Sequence details NCBI ID: XM_004849812.1 (Coding sequence)   Best Hit

Details from NCBI annotation

Gene Symbol Uchl1
Gene Name ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
Entrez Gene ID 101702892

This gene is present in the GenAge database and has been identified as potentially important to ageing in humans.

Database interlinks

Part of NW_004624761.1 (Scaffold)

For more information consult the page for NW_004624761.1 (Scaffold)

Potential Gene Matches

The following genes have been identified as possible homologs of the naked mole-rat gene and compared to it.

UCHL1 ENSCPOG00000001263 (Guinea pig)

Gene Details

ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)

External Links

Gene Match (Ensembl Protein ID: ENSCPOP00000001144, Guinea pig)

Protein Percentage 94.65%
CDS Percentage 92.51%
Ka/Ks Ratio 0.15797 (Ka = 0.0338, Ks = 0.214)

UCHL1 ENSG00000154277 (Human)

Gene Details

ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)

External Links

Gene Match (Ensembl Protein ID: ENSP00000284440, Human)

Protein Percentage 95.52%
CDS Percentage 92.38%
Ka/Ks Ratio 0.07236 (Ka = 0.0208, Ks = 0.2881)

Uchl1 ENSMUSG00000029223 (Mouse)

Gene Details

ubiquitin carboxy-terminal hydrolase L1

External Links

Gene Match (Ensembl Protein ID: ENSMUSP00000031131, Mouse)

Protein Percentage 95.07%
CDS Percentage 88.34%
Ka/Ks Ratio 0.03927 (Ka = 0.0232, Ks = 0.5901)

Uchl1 ENSRNOG00000002343 (Rat)

Gene Details

ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) (Uchl1), mRNA

External Links

Gene Match (Ensembl Protein ID: ENSRNOP00000003248, Rat)

Protein Percentage 95.07%
CDS Percentage 88.49%
Ka/Ks Ratio 0.04136 (Ka = 0.0235, Ks = 0.5678)

Genome Location

Sequence Coding sequence

Length: 672 bp    Location: 25797561..25786028   Strand: -
Raw sequence   
>XM_004849812.1
ATGCAGCTCAAGCCCATGGAGATCAACCCCGAGATACTGAACAAAGTGCTGTCGCGGCTAGGGGTGGCCGGCCAGTGGCGCTTCGCCGACGTGCTAGGGCTGGAGGACGAGGCTCTGGGCTCGGTGCCAGCGCCGGCCTGCGCGCTGCTGCTGCTGTTTCCCCTCACCGCCCAGCATGAGAACTTCAGGAAAAAACAGATTGAAGAACTGAAAGGACAAGAAGTGAGTCCCAAAGTGTATTTCATGAAGCAGACCATTGGAAACTCCTGTGGTACCATCGGACTGATCCACGCAGTGGCCAATAACCGAGACAAACTGGAATTTGAGGATGGATCGGTCCTGAAACAGTTTCTTTCTGAAACAGAGAAGATGTCCCCTGAAGACAGAGCAAAGTGCTTTGAAAAGAATGAGGCCATCCAGGCAGCCCACGATGCCGTGGCCCAGGAAGGCCAGTGTCGGGTAGATGACAAAGTGAATTTTCATTTTATTCTGTTTAACAACGTGGATGGCCACCTCTATGAACTGGATGGACGAATGCCTTTTCCAGTGAACCATGGCACCAGTTCAGAGGACTCTCTGCTGCAGGACGCCGCCAAGGTCTGCAGAGAGTTCACCGAGCGCGAACAAGGAGAAGTCCGCTTCTCTGCTGTGGCACTCTGCAAGGCAACCTAG

Related Sequences

XP_004849869.1 Protein

Uchl1 PREDICTED: ubiquitin carboxyl-terminal hydrolase isozyme L1 [Heterocephalus glaber]

Length: 223 aa      View alignments
>XP_004849869.1
MQLKPMEINPEILNKVLSRLGVAGQWRFADVLGLEDEALGSVPAPACALLLLFPLTAQHENFRKKQIEELKGQEVSPKVYFMKQTIGNSCGTIGLIHAVANNRDKLEFEDGSVLKQFLSETEKMSPEDRAKCFEKNEAIQAAHDAVAQEGQCRVDDKVNFHFILFNNVDGHLYELDGRMPFPVNHGTSSEDSLLQDAAKVCREFTEREQGEVRFSAVALCKAT