAAGGGGGATTGTTGCTGGAACCCCCACTGCAAGCAGGCTGTGTACTTCCTCAGCCCCACACTGGATCCCAAAATGCTTCTGGGCAGTCCTCGGGCAGTGAGCTATGCTGTGGAGTTTCACCCCCATTCAGGAGATGTCACCATGCAGTTCAGGCTCGCAGACACCAGGAACTGA

XM_004842965.1 Coding sequence

Zfp90 ZFP90 zinc finger protein, transcript variant X1

Length: 1989 bp    Location: 17772274..17756517   Strand: -
>XM_004842965.1
ATGGCCCCCAGGCGGCCCACCGCAGCACCTCAGATCCCACAGTATGTTCCTAGTATTGCCATGGAAACATTGATGTTGTTGAGCAAGATTGTGATCCTGCAGGAATCAGTGACATTCAAAGATGTGGCTGTGGATTTCACCCGGGAAGAATGGCATCACGTGGACTCTGCCCAGAGAAGCTTGTACAGGGATGTGATGCTGGAGAACTACAGCCACCTGGTTTCTCTTGGATATCAAGTTTCCAAACCAGAGGTGATCTTCAAATTGGAGCAAGGAGAAGAGCCATGGATATCAGAGGGAGAAATCCAAAGGCCTTTCTGTTCAGACTGGAAGACAAGGCCAGAAGCTAAATCATCAAAGCTGCAACACAGCACATCTGAAGTATCCCCTAGCACAGATGATTTCTCACATGTCACATTAGAAGATGCCTGGGATATTAGTAGCCAGCTAGAGAGGCAGCAAAAAAATTGGAGGAGATATCTGGGGCCAGAAGTATCTACACAGAAGAAAATAACCACCCCAGAGGAAAATTTTGAGCAAAATAAATTTGGTGAAAACTCTAGATTGAACATAGACTTGATTCCACAACTGAACATTCCTTCAAGAATAAGGCCTAGTGAATATGGAACACTTGGAAACAATTTGGGACATAATTCAGACTTACTTAATCAAAATAATATCCTTGCAAAAAAGAAGCCCTATAAATGTAATAAATGTAGAAAAGCCTTTATTCATAGATCATCACTTAATAAACATGAGAAAACTCATAAAGGAGAAGACACATTCCCTAATGGTACAGGTCAGGGAATTTATCCTGGCAAGAAGCACCATGAATGTACTGACTGTGGGAAAACTTTCCTCTGGAAGACACAGCTTACTGAGCATCAGAGGATTCACACTGGAGAAAAACCCTTTGAGTGCAATGTGTGTGGAAAAGCCTTCAGGCATAGCTCATCCCTAGGTCAGCATGAGAATGCTCATACAGGAGAGAAACCCTATCAGTGCAGTCTCTGTGGGAAAGCCTTCCAATGCAGCTCCTCCCTTGTCCAACACCAGAGAATTCACACTGGAGAGAAGCCCTATCGATGTAATCTTTGTGGGAGGTCCTTTAGGCATGGCACATCCCTTACTCAACATGAGGTCACACACAGTGGAGAGAAGCCCTTCCAGTGTAAGGAATGTGGGAAAGCTTTTAGTCGATGTTCTTCTCTTGTCCAACATGAGAGGACTCATACTGGAGAGAAACCTTTTGAATGTAGCATATGTGGAAGGGCTTTTGGTCAGAGCCCATCCCTTTATAAACACATGAGGATTCATAAAAGAGGAAAACCTTACCAAAGCAATAACTACAGCATAGATTTTAAGCACAGCTCTTCTCTTACTCAAGAAGAAAGTGCACTGTCTGAAGTAAAATCCTACCATTGTAATGACTGTGGGGAAGACTTCAGTCACATTACAGACTTTACTAACCATCAGAGGATTCATACTGGAGAGAATCCCTATGATTGTGAGCAGGCCTTTAGTCAACAATCTATTTCTCATCCTGGAGAGAAACCCTATCAATGTAATGTATGTGGAAAGGCTTTCAAAAGGAGTACAAGTTTCATAGAGCATCACAGAATTCATACAGGTGAGAAGCCCTATGAATGTAATGAATGTGGAGAGGCCTTCAGTCGACGCTCATCACTTACTCAACATGAGAGAACCCACACTGGAGAGAAACCCTATGAATGTATTGACTGTGGAAAAGCTTTCAGTCAGAGTTCATCCCTTATTCAGCATGAGAGAACTCACACTGGAGAGAAACCCTATGAATGTAATGAATGTGGGCGTGCATTCCGTAAGAAAACCAATCTGCATGATCATCAAAGAATTCATACTGGAGAAAAACCTTACTCTTGTAAGGATTGTGGGAAGAATTTCAGTCGAAGCTCAGCTCTTACTAAACACCAGAGAATTCATACAAGAAGTAAACTGCAGGAACCCTAA

XM_004842948.1 Coding sequence

Nip7 NIP7, nucleolar pre-rRNA processing protein, transcript variant X2

Length: 468 bp    Location: 17034381..17021115   Strand: -
>XM_004842948.1
ATGCGGCCTTTAACTGAAGAGGAGACCCGTGTGATGTTTGAGAAAATCGCAAAATACATCGGGGAGAACCTTCAGCTGCTGGTTGACAGGCCCGACGGTACCTACTGTTTTAGGCTGCACAACGACCGGGTGTACTACGTGAGTGAGAAGATGCTGAAGCTGGCCGCCAATATCTCCAGGGACAAGCTGGTGTCGCTGGGGACCTGCTTCGGAAAATTCACCAAGACCCACAAGTTTCGGCTGCACATTACGGCTCTGGATTACCTGGCACCTTACGCCAAGTATAAAGTGTGGATAAAGCCTGGAGCAGAGCAGTCCTTCTTGTATGGAAACCATGTATTGAAATCTGGTTTGGGCCGGATCACTGAAAGTACTTCTCAGTACCAGGGAGTGGTGGTGTACTCCATGGCAGACATCCCTTTGTTTCCCTCTTCCACCTTGAGAAAACCAATGAACGGTGTGAGCTGA

XM_004842949.1 Coding sequence

Nip7 NIP7, nucleolar pre-rRNA processing protein, transcript variant X3

Length: 402 bp    Location: 17034381..17032029   Strand: -
>XM_004842949.1
ATGCGGCCTTTAACTGAAGAGGAGACCCGTGTGATGTTTGAGAAAATCGCAAAATACATCGGGGAGAACCTTCAGCTGCTGGTTGACAGGCCCGACGGTACCTACTGTTTTAGGCTGCACAACGACCGGGTGTACTACGTGAGTGAGAAGATGCTGAAGCTGGCCGCCAATATCTCCAGGGACAAGCTGGTGTCGCTGGGGACCTGCTTCGGAAAATTCACCAAGACCCACAAGTTTCGGCTGCACATTACGGCTCTGGATTACCTGGCACCTTACGCCAAGGGTTTTGGGGTAGCAGCAAAGTCTACACAAGACTGTAGGAAAGTAGACCCCATGGCGATTGTGGTATTTCATCAAGCAGACGTTGGGGAATACATACGGCATGAAGAGACATTGACTTAA

XM_004842910.1 Coding sequence

Atxn1l ataxin 1-like, transcript variant X3

Length: 2067 bp    Location: 14119440..14128670   Strand: +
>XM_004842910.1
ATGAAACCTGTTCATGAGAGGAGTCAGGAATGTCTTCCACCAAAGAAACGAGACCTCCCCGTGACCAGCGAGGATATGGGGCGGACTACCAGCTGTTCCACAAACCACACACCCTCCAGTGATGCCTCTGAATGGTCCCGAGGGGTTGTGGTGGCTGGGCAGAGCCAGGCTGGAGCCAGAGTCAGCCTGGGGGGTGATGGATCTGAAGCTATCACTGGTCTGACGGTAGACCAGTATGGCATGCTGTATAAGGTGGCTGTGCCACCTGCCACCTTCTCACCCACTGGCCTCCCATCTGTGGTGAACATGAGCCCCTTGCCCCCCACGTTTAATGTAGCGTCTTCACTGATTCAACATCCAGGAATCCACTATCCCCCAATCCACTATGCTCAGCTCCCATCCACCTCACTGCAGTTTATCGGGTCTCCTTATAGCCTTCCTTATGCTGTGCCACCTAATTTCCTACCAAGTCCCCTCCTTTCTCCTTCTGCCAATCTTGCCACTTCTCACCTTCCACACTTTGTGCCATATGCTTCACTCCTGGCAGAAGAAGCCACTCCTCCCCCCCAGCCTTCATCCCCAGCCCATTCATTTAACAAAACCCCCACTGCCGCCTCCCCGCCTGGGCAGTTGCCACATCACTCAAGTACTCAGCCACTGGACCTCGCTCCAGGCCGGTTGCCCATTTATTATCAGATGTCTAGGCTACCTGGTGGGTATACCTTGCATGAAAACCCTCCAACAGGTGCCAGCCCAGTTCTTACCCCTCAGGAGGGCCAGTCTGCTCTGGAAGCAGCTGCTGCCAATGGAGGACAGAGACAACGAGAGCGAAATTTAGTAAGACGGGAAAGTGAAGCCCTTGACTCCCTGAGCAGCAAGGGTGAAAGCCAAGGACTGGTGCCAGTGGTAGAATGTGTGGTGGATGGACAATTGTTTTCAGGTTCTCAGACTTCACGGGTAGAGGTGACGGCACCAGCACATCGAGGGACTCCAGACACCGACCTTGAGGTCCAGCGGGTAGTTGGCGCTTTAGCTTCTCAGGACTATCGTGTGGTGGCAGCTCAGAGGAAAGATGAATCCAGCCCCCTCAACCTGTCCCATCATACTCCTGACCATCAGGGTGAGGGACGAGGGTCAGCCAGGAACCCTGCAGAGGTGGCAGAGAAGAATCAGGCCCGTGGGTTCTACCCTCAATCCCATCAGGAACCAGTAAAACATAGACTTTTACCCAAAGCGATGGTTGTTGCCAATGGCAACCTGGTGCCCACTGGAACTGACCCAGGCCTGCTGCCTGTGGGCTCTGAGATCCTGGTGGCATCAAGTCTGGACATGCAGGCCAGAGCCTTCCCAGACAAGGAGCCAACGCCACCCCCTATTACCTCTTCCCACTTGCCCTCCCATTTCATGAAAGGCGCCATCATCCAGCTGGCTACAGGGGAGCTGAAGCGGGTAGAGGACCTCCAGACCCAGGATTTTGTGCGCAGTGCCGAAGTGAGCGGGGGGCTGAAGATTGACTCAAGTACGGTTGTGGACATTCAGGAGAGCCAATGGCCTGGATTTGTCATGCTGCATTTTGTGGTTGGTGAGCAGCAGAGCAAAGTGAGCATTGAGGTGCCCCCCGAGCACCCCTTCTTTGTATATGGCCAGGGTTGGTCGTCCTGCAGCCCTGGGCGGACTGCACAACTCTTCTCTCTGTCCTGCCATCGACTACAGGTGGGAGATGTCTGCATCTCTATCAGTTTACAGAGCTTGAACAGTAACTCGGTTTCTCAGGCCAGCTGTGCTCCCCCAGGCCAGTTGGGTCCCTCCCGAGAAAGGCCTGAGAGAACAGTCTTGGGACCCAGAGACCTGTGTGACAGTGAGGGGAAGAGCCAGCCCACAGGAGAGGGCTCCCATGTGGTAGAGCCCTCCCAGCCTGAGCCTGGTGCTCAGGCCTGCTGGCCAGCCCCAAACTTCCAAAGATACAGCGTGCAAGGGGAGGAGGCACGGGCTGGACTGCTCCGTCCCTCTTTCATTCCACAAGAGGTAAAGCTGTCCATTGAAGGGCGTTCAAATGCGGGAAAATGA

XM_004842925.1 Coding sequence

LOC101707073 RNMT-activating mini protein-like

Length: 357 bp    Location: 14502535..14502150   Strand: -
>XM_004842925.1
ATGACTGACACTACTAACGCTACTCCAAATTTTGAAGAGATGTTTGCAAACAGATTCACAGAAGATGACAAAGAATACCAAGAATATTTGAAACACCCTCCTGAATCCCCTCCAGTTATTGAGGAATGGAATAACAGAGCTGGTGGGAACCAAAGAAACAGAGGCAATCGGTTGCAAGATAACAGACAGTTTAGAAGTAGGGACAGCAGACGAGGGTGGCCAACTGACAATCGATCAGACCAGTGGCATGGAAGATCCTGGGGTAACAATTACCCGCAGCACAGACAAGAGCCTTATTATCCACAGCAATATGGACAATATGGTTATAACCAGTGGCCTCCCTACAGTTACTACTGA

XM_004842926.1 Coding sequence

Zfhx3 zinc finger homeobox 3, transcript variant X1

Length: 11115 bp    Location: 15340840..15098418   Strand: -
>XM_004842926.1
ATGGAAGGCTGTGACTCGCCCGTCGTCTCGGGGAAGGACGATGGGTGTGGTATCCCTCAGCACCGGCAATGGACTGAACTCAACAGCACCCGCCTCCCCGACAAACCCAGTAGCATGGAGCAGCCCACAGGCGAGAGCCACGGGCCCCTGGACAGCCTGAGGGCCCCCTTCAGTGAGCGCCTGGCGGACAGCAGCGCCCCCTTGGCCGGGCCCCCCGCCGAGCCCGCCGGCAAGGAGGTCAGCTGCAACGAGTGCTCGGCCTCCTTCGCCAGCCTCCAGACCTACATGGAGCACCACTGCCCCGGCGCACGCCCCCCACCGCCCCTGCGAGAGGAGAGCGCCAGCGACACCAGTGAGGAGGGCGAGGAGGAGAGCGACGTGGAGAACCTGGCTGGGGAGATCGTCTACCAGCCCGACGGCTCCGCGTACATCGTGGAGAGCCTGAGCCAGCTGACCCAGAGCGGGGCCGCGTGTGGCAGTGGCAGCGGGCCTCTCCCCTCGCTCTTCCTGAACTCGCTCCCCGGTGCGGGGGGCAAACAAGGGGACCCTTCGTGTGCTGCACCCGTCTACCCGCAGATTATCAACACTTTCCACATAGCCTCATCCTTCGGGAAATGGTTTGAGGGCTCAGACCAGGCCTTCCCGAATACCTCAGCCCTGGCGGGGCTCAGCCCCGTCCTGCACAGCTTCCGCGTTTTTGACGTGCGACACAAAAGCAACAAGGATTACCTGAACAGCGACGGTTCTGCCAAAAGCTCCTGTGTATCCAAAGATGTTCCCAACAATGTGGACCTGTCCAAATTCGATGGCTTTGTGCTCTACGGCAAGAGGAAGCCCATCCTGATGTGTTTCTTGTGCAAACTCTCCTTCGGGTACGTCCGTTCGTTTGTGACCCACGCGGTACACGACCATCGAATGACCCTGAGTGAAGACGAGCGGAAAATTCTTAGCAATAAGAACATCTCCGCTATCATCCAAGGGATTGGCAAAGACAAGGAACCCCTTGTAAGTTTTCTGGAACCAAAAAACAAAAACTTTCAACACCCTTTAGTTTCCACAGCTAACCTCATAGGCCCCGGACACAGTTTTTATGGTAAATTTAGTGGCATTCGAATGGAAGGGGAGGAGGTTCTCCCAGCCGGCTCTGCCGCCGGCCCTGAGCAGCCCCAGGCTGGTCTCTTGACCCCCAGCACCCTCTTGAACCTTGGCGGACTCACCAGCTCGGTCCTGAAAACCCCCATTACCTCAGTCCCCCTGGGGCCTCTGGCTTCCAGTCCTACCAAATCCTCAGAGGGCAAGGACTCTGGGGCAGCTGAAGGAGAGAGGCAAGAAGCGGGCGATCCGGATTGCTTCTCTGAGAAAGCAGAGCCAGCTGAGGAGGAGGAGGCGGAGGAGGAAGAAGAGGAAGAAGAGGCAGAGGAGGAGGAGGAGGAAGAAGAGGAGGAAGAAGAGGAGGAGGAGGAAGATGAGGGTTGCAAAGGACTCTTTCCAAGTGAGTTGGATGACGAGCTGGAGGACAGGCCCTCCGAGGAGTCTGGGGCAGTAGCAGGTGGTAGCAGCAAAAAGGACCTTGCTCTCTCAAACCAAAGCATTTCTAACTCCCCCTTAATGCCTAATGTGCTCCAGACCTTGTCGAGGGGCACAGCTTCTACTAGTTCTAATTCCGCTTCTTCCTTTGTTGTCTTTGATGGTGCGAACAGGAGGAATCGTTTAAGCTTTAACAGTGAGGGCGTCAGGGCCAATGTGGCAGAGGGCGGCAGGAGGCTGGACTTCGCTGATGAAAGTGCCAATAAAGACAATGCCACAGCACCAGAACCAAATGAAAGCACAGAGGGCGATGATGGGGGCTTCGTCTCACATCACCAGCACGCTGGCTCCCTCTGCGAGCTTGGGGTTGGGGAGTGCCCCTCGGGGAGTGGCGTAGAGTGCCCCAAATGTGACACGGTCTTGGGCTCCTCCCGCTCACTGGGCGGCCACATGACCATGATGCATTCTCGTAACTCGTGTAAGACACTCAAGTGCCCCAAGTGCAACTGGCACTATAAGTACCAGCAGACGCTGGAGGCACACATGAAGGAGAAGCACCCGGAGCCGGGGGGCTCCTGCGTCTACTGCAAAAGTGGGCAGCCCCACCCCCGGTTGGCACGAGGCGAGAGCTACACTTGTGGTTACAAGCCTTTCCGCTGCGAGGTGTGTAACTACTCCACAACTACCAAAGGCAACCTCAGTATTCATATGCAGTCCGACAAGCATCTCAACAACATGCAGAACCTGCAGAATGGAGGGGGGGAGCAAGTCTTCAGCCACACTGCTGGAGCGGCAGCGGCGGCGGCAGCAGCGGCGGCTGCAGCAGCCAATATCAGTGGTTCCTGCGGGGCCCCCTCACCCACCAAACCAAAAACCAAACCCACGTGGCGGTGTGAGGTGTGTGATTATGAGACCAACGTGGCTAGGAACCTCCGCATCCACATGACCAGTGAGAAGCACATGCATAACATGATGCTGCTACAGCAGAACATGACTCAAATCCAACACAACCGCCACCTGGGGCTCGGCAGCCTGCCCTCGCCTGCCGAGGCCGAGCTCTACCAATACTACCTGGCCCAGAACATGAACCTGCCCAACCTGAAGATGGACAGTGCTGCCTCGGACACCCAGTTCATGATGAGTGGATTCCAGCTGGATCCCACCGGGCCCATGACCGCCATGACACCTGCTCTAGTGGGCGGTGAGATCCCCCTAGACATGCGCCTCGGGGGCGGGCAGCTGGTGTCGGAGGAGCTGATGAACCTGGGCGAGAGCTTCATCCAGACCAACGACCCGTCCCTGAAGCTCTTCCAGTGCGCTGTCTGCAACAAGTTCACGACGGACAACCTGGACATGCTGGGGCTGCACATGAACGTGGAGCGCAGCCTTGCGGAGGACGAGTGGAAGGCCGTGATGGGGGACTCGTACCAGTGTAAGCTCTGCCGCTACAACACCCAGCTCAAGGCCAACTTCCAGCTGCACTGCAAGACGGACAAGCATGTGCAGAAGTACCAGCTGGTGGCCCACATCAAAGAGGGCGGCAAGGCCAACGAGTGGAGGCTCAAGTGTGTGGCCATCGGCAACCCCGTGCACCTCAAGTGCAATGCCTGCGACTATTACACGAACAGCCTGGAGAAGCTGCGGCTGCACACGGTCAACTCCAGGCACGAGGCCAGCCTGAAGCTGTACAAGCACCTGCAGCAGCATGAGAGTGGCGTGGAGGGCGAGAGCTGCTACTACCACTGCGTCCTGTGCAGCTACTCCACCAAGGCCAAGCTCAACCTCATCCAACATGTGCGCTCCATGAAGCACCAGCGCAGCGAGAGCCTACGCAAGCTGCAGCGGCTGCAGAAAGGCCTTCCAGAAGAGGACGAGGACCTGGGGCAGATCTTCACCATCCGCAGGTGTCCCTCGACCGACCCAGAAGAAGCCATTGAAGATGTTGAAGGACCCAGTGAAACAGGTGCTGATCCAGAGGAGCTTGCTAAAGACCAGGAAAGTGGAGGCGAGAAAGACCAGAGCAAATGGACAGCCTCATCCAGCCAAGCAGAGAAGGAGCTGACGGATTCTCCTGCTGCCTCCAAACGCATCTCCTTCCCAGGTAGTTCGGAGTCTCAGCTCTCTTCAAAGCGACCAAAAACATCTGAGGCGATCAAACCGGAGCAGATGTACCAGTGCCCCTACTGCAAGTACAGCAATGTCGATGTGAACCGGCTCCGGGTGCATGCCATGACACAGCACTCAGTGCAGCCCATGCTTCGCTGCCCCCTGTGCCAGGACATGCTCAACAATAAGATCCACCTTCAGCTGCACCTCACCCACCTCCACAGTGTGGCACCTGACTGCGTGGAGAAGCTCATTATGACGGTGACCACCCCTGAGATGGTGATGCCCAGCAGCATGTTCCTCCCAGCAGCTGTTTCAGATCGAGATGGGAATTCCAATTTGGAAGAGGCAGGAAAGCAGTCTGAAACATCAGAGGATCTGGGAAAAAACATCTTACCATCTGTGAGCACAGAACATAGTGGAGATTTGAAACCTTCTTCTGCTGATCCAGGCTCTGTGAGAGAAGACTCGGGCTTTCTCTGCTGGAAAAAGGGGTGTAACCAGGTTTTCAAAACTTCTGCTGCCCTTCAGACACATTTTAATGAAGTGCATGCCAAAAGGCCTCAGCTGCCTGTGTCAGATCGCCATGTGTACAAGTACCGGTGTAATCAGTGCAGCCTGGCATTCAAGACAATTGAAAAGTTGCAGCTCCATTCTCAGTACCATGTGATCAGAGCTGCCACCATGTGCTGTCTTTGTCAGCGCAGTTTCCGAACTTTCCAGGCTCTCAAAAAGCACCTTGAGACGAGCCACCTGGAGTTGAGTGAGGCTGACATCCAACAACTTTATGGTGGCCTTTTGGCCAATGGGGACCTCCTGGCAATGGGAGATCCCACCCTGGCTGAAGACCACACTATAATTGTGGAAGAAGACAAGGAGGAAGAGAGTGACTTGGAAGATAAACAAAGCCCAACAGGCAGTGACTCTGGGTCAGTACAAGAAGATTCAGGCTCAGAGCCAAAGAGAGCTCTCCCTTTCAGAAAAGGCCCCAACTTTACCATGGAAAAATTTCTAGACCCTTCTCGCCCTTACAAGTGTACTGTCTGTAAGGAATCTTTCACTCAAAAGAATATCCTGCTAGTGCACTACAATTCTGTCTCCCACCTACATAAGTTAAAAAGAGCCCTTCAAGAATCTGCAACTGGTCAACCAGAACCCACCAGCAGCCCAGACAATAAACCTTTTAAGTGTAACACTTGTAATGTGGCCTATAGCCAGAGTTCTACTCTGGAGATCCACATGAGGTCTGTGTTGCATCAAACCAAAGCCAGGGCAGCCAAGCTGGAGGCCGCAAGTGGCAGCAGCAATGGGACTGGGAACAGCAGCAGTGTCTCCCTAAGCTCCTCCACACCAAGTCCTGTCAGTACCAGTGGCAGTAACACCTTTACCACCACCAATCCAAGTAGTACTGGCATTGTACCAAGCTCCAACTTACTGAGCCAAGTGCCCACTGACACTGTCGGGATGCCACCTCTAGGAAATCCCATCAGTGCCAACATCGCTTCCCCTTCAGAGCCCAAGGAGGCCAATCGGAAGAAGCTGGCAGATATGATTGCATCCAGGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAGCAACAGCAGCAGCAGCAAGCACAGACACTGGCCCAGGCCCAGGCTCAAGTTCAGGCTCACTTACAGCAGGAGCTGCAGCAGCAGGCTGCCCTTATCCAGTCACAGCTGTTTAATCCCACCCTCCTTCCTCACTTCCCCATGACCACTGAGACACTGCTGCAGTTGCAACAGCAGCAGCATCTCCTCTTCCCTTTCTATATCCCCAGTGCTGAGTTCCAGCTCAACCCTGAGGTGAGCTTGCCAGTGACCAGTGGGGCACTGACGCTGACAGGGACTGGTCCAGGCCTGCTGGAAGATCTGAAGGCTCAGGTTCAGATCCCACAGCAGAGTCACCAACAGATCCTGCAGCAACAGCAGCAGCACCAAAGTCAACTCTCTGTGTCCCAGAGTCACTCTGCTCTCCTTCAGCCAAGTCAGCACCCCGAAAAGAAAAACAAATTGGTCATCAAAGAGAAGGAAAAAGAAAGCCAGAGAGAGAGAGAGGGTGTGGAGGGGGGAGAGGGCAACACGGGTCCAAAGGAATTGTTGCCAGACGCCTTGAAGGCCAAAGAGAAGAAGGAGTTGGCACCAGGGGGTGGTTCTGAGCCTTCTATGCTTCCTCCACGCATCGCCTCAGATGCCAGAGGGAACGCCACCAAGGCCTTGCTGGAGAACTTTGGCTTTGAGCTGGTCATTCAGTACAATGAGAATAAGCAGAAGGTGCAGAAGAAGAATGGGAAGACAGAACAGGGAGAGAACCTGGAAAAACTTGAGTGCGACTCCTGTGGCAAGTTATTTTCCAACATCTTGATCTTAAAGAGTCATCAGGAGCACGTTCATCAGAATTACTTTCCCTTTAAACAGCTCGAGAAGTTTGCCAAACAGTACCGGGAGCACTATGATAAACTGTACCCCCTGAGGCCCCAGACCCCCGAGCCGCCNNNNNNNNNNNNNNNNNNNNNACCACCCCCGCTTCCTGCTGCACCCCCTCAGCCAGCTTCCGCACCTGCCATCCCTGCGTCAGCCCCACCCATCACTTCACCAACAATCGCGCCAGCCCAGCCATCTGTGCCGCTCACCCAGCTCTCTATGCCAATGGAGCTGCCCATCTTCTCACCACTGATGATGCAGACGATGCCACTGCAGACCTTGCCAGCTCAGCTGCCCCCTCAGCTTGGCCCTGTGGAGCCTCTGCCTGCAGACCTGGCCCAGCTGTATCAGCATCAGCTCAATCCAACCCTGCTCCAGCAGCAGAACAAGAGACCTCGCACCAGAATCACAGATGACCAGCTCCGAGTGCTGCGGCAATATTTTGACATTAACAATTCCCCCAGTGAAGAGCAAATCAAAGAGATGGCAGATAAGTCTGGGTTGCCCCAGAAAGTGATCAAGCACTGGTTCAGGAACACACTCTTCAAAGAGCGGCAGCGTAACAAGGACTCCCCTTACAACTTCAGCAATCCTCCCATCACCAGCCTGGAGGAGCTCAAGATTGACTCTCGGCCCCCTTCCCCAGAACCTCAGAAGCAGGAGTACTGGGGAAGCAAGAGATCTTCAAGAACAAGGTTTACTGACTACCAACTCCGAGTCCTCCAGGACTTCTTTGATGCCAATGCTTACCCAAAGGATGATGAATTTGAGCAACTCTCTAATTTACTGAACCTTCCAACCCGAGTCATTGTGGTATGGTTCCAGAATGCCCGACAGAAGGCCAGGAAAAATTACGAGAATCAGGGAGAGGGCAAAGATGGAGAGCGGCGTGAGCTTACAAATGATAGATACATTCGAACGAGCAACTTGAACTACCAGTGCAAAAAATGTAGCCTGGTGTTTCAGCGCATCTTTGATCTCATCAAGCATCAGAAGAAGCTGTGTTATAAGGATGAGGATGAGGAAGGGCAGGATGACAGCCAAAATGAGGATTCCATGGATGCCATGGAAATCCTCACACCAACCAGTTCCTCCTGCAGCACTCCAATGCCCTCCCAGGCTTACAGTGCCCCGGCACCATCAGCCAATCCTGCTCCTGCTGCTTTCCTGCACCTTACAGCTGAGGCAGATGAGCTAGCCACCTTCAATTCAAAAACAGAAGCAAGTGATGAGAAACCAAAGCAAGCTGAACCTCCCAGTGCACAGCCAAACCAAACCCAAGAAAAGCAAGGACAACCAAAGCCAGAGCTTCAGCAGCAAGACCAATCTGAGCAGAAGACAACTGTGCCCCAGCAAAAGCTTCCACAGCTGGCTGCCCCACCTTCCTTACCACAGCCTCCTCCACAGGCTCCTCCTCCTCAATGCCCCTTACCCCAGTCGAGCCCCAGTCCCTCTCAGCTCTCCCATCTGCCCCTCAAACCTCTCCACACATCAACGCCTCAACAGCTGGCCAACCTACCTCCTCAGCTCATCCCCTACCAGTGTGACCAGTGTAAGCTGGCATTTCCATCGTTTGAGCATTGGCAAGAGCATCAGCAACTTCATTTCTTGAGTGCACAGAACCAGTTCATCCACCCCCAGTTCCTGGACAGGTCACTGGACATGCCTTTCATGCTGTTCGATCCCAGTAACCCACTCCTGGCCAGCCAGCTGCTTTCCGGAGCCATACCTCAGATTCCAGCAAGCTCCGCCACTTCTCCTTCCACACCAACCTCTACGATGAACACTCTGAAGAGGAAGCTGGAGGAAAAGGCCAGTGCAAGCCCTGGTGAAAATGACAGTGGGACAGGAGGAGAAGAGCCTCAGAGAGACAAGCGTTTGAGGACAACTATTACACCGGAGCAACTAGAAATTCTCTACCAAAAGTATCTACTGGACTCTAATCCAACGCGAAAGATGTTGGATCATATTGCTCATGAGGTGGGTTTGAAGAAACGTGTGGTTCAAGTCTGGTTTCAGAACACTAGAGCTCGAGAACGGAAAGGACAGTTCCGGGCCGTGGGCCCAGCCCAGGCGCACAGGAGATGCCCTTTCTGCAGAGCGCTCTTTAAAGCCAAGACTGCCCTTGAGGCTCATATCCGGTCTCGTCACTGGCACGAAGCCAAGAGAGCTGGCTATAACCTAACTCTGTCTGCAATGCTTTTGGACTGCGATGGGGGGCTCCAGATGAAAGGAGATATTTTTGATGGAACTAGCTTTTCCCACCTACCCCCAAGTAGTAGTGATGGTCAGGGTGTTCCCCTGTCGCCTGTGAGTAAAACCATGGAATTGTCTCCCAGAACTCTTCTCAGCCCTTCCTCCATCAAAGTGGAAGGGATTGAAGACTTTGAAAGCCCCTCCATGTCCTCAGTTAATCTAAACTTTGACCAAGCTAAGCTGGACAATGATGACTGTTCCTCTGTCAACACGGCAATCACAGACACCACGACAGGAGATGAGGGTAATGCAGATAACGACAGTGCGACGGGAATAGCAACTGAAACCAAATCTTCTGCACCCAATGAAGGGTTGACCAAAGCGGCCATGATGGCAATGTCTGAGTATGAAGATCGGTTGTCTTCTGGCCTGGTCAGCCCAGCCCCGAGCTTTTATAGCAAGGAATATGACAACGAAGGTACAGTGGACTACAGTGAAACCTCAAGTCTTGCGGACCCGTGCTCCCCAAGTCCTGGTGCAAGTGGGTCTGCAGGCAAATCTGGTGACAGCGGGGATCGGCCCGGGCAGAAACGTTTTCGCACTCAGATGACCAATCTGCAGCTGAAGGTCCTCAAGTCATGCTTTAATGACTATAGGACACCCACTATGCTAGAGTGTGAGGTCCTGGGCAATGACATTGGACTGCCAAAGAGAGTTGTTCAGGTCTGGTTCCAGAATGCCCGGGCAAAAGAAAAGAAGTCCAAGTTAAGCATGGCCAAGCATTTTGGTATAAACCAAACGAGTTATGAGGGACCCAAAACAGAGTGCACTTTGTGTGGCATCAAGTACAGCGCTCGGCTGTCTGTACGTGACCATATCTTTTCCCAACAGCATATCTCCAAAGTTAAAGACACCATTGGAAGCCAGTTGGACAAGGAGAAAGAATACTTTGACCCAGCCACTGTACGTCAGTTGATGGCTCAACAAGAGCTAGACCGGATTAAAAAGGCCAATGAGGTCCTTGGACTGGCAGCTCAGCAGCAAGGGATGTTTGACAACGCCCCTCTTCAGGCTCTGAATCTTCCTACAGCATATCCAGCGCTCCAGGGCATTCCTCCTGTGTTGCTCCCGGGTCTCAACAGCCCCTCCTTGCCAGGCTTTACTCCATCCAACACAGCTTTAACGTCTCCTAAGCCGAACTTGATGGGTCTGCCCAGCACAACAGTTCCTTCCCCTGGCCTCCCCACATCTGGATTACCAAATAAACCGTCCTCAGTGTCACTGAGCTCCCCAACCCCAGCACAAGCCACAATGGCGTTGGCCCCTCAGCAACCCCCTCAACTCCAGCAGCAGCAGCAGCAGCCACAGGTGCAGCAGCCTCCCCCGCCGCCAGCAGCCCAGCCGCCACCCACACAGCTCCCACCTCAACAGCCACGAAAAGACAGTGAGAAAGTAAAGGAGAAGGAAAAGGCACACAAAGGGAAAGGTGAACCCCTGCCTGTCCCCAAGAAGGAGAAAGGAGAGGCCCCCACGGCCGCTGCAGCCACCATCTCAGCCCCACTGCCCTCCATGGAGTATGCAGTGGACCCTGCCCAGCTGCAGGCCCTGCAGGCAGCCTTGACTTCAGACCCCACAGCATTGCTCACGAGCCAGTTCCTTCCTTACTTTGTACCAGGCTTTTCTCCTTATTACGCCCCCCAGATCCCTGGCGCCCTGCAGAGCGGGTACCTGCAGCCTATGTATGGCATGGAAGGCCTGTTCCCCTACAGCCCTGCACTGTCGCAGGCCCTGATGGGGCTGTCCCCGGGCTCCCTACTGCAGCAGTACCAGCAATACCAGCAGAGTCTGCAGGAGGCGATCCAGCAGCAGCAGCAGCGGCAACTACAGCAACAGCAGCAGCAGCAACAGCAGCAGCAAAAAGTGCAGCAGCAGCAGCAGCCCAAAGCAAGCCAAACCCCAGTCCCCCAGGGGGCTGCTTCCCCAGACAAAGACCCTGCCAAAGAATCCCCCAAACCAGAAGAGCAGAAAAACGCCCCCCGTGAGGTGTCCCCCCTCCTGCCGAAACCCCCCGAAGAGCCAGAAGCAGAAAGCAAAAGTGCGGACTCCCTCTACGACCCCTTCATTGTTCCAAAGGTGCAGTACAAGTTGGTCTGCCGCAAGTGCCAGGCGGGCTTCGGCGATGAGGAGGCGGCGAGGAGCCACCTGAAGTCCCTCTGCTTCTTCGGCCAGTCTGTGGCGAACATGCAAGAGATGGTGCTTCACGTCCCCACCGGCAGCGGTGGCGGCGGCGGCGGCGGCGGCAGCGGCTCGTACCACTGCCTAGCGTGCGAGAGCGCGCTCTGTGGGGAGGAAGCTCTGAGTCAACATCTCGAGTCGGCCTTGCACAAACACAGAACAATCACGAGAGCAGCAAGAAACGCCAAAGAGCACCCTAGTTTATTACCTCACTCTGCCTGCTTCCCCGATCCTAGCACCGCATCTACCTCGCAGTCTGCCGCTCACTCAAATGACAGTCCCCCTCCCCCATCGGCCGCCGCCCCCTCTTCGTCCGCTTCCCCCCATGCCTCCAGGAAGTCTTGGCCTCAAGTGGTCTCCCGGGCTTCGGCAGCGAAGCCCCCTTCTTTTCCTCCTCTCTCCTCATCTTCAACGGTTACCTCAAGTTCATGCAGCACCTCAGGGGTTCAGCCCTCGATGCCAACAGACGACTATTCGGAGGAGTCTGACACGGATCTCAGCCAAAAGTCCGACGGACCGGCGAGCCCGGTGGAGGGTCCCAAAGACCCCAGCTGCCCCAAGGACAGTGGTCTGACCAGTGTAGGAACGGACACCTTCAGATTGTAA

XM_004842929.1 Coding sequence

Zfhx3 zinc finger homeobox 3, transcript variant X4

Length: 11115 bp    Location: 15274805..15098418   Strand: -
>XM_004842929.1
ATGGAAGGCTGTGACTCGCCCGTCGTCTCGGGGAAGGACGATGGGTGTGGTATCCCTCAGCACCGGCAATGGACTGAACTCAACAGCACCCGCCTCCCCGACAAACCCAGTAGCATGGAGCAGCCCACAGGCGAGAGCCACGGGCCCCTGGACAGCCTGAGGGCCCCCTTCAGTGAGCGCCTGGCGGACAGCAGCGCCCCCTTGGCCGGGCCCCCCGCCGAGCCCGCCGGCAAGGAGGTCAGCTGCAACGAGTGCTCGGCCTCCTTCGCCAGCCTCCAGACCTACATGGAGCACCACTGCCCCGGCGCACGCCCCCCACCGCCCCTGCGAGAGGAGAGCGCCAGCGACACCAGTGAGGAGGGCGAGGAGGAGAGCGACGTGGAGAACCTGGCTGGGGAGATCGTCTACCAGCCCGACGGCTCCGCGTACATCGTGGAGAGCCTGAGCCAGCTGACCCAGAGCGGGGCCGCGTGTGGCAGTGGCAGCGGGCCTCTCCCCTCGCTCTTCCTGAACTCGCTCCCCGGTGCGGGGGGCAAACAAGGGGACCCTTCGTGTGCTGCACCCGTCTACCCGCAGATTATCAACACTTTCCACATAGCCTCATCCTTCGGGAAATGGTTTGAGGGCTCAGACCAGGCCTTCCCGAATACCTCAGCCCTGGCGGGGCTCAGCCCCGTCCTGCACAGCTTCCGCGTTTTTGACGTGCGACACAAAAGCAACAAGGATTACCTGAACAGCGACGGTTCTGCCAAAAGCTCCTGTGTATCCAAAGATGTTCCCAACAATGTGGACCTGTCCAAATTCGATGGCTTTGTGCTCTACGGCAAGAGGAAGCCCATCCTGATGTGTTTCTTGTGCAAACTCTCCTTCGGGTACGTCCGTTCGTTTGTGACCCACGCGGTACACGACCATCGAATGACCCTGAGTGAAGACGAGCGGAAAATTCTTAGCAATAAGAACATCTCCGCTATCATCCAAGGGATTGGCAAAGACAAGGAACCCCTTGTAAGTTTTCTGGAACCAAAAAACAAAAACTTTCAACACCCTTTAGTTTCCACAGCTAACCTCATAGGCCCCGGACACAGTTTTTATGGTAAATTTAGTGGCATTCGAATGGAAGGGGAGGAGGTTCTCCCAGCCGGCTCTGCCGCCGGCCCTGAGCAGCCCCAGGCTGGTCTCTTGACCCCCAGCACCCTCTTGAACCTTGGCGGACTCACCAGCTCGGTCCTGAAAACCCCCATTACCTCAGTCCCCCTGGGGCCTCTGGCTTCCAGTCCTACCAAATCCTCAGAGGGCAAGGACTCTGGGGCAGCTGAAGGAGAGAGGCAAGAAGCGGGCGATCCGGATTGCTTCTCTGAGAAAGCAGAGCCAGCTGAGGAGGAGGAGGCGGAGGAGGAAGAAGAGGAAGAAGAGGCAGAGGAGGAGGAGGAGGAAGAAGAGGAGGAAGAAGAGGAGGAGGAGGAAGATGAGGGTTGCAAAGGACTCTTTCCAAGTGAGTTGGATGACGAGCTGGAGGACAGGCCCTCCGAGGAGTCTGGGGCAGTAGCAGGTGGTAGCAGCAAAAAGGACCTTGCTCTCTCAAACCAAAGCATTTCTAACTCCCCCTTAATGCCTAATGTGCTCCAGACCTTGTCGAGGGGCACAGCTTCTACTAGTTCTAATTCCGCTTCTTCCTTTGTTGTCTTTGATGGTGCGAACAGGAGGAATCGTTTAAGCTTTAACAGTGAGGGCGTCAGGGCCAATGTGGCAGAGGGCGGCAGGAGGCTGGACTTCGCTGATGAAAGTGCCAATAAAGACAATGCCACAGCACCAGAACCAAATGAAAGCACAGAGGGCGATGATGGGGGCTTCGTCTCACATCACCAGCACGCTGGCTCCCTCTGCGAGCTTGGGGTTGGGGAGTGCCCCTCGGGGAGTGGCGTAGAGTGCCCCAAATGTGACACGGTCTTGGGCTCCTCCCGCTCACTGGGCGGCCACATGACCATGATGCATTCTCGTAACTCGTGTAAGACACTCAAGTGCCCCAAGTGCAACTGGCACTATAAGTACCAGCAGACGCTGGAGGCACACATGAAGGAGAAGCACCCGGAGCCGGGGGGCTCCTGCGTCTACTGCAAAAGTGGGCAGCCCCACCCCCGGTTGGCACGAGGCGAGAGCTACACTTGTGGTTACAAGCCTTTCCGCTGCGAGGTGTGTAACTACTCCACAACTACCAAAGGCAACCTCAGTATTCATATGCAGTCCGACAAGCATCTCAACAACATGCAGAACCTGCAGAATGGAGGGGGGGAGCAAGTCTTCAGCCACACTGCTGGAGCGGCAGCGGCGGCGGCAGCAGCGGCGGCTGCAGCAGCCAATATCAGTGGTTCCTGCGGGGCCCCCTCACCCACCAAACCAAAAACCAAACCCACGTGGCGGTGTGAGGTGTGTGATTATGAGACCAACGTGGCTAGGAACCTCCGCATCCACATGACCAGTGAGAAGCACATGCATAACATGATGCTGCTACAGCAGAACATGACTCAAATCCAACACAACCGCCACCTGGGGCTCGGCAGCCTGCCCTCGCCTGCCGAGGCCGAGCTCTACCAATACTACCTGGCCCAGAACATGAACCTGCCCAACCTGAAGATGGACAGTGCTGCCTCGGACACCCAGTTCATGATGAGTGGATTCCAGCTGGATCCCACCGGGCCCATGACCGCCATGACACCTGCTCTAGTGGGCGGTGAGATCCCCCTAGACATGCGCCTCGGGGGCGGGCAGCTGGTGTCGGAGGAGCTGATGAACCTGGGCGAGAGCTTCATCCAGACCAACGACCCGTCCCTGAAGCTCTTCCAGTGCGCTGTCTGCAACAAGTTCACGACGGACAACCTGGACATGCTGGGGCTGCACATGAACGTGGAGCGCAGCCTTGCGGAGGACGAGTGGAAGGCCGTGATGGGGGACTCGTACCAGTGTAAGCTCTGCCGCTACAACACCCAGCTCAAGGCCAACTTCCAGCTGCACTGCAAGACGGACAAGCATGTGCAGAAGTACCAGCTGGTGGCCCACATCAAAGAGGGCGGCAAGGCCAACGAGTGGAGGCTCAAGTGTGTGGCCATCGGCAACCCCGTGCACCTCAAGTGCAATGCCTGCGACTATTACACGAACAGCCTGGAGAAGCTGCGGCTGCACACGGTCAACTCCAGGCACGAGGCCAGCCTGAAGCTGTACAAGCACCTGCAGCAGCATGAGAGTGGCGTGGAGGGCGAGAGCTGCTACTACCACTGCGTCCTGTGCAGCTACTCCACCAAGGCCAAGCTCAACCTCATCCAACATGTGCGCTCCATGAAGCACCAGCGCAGCGAGAGCCTACGCAAGCTGCAGCGGCTGCAGAAAGGCCTTCCAGAAGAGGACGAGGACCTGGGGCAGATCTTCACCATCCGCAGGTGTCCCTCGACCGACCCAGAAGAAGCCATTGAAGATGTTGAAGGACCCAGTGAAACAGGTGCTGATCCAGAGGAGCTTGCTAAAGACCAGGAAAGTGGAGGCGAGAAAGACCAGAGCAAATGGACAGCCTCATCCAGCCAAGCAGAGAAGGAGCTGACGGATTCTCCTGCTGCCTCCAAACGCATCTCCTTCCCAGGTAGTTCGGAGTCTCAGCTCTCTTCAAAGCGACCAAAAACATCTGAGGCGATCAAACCGGAGCAGATGTACCAGTGCCCCTACTGCAAGTACAGCAATGTCGATGTGAACCGGCTCCGGGTGCATGCCATGACACAGCACTCAGTGCAGCCCATGCTTCGCTGCCCCCTGTGCCAGGACATGCTCAACAATAAGATCCACCTTCAGCTGCACCTCACCCACCTCCACAGTGTGGCACCTGACTGCGTGGAGAAGCTCATTATGACGGTGACCACCCCTGAGATGGTGATGCCCAGCAGCATGTTCCTCCCAGCAGCTGTTTCAGATCGAGATGGGAATTCCAATTTGGAAGAGGCAGGAAAGCAGTCTGAAACATCAGAGGATCTGGGAAAAAACATCTTACCATCTGTGAGCACAGAACATAGTGGAGATTTGAAACCTTCTTCTGCTGATCCAGGCTCTGTGAGAGAAGACTCGGGCTTTCTCTGCTGGAAAAAGGGGTGTAACCAGGTTTTCAAAACTTCTGCTGCCCTTCAGACACATTTTAATGAAGTGCATGCCAAAAGGCCTCAGCTGCCTGTGTCAGATCGCCATGTGTACAAGTACCGGTGTAATCAGTGCAGCCTGGCATTCAAGACAATTGAAAAGTTGCAGCTCCATTCTCAGTACCATGTGATCAGAGCTGCCACCATGTGCTGTCTTTGTCAGCGCAGTTTCCGAACTTTCCAGGCTCTCAAAAAGCACCTTGAGACGAGCCACCTGGAGTTGAGTGAGGCTGACATCCAACAACTTTATGGTGGCCTTTTGGCCAATGGGGACCTCCTGGCAATGGGAGATCCCACCCTGGCTGAAGACCACACTATAATTGTGGAAGAAGACAAGGAGGAAGAGAGTGACTTGGAAGATAAACAAAGCCCAACAGGCAGTGACTCTGGGTCAGTACAAGAAGATTCAGGCTCAGAGCCAAAGAGAGCTCTCCCTTTCAGAAAAGGCCCCAACTTTACCATGGAAAAATTTCTAGACCCTTCTCGCCCTTACAAGTGTACTGTCTGTAAGGAATCTTTCACTCAAAAGAATATCCTGCTAGTGCACTACAATTCTGTCTCCCACCTACATAAGTTAAAAAGAGCCCTTCAAGAATCTGCAACTGGTCAACCAGAACCCACCAGCAGCCCAGACAATAAACCTTTTAAGTGTAACACTTGTAATGTGGCCTATAGCCAGAGTTCTACTCTGGAGATCCACATGAGGTCTGTGTTGCATCAAACCAAAGCCAGGGCAGCCAAGCTGGAGGCCGCAAGTGGCAGCAGCAATGGGACTGGGAACAGCAGCAGTGTCTCCCTAAGCTCCTCCACACCAAGTCCTGTCAGTACCAGTGGCAGTAACACCTTTACCACCACCAATCCAAGTAGTACTGGCATTGTACCAAGCTCCAACTTACTGAGCCAAGTGCCCACTGACACTGTCGGGATGCCACCTCTAGGAAATCCCATCAGTGCCAACATCGCTTCCCCTTCAGAGCCCAAGGAGGCCAATCGGAAGAAGCTGGCAGATATGATTGCATCCAGGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAGCAACAGCAGCAGCAGCAAGCACAGACACTGGCCCAGGCCCAGGCTCAAGTTCAGGCTCACTTACAGCAGGAGCTGCAGCAGCAGGCTGCCCTTATCCAGTCACAGCTGTTTAATCCCACCCTCCTTCCTCACTTCCCCATGACCACTGAGACACTGCTGCAGTTGCAACAGCAGCAGCATCTCCTCTTCCCTTTCTATATCCCCAGTGCTGAGTTCCAGCTCAACCCTGAGGTGAGCTTGCCAGTGACCAGTGGGGCACTGACGCTGACAGGGACTGGTCCAGGCCTGCTGGAAGATCTGAAGGCTCAGGTTCAGATCCCACAGCAGAGTCACCAACAGATCCTGCAGCAACAGCAGCAGCACCAAAGTCAACTCTCTGTGTCCCAGAGTCACTCTGCTCTCCTTCAGCCAAGTCAGCACCCCGAAAAGAAAAACAAATTGGTCATCAAAGAGAAGGAAAAAGAAAGCCAGAGAGAGAGAGAGGGTGTGGAGGGGGGAGAGGGCAACACGGGTCCAAAGGAATTGTTGCCAGACGCCTTGAAGGCCAAAGAGAAGAAGGAGTTGGCACCAGGGGGTGGTTCTGAGCCTTCTATGCTTCCTCCACGCATCGCCTCAGATGCCAGAGGGAACGCCACCAAGGCCTTGCTGGAGAACTTTGGCTTTGAGCTGGTCATTCAGTACAATGAGAATAAGCAGAAGGTGCAGAAGAAGAATGGGAAGACAGAACAGGGAGAGAACCTGGAAAAACTTGAGTGCGACTCCTGTGGCAAGTTATTTTCCAACATCTTGATCTTAAAGAGTCATCAGGAGCACGTTCATCAGAATTACTTTCCCTTTAAACAGCTCGAGAAGTTTGCCAAACAGTACCGGGAGCACTATGATAAACTGTACCCCCTGAGGCCCCAGACCCCCGAGCCGCCNNNNNNNNNNNNNNNNNNNNNACCACCCCCGCTTCCTGCTGCACCCCCTCAGCCAGCTTCCGCACCTGCCATCCCTGCGTCAGCCCCACCCATCACTTCACCAACAATCGCGCCAGCCCAGCCATCTGTGCCGCTCACCCAGCTCTCTATGCCAATGGAGCTGCCCATCTTCTCACCACTGATGATGCAGACGATGCCACTGCAGACCTTGCCAGCTCAGCTGCCCCCTCAGCTTGGCCCTGTGGAGCCTCTGCCTGCAGACCTGGCCCAGCTGTATCAGCATCAGCTCAATCCAACCCTGCTCCAGCAGCAGAACAAGAGACCTCGCACCAGAATCACAGATGACCAGCTCCGAGTGCTGCGGCAATATTTTGACATTAACAATTCCCCCAGTGAAGAGCAAATCAAAGAGATGGCAGATAAGTCTGGGTTGCCCCAGAAAGTGATCAAGCACTGGTTCAGGAACACACTCTTCAAAGAGCGGCAGCGTAACAAGGACTCCCCTTACAACTTCAGCAATCCTCCCATCACCAGCCTGGAGGAGCTCAAGATTGACTCTCGGCCCCCTTCCCCAGAACCTCAGAAGCAGGAGTACTGGGGAAGCAAGAGATCTTCAAGAACAAGGTTTACTGACTACCAACTCCGAGTCCTCCAGGACTTCTTTGATGCCAATGCTTACCCAAAGGATGATGAATTTGAGCAACTCTCTAATTTACTGAACCTTCCAACCCGAGTCATTGTGGTATGGTTCCAGAATGCCCGACAGAAGGCCAGGAAAAATTACGAGAATCAGGGAGAGGGCAAAGATGGAGAGCGGCGTGAGCTTACAAATGATAGATACATTCGAACGAGCAACTTGAACTACCAGTGCAAAAAATGTAGCCTGGTGTTTCAGCGCATCTTTGATCTCATCAAGCATCAGAAGAAGCTGTGTTATAAGGATGAGGATGAGGAAGGGCAGGATGACAGCCAAAATGAGGATTCCATGGATGCCATGGAAATCCTCACACCAACCAGTTCCTCCTGCAGCACTCCAATGCCCTCCCAGGCTTACAGTGCCCCGGCACCATCAGCCAATCCTGCTCCTGCTGCTTTCCTGCACCTTACAGCTGAGGCAGATGAGCTAGCCACCTTCAATTCAAAAACAGAAGCAAGTGATGAGAAACCAAAGCAAGCTGAACCTCCCAGTGCACAGCCAAACCAAACCCAAGAAAAGCAAGGACAACCAAAGCCAGAGCTTCAGCAGCAAGACCAATCTGAGCAGAAGACAACTGTGCCCCAGCAAAAGCTTCCACAGCTGGCTGCCCCACCTTCCTTACCACAGCCTCCTCCACAGGCTCCTCCTCCTCAATGCCCCTTACCCCAGTCGAGCCCCAGTCCCTCTCAGCTCTCCCATCTGCCCCTCAAACCTCTCCACACATCAACGCCTCAACAGCTGGCCAACCTACCTCCTCAGCTCATCCCCTACCAGTGTGACCAGTGTAAGCTGGCATTTCCATCGTTTGAGCATTGGCAAGAGCATCAGCAACTTCATTTCTTGAGTGCACAGAACCAGTTCATCCACCCCCAGTTCCTGGACAGGTCACTGGACATGCCTTTCATGCTGTTCGATCCCAGTAACCCACTCCTGGCCAGCCAGCTGCTTTCCGGAGCCATACCTCAGATTCCAGCAAGCTCCGCCACTTCTCCTTCCACACCAACCTCTACGATGAACACTCTGAAGAGGAAGCTGGAGGAAAAGGCCAGTGCAAGCCCTGGTGAAAATGACAGTGGGACAGGAGGAGAAGAGCCTCAGAGAGACAAGCGTTTGAGGACAACTATTACACCGGAGCAACTAGAAATTCTCTACCAAAAGTATCTACTGGACTCTAATCCAACGCGAAAGATGTTGGATCATATTGCTCATGAGGTGGGTTTGAAGAAACGTGTGGTTCAAGTCTGGTTTCAGAACACTAGAGCTCGAGAACGGAAAGGACAGTTCCGGGCCGTGGGCCCAGCCCAGGCGCACAGGAGATGCCCTTTCTGCAGAGCGCTCTTTAAAGCCAAGACTGCCCTTGAGGCTCATATCCGGTCTCGTCACTGGCACGAAGCCAAGAGAGCTGGCTATAACCTAACTCTGTCTGCAATGCTTTTGGACTGCGATGGGGGGCTCCAGATGAAAGGAGATATTTTTGATGGAACTAGCTTTTCCCACCTACCCCCAAGTAGTAGTGATGGTCAGGGTGTTCCCCTGTCGCCTGTGAGTAAAACCATGGAATTGTCTCCCAGAACTCTTCTCAGCCCTTCCTCCATCAAAGTGGAAGGGATTGAAGACTTTGAAAGCCCCTCCATGTCCTCAGTTAATCTAAACTTTGACCAAGCTAAGCTGGACAATGATGACTGTTCCTCTGTCAACACGGCAATCACAGACACCACGACAGGAGATGAGGGTAATGCAGATAACGACAGTGCGACGGGAATAGCAACTGAAACCAAATCTTCTGCACCCAATGAAGGGTTGACCAAAGCGGCCATGATGGCAATGTCTGAGTATGAAGATCGGTTGTCTTCTGGCCTGGTCAGCCCAGCCCCGAGCTTTTATAGCAAGGAATATGACAACGAAGGTACAGTGGACTACAGTGAAACCTCAAGTCTTGCGGACCCGTGCTCCCCAAGTCCTGGTGCAAGTGGGTCTGCAGGCAAATCTGGTGACAGCGGGGATCGGCCCGGGCAGAAACGTTTTCGCACTCAGATGACCAATCTGCAGCTGAAGGTCCTCAAGTCATGCTTTAATGACTATAGGACACCCACTATGCTAGAGTGTGAGGTCCTGGGCAATGACATTGGACTGCCAAAGAGAGTTGTTCAGGTCTGGTTCCAGAATGCCCGGGCAAAAGAAAAGAAGTCCAAGTTAAGCATGGCCAAGCATTTTGGTATAAACCAAACGAGTTATGAGGGACCCAAAACAGAGTGCACTTTGTGTGGCATCAAGTACAGCGCTCGGCTGTCTGTACGTGACCATATCTTTTCCCAACAGCATATCTCCAAAGTTAAAGACACCATTGGAAGCCAGTTGGACAAGGAGAAAGAATACTTTGACCCAGCCACTGTACGTCAGTTGATGGCTCAACAAGAGCTAGACCGGATTAAAAAGGCCAATGAGGTCCTTGGACTGGCAGCTCAGCAGCAAGGGATGTTTGACAACGCCCCTCTTCAGGCTCTGAATCTTCCTACAGCATATCCAGCGCTCCAGGGCATTCCTCCTGTGTTGCTCCCGGGTCTCAACAGCCCCTCCTTGCCAGGCTTTACTCCATCCAACACAGCTTTAACGTCTCCTAAGCCGAACTTGATGGGTCTGCCCAGCACAACAGTTCCTTCCCCTGGCCTCCCCACATCTGGATTACCAAATAAACCGTCCTCAGTGTCACTGAGCTCCCCAACCCCAGCACAAGCCACAATGGCGTTGGCCCCTCAGCAACCCCCTCAACTCCAGCAGCAGCAGCAGCAGCCACAGGTGCAGCAGCCTCCCCCGCCGCCAGCAGCCCAGCCGCCACCCACACAGCTCCCACCTCAACAGCCACGAAAAGACAGTGAGAAAGTAAAGGAGAAGGAAAAGGCACACAAAGGGAAAGGTGAACCCCTGCCTGTCCCCAAGAAGGAGAAAGGAGAGGCCCCCACGGCCGCTGCAGCCACCATCTCAGCCCCACTGCCCTCCATGGAGTATGCAGTGGACCCTGCCCAGCTGCAGGCCCTGCAGGCAGCCTTGACTTCAGACCCCACAGCATTGCTCACGAGCCAGTTCCTTCCTTACTTTGTACCAGGCTTTTCTCCTTATTACGCCCCCCAGATCCCTGGCGCCCTGCAGAGCGGGTACCTGCAGCCTATGTATGGCATGGAAGGCCTGTTCCCCTACAGCCCTGCACTGTCGCAGGCCCTGATGGGGCTGTCCCCGGGCTCCCTACTGCAGCAGTACCAGCAATACCAGCAGAGTCTGCAGGAGGCGATCCAGCAGCAGCAGCAGCGGCAACTACAGCAACAGCAGCAGCAGCAACAGCAGCAGCAAAAAGTGCAGCAGCAGCAGCAGCCCAAAGCAAGCCAAACCCCAGTCCCCCAGGGGGCTGCTTCCCCAGACAAAGACCCTGCCAAAGAATCCCCCAAACCAGAAGAGCAGAAAAACGCCCCCCGTGAGGTGTCCCCCCTCCTGCCGAAACCCCCCGAAGAGCCAGAAGCAGAAAGCAAAAGTGCGGACTCCCTCTACGACCCCTTCATTGTTCCAAAGGTGCAGTACAAGTTGGTCTGCCGCAAGTGCCAGGCGGGCTTCGGCGATGAGGAGGCGGCGAGGAGCCACCTGAAGTCCCTCTGCTTCTTCGGCCAGTCTGTGGCGAACATGCAAGAGATGGTGCTTCACGTCCCCACCGGCAGCGGTGGCGGCGGCGGCGGCGGCGGCAGCGGCTCGTACCACTGCCTAGCGTGCGAGAGCGCGCTCTGTGGGGAGGAAGCTCTGAGTCAACATCTCGAGTCGGCCTTGCACAAACACAGAACAATCACGAGAGCAGCAAGAAACGCCAAAGAGCACCCTAGTTTATTACCTCACTCTGCCTGCTTCCCCGATCCTAGCACCGCATCTACCTCGCAGTCTGCCGCTCACTCAAATGACAGTCCCCCTCCCCCATCGGCCGCCGCCCCCTCTTCGTCCGCTTCCCCCCATGCCTCCAGGAAGTCTTGGCCTCAAGTGGTCTCCCGGGCTTCGGCAGCGAAGCCCCCTTCTTTTCCTCCTCTCTCCTCATCTTCAACGGTTACCTCAAGTTCATGCAGCACCTCAGGGGTTCAGCCCTCGATGCCAACAGACGACTATTCGGAGGAGTCTGACACGGATCTCAGCCAAAAGTCCGACGGACCGGCGAGCCCGGTGGAGGGTCCCAAAGACCCCAGCTGCCCCAAGGACAGTGGTCTGACCAGTGTAGGAACGGACACCTTCAGATTGTAA

XM_004842927.1 Coding sequence

Zfhx3 zinc finger homeobox 3, transcript variant X2

Length: 11115 bp    Location: 15330358..15098418   Strand: -
>XM_004842927.1
ATGGAAGGCTGTGACTCGCCCGTCGTCTCGGGGAAGGACGATGGGTGTGGTATCCCTCAGCACCGGCAATGGACTGAACTCAACAGCACCCGCCTCCCCGACAAACCCAGTAGCATGGAGCAGCCCACAGGCGAGAGCCACGGGCCCCTGGACAGCCTGAGGGCCCCCTTCAGTGAGCGCCTGGCGGACAGCAGCGCCCCCTTGGCCGGGCCCCCCGCCGAGCCCGCCGGCAAGGAGGTCAGCTGCAACGAGTGCTCGGCCTCCTTCGCCAGCCTCCAGACCTACATGGAGCACCACTGCCCCGGCGCACGCCCCCCACCGCCCCTGCGAGAGGAGAGCGCCAGCGACACCAGTGAGGAGGGCGAGGAGGAGAGCGACGTGGAGAACCTGGCTGGGGAGATCGTCTACCAGCCCGACGGCTCCGCGTACATCGTGGAGAGCCTGAGCCAGCTGACCCAGAGCGGGGCCGCGTGTGGCAGTGGCAGCGGGCCTCTCCCCTCGCTCTTCCTGAACTCGCTCCCCGGTGCGGGGGGCAAACAAGGGGACCCTTCGTGTGCTGCACCCGTCTACCCGCAGATTATCAACACTTTCCACATAGCCTCATCCTTCGGGAAATGGTTTGAGGGCTCAGACCAGGCCTTCCCGAATACCTCAGCCCTGGCGGGGCTCAGCCCCGTCCTGCACAGCTTCCGCGTTTTTGACGTGCGACACAAAAGCAACAAGGATTACCTGAACAGCGACGGTTCTGCCAAAAGCTCCTGTGTATCCAAAGATGTTCCCAACAATGTGGACCTGTCCAAATTCGATGGCTTTGTGCTCTACGGCAAGAGGAAGCCCATCCTGATGTGTTTCTTGTGCAAACTCTCCTTCGGGTACGTCCGTTCGTTTGTGACCCACGCGGTACACGACCATCGAATGACCCTGAGTGAAGACGAGCGGAAAATTCTTAGCAATAAGAACATCTCCGCTATCATCCAAGGGATTGGCAAAGACAAGGAACCCCTTGTAAGTTTTCTGGAACCAAAAAACAAAAACTTTCAACACCCTTTAGTTTCCACAGCTAACCTCATAGGCCCCGGACACAGTTTTTATGGTAAATTTAGTGGCATTCGAATGGAAGGGGAGGAGGTTCTCCCAGCCGGCTCTGCCGCCGGCCCTGAGCAGCCCCAGGCTGGTCTCTTGACCCCCAGCACCCTCTTGAACCTTGGCGGACTCACCAGCTCGGTCCTGAAAACCCCCATTACCTCAGTCCCCCTGGGGCCTCTGGCTTCCAGTCCTACCAAATCCTCAGAGGGCAAGGACTCTGGGGCAGCTGAAGGAGAGAGGCAAGAAGCGGGCGATCCGGATTGCTTCTCTGAGAAAGCAGAGCCAGCTGAGGAGGAGGAGGCGGAGGAGGAAGAAGAGGAAGAAGAGGCAGAGGAGGAGGAGGAGGAAGAAGAGGAGGAAGAAGAGGAGGAGGAGGAAGATGAGGGTTGCAAAGGACTCTTTCCAAGTGAGTTGGATGACGAGCTGGAGGACAGGCCCTCCGAGGAGTCTGGGGCAGTAGCAGGTGGTAGCAGCAAAAAGGACCTTGCTCTCTCAAACCAAAGCATTTCTAACTCCCCCTTAATGCCTAATGTGCTCCAGACCTTGTCGAGGGGCACAGCTTCTACTAGTTCTAATTCCGCTTCTTCCTTTGTTGTCTTTGATGGTGCGAACAGGAGGAATCGTTTAAGCTTTAACAGTGAGGGCGTCAGGGCCAATGTGGCAGAGGGCGGCAGGAGGCTGGACTTCGCTGATGAAAGTGCCAATAAAGACAATGCCACAGCACCAGAACCAAATGAAAGCACAGAGGGCGATGATGGGGGCTTCGTCTCACATCACCAGCACGCTGGCTCCCTCTGCGAGCTTGGGGTTGGGGAGTGCCCCTCGGGGAGTGGCGTAGAGTGCCCCAAATGTGACACGGTCTTGGGCTCCTCCCGCTCACTGGGCGGCCACATGACCATGATGCATTCTCGTAACTCGTGTAAGACACTCAAGTGCCCCAAGTGCAACTGGCACTATAAGTACCAGCAGACGCTGGAGGCACACATGAAGGAGAAGCACCCGGAGCCGGGGGGCTCCTGCGTCTACTGCAAAAGTGGGCAGCCCCACCCCCGGTTGGCACGAGGCGAGAGCTACACTTGTGGTTACAAGCCTTTCCGCTGCGAGGTGTGTAACTACTCCACAACTACCAAAGGCAACCTCAGTATTCATATGCAGTCCGACAAGCATCTCAACAACATGCAGAACCTGCAGAATGGAGGGGGGGAGCAAGTCTTCAGCCACACTGCTGGAGCGGCAGCGGCGGCGGCAGCAGCGGCGGCTGCAGCAGCCAATATCAGTGGTTCCTGCGGGGCCCCCTCACCCACCAAACCAAAAACCAAACCCACGTGGCGGTGTGAGGTGTGTGATTATGAGACCAACGTGGCTAGGAACCTCCGCATCCACATGACCAGTGAGAAGCACATGCATAACATGATGCTGCTACAGCAGAACATGACTCAAATCCAACACAACCGCCACCTGGGGCTCGGCAGCCTGCCCTCGCCTGCCGAGGCCGAGCTCTACCAATACTACCTGGCCCAGAACATGAACCTGCCCAACCTGAAGATGGACAGTGCTGCCTCGGACACCCAGTTCATGATGAGTGGATTCCAGCTGGATCCCACCGGGCCCATGACCGCCATGACACCTGCTCTAGTGGGCGGTGAGATCCCCCTAGACATGCGCCTCGGGGGCGGGCAGCTGGTGTCGGAGGAGCTGATGAACCTGGGCGAGAGCTTCATCCAGACCAACGACCCGTCCCTGAAGCTCTTCCAGTGCGCTGTCTGCAACAAGTTCACGACGGACAACCTGGACATGCTGGGGCTGCACATGAACGTGGAGCGCAGCCTTGCGGAGGACGAGTGGAAGGCCGTGATGGGGGACTCGTACCAGTGTAAGCTCTGCCGCTACAACACCCAGCTCAAGGCCAACTTCCAGCTGCACTGCAAGACGGACAAGCATGTGCAGAAGTACCAGCTGGTGGCCCACATCAAAGAGGGCGGCAAGGCCAACGAGTGGAGGCTCAAGTGTGTGGCCATCGGCAACCCCGTGCACCTCAAGTGCAATGCCTGCGACTATTACACGAACAGCCTGGAGAAGCTGCGGCTGCACACGGTCAACTCCAGGCACGAGGCCAGCCTGAAGCTGTACAAGCACCTGCAGCAGCATGAGAGTGGCGTGGAGGGCGAGAGCTGCTACTACCACTGCGTCCTGTGCAGCTACTCCACCAAGGCCAAGCTCAACCTCATCCAACATGTGCGCTCCATGAAGCACCAGCGCAGCGAGAGCCTACGCAAGCTGCAGCGGCTGCAGAAAGGCCTTCCAGAAGAGGACGAGGACCTGGGGCAGATCTTCACCATCCGCAGGTGTCCCTCGACCGACCCAGAAGAAGCCATTGAAGATGTTGAAGGACCCAGTGAAACAGGTGCTGATCCAGAGGAGCTTGCTAAAGACCAGGAAAGTGGAGGCGAGAAAGACCAGAGCAAATGGACAGCCTCATCCAGCCAAGCAGAGAAGGAGCTGACGGATTCTCCTGCTGCCTCCAAACGCATCTCCTTCCCAGGTAGTTCGGAGTCTCAGCTCTCTTCAAAGCGACCAAAAACATCTGAGGCGATCAAACCGGAGCAGATGTACCAGTGCCCCTACTGCAAGTACAGCAATGTCGATGTGAACCGGCTCCGGGTGCATGCCATGACACAGCACTCAGTGCAGCCCATGCTTCGCTGCCCCCTGTGCCAGGACATGCTCAACAATAAGATCCACCTTCAGCTGCACCTCACCCACCTCCACAGTGTGGCACCTGACTGCGTGGAGAAGCTCATTATGACGGTGACCACCCCTGAGATGGTGATGCCCAGCAGCATGTTCCTCCCAGCAGCTGTTTCAGATCGAGATGGGAATTCCAATTTGGAAGAGGCAGGAAAGCAGTCTGAAACATCAGAGGATCTGGGAAAAAACATCTTACCATCTGTGAGCACAGAACATAGTGGAGATTTGAAACCTTCTTCTGCTGATCCAGGCTCTGTGAGAGAAGACTCGGGCTTTCTCTGCTGGAAAAAGGGGTGTAACCAGGTTTTCAAAACTTCTGCTGCCCTTCAGACACATTTTAATGAAGTGCATGCCAAAAGGCCTCAGCTGCCTGTGTCAGATCGCCATGTGTACAAGTACCGGTGTAATCAGTGCAGCCTGGCATTCAAGACAATTGAAAAGTTGCAGCTCCATTCTCAGTACCATGTGATCAGAGCTGCCACCATGTGCTGTCTTTGTCAGCGCAGTTTCCGAACTTTCCAGGCTCTCAAAAAGCACCTTGAGACGAGCCACCTGGAGTTGAGTGAGGCTGACATCCAACAACTTTATGGTGGCCTTTTGGCCAATGGGGACCTCCTGGCAATGGGAGATCCCACCCTGGCTGAAGACCACACTATAATTGTGGAAGAAGACAAGGAGGAAGAGAGTGACTTGGAAGATAAACAAAGCCCAACAGGCAGTGACTCTGGGTCAGTACAAGAAGATTCAGGCTCAGAGCCAAAGAGAGCTCTCCCTTTCAGAAAAGGCCCCAACTTTACCATGGAAAAATTTCTAGACCCTTCTCGCCCTTACAAGTGTACTGTCTGTAAGGAATCTTTCACTCAAAAGAATATCCTGCTAGTGCACTACAATTCTGTCTCCCACCTACATAAGTTAAAAAGAGCCCTTCAAGAATCTGCAACTGGTCAACCAGAACCCACCAGCAGCCCAGACAATAAACCTTTTAAGTGTAACACTTGTAATGTGGCCTATAGCCAGAGTTCTACTCTGGAGATCCACATGAGGTCTGTGTTGCATCAAACCAAAGCCAGGGCAGCCAAGCTGGAGGCCGCAAGTGGCAGCAGCAATGGGACTGGGAACAGCAGCAGTGTCTCCCTAAGCTCCTCCACACCAAGTCCTGTCAGTACCAGTGGCAGTAACACCTTTACCACCACCAATCCAAGTAGTACTGGCATTGTACCAAGCTCCAACTTACTGAGCCAAGTGCCCACTGACACTGTCGGGATGCCACCTCTAGGAAATCCCATCAGTGCCAACATCGCTTCCCCTTCAGAGCCCAAGGAGGCCAATCGGAAGAAGCTGGCAGATATGATTGCATCCAGGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAGCAACAGCAGCAGCAGCAAGCACAGACACTGGCCCAGGCCCAGGCTCAAGTTCAGGCTCACTTACAGCAGGAGCTGCAGCAGCAGGCTGCCCTTATCCAGTCACAGCTGTTTAATCCCACCCTCCTTCCTCACTTCCCCATGACCACTGAGACACTGCTGCAGTTGCAACAGCAGCAGCATCTCCTCTTCCCTTTCTATATCCCCAGTGCTGAGTTCCAGCTCAACCCTGAGGTGAGCTTGCCAGTGACCAGTGGGGCACTGACGCTGACAGGGACTGGTCCAGGCCTGCTGGAAGATCTGAAGGCTCAGGTTCAGATCCCACAGCAGAGTCACCAACAGATCCTGCAGCAACAGCAGCAGCACCAAAGTCAACTCTCTGTGTCCCAGAGTCACTCTGCTCTCCTTCAGCCAAGTCAGCACCCCGAAAAGAAAAACAAATTGGTCATCAAAGAGAAGGAAAAAGAAAGCCAGAGAGAGAGAGAGGGTGTGGAGGGGGGAGAGGGCAACACGGGTCCAAAGGAATTGTTGCCAGACGCCTTGAAGGCCAAAGAGAAGAAGGAGTTGGCACCAGGGGGTGGTTCTGAGCCTTCTATGCTTCCTCCACGCATCGCCTCAGATGCCAGAGGGAACGCCACCAAGGCCTTGCTGGAGAACTTTGGCTTTGAGCTGGTCATTCAGTACAATGAGAATAAGCAGAAGGTGCAGAAGAAGAATGGGAAGACAGAACAGGGAGAGAACCTGGAAAAACTTGAGTGCGACTCCTGTGGCAAGTTATTTTCCAACATCTTGATCTTAAAGAGTCATCAGGAGCACGTTCATCAGAATTACTTTCCCTTTAAACAGCTCGAGAAGTTTGCCAAACAGTACCGGGAGCACTATGATAAACTGTACCCCCTGAGGCCCCAGACCCCCGAGCCGCCNNNNNNNNNNNNNNNNNNNNNACCACCCCCGCTTCCTGCTGCACCCCCTCAGCCAGCTTCCGCACCTGCCATCCCTGCGTCAGCCCCACCCATCACTTCACCAACAATCGCGCCAGCCCAGCCATCTGTGCCGCTCACCCAGCTCTCTATGCCAATGGAGCTGCCCATCTTCTCACCACTGATGATGCAGACGATGCCACTGCAGACCTTGCCAGCTCAGCTGCCCCCTCAGCTTGGCCCTGTGGAGCCTCTGCCTGCAGACCTGGCCCAGCTGTATCAGCATCAGCTCAATCCAACCCTGCTCCAGCAGCAGAACAAGAGACCTCGCACCAGAATCACAGATGACCAGCTCCGAGTGCTGCGGCAATATTTTGACATTAACAATTCCCCCAGTGAAGAGCAAATCAAAGAGATGGCAGATAAGTCTGGGTTGCCCCAGAAAGTGATCAAGCACTGGTTCAGGAACACACTCTTCAAAGAGCGGCAGCGTAACAAGGACTCCCCTTACAACTTCAGCAATCCTCCCATCACCAGCCTGGAGGAGCTCAAGATTGACTCTCGGCCCCCTTCCCCAGAACCTCAGAAGCAGGAGTACTGGGGAAGCAAGAGATCTTCAAGAACAAGGTTTACTGACTACCAACTCCGAGTCCTCCAGGACTTCTTTGATGCCAATGCTTACCCAAAGGATGATGAATTTGAGCAACTCTCTAATTTACTGAACCTTCCAACCCGAGTCATTGTGGTATGGTTCCAGAATGCCCGACAGAAGGCCAGGAAAAATTACGAGAATCAGGGAGAGGGCAAAGATGGAGAGCGGCGTGAGCTTACAAATGATAGATACATTCGAACGAGCAACTTGAACTACCAGTGCAAAAAATGTAGCCTGGTGTTTCAGCGCATCTTTGATCTCATCAAGCATCAGAAGAAGCTGTGTTATAAGGATGAGGATGAGGAAGGGCAGGATGACAGCCAAAATGAGGATTCCATGGATGCCATGGAAATCCTCACACCAACCAGTTCCTCCTGCAGCACTCCAATGCCCTCCCAGGCTTACAGTGCCCCGGCACCATCAGCCAATCCTGCTCCTGCTGCTTTCCTGCACCTTACAGCTGAGGCAGATGAGCTAGCCACCTTCAATTCAAAAACAGAAGCAAGTGATGAGAAACCAAAGCAAGCTGAACCTCCCAGTGCACAGCCAAACCAAACCCAAGAAAAGCAAGGACAACCAAAGCCAGAGCTTCAGCAGCAAGACCAATCTGAGCAGAAGACAACTGTGCCCCAGCAAAAGCTTCCACAGCTGGCTGCCCCACCTTCCTTACCACAGCCTCCTCCACAGGCTCCTCCTCCTCAATGCCCCTTACCCCAGTCGAGCCCCAGTCCCTCTCAGCTCTCCCATCTGCCCCTCAAACCTCTCCACACATCAACGCCTCAACAGCTGGCCAACCTACCTCCTCAGCTCATCCCCTACCAGTGTGACCAGTGTAAGCTGGCATTTCCATCGTTTGAGCATTGGCAAGAGCATCAGCAACTTCATTTCTTGAGTGCACAGAACCAGTTCATCCACCCCCAGTTCCTGGACAGGTCACTGGACATGCCTTTCATGCTGTTCGATCCCAGTAACCCACTCCTGGCCAGCCAGCTGCTTTCCGGAGCCATACCTCAGATTCCAGCAAGCTCCGCCACTTCTCCTTCCACACCAACCTCTACGATGAACACTCTGAAGAGGAAGCTGGAGGAAAAGGCCAGTGCAAGCCCTGGTGAAAATGACAGTGGGACAGGAGGAGAAGAGCCTCAGAGAGACAAGCGTTTGAGGACAACTATTACACCGGAGCAACTAGAAATTCTCTACCAAAAGTATCTACTGGACTCTAATCCAACGCGAAAGATGTTGGATCATATTGCTCATGAGGTGGGTTTGAAGAAACGTGTGGTTCAAGTCTGGTTTCAGAACACTAGAGCTCGAGAACGGAAAGGACAGTTCCGGGCCGTGGGCCCAGCCCAGGCGCACAGGAGATGCCCTTTCTGCAGAGCGCTCTTTAAAGCCAAGACTGCCCTTGAGGCTCATATCCGGTCTCGTCACTGGCACGAAGCCAAGAGAGCTGGCTATAACCTAACTCTGTCTGCAATGCTTTTGGACTGCGATGGGGGGCTCCAGATGAAAGGAGATATTTTTGATGGAACTAGCTTTTCCCACCTACCCCCAAGTAGTAGTGATGGTCAGGGTGTTCCCCTGTCGCCTGTGAGTAAAACCATGGAATTGTCTCCCAGAACTCTTCTCAGCCCTTCCTCCATCAAAGTGGAAGGGATTGAAGACTTTGAAAGCCCCTCCATGTCCTCAGTTAATCTAAACTTTGACCAAGCTAAGCTGGACAATGATGACTGTTCCTCTGTCAACACGGCAATCACAGACACCACGACAGGAGATGAGGGTAATGCAGATAACGACAGTGCGACGGGAATAGCAACTGAAACCAAATCTTCTGCACCCAATGAAGGGTTGACCAAAGCGGCCATGATGGCAATGTCTGAGTATGAAGATCGGTTGTCTTCTGGCCTGGTCAGCCCAGCCCCGAGCTTTTATAGCAAGGAATATGACAACGAAGGTACAGTGGACTACAGTGAAACCTCAAGTCTTGCGGACCCGTGCTCCCCAAGTCCTGGTGCAAGTGGGTCTGCAGGCAAATCTGGTGACAGCGGGGATCGGCCCGGGCAGAAACGTTTTCGCACTCAGATGACCAATCTGCAGCTGAAGGTCCTCAAGTCATGCTTTAATGACTATAGGACACCCACTATGCTAGAGTGTGAGGTCCTGGGCAATGACATTGGACTGCCAAAGAGAGTTGTTCAGGTCTGGTTCCAGAATGCCCGGGCAAAAGAAAAGAAGTCCAAGTTAAGCATGGCCAAGCATTTTGGTATAAACCAAACGAGTTATGAGGGACCCAAAACAGAGTGCACTTTGTGTGGCATCAAGTACAGCGCTCGGCTGTCTGTACGTGACCATATCTTTTCCCAACAGCATATCTCCAAAGTTAAAGACACCATTGGAAGCCAGTTGGACAAGGAGAAAGAATACTTTGACCCAGCCACTGTACGTCAGTTGATGGCTCAACAAGAGCTAGACCGGATTAAAAAGGCCAATGAGGTCCTTGGACTGGCAGCTCAGCAGCAAGGGATGTTTGACAACGCCCCTCTTCAGGCTCTGAATCTTCCTACAGCATATCCAGCGCTCCAGGGCATTCCTCCTGTGTTGCTCCCGGGTCTCAACAGCCCCTCCTTGCCAGGCTTTACTCCATCCAACACAGCTTTAACGTCTCCTAAGCCGAACTTGATGGGTCTGCCCAGCACAACAGTTCCTTCCCCTGGCCTCCCCACATCTGGATTACCAAATAAACCGTCCTCAGTGTCACTGAGCTCCCCAACCCCAGCACAAGCCACAATGGCGTTGGCCCCTCAGCAACCCCCTCAACTCCAGCAGCAGCAGCAGCAGCCACAGGTGCAGCAGCCTCCCCCGCCGCCAGCAGCCCAGCCGCCACCCACACAGCTCCCACCTCAACAGCCACGAAAAGACAGTGAGAAAGTAAAGGAGAAGGAAAAGGCACACAAAGGGAAAGGTGAACCCCTGCCTGTCCCCAAGAAGGAGAAAGGAGAGGCCCCCACGGCCGCTGCAGCCACCATCTCAGCCCCACTGCCCTCCATGGAGTATGCAGTGGACCCTGCCCAGCTGCAGGCCCTGCAGGCAGCCTTGACTTCAGACCCCACAGCATTGCTCACGAGCCAGTTCCTTCCTTACTTTGTACCAGGCTTTTCTCCTTATTACGCCCCCCAGATCCCTGGCGCCCTGCAGAGCGGGTACCTGCAGCCTATGTATGGCATGGAAGGCCTGTTCCCCTACAGCCCTGCACTGTCGCAGGCCCTGATGGGGCTGTCCCCGGGCTCCCTACTGCAGCAGTACCAGCAATACCAGCAGAGTCTGCAGGAGGCGATCCAGCAGCAGCAGCAGCGGCAACTACAGCAACAGCAGCAGCAGCAACAGCAGCAGCAAAAAGTGCAGCAGCAGCAGCAGCCCAAAGCAAGCCAAACCCCAGTCCCCCAGGGGGCTGCTTCCCCAGACAAAGACCCTGCCAAAGAATCCCCCAAACCAGAAGAGCAGAAAAACGCCCCCCGTGAGGTGTCCCCCCTCCTGCCGAAACCCCCCGAAGAGCCAGAAGCAGAAAGCAAAAGTGCGGACTCCCTCTACGACCCCTTCATTGTTCCAAAGGTGCAGTACAAGTTGGTCTGCCGCAAGTGCCAGGCGGGCTTCGGCGATGAGGAGGCGGCGAGGAGCCACCTGAAGTCCCTCTGCTTCTTCGGCCAGTCTGTGGCGAACATGCAAGAGATGGTGCTTCACGTCCCCACCGGCAGCGGTGGCGGCGGCGGCGGCGGCGGCAGCGGCTCGTACCACTGCCTAGCGTGCGAGAGCGCGCTCTGTGGGGAGGAAGCTCTGAGTCAACATCTCGAGTCGGCCTTGCACAAACACAGAACAATCACGAGAGCAGCAAGAAACGCCAAAGAGCACCCTAGTTTATTACCTCACTCTGCCTGCTTCCCCGATCCTAGCACCGCATCTACCTCGCAGTCTGCCGCTCACTCAAATGACAGTCCCCCTCCCCCATCGGCCGCCGCCCCCTCTTCGTCCGCTTCCCCCCATGCCTCCAGGAAGTCTTGGCCTCAAGTGGTCTCCCGGGCTTCGGCAGCGAAGCCCCCTTCTTTTCCTCCTCTCTCCTCATCTTCAACGGTTACCTCAAGTTCATGCAGCACCTCAGGGGTTCAGCCCTCGATGCCAACAGACGACTATTCGGAGGAGTCTGACACGGATCTCAGCCAAAAGTCCGACGGACCGGCGAGCCCGGTGGAGGGTCCCAAAGACCCCAGCTGCCCCAAGGACAGTGGTCTGACCAGTGTAGGAACGGACACCTTCAGATTGTAA

XM_004842928.1 Coding sequence

Zfhx3 zinc finger homeobox 3, transcript variant X3

Length: 11115 bp    Location: 15273632..15098418   Strand: -
>XM_004842928.1
ATGGAAGGCTGTGACTCGCCCGTCGTCTCGGGGAAGGACGATGGGTGTGGTATCCCTCAGCACCGGCAATGGACTGAACTCAACAGCACCCGCCTCCCCGACAAACCCAGTAGCATGGAGCAGCCCACAGGCGAGAGCCACGGGCCCCTGGACAGCCTGAGGGCCCCCTTCAGTGAGCGCCTGGCGGACAGCAGCGCCCCCTTGGCCGGGCCCCCCGCCGAGCCCGCCGGCAAGGAGGTCAGCTGCAACGAGTGCTCGGCCTCCTTCGCCAGCCTCCAGACCTACATGGAGCACCACTGCCCCGGCGCACGCCCCCCACCGCCCCTGCGAGAGGAGAGCGCCAGCGACACCAGTGAGGAGGGCGAGGAGGAGAGCGACGTGGAGAACCTGGCTGGGGAGATCGTCTACCAGCCCGACGGCTCCGCGTACATCGTGGAGAGCCTGAGCCAGCTGACCCAGAGCGGGGCCGCGTGTGGCAGTGGCAGCGGGCCTCTCCCCTCGCTCTTCCTGAACTCGCTCCCCGGTGCGGGGGGCAAACAAGGGGACCCTTCGTGTGCTGCACCCGTCTACCCGCAGATTATCAACACTTTCCACATAGCCTCATCCTTCGGGAAATGGTTTGAGGGCTCAGACCAGGCCTTCCCGAATACCTCAGCCCTGGCGGGGCTCAGCCCCGTCCTGCACAGCTTCCGCGTTTTTGACGTGCGACACAAAAGCAACAAGGATTACCTGAACAGCGACGGTTCTGCCAAAAGCTCCTGTGTATCCAAAGATGTTCCCAACAATGTGGACCTGTCCAAATTCGATGGCTTTGTGCTCTACGGCAAGAGGAAGCCCATCCTGATGTGTTTCTTGTGCAAACTCTCCTTCGGGTACGTCCGTTCGTTTGTGACCCACGCGGTACACGACCATCGAATGACCCTGAGTGAAGACGAGCGGAAAATTCTTAGCAATAAGAACATCTCCGCTATCATCCAAGGGATTGGCAAAGACAAGGAACCCCTTGTAAGTTTTCTGGAACCAAAAAACAAAAACTTTCAACACCCTTTAGTTTCCACAGCTAACCTCATAGGCCCCGGACACAGTTTTTATGGTAAATTTAGTGGCATTCGAATGGAAGGGGAGGAGGTTCTCCCAGCCGGCTCTGCCGCCGGCCCTGAGCAGCCCCAGGCTGGTCTCTTGACCCCCAGCACCCTCTTGAACCTTGGCGGACTCACCAGCTCGGTCCTGAAAACCCCCATTACCTCAGTCCCCCTGGGGCCTCTGGCTTCCAGTCCTACCAAATCCTCAGAGGGCAAGGACTCTGGGGCAGCTGAAGGAGAGAGGCAAGAAGCGGGCGATCCGGATTGCTTCTCTGAGAAAGCAGAGCCAGCTGAGGAGGAGGAGGCGGAGGAGGAAGAAGAGGAAGAAGAGGCAGAGGAGGAGGAGGAGGAAGAAGAGGAGGAAGAAGAGGAGGAGGAGGAAGATGAGGGTTGCAAAGGACTCTTTCCAAGTGAGTTGGATGACGAGCTGGAGGACAGGCCCTCCGAGGAGTCTGGGGCAGTAGCAGGTGGTAGCAGCAAAAAGGACCTTGCTCTCTCAAACCAAAGCATTTCTAACTCCCCCTTAATGCCTAATGTGCTCCAGACCTTGTCGAGGGGCACAGCTTCTACTAGTTCTAATTCCGCTTCTTCCTTTGTTGTCTTTGATGGTGCGAACAGGAGGAATCGTTTAAGCTTTAACAGTGAGGGCGTCAGGGCCAATGTGGCAGAGGGCGGCAGGAGGCTGGACTTCGCTGATGAAAGTGCCAATAAAGACAATGCCACAGCACCAGAACCAAATGAAAGCACAGAGGGCGATGATGGGGGCTTCGTCTCACATCACCAGCACGCTGGCTCCCTCTGCGAGCTTGGGGTTGGGGAGTGCCCCTCGGGGAGTGGCGTAGAGTGCCCCAAATGTGACACGGTCTTGGGCTCCTCCCGCTCACTGGGCGGCCACATGACCATGATGCATTCTCGTAACTCGTGTAAGACACTCAAGTGCCCCAAGTGCAACTGGCACTATAAGTACCAGCAGACGCTGGAGGCACACATGAAGGAGAAGCACCCGGAGCCGGGGGGCTCCTGCGTCTACTGCAAAAGTGGGCAGCCCCACCCCCGGTTGGCACGAGGCGAGAGCTACACTTGTGGTTACAAGCCTTTCCGCTGCGAGGTGTGTAACTACTCCACAACTACCAAAGGCAACCTCAGTATTCATATGCAGTCCGACAAGCATCTCAACAACATGCAGAACCTGCAGAATGGAGGGGGGGAGCAAGTCTTCAGCCACACTGCTGGAGCGGCAGCGGCGGCGGCAGCAGCGGCGGCTGCAGCAGCCAATATCAGTGGTTCCTGCGGGGCCCCCTCACCCACCAAACCAAAAACCAAACCCACGTGGCGGTGTGAGGTGTGTGATTATGAGACCAACGTGGCTAGGAACCTCCGCATCCACATGACCAGTGAGAAGCACATGCATAACATGATGCTGCTACAGCAGAACATGACTCAAATCCAACACAACCGCCACCTGGGGCTCGGCAGCCTGCCCTCGCCTGCCGAGGCCGAGCTCTACCAATACTACCTGGCCCAGAACATGAACCTGCCCAACCTGAAGATGGACAGTGCTGCCTCGGACACCCAGTTCATGATGAGTGGATTCCAGCTGGATCCCACCGGGCCCATGACCGCCATGACACCTGCTCTAGTGGGCGGTGAGATCCCCCTAGACATGCGCCTCGGGGGCGGGCAGCTGGTGTCGGAGGAGCTGATGAACCTGGGCGAGAGCTTCATCCAGACCAACGACCCGTCCCTGAAGCTCTTCCAGTGCGCTGTCTGCAACAAGTTCACGACGGACAACCTGGACATGCTGGGGCTGCACATGAACGTGGAGCGCAGCCTTGCGGAGGACGAGTGGAAGGCCGTGATGGGGGACTCGTACCAGTGTAAGCTCTGCCGCTACAACACCCAGCTCAAGGCCAACTTCCAGCTGCACTGCAAGACGGACAAGCATGTGCAGAAGTACCAGCTGGTGGCCCACATCAAAGAGGGCGGCAAGGCCAACGAGTGGAGGCTCAAGTGTGTGGCCATCGGCAACCCCGTGCACCTCAAGTGCAATGCCTGCGACTATTACACGAACAGCCTGGAGAAGCTGCGGCTGCACACGGTCAACTCCAGGCACGAGGCCAGCCTGAAGCTGTACAAGCACCTGCAGCAGCATGAGAGTGGCGTGGAGGGCGAGAGCTGCTACTACCACTGCGTCCTGTGCAGCTACTCCACCAAGGCCAAGCTCAACCTCATCCAACATGTGCGCTCCATGAAGCACCAGCGCAGCGAGAGCCTACGCAAGCTGCAGCGGCTGCAGAAAGGCCTTCCAGAAGAGGACGAGGACCTGGGGCAGATCTTCACCATCCGCAGGTGTCCCTCGACCGACCCAGAAGAAGCCATTGAAGATGTTGAAGGACCCAGTGAAACAGGTGCTGATCCAGAGGAGCTTGCTAAAGACCAGGAAAGTGGAGGCGAGAAAGACCAGAGCAAATGGACAGCCTCATCCAGCCAAGCAGAGAAGGAGCTGACGGATTCTCCTGCTGCCTCCAAACGCATCTCCTTCCCAGGTAGTTCGGAGTCTCAGCTCTCTTCAAAGCGACCAAAAACATCTGAGGCGATCAAACCGGAGCAGATGTACCAGTGCCCCTACTGCAAGTACAGCAATGTCGATGTGAACCGGCTCCGGGTGCATGCCATGACACAGCACTCAGTGCAGCCCATGCTTCGCTGCCCCCTGTGCCAGGACATGCTCAACAATAAGATCCACCTTCAGCTGCACCTCACCCACCTCCACAGTGTGGCACCTGACTGCGTGGAGAAGCTCATTATGACGGTGACCACCCCTGAGATGGTGATGCCCAGCAGCATGTTCCTCCCAGCAGCTGTTTCAGATCGAGATGGGAATTCCAATTTGGAAGAGGCAGGAAAGCAGTCTGAAACATCAGAGGATCTGGGAAAAAACATCTTACCATCTGTGAGCACAGAACATAGTGGAGATTTGAAACCTTCTTCTGCTGATCCAGGCTCTGTGAGAGAAGACTCGGGCTTTCTCTGCTGGAAAAAGGGGTGTAACCAGGTTTTCAAAACTTCTGCTGCCCTTCAGACACATTTTAATGAAGTGCATGCCAAAAGGCCTCAGCTGCCTGTGTCAGATCGCCATGTGTACAAGTACCGGTGTAATCAGTGCAGCCTGGCATTCAAGACAATTGAAAAGTTGCAGCTCCATTCTCAGTACCATGTGATCAGAGCTGCCACCATGTGCTGTCTTTGTCAGCGCAGTTTCCGAACTTTCCAGGCTCTCAAAAAGCACCTTGAGACGAGCCACCTGGAGTTGAGTGAGGCTGACATCCAACAACTTTATGGTGGCCTTTTGGCCAATGGGGACCTCCTGGCAATGGGAGATCCCACCCTGGCTGAAGACCACACTATAATTGTGGAAGAAGACAAGGAGGAAGAGAGTGACTTGGAAGATAAACAAAGCCCAACAGGCAGTGACTCTGGGTCAGTACAAGAAGATTCAGGCTCAGAGCCAAAGAGAGCTCTCCCTTTCAGAAAAGGCCCCAACTTTACCATGGAAAAATTTCTAGACCCTTCTCGCCCTTACAAGTGTACTGTCTGTAAGGAATCTTTCACTCAAAAGAATATCCTGCTAGTGCACTACAATTCTGTCTCCCACCTACATAAGTTAAAAAGAGCCCTTCAAGAATCTGCAACTGGTCAACCAGAACCCACCAGCAGCCCAGACAATAAACCTTTTAAGTGTAACACTTGTAATGTGGCCTATAGCCAGAGTTCTACTCTGGAGATCCACATGAGGTCTGTGTTGCATCAAACCAAAGCCAGGGCAGCCAAGCTGGAGGCCGCAAGTGGCAGCAGCAATGGGACTGGGAACAGCAGCAGTGTCTCCCTAAGCTCCTCCACACCAAGTCCTGTCAGTACCAGTGGCAGTAACACCTTTACCACCACCAATCCAAGTAGTACTGGCATTGTACCAAGCTCCAACTTACTGAGCCAAGTGCCCACTGACACTGTCGGGATGCCACCTCTAGGAAATCCCATCAGTGCCAACATCGCTTCCCCTTCAGAGCCCAAGGAGGCCAATCGGAAGAAGCTGGCAGATATGATTGCATCCAGGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAGCAACAGCAGCAGCAGCAAGCACAGACACTGGCCCAGGCCCAGGCTCAAGTTCAGGCTCACTTACAGCAGGAGCTGCAGCAGCAGGCTGCCCTTATCCAGTCACAGCTGTTTAATCCCACCCTCCTTCCTCACTTCCCCATGACCACTGAGACACTGCTGCAGTTGCAACAGCAGCAGCATCTCCTCTTCCCTTTCTATATCCCCAGTGCTGAGTTCCAGCTCAACCCTGAGGTGAGCTTGCCAGTGACCAGTGGGGCACTGACGCTGACAGGGACTGGTCCAGGCCTGCTGGAAGATCTGAAGGCTCAGGTTCAGATCCCACAGCAGAGTCACCAACAGATCCTGCAGCAACAGCAGCAGCACCAAAGTCAACTCTCTGTGTCCCAGAGTCACTCTGCTCTCCTTCAGCCAAGTCAGCACCCCGAAAAGAAAAACAAATTGGTCATCAAAGAGAAGGAAAAAGAAAGCCAGAGAGAGAGAGAGGGTGTGGAGGGGGGAGAGGGCAACACGGGTCCAAAGGAATTGTTGCCAGACGCCTTGAAGGCCAAAGAGAAGAAGGAGTTGGCACCAGGGGGTGGTTCTGAGCCTTCTATGCTTCCTCCACGCATCGCCTCAGATGCCAGAGGGAACGCCACCAAGGCCTTGCTGGAGAACTTTGGCTTTGAGCTGGTCATTCAGTACAATGAGAATAAGCAGAAGGTGCAGAAGAAGAATGGGAAGACAGAACAGGGAGAGAACCTGGAAAAACTTGAGTGCGACTCCTGTGGCAAGTTATTTTCCAACATCTTGATCTTAAAGAGTCATCAGGAGCACGTTCATCAGAATTACTTTCCCTTTAAACAGCTCGAGAAGTTTGCCAAACAGTACCGGGAGCACTATGATAAACTGTACCCCCTGAGGCCCCAGACCCCCGAGCCGCCNNNNNNNNNNNNNNNNNNNNNACCACCCCCGCTTCCTGCTGCACCCCCTCAGCCAGCTTCCGCACCTGCCATCCCTGCGTCAGCCCCACCCATCACTTCACCAACAATCGCGCCAGCCCAGCCATCTGTGCCGCTCACCCAGCTCTCTATGCCAATGGAGCTGCCCATCTTCTCACCACTGATGATGCAGACGATGCCACTGCAGACCTTGCCAGCTCAGCTGCCCCCTCAGCTTGGCCCTGTGGAGCCTCTGCCTGCAGACCTGGCCCAGCTGTATCAGCATCAGCTCAATCCAACCCTGCTCCAGCAGCAGAACAAGAGACCTCGCACCAGAATCACAGATGACCAGCTCCGAGTGCTGCGGCAATATTTTGACATTAACAATTCCCCCAGTGAAGAGCAAATCAAAGAGATGGCAGATAAGTCTGGGTTGCCCCAGAAAGTGATCAAGCACTGGTTCAGGAACACACTCTTCAAAGAGCGGCAGCGTAACAAGGACTCCCCTTACAACTTCAGCAATCCTCCCATCACCAGCCTGGAGGAGCTCAAGATTGACTCTCGGCCCCCTTCCCCAGAACCTCAGAAGCAGGAGTACTGGGGAAGCAAGAGATCTTCAAGAACAAGGTTTACTGACTACCAACTCCGAGTCCTCCAGGACTTCTTTGATGCCAATGCTTACCCAAAGGATGATGAATTTGAGCAACTCTCTAATTTACTGAACCTTCCAACCCGAGTCATTGTGGTATGGTTCCAGAATGCCCGACAGAAGGCCAGGAAAAATTACGAGAATCAGGGAGAGGGCAAAGATGGAGAGCGGCGTGAGCTTACAAATGATAGATACATTCGAACGAGCAACTTGAACTACCAGTGCAAAAAATGTAGCCTGGTGTTTCAGCGCATCTTTGATCTCATCAAGCATCAGAAGAAGCTGTGTTATAAGGATGAGGATGAGGAAGGGCAGGATGACAGCCAAAATGAGGATTCCATGGATGCCATGGAAATCCTCACACCAACCAGTTCCTCCTGCAGCACTCCAATGCCCTCCCAGGCTTACAGTGCCCCGGCACCATCAGCCAATCCTGCTCCTGCTGCTTTCCTGCACCTTACAGCTGAGGCAGATGAGCTAGCCACCTTCAATTCAAAAACAGAAGCAAGTGATGAGAAACCAAAGCAAGCTGAACCTCCCAGTGCACAGCCAAACCAAACCCAAGAAAAGCAAGGACAACCAAAGCCAGAGCTTCAGCAGCAAGACCAATCTGAGCAGAAGACAACTGTGCCCCAGCAAAAGCTTCCACAGCTGGCTGCCCCACCTTCCTTACCACAGCCTCCTCCACAGGCTCCTCCTCCTCAATGCCCCTTACCCCAGTCGAGCCCCAGTCCCTCTCAGCTCTCCCATCTGCCCCTCAAACCTCTCCACACATCAACGCCTCAACAGCTGGCCAACCTACCTCCTCAGCTCATCCCCTACCAGTGTGACCAGTGTAAGCTGGCATTTCCATCGTTTGAGCATTGGCAAGAGCATCAGCAACTTCATTTCTTGAGTGCACAGAACCAGTTCATCCACCCCCAGTTCCTGGACAGGTCACTGGACATGCCTTTCATGCTGTTCGATCCCAGTAACCCACTCCTGGCCAGCCAGCTGCTTTCCGGAGCCATACCTCAGATTCCAGCAAGCTCCGCCACTTCTCCTTCCACACCAACCTCTACGATGAACACTCTGAAGAGGAAGCTGGAGGAAAAGGCCAGTGCAAGCCCTGGTGAAAATGACAGTGGGACAGGAGGAGAAGAGCCTCAGAGAGACAAGCGTTTGAGGACAACTATTACACCGGAGCAACTAGAAATTCTCTACCAAAAGTATCTACTGGACTCTAATCCAACGCGAAAGATGTTGGATCATATTGCTCATGAGGTGGGTTTGAAGAAACGTGTGGTTCAAGTCTGGTTTCAGAACACTAGAGCTCGAGAACGGAAAGGACAGTTCCGGGCCGTGGGCCCAGCCCAGGCGCACAGGAGATGCCCTTTCTGCAGAGCGCTCTTTAAAGCCAAGACTGCCCTTGAGGCTCATATCCGGTCTCGTCACTGGCACGAAGCCAAGAGAGCTGGCTATAACCTAACTCTGTCTGCAATGCTTTTGGACTGCGATGGGGGGCTCCAGATGAAAGGAGATATTTTTGATGGAACTAGCTTTTCCCACCTACCCCCAAGTAGTAGTGATGGTCAGGGTGTTCCCCTGTCGCCTGTGAGTAAAACCATGGAATTGTCTCCCAGAACTCTTCTCAGCCCTTCCTCCATCAAAGTGGAAGGGATTGAAGACTTTGAAAGCCCCTCCATGTCCTCAGTTAATCTAAACTTTGACCAAGCTAAGCTGGACAATGATGACTGTTCCTCTGTCAACACGGCAATCACAGACACCACGACAGGAGATGAGGGTAATGCAGATAACGACAGTGCGACGGGAATAGCAACTGAAACCAAATCTTCTGCACCCAATGAAGGGTTGACCAAAGCGGCCATGATGGCAATGTCTGAGTATGAAGATCGGTTGTCTTCTGGCCTGGTCAGCCCAGCCCCGAGCTTTTATAGCAAGGAATATGACAACGAAGGTACAGTGGACTACAGTGAAACCTCAAGTCTTGCGGACCCGTGCTCCCCAAGTCCTGGTGCAAGTGGGTCTGCAGGCAAATCTGGTGACAGCGGGGATCGGCCCGGGCAGAAACGTTTTCGCACTCAGATGACCAATCTGCAGCTGAAGGTCCTCAAGTCATGCTTTAATGACTATAGGACACCCACTATGCTAGAGTGTGAGGTCCTGGGCAATGACATTGGACTGCCAAAGAGAGTTGTTCAGGTCTGGTTCCAGAATGCCCGGGCAAAAGAAAAGAAGTCCAAGTTAAGCATGGCCAAGCATTTTGGTATAAACCAAACGAGTTATGAGGGACCCAAAACAGAGTGCACTTTGTGTGGCATCAAGTACAGCGCTCGGCTGTCTGTACGTGACCATATCTTTTCCCAACAGCATATCTCCAAAGTTAAAGACACCATTGGAAGCCAGTTGGACAAGGAGAAAGAATACTTTGACCCAGCCACTGTACGTCAGTTGATGGCTCAACAAGAGCTAGACCGGATTAAAAAGGCCAATGAGGTCCTTGGACTGGCAGCTCAGCAGCAAGGGATGTTTGACAACGCCCCTCTTCAGGCTCTGAATCTTCCTACAGCATATCCAGCGCTCCAGGGCATTCCTCCTGTGTTGCTCCCGGGTCTCAACAGCCCCTCCTTGCCAGGCTTTACTCCATCCAACACAGCTTTAACGTCTCCTAAGCCGAACTTGATGGGTCTGCCCAGCACAACAGTTCCTTCCCCTGGCCTCCCCACATCTGGATTACCAAATAAACCGTCCTCAGTGTCACTGAGCTCCCCAACCCCAGCACAAGCCACAATGGCGTTGGCCCCTCAGCAACCCCCTCAACTCCAGCAGCAGCAGCAGCAGCCACAGGTGCAGCAGCCTCCCCCGCCGCCAGCAGCCCAGCCGCCACCCACACAGCTCCCACCTCAACAGCCACGAAAAGACAGTGAGAAAGTAAAGGAGAAGGAAAAGGCACACAAAGGGAAAGGTGAACCCCTGCCTGTCCCCAAGAAGGAGAAAGGAGAGGCCCCCACGGCCGCTGCAGCCACCATCTCAGCCCCACTGCCCTCCATGGAGTATGCAGTGGACCCTGCCCAGCTGCAGGCCCTGCAGGCAGCCTTGACTTCAGACCCCACAGCATTGCTCACGAGCCAGTTCCTTCCTTACTTTGTACCAGGCTTTTCTCCTTATTACGCCCCCCAGATCCCTGGCGCCCTGCAGAGCGGGTACCTGCAGCCTATGTATGGCATGGAAGGCCTGTTCCCCTACAGCCCTGCACTGTCGCAGGCCCTGATGGGGCTGTCCCCGGGCTCCCTACTGCAGCAGTACCAGCAATACCAGCAGAGTCTGCAGGAGGCGATCCAGCAGCAGCAGCAGCGGCAACTACAGCAACAGCAGCAGCAGCAACAGCAGCAGCAAAAAGTGCAGCAGCAGCAGCAGCCCAAAGCAAGCCAAACCCCAGTCCCCCAGGGGGCTGCTTCCCCAGACAAAGACCCTGCCAAAGAATCCCCCAAACCAGAAGAGCAGAAAAACGCCCCCCGTGAGGTGTCCCCCCTCCTGCCGAAACCCCCCGAAGAGCCAGAAGCAGAAAGCAAAAGTGCGGACTCCCTCTACGACCCCTTCATTGTTCCAAAGGTGCAGTACAAGTTGGTCTGCCGCAAGTGCCAGGCGGGCTTCGGCGATGAGGAGGCGGCGAGGAGCCACCTGAAGTCCCTCTGCTTCTTCGGCCAGTCTGTGGCGAACATGCAAGAGATGGTGCTTCACGTCCCCACCGGCAGCGGTGGCGGCGGCGGCGGCGGCGGCAGCGGCTCGTACCACTGCCTAGCGTGCGAGAGCGCGCTCTGTGGGGAGGAAGCTCTGAGTCAACATCTCGAGTCGGCCTTGCACAAACACAGAACAATCACGAGAGCAGCAAGAAACGCCAAAGAGCACCCTAGTTTATTACCTCACTCTGCCTGCTTCCCCGATCCTAGCACCGCATCTACCTCGCAGTCTGCCGCTCACTCAAATGACAGTCCCCCTCCCCCATCGGCCGCCGCCCCCTCTTCGTCCGCTTCCCCCCATGCCTCCAGGAAGTCTTGGCCTCAAGTGGTCTCCCGGGCTTCGGCAGCGAAGCCCCCTTCTTTTCCTCCTCTCTCCTCATCTTCAACGGTTACCTCAAGTTCATGCAGCACCTCAGGGGTTCAGCCCTCGATGCCAACAGACGACTATTCGGAGGAGTCTGACACGGATCTCAGCCAAAAGTCCGACGGACCGGCGAGCCCGGTGGAGGGTCCCAAAGACCCCAGCTGCCCCAAGGACAGTGGTCTGACCAGTGTAGGAACGGACACCTTCAGATTGTAA

XM_004842930.1 Coding sequence

Zfhx3 zinc finger homeobox 3, transcript variant X5

High confidence: 4 potential gene matches
Length: 11115 bp    Location: 15271902..15098418   Strand: -
>XM_004842930.1
ATGGAAGGCTGTGACTCGCCCGTCGTCTCGGGGAAGGACGATGGGTGTGGTATCCCTCAGCACCGGCAATGGACTGAACTCAACAGCACCCGCCTCCCCGACAAACCCAGTAGCATGGAGCAGCCCACAGGCGAGAGCCACGGGCCCCTGGACAGCCTGAGGGCCCCCTTCAGTGAGCGCCTGGCGGACAGCAGCGCCCCCTTGGCCGGGCCCCCCGCCGAGCCCGCCGGCAAGGAGGTCAGCTGCAACGAGTGCTCGGCCTCCTTCGCCAGCCTCCAGACCTACATGGAGCACCACTGCCCCGGCGCACGCCCCCCACCGCCCCTGCGAGAGGAGAGCGCCAGCGACACCAGTGAGGAGGGCGAGGAGGAGAGCGACGTGGAGAACCTGGCTGGGGAGATCGTCTACCAGCCCGACGGCTCCGCGTACATCGTGGAGAGCCTGAGCCAGCTGACCCAGAGCGGGGCCGCGTGTGGCAGTGGCAGCGGGCCTCTCCCCTCGCTCTTCCTGAACTCGCTCCCCGGTGCGGGGGGCAAACAAGGGGACCCTTCGTGTGCTGCACCCGTCTACCCGCAGATTATCAACACTTTCCACATAGCCTCATCCTTCGGGAAATGGTTTGAGGGCTCAGACCAGGCCTTCCCGAATACCTCAGCCCTGGCGGGGCTCAGCCCCGTCCTGCACAGCTTCCGCGTTTTTGACGTGCGACACAAAAGCAACAAGGATTACCTGAACAGCGACGGTTCTGCCAAAAGCTCCTGTGTATCCAAAGATGTTCCCAACAATGTGGACCTGTCCAAATTCGATGGCTTTGTGCTCTACGGCAAGAGGAAGCCCATCCTGATGTGTTTCTTGTGCAAACTCTCCTTCGGGTACGTCCGTTCGTTTGTGACCCACGCGGTACACGACCATCGAATGACCCTGAGTGAAGACGAGCGGAAAATTCTTAGCAATAAGAACATCTCCGCTATCATCCAAGGGATTGGCAAAGACAAGGAACCCCTTGTAAGTTTTCTGGAACCAAAAAACAAAAACTTTCAACACCCTTTAGTTTCCACAGCTAACCTCATAGGCCCCGGACACAGTTTTTATGGTAAATTTAGTGGCATTCGAATGGAAGGGGAGGAGGTTCTCCCAGCCGGCTCTGCCGCCGGCCCTGAGCAGCCCCAGGCTGGTCTCTTGACCCCCAGCACCCTCTTGAACCTTGGCGGACTCACCAGCTCGGTCCTGAAAACCCCCATTACCTCAGTCCCCCTGGGGCCTCTGGCTTCCAGTCCTACCAAATCCTCAGAGGGCAAGGACTCTGGGGCAGCTGAAGGAGAGAGGCAAGAAGCGGGCGATCCGGATTGCTTCTCTGAGAAAGCAGAGCCAGCTGAGGAGGAGGAGGCGGAGGAGGAAGAAGAGGAAGAAGAGGCAGAGGAGGAGGAGGAGGAAGAAGAGGAGGAAGAAGAGGAGGAGGAGGAAGATGAGGGTTGCAAAGGACTCTTTCCAAGTGAGTTGGATGACGAGCTGGAGGACAGGCCCTCCGAGGAGTCTGGGGCAGTAGCAGGTGGTAGCAGCAAAAAGGACCTTGCTCTCTCAAACCAAAGCATTTCTAACTCCCCCTTAATGCCTAATGTGCTCCAGACCTTGTCGAGGGGCACAGCTTCTACTAGTTCTAATTCCGCTTCTTCCTTTGTTGTCTTTGATGGTGCGAACAGGAGGAATCGTTTAAGCTTTAACAGTGAGGGCGTCAGGGCCAATGTGGCAGAGGGCGGCAGGAGGCTGGACTTCGCTGATGAAAGTGCCAATAAAGACAATGCCACAGCACCAGAACCAAATGAAAGCACAGAGGGCGATGATGGGGGCTTCGTCTCACATCACCAGCACGCTGGCTCCCTCTGCGAGCTTGGGGTTGGGGAGTGCCCCTCGGGGAGTGGCGTAGAGTGCCCCAAATGTGACACGGTCTTGGGCTCCTCCCGCTCACTGGGCGGCCACATGACCATGATGCATTCTCGTAACTCGTGTAAGACACTCAAGTGCCCCAAGTGCAACTGGCACTATAAGTACCAGCAGACGCTGGAGGCACACATGAAGGAGAAGCACCCGGAGCCGGGGGGCTCCTGCGTCTACTGCAAAAGTGGGCAGCCCCACCCCCGGTTGGCACGAGGCGAGAGCTACACTTGTGGTTACAAGCCTTTCCGCTGCGAGGTGTGTAACTACTCCACAACTACCAAAGGCAACCTCAGTATTCATATGCAGTCCGACAAGCATCTCAACAACATGCAGAACCTGCAGAATGGAGGGGGGGAGCAAGTCTTCAGCCACACTGCTGGAGCGGCAGCGGCGGCGGCAGCAGCGGCGGCTGCAGCAGCCAATATCAGTGGTTCCTGCGGGGCCCCCTCACCCACCAAACCAAAAACCAAACCCACGTGGCGGTGTGAGGTGTGTGATTATGAGACCAACGTGGCTAGGAACCTCCGCATCCACATGACCAGTGAGAAGCACATGCATAACATGATGCTGCTACAGCAGAACATGACTCAAATCCAACACAACCGCCACCTGGGGCTCGGCAGCCTGCCCTCGCCTGCCGAGGCCGAGCTCTACCAATACTACCTGGCCCAGAACATGAACCTGCCCAACCTGAAGATGGACAGTGCTGCCTCGGACACCCAGTTCATGATGAGTGGATTCCAGCTGGATCCCACCGGGCCCATGACCGCCATGACACCTGCTCTAGTGGGCGGTGAGATCCCCCTAGACATGCGCCTCGGGGGCGGGCAGCTGGTGTCGGAGGAGCTGATGAACCTGGGCGAGAGCTTCATCCAGACCAACGACCCGTCCCTGAAGCTCTTCCAGTGCGCTGTCTGCAACAAGTTCACGACGGACAACCTGGACATGCTGGGGCTGCACATGAACGTGGAGCGCAGCCTTGCGGAGGACGAGTGGAAGGCCGTGATGGGGGACTCGTACCAGTGTAAGCTCTGCCGCTACAACACCCAGCTCAAGGCCAACTTCCAGCTGCACTGCAAGACGGACAAGCATGTGCAGAAGTACCAGCTGGTGGCCCACATCAAAGAGGGCGGCAAGGCCAACGAGTGGAGGCTCAAGTGTGTGGCCATCGGCAACCCCGTGCACCTCAAGTGCAATGCCTGCGACTATTACACGAACAGCCTGGAGAAGCTGCGGCTGCACACGGTCAACTCCAGGCACGAGGCCAGCCTGAAGCTGTACAAGCACCTGCAGCAGCATGAGAGTGGCGTGGAGGGCGAGAGCTGCTACTACCACTGCGTCCTGTGCAGCTACTCCACCAAGGCCAAGCTCAACCTCATCCAACATGTGCGCTCCATGAAGCACCAGCGCAGCGAGAGCCTACGCAAGCTGCAGCGGCTGCAGAAAGGCCTTCCAGAAGAGGACGAGGACCTGGGGCAGATCTTCACCATCCGCAGGTGTCCCTCGACCGACCCAGAAGAAGCCATTGAAGATGTTGAAGGACCCAGTGAAACAGGTGCTGATCCAGAGGAGCTTGCTAAAGACCAGGAAAGTGGAGGCGAGAAAGACCAGAGCAAATGGACAGCCTCATCCAGCCAAGCAGAGAAGGAGCTGACGGATTCTCCTGCTGCCTCCAAACGCATCTCCTTCCCAGGTAGTTCGGAGTCTCAGCTCTCTTCAAAGCGACCAAAAACATCTGAGGCGATCAAACCGGAGCAGATGTACCAGTGCCCCTACTGCAAGTACAGCAATGTCGATGTGAACCGGCTCCGGGTGCATGCCATGACACAGCACTCAGTGCAGCCCATGCTTCGCTGCCCCCTGTGCCAGGACATGCTCAACAATAAGATCCACCTTCAGCTGCACCTCACCCACCTCCACAGTGTGGCACCTGACTGCGTGGAGAAGCTCATTATGACGGTGACCACCCCTGAGATGGTGATGCCCAGCAGCATGTTCCTCCCAGCAGCTGTTTCAGATCGAGATGGGAATTCCAATTTGGAAGAGGCAGGAAAGCAGTCTGAAACATCAGAGGATCTGGGAAAAAACATCTTACCATCTGTGAGCACAGAACATAGTGGAGATTTGAAACCTTCTTCTGCTGATCCAGGCTCTGTGAGAGAAGACTCGGGCTTTCTCTGCTGGAAAAAGGGGTGTAACCAGGTTTTCAAAACTTCTGCTGCCCTTCAGACACATTTTAATGAAGTGCATGCCAAAAGGCCTCAGCTGCCTGTGTCAGATCGCCATGTGTACAAGTACCGGTGTAATCAGTGCAGCCTGGCATTCAAGACAATTGAAAAGTTGCAGCTCCATTCTCAGTACCATGTGATCAGAGCTGCCACCATGTGCTGTCTTTGTCAGCGCAGTTTCCGAACTTTCCAGGCTCTCAAAAAGCACCTTGAGACGAGCCACCTGGAGTTGAGTGAGGCTGACATCCAACAACTTTATGGTGGCCTTTTGGCCAATGGGGACCTCCTGGCAATGGGAGATCCCACCCTGGCTGAAGACCACACTATAATTGTGGAAGAAGACAAGGAGGAAGAGAGTGACTTGGAAGATAAACAAAGCCCAACAGGCAGTGACTCTGGGTCAGTACAAGAAGATTCAGGCTCAGAGCCAAAGAGAGCTCTCCCTTTCAGAAAAGGCCCCAACTTTACCATGGAAAAATTTCTAGACCCTTCTCGCCCTTACAAGTGTACTGTCTGTAAGGAATCTTTCACTCAAAAGAATATCCTGCTAGTGCACTACAATTCTGTCTCCCACCTACATAAGTTAAAAAGAGCCCTTCAAGAATCTGCAACTGGTCAACCAGAACCCACCAGCAGCCCAGACAATAAACCTTTTAAGTGTAACACTTGTAATGTGGCCTATAGCCAGAGTTCTACTCTGGAGATCCACATGAGGTCTGTGTTGCATCAAACCAAAGCCAGGGCAGCCAAGCTGGAGGCCGCAAGTGGCAGCAGCAATGGGACTGGGAACAGCAGCAGTGTCTCCCTAAGCTCCTCCACACCAAGTCCTGTCAGTACCAGTGGCAGTAACACCTTTACCACCACCAATCCAAGTAGTACTGGCATTGTACCAAGCTCCAACTTACTGAGCCAAGTGCCCACTGACACTGTCGGGATGCCACCTCTAGGAAATCCCATCAGTGCCAACATCGCTTCCCCTTCAGAGCCCAAGGAGGCCAATCGGAAGAAGCTGGCAGATATGATTGCATCCAGGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAGCAACAGCAGCAGCAGCAAGCACAGACACTGGCCCAGGCCCAGGCTCAAGTTCAGGCTCACTTACAGCAGGAGCTGCAGCAGCAGGCTGCCCTTATCCAGTCACAGCTGTTTAATCCCACCCTCCTTCCTCACTTCCCCATGACCACTGAGACACTGCTGCAGTTGCAACAGCAGCAGCATCTCCTCTTCCCTTTCTATATCCCCAGTGCTGAGTTCCAGCTCAACCCTGAGGTGAGCTTGCCAGTGACCAGTGGGGCACTGACGCTGACAGGGACTGGTCCAGGCCTGCTGGAAGATCTGAAGGCTCAGGTTCAGATCCCACAGCAGAGTCACCAACAGATCCTGCAGCAACAGCAGCAGCACCAAAGTCAACTCTCTGTGTCCCAGAGTCACTCTGCTCTCCTTCAGCCAAGTCAGCACCCCGAAAAGAAAAACAAATTGGTCATCAAAGAGAAGGAAAAAGAAAGCCAGAGAGAGAGAGAGGGTGTGGAGGGGGGAGAGGGCAACACGGGTCCAAAGGAATTGTTGCCAGACGCCTTGAAGGCCAAAGAGAAGAAGGAGTTGGCACCAGGGGGTGGTTCTGAGCCTTCTATGCTTCCTCCACGCATCGCCTCAGATGCCAGAGGGAACGCCACCAAGGCCTTGCTGGAGAACTTTGGCTTTGAGCTGGTCATTCAGTACAATGAGAATAAGCAGAAGGTGCAGAAGAAGAATGGGAAGACAGAACAGGGAGAGAACCTGGAAAAACTTGAGTGCGACTCCTGTGGCAAGTTATTTTCCAACATCTTGATCTTAAAGAGTCATCAGGAGCACGTTCATCAGAATTACTTTCCCTTTAAACAGCTCGAGAAGTTTGCCAAACAGTACCGGGAGCACTATGATAAACTGTACCCCCTGAGGCCCCAGACCCCCGAGCCGCCNNNNNNNNNNNNNNNNNNNNNACCACCCCCGCTTCCTGCTGCACCCCCTCAGCCAGCTTCCGCACCTGCCATCCCTGCGTCAGCCCCACCCATCACTTCACCAACAATCGCGCCAGCCCAGCCATCTGTGCCGCTCACCCAGCTCTCTATGCCAATGGAGCTGCCCATCTTCTCACCACTGATGATGCAGACGATGCCACTGCAGACCTTGCCAGCTCAGCTGCCCCCTCAGCTTGGCCCTGTGGAGCCTCTGCCTGCAGACCTGGCCCAGCTGTATCAGCATCAGCTCAATCCAACCCTGCTCCAGCAGCAGAACAAGAGACCTCGCACCAGAATCACAGATGACCAGCTCCGAGTGCTGCGGCAATATTTTGACATTAACAATTCCCCCAGTGAAGAGCAAATCAAAGAGATGGCAGATAAGTCTGGGTTGCCCCAGAAAGTGATCAAGCACTGGTTCAGGAACACACTCTTCAAAGAGCGGCAGCGTAACAAGGACTCCCCTTACAACTTCAGCAATCCTCCCATCACCAGCCTGGAGGAGCTCAAGATTGACTCTCGGCCCCCTTCCCCAGAACCTCAGAAGCAGGAGTACTGGGGAAGCAAGAGATCTTCAAGAACAAGGTTTACTGACTACCAACTCCGAGTCCTCCAGGACTTCTTTGATGCCAATGCTTACCCAAAGGATGATGAATTTGAGCAACTCTCTAATTTACTGAACCTTCCAACCCGAGTCATTGTGGTATGGTTCCAGAATGCCCGACAGAAGGCCAGGAAAAATTACGAGAATCAGGGAGAGGGCAAAGATGGAGAGCGGCGTGAGCTTACAAATGATAGATACATTCGAACGAGCAACTTGAACTACCAGTGCAAAAAATGTAGCCTGGTGTTTCAGCGCATCTTTGATCTCATCAAGCATCAGAAGAAGCTGTGTTATAAGGATGAGGATGAGGAAGGGCAGGATGACAGCCAAAATGAGGATTCCATGGATGCCATGGAAATCCTCACACCAACCAGTTCCTCCTGCAGCACTCCAATGCCCTCCCAGGCTTACAGTGCCCCGGCACCATCAGCCAATCCTGCTCCTGCTGCTTTCCTGCACCTTACAGCTGAGGCAGATGAGCTAGCCACCTTCAATTCAAAAACAGAAGCAAGTGATGAGAAACCAAAGCAAGCTGAACCTCCCAGTGCACAGCCAAACCAAACCCAAGAAAAGCAAGGACAACCAAAGCCAGAGCTTCAGCAGCAAGACCAATCTGAGCAGAAGACAACTGTGCCCCAGCAAAAGCTTCCACAGCTGGCTGCCCCACCTTCCTTACCACAGCCTCCTCCACAGGCTCCTCCTCCTCAATGCCCCTTACCCCAGTCGAGCCCCAGTCCCTCTCAGCTCTCCCATCTGCCCCTCAAACCTCTCCACACATCAACGCCTCAACAGCTGGCCAACCTACCTCCTCAGCTCATCCCCTACCAGTGTGACCAGTGTAAGCTGGCATTTCCATCGTTTGAGCATTGGCAAGAGCATCAGCAACTTCATTTCTTGAGTGCACAGAACCAGTTCATCCACCCCCAGTTCCTGGACAGGTCACTGGACATGCCTTTCATGCTGTTCGATCCCAGTAACCCACTCCTGGCCAGCCAGCTGCTTTCCGGAGCCATACCTCAGATTCCAGCAAGCTCCGCCACTTCTCCTTCCACACCAACCTCTACGATGAACACTCTGAAGAGGAAGCTGGAGGAAAAGGCCAGTGCAAGCCCTGGTGAAAATGACAGTGGGACAGGAGGAGAAGAGCCTCAGAGAGACAAGCGTTTGAGGACAACTATTACACCGGAGCAACTAGAAATTCTCTACCAAAAGTATCTACTGGACTCTAATCCAACGCGAAAGATGTTGGATCATATTGCTCATGAGGTGGGTTTGAAGAAACGTGTGGTTCAAGTCTGGTTTCAGAACACTAGAGCTCGAGAACGGAAAGGACAGTTCCGGGCCGTGGGCCCAGCCCAGGCGCACAGGAGATGCCCTTTCTGCAGAGCGCTCTTTAAAGCCAAGACTGCCCTTGAGGCTCATATCCGGTCTCGTCACTGGCACGAAGCCAAGAGAGCTGGCTATAACCTAACTCTGTCTGCAATGCTTTTGGACTGCGATGGGGGGCTCCAGATGAAAGGAGATATTTTTGATGGAACTAGCTTTTCCCACCTACCCCCAAGTAGTAGTGATGGTCAGGGTGTTCCCCTGTCGCCTGTGAGTAAAACCATGGAATTGTCTCCCAGAACTCTTCTCAGCCCTTCCTCCATCAAAGTGGAAGGGATTGAAGACTTTGAAAGCCCCTCCATGTCCTCAGTTAATCTAAACTTTGACCAAGCTAAGCTGGACAATGATGACTGTTCCTCTGTCAACACGGCAATCACAGACACCACGACAGGAGATGAGGGTAATGCAGATAACGACAGTGCGACGGGAATAGCAACTGAAACCAAATCTTCTGCACCCAATGAAGGGTTGACCAAAGCGGCCATGATGGCAATGTCTGAGTATGAAGATCGGTTGTCTTCTGGCCTGGTCAGCCCAGCCCCGAGCTTTTATAGCAAGGAATATGACAACGAAGGTACAGTGGACTACAGTGAAACCTCAAGTCTTGCGGACCCGTGCTCCCCAAGTCCTGGTGCAAGTGGGTCTGCAGGCAAATCTGGTGACAGCGGGGATCGGCCCGGGCAGAAACGTTTTCGCACTCAGATGACCAATCTGCAGCTGAAGGTCCTCAAGTCATGCTTTAATGACTATAGGACACCCACTATGCTAGAGTGTGAGGTCCTGGGCAATGACATTGGACTGCCAAAGAGAGTTGTTCAGGTCTGGTTCCAGAATGCCCGGGCAAAAGAAAAGAAGTCCAAGTTAAGCATGGCCAAGCATTTTGGTATAAACCAAACGAGTTATGAGGGACCCAAAACAGAGTGCACTTTGTGTGGCATCAAGTACAGCGCTCGGCTGTCTGTACGTGACCATATCTTTTCCCAACAGCATATCTCCAAAGTTAAAGACACCATTGGAAGCCAGTTGGACAAGGAGAAAGAATACTTTGACCCAGCCACTGTACGTCAGTTGATGGCTCAACAAGAGCTAGACCGGATTAAAAAGGCCAATGAGGTCCTTGGACTGGCAGCTCAGCAGCAAGGGATGTTTGACAACGCCCCTCTTCAGGCTCTGAATCTTCCTACAGCATATCCAGCGCTCCAGGGCATTCCTCCTGTGTTGCTCCCGGGTCTCAACAGCCCCTCCTTGCCAGGCTTTACTCCATCCAACACAGCTTTAACGTCTCCTAAGCCGAACTTGATGGGTCTGCCCAGCACAACAGTTCCTTCCCCTGGCCTCCCCACATCTGGATTACCAAATAAACCGTCCTCAGTGTCACTGAGCTCCCCAACCCCAGCACAAGCCACAATGGCGTTGGCCCCTCAGCAACCCCCTCAACTCCAGCAGCAGCAGCAGCAGCCACAGGTGCAGCAGCCTCCCCCGCCGCCAGCAGCCCAGCCGCCACCCACACAGCTCCCACCTCAACAGCCACGAAAAGACAGTGAGAAAGTAAAGGAGAAGGAAAAGGCACACAAAGGGAAAGGTGAACCCCTGCCTGTCCCCAAGAAGGAGAAAGGAGAGGCCCCCACGGCCGCTGCAGCCACCATCTCAGCCCCACTGCCCTCCATGGAGTATGCAGTGGACCCTGCCCAGCTGCAGGCCCTGCAGGCAGCCTTGACTTCAGACCCCACAGCATTGCTCACGAGCCAGTTCCTTCCTTACTTTGTACCAGGCTTTTCTCCTTATTACGCCCCCCAGATCCCTGGCGCCCTGCAGAGCGGGTACCTGCAGCCTATGTATGGCATGGAAGGCCTGTTCCCCTACAGCCCTGCACTGTCGCAGGCCCTGATGGGGCTGTCCCCGGGCTCCCTACTGCAGCAGTACCAGCAATACCAGCAGAGTCTGCAGGAGGCGATCCAGCAGCAGCAGCAGCGGCAACTACAGCAACAGCAGCAGCAGCAACAGCAGCAGCAAAAAGTGCAGCAGCAGCAGCAGCCCAAAGCAAGCCAAACCCCAGTCCCCCAGGGGGCTGCTTCCCCAGACAAAGACCCTGCCAAAGAATCCCCCAAACCAGAAGAGCAGAAAAACGCCCCCCGTGAGGTGTCCCCCCTCCTGCCGAAACCCCCCGAAGAGCCAGAAGCAGAAAGCAAAAGTGCGGACTCCCTCTACGACCCCTTCATTGTTCCAAAGGTGCAGTACAAGTTGGTCTGCCGCAAGTGCCAGGCGGGCTTCGGCGATGAGGAGGCGGCGAGGAGCCACCTGAAGTCCCTCTGCTTCTTCGGCCAGTCTGTGGCGAACATGCAAGAGATGGTGCTTCACGTCCCCACCGGCAGCGGTGGCGGCGGCGGCGGCGGCGGCAGCGGCTCGTACCACTGCCTAGCGTGCGAGAGCGCGCTCTGTGGGGAGGAAGCTCTGAGTCAACATCTCGAGTCGGCCTTGCACAAACACAGAACAATCACGAGAGCAGCAAGAAACGCCAAAGAGCACCCTAGTTTATTACCTCACTCTGCCTGCTTCCCCGATCCTAGCACCGCATCTACCTCGCAGTCTGCCGCTCACTCAAATGACAGTCCCCCTCCCCCATCGGCCGCCGCCCCCTCTTCGTCCGCTTCCCCCCATGCCTCCAGGAAGTCTTGGCCTCAAGTGGTCTCCCGGGCTTCGGCAGCGAAGCCCCCTTCTTTTCCTCCTCTCTCCTCATCTTCAACGGTTACCTCAAGTTCATGCAGCACCTCAGGGGTTCAGCCCTCGATGCCAACAGACGACTATTCGGAGGAGTCTGACACGGATCTCAGCCAAAAGTCCGACGGACCGGCGAGCCCGGTGGAGGGTCCCAAAGACCCCAGCTGCCCCAAGGACAGTGGTCTGACCAGTGTAGGAACGGACACCTTCAGATTGTAA

XM_004842932.1 Coding sequence

LOC101710161 60S ribosomal protein L39-like

Length: 156 bp    Location: 16634952..16635133   Strand: +
>XM_004842932.1
ATGTCTTCTCACAAGACTTTCAGAATCAAGCGATTCCTGGCCAAGAAGCAAAAGCAGAATAGTCTCATTCCTCAATGGATTCGGATGAGGACTGGTAATAAAATCAGGTACAACTCCAAGAGGAGACACTGGAGGAGGACCAAGCTGGGACTGTAA

XM_004842920.1 Coding sequence

Txnl4b thioredoxin-like 4B

High confidence: 4 potential gene matches
Length: 450 bp    Location: 14301668..14293564   Strand: -
>XM_004842920.1
ATGAGCTTCCTGTTGCCCAAACTGACGAGCAAAAAAGAAGTAGACCAGGCAATAAAAAGTACCGCAGAGAAAGTGTTGGTTCTCAGGTTTGGGAGAGATGAGGATCCTGTCTGTCTGCAGCTAGATGATATTCTCTGTAAGACCTCTCCTGACTTGAGTAAAATGGCTGCTATATATCTGGTAGATGTGGACCACACTCCAGTTTACACACAGTATTTTGACATCAGTTATATTCCATCTACTGTATTTTTCTTCAATGGGCAGCATATGAAAGTGGATTATGGGTCTCCAGATCACACTAAGTTCGTGGGCAGTTTCAAAACTAAACAAGACTTCATAGATTTGATCGAAGTAATCTATCGAGGCGCAATGAGGGGGAAACTTATCGTCCAAAGTCCTATTGATCCCAAGAATATTCCCAAATACGACCTTCTCTATCAAGACATTTAG

XM_004842904.1 Coding sequence

Marveld3 MARVEL domain containing 3, transcript variant X2

Length: 1119 bp    Location: 13898906..13907130   Strand: +
>XM_004842904.1
ATGGAAGAGACGTCGGGGGCTCGTGAGCCCCGGGCCCGGCCGAGAGAGCGAGACCCGGAGCGGCGCCCTCGCCCGGATCGAGAGCGCCACTCCGAGCGACCGCGGGACAGAGCCGGGGACCGGCGCAGGGAGAGGAACGGGGACCGGCGAGGGGACCGGGACAGGAGAAGGGACCGAGACCCCCTCCAGGACCGACGCCGGGACGCCGGCCATCGTGCAGGTGAACCAAGAGTCTGGGAAAAGTCCCGCGGAACCCAGAGGCTGGAGGAACCCCGGGGAACAACCTGGGACGCAGCCCCGCCCCCCTGGCCCGCGCCCTGGGAAACCCCGGAGCCGCCGCCCCCGAGGAAGGAGAGGTTCGCGCGCCACGGACCCGAAAGTGAACCCACTTCTGGGAGATATGTGCCCTCGAACCCCAGGCCTGGACCAGAGGAAGTGGAATATTACCAGTCAGAGGCCGAAGGACTTCTGGAATGCCACAAATGCAGATACTTGTGCACTGGGAGAGCCTGCTGCCAGATGCTGGAGGTTCTGCTAAACTTGCTGATCCTGGCCTGCAGCTCTGTGTCTTACGGTTCCACAGGGGGCTACACAGGCATCACCAGCCTGGGGGGCATTTACTACTACCAGTATGGAGGGGCCTACAGTGGCTTCAATGGCGCTGACGGGGAGAAGGCCAAGCAGCTGGATGTCCAGTTCTACCAGCTCAAGCTGCCCATGGTCACTGCGGCAATGGCCTACAGTGGAGCCCTCATGGCCTTCTCCTGCCTCCTTATTTTCATGGGTGTCCTGCGGGTCCCTTGGCATTGTCCACCATGGCTGCTGATTGAGGGCTTATTGGATGTGGTCATTGCCGGAGCCTACATCCCAGCCATGTACTTCTTCTTCCACCATCTTTCCACTGCCTATGCCTCCTCTGTGTGTCAAGAGAGGGAGGCACTGTACCAGAGCAAAGGGTACAGTGGCTTCAGCTGTGGTTTCCATGGCGGCGATATAGGAGCTGGAGTCTTTGCATCCCTGGGCATTGGGGTCTTTGCCCTGGGAGCCATCCTGGCCATCAGGGCTTACCGAAAAGTCAGGAAGCTAAAAGAGAAGCCTGCAGAAATGCTTAAGTTTTAG

XM_004842907.1 Coding sequence

Ap1g1 adaptor-related protein complex 1, gamma 1 subunit, transcript variant X3

Length: 2469 bp    Location: 14081208..13997903   Strand: -
>XM_004842907.1
ATGCCAGCCCCCATCAGATTGCGGGAGCTGATCCGGACCATCCGGACAGCCCGAACCCAAGCTGAAGAACGAGAAATGATCCAGAAAGAATGTGCTGCAATCCGGTCATCATTTAGAGAAGAAGACAATACATACCGGTGTCGGAATGTGGCAAAATTACTATATATGCACATGCTGGGGTACCCTGCTCACTTTGGACAGTTGGAGTGCCTCAAGCTTATTGCTTCTCAAAAATTTACAGACAAACGCATTGGCTATTTAGGAGCAATGCTGCTGTTAGATGAAAGACAAGATGTCCATCTTCTCATGACTAACTGTATCAAGAATGATCTTAATCATAGCACTCAGTTTGTACAGGGACTAGCTCTTTGTACCCTTGGCTGCATGGGCTCCTCAGAGATGTGCAGAGATCTTGCAGGAGAGGTGGAGAAGCTCTTGAAAACCTCCAACTCTTACTTAAGAAAAAAGGCAGCACTGTGTGCTGTTCATGTCATCAGGAAAGTTCCTGAACTTATGGAGATGTTTTTACCAGCAACAAAAAATTTATTGAATGAGAAGAATCATGGTGTCCTTCACACTTCTGTAGTCCTCCTCACAGAAATGTGTGAGCGAAGCCCAGATATGCTCGCACATTTCAGAAAGCTTGTGCCCCAATTAGTTCGTATTCTAAAGAACCTCATCATGTCCGGATATTCCCCAGAACATGATGTTTCTGGTATCAGTGACCCCTTTTTGCAGGTACGGATTTTGCGGTTATTAAGAATTTTAGGACGAAATGATGATGACTCAAGTGAAGCTATGAATGATATACTAGCACAGGTTGCCACTAATACAGAGACTAGTAAAAATGTAGGAAATGCTATTCTTTATGAAACTGTTTTGACTATCATGGATATTAAATCAGAGAGTGGACTGCGAGTTCTAGCCATAAATATCCTGGGTCGTTTCTTATTGAACAATGACAAAAATATTAGATACGTAGCTCTGACATCTTTGTTGAAGACCGTGCAGACAGATCACAATGCAGTACAGAGACACAGAAGCACAATTGTGGACTGTCTAAAAGATTTGGATGTCTCAATAAAACGGCGTGCAATGGAATTGAGTTTTGCCCTGGTAAATGGAAATAATATCCGAGGCATGATGAAGGAATTACTTTATTTTCTGGATTCATGTGAGCCAGAGTTTAAGGCAGACTGTGCATCTGGAATCTTTCTTGCTGCAGAAAAGTATGCACCTTCCAAACGGTGGCATATAGATACCATTATGCGTGTTCTGACAACAGCAGGAAGTTACGTTCGTGATGATGCAGTCCCCAATTTGATACAGTTAATAACCAATAGTGTGGAGATGCACGCTTATACTGTCCAGCGCTTGTATAAAGCAATTCTTGGTGATTATTCTCAACAACCTTTGGTACAAGTAGCTGCATGGTGTATAGGCGAATATGGTGATCTTCTTGTATCTGGACAATGTGAAGAGGAAGAACCTATTCAGGTAACAGAGGATGAAGTATTGGATATTTTAGAAAGTGTACTAATCTCTAATATGTCCACCTCTGTGACACGAGGTTATGCCCTCACTGCCATCATGAAGCTTTCAACTCGATTCACTTGTACTGTAAACCGAATTAAAAAAGTGGTTTCCATCTATGGAAGCAGCATTGATGTGGAGCTCCAGCAGAGGGCAGTAGAATATAATGCACTTTTTAAGAAATATGACCATATGAGGTCGGCCCTACTTGAGAGAATGCCTGTCATGGAAAAAGTGACCACAAATGGCCCTACTGAGATTGTGCAGACAAATGGAGAGACAGAACCAGCTCCATTAGAGACAAAACCACCACCTTCTGGGCCACAGCCCACCAGCCAGGCGAATGACTTACTGGATTTGTTGGGAGGAAATGACATAACACCTGTTATTCCAACTGCACCTACAAGCAAACCAGCATCTGCTGGTGGAGAACTTCTTGATTTGCTGGGAGACATCAGCCTTACAGGTGCTCCAACTGCTGCTCCTACCCCTGCCTCAGTCCCTCAGATATCTCAGCCCCCCTTCTTGTTGGATGGGCTTTCATCACAGCCTCTCTTCAATGACATCACTGCAGGCATCCCCTCCATCACAGCATACAGTAAGAATGGCTTGAAGATAGAATTCACCTTTGAACGGTCAAACACCAACCCCAGTGTAACAGTGATAACGATACAGGCCTCTAACAGCACAGAGCTAGACATGACGGACTTTGTATTCCAGGCTGCAGTACCAAAGACATTCCAGCTGCAGCTTCTGTCTCCTAGCAGCAGCATTGTCCCAGCATTTAATACAGGGACCATCACACAAGTCATTAAAGTTCTGAACCCACAGAAGCAACAGCTGCGAATGAGGATCAAGCTCACATATAATCACAAGGGCTCAGCAATGCAAGATCTAGCAGAGGTGAACAACTTTCCCCCTCAGTCCTGGCAATGA

XM_004842908.1 Coding sequence

Atxn1l ataxin 1-like, transcript variant X1

Length: 2067 bp    Location: 14119440..14128670   Strand: +
>XM_004842908.1
ATGAAACCTGTTCATGAGAGGAGTCAGGAATGTCTTCCACCAAAGAAACGAGACCTCCCCGTGACCAGCGAGGATATGGGGCGGACTACCAGCTGTTCCACAAACCACACACCCTCCAGTGATGCCTCTGAATGGTCCCGAGGGGTTGTGGTGGCTGGGCAGAGCCAGGCTGGAGCCAGAGTCAGCCTGGGGGGTGATGGATCTGAAGCTATCACTGGTCTGACGGTAGACCAGTATGGCATGCTGTATAAGGTGGCTGTGCCACCTGCCACCTTCTCACCCACTGGCCTCCCATCTGTGGTGAACATGAGCCCCTTGCCCCCCACGTTTAATGTAGCGTCTTCACTGATTCAACATCCAGGAATCCACTATCCCCCAATCCACTATGCTCAGCTCCCATCCACCTCACTGCAGTTTATCGGGTCTCCTTATAGCCTTCCTTATGCTGTGCCACCTAATTTCCTACCAAGTCCCCTCCTTTCTCCTTCTGCCAATCTTGCCACTTCTCACCTTCCACACTTTGTGCCATATGCTTCACTCCTGGCAGAAGAAGCCACTCCTCCCCCCCAGCCTTCATCCCCAGCCCATTCATTTAACAAAACCCCCACTGCCGCCTCCCCGCCTGGGCAGTTGCCACATCACTCAAGTACTCAGCCACTGGACCTCGCTCCAGGCCGGTTGCCCATTTATTATCAGATGTCTAGGCTACCTGGTGGGTATACCTTGCATGAAAACCCTCCAACAGGTGCCAGCCCAGTTCTTACCCCTCAGGAGGGCCAGTCTGCTCTGGAAGCAGCTGCTGCCAATGGAGGACAGAGACAACGAGAGCGAAATTTAGTAAGACGGGAAAGTGAAGCCCTTGACTCCCTGAGCAGCAAGGGTGAAAGCCAAGGACTGGTGCCAGTGGTAGAATGTGTGGTGGATGGACAATTGTTTTCAGGTTCTCAGACTTCACGGGTAGAGGTGACGGCACCAGCACATCGAGGGACTCCAGACACCGACCTTGAGGTCCAGCGGGTAGTTGGCGCTTTAGCTTCTCAGGACTATCGTGTGGTGGCAGCTCAGAGGAAAGATGAATCCAGCCCCCTCAACCTGTCCCATCATACTCCTGACCATCAGGGTGAGGGACGAGGGTCAGCCAGGAACCCTGCAGAGGTGGCAGAGAAGAATCAGGCCCGTGGGTTCTACCCTCAATCCCATCAGGAACCAGTAAAACATAGACTTTTACCCAAAGCGATGGTTGTTGCCAATGGCAACCTGGTGCCCACTGGAACTGACCCAGGCCTGCTGCCTGTGGGCTCTGAGATCCTGGTGGCATCAAGTCTGGACATGCAGGCCAGAGCCTTCCCAGACAAGGAGCCAACGCCACCCCCTATTACCTCTTCCCACTTGCCCTCCCATTTCATGAAAGGCGCCATCATCCAGCTGGCTACAGGGGAGCTGAAGCGGGTAGAGGACCTCCAGACCCAGGATTTTGTGCGCAGTGCCGAAGTGAGCGGGGGGCTGAAGATTGACTCAAGTACGGTTGTGGACATTCAGGAGAGCCAATGGCCTGGATTTGTCATGCTGCATTTTGTGGTTGGTGAGCAGCAGAGCAAAGTGAGCATTGAGGTGCCCCCCGAGCACCCCTTCTTTGTATATGGCCAGGGTTGGTCGTCCTGCAGCCCTGGGCGGACTGCACAACTCTTCTCTCTGTCCTGCCATCGACTACAGGTGGGAGATGTCTGCATCTCTATCAGTTTACAGAGCTTGAACAGTAACTCGGTTTCTCAGGCCAGCTGTGCTCCCCCAGGCCAGTTGGGTCCCTCCCGAGAAAGGCCTGAGAGAACAGTCTTGGGACCCAGAGACCTGTGTGACAGTGAGGGGAAGAGCCAGCCCACAGGAGAGGGCTCCCATGTGGTAGAGCCCTCCCAGCCTGAGCCTGGTGCTCAGGCCTGCTGGCCAGCCCCAAACTTCCAAAGATACAGCGTGCAAGGGGAGGAGGCACGGGCTGGACTGCTCCGTCCCTCTTTCATTCCACAAGAGGTAAAGCTGTCCATTGAAGGGCGTTCAAATGCGGGAAAATGA

XM_004842900.1 Coding sequence

Tat tyrosine aminotransferase

High confidence: 4 potential gene matches
Length: 1359 bp    Location: 13803204..13793633   Strand: -
>XM_004842900.1
ATGGACCCCTATAGGATCGAGACAAGTGACAGTGGCAGCCAAGTTCTGGATATGCATGTCAACATCAGTGGGAGAAGCTCCATGCCAGGGAAAATGAAAGGCAGGAAGGCCAGATGGTCAGTGAGGCCCTCTGACATGTCCATCAGAACCTTCAATCCCATCCGGGCCATTGTGGACAGCATGAAGGTGAAGCCAAACCCAAAGAAAACCATGATTTCTCTGTCAATTGGAGACCCTACTGTGTTTGGAAACCTCCCTACAGACCTTGAAGTTACCCAAGCAATGAAAAATGTGCTGGATTCAGGGAAATACAATGGCTATGCCCCATCCATTGGCTACCTATCCAGCCGGGAGGAGGTTGCTTCCTACTACCACTGCGCCAAAGCACCACTAGAAGCTAAGGATGTCATTCTGACAAGTGGCTGCAGTCAGGCTATTGAACTTTGCTTAGCTGTGTTGGCCAACCCAGGGCAAAACATCCTTGTTCCGAGACCTGGTTTTTCTCTCTATAGAACTTTGGCTGAATCTATGGGAATTGAAGTCAAACTCTATAATCTATTGCCAGAGAAGTCTTGGGAAATTGACCTGAAACAAATGGAATCTCTGATTGATGAAAAGACAGCCTGTCTCATCATCAACAATCCATCAAATCCCTGTGGGTCAGTGTTCAGTAAGAGTCATCTTCAGAAGATTCTGGCAGTGGCTGCAAGGCAGTGTGTTCCCATCTTAGCTGATGAGATCTATGGAGACATGGTGTTTTTGGATTGCAAATATGAACCACTGGCCACACTTAGCACCAATGTTCCCATCCTGTCCTGTGGAGGGCTGGCCAAGCGGTGGCTGATTCCTGGCTGGAGACTGGGCTGGATCCTCATCCATGACCGAAGAGACATATTTGGCAATGAGATCCGAGATGGGCTGGTGAAGCTGAGTCAGCGGACCTTGGGACCATGCACCATTGTCCAGGGAGCTCTGAAAAGCATCCTGCGTCGCACTCCTCAAGAGTTCTACGACAACACTCTATGCTTCCTCAAGTCCAATGCTGATCTCTGCTATGGGGCATTGTCTGCAATACCTGGACTCCAGCCAGTCTGCCCTTCAGGGGCCATGTACCTCATGGTTGGAGTTGAGATGGAACATTTCCCAGAGTTTGAGAATGATGTGGAGTTCACAGAGCGGTTGATTGCTGAGCAGTCTGTCCATTGCCTCCCAGGAAAGTGCTTTGAGTACCCAAATTTCTTCCGAGTGGTGATTACTGTGCCTGAGGTGATGATGCTGGAGGCTTGTAGCCGGATCCAGGAATTCTGTGAGCAGCACTACCATTGTGCTGAAGGCAGCCAGGAGGAATGTGACAAATAG

XM_004842901.1 Coding sequence

Phlpp2 PH domain and leucine rich repeat protein phosphatase 2, transcript variant X1

Length: 4074 bp    Location: 13994182..13919557   Strand: -
>XM_004842901.1
ATGGGGGAGGTGGAGCCGGGGCCCGCGGGCCCGCTGGAGCCCCCGGAGCCGCCCGAAGTGCCGCCGACTCGCCGGCCGGGAGGGATCCGGGTCCTGAAGAGAAATATGAAGCACAATGGGAGCAGAAATTGTTTGAATAGGAGAAGTAGGTTTGGTTCTCGAGAAAGAGACTGGCTGAGAGAAGATGTGAAGAGAGGCTGTGTTTACCTTTATGGAGCCGACACAACCACTGCCACTACAAGCACCACCTCCAGCTCTTCCTCTTCTTCCTCCACCTCCTCTGACTTACATCTCGTCCTTTGCACAGTAGAAACACCAGCTTCAGAAATATGTGCTGGAGAGGGGAGAGAAAGTCTTTATTTACAGCTTCATGGAGACCTGGTCAGGAGACTGGAACCTACTGAACGACCTCTTCAGATTGTTTATGATTACTTATCCAGACTGGGATTTGATGATCCTTTGCGCATACAGGAGGAGGCTACAAATCCTGACCTTGGCTGTATGATTCGATTTTATGGTGAAAAACCATGCCAGATGGATCATCTGGATCGAATCCTACTGTCTGGTATCTATAATGTTCGCAAGGGAAAGACTCAGCTGCATAAGTGGGCTGAGCGCCTAGTTGTTCTCTGTGGCACCTGCCTTATCGTTTCCTCAGTGAAGGAATGTCAAACTGGAAAGATGCACATTTTGCCTCTGGTTGGGGGAAAGATAGAAGAAGTGAAGCGCCGGCAGCACTCCCTTGCATTCAGCTCAGCTGGAGCCCAGGCTCAGACCTATCATGTCAGCTTTGAGACTTTGGCGGAGTACCAGAGATGGCAGCGGCAAGCATCTAAGGTGGTGTCCCAGCGAATCAGCACTGTGGATCTGTCATGTTACAGCCTTGAGGAGGTTCCTGAGCATCTCTTCTACAGTCAAGATATCACCTACCTCAATCTGCGACACAACTTCATGCAATTAGAAAGACCAGGGGGCCTTGACACACTCTACAAATTTTCTCAACTGAAGGGCCTGAACTTGTCCCACAACAAACTTGGGTTGTTCCCTGTATTGCTTTGTGAGATTTCTACGCTGACTGAGCTCAACCTTTCCTGTAATGGATTTCATGACCTGCCAACTCAGATTGGAAACCTGCTAAACCTTCAAACACTCTGTCTTGATGGCAACTTTCTGAATACTTTACCTGAAGAATTGGGAAATCTGCAACAGCTTTCCTCCTTGGGAATTTCCTTCAACAACTTTAGTTACATTCCTGATGTTTATGAGAAACTCACAATGTTAGATAAAGTGGTTATGGTAGGAAATTGTCTGGAAGTCCTGGATTTAGGGGTGCTGAGCCGGATGAGCCATATCAAGCATGTGGATTTAAGGATGAATCATTTGAAAACCTTGGTTTTTGAAAATCTGGAGGGAAATAAATACATTACGCACATGGATTTGAGGGACAATCAGCTGACTGACTTGGATCTTAGCTCCTTATGTAGCCTGGAGCAGCTGCATTGTGAGCGGAACCAGCTGAGGGAGCTGACACTGAGTGGCTTCTCCCTACGAATTCTCTGTGCCAGTTCAAACAGGCTGACAGCAGTGAATGTCTACCCTGTGCCCAATCTACTCACTTCCCTGGAACTCTGCCGAAACCTGCTGGAATGTGTCCCAGATTGGGCCTGTGAAGCAAAGAAGCTAGAAATATTAGACATGAGCTATAATCTTCTCACAGAGCTTCCTATAAGAATTCTGAGTAGCTTGAGTCTTAGGAAACTGATGGTGGGGCACAATCATGTCCACAATCTTCCGGCACTGGTGGAGCACATCCCCCTGGAGGTTCTGGATCTCCAGCATAATGTTCTCACCAGGCTGCCAGACACCCTCTTCTCCAAGGCCTTAAATCTTAGATACTTGAATGCATCTGCAAATAGCCTGGAGTTCTTGCCTTCTGCTTGCACTGGAGAGGAGAGCCTGAGCGTGCTGCAGCTGCTTTACCTGACCAACAACCTCCTGACAGATCAATGTATCCCCATCCTGGTCGGGCATCCACACCTCCGGATCTTGCATCTTGCAAACAACCACCTGCAGACCTTTCCTGCAAGCAAACTAAACAAATTGGAGCAACTAGAGGAACTGAACCTAAGTGGCAACAAGCTTAAAACCATTCCCACAACCATAGCAAACTGCAAAAGGCTTCACACCCTTGTTGCACACTCCAACAACATCAGCATTTTCCCAGAAATACTGCAGTTACCTCAGATCCAGTTTGTAGACCTAAGTTGCAATGATTTGACAGAAATCCTAATTCCAGAGGCTCTGCCTGCTACCTTACAAGACCTTGACCTGACTGGAAATACAAATCTGGTTCTGGAACACAAGACTCTGGACATGTTTAGCCATATCACAACCCTGAAAATTGATCAGAAACCTTTGCCAACCACAGATTCTACAGTTACATCAAGTTTCTGGAGCCATGGATTGGCTGAAATGGCAGGACAGAGAAATAAGCTATGTCTGTCTGCCCTAGCTATGGATAACTTTGCAGAGGGAGTAGGAGCTGTGTATGGCATGTTTGATGGAGACCGAAATGAGGAGCTTCCTCGCCTGCTGCAGTGCACAATGGCAGATGTGCTTTTGGAAGAAATACAGCAGTCAACAAATGACATAGTTTTCATGGTCAACACCTTCTTGGTATCTCACAGGAAGTTAGGAATGGCTGGCCAGAAGCTGGGCTCCTCTGCTCTCCTGTGCTACATCCGCCCTGACACTGCTGATCCAACAAGTAGTTTTAGCTTGACTGTGGCTAATGTTGGCACATGCCAAGCAGTCCTCTGCCGAGGCGGGAAGCCAGTACCCCTCTCTAAGGTCTTCAGCCTGGAACAGGACCCAGAGGAGGCGCAAAGAGTGAAGGACCAAAAAGCCATCATAACAGAGGACAACAAAGTAAATGGGGTAACTTGCTGTACGAGGATGCTGGGCTGTACATACCTCTACCCTTGGATCCTCCCCAAACCCCACATATCGTCCACTTCACTTACCATTCAAGATGAGTTGCTGATTCTGGGAAACAAAGCATTGTGGGAACACTTGTCATATACAGAAGCTGTCAATGCAGTACGTCATGTGCAAGACCCATTGGCAGCTGCCAAGAAACTGTGCACATTAGCACAGAGCTATGGTTGTCAGGACAATGTGGGGGCAATGGTGGTTTATTTAAACATTGGTGAGGAAGGCTGCACTTGTGAAATGAACGGGCTCACCCTCCCAGGTCCTGTGGGATTTCCTTCAACCACCACCATCAAGGATGGCCCCAAGCCTACCACTCCTTCTTCTAGTAGCGGTATTGCCTCAGAGTTCAGCAGTGAGATGTCCACCTCTGAGGTGAGCAGTGAGGTGGGCTCTACTGCTTCTGATGAACACAACACTGGAGGCCTGGAGGCTGGCTTGCTCCCAAGGCCAGAGAGGCGCTGCAGCCTCCACCCAACACCCACGTCTGGGGTTTTTCAGCGCCAGCCCTCTTGTGCAACCTTCTCCAGTAATCAGTCTGACAATGGCCTGGACAGTGATGATGACCAGCCTGTTGAAGGGGTCATAACCAATGGCAGTAAGGTGGAAGTAGAAGTAGATATCCATTGCTGCCGAGGAAGAGATCTTGAGTACTCTCCTACTCTTAAAGAGAATTCTTCCACCCCATGTCCTGAGGAACACCCTAGAGGGTTCTGTTTTGGGATCCGAAGACAGAACAGTGTGAATAGTGGCATACTTCTGCCACTAAACAAGGACAAGATGGAGTTACAGAAATCTCCTTCCACTTCCTGTCTGTATGGAAAGAAACTCTCCAATGGCTCTATTGTGCCCCTAGAAGACAGTCTGAACCTCATAGAAGTGGCCACAGAAGCACCCAAGAGGAAAACTGGCTACTTTGCTGCCCCCACTCAGCTGGAACCAGAGGATCAGTTTGTTGTACCTCGTGACCTGGAGGAAGAAGTGAAGGAGCAAATGAAGCAGCATCAGGAAAGCAGGCCCCACCCTGAGCCCCATGAAGAGGATCGGACCGAGCTCCCAGAGGAGTTTGACACAGCGCTGTGA

XM_004842887.1 Coding sequence

Il34 interleukin 34, transcript variant X2

Length: 669 bp    Location: 12860368..12867120   Strand: +
>XM_004842887.1
ATGAGTACTTGCAACCCAAGAAAATGGGTGACAGTGGGTACAGCTTTGCACCCTGGGGCGGTGGGAACACGGTGCCTGGTGCTCATGTGCTCTTGTTGGGTGTGGTCTGCAGATCTTGGGATCCTCCTTGGTGTGGCCTTGGGGACCGAGGGCCTGAAGGTGTGGCCTTTGACTCAGAATAAGGGGTGCACTGCCACTGGCTACCTTCGGGACAAGCTGCAGTACAAGAACCGGCTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGCGTGCCTTATGAGGGGGTGCTCAGAATCGCTAACGTCAGCAGGCTGAGGAGGGCCCGGGTGAGTGAGCAGGAGCTGCGGTACCTGTGGGTCTTGGTGAGTCTCAGCACCACCGAGTCAGTGCAGGACGTGCTGCTAGAGGGCCACCCGTCCTGGAAGTACCTGGAGGAGGTGCAGACGCTGCTGATGAACGTGTATCGGGACCTCAGGGATGTGGAGATCGGCCCCAAGGTGGAAGCCGTGTTGTCGGTCCTCAGCACCCCAGGCCTGAGCCTGAAGCTGGTGAGGCCCAAAGCCCTGATGGACAACTGCTTCCGGGTCATGGAGCTGTTGTACTGCTCTTGCTTCTTTTTCTCTCTCTGCCCCTTACAGGTAAACAAAGCCCCGTCCTAA

XM_004842898.1 Coding sequence

Znf23 zinc finger protein 23, transcript variant X3

Length: 1950 bp    Location: 13641712..13633654   Strand: -
>XM_004842898.1
ATGCTGGAGAATTATGGACATGTGACTTCCCTAGGGTTTCCACTTCTGAAACCGGCTGTGATCTCACACCTGGAGAGAGGAGGTGAGCTGGAGGGCCTATCTCCTCTGGCCATTGTGACTGGAACAGGCCCTCAGGGCCTCTGGACTGTAGATATTGATATACAGACAAACAATAATTTGACAAAGGAAATGTATGAAGAAAAAGATAGCACATCATTTGAACTTCCGAAGGACTTTTCCCTGGAAACAGACACTTTAGAAGCCTATATGCCACAGCAACAACAGGAAGTCCACTCAGCAGGAACGTTGACAAAGGAAAACAGCAATAGCATGGATGGAACAGTGAAAGATGAAACAAGCTCCATGGAGGAGTGTTCCTTTAATAACAGTACAAACTTGTTTCAGCATCATAGTATCTCCACTGAAGAGCAGCACCCTGGTTGTATAGGACTGATGAAAGCCTTCAGCTTTGACACAGAACTTATTAAGCATGAAATAATTAATACTGTGGAAAGTACTTTGAAATGTGAAAATTTTGTGGAAACCTTCACATTTGACTCTCAACCTAGTCAGCATCTAGAAAACTATACTGTAGAGAAGCCTTACCAGTGTGTGGAATGTGGCAAAGCCTTCAGTGTTAATGCAAAATTAATTTGGCATCAAAGACTTCATAGTGGGGAGAAACCCTTCAAATGTTTGGAGTGTGGGAAATGCTTCAATTACAGTTCCCATTATATCACACATCAGACAATCCACAGTGGGGAGAAGCCCTATCAATGTAAGATTTGTGGGAAAGCCTTTAGTGTTAATGGGAGTCTTAGTAGGCATCAGAGGACCCATACAGGAGAGAAACCCTATCAGTGCCAGGAGTGTGGAACTGGCTTTGGCTGTAGTTCTGCATATATTACACACCGGAGAGTCCACACTGGAGAGAAACCTTATGAGTGCAGTGATTGTGGGAAAGCTTTCAATGTTAATGCAAAATTAATTCAACATCAGAGAATCCACACTGGAGAGAAACCTTACGTGTGCAGTGAGTGTGGGAAAGGCTTCAGGTGCAGCTCCCAGCTTAGGCAGCATCAGAGTATCCATAGTGGAGAGAAACCCTATCCATGTAAAGAGTGTGGAAAAGCCTTCAATAATAATGCAAAACTCATTCAGCATCAAAGAATCCACACAGGTGAGAAACCTTATGGGTGCAATGAATGTGGAAAAGCCTTCAGTGTCAAAGGAAAGTTAATCCAGCATCAGAGAATCCACACTGGTGAGAAACCATATGGATGTAATGAATGTGGAAAAGCCTTTAGGTGTAACTCTCAGCTTCGACAGCATCTGAGGATCCATACTGGGGAGAAGCCCTATAAGTGTGATGAGTGTGGAAAGGCTTTCAGTGTTAATGCAAAACTAATGCAACATCAGAGAATTCACACTGGGGAGAAGCCTTTTGAATGTAATGAATGTGGGAAATGCTTTACTTCTAAAAGAAATCTACTTGATCATCACCGAATCCATACTGGAGAAAAGCCTTATCAGTGCACGGAATGTGGGAAAGCTTTCAGTATCAATGCCAAGTTAACTAGACATCAACGAATACATACTGGAGAAAAACCTTTCAAGTGTATGGAATGTGAGAAAGCATTCAGCTGTAGTTCTGACTATATTGTGCACCAGAGAATTCATACTGGAGAGAAACCCTTTCAGTGTAAGGAGTGTGGAAAAGCCTTCCATGTTAATGCCCATTTAATTCGACATCAGAGAAGCCACACTGGGGAGAAACCTTTCCGATGTGTGGAGTGTGGCAAAGGTTTCAGCTTTAGTTCTGACTGTATTATACACCAGACTGTCCACACTTGGAAGAAACCTTATGTGTGTAATATCTGTGGGAAAGCCTTCAGGTTTACCTTCCAACTCGGTCAGCATCAGAGTGTCCATAATGAAGGGAAATGTTAG

XM_004842889.1 Coding sequence

Il34 interleukin 34, transcript variant X4

Length: 651 bp    Location: 12831341..12867591   Strand: +
>XM_004842889.1
ATGCCCCGGGGACTCGCCTGGCTGCACTATCTTGGGATCCTCCTTGGTGTGGCCTTGGGGACCGAGGGCCTGAAGGTGTGGCCTTTGACTCAGAATAAGGGGTGCACTGCCACTGGCTACCTTCGGGACAAGCTGCAGTACAAGAACCGGCTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGCGTGCCTTATGAGGGGGTGCTCAGAATCGCTAACGTCAGCAGGCTGAGGAGGGCCCGGGTGAGTGAGCAGGAGCTGCGGTACCTGTGGGTCTTGGTGAGTCTCAGCACCACCGAGTCAGTGCAGGACGTGCTGCTAGAGGGCCACCCGTCCTGGAAGTACCTGGAGGAGGTGCAGACGCTGCTGATGAACGTGTATCGGGACCTCAGGGATGTGGAGATCGGCCCCAAGGTGGAAGCCGTGTTGTCGGTCCTCAGCACCCCAGGCCTGAGCCTGAAGCTGGTGAGGCCCAAAGCCCTGATGGACAACTGCTTCCGGGTCATGGAGCTGTTGTACTGCTCTTGCTGTAAACAAAGCCCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGGCTCACAGTCCAGAGCCCTTGTTGCAATGTGCAGCCACCCACTTGTACCCTCCAACCTAG

XM_004842892.1 Coding sequence

Hydin HYDIN, axonemal central pair apparatus protein

High confidence: 2 potential gene matches
Length: 15312 bp    Location: 13361090..13000939   Strand: -
>XM_004842892.1
ATGACAAGTAGAAGACTTGAGGAGTCTATGGGGGCTGTTCAGATGGGTTTAATCAAAATGCTCAAAGGATTCCAAAGCAAAGTTTCACCACCCCTGAGTCCAAAGATGGTCACAGAAGAGGAGGTAAACCAAATGCTGACACCCTCAGAGTTCCTGAAAGAAATGTCCCTCACTACACAGCAGAGATTAGCAAATACGCATTTCACATGCCGACCACAGATCATCGAACTCTTAGATATGGGGGAAACAACACATCAAAAGTTTTCAGGAGTGGACTTGGATCATGCATTATTCCAGCCCTTTCCATCAGAAATCATATTCCAGAACTATACTCCCTGTGAAGTCTATGAAGTTCCACTGGTTTTGAGGAACAATGACAAAATTCCAAGAATGGTGAAAATTGTTGAGGAAAGTTCACCTTACTTTAAGGTAATCAGCCCCAAAGACATTGGCCACAAAGTAGCTCCAGGAGTGCCATCCATTTTCCGAATCCTCTTCACTCCAGAGGAGAACAAGGATTACGCCCATGTGTTGACCTGTGTTACTGAAAGAGAAAAGTTTATTGTACCCATCAAAGCTAGAGGTCCACGAGCCATCCTGGATTTTCCCGACGAGCTGAATTTTTCCACTTGCCCTGTCAAATACAGCACTCAAAAGATTCTGTTGATACAAAACATTGGCAACAAAGACGCTGTGTTTCACATCAAAACTCATAGGCCTTTCTCTGTGGAGCCAACTGATGGAACTCTTAATGCGGGAGAATCCATGCAACTGGAAGTGAATTTTGAGCCACAGAGTGTGGGTGATCACAGTGAAAGACTTATAGTGTGTTATGACACAGGTGAAAAAATTTGTGTATCTCTGTGTGGAGCTGCCACAGACATGAATATCAGACTGGACAAGAATTCCTTGATCATCGAGAAGACCTACATTTCTCTGGCCAGTCAGCGGACGATAGCCATTCACAACCGCAGTAACATTATTGCCCATTTCCAGTGGAAAATATTCGCCACCCAAGAAGAGGAGGACAGAGAAAAGTATAGGATCTGTGAAGATTTGACTAAGGAAGAAAAGCATGAGACCGATGAGTTTCTTGAAGAGTGCATTATTGATCCTTCACTCCGAGAACATCTTTCCATTCTCTCCCGCACCTTTGAGAATCAGAGGAAGCTGGTGCAGGGAGACAGCATGCTCTTCTTGGGTAGCGTTTTCACCATTGAGCCCCTGGAAGGTGATGTTTGGCCCAACTCATCAGCTGAAATCACTGTGTACTTTAACCCTGTAGAGGCCAGGATCTACCATCAGACCATTTACTGTGACATTTCAGGCCGAGAAATCCGTCTGCCCCTCCGACTCAAAGGGGAAGGAATAGGACCTAAGATTCACTTCAACTTTGAATTGCTGGATATCGGGAAGGTTTTCACTGGATCTGTACATTGTTACGAGGCTGTACTGTCCAACAAGAGCAGCATCGACGCCCTCTTCAATGTGATCCCTCCAACTTCGCCTTTGGGGGCCTGCTTTGTTTTCAGCCCCAAAGAAGGCATCATTGAACCAAGTGGAGTCCAAGCTGTCCAGATCACATTCAGTTCTGGCATCCTGGGGCACTTTGAAGAAGAGTTCCTGATCAATGTTAACGGGTCCCCCGAGCATGTGAAATTGACCATTAGAGGCTGTGTCATTGGACCTACTTTTCATTTTAATGTTCCTGCTCTGCACTTTGGTGATGTTTCCTATGGATTTCCTCATACCCTGATGTGTTCCCTCAATAATACATCTTTGGTCCCTATGACCTTCAAACTGCACATCCCTGGGGATGGCCTTGGCCCAGAAAGCATCCCAAGTGGTGAGCAGGCTTCAACCAACAGAAGACTGTCTGGGACCAGTGAAGAAACACCCACAGTGAAACCTAAAGAATTCACCATAATTCCCAGCTGGGGCACCATTCGCTCGCAGGGATTTGCAGCTATCAAGGTGACTTTATGCTCCAACACTGTGCAGAAATACGAGTTGGCACTGGTTGTGGATGTGGAGGGCGTGGGAGAAGAGGTGCTGGCTCTCTTAGTCACAGCAAGATGTATTGTACCTACCATTCAACTAGTTAAGACAGAGGTGGACTTTGGGCTCTGCTTCCTGAAATACCCATATGAGAAAACTGTCCAGCTTGTCAATCACGCTGACCTCCCAGGATGCTATGAGGTTCTGCCTCCGGTGTGTGAGGACCCCCTGGCTGTGCTGCTTTCTGCCCCCTCCCCCTGCGGGCTCATCCCCCCCAACAGCACTGTGCACGTACCACTGGCCCTGGAGACCCAGCTCACCGGAGAGCACAGGGCCACGCTTTACATCTCCGTCTTTGGAAGCCAGGACCCTCCTTTGGTCTGTCGCCTAAAGATCATTGGACAAGGCCCAGTTATCCAAATGCATCCCACTCAAGTTGATTTTGGCAACATCTACGTCCTACAGGACTCTTCCAGGATTCTCAACCTGGCTAACCAGTCTTGCATTCCTGCATTTTTTCGTGCACACATGGCAAACAAAAAATCCCTTTGGACGATTGAACCCATTGAAGGCATGGTTCCTGGAGAAGCTAATGTTCCCCTGACACTCACTGCCAACCTGAATGACGTTCTGACGTTCAAGGACACGGTCATTTTGGACATTGAAAATAGCAACACCTATCAGATTCCTGTCCAGGCTTCAGGAATTGGTTCTACCATTGTTTCAGATAAGCCCTTTGCTCCAGAACTCAATTTGGGAGCACATTTTAGCCTGGATACCTATTATTACCACTTCAAGCTGACCAACATGGGACGTCGGATCCAACAGTTGTTCTGGATGAATGATAGTTTCTGTCCCCAGAACAAGTTGAGCATGAAGGGTCAGGTTAAAAGGGGACTTGCTTGTGGCCCTTCCCAGCCCCAGAGCTCCCAGGAGCCCAGGGATCCAGAAGGTCCAGTGTTTCAGATTCATCCCATCAGGATGGAGCTCTACCCAGGCCAGACGATCGATGTGATTCTGGAAGGCTATTCTGCAACTCCCAGGGTAGTCAAAGAAAAGTTGGTGTGTCACGCTACGGTTGGTACCAAGAGGGGGAAGAGCTTGCTGATGACCGTGAACATCATCTGTGAGTTCGTAGCACCGCTTATCCAGCTGTCCACCAGACAACTCGTATACCGACTGGAGAAGAAACCTAACACTAAACTGGAACCTGATTACCAGCCCTTGGTCATAAAGAACATCTCCAACCTGCCTGTGAACATGTTGCTCTCAACAACTGAACCCTTCTGTATATGTGAGACTGATAAATCCCTACTGCCTGCAATCCCTGAGCCTATTAAACTGGAGATTAATGAAGCAAAAAATCTGCTAGTCAAGTTTGACCCTTCCTACAAAAATGATTTGAACAACTGGGTGGCAGAAGAAGACCTAGAGATTAAGTATGTGGAACACCCGCAAGTGGACAGCCTGAACCTGCACGGGGAAGTATATTACCCCAACCTCAGCTTTGAGACAATGGAGGTGGATTTTGGCTGCATCTTGAATGATACCGAGGTCGTCCGCTACCTTATGATCACCAACTCCAGCCCCCTGCTTGTGAAGTTCCACTGGTTCTTCCTTGTGGATCACGAGGAAATTCAGAGAAGGTTTGTGACATGGACAAAGAAGCTCTCCACTACACCCACGACCCAGACAGAGTCTATCCCAGTAACCTCACTGCCTGCCAGCTTGCCATCATTCCCAGCTACACTCAAGTCTGCTGATACAGATTTAAGTGATTCTATTAAGACTTCCCTGATGGTTGAAGATGCTGGGTCTGAAGAAAAAGAACTGAAAAAAATCAGAGCACCCACCTTGATCTCAGATGGGGAAAAACATAGCTCTTCTGAAAGAGAAAGTAGCCAGAGCCAGCTGGATTTTGAAGAACCCCTGTGGATCTTTCAAGAGGAGTTGGTTTCCATGGGGATTGAAGAAGTGTTCGACATTTTGCCCCTCTATGGAGTCTTGCAGCCATACAGCAGCCAGCAAATATCTTTCACTTTCTATGGACACTGTGACATCATTGCACAGGCCAAAGCTCTGTGTGAAGTGGAAGGCGGGCCCACCTATGAAATAACACTGAAGGGACAGGCTTCCATGATCAACTATTCCCTCGACACCAAGGATATTAACTGCGGGCTACAGCTGTTCGACCACATCGCAGAGCGTGAGATCACACTGAAGAACACCGGGAAAGTTGGCTTCGAGTTCAAGGTTCTGACTGACCACCAGTCTTCCCCAGACAGCCTTCTCCCTGGGGTGCCACAGATTGTGCCTCTGTCGGGTTTTATCAGTTCATATAGGAAGCAAGTGTTGAAGGTTTACTATTTACCTGGAATACCTGAGATCTTTCAAAGGCGCTTCCAAATACAGATTGCCCACCTGGACCCAGAAAATATCACTCTGAGTGGAGAGGGAATCTTTCCCCGGATCAGCCTGGATCTTCCCAGGAACCTCCAAGGCAATGAAAAATATAAAACCTTCTTGCACCAGGCCAGAAAAGATGCAGAAAAAGAGTACAACAAAAATGAAACTCACAGTCACTCCGAGATGGTAACTGAGGAAATGCCTGAGGATGAATCTTCTGAGTTAAGTGCTTATCTCCAGATGAAAGTAGACCAACTTATCATCCAAGCCTATGCACTAGAACATCAGAAAACAGTTATCCCCGATCCCACAGAGAACACCTGTTTCAGCCACTGGAGTCGCCGCAAACTAGCCAAAGTCCAGCTGCCAGAATATATCCTGGACTTTGGCTACATTGTCCTTGGGGACGTGCAAACCCATATCATCAAGATCACCAACACCAGTCACTTCCCAGTGTCCTTCCATGCAGAAAAGCGTGTCCTTCGTGACACAGGCTTCAGTACTGAGCTAGATCGTGTAAAGAATCTGCCGTACTATGAAACAGAAACATTTGAAATTAGATTTGACCCACAAGGGGCTAATCTTCCCGTGGGAAGCAAAGAAATCCTGCTGCCCATCAAGGTGGTTGGAGGGCCAACAGTTCACATCTGTCTCCGAGCTAAGGTGATTGTCCCTGCCATGACGCTGTCTTGTGGAAAAGTGGAATTTGCTGCAATTCAGTGTGGACAGTGCATGGTGGAAACGATTCAGCTCTCCAATCATCTCCAAGTACCTTGTGAATGGTTTGTCCACAGTCCTAAGCCTATTAACAAGCTGGAGAAACACATGCCAAAATATTTAAGACGGAAACTACATGCTGAATTAAAGCCAAAGTCTCAGATCTTTGAGATCCAGCCCACGTCTGGAATCTTGGATCCTGATGAGATGGCCAATGTGCAAGTGAAATTCATGCCAAAAGAAGAGAAATTCTACAGCCAAACCCTGATGTTCCAGATTGCCCAGAGTGCTCAAAAGCTTACACTGCTGGTACATGGGCAAGGTCTGGAACCACACCTGGAATTCAGCCCTTCAGTTCTGGAACTGGGACCACTGCTGCCTCTCGCCTCTGGAGATGAGGCCGAGGTGACAGTGAAGAATCCCTGCAACTTTCCAGTGGAGTTTTACTCCTTAGAATTTGATCGGCAATATCTCTTAGAAGAGAAGATCTTGCGCCAGCTGAAGGGCTATGACTCCTACAATACCCTGCTGTTACCACCTCGCACCCCAGGGGAGAATCTGCCCCCAGAATTGTATGAGTACTTTAAAGAGATCAAGAAGCCTAAAGAAGAACAAATGAAGGCAAAAAATCTGGAGAGTCTGGCGCAGGATAATGAATTGGAAGAGCTGACTGTGTCAGGAACCTCCGCTAGCACAAAGAGAACATCCGTCAGCCAAGGGATCTCTGTCACATCCTACTTTGAAAACCAGCACAACCTTTTGACAGAGTCCAAAGCCTACACAGATGAAGATGAGGATGAGGACAGCCTGGAAAAATTAATCTTTCAAACTGACAAGATTCAAAGAAGCCACAGCCATTCTGCAGAGGAAGTTGGAGAGGTGGAAAGCAACCCAGTGAGCAAGGCAATCGCTCGCCACCTAGGCATTGACATCTCTGCCGAGGGCTGCATGGCCAAGAGTCGGAAAGGCATCGCCATTATCATCCATGGGACACCCTTGTCAGGAAAGACACCCAACGCTATCAGCATAGCCAAGTACTACAGTGCAGCCTGCTTGAGCATTGACTCCATTGTCCTGGAAGCCATATCTGACAGCAGCAGCATCCCTGGGATGCGGGCCCGTGAGCTCTGCATCAGGGCCACCATAGAGCAGTCCATAAAGGAAGAAGACGACTCTACCCAGGAGGCTTCTGGAGGCCAGAGTGCCACAGTACCATCACAACCAAGCAGTGAGAACTTGGGCAAATTCACCTCAGAAATCACTCTAGTGACCCCAGAAATTAAACCTGGAAAGAGCATGCATGGGAGTGTGTTGTTACCCAAAAGCAAGCCAGAGAGCCACAGTTCTGGGTCACAGAAGCAGCACCACCAGCACCAATCTGAAACACCACAGATTCCCTCCAGCCCGCTCCTGGGGCCCACCCAGCGCCGGCTCAGTGTCAGCGCCAGTATCGGAGGGGAGACTGGGCTGACAAGCTGCGTGTTCCCCGATGAGCTTCTGACGCAGATCTTGACTGAGCGGATACAGCTGAGCGACTGCTACCAAGGAGTGGTGTTTGATGGCCTTGACACCCTCTTCTCTTGGAGCACGACTGCTGCCCTCCGGTGCCTGCTGAAGGCCATTGGCAGCCGTGAGCACATCTATGTTCTCAACATGGCCCAGGATTTCATGGACATGAAGGCCCAGGAGAAGGCCAGAAAGGAGCAAGAAGAACACAAACACAAGGAAGCACTTGAGAAAGAGAAGAAGCGTCTCCAAAACATGGATGAGGAAGAATATGATGCCTTGACAGAGGAGGAGAAAAGCAGGTTCGACCGGGAGGTTCAGCAGGGGCTCCGGGAGAGGAAGAAGAGGGAGCTGGAGCGGTTGACCAGAGAGATGCAAGAAAAGAAGCTACAGCAGGAGCTTCTGCGACAGAAGGAAGAAGATGAGCTGAAACAAAAGATCAAAAAGCCCAAGCAAGGCCCAGTGAAGGGGGAGCCCCCTGTGAAGAAACCGCAAGCAGCAAACAAGCCGGTCCCTGTATCCACCAAACCCGAGGTCAAGACAGACTTGTTAGAAAGGAAAATTTCTGTTAGGAAGCAAGCAATACCTGAGAAGGAAGAAGCAAGCAAGAAAAAAAAAACCATGGCTGATATCAACATACCTGGGTTTCCTCTTGCCCAGGAGCAAGAGGACAGTGAAGGGGAGTTTCTAAAGGACTCTGCTGACAAGCAACTGAAGTTTAAGGCCTATGAGATGACTCTGAAGGATATCCAGAACCTCCTCACATACTGGGACCGGAAGTTGGGCATTCAGCTGCCTCACCCGGGGATGGAGGAGGTGCCCCATGAGACTGATGACCAGCGCCAGGTTCCTTCTGGTGGGCGTCGGGGCCGCAAGGACCGGGAGAGGGAGCGCCTGGAGAAGGAGCGGGCAGAGAAGGAGCGCCTGGAGAGGGAAAAGGCCGACAGGGAACGCCTGGAGAAGCTGCGGGCCATGGAGGAGCCCAGCGATGCCGAGGGGGAAGCAGAAGAGGATCACAAGGGGAAGAAGGATATGGGAGTGCCCTTTATGAGCATCCAGACTCCAGACTTTGAAGGCTCAAGCTGGAAACAGGCCCTGGAGAGTGATAAGCTTCCCAAAGTAGAGCAGATCCTGGACATCTTGGGCCTGGGGTCCTCTGGCCCACCCATCCCACCTCCTGCCTTGTTCTCCATCGTCTCATATCCTGTGAAGCGGCTACCCGTGATCCCCTCCGAAGTTCTCAAACATTTTGTGTTTGTGGTCCCACCATCTGACAAGCTGGATGAGAAAAAAGAGGTGGAAACAGAATCAGATCGCTCTGCCATCACCCTGTCAGTGAAGGGCCAGGAGGAACAGGCTATCTCATCTAAGTCAAGCAGATTGAAACTGAAAGAAAAACCTGAACCACTCCAGGAGACTCAGAAGGAAAAACGTCGCTCAGCCCTTGGCAAGAAGGTCGTTTCGGGGGGATCTGCTGGACCCATTGCTCCCCTGACAGACATAGACCAGAAGAACTTTGGTGGGCAGCCCTCCCAGGAGAAATTTGTCAGGCTGAATTACTTCCGGTGGATCGTGCCGGCCAATGGAGAAGTGACATTGCGAGTGCACTTCTCTTCTAGTGCTGTCGGGAACTTTGACCAGACATTTAACTTTGAGGTCCTTGGAACTCGTCGCCAATACCAGCTTTATTGCCGAGGTGTCTGCACTTATCCATATATTTGCCAAGACCCAAAAGTGGTGTTTCCTCAGTGGAAGCAGGACATGAAAGTAAATGAGGTCATCTTTAAGAAGTATGTTATGAGCACGAAGAGGTTTTACTTCGGCCCACTGCTTTGTGGAAAGTCAAGAGACAAGTACAAGTCATCCTTATTCCCAGGCAACGTGGAGACACTGACAATCCTGAACAATTCCCCCATGACGGTGGAGGTGTGCTTCTGTTTCCAGAATGATGTCAAAGCAAGCACCTACTTTCTGGAGCCTGTCAACATGACTCTGAAGCCCAATGAGAAGCAGATGCTAAGTGTCTGGGCCTACCCTACTGCAGTTGGCATCTTTGAGGATAGCATTGTCTGCTGCACCAAGGAGAACCCGGAACCAGCTATCTTCAAACTAAGCTGCCAGGGGATCCGCCCAGAACTAGAGCTGGAACCCAGGCAACTACATTTTGATCGGCTCTTGCTGCACAGAAAAGAATCCAAAGTAGTTCTCCTCCGCAATGTCACACCCCTGCCTGTGGCCTGGCGGGTCACCAGTCTGGAGCACCTGGGAGAAGACTTCACATTGTCCATGATGCAGGGTATCATCCCTCCCTCGGCAGAGTACACCCTGCACGTGCACTTCCAGCCCTCCAAACCCGCGAACGTCAAGAAGCCTATTCGGCTGGAGGTTTTAGATGCAGAAAATCTTGTTGGAGTTGTGCAGATTGAAAATATCCTGATCTTTGCAGAATCCTATGACATCGCCCTGGACATCACCTTCCCCAAAGGAGCTGAAGGAACCCTAGACTTTGGGACTGTGAAGGTCATGGAGGATCTGAAGCAGCTCCTTCAACTGAAGAACCGAGGGAAGTACGAGATCATGTTCAGCTTTTCTGTGGACTCTGTAGGAATTTTGCCAACCAATGTCAATTCCATGATCTCAGTCCTACCCCAGAGGGGCTCACTGTCAGCAACAGAAAAGCCCACGAATGTCCAGGTGTTCTTTCGTGCAAAAAAGGAAGTGAAGATTGAGCAGCAGCCCATTTTGTGCTGCCAGATTATTGAGCCCAATCTTGCAGAAGGGGGTGAGATAATTGCCAGCATCCCAATTAAGTTTTCTGTGAATGCAGTGTATTCCAAATTCACCATCAGCCCCTCCTCCATCATCAACTTTGGGGCTTTGATCTGCGGCACTCGCAAGAGCTCTACCATCAGCATAGAAAACCAAGGCGTTACTGACTTCAAGTATGCCCTCTACAGGCTGTCAGGGGACAGCCCCATTCATCAGAAGAAACTAACTGGCCACTTTAGACATGCAAGAGCCCGGGAAAGTGAAAACTTCCTCAAGACTAAATCAGCCAAGTTCTCAGACTCAATTCAGAAAGAAACAAACATCACAAGCCAGGCCCGCTTCTCCCATGGCATGTTCACTGTGTACCCTGGGTCTGGCTCCATCGCTGCCGGAGGACAGCAAGTCATCACCGTGGATTGTATGGCTGACCCAGTGGGAAAGTGTGAGGAGTTTTTAGCCATCGATATCTCTGACCGAGACCCCAGAGAACATCCTGCTGGCATTCCTTATACCTTGCTTGCTGAAGCCTGCCTACCAGCCTTTGTTACTGACAACAAGGCCTCAGTATTTGAGGAGCACCACATCTGCACCAGCCTCAACCTGCACCACATCCTGCAGAGCTCAGAGAATGGGGGGCTGTTTGTGGAGGACGAGAACAAGTTCATCTTCTGCAACATCCTGGTGGGCCATCAGGCCAAGGCTCGGTTCAAGATCAGCAATGTGGGCAAGATTCCCTGTGACGTCAACATTGTCGTTAAGCCCGTCTCCAACAAGGCCTTTGCCCGCATCAATGACATCTTTGAAGTGGAACCTAACAAGATGTGTGTGGCCAGTCGCTCAAATGCCTTTGCCACAGTGTTCTTTACCCCACAGGCCATGCAGACTTACCAGTGTATCTTCGAGGCTACCTTGGATGGCTTGCCCAGCACCCTGGCCAGAAACCGGGGCCTCACGTTTGATATTGTTGGTGAGGGAACCCTCCCTCAAGTGACTATTGTGAGGCCAGTTCTCTATAACCAACATGGAAACCCCTTGCTCCTCTTCAAGAGGCTCTTGCTTGGTCATTCAGAGAAACTGCCTCTCATCCTCAAGAACAATGGCACCATTCCTGCCCAGCTGCATGTGGACCTGCAGGACCAACAAGGAGTCTTCTCCCTGAAAGGGAGGCCAACCACCTCCTACATCTATATCACTGAGGAAAACAAACCAAATGAAAAAGCAGTAAAAGCTCACACAGCTTCCCTGGTTGTTTCTCCTGGAAACACAGCTGAATTTGATGTCTTTTTCCACTCCCAGAAAGTTGGGAGAGTGACAGGCATCATTCGCCTGTCAGTGATCGACAACCGGTATGAGGAGACCCTTATCCACCTGGTGGCAGAGGGCTACAAGGATGACATCACCTTGGACAACATCCACGGGCTGGTGGCTTCCTCCAGCCAAGAGGCCTCAAATATTTCTGATGTCATAGAGGTCACTGAGGAAGACACCATGGATGACTTGCTGGCAGCTGCTCTCATCAACCACATCCAGTTTGGGGACTGCCACATCGGAAACAGCTATAGTGCAAGCTTCACAATTACAAATCACAGCCAAGTGAACGTGATACGGTTTGAATGGCCCCTTTTAGCTACCATTTATTTCTCCCCACAGATGGGCCACCTCCACCCTGGCTGTGCTAAGGACATAGTGGTGACCATGAAGTCAGACACACCCATCAATCTGAAGAAGATGGGGGTCAAGTGTAAGCTCTCCAAGATCATGTTTCAGCTCCCTGCAGATCAGGTCCCTGACTGGGATGACCGCATGCACACAGTCAAGTGGGTGGATGTGCCCAGAAACACACCAGGAACCATCACTACAAAACGAAAGGTGATAGAGACAGATCCTGAGCCTGTCCACTCAATACTAGAAGAAAATTACCGAGAACTACGGATTCAGATCAGTGCCAATGTGGATTTTGCTTCATACCAGTGCCAAAAGAGTGACGTGTGCTTTAAGGAAACCCTGGTTTACCAGACTCGAGTGTTTGAGTTTGACCTGGTTAATTCTGGACATGTACAGCTAAAATTCAACTGGGTCTCAGATGATGCTACAAAGGCAGTCAGCTTTGCCAAGCCAGAAAACCAAGGTTTCCCCCAAAAAGAGCAACTTAGTCAGGTCACGATCAGCACCCTGGACAGCGCCGTGGAACACTGGACTGAGGGTTCCTTATCACCCTTCTCTGTGGAGCCCTCTTCCGGCATCGTGCCTGTGGGGAAGACTCAGAAGCTCAAAGTGAAATTCTCCCCACTGGACACTGGAGACTTTGAGAGCAATCTTTTCTGCCAGATTCCCAACCTACCACCTGGACAGCAAGGTCCTGTCCTGGTAGCAAAAGGGCGGAGCTCCTTGCCCATCTGCCATTTTGACCTGAATGACTCAGACTACATCCGTGAGCATCGGCGCAACCAAGAGCTCCGAGCATCTGGCACAGGGCCTCTGGATCCAAACACCAGGGTGATTGAGTTCAACACTGTGGGCATAGGAGAAAAGAATCTCCAGACTTTTACAATCCTGAACCCAACCAATAGGAGCTACTCCTTCTGCTGGATCTCTGAAGAAAGTGAAAGTCTCCAGAACCCTCCAGCCTTTGCATGCCTTACAGAGAAGGGCTCCATCCACCCTGAAAAGAAAGCTGAGATGGTGTTCCAGTTCTTGCCCTCCCATCTGGACATCACAGAAGCCTTATGGACTTTCTTAATCCCTGAACACAATATCTCAGTCCCCTTCCTGCTGGTGGGTAGAACCACTGACCCTCTCCTCTCTCTGGACAAGTCACACCTCAACTTCAGTTCTCTCCTCATTGGCAGAGAAGCCAGGGAGACTGTGCAGATCATCAACAAGGAGGAGCAGGGCTTCAATTTTGCCTTCCAGGACAACTCTCGTTATTCTGAAGGTTTCAGCAGCAACTTGGTCGTGTGCCCCATGGAAGGCTGTATCCCACCACAGTCCAGGTTCCCTATTGATATTTTCTTCACACCAAAGCAGGAAGGAGATGTGAACTTTAATTTGATCTGCAATGTGAAAAGGAAAGCCCACCCCCTGACCCTAAACGTCAAGGCTGAGGGCTATTCCATGAATGCAGAGGTCAAGTGCAAGGACAGGACTGGCTCCATCACTCTCTTGACACCCAACCAGACCAACATCATCAACTTCTATGAGGTGGAGTTAAATGAATCTGTCCAGTGTGAATTCAGCTTTATAAACACTGGAAAGTTCAACTTCAATTTCCAGGCAGAACTTTCTGGGCCCAAAGCCCTGTTACAGTACTTGGAATTTTCGCCCATTGACAGCACAGTGGATGCAGGACAGAGTGAACAGGCCACTCTGTCTTTCCAGCCATTTCGGAAGAGCGTCTTGAAAGGCGTGGAACTCAGAATCAAGATCAGCTATGGCCCAACATTTATGTGCAGCATCTCAGGCTGTGCTGTGAGTCCAGCTGTCGATTTCTCCTTCACCAGCTACAACTTTGGGACGTGCTTCATCTACCAAGCCGGAATGCCCTCATACAAACAAACTCTGGTCATCACCAACAAAGAAGATACATCCATGAGCATAGATTGTTTGTACACCAACACCAGCTACCTTGAGGTGAGCTTCCATGCCGAAGTGATAAAGCCAGGAAAGACACTGGAGATTCCAATCACCTTTTATCCTCGAGAAAGTATCAACTACCAGGAACTTATCCCCTTTGAAATCAATGGGCTCTCTCAACAAACAGTCAAAATCAAAGGGAAAGGCACTGAAATGAAGATTTCAGTCCTAGATCCAGCCAGTAAGATTGTGAAGTTAGGAGCTGTCCTGCCAGGACAAGTCGTGAAGAAAACTGTCTGCATCATGAACAACAGCCTTGCGCAGCTCACATTTAACCAGTCTGTGCTGTTCTCTACTCCAGAACTCCAGGAACCCAAGGTTCTCACCTTGGTGCCCTTCCAAAACATCACCCTGAAGCCCAAAGAAGTCTGTAAGCTCGAAGTCATCTTCGCCCCAAAGAAGCGCATCCCTCCCTTCTCTGAGGAGGTGTTCATGGAATGCCTGGGCCTCCTGCAGCCCCTCTTCCTCCTCAGTGGCTGCTGCCAGGCTCTGGAGATCTCTTTGGACCAGGATAACCTCCCCTTTGGACCAGTCGTGTTTCAGACACAAGCCACACGCCGCATCCTCATGTTGAACACAGGAGACATGGGGGCAAGGTTCAAATGGGATGTCAAGAAATTCGAGCCTCATTTCTCCATCAGCCCGGATGAGGGTTACATCACCACTGGCATGGAGGTTTCTTTCGAAGTGACCTACCATCCCACGGAGGTGGGAAAGGAGACTTTCTGTAAAAACATTCCCTGCTTCATCCAGGGGGGCAGTCCTCTGAGCCTCACCCTGTCTGGTGTCTGCGTGGGGCCACCTGCTGTAAAAGAGGTGGTGAATTTCAACTGCCAGGTGCGCTGCAAGAACACGCAGACCATTTTGCTGTCAAACCACACCAACCAGACCTGGAATCTGCGCCCCATCTTTGAGGGTGAGCACTGGGAAGGGCCGGAGTTCATCACACTGGAGCCCCATCAGCAAAATAAGCCTTACGAGATCACCTACAGGCCCCGCACCATGAACTTGGAGAACCGCAAGCACCAGGGCACCCTCTTCTTCCCGCTTCCAGATGGAACCGGCTGGCTTTATGCTCTGCATGGGACTGCTGAACTCCCGAAAGCTGTAGCCAATATCTACCGTGAGGTGCCATGTAAGACACCCTACACCGAGCTCCTGTCAATCACCAACTGGCTGAATAAGCCCCAGAGATTCCGGGTCATCATAGAAATGGTGAAACCAGAGAAGGCAGACCTAAGCATCACTATGAAGGGCCTTGATTACATTGACCTGCTCTCGGGCTCCAAGAAAGACTACAAACTGAACTTCTTTTCCCACAAGGAGGGACTCTACACTGCAAAGGTGATCTTCCGAAATGAGGTGACTAATGAGTTCTTGTTCTACACGGTGAGTTTCAAGGTCACCCCTTCGGGCACCATCAAAACCATCAAAATGACAAGCCCAGTGCGGCAGAGCGCATCAGCCTCCATCAAGCTGGAGAACCCCCTGCCCTACTCAGCAACCTTCTCCGCGGAATGCAGGGTGTCTGATATCAGCCTGCCCTCCCAGTTTGCTGTGCCTGCCAACTCTGAGGGCACATTCTCATTTGAATACCAGCCCCTGAAAGCTGGCGAAACCTTAGGAAGACTAACTTTGTACAACAGTGATTTGGGTTACTACCAGTACGAGCTCAATCTGAAGGCTGTGCCAGCACCTCCTGAAAAGCCCATCCACTTCCAGACTGTTCTTGGCAGCAGCCAAAGCATCTTTGCAAAGTTCATCAATTATACACGGCAGAAGACAGAGTACTCCTCCAGGACAGACTGTCCAGATTTTCACACAGAAAAAGTCATCAGTGCACCCCCAGGAGCCCAGGGAGGCACTGAAGTCAGCATGGAAGTCTTCTTTGAACCCAGCCACCTGGGTGAGACCAAGGGCATCCTGACCCTGGCATCACTTCTAGGTGGGGAGTACATCATCCCCCTCTTCGGAATGGCTCTACCCCCCAAGCCCCAGGGACCCTTCGTGATCCGAGCTGGGTACAACATAGTCATCCCCTTCAAGAACATCTTCCTTCACACAGCCAGCTTCTCCTGCACTGTGAATAACCCAGCCTTCACTGTCCGTGCTGCAGACTCTGTGCGGCCCAAGAAGGTCAACAACATCACAGTCTCCTTTGAAGGAAACCCATCCGGCACCAAAACCCCCATCACCACCAAGCTGACTGTGACCTGCCCAACCTGTGAAGGCAGTGAAGCAGGAATTAAATGGGTTTATTACCTGAAGGGCATCACCCCTTAG

XM_004842893.1 Coding sequence

Ftsjd1 FtsJ methyltransferase domain containing 1, transcript variant X1

Length: 2301 bp    Location: 13484046..13475816   Strand: -
>XM_004842893.1
ATGAGCAAGTGCAGAAAGTCACCAGTTCAGCAGTTAGCAAGTCTTGAGACATTCACCCCAAATGTTCTTGATGACATTTTTGAACTCTTTGCCAAGAACTTTTCTTATTGCAAGCCACTTAATAATGAGTGGCAGTTACCAGATCCCAGTGAGATTTTCATCTGTGATCACACAGAACTTAATGCATTTCTTGACTTGAAGAACTCCCTAAATGAAGTAAAAAATCTCCTAAGTGATAAGAAACTGGATGAGTGGCATGAGCACACCGCTTTTACTAATAAAGCAGGAAAAATCATTTCTCATGTGAAAAAATCTGTGAATGCTGAACTTTGTACTCAAGCGTGGTGTAAATTCCATGAGATTTTGTGTAGCTTTCCACTTATTCCACAGGAGGCTTTTCAGAATGGAAAACTGAATTCTCTTCACCTTTGTGAAGCTCCTGGAGCTTTTATAGCTAGTCTCAATCACTACTTAAAATCTCATCAGTTCCCTTGTGAGTGGAGTTGGGTAGCTAATACTCTAAATCCGTACAATGAAGCAAATGATAATCTTATGATGATCATGGATGACCGGCTCATTGCAAATACCTTGCATTGGTGGTACTTCGGTCCAGATAACACTGGTGATATCATGACCCTGGAATATCTGACTGGACTTGAGAATTTCCTAAGTGACATGGCTACCATTCACTTGATCACTGCAGATGGGAGTTTTGATTGCCAAGGAAACCCAGGTGAACAAGAAGCTTTAGTCTCTTCTTTGCATTACTGTGAAGTTGTCACTGCTCTGACTACTCTTGGAAAAGGTGGCTCTTTTGTTCTAAAGATGTTTACTTTGTTTGAACATTGTTCCATAAACCTGATGTACTTGTTAAACTGTTCCTTTGACCAAGTCCATGTTTTCAAACCTGCAACTAGCAAGGCAGGAAACTCAGAAGTCTATGTGGTATGTCTTCGGTATAAGGGAAGAGAAGCCATCCATCCTGTGTTGTCTAAGATGGTGCTGAATTTTGGGACTGAAATGACCAGAAAAGCTCTCTTTCCCCATCATGTGATTCCTGAATCTTTTCTTAAAAGACATGAAGAATGTTGTGCTTTTTTTCATAAGTATCAGTTAGAGACTATTTCTGAGAACATTCGTCTGTTTGAATGCATGGAAAAAGAGGAACAAACAAAGTTGAATAATTTAAGGGATTGTGCAGTACAATATTTTATGCAAAAATTTCAACTGAAGCCTCTTTCCAGAAATAACTGGCTAGTAAAAAAATATAACATTGGTTGTAGTACCAATACAAAGTGGTTTGGACAGAGAAACAGATATTTTAAAACCTATAATGAAAGGAAGATTCTGGAAACCTTATCATGGAAAGATAAAGTAGCTAAAGGGTACTTTAATAGTTGGGCTGAAGAACATTCTGTGCATCATCCTGGACAAAATTCTCTTTTAGAAGGGGCAGCTTCCAATCTTGAATGTGACTTCTGGCGTATTATAGAAGGAAAGAAACTGCCAAAGGTAAAGTGCTCTCCTTTCTGCGATGGTGAAATTTTAAAGGCTCTTAATGAAGCAATTGAGAAGTCCTTAGGAGAAACTTTGAATTTGGATTCCAAGTTTAGGCCACAACAGCAGTATTATTGTTCTTGTCACATTTTTTCAGAAGAACTGTTACTTTCTGAGTTGTTTAGTCTTACCCAGTGCCTTCAGGACAAGCAGATTGTAGAACCCAGCAACCAGATAAAGTGCCTATTTGTGGGTTTACCCACTCTCCATGATGTTAAAGTGCATATGCCATTGGAAGTTCAAATCCTGGAATCTGCTGAACTCATGACTTTTAGCTGTTCATTGCTTCATGATGGAGACCCAAATTACCAGCATTTGTTTTTGGACTGCTTTCTACATTCATTACAGCAGCTTCATACAGGAGATGTTATGATTTTGCCTGTACTTTCTTGTTTAACAAGATTTATGGCTGGCTTGATCTTTATACTCCACAGTTGTTTTAGATTCATCACATTTTCTTGTCCCATGTCTTCTGAGCCCCTGAGGACCTGTGCAGTCCTGCTATGTGTTGGTTATCAGAATCTTCCAAATCCAGTTTTCCAGTATCTGCAGAATATGAATGAATTATTGAGCACTTTGCTTAACTCTGATACACCCCAGCAGGTTTTACAGTTTGTGCCAATGGAGTTGCTCCTTAAAGGGGCACTACTTGATTTTTTGTGGGATTTGAATGCTGCCATTGCTAAAAGGCATTTGCATTTGATTATTCAAGGAGAGAGAGAAGAAATAAGCAACCTAAATTGA

XM_004842890.1 Coding sequence

Il34 interleukin 34, transcript variant X5

Length: 651 bp    Location: 12855872..12867591   Strand: +
>XM_004842890.1
ATGCCCCGGGGACTCGCCTGGCTGCACTATCTTGGGATCCTCCTTGGTGTGGCCTTGGGGACCGAGGGCCTGAAGGTGTGGCCTTTGACTCAGAATAAGGGGTGCACTGCCACTGGCTACCTTCGGGACAAGCTGCAGTACAAGAACCGGCTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGCGTGCCTTATGAGGGGGTGCTCAGAATCGCTAACGTCAGCAGGCTGAGGAGGGCCCGGGTGAGTGAGCAGGAGCTGCGGTACCTGTGGGTCTTGGTGAGTCTCAGCACCACCGAGTCAGTGCAGGACGTGCTGCTAGAGGGCCACCCGTCCTGGAAGTACCTGGAGGAGGTGCAGACGCTGCTGATGAACGTGTATCGGGACCTCAGGGATGTGGAGATCGGCCCCAAGGTGGAAGCCGTGTTGTCGGTCCTCAGCACCCCAGGCCTGAGCCTGAAGCTGGTGAGGCCCAAAGCCCTGATGGACAACTGCTTCCGGGTCATGGAGCTGTTGTACTGCTCTTGCTGTAAACAAAGCCCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGGCTCACAGTCCAGAGCCCTTGTTGCAATGTGCAGCCACCCACTTGTACCCTCCAACCTAG

XM_004842869.1 Coding sequence

LOC101718980 uncharacterized LOC101718980, transcript variant X2

Length: 840 bp    Location: 12527174..12537525   Strand: +
>XM_004842869.1
ATGTGTATGGATCTAGGATTCCTAAAAGTCTCTAACGAGGGTGTAGCTCAGTGGTACAGCGCATGCTTAGCATGCACGAGGCCCCGGGTTCAATCCCTGGCACTTCCAGCGCTGGAGAGGCTTTCTTATGCCCATAGCTTTCCGTGTTTATCTTCCAGGGAACCTGTACAAGGGAGCCAGCTGAGCGAAGCCAAACCAAGCGTAGATTTGGACATGGCTGGGGAGCCCAGGCCGGGCCCTGGCCAGCCAGGACAGAAGAGGCAGCAGGACACAGCCGGCTTCCGAGGCAGCAGCAACTACCACTTGAACTATGAGCTGCACGGAGGAGATGCCCCCTGTAGGGGGTATGGACACCAGAGGATCTCCCCACTCATCAACCAGGTGCCTGGCAAGCTCCAAAGGACTTTCATGGGCCTGGGGGTCAGAAGGAGCTGCAGCCCCTACAAGGCCTCTAGGAGCAGATACCTGCACCCCGAGCAGGCCAAGCGTGAGTTCGGCCACAGCTGCAGTGCTGGGGAGAGGCTGGGTGGCTCAAGCGCAGTGACAGCAGGCCTAGGAGCCCTGGGAGCCATGCTCTTGGCCCTTGTGGCCTCTGCGGGCACCAACCCTGGCCCCTCCCCAGCTGTGAGGACCGAGGAGCTGCGCTCCATCCGGGGGAAGCTGAGCGAGATCAAAGCCCAGGTGGACAGGCTGTTGGAGAGTCTGGAGCACATGGACCAGCGCAGAGCCCAGGCTGCAGGGACAAAGGACAGTGACAAGAACAGGGTCCCTGGTAGTGAGGGCTGCTCACGCCAAACTACTGAGGCCCAACAGGAGCCCAGGGGCCAGCGGGAAGGATAG

XM_004842886.1 Coding sequence

Il34 interleukin 34, transcript variant X1

Length: 735 bp    Location: 12860372..12867591   Strand: +
>XM_004842886.1
ATGAGTACTTGCAACCCAAGAAAATGGGTGACAGTGGGTACAGCTTTGCACCCTGGGGCGGTGGGAACACGGTGCCTGGTGCTCATGTGCTCTTGTTGGGTGTGGTCTGCAGATCTTGGGATCCTCCTTGGTGTGGCCTTGGGGACCGAGGGCCTGAAGGTGTGGCCTTTGACTCAGAATAAGGGGTGCACTGCCACTGGCTACCTTCGGGACAAGCTGCAGTACAAGAACCGGCTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGCGTGCCTTATGAGGGGGTGCTCAGAATCGCTAACGTCAGCAGGCTGAGGAGGGCCCGGGTGAGTGAGCAGGAGCTGCGGTACCTGTGGGTCTTGGTGAGTCTCAGCACCACCGAGTCAGTGCAGGACGTGCTGCTAGAGGGCCACCCGTCCTGGAAGTACCTGGAGGAGGTGCAGACGCTGCTGATGAACGTGTATCGGGACCTCAGGGATGTGGAGATCGGCCCCAAGGTGGAAGCCGTGTTGTCGGTCCTCAGCACCCCAGGCCTGAGCCTGAAGCTGGTGAGGCCCAAAGCCCTGATGGACAACTGCTTCCGGGTCATGGAGCTGTTGTACTGCTCTTGCTGTAAACAAAGCCCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGGCTCACAGTCCAGAGCCCTTGTTGCAATGTGCAGCCACCCACTTGTACCCTCCAACCTAG

XM_004842884.1 Coding sequence

Mtss1l metastasis suppressor 1-like, transcript variant X1

Length: 2244 bp    Location: 12887578..12868203   Strand: -
>XM_004842884.1
ATGGAGACGGCGGAGAAGGAGTGCGGCGCCCTGGGCGGGCTCTTCCAGGCCATCGTCAATGACATGAAGAGCTCCTACCCCATCTGGGAGGACTTCAACTCCAAGGCCACGAAGCTACATTCTCAGTTGAGGACCACTGTGCTGGCTGCTGTGGCCTTCCTGGATGCCTTCCAGAAAGTGGCTGACATGGCCACCAACACCCGAGGGGCCACGCGGGACATCGGCTCGGCGCTCACGCGCATGTGCATGCGCCACCGCAGCATCGAGACCAAGCTGCGGCAGTTCACCAACGCGCTGCTGGAGAGCCTCATCAACCCGCTGCAGGAGCGCATCGAGGACTGGAAAAAGTCGGCCAACCAGCTGGACAAGGACCACGCGAAAGAGTACAAACGAGCCCGGCACGAGATCAAGAAGAAGTCCTCAGACACGCTGAAGCTGCAGAAGAAAGCACGCAAAGAGCTACTTGGGAAAGGAGACCTGCAGCCCCAGCTGGACAGTGCCCTGCAGGACGTCAACGACATGTACCTGCTGCTGGAGGAGACGGAGAAACAGGCAGTGCGCCGGGCCCTCATCGAGGAGCGAGGCCGCTTCTGCACCTTCATCACCTTCCTGCAGCCTGTGGTGAACGGTGAGCTGACCATGCTGGGAGAGATCACCCACCTGCAGGGCATCATTGACGACCTGGTGGTGCTGACCGCGGAACCCCACAAGCTGCCTCCCGCCAGCGAGCAGGTGATCAAAGACCTGAAGGGCTCAGACTACAGCTGGTCCTACCAGACCCCACCCTCTTCACCTAGCAGCTCCAGCTCCCGGAAGTCCAGCATGTGCAGTGCCCCCAGCAGCAGTAGCAGTGCCAAGGGTGGCGGAGCCCCGTGGCCTGGGGGTGCCCAAACATACTCACCCAGTTCCACCTGTCGCTACCGCAGCCTGGCGCAGCCAGCCACCGCCACCACCCGCCTCTCCAGCGTGTCCTCCCACGACTCTGGCTTCGTCTCCCAGGATGCCACCTACTCCAAGCCCCCCTCGCCCATGCCTTCAGACATCACCAGCCAGAAGTCCTCCAGCTCTGCATCCTCTGAGGCTTCGGAAACCTGCCAGTCTGTTAGCGAGTGCAGCTCCCCCACCTCGGACTGGACCAAGGCCGGCCCCCATGAGCAGCCCACAGGCACCACCCTGCAGCGGAGGAAGGACCGAGTGGAGCTCCTCCGAGACACAGAGCCAGGATCTGCTAGCACAGGCCCCCTGGGCCCCACTGGGGAGGAGGCACCTCGACCCCGGATGTCCCCTGCCACCATTGCAGCCAAGCATGGCGAGGAGGTGTCGCCCGCCGCCAGCGACCTGGCCATGGTGCTGACCCGAGGCCTGAGCCTGGAGCACCAGAAGAGCAGCCGGGACTCACTGCAGTACTCCAGTGGCTATAGCACACAGACCACCACGCCCTCCTGCTCTGAGGACACCATCCCCTCCCAAGGCTCTGACTACGACTGCTACTCTGTGAACGGTGATGCAGACAGCGAGGGGCCCCAGGAGTTTGACAAGTCGTCCACCATCCCGCGCAACAGCAACATCGCCCAGAACTACCGCCGCCTCCTCCAGACCAAGCGCCCGGCCTCCACTGCTGGGCTGCCCACAGCCACAGGCCTGCCCTCGGGTGCACCCCCTGGTGTGGCCACCATCCGCCGCACGCCCTCCACCAAGCCCACCGTGCGCCGCGCCCTGTCCAGCGCTGGCCCCATCCCCATCCGGCCACCCATCGTCCCCGTGAAGACGCCCACGGTGCCCGATTCCCCCGGCTACATGGGGCCCACGAGGGTGGGCAGCGAGGAGTGTGTCTTCTACACAGATGAGGCCGCCTCACCCCTGGCCCCGGACCTCGCCAAGGCCTCCCCGAAAAGGCTGAGCCTGCCCAACACCGCCTGGGGCAGCCCATCCCCCGAGGCAGCCAGCTACCCTGGGCCAGGGACCAGGCTGGCAGCGGAGGACGAGGAGGAGCAGCAGCTGGCCGCCAACAGGCACAGCCTGGTGGAGAAGCTTGGGGAGCTGGTGGCCGGGGCCCACGCCCTGGGCGAGGGCCAGTTCCCCTTCCCCACCGCCCTGTCGGCCACCCCCACCGAGGAGACGCCCACCCCACCCCCTGCTGCCACCAGTGACCCCCCAGCAGAAGACATGCTGGTAGCCATCCGGCGCGGGGTCCGGCTCCGCAGGACCGTCACCAACGACAGGTCGGCACCCCGCATCTTATGA

XM_004842882.1 Coding sequence

Cog4 component of oligomeric golgi complex 4, transcript variant X2

Length: 2292 bp    Location: 12747106..12715437   Strand: -
>XM_004842882.1
ATGGGGGACCTCGAGTCATCTCAGAAGTTATCGGGGGTCTCTCGCCCAGCAGAGGGGGTGGGAGGAGGCAGCTGCACCGAAATCTCTACCGAGCTCATTCGTTCCCTGACAGAGCTGCAGGAGCTGGAAGCTGTGTACGAACGGCTCTGCGGCGAGGAGAAAGTGGTGGAAAGAGAGCTAGATGCTCTTTTGGAACAACAAAACACCATTGAAAGTAAGATGGTCACTCTCCACCGAATGGGGCCCAATCTGCAGTTGATTGAGGGAGATGCAAAGCAGCTGGCTGGAATGATCACCTTCACCTGCAACCTAGCTGAGAATGTGTCCAGCAAAGTCCGTCAGCTTGACTTGGCCAAGAACCGTCTCTATCAGGCCATCCAAAGGGCTGATGACATCTTGGACCTGAAGTTCTGCATGGATGGGGTTCGGAGTGCGCTGAGGAGTGAAGATTATGAGCAGGCCGCAGCCCACATTCATCGCTACCTGTGCCTAGACAAGTCAGTCATCGAGCTCAGCCGACAGGGCCAGGAAGGGAGCATGATTGATGCCAACCTAAAATTGCTGCAAGAAGCTGAGCAGCGTCTCAAAGCCATTGTAGCAGAGAAGTTTGCCATCGCCACCAAGGAAGGAGATTTGCCCCAGGTGGAGCGCTTCTTCAAGATCTTCCCATTGCTGGGTTTACATGAAGAGGGATTAAGCAAGTTCTCTGAATACCTTTGTAAGCAGGTGGCCAGTAAAGCTGAGGAGAACCTCCTCCTGGTGCTGAGGTCAGACATGAGTGACAGACGAGCTGCAGTCATCTTCGCAGACACACTCACTCTCCTGTTTGAAGGGATTGCCCGCATCGTGGAGACCCACCAACCCATTGTGGAGACTTACTATGGACTGGGAAGGCTTTATACCCTGATCAAATATCTTCAGGTGGAGTGTGACAGACAGGTGGAGAAGGTGGTGGACAAGTTCACCAAGCAGAGGGACTACCAGCAGCAGTTCCGGCTTGTCCAGAATAACTTGAGAAATTCTGCACCAGAAAAAATCGAACCAAGGGAGCTGGACCCCATCCTGACTGAGGTCACCCTGATGAATGCCCGTAGTGAGCTGTACTTACGCTTCCTCAGGAAAAGGATCAGCTCAGATTTTGAGGTGGGAGACTCCATGGCCTCAGAAGAAGTAAAGCAAGAGCACCAGAAGTGCCTGGACAAACTCCTCAATAACTGCCTGTTGAGCTGTACCATGCAGGAGCTAATTGGCTACTATATTACCATGGAGGAGTACTTCATGAGGGAGACTGTCAATAAGGCTGTGGCTCTGGACACCTATGAGAAGGGCCAGTTGACGTCTAGCATGGTGGATGATGTCTTCTACATTGTGAAGAAGTGCATCGGGCGGGCTCTGTCCAGCTCCAACATTGACTGTCTCTGCGCCATGATCAACCTCGCCACCAGAGAGCTGGAGGCTGATTTCAGGGGCGTTCTGTCCAACAAGCTGAGGATGGGCTTCCCGGCCACCACCTTACAGGACATCCAGCGCGGGGTGACCAGTGCTGTGAACATCATGCACAGCAGCCTCCAGCAGGGCAAATTTGACACAAAAGGCATTGAGAGCACTGATGAGGCCAAGCTGTCCTTCCTGAGTGACTGCACCAAACTATTCAGCCAGGGCATTGGAGGGGAGCAGGCCCAAGCCAAGTTTGATAGCTGCCTTTCTGATTTGGCTGCTGTGTCCAACAAATTCCGAGACCTCCTGCAGGAAGGGCTGGCGGAGCTCAGCAGCACAGCAGTGAAGCCGCAGGTGCAGCCATGGATCAACACCTTTCTCTCCGTCTCGCACAACATAGAGGAGGAAGAATTCAATGACTATGAGGCCAATGACCCTTGGGTACAACAGTTCATCCTTAACCTGGAGCAGCAAATGTCAGAGTTCAAGGCCAGCCTGTCCCCAGTCATCTATGACAGCCTGACCAGCCTCCTGACCAGCCTTGTTGCTGTCGAATTAGAGAAAGTGGTGCTGAAATCCTCCTTCAACCGGCTGGGCGGGCTGCAGTTTGACAAGGAGCTGAGGTCGCTCATTGCCTACCTTACCACGGTGACCACCTGGACCATCCGAGACAAGTTTGCCCGGCTTTCCCAGATGGCCACAATCCTGAATCTGGAGCGGGTGACTGAGATCCTAGATTACTGGGGTGCCAACTCCGGTCCACTGACCTGGCGCCTCACCCCTGCTGAAGTACGCCAGGTGCTGGCTCTGCGCATAGATTTCCGGCATGAGGACATCAAGCGGCTGCGCCTATAG

XM_004842880.1 Coding sequence

Fuk fucokinase, transcript variant X2

Length: 3189 bp    Location: 12694871..12715173   Strand: +
>XM_004842880.1
ATGGGGCAGCTGGAGGGGGTCGATTGGACAGTTATCATCCTGACTTGCCAGTATAAGGACAGTGTCCAGGCCTTTCAGAGAGAGCTCGAGGTGCGGCAGAAGCGGGAGCAGATCCCCACCGGGACACTCTTACTGGCTGTTGAGGACCCTGAAGTGCGTGTGGGCAGTGGAGGAGCCACCCTCAACGCGCTGCTGGTGGCTGCTGAACACCTGAGTGCCCGTGCAGGCTTCACTGGCCGAGACTTTCCCTTTGATGACTGTGGCCGGGCCTTTACCTGCCTCCCTGTAGAGAACCCCCAGGCCCCTGTGGAGGCCTTGGTCTGCAACCTGGACTGCTTACTGGATGTGATGACCCACCGGCTGGGCCCAGGCTCCCCTCCAGGCATGTGGGTCTGCAGCACCGACATGCTGCTGTCTGTTCCTGCAAACCCTGGGATCAACTGGAACGGCTTCCGGGGAGCCAGAGTGATTGCCCTTCCTGGGAGCCCAGCCTACGCACTGAATCATGGCATCTACCTCACAGACTCCCAGGGCTTCGTTTTGGACATTTACTACCAAGGCACTGAAGCAGAGATACAGCGGTGTGTCGGACCTGATGGGCAGGTGCCACTGGTCTCCGGGGTTGTCTTCTTCTCTGTGGAGACTGCCGAGCACCTCCTGGCCACCCATGTGAGCCCACCTCTGGATGCCTGCACCTATATGGGCCTGGACTCTGGAGCCCGGCCTGTCCAGCTGTCTCTGTTTTTCGACATCCTGCTCTGCATGGCGCGGAACACAAGCAGAGAGGTCTTCCTGGCTGGGCGGCCCCCAGAGATGGGGCAAGGTGACATGGATGTAGCAGGTTATTTGCAGGGTGCCCGGGCCCAGTTGTGGAGGGAGCTTCGAGATCAGCCGCTCACCATGGCGTATGTCCCTGACGGCAGCTACAGCTACATGACCTCCTCAGCCAGTGAGTTCCTGCACAACTTCACGCTGCCAGGGGTCCCCAGGGTGCAGATCATCCACTCCCAGGTGGAGGAGCAGCAGCTCCTGGAGACTGGGAGCTCTGTGGTCGGTTGCCTGCTGGAGGGTGCCGTCCACCTGGGGCCAGGGAGTGTCATACAACACTGCCACCTGCAGGGCCCCATTCATATCGGCTCTGGCTGCTTCGTGAGTAACCTAGACACAGCTCAGTCTGAGGCGCTGCGTGGCCTGGAGCTGCAAGATCTTGTCCTGCAGGGACACCATGTGCAGCTGCCTGGCTCTCTGGGCCGTGCCTTCACCCTCGTTGGTCGTCTGGACACCTGGGAAAGACAGGGGGCAGGCACATATCTCAACATGTCCTGGAGTGAATTCTTCAAGAAGACTGGCATCCGAGACTGGGACCTGTGGGACCCAGACACGTCCCCCACAGAGCGTCACCTTCTCAACGCCCGCCTCTTTCCTGTGCTCCACCCGTCGAGGGCCCCAGGGCCCCAGGACATGCTGTGGATGCTGGACCCCCGGGAGGATGGAGGCAGGGCTTTGCGGGCCTGGCGAGCCTCCTGGCGCCTATCCTGGGAGCAGCTGCAGCCCCACCTGGACCGGGCTGCCACACTGGCCTCCCGCCGGGGCCTGTTCTTCCTGCAGGCCGTGCAGAAGGCGAGGCATGTGTTGGAAACCCGGCAGGACCTTAGCCTGCGCCCCTTGATCTGGGCTGCTGTCCACGAGGGCTGTCCTGGGCCCCTGCTGGCCATGCTGGACCAGGTTGCAGCGGGGGCCAGAGACCCTGGTGTGGCAGCTCGGGCTCTGGCCTGTGTGGCAGACGTACTGGGCTGCATGGCAGAGGGCCAGGGAGGCTTACGGAGCGGGCCAGCTGCCAACCCTGAGTGGGTGCGGCCCTTCTCATTCCTGGAGTGTGGAGACCTAGCAGGGGGCGTGAAGGCACTTGCCCAGGAGAGGGACAAGTGGCTGAGCAGGCCAGCCTTGCTGGTGCGAGCTGCTCGCCACTATGAGGGAGCTGGGCAGATCCTGATCCGCCAGGCTGTGATGACAGCCCAGCACTTTGTTTCCACGGAGCCGGTACAGTTTCCGGCACCTGGGCAGTGGGTGGTGGCCGAGTGTCCAGCCCGTGTGGATTTCTCTGGGGGCTGGAGTGACACACCACCTCTTGCCTATGAGCTTGGTGGGGCAGTGCTGGGCCTGGCTGTGCGAGTGGATGGCCGCCGGCCCATCGGGGCCAGGGCACGCTGTATCCTGGAGCCTGAGCTGTGGCTGGCGGTGGGGTCTCGGCAGGATGAGAAGGCCCTGAAGATAGTGTGCCGGAGTCTGGAGGACCTGCAGGATTACTGCCAGCCCCATGCATCAGGGGCCCTGCTGAAGGCGGCCTTTATCTGTTCGGGGATTGTAGACGTCCGTTCTGAGCTCCCGCTGCGCCAACAGCTGCTGCAGACCTTTGGGGGTGGCTTTGAGCTGCACACGTGGTCTGAGCTCCCCCATGGCTCCGGTCTTGGGACTAGCAGCATCCTGGCTGGTGCTGCCCTGGCTGCTGTGCAGCGGGCTGCAGGCTGGGCTATGAGCACAGAGGCCCTGATCCATGCAGTGCTGCACCTGGAACAGGTGCTCACCACAGGAGGTGGCTGGCAGGACCAGGTGGGTGGCCTGATGCCTGGCATCAAGGTGGGGCGCTCCCGGGCCCAGCTTCCACTGAAGGTGGAGGTGGAAGAGATCACTGTGCCTGAAGGCTTTGTCCAGAAGCTCAATGAGCACCTGCTCCTGGTGTACACTGGCAAGACCCGTCTGGCACGGAATTTGCTGCAGGATGTGCTAAGGAGCTGGTATGCCCGGCTGCCTGTCGTGGTGCACAGTGCTCATAGCCTGGTGCGGCAGACTGAGGAGTGCACTGAAGCCTTCCGCCAAGGAAGCCTGCCTCTCCTGGGCCTGTACCTGACCTCGTACTGGGAGCAGAAGAAGCTCATGGCTCCAGGTTGTGAGCCCCTGGCTGTGCGGCGGATGATGGATGTCCTGGCTCCCTATGTGCATGGCCAGAGCCTGGCAGGAGCAGGTGGCGGGGGCTTTCTCTATCTGTTGACTAAGGAACCACGGCAAAAGGAAGTTGTGGAGGCTGTGCTGGCCAAGACTGAGGGCCTTGGCAACTACAGCATCCATCTGGTGGAAGTGGACATTCAGGGCCTGAGCCTGCGGCTGGTGGGGAGTGAGAGCTCCACCTGA

XM_004842870.1 Coding sequence

LOC101718980 uncharacterized LOC101718980, transcript variant X3

Length: 831 bp    Location: 12527174..12537525   Strand: +
>XM_004842870.1
ATGTGTATGGATCTAGGATTCCTAAAAGTCTCTAACGAGGGTGTAGCTCAGTGGTACAGCGCATGCTTAGCATGCACGAGGCCCCGGGTTCAATCCCTGGCACTTCCAGCGCTGGAGAGGCTTTCTTATGCCCATAGCTTTCCGTGTTTATCTTCCAGGGAACCTGTACAAGGGAGCCAGCTGAGCGAAGCCAAACCAAGCGTAGATTTGGACATGGCTGGGGAGCCCAGGCCGGGCCCTGGCCAGCCAGGACAGAAGAGGCAGCAGGACACAGCCGGCTTCCGGGGGTATGGACACCAGAGGATCTCCCCACTCATCAACCAGGTGCCTGGCAAGCTCCAAAGGACTTTCATGGGCCTGGGGGTCAGAAGGAGCTGCAGCCCCTACAAGGCCTCTAGGAGCAGATACCTGCACCCCGAGCAGGCCAAGCGTGAGTTCGGCCACAGCTGCAGTGCTGGGGAGAGGCTGGGTGGCTCAAGCGCAGTGACAGCAGGCCTAGGAGCCCTGGGAGCCATGCTCTTGGCCCTTGTGGCCTCTGCGGGCACCAACCCTGGCCCCTCCCCAGCTGTGAGGACCGAGGAGCTGCGCTCCATCCGGGGGAAGCTGAGCGAGATCAAAGCCCAGGTGGACAGGCTGTTGGAGAGTCTGGAGCACATGGACCAGCGCAGAGCCCAGGCTGCAGGTCAGGCACCAAAGGGACAAAGGACAGTGACAAGAACAGGGTCCCTGGTAGTGAGGGCTGCTCACGCCAAACTACTGAGGCCCAACAGGAGCCCAGGGGCCAGCGGGAAGGATAGCCACAGAGCAGGCGGTGCAGAACCAAGCATCTGA

XM_004842858.1 Coding sequence

Pdpr pyruvate dehydrogenase phosphatase regulatory subunit, transcript variant X2

Length: 2454 bp    Location: 12492966..12423910   Strand: -
>XM_004842858.1
ATGTTTCACCGGTTCCTGTCGATTATCCGAAGACAAAGAACCAGCCCAAGATGCCAGAACTGGTGCTTGGCAAGAAGCAGTGCGTCGGCTGCCGAGGCCCATTCTGTCACCCTGCCTGCCCAGGCCCAGGTGGTCATCTGTGGGGGTGGAATCATGGGCACATCCGTGGCCTATCACCTCTCCAGGATGGGGTGGAAGGACATCGTTCTTTTGGAGCAGGGCAGGCTGGCCGCTGGCTCTACCAGGTTCTGTGCTGGCATCCTGAGCACTGCCAGGCACTTGACCATCGAGCAGAAGATGGCCGACTATTCAAACAAACTCTACGAACAGCTAGAGCAAGAAACAGGGATCCAAACAGGTTACATAAGGACAGGCTCGGTCTTTCTGGCCCAAACACAGGACCGGCTGATCTCCTTGAAGCGCATCAACTCAAGACTGAATGTTATAGGCATCCCTTCTGAGATCATCTCCCCCAAGAAGGTGGCTGAACTGCACCCTTTCCTCAACGTGCACGACCTGGTGGGGGCCATGCACGTTCCTGAGGATGCGGTGGTATCCTCCGCCGATGTGGCCCTGGCCCTGGCAAGTGCTGCCTCCCAGAATGGTGTTCAGATTTATGACCGAACAAGTGTTCTTCATGTAATGGTCAAAAAAGGTCAAGTTACTGGTGTGGAGACAGATAAAGGACAGATTGAGTGCCAGTATTTTGTCAACTGTGCTGGTCAGTGGGCATACGAGCTGGGTCTGTCCAACGAGGAGCCGGTTAGTATCCCGTTACATGCCTGTGAACACTTCTACCTTCTGACTCGCCCCTTGGAGACCCCTCTGCAGAACAACACACCAACTATCGTGGACCCTGATGGAAGAATTTATATTCGGAACTGGCAGGGTGGCATCTTGTCTGGGGGCTTTGAGAAGAACCCGAAACCTATTTTTACCGAGGGCAAGAACCAGCTGGAAATTCAGAATCTGCAGGAAGACTGGGATCACTTTGAGCCCCTACTGAGTTCCCTCCTGCGTCGGATGCCAGAACTGGAGATGCTGGAGATCCTGAAGCTGGTGAACTGTCCCGAGACCTTCACGCCAGACATGAGGTGCATCATGGGCGAGTCCCCTGTGGTCCGTGGCTACTTTGTCCTGGCAGGGATGAACTCGGCCGGCCTGTCCTTTGGTGGAGGGGCTGGGAAGTACCTTGCTGAATGGATAGTACATGGTTATCCTTCAGAAAACGTCTGGGAATTGGACTTGAAACGCTTTGGAGCCCTCCAGAGCAGCCGTACCTTTCTGCGCCACCGGGTCATGGAAGTCATGCCTTTGATATACGACCTGAAGGTTCCCCGTTGGGACTTCCAGACTGGTAGGCAGCTGCGTACTTCTCCGCTGTATGACCGGCTGGATGCACAAGGGGCCAGATGGATGGAGAAACATGGATTTGAGAGGCCAAAGTACTTTGTTCCACCTGACAAGGACCTCCTCGCGTTGGAGCAGAGCAAGACTTTCTATAAGCCAGACTGGTTTGACATTGTGGAGTCTGAAGTCAAGTGCTGTAAGGAGGCAGTGTGTGTTATCGACATGTCCTCCTTCACAAAGTTTGAGATAACATCCACTGGGGACCAGGCTTTAGAAGTTCTGCAGTTCCTCTTCTCCAACGACCTGGACGTGCCCGTGGGCCACATCGTGCACACAGGCATGCTCAACGAGGCTGGGGGCTATGAGAACGATTGCAGCATCGCACGCCTGAGCAAGCGCAGTTTCTTCATGATCTCTCCAACCGACCAACAGGTCCACTGCTGGGCCTGGCTCAGGAAGCACATGCCCGAGGACAGCAGCCTGGTGCTGGAGGATGTCACCTGGAAGTACACAGCCCTCAACCTGATTGGCCCGCGAGCTGTGGATGTGCTGTCTGAACTGTCCTACGCCCCTATGACTCCAGACCACTTCCCGACTCTGTTTTGCAAGGAGATGAGCGTGGGCTACGCAAACGGGATCCGGGTGATGAGCATGACCCACACCGGAGAGCCAGGTTTCATGCTGTACATCCCCATCGAGGGCATGGACTTCATGGGCCAGGATGCCCTGCTGCAGCAGAAGCAGAACGGGGTATACAGGCGCTTCACCCTGTTCATCCTGGAAGACCACGACACGGACCTGGACCTCTGGCCGTGGTGGGGGGAGCCTATTTACCGGAACGGCCAGTACGTTGGCCAGACCACCAGCAGTGCCTACAGCTACACTCTGGAGCGCCATGTGTGCCTGGGCTTCGTGCACAACTTTTCCGAGGACACTGGGGAGGAGCAGGTGGTCACAGCAGATTTTGTCAACCGGGGAGAATACGAGATCGACATCGCGGGCTGCCGATTCCAGGCCAAGGCCAAACTCTACCCTGTTGCCTCCTTCTTTACACACAAGCGCCGAAAGGATGATGTGGAGCTAAGTGACTTGCATGGGAAGTAA

XM_004842874.1 Coding sequence

Ddx19b DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B, transcript variant X2

Length: 1404 bp    Location: 12572318..12587821   Strand: +
>XM_004842874.1
ATGGCCACTGACTCATGGGCTCTAGCGGTGGACGAGCAAGAAGCGGCGGCTGAGTCGTTGAGCAACTTGCATCTAAAGGAAGAGAAAATCAAACCAGATGCCAATGGTGCTGTTGTCAAGACCAATGCTAATGAAGAGAAGACAGATGAAGAAGAGAAAGAGGACAGAGCTGCCCAGTCTTTACTCAACAAGCTGATCAGAAGCAACCTTGTGGATAACACAAACCAAGTGGAAGTGTTGCAGCGGGACCCCAGCTCCCCTCTCTACTCCGTGAAGTCTTTTGAAGAGCTCCACCTAAAACCACAGCTTCTCCAGGGAGTCTATGCCATGGGTTTCAACCGTCCATCCAAAATACAAGAGAACGCATTGCCTTTGATGCTTGCTGAACCTTCACAGAATTTAATTGCCCAGTCTCAATCTGGTACTGGCAAAACAGCTGCCTTTGTGTTGGCCATGCTAAGCCAAGTAGAACCTGCAAACAGATACCCCCAGTGTCTGTGCCTCTCCCCGACGTATGAGCTCGCTCTGCAAACAGGAAAAGTGATTGAACAGATGGGTAAATTTTACCCTGAATTGAAGCTGGCTTATGCTGTTCGAGGCAATAAATTGGAAAGAGGTCAGAAGATCAGTGAGCAGATTGTCATCGGCACCCCCGGGACCGTCCTGGACTGGTGCTCCAAGCTCAAGTTCGTTGACCCCAAGAAGATCAAGGTGTTTGTGCTGGATGAAGCCGACGTGATGATAGCTACTCAGGGCCACCAGGATCAGAGCATCCGCATTCAGAGGATGCTGCCCAGGAACTGCCAGATGCTGCTTTTCTCTGCTACCTTCGAAGACTCTGTGTGGCAGTTTGCCCAGAAAGTGGTCCCAGACCCCAACATCATCAAACTGAAGCGCGAGGAGGAGACCCTGGACACCATCAAGCAGTATTACGTCCTGTGCAGCAACAGAGATGAGAAGTTCCAGGCTCTGTGCAACCTCTATGGGGCCATCACCATCGCTCAGGCCATGATTTTCTGCCATACCCGCAAAACAGCTAGTTGGCTGGCGGCAGAGCTCTCGAAAGAAGGCCACCAGGTGGCTCTGCTGAGTGGCGAGATGATGGTGGAGCAGAGGGCTGCAGTGATTGAGCGCTTCCGCGAGGGCAAAGAGAAGGTTCTGGTGACCACCAATGTGTGCGCCCGAGGTATTGATGTTGAGCAAGTGTCTGTGGTCATCAACTTTGATCTCCCTGTGGACAAGGACAGGAACCCGGACAACGAGACCTACCTGCACCGGATCGGGCGCACCGGCCGCTTTGGCAAGAGGGGCCTGGCCGTGAACATGGTGGACAGCAAGCACAGCATGAACATCCTCAACAGGATCCAGGAGCATTTTAAAGATAGAAAGATTGGACACAGATGA

XM_004842862.1 Coding sequence

Clec18c C-type lectin domain family 18, member C, transcript variant X3

Length: 1137 bp    Location: 12514478..12525139   Strand: +
>XM_004842862.1
ATGCGGAGAATGGACTGGAATGAGAGCCTGGCTCAGCTGGCTCAAGCCAGGGCAGCCCTCTGTGGCATGCCAGCCCCAGACCTGGTCCCTGCCCCACGGCGCACCCCGCAAATGGGCTGGAACATACAGCTGCTGCCCATAGGCTCGGCGTCCTTTGCTGGAGTGGTCAACCTCTGGTTCGCAGAGGGGCAGTGGTACAGCCACGAGGCAGCTGAGTGTGCCCATAATGCCACCTGCATCCACTACACTCAGCTTGTGTGGGCCACTTCGAGCCAGCTGGGCTGTGGGCGGCATCTGTGCTCCGTGGGCCAGGCAGCGATGGAAGCCTTTGCCTGTGCCTACTCCCCAGGAGGCAACTGGGAGGTAAACAGGAAGACAATTGTCCCTTATAAGAAGGGTGCCTGGTGTTCACTCTGCACAGCCAGTGTCTCGGGCTGCTTCAAGGCCTGGGACCACGCAGGGGGGCTCTGTGAGGTCCCCAGGAACCCATGTCGCATCAGCTGCCGGAACCATGGACATCTCAACATTAGCACCTGCCACTGCCACTGTCCACCTGGCTACACAGGCAGATACTGCCAAGTCCGGTGCAGCGTGGAGTGTGTACATGGCCACTTCCGGGAAGAGGAGTGCTCTTGTGTCTGCAATGTCGGCTACGGGGGAGCCCAGTGTGCCACCAAGGTGCGCTTTCCTTTCCACACCTGTGACCTGAGGATCGATGGGGACTGTTTCACCGTGTCTTCGGAGGCAGACACCTATTACGGAGCCAAGATGAAATGCCAGGGAAAGGGCGGGGTGCTAGCCCAGATTGAGAGCCAGAAAGTGCAGGACATCCTCGCCTTCTATCTGGGCCGCCTGGAGACTACCAACGAGGTGACTGACAGCGACTTTGAGACCAGGAACTTCTGGATTGGGCTCACCTACAAGATGGCAAAGGACTCCTTCCGCTGGACCACTGGGGAGCACCAGTCCTTCACCAGTTTTGCCTTCGGTCAGCCTGACAATCAGGGGTTTGGCAACTGTGTGGAACTGCAGGCATCATCTGCCTTCAACTGGAATGACCAACGCTGTAAAACCCGAAACCGTTACATCTGCCAGTTTGCTCAAGAGCACATTTCCCGGTGGGACCCAAGGCCCTGA

XM_004842867.1 Coding sequence

Exosc6 exosome component 6

Length: 819 bp    Location: 12539645..12538315   Strand: -
>XM_004842867.1
ATGCCCGGGGATCACCGCCGCATCCGCGGGCCAGAGGAGTCGCAGCCCCCGCAGTTGTACGCAACTGACGAGGACGAGGCGCCCGCCGCCCGCGATCCGGTTCGGTTGCGGCCCGTGTACGCGCGCGCCGGGCTGCTGACCCAGGCTAAGGGTTCGGCCTACCTGGAGGCCGGAGACACCAAGGTGCTGTGCGCCGTATCAGGCCCGCGCCAGGCGGAGGGCGGCGAGCGCGGCAGCGGCCCTGCGGGAGCGGGTGGCGAGGCTCCCGCCGCACTGCGCGGCCGCCTGGTCTGCGAGTTCCGCCGCGCGCCCTTCTCGGGCCGCCGGCGCCGCGCTCCCCAGGGTGGCAGCGAGGAACGCGAGCTGGCGCTAGCGCTGCAGGAGGCGCTGGAGCCGGCCGTGCGCCTGGGCCGCTACCCGCGCGCGCAGCTCGAGGTGTCGGCGCTGCTGCTGGAAGACGGCGGCTCGGCTCTGGCTGCCGCGCTCACTGCCGCCGCCCTCGCCCTGGCCGACGCGGGAGTTGAGATGTATGACCTGGTGGTGGGCTGCGGCCTGGGTCTCACACCAGGGCCGGCGCCCATCTGGCTGCTGGACCCCACCCGGCTCGAGGAGGAGCGCGCCGCTGCAGGCCTCACGGTGGCGCTCATGCCCGTGCTCAATCAGGTCGCCGGGCTGCTGGGCAGCGGCGAGGGGGGCCAGATCGAGAGCTGGGCGGAGGCCGTGCGCCTGGGCCTCGAGGGCTGCCAGCGCCTCTACCCGGTGCTGCAGCAGTGCCTGGTGCGCGCAGCTCGTCGAAGGGGCGCCGCCGCCCCGCCCTGA

XM_004842864.1 Coding sequence

Aars alanyl-tRNA synthetase, transcript variant X1

Length: 2934 bp    Location: 12566930..12541512   Strand: -
>XM_004842864.1
ATGAATTCAACCCTAACAGCAAGTGAAATCCGGGAGCGATTTATAGATTTCTTCAAAAGAAATGAGCACACCTATGTTCACTCATCTGCCACCATCCCATTGGATGACCCAACTTTACTCTTTGCCAATGCAGGCATGAACCAGTTCAAACCCATCTTCCTGAACACAATTGACCCATCCCACCCTTTGGCAAAGCTGAGCAGAGCTGCCAACACACAGAAATGCATCCGGGCTGGGGGCAAGCACAATGACCTGGACGACGTGGGCAAAGATGTTTACCACCACACCTTTTTTGAGATGCTGGGCTCCTGGTCCTTTGGAGATTACTTCAAGGAATCAGCATGTAAGATGGCTCTGGAACTCCTCACCCAAGAGTTTGGCATTCCAGTTGACAGACTCTATGTTACTTACTTTGGAGGGGATGAAGCAGCTGGCTTAGAACCAGATCTGGAATGTAAACAGATCTGGCAGACTTTGGGGCTGGATGACAGCAGAATCCTCCCTGGCAACATGAAGGATAACTTCTGGGAGATGGGTGACACAGGCCCATGTGGTCCCTGCAGTGAGATTCACTATGACCGGATTGGTGGCCGGGATGCCTCATACCTCGTCAACCAGGACGATCCCAACGTACTCGAGATCTGGAACCTTGTGTTCATCCAGTATAACAGGGAGACTGATGGCACTTTGAAACCTCTTCCCAAGAAAAGCATCGACACGGGGATGGGCCTGGAGCGACTGGTGTCCGTGCTGCAGAATAAGATGTCCAACTACGACACGGACCTTTTTGTTCCCTACTTCGAAGCCATTCAGAAGGGCACAGGTGCCCGTCCCTATACTGGGAAAGTCGGTGCTGAGGATGCCGATGGGATTGACATGGCCTACAGAGTACTGGCTGACCATGCTCGGACCATCACCGTGGCACTGGCCGATGGCGGCCGGCCGGACAACACAGGGCGGGGGTATGTGCTGCGACGGATTCTCCGCCGGGCGGTCCGGTACTCCCACGAGAAGCTCAATGCCAGTAGGGGTTTCTTCGCCACATTAGTGGACGTTGTTGTCCAGTCCCTGGGAGATGCATTTCCTGAGCTAAAGAAGGATCCAGACATGGTGAAGGACATTATTAATGAAGAAGAAGTGCAGTTCCTCAAGACTCTCAGCAGAGGACGTCGCATCCTGGACCGGAAAATTCAGAGCCTGGGAGACTGCAAGACCATTCCAGGTGACACTGCTTGGCTACTCTATGACACCTACGGGTTCCCAGTGGATCTCACTGGACTGATTGCTGAAGAGAAGGGCCTGGTGGTCGATATGGATGGCTTCGAAGAAGAGCGGAAACTGGCCCAGCTGAAGTCACAGGGCAAGGGGGCTGGCGGAGAAGACCTCATTATGCTGGACATCTATGCTATTGAAGAGCTGCGGGCAAGGGGCCTGGAGGCCACAGATGACTCTCCAAAGTACAACTACCACTCGGACTCCAGCGGCGGCTACCTGTTTGAGAGTGCAGTGGCCACGGTGCTGGCTCTGCGGAGGGAGAAGATGTTCGTGGAAGAGGTGTCCACGGGCCAGGAGTGTGGAGTGCTGCTGGACAAGACTTGTTTCTATGCCGAGCAAGGGGGACAGATCTACGACGAAGGCTACCTGGTGAAGGTGGACGACAGCAGCGAGGACAAAACTGAGTTCACAGTGAAGAATGCCCAGGTGCGAGGCGGGTACGTACTGCACATAGGAACCATCTATGGCAACCTGAAAGTGGGTGATCAGGTCCGGCTGTTTATTGATGAGCCCCGGCGCAGACCCATCATGAGCAACCACACAGCCACCCACATTCTGAACTTCGCCCTGCGCTCGGTGCTTGGGGAAGCAGATCAGAAAGGCTCACTGGTTGCTCCCGACCGCCTTCGGTTTGACTTCACTGCCAAGGGAGCCATGTCCACCCAACAGATCAAGAAAGCTGAAGAGACAGGAAACGAGATGATCAAGGCAGCCAAGCCTGTCTACACCCAGGACTGTCCCCTGGCAGCAGCCAAAGCCATCCAGGGCCTGAGGGCTGTGTTTGACGAGACCTACCCTGACCCTGTGCGAGTCGTCTCCATCGGGGTCCCAGTGTCCGAGCTGTTGGATGACCCCTCAGGGCCTGCTGGCTCCCTCACTTCCGTGGAGTTCTGTGGGGGAACGCACCTTCGAAACTCAAGTCACGCAGGAGCTTTTGTGATTGTAACGGAAGAAGCTATTGCCAAGGGTATCAGGAGGATTGTTGCTGTCACAGGTGCTGAAGCCCAGAAGGCCCTCAGGAAGGCAGAGAGCTTGAAGAAATCTTTCTCCACCATGGAATCCAAAGTGAAGGCCCAGACCGCACCAAACAAGGACGTGCAGAGGGAGATCGTGGACCTTGGTGAGGCCCTGGCCACCGCAGTTATTCCCCAGTGGCAGAAGGACGAACTTCGGGAGACTCTGAAATCCCTGAAGAAGGTCATGGACGACCTAGACCGCGCCAGCAAAGCCGACGTCCAGAAGCGAGTGCTGGAGAGGACAAAGCAGCTCATCGACAGCAACCCCAACCAGCCCCTGGTCATCCTGGAGATGGAGAGCGGTGCCTCGGCCAAGGCCTTGAATGAAGCCCTGAAGCTTTTCAAGACCCATTCCCCTGAGACATCTGCCATGCTCTTCACAGTGGACAACGAGGCTGGCAAGATCACCTGCTTGTGTCAAGTGCCCCAGGTCAGGACTGCCTGTAGCCTTGCTCCAAAGCCTGCAAACTCCCAGGCCAATGGGAAGCAAAATCTGTTAGAGTTTTGTCCTTCTTTCTGCTGTTTGCTGAGGCTGGCTGATGTATGCAGCCTCCATGAGAAACAGCTGATCTCCTCCCCACCTATTTGTCATTTTCTCCATCACTCTTTACCCTCAGGCCTTTTCTTTGGTGAATATGTTTAA

XM_004842861.1 Coding sequence

Clec18c C-type lectin domain family 18, member C, transcript variant X2

Length: 1149 bp    Location: 12515136..12525139   Strand: +
>XM_004842861.1
ATGGAAACCAGACACCATGGAAGGGACTGGAATGAGAGCCTGGCTCAGCTGGCTCAAGCCAGGGCAGCCCTCTGTGGCATGCCAGCCCCAGACCTGGTCCCTGCCCCACGGCGCACCCCGCAAATGGGCTGGAACATACAGCTGCTGCCCATAGGCTCGGCGTCCTTTGCTGGAGTGGTCAACCTCTGGTTCGCAGAGGGGCAGTGGTACAGCCACGAGGCAGCTGAGTGTGCCCATAATGCCACCTGCATCCACTACACTCAGCTTGTGTGGGCCACTTCGAGCCAGCTGGGCTGTGGGCGGCATCTGTGCTCCGTGGGCCAGGCAGCGATGGAAGCCTTTGCCTGTGCCTACTCCCCAGGAGGCAACTGGGAGGTAAACAGGAAGACAATTGTCCCTTATAAGAAGGGTGCCTGGTGTTCACTCTGCACAGCCAGTGTCTCGGGCTGCTTCAAGGCCTGGGACCACGCAGGGGGGCTCTGTGAGGTCCCCAGGAACCCATGTCGCATCAGCTGCCGGAACCATGGACATCTCAACATTAGCACCTGCCACTGCCACTGTCCACCTGGCTACACAGGCAGATACTGCCAAGTCCGGTGCAGCGTGGAGTGTGTACATGGCCACTTCCGGGAAGAGGAGTGCTCTTGTGTCTGCAATGTCGGCTACGGGGGAGCCCAGTGTGCCACCAAGGTGCGCTTTCCTTTCCACACCTGTGACCTGAGGATCGATGGGGACTGTTTCACCGTGTCTTCGGAGGCAGACACCTATTACGGAGCCAAGATGAAATGCCAGGGAAAGGGCGGGGTGCTAGCCCAGATTGAGAGCCAGAAAGTGCAGGACATCCTCGCCTTCTATCTGGGCCGCCTGGAGACTACCAACGAGGTGACTGACAGCGACTTTGAGACCAGGAACTTCTGGATTGGGCTCACCTACAAGATGGCAAAGGACTCCTTCCGCTGGACCACTGGGGAGCACCAGTCCTTCACCAGTTTTGCCTTCGGTCAGCCTGACAATCAGGGGTTTGGCAACTGTGTGGAACTGCAGGCATCATCTGCCTTCAACTGGAATGACCAACGCTGTAAAACCCGAAACCGTTACATCTGCCAGTTTGCTCAAGAGCACATTTCCCGGTGGGACCCAAGGCCCTGA

XM_004842851.1 Coding sequence

Fa2h fatty acid 2-hydroxylase, transcript variant X2

Length: 1119 bp    Location: 12125742..12186205   Strand: +
>XM_004842851.1
ATGGCCCCTGCTCCGCCCCCTGCCGCCTCCTTCTCCCCCGCCGAAGTCCAGCGGCGCCTGGCGGCGGGCGACTGTTGGGTCCGCCGCGGGGCGCGCCTCTACGACCTCACCGGCTTCGTGCGGCACCACCCGGGGGGCGAGCAGCTGCTGCGGGCGCGGGCCGGTCTGGACGTTAGCGCCGACCTGGACGGACCCCCGCACCGGCACTCGGCCAACGCACGCCGCTGGCTGGAGCAGTACTACGTGGGAGAGCTGCGAGGCGACCCGCAGGAGCCCAAGGAGAATGGGGCCATAGCCTCTGCAGAAACTCAGAAGACGGACCCTGAGATGGAACCAAGGCTCAAAGTGGTGGACTGGGACAAGGACCTGGTGGACTGGAAGAAGCCTCTGCTGTGGCAGGTGGGCCAGCTGGGGGAGAAGTACCACGAGTGGGTCCACCAGCCGGTGAGCAGGCCCATCCGCCTCTTCCACTCCGACCTCCTCGAGTCCCTGTCCAAGACAGTCTGGTACAGTGTCCCCATCATCTGGGTGCCCCTGGTGCTGTACTTGAGCTGGTCCTACTACAGAATCCTCGCCCAGGGCAACGTCCGACTCTTCAAGTCGTTCACATCAGAGTACTCGGTGGTGGTGCCCAAGTCCATGTTCCCCAGCCTCTTCGTGCTGGGGATATTTCTCTGGAGCCTTGTGGAGTACTTCATCCACCGCTTCCTGTTCCACATGAAGCCCTCCGGCGACAGCTATTACCTCATCATGCTGCACTTCGCCCTGCACGGCCAGCATCACAAGGCACCCTTCGACGGCTCCCGCCTGGTCTTCCCGCCCGTGCCAGCCTCTCTGATAATCGGCTTCTTCTATGTGCTCATGCGGCTTGTCCTGCCCGAGGCAGTGGCGGGCAGCATATTTGCGGGGGGCCTGTTGGGCTACGTCCTCTACGACATGATCCATTACTACCTGCACTTTGGCTCGCCTCACAAGGGCTCCTACCTGTACAGCATGAAGGCCCACCACGTGAAACATCACTTCGCCCACCAGCAGTCAGGGTTTGGCATCAGCACTAAGTTGTGGGATTACTTGTTCCACACCCTCACCCCAGAGGAACAGCGGCTGAAGACCCAGTGA

XM_004842853.1 Coding sequence

LOC101714124 mixed lineage kinase domain-like protein-like

Length: 555 bp    Location: 12194424..12195386   Strand: +
>XM_004842853.1
ATGATACTTTATAGTGGATGGAAACCTGCCTTAGTGCAAAGTAGCGCAGGTATGGATAAATTGGGGCAGATCATCTCCTTAGGCCAGCAAATCCTGAAGCAGTGGGAAGAGTTCAAATACTGCCAGAATCAGAGCCAGCGTCTGCGGGACCACGTAAGTGGGCTCCTTCAGGTTCTGCAGTGGCTCCAGGACCAAGGAACAAGGAACTTGTCCCCTGAAATAACTGCTGTCCTGGATAACTTCCAAAATGCCCTGGAGAAAGCTATGGAGAAGATGGAAAAATTCAACACTCAGACCATTTTCAGGAAGGTTCTAATGCCAGGTAGTAACAAGATACTCTTCAAGGAAGTCAACCAGATGCTGAGAGATGTCTGGGAGGTGTTCATGCTGCAACTTCAGATTGATCAACATGTGTGTATTTCAAGCATCAGCAAAGGAGAATTCTGGCCACAGGAAGATCAGAGTGATGCAGAGAAGGACAGACGATTCTTGCTGGCTTTCCAAAGCCTGAAAGAGGTTAAGTTAGGGGTTTTCTTTCTTAGGGGTGGGGTGTGA

XM_004842840.1 Coding sequence

LOC101710293 chymotrypsinogen B-like

Length: 792 bp    Location: 11751101..11754280   Strand: +
>XM_004842840.1
ATGGTCTCCCTTTGGCTTCTGTCCTGCTTTGCCTTGGTAGCAGCCGTCCATGGCTGTGGAGTCCCTGCCGTCCAACCTGTGCTGAGTGGCCTGGCCAGGATCGTCAATGGCGAGGATGCTGTCCCCGGCTCCTGGCCCTGGCAGGTGTCCCTACAGGACAAAACTGGCTTCCACTTCTGCGGGGGCTCCCTCATCAGCCCGGACTGGGTGGTCACCGCTGCCCACTGCGGGGTCACAACATCCGATGTGGTGGTGGCTGGGGAGTTTGACCAAGGCTCTGATGAGGAGGATGTCCAGGTCTTGAAGATCGCAAAGGTTTTCAAGAACCCCAAGTTCAACATATTCACCGTGCGCAATGACATCACCCTGCTGAAGCTGGCCACACCTGCCCAGTTCTCCAAAACCGTGTCTGCCGTGTGCCTTCCCAGTGCCAGTGATGACTTCTCTGCTGGGGCCCTGTGTGTCACCACTGGCTGGGGCAAGACCAAGTACAATGCTAACAAGACCCCCGACAAGCTACAGCAGGCAGTCTTGCCCCTGGTGTCCACTGCCAACTGCAAGAAGTACTGGGGCACCAAGATTACTGACGTGATGATCTGCGCCGGGGCCAGCGGCGTCTCCTCCTGCATGGGTGACTCTGGTGGGCCCCTGGTGTGCCAGAAGGACGGAGCCTGGACCCTGGTAGGCATCGTGTCCTGGGGTAGCGGCACCTGCGACACCTCCGCTCCCGCTGTGTATGCTCGTGTCACTGCACTCCTGCCCTGGGTTCAGGAGATCCTGGAAGCCAACTGA

XM_004842850.1 Coding sequence

Fa2h fatty acid 2-hydroxylase, transcript variant X1

Length: 1230 bp    Location: 12125742..12186206   Strand: +
>XM_004842850.1
ATGGCCCCTGCTCCGCCCCCTGCCGCCTCCTTCTCCCCCGCCGAAGTCCAGCGGCGCCTGGCGGCGGGCGACTGTTGGGTCCGCCGCGGGGCGCGCCTCTACGACCTCACCGGCTTCGTGCGGCACCACCCGGGGGGCGAGCAGCTGCTGCGGGCGCGGGCCGGTCTGGACGTTAGCGCCGACCTGGACGGACCCCCGCACCGGCACTCGGCCAACGCACGCCGCTGGCTGGAGCAGTACTACGTGGGAGAGCTGCGAGGCGACCCGCAGGAGCCCAAGGAGAATGGGGCCATAGCCTCTGCAGAAACTCAGAAGACGGACCCTGAGATGGAACCAAGGCTCAAAGTGGTGGACTGGGACAAGGACCTGGTGGACTGGAAGAAGCCTCTGCTGTGGCAGGTGGGCCAGCTGGGGGAGAAGTACCACGAGTGGGTCCACCAGCCGGTGAGCAGGCCCATCCGCCTCTTCCACTCCGACCTCCTCGAGTCCCTGTCCAAGACAGTCTGGTACAGTGTCCCCATCATCTGGGTGCCCCTGGTGCTGTACTTGAGCTGGTCCTACTACAGAATCCTCGCCCAGGGCAACGTCCGACTCTTCAAGTCGTTCACATCAGAGTACTCGGTGGTGGTGCCCAAGTCCATGTTCCCCAGCCTCTTCGTGCTGGGGATATTTCTCTGGAGCCTTGTGGAGTACTTCATCCACCGCTTCCTGTTCCACATGAAGCCCTCCGGCGACAGCTATTACCTCATCATGCTGCACTTCGCCCTGCACGGCCAGCATCACAAGGCACCCTTCGACGGCTCCCGCCTGGTCTTCCCGCCCGTGCCAGCCTCTCTGATAATCGGCTTCTTCTATGTGCTCATGCGGCTTGTCCTGCCCGAGGCAGTGGCGGGCAGCATATTTGCGGGGGGCCTGTTGGGCTACGTCCTCTACGACATGATCCATTACTACCTGCACTTTGGCTCGCCTCACAAGGGCTCCTACCTGTACAGCATGAAGGCCCACCACGTGAAACATCACTTCGCCCACCAGCAGTCAGGGACTAGAACAGAGCTGCTGAGCTGGAAATGGACTTGGGCCCACGAGGAAGGAGAAGCGGCAGGAAAGAAAAGGAGGAAGAGGAAGGTAGCAGCCTCTCTCCTGGGGACGCTAGACACACAGGGTTTGGCATCAGCACTAAGTTGTGGGATTACTTGTTCCACACCCTCACCCCAGAGGAACAGCGGCTGA

XM_004842846.1 Coding sequence

Znrf1 zinc and ring finger 1, E3 ubiquitin protein ligase, transcript variant X3

High confidence: 4 potential gene matches
Length: 684 bp    Location: 11954455..11848440   Strand: -
>XM_004842846.1
ATGGGTGGCAAGCAGAGCACGGCGACCCGCTCCCGGGGCCCCTTCCCGGGGGTCTCCACCGATGACAGCGCCGTGCCCCCGCCGGGAGGGGCGCCCCACTTTGGGCACTACCGGACGGGCAGCGGGGCCATGGGGCTACGCAGCCGCTCGGTCAGCTCGGTGGCGGGCATGGGCATGGACCCCAGCACGGCCAGCGGAGTGCCCTTTGGCCTCTACACCCCCGCCTCCCGGGGGACTGGCGACTCCGAGAGGGCGCCCGGCGGCGGAGGGTCTGCGTCCGACTCCAGCTATGCCCACGGTAATGGTTACCAGGAGACGGGCGGCGGTCACCATAGAGACGGGATGCTGTACCTGGGCTCCCGAGCCTCGCTGGCGGATGCTCTACCTCTGCACATCGCACCCAGGTGGTTCAGCTCGCACAGTGGTTTCAAGTGCCCCATTTGCTCCAAGTCTGTGGCTTCCGATGAGATGGAAATGCACTTTATAATGTGTCTGAGCAAACCTCGCCTCTCCTACAATGATGATGTGCTGACTAAAGATGCGGGTGAGTGTGTGATCTGCCTAGAGGAGCTGCTTCAGGGGGACACGATAGCCAGGCTGCCCTGCCTGTGCATCTATCACAAAAGCTGCATAGACTCGTGGTTTGAAGTGAACAGATCTTGTCCAGAACACCCTGCGGACTGA

XM_004842845.1 Coding sequence

Znrf1 zinc and ring finger 1, E3 ubiquitin protein ligase, transcript variant X2

Length: 684 bp    Location: 11954455..11848440   Strand: -
>XM_004842845.1
ATGGGTGGCAAGCAGAGCACGGCGACCCGCTCCCGGGGCCCCTTCCCGGGGGTCTCCACCGATGACAGCGCCGTGCCCCCGCCGGGAGGGGCGCCCCACTTTGGGCACTACCGGACGGGCAGCGGGGCCATGGGGCTACGCAGCCGCTCGGTCAGCTCGGTGGCGGGCATGGGCATGGACCCCAGCACGGCCAGCGGAGTGCCCTTTGGCCTCTACACCCCCGCCTCCCGGGGGACTGGCGACTCCGAGAGGGCGCCCGGCGGCGGAGGGTCTGCGTCCGACTCCAGCTATGCCCACGGTAATGGTTACCAGGAGACGGGCGGCGGTCACCATAGAGACGGGATGCTGTACCTGGGCTCCCGAGCCTCGCTGGCGGATGCTCTACCTCTGCACATCGCACCCAGGTGGTTCAGCTCGCACAGTGGTTTCAAGTGCCCCATTTGCTCCAAGTCTGTGGCTTCCGATGAGATGGAAATGCACTTTATAATGTGTCTGAGCAAACCTCGCCTCTCCTACAATGATGATGTGCTGACTAAAGATGCGGGTGAGTGTGTGATCTGCCTAGAGGAGCTGCTTCAGGGGGACACGATAGCCAGGCTGCCCTGCCTGTGCATCTATCACAAAAGCTGCATAGACTCGTGGTTTGAAGTGAACAGATCTTGTCCAGAACACCCTGCGGACTGA

XM_004842844.1 Coding sequence

Znrf1 zinc and ring finger 1, E3 ubiquitin protein ligase, transcript variant X1

Length: 684 bp    Location: 11954455..11848440   Strand: -
>XM_004842844.1
ATGGGTGGCAAGCAGAGCACGGCGACCCGCTCCCGGGGCCCCTTCCCGGGGGTCTCCACCGATGACAGCGCCGTGCCCCCGCCGGGAGGGGCGCCCCACTTTGGGCACTACCGGACGGGCAGCGGGGCCATGGGGCTACGCAGCCGCTCGGTCAGCTCGGTGGCGGGCATGGGCATGGACCCCAGCACGGCCAGCGGAGTGCCCTTTGGCCTCTACACCCCCGCCTCCCGGGGGACTGGCGACTCCGAGAGGGCGCCCGGCGGCGGAGGGTCTGCGTCCGACTCCAGCTATGCCCACGGTAATGGTTACCAGGAGACGGGCGGCGGTCACCATAGAGACGGGATGCTGTACCTGGGCTCCCGAGCCTCGCTGGCGGATGCTCTACCTCTGCACATCGCACCCAGGTGGTTCAGCTCGCACAGTGGTTTCAAGTGCCCCATTTGCTCCAAGTCTGTGGCTTCCGATGAGATGGAAATGCACTTTATAATGTGTCTGAGCAAACCTCGCCTCTCCTACAATGATGATGTGCTGACTAAAGATGCGGGTGAGTGTGTGATCTGCCTAGAGGAGCTGCTTCAGGGGGACACGATAGCCAGGCTGCCCTGCCTGTGCATCTATCACAAAAGCTGCATAGACTCGTGGTTTGAAGTGAACAGATCTTGTCCAGAACACCCTGCGGACTGA

XM_004842839.1 Coding sequence

Bcar1 breast cancer anti-estrogen resistance 1, transcript variant X2

Length: 2472 bp    Location: 11673918..11695988   Strand: +
>XM_004842839.1
ATGAACTACCTGAATGTGCTGGCCAAAGCCCTCTATGACAATGTGGCGGAGTCCCCAGATGAGCTCTCCTTTCGCAAGGGTGACATCATGACTGTGCTGGAGAGGGACACACAGGGCCTGGATGGCTGGTGGCTCTGCTCACTGCATGGGCGCCAGGGCATTGTGCCTGGGAACCGCCTCAAGATCCTGGTGGGCATGTACGACAAGAAGCCAGCAGGGCCCGGCCCTGGCCCACCTGCCACTGTAGCTCAGCCCCAGCCCCAGCCCAGCCTCCCACCTGGCCTGCATGCCACCGTGCCCCCGGCTTCCCAGTACACGCCTATGCTCCCTGCTGCATACCAGCCCCAGCCGGACAGCGTCTACCTGGTACCCACTCCCAGCAAGGCTCAGCAAGGCCTCTACCAAGCCCCGGGGTCCAGCCCGCAGTTCCAGTCGCCCCCAGCGAAGCAGACATCCACGTTCTCAAAACAGACGCCTCATCACCCATTTCCCAGCCCAGCCACAGACCTTTACCAGGTGCCCCCAGGACCTGGAAATCCTGCCCAGGACATCTACCAGGTGCCGCCTTCTGCTGGCATAGGGCACGACATCTACCAGGTGCCCCCATCCATGGACACACGCAGCTGGGAGGGGACAAAGCCACCAGCAAAGGTATATGATACCCCACCAATGGCTGTCAAGGGTCCCAATGGCCGAGACCCACTGTTGGACGTGTATGATGTCCCCCCCAGCGTGGAGAAGGGCCTGCCACCATCCGGTCACCATGTGGTGTACGATGTTCCCCCATCGGTGAGCAAGGATGTCCCTGATGGCCCAGTGCAGCGAGAGGAGACCTATGATGTGCCCCCTGCCTTTGCCAAGGTCAAGCCCTTTGACCCAGCCCGCCACCCGCTGATCCTCGCTGCACCCCCTCCGGATTCCCCACCAGCTGAGGACGTGTATGACGTGCCACCCCCTGCTCCTGATCTCTATGATGTGCCTCCTGGCTTGCGGCGGCCCGGCCCTGGCAGCCTGTATGATGTGCCCCGTGAGCGGGTGCTTCCTCCTGAGGTGGCAGACGGCGTGGTTGACGACGGGGTGTACGCTGTGCCCCCTCCAGCAGAGCCCGAGGCCATGCCCGTGGCTGATGGCAAGCGTCTGTCTGCCTCCAGCACGGGCAGCACGCGCAGCAGCCAGTCAGCGTCCTCCTTGGAGGCAGCTGTGTCGGGCCGGGAGCCCCTGGAGCTGGAGGTCGCTGTGGAGTCCTTGGCGAGACTGCAGCAGGGTGTGAGTGCCACCGTAGCCCACCTCCTGGACCTGGTGGGCAGTGCCAGCGGGGCTGGGGGGTGGCGTGGCACCCCCGAGCCTCAGGAGCCACCAGTCCAGGACCTGCAGGCCTCAGTGACTGCTGTCCAGAGCGCTGTCCATGAGCTGCTGGAGTTTGCCCGCAGTGCTGTGGGCAATGCCGCCCATACTTCTGACCGCACCCTGCACGCCAAGCTTGGCCGGCAGCTGCAGAAGATGGAGGACGTGTACCAGACACTGGTGGCACATGGCCAGGTCCTTGACAATGGCCGGGGAGGCCCAGGGTTCACCCTGGAAGACCTGGACCGTCTGGTGGCTTGCTCACGGGCTGTGCCCGAGGATGCCAAGCAGCTGGCCTCCTTCTTGCATGGCAATGCCTCACTGCTCTTCAGACGGACCAAGGCCCCTGCTCCTGGGCCCGAGGGGGGCGGCCCCCTGCACCCCAACCCCACTGACAAGGCCAGCAGCATCCAGTCACGGCCCCTGCCCTCCCCCCCCAAGTTCACCTCCCAGGACTCTCCAGATGGGCAGTACGAGAACAGTGAGGGGGGCTGGATGGAGGACTATGACTACGTCCACCTGCAGGGGAAGGAAGAGTTTGAGAAGACCCAAAAGGAGCTGCTGGAGAAGGGCAACATCATGCGGCAAGGGAAGGGCCAGCTGGAGCTGCAGCAGCTGAAGCAGTTTGAGCGGCTGGAGCAGGAGGTGTCACGGCCCATAGACCACGACCTGGCCAACTGGACACCAGCCCAGCCCCTGGCACCGGGCCGGCCAGGTGCCCTGGGGCCCTCGGATCGGCAGCTGCTGCTCTTCTACCTGGAGCAGTGCGAGGCCAACCTGACCATACTGACTGACGCTGTAGACGCCTTTTTCACCGCCGTGGCCACCAACCAGCCCCCCAAGATCTTCGTGGCGCACAGCAAGTTCGTCATCCTCAGTGCCCACAAGCTGGTGTTCATTGGGGATACACTGTCGCGGCAGGCCAAGGCTGCGGACGTGCGCAGCCAGGTGACCCATTACAGCAACCTGCTCTGCGACCTCTTGCGCGGCATTGTGGCCACCACCAAGGCCGCTGCCCTGCAGTACCCATCGCCCTCCGCAGCGCAAGACATGGTGGACAGGGTCAAGGAGCTGGGCCACAGCACCCAGCAGTTCCGCCGCGTCCTGGGCCAGCTGGCAGCCGCCTGA

XM_004842841.1 Coding sequence

Zfp1 ZFP1 zinc finger protein, transcript variant X1

Length: 1221 bp    Location: 11841436..11794103   Strand: -
>XM_004842841.1
ATGAACAAATCCCAGGTGTCAGTTTCATTCACGGATGTGACTGTGGACTTCACCCAGGAAGAGTGGGAGCAGCTGGACCCTTCTCAGAGGATTTTATACATGGATGTGATGCTGGAGAATTACAGCAACCTACTTTCAGTGGAAGTGTGGAAGGCTGATGACCAGATGGAAAGGGAGCACAGAAATCCAGATGAGCAAGCAAGGCAGTTTACGGTCCTTAAGAACCAAACCCCATTTGAGGAGAGAGGTAATCTCTTTGGAAAAACATTTAATCTGAACACAGAATTTGTTTCTTTAAGACAAGTGCCCTATAAATATGATTTATATGAAAAAACTTTGAAGTATAATTCAGACTTACTTAATAATAATAGCTATGCAACAAAGAAAGGTGATGAATGCACTGGATTTGGAAAACCACTCCTATATCTGAAACAAGAGAAAACCCATCTTGGAGCGGAATACTCTGAATATAATAAAAGTGGGAAAGCCCTTAGCCATAAAGAAGTCATTTTTAAACATCAGAAAATTAAAAACTTGATTCAACCTTTTATTTGTAATTACTGTGACAAGGCCTTCCCCTTTAAGTCACTCCTCATCAGTCATAAGAGAATACACACTGGAGAAAAACCCTATGAATGTAATGTATGTAAGAAAACTTTCTCCCATAAGGCAAACCTCATCAAACATCAGAGAATTCACACTGGAGAGAAACCCTTTGAATGTCCTGAGTGTGGAAAAGCTTTCACTCACCAGTCAAATCTTATTGTACACCAGAGAGCACATATGGAGAAGAAGCCCTATGAGTGCGGTGACTGTGGAAAGACATTTGCTCAGAAGTTTGAACTTACTACACACCAGAGAATTCATACTGGAGAGCGACCCTATGAGTGTAATGAATGTGCAAAAACCTTCTTTAAGAAATCAAACCTCATTATACATCAGAAAATTCACACAGGAGAGAAACGCTATGAGTGTAGTGAATGTGGAAAGTCTTTTATCCAGAACTCACAACTCATCATACATATGAGAACTCATACAGGAGAGAAACCGTATGAATGTACTGAATGCGGCAAAACTTTCAGCCAGAGGTCAACTCTTCGATTACATTTGAGAATCCATACAGGAGAGAAACCATATGAGTGTACTGAATGTGGAAAGGCCTTCAGCAGGAAGTCCCGACTCAGTGTCCATCAGAGAGTTCATATAGGGGACAGACCTTGA

XM_004842830.1 Coding sequence

LOC101706577 40S ribosomal protein S4-like, transcript variant X1

Length: 828 bp    Location: 11405207..11409155   Strand: +
>XM_004842830.1
ATGCAGAGAGAAAGGTATATATTTCATAGCTCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGAGTGGCAGCTCCAAAGCATTGGATGCTGGATAAGTTGACCGGTGTGTTTGCTCCTCGTCCATCCACCGGCCCCCACAAGCTGAGAGAATGTCTGCCTCTTATCATCTTCCTAAGGAATAGACTTAAATATGCCTTGACAGGGGATGAAGTAAAGAAGATTTGCATGCAGCGCTTCATTAAGATTGATGGAAAAGTCAGAACTGATATAACCTACCCTGCTGGCTTTATGGATGTCGTCAGCATTGAGAAGACAGGAGAGCATTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTTCACCGTATTACACCTGAGGAAGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTGGGCACAAAAGGGATCCCTCATCTCGTGACCCACGATGCTCGCACCATTCGCTACCCTGATCCACTCATCAAGGTGAATGACACCATCCAGATTGATTTGGCGTCTGGCAAGATCACCGATTTCATCAAGTTCGACACTGGTAATCTGTGTATGGTGACCGGAGGTGCTAACTTGGGAAGAATCGGCGTGATCACCAATAGGGAGAAGCATCCCGGCTCTTTTGATGTGGTTCACGTGAAAGATGCCAACGGCAACAGCTTTGCCACCCGGCTCTCCAACATTTTCGTTATTGGCAAGGGCAACAAGCCGTGGATTTCTCTTCCTCGAGGAAAAGGAATCCGCCTCACTATTGCTGAAGAGAGAGATAAGAGGCTGGCGGCCAAGCAGAGCAGTGGATGA

XM_004842831.1 Coding sequence

LOC101706577 40S ribosomal protein S4-like, transcript variant X2

Length: 813 bp    Location: 11405207..11409155   Strand: +
>XM_004842831.1
ATGCAGAGAGAAAGCTCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGAGTGGCAGCTCCAAAGCATTGGATGCTGGATAAGTTGACCGGTGTGTTTGCTCCTCGTCCATCCACCGGCCCCCACAAGCTGAGAGAATGTCTGCCTCTTATCATCTTCCTAAGGAATAGACTTAAATATGCCTTGACAGGGGATGAAGTAAAGAAGATTTGCATGCAGCGCTTCATTAAGATTGATGGAAAAGTCAGAACTGATATAACCTACCCTGCTGGCTTTATGGATGTCGTCAGCATTGAGAAGACAGGAGAGCATTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTTCACCGTATTACACCTGAGGAAGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTGGGCACAAAAGGGATCCCTCATCTCGTGACCCACGATGCTCGCACCATTCGCTACCCTGATCCACTCATCAAGGTGAATGACACCATCCAGATTGATTTGGCGTCTGGCAAGATCACCGATTTCATCAAGTTCGACACTGGTAATCTGTGTATGGTGACCGGAGGTGCTAACTTGGGAAGAATCGGCGTGATCACCAATAGGGAGAAGCATCCCGGCTCTTTTGATGTGGTTCACGTGAAAGATGCCAACGGCAACAGCTTTGCCACCCGGCTCTCCAACATTTTCGTTATTGGCAAGGGCAACAAGCCGTGGATTTCTCTTCCTCGAGGAAAAGGAATCCGCCTCACTATTGCTGAAGAGAGAGATAAGAGGCTGGCGGCCAAGCAGAGCAGTGGATGA

XM_004842832.1 Coding sequence

LOC101706577 40S ribosomal protein S4-like, transcript variant X3

Length: 792 bp    Location: 11405207..11409155   Strand: +
>XM_004842832.1
ATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGAGTGGCAGCTCCAAAGCATTGGATGCTGGATAAGTTGACCGGTGTGTTTGCTCCTCGTCCATCCACCGGCCCCCACAAGCTGAGAGAATGTCTGCCTCTTATCATCTTCCTAAGGAATAGACTTAAATATGCCTTGACAGGGGATGAAGTAAAGAAGATTTGCATGCAGCGCTTCATTAAGATTGATGGAAAAGTCAGAACTGATATAACCTACCCTGCTGGCTTTATGGATGTCGTCAGCATTGAGAAGACAGGAGAGCATTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTTCACCGTATTACACCTGAGGAAGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTGGGCACAAAAGGGATCCCTCATCTCGTGACCCACGATGCTCGCACCATTCGCTACCCTGATCCACTCATCAAGGTGAATGACACCATCCAGATTGATTTGGCGTCTGGCAAGATCACCGATTTCATCAAGTTCGACACTGGTAATCTGTGTATGGTGACCGGAGGTGCTAACTTGGGAAGAATCGGCGTGATCACCAATAGGGAGAAGCATCCCGGCTCTTTTGATGTGGTTCACGTGAAAGATGCCAACGGCAACAGCTTTGCCACCCGGCTCTCCAACATTTTCGTTATTGGCAAGGGCAACAAGCCGTGGATTTCTCTTCCTCGAGGAAAAGGAATCCGCCTCACTATTGCTGAAGAGAGAGATAAGAGGCTGGCGGCCAAGCAGAGCAGTGGATGA

XM_004842835.1 Coding sequence

Tmem170a transmembrane protein 170A, transcript variant X1

Length: 780 bp    Location: 11458662..11476497   Strand: +
>XM_004842835.1
ATGGGGCGCACGGAATTGCCCTACTTTCTTTTACGTGGTGATGCGAAAGAGCCGAGGGTCCCCAAACGTGGCAGCAGACACTCCTCCAGTAGGGGGCGTACCCCGTGGGGTCTGGGTTTTTGCGAGTCGTACGCAACGTCGGGGGCGGGAACAACTCTAGCCTCGCCCCTTGCGTGTGCGGCGACCTGTGATTGGAAGAAGGGACTATTACTTGGCAGCGCCGTAGATGTGGGAAGAAGAGGGCCTCGGGCGAAGGTGACGCGGAGACGGCGTAGGTGTGGGGACCAAGGCTGTGTAGCACTTCGGACACGCTCCCTTCATCTTTCTGTGGTGAATGGCGCCAGGATGGAGCGCGAGGGGAGCGACGGCAGCGGGGGTTCGGCTGGACTCCTGCAGCAGATCCTCAGCCTGAAGCTCGTGCCGCGAGTGGGCAACGGGACCCTGTGCCCTAACTCCACTTCTCTCTGCTCCTTCCCAGAGATGTGGTATGGCGTGTTCCTGTGGGCACTGGTGTCCTCTCTATTCTTTCACGTCCCCGCCGGGTTACTGGCCCTCTTCACCCTCAGACGTCACAAATATGGTAGGTTCATGTCTGTAAGCATCCTGTTGATGGGCATCGTGGGACCAATTACTGCTGGAATCTTGACAAGTGCAGCGATTGCTGGAGTTTACCGAGCAGCAGGGAAACAGATGATACCATTCGAAGCCCTCACCTTGGGCACAGGACAGACGTTCTGTGTAGTGGTGGTCTCCTTCTTACGGATTTTAGCCACTTTATAG

XM_004842826.1 Coding sequence

Kars lysyl-tRNA synthetase, transcript variant X4

Length: 1542 bp    Location: 11337591..11352150   Strand: +
>XM_004842826.1
ATGCTGATGCTAGCTGCTCTAAGGCTTGTTAGGGGGTCCCTGCGCCAAACCTGGGCAGAATGGGGTCAAAGGGAACTTCGACTGGGTCAACTTGCTCCTTTCACAGCGCTTCACAAGGACAAGGCACTTTCTGATATAAGAAGTGAGCTAAAAAGACGCCTTAAAGCCGAGAAGAAAGTGGCAGAGAAGGAGGCCAAGCAGAAGGAGCTCAGTGAGAAACAACTAAGCCAACCTACTGCAGCTGCCACTAATCACACCACTGACAATGGTGTGGGTACCGAGGAAGAAACCCTGGACCCAAACCAATACTACAAGATCCGAAGTCAAGCAGTCCACCAGCTGAAGGTCAGTGGGGAGGATCCATACCCACACAAGTTCCACGTAGACATCTCACTCACCCAGTTCATCCAAGAATACAGTCACCTGCAGCCTGGGGACCACCTGACCGACATCACCTTAAAGGTGGCAGGTAGAATCCATGCCAAAAGAGCTTCTGGGGGGAAGCTCATCTTCTATGACCTTCGAGGAGAGGGAGTCAAGTTGCAAGTCATGGCCAATTCCAGGAATTACAAATCAGAGGAAGAATTTATTTGTATCAACAACAAACTGCGTCGGGGAGACATAATCGGCGTTCATGGGAATCCTGGGAAAACCAAGAAGGGTGAGCTAAGCATCATTCCCTATGAGATCACACTGTTGTCTCCCTGCCTGCATATGTTACCTCATCTGCACTTCGGCCTCAAAGACAAGGAAACCCGGTATCGACAGAGATACTTGGACCTGATACTCAATGACTTTGTGAGGCAGAAATTTATCATCCGCTCTAAGATCATTACATATATAAGAAGTTTCTTGGATGAGCTGGGATTTCTCGAGATTGAAACTCCCATGATGAACATCATCCCAGGGGGAGCTGTGGCCAAGCCTTTCATCACGTACCACAACGAGCTGGATATGAACTTATACATGAGAATTGCTCCAGAACTCTACCATAAGATGCTGGTGGTGGGTGGCATTGACCGGGTTTATGAAATTGGACGCCAGTTCCGGAATGAAGGAATTGATTTGACCCACAATCCTGAGTTCACCACCTGTGAGTTCTACATGGCCTATGCAGACTATCATGATCTTATGGAAATAACAGAGAAGTTGATTTCAGGAATGGTGAAGAACATTACAGGCAGTTACAAGGTCACCTACCACCCAGATGGTCCAGAGGGCCAAGCCTATGAGATTGACTTCACCCCACCCTTCCGGAGAATCGGAATGGTGGAAGAGCTGGAGAAAGCCCTAGGGGTGAAGCTGCCTGAAACCAACCTCTTTGAAACTGAAGAAACTCGAAAAATTCTTGATGATATCTGTGTAGCAAAAGCTGTTGAATGCCCTCCGCCTCGGACCACTGCCAGGCTCCTTGATAAGCTTGTTGGAGAGTTCTTGGAAGTGGCATGCATCAATCCTACATTCATCTGCGATCACCCACAGATAATGAGCCCGTTAGCTAAATGTTTCTTCTCCCCAGGCACCGCTCCAAAGAGGGTCTGA

XM_004842827.1 Coding sequence

Terf2ip telomeric repeat binding factor 2, interacting protein

High confidence: 4 potential gene matches
Length: 1182 bp    Location: 11337495..11327943   Strand: -
>XM_004842827.1
ATGGCAGAGGCGTTGGATATGGGCAAAGACCCCAATGGGCCCACTCATTCCTCCACTCTGTTCGTGAGGGGAGACGGGAACCCTCTGTCGTTCTACGTGCGGCCCAGCCCGATCAAGCGCCGGCTGTCGACGCTGATCCTCCATGGCGGCGGCACCGTGTGCCGGGTGCAGGAGCCTGGGGCGGTGCTGCTGGCCCAGCCCGGGGAAGCGCTGGCCGAGGCCTCGGGAGACTTCATCTCCACACAGTACATCCTGGACTGCGTGGAGCGCAACGAGAGGCTGGAGCTGGAGGCCTATCGGCTGGGGGCGGCCTTGGCGGGGGTGCGGGCTCTGGAGACCAAGCCCGGGGCCTCGGGCGAGGGCGCCGCGGAGTCCGAGCCGCAGCCGCCCACCGGGCGGGTCGCCTTCACGGACGCGGACGACGTGGCCATTCTGACCTACGTGAAGGAACATGCCCGCTCGCCCAGCTCGGTCACGGGCAACGCTCTGTGGAAAGCGATGGAGAAGGGCGCGCTCACGCAGCACTCGTGGCAGTCCATGAAGGACCGCTACCTCAAGCACCTGCGGGGCCAGGAGCACAAGTACCTGCTGGGGGACGCGCCCGTGAGCCCCTCTTCGCAGAAGCTCAAGAGGAAGGCGGAGCAGGACCCGGAGGCTGCGGACAGCGGGGAACCACAAAATAAGAGAACTCCAGACTTGCCTGAAGAAGAATGTGGGAAGGAAGAGAGTGGGGAAAATGAAACAGTCAAAAAAATACTTGTAGAAAGCACCCGGGACTTTGAGGAAGTTGTGGTGAATGAGAGCTCTGATTTTGAAATACACATAACTATGTGTGATGATGATCCTCCCACACCAGAAGACTCAGAAACACAGCCTGATGAGGAGGAAGAAGAAAAACTTTCGTCACCAGAGGTGGGAGCTGCCATTAAGATTATCCGGCAATTAATGGAAAAGTTTAACTTGGATCTATCAACAGTTACACAGGCCTTCCTAAAAAATAGTGGTGAGTTGGAGGCTACTTCCTCCTTTTTAGAGTGTGGTCGGAGAGCAGATGGATACCCCATTTGGTCCCGGCAAGATGACTTAGATTTGCAAAAAGATGATGAAGCTACCAGAGATGCATTAGTCAAAAAATTTGGTGCTCAGAATGTAGCTCGGAGGATTGAATTCCGAAAGAAATAA

XM_004842805.1 Coding sequence

Cmc2 COX assembly mitochondrial protein 2 homolog (S. cerevisiae), transcript variant X3

Length: 240 bp    Location: 6331037..6369249   Strand: +
>XM_004842805.1
ATGCATCCTGACTTGTCTCTACACCTGCACACAGAAGAATGCAACATCTTGATTAACTTGCTTAAGGAATGTCACAAAAATCACAGCTTTCTGAAATTTTTTGGTCATTGCAACCATCTTGATCGGGAGATGAGAAAATGCTTGAAGAATGAGTACATGGAAAAGAGAACCAGAAGCAGGGAACGCGGGAATGACTTGCGAAAAAGACTTTTCAATCCTTCAGAGGAATCTGAAAAATAA

XM_004842810.1 Coding sequence

Dynlrb2 dynein, light chain, roadblock-type 2

High confidence: 4 potential gene matches
Length: 291 bp    Location: 6814160..6805249   Strand: -
>XM_004842810.1
ATGACAGAGGTGGAGGAAACCCTGAAGAGGATCCAGAGCCATAAAGGAGTTATTGGAACCATGGTTGTAAATGCAGAAGGCATCCCTATCCGAACCACTCTGGACAACTCAACCACAGTTCAGTATGCAGGCCTTCTTCATCAGCTCACAATAAAAGCCAAGAGCACAATCCGTGATATCGATCCTCAGAACGACTTAACTTTCCTTAGGATCAGGTCAAAGAAACACGAAATCATGGTAGCTCCAGATAAAGAATATCTTCTGATTGTCATTCAGAACCCATGTGAATAG

XM_004842816.1 Coding sequence

Nudt7 nudix (nucleoside diphosphate linked moiety X)-type motif 7, transcript variant X2

Length: 552 bp    Location: 9242772..9228699   Strand: -
>XM_004842816.1
ATGTCGCGATCTCGTCACCCCCAGGAGCCAGACAGAAACAATTTGATAGATGATGCAAAGACCCGCTTGAAAAAGCTCGATGTTGGTGCCAAATATTCTCACTTGTCGAGTCACAAATACTCCGTCCTCGTACCTTTGGTGGCTAGAGAAGGAAAACTCCATCTGCTCTTCACTGTCCGGTCTGAGAAGAAAAAAAAGTTGGTTACCCCAGTGGTGGGTTTTATAGACCACAACTTTGAGGCCCAGCCGAATCCTGATGAAGTTAAGGATGTGTTCCTTGTGCCTCTGGACTATTTTCTACATCCACGTGTCTACTACCCTTATCACTTTACACAAGCTGGCCATTCTTTTGTCATGCATTGCTTTGAATACAGACGCCCTGAAGATGGTGTGACTTATTTCATCAGGGGACTGACTGCGCGATTTGCTGTAGTGGTTGCCTTGATTATTTTGGAACAGAAACCTACCTTTGAGGTTGAATATAATCTCAATGATCTACTATCATCTTGTGAAAAACAGTTGCTTCTTTACCATGCTACAAGCAAGTTATGA

XM_004842806.1 Coding sequence

Cmc2 COX assembly mitochondrial protein 2 homolog (S. cerevisiae), transcript variant X4

High confidence: 4 potential gene matches
Length: 240 bp    Location: 6342218..6369249   Strand: +
>XM_004842806.1
ATGCATCCTGACTTGTCTCTACACCTGCACACAGAAGAATGCAACATCTTGATTAACTTGCTTAAGGAATGTCACAAAAATCACAGCTTTCTGAAATTTTTTGGTCATTGCAACCATCTTGATCGGGAGATGAGAAAATGCTTGAAGAATGAGTACATGGAAAAGAGAACCAGAAGCAGGGAACGCGGGAATGACTTGCGAAAAAGACTTTTCAATCCTTCAGAGGAATCTGAAAAATAA

XM_004842807.1 Coding sequence

Cenpn centromere protein N, transcript variant X1

Length: 1038 bp    Location: 6330943..6309693   Strand: -
>XM_004842807.1
ATGGGCCGTGCCAGAGAGATGGACGAGACTCTTGCCGAGTTCATCAGGAGGACCATCTTTAAAATCCCCATGGCTACAATGATGACAGTCTTAGAAACCTGGGGTTTTTTGTCTGAAAGCCAGTTGCAGAGCCTAAACTTCAAGCAGAGAAAGGAATCTTTGGTTCACAACTTGCTTCTGCTATGTGAGGAGAACCACGCAAGCATCAACGATGTGGCCCTTTTAGACATCGTTTATATACAAGTTCATCGGCACCAGAAAATGTGGAATGTTTTTCATATGAGTAAAGGACCAGATGAAGATGTTGATATTTTTGACATGGAAGAATTCAAAAGCTTATTTAAGAAAATTCTTCACCGAGCATTAAAAAATGTGACCGTGAGCTTCAGGGATGCCCAGGAGAATGCAGTCTGGATTCGCATCGCCTGGGGAACTCAGCACAAAAAGCCCAACCAGTACCAGCCTACTTACGTGGTGTACCATTCCCAGACTCCGTTCGCCTTCGCTTCTTCCTCCAGGCTGAAGAGCACTGTACCCCTTCTGGGTCAGGCACTGACAGTCGCCAGCAAACACCACCAGATCGTGCAGATGGACCTGAGAAGCCGCCACCTGGACTCTCTCAAAGCCATCGTTTTTAAACAGTTCAATCAGACCTTTGAAAATCACAACTCTACAACACCTCTTCAGGAAAGAAGCCTTGGAGTAGATATAAACATGGATTCAAGGATCATTCATGAAAACACCATAGAAAAAGAGAGGGTCCGAAGAGTAACTCAAGAAACATTTGGGGTCTGCCCTCAACCTCAGCTAGAGTTTGCACAGTACAAGCTTGAAACGAAGTTCAAAGGTGACTTATATGGGGGCATCTTGGCCAAGAGGGAAGAGCCCCTACGGTGCCTGATAAAGTTCTCCAGCCCACATCTTTTGGAAGCACTGAAATCCTTAGCTCCAGCCGGTATTGCAGATGCTCCACTTTCTCCATTGCTCACCTGCATACCCAACAAGGCAATGAATTATTTTAAAATTAGAGATAAGTAA

XM_004842809.1 Coding sequence

Cenpn centromere protein N, transcript variant X3

Length: 861 bp    Location: 6330943..6309693   Strand: -
>XM_004842809.1
ATGGGCCGTGCCAGAGAGATGGACGAGACTCTTGCCGAGTTCATCAGGAGGACCATCTTTAAAATCCCCATGGCTACAATGATGACAGTCTTAGAAACCTGGGGTTTTTTGTCTGAAAGCCAGTTGCAGAGCCTAAACTTCAAGCAGAGAAAGGAATCTTTGGTTCACAACTTGCTTCTGCTATGTGAGGAGAACCACGCAAGCATCAACGATGTGGCCCTTTTAGACATCGTTTATATACAAGTTCATCGGCACCAGAAAATGTGGAATGTTTTTCATATGAGTAAAGGACCAGATGAAGATGTTGATATTTTTGACATGGAAGAATTCAAAAGCTTATTTAAGAAAATTCTTCACCGAGCATTAAAAAATGCACTGACAGTCGCCAGCAAACACCACCAGATCGTGCAGATGGACCTGAGAAGCCGCCACCTGGACTCTCTCAAAGCCATCGTTTTTAAACAGTTCAATCAGACCTTTGAAAATCACAACTCTACAACACCTCTTCAGGAAAGAAGCCTTGGAGTAGATATAAACATGGATTCAAGGATCATTCATGAAAACACCATAGAAAAAGAGAGGGTCCGAAGAGTAACTCAAGAAACATTTGGGGTCTGCCCTCAACCTCAGCTAGAGTTTGCACAGTACAAGCTTGAAACGAAGTTCAAAGGTGACTTATATGGGGGCATCTTGGCCAAGAGGGAAGAGCCCCTACGGTGCCTGATAAAGTTCTCCAGCCCACATCTTTTGGAAGCACTGAAATCCTTAGCTCCAGCCGGTATTGCAGATGCTCCACTTTCTCCATTGCTCACCTGCATACCCAACAAGGCAATGAATTATTTTAAAATTAGAGATAAGTAA

XM_004842808.1 Coding sequence

Cenpn centromere protein N, transcript variant X2

High confidence: 4 potential gene matches
Length: 1020 bp    Location: 6330109..6309693   Strand: -
>XM_004842808.1
ATGGACGAGACTCTTGCCGAGTTCATCAGGAGGACCATCTTTAAAATCCCCATGGCTACAATGATGACAGTCTTAGAAACCTGGGGTTTTTTGTCTGAAAGCCAGTTGCAGAGCCTAAACTTCAAGCAGAGAAAGGAATCTTTGGTTCACAACTTGCTTCTGCTATGTGAGGAGAACCACGCAAGCATCAACGATGTGGCCCTTTTAGACATCGTTTATATACAAGTTCATCGGCACCAGAAAATGTGGAATGTTTTTCATATGAGTAAAGGACCAGATGAAGATGTTGATATTTTTGACATGGAAGAATTCAAAAGCTTATTTAAGAAAATTCTTCACCGAGCATTAAAAAATGTGACCGTGAGCTTCAGGGATGCCCAGGAGAATGCAGTCTGGATTCGCATCGCCTGGGGAACTCAGCACAAAAAGCCCAACCAGTACCAGCCTACTTACGTGGTGTACCATTCCCAGACTCCGTTCGCCTTCGCTTCTTCCTCCAGGCTGAAGAGCACTGTACCCCTTCTGGGTCAGGCACTGACAGTCGCCAGCAAACACCACCAGATCGTGCAGATGGACCTGAGAAGCCGCCACCTGGACTCTCTCAAAGCCATCGTTTTTAAACAGTTCAATCAGACCTTTGAAAATCACAACTCTACAACACCTCTTCAGGAAAGAAGCCTTGGAGTAGATATAAACATGGATTCAAGGATCATTCATGAAAACACCATAGAAAAAGAGAGGGTCCGAAGAGTAACTCAAGAAACATTTGGGGTCTGCCCTCAACCTCAGCTAGAGTTTGCACAGTACAAGCTTGAAACGAAGTTCAAAGGTGACTTATATGGGGGCATCTTGGCCAAGAGGGAAGAGCCCCTACGGTGCCTGATAAAGTTCTCCAGCCCACATCTTTTGGAAGCACTGAAATCCTTAGCTCCAGCCGGTATTGCAGATGCTCCACTTTCTCCATTGCTCACCTGCATACCCAACAAGGCAATGAATTATTTTAAAATTAGAGATAAGTAA

XM_004842799.1 Coding sequence

Bcmo1 beta-carotene 15,15'-monooxygenase 1, transcript variant X2

Length: 1413 bp    Location: 6180872..6146876   Strand: -
>XM_004842799.1
ATGGACGTCCTATTCGGCAGGAACAAGAAAGAGCAGCTGGAGCCTGTGCAGGCCCAAGTGACAGGCAGGATTCCTCCCTGGCTCCAGGGGACCCTGCTTCGCAATGGGCCTGGGATGCACACGGTGGGTGACAGCAGATACAACCACTGGTTCGATGGCCTGGCCCTGCTACACAGCTTCACCATCAGGGACGGTGAGGTCTATTACAGGAGCAAATACCTGAAAAGCGACACTTACAACGCCAATGTCGAGGCAAACAGGATTGTGGTGTCAGAGTTTGGGACAATGGCCTATCCAGACCCCTGCAAAAACATCTTCTCCAAAGCTTTCTCCTACCTGTCCCACACCATCCCTGATTTCACAGACAACTGCCTGATCAACATCATGAGGTGTGGGGAAGACTTCTATGCGACCACGGAGACCAATTACATGAGGAGGATCAACCCTCAGACACTGGAGACCCTGGAGAAGGTGGATTATCGGAAATATGTGGCTATAAATCTGGCAACAGCACATCCTCATTATGATGAGGCTGGAAATGTTCTCAATATGGGCACATCCATTGTGGACAAGGGGAGGACAAAATACGTGATATTTAAGATCCCTGCCACAGTGCCAGAGGCCAACAGGAAGGGGAAGAGCCCCCTGAAACACACAGAGGTGTTCTGCTCCATCCCCTCCCGCTCGCTCCTCTCCCCCAGCTACTACCACAGCTTTGGGGTCACCCAGAACTATGTGGTGTTTCTGGAGCAGCCCTTCAGGTTGGACATTCTCAAGATGGCGACCGCGTACATGCGAGGAGTGAGCTGGGCATCCTGCATGGCTTTCCACAGGGAGGACAAGAATGCAGAAGTGGGCACAAATCTAATCAAAGTGGCATCTACAACAGCAACTGCCCTGAAGGAAAGGGATGACCAGGTGTACTGCCAGCCGGAATTGCTGTTGGAAGGCTTGGAGCTCCCTCAGATCAATTACACTCACAACGGAAAGCCATATCGATACGTCTTCGCTGCTGGAGTTCAGTGGAGTCCAATCCCAACCCAGATACTCAAGTATGACACTCTCACTAAGTCATCCCTGAGGTGGGGAGAGGAGAGCTGCTGGCCAGCAGAGCCCCTGTTTGTGCCTGCGCCAGGCGCCAAGGACGAGGATGATGGAGTTATCTTATCAGCCATTGTCTCTACTGACCCCCAAAAGCTGCCTTTCCTGCTCATCCTGGATGCCAAGAGCTTCACAGAGCTGGCACGCGCCTCCCTTGCCGTGGAGATGCACCTGGACCTCCATGGGTTGTTCATCCCCGATGCAGATGGGGCTGCAAGGAATCAGGCCACTTCCGAGACAGAGCAGGCCCCGGCTTCAGGCTGCCAGGGGCCCCACAGGCCTGACGGGGCTGGTGGGCTTGGGCTCCCCTAG

XM_004842801.1 Coding sequence

LOC101724981 chromosome unknown open reading frame, human C16orf46

Length: 1107 bp    Location: 6285322..6289088   Strand: +
>XM_004842801.1
ATGGATCTCTGTCAGGAAAGTGAGACTGATTTAGAAAATAATGAAATTCAAAGCCCAGAAGAAACTGAACTAACCTTTACTTGTGCGGGTGAAAGAAGTGAAAAGAATCACATTTACTGTCTTCTCGACATCAGTGACCTTACGCTGGAAGAGGACGCTGGAGCCAATGAGTTTGCAATTGGCACTGGCTGGGAAGAAGCCGTCCAAGGCTGGGGAAAGACTTCTCCCACTGCCTGCATCTGGCCCAGGAAGAAACTGAAGAAGGCTCGGGGCTGCGCCAGTGCCAGCAGCAGCTGCTTGCTCTGTGCCAGCCTCTCCCCAGGGAGCCCAGAGGCCAGGCCTCCCACCTGGCCCAGGAAGGTGGAGGCCGGGGCGGAGGTGGGCCTGGAGGGGAGTCAGGGCTCCCAGGGCCCGAACACGGCTCCCAGGGAGGCCAGCAGAATCTGCTTCCCCCACGATGTCCCTGAAGGAAAAAAAAGCCTGCGAATGAAGGAGTTCATCTGGCGCCTGGAGGACTGGGCCATCCCCGGGGTGAGGGGCGCGGCCGCTGAGCGAGCGCCCACCGCGCCCACCGTCTCCGACTCCCTGAGCTCCAAGGCCCACCTGGTTCTGCCGCCCCTGAGAGCCTCAGCCCAGAGCCGCCTGAGTAAGAACTTGTTCTGTCAGTCAGAAGAGGAGGCGCCGAGTGTGGACAAGGAAGAGGGTGTGGACGGGAAAGGGGAGCAGGAACCCTTGGAGCTGGCCGGGCACCTTCCGCTCGGTGACGCCCGGCCTGGCCCTGGCCCTGCCCCCGCGGCCCGGTCCCTGCTGGCCCACGCGGAGCGGTGCTGCCTGAGCTGGTCCCTGCTGCCTGAGAGGAGCCCCGGCTCCCTCCCCTACTTCGCCACCGTGCAGCCCCTGCAGAAGCGCGGCATGCAGAGCTACAGGGCCAAACTGAAAGCCAGGGGGCTGGGGCTGCCCAGGAACTCACAAAAGCTTGCCTTCCCAGAGGCCAGGCGCGAGAACAGGCCGCCTGTGCTGGAGACCGACGTGCTCCCCAGGTCTCTCCTGCCCGCCCTCACCGTGAGCAGAGTCGTCATCCCTGTCTCCACGCACAGAGTCCTCTGA

XM_004842803.1 Coding sequence

Cmc2 COX assembly mitochondrial protein 2 homolog (S. cerevisiae), transcript variant X1

Length: 1779 bp    Location: 6340357..6368955   Strand: +
>XM_004842803.1
ATGTCTACAAAGCGCCCACCTGTGTCTCCTGATTCTGGTGAAAAGAAGAGGAGGAAGGCAATTACTCTTGAGATGAAACTGAAAATCATTGCTCAGCATGAGGGTGGCAAACCAGTAATGGTCATCTCACGTGAGTTAGGACTTTCCCAATCCACCATCTCGACCATTCTAAAGGATAAGAAGCGAATCAGTGATGCAGTGAAATCGTCGGCATCAATTAAGTCCACTGTCATCACAAAGAAAAGAGCTGGGCCAATTGATGATATGGAAAAGTTACTGGTCAAGTGGATAGAAGAGCAGATTCAGAATCGTATACCACTTAGCCTACTGATGATCCAGGCTAAGGCAAGAAGTCTTTTCAATATGCTAAAAGAGCATGCCGATCCTACGTATACACAGATGTTTACAGCAAGTCATGGATGGTTCCAACGTTTCAAAAAGCGTCATAATTTTCATACTGTTAAGGTCACGGGCGAGGCAGCAGGTGCTGATATTGAATGTGCTGAAGCTTTTAAGGAAGAGCTGCACAGTATAATTGTAGATCAGAAATATTTACCTGAACAAATATTTAACGTTGACGAAACAAGCTTGTTCTGGAAGCGTATCCCAGAGTGCACATACATTCATCAAGAGTCCAAGGCAATACCAGGATTCAGAGACCATGTAACTCTGCTTTTGGGTGGAAATGTTGTAGGGCTCAAATTAAAGCCTTTGCTAATCTACCACTCGGAGAACCCTAGAGCCTTCAAGAATGTGAGCAAACATACACTTCCTGTTCACTATCGCCATAACAAGAAAGCCTGGATGACATCGGCATTGTTTGAAGACTGGTTTTTGAACTGTTTTATTCCACAGGTAAAAGAATATTGTAAGCAAAACAACATTGCATTTAAGATTCTTCTGATTTTAGATGATGCTCCTGGGCATCCACAACATATTGGCACCATGCATCCTGATGTAAAAGTGGTCTATTTACCGCTGAACACTACCATGCTCATTCAACCAATGGACCAAGGTGCAATAGCTGCATTCAAAGCACAATACTTACGTCAAACATTTACGCAGGCTGTCAGAGCAACTGAATCTGGCCAAACACTCCTAGAGTTTTGGAAAGGGTTTAACATTCTGAATGCTATCCAGAATATTGCTGCAGCATGGGAAGAAGTCACAGAGCAGTGCATGAACTGCATTTGGAAGAAAGTTTTGAAGACATATGGGAACACATTCAAAGGCTTTAACAAAGATCACACTGTTGATGAAATAGTAGGTAATAAGATATTAGTGGTTGGAAAACAGCTAGAATTGGACATCAATGAAGAGGATATTCATGAGATTGTCAGCATTAAGGCTGAGGAGATTTCTAATGAGGAACTGATTGAATTGCAGGAAGAAAGAAGTAAGGAAGTTGAAGCAGAGGAAGAAATTGTACCCAAGCAACTAAAAAAGTTCACAACAAAAAAACTGGCAGAGGCATTTGCTACCATCAGCAGGGGCATGAGAATGTTAGAAGAAATGGATGGCAATTATGAGAGATTTGCAAGAGCCGACAGGCAGATACAGGATGCTCTTGTTTGTTATAGAGAAATATATGATGAAAAGAAAAAACAAACTGTGTGTTCAAAACTTGATAGCATCATGAAAAACACTGTGCCTGCTAAGCCATCAACAAATGTCAATGCTCCCATGCCTTCCATCAGCTATTCTCAAGTCTCCTCAGAAGGGAGGAAAATTGATAACCCAGGAGCTGTAGCATCCACATCATCCAGGAATAAATTTTAG

XM_004842795.1 Coding sequence

LOC101722740 mitochondrial import receptor subunit TOM20 homolog

Length: 438 bp    Location: 5733495..5734067   Strand: +
>XM_004842795.1
ATGCGGGGTCGGAACAGCGCTATCGCCGCCGGCGTGTTCCGGGCCCTCTTCATCGGCTACTGCATCTACTTCGACCGCGAGAGGCGAAATGATCCCAACTTCAAGAATAGGCTTCGTGAACGAAGAAAGAAACAGAAGCTTGCCAAGGAGAGAGCTGGGCTTTCCAAGTTACCTGACCCTAAAGATGCTGAACCTGTTCAAAAATTCTTCCTTGAAGAAATACAGCTTGGTGAAGAGTTTCGAGCTCAAGGTAAGTATGAGAAAGGTGAGGACCATCTGACAAATGCAGCTGCTGTGTGTGGACAGCCACAGCAATTGCTGCAGGTGTTACAGCAAACTCTTCCACCACCAGTGTTCTGGATGCTTCTCACTAAGCTCCCAACAATTAGTCAGAGAATTCTAAGTGCTCAGAGCTTGGCTGAAGATGATGTGGAATGA

XM_004842791.1 Coding sequence

Sdr42e1 short chain dehydrogenase/reductase family 42E, member 1, transcript variant X4

Length: 1182 bp    Location: 5494825..5504483   Strand: +
>XM_004842791.1
ATGGACTCCCAAAGATCTCCAAAGGAAACTGTCCTCATTACAGGAGGAGGTGGCTACTTTGGTTTCCGCCTCGGCTGTGCGCTGAGCCGGAAGGGAGTCCGTGTGATTCTGTTTGACATCAGCAGCCCTGCTCAGACCATCCCACAAGGAATGAAGTTTGTACTTGGAGACATCCGCCACCTTTCTGACGTGGAGAGGGCCTTCCAGGACTCAGACATCTCATGTGTGTTCCACATTGCCTCTTATGGCATGTCGGGGCGGGAGCAACTGAACCAAAACCTGATTGAGGAAGTCAACGTGGGTGGCACCGACAATGTCCTGCAGGCCTGCTGCAGGAGAGGGGTTCCCAGACTGGTGTACACGAGCACTTTCAATGTCATCTTTGGAGGCCAAGTCATCAGAAATGGAGATGAGTCCCTGCCTTACCTGCCGCTTCACCTGCACCCTGATCACTACTCTCGGACCAAATCTATTGCAGAGAAGAAGGTGCTAGAGGCAAATGGCTCTGCCCTGGAGACAGGAGATAATGTCTTAAGAACCTGTGCTCTGAGACCAGCTGGCATCTATGGGCCTGGAGAACAAAGGCACCTTCCCAGGATAGTGAGTTACATTGAGAGGGGCCTGTTCAGTTTTGTGTATGGTGACCCCAGCAGCCTGGTTGAGTTTGTCCATGTGGATAACTTGGTGCAGGCACACATTCTAGCCTCAGAGGCCCTGAAGGTTGATAAGGGCCACACTGCCTCTGGGCAGCCCTACTTCATCTCAGATGGCAGACCAGTGAACAACTTTGAGTTCTTCCGGCCTTTGGTTGAGGGCCTGGGCTACAAGTTCCCATCCACCCGCCTGCCACTCACCCTGGTCTACTGCTTTGCTTTCCTGACAGAGATGTCCCACTTCATCATTGGCCGACTCTACAACTTCCAGCCTTTCCTCACCCGCACTGAAGTTTATAAAACTGGTGTCACACATTACTTCAGCCTAAAGAAAGCCAAGATAGAGCTTGGTTATGAGCCTCAGCCGTTTGACCTGCAGGAAGTAGTAGACTGGTTTAAAGCCCATGGTCATGGCCGAAGTCCTGGAAATGGAGACTCAGAGTTTCTTCTTTGGCATGGGCTGTTGATCTTACTCTTGGTTCTATCAGTTTTCACCTGGCTACCACCTACTCTGTTTCTGTCAGTGTGA

XM_004842790.1 Coding sequence

Sdr42e1 short chain dehydrogenase/reductase family 42E, member 1, transcript variant X3

Length: 1182 bp    Location: 5494798..5504483   Strand: +
>XM_004842790.1
ATGGACTCCCAAAGATCTCCAAAGGAAACTGTCCTCATTACAGGAGGAGGTGGCTACTTTGGTTTCCGCCTCGGCTGTGCGCTGAGCCGGAAGGGAGTCCGTGTGATTCTGTTTGACATCAGCAGCCCTGCTCAGACCATCCCACAAGGAATGAAGTTTGTACTTGGAGACATCCGCCACCTTTCTGACGTGGAGAGGGCCTTCCAGGACTCAGACATCTCATGTGTGTTCCACATTGCCTCTTATGGCATGTCGGGGCGGGAGCAACTGAACCAAAACCTGATTGAGGAAGTCAACGTGGGTGGCACCGACAATGTCCTGCAGGCCTGCTGCAGGAGAGGGGTTCCCAGACTGGTGTACACGAGCACTTTCAATGTCATCTTTGGAGGCCAAGTCATCAGAAATGGAGATGAGTCCCTGCCTTACCTGCCGCTTCACCTGCACCCTGATCACTACTCTCGGACCAAATCTATTGCAGAGAAGAAGGTGCTAGAGGCAAATGGCTCTGCCCTGGAGACAGGAGATAATGTCTTAAGAACCTGTGCTCTGAGACCAGCTGGCATCTATGGGCCTGGAGAACAAAGGCACCTTCCCAGGATAGTGAGTTACATTGAGAGGGGCCTGTTCAGTTTTGTGTATGGTGACCCCAGCAGCCTGGTTGAGTTTGTCCATGTGGATAACTTGGTGCAGGCACACATTCTAGCCTCAGAGGCCCTGAAGGTTGATAAGGGCCACACTGCCTCTGGGCAGCCCTACTTCATCTCAGATGGCAGACCAGTGAACAACTTTGAGTTCTTCCGGCCTTTGGTTGAGGGCCTGGGCTACAAGTTCCCATCCACCCGCCTGCCACTCACCCTGGTCTACTGCTTTGCTTTCCTGACAGAGATGTCCCACTTCATCATTGGCCGACTCTACAACTTCCAGCCTTTCCTCACCCGCACTGAAGTTTATAAAACTGGTGTCACACATTACTTCAGCCTAAAGAAAGCCAAGATAGAGCTTGGTTATGAGCCTCAGCCGTTTGACCTGCAGGAAGTAGTAGACTGGTTTAAAGCCCATGGTCATGGCCGAAGTCCTGGAAATGGAGACTCAGAGTTTCTTCTTTGGCATGGGCTGTTGATCTTACTCTTGGTTCTATCAGTTTTCACCTGGCTACCACCTACTCTGTTTCTGTCAGTGTGA

XM_004842788.1 Coding sequence

Sdr42e1 short chain dehydrogenase/reductase family 42E, member 1, transcript variant X1

Length: 1182 bp    Location: 5494798..5504482   Strand: +
>XM_004842788.1
ATGGACTCCCAAAGATCTCCAAAGGAAACTGTCCTCATTACAGGAGGAGGTGGCTACTTTGGTTTCCGCCTCGGCTGTGCGCTGAGCCGGAAGGGAGTCCGTGTGATTCTGTTTGACATCAGCAGCCCTGCTCAGACCATCCCACAAGGAATGAAGTTTGTACTTGGAGACATCCGCCACCTTTCTGACGTGGAGAGGGCCTTCCAGGACTCAGACATCTCATGTGTGTTCCACATTGCCTCTTATGGCATGTCGGGGCGGGAGCAACTGAACCAAAACCTGATTGAGGAAGTCAACGTGGGTGGCACCGACAATGTCCTGCAGGCCTGCTGCAGGAGAGGGGTTCCCAGACTGGTGTACACGAGCACTTTCAATGTCATCTTTGGAGGCCAAGTCATCAGAAATGGAGATGAGTCCCTGCCTTACCTGCCGCTTCACCTGCACCCTGATCACTACTCTCGGACCAAATCTATTGCAGAGAAGAAGGTGCTAGAGGCAAATGGCTCTGCCCTGGAGACAGGAGATAATGTCTTAAGAACCTGTGCTCTGAGACCAGCTGGCATCTATGGGCCTGGAGAACAAAGGCACCTTCCCAGGATAGTGAGTTACATTGAGAGGGGCCTGTTCAGTTTTGTGTATGGTGACCCCAGCAGCCTGGTTGAGTTTGTCCATGTGGATAACTTGGTGCAGGCACACATTCTAGCCTCAGAGGCCCTGAAGGTTGATAAGGGCCACACTGCCTCTGGGCAGCCCTACTTCATCTCAGATGGCAGACCAGTGAACAACTTTGAGTTCTTCCGGCCTTTGGTTGAGGGCCTGGGCTACAAGTTCCCATCCACCCGCCTGCCACTCACCCTGGTCTACTGCTTTGCTTTCCTGACAGAGATGTCCCACTTCATCATTGGCCGACTCTACAACTTCCAGCCTTTCCTCACCCGCACTGAAGTTTATAAAACTGGTGTCACACATTACTTCAGCCTAAAGAAAGCCAAGATAGAGCTTGGTTATGAGCCTCAGCCGTTTGACCTGCAGGAAGTAGTAGACTGGTTTAAAGCCCATGGTCATGGCCGAAGTCCTGGAAATGGAGACTCAGAGTTTCTTCTTTGGCATGGGCTGTTGATCTTACTCTTGGTTCTATCAGTTTTCACCTGGCTACCACCTACTCTGTTTCTGTCAGTGTGA

XM_004842789.1 Coding sequence

Sdr42e1 short chain dehydrogenase/reductase family 42E, member 1, transcript variant X2

Length: 1182 bp    Location: 5496452..5504483   Strand: +
>XM_004842789.1
ATGGACTCCCAAAGATCTCCAAAGGAAACTGTCCTCATTACAGGAGGAGGTGGCTACTTTGGTTTCCGCCTCGGCTGTGCGCTGAGCCGGAAGGGAGTCCGTGTGATTCTGTTTGACATCAGCAGCCCTGCTCAGACCATCCCACAAGGAATGAAGTTTGTACTTGGAGACATCCGCCACCTTTCTGACGTGGAGAGGGCCTTCCAGGACTCAGACATCTCATGTGTGTTCCACATTGCCTCTTATGGCATGTCGGGGCGGGAGCAACTGAACCAAAACCTGATTGAGGAAGTCAACGTGGGTGGCACCGACAATGTCCTGCAGGCCTGCTGCAGGAGAGGGGTTCCCAGACTGGTGTACACGAGCACTTTCAATGTCATCTTTGGAGGCCAAGTCATCAGAAATGGAGATGAGTCCCTGCCTTACCTGCCGCTTCACCTGCACCCTGATCACTACTCTCGGACCAAATCTATTGCAGAGAAGAAGGTGCTAGAGGCAAATGGCTCTGCCCTGGAGACAGGAGATAATGTCTTAAGAACCTGTGCTCTGAGACCAGCTGGCATCTATGGGCCTGGAGAACAAAGGCACCTTCCCAGGATAGTGAGTTACATTGAGAGGGGCCTGTTCAGTTTTGTGTATGGTGACCCCAGCAGCCTGGTTGAGTTTGTCCATGTGGATAACTTGGTGCAGGCACACATTCTAGCCTCAGAGGCCCTGAAGGTTGATAAGGGCCACACTGCCTCTGGGCAGCCCTACTTCATCTCAGATGGCAGACCAGTGAACAACTTTGAGTTCTTCCGGCCTTTGGTTGAGGGCCTGGGCTACAAGTTCCCATCCACCCGCCTGCCACTCACCCTGGTCTACTGCTTTGCTTTCCTGACAGAGATGTCCCACTTCATCATTGGCCGACTCTACAACTTCCAGCCTTTCCTCACCCGCACTGAAGTTTATAAAACTGGTGTCACACATTACTTCAGCCTAAAGAAAGCCAAGATAGAGCTTGGTTATGAGCCTCAGCCGTTTGACCTGCAGGAAGTAGTAGACTGGTTTAAAGCCCATGGTCATGGCCGAAGTCCTGGAAATGGAGACTCAGAGTTTCTTCTTTGGCATGGGCTGTTGATCTTACTCTTGGTTCTATCAGTTTTCACCTGGCTACCACCTACTCTGTTTCTGTCAGTGTGA

XM_004842781.1 Coding sequence

Mlycd malonyl-CoA decarboxylase, transcript variant X2

Length: 1215 bp    Location: 3619775..3604770   Strand: -
>XM_004842781.1
ATGAGAGGCTTCGGGCCAGGCTTCGCCACACGGAGTCTCCTCCCGCTGCGGTTTGCCCCGCGGGCGCCGTGGCCGCCGTGGCCGCCGGGGCCCCTGCGGTGTGTCAGGCCGGCGGCGACGGGCTCCCTGACGCGGACCATGGACGAGCTGCTGCGCCGCGCCGTGCCGCCCAAGCCGGCCTACGAGCTGCGCGAGAAGACGCCGGCGCCCGCCGAGGGCCAGTGCGCCGACTTCGTGAGCTTCTACGACGGCCTGGCCGAGGAGATGAATGGGGTGCTGAAAAGCATGCTCTCAGAATGGTTTTCCCCTGGGTTCCTGAACCTAGAAAGGGTCACCTGGCATTCGCCATGTGAGGTGCTTCAGAAAATCAGCGAGTCTGAGGCCGTGCATCCTGTAAAGAACTGGATGGATTTGAAACAGCGCGTGGGGCCCTACAGGCGGTGTTATATCTTTTCTCACTGTTCGACCCCTGGGGAGCCCCTGATCGTTCTGCATGTGGCGCTCACCAGCGACATTTCCAACAATATCCAGGCCATCATAAAGGAGCGGCCCCCGTCAGAAATGGAGGAGAGGGGCAGAATCACCACCGCCATCTTTTACTCCGTCAGCCTCATACAGCAGGGACTGCAGGGCGTCGAGCTGGGAACTTTCCTCGTAAAGCGGGTCCTCAACGAGCTGCAGAAAGAGTTTCCTCAGCTGGGGGCCATTTCCAGTCTGTCACCCATACCTGGATTCACCAAGTGGCTTCTGGGGCTTCTGAGCTCGCAGACAACGGAGCATGGGCGGAAGGAACTGTTCACAGATTCGGAGCATAAAGAAATCGCCGAGATTGTCGGCAGCCCAGTCCACGAGACCCTCAGGGTTCTCCTCAGCAGCAGCGAGTGGGCACAGTCGGAGAAGCTGGTGCGGGCGCTCCAAGTGCCCCTGATGCGGGTCTGCGCCTGGTACCTGTACGGGGAGAAGCACCGCGGCTTCGCCCTCAGCCATGTGGCCAACTTCCACCTGCAGAACGGGGCTGTGATGTGGCGGATCAACTGGATGGCCGACCGCAGCCCCAGGGGCCTCACCAGCTCATGTGGCCTCATGGCCAACTTCCGCTACTACTCAGAGGAGCTGGGCCCCAACAGCACCGCCTACCTGGGCTCTAAGAGCATCAAGGCTTCCGAGCAGGTCCTCCGCCTGGTGGCCCAGTTCCAGGAGAACAGCAAGCTCTAG

XM_004842778.1 Coding sequence

Slc38a8 solute carrier family 38, member 8

High confidence: 4 potential gene matches
Length: 1299 bp    Location: 3524770..3547445   Strand: +
>XM_004842778.1
ATGGAGGAACAGCCCCGAGGAAGCGGAGGCCTTCCAGAAAAGCCGCTCCCCGCCCCTGCTGTCCCCACTTTGTCCTCGTTGGGTGCTGTCTTCATTCTGCTGAAATCGGCACTGGGGGCCGGCCTGCTCAACTTCCCCTGGGCCTTCCACAAGGCAGGGGGCGTGGTGCCTGCTTTCCTGGTGGAGCTGGTCTCCTTAGTGTTCCTGATCAGCGGGCTGATCACCCTGGGCTACGCAGCCTCCGTCAGCGGCCAGGACACCTACCAGGGCGTGGTCCGAGGGCTGTGTGGCGCCGCCATGGGGAAGCTGTGTGAGGCCTGCTTCCTCCTCAACCTGCTCATGATCTCCGTGGCCTTCCTCAGGGTGATTGGGGACCAGCTGGAGAAGTTGTGCGAAGCCCTCCTGCCTGGCATCCCACAGCCCTGGTTCACTGCCCAGCGCTTCACGCTGCCCCTACTCTCCACACTGGTCATCCTGCCCCTGTCCGTGCCTCGGGAGATCGCCTTCCAGAAATACACCAGCATCCTAGGCACCTTGGCTGCCTGCTACCTGGCCCTGGTCGTGACGGCACAGTACTACCTCTGGCCCCAGGACTTCAAGCACGAGCCCCACCCCTCACAGAGCCCCTCCTCCTGGACCTCGCTGTTCAGTGTCTTCCCCACCATCTGCTTCGGATTCCAGTGTCACGAAGCTGCTGTGTCCATCTACTGTAGCCTGCGCCCGCGGAGCCTGTCCCACTGGGCCCTGGTCTCTGTGCTGTCCTTGCTGGCCTGCTGCCTCGTCTACTCACTGACAGGGGTTTATGGCTTCCTGACCTTCGGGACGGAAGTTTCCGCTGACATCTTGATGTCCTACCCGGGCAACAACACAGCCATCATCACTGCCCGGGTCTTCTTTGCCGTCTCCATCGTGACCATCTACCCCATCGTGCTCTTCCTGGGGAGGTCCGTAATACAGGACTTCTGGAGGTGGAGCTGCTGTGGGGCGCAGGGGCCACTGGTGCTGGCCGACCCCTCGGGGCCGTGGGTTCGGGTGCCACTGACTGCCCTGTGGGTGGCTGTGTCGCTCGCTATGGTCCTGTTCCTGCCCGACCTCAGCAGCATCATCGGTATTATCGGCGGTGTGAGCGCCTTCTTCATCTTCATCTTCCCAGGTTTGTGCCTCATCTATGCTGTGGATGTCGAGCCCATAAGACCAAGAGTCAAGTGCTTCCTGGAGGCCTGGGGTGTGGTCTCGGCGCTGCTGGGCACCTTCATCTTCGGGCAGAGCACGGTGGCCACCATCCTGGAGCTGCTCTGA

XM_004842773.1 Coding sequence

Hsdl1 hydroxysteroid dehydrogenase like 1, transcript variant X2

Length: 993 bp    Location: 3441906..3462857   Strand: +
>XM_004842773.1
ATGGCTGCTGTTGACAGCTTCTACCTCTTGTACAGGGAAATTGCCAGGTCTTGCAATTGCTATATGGAAGCTCTGGCTTTGGTTGGAGCCTGGTACACGGCCAGAAAAAGCATCACCGTCGTCTGTGACTTTTACAGCCTGATCAGACTGCACTTTATCCCTCGCCTGGGGAGCAGAACAGACCTGACCAAGCAGTATGGAAGATGGGCCATCGTCAGTGGTGCGACCGATGGGATTGGAAAAGCCTATGCTGAAGAGCTAGCAAGCCGAGGTCTCAATATTATTCTGATTAGCCGGAACGAAGAGAAGTTACAGAATGTTGCTAAAGACATAGCTGACACCTACAGAGTGGAAACTGATGTTATAGTTGCAGACTTCAGCAGAGGCCGTGAGATCTACGATCTGATTCAGGAAGCTCTGAAAGACAGAGATGTTGGCATCTTGGTGAATAACGTAGGCGTGTCTTATCCCTACCCCCAGTATTTCACGCAGGTCTCCGAGGACAAGCTGTGGGACATCATAAATGTGAACATTGCGGCCGCCAGTTTGATGGTCCACATAGTGTTACCCGGAATGGTGGAGAGAAAGAAAGGTGCTATTGTCACCATCTCCTCTGGCTCCTGCTGCAAACCCACTCCCCAGCTGGCGGCATTTTCTGCTTCTAAGGCTTACTTAGACCACTTCAGCAGAGCACTGCAGTATGAGTATGCTTCTAAAGGAATCTTTGTGCAGAGTCTAATCCCGTTCTACGTTGCTACCAACACGGCTGCTCCTCGAAGCTTTCTGCACAGATGCTCATGGTTGGTGCCTTCGCCAAAAGTATACGCACATCACGCTGTCTCTACCCTCGGAATTTCCAAAAGGACCACGGGGTACTGGTCCCACTCCATTCAGTTTCTTTTTGCCCAGTATATGCCTGAATGGCTGTGGGTATGGGGAGCAAATATTCTCAATCGCTCGTTACAAAAGGAGGCCTTATCCTGCAAAGCATGA

XM_004842775.1 Coding sequence

Mbtps1 membrane-bound transcription factor peptidase, site 1, transcript variant X1

Length: 3165 bp    Location: 3466773..3521830   Strand: +
>XM_004842775.1
ATGACCATGAAGCTTGTCAACATCTGGCTGCTTCTGCTAGTGGTTTTGCTCTGTGGGAAGAAACATCTGGGTGACAGACTGGAAAAGAAATCGTTTGAAAAGGCCCCATGCCCTGGCTGTTCCCACCTGACTTTAAAGGTGGAATTCTCCTCAACAGTTGTGGAATATGAATATATTGTGGCTTTCAATGGATACTTCACGGCCAAAGCTAGAAATTCATTTATTTCAAGTGCTCTGAAGAGCAGTGAAGTAGACAACTGGAGAATTATACCTCGGAACAATCCATCCAGTGACTACCCTAGTGACTTTGAAGTGATTCAGATAAAAGAGAAACAGAAAGCGGGGCTGCTAACACTTGAAGATCATCCAAACATCAAACGGGTAACACCCCAGCGGAAAGTCTTTCGCTCCCTGAAGTTCGCGGAGTCTGACACTCTCGTACCTTGCAATGAAACCCAGTGGAGCCAGAAGTGGCAGTCATCACGTCCCCTGAGAAGAGCCAGTCTGTCCCTGGGCTCTGGCTTCTGGCACGCCACAGGACGGCATTCGAGTAGACGGCTGCTGAGAGCCATTCCACGCCAGGTTGCCCAGACGCTGCAGGCAGACGTGCTGTGGCAGATGGGATACACAGGTGCTAATGTCAGAGTTGCTGTTTTTGATACTGGGCTGAGCGAGAAGCATCCCCACTTCAAGAATGTGAAGGAGAGAACCAACTGGACCAATGAGCGAACCCTGGATGATGGGCTGGGCCATGGCACATTCGTGGCAGGTGTGATTGCCAGTATGAGGGAATGCCAAGGGTTTGCTCCAGATGCAGAACTTCATATTTTCAGGGTCTTCACCAACAATCAGGTATCTTACACATCTTGGTTTTTGGACGCCTTCAACTATGCCATCTTAAAAAAGATTGATGTGCTAAACCTCAGCATCGGAGGTCCCGACTTCATGGATCATCCCTTTGTTGACAAGGTGTGGGAATTAACAGCTAACAACGTAATCATGGTCTCTGCTATTGGCAACGACGGGCCTCTTTATGGCACTCTGAATAACCCCGCTGATCAGATGGATGTGATTGGAGTGGGTGGCATTGACTTTGAAGATAACATCGCCCGCTTTTCCTCCAGGGGAATGACCACCTGGGAGCTACCAGGAGGCTACGGTCGTGTGAAACCTGATGTTGTCACCTATGGTGCTGGAGTGCGGGGTTCCGGTGTGAAAGGGGGTTGCCGAGCCCTCTCAGGGACCAGTGTCGCCTCTCCGGTGGTCGCAGGGGCCGTCACCTTGTTGGTGAGCACAGTCCAGAAGCGTGAGCTGGTGAACCCTGCTAGCATGAAGCAGGCCCTGATTGCATCCGCCCGGAGGCTGCCTGGTGTCAACATGTTTGAGCAAGGCCATGGCAAGCTGGATCTGCTCAGAGCCTACCAGATCCTCAGCAGCTACAAGCCCCAGGCCAGTCTGAGCCCCAGCTACATCGATCTGACCGAATGTCCCTACATGTGGCCCTATTGCTCCCAGCCCATCTACTATGGAGGAATGCCAACAATTGTCAATGTCACCATTCTCAATGGCATGGGGGTCACAGGAAGAATTGTGGATAAGCCTGACTGGCAGCCTTACCTGCCACAGAATGGAGACAGCATTGAAGTCGCTTTCTCTTACTCCTCGGTGTTATGGCCTTGGTCAGGCTACTTGGCCATCTCCATTTCTGTGACCAAGAAGGCAGCTTCCTGGGAGGGCATTGCCCAGGGCCATGTCATGATCACGGTGGCTTCCCCAGCGGAGACGGAATCAAAAATTGGTGCAGAACAGACATCAACGGTGAAGCTCCCAGTTAAGGTGAAAATAATTCCTACCCCACCCCGGAGTAAGAGGGTCCTCTGGGATCAGTACCACAACCTCCGATACCCCCCTGGCTACTTCCCCAGGGACAACTTGAGGATGAAGAATGACCCTCTGGACTGGAACGGTGACCATATCCACACGAACTTCAGGGATATGTACCAGCATCTGAGAAGCATGGGCTACTTTGTGGAGGTCCTCGGCTCTCCCTTCACGTGCTTCGATGCCACGCAGTATGGAACTTTGCTAATGGTGGACAGTGAGGAGGAGTACTTCCCTGAGGAGATCGCCAAGTTGAGGAGGGACGTGGACAATGGCCTTTCGCTTGTCATCTTCAGTGACTGGTACAACACTTCTGTTATGAGAAAAGTGAAGTTTTATGATGAAAACACGAGGCAGTGGTGGATGCCGGATACTGGAGGAGCCAACATCCCAGCTCTGAACGAGCTGCTGTCTGTGTGGAACATGGGGTTCAGTGATGGCCTGTATGAAGGGGAGTTTACCTTGGCCAACCATGACATGTACTATGCTTCAGGGTGCAGCATTGCTAAATTTCCAGAAGATGGCATAGTGATAACACAGACTTTTAAGGACCAAGGCTTGGAGGTTTTAAAGCAGGAGACAGCGGTCGTTGAAAATATCCCCATTTTAGGACTTTATCAGACTCCAGCTGAGGGTGGAGGCCGGATTGTGTTGTATGGAGACTCCAATTGCTTGGATGACAGTCACCGACAGAAAGACTGCTTTTGGCTTCTGGACGCGCTCCTTCAGTACACATCATACGGGGTCACCCCGCCCAGCCTCAGCCACTCGGGGAACCGGCAGCGCCCTCCCAGCGGAGTGGGCTCGGCTGCTCCCGAGAGGATGGAAGGAAACCATCTTCATCGGTACTCCAAGGTCCTTGAGGCCCATTTGGGAGACCCGAAGCCTCGACCTCTGCCGGCCTGTCCACACCTGTCATGGGCCAAACCACAGCCTTTGAATGAGACAGCGCCCAGTAATCTTTGGAAACATCAAAAGTTGCTCTCCATCGACTTGGACAAAGTGGTGTTACCCAACTTTCGATCGAATCGCCCTCAAGTGAGACCCTTGTCCCCTGGAGAAAGTAGTGCCTGGGACATTCCTGGAGGGATCATGCCTGGCCGCTACAACCAGGAGGTGGGCCAGACCATCCCTGTCTTCGCCTTCCTGGGAGCCATGGTGGTCCTGGCCTTCTTTGTGGTGCAAATGAACAAGGCCAAGAGCAGGCCAAAGCGGAGGAAGCCCAGGGTGAAACGCCCGCAGCTCATGCAGCAGGTTCACCCTCCCAGGACCCCATCCGTGTGA

XM_004842769.1 Coding sequence

LOC101711988 TATA box-binding protein-associated factor, RNA polymerase I, subunit C-like, transcript variant X2

Length: 2661 bp    Location: 3403145..3412706   Strand: +
>XM_004842769.1
ATGTTCGAGAGCGCGAGGAGGTGCCGGGGGTGCGGGGTCCGAACCCCGGTCCCCTGTTCCAGGCCCACGTGTGCTCCGCCTGGAGCTGATGCCGGCGCAGCCGGGTTCTGCCGCCCTGGAGTGGAGGTGATGGACTTCCCCAGCTCCCTCCGCCCCTCATTGTTCCTGACTGGCCCCCTTGGTGTGAGCGATGTCCCCGACCTGTCCTTTATGTGCAGCTGGAGAGACGCGCTGACCCTGCCAGAGTCCCCACCCCAGGACTGTAAGAACACAGCTCCGCACTTGGCCGAGGCCCTGCTATGGGAGCCAGCGATGCCTGGGCCCCTCCCGCTGCTGCCTCCCTGTCCCGACCCCTGGGACCCTGGTGTGACCGCACAGGACCTCCTTTTCCGAGGCGGTTTCCGCTACCGGAGGCAGCCCCAGGTCGTGTTGGACGTCACTGAACAGCTCAGCAGGTTCCTGTGGAATCATGGGGACATAGCCTTTGGTCCCCTGGGGAAGATGATGCTGGAGAATTTCAAACTGGAGGGAGGCCGGAACCGCTCTAAGAAGATGACAGTGGTCAGCGCTAAGAGGCTGCTGCAGGACCTCGGTGGACACCAGCCCTGGGGGTGTCCCTGGGCCCACCTCAGCCACCGACTGCGCCGCTTCGCCATCGTTGGGGGCCCGGTGCTGGGCAAGTCAGTGTCGAGTCTGCTGGGGAGGCTGCTGCACGAGGAGCTGGCCACGCGCTGGGAGCAGCTGCTCCTGGATGAGGCCTTCACTGGAGGCACCCTGGCCTGGCTGCCTGGAAGGACCCCGCAGGTGGGCCAGCTGGTCTACCCAGCTGGCGGTGCCCTGGACAGGCTTCGTTTCCAGGAGGTCAGTCTGACCTCAGGCAGTGACCCCCAGGTCCTTGGGGACCCTGGGTGCATCCAGCTCCAGGGACCTGTGCGCCAGGTGGTGACCAACACTGTCCAAGGAGAAACGCTGCTGGCTGTGCGCTCTGACTACCACTGTGCTGTGTGGAAGGTGAGGAGGCAGCGGCGGCCGGCCCCTCTGCAGGTGCTGCGGGTTGCGAAGGGGGCCACGGGGATCAGTCTCAGCCCTCACCTCCCTGGGGAGCTGGCCATCTGCAGCCGTTCCGGAGCCGTCTGTCTGTGGACCCCCCAGGATGGGCTGCAGCAAGTCTACAAGGACCCAGAGACCCTGGTGTTCCGGGACCCTTCTCCCTGGCGTTGGGCAGACTTCACTGCCCATCCCCGGGTGCTGACTGTGGGTGACCGCACTGGAGTGAAGATGGTCGACACTCAGGGCCCCCCGGGATGTGGTCTGCTGCTTTTCCGGGCAGGGGCTGAGGCCTCCTGCCAGAAAGGGGAACGTGTCCTGCTCACGCAGTACCCGGGGCAGTGCAGCCCCGAGTCACTGCCCCCGACTCTGCATCTCATCTGTACCCAGTTCTCGCTCTACCTGGTGGATGAACGCCTGCCCCTGGTGCCCATGCTTAAGTGGAATCATGACCTCCCCTCCCCCGCCCTGCTGGCCCGCCTGCTGCCTCCAGCCGGTCCTGGCTGCCCACAGCCTCTGTTCTTGGGTGGCCTAGGTGGGCAGGTACAGCTGCTGCATATCACAGGTGAGGCCTCTGCACCCCGACTGGCCGGGCCCCCCCAGTCTCTACCTTCCCTGACTGACTGCCTCTCTGCATTTCCCCTGCTGGAGCCCAAGAGCCACCAGCAGCTGCAGGAGCGACTGGAAGCGCCAACCATAGGTCTGGCCTGTGCCTCCCCGCCCAGTGCCTCCACTCCCACAGCGTGGCTCTTCCAGCTCTCGGCAGCTGGGGATATCTTCTACCAGCACCTCGCTCTCCAAGCAGCGACCAGTTTCCACCGAGACTGCGGGCCTCCTGGCGACCCCAGGCCCGACTCCCCTGCACCCAGGGCAACAGCACCTCCTATGGATCAGAGGCCCCCACCCTCCTGGTCCCCCCAGGTCACTGCCTGGTGCAGCCGCTGGCTGGAGGCCCTGCTGCAGGTGCCGCCTGCATCCCCTGTGTGGACTGCACCCACCTTTTCCCATCGCCGCCTGCTAGGCCGCCTGGAGCCCCAGCCGGTGGAGGGGAAAGTGCCTCAGGCTCTGCGGGCGGCCATGGCCAGGGGGCGGATTCTGCAGCAGAGGGACCTGGGCCTGCTCCCTCGGGCAGAGCCACCCCCTGCCCCTGAGCCAGGCCCACAGGATGAGCTCAGTGAGCGTCTGGAGGCAGCCTGGGAAGGCCAGGGGGCTACATGGTGGAAGAGACAGCAGGGTAAGGCCTCGGAGCCAGGGAAGCAGACCAAGCGGCCCAAGCGCCGCACTCCGCTGTCCAGCACCTTCTCTTCGCTCACCAGCTGCTTGGACTTATCAGATACCAGCAGCCCCCCTCACAGCTCAGAGCTCAGGCCCCAGCCCCCTGTGACCCCACACTCCCAGGAGTCAGCTCAGCAACTGTGGGCCCAGGGTGACCACTCAGAGAGGTGGCAGACCCTTGGGGACTACATGGCAGAGCTGCCACTTACAAAGGGCACCCCTCCCCTGGGACATGTGCCCACACCCCCCTCCCAGGCCTCCAGTGTCCAAGCCACACCCTCCCGGCTTCCTACCCCTGGCTCTCAGCCCCACCGGAAGAGGCCACGGATGGGCTTCTGA

XM_004842768.1 Coding sequence

LOC101711988 TATA box-binding protein-associated factor, RNA polymerase I, subunit C-like, transcript variant X1

Length: 2664 bp    Location: 3403145..3412706   Strand: +
>XM_004842768.1
ATGTTCGAGAGCGCGAGGAGGTGCCGGGGGTGCGGGGTCCGAACCCCGGTCCCCTGTTCCAGGCCCACGTGTGCTCCGCCTGGAGCTGATGCCGGCGCAGCCGGGTTCTGCCGCCCTGGAGTGGAGGTGATGGACTTCCCCAGCTCCCTCCGCCCCTCATTGTTCCTGACTGGCCCCCTTGGTGTGAGCGATGTCCCCGACCTGTCCTTTATGTGCAGCTGGAGAGACGCGCTGACCCTGCCAGAGTCCCCACCCCAGGACTGTAAGAACACAGCTCCGCACTTGGCCGAGGCCCTGCTATGGGAGCCAGCGATGCCTGGGCCCCTCCCGCTGCTGCCTCCCTGTCCCGACCCCTGGGACCCTGGTGTGACCGCACAGGACCTCCTTTTCCGAGGCGGTTTCCGCTACCGGAGGCAGCCCCAGGTCGTGTTGGACGTCACTGAACAGCTCAGCAGGTTCCTGTGGAATCATGGGGACATAGCCTTTGGTCCCCTGGGGAAGATGATGCTGGAGAATTTCAAACTGGAGGGAGGCCGGAACCGCTCTAAGAAGATGACAGTGGTCAGCGCTAAGAGGCTGCTGCAGGACCTCGGTGGACACCAGCCCTGGGGGTGTCCCTGGGCCCACCTCAGCCACCGACTGCGCCGCTTCGCCATCGTTGGGGGCCCGGTGCTGGGCAAGTCAGTGTCGAGTCTGCTGGGGAGGCTGCTGCACGAGGAGCTGGCCACGCGCTGGGAGCAGCTGCTCCTGGATGAGGCCTTCACTGGAGGCACCCTGGCCTGGCTGCCTGGAAGGACCCCGCAGGTGGGCCAGCTGGTCTACCCAGCTGGCGGTGCCCTGGACAGGCTTCGTTTCCAGGAGGTCAGTCTGACCTCAGGCAGTGACCCCCAGGTCCTTGGGGACCCTGGGTGCATCCAGCTCCAGGGACCTGTGCGCCAGGTGGTGACCAACACTGTCCAAGGAGAAACGCTGCTGGCTGTGCGCTCTGACTACCACTGTGCTGTGTGGAAGGTGAGGAGGCAGCGGCGGCCGGCCCCTCTGCAGGTGCTGCGGGTTGCGAAGGGGGCCACGGGGATCAGTCTCAGCCCTCACCTCCCTGGGGAGCTGGCCATCTGCAGCCGTTCCGGAGCCGTCTGTCTGTGGACCCCCCAGGATGGGCTGCAGCAAGTCTACAAGGACCCAGAGACCCTGGTGTTCCGGGACCCTTCTCCCTGGCGTTGGGCAGACTTCACTGCCCATCCCCGGGTGCTGACTGTGGGTGACCGCACTGGAGTGAAGATGGTCGACACTCAGGGCCCCCCGGGATGTGGTCTGCTGCTTTTCCGGGCAGGGGCTGAGGCCTCCTGCCAGAAAGGGGAACGTGTCCTGCTCACGCAGTACCCGGGGCAGTGCAGCCCCGAGTCACTGCCCCCGACTCTGCATCTCATCTGTACCCAGTTCTCGCTCTACCTGGTGGATGAACGCCTGCCCCTGGTGCCCATGCTTAAGTGGAATCATGACCTCCCCTCCCCCGCCCTGCTGGCCCGCCTGCTGCCTCCAGCCGGTCCTGGCTGCCCACAGCCTCTGTTCTTGGGTGGCCTAGGTGGGCAGGTACAGCTGCTGCATATCACAGGAAAGGAGGCCTCTGCACCCCGACTGGCCGGGCCCCCCCAGTCTCTACCTTCCCTGACTGACTGCCTCTCTGCATTTCCCCTGCTGGAGCCCAAGAGCCACCAGCAGCTGCAGGAGCGACTGGAAGCGCCAACCATAGGTCTGGCCTGTGCCTCCCCGCCCAGTGCCTCCACTCCCACAGCGTGGCTCTTCCAGCTCTCGGCAGCTGGGGATATCTTCTACCAGCACCTCGCTCTCCAAGCAGCGACCAGTTTCCACCGAGACTGCGGGCCTCCTGGCGACCCCAGGCCCGACTCCCCTGCACCCAGGGCAACAGCACCTCCTATGGATCAGAGGCCCCCACCCTCCTGGTCCCCCCAGGTCACTGCCTGGTGCAGCCGCTGGCTGGAGGCCCTGCTGCAGGTGCCGCCTGCATCCCCTGTGTGGACTGCACCCACCTTTTCCCATCGCCGCCTGCTAGGCCGCCTGGAGCCCCAGCCGGTGGAGGGGAAAGTGCCTCAGGCTCTGCGGGCGGCCATGGCCAGGGGGCGGATTCTGCAGCAGAGGGACCTGGGCCTGCTCCCTCGGGCAGAGCCACCCCCTGCCCCTGAGCCAGGCCCACAGGATGAGCTCAGTGAGCGTCTGGAGGCAGCCTGGGAAGGCCAGGGGGCTACATGGTGGAAGAGACAGCAGGGTAAGGCCTCGGAGCCAGGGAAGCAGACCAAGCGGCCCAAGCGCCGCACTCCGCTGTCCAGCACCTTCTCTTCGCTCACCAGCTGCTTGGACTTATCAGATACCAGCAGCCCCCCTCACAGCTCAGAGCTCAGGCCCCAGCCCCCTGTGACCCCACACTCCCAGGAGTCAGCTCAGCAACTGTGGGCCCAGGGTGACCACTCAGAGAGGTGGCAGACCCTTGGGGACTACATGGCAGAGCTGCCACTTACAAAGGGCACCCCTCCCCTGGGACATGTGCCCACACCCCCCTCCCAGGCCTCCAGTGTCCAAGCCACACCCTCCCGGCTTCCTACCCCTGGCTCTCAGCCCCACCGGAAGAGGCCACGGATGGGCTTCTGA

XM_004842770.1 Coding sequence

LOC101711988 TATA box-binding protein-associated factor, RNA polymerase I, subunit C-like, transcript variant X3

Length: 2163 bp    Location: 3407921..3412706   Strand: +
>XM_004842770.1
ATGATGCTGGAGAATTTCAAACTGGAGGGAGGCCGGAACCGCTCTAAGAAGATGACAGTGGTCAGCGCTAAGAGGCTGCTGCAGGACCTCGGTGGACACCAGCCCTGGGGGTGTCCCTGGGCCCACCTCAGCCACCGACTGCGCCGCTTCGCCATCGTTGGGGGCCCGGTGCTGGGCAAGTCAGTGTCGAGTCTGCTGGGGAGGCTGCTGCACGAGGAGCTGGCCACGCGCTGGGAGCAGCTGCTCCTGGATGAGGCCTTCACTGGAGGCACCCTGGCCTGGCTGCCTGGAAGGACCCCGCAGGTGGGCCAGCTGGTCTACCCAGCTGGCGGTGCCCTGGACAGGCTTCGTTTCCAGGAGGTCAGTCTGACCTCAGGCAGTGACCCCCAGGTCCTTGGGGACCCTGGGTGCATCCAGCTCCAGGGACCTGTGCGCCAGGTGGTGACCAACACTGTCCAAGGAGAAACGCTGCTGGCTGTGCGCTCTGACTACCACTGTGCTGTGTGGAAGGTGAGGAGGCAGCGGCGGCCGGCCCCTCTGCAGGTGCTGCGGGTTGCGAAGGGGGCCACGGGGATCAGTCTCAGCCCTCACCTCCCTGGGGAGCTGGCCATCTGCAGCCGTTCCGGAGCCGTCTGTCTGTGGACCCCCCAGGATGGGCTGCAGCAAGTCTACAAGGACCCAGAGACCCTGGTGTTCCGGGACCCTTCTCCCTGGCGTTGGGCAGACTTCACTGCCCATCCCCGGGTGCTGACTGTGGGTGACCGCACTGGAGTGAAGATGGTCGACACTCAGGGCCCCCCGGGATGTGGTCTGCTGCTTTTCCGGGCAGGGGCTGAGGCCTCCTGCCAGAAAGGGGAACGTGTCCTGCTCACGCAGTACCCGGGGCAGTGCAGCCCCGAGTCACTGCCCCCGACTCTGCATCTCATCTGTACCCAGTTCTCGCTCTACCTGGTGGATGAACGCCTGCCCCTGGTGCCCATGCTTAAGTGGAATCATGACCTCCCCTCCCCCGCCCTGCTGGCCCGCCTGCTGCCTCCAGCCGGTCCTGGCTGCCCACAGCCTCTGTTCTTGGGTGGCCTAGGTGGGCAGGTACAGCTGCTGCATATCACAGGAAAGGAGGCCTCTGCACCCCGACTGGCCGGGCCCCCCCAGTCTCTACCTTCCCTGACTGACTGCCTCTCTGCATTTCCCCTGCTGGAGCCCAAGAGCCACCAGCAGCTGCAGGAGCGACTGGAAGCGCCAACCATAGGTCTGGCCTGTGCCTCCCCGCCCAGTGCCTCCACTCCCACAGCGTGGCTCTTCCAGCTCTCGGCAGCTGGGGATATCTTCTACCAGCACCTCGCTCTCCAAGCAGCGACCAGTTTCCACCGAGACTGCGGGCCTCCTGGCGACCCCAGGCCCGACTCCCCTGCACCCAGGGCAACAGCACCTCCTATGGATCAGAGGCCCCCACCCTCCTGGTCCCCCCAGGTCACTGCCTGGTGCAGCCGCTGGCTGGAGGCCCTGCTGCAGGTGCCGCCTGCATCCCCTGTGTGGACTGCACCCACCTTTTCCCATCGCCGCCTGCTAGGCCGCCTGGAGCCCCAGCCGGTGGAGGGGAAAGTGCCTCAGGCTCTGCGGGCGGCCATGGCCAGGGGGCGGATTCTGCAGCAGAGGGACCTGGGCCTGCTCCCTCGGGCAGAGCCACCCCCTGCCCCTGAGCCAGGCCCACAGGATGAGCTCAGTGAGCGTCTGGAGGCAGCCTGGGAAGGCCAGGGGGCTACATGGTGGAAGAGACAGCAGGGTAAGGCCTCGGAGCCAGGGAAGCAGACCAAGCGGCCCAAGCGCCGCACTCCGCTGTCCAGCACCTTCTCTTCGCTCACCAGCTGCTTGGACTTATCAGATACCAGCAGCCCCCCTCACAGCTCAGAGCTCAGGCCCCAGCCCCCTGTGACCCCACACTCCCAGGAGTCAGCTCAGCAACTGTGGGCCCAGGGTGACCACTCAGAGAGGTGGCAGACCCTTGGGGACTACATGGCAGAGCTGCCACTTACAAAGGGCACCCCTCCCCTGGGACATGTGCCCACACCCCCCTCCCAGGCCTCCAGTGTCCAAGCCACACCCTCCCGGCTTCCTACCCCTGGCTCTCAGCCCCACCGGAAGAGGCCACGGATGGGCTTCTGA

XM_004842761.1 Coding sequence

Map1lc3b microtubule-associated protein 1 light chain 3 beta

High confidence: 1 potential gene match
Length: 384 bp    Location: 3084393..3094250   Strand: +
>XM_004842761.1
ATGCCTTCGGAAAAGACCTTCAAGCAGCGCCGCACCTTCGAACAAAGAGTGGAAGACGTTCGGCTCATCCGGGAGCAGCACCCCACCAAGATCCCGGTGATCATAGAACGGTACAAGGGTGAGAAGCAGCTGCCCGTCCTGGATAAAACCAAGTTCCTCGTCCCTGACCATGTCAACATGAGCGAGCTCATCAAGATCATCAGGCGGCGCTTGCAGCTCAACGCCAACCAGGCCTTCTTCCTGTTGGTGAACGGCCACAGCATGGTGAGCGTGTCCACCCCCATCTCGGAGGTGTACGAGAGCGAGAAGGACGGGGACGGCTTCCTGTACATGGTGTACGCCTCCCAGGAGACCTTCGGGAGGGGGCTGTCCGTGTGCGACTAG

XM_004842758.1 Coding sequence

LOC101707914 forkhead box protein L1-like

Length: 1041 bp    Location: 2642035..2645268   Strand: +
>XM_004842758.1
ATGAGCCACCTCTTTGGTCCCCCGGTGCCAGCTCTGGCCGCCTCATCCATGCTCTATCTGTACGGCCCGGAAAGGCCCGGGCTGCCCCTGGCCTTCGCCCCTGCGGCCGCTCTGGCTGCCTCGGGCAGGGCAGAGCCACCCCAAAAGCCGCCTTACAGCTACATCGCGCTCATCACCATGGCGATCCAGGACGCGCCCCAGCAGAGGGTCACACTGAACGGCATCTACCAGTTCATCATGGACCGCTTCCCCTTCTACCACGACAACAGGCAGGGCTGGCAGAACTCCATCCGCCACAACCTCTCGCTCAACGAGTGCTTCGTCAAGGTGCCACGCGAGAAGGGGCGGCCGGGCAAGGGCAGCTACTGGACGCTGGACCCTCGCTGCCTGGATATGTTCGAGAACGGGAACTACCGGCGCCGGAAGAGGAAGCCCAAGCCCGGAGCCGGGGCCCCGGAGGCCAAACGGGCCCGCGCGGAGCTGCAGGAACGCGGCGCGGAGGCGCAGCTGCCCGTGGGGAGCGGGGAGGGGCGTGCGGGCGCCAGGACCCCCGGCCACCAGGCGGCCGCCGCGCGCCCCTCGACCCCCGGGGAGAGCCGCTCTCCGCCGGCGCCCCTGCGCCGGCCGGGGCCCAAGTTCGAGGACGAGGACGCGGGCAACGCAGCGCAGGGAGCAGCAACCACGGCGGCTTGCGTGGCAGCGCCAGCGCGCACGGAGGACGACCCGGGGTCCCCTCCGCGCCCCGCCTCCCGCAGCTCCCCGAAGAGCACTGACAGGTCCGCGAGCTTCAGCATCGATAGCATCCTGGCGGGAAGGCAGGGCCAGAAGCCGGCCGGAGGGAGTGAGGGCCTGGGGGCCGCCAAGCCGGGGCCCGGAGCTCTGGGCTCCTCGCTCCTGGCCGCCTCCTCGGGACTCCGGCCGCCTTTCAACGCCTCCCTCATGCTCGATCCGCACGTCCAGGGCGGATTCTTCCAGCTGGGGATCCCTTTCCTCACCTACTTCCCTCTGCAGCTTCCTGACCCCGCGCTCCCCTTCCAGTAG

XM_004842755.1 Coding sequence

Mthfsd methenyltetrahydrofolate synthetase domain containing, transcript variant X1

Length: 927 bp    Location: 2626602..2611675   Strand: -
>XM_004842755.1
ATGGAGCCGAGGGCGGGCGTCTCCAAGCAGGACATCCGGGAACAAATCTGGAGCTACATGGAGGCTCACGACGTGGCCAACTTCCCCCGACCTGTTCACCACAGGATCCCCAACTTCAAGGGGTCTCACCTGGCTTCCCAGAACATCCGGGGCCTGGACGTTTTTGCCAGAGCGCAGGAAGTGAAGGTGGACCCGGACAAACCACTGGAAGGCGTGCGGCTGATGGCTTTGCAGAGCCAAAAAACACTGCTGGTTCCGACGCCGCGACTGAAAAGGGGGCTGTTCAACAGGATCACGCCACCCCCCGGGGCGACGGCAGCCGCGCTGCGCAGGTGCGCCACCTCCCAGGGTGTGAGGAACTTCAGCGTCCCCGTGGGCTTGGACTCCAGTGTCCACGTGGACTTGGTGGTGGTGGGATCCGTGGCTGTTTCCGAGAAAGGCTGGAGGATCGGGAAGGGAGAAGGTTACGCAGACCTCGAGTATGCCATGATGGTGTCCATGGGAGCCGTCTGCGAGGGGACACCCGTGGTCACCACCGTCCACGACTGCCAGGTCCTGGACTTCCCGGAAGCACTCCTGGAGGACCACGACCTCACAGTAGACTACATCCTCACTCCAACCAGGGTCATCGCCACCGGCTGCGAGCGCCCAAAGCCAGTGGGCATCACGTGGTCCAAGATCAGCCCTGAGATGCTGGAGAGAATCCCGGTGCTCCGAAGCCTACGAGAGCGAGAGAGGCGGGCTGGGAAGGACGTCAGCCTGTGGGCCGATCTCCCGCACCCGGCACCCCTGTGCACCGTCGTGGGACCCCAGCTCGCACCCCGGCCAGGGTTGAGTGTCCCGGGGGCAGCCTCTGGCAGGATGGGCAGCCCCCAGCAGCGGAGCCACGCTGGACAGACACAGGCCCTCCGCCACCGGCGTCTCTGA

XM_004842756.1 Coding sequence

Mthfsd methenyltetrahydrofolate synthetase domain containing, transcript variant X2

High confidence: 4 potential gene matches
Length: 927 bp    Location: 2626612..2611675   Strand: -
>XM_004842756.1
ATGGAGCCGAGGGCGGGCGTCTCCAAGCAGGACATCCGGGAACAAATCTGGAGCTACATGGAGGCTCACGACGTGGCCAACTTCCCCCGACCTGTTCACCACAGGATCCCCAACTTCAAGGGGGCGTCCAGGGCAGCGGAGCACCTCCCTCGCCTGCAGGAGTTCAGAGTGGCGGGAACCGTCAAAGTCAACCCCGACGCTCCCCAGAGCAAGGCCCGCTTCCTGGTGCTCCAGAGCCAAAAAACACTGCTGGTTCCGACGCCGCGACTGAAAAGGGGGCTGTTCAACAGGATCACGCCACCCCCCGGGGCGACGGCAGCCGCGCTGCGCAGGTGCGCCACCTCCCAGGGTGTGAGGAACTTCAGCGTCCCCGTGGGCTTGGACTCCAGTGTCCACGTGGACTTGGTGGTGGTGGGATCCGTGGCTGTTTCCGAGAAAGGCTGGAGGATCGGGAAGGGAGAAGGTTACGCAGACCTCGAGTATGCCATGATGGTGTCCATGGGAGCCGTCTGCGAGGGGACACCCGTGGTCACCACCGTCCACGACTGCCAGGTCCTGGACTTCCCGGAAGCACTCCTGGAGGACCACGACCTCACAGTAGACTACATCCTCACTCCAACCAGGGTCATCGCCACCGGCTGCGAGCGCCCAAAGCCAGTGGGCATCACGTGGTCCAAGATCAGCCCTGAGATGCTGGAGAGAATCCCGGTGCTCCGAAGCCTACGAGAGCGAGAGAGGCGGGCTGGGAAGGACGTCAGCCTGTGGGCCGATCTCCCGCACCCGGCACCCCTGTGCACCGTCGTGGGACCCCAGCTCGCACCCCGGCCAGGGTTGAGTGTCCCGGGGGCAGCCTCTGGCAGGATGGGCAGCCCCCAGCAGCGGAGCCACGCTGGACAGACACAGGCCCTCCGCCACCGGCGTCTCTGA

XM_004842749.1 Coding sequence

LOC101704882 chromosome unknown open reading frame, human C16orf74

Length: 228 bp    Location: 2141562..2124160   Strand: -
>XM_004842749.1
ATGGGGCTTAAGCTGTCCTGCCTAAAAGGCTTTAAGATGTGCGTCAGCACCAGCGGCAGCCATGATGAGGGCCCCGTGCTGAGCGGCAAGTACCTGGATGTGCCCAACATCATCATCACGCCCCCGACACCCACGGGCATGATGCTGCCCAGGGACTCCAGGCGCACAGACTGGCTGGACAAGGCGGGGTCTTGCCTAGATGACGCAGAGCTGGACCCCGAGGCATGA

XM_004842751.1 Coding sequence

LOC101705610 cytochrome c oxidase subunit 4 isoform 1, mitochondrial-like

Length: 627 bp    Location: 2187449..2193874   Strand: +
>XM_004842751.1
ATGGTGCTCCGCGGCGCGGCCTCCTCTTTTTCCGGTCGTGGGTTCACTCTTCCGGTCGCTGGCAGCCGGGACGCAGAGGGCGGGCGGTCGAAGCGGTCGCCGTGGAGCGGTGGCGGAATGTTGGCTACCAGGGTATTTAGCCTAATCAGCAAGCGAGCCATTTCCACCTCGGTGTGTGCTCGAGCCCATGGGAGTGTGGTGAAGAGTGAAGACTACGCTCTCCCCAGCTATGTCGATCGGCGTGACTACCCCCTGCCTGACGTGGCCCATGTCCAGCAGCTGTCTGCCAGCCAGAAGGCCCTGAAGGAGAAGGAGAAGGCCTCCTGGAGCAGCCTGACCAGGGATGAGAAAGTCGAGTTGTATCGCATTCGGTTCAACGAGAGCTTTGCAGAGATGAACAGGAGCACCAATGAGTGGAAGACAGTTGTGGGCGCCGCCATGTTCTTCATCGGCTTCACTGGCCTCATTCTGATCTGGGAGAAGCGCCACGTGTACGGCCCCATCCCGCACACCTTCGACGAGGAGTGGGTGGCCATGCAGACCAAGAGGATGCTGGACATGAAGGCCAGCCCCATCCAGGGCTTCTCTGCCAAGTGGGACTACGACAAGAACGAGTGGAAGAAGTGA

XM_004842741.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X9

Length: 3606 bp    Location: 1978007..2108734   Strand: +
>XM_004842741.1
ATGAGCCATGAGCCCAAGTCCCCTTCGCTAGGGATGCTTTCCACCGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCCCTCGCCACTCAATGGCGCCCTGGTGCCCAGTGGCAGCCCGGCCACCAGCAGCACGCTGTCGGCCCAGGCCGCGCCATCCTCCAGCTTTGCCGCCGCGCTGCGCAAGCTCGCCAAACAGGCGGAGGAGCCCAGAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842743.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X11

Length: 3426 bp    Location: 2027261..2108734   Strand: +
>XM_004842743.1
ATGTTTGGATTGAAGCCGCCGCTGTATTACTTACCAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842744.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X12

Length: 3396 bp    Location: 2068876..2108734   Strand: +
>XM_004842744.1
ATGAAAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842740.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X8

Length: 3606 bp    Location: 2066981..2108734   Strand: +
>XM_004842740.1
ATGAGCCATGAGCCCAAGTCCCCTTCGCTAGGGATGCTTTCCACCGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCCCTCGCCACTCAATGGCGCCCTGGTGCCCAGTGGCAGCCCGGCCACCAGCAGCACGCTGTCGGCCCAGGCCGCGCCATCCTCCAGCTTTGCCGCCGCGCTGCGCAAGCTCGCCAAACAGGCGGAGGAGCCCAGAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842736.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X4

Length: 3615 bp    Location: 2068876..2108734   Strand: +
>XM_004842736.1
ATGAAAGGCATGAGCCATGAGCCCAAGTCCCCTTCGCTAGGGATGCTTTCCACCGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCCCTCGCCACTCAATGGCGCCCTGGTGCCCAGTGGCAGCCCGGCCACCAGCAGCACGCTGTCGGCCCAGGCCGCGCCATCCTCCAGCTTTGCCGCCGCGCTGCGCAAGCTCGCCAAACAGGCGGAGGAGCCCAGAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842733.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X1

Length: 3654 bp    Location: 2066852..2108734   Strand: +
>XM_004842733.1
ATGCTGATTTGCATATGCTCCCCTCCCCCCGCAGCCTGGAATCCAGGCATGAGCCATGAGCCCAAGTCCCCTTCGCTAGGGATGCTTTCCACCGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCCCTCGCCACTCAATGGCGCCCTGGTGCCCAGTGGCAGCCCGGCCACCAGCAGCACGCTGTCGGCCCAGGCCGCGCCATCCTCCAGCTTTGCCGCCGCGCTGCGCAAGCTCGCCAAACAGGCGGAGGAGCCCAGAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842728.1 Coding sequence

Kiaa0513 KIAA0513 ortholog, transcript variant X1

Length: 1230 bp    Location: 1751461..1797521   Strand: +
>XM_004842728.1
ATGGAGGCCCCAGAGGTGCCTGTGGGCTCTCTGATTGACTTTGGGACTGAGCCGCCAGCCTCCCCTCCCCTGGAGGCCGCACCCCCAGCCCCCCAGGACAGGGACGGCTCCCTGGGCGATGGTGCATCTGAGAGTGAAGCCACGGAATCCGCAGACAGCGAGAACGACATGGGCGAGTCACCCTCGCACCCCTCCTGGGAGCAAGAGCGCCGCTCCTCCTCCAGCGAGTCCTTCTCCTCCACCCAGAGTGCGGAGTCCACCCAGGATGAGGAGACCCAGGCACTCCGCGAGTTCATGTGCAGCTATGTGGAGAAGATCTTCTCGGGACGGGAGGACTTAGACCAGGAGGAGAAAGCCAAGTTCGGAGAGTACTGCAGCAGTGAGGATGGCAAGGGCCGGGAGTGGTTCGCCCGGTACGTGAGTGCCCAGCGCTGCAATTCCAAGTGTGTGTCTGAGCCGACCTTCTACCGCCTGGTGCAGTCCTTCGCCGTGGTGCTGTTTGAGTGCCATCAGATGGATGACTTCGGGCCCGCCAAGAACCTCATGACCATGTGCTTCACCTACTATCACAGCGGCAAGCCGCACCTGCTGCCTGCGGAGCCCAGGGAGAAGGTGGCTGGCAGCATCGATGCCTACCTGAAGTCTGCCAACAGCTGGCTGGCCGAGAAGAAGGACATTGCTGAGCGGCTGCTGAAGAACACGGAGCACGTGAAGGGCTTCTTCGGGGGGCTGGAGACCAAGCTGAAGGGGCCCTTGGTCAGGAAGAACGAGGATGATGAGAACAAACCCAAGGACAAGCAGCCCAAGACTGGTGAGGTGACGGTGCCCAGCCCCGAGGAGGAGCCGAAGGGGGAGAAGATCTACCTGTACACGCACCTGAAGCAGCAGCCCATTTGGCACACGCTGAGGTTCTGGAATGCCGCCTTTTTCGACGCGGTCCACTGTGAGAGGAGAAAGCGGTCCCCCACCACCAGAGGGGATGCTGGAGAGCAGGAGGACAAGAGGGAGAAGTGGTGCCACATGACCCAGGAGGAGCGGGACGACAGTGTGCGGTTCAATGAGAACATCACCTTCGGGCAGCTGGGCACCTTCACCCACAACATGCTGGCCTTTGGGCTGAGCAAGAAGCTCTGTGGCGACTTCCTCAAGAAGCAGGCTGTGATCGGCAACCTGGACCAGGAGCAGTACAAGCTGCTGAGCGACCACATTGAGCAGATGGCCGCCGAATAG

XM_004842723.1 Coding sequence

Usp10 ubiquitin specific peptidase 10, transcript variant X1

Length: 2421 bp    Location: 1587324..1616711   Strand: +
>XM_004842723.1
ATGATTGCAGGGGGCAGACCTCATTTCATCACGCTGTGCCCTCCCCGGCTGTCAGCCTGGTCTGTCGTCCCCACATGCTGCCCAGGGCTGGAGGCTTTCCTGTCTTTCCTTCTCCAAGTGGAACAGAATACACTCCCCCCGTACAGTGGAACAGCTCTGTGTGGCACTCAGGCTGCGGACGAACTGCCTGATGGACAAGAGTATCAGAGAATTGAGTTCGGTGTCAATGAAGTAATTGACCCCAGTGACACTCTGCCGAGAGCCCCCGGCAACAGTATTTCAAGCACATTGAACCCTCAGGCCCCTGAATTTATTCTTGGTTGTACAGCTTCCAAAAAGACCCCTGATGGGCTAGACCAGGAGGTGAACTCCAGCTCCCTTGACCACCCATACCCGGGCCCAGCCCTGGCCTTGGACAGCAGCTCGCATGCTGAGGCAGAGGCTCTGGAGAACACTGGTGGCCCAGGTGGCCTGGGACAGAGGGAGCGGAAAAGGAAGAAGAAGCGGCCCCCAGGGTATTACAGTTACCTGAAAACTGGGGGTGACGAAAGTATTTCCACAGAAGCTGTGGTCAACGGCCATGCCAACTCAGCTGGCCTCGGTGGGGTGGGCGCCGAGGATGCGGAGTTTATGGGTGACATGCTCCCGCCGGTTTCGCCCAGGACTTGTGACAGCCCTCAGAACTCCACGGACTTCATCAGTGACACTGTGCCTGATAGTCCTTACCCTGGAGCGCTCGACAGCGCCGCCAGGACTGTGGGGCAGCCCGAGGGCTGCTGTGGGCCTGACTTTGAGCAAGCCTGCCTCCCCGCAGACCGCCTGCTAAGGACAGCTGTGGCTCCGCCCTGTGCTGCTACCGATACTACTGAGAACCTTGGCATCACCAATGGACAAGTACTTGAATCCTCGAGTGTGGGCACAGCTGCCAACGGGGAGCTGCACACTGTGGAGAGCACAGACTCAGACGTGGCCAAGCTGGAGCGTGCGCCACCTCCCGCTGACAGCGTACTCCCTGCACCCATTCCCATTAACCAGCCTGCCAAGTCCTGGGCCAGCCTCTTTCATGATGCTAAGCCCTCTTCCTCCTCACCCGTGGCGTATGTGGAAACTAAGTGTTCACCTCCTGCCCCATCTCCCCTGGTCTCTGAAAAGCAGGTTGAAGTCAAAGAAGGGCTTGTTCCAGTTTCAGAGGATCCCGTAGCCATGCAGATCGCAGAGTTACTGGAGAACGTAACCCTAGTACATAAGCCAGTGTCATTGCAACCCCGCGGGCTGATCAATAAAGGAAACTGGTGCTACATTAATGCTACTCTGCAGGCGTTGGTCGCTTGCCCTCCGATGTACCACCTCATGAAGTTCATTCCTCTGTACTCCAAGGTGCAGAGGCCTTGCACGTCGACGCCCATGATAGATAGCTTTGTTCGGCTAATGAACGAGTTTACCAACATGCCTGTGCCTCCGAAGCCCCGCCAAGCTCTTGGAGATAAAATCGTGAGGGACATCCGGCCTGGAGCTGCCTTTGAGCCCACGTACATTTACAGACTCCTGACCGTCATCAAGTCGAGCCTGTCTGAAAAGGGTCGACAGGAAGATGCTGAGGAGTACCTGGGCTTCATCCTAAACGGCCTGCACGAGGAGATGCTGAGCCTGAAGAGGCTCCTCTCACCGGACAGTGAAAAACTCACGGTTTCCAATGGGCCCAGAAGCCCCTTGCCCAAGGACGCAGCACAGCAAGAGCAAGGTGAAGGCAGCGAGGAGGAGTGGGAGCAAGTGGGCCCCAGGAACAAGACGTCGGTCACCCGCCAGGCGGATTTCGTTCAGACCCCAATCACTGGCATTTTTGGCGGACACATCAGGTCGGTGGTTTACCAGCAGAGTTCAAAAGAGTCTGCCACCCTGCAGCCATTTTTCACATTGCAGCTGGATATCCAGTCTGACAAGATACGCACCGTGCAGGATGCGCTCGAGAGCCTGGTGGCGAGAGAATCTGTCCAGGGTTACACCACGAAAACCAAACAAGAGGTGGAGATCAGCCGGCGGGTGACTCTGGAGAAGCTGCCTCCTGTCCTTGTGCTGCACCTGAAGCGCTTCGTGTATGAGAAGACTGGCGGCTGCCAGAAGCTGGCCAAGAACATCGACTACCCCGTGGACCTGGAGATCAGCAGGGAACTGCTTTCTCCAGGGGTTAAAAATAAGAATTTTAAATGCCATAGGACCTACAGGCTCTTCGCAGTGGTCTACCATCACGGCAACAGCGCCACGGGCGGGCACTACACCACCGACGTCTTCCAGATCGGGCTCAACGGCTGGCTGCGCATCGACGACCAGGTGGTCAAGGTGATCCAGCAGTACCAGGTGCTGAAGCCCGCCGCCGAACGCACCGCCTACCTCCTGTATTACCGCCGTGTGGACCTGCTGTGA

XM_004842722.1 Coding sequence

LOC101696467 uncharacterized LOC101696467, transcript variant X2

Length: 831 bp    Location: 1541039..1535937   Strand: -
>XM_004842722.1
ATGTCAAGTGCCAGCTTCGGTGAGTTCCTGGGTCAGAAGCCTGGTTCCGGGTGCAGGCTCAGCTGGACCCCGGGTCAGGCTTGTGCGCTGCTGTCCCTGGCCCAGTCTTTCCAGGGTTGGTCAGAGGCGGTGAGCGCCAGGGTGGCTGCGTCTCTGGTGTCCCAAAGCAGGCCCTTGGGCCTCAGGACTCCAGCCAAGGCCACAGTGGCCTCCCCCGGGGCAGGCTCCGGCCGGCCTTGGGCTGACAGTGCCCCCTTGTCACAGTGCACTCTCCACCGCACGCGCAGTGTCTCTCCCGAGAGGAGGGCGAGGAGCTGGAGCCAGAGAGCAGCTGACTGTCCTCCCAGTCGGCCAGAGGAGCCGCCTGCATGTCCCATCTGCACTGCGACCAGAGCTGTGCCCAGCTGGGCCCAGCTGACACCCGGGCTCCTTGGCACCAGAAATCACGCTTTAAGCTTTAAGCGCTGCTTGGCATCCAACCTGCTACTCAGCGAAGGACAAAGCACTTCGTTCCCAGCTCTCTTCTGTGCTGTCGCCACTTCCCTCAAAGGGGCCACCTGTGTCCAAGGCCTCACCGCAGGTCCTGTGTTCTCCAGAGAATGCGACACAACCCAAGGGCGAAGCCGACTGGGGCCAGGCCTCACGGTCGAGGGAACTGGGGACAGTGACTCCCGAGGTCTGCGCTCCCGCAGTCTTCAGAAGCAGAAATGGACCCAGGGAGCAGCAGAGGATCCAAACCGAGCGAGCCCCGCGGGGGACAGAGGAGCAGGGGAAGAGGAAGCGGCTTTGCTTCTTCGGGTGTCAGCGCTCACCACGAATCTTCTCCTGTGA

XM_004842693.1 Coding sequence

Zfpm1 zinc finger protein, FOG family member 1, transcript variant X4

Length: 2730 bp    Location: 1035653..988114   Strand: -
>XM_004842693.1
ATGTCCAGGAGGAAGCAGAGCAACCCCCGGCAGATCAGGCGTTCTCCTGGAGACATGGATGCTGCAGAGGAGGCCCAGGCCCCAGACAGCAGCCTTGAGGAGCAGGAGGCCCCAGCACCAGAGCCCACAGCCATAGGGAGGCCGGAGCCCCTGACCCCTTCCACCGCAGAGGAGCTGGAGCTGGAGCTTCGGGATGGACAGAGGTGCGTGCAGGCCCGACTCAGCCTCGCCAAGGGCCTGTGCTGGGGCCCGTTCCGTGGGAGCATCCAGACCAGAGCACCATCCCCTGGGCAGGCAGAACCGGGCCCGGCCCTGACCCTGCTGCTCACAGATGCAGCCTGCTGGCTGAGGACGCTGCCCCAGGCCCTGACCGAGGCTGACGCCAACTCGGAGATCTACAGGAAGGATGGCAGCCTCTGGTGCAGGGTCACCAGGCCGGTGCCCGCGGGCGAGGCCCTGTGTGCACTCCTGACGGCCAAGCCCCGGGGCACCCCCAGCCATCCCACGAAGGAGGAACCAGCAGAGCCCGAGAACCCTGCCCCAGTGCCCCCTGACATCCAGCTGCTGCCCCAGCAGGCCGGCATGGCGTCCATCCTCGCCACAGCAGTCATCAACAAGGACGTCTTCCCGTGCAAGGACTGTGGCATCTGGTACCGCAACGAGCGCAACCTGCAAGCCCACCTCCTCTACTACTGCGCCAGCCGCCAGGGTGCCAGCTCCCCAGCCGCGGCAGCCACAGAGGACAAGCCTAAGGAGCCATACCCCAACGAGCGGATCTGCCCCTTCCCACAGTGCCGTAAGAGCTGCCCCAGCGCCAGCTCCCTGGAGATCCACATGCGCAGCCACAGCGGAGAGCGGCCCTTTGTATGCCTCATCTGCCTGTCGGCCTTCACCACCAAGGCCAACTGCGAACGCCACCTCAAGGTGCACACAGACACGCTCAGCGGTGTCTGTCACAGCTGTGGCTTCATCTCCACCACTCGGGACATCCTCTATAGCCACCTGGTGACCAGCCACATGGTCTGCCAGCCCGGCTCCAAGGGGGAGATATACTCGCCAGGTGCAGCACACCCAGCTGCCAAGCTGCCTGCAGACGCCCTCGCCAGCCTCCAGAAGCACGCAGGCCTGCATGGTCCCCTGGCCTCCGCGGACCTAGGCCTGGCACCCATCCCATCACCAGGCCTGGACAAGACCCTGGTTGAGGCCACCAACGGAGAGGCCCAGAATGGGAGCGGCGGCGAGACCCCCGCGATCCCCAAGAACGTCAAGGTGGAGGCGGCCGAGGAGTCGGAGGCAGCGCGCGTGCCAGGCCAGGCAGAGCCTGCACCCCGGGCCCCGTCGCGGACGCCGTCGCCCCACAGCCCCGGTGCGGCCCGCGTGAAGGCCGAGATGCCCAGTCCCACGCCTGGCGCCAGCCCCGCACCCGGAGAGCTGGGTTTGGCCGGCGCGCTTTTCCTGCCGCAGCTCGTGTTCGCGCCAGACGCGGGCGCCGCCCCCGGCCCCGCGGCGCCCCAGGCCTCGGAGATCCTGGCCAAGATGTCGGAGCTGGTGCACAGCCGGCTGCAGCAGGGCGCGGGGGCGCCGGCCGCGCTGCTGGCGGGGACCAAGGGTGCCACGTGCTTCGAGTGCGAGATCACCTTCAACAACGTCAACAACTTCTACGTGCACAAGCGCCTCTACTGCTCCGGCCGGCGCCCGCCCGAAGACGCGCCCGCCGCGCGCAGGCCCAAGGCGCCACCGGGCGGCGCGCCTGCAGAACCCGATGCGCCGCGATCGCCGCCGGCGCCCGGGGCGCGTGAGGACGAGGCGGGCGGCGCAGCCACGCCCGAGGCCGATGGGCCCGGCCGGGGCAGCGAGGGCAGCCAGAGCCCGGGCAGCTCAGTGGACGACGCGGAGGACGACCCCAGCCGTACACTGTGCGAGGCCTGCAACATCCGCTTCAGCCGCCACGAGACCTACACGGTGCACAAGCGCTACTACTGCGCCTCGCGCCACGACCCTCCGCCGCGCAGGCCACCCGCTCCCGCTCCCGCTCCAGGGTCCGCGGCGCCCACGCTGACCACGCCGCCTGTGCGCACGCGCCGGCGCCGCAAGCTGTACGAGCTGCACGCGCCCGGCTCCGCCCCCGCACCGCCTGGCCATGGCCCCCCAGCGGCTGGCCCCGCGCCCGAGCCCCCCGGCTCCCCCGGACCCGGAGGCGGAAATGGGAGCGCCGGTCCCGCCCCCGCGCGCTCGCCCGCGCCGGCCGCCGCCGACGGCCCCATCGACCTGAGCAAGCGGCCGCGCCGACAGCCCCACGACGCGCCCGCCGCGCTGCCCGCGCTGGCCGACTACCACGAGTGCACGGCCTGCCGCGTGAGCTTCCACAGCCTCGAGGCCTACCTGGCTCACAAGCAGTACGCGTGCCCCGCCGCGCCACTGCGCCCGGCCGCCGTGTGCCCCTACTGCCCGGCCAATGGGCGTGCGCGCGGCGACCTGGGGGAGCACCTACGCCGGGCACACGGCCTGCGGGACAGCCCCCCGCCGCGCTCCCCGTCCCCGCCGCCCGCGCCCGCCGAGGCCCCCGCCGACCCGGGCGCCCCCACCCCCGGTAAGGGCCCGCCCGCGCCTCCCACGCCCGGTGGCCACCGCTACTGCCGCTTGTGCAACATCCGGTTCAGCAGCCTGTCCACCTTCATCGCTCACAAGAAGTACTACTGCTCCTCGCACGCCGCCGAGCACGTGAAGTGA

XM_004842636.1 Coding sequence

Rpl13 ribosomal protein L13, transcript variant X1

Length: 636 bp    Location: 341835..339103   Strand: -
>XM_004842636.1
ATGGCGCCCAGCCGGAATGGCATGATTCTGAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCTACGTGGTTCAACCAGCCGGCTCGGAAGATCCGCAGGCGCAAGGCCCGGCAGGCGAAAGCGCGCCGCATCGCCCCGCGACCCGCCTCAGGACCCATCCGGCCCATCGTGCGCTGCCCCACGGTGCGGTACCACACCAAGGTCCGAGCTGGCAGGGGCTTCAGTCTGGAGGAGCTGCGGGTGGCTGGTATTCACAAGAAGGTAGCCCGGACCATTGGCATCTCGGTGGACCCCAGGAGGCGGAACAAATCCACCGAGTCCCTGCAGGCCAATGTGCAGCGACTGAAGGAGTACCGCTCCAAACTCATCCTTTTCCCCAGGAAGCCGTCGGCCCCCAAGAAGGGAGACAGCTCTGCTGAAGAACTCAAATTGGCCACCCAGCTGACAGGACCTGTGATGCCCATCCGGAACGTCTACAAGAAGGAGAAGGCCAGGATCATCACAGAGGAGGAGAAGAACTTCAAGGCGTTCGCCAGTTTGCGCATGGCCCGTGCCAACGCCCGGCTCTTTGGCATCCGGGCAAAGAGAGCCAAGGAAGCTGCAGAGCAGGACGTTGAGAAGAAAAAATAA

XM_004842666.1 Coding sequence

Trappc2l trafficking protein particle complex 2-like, transcript variant X4

Length: 357 bp    Location: 786076..781833   Strand: -
>XM_004842666.1
ATGGAGAATGAGCTCAAGTTCCATTACATGGTGCACACATCCCTGGACGTGGTGGATGAGAAGATCTCTGCCATGGGGAAGGCCCTGGTGGACCAGCGAGAGCTCTACCTGGGCCTGCTCTACCCAACAGAGGACTACAAGGTATATGGCTACGTGACCAACTCCAAGGTGAAGTTTGTCATGGTGGTGGACTCCTCAAACACAGCCCTTCGAGACAACGAAATTCGCAGTATGTTCCGGAAGCTGCATAACTCCTACACAGATGTGATGTGTAATCCCTTCTACAACCCTGGGGACCGAATCCAGTCCAGGGTCTTCGACAACATGGTGACATCGATGATGATCCAGGTGTGTTGA

XM_004842664.1 Coding sequence

Trappc2l trafficking protein particle complex 2-like, transcript variant X2

Length: 423 bp    Location: 786131..781833   Strand: -
>XM_004842664.1
ATGGCGGTGTGCATCGCGGTGATCGCCAAGGAGAACTATCCTCTCTACATCCGCAGCACCCCCATGGAGAATGAGCTCAAGTTCCATTACATGGTGCACACATCCCTGGACGTGGTGGATGAGAAGATCTCTGCCATGGGGAAGGCCCTGGTGGACCAGCGAGAGCTCTACCTGGGCCTGCTCTACCCAACAGAGGACTACAAGGTATATGGCTACGTGACCAACTCCAAGGTGAAGTTTGTCATGGTGGTGGACTCCTCAAACACAGCCCTTCGAGACAACGAAATTCGCAGTATGTTCCGGAAGCTGCATAACTCCTACACAGATGTGATGTGTAATCCCTTCTACAACCCTGGGGACCGAATCCAGTCCAGCAGGGTCTTCGACAACATGGTGACATCGATGATGATCCAGGTGTGTTGA

XM_004842665.1 Coding sequence

Trappc2l trafficking protein particle complex 2-like, transcript variant X3

Length: 357 bp    Location: 786108..781833   Strand: -
>XM_004842665.1
ATGGAGAATGAGCTCAAGTTCCATTACATGGTGCACACATCCCTGGACGTGGTGGATGAGAAGATCTCTGCCATGGGGAAGGCCCTGGTGGACCAGCGAGAGCTCTACCTGGGCCTGCTCTACCCAACAGAGGACTACAAGGTATATGGCTACGTGACCAACTCCAAGGTGAAGTTTGTCATGGTGGTGGACTCCTCAAACACAGCCCTTCGAGACAACGAAATTCGCAGTATGTTCCGGAAGCTGCATAACTCCTACACAGATGTGATGTGTAATCCCTTCTACAACCCTGGGGACCGAATCCAGTCCAGGGTCTTCGACAACATGGTGACATCGATGATGATCCAGGTGTGTTGA

XM_004842654.1 Coding sequence

Cdh15 cadherin 15, type 1, M-cadherin (myotubule), transcript variant X4

Length: 2016 bp    Location: 617582..605556   Strand: -
>XM_004842654.1
ATGGACACCGCGCTCCTCCTGGCCCTCGGGCTGCTGGCACAGAGCCTTGGCTTGTCCTGGGGGGTCCCCAGGCGCCCCAGCACCCTGTACCCCTGGCGCCGGCCACCTGCACTGGGCCGAGTTCGGAGAGCCTGGGTCATCCCACCCATTAGCGTGTCAGAGAACTACAAGGGCCTGCCCTACATGCTGGTGCAGATCCGGTCCGACAAGCGGCAGCCAGGCGGGGTCATCTACAGCATCCAGGGCCCCGGTGTGGATGAGGAGCCCCTGGGCCTCTTCTCTGTGGAGAAGTTCTCAGGGCGGGTGTTCCTCAACGCGGAGCTGGACCGGGAGAAGACGTCCTCCTACAGGCTCAAGGTCTTTGCCCTGGACCGGGGAGGGTCTGTCCTGGAGGAGCCCACTGACCTGGAGATCGTGGTTGTGGATCAGAACGACAACCGGCCAGCCTTCGTGCAGGAGGTGTTCGCTGGCCGCGTGCTGGAAGGCGCAGCCCCAGGCACCTATGTGACCCGGGCCGAGGCCACCGACGCCGATGACCCAGACACAGACAATGCGGCGCTGCACTACTCCATCCTGGCACAGGGGAGCCCCGAGCTCTTCAGCATCCATGAGCGCACGGGCGAGATCCGCACTGTACACGTGGGGCTGGACCGTGAGGCGGTCACCACGTACAACCTGACGCTGCAGGTGGCAGACATGTCTGGACAAGGCCTCAGTGCCACAGCGTCGGCCATCATCTCCGTGGACGACATCAACGACAATGCCCCTGAGTTCACCAGGGGCAAGCTCCTCATGGAGGTCACAGAGGCTGTCAGTGGAGTGGATGTGGGGCGGCTGGAGGTGGAGGACAGGGACCTGCCTGGCTCCCCCAACTGGGTGGCCAACGTCACTATCCTGGAGGGTGACCCCGAGGGACACTTCGGCATCAGAACGGACCCCAGGACCAACGAGGGTGTGCTGTCTGTGGTGAAGCCCCTGGACTATGAGAGCCATGCACACTATGAGCTCAGGGTGTCTGTGCAGAATGAGGCCCCACTACAGGCAGCACCCCCCCGGGCCCAGCGGGGCCAGGCCACAGTCAGCATCCGGGTGCAGGACGTCAACGAGGCACCTGTGTTCCTCGAGAACCCGCTGAGAACCAGCCTGGCAGAGGGGGCACCCCCCGGGACCTTCGTGGCCAGCTTCTCTGCACAAGACCCCGACACCGTGCAGCTGCAGAGGGTCAGGTCACACAAACACGGCTGCCCTGTCCTCCCTGGCCGCTACTCCAAGGACTATGACCCTGAGGACTGGCTGCAGGTGGACGGAGCCACTGGCCAGATCCAGACGCGAAGGGTTCTGAGCCCGGCCTCCCCCTTCCTGAAGGACGGCTGGTACCGGGCCATCGTCCTCGCCCTCGACGACGGCTCGCCGCCTCGTACGGCCACCGGCACGCTGTCCGTGGAGATCCTGGCGGTGAACGACCACGCGCCTGCACTGGCGCCGCTGGCGGCTCCAAGCCTGTGCAGCGAGCCGGAACGCGGCCCCGGGCTGCTGCTGGGCGCCACTGACCAGGACCTGCCGCCGCACGGGGCGCCCTTCCGCTTCCGCCTCAGCCCCGCCGAGCCCGGGCTGGGCCGCAACTGGAGCCTCAGCCACGTCAACGGGACCCACGCGCGCCTGCGGCCGCGGCACACTCTCCCCGAGGGCCTGCACCGCCTCCGCCTGCTGCTCCAGGACTCCGGACAGCCGCCGAAGGAACGCGAGCAGCCGCTCAACGTCACCCTGTGTCGCTGCGGGCTCAGTGGCGCCTGTCTGCCCGGGGCCGCGGCGCTCAGGGCAGGGGGCGCGGGCCTTGGGCTGGGCGTGCTGGCGGTGGCGCTGGGGAGCGCTGCGGTGCTGCTGCAGCGCGGTTCCGGCAGCGGTCGCGGGACAGGAGCCTGCTGCGCGGCCTGCAGGACGACTACCTTCGGGACAACATTCTCAACTACGACGAGCAGGGAGGCGGGGAGGAGGACCAGGACGCCTACGATATAA

XM_004842639.1 Coding sequence

Rpl13 ribosomal protein L13, transcript variant X4

Length: 543 bp    Location: 341836..340272   Strand: -
>XM_004842639.1
ATGGCGCCCAGCCGGAATGGCATGATTCTGAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCTACGTGGTTCAACCAGCCGGCTCGGAAGATCCGCAGGCGCAAGGCCCGGCAGGCGAAAGCGCGCCGCATCGCCCCGCGACCCGCCTCAGGACCCATCCGGCCCATCGTGCGCTGCCCCACGGTGCGGTACCACACCAAGGTCCGAGCTGGCAGGGGCTTCAGTCTGGAGGAGCTGCGGGTGGCTGGTATTCACAAGAAGGTAGCCCGGACCATTGGCATCTCGGTGGACCCCAGGAGGCGGAACAAATCCACCGAGTCCCTGCAGGCCAATGTGCAGCGACTGAAGGAGTACCGCTCCAAACTCATCCTTTTCCCCAGGAAGCCGTCGGCCCCCAAGAAGGGAGACAGCTCTGCTGAAGAACTCAAATTGGCCACCCAGCTGACAGGACCTGTGATGCCCATCCGGAACGTAAGTGGACGCTGCATTTACTCAGACTTGGGTAGTTATGTCACACTTCAGACGCCTTGGTGCTGA

XM_004842642.1 Coding sequence

Spg7 spastic paraplegia 7 (pure and complicated autosomal recessive), transcript variant X3

Length: 2190 bp    Location: 377935..345038   Strand: -
>XM_004842642.1
ATGGCTGCCGTGTTGCTGCTGCTGCGCATCCTCCGTCAAGGCCCGGGGCCGGGTCCCGGGCGCCTGTGGGGCCTAGGCTCAGGCCTCTTCTTCGGGCCTGCGAGCAGGCCATACGTGGTCTGCAGGCCTCCGTTGGGTGTCGCCGGGGCGGGAGGCCGAGCTCTTCAGGTAAAGAGTTTGCAATCGAGAATGCTAACACCTGCCTTTGAAGGGATTGCTGGACTGTTACTGAAACAGTATCTCATTCAAAATCCAGTGGGACTCTGGCGACTTTTAGGTGGTACTTACTATTTTACTACTTCAAGAATGAGGCAGAAGAATAAAGACAATGATAAATCCAAAGGGAAGGCCCCTGGAGATGATGAAGAGGAGAGGCAGCGCAAGGAGCGAGAGGACCAGATGTACCGTGAGCGGCTGCGCACGCTGTTGGTCATCGCTGTGGTCATGAGCCTGCTAAACTCGCTCAGCTCCAGCGGTGGCAACATCTCCTGGAACGACTTCGTCAGCGAGATGCTGGCCAAGGGCGAGGTGCAGCGTGTGCAGGTGGTGCCCGAGAGTGACGTGGTGGAGGTCTACCTGCACCCGGGGGCCGTGGTGTTTGGACGGCCGCGGCTGTCCTTGGTGTACCGGATGCAGGTGGCAAATATCGACAAATTTGAGGAGAAGCTCCGTGCGGCTGAGGATGAGCTGAACATCGAGAGCAAAGACAGGATCCCAGTCTCCTACAAGCGCACAGGGTTCTTTGGGAATGCCCTCTATGCCCTGGGGATGACAGCCGTGGGCCTGGCCATCCTGTGGTACATGTTCCGCCTGGCTGGGATGACAGGAAGAGAAGGTGGATTCAGCGCGTTCAATCAGCTGAAGATGGCTCGCTTCACGATGGTGGACGGAAAGTCAGGGAAAGGAGTCAGCTTCAAAGATGTGGCTGGAATGCACGAGGCCAAGCTGGAGGTCCGGGAGTTCGTGGATTATCTGAAGAGCCCCGAGCGCTTCCTCCAGCTTGGAGCCAAGGTCCCAAAGGGCGCACTGCTGCTCGGGCCCCCAGGCTGTGGGAAGACGCTGCTGGCCAAGGCGGTGGCCACCGAGGCCCAGGTGCCCTTCTTGGCGATGGCTGGCCCGGAGTTCGTGGAGGTTGTCGGAGGAATGGGCACCACAGACCACGTCATCGTCCTGGCGTCCACAAACCGAGCTGACATCCTGGACAGCGCTCTGATGAGGCCTGGCCGCCTCGACCGGCATGTCTTCATCGATCTTCCCACCCTGCAGGAGCGGCGAGAGATTTTCGAACAGCACCTGAAAGGCCTGAAGCTGACCCAGGAGAGCAGATTTTACTCACAGCGGCTGGCAGAGCTGACGCCAGGATTCAGTGGTGCTGACATCGCCAACATCTGCAATGAGGCTGCACTGCATGCCGCCCGGGAGGGGCACTCATCCGTGCACACGCTGGACTTCGAGTATGCTGTGGAGCGGGTCGTGGCAGGGACGGCCAAAAAGAGCAAGGTCCTCTCCAGGGAGGAGCAGAGGGCTGTGGCCTTTCACGAGTCGGGCCATGCCCTGGTGGGCTGGCTGCTGGAGCACACAGAAGCTGTGATGAAGGTCTCCATTGCACCTCGGACGAACGCCGCACTGGGTTTCTCGCAGATGCTGCCCCGAGACCAGCATCTCTTCACCACCGAGCAGCTGTTTGAGCGCATGTGCATGGCCCTGGGCGGCCGTGCAGCCGAGGCCATCTCCTTCAGCCGGGTTACTTCTGGGGCCCAGGATGACCTGAGGAAGGTCACGCGCATTGCCTACTCCATGGTGAAGCAGTTCGGGATGGTGCCCAGCATTGGGCCTGTCTCCTTTCCTGAGGCACAGGAGGGCCTCATGGACATCGGACGGCGCCCCTTCAGCCAGGGCCTCCAGCAGATGATGGACCATGAGGCGAAGCTGCTGGTGGCCAAGGCCTACAGGCACACGGAGAAGGTGCTTCTGGACAACCTGGACAAGCTGCAGGCACTGGCGAATGCCCTCCTGCAAAAGGAAGTGATAAACTATGAGGACATTGAGGCCCTCATTGGCCCACCGCCCCACGGGCCCAAAAAAATGATAGCACCACAGAAGTGGATTGATGCCCAAAGTGAGAGCCAAGAGGCTGGGGAGGAGGAGGCCGCCCCACTGCCCCCCCTGCACGGGGAGGAGCTCTCCTGA

XM_004842644.1 Coding sequence

Ankrd11 ankyrin repeat domain 11, transcript variant X2

Length: 8025 bp    Location: 392509..571819   Strand: +
>XM_004842644.1
ATGCCCAAGAGTGGGTGTTCTAAAACACCACAGCAAGAAGACTTTCCTCTCAGCAACGACATGGTGGAGAAACAAACTGGGAAAAAGGATAAAGATAAAGTTTCTCTAACCAAGACCCCAAAGCTGGACCGCAGTGATGGAGGGAAGGAGGTGAGAGAGCGTACCACCAAGCGGAAGCTGCCCTTCACCGTGGGGGCCAATGGAGAGCAGAAGGACTCAGACACAGAGAAGCAGGGTCCCGAGCGGAAGAGGATCAAGAAGGAGCCTGTCGCCCGAAAGTCTGGGCTGCTGTTTGGCATGGGGCTGTCTGGGATCCGGGCCGGCTATCCCCTCTCCGAGCGCCAGCAGGTGGCTCTCCTCATGCAGATGACGGCCGAGGAGTCTGCCAACAGCCCAGTAGACACAACACCAAAGCACCCCTCCCAGTCTACAGTGTGTCAGAAGGGGACGCCTAACTCTGCCTCAAAAACCAAAGATAAAGTGAACAAGAGGAATGAGCGGGGGGAGACCCGCCTGCACCGGGCCGCCATCCGAGGAGACGCCCGGCGCATCAAGGAGCTCATCAGTGAGGGTGCAGACGTCAACGTCAAGGACTTTGCAGGCTGGACAGCGCTGCATGAGGCGTGTAACCGGGGCTACTACGATGTCGCCAAGCAGCTGCTGGCCGCAGGTGCAGAGGTGAACACCAAAGGCCTGGATGATGACACGCCTTTGCATGATGCCGCCAACAACGGCCACTACAAGGTGGTGAAGCTGTTGTTACGGTATGGGGGGAATCCTCAGCAGAGCAACCGGAAAGGCGAGACCCCGTTGAAAGTGGCCAATTCCCCCACGATGGTGAATCTGCTGTTAGGCAAAGGCACCTACACGTCCAGTGAAGAGAGCTCCACTGAGAGCTCTGAGGAGGAAGACGCCCCGTCATTCGCGCCGTCCAGCTCAGTCGACGGCAATAACACGGACTCTGAGTTTGAGAAAGGCCTGAAGCTCAAGGCCAAGAATCCAGAGCCACAGAAGGCCGTGACCCCTGTCAAGGACGAGTACGAGTTTGATGAGGATGACGAGCAGGACAGGGTCCCCCCAGTGGATGACAAGCACTTGCTAAAGAAGGATTACAGGAAAGAGACTAAGTCAAACAGTTTCATTTCGATACCCAAAATGGAAGTTAAGAGTTACACCAAGAACAATACGATTGCACCAAAGAAAGCAGCCCATCGTATCCTGTCAGACACATCCGACGAGGAGGACACTGGCCTCGCCGTTGGTGCCGGGGAGAAGCTGAGGCTGTCAGCACACTCTGTGCTGCCCAGCAGCAAGGTACGGGAGCCGTCCAACTCCAGGCAGCAGAAGGAGAAAAGCAAAGTGAAGAAGAAGCGAAAGAAAGAAGCAAAAAGCAAAGAAGTTCGCTTTGGAAAGAGGAATGACAAGTTCTGTTCCTCTGAGTCAGAGAGCGAGTCCTCAGAGAGTGAGGAGGACGATGACGACTCTGTGGGGAGCACAGGCTGCCTCAAGGGGTCCCCACTGGTGCTGAAGGACCCCTCCCTGTTCAGCTCACTGTCTGCCTCCTCCACCTCCTCCCACGGCAGTGCCGTGGCCCCGAAGCACGGCACCAACCACGGTGATCAGCATGCCAAGCACTGGCGCACGGACAACTGGAAAGCCATCTCCTCCCCGGCCTGGTCTGAGGTCAGCTCCCTGTCAGACTCCTCACGGACAGGACTGACGAGCGAGTCTGACTGCCCCTCTGAGGGCTCCAGCGTGGAGTCGCTGAAGCCCACAAGGAGGAAGCAGGAGCTCCGGAAGAGGGGCAGCCTGCCAAGTGCACCACCGGAGAAGAGGGGCACCTGCCACCCTGGCACAGATGGCGCTGTCCCCAAGCTGGACAAGGAGGGAAAAGTCGTCAAAAAACACAAGACAAAACACAAACACAAAAACAAGGAGAAGGGGCAGTGTTCCGTGAGCCAGGAACTTAAACTGAAAAGTTTTACGTACGAATACGAGGACTCCAAGCAAAAGTCAGAGAAAGCCATCCTCTTAGACAATGACATTTCCACAGACAATAAGCTGAAAGTGCTGAAGCACGACCGAGACCATTTTAAGAAAGAAGAGAAGCTCAGCAAACTGAAGTCAGAAGACAAGGAGTGGATCTTCAAAGAAGAGATGCTTAAGGTCTCCAAAGACGAGAAGTTGATGAAGAGGGCCAAAGACATCGGCAGGTCTTTCCGGGAAGAGAAAGACCGTTCCGGTAAAACAGAGAGGGAGAAGGCTGTGAAGGAAAAGTCCCCCAAAGAGGAACGGCTGAGGCTCTACAAAGAGGAGAAGAAGAAAAAGTCCAAAGACCGGCCTTCGAAGTTAGAGAAGAAGAATGACATGAAGGAGGACAGGGCTTGCAAGGAGAAGGAAAAGCTCAAAAAGGAAAAAGGTTACAGAGACGATGCTGCATTTGACGAATTCTGCAGCAAAACTCAGTTTCTAGAGAATGAGGACACCAAATTCAGCCTTTCTGATGATCAGCAAGAGAGGTGGTTTTCTGACCTGTCTGATTCCTCCTTTGATTTCAAAGGGGAGGACAGCTGGGACTCCCCAGTGACAGACTACAGGGACATCAAGAATGACTCTGTGGCCAAACTCATCTTAGAGACAGTGAAGGAGGATAGTAAGGAGAAGAAGCGAGACAACAGAGCCCGGGAGAAGCGGGACTTCAGAGACTCGTTCTTCCGAAAGAAAGACAGGGACTGTCTGGACAAGAGCTCCGAGAAGAGAAGAGACCAGGTGGAGAAGCACAAAGGCGTCCCCAGCTACCTCTCTGAGAAAGACAAGAAGAGGAGGGAATGTGCCGAGGGCGGGCGCGATCGCAGGGATGGCCTGGACGGCTCCCGGGAGCGCAAGGAAGCCCGGCTCCGGCCTGAGGAGGCGCATCGGGAGGACTTGAAGGACTGTGGCTGCGAGAGTGCATTCAGGGACAAGCCGGACTCTGACCTCCCCAAGGGCCTCGAGCCCTGGGAACGGCCCCACGCCCTGCGCCTGGAGAAGGACCGGAAGGAGAAGGTGCGGGTGGAGAAGTGCAAAGACAAGTCACTGGACAGAGACAAGAGCGAGAAATCTCTCCTTGAGAAATGTCAGAAGGACAAAGAATTTGACAAATGTTTTAAAGAGAAGAGAGATGCTAAGGAAAAGCATAAAGAGGCCCACAGCAAAGACAGGAAGGCGTCGCTCGACCAAGGGAGAGAGAAGAAGGAGAAGATGTTCCCTGGACTTCTCTCAGAAGACTTCTCCGAAAAAAAAGATGAAAAGAAAGGGAGAGAGAAGAGCTGGTACATTGCAGACATATTCACAGACGAAAGTGAAGATGAAAAAGATGACTATATGGCCAGCAGCTTCAAGGCCGGGGAAGCCGGGGACGCGCAGAGAGGGGACAGCCTCCAGGACAAGGAGGATGGCAGAGAGCTGCATCTCTTGGACAGACACCGGAAGTCCTCTGACCGGCAGCACGCAGAGAAGCCAAGGGATAAAGAGCCCAAGGAGAAGAGGAAGGACAGGGTGGCTGCCGACAGTGGGCGCGACAGGAAGGACAAGATCTTTGAGAAGCACCGAGAGAAGAAGGACAAAGAGTGTGCAGAGAGATACAAGGACAGGAAAGACAGGGCTTCCGTCGACTCTGCCCAGGAAAAGAAGAACAAGCAGAAGCTCCCTGAGAAGGTGGAGAAGAAGCACTCCACCGAAGACAAGGCCAAGAGTAAGCACAAGGACAAGCCAGAGAAGGAGCACTCCAAAGAGAGGAAGGGCTCGAGGGGCGCCGAGGCAGAGAAGAGCCTGCTGGAGAAGCTGGAGGAGGAGGCGCTGCACGAGGACCGGGAGGACTCCAATGACAAAGCCAGCGAGGTCTCGTCAGACAGCTTCACAGACCGGGGCCAGGAGCCGGGCCTGAGCGCCCTCCTGGAGGTGTCCTTCTCAGAGCCGCCCGATGACAAGGCCAGAGAGAGCTGCCTCACGGAGAAGCTGAGGGACAGGGAGCGGCACAGGCACTCCTCATCCTCCTCCAAGAAGAGCCACGACCGGGAGCGAGCCAAGAAGGAGAAGGCTGAGAAGAAAGAGAAGGCCGAGGACTACAAGGACGGTGGCTGCAGGAAGGACTCGAGCCAGTATGAGAAGGACTTCCTGGATGCAGAGGCCTACGGGGTCGCCTACACCGTGAAAGCCGACATGGAAGAGGAGTTGGATAAGACCGTTGAGATATTTCCCTCGGAAAAGAAAGAGAGAAATGATCCCGAGAGAGAATCTGCCAAGAAAATCGAGAAGGAACTAAAGCCTTACGGATCTAGTACCATCAGCATCCTGAAGGAGAAGAAGAAAAGAGAGAAACACAGGGAGAAGTGGAGAGACGAGAAGGAGAGACACCGGGAGAAGCACACGGACGGGTTCCTCAAACACCACAAGGACGAGCCAAAGCCCGCAGCCAAAGACAAGGACAACCCTCCGAACTCCTTCAGGGAGAAGTCCAGGGACGAAAGCCTGAAACTCAGTGAGACCAAGCTGAAGGAGAAGCTCAGGGAGAACACAGAGAGAGAAAAGGCGGACTCCATGAAGATCAGCAACGGCAGCGACAAGCTCCCGCTGGCCAGAGACCTGGGCAAGAAGGACGCCCGGCCCCGGGAGAAGCTCCTAGGAGACGGCGACCTGATGATGACCAGCTTTGAGAGGATGCTATCCCAGAAGGACCTGGAGGTCGAGGAGCGCCACAAGCGTCACAAGGAGCGCATGAAGCAGATGGAGAAGATGAGGCACAGGTCTGGGGACCCCAAGCTCAAGGACAAGACCAAGCCCCCCGAGGAGGGGCGGAAGAAGAGCCTGGACGTTCCTCCTAAGAAACCCCTGGGGCCAGACCCTCCCTTCAAGGAGAAGAAGCTCAAGGACTCCGCTCCCACACCACCCGCCACCGCCATCGAGGGCAAGCTGGGGCCCGGGGCGGAGTGCAAAGACTGGCCGGCAGCGCCGCCCCCCAAGGAGGTGTTGCCCCCCTCCCCCCGGCCTGAGCAGAGCCGGCCCACTGGGGTGCCCACGCCAAGCTACGAGGAGGTGATGCACACGCCCAGGACGCCGTCCTGCAGCGCTGATGACTACCCCGACCTGGTGTTTGACTGTGCGGACTCCCAGCACTCAATGCCTGTCTCCGCCACGTCCACCAGCACCTGCTCTCCGCCGTTTTTTGACAGGTTCTCTGTGGCTTCCAGTGGGGTGTCAGAAAACCCGGGCCAGACACCCACAAGGCCTGTCTCCTCCAACCTGTACCGCTCCATCTCTGTGGACATCAGGAGAACCCCCGAGGAAGAGTTCAGTGTCGGGGACAAGTTGTTCAGGCAGCAGAGCGTGCCTGCGGCCTCCAGCTTCGGCTCCCCTGTGCAGCACCTGCTGGAAGACAAGGCCCCGCTACCGCCTGTTCCCTCTGAAAAGTTCCCCTGCCTGTCCCCAGGGTACTACTCCCCAGACTACGGCATCCCCTCGGGCATGCCCTCACCCAAGGTGGATTCGCTCCACTGCCCCCCTGCCTGCACGGTGAGCGTCACGCCCTCCCCCGAGGGCGTCTTCTCCAGTTTACCAGCAAAAGCCTCTCCTCCCAGAGGTGAGCTGTTTGCCCCTGCTGTAGATGGGGCCCTCACCCCAGACCTGGGCCTCCCTCTGGACGCCACAGAGGACCAGCAGGCCACAGCCGCCATCATCCCCCCAGAGCCCAGCTACCTGGAACCCTTGGATGAGGGCCCCTTCAGCACTGTCATCACTGAGGAGCCTGGGGAGTGGGCGCACCCTGCTGCCGAGCAGACCCTTTCTCCCTCCTTGGTCACTGGTGCCTCTGAAAACCCTGTCAGCTGGCCTGTGGGTGCCGACCTCCTGCTGAAGTCCCCTCAGAGGTTCCCAGAGTCCCCTAAACATTACTGCCCTGCTGAGTCCCTCCACACTGCCACCCCAGGGCCCTTCAGTGCTGCAGAGCCCCCGTACCCTGTCTCTCCTGTCTCCTACCCTCTGCCAGCCGCCGAGCCAGACCTGGAGGAAGTCAAAGATGATGGGGTGGGAGCCATCTCCGCCACCACCGAGGGAGGCACACCTTACACCACCCCTGCCAGGCTCGAGTCCTTCTTTGGCAGCTGCAAGCCACTCCCCGATGCACCCCTCGACCAGGTGCCTGAGCCCACATGTGTCTCCACGGTGGCCCAGGTGGAGGCCCTCGGAGCCCTGGAGAGCAGCTTCCTGGACAGTGGCCACGGCCTGGCTGCTCTTGGCCAGGTGGAGCCCGTACCCTGGCACGACGCCTTCACCAGCACCGAGGACGACCTGGACCTGGGGCCCTTCTCACTGCCGGAGCTCCCTCTGCAGCCCAAGGACCCCCCAGATGTTGAAATGGAGCCTGCAGGAGGAAGCCCTGCTCCCCCAGGAGAGGCCCTCCCTGTGCCCGCTGGGGTCAGCAGTGATGGGGACGGCCCTGTGGCCGAGGCCGAGGATCAGCCAGCTCCACCTACCGAGCAGGCCGTCCCCCGACTCCCTGCTGAGCTCGAGCCCTCCGAGGAACCGAAGCTGGATGTGGTTCTGGAAGCCACTGTGGAAGCAGAAGCAGTGGCGGACGAGCAGGCCCCTGAGGACCTGGACTCCGGCTCAGTGCCTGTGCCCGGCCCCCCAGAATGGCATCCCCTGGAGGGCGGAGATGAGGTGGAGGCTGAAGCCCCTGCGGCTGCGCCCCACTGTGCCCCTGACGGCCCCCCCCAGGAGGCCCCCCCACAGGCCCAAGCTGATTCAGAGGCCACCCCTGCTGCCACCCCAGCCGAGGGGCCTCTGGGCAGCGTGCAGCCAGGAGCTCCAGAGCCCGAGCCCAGGCCTGCAGCTGAAGCCCCCAAGGCCCCCCGGGTGGAGGAGGTTCCTCAGCGCATGACCAGGAACCGGGCCCAGATGTTGGCCAGTCAGAGCAAGCAGGGCACACCACCCACAGAGAAGGAGCCTGCACCCGCGCCCACACCCACGTCCACGCAGGCCTCCCGAACCAAGGCCCGTGCCCCCGAGGAGGAGGACGCCCAAGCCCAGCACCCGCGCAAGCGCCGCTTCCAGCGCTCCAGCCAGCAGCTGCAGCAGCAGCTGCACACGTCCACACGGCAGACTCGGGAGGTCATCCAGCAGACACTGGCCGCCATTGTGGACGCCATCAAGCTGGACGACATTGAGCCCTATCACAGTGACAGATCCAACCCATACTTTGAGTACCTTCAGATCAGAAAGAAGATCGAAGAGAAGCGCAAGATCCTCTGCTACATCACACCACAGGCGCCCCAGTGCTACGCTGAGTACGTCACCTACACGGGGTCCTACCTCTTAGACGGCAAGCCACTCAGCAAGCTCCACATCCCTGTGATCGCGCCCCCACCCTCCCTGGCAGAGCCCCTCAAGGAGCTCTTCAAGCAGCAGGAAGCTGTGCGGGGGAAGCTGCGTCTGCAGCACAGCATCGAGCGGGAGAAGCTCATAGTGTCCTGTGAGCAGGAGATCCTGCGGGTCCATTGCCGGGCAGCCCGGACGATTGCCAACCAGGCGGTGCCTTTCAGCGCCTGCACGATGCTGTTAGACTCTGAGGTCTACAACATGCCCCTGGAGAGCCAGGTGCGTGGCGGTCCCCAGGGTTACTCACTTGCCCTTCACTTGGGCAGCAGCCACCCCCACGCACCCTCTACCCTGAGCCAGCTGTTGACAGCACTGTGTCCCTGGAGGGCCACCTGTCTGCCTGCAGCCACAGAAGGGGCAGGAGCAGTGGCACTGAGGGGTGGCCACATGCACCCCGCAGGGAACAGCTGCCCTTCCTCCCTCACGGGGCAGGTGCGACTGCATTTTCCATTCCCACTTCCTGAGGAGCAGTGGGGCTGGCACACCGGTGGCCCTGGGCAGCAGGTGGTAGCAGCTACAGGGCCTGTGGTGACTGGCCAGGCAGGGGCTCATCTGACCCAGGTAGACCGAGGCTTCTCCTGTGGGAACGAGGGCAGATCTGCAGCAGGCTAG

XM_004842650.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 915 bp    Location: 473111..472121   Strand: -
>XM_004842650.1
ATGCAGCCGTTAAAAATGGTATCTGGCTCCCTTGTTGCTTTTGCTGCTTCTGCTGCTGTGCTCTGCTGCTCCTCGGTACCCTCCTCAGGGAGAGCCGATTATGGACCGAAGCCTGTTGATGAAACATGGACACGGACACCAAGCTGGTCCTCAGCACTCTGTACCAGCTTTCTCACCTTTCAGTTTCTTTTCCACTTTGTAAGTTACTGGTTTTCTGCANNAGTTTCTTCAGGTTTTAACAGTCTCAGCTTGGAAAAGAAGACTGAATGGAACTCAAGGGTAGTCTCTTCATGCCATTCTCTGGTGGTTGGGATTTTGGGCCTCTATATTTTCCTCTTTGATGAGGCTACGAGAGCTGACCCACTTTGGGGCGATTCATCATTTGTGAAACTAAACACTGCTACTGCTTCAGGCTACCTCATTTCTGATTTGTTGATTCTCATTTTCTATTGGAAAGTGATTGGTGACAAGTTTTTCATAATTCATCACTGTGCAGTGCTGTACTTGTACTGCTTTGTACTGAAATATCAAGTGCTGGGGTACACGGCAAATTTTCGACTGCTTGCAGAGCTTTCCAGCCCTTTTGTGAATCAGTGGTGGTTCTTTGAAGCTCTGAAGTATCCAAAGTTTTCCAAAGCTAATGTCATCAATGCAACTCTCATGACAGTGGCATTCTTCATTGTGCGGACTGCTGTAATACCTCCTTTCTACAGCTTCTTATATTCCGTGTATGGAACAGAACCCTACATCAGGCTGGGATTTGTAATCCAGTGTTCCTGGGTCTCTACTTGTATTGTTTTGGATGTGATGAATGTCATGTGGATGATCAAAATCTCTAAAGGGTGCATCAAAGTCATCTCTCTCATCAGACAAGAGAAAGCCAGTAACAGTCTTCAGAATGGAAAACTTGATTAA

XM_004842643.1 Coding sequence

Ankrd11 ankyrin repeat domain 11, transcript variant X1

Length: 8025 bp    Location: 534229..571819   Strand: +
>XM_004842643.1
ATGCCCAAGAGTGGGTGTTCTAAAACACCACAGCAAGAAGACTTTCCTCTCAGCAACGACATGGTGGAGAAACAAACTGGGAAAAAGGATAAAGATAAAGTTTCTCTAACCAAGACCCCAAAGCTGGACCGCAGTGATGGAGGGAAGGAGGTGAGAGAGCGTACCACCAAGCGGAAGCTGCCCTTCACCGTGGGGGCCAATGGAGAGCAGAAGGACTCAGACACAGAGAAGCAGGGTCCCGAGCGGAAGAGGATCAAGAAGGAGCCTGTCGCCCGAAAGTCTGGGCTGCTGTTTGGCATGGGGCTGTCTGGGATCCGGGCCGGCTATCCCCTCTCCGAGCGCCAGCAGGTGGCTCTCCTCATGCAGATGACGGCCGAGGAGTCTGCCAACAGCCCAGTAGACACAACACCAAAGCACCCCTCCCAGTCTACAGTGTGTCAGAAGGGGACGCCTAACTCTGCCTCAAAAACCAAAGATAAAGTGAACAAGAGGAATGAGCGGGGGGAGACCCGCCTGCACCGGGCCGCCATCCGAGGAGACGCCCGGCGCATCAAGGAGCTCATCAGTGAGGGTGCAGACGTCAACGTCAAGGACTTTGCAGGCTGGACAGCGCTGCATGAGGCGTGTAACCGGGGCTACTACGATGTCGCCAAGCAGCTGCTGGCCGCAGGTGCAGAGGTGAACACCAAAGGCCTGGATGATGACACGCCTTTGCATGATGCCGCCAACAACGGCCACTACAAGGTGGTGAAGCTGTTGTTACGGTATGGGGGGAATCCTCAGCAGAGCAACCGGAAAGGCGAGACCCCGTTGAAAGTGGCCAATTCCCCCACGATGGTGAATCTGCTGTTAGGCAAAGGCACCTACACGTCCAGTGAAGAGAGCTCCACTGAGAGCTCTGAGGAGGAAGACGCCCCGTCATTCGCGCCGTCCAGCTCAGTCGACGGCAATAACACGGACTCTGAGTTTGAGAAAGGCCTGAAGCTCAAGGCCAAGAATCCAGAGCCACAGAAGGCCGTGACCCCTGTCAAGGACGAGTACGAGTTTGATGAGGATGACGAGCAGGACAGGGTCCCCCCAGTGGATGACAAGCACTTGCTAAAGAAGGATTACAGGAAAGAGACTAAGTCAAACAGTTTCATTTCGATACCCAAAATGGAAGTTAAGAGTTACACCAAGAACAATACGATTGCACCAAAGAAAGCAGCCCATCGTATCCTGTCAGACACATCCGACGAGGAGGACACTGGCCTCGCCGTTGGTGCCGGGGAGAAGCTGAGGCTGTCAGCACACTCTGTGCTGCCCAGCAGCAAGGTACGGGAGCCGTCCAACTCCAGGCAGCAGAAGGAGAAAAGCAAAGTGAAGAAGAAGCGAAAGAAAGAAGCAAAAAGCAAAGAAGTTCGCTTTGGAAAGAGGAATGACAAGTTCTGTTCCTCTGAGTCAGAGAGCGAGTCCTCAGAGAGTGAGGAGGACGATGACGACTCTGTGGGGAGCACAGGCTGCCTCAAGGGGTCCCCACTGGTGCTGAAGGACCCCTCCCTGTTCAGCTCACTGTCTGCCTCCTCCACCTCCTCCCACGGCAGTGCCGTGGCCCCGAAGCACGGCACCAACCACGGTGATCAGCATGCCAAGCACTGGCGCACGGACAACTGGAAAGCCATCTCCTCCCCGGCCTGGTCTGAGGTCAGCTCCCTGTCAGACTCCTCACGGACAGGACTGACGAGCGAGTCTGACTGCCCCTCTGAGGGCTCCAGCGTGGAGTCGCTGAAGCCCACAAGGAGGAAGCAGGAGCTCCGGAAGAGGGGCAGCCTGCCAAGTGCACCACCGGAGAAGAGGGGCACCTGCCACCCTGGCACAGATGGCGCTGTCCCCAAGCTGGACAAGGAGGGAAAAGTCGTCAAAAAACACAAGACAAAACACAAACACAAAAACAAGGAGAAGGGGCAGTGTTCCGTGAGCCAGGAACTTAAACTGAAAAGTTTTACGTACGAATACGAGGACTCCAAGCAAAAGTCAGAGAAAGCCATCCTCTTAGACAATGACATTTCCACAGACAATAAGCTGAAAGTGCTGAAGCACGACCGAGACCATTTTAAGAAAGAAGAGAAGCTCAGCAAACTGAAGTCAGAAGACAAGGAGTGGATCTTCAAAGAAGAGATGCTTAAGGTCTCCAAAGACGAGAAGTTGATGAAGAGGGCCAAAGACATCGGCAGGTCTTTCCGGGAAGAGAAAGACCGTTCCGGTAAAACAGAGAGGGAGAAGGCTGTGAAGGAAAAGTCCCCCAAAGAGGAACGGCTGAGGCTCTACAAAGAGGAGAAGAAGAAAAAGTCCAAAGACCGGCCTTCGAAGTTAGAGAAGAAGAATGACATGAAGGAGGACAGGGCTTGCAAGGAGAAGGAAAAGCTCAAAAAGGAAAAAGGTTACAGAGACGATGCTGCATTTGACGAATTCTGCAGCAAAACTCAGTTTCTAGAGAATGAGGACACCAAATTCAGCCTTTCTGATGATCAGCAAGAGAGGTGGTTTTCTGACCTGTCTGATTCCTCCTTTGATTTCAAAGGGGAGGACAGCTGGGACTCCCCAGTGACAGACTACAGGGACATCAAGAATGACTCTGTGGCCAAACTCATCTTAGAGACAGTGAAGGAGGATAGTAAGGAGAAGAAGCGAGACAACAGAGCCCGGGAGAAGCGGGACTTCAGAGACTCGTTCTTCCGAAAGAAAGACAGGGACTGTCTGGACAAGAGCTCCGAGAAGAGAAGAGACCAGGTGGAGAAGCACAAAGGCGTCCCCAGCTACCTCTCTGAGAAAGACAAGAAGAGGAGGGAATGTGCCGAGGGCGGGCGCGATCGCAGGGATGGCCTGGACGGCTCCCGGGAGCGCAAGGAAGCCCGGCTCCGGCCTGAGGAGGCGCATCGGGAGGACTTGAAGGACTGTGGCTGCGAGAGTGCATTCAGGGACAAGCCGGACTCTGACCTCCCCAAGGGCCTCGAGCCCTGGGAACGGCCCCACGCCCTGCGCCTGGAGAAGGACCGGAAGGAGAAGGTGCGGGTGGAGAAGTGCAAAGACAAGTCACTGGACAGAGACAAGAGCGAGAAATCTCTCCTTGAGAAATGTCAGAAGGACAAAGAATTTGACAAATGTTTTAAAGAGAAGAGAGATGCTAAGGAAAAGCATAAAGAGGCCCACAGCAAAGACAGGAAGGCGTCGCTCGACCAAGGGAGAGAGAAGAAGGAGAAGATGTTCCCTGGACTTCTCTCAGAAGACTTCTCCGAAAAAAAAGATGAAAAGAAAGGGAGAGAGAAGAGCTGGTACATTGCAGACATATTCACAGACGAAAGTGAAGATGAAAAAGATGACTATATGGCCAGCAGCTTCAAGGCCGGGGAAGCCGGGGACGCGCAGAGAGGGGACAGCCTCCAGGACAAGGAGGATGGCAGAGAGCTGCATCTCTTGGACAGACACCGGAAGTCCTCTGACCGGCAGCACGCAGAGAAGCCAAGGGATAAAGAGCCCAAGGAGAAGAGGAAGGACAGGGTGGCTGCCGACAGTGGGCGCGACAGGAAGGACAAGATCTTTGAGAAGCACCGAGAGAAGAAGGACAAAGAGTGTGCAGAGAGATACAAGGACAGGAAAGACAGGGCTTCCGTCGACTCTGCCCAGGAAAAGAAGAACAAGCAGAAGCTCCCTGAGAAGGTGGAGAAGAAGCACTCCACCGAAGACAAGGCCAAGAGTAAGCACAAGGACAAGCCAGAGAAGGAGCACTCCAAAGAGAGGAAGGGCTCGAGGGGCGCCGAGGCAGAGAAGAGCCTGCTGGAGAAGCTGGAGGAGGAGGCGCTGCACGAGGACCGGGAGGACTCCAATGACAAAGCCAGCGAGGTCTCGTCAGACAGCTTCACAGACCGGGGCCAGGAGCCGGGCCTGAGCGCCCTCCTGGAGGTGTCCTTCTCAGAGCCGCCCGATGACAAGGCCAGAGAGAGCTGCCTCACGGAGAAGCTGAGGGACAGGGAGCGGCACAGGCACTCCTCATCCTCCTCCAAGAAGAGCCACGACCGGGAGCGAGCCAAGAAGGAGAAGGCTGAGAAGAAAGAGAAGGCCGAGGACTACAAGGACGGTGGCTGCAGGAAGGACTCGAGCCAGTATGAGAAGGACTTCCTGGATGCAGAGGCCTACGGGGTCGCCTACACCGTGAAAGCCGACATGGAAGAGGAGTTGGATAAGACCGTTGAGATATTTCCCTCGGAAAAGAAAGAGAGAAATGATCCCGAGAGAGAATCTGCCAAGAAAATCGAGAAGGAACTAAAGCCTTACGGATCTAGTACCATCAGCATCCTGAAGGAGAAGAAGAAAAGAGAGAAACACAGGGAGAAGTGGAGAGACGAGAAGGAGAGACACCGGGAGAAGCACACGGACGGGTTCCTCAAACACCACAAGGACGAGCCAAAGCCCGCAGCCAAAGACAAGGACAACCCTCCGAACTCCTTCAGGGAGAAGTCCAGGGACGAAAGCCTGAAACTCAGTGAGACCAAGCTGAAGGAGAAGCTCAGGGAGAACACAGAGAGAGAAAAGGCGGACTCCATGAAGATCAGCAACGGCAGCGACAAGCTCCCGCTGGCCAGAGACCTGGGCAAGAAGGACGCCCGGCCCCGGGAGAAGCTCCTAGGAGACGGCGACCTGATGATGACCAGCTTTGAGAGGATGCTATCCCAGAAGGACCTGGAGGTCGAGGAGCGCCACAAGCGTCACAAGGAGCGCATGAAGCAGATGGAGAAGATGAGGCACAGGTCTGGGGACCCCAAGCTCAAGGACAAGACCAAGCCCCCCGAGGAGGGGCGGAAGAAGAGCCTGGACGTTCCTCCTAAGAAACCCCTGGGGCCAGACCCTCCCTTCAAGGAGAAGAAGCTCAAGGACTCCGCTCCCACACCACCCGCCACCGCCATCGAGGGCAAGCTGGGGCCCGGGGCGGAGTGCAAAGACTGGCCGGCAGCGCCGCCCCCCAAGGAGGTGTTGCCCCCCTCCCCCCGGCCTGAGCAGAGCCGGCCCACTGGGGTGCCCACGCCAAGCTACGAGGAGGTGATGCACACGCCCAGGACGCCGTCCTGCAGCGCTGATGACTACCCCGACCTGGTGTTTGACTGTGCGGACTCCCAGCACTCAATGCCTGTCTCCGCCACGTCCACCAGCACCTGCTCTCCGCCGTTTTTTGACAGGTTCTCTGTGGCTTCCAGTGGGGTGTCAGAAAACCCGGGCCAGACACCCACAAGGCCTGTCTCCTCCAACCTGTACCGCTCCATCTCTGTGGACATCAGGAGAACCCCCGAGGAAGAGTTCAGTGTCGGGGACAAGTTGTTCAGGCAGCAGAGCGTGCCTGCGGCCTCCAGCTTCGGCTCCCCTGTGCAGCACCTGCTGGAAGACAAGGCCCCGCTACCGCCTGTTCCCTCTGAAAAGTTCCCCTGCCTGTCCCCAGGGTACTACTCCCCAGACTACGGCATCCCCTCGGGCATGCCCTCACCCAAGGTGGATTCGCTCCACTGCCCCCCTGCCTGCACGGTGAGCGTCACGCCCTCCCCCGAGGGCGTCTTCTCCAGTTTACCAGCAAAAGCCTCTCCTCCCAGAGGTGAGCTGTTTGCCCCTGCTGTAGATGGGGCCCTCACCCCAGACCTGGGCCTCCCTCTGGACGCCACAGAGGACCAGCAGGCCACAGCCGCCATCATCCCCCCAGAGCCCAGCTACCTGGAACCCTTGGATGAGGGCCCCTTCAGCACTGTCATCACTGAGGAGCCTGGGGAGTGGGCGCACCCTGCTGCCGAGCAGACCCTTTCTCCCTCCTTGGTCACTGGTGCCTCTGAAAACCCTGTCAGCTGGCCTGTGGGTGCCGACCTCCTGCTGAAGTCCCCTCAGAGGTTCCCAGAGTCCCCTAAACATTACTGCCCTGCTGAGTCCCTCCACACTGCCACCCCAGGGCCCTTCAGTGCTGCAGAGCCCCCGTACCCTGTCTCTCCTGTCTCCTACCCTCTGCCAGCCGCCGAGCCAGACCTGGAGGAAGTCAAAGATGATGGGGTGGGAGCCATCTCCGCCACCACCGAGGGAGGCACACCTTACACCACCCCTGCCAGGCTCGAGTCCTTCTTTGGCAGCTGCAAGCCACTCCCCGATGCACCCCTCGACCAGGTGCCTGAGCCCACATGTGTCTCCACGGTGGCCCAGGTGGAGGCCCTCGGAGCCCTGGAGAGCAGCTTCCTGGACAGTGGCCACGGCCTGGCTGCTCTTGGCCAGGTGGAGCCCGTACCCTGGCACGACGCCTTCACCAGCACCGAGGACGACCTGGACCTGGGGCCCTTCTCACTGCCGGAGCTCCCTCTGCAGCCCAAGGACCCCCCAGATGTTGAAATGGAGCCTGCAGGAGGAAGCCCTGCTCCCCCAGGAGAGGCCCTCCCTGTGCCCGCTGGGGTCAGCAGTGATGGGGACGGCCCTGTGGCCGAGGCCGAGGATCAGCCAGCTCCACCTACCGAGCAGGCCGTCCCCCGACTCCCTGCTGAGCTCGAGCCCTCCGAGGAACCGAAGCTGGATGTGGTTCTGGAAGCCACTGTGGAAGCAGAAGCAGTGGCGGACGAGCAGGCCCCTGAGGACCTGGACTCCGGCTCAGTGCCTGTGCCCGGCCCCCCAGAATGGCATCCCCTGGAGGGCGGAGATGAGGTGGAGGCTGAAGCCCCTGCGGCTGCGCCCCACTGTGCCCCTGACGGCCCCCCCCAGGAGGCCCCCCCACAGGCCCAAGCTGATTCAGAGGCCACCCCTGCTGCCACCCCAGCCGAGGGGCCTCTGGGCAGCGTGCAGCCAGGAGCTCCAGAGCCCGAGCCCAGGCCTGCAGCTGAAGCCCCCAAGGCCCCCCGGGTGGAGGAGGTTCCTCAGCGCATGACCAGGAACCGGGCCCAGATGTTGGCCAGTCAGAGCAAGCAGGGCACACCACCCACAGAGAAGGAGCCTGCACCCGCGCCCACACCCACGTCCACGCAGGCCTCCCGAACCAAGGCCCGTGCCCCCGAGGAGGAGGACGCCCAAGCCCAGCACCCGCGCAAGCGCCGCTTCCAGCGCTCCAGCCAGCAGCTGCAGCAGCAGCTGCACACGTCCACACGGCAGACTCGGGAGGTCATCCAGCAGACACTGGCCGCCATTGTGGACGCCATCAAGCTGGACGACATTGAGCCCTATCACAGTGACAGATCCAACCCATACTTTGAGTACCTTCAGATCAGAAAGAAGATCGAAGAGAAGCGCAAGATCCTCTGCTACATCACACCACAGGCGCCCCAGTGCTACGCTGAGTACGTCACCTACACGGGGTCCTACCTCTTAGACGGCAAGCCACTCAGCAAGCTCCACATCCCTGTGATCGCGCCCCCACCCTCCCTGGCAGAGCCCCTCAAGGAGCTCTTCAAGCAGCAGGAAGCTGTGCGGGGGAAGCTGCGTCTGCAGCACAGCATCGAGCGGGAGAAGCTCATAGTGTCCTGTGAGCAGGAGATCCTGCGGGTCCATTGCCGGGCAGCCCGGACGATTGCCAACCAGGCGGTGCCTTTCAGCGCCTGCACGATGCTGTTAGACTCTGAGGTCTACAACATGCCCCTGGAGAGCCAGGTGCGTGGCGGTCCCCAGGGTTACTCACTTGCCCTTCACTTGGGCAGCAGCCACCCCCACGCACCCTCTACCCTGAGCCAGCTGTTGACAGCACTGTGTCCCTGGAGGGCCACCTGTCTGCCTGCAGCCACAGAAGGGGCAGGAGCAGTGGCACTGAGGGGTGGCCACATGCACCCCGCAGGGAACAGCTGCCCTTCCTCCCTCACGGGGCAGGTGCGACTGCATTTTCCATTCCCACTTCCTGAGGAGCAGTGGGGCTGGCACACCGGTGGCCCTGGGCAGCAGGTGGTAGCAGCTACAGGGCCTGTGGTGACTGGCCAGGCAGGGGCTCATCTGACCCAGGTAGACCGAGGCTTCTCCTGTGGGAACGAGGGCAGATCTGCAGCAGGCTAG

XM_004842645.1 Coding sequence

Ankrd11 ankyrin repeat domain 11, transcript variant X3

Length: 8025 bp    Location: 534693..571819   Strand: +
>XM_004842645.1
ATGCCCAAGAGTGGGTGTTCTAAAACACCACAGCAAGAAGACTTTCCTCTCAGCAACGACATGGTGGAGAAACAAACTGGGAAAAAGGATAAAGATAAAGTTTCTCTAACCAAGACCCCAAAGCTGGACCGCAGTGATGGAGGGAAGGAGGTGAGAGAGCGTACCACCAAGCGGAAGCTGCCCTTCACCGTGGGGGCCAATGGAGAGCAGAAGGACTCAGACACAGAGAAGCAGGGTCCCGAGCGGAAGAGGATCAAGAAGGAGCCTGTCGCCCGAAAGTCTGGGCTGCTGTTTGGCATGGGGCTGTCTGGGATCCGGGCCGGCTATCCCCTCTCCGAGCGCCAGCAGGTGGCTCTCCTCATGCAGATGACGGCCGAGGAGTCTGCCAACAGCCCAGTAGACACAACACCAAAGCACCCCTCCCAGTCTACAGTGTGTCAGAAGGGGACGCCTAACTCTGCCTCAAAAACCAAAGATAAAGTGAACAAGAGGAATGAGCGGGGGGAGACCCGCCTGCACCGGGCCGCCATCCGAGGAGACGCCCGGCGCATCAAGGAGCTCATCAGTGAGGGTGCAGACGTCAACGTCAAGGACTTTGCAGGCTGGACAGCGCTGCATGAGGCGTGTAACCGGGGCTACTACGATGTCGCCAAGCAGCTGCTGGCCGCAGGTGCAGAGGTGAACACCAAAGGCCTGGATGATGACACGCCTTTGCATGATGCCGCCAACAACGGCCACTACAAGGTGGTGAAGCTGTTGTTACGGTATGGGGGGAATCCTCAGCAGAGCAACCGGAAAGGCGAGACCCCGTTGAAAGTGGCCAATTCCCCCACGATGGTGAATCTGCTGTTAGGCAAAGGCACCTACACGTCCAGTGAAGAGAGCTCCACTGAGAGCTCTGAGGAGGAAGACGCCCCGTCATTCGCGCCGTCCAGCTCAGTCGACGGCAATAACACGGACTCTGAGTTTGAGAAAGGCCTGAAGCTCAAGGCCAAGAATCCAGAGCCACAGAAGGCCGTGACCCCTGTCAAGGACGAGTACGAGTTTGATGAGGATGACGAGCAGGACAGGGTCCCCCCAGTGGATGACAAGCACTTGCTAAAGAAGGATTACAGGAAAGAGACTAAGTCAAACAGTTTCATTTCGATACCCAAAATGGAAGTTAAGAGTTACACCAAGAACAATACGATTGCACCAAAGAAAGCAGCCCATCGTATCCTGTCAGACACATCCGACGAGGAGGACACTGGCCTCGCCGTTGGTGCCGGGGAGAAGCTGAGGCTGTCAGCACACTCTGTGCTGCCCAGCAGCAAGGTACGGGAGCCGTCCAACTCCAGGCAGCAGAAGGAGAAAAGCAAAGTGAAGAAGAAGCGAAAGAAAGAAGCAAAAAGCAAAGAAGTTCGCTTTGGAAAGAGGAATGACAAGTTCTGTTCCTCTGAGTCAGAGAGCGAGTCCTCAGAGAGTGAGGAGGACGATGACGACTCTGTGGGGAGCACAGGCTGCCTCAAGGGGTCCCCACTGGTGCTGAAGGACCCCTCCCTGTTCAGCTCACTGTCTGCCTCCTCCACCTCCTCCCACGGCAGTGCCGTGGCCCCGAAGCACGGCACCAACCACGGTGATCAGCATGCCAAGCACTGGCGCACGGACAACTGGAAAGCCATCTCCTCCCCGGCCTGGTCTGAGGTCAGCTCCCTGTCAGACTCCTCACGGACAGGACTGACGAGCGAGTCTGACTGCCCCTCTGAGGGCTCCAGCGTGGAGTCGCTGAAGCCCACAAGGAGGAAGCAGGAGCTCCGGAAGAGGGGCAGCCTGCCAAGTGCACCACCGGAGAAGAGGGGCACCTGCCACCCTGGCACAGATGGCGCTGTCCCCAAGCTGGACAAGGAGGGAAAAGTCGTCAAAAAACACAAGACAAAACACAAACACAAAAACAAGGAGAAGGGGCAGTGTTCCGTGAGCCAGGAACTTAAACTGAAAAGTTTTACGTACGAATACGAGGACTCCAAGCAAAAGTCAGAGAAAGCCATCCTCTTAGACAATGACATTTCCACAGACAATAAGCTGAAAGTGCTGAAGCACGACCGAGACCATTTTAAGAAAGAAGAGAAGCTCAGCAAACTGAAGTCAGAAGACAAGGAGTGGATCTTCAAAGAAGAGATGCTTAAGGTCTCCAAAGACGAGAAGTTGATGAAGAGGGCCAAAGACATCGGCAGGTCTTTCCGGGAAGAGAAAGACCGTTCCGGTAAAACAGAGAGGGAGAAGGCTGTGAAGGAAAAGTCCCCCAAAGAGGAACGGCTGAGGCTCTACAAAGAGGAGAAGAAGAAAAAGTCCAAAGACCGGCCTTCGAAGTTAGAGAAGAAGAATGACATGAAGGAGGACAGGGCTTGCAAGGAGAAGGAAAAGCTCAAAAAGGAAAAAGGTTACAGAGACGATGCTGCATTTGACGAATTCTGCAGCAAAACTCAGTTTCTAGAGAATGAGGACACCAAATTCAGCCTTTCTGATGATCAGCAAGAGAGGTGGTTTTCTGACCTGTCTGATTCCTCCTTTGATTTCAAAGGGGAGGACAGCTGGGACTCCCCAGTGACAGACTACAGGGACATCAAGAATGACTCTGTGGCCAAACTCATCTTAGAGACAGTGAAGGAGGATAGTAAGGAGAAGAAGCGAGACAACAGAGCCCGGGAGAAGCGGGACTTCAGAGACTCGTTCTTCCGAAAGAAAGACAGGGACTGTCTGGACAAGAGCTCCGAGAAGAGAAGAGACCAGGTGGAGAAGCACAAAGGCGTCCCCAGCTACCTCTCTGAGAAAGACAAGAAGAGGAGGGAATGTGCCGAGGGCGGGCGCGATCGCAGGGATGGCCTGGACGGCTCCCGGGAGCGCAAGGAAGCCCGGCTCCGGCCTGAGGAGGCGCATCGGGAGGACTTGAAGGACTGTGGCTGCGAGAGTGCATTCAGGGACAAGCCGGACTCTGACCTCCCCAAGGGCCTCGAGCCCTGGGAACGGCCCCACGCCCTGCGCCTGGAGAAGGACCGGAAGGAGAAGGTGCGGGTGGAGAAGTGCAAAGACAAGTCACTGGACAGAGACAAGAGCGAGAAATCTCTCCTTGAGAAATGTCAGAAGGACAAAGAATTTGACAAATGTTTTAAAGAGAAGAGAGATGCTAAGGAAAAGCATAAAGAGGCCCACAGCAAAGACAGGAAGGCGTCGCTCGACCAAGGGAGAGAGAAGAAGGAGAAGATGTTCCCTGGACTTCTCTCAGAAGACTTCTCCGAAAAAAAAGATGAAAAGAAAGGGAGAGAGAAGAGCTGGTACATTGCAGACATATTCACAGACGAAAGTGAAGATGAAAAAGATGACTATATGGCCAGCAGCTTCAAGGCCGGGGAAGCCGGGGACGCGCAGAGAGGGGACAGCCTCCAGGACAAGGAGGATGGCAGAGAGCTGCATCTCTTGGACAGACACCGGAAGTCCTCTGACCGGCAGCACGCAGAGAAGCCAAGGGATAAAGAGCCCAAGGAGAAGAGGAAGGACAGGGTGGCTGCCGACAGTGGGCGCGACAGGAAGGACAAGATCTTTGAGAAGCACCGAGAGAAGAAGGACAAAGAGTGTGCAGAGAGATACAAGGACAGGAAAGACAGGGCTTCCGTCGACTCTGCCCAGGAAAAGAAGAACAAGCAGAAGCTCCCTGAGAAGGTGGAGAAGAAGCACTCCACCGAAGACAAGGCCAAGAGTAAGCACAAGGACAAGCCAGAGAAGGAGCACTCCAAAGAGAGGAAGGGCTCGAGGGGCGCCGAGGCAGAGAAGAGCCTGCTGGAGAAGCTGGAGGAGGAGGCGCTGCACGAGGACCGGGAGGACTCCAATGACAAAGCCAGCGAGGTCTCGTCAGACAGCTTCACAGACCGGGGCCAGGAGCCGGGCCTGAGCGCCCTCCTGGAGGTGTCCTTCTCAGAGCCGCCCGATGACAAGGCCAGAGAGAGCTGCCTCACGGAGAAGCTGAGGGACAGGGAGCGGCACAGGCACTCCTCATCCTCCTCCAAGAAGAGCCACGACCGGGAGCGAGCCAAGAAGGAGAAGGCTGAGAAGAAAGAGAAGGCCGAGGACTACAAGGACGGTGGCTGCAGGAAGGACTCGAGCCAGTATGAGAAGGACTTCCTGGATGCAGAGGCCTACGGGGTCGCCTACACCGTGAAAGCCGACATGGAAGAGGAGTTGGATAAGACCGTTGAGATATTTCCCTCGGAAAAGAAAGAGAGAAATGATCCCGAGAGAGAATCTGCCAAGAAAATCGAGAAGGAACTAAAGCCTTACGGATCTAGTACCATCAGCATCCTGAAGGAGAAGAAGAAAAGAGAGAAACACAGGGAGAAGTGGAGAGACGAGAAGGAGAGACACCGGGAGAAGCACACGGACGGGTTCCTCAAACACCACAAGGACGAGCCAAAGCCCGCAGCCAAAGACAAGGACAACCCTCCGAACTCCTTCAGGGAGAAGTCCAGGGACGAAAGCCTGAAACTCAGTGAGACCAAGCTGAAGGAGAAGCTCAGGGAGAACACAGAGAGAGAAAAGGCGGACTCCATGAAGATCAGCAACGGCAGCGACAAGCTCCCGCTGGCCAGAGACCTGGGCAAGAAGGACGCCCGGCCCCGGGAGAAGCTCCTAGGAGACGGCGACCTGATGATGACCAGCTTTGAGAGGATGCTATCCCAGAAGGACCTGGAGGTCGAGGAGCGCCACAAGCGTCACAAGGAGCGCATGAAGCAGATGGAGAAGATGAGGCACAGGTCTGGGGACCCCAAGCTCAAGGACAAGACCAAGCCCCCCGAGGAGGGGCGGAAGAAGAGCCTGGACGTTCCTCCTAAGAAACCCCTGGGGCCAGACCCTCCCTTCAAGGAGAAGAAGCTCAAGGACTCCGCTCCCACACCACCCGCCACCGCCATCGAGGGCAAGCTGGGGCCCGGGGCGGAGTGCAAAGACTGGCCGGCAGCGCCGCCCCCCAAGGAGGTGTTGCCCCCCTCCCCCCGGCCTGAGCAGAGCCGGCCCACTGGGGTGCCCACGCCAAGCTACGAGGAGGTGATGCACACGCCCAGGACGCCGTCCTGCAGCGCTGATGACTACCCCGACCTGGTGTTTGACTGTGCGGACTCCCAGCACTCAATGCCTGTCTCCGCCACGTCCACCAGCACCTGCTCTCCGCCGTTTTTTGACAGGTTCTCTGTGGCTTCCAGTGGGGTGTCAGAAAACCCGGGCCAGACACCCACAAGGCCTGTCTCCTCCAACCTGTACCGCTCCATCTCTGTGGACATCAGGAGAACCCCCGAGGAAGAGTTCAGTGTCGGGGACAAGTTGTTCAGGCAGCAGAGCGTGCCTGCGGCCTCCAGCTTCGGCTCCCCTGTGCAGCACCTGCTGGAAGACAAGGCCCCGCTACCGCCTGTTCCCTCTGAAAAGTTCCCCTGCCTGTCCCCAGGGTACTACTCCCCAGACTACGGCATCCCCTCGGGCATGCCCTCACCCAAGGTGGATTCGCTCCACTGCCCCCCTGCCTGCACGGTGAGCGTCACGCCCTCCCCCGAGGGCGTCTTCTCCAGTTTACCAGCAAAAGCCTCTCCTCCCAGAGGTGAGCTGTTTGCCCCTGCTGTAGATGGGGCCCTCACCCCAGACCTGGGCCTCCCTCTGGACGCCACAGAGGACCAGCAGGCCACAGCCGCCATCATCCCCCCAGAGCCCAGCTACCTGGAACCCTTGGATGAGGGCCCCTTCAGCACTGTCATCACTGAGGAGCCTGGGGAGTGGGCGCACCCTGCTGCCGAGCAGACCCTTTCTCCCTCCTTGGTCACTGGTGCCTCTGAAAACCCTGTCAGCTGGCCTGTGGGTGCCGACCTCCTGCTGAAGTCCCCTCAGAGGTTCCCAGAGTCCCCTAAACATTACTGCCCTGCTGAGTCCCTCCACACTGCCACCCCAGGGCCCTTCAGTGCTGCAGAGCCCCCGTACCCTGTCTCTCCTGTCTCCTACCCTCTGCCAGCCGCCGAGCCAGACCTGGAGGAAGTCAAAGATGATGGGGTGGGAGCCATCTCCGCCACCACCGAGGGAGGCACACCTTACACCACCCCTGCCAGGCTCGAGTCCTTCTTTGGCAGCTGCAAGCCACTCCCCGATGCACCCCTCGACCAGGTGCCTGAGCCCACATGTGTCTCCACGGTGGCCCAGGTGGAGGCCCTCGGAGCCCTGGAGAGCAGCTTCCTGGACAGTGGCCACGGCCTGGCTGCTCTTGGCCAGGTGGAGCCCGTACCCTGGCACGACGCCTTCACCAGCACCGAGGACGACCTGGACCTGGGGCCCTTCTCACTGCCGGAGCTCCCTCTGCAGCCCAAGGACCCCCCAGATGTTGAAATGGAGCCTGCAGGAGGAAGCCCTGCTCCCCCAGGAGAGGCCCTCCCTGTGCCCGCTGGGGTCAGCAGTGATGGGGACGGCCCTGTGGCCGAGGCCGAGGATCAGCCAGCTCCACCTACCGAGCAGGCCGTCCCCCGACTCCCTGCTGAGCTCGAGCCCTCCGAGGAACCGAAGCTGGATGTGGTTCTGGAAGCCACTGTGGAAGCAGAAGCAGTGGCGGACGAGCAGGCCCCTGAGGACCTGGACTCCGGCTCAGTGCCTGTGCCCGGCCCCCCAGAATGGCATCCCCTGGAGGGCGGAGATGAGGTGGAGGCTGAAGCCCCTGCGGCTGCGCCCCACTGTGCCCCTGACGGCCCCCCCCAGGAGGCCCCCCCACAGGCCCAAGCTGATTCAGAGGCCACCCCTGCTGCCACCCCAGCCGAGGGGCCTCTGGGCAGCGTGCAGCCAGGAGCTCCAGAGCCCGAGCCCAGGCCTGCAGCTGAAGCCCCCAAGGCCCCCCGGGTGGAGGAGGTTCCTCAGCGCATGACCAGGAACCGGGCCCAGATGTTGGCCAGTCAGAGCAAGCAGGGCACACCACCCACAGAGAAGGAGCCTGCACCCGCGCCCACACCCACGTCCACGCAGGCCTCCCGAACCAAGGCCCGTGCCCCCGAGGAGGAGGACGCCCAAGCCCAGCACCCGCGCAAGCGCCGCTTCCAGCGCTCCAGCCAGCAGCTGCAGCAGCAGCTGCACACGTCCACACGGCAGACTCGGGAGGTCATCCAGCAGACACTGGCCGCCATTGTGGACGCCATCAAGCTGGACGACATTGAGCCCTATCACAGTGACAGATCCAACCCATACTTTGAGTACCTTCAGATCAGAAAGAAGATCGAAGAGAAGCGCAAGATCCTCTGCTACATCACACCACAGGCGCCCCAGTGCTACGCTGAGTACGTCACCTACACGGGGTCCTACCTCTTAGACGGCAAGCCACTCAGCAAGCTCCACATCCCTGTGATCGCGCCCCCACCCTCCCTGGCAGAGCCCCTCAAGGAGCTCTTCAAGCAGCAGGAAGCTGTGCGGGGGAAGCTGCGTCTGCAGCACAGCATCGAGCGGGAGAAGCTCATAGTGTCCTGTGAGCAGGAGATCCTGCGGGTCCATTGCCGGGCAGCCCGGACGATTGCCAACCAGGCGGTGCCTTTCAGCGCCTGCACGATGCTGTTAGACTCTGAGGTCTACAACATGCCCCTGGAGAGCCAGGTGCGTGGCGGTCCCCAGGGTTACTCACTTGCCCTTCACTTGGGCAGCAGCCACCCCCACGCACCCTCTACCCTGAGCCAGCTGTTGACAGCACTGTGTCCCTGGAGGGCCACCTGTCTGCCTGCAGCCACAGAAGGGGCAGGAGCAGTGGCACTGAGGGGTGGCCACATGCACCCCGCAGGGAACAGCTGCCCTTCCTCCCTCACGGGGCAGGTGCGACTGCATTTTCCATTCCCACTTCCTGAGGAGCAGTGGGGCTGGCACACCGGTGGCCCTGGGCAGCAGGTGGTAGCAGCTACAGGGCCTGTGGTGACTGGCCAGGCAGGGGCTCATCTGACCCAGGTAGACCGAGGCTTCTCCTGTGGGAACGAGGGCAGATCTGCAGCAGGCTAG

XM_004842648.1 Coding sequence

Ankrd11 ankyrin repeat domain 11, transcript variant X6

Length: 7545 bp    Location: 557651..571820   Strand: +
>XM_004842648.1
ATGAGCGGGGGGAGACCCGCCTGCACCGGGCCGCCATCCGAGGAGACGCCCGGCGCATCAAGGAGCTCATCAGTGAGGGTGCAGACGTCAACGTCAAGGACTTTGCAGTGTCTGTTTCCAGGCTGGACAGCGCTGCATGAGGCGTGTAACCGGGGCTACTACGATGTCGCCAAGCAGCTGCTGGCCGCAGGTGCAGAGGTGAACACCAAAGGCCTGGATGATGACACGCCTTTGCATGATGCCGCCAACAACGGCCACTACAAGGTGGTGAAGCTGTTGTTACGGTATGGGGGGAATCCTCAGCAGAGCAACCGGAAAGGCGAGACCCCGTTGAAAGTGGCCAATTCCCCCACGATGGTGAATCTGCTGTTAGGCAAAGGCACCTACACGTCCAGTGAAGAGAGCTCCACTGAGAGCTCTGAGGAGGAAGACGCCCCGTCATTCGCGCCGTCCAGCTCAGTCGACGGCAATAACACGGACTCTGAGTTTGAGAAAGGCCTGAAGCTCAAGGCCAAGAATCCAGAGCCACAGAAGGCCGTGACCCCTGTCAAGGACGAGTACGAGTTTGATGAGGATGACGAGCAGGACAGGGTCCCCCCAGTGGATGACAAGCACTTGCTAAAGAAGGATTACAGGAAAGAGACTAAGTCAAACAGTTTCATTTCGATACCCAAAATGGAAGTTAAGAGTTACACCAAGAACAATACGATTGCACCAAAGAAAGCAGCCCATCGTATCCTGTCAGACACATCCGACGAGGAGGACACTGGCCTCGCCGTTGGTGCCGGGGAGAAGCTGAGGCTGTCAGCACACTCTGTGCTGCCCAGCAGCAAGGTACGGGAGCCGTCCAACTCCAGGCAGCAGAAGGAGAAAAGCAAAGTGAAGAAGAAGCGAAAGAAAGAAGCAAAAAGCAAAGAAGTTCGCTTTGGAAAGAGGAATGACAAGTTCTGTTCCTCTGAGTCAGAGAGCGAGTCCTCAGAGAGTGAGGAGGACGATGACGACTCTGTGGGGAGCACAGGCTGCCTCAAGGGGTCCCCACTGGTGCTGAAGGACCCCTCCCTGTTCAGCTCACTGTCTGCCTCCTCCACCTCCTCCCACGGCAGTGCCGTGGCCCCGAAGCACGGCACCAACCACGGTGATCAGCATGCCAAGCACTGGCGCACGGACAACTGGAAAGCCATCTCCTCCCCGGCCTGGTCTGAGGTCAGCTCCCTGTCAGACTCCTCACGGACAGGACTGACGAGCGAGTCTGACTGCCCCTCTGAGGGCTCCAGCGTGGAGTCGCTGAAGCCCACAAGGAGGAAGCAGGAGCTCCGGAAGAGGGGCAGCCTGCCAAGTGCACCACCGGAGAAGAGGGGCACCTGCCACCCTGGCACAGATGGCGCTGTCCCCAAGCTGGACAAGGAGGGAAAAGTCGTCAAAAAACACAAGACAAAACACAAACACAAAAACAAGGAGAAGGGGCAGTGTTCCGTGAGCCAGGAACTTAAACTGAAAAGTTTTACGTACGAATACGAGGACTCCAAGCAAAAGTCAGAGAAAGCCATCCTCTTAGACAATGACATTTCCACAGACAATAAGCTGAAAGTGCTGAAGCACGACCGAGACCATTTTAAGAAAGAAGAGAAGCTCAGCAAACTGAAGTCAGAAGACAAGGAGTGGATCTTCAAAGAAGAGATGCTTAAGGTCTCCAAAGACGAGAAGTTGATGAAGAGGGCCAAAGACATCGGCAGGTCTTTCCGGGAAGAGAAAGACCGTTCCGGTAAAACAGAGAGGGAGAAGGCTGTGAAGGAAAAGTCCCCCAAAGAGGAACGGCTGAGGCTCTACAAAGAGGAGAAGAAGAAAAAGTCCAAAGACCGGCCTTCGAAGTTAGAGAAGAAGAATGACATGAAGGAGGACAGGGCTTGCAAGGAGAAGGAAAAGCTCAAAAAGGAAAAAGGTTACAGAGACGATGCTGCATTTGACGAATTCTGCAGCAAAACTCAGTTTCTAGAGAATGAGGACACCAAATTCAGCCTTTCTGATGATCAGCAAGAGAGGTGGTTTTCTGACCTGTCTGATTCCTCCTTTGATTTCAAAGGGGAGGACAGCTGGGACTCCCCAGTGACAGACTACAGGGACATCAAGAATGACTCTGTGGCCAAACTCATCTTAGAGACAGTGAAGGAGGATAGTAAGGAGAAGAAGCGAGACAACAGAGCCCGGGAGAAGCGGGACTTCAGAGACTCGTTCTTCCGAAAGAAAGACAGGGACTGTCTGGACAAGAGCTCCGAGAAGAGAAGAGACCAGGTGGAGAAGCACAAAGGCGTCCCCAGCTACCTCTCTGAGAAAGACAAGAAGAGGAGGGAATGTGCCGAGGGCGGGCGCGATCGCAGGGATGGCCTGGACGGCTCCCGGGAGCGCAAGGAAGCCCGGCTCCGGCCTGAGGAGGCGCATCGGGAGGACTTGAAGGACTGTGGCTGCGAGAGTGCATTCAGGGACAAGCCGGACTCTGACCTCCCCAAGGGCCTCGAGCCCTGGGAACGGCCCCACGCCCTGCGCCTGGAGAAGGACCGGAAGGAGAAGGTGCGGGTGGAGAAGTGCAAAGACAAGTCACTGGACAGAGACAAGAGCGAGAAATCTCTCCTTGAGAAATGTCAGAAGGACAAAGAATTTGACAAATGTTTTAAAGAGAAGAGAGATGCTAAGGAAAAGCATAAAGAGGCCCACAGCAAAGACAGGAAGGCGTCGCTCGACCAAGGGAGAGAGAAGAAGGAGAAGATGTTCCCTGGACTTCTCTCAGAAGACTTCTCCGAAAAAAAAGATGAAAAGAAAGGGAGAGAGAAGAGCTGGTACATTGCAGACATATTCACAGACGAAAGTGAAGATGAAAAAGATGACTATATGGCCAGCAGCTTCAAGGCCGGGGAAGCCGGGGACGCGCAGAGAGGGGACAGCCTCCAGGACAAGGAGGATGGCAGAGAGCTGCATCTCTTGGACAGACACCGGAAGTCCTCTGACCGGCAGCACGCAGAGAAGCCAAGGGATAAAGAGCCCAAGGAGAAGAGGAAGGACAGGGTGGCTGCCGACAGTGGGCGCGACAGGAAGGACAAGATCTTTGAGAAGCACCGAGAGAAGAAGGACAAAGAGTGTGCAGAGAGATACAAGGACAGGAAAGACAGGGCTTCCGTCGACTCTGCCCAGGAAAAGAAGAACAAGCAGAAGCTCCCTGAGAAGGTGGAGAAGAAGCACTCCACCGAAGACAAGGCCAAGAGTAAGCACAAGGACAAGCCAGAGAAGGAGCACTCCAAAGAGAGGAAGGGCTCGAGGGGCGCCGAGGCAGAGAAGAGCCTGCTGGAGAAGCTGGAGGAGGAGGCGCTGCACGAGGACCGGGAGGACTCCAATGACAAAGCCAGCGAGGTCTCGTCAGACAGCTTCACAGACCGGGGCCAGGAGCCGGGCCTGAGCGCCCTCCTGGAGGTGTCCTTCTCAGAGCCGCCCGATGACAAGGCCAGAGAGAGCTGCCTCACGGAGAAGCTGAGGGACAGGGAGCGGCACAGGCACTCCTCATCCTCCTCCAAGAAGAGCCACGACCGGGAGCGAGCCAAGAAGGAGAAGGCTGAGAAGAAAGAGAAGGCCGAGGACTACAAGGACGGTGGCTGCAGGAAGGACTCGAGCCAGTATGAGAAGGACTTCCTGGATGCAGAGGCCTACGGGGTCGCCTACACCGTGAAAGCCGACATGGAAGAGGAGTTGGATAAGACCGTTGAGATATTTCCCTCGGAAAAGAAAGAGAGAAATGATCCCGAGAGAGAATCTGCCAAGAAAATCGAGAAGGAACTAAAGCCTTACGGATCTAGTACCATCAGCATCCTGAAGGAGAAGAAGAAAAGAGAGAAACACAGGGAGAAGTGGAGAGACGAGAAGGAGAGACACCGGGAGAAGCACACGGACGGGTTCCTCAAACACCACAAGGACGAGCCAAAGCCCGCAGCCAAAGACAAGGACAACCCTCCGAACTCCTTCAGGGAGAAGTCCAGGGACGAAAGCCTGAAACTCAGTGAGACCAAGCTGAAGGAGAAGCTCAGGGAGAACACAGAGAGAGAAAAGGCGGACTCCATGAAGATCAGCAACGGCAGCGACAAGCTCCCGCTGGCCAGAGACCTGGGCAAGAAGGACGCCCGGCCCCGGGAGAAGCTCCTAGGAGACGGCGACCTGATGATGACCAGCTTTGAGAGGATGCTATCCCAGAAGGACCTGGAGGTCGAGGAGCGCCACAAGCGTCACAAGGAGCGCATGAAGCAGATGGAGAAGATGAGGCACAGGTCTGGGGACCCCAAGCTCAAGGACAAGACCAAGCCCCCCGAGGAGGGGCGGAAGAAGAGCCTGGACGTTCCTCCTAAGAAACCCCTGGGGCCAGACCCTCCCTTCAAGGAGAAGAAGCTCAAGGACTCCGCTCCCACACCACCCGCCACCGCCATCGAGGGCAAGCTGGGGCCCGGGGCGGAGTGCAAAGACTGGCCGGCAGCGCCGCCCCCCAAGGAGGTGTTGCCCCCCTCCCCCCGGCCTGAGCAGAGCCGGCCCACTGGGGTGCCCACGCCAAGCTACGAGGAGGTGATGCACACGCCCAGGACGCCGTCCTGCAGCGCTGATGACTACCCCGACCTGGTGTTTGACTGTGCGGACTCCCAGCACTCAATGCCTGTCTCCGCCACGTCCACCAGCACCTGCTCTCCGCCGTTTTTTGACAGGTTCTCTGTGGCTTCCAGTGGGGTGTCAGAAAACCCGGGCCAGACACCCACAAGGCCTGTCTCCTCCAACCTGTACCGCTCCATCTCTGTGGACATCAGGAGAACCCCCGAGGAAGAGTTCAGTGTCGGGGACAAGTTGTTCAGGCAGCAGAGCGTGCCTGCGGCCTCCAGCTTCGGCTCCCCTGTGCAGCACCTGCTGGAAGACAAGGCCCCGCTACCGCCTGTTCCCTCTGAAAAGTTCCCCTGCCTGTCCCCAGGGTACTACTCCCCAGACTACGGCATCCCCTCGGGCATGCCCTCACCCAAGGTGGATTCGCTCCACTGCCCCCCTGCCTGCACGGTGAGCGTCACGCCCTCCCCCGAGGGCGTCTTCTCCAGTTTACCAGCAAAAGCCTCTCCTCCCAGAGGTGAGCTGTTTGCCCCTGCTGTAGATGGGGCCCTCACCCCAGACCTGGGCCTCCCTCTGGACGCCACAGAGGACCAGCAGGCCACAGCCGCCATCATCCCCCCAGAGCCCAGCTACCTGGAACCCTTGGATGAGGGCCCCTTCAGCACTGTCATCACTGAGGAGCCTGGGGAGTGGGCGCACCCTGCTGCCGAGCAGACCCTTTCTCCCTCCTTGGTCACTGGTGCCTCTGAAAACCCTGTCAGCTGGCCTGTGGGTGCCGACCTCCTGCTGAAGTCCCCTCAGAGGTTCCCAGAGTCCCCTAAACATTACTGCCCTGCTGAGTCCCTCCACACTGCCACCCCAGGGCCCTTCAGTGCTGCAGAGCCCCCGTACCCTGTCTCTCCTGTCTCCTACCCTCTGCCAGCCGCCGAGCCAGACCTGGAGGAAGTCAAAGATGATGGGGTGGGAGCCATCTCCGCCACCACCGAGGGAGGCACACCTTACACCACCCCTGCCAGGCTCGAGTCCTTCTTTGGCAGCTGCAAGCCACTCCCCGATGCACCCCTCGACCAGGTGCCTGAGCCCACATGTGTCTCCACGGTGGCCCAGGTGGAGGCCCTCGGAGCCCTGGAGAGCAGCTTCCTGGACAGTGGCCACGGCCTGGCTGCTCTTGGCCAGGTGGAGCCCGTACCCTGGCACGACGCCTTCACCAGCACCGAGGACGACCTGGACCTGGGGCCCTTCTCACTGCCGGAGCTCCCTCTGCAGCCCAAGGACCCCCCAGATGTTGAAATGGAGCCTGCAGGAGGAAGCCCTGCTCCCCCAGGAGAGGCCCTCCCTGTGCCCGCTGGGGTCAGCAGTGATGGGGACGGCCCTGTGGCCGAGGCCGAGGATCAGCCAGCTCCACCTACCGAGCAGGCCGTCCCCCGACTCCCTGCTGAGCTCGAGCCCTCCGAGGAACCGAAGCTGGATGTGGTTCTGGAAGCCACTGTGGAAGCAGAAGCAGTGGCGGACGAGCAGGCCCCTGAGGACCTGGACTCCGGCTCAGTGCCTGTGCCCGGCCCCCCAGAATGGCATCCCCTGGAGGGCGGAGATGAGGTGGAGGCTGAAGCCCCTGCGGCTGCGCCCCACTGTGCCCCTGACGGCCCCCCCCAGGAGGCCCCCCCACAGGCCCAAGCTGATTCAGAGGCCACCCCTGCTGCCACCCCAGCCGAGGGGCCTCTGGGCAGCGTGCAGCCAGGAGCTCCAGAGCCCGAGCCCAGGCCTGCAGCTGAAGCCCCCAAGGCCCCCCGGGTGGAGGAGGTTCCTCAGCGCATGACCAGGAACCGGGCCCAGATGTTGGCCAGTCAGAGCAAGCAGGGCACACCACCCACAGAGAAGGAGCCTGCACCCGCGCCCACACCCACGTCCACGCAGGCCTCCCGAACCAAGGCCCGTGCCCCCGAGGAGGAGGACGCCCAAGCCCAGCACCCGCGCAAGCGCCGCTTCCAGCGCTCCAGCCAGCAGCTGCAGCAGCAGCTGCACACGTCCACACGGCAGACTCGGGAGGTCATCCAGCAGACACTGGCCGCCATTGTGGACGCCATCAAGCTGGACGACATTGAGCCCTATCACAGTGACAGATCCAACCCATACTTTGAGTACCTTCAGATCAGAAAGAAGATCGAAGAGAAGCGCAAGATCCTCTGCTACATCACACCACAGGCGCCCCAGTGCTACGCTGAGTACGTCACCTACACGGGGTCCTACCTCTTAGACGGCAAGCCACTCAGCAAGCTCCACATCCCTGTGATCGCGCCCCCACCCTCCCTGGCAGAGCCCCTCAAGGAGCTCTTCAAGCAGCAGGAAGCTGTGCGGGGGAAGCTGCGTCTGCAGCACAGCATCGAGCGGGAGAAGCTCATAGTGTCCTGTGAGCAGGAGATCCTGCGGGTCCATTGCCGGGCAGCCCGGACGATTGCCAACCAGGCGGTGCCTTTCAGCGCCTGCACGATGCTGTTAGACTCTGAGGTCTACAACATGCCCCTGGAGAGCCAGGTGCGTGGCGGTCCCCAGGGTTACTCACTTGCCCTTCACTTGGGCAGCAGCCACCCCCACGCACCCTCTACCCTGAGCCAGCTGTTGACAGCACTGTGTCCCTGGAGGGCCACCTGTCTGCCTGCAGCCACAGAAGGGGCAGGAGCAGTGGCACTGAGGGGTGGCCACATGCACCCCGCAGGGAACAGCTGCCCTTCCTCCCTCACGGGGCAGGTGCGACTGCATTTTCCATTCCCACTTCCTGAGGAGCAGTGGGGCTGGCACACCGGTGGCCCTGGGCAGCAGGTGGTAGCAGCTACAGGGCCTGTGGTGACTGGCCAGGCAGGGGCTCATCTGACCCAGGTAGACCGAGGCTTCTCCTGTGGGAACGAGGGCAGATCTGCAGCAGGCTAG

XM_004842647.1 Coding sequence

Ankrd11 ankyrin repeat domain 11, transcript variant X5

Length: 7911 bp    Location: 461933..576809   Strand: +
>XM_004842647.1
ATGCCCAAGAGTGGGTGTTCTAAAACACCACAGCAAGAAGACTTTCCTCTCAGCAACGACATGGTGGAGAAACAAACTGGGAAAAAGGATAAAGATAAAGTTTCTCTAACCAAGACCCCAAAGCTGGACCGCAGTGATGGAGGGAAGGAGGTGAGAGAGCGTACCACCAAGCGGAAGCTGCCCTTCACCGTGGGGGCCAATGGAGAGCAGAAGGACTCAGACACAGAGAAGCAGGGTCCCGAGCGGAAGAGGATCAAGAAGGAGCCTGTCGCCCGAAAGTCTGGGCTGCTGTTTGGCATGGGGCTGTCTGGGATCCGGGCCGGCTATCCCCTCTCCGAGCGCCAGCAGGTGGCTCTCCTCATGCAGATGACGGCCGAGGAGTCTGCCAACAGCCCAGTAGACACAACACCAAAGCACCCCTCCCAGTCTACAGTGTGTCAGAAGGGGACGCCTAACTCTGCCTCAAAAACCAAAGATAAAGTGAACAAGAGGAATGAGCGGGGGGAGACCCGCCTGCACCGGGCCGCCATCCGAGGAGACGCCCGGCGCATCAAGGAGCTCATCAGTGAGGGTGCAGACGTCAACGTCAAGGACTTTGCAGGCTGGACAGCGCTGCATGAGGCGTGTAACCGGGGCTACTACGATGTCGCCAAGCAGCTGCTGGCCGCAGGTGCAGAGGTGAACACCAAAGGCCTGGATGATGACACGCCTTTGCATGATGCCGCCAACAACGGCCACTACAAGGTGGTGAAGCTGTTGTTACGGTATGGGGGGAATCCTCAGCAGAGCAACCGGAAAGGCGAGACCCCGTTGAAAGTGGCCAATTCCCCCACGATGGTGAATCTGCTGTTAGGCAAAGGCACCTACACGTCCAGTGAAGAGAGCTCCACTGAGAGCTCTGAGGAGGAAGACGCCCCGTCATTCGCGCCGTCCAGCTCAGTCGACGGCAATAACACGGACTCTGAGTTTGAGAAAGGCCTGAAGCTCAAGGCCAAGAATCCAGAGCCACAGAAGGCCGTGACCCCTGTCAAGGACGAGTACGAGTTTGATGAGGATGACGAGCAGGACAGGGTCCCCCCAGTGGATGACAAGCACTTGCTAAAGAAGGATTACAGGAAAGAGACTAAGTCAAACAGTTTCATTTCGATACCCAAAATGGAAGTTAAGAGTTACACCAAGAACAATACGATTGCACCAAAGAAAGCAGCCCATCGTATCCTGTCAGACACATCCGACGAGGAGGACACTGGCCTCGCCGTTGGTGCCGGGGAGAAGCTGAGGCTGTCAGCACACTCTGTGCTGCCCAGCAGCAAGGTACGGGAGCCGTCCAACTCCAGGCAGCAGAAGGAGAAAAGCAAAGTGAAGAAGAAGCGAAAGAAAGAAGCAAAAAGCAAAGAAGTTCGCTTTGGAAAGAGGAATGACAAGTTCTGTTCCTCTGAGTCAGAGAGCGAGTCCTCAGAGAGTGAGGAGGACGATGACGACTCTGTGGGGAGCACAGGCTGCCTCAAGGGGTCCCCACTGGTGCTGAAGGACCCCTCCCTGTTCAGCTCACTGTCTGCCTCCTCCACCTCCTCCCACGGCAGTGCCGTGGCCCCGAAGCACGGCACCAACCACGGTGATCAGCATGCCAAGCACTGGCGCACGGACAACTGGAAAGCCATCTCCTCCCCGGCCTGGTCTGAGGTCAGCTCCCTGTCAGACTCCTCACGGACAGGACTGACGAGCGAGTCTGACTGCCCCTCTGAGGGCTCCAGCGTGGAGTCGCTGAAGCCCACAAGGAGGAAGCAGGAGCTCCGGAAGAGGGGCAGCCTGCCAAGTGCACCACCGGAGAAGAGGGGCACCTGCCACCCTGGCACAGATGGCGCTGTCCCCAAGCTGGACAAGGAGGGAAAAGTCGTCAAAAAACACAAGACAAAACACAAACACAAAAACAAGGAGAAGGGGCAGTGTTCCGTGAGCCAGGAACTTAAACTGAAAAGTTTTACGTACGAATACGAGGACTCCAAGCAAAAGTCAGAGAAAGCCATCCTCTTAGACAATGACATTTCCACAGACAATAAGCTGAAAGTGCTGAAGCACGACCGAGACCATTTTAAGAAAGAAGAGAAGCTCAGCAAACTGAAGTCAGAAGACAAGGAGTGGATCTTCAAAGAAGAGATGCTTAAGGTCTCCAAAGACGAGAAGTTGATGAAGAGGGCCAAAGACATCGGCAGGTCTTTCCGGGAAGAGAAAGACCGTTCCGGTAAAACAGAGAGGGAGAAGGCTGTGAAGGAAAAGTCCCCCAAAGAGGAACGGCTGAGGCTCTACAAAGAGGAGAAGAAGAAAAAGTCCAAAGACCGGCCTTCGAAGTTAGAGAAGAAGAATGACATGAAGGAGGACAGGGCTTGCAAGGAGAAGGAAAAGCTCAAAAAGGAAAAAGGTTACAGAGACGATGCTGCATTTGACGAATTCTGCAGCAAAACTCAGTTTCTAGAGAATGAGGACACCAAATTCAGCCTTTCTGATGATCAGCAAGAGAGGTGGTTTTCTGACCTGTCTGATTCCTCCTTTGATTTCAAAGGGGAGGACAGCTGGGACTCCCCAGTGACAGACTACAGGGACATCAAGAATGACTCTGTGGCCAAACTCATCTTAGAGACAGTGAAGGAGGATAGTAAGGAGAAGAAGCGAGACAACAGAGCCCGGGAGAAGCGGGACTTCAGAGACTCGTTCTTCCGAAAGAAAGACAGGGACTGTCTGGACAAGAGCTCCGAGAAGAGAAGAGACCAGGTGGAGAAGCACAAAGGCGTCCCCAGCTACCTCTCTGAGAAAGACAAGAAGAGGAGGGAATGTGCCGAGGGCGGGCGCGATCGCAGGGATGGCCTGGACGGCTCCCGGGAGCGCAAGGAAGCCCGGCTCCGGCCTGAGGAGGCGCATCGGGAGGACTTGAAGGACTGTGGCTGCGAGAGTGCATTCAGGGACAAGCCGGACTCTGACCTCCCCAAGGGCCTCGAGCCCTGGGAACGGCCCCACGCCCTGCGCCTGGAGAAGGACCGGAAGGAGAAGGTGCGGGTGGAGAAGTGCAAAGACAAGTCACTGGACAGAGACAAGAGCGAGAAATCTCTCCTTGAGAAATGTCAGAAGGACAAAGAATTTGACAAATGTTTTAAAGAGAAGAGAGATGCTAAGGAAAAGCATAAAGAGGCCCACAGCAAAGACAGGAAGGCGTCGCTCGACCAAGGGAGAGAGAAGAAGGAGAAGATGTTCCCTGGACTTCTCTCAGAAGACTTCTCCGAAAAAAAAGATGAAAAGAAAGGGAGAGAGAAGAGCTGGTACATTGCAGACATATTCACAGACGAAAGTGAAGATGAAAAAGATGACTATATGGCCAGCAGCTTCAAGGCCGGGGAAGCCGGGGACGCGCAGAGAGGGGACAGCCTCCAGGACAAGGAGGATGGCAGAGAGCTGCATCTCTTGGACAGACACCGGAAGTCCTCTGACCGGCAGCACGCAGAGAAGCCAAGGGATAAAGAGCCCAAGGAGAAGAGGAAGGACAGGGTGGCTGCCGACAGTGGGCGCGACAGGAAGGACAAGATCTTTGAGAAGCACCGAGAGAAGAAGGACAAAGAGTGTGCAGAGAGATACAAGGACAGGAAAGACAGGGCTTCCGTCGACTCTGCCCAGGAAAAGAAGAACAAGCAGAAGCTCCCTGAGAAGGTGGAGAAGAAGCACTCCACCGAAGACAAGGCCAAGAGTAAGCACAAGGACAAGCCAGAGAAGGAGCACTCCAAAGAGAGGAAGGGCTCGAGGGGCGCCGAGGCAGAGAAGAGCCTGCTGGAGAAGCTGGAGGAGGAGGCGCTGCACGAGGACCGGGAGGACTCCAATGACAAAGCCAGCGAGGTCTCGTCAGACAGCTTCACAGACCGGGGCCAGGAGCCGGGCCTGAGCGCCCTCCTGGAGGTGTCCTTCTCAGAGCCGCCCGATGACAAGGCCAGAGAGAGCTGCCTCACGGAGAAGCTGAGGGACAGGGAGCGGCACAGGCACTCCTCATCCTCCTCCAAGAAGAGCCACGACCGGGAGCGAGCCAAGAAGGAGAAGGCTGAGAAGAAAGAGAAGGCCGAGGACTACAAGGACGGTGGCTGCAGGAAGGACTCGAGCCAGTATGAGAAGGACTTCCTGGATGCAGAGGCCTACGGGGTCGCCTACACCGTGAAAGCCGACATGGAAGAGGAGTTGGATAAGACCGTTGAGATATTTCCCTCGGAAAAGAAAGAGAGAAATGATCCCGAGAGAGAATCTGCCAAGAAAATCGAGAAGGAACTAAAGCCTTACGGATCTAGTACCATCAGCATCCTGAAGGAGAAGAAGAAAAGAGAGAAACACAGGGAGAAGTGGAGAGACGAGAAGGAGAGACACCGGGAGAAGCACACGGACGGGTTCCTCAAACACCACAAGGACGAGCCAAAGCCCGCAGCCAAAGACAAGGACAACCCTCCGAACTCCTTCAGGGAGAAGTCCAGGGACGAAAGCCTGAAACTCAGTGAGACCAAGCTGAAGGAGAAGCTCAGGGAGAACACAGAGAGAGAAAAGGCGGACTCCATGAAGATCAGCAACGGCAGCGACAAGCTCCCGCTGGCCAGAGACCTGGGCAAGAAGGACGCCCGGCCCCGGGAGAAGCTCCTAGGAGACGGCGACCTGATGATGACCAGCTTTGAGAGGATGCTATCCCAGAAGGACCTGGAGGTCGAGGAGCGCCACAAGCGTCACAAGGAGCGCATGAAGCAGATGGAGAAGATGAGGCACAGGTCTGGGGACCCCAAGCTCAAGGACAAGACCAAGCCCCCCGAGGAGGGGCGGAAGAAGAGCCTGGACGTTCCTCCTAAGAAACCCCTGGGGCCAGACCCTCCCTTCAAGGAGAAGAAGCTCAAGGACTCCGCTCCCACACCACCCGCCACCGCCATCGAGGGCAAGCTGGGGCCCGGGGCGGAGTGCAAAGACTGGCCGGCAGCGCCGCCCCCCAAGGAGGTGTTGCCCCCCTCCCCCCGGCCTGAGCAGAGCCGGCCCACTGGGGTGCCCACGCCAAGCTACGAGGAGGTGATGCACACGCCCAGGACGCCGTCCTGCAGCGCTGATGACTACCCCGACCTGGTGTTTGACTGTGCGGACTCCCAGCACTCAATGCCTGTCTCCGCCACGTCCACCAGCACCTGCTCTCCGCCGTTTTTTGACAGGTTCTCTGTGGCTTCCAGTGGGGTGTCAGAAAACCCGGGCCAGACACCCACAAGGCCTGTCTCCTCCAACCTGTACCGCTCCATCTCTGTGGACATCAGGAGAACCCCCGAGGAAGAGTTCAGTGTCGGGGACAAGTTGTTCAGGCAGCAGAGCGTGCCTGCGGCCTCCAGCTTCGGCTCCCCTGTGCAGCACCTGCTGGAAGACAAGGCCCCGCTACCGCCTGTTCCCTCTGAAAAGTTCCCCTGCCTGTCCCCAGGGTACTACTCCCCAGACTACGGCATCCCCTCGGGCATGCCCTCACCCAAGGTGGATTCGCTCCACTGCCCCCCTGCCTGCACGGTGAGCGTCACGCCCTCCCCCGAGGGCGTCTTCTCCAGTTTACCAGCAAAAGCCTCTCCTCCCAGAGGTGAGCTGTTTGCCCCTGCTGTAGATGGGGCCCTCACCCCAGACCTGGGCCTCCCTCTGGACGCCACAGAGGACCAGCAGGCCACAGCCGCCATCATCCCCCCAGAGCCCAGCTACCTGGAACCCTTGGATGAGGGCCCCTTCAGCACTGTCATCACTGAGGAGCCTGGGGAGTGGGCGCACCCTGCTGCCGAGCAGACCCTTTCTCCCTCCTTGGTCACTGGTGCCTCTGAAAACCCTGTCAGCTGGCCTGTGGGTGCCGACCTCCTGCTGAAGTCCCCTCAGAGGTTCCCAGAGTCCCCTAAACATTACTGCCCTGCTGAGTCCCTCCACACTGCCACCCCAGGGCCCTTCAGTGCTGCAGAGCCCCCGTACCCTGTCTCTCCTGTCTCCTACCCTCTGCCAGCCGCCGAGCCAGACCTGGAGGAAGTCAAAGATGATGGGGTGGGAGCCATCTCCGCCACCACCGAGGGAGGCACACCTTACACCACCCCTGCCAGGCTCGAGTCCTTCTTTGGCAGCTGCAAGCCACTCCCCGATGCACCCCTCGACCAGGTGCCTGAGCCCACATGTGTCTCCACGGTGGCCCAGGTGGAGGCCCTCGGAGCCCTGGAGAGCAGCTTCCTGGACAGTGGCCACGGCCTGGCTGCTCTTGGCCAGGTGGAGCCCGTACCCTGGCACGACGCCTTCACCAGCACCGAGGACGACCTGGACCTGGGGCCCTTCTCACTGCCGGAGCTCCCTCTGCAGCCCAAGGACCCCCCAGATGTTGAAATGGAGCCTGCAGGAGGAAGCCCTGCTCCCCCAGGAGAGGCCCTCCCTGTGCCCGCTGGGGTCAGCAGTGATGGGGACGGCCCTGTGGCCGAGGCCGAGGATCAGCCAGCTCCACCTACCGAGCAGGCCGTCCCCCGACTCCCTGCTGAGCTCGAGCCCTCCGAGGAACCGAAGCTGGATGTGGTTCTGGAAGCCACTGTGGAAGCAGAAGCAGTGGCGGACGAGCAGGCCCCTGAGGACCTGGACTCCGGCTCAGTGCCTGTGCCCGGCCCCCCAGAATGGCATCCCCTGGAGGGCGGAGATGAGGTGGAGGCTGAAGCCCCTGCGGCTGCGCCCCACTGTGCCCCTGACGGCCCCCCCCAGGAGGCCCCCCCACAGGCCCAAGCTGATTCAGAGGCCACCCCTGCTGCCACCCCAGCCGAGGGGCCTCTGGGCAGCGTGCAGCCAGGAGCTCCAGAGCCCGAGCCCAGGCCTGCAGCTGAAGCCCCCAAGGCCCCCCGGGTGGAGGAGGTTCCTCAGCGCATGACCAGGAACCGGGCCCAGATGTTGGCCAGTCAGAGCAAGCAGGGCACACCACCCACAGAGAAGGAGCCTGCACCCGCGCCCACACCCACGTCCACGCAGGCCTCCCGAACCAAGGCCCGTGCCCCCGAGGAGGAGGACGCCCAAGCCCAGCACCCGCGCAAGCGCCGCTTCCAGCGCTCCAGCCAGCAGCTGCAGCAGCAGCTGCACACGTCCACACGGCAGACTCGGGAGGTCATCCAGCAGACACTGGCCGCCATTGTGGACGCCATCAAGCTGGACGACATTGAGCCCTATCACAGTGACAGATCCAACCCATACTTTGAGTACCTTCAGATCAGAAAGAAGATCGAAGAGAAGCGCAAGATCCTCTGCTACATCACACCACAGGCGCCCCAGTGCTACGCTGAGTACGTCACCTACACGGGGTCCTACCTCTTAGACGGCAAGCCACTCAGCAAGCTCCACATCCCTGTGATCGCGCCCCCACCCTCCCTGGCAGAGCCCCTCAAGGAGCTCTTCAAGCAGCAGGAAGCTGTGCGGGGGAAGCTGCGTCTGCAGCACAGCATCGAGCGGGAGAAGCTCATAGTGTCCTGTGAGCAGGAGATCCTGCGGGTCCATTGCCGGGCAGCCCGGACGATTGCCAACCAGGCGGTGCCTTTCAGCGCCTGCACGATGCTGTTAGACTCTGAGGTCTACAACATGCCCCTGGAGAGCCAGGGGGATGAGAACAAGTCGGTGCGAGATCGCTTCAACGCCCGCCAGTTCATCTCCTGGCTGCAGGACGTGGACGACAAGTACGACCGCATGAAGACGTGTCTCCTGATGCGGCAGCAGCACGAGGCGGCGGCCCTCAATGCCGTGCAGAGGATGGAGTGGCAGCTGAAGGCACAGGAGCTGGACCCTGCGGGGCACAAGTCCCTGTGCGTGAACGAGGTGCCCTCCTTCTATGTGCCCATGGTTGATGTCAACGACGATTTTGTGCTGCTGCCAGCGTGA

XM_004842646.1 Coding sequence

Ankrd11 ankyrin repeat domain 11, transcript variant X4

Length: 8022 bp    Location: 461933..571819   Strand: +
>XM_004842646.1
ATGCCCAAGAGTGGGTGTTCTAAAACACCACAGCAAGAAGACTTTCCTCTCAGCAACGACATGGTGGAGAAACAAACTGGGAAAAAGGATAAAGATAAAGTTTCTCTAACCAAGACCCCAAAGCTGGACCGCAGTGATGGAGGGAAGGAGGTGAGAGAGCGTACCACCAAGCGGAAGCTGCCCTTCACCGTGGGGGCCAATGGAGAGCAGAAGGACTCAGACACAGAGAAGCAGGGTCCCGAGCGGAAGAGGATCAAGAAGGAGCCTGTCGCCCGAAAGTCTGGGCTGCTGTTTGGCATGGGGCTGTCTGGGATCCGGGCCGGCTATCCCCTCTCCGAGCGCCAGCAGGTGGCTCTCCTCATGCAGATGACGGCCGAGGAGTCTGCCAACAGCCCAGACACAACACCAAAGCACCCCTCCCAGTCTACAGTGTGTCAGAAGGGGACGCCTAACTCTGCCTCAAAAACCAAAGATAAAGTGAACAAGAGGAATGAGCGGGGGGAGACCCGCCTGCACCGGGCCGCCATCCGAGGAGACGCCCGGCGCATCAAGGAGCTCATCAGTGAGGGTGCAGACGTCAACGTCAAGGACTTTGCAGGCTGGACAGCGCTGCATGAGGCGTGTAACCGGGGCTACTACGATGTCGCCAAGCAGCTGCTGGCCGCAGGTGCAGAGGTGAACACCAAAGGCCTGGATGATGACACGCCTTTGCATGATGCCGCCAACAACGGCCACTACAAGGTGGTGAAGCTGTTGTTACGGTATGGGGGGAATCCTCAGCAGAGCAACCGGAAAGGCGAGACCCCGTTGAAAGTGGCCAATTCCCCCACGATGGTGAATCTGCTGTTAGGCAAAGGCACCTACACGTCCAGTGAAGAGAGCTCCACTGAGAGCTCTGAGGAGGAAGACGCCCCGTCATTCGCGCCGTCCAGCTCAGTCGACGGCAATAACACGGACTCTGAGTTTGAGAAAGGCCTGAAGCTCAAGGCCAAGAATCCAGAGCCACAGAAGGCCGTGACCCCTGTCAAGGACGAGTACGAGTTTGATGAGGATGACGAGCAGGACAGGGTCCCCCCAGTGGATGACAAGCACTTGCTAAAGAAGGATTACAGGAAAGAGACTAAGTCAAACAGTTTCATTTCGATACCCAAAATGGAAGTTAAGAGTTACACCAAGAACAATACGATTGCACCAAAGAAAGCAGCCCATCGTATCCTGTCAGACACATCCGACGAGGAGGACACTGGCCTCGCCGTTGGTGCCGGGGAGAAGCTGAGGCTGTCAGCACACTCTGTGCTGCCCAGCAGCAAGGTACGGGAGCCGTCCAACTCCAGGCAGCAGAAGGAGAAAAGCAAAGTGAAGAAGAAGCGAAAGAAAGAAGCAAAAAGCAAAGAAGTTCGCTTTGGAAAGAGGAATGACAAGTTCTGTTCCTCTGAGTCAGAGAGCGAGTCCTCAGAGAGTGAGGAGGACGATGACGACTCTGTGGGGAGCACAGGCTGCCTCAAGGGGTCCCCACTGGTGCTGAAGGACCCCTCCCTGTTCAGCTCACTGTCTGCCTCCTCCACCTCCTCCCACGGCAGTGCCGTGGCCCCGAAGCACGGCACCAACCACGGTGATCAGCATGCCAAGCACTGGCGCACGGACAACTGGAAAGCCATCTCCTCCCCGGCCTGGTCTGAGGTCAGCTCCCTGTCAGACTCCTCACGGACAGGACTGACGAGCGAGTCTGACTGCCCCTCTGAGGGCTCCAGCGTGGAGTCGCTGAAGCCCACAAGGAGGAAGCAGGAGCTCCGGAAGAGGGGCAGCCTGCCAAGTGCACCACCGGAGAAGAGGGGCACCTGCCACCCTGGCACAGATGGCGCTGTCCCCAAGCTGGACAAGGAGGGAAAAGTCGTCAAAAAACACAAGACAAAACACAAACACAAAAACAAGGAGAAGGGGCAGTGTTCCGTGAGCCAGGAACTTAAACTGAAAAGTTTTACGTACGAATACGAGGACTCCAAGCAAAAGTCAGAGAAAGCCATCCTCTTAGACAATGACATTTCCACAGACAATAAGCTGAAAGTGCTGAAGCACGACCGAGACCATTTTAAGAAAGAAGAGAAGCTCAGCAAACTGAAGTCAGAAGACAAGGAGTGGATCTTCAAAGAAGAGATGCTTAAGGTCTCCAAAGACGAGAAGTTGATGAAGAGGGCCAAAGACATCGGCAGGTCTTTCCGGGAAGAGAAAGACCGTTCCGGTAAAACAGAGAGGGAGAAGGCTGTGAAGGAAAAGTCCCCCAAAGAGGAACGGCTGAGGCTCTACAAAGAGGAGAAGAAGAAAAAGTCCAAAGACCGGCCTTCGAAGTTAGAGAAGAAGAATGACATGAAGGAGGACAGGGCTTGCAAGGAGAAGGAAAAGCTCAAAAAGGAAAAAGGTTACAGAGACGATGCTGCATTTGACGAATTCTGCAGCAAAACTCAGTTTCTAGAGAATGAGGACACCAAATTCAGCCTTTCTGATGATCAGCAAGAGAGGTGGTTTTCTGACCTGTCTGATTCCTCCTTTGATTTCAAAGGGGAGGACAGCTGGGACTCCCCAGTGACAGACTACAGGGACATCAAGAATGACTCTGTGGCCAAACTCATCTTAGAGACAGTGAAGGAGGATAGTAAGGAGAAGAAGCGAGACAACAGAGCCCGGGAGAAGCGGGACTTCAGAGACTCGTTCTTCCGAAAGAAAGACAGGGACTGTCTGGACAAGAGCTCCGAGAAGAGAAGAGACCAGGTGGAGAAGCACAAAGGCGTCCCCAGCTACCTCTCTGAGAAAGACAAGAAGAGGAGGGAATGTGCCGAGGGCGGGCGCGATCGCAGGGATGGCCTGGACGGCTCCCGGGAGCGCAAGGAAGCCCGGCTCCGGCCTGAGGAGGCGCATCGGGAGGACTTGAAGGACTGTGGCTGCGAGAGTGCATTCAGGGACAAGCCGGACTCTGACCTCCCCAAGGGCCTCGAGCCCTGGGAACGGCCCCACGCCCTGCGCCTGGAGAAGGACCGGAAGGAGAAGGTGCGGGTGGAGAAGTGCAAAGACAAGTCACTGGACAGAGACAAGAGCGAGAAATCTCTCCTTGAGAAATGTCAGAAGGACAAAGAATTTGACAAATGTTTTAAAGAGAAGAGAGATGCTAAGGAAAAGCATAAAGAGGCCCACAGCAAAGACAGGAAGGCGTCGCTCGACCAAGGGAGAGAGAAGAAGGAGAAGATGTTCCCTGGACTTCTCTCAGAAGACTTCTCCGAAAAAAAAGATGAAAAGAAAGGGAGAGAGAAGAGCTGGTACATTGCAGACATATTCACAGACGAAAGTGAAGATGAAAAAGATGACTATATGGCCAGCAGCTTCAAGGCCGGGGAAGCCGGGGACGCGCAGAGAGGGGACAGCCTCCAGGACAAGGAGGATGGCAGAGAGCTGCATCTCTTGGACAGACACCGGAAGTCCTCTGACCGGCAGCACGCAGAGAAGCCAAGGGATAAAGAGCCCAAGGAGAAGAGGAAGGACAGGGTGGCTGCCGACAGTGGGCGCGACAGGAAGGACAAGATCTTTGAGAAGCACCGAGAGAAGAAGGACAAAGAGTGTGCAGAGAGATACAAGGACAGGAAAGACAGGGCTTCCGTCGACTCTGCCCAGGAAAAGAAGAACAAGCAGAAGCTCCCTGAGAAGGTGGAGAAGAAGCACTCCACCGAAGACAAGGCCAAGAGTAAGCACAAGGACAAGCCAGAGAAGGAGCACTCCAAAGAGAGGAAGGGCTCGAGGGGCGCCGAGGCAGAGAAGAGCCTGCTGGAGAAGCTGGAGGAGGAGGCGCTGCACGAGGACCGGGAGGACTCCAATGACAAAGCCAGCGAGGTCTCGTCAGACAGCTTCACAGACCGGGGCCAGGAGCCGGGCCTGAGCGCCCTCCTGGAGGTGTCCTTCTCAGAGCCGCCCGATGACAAGGCCAGAGAGAGCTGCCTCACGGAGAAGCTGAGGGACAGGGAGCGGCACAGGCACTCCTCATCCTCCTCCAAGAAGAGCCACGACCGGGAGCGAGCCAAGAAGGAGAAGGCTGAGAAGAAAGAGAAGGCCGAGGACTACAAGGACGGTGGCTGCAGGAAGGACTCGAGCCAGTATGAGAAGGACTTCCTGGATGCAGAGGCCTACGGGGTCGCCTACACCGTGAAAGCCGACATGGAAGAGGAGTTGGATAAGACCGTTGAGATATTTCCCTCGGAAAAGAAAGAGAGAAATGATCCCGAGAGAGAATCTGCCAAGAAAATCGAGAAGGAACTAAAGCCTTACGGATCTAGTACCATCAGCATCCTGAAGGAGAAGAAGAAAAGAGAGAAACACAGGGAGAAGTGGAGAGACGAGAAGGAGAGACACCGGGAGAAGCACACGGACGGGTTCCTCAAACACCACAAGGACGAGCCAAAGCCCGCAGCCAAAGACAAGGACAACCCTCCGAACTCCTTCAGGGAGAAGTCCAGGGACGAAAGCCTGAAACTCAGTGAGACCAAGCTGAAGGAGAAGCTCAGGGAGAACACAGAGAGAGAAAAGGCGGACTCCATGAAGATCAGCAACGGCAGCGACAAGCTCCCGCTGGCCAGAGACCTGGGCAAGAAGGACGCCCGGCCCCGGGAGAAGCTCCTAGGAGACGGCGACCTGATGATGACCAGCTTTGAGAGGATGCTATCCCAGAAGGACCTGGAGGTCGAGGAGCGCCACAAGCGTCACAAGGAGCGCATGAAGCAGATGGAGAAGATGAGGCACAGGTCTGGGGACCCCAAGCTCAAGGACAAGACCAAGCCCCCCGAGGAGGGGCGGAAGAAGAGCCTGGACGTTCCTCCTAAGAAACCCCTGGGGCCAGACCCTCCCTTCAAGGAGAAGAAGCTCAAGGACTCCGCTCCCACACCACCCGCCACCGCCATCGAGGGCAAGCTGGGGCCCGGGGCGGAGTGCAAAGACTGGCCGGCAGCGCCGCCCCCCAAGGAGGTGTTGCCCCCCTCCCCCCGGCCTGAGCAGAGCCGGCCCACTGGGGTGCCCACGCCAAGCTACGAGGAGGTGATGCACACGCCCAGGACGCCGTCCTGCAGCGCTGATGACTACCCCGACCTGGTGTTTGACTGTGCGGACTCCCAGCACTCAATGCCTGTCTCCGCCACGTCCACCAGCACCTGCTCTCCGCCGTTTTTTGACAGGTTCTCTGTGGCTTCCAGTGGGGTGTCAGAAAACCCGGGCCAGACACCCACAAGGCCTGTCTCCTCCAACCTGTACCGCTCCATCTCTGTGGACATCAGGAGAACCCCCGAGGAAGAGTTCAGTGTCGGGGACAAGTTGTTCAGGCAGCAGAGCGTGCCTGCGGCCTCCAGCTTCGGCTCCCCTGTGCAGCACCTGCTGGAAGACAAGGCCCCGCTACCGCCTGTTCCCTCTGAAAAGTTCCCCTGCCTGTCCCCAGGGTACTACTCCCCAGACTACGGCATCCCCTCGGGCATGCCCTCACCCAAGGTGGATTCGCTCCACTGCCCCCCTGCCTGCACGGTGAGCGTCACGCCCTCCCCCGAGGGCGTCTTCTCCAGTTTACCAGCAAAAGCCTCTCCTCCCAGAGGTGAGCTGTTTGCCCCTGCTGTAGATGGGGCCCTCACCCCAGACCTGGGCCTCCCTCTGGACGCCACAGAGGACCAGCAGGCCACAGCCGCCATCATCCCCCCAGAGCCCAGCTACCTGGAACCCTTGGATGAGGGCCCCTTCAGCACTGTCATCACTGAGGAGCCTGGGGAGTGGGCGCACCCTGCTGCCGAGCAGACCCTTTCTCCCTCCTTGGTCACTGGTGCCTCTGAAAACCCTGTCAGCTGGCCTGTGGGTGCCGACCTCCTGCTGAAGTCCCCTCAGAGGTTCCCAGAGTCCCCTAAACATTACTGCCCTGCTGAGTCCCTCCACACTGCCACCCCAGGGCCCTTCAGTGCTGCAGAGCCCCCGTACCCTGTCTCTCCTGTCTCCTACCCTCTGCCAGCCGCCGAGCCAGACCTGGAGGAAGTCAAAGATGATGGGGTGGGAGCCATCTCCGCCACCACCGAGGGAGGCACACCTTACACCACCCCTGCCAGGCTCGAGTCCTTCTTTGGCAGCTGCAAGCCACTCCCCGATGCACCCCTCGACCAGGTGCCTGAGCCCACATGTGTCTCCACGGTGGCCCAGGTGGAGGCCCTCGGAGCCCTGGAGAGCAGCTTCCTGGACAGTGGCCACGGCCTGGCTGCTCTTGGCCAGGTGGAGCCCGTACCCTGGCACGACGCCTTCACCAGCACCGAGGACGACCTGGACCTGGGGCCCTTCTCACTGCCGGAGCTCCCTCTGCAGCCCAAGGACCCCCCAGATGTTGAAATGGAGCCTGCAGGAGGAAGCCCTGCTCCCCCAGGAGAGGCCCTCCCTGTGCCCGCTGGGGTCAGCAGTGATGGGGACGGCCCTGTGGCCGAGGCCGAGGATCAGCCAGCTCCACCTACCGAGCAGGCCGTCCCCCGACTCCCTGCTGAGCTCGAGCCCTCCGAGGAACCGAAGCTGGATGTGGTTCTGGAAGCCACTGTGGAAGCAGAAGCAGTGGCGGACGAGCAGGCCCCTGAGGACCTGGACTCCGGCTCAGTGCCTGTGCCCGGCCCCCCAGAATGGCATCCCCTGGAGGGCGGAGATGAGGTGGAGGCTGAAGCCCCTGCGGCTGCGCCCCACTGTGCCCCTGACGGCCCCCCCCAGGAGGCCCCCCCACAGGCCCAAGCTGATTCAGAGGCCACCCCTGCTGCCACCCCAGCCGAGGGGCCTCTGGGCAGCGTGCAGCCAGGAGCTCCAGAGCCCGAGCCCAGGCCTGCAGCTGAAGCCCCCAAGGCCCCCCGGGTGGAGGAGGTTCCTCAGCGCATGACCAGGAACCGGGCCCAGATGTTGGCCAGTCAGAGCAAGCAGGGCACACCACCCACAGAGAAGGAGCCTGCACCCGCGCCCACACCCACGTCCACGCAGGCCTCCCGAACCAAGGCCCGTGCCCCCGAGGAGGAGGACGCCCAAGCCCAGCACCCGCGCAAGCGCCGCTTCCAGCGCTCCAGCCAGCAGCTGCAGCAGCAGCTGCACACGTCCACACGGCAGACTCGGGAGGTCATCCAGCAGACACTGGCCGCCATTGTGGACGCCATCAAGCTGGACGACATTGAGCCCTATCACAGTGACAGATCCAACCCATACTTTGAGTACCTTCAGATCAGAAAGAAGATCGAAGAGAAGCGCAAGATCCTCTGCTACATCACACCACAGGCGCCCCAGTGCTACGCTGAGTACGTCACCTACACGGGGTCCTACCTCTTAGACGGCAAGCCACTCAGCAAGCTCCACATCCCTGTGATCGCGCCCCCACCCTCCCTGGCAGAGCCCCTCAAGGAGCTCTTCAAGCAGCAGGAAGCTGTGCGGGGGAAGCTGCGTCTGCAGCACAGCATCGAGCGGGAGAAGCTCATAGTGTCCTGTGAGCAGGAGATCCTGCGGGTCCATTGCCGGGCAGCCCGGACGATTGCCAACCAGGCGGTGCCTTTCAGCGCCTGCACGATGCTGTTAGACTCTGAGGTCTACAACATGCCCCTGGAGAGCCAGGTGCGTGGCGGTCCCCAGGGTTACTCACTTGCCCTTCACTTGGGCAGCAGCCACCCCCACGCACCCTCTACCCTGAGCCAGCTGTTGACAGCACTGTGTCCCTGGAGGGCCACCTGTCTGCCTGCAGCCACAGAAGGGGCAGGAGCAGTGGCACTGAGGGGTGGCCACATGCACCCCGCAGGGAACAGCTGCCCTTCCTCCCTCACGGGGCAGGTGCGACTGCATTTTCCATTCCCACTTCCTGAGGAGCAGTGGGGCTGGCACACCGGTGGCCCTGGGCAGCAGGTGGTAGCAGCTACAGGGCCTGTGGTGACTGGCCAGGCAGGGGCTCATCTGACCCAGGTAGACCGAGGCTTCTCCTGTGGGAACGAGGGCAGATCTGCAGCAGGCTAG

XM_004842630.1 Coding sequence

Cdk10 cyclin-dependent kinase 10, transcript variant X1

Length: 1158 bp    Location: 291065..285399   Strand: -
>XM_004842630.1
ATGGCGGACCCGGACCCAGAGTCGGAGCAGATCCGCCTGAAGTGTATCCGTAAGGAGGGCTTCTTCATTGTGCCTCCGGAACACAGGCTGGGACGATGCCGGAGTGTGAAGGAGTTTGAGAAGCTGAACCGCATTGGCGAGGGCACCTATGGCATTGTGTATCGGGCCCGGGACACCCAGACAGATGAGACTGTTGCCCTGAAGAAGGTGCGGATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCCTGCGGGAGATCACGCTGCTCCTGCGCCTACGCCACCCCAACATCGTGGAGCTGAAGGAGGTGGTGGTGGGGAACCACCTGGAGAGCATCTTCCTGGTGATGGGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAAAACATGCCCACTCCTTTCTCTGAGGCCCAGGTCAAGTGCATTGTGCTGCAGGTGCTCCGGGGACTCCAGTACCTGCACAGGAACTTCATCATCCACAGGGACCTGAAGGTCTCCAATCTGCTCATGACTGACAAGGGCTGTGTGAAGACAGCGGACTTTGGCCTGGCCCGGGCCTCTGGGGTCCCAATGAAGCCAGTGACTCCCAAGGTGGTCACCCTCTGGTACCGTGCCCCTGAGCTGCTGCTGGGAACTACGACCCAGACCACCAGCATCGACATGTGGGCCGTGGGCTGCATCCTGGCTGAGCTGTTGGCCCACAAGCCCCTGCTCCCTGGCACATCTGAGATCCACCAGGTTGACCTGATTGTGCAGCTGCTGGGGACGCCCAGCGAGAACATCTGGCCGGGCTTTTCCAAACTGCCACTGGTCAGCCAGTACAGCCTGAGGAAGCAGCCATACAACAACCTCAAGCACAAGTTCCCATGGCTCTCGGAGGCTGGGCTGCGTCTGCTGAATTTCCTCTTCATGTATGATCCCAAGAAAAGGGCAACAGCGGGGGACTGCTTGGAGAGCTCTTATTTCAAGGAGAAGCCCCTGCGTGAGTTCCTCACTCCCTCAGGGGCAGAATGCTGGGGCTGGGTGGCAGCCCTGGGTGCCTGTGTAGACCTGGGGGAGGGGGGAGCTGATACAGGGCTGGGTATCCGGGGCAGCCAGGCTGGGCTTCGGTGCACGGGGGTTCAGACCTGGAGTGCACCCCCAGCCCAGCACTGA

XM_004842625.1 Coding sequence

Vps9d1 VPS9 domain containing 1, transcript variant X4

Length: 1956 bp    Location: 266919..277225   Strand: +
>XM_004842625.1
ATGGCAGCTGCAGCCGGGGACGGCGCGGCGAAGCCGCTGCAGAGCGCTATGAAGCTGGCCAACCGGGCCATAGAGCTGGACACCGGCAACCGGCCGCGGGAGGCATACACAGAATACCTGAGGAGCGTTCACTACATCTCCCAGGTGCTACTGGAGGAAGTGGAATCAACTAAAGAAGCCTGGGAAATAGTGGCCCCTGACACTTCAAAGATGCTGAAGCTGGCGGAGCAGTGTCTGGAGCGGGCCCGGTCAACAGCTGCCAAGCTCGGGAAGACACGCCAGAAGCCAGCGGTACCCATGGCTGCTACGGCGCCACCTATTGGCCGACACCGCAGAGTGTGCTCCGATGAAGGAGGGAAGCTCTCTCCTTTCGTGCCGCCTGAGATCTTCCAGAAGCTTCAGGCAGTCGAGTCCCAAAACTCTAAGAAGGAACTGACACCACTGGAGGAGGCCTCCCTGCAGAACCAGAAACTGAAGGCCACCTACGAGGCCCGGATGGCCCGTCTGGACCCCAGCCAGGCCACACAGAAGACGTCGCTGACCCTGTCTCTGCAGCGGCAGATGATGGAGAACCTGGTGATCGCCAGAGCCCGCGAGGAGACGCTGCAGCGGAAGATGGAGGAACGCCGGCTGCGGCTCCAGGAGGCCGCCAACAGGAAGTTCTGTAGTCAGGTCGCCTTGACCCCCGAGGAGCGAGAACAGAGGGCCCTCTATGCAGCCATCCTTGAGTACGAGCAAGACCATGATTGGCCGAAGCACTGGAGGGCCAAACTCAAGAGGAGCCCAGGGGACCTATCTCTGGTGACCAGCCTGGTCTCACACCTGCTCAGCCTTCCTGACCACCCGATCTCGCAGCTGCTGAAGAAACTGCAGTGTGCAGTGTACAAGGCACTGTATCCCGTTGTGAGCCATGGCGCTATTGGTGCTATGTCTGCCCCAGGATGCTGCTCCCTGCCCTCGGATGCTGACAGGCTGCTGGCTCCTGGGAGCCGGCGCCTCCGCTCCTCCCAGAGCCTGTACTGCATGTTGTCACCCCCAGAGCCCAATGTGGCCCCACAGCCCCAGGATGGACCCCTTGACACCCCCCTACTTCTCCCCGGGACCCTGGAGAGAGGGACAGATGGCAGCCCAGCCAGGCCCCCCTCACCCTTGGTAGATACTTTGTCCTACCTGCCGGACAAGGACAGCTCCTTCGAGGACCTGGAGCAGTTCCTGGCTACATCAGAGAGGTGGAGCTGGGGCTCCGGGCCACAGGTGACACAGAGGGAGCCCTTGCTGGAGTGTCTGAAGAGCACAGTGAAGGACATTCACAATGCCATCGACAGGCTGCTCTCGCTGACCCTCCTGGCCTTTGAGAGCCTGAACACAGCTGCCTGCAAAGACCGTTGCCTGGCCTGCCTCGAGGAGCCCTTCTTCTCCCCACTGTGGCCTCTGCTGCTGGCCCTGTACAGGAGCGTGCACCATGCTCGGGAGGCCGCCCTGAGCAGGAGCATGGAGCTCTACCGGAACGCACCCCCCACAGCCCTGGGTATCCCCACCAAGCTCCTCCCCCAGGAACCGGAGGCCAAGGGGGGTGCCAGCTACCCCTACTGCAGCGCGGCCCAGGAGCTGGGGCTGCTGGTCCTGGAGAGCTGCCCGCAGAAGAAGCTGGGCTGCATCGTGAGGACCCTGCGGGTCATCTGTGTCTGTGCTGAAGACTACTGCCGTGCCCAGGAGCCCACGCCTGAGGCCAGACCCCAAACCCCTGCAGCTGCCATTGGTGCGGATGACTTGCTGCCCATCTTGTCCTTTGTGGTACTGAGGAGCGGCCTTCCCCAGCTGGTATCAGAATGCGCAGCCCTGGAGGAATTCACCCATGAGGGATACCTGATTGGAGAGGAAGGTTACTGCCTGACGTCACTGCAGAGTGCCTTGAACTACGTGGAGCTGCTGCCACAGGGGGCCCTGGGCAAGTAG

XM_004842624.1 Coding sequence

Vps9d1 VPS9 domain containing 1, transcript variant X3

Length: 1962 bp    Location: 267583..277225   Strand: +
>XM_004842624.1
ATGTTACTGAAAAATGATCAGACACCACTGCTCCTGCTCCCACAGGAGCACTGGGCAGGTTTGATGCAACCATTCACCTCTGCTGGCCTGAGCTCCAGCATTTTTCTTCCCCGGACACAGGAGGCATACACAGAATACCTGAGGAGCGTTCACTACATCTCCCAGGTGCTACTGGAGGAAGTGGAATCAACTAAAGAAGCCTGGGAAATAGTGGCCCCTGACACTTCAAAGATGCTGAAGCTGGCGGAGCAGTGTCTGGAGCGGGCCCGGTCAACAGCTGCCAAGCTCGGGAAGACACGCCAGAAGCCAGCGGTACCCATGGCTGCTACGGCGCCACCTATTGGCCGACACCGCAGAGTGTGCTCCGATGAAGGAGGGAAGCTCTCTCCTTTCGTGCCGCCTGAGATCTTCCAGAAGCTTCAGGCAGTCGAGTCCCAAAACTCTAAGAAGGAACTGACACCACTGGAGGAGGCCTCCCTGCAGAACCAGAAACTGAAGGCCACCTACGAGGCCCGGATGGCCCGTCTGGACCCCAGCCAGGCCACACAGAAGACGTCGCTGCGGCAGATGATGGAGAACCTGGTGATCGCCAGAGCCCGCGAGGAGACGCTGCAGCGGAAGATGGAGGAACGCCGGCTGCGGCTCCAGGAGGCCGCCAACAGGAAGTTCTGTAGTCAGGTCGCCTTGACCCCCGAGGAGCGAGAACAGAGGGCCCTCTATGCAGCCATCCTTGAGTACGAGCAAGACCATGATTGGCCGAAGCACTGGAGGGCCAAACTCAAGAGGAGCCCAGGGGACCTATCTCTGGTGACCAGCCTGGTCTCACACCTGCTCAGCCTTCCTGACCACCCGATCTCGCAGCTGCTGAAGAAACTGCAGTGTGCAGTGTACAAGGCACTGTATCCCGTTGTGAGCCATGGCGCTATTGGTGCTATGTCTGCCCCAGGATGCTGCTCCCTGCCCTCGGATGCTGACAGGCTGCTGGCTCCTGGGAGCCGGCGCCTCCGCTCCTCCCAGAGCCTGTACTGCATGTTGTCACCCCCAGAGCCCAATGTGGCCCCACAGCCCCAGGATGGACCCCTTGACACCCCCCTACTTCTCCCCGGGACCCTGGAGAGAGGGACAGATGGCAGCCCAGCCAGGCCCCCCTCACCCTTGGTAGATACTTTGTCCTACCTGCCGGACAAGGACAGCTCCTTCGAGGACCTGGAGCAGTTCCTGGCTACATCAGAGAGGTGGAGCTGGGGCTCCGGGCCACAGGTGACACAGAGGGAGCCCTTGCTGGAGTGTCTGAAGAGCACAGTGAAGGACATTCACAATGCCATCGACAGGCTGCTCTCGCTGACCCTCCTGGCCTTTGAGAGCCTGAACACAGCTGCCTGCAAAGACCGTTGCCTGGCCTGCCTCGAGGAGCCCTTCTTCTCCCCACTGTGGCCTCTGCTGCTGGCCCTGTACAGGAGCGTGCACCATGCTCGGGAGGCCGCCCTGAGCAGGAGCATGGAGCTCTACCGGAACGCACCCCCCACAGCCCTGGGTATCCCCACCAAGCTCCTCCCCCAGGAACCGGAGGCCAAGGGGGGTGCCAGCTACCCCTACTGCAGCGCGGCCCAGGAGCTGGGGCTGCTGGTCCTGGAGAGCTGCCCGCAGAAGAAGCTGGGCTGCATCGTGAGGACCCTGCGGGTCATCTGTGTCTGTGCTGAAGACTACTGCCGTGCCCAGGAGCCCACGCCTGAGGCCAGACCCCAAACCCCTGCAGCTGCCATTGGTGCGGATGACTTGCTGCCCATCTTGTCCTTTGTGGTACTGAGGAGCGGCCTTCCCCAGCTGGTATCAGAATGCGCAGCCCTGGAGGAATTCACCCATGAGGGATACCTGATTGGAGAGGAAGGTTACTGCCTGACGTCACTGCAGAGTGCCTTGAACTACGTGGAGCTGCTGCCACAGGGGGCCCTGGGCAAGTAG

XM_004842619.1 Coding sequence

Spire2 spire homolog 2 (Drosophila), transcript variant X1

Length: 2154 bp    Location: 193346..165624   Strand: -
>XM_004842619.1
ATGGCGCGGGCGAGCGGCGCGGCGGCCCCGGAGCGCGCGGGGGGCGCGGCGCGGGCCGAGCCGTGGGAGCTGTCCCTGGAGGAGGTGCTGAAGGTGTACGAGCAGCCCATCAACGAGGAGCAGGCCTGGGCCGTGTGCTTCCAGGGCTGCCGCGGGCTGCGGGGAGCGCCGGGAGGGCGGCGCATCCGCGACACGGCGGACATCCTGCTGCGCAGGGACGGCTCGGTGGGCGCGCGGCGGGAGCCAGAGCCCACAACCTTGGTGGTGCCGCCGGCCAGCTCAGAAGCTCAGATGGTGCAGTCCCTGGGCTTCGCCATCTACCGCGCGCTGGACTGGGGCCTGGACGAGAGCGAGGAGCGCGAGCTCAGCCCGCAGCTGGAGCGGCTCATCGACCTCATGGCCAACAGCGACCACGATGACGGCGGCGGCTGTGGGGCTGCGGACGAGGGTTACGGGGCCCCCGAGGAGGAGGAGGAGCCCGAGGGCGGCCCCCGGGCCGTGCGCACCTTCGCCCAGGCCATGCGGCTGTGTGCCGCTCGCCTCACCGAGCCCCAGGGTGCGCAGGCGCACTACCAGGCCGTGTGCCGCGCCCTCTTCGTGGAGACCCTTGAGCTCCGCGCCTTCCTGGCCCGAGTCCGAGAGGCCAAGGAGATGCTGCAGAGGCTGGGGGAGGATGAGCCACAGATACAGAAGCCACGAGCTGAGCTTGACAACCTTGGACACACAGACTGGGCCCGGTTGTGGGTGCAGCTCATGAGGGAGCTGCGCCATGGGGTGAAGCTCAAGAAGGTGCAGGAGCAAGAGTTCAACCCCCTGCCTACCGAGTTCCAGCTTACACCCTTCGAGATGCTGATGCAGGACATCCGCGCCAGGAACTACAAGCTGCGCAAGGTCATGGTGGATGGGGACATCCCTCCCAGAGTGAAGAAGGACGCACATGAGCTCATCCTGGACTTCATCCGCTCCAGGCCTCCCCTGAAACAGGTCTCTGAGCGCCGGCTTCGCCCACTGCCACAGCAGCAAAGGACCCTGCACGAGAGGATTCTGGAGGAGATCAAGCAAGAGCACAAGCTGCGGCCCGTGGGGACCCAGCGCATAGGCATCCGTGGCTTTGGCTCTCTGCCTTGCATCCTCAACGCCTGCTCTGGGGACATCAGGTCCACTTCCTGTATCGATCTGTCTGTCACGGACGTCGGGAGTGGCACTCAGCGCCCACGGCCCCGGGTCCTGCTGAAGGCACCCACACTGGCTGAGCTGGAGGAGATGAACACCTCTGAGGAGGAAGAGTCTCCATGTGGGGAGGTGACACTGAAACGGGATCGCTCCTTCTCAGAGCACGACCTGGCCCAGCTCCGGAGCGAGGCAGCCTCTGCCCTGCAGCCAGCTGCTCCGCCCCAGGAAGGAACAGGACTGCCTCGGCCCCGGGCAGGCAGCATGCACACCTGGAGGCCCAGTGCCTGGGACCAGGGCTCCTGTCCTGCGGTTGTCCAGCCCCAGCCGGACCCCGGTGCCCCTGTGCTCAGCAGTCTGAGCTCTGCAGGCAGACCTGAGGGCTCTGTGCCAGACCCCAGGCACCTGTGGCTGGATTTCAGCCATCCGGTAGAGAGCCTGGCCCTGACTGTGGAGGAGGTGGTGGATGTGCGCCGTGTGCTGGTGAAAGCTGAGATGGAAAAATTCATCCAGGACCAGGAGCTCTTCAGCAGCCTGAAGCGGGGAAAGGTCTGCTGCTGCTGCCGGGCCCGGTTCTCGCTGTTCTCCTGGCCACCCACTTGTCTCTTCTGCAAGAGAGCCGTCTGCACTTCCTGTAGCGTAAAGATGAAGATGCCTTCTAAGAAGTGTGCACACATCCCCGTCTACACTCTGGGCTTTGAGAGTCCTCAGAGGACACCCATGGCCAAGGCCACGCCAACGCAGAGGAGAGAGGTCTTCCAGTCTCTACAGGGGCCAAGGTGGCGAAGCGTGGAGGAGGAGTTCCCGCACATCTATGCACATGGTTGCATCCTTAAGGACGTCTGCAGTGACTGCACCAGCTTCGTGGCTGATGTCGTGCGCTCTAGCCGCAGGAGTGTGGACGCCCTTAATGCCACACCACACCGCAGCCGCCAGACCCAGTCACTCTACCTCCCTGACACCAAGACTCTGGACTTCAAGTGA

XM_004842620.1 Coding sequence

Spire2 spire homolog 2 (Drosophila), transcript variant X2

Length: 1968 bp    Location: 184654..165624   Strand: -
>XM_004842620.1
ATGGCTTGCGGTCCCCCTTCGGCTCTGGCAGGCTTCCCGGTCCCCAGGGCATTCTGGAAAGAGCCCACAACCTTGGTGGTGCCGCCGGCCAGCTCAGAAGCTCAGATGGTGCAGTCCCTGGGCTTCGCCATCTACCGCGCGCTGGACTGGGGCCTGGACGAGAGCGAGGAGCGCGAGCTCAGCCCGCAGCTGGAGCGGCTCATCGACCTCATGGCCAACAGCGACCACGATGACGGCGGCGGCTGTGGGGCTGCGGACGAGGGTTACGGGGCCCCCGAGGAGGAGGAGGAGCCCGAGGGCGGCCCCCGGGCCGTGCGCACCTTCGCCCAGGCCATGCGGCTGTGTGCCGCTCGCCTCACCGAGCCCCAGGGTGCGCAGGCGCACTACCAGGCCGTGTGCCGCGCCCTCTTCGTGGAGACCCTTGAGCTCCGCGCCTTCCTGGCCCGAGTCCGAGAGGCCAAGGAGATGCTGCAGAGGCTGGGGGAGGATGAGCCACAGATACAGAAGCCACGAGCTGAGCTTGACAACCTTGGACACACAGACTGGGCCCGGTTGTGGGTGCAGCTCATGAGGGAGCTGCGCCATGGGGTGAAGCTCAAGAAGGTGCAGGAGCAAGAGTTCAACCCCCTGCCTACCGAGTTCCAGCTTACACCCTTCGAGATGCTGATGCAGGACATCCGCGCCAGGAACTACAAGCTGCGCAAGGTCATGGTGGATGGGGACATCCCTCCCAGAGTGAAGAAGGACGCACATGAGCTCATCCTGGACTTCATCCGCTCCAGGCCTCCCCTGAAACAGGTCTCTGAGCGCCGGCTTCGCCCACTGCCACAGCAGCAAAGGACCCTGCACGAGAGGATTCTGGAGGAGATCAAGCAAGAGCACAAGCTGCGGCCCGTGGGGACCCAGCGCATAGGCATCCGTGGCTTTGGCTCTCTGCCTTGCATCCTCAACGCCTGCTCTGGGGACATCAGGTCCACTTCCTGTATCGATCTGTCTGTCACGGACGTCGGGAGTGGCACTCAGCGCCCACGGCCCCGGGTCCTGCTGAAGGCACCCACACTGGCTGAGCTGGAGGAGATGAACACCTCTGAGGAGGAAGAGTCTCCATGTGGGGAGGTGACACTGAAACGGGATCGCTCCTTCTCAGAGCACGACCTGGCCCAGCTCCGGAGCGAGGCAGCCTCTGCCCTGCAGCCAGCTGCTCCGCCCCAGGAAGGAACAGGACTGCCTCGGCCCCGGGCAGGCAGCATGCACACCTGGAGGCCCAGTGCCTGGGACCAGGGCTCCTGTCCTGCGGTTGTCCAGCCCCAGCCGGACCCCGGTGCCCCTGTGCTCAGCAGTCTGAGCTCTGCAGGCAGACCTGAGGGCTCTGTGCCAGACCCCAGGCACCTGTGGCTGGATTTCAGCCATCCGGTAGAGAGCCTGGCCCTGACTGTGGAGGAGGTGGTGGATGTGCGCCGTGTGCTGGTGAAAGCTGAGATGGAAAAATTCATCCAGGACCAGGAGCTCTTCAGCAGCCTGAAGCGGGGAAAGGTCTGCTGCTGCTGCCGGGCCCGGTTCTCGCTGTTCTCCTGGCCACCCACTTGTCTCTTCTGCAAGAGAGCCGTCTGCACTTCCTGTAGCGTAAAGATGAAGATGCCTTCTAAGAAGTGTGCACACATCCCCGTCTACACTCTGGGCTTTGAGAGTCCTCAGAGGACACCCATGGCCAAGGCCACGCCAACGCAGAGGAGAGAGGTCTTCCAGTCTCTACAGGGGCCAAGGTGGCGAAGCGTGGAGGAGGAGTTCCCGCACATCTATGCACATGGTTGCATCCTTAAGGACGTCTGCAGTGACTGCACCAGCTTCGTGGCTGATGTCGTGCGCTCTAGCCGCAGGAGTGTGGACGCCCTTAATGCCACACCACACCGCAGCCGCCAGACCCAGTCACTCTACCTCCCTGACACCAAGACTCTGGACTTCAAGTGA

XM_004842613.1 Coding sequence

Def8 differentially expressed in FDCP 8 homolog (mouse), transcript variant X5

Length: 1128 bp    Location: 119035..107214   Strand: -
>XM_004842613.1
ATGGAATATAATGAGAAGCTGGCCCGGTTCCGGCAAGCCCACCTCAACCCCTTCAACAAGCAGCTTGGGGCAGGGCAGCATGAGCAGGGAGCCGCTCAGGAGGCTCTGGAGATCAGCTCTGAAGAGATCCTGCCTGAGCTGCGCCCTGGGGAGCCTGAGTTCTGCTGCTCTGAGCGTGTGATGGATCTTGGCCTGTCTGAGGACCACTTCTCTCGCCCTGTGGGTCTGTTCCTGGCCTCTGATGTCCAGCAGCTTCGGCAAGCGATTGAGGAATGTAAGCAGGTGATTCTGGAGCTGCCTGAGCAGTCAGAGAGGCAGAAGGATGCTGTGGTGAGGCTCATCCACCTCCGGCTGAAGCTGCAGGAGCTGAAGGACCCCAATGAGGATGAGCCCAATATCCGAGTCCTCCTAGAGCACCGCTTCTACAAGGAGAAGAGCAAAAGTGTCAAGCAGACCTGTGACAAGTGCAACACCATCATCTGGGGGCTCATTCAGACCTGGTACACCTGCACAGGCTGCTATTACCGCTGCCACAGCAAGTGCTTGAACCTCATCTCCAAGCCCTGTGTGAGCTCCAAGGTTAGCCACCAGGCCGAGTACGAGCTGAACATCTGCCCCGAGACGGGGCTGGACAGCCAGGATTACCGCTGTGCCGAGTGCCGGGCGCCCATCTCTCTGCGGGGCGTGCCCAGTGAGGCCCGACAGTGTGACTACACGGGCCGGTACTACTGCAGCCACTGCCACTGGAACGACCTGGCTGTTATCCCTGCACGCGTCGTGCACAACTGGGACTTCGAGCCGCGCAAGCATGCGCTACCTGGCTCTGATGGTGTCGAGGCCGGTGCTCCGGCTGCGGGAGATCAACCCCCTGCTGTTCAACTATGTGGAGGAGCTGGTGGAGATCCGGAAGTTGCGCCAGGACATCCTGCTCATGAAGCCATACTTCATCACTTGCAAGGAGGCCATGGAAGCCCGGCTGCTGCTGCAGCTCCAGGACCGACAGCATTTTGTGGAGAACGACGAGATGTACTCCATCCAGGACCTGCTGGATGTGCATTTGGGCCGCCTTGGCTGCTCTCTCACCGAGATCCACACGCTCTTTGCCAAGCATATCAAGCTGGACTGTGA

XM_004842614.1 Coding sequence

Mc1r melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)

Length: 957 bp    Location: 133933..132768   Strand: -
>XM_004842614.1
ATGCCCATACAAGAGCCCCTGAGGAGGATGCTGGGCTCCCTCAATGCTACCCCCTCAGCCACCCCACTCCTCAGGTTGCCTGGCAACCACACGGGACCTGGGTGCCTGCACGTGTCCATCCCTGATGGGCTCTTCCTTGGCCTGGGGCTGGTCAGGTTGGTGGAGAATGTGCTGGTGGTGGTCGCCATCGTTAAGAACTGTAACCTGCACTCCCCCATGTACTGCTTCATCTGCTGCCTGGCCCTGTCCGACCTGCTGGTGAGCTCCAGCATCGTGCTAGAGACAGCTATCATCCTGCTACTGGAGGCAGGTACCCTGGTGACCTGGGCCACTGTAGTGCCACAGCTGGACAACTTAATTGATGTGCTCATCTGCAGCTCTATGATGTCCAGCCTCTGCTTTCTTGGCGCCATTGCTGTGGACCGCTACATCTCCATCTTCTACACACTGCGTTATCACAGCATTGTGACACTGTCTCGGTCCCAGCGGGCCATCGCAGCCATCTGGGTGGCCAGTGTCCTCTCCAGCACCCTCTTTATTACCTACTACAAGCACACTGCTGTGCTGCTGTGCCTGGTCATCTTCTTCCTCGCCATGCTGGCTCTCATGGCGATTCTGTACGTGCACATGCTCACCCGAGCCTGGCAGCATGCCTGGGGCATCGCCCAGCTCCACAAGAGGCAGCACCCAGTCCTTCAGGGCTTCTGCCTCAAGGGGGCTGCCACCCTGACCATCCTCCTGGGGATTTTCTTCCTGTGCTGGGGCCCCTTCTTCCTGCATCTCACTCTTGTCATCCTCTGCCCCCAACACCCTGCCTGCAGCTGCGTCTTCCAGAACTTCAATCTCTTTCTGGTGCTCATCATGTGCAACTCCATCGTGGACCCCCTCATCTATGCCTTCCGCAGCCCAGAGCTCTGCAGGACACTCAAGGAGGTGCTGGTGTGCTGCTCCCCCTGA

XM_004842605.1 Coding sequence

LOC101723550 AFG3-like protein 1-like, transcript variant X3

Length: 1992 bp    Location: 82905..59943   Strand: -
>XM_004842605.1
ATGCAGAAGGGAGAGTTTCCCTGGGATGACAAGGATTTCCGAAATCTGGCCGTTTTGGGGGCAGGTGTTGCTGTGGGAGTTTTCTACTTCTGTTTTCGAGATCCTGGAAAAGAAATCACCTGGAAGCACTTTGTGCAGTATTACCTGGCCAGAGGCTTGGTGGACCGGCTAGAAGTCGTGAACAAACAGTTTGTGCGGGTTATTCCTGCCCCAGGGACCTCTTCTGCGAAGTTTGTGTGGTTCAACATCGGCAGTGTTGATATCTTTGAGCGGAACCTCGAGTCTGCTCAGTGGGAGCTGGGGATCGAACCCACCAACCAGGCCGCAGTGGTCTACACCACTGAGAGTGATGGCTCTTTCCTGGGAAGCCTGGTGCCTACCCTTCTTCTGGTTAGCATCCTTCTCTATGCTGTGAGGAGGCACTCGATGGGGGCCGGGCGCCGCGGGCGAGGAGGAGGCCTCTTCAGTGTTGGTGAGACAACAGCCAAGATCCTGAAGAACAACATTGATGTGCGATTTGCAGATGTAGCTGGCTGTGAAGAAGCCAAATTGGAAATTATGGAGTTTGTGAATTTCCTGAAAAACCCCAAGCAGTATCAGGACTTAGGAGCCAAAATCCCAAAGGGAGCCATGCTCACTGGTCCACCTGGTACCGGCAAAACACTTCTTGCCAAAGCAACCGCAGGGGAGGCTAGCGTGCCCTTCATCACTGTGAATGGATCAGAATTCCTGGAAATGTTTGTTGGTGTTGGGCCAGCAAGGGTCCGTGACATGTTTGCAATGGCTAGGAAAAACGCTCCTTGTATCTTATTCATTGATGAGATGGATGCCATTGGCCGGAAGCGAGTCCGAGGGCACCTTGGGGGTCAGAATGAGCAGGAGAACACCCTGAACCAGATGCTTGTGGAGATGGATGGATTCAACTCCACCACCAATGTAGTGGTGCTGGCAGCCACTAACCGCCCTGATATCCTCGACCCAGCCCTAATGCGCCCTGGCCGCTTTGACCGCCACATTTATATTGGTCCCCCTGACATCAAAGGCAGGTCCTCTATCTTCAAGGTCCACCTGCACCCACTGAAGTTGGCTGAAAGCCTCAGTAAGGACTCCCTGGCATGGAAGCTGGCAGCTCTCACTCCAGGCTTCACTGGTGCTGATATTTTTAATGTGTGCAATGAAGCTGCGCTGATCGCAGCCCGCTACCTGAGTCCTTCTGTTCAGGAGAAGCACTTCAAGCAAGCCATTGAGAGGGTCGTTGGAGGCCTTGAGAAGAAGACCCAGGTCTTGCAGCCCAGTGAAAAGACGACCGTGGCCTACCACGAGGCCGGGCATGCAGTCGTGGGCTGGTTCCTGGAGCATGCAGACCCCCTGCTGAAGGTATCCATTATCCCCCGGGGCAAGGGGCTTGGCTATGCCCAGTACCTGCCCCGGGAACAGCACCTCTACACAAGAGAGCAGCTCTTCGACCGCATGTGCATGATGCTGGGGGGCCGGGGGGCCGAGCAACTGTTCTTTGGGCAGATCACCACAGGGGCGCAAGATGACCTAAGGAAGGTCACACAGAGTGCCTATGCACAGATCGTGCAGTTTGGGATGAGTGAGAGGCTGGGTCAGGTGTCCTTTGACCTCGCACGCCAAGGTGAGGCCCTGGTGGAGAAGCCCTACAGCGAGGCCACTGCCCAGCTCATCGATGAGGAGGTTCGGCACCTCATCAGCTCTGCCTACGATCGCACTCTAGAGCTGCTGACTCAGTGCCGGGAGCAGGTAGAGAAGGTGGGCCAGCGGCTGCTTGAGAAGGAGGTGCTAGAGAAGGCTGACATGGTTGAGCTGCTAGGCCCTCGGCCCTTCGCGGAGAAGTCCACCTATGAGGAGTTTGTGGAGGGCACTGGCGGCCTGGAGGAGGACACATCCCTTCCTGAGGGGCTGAAGGATTGGAACCAGGGACAGGAGGAGGGGGACACTGAGCAGCGCTTGCAGGGGAGCCCTACATAG

XM_004842609.1 Coding sequence

Def8 differentially expressed in FDCP 8 homolog (mouse), transcript variant X1

Length: 1356 bp    Location: 119035..103890   Strand: -
>XM_004842609.1
ATGGAATATAATGAGAAGCTGGCCCGGTTCCGGCAAGCCCACCTCAACCCCTTCAACAAGCAGCTTGGGGCAGGGCAGCATGAGCAGGGAGCCGCTCAGGAGGCTCTGGAGATCAGCTCTGAAGAGATCCTGCCTGAGCTGCGCCCTGGGGAGCCTGAGTTCTGCTGCTCTGAGCGTGTGATGGATCTTGGCCTGTCTGAGGACCACTTCTCTCGCCCTGTGGGTCTGTTCCTGGCCTCTGATGTCCAGCAGCTTCGGCAAGCGATTGAGGAATGTAAGCAGGTGATTCTGGAGCTGCCTGAGCAGTCAGAGAGGCAGAAGGATGCTGTGGTGAGGCTCATCCACCTCCGGCTGAAGCTGCAGGAGCTGAAGGACCCCAATGAGGATGAGCCCAATATCCGAGTCCTCCTAGAGCACCGCTTCTACAAGGAGAAGAGCAAAAGTGTCAAGCAGACCTGTGACAAGTGCAACACCATCATCTGGGGGCTCATTCAGACCTGGTACACCTGCACAGGCTGCTATTACCGCTGCCACAGCAAGTGCTTGAACCTCATCTCCAAGCCCTGTGTGAGCTCCAAGGTTAGCCACCAGGCCGAGTACGAGCTGAACATCTGCCCCGAGACGGGGCTGGACAGCCAGGATTACCGCTGTGCCGAGTGCCGGGCGCCCATCTCTCTGCGGGGCGTGCCCAGTGAGGCCCGACAGTGTGACTACACGGGCCGGTACTACTGCAGCCACTGCCACTGGAACGACCTGGCTGTTATCCCTGCACGCGTCGTGCACAACTGGGACTTCGAGCCGCGCAAGGTGTCTCGCTGCAGCATGCGCTACCTGGCTCTGATGGTGTCGAGGCCGGTGCTCCGGCTGCGGGAGATCAACCCCCTGCTGTTCAACTATGTGGAGGAGCTGGTGGAGATCCGGAAGTTGCGCCAGGACATCCTGCTCATGAAGCCATACTTCATCACTTGCAAGGAGGCCATGGAAGCCCGGCTGCTGCTGCAGCTCCAGGACCGACAGCATTTTGTGGAGAACGACGAGATGTACTCCATCCAGGACCTGCTGGATGTGCATTTGGGCCGCCTTGGCTGCTCTCTCACCGAGATCCACACGCTCTTTGCCAAGCATATCAAGCTGGACTGTGAGCGGTGCCAGGCCAAGGGCTTCGTGTGTGAGCTCTGCAGAGAGGGTGATGTGCTGTTCCCATTCGACAGCCACACATCTGTGTGCACAGACTGCTCAGCCGTCTTCCACAGGGATTGCTACTATGACAACTCCACCACATGCCCCAAGTGTGCCCGGCTCAACTTGAGGAAGCAGTCCCTCTTCCAGGAGCCTGGTCCAGACATGGATGCCTAG

XM_004842602.1 Coding sequence

LOC101722738 probable 5-hydroxyisourate hydrolase R09H10.3-like, transcript variant X3

Length: 357 bp    Location: 26894..29564   Strand: +
>XM_004842602.1
ATGGAGCGCAGAAGCAGCCCACTGACCACACATGTCCTGGACACCACCTCAGGGCTGCCAGCCCGGGGCCTCTGCCTCCGTTTGTCCCAGCTGGAGGACTCGGACCAGCAGTGGACAGTGCTGAGGGAAAGCTACACAGATGCGGATGGCCGCTGCCCTGGCCTTCTAAGGCCAGGCCAGATGAAGCCAGGCACCTACAAGCTGTCATTCGACACCGAGGGCTACTGGAAGAAGATGGGGCAGGAGAGCTTCTACCCATATGTAGAGGTTGTCTTCAACATCACAAACGAGACCCAGAAGTTCCATGTACCCCTGCTGCTGAGCCCATGGTCCTACACCACATACAGAGGGAGCTAG

XM_004842601.1 Coding sequence

LOC101722738 probable 5-hydroxyisourate hydrolase R09H10.3-like, transcript variant X2

Length: 543 bp    Location: 27064..30921   Strand: +
>XM_004842601.1
ATGGCTGAGCAGCGCGACCACTGGCGGGCCAGACCTCCTGGGGCGGGGGTGTTGTTTCCAAACCTGGCGCCTTGGCTGAGTGCGTCCAGTCCCCTTGGATCCTGCCTGGGGACTCATCGCACTAGTTTGTGTGGGGTGCTCTGTGCTCAGGCCCCAGGCACTCACCCTGCCCCTGCACTGGGTCAGGGCGCTGGCATGGAGCGCAGAAGCAGCCCACTGACCACACATGTCCTGGACACCACCTCAGGGCTGCCAGCCCGGGGCCTCTGCCTCCGTTTGTCCCAGCTGGAGGACTCGGACCAGCAGTGGACAGTGCTGAGGGAAAGCTACACAGATGCGGATGGCCGCTGCCCTGGCCTTCTAAGGCCAGGCCAGATGAAGCCAGGCACCTACAAGCTGTCATTCGACACCGAGGGCTACTGGAAGAAGATGGGGCAGGAGAGCTTCTACCCATATGTAGAGGGCTGCCTGGGGAAGGGTGACGTCACACAGAGACACCCGAGAAAAGGCCTGGACAACAGCACTGGTGGGGCCAGCAGGTAA

XM_004842600.1 Coding sequence

LOC101722738 probable 5-hydroxyisourate hydrolase R09H10.3-like, transcript variant X1

Length: 552 bp    Location: 27064..29564   Strand: +
>XM_004842600.1
ATGGCTGAGCAGCGCGACCACTGGCGGGCCAGACCTCCTGGGGCGGGGGTGTTGTTTCCAAACCTGGCGCCTTGGCTGAGTGCGTCCAGTCCCCTTGGATCCTGCCTGGGGACTCATCGCACTAGTTTGTGTGGGGTGCTCTGTGCTCAGGCCCCAGGCACTCACCCTGCCCCTGCACTGGGTCAGGGCGCTGGCATGGAGCGCAGAAGCAGCCCACTGACCACACATGTCCTGGACACCACCTCAGGGCTGCCAGCCCGGGGCCTCTGCCTCCGTTTGTCCCAGCTGGAGGACTCGGACCAGCAGTGGACAGTGCTGAGGGAAAGCTACACAGATGCGGATGGCCGCTGCCCTGGCCTTCTAAGGCCAGGCCAGATGAAGCCAGGCACCTACAAGCTGTCATTCGACACCGAGGGCTACTGGAAGAAGATGGGGCAGGAGAGCTTCTACCCATATGTAGAGGTTGTCTTCAACATCACAAACGAGACCCAGAAGTTCCATGTACCCCTGCTGCTGAGCCCATGGTCCTACACCACATACAGAGGGAGCTAG

XM_004842597.1 Coding sequence

Gas8 growth arrest-specific 8, transcript variant X2

Length: 1674 bp    Location: 42867..12658   Strand: -
>XM_004842597.1
ATGCAGGGCAGAGTGATATGCTCAGCTGAGTGCTTCCATCAAGGGCATGAGAGGAAGCAAGGGGGAGAGGTTCCAGATAGGTCCTCCCCAAATGCCTGTGGAAGCCAGTCAGAGCCTTCCAAGGAGGGGAAACGATTCGGCAGAATTCCCTGTACTTACCCAGTAATTTTTCTTCAACCCCAGGCACCCAAAAAGAAAGGGAAGAAAGGTAAACCCAAAGGTACTGCAGTTGTGGATGGGCTTGATCCAGAGGACATGAACAAGGGGCAGGTGGAGGAGCACATCAGGCGCATCCGGGAGGAGCTGGACCGGGAGCGGGAGGAGCGCAACTACTTCCAGCTGGAGCGGGACAAGATCCACACTTTCTGGGAGATAACGAGAAGGCAGTTGGAGGAGAAGAAGGCTGAGCTGCGGAACAAAGACCGGGAGATGGAGGAGGCTGAGGAGAGGCATCAGGTGGAGATCAAGGTGTACAAGCAGAAGGTGAAGCACCTGCTGTATGAACACCAGAACAGCCTGACGGAGCTGAAGGCCGAGGGCACCGTGGCCATGAAGCTGGCCCAGAAGCAGCACCACACCCAAGAGGGCGCACTGCGCAAGGACATGCGGGCGCTCAAGGTGGAGCTCAAGGAGCAGGAGCTGGCCAGCGAGGTGGTGGCCAAGACCCTGCGGCTGAAACACGCCGAGGAGATCACCAAGATGAGGAATGACTTTGAGAGGCAAATTCGAGAAATTGAGGCTAAGTATGACAAGAAGATGAAGGTGCTGAGGGATGAGCTTGATCTGCGAAGAAAGACTGAGATCCACGAAGTGGAGGAGAGGAAGAATGGCCAGATCAACACACTGATGCAGCGCCACGAAGAGGCCTTCACCGACATCAAGAACTACTATAATGACATCACACTCAACAACTTGGCCCTCATCAGCTCCCTCAAGGAGCAGATGGAAGACATGCGAAAGAAGGAGGAGCGCCTGCAGCGAGAGATGGCGGAGGTGGCCTTGCAGAACAGGCGCCTGGTGGATCCCCTCCAGAAGGCCCGGGATGAGATGGCTGAGATGCGGAGGAAACTCGGGGACTGTGAAAGGGACAAACAGATCCTGGTGAGCACGAAAGCACGTTTGAAGGTTACTGAGAAGGAGCTGAAGGACCTGCAGTGGGAGCACGAGGTGCTGGAGCAGCGCTTCCTCAAGGTGCAGCAGGAGCGGGACGAGCTCTACCGGAAGTTCACAGCGGCCATCCAGGAGGTGCAGCAGAAGACTGGCTTTAAAAACTTGCTGCTGGAGCGCAAGCTGCAGGTGCTAAGTACTGCTGTGGAGAAGAGGGAGGTACAATTCAACGAGGTGCTGGCAGCCTCCAACATGGACCCCGCTGCGCTGATGCTCGTGTCTCACAAGCTTGAGGATGTTTTGGAATCAAAGAACACCACCATCAAGGACCTACAGTATGAGCTGGCACGGGTCTGCAAGCAGGTGAGAAGCCTCCATCCTTGGCCTCGGCCCTCCTCCAGGACTCAGTCTCCTGCCAAGCCTGCCCTAGGCGTCCCTCAGGCTGAACAGCAGGAGAGTGAGGTGCAGCAGGTGAGCGGGGTCTGGACGGATGAGGGCGGGGCTCTGGGCGGCCGGGAGGCTGCTGGGAGAAGGGCAGCCCGCAGTCACGCACCAGGGTTGGCTTAG

XM_004843106.1 Coding sequence

Tk2 thymidine kinase 2, mitochondrial, transcript variant X2

High confidence: 4 potential gene matches
Length: 561 bp    Location: 19916740..19953113   Strand: +
>XM_004843106.1
ATGGAGCCTGTGCCCAAGTGGAGAAATGTCCGTGGCCACAATCCTCTGGGCCTGATGTACCATGATGCCTGTCGATGGGGCCTCACCCTGCAGACATACGTGCAGCTCACCATGCTGGACCAGCACACTCGTCCTCAGATGTCACCTATACGGCTGATGGAGAGGTCGATTCATAGTGCAAGATACATTTTTGTAGAAAACCTATATAGAAGTGGGAAGATGCCTGAAGTGGACTATGTGATTCTGTCTGAATGGTTTGACTGGATTGTGAAGAACATCAATGTCTCTGTTGACCTAATAGTTTATCTCCGGACCACTCCTGAGACCTGTCACCAGAGATTAAAGATGAGGTGCAGGGAAGAGGAGAAGGTCATTCCACTGGAATACCTGGAGGCCATTCACCGCCTCTATGAGCAATGGCTGGTCACAGGAAGCCTCTTCCCTGTGACGGCCCCTGTTCTGGTGATTGAGGCTGACCACAACATGGAGAAGATGTTACAAGTATTTGAACAAAACCGCACCCGAATATTAACACCAGAGAATTGGAAGCATGGCCCATAG

XM_004843208.1 Coding sequence

Snai3 snail family zinc finger 3

High confidence: 4 potential gene matches
Length: 870 bp    Location: 891316..896429   Strand: +
>XM_004843208.1
ATGCCGCGCTCCTTCCTGGTGAAGACGCAGCCCGGCCACCGGGCACCCGACTACGGGCGGCTGGAGACGCGCAGAGAAGGCAATGGCAGCTGCTCCCCCAACAAAGAGGCCCCGTCCACGCCCAGCGACCTGCCCCGGCCCTGGGGCCGCACCTCAGCAGTCACCTGCATCTCCCTGCCCCTCCCGCCTCGTCAAGAGGAAGCTTTGGGGTTTCCCGGGCCAGATGCCCCGGAGATTGGCCTGGGAGGCCCTTGGGCCGCCCGGGTCCCCAGTTTCCCCCTCAGAGACAGCCTGAATCACCTCAACCTGCCCCCACTGCTGCTGCTGCCCACGCGCTGGCCCCTGGTCCTGCACCCCCATGCCTATGGGGCTCCAGACAAACTGCTCGGGGCCATGGGGGCCCCTCGAGCCCCAGGAGGCTTCGAGTGCGTCCACTGCCACAAGGCCTACCACACGCCAGCCGGGCTGGCCCGGCACCAGCAGCTGCAGTGCCACCTGCAGGCCGGGCGCGTCTTCACCTGCAAGCACTGCGACAAGGAATACGGCAGCCTGGGAGCCCTCAAGATGCACATCCGCACCCACACGCTGCCCTGCGTATGCACCGTGTGTGGCAAGGCCTTCTCCAGGCCCTGGCTGCTGCAGGGCCACATCCGGACCCACACAGGTGAGAAGCCCTACGCCTGCCCTCACTGCAGCAGGGCCTTCGCCGACCGCTCTAACCTCCGGGCACACCAGCAGACACACTCAGGAACCAAGAAGTACCCATGCAAGGGCTGCGGAAAGACCTTCTCCCGTATGTCCCTCCTAGCACGACACGAGGAAGCAGGCTGCTGCCTGGCCCCTGAGGGTCCCCCCTGCCCCGAGAGCTGA

XM_004843209.1 Coding sequence

Il17c interleukin 17C

High confidence: 4 potential gene matches
Length: 669 bp    Location: 921967..920266   Strand: -
>XM_004843209.1
ATGCCTGCCGCTGCCAGCACTGCCAGCATGATGAGGGAGGCCTGCACCCCACTTTCCCCTGGGAATGGAAGGCAGGTGCCCCTGCTGGGGCCTGACCACGCCCTCTCCTGCCCCCAGCTCCTCCGTGGCATCCTGTTTCTGGCCTGGCTGCCTGGAAGCCTGGCCCACCAAGGCCCCCCGCTCTGGGGGACCCCACGCTGCTACTCGGCTGAGGAGCTGCCTCACGGCCAGGTGCCCCTACACCTGCTGGCTCGAAATGCCAGGTGGGAGCAGGCCCTGCCTGTGGCCCTGGTGCCCACCCTGGAGGCAGCTGGCTCCAGGCCACACAAGCAGCCCCAGGCCAGGACTCAGTGCCCCACACTGAGGCCCGAGAAGGTGCTGCAGGCAGACACCCATGAGCGCTCCATCTCGCCCTGGAGATACCGCATCGACGTGGACGAGGACCGCTACCCGCAGAAGCTGGCTGTGGCTGAGTGTCTGTGCCGTGGCTGCATCAACAGCAGGACCGGCCGGGAGACAGCCGCGCTCAACTCCGTGCCCCTGCACCAGAACCTGCTCGTGCTGCGCCGCCGAGCCTGTGCCCCCACGCCCGGGGCCTTCGCCTTCCACACAGAGTTCATCCGCGTGCCCGTGGGCTGCACCTGCGTCCTGCCCAGGTCAGCCCAGTGA

XM_004843171.1 Coding sequence

Arl2bp ADP-ribosylation factor-like 2 binding protein

High confidence: 4 potential gene matches
Length: 495 bp    Location: 28805617..28799576   Strand: -
>XM_004843171.1
ATGATGGACACTCTGGAGGAGGAGAACTTGGCGCAGTCCTTCTCCTCTGCCTCGGATGCAGAATTTGATGCTGTGGTTGGATATTTAGAGGACATTATCATGGATGATGAGTTCCAGTTACTACAGAGAAATTTCATGGACAAGTACTACCAGGAGTTTGAAGACACAGAGGAGAATAAACTCACCTACACACCCATTTTTAATGAATATATTTCTCTAGTGGAGAAGTACATTGAGGAGCAGCTGCTGGAACGGATCCCAGGGTTCAGCATGGCAGCCTTCACGACAACATTACAGCACCATAAAGATGAAGTGGCTGGTGACATCTTTGACATGCTGCTCACATTTACAGATTTTCTGGCTTTTAAAGAAATGTTTCTGGACTACAGAGCAGAAAAGGAAGGCCGGGGGCTGGATTTAAGCAGTGGCTTGGTAGTGACATCGTTGTGCAAATCATCTGCAATGCCAGCTTCCCAGAACAATCTGCGGCACTAG

XM_004843104.1 Coding sequence

Cmtm3 CKLF-like MARVEL transmembrane domain containing 3, transcript variant X2

High confidence: 4 potential gene matches
Length: 555 bp    Location: 19839430..19830839   Strand: -
>XM_004843104.1
ATGTGGCCCCCCGACCCCGACCCCGACCCGGACCCCGAGCCTGCGGGCGACTCCCGGGCCGGCGCCGCAGTCCTCGGGCTCCGTGCGCTGCTGCCGGCGCGCGCTTTCCTCTGCTCGCTCAAAGGCCGCCTCCTGCTGGCCGAGTCGGGTCTCTCATTCATCACTTTCATCTGCTACGTGGTGTCCTCAGCATCTGCCTTCCTCACAGTGCCTCTGCTAGAGTTCTTGCTGGCCCTCTACTTCCTCTTCGCTGATGCCATGCAGCTGAATGACAAGTGGCAGGGCTTGTGCTGGCCCATGATGGACTTCCTGCGATGTGTCACTGCCGCCCTCATCTACTTTGTCATCTCCATCACAGCTGTTGCCAAATACTCCGATGGGTCTTACAAAGCAGCCGGGGTTTTTGGCTTCTTTGCCACCATCGTGTTTGCAATTGACTTCTACCTGATCTTTAATGAAGTGGCCAAATTTCTCAAGCAAGGGGACTCTTCTGGTGCTGATGAAACCACAGTCCACAGGGCAGAAGAGGAGAATTCTGACTCTGACTCTGACTGA

XM_004843151.1 Coding sequence

Ccdc135 coiled-coil domain containing 135, transcript variant X3

High confidence: 4 potential gene matches
Length: 2619 bp    Location: 28406203..28386638   Strand: -
>XM_004843151.1
ATGGAGGTCCTGAAGGAGAAAGTGGAGGAAGAGGAGGCTGCCGAGCGGGAGGAGGCTGCTGAGCGGGCTGAAAGGGTGGAGAAAACGAGGCCAGCGGAGGTGCAGAAGGAAGAAGCCACCCTGACCCAGGAGATGCTCCGAGACCTGGGGAAGCAGCTGTTGGAGATTCAAATGCCCACACCAGCAGAGCCCCCGATCGTAACCAAGGACACCGTTGACATCTCCAACCTGCCCCTTTCCTACAAAACCAACACACTCAAGGAGGAGCACTTGCTGCAGGTGGCCAACAACTTCTCCCGCCAGTACAGCCACCTGTGCCCGGACCGCGTGCCCCTCTTCTTGCAGCCCCTGAATGAGTGTGAAGTGCCTAAGTTTGTGAGCACTACCATCCGGCCCACACTGATGCCCTACCCAGACCTTTATAACTGGGATGGCTGTGCCAACTTTGTCTCCAACTTCCTCACCAGGGTGCCTCTGCCTGACCCCCTCAAGCCGCCCTCGCACCTGTATTCCTCAACCACGGTGCTCAAGCACCAGAAGGGGAACTGCTTCGACTTCAGCACGCTGCTCTGTTCCATGCTGCTTGGTGCTGGCTACGATGCCTACTGCGTCAATGGGTATGGCTCCCAGGCTCTGTGCAACATGGACCTGACTCGGGAGGTCTGCCCACTCACCGTGACACCCAAAGAGACAGTCAAGAAGAAAGAGAAGGCACAGCCCAAGAAGTACACCATCAAACCGCCACGGGACCTGACCAGCAGGTTTGAGCAGGAGCAGGAGATCAAGAAGCAGAAGGAGGCCAAAGCCCAGGAGGAGAAGCGGTGGTGGGAAGAAGAAGAAGAGCACCTTCTGGAGGCAGAGAGGGCGAAGCCTGACCCCCTACATGGCCTTCGGGTGCACTGCTGGGTCCTGGTGCTGTTGGGGAAGCGAGAGGTGCCTGAGAGCTTCTTCATCGACCCTTTCACTGGCCGCAGCTACAGCATCCAGGATGATCACTTCCTGGGCATCGAGAGCCTCTGGAACCACAGGAACTATTGGATCAACATGCAGGACTGCCGGAACTGCTGCAAGGACTTGGTCTTTGACCTGGGAGACTCTGTGAGGTGGGAGTACATGCTCTTGGGGACAGATAAGCCTCATCTGTCCTTGACTGAGGAAGAGGATGAAGGGATGAATGATGACAATGACACAGAAGATCTGGACAAGGAGAACCAGGATAAGAGCTTCGATATGCCGTCCTCATGGGTGGAGCAGATCGACATCTCCCCAGAAGCATTTGAAACCCACTGCCTGAACGGGAAGAAGGTGCTGCATTACAGGAGGGCACAGCTGGAGAAATGGGCCCCGTACCTCAACAGCAATGGCCTGGTGTGCCGCCTCACCACCTACGAAGACCTGGAGTGTACCAAGATTTTGGAGATCAAGGAGTGGTATCAGAACCGGGAGGACATGCTGGAGCTGAAGCACATAAACAACAGCACAAGCCTGCACACTGACTACTTCAGGCCGGGCCACCCCCGGGCTCTGCATGTGCACTCATACAAGTCCATGGAGCCTGAGAATGACCGTGTCATGGAGTTTTATGAAACAGCCCGTGTGGACGGCCTGATAAAATGGGAGGAGACTCCCAGGACAATGACTCAGTACTATCAAGGACGCCCAGACTTCCTCTCCTACCGCCATATCAACTTTGGGCCCAGGTTCAAGAAGCTCACTTTGACCAGCACAGAGTCGAACCCCCGGCCCATACTGAAAATCACAGAGCGGTTCTCCCGAAACCCAGCGAAGCCCGCAGATGAGGATGTGGCAGAGCGTGTGTTCTTGATCTCCGAGGAGCGCATCCAACTGCGCTACCACTGCCGTGATGACTACATCACTGCCTCCAAGCGCGAGTTCCTGCAGCGCTCTGAGGTGGACAGCAAGGGCAACAAGATCATCATGACATCAGACGTGTGCATCAGCTTTGAGGTGGAGCCCATGGAGCACACCAAGAAGCTTCTCTACCAGTACGAGACCATGATGCACCTGAAGAATGAGGAGAAGCTGTCCAAACACCAGGCCTGGGAGTCCGAGCTGGAGGTGCTGGAGATCCTGAAGCTTCGAGAGGAAGAGGAGGAGGCACACATACTGAACATCTCCATCTATGACACCAAGCGCAACGAAAAGAGCAAGGAGTATCGGGAGGCCATGGAGCGTGTGATGCACGAGGAGCACCTGCGGCAGGTGGAGGCCCAGCTGGACTACCTGGCTCCATTCCTGGCCCAGCTGCCCCCGGGTGAGAAGCTGACTCGTGTGCAGGCTGTGCACCTCAAGGATGCGTGCCTCGGTGACTTCAAGCAGCGGCTCATCGACAAGGCCAACCTTATCCAGGCCCGCTTCGAGAAGGAGAACCAGGAGCTGCAGAAGAAGCAGCAGTGGTACCAGGAGAACCAGGTGACCCTGACACCAGAGGATGAAGACTTGTACCTGAGTTACTGCTCTCAGGCCATGTTCCGTATCCGCATCCTGGAGCAGCGGCTCAATCGACACAAGGAGCTGGCCCCCCTGAAGTATTTGGCGTTGGAGGAAAAGCTCTACAAGGATCCACGCCTGGCAGAGTTCCTCAAAGTCTTCGCTTGA

XM_004843102.1 Coding sequence

Cmtm4 CKLF-like MARVEL transmembrane domain containing 4, transcript variant X2

High confidence: 4 potential gene matches
Length: 627 bp    Location: 19769120..19824173   Strand: +
>XM_004843102.1
ATGCGGAGCGGCGAGGAGCTGGACGGCTTCGAGGGCGAGGCCTCGAGCACCTCCATGATCTCGGGCGCCAGCAGCCCGTACCAGCCCACGACCGAGCCGGTGAGCCAGCGCCGCGGGCTGGCCGGCCTCCGCTGCGACCCCGACTACCTGCGCGGCGCGCTCGGCCGCCTCAAGGTCGCCCAAGTGATTCTGGCCCTGATTGCGTTCATCTGCATTGAGACCATCATGGAGTGCTCCCCGTGTGAAGGTCTCTACTTCTTTGAGTTTGTAAGCTGTAGTGCATTTGTGGTGACAGGAGTCTTGCTGATTCTGTTCAGCCTCAACCTTCACATGAGGATCCCCCAGATCAACTGGAACCTGACAGATTTGGTCAACACTGGACTCAGCACTTTCTTTTTCTTTATTGCCTCAATTGTACTGGCTGCTCTAAACCACAAAACTGGAGCTGAAATTGCTGCCATGATATTTGGCTTCTTGGCAACAGCAGCCTATGCAGTGAGCACATTCTTGGCCGTACAGAAATGGAGAGTCAGCATCCGCCAGCAGAGCGCCAATGACTACATCCGAGCCCGCACTGAGTCCAGAGATGTGGACAGTCGCCCCGAGATCCAGCGCCTGGACACATGA

XM_004843110.1 Coding sequence

Bean1 brain expressed, associated with NEDD4, 1

High confidence: 4 potential gene matches
Length: 744 bp    Location: 20015605..19970553   Strand: -
>XM_004843110.1
ATGTCCTTCAAACGCCCTTGCCCCTTAGCACGATACAACCGCACCAGCTACTTCTACCCCACATTCTCAGAGAGCTCGGAGCATAGTCACCTGCTCGTGTCTCCTGTGCTGGTGGCGAGTGCTGTCATAGGTGTGGTCATCATCCTCTCCTGCATCACCATCATCGTGGGCAGCATCCGCAGGGACAGGCAAGCCAGGCTCCAGCGCCACCACCGCCGGCGACACCGAAACCAAGACTACGAGCAGAGCCATGTGTCTGACGGGCGCACGTACAGCCGCTCCAGCCACAGGCTGCGCTCGGCCTGCAGCCCCACGGAGGACTGGCCCCCACCCTTGGACATCAGCTCTGATGGGGATGTGGACGCCACTGTGCTCAGGGAGCTGTACCCTGATTCTCCACCAGGCTACGAGGAGTGTGTGGGCCCAGGAGCCACTCAGCTGTATGTCCCCATGGACGCACCGCCGCCCTACTCACTGACCGCCTCCTGTCCCACACTGAATGGCGCCCTCGACTCAGACAGTGGCCCCAGCCCCAGTGGACACCAGCAAGAGCAGAGGACCGGGGCCCAGAGTGACCTCCGCACCGTCTCCATGGACACGTTGCCCACTTACGAGACCGTGTGTGGAGCTGGCTCCCCGTCGGGCCTGCTGCCGCTGCCGGGGCCAGAACCAGGTCCAAGGAACTCACAGGGCTCAGCCACCCCTACTCGGGCCTCAGCCTCAGGCCCTGAGAGGATTGTGTGA

XM_004843037.1 Coding sequence

Tppp3 tubulin polymerization-promoting protein family member 3

High confidence: 4 potential gene matches
Length: 531 bp    Location: 18922562..18926195   Strand: +
>XM_004843037.1
ATGGCAGAGAGCACAGATGTAGCTGGGCTGCAGGAGAGCTTCCGAAAGTTTGCCATTCATGGCGACCCCAAGGCAAGCGGACAAGAGATGAATGGCAAGAACTGGGCCAAGCTGTGCAAGGACTGCAAGGTGGCTGATGGAAAGGCTGTGACAGGGACCGATGTTGACATCGTCTTCTCCAAAGTCAAGGGGAAGTCAGCTCGTGTCATCAACTATGAGGAGTTCAAGAAGGCCCTGGAAGAGCTGGCCCCCAAGCGATTCAAGGGAAAGAGCAAGGAGGAGGCCTTCGATGCTATCTGCCAGCTGGTGGCAGGCAAGGAACCAGCCAACTTGGGCGTCACTAAAGCAAAAACAGGGGGTGCTGTGGAACGGCTGACTGACACTAGCAAGTACACTGGCTCCCACAAAGAGCGCTTCGATGAGAGCGGCAAGGGCAAGGGCATTGCCGGACGGCAGGACATCCTGGACGACAGTGGCTATGTGAGCGCCTACAAGAATGCAGGCACCTATGATGCTAAGGTGAAGAAGTGA

XM_004843031.1 Coding sequence

Agrp agouti related protein homolog (mouse)

High confidence: 4 potential gene matches
Length: 390 bp    Location: 18826353..18827341   Strand: +
>XM_004843031.1
ATGCTGACCACAGTGCTGCTGAGTTGTGCCCTGCTGCTAGCATTGCCTGAAACGCAGGGGGCCCAGATGGGCTTGGCCCCCTTGGAGGGCATCAGAAGGCCTGACCAGGTCCTGTTCCCAGAGTTCCCAGGTCTGCATGCTCCGCTGAAGAAAACTCCAGACAAAGCAGAAGAGGCTCTGCTGCAGAAAGCAGAAGCTTTGGCAGAGGTGCTAGACGCACAGAGCCGCGAGCCCCGCACCCCACGCCGCTGTGTAAGGGTGCACGAGTCCTGCTTGGGGCAGCAAGTACCATGCTGTGACCCGTGCGCCACATGCTACTGCCGCTTCTTCAACGCTTTCTGCTACTGCCGCAAGCTGGGTACTGCTACGAATCCCTGCAGTCGCACCTAA

XM_004843021.1 Coding sequence

Enkd1 enkurin domain containing 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1041 bp    Location: 18682596..18686735   Strand: +
>XM_004843021.1
ATGTGCGAGGGTCCCTCCCGCATCTCCGGGCCCATCCCTCCAGATCCCACGCTATGCCCTGACTACTACCAGTGGCCGGCCTCGGCTCAAGGGCGCCTTGAGGGAAATGCGCTGAAGCTGGACCTGCTGACCTCGGACCGAGACCTGGACGACATACCTCTGCGTGGCCCACGCATTAGGCCTGGAGCCCGAGAGATCCTGGAGCAAGGCCAGCATGGTGTGGGGGATTTGCTGCTGCAATTAGAGGGCATCTCCCTTGGTCCAGGGGCCTCTCCCAAGAGAAAGGACCCTAAAGACCACAAAAAAGAAAACCTGAGGCGGATCAGGGAGATCCAGAGGCGCTTCAGAGAGCAGGAGCACAGCCGGGAGCAGGTCCAACCCAGGCCCCTGAAGGCACTGTGGCACTCATCCAAGTATGATAAGGTGGTGTCCCGAGTCAAGGCCCATCTGCAGAAGCCTAGCCCTGCCTCTGTGATACAGCCTGCCCACTTCCTTCGGGCACACTCCCGCTGTGGCCCTGGGCTCCCACCACCCCGTGTCCCCAGTCCCCAGCTTACTCCAGCAAGTCCTAAAGCTAAGGGGCCAGGCATAGGTGTGGACTTCATTAGTCACAATGCCCAAGCTGCGAAGAGAGCCCCCCAGCGCCATTCCCGCTCACTGCAGATCCTGGCCCAGGTGCTGGAGAGACAGCGGCAAGCCCAGGAGCACTACAACACCACACAGAAAGGCCTTGTTCCCCATTATTTGTTGGAGCGCAAAGATCTGTGGCGGCGGGAGGCTGAGGCCAGGCAGAATAGCCAGCCAGATCCCACCATGCCCCCTGGCCACACTCGCATGCCTGAGAACCAGCGGCTGGAGACACTAAATAATCTGCTGCAGAGCCAGAGTCAGCTGCTGCGTGAGCTAGTACTGCTGCCTGCTGGAGCAGACTCACTGAGAGCCCAGGGGCACCGTGCTGAGCTAGACCGGAAGCTGGTACAGGTGGAAGAAGCCATCAAGATCTTTTCCCGGCCCAAAGTGTTTGTGAAGATGGACTCCTGA

XM_004842725.1 Coding sequence

Usp10 ubiquitin specific peptidase 10, transcript variant X3

High confidence: 4 potential gene matches
Length: 2310 bp    Location: 1554086..1616711   Strand: +
>XM_004842725.1
ATGGCCCTCCACGGCCCGCAGCTCCCCCCGTACAGTGGAACAGCTCTGTGTGGCACTCAGGCTGCGGACGAACTGCCTGATGGACAAGAGTATCAGAGAATTGAGTTCGGTGTCAATGAAGTAATTGACCCCAGTGACACTCTGCCGAGAGCCCCCGGCAACAGTATTTCAAGCACATTGAACCCTCAGGCCCCTGAATTTATTCTTGGTTGTACAGCTTCCAAAAAGACCCCTGATGGGCTAGACCAGGAGGTGAACTCCAGCTCCCTTGACCACCCATACCCGGGCCCAGCCCTGGCCTTGGACAGCAGCTCGCATGCTGAGGCAGAGGCTCTGGAGAACACTGGTGGCCCAGGTGGCCTGGGACAGAGGGAGCGGAAAAGGAAGAAGAAGCGGCCCCCAGGGTATTACAGTTACCTGAAAACTGGGGGTGACGAAAGTATTTCCACAGAAGCTGTGGTCAACGGCCATGCCAACTCAGCTGGCCTCGGTGGGGTGGGCGCCGAGGATGCGGAGTTTATGGGTGACATGCTCCCGCCGGTTTCGCCCAGGACTTGTGACAGCCCTCAGAACTCCACGGACTTCATCAGTGACACTGTGCCTGATAGTCCTTACCCTGGAGCGCTCGACAGCGCCGCCAGGACTGTGGGGCAGCCCGAGGGCTGCTGTGGGCCTGACTTTGAGCAAGCCTGCCTCCCCGCAGACCGCCTGCTAAGGACAGCTGTGGCTCCGCCCTGTGCTGCTACCGATACTACTGAGAACCTTGGCATCACCAATGGACAAGTACTTGAATCCTCGAGTGTGGGCACAGCTGCCAACGGGGAGCTGCACACTGTGGAGAGCACAGACTCAGACGTGGCCAAGCTGGAGCGTGCGCCACCTCCCGCTGACAGCGTACTCCCTGCACCCATTCCCATTAACCAGCCTGCCAAGTCCTGGGCCAGCCTCTTTCATGATGCTAAGCCCTCTTCCTCCTCACCCGTGGCGTATGTGGAAACTAAGTGTTCACCTCCTGCCCCATCTCCCCTGGTCTCTGAAAAGCAGGTTGAAGTCAAAGAAGGGCTTGTTCCAGTTTCAGAGGATCCCGTAGCCATGCAGATCGCAGAGTTACTGGAGAACGTAACCCTAGTACATAAGCCAGTGTCATTGCAACCCCGCGGGCTGATCAATAAAGGAAACTGGTGCTACATTAATGCTACTCTGCAGGCGTTGGTCGCTTGCCCTCCGATGTACCACCTCATGAAGTTCATTCCTCTGTACTCCAAGGTGCAGAGGCCTTGCACGTCGACGCCCATGATAGATAGCTTTGTTCGGCTAATGAACGAGTTTACCAACATGCCTGTGCCTCCGAAGCCCCGCCAAGCTCTTGGAGATAAAATCGTGAGGGACATCCGGCCTGGAGCTGCCTTTGAGCCCACGTACATTTACAGACTCCTGACCGTCATCAAGTCGAGCCTGTCTGAAAAGGGTCGACAGGAAGATGCTGAGGAGTACCTGGGCTTCATCCTAAACGGCCTGCACGAGGAGATGCTGAGCCTGAAGAGGCTCCTCTCACCGGACAGTGAAAAACTCACGGTTTCCAATGGGCCCAGAAGCCCCTTGCCCAAGGACGCAGCACAGCAAGAGCAAGGTGAAGGCAGCGAGGAGGAGTGGGAGCAAGTGGGCCCCAGGAACAAGACGTCGGTCACCCGCCAGGCGGATTTCGTTCAGACCCCAATCACTGGCATTTTTGGCGGACACATCAGGTCGGTGGTTTACCAGCAGAGTTCAAAAGAGTCTGCCACCCTGCAGCCATTTTTCACATTGCAGCTGGATATCCAGTCTGACAAGATACGCACCGTGCAGGATGCGCTCGAGAGCCTGGTGGCGAGAGAATCTGTCCAGGGTTACACCACGAAAACCAAACAAGAGGTGGAGATCAGCCGGCGGGTGACTCTGGAGAAGCTGCCTCCTGTCCTTGTGCTGCACCTGAAGCGCTTCGTGTATGAGAAGACTGGCGGCTGCCAGAAGCTGGCCAAGAACATCGACTACCCCGTGGACCTGGAGATCAGCAGGGAACTGCTTTCTCCAGGGGTTAAAAATAAGAATTTTAAATGCCATAGGACCTACAGGCTCTTCGCAGTGGTCTACCATCACGGCAACAGCGCCACGGGCGGGCACTACACCACCGACGTCTTCCAGATCGGGCTCAACGGCTGGCTGCGCATCGACGACCAGGTGGTCAAGGTGATCCAGCAGTACCAGGTGCTGAAGCCCGCCGCCGAACGCACCGCCTACCTCCTGTATTACCGCCGTGTGGACCTGCTGTGA

XM_004842662.1 Coding sequence

Pabpn1l poly(A) binding protein, nuclear 1-like (cytoplasmic)

High confidence: 4 potential gene matches
Length: 810 bp    Location: 776911..779083   Strand: +
>XM_004842662.1
ATGTGGCCCTTCCAGAGCTGCACACTCTTCCCGCCCCCCACCGAGGCCTGGCTCCAGACGGTCTCCTCGGACCCTGAAGCCCAGGGCTGGGGGGCCTGGGCCAGGTCAGAGAAGACCCCTCTGGAGCCAGGAAGTGGGGGTGGAAGGGAGGCTGAGGAAGAGGAGGATGGAGACGCAGGCTTCCCACTGTCCCTGCTGGAGTCCGACAGCCTGGCCAATGGCCCTGAACCTGACCAGGGGCTGGAGGCCATCAAACTGAAGCTGTGGACCATGGAGCAGGCCCAGGGGGCGCCGGAGCCACCCAGCAAACAGGAACTGGCCACGGAGGAAGAGGGCGCCAGGGCCAGGCAACTGCTGAGCCCTGAGACTGTGGGTGGCCCCTTCCCTGTGGCCCCCCGGGAGACGGTGGAGGCCGACCACAGATCCATCTACGTGGGCAATGTGGACTATGGCGGCACGGCCGAGGAGCTGCAGGCCCACTTCCACCCCTGTGGGGAGGTGCACCGCGTCACCATCCTGTGCGACAAGTTCTCCGGCCATCCCAAGGGCTATGCCTACGTGGAGTTCACCACCCAGCTCTCGGCCCAGGCTGCGGTAGAGCTGGATGAGAGCATCTTCCGGGGCCGGGTCATCAAGGTGCTCCCCAAGAGGACCAACTTTCCAGGGATCAGCTCCACGGACCGCGGGGGCCTTCAGGGGACCAGGGTGGTGGCAGCCCCGTGCAGCAGCCTCCAGGGCAGGCCCCGGTTCCGACCACGTGGGCAGGGCAGGGGACGCGGAAGATTCTCCATGTGGTTCTCACCATACTGA

XM_004842950.1 Coding sequence

Tmed6 transmembrane emp24 protein transport domain containing 6

High confidence: 3 potential gene matches
Length: 723 bp    Location: 17023955..17031619   Strand: +
>XM_004842950.1
ATGTCCCCTTTACTCCTTGGGGCTGGGCTGGTGGTTCTGAATCTAGTGACATCTGCTAGGAGCCAGAACAGAGAACCTTTAAGTGGCTCTGGGAACCAGCCACTCTTCCGTGAGGCTGATCGCCATGATTTCGCCATCATGATCCTTCCAGGGGGCATAGAATGCTTTTGGCAATTTGCCCACCAAAATGGATACTTCTTTTTCAGCTATGAGGTTCAGCGGATACTTGGGATGTCACACAACCGGCATGTTGCTGCCACAGCACATACTCCACAGGGTTTCCTCATAGAAACCTCCCAGGATGTTCGGGGCCAGATTAACTTCTCCACCCAAGAGACAGGTTACTACCAGCTTTGTTTAAGAAACCAGCAAAATCACTTTAGTTCTCTGCAAGTCTACCTCAACTTTGGAGTCTTCTACGAGGGGCCTGAGATAGACTACAAAGAGAATCAAAGAAAACAGCTGAATGATACCCTAGATGCAATTGAGGAGAGTTCACGAAGGGTGCAGGCCAATATCTTTCACATGTGGCGATTCTACAACTTTGCTCGGATGAAGAAGATGGCTGACTTTTTCCTTCTTCTATCAAATTATAACTATGTGAACTGGTGGTCAACAGCCCAGAGCCTTGTTATTGTTCTTTCTGGGATCTTGCAGCTGTATTTCTTAAAGCGTCTCTTCAATGTTCCAACCACAACTGACACAAAAAAGCCAAGATGCTAA

XM_004842663.1 Coding sequence

Trappc2l trafficking protein particle complex 2-like, transcript variant X1

High confidence: 4 potential gene matches
Length: 420 bp    Location: 786131..781833   Strand: -
>XM_004842663.1
ATGGCGGTGTGCATCGCGGTGATCGCCAAGGAGAACTATCCTCTCTACATCCGCAGCACCCCCATGGAGAATGAGCTCAAGTTCCATTACATGGTGCACACATCCCTGGACGTGGTGGATGAGAAGATCTCTGCCATGGGGAAGGCCCTGGTGGACCAGCGAGAGCTCTACCTGGGCCTGCTCTACCCAACAGAGGACTACAAGGTATATGGCTACGTGACCAACTCCAAGGTGAAGTTTGTCATGGTGGTGGACTCCTCAAACACAGCCCTTCGAGACAACGAAATTCGCAGTATGTTCCGGAAGCTGCATAACTCCTACACAGATGTGATGTGTAATCCCTTCTACAACCCTGGGGACCGAATCCAGTCCAGGGTCTTCGACAACATGGTGACATCGATGATGATCCAGGTGTGTTGA

XR_205168.1 Non-coding sequence

LOC101707183 PREDICTED: Heterocephalus glaber uncharacterized LOC101707183 (LOC101707183), misc_RNA.

Length: 459 bp     
>XR_205168.1
CTTCTTTATTTTACTCTATAATTTATTTATATTTTAGGTTTCCCAAATAAGAGAAATCATTCCATATTGAACCTTCTATGCCTGACTTATTTCACTTAATATGATGATCTCACGATTCATCCATTTTCCTACAAATGACTTGAATTTAGCCTTCTTTATGGCTGAATAATACTCCATTGCTTGAGCTGAGTAACCATAACACACAGAAGTGAGGGGTGAAGTTGGAGCCTCCTGGGAACACAGCTGGATTACGTCACAAGCCCAGAGTGGCCCTGCCTACTTCAAACCAGGCTCATGTTCTGCAGAGCGTCGCTGAACACTCCGAGCTGCTCCAGCATCCTGCCTCTGAGCCTTAGTCCTTGCTATTCGTGCCTCTGAGGGTGCTCGTCCTCCCTTCCTCAGCTAGCCCAAGTCTTCTGGCCTTTCCGCGCCCAGCTTAATTACACCGCTCCTCCACCA

XR_205154.1 Non-coding sequence

LOC101698575 PREDICTED: Heterocephalus glaber uncharacterized LOC101698575 (LOC101698575), misc_RNA.

Length: 297 bp     
>XR_205154.1
AGCTCGGGGCTGGGGCCCGACCCCGGACCCCGGACCCCGGACCCAGGACCCGCGCCGGGCCGGGGAGACGCTCTCACCGCGGAGAAGCGCCCGGGACGCTGGCCGCTCTCCGCCTCCTCCCTGGCAGACTGCGGCCACTGGAGCCCACGCGCGATCCCAATGTAGGCCGGCTTGCGGCCGGCACACACTGAGGAAAGAATTTGATGAGGGATTGCTGGCACGCAGTGCCCTCACAGAGACCAAGGTTCAAGCAGTTGGTAGAAGACTTTTTTTTTAATAAAAAAAGAATTTGATAAA

XR_205156.1 Non-coding sequence

Banp PREDICTED: Heterocephalus glaber BTG3 associated nuclear protein (Banp), transcript variant X5, misc_RNA.

Length: 1805 bp     
>XR_205156.1
CGTCACTCAGTCTCAAAGAGGAAGCATGTTCCTCCAACTGGCCCCGGACGCGACCGTTTTCGCTCTAGCAAGAAGCGGAGGCGTACGAAAGGGCTGTGAGAGCCTAGGGAGCTAATTCTCGGCGCGGGAGACGGAAGCCTGCGCATGCTCGTCGGAGTTCGCAGAAGAAAGCGCGCGCAGGAGGAGCCAAGCGCAGGCCCCGCCCCGGGCAAGGCGCCCCGCGTCCAGGGAGCCTGCGCAGAGGGCGGGGCTCGGAGCGTGGGGAGGTGCTCGCGGCGCCTGCGCAGAGCGGCGGCTTCTCTCGCGAGGACGGACGCCATTATCGCATCTCCTCGACAAACACCACGAGAATTCCGCAGCCCACACGGTGACAGCCACCCAGGCGCCCTGTGAATTGGATTCTTGCCCCTTGACTGGGCCCTCTTCTCGAATTCTGGATGATGTCAGAACAGGACCTGGCGGATGTGGTTCAGATCGCAGTGGAAGACCTGAGTCCTGACCACCCAGTTGTTTTGGAGAACCATGTGGTAACAGATGAAGACGAACCTGCTTTAAAGCGCCAGAGACTAGAAATCAATTGCCAGGATCCGTCCATAAAGTCTTTCCTGTACTCCATTAACCAGACGATATGCTTACGGTTGGATAGCATTGAGGCCAAGCTGCAGGCTCTGGAGGCGACGTGTAAGTCCCTGGAGGAGAAGCTGGACCTGGTCACCAACAAGCAGCACAGCCCCATCCAGGTCCCCATGGTGGCGGGCTCCCCGCTTGGCGCCACCCAGACCTGCAACAAAGTGCGATGCGTCGTCCCCCAGACTACAGTAATTCTCAACAATGATCGGCAGAACGCCATTGTAGCCAAGATGGAAGACCCCTTGAGCAACAGGGCACCGGATTCCCTGGAAAATATCATTAGCAATGCTGTGCCTGGACGTCGGCAGAACACCATTGTGGTGAAGGTGCCGGGTCAAGACGACAGCCACAACGAAGACGGGGAGAGCGGGTCGGAGGCCAGCGACTCGGTGTCCAACTGTGGCCAGCCCGGGAGCCAGAGCATCGGGAGTAACGTCACGCTCATCACCCTGAACTCGGAAGAGGATTACCCCAACGGCACCTGGCTTGGTGACGAGAACAACCCCGAGATGAGGGTGCGCTGTGCCATCATCCCCTCCGACATGCTGCACATCAGCACCAACTGCCGCACCGCTGAGAAGATGGCGCTCACGCTGCTGGACTACCTCTTCCACCGCGAGGTGCAGGCCGTGTCCAATCTGTCCGGCCAGGGCAAGCACGGGAAGAAGCAGCTTGATCCACTCACCATCTATGGCATCCGGTGTCACCTTTTCTATAAATTTGGAATCACGGAATCTGACTGGTACCGGATCAAACAGAGCATTGACTCCAAATGCCGGACAGCGTGGCGGCGAAAACAGCGAGGGCAGAGTCTGGCGGTCAAGAGCTTCTCCCGGAGGACGCCATCCTCGTCCTCTTACAGTGCCTCAGGGCCACCTCCACATAGCCCAGGTGCCGCAGGGGGAGCAGGTGCAGATCACGCAGGACAGCGAGGGCAATCTGCAGATCCACCACGTGGGCCAGGACGGGCAGGTGCTGCAGGGAGCCCAGCTCATCGCCGTGGCCTCTTCAGACCCTGCCTCGGCTGGCGTGGACGGGTCACCTCTCCAGGGCAGTGACATCCAGGTGCAGTATGTCCAGCTGGCGCCCGTGAGCGAGCACACAGCCACGGCACAGACGACTGAGAGCCTGCAGCCCGCCCTGCAGCCTGAGATGCAGCTGGAGCACGGGGCCAT

XR_205160.1 Non-coding sequence

LOC101723428 PREDICTED: Heterocephalus glaber uncharacterized LOC101723428 (LOC101723428), misc_RNA.

Length: 532 bp     
>XR_205160.1
GGAAGCGATCGGTGGGCCCTGCACCCCCGCGGGCCGCGCTGGGCTCGGAAGGGGAATCAATCACACGACTGCCGAGATGTGCCCTCGACTATCCGCTCTGCAGGCCTCGCCTCCCGGCTCTGACGATGTCCTCAAACCTTCTGGAAAGAGGGGACAGGCTCCCTGCCTCTCCTTTCTCCAGCCCTGGAGACAGAGCCCCTTGTAGGATCCCAGTTCTTACAGTCAGTGGATGGATGGATGGATGGATGGATTTACGGATTCCTACCAAAACCCTAAGAGTAGGATAGCACAAAACTGGAACTGATCACAGCCCACTTGAACAGGAAGATGAAGAGAAGGCTGCTGACGGCTTCTAGGTGTCTCTCTTGGGATAGAAGCCGATCAGAGCAGTTTAATGGACGGCCAGACGTGGGTTAGAGGGAGGCCAGGGTGGCTTGTAGCCTCCCAGTGGCAAAAAGGGAGCCAGGCCCCAAAGGAGGCCAGAAACCAAAAACCCAGGGCTTTCTGAACTGTTTCAGAAAGTGGGAAGAAT

XR_205161.1 Non-coding sequence

LOC101697579 PREDICTED: Heterocephalus glaber uncharacterized LOC101697579 (LOC101697579), misc_RNA.

Length: 2256 bp     
>XR_205161.1
CACCAGAATTAAATTCTACTTGTGAAAAATAGAAAGTTTGGAGATAAATCTAAAGACCTCTGAGGATGTTTAACTCAATCTTCAACCCCATAGACAGCCACAATTATTAGTATGACATGAGTTTTTTTAGTTCATTGTCCTAGAAAATAGTAATTGTCAGTTTGCAAGTGTATTTGTGTATGTCTATGAATGTTTACATAAATGGTATTATATTGTCAAATCAACACCGAACTTGATTTTTGTTTCCAGAGCTATGCCCAGGAGACTGTTCCATGAGGCACATAAAGAACCACGGATTTTCCAGTCCCCTGCAAAGTAGCTCATTGTGGCTCTGTAACTTGTACACCTTTTCTCCTGTGGGTGGACTGGATGCTTATATAAATTTTGACTTTTCATTTTATAAACAGTACTACAGGTAACATCCTGTTCCTGGCTTCTATATATGAGTGTTCAATGAAAGAGATATAGAAATATGCATGGGTTGAGTCATTAAGCATGCAAAAACTGACCCCTGCCCCAAGAAGCTGTATATACAGGTACCTTTCACCAGGTAGGTGTAGAGATAAGTTTTCCCACACCCTTGCCAACACATGACATCAGCAAACATTTCTCTACATTTCTCAGTGGGATGTGTGGGTCTCACATCTTAACTGCTCTTCCCCTGCATATCATTTTAAATGTACACCAGCCACTTATATTCCCTTGAACCTGGATTTAGGAGATGATTAGGGATATATCAGGAAGATATGTTTACCACTGAAGAGAAAGCAGTTGGGGTTAAAGTAGCAAGTGCCATCAGATGTTGAGCCTTTGGGGGATGTGTTGTGGATGAAATACTGGATACAGAGGGAGAGGAATGTGGATGAGGAAGGGGTAGAGCCAGCATTGTAGGAATCTGGACCACATAAAAGGGCTGGTCTTCCATCCTATTGCCAAGGAACATACATCTGGCATTTTTAGTTCCTAAGGTTTCAAAATGAAGTTTACATTTCAACCATATGTCTTTTTCCCTCTTACAGAATTCCGGCAGTGGCAGAGGATAGAGAAATCCAGGACCTATCTCAATGGTAAAACTGACAAGGCTTGGTGGCTCCTCAAATGTGAGCAAGAAGATGAGGATGTGTGCCACAGGTTTTGCACAACTCCTCAGAGCTTCTCTCCGCCTGTCTTCCAGCTCCATGCGAAAGCCCTGTGGAAAGTTGCTTCTCCTAGTGTGGCTCGTGAGTCAGCAGATAGCATTGCCTGAGAACGTGCTAAAAATGCAAGTTCTTAGCCCCACCCACACTCACTGAATCAGAATCTCTGCTGGTGGGTTGCTCTCCAGGTGATGGTTTTGCACATTCAGATTTGAGGATTGTGGATGCCCAAGATTGCATAAGGGAGGAGTCTGGATCCCTGAGTCACAGTTTGGAGGACAGCCACTCACGGGACCCAGCTGAACAGACCCTCTGGCATGGGATTTTATGGAAGGGAAAAGGTTCAGAACTGGCCAGGTGATGTTTTTATTGGGAGGAAAGCTTGGAGAATCAACAGGAGAAACAGAAAAGAACTTGCAGAACAACCCCTGGGCTACTGAGTTGAGAAATTGGAGGCTTACTTTCCCACGCTGTCAAATGGACTTCGGGATTGACACAGCCTTGGTGTGTCTGCTTATTAAATAATTGGGAGGATGGGGTAGTTTTGAGAGTTTTCTAATTTGAAAATTGGGCTTTGGGCAGGTTGTGGAGTCAGGCAATGTCTGGCCTGAAGCTCTCAAGGCTCGCAAGTGTGAATGAGCTTGTTCTGTGGCCCTGGCTTTCACCTTGGGAGGAGAACACAGGGAGGCTCCTCTGGAGAGGTCTTGGCTTCTGCAGGTGCCGTTCTTTTTAATTAGGGTGTGGGCTGATGAGGCCAGCTCCACCCAGAGGCATCGTGGGAAGGGGGTGAAACCCATCTGACATCAAACAAATGGCTTTGGGTGAGAGCATCTCCCAAATTCATAATTGTGGGGCTCATCGTGCCCAAAGGGAGCTTGAGAATTTAGGATGTGATTCAGAAAGATATTTCCGACCTTCGCCGGAAATGGGGAGAAATCAGTTTTATTTATTAATTCCATCTTGCCAGCTCCCAATTTGGTGCAAACAGTTATGTTTTGCAGCACGTTTCCACCTTGCAACTAGCAGAGTTAATTTAATGAAATGAGTAGTCTTGTGATGACCTAAAGGGGGAAAACACATTAATCTGGAAACTATCAAAGCCATCTGACATGTATTATTG

XR_205164.1 Non-coding sequence

LOC101698707 PREDICTED: Heterocephalus glaber uncharacterized LOC101698707 (LOC101698707), misc_RNA.

Length: 1315 bp     
>XR_205164.1
TCTAGATACATCATATCCTGGGATAATGAAAAGATTCGTGGAAACTCAAAAGATCAAGAAGCTCCTCTTAGGAAACGAAGGTGGGACCCAGCATTTTTGGGAATTGCAACCCATTGAATAGAAGAATTCAGGAGCTCTAGAATTTTTTCCTAGCAAGGAGCAAGTTGAAGATGGACTTACAGCCCTTTACTGAGTGCCCAGTGCTGGCTGCTAGATTTCCCAATTTCTGATGACCTGAATGGAGGGAGGAAATGTGGTTAAGGAGTTTAATCCCAACCCAGCCACTGACTGTGTGATTTGGACAGTTGGTTCTCACTGCCTGGCACCCTCATCTATAAACAGGGAGAATCAAATTTGTGAATGCAGATCGGGAGCTGTCATCAATGTCAAAGGAAGGGACAAGGATATCAAAGTATATGTAATCCCAGCTTCTCTTCTTCCTAGGAGGATTTTGTATTTCAGATTTTTTTGCTCAGAGTAAGATTGCAGAAAAAAGGAAATGAGACTACTACAGAAGAACATTATGGAGCCGAAGTTGTAGAAGAGATGAAGAGGAAGGCTAGTATTTGAAGGGACCAGAGCAGCAGAGAGGCTGAAAGCATGATGGGAGCTTTGGGGAGGACAGTAGAGAGCCTTTTAGGCAGTTTGCTTTGTGCTGTGTGAAATGATTTTCCCCTGGTTTCCTCTGCAAATGACTTCAGGAAAACACTGGCTCAAGGATCTTGAGGTCAGATGTACTATATGATGTCTTTGCATTGGGTATTAGCCTCAAAGCTCTGGCAATAAGGCCTACCTAAATTCAACAACCTTCTTATTTGCTAACAAAATCAATCTAAGCCTTGTAGATCTGTCTGGGGGTTACAGTTGTCCAAGATCAGCCCTTTCTCATTGTCCATCTCCTCAATTTATTTTTCAATTTTTAACAATAAATATGGACCACTTATAAAAGATTATTTGAAACATTTCCAGGCCAGGGTCAACCAGTTGCTCATCAGTGACAGGAGATGGAGCAAAGTTCTGAGGCAAGACGCACTTTACACACTGGGTCACACAGAAGAAATGGCTGGGGAAGATCTATGTCAAACCTGGATGTGTGGCCTTGCTGTAGATTGCTGGCAATGAATGTTGCCATGGTCTGCAAAGGCCTGCAGGGAGAGGAGTTTACAGGATCAGCTCAGAAAGATTGCTAGGCACAGGTGGGTTTTTTTTTTTTTTTTCAAAATCCCATCCAAAAGCATTTACTTTAATAAATATACTGAGATGAAATAATAATCATGTCACTGGTGCATAAGAAGGATAATAAGATATTAATATA

XR_205165.1 Non-coding sequence

LOC101700620 PREDICTED: Heterocephalus glaber uncharacterized LOC101700620 (LOC101700620), misc_RNA.

Length: 214 bp     
>XR_205165.1
GAAAAATATTAGCTGACAGGAAGGAGAAGTGATACTCTGAAAATCTATCAAGTTTTGACTATGTTTAAGTCACCCTGTGAAACAGATGTTGCTGTCATCCTCATGCTATTGACAAGCGAAGCTCAGAGAGGTTGAAGGATTATGGCTGGTTTATGTTCAAGTTCAATAATTCTCCCACCGTCTTCATTCTATCAAGTCATCCAGTGAATTCTTA

XR_205166.1 Non-coding sequence

LOC101719911 PREDICTED: Heterocephalus glaber uncharacterized LOC101719911 (LOC101719911), misc_RNA.

Length: 210 bp     
>XR_205166.1
GAGGACCATACGGACCTGCAAGATTCCTGTGCTACTAAGTTCGAATCCTAGCCCCGCCGGTGGACCACTGAGATCTGAGGCTTGGATCCGCAGGTGGCCACGGTGAACTCATCCTGGAAGCTGTTGAACAAAACATTCCAGCCTTGTACTTGGTGGCTGTATGAGTTGACTTCTCCTTGTTGGACAAAATATCTGACACCCACAACTTAA

XR_205167.1 Non-coding sequence

Fhod1 PREDICTED: Heterocephalus glaber formin homology 2 domain containing 1 (Fhod1), transcript variant X3, misc_RNA.

Length: 3389 bp     
>XR_205167.1
CGTCCGGTCCAGCCCGGCCCAAACAGCAGAGCCAGTCGAGGCGAAGCTGCCCCCTGGCAGGCACTGTGAGGCGCGCGGTGTGAGCCGGCGGCTGAGTCATGGCGGGCGGGGAAGACCGCGGGGACGGGGAGCCGGTATCAGTGGTGACCGTAAGGGTGCAGTACCTGGAAGACACCGACCCCTTTGCATGTGCCAACTTCCCGGAGCCCCGCCGGCCCCCGACCTGTAGCCTGGATGGAGGGCTGCCACTGAGTACGCAGATACCTGCGCTGCACCGCCTGTTGGGGGCGCCACTCAAGCTGGAGGACTGTGCCCTGCAAGTATCTCCCTCTGGATACTACGTGGATCTGGAATTGTCCTTGGAAGAGCAGCGGGAGATGCTGGAGAGCTTCTATGAAGAGATCAGCAAAGGGCGGAAGCCCACACTGATCCTGCGGACCCAGCTCTCCGTGAGGGTCAATGCTATCTTGGAAAAGTTGTATGGCTCCAGTGGTCCTGAGCTCCGGCGCTCCCTCTTCTCACTGAAGCAGATCTTCCAGGAAGACAAGGACTTGGTGCCTGAATTCGTCCACTCAGAGGGGCTGAACTGCCTGATTCGTGTGGGTGCTGCAGCTGATCACAACTACCAGAGCTACATTCTTCGAGCCCTGGGCCAGCTGATGCTTTTTGTGGACGGGATGCTGGGGGTAGTGGCCCACAATGAGACAGTACAGTGGCTGTATACACTGTGTGCGAGCCTGTCCCGCTTGGTGGTGAAGACCGCTCTGAAGCTGCTCCTGGTATTTGTGGAATACTCTGAGAGCAACGCACCACTTTTCATCCGGGCAGTGAACTCTGTGGCCAGCACCACAGGTACTCTCCCCTGGGCCAATATGATGTCCATCCTGGAGGAGAAGAATGGTGCTGACCCAGAGCTATTGGTGTACACTGTCACTCTCATCAACAAGACGCTGGGGGCACTCCCTGACCAGGACTCCTTCTACGACATGACAGATGCGCTGGAGCAGCAGGGCATGGAGGCACTGGTCCAGCGCCTCCTGGGCACTGCTGGCACTGACGTCGACCTGCGCACACAGCTTATGCTCTATGAGAGCGCCCTACGGTTGGAGGATGGAGACATGGAGGAAGCCACAGCTGCTGCAGCTGCAGGTGGCCGGCGGGAGCGAAGAAAGCCCTCTTCAGAGGAGGGCAAGAGGAGCCGCCGATCTCTGGAGGGTGGGGGCTACCTTGTGCGTGCCCCGGAACCTGGCCCCACAGGCCCCTCCTCAACGATAGGCCTCACCTCCTGTACTGACCTTGCCCCACCAAGTGCCGTCTCCAGCCCAGCGGGATTAGCCTCTGGCCCCTATACCTCGGTGAACCTCTTTCCTACCATTTCTGTGGCACCTTCCATTGACAGCTCCGGCGAAAGGAGCATCTACAAAGCCCGGTTTCTGGAGCATATGGCAGCAGCAGAAACAGAGAAGCAGGCTGCGCTGGCCCAGGGCCGGGCAGAGACACTGGCAAGGGCCACACCAGATGAGGCCGACGGACCCCCAGGCACCCAGGAACTGTGGGGCTCCCCAGAGCCAGCCCCTGCACCCAGAACACCCCAGAGCGCTGCTCCCCGAATCCTGCTTCGGGCCCAGGGGAGCCTTGAGCCAGAGACCAAGGAGCCACCAGCACCACTAAGCCCCAAGGATGAGCCCATCCAGGAGATCCCTGGACGGGTATCCAAGCTCTGCATTGGGGACCTGGACTTCTCAGATCTGGGGGAGGATGAAGACCAGGACATATTGAATGTGGAGTCAGTGGAGGCTGGAAAAGGGATCCCACTCCCACCACCTCTACTGCCTCTGCAATCTGGAGGCCCCCCACCTCCTCCACCCCCACTTCCCCCACCCATCAAAGGCCCCTGCCCACCACCTCCACCCCTGGCTGCCCCTCTTCCCCCCTCAGCACTTGATGGCCCACCCCTCCCCACCAAGAGGAAGACAGTAAAACTCTTCTGGCGGGAGCTGAAGCTAGCTGGGTGTCATACAGGCTCCAGAAGCCACTTTGGGCCCTCCCCGACCCTGTGGGCCTCCTTGGATCCTGTTTCAGTGGATACAGCAAGGCTGGAACACCTCTTTGAGTCACGAGCCAAAGATGTGCTACCTTCCAAGAAAACTGGTGAGGGCCGCCGGACAATGACCACAGTGCTGGACCCCAAGCGCAGCAATGCCATCAACATTGGCCTAACCACTTTGCCACCTGTGCATGTTATTAAGGCTGCCCTGCTCAACTTTGATGAATTTGCTGTCAGCAAGGATGGCATTGAGAAGCTACTGACCATGATGCCCACGGAGGAGGAGAAGCAGAAGATTGAGGAAGCCCAGCTAGCCAACCCTGATGTACCCCTGGGCCCAGCTGAGAATTTCCTGATGACTCTTGCCTCCACTGGGGGCCTGGCTTCCCGTTTACAACTCTGGGCCTTCAAGCTGGACTATGACAGCATGGAACGGGAAATTGCAGAGCCACTATTTGACCTAAAAGTGGGCATGGGACAGCTGGTGCAGAACACCACCTTCCGCTGCATCCTGGCTACACTGCTGGCTGTGGGCAACTTCCTCAATGGGTCCCAGAGCAGCGGCTTTGAGTTGAGCTACCTGGAGAAGGTGTCAGAGGTGAAAGACACAGTACGCCGGCAGTCACTGCTGTACCATCTCTGCTGTCTAGTACTCCAGACCCAGCCTGATTCCTCCGACCTCTACTCAGAGATTCCTGCCCTGACCCGCTGTGCCAAGGTGGACTTTGAGCAGCTGACTGAGAACCTGGGGCAGCTGGAACGCCGGAGCCGGACAGCTGAGGAAAGCCTTCGGAGCTTGGCCAAGCATGAGCTGGCCCCAGCCCTGCGTGCCCGCCTCACCCACTTCCTGGCCCAGTGTGCCCGTCGTGTTGCCATGCTCGAGGTAGTACACCGCCGTGTCTGCAACAGGTTCCATGCCTTCCTGCTCTACTTGGGCTACACTGCACAGACAGCCCGTGAAGTGCGTATCATGCAATTCTGCCACATTCTTCGGGAGTTTGCACTCGAGTATCGGACTTGTCGGGAACGGGTATTGCAGCAGCAGAAGAAGCGGGCCACCTACCGTGAACGTAACAAGACCCGGGGACGCATGATCACTGAGAGAAGTTCTCAGGTGTGGCTGGAGAAGTCCCCAACAACCCATCTGTTCCAGTGGCCGTGGGGAGTGGGCCAGGCCGGGGTGATGCTGACAGTCATGCCAGTATGAAGAGTCTGCTGACCAGCAGGCCAGAGGACACTACACATGTCCGCCGTAGCAGAGGTATGGTCCAGAGCAGCTCCCCAATCATGCCCACAGCAGTGGGGCCCTCCACTACACTTCCTGATGAACCTCCAGGCTCCA

XR_205170.1 Non-coding sequence

Ndrg4 PREDICTED: Heterocephalus glaber NDRG family member 4 (Ndrg4), transcript variant X6, misc_RNA.

Length: 3435 bp     
>XR_205170.1
AGCGCAATTGGTGGATTTTTTTAAACCGCCTTGGAGGGGGCGGCGAGCGCTTGGCTGCGGGCTGCTGGCTCCGCTTGCTCCGCTCACCCGCACTGCTCGACTCTCCGGGCCGCGCTCCCCGCCGCCGCCACGATGAGGGTGCTGGGACACAAGATCGAGCTGCTGACAGGGCTCCTACTGCACGACGTGACCATGGCCGGGCTGCAAGAGCTGCGATTCCCAGAGGAGAAGCCCCTGCTTCGCGGCCAGGATGTTACCGAGCTGGAGAACCCTGACACCTTCCTCTCCACTGTGGACACGGACTGGAAGGAACATGACATTGAGACGCCTTATGGGCTTCTCCACGTGGTGATCCGCGGCTCCCCCAAGGGCAACCGCCCAGCCATCTTCACCTACCATGACGTGGGCCTAAACCACAAGCTGTGTTTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACCAAGCACTTTGTGGTGTGCCACGTGGATGCCCCCGGACAGCAGGTGGGGGCGTCGCAGTTTCCTCAAGGGTACCAGTTCCCCTCCATGGAGCAGCTGGCTGCCATGCTCCCCAGCGTGGTACAGCACTTTGGGTTCAAGTACATTATTGGCATCGGAGTGGGAGCCGGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCTGACCTGGTGGAGGGGCTGGTGCTCATGAACATCGACCCCAATGGCAAAGGCTGGATTGACTGGGCTGCCACCAAGCTCTCTGGCCTGACCAGCACTTTGCCAGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTGGTGAACAACACGGAGCTGGTGCAGAGCTACCGGCAGCAGATCGGGAATGTGGTGAACCAGGCCAACCTGCAGCTCTTCTGGAACATGTACAACAGCCGAAGAGACCTGGACATTAACCGGCCTGGGACAGTGCCCAATGCCAAGACGCTCCGCTGCCCGGTGATGCTGGTGGTTGGGGACAACGCACCTGCTGAGGATGGGGTGGTGAGTGTGCGATGGGCATGGATGCTGGGGGATCCTGGCCAGCAAGGCCAACTCTTGATGCAGCCCAAGGTGGCCTCAGGGGCAATCACCAGATGGCGGGCTTCCCGTCCACTTCCCTGCCATCTGCCATCCTTCGGAGAGGGGCCTAAGAGGAAGGAGCTGGAGCCGCTGCCTGATGTGCCCCCTACTTCCCCACTAGTGCAGCCCCGAACCTGAGTCTCTACACACTTAGGGCCCAGAGCCTCAGATCTTTCTTCTAAAATTCAACTTGCATGAAATGGATTCATTCTTCCCCGTGCCCCCCACATACCCTGGGATGTTGGCACTGTATGTCAGCCCTCCTGTTGGCGCTCTGGCAGCAGGCAGCCTGGGGGTGGGTGTCCCTCAGGACCAGGAGTGCCCAGAAAATACTGTACCTTCCAGAGTCAGGCAGCACCAGGGGCATGGGCTGGCCCAGGTCTCCGGCTACACCTCACATTGCTGCCCGGCCCCTGTGGCCCCTGGAACTTTTGCAGACCCATCTGCGAATGGGGTCCCAGGGTTTCAGGCCCCTTAGGGGCTGCTAACTGACTTCCAGAGCCTTGCAGATCCCTGAAAGGAAGAAGCCAGGGAAGGCAGCCTCCTCTAGGCCCTAGGCCCGCACTTGCCCCCAGCACTGCCCCTTCCTCTGCTCTGAGCACAGACATGGCCTTAGCCTTGGGGGCAGGGGTGTTGCTGAGACTGGCTCCTTGTCTCCAGGTTGAATGCAACTCCAAAATGGACCCAACCTCCACGACCTTCCTGAAGGTGAGCTTGGCCGCAGGGAGCAGGAGCACACAGTACGTCTGGCTGACAGAGCCTGTCCAGGGTGGGGGATCTGCTCACTCACCTCATTCTCTCCTTTGTAGATGGCAGATTCCGGGGGACTCCCTCAGGTCACACAGCCGGGGAAGCTGACCGAGGCCTTCAAATACTTCCTGCAAGGCATGGGCTACAGTGAGTACTCCCTACTCGCCCTGGCCTGGAAGCTGGTGGGTGGGCCCTAGGGCTGGCAGGGCTGGCACAGTGTCTGGCGCTGAGGACCTGTGGGTGTATGAGCACTGTGTTACCTGGGCCCCTCGCCCGACTGCACGGGGTTGTCCCAGGCCAGGCCCAGCTCTCCCATGCCCATGTGGAGGCCTCAGGGCACTGTTCTGAGGGCAGGGCTGGGCCTGTTGGGAAGAATCTTCTCCCAAACCCAGGGGTCCAGGGCCTGGGCTGGGTCCTGCCAGGGAGCATGATAAGGCGAGCCACCCACTCTGCAGGGACTATTGGTGCAGCTGGGCCCAGGGACCCTAAGAGACTCTTTGTCACAGGTGGTGGGTGACATCTAGGGGCATCATAGGTGTAAGCTTGAGGTGTGGGGACCAGAAAAAGCAAGTGAGACTATATGGTGTTAGGAGAGCCAGCCACAGGCAGCAGAATGTAAGGGAGGCAAACCTGAAGCCCTGAGGACATGAGCCCTGGGGTGGGACCTGCTCCCTGTCCTCCACTCCCCAAGTTCCCCCTTGGTAGGGATGGTGAGACCCCAGGGTCTGTCCTTCAGTCCCCCAACAAATAGCTCTGGTGGCTCCTGTGTACCCCCTTGGCCCCTGGTCCCCTCCCAACACACTGCTGCTTCTCCAGTTCCTCTATTGCTGGGAAGCAAACTTCCTGTTCGTGAATGTTTTTCCCCTCAGTCTCCTTGGGAGGAAGGTGTGCGGAGCTGGGGAACACAGCAGGAAAGGAGCTCCTCCAGCCCAGGGGCCTGCCAGCCTCTGCACCAGGTGTAGGGCAGAGGGGCCCAGGCTGGCAGGGTGGCCTGGCAGGCTCTCCAGCCAGGCCCTGCACTCACAAGAATTTGTGAACATTTGTGAAATGACAGATAAGCAGAACTTGCCAGGTGCTGGGGTACATTCTCAGGGCCCTGGGGGAGATGCACCAGGTAGCCCCGTAGTTAGGAGGGATTCTGCGTTTGGGAGACTGAGGCCCTGCAGAATCCTGAGGACCCAAGAGGCCCAAGAGGGCCTGCTGACATGAGCCTGGGTTGTGGACGGCAGGTGAGATGAGAGCCCCCATCCTGCTGGCAGGGCTCCCTGGGTCATAGTGAGATCAGTCCCTCCAGAGGGTCCTTGGGTGGGTGGGCAGGCGTGGGCTCCTGAGGCTCGGCCCTACCAGGCCCTCTCTCTGCTTGTCCACTCATCTCTGGCCCATCTCAATGTCCCTGCCTCACCTGGCCAAGATCTTCACTGTGTTCTGTGTCTCCCTGCCCCCGCCACTCTGGCTCTGTCTTCTCTCTCAGTTGCATACTTGAAGGACCGAAGGCTGAGTGGAGGAGCAGTGCCCTCTGCCAGCATGACCCGCCTGGCACGCTCCCGCACCGCATCTCTTACCAGTGCCAGCTCTGTGGATGGCAGCCGC

XR_205171.1 Non-coding sequence

Kifc3 PREDICTED: Heterocephalus glaber kinesin family member C3 (Kifc3), transcript variant X4, misc_RNA.

Length: 3876 bp     
>XR_205171.1
CCGGGCCAAGCCCCGGGCGAGCCCCCGGTGCTGCAGCGACGCGCGGATCCTTCCTGCGCCAGGCCGGCTGCCCCGGAGAAGGCTGCTAAGCCCCAGGCCATGGTCCCCTCTCCCCGGACCCGGAACCTGGGAGCCACGCCCTCACTGCCCGGCCCGCGGAGAGTGGGCCGGGCCGGGGAGCCGCCAGAGCCCAAGATGGCTCGCCCCGCCCCAGCCCCAGCCAGCCCGGCTGCCCGCCCTTTCTCACACACCGGCTCGGGGAGGTTGAGAACTGGGCGTGGAAAAGACACAGTGGTTGGCAGTGACGAGGACTCCAGTGCCCGAATTGCAGCTCGCCCGGCCCTAGGACAGTGCCGAACCCTCAGCGGGGACTGGGCAGGCCCTGGGAGTCCCCGCAGGCTCTACCTGACCGTGCGGCAAGCCCTGCAGGACAAGGGGTGCAAGAGCAAGAGTCAGGGGACGAAAGAAGACAATCTCCCGAAGAGGCAGGCGCTGGTCCCCAGGCGGGACCGAGAGGCCCTGAAAGCTGGTGCTGCCACGAATGTAGAGAAAACAGGTGGGCGGCTCTTTGGCAAAGGGAGGTGCTCGAGCCTGCCAGGGTCGCCAGGGGCGGCCCCTGAGGTGCATAGGATGGTGGAGGCCATGTCCCAGCTTCAGAAGGAGAAAGCTCAGCTTCAGGAGGAGCTGGCAGTCCTACGGGAGAGGCTGGCCCTCCACGACAGTGACCAGCAAACCACAACCACCCAGCTGCAAAACCAGGTGGAAAATCTCAAGGAGAAGCTCGTCAGCCAGGCCCAGGAAGTGACCCGCCTGCGATCCGAGCTGGGAGGCACTGAATTGGAGAAGCAGCGCCGGGACCCACTGATGGTGGAGAATGAGCGGCTGAGGCAGGAGCTAGGGCGCTACGAGGCTGAGCTGCAGGAGCTGTGTGCCCAGCCGGCAGCCACACCCTGCTTGGGCTGCAAGCACAGCCAGGAGAGCACCCAGCTCCGCCACAAGGTATCCCAGTTGCAGCTGGAGGTGGCGGAGAACAAGGGCATGCTGTCGGAGCTGAACCTGGAGGTGCAGCAGAAGACCGACCGGCTAGCTGAGGTGGAGCTGCGGCTCAAAGACTGCCTGGCTGAGAAGGCACAGGAGGAAGAGCGGCTCAGCCGACGCCTGCGAGACAGCCATGAGACCATTGCCAGCCTGCAGGCCCAGTCTCCACCTGTCAAGTATGTCACCAAGACAGTGGAGGTGGAGTCGTCCAAGACCAAGCAGGCTCTCAGTGAGTCCCAGGCCCAGAACCAGCACCTGCAGGAGCAGGTGGCCATGCAGCGGCAGGTGCTGAAGGAGATGGAGCAGCAGCTTCACAGCTCAAATCAGCTGACCACGCAGCTCCGGGCACAGATCTCCATGTATGAGACAGAGCTGGAGCGGGCCCATGGGCAGATGCTGGAGGAGATGCAGTCCATGGAGGAGGACAAGAACCGGGCCATTGAGGAGGCCTTTGCCAGAGCCCAGGTGGAGATGAAGGCTGTTCATGAGAACCTGGCAGGTGTCCGGACAAACCTACTGATGTTGCAGCCAGCACTGCGGACCCTCACCAATGACTACAATGGGCTTAAGCGGCAGGTGCGCAACTTCCCAATGCTGCTGGATGAGGCCCTCCAGAGCGCCAAGGCTGAGATTGACCAGATCATTGAGGAGGTCAACAGCAACAACCATGACCTGCTTCGCAAGTACCGCCGGGAGCTGCAGCTGCGCAAGAAGTGCCACAACGAGCTTGTGCGGCTGAAAGGAAACATCCGGGTGATTGCTCGTGTTCGGCCCATCACCAAAGAGGACGGGGAAGGACCCGATGCGACCAATGTTGTGTCCTTTGATCCCGATGATGACGCTATCATTCACCTACTGCACAAGGGCAAGCCAGTGTCCTTTGAGCTGGATAAGGTCTTCTCCCCGCAGGCCTCACAGCAGGACGTATTTCAGGAGGTGCAGGCCTTGATCACTTCCTGCATCGATGGCTTCAATGTCTGCATCTTTGCCTATGGCCAGACGGGTGCCGGCAAGACATACACGATGGAGGGAACCCCCGAGAACCCAGGCATCAACCAACGGGCCCTGCAGCTGCTCTTCTCAGAGGTTCGGGAAAAGGCATCCGACTGGGAGTATACCATCACCGTCAGCGCTGCTGAGATCTATAATGAGATCCTCAGGGACCTGCTGGGGACAGAGCCTCAGGAGAAGCTGGAGATTCGGCTGTGCCCAGACGGCAGTGGGCAACTGTATGTGCCAGGGCTGACCCGGTTCCGGGTGCAGAGCGTGGCTGACATCAACAAGGTGTTTGAGTTCGGCTATGCGAATCGCACCACGGAGTTCACCAACTTGAACGAGCACAGTTCCCGCTCTCATGCCCTGCTCATCGTGACTGTTCAGGGCCGGGATTGCAGCACAGGCATCCGCACCATGGGGAAGCTGAACCTGGTGGATTTGGCTGGCTCAGAGCGTGTGGGCAAGTCAGGTGCTGAGGGCAGCCGTCTGCGGGAGGCACAGCACATCAACAAGTCACTGTCGGCCCTGGGGGACGTCATTGCTGCCCTGCGCTCTCGCCAGGGCCATGTGCCCTTCCGCAACTCCAAGCTCACCTACCTGCTGCAGGACTCGCTGAGTGGCGACAGCAAGACACTTATGGTGGTGCAGGTGTCTCCTGTGGAGAAGAACACCAGCGAGACGCTCTACTCCCTCAGGTTCGCTGAGAGGGTGCGCTCCGTGGAGCTGGGTCCCGGGTCCCGCCGCACAGAGCTCGGGTCCTGGTCGAGCCAGGAGCATCTGGAGTTGGAGCCAACTTGCCAGACACCACAGCCAACAGCTCGAGCGCACTCAGCCCCTGGCTCTGGGACCTCCAGCCGTCCTGGCTCTATCCGGAGGAAGCTGCAGCCGTCAGATGGGAAAACCAGGCCCCAGGAGAGAAGGCGCCAGGTCAAGATCCTTGGAGGCAGGCCATCCTGGCTCTCGCACAACACCTCCAAGGCAGGCGGCCTCTTTGCCCTGGGCCTTGATGTTGGTATTCTTGTGGGATGAGGGGCAGAAAGCTCAGGGCTCACTTCACGTGAGGAGTGAGCTTCCCTCATGCAAGGGCCTGGCCAGTCCTTAAGTCCAGAGGGTTGGGGGTGGCAGGGCCCTAGCAGGAGAGGACAAGCCCACCAGTGAGACACCTGTCACTTTGATTTCAGCCTGACGGCTGGGGCTGCAGTCTCCAGGGAAAATGAGACCGGTGCCTGTGTAAGGACAAGGATGTGCCACCCTACTGGGCCTGGAGTCGGCCTGCTCCTGCTGCAGCATCAGGGATGGAAGTGGAGGCCCTCCTGTTCTGCAGCAGAGATGAGAGACTCAGAAGGAAGTGCTGTCTTGGCTGTTGCTCTGGGTCCAAGTGGCATAGCAGGAATGGCCTATTCTGCCTGGCAGGCTCTGGGCATCAGAGCTGGTCCTCATGGGTAGGGCAGGCCTCTTGCTGGGCTGGCCCAGCTCCTTTCCTGAGCCAGAGGGCCGGCCCGGCAGCCCCCTTCTAGTGCATGGCCCAAGAGGCCTCTGGGAAGGCACAGGGGCTCCACGGTACAGGTCTGATTTAGTGGGCATCGAGGGGCATCCCACAGGGGTGTGTACAGTGGTACAGTGTACTCATAGATGTACAAAGGAGCCCGGCCACCTGCCATGGCCGGGCTATATTTATGGCTGGCAGAAAAGGCCAGTGGGCAAGGTTCTTTCCCCTCACCTGCCTGGCACCAGGTATTCTCCTTGCTCACTGGCTTCCTGACATTTTCCTCCCTCTGAAATCCTATTTAAGAACTTTTGGAATTTAGCCATTTTTATTAAAATAAAAACCTTTTTACACAA

XR_205173.1 Non-coding sequence

Kifc3 PREDICTED: Heterocephalus glaber kinesin family member C3 (Kifc3), transcript variant X6, misc_RNA.

Length: 3721 bp     
>XR_205173.1
GTTCAGGGAGCAGGGAGAGTCGACCACGTTCTCGCTGACCCTGCCGGGTTGGGGTTCTGCGGTCTGCCCGGCACACATCTGGGGGCTCTCTCTGGTGCCCGCCCACGGCTGTAAACAAGGGCGTGGAAAAGACACAGTGGTTGGCAGTGACGAGGACTCCAGTGCCCGAATTGCAGCTCGCCCGGCCCTAGGACAGTGCCGAACCCTCAGCGGGGACTGGGCAGGCCCTGGGAGTCCCCGCAGGCTCTACCTGACCGTGCGGCAAGCCCTGCAGGACAAGGGGTGCAAGAGCAAGAGTCAGGGGACGAAAGAAGACAATCTCCCGAAGAGGCAGGCGCTGGTCCCCAGGCGGGACCGAGAGGCCCTGAAAGCTGGTGCTGCCACGAATGTAGAGAAAACAGGTGGGCGGCTCTTTGGCAAAGGGAGGTGCTCGAGCCTGCCAGGGTCGCCAGGGGCGGCCCCTGAGGTGCATAGGATGGTGGAGGCCATGTCCCAGCTTCAGAAGGAGAAAGCTCAGCTTCAGGAGGAGCTGGCAGTCCTACGGGAGAGGCTGGCCCTCCACGACAGTGACCAGCAAACCACAACCACCCAGCTGCAAAACCAGGTGGAAAATCTCAAGGAGAAGCTCGTCAGCCAGGCCCAGGAAGTGACCCGCCTGCGATCCGAGCTGGGAGGCACTGAATTGGAGAAGCAGCGCCGGGACCCACTGATGGTGGAGAATGAGCGGCTGAGGCAGGAGCTAGGGCGCTACGAGGCTGAGCTGCAGGAGCTGTGTGCCCAGCCGGCAGCCACACCCTGCTTGGGCTGCAAGCACAGCCAGGAGAGCACCCAGCTCCGCCACAAGGTATCCCAGTTGCAGCTGGAGGTGGCGGAGAACAAGGGCATGCTGTCGGAGCTGAACCTGGAGGTGCAGCAGAAGACCGACCGGCTAGCTGAGGTGGAGCTGCGGCTCAAAGACTGCCTGGCTGAGAAGGCACAGGAGGAAGAGCGGCTCAGCCGACGCCTGCGAGACAGCCATGAGACCATTGCCAGCCTGCAGGCCCAGTCTCCACCTGTCAAGTATGTCACCAAGACAGTGGAGGTGGAGTCGTCCAAGACCAAGCAGGCTCTCAGTGAGTCCCAGGCCCAGAACCAGCACCTGCAGGAGCAGGTGGCCATGCAGCGGCAGGTGCTGAAGGAGATGGAGCAGCAGCTTCACAGCTCAAATCAGCTGACCACGCAGCTCCGGGCACAGATCTCCATGTATGAGACAGAGCTGGAGCGGGCCCATGGGCAGATGCTGGAGGAGATGCAGTCCATGGAGGAGGACAAGAACCGGGCCATTGAGGAGGCCTTTGCCAGAGCCCAGGTGGAGATGAAGGCTGTTCATGAGAACCTGGCAGGTGTCCGGACAAACCTACTGATGTTGCAGCCAGCACTGCGGACCCTCACCAATGACTACAATGGGCTTAAGCGGCAGGTGCGCAACTTCCCAATGCTGCTGGATGAGGCCCTCCAGAGCGCCAAGGCTGAGATTGACCAGATCATTGAGGAGGTCAACAGCAACAACCATGACCTGCTTCGCAAGTACCGCCGGGAGCTGCAGCTGCGCAAGAAGTGCCACAACGAGCTTGTGCGGCTGAAAGGAAACATCCGGGTGATTGCTCGTGTTCGGCCCATCACCAAAGAGGACGGGGAAGGACCCGATGCGACCAATGTTGTGTCCTTTGATCCCGATGATGACGCTATCATTCACCTACTGCACAAGGGCAAGCCAGTGTCCTTTGAGCTGGATAAGGTCTTCTCCCCGCAGGCCTCACAGCAGGACGTATTTCAGGAGGTGCAGGCCTTGATCACTTCCTGCATCGATGGCTTCAATGTCTGCATCTTTGCCTATGGCCAGACGGGTGCCGGCAAGACATACACGATGGAGGGAACCCCCGAGAACCCAGGCATCAACCAACGGGCCCTGCAGCTGCTCTTCTCAGAGGTTCGGGAAAAGGCATCCGACTGGGAGTATACCATCACCGTCAGCGCTGCTGAGATCTATAATGAGATCCTCAGGGACCTGCTGGGGACAGAGCCTCAGGAGAAGCTGGAGATTCGGCTGTGCCCAGACGGCAGTGGGCAACTGTATGTGCCAGGGCTGACCCGGTTCCGGGTGCAGAGCGTGGCTGACATCAACAAGGTGTTTGAGTTCGGCTATGCGAATCGCACCACGGAGTTCACCAACTTGAACGAGCACAGTTCCCGCTCTCATGCCCTGCTCATCGTGACTGTTCAGGGCCGGGATTGCAGCACAGGCATCCGCACCATGGGGAAGCTGAACCTGGTGGATTTGGCTGGCTCAGAGCGTGTGGGCAAGTCAGGTGCTGAGGGCAGCCGTCTGCGGGAGGCACAGCACATCAACAAGTCACTGTCGGCCCTGGGGGACGTCATTGCTGCCCTGCGCTCTCGCCAGGGCCATGTGCCCTTCCGCAACTCCAAGCTCACCTACCTGCTGCAGGACTCGCTGAGTGGCGACAGCAAGACACTTATGGTGGTGCAGGTGTCTCCTGTGGAGAAGAACACCAGCGAGACGCTCTACTCCCTCAGGTTCGCTGAGAGGGTGCGCTCCGTGGAGCTGGGTCCCGGGTCCCGCCGCACAGAGCTCGGGTCCTGGTCGAGCCAGGAGCATCTGGAGTTGGAGCCAACTTGCCAGACACCACAGCCAACAGCTCGAGCGCACTCAGCCCCTGGCTCTGGGACCTCCAGCCGTCCTGGCTCTATCCGGAGGAAGCTGCAGCCGTCAGATGGGAAAACCAGGCCCCAGGAGAGAAGGCGCCAGGTCAAGATCCTTGGAGGCAGGCCATCCTGGCTCTCGCACAACACCTCCAAGGCAGGCGGCCTCTTTGCCCTGGGCCTTGATGTTGGTATTCTTGTGGGATGAGGGGCAGAAAGCTCAGGGCTCACTTCACGTGAGGAGTGAGCTTCCCTCATGCAAGGGCCTGGCCAGTCCTTAAGTCCAGAGGGTTGGGGGTGGCAGGGCCCTAGCAGGAGAGGACAAGCCCACCAGTGAGACACCTGTCACTTTGATTTCAGCCTGACGGCTGGGGCTGCAGTCTCCAGGGAAAATGAGACCGGTGCCTGTGTAAGGACAAGGATGTGCCACCCTACTGGGCCTGGAGTCGGCCTGCTCCTGCTGCAGCATCAGGGATGGAAGTGGAGGCCCTCCTGTTCTGCAGCAGAGATGAGAGACTCAGAAGGAAGTGCTGTCTTGGCTGTTGCTCTGGGTCCAAGTGGCATAGCAGGAATGGCCTATTCTGCCTGGCAGGCTCTGGGCATCAGAGCTGGTCCTCATGGGTAGGGCAGGCCTCTTGCTGGGCTGGCCCAGCTCCTTTCCTGAGCCAGAGGGCCGGCCCGGCAGCCCCCTTCTAGTGCATGGCCCAAGAGGCCTCTGGGAAGGCACAGGGGCTCCACGGTACAGGTCTGATTTAGTGGGCATCGAGGGGCATCCCACAGGGGTGTGTACAGTGGTACAGTGTACTCATAGATGTACAAAGGAGCCCGGCCACCTGCCATGGCCGGGCTATATTTATGGCTGGCAGAAAAGGCCAGTGGGCAAGGTTCTTTCCCCTCACCTGCCTGGCACCAGGTATTCTCCTTGCTCACTGGCTTCCTGACATTTTCCTCCCTCTGAAATCCTATTTAAGAACTTTTGGAATTTAGCCATTTTTATTAAAATAAAAACCTTTTTACACAA

XM_004842834.1 Coding sequence

Tmem231 transmembrane protein 231

High confidence: 3 potential gene matches
Length: 951 bp    Location: 11411123..11429132   Strand: +
>XM_004842834.1
ATGGCGCTCTACGAGCTCTTCTCCCACCCGGCCGAGCGCGGCTACCGTGCGGGGCTCTGCTCCAAGGCCGCGCTGTTCCTGCTGCTGGCCGCCGTGCTCACCTACATCCCGCCGCTGCTGGTGGCCTTCCGGAGCCACGGGTTCTGGCTGAAGCGCAGCAGCTACGAGGAACAGCCGACCGTGCGCTTCCTGCACCAGGTCCTGCTCGTGGCCCTGCTGCAACCCGAGCAGGGTGGGTTCCTCTCCTGGAGCACGTTCCCCGCCTTCAATCGGCTACAGGGAGGCCGGCTGCGCGTCCCGCTCGTCTCGACTAGAGAAGAAGACAGGAATGGAGATGGGAAGATGGACATGTTGCATTTTAAACTGGAGCTTCCCCTGCAGTCCACAGAGCACGTCCTCGGTGTGCAGCTCATCCTGACCTTCTCATACCAGCTGCACAGGATGTCGACATTCGTGATGCAGAGCATGGCCTTTCTCCAGTCTTCCTGCGTGGTGCCGGGGGCCCAGCTGTACGTGAACGGAGACCTGAGGCTGCAGCAGAGGCAGCCGCTGAGCTACAGCGGCCTGGATGTCCGATACAATGTGTCTGTGATCAACGGGACCAGCCCTTTTGCCTACGACTACGACCTCACCCGCATTGTGGCTGCCTACCAGGAAAGGAACGTCACCACCGTCCTGAACAACCCCAACCCCATCTGGTTGGTGGGCAGGGCCTCGGAAGCTCCCTTTGTGATTAATGCTGTCATCCGATACCCTGAGGAAGTCATCTCTTACCAGCCAGGATTCTGGGAGATGATCAAGTTCGCCTGGGTTCAGTACGTCAGCATCCTGCTCGTCTTCGTCTGGATGTTTGAAAGAATCAAAATATTCGTGTTTCAGAATCAAGTGGTGACCACCATCCCTGTGACAACTATGTCAAAGGGAGACTTGTATAAGGAGCACTTATCCTGA

XM_004843140.1 Coding sequence

Tepp testis, prostate and placenta expressed

High confidence: 4 potential gene matches
Length: 585 bp    Location: 28192360..28188296   Strand: -
>XM_004843140.1
ATGGCTCGCATCATTGACCTGGTGCCCTGGGATGATGGCTCCACCCACATGCACGCATCCTCAGCCATCTTGCTCCCTATGGAGCGACAGCGCAATCAGCTGGCCGGTGTGAAGCAGCAGCTCTACCACCCAGCCCTGCCCACCCTGCGCCGGATGGACATGGACACCAGCAAGGCCTGCCTCTCAGATGAGCACTGCCAGTCCACCACTTACTGCCGCAAAGATGAGTTTGACAATGCCCACTTCACACTCCTGGGGGTCCCCAACAAACCCCTGCAGTGCTTGGACATCACGGCGACCGGCCAGAAGCTCCACCGCAGGTACCGCGAGGGGAAGCTAGCGCCAATCGCGCCAGGCATCAACTGGATGGACTGGCCCTGCTTCACACGCGCCATCGAGGACTGGTCCCGCTTCGTGTCCTCTGCTGGGGAGTTCAAGCTGCCTTGCCCGGGCAAGAGGGTCGAGAGTTTCAGCGGCTACGCGGTGCGGTACTTGAAGCCAGATGTGACCCAGAACTGGCGGTACTGCCTCAACCAGAACCCCAGCCTAGACCGCTATGGACAGAAGCCCCTGCCTTTTCTCTGA

XM_004843235.1 Coding sequence

Kctd19 potassium channel tetramerisation domain containing 19

High confidence: 4 potential gene matches
Length: 2904 bp    Location: 19005073..19036994   Strand: +
>XM_004843235.1
ATGAAGACAGACCTGTACGGGAACTCCAAAACCACTAAAATGGCATGGCGTGGCGTGGCGTGGCGTGGCGTGGCGTGGCGTGGCGGGGACGGGGGCGAGGCTGGAGCCCAGGATTACCATGGCAGGGAGGAGGCTGGCATACCCTATGAATCAGCAGAGGATTTGTTTCATTTCAATGTTGGGGGCTGGCATTTCTCAGTTCCCAGAAGCAAACTTGCTCAGTTCCCAGACTCCCTGCTATGGAAAGAGGCTTTAGCATTGACCTCTTCAGAAAACCAGAGGTTGTTCATAGACAGAGATGGCTCCACATTTAGGCACGTGCACTATTATCTCTACACCTCTAAGCTCTCCTTCTCCAGTTGTGCAGAACTGAACTTGCTGTATGAGCAAGCACTGGGTTTGCAGCTGATGCCTTTGTTGCAGACTCTAGATAATCTGAAGGAAGGGAAACACCACCTCCGTGTGAGGCCTGCAGACATACCTGTTGCTGAGAGAGCATCTTTGAACTACTGGCGAACATGGAAGTGTATCAGCAAACCCTCTGAGTTCCCGATAAAAAGCCCAGCCTTCACAGGCCTACATGATAAGGCACCTTTGGGGCTCATGGACACACCACTGTTAGACACAGAAGAGGAAGTGCACTACTGCTTCCTGCCTATAGACCTGATAGCCAAATATCCAAGCCTGGTGACTGAGGACAACCTGCTGTGGCTGGCTGAGACTGTGGTCCTGATCGAGTGCGAGTGCAGCGAGTTCCGTTTCATTGTAAATTTTCTTCGCTCACACAAGATTTTACTTCCGGATAATTTCTCCAACATAGATGTGTTAGAAGCGGAAGTGGAAAATTTGGAAATCCCTGAGCTCACAGAAGCCATACGATTGTGCCGGATGAACATGGGTGGTTGTTCCCGAACTTCCTGTCCTCCCCCAAGCCTTGGAAAGAGGGGGCGTGGAGCTGGCCTAGAGTCTGTGAAGCCTCTTTACATGATGGCCCTGGGTCTTCTGGTCAAGTACCCAGACTCCGCACTGGGACAGCTCCACATTGAGAGCACGTTGGATGGAAGCAGACTATACATCATGGGGAACGGGGTCCTTTTCCAGCATGTCAAGAACTGGTTGGGCACTTGCCGTCTGCCGCTGACAGAGACCCTTTCCGAGGTGTATGAGCTTTGTTCCTTCCTGGACAAGAGGGACATCACCTATGAGCCAGTGAAAGTGGCTCTGAAGACTCATCTGGAGCCGAGGATTGTGTCATCGGTGGATGTGCTCAATGAATGGACAGCAGAGGTCACTGTGTATTCCCCCCAACAGATCATCAAGGTTTATGTTGGAAGTCACTGGTACACAACCACCCTGCAGACTCTGCTAAAGTATCCAGAACTGCTGTCCAACCCTCAGAGAGTGTACTGGATCACATACGGACAGACCCTGCTCATCCATGGGGATGGCCAAATGTTCCGACATATTCTCAACTTCCTGAGACTTGGAAAACTGTTCTTACCATCTGAATTTAAGGAATGGCCTCTTTTCTGCCAGGAAGTGGAAGAATACCACATTCCATCCCTCTCAGAAGCCCTTGCACAATGTGAGGCATACAAAGCATGGACCCAAGAGAAAGAATCTGAAAATGAAGAAGCTTTTCCCATCAGGAAGCTGCATGTAGTGACAGAAGGGCCACGGTCATTGGTGGAGTTCAGTAGAGATGCTAAGGAAACTACAGCCTGCATGCCTGTGGACTTCCAAGATTGCAATGACAAGAATCCATGGAACAAGACCAAGGGGAACCTGGCCAGATCTAGCCAATTAAAAGAGGCTGAACAGCACCCCCGAGCCATCCAGGTCTCCCTATGCCGAAATGCCAAGAAGGCAGACAATTCCAGCACATACTCACAGTGCTCTGGCTTGTGTGGCAACCCCAGACACTGGGGGGCCCACTCTGAGAGTCCTCCCAAAAAGAAGTGCCCCACAATCAACCTCACACAGAAACTTGAAACCAAAGACCCTCCTGTCACCCCCATGCAAAAACTCATCTCCCTGGTAAGGGAATGGGACATGGTCAATTGCAAACAGTGGGAATTCCAGCCCCTGACAGCCCCCCACAACAGCCCCTTAGAGGAGGTTGCCCCACATCCCTCTTCCGGAAATGAGGCTGCTTCTGAGCCCAGTACCTCAGCTGCCTGGAAAAGCCATTCCATAGTCTCAGAGAAGGGCCCAAGTCCACAGGCAGGGGCTGGAACAGCAGCACAAGACAAGGGGCCAGAGCCAACCTTTAAGTCATACTTCTCCACAAAAAGAGCTGTAGCCTTGAAGGACTGGGGCAAGCAGAGGCCAAAGGAGAGAGAAAGCCCTGCTCCTGAACAGCCTCTGCTTAATGCCAGTGGAATGAACAACCCAGGAGTCATTCTCAAAGTGACTCACCCTCCTGTGGTGGGTAGTGATGGCTCCTGCATGTTCTTTGAGGACAGCATCATCTACACCACACAGATGGATAACCTCAGACACATGTCATTGACATCCAGCCCCCAGCCCCAAGAAGTGACTTTCCTGAGTTTCTCTCTATCCTGGGAAGAGATGTTCTATGCGCAGAAATGTCACCGCTTCCTGACTGATGTCATCCTGGATTCCATCAGGCAAAAGGACCCCAAAGCCATCACAGCCAAAGTGGTCTCATTGGCCAGTGGGCTGTGGACACTACACATCAGCCCCAAGCAGTTTGTGGTGGATTTGCTGGCTATCACTGGCTTCAAGGATGACCGGCACACCCAGGAGCGCCTGTACAGCTGGGTGGAGCTCACACTGCCTTTCGCCAGGAAATATGCCCGCTGTGTGGACCTGCTCATCCAGAGAGGCCTGTCTAGGTCTGTCTCTTACTCTGTCCTGGGCAAGTACTTACAAGAGGGATAG

XM_004843199.1 Coding sequence

Slc12a3 solute carrier family 12 (sodium/chloride transporters), member 3, transcript variant X10

High confidence: 4 potential gene matches
Length: 3015 bp    Location: 29132800..29097504   Strand: -
>XM_004843199.1
ATGGCAGAGCTGCCCACAGCGGAGATGCCCAGGGACCCTGCCCTGTGCAGCGGGCGCTTCACCATCAGCACACTCCTTGGGGGTGACGAGTCCCTGCCAACAGCGGCCTATGACACCAGCCACCCCAACCACCTGACCCACGGCAGCACCCTCTACATGCGCACCTTCGGGTACAACACCATCGACGTGGTGCCGGCCTACGAGCACTATGCCGACAGTGCCCTGCCCGGCGAGCCTCGGAAGATCCGGCCCACGCTGGCTGACCTGCACTCCTTCCTCAAGCAGGAAGGGAGCCACCTGCACGCCCTGGCCTTTGACAGCCAGCCCAGCCACGAGCTGACCGATGGGCTGGTGGAGGATGAGGCGGGCACCCATGGTGAGACGAGCCCCGGGGAGCCTGTGCGCTTCGGCTGGGTGAAGGGAGTGATGATCCGCTGTATGCTCAACATTTGGGGTGTGATCCTCTACCTGCGGCTCCCCTGGATTACGGCGCAGGCGGGCATTGTCTTGACCTGGATCATCATCCTGCTCTCGGTCACGGTGACCTCCATCACTGGCCTCTCCATCTCTGCCATCTCCACCAATGGCAAGGTCAAGTCAGGTGGCACCTATTTCCTCATCTCCCGGAGCCTGGGCCCAGAGCTGGGGGGCTCCATTGGCCTCATCTTTGCCTTTGCCAACGCCGTTGGTGTATCCATGCACACCGTGGGCTTTGCAGAGACTGTTCGGGACCTGCTGCAGGAGTACGGCGTGCCCATTGTGGACCCCATCAACGACATCCGAATCATTGGCGTGGTCACCGTCACTGTGCTCCTGGGCATTTCCCTGGCTGGCATGGAGTGGGAGTCCAAGGCTCAGGTGTTGTTCTTCCTTGTCATCATGGTCTCCTTTGCCAACTACTTGGTGGGGACACTGATCCCCCCATCTGAGGACAAGGCCTCCAAGGGCTTCTTCAGCTACCGGGGAGACATTTTTGTCCAGAACTTAGTGCCTGACTGGCGGGGTATTGATGGCAGCTTCTTCGGAATGTTCTCCATCTTCTTTCCCTCTGCCACCGGCATCCTGGCAGGAGCCAACATCTCCGGGGATCTCAAGGACCCTGCCGTGGCCATCCCCAGGGGAACTCTGATGGCCATTTTCTGGACCACCATCTCCTACCTGGCCGTCTCAGCCACCATTGGCTCCTGTGTGGTCCGGGATGCCTCTGGGGACCTGAACGACACGGTGACCTCTGGCCTGGGTACTTGTGAGGGGCTGGCCTGCAACTATGGCTGGAACTTCACCAAGTGCTCCCAGCAGCACAGCTGCCGCTATGGCCTCATCAATTACTACCAGACCATGAGCATGGTGTCAGCCTTCGCACCCCTGATCACAGCCGGCATCTTCGGGGCCACCCTCTCCTCTGCCCTTGCCTGCCTCGTCTCAGCTGCCAAAGTTTTCCAGTGCCTGTGTGAGGACCAGCTGTACCCACTGATCGGCTTCTTTGGCAAAGGCTACGGCAAGAACAAGGAGCCTGTGCGCGGCTACCTGCTGGCCTATGCCATCGCCGTGGCCTTCATCATCATTGCGGAGCTCAACACCATTGCCCCAATCATCTCCAACTTCTTCCTGTGCTCCTACGCCCTCATCAACTTCAGCTGCTTCCACGCCTCCATCACCAACTCACCCGGGTGGAGGCCCTCGTTCCAGTACTACAGCAAGTGGGCGGCGCTCTTTGGGGCAGTTATCTCCGTGGTCATCATGTTCCTGCTCACCTGGTGGGCGGCCCTCATCGCCATTGGAGTCGTCCTCTTCCTCCTGCTCTACGTGATCTACAAGAAACCAGAGGTGAACTGGGGCTCCTCCGTGCAGGCTGGCTCCTACAACCTGGCCCTGAGCTACTCCATGGGCCTCATTGAGGTGGAAGACCACATCAAGAACTACCGCCCCCAGTGCCTGGTGCTCACAGGCCCCCCCAACTTCCGCCCGGCCCTTGTGGACTTTGTGGGCACCTTCACCCAGAACCTGAGCCTCATGATCTGTGGCCATGTGCTCATTGGTCCCCACAAGCAGAGGATGCCTGAGCTCCGACTCCTGGCCAATGGACACACGAAGTGGCTAAAGAAGAGGAAGGTCAAGGCCTTCTACTCAGATGTCATCGCTGAGGACCTCCGCAGTGGTGTCCAGATTCTTATGCAGGCCGTGGGTCTGGGGAGAATGAAGCCCAACATTCTTGTGGTGGGATTCAAGAAGAACTGGCAGTCTGCTCACCCGGCCACAGTGGAAGACTACATCAGCATCCTACACGATGCCTTTGATTTCAACTACGGCATGTGCATCATGAGGATGCGAGAGGGGCTCAATGTCTCCGAGGTGATGCAGGCTCACATGGACCCCGAGGCTCTGGTGTGGGAGGAGCAGGCCAGCACCATCTTCCAGTCAGAGCAGGCCAAGAAGACCATTGACATCTACTGGCTGTTTGACGATGGAGGCCTTACGCTCCTCATCCCCTACCTCCTCCACCGCAAGAAGAGATGGGCCAAATGCAAGATCCGTGTGTTCGTCGGGGGCCAGATCAACAGACTGGACCAGGAGAGAAAGGCGATCATTTCTCTGTTGAGCAAGTTTCGACTGGGATTCCATGAAGTTCACATCCTTCCTGACATCAATCAGAAGCCGAATGCTGAGCACATTAAGCGGTTTGAGGACATGATTGCACCATTCCGCCTAAATGATGGCTTCAAGGACGAGGCCACGGTCGCAGAGATGAGGCGGGACTGTCCCTGGAAGATCTCAGATGAAGAGGTCAATAAGAACAGAGTCAAGTCCCTTCGGCAGGTGAGGCTGAATGAGATTCTGCTGGATTACTCCCAGGATGCTGCCCTGGTCGTCATCACCTTGCCCATAGGGAGGAAGGGGAAGTGCCCCAGCTCCCTGTACATGGCCTGGCTGGAGACCTTGTCCCAGGACCTCAGACCTCCAGTCATCTTGATCCGAGGGAACCAGGAAAATGTGCTCACCTTTTACTGCCAGTAA

XM_004843203.1 Coding sequence

Nup93 nucleoporin 93kDa, transcript variant X3

High confidence: 4 potential gene matches
Length: 2460 bp    Location: 29259947..29153507   Strand: -
>XM_004843203.1
ATGGATACTGAGGGGTTTGGTGAGCTTCTTCAGCAAGCTGAACAGCTTGCCGCTGAGACTGAGGGCATCTCAGAGCTTCCCCATGTGGAACGGAACTTACAGGAGATCCAGCAGGCAGGCGAGCGCCTGCGTTCCCGTACCCTCACACGCACTTCCCAGGAGACAGCAGATGTCAAGGCGTCAGTTCTTCTTGGGTCTCGAGGACTTGACATATCCCACATCTCCCAGCGATTGGAGAGTCTGAGTGCGGCTACCACCTTTGAGCCTCTTGAGCCTGTGAAGGACACAGACATTCAGGGCTTCCTGAAGAATGAGAAGGACAATGCACTGCTGTCTGCCATTGAAGAGTCCCGGAAGAGGACCTTTGGCATGGCTGAGGAGTATCATCGAGAGTCAATGCTGGTCGAGTGGGAGCAAGTGAAGCAGCGGATTCTGCACACACTGCTGGCGTCAGGAGAAGATGCCCTTGACTTTACTCAAGAAATTGAGCCAAGTTACATAACTGATGTGGGCCCCCCTGGTCGAAGCGCTATGGATGCTGTTGAGATGGCCTATGCCCAGCAGATTTATATCTATAATGAGAAGATTGTCAGTGGGCAACTACAGCCTAACCTCGTGGACCTCTGTGGTACAGTTCCCCGCCTGAATGATAAGAACATTTCTGACATGTGGACCATGGTAAAACAAATGACAGATGTGTTGTTGGTACCGGCTGGTGATACCCTGAAGAGCCGAAACAGCTTGGAAGTGCGCATGGACTTTGTCAGGCAGGCCTTGGGATACCTTGAGCAGAGCTACAAGAATTACACTCTTGTGACTGTGTTTGGAAATTTACATCAGGCCCAGCTGGGTGGTGTACCCGGAACTTACCAGTTGGTTCGAAGTTTCCTGAACATTAAACTTCCGGCTCCCTTACCTGGACTTCAGGACGGAGAGGTGGAGGGCCACCCTGTCTGGGCACTAATTTATTACTGCATGCGCTGTGGAGACTTGCTTGCTGCCTCACAGGTGGTTAATCGGGCCCAGCACCAGCTGGGAGAGTTTAAGACCTGGTTCCAGGAGTACATGAACAGCAAGGACAGAAGATTGTCCCCAGCTACAGAAAACAAGCTCCGGCTGCATTACCGCAGAGCCCTCAGGAACAACACAGACCCCTACAAGCGGGCTGTATACTGTATCATTGGCAGATGCGACGTCACTGACAACCAGAGCGAAGTGGCAGACAAAACTGAGGACTACTTGTGGCTGAAGTTGAACCAAGTGTGTTTTGATGATGACGGCACCAGCTCCCCACAAGATAGGCTCAGTCTCTCTCAGTTCCAGAAACAGTTGTTGGAAGACTATGGTGAGTCCCACTTTAGGGTGCACCAGCAGCCCTTCCTCTACTTCCAAGTGCTGTTCCTGACAGCACAGTTTGAAGCCGCCATCGCTTTTCTCTTCCGCCTGGAACGGATGCGCCCCCATGCTGTCCACGTGGCCCTGGTGCTGTTTGAGCTAAAGCTGCTTTTAAAATCATCAGGGCAGAATGCTCAGCTTCTCAGCCATGAGCCTGGTGACCCTCCCTGCATGCGGCGGCTGAACTTTGTGCGACTGCTCATGCTGTATACCCGGAAATTTGAGTCCACAGATCCAAGGGATGCCCTCCAGTACTTCTACTTCCTCAGGGATGAGAAAGATAGTCAAGGAGAAAACATGTTTTTACGCTGTGTGAGTGAGCTTGTGATAGAAAGTCGAGAGTTTGATATGATTCTTGGGAAACTACAGAATGATGGAAGTAGAAAGCCTGGAGTCATAGATAAGTTCACTAGTGACACAAAGCCTATTATCAATAAAGTTGCTTCCGTGGCAGAAAATAAAGGACTGTTTGAAGAAGCAGTGAAGCTTTACGATCTTGCCAAGAATGCTGACAAAGTGCTGGAGCTGATGAACAAATTGCTGAGCCCTGTTGTTCCCCAGATCAGTGCCCCGCAATCCAATAAAGAGAGGCTTAAGAACATGGCCCTCTCCATTGCTGAACGGTACAGGGCTCAGGGTGTAAGTGCAAATAAATTTCTGGACTCTACATTCTATCTTCTGTTGGACTTGATCACCTTTTTTGACGAGTATCACAATGGTCATATTGACAGAGCCTTTGATATAATTGAGCGCTTGAAGCTGGTGCCCCTGAGTCAGGAAAGTGTGGAAGAGAGAGTGGCTGCCTTCAGAAATTTCAGTGATGAAATCAGGCACAACCTCTCACAAGTTCTTCTCGCCACCATGAACATCTTGTTCACACAGTTCAAGAGGCTCAAGGGGACAAGTCCATCCTCAGCATCCAGGCCCCAGCGAGTCATGGAGGACCGCGACTCTCAACTCCGAAGTCAAGCACGAGCCCTGATTACTTTCGCTGGAATGATACCCTACCGGACATCTGGGGACACCAATGCAAGGCTGGTGCAGATGGAAGTCCTCATGAACTAA

XM_004843176.1 Coding sequence

Fam192a family with sequence similarity 192, member A, transcript variant X2

High confidence: 1 potential gene match
Length: 813 bp    Location: 28862412..28900758   Strand: +
>XM_004843176.1
ATGCTCCATCTGAATCTACTTGAACCAAGAGCAGATAGTCTTTTCATTATGGATGGAGGTGATGATGGTAACCTTGTTATCAAAAAGAGGTTTGTGTCTGAGGCAGAATTAGATGAACGGCGCAAAAGGAGACAAGAAGAATGGGAGAAAGTTCGAAAACCTGAAGATCCCAAAGAATGTCCAGAGGAGGTTTATGACCCTCGGTCTCTCTATGAAAGACTACAGGAACAGAAAGACCGGAAGCAGCAGGAGTATGAAGAGCAGTTCAAATTTAAAAACATGGTAAGAGGCTTAGATGAAGATGAGACCAACTTCCTTGATGAGGTTTCTCGGCAGCAGGAACTAATAGAAAAGCAACGAAGAGAAGAAGAACTGAAAGAACTAAAGGAATACAGAAGTAATCTCAACAAGGTTGGAATCTCTGCAGAAAACAAGAAGGAAGTGGAGAAGAAACTGCCTGTGAAACCAATAGAAACCAAGAACAAGTTCTCCCAGGCAAAGCTGTTGGCAGGAGCTGTGAAGCATAAGAGCTCAGAGAGTGGCAATAGTGTGAAAAGACTGAAACCGGACTCTGATCCAGATGACAAGAGTCAAGAGGCCCCATCCTGTGTATCGGTTGGAAGTACCTCCCTGAGTGGCCCATCCATTCACTGCCCACCCGCCGCTGTCTGCATCGGCATCCTTCCAGGCCTGGGAGCCTACTCGGGGAGCAGCGACTCTGAGTCCAGCTCAGACAGTGAAGGCACCATCAATGCCACAGGGAAGATCGTCTCCTCCATCTTCCGAACCAACACCTTCCTGGAGGCACCCTAG

XM_004843114.1 Coding sequence

Cdh11 cadherin 11, type 2, OB-cadherin (osteoblast), transcript variant X2

High confidence: 1 potential gene match
Length: 2391 bp    Location: 21345400..21502249   Strand: +
>XM_004843114.1
ATGAAGGAGAACTATTGTTTACAAGCTGCCCTGGTGTGCCTGAGCATGCTGTGCCACAGCCAGGCATTTGCCCTTGAGCGACGAAGCCACCTGCATCCCTCATTCCATGGGCACCAAGAGAGAGGCAAGGAAGGGCAGGTGCTGCAGCGCTCTAAGAGAGGCTGGGTCTGGAACCAATTCTTCGTGATAGAGGAGTACACTGGGCCTGATCCTGTGCTTGTGGGCAGGCTGCATTCTGATCTTGACACTGGTGATGGGAAGATTAAATACATTCTCTCAGGTGAAGGAGCTGGAACCATTTTTGTGATTGATGACAAATCAGGGAACATTCATGCCACCAAGACGTTGGACCGGGAGGAAAAAGCCCAGTATACACTGATGGCTCAAGCGGTGGACAGGGAAACAAACCGACCACTGGAGCCAGCTTCCTCATTCATTGTCAAGGTCCAGGACATTAATGACAACCCACCGGAGTTTCTACATGAGATCTATTATGCCAACGTGCCTGAAAGGTCCAATGTGGGAACATCGGTGATCCAGGTAACAGCTTCTGATGCAGATGACCCCACCTATGGAAATAGTGCCAAGTTAGTGTACAGTATCCTTGAAGGACAACCTTACTTTTCAGTGGAGGCACAGACAGGTATCATTAGAACAGCTCTCCCCAACATGGACAGAGAAGCCAAGGAGGAATACCATGTGGTAATCCAGGCCAAGGACATGGGTGGACATATGGGTGGACTCTCAGGAACTACCAAAGTGATGATCACTCTGACCGATGTCAATGACAACCCACCAAAGTTTCCTCAGAGCGTATACCAGATGTCTGTGTCAGAAGCAGCTGTCCCTGGGGAGGAAGTAGGAAGAATGAAAGCTAAAGACCCAGACATTGGAGAAAATGGCTTAGTCACATACAATATTGTTGATGGAGATGGTATGGAACTGTTTGAAATCACAACAGACTATGAAACACAGGAGGGTGTGGTGAAGCTGAAAAAGCCTGTAGATTTTGAAACCAAAAGAGCATATAGTTTGAAAGTAGAGGCAGCCAATGTGCACTTCGACCCAAAGTTCATCAGTAATGGACCTTTCAAGGACACTGTCACAGTCAAGATCGCTGTTGAAGATGTTGACGAGCCCCCCATGTTCTTGGCTCCAAGTTATATCCATGAAGTCCAAGAAAATGCAGCCCCTGGCACTGTGGTTGGGAGAGTGCATGCCAAAGACCCTGATGCTGCCAACAGTCCAATAAGGTATTCAATTGATCGTCATACTGACCTCGACAGGTTTTTCACTATTAATCTAGAGGATGGTTTTATTAAAACCACAAAACCTCTGGATAGAGAAGAAACTGCCTGGCTCAACATCTCTGTCTTTGCAGCAGAAATCCACAACCGACATCAGGAAGCCAAAGTCCCAGTGGCCATTAGAGTGCTTGATGTCAATGATAATGCTCCCAAGTTTGCTGCCCCCTATGAAGGCTTCATCTGTGAGAGTGATCAGACCAAACCACTTTCCAACCAGCCAATTGTTACAATTAGTGCAGATGACAAGGATGACACAGCCAATGGACCAAGATTTATCTTCAGCCTACCCCCTGAAATCATTCACAATCCAAATTTCACAGTCAGAGACAACAGAGATAACACAGCAGGAGTGTATGCCCGGCGAGGAGGGTTCAGTCGGCAGAAGCAGGACTTATACCTCCTGCCCATAGTGATCAGCGATGGAGGCATTCCGCCCATGAGTAGTACCAACACCCTCACCATCAAAGTCTGCGGGTGTGACATGAATGGGGTGCTGCTCTCCTGTAATGCTGAGGCGTACATCCTGAATGCTGGTCTAAGCACAGGGGCGCTCATCGCCATCCTCGCCTGCATCGTCATTCTCCTGGTCATTGTAGTTTTGTTTGTGACCCTGAGAAGACAAAAGAAAGAACCACTCATTGTTTTTGAGGAGGAAGATGTCCGTGAGAACATCATTACCTATGATGATGAAGGGGGTGGTGAGGAAGACACAGAAGCCTTTGATATCGCCACCCTCCAGAACCCAGATGGTATCAATGGATTTATTCCCCGCAAAGACATCAAACCTGAGTACCAGTACATGCCTAGACCTGGGCTCCGGCCAGCACCCAACAGCGTGGATGTGGATGACTTCATCAACACTAGGATACAGGAGGCAGACAATGATCCCACCGCCCCTCCCTATGACTCCATCCAAATCTATGGCTACGAAGGCAGGGGCTCAGTGGCTGGGTCCCTGAGCTCCTTAGAGTCTGCAACCACAGATTCAGACTTGGACTATGACTATCTACAGAACTGGGGACCTCGTTTTAAGAAATTAGCAGACTTGTATGGTTCCAAAGACACTTTTGATGATGATTCTTAA

XM_004843053.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 915 bp    Location: 19093378..19110738   Strand: +
>XM_004843053.1
ATGGCGGAGTCGCTGCCCCTGGAGATGCTCACATATATTCTGAGCTTCCTGCCTCTGTCAGATCAGAAAGAGGCCTCCCTTGTGAGTCGGGCTTGGTACTGTGCAGCCCAGAATGCCCTTCGGGAGCAACCAGCCCTTACCTCTCTGGACCTCAGTGGCTGCTCAGAACTGACTGATGGGGCACTCTTGGCTGTGAGCCAGGGCCTTCGGTACCTGCAGCGCCTAAGCCTGGGGAAGCTGCAGCGGCTGACAGACACAGGGTGCACAGCCCTGGGGGGGCATGTGGCAATTTCGGAGCCTGGACATGGCGAGTGCTGCTTGGTGAGTGGGCAGGGACTGGCCCAGGCCCTGGGGCCAGTGCATGGAGCTCCACCCCCACTGATCACCCTCAGGCTGGCCTACTGTTCTTCACTGAAGCTGTACTCAGAGCAGGAACATCAGGCTTCAGACCCCGAGGAACCCTTTCTCAAGCCACAGGGACCCTCCCTGCTCATGCTGCAGGCCCTGCAGGAGTTGGACCTCACAGCCTGCAGCAAGCTGACTGATGCCAGTCTGGCCAAGGTGCTCCAGTTCCCCCAGCTGAGGCAACTGTCACTGAGCCTATTGCCAGCGCTCACAGACAACGGTTTGGTGGCTGTGGCCAGGGGCTGCCCTAGCCTGGAGCACTTGTCACTGAGTCACTGCAGCTGCCTCAGTGATGACGATTGGGCCCAGGCAGCTGGGTCCTGGCTCAGGCTGCAGCACCTCAACTTATCCAGCTGCAGTCAGCTCACAGAGCAAACACTGGACACCAATAGCCAGGTGTGCAAGCAGCTCCAAGTGTTGGATGTGGCCATGTGTCCTGGTATCAATGTGGTGGCCGTCAGGCACTTCCAAGCCCAGCTGCCTCAGGTGACTTGTGAGGGGCTGACCTGA

XM_004843073.1 Coding sequence

Cbfb core-binding factor, beta subunit, transcript variant X4

High confidence: 4 potential gene matches
Length: 447 bp    Location: 19264146..19206277   Strand: -
>XM_004843073.1
ATGCCGCGCGTCGTGCCCGACCAGAGAAGCAAGTTCGAGAACGAGGAGTTTTTCAGGAAGCTGAGCCGCGAGTGTGAGATTAAGTACACGGGCTTCAGGGACCGGCCCCACGAAGAGCGGCAGATGCGCTTCCAGAACGCCTGCCGCGACGGCCGCTCCGAGATCGTGTATTTAAAGGCTCCCATGATTCTGAATGGAGTCTGTGTTATCTGGAAAGGCTGGATTGATCTCCAGAGACTGGATGGTATGGGTTGCCTGGAGTTTGATGAAGAGCGAGCCCAGCAGGAGGATGCATTAGCACAACAGGCCTTCGAAGAGGCTCGGAGAAGGACACGTGAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGGCAAGAAGACAACAAGACCCTAGTCCTGGTTCCAACTTAGGTGGTAGTGATGATCTCAAACTTCGTTAA

XM_004843044.1 Coding sequence

Slc9a5 solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5

High confidence: 4 potential gene matches
Length: 2895 bp    Location: 19074076..19051515   Strand: -
>XM_004843044.1
ATGTTAGGCCGGTGGAGCGGAAGTTTCTTCTGGCTGGTTCCTTCTCCCTCGTTTAGGCCCCAATTCCTACAGTTTGAGATATCAGTGGAAGCATTTCCCTCACTTCGGGAAAACGGCGGCGGCGGCGGCGGCAGCGGCGACGCGGGGCTGGTGGTCTTGCGGTGCCGGGAAGACGGCGAGACAGCCTGCAGAATGCCGCGCGCCGCACTGCCTTTGCTCGTGCTGCCCCTGGCAGGGGTGGTGGCGGCCGAAGAGACTACCCAAGAGCCTGGGGCGCCGGGCGAGCATCCCCCGGGATTGGCGCTCTTCCGCTGGCAGTGGCACGAGGTGGAGGCGCCCTACCTGGTGGCCCTCTGGATCCTGGTGGCCAGCCTGGCCAAAATAGTGTTTCACTTGTCTCGGAAAGTAACATCTCTGGTGCCTGAGAGCTGCCTGCTGATTTTGCTGGGCCTGGTGCTAGGGGGCATTGTTTTAGCTGTGGCCAAGAAAGCTGAGTACCAGCTGGAGCCAGGCACCTTCTTCCTCTTCCTGCTGCCTCCTATCGTGCTTGACTCAGGCTATTTCATGCCTAGTCGGCTGTTCTTTGACAACTTGGGTGCCATCCTCACCTATGCTGTGGTGGGAACACTCTGGAATGCCTTCACAACAGGCGCTGCCCTCTGGGGCCTACGGCAAGCTGGATTTGTGGCCTCTAGGGTACAAGCTGGCCTGCTGGACTTCCTGCTATTTGGGAGCCTCATCTCAGCGGTGGACCCTGTGGCTGTGCTGGCTGTCTTTGAAGAGGTGCACGTCAATGAGACTCTCTTTATCATCGTCTTTGGCGAGTCCCTGCTCAATGATGCAGTCACTGTGGTGCTGTACAAAGTCTGCAACTCCTTTGTGGAGATGGGTTCTGCCAACGTGCAGGCTGCTGACTACCTGAAGGGAGTCGCCTCCCTGTTTGTGGTCAGTCTGGGCGGGGCAGCCGTGGGCTTAGTCTTTGCCTTCCTCCTGGCTCTGACCACACGCTTCACCAAGCGGGTCCGCATCATCGAGCCCTTGCTGGTCTTCCTCCTCGCCTACGCAGCCTACCTCACTGCTGAAATGGCCTCACTCTCCGCCATTCTTGCGGTGACCATGTGCGGCCTGGGCTGTAAGAAGTATGTGGAGGCCAACATCTCCCATAAATCACGTACAGCTGTCAAATATACAATGAAGACTCTAGCCAGCTGTGCTGAGACTGTCATCTTCATGCTGCTCGGCATCTCGGCTGTGGATTCATCTAAATGGGCCTGGGACTCCGGGCTGGTGCTGGGCACCCTCATCTTCATCCTATTCTTCCGAGCCCTTGGCGTAGTCCTGCAGACGTGGGTGCTGAATCAGTTCCGGCTGGTCCCTCTGGACAAGATTGACCAAGTGGTGATGTCCTATGGGGGCCTCCGGGGGGCTGTGGCCTTTGCTCTCGTCATCCTACTGGACAGGACCAAGGTCCCTGCCAAGGACTACTTTGTGGCCACCACTATTGTGGTGGTCTTCTTCACAGTCATTGTGCAGGGCTTGACCATCAAGCCTCTGGTCAAGTGGCTGAAGGTGAAGAGGAGTGAGCATCACAAACCTACCCTGAACCAGGAGCTGCATGAGCACACTTTTGACCACATTCTGGCTGCAGTGGAGGACGTTGTGGGGCACCATGGCTACCACTACTGGAGGGACAGGTGGGAGCAGTTTGACAAGAAATACCTGAGTCAGCTGTTGATGCGGAGGTCAGCCTATCGTATCCGGGACCAAATCTGGGATGTGTACTACAGACTCAACATCCGGGATGCCATCAGCTTCGTGGACCAGGGAGGCCACGTCTTGTCCTCTACAGGCCTCACTCTGCCCTCTATGCCCAGCCGCAATTCTGTGGCAGAGACATCTGTCACCAACCTGCTGAGGGAAAGTGGCAGTGGAGCATGTCTGGATCTGCAGGTGATTGACACGGTACGCAGTGGCCGGGACCGTGAGGATGCAGCAATGCATCATCTGCTCTGTGGAGGCCTCTACAAGCCACGACGCAGGTACAAAGCCAGCTGCAGCCGCCACTTCATCTCCGAGGATGCACAGGAGCGGCAGGACAAGGAGGTATTTCAGCAGAACATGAAGCGGCGGCTGGAGTCCTTTAAATCCACCAAGCACAACATTTGTTTCACCAAGAGCAAGCCACGACCCCACAAAGCTGGCCGCAAGAAGAAGGATGGTGTGGCCAATGCTGAGGCTATAAATGGGAAACCTCCTCGAGATCTGGGCTTTCAGGACACAGCTGCTGTGATACTAAATGTGGAGTCTGAGGAGGAGGAGGAGGAGGAGAGCGACAGTTCAGAGACAGAGAAGGAAGACGACGAGGGGATCATCTTTGTGGCTCGGGCCACCAGTGAGGTTCTCCAAGAGGGCAAAGTCTCAGGAAGCCTTGAGCTGTGCCCGAGCCCACGGGTAATTCCTCCTTCACCAACTTGTGCAGAGAAGGAGCTACCTTGGAAGAGTGGGCAGGGGGACCTGGCAGTGTATGTGTCTTCAGAAACCACCAAGATTGTGCCTGTGGACATGCAGATGGGCTGGAATCAGAGCATCTCATCCCTGGAGAGCCTCGCATCCCCTCCCTGCACCCAAGCCACCACTCTGACCCGCCTGCCTCCCAGACAACAGGATGCTGAAGAGCCTCAGGCCCTTCTTGACCTGTCTTCTGACCCCCACCCTAGTTTTGCCTTTCCCCCAAGCCTGGCTAAGGCTGGCCGCTCTCGAAGTGAGAGTAGTGCTGACATCCCCCAGCAGCAGGAGCTGCAGCCCCTCATGGGCCACAAGGACCACACTCATCTTAGCCCAGGCACTGCTACCTCCCACTGGTGTATCCACTTCAACAGAGGGGCCAGGCTGTAG

XM_004843045.1 Coding sequence

Tmem208 transmembrane protein 208

High confidence: 4 potential gene matches
Length: 522 bp    Location: 19093273..19090985   Strand: -
>XM_004843045.1
ATGGCGCCCAAGGGCAAAGTGGGCACAAGAGGGAAGAAGCAGATATTTGAAGAGAACAGAGAGACCCTGAAGTTCTACCTGCGAATCATACTGGGGGCCAATGCTATTTACTGCCTTGTGACCTTGGTTTTCTTCTACTCATCTGCCTCATTTTGGGCCTGGATTGCCCTGGCCTTCAGTTTGGCAGTATATGGAGCCAGCTATCACTCTATGAGCTCCATGGCTCGAGCAGCCTTCTCTGAAGATGGGGCCTTGATGGATGGTGGCATGGACCTCAACATGGAGCAGGGCATGGCAGAGCACCTCAAGGATGTGATCCTGCTGACAGCCATTGTGCAGGTGCTCAGCTGCTTCTCCCTCTACATCTGGTCCTTCTGGCTTCTGGCTCCAGGTCGGGCCCTTTACCTCCTGTGGGTGAATGTGCTGGGCCCTTGGTTCACAGCAGACAGTGGCACCTCAGCACCAGAGCACAATGAAAAACGGCAGCGCCGACAGGAGCGGCGACAGATGAAGCGGTTATAG

XM_004843020.1 Coding sequence

Pard6a par-6 partitioning defective 6 homolog alpha (C. elegans), transcript variant X2

High confidence: 4 potential gene matches
Length: 1041 bp    Location: 18688703..18686921   Strand: -
>XM_004843020.1
ATGGCCAGGCCGCAGAGGACTCCGGCGCGCAGTCCTGACAGCATCGTCGAGGTGAAGAGCAAATTTGACGCCGAGTTCCGACGCTTCGCACTGCCCCGAGCTTCGGTGAGCGGCTTCCAGGAGTTCTCACGGTTGCTGCGAGCGGTGCACCAGATCCAGGGCCTGGACGTGCTGCTTGGCTACACAGATGCTCACGGCGACCTGCTGCCCCTCACCAACGATGACAGTCTGCACCGGGCGCTGGCCAGTGGTCCCTCACCGCTGCGCCTACTGGTGCAGAAGCGGGAAGCAGACTCCAGAAGCCTGGCTTTTGCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGGCTCTTGCTGCGACCAGTGGCCCCACTGCGTACCCGGCCACCTCTGCTAATTGGCCTGCCCCAAGATTTTCGCCAGGTTTCCTCAGTGATAGATGTGGACCTACTACCTGAGACCCACCGACGAGTGCGGCTGCACAAGCATGGTTCAGACCGCCCCCTGGGTTTCTACATACGAGATGGGATGAGCGTCCGTGTGGCTCCCCAGGGCCTGGAGCGGGTTCCAGGCATCTTCATCTCCCGCCTGGTACGTGGGGGCCTGGCTGAGAGTACAGGGCTGCTGGCAGTCAGTGATGAGATCCTCGAGGTCAATGGCATTGAGGTGGCTGGGAAGACCTTGGATCAAGTGACGGACATGATGGTTGCCAACAGCCATAACCTCATTGTCACTGTCAAGCCTGCCAACCAGCGCAATAATGTGGTTCGAGGGGCATCTGGGCGTCTGACAGGGCCTCCCTCTGCAGGACCTGGGCCTACTGAGCCCGACAGTGATGATGATGACAGCAGTGACCTGGTCCTTGACAACCGCCAGACTCCCTGTTACAATGGGCTGTCTCAGGGTCCCCCATGCTGGGACTTGCATTCTGGGTGCCTACTTCCTGGTGCCCGCAGCTCTCTCCCCTCCCTGGATGATCAAGGACAGGCCAGCTCTGGCTGGGGGAGTGGCATACGAGGAGATGGTAGTGGCTTCAGCCTTTGA

XM_004843026.1 Coding sequence

Ctcf CCCTC-binding factor (zinc finger protein), transcript variant X3

High confidence: 4 potential gene matches
Length: 2184 bp    Location: 18760190..18707808   Strand: -
>XM_004843026.1
ATGGAAGGTGAGGCTGTTGAAGCCATTGTGGAAGAGTCTGAAACTTTCATTAAAGGAAAGGAGAGAAAGACTTACCAGCGACGCCGGGAAGGAGGTCAGGAAGAAGATGCTTGCCACCTGCCCCAGAACCAGACGGATGGGGGTGAGGTGGTTCAGGATGTCAACAGCAGTGTACAGATGGTAATGATGGAACAGCTGGATCCTACCCTTCTTCAGATGAAGACTGAAGTAATGGAGGGCTCAGTGGCTCCAGAGGCAGAGGCTGCTGTGGACGATACACAGATCATAACTTTACAGGTTGTAAATATGGAAGAACAGCCTATAAACATAGGAGAGCTGCAGCTTGTTCAAGTACCTGTTCCTGTAACTGTACCTGTTGCTACCACTTCAGTAGAAGAACTTCAGGGGGCTTATGAAAATGAAGTATCTAAAGAGGGCCTTGCAGAAAGTGAACCCATGATATGTCACACCTTACCTTTGCCTGAAGGGTTTCAGGTGGTGAAAGTGGGGGCCAATGGAGAGGTGGAGACACTAGAGCAAGGGGAACTTCCACCTCAGGAAGATCCTAGCTGGCAAAAAGACCCAGACTATCAGCCACCAGCCAAAAAAACAAAGAAAACCAAAAAGAGCAAACTGCGTTACACAGAGGAGGGCAAAGATGTGGATGTGTCTGTCTATGATTTTGAGGAAGAACAGCAGGAAGGTCTGCTGTCAGAGGTTAATGCAGAAAAAGTAGTTGGTAATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGTGTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCCACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCCTCCTGAGGAATCACCTTAATACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGTGACATGGCCTTTGTGACCAGTGGAGAATTGGTGCGGCATCGTCGTTACAAACACACCCACGAGAAGCCATTTAAGTGTTCCATGTGTGATTATGCCAGTGTAGAAGTCAGCAAATTAAAACGTCACATTCGCTCTCATACTGGTGAGCGTCCGTTCCAGTGCAGTTTGTGCAGTTACGCCAGCAGGGATACATACAAGCTCAAAAGGCACATGAGAACCCATTCAGGGGAAAAACCTTATGAATGTTATATTTGTCATGCTCGGTTTACCCAGAGTGGTACCATGAAGATGCACATCTTACAGAAGCACACAGAAAATGTGGCTAAGTTTCATTGTCCCCACTGTGACACTGTCATAGCCCGAAAAAGTGATTTGGGTGTCCACTTGCGAAAGCAGCATTCCTATATTGAACAAGGCAAGAAATGCCGTTACTGCGATGCTGTATTTCATGAGCGCTATGCCCTCATCCAGCATCAGAAATCACACAAGAATGAGAAACGCTTTAAGTGTGACCAGTGTGATTATGCTTGTAGACAGGAGAGGCACATGATCATGCATAAACGTACCCACACCGGGGAGAAGCCTTATGCTTGCACCCACTGCGACAAGACCTTCCGCCAAAAACAGCTCCTCGACATGCACTTCAAGCGCTATCATGACCCCAACTTTGTTCCTGCGGCCTTTGTCTGTTCTAAGTGTGGGAAGACATTTACACGTCGGAATACCATGGCAAGACATGCTGATAATTGTGCTGGTCCAGATGGTGTAGAAGGTGAAAATGGAGGAGAAACGAAGAAGAGTAAACGTGGAAGAAAAAGAAAAATGCGCTCTAAAAAAGAAGATTCCTCTGATAGTGAAAATGCTGAGCCCGATCTGGATGACAATGAGGATGAGGAGGAACCTGCAGTAGAAATTGAACCTGAACCAGAGCCTCAGCCCGTGACCCCAGCCCCACCACCTGCCAAAAAGCGGAGAGGGCGACCACCTGGCAGAACCAATCAGCCCAAACAGAACCAGCCAACAGCCATCATTCAGGTTGAAGACCAGAATACAGGTGCAATTGAGAACATTATAGTTGAAGTCAAAAAAGAGCCAGACGCTGAGCCTGTGGAGGGGGAAGAAGAAGAGGCCCAGCCAGCCACCACAGATGCCCCCAATGGGGACCTCACACCTGAGATGATCCTCAGCATGATGGACCGGTGA

XM_004843001.1 Coding sequence

Pskh1 protein serine kinase H1

High confidence: 3 potential gene matches
Length: 1284 bp    Location: 18485059..18450221   Strand: -
>XM_004843001.1
ATGTCCGTGATGGGCTGTGGGACAAGCAAGGTCCTTCCTGAGCCACCCAAGGATGTCCAGCTGGATCTGGTCAAGAAGGTAGAACCCTTCAGTGGCGCTAAGAATGATGTGTACAAGCACTTCATCACAGAGGTGGACAATGTTGGCCCTCTCAAGGCTTCGTTTCCAGCTGCTAGTCAGTATACATCCCTTGGCACTGGTGCCCCCACTACTGGCCACACAGAGCCTCCTTCAGAACCACCACGAAGGGCCAGGGTGGCAAAGTACAGGGCCAAGTTTGACCCACGTGTGACAGCTAAATATGACATCAAGGCTCTGATTGGTCGAGGCAGCTTCAGCCGAGTGGTACGAGTGGAACACCGGGCAACCCGCCAGCCATATGCCATCAAGATGATTGAGACCAAGTACCGAGAGGGACGGGAGGTGTGTGAGTCTGAGCTTCGTGTCCTGCGCCGGGTGCGCCACGCCAACATCATCCAGCTGGTAGAAGTGTTTGAAACACAGGAGCGTGTGTACATGGTGATGGAGCTAGCCACCGGTGGTGAGCTCTTTGACCGCATCATTGCTAAGGGTTCCTTCACTGAGCGCGATGCCACAAGGGTGCTGCAGATGGTGCTGGATGGCGTCCGATATCTGCATGCACTAGGCATCACACACCGTGACCTCAAGCCTGAGAATCTGCTCTACTACCACCCAGGCACTGACTCCAAGATTATCATCACTGACTTTGGCCTGGCCAGTGCCCGCAAGAAGGGTGATGACTGCCTCATGAAGACCACCTGTGGCACACCTGAGTACATTGCTCCCGAGGTCCTGGTCCGAAAGCCCTACACCAACTCTGTGGACATGTGGGCACTGGGTGTCATTGCCTACATCTTGCTCAGTGGTACCATGCCTTTTGAGGATGACAACCGCACCCGGCTGTACCGGCAGATCCTCAGGGGCAAGTACAGTTACTTGGGGGAGCCCTGGCCTAGTATATCCAATCTGGCCAAGGATTTCATTGACCGCCTGCTGACTGTGGACCCTGGAGCCCGAATGACTGCACTGCAGGCCTTGAGGCACCCATGGGTGGTGAGCATGGCAGCTTCTTCATCTATGAAGAATCTGCACCGCTCTATCTCCCAGAACCTCCTCAAGCGTGCCTCCTCACGCTGCCAAAGCACCAAGTCTGCCCAGTCTACACGTTCCAGCCGCTCCACACGCTCCAACAAGTCGCGCCGTGTGCGGGAGCGGGAACTGCGGGAGCTCAACCTGCGATATCAGCAGCAGTACAATGGCTGA

XM_004842727.1 Coding sequence

Zdhhc7 zinc finger, DHHC-type containing 7

High confidence: 4 potential gene matches
Length: 927 bp    Location: 1740080..1715907   Strand: -
>XM_004842727.1
ATGCAGCCCTCGGGACACCGGCTCCGGGACATCGAGCACCATCCCCTCCTGACTGAAAACGACAACTATGACTCTGCCTCCTCTTCCTCCTCTGAGCCTGAAGCGGCAGACAAGGTGTGGTTCATCCGGGACGGCTGCGGCATGGTGTGCGCCATCATGACGTGGCTCCTGGTCGTCTACGCAGACTTCGTGGTGACATTTGTCATGCTGCTGCCTTCCAAAGACTTCTGGTACTCCGTGGCGAACGGGGTCGTCTTCAACTGCCTGCTGGTGCTGGCGCTCTCGTCACACCTGAGGACCATGCTCACCGACCCTGGGGCGGTCCCCAAGGGGAACGCGACAAAGGAGTACATGGAGAGCCTGCAGCTGAAGCCTGGCGAGGTGATCTACAAGTGCCCCAAGTGCTGCTGCATCAAGCCCGAGCGCGCCCACCACTGCAGTATTTGCAAAAGATGCATTCGGAAAATGGATCACCACTGCCCGTGGGTGAACAATTGTGTGGGAGAAAAGAATCAGAGGTTTTTTGTACTCTTCACTATGTACATCGCCCTGTCTTCAGTGCACGCGCTCGTCCTCTGCGGCCTGCAGTTCATCTCCTGCGTCCGGGGACAGTGGACTGAGTGCAGCGACTTCTCGCCTCCCGTAACTGTAATCCTGTTGGTCTTCCTGTGCCTTGAGGGTCTGCTATTCTTCACTTTCACCGCAGTGATGTTTGGCTCCCAGATCCACTCAATATGCAGCGACGAGACGGAGATCGAGCGGCTGAAAAGCGAGAAGCCCACGTGGGAGCGGAGGCTGCGCTGGGAAGGGATGAAGTCCGTCTTTGGGGGTCCCCCCTCACTCCTGTGGATGAACCCCTTCGTCGGCTTCCGGTTCCAGCGACTGCAGGCGCGGCCCAGGAAAGGCAGCCCAGAGTTCTCCGTGTGA

XM_004842906.1 Coding sequence

Ap1g1 adaptor-related protein complex 1, gamma 1 subunit, transcript variant X2

High confidence: 3 potential gene matches
Length: 2478 bp    Location: 14081209..13997903   Strand: -
>XM_004842906.1
ATGCCAGCCCCCATCAGATTGCGGGAGCTGATCCGGACCATCCGGACAGCCCGAACCCAAGCTGAAGAACGAGAAATGATCCAGAAAGAATGTGCTGCAATCCGGTCATCATTTAGAGAAGAAGACAATACATACCGGTGTCGGAATGTGGCAAAATTACTATATATGCACATGCTGGGGTACCCTGCTCACTTTGGACAGTTGGAGTGCCTCAAGCTTATTGCTTCTCAAAAATTTACAGACAAACGCATTGGCTATTTAGGAGCAATGCTGCTGTTAGATGAAAGACAAGATGTCCATCTTCTCATGACTAACTGTATCAAGAATGATCTTAATCATAGCACTCAGTTTGTACAGGGACTAGCTCTTTGTACCCTTGGCTGCATGGGCTCCTCAGAGATGTGCAGAGATCTTGCAGGAGAGGTGGAGAAGCTCTTGAAAACCTCCAACTCTTACTTAAGAAAAAAGGCAGCACTGTGTGCTGTTCATGTCATCAGGAAAGTTCCTGAACTTATGGAGATGTTTTTACCAGCAACAAAAAATTTATTGAATGAGAAGAATCATGGTGTCCTTCACACTTCTGTAGTCCTCCTCACAGAAATGTGTGAGCGAAGCCCAGATATGCTCGCACATTTCAGAAAGAATGAAAAGCTTGTGCCCCAATTAGTTCGTATTCTAAAGAACCTCATCATGTCCGGATATTCCCCAGAACATGATGTTTCTGGTATCAGTGACCCCTTTTTGCAGGTACGGATTTTGCGGTTATTAAGAATTTTAGGACGAAATGATGATGACTCAAGTGAAGCTATGAATGATATACTAGCACAGGTTGCCACTAATACAGAGACTAGTAAAAATGTAGGAAATGCTATTCTTTATGAAACTGTTTTGACTATCATGGATATTAAATCAGAGAGTGGACTGCGAGTTCTAGCCATAAATATCCTGGGTCGTTTCTTATTGAACAATGACAAAAATATTAGATACGTAGCTCTGACATCTTTGTTGAAGACCGTGCAGACAGATCACAATGCAGTACAGAGACACAGAAGCACAATTGTGGACTGTCTAAAAGATTTGGATGTCTCAATAAAACGGCGTGCAATGGAATTGAGTTTTGCCCTGGTAAATGGAAATAATATCCGAGGCATGATGAAGGAATTACTTTATTTTCTGGATTCATGTGAGCCAGAGTTTAAGGCAGACTGTGCATCTGGAATCTTTCTTGCTGCAGAAAAGTATGCACCTTCCAAACGGTGGCATATAGATACCATTATGCGTGTTCTGACAACAGCAGGAAGTTACGTTCGTGATGATGCAGTCCCCAATTTGATACAGTTAATAACCAATAGTGTGGAGATGCACGCTTATACTGTCCAGCGCTTGTATAAAGCAATTCTTGGTGATTATTCTCAACAACCTTTGGTACAAGTAGCTGCATGGTGTATAGGCGAATATGGTGATCTTCTTGTATCTGGACAATGTGAAGAGGAAGAACCTATTCAGGTAACAGAGGATGAAGTATTGGATATTTTAGAAAGTGTACTAATCTCTAATATGTCCACCTCTGTGACACGAGGTTATGCCCTCACTGCCATCATGAAGCTTTCAACTCGATTCACTTGTACTGTAAACCGAATTAAAAAAGTGGTTTCCATCTATGGAAGCAGCATTGATGTGGAGCTCCAGCAGAGGGCAGTAGAATATAATGCACTTTTTAAGAAATATGACCATATGAGGTCGGCCCTACTTGAGAGAATGCCTGTCATGGAAAAAGTGACCACAAATGGCCCTACTGAGATTGTGCAGACAAATGGAGAGACAGAACCAGCTCCATTAGAGACAAAACCACCACCTTCTGGGCCACAGCCCACCAGCCAGGCGAATGACTTACTGGATTTGTTGGGAGGAAATGACATAACACCTGTTATTCCAACTGCACCTACAAGCAAACCAGCATCTGCTGGTGGAGAACTTCTTGATTTGCTGGGAGACATCAGCCTTACAGGTGCTCCAACTGCTGCTCCTACCCCTGCCTCAGTCCCTCAGATATCTCAGCCCCCCTTCTTGTTGGATGGGCTTTCATCACAGCCTCTCTTCAATGACATCACTGCAGGCATCCCCTCCATCACAGCATACAGTAAGAATGGCTTGAAGATAGAATTCACCTTTGAACGGTCAAACACCAACCCCAGTGTAACAGTGATAACGATACAGGCCTCTAACAGCACAGAGCTAGACATGACGGACTTTGTATTCCAGGCTGCAGTACCAAAGACATTCCAGCTGCAGCTTCTGTCTCCTAGCAGCAGCATTGTCCCAGCATTTAATACAGGGACCATCACACAAGTCATTAAAGTTCTGAACCCACAGAAGCAACAGCTGCGAATGAGGATCAAGCTCACATATAATCACAAGGGCTCAGCAATGCAAGATCTAGCAGAGGTGAACAACTTTCCCCCTCAGTCCTGGCAATGA

XM_004842921.1 Coding sequence

Hp haptoglobin

High confidence: 3 potential gene matches
Length: 1044 bp    Location: 14288094..14292159   Strand: +
>XM_004842921.1
ATGAGTGCTCTGGGAGCTCTCGTCACCCTCCTGCTCTGGGGACAGCTTTTTGCCATGGACATTAACAATGAAGTCACAGAAATTGCAGATGACAGCTGTCCAAAGCCCCCTGAGATTGCAAATGGCTACGTGGAGCACCTGGTTCGCTATCAGTGTCAGCCTTACTACAGGCTGCACACTGAAGGGGACGGAGTATATGCTTTAAATAGTGAGAAGCAGTGGGTGAACAAGGCCATTGGAGAGGAACTTCCAGAATGTGAAGCAGTATGTGGAAAGCCGAAGAATCCAGTGGATCAGGTGCAGCGCATCATTGGTGGCTCTCTGGACGCCAAAGGCAGCTTTCCCTGGCAGGCTAAGATGATCTCCCGTCACAATCTCACCACGGGGGCCACACTGATCAGTGAACAGTGGCTTTTGACCACAGCCAAAAATCTCTTCCTGAATCACACAGAGAATGCTACAGCAGAGGAGATCGCTCCTACCTTGAAACTCTTCGTGGGAAAAAGGCAGCCAGTGGAGATTGAGAAGGTGGTTTTCTACCCAAACTATTCCATAGTAGACATTGGGCTCATCAAACTCAAACAGAAGGTGCTTGTCAATGAGAGAGTGATGCCCATTTGCCTGCCTTTGAAGGATTATGCGGAGGTGGGGCGTGTGGGTTATGTGTCTGGCTGGGGGCGAAATGTCAACTTTCGGTTTACCGAGCATCTCAAGTATGTCACGCTGCCTGTTGCTAACCAGAGCAAATGTGTGGAGCACTACGAAGGCAGCACAGTGCCCGAGGAGAAGACCTGGAAGAGCCCTGTAGGGGTGCAGCCCATCCTGAATGAACACACCTTCTGTGCTGGAATGTCCAGGTACCAGGAGGACACCTGCTATGGTGATGCTGGAGGTGCCTTTGCCATTCACGACCTGGAGCAGGACACCTGGTACGCAGCCGGGATCTTGAGCTTTGACAAAAGCTGCACTGTAGCTGAGTATGGTGTGTACGTGAAGGTGGCCTCCATCCTGGACTGGGTTCAGACAACCATGGCCAACAACTAA

XM_004842885.1 Coding sequence

Mtss1l metastasis suppressor 1-like, transcript variant X2

High confidence: 4 potential gene matches
Length: 2139 bp    Location: 12887578..12868203   Strand: -
>XM_004842885.1
ATGGAGACGGCGGAGAAGGAGTGCGGCGCCCTGGGCGGGCTCTTCCAGGCCATCGTCAATGACATGAAGAGCTCCTACCCCATCTGGGAGGACTTCAACTCCAAGGCCACGAAGCTACATTCTCAGTTGAGGACCACTGTGCTGGCTGCTGTGGCCTTCCTGGATGCCTTCCAGAAAGTGGCTGACATGGCCACCAACACCCGAGGGGCCACGCGGGACATCGGCTCGGCGCTCACGCGCATGTGCATGCGCCACCGCAGCATCGAGACCAAGCTGCGGCAGTTCACCAACGCGCTGCTGGAGAGCCTCATCAACCCGCTGCAGGAGCGCATCGAGGACTGGAAAAAGTCGGCCAACCAGCTGGACAAGGACCACGCGAAAGAGTACAAACGAGCCCGGCACGAGATCAAGAAGAAGTCCTCAGACACGCTGAAGCTGCAGAAGAAAGCACGCAAAGGGAAAGGAGACCTGCAGCCCCAGCTGGACAGTGCCCTGCAGGACGTCAACGACATGTACCTGCTGCTGGAGGAGACGGAGAAACAGGCAGTGCGCCGGGCCCTCATCGAGGAGCGAGGCCGCTTCTGCACCTTCATCACCTTCCTGCAGCCTGTGGTGAACGGTGAGCTGACCATGCTGGGAGAGATCACCCACCTGCAGGGCATCATTGACGACCTGGTGGTGCTGACCGCGGAACCCCACAAGCTGCCTCCCGCCAGCGAGCAGGTGATCAAAGACCTGAAGGGCTCAGACTACAGCTGGTCCTACCAGACCCCACCCTCTTCACCTAGCAGCTCCAGCTCCCGGAAGTCCAGCATGTGCAGCCTGGCGCAGCCAGCCACCGCCACCACCCGCCTCTCCAGCGTGTCCTCCCACGACTCTGGCTTCGTCTCCCAGGATGCCACCTACTCCAAGCCCCCCTCGCCCATGCCTTCAGACATCACCAGCCAGAAGTCCTCCAGCTCTGCATCCTCTGAGGCTTCGGAAACCTGCCAGTCTGTTAGCGAGTGCAGCTCCCCCACCTCGGACTGGACCAAGGCCGGCCCCCATGAGCAGCCCACAGGCACCACCCTGCAGCGGAGGAAGGACCGAGTGGAGCTCCTCCGAGACACAGAGCCAGGATCTGCTAGCACAGGCCCCCTGGGCCCCACTGGGGAGGAGGCACCTCGACCCCGGATGTCCCCTGCCACCATTGCAGCCAAGCATGGCGAGGAGGTGTCGCCCGCCGCCAGCGACCTGGCCATGGTGCTGACCCGAGGCCTGAGCCTGGAGCACCAGAAGAGCAGCCGGGACTCACTGCAGTACTCCAGTGGCTATAGCACACAGACCACCACGCCCTCCTGCTCTGAGGACACCATCCCCTCCCAAGGCTCTGACTACGACTGCTACTCTGTGAACGGTGATGCAGACAGCGAGGGGCCCCAGGAGTTTGACAAGTCGTCCACCATCCCGCGCAACAGCAACATCGCCCAGAACTACCGCCGCCTCCTCCAGACCAAGCGCCCGGCCTCCACTGCTGGGCTGCCCACAGCCACAGGCCTGCCCTCGGGTGCACCCCCTGGTGTGGCCACCATCCGCCGCACGCCCTCCACCAAGCCCACCGTGCGCCGCGCCCTGTCCAGCGCTGGCCCCATCCCCATCCGGCCACCCATCGTCCCCGTGAAGACGCCCACGGTGCCCGATTCCCCCGGCTACATGGGGCCCACGAGGGTGGGCAGCGAGGAGTGTGTCTTCTACACAGATGAGGCCGCCTCACCCCTGGCCCCGGACCTCGCCAAGGCCTCCCCGAAAAGGCTGAGCCTGCCCAACACCGCCTGGGGCAGCCCATCCCCCGAGGCAGCCAGCTACCCTGGGCCAGGGACCAGGCTGGCAGCGGAGGACGAGGAGGAGCAGCAGCTGGCCGCCAACAGGCACAGCCTGGTGGAGAAGCTTGGGGAGCTGGTGGCCGGGGCCCACGCCCTGGGCGAGGGCCAGTTCCCCTTCCCCACCGCCCTGTCGGCCACCCCCACCGAGGAGACGCCCACCCCACCCCCTGCTGCCACCAGTGACCCCCCAGCAGAAGACATGCTGGTAGCCATCCGGCGCGGGGTCCGGCTCCGCAGGACCGTCACCAACGACAGGTCGGCACCCCGCATCTTATGA

XM_004842854.1 Coding sequence

Rfwd3 ring finger and WD repeat domain 3

High confidence: 3 potential gene matches
Length: 2406 bp    Location: 12217299..12251104   Strand: +
>XM_004842854.1
ATGCAGCCGGCTCGGAAGTTCCGGCGCGTGCCCACGCCTTTAGTGATGGCTTACGAAGCACTGGGCTATGATCCTCCAGTGCGTTTAGATGATGATACAGCAGATCCTATTGCTGAGTTGGTTGGCAGCCAAGGGAGACTGCCTGTGCTCCAGCCTGCTCCTACTGAAGTAGCTGGAAACCAGGGGACGCCACTCCTACACCAGGCTGCTCCTGCTGAAGCAGTCAGCAGCCAAGGGAGACCACTTTTGCTCCAGCCTGCTGCTGTTCAAGTGGTCAGCAGCCAAAGAGATCCACCGCTTCTCCAGCCTGTTCCTCCTGCTCCAGTTGACCTGACGGAGGAAGTAGAACACTTAGAAGAGAATGTGGAGAACATCAATCCAGGAAGTTCAGGGGAGCCTCGGCAGGAATCTGATGCTAACCACCCTGTCCAAACACCCTCACTAATGTCAATGAACAGCTTCATCAGTGGTCTGCAGAGACTTCATGGCATGCTGGAATTCCTGAGGCCTCCGCCTTCAGACCACAGTGTGGGGCCACTGAGAGCAAGAAGGAGGGGGCGCATTTCACGTAGGGTTAGAGCTGGAGCATCCCAGAGGACAGACAATGCCAGGTCCAGAACACCATTGGATGCTTACTTTCAGGTGAGCAGGAGCCAGCCCCACTTGCCAGCCACCTCTTACAATTCACAGATTAGGAATCCAGTCTCTGAAGACGTACAGGAGTCAGGTAGTTCTGATTCCGACAGTGACGACTCTGCAGAGTATGAAGTTGTCCAGGCAGAGGAACCCAGAGCTGTTGCTGTAGAAGAACAACGAGGAGATGTCTCAGCAGAGCAAGAAGTTACACATATTAGCCAAGATGAGACCCTCACCAAAGAGTCTCCCCAGAAGCCCAGCACTCCTCTGAATACTGCTTCCATGGATGAAGAAGAAGAGGGGGACATTTGTACAATATGTTTTGAACAGTGGACCAGTGCTGGGGACCACCGGCTCTCGGCATTACGCTGTGGCCATCTCTTTGGATACAGATGCATTTCTAAGTGGCTCAAAGGGCAAACACGGAAGTGTCCCCAGTGCAACAAGAAGGCCAAGCACAATGACATTGTTGTCCTTTATGCCCGAACCCTGAGAGCGTTGGACACTAATGAACAGGAACGTGTAAAAAGTGCCTTAGTGAAGGAGCAAATGCTAAGGAAGCAGGCCGAGTTAGAATCTGCACAGTGCCGGCTCCAGCTTCAGGTCCTCACTGAGGAATGCAGTAGACTTCGCACTTGTGTCCAGGACTTGCAAAAACTTACGCAGGAACGGGGTCCAGTTTCAGGGCAGCGCAAGGGCCCCGGTGCTCATTTCCCAAACGCCCTGCCTGCCAGCCGGAGCCAGCATCAGTACCACTTCCAGAAGGCCTTCGCTGTGTCCCAGACGGGGAACTGCCGCACCATGGCCCACGGTGGCGCTCTGAGCTGCCTAGTGGTTTCGCAGCCTTCTCCTCAGGCTTCCTTCTTTCCGGGCTTTGGTGTGAAGATGCTGAGCACTGCCAACATGAAAAGCAGTCAGTATATCCCGATGCATACCAAACAGATCCGTGGGCTGGCTTTCAGCACGAGGTCCAAAAGCTTGCTGCTCTCTGCTTCCCTTGACAACACTATTAAACTGACCAGCCTGGAGACAAATACTGTGGTCCAGACTTACAATACTGGGCGACCTGTCTGGAGCTGTTGCTGGTGTCTCGATGAAAACAACTATGTCTATGCTGGACTGGCCAATGGGTCAATTCTGGTGTACGACCTGCGAAACACAAGCTGTCATGTGCAGGAATTAGTCCCTCAGAAAGCCAGATGCCCTCTGGTGTCCCTGTCATACATGCCCAGAGCTGCCTCAGCTGCATTTCCATATGGTGGGCTGTTGGCTGGAACCCTGGAGCATGCTTCCTTCTGGGAACTGAAAATGGGCTTTTCACACTGGCCTCACGTGCTGCCCTTGGAGCCAGGGGGCTATGTGGACTTTCAGACAGAGAGCAGCACCCGACACTGTCTGGTAACCCACAGGCCTGATAAGAACCACAACACCATGCGAAGTGTGCTGATGCAGATGTCCTATAATCTGGATGACGCTGGAGAGCCAGTCTGCTCCTGCCATCCTGTGCAGACATTCCTTGGGGGACCCACTTGCAAACTGTTGACCAAAAGTGCCATATTTCAAAGCCCAGAGAATGATGGCAGCATCCTGGTCTGTACTGGCGATGAAGCATCAAATTCTGCCCTGCTGTGGGATGCTGGCAGTGCGTCATTACTGCAGGACCTGCAGACCGATCATCCTGTCTTGGACATCTGCCCGTTTGATGTGAACCATAGCAGCTACCTGGCCACCTTAACAGAGAAGATTGTCCACATCTATAAGTGGGAGTGA

XM_004842802.1 Coding sequence

Atmin ATM interactor

High confidence: 1 potential gene match
Length: 2448 bp    Location: 6305780..6290457   Strand: -
>XM_004842802.1
ATGGCGGCCTCGGAGGCGGCGGCGGTGGAACCCGCGGCTCTGGCGGCGGGCGCCCTGGCCGTCCCAGCGGCCGCGAGTGGAACCGCCGCCGCCGCCTCGGGCCCTTGGGGGGCTCCGGGGTCCCGGCTGAGGGGCAGCCGGCTACGGCCCGCGGCGGCACGTCAGCACCCCGCAGCCCCGGCGCCGCCGGCCCGGGAGCTGATCCAGCCGTCGGTGAGTGAGCTGTCGCGGGCCGTGCGGACCAACATCCTGTGCACCGTGCGCGGCTGCGGCAAGATCCTGCCCAACAGCCCGGCGCTCAACATGCACCTGGTCAAGAGCCACCGCCTGCAGGATGGCATAGTAAACCCAACAATAAGAAAAGACTTGAAGACTGTACCAAAATTCTACTGTTGTCCAATTGAAGGATGCCCCAGAGGCCCCGACAGACCATTTTCACAGTTTTCTCTCGTAAAACAGCACTTCATGAAGATGCACGCCGAGAAGAAGCACAAATGCAGCAAGTGCAGCAACTCGTATGGCACCGAGTGGGACCTGAAGAGGCACGCAGAGGACTGCGGCAAGACCTTCCAGTGCACATGCGGCTGCCCCTATGCCAGTAGGACGGCGCTGCAGTCGCACATCTACCGCACAGGCCACGAGATCCCCGCGGAGCACCGGGATCCACCTAGTAAAAAAAGGAAAATGGAAAACTACCTGCAAAACCAGAAGTTGTCCACAAAGACCATTGAATCCTCGAGCAGCCAACCAAACCCTCGGCCAGAAGCCCAGGAACTGGAGACTTCAGAAATAAAACTCATGCCCTCTCTTGAGGACTCCCGAGGCTCCAGGAAGCAGAGCGTCACCACACCTCCACGATACCCTCAGAAGCTGCTCCTACCGAAGCCCAAGGTGGCTCTGGTGAAGCTTCCGGTCATGCAGCTGTCGCCTATGCCGGTCTTTGTGCCTACAGCCGACTCTGCAGCCCAGCCCGTGGTGTTGGGCGTCGATCAGGGCTCAGCAACGGGTGCCGTGCACCTGGTGCCCCTGTCGGTGGGGGCTCTGATCCTCGGCCTAGATTCCGAGGCATGCTCCCTGAAGGAGAGCTTGCCTCTCTCCAAAGTTATAAATCCCGGTGTTGAGCCAGTGAGTATGGGTGTTCAAGTGAACCTAGGAAAGAGTCCTTCTAATCCTTCCCAAGAGCTAGGGAGCCCATGTCAGAGAAACGGCATTTCATCCATCAACGTGCAGACGGATCTGACCTGTGCCTCGCCACACTTGGTCCCCTCTGCCCCATGGCCTGGCCCTGACTCCTCCGTGTCATCTTGCTCTCAAACCGACCTGTCATTTGATTCTCAAGTGTCTCTTCCCATTAGTGTTCACACTCAGACTCTGCTCCCCAGCTCTAAAGCAGTGTCGTCCATCGCTGCTCAGACGGACACTTTCCTCGACACCTGTCTCCAGCCAGGTGGGGTCTCCAGGGAGACCCAGACCTGCAGGGTGCTGGGGCCCCCGGACACCCGGATGCAGGTGGACCAAGCCGGGATGTGTGGGGACATTTTTGAGAGTGTCCACTCATACAGCGTCCCCACAGATAATATTATAAACAGCAGTTTAGTAGCAGAGACCGTCACTCACAGTTTGTTACCTCAGAGCAACCCTAAGGCTTTAAGTGAAGATATTGAGAAATCCGCACCCATCTTAAACTTTAGTGCGCAGAACGGCATGCTTCCCTCACAGAACATGACAGATAACCAGACCCAAACCATAGATCTGTTGAGCGACTTAGAAAACATCTTGTCAAGCACTCTGCCCGGTCAGGCGTTGGACAACCGTGGTCTTTTGTCTGATGCCAATCCCGGGGCTGACACCCAGCTCCCCTCCGGCCCCACCCAGAACCCCAGCATCGATTTTGATATTGAAGAGTTCTTCTCCGCCTCCAACATCCAGACTCAAACTGAAGAGAGCGGCCTCGGCACCATGGCCACGGAGCCAGTCCTGGAGTCACTGGACATAGAGACCCAGACCGACTTCTTTCTTGCGGATCCGTCCGCCCCACCCTACGGGTGCAGGGGCGGGGCTCACTTCCTAGGGCTCGAGATGTTCGACACGCAGACCCAGACGGATTTAAACTTCTTTTTAGACAGCAGCCCTCACCTGCCCCTCGGCAGCATCCTGAAACACTCCAGCTTTTCCATGAGTACGGACTCGTCCGACACTGAGACCCAGACCGAAGGACTCTGCGCCGCCCGAAGTGTCCCCGCTCTGGAGAGCAAGGTGCAGCTGAACAGCGCCGAAACACAGACCACCAGGTCAGGCCTGGAGACTCTGGGGAGCTTGTTCTTCACCAGCAACGAAACGCAGACAGCCATGGACGACTTCCTGCTGGCCGATTTGGCCTGGAACACCATGGAGTCTCAGTTCAGCTCCGTGGAAACCCAGACGTGTGCCGAGCTGCACAACTTCTAA

XM_004842811.1 Coding sequence

Wwox WW domain containing oxidoreductase

High confidence: 4 potential gene matches
Length: 1245 bp    Location: 8924253..7983646   Strand: -
>XM_004842811.1
ATGGCAGCGCTGCGCTACGCCGGCCTGGACGACACGGACAGCGAGGACGAGCTGCCCCCGGGCTGGGAGGAGCGAACTACCAAGGACGGCTGGGTTTACTATGCCAATCACACCGAGGAGAAGACTCAGTGGGAGCATCCGAAAACTGGCAAAAGAAAACGAGTAGCAGGAGATTTGCCTTATGGATGGGAGCAAGAAACAGATGAGAACGGGCAAGTGTTTTTTGTTGACCACATAAATAAGAGAACCACCTACTTGGACCCAAGACTGGCCTTTACTGTGGACGACAACCCGACCAAGCCAACCACCAGGCAGAGATACGACAGCAGCACCACGGCCATGGACATCCTGCAGGGTCGGGACTTCACGGGCAAAGTGGTCGTGGTCACTGGGGCTAATTCAGGAATAGGGTTTGAAACTGCCAAGTCTTTTGCTCTGCACGGTGCTCACGTGATCCTGGCATGTAGGAATATGGCAAGAGCCAGCGAAGCAGTGTCACGTATTTTAGAAGAGTGGCACAAAGCCAAGGTAGAAGCAATGACCCTGGACCTTGCTCTGCTCCGTAGCGTGCAGCATTTTGCTGAAGCGTTCAAGGCCAAGAATGTGCCTCTTCATGTGCTTGTGTGCAGCGCTGCGGCTTTTGGTATTCCCTGGAGCCTCACAAAAGATGGCCTGGAGACCACCTTCCAGGTGAACCACCTGGGCCACTTCTACCTGGTCCAGCTCCTGCAGGATGTTTTGTGCCGCTCGGCCCCTGCCCGTGTCGTCGTGGTGTCCTCCGAGTCCCATAGATTTACAGATATTAATGACACCTCGGGAAACCTTGACTTTAGCCGCCTGTCTCCATCACAAAACGACTACTGGGCCATGCTGGCCTACAACAGGTCCAAGCTCTGCAACATCCTGTTCTCCAGCGAGCTGCACCGCCGCCTCTCCCCGCGTGGGGTCACTTCCAACGCCGTGCATCCGGGGAACATGATGTATTCCTCGCTTCACCGAAGCTGGTGGGTGTGGACGCTGCTGTTCACCTTGGCGAGGCCATTCACCAAGTCCATGCAACAAGGAGCAGCCACCACTGTCTACTGTGCAGCAGCCCCAGAGATGGAGGGCCTGGGAGGAATGTATTTCAACAACTGCTGCCGCTGCCTGCCCTCGGCCCAAGCACAGAGCGAGGAGACAGCCCAGGCCCTGTGGGAGCTCAGTGAGCGACTGGTGCAGGACCGGCTGGGCAGTGCGTCCGGCTAA

XM_004842631.1 Coding sequence

Cdk10 cyclin-dependent kinase 10, transcript variant X2

High confidence: 4 potential gene matches
Length: 1083 bp    Location: 291063..285006   Strand: -
>XM_004842631.1
ATGGCGGACCCGGACCCAGAGTCGGAGCAGATCCGCCTGAAGTGTATCCGTAAGGAGGGCTTCTTCATTGTGCCTCCGGAACACAGGCTGGGACGATGCCGGAGTGTGAAGGAGTTTGAGAAGCTGAACCGCATTGGCGAGGGCACCTATGGCATTGTGTATCGGGCCCGGGACACCCAGACAGATGAGACTGTTGCCCTGAAGAAGGTGCGGATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCCTGCGGGAGATCACGCTGCTCCTGCGCCTACGCCACCCCAACATCGTGGAGCTGAAGGAGGTGGTGGTGGGGAACCACCTGGAGAGCATCTTCCTGGTGATGGGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAAAACATGCCCACTCCTTTCTCTGAGGCCCAGGTCAAGTGCATTGTGCTGCAGGTGCTCCGGGGACTCCAGTACCTGCACAGGAACTTCATCATCCACAGGGACCTGAAGGTCTCCAATCTGCTCATGACTGACAAGGGCTGTGTGAAGACAGCGGACTTTGGCCTGGCCCGGGCCTCTGGGGTCCCAATGAAGCCAGTGACTCCCAAGGTGGTCACCCTCTGGTACCGTGCCCCTGAGCTGCTGCTGGGAACTACGACCCAGACCACCAGCATCGACATGTGGGCCGTGGGCTGCATCCTGGCTGAGCTGTTGGCCCACAAGCCCCTGCTCCCTGGCACATCTGAGATCCACCAGGTTGACCTGATTGTGCAGCTGCTGGGGACGCCCAGCGAGAACATCTGGCCGGGCTTTTCCAAACTGCCACTGGTCAGCCAGTACAGCCTGAGGAAGCAGCCATACAACAACCTCAAGCACAAGTTCCCATGGCTCTCGGAGGCTGGGCTGCGTCTGCTGAATTTCCTCTTCATGTATGATCCCAAGAAAAGGGCAACAGCGGGGGACTGCTTGGAGAGCTCTTATTTCAAGGAGAAGCCCCTGCCCTGCGAGCCAGAACTCATGCCCACCTTCCCTCACCACCGAAATAAGCGGGCTGCTCCAGGCGTGGCAGAGGGCCAGAGCAAAAGGTGCAAGCCCTGA

XM_004842774.1 Coding sequence

Hsdl1 hydroxysteroid dehydrogenase like 1, transcript variant X3

High confidence: 4 potential gene matches
Length: 993 bp    Location: 3441781..3462857   Strand: +
>XM_004842774.1
ATGGCTGCTGTTGACAGCTTCTACCTCTTGTACAGGGAAATTGCCAGGTCTTGCAATTGCTATATGGAAGCTCTGGCTTTGGTTGGAGCCTGGTACACGGCCAGAAAAAGCATCACCGTCGTCTGTGACTTTTACAGCCTGATCAGACTGCACTTTATCCCTCGCCTGGGGAGCAGAACAGACCTGACCAAGCAGTATGGAAGATGGGCCATCGTCAGTGGTGCGACCGATGGGATTGGAAAAGCCTATGCTGAAGAGCTAGCAAGCCGAGGTCTCAATATTATTCTGATTAGCCGGAACGAAGAGAAGTTACAGAATGTTGCTAAAGACATAGCTGACACCTACAGAGTGGAAACTGATGTTATAGTTGCAGACTTCAGCAGAGGCCGTGAGATCTACGATCTGATTCAGGAAGCTCTGAAAGACAGAGATGTTGGCATCTTGGTGAATAACGTAGGCGTGTCTTATCCCTACCCCCAGTATTTCACGCAGGTCTCCGAGGACAAGCTGTGGGACATCATAAATGTGAACATTGCGGCCGCCAGTTTGATGGTCCACATAGTGTTACCCGGAATGGTGGAGAGAAAGAAAGGTGCTATTGTCACCATCTCCTCTGGCTCCTGCTGCAAACCCACTCCCCAGCTGGCGGCATTTTCTGCTTCTAAGGCTTACTTAGACCACTTCAGCAGAGCACTGCAGTATGAGTATGCTTCTAAAGGAATCTTTGTGCAGAGTCTAATCCCGTTCTACGTTGCTACCAACACGGCTGCTCCTCGAAGCTTTCTGCACAGATGCTCATGGTTGGTGCCTTCGCCAAAAGTATACGCACATCACGCTGTCTCTACCCTCGGAATTTCCAAAAGGACCACGGGGTACTGGTCCCACTCCATTCAGTTTCTTTTTGCCCAGTATATGCCTGAATGGCTGTGGGTATGGGGAGCAAATATTCTCAATCGCTCGTTACAAAAGGAGGCCTTATCCTGCAAAGCATGA

XM_004842753.1 Coding sequence

Irf8 interferon regulatory factor 8, transcript variant X2

High confidence: 4 potential gene matches
Length: 1281 bp    Location: 2273018..2288901   Strand: +
>XM_004842753.1
ATGTGTGACAGGAATGGCGGGCGGCGGCTTCGGCAGTGGCTGATTGAACAAATCGACAGCAACATGTACCCAGGGCTGATTTGGGAGAATGAGGAGAAGAGCATGTTCCGCATCCCGTGGAAGCACGCCGGCAAGCAGGATTATAACCAGGAGGTGGATGCCTCCATCTTCAAGGCCTGGGCAGTTTTTAAAGGGAAGTTTAAAGAAGGAGACAAAGCTGAACCAGCCACTTGGAAGACAAGGTTACGCTGTGCTTTGAACAAGAGCCCAGATTTTGAGGAAGTGACAGACCGATCCCAGCTGGACATTTCCGAGCCATACAAAGTTTATAGAATTGTCCCGGAGGAAGAGCAAAAATGCAAACTGGGCCTCGCGCCTCCCGGCTGTGTGAATGACGTCGCGGAGATGGAGTGTGGCCGCCCCGAGTTGGAGGACATGATCAAGGAGCCTCCTGTGGATGACTACATGGGGTTGATCAAGAGGAGCCCGTCCCCGCCAGAGGCCTGCAGGAGCCAGCTCCTCCCGGACTGGTGGGTGCCGCAGCCCAGCGCAGGCTTGCCGCTGGTGACCGGGTACCCCACCTATGACCCACACCATGCAGCCTTCTCCCAGATGGTGATCAGCTTCTACTACGGGGGCAAGCTGGTGGGCCAGGCCACCACCACCTGCCCCGAGGGCTGCCGCCTGGCCCTGGGCCCGCCGGGGCTGCCCAGCGCCAAGCTGTACGGGCCCGAGGGCCTGGAGCTGGTCCGCTTCCCGCCGGCTGACACCATTGCCACCGAGCGCCAAAGGCAGGTGACACGGAAACTGCTCGGGCACCTGGAGCGCGGCGTGCTCCTGCACAGCAGCCGTCAGGGCGTGTTCGTCAAGCGGCTGTGCCAGGGCCGTGTGTTCTGCAGTGGCAACGCCGTGGTGCGCAAGGGCAGGCCCAACAAGCTGGAGCGCGACGAGGTGGTCCAGGTCTTCGACACCAGCCAGTTCTTCCGAGAGCTACAGCAGTTCTACGGCAGCCAGGCCCGCCTGCCGGACAGCAGGGTGGTGCTGTGCTTTGGGGAGGAGTTTCCGGACATGGCGCCCTTGCGCTCCAAGCTCATCCTGGTGCAGGTGGAGCAGCTGTATGTCCGGCAGCTGGTGGAGGACTCGGGGAAGAGCTGCAGTGTGGGCGCTGTGCTGCCAGCCCCCGAGGAGCCCCAGCCGGACCAGGCCTTCCGGATGTTTCCCGAGATTTGTGCCTCTCACCAGAGACCCTTTTTCAGAGAAAACCAGCAGATCACGGTCTGA

XM_004842719.1 Coding sequence

Cotl1 coactosin-like 1 (Dictyostelium)

High confidence: 4 potential gene matches
Length: 429 bp    Location: 1510177..1485301   Strand: -
>XM_004842719.1
ATGGCCACCAGGATCGACAAGGAGGCGTGCCGCGAGGCGTACAACCTGGTGCGCGACGACGGCTCGGCGGTCATCTGGGTGACTTTCAGATACGATGGCGCCACCATCGTCCCCGGCGAGCAGGGCGCCGAGTACCAGCACTTCGTCCAGCAGTGCACAGATGACGTCCGGCTGTTCGCCTTTGTGCGCTTCACCACGGGGGACGCCATGAGCAAGCGGTCCAAGTTTGCCCTCATCACATGGATCGGGGAGAATGTCAGCGGGCTACAGCGTGCCAAGACCGGCACAGACAAGACCCTGGTGAAGGAAGTGGTGCAGAATTTTGCTAAAGAGTTCGTGATCAGCGATCGGAAGGAGCTGGAGGAAGATTTCATCAAGAACGAGCTGAAGAAGGCGGGGGGCGTGAATTACGACGCCCAGACAGAGTAA

XM_004842608.1 Coding sequence

unclassified transcription discrepancy mRNA

High confidence: 4 potential gene matches
Length: 570 bp    Location: 49537..58790   Strand: +
>XM_004842608.1
ATGCGCTGCGCCCGGAGCCGGGGCCGAGTCGGCACCGCAGCTGTTGGCGCTCCCGGAAGGGTGACGCCGCCTGCGTCCCCCGCCGCGCCCGCCGGCCAAATGGAGCCTCCAGAGGGCCCGGGAGGGATCGTTAAGGAGGTGGAGGTGCAGCAGGCTGCCCTGGGTGTCCCAGCCCATGGGACAGGGGACAGTGGCCACACACCTGTGGCTGAGGAGGCGGCAGGCATCCCAATCCCAGCACCAGGTCTCCTGCAGGTCACAGAGAGGAGGCAGCCCCTGAGCAGTGTCTCCTCTCTGGAGGTCCACTTTGACCTCCTGGACCTCACTGAGCTCACCGACATGTCAGACCAGGAGCTGGCTGAGGTCTTTGCTGACTCCGATGATGAAAACCTGACCAGTGAATCCCCGGCAGGTCTGCACCCACTGCCCCGAGCAGGCTGCCTACGCTCCCCCTCCTGGACGAGGACGAGGGCCGAGCAGAACCGAGAGAAGCAGCCGCTTGGAGACCCGGAGCGGCAAGCTGCGATCGTGGACACATTTCTCACCGTGGAGGGGCCCAAGGAAGACTAG

XM_004842673.1 Coding sequence

Aprt adenine phosphoribosyltransferase

High confidence: 4 potential gene matches
Length: 543 bp    Location: 805758..807963   Strand: +
>XM_004842673.1
ATGTCGGAGCCCGAGCTGCAGCTGGTGGCCCGGCGCATTCGCAGCTTCCCCGACTTCCCCATCCCAGGCGTGCTCTTTAGGGACATCTCGCCCCTCCTAAAGGACCCCGAATCCTTCCGCGCTTGCATCCGCCTGCTGGCCAGCCATCTGAAGACCGCGCACGGAGGCAAGATTGACTACATCGCAGGCCTGGACTCCAGGGGCTTCCTGTTTGGGCCCTCGCTGGCCCAGGAGCTGGGCCTGGGCTATGTGCTCATCCGGAAGCGCGGGAAGCTGCCGGGCCCCACTGTGTCTGCCTCCTATGCACTGGAATACGGGAAGGCCGAGCTGGAGATCCAGAAGGATGCCCTGGAGCCCGGGCAGAAGGTGGTTGTGGTGGACGACCTGCTGGCCACTGGTGGAACCATGTGTGCGGCCTGTGAGCTGCTGGGCCAGCTGGGGGCCGAGGTGCTGGAAAGCGTGACCCTGGTGGAGCTGACCTCACTCAAGGGCAGGGAGAAGTTGGGCCCCGTCCCCTTCTTCTCCCTCCTGCAGTACGAGTGA

XM_004842682.1 Coding sequence

Rnf166 ring finger protein 166, transcript variant X1

High confidence: 4 potential gene matches
Length: 714 bp    Location: 878208..886151   Strand: +
>XM_004842682.1
ATGGCGATGTTCCGCAGCCTGGTGGCTTCGGCTCATCAGCGGCAGCCGCCGCCCGGGCCTGCGGGCGGCGACAGCGGCCTGGAGGCGCAGTACAGTTGTCCCATCTGCCTGGAGGTGTACCACCGGCCGGTGGCCATCGGCAGCTGCGGCCACACGTTCTGCGGGGAGTGCCTCCAGCCATGTCTGCAGGTGCCATCCCCTCTGTGCCCGCTCTGCCGCCTGCCCTTTGACCCCAAGAAAGTGGACAAAGCCACTCACGTGGAGAAGCAGCTCTCGTCCTACAAGGCTCCCTGCCGGGGCTGCAACAAGAAGGTGACCCTGGCGAAGATGAGAGTGCACGTGTCCTCGTGCCTGAAGGTCCAGGAGCAGATGGCCAACTGCCCCAAGTTTGTCCCCGTGGTGCCCACCTCCCAGCCCATTCCAAGCAACGTCCCCAACAGGTCCACCTTTGCCTGCCCCTACTGCGGCGCCCGCAACCTGGACCAGCAGGAGCTGGTGAAGCACTGTGTGGAGAGCCACCGCAGCGACCCCAACCGAGTGGTGTGCCCCATCTGCTCAGCCATGCCCTGGGGTGACCCGAGCTACAAGAGCGCCAACTTCCTGCAGCACCTGCTGCACCGGCACAAGTTCTCCTACGACACCTTCGTGGACTATAGCATCGATGAAGAAGCTGCCTTCCAGGCTGCCCTGGCCCTGTCCCTCTCTGAGAACTGA

XM_004842649.1 Coding sequence

Ankrd11 ankyrin repeat domain 11, transcript variant X7

High confidence: 4 potential gene matches
Length: 7908 bp    Location: 461933..576809   Strand: +
>XM_004842649.1
ATGCCCAAGAGTGGGTGTTCTAAAACACCACAGCAAGAAGACTTTCCTCTCAGCAACGACATGGTGGAGAAACAAACTGGGAAAAAGGATAAAGATAAAGTTTCTCTAACCAAGACCCCAAAGCTGGACCGCAGTGATGGAGGGAAGGAGGTGAGAGAGCGTACCACCAAGCGGAAGCTGCCCTTCACCGTGGGGGCCAATGGAGAGCAGAAGGACTCAGACACAGAGAAGCAGGGTCCCGAGCGGAAGAGGATCAAGAAGGAGCCTGTCGCCCGAAAGTCTGGGCTGCTGTTTGGCATGGGGCTGTCTGGGATCCGGGCCGGCTATCCCCTCTCCGAGCGCCAGCAGGTGGCTCTCCTCATGCAGATGACGGCCGAGGAGTCTGCCAACAGCCCAGACACAACACCAAAGCACCCCTCCCAGTCTACAGTGTGTCAGAAGGGGACGCCTAACTCTGCCTCAAAAACCAAAGATAAAGTGAACAAGAGGAATGAGCGGGGGGAGACCCGCCTGCACCGGGCCGCCATCCGAGGAGACGCCCGGCGCATCAAGGAGCTCATCAGTGAGGGTGCAGACGTCAACGTCAAGGACTTTGCAGGCTGGACAGCGCTGCATGAGGCGTGTAACCGGGGCTACTACGATGTCGCCAAGCAGCTGCTGGCCGCAGGTGCAGAGGTGAACACCAAAGGCCTGGATGATGACACGCCTTTGCATGATGCCGCCAACAACGGCCACTACAAGGTGGTGAAGCTGTTGTTACGGTATGGGGGGAATCCTCAGCAGAGCAACCGGAAAGGCGAGACCCCGTTGAAAGTGGCCAATTCCCCCACGATGGTGAATCTGCTGTTAGGCAAAGGCACCTACACGTCCAGTGAAGAGAGCTCCACTGAGAGCTCTGAGGAGGAAGACGCCCCGTCATTCGCGCCGTCCAGCTCAGTCGACGGCAATAACACGGACTCTGAGTTTGAGAAAGGCCTGAAGCTCAAGGCCAAGAATCCAGAGCCACAGAAGGCCGTGACCCCTGTCAAGGACGAGTACGAGTTTGATGAGGATGACGAGCAGGACAGGGTCCCCCCAGTGGATGACAAGCACTTGCTAAAGAAGGATTACAGGAAAGAGACTAAGTCAAACAGTTTCATTTCGATACCCAAAATGGAAGTTAAGAGTTACACCAAGAACAATACGATTGCACCAAAGAAAGCAGCCCATCGTATCCTGTCAGACACATCCGACGAGGAGGACACTGGCCTCGCCGTTGGTGCCGGGGAGAAGCTGAGGCTGTCAGCACACTCTGTGCTGCCCAGCAGCAAGGTACGGGAGCCGTCCAACTCCAGGCAGCAGAAGGAGAAAAGCAAAGTGAAGAAGAAGCGAAAGAAAGAAGCAAAAAGCAAAGAAGTTCGCTTTGGAAAGAGGAATGACAAGTTCTGTTCCTCTGAGTCAGAGAGCGAGTCCTCAGAGAGTGAGGAGGACGATGACGACTCTGTGGGGAGCACAGGCTGCCTCAAGGGGTCCCCACTGGTGCTGAAGGACCCCTCCCTGTTCAGCTCACTGTCTGCCTCCTCCACCTCCTCCCACGGCAGTGCCGTGGCCCCGAAGCACGGCACCAACCACGGTGATCAGCATGCCAAGCACTGGCGCACGGACAACTGGAAAGCCATCTCCTCCCCGGCCTGGTCTGAGGTCAGCTCCCTGTCAGACTCCTCACGGACAGGACTGACGAGCGAGTCTGACTGCCCCTCTGAGGGCTCCAGCGTGGAGTCGCTGAAGCCCACAAGGAGGAAGCAGGAGCTCCGGAAGAGGGGCAGCCTGCCAAGTGCACCACCGGAGAAGAGGGGCACCTGCCACCCTGGCACAGATGGCGCTGTCCCCAAGCTGGACAAGGAGGGAAAAGTCGTCAAAAAACACAAGACAAAACACAAACACAAAAACAAGGAGAAGGGGCAGTGTTCCGTGAGCCAGGAACTTAAACTGAAAAGTTTTACGTACGAATACGAGGACTCCAAGCAAAAGTCAGAGAAAGCCATCCTCTTAGACAATGACATTTCCACAGACAATAAGCTGAAAGTGCTGAAGCACGACCGAGACCATTTTAAGAAAGAAGAGAAGCTCAGCAAACTGAAGTCAGAAGACAAGGAGTGGATCTTCAAAGAAGAGATGCTTAAGGTCTCCAAAGACGAGAAGTTGATGAAGAGGGCCAAAGACATCGGCAGGTCTTTCCGGGAAGAGAAAGACCGTTCCGGTAAAACAGAGAGGGAGAAGGCTGTGAAGGAAAAGTCCCCCAAAGAGGAACGGCTGAGGCTCTACAAAGAGGAGAAGAAGAAAAAGTCCAAAGACCGGCCTTCGAAGTTAGAGAAGAAGAATGACATGAAGGAGGACAGGGCTTGCAAGGAGAAGGAAAAGCTCAAAAAGGAAAAAGGTTACAGAGACGATGCTGCATTTGACGAATTCTGCAGCAAAACTCAGTTTCTAGAGAATGAGGACACCAAATTCAGCCTTTCTGATGATCAGCAAGAGAGGTGGTTTTCTGACCTGTCTGATTCCTCCTTTGATTTCAAAGGGGAGGACAGCTGGGACTCCCCAGTGACAGACTACAGGGACATCAAGAATGACTCTGTGGCCAAACTCATCTTAGAGACAGTGAAGGAGGATAGTAAGGAGAAGAAGCGAGACAACAGAGCCCGGGAGAAGCGGGACTTCAGAGACTCGTTCTTCCGAAAGAAAGACAGGGACTGTCTGGACAAGAGCTCCGAGAAGAGAAGAGACCAGGTGGAGAAGCACAAAGGCGTCCCCAGCTACCTCTCTGAGAAAGACAAGAAGAGGAGGGAATGTGCCGAGGGCGGGCGCGATCGCAGGGATGGCCTGGACGGCTCCCGGGAGCGCAAGGAAGCCCGGCTCCGGCCTGAGGAGGCGCATCGGGAGGACTTGAAGGACTGTGGCTGCGAGAGTGCATTCAGGGACAAGCCGGACTCTGACCTCCCCAAGGGCCTCGAGCCCTGGGAACGGCCCCACGCCCTGCGCCTGGAGAAGGACCGGAAGGAGAAGGTGCGGGTGGAGAAGTGCAAAGACAAGTCACTGGACAGAGACAAGAGCGAGAAATCTCTCCTTGAGAAATGTCAGAAGGACAAAGAATTTGACAAATGTTTTAAAGAGAAGAGAGATGCTAAGGAAAAGCATAAAGAGGCCCACAGCAAAGACAGGAAGGCGTCGCTCGACCAAGGGAGAGAGAAGAAGGAGAAGATGTTCCCTGGACTTCTCTCAGAAGACTTCTCCGAAAAAAAAGATGAAAAGAAAGGGAGAGAGAAGAGCTGGTACATTGCAGACATATTCACAGACGAAAGTGAAGATGAAAAAGATGACTATATGGCCAGCAGCTTCAAGGCCGGGGAAGCCGGGGACGCGCAGAGAGGGGACAGCCTCCAGGACAAGGAGGATGGCAGAGAGCTGCATCTCTTGGACAGACACCGGAAGTCCTCTGACCGGCAGCACGCAGAGAAGCCAAGGGATAAAGAGCCCAAGGAGAAGAGGAAGGACAGGGTGGCTGCCGACAGTGGGCGCGACAGGAAGGACAAGATCTTTGAGAAGCACCGAGAGAAGAAGGACAAAGAGTGTGCAGAGAGATACAAGGACAGGAAAGACAGGGCTTCCGTCGACTCTGCCCAGGAAAAGAAGAACAAGCAGAAGCTCCCTGAGAAGGTGGAGAAGAAGCACTCCACCGAAGACAAGGCCAAGAGTAAGCACAAGGACAAGCCAGAGAAGGAGCACTCCAAAGAGAGGAAGGGCTCGAGGGGCGCCGAGGCAGAGAAGAGCCTGCTGGAGAAGCTGGAGGAGGAGGCGCTGCACGAGGACCGGGAGGACTCCAATGACAAAGCCAGCGAGGTCTCGTCAGACAGCTTCACAGACCGGGGCCAGGAGCCGGGCCTGAGCGCCCTCCTGGAGGTGTCCTTCTCAGAGCCGCCCGATGACAAGGCCAGAGAGAGCTGCCTCACGGAGAAGCTGAGGGACAGGGAGCGGCACAGGCACTCCTCATCCTCCTCCAAGAAGAGCCACGACCGGGAGCGAGCCAAGAAGGAGAAGGCTGAGAAGAAAGAGAAGGCCGAGGACTACAAGGACGGTGGCTGCAGGAAGGACTCGAGCCAGTATGAGAAGGACTTCCTGGATGCAGAGGCCTACGGGGTCGCCTACACCGTGAAAGCCGACATGGAAGAGGAGTTGGATAAGACCGTTGAGATATTTCCCTCGGAAAAGAAAGAGAGAAATGATCCCGAGAGAGAATCTGCCAAGAAAATCGAGAAGGAACTAAAGCCTTACGGATCTAGTACCATCAGCATCCTGAAGGAGAAGAAGAAAAGAGAGAAACACAGGGAGAAGTGGAGAGACGAGAAGGAGAGACACCGGGAGAAGCACACGGACGGGTTCCTCAAACACCACAAGGACGAGCCAAAGCCCGCAGCCAAAGACAAGGACAACCCTCCGAACTCCTTCAGGGAGAAGTCCAGGGACGAAAGCCTGAAACTCAGTGAGACCAAGCTGAAGGAGAAGCTCAGGGAGAACACAGAGAGAGAAAAGGCGGACTCCATGAAGATCAGCAACGGCAGCGACAAGCTCCCGCTGGCCAGAGACCTGGGCAAGAAGGACGCCCGGCCCCGGGAGAAGCTCCTAGGAGACGGCGACCTGATGATGACCAGCTTTGAGAGGATGCTATCCCAGAAGGACCTGGAGGTCGAGGAGCGCCACAAGCGTCACAAGGAGCGCATGAAGCAGATGGAGAAGATGAGGCACAGGTCTGGGGACCCCAAGCTCAAGGACAAGACCAAGCCCCCCGAGGAGGGGCGGAAGAAGAGCCTGGACGTTCCTCCTAAGAAACCCCTGGGGCCAGACCCTCCCTTCAAGGAGAAGAAGCTCAAGGACTCCGCTCCCACACCACCCGCCACCGCCATCGAGGGCAAGCTGGGGCCCGGGGCGGAGTGCAAAGACTGGCCGGCAGCGCCGCCCCCCAAGGAGGTGTTGCCCCCCTCCCCCCGGCCTGAGCAGAGCCGGCCCACTGGGGTGCCCACGCCAAGCTACGAGGAGGTGATGCACACGCCCAGGACGCCGTCCTGCAGCGCTGATGACTACCCCGACCTGGTGTTTGACTGTGCGGACTCCCAGCACTCAATGCCTGTCTCCGCCACGTCCACCAGCACCTGCTCTCCGCCGTTTTTTGACAGGTTCTCTGTGGCTTCCAGTGGGGTGTCAGAAAACCCGGGCCAGACACCCACAAGGCCTGTCTCCTCCAACCTGTACCGCTCCATCTCTGTGGACATCAGGAGAACCCCCGAGGAAGAGTTCAGTGTCGGGGACAAGTTGTTCAGGCAGCAGAGCGTGCCTGCGGCCTCCAGCTTCGGCTCCCCTGTGCAGCACCTGCTGGAAGACAAGGCCCCGCTACCGCCTGTTCCCTCTGAAAAGTTCCCCTGCCTGTCCCCAGGGTACTACTCCCCAGACTACGGCATCCCCTCGGGCATGCCCTCACCCAAGGTGGATTCGCTCCACTGCCCCCCTGCCTGCACGGTGAGCGTCACGCCCTCCCCCGAGGGCGTCTTCTCCAGTTTACCAGCAAAAGCCTCTCCTCCCAGAGGTGAGCTGTTTGCCCCTGCTGTAGATGGGGCCCTCACCCCAGACCTGGGCCTCCCTCTGGACGCCACAGAGGACCAGCAGGCCACAGCCGCCATCATCCCCCCAGAGCCCAGCTACCTGGAACCCTTGGATGAGGGCCCCTTCAGCACTGTCATCACTGAGGAGCCTGGGGAGTGGGCGCACCCTGCTGCCGAGCAGACCCTTTCTCCCTCCTTGGTCACTGGTGCCTCTGAAAACCCTGTCAGCTGGCCTGTGGGTGCCGACCTCCTGCTGAAGTCCCCTCAGAGGTTCCCAGAGTCCCCTAAACATTACTGCCCTGCTGAGTCCCTCCACACTGCCACCCCAGGGCCCTTCAGTGCTGCAGAGCCCCCGTACCCTGTCTCTCCTGTCTCCTACCCTCTGCCAGCCGCCGAGCCAGACCTGGAGGAAGTCAAAGATGATGGGGTGGGAGCCATCTCCGCCACCACCGAGGGAGGCACACCTTACACCACCCCTGCCAGGCTCGAGTCCTTCTTTGGCAGCTGCAAGCCACTCCCCGATGCACCCCTCGACCAGGTGCCTGAGCCCACATGTGTCTCCACGGTGGCCCAGGTGGAGGCCCTCGGAGCCCTGGAGAGCAGCTTCCTGGACAGTGGCCACGGCCTGGCTGCTCTTGGCCAGGTGGAGCCCGTACCCTGGCACGACGCCTTCACCAGCACCGAGGACGACCTGGACCTGGGGCCCTTCTCACTGCCGGAGCTCCCTCTGCAGCCCAAGGACCCCCCAGATGTTGAAATGGAGCCTGCAGGAGGAAGCCCTGCTCCCCCAGGAGAGGCCCTCCCTGTGCCCGCTGGGGTCAGCAGTGATGGGGACGGCCCTGTGGCCGAGGCCGAGGATCAGCCAGCTCCACCTACCGAGCAGGCCGTCCCCCGACTCCCTGCTGAGCTCGAGCCCTCCGAGGAACCGAAGCTGGATGTGGTTCTGGAAGCCACTGTGGAAGCAGAAGCAGTGGCGGACGAGCAGGCCCCTGAGGACCTGGACTCCGGCTCAGTGCCTGTGCCCGGCCCCCCAGAATGGCATCCCCTGGAGGGCGGAGATGAGGTGGAGGCTGAAGCCCCTGCGGCTGCGCCCCACTGTGCCCCTGACGGCCCCCCCCAGGAGGCCCCCCCACAGGCCCAAGCTGATTCAGAGGCCACCCCTGCTGCCACCCCAGCCGAGGGGCCTCTGGGCAGCGTGCAGCCAGGAGCTCCAGAGCCCGAGCCCAGGCCTGCAGCTGAAGCCCCCAAGGCCCCCCGGGTGGAGGAGGTTCCTCAGCGCATGACCAGGAACCGGGCCCAGATGTTGGCCAGTCAGAGCAAGCAGGGCACACCACCCACAGAGAAGGAGCCTGCACCCGCGCCCACACCCACGTCCACGCAGGCCTCCCGAACCAAGGCCCGTGCCCCCGAGGAGGAGGACGCCCAAGCCCAGCACCCGCGCAAGCGCCGCTTCCAGCGCTCCAGCCAGCAGCTGCAGCAGCAGCTGCACACGTCCACACGGCAGACTCGGGAGGTCATCCAGCAGACACTGGCCGCCATTGTGGACGCCATCAAGCTGGACGACATTGAGCCCTATCACAGTGACAGATCCAACCCATACTTTGAGTACCTTCAGATCAGAAAGAAGATCGAAGAGAAGCGCAAGATCCTCTGCTACATCACACCACAGGCGCCCCAGTGCTACGCTGAGTACGTCACCTACACGGGGTCCTACCTCTTAGACGGCAAGCCACTCAGCAAGCTCCACATCCCTGTGATCGCGCCCCCACCCTCCCTGGCAGAGCCCCTCAAGGAGCTCTTCAAGCAGCAGGAAGCTGTGCGGGGGAAGCTGCGTCTGCAGCACAGCATCGAGCGGGAGAAGCTCATAGTGTCCTGTGAGCAGGAGATCCTGCGGGTCCATTGCCGGGCAGCCCGGACGATTGCCAACCAGGCGGTGCCTTTCAGCGCCTGCACGATGCTGTTAGACTCTGAGGTCTACAACATGCCCCTGGAGAGCCAGGGGGATGAGAACAAGTCGGTGCGAGATCGCTTCAACGCCCGCCAGTTCATCTCCTGGCTGCAGGACGTGGACGACAAGTACGACCGCATGAAGACGTGTCTCCTGATGCGGCAGCAGCACGAGGCGGCGGCCCTCAATGCCGTGCAGAGGATGGAGTGGCAGCTGAAGGCACAGGAGCTGGACCCTGCGGGGCACAAGTCCCTGTGCGTGAACGAGGTGCCCTCCTTCTATGTGCCCATGGTTGATGTCAACGACGATTTTGTGCTGCTGCCAGCGTGA

XM_004842618.1 Coding sequence

Tcf25 transcription factor 25 (basic helix-loop-helix), transcript variant X2

High confidence: 4 potential gene matches
Length: 2031 bp    Location: 162442..137932   Strand: -
>XM_004842618.1
ATGTCGCGCCGGGCCCTCCGGAGGCTGAGGGGGGAACAGCGTGGACAGGAGCCCCTCGGGCCCGGAGCCCTGCAGTTTGTCCTCCGTGATGACGAAGACGCAGAAGAAGAAGGACCAAAGGGGGGCCCGGGGGTTCGGGTCCCCGGAGGCACAGGGAAAGAGGGCGTTCAAGTCAACAACCGGTTCGAGCTGATAAACATTGAGGACCTTGAGGACGACACTGTGGTAAACGGGGAGAGGTCTGACTGTGTGCGTGCACACTCTATGGCTTCGGGAAACAAAGCAAGGCCCCCACGTGGAGGCCCAGAGACCCAGCGAGATGGGGATGTGATCAAGGCAGTGTTCCCAGAGCAGTCTAATGTAAGTGGCAAACTCCGAAAGAAGAAAAAGAAGCAAAGAAACAAGAAAAACAGCACAGGAGAGACCTCGGAGAATGGGCTGGAAGACATTGACCGAATCCTGGAGAGGATCGAGGATGGCAGTGGGCTCAGCCACCCTGGCCCCCCTCTGCCCAGCTCCAGGAAGCACGTCTTACATGTGGAGCACAGACACTTGAATCCAGACACAGAACTGAAGAGATATTTTGGTGCTCGAGCGGTCCTGGGGGAACAGAGGCCACGGCAGAGACAGCGTGTGTACCCCAAGTGTACATGGCTGACGACCCCCAAGAGTACCTGGCCCCGGTACAGCAAACCAGGTCTGTCCATGCGGCTTCTGGAATCGAAGAAAGGTCTCTCCTTCTTTGCCTTTGAGCATAGCGAGGATTACCAGCAGGCACAGCACAAGTTTCTGGTGGCCGTGGAGTCAATGGAGCCCAACAACATTGTGGTTCTGCTCCAGACAAGCCCCTACCATGTAGACTCGCTCCTGCAGCTCAGCGATGCCTGCCGCTTTCAGGATGACCAGGAGATGGCTCGAGACCTGACAGAGAGAGCACTGTACAGCATGGAGTGCGCCTTCCACCCTTTGTTCAGCCTCACCAGTGGGACTTGCCGGCTGGATTACCGCAGGCCTGAGAACAGGAGCTTCTACCTGGCCCTCTATAAGCAGATGAGCTTCCTGGAGAAACGAGGCTGCCCACGTACTGCGCTGGAGTACTGCAAGCTCATCCTCAGCCTGGAGCCAGATGAGGACCCCCTCTGCATGCTGCTGCTTATTGACCACCTGGCCTTGAGGGCCCGGAACTACGAGTACTTGATCCACCTCTTCCAGGAGTGGGAGGCGCATCGGAACCTGTCCCAGCTCCCAAATTTTGCCTTCTCAGTGTCGTTAGCATATTTCTTGCTGAGTCAGCAGATAGACCTCCCCCAGCAGGAGCTGAACTCCACAAGGGAAAAGGCCTCCACCCTCATCCAGCAGGCGCTCATCATGTTCCCTGGAGTTCTCATGCCCTTGCTGGAGTCCTGCAGTGTGCGGCCCGACGCTGCTGTCTCAGGTCACCACTTCTTTGGCCCCGAGGCTGAGATAAGCCAGCCACCTGCCCTGAGCCAGCTGGTGAGCCTGTACCTTGGGAGGTCTCACTTTCTCTGGAAAGAACCTGCCACCATGAGCTGGCTGGAGGAGAATGTCCGAGAAGTTTTGCGAGCTGTGGACGCAGGGGACCCCACCGTGCAGGCCTGTGAGGGCAGGCGGAAGGTGCTGTACCAGCGTGCACCCAGGAACATCCACCGTCACGTGATCCTCTCGGAGATCAAGGAGGCTGTGGCCGTGCTGCCTCCGGAGGTGACCACGCAGTCTGTGATGGGGTTTGACCCTCTGCCTCCCCTGGACACCATCTACTCCTACGTCCGACCCGAGAGGCTAAGTCCTGTCAGCCATGGAAACACGATCGCCCTCTTCTTCCGGTCACTATTGCCAAACTACACCATGGAGGGAGAGAGGCTGGAGGAAGGAGTGGCTGGAGGTCTGAACCGAAACCAAGGCTTGAACCGGCTGATGCTGGCTGTGCGTGACCTGATGGCCAACTTCCACTTTAACGACATGGAGGTGCCACACGAGGAAAACCCTGAGGGGGAGGCTGACTGGGACTGA

XM_004843018.1 Coding sequence

Gfod2 glucose-fructose oxidoreductase domain containing 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 1158 bp    Location: 18649494..18676044   Strand: +
>XM_004843018.1
ATGAAGATGCTGCCGGGAGTGGGTGTGTTTGGGACTGGCAGCTCAGCCCGGGTCCTGGTCCCACTACTAAGAGCAGAAGGGTTCACTGTGGAGGCCCTGTGGGGGAAGACAGAGGAGGAGGCGAAGCAGCTTGCGGAGGAGATGGACATCACCTTCTATACTAGCCGCACTGATGACGTCTTGCTGCATCAGGACGTGGATCTGGTGTGCATCAACATCCCCCCTCCGCTTACTCGACAGATATCTGTAAAAGCTCTAGGTATTGGGAAGAATGTGGTCTGTGAGAAGGCAGCAACATCGGTGGATGCCTTCCGGATGGTGACAGCTTCACGCTACTACCCACAGCTGATGAGCCTGGTGGGGAATGTGCTGCGCTTCCTGCCTGCCTTCGTGCGCATGAAGCAGCTGATTGCAGAGCATTATGTAGGCGCAGTGATGATCTGTGATGCCCGCATCTACTCAGGCAGCCTGCTCAGCCCCAGCTATGGCTGGATCTGTGATGAGCTCATGGGTGGCGGGGGCCTGCATACCATGGGCACCTACATCGTGGACCTGCTGACCCACTTGACTGGCAGGAGAGCTGAGAAGGTCCATGGGCTGCTCAAGACCTTCGTGAGGCAGAATGCTGCCATCCGAGGCATCCGGCATGTCACCAGCGATGACTTCTGTTTCTTCCAAATGCTCATGGGTGGAGGAGTATGCAGCACAGTGACACTTAACTTCAACATGCCTGGTGCCTTTGTGCATGAAGTCATGGTTGTGGGCTCTTCAGGGCGCCTTGTCGCCCGGGGAGCTGACCTCTATGGGCAAAAGAATTCTGCCACACAAGAGGAGCTGCTAGTGAGAGACTCACTGGCCATGGGCTCAGGGCTGCCCGAACAGAGGCCCCAGGATGTCCCGCTGCTCTACCTGAAGGGCATGGTCTACATGGTGCAGGCCTTGCGCCAGTCCTTCCAGGGGCAGGGGGACCGCCGCACCTGGGATCGCACCCCTGTCTCCATGGCTGCCTCATTCGAGGATGGGCTCTACATGCAGAGTGTGGTGGATGCCATCAAGAGGTCAAGCCGATCAGGGGAGTGGGAGACCGTAGAGATTCTGACAGAGGAGCCTGATGCCAACCAGAACCTGTGTGAAGCACTTCAGCGGAATAACCTATAA

XM_004843014.1 Coding sequence

Tsnaxip1 translin-associated factor X interacting protein 1

High confidence: 4 potential gene matches
Length: 2124 bp    Location: 18558356..18538528   Strand: -
>XM_004843014.1
ATGGCTTCCCCACAGTCGCGGGACTACAGCTTCTCCAAATCGAGAAAATACCCGAGATCTTCAGGAGTGACCTTAGATGATTCCTTTCCAGAATCCAAGAGCAGCCAGAAATTCAAGCTTTCACAGAAACGGAAGACACTGCCTGTGCAATTTTCCATGAGTGGCAACCTGTCCCCATGGCCCACATATGCCAGTGGCCAGACCATTCTGCAAAATCGAAAGCCCTGCTCAGATGATTGCCGGAAGCGCACCAGTAGCTGGCAGCAGCAGCCCATAGGCTTTGCCAAGCCTAGGTACCTGGAGCAGCTAGAGAACTACCTACACAAGGAGCTCCTCCTGCTAGACCTGGGCACGGATTCTGCACAAGAGCTGAGGCTGCAGCCTTACAGGGAGATCTTTGAGTTCTTCATAGAGGATTTCAAAACATACAAGCCACTGCTATCCTCCATCAAGAATGCATATGAGGTGATGCTGGCCCACCAAAAGGAGAAGATTCGGGCCCTGGAGCCCCTGAAGGGCCAGCTTATCACCATGAGTGAGGACTGCAATGAGAGGATCCTGGCCATGAGGGCTGAGGAGAAGTATGAAATCTCTATGCTCAAGAAAGAGAAGATGAATCTGCTAAAACTTATTGACAAAAAGAACGAGGAGAAGATTTCATTGCAGAGTGAGGTGTCCAAGCTGAGGAAGAACTTGGCTGAGGAGTACCTGCGCTACCTCACTGAGCGAGATGCCCGAAAGATTCTCATTGCAGACTTAAATGAATTACGATACCAGCGGGAGGACATGTCATTAGCCCAGTCCCCAGGTGTCTGGGGGGAAGACCCTGTGAAGCTAACACTGGCTCTGAAGATGACTCGGCAAGACCTGACCCACACGCAGATGGAACTCAACACCATGAAGGCTAACTTTGGAGATGTGGTACCCAGGAGAGACTTTGAAATGCAGGAAAAGACCAATAAGGATCTTCAAGAGCAGCTGGACAGCCTGAGAGCTGACTATGAAGAGGTCCGCAAGGAGCATGAAATATTGCTGCAGTTGCATATGACCACACTGAAAGAACGGGACCAGTTCTCTTCTGAGCTGCAGGATATCCAGCGCACCTCCACACCACGACCTGACTGGACCAAGTGTGCAGATGTGGTGGCCGGGGGCCAAGATCGCTGGCAAATGCTGGCTGAAGGCAAGAACAGTGAGCAACTGGTGGATGTGCTGTTGGAAGAGATTGGCGAAGGCCTGCTCCGGGAGAAAGAGTTTTTCCCTGGTCTGGGATATGGGGAGGCAGTCCCCCCTTTTCTTCGGTTTGATGGCCCTGTGAAGAACAAAAAACCAAGCAAGAAAGATGTGGTAAAGCTCCTTAAGGATGCCTGGAAGGAACGTCTCTCAAAGGAACAGAAAGAGAAGTTTCCAGATTTCTTCTTCAATTTCCTGGAGCATCGCTTTGGGCCGAGTGATGCCATAGCCTGGGCATATACCATTTTTGAAAATATCAAGCTTTTCCGCTCCAATGAGGTCATGAGTCGGTTTTATGCAATCTTGATGGGAAAGATGACAGAGAGTGTGTATATCAACCAGAAAGAGACAGTAGCCCAGCTGCTGAAGGAGATGATAAATGCTGACAGTCAGAATGAGGGGCTATTAACCATGGAGCAGTTCAGCACCATCCTCAAGAGCACTTTTCCCCTCAAGAAGGAAGAACATATTCAGCACCTGATGGAGGCAGGGGGCTGGCATCCCAACAGCACCAGTGCAGACTTGCTTGATTACCGCTCATTGTTTAAGGAGGATGAGGAGGGTCAGAGCGAACCCTTTGTGCAAAAGCTGTGGGAACAGTACATGGTTGAGAAGGATGAGTACTTACAGGAACTAAAGCAGGAGCTGGGCATGGAACTCTATGAGGAGGTAACTTTTTCCAAGCTGCAGAGGGCCCTGATGATCATCGATCCCACTCTGGACAAGCAGACTCTGAACACTCACCTGAGCCAGGCCTTCCAGATCCCTGTGTCAGAACTGCCAGAGGATGAGAATGAGGACATTATGACAAGGCTCCAGACTGCAATGGAACAGCTTCAGATGGCTGACGTCAAGCGTATAGGGCCTCGAGAACCAGAGTCTGCAAGCTAA

XM_004842986.1 Coding sequence

Esrp2 epithelial splicing regulatory protein 2

High confidence: 4 potential gene matches
Length: 2157 bp    Location: 18075742..18082422   Strand: +
>XM_004842986.1
ATGAGTCCGCCGCCGCCGCCGCCGCCTCCGACCCCGGCCCCAGACCCCACTATAGACTCCGCCGCAGACCCCTGCCCCGGGTCAGGATCTCTGGCTGTCCTATTCGGGGCTACGGCCGGTGCGCTGGGGCCGGAGCTGGGTTCCGATGAGACCGACTTAATCCTCCTAGTATGGCAAGTGGTGGAGCCGCGAAGCCGCCAGGTGGGGACGCTGCACAAATCGCTGGTACGAGCCGAGGCGGCTGCACTGAGTCCGCAGTGCCGCGAGGCGAGCGGCCTGAGCGCGGACAGCCTGGCCCGGGCCGAGTCGCTGGACAAGGTGCTTCAGCAGTTCTCACAACTGGTGAACAGGGATGTGGCTCTGCTGGGCGGAGGCCCCTATGTGCTCTGCACTGATGGGCAGCAGCTGTTGCGACAGGTCCTGCATCCTGAGGCCTCCAGGAAGAATCTGGTGCTCCCCGACACCTTCTTCTCCTTCTACGACCTCCGCAGAGAGTTCCATATGCAGCACCCGAGCACCTGCTCTGCCAGGGACCTCACCGTGGCCACTATGGCACAGGACTTGGGACTAGAGACAGATGCCACAGAGGATGACTTTGGGGTCTGGGAAGTGAAGACAATGGTGGCTGTCATCCTCCACCTGCTTGAAGGACCCAGTGGTCAATTGTTTTCGAAGCCCGAGGTGGTAAAGCAGAAATATGAGACAGGGCCTTGCAGCAAGGCTGATGTGGTGGAAAGTGAGACTGTGGTACGGGCCCGTGGGCTGCCCTGGCAGTCATCAGACCAGGATGTGGCTCGCTTCTTCAAAGGGCTGAACATTGCCAGGGGTGGTGTAGCACTCTGCCTCAACGCCCAGGGCCGAAGAAATGGTGAGGCCCTCATCCGCTTCACCGACAGGGAGCAGCGGGACCTAGCACTGCAAAGACACAAGCACCACATGGGTGTCCGCTATATTGAGGTCTATAAAGCAACAGGGGAGGAGTTTGTGAAGATTGCAGGGGGCACATCACTAGAGGTAGCTCGTTTCCTGTCACGGGAAGACCAAGTGATCCTAAGGCTGCGGGGACTGCCCTTCTCAGCTGGGCCAGCAGATGTGCTAAGCTTCCTGGGGCCAGAGTGCCCAGTGACTGGGGGTGCTGATGGGCTGCTCTTTGTGCGCCACCCTGATGGCAGGCCAACTGGTGATGCCTTTGCCCTCTTTGCCTGTGAGGAGTTGGCACAGGCTGCACTGCGAAGGCACAAGGGCATGCTGGGTAAGCGATACATTGAACTCTTCCGGAGCACTGCAGCTGAGGTACAGCAGGTCCTGAACCGCTATGCATCCAGCCCACTCCTTCCCACATTGACAGCTCCACTGCTGCCCATCCCTTTCCCACTGGCAGCTGGGACTGGGAGGGACTGTGTGCGCCTTCGAGGCTTGCCTTACACAGCCACCATTGAAGATATTCTGAGCTTTTTGGGGGAGGCGGCAGCTGACATACGGCCCCATGGTGTACACATGGTGCTCAACCAGCAGGGCCGTCCGTCCGGCGATGCTTTCATCCAGATGACATCGGCAGAGCGGGCCCTAGCTGCTGCTCAGCGTTGCCACAAGAAGATGATGAAGGAGCGCTATGTGGAGGTGGTCTCCTGTTCTACAGAGGACATGAGCCGTGTACTGATGGGGGGAACCTTGAGCCGCAGTGGCATGTCCCCTCCACCCTGCAAGCTGCCCTGCCTCTCACCACCCACCTACGCCACCTTCCAGGCCACCCCAACCCTCATTCCCACTGAGACGGCGGCTCTGTATCCTACTTCAGCACTGCTCCCAACTGCCAGGGTGCCTGCTGCCCCCACCCCTGTTGCCTACTACCCAGGGCCAGCCACTCAACTCTACATGAACTACACAGCCTACTACCCCAGCCCCCCAGTCTCCCCTACCACCGTGGGCTACCTTGCAACACCCCCTACTGCCCTGGGCTCTACTTCCACCTCAATGTTGTCTCAGCCAGGAGCCTTGATCCGAATGCAGGGTGTCCCTTACACAGCTGGCATGAAGGATCTGCTCAGTGTCTTCCAGGCCTACCAGCTGGCCCCTGATGATTACACCACTCTGATGCCTGTTGGTGATCCACCTCGCCCTGTGTTACAAGCCCCCAAGGAGTGGGTGTGTTTGTAG

XM_004842883.1 Coding sequence

Sf3b3 splicing factor 3b, subunit 3, 130kDa

High confidence: 4 potential gene matches
Length: 3654 bp    Location: 12747382..12793643   Strand: +
>XM_004842883.1
ATGTTCCTGTACAACTTGACCTTGCAGCGAGCCACTGGTATCAGCTTTGCCATTCATGGCAACTTCTCTGGAACCAAACAACAAGAAATTGTTGTTTCCCGTGGAAAGATCTTGGAGCTACTTCGTCCAGACCCTAACACTGGCAAAGTACATACCCTCCTTACTGTGGAAGTATTTGGTGTTATCCGGTCACTCATGGCCTTTAGGCTGACAGGTGGCACCAAAGACTACATTGTAGTCGGCAGTGACTCAGGTCGGATTGTTATCTTGGAATACCAGCCATCTAAGAATATGTTTGAGAAAATTCATCAAGAAACTTTTGGCAAAAGTGGATGCCGCCGCATTGTTCCTGGCCAGTTCTTAGCTGTGGATCCCAAAGGACGAGCTGTTATGATTAGTGCTATTGAGAAACAGAAATTGGTGTATATCTTGAACAGAGATGCTGCAGCCCGACTTACCATTTCATCTCCCTTGGAAGCCCACAAAGCGAACACTTTAGTATATCATGTGGTTGGAGTAGATGTGGGATTTGAAAATCCAATGTTTGCTTGTCTGGAAATGGATTATGAGGAAGCAGACAATGATCCAACAGGGGAAGCAGCAGCTAATACCCAGCAGACACTTACTTTCTATGAGCTAGACCTTGGTTTAAATCATGTGGTCCGAAAATACAGTGAACCTTTGGAGGAACATGGCAACTTCCTAATTACAGTTCCAGGAGGGTCAGATGGTCCAAGTGGAGTGCTGATCTGCTCTGAAAACTATATCACCTATAAGAACTTTGGTGACCAGCCAGATATCCGGTGTCCAATTCCTAGAAGGCGGAATGACCTGGATGACCCTGAAAGAGGAATGATTTTTGTCTGCTCTGCCACCCATAAAACCAAGTCGATGTTCTTCTTTTTGGCTCAAACTGAGCAGGGAGATATCTTTAAGATCACTTTAGAGACAGATGAAGATATGGTAACTGAGATTCGCCTGAAGTATTTTGATACTGTGCCTGTTGCTGCTGCCATGTGTGTACTTAAGACAGGCTTCCTTTTTGTAGCATCAGAATTTGGAAACCATTACTTATACCAAATTGCACATCTTGGAGACGATGATGAAGAACCTGAGTTTTCATCTGCCATGCCTCTGGAAGAAGGAGACACATTCTTCTTTCAGCCGAGACCACTCAAAAACCTTGTGCTGGTTGATGAGTTGGACAGCCTGTCACCCATTCTGTTTTGCCAGATAGCTGATCTGGCTAATGAAGACACTCCACAGCTGTACGTAGCCTGCGGTCGGGGACCCAGATCATCTTTGAGAGTCTTACGGCATGGGCTGGAGGTGTCAGAAATGGCTGTTTCTGAGCTGCCTGGTAACCCTAATGCTGTCTGGACAGTACGTCGGCACATTGAAGATGAGTTTGATGCCTACATCATTGTGTCCTTCGTGAATGCCACCCTTGTGCTGTCTATCGGAGAGACTGTGGAAGAAGTGACTGACTCAGGATTCCTGGGCACCACCCCGACCCTGTCCTGCTCCTTGTTAGGAGATGATGCCTTGGTGCAGGTGTATCCAGATGGCATTCGACACATACGAGCAGACAAGAGAGTTAATGAGTGGAAGACTCCTGGGAAAAAAACAATTGTGAAGTGTGCGGTGAACCAGCGACAAGTGGTGATTGCCCTGACAGGAGGAGAGCTGGTGTATTTTGAAATGGATCCCTCAGGACAGCTGAACGAATACACAGAGAGGAAGGAGATGTCAGCAGATGTAGTGTGCATGAGTCTGGCCAACGTTCCCCCTGGAGAGCAGCGGTCTCGCTTCCTGGCTGTAGGGCTGGTGGACAACACTGTCAGAATCATCTCCTTGGACCCCTCAGACTGTTTGCAGCCTCTGAGCATGCAAGCTCTCCCGGCCCAGCCTGAGTCCTTATGTATCGTGGAAATGGGTGGGACAGAGAAGCAGGATGAGCTGGGTGAGAGAGGCTCTATTGGCTTCCTGTACCTGAACATCGGGCTCCAGAATGGTGTGCTGCTGAGAACTGTCCTAGACCCTGTCACTGGAGACCTGTCTGACACCCGCACCAGGTACCTGGGATCCCGTCCTGTGAAGCTTTTCCGAGTTCGGATGCAAGGCCAGGAGGCAGTATTGGCCATGTCTAGCCGCTCATGGTTGAGCTATTCTTACCAATCCCGTTTTCATCTCACACCCCTGTCTTATGAGACCCTGGAGTTTGCATCTGGCTTCGCCTCTGAACAGTGTCCTGAAGGCATTGTGGCCATCTCCACCAACACCCTGAGGATTTTGGCATTGGAGAAGCTAGGTGCTGTCTTCAATCAAGTAGCCTTTCCACTGCAGTACACACCCAGGAAATTTGTCATCCACCCTGAGAGTAATAACCTTATCATTATCGAGACAGACCATAATGCTTACACTGAGGCTACAAAAGCTCAGAGAAAGCAACAGATGGCAGAGGAAATGGTGGAAGCAGCAGGGGAAGATGAACGAGAGCTGGCTGCAGAGATGGCAGCAGCATTCCTCAATGAAAACCTCCCTGAATCTATTTTTGGTGCTCCCAAGGCTGGCAATGGGCAGTGGGCGTCTGTGATCCGGGTGATGAATCCTATTCAAGGGAACACGCTGGACCTTGTCCAGCTAGAACAGAATGAGGCAGCTTTTAGTGTGGCTGTGTGTAGGTTCTCTAACACTGGTGAAGACTGGTATGTGCTGGTGGGTGTGGCCAAGGACCTGATCCTGAACCCCCGATCTGTGGCAGGGGGCTTTGTGTATACTTATAAGCTGGTGAACAATGGGGAAAAACTGGAGTTTTTGCACAAGACTCCAGTGGAAGAGGTCCCTGCTGCCATCGCTCCATTCCAAGGGAGGGTTTTGATTGGAGTGGGGAAGCTTTTGCGAGTCTATGATTTGGGGAAGAAGAAGTTACTCCGAAAGTGTGAGAATAAGCACATTGCCAATTATATATCTGGGATCCAGACTATTGGACACAGGGTGATTGTGTCTGATGTCCAAGAAAGTTTCATCTGGGTTCGCTACAAGCGTAATGAGAACCAGCTCATCATCTTTGCCGACGACACCTATCCCCGATGGGTCACTACAGCTAGTCTTCTTGACTATGACACTGTAGCTGGGGCAGATAAGTTTGGCAACATTTGTGTGGTAAGGCTTCCACCTAATACCAACGATGAGGTAGATGAAGATCCCACAGGAAACAAAGCACTGTGGGACCGGGGCTTGCTGAATGGGGCCTCCCAGAAGGCAGAAGTGATCATGAACTACCATGTTGGGGAGACGGTGCTGTCCTTACAGAAGACCACGCTGATCCCTGGAGGCTCTGAGTCGCTCGTCTACACCACCTTGTCAGGAGGAATTGGCATCCTTGTCCCATTCACATCCCACGAGGATCACGACTTTTTCCAACACGTGGAAATGCACCTGAGGTCTGAACATCCCCCTCTCTGTGGGCGGGACCACCTCAGCTTTCGCTCTTATTACTTCCCAGTTAAGAATGTGATTGATGGAGACCTCTGTGAACAGTTCAACTCTATGGAGCCCAACAAGCAAAAGAATGTCTCTGAAGAACTGGACCGAACTCCTCCTGAGGTGTCCAAGAAGCTTGAGGATATCCGGACTCGTTATGCCTTCTGA

XM_004842635.1 Coding sequence

Dpep1 dipeptidase 1 (renal)

High confidence: 4 potential gene matches
Length: 1344 bp    Location: 315813..310363   Strand: -
>XM_004842635.1
ATGGTGCGACTGTCTGGACTAAAGGCCTCCTTCCTCCCCGAAGTGGAGCAGCTCTTCATGCCCCACATCCTCTGCCCCACAGGCCAGGCATCAAGCAGACTCGACCTTGTCATGTGGACCAGCTGGTGGCTCTGGGCCCTGGTGGCCACGTGTGCTGGGCAGACGTTCCGCGAGCAGGCAGAGACCATCATGCGAGCCATGCCTGTCATCGACGGGCACAACGACCTGCCCTGGCAGCTGCTGACCAAGTTCAACAACCAGCTGCAGGAGAAGAGGGCCAACCTGAGCACTCTGGCGGGCACGCACACCAACATCCCCAAGCTGAGGGCTGGCTTTGTGGGCGGCCAGTTCTGGTCTGCGTACGTGCCCTGTGACACCCAGGACAAAGACGCCGTGAAGAGGACGCTGGAGCAGATCGATGTCATCCACCGCATGTGCCAGGCGTACCCTGAGACCTTCATGTGTGTCACCAGCAGTGAAGGCATCGAGCAGGCCTTCCGGGAGGGTAAGGTGGCCAGCCTGGTGGGCGTGGAGGGCGGCCACTCCATCGACAGCAGCCTGGGCGTCCTGCGGGCGCTGTACCAGCTGGGGATGCGCTACCTGACCCTCACCCACAGCTGCAACACACCCTGGGCTGACAACTGGCTGGTGGACACAGGGCACGACGAGGCTGAGAGCCAGGGGCTGTCAGAGTTTGGGAAGAAAGTGGTGAGGGAGATGAACCGCCTGGGCATCATGATCGACCTGGCCCACACGTCAGTGGCCACCATGAGGGCCGCCCTGGAGCTGTCCTCAGCGCCCGTCATCTTCAGCCACTCATCTGCCTACCAGCTGTGCCCGCACAAGCGCAACGTGCCCAACGATGTGCTCCAGCTAGTGAAAGACACGGGCAGCCTGGTGATGGTGAACTTCTACACTGACTATGTGAGCTGCTCATCACAGGCCAAACTGACTGAGGTGGCCGACCACCTGGACCACATCAGGAAGGTGGCCGGGGCCCAAGCCGTGGGCTTCGGTGGGGACTATGACGGTGTGAGCAGGCTACCCGCAGGGCTGGAAGATGTCTCCAAGTACCCAGACCTCGTGGCCGAGCTGCTGCAGAGGGGCTGGACAGAGGAGGAGGTCAAGGGTGCACTGGCGAAAAACCTGCTGAGGGTCTTCAAGGCGGTGGAGAAGGTAAGCAACCTCACGGCCACCCCCGAGGAGGAGCCCATTGCTCTGAACAAGCTGAAGGGCTCCTGCAGGACGCAGTATGGTTACTCAGCGGCCCCCAGCCTCTCCCACAGCCCAGGCGCCCTCCTGGCCTCCCTGGCTCCCTTGCTCCTTGGCCTGCATCTTATGTGA

XM_004842762.1 Coding sequence

Zcchc14 zinc finger, CCHC domain containing 14

High confidence: 4 potential gene matches
Length: 3195 bp    Location: 3138799..3097565   Strand: -
>XM_004842762.1
ATGGTGGAGAAGCGCTGCCCGCTGCAGAGGGACGGCGTGTACCGCTGGTTCTCGGAGCTGCCGTCGCCGCAGCGCGTGGAGTTCCTGTGCGGCCTGCTGGACCTGTGCATCCCGCTGGAGCTGCGCTTCCTCGGCTCGTGCCTCGAGGACCTGGCGCGCAAGGACTACCACTCGCTGCGCGACTCGGAGATCAAGGCCAACAACCCGGCTGACCTGGGGAGCCTCACCAACCTGACGGACGAGGTGGTGCGCAGCAAGCTGCTGGTGTCGCTGGCGCTGCTGGGCTCCGAGCAGCGCGAGGCGGCGGGCGTGCTCTACCGCACGCTCACGCACATCGACTCCATCATCCATAACTACGGGCTGCAGCTCAACGAGGGCCGCACGGGCGATGAGTTCCTGCTGCTCTTTACCATGGCCTCCAACCACCCGGCCTTCAGCTTCCACCAGAAGCAGGTGCTGCGCCAGGAGCTCACGCAGATCCAGAGCAGCCTGAGCGGTGGCGGCGGGGGCCCCGGGGGCAAGGGCGCCCCTGGACCCACCTGCCCGGCCTGCCACAAGATGGCCCCCCGGGCCGAGCCCCCCGTGAGCAGCGTGGGGAACAGCCTGGAGAAGGCGCTGCGCACGTCCGCACATTCCTCGGAGGAGCCCAAGAGGCCACCGGGCAAGCATGGCAAAGTGAGCGTTGAAAAGATTGATCTGAAGGGATTATCACACACAAAAAGTGACAGGAATGTTGAATGTTCCTTTGAGGTCTTGTGGTCTGACTCTTCAGTAACATCCGTAACCAAATCTTCCTCAGAAGTGACTGAGTTCATTTCAAAGTTGTCCCAGGTGTGCCCGGAAGAGAACCTGGAGAAGCTCATTCCCTGCCTGGCGGGCCCAGACTCCTTCTACGTGGAGCGGAACCATGTGGACCTGGAGGCCGGCCTGAGGTATTTGGCTTCATTACCTTCTCATGTATTAAAAAACGACCAGATTAAGAAATTTTTCAGCACTTCGTCTTCTACCCAACAGCTTCAAAGTCCAGGTCCCGGCAACTCTTCCCTCCCTAAAGTGGGCACCATGGTGGGCGCGTCTGGAAGGCCCGTGTGCGGCGTGGCTGGCATCCCGTCTTCTCAGAGCAGTGCCCAGCACCACCTGCAGCACACGGCTGGCGCGGCCTCAGTGCTGGCGTACCGAGCCCAGGTGGACGCCACGCCCACCATCCTCATGCCCTCCGGCCTGCAGGCCCCACCGCCCCCGGAGCAGAACGGCATCTTGGACTGGCTGAGGAAGCTGCGGCTGCACAAGTACTATCCCGTCTTTAAACAGCTCACCATGGAGAAGTTTCTGAGCCTTACCGAGGAAGATCTGAACAAGTTTGAGTCCCTCACCATGGGAGCGAAGAAGAAGCTGAAGACCCAGCTGGAGCTGGAGAAGGAGAAGTCAGAGCGACGGTGCCTGAACTCCGCGGCCCCTTCCTTGGTCACCAGCAGCGGAGTGGCCCGAGTCCCCCCCACCAGCCACGTGGGGCCCGTGCAGACCGGACGCAGCAGCCACGCGGCAGAGCTTCGGGTGGAGGTGGAGCAGCCCCCTCACCAGACGCCCCGGGAAGGTGGCAGCTCCTCCGAGTACTCCAGCTCCTCCTCCAGCCCTATGGGCGTGCAGGTGCGAGAAGAGAGCTCGGACAGCGCTGAGGAGAACGACAGACGTGTGGACGTGCACTTGGAGGGCTCCGACAAGGAGAAGCCCGTGATGCTGCTGAGCCACTTCCCCTCGAGCTCCGCCAGACCCACGGCCCAGGTCCTGCCTGTGCAGAACGAGGCAGGCTCCAGCCCTGCGGGCCACCACCCCTTGGCCTCGAAGTTACTGCCCGCTGCCTCGCACCTGGCCCCAATGCGGATGCTGAGCTCCATGCACAAAGCAGAGCGAGGGGGCTCGGACGTGAAGCTCCTGTCGTCATCCATGCACTCGCTCCTGTCTCTGGAGGAGAGGGGCAAAGGGCCCGGGGCCCGGACTGGCGTGAAGGTGGACAAGGGCTTCGGCAGTGCTGTGCTGGACACACTCCCTCCATCGGCACCACACCCACCTGTGCAGGTCCTCTCGGGACTCTCGGAGAGCAGCACCGTGTCCCCAACTGTCTCCTTTGGTCCCCGGGCAAAGGTTGTGCATGCGGCCACACTGGACCGGGTGCTGAAGACAGCACAGCAGCCGCCCCTGGCGGTGGAGACCAGCACCGCAGCCGCAGGGACACCCAGCACCGTGCTGCATGTGGCCCGGCCGCCCATCAAGCTGCTGCTGTCGTCCTCCGCCCCCGCCGATGCTGCCGTCTCCGGCCAGACATCCTGCCCCAACAGTGTGCAGATCAGTGTGGCCCCTGCAATAATCAACCCCCGGACTGCTCTGTACACAGCCAACACCAAAGTTGCCTTCTCCGCTGTGAGCAGCGTGCCTGTGGGGCCCCTGCAGGGCAGCTTCTGCACCAACAGCAACCCTGCCTCCTCCAGCAGCCACCCTGCCTCCGCCTTCGCCAGCATGGCCACGGCGCCCAGCTACCCGGCCCCCAGCTCCAGCCCCGCGCTTGCCTCGGTCCCCGAAAGCAGCTTCTACAGTGGCAGTGGCTCCGCAGGGAACCTCCCCACCCAGAGCCAGGGCCACCATCACCACCACCACCATCAGCAGCCCCCTGCGCCCCCCCAGCCTGCGCCACCACCCGGCTGCATTGTGTGCACCTCGTGCGGGTGCAGCGGTAGCTGCGGCTCCGGCGGCCTGACTGTGAGCTACACCAACTACTTCCAGCACCCGTTCTCCGGGCCATCCATGTTCACCTTCCCCTTCCTGCCCTTCAGCCCCATGTGCAGCAATGGCTACGTGAGCGCCCAGCAATACGGCGGCAGCTCGGCCTTCCCCGTCGTGCACGCCCCCTACAGTGGCAGCGTCACCCCTGAGCCCGTGCTGGGCGGCCAGTCCTCGTTTGCCGTGCCGCCCATGCAGAGCTTCATGGCAGGGGCAGCGGGCGTGTACCAGACCCAGGGGCTGGTGGGCAGCAGCAACGGTTCTAGTCACAAAAAGAGCGGGAACCTGTCTTGTTACAACTGTGGGGCCACCGGGCACCGAGCTCAGGACTGCAAGCAGCCGTCCATGGACTTCAACCGGCAAGGTACGTTTAGGTTGAAATACGCCCCTCCAGCTGAAAGTCTGGACTCCACAGACTGA

XM_004843006.1 Coding sequence

Thap11 THAP domain containing 11

High confidence: 4 potential gene matches
Length: 903 bp    Location: 18530146..18528310   Strand: -
>XM_004843006.1
ATGCCTGGCTTTACGTGCTGCGTACCGGGCTGCTACAACAACTCGCACCGGGACAAGGCTCTGCATTTCTATACATTTCCCAAGGACGCTGAGCTGCGGCGCCTTTGGCTCAAGAACGTGTCCCGTGCTGGCGTCAGTGGGTGCTTCTCCACTTTCCAGCCCACCACGGGCCACCGTCTTTGCAGCGTTCACTTCCAGGGCGGCCGTAAGACCTACACGGTGCGTGTTCCCACCATCTTCCCGCTGCGCGGCGTCAATGAGCGCAAAGTAGCGCGCAGACCCGCGGGGGCCGCGGCCGCTCGCCGCAGGCAGCAACAACAGCAGCAGCAGCAACAACAGCAGCAGCAGCAGCAGCCGTCGCCGTCCGTCTCCGCTACCCAGACCTCCCAACTGCAGCCGAACCTGGTGTCTGCCTCTGCAGCCGTGCTTCTCACCCTTCAGGCTGCTGTGGACAACAGTCAGGTTCCTGGATCTGGCCCGCCGGCACCCACCACTCCCACCGGAGAAGATGTGAAGCCCATCGACCTTACTGTGCAAGTGGAGTTCGCAGCCGCAGAGGGCGCAGCCGCCGCAGCCGCCGCGTCAGAGCTAGAAGCTGCCACAGCTGGGCTGGAGGCCGCGGAGTGCCCGATGGGCCCCCAGTTGGTGGTGGTAGGTGAAGAGGGCTTCCCCGATACTGGTTCTGACCACTCATACTCGTTATCGTCAGGCACCACGGAGGAGGAGCTCCTGCGCAAGCTGAATGAGCAGCGGGACATCCTGGCACTGATGGAAGTGAAGATGAAAGAGATGAAGGGTAGCATCCGCCACCTGCGTCTCACCGAGGCCAAACTTCGAGAAGAGCTTCGTGAAAAGGATCGTCTGCTTGCCATGGCTGTCATCCGTAAGAAGCACGGGATGTGA

XM_004842813.1 Coding sequence

Clec3a C-type lectin domain family 3, member A

High confidence: 4 potential gene matches
Length: 591 bp    Location: 8992278..8984423   Strand: -
>XM_004842813.1
ATGGCAAAGAATGGACTTGTAATTTGCATCCTGGTCATCTGCTTACTCCTGGACCAGACCACCGGCCACCCATCCAAATTAAAAGCCAGGAACCACAGCAAACGCCGTGTGAAAGAAAAAGATGGAGACCTGAAGTCTCAAGTGGAAAAGCTCTGGAGAGAAGTCAATGCGCTGAAGGAGATGCAAGCCCTGCAGACAGTCTGTCTCCGAGGCACAAAATTTCACAGGAAATGCTACCTTGCTTCAGAAGACATCAAGCATTTCCATGAAGCTAATGAAGACTGTATTTCCAAGGGAGGGATCCTGGTTGTCCCCAGGAACTCTGACGAAATCAACGCCCTCCGAGACTATGGTAAGAAGAGCCTGCCAGGTGTCAATGACTTTTGGCTGGGCATCAATGATATGGCCACAGAAGGCAAGTTTCTTGATGTCAATGGAATGGCCATCTCCTTCCTCAACTGGGACCGTGCACAGCCCAGTGGTGGCAAGAAGGAAAACTGTGTCCTCTTCTCCCAATCAGCTCAGGGGAAGTGGAGTGATGAAGTCTGTCGTAGTAGCAAGAGGTACATATGCGAGTTTACCATCCCCTAA

XM_004842689.1 Coding sequence

Zc3h18 zinc finger CCCH-type containing 18, transcript variant X4

Length: 2865 bp    Location: 965937..923734   Strand: -
>XM_004842689.1
ATGGATGTGGCCGAGAGCCCTGAACGGGATCCTCACTCCCCAGAGGACGAAGAGGAGCAGCCGACACTCTCGGACGATGACATTCTGAGGGAAAGCGGATCAGATCAGGATTTAGATGGAGCTAGGGGGAGGGCTTCTGATTTGGAGGATGAGGAAAACGCAGCCCCAGTACCAGGCCAGGAGGAGGAGAACCGCTCCGATGAAGAGGACAGAGCCAGTGAACCCAAGTCCCAGGATCAGGACTCCGAGGCTCGAGAGCTGAGCAGGGATCGGACGGGCTCCCCGTGTGAAGAAGAGGGGAACGATGGCGAGGAAGACCAGACGAGTGACCTCAGGGACGAGGCCTCCTCGGTGACCAGGGAGCTGGACGAGCACGAACTGGACTATGACGAGGAGGTCCCTGAGGAGCCGGCCCCTGCCGCCCAGGAGGAGGAGGCCGAGAAGGCGGGGGCGGAGGAGGAGGAGGATAAGGAGGCCAGCGCGCCTGCCCAGGAAGGGAGGCCCACTGTCCAGAGTAGGGGAGAAAAGGAGCCCCCGGAGGCCACCAAGGAGAGGAGAAAAGAGGACGACGATGGGGAGATTGACGACGGGGAGATAGACGACGACGACTTGGAAGAAGGCGAAGTGAAGGACCCCAGTGACCGGAAGGTGAGGCCTCGCCCCACCTGCCGATTCTTCATGAAAGGGAACTGTACCTGGGGGATGAACTGTAGGTTCATACACCCCGGAGTGAACGACAAGGGGAACTACTCCCTCATCACCAAAGCCGAGCCCTTCCCGCCCAACGGTGCCCCGCCACTCGGACCTCACCCCCTGATGCCTGCCAACCCGTGGGGTGGGCCAGTAGTTGATGAAATTTTGCCTCCACCCCCGCCGGAGCCCCCAACAGAGAGTGCCTGGGAACGTGGACTCCGGCATGCGAAGGAGGTTTTAAAAAAAGCAACCATTCGTAAGGAACAGGAGCCTGATTTTGAAGAGAAAAGGTTCACAGTGACCATTGGTGAAGATGAGCGAGAGTTTGACAAAGAAAATGAAGTTTTCCGGGATTGGAATTCTCGGGTCCCAAGAGATGTCAGAGATACAGCACTTGAGCCTTACGCAGATCCTTACTACGACTATGAAATAGAGCGGTTTTGGCGTGGTGGACAGTACGAGAATTTTAGGGTGCAATACACAGATGCAGAGCCGTATCATAATTACCGAGAAAGGGAGAGGGACCGAGAGCGTGAGAACAGACAGCGTGAGCGCGAGCGCGAGCGGGAGCGAGACCGAGAGCGCGAGCGGCGGCAGAGGGAGCGCGAGCGCGAGCGGGAGCGAGAGCGGGACAAGGAGCGGCAGCGGCGGAAGGAGGAGTGGGAGAGAGAGCGAGCCAAGCGCGACGAGAAGGACAGACAGCACCGGGACCGCGAGCGGGACCGCGACAAGGAGCGGGACAAGGACAAGGACAAGGACAAGCCGAAGGCCCGCTCTCCGCAGCCCCCAAGCCGTCAAGCTGAGCCACCGAAGAAGGAGGCCGCCTCAGGGCCACAGGTAAAGCGGGCCGATGAGTGGAAGGACCCATGGCGCCGATCCAAGTCTCCCAGGAAGAAACTCGGGGTGTCAGTCTCTCCTAGCCGGGCACGAAGGCGTCGAAAAACTTCTGCCTCCTCCGCCTCCGCCTCCAATTCCTCCAGGTCATCTTCTCGGTCTTCGTCCTACTCCGGCTCCGGCTCGTCACGGTCCAGGTCGAGGTCCTCATCCTACAGCTCCTACTCCAGCCGCTCTTCCAGACACAGCTCCTTCTCAGCCAGCCGGTCCAGGTCCCGGTCCTTCTCCTCGTCCCCGTCGCAGTCCCCCACACCCTCCCCACACAGACCTTCCATCAGAGCCAAGGGGGAGCTGGCGCCACCCCCCGGGAAAGCAGGAGAGAAGTCCTTGAAGAAGCCAGCCCCACCTCCAGTGCCCCTACAGGCCAGCAAGACTCCTGCCCCTGCCCCTGAGCCCACAAAGCCTGGAGACCCCCGGGAAACCAGGAGGAAGGAGCGGCAGGCCAGGACGCCCCCCCGGAGGCGAACGCTCAGCGGCAGTGGCAGTGGCAGCGGCAGCAGCTACAGTGGCTCCAGCTCCCGATCCAGGTCCCTGAGTGTGAGCAGCGTCTCCTCGGTGTCCAGCGCCACCTCGAGCAGCAGCTCGGTGCACAGCGTGGACTCGGAGGACATGTATGCGGACCTGGCCAGCCCCGTGTCCTCGGCCAGTTCCCAGTCCCCCACCCCAGCCCAGACCAAGAAGGAGCGAGGAAAATCAAAGAAAGAAGACGGCGTTAAGGAGGAAAAGCGAAAAAGGGACACCTCCACGCAGCCGCCCAAGTCCTCGAAGCCCGCGGCCAGCGGGAAGCCCTCACAGCAGCTCACAGCCCCGGCCCCCACGGCCCCTGGGCAGCCCCCCCAGGGCTCCTTCGTGGCCCACAAGGAGATCAAGCTGACGCTGCTGAACAAGGCAGCTGACAAAGGAAGTAGGAAGCGGTATGAGCCAGCGGACAAGGACCGACAAAGCCCCCCAGCCAAGCGGGCCACCCTGTCCCCAGACCGAGGTTCCCGGGACCGAAAGTCAGGCGGGAGACAGGGCTCCCCCAAGCCAGAGCGGCAGAGGAGCCAGAACTCCAAGGCCCTTGTGGCTCCCACAGACAGGAAGCGCCAGCTGTCACCCCAGTCCAAGAGCTCCAGCAAGGTGACCAGCGTGCCCGGCAAAGCTGCAGACAGCATGGCCCCGGGCACCAAGGCCGGCAAGGCCAGCACGCTGTCACGCCGGGAGGAGCTCCTGAAGCAGCTCAAGGCCGTGGAGGACGCCATCGCGCGCAAGCGAGCCAAGATCCCCGGGAAGGTGTAG

XM_004842599.1 Coding sequence

Gas8 growth arrest-specific 8, transcript variant X4

High confidence: 4 potential gene matches
Length: 1617 bp    Location: 42867..29778   Strand: -
>XM_004842599.1
ATGCAGGGCAGAGTGATATGCTCAGCTGAGTGCTTCCATCAAGGGCATGAGAGGAAGCAAGGGGGAGAGGTTCCAGATAGGTCCTCCCCAAATGCCTGTGGAAGCCAGTCAGAGCCTTCCAAGGAGGGGAAACGATTCGGCAGAATTCCCTGTACTTACCCAGTAATTTTTCTTCAACCCCAGGCACCCAAAAAGAAAGGGAAGAAAGGTAAACCCAAAGGTACTGCAGTTGTGGATGGGCTTGATCCAGAGGACATGAACAAGGGGCAGGTGGAGGAGCACATCAGGCGCATCCGGGAGGAGCTGGACCGGGAGCGGGAGGAGCGCAACTACTTCCAGCTGGAGCGGGACAAGATCCACACTTTCTGGGAGATAACGAGAAGGCAGTTGGAGGAGAAGAAGGCTGAGCTGCGGAACAAAGACCGGGAGATGGAGGAGGCTGAGGAGAGGCATCAGGTGGAGATCAAGGTGTACAAGCAGAAGGTGAAGCACCTGCTGTATGAACACCAGAACAGCCTGACGGAGCTGAAGGCCGAGGGCACCGTGGCCATGAAGCTGGCCCAGAAGCAGCACCACACCCAAGAGGGCGCACTGCGCAAGGACATGCGGGCGCTCAAGGTGGAGCTCAAGGAGCAGGAGCTGGCCAGCGAGGTGGTGGCCAAGACCCTGCGGCTGAAACACGCCGAGGAGATCACCAAGATGAGGAATGACTTTGAGAGGCAAATTCGAGAAATTGAGGCTAAGTATGACAAGAAGATGAAGGTGCTGAGGGATGAGCTTGATCTGCGAAGAAAGACTGAGATCCACGAAGTGGAGGAGAGGAAGAATGGCCAGATCAACACACTGATGCAGCGCCACGAAGAGGCCTTCACCGACATCAAGAACTACTATAATGACATCACACTCAACAACTTGGCCCTCATCAGCTCCCTCAAGGAGCAGATGGAAGACATGCGAAAGAAGGAGGAGCGCCTGCAGCGAGAGATGGCGGAGGTGGCCTTGCAGAACAGGCGCCTGGTGGATCCCCTCCAGAAGGCCCGGGATGAGATGGCTGAGATGCGGAGGAAACTCGGGGACTGTGAAAGGGACAAACAGATCCTGGTGAGCACGAAAGCACGTTTGAAGGTTACTGAGAAGGAGCTGAAGGACCTGCAGTGGGAGCACGAGGTGCTGGAGCAGCGCTTCCTCAAGGTGCAGCAGGAGCGGGACGAGCTCTACCGGAAGTTCACAGCGGCCATCCAGGAGGTGCAGCAGAAGACTGGCTTTAAAAACTTGCTGCTGGAGCGCAAGCTGCAGGTGCTAAGTACTGCTGTGGAGAAGAGGGAGGTACAATTCAACGAGGTGCTGGCAGCCTCCAACATGGACCCCGCTGCGCTGATGCTCGTGTCTCACAAGCTTGAGGATGTTTTGGAATCAAAGAACACCACCATCAAGGACCTACAGTATGAGCTGGCACGGGTCTGCAAGGCCCACAATGACCTGCTTCGCACATATGAGGCAAAGCTGCTAGCCTTCGGGATCCCCTTGGACAATGTGGGCTTCAAACCTCTGGAGACAGCTGTGATAGGGCAGACACTGGGCCAAGGCCCTGCGGGACTCGTGGCTACGCCGACATAG

XM_004842621.1 Coding sequence

Spire2 spire homolog 2 (Drosophila), transcript variant X3

High confidence: 4 potential gene matches
Length: 1863 bp    Location: 193121..165624   Strand: -
>XM_004842621.1
ATGGTGCAGTCCCTGGGCTTCGCCATCTACCGCGCGCTGGACTGGGGCCTGGACGAGAGCGAGGAGCGCGAGCTCAGCCCGCAGCTGGAGCGGCTCATCGACCTCATGGCCAACAGCGACCACGATGACGGCGGCGGCTGTGGGGCTGCGGACGAGGGTTACGGGGCCCCCGAGGAGGAGGAGGAGCCCGAGGGCGGCCCCCGGGCCGTGCGCACCTTCGCCCAGGCCATGCGGCTGTGTGCCGCTCGCCTCACCGAGCCCCAGGGTGCGCAGGCGCACTACCAGGCCGTGTGCCGCGCCCTCTTCGTGGAGACCCTTGAGCTCCGCGCCTTCCTGGCCCGAGTCCGAGAGGCCAAGGAGATGCTGCAGAGGCTGGGGGAGGATGAGCCACAGATACAGAAGCCACGAGCTGAGCTTGACAACCTTGGACACACAGACTGGGCCCGGTTGTGGGTGCAGCTCATGAGGGAGCTGCGCCATGGGGTGAAGCTCAAGAAGGTGCAGGAGCAAGAGTTCAACCCCCTGCCTACCGAGTTCCAGCTTACACCCTTCGAGATGCTGATGCAGGACATCCGCGCCAGGAACTACAAGCTGCGCAAGGTCATGGTGGATGGGGACATCCCTCCCAGAGTGAAGAAGGACGCACATGAGCTCATCCTGGACTTCATCCGCTCCAGGCCTCCCCTGAAACAGGTCTCTGAGCGCCGGCTTCGCCCACTGCCACAGCAGCAAAGGACCCTGCACGAGAGGATTCTGGAGGAGATCAAGCAAGAGCACAAGCTGCGGCCCGTGGGGACCCAGCGCATAGGCATCCGTGGCTTTGGCTCTCTGCCTTGCATCCTCAACGCCTGCTCTGGGGACATCAGGTCCACTTCCTGTATCGATCTGTCTGTCACGGACGTCGGGAGTGGCACTCAGCGCCCACGGCCCCGGGTCCTGCTGAAGGCACCCACACTGGCTGAGCTGGAGGAGATGAACACCTCTGAGGAGGAAGAGTCTCCATGTGGGGAGGTGACACTGAAACGGGATCGCTCCTTCTCAGAGCACGACCTGGCCCAGCTCCGGAGCGAGGCAGCCTCTGCCCTGCAGCCAGCTGCTCCGCCCCAGGAAGGAACAGGACTGCCTCGGCCCCGGGCAGGCAGCATGCACACCTGGAGGCCCAGTGCCTGGGACCAGGGCTCCTGTCCTGCGGTTGTCCAGCCCCAGCCGGACCCCGGTGCCCCTGTGCTCAGCAGTCTGAGCTCTGCAGGCAGACCTGAGGGCTCTGTGCCAGACCCCAGGCACCTGTGGCTGGATTTCAGCCATCCGGTAGAGAGCCTGGCCCTGACTGTGGAGGAGGTGGTGGATGTGCGCCGTGTGCTGGTGAAAGCTGAGATGGAAAAATTCATCCAGGACCAGGAGCTCTTCAGCAGCCTGAAGCGGGGAAAGGTCTGCTGCTGCTGCCGGGCCCGGTTCTCGCTGTTCTCCTGGCCACCCACTTGTCTCTTCTGCAAGAGAGCCGTCTGCACTTCCTGTAGCGTAAAGATGAAGATGCCTTCTAAGAAGTGTGCACACATCCCCGTCTACACTCTGGGCTTTGAGAGTCCTCAGAGGACACCCATGGCCAAGGCCACGCCAACGCAGAGGAGAGAGGTCTTCCAGTCTCTACAGGGGCCAAGGTGGCGAAGCGTGGAGGAGGAGTTCCCGCACATCTATGCACATGGTTGCATCCTTAAGGACGTCTGCAGTGACTGCACCAGCTTCGTGGCTGATGTCGTGCGCTCTAGCCGCAGGAGTGTGGACGCCCTTAATGCCACACCACACCGCAGCCGCCAGACCCAGTCACTCTACCTCCCTGACACCAAGACTCTGGACTTCAAGTGA

XM_004842628.1 Coding sequence

Fanca Fanconi anemia, complementation group A

High confidence: 4 potential gene matches
Length: 4374 bp    Location: 208016..252663   Strand: +
>XM_004842628.1
ATGGCGGTGTCCCAGGTTCTCCCCGGGGCTGGGGTCACATCCGGGCGAGGGGCTGCTGTGGCGGGGTGTAGGTGTCAGTGCTGTCACGTTTGGAAACTGATGTCTCTCTTAGCGGGAAGGGTCAAGCGGCAAAAACATAACCCTGAAAATGAACAGAAATTAAAGGAATCAGCCGTGCAGCTCCTGAGACGCCACCAGAACTTGGAGGATCTTCTGCTTGAGGTAGAAGAGCCACCATGTAAAAAATTATGCCTCAGTAAACTGATTGATAGTAACAGTGCTGAGGCCTGCAGTGATCATGTTAGTTCCTTTATAGGCTCTGCCTTGCGGGATCGAGCCTTGAGGCTGGGGGTTCCTGTGGCTGTCCTGGCAGCCAGGATGGTGGCCTGCAGCATGGAGCAGGTGTGTGCGGAGCCTAGCCATCCAGTTCTGCTCAGCTCGGAGCAGAGGAAGAAGGTATCTTCCTTGTTAGACGTTGCTCAGTATTTATTGACACACAGTATGTTCTCCCGTCTCTCCTTCTGTCAAGAATTATGGAGAGTACAGAGCTCTTTGCTGCTGGAAGCTGTGTGGTGCCTGCATGTGCACAGCGTGGTCAGCCTGCGGGAGCTGCTGGAGAGCCATCCTGAAGCTCAGGCTGTGACAGCGTGGCTTTTTGGGAACCTGTGCCTGCTGTGTGAGCAGATGGAAGCCTCCTGCCAGTCCGGCGACACGACCAGGGCTATGCTTTCTGATTTTGTGCAACTGTTGGTTTTGAGAGCATTTCAGGAAAACTCCAATGTGGGAAGAACCATGGAGCCTGAGAAGATGCCTCAGGTTGCCCTGGCTGTGCTGCAGAAAATGCTGAGCTTTGCGCTGGACTCCCTGGCTGCTGGCCTTCAGGAGGAGTCCCCGGCTTACAAGGCAGTGAGGTGGTGGTTTGATGTGTTCAGTGCGCACTCGTGTTGTGTGATTGCGCCAGATCCTCTGAAGAAGTTCTTCCGTCACACACTGGTCCAGACGCTCACGCACAGCCCTGTGCTAAAAGTGTCAGACGCGGTCCAGATGCAGAGCAGGTGGAGCTTCTCGAGAACACATCCGCTGCTTATCTCTCTCTACTGCCGGCTCTTCATGATGCTGAGCCCCGAGGAAGCCATCAGCTGTGTGCAGGAAGTTTTGGAGGAGCAGGAAGTCAACTGGCAGCGTGTGCTGTCCTGCGTGTCTGTGCTGGTCACCTGCTTCCCCGAGGCACAGCAGCTGGTGAGAGATTGGGTGGCCCGTTTGATGGCTGGTGCCTTCGAGAGCTTCCATCTGGACAGCATGGTCACTGCATTCCTGGTTGTGCGCCAGGCTGCACTGGAGGGCCCTGCTGCATTCCCACCCTATGCGGACTGGTTCAAGGCCTCCTTCGGGAGCTCGCGTGGCTACCACAGCTGCAGCAAGAAGGCCCTGGTCTTCCTCTTCAAGTTCCTGTCTGACCTCGTGCCCTGGGAGGCCCCCTGGTACCTGCAGGTGCACATTCTCTACCCGCCACTGGTCCCGAGCAAGTACCGCTGCGTCCTTACTGACTACATCTCGCTGGCCAGGACACGGCTGGCTGACCTGAAGGTTTCCTTGGAGAACATGGGACTGTATGGAGATGGGTCCTTAGCCAGGGACGTTGCAGAGCCCCGCAGCCAAGCGGCCCAGGATGTGGAGAAGGCCGTCTCGATGTTTGAACACACAGGGAAAGTCCCGGTCCCTGTCCTGGAGGCCAGCATATTCAGGAGGCCCTACTACGTGTCCCACTTCCTCCCTGTTCTGCTGACGCCTCGTGTGCTCCCCAAGGTCCCTGATGCACGGGCAGCGTTCATCGAGTCTCTGAGGAGGGCAGACAAAATCCCCCCATCTGTGTATGCCACCTACTGCCAAGCCTGCGCCACTGCTGAGGAGGAGAAGTCGGGAAGTGCAGACCCAGGAATGGAGACAAAGCCCAGCTATGCGGAAGAGGCCTTGGGGCCACTCAAGGCTGCACTAGGACAGCTCAGAGCCTTGATGGCCAACCCCATGCAGTACGACGTTTTGTCTGCTCAGATGGCTGTGGTTGCTGAAAGGCTTGGTGCCGTCTTGGGTCGTAGGATGGATGATGTCTGTTCCGAGGAAACGAAGATTCAGCTCAGCATCCTTGCCCCAGACATCCCGCAGCAGCACCAGGTAGTGGATCTGCTGCTGACGGCTTTCTGTCAGGACCTGATGGCAGCCTGCAGCTTTGTGCCCCCGGAGAGGCAGGGCCCCTGGGCTACCCTCTTCGTGAGGACCCTGTGTGGTCATGCACTGCTGCCTGCAGTCCTTGGCCGGCTTTGCCAGCTGCTGCATCACCAGGGCCCGAGCTTGAGTGCCCCACATGTGCTGGGCTTGGCTGCCTTGGCTGTCCACCTAGGGGAATGCAGGGCTACGCTCCCAGAGGTGGACCCAGGACCTGCTGCAGCCACCCGCAGCCTTCCTGTCCCGGAGTTCCTGGATGGCCTCTTGTCCTGCCACACCGGGGAGTCTGTGCTCTTCTGCCTGAAGTTCTGCACAGCAGCGATCACCTACTCTTGGTGCAGATTCTCCCCTCAGCCCCACGGAGCCCTCCGCAGCTGTTTATCTCCAGGCCTTATCAAAAAGTTCCAGTTCGCCTTGTTCAGATTGGTTTCAGAGGCCCGAGAGCCTTGTCATGTGGAGAATGTGACCGGCCCTCCCTGGAGACCCTTGTGCCTTCCTTCCGAAGACTGGCAGAGCGCTGCACTGGCTCTGTGGCAACAGAGCAGCTTCCAGGAGCTGCTAGAAGAGCCGGAGTTCCGGTTGACTTACAGAGACTGGCTGCAGCTGGAACTGGACATCCCCCCTGGAGCCGATCCTCTGTCAGACACAGAAAAGCAGGACTTCCACCAGTGGGCGATCCACAAGCACTTCCTGCCTGCACCCTTGGCTTCTGGGGGCTGCGGTGGGGACCTGGAGGTGGCATGCATGGTCCTCATCGACGCACTGATGGACTTCTACCACAGTCCAAGGAGCTGTGGCCACACAGAGAGCCCCAGCTGGGCCTACAGTGGCCGCAAAGGCAACGGGGATCTCCTCTGCAGGCTGCAGGAGATGGCTGCTGACCTGGAAGCCGGCTGTCCTGTCTCTCAGGAACACTTTGTCTTCCGGGTCTTCCGAAGACGGCTTGAGGGCCTGGCCAGTGGGAGAGGCGTGGCTGCCGCCCTTTGGAGACAGCGGGAGCTCCTCATGGGCAGACGGCTGCTCCTCCGCCTGCCTCCCTCTGTTCTCCTTGGCAACCTGCAGGCCGAGGGGCCCAGCTGTGAGGACTTCTTCCACCTGGTCAACTCCGAGCTGAGAAACTTCTGCAACCATGGTGGTGCCCTCACCCTGACCCACGACATCACTGCCCACTTCTTTAGGGGGCTCCTGAATGCCTGCGTGCGCAGCCTGGACCCCTCACTGACTGCCAACCTTACCCTGGCCAAGTGCCAGGCCAGATGCCCTCTGATGGTGACCTCCGCACTGTCGTGGTGGTCAAGCCTGGAGCCAGTGCTGTGCAGTCAGTGGCAAAAGTACTGCCAGGGCGGGCTGCCCCTTGAGCTACAGAGGCTGCGGGAGGCTGAGCAGTTTGCCCACAGCTTCCTCTCCCTGGACTCGACTTCTCCTGCCCCCACCCCAGCCTGGGTCTCTGCTGCCGCACTGCACTTCGCAGTCCAGAGAGTCGGGAAGGACAATGCAAGGAGCCTGCTGAAGAAGCTGGACTTCGAGAGAGAGGAGCTCTTGGTGCCCCTCTTTTTCTTCTCCTTGCTCAGCCTGCTGTCATCACACCTGACCTCAACTGCCATAGCTGACTCCCTGAAGGCCACGGAGGTGTGTGCTGAGGTCCTTGCCTGTCTGCAGAGGAGGAAGCTGTCCTGGCTGGGCCTTTTCCAGCTGACAGAAGCAGATGCTGGGCTGGGTCACCTCCTCCTCCATCTGGCCCCGGATCAGCTTGCCAGGCTGCTGCCCTTTGCCTTCTACAGGCTCCTTCCCCACTTTGACAAGGCTGCCACTGTCAGGGATGTGGGCTTTCTGCGCGTTGCTGTCGACATGTACCTCCAGCTGGTCCAGCTGTTTGTGGGAGGGGAGACCACCGCAGTGTCACCATCAGCTAGCACAAGCCTACGGCTGCAGAGCCAGCCCCTGCCACAGGGCAGCCCTGTAGAACTGATAACGGAAGCACGTCTGTTTCTGCTGCAGTTAATACCTCAGTGCCCACAAGAGAGCTTCTCAGACATGATGGAGTTGCTGGCTGGCCATGCAGACTGCGACCCCGAGGTGGCCAGTGCCGTGCTGAACAGGTGCCACGCTGGGACCGATGCAGACCTGTACCGAGAGCCCTGTCTCCTCTGA

XM_004842627.1 Coding sequence

Znf276 zinc finger protein 276, transcript variant X2

Length: 1614 bp    Location: 266758..252631   Strand: -
>XM_004842627.1
ATGGGGCACTGTCGTCTCTGCCATGGGAAGTTTTCCTCACGGAGTCTCCGAAGCATCTCTGACAGGGCGTCTGGGGACAGCCCAGAGAAACCTTCCCCAGGAGACCGTGTCTTCATCAGGGACTTCCAGCACTTGCTGGGTGTGGCTGTGCACCAGGACTCATCCTTGTCCCAGTTTGTCTGCAAGAGCTGCCATGCCCAGTTCTACCAGTGCCACAGCCTGCTCAGGTCCTTCTTGCAGAGGGTCAACGTGTGCCCGACAGGCCAGCGGAAGTCTTGTACAAAGGTCGGTGCTCAGCCCCCCACAGTGGCGGAGGAGGGAGTGTGTCTGGTGGATCTGATCACCTCGACTCCCCGGTGCCTGCATGGCTTAGTGGGGTGGGTGCACGGACATGCGGCCAGCTGTGGGGCCCTGCCCAGCCTTCAGAGAACACTGTCCTCCGAGTACTGCGGCATCATCCAGGCGGTGTGGGCCTGCGATCAGGGCCACGACTACACCATGGACACCGATTCCAGCTGCAGAGCCCTCTTACTGGACAATGCATTGGCAGTCAAATGGCCATGGGACAAGGAGATGGCACCACGGCTCATCCAGAACCTGGGGTCTGACCCTGCTGGGGCTGCACCCCAGCTGTCCCAAGGCAGAGGAACCACGGCTGGGGCTGAGACCAAGATGCTGCCCAATGTGGATGCAGCCCCATCTTCAGATGGCAGCTCTGTGGGGCCCAGGCCAGGCCCCCCACCTCGGCCAAGCCTCCCTCAAAATGAGGCCCCAGGGCAATTGGGTGAGAAGCAGGTTCCATCTTCAACTTCGGATGATCGGGTAAAAGACGAGTTCAGTGACCTTTCTGAGGGAGACTTCCTGAGTGAAGATGAAAATGGCAAGAAGCAAAATGCACAGTCTTCGGACGAGTCCTTTGAGCCTTACCCAGAAAAGAAGGTCTCTGGGAAGAAAAGTGAAAGCAAAGAAGCCAAGAAGACTGAAGAACCAAAAATGCGGAAAAAACCTGGGCCTAAGCCTGGATGGAAAAAAAAGCTCCGCTGCGAGAGGGAGGAGCTGCCCACCATCTATAAGTGTCCTTACCAGGGCTGCACGGCTGTGTACCGTGGGGCTGACGGCATGAAGAAGCACATCAAGGAGCATCACGAGGAGGTTCGGGAAAGGCCCTGTCCCCACCCTGGCTGCAACAAGGTGTTCATGATTGACCGCTACCTGCAACGCCACGTGAAACTTATCCACACAGAGGTGCGCAACTATATCTGTGACGAGTGTGGGCAGACCTTCAAGCAGCGGAAGCACCTTCTTGTCCATCAGATGCGCCACTCAGGAGCCAAACCACTGCAGTGTGAAGTCTGTGGCTTCCAGTGCAGGCAGCGGGCATCCCTCAAGTACCATATGACCAAGCACAAGGCAGAGACTGAGCTGGATTTCGCTTGCGATCAATGCGGCCGACGGTTCGAGAAGGCGCACAACCTCAATGTGCACATGTCCATGGTCCACCCTCTGACACAGACCCAAGACAAGGCCCTGCCCTTGGAGGTGGAGCCACCTCCTGGAGCCCGGAGCCCTTCTGGGACCACGGAGGGCCAGGCAGTGAAGCCAGAGCCCACCTGA

XR_205155.1 Non-coding sequence

LOC101704881 PREDICTED: Heterocephalus glaber uncharacterized LOC101704881 (LOC101704881), misc_RNA.

Length: 3531 bp     
>XR_205155.1
GTTACGCTCCCTGCTCCCTGATCCCGTGACCCCAGCGCCGAGTCCGCCAGCGGGCCGGCGGGGTGGGGGGCGAAGGTCTGGAGCAGGCCGCGGAGTCCCTGGATTTCCTTGAGCAAGCTGCGGTTGCCTGGATCTTATTTCCAGCTCAGCTGCAAGGTCTGCTCAGGGCCTGGCTGGTTGGTTTTCAAGTCTAAAGGGGTGTGATTGAGTCCTCCTCCCTGCTTTGTTAATTTGGGGCCAATTGGTGTCCTCCTAGCACTGCCAGCAGGCCCGGGGCCTTCTGAAGAGTGGAGTGGATGGTGTGCCAGGGAGCGGGGATCTGGGGTCCCGGCCGCAGAGGTAGAGCCCTTCCGAAGTCAGAAGTCGGCGCAGCGAGCCGCCATGGCCGTTTATCGTCCCGAGAGGGCTAAGGAGCCTGTGCTGAAGCCCACCAAGGGTTAATGTTCACAGGAAGTGACAGTTGTCTTCTTTTGTTTCTGGAGCCCCAAACAAGTTCAGCTTGCAGCTGGAAGGGCAGAAGAGGAAAGAGTTTGGAAAGGAAAGTTCTAAGCACTTCGTGGCTCATGCAGGAGTGGGACTTGTTCTACAGATCCTTAATTTCACGTGGATAACCATCTCCTCAGACCAGCTTGCTCGTTTTCTCCTGAAGGCCAGCTGACTCACTTCTGGAAGTCACCCCCCCCCCCGCCCGCCCGCCATGATCGACCGCGGCACCCAGCCAGGCTTAGTGCCCAGGCCATGCAGCAGGCCATATGCTACTCATGGGAAATGCGGAAGCGCGGTACCAGCAGCAAGGAAGAGGGGAACTGTTTTCTCATCCCATGGGCAGCTATACTGATGGCCCAGGCAGGGCCACACTGTCCGTCCACCTTATGGAGCCGCGGGAGGGCAACTGAGAGCTGTGGTCTGCCCAGATCTGGCTGAGTGCTCACTGCTCCAAAGGCTGAAGCTAAGCGATCTGCCACAGAGGCTGGCTGCAGAGGAGCAGGTGGTCGTTGGACAAGCAGATCTGCTGGCCCCAGGTCTTCCTGCAGTGCACTTGGCAGCTTCCCTTGGAGGAGCCTGTGTTGTAGGCTCACATCCGGCTGGCTGGCGGGAGCAGCACAGCTGAGCAGGCTAAACTGGAGATGCCTGGGCTGGAGGGTAATTTGGCTTTCTGTGTGCCTCACATCCAGCATGCACTACAGGTGGGGCTTGCTCTCTCTGTCCCCAAAGCCATGCTAGGCCAGGACCTCTTTGCTCAGCCACTCTGCTGCATCCAGGCCCTCTGCTGTTTTAGCCTGTTTGTTACTTGGTCCCTAAGGCAATCCTATGTGAATCTGCAGTTTCCTAAACAGAACAGGCAAATTGTGTGACCTAGTCACACAAACAGGGTCAAGGAGGGACTGGGCACTCACCTAGGACCACCTGGTGAAAGGGAGCAGTTGCTTCCGGGGTGGGGGGGGGGGCTGCCTAGTCCAAGGAGGTGTGCAAACTGCCCAAGATCACCGAAAGATGATTTATAGGCATTTAAAGCTAAGGTGCACAACAGCCCAGTAGCTGGTTTCTATATTTAACTCCTGTAAAATTTATCCTCTTATTTCCTGAATGCTTTTTAAAGTTATAAAGTAAAACTGGGAGCCAGGTGAGGGGACACAAGCCTGTAACCCCAGCAGTGTGGAGGCTGAGGCAGGAGGATCACCAGTTCCAGGCCAGTGTGGGGTACACAGTGAGACCCTATCTCAAAACTGAAACAAAAGTAAAAGTGGGCTCAGTGACCAACCAAGCGGCTCCCTGTCCTCAGTTACCAGTTACCATGTTGGGAGAGGGGGAGCTCCTGCAAAGTGTTGGTGCCTGGTCCCTGTACCAGTGGGCGAGCTCCTGGCTCCTAACCCTGACCCCAGGCTGATCACAAAGTCCCTTGGGCGCGTGGCCCACAGTTGTCACCCACAGGGCAGGGCAGCTTCAGCGTGGGCTCAACCCTGCTACTGCCCAGGACCCCTTCTCCCCATCTCTTTCGGTAGGAATTGCCCCAAGCTTCAAGCCTTGTGGGCTCCCTCCCAGGGAGCAGTGTCCCTGCAGCCTCCTTTCCAGAAGCTGGGTGCCGAGCTGCAGTTCAGGTGTCTGGGCTGGGCAGACATCTTGGACAGACCCCACTGTGGCAGAGTAAGTGCTGCGATGAAGTATGGCGTGACACCCCAGCAGTGAGCTGGGCGTCTCCCGGGTGTCACACAATGTCAGCAACACCACGTCCCCTCTGTGTGCCAGAGCCACTCACGGCAGGATGTGTGCGTGCTGAATCTTCCTGAGTCCTGGGCCGTGCTGGTGTGCTGCAGATGGGCACTGCAGAGGCACACGCTGTCCAAGACCACAGCCAGTGGGGGCAAAACCCAGTCTGCTTCCAGGGCACGTGCCTCACTACACCTGCCACGCCTGGGGGTGCACACAAATCCAGATCAGAATCAGCAAGCATGACCTTATTGTTTTTTGAGACAAGTCCTTGTTCTGTAGTCCAGGTTGCCCTTGAACTCGTGATCCTTCTGCCTCAGCCTCTCAAGTGCTGGGACTATAGGAGTGCAGCACACCATGGCATTTAACACTTATTCCCACCAGTTTGAGGACTGCCTGGCTACATCGTGAGACTCTCTCAAAAAGCAAAAAATACAGACAAAACAAAACCAAAAAGCAAAACCCTCCCTCCTGAAGAGACACTGAAAACCCAGCAGGCACATCCCTCAGCTGTCAGAGCCACAGCATTGTGATGCATCATGGGCCTCTGGACTCACCTTGGGCGCTGATGAGAGGACAAAGGTGACAGGCATTGTGACCTCAGTATCAGCACAGCAATGCTGTGGCTCTGCTGCAAAGGGTTTTGGGGACCCTGGAGGCCACACTGACCACGGTGATTCTACCCCGATTCCCTCTGGTAGGGCGTCTAGTGTGAAAGACCTGGGTTGTGCAGTGGCAGAAGCGGGACGGCCTGGCTTCCATGCTGTCCCTGAGCTGAGGGATAACCAGCCCTGCAGCCTGTCTGGACTCCTGCATGTAGCCCTCCCCAGGGAGGGCAGGGCCTGGCCCTTCACTCCCTACGCCCACTCCCGTGTGCAGCAGCCCTGTTCTCTGGAGCCTTGCTGGGCTCCCGCTTAGTGAAGTCAGCTTGTCACTACAGGGACACAGACACTGGAACTTGCATGGCTGTGGCTGGGACTGACTGTGTTCATGGCTAACATCACAGCTTCAAGCATATGTCAACCTGAGATTCCCACTGTTCAAGTGCTCAGTGGTGCCAACGGCCACGAGTCACTCACTGGACAGCGAAGACCTCAATGTTTACATCTCACCCAGTGAACTCTTATCTTGCTGGCAGGAGCTCACATATGAATCCTTCAGAGAAACCTTTTGTAAGCCAACCCCAAAACTAGGCCTCATTTTTGTTCTTGTATTTTTTTTTTTTTTATAACTCTCTATACTCTGTTCAGAACACTTGCTATAGACTGTAACTGGGGAAGGTTTTTGTGCCCTTGAGCTGCTATAATAAAATACCTGAGACCA

XM_004842656.1 Coding sequence

Acsf3 acyl-CoA synthetase family member 3, transcript variant X2

High confidence: 4 potential gene matches
Length: 1743 bp    Location: 655921..627093   Strand: -
>XM_004842656.1
ATGCTTCTCAGCGCCATGCTGCTCCGCATGACTCTGCCCTCCCGGCACCTGGTCTGGGCTGCGGCCTCCTGCGGTCCGGCACCTGGGAGACACCGAGGAGGCCGCTTCCTGCACAGGGCCCCCACTGCCCGCTCTGACAGGGCCGGCCCTGTCTTCACCAAGGCCCTGGCCTTTGGGGACAGGATCGCCCTGGTTGACCAGCACGGCTGCCACACCTACCGGGACCTGTACCACCGCAGCCTGCGCCTGTCCCTGGAGATCTGCAGGCTCCGTGGCTGCATGGACGGAGACCTGCAGGACGAACGGATCTCCTTCCTGTGCTCCAACGATGTCTCCTATGTCGTGGCCCAGTGGGCTTCGTGGGTGAGCGGTGGCATCGCTGTCCCCCTCTTCTGGAAGCACCCCGAGCCACAGCTGGAGTACTTCATCCAGGACTCCCGCAGCTCCGTGGTCCTGGCCAGCCCGGAGCATGTGCCGCTGGTGGGCCCAGTCGCCGGGAGGCTGGGGCTCCCACTCTTGTCTCTCCCTCCCGACGTCTACCATGGGGCTGTGGAGGAGCCCGCAGCGGAGCCAGAGCAGAAGCACAAGTGGCGAGAACGGGGCGCCATGATCCTCTACACCAGTGGGACCACAGGGAGGCCCAGGGGCGTGCTGAGCACCCACGGCAGCCTCACGGCCACGGTGACTGGGCTGGTCCATGCCTGGGCGTGGACGAGAGACGACGTGATCCTGCACGTCCTCCCGCTGCACCACATGCACGGCGTGGTCAACAAGCTGCTGTGCCCGCTCTGGGTGGGGGCCACCTGCGTGATGCTGCCCGAGTTCAGCGCCCAGCAGGTTTGGGAAAAGTTCCTTAGTTCTGAAACTCCACGGATTAATGTGTTCATGGCAGTGCCCACCATATACTCCAAGTTGCTGGATTACTACGACCAGCACTTCACCCAGCCTCATGTCCAGGATTTCGTGCGTGCAGTTTGTGAAGAAAAAATAAGGCTCATGGTGTCCGGCTCGGCCGCACTGCCCACGCCCCTGCTGGAGAGGTGGAAGAGCGCCACGGGCCACATGCTGCTGGAGCGCTACGGCATGACCGAGGTTGGCATGGCCCTGTCCAGCCCCCTGGCCGGGGCTCGCCTACCAGGTTCTGTGGGGACCCCACTGCCCGGAGTGGAGGTTCGCATCGTCTCGGAGAGCCCACAGAGGGACGGCTGCCCATACACCGTGCACGCCCAGGGGGACACGCAGGGGACAAAGGTGACCCCAGGGCTTGAGGAGAAGGAAGGGGAGCTGCTGGTCAGGGGCCCCTCCGTGTTCCGAGAGTACTGGGATAAACCAGAAGAAACGAAGACCGCCTTCACCTCCGACGGCTGGTTCAGGACAGGGGACACCGCTGTGTTCAAGGATGACAGTTACTGGATCCGCGGCCGCACGTCAGTGGACATCATCAAGACTGGAGGGTACAAAGTCAGCGCGCTGGAGGTCGAGCGGCAGCTGCTGGCCCACCCCAGCATCTCGGATGTGGCTGTGATTGGCGTTCCGGATGTGACGTGGGGTCAGCGGGTCACGGCTGTGGTGGCCCTTCACGCAGGACACTCGCTGTCCCACAGTGACCTCAAGGAGTGGGCCAGGCGCTTCCTGGCCCCCTACGCTGTGCCCTCGGGGCTCGTACTGATGGAGGAGATCCCGCGGAACCAGATGGGCAAGATCAACAAGAAGGACCTGGTCAGGCAGCTCTACCCAGAGTGA

XM_004842655.1 Coding sequence

Acsf3 acyl-CoA synthetase family member 3, transcript variant X1

Length: 1743 bp    Location: 652599..627093   Strand: -
>XM_004842655.1
ATGCTTCTCAGCGCCATGCTGCTCCGCATGACTCTGCCCTCCCGGCACCTGGTCTGGGCTGCGGCCTCCTGCGGTCCGGCACCTGGGAGACACCGAGGAGGCCGCTTCCTGCACAGGGCCCCCACTGCCCGCTCTGACAGGGCCGGCCCTGTCTTCACCAAGGCCCTGGCCTTTGGGGACAGGATCGCCCTGGTTGACCAGCACGGCTGCCACACCTACCGGGACCTGTACCACCGCAGCCTGCGCCTGTCCCTGGAGATCTGCAGGCTCCGTGGCTGCATGGACGGAGACCTGCAGGACGAACGGATCTCCTTCCTGTGCTCCAACGATGTCTCCTATGTCGTGGCCCAGTGGGCTTCGTGGGTGAGCGGTGGCATCGCTGTCCCCCTCTTCTGGAAGCACCCCGAGCCACAGCTGGAGTACTTCATCCAGGACTCCCGCAGCTCCGTGGTCCTGGCCAGCCCGGAGCATGTGCCGCTGGTGGGCCCAGTCGCCGGGAGGCTGGGGCTCCCACTCTTGTCTCTCCCTCCCGACGTCTACCATGGGGCTGTGGAGGAGCCCGCAGCGGAGCCAGAGCAGAAGCACAAGTGGCGAGAACGGGGCGCCATGATCCTCTACACCAGTGGGACCACAGGGAGGCCCAGGGGCGTGCTGAGCACCCACGGCAGCCTCACGGCCACGGTGACTGGGCTGGTCCATGCCTGGGCGTGGACGAGAGACGACGTGATCCTGCACGTCCTCCCGCTGCACCACATGCACGGCGTGGTCAACAAGCTGCTGTGCCCGCTCTGGGTGGGGGCCACCTGCGTGATGCTGCCCGAGTTCAGCGCCCAGCAGGTTTGGGAAAAGTTCCTTAGTTCTGAAACTCCACGGATTAATGTGTTCATGGCAGTGCCCACCATATACTCCAAGTTGCTGGATTACTACGACCAGCACTTCACCCAGCCTCATGTCCAGGATTTCGTGCGTGCAGTTTGTGAAGAAAAAATAAGGCTCATGGTGTCCGGCTCGGCCGCACTGCCCACGCCCCTGCTGGAGAGGTGGAAGAGCGCCACGGGCCACATGCTGCTGGAGCGCTACGGCATGACCGAGGTTGGCATGGCCCTGTCCAGCCCCCTGGCCGGGGCTCGCCTACCAGGTTCTGTGGGGACCCCACTGCCCGGAGTGGAGGTTCGCATCGTCTCGGAGAGCCCACAGAGGGACGGCTGCCCATACACCGTGCACGCCCAGGGGGACACGCAGGGGACAAAGGTGACCCCAGGGCTTGAGGAGAAGGAAGGGGAGCTGCTGGTCAGGGGCCCCTCCGTGTTCCGAGAGTACTGGGATAAACCAGAAGAAACGAAGACCGCCTTCACCTCCGACGGCTGGTTCAGGACAGGGGACACCGCTGTGTTCAAGGATGACAGTTACTGGATCCGCGGCCGCACGTCAGTGGACATCATCAAGACTGGAGGGTACAAAGTCAGCGCGCTGGAGGTCGAGCGGCAGCTGCTGGCCCACCCCAGCATCTCGGATGTGGCTGTGATTGGCGTTCCGGATGTGACGTGGGGTCAGCGGGTCACGGCTGTGGTGGCCCTTCACGCAGGACACTCGCTGTCCCACAGTGACCTCAAGGAGTGGGCCAGGCGCTTCCTGGCCCCCTACGCTGTGCCCTCGGGGCTCGTACTGATGGAGGAGATCCCGCGGAACCAGATGGGCAAGATCAACAAGAAGGACCTGGTCAGGCAGCTCTACCCAGAGTGA

XM_004842670.1 Coding sequence

Galns galactosamine (N-acetyl)-6-sulfate sulfatase, transcript variant X4

Length: 1377 bp    Location: 786257..802570   Strand: +
>XM_004842670.1
ATGGCCATGGAGGCCGCGGTCGTGGTGCCCAGGGGGTGGCGGCTGCTGCTGCTGGTGAGCGCCGCGGGGCTTGTGGCCCTGGGCGCCCCGCAGCCCCCTAACATCCTGCTGCTGCTCATGGACGACATGGGGTGGGGTGACCTGGGGGTGTACGGAGAGCCCTCCAGAGAGACCCCGAACCTGGACCGCATGGCTGCAGAGGGGATGCTGTTCCCCAACTTCTACTCTGCCAACCCCCTGTGTTCGCCGTCCAGGGCGGCCCTGCTCAGTGGACGGCTGCCCATCCGCAACGGCTTCTACACCACCAATGCGCACGCCAGGAATGCGTACACCCCGCAGGAAATAGTGGGCGGCATCCCCGACTCAGAGCGCCTCCTGCCCTCACTCCTGAAAGAGGCTGGCTACGCCACCAAGATCGTGGGCAAGTGGCACCTGGGTCACAGGCCCCAGTTCCACCCCCTGAAGCACGGATTCGATGAGTGGTTTGGATCACCCAACTGTCACTTTGGACCTTATGACAACAAGGCCAAGCCCAACATCCCTGTGTATAAGGACTGGGAAATGGTCGGCAGATTTTATGAAGAATTCCCAATCAACGTGAAGACTGGGGAATCCAACCTCACCCAGATCTACTTACAGGAAGCCCTGGACTTCATCAAGCGGCAGCAGGCAGCACGACGCCCGTTCTTCCTCTACTGGGCAGTGGATGCCACACATGCTCCTGTGTACGCCTCCCGGCCTTTCCTGGGCAGCAGCCAGCGTGGGCGGTATGGGGATGCGGTGCGGGAGATCGATGACAGTGTCGGGAAGATGCTGAGCCTGCTGCAGGTCCTGGGCCTTGCGGAGAGCACCTTCGTCTTCTTCACCTCAGACAATGGTGCTGCCCTTGTCTCTGCTCCCAGCCAAGGTGGCAGCAATGGCCCCTTCCTGTGCGGGAAGCAGACCACCTTTGAAGGTGGCATGAGGGAGCCTGCAATTGCGTGGTGGCCCAGGCACATCCCTCCTGGCCAGGTGAGCCACCAGCTGGGCAGCATCATGGACCTTTTCACCACCAGCCTGGCCCTTGCGGGCCTGAAGCCCCCCAGAGACAGGGTGATTGATGGCTTCAGCCTCCTCCCTGCCTTGCTGCAGGGCCAGCTGACAGATAGGCCCATACTCTATTACCGTGGCAACACCCTGATGGCTGTCACCCTCGGGCAGCACAAGGCCCACTTCTGGACCTGGACCAACTCCTGGGAGGAGTTCAGACAGGGCATCAACTTCTGCCCCGGGCAGAACATCTCAGGAGTCACCACGCATACCCAGGAGGAACACACAAAGCTGCCTCTGGTCTTCCACCTGGGGCGCGACCCTGGGGAGAGGTTTCCGCTCAGGTGA

XM_004842658.1 Coding sequence

Cbfa2t3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3, transcript variant X1

High confidence: 4 potential gene matches
Length: 1848 bp    Location: 716836..773169   Strand: +
>XM_004842658.1
ATGGCACAGGCACCCTCCACGCTGGAGAGCGGGGCCCTGGCATCTGCGCCCTGGGGTCCCAGGAAGGGCAGCCCAGCAGACAGGACAGAGAAGGCCGCAGCGATGCCCGACTCCCCAGCTGAGGTGAAGACGCAGCCCCGGGCCACACCTCCCAGCATGCCGCCCCCGCCCCCCGCTGCGTCCCAGGGGGCCGCGCGCCCGCCCTCCTTCACGCCGCACACACATGGCGAGGACGGCCCTGCGACGTCTCTGCCCCACAGCCGTTTCCACGGCTGCTTAAAGTGGTCCATGGTCTGTCTCTTGATGAACGGCGGCAGCCACTCGCCAACAGCCGTGCATGGTGCCCCGTCCACACCCAACGGCTTCAGCAACGGCCCGGCCACGTCGTGCTCAGCTGCGCTGTCCACGCAGCACCTGCCCCCGGCCTGTGGGGCCCGGCAGCTCAGCAAGCTGAAGCGCTTCCTCAGCACCCTGCAGCAGTTCGGCAGCGACATCTCGCCCGAGATCGGGGAGCGCGTGCGCATGCTGGTGCTGGGGCTGGTGAACTCGACACTGACGATCGAAGAGTTCCACGCCAAGCTGCAGGAGGCCACCAATTTCCCTCTGCGGCCATTCGTCATCCCCTTCCTGAAGGCCAACTTGCCCTTGCTGCAGCGCGAGCTGCTGCACTGCGCCCGCCTGGCCAAGCAGACACCCGCCCAGTACCTGGCCCAGCATGAGCAGACACTGCTGGATGCCAGCACCACCTCCCCCGGCGACTCCTCCGAGCTCCTGTTAGAGGTGAACGAGAATGGCAAGAGGCGGACGCCTGACAGGACCAAAGAGAATGGGTCAGACGGTGACCCGCCGCACCTGGACCACCTCAGCAAACGGCCGTGCACCCTGAGCCCCGCCCAGCGCTGCAGCCCCAGCAACGGGCTGCCACACCCCATGCCGCCACCACACTACCGCCTGGAGGACATGGCCATGGCCCACCACTTCCGCGACCCCTACCGACCCCCCGAGCCCCGGGAGCTGCGGGAGCGCCATCGGCAGCTGGCAGTGCCTGGGGCCCGGCAGGAAGAAGTGATTGACCACAGGCTCACAGAGCGAGAGTGGGCGGAAGAGTGGAAACACCTCAACAGTCTCCTGAACTGCATTATGGACATGGTGGAGAAGACTCGGCGCTCACTCACGGTGCTGCGCCGATGCCAGGAGACAGACCGCGAGGAGCTCAACCACTGGATCCGGCGCTACAGCGACGCCGAGGACCTGAAGAAGGGCCCTGGTCCCACCCGGCCCCTCAGCAGCTCTGCTGGCCTCGAGAGCTCTCAGCTTGACTTGCACCGTGAGCTCACACCCAGGGCGCTGTCCGGCTACATGCCTGAGGAGATCTGGAGGAAGGCCGAGGAGGCCGTGAACGAGGTGAAGCGTCAGGCGATGTCGGAGCTGCAGAAAGCCGTGTCAGACGCAGAGCGCAAAGCCCATGAGCTCATCACCACAGAGCGTGCCAAGATGGAGCGGGCCCTGGCCGAGGCCAAGCGCCAGGCCTCTGAGGACGCCCTGACTGTCGTAAACCAGCAGGAGGACTCCAGCGAGAGCTGCTGGAACTGCGGGCGCAAGGCCAGCGAGACGTGCAGTGGCTGCAATGCTGCACGCTACTGCGGCTCCTTCTGCCAGCACAAGGACTGGGAGAAGCACCACCATGTGTGCGGCCAGAGCCTGCAGGGCCCTGCTGCTGCAGTGCCCGACACGCTGCCTGGGCAGCCTGATGCCACTGCCAGCCCCAGCGAGGCCAGCTCTGCCGGGCCCTCCCGCCCGGGCTCCCCTGGCCCACCCGGCCCGCTGGATGCTGCCGTGCCCCGCTGA

XM_004842659.1 Coding sequence

Cbfa2t3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3, transcript variant X2

Length: 1746 bp    Location: 735897..773169   Strand: +
>XM_004842659.1
ATGCCCGACTCCCCAGCTGAGGTGAAGACGCAGCCCCGGGCCACACCTCCCAGCATGCCGCCCCCGCCCCCCGCTGCGTCCCAGGGGGCCGCGCGCCCGCCCTCCTTCACGCCGCACACACATGGCGAGGACGGCCCTGCGACGTCTCTGCCCCACAGCCGTTTCCACGGCTGCTTAAAGTGGTCCATGGTCTGTCTCTTGATGAACGGCGGCAGCCACTCGCCAACAGCCGTGCATGGTGCCCCGTCCACACCCAACGGCTTCAGCAACGGCCCGGCCACGTCGTGCTCAGCTGCGCTGTCCACGCAGCACCTGCCCCCGGCCTGTGGGGCCCGGCAGCTCAGCAAGCTGAAGCGCTTCCTCAGCACCCTGCAGCAGTTCGGCAGCGACATCTCGCCCGAGATCGGGGAGCGCGTGCGCATGCTGGTGCTGGGGCTGGTGAACTCGACACTGACGATCGAAGAGTTCCACGCCAAGCTGCAGGAGGCCACCAATTTCCCTCTGCGGCCATTCGTCATCCCCTTCCTGAAGGCCAACTTGCCCTTGCTGCAGCGCGAGCTGCTGCACTGCGCCCGCCTGGCCAAGCAGACACCCGCCCAGTACCTGGCCCAGCATGAGCAGACACTGCTGGATGCCAGCACCACCTCCCCCGGCGACTCCTCCGAGCTCCTGTTAGAGGTGAACGAGAATGGCAAGAGGCGGACGCCTGACAGGACCAAAGAGAATGGGTCAGACGGTGACCCGCCGCACCTGGACCACCTCAGCAAACGGCCGTGCACCCTGAGCCCCGCCCAGCGCTGCAGCCCCAGCAACGGGCTGCCACACCCCATGCCGCCACCACACTACCGCCTGGAGGACATGGCCATGGCCCACCACTTCCGCGACCCCTACCGACCCCCCGAGCCCCGGGAGCTGCGGGAGCGCCATCGGCAGCTGGCAGTGCCTGGGGCCCGGCAGGAAGAAGTGATTGACCACAGGCTCACAGAGCGAGAGTGGGCGGAAGAGTGGAAACACCTCAACAGTCTCCTGAACTGCATTATGGACATGGTGGAGAAGACTCGGCGCTCACTCACGGTGCTGCGCCGATGCCAGGAGACAGACCGCGAGGAGCTCAACCACTGGATCCGGCGCTACAGCGACGCCGAGGACCTGAAGAAGGGCCCTGGTCCCACCCGGCCCCTCAGCAGCTCTGCTGGCCTCGAGAGCTCTCAGCTTGACTTGCACCGTGAGCTCACACCCAGGGCGCTGTCCGGCTACATGCCTGAGGAGATCTGGAGGAAGGCCGAGGAGGCCGTGAACGAGGTGAAGCGTCAGGCGATGTCGGAGCTGCAGAAAGCCGTGTCAGACGCAGAGCGCAAAGCCCATGAGCTCATCACCACAGAGCGTGCCAAGATGGAGCGGGCCCTGGCCGAGGCCAAGCGCCAGGCCTCTGAGGACGCCCTGACTGTCGTAAACCAGCAGGAGGACTCCAGCGAGAGCTGCTGGAACTGCGGGCGCAAGGCCAGCGAGACGTGCAGTGGCTGCAATGCTGCACGCTACTGCGGCTCCTTCTGCCAGCACAAGGACTGGGAGAAGCACCACCATGTGTGCGGCCAGAGCCTGCAGGGCCCTGCTGCTGCAGTGCCCGACACGCTGCCTGGGCAGCCTGATGCCACTGCCAGCCCCAGCGAGGCCAGCTCTGCCGGGCCCTCCCGCCCGGGCTCCCCTGGCCCACCCGGCCCGCTGGATGCTGCCGTGCCCCGCTGA

XM_004842661.1 Coding sequence

Cbfa2t3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3, transcript variant X4

Length: 1746 bp    Location: 736637..773169   Strand: +
>XM_004842661.1
ATGCCCGACTCCCCAGCTGAGGTGAAGACGCAGCCCCGGGCCACACCTCCCAGCATGCCGCCCCCGCCCCCCGCTGCGTCCCAGGGGGCCGCGCGCCCGCCCTCCTTCACGCCGCACACACATGGCGAGGACGGCCCTGCGACGTCTCTGCCCCACAGCCGTTTCCACGGCTGCTTAAAGTGGTCCATGGTCTGTCTCTTGATGAACGGCGGCAGCCACTCGCCAACAGCCGTGCATGGTGCCCCGTCCACACCCAACGGCTTCAGCAACGGCCCGGCCACGTCGTGCTCAGCTGCGCTGTCCACGCAGCACCTGCCCCCGGCCTGTGGGGCCCGGCAGCTCAGCAAGCTGAAGCGCTTCCTCAGCACCCTGCAGCAGTTCGGCAGCGACATCTCGCCCGAGATCGGGGAGCGCGTGCGCATGCTGGTGCTGGGGCTGGTGAACTCGACACTGACGATCGAAGAGTTCCACGCCAAGCTGCAGGAGGCCACCAATTTCCCTCTGCGGCCATTCGTCATCCCCTTCCTGAAGGCCAACTTGCCCTTGCTGCAGCGCGAGCTGCTGCACTGCGCCCGCCTGGCCAAGCAGACACCCGCCCAGTACCTGGCCCAGCATGAGCAGACACTGCTGGATGCCAGCACCACCTCCCCCGGCGACTCCTCCGAGCTCCTGTTAGAGGTGAACGAGAATGGCAAGAGGCGGACGCCTGACAGGACCAAAGAGAATGGGTCAGACGGTGACCCGCCGCACCTGGACCACCTCAGCAAACGGCCGTGCACCCTGAGCCCCGCCCAGCGCTGCAGCCCCAGCAACGGGCTGCCACACCCCATGCCGCCACCACACTACCGCCTGGAGGACATGGCCATGGCCCACCACTTCCGCGACCCCTACCGACCCCCCGAGCCCCGGGAGCTGCGGGAGCGCCATCGGCAGCTGGCAGTGCCTGGGGCCCGGCAGGAAGAAGTGATTGACCACAGGCTCACAGAGCGAGAGTGGGCGGAAGAGTGGAAACACCTCAACAGTCTCCTGAACTGCATTATGGACATGGTGGAGAAGACTCGGCGCTCACTCACGGTGCTGCGCCGATGCCAGGAGACAGACCGCGAGGAGCTCAACCACTGGATCCGGCGCTACAGCGACGCCGAGGACCTGAAGAAGGGCCCTGGTCCCACCCGGCCCCTCAGCAGCTCTGCTGGCCTCGAGAGCTCTCAGCTTGACTTGCACCGTGAGCTCACACCCAGGGCGCTGTCCGGCTACATGCCTGAGGAGATCTGGAGGAAGGCCGAGGAGGCCGTGAACGAGGTGAAGCGTCAGGCGATGTCGGAGCTGCAGAAAGCCGTGTCAGACGCAGAGCGCAAAGCCCATGAGCTCATCACCACAGAGCGTGCCAAGATGGAGCGGGCCCTGGCCGAGGCCAAGCGCCAGGCCTCTGAGGACGCCCTGACTGTCGTAAACCAGCAGGAGGACTCCAGCGAGAGCTGCTGGAACTGCGGGCGCAAGGCCAGCGAGACGTGCAGTGGCTGCAATGCTGCACGCTACTGCGGCTCCTTCTGCCAGCACAAGGACTGGGAGAAGCACCACCATGTGTGCGGCCAGAGCCTGCAGGGCCCTGCTGCTGCAGTGCCCGACACGCTGCCTGGGCAGCCTGATGCCACTGCCAGCCCCAGCGAGGCCAGCTCTGCCGGGCCCTCCCGCCCGGGCTCCCCTGGCCCACCCGGCCCGCTGGATGCTGCCGTGCCCCGCTGA

XM_004842671.1 Coding sequence

Galns galactosamine (N-acetyl)-6-sulfate sulfatase, transcript variant X5

Length: 1338 bp    Location: 786255..805450   Strand: +
>XM_004842671.1
ATGGCCATGGAGGCCGCGGTCGTGGTGCCCAGGGGGTGGCGGCTGCTGCTGCTGGTGAGCGCCGCGGGGCTTGTGGCCCTGGGCGCCCCGCAGCCCCCTAACATCCTGCTGCTGCTCATGGACGACATGGGGTGGGGTGACCTGGGGGTGTACGGAGAGCCCTCCAGAGAGACCCCGAACCTGGACCGCATGGCTGCAGAGGGGATGCTGTTCCCCAACTTCTACTCTGCCAACCCCCTGTGTTCGCCGTCCAGGGCGGCCCTGCTCAGTGGACGGCTGCCCATCCGCAACGGCTTCTACACCACCAATGCGCACGCCAGGAATGCGTACACCCCGCAGGAAATAGTGGGCGGCATCCCCGACTCAGAGCGCCTCCTGCCCTCACTCCTGAAAGAGGCTGGCTACGCCACCAAGATCGTGGGCAAGTGGCACCTGGGTCACAGGCCCCAGTTCCACCCCCTGAAGCACGGATTCGATGAGTGGTTTGGATCACCCAACTGTCACTTTGGACCTTATGACAACAAGGCCAAGCCCAACATCCCTGTGTATAAGGACTGGGAAATGGTCGGCAGATTTTATGAAGAATTCCCAATCAACGTGAAGACTGGGGAATCCAACCTCACCCAGATCTACTTACAGGAAGCCCTGGACTTCATCAAGCGGCAGCAGGCAGCACGACGCCCGTTCTTCCTCTACTGGGCAGTGGATGCCACACATGCTCCTGTGTACGCCTCCCGGCCTTTCCTGGGCAGCAGCCAGCGTGGGCGGTATGGGGATGCGGTGCGGGAGATCGATGACAGTGTCGGGAAGATGCTGAGCCTGCTGCAGGTCCTGGGCCTTGCGGAGAGCACCTTCGTCTTCTTCACCTCAGACAATGGTGCTGCCCTTGTCTCTGCTCCCAGCCAAGGTGGCAGCAATGGCCCCTTCCTGTGCGGGAAGCAGACCACCTTTGAAGGTGGCATGAGGGAGCCTGCAATTGCGTGGTGGCCCAGGCACATCCCTCCTGGCCAGGGCATCAACTTCTGCCCCGGGCAGAACATCTCAGGAGTCACCACGCATACCCAGGAGGAACACACAAAGCTGCCTCTGGTCTTCCACCTGGGGCGCGACCCTGGGGAGAGGTTTCCGCTCAGCTTTGCCAGCACAGAGTACCAGGATGCCCTCAGCAGGATCACCCTGGTGGTCCAGCAGCACCAGGACACCCTGGTCCCTGGACAGCCTCAGCTCAACGTGTGCGACCAGGCAGTCATGAACTGGGCACCCCCAGGCTGTGAGAAGCTGGGCAAGTGTCTGCGGCCTCCAGAGTCCGTCCTGGAGAAGTGCTTCTGGCCCCATTAG

XM_004842677.1 Coding sequence

Cdt1 chromatin licensing and DNA replication factor 1, transcript variant X4

Length: 1608 bp    Location: 813851..808063   Strand: -
>XM_004842677.1
ATGGCACAGAGCCGGGTCACCGACTTCTTCGCTTGCCGCCGCCCGGGGTCTGCAGCTCCGCGGGTCAAGGCAGCCTGCCGCACCCCGAGCCCTGCCCGGCCCGCGCCCGGCCCGGGCAGCAGCCGCAAGCGCGCCCGTCCTCCCGCTGCGTCCGGGGGCGAGCAGCCCGCGCCGCCCGCGCGCCGGAGACTGCGGCTTCGGGACGACTCCTGTCCCAGTTCCCCAGCCACCCTCAGCTCCCTTGCCTGTCCTTCGCCGGTCAAGAAGATCAAGAAAACCTCCGCTCCTGCACCAGCAGGCCAGCTGTCCCTCCCCGCAGCCCCACAGGACAAGGACACCCTCTCTGAGCTCCAGGTGTGCCTTCAGCGTGCACGGGAGCTGGGCACACGCGTCCAGGCACTGAGGGCCAGGCCTCAGGAGGGTGCTGAGGAACCCAGCCCACCGGAGGCCAACCTCCAGGAGCAGCCATGTGGCCAGAAGACGCCTGCCTACCAACGCTTCCATGCCCTGGCCCAGCCCGGCCCACCAGGCCTTGTGCTGCCCTACAAGTACCAGGTGCTGGCCGAGATGTTTCGAAGCATGGACACCATTGTGGGCATGCTCCACAACCGCTCCGAGACTGCGACCTTTGCCAAGGTCAAGGGGGGGGTCCAGGACATGATGCGCAAGCGCTTCGAGGAGCGCAACGTGGGCCAGATCAAAACTGTGTATCCGATGTCCTACTGCTTCCGCCAGGAGCGCAATGTCCCCACCTTCAAGGACAGTGTCAAGAAGTCTGATTACCAGCTCACCATAGAGCCACTGCTGGGCCAGGAGCCTGGTGGCGCCGTGCCTCAGCTCACAGCCTCACGCCTGCTGCAGCGGCGACAGGTTTTCAGCCAGAACCTGGTGAACCGGGTCAAGGAGCACCACAAGGCCTTCCTCGCCTCCCTGACCCCCCCCATGGCTGTGCCTGAGGACCAGCTGACGCGCTGGCACCCGCGCTTCAACGTGGATGAGGTGCCTGACATCGAGCCTGCTGAGCTGCCCCAGCCACCCACCACGGAGCAGCTCACCAGTGCCCAGGAGGTGCTGGCCCGCGCCCGAAGCCTGATGTCGCCCAGGATGGAGAAGGCGTTGTGTCACGCAGCACTGTGTGCAGCGGAGCCCGGCAGCCCTGGATCCCCCGGCCCGGCCCTGCCAGCCAGCCCTGCCAGCCCGCCCAGCGCCCTGAAGGGTGTGCCCCAGGCCCTGCTGGAGCGGATCCGTGCCAAGGAGGCCCAGAAACAGCTGGCGCAGATGACGCGCTGCCCGGAGCACGAGCTGCGGCTGCAGCGGCTGCAGCGACTGCCCGAGCTGGCCCGCGTGCTGCGCGGTGTCTTCGTGTCTGAGAGAAAGCCCGCGCTCACCATGGAGGTGGCCTGCACCAGGATGGTGGGCAGCTGCCGTGCTGCCCTGAGCCTGGGGGAGATGGAGAGGCACCTGCTGCTCCTCAGCGAGCTGCTGCCTGACTGGCTCAGCCTGCACCGCATCCGCACCAGCACTTACATCAAGCTGGACAAGGCTGCCAACCTGGCCAGCATCACTGCACGGCTGGCCCACCAGGCCCACACTGAGGAGGGGCAGTGA

XM_004842674.1 Coding sequence

Cdt1 chromatin licensing and DNA replication factor 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1737 bp    Location: 813851..809328   Strand: -
>XM_004842674.1
ATGGCACAGAGCCGGGTCACCGACTTCTTCGCTTGCCGCCGCCCGGGGTCTGCAGCTCCGCGGGTCAAGGCAGCCTGCCGCACCCCGAGCCCTGCCCGGCCCGCGCCCGGCCCGGGCAGCAGCCGCAAGCGCGCCCGTCCTCCCGCTGCGTCCGGGGGCGAGCAGCCCGCGCCGCCCGCGCGCCGGAGACTGCGGCTTCGGGACGTGGACTCCTGTCCCAGTTCCCCAGCCACCCTCAGCTCCCTTGCCTGTCCTTCGCCGGTCAAGAAGATCAAGAAAACCTCCGCTCCTGCACCAGCAGGCCAGCTGTCCCTCCCCGCAGCCCCACAGGACAAGGTCCCCTCAAAGGACACCCTCTCTGAGCTCCAGGTGTGCCTTCAGCGTGCACGGGAGCTGGGCACACGCGTCCAGGCACTGAGGGCCAGGCCTCAGGAGGGTGCTGAGGAACCCAGCCCACCGGAGGCCAACCTCCAGGAGCAGCCATGTGGCCAGAAGACGCCTGCCTACCAACGCTTCCATGCCCTGGCCCAGCCCGGCCCACCAGGCCTTGTGCTGCCCTACAAGTACCAGGTGCTGGCCGAGATGTTTCGAAGCATGGACACCATTGTGGGCATGCTCCACAACCGCTCCGAGACTGCGACCTTTGCCAAGGTCAAGGGGGGGGTCCAGGACATGATGCGCAAGCGCTTCGAGGAGCGCAACGTGGGCCAGATCAAAACTGTGTATCCGATGTCCTACTGCTTCCGCCAGGAGCGCAATGTCCCCACCTTCAAGGACAGTGTCAAGAAGTCTGATTACCAGCTCACCATAGAGCCACTGCTGGGCCAGGAGCCTGGTGGCGCCGTGCCTCAGCTCACAGCCTCACGCCTGCTGCAGCGGCGACAGGTTTTCAGCCAGAACCTGGTGAACCGGGTCAAGGAGCACCACAAGGCCTTCCTCGCCTCCCTGACCCCCCCCATGGCTGTGCCTGAGGACCAGCTGACGCGCTGGCACCCGCGCTTCAACGTGGATGAGGTGCCTGACATCGAGCCTGCTGAGCTGCCCCAGCCACCCACCACGGAGCAGCTCACCAGTGCCCAGGAGGTGCTGGCCCGCGCCCGAAGCCTGATGTCGCCCAGGATGGAGAAGGCGTTGTGTCACGCAGCACTGTGTGCAGCGGAGCCCGGCAGCCCTGGATCCCCCGGCCCGGCCCTGCCAGCCAGCCCTGCCAGCCCGCCCAGCGCCCTGAAGGGTGTGCCCCAGGCCCTGCTGGAGCGGATCCGTGCCAAGGAGGCCCAGAAACAGCTGGCGCAGATGACGCGCTGCCCGGAGCACGAGCTGCGGCTGCAGCGGCTGCAGCGACTGCCCGAGCTGGCCCGCGTGCTGCGCGGTGTCTTCGTGTCTGAGAGAAAGCCCGCGCTCACCATGGAGGTGGCCTGCACCAGGATGGTGGGCAGCTGCCGTGCTGCCCTGAGCCTGGGTATGCGTGGGTCAGGGAGGAGTCCAGGGTGGGCAGGGTCCCGACCAGGGTGTCTATGCACCCGATGCCCACAGGGCGCCTGCTATGTGTGTGGGCAGTGGCCTCCAGGGCACCTACCTGCTCTGCAGCCTCCCCGGGGCCTTGCAAACCTGCTGTCCTTGTGGGCCTTGGGACAGACTCCTGACTCCTTACCCGTGTCCTCTCCTCCCAGACCACAGGCATGGTCTGCCCGAGGCTTTCAAGGCTGGGGACCCAGCTCTGCATTCGGGCTTCAGTGA

XM_004842678.1 Coding sequence

Ctu2 cytosolic thiouridylase subunit 2 homolog (S. pombe), transcript variant X1

Length: 1689 bp    Location: 878032..871707   Strand: -
>XM_004842678.1
ATGTGCCAGGTGGGCGAGGACTACGTGGAACCGCCGCCCCGGGAGCCCCCGCCGGTGCCCAGGCCCGGCTGTGGGCAGAAGTGTGTGAAGTGCAAGCAGGGCGATCCGGTGGTGGTTATCCGAGCTGGAGATGCCTTTTGCAGGGACTGTTTCAAGGCCTTCTATGTCCACAAGTTCAGAGCCATGCTAGGGAAGAACCGGCTCATCTTTCCTGGTGAGAAGGTGCTCTTGGCGTGGTCTGGTGGTCCCTCATCCAGCTCCATGGTCTGGCAGGTCCTTGAGGGCCTGAGTCAGGACTCTGCTAAGAGGCTGCGCTTCGTGCCAGGAGTCGTCTATGTGGATGAGGGTGCAGCCTGCGGCCAGAGCCCAGAGGACAGAGCAAAGACCCTGGCTGAGGTGAAGCAGGTTTTGCACGTCGTCAACTTCCCGTGGCACCTGGTGGCCCTGGAAGAGGTGTTCAGCCTGCCACCGTCGGTGCTGCGGTGCTGTCCCCAGGAGCCAGCTGGGACGGAGGGTGCCTACAAGTCCGCCGTGGACAGCTTTCTCCAGCAGTACCACGTGCTGGGGGCCGAGGGGGCTGAGGACAGCTGCGGCCGGGCTCGGGGGGAGGAGGAGCGGCCCTGGCCCCAGAGCCAGGACCCCCACAGCCTCCCGAGCCCAGCTGGGCCCCCCTCTGCCGCCCAGACCGAGGCCCTGTGTAGACTGTTTGAGTCTGTGAGGACGCTGACGGCCAAGGAGGAGCTTCTGCAGACCCTGCGGAGCCACCTGATCCTGCACGTGGCTCGAGCCCACGGCTACTCCAAGGTGATGACCGGGGACAGCTGCACCCGCCTGGCCATCAAGCTCATGACCAACCTGGCCCTGGGCCGAGGAGCCTTCCTCGCCTGGGACACGGGCTTCTCGGACGAGCGACACGGGGATGTGGTGGTGGTGCGGCCCATGAGGGACCACACTCTGAAGGAGGTGGCCTTCTACAACCGTCTGTTTGCTGTTCCCTTAGTCTTCACACCGGCTGTGGACACTAAGGCCCCCGAGAAAGCCAGCGTCCACCGGCTGATGGAGGCCTTCATCCTCAGGCTGCAGGCCCAGTTCCCCTCCACGGTCAGCACTGTGTACAGGACAGGAGAGAAGCTGGTCAAGGCGCCCAGGGACGGCTGTGGTGGGGGGCCCTCAGGCCCTCGGTGCCTCCTCTGCCTGTGCACACTGGACATCGACACTGCTGACAGTGCCACGGCTTTTGGGGCTCAGACCTCGAGTCTCTCCCAGATGCCGCCGTCCACCCTTCAGGCTGAGGCTGGGACGCCCACAGCACCCTGCTGCGCTGTAGGCGAGGGCCCTGGCTGTTGCTGGAAGGCCCGTGGGAGGACGGACGATGCCCAGGCGCAGGTCACCCAGCAGCTGTGCTACGGCTGCAGGGGGAACATGAGCGACCTCGTGAGTGTGGCTGCCCCTCCCCTCCCGGTGGCAGCGGGGTTCGGTGCTTGGGCTCTGCCACCCCTCACCCAGCTGGCTTCTGTTGCAGCCCTCCCTGGACCGCTTGCCGCCCTACATCCTGGCCGAGGCCCAGCTCCGCAGCCAGAGGTACTGGGCCTGTCTGGTGGGGTCCCAGGTGGGAGCCCCTGGGCTGGTTCCCACCCACTCTTCCCACAGGGCCGGGGTCATGCAGGAGATCCAGGAGTATCTGATTGA

XM_004842683.1 Coding sequence

Rnf166 ring finger protein 166, transcript variant X2

Length: 471 bp    Location: 878208..886151   Strand: +
>XM_004842683.1
ATGGCGATGTTCCGCAGCCTGGTGGCTTCGGCTCATCAGCGGCAGCCGCCGCCCGGGCCTGCGGGCGGCGACAGCGGCCTGGAGGCGCAGTACAGTTGTCCCATCTGCCTGGAGGTCCAGGAGCAGATGGCCAACTGCCCCAAGTTTGTCCCCGTGGTGCCCACCTCCCAGCCCATTCCAAGCAACGTCCCCAACAGGTCCACCTTTGCCTGCCCCTACTGCGGCGCCCGCAACCTGGACCAGCAGGAGCTGGTGAAGCACTGTGTGGAGAGCCACCGCAGCGACCCCAACCGAGTGGTGTGCCCCATCTGCTCAGCCATGCCCTGGGGTGACCCGAGCTACAAGAGCGCCAACTTCCTGCAGCACCTGCTGCACCGGCACAAGTTCTCCTACGACACCTTCGTGGACTATAGCATCGATGAAGAAGCTGCCTTCCAGGCTGCCCTGGCCCTGTCCCTCTCTGAGAACTGA

XM_004843223.1 Coding sequence

Cdyl2 chromodomain protein, Y-like 2

High confidence: 3 potential gene matches
Length: 2037 bp    Location: 6593962..6760431   Strand: +
>XM_004843223.1
ATGAGGGTGGCCGGGCTGTCCTGGCTGGCTCTTGAGAGCACCTCTGGACGGGTCATCTCGGCCCTCCTCCCAGTGCCTCTTTTTGCACACCAGCCTGGAGCGGCGGGGGCCGCGCAGCCCCGAGGGGCCAGGTCTTCCCAGGCGAGGGTGGGGGCCGGGCCAGCTGAGCGGGACCGGGGGACCTGCTCCTGCCCCCCTCTACCTGCCACCCCGGCCGCCCCTTCGCGGTCCCGGGCCGGCCCGCCCGCGGGCACCTGGCCCTCCACCCCCGGCGGCCCCCGCCGGCCACCCCAGCAGAGGGCCGAGGCGGCGGGGCGGGCGCGGTGTGACTCGGCTGGGACCGGTCCCCCAGGGCGCGGCCGGGCAGCCGCCCCCGTCCCCCCTCCCCTCGCACACACACTCTCTCACTCCATCTACTTTGCGGCCTTGGAGGGGAAGGAGGAAGCCGGGCGGAGCCGGGCGGGGGAGGTAGCGGTCCCGGGGAGGTGGCTCTCGCCCGACGAGCCGCCCCGAGTGCAGAAAGTACAGGTCGAACGGATTGTTGACAAGAGGAAGAACAAGAAGGGAAAATGGGAGTACCTCATCCGGTGGAAAGGCTACGGGAGCACGGAGGACACGTGGGAGCCAGAGCACCACCTCCTGCACTGTGAGGAGTTCATCGATGAGTTCAACGGGCTGCACCTGACCAAGGACAAGAGGGTCAAGTCCGGGAAGCAGGCGGGCACCTCCAAGCTCCTGCGGGACACCCGAAGCCCCGCGTCGTCGGTGGAGAAACTCTCCCACAGGCCCGCGGAGCCGGGAAAGAGCAAAGGGGCTTCCCACAAGCGGAAGCGAATCAACCCGCCCCTGTCCAAGCCCAGGAAGGGCTACTCAGGCAAACCCCCGGGGGCTGGAGACAGGGCTGCCAAGACTGTGTCGTACAGGACTACGCCCAGTGGCCTGCAGATCATGCCCATGAAAAAGGCCCCGAACGGCATGGAGAACGGGGATGCCGGCTCTGAGAAGGACGAGAGGCACTTTGGAAACGGGTCCCATCAGCCTGATGTGGATCTGACCGACCCTGTCGGAGAGCAGGACGCCAGCAGTGGCGAATGTGATGGGCCCCACTCGGCGCTGGTGGAGAACGGGCTGGGCTCTGCTCTGACCAATGGGGGGCTGAACCTGCACAGCCCCGTGAAGAGGAAGCTGGAGGCTGAGAAGGACTATGTCTTTGATAAGAGGCTCAGGTACAGCGTCCGCCAGAACGAAAGCAACTGTCGATTTCGGGACATTGTGGTGCGGAAGGAAGAGGGTTTCACGCACATCCTGCTGTCCAGCCAGACCTCAGACAACAACGCGTTGACGCCCGAGATCATGAAGGAGGTCCGGCGAGCACTGTGCAATGCAGCCACAGATGACAGCAAGCTGCTGCTGCTCAGCGCCGTGGGGAGCGTGTTCTGCAGCGGTCTGGACTACTCCTACCTGATTGGCCGGCTGTCCAGTGACCGGCGAAAGGAGAGCACTCGGATTGCGGAAGCCATCAGGGACTTCGTGAAGGCCTTCATCCAGTTCAAGAAGCCCATCGTGGTGGCCATCAATGGGCCAGCCCTGGGCCTGGGCGCTTCCATTCTGCCCCTCTGTGACATCGTGTGGGCCAGTGAGAAGGCCTGGTTTCAGACGCCCTATGCCACCATCCGCCTCACACCTGCTGGCTGCTCCTCCTACACCTTCCCCCAGATCCTGGGTGTGGCACTGGCCAACGAGATGCTGTTCTGCGGGCGGAAGCTCACCGCCCAGGAGGCGTGCAGCAGGGGCCTGGTGTCCCAGGTCTTCTGGCCCACCACGTTCAGCCAGGAGGTCATGCTGCGTGTCAAGGAGATGGCGTCATGCAGCGCCGTGGTGTTAGAGGAGTCCAAATGCCTGGTGCGCAGCTTCCTGAAGTCGGTCTTGGAGGACGTGAATGAGAAGGAGTGTGTCATGCTCAAGCAGCTCTGGAGCTCCTCCAAAGGCCTGGACTCTCTGTTCAGCTACCTGCAGGACAAGATCTACGAGGTCTGA

XM_004842787.1 Coding sequence

Hsd17b2 hydroxysteroid (17-beta) dehydrogenase 2, transcript variant X2

High confidence: 4 potential gene matches
Length: 960 bp    Location: 5445784..5372925   Strand: -
>XM_004842787.1
ATGATCATGGTCATCTCTGAGGCAGCATGGTTCTGCCTGGCTGTCACTGCAGCCCTAGGCAGCATAGTTTTCTGCAAACACAAGAGCCCAGGGCAGCTGGGGAGACCAGTGGTCTGGCTCACTGGACTCTGCGGAGGGGCTTACCTGCTCATCTTGTCCTTCTTCTGGAGCTTGGTTCTCTTCTCCTTGTTGTGTTTCCTCATGTGTATGTACTTGGCTGACCAAGAGCTGTTACCCGTGGATCAAAAGGCAGTCCTGGTGACAGGTTGTGATTCTGGGTTCGGCCATGCATTGGCCAAGAACTTGGACAAGCTGGGCTTCACAGTATTCGCTGGAGTTTTGAATGAAAAGAGCTCAGGAGCTGAGGAATTGCGAAGAAACTGCTCCAAGCACATCACTGTGCTTCAGATGGACATCACCAACCCAGAACAGATAAAAGATGCTCACAGCAAAGTCATAGAGAAGGTGCAGGACAAAGGAGTGGTCCCATTGCCAAAGTTCGCAGCTTACAACTCAACGAAGGCAGCTCTGACTATGTTTTCTTCAATTATGAGGCAAGAACTTTCTGCATGGGGAGTAAAAGTCTCTGTGGTCCAGCCTGGAGGCTTCCGAACAAATATTGCAGGCACAAATGATGTATGGCTCAAGAACGAAAAGGACATCCTGGACCACCTCACCCAAGAGCAGCTGAGGGACTATGGCCGGGACTATGTTCTTCTGCAGAAGAATTTCCTCAATAAGTTTGAAAGCTTTACCTGCCCAGACTTTACCCCAGTGCTCCGGGACATCCAACATGCCATCTCTGCTCAGAGCCCGTCTCCCTTCTATATGCCGGGGAAAATGGTTTCCCTGTGGGTCTACTTTGCCTTCCTTTCCCCTACCCACTTATTTGATTATTGTGTTAAAAAAATATTTGTCAAGAGTGAGTATATTCCCAGAGCTCTACACATGCCTAACTAG

XM_004842695.1 Coding sequence

Banp BTG3 associated nuclear protein, transcript variant X1

High confidence: 4 potential gene matches
Length: 1581 bp    Location: 1286241..1207829   Strand: -
>XM_004842695.1
ATGATGTCAGAACAGGACCTGGCGGATGTGGTTCAGATCGCAGTGGAAGACCTGAGTCCTGACCACCCAGTTGTTTTGGAGAACCATGTGGTAACAGATGAAGACGAACCTGCTTTAAAGCGCCAGAGACTAGAAATCAATTGCCAGGATCCGTCCATAAAGTCTTTCCTGTACTCCATTAACCAGACGATATGCTTACGGTTGGATAGCATTGAGGCCAAGCTGCAGGCTCTGGAGGCGACGTGTAAGTCCCTGGAGGAGAAGCTGGACCTGGTCACCAACAAGCAGCACAGCCCCATCCAGGTCCCCATGGTGGCGGGCTCCCCGCTTGGCGCCACCCAGACCTGCAACAAAGTGCGATGCGTCGTCCCCCAGACTACAGTAATTCTCAACAATGATCGGCAGAACGCCATTGTAGCCAAGATGGAAGACCCCTTGAGCAACAGGGCACCGGATTCCCTGGAAAATATCATTAGCAATGCTGTGCCTGGACGTCGGCAGAACACCATTGTGGTGAAGGTGCCGGGTCAAGACGACAGCCACAACGAAGACGGGGAGAGCGGGTCGGAGGCCAGCGACTCGGTGTCCAACTGTGGCCAGCCCGGGAGCCAGAGCATCGGGAGTAACGTCACGCTCATCACCCTGAACTCGGAAGAGGATTACCCCAACGGCACCTGGCTTGGTGACGAGAACAACCCCGAGATGAGGGTGCGCTGTGCCATCATCCCCTCCGACATGCTGCACATCAGCACCAACTGCCGCACCGCTGAGAAGATGGCGCTCACGCTGCTGGACTACCTCTTCCACCGCGAGGTGCAGGCCGTGTCCAATCTGTCCGGCCAGGGCAAGCACGGGAAGAAGCAGCTTGATCCACTCACCATCTATGGCATCCGGTGTCACCTTTTCTATAAATTTGGAATCACGGAATCTGACTGGTACCGGATCAAACAGAGCATTGACTCCAAATGCCGGACAGCGTGGCGGCGAAAACAGCGAGGGCAGAGTCTGGCGGTCAAGAGCTTCTCCCGGAGGACGCCATCCTCGTCCTCTTACAGTGCCTCAGAGACCATGATGGGTACCCCACCGCCTGCCCCCGAGCTGCAGCAGCCGCAGCCGCAGGCCCTGCACTACACCCTGGCCAATGCCCAGCAAGTGCAGATCCACCAGATTGGAGAGGACGGCCAGGTGCAAGTAGGCCACCTCCACATAGCCCAGGTGCCGCAGGGGGAGCAGGTGCAGATCACGCAGGACAGCGAGGGCAATCTGCAGATCCACCACGTGGGCCAGGACGGGCAGGTGCTGCAGGGAGCCCAGCTCATCGCCGTGGCCTCTTCAGACCCTGCCTCGGCTGGCGTGGACGGGTCACCTCTCCAGGGCAGTGACATCCAGGTGCAGTATGTCCAGCTGGCGCCCGTGAGCGAGCACACAGCCACGGCACAGGTGAGTCCTCGGCCTCCGAGGAAGGCCACCCTGCTGCTCCTCTGTGCTGTCTCTGCTTTGGGGCTTCGGCCGTGGCTTTCTCCTGGACGAGGTGTGTTGAGTCGGAAGGCAGGGGCATGTTTGAGGCTTCTGTCCCGATGA

XM_004842698.1 Coding sequence

Banp BTG3 associated nuclear protein, transcript variant X4

Length: 1251 bp    Location: 1286241..1208083   Strand: -
>XM_004842698.1
ATGATGTCAGAACAGGACCTGGCGGATGTGGTTCAGATCGCAGTGGAAGACCTGAGTCCTGACCACCCAGTTGTTTTGGAGAACCATGTGGTAACAGATGAAGACGAACCTGCTTTAAAGCGCCAGAGACTAGAAATCAATTGCCAGGATCCGTCCATAAAGTCTTTCCTGTACTCCATTAACCAGACGATATGCTTACGGTTGGATAGCATTGAGGCCAAGCTGCAGGCTCTGGAGGCGACGTGTAAGTCCCTGGAGGAGAAGCTGGACCTGGTCACCAACAAGCAGCACAGCCCCATCCAGGTCCCCATGGTGGCGGGCTCCCCGCTTGGCGCCACCCAGACCTGCAACAAAGTGCGATGCGTCGTCCCCCAGACTACAGTAATTCTCAACAATGATCGGCAGAACGCCATTGTAGCCAAGATGGAAGACCCCTTGAGCAACAGGGCACCGGATTCCCTGGAAAATATCATTAGCAATGCTGTGCCTGGACGTCGGCAGAACACCATTGTGGTGAAGGTGCCGGGTCAAGACGACAGCCACAACGAAGACGGGGAGAGCGGGTCGGAGGCCAGCGACTCGGTGTCCAACTGTGGCCAGCCCGGGAGCCAGAGCATCGGGAGTAACGTCACGCTCATCACCCTGAACTCGGAAGAGGATTACCCCAACGGCACCTGGCTTGGTGACGAGAACAACCCCGAGATGAGGGTGCGCTGTGCCATCATCCCCTCCGACATGCTGCACATCAGCACCAACTGCCGCACCGCTGAGAAGATGGCGCTCACGCTGCTGGACTACCTCTTCCACCGCGAGGTGCAGGCCGTGTCCAATCTGTCCGGCCAGGGCAAGCACGGGAAGAAGCAGCTTGATCCACTCACCATCTATGGCATCCGGTGTCACCTTTTCTATAAATTTGGAATCACGGAATCTGACTGGTACCGGATCAAACAGAGCATTGACTCCAAATGCCGGACAGCGTGGCGGCGAAAACAGCGAGGGCAGAGTCTGGCGGTCAAGAGCTTCTCCCGGAGGACGCCATCCTCGTCCTCTTACAGTGCCTCAGGGCCACCTCCACATAGCCCAGGTGCCGCAGGGGGAGCAGGTGCAGATCACGCAGGACAGCGAGGGCAATCTGCAGATCCACCACGTGGGCCAGGACGGGCAGGTGCTGCAGGGAGCCCAGCTCATCGCCGTGGCCTCTTCAGACCCTGCCTCGGCTGGCGTGGACGGGTCACCTCTCCAGGGCAGTGA

XM_004842706.1 Coding sequence

Ca5a carbonic anhydrase VA, mitochondrial, transcript variant X6

Length: 1170 bp    Location: 1293646..1312728   Strand: +
>XM_004842706.1
ATGCTCAGGGCCATGACGCTGGCAAAGGGCCCCTGCAAGCCCTCCCGCACCCACTTCCTGCTCACGTGGACCTGGGGGGCTCCCCTGGCCCCCGCGACAGGGCGGGCACGGCAGTGTTCCCAGCAGCCCTGCACACAGAGCCACAGGAGCAACACGTGGCACCCCCGCTGGACAGGCCAGGTCTCCCTGCCAGGGGGCACCCGGCAGTCTCCCATCAACATCCGGCGGAGGGACAGCGTCTACGACCCCCAGCTGCCGCCGCTCAGGGCCTCCTACAGTGCTGCGTCCTGTCAGCACGTGTGGAACACGGGCTACCTCTGCCAGGTGGAGTTCGACGAGGCCAGCGAGGGCTCAGGGATCAGCGGGGGCCCCCTGGAGAACCACTACCGACTGAAGCAGTTCCACTTCCACTGGGGGGCTGGGGACGCACGGGGCTCCGAGCACGCCGTGGACGACCTCACCTTCCCCGCCGAGCTGCACTTAGTTCACTGGAATCCCTCGAGGTACCCGAGTTACCGGGAAGCAGTCCTGGGGGAGAAGGGCCTGGCTGTGATCGCCGTCTTTCTGCAGCCATGTGTCTGTGCCACAGCTGGGCGCCCCGCTCCAGGCCCTGCAGCAGCTGGCGGATGTCTTACCGGAGATAAAACACAAGCACACGCTTGGGGAAGGAATCGCGCCAAGGCCGCCTGCCCGAGGGGGACTGCGAGGCCCGGGAAGTTGGGCCAAGCACTCAGCTTACCTGGCACAAAGCGGTCGGGCTTTTGGAAGGTCAGCGAGGATGACAATGCTTGTCTCCAAGGCCTTGGGCAGTCAGCCGCTCTCACGTCAAGCTGCCTGATGTTGCTGGGCAGTGGTGCTGGGGACAGCGCAGTGGCTCCGTGCCCATGTTCAGAGAGTCACCTTGCGGCCCCGCGGTCCTGCGACAGGCACTCACACAGCAGAGCCGGGCCCCGAGCTCGTGTTTGTACCGCTGTGGGTAGCAGCAGATGGTGGCATAGCCCAGGTGTTGGTGGATGGGTAAAGACACCGAAACATGGCCGTCCCCATGCGGAAGGCCTCAGCCCTAAAAGGCAGGAAGTCCTGACACATGTCCCGCATGGGCAACCTTGGGGACAGGCACTGAGAGAAATGGGCCAAACACAGAAACCCGATACCACAGGGGTCCTGTGA

XR_205157.1 Non-coding sequence

LOC101723194 PREDICTED: Heterocephalus glaber uncharacterized LOC101723194 (LOC101723194), misc_RNA.

Length: 3301 bp     
>XR_205157.1
GATCCCGACAGTGCCGCGGGAGAGGCGCGCGCCAGCCGGGACACGCGGGCGAGCGTCACCGAGCGCGGAGGGCCGGGCTCCCGCGTTCAGGCCCTGTGCTGCTGGGCGTGTGTGAAGCGTGCCCGCGAAACCGTCCCAGTTAAAAAGAGCACAGTTCGCGATTTGGCTGCATAGGAGCCAAGCTGAGCCCACACCCTGAGAAACCAGAACTAAAGGAGCAGATGGAAGAGAGAAAGTCTGCACGAGTGGAGGAAGAAAATCCCCCAGAATGGATAAGGTCATGGTAGACTAGGTGGAAAACAAAACTGGGGAGGAAAAGTTGGATAAGAAACTGTAGGGTGGGCTGGGATTTAGCTCAGTGGCACCACGCCTGCCTTGCAAGTGCAAGGTCCTGAGTTTGATCTGCAGTGTCAAAAAAAAAAAAGAAGAAAGAAACTGCAGGGAAGCTGAGGATGGCGCATGTCCTCCAGCCTTCCAGGCACAGCCTGCACCAAGCAGTGCGGTCAGGAGGGAAAGGGATTCCACCGTGGATTCATGCGCCAGGTCAAGGAGCTCCCCTGGGTGGACTCAGAGCAGGATTATGTGGCCTGGAAGTGCCCAGTCCGAGGGAGGGAAGAGAGCACTGTGAGGGCCCGGCCCAGGCCCCAGGGACTAGAATCTGGAGCCGCCCTCATTGTAGGTGCCAGGCGAGTGTGAGGAGTGTGAGCATGGGGGGAATGCCTTGGCCAGAGAAGGTGGAGACCGCACCTTCAGCTGTTCTGCTGTGACTTAGGGAGGTGCAGGACGGGGGACTCCTGCCTCAGAACTAGTGAGATTCTTCTGTCCTCCTCCACTTGCAACCAGTGAAGATTTGGACACAGCATCTCTCACAGACTTAGTAATTGTTCAGGTTTTCTCACCCTGTGTTAAAACTTGGGAGTTTAGATAACAGAAAGACTTTCTCACTTTCCCAAAGCTCTAGAGGGAGAACACAAGAAGTTTGAACACCATGTGGCATTTACCCTGCAGTAGGGGTGTGGCAGCACAGAATGTGGTGGACAGGGCGGAGATGCTGTGCTTCGGGACAGGAGAGCAGCAGAGGAGGCCCTGAGCATAGTCCCATTTCACCAGAGCTTGCAGGTGGGCATCAGCAGGCGGGGCTGTGTGGGCAGGCTGCTCTCTCAGGTGGTGACGGTTTCCTCTGGAGAAGGAGCCCGTGCGTGACAGGACACCCAGGACATGTGGGCAGAAATACCTTTGCAGTGATGAGATGTTTGCAATCACGTCAGTGCTGTCATTGAGCAAGCACTGTTCAGATCCTTCTCCGGGCTGGGCCCTGAGCTGGAAACTGTGCAGACAGAGCCAAAGAAACTGTCATCCCAGCATCCCCAGAGCTCTCAGACTCGGAAAGCAGCAAGTGATGGGAAGGACTCGGACAAAGAAGCCACTGCTGGGTGGGACTGCATCGGTGTTTGTGTTAATTCTCCATCTGGCTTCTGCAGCTGCCACACCTGTCTGAAGGTAATGACTGTGACCTCTCAAAATATCACCACCTCCTTGGCTCCAGGTTGGCTGAAGGCCACTCACATTGCTCAGGTCTGAGGATGCAGGTGACCTCATCAGTGTCCCCTGACCGTGTCCCTGTCAGCTGCAGAAACCAAGAGGCAAGATAATCGTCAGATTTAGCAACATCAGGAGGAGCCAGCCAGACATGGACTGCAGAGCCTCAGTTCAAGATGCTGCTGAGAAAGTGAAGCAGGCAGGAGTCAGTGCCGGAGAGGGGTCCATGTCGGTGTCGGGAGAGCGCATTGGTGGCCTTCAGCAGTGGTGGTGAATCCTGGAGAGACGTCTGTCCCCAGGAGTCCCCGATGACAGCTCCAGATGCCAGATGACTAATAGAACCACTCCCTTGTGTTGACCTCACAGGAAGTCCTTGGATGTACATCTACTGCTACCGAGGTCACCATGGCAGTACCACGCAGCCCCAGTCCAGGGGCTGAAGTGAATGTTGTGGAGTTCAAGGAGTATAAGTGCTCTTGGGAGGGAGAGAATGAACTGCAATTTGAAGACCGCAGATCAAGTTCTGTTAGACCTGAAGCAGCTCTCGGCTCCCTAGACACCAAAGTGCAGAAATGTGGTGAGTTGTGTAGGTTCACAGTAAGCAGGATGATAAATGGTTCTGTTTTCTCTCCACAAATGAAATAGTTTCCAAAAGTGATTCTTTTCTTCACTTTATTGAAATTAATTTATCTTCCCGTATTTGTAGAAAGGCAGAAGTTGGTATCTTGCCCTCCATCTGGATGGAAAACTGGGGCTCAAAGCATTTACCAGTGTCTCCCAGTTCACACCAGGAGTGGGGTGGGACCCAGGTAAAAATCCCAGTTACCGATTCCTGTTGAGGGCAGGGAATGGTGTGCTTTTCTCAAGAATGGGTCAGGCCATTTCGGTTAGGACCCTCTGTGTCCCTCTCGGACCCTCCAGATGTGTAGCATCGCTCTTGGCCTAAGGTTCTGGGACCAGGGCCCTTGCCTTGCCCTGAAGCTTCCATGGAGTCTGAGTGGGCACAGCACCTGCTGGTTATGTTGGGGCAAGCTGGGGCGACAGGTTTCAGAGGAGCTGGGGGGCCGGGGTTCCGCTCCTAACTGAACCTATGGCAGCCACCGTTGTCACCACGGAGACCAGGGACTTGATTGGCAGTGGGGAAGACCTGCTTCGTGGACACAGGCTCTCAGGCATCCAGGAGAGCCGTGCCTGTCACTCAGTGGAGGGTGTGTCTGGGACAAGAGACTGTGGCCCCCGTCTGTCTCTCCAAGAGCGGGTGGACTAGGGAGGGGCTGGGCAGCAGGTCCAGGTGGACCTTGGGGGCCTGAGTCAGACTTGAGGCCGCAGGAGAGGCGGTGTGGAGGAGGCCAGCTGTGGCCCGGCCCAGGTCCCAAGCAGGGCGCCGCCTTCCCGTGCTGGGCCCCATAGCAGAGCGATCAGCCTGTGCAGGAGAGGGGCTGTGGTGACCAAGGAGTCAGGGACCAGCTGGACCAGCGCTGGGGAGGTGCTTTGGGGCTGGGCCGATGGGGGTGGAGCCCTGGCTCTCAGAACCATTTTGTTCTTTTCCAGTTATCTTTAATTGTTATTCTTCGTACTTGGTCATCTACTTGTTTTGCTTTTTGCTTTTATCTTGTTTTTTATTTGGAGACAGAAAGTCACCTTGTAGCCTGGGTTGGGCTTGAACTTGCAGCATTCTGCCTCCTTCAGCCTCCTGAGTGGCTAAGATTACAGGTGGGTCCAACTACACACAGCAGAGGATGAGGAGGAGGCAGAGGGGGAG

XM_004842699.1 Coding sequence

Slc7a5 solute carrier family 7 (amino acid transporter light chain, L system), member 5, transcript variant X1

High confidence: 4 potential gene matches
Length: 1536 bp    Location: 1325368..1349610   Strand: +
>XM_004842699.1
ATGGCGGGCGCGGGCGCGAAGCGGCGCTCGGTGGCCACCGCGGCGGCAGAGGAGGAGGAGCAGCAGGCGCGAGAGAAGATGCTGGCGGCGCGGCGCGCGGACCCCGCTGGCCAGGGCCAGGGCGAGGGCGAGGGCGAGGGCGTGACCCTGCAGCGGAACATCACCCTGCTCAACGGCGTGGCTATCATCGTGGGCACCATCATCGGCTCGGGCATCTTCGTGACCCCCACGGGCGTGCTCAAGGAGGCGGGCTCGCCGGGCCTGGCGCTGGTGGTGTGGGCCGTGTGCGGGGTCTTCTCCATCGTGGGCGCTCTCTGCTATGCCGAGCTGGGCACCACCATCACCAAGTCGGGCGGCGACTACGCCTACATGCTGGAGGTGTACGGCTCGCTGCCCGCCTTCCTCAAGCTCTGGATCGAGCTGCTCATCATCCGGCCCTCCTCGCAGTACATCGTGGCGCTGGTCTTCGCCACCTACCTGCTCAAGCCGGTCTTCCCCACCTGCCCGGTGCCCGAGGAGGCCGCCAAGCTCGTGGCCTGCCTCTGCGTGCTGCTGCTCACCGCCGTGAACTGCTACAGCGTGAAGGCCGCCACCCGCGTGCAGGACGCCTTTGCAGCTGCCAAGCTCCTGGCACTGGCTCTGATCATCCTGCTCGGCTTCATCCAGATCGCAAAGGGTGACGTGTCCAACCTAGACCCCAAGTTCTCCTTCGAAGGCACCCACCTGGATGTGGGGAACATCGTGCTGGCCTTGTACAGTGGCCTCTTTGCCTATGGAGGATGGAATTACCTGAATTTTGTCACAGAGGAGATGATCAATCCCTACAGAAACCTGCCGCTGGCCATCAGCATCTCGCTGCCCATCGTCACCCTGGTGTACGTGCTGACAAACCTGGCCTACTTCACCACCCTGTCCACAGAGCAGATGCTGTCGTCCGAGGCCGTGGCTGTGGACTTCGGCAACTACCACCTGGGAGTCATGTCCTGGATCATCCCGGTCTTCGTGGGCTTGTCCTGCTTCGGCTCGGTCAATGGCTCCCTGTTCACGTCCTCGAGGCTGTTCTTCGTGGGGTCCCGGGAGGGCCACCTGCCCTCAGTGCTCTCCATGATCCACCCAGACCTCCTGACGCCCATGCCGTCCCTCGTGTTCACGTGCATCATGACCCTGCTCTACGCCTTCTCCAACGACATCTTCTCTGTCATCAACTTATTCAGCTTCTTCAACTGGCTGTGTGTGGCACTGGCCATCATCGGCATGATCTGGCTCCGCTTCAAGAAGCCAGAGCTGGAGCGGCCCATCAAGGTGAGCCTGGCGCTGCCGGTGTTCTTCACCCTGGCCTGCCTGTTCCTCATCGCCGTGTCCTTCTGGAAGACGCCCGTGGAGTGCGCCATTGGCTTCACCATCATCCTCAGCGGGCTGCCCGTCTACTTCTTTGGGGTCTGGTGGAAGAACAAGCCCAAGTGGCTCCTGCAGGCAATCTATTCCACCACCGTCCTGTGCCAGAAGCTCCTGCATGTGGTCCCTCAGGAGACCTAG

XM_004843211.1 Coding sequence

Atp2c2 ATPase, Ca++ transporting, type 2C, member 2

High confidence: 4 potential gene matches
Length: 3459 bp    Location: 1394217..1445726   Strand: +
>XM_004843211.1
ATGGCCACCACCTCCATCGACAAGCAGGAGCGTTCGGTCGCCACCTGGGTCTCCCCGCGCTGCGCCTCCATCCGCACACCCGCGGCCCTGGCTGTGGCAGCACCAGTGTCTGCAGCTCTGCTGTCTCAACGAGAAGCCGCTTCCACCTGCTTCTCAGCCACAGAACTTCGTATTGACTCAGTAGTGACCTGGAGGGAGGAACGGGGCACCGCATGCCAGTGGCGAAGCACAAGGGAGCAGCTCAGGGCGGCGGGCATGTGCTGGGGTGGGGTGCTGAGGAAAGCTCCCGGGGAAGGGGCCCGTGCCCCGGATGGGAAGAGGGGCAGGGACCCCGCCATTGGAATCCAGATGGTGGCCCTGATCCAGGACGGCTTCCTGAGACCTTGCTCCAAATGGGTCATGCGTGTCTCGCCCAGTAGGAGACCAGACACAGGGCAGGACGCAGCCCGTGGTGTTCGCAGCTCTGTCTCCACAGGCGGCCTGCAGTGCCAGACTCCCAGAGAGGCTATGGACAAGTACATTTCGGAAGCCTGGGAGACCGTGCGTTGTCAGGAGGGGCCAGAAGAGCACACGGGGGTGGGGGCAGGACAGTTCACGGGGAGCCCTCGCCCGCTCACCATGGGCGAGAGACGCTTTGGCTTCCTGCAGAAACTCGCCTTCCTGGCCCGGGGCCACCAGTACCAGGCACTGCAGAGAGTCGACGAGGAAAGCTCGACTGACGGGCAGTGCCAGCTGGAGGCCACCGAGAGGAGGAGGACGGTCTGGGCCTTGCCACCCAAGGAAGCGTGCAAATGCCACAGAGAGGACTTGGCAGAGGCGCTTTCTGTGGACCTGGACAGAGGCCTGTCTGAGTTCGCAGTGACACAGCGCAGGCTGGTTCACGGCTGGAACGAGTTTGTCGCTGACAACACGGAACCTGTGTGGAAGAAATACCTGGATCAGTTCAAGAGCCCCCTGATCCTGCTGCTGCTGGGCTCGGCCGGGGTGAGTGTGCTCACCAGGCAGTTTGAGGACGCCGTCAGCATCGCCATGGCCGTGCTCATCGTGGTCACTGTCGCCTTCATCCAGGAGTACCGCTCGGAGAAGTCTCTGGAGGCGCTGACCAAGCTGGTCCCCCCCGAGTGCACCTGCATGAGGGACGGGAGGCTGCAGCACCTGCTCGCGAGGGACCTGGTTCCTGGGGACGTCGTGTGCCTCTCCGCTGGAGACCGGATCCCCGCAGACATCCGACTCACCCAGGCCACAGACCTCCTAGTGGACGAGTCCAGTTTCACCGGAGAAGTGGAACCGTGCAGCAAAACAGACAGCCCCATGACGGGCAGTGGGGACCTCAGTACCCTGAGCAACATCGCCTTCATGGGGACCCTGGTGCAGTGCGGGAAAGGCCAGGGCGTCGTGATAGGAACGGGGGAGAGGTCCCAATTCGGAGAGGTGTTCAAGATGATGCAGGCGGAAGAGACACCTAAAACGCCTCTACAAAAGAGCATGGACGGGCTGGGGAAGCAGCTGACTCTCTTCTCCTTCAGTATCATTGGCCTCATCATGCTCATCGGCTGGGTGCAGGGCAAGCCGCTGCTCAGTGTGTTCACCATCGGGGTCAGCCTGGCCGTGGCGGCCATTCCCGAGGGCCTGCCCATCGTCGTCACGGTGACCCTGGTGCTGGGCGTGCTGCGGATGGCCAAGAAGCGAGTCATCGTGAAGAAGCTGCCCATCGTGGAGACCCTGGGCTGCTGCAGCGTCATCTGCTCTGATAAGACGGGGACTCTGACAGCCAACAAAATGACGGTGACCCAGCTGGTGACGTCTGACGGGGTCCGCGCGGAGGTCAGCGGAGTCGGCTACAATGGCCAAGGGACTGTGCATCTTCTCCCGGCCAAGGAGGTCATCAGGGGCTTCACCAGCGTCTCGGTGGGGAAGCTGGTGGAGGCAGGCTGCGTGGCCAACAATGCCGTCATCAGCAGGGGTGCGGTGCTGGGGCAGCCCACGGACGGGGCCCTGCTCGCGCTGGCCATGAAGATGGACTTGGGCGACATCAAGGACACATACGTGAGGCAGGAGGAGATCCCGTTCAGCTCTGCACAGAAGTGGATGGCCGTGAGGTGCCACTCGAGCCAGGACCAGGGAGACATTTACTTCATGAAAGGGGCCTTTGAGGAAGTGATCCGCTCCTGCACCATGTACAACTACGGGGGCGTCCCCCTGCCTCTGACGCCCCAACAGGAGGCATTCTGCCTGCAGGAGGAGAACAGGATGGGGTCGCTCGGCCTGCGGGTGCTGGCACTGGCATCAGGGCCCGAGCTGGGGAGGCTGACGTTCCTGGGCCTCGTGGGCATCATCGACCCCCCGCGGGACGGCGTGAAGGAAGCAGTCCGGGTGCTCTCAGAGTCGGGGGTGTCCGTGAAAATGATAACGGGAGACGCTCTGCAGACAGCCTCGGCCATAGGAAGAGACATTGGCCTGTGCAATGGGAAGCTGAGAGCCATGTCGGGGGAAGAAGTGGAGAGCACAGAGCCAGGCACACTGGTGGGCCTCGTCAGGGAGGTGTCTGTGTTCTTCCGGACCAGCCCAAAGCACAAGCTCAAGATTATCAAGGCGCTGCAGGAGTCAGGGGCAATCGTGGCCATGACGGGCGACGGTGTGAACGACGCAGTCGCCCTTAAGTCTGCAGACATCGGGATCGCCATGGGGCAGGCGGGGACGGACGTCAGCAAAGAGGCCGCCAGCATGATCCTGGTGGATGACGACTTCTCAGCCATCATGAGCGCAGTGGAGGAGGGCAAGGGCATCTTCTACAACATCATGAACTTTGTGCGGTTCCAGCTGAGCACGAGCATCTCAGCCCTGAGTCTCATCACTCTGTCCACCGTGTGCAACCTGCCCAGCCCGCTCAACGCCATGCAGATCCTGTGGGTGAACATCATCATGGACGGGCCGCCGGCGCAGAGCAGCTTGGGGGTGGAGCCCGTGGACAGGGACACCCTGGGGCAGCCACCACGGAGCATGGAGGACACGATCCTGAGCAGGGCGGTCCTCCTCAGGATCCTCATGTCCGCCGCCACCATCATCAGCGGGACCCTCTTTGTCTTCTGGAGAGAGGTCCCCGAGGACAGAGCCAGCACACCCCGCACCACCACCATGACCTTCACGTGCTTTGTGTTCTTCGACCTCTTCAACGCCCTGACCTGCCGCTCCCAGACCAAGCTGATCTTCGAAATCGGCTTCCTCAGGAACCGCATGTTCCTCTACTCGGTCCTCGGGTCGCTGCTGGGCCAGGTGGCCGTGATCTACGTCCCGCCCTTGCAGAAGGTCTTCCAGACGGAGAACCTGGGGGCCCTGGACCTGCTGTTCCTAACTGGCCTGGCCTCGTCCGTCTTCATCTTCTCGGAGCTCCTGAAGCTCTGCGAAAAGCGCTGCTGCTCCTGCGCCAGGAAAGCCCAGGAGCCCCCCGAGCACCCCTGA

XM_004842717.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X10

Length: 1383 bp    Location: 1466658..1451212   Strand: -
>XM_004842717.1
ATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842710.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X3

Length: 1440 bp    Location: 1466216..1451212   Strand: -
>XM_004842710.1
ATGTCCAGTGTAGAGAAAGCCAGGGATGGAAGAAACGTCCTCCCAAGACCAGGAAAGATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842712.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X5

Length: 1434 bp    Location: 1466216..1451212   Strand: -
>XM_004842712.1
ATGCCGCCTCCTGAAAGGAAGTCGGGAAACGTCCTCCCAAGACCAGGAAAGATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842713.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X6

Length: 1434 bp    Location: 1466216..1451212   Strand: -
>XM_004842713.1
ATGCCGCCTCCTGAAAGGAAGTCGGGAAACGTCCTCCCAAGACCAGGAAAGATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842711.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X4

Length: 1434 bp    Location: 1466216..1451212   Strand: -
>XM_004842711.1
ATGCCGCCTCCTGAAAGGAAGTCGGGAAACGTCCTCCCAAGACCAGGAAAGATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842709.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X2

Length: 1440 bp    Location: 1466216..1451212   Strand: -
>XM_004842709.1
ATGTCCAGTGTAGAGAAAGCCAGGGATGGAAGAAACGTCCTCCCAAGACCAGGAAAGATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842716.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X9

Length: 1383 bp    Location: 1466216..1451212   Strand: -
>XM_004842716.1
ATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842708.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X1

Length: 1569 bp    Location: 1462727..1451212   Strand: -
>XM_004842708.1
ATGGTCCTCAGCTACCAATGGAGACACGTGGGCGTGTCCCGTGACCTTACAGTGAAATGCCAACCAGCCAGCTGTGCCACCGCGGGCCTGGGAACTGTGAAGCCGAGTGACAGAAGCTATGGACCTGAAATGTCCAGTGTAGAGAAAGCCAGGGATGGAAGAAACGTCCTCCCAAGACCAGGAAAGATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842721.1 Coding sequence

LOC101696467 uncharacterized LOC101696467, transcript variant X1

Length: 978 bp    Location: 1543413..1539413   Strand: -
>XM_004842721.1
ATGTCAAGTGCCAGCTTCGGTGAGTTCCTGGGTCAGAAGCCTGGTTCCGGGTGCAGGCTCAGCTGGACCCCGGGTCAGGCTTGTGCGCTGCTGTCCCTGGCCCAGTCTTTCCAGGGTTGGTCAGAGGCGGTGAGCGCCAGGGTGGCTGCGTCTCTGGTGTCCCAAAGCAGGCCCTTGGGCCTCAGGACTCCAGCCAAGGCCACAGTGGCCTCCCCCGGGGCAGGCTCCGGCCGGCCTTGGGCTGACAGTGCCCCCTTGTCACAGTGCACTCTCCACCGCACGCGCAGTGTCTCTCCCGAGAGGAGGGCGAGGAGCTGGAGCCAGAGAGCAGCTGACTGTCCTCCCAGTCGGCCAGAGGAGCCGCCTGCATGTCCCATCTGCACTGCGACCAGAGCTGTGCCCAGCTGGGCCCAGCTGACACCCGGGCTCCTTGGCACCAGAAATCACGCTTTAAGCTTTAAGCGCTGCTTGGCATCCAACCTGCTACTCAGCGAAGGACAAAGCACTTCGTTCCCAGCTCTCTTCTGTGCTGTCGCCACTTCCCTCAAAGGGGCCACCTGTGTCCAAGGCCTCACCGCAGGTCCTGTGTTCTCCAGAGAATGCGACACAACCCAAGGGCGAAGCCGACTGGGGCCAGGCCTCACGGTCGAGGGAACTGGGGACAGTGACTCCCGAGGTCTGCGCTCCCGCAGTCTTCAGAAGCAGAAATGGACCCAGGTGAGAAATTTAGCAACTGGCAGCCAGTGTCCTGGCCCGGTGGCCCATGGCAAATTCTACTGGGTTTCCAGTCTGCAGGTGGCCTTGCCAAGGCCTGCAGGCAGGGAGGGAGGTGGCCCCTCTCCGAGGCTTGGGGGGCAGGGCGCCTCTGTGCCCACACAACTGCTCCTGCTCCTTCCAGGCAGAGGAAACAGATTGCCCGTCAGACACAATGCTTCCTTTGGCTCCTGTTTTCCTCCTCAAATCAAATTACCCCACTGA

XR_205159.1 Non-coding sequence

Kiaa0513 PREDICTED: Heterocephalus glaber KIAA0513 ortholog (Kiaa0513), transcript variant X4, misc_RNA.

Length: 4308 bp     
>XR_205159.1
CACTGACTGACAGCTCGCGCCTCGGCGCCTCCTAAGGACCCGGCTGCTCGCGGGCGGCGTAGTCGCCGCTGCTGCAGGTCGGACGCCGTTGCCTGCTGCCGGGTCTCCCGCCGTACGGACGCCGCTGCGATGCCATAGGGCCACCCAGCTGCCCTAGAAGACTCGCCCTTTGTGGCTACTGTGTGTGCCTGGCAGGCTCCCACCGACGCACCTCAGAGGCTGCCCTGACAGCCTGCCCGCACCATGGAGGCCCCAGAGGTGCCTGTGGGCTCTCTGATTGACTTTGGGACTGAGCCGCCAGCCTCCCCTCCCCTGGAGGCCGCACCCCCAGCCCCCCAGGACAGGGACGGCTCCCTGGGCGATGGTGCATCTGAGAGTGAAGCCACGGAATCCGCAGACAGCGAGAACGACATGGGCGAGTCACCCTCGCACCCCTCCTGGGAGCAAGAGCGCCGCTCCTCCTCCAGCGAGTCCTTCTCCTCCACCCAGAGTGCGGAGTCCACCCAGGATGAGGAGACCCAGGCACTCCGCGAGTTCATGTGCAGCTATGTGGAGAAGATCTTCTCGGGACGGGAGGACTTAGACCAGGAGGAGAAAGCCAAGTTCGGAGAGTACTGCAGCAGTGAGGATGGCAAGGGCCGGGAGTGGTTCGCCCGGTACGTGAGTGCCCAGCGCTGCAATTCCAAGTGTGTGTCTGAGCCGACCTTCTACCGCCTGGTGCAGTCCTTCGCCGTGGTGCTGTTTGAGTGCCATCAGATGGATGACTTCGGGCCCGCCAAGAACCTCATGACCATGTGCTTCACCTACTATCACAGCGGCAAGCCGCACCTGCTGCCTGCGGAGCCCAGGGAGAAGGTGGCTGGCAGCATCGATGCCTACCTGAAGTCTGCCAACAGCTGGCTGGCCGAGAAGAAGGACATTGCTGAGCGGCTGCTGAAGAACACGGAGCACGTGAAGGGCTTCTTCGGGGGGCTGGAGACCAAGCTGAAGGGGCCCTTGGTCAGGAAGAACGAGGATGATGAGAACAAACCCAAGGACAAGCAGCCCAAGACTGGTGAGGTGACGGTGCCCAGCCCCGAGGAGGAGCCGAAGGGGGAGAAGATCTACCTGTACACGCACCTGAAGCAGCAGCCCATTTGGCACACGCTGAGGTTCTGGAATGCCGCCTTTTTCGACGCGGTCCACTGTGAGAGGAGAAAGCGGTCCCCCACCACCAGAGGGGATGCTGGAGAGCAGGAGGACAAGAGGGAGAAGTGGTGCCACATGACCCAGGAGGAGCGGGACGACAGTGTGCGGTTCAATGAGAACATCACCTTCGGGCAGCTGGGCACCTTCACCCACAACATGCTGGCCTTTGGGCTGAGCAAGAAGCTCTGTGGCGACTTCCTCAAGAAGCAGGCTGTGATCGGCAACCTGGACCAGGAGCAGTACAAGCTGCTGAGCGACCACATTGAGCAGATGGCCGCCGAATAGGAGACCGAGGGGGGCGCCGCTCTCCGGGCCAGCAGCTGGCCGCCACCCTTGGAGTGGCCCTGCATGTCACCGGCAGCGCCGGAGCCGCCCTTGCTGCCCAGAACTAGCGATTAGAAGACCCGCTGCCCGTCCTCCTTCTGCCCTCTGCCCGTGTCTGCACCCCCATCCGCGTGCCAGCGTCTCGAGACCCCCCGCCCCCAAGTGCCAGGCTTGTGAGATGAGCCCAAGAGGAGGGGAAGGCGGCCGCAGCCAGGGTGGGCCCAGGGCAGCCTCTGCACAGCGGCCCGCTGAGGGCAGAGTGGAGGCGTGGGCACAGAGGGGCGGAAGGATGCAGGGCAGGGACAGTCTGCAGCGTGAGACCCGCCACCCTCGCAGGGCCGTGGGCGCCCTGTGCATCCCAGTCGCCGAGGAGCTTGCAGGGCCTGAGATGCAGAGAAAGTCGCGCCACACGGGGACGGCACCCATGAGGGCAGGGAGAGAGTCCTGTGGCCGCTGCAGAGGACGGCGCTGTGCCGGCTGGCGATAGCACGGCGCGCCCTGGCCTCCCTCTCCAGGTGCCGGACCCGCAGCCCGCTCTGTCTCTTCCCACAGACCTCACAGATGCAGCCTTTGTCCTGACCCAGGCCTGGACTGCGACCCCGCCACGCCCTGCCCAGCCCTTGGAAGGGTCTCAGCCATGCTTCCCTCCCTGCCCCTCAAGTACACATTAAACCCTGCACCCCACTGTCCTCTAGGGAGCGCCTCCCCAATCGGCGCAGAGCAGGGCTTGCGGCTGAGCCCTGGAGCATTTGTGTCCCCACGATGGCCGCAGAGGGGGTGGCAGTGGGGGTTCGCAGCGGGTGGCTTGGTGTGTGCGTCACGTCAGCCAGTCTCAGTCCCCTGCGCCCTCTGGGCCTCTGGGTCTCAGCTGAGTCTGGCCCTCTGCTAAATCCAGTCAAATCAAGGGTACAGGCTTCAATCTCTCTAGTGCCACCTTCTGGACATCTGCTCCCTGGAGTGAGGGCGCCAGGCCCCGAGGGCAGGCAAGAGGTCTTTCCCACTCCTGGGTGTTCCTGGAAGCGCACAAAGACCTTGCCCAGGGGCCAGGGGTTTAGTTCAGTGGTGCGGCTGCTGCCTGCCTTGCCTTGATCCCCAGTACCAAAAAAAAGAGGAAAGCCCTTGCCCCAGGTGGTCAGGATGTGGCCTTGTGTGGTGGTTCTCCAGGGTCTGCTTTCTGGGGAGACGGCACCGGTGGAGACGCTGGAAGCCAGCACAGCCTTGGGCAGGAGCGCGTCTGGCTCCTGGCTTTCCAGGCCCTTGGCCTTCAGGAGTGCCCTTGACCTCTCCAGGCGGCACCTTGAGGAGGAGGAAGGGACGCTGTGTCTTTCCTGGCTCCTGCCCAGCTGGGGTCAGTCTGACTCCGAGAAGTGCGACCTGCAGTGGGCACTGCCAAATGGGGGCTTGCAGGGCTTGTCCTTAGCAGGGCTCTTTGTGCAGCATGGCTCTGTGTTTTCACCATTGTTGGCGATTTGGGGGTTCCCTAGGCGCCACATTTATCCCCCAAATGTACCTGCTGTGTGTGCACACCACCATCCCAGCCACACACAGGAGAATGGGGTTCTGGCATCTCAGGGGACCTGTGCAGTGACAAGTGCAGACTGCGATTTTCCTGTTGCCTAAAGAGCAGCTGCAGAGCTCGGAGTGACCAGAGGGGAGCAGAGGAAGGGTAGTGTGGAGAACCAGCATGCGTTAGCACGGCAGGGCTCAGGTTCGTCCCAAAACGTAGGCTGCATTTAGAACCAGCACCGCCAGAGCCCCGAGTGAGGGCAGAACGGGGCCCGGCTGGCGCCCACTTCCACAGCGTGGTCGGGGCACAGCGCTCTCACATCGCGGGGCTGCTGCTGTGAGGCCAGCGCCCCTGTGGGTCCGGGTGTGGAAGGGGCGTCTGTGACCTGGCCATGGAGGCCGAGCAGGGAGGGACAGAAGGGTCATTTCCACATTGTCCATGGCGCCATCCTCCACCCGCGTCTCTGGGCCCACGGGCCACCTGCTCCCAGGAGGGCAGAAGAATCCCAGGGCCTCCGAGGGCCGGGCCACATCCGGGCCAGTGAGGGCTGCCTGGTTCTGGGAAGCGGGATGAGGGCAGAGAGGCCTGGCTGTGCCCATGGGACGGGATGTCGGCAAGCGGCTCCCGAGGGGCTGCTGGGCCACCTGATCGACAGCCCCAGGCTCCCCCCGAGCAAAGCCCCTCGCTCTCCCTCCCGAGTCCTGGCGGGGACCCTGCACGGTGACCAGAGGGGCTCCCGTCCCGACCCCTTCCCATGACCCAGGACGGGGCGGCCCCTCTCTGCCCTGGGCCGGAAGGATGTGCTCACGGGATAGACATGGGGACGGTGCTGGGACAGGGCAGGGCCTCTCGGCAGTGTGTCCAGGTCCCTGCCGGGAGGGCGCAGTGGAGCCTGGGGCTGTCACCTCCAGTGGCCCGGTCCCAGCCCCTGAGGACGCAGTTGGCTGGCAATCCCCGTGACGCACGGCACCTTCCCGTGCTGACTTCTGTCTCTGTCTCTGTCCCCCACATGGTCTGGGACCCGCCCTTGCCTCTGGCCTTTGGTCCTCTGTGGTCGCCCCTGTGGTACCAGCATCTCATTGTCACTGTTATGCAATCCTGCAAGAGTCCCTCGGGGTGATGTTCTAAAGTGATATTTTAAGGCCGAGAAAGTTCCCAGGTTGGAGTTGGCAAAGCAGTGCTGACATCAAAGTTGTTTCTTGTGAAGAAGAAAAATATGTGTGTGTGTATATATATATTGCACCTTGGGTGGTCAGAAAGTGGAAACTGAAATAAATTATCTTTTAGAA

XM_004842730.1 Coding sequence

Kiaa0513 KIAA0513 ortholog, transcript variant X3

Length: 1194 bp    Location: 1751461..1797521   Strand: +
>XM_004842730.1
ATGGAGGCCCCAGAGGTGCCTGTGGGCTCTCTGATTGACTTTGGGACTGAGCCGCCAGCCTCCCCTCCCCTGGAGGCCGCACCCCCAGCCCCCCAGGACAGGGACGGCTCCCTGGGCGATGGTGCATCTGAGAGTGAAGCCACGGAATCCGCAGACAGCGAGAACGACATGGGCGAGTCACCCTCGCACCCCTCCTGGGAGCAAGAGCGCCGCTCCTCCTCCAGCGAGTCCTTCTCCTCCACCCAGAGTGCGGAGTCCACCCAGGATGAGGAGACCCAGGCACTCCGCGAGTTCATGTGCAGCTATGTGGAGAAGATCTTCTCGGGACGGGAGGACTTAGACCAGGAGGAGAAAGCCAAGTTCGGAGAGTACTGCAGCAGTGAGGATGGCAAGGGCCGGGAGTGGTTCGCCCGGTACGTGAGTGCCCAGCGCTGCAATTCCAAGTGTGTGTCTGAGCCGACCTTCTACCGCCTGGTGCAGTCCTTCGCCGTGGTGCTGTTTGAGTGCCATCAGATGGATGACTTCGGGCCCGCCAAGAACCTCATGACCATGTGCTTCACCTACTATCACAGCGGCAAGCCGCACCTGCTGCCTGCGGAGCCCAGGGAGAAGGTGGCTGGCAGCATCGATGCCTACCTGAAGTCTGCCAACAGCTGGCTGGCCGAGAAGAAGGACATTGCTGAGCGGCTGCTGAAGAACACGGAGCACGTGAAGGGCTTCTTCGGGGGGCTGGAGACCAAGCTGAAGGGGCCCTTGGTCAGGAAGAACGAGGATGATGAGAACAAACCCAAGGACAAGCAGCCCAAGACTGTGACGGTGCCCAGCCCCGAGGAGGAGCCGAAGGGGGAGAAGATCTACCTGTACACGCACCTGAAGCAGCAGCCCATTTGGCACACGCTGAGGTTCTGGAATGCCGCCTTTTTCGACGCGGTCCACTGTGAGAGGAGAAAGCGGTCCCCCACCACCAGGGAGAAGTGGTGCCACATGACCCAGGAGGAGCGGGACGACAGTGTGCGGTTCAATGAGAACATCACCTTCGGGCAGCTGGGCACCTTCACCCACAACATGCTGGCCTTTGGGCTGAGCAAGAAGCTCTGTGGCGACTTCCTCAAGAAGCAGGCTGTGATCGGCAACCTGGACCAGGAGCAGTACAAGCTGCTGAGCGACCACATTGAGCAGATGGCCGCCGAATAG

XM_004842739.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X7

Length: 3606 bp    Location: 1923754..2108734   Strand: +
>XM_004842739.1
ATGAGCCATGAGCCCAAGTCCCCTTCGCTAGGGATGCTTTCCACCGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCCCTCGCCACTCAATGGCGCCCTGGTGCCCAGTGGCAGCCCGGCCACCAGCAGCACGCTGTCGGCCCAGGCCGCGCCATCCTCCAGCTTTGCCGCCGCGCTGCGCAAGCTCGCCAAACAGGCGGAGGAGCCCAGAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842746.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X14

Length: 3033 bp    Location: 2066850..2101923   Strand: +
>XM_004842746.1
ATGCTGATTTGCATATGCTCCCCTCCCCCCGCAGCCTGGAATCCAGGCATGAGCCATGAGCCCAAGTCCCCTTCGCTAGGGATGCTTTCCACCGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCCCTCGCCACTCAATGGCGCCCTGGTGCCCAGTGGCAGCCCGGCCACCAGCAGCACGCTGTCGGCCCAGGCCGCGCCATCCTCCAGCTTTGCCGCCGCGCTGCGCAAGCTCGCCAAACAGGCGGAGGAGCCCAGAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAG

XM_004842734.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X2

Length: 3651 bp    Location: 2066852..2108734   Strand: +
>XM_004842734.1
ATGCTGATTTGCATATGCTCCCCTCCCCCCGCAGCCTGGAATCCAGGCATGAGCCATGAGCCCAAGTCCCCTTCGCTAGGGATGCTTTCCACCGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCCCTCGCCACTCAATGGCGCCCTGGTGCCCAGTGGCAGCCCGGCCACCAGCAGCACGCTGTCGGCCCAGGCCGCGCCATCCTCCAGCTTTGCCGCCGCGCTGCGCAAGCTCGCCAAACAGGCGGAGGAGCCCAGAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842752.1 Coding sequence

Irf8 interferon regulatory factor 8, transcript variant X1

Length: 1281 bp    Location: 2272432..2288901   Strand: +
>XM_004842752.1
ATGTGTGACAGGAATGGCGGGCGGCGGCTTCGGCAGTGGCTGATTGAACAAATCGACAGCAACATGTACCCAGGGCTGATTTGGGAGAATGAGGAGAAGAGCATGTTCCGCATCCCGTGGAAGCACGCCGGCAAGCAGGATTATAACCAGGAGGTGGATGCCTCCATCTTCAAGGCCTGGGCAGTTTTTAAAGGGAAGTTTAAAGAAGGAGACAAAGCTGAACCAGCCACTTGGAAGACAAGGTTACGCTGTGCTTTGAACAAGAGCCCAGATTTTGAGGAAGTGACAGACCGATCCCAGCTGGACATTTCCGAGCCATACAAAGTTTATAGAATTGTCCCGGAGGAAGAGCAAAAATGCAAACTGGGCCTCGCGCCTCCCGGCTGTGTGAATGACGTCGCGGAGATGGAGTGTGGCCGCCCCGAGTTGGAGGACATGATCAAGGAGCCTCCTGTGGATGACTACATGGGGTTGATCAAGAGGAGCCCGTCCCCGCCAGAGGCCTGCAGGAGCCAGCTCCTCCCGGACTGGTGGGTGCCGCAGCCCAGCGCAGGCTTGCCGCTGGTGACCGGGTACCCCACCTATGACCCACACCATGCAGCCTTCTCCCAGATGGTGATCAGCTTCTACTACGGGGGCAAGCTGGTGGGCCAGGCCACCACCACCTGCCCCGAGGGCTGCCGCCTGGCCCTGGGCCCGCCGGGGCTGCCCAGCGCCAAGCTGTACGGGCCCGAGGGCCTGGAGCTGGTCCGCTTCCCGCCGGCTGACACCATTGCCACCGAGCGCCAAAGGCAGGTGACACGGAAACTGCTCGGGCACCTGGAGCGCGGCGTGCTCCTGCACAGCAGCCGTCAGGGCGTGTTCGTCAAGCGGCTGTGCCAGGGCCGTGTGTTCTGCAGTGGCAACGCCGTGGTGCGCAAGGGCAGGCCCAACAAGCTGGAGCGCGACGAGGTGGTCCAGGTCTTCGACACCAGCCAGTTCTTCCGAGAGCTACAGCAGTTCTACGGCAGCCAGGCCCGCCTGCCGGACAGCAGGGTGGTGCTGTGCTTTGGGGAGGAGTTTCCGGACATGGCGCCCTTGCGCTCCAAGCTCATCCTGGTGCAGGTGGAGCAGCTGTATGTCCGGCAGCTGGTGGAGGACTCGGGGAAGAGCTGCAGTGTGGGCGCTGTGCTGCCAGCCCCCGAGGAGCCCCAGCCGGACCAGGCCTTCCGGATGTTTCCCGAGATTTGTGCCTCTCACCAGAGACCCTTTTTCAGAGAAAACCAGCAGATCACGGTCTGA

XM_004842757.1 Coding sequence

LOC101707551 forkhead box protein C2-like

Length: 1467 bp    Location: 2632602..2634747   Strand: +
>XM_004842757.1
ATGCAGGCGCGCTACTCCGTGCCGGACCCCAGCGCGCTGGGGGTGGTGCCCTACCTGGGCGAGCAGAGCTACTACCGCGCGGCAGGCGGCTACGGCGGCATGGCCGGGCCCGTGGGCGTCTACCCCGGCCACCCCGAGCAATACGGCGCGGGCGCAGGCCGGCCCTACGCCCCCTACCACCAGCACGCGCCCGCGGCACCCAAGGACCTGGTCAAGCCGCCCTACAGCTACATCGCGCTCATCACCATGGCGATCCAGCACGCGCCTGAGAAGAAGGTCACGCTGAACGGCATCTACCAGTTCATCATGGACCGCTTCCCCTTCTACCGCGAGAACAGGCAGGGCTGGCAGAACTCCATCCGCCACAACCTCTCGCTCAACGAGTGCTTCGTCAAGGTGCCGCGCGACGACAAGAAGCCGGGCAAGGGCAGCTACTGGACGTTGGACCCCGACTCGTACAACATGTTTGAGAACGGCAGCTTCCTGCGGCGGCGCCGGCGCTTCAAGAAGAAGGATGTGCCCAAGGAGAGGGAGGCGCGCGCCGTGGCCCGGGAGCCGCCCCCCGCCGCTGCCCAGGGCGCCCCGGCCGGGCCAGGCCTCGCCGACGCCGCGCCCGAGGCCGAGCGCAAGGTGGTGGTCAAGAGCGAGGCGGCGTCGCCCGCGCTGCCGGTCATCACCAAGGTGGAGGCGCTGAGCCCCGAGGCCGCGCAGCGGGGCAGCCCGCGCAGCGCCGAGTCCTCTCCGGCCGGGTCCCCCGACGGCTCCCCGCCCGCGCACCACGCCGCCGCGCCCAACGGGCTGCCGGGCTTCAGCGTGGAGAGCATCATGACGCTGCGGGCGTCGCCTCCCGGGCCCGAGCTCAGCCCCGCGGCCGGGCGCGCGGGCCTCGCGGTGCCGCCGCTCGCGCTGTCTTACTCCGCTGCGCCGCCCGCCGCCTACGGGCAGCCGTGCGCGCAGGGCCTGGAAGCCGGGCCCGCGGGCGGCTACCAGTGCAGCATGCGCGCCCTGAGCCTGTACACCGGCGCCGAGCGGCCCGCGCTGGACGACGCCCTCTCGGACCACCCGGGCGGCCCCGCGTCGCCGCTGAGCGCACTCGGCCTCGCGGCCGGCCAGGAGGGCGCGCTCGCCGCCGCGGGCCACCACCACCACCACCAGCACCCAGGCCACCACCCGCAGGCGCCGCAGCCCGCGCCCGCGCCGCAGCCCGGGGCCGCCGCGGCCCAGGCGGCCTCCTGGTACCTGAACCACGGCGGGGACCTGAGCCACCTCCCCGGGCACGCGTTCGCGGCCCAGCAGCAGCCGTTCCCCAACGTGCGGGAGATGTTCAACTCGCACCGGCTGGGGATGGAGAACTCGGCCCTCGGGGAGTCCCAGGTCGGCAACGCGAGCTGTCAGCTGCCCTACAGAGCCACGCCGTCCCTCTACCGCCACGCAGCCCCCTACTCCTACGACTGCTCCAAGTACTGA

XM_004842759.1 Coding sequence

Fbxo31 F-box protein 31, transcript variant X1

High confidence: 4 potential gene matches
Length: 1539 bp    Location: 3078223..3043600   Strand: -
>XM_004842759.1
ATGGCGGTGTGCGCTCGGCTCTGCGGCGTGGGCCCGGCGCGCGGGTGTCGGCGCCGCCAGCAGCGCGGGGGTCCGGCCGAGACGACGGCGGCGGACAGCGAGCTGGACACGGACCCGGAGGAGGAGCGCATCGAGGCGGGGCCGTCGCCGCCGCCGCGCTGCTCGCTGCTGGACCTGCCGCCCGAGCTGCTGGTGGAGATCTTCGCCTCGTTGCCCGGCACCGATCTGCCCAGCCTGGCGCAGGTCTGCAGCAAGTTCCGCCGCGTGCTGCACACCGACACAATCTGGCGGCGGCGCTGCCGCGAGGAGTACGGCGTTTGTGAGAACTTGCGGAAGATGGAGATCACGGGCTTGTCTTGCCGGGATATCTACGCAAAGCTGCTTCACCGATACCGACACATTCTGGGATTGTGGCAGCCAGACATTGGGCCGTATGGAGGACTACTGAATGTGGTGGTGGATGGCTTGTTCATCATCGGCTGGATGTACCTGCCGCCCCATGACCCTCACGTGGATGACCCCATGCGATTCAAGCCTTTGTTTCGAATCCACCTGATGGAGAGGAAGTTGGCCACGGTGGAGTGTATGTATGGCCACAAGGGGCCTCACAATGGCCACATCCAGATAGTGAAGAAGGATGAGTTCTCCACTAAGTGCAACCAGACGGACCACCACAGGATGTCTGGCGGGAGGCAGGAGGAGTTCCGGACGTGGCTGAGGGAGGAGTGGGGCCGCACGCTGGAGGACATTTTCCACGAGCACATGCAGGAGCTCATTCTGATGAAGTTCATCTACACCAGTCAGTACGACAACTGCCTGACCTACCGCCGGATCTACCTCCCGCCCAGCCGCCCGGACGACCTCATCAAGCCCGGCCTCTTCAAGGGCACCTACGGCAGCCATGGCCTGGAGATCGTGATGCTCAGCTTCCATGGCCACCGCGCCAGGGGCACCAAGATCACGGGTGACCCCAACATCCCTGCCGGGCAGCAGACGGTGGAGGTCGACCTGAGACACCGCATCCAGCTGCCTGACATTGAGAATCTCCGCAACTTCAATGAGCTCTCGCGTATTGTCCTGGAGGTGCGAGAGCAGGTGCGGCAGGAGCAGCAGCAGGAGCCCAGCGAGGGCCCGGCCCTGCCCCAGGAGCAGGCAGCTAGGGAGGCGGACGCAGCGCCCGCTGAGGACAGCAGGAAGCCTGCAGATGGAGCAGCTGCGGCTGAGCAGCTAGCCCAGTCTGGCAAGGGCCAGCCGTTTGTGTTGCCCATGGGCGTGAGCTCGAGGAACGAGGACTATCCCCGCACCTGCCGGATGTGTTTTTATGGCACAGGCCTCATTGCCGGCCATGGCTTCACCAGCCCCGAGCGCACTCCGGGCGTCTTTCTCTTGTTCGATGAGGACCGCTTCGGGTTCATCTGGCTGGAGCTGAAGTCCTTCAGCCTGTACAGCCGGGTCCGGGCCTCCTTCCGGCATGCAGACGCACCCTCGCCTCAGGCCTTCGATGAGATGCTCAAGAACATCCAGTCCCTCACTTCCTGA

XR_205163.1 Non-coding sequence

LOC101698060 PREDICTED: Heterocephalus glaber uncharacterized LOC101698060 (LOC101698060), misc_RNA.

Length: 1503 bp     
>XR_205163.1
CCGGGTGCGCGGCGTCCCCCGCTCGCCGCTCCGCTGCGCGCTTCGCATAAGGAGAGCTCGGGCGGGGCGCGCGGAGGGCGCTGTCCGGGCGGCGCGGGCTCTGCACCGGGACTTAGCACTGCATGCTTCTCGCCGCCTCTTCTGCCTGGCGCTTTTTATTTTTCTTTCTTTCTCTTTCTTTCCCCCTCCTCTCCTCGCTCCCTCGCTCGCTCAGTCTCTTCCCTCCGCGCAAAGTGCAGGACAGAGGTGCAGCCCAGCTGGCGGAGAGGAAGGGGAGGGGGAGTTAAGTTCTTTCTTGCCTTTTTTTTTTTTTTTTTTTAAGCAAAATAGCAAAGTCCCGGGAAAGGAAAAAAAAAATAAGGCGAGGCAGAGAGCAGAAGGGGGGTAAGGCCGAGCCGACTAGCAGCCTGAGCTACAGCTCGAAGATGAAAAAAGATTTTAAAGCCTCTGATCCAGCAAGAAGAGTTTAAAGCAATTGCTGAGTTTTATAGCACTCGTGACGTCAGGCCCAAATGGGAAATTGACTGGCACTCCGGGCCAATGGGAGGCGGCGAGAGCGGCCGCGATTAGCATAATAGTATAGAAACAGGGAAACTTTTCGGAGCTGTCAATCAGGGCCCAATCAGCTGACTGTCAGCTGGGACGGGCGGGGTTAACCCTTCCCGCGCCGCCGCGCCGCTCCGGGGAGGGAGGGAGCGGCCCAGGCGCAAAGTTTGGTGCTAGAGCGACAGGAGTTTCCCGAGGGGCGGCGGGAGGCCGTAGGGCCGGGGGGAAGGTGTGCTGGCTCCGGGCGCGCCCCAGGCCTCCCGGCCGCGCTGGCTGCCTCCGGCTCCCCTAGCCGCTCGCTTCTTTTCCTTCCCTGCGCCTTCCGCACCCCAGGGGGAAGGACGCTAAGAGGGTGCACTGGAAAAAAAATCTGGGAAGCCTGCAAAAGGATTGAAGAGTGGAAACTATTGTTGGACCGAGTTGGTTTTTACCTCAACAGCGCCACCTTTCGGCAAAGGGCTTTTCCTTCCATGAAATACTGGTTGTGCACAAGAGATGTGAGAAAGCCAGATGTTTTCTGGGAAGGTGTGCCAGATTTCACCCAGATCTGTTTCCTTCCTTTATCTGACAAATCCCAGCACGTCCTAGCAGACAGGAGGCACTGATTTAATAAATAGTTTGGGGGATACATGAACACTGGAATTAAAGGGGCTCTGTGGTTTTAGCAGTAGAGATGTGAAACCATGGGGCCTGTTTTCCCAGATTGCCACCTTTTTTCTATTTCCCCTTTCCTTTTTCAGGGCATAGCCATCTGCTTCTGCTTAGATTTTTCTTTCCCTTCAATTAAGGACTGACTGTGACTTGCTCTTCCATTCTCATTGCTTTTGATCCCATTCGCAGCTTATGCCAGTGAGGGAATTTATCTCCAAAGCATTCGACCCTTCGAAGATTTTACTGTCATCGACTCAGAACTGCTCTTAAGAAAAGCAAAGGAAATTAAAAAAAAAAAAAAAAAAA

XM_004843216.1 Coding sequence

Adad2 adenosine deaminase domain containing 2

High confidence: 4 potential gene matches
Length: 1803 bp    Location: 3399282..3393436   Strand: -
>XM_004843216.1
ATGGCTTCGCCGGCCGGCACGGGCACTGGCGCCGAGGATGTCGGCCGCAGGAAGCTCCGCCTGGCAGCGTCGCTGCAGATCAACCCCCCACGCAGCGACTGGCGGTCGTCAGCCAGCATGGGCTGGGATGCCTGGGGATCCCCGGCCGCCCGCAAGGCTGAGGAGGACGTGGAGGGGCGTGAGCAGCCCCAGGCCTCAGCTGCGGCGGCAGGGGACTGTGGCCCGGAGGCCGGGGCCAGCGGTGGCGGCGGGAAGCATGGGACCACACGGGCTGGGGACGACGCGAGGGTGTCTGTGCCACCCACAGGGCTGGCGGGGGACCTGCTGAAGGTGGCCGGGCAGCTGAGATTGCCGCCCGCGGACCCGCCCCCCGGCCAGGCCGTGGCCTTGCTGGCGCAGTACGCTGCGGGGCTGGGCGCCACGCTAACCTTCCACGAGGACCCTGCGGCAGGTCCTGGCTCCCCCTTCTCCGTGTGTGCAGAACTGGATGGGATGGTGTGCCCCTTGGGCACTGCGAACACCAAAGTGGAGGCCAAGCAGCAGGCGGCACTCTCTGCCCTGTGCTACATCCGGAGTCAGCTGGAGAGCACAGGTAACCCAGCCCCTGGGCAGGAGGCAAACCGGTGGGCCCCACTGCTGCCCTTTGGCCCTTGTGCAGAGGACATCCTGCCCCACGAGCAGCGCTGCGCAGCCGTGGTCAGTGCCGGCTTGGACCGCCTGCTGGGCGATGACTCTCCCTACAGGGCCTGCATGGGGACAGTGGCTGCAGTCATCCTGGAGCACGAGCTCCCGGGTGCCAAGGGCCACACCAAGGAGATCTATGAGCTGGTGGCACTGGGCACAGGCAGTGGCACCTGTGCCAGCTGGCTGGAGTTCTCGGGCCGGCAGTTGCACGACTGTCATGGTCTGATCATCGCACGCCGGGCCCTGATGAGGTTCTTCTTCCGGCAGCTGCTGCTGGCCACGAAGGGGGGCCCCAAAGGCAAGGAGCGCTCTGTGCTGGCCCCCCAGCCTGGGCCCGGGCCCCCTTTTGCCCTCAAGCCCCGGATCTTCCTGCACCTGTACGTCAGCAACACTCCCAAAGGAGCAGCCCACGACATCTACCTCCCGCCGCCCTCGGAAGATGGCCTTCTGCTCAGCTCCTCCTTCCGCCTCCAGGCCCACATCTGCGGGCAGTTGAAGCCGGTGTCCTACGTGGCGCACACACTCCGAGACACCCATGTGGGCTGCCTGTCAGCCAGCGACAAGCTGGCGCGCTGGGCAGTGCTGGGGCTGGGTGGCGCTCTGCTGGCCCACTTCCTGCCCCCACTCTACGCCACCAGCCTCATCCTGGCTGATCCCTGCCATGACCCCCCGACTCTGAGCAGGGCCATTCACGACCGGCCCAGCCTAGACAGCACCTCGGGGTCGTGCCTGCCACCTCCCTACGTCCGCACCACCCTGCACCTGTTTTCAGGGCCCCCTGTGGCCCCCTCCAACCCTGTCTCCAGCGCCTCCCACGGCCTGAGCCTCAACTGGAGCCTGGGGGACCCTGACGTGGAAGTTGTGGATGTGGCTACTGGCCGCGTGAAGGCCAAGGCCACGCCTGGGCCTCCTTCCCGTCTCTGTAAGGCTGCCTTCCTGCGGGCCTTCCGCCAGGCCGCTGCTGCTCTGGGTCAGCCCCACCTCCTGGCCCTAAAGACCTATGAGGCTGCCAAGGCTGGACCCTACCAGGAGGCTCGCCAGCAGCTGTCACTCCTCCTGGACCAGCAGGGCCTGGGCTCTTGGCCTTCCAAGCTACTGGTGGGCAAATTCGGGAGCTGA

XM_004842771.1 Coding sequence

LOC101711988 TATA box-binding protein-associated factor, RNA polymerase I, subunit C-like, transcript variant X4

Length: 2076 bp    Location: 3408383..3412706   Strand: +
>XM_004842771.1
ATGGTGGTGGACAGCTTGCCCAGGTGTCCCTGGGCCCACCTCAGCCACCGACTGCGCCGCTTCGCCATCGTTGGGGGCCCGGTGCTGGGCAAGTCAGTGTCGAGTCTGCTGGGGAGGCTGCTGCACGAGGAGCTGGCCACGCGCTGGGAGCAGCTGCTCCTGGATGAGGCCTTCACTGGAGGCACCCTGGCCTGGCTGCCTGGAAGGACCCCGCAGGTGGGCCAGCTGGTCTACCCAGCTGGCGGTGCCCTGGACAGGCTTCGTTTCCAGGAGGTCAGTCTGACCTCAGGCAGTGACCCCCAGGTCCTTGGGGACCCTGGGTGCATCCAGCTCCAGGGACCTGTGCGCCAGGTGGTGACCAACACTGTCCAAGGAGAAACGCTGCTGGCTGTGCGCTCTGACTACCACTGTGCTGTGTGGAAGGTGAGGAGGCAGCGGCGGCCGGCCCCTCTGCAGGTGCTGCGGGTTGCGAAGGGGGCCACGGGGATCAGTCTCAGCCCTCACCTCCCTGGGGAGCTGGCCATCTGCAGCCGTTCCGGAGCCGTCTGTCTGTGGACCCCCCAGGATGGGCTGCAGCAAGTCTACAAGGACCCAGAGACCCTGGTGTTCCGGGACCCTTCTCCCTGGCGTTGGGCAGACTTCACTGCCCATCCCCGGGTGCTGACTGTGGGTGACCGCACTGGAGTGAAGATGGTCGACACTCAGGGCCCCCCGGGATGTGGTCTGCTGCTTTTCCGGGCAGGGGCTGAGGCCTCCTGCCAGAAAGGGGAACGTGTCCTGCTCACGCAGTACCCGGGGCAGTGCAGCCCCGAGTCACTGCCCCCGACTCTGCATCTCATCTGTACCCAGTTCTCGCTCTACCTGGTGGATGAACGCCTGCCCCTGGTGCCCATGCTTAAGTGGAATCATGACCTCCCCTCCCCCGCCCTGCTGGCCCGCCTGCTGCCTCCAGCCGGTCCTGGCTGCCCACAGCCTCTGTTCTTGGGTGGCCTAGGTGGGCAGGTACAGCTGCTGCATATCACAGGAAAGGAGGCCTCTGCACCCCGACTGGCCGGGCCCCCCCAGTCTCTACCTTCCCTGACTGACTGCCTCTCTGCATTTCCCCTGCTGGAGCCCAAGAGCCACCAGCAGCTGCAGGAGCGACTGGAAGCGCCAACCATAGGTCTGGCCTGTGCCTCCCCGCCCAGTGCCTCCACTCCCACAGCGTGGCTCTTCCAGCTCTCGGCAGCTGGGGATATCTTCTACCAGCACCTCGCTCTCCAAGCAGCGACCAGTTTCCACCGAGACTGCGGGCCTCCTGGCGACCCCAGGCCCGACTCCCCTGCACCCAGGGCAACAGCACCTCCTATGGATCAGAGGCCCCCACCCTCCTGGTCCCCCCAGGTCACTGCCTGGTGCAGCCGCTGGCTGGAGGCCCTGCTGCAGGTGCCGCCTGCATCCCCTGTGTGGACTGCACCCACCTTTTCCCATCGCCGCCTGCTAGGCCGCCTGGAGCCCCAGCCGGTGGAGGGGAAAGTGCCTCAGGCTCTGCGGGCGGCCATGGCCAGGGGGCGGATTCTGCAGCAGAGGGACCTGGGCCTGCTCCCTCGGGCAGAGCCACCCCCTGCCCCTGAGCCAGGCCCACAGGATGAGCTCAGTGAGCGTCTGGAGGCAGCCTGGGAAGGCCAGGGGGCTACATGGTGGAAGAGACAGCAGGGTAAGGCCTCGGAGCCAGGGAAGCAGACCAAGCGGCCCAAGCGCCGCACTCCGCTGTCCAGCACCTTCTCTTCGCTCACCAGCTGCTTGGACTTATCAGATACCAGCAGCCCCCCTCACAGCTCAGAGCTCAGGCCCCAGCCCCCTGTGACCCCACACTCCCAGGAGTCAGCTCAGCAACTGTGGGCCCAGGGTGACCACTCAGAGAGGTGGCAGACCCTTGGGGACTACATGGCAGAGCTGCCACTTACAAAGGGCACCCCTCCCCTGGGACATGTGCCCACACCCCCCTCCCAGGCCTCCAGTGTCCAAGCCACACCCTCCCGGCTTCCTACCCCTGGCTCTCAGCCCCACCGGAAGAGGCCACGGATGGGCTTCTGA

XM_004842779.1 Coding sequence

Osgin1 oxidative stress induced growth inhibitor 1

High confidence: 4 potential gene matches
Length: 1422 bp    Location: 3585245..3577184   Strand: -
>XM_004842779.1
ATGAGCGAGTCCAGGAAGGACCAGGTGGGCACCAGCAGCTCGGAGCCCCTGCCCGTCATCATCATCGGCAACGGGCCCTCGGGCATCTGCCTGTCCTACCTGCTCTCAGGCCATGCGCCCTACGTGAAGCCGGATGCCGTCCACCCACACCCGCTGCTGCACAGGAAGCTGGCCGAGGCTTCGGGGCGCTGCCTCCTGGACCAGGACCTGGATTACCTGTCTGAGGGCCTCGAAGGCCGGAGCCAGAGCCCTGTGGCACTGCTCTTTGATGCCCTCCTGCGCCCAGACACGGACTTCGGGGGCACCTTGGACTCCGTGCTCTCCTGGAAGCGGCAGGAGGAGCGAGCTGTCCCCCACCTGGTCCTGGGCTGCGGCCCACCCGGGGGTGCCTGGCATGCCATGGAAGGCTCCATGGTGACCCTGAGCCAGGGCGAGTGGATGGGGCTCCCCGACCTGCAGGTCAAGGACTGGATGCGGGGGAAGCGCAGAGGTCTCCGCAACAGCCGGGCCACGGCCGGGGACATTGCCCAGTACTACAGGGACTACGTGACCGAGAAGGGTCTGAGCCCCAACTTCCTGTCTGGCGCGTTGGTCACAGGCGTGGAGATGGGGGGAGCCGAGCCCAAGGACCCCAGTGCCCTCTTCCGAGTGAGTGGCATCCTGACCGCTAAGGACCGGCGCCAGCGGCCCTTCTCGCTGTGGGCCCGAAGTGTGGTCCTGGCCACCGGCACATTTGACAGCCCGGCCCGGCTCGGCATCCCGGGCGAGGCCCTGCCCTATGTGCACCACAAGCTGTCGGCCCTGGAGGCGGCCATGCGGGCGGGCACCGTCACCCCGGCCTCAGAGCCCGTGCTCATCATCGGCGCCGGGCTGTCTGCGGCCGATGCAGTGCTCTACGCCCGCCACTGTGGCCTCCCTGTGATCCACGCCTTCCGGCGGCCAGTGGACAACCCGGGCCTGGTATTCAACCAGCTGCCCAAGATGCTGTACCCCGAGTACCACAAGGTGCACCAGATGATGCGGGAGCAGTCGGCCCCATCACCCAGCCCCTACGAGGGCTACTGCAGCCTCCCTGGGCACCGGCCGCTGCTCTTCAAGGAGGGCCGCCAGGCTGTGCTGTGTGACCCGTGCAGCCGCCACCAGGTCTTCGGCGTCTCCCTAGTGCTGGTCCTCATTGGCTCGCACCCCGACCTCTCCTTCCTCCCAGGGGCAGGTGCCAACCTCACCTCTGACCCTGAGCAGCCCCTGAGTGCCAAGAGGAACCCCATCAACGTGGACCCCTTCACCTACCAGAGCACGTGCCAGGAGGGCCTGTACGCCCTCGGGCCTCTGGCTGGGGACAATTTCGTGCGGTTTGTGCAGGGCGGGGCCCTGGCCGTGGCCAGCTCCTTGCTGAGAAAGGAGACCCGGAAGCCACCCTAG

XR_205162.1 Non-coding sequence

LOC101697807 PREDICTED: Heterocephalus glaber uncharacterized LOC101697807 (LOC101697807), misc_RNA.

Length: 1598 bp     
>XR_205162.1
TGAGCCAACACAGCAGTCCAAAGAAGCTACTCTCACCATGCTTGAGAAGACACCACACAGATTCTGAGGGTGATGCCTGGGAATCCCACATGCTCCACCCCCATCTGATCAAGTCTTCCAGCCCAGGAACCAAGTAGGGAGTGGAGAAGCTCTACCACAACCAGCCCAGCCACCAGGTGACAGCGAACCCAGGAGACACTGGTGGGCAGGAAGTGCAGAGCTGCTCCCAACTCCTGACCCATGGAAGCTGAGGGAGACCTTCAGTAAGGACAGTGGTGTAAGCAGCTAAGTTCCTTGGGTTCTGATGTATAAATGAACATTTCACATAAACTAGATGAAAGAATCACTCAACCAATTTAATGCTGTGCTCGGTTCTTTAAGAGAAGAAGAGAATGCTGGCATGGACCTTTTTCTTCATAGAAGGATAACGGGATCAATAAAGCCGGCTTTGAGAGAGGAAGGAACTGATCTTCATGCTGGTATCAAATGACGCATCCGTGCAGCACGGAGAAGGACCATGCCCACTAAGTGACCTAATTGCACATTCTCAAAACACTGTATTCCTGTTATTGGCTTCATCAGCATTGTCCTCCTAGAGGTTGCTCTTAATTAGCCCAGGAGAGGACTGAAGGAAAGAACTGTGACTGCCACCTTCAGCACAGAGGGTCTGGCCAGGAAGAGGCAGGGACCCATGATGGTCGTCACTCACCCAACGCTTTATCTGCACCAGCAGAGTCCCCGGTGTTGAATCTCCCCTTCCACCCTGCAGCAACATCTCAAAGATGGGCTGCTTATTCCTTTCTACAGATGAAGAAGAGGGAGGTGTGGTGAGGTTGGGAAGCTCATCCTCATTTCACAGCTAGGGATTTCGGAAGAGAATTTCCTACACAGATCTGACTGATCTCCCCTAAAATGAGGGACCGCTACGACTCCCCATCATGCCAAGCTACCAGCTATCCATCAGCAAAATAAGGGAGAAGGTATACTGAGTCCGTTGAACCTCACCTCTCAGTTTGCATCCTCAGAAATAAGTCCAGAGAGGGAGAATGACTTGCCAAAGTCACACAGCAGAGCCAGGACGAAGTCCCTTGGTTTGGGACAAATACTCTCAAGCCATTGGCAAACACACAACACACTTCTGCTCTTCTCCAGTCCTCCTCTGGACACCAGCAATAAATAAAATAGTGCTGGCCAGAGATATGGGGAGACAAAAGGTTGTTCTAATAGAAGGGGATATTATGGGTTATCTAGATTATTTTTCCTAACCAACCAGCAGACTTTTATTAAGTGCCTAATTTCTGCAAAACTGAGCTGAGGTGATGAGAGAGTCTCAGCAATGAAAAACAAGCATACCAAAGGGGCATGTGTTTCTTTTCTTACTCTTCAGTTGCAATCTCAAAGGCAAGTTTGAGCTTATAAGCAAAATGAGGCAAATAAGATTTTTTAAGATGACAAAAGCTGCAATTGCATGTGATACACACAGCTAATGAAGGCCTCAAAGTGCTTCCTTCCTGATTTACCTTGATCACCCAACATAGTTTTCCAGTATTGAAGTAATCAGGTTTTTTGAATTCACTAGTTGAAAAAGTAAATGAAAA

XM_004842798.1 Coding sequence

Bcmo1 beta-carotene 15,15'-monooxygenase 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1671 bp    Location: 6180871..6146876   Strand: -
>XM_004842798.1
ATGGACGTCCTATTCGGCAGGAACAAGAAAGAGCAGCTGGAGCCTGTGCAGGCCCAAGTGACAGGCAGGATTCCTCCCTGGCTCCAGGGGACCCTGCTTCGCAATGGGCCTGGGATGCACACGGTGGGTGACAGCAGATACAACCACTGGTTCGATGGCCTGGCCCTGCTACACAGCTTCACCATCAGGGACGGTGAGGTCTATTACAGGAGCAAATACCTGAAAAGCGACACTTACAACGCCAATGTCGAGGCAAACAGGATTGTGGTGTCAGAGTTTGGGACAATGGCCTATCCAGACCCCTGCAAAAACATCTTCTCCAAAGCTTTCTCCTACCTGTCCCACACCATCCCTGATTTCACAGACAACTGCCTGATCAACATCATGAGGTGTGGGGAAGACTTCTATGCGACCACGGAGACCAATTACATGAGGAGGATCAACCCTCAGACACTGGAGACCCTGGAGAAGGTGGATTATCGGAAATATGTGGCTATAAATCTGGCAACAGCACATCCTCATTATGATGAGGCTGGAAATGTTCTCAATATGGGCACATCCATTGTGGACAAGGGGAGGACAAAATACGTGATATTTAAGATCCCTGCCACAGTGCCAGAGGCCAACAGGAAGGGGAAGAGCCCCCTGAAACACACAGAGGTGTTCTGCTCCATCCCCTCCCGCTCGCTCCTCTCCCCCAGCTACTACCACAGCTTTGGGGTCACCCAGAACTATGTGGTGTTTCTGGAGCAGCCCTTCAGGTTGGACATTCTCAAGATGGCGACCGCGTACATGCGAGGAGTGAGCTGGGCATCCTGCATGGCTTTCCACAGGGAGGACAAGACTCACATCCACATCATCGACCAGAGGACCAGAAAGCCGGTGCCCACCAGGTTCTACACAGATGCCATGGTGGTGTTTCATCACGTCAACGCCTATGAGGAAGGCGGCTGCATTGTGTTTGACGTCATCACCTACAAGGACAGCAGCCTCTATGACCTCTTCTACCTGGCCAACCTAAACCAGGACTTCGAGGAGAACTCCAGGCTCACGTCGGTGCCCACCCTCAGGAGGTTCGCTGTGCCGCTCCACGTGGATGGGAATGCAGAAGTGGGCACAAATCTAATCAAAGTGGCATCTACAACAGCAACTGCCCTGAAGGAAAGGGATGACCAGGTGTACTGCCAGCCGGAATTGCTGTTGGAAGGCTTGGAGCTCCCTCAGATCAATTACACTCACAACGGAAAGCCATATCGATACGTCTTCGCTGCTGGAGTTCAGTGGAGTCCAATCCCAACCCAGATACTCAAGTATGACACTCTCACTAAGTCATCCCTGAGGTGGGGAGAGGAGAGCTGCTGGCCAGCAGAGCCCCTGTTTGTGCCTGCGCCAGGCGCCAAGGACGAGGATGATGGAGTTATCTTATCAGCCATTGTCTCTACTGACCCCCAAAAGCTGCCTTTCCTGCTCATCCTGGATGCCAAGAGCTTCACAGAGCTGGCACGCGCCTCCCTTGCCGTGGAGATGCACCTGGACCTCCATGGGTTGTTCATCCCCGATGCAGATGGGGCTGCAAGGAATCAGGCCACTTCCGAGACAGAGCAGGCCCCGGCTTCAGGCTGCCAGGGGCCCCACAGGCCTGACGGGGCTGGTGGGCTTGGGCTCCCCTAG

XM_004842818.1 Coding sequence

Adamts18 ADAM metallopeptidase with thrombospondin type 1 motif, 18, transcript variant X2

Length: 3144 bp    Location: 9534073..9668702   Strand: +
>XM_004842818.1
ATGAATTCCTCATCTCACCGTTACCTCAGCTGCTGGCCCAGGAACACAACTACAGCGCCCCTGCGGGCCACCATCCCCATGTACTGTACAAGAGGACAGCAGAGGAGAAGGTCCAGTGGTACGGTGGCTACCCTGGCCCCAGCCGGACTTACCCCGGTCACTCCCCAAGTCACACTCCCCCTGCATCCCAGAGTGCAGAGACAGAATTCCACCATCGAAGGTGGCAAAAGCAGCATTTTTGTGGACGACGCAAGAAATGTATATGCTCCGCAGCCTCCCACTGCGGACGCCTCCCGACGGCTTGATGCGTCCGGGAGCTCAGGGCGGCCTCGGAGGTCGGCTGGGAAGCCCCCAAAGGGCCTCAGCGTGGAAACCCTCGTGGTGGCGGACCAGAAGATGGTGGGCAAGCACGGCAAGGGGAATGTCACCACCTACATCCTCACAGTCATGAACATGGTTTCCAGCCTATTTAAAGATGGAACTATTGGAAGTGACATAAATATTGTAGTGGTGGGCCTCATTCTTCTGGAACAAGAACCTGGAGGACTATTGATCAACCACCATGCAGATCAGTCTCTGAACAGTTTTTGTCAGTGGCAGTCTGCCCTCATTGGAAAGAATGGCAAGAGGCATGACCACGCCATCTTACTCACAGGATTTGACATTTGTTCCTGGAAGAATGAACCATGTGACACTCTAGGGTTCGCCCCTATCAGTGGAATGTGCAGTAAGTACCGAAGTTGCACCATCAATGAAGACACGGGGCTGGGGCTCGCTTTCACCATTGCCCATGAGTCTGGGCACAACTTTGGCATGATTCACGACGGGGAAGGCAATCCGTGCAGGAAGGCTGAGGGCAACATCATGTCTCCCACACTGACAGGAAACAATGGGGTGTTTTCATGGTCTTCCTGCAGCCGACAGTATCTCAAGAAGTTCCTTAGCACACCTCAGGCTGGGTGTCTAGTGGACGAGCCCAAGCAAACAGGACAGTATAAATACCCCGACAAACTGCCGGGGCAGATTTACGATGCAGACACACAGTGCAAGTGGCAATTTGGAGCGAAAGCCAAGTTATGCAGCCTTGGTTTCACAAAGGACATTTGCAAATCACTTTGGTGCCACCGAGTGGGCCACAGGTGTGAGACCAAGTTTATGCCGGCAGCCGAAGGAACCATTTGTGGCCTGAGTATGTGGTGCCGCCAAGGCCAGTGTGTGAAGCTGGGGGAGCTCGGGCCCCGCCCCGTCCATGGTCAGTGGTCCACCTGGTCGAAGTGGTCAGAATGTTCCCGGACTTGCGGCAGAGGAGTCAAGTATCAGGAGAGACACTGCAACAACCCCAAGCCTCAGTATGGTGGCAAGTTCTGTCCAGGATCTAGCCGTATTTATAAGCTGTGCAACATTGACCCTTGTAGTGCAAATAGCTTGGATTTTCGAGCCCAGCAGTGTGCAGAATATAACAGCAAACCTTTCCGTGGATGGTTCTACCAGTGGAAACCCTATACAAAAGTGGAAGAGGAGGATCGATGTAAACTGTACTGTAAGGCCGAGAACTTTGAATTTTTTTTTGCAATGTCCGGCAAGGTCAAAGATGGGACTCCTTGTTCCCCGCACAAAAATGACATCTGTATCGATGGGATTTGTGAACCAGTAGGATGTGATCACGAACTTGGGTCCAAAGCAGTTTTGGATGCCTGCGGCGTCTGCAAAGGTGATAATTCAACTTGCAAGTTTTATAAAGGGCTGTACCTCAACCAGCATAAAGCAAATGAATATTATCCAGTGGTCATCATTCCAGCTGGTGCCCGAAGCATTGAGATCCAAGAGCTCCAGATATCCTCCAGTTACCTTGCCGTGCGAAGCCTTAGCCAGAGGTATTACCTCACAGGCGGCTGGAGCATTGACTGGCCGGGGGAGTTCCCTTTTGCTGGGACCATGTTTGAATATCAGCGCTCCTTCAACCACCCGGAACGCCTGTATGCACCAGGACCCACGAACGAGACACTGGTCTTCGAAATTCTGATGCAAGGCAAAAATCCTGGGATAGCTTGGAAGTATGCACTTCCCAGGGCCACAAACGGAACTCATTCGGCCACGAAAAGACAGCAGCACACCTGGAGCACAGTGCAGTCAGCCTGCTCCGTCTCCTGCGGAGGAGGTTACATAAGTGTAAAGGCCATTTGCTTACGAGATCAAAATACTCAAGTCAATTCTTCATTCTGCAATGTAAGAACCAAGCCAGCAACTGAAGCCAAAAAATGCAATGCTTTCTCCTGCCCGGCCTATTGGATGCCCGGTGAATGGAGCACCTGCAGCAAGTCGTGCGCTGGGGGCCAGCAGAGCCGGAAGATCCAGTGTGTGCAGAAGCAGCCCTTCCGGGAGGAGGTAACAGCAGTGCTGCATTCTCTCTGTCCCGTGAGCACACCCACTCAGGTTCAGGTCTGCAACAGCCACGCCTGCCCTCCGGCATGGAGCCCGGGGCCCTGGTCTCAGTGTTCCAAGACCTGTGGCCGTGGAGTGAGGCGGCGTGAGGTCCTGTGTAAGAGTGCTGCCGCGGAGATCCTCCCTGAGAGCCTGTGCAGCAGCAGCCCCAGGCCTGAGGTACAGGAGGGCTGTGTGCTGGGACGGTGCCCCAAGAACAACCAGCTACAGTGGGTCACCTCTTCCTGGAGTGAGTGTTCCACAACCTGTGGCTTGGGTGTGAGGCGGAGAGAGATGAAGTGCAGTGAGAAGACCTTCCAGGGAAAGCTGGTCACTTTCCCTGAGCGAAGATGCCGCAATATTAAGAAACCAAACCTGGACTTGGAAGAAACGTGCAGCCACAGGGCTTGTCCAGTGTACAACTGGGCACCGGGATGGTATTCATCACCATGGCAACAGTGCACAGTAACCTGCGGGGGAGGCGTTCAGACCCGCTCAGTCCACTGTGTGCAGCAAGGCCGGCCCTCCTCCAGCTGCCTGCTCCACCAGAAGCCGCCAGTGCTCCGAGCCTGTAATACCAACTTTTGTCCAGCTCTGGAAAAGAGAGAGGACCCATCCTGTGTAGATTTCTTCAGCTGGTGCCACCTCGTTCCTCAGCATGGTGTCTGCAATCACAAGTTTTATGGGAAACAGTGCTGCAAGTCCTGCACGAGGAAGAGCTGA

XM_004842822.1 Coding sequence

Cntnap4 contactin associated protein-like 4, transcript variant X2

High confidence: 4 potential gene matches
Length: 3921 bp    Location: 10649853..10378255   Strand: -
>XM_004842822.1
ATGAGGTCTATCACCGGAGCTGTCCTCAAGACGCTACTTCTGTTATCTACTCAAAATTGGAACAAAGTGGAAGCTGGCAATTCCTATGACTGTGATGATCCTCTTGTATCCGCTTTGCCTCAGGCGTCCTTCAGCAGTTCTTCTGAGCTCTCCAGCAGTCACGGTCCTGGCTTTGCCAGGCTGAATAGAAGAGATGGAGCTGGTGGTTGGTCTCCATTTGTGTCAAATAAATACCAGTGGTTGCAGACTGACCTTGGAGAGAGAATGGAGATCACCTCTGTGGCCACTCAAGGAGGATATGGAAGCTCCAACTGGGTGACCAGCTATCTCCTGATGTTCAGCGACAGTGGCAGGAACTGGAAACAGTATCGACAAGAAGACAGCATCTGGGGTTTTTCAGGGAATGTAAATGCAGACAGTGTAGTATACTATCGGCTCCAGCCTTCTATCAAAGCCAGATTTCTACGCTTCATCCCCCTAGAATGGAACCCCAAGGGCAGAATTGGAATGCGAATCGAGGTGTTTGGATGTGCATACCGATCAGAGGTGATTGATCTTGATGGAAAAAGTTCCCTTCTGTACAGATTTGATCAAAAATCCCTGAGCCCAGTAAAAGATATTATTTCCTTGAAGTTTAAAACCATGCAGAGTGATGGGATTCTACTCCACAGAGCAGGTCCAAGTGGTGATCATATCACGCTGGAATTAAAAAGAGGAAAACTCTTTCTACTTATTAATTCAGGTGCAGCTAAACTGCTCTCCACTCACCCTCTGGTCAATCTCACCCTGGGCAGCCTGCTGGATGATCAGCACTGGCATTCTGTGCTCATCCAGCATTTGGGCAAGCAGGTCAACTTCACAGTGGACGAGCACAGGCATCATTTCCATACCCAGGGAGAATTCAGTTACCTGGATCTCGATTATGAGATCAGCTTTGGAGGGATTTCAGCACCTTCAAAATCGGTGTCATTCTCACATAACAATTTCCATGGATGTTTAGAAAATCTCTATTATAACGGAGTGGATATCATTGATTTGGCCAAGAAACAAAAACCACAGATCATCATTATGGGAAATGTGTCATTTTCTTGTTCACAACCACAGTCTGTGCCTCTTACTTTCCTGAGCTCCAGAAGTTACTTAGCACTGTCAACCTTTGCCAGAGACGATGAGATTTCGGTTAGTTTTCAATTTCGCACCTGGAATAAGGCAGGACTTCTGCTTTTCAGTGAACTACAGCTCGTTTCTGGGGGTCTGCTCCTCTTGCTCAGTGATGGAAGACTTAAGCTGAATCTCCATCCACCAGGAAAATTACCCAGTGACATCACAGCAGGTGTGGGATTGAATGATGGACAGTGGCATTCCATTGCCTTATACGCAAAAAAGAATCACCTGAGTCTGATGGTGGATGGCCATGTGACCTCTGCTTCTCCTCTGCCGGGGACCGAGATTTATTCAGGTGGCACTTATTATTTTGGAGGTTGCCCTGAAAATAGCTTTGCATCAAAGTGCAAAAGCCCACTTGGAAGATTCCAGGGATGCATGAGACTTATTTCCATCAGTAAAGAAGTGGTAGATCTGATTTCAGTTCAGCAAGGGTCGCTTGGGAACTTCAGTGACCTTCAGATAGACTCTTGTGGCATCTCAGATAGGTGTTTGCCTAACTATTGTGAGCACGGAGGTGAATGCTCTCAGTCCTGGAGCACCTTTCATTGTAACTGCACCAACACTGGCTACACTGGAGCCACCTGCCATAGCTCTATCTATGAGCAGTCATGTGAAGCATATAAACACAGAGGAAATACCTCAGGGTTTTACTATGTAGATTCTGATGGAAGTGGCCCTCTGGGACCATTTCTTCTCTTTTGCAACATGACTGAAACGGCATGGACCATCGTACAGCACAACGGCTCTGACTTAACAAGAGTCAGAAATACTCACCCAGAGAACCCATATGCTGGGTTTTTCGAGTACATGGCCAGCATGGAGCAACTCCAGGCCACAATTAACCGTGCGGAGCACTGCGAACAGGAGCTTGCTTACTACTGCAAGAAGTCACGGCTTGTAAGTCAGCAAGATGGCACCCCTTTGAGCTGGTGGGTTGGAAGAACCAATGAAACACAGACTTACTGGGGAGGTTCTGTGCCTGACCCTCAAAAATGTACTTGTGGCTTGGAAGGGAACTGCATTGATGATCAATATCACTGCAATTGTGATGCTGACCGGAGTGAATGGACCAATGACACTGGATTCCTTTCTTATAAAGAACATCTGCCAGTAACTAAGATAGTAATAACAGACACGGGGCGGCCCCATTCAGAAGCAGCTTATAAACTGGGGCCTCTACTCTGCAGAGGAGACAAGTCATTTTGGAATTCTGCTTCCTTCAATACTGAGGCTTCATACCTTCACTTTCCTACTTTCCATGGAGAACTTACTGCGGATGTGTCTTTCTTTTTTAAGACAACAGCTTTATCTGGTGTATTTTTAGAGAACCTGGGAATCACTGACTTTATAAGAATAGAGCTATGCTCTCCAACAATAGTGACCTTTTCATTTGATGTGGGAAATGGGCCTTTTGAAATCTCAGTGCAGTCACCCACCCAATTCAATGACAACCAGTGGCATCACGTTAGAGTTGAAAGGAACATGAAGGAGGCCTCCATTCAAGTGGACCAGCTGTTGCCAAAGGTCCAGCCTGCTCCGGCCGATGGCCATGTCCTTTTACAGCTCAACAGCCAGCTCTTTGTGGGTGGGACGGCCACGAGACAGAGAGGCTTTTTGGGCTGTATCCGGTCGCTGCAATTGAACGGGATGGCCCTGGATCTGGAAGAAAGAGCCACGGTGACTCCAGGGGTGCAACCAGGTTGTCGAGGACATTGCAGCAGCTACGGGAAGTTGTGTCGCAATGGAGGGAAGTGCAGAGAAAAGCCCAGTGGGTTCTTCTGTGACTGCTCTTCCTCTGCCTACACAGGGCCTTTCTGCTCCGACGAGATTTCTGCGTATTTTGGATCTGGCTCATCAGTGATTTACAATTTTCAAGAAAATTACTCCTTAAGCAAAAACTCCAGCTCCCATGCTGCTTCATTTCATGGTGATATGAAGCTGAGCAGAGAAATGATTACATTTAGCTTCCGAACAACAAGAACACCAAGCTTACTGCTGTATATGAGCTCCTTTTACAAAGAATACCTTTCAGTTATCATTGCCAAAAATGGAAGTTTCCAAATAAGGTACAAGCTAAGCAAATATCAAGAACCTGATGTTATTAACTTTGATTTTAAAAGTATGGCTGATGGGCAACTTCACCACGTAAAGATTAACCGAGAAGAAAGGATGGTCCTTGTGGAGATTGATGAGAATACAAGGAGACAAATATACCTGTCCTCAGGTTCCGAATTCACTGCAGTCAGATCTCTGATATTGGGCAAGATTTTAGAGCACAGTGATGTGGACCAGGACACGGCTCTGGCGGGAGCACAGGGCTTCACTGGCTGCCTCTCTGCGGTGCAGCTCAGCCACGTGGCCCCGCTGAAGGCTGCCCTGCGCTCTGGCCACCCAGCAGCTGTCACCGTCACTGGGCACGTGACCGAGTCCAGCTGTGTGGCCCCTGCTGGCACTGATGCCACATCAAGGGAAAGAACACATTCATTCACAGATCATTCTGGAACAATGGATGACAGGGAACCCCTCACTAATGTAATCAAAAGTGACTCAGCAGTAATTGGAGGCCTGATAGCTGTTGTGATCTTTATCTTGCTTTGCATCACTGCCATAGCTGTTCGCATTTATCAGCAGAAAAGGTTATACAAAAGAAATGAGGCAAAAAGGTCAGAGAATGTAGACAGTGCTGAAGCTGTTTTGAAAAGTGAGCTTAATATACAAAATGCAGTGAATGAAAATCAGAAAGAGTACTTCTGA

XM_004842825.1 Coding sequence

Kars lysyl-tRNA synthetase, transcript variant X3

Length: 1791 bp    Location: 11337544..11353796   Strand: +
>XM_004842825.1
ATGGCTACGGTGCAAGGGGCTGAGGTGAAAGTGGACGACGAACCGAAACTAAGCAAAAATGAGCTAAAAAGACGCCTTAAAGCCGAGAAGAAAGTGGCAGAGAAGGAGGCCAAGCAGAAGGAGCTCAGTGAGAAACAACTAAGCCAACCTACTGCAGCTGCCACTAATCACACCACTGACAATGGTGTGGGTACCGAGGAAGAAACCCTGGACCCAAACCAATACTACAAGATCCGAAGTCAAGCAGTCCACCAGCTGAAGGTCAGTGGGGAGGATCCATACCCACACAAGTTCCACGTAGACATCTCACTCACCCAGTTCATCCAAGAATACAGTCACCTGCAGCCTGGGGACCACCTGACCGACATCACCTTAAAGGTGGCAGGTAGAATCCATGCCAAAAGAGCTTCTGGGGGGAAGCTCATCTTCTATGACCTTCGAGGAGAGGGAGTCAAGTTGCAAGTCATGGCCAATTCCAGGAATTACAAATCAGAGGAAGAATTTATTTGTATCAACAACAAACTGCGTCGGGGAGACATAATCGGCGTTCATGGGAATCCTGGGAAAACCAAGAAGGGTGAGCTAAGCATCATTCCCTATGAGATCACACTGTTGTCTCCCTGCCTGCATATGTTACCTCATCTGCACTTCGGCCTCAAAGACAAGGAAACCCGGTATCGACAGAGATACTTGGACCTGATACTCAATGACTTTGTGAGGCAGAAATTTATCATCCGCTCTAAGATCATTACATATATAAGAAGTTTCTTGGATGAGCTGGGATTTCTCGAGATTGAAACTCCCATGATGAACATCATCCCAGGGGGAGCTGTGGCCAAGCCTTTCATCACGTACCACAACGAGCTGGATATGAACTTATACATGAGAATTGCTCCAGAACTCTACCATAAGATGCTGGTGGTGGGTGGCATTGACCGGGTTTATGAAATTGGACGCCAGTTCCGGAATGAAGGAATTGATTTGACCCACAATCCTGAGTTCACCACCTGTGAGTTCTACATGGCCTATGCAGACTATCATGATCTTATGGAAATAACAGAGAAGTTGATTTCAGGAATGGTGAAGAACATTACAGGCAGTTACAAGGTCACCTACCACCCAGATGGTCCAGAGGGCCAAGCCTATGAGATTGACTTCACCCCACCCTTCCGGAGAATCGGAATGGTGGAAGAGCTGGAGAAAGCCCTAGGGGTGAAGCTGCCTGAAACCAACCTCTTTGAAACTGAAGAAACTCGAAAAATTCTTGATGATATCTGTGTAGCAAAAGCTGTTGAATGCCCTCCGCCTCGGACCACTGCCAGGCTCCTTGATAAGCTTGTTGGAGAGTTCTTGGAAGTGGCATGCATCAATCCTACATTCATCTGCGATCACCCACAGATAATGAGCCCGTTAGCTAAATGGCACCGCTCCAAAGAGGGTCTGACTGAGCGCTTTGAGCTCTTTGTCATGAAGAAGGAGGTATGCAATGCCTACACTGAGCTGAATGACCCCATGCGGCAGCGGCAGCTGTTTGAAGAACAGGCCAAGGCCAAGGCTGCTGGTGACGATGAGGCCATGTTCATAGACGAAAACTTCTGCACTGCTCTGGAGTATGGGCTGCCTCCCACTGCTGGCTGGGGCATGGGCATTGACCGCATCACCATGTTTCTTACAGACTCTAATAACATCAAGGAAGTGCTCCTGTTTCCTGCCATGAAGCCAGAAGACAAGAAAGAGACTGTAGCAAGCATTGACACAATGGAAAGCACAGTGGTTGGCACTTCCGTCTAG

XM_004842823.1 Coding sequence

Kars lysyl-tRNA synthetase, transcript variant X1

Length: 1875 bp    Location: 11337592..11353796   Strand: +
>XM_004842823.1
ATGCTGATGCTAGCTGCTCTAAGGCTTGTTAGGGGGTCCCTGCGCCAAACCTGGGCAGAATGGGGTCAAAGGGAACTTCGACTGGGTCAACTTGCTCCTTTCACAGCGCTTCACAAGGACAAGGCACTTTCTGATATAAGAAGTGAGCTAAAAAGACGCCTTAAAGCCGAGAAGAAAGTGGCAGAGAAGGAGGCCAAGCAGAAGGAGCTCAGTGAGAAACAACTAAGCCAACCTACTGCAGCTGCCACTAATCACACCACTGACAATGGTGTGGGTACCGAGGAAGAAACCCTGGACCCAAACCAATACTACAAGATCCGAAGTCAAGCAGTCCACCAGCTGAAGGTCAGTGGGGAGGATCCATACCCACACAAGTTCCACGTAGACATCTCACTCACCCAGTTCATCCAAGAATACAGTCACCTGCAGCCTGGGGACCACCTGACCGACATCACCTTAAAGGTGGCAGGTAGAATCCATGCCAAAAGAGCTTCTGGGGGGAAGCTCATCTTCTATGACCTTCGAGGAGAGGGAGTCAAGTTGCAAGTCATGGCCAATTCCAGGAATTACAAATCAGAGGAAGAATTTATTTGTATCAACAACAAACTGCGTCGGGGAGACATAATCGGCGTTCATGGGAATCCTGGGAAAACCAAGAAGGGTGAGCTAAGCATCATTCCCTATGAGATCACACTGTTGTCTCCCTGCCTGCATATGTTACCTCATCTGCACTTCGGCCTCAAAGACAAGGAAACCCGGTATCGACAGAGATACTTGGACCTGATACTCAATGACTTTGTGAGGCAGAAATTTATCATCCGCTCTAAGATCATTACATATATAAGAAGTTTCTTGGATGAGCTGGGATTTCTCGAGATTGAAACTCCCATGATGAACATCATCCCAGGGGGAGCTGTGGCCAAGCCTTTCATCACGTACCACAACGAGCTGGATATGAACTTATACATGAGAATTGCTCCAGAACTCTACCATAAGATGCTGGTGGTGGGTGGCATTGACCGGGTTTATGAAATTGGACGCCAGTTCCGGAATGAAGGAATTGATTTGACCCACAATCCTGAGTTCACCACCTGTGAGTTCTACATGGCCTATGCAGACTATCATGATCTTATGGAAATAACAGAGAAGTTGATTTCAGGAATGGTGAAGAACATTACAGGCAGTTACAAGGTCACCTACCACCCAGATGGTCCAGAGGGCCAAGCCTATGAGATTGACTTCACCCCACCCTTCCGGAGAATCGGAATGGTGGAAGAGCTGGAGAAAGCCCTAGGGGTGAAGCTGCCTGAAACCAACCTCTTTGAAACTGAAGAAACTCGAAAAATTCTTGATGATATCTGTGTAGCAAAAGCTGTTGAATGCCCTCCGCCTCGGACCACTGCCAGGCTCCTTGATAAGCTTGTTGGAGAGTTCTTGGAAGTGGCATGCATCAATCCTACATTCATCTGCGATCACCCACAGATAATGAGCCCGTTAGCTAAATGGCACCGCTCCAAAGAGGGTCTGACTGAGCGCTTTGAGCTCTTTGTCATGAAGAAGGAGGTATGCAATGCCTACACTGAGCTGAATGACCCCATGCGGCAGCGGCAGCTGTTTGAAGAACAGGCCAAGGCCAAGGCTGCTGGTGACGATGAGGCCATGTTCATAGACGAAAACTTCTGCACTGCTCTGGAGTATGGGCTGCCTCCCACTGCTGGCTGGGGCATGGGCATTGACCGCATCACCATGTTTCTTACAGACTCTAATAACATCAAGGAAGTGCTCCTGTTTCCTGCCATGAAGCCAGAAGACAAGAAAGAGACTGTAGCAAGCATTGACACAATGGAAAGCACAGTGGTTGGCACTTCCGTCTAG

XM_004842634.1 Coding sequence

Chmp1a charged multivesicular body protein 1A

High confidence: 4 potential gene matches
Length: 591 bp    Location: 302426..308056   Strand: +
>XM_004842634.1
ATGGACGATACGCTGTTCCAGCTGAAGTTCACAGCGAAGCAGCTGGAGAAGCTCGCCAAGAAGGCAGAGAAGGACTCCAAAGCTGAGCAGGCCAAGGTGAAGAAGGCCCTGCAGCAGAAGAACGTGGAGTGTGCCCGGGTATATGCAGAGAATGCCATCCGCAAGAAGAATGAGGGTGTCACTTGGCTGCGCATGGCATCCCGCGTGGATGCGGTGGCCTCCAAGGTGCAGACAGCCGTGACCATGAAGGGGGTGACGAAGAACATGGCCCAGGTGACCAAAGCACTGGACAAGGCCCTGAGCTCCATGGACCTGCAGAAGGTGTCTGCAGTGATGGACAGGTTCGAGCAGCAGGTGCAGAACCTGGATGTACACACGTCGGTGATGGAGGACTCCATGAGCTCGGCCACCACACTGACCACACCCCAGGAGCAGGTGGACAGCCTCATCATGCAGATTGCCGAGGAGAATGGGCTTGAGGTGCTGGACCAGCTCAGCCAGCTGCCCGAGGGCGCCTCGGCTGTGGGCGAGAGCTCTGTACGCAGCCAGGAGGACCAGCTGTCGCGCAGGTTGGCTGCCTTGCGGAACTAG

XM_004842637.1 Coding sequence

Rpl13 ribosomal protein L13, transcript variant X2

High confidence: 2 potential gene matches
Length: 636 bp    Location: 341756..339098   Strand: -
>XM_004842637.1
ATGGCGCCCAGCCGGAATGGCATGATTCTGAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCTACGTGGTTCAACCAGCCGGCTCGGAAGATCCGCAGGCGCAAGGCCCGGCAGGCGAAAGCGCGCCGCATCGCCCCGCGACCCGCCTCAGGACCCATCCGGCCCATCGTGCGCTGCCCCACGGTGCGGTACCACACCAAGGTCCGAGCTGGCAGGGGCTTCAGTCTGGAGGAGCTGCGGGTGGCTGGTATTCACAAGAAGGTAGCCCGGACCATTGGCATCTCGGTGGACCCCAGGAGGCGGAACAAATCCACCGAGTCCCTGCAGGCCAATGTGCAGCGACTGAAGGAGTACCGCTCCAAACTCATCCTTTTCCCCAGGAAGCCGTCGGCCCCCAAGAAGGGAGACAGCTCTGCTGAAGAACTCAAATTGGCCACCCAGCTGACAGGACCTGTGATGCCCATCCGGAACGTCTACAAGAAGGAGAAGGCCAGGATCATCACAGAGGAGGAGAAGAACTTCAAGGCGTTCGCCAGTTTGCGCATGGCCCGTGCCAACGCCCGGCTCTTTGGCATCCGGGCAAAGAGAGCCAAGGAAGCTGCAGAGCAGGACGTTGAGAAGAAAAAATAA

XM_004842617.1 Coding sequence

Tcf25 transcription factor 25 (basic helix-loop-helix), transcript variant X1

Length: 2091 bp    Location: 162442..138059   Strand: -
>XM_004842617.1
ATGTCGCGCCGGGCCCTCCGGAGGCTGAGGGGGGAACAGCGTGGACAGGAGCCCCTCGGGCCCGGAGCCCTGCAGTTTGTCCTCCGTGATGACGAAGACGCAGAAGAAGAAGGACCAAAGGGGGGCCCGGGGGTTCGGGTCCCCGGAGGCACAGGGAAAGAGGGCGTTCAAGTCAACAACCGGTTCGAGCTGATAAACATTGAGGACCTTGAGGACGACACTGTGGTAAACGGGGAGAGGTCTGACTGTGTGCGTGCACACTCTATGGCTTCGGGAAACAAAGCAAGGCCCCCACGTGGAGGCCCAGAGACCCAGCGAGATGGGGATGTGATCAAGGCAGTGTTCCCAGAGCAGTCTAATGTAAGTGGCAAACTCCGAAAGAAGAAAAAGAAGCAAAGAAACAAGAAAAACAGCACAGGAGAGACCTCGGAGAATGGGCTGGAAGACATTGACCGAATCCTGGAGAGGATCGAGGATGGCAGTGGGCTCAGCCACCCTGGCCCCCCTCTGCCCAGCTCCAGGAAGCACGTCTTACATGTGGAGCACAGACACTTGAATCCAGACACAGAACTGAAGAGATATTTTGGTGCTCGAGCGGTCCTGGGGGAACAGAGGCCACGGCAGAGACAGCGTGTGTACCCCAAGTGTACATGGCTGACGACCCCCAAGAGTACCTGGCCCCGGTACAGCAAACCAGGTCTGTCCATGCGGCTTCTGGAATCGAAGAAAGGTCTCTCCTTCTTTGCCTTTGAGCATAGCGAGGATTACCAGCAGGCACAGCACAAGTTTCTGGTGGCCGTGGAGTCAATGGAGCCCAACAACATTGTGGTTCTGCTCCAGACAAGCCCCTACCATGTAGACTCGCTCCTGCAGCTCAGCGATGCCTGCCGCTTTCAGGATGACCAGGAGATGGCTCGAGACCTGACAGAGAGAGCACTGTACAGCATGGAGTGCGCCTTCCACCCTTTGTTCAGCCTCACCAGTGGGACTTGCCGGCTGGATTACCGCAGGCCTGAGAACAGGAGCTTCTACCTGGCCCTCTATAAGCAGATGAGCTTCCTGGAGAAACGAGGCTGCCCACGTACTGCGCTGGAGTACTGCAAGCTCATCCTCAGCCTGGAGCCAGATGAGGACCCCCTCTGCATGCTGCTGCTTATTGACCACCTGGCCTTGAGGGCCCGGAACTACGAGTACTTGATCCACCTCTTCCAGGAGTGGGAGGCGCATCGGAACCTGTCCCAGCTCCCAAATTTTGCCTTCTCAGTGTCGTTAGCATATTTCTTGCTGAGTCAGCAGATAGACCTCCCCCAGCAGGAGCTGAACTCCACAAGGGAAAAGGCCTCCACCCTCATCCAGCAGGCGCTCATCATGTTCCCTGGAGTTCTCATGCCCTTGCTGGAGTCCTGCAGTGTGCGGCCCGACGCTGCTGTCTCAGGTCACCACTTCTTTGGCCCCGAGGCTGAGATAAGCCAGCCACCTGCCCTGAGCCAGCTGGTGAGCCTGTACCTTGGGAGGTCTCACTTTCTCTGGAAAGAACCTGCCACCATGAGCTGGCTGGAGGAGAATGTCCGAGAAGTTTTGCGAGCTGTGGACGCAGGGGACCCCACCGTGCAGGCCTGTGAGGGCAGGCGGAAGGTGCTGTACCAGCGTGCACCCAGGAACATCCACCGTCACGTGATCCTCTCGGAGATCAAGGAGGCTGTGGCCGTGCTGCCTCCGGAGGTGACCACGCAGTCTGTGATGGGGTTTGACCCTCTGCCTCCCCTGGACACCATCTACTCCTACGTCCGACCCGAGAGGCTAAGTCCTGTCAGCCATGGAAACACGATCGCCCTCTTCTTCCGGTCACTATTGCCAAACTACACCATGGAGGTATGTCAGGCACATCCTTGCCAGAGACAGCACAACCGTGTAGCAGGAAGTGGGGCCTCTGGGGCTGGCTGGTCCAGAGTCCTCTCCCTCCCTGCTGGGGCCCAGCCCAGCTCAGCTCAGACCTGTCTCCCTACCACAGGGAGAGAGGCTGGAGGAAGGAGTGGCTGGAGGTCTGAACCGAAACCAAGGCTTGAACCGGCTGATGCTGGCTGTGCGTGA

XM_004842626.1 Coding sequence

Znf276 zinc finger protein 276, transcript variant X1

Length: 2037 bp    Location: 266777..252631   Strand: -
>XM_004842626.1
ATGCGAAGGGGCCGAGAGGAACGGAACAAGCGTCGGACGAGCGGGGCCGAGTGGGGCCGAACTGGGCCGAACGGGGCCGAGTGGGGCCGAACGGAGCCGAGCGGGCTGAGTCGAACACAGTCGAGCGGGGCCGAGCGGGCTGAGTCGAACACAGCCGGGCGGGGCCGAGCCGTACCGAGCAGCCCTGCGCCGCCTCTTGGGTTGGCCGACGCCATGAAGCGGGACCGGCTCGGCCGCTTCCTGTCTCCGGGGCCGGCCCGGCAGCGCGGGGGCGCGGGCGGCGGTCGCGCGCGGGGTCGTCTCGCCCGTGGCGAAGGCGCGGAGACCTTGACGGCGGCGCGGCTCGGCTGGAGCTCGGCGCGGGCCTGCGGGGACCCGGTCGAGGACGGCGCGGACGAGGCAGGAACAGGCCGGGCTCTTGCCATGGGGCACTGTCGTCTCTGCCATGGGAAGTTTTCCTCACGGAGTCTCCGAAGCATCTCTGACAGGGCGTCTGGGGACAGCCCAGAGAAACCTTCCCCAGGAGACCGTGTCTTCATCAGGGACTTCCAGCACTTGCTGGGTGTGGCTGTGCACCAGGACTCATCCTTGTCCCAGTTTGTCTGCAAGAGCTGCCATGCCCAGTTCTACCAGTGCCACAGCCTGCTCAGGTCCTTCTTGCAGAGGGTCAACGTGTGCCCGACAGGCCAGCGGAAGTCTTGTACAAAGGTCGGTGCTCAGCCCCCCACAGTGGCGGAGGAGGGAGTGTGTCTGGTGGATCTGATCACCTCGACTCCCCGGTGCCTGCATGGCTTAGTGGGGTGGGTGCACGGACATGCGGCCAGCTGTGGGGCCCTGCCCAGCCTTCAGAGAACACTGTCCTCCGAGTACTGCGGCATCATCCAGGCGGTGTGGGCCTGCGATCAGGGCCACGACTACACCATGGACACCGATTCCAGCTGCAGAGCCCTCTTACTGGACAATGCATTGGCAGTCAAATGGCCATGGGACAAGGAGATGGCACCACGGCTCATCCAGAACCTGGGGTCTGACCCTGCTGGGGCTGCACCCCAGCTGTCCCAAGGCAGAGGAACCACGGCTGGGGCTGAGACCAAGATGCTGCCCAATGTGGATGCAGCCCCATCTTCAGATGGCAGCTCTGTGGGGCCCAGGCCAGGCCCCCCACCTCGGCCAAGCCTCCCTCAAAATGAGGCCCCAGGGCAATTGGGTGAGAAGCAGGTTCCATCTTCAACTTCGGATGATCGGGTAAAAGACGAGTTCAGTGACCTTTCTGAGGGAGACTTCCTGAGTGAAGATGAAAATGGCAAGAAGCAAAATGCACAGTCTTCGGACGAGTCCTTTGAGCCTTACCCAGAAAAGAAGGTCTCTGGGAAGAAAAGTGAAAGCAAAGAAGCCAAGAAGACTGAAGAACCAAAAATGCGGAAAAAACCTGGGCCTAAGCCTGGATGGAAAAAAAAGCTCCGCTGCGAGAGGGAGGAGCTGCCCACCATCTATAAGTGTCCTTACCAGGGCTGCACGGCTGTGTACCGTGGGGCTGACGGCATGAAGAAGCACATCAAGGAGCATCACGAGGAGGTTCGGGAAAGGCCCTGTCCCCACCCTGGCTGCAACAAGGTGTTCATGATTGACCGCTACCTGCAACGCCACGTGAAACTTATCCACACAGAGGTGCGCAACTATATCTGTGACGAGTGTGGGCAGACCTTCAAGCAGCGGAAGCACCTTCTTGTCCATCAGATGCGCCACTCAGGAGCCAAACCACTGCAGTGTGAAGTCTGTGGCTTCCAGTGCAGGCAGCGGGCATCCCTCAAGTACCATATGACCAAGCACAAGGCAGAGACTGAGCTGGATTTCGCTTGCGATCAATGCGGCCGACGGTTCGAGAAGGCGCACAACCTCAATGTGCACATGTCCATGGTCCACCCTCTGACACAGACCCAAGACAAGGCCCTGCCCTTGGAGGTGGAGCCACCTCCTGGAGCCCGGAGCCCTTCTGGGACCACGGAGGGCCAGGCAGTGAAGCCAGAGCCCACCTGA

XM_004842596.1 Coding sequence

Gas8 growth arrest-specific 8, transcript variant X1

Length: 1677 bp    Location: 42867..12532   Strand: -
>XM_004842596.1
ATGCAGGGCAGAGTGATATGCTCAGCTGAGTGCTTCCATCAAGGGCATGAGAGGAAGCAAGGGGGAGAGGTTCCAGATAGGTCCTCCCCAAATGCCTGTGGAAGCCAGTCAGAGCCTTCCAAGGAGGGGAAACGATTCGGCAGAATTCCCTGTACTTACCCAGTAATTTTTCTTCAACCCCAGGCACCCAAAAAGAAAGGGAAGAAAGGTAAACCCAAAGGTACTGCAGTTGTGGATGGGCTTGATCCAGAGGACATGAACAAGGGGCAGGTGGAGGAGCACATCAGGCGCATCCGGGAGGAGCTGGACCGGGAGCGGGAGGAGCGCAACTACTTCCAGCTGGAGCGGGACAAGATCCACACTTTCTGGGAGATAACGAGAAGGCAGTTGGAGGAGAAGAAGGCTGAGCTGCGGAACAAAGACCGGGAGATGGAGGAGGCTGAGGAGAGGCATCAGGTGGAGATCAAGGTGTACAAGCAGAAGGTGAAGCACCTGCTGTATGAACACCAGAACAGCCTGACGGAGCTGAAGGCCGAGGGCACCGTGGCCATGAAGCTGGCCCAGAAGCAGCACCACACCCAAGAGGGCGCACTGCGCAAGGACATGCGGGCGCTCAAGGTGGAGCTCAAGGAGCAGGAGCTGGCCAGCGAGGTGGTGGCCAAGACCCTGCGGCTGAAACACGCCGAGGAGATCACCAAGATGAGGAATGACTTTGAGAGGCAAATTCGAGAAATTGAGGCTAAGTATGACAAGAAGATGAAGGTGCTGAGGGATGAGCTTGATCTGCGAAGAAAGACTGAGATCCACGAAGTGGAGGAGAGGAAGAATGGCCAGATCAACACACTGATGCAGCGCCACGAAGAGGCCTTCACCGACATCAAGAACTACTATAATGACATCACACTCAACAACTTGGCCCTCATCAGCTCCCTCAAGGAGCAGATGGAAGACATGCGAAAGAAGGAGGAGCGCCTGCAGCGAGAGATGGCGGAGGTGGCCTTGCAGAACAGGCGCCTGGTGGATCCCCTCCAGAAGGCCCGGGATGAGATGGCTGAGATGCGGAGGAAACTCGGGGACTGTGAAAGGGACAAACAGATCCTGGTGAGCACGAAAGCACGTTTGAAGGTTACTGAGAAGGAGCTGAAGGACCTGCAGTGGGAGCACGAGGTGCTGGAGCAGCGCTTCCTCAAGGTGCAGCAGGAGCGGGACGAGCTCTACCGGAAGTTCACAGCGGCCATCCAGGAGGTGCAGCAGAAGACTGGCTTTAAAAACTTGCTGCTGGAGCGCAAGCTGCAGGTGCTAAGTACTGCTGTGGAGAAGAGGGAGGTACAATTCAACGAGGTGCTGGCAGCCTCCAACATGGACCCCGCTGCGCTGATGCTCGTGTCTCACAAGCTTGAGGATGTTTTGGAATCAAAGAACACCACCATCAAGGACCTACAGTATGAGCTGGCACGGGTCTGCAAGCAGGTGAGAAGCCTCCATCCTTGGCCTCGGCCCTCCTCCAGGACTCAGTCTCCTGCCAAGCCTGCCCTAGGCGTCCCTCAGGCTGAACAGCAGGAGAGTGAGGTGCAGCAGGACCTTGCACTTGCCAGGTTGGTGTTAGAGAAGATGATGATGAGGAGCCTGATGAGGATGATGATGACATTGTATTTACAAAAGATGCGGAAGAGATGA

XM_004842598.1 Coding sequence

Gas8 growth arrest-specific 8, transcript variant X3

Length: 1626 bp    Location: 42867..33318   Strand: -
>XM_004842598.1
ATGCAGGGCAGAGTGATATGCTCAGCTGAGTGCTTCCATCAAGGGCATGAGAGGAAGCAAGGGGGAGAGGTTCCAGATAGGTCCTCCCCAAATGCCTGTGGAAGCCAGTCAGAGCCTTCCAAGGAGGGGAAACGATTCGGCAGAATTCCCTGTACTTACCCAGTAATTTTTCTTCAACCCCAGGCACCCAAAAAGAAAGGGAAGAAAGGTAAACCCAAAGGTACTGCAGTTGTGGATGGGCTTGATCCAGAGGACATGAACAAGGGGCAGGTGGAGGAGCACATCAGGCGCATCCGGGAGGAGCTGGACCGGGAGCGGGAGGAGCGCAACTACTTCCAGCTGGAGCGGGACAAGATCCACACTTTCTGGGAGATAACGAGAAGGCAGTTGGAGGAGAAGAAGGCTGAGCTGCGGAACAAAGACCGGGAGATGGAGGAGGCTGAGGAGAGGCATCAGGTGGAGATCAAGGTGTACAAGCAGAAGGTGAAGCACCTGCTGTATGAACACCAGAACAGCCTGACGGAGCTGAAGGCCGAGGGCACCGTGGCCATGAAGCTGGCCCAGAAGCAGCACCACACCCAAGAGGGCGCACTGCGCAAGGACATGCGGGCGCTCAAGGTGGAGCTCAAGGAGCAGGAGCTGGCCAGCGAGGTGGTGGCCAAGACCCTGCGGCTGAAACACGCCGAGGAGATCACCAAGATGAGGAATGACTTTGAGAGGCAAATTCGAGAAATTGAGGCTAAGTATGACAAGAAGATGAAGGTGCTGAGGGATGAGCTTGATCTGCGAAGAAAGACTGAGATCCACGAAGTGGAGGAGAGGAAGAATGGCCAGATCAACACACTGATGCAGCGCCACGAAGAGGCCTTCACCGACATCAAGAACTACTATAATGACATCACACTCAACAACTTGGCCCTCATCAGCTCCCTCAAGGAGCAGATGGAAGACATGCGAAAGAAGGAGGAGCGCCTGCAGCGAGAGATGGCGGAGGTGGCCTTGCAGAACAGGCGCCTGGTGGATCCCCTCCAGAAGGCCCGGGATGAGATGGCTGAGATGCGGAGGAAACTCGGGGACTGTGAAAGGGACAAACAGATCCTGGTGAGCACGAAAGCACGTTTGAAGGTTACTGAGAAGGAGCTGAAGGACCTGCAGTGGGAGCACGAGGTGCTGGAGCAGCGCTTCCTCAAGGTGCAGCAGGAGCGGGACGAGCTCTACCGGAAGTTCACAGCGGCCATCCAGGAGGTGCAGCAGAAGACTGGCTTTAAAAACTTGCTGCTGGAGCGCAAGCTGCAGGTGCTAAGTACTGCTGTGGAGAAGAGGGAGGTACAATTCAACGAGGTGCTGGCAGCCTCCAACATGGACCCCGCTGCGCTGATGCTCGTGTCTCACAAGCTTGAGGTAGGTGGAGGATGGGATCCTTCCCCCAGCGTGCCTTCACCCTGTGCTGTGCCACCTCCAAGGGCACAGAGGCCCCCATTCCCCATGGGGGCCTGGGAGCAGGTTGGTCCTGCAGGCCATGCCACTGCAGTCTCCTTTCTTGGTGCTGAGCACTCCTGGGTTTCCCAGCCCTACCTTAGCCTTGTGACTTATGCCTCTGCCCTGCAGCTATCCAAAGTGGCTTGA

XM_004842606.1 Coding sequence

LOC101723550 AFG3-like protein 1-like, transcript variant X4

Length: 2067 bp    Location: 92316..59943   Strand: -
>XM_004842606.1
ATGCAGAAGGGAGAGTTTCCCTGGGATGACAAGGATTTCCGAAATCTGGCCGTTTTGGGGGCAGGTGTTGCTGTGGGAGTTTTCTACTTCTGTTTTCGAGATCCTGGAAAAGAAATCACCTGGAAGCACTTTGTGCAGTATTACCTGGCCAGAGGCTTGGTGGACCGGCTAGAAGTCGTGAACAAACAGTTTGTGCGGGTTATTCCTGCCCCAGGGACCTCTTCTGCGAAGTTTGTGTGGTTCAACATCGGCAGTGTTGATATCTTTGAGCGGAACCTCGAGTCTGCTCAGTGGGAGCTGGGGATCGAACCCACCAACCAGGCCGCAGTGGTCTACACCACTGAGAGTGATGGCTCTTTCCTGGGAAGCCTGGTGCCTACCCTTCTTCTGGTTAGCATCCTTCTCTATGCTGTGAGGAGGCACTCGATGGGGGCCGGGCGCCGCGGGCGAGGAGGAGGCCTCTTCAGTGTTGGTGAGACAACAGCCAAGATCCTGAAGAACAACATTGATGTGCGATTTGCAGATGTAGCTGGCTGTGAAGAAGCCAAATTGGAAATTATGGAGTTTGTGAATTTCCTGAAAAACCCCAAGCAGTATCAGGACTTAGGAGCCAAAATCCCAAAGGGAGCCATGCTCACTGGTCCACCTGGTACCGGCAAAACACTTCTTGCCAAAGCAACCGCAGGGGAGGCTAGCGTGCCCTTCATCACTGTGAATGGATCAGAATTCCTGGAAATGTTTGTTGGTGTTGGGCCAGCAAGGGTCCGTGACATGTTTGCAATGGCTAGGAAAAACGCTCCTTGTATCTTATTCATTGATGAGATGGATGCCATTGGCCGGAAGCGAGTCCGAGGGCACCTTGGGGGTCAGAATGAGCAGGAGAACACCCTGAACCAGATGCTTGTGGAGATGGATGGATTCAACTCCACCACCAATGTAGTGGTGCTGGCAGCCACTAACCGCCCTGATATCCTCGACCCAGCCCTAATGCGCCCTGGCCGCTTTGACCGCCACATTTATATTGGTCCCCCTGACATCAAAGGCAGGTCCTCTATCTTCAAGGTCCACCTGCACCCACTGAAGTTGGCTGAAAGCCTCAGTAAGGACTCCCTGGCATGGAAGCTGGCAGCTCTCACTCCAGGCTTCACTGGTGCTGATATTTTTAATGTGTGCAATGAAGCTGCGCTGATCGCAGCCCGCTACCTGAGTCCTTCTGTTCAGGAGAAGCACTTCAAGCAAGCCATTGAGAGGGTCGTTGGAGGCCTTGAGAAGAAGACCCAGGTCTTGCAGCCCAGTGAAAAGACGACCGTGGCCTACCACGAGGCCGGGCATGCAGTCGTGGGCTGGTTCCTGGAGCATGCAGACCCCCTGCTGAAGGTATCCATTATCCCCCGGGGCAAGGGGCTTGGCTATGCCCAGTACCTGCCCCGGGAACAGCACCTCTACACAAGAGAGCAGCTCTTCGACCGCATGTGCATGATGCTGGGGGGCCGGGGGGCCGAGCAACTGTTCTTTGGGCAGATCACCACAGGGGCGCAAGATGACCTAAGGAAGGTCACACAGAGTGCCTATGCACAGGTAAGAGGTGGGTGTCCTGGCGCAGCCCCACACCCTCGAGGCCACGGCTCATGCTGGGCTCCCTGTGGTTTCCAGATCGTGCAGTTTGGGATGAGTGAGAGGCTGGGTCAGGTGTCCTTTGACCTCGCACGCCAAGGTGAGGCCCTGGTGGAGAAGCCCTACAGCGAGGCCACTGCCCAGCTCATCGATGAGGAGGTTCGGCACCTCATCAGCTCTGCCTACGATCGCACTCTAGAGCTGCTGACTCAGTGCCGGGAGCAGGTAGAGAAGGTGGGCCAGCGGCTGCTTGAGAAGGAGGTGCTAGAGAAGGCTGACATGGTTGAGCTGCTAGGCCCTCGGCCCTTCGCGGAGAAGTCCACCTATGAGGAGTTTGTGGAGGGCACTGGCGGCCTGGAGGAGGACACATCCCTTCCTGAGGGGCTGAAGGATTGGAACCAGGGACAGGAGGAGGGGGACACTGAGCAGCGCTTGCAGGGGAGCCCTACATAG

XM_004842604.1 Coding sequence

LOC101723550 AFG3-like protein 1-like, transcript variant X2

Length: 2058 bp    Location: 82905..59943   Strand: -
>XM_004842604.1
ATGCAGAAGGGAGAGTTTCCCTGGGATGACAAGGATTTCCGAAATCTGGCCGTTTTGGGGGCAGGTGTTGCTGTGGGAGTTTTCTACTTCTGTTTTCGAGATCCTGGAAAAGAAATCACCTGGAAGCACTTTGTGCAGTATTACCTGGCCAGAGGCTTGGTGGACCGGCTAGAAGTCGTGAACAAACAGTTTGTGCGGGTTATTCCTGCCCCAGGGACCTCTTCTGCGAAGTTTGTGTGGTTCAACATCGGCAGTGTTGATATCTTTGAGCGGAACCTCGAGTCTGCTCAGTGGGAGCTGGGGATCGAACCCACCAACCAGGCCGCAGTGGTCTACACCACTGAGAGTGATGGCTCTTTCCTGGGAAGCCTGGTGCCTACCCTTCTTCTGGTTAGCATCCTTCTCTATGCTGTGAGGAGGCACTCGATGGGGGCCGGGCGCCGCGGGCGAGGAGGAGGCCTCTTCAGTGTTGGTGAGACAACAGCCAAGATCCTGAAGAACAACATTGATGTGCGATTTGCAGATGTAGCTGGCTGTGAAGAAGCCAAATTGGAAATTATGGAGTTTGTGAATTTCCTGAAAAACCCCAAGCAGTATCAGGACTTAGGAGCCAAAATCCCAAAGGGAGCCATGCTCACTGGTCCACCTGGTACCGGCAAAACACTTCTTGCCAAAGCAACCGCAGGGGAGGCTAGCGTGCCCTTCATCACTGTGAATGGATCAGAATTCCTGGAAATGTTTGTTGGTGTTGGGCCAGCAAGGGTCCGTGACATGTTTGCAATGGCTAGGAAAAACGCTCCTTGTATCTTATTCATTGATGAGATGGATGCCATTGGCCGGAAGCGAGTCCGAGGGCACCTTGGGGGTCAGAATGAGCAGGAGAACACCCTGAACCAGATGCTTGTGGAGATGGATGGATTCAACTCCACCACCAATGTAGTGGTGCTGGCAGCCACTAACCGCCCTGATATCCTCGACCCAGCCCTAATGCGCCCTGGCCGCTTTGACCGCCACATTTATATTGGTCCCCCTGACATCAAAGGCAGGTCCTCTATCTTCAAGGTCCACCTGCACCCACTGAAGTTGGCTGAAAGCCTCAGTAAGGACTCCCTGGCATGGAAGCTGGCAGCTCTCACTCCAGGCTTCACTGGTGCTGATATTTTTAATGTGTGCAATGAAGCTGCGCTGATCGCAGCCCGCTACCTGAGTCCTTCTGTTCAGGAGAAGCACTTCAAGCAAGCCATTGAGAGGGTCGTTGGAGGCCTTGAGAAGAAGACCCAGGTCTTGCAGCCCAGTGAAAAGACGACCGTGGCCTACCACGAGGCCGGGCATGCAGTCGTGGGCTGGTTCCTGGAGCATGCAGACCCCCTGCTGAAGGTATCCATTATCCCCCGGGGCAAGGGGCTTGGCTATGCCCAGTACCTGCCCCGGGAACAGCACCTCTACACAAGAGAGCAGCTCTTCGACCGCATGTGCATGATGCTGGGGGGCCGGGGGGCCGAGCAACTGTTCTTTGGGCAGATCACCACAGGGGCGCAAGATGACCTAAGGAAGGTCACACAGAGTGCCTATGCACAGGTAAGAGGTGGGTGTCCTGGCGCAGCCCCACACCCTCGAGGCCACGGCTCATGCTGGGCTCCCTGTGGTTTCCAGATCGTGCAGTTTGGGATGAGTGAGAGGCTGGGTCAGGTGTCCTTTGACCTCGCACGCCAAGGTGAGGCCCTGGTGGAGAAGCCCTACAGCGAGGCCACTGCCCAGCTCATCGATGAGGAGGTTCGGCACCTCATCAGCTCTGCCTACGATCGCACTCTAGAGCTGCTGACTCAGTGCCGGGAGCAGGTGGGCCAGCGGCTGCTTGAGAAGGAGGTGCTAGAGAAGGCTGACATGGTTGAGCTGCTAGGCCCTCGGCCCTTCGCGGAGAAGTCCACCTATGAGGAGTTTGTGGAGGGCACTGGCGGCCTGGAGGAGGACACATCCCTTCCTGAGGGGCTGAAGGATTGGAACCAGGGACAGGAGGAGGGGGACACTGAGCAGCGCTTGCAGGGGAGCCCTACATAG

XM_004842603.1 Coding sequence

LOC101723550 AFG3-like protein 1-like, transcript variant X1

Length: 2067 bp    Location: 82905..59943   Strand: -
>XM_004842603.1
ATGCAGAAGGGAGAGTTTCCCTGGGATGACAAGGATTTCCGAAATCTGGCCGTTTTGGGGGCAGGTGTTGCTGTGGGAGTTTTCTACTTCTGTTTTCGAGATCCTGGAAAAGAAATCACCTGGAAGCACTTTGTGCAGTATTACCTGGCCAGAGGCTTGGTGGACCGGCTAGAAGTCGTGAACAAACAGTTTGTGCGGGTTATTCCTGCCCCAGGGACCTCTTCTGCGAAGTTTGTGTGGTTCAACATCGGCAGTGTTGATATCTTTGAGCGGAACCTCGAGTCTGCTCAGTGGGAGCTGGGGATCGAACCCACCAACCAGGCCGCAGTGGTCTACACCACTGAGAGTGATGGCTCTTTCCTGGGAAGCCTGGTGCCTACCCTTCTTCTGGTTAGCATCCTTCTCTATGCTGTGAGGAGGCACTCGATGGGGGCCGGGCGCCGCGGGCGAGGAGGAGGCCTCTTCAGTGTTGGTGAGACAACAGCCAAGATCCTGAAGAACAACATTGATGTGCGATTTGCAGATGTAGCTGGCTGTGAAGAAGCCAAATTGGAAATTATGGAGTTTGTGAATTTCCTGAAAAACCCCAAGCAGTATCAGGACTTAGGAGCCAAAATCCCAAAGGGAGCCATGCTCACTGGTCCACCTGGTACCGGCAAAACACTTCTTGCCAAAGCAACCGCAGGGGAGGCTAGCGTGCCCTTCATCACTGTGAATGGATCAGAATTCCTGGAAATGTTTGTTGGTGTTGGGCCAGCAAGGGTCCGTGACATGTTTGCAATGGCTAGGAAAAACGCTCCTTGTATCTTATTCATTGATGAGATGGATGCCATTGGCCGGAAGCGAGTCCGAGGGCACCTTGGGGGTCAGAATGAGCAGGAGAACACCCTGAACCAGATGCTTGTGGAGATGGATGGATTCAACTCCACCACCAATGTAGTGGTGCTGGCAGCCACTAACCGCCCTGATATCCTCGACCCAGCCCTAATGCGCCCTGGCCGCTTTGACCGCCACATTTATATTGGTCCCCCTGACATCAAAGGCAGGTCCTCTATCTTCAAGGTCCACCTGCACCCACTGAAGTTGGCTGAAAGCCTCAGTAAGGACTCCCTGGCATGGAAGCTGGCAGCTCTCACTCCAGGCTTCACTGGTGCTGATATTTTTAATGTGTGCAATGAAGCTGCGCTGATCGCAGCCCGCTACCTGAGTCCTTCTGTTCAGGAGAAGCACTTCAAGCAAGCCATTGAGAGGGTCGTTGGAGGCCTTGAGAAGAAGACCCAGGTCTTGCAGCCCAGTGAAAAGACGACCGTGGCCTACCACGAGGCCGGGCATGCAGTCGTGGGCTGGTTCCTGGAGCATGCAGACCCCCTGCTGAAGGTATCCATTATCCCCCGGGGCAAGGGGCTTGGCTATGCCCAGTACCTGCCCCGGGAACAGCACCTCTACACAAGAGAGCAGCTCTTCGACCGCATGTGCATGATGCTGGGGGGCCGGGGGGCCGAGCAACTGTTCTTTGGGCAGATCACCACAGGGGCGCAAGATGACCTAAGGAAGGTCACACAGAGTGCCTATGCACAGGTAAGAGGTGGGTGTCCTGGCGCAGCCCCACACCCTCGAGGCCACGGCTCATGCTGGGCTCCCTGTGGTTTCCAGATCGTGCAGTTTGGGATGAGTGAGAGGCTGGGTCAGGTGTCCTTTGACCTCGCACGCCAAGGTGAGGCCCTGGTGGAGAAGCCCTACAGCGAGGCCACTGCCCAGCTCATCGATGAGGAGGTTCGGCACCTCATCAGCTCTGCCTACGATCGCACTCTAGAGCTGCTGACTCAGTGCCGGGAGCAGGTAGAGAAGGTGGGCCAGCGGCTGCTTGAGAAGGAGGTGCTAGAGAAGGCTGACATGGTTGAGCTGCTAGGCCCTCGGCCCTTCGCGGAGAAGTCCACCTATGAGGAGTTTGTGGAGGGCACTGGCGGCCTGGAGGAGGACACATCCCTTCCTGAGGGGCTGAAGGATTGGAACCAGGGACAGGAGGAGGGGGACACTGAGCAGCGCTTGCAGGGGAGCCCTACATAG

XM_004842607.1 Coding sequence

LOC101723550 AFG3-like protein 1-like, transcript variant X5

Length: 1641 bp    Location: 78773..59943   Strand: -
>XM_004842607.1
ATGGGGGCCGGGCGCCGCGGGCGAGGAGGAGGCCTCTTCAGTGTTGGTGAGACAACAGCCAAGATCCTGAAGAACAACATTGATGTGCGATTTGCAGATGTAGCTGGCTGTGAAGAAGCCAAATTGGAAATTATGGAGTTTGTGAATTTCCTGAAAAACCCCAAGCAGTATCAGGACTTAGGAGCCAAAATCCCAAAGGGAGCCATGCTCACTGGTCCACCTGGTACCGGCAAAACACTTCTTGCCAAAGCAACCGCAGGGGAGGCTAGCGTGCCCTTCATCACTGTGAATGGATCAGAATTCCTGGAAATGTTTGTTGGTGTTGGGCCAGCAAGGGTCCGTGACATGTTTGCAATGGCTAGGAAAAACGCTCCTTGTATCTTATTCATTGATGAGATGGATGCCATTGGCCGGAAGCGAGTCCGAGGGCACCTTGGGGGTCAGAATGAGCAGGAGAACACCCTGAACCAGATGCTTGTGGAGATGGATGGATTCAACTCCACCACCAATGTAGTGGTGCTGGCAGCCACTAACCGCCCTGATATCCTCGACCCAGCCCTAATGCGCCCTGGCCGCTTTGACCGCCACATTTATATTGGTCCCCCTGACATCAAAGGCAGGTCCTCTATCTTCAAGGTCCACCTGCACCCACTGAAGTTGGCTGAAAGCCTCAGTAAGGACTCCCTGGCATGGAAGCTGGCAGCTCTCACTCCAGGCTTCACTGGTGCTGATATTTTTAATGTGTGCAATGAAGCTGCGCTGATCGCAGCCCGCTACCTGAGTCCTTCTGTTCAGGAGAAGCACTTCAAGCAAGCCATTGAGAGGGTCGTTGGAGGCCTTGAGAAGAAGACCCAGGTCTTGCAGCCCAGTGAAAAGACGACCGTGGCCTACCACGAGGCCGGGCATGCAGTCGTGGGCTGGTTCCTGGAGCATGCAGACCCCCTGCTGAAGGTATCCATTATCCCCCGGGGCAAGGGGCTTGGCTATGCCCAGTACCTGCCCCGGGAACAGCACCTCTACACAAGAGAGCAGCTCTTCGACCGCATGTGCATGATGCTGGGGGGCCGGGGGGCCGAGCAACTGTTCTTTGGGCAGATCACCACAGGGGCGCAAGATGACCTAAGGAAGGTCACACAGAGTGCCTATGCACAGGTAAGAGGTGGGTGTCCTGGCGCAGCCCCACACCCTCGAGGCCACGGCTCATGCTGGGCTCCCTGTGGTTTCCAGATCGTGCAGTTTGGGATGAGTGAGAGGCTGGGTCAGGTGTCCTTTGACCTCGCACGCCAAGGTGAGGCCCTGGTGGAGAAGCCCTACAGCGAGGCCACTGCCCAGCTCATCGATGAGGAGGTTCGGCACCTCATCAGCTCTGCCTACGATCGCACTCTAGAGCTGCTGACTCAGTGCCGGGAGCAGGTAGAGAAGGTGGGCCAGCGGCTGCTTGAGAAGGAGGTGCTAGAGAAGGCTGACATGGTTGAGCTGCTAGGCCCTCGGCCCTTCGCGGAGAAGTCCACCTATGAGGAGTTTGTGGAGGGCACTGGCGGCCTGGAGGAGGACACATCCCTTCCTGAGGGGCTGAAGGATTGGAACCAGGGACAGGAGGAGGGGGACACTGAGCAGCGCTTGCAGGGGAGCCCTACATAG

XM_004842611.1 Coding sequence

Def8 differentially expressed in FDCP 8 homolog (mouse), transcript variant X3

Length: 1356 bp    Location: 119283..103890   Strand: -
>XM_004842611.1
ATGGAATATAATGAGAAGCTGGCCCGGTTCCGGCAAGCCCACCTCAACCCCTTCAACAAGCAGCTTGGGGCAGGGCAGCATGAGCAGGGAGCCGCTCAGGAGGCTCTGGAGATCAGCTCTGAAGAGATCCTGCCTGAGCTGCGCCCTGGGGAGCCTGAGTTCTGCTGCTCTGAGCGTGTGATGGATCTTGGCCTGTCTGAGGACCACTTCTCTCGCCCTGTGGGTCTGTTCCTGGCCTCTGATGTCCAGCAGCTTCGGCAAGCGATTGAGGAATGTAAGCAGGTGATTCTGGAGCTGCCTGAGCAGTCAGAGAGGCAGAAGGATGCTGTGGTGAGGCTCATCCACCTCCGGCTGAAGCTGCAGGAGCTGAAGGACCCCAATGAGGATGAGCCCAATATCCGAGTCCTCCTAGAGCACCGCTTCTACAAGGAGAAGAGCAAAAGTGTCAAGCAGACCTGTGACAAGTGCAACACCATCATCTGGGGGCTCATTCAGACCTGGTACACCTGCACAGGCTGCTATTACCGCTGCCACAGCAAGTGCTTGAACCTCATCTCCAAGCCCTGTGTGAGCTCCAAGGTTAGCCACCAGGCCGAGTACGAGCTGAACATCTGCCCCGAGACGGGGCTGGACAGCCAGGATTACCGCTGTGCCGAGTGCCGGGCGCCCATCTCTCTGCGGGGCGTGCCCAGTGAGGCCCGACAGTGTGACTACACGGGCCGGTACTACTGCAGCCACTGCCACTGGAACGACCTGGCTGTTATCCCTGCACGCGTCGTGCACAACTGGGACTTCGAGCCGCGCAAGGTGTCTCGCTGCAGCATGCGCTACCTGGCTCTGATGGTGTCGAGGCCGGTGCTCCGGCTGCGGGAGATCAACCCCCTGCTGTTCAACTATGTGGAGGAGCTGGTGGAGATCCGGAAGTTGCGCCAGGACATCCTGCTCATGAAGCCATACTTCATCACTTGCAAGGAGGCCATGGAAGCCCGGCTGCTGCTGCAGCTCCAGGACCGACAGCATTTTGTGGAGAACGACGAGATGTACTCCATCCAGGACCTGCTGGATGTGCATTTGGGCCGCCTTGGCTGCTCTCTCACCGAGATCCACACGCTCTTTGCCAAGCATATCAAGCTGGACTGTGAGCGGTGCCAGGCCAAGGGCTTCGTGTGTGAGCTCTGCAGAGAGGGTGATGTGCTGTTCCCATTCGACAGCCACACATCTGTGTGCACAGACTGCTCAGCCGTCTTCCACAGGGATTGCTACTATGACAACTCCACCACATGCCCCAAGTGTGCCCGGCTCAACTTGAGGAAGCAGTCCCTCTTCCAGGAGCCTGGTCCAGACATGGATGCCTAG

XM_004842612.1 Coding sequence

Def8 differentially expressed in FDCP 8 homolog (mouse), transcript variant X4

High confidence: 4 potential gene matches
Length: 1356 bp    Location: 119268..103890   Strand: -
>XM_004842612.1
ATGGAATATAATGAGAAGCTGGCCCGGTTCCGGCAAGCCCACCTCAACCCCTTCAACAAGCAGCTTGGGGCAGGGCAGCATGAGCAGGGAGCCGCTCAGGAGGCTCTGGAGATCAGCTCTGAAGAGATCCTGCCTGAGCTGCGCCCTGGGGAGCCTGAGTTCTGCTGCTCTGAGCGTGTGATGGATCTTGGCCTGTCTGAGGACCACTTCTCTCGCCCTGTGGGTCTGTTCCTGGCCTCTGATGTCCAGCAGCTTCGGCAAGCGATTGAGGAATGTAAGCAGGTGATTCTGGAGCTGCCTGAGCAGTCAGAGAGGCAGAAGGATGCTGTGGTGAGGCTCATCCACCTCCGGCTGAAGCTGCAGGAGCTGAAGGACCCCAATGAGGATGAGCCCAATATCCGAGTCCTCCTAGAGCACCGCTTCTACAAGGAGAAGAGCAAAAGTGTCAAGCAGACCTGTGACAAGTGCAACACCATCATCTGGGGGCTCATTCAGACCTGGTACACCTGCACAGGCTGCTATTACCGCTGCCACAGCAAGTGCTTGAACCTCATCTCCAAGCCCTGTGTGAGCTCCAAGGTTAGCCACCAGGCCGAGTACGAGCTGAACATCTGCCCCGAGACGGGGCTGGACAGCCAGGATTACCGCTGTGCCGAGTGCCGGGCGCCCATCTCTCTGCGGGGCGTGCCCAGTGAGGCCCGACAGTGTGACTACACGGGCCGGTACTACTGCAGCCACTGCCACTGGAACGACCTGGCTGTTATCCCTGCACGCGTCGTGCACAACTGGGACTTCGAGCCGCGCAAGGTGTCTCGCTGCAGCATGCGCTACCTGGCTCTGATGGTGTCGAGGCCGGTGCTCCGGCTGCGGGAGATCAACCCCCTGCTGTTCAACTATGTGGAGGAGCTGGTGGAGATCCGGAAGTTGCGCCAGGACATCCTGCTCATGAAGCCATACTTCATCACTTGCAAGGAGGCCATGGAAGCCCGGCTGCTGCTGCAGCTCCAGGACCGACAGCATTTTGTGGAGAACGACGAGATGTACTCCATCCAGGACCTGCTGGATGTGCATTTGGGCCGCCTTGGCTGCTCTCTCACCGAGATCCACACGCTCTTTGCCAAGCATATCAAGCTGGACTGTGAGCGGTGCCAGGCCAAGGGCTTCGTGTGTGAGCTCTGCAGAGAGGGTGATGTGCTGTTCCCATTCGACAGCCACACATCTGTGTGCACAGACTGCTCAGCCGTCTTCCACAGGGATTGCTACTATGACAACTCCACCACATGCCCCAAGTGTGCCCGGCTCAACTTGAGGAAGCAGTCCCTCTTCCAGGAGCCTGGTCCAGACATGGATGCCTAG

XM_004842610.1 Coding sequence

Def8 differentially expressed in FDCP 8 homolog (mouse), transcript variant X2

Length: 1356 bp    Location: 119035..103890   Strand: -
>XM_004842610.1
ATGGAATATAATGAGAAGCTGGCCCGGTTCCGGCAAGCCCACCTCAACCCCTTCAACAAGCAGCTTGGGGCAGGGCAGCATGAGCAGGGAGCCGCTCAGGAGGCTCTGGAGATCAGCTCTGAAGAGATCCTGCCTGAGCTGCGCCCTGGGGAGCCTGAGTTCTGCTGCTCTGAGCGTGTGATGGATCTTGGCCTGTCTGAGGACCACTTCTCTCGCCCTGTGGGTCTGTTCCTGGCCTCTGATGTCCAGCAGCTTCGGCAAGCGATTGAGGAATGTAAGCAGGTGATTCTGGAGCTGCCTGAGCAGTCAGAGAGGCAGAAGGATGCTGTGGTGAGGCTCATCCACCTCCGGCTGAAGCTGCAGGAGCTGAAGGACCCCAATGAGGATGAGCCCAATATCCGAGTCCTCCTAGAGCACCGCTTCTACAAGGAGAAGAGCAAAAGTGTCAAGCAGACCTGTGACAAGTGCAACACCATCATCTGGGGGCTCATTCAGACCTGGTACACCTGCACAGGCTGCTATTACCGCTGCCACAGCAAGTGCTTGAACCTCATCTCCAAGCCCTGTGTGAGCTCCAAGGTTAGCCACCAGGCCGAGTACGAGCTGAACATCTGCCCCGAGACGGGGCTGGACAGCCAGGATTACCGCTGTGCCGAGTGCCGGGCGCCCATCTCTCTGCGGGGCGTGCCCAGTGAGGCCCGACAGTGTGACTACACGGGCCGGTACTACTGCAGCCACTGCCACTGGAACGACCTGGCTGTTATCCCTGCACGCGTCGTGCACAACTGGGACTTCGAGCCGCGCAAGGTGTCTCGCTGCAGCATGCGCTACCTGGCTCTGATGGTGTCGAGGCCGGTGCTCCGGCTGCGGGAGATCAACCCCCTGCTGTTCAACTATGTGGAGGAGCTGGTGGAGATCCGGAAGTTGCGCCAGGACATCCTGCTCATGAAGCCATACTTCATCACTTGCAAGGAGGCCATGGAAGCCCGGCTGCTGCTGCAGCTCCAGGACCGACAGCATTTTGTGGAGAACGACGAGATGTACTCCATCCAGGACCTGCTGGATGTGCATTTGGGCCGCCTTGGCTGCTCTCTCACCGAGATCCACACGCTCTTTGCCAAGCATATCAAGCTGGACTGTGAGCGGTGCCAGGCCAAGGGCTTCGTGTGTGAGCTCTGCAGAGAGGGTGATGTGCTGTTCCCATTCGACAGCCACACATCTGTGTGCACAGACTGCTCAGCCGTCTTCCACAGGGATTGCTACTATGACAACTCCACCACATGCCCCAAGTGTGCCCGGCTCAACTTGAGGAAGCAGTCCCTCTTCCAGGAGCCTGGTCCAGACATGGATGCCTAG

XM_004842616.1 Coding sequence

Tubb3 tubulin, beta 3 class III, transcript variant X2

High confidence: 4 potential gene matches
Length: 1353 bp    Location: 130499..124014   Strand: -
>XM_004842616.1
ATGAGGGAGATTGTGCACATCCAGGCCGGCCAGTGTGGCAACCAGATCGGGGCCAAGTTCTGGGAGGTTATCAGCGATGAGCATGGCATAGACCCCAGCGGCAACTACGTGGGGGACTCGGACCTGCAACTGGAGCGCATCAGTGTCTACTACAATGAGGCCTCCTCTCACAAGTATGTGCCTCGAGCCATCCTGGTGGACCTGGAGCCTGGGACCATGGACAGCGTTCGGTCGGGGGCCTTTGGGCACCTCTTCCGGCCGGACAACTTCATCTTTGGTCAGAGTGGTGCTGGCAACAACTGGGCGAAGGGCCACTACACAGAGGGCGCGGAGCTGGTGGACTCGGTCCTGGACGTGGTGCGGAAGGAGTGTGAGAACTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTGGGTGGCGGCACGGGCTCGGGCATGGGCACCCTGCTCATCAGCAAGGTGCGCGAGGAGTACCCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACCGTGGTGGAGCCCTACAACGCCACCCTGTCCATCCACCAGCTGGTGGAGAACACCGACGAGACCTACTGCATCGACAACGAGGCGCTGTACGACATCTGCTTCCGCACCCTCAAGCTGGCCACGCCCACCTACGGGGACCTCAACCATCTGGTGTCGGCCACCATGAGCGGCGTCACCACCTCCCTGCGCTTCCCGGGCCAGCTCAATGCCGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCCCGCCTGCACTTCTTCATGCCCGGCTTTGCCCCGCTCACTGCCCGGGGCAGCCAGCAGTACCGCGCCCTCACGGTACCTGAGCTCACCCAGCAAATGTTTGACGCCAAGAACATGATGGCCGCCTGTGACCCGCGCCATGGCCGCTACCTGACAGTGGCCACCGTCTTCCGGGGCCGCATGTCCATGAAGGAGGTGGACGAGCAGATGCTGGCCATCCAGAGCAAGAACAGCAGCTACTTCGTGGAGTGGATCCCCAACAACGTCAAGGTGGCCGTGTGCGACATCCCGCCTCGTGGGCTCAAAATGTCCTCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCGGAGCAGTTCACAGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTGGTATCCGAGTACCAGCAGTACCAGGACGCCACGGCCGAGGAGGAGGGCGAGATGTATGAAGACGACGACGAGGAATCTGAGGCCCAGGGCCCCAAGTGA

XM_004842615.1 Coding sequence

Tubb3 tubulin, beta 3 class III, transcript variant X1

Length: 1437 bp    Location: 126474..124014   Strand: -
>XM_004842615.1
ATGCAGACAACACAAGGCTCTTTCTGGAGCCCCTCGATGAGGCCAGCGGAGCCCAGGCGTGAATTTTATGCCAAGGGCTGTGAAGCTGCAGGGAGGAAAGGTTTTTGTGGCCACCCACCAACTTCTCCATCTGTGTTGCAGTTCTGGGAGGTTATCAGCGATGAGCATGGCATAGACCCCAGCGGCAACTACGTGGGGGACTCGGACCTGCAACTGGAGCGCATCAGTGTCTACTACAATGAGGCCTCCTCTCACAAGTATGTGCCTCGAGCCATCCTGGTGGACCTGGAGCCTGGGACCATGGACAGCGTTCGGTCGGGGGCCTTTGGGCACCTCTTCCGGCCGGACAACTTCATCTTTGGTCAGAGTGGTGCTGGCAACAACTGGGCGAAGGGCCACTACACAGAGGGCGCGGAGCTGGTGGACTCGGTCCTGGACGTGGTGCGGAAGGAGTGTGAGAACTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTGGGTGGCGGCACGGGCTCGGGCATGGGCACCCTGCTCATCAGCAAGGTGCGCGAGGAGTACCCCGACCGCATCATGAACACCTTCAGCGTGGTGCCCTCGCCCAAGGTGTCGGACACCGTGGTGGAGCCCTACAACGCCACCCTGTCCATCCACCAGCTGGTGGAGAACACCGACGAGACCTACTGCATCGACAACGAGGCGCTGTACGACATCTGCTTCCGCACCCTCAAGCTGGCCACGCCCACCTACGGGGACCTCAACCATCTGGTGTCGGCCACCATGAGCGGCGTCACCACCTCCCTGCGCTTCCCGGGCCAGCTCAATGCCGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCCCGCCTGCACTTCTTCATGCCCGGCTTTGCCCCGCTCACTGCCCGGGGCAGCCAGCAGTACCGCGCCCTCACGGTACCTGAGCTCACCCAGCAAATGTTTGACGCCAAGAACATGATGGCCGCCTGTGACCCGCGCCATGGCCGCTACCTGACAGTGGCCACCGTCTTCCGGGGCCGCATGTCCATGAAGGAGGTGGACGAGCAGATGCTGGCCATCCAGAGCAAGAACAGCAGCTACTTCGTGGAGTGGATCCCCAACAACGTCAAGGTGGCCGTGTGCGACATCCCGCCTCGTGGGCTCAAAATGTCCTCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCGGAGCAGTTCACAGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTGGTATCCGAGTACCAGCAGTACCAGGACGCCACGGCCGAGGAGGAGGGCGAGATGTATGAAGACGACGACGAGGAATCTGAGGCCCAGGGCCCCAAGTGA

XM_004842623.1 Coding sequence

Vps9d1 VPS9 domain containing 1, transcript variant X2

Length: 1974 bp    Location: 267584..277225   Strand: +
>XM_004842623.1
ATGTTACTGAAAAATGATCAGACACCACTGCTCCTGCTCCCACAGGAGCACTGGGCAGGTTTGATGCAACCATTCACCTCTGCTGGCCTGAGCTCCAGCATTTTTCTTCCCCGGACACAGGAGGCATACACAGAATACCTGAGGAGCGTTCACTACATCTCCCAGGTGCTACTGGAGGAAGTGGAATCAACTAAAGCCTGGGAAATAGTGGCCCCTGACACTTCAAAGATGCTGAAGCTGGCGGAGCAGTGTCTGGAGCGGGCCCGGTCAACAGCTGCCAAGCTCGGGAAGACACGCCAGAAGCCAGCGGTACCCATGGCTGCTACGGCGCCACCTATTGGCCGACACCGCAGAGTGTGCTCCGATGAAGGAGGGAAGCTCTCTCCTTTCGTGCCGCCTGAGATCTTCCAGAAGCTTCAGGCAGTCGAGTCCCAAAACTCTAAGAAGGAACTGACACCACTGGAGGAGGCCTCCCTGCAGAACCAGAAACTGAAGGCCACCTACGAGGCCCGGATGGCCCGTCTGGACCCCAGCCAGGCCACACAGAAGACGTCGCTGACCCTGTCTCTGCAGCGGCAGATGATGGAGAACCTGGTGATCGCCAGAGCCCGCGAGGAGACGCTGCAGCGGAAGATGGAGGAACGCCGGCTGCGGCTCCAGGAGGCCGCCAACAGGAAGTTCTGTAGTCAGGTCGCCTTGACCCCCGAGGAGCGAGAACAGAGGGCCCTCTATGCAGCCATCCTTGAGTACGAGCAAGACCATGATTGGCCGAAGCACTGGAGGGCCAAACTCAAGAGGAGCCCAGGGGACCTATCTCTGGTGACCAGCCTGGTCTCACACCTGCTCAGCCTTCCTGACCACCCGATCTCGCAGCTGCTGAAGAAACTGCAGTGTGCAGTGTACAAGGCACTGTATCCCGTTGTGAGCCATGGCGCTATTGGTGCTATGTCTGCCCCAGGATGCTGCTCCCTGCCCTCGGATGCTGACAGGCTGCTGGCTCCTGGGAGCCGGCGCCTCCGCTCCTCCCAGAGCCTGTACTGCATGTTGTCACCCCCAGAGCCCAATGTGGCCCCACAGCCCCAGGATGGACCCCTTGACACCCCCCTACTTCTCCCCGGGACCCTGGAGAGAGGGACAGATGGCAGCCCAGCCAGGCCCCCCTCACCCTTGGTAGATACTTTGTCCTACCTGCCGGACAAGGACAGCTCCTTCGAGGACCTGGAGCAGTTCCTGGCTACATCAGAGAGGTGGAGCTGGGGCTCCGGGCCACAGGTGACACAGAGGGAGCCCTTGCTGGAGTGTCTGAAGAGCACAGTGAAGGACATTCACAATGCCATCGACAGGCTGCTCTCGCTGACCCTCCTGGCCTTTGAGAGCCTGAACACAGCTGCCTGCAAAGACCGTTGCCTGGCCTGCCTCGAGGAGCCCTTCTTCTCCCCACTGTGGCCTCTGCTGCTGGCCCTGTACAGGAGCGTGCACCATGCTCGGGAGGCCGCCCTGAGCAGGAGCATGGAGCTCTACCGGAACGCACCCCCCACAGCCCTGGGTATCCCCACCAAGCTCCTCCCCCAGGAACCGGAGGCCAAGGGGGGTGCCAGCTACCCCTACTGCAGCGCGGCCCAGGAGCTGGGGCTGCTGGTCCTGGAGAGCTGCCCGCAGAAGAAGCTGGGCTGCATCGTGAGGACCCTGCGGGTCATCTGTGTCTGTGCTGAAGACTACTGCCGTGCCCAGGAGCCCACGCCTGAGGCCAGACCCCAAACCCCTGCAGCTGCCATTGGTGCGGATGACTTGCTGCCCATCTTGTCCTTTGTGGTACTGAGGAGCGGCCTTCCCCAGCTGGTATCAGAATGCGCAGCCCTGGAGGAATTCACCCATGAGGGATACCTGATTGGAGAGGAAGGTTACTGCCTGACGTCACTGCAGAGTGCCTTGAACTACGTGGAGCTGCTGCCACAGGGGGCCCTGGGCAAGTAG

XM_004842622.1 Coding sequence

Vps9d1 VPS9 domain containing 1, transcript variant X1

High confidence: 4 potential gene matches
Length: 1977 bp    Location: 267585..277225   Strand: +
>XM_004842622.1
ATGTTACTGAAAAATGATCAGACACCACTGCTCCTGCTCCCACAGGAGCACTGGGCAGGTTTGATGCAACCATTCACCTCTGCTGGCCTGAGCTCCAGCATTTTTCTTCCCCGGACACAGGAGGCATACACAGAATACCTGAGGAGCGTTCACTACATCTCCCAGGTGCTACTGGAGGAAGTGGAATCAACTAAAGAAGCCTGGGAAATAGTGGCCCCTGACACTTCAAAGATGCTGAAGCTGGCGGAGCAGTGTCTGGAGCGGGCCCGGTCAACAGCTGCCAAGCTCGGGAAGACACGCCAGAAGCCAGCGGTACCCATGGCTGCTACGGCGCCACCTATTGGCCGACACCGCAGAGTGTGCTCCGATGAAGGAGGGAAGCTCTCTCCTTTCGTGCCGCCTGAGATCTTCCAGAAGCTTCAGGCAGTCGAGTCCCAAAACTCTAAGAAGGAACTGACACCACTGGAGGAGGCCTCCCTGCAGAACCAGAAACTGAAGGCCACCTACGAGGCCCGGATGGCCCGTCTGGACCCCAGCCAGGCCACACAGAAGACGTCGCTGACCCTGTCTCTGCAGCGGCAGATGATGGAGAACCTGGTGATCGCCAGAGCCCGCGAGGAGACGCTGCAGCGGAAGATGGAGGAACGCCGGCTGCGGCTCCAGGAGGCCGCCAACAGGAAGTTCTGTAGTCAGGTCGCCTTGACCCCCGAGGAGCGAGAACAGAGGGCCCTCTATGCAGCCATCCTTGAGTACGAGCAAGACCATGATTGGCCGAAGCACTGGAGGGCCAAACTCAAGAGGAGCCCAGGGGACCTATCTCTGGTGACCAGCCTGGTCTCACACCTGCTCAGCCTTCCTGACCACCCGATCTCGCAGCTGCTGAAGAAACTGCAGTGTGCAGTGTACAAGGCACTGTATCCCGTTGTGAGCCATGGCGCTATTGGTGCTATGTCTGCCCCAGGATGCTGCTCCCTGCCCTCGGATGCTGACAGGCTGCTGGCTCCTGGGAGCCGGCGCCTCCGCTCCTCCCAGAGCCTGTACTGCATGTTGTCACCCCCAGAGCCCAATGTGGCCCCACAGCCCCAGGATGGACCCCTTGACACCCCCCTACTTCTCCCCGGGACCCTGGAGAGAGGGACAGATGGCAGCCCAGCCAGGCCCCCCTCACCCTTGGTAGATACTTTGTCCTACCTGCCGGACAAGGACAGCTCCTTCGAGGACCTGGAGCAGTTCCTGGCTACATCAGAGAGGTGGAGCTGGGGCTCCGGGCCACAGGTGACACAGAGGGAGCCCTTGCTGGAGTGTCTGAAGAGCACAGTGAAGGACATTCACAATGCCATCGACAGGCTGCTCTCGCTGACCCTCCTGGCCTTTGAGAGCCTGAACACAGCTGCCTGCAAAGACCGTTGCCTGGCCTGCCTCGAGGAGCCCTTCTTCTCCCCACTGTGGCCTCTGCTGCTGGCCCTGTACAGGAGCGTGCACCATGCTCGGGAGGCCGCCCTGAGCAGGAGCATGGAGCTCTACCGGAACGCACCCCCCACAGCCCTGGGTATCCCCACCAAGCTCCTCCCCCAGGAACCGGAGGCCAAGGGGGGTGCCAGCTACCCCTACTGCAGCGCGGCCCAGGAGCTGGGGCTGCTGGTCCTGGAGAGCTGCCCGCAGAAGAAGCTGGGCTGCATCGTGAGGACCCTGCGGGTCATCTGTGTCTGTGCTGAAGACTACTGCCGTGCCCAGGAGCCCACGCCTGAGGCCAGACCCCAAACCCCTGCAGCTGCCATTGGTGCGGATGACTTGCTGCCCATCTTGTCCTTTGTGGTACTGAGGAGCGGCCTTCCCCAGCTGGTATCAGAATGCGCAGCCCTGGAGGAATTCACCCATGAGGGATACCTGATTGGAGAGGAAGGTTACTGCCTGACGTCACTGCAGAGTGCCTTGAACTACGTGGAGCTGCTGCCACAGGGGGCCCTGGGCAAGTAG

XM_004842632.1 Coding sequence

Cdk10 cyclin-dependent kinase 10, transcript variant X3

Length: 945 bp    Location: 291068..285399   Strand: -
>XM_004842632.1
ATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCCTGCGGGAGATCACGCTGCTCCTGCGCCTACGCCACCCCAACATCGTGGAGCTGAAGGAGGTGGTGGTGGGGAACCACCTGGAGAGCATCTTCCTGGTGATGGGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAAAACATGCCCACTCCTTTCTCTGAGGCCCAGGTCAAGTGCATTGTGCTGCAGGTGCTCCGGGGACTCCAGTACCTGCACAGGAACTTCATCATCCACAGGGACCTGAAGGTCTCCAATCTGCTCATGACTGACAAGGGCTGTGTGAAGACAGCGGACTTTGGCCTGGCCCGGGCCTCTGGGGTCCCAATGAAGCCAGTGACTCCCAAGGTGGTCACCCTCTGGTACCGTGCCCCTGAGCTGCTGCTGGGAACTACGACCCAGACCACCAGCATCGACATGTGGGCCGTGGGCTGCATCCTGGCTGAGCTGTTGGCCCACAAGCCCCTGCTCCCTGGCACATCTGAGATCCACCAGGTTGACCTGATTGTGCAGCTGCTGGGGACGCCCAGCGAGAACATCTGGCCGGGCTTTTCCAAACTGCCACTGGTCAGCCAGTACAGCCTGAGGAAGCAGCCATACAACAACCTCAAGCACAAGTTCCCATGGCTCTCGGAGGCTGGGCTGCGTCTGCTGAATTTCCTCTTCATGTATGATCCCAAGAAAAGGGCAACAGCGGGGGACTGCTTGGAGAGCTCTTATTTCAAGGAGAAGCCCCTGCGTGAGTTCCTCACTCCCTCAGGGGCAGAATGCTGGGGCTGGGTGGCAGCCCTGGGTGCCTGTGTAGACCTGGGGGAGGGGGGAGCTGATACAGGGCTGGGTATCCGGGGCAGCCAGGCTGGGCTTCGGTGCACGGGGGTTCAGACCTGGAGTGCACCCCCAGCCCAGCACTGA

XM_004842633.1 Coding sequence

Cdk10 cyclin-dependent kinase 10, transcript variant X4

Length: 945 bp    Location: 290966..285399   Strand: -
>XM_004842633.1
ATGGACAAGGAGAAGGATGGCATCCCCATCAGCAGCCTGCGGGAGATCACGCTGCTCCTGCGCCTACGCCACCCCAACATCGTGGAGCTGAAGGAGGTGGTGGTGGGGAACCACCTGGAGAGCATCTTCCTGGTGATGGGTTACTGTGAGCAGGACCTGGCCAGCCTCCTGGAAAACATGCCCACTCCTTTCTCTGAGGCCCAGGTCAAGTGCATTGTGCTGCAGGTGCTCCGGGGACTCCAGTACCTGCACAGGAACTTCATCATCCACAGGGACCTGAAGGTCTCCAATCTGCTCATGACTGACAAGGGCTGTGTGAAGACAGCGGACTTTGGCCTGGCCCGGGCCTCTGGGGTCCCAATGAAGCCAGTGACTCCCAAGGTGGTCACCCTCTGGTACCGTGCCCCTGAGCTGCTGCTGGGAACTACGACCCAGACCACCAGCATCGACATGTGGGCCGTGGGCTGCATCCTGGCTGAGCTGTTGGCCCACAAGCCCCTGCTCCCTGGCACATCTGAGATCCACCAGGTTGACCTGATTGTGCAGCTGCTGGGGACGCCCAGCGAGAACATCTGGCCGGGCTTTTCCAAACTGCCACTGGTCAGCCAGTACAGCCTGAGGAAGCAGCCATACAACAACCTCAAGCACAAGTTCCCATGGCTCTCGGAGGCTGGGCTGCGTCTGCTGAATTTCCTCTTCATGTATGATCCCAAGAAAAGGGCAACAGCGGGGGACTGCTTGGAGAGCTCTTATTTCAAGGAGAAGCCCCTGCGTGAGTTCCTCACTCCCTCAGGGGCAGAATGCTGGGGCTGGGTGGCAGCCCTGGGTGCCTGTGTAGACCTGGGGGAGGGGGGAGCTGATACAGGGCTGGGTATCCGGGGCAGCCAGGCTGGGCTTCGGTGCACGGGGGTTCAGACCTGGAGTGCACCCCCAGCCCAGCACTGA

XM_004842641.1 Coding sequence

Spg7 spastic paraplegia 7 (pure and complicated autosomal recessive), transcript variant X2

Length: 2358 bp    Location: 377935..345038   Strand: -
>XM_004842641.1
ATGGCTGCCGTGTTGCTGCTGCTGCGCATCCTCCGTCAAGGCCCGGGGCCGGGTCCCGGGCGCCTGTGGGGCCTAGGCTCAGGCCTCTTCTTCGGGCCTGCGAGCAGGCCATACGTGGTCTGCAGGCCTCCGTTGGGTGTCGCCGGGGCGGGAGGCCGAGCTCTTCAGAGTTTGCAATCGAGAATGCTAACACCTGCCTTTGAAGGGATTGCTGGACTGTTACTGAAACAGTATCTCATTCAAAATCCAGTGGGACTCTGGCGACTTTTAGGTGGTACTTACTATTTTACTACTTCAAGAATGAGGCAGAAGAATAAAGACAATGATAAATCCAAAGGGAAGGCCCCTGGAGATGATGAAGAGGAGAGGCAGCGCAAGGAGCGAGAGGACCAGATGTACCGTGAGCGGCTGCGCACGCTGTTGGTCATCGCTGTGGTCATGAGCCTGCTAAACTCGCTCAGCTCCAGCGGTGGCAACATCTCCTGGAACGACTTCGTCAGCGAGATGCTGGCCAAGGGCGAGGTGCAGCGTGTGCAGGTGGTGCCCGAGAGTGACGTGGTGGAGGTCTACCTGCACCCGGGGGCCGTGGTGTTTGGACGGCCGCGGCTGTCCTTGGTGTACCGGATGCAGGTGGCAAATATCGACAAATTTGAGGAGAAGCTCCGTGCGGCTGAGGATGAGCTGAACATCGAGAGCAAAGACAGGATCCCAGTCTCCTACAAGCGCACAGGGTTCTTTGGGAATGCCCTCTATGCCCTGGGGATGACAGCCGTGGGCCTGGCCATCCTGTGGTACATGTTCCGCCTGGCTGGGATGACAGGAAGAGAAGGTGGATTCAGCGCGTTCAATCAGCTGAAGATGGCTCGCTTCACGATGGTGGACGGAAAGTCAGGGAAAGGAGTCAGCTTCAAAGATGTGGCTGGAATGCACGAGGCCAAGCTGGAGGTCCGGGAGTTCGTGGATTATCTGAAGAGCCCCGAGCGCTTCCTCCAGCTTGGAGCCAAGGTCCCAAAGGGCGCACTGCTGCTCGGGCCCCCAGGCTGTGGGAAGACGCTGCTGGCCAAGGCGGTGGCCACCGAGGCCCAGGTGCCCTTCTTGGCGATGGCTGGCCCGGAGTTCGTGGAGGTTGTCGGAGGCCTGGGTGCTGCCCGCGTACGCAGCCTCTTCAAGGAAGCCCGGGCCCGGGCCCCGTGCATAGTGTACATCGACGAGATCGATGCTGTGGGGAAGAAGCGCTCCACCTCCAAGTCTGGCTTCTCCAACACGGAGGAGGAGCAGACCCTCAACCAGCTCCTGGTGGAGATGGATGGAATGGGCACCACAGACCACGTCATCGTCCTGGCGTCCACAAACCGAGCTGACATCCTGGACAGCGCTCTGATGAGGCCTGGCCGCCTCGACCGGCATGTCTTCATCGATCTTCCCACCCTGCAGGAGCGGCGAGAGATTTTCGAACAGCACCTGAAAGGCCTGAAGCTGACCCAGGAGAGCAGATTTTACTCACAGCGGCTGGCAGAGCTGACGCCAGGATTCAGTGGTGCTGACATCGCCAACATCTGCAATGAGGCTGCACTGCATGCCGCCCGGGAGGGGCACTCATCCGTGCACACGCTGGACTTCGAGTATGCTGTGGAGCGGGTCGTGGCAGGGACGGCCAAAAAGAGCAAGGTCCTCTCCAGGGAGGAGCAGAGGGCTGTGGCCTTTCACGAGTCGGGCCATGCCCTGGTGGGCTGGCTGCTGGAGCACACAGAAGCTGTGATGAAGGTCTCCATTGCACCTCGGACGAACGCCGCACTGGGTTTCTCGCAGATGCTGCCCCGAGACCAGCATCTCTTCACCACCGAGCAGCTGTTTGAGCGCATGTGCATGGCCCTGGGCGGCCGTGCAGCCGAGGCCATCTCCTTCAGCCGGGTTACTTCTGGGGCCCAGGATGACCTGAGGAAGGTCACGCGCATTGCCTACTCCATGGTGAAGCAGTTCGGGATGGTGCCCAGCATTGGGCCTGTCTCCTTTCCTGAGGCACAGGAGGGCCTCATGGACATCGGACGGCGCCCCTTCAGCCAGGGCCTCCAGCAGATGATGGACCATGAGGCGAAGCTGCTGGTGGCCAAGGCCTACAGGCACACGGAGAAGGTGCTTCTGGACAACCTGGACAAGCTGCAGGCACTGGCGAATGCCCTCCTGCAAAAGGAAGTGATAAACTATGAGGACATTGAGGCCCTCATTGGCCCACCGCCCCACGGGCCCAAAAAAATGATAGCACCACAGAAGTGGATTGATGCCCAAAGTGAGAGCCAAGAGGCTGGGGAGGAGGAGGCCGCCCCACTGCCCCCCCTGCACGGGGAGGAGCTCTCCTGA

XM_004842640.1 Coding sequence

Spg7 spastic paraplegia 7 (pure and complicated autosomal recessive), transcript variant X1

High confidence: 4 potential gene matches
Length: 2364 bp    Location: 377935..345038   Strand: -
>XM_004842640.1
ATGGCTGCCGTGTTGCTGCTGCTGCGCATCCTCCGTCAAGGCCCGGGGCCGGGTCCCGGGCGCCTGTGGGGCCTAGGCTCAGGCCTCTTCTTCGGGCCTGCGAGCAGGCCATACGTGGTCTGCAGGCCTCCGTTGGGTGTCGCCGGGGCGGGAGGCCGAGCTCTTCAGGTAAAGAGTTTGCAATCGAGAATGCTAACACCTGCCTTTGAAGGGATTGCTGGACTGTTACTGAAACAGTATCTCATTCAAAATCCAGTGGGACTCTGGCGACTTTTAGGTGGTACTTACTATTTTACTACTTCAAGAATGAGGCAGAAGAATAAAGACAATGATAAATCCAAAGGGAAGGCCCCTGGAGATGATGAAGAGGAGAGGCAGCGCAAGGAGCGAGAGGACCAGATGTACCGTGAGCGGCTGCGCACGCTGTTGGTCATCGCTGTGGTCATGAGCCTGCTAAACTCGCTCAGCTCCAGCGGTGGCAACATCTCCTGGAACGACTTCGTCAGCGAGATGCTGGCCAAGGGCGAGGTGCAGCGTGTGCAGGTGGTGCCCGAGAGTGACGTGGTGGAGGTCTACCTGCACCCGGGGGCCGTGGTGTTTGGACGGCCGCGGCTGTCCTTGGTGTACCGGATGCAGGTGGCAAATATCGACAAATTTGAGGAGAAGCTCCGTGCGGCTGAGGATGAGCTGAACATCGAGAGCAAAGACAGGATCCCAGTCTCCTACAAGCGCACAGGGTTCTTTGGGAATGCCCTCTATGCCCTGGGGATGACAGCCGTGGGCCTGGCCATCCTGTGGTACATGTTCCGCCTGGCTGGGATGACAGGAAGAGAAGGTGGATTCAGCGCGTTCAATCAGCTGAAGATGGCTCGCTTCACGATGGTGGACGGAAAGTCAGGGAAAGGAGTCAGCTTCAAAGATGTGGCTGGAATGCACGAGGCCAAGCTGGAGGTCCGGGAGTTCGTGGATTATCTGAAGAGCCCCGAGCGCTTCCTCCAGCTTGGAGCCAAGGTCCCAAAGGGCGCACTGCTGCTCGGGCCCCCAGGCTGTGGGAAGACGCTGCTGGCCAAGGCGGTGGCCACCGAGGCCCAGGTGCCCTTCTTGGCGATGGCTGGCCCGGAGTTCGTGGAGGTTGTCGGAGGCCTGGGTGCTGCCCGCGTACGCAGCCTCTTCAAGGAAGCCCGGGCCCGGGCCCCGTGCATAGTGTACATCGACGAGATCGATGCTGTGGGGAAGAAGCGCTCCACCTCCAAGTCTGGCTTCTCCAACACGGAGGAGGAGCAGACCCTCAACCAGCTCCTGGTGGAGATGGATGGAATGGGCACCACAGACCACGTCATCGTCCTGGCGTCCACAAACCGAGCTGACATCCTGGACAGCGCTCTGATGAGGCCTGGCCGCCTCGACCGGCATGTCTTCATCGATCTTCCCACCCTGCAGGAGCGGCGAGAGATTTTCGAACAGCACCTGAAAGGCCTGAAGCTGACCCAGGAGAGCAGATTTTACTCACAGCGGCTGGCAGAGCTGACGCCAGGATTCAGTGGTGCTGACATCGCCAACATCTGCAATGAGGCTGCACTGCATGCCGCCCGGGAGGGGCACTCATCCGTGCACACGCTGGACTTCGAGTATGCTGTGGAGCGGGTCGTGGCAGGGACGGCCAAAAAGAGCAAGGTCCTCTCCAGGGAGGAGCAGAGGGCTGTGGCCTTTCACGAGTCGGGCCATGCCCTGGTGGGCTGGCTGCTGGAGCACACAGAAGCTGTGATGAAGGTCTCCATTGCACCTCGGACGAACGCCGCACTGGGTTTCTCGCAGATGCTGCCCCGAGACCAGCATCTCTTCACCACCGAGCAGCTGTTTGAGCGCATGTGCATGGCCCTGGGCGGCCGTGCAGCCGAGGCCATCTCCTTCAGCCGGGTTACTTCTGGGGCCCAGGATGACCTGAGGAAGGTCACGCGCATTGCCTACTCCATGGTGAAGCAGTTCGGGATGGTGCCCAGCATTGGGCCTGTCTCCTTTCCTGAGGCACAGGAGGGCCTCATGGACATCGGACGGCGCCCCTTCAGCCAGGGCCTCCAGCAGATGATGGACCATGAGGCGAAGCTGCTGGTGGCCAAGGCCTACAGGCACACGGAGAAGGTGCTTCTGGACAACCTGGACAAGCTGCAGGCACTGGCGAATGCCCTCCTGCAAAAGGAAGTGATAAACTATGAGGACATTGAGGCCCTCATTGGCCCACCGCCCCACGGGCCCAAAAAAATGATAGCACCACAGAAGTGGATTGATGCCCAAAGTGAGAGCCAAGAGGCTGGGGAGGAGGAGGCCGCCCCACTGCCCCCCCTGCACGGGGAGGAGCTCTCCTGA

XM_004843206.1 Coding sequence

unclassified transcription discrepancy mRNA

Length: 1752 bp    Location: 600887..604740   Strand: +
>XM_004843206.1
ATGGAGCGCGAGGAACGGGCGCTGCGCGCTGCGGGCGGCTTCGGCCGGGCCCGGCGCCTGCTGGCCGTGGCGTCGTGGCTGCCGTGTGTGGCGCTGGGGCTGGCGCTGAGCTCCGACCTGCTGCTCACGGCGCGGCCCGCGCTGCTGTCCCCCGCGCTCGCGCCCAGCCCCTGCCCGCTGCTGCGCTACCCCGCGGCGCCCACGGCCCCCTTGCCCGACGGCACGCGGCCCTGCACGCGAGGCTGGCTCTACGCGCTGCCCGTCGCTGGCCTCTGGCGCAGCCCGGTCATCCAGGTGGGCGCCGGTCCCCGGCGGGGGCGATGGTCGCCGGGGCGGCCGGGCCGCGGGGTGGGGGCACGGACGAGGTCGCCCAGCCAAGCGCGGCCAGGCCTTTGCCCCACCACCGTCCGCGCTGGCCGAGAGTGCCCACCTGCTGTCTCTGGGCCCTGGCACCAGCCCGGCCGCCTCCGCGCCCCACCCGCAGCTTGCACGTGGGACCTCGTGTGTGGGGATGGCTGGAAGGTCCCCCTGCAGCACACGGGCCACCTCCTGGGCTGCCTGCTGGGCGCGGTGCTCCCGGGTGCTGGCTGCGACAGGGGAGCCCTGTTTGGCCGCCGGGCTGTTTTTGTGTCCTCCCTGGTCCTGGCCACTGTCCTTGGGGCCAGCAAGGCCCTGGCTGCCAGTTTCCCTGCCCTCCTGGCCCTGCGGCTGCTCCACGGGGGCGCCCTGGTAGGGGCCTCCCTGGCCCTCTCTGTGGCGCGCCTGGAGCTGTGTGACCCCGTGCACCGCCTGGCCTTCTCCTCGGGTGCCAGCCTCNTGCTGGGTGCACTACTGCTGCCCAGGCTGGCCGTGTTGGCACAGGACTGGCGCCTTCTGCAGGGGCTGATTGCTCTGGTGACCGGGCTCCTGCTGCTCTTTTGGGGGTTCCCAGCCCTGTTTCCCAAGTCTCCCTGCTGGCTGCTGGCCACGGGACAGGTGGCCCAGGCCAGGAGGATCCTGTGGCACTTCGCGGAAGCCAGCGGTGTGGACCCTGAGCAGGGCTCCCTGGAGGACAGCTCCCTGGCTACAGCCACAGAGCTGGCCGAGTTGGCTACAGGCAGCACCCAGCCTCGGTACCACTCGGTCCTGGGCCTCCTGCACAGCCACGTCACCTGGAGAAACACGCTCATCCTGGGCATCAGCTCGCTGGTTGGCGGGGGCATCCGAGCCAGCTTCCTGCGCAGCCTGGCCCCATGAGAGACATCCTTCTACCTGCCCTATTTCCCGGAGGCCGGCCTGGAGGCCACAGCCATCATCTGCTTGCTCCTGACTGCTGATCGCTGGGGTCGCCGCCTCATCCTGCTGCTGGGCACCCTGGTCACAGGCCTGGCATCCCTGCTGCTGCTTGCTGGGGCTCAGTACCTGCCAGGCTGGATCTCGCTGCCCCTGTCGGTCCTGGGCCTCCTGGCCTCCCAGACCATGTCGGTGCTCAGCAGCCTCTTTGTGGCTGAGGCCTGCCCCACGGTAATCAGGGGCGCTGCGCTGGGCCTCGTGCTGGGCGCCAGGTCCCTGGGCCAGGCAGCTGCGCCCCTCACGGAGATGGCCGGCCAGCGGGGCTTCTTCCTGCAGCACACGGTGCTGGCCTCCGTGGCCATCCTCGCCCTGCTCTGTATCCTGCTGCTGCCCGAGACCTGCGGCCGAGCACTGCCTGTGTCGCTGGAGGATGCCGACCGCCCCCAGGACCGCCTGCCCCTTCTGCGGCCCTCCCACTGA

XM_004842651.1 Coding sequence

Cdh15 cadherin 15, type 1, M-cadherin (myotubule), transcript variant X1

High confidence: 4 potential gene matches
Length: 2358 bp    Location: 617582..604894   Strand: -
>XM_004842651.1
ATGGACACCGCGCTCCTCCTGGCCCTCGGGCTGCTGGCACAGAGCCTTGGCTTGTCCTGGGGGGTCCCCAGGCGCCCCAGCACCCTGTACCCCTGGCGCCGGCCACCTGCACTGGGCCGAGTTCGGAGAGCCTGGGTCATCCCACCCATTAGCGTGTCAGAGAACTACAAGGGCCTGCCCTACATGCTGGTGCAGATCCGGTCCGACAAGCGGCAGCCAGGCGGGGTCATCTACAGCATCCAGGGCCCCGGTGTGGATGAGGAGCCCCTGGGCCTCTTCTCTGTGGAGAAGTTCTCAGGGCGGGTGTTCCTCAACGCGGAGCTGGACCGGGAGAAGACGTCCTCCTACAGGCTCAAGGTCTTTGCCCTGGACCGGGGAGGGTCTGTCCTGGAGGAGCCCACTGACCTGGAGATCGTGGTTGTGGATCAGAACGACAACCGGCCAGCCTTCGTGCAGGAGGTGTTCGCTGGCCGCGTGCTGGAAGGCGCAGCCCCAGGCACCTATGTGACCCGGGCCGAGGCCACCGACGCCGATGACCCAGACACAGACAATGCGGCGCTGCACTACTCCATCCTGGCACAGGGGAGCCCCGAGCTCTTCAGCATCCATGAGCGCACGGGCGAGATCCGCACTGTACACGTGGGGCTGGACCGTGAGGCGGTCACCACGTACAACCTGACGCTGCAGGTGGCAGACATGTCTGGACAAGGCCTCAGTGCCACAGCGTCGGCCATCATCTCCGTGGACGACATCAACGACAATGCCCCTGAGTTCACCAGGGGCAAGCTCCTCATGGAGGTCACAGAGGCTGTCAGTGGAGTGGATGTGGGGCGGCTGGAGGTGGAGGACAGGGACCTGCCTGGCTCCCCCAACTGGGTGGCCAACGTCACTATCCTGGAGGGTGACCCCGAGGGACACTTCGGCATCAGAACGGACCCCAGGACCAACGAGGGTGTGCTGTCTGTGGTGAAGCCCCTGGACTATGAGAGCCATGCACACTATGAGCTCAGGGTGTCTGTGCAGAATGAGGCCCCACTACAGGCAGCACCCCCCCGGGCCCAGCGGGGCCAGGCCACAGTCAGCATCCGGGTGCAGGACGTCAACGAGGCACCTGTGTTCCTCGAGAACCCGCTGAGAACCAGCCTGGCAGAGGGGGCACCCCCCGGGACCTTCGTGGCCAGCTTCTCTGCACAAGACCCCGACACCGTGCAGCTGCAGAGGGTCAGCTACTCCAAGGACTATGACCCTGAGGACTGGCTGCAGGTGGACGGAGCCACTGGCCAGATCCAGACGCGAAGGGTTCTGAGCCCGGCCTCCCCCTTCCTGAAGGACGGCTGGTACCGGGCCATCGTCCTCGCCCTCGACGACGGCTCGCCGCCTCGTACGGCCACCGGCACGCTGTCCGTGGAGATCCTGGCGGTGAACGACCACGCGCCTGCACTGGCGCCGCTGGCGGCTCCAAGCCTGTGCAGCGAGCCGGAACGCGGCCCCGGGCTGCTGCTGGGCGCCACTGACCAGGACCTGCCGCCGCACGGGGCGCCCTTCCGCTTCCGCCTCAGCCCCGCCGAGCCCGGGCTGGGCCGCAACTGGAGCCTCAGCCACGTCAACGGGACCCACGCGCGCCTGCGGCCGCGGCACACTCTCCCCGAGGGCCTGCACCGCCTCCGCCTGCTGCTCCAGGACTCCGGACAGCCGCCGAAGGAACGCGAGCAGCCGCTCAACGTCACCCTGTGTCGCTGCGGGCTCAGTGGCGCCTGTCTGCCCGGGGCCGCGGCGCTCAGGGCAGGGGGCGCGGGCCTTGGGCTGGGCGTGCTGGCGGTGGCGCTGGGGAGCGCTGCGGTGCTGCTGCTGCTGGTTCTGCTCGTGCTGCTCAGAGCGCGGTTCCGGCAGCGGTCGCGGGACAGGAGCCTGCTGCGCGGCCTGCAGGACGACTACCTTCGGGACAACATTCTCAACTACGACGAGCAGGGAGGCGGGGAGGAGGACCAGGACGCCTACGATATAAGCCAGCTGCGCCACCCCTGGGAGCCAGTGTTCCCGAGCTTCCCCCCGGGCCGGCCGCCCCTACGCCGCGAGGCCCCCTTGGGCCGCGGGCGCCCCCAGCCGCCCCGCGCGCCGCCCGCCAGCCCCGCGGACATCGCCGGCTTCATCCGAGACGGCCTGCAGGCTGCGGACTGCGACCCCAGCGTGCCGCCCTACGACACGGCGCTCATCTACGACTACGAGGGGGAAGGCTCCGTGGCGGGGACGCTGAGCTCCCCCGTGTCCAGCGTGGGCGAGGAGGACCAGGACTACGACTACCTCCAAGACTGGGGCCCGCGCTTCGCCCGACTGGCGGACCTGTACGGACACCCGTGA

XM_004842652.1 Coding sequence

Cdh15 cadherin 15, type 1, M-cadherin (myotubule), transcript variant X2

Length: 2226 bp    Location: 617582..604894   Strand: -
>XM_004842652.1
ATGGACACCGCGCTCCTCCTGGCCCTCGGGCTGCTGGCACAGAGCCTTGGCTTGTCCTGGGGGGTCCCCAGGCGCCCCAGCACCCTGTACCCCTGGCGCCGGCCACCTGCACTGGGCCGAGTTCGGAGAGCCTGGGTCATCCCACCCATTAGCGTGTCAGAGAACTACAAGGGCCTGCCCTACATGCTGGTGCAGATCCGGTCCGACAAGCGGCAGCCAGGCGGGGTCATCTACAGCATCCAGGGCCCCGGTGTGGATGAGGAGCCCCTGGGCCTCTTCTCTGTGGAGAAGTTCTCAGGGCGGGTGTTCCTCAACGCGGAGCTGGACCGGGAGAAGACGTCCTCCTACAGGCTCAAGGTCTTTGCCCTGGACCGGGGAGGGTCTGTCCTGGAGGAGCCCACTGACCTGGAGATCGTGGTTGTGGATCAGAACGACAACCGGCCAGCCTTCGTGCAGGAGGTGTTCGCTGGCCGCGTGCTGGAAGGCGCAGCCCCAGGCACCTATGTGACCCGGGCCGAGGCCACCGACGCCGATGACCCAGACACAGACAATGCGGCGCTGCACTACTCCATCCTGGCACAGGGGAGCCCCGAGCTCTTCAGCATCCATGAGCGCACGGGCGAGATCCGCACTGTACACGTGGGGCTGGACCGTGAGGCGGTCACCACGTACAACCTGACGCTGCAGGTGGCAGACATGTCTGGACAAGGCCTCAGTGCCACAGCGTCGGCCATCATCTCCGTGGACGACATCAACGACAATGCCCCTGAGTTCACCAGGGGCAAGCTCCTCATGGAGGTCACAGAGGCTGTCAGTGGAGTGGATGTGGGGCGGCTGGAGGTGGAGGACAGGGACCTGCCTGGCTCCCCCAACTGGGTGGCCAACGTCACTATCCTGGAGGGTGACCCCGAGGGACACTTCGGCATCAGAACGGACCCCAGGACCAACGAGGGTGTGCTGTCTGTGGTGAAGCCCCTGGACTATGAGAGCCATGCACACTATGAGCTCAGGGTGTCTGTGCAGAATGAGGCCCCACTACAGGCAGCACCCCCCCGGGCCCAGCGGGGCCAGGCCACAGTCAGCATCCGGGTGCAGGACGTCAACGAGGCACCTGTGTTCCTCGAGAACCCGCTGAGAACCAGCCTGGCAGAGGGGGCACCCCCCGGGACCTTCGTGGCCAGCTTCTCTGCACAAGACCCCGACACCGTGCAGCTGCAGAGGGTCAGGTCACACAAACACGGCTGCCCTGTCCTCCCTGGCCGCTACTCCAAGGACTATGACCCTGAGGACTGGCTGCAGGTGGACGGAGCCACTGGCCAGATCCAGACGCGAAGGGTTCTGAGCCCGGCCTCCCCCTTCCTGAAGGACGGCTGGTACCGGGCCATCGTCCTCGCCCTCGACGACGGCTCGCCGCCTCGTACGGCCACCGGCACGCTGTCCGTGGAGATCCTGGCGGTGAACGACCACGCGCCTGCACTGGCGCCGCTGGCGGCTCCAAGCCTGTGCAGCGAGCCGGAACGCGGCCCCGGGCTGCTGCTGGGCGCCACTGACCAGGACCTGCCGCCGCACGGGGCGCCCTTCCGCTTCCGCCTCAGCCCCGCCGAGCCCGGGCTGGGCCGCAACTGGAGCCTCAGCCACGTCAACGGGACCCACGCGCGCCTGCGGCCGCGGCACACTCTCCCCGAGGGCCTGCACCGCCTCCGCCTGCTGCTCCAGGACTCCGGACAGCCGCCGAAGGAACGCGAGCAGCCGCTCAACGTCACCCTGTGTCGCTGCGGGCTCAGTGGCGCCTGTCTGCCCGGGGCCGCGGCGCTCAGGGCAGGGGGCGCGGGCCTTGGGCTGGGCGTGCTGGCGGTGGCGCTGGGGAGCGCTGCGGTGCTGCTGCTGCTGGTTCTGCTCGTGCTGCTCAGAGCGCGGTTCCGGCAGCGGTCGCGGGACAGGAGCCTGCTGCGCGGCCTGCAGGACGACTACCTTCGGGACAACATTCTCAACTACGACGAGCAGGGAGGCGGGGAGGAGGACCAGGGCCTGCAGGCTGCGGACTGCGACCCCAGCGTGCCGCCCTACGACACGGCGCTCATCTACGACTACGAGGGGGAAGGCTCCGTGGCGGGGACGCTGAGCTCCCCCGTGTCCAGCGTGGGCGAGGAGGACCAGGACTACGACTACCTCCAAGACTGGGGCCCGCGCTTCGCCCGACTGGCGGACCTGTACGGACACCCGTGA

XM_004842653.1 Coding sequence

Cdh15 cadherin 15, type 1, M-cadherin (myotubule), transcript variant X3

Length: 2097 bp    Location: 617582..605110   Strand: -
>XM_004842653.1
ATGGACACCGCGCTCCTCCTGGCCCTCGGGCTGCTGGCACAGAGCCTTGGCTTGTCCTGGGGGGTCCCCAGGCGCCCCAGCACCCTGTACCCCTGGCGCCGGCCACCTGCACTGGGCCGAGTTCGGAGAGCCTGGGTCATCCCACCCATTAGCGTGTCAGAGAACTACAAGGGCCTGCCCTACATGCTGGTGCAGATCCGGTCCGACAAGCGGCAGCCAGGCGGGGTCATCTACAGCATCCAGGGCCCCGGTGTGGATGAGGAGCCCCTGGGCCTCTTCTCTGTGGAGAAGTTCTCAGGGCGGGTGTTCCTCAACGCGGAGCTGGACCGGGAGAAGACGTCCTCCTACAGGCTCAAGGTCTTTGCCCTGGACCGGGGAGGGTCTGTCCTGGAGGAGCCCACTGACCTGGAGATCGTGGTTGTGGATCAGAACGACAACCGGCCAGCCTTCGTGCAGGAGGTGTTCGCTGGCCGCGTGCTGGAAGGCGCAGCCCCAGGCACCTATGTGACCCGGGCCGAGGCCACCGACGCCGATGACCCAGACACAGACAATGCGGCGCTGCACTACTCCATCCTGGCACAGGGGAGCCCCGAGCTCTTCAGCATCCATGAGCGCACGGGCGAGATCCGCACTGTACACGTGGGGCTGGACCGTGAGGCGGTCACCACGTACAACCTGACGCTGCAGGTGGCAGACATGTCTGGACAAGGCCTCAGTGCCACAGCGTCGGCCATCATCTCCGTGGACGACATCAACGACAATGCCCCTGAGTTCACCAGGGGCAAGCTCCTCATGGAGGTCACAGAGGCTGTCAGTGGAGTGGATGTGGGGCGGCTGGAGGTGGAGGACAGGGACCTGCCTGGCTCCCCCAACTGGGTGGCCAACGTCACTATCCTGGAGGGTGACCCCGAGGGACACTTCGGCATCAGAACGGACCCCAGGACCAACGAGGGTGTGCTGTCTGTGGTGAAGCCCCTGGACTATGAGAGCCATGCACACTATGAGCTCAGGGTGTCTGTGCAGAATGAGGCCCCACTACAGGCAGCACCCCCCCGGGCCCAGCGGGGCCAGGCCACAGTCAGCATCCGGGTGCAGGACGTCAACGAGGCACCTGTGTTCCTCGAGAACCCGCTGAGAACCAGCCTGGCAGAGGGGGCACCCCCCGGGACCTTCGTGGCCAGCTTCTCTGCACAAGACCCCGACACCGTGCAGCTGCAGAGGGTCAGGTCACACAAACACGGCTGCCCTGTCCTCCCTGGCCGCTACTCCAAGGACTATGACCCTGAGGACTGGCTGCAGGTGGACGGAGCCACTGGCCAGATCCAGACGCGAAGGGTTCTGAGCCCGGCCTCCCCCTTCCTGAAGGACGGCTGGTACCGGGCCATCGTCCTCGCCCTCGACGACGGCTCGCCGCCTCGTACGGCCACCGGCACGCTGTCCGTGGAGATCCTGGCGGTGAACGACCACGCGCCTGCACTGGCGCCGCTGGCGGCTCCAAGCCTGTGCAGCGAGCCGGAACGCGGCCCCGGGCTGCTGCTGGGCGCCACTGACCAGGACCTGCCGCCGCACGGGGCGCCCTTCCGCTTCCGCCTCAGCCCCGCCGAGCCCGGGCTGGGCCGCAACTGGAGCCTCAGCCACGTCAACGGGACCCACGCGCGCCTGCGGCCGCGGCACACTCTCCCCGAGGGCCTGCACCGCCTCCGCCTGCTGCTCCAGGACTCCGGACAGCCGCCGAAGGAACGCGAGCAGCCGCTCAACGTCACCCTGTGTCGCTGCGGGCTCAGTGGCGCCTGTCTGCCCGGGGCCGCGGCGCTCAGGGCAGGGGGCGCGGGCCTTGGGCTGGGCGTGCTGGCGGTGGCGCTGGGGAGCGCTGCGGTGCTGCTGCAGCGCGGTTCCGGCAGCGGTCGCGGGACAGGAGCCTGCTGCGCGGCCTGCAGGACGACTACCTTCGGGACAACATTCTCAACTACGACGAGCAGGGAGGCGGGGAGGAGGACCAGGGCCTGCAGGCTGCGGACTGCGACCCCAGCGTGCCGCCCTACGACACGGCGCTCATCTACGACTACGAGGGGGAAGGCTCCGTGGCGGGGACGCTGA

XM_004842657.1 Coding sequence

Acsf3 acyl-CoA synthetase family member 3, transcript variant X3

Length: 1398 bp    Location: 652599..629777   Strand: -
>XM_004842657.1
ATGCTTCTCAGCGCCATGCTGCTCCGCATGACTCTGCCCTCCCGGCACCTGGTCTGGGCTGCGGCCTCCTGCGGTCCGGCACCTGGGAGACACCGAGGAGGCCGCTTCCTGCACAGGGCCCCCACTGCCCGCTCTGACAGGGCCGGCCCTGTCTTCACCAAGGCCCTGGCCTTTGGGGACAGGATCGCCCTGGTTGACCAGCACGGCTGCCACACCTACCGGGACCTGTACCACCGCAGCCTGCGCCTGTCCCTGGAGATCTGCAGGCTCCGTGGCTGCATGGACGGAGACCTGCAGGACGAACGGATCTCCTTCCTGTGCTCCAACGATGTCTCCTATGTCGTGGCCCAGTGGGCTTCGTGGGTGAGCGGTGGCATCGCTGTCCCCCTCTTCTGGAAGCACCCCGAGCCACAGCTGGAGTACTTCATCCAGGACTCCCGCAGCTCCGTGGTCCTGGCCAGCCCGGAGCATGTGCCGCTGGTGGGCCCAGTCGCCGGGAGGCTGGGGCTCCCACTCTTGTCTCTCCCTCCCGACGTCTACCATGGGGCTGTGGAGGAGCCCGCAGCGGAGCCAGAGCAGAAGCACAAGTGGCGAGAACGGGGCGCCATGATCCTCTACACCAGTGGGACCACAGGGAGGCCCAGGGGCGTGCTGAGCACCCACGGCAGCCTCACGGCCACGGTGACTGGGCTGGTCCATGCCTGGGCGTGGACGAGAGACGACGTGATCCTGCACGTCCTCCCGCTGCACCACATGCACGGCGTGGTCAACAAGCTGCTGTGCCCGCTCTGGGTGGGGGCCACCTGCGTGATGCTGCCCGAGTTCAGCGCCCAGCAGGTTTGGGAAAAGTTCCTTAGTTCTGAAACTCCACGGATTAATGTGTTCATGGCAGTGCCCACCATATACTCCAAGTTGCTGGATTACTACGACCAGCACTTCACCCAGCCTCATGTCCAGGATTTCGTGCGTGCAGTTTGTGAAGAAAAAATAAGGCTCATGGTGTCCGGCTCGGCCGCACTGCCCACGCCCCTGCTGGAGAGGTGGAAGAGCGCCACGGGCCACATGCTGCTGGAGCGCTACGGCATGACCGAGGTTGGCATGGCCCTGTCCAGCCCCCTGGCCGGGGCTCGCCTACCAGGTTCTGTGGGGACCCCACTGCCCGGAGTGGAGGTTCGCATCGTCTCGGAGAGCCCACAGAGGGACGGCTGCCCATACACCGTGCACGCCCAGGGGGACACGCAGGGGACAAAGGGGACACCGCTGTGTTCAAGGATGACAGTTACTGGATCCGCGGCCGCACGTCAGTGGACATCATCAAGACTGGAGGGTACAAAGTCAGCGCGCTGGAGGTCGAGCGGCAGCTGCTGGCCCACCCCAGCATCTCGGATGTGGCTGTGA

XM_004842660.1 Coding sequence

Cbfa2t3 core-binding factor, runt domain, alpha subunit 2; translocated to, 3, transcript variant X3

Length: 1746 bp    Location: 735527..773169   Strand: +
>XM_004842660.1
ATGCCCGACTCCCCAGCTGAGGTGAAGACGCAGCCCCGGGCCACACCTCCCAGCATGCCGCCCCCGCCCCCCGCTGCGTCCCAGGGGGCCGCGCGCCCGCCCTCCTTCACGCCGCACACACATGGCGAGGACGGCCCTGCGACGTCTCTGCCCCACAGCCGTTTCCACGGCTGCTTAAAGTGGTCCATGGTCTGTCTCTTGATGAACGGCGGCAGCCACTCGCCAACAGCCGTGCATGGTGCCCCGTCCACACCCAACGGCTTCAGCAACGGCCCGGCCACGTCGTGCTCAGCTGCGCTGTCCACGCAGCACCTGCCCCCGGCCTGTGGGGCCCGGCAGCTCAGCAAGCTGAAGCGCTTCCTCAGCACCCTGCAGCAGTTCGGCAGCGACATCTCGCCCGAGATCGGGGAGCGCGTGCGCATGCTGGTGCTGGGGCTGGTGAACTCGACACTGACGATCGAAGAGTTCCACGCCAAGCTGCAGGAGGCCACCAATTTCCCTCTGCGGCCATTCGTCATCCCCTTCCTGAAGGCCAACTTGCCCTTGCTGCAGCGCGAGCTGCTGCACTGCGCCCGCCTGGCCAAGCAGACACCCGCCCAGTACCTGGCCCAGCATGAGCAGACACTGCTGGATGCCAGCACCACCTCCCCCGGCGACTCCTCCGAGCTCCTGTTAGAGGTGAACGAGAATGGCAAGAGGCGGACGCCTGACAGGACCAAAGAGAATGGGTCAGACGGTGACCCGCCGCACCTGGACCACCTCAGCAAACGGCCGTGCACCCTGAGCCCCGCCCAGCGCTGCAGCCCCAGCAACGGGCTGCCACACCCCATGCCGCCACCACACTACCGCCTGGAGGACATGGCCATGGCCCACCACTTCCGCGACCCCTACCGACCCCCCGAGCCCCGGGAGCTGCGGGAGCGCCATCGGCAGCTGGCAGTGCCTGGGGCCCGGCAGGAAGAAGTGATTGACCACAGGCTCACAGAGCGAGAGTGGGCGGAAGAGTGGAAACACCTCAACAGTCTCCTGAACTGCATTATGGACATGGTGGAGAAGACTCGGCGCTCACTCACGGTGCTGCGCCGATGCCAGGAGACAGACCGCGAGGAGCTCAACCACTGGATCCGGCGCTACAGCGACGCCGAGGACCTGAAGAAGGGCCCTGGTCCCACCCGGCCCCTCAGCAGCTCTGCTGGCCTCGAGAGCTCTCAGCTTGACTTGCACCGTGAGCTCACACCCAGGGCGCTGTCCGGCTACATGCCTGAGGAGATCTGGAGGAAGGCCGAGGAGGCCGTGAACGAGGTGAAGCGTCAGGCGATGTCGGAGCTGCAGAAAGCCGTGTCAGACGCAGAGCGCAAAGCCCATGAGCTCATCACCACAGAGCGTGCCAAGATGGAGCGGGCCCTGGCCGAGGCCAAGCGCCAGGCCTCTGAGGACGCCCTGACTGTCGTAAACCAGCAGGAGGACTCCAGCGAGAGCTGCTGGAACTGCGGGCGCAAGGCCAGCGAGACGTGCAGTGGCTGCAATGCTGCACGCTACTGCGGCTCCTTCTGCCAGCACAAGGACTGGGAGAAGCACCACCATGTGTGCGGCCAGAGCCTGCAGGGCCCTGCTGCTGCAGTGCCCGACACGCTGCCTGGGCAGCCTGATGCCACTGCCAGCCCCAGCGAGGCCAGCTCTGCCGGGCCCTCCCGCCCGGGCTCCCCTGGCCCACCCGGCCCGCTGGATGCTGCCGTGCCCCGCTGA

XM_004842669.1 Coding sequence

Galns galactosamine (N-acetyl)-6-sulfate sulfatase, transcript variant X3

Length: 1380 bp    Location: 786254..802647   Strand: +
>XM_004842669.1
ATGGCCATGGAGGCCGCGGTCGTGGTGCCCAGGGGGTGGCGGCTGCTGCTGCTGGTGAGCGCCGCGGGGCTTGTGGCCCTGGGCGCCCCGCAGCCCCCTAACATCCTGCTGCTGCTCATGGACGACATGGGGTGGGGTGACCTGGGGGTGTACGGAGAGCCCTCCAGAGAGACCCCGAACCTGGACCGCATGGCTGCAGAGGGGATGCTGTTCCCCAACTTCTACTCTGCCAACCCCCTGTGTTCGCCGTCCAGGGCGGCCCTGCTCAGTGGACGGCTGCCCATCCGCAACGGCTTCTACACCACCAATGCGCACGCCAGGAATGCGTACACCCCGCAGGAAATAGTGGGCGGCATCCCCGACTCAGAGCGCCTCCTGCCCTCACTCCTGAAAGAGGCTGGCTACGCCACCAAGATCGTGGGCAAGTGGCACCTGGGTCACAGGCCCCAGTTCCACCCCCTGAAGCACGGATTCGATGAGTGGTTTGGATCACCCAACTGTCACTTTGGACCTTATGACAACAAGGCCAAGCCCAACATCCCTGTGTATAAGGACTGGGAAATGGTCGGCAGATTTTATGAAGAATTCCCAATCAACGTGAAGACTGGGGAATCCAACCTCACCCAGATCTACTTACAGGAAGCCCTGGACTTCATCAAGCGGCAGCAGGCAGCACGACGCCCGTTCTTCCTCTACTGGGCAGTGGATGCCACACATGCTCCTGTGTACGCCTCCCGGCCTTTCCTGGGCAGCAGCCAGCGTGGGCGGTATGGGGATGCGGTGCGGGAGATCGATGACAGTGTCGGGAAGATGCTGAGCCTGCTGCAGGTCCTGGGCCTTGCGGAGAGCACCTTCGTCTTCTTCACCTCAGACAATGGTGCTGCCCTTGTCTCTGCTCCCAGCCAAGGTGGCAGCAATGGCCCCTTCCTGTGCGGGAAGCAGACCACCTTTGAAGGTGGCATGAGGGAGCCTGCAATTGCGTGGTGGCCCAGGCACATCCCTCCTGGCCAGGTGAGCCACCAGCTGGGCAGCATCATGGACCTTTTCACCACCAGCCTGGCCCTTGCGGGCCTGAAGCCCCCCAGAGACAGGGTGATTGATGGCTTCAGCCTCCTCCCTGCCTTGCTGCAGGGCCAGCTGACAGATAGGGCATCAACTTCTGCCCCGGGCAGAACATCTCAGGAGTCACCACGCATACCCAGGAGGAACACACAAAGCTGCCTCTGGTCTTCCACCTGGGGCGCGACCCTGGGGAGAGGTTTCCGCTCAGGTGAATGGAGAGGAGGCCATCCTGGATCGGGTGCCCGAGGTCCAGGCAGGAGAGGAGGCACTGAAGGGGATGGCCCCGCGGGGCTGGAAGAAGGAGAAAGGAGCCTCTGA

XM_004842672.1 Coding sequence

Galns galactosamine (N-acetyl)-6-sulfate sulfatase, transcript variant X6

Length: 1305 bp    Location: 786256..798614   Strand: +
>XM_004842672.1
ATGGCCATGGAGGCCGCGGTCGTGGTGCCCAGGGGGTGGCGGCTGCTGCTGCTGGTGAGCGCCGCGGGGCTTGTGGCCCTGGGCGCCCCGCAGCCCCCTAACATCCTGCTGCTGCTCATGGACGACATGGGGTGGGGTGACCTGGGGGTGTACGGAGAGCCCTCCAGAGAGACCCCGAACCTGGACCGCATGGCTGCAGAGGGGATGCTGTTCCCCAACTTCTACTCTGCCAACCCCCTGTGTTCGCCGTCCAGGGCGGCCCTGCTCAGTGGACGGCTGCCCATCCGCAACGGCTTCTACACCACCAATGCGCACGCCAGGAATGCGTACACCCCGCAGGAAATAGTGGGCGGCATCCCCGACTCAGAGCGCCTCCTGCCCTCACTCCTGAAAGAGGCTGGCTACGCCACCAAGATCGTGGGCAAGTGGCACCTGGGTCACAGGCCCCAGTTCCACCCCCTGAAGCACGGATTCGATGAGTGGTTTGGATCACCCAACTGTCACTTTGGACCTTATGACAACAAGGCCAAGCCCAACATCCCTGTGTATAAGGACTGGGAAATGGTCGGCAGATTTTATGAAGAATTCCCAATCAACGTGAAGACTGGGGAATCCAACCTCACCCAGATCTACTTACAGGAAGCCCTGGACTTCATCAAGCGGCAGCAGGCAGCACGACGCCCGTTCTTCCTCTACTGGGCAGTGGATGCCACACATGCTCCTGTGTACGCCTCCCGGCCTTTCCTGGGCAGCAGCCAGCGTGGGCGGTATGGGGATGCGGTGCGGGAGATCGATGACAGTGTCGGGAAGATGCTGAGCCTGCTGCAGGTCCTGGGCCTTGCGGAGAGCACCTTCGTCTTCTTCACCTCAGACAATGGTGCTGCCCTTGTCTCTGCTCCCAGCCAAGGTGGCAGCAATGGCCCCTTCCTGTGCGGGAAGCAGACCACCTTTGAAGGTGGCATGAGGGAGCCTGCAATTGCGTGGTGGCCCAGGCACATCCCTCCTGGCCAGGTGAGCCACCAGCTGGGCAGCATCATGGACCTTTTCACCACCAGCCTGGCCCTTGCGGGCCTGAAGCCCCCCAGAGACAGGGTGATTGATGGCTTCAGCCTCCTCCCTGCCTTGCTGCAGGGCCAGCTGACAGATAGAGCTCAGTTACCGCTGAGGAGAGAAGGTGCTGGGCACCCGGCCTCCCCGAGTCCAGCTCTGCCTCTCCGGGACCAAGCCCCACAGCCTCATCTTCCGCCTCCTTTTCTCCTTTGCTGGGAGAGTCCCGGGGCGGAACCCAGGACCTGGCACACGTGA

XM_004842668.1 Coding sequence

Galns galactosamine (N-acetyl)-6-sulfate sulfatase, transcript variant X2

Length: 1389 bp    Location: 786257..805064   Strand: +
>XM_004842668.1
ATGGCCATGGAGGCCGCGGTCGTGGTGCCCAGGGGGTGGCGGCTGCTGCTGCTGGTGAGCGCCGCGGGGCTTGTGGCCCTGGGCGCCCCGCAGCCCCCTAACATCCTGCTGCTGCTCATGGACGACATGGGGTGGGGTGACCTGGGGGTGTACGGAGAGCCCTCCAGAGAGACCCCGAACCTGGACCGCATGGCTGCAGAGGGGATGCTGTTCCCCAACTTCTACTCTGCCAACCCCCTGTGTTCGCCGTCCAGGGCGGCCCTGCTCAGTGGACGGCTGCCCATCCGCAACGGCTTCTACACCACCAATGCGCACGCCAGGAATGCGTACACCCCGCAGGAAATAGTGGGCGGCATCCCCGACTCAGAGCGCCTCCTGCCCTCACTCCTGAAAGAGGCTGGCTACGCCACCAAGATCGTGGGCAAGTGGCACCTGGGTCACAGGCCCCAGTTCCACCCCCTGAAGCACGGATTCGATGAGTGGTTTGGATCACCCAACTGTCACTTTGGACCTTATGACAACAAGGCCAAGCCCAACATCCCTGTGTATAAGGACTGGGAAATGGTCGGCAGATTTTATGAAGAATTCCCAATCAACGTGAAGACTGGGGAATCCAACCTCACCCAGATCTACTTACAGGAAGCCCTGGACTTCATCAAGCGGCAGCAGGCAGCACGACGCCCGTTCTTCCTCTACTGGGCAGTGGATGCCACACATGCTCCTGTGTACGCCTCCCGGCCTTTCCTGGGCAGCAGCCAGCGTGGGCGGTATGGGGATGCGGTGCGGGAGATCGATGACAGTGTCGGGAAGATGCTGAGCCTGCTGCAGGTCCTGGGCCTTGCGGAGAGCACCTTCGTCTTCTTCACCTCAGACAATGGTGCTGCCCTTGTCTCTGCTCCCAGCCAAGGTGGCAGCAATGGCCCCTTCCTGTGCGGGAAGCAGACCACCTTTGAAGGTGGCATGAGGGAGCCTGCAATTGCGTGGTGGCCCAGGCACATCCCTCCTGGCCAGGTGAGCCACCAGCTGGGCAGCATCATGGACCTTTTCACCACCAGCCTGGCCCTTGCGGGCCTGAAGCCCCCCAGAGACAGGGTGATTGATGGCTTCAGCCTCCTCCCTGCCTTGCTGCAGGGCCAGCTGACAGATAGGGCATCAACTTCTGCCCCGGGCAGAACATCTCAGGAGTCACCACGCATACCCAGGAGGAACACACAAAGCTGCCTCTGGTCTTCCACCTGGGGCGCGACCCTGGGGAGAGGTTTCCGCTCAGCTTTGCCAGCACAGAGTACCAGGATGCCCTCAGCAGGATCACCCTGGTGGTCCAGCAGCACCAGGACACCCTGGTCCCTGGACAGCCTCAGCTCAACGTGTGCGACCAGGCAGTCATGA

XM_004842667.1 Coding sequence

Galns galactosamine (N-acetyl)-6-sulfate sulfatase, transcript variant X1

High confidence: 4 potential gene matches
Length: 1578 bp    Location: 786258..805450   Strand: +
>XM_004842667.1
ATGGCCATGGAGGCCGCGGTCGTGGTGCCCAGGGGGTGGCGGCTGCTGCTGCTGGTGAGCGCCGCGGGGCTTGTGGCCCTGGGCGCCCCGCAGCCCCCTAACATCCTGCTGCTGCTCATGGACGACATGGGGTGGGGTGACCTGGGGGTGTACGGAGAGCCCTCCAGAGAGACCCCGAACCTGGACCGCATGGCTGCAGAGGGGATGCTGTTCCCCAACTTCTACTCTGCCAACCCCCTGTGTTCGCCGTCCAGGGCGGCCCTGCTCAGTGGACGGCTGCCCATCCGCAACGGCTTCTACACCACCAATGCGCACGCCAGGAATGCGTACACCCCGCAGGAAATAGTGGGCGGCATCCCCGACTCAGAGCGCCTCCTGCCCTCACTCCTGAAAGAGGCTGGCTACGCCACCAAGATCGTGGGCAAGTGGCACCTGGGTCACAGGCCCCAGTTCCACCCCCTGAAGCACGGATTCGATGAGTGGTTTGGATCACCCAACTGTCACTTTGGACCTTATGACAACAAGGCCAAGCCCAACATCCCTGTGTATAAGGACTGGGAAATGGTCGGCAGATTTTATGAAGAATTCCCAATCAACGTGAAGACTGGGGAATCCAACCTCACCCAGATCTACTTACAGGAAGCCCTGGACTTCATCAAGCGGCAGCAGGCAGCACGACGCCCGTTCTTCCTCTACTGGGCAGTGGATGCCACACATGCTCCTGTGTACGCCTCCCGGCCTTTCCTGGGCAGCAGCCAGCGTGGGCGGTATGGGGATGCGGTGCGGGAGATCGATGACAGTGTCGGGAAGATGCTGAGCCTGCTGCAGGTCCTGGGCCTTGCGGAGAGCACCTTCGTCTTCTTCACCTCAGACAATGGTGCTGCCCTTGTCTCTGCTCCCAGCCAAGGTGGCAGCAATGGCCCCTTCCTGTGCGGGAAGCAGACCACCTTTGAAGGTGGCATGAGGGAGCCTGCAATTGCGTGGTGGCCCAGGCACATCCCTCCTGGCCAGGTGAGCCACCAGCTGGGCAGCATCATGGACCTTTTCACCACCAGCCTGGCCCTTGCGGGCCTGAAGCCCCCCAGAGACAGGGTGATTGATGGCTTCAGCCTCCTCCCTGCCTTGCTGCAGGGCCAGCTGACAGATAGGCCCATACTCTATTACCGTGGCAACACCCTGATGGCTGTCACCCTCGGGCAGCACAAGGCCCACTTCTGGACCTGGACCAACTCCTGGGAGGAGTTCAGACAGGGCATCAACTTCTGCCCCGGGCAGAACATCTCAGGAGTCACCACGCATACCCAGGAGGAACACACAAAGCTGCCTCTGGTCTTCCACCTGGGGCGCGACCCTGGGGAGAGGTTTCCGCTCAGCTTTGCCAGCACAGAGTACCAGGATGCCCTCAGCAGGATCACCCTGGTGGTCCAGCAGCACCAGGACACCCTGGTCCCTGGACAGCCTCAGCTCAACGTGTGCGACCAGGCAGTCATGAACTGGGCACCCCCAGGCTGTGAGAAGCTGGGCAAGTGTCTGCGGCCTCCAGAGTCCGTCCTGGAGAAGTGCTTCTGGCCCCATTAG

XM_004842676.1 Coding sequence

Cdt1 chromatin licensing and DNA replication factor 1, transcript variant X3

Length: 1623 bp    Location: 813851..808063   Strand: -
>XM_004842676.1
ATGGCACAGAGCCGGGTCACCGACTTCTTCGCTTGCCGCCGCCCGGGGTCTGCAGCTCCGCGGGTCAAGGCAGCCTGCCGCACCCCGAGCCCTGCCCGGCCCGCGCCCGGCCCGGGCAGCAGCCGCAAGCGCGCCCGTCCTCCCGCTGCGTCCGGGGGCGAGCAGCCCGCGCCGCCCGCGCGCCGGAGACTGCGGCTTCGGGACGTGGACTCCTGTCCCAGTTCCCCAGCCACCCTCAGCTCCCTTGCCTGTCCTTCGCCGGTCAAGAAGATCAAGAAAACCTCCGCTCCTGCACCAGCAGGCCAGCTGTCCCTCCCCGCAGCCCCACAGGACAAGGTCCCCTCAAAGGACACCCTCTCTGAGCTCCAGGTGTGCCTTCAGCGTGCACGGGAGCTGGGCACACGCGTCCAGGCACTGAGGGCCAGGCCTCAGGAGGGTGCTGAGGAACCCAGCCCACCGGAGGCCAACCTCCAGGAGCAGCCATGTGGCCAGAAGACGCCTGCCTACCAACGCTTCCATGCCCTGGCCCAGCCCGGCCCACCAGGCCTTGTGCTGCCCTACAAGTACCAGGTGCTGGCCGAGATGTTTCGAAGCATGGACACCATTGTGGGCATGCTCCACAACCGCTCCGAGACTGCGACCTTTGCCAAGGTCAAGGGGGGGGTCCAGGACATGATGCGCAAGCGCTTCGAGGAGCGCAACGTGGGCCAGATCAAAACTGTGTATCCGATGTCCTACTGCTTCCGCCAGGAGCGCAATGTCCCCACCTTCAAGGACAGTGTCAAGAAGTCTGATTACCAGCTCACCATAGAGCCACTGCTGGGCCAGGAGCCTGGTGGCGCCGTGCCTCAGCTCACAGCCTCACGCCTGCTGCAGCGGCGACAGGTTTTCAGCCAGAACCTGGTGAACCGGGTCAAGGAGCACCACAAGGCCTTCCTCGCCTCCCTGACCCCCCCCATGGCTGTGCCTGAGGACCAGCTGACGCGCTGGCACCCGCGCTTCAACGTGGATGAGGTGCCTGACATCGAGCCTGCTGAGCTGCCCCAGCCACCCACCACGGAGCAGCTCACCAGTGCCCAGGAGGTGCTGGCCCGCGCCCGAAGCCTGATGTCGCCCAGGATGGAGAAGGCGTTGTGTCACGCAGCACTGTGTGCAGCGGAGCCCGGCAGCCCTGGATCCCCCGGCCCGGCCCTGCCAGCCAGCCCTGCCAGCCCGCCCAGCGCCCTGAAGGGTGTGCCCCAGGCCCTGCTGGAGCGGATCCGTGCCAAGGAGGCCCAGAAACAGCTGGCGCAGATGACGCGCTGCCCGGAGCACGAGCTGCGGCTGCAGCGGCTGCAGCGACTGCCCGAGCTGGCCCGCGTGCTGCGCGGTGTCTTCGTGTCTGAGAGAAAGCCCGCGCTCACCATGGAGGTGGCCTGCACCAGGATGGTGGGCAGCTGCCGTGCTGCCCTGAGCCTGGGGGAGATGGAGAGGCACCTGCTGCTCCTCAGCGAGCTGCTGCCTGACTGGCTCAGCCTGCACCGCATCCGCACCAGCACTTACATCAAGCTGGACAAGGCTGCCAACCTGGCCAGCATCACTGCACGGCTGGCCCACCAGGCCCACACTGAGGAGGGGCAGTGA

XM_004842675.1 Coding sequence

Cdt1 chromatin licensing and DNA replication factor 1, transcript variant X2

Length: 1623 bp    Location: 813851..808063   Strand: -
>XM_004842675.1
ATGGCACAGAGCCGGGTCACCGACTTCTTCGCTTGCCGCCGCCCGGGGTCTGCAGCTCCGCGGGTCAAGGCAGCCTGCCGCACCCCGAGCCCTGCCCGGCCCGCGCCCGGCCCGGGCAGCAGCCGCAAGCGCGCCCGTCCTCCCGCTGCGTCCGGGGGCGAGCAGCCCGCGCCGCCCGCGCGCCGGAGACTGCGGCTTCGGGACGTGGACTCCTGTCCCAGTTCCCCAGCCACCCTCAGCTCCCTTGCCTGTCCTTCGCCGGTCAAGAAGATCAAGAAAACCTCCGCTCCTGCACCAGCAGGCCAGCTGTCCCTCCCCGCAGCCCCACAGGACAAGGTCCCCTCAAAGGACACCCTCTCTGAGCTCCAGGTGTGCCTTCAGCGTGCACGGGAGCTGGGCACACGCGTCCAGGCACTGAGGGCCAGGCCTCAGGAGGGTGCTGAGGAACCCAGCCCACCGGAGGCCAACCTCCAGGAGCAGCCATGTGGCCAGAAGACGCCTGCCTACCAACGCTTCCATGCCCTGGCCCAGCCCGGCCCACCAGGCCTTGTGCTGCCCTACAAGTACCAGGTGCTGGCCGAGATGTTTCGAAGCATGGACACCATTGTGGGCATGCTCCACAACCGCTCCGAGACTGCGACCTTTGCCAAGGTCAAGGGGGGGGTCCAGGACATGATGCGCAAGCGCTTCGAGGAGCGCAACGTGGGCCAGATCAAAACTGTGTATCCGATGTCCTACTGCTTCCGCCAGGAGCGCAATGTCCCCACCTTCAAGGACAGTGTCAAGAAGTCTGATTACCAGCTCACCATAGAGCCACTGCTGGGCCAGGAGCCTGGTGGCGCCGTGCCTCAGCTCACAGCCTCACGCCTGCTGCAGCGGCGACAGGTTTTCAGCCAGAACCTGGTGAACCGGGTCAAGGAGCACCACAAGGCCTTCCTCGCCTCCCTGACCCCCCCCATGGCTGTGCCTGAGGACCAGCTGACGCGCTGGCACCCGCGCTTCAACGTGGATGAGGTGCCTGACATCGAGCCTGCTGAGCTGCCCCAGCCACCCACCACGGAGCAGCTCACCAGTGCCCAGGAGGTGCTGGCCCGCGCCCGAAGCCTGATGTCGCCCAGGATGGAGAAGGCGTTGTGTCACGCAGCACTGTGTGCAGCGGAGCCCGGCAGCCCTGGATCCCCCGGCCCGGCCCTGCCAGCCAGCCCTGCCAGCCCGCCCAGCGCCCTGAAGGGTGTGCCCCAGGCCCTGCTGGAGCGGATCCGTGCCAAGGAGGCCCAGAAACAGCTGGCGCAGATGACGCGCTGCCCGGAGCACGAGCTGCGGCTGCAGCGGCTGCAGCGACTGCCCGAGCTGGCCCGCGTGCTGCGCGGTGTCTTCGTGTCTGAGAGAAAGCCCGCGCTCACCATGGAGGTGGCCTGCACCAGGATGGTGGGCAGCTGCCGTGCTGCCCTGAGCCTGGGGGAGATGGAGAGGCACCTGCTGCTCCTCAGCGAGCTGCTGCCTGACTGGCTCAGCCTGCACCGCATCCGCACCAGCACTTACATCAAGCTGGACAAGGCTGCCAACCTGGCCAGCATCACTGCACGGCTGGCCCACCAGGCCCACACTGAGGAGGGGCAGTGA

XM_004842681.1 Coding sequence

Ctu2 cytosolic thiouridylase subunit 2 homolog (S. pombe), transcript variant X4

Length: 1569 bp    Location: 878032..871707   Strand: -
>XM_004842681.1
ATGTGCCAGGTGGGCGAGGACTACGTGGAACCGCCGCCCCGGGAGCCCCCGCCGGTGCCCAGGCCCGGCTGTGGGCAGAAGTGTGTGAAGTGCAAGCAGGGCGATCCGGTGGTGGTTATCCGAGCTGGAGATGCCTTTTGCAGGGACTGTTTCAAGGCCTTCTATGTCCACAAGTTCAGAGCCATGCTAGGGAAGAACCGGCTCATCTTTCCTGGTGAGAAGGTGCTCTTGGCGTGGTCTGGTGGTCCCTCATCCAGCTCCATGGTCTGGCAGGTCCTTGAGGGCCTGAGTCAGGACTCTGCTAAGAGGCTGCGCTTCGTGCCAGGAGTCGTCTATGTGGATGAGGGTGCAGCCTGCGGCCAGAGCCCAGAGGACAGAGCAAAGACCCTGGCTGAGGTGAAGCAGGTTTTGCACGTCGTCAACTTCCCGTGGCACCTGGTGGCCCTGGAAGAGGTGTTCAGCCTGCCACCGTCGGTGCTGCGGTGCTGTCCCCAGGAGCCAGCTGGGACGGAGGGTGCCTACAAGTCCGCCGTGGACAGCTTTCTCCAGCAGTACCACGTGCTGGGGGCCGAGGGGGCTGAGGACAGCTGCGGCCGGGCTCGGGGGGAGGAGGAGCGGCCCTGGCCCCAGAGCCAGGACCCCCACAGCCTCCCGAGCCCAGCTGGGCCCCCCTCTGCCGCCCAGACCGAGGCCCTGTGTAGACTGTTTGAGTCTGTGAGGACGCTGACGGCCAAGGAGGAGCTTCTGCAGACCCTGCGGAGCCACCTGATCCTGCACGTGGCTCGAGCCCACGGCTACTCCAAGGTGATGACCGGGGACAGCTGCACCCGCCTGGCCATCAAGCTCATGACCAACCTGGCCCTGGGCCGAGGAGCCTTCCTCGCCTGGGACACGGGCTTCTCGGACGAGCGACACGGGGATGTGGTGGTGGTGCGGCCCATGAGGGACCACACTCTGAAGGAGGTGGCCTTCTACAACCGTCTGTTTGCTGTTCCCTTAGTCTTCACACCGGCTGTGGACACTAAGGCCCCCGAGAAAGCCAGCGTCCACCGGCTGATGGAGGCCTTCATCCTCAGGCTGCAGGCCCAGTTCCCCTCCACGGTCAGCACTGTGTACAGGACAGGAGAGAAGCTGGTCAAGGCGCCCAGGGACGGCTGTGGTGGGGGGCCCTCAGGCCCTCGGTGCCTCCTCTGCCTGTGCACACTGGACATCGACACTGCTGACAGTGCCACGGCTTTTGGGGCTCAGACCTCGAGTCTCTCCCAGATGCCGCCGTCCACCCTTCAGGCTGAGGCTGGGACGCCCACAGCACCCTGCTGCGCTGTAGGCGAGGGCCCTGGCTGTTGCTGGAAGGCCCGTGGGAGGACGGACGATGCCCAGGCGCAGGTCACCCAGCAGCTGTGCTACGGCTGCAGGGGGAACATGAGCGACCTCCCCTCCCTGGACCGCTTGCCGCCCTACATCCTGGCCGAGGCCCAGCTCCGCAGCCAGAGGGCCGGGGTCATGCAGGAGATCCAGGAGTATCTGATTGAGGACAGCAGTGACGAGGCAGAGGGCCCGCAGAGCTGA

XM_004842679.1 Coding sequence

Ctu2 cytosolic thiouridylase subunit 2 homolog (S. pombe), transcript variant X2

Length: 1638 bp    Location: 878032..871707   Strand: -
>XM_004842679.1
ATGTGCCAGGTGGGCGAGGACTACGTGGAACCGCCGCCCCGGGAGCCCCCGCCGGTGCCCAGGCCCGGCTGTGGGCAGAAGTGTGTGAAGTGCAAGCAGGGCGATCCGGTGGTGGTTATCCGAGCTGGAGATGCCTTTTGCAGGGACTGTTTCAAGGCCTTCTATGTCCACAAGTTCAGAGCCATGCTAGGGAAGAACCGGCTCATCTTTCCTGGTGAGAAGGTGCTCTTGGCGTGGTCTGGTGGTCCCTCATCCAGCTCCATGGTCTGGCAGGTCCTTGAGGGCCTGAGTCAGGACTCTGCTAAGAGGCTGCGCTTCGTGCCAGGAGTCGTCTATGTGGATGAGGGTGCAGCCTGCGGCCAGAGCCCAGAGGACAGAGCAAAGACCCTGGCTGAGGTGAAGCAGGTTTTGCACGTCGTCAACTTCCCGTGGCACCTGGTGGCCCTGGAAGAGGTGTTCAGCCTGCCACCGTCGGTGCTGCGGTGCTGTCCCCAGGAGCCAGCTGGGACGGAGGGTGCCTACAAGTCCGCCGTGGACAGCTTTCTCCAGCAGTACCACGTGCTGGGGGCCGAGGGGGCTGAGGACAGCTGCGGCCGGGCTCGGGGGGAGGAGGAGCGGCCCTGGCCCCAGAGCCAGGACCCCCACAGCCTCCCGAGCCCAGCTGGGCCCCCCTCTGCCGCCCAGACCGAGGCCCTGTGTAGACTGTTTGAGTCTGTGAGGACGCTGACGGCCAAGGAGGAGCTTCTGCAGACCCTGCGGAGCCACCTGATCCTGCACGTGGCTCGAGCCCACGGCTACTCCAAGGTGATGACCGGGGACAGCTGCACCCGCCTGGCCATCAAGCTCATGACCAACCTGGCCCTGGGCCGAGGAGCCTTCCTCGCCTGGGACACGGGCTTCTCGGACGAGCGACACGGGGATGTGGTGGTGGTGCGGCCCATGAGGGACCACACTCTGAAGGAGGTGGCCTTCTACAACCGTCTGTTTGCTGTTCCCTTAGTCTTCACACCGGCTGTGGACACTAAGGCCCCCGAGAAAGCCAGCGTCCACCGGCTGATGGAGGCCTTCATCCTCAGGCTGCAGGCCCAGTTCCCCTCCACGGTCAGCACTGTGTACAGGACAGGAGAGAAGCTGGTCAAGGCGCCCAGGGACGGCTGTGGTGGGGGGCCCTCAGGCCCTCGGTGCCTCCTCTGCCTGTGCACACTGGACATCGACACTGCTGACAGTGCCACGGCTTTTGGGGCTCAGACCTCGAGTCTCTCCCAGATGCCGCCGTCCACCCTTCAGGCTGAGGCTGGGACGCCCACAGCACCCTGCTGCGCTGTAGGCGAGGGCCCTGGCTGTTGCTGGAAGGCCCGTGGGAGGACGGACGATGCCCAGGCGCAGGTCACCCAGCAGCTGTGCTACGGCTGCAGGGGGAACATGAGCGACCTCCCCTCCCTGGACCGCTTGCCGCCCTACATCCTGGCCGAGGCCCAGCTCCGCAGCCAGAGGTACTGGGCCTGTCTGGTGGGGTCCCAGGTGGGAGCCCCTGGGCTGGTTCCCACCCACTCTTCCCACAGGGCCGGGGTCATGCAGGAGATCCAGGAGTATCTGATTGAGGACAGCAGTGACGAGGCAGAGGGCCCGCAGAGCTGA

XM_004842680.1 Coding sequence

Ctu2 cytosolic thiouridylase subunit 2 homolog (S. pombe), transcript variant X3

High confidence: 4 potential gene matches
Length: 1620 bp    Location: 878032..871707   Strand: -
>XM_004842680.1
ATGTGCCAGGTGGGCGAGGACTACGTGGAACCGCCGCCCCGGGAGCCCCCGCCGGTGCCCAGGCCCGGCTGTGGGCAGAAGTGTGTGAAGTGCAAGCAGGGCGATCCGGTGGTGGTTATCCGAGCTGGAGATGCCTTTTGCAGGGACTGTTTCAAGGCCTTCTATGTCCACAAGTTCAGAGCCATGCTAGGGAAGAACCGGCTCATCTTTCCTGGTGAGAAGGTGCTCTTGGCGTGGTCTGGTGGTCCCTCATCCAGCTCCATGGTCTGGCAGGTCCTTGAGGGCCTGAGTCAGGACTCTGCTAAGAGGCTGCGCTTCGTGCCAGGAGTCGTCTATGTGGATGAGGGTGCAGCCTGCGGCCAGAGCCCAGAGGACAGAGCAAAGACCCTGGCTGAGGTGAAGCAGGTTTTGCACGTCGTCAACTTCCCGTGGCACCTGGTGGCCCTGGAAGAGGTGTTCAGCCTGCCACCGTCGGTGCTGCGGTGCTGTCCCCAGGAGCCAGCTGGGACGGAGGGTGCCTACAAGTCCGCCGTGGACAGCTTTCTCCAGCAGTACCACGTGCTGGGGGCCGAGGGGGCTGAGGACAGCTGCGGCCGGGCTCGGGGGGAGGAGGAGCGGCCCTGGCCCCAGAGCCAGGACCCCCACAGCCTCCCGAGCCCAGCTGGGCCCCCCTCTGCCGCCCAGACCGAGGCCCTGTGTAGACTGTTTGAGTCTGTGAGGACGCTGACGGCCAAGGAGGAGCTTCTGCAGACCCTGCGGAGCCACCTGATCCTGCACGTGGCTCGAGCCCACGGCTACTCCAAGGTGATGACCGGGGACAGCTGCACCCGCCTGGCCATCAAGCTCATGACCAACCTGGCCCTGGGCCGAGGAGCCTTCCTCGCCTGGGACACGGGCTTCTCGGACGAGCGACACGGGGATGTGGTGGTGGTGCGGCCCATGAGGGACCACACTCTGAAGGAGGTGGCCTTCTACAACCGTCTGTTTGCTGTTCCCTTAGTCTTCACACCGGCTGTGGACACTAAGGCCCCCGAGAAAGCCAGCGTCCACCGGCTGATGGAGGCCTTCATCCTCAGGCTGCAGGCCCAGTTCCCCTCCACGGTCAGCACTGTGTACAGGACAGGAGAGAAGCTGGTCAAGGCGCCCAGGGACGGCTGTGGTGGGGGGCCCTCAGGCCCTCGGTGCCTCCTCTGCCTGTGCACACTGGACATCGACACTGCTGACAGTGCCACGGCTTTTGGGGCTCAGACCTCGAGTCTCTCCCAGATGCCGCCGTCCACCCTTCAGGCTGAGGCTGGGACGCCCACAGCACCCTGCTGCGCTGTAGGCGAGGGCCCTGGCTGTTGCTGGAAGGCCCGTGGGAGGACGGACGATGCCCAGGCGCAGGTCACCCAGCAGCTGTGCTACGGCTGCAGGGGGAACATGAGCGACCTCGTGAGTGTGGCTGCCCCTCCCCTCCCGGTGGCAGCGGGGTTCGGTGCTTGGGCTCTGCCACCCCTCACCCAGCTGGCTTCTGTTGCAGCCCTCCCTGGACCGCTTGCCGCCCTACATCCTGGCCGAGGCCCAGCTCCGCAGCCAGAGGGCCGGGGTCATGCAGGAGATCCAGGAGTATCTGATTGA

XM_004842684.1 Coding sequence

Mvd mevalonate (diphospho) decarboxylase

High confidence: 4 potential gene matches
Length: 1272 bp    Location: 905921..911591   Strand: +
>XM_004842684.1
ATGGAGCGCCCGCCCGGCGGGTCCCGCAGGATTCGCGGTGGTGCGGCTCCGGACTGTTGGACAATGCCCTCAGACGAGTCGTTGGTGGCCGTCACCTGCACTGCGCCGGTCAACATCGCGGTTATCAAATACTGGGGCAAGCGAGATGAGCAGCTGATCCTGCCCCTCAACTCCTCTCTGAGCATCACTGTGCACCAGGACCAGCTAAGAACCACCACGACGGCTGCTATCAGCAAGGACTTCACGGAGGACCGGGTCTGGCTGAACGGCCGGGAGGAGGACGTGCGGCAGCCGCGGCTCCAGGCCTGCTTGAGGGAGATCCGCCGCCTGGCCCGGAAGCGCAGGAGCACAGGAGATGGGGACCCACTGCCCCCCAGTGTCAGTGACAGGGTGCACGTGGCCTCGGTGAACAACTTCCCCACGGCTGCAGGCTTGGCCTCCTCAGCAGCGGGCTTCGCCTGCCTCGCCTACACCCTGGCCCGTGCCTATGGGGTTGAGGGTGACCTCTCGGAAGTGGCTCGCAGGGGCTCGGGCAGCGCGTGTCGCAGTCTGTACGGGGGCTTCGTCGAGTGGCAGATGGGGCAGCAGGCAGATGGCAAGGACAGCGTCGCCCGGCAGGTGGCCCCTGAGTCGCACTGGCCCCAGCTCCGAGTCCTCATCCTGGTGGTGAGCGCCGAGCAGAAGCCGATGGGCAGCACGGCAGGCATGCAGACCAGTGTGCAGACCAGCGCCCTGCTCAAGTTCCGGGCGGAGGCGCTCGTGCCGGCACGCATGGTGGAGATGGCCCGCTGCATCCAGGAGCGAGACTTCCCGGGCTTCGCCGAGCTCACCATGAAGGACAGCAATCAGTTCCACGCCACCTGCCTGGACACCTTCCCGCCCATCTCCTACCTCAGCGACACGTCCCGACGCGTCATGCAGCTAGTGCACCGCTTCAACGCCCACTACGGGCAGACAAAGGTGGCGTACACATTTGATGCGGGCCCCAACGCTGTGCTCTTCACCCTGGATGACACCATGGCTGAGTTTGTGGCTGTCGTGAGGCACACCTTTCCCCCAGAGGCCGATGGAGACAAGTTTCTGAAGGGGCTGCCGGTGACACCCGCCCCTATCTCTGATGAGCTGAAAGCCACACTGGCCATGGAGCCTGTCCCTGGAGGTGTCCAGTATGTCATTGCCACGCAGGTGGGGCCAGGGCCGCAAGTCCTGGATGACCCGGACGCTCACCTCCTGGGCCCTGATGGCCTGCCGAAGCCCAAGCCGGCTGCCTGA

XM_004842687.1 Coding sequence

Zc3h18 zinc finger CCCH-type containing 18, transcript variant X2

Length: 2934 bp    Location: 965937..923734   Strand: -
>XM_004842687.1
ATGGATGTGGCCGAGAGCCCTGAACGGGATCCTCACTCCCCAGAGGACGAAGAGGAGCAGCCGACACTCTCGGACGATGACATTCTGAGGGAAAGCGGATCAGATCAGGATTTAGATGGAGCTAGGGGGAGGGCTTCTGATTTGGAGGATGAGGAAAACGCAGCCCCAGTACCAGGCCAGGAGGAGGAGAACCGCTCCGATGAAGAGGACAGAGCCAGTGAACCCAAGTCCCAGGATCAGGACTCCGAGGCTCGAGAGCTGAGCAGGGATCGGACGGGCTCCCCGTGTGAAGAAGAGGGGAACGATGGCGAGGAAGACCAGACGAGTGACCTCAGGGACGAGGCCTCCTCGGTGACCAGGGAGCTGGACGAGCACGAACTGGACTATGACGAGGAGGTCCCTGAGGAGCCGGCCCCTGCCGCCCAGGAGGAGGAGGCCGAGAAGGCGGGGGCGGAGGAGGAGGAGGATAAGGAGGCCAGCGCGCCTGCCCAGGAAGGGAGGCCCACTGTCCAGAGTAGGGGAGAAAAGGAGCCCCCGGAGGCCACCAAGGAGAGGAGAAAAGAGGACGACGATGGGGAGATTGACGACGGGGAGATAGACGACGACGACTTGGAAGAAGGCGAAGTGAAGGACCCCAGTGACCGGAAGGTGAGGCCTCGCCCCACCTGCCGATTCTTCATGAAAGATGTTGTGACACCATTATCCACTCCTCCACCAATACCAAATTCCATACCACTCAGAGACCAGGTTAAAGGGAACTGTACCTGGGGGATGAACTGTAGGTTCATACACCCCGGAGTGAACGACAAGGGGAACTACTCCCTCATCACCAAAGCCGAGCCCTTCCCGCCCAACGGTGCCCCGCCACTCGGACCTCACCCCCTGATGCCTGCCAACCCGTGGGGTGGGCCAGTAGTTGATGAAATTTTGCCTCCACCCCCGCCGGAGCCCCCAACAGAGAGTGCCTGGGAACGTGGACTCCGGCATGCGAAGGAGGTTTTAAAAAAAGCAACCATTCGTAAGGAACAGGAGCCTGATTTTGAAGAGAAAAGGTTCACAGTGACCATTGGTGAAGATGAGCGAGAGTTTGACAAAGAAAATGAAGTTTTCCGGGATTGGAATTCTCGGGTCCCAAGAGATGTCAGAGATACAGCACTTGAGCCTTACGCAGATCCTTACTACGACTATGAAATAGAGCGGTTTTGGCGTGGTGGACAGTACGAGAATTTTAGGGTGCAATACACAGATGCAGAGCCGTATCATAATTACCGAGAAAGGGAGAGGGACCGAGAGCGTGAGAACAGACAGCGTGAGCGCGAGCGCGAGCGGGAGCGAGACCGAGAGCGCGAGCGGCGGCAGAGGGAGCGCGAGCGCGAGCGGGAGCGAGAGCGGGACAAGGAGCGGCAGCGGCGGAAGGAGGAGTGGGAGAGAGAGCGAGCCAAGCGCGACGAGAAGGACAGACAGCACCGGGACCGCGAGCGGGACCGCGACAAGGAGCGGGACAAGGACAAGGACAAGGACAAGCCGAAGGCCCGCTCTCCGCAGCCCCCAAGCCGTCAAGCTGAGCCACCGAAGAAGGAGGCCGCCTCAGGGCCACAGGTAAAGCGGGCCGATGAGTGGAAGGACCCATGGCGCCGATCCAAGTCTCCCAGGAAGAAACTCGGGGTGTCAGTCTCTCCTAGCCGGGCACGAAGGCGTCGAAAAACTTCTGCCTCCTCCGCCTCCGCCTCCAATTCCTCCAGGTCATCTTCTCGGTCTTCGTCCTACTCCGGCTCCGGCTCGTCACGGTCCAGGTCGAGGTCCTCATCCTACAGCTCCTACTCCAGCCGCTCTTCCAGACACAGCTCCTTCTCAGCCAGCCGGTCCAGGTCCCGGTCCTTCTCCTCGTCCCCGTCGCAGTCCCCCACACCCTCCCCACACAGACCTTCCATCAGAGCCAAGGGGGAGCTGGCGCCACCCCCCGGGAAAGCAGGAGAGAAGTCCTTGAAGAAGCCAGCCCCACCTCCAGTGCCCCTACAGGCCAGCAAGACTCCTGCCCCTGCCCCTGAGCCCACAAAGCCTGGAGACCCCCGGGAAACCAGGAGGAAGGAGCGGCAGGCCAGGACGCCCCCCCGGAGGCGAACGCTCAGCGGCAGTGGCAGTGGCAGCGGCAGCAGCTACAGTGGCTCCAGCTCCCGATCCAGGTCCCTGAGTGTGAGCAGCGTCTCCTCGGTGTCCAGCGCCACCTCGAGCAGCAGCTCGGTGCACAGCGTGGACTCGGAGGACATGTATGCGGACCTGGCCAGCCCCGTGTCCTCGGCCAGTTCCCAGTCCCCCACCCCAGCCCAGACCAAGAAGGAGCGAGGAAAATCAAAGAAAGAAGACGGCGTTAAGGAGGAAAAGCGAAAAAGGGACACCTCCACGCAGCCGCCCAAGTCCTCGAAGCCCGCGGCCAGCGGGAAGCCCTCACAGCAGCTCACAGCCCCGGCCCCCACGGCCCCTGGGCAGCCCCCCCAGGGCTCCTTCGTGGCCCACAAGGAGATCAAGCTGACGCTGCTGAACAAGGCAGCTGACAAAGGAAGTAGGAAGCGGTATGAGCCAGCGGACAAGGACCGACAAAGCCCCCCAGCCAAGCGGGCCACCCTGTCCCCAGACCGAGGTTCCCGGGACCGAAAGTCAGGCGGGAGACAGGGCTCCCCCAAGCCAGAGCGGCAGAGGAGCCAGAACTCCAAGGCCCTTGTGGCTCCCACAGACAGGAAGCGCCAGCTGTCACCCCAGTCCAAGAGCTCCAGCAAGGTGACCAGCGTGCCCGGCAAAGCTGCAGACAGCATGGCCCCGGGCACCAAGGCCGGCAAGGCCAGCACGCTGTCACGCCGGGAGGAGCTCCTGAAGCAGCTCAAGGCCGTGGAGGACGCCATCGCGCGCAAGCGAGCCAAGATCCCCGGGAAGGTGTAG

XM_004842688.1 Coding sequence

Zc3h18 zinc finger CCCH-type containing 18, transcript variant X3

Length: 2934 bp    Location: 963414..923734   Strand: -
>XM_004842688.1
ATGGATGTGGCCGAGAGCCCTGAACGGGATCCTCACTCCCCAGAGGACGAAGAGGAGCAGCCGACACTCTCGGACGATGACATTCTGAGGGAAAGCGGATCAGATCAGGATTTAGATGGAGCTAGGGGGAGGGCTTCTGATTTGGAGGATGAGGAAAACGCAGCCCCAGTACCAGGCCAGGAGGAGGAGAACCGCTCCGATGAAGAGGACAGAGCCAGTGAACCCAAGTCCCAGGATCAGGACTCCGAGGCTCGAGAGCTGAGCAGGGATCGGACGGGCTCCCCGTGTGAAGAAGAGGGGAACGATGGCGAGGAAGACCAGACGAGTGACCTCAGGGACGAGGCCTCCTCGGTGACCAGGGAGCTGGACGAGCACGAACTGGACTATGACGAGGAGGTCCCTGAGGAGCCGGCCCCTGCCGCCCAGGAGGAGGAGGCCGAGAAGGCGGGGGCGGAGGAGGAGGAGGATAAGGAGGCCAGCGCGCCTGCCCAGGAAGGGAGGCCCACTGTCCAGAGTAGGGGAGAAAAGGAGCCCCCGGAGGCCACCAAGGAGAGGAGAAAAGAGGACGACGATGGGGAGATTGACGACGGGGAGATAGACGACGACGACTTGGAAGAAGGCGAAGTGAAGGACCCCAGTGACCGGAAGGTGAGGCCTCGCCCCACCTGCCGATTCTTCATGAAAGATGTTGTGACACCATTATCCACTCCTCCACCAATACCAAATTCCATACCACTCAGAGACCAGGTTAAAGGGAACTGTACCTGGGGGATGAACTGTAGGTTCATACACCCCGGAGTGAACGACAAGGGGAACTACTCCCTCATCACCAAAGCCGAGCCCTTCCCGCCCAACGGTGCCCCGCCACTCGGACCTCACCCCCTGATGCCTGCCAACCCGTGGGGTGGGCCAGTAGTTGATGAAATTTTGCCTCCACCCCCGCCGGAGCCCCCAACAGAGAGTGCCTGGGAACGTGGACTCCGGCATGCGAAGGAGGTTTTAAAAAAAGCAACCATTCGTAAGGAACAGGAGCCTGATTTTGAAGAGAAAAGGTTCACAGTGACCATTGGTGAAGATGAGCGAGAGTTTGACAAAGAAAATGAAGTTTTCCGGGATTGGAATTCTCGGGTCCCAAGAGATGTCAGAGATACAGCACTTGAGCCTTACGCAGATCCTTACTACGACTATGAAATAGAGCGGTTTTGGCGTGGTGGACAGTACGAGAATTTTAGGGTGCAATACACAGATGCAGAGCCGTATCATAATTACCGAGAAAGGGAGAGGGACCGAGAGCGTGAGAACAGACAGCGTGAGCGCGAGCGCGAGCGGGAGCGAGACCGAGAGCGCGAGCGGCGGCAGAGGGAGCGCGAGCGCGAGCGGGAGCGAGAGCGGGACAAGGAGCGGCAGCGGCGGAAGGAGGAGTGGGAGAGAGAGCGAGCCAAGCGCGACGAGAAGGACAGACAGCACCGGGACCGCGAGCGGGACCGCGACAAGGAGCGGGACAAGGACAAGGACAAGGACAAGCCGAAGGCCCGCTCTCCGCAGCCCCCAAGCCGTCAAGCTGAGCCACCGAAGAAGGAGGCCGCCTCAGGGCCACAGGTAAAGCGGGCCGATGAGTGGAAGGACCCATGGCGCCGATCCAAGTCTCCCAGGAAGAAACTCGGGGTGTCAGTCTCTCCTAGCCGGGCACGAAGGCGTCGAAAAACTTCTGCCTCCTCCGCCTCCGCCTCCAATTCCTCCAGGTCATCTTCTCGGTCTTCGTCCTACTCCGGCTCCGGCTCGTCACGGTCCAGGTCGAGGTCCTCATCCTACAGCTCCTACTCCAGCCGCTCTTCCAGACACAGCTCCTTCTCAGCCAGCCGGTCCAGGTCCCGGTCCTTCTCCTCGTCCCCGTCGCAGTCCCCCACACCCTCCCCACACAGACCTTCCATCAGAGCCAAGGGGGAGCTGGCGCCACCCCCCGGGAAAGCAGGAGAGAAGTCCTTGAAGAAGCCAGCCCCACCTCCAGTGCCCCTACAGGCCAGCAAGACTCCTGCCCCTGCCCCTGAGCCCACAAAGCCTGGAGACCCCCGGGAAACCAGGAGGAAGGAGCGGCAGGCCAGGACGCCCCCCCGGAGGCGAACGCTCAGCGGCAGTGGCAGTGGCAGCGGCAGCAGCTACAGTGGCTCCAGCTCCCGATCCAGGTCCCTGAGTGTGAGCAGCGTCTCCTCGGTGTCCAGCGCCACCTCGAGCAGCAGCTCGGTGCACAGCGTGGACTCGGAGGACATGTATGCGGACCTGGCCAGCCCCGTGTCCTCGGCCAGTTCCCAGTCCCCCACCCCAGCCCAGACCAAGAAGGAGCGAGGAAAATCAAAGAAAGAAGACGGCGTTAAGGAGGAAAAGCGAAAAAGGGACACCTCCACGCAGCCGCCCAAGTCCTCGAAGCCCGCGGCCAGCGGGAAGCCCTCACAGCAGCTCACAGCCCCGGCCCCCACGGCCCCTGGGCAGCCCCCCCAGGGCTCCTTCGTGGCCCACAAGGAGATCAAGCTGACGCTGCTGAACAAGGCAGCTGACAAAGGAAGTAGGAAGCGGTATGAGCCAGCGGACAAGGACCGACAAAGCCCCCCAGCCAAGCGGGCCACCCTGTCCCCAGACCGAGGTTCCCGGGACCGAAAGTCAGGCGGGAGACAGGGCTCCCCCAAGCCAGAGCGGCAGAGGAGCCAGAACTCCAAGGCCCTTGTGGCTCCCACAGACAGGAAGCGCCAGCTGTCACCCCAGTCCAAGAGCTCCAGCAAGGTGACCAGCGTGCCCGGCAAAGCTGCAGACAGCATGGCCCCGGGCACCAAGGCCGGCAAGGCCAGCACGCTGTCACGCCGGGAGGAGCTCCTGAAGCAGCTCAAGGCCGTGGAGGACGCCATCGCGCGCAAGCGAGCCAAGATCCCCGGGAAGGTGTAG

XM_004842690.1 Coding sequence

Zfpm1 zinc finger protein, FOG family member 1, transcript variant X1

Length: 2853 bp    Location: 1035653..988114   Strand: -
>XM_004842690.1
ATGTCCAGGAGGAAGCAGAGCAACCCCCGGCAGATCAGGCGTTCTCCTGGAGACATGGATGCTGCAGAGGAGGCCCAGGCCCCAGACAGCAGCCTTGAGGAGCAGGAGGCCCCAGCACCAGAGCCCACAGCCATAGGGAGGCCGGAGCCCCTGACCCCTTCCACCGCAGACGTGAATCCACCTCTGGCACCAGCGCCAGTGCACTCCACATCCCCGGGAGCCCCCGAGGAGATGGAGGTGCCAGGGCCTGAGACACTGCGGGAGGAGGCAACCAGCCCCTGGAGCGGGCCAGAGGAGCTGGAGCTGGAGCTTCGGGATGGACAGAGGTGCGTGCAGGCCCGACTCAGCCTCGCCAAGGGCCTGTGCTGGGGCCCGTTCCGTGGGAGCATCCAGACCAGAGCACCATCCCCTGGGCAGGCAGAACCGGGCCCGGCCCTGACCCTGCTGCTCACAGATGCAGCCTGCTGGCTGAGGACGCTGCCCCAGGCCCTGACCGAGGCTGACGCCAACTCGGAGATCTACAGGAAGGATGGCAGCCTCTGGTGCAGGGTCACCAGGCCGGTGCCCGCGGGCGAGGCCCTGTGTGCACTCCTGACGGCCAAGCCCCGGGGCACCCCCAGCCATCCCACGAAGGAGGAACCAGCAGAGCCCGAGAACCCTGCCCCAGTGCCCCCTGACATCCAGCTGCTGCCCCAGCAGGCCGGCATGGCGTCCATCCTCGCCACAGCAGTCATCAACAAGGACGTCTTCCCGTGCAAGGACTGTGGCATCTGGTACCGCAACGAGCGCAACCTGCAAGCCCACCTCCTCTACTACTGCGCCAGCCGCCAGGGTGCCAGCTCCCCAGCCGCGGCAGCCACAGAGGACAAGCCTAAGGAGCCATACCCCAACGAGCGGATCTGCCCCTTCCCACAGTGCCGTAAGAGCTGCCCCAGCGCCAGCTCCCTGGAGATCCACATGCGCAGCCACAGCGGAGAGCGGCCCTTTGTATGCCTCATCTGCCTGTCGGCCTTCACCACCAAGGCCAACTGCGAACGCCACCTCAAGGTGCACACAGACACGCTCAGCGGTGTCTGTCACAGCTGTGGCTTCATCTCCACCACTCGGGACATCCTCTATAGCCACCTGGTGACCAGCCACATGGTCTGCCAGCCCGGCTCCAAGGGGGAGATATACTCGCCAGGTGCAGCACACCCAGCTGCCAAGCTGCCTGCAGACGCCCTCGCCAGCCTCCAGAAGCACGCAGGCCTGCATGGTCCCCTGGCCTCCGCGGACCTAGGCCTGGCACCCATCCCATCACCAGGCCTGGACAAGACCCTGGTTGAGGCCACCAACGGAGAGGCCCAGAATGGGAGCGGCGGCGAGACCCCCGCGATCCCCAAGAACGTCAAGGTGGAGGCGGCCGAGGAGTCGGAGGCAGCGCGCGTGCCAGGCCAGGCAGAGCCTGCACCCCGGGCCCCGTCGCGGACGCCGTCGCCCCACAGCCCCGGTGCGGCCCGCGTGAAGGCCGAGATGCCCAGTCCCACGCCTGGCGCCAGCCCCGCACCCGGAGAGCTGGGTTTGGCCGGCGCGCTTTTCCTGCCGCAGCTCGTGTTCGCGCCAGACGCGGGCGCCGCCCCCGGCCCCGCGGCGCCCCAGGCCTCGGAGATCCTGGCCAAGATGTCGGAGCTGGTGCACAGCCGGCTGCAGCAGGGCGCGGGGGCGCCGGCCGCGCTGCTGGCGGGGACCAAGGGTGCCACGTGCTTCGAGTGCGAGATCACCTTCAACAACGTCAACAACTTCTACGTGCACAAGCGCCTCTACTGCTCCGGCCGGCGCCCGCCCGAAGACGCGCCCGCCGCGCGCAGGCCCAAGGCGCCACCGGGCGGCGCGCCTGCAGAACCCGATGCGCCGCGATCGCCGCCGGCGCCCGGGGCGCGTGAGGACGAGGCGGGCGGCGCAGCCACGCCCGAGGCCGATGGGCCCGGCCGGGGCAGCGAGGGCAGCCAGAGCCCGGGCAGCTCAGTGGACGACGCGGAGGACGACCCCAGCCGTACACTGTGCGAGGCCTGCAACATCCGCTTCAGCCGCCACGAGACCTACACGGTGCACAAGCGCTACTACTGCGCCTCGCGCCACGACCCTCCGCCGCGCAGGCCACCCGCTCCCGCTCCCGCTCCAGGGTCCGCGGCGCCCACGCTGACCACGCCGCCTGTGCGCACGCGCCGGCGCCGCAAGCTGTACGAGCTGCACGCGCCCGGCTCCGCCCCCGCACCGCCTGGCCATGGCCCCCCAGCGGCTGGCCCCGCGCCCGAGCCCCCCGGCTCCCCCGGACCCGGAGGCGGAAATGGGAGCGCCGGTCCCGCCCCCGCGCGCTCGCCCGCGCCGGCCGCCGCCGACGGCCCCATCGACCTGAGCAAGCGGCCGCGCCGACAGCCCCACGACGCGCCCGCCGCGCTGCCCGCGCTGGCCGACTACCACGAGTGCACGGCCTGCCGCGTGAGCTTCCACAGCCTCGAGGCCTACCTGGCTCACAAGCAGTACGCGTGCCCCGCCGCGCCACTGCGCCCGGCCGCCGTGTGCCCCTACTGCCCGGCCAATGGGCGTGCGCGCGGCGACCTGGGGGAGCACCTACGCCGGGCACACGGCCTGCGGGACAGCCCCCCGCCGCGCTCCCCGTCCCCGCCGCCCGCGCCCGCCGAGGCCCCCGCCGACCCGGGCGCCCCCACCCCCGGTAAGGGCCCGCCCGCGCCTCCCACGCCCGGTGGCCACCGCTACTGCCGCTTGTGCAACATCCGGTTCAGCAGCCTGTCCACCTTCATCGCTCACAAGAAGTACTACTGCTCCTCGCACGCCGCCGAGCACGTGAAGTGA

XM_004842691.1 Coding sequence

Zfpm1 zinc finger protein, FOG family member 1, transcript variant X2

Length: 2799 bp    Location: 1034521..988114   Strand: -
>XM_004842691.1
ATGGATGCTGCAGAGGAGGCCCAGGCCCCAGACAGCAGCCTTGAGGAGCAGGAGGCCCCAGCACCAGAGCCCACAGCCATAGGGAGGCCGGAGCCCCTGACCCCTTCCACCGCAGACGTGAATCCACCTCTGGCACCAGCGCCAGTGCACTCCACATCCCCGGGAGCCCCCGAGGAGATGGAGGTGCCAGGGCCTGAGACACTGCGGGAGGAGGCAACCAGCCCCTGGAGCGGGCCAGAGGAGCTGGAGCTGGAGCTTCGGGATGGACAGAGGTGCGTGCAGGCCCGACTCAGCCTCGCCAAGGGCCTGTGCTGGGGCCCGTTCCGTGGGAGCATCCAGACCAGAGCACCATCCCCTGGGCAGGCAGAACCGGGCCCGGCCCTGACCCTGCTGCTCACAGATGCAGCCTGCTGGCTGAGGACGCTGCCCCAGGCCCTGACCGAGGCTGACGCCAACTCGGAGATCTACAGGAAGGATGGCAGCCTCTGGTGCAGGGTCACCAGGCCGGTGCCCGCGGGCGAGGCCCTGTGTGCACTCCTGACGGCCAAGCCCCGGGGCACCCCCAGCCATCCCACGAAGGAGGAACCAGCAGAGCCCGAGAACCCTGCCCCAGTGCCCCCTGACATCCAGCTGCTGCCCCAGCAGGCCGGCATGGCGTCCATCCTCGCCACAGCAGTCATCAACAAGGACGTCTTCCCGTGCAAGGACTGTGGCATCTGGTACCGCAACGAGCGCAACCTGCAAGCCCACCTCCTCTACTACTGCGCCAGCCGCCAGGGTGCCAGCTCCCCAGCCGCGGCAGCCACAGAGGACAAGCCTAAGGAGCCATACCCCAACGAGCGGATCTGCCCCTTCCCACAGTGCCGTAAGAGCTGCCCCAGCGCCAGCTCCCTGGAGATCCACATGCGCAGCCACAGCGGAGAGCGGCCCTTTGTATGCCTCATCTGCCTGTCGGCCTTCACCACCAAGGCCAACTGCGAACGCCACCTCAAGGTGCACACAGACACGCTCAGCGGTGTCTGTCACAGCTGTGGCTTCATCTCCACCACTCGGGACATCCTCTATAGCCACCTGGTGACCAGCCACATGGTCTGCCAGCCCGGCTCCAAGGGGGAGATATACTCGCCAGGTGCAGCACACCCAGCTGCCAAGCTGCCTGCAGACGCCCTCGCCAGCCTCCAGAAGCACGCAGGCCTGCATGGTCCCCTGGCCTCCGCGGACCTAGGCCTGGCACCCATCCCATCACCAGGCCTGGACAAGACCCTGGTTGAGGCCACCAACGGAGAGGCCCAGAATGGGAGCGGCGGCGAGACCCCCGCGATCCCCAAGAACGTCAAGGTGGAGGCGGCCGAGGAGTCGGAGGCAGCGCGCGTGCCAGGCCAGGCAGAGCCTGCACCCCGGGCCCCGTCGCGGACGCCGTCGCCCCACAGCCCCGGTGCGGCCCGCGTGAAGGCCGAGATGCCCAGTCCCACGCCTGGCGCCAGCCCCGCACCCGGAGAGCTGGGTTTGGCCGGCGCGCTTTTCCTGCCGCAGCTCGTGTTCGCGCCAGACGCGGGCGCCGCCCCCGGCCCCGCGGCGCCCCAGGCCTCGGAGATCCTGGCCAAGATGTCGGAGCTGGTGCACAGCCGGCTGCAGCAGGGCGCGGGGGCGCCGGCCGCGCTGCTGGCGGGGACCAAGGGTGCCACGTGCTTCGAGTGCGAGATCACCTTCAACAACGTCAACAACTTCTACGTGCACAAGCGCCTCTACTGCTCCGGCCGGCGCCCGCCCGAAGACGCGCCCGCCGCGCGCAGGCCCAAGGCGCCACCGGGCGGCGCGCCTGCAGAACCCGATGCGCCGCGATCGCCGCCGGCGCCCGGGGCGCGTGAGGACGAGGCGGGCGGCGCAGCCACGCCCGAGGCCGATGGGCCCGGCCGGGGCAGCGAGGGCAGCCAGAGCCCGGGCAGCTCAGTGGACGACGCGGAGGACGACCCCAGCCGTACACTGTGCGAGGCCTGCAACATCCGCTTCAGCCGCCACGAGACCTACACGGTGCACAAGCGCTACTACTGCGCCTCGCGCCACGACCCTCCGCCGCGCAGGCCACCCGCTCCCGCTCCCGCTCCAGGGTCCGCGGCGCCCACGCTGACCACGCCGCCTGTGCGCACGCGCCGGCGCCGCAAGCTGTACGAGCTGCACGCGCCCGGCTCCGCCCCCGCACCGCCTGGCCATGGCCCCCCAGCGGCTGGCCCCGCGCCCGAGCCCCCCGGCTCCCCCGGACCCGGAGGCGGAAATGGGAGCGCCGGTCCCGCCCCCGCGCGCTCGCCCGCGCCGGCCGCCGCCGACGGCCCCATCGACCTGAGCAAGCGGCCGCGCCGACAGCCCCACGACGCGCCCGCCGCGCTGCCCGCGCTGGCCGACTACCACGAGTGCACGGCCTGCCGCGTGAGCTTCCACAGCCTCGAGGCCTACCTGGCTCACAAGCAGTACGCGTGCCCCGCCGCGCCACTGCGCCCGGCCGCCGTGTGCCCCTACTGCCCGGCCAATGGGCGTGCGCGCGGCGACCTGGGGGAGCACCTACGCCGGGCACACGGCCTGCGGGACAGCCCCCCGCCGCGCTCCCCGTCCCCGCCGCCCGCGCCCGCCGAGGCCCCCGCCGACCCGGGCGCCCCCACCCCCGGTAAGGGCCCGCCCGCGCCTCCCACGCCCGGTGGCCACCGCTACTGCCGCTTGTGCAACATCCGGTTCAGCAGCCTGTCCACCTTCATCGCTCACAAGAAGTACTACTGCTCCTCGCACGCCGCCGAGCACGTGAAGTGA

XM_004842692.1 Coding sequence

Zfpm1 zinc finger protein, FOG family member 1, transcript variant X3

Length: 2799 bp    Location: 1017627..988114   Strand: -
>XM_004842692.1
ATGGATGCTGCAGAGGAGGCCCAGGCCCCAGACAGCAGCCTTGAGGAGCAGGAGGCCCCAGCACCAGAGCCCACAGCCATAGGGAGGCCGGAGCCCCTGACCCCTTCCACCGCAGACGTGAATCCACCTCTGGCACCAGCGCCAGTGCACTCCACATCCCCGGGAGCCCCCGAGGAGATGGAGGTGCCAGGGCCTGAGACACTGCGGGAGGAGGCAACCAGCCCCTGGAGCGGGCCAGAGGAGCTGGAGCTGGAGCTTCGGGATGGACAGAGGTGCGTGCAGGCCCGACTCAGCCTCGCCAAGGGCCTGTGCTGGGGCCCGTTCCGTGGGAGCATCCAGACCAGAGCACCATCCCCTGGGCAGGCAGAACCGGGCCCGGCCCTGACCCTGCTGCTCACAGATGCAGCCTGCTGGCTGAGGACGCTGCCCCAGGCCCTGACCGAGGCTGACGCCAACTCGGAGATCTACAGGAAGGATGGCAGCCTCTGGTGCAGGGTCACCAGGCCGGTGCCCGCGGGCGAGGCCCTGTGTGCACTCCTGACGGCCAAGCCCCGGGGCACCCCCAGCCATCCCACGAAGGAGGAACCAGCAGAGCCCGAGAACCCTGCCCCAGTGCCCCCTGACATCCAGCTGCTGCCCCAGCAGGCCGGCATGGCGTCCATCCTCGCCACAGCAGTCATCAACAAGGACGTCTTCCCGTGCAAGGACTGTGGCATCTGGTACCGCAACGAGCGCAACCTGCAAGCCCACCTCCTCTACTACTGCGCCAGCCGCCAGGGTGCCAGCTCCCCAGCCGCGGCAGCCACAGAGGACAAGCCTAAGGAGCCATACCCCAACGAGCGGATCTGCCCCTTCCCACAGTGCCGTAAGAGCTGCCCCAGCGCCAGCTCCCTGGAGATCCACATGCGCAGCCACAGCGGAGAGCGGCCCTTTGTATGCCTCATCTGCCTGTCGGCCTTCACCACCAAGGCCAACTGCGAACGCCACCTCAAGGTGCACACAGACACGCTCAGCGGTGTCTGTCACAGCTGTGGCTTCATCTCCACCACTCGGGACATCCTCTATAGCCACCTGGTGACCAGCCACATGGTCTGCCAGCCCGGCTCCAAGGGGGAGATATACTCGCCAGGTGCAGCACACCCAGCTGCCAAGCTGCCTGCAGACGCCCTCGCCAGCCTCCAGAAGCACGCAGGCCTGCATGGTCCCCTGGCCTCCGCGGACCTAGGCCTGGCACCCATCCCATCACCAGGCCTGGACAAGACCCTGGTTGAGGCCACCAACGGAGAGGCCCAGAATGGGAGCGGCGGCGAGACCCCCGCGATCCCCAAGAACGTCAAGGTGGAGGCGGCCGAGGAGTCGGAGGCAGCGCGCGTGCCAGGCCAGGCAGAGCCTGCACCCCGGGCCCCGTCGCGGACGCCGTCGCCCCACAGCCCCGGTGCGGCCCGCGTGAAGGCCGAGATGCCCAGTCCCACGCCTGGCGCCAGCCCCGCACCCGGAGAGCTGGGTTTGGCCGGCGCGCTTTTCCTGCCGCAGCTCGTGTTCGCGCCAGACGCGGGCGCCGCCCCCGGCCCCGCGGCGCCCCAGGCCTCGGAGATCCTGGCCAAGATGTCGGAGCTGGTGCACAGCCGGCTGCAGCAGGGCGCGGGGGCGCCGGCCGCGCTGCTGGCGGGGACCAAGGGTGCCACGTGCTTCGAGTGCGAGATCACCTTCAACAACGTCAACAACTTCTACGTGCACAAGCGCCTCTACTGCTCCGGCCGGCGCCCGCCCGAAGACGCGCCCGCCGCGCGCAGGCCCAAGGCGCCACCGGGCGGCGCGCCTGCAGAACCCGATGCGCCGCGATCGCCGCCGGCGCCCGGGGCGCGTGAGGACGAGGCGGGCGGCGCAGCCACGCCCGAGGCCGATGGGCCCGGCCGGGGCAGCGAGGGCAGCCAGAGCCCGGGCAGCTCAGTGGACGACGCGGAGGACGACCCCAGCCGTACACTGTGCGAGGCCTGCAACATCCGCTTCAGCCGCCACGAGACCTACACGGTGCACAAGCGCTACTACTGCGCCTCGCGCCACGACCCTCCGCCGCGCAGGCCACCCGCTCCCGCTCCCGCTCCAGGGTCCGCGGCGCCCACGCTGACCACGCCGCCTGTGCGCACGCGCCGGCGCCGCAAGCTGTACGAGCTGCACGCGCCCGGCTCCGCCCCCGCACCGCCTGGCCATGGCCCCCCAGCGGCTGGCCCCGCGCCCGAGCCCCCCGGCTCCCCCGGACCCGGAGGCGGAAATGGGAGCGCCGGTCCCGCCCCCGCGCGCTCGCCCGCGCCGGCCGCCGCCGACGGCCCCATCGACCTGAGCAAGCGGCCGCGCCGACAGCCCCACGACGCGCCCGCCGCGCTGCCCGCGCTGGCCGACTACCACGAGTGCACGGCCTGCCGCGTGAGCTTCCACAGCCTCGAGGCCTACCTGGCTCACAAGCAGTACGCGTGCCCCGCCGCGCCACTGCGCCCGGCCGCCGTGTGCCCCTACTGCCCGGCCAATGGGCGTGCGCGCGGCGACCTGGGGGAGCACCTACGCCGGGCACACGGCCTGCGGGACAGCCCCCCGCCGCGCTCCCCGTCCCCGCCGCCCGCGCCCGCCGAGGCCCCCGCCGACCCGGGCGCCCCCACCCCCGGTAAGGGCCCGCCCGCGCCTCCCACGCCCGGTGGCCACCGCTACTGCCGCTTGTGCAACATCCGGTTCAGCAGCCTGTCCACCTTCATCGCTCACAAGAAGTACTACTGCTCCTCGCACGCCGCCGAGCACGTGAAGTGA

XM_004842694.1 Coding sequence

Zfpm1 zinc finger protein, FOG family member 1, transcript variant X5

High confidence: 4 potential gene matches
Length: 2622 bp    Location: 1015669..988114   Strand: -
>XM_004842694.1
ATGGAGGTGCCAGGGCCTGAGACACTGCGGGAGGAGGCAACCAGCCCCTGGAGCGGGCCAGAGGAGCTGGAGCTGGAGCTTCGGGATGGACAGAGGTGCGTGCAGGCCCGACTCAGCCTCGCCAAGGGCCTGTGCTGGGGCCCGTTCCGTGGGAGCATCCAGACCAGAGCACCATCCCCTGGGCAGGCAGAACCGGGCCCGGCCCTGACCCTGCTGCTCACAGATGCAGCCTGCTGGCTGAGGACGCTGCCCCAGGCCCTGACCGAGGCTGACGCCAACTCGGAGATCTACAGGAAGGATGGCAGCCTCTGGTGCAGGGTCACCAGGCCGGTGCCCGCGGGCGAGGCCCTGTGTGCACTCCTGACGGCCAAGCCCCGGGGCACCCCCAGCCATCCCACGAAGGAGGAACCAGCAGAGCCCGAGAACCCTGCCCCAGTGCCCCCTGACATCCAGCTGCTGCCCCAGCAGGCCGGCATGGCGTCCATCCTCGCCACAGCAGTCATCAACAAGGACGTCTTCCCGTGCAAGGACTGTGGCATCTGGTACCGCAACGAGCGCAACCTGCAAGCCCACCTCCTCTACTACTGCGCCAGCCGCCAGGGTGCCAGCTCCCCAGCCGCGGCAGCCACAGAGGACAAGCCTAAGGAGCCATACCCCAACGAGCGGATCTGCCCCTTCCCACAGTGCCGTAAGAGCTGCCCCAGCGCCAGCTCCCTGGAGATCCACATGCGCAGCCACAGCGGAGAGCGGCCCTTTGTATGCCTCATCTGCCTGTCGGCCTTCACCACCAAGGCCAACTGCGAACGCCACCTCAAGGTGCACACAGACACGCTCAGCGGTGTCTGTCACAGCTGTGGCTTCATCTCCACCACTCGGGACATCCTCTATAGCCACCTGGTGACCAGCCACATGGTCTGCCAGCCCGGCTCCAAGGGGGAGATATACTCGCCAGGTGCAGCACACCCAGCTGCCAAGCTGCCTGCAGACGCCCTCGCCAGCCTCCAGAAGCACGCAGGCCTGCATGGTCCCCTGGCCTCCGCGGACCTAGGCCTGGCACCCATCCCATCACCAGGCCTGGACAAGACCCTGGTTGAGGCCACCAACGGAGAGGCCCAGAATGGGAGCGGCGGCGAGACCCCCGCGATCCCCAAGAACGTCAAGGTGGAGGCGGCCGAGGAGTCGGAGGCAGCGCGCGTGCCAGGCCAGGCAGAGCCTGCACCCCGGGCCCCGTCGCGGACGCCGTCGCCCCACAGCCCCGGTGCGGCCCGCGTGAAGGCCGAGATGCCCAGTCCCACGCCTGGCGCCAGCCCCGCACCCGGAGAGCTGGGTTTGGCCGGCGCGCTTTTCCTGCCGCAGCTCGTGTTCGCGCCAGACGCGGGCGCCGCCCCCGGCCCCGCGGCGCCCCAGGCCTCGGAGATCCTGGCCAAGATGTCGGAGCTGGTGCACAGCCGGCTGCAGCAGGGCGCGGGGGCGCCGGCCGCGCTGCTGGCGGGGACCAAGGGTGCCACGTGCTTCGAGTGCGAGATCACCTTCAACAACGTCAACAACTTCTACGTGCACAAGCGCCTCTACTGCTCCGGCCGGCGCCCGCCCGAAGACGCGCCCGCCGCGCGCAGGCCCAAGGCGCCACCGGGCGGCGCGCCTGCAGAACCCGATGCGCCGCGATCGCCGCCGGCGCCCGGGGCGCGTGAGGACGAGGCGGGCGGCGCAGCCACGCCCGAGGCCGATGGGCCCGGCCGGGGCAGCGAGGGCAGCCAGAGCCCGGGCAGCTCAGTGGACGACGCGGAGGACGACCCCAGCCGTACACTGTGCGAGGCCTGCAACATCCGCTTCAGCCGCCACGAGACCTACACGGTGCACAAGCGCTACTACTGCGCCTCGCGCCACGACCCTCCGCCGCGCAGGCCACCCGCTCCCGCTCCCGCTCCAGGGTCCGCGGCGCCCACGCTGACCACGCCGCCTGTGCGCACGCGCCGGCGCCGCAAGCTGTACGAGCTGCACGCGCCCGGCTCCGCCCCCGCACCGCCTGGCCATGGCCCCCCAGCGGCTGGCCCCGCGCCCGAGCCCCCCGGCTCCCCCGGACCCGGAGGCGGAAATGGGAGCGCCGGTCCCGCCCCCGCGCGCTCGCCCGCGCCGGCCGCCGCCGACGGCCCCATCGACCTGAGCAAGCGGCCGCGCCGACAGCCCCACGACGCGCCCGCCGCGCTGCCCGCGCTGGCCGACTACCACGAGTGCACGGCCTGCCGCGTGAGCTTCCACAGCCTCGAGGCCTACCTGGCTCACAAGCAGTACGCGTGCCCCGCCGCGCCACTGCGCCCGGCCGCCGTGTGCCCCTACTGCCCGGCCAATGGGCGTGCGCGCGGCGACCTGGGGGAGCACCTACGCCGGGCACACGGCCTGCGGGACAGCCCCCCGCCGCGCTCCCCGTCCCCGCCGCCCGCGCCCGCCGAGGCCCCCGCCGACCCGGGCGCCCCCACCCCCGGTAAGGGCCCGCCCGCGCCTCCCACGCCCGGTGGCCACCGCTACTGCCGCTTGTGCAACATCCGGTTCAGCAGCCTGTCCACCTTCATCGCTCACAAGAAGTACTACTGCTCCTCGCACGCCGCCGAGCACGTGAAGTGA

XM_004842697.1 Coding sequence

Banp BTG3 associated nuclear protein, transcript variant X3

Length: 1395 bp    Location: 1286241..1205212   Strand: -
>XM_004842697.1
ATGATGTCAGAACAGGACCTGGCGGATGTGGTTCAGATCGCAGTGGAAGACCTGAGTCCTGACCACCCAGTTGTTTTGGAGAACCATGTGGTAACAGATGAAGACGAACCTGCTTTAAAGCGCCAGAGACTAGAAATCAATTGCCAGGATCCGTCCATAAAGTCTTTCCTGTACTCCATTAACCAGACGATATGCTTACGGTTGGATAGCATTGAGGCCAAGCTGCAGGCTCTGGAGGCGACGTGTAAGTCCCTGGAGGAGAAGCTGGACCTGGTCACCAACAAGCAGCACAGCCCCATCCAGGTCCCCATGGTGGCGGGCTCCCCGCTTGGCGCCACCCAGACCTGCAACAAAGTGCGATGTGCTGTGCCTGGACGTCGGCAGAACACCATTGTGGTGAAGGTGCCGGGTCAAGACGACAGCCACAACGAAGACGGGGAGAGCGGGTCGGAGGCCAGCGACTCGGTGTCCAACTGTGGCCAGCCCGGGAGCCAGAGCATCGGGAGTAACGTCACGCTCATCACCCTGAACTCGGAAGAGGATTACCCCAACGGCACCTGGCTTGGTGACGAGAACAACCCCGAGATGAGGGTGCGCTGTGCCATCATCCCCTCCGACATGCTGCACATCAGCACCAACTGCCGCACCGCTGAGAAGATGGCGCTCACGCTGCTGGACTACCTCTTCCACCGCGAGGTGCAGGCCGTGTCCAATCTGTCCGGCCAGGGCAAGCACGGGAAGAAGCAGCTTGATCCACTCACCATCTATGGCATCCGGTGTCACCTTTTCTATAAATTTGGAATCACGGAATCTGACTGGTACCGGATCAAACAGAGCATTGACTCCAAATGCCGGACAGCGTGGCGGCGAAAACAGCGAGGGCAGAGTCTGGCGGTCAAGAGCTTCTCCCGGAGGACGCCATCCTCGTCCTCTTACAGTGCCTCAGAGACCATGATGGGTACCCCACCGCCTGCCCCCGAGCTGCAGCAGCCGCAGCCGCAGGCCCTGCACTACACCCTGGCCAATGCCCAGCAAGTGCAGATCCACCAGATTGGAGAGGACGGCCAGGTGCAAGTAGGCCACCTCCACATAGCCCAGGTGCCGCAGGGGGAGCAGGTGCAGATCACGCAGGACAGCGAGGGCAATCTGCAGATCCACCACGTGGGCCAGGACGGGCAGGTGCTGCAGGGAGCCCAGCTCATCGCCGTGGCCTCTTCAGACCCTGCCTCGGCTGGCGTGGACGGGTCACCTCTCCAGGGCAGTGACATCCAGGTGCAGTATGTCCAGCTGGCGCCCGTGAGCGAGCACACAGCCACGGCACAGACGACTGAGAGCCTGCAGCCCGCCCTGCAGCCTGAGATGCAGCTGGAGCACGGGGCCATCCAGATCCAGTGA

XM_004842696.1 Coding sequence

Banp BTG3 associated nuclear protein, transcript variant X2

Length: 1512 bp    Location: 1286241..1205212   Strand: -
>XM_004842696.1
ATGATGTCAGAACAGGACCTGGCGGATGTGGTTCAGATCGCAGTGGAAGACCTGAGTCCTGACCACCCAGTTGTTTTGGAGAACCATGTGGTAACAGATGAAGACGAACCTGCTTTAAAGCGCCAGAGACTAGAAATCAATTGCCAGGATCCGTCCATAAAGTCTTTCCTGTACTCCATTAACCAGACGATATGCTTACGGTTGGATAGCATTGAGGCCAAGCTGCAGGCTCTGGAGGCGACGTGTAAGTCCCTGGAGGAGAAGCTGGACCTGGTCACCAACAAGCAGCACAGCCCCATCCAGGTCCCCATGGTGGCGGGCTCCCCGCTTGGCGCCACCCAGACCTGCAACAAAGTGCGATGCGTCGTCCCCCAGACTACAGTAATTCTCAACAATGATCGGCAGAACGCCATTGTAGCCAAGATGGAAGACCCCTTGAGCAACAGGGCACCGGATTCCCTGGAAAATATCATTAGCAATGCTGTGCCTGGACGTCGGCAGAACACCATTGTGGTGAAGGTGCCGGGTCAAGACGACAGCCACAACGAAGACGGGGAGAGCGGGTCGGAGGCCAGCGACTCGGTGTCCAACTGTGGCCAGCCCGGGAGCCAGAGCATCGGGAGTAACGTCACGCTCATCACCCTGAACTCGGAAGAGGATTACCCCAACGGCACCTGGCTTGGTGACGAGAACAACCCCGAGATGAGGGTGCGCTGTGCCATCATCCCCTCCGACATGCTGCACATCAGCACCAACTGCCGCACCGCTGAGAAGATGGCGCTCACGCTGCTGGACTACCTCTTCCACCGCGAGGTGCAGGCCGTGTCCAATCTGTCCGGCCAGGGCAAGCACGGGAAGAAGCAGCTTGATCCACTCACCATCTATGGCATCCGGTGTCACCTTTTCTATAAATTTGGAATCACGGAATCTGACTGGTACCGGATCAAACAGAGCATTGACTCCAAATGCCGGACAGCGTGGCGGCGAAAACAGCGAGGGCAGAGTCTGGCGGTCAAGAGCTTCTCCCGGAGGACGCCATCCTCGTCCTCTTACAGTGCCTCAGAGACCATGATGGGTACCCCACCGCCTGCCCCCGAGCTGCAGCAGCCGCAGCCGCAGGCCCTGCACTACACCCTGGCCAATGCCCAGCAAGTGCAGATCCACCAGATTGGAGAGGACGGCCAGGTGCAAGTAGGCCACCTCCACATAGCCCAGGTGCCGCAGGGGGAGCAGGTGCAGATCACGCAGGACAGCGAGGGCAATCTGCAGATCCACCACGTGGGCCAGGACGGGCAGGTGCTGCAGGGAGCCCAGCTCATCGCCGTGGCCTCTTCAGACCCTGCCTCGGCTGGCGTGGACGGGTCACCTCTCCAGGGCAGTGACATCCAGGTGCAGTATGTCCAGCTGGCGCCCGTGAGCGAGCACACAGCCACGGCACAGACGACTGAGAGCCTGCAGCCCGCCCTGCAGCCTGAGATGCAGCTGGAGCACGGGGCCATCCAGATCCAGTGA

XM_004842703.1 Coding sequence

Ca5a carbonic anhydrase VA, mitochondrial, transcript variant X3

Length: 1203 bp    Location: 1293646..1312728   Strand: +
>XM_004842703.1
ATGCTCAGGGCCATGACGCTGGCAAAGGGCCCCTGCAAGCCCTCCCGCACCCACTTCCTGCTCACGTGGACCTGGGGGGCTCCCCTGGCCCCCGCGACAGGGCGGGCACGGCAGTGTTCCCAGCAGCCCTGCACACAGAGCCACAGGAGCAACACGTGTCTCCTCTTATGCTGTTGGATGCAACCCTCAGGGCACCCCCGCTGGACAGGCCAGGTCTCCCTGCCAGGGGGCACCCGGCAGTCTCCCATCAACATCCGGCGGAGGGACAGCGTCTACGACCCCCAGCTGCCGCCGCTCAGGGCCTCCTACAGTGCTGCGTCCTGTCAGCACGTGTGGAACACGGGCTACCTCTGCCAGGTGGAGTTCGACGAGGCCAGCGAGGGCTCAGGGATCAGCGGGGGCCCCCTGGAGAACCACTACCGACTGAAGCAGTTCCACTTCCACTGGGGGGCTGGGGACGCACGGGGCTCCGAGCACGCCGTGGACGACCTCACCTTCCCCGCCGAGCTGCACTTAGTTCACTGGAATCCCTCGAGGTACCCGAGTTACCGGGAAGCAGTCCTGGGGGAGAAGGGCCTGGCTGTGATCGCCGTCTTTCTGCAGCCATGTGTCTGTGCCACAGCTGGGCGCCCCGCTCCAGGCCCTGCAGCAGCTGGCGGATGTCTTACCGGAGATAAAACACAAGCACACGCTTGGGGAAGGAATCGCGCCAAGGCCGCCTGCCCGAGGGGGACTGCGAGGCCCGGGAAGTTGGGCCAAGCACTCAGCTTACCTGGCACAAAGCGGTCGGGCTTTTGGAAGGTCAGCGAGGATGACAATGCTTGTCTCCAAGGCCTTGGGCAGTCAGCCGCTCTCACGTCAAGCTGCCTGATGTTGCTGGGCAGTGGTGCTGGGGACAGCGCAGTGGCTCCGTGCCCATGTTCAGAGAGTCACCTTGCGGCCCCGCGGTCCTGCGACAGGCACTCACACAGCAGAGCCGGGCCCCGAGCTCGTGTTTGTACCGCTGTGGGTAGCAGCAGATGGTGGCATAGCCCAGGTGTTGGTGGATGGGTAAAGACACCGAAACATGGCCGTCCCCATGCGGAAGGCCTCAGCCCTAAAAGGCAGGAAGTCCTGACACATGTCCCGCATGGGCAACCTTGGGGACAGGCACTGAGAGAAATGGGCCAAACACAGAAACCCGATACCACAGGGGTCCTGTGA

XM_004842704.1 Coding sequence

Ca5a carbonic anhydrase VA, mitochondrial, transcript variant X4

Length: 1203 bp    Location: 1293646..1312728   Strand: +
>XM_004842704.1
ATGCTCAGGGCCATGACGCTGGCAAAGGGCCCCTGCAAGCCCTCCCGCACCCACTTCCTGCTCACGTGGACCTGGGGGGCTCCCCTGGCCCCCGCGACAGGGCGGGCACGGCAGTGTTCCCAGCAGCCCTGCACACAGAGCCACAGGAGCAACACGTGTCTCCTCTTATGCTGTTGGATGCAACCCTCAGGGCACCCCCGCTGGACAGGCCAGGTCTCCCTGCCAGGGGGCACCCGGCAGTCTCCCATCAACATCCGGCGGAGGGACAGCGTCTACGACCCCCAGCTGCCGCCGCTCAGGGCCTCCTACAGTGCTGCGTCCTGTCAGCACGTGTGGAACACGGGCTACCTCTGCCAGGTGGAGTTCGACGAGGCCAGCGAGGGCTCAGGGATCAGCGGGGGCCCCCTGGAGAACCACTACCGACTGAAGCAGTTCCACTTCCACTGGGGGGCTGGGGACGCACGGGGCTCCGAGCACGCCGTGGACGACCTCACCTTCCCCGCCGAGCTGCACTTAGTTCACTGGAATCCCTCGAGGTACCCGAGTTACCGGGAAGCAGTCCTGGGGGAGAAGGGCCTGGCTGTGATCGCCGTCTTTCTGCAGCCATGTGTCTGTGCCACAGCTGGGCGCCCCGCTCCAGGCCCTGCAGCAGCTGGCGGATGTCTTACCGGAGATAAAACACAAGCACACGCTTGGGGAAGGAATCGCGCCAAGGCCGCCTGCCCGAGGGGGACTGCGAGGCCCGGGAAGTTGGGCCAAGCACTCAGCTTACCTGGCACAAAGCGGTCGGGCTTTTGGAAGGTCAGCGAGGATGACAATGCTTGTCTCCAAGGCCTTGGGCAGTCAGCCGCTCTCACGTCAAGCTGCCTGATGTTGCTGGGCAGTGGTGCTGGGGACAGCGCAGTGGCTCCGTGCCCATGTTCAGAGAGTCACCTTGCGGCCCCGCGGTCCTGCGACAGGCACTCACACAGCAGAGCCGGGCCCCGAGCTCGTGTTTGTACCGCTGTGGGTAGCAGCAGATGGTGGCATAGCCCAGGTGTTGGTGGATGGGTAAAGACACCGAAACATGGCCGTCCCCATGCGGAAGGCCTCAGCCCTAAAAGGCAGGAAGTCCTGACACATGTCCCGCATGGGCAACCTTGGGGACAGGCACTGAGAGAAATGGGCCAAACACAGAAACCCGATACCACAGGGGTCCTGTGA

XM_004842705.1 Coding sequence

Ca5a carbonic anhydrase VA, mitochondrial, transcript variant X5

Length: 1191 bp    Location: 1294999..1320130   Strand: +
>XM_004842705.1
ATGGTGAAGACCAGAGCTCCCCCGAGGAGAACAGCAGCCACTCCAGGCCACGGTGAGGACCCGAGCTCCTCTGAAGATGAGAACAACCCAGTTCGCCTCAGGAAAACCAGCTGTCCAAGCTTCTCCAGGACGATCAACAGCACACGATCTTCCCCTCCAGGTCTCCTCTTATGCTGTTGGATGCAACCCTCAGGGCACCCCCGCTGGACAGGCCAGGTCTCCCTGCCAGGGGGCACCCGGCAGTCTCCCATCAACATCCGGCGGAGGGACAGCGTCTACGACCCCCAGCTGCCGCCGCTCAGGGCCTCCTACAGTGCTGCGTCCTGTCAGCACGTGTGGAACACGGGCTACCTCTGCCAGGTGGAGTTCGACGAGGCCAGCGAGGGCTCAGGGATCAGCGGGGGCCCCCTGGAGAACCACTACCGACTGAAGCAGTTCCACTTCCACTGGGGGGCTGGGGACGCACGGGGCTCCGAGCACGCCGTGGACGACCTCACCTTCCCCGCCGAGCTGCACTTAGTTCACTGGAATCCCTCGAGGTACCCGAGTTACCGGGAAGCAGTCCTGGGGGAGAAGGGCCTGGCTGTGATCGCCGTCTTTCTGCAGCTGGGCGCCCCGCTCCAGGCCCTGCAGCAGCTGGCGGATGTCTTACCGGAGATAAAACACAAGCACACGCTTGGGGAAGGAATCGCGCCAAGGCCGCCTGCCCGAGGGGGACTGCGAGGCCCGGGAAGTTGGGCCAAGCACTCAGCTTACCTGGCACAAAGCGGTCGGGCTTTTGGAAGGTCAGCGAGGATGACAATGCTTGTCTCCAAGGATGCGCAGGTGGCCCTGGGCCCCTTCGACCCCTCCTGTCTGCTGCCTGCCTGCCGGGACTACTGGACCTACGCAGGCTCCCTCACCACCCCACCCCTGTCTGAGTCGGTCACCTGGATCGTCCACAAGCAGCCCATCGAGGTGGCTCCCAGCCAGCTGTCCGCGTTCCGGACGCTGCTGTTCTCCGCACCGGGCGAAGAGGAGGAGGCGATGGTGAACAACTACCGCCCGCTTCAGCCCCTGATGGACCGTGAAGTGCGCTCATCCTTCCGGGCACCGACTCAGAGTCCGCGTGAACGGCCAGAGCAGATGTGGCAAGGGCGGCGGGTGCTCCAGGCTTCCCCATCTGAGCCCCATGGCCCCCGAGCTAAGTAA

XM_004842700.1 Coding sequence

Slc7a5 solute carrier family 7 (amino acid transporter light chain, L system), member 5, transcript variant X2

Length: 1548 bp    Location: 1325368..1349610   Strand: +
>XM_004842700.1
ATGGCGGGCGCGGGCGCGAAGCGGCGCTCGGTGGCCACCGCGGCGGCAGAGGAGGAGGAGCAGCAGGCGCGAGAGAAGATGCTGGCGGCGCGGCGCGCGGACCCCGCTGGCCAGGGCCAGGGCGAGGGCGAGGGCGAGGGCGTGACCCTGCAGCGGAACATCACCCTGCTCAACGGCGTGGCTATCATCGTGGGCACCATCATCGGCTCGGGCATCTTCGTGACCCCCACGGGCGTGCTCAAGGAGGCGGGCTCGCCGGGCCTGGCGCTGGTGGTGTGGGCCGTGTGCGGGGTCTTCTCCATCGTGGGCGCTCTCTGCTATGCCGAGCTGGGCACCACCATCACCAAGTCGGGCGGCGACTACGCCTACATGCTGGAGGTGTACGGCTCGCTGCCCGCCTTCCTCAAGCTCTGGATCGAGCTGCTCATCATCCGGCCCTCCTCGCAGTACATCGTGGCGCTGGTCTTCGCCACCTACCTGCTCAAGCCGGTCTTCCCCACCTGCCCGGTGCCCGAGGAGGCCGCCAAGCTCGTGGCCTGCCTCTGCGTGCTGCTGCTCACCGCCGTGAACTGCTACAGCGTGAAGGCCGCCACCCGCGTGCAGGACGCCTTTGCAGCTGCCAAGCTCCTGGCACTGGCTCTGATCATCCTGCTCGGCTTCATCCAGATCGCAAAGGCTCTCGGGGCAGGTGACGTGTCCAACCTAGACCCCAAGTTCTCCTTCGAAGGCACCCACCTGGATGTGGGGAACATCGTGCTGGCCTTGTACAGTGGCCTCTTTGCCTATGGAGGATGGAATTACCTGAATTTTGTCACAGAGGAGATGATCAATCCCTACAGAAACCTGCCGCTGGCCATCAGCATCTCGCTGCCCATCGTCACCCTGGTGTACGTGCTGACAAACCTGGCCTACTTCACCACCCTGTCCACAGAGCAGATGCTGTCGTCCGAGGCCGTGGCTGTGGACTTCGGCAACTACCACCTGGGAGTCATGTCCTGGATCATCCCGGTCTTCGTGGGCTTGTCCTGCTTCGGCTCGGTCAATGGCTCCCTGTTCACGTCCTCGAGGCTGTTCTTCGTGGGGTCCCGGGAGGGCCACCTGCCCTCAGTGCTCTCCATGATCCACCCAGACCTCCTGACGCCCATGCCGTCCCTCGTGTTCACGTGCATCATGACCCTGCTCTACGCCTTCTCCAACGACATCTTCTCTGTCATCAACTTATTCAGCTTCTTCAACTGGCTGTGTGTGGCACTGGCCATCATCGGCATGATCTGGCTCCGCTTCAAGAAGCCAGAGCTGGAGCGGCCCATCAAGGTGAGCCTGGCGCTGCCGGTGTTCTTCACCCTGGCCTGCCTGTTCCTCATCGCCGTGTCCTTCTGGAAGACGCCCGTGGAGTGCGCCATTGGCTTCACCATCATCCTCAGCGGGCTGCCCGTCTACTTCTTTGGGGTCTGGTGGAAGAACAAGCCCAAGTGGCTCCTGCAGGCAATCTATTCCACCACCGTCCTGTGCCAGAAGCTCCTGCATGTGGTCCCTCAGGAGACCTAG

XM_004842718.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X11

High confidence: 4 potential gene matches
Length: 1383 bp    Location: 1468767..1451212   Strand: -
>XM_004842718.1
ATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842714.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X7

Length: 1383 bp    Location: 1466216..1451212   Strand: -
>XM_004842714.1
ATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842715.1 Coding sequence

Tldc1 TBC/LysM-associated domain containing 1, transcript variant X8

Length: 1383 bp    Location: 1466216..1451212   Strand: -
>XM_004842715.1
ATGGGGAACAGCAAAAGCCACTCGGGGAGGACTTGTTGCTCCCAGTTTCTTCCCGAGGAGCAGGCCGAGATCGATAGGTTGTTTGACGCCCTGTCGTCGCAGAAAGACGGTGCGGAGACCTCACCCAGGTCCTTCTCCCTGAAGGCTCTGCAGAGCCACGTCGGGGAGGCGCTTCCCCCAGAGATGCTCGCCAGGCTCTATGACGGCATGCGGCAGGTGTGCGGGACTGGCCCTGCGCAGGGATCCTGCCAGAGCGTCTCCCGGGAGCAGTTCACGGTGTCGCTGTCACACCTGCTCAGGGGAAGCTCCGAGGAGAGGAGTGTCGTGATCCTGAAGATGATTTCTGCCAGCGGAGGTCCCGTGAAGGCCAGAGAAGTGCGGAAGTTCACAGAGGACCTGGTGGGCTCTGTGGTGCACGTGCTGAGCCACAGGCAAGAGCTGCGAGGCTGGGCCGGGAAGGAGGCCCCGGGAGCCCCTGCCAGGACACAGGCGCTGGCTGCCCAGCTGCTGTCCGAGCTGAAGCTTCCAGGTGGCGAGAGGCTGCAGGGGCCTCAGTGGCTGGAGGGCAACTGTGACCGAGCTGCGATCGAGGACTGGGTCTTCAGGGTCCCCCGTGTGGCCATGTTCCTGAGCGTGGTGGTCCACAGGGGCCTTCTTGTCCTAGGCGTGCCCCCGGATCTCGCCATGCTGGTCCCCGAGCGCCAGGTGGAGCCGGGGCAGGAGCTGACGAGCCTGCTGGACGTGCTGGCCGTCATCTTCCTCAGCTCCCACCTGGCCCCAAGGCAGCGGCACTGCTGGCGCCTGCTCTTTGCCTCCCACCTGCACGGGCAGAGCTTCTCGCAGCTGTGTGGCCGTGTCACCCACCGTGGGCCCTGCCTGGCCCTCCTGGAGGACCGCAGCGGCCACGTGTTCGGGGGCTTCGCCTCCTGCTCCTGGGAGGTCAAGCCGCAGTTCCAAGGGGACAACAAGTGCTTCCTGTTCTCCATTGCCCCCAGCATGGCCGTGTACACACCCACGGGCTACAACGACCACTACATGTACCTGAACCACAGCCAGCAGACCATCCCCAACGGGCTGGGCATGGGAGGGCAGCACAGCTACTTCGGGCTGTGGGTGGACGCCGACTTCGGGAACGGGCACAGCAAGGCCAAGCCCACGTGTACCACGTACGACAGCCCGCAGCTGTCCGCCGAGGAGGACTTCCGGTTCGAGAAGATGGAGGTGTGGGCCGTCGGAGAGCCCGTGGAGTCAGAGCTGGCCAAGGGTAAGAAAAGCGTCCTCGACGTGGACCCCGGGGCTCAGATTTTGCTGGAGGCCACTGGGTGGACTCGGCAGAGCGCAGGGTTCCCGGAAATCCCCGACAGCCACAGTGCCGACCAGTGA

XM_004842720.1 Coding sequence

Klhl36 kelch-like family member 36

High confidence: 4 potential gene matches
Length: 1848 bp    Location: 1526261..1535908   Strand: +
>XM_004842720.1
ATGGAGGCAAGCAGGCAGACCCGAGTGTCTCGGCCATACAGGATCAGCGAGTCGTCAAAGGTGTACCACTGGGCCGACCACCCCACCACGGTGCTGCAGCGGCTGAATGAGCAGCGGCTCCGAGGCCTCTTCTGTGATGTGGTGCTGGTGGCCGAGGAGCAGCGCGTGCCTGCTCACCGAAACCTGCTGGCTGTGTGCAGCGACTACTTCAACTCCATGTTCACGCTGGGCATGCGCGAGGCCTTTGAGAAGGAGGTGGTGCTGGTAGGTGCCTCACCCATCGGGCTCAAGGCCGTGGTGGACTTCCTGTACGGCGGTGAGCTGGTGCTGGATGGTGGCAACATCGACCACGTGCTGGAAACGGCGCACCTGCTGCAGATCTGGACGGCGGTGGACTTCTGCTGCGAGTACCTGGAGCAGGAGGTGAGCGAGGACAACTACCTGTACCTGCAGGAGCTGGCCTCCATCTACAGCCTCAAGCGGCTGGACGCCTTCATCGATGGCTTTGTGCTGAGCCGCTTTGGCACCCTGTCCTTCACGCCCGACTTCCTGCAGAGCGTGTCCATGCAGAAGCTGTGCCTGTACCTGAGCAGCAGCCAGGTGCAGCGCGAGTGTGAGCACGACCTGCTGCAGGCGGCCCTGCAGTGGCTGACACAGCAGCCAGAGCGCGAGGCGCACGCCCGCTGCGTGCTCGAGAACATCCGCTTCCCGCTCATCCCCAAGGGCGACCTGCTGCACCGCGTCAAGCCGGCTGTCTGCGCACTGCTGCCCCGCGAGGCCGGCTGCGAGGACTTTGTGGAGGAGGCCGTGCGCTACCACAGCAGCCTGGCGGCGCAGCCCATCCTGCAGACGGCGCGAACCGCACTGCGCACGGACGGCGAGCGCCTGCTGTTTGTGGGCGGCGAGGTCTCCGAGCGGTGTCTGGAGCTCAGCGACGACACCTGCTACCTGGACTCCAAGAGTGAGCAGTGGGTCAAGGAGACGCCACTGCCAGCCCGGCGGAGCCACCACTGCGTTGCCGTGCTGGGCGGCTTCATCTTCATCGCAGGTGGCAGCTTCTCCCGGGACAACGGAGGGGACGCGGCCTCCAGCCTGCTTTATAGGTATGACCCCCGCTGTAAACAGTGGATCAAGGTGGCCTCCATGAACCAGCGCCGTGTGGATTTCTACCTGGCCTCCATCCAAGACATGCTGGTGGCCGTTGGTGGCCGGAATGAAAACGGAGCGCTGTCTTCCGTAGAGACCTACAGTCCCAAGACCGACTCCTGGTCCTACGTGGCCGGCCTGCCCAGGTTCACCTATGGCCACGCGGGCACCATCTACAAAGACTTCGTGTACATCTCGGGCGGCCACGACTACCAGATCGGTCCGTACCGCAAGAACCTGCTGTGCTATGACCACCGCACAGACGTGTGGGAGGAGCGGCGGCCCATGACCACGGCGCGCGGCTGGCACAGCATGTGCAGCCTGGGCGACAGCATCTTCTCCATCGGCGGCAGTGACGACGACGTGGAGTCCATGGAGCGCTTCGACGTGCTGGGCGTGGAGGCCTACAGCCCTCAGTGCGACCAGTGGACGCGCGTGGCGCCGCTGCTGCATGCCAACAGTGAGTCGGGTGTGGCTGTGTGGCAGGGCCGCATCTACATCCTCGGCGGCTACAGCTGGGAGAACACGGCCTTCGCCAAGACTGTGCAGGTGTACGACCGCGAGGCCGACAAGTGGAGCCGCGGGCCCGACCTGCCCAAGGCCATCGCCGGCGTGTCCGCCTGCGTGTGCGCCCTCAGGCCGCGGCCGGAGAACAAGAAGAAGAAGGGCAAGGGCAGGCGGCTGCAGGACTGCGGCCAGTGA

XM_004842724.1 Coding sequence

Usp10 ubiquitin specific peptidase 10, transcript variant X2

Length: 2379 bp    Location: 1554086..1616711   Strand: +
>XM_004842724.1
ATGGCCCTCCACGGCCCGCAGTATATTTTTGGAGATTTTAGCCCTGATGAATTCAATCAGTTCTTTGTGACGCCTCGCTCTTCAGTTGAGCTCCCCCCGTACAGTGGAACAGCTCTGTGTGGCACTCAGGCTGCGGACGAACTGCCTGATGGACAAGAGTATCAGAGAATTGAGTTCGGTGTCAATGAAGTAATTGACCCCAGTGACACTCTGCCGAGAGCCCCCGGCAACAGTATTTCAAGCACATTGAACCCTCAGGCCCCTGAATTTATTCTTGGTTGTACAGCTTCCAAAAAGACCCCTGATGGGCTAGACCAGGAGGTGAACTCCAGCTCCCTTGACCACCCATACCCGGGCCCAGCCCTGGCCTTGGACAGCAGCTCGCATGCTGAGGCAGAGGCTCTGGAGAACACTGGTGGCCCAGGTGGCCTGGGACAGAGGGAGCGGAAAAGGAAGAAGAAGCGGCCCCCAGGGTATTACAGTTACCTGAAAACTGGGGGTGACGAAAGTATTTCCACAGAAGCTGTGGTCAACGGCCATGCCAACTCAGCTGGCCTCGGTGGGGTGGGCGCCGAGGATGCGGAGTTTATGGGTGACATGCTCCCGCCGGTTTCGCCCAGGACTTGTGACAGCCCTCAGAACTCCACGGACTTCATCAGTGACACTGTGCCTGATAGTCCTTACCCTGGAGCGCTCGACAGCGCCGCCAGGACTGTGGGGCAGCCCGAGGGCTGCTGTGGGCCTGACTTTGAGCAAGCCTGCCTCCCCGCAGACCGCCTGCTAAGGACAGCTGTGGCTCCGCCCTGTGCTGCTACCGATACTACTGAGAACCTTGGCATCACCAATGGACAAGTACTTGAATCCTCGAGTGTGGGCACAGCTGCCAACGGGGAGCTGCACACTGTGGAGAGCACAGACTCAGACGTGGCCAAGCTGGAGCGTGCGCCACCTCCCGCTGACAGCGTACTCCCTGCACCCATTCCCATTAACCAGCCTGCCAAGTCCTGGGCCAGCCTCTTTCATGATGCTAAGCCCTCTTCCTCCTCACCCGTGGCGTATGTGGAAACTAAGTGTTCACCTCCTGCCCCATCTCCCCTGGTCTCTGAAAAGCAGGTTGAAGTCAAAGAAGGGCTTGTTCCAGTTTCAGAGGATCCCGTAGCCATGCAGATCGCAGAGTTACTGGAGAACGTAACCCTAGTACATAAGCCAGTGTCATTGCAACCCCGCGGGCTGATCAATAAAGGAAACTGGTGCTACATTAATGCTACTCTGCAGGCGTTGGTCGCTTGCCCTCCGATGTACCACCTCATGAAGTTCATTCCTCTGTACTCCAAGGTGCAGAGGCCTTGCACGTCGACGCCCATGATAGATAGCTTTGTTCGGCTAATGAACGAGTTTACCAACATGCCTGTGCCTCCGAAGCCCCGCCAAGCTCTTGGAGATAAAATCGTGAGGGACATCCGGCCTGGAGCTGCCTTTGAGCCCACGTACATTTACAGACTCCTGACCGTCATCAAGTCGAGCCTGTCTGAAAAGGGTCGACAGGAAGATGCTGAGGAGTACCTGGGCTTCATCCTAAACGGCCTGCACGAGGAGATGCTGAGCCTGAAGAGGCTCCTCTCACCGGACAGTGAAAAACTCACGGTTTCCAATGGGCCCAGAAGCCCCTTGCCCAAGGACGCAGCACAGCAAGAGCAAGGTGAAGGCAGCGAGGAGGAGTGGGAGCAAGTGGGCCCCAGGAACAAGACGTCGGTCACCCGCCAGGCGGATTTCGTTCAGACCCCAATCACTGGCATTTTTGGCGGACACATCAGGTCGGTGGTTTACCAGCAGAGTTCAAAAGAGTCTGCCACCCTGCAGCCATTTTTCACATTGCAGCTGGATATCCAGTCTGACAAGATACGCACCGTGCAGGATGCGCTCGAGAGCCTGGTGGCGAGAGAATCTGTCCAGGGTTACACCACGAAAACCAAACAAGAGGTGGAGATCAGCCGGCGGGTGACTCTGGAGAAGCTGCCTCCTGTCCTTGTGCTGCACCTGAAGCGCTTCGTGTATGAGAAGACTGGCGGCTGCCAGAAGCTGGCCAAGAACATCGACTACCCCGTGGACCTGGAGATCAGCAGGGAACTGCTTTCTCCAGGGGTTAAAAATAAGAATTTTAAATGCCATAGGACCTACAGGCTCTTCGCAGTGGTCTACCATCACGGCAACAGCGCCACGGGCGGGCACTACACCACCGACGTCTTCCAGATCGGGCTCAACGGCTGGCTGCGCATCGACGACCAGGTGGTCAAGGTGATCCAGCAGTACCAGGTGCTGAAGCCCGCCGCCGAACGCACCGCCTACCTCCTGTATTACCGCCGTGTGGACCTGCTGTGA

XM_004842726.1 Coding sequence

Crispld2 cysteine-rich secretory protein LCCL domain containing 2

High confidence: 4 potential gene matches
Length: 1509 bp    Location: 1648778..1691713   Strand: +
>XM_004842726.1
ATGCACCGTGGGGCCATGAGCTGCGTCCCGAGTGGCTTCGTCCCCTTGGGGCTGGTGCTGCTGGTGTGCGGTGCCCAGGGCTTCCTCCTGCCCAACGTGACTGAGCTGGGGGAGCTGCTGGGCCGGTACCAGCGGGCCGAGCCGTACTCGCGGGTGCGCAGGGCCATCCCCCGGGAGGACCGTGAGGAGATCCTGCGGCTGCACAACCAGCTCCGGGGCCAGGTGTCCCCACCCGCCTCCAACATGGAGCACGTGACCTGGGACGAGGAGCTGGAGCGGTCAGCGGCAGCTTGGGCCCAGCAGTGCATCTGGGAGCACGGGCCCACCAGCCTGCTAGTGTCCATCGGGCAGAACCTGGCTGTGCACTGGGGCAGGTACCGCTCGCCCGGCTTCCACGTGCAGTCATGGTACGACGAGGTGAAGGACTACACGTACCCCTACCCCCATGAGTGCAACCCCTGGTGCCCCGAGAGGTGCTCGGGCGCCATGTGCACCCACTACACGCAGATCGTCTGGGCCACCACCAACAAGGTTGGCTGCGCCGTGCACACCTGCCACAGGATAGACGTCTGGGGGGAGATCTGGGAGAACGCCGTCTACCTGGTCTGCAACTATTCTCCCAAGGGGAACTGGATTGGAGAGGCCCCGTACAGGACCGGCAGGCCCTGCTCCGAGTGCCCGCCCAGCTACGGGGGGGGCTGCAGGAACAACCTTTGTTACCGAGAAGAAGCCCACCACCCCACGTCCGAGACAGAGGAGATGAACGAGGTAGAGACGCCCCCGGCTCCCGATGAGAAGCATGCCTGGGTCCAGCCGAGGGTGGTCAAGCCCACCAAGCCCCGGAAGACCCCTGCAGTCACCTACATGACCCAGATTGTCCACTGTGACACCAAGATGAAGGACAGGTGCCAGGGCTCCACATGCAACAGGTACCAGTGCCCAGCAGGCTGCCTGAGCTCCAGGGCCAGCGTCTTCGGGACTCTGTTTTACGAAAGTTCCTCCAGCATCTGCCGGGCCGCCATCCACTATGGCATCCTGGACGACAGGGGCGGCCTGGTGGACGTCACCAGGAATGGGAGGAAGCCCTTCTTCGTCAAGTCCCAGCGACACGGCGTGGAGGCCTTGAGCAAATACAAACCTTCCAGCTCGTTCACGGTGTCAAAGGTAAAAGAGCAGGACCTGGACTGCTACACCACAGTGGCACAACTCTGCCCGTTTGAGAAGCCGGTTTCCCACTGCCCGAGAGTCCGCTGTCCGGCCTCCTGTGGGGACGAGCCGGCCTACTGGGCCCCGGTGATCGGAACCAACATCTACACAGACACGTCCAGCATCTGCAGGGCAGCCGTGCACGCCGGCGCCATCCAGGACGACGTCGGGGGCTCCGTGGACGTGATGCCGGTGGACAAGAAGCCCAGCTACGTGGGCTCGCTGAGGAACGGCGTGCAGTCGGAGAGCCTGAGTGCCACCAGGGATGGGAAGGCCTTCCGGATCTTTGCAGTCAGACAGTGA

XM_004842729.1 Coding sequence

Kiaa0513 KIAA0513 ortholog, transcript variant X2

Length: 1224 bp    Location: 1751461..1797521   Strand: +
>XM_004842729.1
ATGGAGGCCCCAGAGGTGCCTGTGGGCTCTCTGATTGACTTTGGGACTGAGCCGCCAGCCTCCCCTCCCCTGGAGGCCGCACCCCCAGCCCCCCAGGACAGGGACGGCTCCCTGGGCGATGGTGCATCTGAGAGTGAAGCCACGGAATCCGCAGACAGCGAGAACGACATGGGCGAGTCACCCTCGCACCCCTCCTGGGAGCAAGAGCGCCGCTCCTCCTCCAGCGAGTCCTTCTCCTCCACCCAGAGTGCGGAGTCCACCCAGGATGAGGAGACCCAGGCACTCCGCGAGTTCATGTGCAGCTATGTGGAGAAGATCTTCTCGGGACGGGAGGACTTAGACCAGGAGGAGAAAGCCAAGTTCGGAGAGTACTGCAGCAGTGAGGATGGCAAGGGCCGGGAGTGGTTCGCCCGGTACGTGAGTGCCCAGCGCTGCAATTCCAAGTGTGTGTCTGAGCCGACCTTCTACCGCCTGGTGCAGTCCTTCGCCGTGGTGCTGTTTGAGTGCCATCAGATGGATGACTTCGGGCCCGCCAAGAACCTCATGACCATGTGCTTCACCTACTATCACAGCGGCAAGCCGCACCTGCTGCCTGCGGAGCCCAGGGAGAAGGTGGCTGGCAGCATCGATGCCTACCTGAAGTCTGCCAACAGCTGGCTGGCCGAGAAGAAGGACATTGCTGAGCGGCTGCTGAAGAACACGGAGCACGTGAAGGGCTTCTTCGGGGGGCTGGAGACCAAGCTGAAGGGGCCCTTGGTCAGGAAGAACGAGGATGATGAGAACAAACCCAAGGACAAGCAGCCCAAGACTGTGACGGTGCCCAGCCCCGAGGAGGAGCCGAAGGGGGAGAAGATCTACCTGTACACGCACCTGAAGCAGCAGCCCATTTGGCACACGCTGAGGTTCTGGAATGCCGCCTTTTTCGACGCGGTCCACTGTGAGAGGAGAAAGCGGTCCCCCACCACCAGAGGGGATGCTGGAGAGCAGGAGGACAAGAGGGAGAAGTGGTGCCACATGACCCAGGAGGAGCGGGACGACAGTGTGCGGTTCAATGAGAACATCACCTTCGGGCAGCTGGGCACCTTCACCCACAACATGCTGGCCTTTGGGCTGAGCAAGAAGCTCTGTGGCGACTTCCTCAAGAAGCAGGCTGTGATCGGCAACCTGGACCAGGAGCAGTACAAGCTGCTGAGCGACCACATTGAGCAGATGGCCGCCGAATAG

XM_004842731.1 Coding sequence

Fam92b family with sequence similarity 92, member B

High confidence: 4 potential gene matches
Length: 852 bp    Location: 1808402..1799528   Strand: -
>XM_004842731.1
ATGAACGTCGTCCTCTCCAGGGAAGGCCAGGTGCACGCGATGGAGTCGGCAGTGCTGGCCGCCGAGAAGCACGTTGGGCAGCTCTGCTCACTGCTGGCCGCCCACACACGCAAGACGGCCCGGCTGCGGGACACGGGGGACCGACTGGTCAAGCAGCTGATCGCCTCCGCCAGCTCCGAGGCCCCCGAGATGCGGGCCACCCTGCGGGACTTGGCTGAGGACCTGGCCAAAGTGCAGGACTACCGGCAGGCCCTGGTCCAGAGGCTGGAGGCCAAGGTCGTCGACCCCCTGAAGCTGTATGGCACCCAGACCAAGCAGACCCGGGCTGAGATCAAGAAGTTCAAGCGAGTCCAAAAGAATGAGATCAAACAACTGGAAAAGCTGGAGAAACTGAGGCAGAAGTCACCCTCAGATGGGCAGATGATTTCCCAGGCAGAGAGCAGAGTGCAGAGGGCCTCGGTGGACGCCAGCCGCACCACCCGGCAGCTGGAGGACACAGTGGACGCCTTCCAGCGGCGGAAGCTGGAGGACCTCCAGAGGATCCTGCTCGACTTCGTGACCATTGAGATGGTGTTCCACACCAAGGCTGTGGAGGTGTACTCCAGTGCCTGCCGGACCCTGGGCAGCTACGACCCGGAGCAAGACCTGCAGGACCTTCAGGCCAAGGCTTGGGGAATTTCTGGGCATTGCGAGGCTCGGCCGCTCACAGATGCCGTCCTGGGGCTCCCCGCCAGCCAGAGTGCACGGAGCACCCTAGGGAGCCAGAGCAGAGAAGAGGCCAGTGGTGAGGACTCAGCAGAGGAGACGCCTCTGGAGGCCCTCCGGGGACAGGAGCAGGGACCCCGGAACTAG

XM_004842732.1 Coding sequence

LOC101700250 uncharacterized LOC101700250

Length: 699 bp    Location: 1839832..1838542   Strand: -
>XM_004842732.1
ATGGCGGAGGAGGAATGGAGACAAAAGGGGGAAGCACCCTCTCTGGCCAGGGGAGCAGCTACAGGTGTCGTGGGCAGCCACACCCTCGATGTGCCTCCCAGGCGCCGACTCCCATGGTGGGTTCTGCTGCATCCAGCTCACAGGATGCTAGCGGGTTCCTGCCTGGACACAAACTGGCCTGCGTTCACACTGGGAGAGAGGATGACAGTGATGCAAAGCAGCCGTTTCAAGCACTGTCCGCTCCATTCCCCACGGACCAGAGGCCGTCAGTTGGGCAGCTGTGTGCATCCCGGACTCGCAGCCACCTGCAGAGGTGTCTGGGTCCCACGCATGCCCTGGGTCCCTGCAGGAGGCTCCTTCCCAGTCCAGCACCGGCCACACGTCGTGTTTGTGTGGTCTCCTGCTTCTCCCCTCAGCCTCCGCCTGTACAATTTGGGGGTCACAGGGCCCACGTCAGGGTTGCGGCTCCATCAGTGCTGGTCTAAGGAAGCTGACTCTGTCCCCAACCTCAGCGTGGTCCCCAAGGCCCACAACCCCACCCCCAGCTGCTCTGCAGGGTCTCTTGCATCCTTCCCTCTTCCCCAGAGCTCCATTGGAACTGAAATCCTCCCCACGCTCCCGCGTCGCCAGCCCAGTGACCCGGCTCCCTCCTCCGGGGACCTTTGCCCTCTTCCTGTTCCCTCTAACCCACCCGCCTGA

XM_004842745.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X13

Length: 3303 bp    Location: 1923754..2108734   Strand: +
>XM_004842745.1
ATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCCTGCCTACATCTATGATGAGGTCCTGCAGCAGCGCCGAAGGCTAGTTAGCAAGCTGGACCTGGAAGAGCGACGGCGGCGGGAGGCCCAGGAAAAAGGATACTACTATGACCTCGATGACTCTTACGATGAGAGCGATGAGGAGGAGGTCAGGGCCCATCTGCGCTGCGTGGCTGAGCAGCCACCCCTCAAACTGGACACGTCCTCTGAGAAGCTAGAATTTTTGCAACTTTTTGGCTTGACCACCCAACAGCAGAAGGAGGAGCTGGTGGCCCAGAAGCGGAGGAAGCGTCGGCGGATGCTGAAGGAGAGAAGCCCGTCCCCACCAGCAGTTCAGAGTAAGAGGCAGATGCCTTCACCAAGACTGGCACTGTCCACGCGCTACAGCCCCGACGAGATGAACAACAGCCCCAACTTCGAGGAGAAGAGGAAGTTCCTGACCATCTTCAACCTGACCCACATCACTGCGGAGAAGAGGAAAGACAACGAGAGACTTGTTGAAATGCTCCGTGTCGCAAAGCAGAGGACACTGTCCGCAGTGGTGGCAGATTCATTGACAAACTCTCCGAGGGACAGTCCTGCCATCTCCCTGAGCGAACCAGCTACACAGCCTGCTTCTGTGGAGACAGACAAGCCTGTTGGTATTGCTGCCTCCTTGTCCGATGTCCCAAAAGCTGTGGAGACTGGAAGACTGGAACCACTCAGGCCCCAGGAACTATCGAGAGCCCAGGAGCCAGCTCCTACCAGCGGTGAGAAGGCCAGGCTGAGCGAGGCCCCTGGGGGCAAGAAGAGCCTGAGCATGCTTCATTACATCCGGGGCTCTGCGCCCAAGGACATTCCTGTGCCATTGTCCCACAGCGTCAACGGGAAGAGCAAATCGTGGGAGCCCTTCATGGCAGAAGAGTTTGCACATCAGTTCCACGAGTCAGTGCTGCAGTCCACCCAGAAGGCCCTGCAGAAGCATAAAGGGAGTGTAGCTGTGCTGTCTGCAGAGCAGAACCACAAGGTTGACACATCTGTCCACTACAACATTCCTGAGCTGCAGTCATCCAGCCGGGTCCCCCTGCCTCAGCATAATGGGCAGCAGGAGCCCCTAGCCAGGAGGAAGGGTCTACACACACAGGAGATGGACCAGGACTCAGAAGACGACAACGAGGAGGACGACAGTGAAGAGGAAGATGAAGAAGCCCCCAGGCGCAAGTGGCAAGGGATTGAGGCAATTTTTGAAGCTTACCAGGAACACATAGAAGAGCAAAACCTGGAGCGGCAGGTGTTACAGACACAGTGCCGGCGGCTGGAGGCCCAGCACTACAGCCTCAGTCTGACCGCGGAGCAGCTCTCCCACAGCATGGCGGAGTTGAGGAGTCAAAAGCAGAAGATTGTCTCTGAACGGGAGCGACTCCAGGCAGAACTGGACCACTTACGGAAGTGCCTTGCCTTGCCTGCAATGCATTGGCCTAGGGGTTACTTTAAGGGATATCCGAGGTGA

XM_004842735.1 Coding sequence

Gse1 Gse1 coiled-coil protein, transcript variant X3

Length: 3645 bp    Location: 2027261..2108734   Strand: +
>XM_004842735.1
ATGTTTGGATTGAAGCCGCCGCTGTATTACTTACCAGGCATGAGCCATGAGCCCAAGTCCCCTTCGCTAGGGATGCTTTCCACCGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCCCTCGCCACTCAATGGCGCCCTGGTGCCCAGTGGCAGCCCGGCCACCAGCAGCACGCTGTCGGCCCAGGCCGCGCCATCCTCCAGCTTTGCCGCCGCGCTGCGCAAGCTCGCCAAACAGGCGGAGGAGCCCAGAGGGTCCTCGCTGAGCAGTGAGTCGTCTCCCGTGTCCTCCCCGGCCACCAACCACAGCTCCCCCGCCAGCACGCCCAAGCGCGTGCCCATGGGCCCCATCATCGTCCCCCCCGGGGGCCACAGCGTCCCCAGCACACCCCCCGTGGTGACCATCGCCCCCACCAAAACCGTCAATGGCGTCTGGAGGAGTGAGAGCCGCCAGCAGGACGCTGGCTCTCGGGGAGGCAGTGGCAGCGGTCGGGAGCGCCTCATCGTGGAGCCACCACTCGCCCAGGAGAAGGCGGGTGGCCCAGCTGTCCCCTCCCATCTGCTCAGCACCCCGTACCCCTTCGGCCTGTCCCCCGGCTCCGTCATGCAGGATTCCCGCTTTCCACCCCTCAACCTCCAGCGGCCTGTGCACCACGTGCTGCCCCCCAGCACGGTGACTGAGGACTACTTGAGAAGCTTCCGGCCCTACCACACCGCCGAGGACCTGCGCATGTCCTCCCTGCCCCCGCTTGGCCTGGACCCGGCCACTGCCGCTGCCTACTACCACCCCAGCTACTTGGCCCCGCACCCCTTCCCACACCCGGCCTTCAGGATGGATGACTCCTACTGTCTGTCCGCCCTGAGGTCTCCGTTCTACCCCATCCCCACCCCGGGCTCCCTGCCTCCGCTGCACCCCTCGGCTATGCACCTCCACCTCTCCGGCGTCCGCTACCCGCCGGAGCTCTCGCACTCGTCACTGGCCGCCCTGCACTCGGAACGCCTATCAGGGCTCAGCGCGGAGAGGCTGCAGATGGACGAGGAGCTGCGGCGGGAGCGCGAGCGGGAGCGGGAGCGCGAGGCCGACCGGGAGCGGGAGAAGGAGAAGGAGCGAGAGCGGGAGCGGGAACGGGAACGGGAGCGGGAGCTGGAGCGGGAGAAGGAGCGGGAGCTGGAGCGCCAGCGGGAGCAGCGGGCCGCCAAGGTGCTAGAGCCGGCCTTCCTGCCAGTGGTGGAGATGCACGGGCTGCGTGGCCACACTGCCGAGGAGCGGGAGCGGGAGCGGGTCAAGCCCTCAGAGCAGCTGACCCCAACTCGAGCAGAGAAGCTGAAGGACGTGGGCCTGCAGGCGCCCAAACCCGTGCAGCACCCCCTGCATCCAGTGCCCACGTCACAGCACACCATACCCAGCCTCATCTCCAACCACGGCGTCTTCTCCCTGCCGGCCGGCAGTGCCGCTGCCAGCCTGCTGCTGCAGCGCACCAACGAGGAGGAGAAGTGGCTGGCGCGGCAGCGGCGGCTGCGGCAGGAGAAGGAGGACCGGCAGTCCCAGGTGTCAGAGTTCCGGCAGCAGGTGCTGGAGCAGCACCTGGACATCAGCCGGCCCCTGGTGCCCACGGAGGCGGAGCACAGGCCGGAGAGCAGCAGGGCAGGACCAACCCGGCTGGAGCAGGGCAGCCGTGAGGCCCCACCACACTTTGGCGGGCCGCCACCTCTCATCTCTCCCAAGCCGCAGCACCACACGGTGCCTACAGCGCTCTGGAACCCAGTGTCTCTGATGGATAACACCCTGGAGACGAGGAGGGCTGAGAGCCACACTCTGCACAGCCACCCGGTGGCATTTGAGCCCAGCCGCCAGGCCGCCGTCCCACTGGTGAAGGTGGAGCGCGTCTACTGCCCAGAAAAGACAGAGGAGCCCCGGAATCGCGAGGCCAACCCCCTGGACAAGTATCAGCCACCGCCACGGGAGGCAGGAAGCCTGGAGCCCCAGGCCTTTCCCCACGGGCCGGGGCCCTTCCTGGCCGAACTTGAGAAGTCTGCGCAGACCCTCCTGGGCCAGCAGCGGGTCTCCCTCCCCCCGGCAGCCTCCTTTGGGGAGCTCAGTGGGCCCCTGAAACCTGGCTCACCTTACCGGCACCCGGCACCCCGGGGCCCTGACCC